|
Howard et al.: Bionomics of Lobate Lac Scale in Florida
PARATACHARDINA PSEUDOLOBATA
(COCCOIDEA: KERRIIDAE): BIONOMICS IN FLORIDA
F. W. HOWARD1, ROBERT PEMBERTON2, SIBYLLE SCHROER3 AND GREGORY HODGES4
1Fort Lauderdale Research & Education Center University of Florida, IFAS, 3205 College Avenue,
Fort Lauderdale, FL 33314
2USDA, ARS, Invasive Plant Research Laboratory, USDA, Agricultural Research Service, 3225 College Avenue,
Fort Lauderdale, FL 33314
3Federal Research Center for Cultivated Plants, JKI, Institute for Strategies and Technology Assessment in Plant
Protection, Stahnsdorfer Damm 81, 14532 Kleinmachnow, Germany
4Florida Department of Agriculture and Consumer Services, Division of Plant Industry, Florida State Collection of
Arthropods, 1911 SW 34th Street, Gainesville, FL 32608
ABSTRACT
The lobate lac scale, Paratachardina pseudolobata Kondo & Gullan, attacks large numbers
of plants in Florida. The scales primarily infest the branches and main stems <2 cm in di-
ameter; rarely were they found on stems that were larger than 4 cm in diameter or on leaves
and never on roots. They produce honeydew, but ants did not tend the scales nor did ants ap-
pear attracted to the honeydew, which is ejected from the scale instead of being present in
collectable droplets. Males have not been found in Florida populations of the lobate lac scale
and females are parthenogenetic and ovoviviparous. The scales developed into adult females
in 15-19 weeks. Crawlers of second generation were present 21 weeks after young crawlers
of the previous generation were placed on a host plant. The pre-imaginal stadia were: first
instar 8-11 weeks; second instar 7-8 weeks. The numbers of crawlers counted per month on
host plants were notably uniform throughout the year, but there was evidence of a slight in-
crease in crawler production during the warmer months. Lobate lac scales subjected to a
simulated frost of -3 C had a low survival rate. In a test of survival without a host, one of 22
crawlers survived 14 d, and 3 of 32 survived 18 d. Based on the numbers of exit holes in ma-
ture female tests, the parasitism rate since this pest was found in Florida is not greater than
1%.
Key Words: lobate lac scale, bionomics, Florida, parasitism
RESUME
La escama lobulada de la laca, Paratachardina pseudolobata Kondo & Gullan, ataca un gran
numero de plants en la Florida. Las escamas principalmente infestan las ramas y tallos
principles de <3 cm en diametro; raramente se encuentran en tallos mayores de 4 cm de
diametro o sobre las hojas y nunca en las raices. Estas produce gotas de miel, pero no son
atendidas por las hormigas y las hormigas tampoco estan atraidas por las gotas de miel, que
la escama ejecta en vez de ser producida en gotas recolectables. No se ha encontrado machos
de la escama lobulada de la laca en las poblaciones de la Florida y las hembras son parteno-
gen6ticas y ovoviparas. Las escamas se desarrollan en las hembras adults en un period de
15 a 19 semanas. Las larvas (1 estadio) del segundo generaci6n estuvieron presents 21 se-
manas despu6s de que las larvas jovenes de la generaci6n anterior fueron puestas sobre la
plant hospedera. Los estadios pre-imaginales fueron como los siguiente: primer estadio 8-
11 semanas; segundo estadio 7-8 semanas. El numero de larvas contadas por mes sobre las
plants hospederas fue notablemente uniform por todo el ano, pero hubo evidencia de un
aumento ligero en la producci6n de larvas durante los meses mas calidos. Las escamas lobu-
ladas de la laca que fueron sujetas a una escarcha simulada de -3oC tuvieron una tasa de so-
brevivimiento baja. En una prueba de sobrevivimiento sin hospedero, una de las 22 larvas
sobrevivio por 14 dias, y 3 de las 32 sobrevivieron por 18 dias. Basado en el numero de hoyos
de salida de los "test" (capa cerosa) de la hembra adulta, la tasa de parasitismo no fue mas
de >1% desde que esta plaga fue encontrada en la Florida.
Paratachardina pseudolobata (Kondo & Gul- specimens were found in Broward County on a
lan) (Coccoidea: Kerriidae) was found for the first single infested hibiscus shrub, Hibiscus rosa-sin-
time in Florida in 1999 (Hamon 2001). The first ensis L., in a residential area by Rita J. Carpen-
Florida Entomologist 93(1)
ter, District Plant Inspector with the Florida De-
partment of Agriculture and Consumer Services,
Division of Plant Industry (DPI). It was initially
identified by Avas Hamon (DPI Bureau of Ento-
mology) as Paratachardina lobata (Chamberlin);
the identification was confirmed by D. R. Miller
(Systematic Entomology Laboratory, U.S. De-
partment of Agriculture, Beltsville, MD). The in-
fested plant was destroyed, but additional infes-
tations were found in Miami-Dade and Broward
Counties in 2000 and on 17 sites in Palm Beach,
Broward, and Miami-Dade counties in 2001.
Within the next few years, it became widely dis-
seminated in southeastern Florida and was recog-
nized as a severe pest of many species of woody
plants in both urban landscapes and natural ar-
eas. As of Jun 2009, the species was distributed in
all Florida counties south of Lake Okeechobee,
with scattered records in coastal areas north to
St. Lucy and Indian River counties.
Avas Hamon received specimens of this same
species from New Providence, Bahamas, in 1992
(personal communications). In 2005, this species
was found in the central region of Cuba (Novoa et
al. 2007) and has been known for an undeter-
mined number of years on Christmas Island (Aus-
tralia) in the Indian Ocean (Abbott & Green 2007;
Kondo & Gullan 2007). It is obviously an adven-
tive in these localities. The scale was identified as
P lobata, native to southern India and Sri Lanka.
The species became known in Florida by the
vernacular name lobate lac scale in reference to
its taxonomic position in the lac scale family, and
to the presence in the female test with 4 promi-
nent lobes, a conspicuous character that is found
in some other species of Paratachardina, but dis-
tinguishes this species from other scale insects
commonly encountered in Florida.
The lobate lac scale has been referred to as P.
lobata in previous publications on identification
of 307 plant species as hosts in Florida (Pember-
ton 2003b; Howard et al. 2006) and 5 additional
host plant species in Cuba (Novoa et al. 2007);
temporal and spatial characterization of an infes-
tation (Epsky et al. 2006), chemical control meth-
ods (Howard & Steinberg 2005), progress in de-
veloping classical biological control (Pemberton
2003a; Pemberton et al. 2006; Schroer & Pember-
ton 2007; Schroer et al. 2008a) and the reporting
of 2 parasitoid species, Metaphycus sp. and Am-
monoencyrtus caroliniensis N. Comb. (Hy-
menoptera: Eulophidae), that attack the lobate
lac scale in Florida (Howard & Pemberton 2003;
Schauff 2005).
In a recent revision of the genus Paratachar-
dina, Kondo & Gullan (2007) recognized P lobata
as the junior synonym of P. silvestri (Mahdihas-
san) and determined that the adventive species
previously identified as P lobata in Florida,
Christmas Island, and the Bahamas is a new spe-
cies that they described as P. pseudolobata. Mo-
lecular analysis of the lobate lac scales from Flor-
ida, Christmas Island, Cuba, and the Bahamas
found them to be identical (Schroer et al. 2008b).
The species is likely to be native to Asia or Oce-
ania, since the other 8 described species of
Paratachardina are reported from various locali-
ties there (Kondo & Gullan 2007). Lobate lac scale
continues to be widely recognized as the vernacu-
lar name of this species.
In this paper, we report some observations on
lobate lac scale that may be useful to researchers
studying this pest with the ultimate objective of
developing methods for management.
MATERIALS AND METHODS
Host Plant Relationships
Observations of lobate lac scale were con-
ducted on plants in the field in natural and urban
landscaped areas and plants grown in containers
at the Fort Lauderdale Research & Education
Center (FLREC). The plants included 3 each of 6
species growing in containers at Fort Lauderdale
Research & Education Center (FLREC): coco-
plum, C', ,. Ji..,i., -.... icaco L.; yaupon holly, Ilex
vomitoria Aiton; wild coffee, Psychotria nervosa
Swartz; Bahama wild coffee, P ligustrifolia
(Northrop) Milspaugh; guama, Inga edulis Mar-
tius; and white indigo-berry, Randia aculeate L.
Containerized plants were grown in a potting mix
consisting of about equal portions of muck, sand,
bark chips, and perlite. The containers were black
plastic with a volume of 9.5-38 L depending on the
size of the plant. The plants were lightly fertilized
at 6-month intervals with Osmocote 14-14-14 (N-
P-K) (Scotts Co., Marysville, OH) at rates ad-
justed to the size of each plant to a maximum of
90 g/plant. Plants were grown in full sun or under
partial shade and irrigated by overhead sprin-
klers usually twice a week, with irrigation sus-
pended during rainy periods.
Some scale insect species are eurymerous (i.e.,
they infest different parts of the same plant),
while other species prefer or are even restricted to
distinct plant parts, such as the leaves. Observa-
tions were made to determine which parts of the
host plants were most frequently attacked by the
lobate lac scale. Scales were observed to deter-
mine the presence of collectable droplets of honey
dew and tending ants.
Since some species of Coccoidea, notably in the
families Pseudococcidae, Margarodidae, Eriococ-
cidae, and rarely Diaspididae, infest the roots of
their host plants (Howard et al. 1999), we at-
tempted to determine whether the lobate lac scale
infests roots. We estimated the numbers of tests of
mature lobate lac scales on the above-ground
parts of plants, then lifted each from its container
and washed the roots of soil by immersion and
gentle agitation in a large bucket of water.
March 2010
Howard et al.: Bionomics of Lobate Lac Scale in Florida
Life History
Observations were conducted to determine the
time of development of the lobate lac scale from
early first instar to mature female and to the ad-
vent of the crawlers of the subsequent generation.
Lobate lac scales were identified to instar based
on gross morphological characters (Kondo & Gul-
lan 2007) and measurements. Examinations were
conducted with a 10X-hand lens, and measure-
ments with a steel measuring scale calibrated to
0.1 mm (Ted Pella, Redding, CA).
On 10 Oct 2003, 50 crawlers were obtained by
dissecting mature female scales infesting a wax-
myrtle plant (Myrica cerifera L.). They were
transferred with a human hair to 2 guama plants
(Inga edulis), which had been propagated by cut-
tings and grown in potting mix in plastic cones (5
cm diameter upper rim x 25 cm length). The in-
fested guama plants, 25-30 cm tall when infested
with the crawlers, were placed in a PercivalTM en-
vironmental chamber set at 27C with 12 h light
and 12 h dark. The scale insects were identified to
stage and counted weekly.
Seasonal Abundance of Crawlers
Scale detection and counts were conducted on
3 plant species (wax myrtle, wild coffee, and red-
berry stopper) that are highly susceptible to lo-
bate lac scale (Howard et al. 2006) to reveal the
relative numbers of crawlers during a 12-month
period. The host plants were in different habitats,
growing conditions, and locations as follows:
(1) Wax myrtles, 1.0 0.4 m tall, in 38-liter
black plastic containers with growing medium
and fertilizer applications as described above in
full sun at the FLREC (255'N, 8014'W).
(2) Wild coffee, 1.7 + 0.3 m tall, growing as a
hedge in full sun on the campus of Broward Col-
lege, which is adjacent to the FLREC (255'N,
8014'W).
(3) Wild coffee, 1.9 + 0.3 m tall, occurring nat-
urally as an understory plant in a hardwood ham-
mock at Fern Forest Nature Center (Broward
County Division of Parks and Recreation) (26013'
N, 80011'W).
(4) Redberry stopper (Eugenia confusa De
Candolle), 1.8 0.6 m tall, as understory in a
hardwood hammock at Simpson Park (Miami Di-
vision of Parks and Recreation) (25046'N,
8012'W).
Three plants were randomly selected from in-
fested plants in each of the 4 sites. The initial
heights of the plants were measured from ground
level to the highest point on the shrub. On 3
branches, single segments (5 cm long), where the
lobate lac scale populations occurred at maximum
densities, were delimited and marked on each
plant. These segments will be referred to as "sam-
ple stem segments". Observations were initiated
at Sites 2 and 4 in Dec 2005, and at Sites 1 and 3
in Jan 2006. At the commencement of observa-
tions in each host plant/habitat situation, the
numbers of mature female lobate lac scales and of
crawlers were counted on the entire surface of
each sample stem segment. This procedure was
repeated monthly. Data were not collected on en-
vironmental factors at any of the sites. During the
period of observations, 3 sample stem segments
that were lost due to breakage or die-back of
branches were replaced with 5 cm segments of
similar diameters and population levels. Observa-
tions were not made in Jun 2006 on wax myrtle at
Site 1 (FLREC). The diameter at midpoint of the
sample stem segments was measured to 0.1 cm
every third month with a Vernier caliper and the
circumference and surface area of each 5-cm seg-
ment calculated to enable comparisons of crawl-
ers per 1 cm2 of stem surface per month. Numbers
per stem sample segment were pooled per plant
species-habitat situation. The number of crawlers
per sample by date were analyzed by the Tukey
honest significant difference (HSD) test of
ANOVA (SPSS 10.0, SPSS Inc., Chicago, IL) at 5%
level.
Survival of a Simulated Frost
An experiment was performed to test the sur-
vivorship of second instar and mature female lo-
bate lac scales exposed to a simulated frost that
decreased from an above-freezing temperature
to a minimum temperature of -30C. The experi-
ment was initiated on 23 Dec 2003. Two wax
myrtle plants infested with lobate lac scale were
selected for simulated frost treatment and one as
a control. All adult females and second instars on
1 branch of each plant were determined as live or
dead by examination, with probing of apparently
dead insects for verification. Two test plants
were placed in a SanyoTM temperature cabinet
set at -30C. The chamber door was briefly opened
and a digital thermometer observed to deter-
mine the temperature inside the cabinet at 15,
25, 40, and 80 min after the plants were placed
in it, since it was expected that heat of the con-
tainer and plant would raise the cabinet temper-
ature temporarily. After 80 min, the cold-treated
plants were removed from the cold chamber and
placed outdoors in the nursery at the FLREC.
The minimum daily outdoor temperature at the
FLREC during 15 d post-treatment was +120C,
recorded by the Florida Automatic Weather Net-
work (FAWN) on Dec 27, 2003. Fifteen days after
the cold treatment the branch examined prior to
treatment was removed from each wax myrtle
plant and the scale insects examined for survi-
vorship by examination and probing under a ste-
reoscopic microscope.
Florida Entomologist 93(1)
Survival of the First Instar Without a Host
Long distance spread of scale insects is
thought to be almost exclusively via movement of
their host plants. To obtain evidence of whether
lobate lac scales could be spread for a long dis-
tance without host plants (for example, on the
clothing of an international airline passenger), we
conducted observations to determine how long
crawlers deprived of host plants survived. Young
crawlers were obtained by dissecting female lo-
bate lac scales that infested wax myrtles. The
crawlers were placed in a polystyrene tube (14
mL, 17 x 100 mm) lined with moist filter paper,
and the tube was capped. The tube was kept in a
laboratory at about 23C. After a predetermined
number of days, the survival of the crawlers was
assessed by microscopic examination. Two sets of
observations were made: (1) 22 crawlers trans-
ferred to the tube on 20 Nov 2003 and examined
14 d later, and (2) 32 crawlers transferred on 9
Jan 2004 and examined 18 d later.
Status of Natural Enemies in Florida
The 2 parasitoid species reported from lobate
lac scale hosts in Florida (Howard & Pemberton
2003; Schauff 2005) were identified from only a
few specimens reared from a total of about 3000
lobate lac scale-infested twig samples that were
collected from various field sites in southeastern
Florida during 2002-2003. Monitoring was con-
tinued for the presence of natural enemies to ob-
tain data indicating any changes in the frequency
of parasitism of lobate lac scale in the field. Sec-
tions of infested branches 15 cm long were col-
lected on a total of 37 sites in Broward County,
Florida, during 2003-2009. The branch sections
were examined in the laboratory under a stereo-
scopic microscope and the numbers of mature fe-
males with and without parasitoid exit holes de-
termined.
RESULTS
Host Plant Relationships
After examining thousands of lobate lac scale
infestations on many plant species distributed on
multiple sites in southern Florida, we found that
this scale infested primarily the branches and
main stems of <2 cm in diameter. Rarely were
they on stems larger than 4 cm in diameter. They
did not infest leaf tissue, except for rare cases,
e.g., when a few lobate lac scales were on the rel-
atively fibrous petioles of guami.
Although the surfaces of lobate lac scale-in-
fested plants were sticky with honeydew and
coated with crusts of sooty mold, and ants were of-
ten present near and on plants, we did not see
ants tending lobate lac scales or feeding on their
honeydew. The honeydew is ejected from the scale
and not present as collectible droplets. In south-
ern Asia, ants were not associated with the hon-
eydew of a closely related species, Paratachardina
silvestri (as Tachardina lobata Green) (Hassan
1979). This is intriguing, because the association
between ants and honeydew-producing insects,
with the latter providing honeydew to attract the
ants, protects the honeydew producers, and is a
familiar example of mutualism. It is unlikely that
lobate lac scale honeydew is repellent to ants.In
the plants of 6 species that were examined for
above-ground and root infestations, there was a
mean of 408.4 (SD = 954.5) mature female scales
estimated per plant on the above-ground stems
and branches. However, no live scale insects of
any stages or remains of dead scales were found
on the roots of any of the plants. Thus, it appears
that in lobate lac scales there are no root-infesting
populations to serve as a source of infestation of
above-ground parts, as is the case in cycad aula-
caspis scale, Aulacaspis yasumatsui Takagi
(Howard et al. 1999).
Life History
We observed that lobate lac scales do not ovi-
posit on plant surfaces, as is true of most of the
Coccoidea. They apparently oviposit within the
test where the eggs quickly hatch, a form of
ovoviviparity found in other species of the sub-
family Tachardininae (Kapur 1962). The crawlers
exit the mother's test through the dorsal anal
opening, as reported in the true lac scale.
When 50 first instar crawlers were trans-
ferred to a guama plant, 23 crawlers had settled
on the plant when examined 1 week later. The
remaining 27 crawlers apparently had moved
from the plant. Seven of the 23 settled first in-
stars developed to adult females, reaching the
mature female stage 15-19 weeks after being
placed on the plant. Twenty-one weeks after
placement of young larvae on the plant, >100
crawlers of the second generation were ob-
served on the plant. The stadia of pre-imaginal
instars were first instar 8-11 weeks and second
instar 7-8 weeks. Thus, the development time in
lobate lac scales from crawler to adult, about 4-
5 months, is of relatively long duration, since a
development time of 1 month is probably more
typical of scale insects in general. For example,
development from young crawler to adult is
about 1 month in both the cycad aulacaspis
scale (Diaspididae) (Howard et al. 1999) and in
Dactylopius coccus Costa (Dactylopiidae)
(Guerra & Kosztarab 1992). The longer develop-
ment time of lobate lac scale is similar to that of
some other Kerriidae. For example, depending
on conditions, 1 strain of the true lac scale de-
velops from egg to adult in about 8-9 months
(Kapur 1962).
March 2010
Howard et al.: Bionomics of Lobate Lac Scale in Florida
Of the thousands of lobate lac scale examined,
there was no male stage. In field studies oflobate
lac scale over a 3-year period on Christmas Is-
land, there was no evidence of a male stage (Dr.
Kirsti Abbott, School of Biological Sciences, Victo-
ria University of Wellington, New Zealand, Per-
sonal Communications). Kondo & Gullan 2007 re-
ported that a male stage was unknown in lobate
lac scale, and suggested that this species may be
parthenogenetic.
Seasonal Abundance of Crawlers
The numbers of crawlers observed throughout
the year were lower than expected (Table 1). The
sampling from surfaces with high density of fe-
male scales may have biased the data towards
fewer crawlers. Because scale crawlers tend to
settle near where they hatched or were ovipos-
ited, stem segments of high mature female scale
density would be expected to have high numbers
of crawlers. However, a higher density of both the
mature and immature scales at these stem seg-
ments may have stimulated crawlers to disperse
to surfaces of lower scale density on the same or
other plants.
Nevertheless, the data were sufficient to reveal
that crawlers were present on plants each month
throughout the year in all 4 host plant species/
habitats (except for Mar 2006). The numbers of
crawlers were notably uniform throughout the
year, but there were some indications of a slight
increase in crawler numbers during the warmer
season: Crawlers were present on 18 of the stem
sample segments examined during Apr-Sep com-
pared to eight of the stem sample segments exam-
ined during Oct-Mar. Also, there were small sta-
tistically significant (Tukey HSD test at P < 0.05)
increases in numbers of crawlers from the previ-
ous month in 6 monthly counts during Apr-Sep
compared to 2 such increases during Oct-Mar (Ta-
ble 1). This reveals a seasonal pattern of year-
round reproduction with a slight increase in the
warmer and rainier months, which is typical of in-
sects adapted to a humid tropical climate.
Survival of Simulated Frosts
In the experiment on the effect of a simulated
frost on lobate lac scale, the temperatures re-
corded inside the cabinet after placing the plants
in it were 0 -1, -2, and -3C, at 15, 25, 40, and 80
min, respectively. The cabinet temperature had
been initially set at -3C, and the temporary in-
crease to 0 fifteen min after the plants were
placed in it was probably largely due to convection
heat from the soil, plants, and container. During
the 15-day post-treatment period when the plants
were in the nursery, the minimum daily outdoor
temperature at FLREC was 12.0 on Dec 27, 2003
(FAIRS). At the end of the post-treatment period,
9 of 71 second instars and 3 of 74 mature female
scales on Plant #1 had survived the simulated
frost. None of the scales on Plant #2, including 48
second instars and 1 mature female, survived. On
the control plant, 77% of 36 second instars and
71.6% of 88 mature females survived. The cause
of mortality of scales in the controls is unknown.
Chong (et al. 2008) evaluated the lobate lac
scale's ability to survive at various cold tempera-
tures of longer duration. They concluded that the
insect scale may have a higher potential to invade
TABLE 1. MEAN NUMBERS OF LOBATE LAC SCALE CRAWLERS PER CM2 OBSERVED IN MONTHLY EXAMINATIONS OF SAM-
PLE AREAS ON BRANCHES IN 4 DIFFERENT HOST PLANT-HABITAT COMBINATIONS, DEC 2005-Nov 2006.
Myrica cerifera Psychotria nervosa Psychotria nervosa Eugenia confusa
in containers in urban landscape in natural hammock in natural hammock
Month observed (FLREC) Broward College Fern Forest Simpson Park
Dec 2005 0.01 ab 0.02 a
Jan 2006 0.02 a 0.00 a 0.01 a 0.06 a
Feb 0.00 a 0.02 ab 0.00 a 0.00 a
Mar 0.00 a 0.00 a 0.00 a 0.00 a
Apr 0.11 ab 0.00 a 0.02 a 0.02 a
May 0.13 ab 0.00 a 0.02 a 0.46 b
Jun 0.11 ab 0.03 a 0.02 a
Jul 0.69 b 0.01 a 0.74 b 0.11 a
Aug 0.00 a 0.19 b 0.01 a 0.05 a
Sep 0.07 a 0.00 a 0.01 a 0.14 a
Oct 0.00 a 0.00 a 0.01 a 0.02 a
Nov 0.00 a 0.03 ab 0.09 a 0.00 a
= data not recorded; FLREC = Fort Lauderdale Research & Education Center, Means (n = 9) followed by the same letter within
a column do not differ significantly, as determined by Tukey HSD test at P < 0.05.
areas where the average winter temperatures do
not drop below freezing for an extended duration
(3 or more consecutive d), such as southern Flor-
ida, Rio Grande Valley in Texas, and Colorado
river Delta between California and Arizona.
From these observations, it appears that a
light frost would greatly reduce field populations
of lobate lac scale but not eliminate them, so that
in time their populations would recover. However,
it seems possible that in some cases mature fe-
males that survive a frost may not be reproduc-
tive. Subfreezing temperatures could also have an
impact on lobate lac scale by killing their host
plants. The host range of lobate lac scale includes
over 300 plant species in Florida, including tropi-
cal and temperate zone species. The frost-toler-
ance among different species is undoubtedly
highly variable.
Survival of the First Instar Without a Host
In 2 sets of observations to determine survivor-
ship of crawlers without a host plant, initiated 20
Nov 2003 and 9 Jan 2004, respectively, one of 22
crawlers survived 14 d without a host, and 3 of 32
survived 18 d without a host.
The survival of crawlers for relatively long pe-
riods without a host was unexpected, and al-
though the survival rate was low, a single individ-
ual of a parthenogenetic species such as lobate lac
scale can initiate an infestation. A remaining
question, which has important implications for
preventing international spread of scale insects,
is whether crawlers deprived of a host for long pe-
riods are capable of settling, developing, and re-
producing.
Status of Natural Enemies in Florida
A total of 22,828 mature female lobate lac
scales were examined on branch samples col-
lected on 36 field visits in Broward County during
the period Mar 2003-Jun 2009. Samples were ob-
tained from 21 host plant species. A mean of 0.4%
(SD = 0.4) of the mature female scale insects per
site had parasitoid exit holes. Scales in about half
of the samples (20/39) and on 10/18 sampled plant
species had exit holes. While parasitism is low, it
is often present in lobate lac scale populations. We
conclude that although at least 2 species of hy-
menopterous parasitoids attack lobate lac scale in
Florida, their impact on this scale insect is negli-
gible. Thus, classical biological control remains
the most promising option for long term manage-
ment of this pest.
ACKNOWLEDGMENTS
We thank Bryan Steinberg, Sebastian Ortiz, Sergio
Gallo, and Nancy Miller, University of Florida Fort Lau-
derdale Research & Education Center, for assistance
March 2010
with this work. The research was financially supported
by the Florida Nursery and Growers Association, the
South Florida Water Management District, and the
USDA-APHIS.
REFERENCES CITED
ABBOTT, K., AND GREEN, P. T. 2007. Collapse of an ant-
scale mutualism in a rainforest on Christmas Island.
Oikos 116: 1238-1246.
CHONG, J-H, RODA, R. L., AND MANNION. C. M. 2008.
Mortality of the lobate lac scale, lobate lac scale,
Paratachardina pseudolobata (Hemiptera: Kerri-
idae, at or below freezing temperatures. Florida En-
tomol. 91: 674-678.
EPSKY, N. D., AMALIN, D., KENDRA, P. E., PUCHE, H.,
AND MANNION, C. M. 2006. Temporal and spatial
characterization of an infestation of Paratachardi-
na lobata lobata (Hemiptera: Kerriidae), a new in-
vasive pest in Florida. Florida Entomol. 89: 367-
374.
GUERRA, G. P., AND KOSZTARAB, M. 1992. Biosystemat-
ics of the family Dactylopiidae (Homoptera: Coccin-
ea) with emphasis on the life cycle of Dactylopius
coccus Costa. Bulletin 92-1. Virginia Agric. Exp. Sta.,
Blacksburg, Virginia, USA.
HAMON, A. B. 2001. Pest Alert: Lobate lac scale, Parata-
chardina lobata lobata (Chamberlin) (Hemiptera:
Kerriidae). Florida Department of Agriculture
and Consumer Services, Division of Plant Industry. ht-
tp:// www.doacs.state.fl.us/pi/enpp/ento/paratachar-
dina.html. Accessed October 2, 2006.
HASSAN, S. M. 1979. A comparative study of some scale
insects interpreting the biogenesis of lac products.
The Pakistan J. Scientific Res. 31.
HOWARD, F. W., AND PEMBERTON, R. W. 2003. The lo-
bate lac scale, a new pest of trees and shrubs in Flor-
ida: implications for the Caribbean Region. Proc.
Caribbean Food Crops Soc. 39: 91-94.
HOWARD, F. W., AND STEINBERG, B. 2005. Root drenches
and topical insecticide treatments for control of the
lobate lac scale, Paratachardina lobata (Chamber-
lin). Proc. Florida State Hort. Soc. 118: 314-318.
HOWARD, F. W., HAMON, A., MCLAUGHLIN, M.,
WEISSLING, T., AND YANG, S.-L. 1999.Aulacaspisya-
sumatsui (Hemiptera: Sternorrhyncha: Diaspid-
idae), a scale insect pest of cycads recently intro-
duced into Florida. Florida Entomol. 82: 14-27.
HOWARD, F. W., PEMBERTON, R. W., HODGES, G. S.,
STEINBERG, B., MCLEAN, D., AND LIU, H. 2006. The
host plant range of lobate lac scale, Paratachardina
lobata, in Florida. Proc. Florida State Hort. Soc. 120:
308-408.
KAPUR, A. P. 1962. Chapter III, The Lac Insect, pp. 59-
89 In B. Mukhopadhyay and M. S. Muthana [eds.], A
Monograph on Lac. Indian Lac Research Institute,
Namkum, Ranchi, Bihar, India.
KONDO, T., AND GULLAN, P. J. 2007. Taxonomic review
of the lac insect genus Paratachardina Balachowsky
(Hemiptera: Coccoidea), with a revised key to genera
of Kerriidae and description of two new species.
Zootaxa 1617: 1-41.
NOVOA, M. M., GRILLO-RAVELLO, H., AND HODGES, G. S.
2007. Paratachardina lobata lobata (Chamberlin)
(Hemiptera: Coccoidea: Kerriidae) un nuevo registro
de insecto escama para Cuba. Revista Centro Agrico-
la (Cuba) 34.
Florida Entomologist 93(1)
Howard et al.: Bionomics of Lobate Lac Scale in Florida
PEMBERTON, R. W. 2003a. Potential for biological con-
trol of the lobate lac scale, Paratachardina lobata lo-
bata (Hemiptera: Keriidae). Florida Entomol. 86:
353-360.
PEMBERTON, R. W. 2003b. Invasion of Paratachardina
lobata lobata (Hemiptera: Kerriidae) in South Flori-
da: a snapshot sample of an infestation in a residen-
tial yard. Florida Entomol. 86: 373-377.
PEMBERTON, R. W., NGUYEN, R., WINOTAI, A., AND
HOWARD, F. W. 2006. Host acceptance trials of Ker-
ria lacca (Kerriidae) parasitoids from northern Thai-
land on the pest lobate lac scale (Paratachardina lo-
bata) (Kerriidae) in Florida. Florida Entomol. 89:
336-339.
SCHAUFF, M. E. 2005. Ammonoencyrtus carolinensis, N.
Comb. (Hymenoptera: Encyrtidae), a parasite of lo-
bate lac scale, Paratachardina lobata (Chamberlin)
(Hemiptera: Kerriidae). Proc. Entomol. Soc. Wash-
ington 107: 115-118.
SCHROER, S., AND PEMBERTON, R. W. 2007. Host accep-
tance tests of parasitoids of the Indian Paratachar-
dina lobata on the invasive lobate lac scale in Flori-
da. Florida Entomol. 90: 545-552.
SCHROER, S., PEMBERTON, R. W., AND SILVARAJ, P. 2008A.
Parasitoids of Paratachardina loabata (Hem., Kerri-
idae): surveys for biological control of the invasive lo-
bate lac scale. J. Applied Entomology 132: 12-17.
SCHROER, S., PEMBERTON, R. W., COOK, L. G., KONDO,
T., AND GULLAN, P. J. 2008b. The genetic diversity,
relationships, and potential for biological control of
the lobate lac scale, Paratachardina pseudolobata
Kondo and Gullan (Hemiptera: Coccideae: Ker-
ridae), a pest in Florida, the Bahamas and Christ-
mas Island. Biol. Control 46: 256-266.
Florida Entomologist 93(1)
March 2010
PHALACROCOCCUS HOWERTONI, A NEW GENUS AND SPECIES
OF SOFT SCALE (HEMIPTERA: COCCIDAE) FROM FLORIDA
GREGORY S. HODGES' AND CHRISTOPHER J. HODGSON2
'Florida Department of Agriculture and Consumer Services, Division of Plant Industry, Gainesville, FL 32614 USA
E-mail: hodgesg@doacs.state.fl.us
2Department of Biodiversity and Biological Systematics, The National Museum of Wales, Cardiff, CF10 3NP
E-mail: hodgsoncj@cardiff.ac.uk
ABSTRACT
A new soft scale genus Phalacrococcus Hodges & Hodgson gen. nov. and a new species Pha-
lacrococcus howertoni Hodges & Hodgson sp. nov., is described from Florida, United States.
The adult female and adult male, male and female second-instars, first-instars, and pupa
are described and illustrated. Host records, biology, and distribution information are pro-
vided.
Key Words: Soft scales, Phalacrococcus howertoni
RESUME
Se describe un nuevo g6nero de escama blanda, Phalacrococcus Hodges & Hodgson gen.
nov. y una nueva especie, Phalacrococcus howertoni Hodges & Hodgson sp. nov., de la Flo-
rida, Estados Unidos. Se described e ilustran los adults hembra y macho, los segundos es-
tadios de la ninfa de la hembra y el macho, el primer estadio y la pupa. Se provee un registro
de las plants hospederas, la biologia e informaci6n sobre la distribuci6n.
The Coccidae (soft scales) are the third largest
family of scale insects (Hemiptera: Sternorrhyn-
cha: Coccoidea) with approximately 1200 de-
scribed species (Ben-Dov 1993). There are approx-
imately 106 species (representing 29 genera) of
soft scales known from the United States (Miller
et al. 2007) and 43 species have been found in
Florida (representing 18 genera) (Ben Dov et al.
2009; SCALENET Region Query).
Soft scale insects can be serious pests, espe-
cially when they are invasive species. Miller &
Miller (2003) noted that there were 42 introduced
soft scale species in the United States of which 41
were considered to be pests. Records maintained
in the entomology section of the Florida Depart-
ment of Agriculture & Consumer Services, Divi-
sion of Plant Industry (FDACS-DPI) indicate that
there have been approximately 255 invasive ar-
thropod species introduced into Florida over the
last 20 years. Of those introductions, only 1 soft
scale (Ceroplastes rusci (Linnaeus)) has become
established in Florida.
The species discussed in this paper was first
collected by Lynn Howerton (Florida Department
of Agriculture and Consumer Services- Division of
Plant Industry plant inspector) on the stems of a
croton (Codiaeum variegatum (L.) A. Juss.) from
Monroe County, Florida in Apr 2008. Since the
initial find, there have been a total of 343 speci-
men submissions of this species to the FDACS-
DPI representing collections in 21 Florida coun-
ties. Nonetheless, this new species is believed to
be established in the natural environment in 5
counties, where it has been recorded from 72
plant host species in 34 families (Table 1).
MATERIALS AND METHODS
Sample Collections And Specimen Preparation
Field specimens were obtained from collections
made by FDACS-DPI plant inspectors and Uni-
versity of Florida extension personnel. Live spec-
imens were collected from natural areas and from
nursery settings. Specimens were cleared in 10%
potassium hydroxide (KOH), stained in McKen-
zie's stain (equal portions of acid fuschin, eryth-
rosin, and lignin pink in aqueous solution), dehy-
drated in a series of ethyl alcohol baths and clove
oil, and mounted in Canada Balsam. Descriptions
for each of the life stages are based on multiple
mounted specimens. Illustrations follow the stan-
dard format as used for scale insects, with the
dorsum shown on the left side and venter shown
on the right side. Special features are enlarged to
the side of each illustration. The terminology used
for the description of the adult female follows that
of Hodgson (1994). The collection data for the ma-
terial studied are followed by the number of
slides, with the total number of specimens in pa-
rentheses.
Specimen Depositories. AUCC: Auburn Uni-
versity Coccoidea Collection, Auburn, Alabama,
U.S.A.; BMNH: The British Natural History Mu-
Hodges & Hodgson: New Soft Scale in Florida
TABLE 1. HOST PLANTS OF PHALACROCOCCUS HOWERTONI HODGES & HODGSON NOT UNDER PROTECTIVE CULTIVA-
TION.
Species
Family
Acalypha wilkensiana (Muell.-Arg.) Fosberg
Alocasia sp.
Annona muricata L.
Ardisia escallanoides Schltdl. & Cham
Averrhoa carambola L.
Bidens alba L. (DC.)
Blechum brownei Juss.
Bursera simaruba L.
Capparis cynophallophora L.
Calocasia esculentum L.
Callophyllum sp.
Calyptranthes pallens Griseb.
Chamaesyce hirta (L.) Millsp.
Chrysobalanus icaco L.
Chrysophyllum cainito L.
Citharexylum spinosum L.
Clausena lansium Skeels
Clusia species
Coccoloba diversifolia Jacq.
Coccoloba uvifera (L.) L.
Codiaeum uariegatum (L.) A. Juss.
Conocarpus erectus L.
Cupania glabra Sw.
Digitaria sp.
Dimocarpus longan Lour.
Dodonaea vicosa (L.) Jacq.
Eclipta prostrata (L.) L.
Elaeocarpus sp.
Eugenia axillaris (Sw.) Willd.
Fatoua villosa (Thunb.) Nakai.
Ficus aurea Nutt.
Ficus mysorensis L.
Ficus microcarpum L.
Filicium decipens Wight & Arn.
Glycosmis pentaphylla
Guajacum sanctum L.
Gymnanthes lucida Sw.
Hamelia patens Jacq.
Heliconia species
Jatropha integerrina Jacq.
Licaria triandra (Sw.) Kostrm.
Ligustrum japonicum Thunb.
Manilkara jaimiqui (C. Wright) Dubard
Mangifera indica L.
Morus alba L.
Myricianthes fragrans (Sw.) McVaugh
Persea americana P. Mill.
Phyla nodiflora (L.) Green
Phyllanthus urinaria L.
Piper methisteum G. Forst
Psidium guajava L.
Psychotria ligustrifolia (North.) Mill.
Psychotria nervosa Sw.
Psychotria sulzneri Small
Randia aculeata L.
Rapanea punctata Lam. Lundell
Euphorbiaceae
Araceae
Annonaceae
Myrsinaceae
Oxalidaceae
Asteraceae
Acanthaceae
Burseraceae
Capparaceae
Araceae
Guttiferae
Myrtaceae
Euphorbiaceae
Chyrsobalanaceae
Sapotaceae
Verbenaceae
Rutaceae
Guttiferae
Polygonaceae
Polygonaceae
Euphorbiaceae
Combretaceae
Sapindaceae
Poaceae
Sapindaceae
Sapindaceae
Asteraceae
Elaeocarpaceae
Myrtaceae
Moraceae
Moraceae
Moraceae
Moraceae
Sapindaceae
Rutaceae
Zygophyllaceae
Euphorbiaceae
Rubiaceae
Musaceae
Euphorbiaceae
Lauraceae
Oleaceae
Sapotaceae
Anacardiaceae
Moraceae
Myrtaceae
Lauraceae
Verbenaceae
Euphorbiaceae
Piperaceae
Myrtaceae
Rubiaceae
Rubiaceae
Rubiaceae
Rubiaceae
Myrsinaceae
Florida Entomologist 93(1)
TABLE 1. (CONTINUED) HOST PLANTS OF PHALACROCOCCUS HOWERTONI HODGES & HODGSON NOT UNDER PROTEC-
TIVE CULTIVATION.
Species
Family
Savia bahamensis Britt.
Schinus tenebinthifolius Raddi
Sida sp.
Sideroxylon celastrinum (Kunth) T.D. Pennington
Sideroxylon foetidissimum Jacq.
Sideroxylon salicifolium (L.) Lam.
Spermacoce verticillata L.
Spigelia anthelmia 1.
Spondias dulci Parkinson
Spondias purpurea L.
Tabebuia heterophylla DC. (Britton)
Tetrazygia bicolor (P. Mill.) Cogn.
Zanthoxylum fagara (L.) Sarg.
Zanthoxylum flavum Vahl.
seum, London, U.K.; FSCA: The Florida State
Collection of Arthropods, Gainesville, Florida,
U.S.A.; USNM: The National Entomological Col-
lection of the National Museum of Natural His-
tory, Beltsville, Maryland, U.S.A.
PHALACROCOCCUS Hodges & Hodgson
Generic Diagnosis: Adult female (Fig.1). Unmounted
Material
Adult female approximately 4 mm long by 2
mm wide, green to yellow-green in color, with
dark striations on dorsum.
Mounted Material
Oval to almost round; anal cleft about 1/4th-1/
5th body length. Dorsum lightly sclerotized in
more mature specimens, with more distinct scle-
rotizations in each stigmatic cleft; dorsum with-
out areolations, and dorsal setae, dorsal tuber-
cles, pocket-like sclerotizations and tubular ducts
absent. Preopercular pores present in 2 diverging
bands as far forward as the thorax; dorsal microd-
ucts and sclerotized simple pores present
throughout. Anal plates each with 4 setae near
apex; anal ring with 5 pairs of setae. Margin with
a single line of strongly spinose setae; stigmatic
clefts shallow, each with 3+ blunt stigmatic
spines, clearly differentiated from marginal spi-
nose setae. Eyespots on margin. Venter with
abundant multilocular disc-pores, mostly with 5
loculi, present on all abdominal and thoracic seg-
ments and laterad to mouthparts. Pairs of longer
setae present on 3 pregenital abdominal seg-
ments. Ventral tubular ducts absent. Antennae 8
segmented. Legs well developed; tibio-tarsal ar-
ticulation with an articulatory sclerosis; claw dig-
itules both broad; claw without a denticle*.
Euphorbiaceae
Anacardiaceae
Malvaceae
Sapotaceae
Sapotaceae
Sapotaceae
Rubiaceae
Longaniaceae
Anacardiaceae
Anacardiaceae
Bignoniaceae
Melastomataceae
Rutaceae
Rutaceae
Second-instar Female (Fig. 2)
Dorsum without dorsal setae but with 4 longitu-
dinal rows of largish simple pores; dorsal micro-
ductules apparently absent. Margin with a single
line of stout, sharply spinose setae; stigmatic clefts
shallow, each with 1-4 (generally 3) blunt stigmatic
spines, clearly differentiated from marginal spi-
nose setae. Venter with a submarginal row of mi-
croducts; spiracular disc-pores few. Ventral tubular
ducts absent. Limbs well developed; claw digitules
both broad; claw with a hint of a denticle*.
Second-instar Male (Fig. 3)
Dorsum with minute dorsal setae (but these
sometimes not visible), plus 4 rows of largish
simple pores. Dorsal microductules apparently
absent. Dorsum with dorsal tubular ducts in a
submarginal band, plus partial sub-median lines
and 2 pairs of radial lines. Margin with a single
line of stout, sharply spinose setae; stigmatic
clefts shallow, each with 3 blunt stigmatic
spines, usually clearly differentiated from mar-
ginal spinose setae. Venter with a submarginal
row of microducts; spiracular disc-pores few.
Ventral tubular ducts absent. Limbs well devel-
oped; claw digitules both broad; claw probably
with a hint of a denticle*. First-instar nymph
(Fig. 4) (sex not determined). Dorsum with sub-
median lines of dorsal setae, and submedial and
submarginal lines of simple pores. Margin with a
single line of spinose setae; stigmatic clefts shal-
low, each with 1 blunt stigmatic spine, clearly
differentiated from marginal spinose setae. Ven-
ter with a few microducts submarginally; spirac-
ular disc-pores few. Ventral tubular ducts ab-
sent. Limbs well developed; claw digitules dis-
similar; claw with a minute denticle*.
March 2010
Hodges & Hodgson: New Soft Scale in Florida
Adult Male (Fig. 6)
Head with numerous reticulations; with 2
pairs of simple eyes. Ocular sclerite without se-
tae; gena without setae. Antennae 10 segmented,
each just under half total body length; antennal
bristles on apical 3 segments all exceptionally
long. Fleshy setae short, thick, with a rounded
apex, abundant on antennae and legs; hair-like
setae very scarce, almost absent from head and
body. Wings well developed; hamulohalteres ab-
sent. Legs well developed; anterior coxae with
coxal bristles. Glandular pouches and glandular
pouch setae present, latter with capitate apices.
Penial sheath quite long, about 1/4 total body
length; aedeagus short, and apparently bifid api-
cally.
[*The claws on the Ist-instar nymphs appear
to have a fairly distinct but minute denticle; the
second instars appear to have just a hint of a den-
ticle whereas none can be seen on the adult fe-
males.]
The generic name derivation, Phalacrococcus
is derived from the Greek word phalakros, bald
headed or smooth (referring to the lack of dorsal
setae), and coccus, from the Greek coccum, often
used to describe scale insects.
Phalacrococcus howertoni Hodges & Hodgson
spec. nov.
Material Studied. Holotype ad United
States of America, Florida, Monroe County, Codi-
aeum variegatum, Apr 9, 2008, L. Howerton (de-
posited in FSCA, acc. No. E-2008-2067).
Paratype, 9 9 United States of America, Flor-
ida: Marathon, Codiaeum variegatum Apr 2008,
L. Howerton (FSCA, E-2008-2067): 3 (8 ad 9 Y) (2
ad 9 9 deposited in USNM, 4 ad 9 9 deposited in
FSCA, 2 ad 9 9 deposited in BNHM); Miami,
Psidium guajava, May 2008, E. Camero (FSCA,
E-2008-2858): 2 (4 ad 9 ) (2 ad 9 9 deposited in
BNHM, 2 9 9 deposited in FSCA); Miami, Burs-
era simaruba, Jun 2008, H. Mayer (FSCA, E-
2008-3823): 14(32 ad 9 9) (16 ad 9 9 deposited in
BNHM, 2 ad 9 9 deposited in FSCA, 6 ad 9 9 de-
posited in AUEC, 8 ad 9 9 deposited in USNM);
Ft. Pierce, Codiaeum variegatum, Jun 2008, C.
Averoff(FSCA, E-2008-3847): 2 (6 ad 9 9) (1 ad
9 deposited in AUCC, 1 ad 9 9 deposited in
FSCA, 4 ad 9 9 deposited in BNHM); Homestead,
Eugenia axillaris Jun 2008, L. King (FSCA, E-
2008-3997): 2 (4 ad 9 9) (2 ad 9 9 deposited in
BNHM, 2 ad 9 9 deposited in FSCA).
Other Material Studied. United States of
America, Florida: Miami-Dade Co., Miami, Codi-
aeum variegatum, 6.iii.2009, Juan Torres (E2009-
1163-301): 2 (2 pupae); Marathon, Codiaeum var-
iegatum, Apr 2008, L. Howerton (FSCA, E-2008-
2067, deposited in BNHM): 2 (4 2nd$ 9), 3 (7
2ndd S), 3 (8 1st); Miami Beach, Codiaeum varie-
gatum, Apr 2008, collector unknown (FSCA,
2008-2538) 1 (1 2nd 9), 2 (4 2nd S); Miami-Dade
Co., Homestead, Alocasia sp., 13.iv.2009, Juan
Menendez (E2609-2160-301), 5 (5 adSd ); Davie,
Codiaeum variegatum, Apr 2008, G. Azore
(FSCA-2008-2434) 1 (2 2nd9 ), 1 (3 2nddd);
Davie, Codiaeum variegatum, Apr 2008, G. Azore
(FSCA, E-2008-2547): 3 (7 2nd$ 9), 3 (8 2ndSd );
Miami, Psidium guajava, May 2008, E. Camero
(FSCA, E-2008-2858, deposited in BNHM): 1 (1
2nd9), 1 (3 2ndd S): 2 (4 1st); Miami, Bursera si-
maruba, Jun 2008, H. Mayer (FSCA, E-2008-
3823): 2 (2 2nd$ 9), 2 (4 2ndd ) 14 (32 1st);
Homestead, Sideroxylon celastrinum, Jun 2008,
L. King (FSCA, E-2008-3998, deposited in
USNM): 1 (2 2nd 9 ), 1 (3 2ndd 6); Ft. Pierce, Co-
diaeum variegatum, Jun 2008, C. Averoff (FSCA,
E-2008-3847): 2 (6 1st); Homestead, Eugenia axil-
laris, Jun 2008, L. King (FSCA, E-2008-3997, de-
posited in USNM): 2 (4 1st).
ADULT FEMALE (Fig. 1).
Described from 6 specimens in fair to good con-
dition.
Mounted material. Oval to almost round, 2.5-
5.3 mm long and 1.8-3.25 mm wide (venter
slightly narrower, width 1.7-3.1 mm); anal cleft
about 1/4th- 1/5th body length.
Dorsum. Derm membranous but becoming
mildly sclerotized when mature; with slightly
heavier sclerotization in each stigmatic area.
Dorsal setae absent. Preopercular pores in 2 di-
verging elongate groups anterior to anal plates,
each group extending anteriorly to about me-
sothorax and with many pores (100+), these
gradually becoming sparser anteriorly; each
pore probably almost flat (appearing like a
small lens) and rather variable in size, each 4-7
pm wide. Dorsal microductules oval, appearing
bilocular, each about 1.5 pm wide, with single
inner ductule arising medially, most ductules
swollen proximally; frequent throughout. Also
with a round pore with a sclerotized outer mar-
gin and a small inner pore, which appears sim-
ilar to a setal basal socket, each about 3 pm
wide; also frequent throughout. Dorsal tuber-
cles, pocket-like sclerotisations and dorsal tu-
bular ducts absent. Anal plates each about 135-
160 pm long, width of single plate 95-115 pm;
each plate triangular with a rather rounded
apex, and with 4 setae near apex, each 28-33
pm long (but most missing). Anogenital fold
with a pair of large setae on each corner of an-
terior margin, each about 95-100 pm long, plus
5 moderately large setae along each lateral
margin. Anal ring well developed, with 5 pairs
of setae, each mostly about 140-170 pm long;
anal tube short with anal ring lying under ante-
rior margin of anal plates. Eyespots small, on
margin, each about 15-18 pm wide.
Florida Entomologist 93(1)
March 2010
S
" vT
'\-
.:' '^ -
'4 \
. :
*-d
*'"
* r
^^ -. '
L
B
w\
E
F
Fig. 1. Adult female Phalacrococcus howertoni Hodges & Hodgson. Unless otherwise stated, in this and subse-
quent figures: A = dorsal seta; B = dorsal microductule; C = dorsal simple pore; D = dorsal tubular duct; E = preo-
percular pore; F = dorsal view of anal plate; G = ventral view of anal plate; H = stigmatic spine; J = marginal setae;
L = spiracular disc-pore; M = multilocular disc-pore; N = ventral microduct; P = ventral seta; Q = part of metatho-
racic leg; R = anal ring; S = antenna and T = preantennal pore.
SM
Hodges & Hodgson: New Soft Scale in Florida
Margin. Marginal setae all rather stout and
sharply spinose, each 16-35 pm long, with a nar-
row basal socket; with 33-39 anteriorly between
eyespots and, on each side, 11-20 between eyes-
pots and anterior stigmatic areas, 17-27 laterally
between stigmatic areas and 41-65 on each side of
abdomen; setae on anal lobes not differentiated.
Stigmatic clefts shallow, but each with a small
area of denser sclerotization, and each with a
rather variable number of stigmatic spines, gen-
erally 3, but up to 8 on some specimens, arranged
in a semicircle, each clearly differentiated from
marginal spines, slightly curved with a rounded
or even slightly flattened and abbreviated apex;
median spine(s) generally larger than more lat-
eral spines, range 20-35 pm long.
Venter. Derm membranous. Spiracular disc-
pores each mainly with 5 loculi, in a band be-
tween each spiracle and stigmatic cleft, each band
narrow near spiracles and broadening slightly
nearer margin; also each band extending a short
distance medially anterior to each spiracle; with
about 30-50 pores in each anterior band and 45-70
in each posterior band; each band with 5-6 pores
within area of sclerotization in each cleft with
thickened margins. Multilocular disc-pores: those
in segment VII with mainly 6 or 7 loculi; those
more anteriorly almost always with 5 loculi; each
about 7-8 pm wide; with 22-75 on either side of
anterior end of anal cleft, and then as follows (on
each side): abdominal segment VI 3-11, V 2-16, IV
5-17, III 7-27, II 1-6 mesad to each coxa + 4-15
more laterally; medially with 0-7 on metathorax,
0-8 posterior to each mesocoxa, 0-4 near each pro-
coxa and 0-2 on each side of clypeolabral shield.
Ventral microducts each about 1 pm wide, fre-
quent in a broad submarginal band and rather
less frequent throughout rest of venter although
absent medially on more posterior abdominal seg-
ments. Ventral tubular ducts absent. With a sin-
gle pair of preantennal pores. Ventral setae
sparse; with three pairs of longer pregenital setae
(on abdominal segments V-VII), longest about
100-115 pm long; most abdominal segments with
5-10 shorter setae in a group submedially; also
with 4-6 setae near each meta- and mesocoxa, and
3 or 4 near each procoxa; with 3 or 4 pairs ofinter-
antennal setae, longest about 65-70 pm long; sub-
marginal setae in a rather sparse band rather
than a line, each about 20-25 pm long.
Antennae each 8 segmented, total length 355-
470 pm; setal distribution typical of Coccidae ex-
cept segments III & IV with 0 or 1 seta and V with
3 setae; length of apical seta 33-36 pm long. Cly-
peolabral shield 175-190 pm long; labium proba-
bly with 4 pairs of setae. Spiracles of normal size,
width of peritremes: anterior 72-90 pm, posterior
85-105 pm. Legs well developed; lengths (pm) of
metathoracic legs: coxae 170-205; trochanter + fe-
mur 250-270; tibia 165-180; tarsus 95-105; claw
25-29; tibio-tarsal articulation clear, with a dis-
tinct articulatory sclerosis; longest coxal seta
about 90-100 pm; longest trochanter seta about
135-140 pm; coxa with 7 setae, trochanter 2 or 3
on ventral surface, femur 3 or 4, tibia 3 and tarsus
2; tarsal digitules longer than claw digitules; claw
digitules longer than claw, each similar with
broad apices; claw without a denticle. Vulva prob-
ably present between abdominal segments VII
and VIII.
Comment. The adult females of this new spe-
cies of soft scale share character-states with the
Eulecaniinae (absence of dorsal tubercles, pocket-
like sclerotisations and dorsal tubular ducts; spi-
nose marginal setae, and multilocular disc-pores
extending anteriorly onto thorax and head) but
the multilocular disc-pores have 7 or fewer loculi,
ventral tubular ducts are absent, the legs have an
articulatory sclerosis and the claw digitules are
broad. It also has character-states which it shares
with the Paralecaniini (absence of dorsal tubular
ducts; stigmatic clefts with sclerotizations; mul-
tilocular disc-pores with less than 10 loculi; ven-
tral tubular ducts absent) but, again, it has char-
acters that do not fit, namely eyespots on margin
and multilocular disc-pores not restricted to pos-
terior abdominal segments. It is close to Coccini
but the absence of dorsal setae and the presence
of strongly spinose marginal setae etc. makes it
different from all known genera included in this
group as defined by Hodgson (1994). It is there-
fore being placed in a new genus, Phalacrococcus
Hodges & Hodgson but wider relationships re-
main unclear.
SECOND-INSTAR FEMALE (Fig. 2)
Described from 5 specimens in fair to good condition.
Mounted Material. Oval, 0.75-0.93 mm long and 0.45-
0.60 mm wide; anal cleft about 1/6 body length.
Dorsum. Derm membranous. Dorsal setae ab-
sent (but see notes below). Preopercular pores ab-
sent. Dorsal microductules apparently absent.
Dorsal simple pores, each about 2-5-3.0 pm wide,
in a pair of submedial lines and submarginally;
with about 9 pores in each submedial line and
about 15 in each submarginal line. Dorsal tuber-
cles, pocket-like sclerotisations and dorsal tubu-
lar ducts absent. Anal plates each about 68-70 pm
long, plates with apices wide apart; each plate tri-
angular with a rather rounded apex, and with 4
setae, 3 near apex and 1 on each inner margin;
length of apical setae 25-30 pm long. Anogenital
fold with a pair of setae on each corner of anterior
margin, each about 20-25 pm long; each plate also
with a ventral lateral margin seta. Anal ring well
developed, with 3 pairs of setae, each about 70-95
pm long; anal tube short, anal ring lying under
anterior margin of anal plates. Eyespots small, on
margin, often obscure, each about 15-18 pm wide.
Margin. Marginal setae all rather stout and
sharply spinose, each 7-13 pm long, with a fairly
14 Florida Entomologist 93(1) March 2010
L
J
\ o coo o'
/ -~
S o N,
II I '" '
r I -,...4
01
Q
F G
Fig. 2. Second-instar female Phalacrococcus howertoni Hodges & Hodgson. For labels, see caption for Fig. 1.
Hodges & Hodgson: New Soft Scale in Florida
narrow basal socket; with 12-15 anteriorly be-
tween eyespots and, on each side, 4-6 between
eyespots and anterior stigmatic areas, 4-7 later-
ally between stigmatic areas and 16-25 on each
side of abdomen. Stigmatic clefts shallow, each
with a rather variable number of stigmatic
spines, generally 3, but varying from 1-4 on some
specimens, each clearly differentiated from mar-
ginal spines, often slightly curved with rounded
apex; median spine(s) generally slightly larger
than lateral spines: median spines 20-27 pm long,
lateral 13-19 pm long.
Venter. Derm membranous. Spiracular disc-
pores each mainly with 5 loculi (range 4-7), in a
more or less single line between each spiracle and
stigmatic cleft; with about 4-8 (usually 7 or 8) in
each anterior band and 4-10 (usually 8-10) in each
posterior band. Multilocular disc-pores absent.
Ventral microducts each about 1.5 pm wide, fre-
quent in a submarginal line, with about 8 on each
side of abdomen, 2 on each side of thorax and 2
laterally on head; also with a pair between scapes.
Ventral tubular ducts absent. Preantennal pores:
1 pair present. Ventral setae sparse; with 3 pairs
of longer pregenital setae (on abdominal seg-
ments V-VII), longest 58-70 pm long on segment
VII; abdomen with a submedian row and inner
and outer submarginal rows of small setae, dis-
tributed segmentally; outer submarginal row
with 1 pair per segment on abdomen, 2 pairs be-
tween stigmatic clefts, 1 pair laterally on head
and another pair anteriorly on head; with 1 small
seta near each coxa, interantennal setae 2 pairs,
usually subequal in length, each about 36-45 pm
long.
Antennae each 6 segmented, total length
165-185 pm; setal distribution as normal on
Coccidae. Clypeolabral shield 100-115 pm long;
labium with 3 pairs of setae. Spiracles small,
width of peritremes: anterior 14-15 pm, poste-
rior 16-17 pm. Legs well developed; lengths
(pm) of metathoracic legs: coxae 68-78; tro-
chanter + femur 98-110; tibia 61-65; tarsus 50-
60; claw 16-17; coxa with 5 setae, trochanter 2
on ventral surface, femur 2, tibia 2 and tarsus 4;
tarsal digitules sometimes slightly dissimilar,
longer than claw digitules; claw digitules longer
than claw, similar with broad apices; claw with
just a hint of a denticle.
Comment. It was noted that the dorsal setae
on some 2nd-instar males (described below)
were sometimes apparently absent (but per-
haps represented by just their basal sockets)
while other specimens had minute setae in the
submedian line of simple pores. It is therefore
possible that the same could apply to 2nd-instar
females (i.e., that they are present on some
specimens but only represented by their basal
sockets, which are about the same size of the
simple pores, on others-as on the above speci-
mens).
Apart from the possible lack of dorsal micro-
ductules, the second-instar female nymphs of P.
howertoni show nothing distinctive.
SECOND-INSTAR MALE (Fig. 3).
Described from 3 specimens in fair to good condition.
Material studied. Oval, 0.82-1.50 mm long and 0.57-
0.78 mm wide; anal cleft about 1/6 body length.
Dorsum. Derm membranous. Dorsal setae
noted submedially on meso- and metathorax on 2
specimens. Preopercular pores absent; dorsal mi-
croductules apparently absent. Dorsal simple
pores, each about 1.5 pm wide, rather hard to see
but apparently in a pair of submedial lines and
submarginally; with about 4 or 5 pores in each
submedial line and about 14 or 15 in each sub-
marginal line. Dorsal tubular ducts present in a
submarginal row, with 10-15 between eyespots,
and (on each side) 6-11 between eyespots and an-
terior stigmatic cleft, 6-8 between clefts and 5-10
along anterior abdominal submargin; also with
an anterior radial line from near each eyespot and
another in about abdominal segment IV, each
with 6-8 ducts; plus a pair of partial submedian
bands extending from anterior plates anteriorly,
each with about 7 or 8 ducts. Anal plates each
about 68-71 pm long, each plate about 30-35 pm
wide; plates with apices wide apart; each plate
triangular with a rather rounded apex, with 4 se-
tae, 3 near apex and one on each inner margin;
length of apical setae 18-21 pm long. Anogenital
fold with a pair of setae on each corner of anterior
margin, each about 16-18 pm long; each anal
plate also with 1 seta ventral lateral margin seta.
Anal ring well developed, with 3 pairs of setae,
each about 70-95 pm long; anal tube short, anal
ring lying under anterior margin of anal plates.
Eyespots small, on margin, often obscure, each
about 12-15 pm wide.
Margin. Marginal setae all rather stout and
sharply spinose, each 7-13 pm long, with a fairly
narrow basal socket; with 9-13 anteriorly be-
tween eyespots and, on each side, 5-9 between
eyespots and anterior stigmatic areas, 4-6 later-
ally between stigmatic areas and 17-22 on each
side of abdomen. Stigmatic clefts shallow, each
with 3 stigmatic spines, each generally clearly dif-
ferentiated from marginal spines, usually
straight but occasionally slightly curved, with a
rounded apex; median spine(s) generally slightly
larger than lateral spines: median spines 12-18
pm long, lateral 13-17 pm.
Venter. Derm membranous. Spiracular disc-
pores each mainly with 5 loculi, in a more or less
single line between each spiracle and stigmatic
cleft; with 7-10 in each anterior band and 8-10 in
each posterior band. Multilocular disc-pores ab-
sent. Ventral microducts each about 1.5 pm wide,
frequent in a submarginal line, with about 8 on
Florida Entomologist 93(1)
D
Ao
C O0
/
S
LN
N
Fig. 3. Second-instar male Phalacrococcus howertoni Hodges & Hodgson. For labels, see caption for Fig. 1.
March 2010
i
Hodges & Hodgson: New Soft Scale in Florida
each side of abdomen, 4 on each side of thorax, 2
laterally on head and 2 anteriorly on head; also
probably with a pair between scapes. Ventral tu-
bular ducts absent. Preantennal pores: 1 pair
present. Ventral setae sparse; with three pairs of
longer pregenital setae (on abdominal segments
V-VII), longest on segment VII, each 58-70 pm
long; abdomen with segmentally arranged sub-
median and an inner and outer submarginal rows
of small setae; outer submarginal row with 1 pair
per segment on abdomen, 1 pair between stig-
matic clefts and 1 pair anteriorly on head; also
with 1 small seta near each coxa, plus 2 pairs of
interantennal setae, usually subequal in length,
each about 40-55 pm long.
Antennae each 6 or 7 segmented (when 6 seg-
mented, with a distinct pseudoarticulation in the
long segment III), total length 195-211 pm; setal
distribution as normal on Coccidae. Clypeolabral
shield 85-95 pm long; labium with 3 pairs of setae.
Spiracles small, width of peritremes: anterior 13-
18 pm, posterior 16-19 pm. Legs well developed;
lengths (pm) of metathoracic legs: coxae 80; tro-
chanter + femur 100-115; tibia 66-70; tarsus 53-
58; claw 14-15; coxa with 5 or 6 setae, trochanter
2 on ventral surface, femur 2, tibia 2 and tarsus 3
or 4; tarsal digitules sometimes slightly dissimi-
lar, longer than claw digitules; claw digitules
longer than claw, each similar with broad apices;
claw with just a hint of a denticle.
Comment. Miller & Williams (1997) illustrated
the suture distribution on the tests of many sec-
ond-instar male Coccidae. Most of these tests had
complex suture patterns with frequent radial
lines. As the dorsal tubular ducts on second-instar
males lie under the suture lines in the tests, it is
possible to determine the layout of these lines on
the test by looking at the dorsal tubular duct dis-
tribution on the second-instar male nymphs.
None of the suture patterns shown by Miller &
Williams quite match that of P howertoni. The
pattern shown for Ceroplastes acaciae Cockerell
is somewhat similar in that the median suture
lines appear to be incomplete, but C. acaciae lacks
the anterior radial lines. In any case, it seems im-
probable that P howertoni would be closely simi-
lar to the Ceroplastinae. Thus it appears that the
distribution of the suture lines offers no obvious
suggestions as to the nearest relative of P hower-
toni.
FIRST INSTAR (sex not determined) (Fig. 4).
Described from 5 specimens in fair to good condition
and with reference to 7 others.
Material studied. Oval, 0.40-0.61 mm long and 0.25-
0.35 mm wide; anal cleft very short.
Dorsum. Derm membranous. Dorsal setae in 2
submedial lines of 5 short setae, each about 2 pm
long. Preopercular pores absent; dorsal micro-
ductules apparently absent. Dorsal simple pores
extremely hard to see but each about 2 pm wide,
in submedial lines and submarginally; with per-
haps 2 pores in each submedial line on abdomen
and perhaps 7 in each submarginal line. Anal
plates each about 42-53 pm long, plates with api-
ces wide apart; each plate triangular with a
rather rounded apex each with longitudinal
ridges on dorsal surface; each with 4 setae, 1 on
inner margin and 3 near apex, apical seta very
long, each about 160-185 pm long. Anogenital fold
with a pair of setae on each corner of anterior
margin, each about 13-16 pm long; also each plate
with a single ventral lateral margin seta Anal
ring well developed, with 3 pairs of setae, each
about 40-55 pm long; anal tube short, anal ring ly-
ing under anterior margin of anal plates. Eyes-
pots small, on margin, often obscure, each about
10-11 pm wide.
Margin. Marginal setae all rather stout and
sharply spinose, each 10-16 pm long, with a fairly
narrow basal socket; with 8 anteriorly between
eyespots and, on each side, 2 or 3 between eyes-
pots and anterior stigmatic areas, 3 laterally be-
tween stigmatic areas and 9 or 10 on each side of
abdomen. Stigmatic clefts shallow, each with 1
stigmatic spine, clearly differentiated from mar-
ginal spines, often slightly curved with a flat-
tened, rounded apex; each 12-20 pm long.
Venter. Derm membranous. Spiracular disc-
pores each mainly with 5 loculi (range 4-7), in a
more or less single line between each spiracle and
stigmatic cleft; with 3 or 4 in each band. Multiloc-
ular disc-pores absent. Ventral microducts ex-
tremely hard to see, each about 1.0-1.5 pm wide,
present submarginally, with perhaps 1 on abdo-
men, 1 on thorax and 1 on head. Tubular ducts
and preantennal pores absent. Ventral setae
sparse; with 3 pairs of longer pregenital setae (on
abdominal segments V-VII), longest 40-53 pm
long; abdomen with an inner and outer submar-
ginal row of small setae, segmentally arranged on
abdomen, plus 1 pair between stigmatic clefts and
1 pair anteriorly on head; setae near each coxa ab-
sent; with 1 pair of interantennal setae, each
about 30-38 pm long.
Antennae each 6 segmented, total length 150-
160 pm; setal distribution as normal on Coccidae.
Clypeolabral shield 70-80 pm long; labium with 3
pairs of setae. Spiracles small, width of peri-
tremes 6.5-8.0 pm. Legs well developed; lengths
(pm) of metathoracic legs: coxae 43-48; trochanter
+ femur 68-76; tibia 36-43; tarsus 36-43; claw 15;
coxa with 5 setae, trochanter 2 on ventral surface,
femur 2, tibia 2 and tarsus 4; tarsal digitules off-
set and dissimilar, 1 shorter than other; subequal
in length to claw digitules; claw digitules longer
than claw, dissimilar; claw with a minute denti-
cle.
Comment. The first-instars of P howertoni are
typical soft scale crawlers except that they appear
to lack the "trilocular" pore which is generally
Florida Entomologist 93(1)
\ / /S
/J
C 0-"
::
a I-
I I
Fig. 4. First-instar Phalacrococcus howertoni Hodges & Hodgson. For labels, see caption for Fig. 1.
N
U:
March 2010
^-
R
Hodges & Hodgson: New Soft Scale in Florida
present near the dorsal anterior margin of the
head. The apparent lack of dorsal microductules
may be related to the condition of the slides al-
though they were not detected on the 2nd-instars
either.
PUPA (Fig. 5)
Described from 2 specimens, 1 poor.
Mounted Material. Elongate oval. Division
into head, thorax and abdomen fairly clear, al-
though segmentation often obscure apart from on
abdomen. Derm membranous, with small dermal
spinules. All ducts and pores (bar spiracular disc-
pores) absent and setae few. Of moderate size:
length 1.12-1.2 mm; head width 312-341 pm.
Head. Lacking mouthparts and simple eyes.
With a pair of moderately long, 10-segmented an-
tennae pointing posteriorly, extending posteriorly
almost to mesocoxae (ratio of total body length to
antennal length about 1:0.35; apical segment
pointed, apparently without incipient setae; basal
segments slightly to moderately sclerotized; total
length 475-480 pm. Setae: with 2 pairs of minute
setae on apex of head.
Thorax. Unsclerotized, segmentation obscure.
Legs well-developed; coxa and trochanter slightly
sclerotized; prothoracic legs probably generally
directed anteriorly and curving round in front of
anterior margin of head but not on available spec-
imens; metathoracic legs extending posteriorly to
about abdominal segment V; coxae with a minute
seta; length of metathoracic legs 490-540 pm.
Wing-buds extending to about anterior margin of
abdomen; mildly sclerotized; length 460-485 pm,
width 110-156 pm (ratio length to width 1:0.28).
Spiracles: width of peritremes 26-30 pm; anterior
spiracles each with 9-12 disc-pores anterolater-
ally to each peritreme; posterior spiracles with 0-
2 disc-pores; number of loculi in each disc-pore
highly variable, from 1 to 15 or more. Setae: with
one pair medially on dorsum of mesothorax and
another pair medially on venter of metathorax.
Abdomen. Segmentation usually distinct, an-
terior-most segment on venter considered to rep-
resent segment II, so that there are 7 visible seg-
ments (segments II to VIII) anterior to penial
sheath. Caudal extensions of segment VII lobe-
like, about half length of penial sheath. Setae:
with pairs of small dorsal abdominal setae medi-
ally on segments III-VII and two pairs of small
ventral abdominal setae on segments III-VI; dor-
sopleural setae quite large, each 15-20 pm long
more or less in a line from segment VII to segment
IV, those on caudal extension of segment VII sim-
ilar, plus single setae on 1 or 2 more anterior seg-
ments; ventropleural setae: single short setae on
segments II-VII. Caudal extension of segment
VIII represented by a pair of obscure membra-
nous lobes dorsally on either side of base of penial
sheath, each with 2 minute fleshy setae. Ante-
anal setae absent. Penial sheath lightly sclero-
tized, more or less triangular, 115-130 pm long
and 85-95 pm wide at base (ratio length to width
1:0.74); with 2 pair of small pores or setae on dor-
sal surface. Anus not located.
Comment. Relatively few pupae of soft scales
have been studied but of those studied, the pres-
ence of spiracular disc-pores near the posterior
spiracle appears to be unusual and few have a
line of dorsal pleural setae along the margin of
the abdomen, as on some species of Crystallotesta-
most pupae have the dorsal pleural setae ar-
ranged segmentally.
ADULT MALE (Fig. 6).
Described from 5 specimens in good condition.
Unmounted material: not seen.
Mounted material. Moderately large, total
body length 1.5-1.63 mm; width across triangular
plates 0.36-0.38 mm; body quite broad.
Head: approximately diamond-shaped in dor-
sal view; length 220-245 pm; width across genae
230-250 pm. Median crest (mc) reticulated dor-
sally; with 4-6 small hs dorsal head setae (dhs) on
each side. Ventral mid-cranial ridge (vmcr) repre-
sented by a sclerotized ridge between scapes; area
between vmcr and scapes with faint ridges or re-
ticulations; with 2-4 pairs of ventral mid-cranial
ridge setae (vmcrs). Genae (g) strongly reticu-
lated, each reticulation with numerous inner mi-
croridges: genal setae absent. Eyes: with 2 pairs
of round, simple eyes, subequal in size, each 35-40
pm wide; anterior pair near anterior margin of
head and posterior se close to posterior margin.
Ocelli (o) slightly oval, each about 17-20 pm wid-
est laterally. Ocular sclerite (ocs) strongly polygo-
nally reticulated, each reticulation with a 1 or 2
inner micro-ridges. Preocular ridge fairly short
but distinct. Interocular ridge absent. Postocular
ridge (pocr) well developed but short, not nearly
reaching ocelli. Dorsal ocular setae absent. Ven-
tral head setae absent. Cranial apophysis (ca) Y-
shaped, about 45-55 pm long. Preoral ridge (pror)
well developed.
Antennae: total length about 675 pm long (ra-
tio of total body length to antennal length about
1:0.42). Scape (scp): 40-55 pm long and 40-42 pm
wide, with 3 hs. Pedicel (pdc): 35-37 pm long, 45-
50 pm wide; with 3-7 hs on dorsal surface. Seg-
ments III-X all about 25-33 pm wide; lengths of
segments (pm): III 53-70; IV 66-115; V 80-83; VI
80-83; VII 73-83; VIII 75-77; IX 66-73, and X 48-
60; fs each about 18-21 pm long (i.e. much less
than width of segment), with a rounded apex; ex-
tremely abundant; hs absent; each segment often
with a basal seta very similar to an antennal bris-
tle. Segment VIII and IX each with an exception-
ally long antennal bristle (ab); segment X with a
Florida Entomologist 93(1)
wb --
ads -" -
S - -~ avs
dps --
- vps
Ce I- -
cevie
'ps
Fig. 5. Pupa Phalacrococcus howertoni Hodges & Hodgson. Where ads = dorsal abdominal setae; ant = antenna;
avs = ventral abdominal setae; ce., = caudal extension to segment VII; ce, = caudal extension to segment VIII; dps
= dorsal pleural setae; sp2 = anterior spiracle; sp, = posterior spiracle; vps = ventral pleural setae and wb = wing bud.
March 2010
Hodges & Hodgson: New Soft Scale in Florida
prn -
v prnr-
ptm
pscr-
pscs.
tegs te ;i ,-
mts
pn-
ads
S dps--
scp
\
pdc B,
I'.
eps2
A2
pc
r. 'E
ora
.- d tdgt
cdgt
'psp
Fig. 6 = Adult male Phalacrococcus howertoni Hodges & Hodgson. Where: A, = polygonal reticulations on gena; A2
= polygonal reticulations on ocular sclerite; B, = fleshy seta on antenna; B2 = fleshy setae on legs; C = cranial apophy-
sis; D = hair-like dorsal pleural seta; E = apical 2 segments of antenna (note that apical segment is usually longer than
shown), and F = distal end of metathoracic leg. And where: ab = antennal bristles; ads = dorsal abdominal setae; aed
= aedeagus; amss = anterior metasternal setae; as = abdominal sternite; at = abdominal tergite; avs = ventral abdom-
inal setae; bma = basal membranous area; cdgt = claw digitule; ce = caudal extension; dhs = dorsal head setae; dps =
dorsal pleural setae; dse = dorsal simple eye; epm, = metepimeron; eps2 = mesepisternum; eps,s = postmetaspiracular
setae; f = furca; fs = fleshy seta; g = gena; gp = glandular pouch; gps = glandular pouch setae; lpl = lateropleurite; me
= midcranial ridge; mdr = median ridge; mr = marginal ridge; mts = metatergal setae; o = ocellus; ocs = ocular sclerite;
pdc = pedicel; pepcv = proepisternum + cervical sclerite; plr, = metapleural ridge; pn2 = mesopostnotum; pn, = meta-
postnotum; pna = postnotal apophysis; pocr = postocular ridge; prn = lateral pronotal sclerite; prnr = pronotal ridge;
procr = preocular ridge; prsc = prescutum; ps = penial sheath; pscr = prescutal ridge; pscs = prescutal suture; psp =
penial sheath pores; pss = penial sheath setae; pt = post-tergite; scl = scutellum; scp = scape; set = scutum; sets = scutal
setae; sp2 = anterior spiracle; sp, = posterior spiracle; stn1 = prosternum; stn2 = basisternum; stn, = metasternum; tdgt
= tarsal digitule; teg = tegula; tegs = tegular setae; tibs = tibial spur; vmcr = ventral midcranial ridge; vmcrs = ventral
midcranial ridge setae; vps = ventral pleural setae, and vse = ventral simple eye.
Florida Entomologist 93(1)
few fs (some may be short ab) + 3 exceptionally
long ab; each bristle 80-110 pm long; capitate se-
tae absent.
Thorax. Prothorax: pronotal ridge (prnr)
strong and not fused medially; pronotal sclerite
(prn) broad. Post-tergite lightly sclerotized with
ridges. All pronotal setae absent. Prosternum
(stn1) strongly sclerotized with a well-developed
median ridge and transverse ridges; all proster-
nal setae absent. Proepisternum + cervical scler-
ite (pepcv) well developed; propleural ridge quite
large; propleural apophysis well developed.
Mesothorax: prescutum (prsc) 185-207 pm
wide and 100-112 pm long, probably rather con-
vex in life; with slight indications of nodulations;
without prescutal setae; prescutal ridge (pscr)
and prescutal sclerite (pscs) well developed.
Scutum (sct): median membranous area 165-190
pm wide and 75-104 pm long, with 4-8 hs scutal
setae (scts) on each side; sclerotized lateral areas
without nodulations or setae; area laterad to
scutellum more heavily sclerotized. Prealare
ridge (prar) well developed but narrow, terminat-
ing in a well-developed anterior notal wing pro-
cess. Scutellum (scl) 185-215 pm wide and 66-70
pm long; with a large foramen; scutellar setae ab-
sent. Mesopostnotum (pn2) underlying metapost-
notum (pn,); postnotal apophysis (pna) normal;
area within mesopostnotum membranous. Pre-
alare and triangular plate well developed.
Mesepisternum (eps2) rather small, without nod-
ulations. Basisternum (stn2) about 250-275 pm
wide and 170-175 pm long; with a narrow, com-
plete median ridge (mdr); marginal ridges well
developed; furca (f) with arms extending anteri-
orly to about halfway to marginal ridge (mr). Lat-
eropleurite (lpl) relatively small, possibly with a
membranous centre. Postalare (pa) not reticu-
lated at anterior end but perhaps with a few stri-
ations; postalare setae absent. Mesothoracic spir-
acle (sp2): peritreme 33-35 pm wide; disc-pores ab-
sent. Postmesospiracular setae absent. Tegula
(teg): with about 3-5 hs regular setae tegss).
Metathorax. Metatergal seta (mts): with 1 hs
on each side. Metapostnotum (pn3) present. Dor-
sospiracular setae (dss) absent. Dorsal part of
metapleural ridge (plr ) absent; ventral part
broad. Metepisternum (eps3) unsclerotized, with a
dense group of about 20 fs postmetaspiracular se-
tae (eps3s). Metepimeron (epm3) heavily sclero-
tized; base of metapleural ridge and metepimeron
with a dense group of perhaps 20 fs. Antemetaspi-
racular setae absent. Metathoracic spiracle (sp3):
peritreme 27-33 pm wide; without disc-pores.
Metasternum (stn ) unsclerotized. Anterior
metasternal setae (amss): 1 hs medially; posterior
metasternal setae absent. All structures associ-
ated with hamulohalteres absent.
Wings: about 1075-1125 pm long and 472-525
pm wide (ratio of length to width 1:0.45; ratio of
total body length to wing length 1:0.70). Without
alar lobe or alar setae. Hamulohalteres (h) ab-
sent.
Legs: metathoracic legs marginally longer
than others, with numerous fs, each slightly
shorter than those on antennae but equally broad
and blunt apically. Lengths (in pm) coxae (cx): I
99-112; II 95-112; III 105-110 pm long; setae of
coxa III: a few hs + many fs; procoxae with a
group of pointed coxal bristles. Trochanter (tr) +
femur (fm): I 235-252; II 230-257; III 223-252 pm
long; trochanter III with 2 long hs + many fs; fe-
mur III with many fs and a few hs. Tibia (ti): I
248-265; II 240-277; III 260-303 pm; tibia III with
many fs + a few hs; some more distal setae becom-
ing spur-like; with 1 apical spur (tibs), length (III)
25-28 pm. Tarsi (ta): I 99-108; II 95-102; III 99-
103 pm long (ratio of length of tibia III to tarsus
III 1:0.36); tarsus III with 0-1 fs and several hs,
some spur-like; tarsal spurs (tabs) not differenti-
ated; tarsal campaniform pore absent; tarsal dig-
itules (tdt) longer than claw, subequal in length to
claw digitules, both with capitate apices. Claws
(c): length (III): 25-27) pm, subequal to width of
tarsus; claw digitules both with small clubbed
apices.
Abdomen. Tergites (at) on segments I, II, VII
and VIII lightly sclerotized; sternites (as) of seg-
ments II, III, IV, VII and VIII sclerotized; pleu-
rites (ap) unsclerotized. Caudal extension (ce) of
segment VII very small, that on VIII absent. Dor-
sal abdominal setae (ads) extremely few, with
pairs of short hs on segments IV-VII. Pleural se-
tae: dorsopleural setae (dps): with a line of rather
longer hs setae extending from about segment II-
VII, longest about 25-30 pm long; ventropleural
setae (vps) sparse, with 3 on segment VII and
VIII, and single on V and VI (and maybe some-
times on IV). Ventral abdominal setae (avs) very
sparse, with 1 pair of short hs on segments III and
IV and 2 or 3 pairs on segments V-VII. Segment
VIII without ante anal-setae. Glandular pouches
present, each deep and divided into inner and
outer chambers; each with a pair of glandular
pouch setae with capitate apices and 85-100 pm
long.
Genital Segment. Penial sheath (ps) quite long
with almost parallel sides; 370-395 pm long and
about 50 pm wide near middle (ratio of total body
length to penial sheath length 1:0.24). Basal rod
(bra) short but rather variable in length, 70-170
pm long, not nearly reaching basal membranous
area anteriorly (bma). Aedeagus (aed) short, 125-
135 pm long; apex appears to be divided. Penial
sheath with about 12 small penial sheath setae
and with a group of pores on apex.
Comment. Less than 100 adult male Coccidae
have been studied in detail but the male of P. how-
ertoni is immediately separable from them in hav-
ing: (i) exceptionally long antennal bristles on an-
tennal segments VIII-X (much longer than the
segments), and (ii) extremely short, thick fleshy
March 2010
Hodges & Hodgson: New Soft Scale in Florida
setae with a blunt apex on antennae and (in par-
ticular) legs. These setae much more closely re-
semble the fleshy setae on some male Eriococ-
cidae than those usually found on Coccidae. In ad-
dition, it has the following unique combination of
other characters: (i) absence of setae on ocular
sclerite; (ii) presence of a dense group of fleshy
postmetaspiracular setae and metepimeron setae
(the only fleshy setae on body derm); (iii) capitate
glandular pouch setae; (iv) aedeagus apparently
bifid apically, and (v) extreme paucity of hair-like
setae on body derm. Because of these unique
characters, it is not possible to suggest any close
phylogenetic relatives.
Economic Importance. Large populations of
soft scales are frequent and can cause much leaf
loss and some twig and limb dieback on larger
woody hosts (Kosztarab 1996). In a few cases,
smaller plants have dies, particularly those of Co-
diaeum. Like most soft scales, P howertoni elimi-
nates large quantities of honeydew and this in-
hibits photosynthesis and encourages sooty mold.
Life Cycle. Under the ecological conditions in
Florida, P howertoni has multiple overlapping
generations a year, averaging about one a month.
It overwinters as the adult female and each fe-
male can lay about 400 eggs.
Natural Enemies. Some natural enemies have
been noted. Predators: Cryptolaemus montrouz-
ieri Mulsant (Coleoptera: Coccinellidae) has been
reported as a major predator on heavily infested
material; and Laelilla coccidiuora Comstock (Lep-
idoptera: Pyralidae) has been recorded from a few
samples from southern Florida. In addition, the
parasitoid Metaphycus flavus (Howard) (Hy-
menoptera: Encyrtidae) has been noted quite of-
ten but has only been found in about 3% of speci-
mens in any 1 collection.
Taxonomic Position: This new soft scale ge-
nus and species shows similarities to members
of the Eulecaniinae, Paralecaniini, and Coccini
but varies significantly from all these taxa. Its
taxonomic relationships, therefore are uncer-
tain and no suggestions can be made at the mo-
ment to the geographic region from which this
species originated.
ACKNOWLEDGMENTS
GSH thanks the Florida Department of Agriculture
and Consumer Sciences-Division of Plant Industry for
collection of specimens and processing of specimens and
Dr. Catharine Mannion and Lyle Buss from the Univer-
sity of Florida for photographs and life history informa-
tion. CJH thanks The National Museum and Galleries
of Wales, Cardiff, for the help and encouragement in his
research.
REFERENCES CITED
BEN-DOV, Y. 1993. A Systematic Catalogue of the Soft
Scale Insects of the World. Flora and Fauna Hand-
book No. 9. Sandhill Crane Press, Gainsville. 536 pp.
BEN-DOV, Y., MILLER, D. R., AND GIBSON, G. A. P. 2009.
SCALENET: A Database of the Scale Insects of the
World, In United States Department of Agriculture
(USDA). http://www.sel.barc.usda.gov/scalenet/
scalenet.htm.
HODGSON, C. J. 1994a. The Scale Insect Family Coc-
cidae: An Identification Manual to Genera. CAB In-
ternational, Wallingford, Oxon, UK. 639 pp.
KOSZTARAB, M. 1996. Scale Insects of Northeastern
North America. Virginia Museum of Natural Histo-
ry, Martinsville VA 650pp.
MILLER, G. L., AND MILLER, D. R. 2003. Invasive soft
scales (Hemiptera: Coccidae) and their threat to U.S.
agriculture. Proc. Entomol. Soc. Washington 105(4):
832-846.
MILLER, G. L., AND WILLIAMS, M. L. 1997. The male
test, pp. 49-54 In Y. Ben-Dov and C. J. Hodgson
[eds.], Soft Scale Insects, Their Biology, Natural En-
emies and Control. World Crop Pests, Vol. 8A. Elsevi-
er, Amsterdam.
Florida Entomologist 93(1)
March 2010
EVALUATIONS OF A NOVEL ISOLATE OF ISARIA FUMOSOROSEA FOR
CONTROL OF THE ASIAN CITRUS PSYLLID, DIAPHORINA CITRI
(HEMIPTERA: PSYLLIDAE)
MARJORIE A. HOY1, RAGHUWINDER SINGH'2 AND MICHAEL E. ROGERS3
'Department of Entomology and Nematology, P.O. Box 110620, University of Florida, Gainesville,
Florida 32611-0620 USA
2Current address: Plant Disease Diagnostic Clinic, 302 Life Science Bldg, Department of Plant Pathology &
Crop Physiology, Louisiana State University AgCenter, Baton Rouge, LA 70803 USA
3University of Florida, Institute of Food and Agricultural Sciences, Citrus Research and Education Center,
700 Experiment Station Road, Lake Alfred, Florida 33850 USA
ABSTRACT
A fungal pathogen that killed adult Diaphorina citri Kuwayama (Asian citrus psyllid) in
Florida citrus groves was isolated, characterized molecularly and morphologically and iden-
tified as a novel isolate of Isaria fumosorosea (Ifr) (= Paecilomyces fumosoroseus) from the
Asian citrus psyllid (Ifr AsCP), but no concentration-mortality or time-response data were
obtained. When adult psyllids were sprayed with spores at 28 C, time response (LTs0) values
of 111 and 102.5 h at spore concentrations of 1 x 107 and 1 x 108 spores/mL, respectively, were
obtained. The LT,, was 167.4 and 174.6 h, respectively, for the 2 spore concentrations. After
192 h, the LCs, value was 6.8 x 105 spores/mL and the LC,, was 2.2 x 108 spores/mL. Ten se-
rial passages of Ifr AsCP were carried out on malt extract agar (MEA) and dilute Sabouraud
dextrose agar and yeast (SDY) media. The pathogenicity to adult psyllids did not decline, but
spore yield declined on the SDY medium and Ifr AsCP consistently produced more spores on
SDY than on MEA media. Ifr AsCP was highly pathogenic to the psyllid when healthy adults
were exposed to spores from psyllid cadavers stored at -74 C. Two pilot field trials were con-
ducted in Florida citrus groves to assess methods for confirming infection; Ifr AsCP spores
infected immature psyllids when applied at a rate of 1 x 107 spores/mL, but monitoring for
infected nymphs required special handling methods.
Key Words: Diaphorina citri, Isaria fumosorosea (= Paecilomyces fumosoroseus), concentra-
tion-mortality data, timed-response data, field evaluation methods, stability
RESUME
Un hongo pat6geno que mat6 adults de Diaphorina citri Kuwayama (silido asidtico de los
citricos) en huertos de citricos en la Florida fue aislado, molecularmente y morfologicamente
caracterizado e identificado como un aislado novedoso de Isaria fumosorosea (Ifr) (= Paecilo-
myces fumosoroseus) del silido asidtico de los citricos (Ifr AsCP), pero no se obtuvo datos de
concentracion-mortalidad o tiempo-letal. Cuando los silidos adults fueron rociados con es-
poras a los 28 C, los valores obtenidos del tiempo letal (TL5s) fueron 111 y 102.5 horas a la
concentration de esporas de 1 x 107 y 1 x 108 esporas/mL, respectivamente. El TL,, fue 167.4
y 174.6 horas, respectivamente, para las dos concentraciones de esporas. Despu6s de 192 ho-
ras, el valor CL5s fue 6.8 x 105 esporas/mL y la CL,, fue 2.2 x 108 esporas/mL. Se hicerion diez
pasos seriales de Ifr AsCP sobre un extract de malto y agar (MEA) y un medio de agar de
dextrosa Sabouraud diluido y levadura (SDL). La patogenicidad de los adults silidos no dis-
minuiron, pero el rendimiento de esporas sobre el medio SDL y el Ifr AsCP consistentemente
produj6 mas esporas sobre SDL que sobre el medio MEA. El Ifr AsCP fue altamente patoge-
nico a los silidos cuando los adults sanos fueron expuestos a las esporas que provienieron
de los cadaveres de silidos almacenados a los -74 C. Se realizaron dos pruebas piloto en
huertos de citricos de la Florida para evaluar los m6todos para confirmar infecciones; las es-
poras de Ifr AsCP infectaron los inmaduros de los silidos cuando fue aplicado a la tasa de 1
x 107 esporas/mL, pero para el monitoreo de ninfas infectadas se require m6todos especiales
de manejo.
The Asian citrus psyllid, Diaphorina citri Ku- datus Liberibacter asiacticus, renders fruit unus-
wayama, is a vector of citrus greening disease, able and ultimately kills the trees (da Graca 1991;
which is the most serious disease of citrus. Citrus Garnier et al. 2000; Halbert et al. 2000; Halbert
greening disease, caused by the bacterium Candi- 2005). Establishment of citrus greening disease
Hoy et al.: Novel Isolate of Isaria fumosorosea
in Florida was confirmed in 2005 and the disease
is widely distributed (Halbert 2005; Bouffard
2006; http://www.doacs.state.fl.us/pi/chrp/green-
ing/maps/cgsit_map.pdf).
Until citrus greening disease was discovered in
Florida, control of Asian citrus psyllid relied
heavily on native predators (Michaud 2004) and
parasitoids introduced in a classical biological
control program (Hoy et al. 1999, 2001; Hoy &
Nguyen 2000; Skelley & Hoy 2004). The predators
are most effective when nymphal psyllid densities
are high and the parasitoids cause high rates of
mortality late in the growing season (Hoy et al.
unpublished; Qureshi et al. 2009). The occurrence
of fungal pathogens attacking D. citri in Florida
has been noted (Halbert & Manjunath 2004;
Michaud 2004; Meyer 2007; Meyer et al. 2007,
2008), but detailed information on the distribu-
tion, phenology, or impact of these fungi on the
population dynamics of D. citri is not yet avail-
able.
Methods for managing citrus greening disease
are being developed and include monitoring, re-
moving symptomatic trees, replanting groves
with certified disease-free nursery stock, develop-
ment of resistant trees, and suppression of D. citri
populations with pesticides (Browning et al. 2006;
Stansly & Rogers 2006; Rogers & Stelinski 2009).
Petroleum oil and synthetic organic insecticides
have been used to suppress D. citri populations in
Florida (Rae et al. 1997; Browning et al. 2006;
Srinivasan et al. 2008; Cocco & Hoy 2008) but,
now that greening has been confirmed in Florida,
growers are applying sprays more frequently in
an attempt to reduce the likelihood of disease
transmission (Padrick 2006). Unfortunately,
many synthetic organic pesticides can cause sec-
ondary outbreaks of pests that are under substan-
tial biological control (McCoy 1985; Browning
1990; Hoy 2000). As a result, control tactics that
would suppress the Asian citrus psyllid and still
allow natural enemies to survive are needed to
sustain Florida's citrus industry.
During Sep 2005, a fungal pathogen was found
killing adult D. citri in Florida citrus groves
(Meyer et al. 2008). Based upon morphological
and molecular methods, a novel strain was identi-
fied as Isaria fumosorosea (Ifr) (previously known
as Paecilomyces fumosoroseus or Pfr) and desig-
nated as Ifr from the Asian citrus psyllid or Ifr
AsCP. Ifr AsCP is distinct from (Meyer et al.
2008), but related to, another isolate (Pfr 97) that
was originally collected from scales in Apopka,
Florida and commercialized as a microbial insec-
ticide (Vidal et al. 1998). Ifr AsCP also is related
to a strain isolated from D. citri in Indonesia
(Subandiyah et al. 2000). Because Ifr AsCP was
found attacking D. citri in citrus groves in Flor-
ida, we considered that it might be uniquely
adapted to citrus grove environmental conditions
and to the Asian citrus psyllid.
The objectives of this study were to develop
concentration-mortality and time-response data,
to resolve how stable this isolate is after undergo-
ing serial transfers on 2 different media because
attenuation of Hyphomycetes after serial trans-
fers on media has been shown to alter virulence
and host specificity (Vandenberg & Cantone
2004), and to determine if frozen infected cadav-
ers could infect live psyllids. In addition, we eval-
uated methods for assessing infection status of
psyllids treated with Ifr AsCP in 2 pilot field tri-
als.
MATERIALS AND METHODS
Colony ofD. citri
A greenhouse colony of D. citri was established
by collecting 10 adult females with orange abdo-
mens from citrus during Mar 2006. The colony
was maintained with methods modified from
Skelley and Hoy (2004) in a greenhouse at 20-
32C under a 16L:8D photoperiod. Adult D. citri
were allowed to oviposit on tender new growth
(flush) produced by small potted citrus trees held
in mesh cages (61 x 61 x 61 cm). Upon emergence,
adult D. citri were collected to initiate another
generation or used for evaluation of conidial
(spore) pathogenicity in the serial transfer test or
for concentration-mortality tests.
Cultivation of Ifr AsCP
Mycosed D. citri that had been exposed to
field-collected cadavers were obtained from Ja-
son Meyer. Inoculated insects were held in a
sterile 50-mL centrifuge tube (USA Scientific,
Ocala, FL) containing a single mature sour or-
ange leaf (Citrus aurantium L.) and a water-
soaked cotton ball to maintain RH at approxi-
mately 100%. These cultures were held in a
growth chamber at 28 + 1C under a 16L:8D pho-
toperiod. Spores from the infected insects were
used to inoculate 15 x 1.5-cm petri plates (Fish-
erbrand, Fisher Scientific, Suwanee, GA) con-
taining dilute SDY media (7.5 g Sabouraud dex-
trose agar, 5 g yeast extract, and 15 g agar/L of
water) and maintained in the growth chamber
under the same conditions. Spores from these in
vitro cultures were harvested 23 d after inocula-
tion by scraping fungal hyphae and spores off the
plates with a sterilized spatula and suspending
them in 20 mL of autoclaved deionized water.
The suspension was filtered through Miracloth
(Calbiochem, EMD Biosciences Inc., La Jolla,
CA) and spore concentrations were determined
with a hemocytometer. New SDY plates were in-
oculated with 0.5 mL of a 1 x 10/mL spore sus-
pension. In a similar manner, Ifr AsCP was
maintained on Malt Extract Agar (MEA) plates
(45 g of malt extract agar/L water, MP Biomedi-
Florida Entomologist 93(1)
cals, Inc., Solon, OH). Plates were sealed with
parafilm (Pechiney Plastic Packaging, Menasha,
WI) and held in a growth chamber at 28 1C
under a 16L:8D photoperiod for 23 d.
Serial Transfer of Ifr AsCP on MEA or SDY Media
Every 23 d, spores were harvested from Ifr
AsCP grown on SDY and MEA plates and used
to inoculate 2 plates each with 0.5 mL of spore
suspension at 1 x 107 spores/mL. The pathoge-
nicity of these spores was assessed in newly
emerged adult psyllids from the greenhouse col-
ony. Ten adult psyllids (4- to 5-d old) were aspi-
rated from the colony into a 50-mL centrifuge
tube, chilled for 10 min on ice and then placed in
a 15 x 1.5-cm sterile petri dish and sprayed with
2 mL of spore suspension (1 x 107 spores/mL)
that had been harvested from 2 MEA or 2 SDY
plates. Psyllids were treated with autoclaved
deionized water as a control. Treated psyllids
were then individually transferred to 50-mL
centrifuge tubes along with a mature sour or-
ange leaf. A cotton ball moistened with tap wa-
ter and squeezed to remove excess water was
placed in the lid. A single Kimwipe (Kimberly-
Clark Corp, Roswell, GA) was used to cover the
cotton before fastening the lid. The tubes were
incubated at 28 1C under 16L:8D photope-
riod. Psyllids were observed for mortality every
24 h starting 4 d after treatment because Meyer
et al. (2008) had shown that mortality did not
occur until at least 6 d after exposure to 1 x 107
spores/mL under these conditions.
Mean (standard deviation = SD) percentage
germination for transfers 8, 9, and 10 on SDY me-
dia was determined by spreading a thin layer of
SDY medium on a plain microscope slide (3 x 1 x
1 mm) (Fisher Brand, Fisher Scientific, Pitts-
burgh, PA). The slide containing the medium was
placed into a chamber with 100% RH overnight
and then smeared with 100 pL of spore suspen-
sion diluted to 1,000 spores/100 pL. The micro-
scope slides were held under 100% RH overnight
at 24-25C and 100 spores were scored for germi-
nation. A total of 5 slides were scored after each
transfer and the mean percentage germination
was calculated.
Storage of Infected Psyllid Cadavers
Different methods have been used to store fun-
gal isolates, including storing the fungus on agar
slants under mineral oil, storing the fungus along
with the growing medium under water or mineral
oil, freezing at very low temperatures, or storing
the fungus on growing medium at room tempera-
ture (Dhingra & Sinclair 1995). These methods
require an additional step prior to culturing or
use of the fungus, which may lead to contamina-
tion due to handling or improper sterilization
techniques, as well as additional time before the
fungus can be used or tested.
To determine iflfr AsCP could be stored at -74C
on psyllid cadavers, which would allow us to
maintain Ifr AsCP on psyllids without the need
to continuously transfer it to new hosts, cadav-
ers were obtained by touching live adults to an
infected psyllid with abundant spores and the
newly infected psyllids were held in 50-mL cen-
trifuge tubes with a citrus leaf for food at 28
1C under a 16L:8D photoperiod for 72 h, after
which 100% mortality was observed. After an
additional week, the cadavers were evaluated to
confirm that they had spores and the tubes then
were placed into sealed plastic bags in a -74C
freezer. Every 2 weeks, 2 cadavers were ran-
domly chosen and thawed to room temperature.
Ten adult psyllids that were 4- to 5-d old were
collected from the greenhouse colony in a 50-mL
centrifuge vial and chilled for 10 min on ice. Two
psyllid cadavers were placed in the tube along
with 10 chilled psyllids. The vial was tapped
several times on a tabletop to ensure the chilled
psyllids encountered the cadaver and then the
psyllids were held individually in a new 50-mL
tube, as described previously. A control also was
included, where chilled psyllids were touched
with water. The vials were held in a growth
chamber at 28 1C under 16L:8D photoperiod.
This procedure was followed 5 times every 2
weeks and data were recorded as the number of
dead psyllids 24, 48, and 72 h after exposure to
the cadavers.
Concentration-Mortality and Time-Response Data
Five different concentrations of Ifr AsCP (1 x
104 to 108 spores/mL), plus a water control, were
used to conduct a concentration-mortality test at
28 1C under a 16L:8D photoperiod. The bioas-
say was repeated 5 times at 7-10-d intervals. Ifr
AsCP spores were scraped off 2 SDY plates that
had been inoculated 23 d earlier. A series of plates
was inoculated at different times so that each rep-
licate was conducted with spores from plates that
were 23 d old. The spore suspension was vortexed
in autoclaved deionized water for 1 min and then
filtered. Spores were counted and the required
concentrations were obtained by serial dilutions.
Twenty adult psyllids that were 4- to 5-d old (both
sexes) were used for each concentration in each
replicate. Psyllids were collected in 50-mL centri-
fuge tubes and chilled for 10 min on ice and then
placed in a petri dish. Psyllids were sprayed with
2 mL of each spore concentration. Then the psyl-
lids were individually transferred to a sterile 50-
mL centrifuge tube and maintained as described
previously. Psyllids were observed for mortality
every 24 h until 10 d after treatment. Data were
analyzed by probit analysis in PoloPlus (Le Ora
Software 2002-2003).
March 2010
Hoy et al.: Novel Isolate of Isaria fumosorosea
Evaluation of Infection with Ifr AsCP During Pilot Field
Trials
SDY plates (n = 20) that had been inoculated
24 d previously with Ifr AsCP were used to pre-
pare spore suspensions for field application. The
spore suspension was prepared as described
above. The spore suspension (concentrated) was
stored overnight at 4C in sterile 50-mL centri-
fuge tubes and transported to the field in an ice
chest containing ice packs. The spore suspen-
sion was diluted to 1 x 107 spores/mL (2.7 L)
with autoclaved deionized water immediately
before spraying trees at the Citrus Research
and Education Center (CREC) near Lake Al-
fred, Florida.
At the CREC, 3'Hamlin' orange trees, ca. 2-3 m
in height and with flush less than 4 cm in length
were sprayed with 1 L of autoclaved deionized wa-
ter/tree as controls. Subsequently, 3 trees were
sprayed with 900 mL of 1 x 107 spores/mL/tree.
Before spraying the trees, a pretreatment sample
of 5 shoots was collected randomly from each tree,
and each shoot was placed in a separate clear
plastic bag (25.4 x 30.4 cm polyethylene bag,
Fisher Scientific, Suwanee, GA) secured with
twist ties. The sprays were applied with a battery-
operated sprayer (Scorpion sprayer, AgSouth,
LLC, Union City, TN). An hour after treatment, a
post-treatment sample of 5 shoots per tree was
collected from both the Ifr AsCP- and water-
treated trees and placed into clear plastic bags se-
cured with twist ties. The bags were stored in an
ice chest with ice packs for the trip to Gainesville,
Florida.
Immediately after returning to Gainesville,
the numbers of psyllid nymphs, adults and/or
eggs were recorded and shoot length measured.
Insects also were examined for evidence of in-
fection with Ifr AsCP. The shoots were replaced
into the bags with 2 moist paper towels to main-
tain a high RH and stored in a growth chamber
at 23 + 1C under a 16L:8D photoperiod. After 5
d, the number of nymphs and adults that were
dead or alive was recorded. Dead nymphs and/
or adults recovered from plastic bags were
placed on 9.5 x 1.5 cm petri plates containing
crystal violet dodine medium (Chase et al.
1986) to observe if any fungal growth occurred.
Dead nymphs were evaluated for visible signs
of Ifr AsCP.
Foliage samples were randomly collected
weekly twice more after the spray and scored as
described above. Data were analyzed by ANOVA
(SAS 1999) and means were separated with
Fisher's least significant difference (LSD) at a 5%
level of significance. Weather data were obtained
from the weather station at the CREC (http://
fawn.ifas.ufl.edu/scripts/reportrequest.asp), and
mean daily temperature, RH, and rainfall were
obtained.
A second pilot field trial was conducted with
spores that were 'mass' produced by Dr. Jarrod
Leland (USDA-ARS) and shipped to Gainesville,
FL in a dry state in vacuum-sealed plastic bags.
Ifr AsCP was grown in a liquid culture for 3 d, and
50 mL of inoculum was added to 1 kg of barley
along with 400 mL of sterile water. The barley
was kept in a low-oxygen bag at 60% RH, with the
bag manipulated daily to prevent clumping.
Spores were harvested after 10 d and stored at 2-
4C until the trial was conducted. The day before
the spray was applied, the dry Ifr AsCP spores
were suspended in autoclaved deionized water
and vortexed for 1 min. The suspension was then
filtered through a double layer of autoclaved Mir-
acloth (Calbiochem, EMD Biosciences, Inc. La
Jolla, CA) and spores were counted with a
hemocytometer. The spore suspension (concen-
trated) was stored overnight at 4C in sterile 50-
mL conical centrifuge tubes and transported to
field in an ice chest containing ice packs. The
spore suspension was diluted to 1 x 107 spores/mL
with autoclaved deionized water in the field just
before spraying.
The 3-y-old block of trees sprayed in this pilot
field trial was located at the Florida Citrus Foun-
dation research grove, in Orange County, near
Winter Garden, Florida and consisted of a Min-
neola cross (LB89), planted 3.8 m apart in the
row with rows 6.1 m apart. The 20 trees were ca.
1.2-1.5 m tall, and the 2 treatments were ran-
domly chosen by coin toss. Trees initially con-
tained flush less than 4 cm long with eggs and
small psyllid nymphs. Ten trees were treated
first with 500 mL of autoclaved deionized water
and then 10 trees were treated with 500 mL of 1
x 107 spores/mL/tree with a battery-operated
sprayer (Scorpion sprayer, AgSouth, LLC, Union
City, TN).
Sampling and analysis of field samples was
conducted as described above, except that each
shoot was placed into a separate zip-lock plastic
bag (Great Value Zip Close bags 17.8 x 20.3 cm,
Walmart Stores Inc., Bentonville, AR) with the
goal of maintaining higher RH and preventing
loss of psyllid nymphs from the bag. In addition,
three dead nymphs per shoot or per bag that ap-
peared to be infected with fungus were placed on
a petri dish (6.0 x 1.5 cm, Fisher's Scientific, Su-
wannee, GA) containing SDY media and the
identity of the fungus was subsequently con-
firmed by the polymerase chain reaction (PCR)
(Meyer 2007; Meyer et al. 2008). Foliage samples
were collected for 4 weeks after the sprays and
scored as described above. Data were analyzed
by ANOVA and means were separated with
Fisher's least significant difference (LSD) at 5%
level of significance. Weather data were obtained
from the weather station on the site and mean
daily temperature, RH, and rainfall were ob-
tained.
Florida Entomologist 93(1)
RESULTS AND DISCUSSION
Serial Transfer of Ifr AsCP on MEA and SDY Media
Ifr AsCP produced on SDY medium produced
significantly more spores than on MEA (Fig. 1).
When spore production was evaluated over time,
there was no significant difference in spore pro-
duction on MEA over the 10 transfers, with spore
production ranging from 6.1 x 107 to 7.14 x 10 per
10-cm plate (Fig. 1). Spore production on SDY me-
dium was more variable, and appeared to decline
over the 10 transfers. Whether this was due to ge-
netic changes in the Ifr AsCP being transferred or
due to a decline in the quality of the media used
was not determined. Media was prepared fresh
for each transfer, but the dry media was stored at
room temperature for >10 months.
Viability of spores was maintained when Ifr
AsCP was grown on SDY media. Mean (SD) per-
centage germination for transfers 8, 9, and 10
were 97 (2.7), 96 (3.9), and 96 (3.5), respectively.
Serial transfer for only 10 generations might not
be sufficient to show reduced rates of germina-
tion, but the production of spores declined for Ifr
AsCP grown on the SDY medium.
The colony phenotypes ofIfr AsCP on the 2 me-
dia differed consistently throughout the 10 trans-
fers. Mycelia and spores on the SDY medium ap-
peared dense and grayish in color. When the
plates were turned over, there was intense yellow
pigmentation. By contrast, the mycelia and
spores on the MEA plates were less dense, lighter
in color, and no pigmentation was seen on the un-
derside of the cultures.
Storage of Frozen Cadavers
After 10 weeks of storage at -74C, Ifr AsCP
spores on the psyllid cadavers retained a high de-
gree of virulence. All adults that were tested died
within 72 h after being exposed to the frozen ca-
davers. Thus, freezing for up to 10 weeks at -74C
a
I lll
Trarb numtr
Fig. 1. Spore production of Ifr AsC
fers on MEA and SDY media.
did not affect the infectivity of the cadavers and
this method of storage has the advantage of re-
ducing handling or processing of the fungus to
separate it from mineral oil, water, or other stor-
age media. This storage method should reduce the
chance of attenuation of Ifr AsCP, because Ifr
AsCP can be maintained on psyllid hosts continu-
ously with little labor. When spores were isolated
from the cadavers with a sterile needle and
streaked on SDY plates, all single colonies had a
phenotype typical of Ifr AsCP.
Concentration-Mortality and Time-Response Data
At concentrations of 1 x 107 and 1 x 108 spores/
mL at 28C under a 16L:8D photoperiod, the LT,,
for D. citri adults was 111 and 102.5 h, respec-
tively (Fig. 2, Table 1). No mortality was observed
in the water controls. The LT,, was 167.4 and
174.6 h, respectively, for the 2 spore concentra-
tions. The time-response lines for the 2 concentra-
tions were not different.
A complete concentration-mortality line was
calculated for adult psyllid mortality after 192 h
(Table 2, Fig. 3). The LC5s value was 6.8 x 105
spores/mL and the LC9, was 2.2 x 108 spores/mL
under these laboratory conditions.
Pilot Field Trials
During the first trial, the RH was approxi-
mately 42% on the day the sprays were applied,
although RH increased later and averaged 60-
70% (data not shown). Temperature averages
ranged from approximately 12-15C; only 2 rains
occurred during the trial. The mean number of
psyllid nymphs was not significantly different on
the shoots prior to treatment with water or Ifr
Ica
l. .,,ep , . .
so p/
t IU 'pommH.L / :
4- t Ilpo '.L /, -
7, ,
a
I
I.
1 O -o a a o 4O
Log time (h)
S Fig. 2. Time-response curves for adults of D. citri to
S a 9 10 2 concentrations of Ifr AsCP at 28 + 1 C, 16L:8D photo-
period and -100% RH. The lines were generated by
P during 10 trans- Polo-Plus; the individual points indicate the actual mor-
tality caused by the 5 replicates for each concentration.
March 2010
Hoy et al.: Novel Isolate of Isaria fumosorosea
TABLE 1. COMPARISON OF TIME TO DEATH (LT) OF ADULT
D. CITRI FROM 2 CONCENTRATIONS OF IFR
ASCP TESTED AT 28 + 1C, UNDER 16L:8D
PHOTOPERIOD AND 100% RH.
Lethal Time (h) (95% fiducial limits) for
1 x 107 spores/mL 1 x 10' spores/mL
LT,1 88.5 (83.9 to 92.3) 76.5 (71.8 to 80.5)
LT,, 111.0 (107.8 to 114.2) 102.5 (99.0 to 106.0)
LT,9 139.2 (134.1 to 145.7) 137.5 (131.8 to 144.7)
LT95 148.4 (142.2 to 156.8) 149.4 (142.2 to 158.9)
LT,, 167.4 (158.3 to 180.2) 174.6 (163.7 to 189.6)
Slope 13.0 0.98 10.1 0.7
AsCP (F = 0.60, df = 1, P = 0.45) or immediately
after the sprays were applied (data not shown).
The number of nymphs/shoot on the trees treated
with water averaged 14.5 and 12.9 immediately
before and after treatment, respectively, which
was not significantly different (F = 0.10, df= 1, P
= 0.75).
After holding the immediate post-spray sam-
ple shoots for 5 d, no fungal infection was ob-
served on any of the dead nymphs or adults, but
this could have been due to the low RH in the field
at the time of the spray application resulting in
low infection rates, or to the low RH in the bags,
which were secured with twist ties. All dead
nymphs appeared to have starved and dried out,
perhaps because the leaves had fallen off the ten-
der young shoots so that adequate food was not
available. In most samples, a large proportion (up
to 100%) of nymphs and/or adults were missing
from the bags, which had been closed with wire
twist ties. We concluded that these small insects
escaped through small openings where the bags
were secured.
One week after the sprays were applied, there
were significantly fewer psyllid nymphs (F = 5.13,
df = 1, P = 0.03) on the foliaged treated with Ifr
AsCP (data not shown), but 2 weeks after sprays
were applied, there were no differences in the
TABLE 2. CONCENTRATION-MORTALITY DATA AFTER 192
H FOR IFR ASCP APPLIED TO ADULTS OF D.
CITRI AT 28 1C, UNDER 16L:8D PHOTOPE-
RIOD AND -100% RH.
Lethal concentration (spores/mL)
(95% fiducial limits)
LC,, 2.8 x 104 (5.8 x 103 to 7.5 x 104)
LC,, 6.8 x 105 (3.1 x 105 to 1.6 x 106)
LC,, 4.1 x 107 (1.2 x 107 to 3.3 x 108)
LC,, 2.2 x 108 (0.5 x 108 to 3.6 x 109)
Slope 0.92 0.07
Spore concentration (sporeslmL)
Fig. 3. Concentration-mortality curve for adults
treated with Ifr AsCP after 192 h at 28 + 1C, under a
16L:8D photoperiod and -100% RH. The line was gen-
erated by Polo-Plus and the 5 means for each concenta-
tion are represented by the individual symbols, some of
which are on top of each other.
mean number of psyllid nymphs/shoot in the 2
treatments (F = 0.39, df = 1, P = 0.54). The num-
ber of nymphs was reduced in both, probably be-
cause the shoots had matured and predation had
eliminated some of the nymphs.
Prior to spraying the trees, shoot lengths in the
Ifr AsCP- and water-treated trees were signifi-
cantly different (F = 12.04, df= 1, P = 0.002), with
an average length of 3.5 cm in the trees to be
treated with water and 2.2 cm in the trees to be
treated with Ifr AsCP However, immediately af-
ter the sprays were applied, samples were taken
again and there were no significant differences (F
= 0.15, df= 1, P = 0.71) in shoot length (2.2 and 2.1
cm, respectively), for the water- and Ifr AsCP-
treated trees. One week after the sprays were ap-
plied, mean shoot length in the trees treated with
Ifr AsCP averaged 7.9 cm, while the shoots in the
water-treated trees averaged 4.6 cm, a significant
difference (F = 17.54, df = 1, P = 0.0004). Two
weeks after treatment, shoots from the Ifr AsCP-
treated trees again were significantly longer than
on the water-treated trees (F = 7.78, df = 1, P =
0.01). Thus, application of Ifr AsCP appeared to
result in increased shoot lengths for 2 weeks after
treatment, which could have been due to the re-
duced number of psyllids on the shoots. Unfortu-
nately, because we could not confirm infection of
nymphs with Ifr AsCP in the plastic bags, the re-
ductions in the psyllid densities during the course
of the experiment could be attributed to one or
more factors, including the effects of Ifr AsCP, the
production of adults that left the shoots, and pre-
dation on nymphs in both control and treatment
trees by lady beetles, which were abundant in the
block.
Florida Entomologist 93(1)
The data suggest the fungal spray reduced the
number of psyllid nymphs, but the problems in
containing the nymphs in the sample bags and
confirming that the psyllids were infected with
the fungus indicated that our evaluation methods
were inadequate. It should be noted that Ifr-
AsCP-infected nymphs and adults were not ob-
served in the block while sampling, perhaps be-
cause psyllids killed by this fungus do not adhere
strongly to leaf surfaces (Meyer 2007; Meyer et al.
2008).
A second spray application was conducted on
Aug 9, when the RH averaged ca. 67%. Over the
course of this second trial, RH varied but aver-
aged 70-80%. Five rains occurred during the trial
and temperature averages ranged from 27-30'C.
During this experiment, the shoot lengths of the
trees in the 2 treatments did not differ signifi-
cantly, except during week 3, when the shoots on
the Ifr AsCP-treated trees were significantly
longer (F = 5.29, df = 1, P = 0.02).
The mean number of psyllid nymphs on the
trees prior to treatment and immediately after
treatment were significantly different (F = 4.81,
df = 1, P = 0.04; F = 4.54, df = 1, P = 0.04, respec-
tively), with more psyllid nymphs on the trees
treated with water. Reasons for the pre-treatment
differences are unknown. One week after treat-
ment, there were no differences in nymphal psyl-
lid densities between the 2 treatments (F = 0.01,
df = 1, P = 0.90), but during the following week,
there were fewer (F = 5.40, df= 1, P = 0.02) psyllid
nymphs/shoot in the Ifr AsCP-treated trees (mean
= 0.08) compared to the water-treated trees (mean
= 0.45). By the third week after sprays were ap-
plied, there were no significant differences in
nymphal psyllid densities, and densities were
very low (mean = 0.03 and 0 for the water- and Ifr
AsCP-treated trees, respectively). Thus, it was
difficult to determine if nymphal psyllid densities
declined due to treatment with Ifr AsCP based on
the counts.
However, a total of 437 nymphs from the trees
treated with Ifr AsCP that were held in the zip-
lock plastic bags in the laboratory to determine if
they were infected with Ifr AsCP showed sub-
stantial levels of infection under laboratory con-
ditions. At least 327 (75%) were visibly infected
with a fungus that was morphologically similar
to Ifr AsCP To confirm that the fungus was Ifr
AsCP, Meyer (2007) tested 9 randomly selected
nymphs with Ifr AsCP-specific PCR primers and
all were positive, indicating that Ifr AsCP had
persisted in the plot for 3 weeks and had killed
the majority of these psyllid nymphs. A total of
731 psyllid nymphs from the trees treated with
water were held under the same conditions and
692 were recovered, with only 39 missing from
the bags. Of the 692 nymphs recovered, 28 were
dead but these were not infected with a fungus.
Thus, the zip-lock plastic bags were well suited
to containing the psyllid nymphs and the RH
was sufficient that visible symptoms could be ob-
served; fewer than 2% of the nymphs on shoots
placed on the bags were missing when scored for
infection. This suggests that the fungus did kill
psyllid nymphs in the block, but that mortality
from other natural enemies (especially predators
such as coccinellids, which were abundant in the
block) reduced psyllid densities in the water-
treated trees.
CONCLUSIONS
The potential advantages of developing Ifr
AsCP as a microbial pesticide could include the
reduced use of synthetic organic pesticides in cit-
rus, to which D. citri could become resistant. Use
of this microbial pesticide might reduce disrup-
tion of numerous natural enemies in Florida's cit-
rus through the use of synthetic pesticides, thus
reducing the costs of additional control measures,
although it remains to be determined whether
this microbial product could disrupt the natural
enemies, as well.
Potential negative aspects of Ifr AsCP as a mi-
crobial pesticide are likely to be its susceptibility
to copper, which currently is being applied multi-
ple times a year (up to 8) to control citrus canker
(Xanthomonas axonopodis pv. citri (Hasse) Vaut.)
(Timmer et al. 2006). However, if other selective
canker control products are found, this hurdle
might be overcome. Although other strains of Ifr
(= Pfr) have been used successfully against other
pests, the use of fungal microbial pesticides in
IPM programs remains rare (Lacey et al. 2001;
Montesinos 2003).
Alternatively, this pathogen may be an impor-
tant naturally occurring mortality factor of D.
citri in Florida's citrus groves, especially during
periods of high RH, although the pathogen ap-
pears difficult to detect. Only a very few speci-
mens of mycosed adult psyllids were discovered
by Meyer (2007), and no infected nymphs were
seen in his surveys. In these 2 pilot tests, no ca-
davers of nymphs or adults were seen in the field
or on freshly collected foliage, perhaps because
this pathogen does not cause infected psyllids to
'stick' to the leaf surface. Furthermore, we only
saw mycosed nymphs when foliage was returned
to the laboratory and held in tightly closed plastic
bags for 3 d under high RH; evaluations on the
day of collection using a dissecting microscope
failed to indicate any psyllid nymphs were in-
fected. Thus, unless someone is sampling and
holding nymphs and adults under conditions de-
signed specifically to detect this pathogen, they
might not discover Ifr AsCP as a mortality factor
in Florida's psyllid populations. Additional field
studies should be conducted to resolve the role of
this pathogen in regulating D. citri populations in
Florida's citrus groves throughout the year.
March 2010
Hoy et al.: Novel Isolate of Isaria fumosorosea
ACKNOWLEDGMENTS
We thank Harry Anderson and Michael Simms for
assistance with the field trials and Jason M. Meyer and
Drion G. Boucias, Department of Entomology and Nem-
atology, University of Florida, Gainesville for informa-
tion and advice on the project and comments on an
earlier version of the manuscript. Dr. Jarrod Leland,
USDA-ARS, SIMRU, Stoneville MS, provided spores for
the second field trial. This research was funded in part
by the Davies, Fischer and Eckes Endowment in biolog-
ical control to M. A. Hoy.
REFERENCES CITED
BOUFFARD, K. 2006. Greening found in 10 counties. Cit-
rus Industry 87(1): 5-26.
BROWNING, H. W. 1990. Pests of citrus, pp. 101-110 In D.
H. Habeck, F. D. Bennett, and J. H. Frank, J. H.
[eds.], Classical Biological Control in the Southeast-
ern United States. South. Coop. Ser. Bull. No. 355.
Inst. Food Agric. Sci., Univ. Florida, Gainesville.
BROWNING. H. W., CHILDERS, C. C., STANSLY, P. A.,
PENA, J., AND ROGERS, M. E. 2006. Florida citrus
pest management guide: soft-bodied insects attack-
ing foliage and fruit: University of Florida IFAS Ex-
tension. http://edis.ifas.ufl.edu/BODY_CG004.
CHASE, A. R., OSBORNE, L. S., AND FERGUSON, V. M.
1986. Selective isolation of the entomopathogenic
fungi Beauveria bassiana and Metarhizium
anisopliae from an artificial potting medium. Flori-
da Entomol. 69: 285-292.
Cocco, A., AND HOY, M. A. 2008. Toxicity or organosili-
cone adjuvants and selected pesticides to the Asian
citrus psyllid (Hemiptera: Psyllidae) and its parasi-
toid Tamarixia radiata (Hymenoptera: Eulophidae).
Florida Entomol. 91: 610-620.
DA GRAQA, J. V. 1991. Citrus greening disease. Annu.
Rev. Phytopathol. 19: 109-136.
DHINGRA, O. D., AND SINCLAIR, J. B. 1995. Basic Plant
Pathology Methods. Lewis Publ., Boca Raton, 434
pp.
GARNIER, M., JAGOUEIX, E. S., CRONJE, P. R., LE ROUX,
H. F., AND BOVE, J. M. 2000. Genomic characteriza-
tion of a Liberibacter present in an ornamental ruta-
ceous tree, Calodendrum capense, in the Western
Cape province of South Africa. Proposal of'Candida-
tus Liberibacter africanus subsp. capensis'. Int. J.
System. Evol. Microbiol. 50: 2119-2125.
HALBERT, S. E. 2005. Pest Alert: Citrus Greening/Hua-
nglongbing. http://www.doacs.state.fl.us/pi/chrp/
greening/citrusgreeningalert.html.
HALBERT, S. E., AND MANJUNATH, K. L. 2004. Asian cit-
rus psyllids (Sternorrhyncha: Psyllidae) and greening
disease of citrus: a literature review and assessment
of risk in Florida. Florida Entomol. 87: 330-353.
HALBERT, S. E., SUN, X., AND DIXON, W. N. 2000. Asian
citrus psyllid and citrus greening disease. Citrus In-
dustry 91(5): 22-24.
HoY, M. A. 2000. The David Rosen lecture: biological
control in citrus. Crop Protection 10(8-10): 657-664.
HoY, M. A., AND NGUYEN, R. 2000. Classical biological
control of Asian citrus psylla. Citrus Industry 81(12):
48-50.
HoY, M. A., NGUYEN, R., AND JEYAPRAKASH, A. 1999.
Classical biological control of Asian citrus psylla.
Citrus Industry 80(9): 20-22.
HoY, M. A., JEYAPRAKASH, A., AND NGUYEN, R. 2001.
Long PCR is a sensitive method for detecting
Liberobacter asiaticum in parasitoids undergoing
risk assessment in quarantine. Biol. Control 22:
278-287.
LACEY, L. A., FRUTOS, R., KAYA, H. K., AND VAIL, P.
2001. Insect pathogens as biological control agents:
do they have a future? Biol. Control 21: 230-248.
LE ORA SOFTWARE. 2002-2003. PoloPlus: Probit and
Logit Analysis. Berkeley, CA.
McCOY, C. W. 1985. Citrus: current status of biological
control in Florida, pp. 481-499 In M. A. Hoy and D. C.
Herzog [eds.], Biological Control in Agricultural IPM
Systems, Academic Press, Orlando.
MEYER, J. M. 2007. Microbial associates of the Asian cit-
rus psyllid and its two parasitoids: symbionts and
pathogens. Ph.D. Dissertation, University of Flori-
da, Gainesville, 145 pp.
MEYER, J. M., HOY, M. A., AND BOUCIAS, D. G. 2007.
Morphological and molecular characterization of a
Hirsutella species infecting the Asian citrus psyllid,
Diaphorina citri Kuwayama (Hemiptera: Psyllidae)
in Florida. J. Invertebr. Pathol. 95: 101-109.
MEYER, J. M., HOY, M. A., AND BOUCIAS, D. G. 2008. Iso-
lation and characterization of an Isaria fumosorosea
isolate infecting the Asian citrus psyllid in Florida.
J. Invertr. Pathol. 99: 96-102.
MICHAUD, J. P. 2004. Natural mortality of Asian citrus
psyllid (Homoptera: Psyllidae) in central Florida. Bi-
ol. Control 29: 260-269.
MONTESINOS, E. 2003. Development, registration and
commercialization of microbial pesticides for plant
protection. Intl. Microbiol. 6: 245-252.
PADRICK, R. C. 2006. Overt optimism. Florida Grower
99(12): 6-7.
QURESHI, J. A., ROGERS, M. E., HALL, D. G., AND STANS-
LEY, P. A. 2009. Incidence of invasive Asian citrus
psyllid, Diaphorina citri (Hemiptera: Psyllidae) and
its introduced parasitoid Tamarixia radiata (Hy-
menoptera: Eulophidae) in Florida citrus. J. Econ.
Entomol. 102: 247-256.
RAE, D. J., LIANG, W. G., WATSON, D. M., BEATTIE, G. A.
C., AND HUANG, M. D. 1997. Evaluation of petroleum
spray oils for control for the Asian citrus psylla, Dia-
phorina citri (Kuwayama) (Hemiptera: Psyllidae), in
China. Intl. J. Pest Manag. 43: 71-75.
ROGERS, M. E., AND STELINSKI, L. L. 2009. Development
of new tools and recommendations for psyllid man-
agement programs. Citrus Industry 90(1): 8-10.
SAS INSTITUTE. 1999. SAS version 9.1, Cary, NC, USA.
SKELLEY, L. H., AND HOY, M. A. 2004. A synchronous
rearing method for the Asian citrus psyllid and its
parasitoids in quarantine. Biol. Control 29: 14-23.
SRINIVASAN, R., HOY, M. A., SINGH, R., AND ROGERS, M.
E. 2008. Laboratory and field evaluations of Silwet
L-77 and Kinetic alone and in combination with im-
idacloprid and abamectin for the management of
the Asian citrus psyllid, Diaphorina citri Kuwaya-
ma (Hemiptera: Psyllidae). Florida Entomol. 91:
77-100.
STANSLY, P. A., AND ROGERS, M. E. 2006. Managing
Asian citrus psyllid populations. Citrus Industry
87(3): 17-19.
SUBANDIYAH, S., NIKOH, N., SATO, H., WAGIMAN, F.,
TSYUYMYU, S., AND FUKATSU, T. 2000. Isolation and
characterization of two entomopathogenic fungi at-
tacking Diaphorina citri (Homoptera, Psylloidea) in
Indonesia. Mycoscience 41: 509-513.
32 Florida Ento
TIMMER, L. W., CRAHAM, J. H., AND CHAMBERLAIN, H. L.
2006. Fundamentals of citrus canker management.
Citrus Industry 87(6): 12-15.
VANDENBERG, J. D., AND CANTONE, F. A. 2004. Effect of
serial transfer of three strains of Paecilomyces fu-
mosoroseus on growth in vitro, virulence, and host
specificity. J. Invert. Pathol. 85: 40-45.
m
ologist 93(1) March 2010
VIDAL, C., OSBORNE, L. S., LACEY, L. A., AND FARGUES,
J. 1998. Effect of host plant on the potential ofPaecil-
omyces fumosoroseus (Deuteromycotina: Hypo-
mycetes) for controlling the silverleafwhitefly, Bemi-
sia argentifolii (Homoptera: Aleyrodidae), in
greenhouses. Biol. Control 12: 191-199.
Halbert et al: Movement of Citrus Psyllids
TRAILERS TRANSPORTING ORANGES TO
PROCESSING PLANTS MOVE ASIAN CITRUS PSYLLIDS
SUSAN E. HALBERT1, KEREMANE L. MANJUNATH2, CHANDRIKA RAMADUGU2, MATTHEW W. BRODIE3, SUSAN E. WEBB4
AND RICHARD F. LEE2
'Division of Plant Industry, Florida Department of Agriculture and Consumer Services, P.O. Box 147100,
Gainesville, FL 32614-7100
2United States Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository
for Citrus and Dates, Riverside, CA 92507
3Division of Plant Industry, Florida Department of Agriculture and Consumer Services, Plant Inspection,
Naples, FL
4University of Florida, Department of Entomology and Nematology, Gainesville, FL
ABSTRACT
Huanglongbing (citrus greening) is one of the most serious diseases of citrus. Movement of
the disease occurs as a result of natural transmission by the insect vector and by movement
of infected plant material. We demonstrate here that Diaphorina citri Kuwayama, the vector
of citrus greening pathogens, can be transported in trailers of unprocessed fruit. Several
samples ofD. citri collected from trailers of oranges were positive for citrus greening patho-
gens, indicating that the disease can spread widely with the movement of the mature fruit
as a result of moving the vectors. While movement of disease and the vector through plant
materials into new areas has been recognized, our findings emphasize the need to evaluate
the importance of long distance movement of psyllids on unprocessed fruit, even in the ab-
sence of vegetative tissue.
Key Words: Diaphorina citri Kuwayama, Asian citrus psyllid, citrus greening disease, hua-
nglongbing, Citrus, fruit movement
RESUME
La "Huanglongbing" (enverdecimiento de los citricos) es una de las enfermedades mas s6rias
de los citricos. El movimiento de la enfermedad sucede como resultado de la transmission
natural por el insect vector y por el movimiento de material de plants infectadas. Demons-
tramos que Diaphorina citri Kuwayama, un vector de los pat6genos del enverdecimiento de
los citricos, puede ser transportado en remolques con frutas no procesadas. Varias muestras
de D. citri recolectadas de remolques de naranjas resultaron positivas para los pat6genos del
enverdecimiento de los citricos, lo cual indica que la enfermedad puede esparcirce amplia-
mente con el movimiento de frutas maduras como resultado del traslado de los vectores.
Mientras que el movimiento de la enfermedad y el vector por medio del movimiento de ma-
terial de plants en nuevas areas ha sido reconocido, nuestros hallazgos enfatizan la nece-
sidad de evaluar la importancia del movimiento del silido por largas distancias sobre frutas
no procesadas, aun en la ausencia de tejido vegetative.
Huanglongbing (citrus greening disease), asso-
ciated with phloem-limited bacteria in the genus
Candidates Liberibacter, is one of the most im-
portant citrus diseases worldwide, causing signif-
icant economic losses to global citriculture (Bove
2006; Gottwald et al. 2007). Natural spread of the
disease is primarily by the psyllid vectors Diapho-
rina citri Kuwayama (Asian citrus psyllid) and
Trioza erytreae (del Guercio) (African citrus psyl-
lid). The disease also can be transmitted by graft-
ing, dodder (a parasitic plant), and possibly by
seed (Halbert & Manjunath 2004). Diaphorina
citri was reported for the first time in the United
States in Florida in 1998 (Halbert et al. 2002),
and the disease was found to be established in
Florida in Aug 2005 (Halbert 2005; Bove 2006).
In the United States, there are 4 major com-
mercial citrus growing states: Florida, Texas, Ar-
izona, and California. Diaphorina citri was re-
ported in Texas in 2001 (French et al. 2001). Dia-
phorina citri was detected for the first time in Cal-
ifornia in San Diego County near the border with
Mexico on 27-VIII-2008 by California Depart-
ment of Food and Agriculture (CDFA) Agricul-
tural Technician Rosalio Peia and CDFA Agricul-
tural Pest Control Specialist Dan Arena. It was
identified by CDFA Systematic Entomologist Dr.
Alessandra Rung on 29-VIII-2008 (Brian Taylor,
Florida Entomologist 93(1)
personal communication; CDFA 2008). Diapho-
rina citri nymphs positive for citrus greening
pathogens were intercepted in baggage from In-
dia at a FedEx facility in Fresno in Jul 2009
(CDFA 2009). The insects were feeding on curry
leaves (Bergera koenigii L.) that were detected by
a sniff dog. Other than this interception, no citrus
greening has been detected in California. To date,
no citrus greening or citrus psyllids have been de-
tected in Arizona. Both D. citri and citrus green-
ing disease were reported from Louisiana in Jun
2008 (Hummel & Ferrin 2008). In Apr 2009, cit-
rus greening was recorded in South Carolina
(Harden & Kent 2009), and in Jun 2009, the dis-
ease was reported in Georgia (Gomes 2009). To
date, in the United States, only Florida, Louisi-
ana, South Carolina, and Georgia are known to
have the citrus greening pathogens established,
but isolated infected plants smuggled from other
places may remain undetected until vectors
spread the pathogens. So far, Ca. Liberibacter asi-
aticus (LAS) is the only species of citrus greening
pathogen known to occur in the USA.
Movement of the psyllid vectors infected with
LAS has been shown to occur on plants marketed
by garden stores and nurseries in Florida (Manju-
nath et al. 2008). Spread of the insect vector and
the associated disease also occurs through trans-
portation of potted citrus plants by the general
public (unpublished observations, Susan Hal-
bert).
Florida Department of Agriculture and Con-
sumer Services Division of Plant Industry (DPI)
plant inspection supervisor Kenneth L. Hibbard
intercepted numerous D. citri adults in boxes of
unprocessed fruit shipped from the Bahamas to
Ft. Pierce, Florida, for processing in 2001 (Halbert
& Nifiez 2004). At that time, DPI assisted in in-
spections of citrus fruit arriving from Bahamian
groves. The objective of the present study was to
determine whether Asian citrus psyllids were
moving on shipments of unprocessed fruit within
the state of Florida, and if so, whether the psyllids
were infected with citrus greening pathogens.
MATERIALS AND METHODS
Seven loaded trailers of oranges were in-
spected at 2 processing plants in Hendry County,
Florida on 27-III-2006 (Fig. 1). Typically, oranges
are picked and loaded into trailers for transport to
processing facilities that extract orange juice.
Processing plants may obtain fruit from a wide
area depending on contracts and market factors.
We chose trailers with sides made from metal
webbing (as opposed to solid sides) so that both
the sides and the tops of the loads could be in-
spected. Any D. citri found on the oranges were
hand collected with aspirators. They were
counted and preserved in Gainesville and sent to
USDA, Riverside, CA, where they were tested by
quantitative realtime PCR assays to determine if
they were carrying LAS.
Most psyllids were tested in aliquots of 2-6 in-
sects per extraction; however, there were 2 extrac-
tions with 50 psyllids per extraction. DNA was ex-
tracted from psyllids according to the procedure de-
scribed in Manjunath et al. (2008), with some mod-
ifications, and tested for the presence of LAS.
Briefly, the psyllids were air-dried for 10 min, trans-
Fig. 1. Trailers of field-picked oranges at an orange juice processing plant in Florida.
March 2010
Halbert et al: Movement of Citrus Psyllids
ferred to a 1.5-mL microfuge tube containing 300 pL
of extraction buffer (10 mM Tris, pH 8.0, 100 mM
NaCl, 1 mM EDTA, 2% SDS) and 20 units of Pro-
teinase K (New England Biolabs), and ground finely
in a mini bead beater (Biospec Inc.) in the presence
of 1 zinc-plated ultra smooth bead (Daisy products,
#631). The samples were homogenized with the
bead beater at maximum speed for five min. After
brief centrifugation, the samples were incubated ei-
ther at 50'C for 3 h or overnight at 37C. The nucleic
acids were extracted with 300 pL of phenol chloro-
form-isoamyl alcohol (25:24:1), followed by a second
extraction with 300 pL of chloroform-isoamyl alco-
hol (24:1). The aqueous phase was ethanol precipi-
tated, and the resulting DNA pellet was dissolved in
20-50 pL of sterile water and stored at -20'C.
A TaqMan-based real time PCR assay was used
for the detection of Ca. L. asiaticus in psyllids as
described by Manjunath at al. (2008). A hexachlo-
rofluorescein (HEX) labeled probe was used in
combination with forward and reverse primers to
amplify a fragment of the wingless gene (GenBank
accession number AF231365) from the genome of
D. citri. This served as an internal control to en-
sure extraction of good quality insect DNA. Prim-
ers and probes used to amplify the HLB associated
bacterium, LAS, have been described by Li et al.
(2006). Samples with a cycle threshold (ct) value of
30 and below for the bacterial probe were consid-
ered as positive for LAS. A ct value of 31-34 was
counted as "suspect" sample and a ct value of 35
and above indicated absence of LAS.
RESULTS
Live adult D. citri were found in all 7 trailers.
In total, 509 psyllids were collected from the 7
trailers. Collections per trailer ranged from 23 to
268 individuals. Live psyllids could be found both
on the sides and on the tops of all loads, and up to
30 cm below the surface of the oranges, probably
indicating that the insects were distributed
throughout the loads. The psyllids were observed
to be resting on the fruit itself rather than on the
minimal amount of foliage that was present in the
loads.
A total of 116 extractions were done with vary-
ing numbers of psyllids (2 to 50) per extraction.
Four extractions, obtained from 3 different loads,
were clearly positive for citrus greening pathogens
(ct values of up to 30). Two aliquots of 6 insects, 1
aliquot of 3 insects, and 1 aliquot of 50 insects
tested positive for LAS. Another set of 9 extrac-
tions were considered suspects, with ct values for
the bacterial probe ranging from 31 to 34. LAS-
positive psyllids were found in loads from both pro-
cessing plants (Table 1). One hundred and three
extractions were negative (ct values >34).
DISCUSSIoN
Our results indicate that Asian citrus psyllids
can be transported with harvested citrus fruit.
Furthermore, some D. citri found in loads of or-
anges tested positive for citrus greening patho-
gens. One of the LAS-positive loads was traced to
a block where citrus greening disease was con-
firmed later. This block was inspected in Jan
2007, but the trees were asymptomatic at that
time. By Aug 2007, however, the grower had
found citrus greening in that block. This particu-
lar block was among the first in the large grove to
manifest symptoms of citrus greening. Symptoms
in the block of mature orange trees were discov-
TABLE 1. NUMBERS OF DIAPHORINA CITRI KUWAYAMA COLLECTED FROM TRAILERS OF ORANGES AT 2 CITRUS JUICE
PROCESSING PLANTS (A AND B) IN HENDRY COUNTY AND QUANTITATIVE REALTIME PCR TEST RESULTS FOR
CITRUS GREENING PATHOGENS; MAR 2006.
Processing Number of Number of Number of Number of Number of Number of
Plant- psyllids extractions insects extractions extractions extractions
trailer No.' collected tested per extraction positive2 suspect2 negative2
A-1 23 5 4-5 0 0 5
A-2 55 1 50 0 0 1
A-2 continued (same) 1 5 0 0 1
A-3 31 7 4-5 0 1 6
A-4 41 7 5-6 1 0 6
B-1 47 8 5-6 1 0 7
B-2 268 1 50 1 0 0
B-2 continued (same) 71 3-5 1 5 65
B-3 44 15 2-3 0 3 12
Seven collections were made from the 2 processing plants, A and B. A-1 through A-4 represent 4 trailers, and B-1 through
B-3 represent 3 trailers.
'Samples with cycle threshold (CT) values 30 were considered positive, and samples with CT values of 31-34 were considered
suspect. Samples with CT values >34 were considered negative.
Florida Entomologist 93(1)
ered more than 1 year after positive psyllids were
found on oranges picked from that block (Manju-
nath et al. 2008).
The known distributions of Asian citrus psyllid
and citrus greening are growing. The psyllid has
been found recently in southern parts of Califor-
nia where both quarantine and vector suppres-
sion programs are underway (CDFA 2008, 2009).
To date, no samples collected from the outdoor en-
vironment in California have tested positive for
LAS. Texas has 32 counties with sporadic psyllid
populations but none with recorded citrus green-
ing. Florida has 32 counties with reported citrus
greening in the landscape and several more with
finds in retail venues. Diaphorina citri is estab-
lished throughout the Florida peninsula, and
there are records from retail venues ofD. citri and
citrus greening in several counties in the Florida
panhandle. Diaphorina citri also is widespread in
the Caribbean. Citrus greening has been reported
in Cuba (Albrigo 2008), the Dominican Republic
(Garrido Jansen 2008), Belize (Manjunath et al.,
in press 2010), and Mexico (Anonymous 2009).
The status of many other localities in the Carib-
bean Basin with respect to citrus greening dis-
ease is not known.
In order to minimize the accidental introduc-
tion of greening into the greening-free states of
Arizona, Texas, and California, it is important to
consider all possible pathways of entry for the
pathogen and the vector. Recently, USDA APHIS
(Animal and Plant Health Inspection Service) is-
sued federal orders to restrict movement of citrus
and other related plants from Florida (O'Dell &
Harless 2008). However, there are other possible
sources of introduction for both D. citri and citrus
greening pathogens. An effective regulatory pro-
gram designed to protect the US citrus industry
against D. citri and citrus greening must ensure
that all possible means of entry for the pathogens
are restricted. There is a considerable amount of
citrus fruit imported from other citrus growing
areas of the world. The United States imports cit-
rus fruit from Mexico and the Bahamas, both of
which have reported the presence ofD. citri (Hal-
bert & Niunez 2004), and Mexico also has reported
citrus greening (Anonymous 2009). Interceptions
made by the USDA at the border indicate that D.
citri has been present in Mexico since 1996 (Hal-
bert & Niunez 2004). Our results and Ken Hib-
bard's discovery of psyllids on Bahamian fruit ar-
riving in Fort Pierce indicate that there is a risk of
importing live D. citri on shipments of bulk fruit
from outside the United States. Additionally, if
citrus greening becomes established widely in
Mexico, there is a risk that the pathogen could be
transported inadvertently with imported unproc-
essed fruit.
USDA records indicate that in Fiscal Year (FY)
2007 (the Federal Fiscal Year runs from Oct 1-Sep
30), there were 38 loads of citrus (13,812,970 kg)
shipped from the Bahamas to the USA (all desti-
nations). In FY 2008, there were 28 loads
(23,852,814 kg). In the past, Bahamian fruit was
imported into Fort Pierce, FL unprocessed and in-
fested with psyllids, presumably from the Baha-
mas (Halbert & Manjunath 2004; Halbert &
Nuniez 2004). More recently, it has not been possi-
ble for DPI to obtain permission to sample this
fruit for psyllids because the Department of
Homeland Security, rather than the USDA, per-
forms the inspections.
The situation regarding import of fruit from
Mexico is much more complex (Table 2). There is no
interception record for D. citri on fruit from Mexico,
but the thoroughness of fruit inspections is not
known. For Fiscal Years 2007 and 2008, 140 citrus
fruit shipments were rejected for various reasons
such as transporting prohibited product, contami-
nation, presence of pests, etc. Eighty-six of the re-
jected or destroyed shipments were refused be-
cause of the use of non-compliant wood packing ma-
terial. Another 534 shipments were transit ship-
ments received and exported to another country.
TABLE 2. DISPOSITION OF CITRUS FRUIT RECEIVED FROM MEXICO IN FISCAL YEARS 2007 AND 2008.
FY 20071 FY 2008
Number Number
Disposition Kilograms of shipments Kilograms of shipments
Rejected or returned 1,192,974 83 929,497 57
Action taken (problem fixed), released 32,218 2 0 0
Regular inspection, release 41,767,409 5,830 28,071,138 4,126
NARP2, inspected 13,397,325 936 15,348,053 892
NARP, released (no inspection) 310,286,481 16,985 362,945,935 20,015
Shipped to another country transitt only in the USA) 2,345,766 315 1,237,570 219
Total 369,022,173 24,151 408,532,193 25,309
'Federal Fiscal Year (FY) runs from Oct 1 through Sep 30.
National Agricultural Release Program.
March 2010
Halbert et al: Movement of Citrus Psyllids
A total of 48,786 Mexican citrus fruit ship-
ments remained in the USA. Of these, 9,956 ship-
ments received regular inspections, 2 more were
allowed after a paperwork discrepancy was re-
solved, and 38,828 shipments were admitted un-
der the NARP (National Agricultural Release
Program). Of the NARP shipments, 37,000 of
them apparently were not inspected. This
amounts to about 95% of total shipments and just
over 96% of the total by weight.
It is not clear from the data if the Mexican cit-
rus fruit shipments consisted of unprocessed
field picked fruit (as was the case with the fruit
arriving from the Bahamas in 2001), or whether
the fruit was washed, waxed, and ready for sale.
Some citrus fruit requires treatment for fruit
flies, and other shipments come in refrigerated
containers. Both treatments should eliminate
most D. citri. Probably even minimal processing,
such as washing, would eliminate the risk of
psyllids on the fruit, but this requires further
study.
Regulations are subject to change. The records
cited above represent a snapshot in time. A flier
created in Mar 2007 by the USDA/APHIS indi-
cates that the rate of inspection for bulk citrus at
that time was 10%. In 2008, a memorandum from
the USDA requested that all citrus fruit being ex-
ported from Mexico to the USA be sent through
packinghouse cleaning procedures prior to ship-
ping in order to mitigate risk of disseminating D.
citri. The new procedure took effect on Feb 1,
2008. Our results underscore the importance of
re-evaluating regulations based on new informa-
tion.
Dead D. citri were found on the top surface of
some loads that we inspected in the present study.
In Florida, fruit trailers must pass through citrus
canker decontamination spray loops as they leave
the grove where the fruit was picked. It is possible
that these decontamination sprays killed some of
the insects on the tops of the loads, but live D. citri
could be found below the surface layer of oranges.
Further investigations are needed to determine
whether treatments, covering trailers during
transport, or other measures, would best prevent
movement of D. citri with loads of unprocessed
citrus fruit.
ACKNOWLEDGMENTS
We thank the 2 citrus processing plants for access to
loads (not named in order to preserve confidentiality of
data). We thank Patrick J. Gomes, Sherry A. Anderson,
and Robert J. English, USDA/APHIS, and Dr. Wayne N.
Dixon, FDACS/DPI, for assisting us in obtaining the
USDA/APHIS data on shipments of citrus fruit. We
thank Walter Golden, Selina Estrada, Mark Terrell, and
Harvey A.'Rusty' Noah for help with collecting the sam-
ples, David Ziesk and Charlotte Campana for sample
processing help in Gainesville, and Ngoc Nguyen for
help with psyllid DNA extractions in Riverside. This is
Entomology Contribution No. 1143, Florida Depart-
ment of Agriculture and Consumer Services, Division of
Plant Industry, Bureau of Entomology, Nematology, and
Plant Pathology.
LITERATURE CITED
ALBRIGO, G. 2008. Huanglongbing found in Cuba. Cit-
rus Industry Update, March/April 2008. Citrus Re-
search & Education Center, University of Florida In-
stitute of Food and Agricultural Sciences, Lake
Alfred, FL. Page 2.
ANONYMOUS. 2009. Detection of Huanglongbing (Can-
didatus Liberibacter asiaticus) in the municipality
of Tizimin, Yucatan, Mexico. NAPPO Phytosanitary
Alert System. [Internet]. [cited 9 October 2009]
Available at: http://www.pestalert.org/oprDe-
tail.cfm?oprID=384.
BovE, J. M. 2006. Huanglongbing: A destructive, newly-
emerging, century-old disease of citrus. J. Plant
Pathol. 88: 7-37.
CALIFORNIA DEPARTMENT OF FOOD AND AGRICULTURE.
2009. Survey for Asian citrus psyllids in Fresno to-
morrow. Release #09-058 [Internet] [cited 9 October
2009] Available at: http://www.cdfa.ca.gov/egov/
PressReleases/PressRelease.asp?PRnum=09-
058&.
CALIFORNIA DEPARTMENT OF FOOD AND AGRICULTURE.
2008. Single Asian citrus psyllid detected in San Di-
ego. Release #08-057. [Internet] [cited 9 October
2009] Available at: http://www.cdfa.ca.gov/egov/
PressReleases/PressRelease.asp?PRnum=08-
057&.
FRENCH, J. V., KAHLKE, C. J., AND DA GRAQA, J. V. 2001.
First record of the Asian citrus Psylla, Diaphorina
citri Kuwayama (Homoptera: Psyllidae), in Texas.
Subtropical Plant Science 53: 14-15.
GARRIDO JANSEN, L. R. 2008. Deteccion de la enfer-
medad huanglongbing de los citricos Candidatus
Liberibacter Asiaticus, in areas de Imbert 7 Luper-
on, Provincia de Puerto Plata, Republica Dominica-
na. IPPO Report DO-1/1. [Internet] [cited 9 October
2009] Available at: https://www.ippc.int/id/
209336?language=en.
GOMES, P. 2009. Confirmation of Citrus Greening in
Chatham County, Georgia-United States NAPPO
Phytosanitary Alert System. [Internet] [cited 9 Octo-
ber 2009] Available at: http://www.pestalert.org/opr-
Detail.cfm?oprID=382.
GOTTWALD, T. R., DA GRAQA, J. V., AND BASSANEZI, R. B.
2007. Citrus Huanglongbing: The pathogen and its
impact: Online. Plant Health Progress doi: 10.1094/
PHP-2007-0906-01-RV. Available (password re-
quired) at: http://www.plantmanagementnet-
work.org/sub/php/review/2007/huanglongbing/
HALBERT, S. E. 2005 (September). Citrus greening/Hua-
nglongbing. Pest Alert, Florida Department of Agri-
culture and Consumer Services, Division of Plant In-
dustry, Gainesville, Florida. [Internet] [cited 9
October 2009] Available at: (http://
www.doacs.state.fl.us/pi/chrp/greening/citrusgreen-
ingalert.html)
HALBERT, S. E., AND MANJUNATH, K. L. 2004. Asian cit-
rus psyllids (Sternorrhyncha: Psyllidae) and green-
ing disease of citrus: A literature review and assess-
ment of risk in Florida. Florida Entomol. 87: 330-
353.
38 Florida Ento
HALBERT, S. E., NIBLETT, C. L., MANJUNATH, K. L, LEE,
R. F., AND BROWN, L. G. 2002. Establishment of two
new vectors of citrus pathogens in Florida. Proc. Intl.
Soc. Citriculture IX Congress, ASHS Press, Alexan-
dria VA. pp. 1016-1017.
HALBERT, S. E., AND NiUNEZ, C. A. 2004. Distribution of
the Asian citrus psyllid, Diaphorina citri Kuwayama
(Rhynchota: Psyllidae) in the Caribbean basin. Flor-
ida Entomol. 87: 401-402.
HARDEN, C., AND KENT, P. 2009. Menacing citrus dis-
ease detected in South Carolina. Clemson Universi-
ty Newsroom, Public Service Activities, Citrus
greening disease. [Internet] [cited 9 October 2009]
Available at: http://www.clemson.edu/newsroom/ar-
ticles/2009/april/Citrus_disease.php5.
HUMMEL, N. A., AND FERRIN, D. 2008. Pest Alert. Get
the Facts about Citrus Greening (or Huanglong-
bing). Louisiana State University Agricultural Cen-
ter. Pub. 3079.
1m
ologist 93(1) March 2010
LI, W., HARTUNG, J. S., AND LEVY, L. 2006. Quantitative
real-time PCR for detection and identification of
Candidates Liberibacter species associated with cit-
rus huanglongbing. J. Microbiol. Methods 66: 104-
115.
MANJUNATH, K. L., HALBERT, S. E., RAMADUGU, C.,
WEBB, S. E., AND LEE, R. F. 2008. Detection of 'Can-
didatus Liberibacter asiaticus' in Diaphorina citri
and its Importance in the Management of Citrus
Huanglongbing in Florida. Phytopathol. 98: 387-396
MANJUNATH, K. L., RAMADUGU, C., MAJIL, V. M., WILL-
IAMS, S., IREY, M., AND LEE, R. F. 2010. First report
of citrus huanglongbing (HLB) from Belize. Plant
Disease (in press).
O'DELL, M., AND HARLESS, A. 2008. USDA further ex-
pands citrus greening quarantine in Florida. USDA
news release. [Internet] [cited 9 October 2009] Avail-
able at: http://www.aphis.usda.gov/newsroom/con-
tent/2008/01/cgfedord.shtml.
Kuriwada et al.: Effect of Irradiation on Death-feigning Weevils
EFFECT OF IRRADIATION ON DEATH-FEIGNING BEHAVIOR
IN THE MALE SWEETPOTATO WEEVIL CYLAS FORMICARIUS
(COLEOPTERA: BLENTIDAE)
TAKASHI KURIWADA1 2, NORIKUNI KUMANO1 2, KEIKO SHIROMOTO1'2 AND DAI HARAGUCHI1
1Okinawa Prefectural Plant Protection Center, Maji 123, Naha, Okinawa, 902-0072, Japan
2Ryukyu Sankei Co. Ltd., Maji 123, Naha, Okinawa, 902-0072, Japan
ABSTRACT
The sterile insect technique (SIT) is widely used to suppress or eradicate target insect pest
populations. The effectiveness of SIT depends on the ability of the released sterile males to
mate with and inseminate wild females. Irradiation is effective for sterilizing mass-reared
insects, and the negative impacts of this procedure are not limited to reproductive cell dam-
age. In this study, we evaluated the death-feigning that is considered as an antipredator be-
havior of male Cylas formicarius (Summers) (Coleoptera: Blentidae) irradiated with 200 Gy,
which is the dose used in the SIT program in Okinawa Prefecture. Irradiated male insects
were observed in the laboratory for 10 d after irradiation. On d 0, fewer irradiated males
feigned death than nonirradiated males. The number of irradiated and nonirradiated males
who feigned death and the duration of their death-feigning were about the same from 2 d af-
ter irradiation. On the basis of our results, we discuss the optimal release time of irradiated
male C. formicarius.
Key Words: sterile insect technique, predatory avoidance, tonic immobility, thanatosis,
gamma radiation
RESUME
La t6cnica del insecto est6ril (TIE) es usado ampliamente para suprimir o eradicar poblacio-
nes de plagas insectiles seleccionadas. La efectividad de TIE depend de la habilidad de los
machos est6riles liberados a aparearse con hembras salvajes inseminadas. La irradiaci6n es
efectiva para esterilizar insects criados en masas, pero los impacts negatives de este pro-
cedimiento no son limitados al daio de la celulas reproductivas. En este studio, evaluamos
el comportamiento de muerte fingida que es considerado como un comportamiento antede-
predador del macho de Cylas formicarius (Summers) (Coleoptera: Blentidae) irradiados con
200 Gy, la cual es la dosis usada en el program de TIE en Okinawa Prefecture. Los machos
irradiados fueron observados en el laboratorio 10 dias despu6s de la irradiaci6n. En el dia 0,
huberiorn menos machos irradiados que fingieron la muerte que los machos no irradiados.
El numero de machos irradiados y no irradiados que fingieron la muerte y la duraci6n del pe-
riodo de fingir la muerte fueron aproximadamente el mismo a los 2 dias despu6s de la irra-
diaci6n. En base a nuestros resultados, comentamos sobre el tiempo 6ptimo para la
liberaci6n de machos de C. formicarius irradiados.
The sterile insect technique (SIT) is widely
used to suppress or eradicate target insect pest
populations (Dyck et al. 2005). Because the effec-
tiveness of SIT depends on the ability of the re-
leased sterile males to mate with and inseminate
wild females (Knipling 1955, 1979), information
on mating performance and the competitive abil-
ity of sterile males is important information for
the success of eradication programs. These factors
have been focused in previous research (Calkins
& Parker 2005). Especially, irradiation for steril-
ization negatively impacts not only reproductive
cells but also somatic cells (Sakurai et al. 1994,
2000a, b; Bakri et al. 2005; Calkins & Parker
2005; Lance & McInnis 2005).
In nature, the survival of insects depends on
their ability to escape from predators (Edmunds
1974; Ruxton et al. 2004). If gamma radiation re-
duces the antipredator behaviors of released in-
sects, the effectiveness of SIT will have declined
considerably. For example, gamma radiation
damage to the midgut leads to malnutrition,
which is partly responsible for the short life span
of irradiated insects including the sweetpotato
weevil (Sakurai et al. 1994, 2000a, b; Bakri et al.
2005). Condition-dependent resource allocation
toward behavioral traits is widespread in various
animal species (Hunt et al. 2004, 2005). Theoreti-
cal and empirical studies have shown that indi-
viduals with low-condition (i.e., low residual re-
productive value) invest more resources in repro-
duction than in survival (Williams 1966; Charles-
worth & Leon 1976; Clutton-Brock 1984). If the
hunger of the irradiated insects increases with
Florida Entomologist 93(1)
time, the insects will reduce investment in anti-
predator traits (Miyatake 2001b). Consequently,
few survive because of the increased risk ofpreda-
tion in the wild. Comparing of the antipredator
traits of nonirradiated insects with those of irra-
diated insects will provide important information
that can be used to improve SIT programs. How-
ever, the antipredator traits of irradiated insects
have not been widely studied. In the present
study, we focused on the death-feigning behavior
(thanatosis, tonic immobility) exhibited by the
sweetpotato weevil Cylas formicarius; this trait
was used as a model of antipredator behavior. Re-
cently, death-feigning was empirically deter-
mined to be an antipredator adaptation in the red
flour beetle, Tribolium castaneum (Herbst) (Co-
leoptera: Tenebrionidae) (Miyatake et al. 2004;
Miyatake et al. 2009), and nymphs of the dam-
selfly Ischnura elegans (Vander Linden) (Odo-
nata: Coenagrionidae) (Gyssels & Stoks 2005).
Honma et al. (2006) showed that the characteris-
tic posture during death-feigning can prevent pre-
dation gape-limited predators in the pygmy
grasshopper, Criotettix japonicus (De Haan) (Or-
thoptera: Tetrigidae). Furthermore, this behavior
is used by the nursery web spider, Pisaura mira-
bilis against cannibalistic mating partners (Bilde
et al. 2006; Hansen et al. 2008).
Cylas formicarius, which exhibits death-feign-
ing behavior (Reinhard 1923; Sherman &
Tamashiro 1954; Miyatake 2001a, b), is a good
model for examining the effect of mass-rearing on
predator avoidance. Wasps, mites, and mice prey
on the weevils (Reinhard 1923; Cockerham et al.
1954; Sherman & Tamashiro 1954). In Okinawa
Island, ants, stinkbugs, geckos, and wandering
spiders have been observed to prey on the weevils
(K. Yasuda, personal communication; D. Haragu-
chi, unpublished data). These predators, except
for mice, rely on visual stimuli when hunting.
When adult C. formicarius are startled by a
strong stimulus, they fall from the leaves of host
plants (e.g., sweetpotato Ipomoea batatas, rail-
road vine Ipomoea pes-caprae, and blue morning
glory Ipomoea indica) to the ground and feign
death by becoming extremely rigid. Since it is dif-
ficult to locate a death-feigning weevil on the
ground because of its dark body, death-feigning is
considered a defensive strategy that has evolved
in C. formicarius to distract its predators and en-
able escape (Miyatake 2001a). The present study
aims to clarify the effects of irradiation on the in-
tensity of death-feigning behavior of C. formicar-
ius. The proportion of death-feigning weevils and
the duration of their death-feigning (i.e., recovery
time) are compared between nonirradiated and
irradiated males. We predicted that the intensity
of death-feigning is reduced in irradiated male
weevils because starved male C. formicarius re-
duced the intensity of death-feigning (Miyatake
2001b).
Cylas formicarius as well as Euscepes postfas-
ciatus are important pests of sweetpotato, Ipo-
moea batatas (L) Lam., which is cultivated in the
South Pacific, Caribbean Basin, and some coun-
tries of Central and South America (Chalfant et
al. 1990; Yasuda & Kohama 1990; Jansson & Ra-
man 1991; Yasuda 1993). Cylas formicarius was
first detected in Japan in 1903 (Nawa 1903), and
since then, it has spread throughout the south-
western islands of Japan (Moriya 1997). Lower
level pre-and postharvest infestations can reduce
both the quality and marketable yield of sweetpo-
tato, rendering the storage roots unfit for human
and livestock consumption since weevil feeding
leads to the production of toxic sesquiterpenes
(Uritani et al. 1975). Introducing weevils and
their host plants, including sweetpotato, from in-
fested areas to uninfested areas is strictly prohib-
ited by the Japanese Plant Protection law. In
1994, an eradication program targeting C. formi-
carius by means of SIT and male annihilation by
trapping flies with the use of sex pheromones was
initiated on Kume Island, Okinawa Prefecture
(Kohama et al. 2003).
MATERIALS AND METHODS
Insects and Radiation
We used mass-reared virgin adult C. formicar-
ius in this study. Adults collected from Yomitan
village, Okinawa Island, in Oct 1997 were reared
at 25 1C and a photoperiod of 14:10 (L:D) h
(0400-1800 h) on sweetpotato roots for 75 genera-
tions. Rearing was performed at the Okinawa
Prefectural Plant Protection Center (OPPPC),
Naha, Okinawa, Japan. Approximately 50 d after
inoculation with weevils, we dissected the sweet-
potato roots and collected the newly emerged
adults. These adults were maintained in the labo-
ratory at 25 1C under a photoperiod of L14:
D10. The males and females were kept in sepa-
rate meshed plastic containers (15 x 21 x 8 cm)
and fed a diet of sweetpotato root (-200 g)
throughout the experiment period. Experiments
were conducted in the laboratory from Apr to May
2009. The newly emerged adults were considered
to be 0 d old. Weevils (n = 150) aged 10-14 d were
placed in a 200-ml cup and irradiated with 200 Gy
in the irradiation facility of OPPPC, which is de-
signed by Radiation Application Development As-
sociation, Takasaki, Gunma, Japan. This facility
contained 2.315-2.325 PBq cobalt-60 source that
produced an air-absorbed dose rate of 524.9-526.3
Gy/h at 120 cm distance in the experimental pe-
riod. Environmental conditions during the irradi-
ations were 26.0-27.0C, normal atmosphere. The
sterilization procedure followed was approxi-
mately the same as that used in the SIT program
ofC. formicarius in Okinawa Prefecture (Kohama
et al. 2003). The day of irradiation was considered
March 2010
Kuriwada et al.: Effect of Irradiation on Death-feigning Weevils
as d 0. To control for the effect of filling a small
container during irradiation, 150 weevils that
were assigned to treatment of nonirradiation
were placed in a 200-ml cup while the weevils
that were assigned to treatment of irradiation
were irradiated. The irradiated and nonirradi-
ated weevils were kept in separate meshed plastic
containers (15 x 21 x 8 cm) and fed a diet of sweet-
potato root (-200 g). We replicated the experi-
ments twice by using weevils from 2 separate con-
tainers.
Observation of Death-feigning Behavior
We evaluated the changes in the duration of
death-feigning of sterile male weevils over time.
The irradiated and nonirradiated males were ob-
served on days 0, 2, 4, 6, 8, and 10. The sample
size was 32 each d, except for treatment of nonir-
radiation at 6 d (n = 31). Each weevil from 2
treatments was placed in a well of a 24-well mul-
tiplate (AS ONE Corporation, Osaka, Japan) 5 h
before to avoid disturbance by other weevils
(Miyatake 2001a). Death-feigning was induced
by picking up a weevil with tweezers and then
dropping it back into the well. The duration of
death-feigning was recorded for 120 min by using
a digital video camera (GR-DF590; Victor Com-
pany of Japan, Limited (JVC); Yokohama, Ja-
pan). The duration of death-feigning was defined
as the time between the transfer of the weevils
into the well and the detection of the first visible
movement. If the weevil failed to respond to a
stimulus and ran away, the same stimulus (pick-
ing up and dropping) was repeated once or even 3
times. If the weevil failed to respond after 3 tries,
it was considered non-responsive (Miyatake
2001a, b). We observed that the duration of
death-feigning in a few weevils was more than
120 min (11/383 = 2.9%), and the durations of the
weevils were recorded as 7200 s. All the trials
were performed at 25 x 1C and 60-80% RH, and
started at 1400 h. This time was chosen because
it corresponded to late afternoon in the field (i.e.,
4 h before lights were switched off), which is
when weevils will become active.
Statistical Analyses
A generalized linear model (GLM) with bino-
mial error structure and logit link function
(Crawley 2005) was used to determine the rela-
tionship between irradiation and the number of
male weevils exhibiting death-feigning with R
2.60 (R Development Core Team 2007). To com-
pare the duration of death-feigning by the nonir-
radiated and irradiated weevils, a Cox propor-
tional-hazards regression was used (Dalgaard
2002). Treatment type, body weight, day, repli-
cate, and interaction between treatment type and
day were the independent variables.
RESULTS
The GLM results showed that irradiation had
a significantly negative effect (P3 = -0.0047
0.0024 (SE), z = 1.95, P = 0.051) and day had a
positive effect ([3 = 0.15 + 0.076, z = 1.99, P =
0.047) on the proportion of weevils exhibiting
death-feigning. The interaction between treat-
ment type and day was not significant (P3 =
0.00071 0.00054, z = 1.32, P = 0.19). Figure 1
shows that the more nonirradiated weevils
feigned death than irradiated males on the day of
irradiation (d 0); however, this difference between
the nonirradiated and irradiated males decreased
over 2 d. When males showing no death-feigning
behavior were removed, irradiation did not affect
the duration of death-feigning (Fig. 2; P3 = 8.78e5
1.10e-3, z = 0.079, P = 0.94), day (P = -8.22e3 +
2.21e-2, z = 0.37, P = 0.71), replicate (P3 = -2.30e2
9.90e-2, z = 0.23, P = 0.82) or the interaction be-
tween treatment type and day (P = -4.82e65 + 1.82e4,
z = 0.27, P = 0.79). Body weight did not affect ei-
ther the proportion of males exhibiting death-
feigning or the duration of their death-feigning
(proportion: P = -0.27 + 0.21, z = 1.29, P = 0.20, du-
ration: p = -7.82e-2 + 6.16e2, z = 1.27, P = 0.21).
DISCUSSION
Fewer irradiated males feigned death than
nonirradiated males on d 0. This result suggests
that C. formicarius is more active just after irra-
diation because its activity is negatively corre-
lated with the intensity of death-feigning exhib-
ited by other insect species (King & Leaich 2006;
Ohno & Miyatake 2007; Miyatake et al. 2008).
r a
a
-c
o,
oC
CL
*o
o
.0
a
o.
-
0 2 4 6 8 10
Day (s) after kuadiiaon
Fig. 1. Effect of irradiation on the number of male
weevils exhibiting death-feigning. Dashed lines, nonir-
radiated (control) males; solid lines, irradiated males.
.. OGy
200 Gy
Florida Entomologist 93(1)
x 200G;
mating fitness (Miyatake 2001a). Furthermore,
flight and walking activity also increase at night
(Sakuratani et al. 1994), so weevils mainly dis-
a
0
S 000
0
Fig. 2. 1
feigning of
males; crock
resent the
Our result
et al. (20(
high disp
tion. Whe
the wild,
the inten
behavior)
sterile mE
cause the
male exh
of their d
d after irr
showed t
males di
males for
tically de
males are
a short ti
their rele
Altern
into the
Cylas for
than dayt
explain v
night (Mi
dation pr
weevils (]
Sherman
bugs, wa]
weevils o0
lished da
tion). Mo
thus, dea
may not i
ing behav
the even
al. 1954;
mates at
night bec
th-feigning by weevils during the night
be useful. The second reason is the mat-
'ior of C. formicarius. Weevils copulate in
ng and through the night (Cockerham et
Sakuratani et al. 1994); they search for
night. Weevils tend to not feign death at
ause such behavior would reduce their
ACKNOWLEDGMENTS
We thank Y. Nakamoto and Y. Sokei (OPPPC) for ir-
radiating of C. formicarius. We also thank the staff of
OPPPC and Ryukyu Sankei Co. Ltd. for assistance. Dr.
Yasuda provided us with information on the natural en-
perse at night. In conclusion, it would be appro-
priate to release irradiated weevils in the evening
based on weevil's predator avoidance, mating,
and dispersal behaviors. Future studies that com-
parison of the fitness of the weevils between when
weevils are released at daytime and at night
4 should be needed.
Gamma radiation damages the epithelial tis-
sue of the midgut, affecting alimentation (Saku-
rai et al. 1994). Malnutrition caused by the dam-
age to the midgut leads to starvation, which ac-
0 2 4 6 8 10 counts, in part, for the shortened lifespan of the
Day (s) after hiaton irradiated insects. Miyatake (2001b) showed that
fewer starved male C. formicarius feigned death
Effect of irradiation on the duration of death- and that the duration of their death-feigning is
male weevils. Circles, nonirradiated (control) shorter. Although fewer males feigned death on d
sses, irradiated males. The vertical bars rep- 3 of starvation (Miyatake 2001b), our results did
not show definite reductions in the proportion of
male feigning death and the duration of their
Its are consistent with those of Kumano death-feigning over 10 d. The survival rate of ir-
)7): irradiated male C. formicarius have radiated weevils did not differ from that of nonir-
ersal ability immediately after irradia- radiated weevils for 7 d after irradiation (Kumano
n irradiated weevils are released into et al. 2008). These results suggested that irradia-
they face high risk of predation because tion does not result in the complete starving of C.
sity of their death-feigning (antipredator formicarius, and then it is not supported our pre-
is reduced. It seems suitable to release diction that irradiation reduces the intensity of
ales into the wild 2 d after irradiation be- death-feigning.
number of irradiated and nonirradiated Our study (and perhaps, other studies that ex-
ibiting death-feigning and the duration plored the adaptive significance of death-feign-
eath-feigning were about the same for 2 ing) assumed that the duration of death-feigning
radiation However, Kumano et al. (2008) affects predator avoidance. To our knowledge,
;hat the mating ability of irradiated however, the relationship between the 2 variables
i not differ from that of nonirradiated has not been examined rigorously When attacked
about a week after irradiation but dras- by a predator, an insect usually falls from the
creased thereafter. Therefore, irradiated branch and is out of the predator's line of vision
useful for pest eradication or control for (Miyatake 2001a). The dropped insect frequently
me after irradiation (7 d), and delaying feigns death (Ruxton et al. 2004; Ruxton 2006;
ase is wasteful. Ohno & Miyatake et al. 2007). The dark body of
atively, sterile weevils can be released the insect blends with the ground, causing the
vild in the evening because lower adult predator to lose sight of it (Miyatake 2001a). The
micarius feign death during the night predator may lose interest in the insect and give
ime (Miyatake 2001a). Two reasons may up searching for it. Therefore, we hypothesize
vhy weevils tend to not feign death at that the duration of death-feigning is matched
yatake 2001a). First is the effect of pre- with the giving-up time of natural enemies. To ex-
essure. Wasps, mites, and mice prey on amine the hypothesis, first, we must examine
Reinhard 1923; Cockerham et al. 1954; that the death-feigning behavior actually in-
and Tamashiro 1954). Predatory stink- crease survival rate in the field condition. Second,
ndering spiders, and ants also prey on major predators of C. formicarius in the field and
n Okinawa Island (D. Haraguchi, unpub- their giving-up times should be examined. Such
ta and K. Yasuda, personal communica- studies will improve the understanding of the
st predators are davtime hunters and adaptive significance of death-feigning behavior.
March 2010
f death-feigning behavior.
March 2010
Kuriwada et al.: Effect of Irradiation on Death-feigning Weevils
emies of C. formicarius. We borrowed a video camera
from Plant Disease and Insect Pest Management Sec-
tion at Okinawa Prefectural Agricultural Research Cen-
ter. We thank Dr. H. Hirayama, N. Shimada, Dr. G.
Sakurai, Dr. T. Uehara and T. Yamamoto for help with
collecting references. The manuscript was greatly im-
proved by the valuable comments of 3 anonymous re-
viewers.
REFERENCES CITED
BAKRI, A., MEHTA, K., AND LANCE, D. 2005. Sterilizing
insects with ionizing radiation, pp. 233-268 In V. A.
Dyck, J. Hendrichs, and A. S. Robinson [eds.], Sterile
Insect Technique, Principles and Practice in Area-
Wide Integrated Pest Management. Springer, Dor-
drecht.
BILDE, T., TUNI, C., ELSAYED, R., PEKAR, S., AND TOFT,
S. 2006. Death feigning in the face of sexual canni-
balism. Biol. Lett. 2: 23-25.
CALKINS, C. O., AND PARKER, A. G. 2005. Sterile insect
quality, pp. 269-296 In V. A. Dyck, J. Hendrichs, and
A. S. Robinson [eds.], Sterile Insect Technique, Prin-
ciples and Practice in Area-Wide Integrated Pest
Management. Springer, Dordrecht.
CHALFANT, K. L., JANSSON, R. K., SEAL, D. R., AND
SCHALK, J. M. 1990. Ecology and management of
sweet potato insects. Annu. Rev. Entomol. 35: 157-
180.
CHARLESWORTH, B., AND LEON, J. A. 1976. The relation
of reproductive effort to age. American Nat. 110:
449-459.
CLUTTON-BROCK, T H. 1984 Reproductive effort and
terminal investment in iteroparous animals. Ameri-
can Nat. 123: 212-229.
COCKERHAM, K. L., DEEN, O. T., CHRISTIAN, M. B., AND
NEWSOM, L. D. 1954. The biology of the sweet potato
weevil. Louisiana State Univ. Tech. Bull. 483: 1-30.
CRAWLEY, M. J. 2005, Statistics: An Introduction Using
R. John Wiley & Sons Ltd, West Sussex. 327 pp.
DALGAARD, P. 2002, Introductory Statistics with R.
Springer-Verlag, New York. 288 pp.
DYCK, V. A., HENDRICHS, J., AND ROBINSON, A. S. 2005.
Sterile Insect Technique, Principles and Practice in
Area-Wide Integrated Pest Management. Springer,
Dordrecht. 787 pp.
EDMUNDS, M. 1974. Defence in Animals: a Survey of An-
ti-predator Defences. Longman, Harlow, Essex &
New York. 374pp.
GYSSELS, F. G. M., AND STOKS, R. 2005. Threat-sensi-
tive responses to predator attacks in a damselfly.
Ethology 111: 411-423.
HANSEN, L. S., GONZALEZ, S. F., TOFT, S., AND BILDE, T.
2008. Thanatosis as an adaptive male mating strat-
egy in the nuptial gift-giving spider Pisaura mirabi-
lis. Behav. Ecol. 19: 546-551.
HONMA, A., OKU, S., AND NISHIDA, T. 2006. Adaptive sig-
nificance of death feigning posture as a specialized
inducible defense against gape-limited predators.
Proc. R. Soc. Lond. B. 273: 1631-1636.
HUNT, J., BROOKS, R., JENNIONS, M. D., SMITH, M. J.,
BENTSEN, C. L., AND BUSSIERE, L. F. 2004. High-
quality male field crickets invest heavily in sexual
display but die young. Nature 432: 1024-1027.
HUNT, J., BROOKS, R., AND JENNIONS, M. D. 2005. Fe-
male mate choice as a condition-dependent life-his-
tory trait. Am. Nat. 166: 79-92.
JANSSON, R. K., AND RAMAN, K. V. 1991. Sweet potato
pest management: a global overview, pp. 1-12 In R.
K. Jansson and K. V. Raman [eds.], Sweet Potato
Pest Management: A Global Perspective. Westview
Press, Boulder.
KING, B. H., AND LEAICH, H. R. 2006. Variation in pro-
pensity to exhibit thanatosis in Nasonia vitripennis
(Hymenoptera: Pteromalidae). J. Insect Behav. 19:
241-249.
KNIPLING, E. F. 1955. Possibilities of insect control or
eradication through the use of sexually sterile
males. J. Econ. Entomol. 48: 459-462.
KNIPLING, E. F. 1979. The Basic Principles of Insect Pop-
ulation Suppression and Management. United
States Department of Agriculture, Washington. 676
pp.
KOHAMA, T., YAMAGISHI, M., KUBA, H., AND KINJO, K.
2003. A progress report on the eradication program
of the sweet potato weevil, Cylas formicarius (Fabri-
cius) (Coleoptera: Brentidae), with both male anni-
hilation using sex pheromone and sterile insect re-
leases in Kume Island, Okinawa, Japan, pp. 65-69 In
Recent Trends on Sterile Insect Technique and Area
Wide Integrated Pest Management: Economic Feasi-
bility, Control Projects, Farmer Organization and
Bactrocera dorsalis Complex Control Study. Re-
search Institute for Subtropics, Naha, Japan.
KUMANO, N., KOHAMA, T., AND OHNO, S. 2007. Effect of
irradiation on the dispersal ability of male sweetpo-
tato weevils, Cylas formicarius elegantulus (Co-
leoptera: Brentidae), in the field. J. Econ. Entomol.
100: 730-736.
KUMANO, N., HARAGUCHI, D., AND KOHAMA, T. 2008. Ef-
fect of irradiation on mating ability in the male
sweetpotato weevil (Coleoptera: Curculionidae). J.
Econ. Entomol. 101: 1198-1203.
LANCE, D. R., AND MCINNIS, D. O. 2005. Biological basis
of the sterile insect technique, pp. 69-94 In V. A. Dy-
ck, J. Hendrichs, and A. S. Robinson [eds.], Sterile
Insect Technique: Principles and Practice in Area-
wide Integrated Pest Management. Springer, Dor-
drecht, The Netherlands.
MIYATAKE, T. 2001a. Diurnal periodicity of death-feign-
ing in Cylas formicarius (Coleoptera: Brentidae). J.
Insect Behav. 14: 421-432.
MIYATAKE, T. 2001b. Effects of starvation on death-
feigning in adults of Cylas formicarius (Coleoptera:
Brentidae). Ann. Entomol. Soc. America 94:612-616.
MIYATAKE, T., KATAYAMA, K., TAKEDA, Y., NAKASHIMA,
A., SUGITA, A., AND MIZUMOTO, M. 2004. Is death-
feigning adaptive? Heritable variation in fitness dif-
ference of death-feigning behaviour. Proc. R. Soc.
Lond. B. 271: 2293-2296.
MIYATAKE, T., NAKAYAMA, S., NISHI, Y., AND NAKAJIMA,
S. 2009. Tonically immobilized selfish prey can sur-
vive by sacrificing others. Proc. R. Soc. Lond. B. 276:
2762-2767.
MIYATAKE, T., TABUCHI, K., SASAKI, K., OKADA, K.,
KATAYAMA, K., AND MORIYA, S. 2008. Pleiotropic an-
ti-predator strategies, fleeing and feigning death,
correlated with dopamine levels in Tribolium casta-
neum. Anim. Behav. 75: 113-121.
MORIYA, S. 1997. Is it possible to eradicate the two wee-
vil pests of sweet potato, Cylas formicarius and Eus-
cepes postfasciatus from Japan? Bull. Okinawa Ag-
ric. Exp. Sta. 18: 19-27.
NAWA, U. 1903. A note of the sweet potato weevil. Kon-
chu Sekai 7: 327-330.
OHNO, T., AND MIYATAKE, T. 2007. Drop or fly? Negative
genetic correlation between death-feigning intensity
and flying ability as alternative anti-predator strat-
egies. Proc R Soc Lond B. 274: 555-560.
R DEVELOPMENT CORE TEAM. 2007. R: A language and
environment for statistical computing. R Foundation
for Statistical Computing, Vienna.
REINHARD, H. J. 1923. The sweet potato weevil. Bull.
Tex. Agric. Exp. Stn. 308: 1-90.
RUXTON, G. D., SHERRATT T. N., AND SPEED, M. P. 2004.
Avoiding Attack: the Evolutionary Ecology of Cryp-
sis, Warning Signals & Mimicry. Oxford University
Press, Oxford, UK. 249 pp.
RUXTON, G. 2006. Grasshoppers don't play possum. Na-
ture 440: 880.
SAKURAI, H., WATANABE, H., SUGIMOTO, T., SAKURA-
TANI, Y., SETOGUCHI, 0., AND KAWAZOE, K. 1994. Ef-
fect of gamma-radiation on the gametogenesis in the
Sweet potato weevil, Cylas formicarius. Res. Bull.
Fac. Agric., Gifu Univ. 59: 11-20.
SAKURAI, H., MURAKAMI, Y., KOHAMA, T., AND TERUYA,
T. 2000a. Sterilizing mechanism of y-radiation in
the female of West Indian sweet potato weevil, Eu-
scepes fasciatus. Res. Bull. Fac. Agric., Gifu Univ.
65: 13-20.
March 2010
SAKURAI, H., MURAKAMI, Y., UTIMURA, H., KOHAMA, T.,
AND TERUYA, T. 2000b. Sterilizing mechanism of
gamma-radiation in the male of West Indian Sweet
Potato weevil, Euscepes postfasciatus. Res. Bull. Fac.
Agric., Gifu Univ. 65: 5-12.
SHERMAN, M., AND TAMASHIRO, M. 1954. The sweet po-
tato weevils in Hawaii: Their biology and control.
Hawaii Agric. Exp. Stn. Bull. Tech. 23: 1-36.
URITANI, I., SAITO, T., HONDA, H., AND KIM, W. K. 1975.
Induction of furano-terpenoids in sweet potato roots
by the larval components of the sweet potato wee-
vils. Agr. Biol. Chem. Tokyo 39: 1857-1862.
WILLIAMS, G. C. 1966. Adaptation and Natural Selec-
tion. Princeton University Press, Princeton, NJ. 320
pp.
YASUDA, K. 1993. Seasonal prevalence of the sweetpota-
to weevil Cylas formicarius and the West Indian
sweetpotato weevil Euscepes postfasciatus in Okina-
wa, Japan. Proc. Assoc. Plant Prot. Kyushu 39: 88-
90.
YASUDA, K., AND KOHAMA, T. 1990. Distribution of the
sweet potato weevil, Cylas formicarius (Fabricius)
and the West Indian sweet potato weevil, Euscepes
postfasciatus (Fairmire) in Okinawa prefecture.
Proc. Assoc. Plant Prot. Kyushu 36: 123-125.
Florida Entomologist 93(1)
Lee & Pemberton: Pupal Parasitoids of Apple Ermine Moth
PUPAL PARASITOIDS OF YPONOMEUTA MALINELLUS
(LEPIDOPTERA: YPONOMEUTIDAE) IN NORTHEAST ASIA
JANG-HOON LEE2 AND ROBERT W. PEMBERTON1'3"
'Asian Parasite Laboratory, USDA-ARS, Seoul, Republic of Korea
2Current address: Research Institute for Natural Science, Dongguk University, #26, Pil-dong,
3-ga Seoul 100-715, Republic of Korea
3Current address: Invasive Plant Research Laboratory, USDA-ARS, 3225 College Ave.
Ft. Lauderdale, Florida 33314 USA
*Corresponding author
ABSTRACT
Pupal parasitism of the apple ermine moth, Yponomeuta malinellus Zeller (Lepidoptera:
Yponomeutidae), was investigated in northeast Asia with the goal of identifying potential bi-
ological controls of the moth, which threatened the apple industry in Washington State, USA
during the 1980s. Seven primary and 2 secondary parasitoids were recorded from 27, 472
pupae collected and reared from a total of 20 collections at 16 sites in Korea, northern Hon-
shu and Hokkaido Islands in Japan, and Shanxi Province in China during a 4-year period
from 1988 to 1991. The mean total parasitism rate was highest in Korea (38.5%), while the
lowest rate of 2.1% was recorded from Shanxi, China. The mean total parasitism rate de-
tected from Hokkaido and Honshu Islands in Japan was 17.2 and 10.1%, respectively. The
ichnueumonid wasp Herpestomus brunnicornis Gravenhorst dominated the parasitism in
Korea and Japan, while Coccygomimus disparis (Viereck) was responsible for most mortal-
ity of the moth pupae in Shanxi, China. Diadegma armillatum (Gravenhorst) caused very
low mortality in this study, although it is known as an important parasitoid from Europe
and Eurasia. There were significantly different levels of parasitism rates of apple ermine
moth pupae among geographical locations sampled, likely due to the habitat type and host
plant of the apple ermine moth. Herpestomus brunnicornis collected from Korea and Japan
was established in Washington State, USA as a biocontrol agent of the apple ermine moth.
Key Words: apple, biological control, China, Japan, Korea, Malus, parasitoid, Yponomeuta
malinellus
RESUME
El parasitismo de la pupa de la polilla, Yponomeuta malinellus Zeller (Lepidoptera: Ypono-
meutidae), fue investigado en el noreste de Asia con la meta de identificar los agents de con-
trol biol6gico potenciales de la polilla, que amenaz6 la industrial de manzanas en el estado
de Washington, EEUU durante la decade de los 1980. Siete parasitoides primaries y 2 para-
sitoides secundarios fueron registrados de los 27,472 pupas recolectadas y criados de un to-
tal de 20 colecciones en 16 sitios en Corea, la parte norte de las islas Honshu y Hokkaido en
Jap6n, y la Provincia Shanxi Province en China durante un period de 4 aios de 1988 hasta
1991. El promedio total de parasitismo mas alto fue en Corea (38.5%), mientras que la tasa
mas baja de 2.1% fue registrado en Shanxi, China. El promedio total de parasitismo detec-
tado de las islas Hokkaido y Honshu en Jap6n fue 17.2% y 10.1%, respectivamente. La
avispa ichneumonido, Herpestomus brunnicornis Gravenhorst, domino el parasitismo en Co-
rea y Jap6n, mientras Coccygomimus disparis (Viereck) fue responsible para la mayoria de
la mortalidad de las pupas de la polilla en Shanxi, China. Diadegma armillatum (Graven-
horst) causo mortalidad muy baja en este studio, aunque es conocido como un parasitoide
important en Europa y Eurasia. Hubo niveles diferentes significativos en la tasa de para-
sitismo de la pupa de la polilla entire las localidades geograficas muestreadas, a lo mejor de-
bido a la clase de habitat y de la plant hospedera de la polilla. Herpestomus. brunnicornis
recolectada en Corea y Jap6n fue establecido en el estado de Washington, EEUU como un
agent de control biol6gico de la polilla.
The apple ermine moth, Yponomeuta malinel- Asia. In Asia, Malus pumila Miller (Forest Re-
lus Zeller (Lepidoptera: Yponomeutidae), is a uni- search Institute 1969; Moriuti 1977; Shin et al.
voltine defoliator of Malus species in Europe and 1983), M. sieboldii (Regel) (Moriuti 1977), M. tor-
Florida Entomologist 93(1)
ingo Nakai (Issiki et al. 1975), M. baccata
Borkhaurs, and M. micromalus Mak. (Forest Re-
search Institute 1969) are known hosts of apple
ermine moth.
Apple ermine moths lay egg masses on 1-3
year-old branches from mid to late summer. Lar-
vae hatch from eggs in about 3 weeks, but remain
underneath the egg mass covering (hibernacu-
lum) throughout winter. At bud-break in early
spring, first-instars leave the hibernaculum and
each mine a single leaf. Larval stages form col-
ony-like aggregations usually composed of sib-
lings from the same egg mass. Larvae in the sec-
ond through fifth-instars consume foliage, and
groups of larvae form a tent over several leaf clus-
ters. Mature larvae aggregate and spin their co-
coons together in tightly clustered groups, often
under undamaged leaves. Larvae pupate in early
summer and adult emerge 1-2 weeks later (Junni-
kkala 1960; Lee & Pemberton 2007).
In the early 1980s, the apple ermine moth was
established in the Pacific Northwest area of the
U.S. and adjacent areas in Canada, where it was
thought to be a potentially significant pest of ap-
ples. Low rates of parasitism in these areas con-
trasted with high parasitism throughout its na-
tive range in temperate Eurasia (Unruh et al.
1993) and Northeast Asia (Lee & Pemberton
2005, 2007). Surveys for parasitoids of apple er-
mine moth pupae were undertaken in Korea,
northern and central Japan, and Shanxi Province
in China from 1988 to 1991 to identify agents for
biological control in North America. Data on the
larval parasitoid complex of the apple ermine
moth in these regions have been reported previ-
ously (Lee & Pemberton 2005, 2007). The objec-
tives of our research were (1) to determine the
species composition of parasitoids which emerged
from pupal stage of Asian apple ermine moth and
determine the relative mortality contributed by
each parasitoid, and (2) to select promising para-
sitoids of apple ermine moth pupae for classical
biological control.
MATERIALS AND METHODS
Study Sites
The parasitoids of the apple ermine moth and
their parasitism rates were determined through
collection and rearing of pupae in 4 geographic re-
gions from 1988 to 1991. Collections were made
during a total of 20 apple ermine moth seasons
from 16 sites located in Honshu (in 1988 and
1989) and Hokkaido (1991), Japan, Shanxi, China
(1990), and Korea (1989-1991).
In Korea, collections were made in Hongchon
(37.5 and 38N latitude by 127.5 and 128E longi-
tude), Kangwondo and at Mt. Yongmoon (37 and
37.5N by 127 and 127.5E), Kyonggido both in
1989-1991. Mt. Yongmoon is 50 km east of Seoul.
Collections of Y. malinellus were made from
Malus baccata Borkh. at 4 sites along the Yongpo-
chon stream, from sites 500 m apart. Hongchon is
78 km northeast of Seoul. Collections were made
from M. baccata at 3 sampling sites that were 1-
1.5 km apart. This site was a natural area site lo-
cated in Kangwon Univ. Forestry Experimental
Station (Bukbang-ri). Yponomeuta malinellus
were usually collected by cutting branches with
tents from positions just above the ground 0-5 m
above the ground. Branches with tents were
bagged and chilled during transport to the labora-
tory where they were transferred to rearing
cages. Apple ermine moth density was low at Mt.
Yongmoon, and <30 pupae were collected annu-
ally in 1990 and 1991. A total of 1307 pupae were
collected in Korea in 1989-1991. Data from sites
with <50 pupae were not quantitatively analyzed
(Tables 1 and 3).
In Japan, collections on Hokkaido were made
in 3 abandoned orchards, located within 41-42N
and 141 and 145E, where a total of 5,194 pupae
were collected in early Jul 1991. Collections in
northern Honshu Island were made within a re-
gion circumscribed by 39 and 41N by 140-141E.
Seven collections were made at 5 sites in Honshu,
totaling 8,108 pupae from both natural habitats
and abandoned orchards in Jul in 1988 and 1989.
Surveys in China were made in Shanxi Prov-
ince (36-40N by 110-114E) southwest of Beijing.
A total of 12,863 apple ermine moth pupae were
collected from cultivated orchards at 5 sites in
mid Jun, 1990-1991. Information related to these
samplings including habitat characteristics is de-
scribed in Table 1.
Rearing
Pupae were reared inside the laboratory at
ambient temperatures to obtain parasitoids. Pu-
pae were separated from cocoon clusters and
placed in groups of 5 in Petri dishes (1.5 by 6 cm,
or 1.0 by 5 cm), or in groups of 20 in Petri dishes
(1.5 by 9 cm), and held for moth or parasitoid
emergence.
Analysis
Parasitoids of the apple ermine moth pupae
were evaluated from 20 different collections from
16 sites of 4 geographical regions in 3 countries
(Table 1). Most sites were sampled once, although
Korean sites were sampled in each of 3 successive
years, while some were sampled in 2 consecutive
years. Samples from different dates in the same
season were pooled by site to calculate parasit-
ism rates. Parasitism rates were calculated for
each of the 7 primary parasitoids found in the
study areas. The rate of parasitism was calcu-
lated by dividing the number of emerged parasi-
toids by the total number of pupae collected. Four
March 2010
Lee & Pemberton: Pupal Parasitoids of Apple Ermine Moth
TABLE 1. COLLECTION DATA FOR APPLE ERMINE MOTH PUPAE IN 4 GEOGRAPHIC REGIONS AND THEIR HABITAT CHAR-
ACTERISTICS.
Locality Collection Date h collected Host plant Elevation Habitat'
Shanxi Province, China
Daren Jun. 20, 90' 1952 M. asiatica 900m C
Hejiabu Jul. 18, 90' 362 M. asiatica C
Nanzhang Jun. 11, 91' 8608 M. asiatica C
Song Zhuang Jun. 18, 90' 150 M. asiatica C
Wang Guan Ren Jun. 19, 90' 1791 M. asiatica 1062m C
Japan, Hokkaido Island
Abashiri (NFG) Jul. 04, 91' 5001 M. pumila A
Abashiri (NFRI) Jul. 04, 91' 56 M. pumila A
Kamibibi Jul. 02, Jul. 05, 91' 137 M. pumila A
Japan, N. Honshu Island
Mt. Appi Jul. 26, 88' 446 M. sieboldii 850m N
Mt. Appi Jul 05, 89' 773 M. sieboldii 850m N
Morioka Jul. 26, 88' 512 M. halliana 200m A
Morioka Jun 27, Jul. 06, 89' 2711 M. pumila 620m A
Kuzakai Jul. 28, Jul. 06. 89' 2829 M. baccata 793m N
Tashiro-Aomori Jul. 01, 89' 158 M. sieboldii 610m N
Tashiro-Iwate Jun. 27, Jul. 05, 89' 679 M. sieboldii 620m N
Korea, Kyonggi Province
Mt. Yongmoon Jun. 09-22, 89' 205 M. baccata 100-200m N
Mt. Yongmoon Jun. 14, 90' 19 M. baccata 100-200m N
Mt. Yongmoon Jun. 19,91' 29 M. baccata 100-200m N
Korea, Kangwon Province
Hongchon May 30-Jun. 27, 89' 265 M. baccata 200-300 N
Hongchon Jun. 14-Jun. 27, 90' 630 M. baccata 200-300 N
Hongchon Jun. 18, 91' 159 M. baccata 200-300 N
C = cultivated orchard, A = abandoned orchard, N = natural habitat.
indices were developed to evaluate parasitoid im-
portance by geographical region, as follows: (1)
site-specific percentage parasitism for each para-
sitoid was calculated by dividing the number of
pupae from which parasitoids emerged by the
number of hosts collected from each site, (2)
mean parasitism rates for each parasitoid species
were obtained by averaging all the rates of para-
sitism across sites within each geographic region,
(3) total parasitism was calculated by adding the
number of host individuals parasitized by all par-
asitoids in the samples of a season collection at a
particular site divided by total individuals col-
lected, and (4) mean total parasitism (mean sea-
son parasitism for each geographic region) was
calculated by averaging all the total parasitism
values for all sites within each geographic region.
To compare parasitism rates between coun-
tries, we used mean parasitism rates for each par-
asitoid species and mean total percentage para-
sitism. Kruskall-Wallis tests in PROC Nparlway
(SAS Institute 2004) were used because data were
not normally distributed. Percentages were arc-
sine-transformed and one-way ANOVA, followed
by Tukey's Studentized Range (HSD) test in
PROC GLM (SAS Institute 2004) was used to test
for differences among multiple means.
Identification of Natural Enemies
Species identifications or confirmations were
made by J. Papp (Braconidae) (Hungarian Natu-
ral History Museum, Budapest, Hungary), H.
Shima (Tachinidae) (Kyushu University, Fuku-
oka, Japan), R. W. Carlson (Ichneumonidae), E. E.
Grissell (Pteromalidae), and M. E. Schauff (En-
cyrtidae and Eulophidae) (USDA-ARS, Washing-
ton, DC).
RESULTS
A total of 7 primary and 2 secondary parasi-
toids (hyperparasitoids) were reared from the 4
geographical regions sampled, with each region
producing 3 to 5 species of primary parasitoids
(Tables 2 and 3). Parasitoid diversity was higher
Florida Entomologist 93(1)
TABLE 2. PUPAL PARASITOIDS OF APPLE ERMINE MOTH IN NORTHEAST ASIA.
Host stage (Attacked / Emerged)
Ichneumonidae
Coccygomymus disparis (Viereck)'2'3
Diadegma armillatum (Grav.)1'2,3
Herpestomus brunnicornis Grav.2'3
Eulophidae
Aprostocetus sp.'
Pupa-Pupa
Larva-Pupa
Larva-Pupa
Larva-Pupa
D. armillatum pupa
D. armillatum pupa
Larva-Pupa
Larva-Pupa
Larva-Pupa
aHyperparasitoid.
Parasitoid species found in China.
'Parasitoid species found in Japan.
'Parasitoid species found in Korea.
in Korea and Japan (5 species) than in China (3
species) (Table 3). Korea and Japan shared 3 spe-
cies of primary parasitoids and these included the
2 species also found in China (Table 3). Herpesto-
mus brunnicornis Gravenhorst (Hymenoptera:
Ichneumonidae) was the most important parasi-
toid in Korea and Japan (Table 3). Coccygomimus
disparis (Viereck) (Hymenoptera: Ichneu-
monidae) and Diadegma armillatum (Grav.) (Hy-
menoptera: Ichneumonidae) were reared from
collections from all 3 countries. Total parasitism
rates varied by geographic region (X2 =14.0568, df
= 3, P = 0.0028; Kruskall-Wallis test) (Table 3), be-
ing highest (38.7%) in Korea and lowest (2.1%) in
China. The mean total parasitism rates in Japan
were 16.1% 1.4 in Hokkaido and 10.1% 7.6 in
Honshu. The mean total parasitism rates for is-
lands in Japan was not significantly different (F =
20.86, df = 3, P = <0.0001; Tukey's studentized
range (HSD) test).
There was a significant difference in mean par-
asitism rates for three of the seven parasitoid spe-
cies among the countries: H. brunnicornis (X2 =
14.2805, df= 3, P = 0.0025) (F = 17.42, df= 3, P =
<0.0001); Bessa parallel (Meigen) (Diptera: Ta-
chinidae), (X2 = 7.9335, df = 3, P = 0.0474) (F =
3.09, df = 3, P = 0.0497); and Zenillia dolosa
(Meigen) (Tachinidae) (X2 = 12.5462, df = 3, P =
0.0057), (F = 11.70, df= 3, P = 0.0003).
When apple ermine moth was classified for
habitat types such as natural, abandoned, and
cultivated habitats, there was a significant differ-
ence in mean total parasitism rates among the
habitat types (X2 = 7.757, df = 2, P = 0.0207;
Kruskall-Wallis test) (Table 3). The level of mean
total parasitism was 2.1% 4.7 in cultivated or-
chards, which is significantly lower than 21.4%
17.9 in natural habitats and 16.1% 7.0 in aban-
doned orchards (F = 8.49, df = 2, P = 0.031;
Tukey's studentized range (HSD) test). We com-
pared host plant specific parasitism for three dif-
ferent hosts such as M. baccata, M. pumilla, and
M. sieboldii, eliminating other host plant data
with single collection and found a significant dif-
ference between the mean total parasitism by
parasitoids (F = 5.12, df= 2, P = 0.0294). The par-
asitism was significantly lower on M. sieboldii
(8.0% 4.0) than onM. baccata (32.2% 17.4) or
on M. pumila (18.5% 5.21), suggesting that host
plant effect is also associated with level parasit-
ism rates experienced in geographical regions.
DISCUSSION
Parasitoids preferring natural habitat or
abandoned orchards to cultivated orchard
might be a possible explanation to higher para-
sitism rates in Korea and Japan compared to
China. Lill et al. (2002) reported that host plant
identity had a large influence on parasitism lev-
els experienced by herbivores. Similarly host
plant effects also could be possible factors af-
fecting levels of parasitism rate by the parasi-
toid of apple ermine moth.
Taxa
Hymenoptera
Pteromalidae
Pteromalus spp. '12'3
Tricomalopsis sp. '2
Diptera
Tachinidae
Bessa parallella (Meigen)1'2
Nemorilla floralis (Fallen)2
Zenillia dolosa (Meigen)3
March 2010
TABLE 3. PUPAL PARASITISM' OF APPLE ERMINE MOTH IN CHINA, JAPAN, AND KOREA, 1988-1991.
Percentage parasitism'(no. hosts parasitized) by each parasitoid
Number
of hosts Coccygomimus Diadegma Herpestomus Bessa Nemorilla Zenillia Aprostocetus Pteromalus Tricomalopsis Total %
Locality (year) collected disparis armillatum brunniconis parallel floralis dolosa sp. sp. sp. parasitism
Shanxi, China
Daren (90') 1952 0.05 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.05
Hejiabu (90') 362 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0
Nanzhang (91) 8608 10.5 +2 0.0 + 0.0 0.0 0.0 0.1 0.0 10.54
Song Zhuang (90') 150 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 d
Wang Guan Ren (90) 1791 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0
Mean (+ SD) 2.1+ 4.7 + 0.0 0.0 c + b 0.0 0.0 0.0 + 0.0 b 0.0 0.0 0.02 0.04 0.0 0.0 2.1 4.7 c 0
Hokkaido, Japan
Abashiri (NFG) (91') 5001 15.3 + 0.0 0.2 + 0.0 0.0 + 0.0 15.6
Abashiri (NFRI) (91') 56 0.0 0.0 14.4 0.0 0.0 0.0 0.0 0.0 0.0 14.4
Kamibibi (91') 137 0.0 0.0 18.2 0.0 0.0 0.0 0.0 0.0 0.0 18.2
Mean (+ SD) 5.1 8.8 + 12.0 + 10.4 b 0.07 + 0.13 ab + 0.0 0.0 b 0.0 0.0 + 0.0 0.0 16.1 1.4 b
Honshu, Japan
Mt. Appi (88') 446 2.2 0.0 10.8 0.4 0.0 0.0 0.0 0.0 0.0 13.4
Mt. Appi (89') 773 0.0 0.0 1.2 2.8 0.0 0.0 0.0 0.0 0.0 4.0
Morioka (88') 512 6.1 0.0 0.4 0.0 0.0 0.0 0.0 0.0 0.0 6.5 Cn
Morioka (89') 2711 11.1 0.07 14.8 0.0 0.0 0.0 0.0 0.2 0.0 25.97 0
Kuzakai (89') 2829 + 0.0 5.73 0.3 0.0 0.0 0.0 0.0 0.0 6.07
Tashiro-Aomori (89') 158 0.0 0.0 4.4 3.8 + 0.0 0.0 0.0 0.0 8.2
Tashiro-Iwate (89') 679 0.0 0.0 5.5 0.7 0.0 0.0 0.0 0.0 0.0 6.2
Mean ( SD) 2.8 + 4.3 0.01 + 0.03 6.1 + 5.1b 1.14 + 1.52 a + 0.0 + 0.0 b 0.0 + 0.0 0.03 + 0.08 0.03 + 0.08 10.1 + 7.6 b
Kyonggi-do, Korea
Mt. Yongmoon (89') 205 0.0 0.0 26.8 0.0 0.0 2.4 1.5 0.0 0.0 30.7
Kangwon-do Korea
Hongchon (89') 265 0.0 0.0 44.5 0.0 0.0 1.88 0.0 0.0 0.0 46.38 0
Hongchon (90') 630 0.0 0.0 25.2 0.0 0.0 2.7 0.0 0.0 0.0 27.9
Hongchon (91') 159 0.6 1.3 47.8 0.0 0.0 0.0 0.0 0.6 0.0 49.7
Mean ( SD) 0.2 + 0.3 0.3 + 0.7 36.1 + 11.7 a 0.0 + 0.0 c 0.0 + 0.0 1.70 + 1.2 a 0.38 + 0.75 0.2 + 0.3 0.0 + 0.0 38.7 + 11.6 a
'Mean parasitism rates for each parasitoid and total mean parasitism for each geographic region in the same column followed by the same letter are not significantly different.
Mean comparisons were analyzed by Tukey's studentized range (HSD) test at P = 0.05. An arcsine square root transformation was applied to the percentage data to normalize
their distribution. However, original means ( SD) are used for data presentation. + Indicates presence of parasitism of <0.05.
Florida Entomologist 93(1)
The most important parasitoid of apple ermine
moth in Asia, Herpestomus brunicornis, is a soli-
tary, oligophagous, univoltine parasitoid, passing
the fall, winter, and spring as an adult. Early the
following summer, females find and parasitize
fifth-instars, prepupae, or pupal hosts (Kuhl-
mann 1996). This species was able to attack larval
stages, with attacks beginning on young larvae
and causing a considerable mortality in mid-in-
stars in Korea (Lee & Pemberton 2007). However,
much higher parasitism rates occur in pupae than
in larvae (8.7 in Korea and 2.3% in Japan) (Lee &
Pemberton 2005). The low parasitism caused by
H. brunicornis in larvae may be due to interspe-
cific competition caused by other larval parasi-
toids, such as Ageniaspis fuscicollis (Dalman)
(Hymenoptera: Eulophidae) that share host
stages with this developing ichneumonid (Lee &
Pemberton 2007).
Coccygomimus disparis was the most impor-
tant parasitoid in China, although it caused a
mean parasitism of only 2.1%. The highest per-
centage single collection parasitism in China was
10.5% obtained at Nanzhang in 1991. This para-
sitoid was the second most important parasitoid
in Hokkaido and Honshu, where it produced a
mean parasitism rate of 5.1 and 2.8% respec-
tively. Relatively high parasitism by C. disparis
occurred in both cultivated and abandoned or-
chards. Tylianakis et al. (2007) reported that gen-
eralist natural enemies such as Melittobia acasta
(Walker) (Hymenoptera: Eulophidae) were more
specialized in modified habitats, because of re-
duced attack rates on alternative hosts. This
seems to be what occurred with C. disparis in this
study. An ecological homologue of C. disparis, C.
turionellae (L.) (Hymenoptera: Ichneumonidae),
causes only about 1% parasitism in European ap-
ple ermine moth populations, (Junnikkala 1960;
Balchowsky 1966).
There is a similarity in a taxonomic composi-
tion and the suppressive role of the parasitoid
complexes attacking the apple ermine moth in its
native Asia and Europe. An apparent difference is
the role of Diadegma armilatum (Hymenoptera:
Ichneumonidae). This species is a major parasite
of ermine moths in Europe (Junnikkala 1960),
causing relatively high percentage parasitism,
ranging from 10 to 40% (Balachowsky 1966; Zay-
achavskas et al. 1979). By contrast, we found it to
be an incidental parasitoid of the moth in North-
east Asia, having a mean parasitism rate of 0.3%
in Korea and below 0.05% in the other regions. Di-
adegma armilatum also attacks the Apple ermine
larvae in Northeast Asia but produces the low
rates of parasitism of <0.1 (Lee & Pemberton
2005). Diadegma armilatum was attacked by the
hyperparasites, Pteromalus sp. and Tricomalop-
sis sp. (Hymenoptera: Pteromalidae) in Korea and
Japan. This hyperparasitism reached levels simi-
lar to the parasitism by D. armillatum.
Pteromalus sp. was recorded from all 4 coun-
tries with the mean parasitism rate of 0.2% in
Korea and the rates of <0.02 in other countries,
and Tricomalopsis sp. (0.03%) was recorded from
Honshu only. However the European strain of
the species was designated as a candidate for bi-
ological control of Y. malinellus in United States
because it showed a higher physiological perfor-
mance against Y. malinellus, regardless of its
natal Yponomeuta host species (Y. cagnagellus)
(Herard & Prevost 1997). The French strain of
the wasp was released in 1989-1993 in Washing-
ton, but it has not established (Unruh et al.
2003).
Three species of tachinid parasitoids were
reared from the pupae. The parasitism by Bessa
parallel (Meigen) (Diptera: Tachinidae) was re-
sponsible for 1.1% mortality in Honshu, dominat-
ing the parasitism by tachinids. This parasitoid is
also a larval parasitoid of the apple ermine moth,
producing 18% parasitism in Japan (Lee & Pem-
berton 2005). Bessa parallel is a gregarious lar-
val parasitoid of some serious lepidopteran pests
such as Pieris rapae crucivora Boisduval
(Pieridae) and Pryeria sinica Moore (Zygaenidae)
(Shima 1999). Bessa parallel females lay micro-
type eggs on hosts which are eaten with leaf tis-
sue by the host, and then larvae develop within
the host's body, and finally kill the host (Shima
1999). It was broadly distributed in the Palearctic
region, and has more than 20 recorded lepidopter-
ous hosts (from many families), and has 2-3 gen-
eration per year in Japan (Herting 1960). Nemo-
rilla floralis (Fallen) has been recorded as a larval
parasitoid of Cacoecia piceana Linne (Tortri-
cidae), Cnaphalocrocis medinalis Guenee (Pyral-
idae), Euproctis flava Bremer (Lymantriidae),
and Palpita nigropunctalis Bremer (Pyralidae)
(Yasumatsu & Watanabe 1965). It was reported to
parasitize Yponomeuta padellus (L.) (Friese
1963), and is a larval-pupal parasitoid of Y.
euonymelus (Lee & Pemberton 2009).
Zenillia dolosa was recovered only in Korea
where it had a mean parasitism rate of 1.7%. Zen-
illia dolosa is a solitary larval- pupal parasitoid of
apple ermine moth. This fly lays microtype eggs
on host plants (Ho Thi Thu & Nakamura 2006).
This tachinid caused its highest parasitism in
fifth instars with the rate of 5.5% (Lee & Pember-
ton 2007). This parasitoid has not been known to
attack apple ermine moth in Europe (Affolter &
Carl, 1986) or Japan (Shima H. 1989, personal
communication). It has been previously recorded
from nine lepidopterous insects including Hypan-
tria cunea Drurry (Arctiidae) (Shima 1989, per-
sonal communication) and Hyponomeuta padella
L. (Yponomeutidae) (Herting & Simmonds 1975).
Aprotocetus sp. (Hymenoptera: Eulophidae)
was reared from only 3 pupae that were collected
at Yongmoon, Korea in 1989 during the study and
not elsewhere. We are uncertain that this species
March 2010
Lee & Pemberton: Pupal Parasitoids of Apple Ermine Moth
is an obligatory primary parasitoid as its occur-
rence was quite limited.
The ichneumonid Herpestomus brunicornis
was successfully established from our collections
in northwestern Washington (Unruh et al. 2003).
A total of 252 Korean adult wasps were released
in 1989 and 1990, and 159 Japanese wasps were
released in 1989.
ACKNOWLEDGEMENTS
Ren Wang facilitated and participated in the collec-
tions in China, and Toshio Oku and Takuro Kikuchi
helped identify Japanese collection sites. Jason Pember-
ton assisted with the collections in Japan. We sincerely
thank G. H. Lee and K. S. Lee (formerly USDA-ARS,
Seoul) for technical support. We thank the following for
specimen identifications: J. Papp (Hungarian Natural
History Museum, Budapest, Hungary), H. Shima (Ky-
ushu University, Fukuoka, Japan), R. W. Carlson, E. E.
Grissell, and M. E. Schauff (USDA-ARS, Washington,
DC).
REFERENCES CITED
AFFOLTER, F., AND CARL, K. P. 1986. The Natural Ene-
mies of the Apple Ermine Moth Yponomeuta ma-
linellus in Europe. A Literature Review. C.A.B. In-
ternational Institute of Biological Control,
Del6mont, Switzerland. 29 pp.
BALACHOWSKY, A. S. 1966. Entomology Applied to Agri-
culture. Tome II. L6pidoptbres. Paris, Masson et Cie.
1:99-145.
FOREST RESEARCH INSTITUTE (FRI) 1969. A List of For-
est Insect Pest in Korea. Forest Research Institute.
Seoul, Korea. 458 pp.
FRIESE, G. 1963. Die parasiten der palaarktischen
Yponomeutidae (Lepidoptera, Hymenoptera,
Diptera). Beitr. Entomol. 13: 311-326.
HERARD, F., AND PREVOSt, G. 1997. Suitability of
Yponomeuta malinellus and Y cagnagellus (Lepi-
doptera: Yponomeutidae) as hosts of Diadegma
armillata (Hymenoptera: Ichneumonidae). Environ.
Entomol. 26: 933-938.
HERTING, B. 1960. Biologie der westpalaarletischen
Raupenfligen. Dipt., Tachinidae. Monogr. Zur. An-
gew. Entomol. 16: 43-44.
HERTING B., AND SIMMONDS, F. J. 1975. A Catalogue of
Parasites and Predators of Terrestrial Arthropods.
Section A. Vol. 4. Microlepidoptera. C.A.B. Common-
wealth Institute of Biological Control, Farnham Roy-
al, UK. 218 pp.
Ho THI THU, G., AND NAKAMURA, S. 2006. Life history
parameters of the parasitoid fly Zenillia dolosa
(Diptera: Tachinidae), p. 109 In M. Suwa [ed.], Ab-
stracts Volume, 6th International Congress of
Dipterology. Fukuoka International Congress Cen-
ter, Fukuoka.
ISSIKI, S., MUTUURA. A., YAMAMOTO Y., HATTORI, I.,
KUROKO, H., KODAMA, T., YASUDA, T., MORIUTI, S.,
AND SAITO, T. 1975. Early Stages of Japanese Moths
in Colour. Vol. II. Hoikusha Publishing C., Ltd., Osa-
ka, 237 pp.
JUNNIKKALA, E. 1960. Life history and insect enemies of
Hyponomeuta malinellus Zell. (Lep. Hyponomeutidae)
in Finland. Ann. Zool. Soc. "Vanamo" 21: 1-44.
KUHLMANN, U. 1996. Biology and ecology of Herpesto-
mus brunnicornis (Hymenoptera: Ichneumonidae), a
potential biological control agent of the apple ermine
moth (Lepidoptera: Yponomeutidae). Internat. J.
Pest Manage. 42: 131-138.
LEE, J. H., AND PEMBERTON, R. W. 2005. Larval parasi-
toids of the apple ermine moth, Yponomeuta ma-
linellus in Korea, Japan, and China. BioControl 50:
247-258.
LEE, J. H., AND PEMBERTON, R. W. 2007. Seasonal phe-
nology and stage-specific parasitism of the apple er-
mine moth, Yponomeuta malinellus Zeller, in Korea.
Entomol. Res. 37: 54-59.
LEE, J. H., AND PEMBERTON, R. W. 2009. Parasitoid com-
plex of the bird cherry ermine moth Yponomeuta
euonymellus in Korea. Entomol. Res. 39: 201-206.
LILL, J. T., MARQUIS, R. J., AND RICKLEFS, R. E. 2002.
Host plants influence parasitism of forest caterpil-
lars. Nature 417: 170-173.
MORIUTI, S. 1977. Fauna Japonica, Yponomeutidae S.
LAT. (Insect: Lepidoptera), Keigaku Publishing C.
Tokyo, Japan. 327 pp.
SHIMA, H. 1999. Host-Parasite Catalog of Japanese Ta-
chinidae (Diptera). Makunagi, Acta Dipt. 25: 1-108.
SHIN, U. H., PARK, K. T., AND NAM, S. H. 1983. Illustrat-
ed Flora & Fauna of Korea, Vol. 27 Insecta (IX), Sam-
hwa Publishing Co., Ltd. Seoul, 1053 pp.
SAS INSTITUTE. 2004. SAS/STAT User's Guide. Version
9.1, SAS Institute, Cary, NC.
TYLIANAKIS, J. M., TSCHARNTKE, T. AND LEWIS, O. T.
2007. Habitat modification alters the structure of
tropical host-parasitoid food webs. Nature 445: 202-
205
UNRUH, T. R., CONGDON, B. D., AND LAGASA, E. 1993.
Yponomeuta malinellus Zeller (Lepidoptera:
Yponomeutidae), a new immigrant pest of apples in
the Northwest: Phenology and distribution expan-
sion, with notes on efficacy of natural enemies. Pan-
Pac. Entomol. 69: 57-70.
UNRUH, T., SHORT, R., HEARD, F., CHEN, K., HOPPER,
K., PEMBERTON, R. W., LEE, J. H., ERTLE, L., SWAN,
K., FUESTER, R., AND LAGASA, E. 2003. Introduction
and establishment of parasitoids for biological con-
trol of the apple ermine moth, Yponomeuta malinel-
lus (Lepidoptera: Yponomeutidae), in the Pacific
Northwest. Biol. Control 28: 332-345.
YASUMATSU, K., AND WATANABE, C. 1965. A tentative
catalogue of insect natural enemies of injuries in-
sects in Japan. Part 2. Host parasite-predator cata-
logue. Entomological Laboratory, Kyushu Universi-
ty, Fukuoka, 116 pp.
ZAYANCHKAUSKAS, P. A., IONAITIS, V. P., AND YAKIMAV-
ICHYUS, A. B. 1979. Parasites of apple pests
Yponomeuta malinella, Simaethis pariana, natural
control, Lithuanian SSR. Zasch. Rast. 5: 23 (in Rus-
sian).
Florida Entomologist 93(1)
March 2010
REPELLENCY OF THE BIOPESTICIDE, AZADIRACHTIN, TO WIREWORMS
(COLEOPTERA: ELATERIDAE)
RON CHERRY AND GREGG NUESSLY
Everglades Research and Education Center, 3200 E. Palm Beach Road, Belle Glade, FL 33430
ABSTRACT
The neem tree Azadirachta indica A. Juss produces numerous allelochemical compounds.
The most effective active ingredient inA. indica based insecticides is azadirachtin. We found
that azadirachtin did not cause mortality, antifeeding responses, or change growth rate of
Melanotus communis (Gyllenhal) wireworms. However, azadirachtin treated soil was repel-
lent to the wireworms. This is the first report of azadirachtin being repellent to any of the
large and economically important family of Elateridae.
Key Words: Neem, azadirachtin, wireworms, Melanotus communis
RESUME
El arbol de neem,Azadirachta indica A. Juss produce compuestos alleloquimicos numerosos.
El ingredient active mas efectivo en insecticides de baseA. indica es azadirachtin. Descu-
brimos que azadirachtin no caus6 la mortalidad o respuestas de no alimentarse, ni cambiar
la tasa de crecimiento del gusano alambre, Melanotus communis (Gyllenhal). Sin embargo,
el suelo tratado con azadirachtin fue repelente a los gusanos alambres. Este es el primer in-
forme de que azadirachtin es un repelente a cualquiera de los Elateridae, una familiar con
numerosas species y economicamente important.
Wireworms are important insect pests of Flor-
ida sugarcane. Of the different wireworm species
found in Florida sugarcane, Melanotus communis
(Gyllenhal) is the most important pest (Cherry
2007). Hall (1985) noted that M. communis dam-
aged sugarcane by feeding on root primordia,
buds, and roots as well as directly on the stem of
young plants. Hall (1990) later reported that
tillering during the growing season compensated
for early stand losses due to wireworm damage.
Wireworms are primarily a pest in newly planted
sugarcane although the insects are also found in
ratoon sugarcane.
Phytochemicals have been used for many years
to control insect pest damage on agricultural
crops (Lee et al. 1997). Plants produce a wide
range of secondary metabolites (e.g., terpenoids,
alkaloids, and phenolics) that often possess insec-
ticidal, fungicidal, bactericidal, antiviral, anti-
feeding, or growth retardant properties (Singh et
al. 1989; Benner 1993; Wilson et al. 1997).
The neem tree Azadirachta indica A. Juss
produces numerous allelochemical compounds.
The most effective active ingredient in A. indica
based insecticides is azadirachtin. This com-
pound affects a large number of pest insects, act-
ing as a repellent, feeding and oviposition deter-
rent, growth regulator, and reproduction inhibi-
tor. Azadirachtin has been shown to exhibit bio-
logical activity against >400 insect species.
However, little is known about the effects of this
insecticidal plant on sugarcane pests (Garcia et
al. 2006).
In Florida, organic farmers such as some sug-
arcane growers cannot use synthetic chemicals
and have no effective alternative for wireworm
management besides field flooding (Hall &
Cherry 1993), which is not always readily avail-
able. Our objective was to determine if azadirach-
tin had any effect on wireworms that attack Flor-
ida sugarcane. This information may provide an
organic control option for Florida sugarcane
growers. Moreover, these data will provide insight
into the effect of azadirachtin on soil insect pests
for which there is little information. For example,
in spite of the numerous publications on aza-
dirachtin-insect relations, no publication exists
on wireworms (Family Elateridae), which are ma-
jor soil insect pests on many crops.
MATERIALS AND METHODS
Melanotus communis wireworms (larvae) were
collected by digging under sugarcane stools in
commercial sugarcane fields. After collection,
wireworms were stored in moist muck soil with
sliced carrots for food at 18C until used in tests.
Mortality Tests
Mortality to wireworms by azadirachtin was
tested in buckets. Buckets were 23 cm high by 23
cm diameter. Moist muck soil (80% organic mat-
ter) was collected from sugarcane fields and in-
sects and debris removed to insure homogeneity.
Thereafter the soil was placed 15 cm deep into
Cherry & Nuessly: Biopesticide Repellency
each bucket. Five small carrot cubes (1 cm2/cube)
were put in the soil in each bucket to provide food
for the wireworms.
Soil insecticides are typically applied over sug-
arcane seedpieces in rows at sugarcane planting
for wireworm protection. Three treatments, the
untreated control, Thimet 20-G, and Aza-Direct
were used. Rates were calculated based on a 0.3-
m band application in row and 1.5 m between sug-
arcane rows, which is standard in Florida sugar-
cane. Thimet 20-G (AI = 20% phorate) is a soil in-
secticide commonly used for wireworm control in
Florida sugarcane and was applied at full field
rate of 22.3 kg/ha. Aza-Direct (Gowan Co. Yuma,
AZ) is an all natural azadirachtin-based insecti-
cide derived from the Neem tree A. indica. The
Aza-Direct (AI = 1.2% azadirachtin) was applied
at 7.3 L/ha and mixed with water for a total appli-
cation rate of 663 L/ha. This latter rate was se-
lected by the manufacturer (Gowan Company,
Yuma, AZ) as a feasible rate for testing against
the wireworms in sugarcane under muck soil con-
ditions.
Thimet and Aza-Direct were applied evenly on
the soil surface and then stirred throughout the
soil. This procedure simulates insecticide applica-
tion in sugarcane furrows at planting and the
subsequent covering with soil. Thereafter, 6 me-
dium size wireworms were dropped into each
bucket. The mean weight of wireworms was 0.07g
(range 0.05 to 0.12) and wireworms were selected
to insure no significant weight differences be-
tween treatments. Buckets were then covered
with clear plastic to maintain soil moisture and
stored for 14 d at 25C. Thereafter, buckets were
emptied and live wireworms counted. Each repli-
cation consisted of 1 bucket for each of the 3 treat-
ments. Five replications were conducted during
Feb-Mar 2007 and Tukey's test was used to sepa-
rate means (SAS 2009).
Antifeeding Tests
Antifeeding tests were conducted with the aza-
dirachtin rate previously described. Medium size
wireworms were starved 1 week previous to test-
ing to stimulate a feeding response. Testing was
conducted in metal circular pans. Metal was used
because it is odorless. Each pan was 24 cm diam-
eter and 4 cm deep. Moist muck was placed 3 cm
deep in the pan so that wireworms could not es-
cape by climbing out. The pan was marked into 3
equal size sectors, i.e., 120 apart. Three treat-
ments were tested in each pan. The first was a 4-
g piece of fresh carrot. This carrot consisted of the
hard outer part of a carrot to reduce decomposi-
tion and show feeding damage rather than softer
carrot interior. The second was the same as the
first treatment except the carrot piece was dipped
into a solution of the application rate of aza-
dirachtin noted earlier and allowed to drain dry
on a metal screen. The third was the same as the
first treatment except that the carrot piece was
wrapped in a fine mesh metal screen. This screen
allowed air, moisture, mites, and nematodes to
pass, but excluded wireworms from feeding on the
carrot. Each carrot piece was placed in soil 5 cm
from the pan edge in the middle of 1 of the 3 pan
sectors and covered with soil. Thereafter, 25 me-
dium size wireworms (approx. 0.07g each) were
released in the pan center. Hence, the wireworms
had free access to feed on carrots in treatments
one and two, but were excluded from the carrot in
treatment three. The pan was then covered with
aluminum foil and stored at 25C for 4 d. At the
end of 4 d, carrots were recovered, loose soil
brushed off, feeding damage noted (i.e., holes),
and weighed. Ten replicates were conducted dur-
ing Jan-Feb, 2009 and Tukey's test used to sepa-
rate means (SAS 2009).
Growth Rate Tests
Growth rate tests were conducted with the
azadirachtin soil mixture described previously.
Wireworms were starved 1 week previous to test-
ing to enhance a feeding response. Soil (control or
azadirachtin treated) was put into metal cans
that were 6 cm diameter x 2 cm high. A 0.5-g car-
rot slice was also placed in the soil in each can for
food. Wireworms were selected within the range
of 0.060 to 0.090 g/wireworm for testing and were
selected for similar weights between the 2 treat-
ments. Cans were stored at 25C and opened after
7 d to add new carrot if necessary. Cans were
opened again 14 d after test initiation and wire-
worms weighed. Ten replicates were conducted
and t-test analysis (SAS 2009) performed to com-
pare mean weight changes in the 2 treatments.
Repellency Tests
Repellency tests were conducted with the aza-
dirachtin soil mixture described previously, again
to simulate field application. Testing was con-
ducted in a glass container measuring 86 x 10 x
12 cm deep with a glass top. A glass container was
used because glass is odorless. Untreated soil was
put 10 cm deep into one half of the container and
azadirachtin treated soil into the other half. Ten
medium size wireworms were placed on the top of
the soil in the middle of each of the 2 soils. Wire-
worms are mobile and the soil was not compacted,
hence allowing the wireworms to move freely be-
tween the 2 soils. The container was fully covered
with aluminum foil for total darkness and then
held 72 h at 25C. Thereafter, the container was
opened and the location of the wireworms in the 2
soils noted. The azadirachtin soil was repellent to
wireworms during the 0 to 72 h period after aza-
dirachtin application. Hence, to determine if aza-
dirachtin soil had any residual repellency, addi-
Florida Entomologist 93(1)
tional tests were conducted. In these tests, wire-
worms were placed into the container 14 d or 28 d
after treatment and again recovered after 3 d and
their location noted. Ten replicates were con-
ducted for each of the 3 time periods and t-test
analysis (SAS 2009) made to compare mean num-
ber of wireworms in the 2 soil treatments at each
time period.
RESULTS
Mortality tests
Wireworm survival after soil treatment is shown
in Table 1. Control survival was 100%, which is un-
usual for an insect. However, wireworms are typi-
cally hard to collect, but have high survival after col-
lection so that the high survival in this test is not ab-
normal. The Aza-Direct treatment was not signifi-
cantly different from the control indicating the
neem product caused little, if any, mortality to the
wireworms. In contrast, the Thimet treatment had
significantly lower wireworm survival than the con-
trol and Aza-Direct treatment. This latter state-
ment shows the experimental design was correct for
showing wireworm mortality in the presence of an
insecticidal compound.
Antifeeding Tests
Carrot weight (g) in different carrot treatments
after exposure to wireworm feeding is shown in Ta-
ble 2. Untreated carrots protected by screen
weighed significantly more than untreated unpro-
tected carrots or Aza-Direct treated unprotected
carrot pieces. All carrots in all replications except
screened carrots showed visual feeding damage, in-
cluding wireworms in carrots. There was no signifi-
cant difference in carrot weight between untreated
carrots versus Aza-Direct treated carrots. In total,
these data show that the wireworms were actively
feeding and that Aza-Direct did not reduce feeding
on treated carrot pieces.
Growth Rate Tests
In the test to determine if Aza-Direct treated
soil affected growth rates of wireworms, wire-
TABLE 1. WIREWORM SURVIVAL AFTER 14 D IN DIFFER-
ENT SOIL TREATMENTS.
Treatment Mean' SD N2 Range
Aza-Direct 5.0 A 1.0 5 4-6
Control 6.0 A 0 5 6-6
Thimet 1.0 B 0.7 5 0-2
'Means followed by the same letter are not significantly dif-
ferent (alpha = 0.05) using Tukey's test.
'Replications. Six wireworms were used initially per replica-
tion.
TABLE 2. CARROT WEIGHT (G) IN DIFFERENT CARROT
TREATMENTS AFTER EXPOSURE TO WIREWORM
FEEDING.
Treatment Mean' SD N2 Range
Aza-Direct 2.6 B 1.1 10 1.3-3.9
Untreated 2.7 B 1.1 10 1.3-3.7
Screened 4.1 A 0.1 10 4.0-4.1
1Means followed by the same letter are not significantly dif-
ferent (alpha = 0.05) using Tukey's test.
Replications.
worms of comparable weights had been selected
for use in the Aza-Direct treatment versus the
controls. The mean SD weights of wireworms at
the start of the test were 0.078 g 0.009 and
0.078 0.010 for controls and Aza-Direct treat-
ments, respectively. Obviously, these means were
not significantly different (t = 0.13, 18 df, P =
0.89). After 14 d, wireworms in both treatments
grew as indicated by a positive weight change.
The mean SD weight change in wireworms was
0.004 0.004 and 0.006 0.003 for controls and
Aza-Direct treatments, respectively. The means
were not significantly different (t = -1.15, 18 df, P
= 0.27) showing that the Aza-Direct soil treat-
ment had no significant effect on wireworm
growth.
Repellency Tests
Repellency of azadirachtin to wireworms at
different times after soil application is shown in
Table 3. An analysis with a t-test showed there
were significantly more wireworms in controls
than azadirachtin treated soil from 0-3 d, and 14-
17 d after treatment, but not 28-31 d after treat-
ment. The percentage of wireworms in the treated
soil increased over time showing the loss of repel-
lency over time.
DISCUSSION
Wireworms (Elateridae) consist of >800 spe-
cies distributed worldwide. They are significant
pests wherever they occur infesting a wide vari-
ety of crops. Control strategies are primarily
based on the use of synthetic soil insecticides.
However, these chemicals may have adverse envi-
ronmental effects and/or pose health hazards. In
addition, organic farmers are looking for alterna-
tives to synthetic pesticides that meet organic
production guidelines (Waliwitiya et al. 2005).
Few studies have assessed the efficacy of botani-
cal formulations against subterranean root herbi-
vores (Ranger et al. 2009). Examples are evalua-
tions of botanical products against scarab pests in
sugarcane (Abdullah et al. 2006) and nurseries
(Ranger et al. 2009). Weathersbee and Tang (2002)
March 2010
Cherry & Nuessly: Biopesticide Repellency
TABLE 3. REPELLENCY OF AZADIRACHTIN (AZ) TO WIREWORMS AT DIFFERENT TIMES AFTER SOIL APPLICATION.
0-3 d1 14-17 d2 28-31 d3
control AZ control AZ control AZ
Mean SD 13.3 2.1 6.5 2.4 11.4 1.9 8.6 1.9 9.2 3.4 10.2 5.1
Range 10-16 3-10 9-15 5-11 5-13 9-16
% Total 67 33 57 43 47 53
A t-test showed that the control mean was significantly greater (P < 0.0001) than that of AZ.
'A t-test showed that the control mean was significantly greater (P < 0.0005) than that of AZ.
'A t-test showed that there was no significant difference (P > 0.05) between means.
reported on the effect of neem seed extract on feed-
ing, growth, survival, and reproduction of the curcu-
lionid, Diaprepes abbreviatus (L). There are hun-
dreds of publications on the effects of neem products
on insects. However, no studies have been con-
ducted on the use of neem for wireworms.
We found that azadirachtin did not cause mor-
tality, antifeeding responses, or change growth
rate of wireworms at the rate used in this study.
However, azadirachtin treated soil was repellent
to wireworms at up to 17 d after application. This
repellency was gone by 28-31 d after application.
Earlier studies have shown that some insecticides
such as aldrin and lindane are repellent to wire-
worms (Vernon et al. 2008). However, this is the
first report of azadirachtin being repellent to any
of the large and economically important family of
Elateridae. Moreover, this is important because
repellency in itself may be important in organic
farming practices. For example, when corn is pro-
tected from wireworm damage during the first 3
weeks of growth, economic damage may be mini-
mized. Therefore, acceptable qualities of a biopes-
ticide include not only direct toxicity but also re-
pellency effects on the pest (Waliwitiya et al.
2005). Wireworms are pests in a wide range of ag-
ricultural crops, which have a wide range of eco-
nomic damage levels. Future research should be
conducted to determine if repellency of azadirach-
tin at different rates may be useful in reducing
wireworm damage in both sugarcane and other
agroecosystems, especially those involved in or-
ganic farming.
ACKNOWLEDGMENT
This research was supported by Gowan company.
REFERENCES CITED
ABDULLAH, M., BISWAS, M., AND RAHMAN, H. 2006.
Evaluation of botanical products against some major
insect pests of sugarcane. Planter. 82: 463-469.
BENNER, J. P. 1993. Pesticidal compounds from higher
plants. Pestic. Sci. 39: 95-102.
CHERRY, R. 2007. Seasonal population dynamics of wire-
worms (Coleoptera: Elateridae) in Florida sugarcane
fields. Florida Entomol. 90: 426-430.
GARCIA, J., GRISOTO, E., VENDRAMIM, J., AND BOTELHO,
P. 2006. Bioactivity of neem, Azadirachta indica,
against spittlebug Mahanarva fimbriolata (Hemi-
ptera: Cercopidae) on sugarcane. J. Econ. Entomol.
99: 2010-2014.
HALL, D. 1985. Damage by the corn wireworm, Melano-
tus communis (Gyll.) to plant cane during germina-
tion and early growth. J. American Soc. Sugar Cane
Tech. 4: 13-17.
HALL, D. 1990. Stand and yield losses in sugarcane
caused by the wireworm Melanotus communis (Co-
leoptera: Elateridae) infesting plant cane in Florida.
Florida Entomol. 73: 298-302.
HALL, D., AND CHERRY, R. 1993. Effect of temperature
on flooding to control the wireworm Melanotus com-
munis (Coleoptera: Elateridae). Florida Entomol.
76: 155-160.
LEE, S., TSAO, R., PETERSON, C., AND COATS, J. R. 1997.
Insecticidal activity of monoterpenoids to western
corn rootworm (Coleoptera: Chrysomelidae), two-
spotted spider mite (Acari: Tetranychidae), and
house fly (Diptera: Muscidae). J. Econ. Entomol. 90:
883-892.
RANGER, C., READING, M. OLIVER, J., MOYSEEDNED, J.,
AND YOUSSEF, N. 2009. Toxicity of botanical formula-
tions to nursery-infesting white grubs. (Coleoptera:
Scarabaeidae). J. Econ. Entomol. 102: 304-308.
SAS INSTITUTE. 2009. SAS Systems for Windows. SAS
Institute, Cary NC.
SINGH, D., SIDDIQUI, M. S., AND SHARMA, S. 1989. Re-
production retardant and fumigant properties in es-
sential oils against rice weevil (Coleoptera: Curcu-
lionidae) in stored wheat. J. Econ. Entomol. 82: 727-
733.
VERNON, R., TOLMAN, J., SAAVEDRA, H., CLODIUS, M.,
AND GAGE, B. 2008. Transitional sublethal and le-
thal effects of insecticides after dermal exposures to
five economic species of wireworms (Coleoptera: Ela-
teridae). J. Econ. Entomol. 101: 365-374.
WALIWITIYA, R., ISMAN, M., VERNON, R., AND RISEMAN,
A. 2005. Insecticidal activity of selected monoterpe-
noids and rosemary oil to Agriotes obscurus (Co-
leoptera: Elateridae). J. Econ. Entomol. 98: 1560-
1565.
WEATHERSBEE, A., AND TANG, Y. 2002. Effect of neem
seed extract on feeding, growth, survival, and repro-
duction of Diaprepes abbreviatus (Coleoptera: Cur-
culionidae). J. Econ. Entomol. 95: 661-667.
WILSON, C. L., SOLAR, J. M., EL GHAOUTH, A., AND WIS-
NIEWSKI, M. E. 1997. Rapid evaluation of plant ex-
tracts and essential oils for antifungal activity
against Botrytis cinerea. Plant Dis. 81: 204-210.
Florida Entomologist 93(1)
March 2010
AN ARTIFICIAL DIET FOR DIAPREPES ABBREVIATUS
(COLEOPTERA: CURCULIONIDAE) OPTIMIZED FOR LARVAL SURVIVAL
STEPHEN L. LAPOINTE, RANDALL P. NIEDZ AND TERENCE J. EVENS
USDA-ARS, U.S. Horticultural Research Laboratory, 2001 South Rock Road, Ft. Pierce, FL 34945
ABSTRACT
The root weevil Diaprepes abbreviatus (L.) has been reared since 1992 on an artificial diet
first reported in 1982. Recently, we have shown that several ingredients included in the orig-
inal diet have little or no effect on insect performance. Here we examined the effects of 2
principal drivers (cottonseed meal and wheat germ) on weight gain and survival of larval D.
abbreviatus in varying proportions along with a non-nutritive filler (cellulose). We employed
a geometric design to evaluate amount and proportion combined with response surface mod-
els to identify optimal proportions for larval weight gain, larval survival, and development
rate. All larval responses measured lead to the conclusion that cottonseed meal is the only
major nutritive component, in addition to standard vitamin and salt mixes, required for a
successful artificial diet for rearing larvae ofD. abbreviatus to pupation.
Key Words: Diaprepes root weevil, artificial diet, response surface model, mixture optimization
Supplemental material online at http//www.fcla.edu/FlaEnt/fe931.htm#InfoLinkl.
RESUME
El curculionido Diaprepes abbreviatus (L.) ha sido criado desde el ano 1982 sobre una dieta
artificial. Recientamente, hemos probado que various ingredients de esa dieta original tie-
nen poco o ningun efecto sobre el desempeno del insecto. En el present studio, estudiamos
los efectos que resultaron cuando se variaron las proporciones de dos ingredients principa-
les (harina de semillas de algod6n y g6rmen de trigo) y un relleno sin valor nutritive (celu-
losa) sobre el peso y supervivencia de larvas de D. abbreviatus. Se emple6 un diseno
geom6trico junto con modelaje de superficie de respuesta para evaluar cantidad y proporci6n
y entonces identificar proporciones optimas para ganancia de peso, supervivencia y taza de
desarrollo de las larvas. Todas las respuestas larvales medidas llevan a la conclusion de que
la harina de semilla de algodon sea el unico ingredient nutritivo, ademas a las mezclas es-
tandares de vitamins y sal, requerido para una dieta artificial exitosa para criar larvas de
D. abbreviatus hasta la pupaci6n.
Translation provided by the authors.
The ability to rear insects on artificial diets is
often an essential component of research and de-
velopment of pest control strategies. The root
weevil Diaprepes abbreuiatus (L.) (Coleoptera:
Curculionidae) has been continuously reared
since 1992 on an artificial diet developed by Bea-
vers (1982) with procedures described by
Lapointe & Shapiro (1999). That diet was shown
to contain ingredients with little or no effect on
the growth or survival of D. abbreuiatus; 3 ingre-
dients (corn starch, cottonseed meal and wheat
germ) were identified as principal drivers of lar-
val weight gain and survival (Lapointe et al.
2008). The application of response surface meth-
ods (RSM) based on geometric experiment de-
signs is particularly appropriate for determining
optimal responses to insect diet composition and
visualizing complex interactions of diet mixture
components (Clancy & King 1993). Our ongoing
objective is to define a diet that will produce large
numbers of weevils of normative weight, i.e., com-
parable to feral D. abbreuiatus. To accomplish
this, we constructed a 3-component geometric de-
sign that included 2 principal drivers (cottonseed
meal, wheat germ) identified previously
(Lapointe et al. 2008) and cellulose as a non-nu-
tritive filler that could be scaled to produce the de-
sired response. We report here the effect of vary-
ing proportion and amount of diet components
(cottonseed meal, wheat germ, and cellulose) on
larval survival and weight gain.
Mixtures, such as insect diets, require a special
statistical approach based on mixture polynomi-
als developed by Scheffe (Cornell 2002). Mixtures
are inherently constrained because the propor-
tion of one component of a mixture cannot be var-
ied without simultaneously varying the propor-
tion of all other components. Scheffe polynomials
also do not contain an intercept because it is im-
possible to generate a mixture that contains all in-
gredients set to zero. The result is that a degree of
freedom is lost and the intercept is contained in
the linear coefficients (Anderson & Whitcomb
2005). These peculiar qualities of mixtures require
appropriate experiment designs, particularly when
attempting to improve insect diets where the ob-
Lapointe et al.: Optimal Diet for Diaprepes Larvae
jective is to identify component combinations that
result in optimal signal (response) and not to sim-
ply compare a particular set of treatment combi-
nations. For the latter, ANOVA and post-hoc
means tests may be adequate. But if the experi-
menter's need is a more complete description of
the experiment design space and identification of
trends and optima, then mixture designs are re-
quired.
Clancy & King (1993) used RSM to look at the
effect of calcium, magnesium, and phosphorous
on western spruce budworm performance. How-
ever, they did not use a mixture design based on
the Scheff6 polynomial and experienced the diffi-
culty of independently varying cations and ions
(see Niedz & Evens (2006) regarding experimen-
tal designs for exploring cation and anion ef-
fects). As a result, their study ignored the effect
of proportionality and their design was con-
strained and inherently confounded, as the au-
thors recognized.
RSM seeks to identify trends and optimal com-
binations, often the objective of experimentation
in general and of mixtures in particular. A para-
dox of RSM is it's ability to produce compelling vi-
sual imagery of responses that are easily inter-
preted by readers without requiring an under-
standing of the underlying principals of design
and modeling (Anderson & Whitcomb 2005). The
pairing of mixture designs with RSM now avail-
able in modern statistical software programs is
particularly powerful and appropriate for use in
diet development. Here we use a mixture design
combined with RSM to determine the effect of
proportionality and amount of diet ingredients on
survival and weight gain ofD. abbreviatus.
MATERIALS AND METHODS
All stages ofD. abbreviatus were reared at the
U.S. Horticultural Research Laboratory, Fort
Pierce, FL (Lapointe & Shapiro 1999; Lapointe et
al. 2008). Eggs were collected from caged adults
on wax-paper strips (Wolcott 1933) and allowed to
hatch in plastic containers. Standard procedure
for preparing purchased diet for larval develop-
ment was as follows: 40 L of water were combined
with 725 g agar and heated to near boiling. While
stirring, 9.5 kg of commercially prepared insect
diet (product no. F1675, Bio-Serv, Inc., French-
town, NJ, similar to that developed by Beavers
(1982)) were added to the water/agar mixture,
mixed, and heated to boiling. Methyl paraben (9 g
dissolved in 10 mL 95% EtOH, Sigma-Aldrich)
and 9 g of benzoic acid (Sigma-Aldrich) in solution
with boiling deionized water were added as pre-
servatives. After 10 min of boiling, ~15 mL of diet
was dispensed into 30-mL plastic cups and al-
lowed to cool and dry in a laminar flow hood. Ne-
onate larvae were surface sterilized for ~2 min in
0.25% hypochlorite solution (CloroxTM), rinsed
with deionized water, and placed in cups with
diet. Each diet cup was infested with approxi-
mately 12 neonate larvae (<24 h old) and 10 cups
were infested for each experimental diet (treat-
ment) for a total of approximately 120 neonate
larvae per diet. Diet cups were capped and placed
in trays enclosed in zip-lock plastic bags and held
in a dark environmental chamber at 25C and 60-
70% RH. Humidity within the diet cups held in
sealed plastic bags probably exceeded 95%
(Lapointe 2000). Cups were opened 28 d after in-
festation and larvae were counted and weighed. A
total of 30 larvae per treatment were randomly
selected and transferred to fresh diet cups to com-
plete development (1 larva per cup). Larvae pu-
pated in the diet cups. Cups were inspected on
weekdays to determine date of pupation. The date
and time of an observed event (e.g., death, pupa-
tion) were calculated as the midpoint between the
times of the observed change and the previous in-
spection. Time to pupation was recorded for 6
months from date of infestation with neonates.
Insects that failed to pupate within 6 months
were discarded. Survival was determined by the
number of larvae alive at transfer and by the
number of larvae that successfully pupated (sur-
vival of pupae to adult in this trials and in previ-
ous experiments was uniformly high, approach-
ing 100%). Survival from neonate to adult was
calculated by multiplying the percent survival of
neonates to 28 d by the percent survival of larvae
from transfer to adult.
A previous study showed that the F1675 diet
could be diluted with cellulose with no significant
reduction in insect weight gain or survival
(Lapointe et al. 2003). Subsequently, we showed
that at least 3 ingredients in the F1675 diet have
little to no effect on survival or development
(casein, soy protein isolate, and sucrose)
(Lapointe et al. 2008). Therefore, we constructed a
modified D-optimal mixture design sufficient to
satisfy a Scheff6 cubic polynomial response sur-
face model (Cornell 2002) for 3 diet ingredients
(cellulose, cottonseed meal, and wheat germ) in
addition to constant amounts of salt and vitamin
mixtures (Table 1). All diets contained 2.5%
Vanderzant vitamin mix (bio-mix #9796, Bio-
Serv, Frenchtown, NJ), 2.5% Wesson salt mix (bio-
mix #9798, Bio-Serv), 1.5% methyl paraben and
0.5% sorbic acid (Sigma-Aldrich). In addition to
those needed to satisfy model terms, points were
added to estimate lack of fit (LOF). Several points
were duplicated to attain sufficient degrees of
freedom (df) to estimate pure error across the de-
sign space and to minimize leverage for all points
(Weisberg 1985). The resulting design (Fig. 1) had
5 model, 9 lack of fit, and 6 pure error degrees of
freedom (Myers & Montgomery 2002). The LOF
diet blends were chosen so that they could be used
to satisfy higher order model coefficients if neces-
sary.
Florida Entomologist 93(1)
TABLE 1. PROPORTION OF 3 DIET INGREDIENTS VARIED IN
A 3-COMPONENT BLEND EXPERIMENT TO MEA-
SURE LARVAL GROWTH OF D. ABBREVIATUS. CL
= CELLULOSE, CM = COTTONSEED MEAL, WG =
WHEAT GERM.
Blend CL CM WG
1 0.70 0.00 0.30
2 0.97 0.00 0.03
3 0.90 0.05 0.05
4 0.70 0.20 0.10
5 0.97 0.00 0.03
6 0.70 0.00 0.30
7 0.88 0.12 0.00
8 0.79 0.10 0.11
9 0.97 0.03 0.00
10 0.70 0.15 0.15
11 0.83 0.00 0.17
12 0.70 0.20 0.10
13 0.79 0.21 0.00
14 0.79 0.10 0.11
15 0.70 0.10 0.20
16 0.70 0.30 0.00
17 0.88 0.00 0.12
18 0.97 0.03 0.00
19 0.83 0.17 0.00
20 0.70 0.30 0.00
21 0.79 0.00 0.21
RESULTS AND DISCUSSION
A summary of the ANOVA, lack-of-fit tests, the
best fitting models and the R2 statistics for several
responses are presented in Table 2. Some model
Cottonseed meal
Wheat germ
Fig. 1. Design space for a 3-component blend experi-
ment showing coordinates of experimental and valida-
tion diet blend proportions (black points). Points
accompanied by "2" were replicated. Shaded area not
sampled by the experiment design.
fits were improved by backward regression and are
designated as "reduced". Some responses required
transformation as per Box-Cox analyses (Box &
Cox 1964). The remaining diagnostics were all
within acceptable limits, i.e., the data appeared
normal and displayed a constant variance, there
were no outlier-t points, no points that exceeded a
Cook's distance of one (Cook & Weisberg 1982),
and the predicted versus actual value plots showed
close agreement (data not shown). The 3 statistics
(R2, R2ad and R2 d) were clustered with a difference
less than 0.2. &he lack-of-fit tests were not signifi-
cant, indicating that additional variation in the re-
siduals could not be removed with better models.
The models (Table 2) were significant (a = 0.05), in-
dicating significant factor effects on the response
variables, and were considered of sufficient quality
to navigate the experimental design space and to
predict new observations. The ANOVAs revealed
multiple significant terms that are indicative of
important component effects and interactions. The
regression coefficients are reported in coded terms.
Thus, they are directly comparable and provide in-
formation on how each term contributes to the
shape of the response surfaces.
Survival of early instars from neonate (24 h) to
28 d of age ranged from 19 to 102 of the approxi-
mately 120 neonates used to infest each diet. The
response surface model was significant (P =
0.0017) but the R2ad value was 0.45, indicating
that the model explained approximately one-half
of the observed variance. The linear response
model (Fig. 2A) indicated that larval survival to
28 d was maximal (predicted value of 77%) at the
highest content of cottonseed meal (the cotton-
seed meal apex in Fig. 1) and minimal (predicted
value of 26%) at the wheat germ apex.
Standard rearing procedure for D. abbreviatus
includes a transfer of larvae from cups containing
multiple larvae to individual cups at 28 d of age.
Survival of larvae from transfer to adult emer-
gence ranged from 0 to 97%. The response surface
was highly significant (P < 0.0001) and the Ra2d
value was 0.99 (Table 2). In contrast to neonate
survival to 28 d, survival of larvae from transfer
to adult was predicted by the model to be optimal
at a blend that included both cottonseed meal and
wheat germ (range of predicted diet proportions
were 0.84 0.86, 0.07 0.13, and 0.04 0.09 for cel-
lulose, cottonseed meal, and wheat germ, respec-
tively) (Fig. 2B).
A response surface was also constructed for the
calculated survival of neonates to adult (percent
survival of neonates to transfer multiplied by per-
cent survival from transfer to adult). Survival of
neonates to adult varied from 0 to 74%. The re-
sponse surface (Fig. 2C) was highly significant (P
< 0.0001) and the R2a value was 0.75 (Table 2).
The model suggests that binary blends of cotton-
seed meal and cellulose provide optimal larval
survival. In addition, the curvature along the cel-
March 2010
TABLE 2. P-VALUES, REGRESSION COEFFICIENTS, AND RESPONSE SURFACE MODEL FITTING DIAGNOSTIC STATISTICS FOR 5 MEASURES OF D. ABBREVIATUS PERFORMANCE ON
3-COMPONENT ARTIFICIAL DIET BLENDS. CL = CELLULOSE, CM = COTTONSEED MEAL, WG = WHEAT GERM, RC = REGRESSION COEFFICIENT, SQRT = SQUARE ROOT,
P = PROBABILITY OF A GREATER F VALUE (P-VALUES IN BOLD ARE SIGNIFICANT, A = 0.05).
Survival
To transfer @4 wk Transfer to adult Neonate to adult Weight at 4 wk Days to pupation
P RC P RC P RC P RC P RC
Model 0.0017 <0.0001 <0.0001 <0.0001 0.0215
Linear Mixture 0.0017 <0.0001 <0.0001 <0.0001 0.0215
Cellulose 47.47 -3.39 -0.40 0.39 145.33
Cottonseed Meal 92.47 4.40 7.58 5.48 124.98
Wheat Germ 31.22 4.36 4.49 5.48 136.44
CL. CM <0.0001 16.02 0.0018 14.70
CL WG <0.0001 9.76 0.0412 8.79
CM WG <0.0001
CL CM (CL CM) <0.0001 15.64
CL WG (CL WG) <0.0001 23.87
Lack of Fit 0.659 0.673 0.183 0.873 0.581
Model Type Linear Reduced Cubicb Reduced Quadraticb Linear Linear
Transformation' None Sqrt (#Adults+0.97) Sqrt (#Adults+0.74) Sqrt (larval weight) None
R2 0.506 0.999 0.802 0.840 0.422
R2d 0.451 0.998 0.752 0.822 0.340
R2pd 0.320 0.997 0.665 1.788 0.187
'Presented in coded form by placing values between -1 and +1 to allow direct comparison.
bModel reduction by backward elimination
'Transformation determined by Box-Cox plot analysis
Florida Entomologist 93(1)
Cellulose
1.0
Cellulose
1.0
0.70 0.30 0.30 0.70 0.30
Wheat germ Cottonseed meal Wheat germ
Larval survival to 28 d (%) Survival transfer to pupa (%)
Cellulose Cellulose
1.0 1.0
0.30 0.70 0.30
Cottonseed meal Wheat germ
Survival neonate to adult (%)
0.30 0.70 0.30
Cottonseed meal Larval weight (mg) Wheat germ
Larval weight (mg)
Fig. 2. Predicted 3-dimensional surface response plots for 4 measures of larval D. abbreviatus performance
reared on diets with varying proportions of 2 major diet components (cottonseed meal and wheat germ) and a non-
nutritive filler (cellulose): survival of neonate larvae to transfer at 28 d (A), mean larval survival from 28 d to pu-
pation (B), survival of larval D. abbreviatus from neonate to adult (C), and mean weight of 28-d-old larvae (D). Val-
ues on plots are original scale.
lulose-cottonseed meal axis suggests that cotton-
seed meal can be reduced as a percentage of the
blend from 30% without reducing larval survival.
Larval weights at transfer (28 d) ranged from
0.6 to 48.5 mg. The response surface (Fig. 2D) was
highly significant (P < 0.0001) and the R2ad value
was 0.82 (Table 2). The linear model suggests that
larval weight at 28 d is positively correlated with
nutrient content, either cottonseed meal or wheat
germ or a mixture of the 2 with no blending effect
(interaction) (Fig. 2D).
The dataset for larval development was trun-
cated at 180 d. The development period on diets
that produced >0% survival ranged from 119 to
146 d. The response surface (Fig. 3) was signifi-
cant (P = 0.02) and the R2ad value was a relatively
low 0.34 (Table 2). Nonetheless, the predicted R2
was in reasonable agreement with the adjusted
R2 aand the response signal was judged adequate
to navigate the design space and draw general in-
ference. Cottonseed meal had the largest effect on
development time (see regression coefficients in
Table 2). In this context, faster development is
preferred.
Beavers (1982) reported the recipe for what be-
came the F1675 diet produced by BioServ, Inc. for
"citrus root weevil", i.e., D. abbreviatus. In that
article, Beavers alluded to diets developed for the
boll weevil, the plum curculio, and the cerambycid
Dectes texanus as providing a basis for his recipe.
No explanation was provided as to how the partic-
ular combination and proportion of ingredients
0.30
Cottonseed meal
March 2010
Lapointe et al.: Optimal Diet for Diaprepes Larvae
Cellulose
1.0
Cottonseed meal
Days to pupation
Fig. 3. Predicted 3-dimensional surface re
of development for larval D. abbreviatus rea
with varying proportions of 2 major diet
(cottonseed meal and wheat germ) and a n
filler (cellulose). Values on plot are original
acceptable to D. abbreuiatus were de
Since then, D. abbreuiatus has been pr
approximately 25 years by the USDA
recently by the state of Florida without
tion of the original diet. Many thousai
ony-reared D. abbreuiatus have been u
periments spanning fields such as biol
trol, genomics, plant resistance, ecolo
cal ecology, and others. We have
demonstrated that certain ingredien
F1675 diet (casein, cornstarch, soy pi
late, sucrose) have no significant effect
breuiatus development as measured b'
responses (Lapointe et al. 2008). Our ol
the current study was to determine tl
tions of 2 principal nutritional compor
tonseed meal and wheat germ) of a
diet plus a non-nutritive filler (cellu
would allow for scaling of larval weig
produce adults of normative weights. T
of these studies showing adult weight
vival compared with field-collected
will be published separately. Here we
the effect of varying proportions of cell
tonseed meal, and wheat germ on lar
gain and survival.
Larval weight gain from egg eclosi
appeared to be equally responsive to t]
tions of cottonseed meal and wheat ge
diet (Fig. 2D). However, both predict
for larval survival during the first 28
and development rate (the inverse of d
pation, Fig. 3) were greatest at the cottonseed
vertex. Wheat germ appears to be detrimental
to survival compared with cottonseed meal de-
spite the fact that larvae that survived on diets
with high wheat germ content gained weight at
a rate similar to high cottonseed meal diets. The
best combination of early instar survival and
weight gain occurred at the cottonseed vertex
(30% cottonseed meal, 70% cellulose). The best
t.O response surface model for survival of larvae
from 28 d to pupation (Fig. 2B) included a cubic
term that describes curvature resulting from
blending effects (interactions) (Table 2). It's
possible that this effect is an artifact of the cur-
vature resulting from leverage of design points
near the cellulose vertex. Nonetheless, the esti-
00 mate of lack of fit was not significant (Table 2).
0.30 The response surface shows a bias towards cot-
Wheat germ tonseed meal compared with wheat germ for
survival of late instars that was not apparent in
:sponse plot the response of early instars (Fig. 2A). A similar
red on diets surface was generated by modeling larval sur-
components vival from neonate to adult (Fig. 2C), calculated
on-nutritive as the product of the measurements of survival
scale. from neonate to transfer (Fig. 2A) and from
transfer to pupation (Fig. 2B).
The response surface models demonstrated
that larval survival to pupation and larval weight
gain for D. abbreviatus are responses that can be
determined. independently manipulated. Diets that produce
oduced for large insects do not necessarily produce the great-
and more est number of insects (Lapointe et al. 2008). All
modifica- larval responses measured lead to the conclusion
nds of col- that cottonseed meal is the only major nutritive
ised in ex- component required for a successful artificial diet
logical con- for rearing larvae of D. abbreuiatus to pupation.
gy, chemi- Our experience here and in previous experimen-
previously station (Lapointe et al. 2008) is that survival of pu-
ts in the pae to adult emergence is invariably close to
protein iso- 100%. Therefore, we conclude that a cottonseed
t on D. ab- meal diet containing cellulose as a scalable non-
y multiple nutritive filler with standard vitamin and salt
objective in mixes is optimal within the design space de-
he propor- scribed by the ingredients of the original diet de-
nents (cot- scribed by Beavers (1982). It remains to be deter-
simplified mined how diets within the 3-component design
lose) that space described here affect adult responses such
ht gain to as adult weight. That analysis will be the subject
he results of a separate manuscript.
s and sur-
specimens ACKNOWLEDGMENTS
examined
ulose, cot- We thank Peter D'Aiuto, Anna Sara Hill, PeiLing Li,
mal weight Alexander Pheneger, Kelsey Stevens, and Eldridge
Wynn, USDA-ARS, Ft. Pierce, FL for technical assis-
on to 28 d tance. This article reports the results of research only.
he propor- Mention of a trademark or proprietary product is solely
rm in the for the purpose of providing specific information and
S does not constitute a guarantee or warranty of the prod-
ed values uct by the U.S. Department of Agriculture and does not
d (Fig. 2A) imply its approval to the exclusion of other products
ays to pu- that may also be suitable.
REFERENCES CITED
ANDERSON, M. J., AND WHITCOMB, P. J. 2005. RSM Sim-
plified: Optimizing Processes Using Response Sur-
face Methods for Design of Experiments. Productiv-
ity Press, New York.
BEAVERS, J. B. 1982. Biology of Diaprepes abbreviatus
(Coleoptera: Curculionidae) reared on an artificial
diet. Florida Entomol. 65: 263-269.
Box, G. E. P., AND COX, D. R. 1964. An analysis of trans-
formations (with discussion). J. Royal Statistical
Soc., Series B 26: 211-246.
CLANCY, K. M., AND KING, R. M. 1993. Defining the
western spruce budworm's nutritional niche with re-
sponse surface methodology. Ecology 74: 442-454.
COOK, R. D., AND WEISBERG, S. 1982. Residuals and In-
fluence in Regression. Chapman and Hall, New
York.
CORNELL, J. A. 2002. Experiments with Mixtures. 3rd
edn., Wiley & Sons, New York.
LAPOINTE, S. L. 2000. Thermal requirements for devel-
opment of Diaprepes abbreviatus (Coleoptera: Cur-
culionidae). Environ. Entomol. 29: 150-156.
March 2010
LAPOINTE, S. L., EVENS, T. J., AND NIEDZ, R. P. 2008. In-
sect diets as mixtures: optimization for a polypha-
gous weevil. J. Insect Physiol. 54: 1157-1167.
LAPOINTE, S. L., MCKENZIE, C. L., AND HUNTER, W. B.
2003. Toxicity and repellency of Tephrosia candida
to larval and adult Diaprepes root weevil (Co-
leoptera: Curculionidae). J. Econ. Entomol. 96: 811-
816.
LAPOINTE, S. L., AND SHAPIRO, J. P. 1999. Effect of soil
moisture on development of Diaprepes abbreviatus
(Coleoptera: Curculionidae). Florida Entomol. 82:
291-299.
MYERS, R. H., AND MONTGOMERY, D. C. 2002. Response
Surface Methodology: Process and Product Optimi-
zation Using Designed Experiments. 2nd edn., Wiley
& Sons, New York.
NIEDZ, R. P., AND EVENS, T. J. 2006. A solution to the
problem of ion confounding in experimental biology.
Nature Methods 3: 417.
WEISBERG, S. 1985. Applied Linear Regression. 2nd
edn., Wiley & Sons, New York.
WOLCOTT, G. N. 1933. Otiorhynchids oviposit between
paper. J. Econ. Entomol. 26: 1172-3.
Florida Entomologist 93(1)
Color figures for Lapointe, S. L., R. P. Niedz and T. J. Evens. 2010. An
artificial diet for Diaprepes abbreviatus (Coleoptera: Curculionidae)
optimized for larval survival. Fla. Entomol. 93 (1): 56-62.
Ternary graphs of 3D surface surfaces for 5 measures of larval Diaprepes
abbreviatus performance reared on diets with varying proportions of cottonseed
meal, wheat germ and cellulose (a non-nutritive filler).
Figure 1 (B&W) represents the experiment design space. Black circles
correspond to treatment blends. Vertices correspond to 100% cellulose, 30%
cottonseed + 70% cellulose, and 30% wheat germ + 70% cellulose; the lower
center point corresponds to 75% cellulose, 10% cottonseed meal + 11% wheat
germ. Treatment proportions are given in Table 1 of the manuscript.
Figures 2A through 2D present percent larval survival to 28 d (A), percent larval
survival to pupation (B), percent larval survival from neonate to adult (C) and
larval weight at 28 d (D).
Figure 3 represents duration of the developmental period from neonate to
pupation. Color corresponds to response values from low (blue) to high (red).
For more information on the application of geometric designs and response
surface modeling applied to insect diet development, see:
Lapointe, S. L., T. J. Evens and R. P Niedz. 2008. Insect diets as mixtures:
optimization for a polyphagous weevil. Journal of Insect Physiology 54: 1157-
1167.
Cellulose
/o.oo
Figure 1 1.00 /0.00
\0.08
0.70.
0.85 ------- X
0.30
0.70 ---0 2 ---------2
0.30 0.22 0.15 0.08 0.00
Cottonseed meal Wheat germ
Fig. 1. Design space for a three-component blend experiment showing
coordinates of experimental and validation diet blend proportions (black points).
Points accompanied by "2" were replicated. Shaded area not sampled by the
experiment design.
Cellulose
1.0
Cellulose
1.0
ilc
10.0
^ .-
0.0
Li
0.30
Cottonseed meal
0.70 0.30
Wheat germ
Larval survival to 28 d (%)
Cellulose
1.0
22
0.30 0.70 0.30
Cottonseed meal Wheat germ
Survival transfer to pupa (%)
Cellulose
1.0
[ 0.
a I ii]
0.0
A
SI I -
0.30 0.70 0.30
Cottonseed meal Wheat germ
Survival neonate to adult (%)
0.30
Cottonseed meal
0.70
Larval weight (mg)
Fig. 2. Predicted 3-dimensional surface response plots for 4 measures of larval D. abbreviatus
performance reared on diets with varying proportions of 2 major diet components (cottonseed meal
and wheat germ) and a non-nutritive filler (cellulose): survival of neonate larvae to transfer at 28 d (A),
mean larval survival from 28 d to pupation (B), survival of larval D. abbreviatus from neonate to adult
(C), and mean weight of 28-d-old larvae (D). Values on plots are original scale.
Figure 2
0.30
Wheat germ
?c~ir
_--~I-
Figure 3
Cellulose
1.0
0
0.30
Cottonseed meal
I,.'
01~
0.70
Days to pupation
Fig. 3. Predicted 3-dimensional surface response plot of development for larval D. abbreviatus
reared on diets with varying proportions of 2 major diet components (cottonseed meal and wheat
germ) and a non-nutritive filler (cellulose). Values on plot are original scale.
0.30
Wheat germ
- i - a-- _
Fritz et al.: Isolation, Amplification, and Quantification of Sperm DNA
ISOLATING, AMPLIFYING AND QUANTIFYING SPERM DNA IN
ANASTREPHA SUSPENSE (DIPTERA: TEPHRITIDAE)
ANN H. FRITZ', PREETI DHAKAL2, GARY N. FRITZ1 AND LAURA A. KIRBY3
'Department of Biological Sciences, Eastern Illinois University, 600 Lincoln Ave., Charleston, IL 61920
2Division of Biology, Kansas State University, Manhattan, KS 66506-4901
'V. J. Andrew High School, 9001 W. 171st St., Tinley Park, IL 60487
ABSTRACT
A major obstacle for many studies examining sperm competition and cryptic female choice
in insects has been the identification and quantification of sperm stored in the sperm storage
organs of females that have mated with two or more males. Historically, sexual selection
studies have focused primarily on paternity outcomes for inferring potential underlying
mechanisms (e.g., sperm competition and cryptic female choice). We describe a technique for
isolating, genotyping and quantifying sperm in Anastrepha suspense Loew, a species that
has four sperm storage organs (three spermathecae and a ventral receptacle) that are
minute (approximately 80 im) and exhibit complex interior structures restricting sperm re-
covery through simple dissection. With our protocol, we were able to isolate and amplify
sperm DNA (PCR of microsatellite loci) without contamination from female cells, and quan-
tify sperm contributed to a storage organ by one or more males. Briefly, sperm storage or-
gans are dissected-out of the female abdomen, sonicated to remove female cells, rinsed in
saline, crushed between micro-slides (1 x 2 mm), and placed in a microcentrifuge tube for
DNA isolation in situ using a solution containing 10% chelex, proteinase-K and DTT. After
boiling, the DNA is amplified by PCR. With this technique, we have successfully amplified
microsatellite loci from as few as 10 3 sperm. Estimates of absolute numbers of sperm
stored in sperm storage organs was accomplished by incorporating a reference amplicon
standard in each sample during fragment analysis of microsatellite loci. The protocol de-
scribed in this study enable the localization, identification and quantification of sperm from
multiple males stored in female sperm storage organs and, therefore, generates data that
can augment interpretations of paternity outcomes.
Key Words: spermathecae, sperm quantification, multiple-mating, sperm storage
RESUME
Uno de los mayores obstaculos enfrentando studios examinando el papel de elecci6n feme-
nina criptica y competencia espermatica en insects ha sido la identificaci6n y cuantificaci6n
de esperma en los organos de almacenamiento en hembras copulando con dos o mas machos.
Historicamente, studios sobre la selecci6n sexual han enfocado principalmente en los resul-
tados de paternidad pare inferir la dinamica y el mecanismo de fertilizaci6n (por ejemplo,
competencia espermatica y elecci6n femenina criptica). Describimos una tecnica que per-
mite el aislamiento, la determinaci6n del genotipo y cuantificaci6n de esperma en hembras
de la mosca Anastrepha suspense Loew, lo cual tiene cuatro 6rganos de almacenamiento
(tres espermatecas y un receptaculo ventral) minusculos (aproximadamente 80 Jim) y com-
portan un interior complejo que restringe el aislamiento de esperma por medio de disecci6n.
Con este protocolo, es possible aislar y amplificar el ADN (por medio de PCR de microsateli-
tes) sin contaminaci6n de celulas femeninas, y cuantificar esperma contribuido a un 6rgano
de almacenamiento por uno o mas machos. En resume, los organos de almacenamiento son
aislados por disecci6n, las celulas femeninas eliminadas por hondas s6nicas, los organos
aplastados entire dos portaobjetos minusculos (1 x 2 mm), y luego puesto en un tubo de mi-
crocentrifuga para el aislamiento de ADN in situ usando una soluci6n conteniendo 10% che-
lex, proteinasa-K y DTT. Despu6s de hervir, el ADN se amplifica por medio del PCR. Con este
protocolo, amplificamos microsatelites de hasta 10 3 esperma. Estimaci6n del numero ab-
soluto de esperma en los organos de almacenamiento fue possible con la incorporaci6n de
una referencia internal en el analysis de ADN amplificado y sujeto a un analysis de fragmen-
tos. Las tecnicas describidos en este studio facilitan la localizaci6n, identificaci6n y cuanti-
ficaci6n de esperma provieniendo de dos o mas machos y almacenado en los various 6rganos
de la hembra, asi generando informaci6n que facility la interpretaci6n de paternidad.
Translation provided by the authors.
Florida Entomologist 93(1)
Most studies addressing post-copulatory sex-
ual selection have relied on paternity outcomes to
infer the relative roles of sperm competition and
cryptic female choice and make assumptions re-
garding the underlying mechanisms of these phe-
nomena (see review by Simmons 2001). What has
often been the "black box" for many such studies
has been the absence of data on sperm storage
patterns in females and how these patterns might
affect paternity outcomes (e.g., through female
mediation or sperm competition). Since copula-
tion and fertilization are typically temporally re-
moved in insects, the proximate explanation of
paternity outcomes may depend on patterns of
sperm viability, sperm storage, and sperm use.
Aside from its relevance to sexual selection
theory, paternity in insects is particularly impor-
tant in estimating the feasibility and efficacy of
certain biological control systems (e.g., sterile in-
sect technique) and monitoring their control tra-
jectory. An important factor affecting the success
of the sterile insect technique, for example, is the
competitive fate of ejaculate from laboratory-
reared males with that of wild males for paternity
outcomes (Hendricks et al. 2002). With species
that mate multiply, paternity outcomes may also
be affected by the dynamics of sperm storage and
use from males of both sources, and the sequence
in which they mated.
One of the main reasons for the dearth of data
on sperm storage patterns from multiple males
has been the difficulty of accurately isolating,
identifying, and quantifying sperm from multi-
ple-males inside tiny sperm storage organs of
most insects. Also, the difficulty of tagging sperm
from different males with visible markers, and
without affecting the attributes of the sperm it-
self, has hampered such studies in the past (Birk-
head 2000). These problems are compounded
when studying certain insects such as the te-
phritid fruit fly, Anastrepha suspense (Loew),
where the structure, size, and composition of the
sperm storage organs make it extremely difficult
to isolate and quantify sperm.
Anastrepha suspense has four sperm storage
organs: three spermathecae and a ventral recep-
tacle (Fritz & Turner 2002). Females can mate
with one or more males (Sivinski & Heath 1988;
A. H. Fritz unpublished data), and sperm storage
patterns in singly-mated females have been
shown to be highly variable in terms of quantity
and location (Fritz 2004); no studies have exam-
ined sperm storage patterns in multiply-mated
females to date. The spermathecal capsules of A.
suspense are relatively hard, sclerotized spheres,
and surrounded by layers of maternal cells (Fritz
& Turner 2002). Because of their size and shape,
it is very difficult to break the spermathecae open
and remove sperm (e.g., with micropins). The in-
teriors of the spermathecae are highly sculptured
and contain many sclerotized pockets into which
sperm are lodged (Fritz & Turner 2002). Conse-
quently, it is not possible to remove a "ball" of
sperm from each capsule by simple dissection-
many sperm remain lodged and attached to the
interior sculpturing of the spermathecal capsules.
Any spermatozoa released from the capsule have
a propensity to remain in clumps, which often ad-
here to pieces of the capsule walls. Thus, quanti-
fying sperm within such capsules is extremely dif-
ficult, time consuming, and prone to error. Fur-
thermore, the specific identity of the sperm (to
one or more males) is indeterminate.
Spermatozoa in the ventral receptacle are
equally difficult to isolate and quantify. The ven-
tral receptacle of A. suspense is likely the short-
term storage site for sperm (as in Ceratitis capi-
tata, Twig & Yuval 2005) and the site of egg fertil-
ization (as in Batrocera oleae, Solinas & Nuzzaci
1984). This organ is as small as the spermathecae,
is surrounded by a thick layer of osmoregulatory
cells and muscle, and is comprised of numerous
chitinized and spherical alveoli into which sperm
are coiled (Fritz & Turner 2002). Because the
sperm are quite intractable in these alveoli, quan-
tification of sperm in this organ is indirect and in-
volves staining the organ with DAPI, and esti-
mating the number of sperm coiled in a subsam-
ple of alveoli (Fritz 2004).
The purpose of this study was to develop a
methodology that would ameliorate the prob-
lems outlined above and allow for future studies
focusing on sexual selection and biological con-
trol strategies where paternity outcomes are im-
portant considerations. The protocols described
below also eliminate steps in sperm DNA prepa-
ration that would lead to a reduction in DNA
copy number, and eliminates any sources of con-
taminating DNA from the female fly (e.g., during
PCR of the sperm genome). Although the meth-
odology described in this study applies specifi-
cally toA. suspense, the protocols should be gen-
erally applicable to any species (field caught or
otherwise) that has similarly small, multiple,
sperm storage organs with relatively intractable
spermatozoa.
MATERIALS AND METHODS
The methods described here include 5 major
steps: (1) isolation of the sperm storage organs by
microdissection, (2) removal of maternal cells
from spermathecae (to prevent maternal contam-
ination of DNA during PCR), (3) isolation of
sperm DNA from sperm storage organs, (4) PCR
amplification of microsatellite loci, and (5) sperm
quantification. Flies were reared in a quarantine
insectary maintained at 25C, 55% relative hu-
midity and a 14L:10D photoperiod according to
the protocols described by Fritz (2004). All crosses
were done with virgin male and female flies that
had been separated as general flies.
March 2010
Fritz et al.: Isolation, Amplification, and Quantification of Sperm DNA
Dissection of Sperm Storage Organs
Except for the ovaries, the reproductive system
offemaleA. suspense is located within the last ab-
dominal segment and the ovipositor sheath. The
gross and fine anatomy of the female reproductive
system of Caribbean fruit fly have been described
by Fritz & Turner (2002). Under a dissecting mi-
croscope and using micropins, the reproductive
system (including ovaries, oviducts, spermathe-
cae and ventral receptacle) are easily removed
under a drop of insect saline (5.5 g NaC1, 0.44 g
CaC1,, 0.22 g KC1, 1000 mL H20) on a microscope
slide. A pair of spermathecae is located to one side
of the two lateral oviducts and associated with an
accessory gland (Dodson 1978; Fritz & Turner
2002). The third and singular spermatheca is ad-
jacent the opposite lateral oviduct and has a sim-
ilar association with the remaining accessory
gland. The 3 spermathecae, easily identified as
round, orange-pigmented structures, are pear
shaped and of similar size.
The spermathecae are connected to the bursa
by independent ducts, which should be removed
at the base of each spermatheca. Although a valve
at the base of each spermatheca (Fritz & Turner
2002) helps prevent the loss of sperm during dis-
section, it is important to dissect flies in insect sa-
line to prevent water from entering the sperm
storage organs and expelling any sperm through
turgor pressure.
Much of the maternal tissue surrounding each
sperm storage organ can be removed with the
help of micropins. The ventral receptacle is in the
bursa and must be excised by cutting the muscu-
lature surrounding it. Although the 3 spermathe-
cae and the ventral receptacle are surrounded by
several cell layers of maternal cells, it is not criti-
cal that all maternal cells be removed at this junc-
ture, since the next step (below) eliminates any
remaining maternal cells from the preparation. A
new slide and flamed micropins were used for
each dissection in order to prevent contamination
from 1 fly to the other.
Removal of Maternal Cells
Microsatellite loci are typically very useful for
identifying individuals because of their relatively
high levels of polymorphism. When amplifying
the sperm from the sperm storage organs of fe-
male flies through PCR, it is desirable to remove
all traces of the female DNA from the reactants,
particularly when the genotypes of the sperm are
unknown (as in field-caught female flies). Mater-
nal cell removal from sperm storage organs is par-
ticularly important for the following reasons: (1)
preventing female DNA from competing with
sperm DNA for the production of amplicons (espe-
cially when sperm quantities are low), (2) pre-
venting female amplicons from overlapping with
sperm amplicons during fragment analysis (par-
ticularly important for field-caught samples,
where the genotype of the males are unknown),
and (3) preventing the generation of amplicons in
PCR to that of sperm DNA, thus allowing for esti-
mates of the relative and absolute quantification
of spermatozoa through fragment analysis.
The spermathecae are encased in four layers of
maternal cells including gland cells surrounding
secretary ducts (Fritz & Turner 2002). The ven-
tral receptacle is surrounded by a thick layer of
muscle cells overlaying a mitochondria-rich cell
layer (Fritz & Turner 2002). In order to remove
these sources of maternal cells, each sperm stor-
age organ was transferred (with a fine-tipped mi-
cropipette) to a separate 300 pL tube containing
100 pL of 2% Sodium Dodecyl Sulphate (SDS) in
insect saline. The SDS helps prevent the sperm
storage organ from sticking to the sides of the
tube or in a micropipette tip. The lid of each mi-
crocentrifuge tube was then held with tweezers
and the end of each tube submerged in water held
within a micro-cup horn attached to the converter
of a sonicator (Fisher Model 60 Sonic Dismembra-
tor). Each tube was sonicated for 10 s at a medium
amplitude setting of 10 (of 20 gradations). The mi-
cro-cup horn attachment allows sonication in
vitro without direct exposure to an ultrasonic
probe.
The particular sonication variables (time and
amplitude setting) used for removing maternal
cells described above were established by sonicat-
ing sperm storage organs for varying lengths of
time and for different amplitude settings. The ef-
ficacy of sonication as a means of removing mater-
nal cells (and, thus, removal of maternal sources
of DNA) was determined visually by microscopy
(at 400x mag.) and by PCR of the sonicated organs
for one or more microsatellite loci. The microsat-
ellite primers used to amplify the DNA ofA. sus-
pensa are listed and described by Fritz & Schable
(2004). All 3 sperm storage organs of female flies
were subject to PCR along with positive and neg-
ative controls (the female fly DNA and DNA from
non-sonicated sperm storage organs, versus wa-
ter, respectively). The absence of visible ampli-
cons from the PCR of the sperm storage organs
(with fragment analysis on a Beckman CoulterTM
CEQ 8000XL Sequence Analyzer) was evidence
that sonication removed all sources of maternal
cells successfully.
The effect of sonication on the integrity of sper-
matozoa contained within the sperm storage or-
gans also was tested. Spermatozoa were dissected
out of sperm storage organs (with micropins and
by crushing organs under a coverslip) after vary-
ing the sonication variables (time and amplitude)
and subsequently stained with 100 pM 4'-6-Dia-
midino-2-phenylindole (DAPI), which forms a flu-
orescent complex with double stranded DNA).
DAPI-stained spermatozoa were then examined
Florida Entomologist 93(1)
for signs of fragmentation under fluorescent mi-
croscopy at 400X magnification. Further tests of
sperm fragmentation were performed by simply
testing dilutions of spermatozoa in insect saline
under different sonication regimes and counting
sperm (before and after sonication) with a
hemocytometer and DAPI staining.
We tested for the PCR amplification of sperm
DNA contained in the sperm storage organs of
mated females. These organs were subject to the
dissection and sonication protocols described
above, and PCR was conducted on the female
DNA, the DNA of the male with which she mated,
and the DNA of the sperm (contained in her
sperm storage organs) for three microsatellite loci
(loci 1-3B, 1-5E, 1-1H, Fritz & Schable 2004). The
purpose of using 3 microsatellite loci was to max-
imize the probability of finding mated females
that did not share a genotype with either of the
males with which they mated. With this a priori
information, we were able to definitively discern
whether or not our protocols eliminated female
DNA as a source of error (i.e., whether or not fe-
male sources of DNA were contaminating our
PCR amplifications of spermatozoa from the fe-
male's sperm storage organs). The specifics of the
PCR protocol we used to amplify all our samples
and subsequent fragment analysis are described
below.
Isolation of Spermatozoa from Female Sperm Storage
Organs
After sonication, each spermatheca and the
ventral receptacle were transferred (by micropi-
pette) to the surface of a glass slide and washed
quickly in 3 separate drops of de-ionized water to
remove the insect saline, remove female sources
of DNA from the cells ruptured by sonication, and
remove SDS (which might interfere with PCR).
Subsequently, each sperm storage organ was
transferred to the surface of a plastic "micro-cov-
erslip" (1 x 2 mm) in 1 pL of sterile, de-ionized wa-
ter. These "micro-coverslips" were prepared by
cutting plastic slide coverslips (from Fisher Scien-
tific) into the appropriate sizes with a razor blade.
While viewed under a dissection microscope, a
second plastic micro-coverslip of the same size
was placed on the surface of the first micro-cover-
slip, pressed firmly with a probe or tip of tweezers,
and simultaneously rotated to completely crush
and squeeze-out the contents (sperm) from the
storage organ. This "sandwich" of micro-cover-
slips was then picked-up with fine tweezers and
placed into a 300-pL micro-centrifuge tube con-
taining 24 pL of a DNA extraction solution de-
scribed by Walsh et al. (1991): 5% Chelex (pH =
11) including 1 pL of 10 mg/mL proteinase K and
1 pL of 1M DTT. The tube was then subjected to
sonication in a micro-cup horn attached to the
converter of a sonicator (as described above) at a
setting of 10 for 5 s, centrifuged at 15,000 rpm for
20 s, and incubated at 56C for 60 min. The tube
was subsequently subjected to high speed vortex-
ing for 10 s, centrifuged again at 15,000 rpm for
20 s and placed in boiling water for 8 min. The
tube was vortexed once more at high speed for 10
s and centrifuged at 15,000 rpm for 2-3 min.
Amplification and Identification of Sperm DNA
Following the protocol described above, 8 pL of
the DNA sample was amplified in a 25 pL PCR re-
action for each of 3 polymorphic microsatellite loci
mentioned above. In effect, each PCR reaction
amplified 1/3 of the sperm contained in a sperm
storage organ. One of each pair of primers was flu-
orescently labeled with D4 WellRED Dye (Sigma-
Aldrich@). Fragment analysis of amplicons was
by capillary gel electrophoresis on a Beckman
Coulter'TM CEQ 8000XL Sequence Analyzer with
the CEQ DNA Size Standard-400.
The "touchdown" thermocycler program (a pro-
gram that changes the annealing temperature
over various cycles) was as follows: 5 cycles of
96C for 20 s, the highest annealing temperature
for 30 s, and 72C for 1 min; 21 cycles of 96C for
30 s, the highest annealing temperature minus
0.5C per cycle for 30 s, and 72C for 1 min; and
lastly, 10 cycles of 96C for 30 s, 55C for 30 s, and
72C for 1 min. PCR reactants included: 8 pL of
target DNA (from the DNA isolation described
above), 0.25 pL of Taq DNA polymerase, 0.5 pL of
each primer (each at 20 pm), 12.5 pL of FailSafeTM
PCR System buffer B (Epicentre Biotechnolo-
gies), and 3.25 pL of water.
Sperm Quantification
Relative Quantification. A capillary DNA se-
quencer for the fragment analysis of microsatel-
lite loci (Beckman Coulter'TM CEQ 8000XL Se-
quence Analyzer) was used to estimate the rela-
tive amounts of sperm contributed by different
males to a particular sperm storage organ. The
relative contributions of spermatozoa contributed
by 2 or more males were estimated by measuring
the relative peak heights or peak areas from the
output of fragment analysis for a particular locus.
Male genotypes for 3 microsatellite loci were de-
termined after males mated with female flies.
Sperm storage organs in female flies were subse-
quently analyzed for the presence, identity, and
quantification of spermatozoa; the genotype of
each female fly was determined for each of the 3
microsatellite loci (loci 1-3B, 1-5E, 1-1H, Fritz &
Schable 2004) used to identify sperm DNA. The
rationale for amplifying DNA for three microsat-
ellite loci was to increase the probability of ob-
serving female and sperm genotypes that were
completely different (making our analysis of con-
tamination, for example, much easier).
March 2010
Fritz et al.: Isolation, Amplification, and Quantification of Sperm DNA
Absolute Quantification. The absolute num-
bers of sperm in sperm storage organs was quan-
tified by comparing sample peak areas produced
by fragment analysis against a standard curve
generated from peak areas of internal references
for known quantities of spermatozoa. Prior to
generating a standard curve, standardization of
materials and protocols used in quantifying sper-
matozoa were established considering all the
variables that may affect fragment analysis out-
put (e.g., initial quantity and density of sperm in
PCR reactions, thermocycler parameters, quality
and quantity of PCR reactants, etc.). In addition,
the precision of hardware was tested. The preci-
sion of our thermocycler (PXE 0.5 Thermal Cy-
cler, Thermo Electron Corporation), for example,
was tested by amplifying replicates of the DNA
isolated from a particular number of sperm (iso-
lated by our standard protocols outlined above)
and by subsequent fragment analysis of mean
peak area and variance through fragment analy-
sis on our DNA sequencer. Similarly, we tested
the precision of our DNA Sequencer for generat-
ing peak area output from each of the 8 capillary
gels in a new capillary gel array. For example,
amplicons from a single PCR amplification of
DNA from a given number of sperm, and for a
given microsatellite locus, were analyzed simulta-
neously by all 8 capillary wells of our DNA Se-
quencer through fragment analysis (peak height,
peak area, and variance).
In order to establish a standard curve of PCR
amplicon peaks for different quantities of sperm,
it was necessary to obtain different densities of
sperm in standardized PCR reactions. Sperm
were dissected from the testes of males homozy-
gous for a particular microsatellite locus being
considered, pipetted into different volumes of wa-
ter in a 1.5-pL centrifuge tube, and vortexed to
homogenize their distribution. Sperm densities
were obtained by examining 6 subsamples of each
preparation with DAPI staining and a hemocy-
tometer under fluorescent microscopy. Serial dilu-
tions were then used to establish different sperm
densities in equal volumes of liquid.
DNA was extracted from varying densities of
sperm (but in equal volumes of liquid) by using
the "in situ" Chelex based extraction protocol de-
scribed above (protocols of Walsh et al. 1991) used
for extracting DNA from sperm storage organs.
DNA was isolated from 10, 20, 50, 150, 250, 350,
and 500 spermatozoa in 6 replicates. DNA of each
quantity and replicate of sperm was extracted
and amplified (PCR) with fluorescently labeled
primers for 3 polymorphic microsatellite loci (loci
1-3B, 1-5E, 1-1H, Fritz & Schable 2004) based on
protocols as outlined above. PCR amplicons were
then analyzed on a Beckman CoulterTM CEQ
2000XL Sequence Analyzer with the Beckman
Coulter CEQ DNA Size Standard-400 and the
CEQ Fragment Analysis Module Program (Beck-
man Coulter'TM, Fullerton, CA) in order to quan-
tify sperm in terms of peak height and peak area.
The internal reference standard for all 3 mic-
rosatellite loci used in this study was generated
by mass PCR of a fly homozygous for the 4H mic-
rosatellite locus (described by Fritz & Schable
2004). An identical quantity (1 pL in our case) of
this locus' amplified DNA was added to each sam-
ple of amplified sperm DNA (post-PCR) as an in-
ternal reference during fragment analysis. To test
the precision of this approach, for example, we
amplified the DNA of 100 sperm in a single PCR
reaction and subjected these amplicons to frag-
ment analysis in all 8 capillary wells simulta-
neously along with identical quantities of internal
reference DNA (1 pl). As mentioned above, esti-
mates of the absolute numbers of sperm in sperm
storage organs were generated by comparing
sample peak areas produced by fragment analysis
of sperm DNA against a standard curve gener-
ated from the ratios of peak areas of internal ref-
erences to peaks produced by given quantities of
spermatozoa.
RESULTS
The sonication of sperm storage organs (or of
samples of isolated sperm), as described above,
was found to be effective in rupturing maternal
cells without affecting sperm integrity (Fig. 1)
and, therefore, a useful procedure for eliminating
DNA from the female. As described above, sperm
storage organs are rinsed in insect saline after
sonication to remove any traces of female DNA.
The subsequent crushing of sperm storage organs
between 2 "microslides" to expose spermatozoa,
and the isolation of the sperm DNA in situ elimi-
nates the problem of sperm DNA copy loss. We ob-
tained measurable amplicon peaks in fragment
analysis from as few as 10 3 spermatozoa. Fur-
thermore, amplification of sperm DNA isolated
from sonicated storage organs produced no ampl-
icons from the female, thus providing evidence
that maternal sources of DNA had, indeed, been
excluded from PCR reactions of sperm DNA. In a
study with females mated to 2 males (A. Fritz un-
published data), these protocols have successfully
identified the sperm from each male in the sperm
storage organs of females (and without the con-
founding amplicon signature of the females)
(Fig. 2). Relative contributions of sperm by each
male were quantifiable by the proportional
heights of amplicons from each male to the total
amplicon output (Fig. 2) taking into account any
differences in allele amplification efficiency and
by genotyping all male and female flies.
Instrument precision is critical for estimates of
the absolute quantity of spermatozoa from 1 or
more males that have inseminated a particular
female fly. We found that the 8 capillary gels of
our sequencer produced unsatisfactory variation
Florida Entomologist 93(1)
Fig. 1 A: Alveoli of the ventral receptacle (VR) surrounded by maternal cells (arrows point to nuclei) prior to son-
ication. B: Removal of maternal cells after sonication of the ventral receptacle. C: Spermathecal capsules (SC) sur-
rounded by maternal cells (arrows point to nuclei) prior to sonication. D: Removal of maternal cells after sonication
of the spermathecae showing intact spermatozoa emerging from a mechanically crushed capsule.
in output (fragment analysis of peak height and
peak area) generated from a single PCR reaction.
This variation in output by the CEQ Beckman Se-
quencer is, apparently, inherent "noise" in the sys-
tem. This source of variation was ameliorated by
the development of an internal reference run with
each sample of DNA analyzed on the DNA se-
quencer; with the incorporation of an internal ref-
erence, output of fragment analysis becomes the
ratio of the peak height (or area) of the sample
DNA to the peak height (or area) of the internal
reference (Table 1). The mean and standard devi-
ation values indicated, also, that our thermocy-
cler (PXE 0.5 Thermal Cycler, Thermo Electron
Corporation) was satisfactorily precise in produc-
ing similar densities of amplicons from replicates
of the same DNA amplified in random wells of the
thermocycler (Table 1).
The relationship between the quantity of DNA
isolated from different quantities of sperm versus
the ratio of peak area of the internal reference to
sample DNA was used to generate a standard
curve (Table 2, Fig. 3). Peak area ratios generated
for different quantities of sperm DNA showed, as
March 2010
Fritz et al.: Isolation, Amplification, and Quantification of Sperm DNA 6
70000 -
241 bp 5
245 bp
W Is a I-I W
1.4 1I 1I.1
S a 3mo
I.1. I
0 60 100 IS0 O 2 00 300
SIZE (nt)
Fig. 2 Fragment analysis showing amplicon peaks (241 and 245 bp) from the sperm of 2 males homozygous for
different alleles (241 and 245 bp) and stored in the ventral receptacle of a female fly. The female genotype (which
was different from that of the males) is not visibly amplified, demonstrating the absence of contamination of sperm
with DNA from female sources.
expected, a proportional decrease in variance
with increasingly large samples of sperm DNA
(Table 2, Fig. 3). The plot of sperm quantity with
peak area ratios produced an approximately lin-
ear relationship during the exponential stages of
PCR amplification for sperm quantities ranging
from approximately 50 to 350 spermatozoa
(Fig. 3). For our data and experimental condi-
tions, the best-fit regression line through this
range of sperm was y = 0.024x + 7.69. In our pro-
tocol, each PCR reaction represented 1/3 the
sperm contained in a particular sperm storage or-
gan; thus, the total number of sperm estimated in
a particular sperm storage organ by the regres-
sion line shown above would need to be multiplied
by three.
Multiplexing of sperm DNA for the 3 microsat-
ellite loci used in this study was not feasible, since
multiple primer pairs were found to compete dif-
ferentially with reactants (and, therefore, af-
fected differentially the ratio of sample peak area
to the internal reference on the capillary se-
quencer). Thus, all sperm DNA samples were am-
plified in separate PCR reactions for the 3 micro-
satellite loci tested in this study.
DISCUSSION
The protocols outlined above allow for the iso-
lation, amplification, and quantification of sperm
from minute, sclerotized sperm storage organs
containing relatively intractable spermatozoa.
The protocols described herein should be applica-
ble to small, sclerotized spermathecae of any ar-
thropod. Our procedure eliminates the task of
"chasing-down" spermathecae with micropins to
rupture them, eliminates the laborious task of re-
moving relatively intractable sperm from rup-
tured spermathecae, and eliminates contamina-
tion of sperm DNA with DNA from the female ge-
nome. No DNA is lost from spermatozoa, since
DNA is isolated without incorporating any steps
that lead to a loss of copy number (since the re-
lease of sperm from their storage organs and the
subsequent isolation of DNA occur in a single
tube).
By the use of PCR of microsatellite loci, the
identity and location of sperm from 2 or more
males can be ascertained among the sperm stor-
age organs in female flies. By using microsatellite
loci as "non-invasive" markers for each male (as
50000
o4000 -
10000 +
Si m 1i
Florida Entomologist 93(1)
TABLE 1. REPLICATE RATIOS OF REFERENCE PEAK HEIGHT AND PEAK AREA TO THE PEAK AREA AND HEIGHT OF A GIVEN
SAMPLE OF SPERM (E.G., 10) AFTER PCR AND FRAGMENT ANALYSIS ON A DNA SEQUENCER; RFU = RELATIVE
FLOURESCENT UNITS.
Ratio of reference standard to sperm sample Ratio of reference standard to sperm sample
in terms of peak area (rfu x mm) in terms of peak height (rfu)
21963/8933 = 2.45 34143/13684 = 2.49
33751/14437 = 2.33 56426/22286 = 2.53
32731/14153 = 2.31 54081/21254 = 2.54
27975/13107 = 2.13 33577/13562 = 2.47
24795/11332 = 2.18 33051/12908 = 2.56
17314/7212 = 2.4 18138/7414 = 2.44
15100/6289 = 2.4 23523/9041 = 2.6
11806/5004 = 2.35 19412/7677 = 2.52
Mean = 2.32; SD = 0.11 Mean = 2.52; SD = 0.05
opposed to labeling sperm from different males),
this procedure also allows for the relative quanti-
fication and location of spermatozoa from differ-
ent males in multiple sperm storage organs of fe-
male insects. For example, if 2 males homozygous
for different alleles mate with the same female
and contribute sperm to a particular spermath-
eca, then the relative peak heights (or areas) pro-
vide a good estimate of the relative contributions
of each male's sperm. It is convenient if all alleles
at a particular locus amplify with approximately
equal efficiency, but this relationship can be ex-
amined and quantified in order to establish a
baseline for interpreting results from actual ex-
periments or field trials.
Estimates of the absolute number of spermato-
zoa contributed by 1 or more males are also possi-
ble, but more problematic. Quantification of
sperm by quantifying PCR amplicons (by peak
height or area) depends, in part, on the initial
quantity and density of target DNA (from sperm)
used in a reaction. Other variables include the pa-
rameters of the thermocycler and the relative
quantities, qualities, and types of reactants of the
TABLE 2. THE MEAN SD RATIOS FOR EACH OF THE
QUANTITIES OF SPERM DNA AMPLICONS TO
THE REFERENCE DNA AMPLICONS IN TERMS OF
PEAK AREA USED TO MAKE A STANDARD
CURVE.
Mean SD ratios for each quantity
of sperm DNA amplicon to the
Sperm quantity reference standard.
10 sperm 2.69 0.55
20 sperm 6.80 0.74
50 sperm 9.04 0.52
150 sperm 10.84 0.45
250 sperm 14.22 0.59
350 sperm 15.94 0.59
500 sperm 16.13 1.08
PCR. Accurate estimates are only possible with
the incorporation of an internal reference and the
generation of a standard curve. Protocols, re-
agents, and materials need to be standardized
and invariable. For example, we dedicated specific
micropipettes to certain steps to prevent aliquot
variability; and were careful to use reagents of
the same age, batch, and quality (e.g., repeated
freezing and thawing of reagents causes degrada-
tion). Once protocols are standardized, then a
standard curve can be generated of sperm DNA
quantity with peak height and peak area.
Based on the protocol outlined above, the stan-
dard curve generated was only approximately lin-
ear for quantities of sperm from around 50 to 350
spermatozoa. Most females storing sperm in a
sperm storage organ inA. suspense do not exceed
350 sperm (Fritz 2004), which makes this protocol
applicable to this species. For other species, how-
ever, standard curves would need to be generated
using other quantities of spermatozoa and differ-
ent thermocycler parameters to be useful.
The identification and quantification of sperm
stored in females from single or multiple males
has long been a hurdle for studies examining
sperm storage dynamics and paternity. Methods
that have been developed in the past have relied,
in one manner or another, on the ability to tag
sperm from particular males (e.g., dyes or radio-
isotopes), and more recent protocols incorporate
molecular genetics to achieve this result,e.g.,
sperm labeled by transgenesis, or identifiable
through other genetic manipulations of the ge-
nome (San Andres et al. 2007; Scolari et al. 2008;
Zimowska et al. 2009). These methods, however,
run the risk that the system of tagging sperm af-
fects their behavior or viability in a fashion that
affects paternity outcomes. Also, these methods of
tagging are strain specific, thus only applicable to
the individuals that are altered. Thus, these
methods of tagging sperm have typically been
used to identify the presence or absence of sperm
from a given strain of males that is stored in fe-
March 2010
Fritz et al.: Isolation, Amplification, and Quantification of Sperm DNA
I Mean Sperm AmplRefAmp -- Plus SD Minus SD
20
18
16
S12
4
0
0 100 200 300 400 500 600
Spean No.
Fig. 3 Standard curve generated by plotting the mean (-t SD) peak area ratios of the reference standard to the
peak area of amplified sperm DNA of different quantities.
1 l------------------
J 6 - i-------------------------------
peak area of amplified sperm DNA of different quantities.
males. Alternatively, we have described protocols
that are not strain-specific, do not rely on tagging
sperm and, therefore, can be used to study mating
behaviors, sperm storage patterns, and paternity
outcomes in wild-caught females. Furthermore,
our protocols allow for the isolation of sperm DNA
from very small sperm storage organs in females
without contamination with female DNA and
without a reduction in the copy number of sperm.
And, finally, our protocols allow for the relative or
absolute quantification of sperm stored in females
that have mated with 1 or more males.
ACKNOWLEDGMENTS
We thank S. Fraser and E. Ramos for assistance on
this project. This project was supported, in part, by the
National Research Initiative of the USDA Cooperative
State Research Education and Extension Service grant
# 2004-3502-17673.
REFERENCES CITED
BIRKHEAD, T. R. 2000. Defining and demonstrating post-
copulatory female choice-again. Evolution 54: 1057-
1060.
DODSON, G. N. 1978. Morphology of the reproductive
system ofAnastrepha suspense (Loew) and notes on
related species. Florida Entomol. 61: 231-239.
FRITZ, A. H. 2004. Sperm storage patterns in singly
mated females of the Caribbean Fruit Fly, Anas-
trepha suspense (Diptera: Tephritidae). Ann. Ent.
Soc. America 97: 1328-1335.
FRITZ, A. H., AND TURNER, F. 2002. A light and elec-
tron microscopical study of the spermathecae and
ventral receptacle of Anastrepha suspense
(Diptera: Tephritidae) and implications in female
influence of sperm storage. Arthropod Struc. Dev.
30: 293-313.
FRITZ, A. H., AND SCHABLE, N. 2004. Microsatellite loci
from the Caribbean Fruit Fly, Anastrepha suspense
(Diptera: Tephritidae). Mol. Ecol. Not. 4: 443-445.
HENDRICKS, J., ROBINSON, A. S., CAYOL, J. P., AND EN-
KERLIN, W. 2002. Medfly area wide sterile insect
technique programs for prevention, suppression or
eradication: the importance of mating behavior stud-
ies. Florida Entomol. 85: 1-13.
SAN ANDRES, V., URBANEJA, A., SABATER-MUNOZ, B.,
AND CASTANERA, P. 2007. A novel approach to assess
mating success of sterile Ceratitis capitata (Diptera:
Tephritidae) males in sterile insect technique pro-
grams. Mol. Entomol. 100: 1444-1449.
SCOLARI, F., SCHETELIG, M. F., GABRIELI, P., SICILIANO,
P., GOMULSKI, L. M., KARAM, N., WIMMER, E. A., MA-
LACRIDA, A. R., AND GASPERI, G. 2008. Insect trans-
genesis applied to tephritid pest control. J. Appl. En-
tomol. 132: 820-831.
SIMMONS, L. W. 2001. Sperm Competition and its Evolu-
tionary Consequences in the Insects. Princeton Uni-
versity Press, Princeton, NJ.
72 Florida Ento
SIVINSKI, J., AND HEATH, R. 1988. Effects of oviposition
on remating, response to pheromones, and longevity
in female Caribbean fruit fly, Anastrepha suspense
(Diptera: Teprhitidae). Ann. Entomol. Soc. America
81: 1021-1024.
SOLINAS M., AND NUZZACI, G. 1984. Functional anatomy
of Dacus oleae Gmel. female genitalia in relation to
insemination and fertilization processes. Entomo-
logica 19: 135-165.
TWIG, E., AND YUVAL, B. 2005. Function of multiple
sperm storage organs in female Mediterranean fruit
1m
ologist 93(1) March 2010
flies (Ceratitis capitata, Diptera: Tephritidae) J. Ins.
Physiol. 51: 67-74.
WALSH, P. S., METZGER, D. A., AND HIGUCHI, R. 1991.
Chelex 100 as a medium for simple extraction of
DNA for PCR-based typing from forensic material.
Biotechniques. 10: 506-513.
ZIMOWSKA, G. J., NIRMALA, X., AND HANDLER, A. M.
2009. The B2-tubulin gene from three tephritid fruit
fly species and use of its promoter for sperm mark-
ing. Insect Biochem. Mol. Biol. 39: 508-515.
Meagher & Landolt: Floral Lures Attractive To Velvetbean Caterpillar
BINARY FLORAL LURE ATTRACTIVE TO
VELVETBEAN CATERPILLAR ADULTS (LEPIDOPTERA: NOCTUIDAE)
ROBERT L. MEAGHER1 AND PETER J. LANDOLT2
1USDA, ARS, CMAVE, 1700 SW 23rd Drive, Gainesville, FL, 32608
2USDA, ARS, 5230 Konnowac Pass Road, Wapato, WA 98951 USA
ABSTRACT
Evaluation of combinations of flower odor compounds in northern Florida revealed that lina-
lool was synergistic in attractiveness with phenylacetaldehyde (PAA) to the migratory moth
velvetbean caterpillar (Anticarsia gemmatalis Hiibner). This noctuid was the most common
species collected from traps with a binary lure composed of PAA and linalool, with over 900
males and females collected in Sep 2005 and almost 13,000 collected in a 4-week period in
Aug and Sep 2006. Different lid openings of the vials containing the chemical blend in an at-
tempt to vary the release rate of the binary lure did not affect the number of velvetbean cat-
erpillar moths captured. Traps baited with the binary lure and placed in May, Jun and early
Jul of 2005 and 2009 failed to capture adults demonstrating the absence of adult moths early
in the season. Management application of floral attractants in an attract-and-kill strategy
is discussed.
Key Words: floral lure, attractant, trapping, moths, Anticarsia gemmatalis
RESUME
Una evaluaci6n de las combinaciones de olores de compuestos florales en el norte de Florida
revelo que linalol era sinergista con el fenilaldehido (PAA) en la atracci6n a la polilla migra-
toria gusano del frijol (Anticarsia gemmatalis Htibner). Este noctuido fue la especie mas co-
mun en trampas colectadas con cebos del compuesto binario PAA y el linalol, con mas de 900
machos y hembras colectados en septiembre de 2005 y casi 13.000 recogidos en un period
de 4 semanas en agosto y septiembre de 2006. Con el fin de variar la velocidad de liberaci6n
del atractivo binario se usaron tapas de diferente abertura las cuales no afectaron el numero
de adults del gusano del frijol capturados. Trampas cebadas con un seiuelo binario coloca-
das en mayo,junio, y principios dejulio del 2005 y 2009 no capturaron adults demostrando
la ausencia de polillas adults a principios de la temporada. Se discute el manejo para la
aplicaci6n de atrayentes florales en una estrategia para atraer-y matar.
Translation provided by the authors.
Many species of moths are known to be at-
tracted to volatile compounds emitted by flowers
(Knudsen et al. 2006). Some of the flower species
studied include Abelia grandiflora (Haynes et al.
1991), Cestrum nocturnum L. (Heath et al. 1992),
3 species of Gaura (Teranishi et al. 1991; Kint et
al. 1993; Shaver et al. 1997), Lonicera japonica
(Schlotzhauer et al. 1996), Platanthera bifolia L.
(Rich.) (Plepys 2001), and Mahonia = Berberis
aquifolium (Pursh) (Landolt & Smithhisler 2003).
The volatiles released by these flowers contain
multiple compounds. One of the compounds that
has been shown to be attractive to moths is phe-
nylacetaldehyde (PAA). It has been isolated from
many flowering plants and shrubs that are attrac-
tive to moths (Haynes et al. 1991; Heath et al.
1992; Kint et al. 1993; Pair & Horvat 1997;
Landolt & Smithhisler 2003). Phenylacetalde-
hyde as a single attractant or in mixtures has
been used to attract various species of moths
(Smith et al. 1943; Creighton et al. 1973; Cantelo
& Jacobson 1979; Lopez et al. 2000; Landolt et al.
2001, 2006). In Florida, PAA is a strong attrac-
tant for several noctuid moths from different sub-
families, but particularly for soybean looper
moths Ci.., ../.. i, = Pseudoplusia includes
(Walker) (Meagher 2001a, 2002). A recent study
showed that the floral odorants cis-jasmone, ben-
zyl acetate, limonene, linalool, P-myrcene, methyl
salicylate, and methyl-2-methoxy benzoate all in-
creased captures of some moths when added to
traps with PAA, but responses varied among the
moth species that were trapped (Meagher &
Landolt 2008). One interesting result was that
velvetbean caterpillar moths (Anticarsia gem-
matalis Hiibner) responded very strongly to PAA
plus linalool (Meagher & Landolt 2008). Linalool
has been found in several species of moth-visited
flowers (Bruce & Cork 2001; Honda et al. 1998;
Schlotzhauer et al., 1996).
Velvetbean caterpillar is a migratory noctuid
that infests cultivated legumes including soybean
Florida Entomologist 93(1)
Glycine max (L.) Merrill, peanut Arachis hy-
pogaea L., alfalfa Medicago sativa L., cowpeas Vi-
gna unguiculata (L.) Walpers, and velvetbean
Mucuna pruriens (L.) DC in the southeastern U.S.
(Buschman et al. 1977; Herzog & Todd 1980; Bus-
chman et al. 1981; Slansky 1989). It apparently
overwinters in central and southern Florida and
southern Texas where it feeds on wild legumes
such as clovers Melilotus spp. and Trifolium spp.,
medics Medicago spp., kudzu Pueraria lobata
(Willd.) Ohwi, and vetches Vicia spp. (Watson
1916; Buschman et al. 1981; Slansky 1989). Mat-
ing behavior studies (Johnson et al. 1981) led to
the identification of the sex pheromone (Heath et
al. 1983) and to the design of trapping systems
(McLaughlin & Heath 1989; Mitchell & Heath
1986). However, the pheromone components are
costly to synthesize and are not commercially
available.
Meagher & Landolt (2008) found large num-
bers of velvetbean caterpillar moths in traps
baited with a 2-component blend of PAA and lina-
lool. Two experiments following this research
were designed to test whether both floral volatiles
(PAA and linalool) were needed for attraction and
if capture number was influenced by the release
rates of the chemicals.
MATERIALS AND METHODS
Standard Universal Moth Traps, "Unitraps"
(Great Lakes IPM, Vestaburg, MI, USA) were
used to capture moths that were attracted to
chemical compounds. These traps were con-
structed of a white bucket, a yellow cone on top of
the bucket, and a dark green cover above the cone.
A 2.5 x 2.5-cm piece of Vaportape (Hercon Envi-
ronmental, Emigsville, PA, USA), releasing the
pesticide dichlorvos, was stapled to a string and
hung inside the bucket to kill captured moths.
Lures were suspended by a wire inside the bucket
of the trap. Both chemicals tested were dispensed
from 8-ml polypropylene vials (Nalg Nunc, Roch-
ester, NY, USA). Five milliliters of active ingredi-
ent were added to cotton balls in the bottom of the
vial. When 2 chemicals were tested in a single
trap, each chemical was dispensed from a sepa-
rate vial. Phenylacetaldehyde (W287407) and
linalool (W263508, racemic mixture) were pur-
chased from Aldrich Chemical Co. (Milwaukee,
WI, USA).
Traps were placed on 1.5-m metal poles along
roads and edges of 400-ha fields of commercial
peanuts near Williston, FL (Levy County). Previ-
ous research suggested that velvetbean caterpil-
lar moths are not found in north-central Florida
until late Jul or Aug (Watson 1916, Watson
1932). Early season samples were collected in
2005 and 2009 with traps baited with a binary
lure of PAA + linalool in vials with 3.2-mm lid
opening diameters. One trap was placed at Will-
iston on 6 May 2005 and removed 2 Jun 2005; in
2009 one trap was placed on 28 May and re-
moved 18 Aug. Lures and vaportape were re-
placed every 2 weeks.
The 2 main experiments were conducted in
2005 and 2006 at Williston. A randomized com-
plete block experimental design was used, with 5
replicate blocks for each experiment. Lures were
replaced every 2 weeks and Vaportape was re-
placed every 4 weeks. The first experiment was
designed to test linalool as a single attractant
compared to it as a co-attractant. The 4 treat-
ments were no lure as a control, PAA alone, lina-
lool alone, and PAA + linalool. Traps were placed
at least 30 m apart, and treatment order was ran-
domized at each sample date. Release of the
chemicals was allowed through lid opening diam-
eters of the vials of 3.2 mm. Traps were set up at
Williston on 13 Sep and moths were removed 15,
20, 23, 26, 28, and 30 Sep 2005. The second exper-
iment in 2006 was designed to determine if differ-
ent release rates from traps with the binary blend
(PAA + linalool) affected moth capture. Different
release rates were achieved by changing the di-
ameter of the hole in the lid opening. The treat-
ments were hole diameters of 1.0, 1.6, 3.2, 6.4,
and 12 mm. This trapping test was set up 22 Aug
2006 and moths were removed 25 Aug and 7, 18,
and 28 Sep 2006.
Moths captured were identified to species
(Kimball 1965; Covell 2005), and then sorted by
sex. Voucher specimens are deposited in the Flor-
ida State Collection of Arthropods, Florida De-
partment of Agriculture and Consumer Services,
Division of Plant Industry, Gainesville, FL. Trap
catch data were subjected to an ANOVA (PROC
MIXED, SAS 9.2, SAS Institute 2008), where
block, date (block), and block*treatment were
random variables (Littell et al. 1996). If the treat-
ment variable produced a significant F value,
treatment means were separated by simple effect
differences of the least square means. Sex ratios
(number of males/number of females) were ana-
lyzed to determine if they were significantly dif-
ferent from 1.0 by a chi-square test (GraphPad
Software, Inc., San Diego, CA).
A gravimetric method was used to estimate
the loss of PAA and linalool from vials with lid
opening diameters of 1.0, 1.6, 3.2, 6.4, and 12
mm that were placed outdoors and indoors. For
both chemicals, four 8-mL vials were loaded with
5 mL chemical and placed in traps on 2 Jul 2009
in Gainesville, FL. The vials were reweighed
weekly until 30 Jul. Because of high humidity
outdoors, the vials were brought inside and
placed in a laboratory fume hood and weighed
periodically until 5 Nov 2009. Vial weight change
over time was analyzed with regression analysis
(PROC REG, SAS 9.2, SAS Institute 2008) and
slopes were compared by Student's t test statis-
tic (Wuensch 2007).
March 2010
Meagher & Landolt: Floral Lures Attractive To Velvetbean Caterpillar
RESULTS
Early Season Samples
Traps baited with the binary lure of PAA + lina-
lool and placed in Williston from 6 May to 2 Jun
2005 and from 28 May to 18 Aug 2009 captured
several species of moths but not velvetbean cater-
pillar adults. Peanuts were planted in Williston by
the time of sampling, but there was no evidence of
larval infestation by velvetbean caterpillar.
Importance of Blend Components
This experiment tested whether both com-
pounds, PAA and linalool, were needed to attract
moths. During a 17-d-period, a total of 934 male
and female velvetbean caterpillar adults were col-
lected in the Unitraps baited with floral lures.
Captures varied between sampling dates but
were generally highest in traps with the binary
lure and lowest in traps with linalool (Fig. la).
The binary lure of PAA + linalool attracted 81% of
all captured velvetbean caterpillar moths,
whereas the low captures by the single lures of
PAA or linalool were not statistically different
from captures by the unbaited traps (F = 13.4; df
= 3, 12; P = 0.0004) (Fig. Ib). Although several
other pest moth species were collected in high
numbers in traps baited with PAA and PAA +
linalool, very few moths of any species were col-
lected in traps baited with linalool singly (data
not shown).
Testing of Different Release Rates
This experiment tested the attraction of moths
to traps releasing different amounts of the binary
lure compounds. Release rates were adjusted by
changing the size of the opening in the lid of the
vials containing the chemicals. Large numbers of
velvetbean caterpillar moths (12,924) were col-
lected in traps during the 4-week test (Fig. 2a).
Average total captures varied between 1470
moths on 18 Sep in the 6.4 mm treatment to 2
moths on 25 Aug in the 12 mm treatment. Across
all dates there was a non-significant trend for an
inverse relationship between lid opening and
moths captured as fewer moths were found in
traps with the higher release rates (F = 0.62; df=
4, 16; P = 0.6556) (Fig. 2b).
An additional experiment attempted to esti-
mate the release rates of each chemical from vi-
als with different lid openings by measuring the
weight loss of vials over time under outdoor and
indoor conditions. Lid openings affected the re-
lease of the chemicals as shown by different re-
gression slopes (mg change in weight per day)
among the openings. For the outdoor experi-
ment, vials containing PAA gained weight with
the 1.0, 1.6 and 3.2 mm openings, but lost
Data
N
t; ||
b
b b
b. UnhMd PAA UeLM PAA U
Fig. 1. Mean () SE numbers of velvetbean caterpil-
lar moths captured in Universal moth traps (n = 5 per
date per treatment) baited with phenylacetaldehyde
(PAA) and linalool (LIN) dispensed from polypropylene
vials, 2005, Williston, FL, USA. A. Captures over time.
B. Summarized and compared per treatment. Bars fol-
lowed by the same letter are not significantly different
(P > 0.05, Contrasts, PROC Mixed).
weight with the 12 mm openings (weight loss =
4.1 mg per day) (Fig. 3a). Vials containing lina-
lool all gained weight except for the 12 mm
opening (weight loss = 1.34 mg per day) (Fig.
3b). For both chemicals, slopes among openings
were significantly different (P < 0.05) except for
the 1.0 mm versus 1.6 mm comparisons (P >
0.05). Weight loss rates of vials placed in a dry
environment inside the laboratory hood were
higher, although PAA vials with 1.0 mm and 1.6
mm openings, and linalool vials with all open-
ings except 12 mm, still gained weight (Fig. 4).
Weight loss of vials with PAA increased from
0.2 to 1.4 to 4.9 mg per day for openings of 3.2,
6.4 and 12 mm, respectively. Vials with linalool
had a loss of 5.3 mg per day when the opening
was 12 mm. Loss rates among openings for both
chemicals were significantly different (P < 0.05)
except for the 1.0 mm versus 1.6 mm compari-
sons (P > 0.05).
Florida Entomologist 93(1)
-- -- -. i
b. Lid Opening (mm)
Fig. 2. Mean () SE numbers of velvetbean caterpil-
lar moths captured in Universal moth traps (n = 5 per
date per treatment) baited with different release rates
(lid opening diameter = mm) of phenylacetaldehyde +
linalool dispensed from polypropylene vials, 2006, Will-
iston, FL, USA. A. Captures over time. B. Summarized
and compared per treatment with capture numbers in
parenthesis. Means among openings were not signifi-
cantly different (P > 0.05, Contrasts, PROC Mixed).
Sex Ratio
The sex ratio of captured velvetbean caterpil-
lar moths in traps baited with PAA and PAA +
linalool was male-biased. In 2005, over 5 times as
many male velvetbean caterpillar moths were
captured as female moths (sex ratio for PAA,
5.818, X2 = 74.9, P < 0.0001; PAA + linalool, 5.333,
X2 = 355.8, P < 0.0001). In the 2006 release rate
experiment, male moths were again more com-
monly collected than female moths. However, as
the release rate increased the sex ratio decreased
(lid opening 1.0 mm, 4.688, X2 = 1272.1, P <
0.0001; 1.6 mm, 4.507, X2 = 1101.1, P < 0.0001; 3.2
mm, 4.427, X2 = 1060.2, P < 0.0001; 6.4 mm, 3.982,
X2 = 906.8, P < 0.0001; 12 mm, 3.205, X2 = 547.9, P
< 0.0001; correlation coefficient = 0.997).
a.
200
ISO
I
Is
50
I l
I 1
D9 ys
Days
20 a2 30
5 10 i 20 2 30
Days
Fig. 3. Mean weight changes of 8-mL polypropylene
vials placed outdoors with 5 mL of phenylacetaldehyde
(A) or linalool (B) and with varying opening diameters
of the vial lids. Regression slopes were all significantly
different than 0 except for the 6.4 mm opening of pheny-
lacetaldehyde vials. Regression equations for phenylac-
etaldehyde: 1.0, y = 58.1 + 4.3x; 1.6, y = 56.5 + 4.1x; 3.2,
y = 59.8 + 2.0x; 12, y = 68.5 4.1x. Regression equations
for linalool: 1.0, y = 29.2 + 8.9x; 1.6, y = 40.4 + 9.2x; 3.2,
y = 56.7 + 6.5x; 6.4, y = 95.3 + 3.1x; 12, y = 99.3 1.34x.
DISCUSSION
This study follows up on research completed
with several lure combinations in Florida (Meagher
& Landolt 2008). In that study velvetbean caterpil-
lar moths and other moth species such as C. in-
cludens, Argyrogramma verruca (F.), Mocis dissev-
erans (Walker), M. latipes (Guenee), Diaphania hy-
alinata (L.), Heliothis virescens (F.), and Spodoptera
eridania (Stoll) all were captured in higher numbers
in PAA + linalool-baited traps than in unbaited
traps. Our experiments following that research
showed the synergistic effect of the addition of lina-
lool to PAA-baited traps because velvetbean cater-
pillar moths were captured in higher numbers in
traps baited with the binary blend than in traps
baited with either chemical alone.
March 2010
m
Meagher & Landolt: Floral Lures Attractive To Velvetbean Caterpillar
-----. ----.. ------- - --.-------
.a *
30 0 &
o Inl
O 1;
a. N.
0 10 20 30 40 s o 70 so N 1i
DaEP
Uonaool y
E ;
n yplacet Indoors 1-. y mL1 1.x 16 y=-10.
1 t 5M ^ ^ '^-----------------
000
6 -.
(A) or linalool (B) and with varying opening diameters
+ 0.9x; 3.2, y = -3.6 0.2x; 6.4, y = 5.4 1.4x; 12, y = 18.7
- 4.9x. Regression equations for linalool: 1.0, y = 6.5 +
3.1x; 1.6, y = 8.8 + 2.8x; 3.2, y = 16.0 + 2.2x; 6.4, y = 18.5
+ 0.9x; 12, y = 46.9 -5.3x.
Because the peanut fields were being managed
commercially, it was initially surprising that
large numbers of velvetbean caterpillar moths
were captured starting in Aug. However, it was
soon discovered that large areas of hairy indigo
(Indigofera hirsuta L.) bordered the fields and
were heavily infested by velvetbean caterpillars.
This exotic plant is known to be a good host and in
Brazil velvetbean caterpillar can maintain popu-
lations on it for most of the year (Panizzi et al.
2004).
Velvetbean caterpillar moths were captured in
similar numbers in baited traps that had different
vial lid openings, a result that was unlike captures
of 6 other moth species which were captured in
higher numbers with larger openings (data not
shown). Attempts to determine the release rate of
the 2 chemicals by vial weights over time provided
interesting results. It was apparent, because of
the large numbers of moths captured, that vials
with small lid openings (1.0 and 1.6 mm) released
undetermined amounts of chemical, but we hy-
pothesize that the cotton balls consistently gained
water weight, especially under high humidity
weather conditions in Florida during the summer.
However, vials with the 12-mm opening readily
lost weight under the humid conditions. Vials with
the 3.2- and 6.4-mm openings gained or lost
weight in between those extremes. Bringing the
experiment indoors increased the rate of weight
loss of the vials, especially of vials containing PAA.
The weight loss of vials with PAA in our study was
2.5 times less than what was found with a differ-
ent release vessel (our study, 12 mm = 4.9 mg/d;
Meagher 2001b, 0.493 mg/h x 24 h = 11.8 mg/d).
Landolt et al. (2004) reported an estimated 4 mg
per h loss of linalool with p-cresol and m-cresol
from 15 mL vials with a 25 mm-diameter hole in
the vial lid. The hygroscopic (water absorption)
properties of linalool have been determined
(Varutbangkul et al. 2006), although it is not
known how these properties affect moth attrac-
tion. The gravimetric method used in this study
proved inapplicable to determine release rates of
PAA and linalool from the vials utilized in traps.
The large numbers of velvetbean caterpillar
moths captured in traps suggest the possibility of
using these attractants in an attract-and-kill
strategy to manage moth populations (Landolt et
al. 1991). Previous research showed the utility of
the attract-and-kill strategy when alfalfa looper
Autographa californica (Speyer) populations were
controlled and oviposition on host plants was re-
duced in a screenhouse with pesticide-coated sta-
tions baited with a floral odor-based lure (Camelo
et al. 2007). The PAA + linalool lures were attrac-
tive to both male and female moths, although
there was a strong male bias of velvetbean cater-
pillar captured in traps. The sex ratio decreased
with increasing release rates of the blend, but
traps still contained high numbers of male moths
relative to female moths. The success of the at-
tract-and-kill strategy will depend on several
other factors, such as the age of the population re-
sponding to the lures and the percentage of the
actual population trapped. However, results
shown in this study provide an incentive to future
attractants research.
ACKNOWLEDGMENTS
Technical assistance was provided by D. Green.
Helpful comments were provided by R. Nagoshi
(Gainesville, FL, USA). The use of trade, firm, or corpo-
ration names in this publication is for the information
and convenience of the reader. Such use does not consti-
tute an official endorsement or approval by the United
States Department of Agriculture or the Agricultural
Research Service of any product or service to the exclu-
sion of others that may be suitable.
REFERENCES CITED
BRUCE, T. J., AND CORK, A. 2001. Electrophysiological
and behavioral responses of female Helicoverpa ar-
migera to compounds identified in flowers of African
marigold, Tagetes erecta. J. Chem. Ecol. 27: 1119-
1131.
BUSCHMAN, L. L., PITRE, H. N., HOVER, C. H., AND ED-
WARDS, JR., N. C. 1981. Occurrence of the velvetbean
caterpillar in Mississippi: winter survival or immi-
gration? Environ. Entomol. 10: 45-52.
BUSCHMAN, L. L., WHITCOMB, W. H., NEA T. M., AND
MAYS, D. L. 1977. Winter survival and hosts of the
velvetbean caterpillar in Florida. Florida Entomol.
60: 267-273.
CAMELO, L. DE A., LANDOLT, P. J., AND ZACK, R. S. 2007.
A kairomone based attract-and-kill system effective
against alfalfa looper (Lepidoptera: Noctuidae). J.
Econ. Entomol. 100: 366-374.
CANTELO, W. W., AND JACOBSON, M. 1979. Phenylace-
taldehyde attracts moths to bladder flower and to
blacklight traps. Environ. Entomol. 8: 444-447.
COVELL, JR., C. V. 2005. A Field Guide to Moths of East-
ern North America. Virginia Museum of Natural
History, Martinsville, VA, USA.
CREIGHTON, C. A., MCFADDEN, T. L., AND CUTHBERT, E.
R. 1973. Supplementary data on phenylacetalde-
hyde: an attractant for Lepidoptera. J. Econ. Ento-
mol. 66: 114-115.
HAYNES, K. F., ZHAO, J. Z., AND LATIF, A. 1991. Identifi-
cation of floral compounds from Abelia grandiflora
that stimulate upwind flight in cabbage looper
moths. J. Chem. Ecol. 17: 637-646.
HEATH, R. R., LANDOLT, P. J., DUEBEN, B., AND LENCZE-
WSKI, B. 1992. Identification of floral compounds of
night-blooming jessamine attractive to cabbage
looper moths. Environ. Entomol. 21: 854-859.
HEATH, R. R., TUMLINSON, J. H., LEPPLA, N. C.,
MCLAUGHLIN, J. R., DUEBEN, B., DUNDULIS, E., AND
GUY, R. H. 1983. Identification of a sex pheromone
produced by female velvetbean caterpillar moth. J.
Chem. Ecol. 9: 645-656.
HERZOG, D. C., AND TODD, J. W. 1980. Sampling velvet-
bean caterpillar on soybean, pp. 107-140 In M.
Kogan and D. C. Herzog [eds.], Sampling Methods
in Soybean Entomology, Springer-Verlag, New
York.
HONDA, K., OMURA, H., AND HAYASHI, N. 1998. Identifi-
cation of floral volatiles from Ligustrum japonicum
that stimulate flower-visiting by cabbage butterfly,
Pieris rapae. J. Chem. Ecol. 24: 2167-2180.
JOHNSON, D. W., MITCHELL, E. R., TUMLINSON, J. H.,
AND ALLEN, G. E. 1981. Velvetbean caterpillar: re-
sponse of males to virgin females and pheromone in
the laboratory and field. Florida Entomol. 64: 528-
533.
KIMBALL, C. P. 1965. Arthropods of Florida and Neigh-
boring Lands: Lepidoptera of Florida. Florida Dept.
of Agric., Division of Plant Industry, Gainesville, FL.
KINT, S. R., TERANISHI, R., LINGREN, P. D., SHAVER, T.
N., AND RAULSTON, J. R. 1993. Chemical composition
of Gaura suffulta and Gaura longiflora flower vola-
tiles. J. Essential Oil Res. 5: 201-203.
KNUDSEN, J. T., ERIKSSON, R., GERSHENZON, J., AND
STAHL, B. 2006. Diversity and distribution of floral
scent. Botanical Rev. 72: 1-120.
LANDOLT, P. J., AND SMITHHISLER, C. S. 2003. Charac-
terization of the floral odor of Oregongrape: possible
March 2010
feeding attractants for moths. Northwest Sci. 77: 81-
86.
LANDOLT, P. J., ADAMS, T., REED, H. C., AND ZACK, R. S.
2001. Trapping alfalfa looper moths (Lepidoptera:
Noctuidae) with single and double component floral
chemical lures. Environ. Entomol. 30: 667-672.
LANDOLT, P. J., ADAMS, T., AND ZACK, R. S. 2006. Field
response of alfalfa looper and cabbage looper moths
(Lepidoptera: Noctuidae, Plusiinae) to single and bi-
nary blends of floral odorants. Environ. Entomol. 35:
276-281.
LANDOLT, P. J., LENCZEWSKI, B., AND HEATH, R. R.
1991. Lure and toxicant system for the cabbage loop-
er (Lepidoptera: Noctuidae). J. Econ. Entomol. 84:
1344-1347.
LANDOLT, P. J., ZACK, R. S., GREEN, D., AND DECAMELO,
L. 2004. Cabbage looper moths (Lepidoptera: Noctu-
idae) trapped with male pheromone. Florida Ento-
mol. 87: 294-299.
LITTELL, R. C., MILLIKEN, G. A., STROUP, W. W., AND
WOLFINGER, R. D. 1996. SAS System for Mixed Mod-
els. SAS Institute Inc., Cary, NC.
LOPEZ, JR., J. D., SHAVER, T. N., BEERWINKLE, K. R.,
AND LINGREN, P. D. 2000. Feeding attractant and
stimulant for adult control of noctuid and/or other
lepidopteran species. U. S. Patent 6,074,634. Issued
June 2000.
McLAUGHLIN, J. R., AND HEATH, R. R. 1989. Field trap-
ping and observations of male velvetbean caterpil-
lar moths and trapping of Mocis spp. (Lepidoptera:
Noctuidae: Catacolinae) with calibrated formula-
tions of sex pheromone. Environ. Entomol. 18: 933-
938.
MEAGHER, JR., R. L. 2001a. Collection of soybean looper
and other noctuids in phenylacetaldehyde-baited
traps. Florida Entomol. 84: 154-155.
MEAGHER, JR., R. L. 2001b. Trapping fall armyworm
(Lepidoptera: Noctuidae) adults in traps baited with
pheromone and a synthetic floral volatile compound.
Florida Entomol. 84: 288-292.
MEAGHER, JR., R. L. 2002. Trapping noctuid moths with
synthetic floral volatile lures. Entomol. Exp. Appl.
103: 219-226.
MEAGHER, R. L., AND LANDOLT, P. J. 2008. Attractive-
ness of binary blends of floral odorant compounds to
moths in Florida, USA. Entomol. Exp. Appl. 128:
323-329.
MITCHELL, E. R., AND HEATH, R. R. 1986. Pheromone
trapping system for the velvetbean caterpillar (Lep-
idoptera: Noctuidae). J. Econ. Entomol. 79: 289-292.
PAIR, S. D., AND HORVAT, R. J. 1997. Volatiles of Japa-
nese honeysuckle flowers as attractants for adult
Lepidopteran insects. U. S. Patent 5,665,344. Issued
9 Sep 1997.
PANIZZI, A. R., OLIVEIRA, L. J., AND SILVA, J. J. 2004.
Survivorship, larval development and pupal weight
of Anticarsia gemmatalis (Hiibner) (Lepidoptera:
Noctuidae) feeding on potential leguminous host
plants. Neotropical Entomol. 33: 563-567.
PLEPYS, D. 2001. Odour-mediated Nectar Foraging in
the Silver Y Moth, Autographa gamma. Disserta-
tion, Lund University, Lund, Sweden. 110 pp.
SAS INSTITUTE. 2008. SAS 9.2 for windows. SAS Insti-
tute, Cary, NC.
SCHLOTZHAUER, W. S., PAIR, S. D., AND HORVAT, R. J.
1996. Volatile constituents from the flowers of Japa-
nese honeysuckle (Lonicera japonica). J. Agric. Food
Chem. 44: 206-209.
Florida Entomologist 93(1)
Meagher & Landolt: Floral Lures Attractive To Velvetbean Caterpillar
SHAVER, T. N., LINGREN, P. D., AND MARSHALL, H. F.
1997. Nighttime variation in volatile content of flow-
ers of the night blooming plant Gaura drummondii.
J. Chem. Ecol. 23: 2673-2682.
SLANSKY, JR., F. 1989. Early season weedy legumes: po-
tential larval food plants for the migratory velvet-
bean caterpillar (Lepidoptera: Noctuidae). J. Econ.
Entomol. 82: 819-824.
SMITH, C. E., ALLEN, N., AND NELSON, O. A. 1943. Some
chemotropic studies with Autographa spp. J. Econ.
Entomol. 36: 619-621.
TERANISHI, R., BUTTERY, R. G., KINT, S., TAKEOKA, G.,
LINGREN, P. D., RAULSTON, J. R., AND SHAVER, T. N.
1991. Chemical composition of Gaura drummondii
flower volatiles. J. Essential Oil Res. 3: 287-288.
VARUTBANGKUL, V., BRECHTEL, F. J., BAHREINI, R., NG,
N. L., KEYWOOD, M. D., KROLL, J. H., FLAGAN, R. C.,
SEINFELD, J. H., LEE, A., AND GOLDSTEIN, A. H.
2006. Hygroscopicity of secondary organic aerosols
formed by oxidation of cycloalkenes, monoterpenes,
sesquiterpenes, and related compounds. Atmos.
Chem. Phys. Discuss. 6: 1121-1177.
WATSON, J. R. 1916. Life-history of the velvet-bean cat-
erpillar (Anticarsia gemmatalis Hiibner). J. Econ.
Entomol. 9: 521-527.
WATSON, J. R. 1932. Further notes on the velvet bean
caterpillar. Florida Entomol. 16: 24.
WUENSCH, K. 2007. Comparing correlation coefficients,
slopes, and intercepts. http://core.ecu.edu/psyc/
wuenchk/StatsLessons.htm.
Florida Entomologist 93(1)
March 2010
CHARACTERIZATION OF SOLENOPSIS INVICTA
(HYMENOPTERA: FORMICIDAE) POPULATIONS IN VIRGINIA: SOCIAL
FORM GENOTYPING AND PATHOGEN/PARASITOID DETECTION
HAMILTON R. ALLEN' STEVEN M. VALLES2 AND DINI M. MILLER'
1Department of Entomology, Virginia Tech, 216A Price Hall, Blacksburg, VA 24060
2Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive,
Gainesville, FL 32608
*Corresponding author
ABSTRACT
Red imported fire ant, Solenopsis invicta Buren, workers were sampled from 26 colonies in
Virginia during the 2007-2008 time period. Polymerase chain reaction (PCR) assays were
used to determine colony social form monogynyy or polygyny) by genotyping ants at the Gp-
9 locus. Twenty of the colonies (76.9%) were found to be polygyne. Multiplex PCR was also
used to detect the presence of several organisms currently being used as biological control
agents for fire ants in the U.S., including the microsporidian parasite Kneallhazia solenop-
sae and Pseudacteon spp. parasitioid decapitating phorid flies in the sampled colonies.
Kneallhazia solenopsae was detected in 11 of 26 colonies (42%). In addition, Pseudacteon
spp. flies were detected in 2 (7.7%) colonies. The sampled colonies were examined by reverse
transcription PCR (RT-PCR) for the presence of Solenopsis invicta viruses -1 and -2. Results
indicated that 5 colonies were infected with SINV-1 (19%) and none were infected with
SINV-2. This study is the first to characterize the red imported fire ant infestation in Vir-
ginia and documents the presence of biological control agents in this area.
Key Words: monogyne, polygyne, Kneallhazia solenopsae, Solenopsis invicta virus-1, Pseu-
dacteon
RESUME
Se realize un muestreo de las obreras de la hormiga de fuego roja importada, Solenopsis in-
victa Buren, en 26 colonies en el estado de Virginia durante el period del 2007 al 2008. Se
utilizaron ensayos de la reacci6n en cadena por la polimerasa (RCP) para determinar la
forma social de la colonia (monoginia = una sola reina reproductive) o poliginia = reinas mul-
tiples) por medio del genotipo de las hormigas en el locus Gp-9. Se encontr6 que veinte de las
colonies (76.9%) fueron poliginias. Se us6 RCP multiplex para detectar la presencia de various
organismos que estan usando actualmente como agents de control biol6gico para las hor-
migas de fuego en los Estados Unidos, incluyendo el parasite microesporidiano Kneallhazia
solenopsae, y la mosca Pseudacteon spp. (Diptera: Phoridae) que son parasitoides que deca-
pitan las hormigas en las colonial muestreadas. Kneallhazia solenopsae fue detectado en 11
de las 26 colonies (42%). Ademas, se detectaron las moscas Pseudacteon spp. en dos (7.7%)
de las colonies. Se examinaron las colonies muestreadas por la transcripci6n reverse de RCP
(TR-RCP) para la presencia de los virus 1 y 2 de Solenopsis invicta. Los resultados indican
que las 5 colonies fueron infectadas con SINV-1 (19%) y ninguna fue infectada con SINV-2.
Este es el primer studio que caractiza la infestaci6n de la hormiga de fuego roja importada
en Virginia y document la presencia de agents de control biol6gico en esta area.
The spread and current range of the red im-
ported fire ant, Solenopsis invicta (Buren,) in the
United States has been well documented (George
1958; Lofgren 1986, Callcott & Collins 1996; Wil-
liams et al. 2001). Currently, S. invicta infests
over 150 million hectares of land in Alabama, Ar-
kansas, Arizona, California, Florida, Georgia,
Louisiana, Mississippi, New Mexico, North Caro-
lina, Oklahoma, South Carolina, Tennessee,
Texas, Virginia, and Puerto Rico (Kemp et al.
2000; Vander Meer et al. 2007).
Although fire ant infestations have been ob-
served throughout the southeastern U.S. since the
1930s, these aggressive ants were not docu-
mented in Virginia until 1989 (Gina Goodwyn,
Virginia Department of Agriculture and Con-
sumer Services, personal communication).
The initial specimens were collected from
Hampton, Virginia, located on the southeastern
coast of the state. Virginia's Department of Agri-
culture and Consumer Services (VDACS) has
been responsible for documenting and treating all
Allen et al.: Characterization of Solenopsis invicta Populations in Virginia
fire ant mounds that have appeared within Vir-
ginia. Since 1989, the number of fire ant-infested
areas and mounds documented by VDACS has in-
creased annually. From 1989 to 1999, VDACS
identified 136 sites that were infested with S. in-
victa. From 2000-2006 the number of infested
sites increased to 541. The largest number of
mounds identified and treated by VDACS has
been located in the developing coastal cities of
Chesapeake (3,000 mounds) Norfolk (1,700
mounds), and Virginia Beach (2,400 mounds)
(Gina Goodwyn, Virginia Department of Agricul-
ture and Consumer Services, personal communi-
cation), which are all cities located in the Hamp-
ton Roads area. The fact that S. invicta is so prev-
alent in the southeastern region of Virginia is
most likely due to the fact that this area has expe-
rienced the most rapid urban development within
the state. Tschinkel (1988) found a positive corre-
lation between areas of development (building
construction) and fire ant presence.
As of 2009, S. invicta populations in Virginia
are not as widespread as infestations observed in
other southern states such as Texas and Florida;
however, several predictive models have sug-
gested that fire ants can certainly become estab-
lished within the Virginia cities and counties im-
mediately outside of the Hampton Roads area
(Korzukhin et al. 2001; Morrison et. al 2004). In
2009, the cities of Chesapeake, Hampton, New-
port News, Norfolk, Poquoson, Portsmouth, Suf-
folk, Virginia Beach, and Williamsburg and the
counties of James City and York were placed tem-
porarily under the Federal Red Imported Fire Ant
Quarantine which aims to restrict the movement
of fire ants from the quarantined areas to non-
quarantined areas in the state. As a result of the
quarantine's implementation, VDACS is no
longer responsible for treating fire ant mounds in
the quarantined cities and counties. Based on the
increases in S. invicta incidents reported to
VDACS and the recent implementation of the
quarantine by APHIS, it is apparent that there is
need for baseline biological and ecological infor-
mation regarding S. invicta populations in Vir-
ginia.
In response to the rapid spread of S. invicta in
the southern states, many of the states have de-
veloped fire ant research programs to determine
the impacts of S. invicta on other organisms, how
the ants were able to spread, and to establish op-
timal control strategies. Indeed, colony social
form has been reported to play a major role in the
dispersal, control and environmental impacts of
S. invicta (Lofgren & Williams 1984; Glancey et
al. 1987; Porter et al. 1988; Porter et al. 1991;
King et al. 2009).
Fire ant colonies exhibit 1 of 2 social forms.
Colonies contain either 1 egg laying queen (mo-
nogyne) or multiple egg-laying queens (polygyne)
(Glancey 1973). Monogyne and polygyne fire ant
colonies differ in many aspects of their biology in-
cluding their reproductive strategies, territorial-
ity, and colony founding methods (Keller &
Passera 1989; Keller & Ross 1999). For example,
polygyne fire ant colonies have a higher mound
density in a given area than monogyne colonies
(Tschinkel 2006) and the multiple colonies have a
greater influence on local ecology, impacts on hu-
man activities and strategies necessary for con-
trol (King & Tschinkel 2009).
Colony social form is associated with general
protein-9 (Gp-9) (Keller & Ross 1999). Monogyne
ants are consistently homozygous for the B allele
(Gp-9B) and polygyne ants are heterozygous pos-
sessing both alleles (Gp-9Bb). Previous work con-
ducted by Valles et al. (2003) has shown that
these 2 alleles can be distinguished from one an-
other by multiplex PCR.
Until recently, chemical control methods were
the only means available for S. invicta control
(Williams et al. 2001). However, as part of the
USDA's fire ant areawide suppression program,
the effectiveness of several biological control
agents are currently being examined and/or re-
leased in the U.S. These agents include the mi-
crosporidian parasite, Kneallhazia solenopsae,
and decapitating flies found in the genus Pseu-
dacteon (Pereira 2003).
The purpose of this study was twofold. First,
we assessed the colony social form of S. invicta
colonies sampled from Virginia. Social form data
are intended to help direct future quarantine and
control efforts and may also aid researchers in
predicting the potential rate of spread of S. in-
victa colonies in Virginia. The second goal was to
determine if any biological control agents were
present in Virginia S. invicta colonies. To date, no
biological control agents have been released in
Virginia for S. invicta control. Therefore, deter-
mining whether these agents are already present
or not in Virginia would guide future control ef-
forts and releases.
MATERIALS AND METHODS
Fire Ant Sample Collection
Red imported fire ant workers, Solenopsis in-
victa Buren, were collected from 26 different colo-
nies located in 7 different cities (Norfolk, Virginia
Beach, Chesapeake, Portsmouth, Suffolk,
Roanoke, and Richmond) within the state of Vir-
ginia from 2007 through 2008. Individual work-
ers were collected by disturbing the mound and
removing the emerging workers with a hand-held
aspirator (BioQuip, Rancho Dominguez, CA). At
least 10 worker ants were collected from each
mound. All ant samples were placed in glass vials
(Acme Glass and Vial Co., Paso Robles, CA) con-
taining 90-95% ethanol. Vials were labeled with
the date of collection and location information.
Florida Entomologist 93(1)
DNA Preparation
Genomic DNA was extracted from the ants as
described by Valles et al. (2002). Ten worker ants
from each sample were removed from the collec-
tion vials and blotted dry with a clean paper
towel. The dried ants (10 per sample) were placed
into separate 1.5-mL microcentrifuge tubes (Ep-
pendorf, Westbury, NY) containing 150 pL of lysis
buffer (50 mM Tris-HC1, pH 8, 4% sodium dodecyl
sulfate, and 5% 2-mercaptoethanol). Ants were
homogenized by hand with a plastic pestle for 15-
20 s. After homogenization, 200 pL of phenol:chlo-
roform:isoamyl alcohol (Tris-HCl-saturated, pH
8) were added to the tube. The microcentrifuge
tube was inverted 4-5 times until the solution be-
came milky white. The samples were then centri-
fuged for 5 min at 20,817g in a model 5417C cen-
trifuge (Eppendorf, Westbury, NY). Fifty microli-
ters of the DNA-containing layer supernatantt)
were removed from the microcentrifuge tube and
transferred to a new 1.5- mL microcentrifuge tube
(Eppendorf, Westbury, NY). DNA was precipi-
tated by adding 900 pL of 100% isopropanol to the
microcentrifuge tube. The mixture was inverted 5
times and centrifuged for 5 min at 20,817g. The
isopropanol was decanted from the microcentri-
fuge tube, and the pellet was washed twice with
500 pL of 70% ethanol and centrifuged for 5 min
at 20,817g. Ethanol was decanted from the micro-
centrifuge tubes and the tubes were centrifuged
for an additional 4 s (Eppendorf, Westbury, NY),
further separating the supernatant and the pel-
let. The remaining ethanol was removed by mi-
cropipette. Pellets were allowed to dry in an incu-
bator set at 37C for 5 min. Pellets were re-sus-
pended and dissolved in 50 pL of TE buffer
(10mM Tris-HC1, 1 mM EDTA, pH 8.0). The puri-
fied DNA was analyzed spectrophotometrically to
determine the concentration in each sample. All
samples were diluted with TE buffer to achieve
concentrations in the range of 50 to 100 ng DNA/
pL.
RNA Preparation
Total RNA was isolated from 10 fire ant work-
ers from each colony sample. Fire ant workers
were removed from collection vials and blotted
dry with a paper towel. Dried ants were placed in
a 1.5-mL microcentrifuge tube. The ants were ho-
mogenized with a plastic pestle in 0.5 mL of Trizol
reagent (Invitrogen, Carlsbad, CA). Chloroform
(0.2 mL) was added to the homogenate, which was
vortexed briefly and centrifuged at 20,817 g for 5
min at room temperature. The supernatant was
transferred to a clean 1.5- mL microcentrifuge
tube and 0.5 mL of isopropanol was added. The
RNA pellet was rinsed once with 70% ethanol,
dried, and suspended in 20 pL of DEPC-treated
water. The RNA concentration was measured
spectrophotometrically and diluted with DEPC-
treated water to a concentration between 10 and
50 ng RNA/pL.
Polymerase Chain Reaction/Colony Social Form
Multiplex PCR was carried out in a PTC 100
thermal cycler (MJ Research, Waltham, MA) as
described by Valles & Porter (2003). The Gp-9' al-
lele primers, 16BAS and 26BS were used to spe-
cifically identify samples from monogyne colonies
and the Gp-9b allele specific primers, 24bS and
25bAS were used to identify polygyne samples.
The Gp-9B primers corresponded to nucleotide po-
sitions 2167-2199 (16BAS) and 1683-1703 (26BS).
The Gp-9b allele primers correspond to positions
1307-1334 (24bS) and 1702-1729 (25bAS). PCR
was conducted in a 50 pL volume containing 0.5
pL of prepared DNA (25 to 50 ng), 5 pL PCR
buffer (10X), 2 pL of 50 mM MgCl2, 1 pL of 10mM
dNTP, 0.4 pL Platinum Taq polymerase (Invitro-
gen, Carlsbad, CA), 33.1 pL of H20, and 2 pL of
each primer (P16, P24, P25, and P26). The PCR
process was conducted under the following tem-
perature conditions: 1 cycle at 94C for 2 min,
then 35 cycles at 94C for 15 s, 55C for 15 s, and
68C for 30 s, and a single elongation step at 68C
for 5 min. PCR products (17 pL) were separated
on a 1% agarose gel and visualized by ethidium
bromide staining. Positive and negative controls
were run for both monogyne and polygyne sam-
ples.
Kneallhazia solenopsae and Pseudacteon spp. Detection
Oligonucleotide primers specific to the 16S
rDNA gene (Moser et al., 1998; Moser et al., 2000;
Valles et al. 2002; accession number: AF031538)
of K. solenopsae (P1: 5'CGAAGCATGAAAGCG-
GAGC and P2: 5'CAGCATGTATATGCAC-
TACTGGAGC) and the 18S rDNA gene of Pseu-
dacteon flies (P800: 5'GTAGTACACCTATACAT-
TGGGTTCGTACATTACTCTA and P801:
5'ATAAGTTTCAACGCTATAATCCTGAAAG-
CATC) were used in a multiplex PCR to detect the
presence of K. solenopsae and Pseudacteon spp.
genetic material within the Virginia ant samples
(Valles et al. 2009). Multiplex PCR was initiated
by the hot start method in a PTC 100 thermal cy-
cler (MJ Research, Waltham, MA) under the fol-
lowing optimized temperature regime: 1 cycle at
94C for 2 min, then 35 cycles at 94C for 15 s,
55C for 15 s, and 68C for 50 s, followed by a final
elongation step of 5 min at 68C (Valles et al.
2009). The reactions were carried out in a 25-
pLvolume containing 2 mM MgCl2, 200 pM dNTP
mix, 0.5 units of Platinum Taq DNA polymerase
(Invitrogen, Carlsbad, CA), 0.4 pM of primers P1
and P2, 0.05 pM of primers P800 and P801, and
25 to 50 ng of genomic DNA. PCR products were
separated on a 1% agarose gel and visualized by
March 2010
Allen et al.: Characterization of Solenopsis invicta Populations in Virginia
ethidium bromide staining. For all experiments,
positive and negative controls were conducted si-
multaneously.
Verification ofPseudacteon spp. Parasitization
To verify that the corresponding amplicon was
produced from a Pseudacteon fly species by PCR,
the produced amplicon was cloned and sequenced.
The agarose gel-purified amplicon was ligated
into pCR4-TOPO vector, transformed into TOP10
competent cells (Invitrogen, Carlsbad, CA), and
sequenced by the Interdisciplinary Center for
Biotechnology Research (University of Florida).
The sequences were subjected to BLASTn analy-
sis (Altschul et al. 1997) then aligned with identi-
fied sequences with the Vector NTI software suite
(Invitrogen, Carlsbad, CA).
Detection of Solenopsis invicta Viruses
One-step reverse transcriptase polymerase
chain reaction (RT-PCR) was used to identify So-
lenopsis invicta viruses 1 and 2 (SINV-1, -2) in S.
invicta worker ants from Virginia. cDNA was syn-
thesized and subsequently amplified by the One-
Step RT-PCR kit (Invitrogen, Carlsbad, CA) with
oligonucleotide primers p517 (5'CAATAGGCAC-
CAACGTATATAGTAGAGATTGGA) and p519
(5'GGAATGGGTCATCATATAGAAGAATTG) to
detect SINV-1 (Hashimoto et al. 2007) and p64
(5'ATTTGTTTTGGCCACGGTCAACA) and p65
(5'GATGATACAAAGCATTAGCGTAGG-
TAAACG) to detect SINV-2 (Valles et al. 2007).
RT-PCR was conducted in a PTC 100 thermal cy-
cler (MJ Research, Waltham, MA) under the fol-
lowing optimized temperature regimen: 1 cycle at
45C for 30 min, 1 cycle at 94C for 2 min, 35 cy-
cles of 94C for 15 s, 56C for 15 s, 68C for 30 s,
followed by a final elongation step of 68C for 5
min. Amplicons were separated by electrophore-
sis on a 1.2% agarose gel stained with ethidium
bromide.
RESULTS
Colony Social Form
Both monogyne and polygyne fire ant colonies,
were positively identified from the Virginia ant
samples (Fig. 1, Table 1). Among the 26 fire ant
colonies sampled, 20 (76.9%) were heterozygous
at the Gp-9 (Gp-9Bb) locus indicating that the ants
were of polygyne form (Table 1). The remaining 6
colonies were homozygous (Gp-9"B) and consid-
ered monogyne.
Detection of Kneallhazia solenopsae and Decapitating
Phorid Flies in S. invicta Colonies
Multiplexed PCR products for both K. solenop-
sae and Pseudacteon spp. phorid flies are shown
in Fig. 2. Of the 26 sampled colonies, 11 (42%)
were infected with K. solenopsae (Table 2) and
Fig. 1. Multiplex PCR banding patterns of Virginia monogyne and polygyne fire ant colonies separated on a 1%
agarose gel. Lane 1, molecular weight marker expressed as base pairs; lane 2, polygyne band; lane 5, monogyne
band; lane 11, positive monogyne control; lane 12, positive polygyne control.
Florida Entomologist 93(1)
TABLE 1. DISTRIBUTION AND PERCENTAGE OF MONOGYNE AND POLYGYNE S. INVICTA COLONIES COLLECTED IN VIR-
GINIA CITIES.
No. of No. of % No. of %
Site Samples Monogyne Colonies Monogyne Polygyne Colonies Polygyne
Chesapeake* 12 1 8.3 22 91.7
Norfolk* 1 0 0 1 100
Portsmouth* 1 0 0 1 100
Richmond 1 1 100 0 0
Roanoke 2 0 0 2 100
Suffolk* 3 2 66.7 1 33.3
Virginia Beach* 6 2 33.3 4 66.7
Total 26 6 23.1 20 76.9
*Indicates cities in Hampton Roads.
worker ants from 2 colonies were parasitized by
phorid flies. Among the 11 colonies infected with
K. solenopsae, 8 (73%) were polygyne and 3 (27%)
were monogyne (Fig. 2). Phorid fly genetic mate-
rial was found in ant samples collected from 2 dif-
ferent locations: Chesapeake and Virginia Beach
(Table 2). One of the Pseudacteon-parasitized col-
onies was polygyne and 1 was monogyne. The
small ribosomal subunit (18S) sequences from
both of the ant samples (Chesapeake and Virginia
Beach) revealed that the fly genes were identical.
The P tricuspis 18S gene was sequenced in an ef-
fort to determine which Pseudacteon species was
discovered in Virginia. Unfortunately, definitive
species identification could not be determined
(Table 3) because the sequences for P litoralis and
P obtusus are identical to P tricuspis in the se-
quenced region. However, sequence differences
were sufficient to exclude P cultellatus and P cur-
vatus. Thus, the Virginia fire ant samples were
likely P. litoralis, P obtusus, or P. tricuspus-all
species released in the United States as biological
control agents.
Detection of Solenopsis invicta Viruses
SINV-1 was detected in 5 of the 26 (19%) sam-
pled fire ant colonies (Table 4). SINV-2 was not de-
tected in any of the colonies.
DISCUSSION
Polygyne and monogyne fire ant colonies are
present in Virginia and appear to be established
in this state. Although, both social forms were col-
lected, sample data suggest that the majority of S.
Fig. 2. Multiplex PCR banding patterns of Pseudacteon spp. phorid and K. solenopsae on a 1% agarose gel. Lane
1, top band positive Pseudacteon spp. control, bottom band positive K. solenopsae control; lane 5, K. solenopsae in-
fected fire ant worker, lane 8 Pseudacteon spp. phorid fly parasitized fire ant worker.
March 2010
Allen et al.: Characterization of Solenopsis invicta Populations in Virginia 85
TABLE 2. DISTRIBUTION AND PERCENTAGE OF VIRGINIA FIRE ANT COLONIES PARASITIZED BY PSEUDACTEON SPP.
PHORID FLIES AND INFECTED WITH T. SOLENOPSAE.
No. of Colonies Percentage of No. of Percentage of
No. of Parasitized by Pseudacteon spp. Colonies Infected with T solenopsae
Site Samples Pseudacteon spp. flies flies parasitization T solenopsae infection
Chesapeake 12 1 8.3 5 41.7
Norfolk 1 0 0 1 100
Portsmouth 1 0 0 0 0
Richmond 1 0 0 1 100
Roanoke 2 0 0 0 0
Suffolk 3 0 0 1 33.3
Virginia Beach 6 1 16.7 3 50
Total 26 2 7.7 11 42.3
TABLE 3. NUCLEOTIDE DIFFERENCES OBSERVED IN THE SMALL RIBOSOMAL SUBUNIT (18S) SEQUENCES OF PSEUDAC-
TEON PHORID FLIES FROM VIRGINIA AND GENBANK DATABASEA SEQUENCES.
Nucleotide position
Sequence origin 266 630 796 887
Pseudacteon cultelatus C T A C
Pseudacteon littoralis A T A C
Pseudacteon obtusus A T A C
Pseudacteon curvatus A C T T
Pseudacteon (Chesapeake) A T A C
Pseudacteon (Virginia Beach) A T A C
AGenBank accession numbers are provided in the text.
TABLE 4. DISTRIBUTION AND PERCENTAGE OF VIRGINIA FIRE ANT COLONIES INFECTED WITH SINV.
No. of Colonies Infected Percentage of SINV
Site No. of Samples with SINV infection
Chesapeake 12 2 16.7
Norfolk 1 0 0
Portsmouth 1 0 0
Richmond 1 0 0
Roanoke 2 0 0
Suffolk 3 0 0
Virginia Beach 6 3 50
Total 26 5 19.2
invicta colonies in Virginia may be polygyne. This
finding is particularly relevant to control efforts
because polygyne colonies tend to be associated
with higher mound and population densities (Ma-
com & Porter 1996). The higher mound density is
usually accomplished through colony budding, a
process that can be initiated by the use of im-
proper control techniques. During the budding
process, workers from an established colony leave
their original nest with 1 or more fecund queens,
to found a new colony several meters away from
the parent colony (Holldobler & Wilson 1990;
Tschinkel 2006). Budding fire ant colonies are
able to multiply quickly and 1 mound has the po-
tential to split off into as many as 8 mounds in
less than 5 months (Vargo & Porter 1989).
Twenty three of the 26 ant colony samples
were collected from colonies located in the Hamp-
ton Roads area of Virginia (Table 1) and according
to data provided by Virginia's Department of Ag-
riculture and Consumer Services, population and
mound densities in Hampton Roads are higher
than those observed in other areas of the state. In
the U.S., S. invicta ants were first identified in
Florida Entomologist 93(1)
seaports located in Mobile, AL (Tschinkel 2006).
Similarly, Hampton Roads is located on the south-
eastern coast of Virginia near the North Carolina
border. The Hampton Roads area of Virginia is
also a major port area and many of the more re-
cent S. invicta infestations outside of the U.S.
have occurred via human transport near port
towns (King et al. 2008). Thus, the potential for
repeated introductions of the ants into Virginia is
high.
The discovery of polygyne colonies in Virginia
has particular relevance to current, as well as, fu-
ture S. invicta management practices (King et al.
2008). At present, some of the more successful fire
ant control products are not labeled for use in Vir-
ginia and with the recent implementation of the
Federal Fire Ant Quarantine, additional control
measures will be needed. Consequently, we
wanted to determine if any fire ant biological con-
trol organisms were present in the sampled colo-
nies. We discovered that worker ants from several
colonies were either parasitized by Pseudacteon
decapitating phorid flies or infected by K solenop-
sae. Five colonies were also infected with Solenop-
sis invicta virus 1, but none with SINV-2. None of
these organisms have been intentionally released
in Virginia, but both K. solenopsae and several
Pseudacteon phorid fly species have been success-
fully released in the U.S. as part of an areawide
fire ant suppression program being conducted by
the United States Department of Agriculture
(Vander Meer 2007).
Of the 11 Virginia colonies infected with K. so-
lenopsae, 3 were monogyne. This finding is of par-
ticular interest because K. solenopsae infections
of monogyne colonies are considered rare among
North American colonies (Oi et al. 2004). How-
ever, Fuxa et al. (2005) did document a 63% mo-
nogyne colony infection rate in a multiple colony,
monogyne S. invicta population in Louisiana.
Milks et al. (2007) also examined the prevalence
of K. solenopsae in Louisiana S. invicta colonies,
and reported that monogyne colony infections ac-
counted for about 20% of the total number of in-
fected colonies.
Pseudacteon flies were detected in 2 of the
worker ant samples. This discovery is interesting
because the nearest release site for Pseudacteon
flies was approximately 100 miles away from the
sampled region on the east coast of North Caro-
lina (S. D. Porter, USDA-CMAVE, Gainesville,
Florida, personal communication). Identification
of this fly in Virginia raises the possibility that
parasitoid Pseudacteon flies may be spreading
naturally in the U.S. Several different fly species
including P. curvatus, P. littoralis, P. obtusus,
and P. tricuspus have been released by the USDA.
Attempts were made to differentiate between the
2 positive finds in the Virginia ant colonies with
genetic sequencing. However, sequence data for
the 18S rDNA gene could only exclude P. cultella-
tus, which has not been released as a biological
control agent, and P. curvatus. Because Pseudac-
teon introductions were not specifically conducted
in Virginia, it is a distinct possibility that previ-
ously infected ant colonies were brought into the
state and are the source of the Pseudacteon intro-
duction.
The findings presented in this report indicate
that biological control organisms (Pseudacteon
flies, K. solenopsae, and SINV-1) may likely be es-
tablished in additional Virginia S. invicta colo-
nies. Therefore, these organisms may be a practi-
cal addition to an integrated pest management
program designed for S. invicta in Virginia, simi-
lar to the USDA Areawide Fire Ant Suppression
Program. Preliminary results of the suppression
program have demonstrated that K. solenopsae
and Pseudacteon flies have become established in
all of their release locations (Florida, Mississippi,
Oklahoma, South Carolina, and Texas) and have
reduced S. invicta populations by 85-99% (Vander
Meer et al. 2007).
It is obvious that the small sample size (26)
may not accurately represent the relative per-
centage of monogyne and polygyne colonies
within the state of Virginia. The small sample size
also limits our knowledge of the distribution and
prevalence of biological control agents within the
state. However, our results document that both
social forms of S. invicta are present in Virginia
and infected with K solenopsae, Pseudacteon
flies, and SINV-1. Many of the Virginia fire ant
samples were collected from a single region, the
Hampton Roads area. However, S. invicta infesta-
tions may be more widespread within the state, in
areas that have not been sampled. Macom and
Porter (1996) reported that polygyne colonies in
the U.S. are distributed in a mosaic pattern sepa-
rated from one another by monogyne colonies
(Macom & Porter 1996, Mescher et al. 2003). This
pattern may be present in the Virginia infesta-
tions because both social forms are documented to
be present.
Although additional samples will be neces-
sary to conclusively characterize the S. invicta
populations in Virginia, this is the first report
documenting the establishment, social form,
and associated pathogens and parasites of S. in-
victa within the state. Undoubtedly, the S. in-
victa infestation is well established in Virginia.
It is now evident that in order to extend the
scope of knowledge on the expanding S. invicta
population continuous statewide research ef-
forts are necessary.
ACKNOWLEDGMENT
We thank Charles A. Strong for providing technical
assistance, and the Plant and Pest Services division of
Virginia's Department of Agriculture for providing fire
ant incidence data.
March 2010
Allen et al.: Characterization of Solenopsis invicta Populations in Virginia
REFERENCES CITED
ALTSCHUL, S. F., MADDEN, T. L., SCHAFFER, A. A.,
ZHANG, J., ZHANG, Z., MILLER, W., AND LIPMAN, D.
J., 1997. Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs.
Nucleic Acids Res. 25: 3389-3402.
AUBUCHON, M. D., AND VAN DER MEER, R. K. 2008.
Areawide suppression of fire ants, pp. 261-270 In O.
Koul, G. Cuperus, and N. Elliot [eds.], Areawide Pest
Management: Theory and Implementation. CABI,
Wallingford, UK. 480 pp.
FUXA, J. R., MILKS, M. L., SOKOLOVA, Y. Y., AND RICH-
TER, A. R. 2005. Interaction of an entomopathogen
with an insect social form: an epizootic of Thelohania
solenopsae (Microsporidia) in a population of the red
imported fire ant, Solenopsis invicta. J. Invertebr.
Pathol. 88: 79-82.
GLANCEY, B. M., CRAIG, C. H., STRINGER, C. E., AND
BISHOP, P. M. 1973. Multiple fertile queens in colo-
nies of the imported fire ant, Solenopsis invicta. J.
Georgia Entomol. Soc. 8: 327-328.
GLANCEY, B. M., NICKERSON, J. C. E., WOJCIK, D.,
TRAGER, J., BANKS, W. A., AND ADAMS, C. T 1987.
The increasing incidence of the polygynous form of
the red imported fire ant, Solenopsis invicta (Hy-
menoptera: Formicidae) in Florida. Florida. Ento-
mol. 70: 400-402.
HASHIMOTO, Y., AND VALLES, S. M. 2007. Detection and
quantitation of Solenopsis invicta virus in fire ants
by real-time PCR. J. Virol. Methods 140: 132-139.
KELLER, L., AND PASSER, A. L. 1989. Regulation of
queen number in the Argentine ant, Iridomyrmex
humilis (Hymenoptera: Formicidae). Actes des Col-
loques Insectes Sociaux. 6: 287-293.
KELLER, L., AND ROSS, K. G. 1999. Major gene effects on
phenotype and fitness: the relative roles of Pgm-3
and Gp-9 in introduced populations of the fire ant
Solenopsis invicta. J. Evol. Biol. 12: 672-680.
KEMP, S. F., DE SHAZO, R. D., MOFFITT, J. E., WILLIAMS
D. F., AND BUHNER II, W. A. 2000. Expanding habitat
of the imported fire ant (Solenopsis invicta): a public
health concern. J. Allergy Clin. Immunol. 105: 683-
691.
KING, J. R., TSCHINKEL, W. R., AND ROSS, K. G. 2009. A
case study of human exacerbation of the invasive
species problem: transport and establishment of po-
lygyne fire ants in Tallahassee, Florida, USA. Biol.
Invasions 11: 373-377.
KORZUKHIN, M. D., PORTER, S. D., THOMPSON, L. C.,
AND WILEY, S. 2001. Modeling temperature-depen-
dent range limits for the fire ant Solenopsis invicta
(Hymenoptera: Formicidae) in the United States.
Environ. Entomol. 30: 645-655.
LOFGREN, C. S., AND WILLIAMS, D. F. 1984. Polygynous
colonies of the red imported fire ant, Solenopsis in-
victa (Hymenoptera: Formicidae) in Florida. Florida.
Entomol. 67: 484-486.
MACOM, T. E., AND PORTER, S. D. 1996. Comparison of
polygyne and monogyne red imported fire ant (Hy-
menoptera: Formicidae) population densities. Ann.
Entomol. Soc. America 89: 535-543.
MESCHER, M. C., ROSS, K. G., SHOEMAKER, D. D.,
KELLER, L., AND KRIEGER, M. J. B. 2003. Distribu-
tion of the two social forms of the fire ant, Solenopsis
invicta (Hymenoptera: Formicidae) in the native
South American range. Ann. Entomol. Soc. America
96:810-817.
MILKS, M. L., FUXA, J. R., AND RICHTER, A. R. 2007.
Prevalence and impact of the microsporidium Thelo-
hania solenopsae (Microsporidia) on wild popula-
tions of red imported fire ants, Solenopsis invicta, in
Louisiana. J. Invertebr. Pathol. 97:91-102.
MORRISON, L. W. 2000. Mechanisms of Pseudacteon par-
asitoid (Diptera: Phoridae) effects on exploitative
and interference competition in host Solenopsis ants
(Hymenoptera: Formicidae). Ann. Entomol. Soc.
America 93: 841-849.
MORRISON, L. W., PORTER, S. D., DANIELS, E., AND Ko-
RZUKHIN, M. D. 2004. Potential global range expan-
sion of the invasive fire ant, Solenopsis invicta. Eco-
logical Invasions. 6: 183-191.
MOSER, B. A., BECNEL, J. J., MARUNIAK, J., AND
PATTERSON, R. S. 1998. Analysis of the ribosomal
DNA sequences of the microsporida Thelohania and
Vairimorpha of fire ants. J. Invertebr. Pathol. 72:
154-159.
MOSER, B. A., BECNEL, J. J., AND WILLIAMS, D. F. 2000.
Morphological and molecular characterization of the
Thelohania solenopsae complex (Microsporidia: The-
lohaniidae). J. Invertebr. Pathol. 75: 174-177.
PEREIRA, R. M. 2003. Areawide suppression of fire ant
populations in pastures: project update. J. Agric. Ur-
ban Entomol. 20: 123-130.
PORTER, S. D., EIMEREN, B., AND GILBERT, L. E. 1988.
Invasion of red imported fire ants (Hymenoptera:
Formicidae): microgeography of competitive replace-
ment. Ann. Entomol. Soc. Am. 81: 913-918.
PORTER, S. D., BHATKAR, A., MULDER, R., VINSON, S. B.,
AND CLAIR, D. J. 1991. Distribution and density of
polygyne fire ants (Hymenoptera: Formicidae) in
Texas. J. Econ. Entomol. 84: 866-874.
PORTER, S. D., VAN DER MEER, R. K., PESQUERO, M. A.,
CAMPIOLO, S., AND FOWLER, H. G. 1995. Solenopsis
(Hymenoptera: Formicidae) fire ant reactions to at-
tacks of Pseudacteon flies (Diptera: Phoridae) in
southeastern Brazil. Ann. Entomol. Soc. America 88:
570-575.
SOKOLOVA, Y. Y., AND FUXA, J. R. 2008. Biology and life-
cycle of the microsporidium Kneallhazia solenopsae
Knell, Allen, and Hazard 1977 gen. n., comb. N.,
from the fire ant Solenopsis invicta. Parasitol. 135:
903-929.
TSCHINKEL, W. R. 1988. Distribution of the fire ants So-
lenopsis invicta and S. geminata (Hymenoptera: For-
micidae) in northern Florida in relation to habitat
and disturbance. Ann. Entomol. Soc. America 81: 76-
81.
TSCHINKEL, W. R. 2006. The Fire Ants. Cambridge,
Mass: The Belknap Press of Harvard University
Press; 723 pp.
VAN DER MEER, R. K., PEREIRA, R. M., PORTER, S. D.,
VALLES, S. M., AND OI, D. H. 2007. Area-wide sup-
pression of invasive fire ant Solenopsis spp. popula-
tions. pp. 487-496 In M. J. B. Vreysen, A. S. Robin-
son, and J. Hendrichs [eds.], 2007. Area-wide
Control of Insect Pests: From Research to Field Im-
plementation. Springer SBM, Dordrecht, Nether-
lands. 789 pp.
VARGO, E. L., AND PORTER, S. D. 1989. Colony reproduc-
tion by budding in the polygyne form of Solenopsis
invicta (Hymenoptera: Formicidae). Behav. Ecol. So-
ciobiol. 19: 41-47.
VALLEYS, S. M., OI, D. H., PEREIRA, O. P., AND WILLIAMS,
D. F. 2002. Detection of Thelohania solenopsae (Mi-
crosporidia: Thelohaniidae) in Solenopsis invicta
88 Florida Ento
(Hymenoptera: Formicidae) by multiplex PCR. J. In-
vert. Pathol. 81: 196-201.
VALLES, S. M., AND PORTER, S. D. 2003. Identification of
polygyne and monogyne fire ant colonies (Solenopsis
invicta) by multiplex PCR of Gp-9 alleles. Insectes
Soc. 50: 199-200.
VALLEYS, S. M., STRONG, C. A., AND HASHIMOTO, Y. 2007.
A new positive-strand RNA virus with unique ge-
nome characteristics from the red imported fire ant,
Solenopsis invicta. Virology 365: 457-463.
1T
ologist 93(1) March 2010
VALLEYS, S. M., OI, D. H., AND PORTER S. D. 2009.
Kneallhazia (=Thelohania) solenopsae infection rate
of Pseudacteon curvatus flies determined by multi-
plex PCR. Florida. Entomol. 92:344-349.
WILLIAMS, D. F., COLLINS, H. L., AND OI, D. H. 2001.
The Red Imported Fire Ant (Hymenoptera: Formi-
cidae): An Historical Perspective of Treatment Pro-
grams and the Development of Chemical Baits for
Control. American Entomol. 47: 146-149.
Koptur et al.: Ants and Plants on Andros, Bahamas
ANTS AND PLANTS WITH EXTRAFLORAL NECTARIES
IN FIRE SUCCESSIONAL HABITATS ON ANDROS (BAHAMAS)
SUZANNE KOPTUR, PASCALE WILLIAM AND ZURIANY OLIVE
Department of Biological Sciences, Florida International University, Miami, FL 33199
E-mail: kopturs@fiu.edu
ABSTRACT
Honey baits were used to assess the activity and abundance of nectar-drinking ants in fire
successional habitats of rocklands on Andros Island, Bahamas. Vegetation was sampled in
pineyard and coppice habitats (the same communities as Florida's pine rocklands and ham-
mocks), revealing a larger proportion of taxa with extrafloral nectaries in coppice samples,
but roughly equivalent cover of plants with extrafloral nectaries in pineyard and coppice
vegetation. Ant activity was greater in pineyard than in coppice habitats, with time to dis-
covery of baits the shortest in open and recently burned pineyards, and most of the baits ex-
periencing recruitment of ants. Overgrown pineyards and coppices both had longer time-to-
discovery and much less recruitment to baits; coppice edges, more variable, were not signif-
icantly different from either of the 2 other habitat groups. Our preliminary study revealed
some new records of plant genera and species with extrafloral nectaries, but all ants we ob-
served at nectaries and on baits are also known from pine rocklands and hardwood ham-
mocks of south Florida.
Key Words: extrafloral nectaries, ant-plant interactions, ants, Bahamas, Caribbean, fire,
mutualism, rocklands
RESUME
Se utilizaron cebos con miel para determinar la actividad y abundancia de hormigas nec-
tarivoras en habitats sucesionales que sufrieron incendios en suelos rocosos (malpais) de
la Isla Andros, en Bahamas. La vegetaci6n fue muestreada en pinares y habitats de cop-
pice (lo mismo comunidades que los pinare rocosos y hammocks de Florida), revelando un
numero mayor de taxa de plants con nectarios extraflorales en las muestras de coppice,
y casi igual cobertura de plants con nectarios extraflorales en la vegetaci6n de pinar. Asi-
mismo, la actividad de las hormigas fue mayor en el pinar que en el coppice, siendo las zo-
nas abiertas y recientemente incendiadas del pinar las que presentaron los menores
tiempos de descubrimiento de los cebos por las hormigas y la mayoria de los cebos experi-
mentaron reclutamiento de hormigas en estos sitios. Los pinares mas altos (con dano me-
nos reciente por fuego) presentaron tiempos mayores en el descubrimiento de los cebos por
las hormigas y much menor reclutamiento; los bordes de los coppice, fueron mas variables
y no resultaron significativamente diferentes de ninguno de los otros grupos de habitats.
Nuestro studio preliminary revel6 muchos nuevos registros de g6neros y species con nec-
tarios extraflorales, pero todas las hormigas que nosotros observamos en los nectarios y en
los cebos son tambi6n species conocidas de los pinares rocosos y los hardwood hammocks
del sur de Florida.
Translation provided by the authors.
Extrafloral nectaries are plant glands occur-
ring in nearly one-third of terrestrial plant taxa
(Koptur 1992a; Rogers 1985), a useful food re-
source with ants, and often associated with
these and other beneficial insects (Rogers 1985;
Nuessley et al. 2004; Koptur 2005). Plants with
extrafloral nectaries have served as model sys-
tems for many investigations of plant/animal
interactions (Bronstein 1998; Heil & McKey
2003; Rico-Gray & Oliveira 2007) and tests of
ecological theory (Holland et al. 2009). Ant
abundance limits the range of plants with ex-
trafloral nectaries in some ecosystems (Goitia &
Jaffee 2009), but whether plants benefit or not
from ant protection via their extrafloral necta-
ries may depend on whether the plant is in the
sun or in the shade (Kersch & Fonseca 2005), or
whether ant-tended herbivores are also present
(Koptur & Lawton 1988; Suzuki et al. 2004; Ol-
iver et al. 2007). Sometimes aggressive body-
guards attracted to extrafloral nectaries can in-
terfere with pollinator activity (Ness 2006), and
in other plants, while nectaries and ants visit-
ing them may change the insect community on
the plant, herbivory experienced by the plant
may be unaffected (Mody & Linsenmair 2004).
Florida Entomologist 93(1)
Plants bearing extrafloral nectaries are more
common in tropical than temperate areas; plants
with extrafloral nectaries (EFNS) double every 10
degrees latitude when moving from the tundra to
the subtropics (Pemberton 1998), and are of inter-
mediate occurrence in the subtropics (Koptur
1992b). Many studies have been undertaken
around the world to determine which species have
extrafloral nectaries and what proportion of the
flora, and extent of vegetation cover, has nectaries
(Pemberton 1998; Diaz-Castelazo et al. 2004; O1-
iveira & Freitas 2004). These surveys have often
led to more detailed morphological and anatomi-
cal work examining the position and structure of
the nectaries (Diaz-Castelazo et al. 2005;
Machado et al. 2008) as well as inspired ecological
experimentation on their significance and role in
particular plants (Sousa e Paiva et al. 2001;
Cuautle & Rico-Gray 2003; and many others). Ex-
trafloral nectaries and ant-guards can respond to
the environment: their presence can vary among
leaves of the same individual, as well as differ
among individuals (as in aspen, Doak et al. 2007;
Wooley et al. 2007; or peach, Mathews et al. 2009).
Furthermore, many recent studies have shown
that nectar production can be inducible, as well as
the number and size of nectaries on individual
plants influenced by damage the plant experi-
ences (Heil 2008), the soil in which the plant
grows (Abdala-Roberts & Marquis 2007), and the
nutrient status of the plant (Mondor et al. 2006).
More nectar leads to greater protection and less
herbivory (Kost & Heil 2005).
This study is a contribution to the ongoing
world survey of diversity and abundance of plants
with extrafloral nectaries, the ants with which
they are associated, as well as an assessment of
their importance in different habitats of the Ba-
hamas. The Bahamas archipelago lies east of pen-
insular Florida, and shares some geological and
climatic features with southern Florida. While
ants of the Bahamas have been studied by few in-
vestigators (Morrison 2002), and the islands'
plants are fairly well known (Correll & Correll
1982; Morrison 2003; Morrison & Spiller 2008),
there have not yet, to our knowledge, been any
systematic surveys of plants with extrafloral nec-
taries in the Bahamas. In a study of plants with
extrafloral nectaries and ant activity in upland
habitats of the Everglades (Koptur 1992b), the
potentially protective interaction was found to be
more common in plants of fire-successional pine
rocklands than in hardwood hammock or short-
hydroperiod glade habitats. In the Bahamas we
find similar habitats bearing different names:
pine rocklands are called 'pineyard', and ham-
mock is'coppice'.
Andros is the largest island of the Bahamas ar-
chipelago, which has the greatest cover of pine
forest of any of the islands. All of the islands were
logged in the early-mid twentieth century, with
most of the large diameter pines removed by the
1950s (Henry 1974; Allan 1986), as the modest-di-
ameter trunks of the present-day forest will at-
test. While wildfires may start via lightning, espe-
cially at the beginning of the wet season (Snyder
et al. 1990), it is very likely that much of the fire
during most of the year is anthropogenic in origin,
and Bahamian pine forests have a frequent sur-
face fire regime (O'Brien et al. 2006). Burning
brings tender vegetation as the plants resprout,
and such areas are desirable for grazing and for-
aging by wildlife, which may, in turn, be hunted
for food. The relationship between fire and pine-
yard vegetation is relatively clear, as in analogous
pine rocklands of southern Florida, where sup-
pression of fire results in forest succession to
broad-leaved, hammock vegetation in only 25
years (Robertson 1955; Loope et al. 1994); how-
ever, the impact of fire on pineyard insects is not
well known.
The objectives of this study were to assess the
abundance and activity of nectar-drinking ants
that might be associated with plant nectaries,
and to systematically observe the plants of differ-
ent vegetation types to discover which species
bear extrafloral nectaries. We measured ant activ-
ity in fire successional habitats of Andros, and
sampled vegetation to compare the species rich-
ness and cover of plants with extrafloral nectaries
in these habitats. Our goal was to see how ants
and plants with extrafloral nectaries vary among
fire successional pineyard and climax coppice
habitats on limestone substrates on Andros.
MATERIALS AND METHODS
Study Sites
We chose representative pineyard and coppice
sites on the island of Andros, the largest of the 35
inhabited islands in the Bahamas archipelago
(Smith & Vankat 1992). The pine rockland (pine-
yard) habitats occur on 3 of the other islands of
the Bahamas: Grand Bahama, Abaco, New Prov-
idence, and also on the Caicos Islands (Correll &
Correll 1982). Andros is 45 km wide and 165 km
long, and divided by shallow channels into 3
main sections; our work was conducted on North
Andros. Andros has the greatest expanse of pine
forests, and though all were logged throughout
the Bahamas in the middle of the twentieth cen-
tury, they have been left mostly intact, in con-
trast to the pine rocklands of southern Florida
which are now greatly reduced in size due to de-
velopment. "Open pineyard" and coppicee edge"
transects were sampled on the road to Church's
blue hole; overgrown pineyard was studied on
Love Hill, as was burned pineyard (burned
within the previous week, some parts still smok-
ing); and coppice transects were done in Forfar
coppice.
March 2010
Koptur et al.: Ants and Plants on Andros, Bahamas
Similar to southern Florida, the substrate of
Andros is oolitic limestone, with poorly developed
soil (Sealey 1985). Karstic weathering in rock-
lands produces pitted or honeycombed rock sur-
faces, along with solution holes or sinkholes that
may extend down to the freshwater lens below
(Smith & Vankat 1992). Andros is 210 km east
southeast of Miami, and its annual rainfall (1300
mm) is similar, though slightly less, to that of Mi-
ami (1340 mm). The dry evergreen forest commu-
nities coppicess) on Andros are more similar to
hardwood hammocks of south Florida (with more
than one-third of species in common), and to the
northern and central islands of the Bahamas,
than to the drier, southern islands.
Ants
Ant activity has frequently been assessed by
discovery of and recruitment to baits placed in
transects in the habitat. Baiting uses food to at-
tract foraging ants to spots where they may be ob-
served and collected (Bestelmeyer et al. 2000),
and is an indication of ant abundance and espe-
cially, the willingness of ants to take advantage of
foods, in a given habitat. We placed 20 honey baits
on small white cards (2 cm x 2 cm) on the surface
of the ground at intervals of approximately 1.5 m
in 1 or 2 linear transects at each site. Honey is
similar to nectar in composition, and therefore we
expected to measure the activity of nectar-drink-
ing ants, as has been done in earlier studies (Ko-
ptur 1985; Koptur & Lawton 1988; Koptur
1992b).
We monitored the baits for 1 h, checking them
at 5-min intervals, and recording the presence of
ants and other arthropods. We counted the num-
ber of each type of ant present (more than 10 in-
dividuals of 1 species were recorded as "many") at
each interval for each bait. If any ant found the
bait, it was designated "discovered"; if more than
5 individuals of the same species were observed at
a bait, that bait was designated as experiencing
"recruitment". We collected specimens of each
type at the end of the hour, and tallied the mean
time-to-discovery for each bait, as well as the pro-
portion of baits discovered, and the proportion to
which there had been recruitment, for each habi-
tat.
We employed univariate analysis of variance
(ANOVA) to compare time to discovery among
sites (habitats, their ecotone, and different times
since fire for pineyards). We therefore had 4 de-
grees of freedom (5 habitat types minus 1). Be-
cause group sizes were unequal, the harmonic
mean of the sample size for each group was used.
We used post-hoc Tukey HSD and Dunnett C
tests to detect significant differences among hab-
itats (SPSS 2002).
The number of baits discovered in each
transect/habitat were compared with the Pearson
chi-square test df = 4 (5 habitats). Recruitment
data (many zero values) were arcsine trans-
formed prior to analysis.
Plants
In each of the 2 main habitat types (pineyard
and coppice) we assessed plant species richness
along linear transects. Transects of 40 m were
laid out (3 in each habitat), and vegetation (an in-
dividual plant or plants) intercepted by the
transect was recorded for 1 m every 5 m along the
transect. We examined the plants carefully to de-
tect the presence of extrafloral nectaries on all
surfaces of leaves, stems, and reproductive parts,
utilizing hand lenses and dissecting microscopes
to determine if these structures were present. We
utilized previous knowledge of families and gen-
era to guide our inspections, and in genera and
species with which we had no previous experi-
ence, we were especially observant, though we
may have missed some nectaries with our 1-sea-
son sample if the plants were not in the right de-
velopmental stage. Additionally, some nectaries
are merely pores with no discernible structure
and we may have missed those if they were not ac-
tively secreting nectar. We collected vouchers of
species we could not determine in the field, and
were able to determine most of them later using
keys and descriptions in floras (Correll & Correll
1982; Patterson & Stevenson 1977).
We compared the proportion of individuals en-
countered with nectaries, and the proportion of
species with nectaries, for each transect. For 2 of
the samples, only the total number of species and
species with nectaries were recorded (numbers of
individuals not recorded). The data in the table
therefore represent only 2 transects per habitat
for individual counts.
RESULTS
We found 9 species (in 6 genera) of ants visiting
extrafloral nectaries and/or honey baits in pine-
yards and coppices on Andros (Table 1). All of
these ant species occur in south Florida (Deyrup
2003; Deyrup et al. 1988), but none of them occurs
in either Georgia (Ipser et al. 2004) or in longleaf
pine savannahs of Louisiana (Colby & Prowell
2006). Several of the species (Monomorium ebeni-
num, Paratrechina spp., Wasmannia auropunc-
tata) are exotics that occur throughout the tropics
and are considered "tramp species" (Wetterer et
al. 1999; Solomon & Mikheyev 2005).
Baits were discovered more quickly in open
and recently burned pineyards than in coppices or
overgrown pineyards (Fig. 1); coppice edges (the
ecotone with pineyards) were not substantially
different from either of the other groups. Only in
recently burned pineyards were all baits (every
single one) discovered within the hour baiting pe-
Florida Entomologist 93(1)
TABLE 1. BAHAMAS ANTS AND LOCATIONS ENCOUNTERED-
TIONS CONFIRMED BY MARK DEYRUP.
-ANDROS ISLAND MARCH 2004. ALL SPECIES DETERMINA-
Species Pineyard Coppice Baits Plants
Brachymyrmex obscurior X X X
Camponotus sp.* X X
Cyphomyrmex minutus X X X
Monomorium ebeninum X X X X
Paratrechina bourbonica X X X
Paratrechina longicornis X X X
Pseudomyrmex cubaensis X X X
Pseudomyrmex sp.* X X
Wasmannia auropunctata X X X X
*not possible to determine as material was insufficient.
riod; the majority of baits in open pineyard and
coppice edge were also discovered within the hour.
All baits being discovered within the hour is not
unusual in tropical lowland sites (Koptur 1985),
but the mean time to discovery of 10 min for
burned pineyard was notably rapid. Substantially
fewer baits were discovered in coppice and over-
grown pineyards (Table 2). All baits placed in re-
cently burned pineyard recruited ants, while
roughly half the baits in open pineyard and cop-
pice edge habitats did so. Recruitment is of inter-
est, because more ants may provide more protec-
tion, beneficial to plants presenting nectar. In
overgrown pineyard and coppice habitats, only
one-tenth of the baits successfully recruited ants
60- b
a 50-
S10
UV0 0 J
211.
habitat
Fig. 1. Mean time to discovery of honey baits in An-
dros forest habitats. Greater time to discovery indicates
lower ant activity. Univariate ANOVA F (4,1) = 14.888
P < 0.0001. Different letters represent significantly dif-
ferent times to discovery with post-hoc test (P < .05);
bars with the same letters are not significantly different
from each other.
(Table 2). Flies were not observed at baits at the
site with the highest ant recruitment (recently
burned pineyard, with 100% discovery and 100%
recruitment), but all other sites had 10-20% of the
baits with fly visitors. The flies were not collected,
and so are not determined here; some nectar-
drinking flies may be beneficial to plants with ex-
trafloral nectaries, as predators or parasitoids.
Of the 83 species of plants encountered in
transects in both habitats (pineyard and coppice),
we found 23 species with extrafloral nectaries
(28% of all species encountered). Pineyards, the
fire successional, more open habitat, had a
greater total number of species than did coppices
(52 vs. 39 spp., in our samples), but a smaller pro-
portion of these species bear extrafloral nectaries
(13 species, or 25% for pineyard, vs. 12 species, or
31% for coppice, Table 3). Taking into account the
number of individuals encountered in our sam-
ples, however, gives a closer percentage occur-
rence of plants (roughly, cover of plants) with ex-
trafloral nectaries. Pineyards, with 18% of indi-
viduals bearing nectaries, have roughly the same
proportion of individuals with nectaries, versus
20% cover of plants with nectaries in coppices.
Twelve families of plants (11 angiosperms, and
1 fern) are represented in our sampling by indi-
viduals bearing extrafloral nectaries (Table 4).
None of the family occurrences are novel, but the
presence ofextrafloral nectaries has not been pre-
viously noted in the genus Sachsia (Asteraceae),
or in the genus Petitia (Verbenaceae). Many of the
other species, in genera known to have extrafloral
nectary bearing species, are new species occur-
rences, not surprising as this is a new area for a
survey of nectary occurrence (Table 4).
DISCUSSION
Rocklands may seem less hospitable to ants
than habitats with sandy soil substrates, where
ants can more easily excavate to construct their
nests, but rocklands have soil pockets and many
fissures in which ants can nest, as well as at the
March 2010
Koptur et al.: Ants and Plants on Andros, Bahamas
TABLE 2. SUMMARY OF ANTS AT HONEY BAITS ON ANDROS ISLAND. PERCENTAGE OF 20 BAITS MONITORED FOR 1 H EX-
PERIENCING DISCOVERY BY ANTS, RECRUITMENT BY ANTS, AND PRESENCE OF FLIES. THE BURNED PINEYARD
SITE HAD BEEN BURNED WITHIN THE PREVIOUS WEEK.
Burned Open Overgrown Coppice
pineyard Pineyard pineyard edge coppice
Discovery (% baits discovered) 100% 90% 20% 90% 50%
Recruitment (% baits with recruitment) 100% 48% 10% 54% 10%
% with flies 0% 22% 10% 18% 10%
TABLE 3. OCCURRENCE OF PLANT SPECIES AND INDIVIDUALS WITH EXTRAFLORAL NECTARIES IN THE 2 MAIN HABITATS
ON ANDROS, BAHAMAS. DATA FROM ALL TRANSECTS WERE COMBINED FOR EACH HABITAT.
# Spp. % Species with # Individuals % Individuals with
encountered in extrafloral nectaries encountered in extrafloral nectaries
Habitat sampling (# species) sampling (# individuals)
Pineyard 52 25% (13) 256 18% (46)
Coppice 39 31% (12) 177 20% (35)
bases of trees and in trunks and branches of
woody vegetation. Fire is so frequent in pineyards
of Andros that they are recurrently disturbed,
never having the chance for succession to proceed
to coppice vegetation. The cover of plants with ex-
trafloral nectaries was similar in pineyards and
coppices, though the actual proportion of species
with nectaries recorded in pineyards was lower
than in coppices. We measured greater ant activ-
ity in pineyard than in coppice habitat, and great-
est by far in recently burned pineyard habitat.
These observations concur with those made in
south Florida pine rocklands and hammocks (Ko-
ptur 1992b) as well as those in Mexican coffee
plantations and cloud forests, where the structure
of shade vegetation affects ant species richness,
diversity, and abundance: richness and diversity
increased with more complex arboreal structure,
but abundance decreased (Valenzuela-Gonzalez
et al. 2008). We observed the same trends in spe-
cies richness, and the lower proportions of baits
discovered and experiencing recruitment in over-
grown pineyard and coppice habitats provides
support for the decreased abundance of ants in
vegetation with more complex structure. At sea-
level in Jamaica, 28% of plants had extrafloral
nectaries (Keeler 1979), comparable to our results
for these sea-level Bahamian rockland habitats.
Because we used only ground baiting with
honey, and not other methods of ant collection
(Bestelmeyer et al. 2000), we do not have a com-
plete picture of ant occurrence in these habitats.
We may have missed ant species that move from
plant to plant without walking on the ground, or
those that do not consume nectar, for example.
The wider the variety of sampling methods used,
the greater the number of species; King & Porter
(2005) found that combinations of sampling meth-
ods were much more effective for assessing spe-
cies richness than any single method.
Our observations on very recently burned pine-
yards provided us with some surprising results.
With virtually no plant cover of any kind in burned
pineyard, the ants were hungry, and quickly dis-
covered, and then recruited to honey baits. The
ground-nesting Cuban parrots on Abaco were not
adversely affected by pineyard fires (O'Brien et al.
2006). Lower fuel loads from frequent fires may
keep fire intensity low enough to not endanger
nestlings, and parrot pairs choose new nesting
sites in recently burned areas. Ant nests may be
even deeper than parrot nests, so ant populations
that nest below ground may not be harmed by fires.
Ant species that nest in trees or near the soil sur-
face are more likely to be reduced by fire. Fire can
increase species diversity of plants and some in-
sects (O'Dowd & Gill 1984), but Sanders (2004)
found that exotic argentine ant numbers were re-
duced by 75% following fires in northern Califor-
nia. Ants may be used to monitor environmental
change (Kaspari & Majer 2000) but responses to
fire will differ for different ant species, influenced
especially by where they nest. Several studies have
come to different conclusions, but all concur that
effects of fire are habitat-dependent (Farji-Brener
et al. 2002; Hoffman 2003; Parr et al. 2004; Ratch-
ford et al. 2005). Studies on savannas in Africa
(Parr et al. 2002) and Australia (Hoffmann 2003)
showed unburned areas to have the lowest species
richness and abundance of ants. Our study is in
agreement with these general findings, as were
data in a similar study in south Florida (Koptur
1992b), where the successional fire habitats (pine-
yards and pine rocklands) have greater abundance
of plants with extrafloral nectaries, and nectar-
drinking ants as well.
TABLE 4. PLANT SPECIES WITH EXTRAFLORAL NECTARIES ENCOUNTERED IN SAMPLING PINEYARD AND COPPICE HABITATS ON ANDROS ISLAND, BAHAMAS.
FAMILY Latin name, authority common name Nectary position
Asteraceae
Sachsia polycephala Griseb.* foliar, phyllaries
Bromeliaceae
Tillandsia balbisiana J. A. & J. H. Schult.
Tillandsia recurvata L.
Cuttlefish
thread-leaved wild pine
Chrysobalanaceae
Chrysobalanus icaco L. Cocoplum
Euphorbiaceae
Chamaesyce (Euphorbia) blodgettii Engelm. Ex Hitchc.
Croton linearis Jacq.*
Euphorbia heterophylla L.
Grimmeodendron eglandulosum (A. Rich.) Urb.*
Hippomane mancinella L.
Fabaceae
Acacia choriophylla Benth.*
Calliandra haematomma (Bert.) Benth.*
Cassia nictitans L. var. aspera (Ell.) T. & G.
Lysiloma sabicu Benth.*
Pithecellobium hystrix (A. Rich.) Benth.*
Vigna luteola (Jacq.) Benth.
granny-bush
Jacob's ladder, Governor Grant's Livery
young manchineel
Manchineel
Cinnacord
red calliandra
winking cassia
Horseflesh
bristly cat's-claw
yellow vigna
Inflorescence-along peduncle and pedicels
Inflorescence-as above
Foliar-abaxial surface near leaf base
Inflorescence, in cyathium
Paired on leaf bases, abaxial surface
inflorescence
leaf base
petiolar
On rachis between leaflets
foliar
petiolar
On rachis
On rachis
Inflorescence-abortive floral buds
Malpighiaceae
Stigmaphyllon sagraeanum A. Juss.
Passifloraceae
Passiflora suberosa L. corky-stem passionflower, juniper-berry
Polypodiaceae
Pteridium aquilinum (L.) Kuhn var. caudatum (L.) Sadebeck
Rosaceae
Prunus myrtifolia (L.) Urb.
southern bracken
Foliar-where frond becomes ternate and along midrib
West Indian Laurel-cherry
Leaf bases
Rubiaceae
Morinda royoc L. wild mulberry, rhubarb, mouse's pineapple
Postfloral-on ovary after corolla falls off
*Indicates new record of extrafloral nectaries in the species or genus.
foliar
petiolar
Koptur et al.: Ants and Plants on Andros, Bahamas
Five species of Euphorbiaceae and 6 species of
Fabaceae occurred in the habitats studied, and
have extrafloral nectaries; both are families in
which the occurrence, form, and function of necta-
ries have been well documented (Keeler 2008).
Grimmeodendron may be a new genus record of
extrafloral nectaries for the Euphorbiaceae, and
this genus has foliar nectaries on the leaf blade
base, similar to those occurring in species of Al-
SI chornea (Fiala & Linsenmair 1995), and some
Croton species (Fiala & Maschwitz 1981). In the
genus Croton, C. linearis is a new species in this
S:- genus in which foliar nectaries are well known.
a Nectaries of C'i.(./..... .... in which nectaries oc-
S d cur in the inflorescence, as in Euphorbia (So 2004)
and Poinsettia, but are morphologically extraflo-
ral (the cyathium being comprised of individual
flowers of gynoecium or androecium only) might
function in pollination as well as potential anti-
o herbivore defense, depending on the ecological
context.
In the Fabaceae, cinnacord (Acacia chorio-
q phylla, a rare endemic in the Florida Keys) has
the inter-leaflet foliar nectaries characteristic of
z many mimosoid legumes, and is a new species
0 record for this genus, in which many ant-plant in-
teractions have been studied, ranging from obli-
gate (Janzen 1966, 1967) to facultative (Whitney
2004). Some ant acacias native to Central Amer-
ica have different, local ant inhabitats when they
Sgrow in Florida (Wetterer & Wetterer 2003). Cal-
C d liandra haematomma and Lysiloma sabicu have
o o the same type of extrafloral nectaries, probably
3 active on the developing leaves during the time
S 8 they are the most vulnerable to herbivory; these
S^ nectaries may support the same kinds of ant pro-
tectors that are present on Inga species (Koptur
1984, 1994; Wickers 1997; Pascal et al. 2000), that
_ gdo not live in the plant but visit constantly for
nectar and deter herbivores on the leaves. These
a other legume species reported from Andros are all
2 additions to the world list (Keeler 2008), the most
SS striking being the spiny, tiny-leaved, large-flow-
ered Pithecellobium hystrix, with one nectary on
each of its small, twice-compound leaves. The nec-
taries in the inflorescence of Vigna luteola (also
r occurring in south Florida) are actually abortive
m %d flower buds (Kuo & Pate 1985; Pate et al. 1985;
Mizell 2004), and support a round-the-clock ant
guard that may protect the flowers and fruits
H from predators (S. Koptur, personal observa-
tions).
Many of the other species bearing extrafloral
S nectaries occur also in south Florida, where very
Si similar rockland habitats occur. Passiflora sube-
H rosa, Prunus myrtifolia, Pteridium aquilinum,
S. Morinda royoc, and Simarouba glauca are all na-
tive to Everglades habitats. Passiflora leaves and
S3 petioles bear extrafloral nectaries that are well
known for their support of ant bodyguards and
S* other mutualists that benefit the plants (Smiley
1985; Apple & Feener 2001). Prunus nectaries at-
tract ants and also parasitoids that can control
herbivores and benefit the plants, increasing
their fruit production (Tilman 1978; Pemberton
1990; Pemberton & Lee 1996). Pteridium is wide-
spread, and is the single most studied fern with
nectaries; in some cases, it appears that ants do
not protect the plants though nectaries are func-
tioning to attract the ants (Tempel 1983; Rash-
brook et al. 1993); in others, they do (Heads 1986).
The nectaries of these ferns may primarily func-
tion to deter colonization by new herbivores
(Heads & Lawton 1984). Morinda has postfloral
nectaries (Keeler 1985; Koptur 1992b) that may
promote protection of developing fruit as in some
Loasaceae (Keeler 1981).
The extrafloral nectaries of Sachsia may func-
tion as those of other Asteraceae, to attract and
maintain ant-guards to deter pre-dispersal seed
predators (e.g., Helianthella quinqueneruia, In-
ouye & Taylor 1979; Helichrysum spp., O'Dowd &
Catchpole 1983; Melanthera aspera, Mexzon &
Chinchilla 1999). This genus occurs in south Flor-
ida, Cuba, and the Bahamas (Liu et al. 2004) and
merits closer examination.
Petitia, as many other Verbenaceae (species of
Citharexylum, Petrea, and Sr.... 7., p.1:.r., 1.y bears
its extrafloral nectaries on its lower leaf surface
(Diaz-Castelazo et al. 2004). To our knowledge,
there are not yet any ecological studies on mem-
bers of this family.
Further observations throughout the year and
in more habitats and on more of the islands of the
Bahamas will perhaps reveal additional species
with nectaries, and very likely more species of
ants visiting nectaries and associated with these
plants. There may be lower diversity in plants
with extrafloral nectaries and ants due to island
effects; it will be interesting to make comparisons
among islands in the Bahamas and other loca-
tions in the Greater and Lesser Antilles. Obvi-
ously, antiherbivore defense and other beneficial
interactions may well be supported by extrafloral
nectaries on plants in Bahamas rockland habi-
tats, and we predict that they will be more impor-
tant in pineyards than in coppices.
ACKNOWLEDGMENTS
We thank faculty and students in the FIU Caribbean
biodiversity course for help with gathering the initial data
(especially Javier Francisco-Ortega, Jennifer Richards,
Phil Gonsiska, John Geiger), Mark Deyrup (Archbold Bio-
logical Station) for determining ant specimens, Cecilia
Diaz-Castelazo for Spanish translation, and the Forfar
field station for logistical help. Laurel Collins and Javier
Francisco Ortega made our trip possible with the National
Science Foundation UMEB program support. Construc-
tive comments on the manuscript were made by Cecilia
Diaz-Castelazo, Bob Pemberton, and 2 anonymous review-
ers. This is contribution number 178 to the Florida Inter-
national University Program in Tropical Biology.
March 2010
REFERENCES CITED
ABDALA-ROBERTS, L., AND MARQUIS, R. J. 2007. Test of
local adaptation to biotic interactions and soil abiotic
conditions in the ant-tended Chamaecrista fascicu-
lata (Fabaceae). Oecologia 154: 315-326.
ALLAN, T. G. 1986. Management plan for the pine for-
ests of the Bahamas. UTF/BHA/003/BHA Consul-
tancy Report No. 2. Food and Agriculture Organiza-
tion of the United Nations.
APPLE, J. L., AND FEENER, JR., D. 2001.Ant visitation of
extrafloral nectaries in Passiflora: the effects of
nectary attributes and ant behavior on patterns in
facultative ant plant mutualisms Oecologia 2001:
409-416.
BESTELMEYER, B. T., AGOSTI, D., ALONSO, L. E., BRAN-
DAO, C. R. F., BROWN, JR., W. L., DELABIE, J. H. C.,
AND SILVESTRE, R. 2000. Field techniques for the
study of ground-dwelling ants, pp. 122-144 In D. Ag-
osti, J. D. Majer, L. E. Alonso, and T. R. Schultz
[eds.], Ants: Standard Methods for Measuring and
Monitoring Biodiversity. Smithsonian Institution
Press, Washington.
BRONSTEIN, J. L. 1998. The contribution of ant plant
protection studies to our understanding of mutual-
ism. Biotropica 30: 150-161.
COLBY, D., AND PROWELL, D. 2006. Ants (Hymenoptera:
Formicidae) in wet longleaf pine savannas in Louisi-
ana. Florida Entomol. 89: 266-269.
CORRELL, D. S., AND CORRELL, H. B. 1982. Flora of the
Bahama archipelago: including the Turks and Ca-
icos Islands. Vaduz: J. Cramer.
CUAUTLE, M., AND RICO-GRAY, V. 2003. The effect of
wasps and ants on the reproductive success of the
extrafloral nectaried plant Turnera ulmifolia (Turn-
eraceae). Funct. Ecol. 17: 417-423.
DEYRUP, M. 2003. An updated list of Florida ants (Hy-
menoptera: Formicidae). Florida Entomol. 86: 43-48.
DEYRUP, M., CARLIN, N., TRAGER, J., AND UMPHREY, G.
1988. A Review of the Ants of the Florida Keys. Flor-
ida Entomol. 71: 163-176.
DIAZ-CASTELAZO, C., RICO-GRAY, V., OLIVEIRA, P. S.,
AND CUAUTLE, M. 2004. Extrafloral nectary-mediat-
ed ant-plant interactions in the coastal vegetation of
Veracruz, Mexico: Richness, occurrence, seasonality,
and ant foraging patterns. Ecoscience 11: 472-481.
DIAZ-CASTELAZO, C., RICO-GRAY, V., ORTEGA, F., AND
ANGELES, G. 2005. Morphological and secretary
characterization of extrafloral nectaries in plants of
coastal Veracruz, Mexico. Ann. Bot., London 96:
1175-1189.
DOAK, P., WAGNER, D, AND WATSON, A. 2007. Variable
extrafloral nectary expression and its consequences
in quaking aspen. Canadian J. Botany 85: 1-9.
FARJI-BRENER, A., CORLEY, J. C., AND BETTINELLI, J.
2002. The effects of fire on ant communities in north-
western Patagonia: the importance of habitat struc-
ture and regional context. Divers. Distrib. 8: 235-
243.
FIALA, B., AND LINSENMAIR, K. E. 1995. Distribution
and abundance of plants with extrafloral nectaries
in the woody flora of a lowland primary forest in Ma-
laysia. Biodivers. Conserv. 4: 165-182.
FIALA, B., AND MASCHWITZ, U. 1991. Extrafloral necta-
ries in the genus Macaranga (Euphorbiaceae) in Ma-
laysia: comparative studies of their possible signifi-
cance as predispositions for myrmecophytes. Biol. J.
Linn. Soc. 44: 287-305.
Florida Entomologist 93(1)
|