Title: Florida Entomologist
ALL VOLUMES CITATION DOWNLOADS THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00098813/00023
 Material Information
Title: Florida Entomologist
Physical Description: Serial
Creator: Florida Entomological Society
Publisher: Florida Entomological Society
Place of Publication: Winter Haven, Fla.
Publication Date: 2003
Copyright Date: 1917
 Subjects
Subject: Florida Entomological Society
Entomology -- Periodicals
Insects -- Florida
Insects -- Florida -- Periodicals
Insects -- Periodicals
 Notes
General Note: Eigenfactor: Florida Entomologist: http://www.bioone.org/doi/full/10.1653/024.092.0401
 Record Information
Bibliographic ID: UF00098813
Volume ID: VID00023
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: Open Access

Downloads
Full Text



Joseph-J.B. et al.: Irradiation of Spider Mite Eggs


USE OF RADIATION TO STERILIZE TWO-SPOTTED SPIDER MITE
(ACARI: TETRANYCHIDAE) EGGS USED AS A FOOD SOURCE
FOR PREDATORY MITES

SYLVIA JOSEPH-JNO. BAPTISTE1, KEN BLOEM2, STUART REITZ3 AND RUSS MIZELL, III4
'Florida A&M University, College of Engineering Sciences, Technology and Agriculture
Center for Biological Control, Tallahassee, FL 32307

2USDA-APHIS-PPQ-CPHST, at Florida A&M University, CESTA, Center for Biological Control
Tallahassee, FL 32307

3USDA-ARS-CMAVE, at Florida A&M University, CESTA, Center for Biological Control, Tallahassee, FL 32307

4University of Florida, North Florida Research and Education Center, Quincy, FL 32351

ABSTRACT

One-, 2- and 3-day-old two-spotted spider mite eggs were treated with increasing doses of
gamma radiation ranging from 0-280 Gy. Percent egg hatch decreased as radiation increased
for each age group; however, older eggs required higher doses of radiation to prevent egg
hatch than did younger eggs. Based on the regression lines for 1-, 2- and 3-day-old eggs, the
best estimates of the doses of radiation that would prevent 100% of the eggs from hatching
were 43.6 Gy, 55.1 Gy and in excess of 280 Gy, respectively. In general, irradiating spider
mite eggs had no significant effect on their acceptability as prey by females of the predatory
mite Neoseiulus californicus McGregor, except for 1-day-old eggs treated at 240 Gy. Female
N. californicus consumed 50-75% fewer of these eggs than they did eggs of other treatments,
in both no-choice and choice experiments.

Key Words: Tetranychus urticae, Neoseiulus californicus, biological control, rearing

RESUME

Huevecillos de Tetranychus urticae de uno, dos y tres dias de edad fueron tratados con dosis
de radiaci6n gamma entire 0 y 280 Gy. En general, el porcentaje de eclosi6n de los huevecillos
tratados disminuy6 proporcionalmente al aumento en la dosis de radiaci6n en huevecillos de
todas edades, sin embargo, los huevecillos de mayor edad requirieron mayores dosis para
prevenir eclosi6n. Basados en las lines de regresi6n obtenidas en estos experiments, las
dosis requeridas para prevenir el 100% de eclosi6n en huevecillos de T urticae son de 43.6
Gy, 55.1 Gy y mas de 280 Gy, para huevecillos de uno, dos y tres dias de edad, respectiva-
mente. En general, la irradiaci6n de huevecillos no tuvo un efecto significativo en cuanto a
su aceptabilidad como alimento para hembras de Neoseiulus californicus McGregor, excep-
tuando en huevecillos de un dia de edad tratados con 240 Gy. Las hembras de N. californicus
consumieron 50-75% menos de este tratamiento, tanto en experiments donde tuvieron
opci6n de escoger, como en experiments donde no tuvieron opci6n de escoger entire various
tratamientos como alimento.


Translation provided by author.


The two-spotted spider mite, Tetranychus urti-
cae Koch (Acari: Tetranychidae), is an extremely
polyphagous pest that has been reported from
more than 900 host species and is described as a
serious pest of at least 30 economically important
agricultural and ornamental plants, including
corn, cotton, cucumber, beans, tomato, eggplant,
peppers and roses (Helle & Sabelis 1985a, b; Na-
vajas 1998). Unfortunately, chemical control of
this pest can be compromised because of resis-
tance (Gould et al. 1982; Croft et al. 1984; Cran-
shaw & Sclar 2001). As a result, a more


integrated approach utilizing biological control
with predatory mites is increasingly being recom-
mended (Hamlen & Lindquist 1981; Osborne et
al. 1985; Grafton-Cardwell et al. 1997; Nicetic et
al. 2001).
Biological control of spider mites has centered
on the use of predatory mites in the family Phy-
toseiidae (Helle & Sabelis 1985a, b; Schausberger
& Croft 1999). Phytoseiulus persimilis Athias-
Henriot is the most studied species and is the pri-
mary species used to control spider mites in
greenhouses (Osborne et al. 1985; UF/IFAS 2002).







Florida Entomologist 86(4)


Another promising predatory mite is Neoseiulus
(=Amblyseius) californicus (Chant) (Castagnoli &
Simoni 1999; Roy et al. 1999). Although less spe-
cialized than P. persimilis, it has been shown to
provide excellent control of spider mites over a
wide range of climatic and management condi-
tions (Oatman et al. 1977; Pickett & Gilstrap
1986; McMurtry & Croft 1997). In the United
States there are five species of predatory mites
that are available commercially and used in
biological control programs: Galendromus
(=Metaseiulus) occidentalis (Nesbitt), Mesoseilu-
lus (=Phytoseiulus) longipes (Evans), N. californi-
cus, N. fallicus (Garman), and P persimilis (UF/
IFAS 2002).
Castagnoli and Simoni (1999) showed that the
long-term feeding history ofN. californicus affects
its functional and numerical responses when ex-
posed to different densities of two-spotted spider
mite eggs and protonymphs. In general, N. cali-
fornicus that were wild collected or routinely
reared on spider mites performed better than
those reared on pollen or dust mites (Dermatopha-
goides spp.). Because of studies such as this, com-
mercial shipments of predatory mites usually
contain spider mite eggs as a food source (Os-
borne et al. 1985; Penn 1999). The eggs are easy to
handle and help insure that the predatory mites
are in good condition when they arrive.
A problem with the use of live host material in
commercial shipments of predatory mites (or
other natural enemies) is the risk of introducing
new pest species or strains, including chemically
resistant strains, along with the natural enemy
(Penn 1999). One solution to this concern that has
been discussed but never tested is the use of radi-
ation to reproductively sterilize host material
prior to shipment.
Although radiation has been used extensively
for many years to sterilize insects used in sterile
insect release programs (IAEA 2000), there is
limited published literature on the radiation biol-
ogy of spider mites. Henneberry (1964) irradiated
two-spotted spider mite adults and examined the
effects on male and female fertility and their
progeny. Feldmann (1975) studied the induction
of heritable sterility factors such as transloca-
tions and inversions in the two-spotted spider
mite at different doses of gamma radiation and
confirmed the holokinetic nature of their chromo-
somes. Nothing is known about the effect of radi-
ation on spider mite eggs.
In an effort to determine the potential for us-
ing irradiated spider mite eggs as a food source
for predatory mites, studies were initiated with
the following objectives: (1) determine the dose of
gamma radiation that would prevent specific age
groups of T urticae eggs from hatching; and (2)
assess the impact of egg age and exposure to
gamma radiation on acceptability as a food source
by the predatory mite, N californicus.


MATERIALS AND METHODS

Experimental Material and Site

Lima bean (Phaseolus lunatus L.) leaves and
two-spotted spider mites were obtained from the
North Florida Research and Education Centers at
Monticello and Quincy, FL. Bean plants were
started from seeds sown in Perlite planting
medium every 2-3 days and kept in a greenhouse
until they reached the four-true leaf stage. They
were then transferred to a humid cement-block
room, where they were infested with spider mites
and kept for 7-10 days before being discarded and
replaced with fresh plants.
Irradiation of spider mite eggs was conducted
at the USDA-ARS Crop Pest Management and
Research Unit in Tifton, Georgia, using a Cobalt60
Gammacell 220 Irradiator with a dose rate of
approximately 20.06 Gy/min.
The experiments were carried out in the
USDA-ARS Laboratory at the Florida A&M Uni-
versity Center for Biological Control, Tallahassee,
FL. All experiments were set-up at ambient room
temperature and relative humidity (approxi-
mately 21-24C and 60-65% RH). Controlled con-
ditions after experimental set-up were
maintained using a Forma Scientific Growth
Chamber@ with a photoperiod of 12:12 (L:D),
temperature of 28 + 1C, and relative humidity of
58%. Under these conditions, normal egg hatch
began four days after oviposition.
Neoseiulus californicus were purchased from
IPM Laboratories of New York, placed in 15 cm
plastic petri dishes with fresh bean leaves, and
fed spider mites ad libitum until needed for tests.

Dose Response

Approximately 25 gravid female two-spotted
spider mites were transferred to freshly excised,
young, bean leaves devoid of spider mites and
other arthropods and allowed to oviposit for 18-24
h. The leaves were prevented from drying out by
placing them on moist filter paper in covered 7.0
cm plastic petri dishes and kept in a growth
chamber as specified above. After 24 h, the petri
dishes containing the bean leaves were placed un-
der a dissecting microscope and all motile stages
of spider mites removed, leaving only newly ovi-
posited (0-24 h old) eggs. The bean leaves were
then cut into pieces containing 25 eggs and each
piece placed separately in the center of a new 7.0
cm petri dish containing moist filter paper.
Petri dishes containing 1-day-old (0-24 h) eggs
were transported by car (approximately 2 h) in a
small cooler to Tifton, GA, and irradiated. Petri
dishes containing eggs that were to be irradiated
at 2- (24-48 h) and 3-days (48-72 h) of age were
kept in the growth chamber for an additional 1
and 2 days, respectively, before transport to Tif-


December 2003







Joseph-J.B. et al.: Irradiation of Spider Mite Eggs


ton. Once irradiated, petri dishes and eggs were
immediately driven back to Tallahassee, FL, and
placed in a growth chamber as before. Petri
dishes were checked daily for egg hatch. Newly
closed larvae were removed, and the number of
larvae and remaining eggs recorded. Egg hatch in
each petri dish was monitored for a period of 2
weeks from the time egg hatch began. Filter pa-
per in the petri dishes was moistened as needed
throughout the course of the experiment.
Spider mite eggs were treated with increasing
doses of radiation until none of the eggs hatched.
The 1-day-old eggs were treated with the follow-
ing doses of radiation during June 2001: 0, 10, 20,
30, 40, and 50 Gy. Two-day-old eggs were exposed
to 0-60 Gy at intervals of 10 Gy from June to Sep-
tember 2001, and 3-day-old eggs were exposed to
0 to 140 Gy at intervals of 10 Gy and 160 to 280
Gy at intervals of 20 Gy from June to November
2001. Four replicate petri dishes of 25 eggs were
used at each dose. Dose response for this experi-
ment was analyzed with polynomial regression
analysis (Damon & Harvey 1987; SAS Institute
1994). Before analysis, proportion data were
transformed with an arcsine square-root trans-
formation. Backtransformed data are presented
in regression equations.

Predation Study, No-Choice Test

Fresh spider mite eggs were obtained as previ-
ously described by placing 25-30 gravid females
on clean bean leaves and allowing them to ovi-
posit for 18-24 h. The bean leaves were cut into 2
cm square pieces containing 25 eggs. One- and 3-
day-old eggs were then irradiated at 0, 40, 140 or
240 Gy. Following irradiation, the filter paper in a
given petri dish was moistened to the point of
standing water and a few drops of detergent were
added to prevent mites from leaving the leaf disc.
A single adult female N. californicus, which had
been starved for 24 h, was added to each arena.
Each female was allowed to feed for 24 h, after
which the number of eggs eaten was recorded.
Twenty replicates of both 1- and 3-day-old eggs at
each treatment dose were conducted. The data
were analyzed by ANOVA, and means separated
using Duncan's Multiple Range Test (SAS Insti-
tute 1994).

Predation Study, Choice Test

Two-spotted spider mite eggs were obtained
and treated as above, except that bean leaves
were cut into pieces 2 cm x 1 cm containing 10
eggs. Following irradiation (0, 40, 140 and 240
Gy), one leaf strip containing 10 1-day-old eggs
was fitted next to a leaf strip containing 10 3-day-
old eggs that had been treated with the same dose
of radiation. Petri dishes were prepared as before,
and a single adult female N. californicus that had


been starved for 24 h was added to the center of
each 2 cm x 2 cm arena. Each female was allowed
to feed for 24 h, and the numbers of eggs eaten
were recorded. Twenty replicates at each treat-
ment dose were conducted. Analysis of the data
was done by determining the preference of 1-day-
old eggs over 3-day-old eggs (=number of 1-day-
old eggs consumed minus the number of 3-day-old
eggs consumed) for each pairing. Data were ana-
lyzed by paired difference t-test (SAS Institute
1994).

RESULTS

Dose Response

Within each age group percent egg hatch de-
creased as the dose of radiation increased (Fig. 1).
Egg hatch for the three age groups showed signif-
icant curvilinear responses to radiation. For each
age group, there appeared to be a threshold be-
yond which the magnitude of the radiation effect
decreased as dose increased. Significant differ-
ences in the slopes of the regressions indicate that


100
A
Sy = 104.78- 4.04x+ 0.038x
S 60
S4= 0.958
S40
S20

0 10 20 30 40 50
o to 2o so 4o so


100
80
60

40
20

0 1
0 to


20 30 40 50 60


100

S* g y =93.94 -0.66x+0.0013x2
g 60 Y 9 .
0 RZ = 0.717
3 40 '
2o *

0 50 100 150 200 250 300
Dose (Gy)

Fig. 1. Eclosion dose response curves for two-spotted
spider mite eggs that were irradiated when they were
(A) 1-, (B) 2-, or (C) 3-days-old with increasing doses of
gamma radiation. Note different scales on x-axes.







Florida Entomologist 86(4)


one-day-old eggs were more sensitive to radiation
(y = 104.78 4.04x + 0.0382, R2 = 0.958, df= 2, 21,
n = 24, P = < 0.0001) than were 2-day-old eggs (y
= 94.98 2.50x + 0.014x2, R2 = 0.953, df = 2, 25, n
= 28, P < 0.0001), and that 3-day-old eggs were
the most resistant to radiation (y = 93.94 0.66x +
0.0013x, R2 = 0.717, df = 2, 85, n = 88, P < 0.0001).
Irradiation of 1-day-old eggs at 40 Gy resulted in
a 1.0 1.0% egg hatch, and at 50 Gy no eggs
hatched. Irradiation of 2-day-old eggs at 40 Gy re-
sulted in 14.0 1.0% egg hatch; 50 Gy resulted in
3.0 1.0% egg hatch, and at 60 Gy 0.3 0.3% of
the eggs hatched. Irradiation of 3-day-old eggs at
60 Gy resulted in 41.0 4.0% egg hatch. Even at
280 Gy, 5.0 1.9% of the eggs hatched, although
none of the hatching individuals survived past
the second larval instar.

Predation Study, No-Choice Test

At 40 and 240 Gy female N. californicus con-
sumed a greater number of 3-day-old spider mite
eggs than 1-day-old eggs (Table 1). Within an age
class, irradiation of the eggs did not affect the
number of eggs eaten except at the highest dose,
240 Gy, for the 1-day-old eggs.

Predation Study, Choice Test

When N. californicus females were given a
choice between 1- and 3-day-old spider mite eggs
that had been exposed to either 0, 40, 140, or 240
Gy of gamma radiation, the paired t-test indi-
cated that there was no preference for 1- or 3-day-
old eggs, except at 240 Gy, where 3-day-old eggs
were preferred over 1-day-old eggs (Table 2).

DISCUSSION
The results show that it is possible to use
gamma radiation to prevent two-spotted spider
mite eggs from hatching. The results also showed


TABLE 1. MEAN (SD) NUMBER OF SPIDER MITE EGGS
CONSUMED PER ADULT FEMALE N. CALIFORNI-
CUS IN 24 H IN A NO-CHOICE TEST, WHEN PRO-
VIDED WITH 25 1- OR 3-DAY-OLD EGGS THAT
HAD BEEN EXPOSED TO 0, 40, 140 OR 240 GY OF
GAMMA RADIATION.

Mean no. eggs eaten

Dose (Gy) 1-Day-Old 3-Day-Old

0 7.7 + 3.95 A, a' 9.0 + 4.27 A, ab
40 6.3 + 2.14 A, a 10.8 + 4.05 B, a
140 7.6 + 3.91 A, a 10.0 + 5.38 A, ab
240 2.4 + 2.34 A, b 6.7 + 3.01 B, b

1Means followed by different capital letters within a row or
lower case letters within a column are significantly different at
P < 0.05 using Duncan's Multiple Range Test.


TABLE 2. MEAN (SD) NUMBER OF SPIDER MITE EGGS
CONSUMED PER ADULT FEMALE N. CALIFORNI-
CUS IN 24 H IN A CHOICE TEST, WHEN PROVIDED
WITH 10 1-DAY-OLD AND 10 3-DAY-OLD EGGS
THAT HAD BEEN EXPOSED TO 0, 40, 140 OR 240
GY OF GAMMA RADIATION.

Mean no. eggs eaten

Dose (Gy) 1-Day-Old 3-Day-Old

0 6.00 + 2.17 a' 5.60 2.52 a
40 4.05 2.41 a 3.75 1.50 a
140 3.55 2.68 a 4.55 2.45 a
240 2.40 2.03 a 6.00 3.07 b

'Means followed by different letters within a row are signif-
icantly different at P > 0.05 using a paired difference t-test.


that irradiated eggs are still acceptable as a food
source to the predatory mite N. californicus. As
such, irradiated spider mite eggs could be used to
provision shipments of predatory mites to elimi-
nate concerns that the shipments are contami-
nated with reproductively viable pest material.
Gamma radiation treatment had a negative ef-
fect on egg hatch overall, with egg hatch decreas-
ing as dose increased. One- and 2-day-old eggs
were much more sensitive to radiation than were
3-day-old eggs. Based on the regression lines for
1- and 2-day-old eggs, the best estimates of the
doses of radiation that would prevent 100% of the
eggs from hatching are 43.6 Gy and 55.1 Gy, re-
spectively. Although 280 Gy, the highest radiation
level tested against 3-day-old two-spotted spider
mite eggs, did not prevent 100% of the eggs from
hatching, none of the hatching individuals sur-
vived past the second instar.
Not only were older eggs much less sensitive to
radiation, but the variation in the dose response
(i.e., the percentage of eggs hatching at a given
dose) increased with egg age. This can be seen in
the R2 values for the regression lines, which were
0.958, 0.953 and 0.717 for 1-, 2- and 3-day-old
eggs, respectively. Why older eggs were less sensi-
tive to radiation and showed a greater variation
in dose response is not known. The egg stage in
the two-spotted spider mite only lasts about 4
days at 28C, so many developmental and physio-
logical changes are occurring during this time.
Radiation dose response experiments that con-
trolled egg age more precisely (e.g., used eggs that
were laid over 1 h intervals rather than 24 h in-
tervals) would likely show less variation. If such
experiments were coupled with studies on the de-
velopmental changes occurring in two-spotted
spider mite eggs, particularly between 2 and 3
days of age, they might provide insights as to why
older eggs are more radio-resistant.
In general, irradiating two-spotted spider mite
eggs had no significant effect on their acceptabil-


December 2003







Joseph-J.B. et al.: Irradiation of Spider Mite Eggs


ity as prey by female N. californicus, except for 1-
day-old eggs treated at 240 Gy. Female N. califor-
nicus consumed 50-75% fewer of these eggs than
they did eggs of other treatments, in both no-
choice and choice experiments. Research has
shown that phytoseiid mites determine prey ac-
ceptance primarily by contact chemoreception
(Dicke et al. 1988; Vet & Dicke 1992). Our re-
search did not attempt to determine what factors
are assessed by N. californicus to determine prey
(egg) acceptability or what biochemical or physio-
logical effects radiation was having on spider
mite eggs, other than reducing egg hatch. How-
ever, it should be noted that 240 Gy was 5-6 times
the dose of radiation needed to prevent egg hatch
of 1-day-old eggs. A similar drop in acceptability
might have been seen with 3-day-old eggs if a
dose of radiation that was 5-6 times their lethal
dose had been used (280 Gy x 5 = 1,400 Gy). If this
were true, one explanation for these results might
be that female N. californicus are able to assess
egg viability and prefer healthy live prey to dead
prey; thus, eggs that were irradiated at a dose
well in excess of the dose that would prevent them
from hatching were less preferred.
The fact that irradiated spider mite eggs were
still acceptable as prey to N. californicus was not
unexpected. Non-viable lepidopteran eggs result-
ing from irradiated parents have been shown to
be acceptable as developmental hosts for tri-
chogrammatid egg parasitoids (Cossentine et al.
1996; Carpenter et al. 2003). Not only could irra-
diated spider mite eggs be used as a risk-free,
high quality food source in shipments of preda-
tory mites, but they could also be used to main-
tain predatory mite colonies that are free of
spider mites and yet avoid the quality problems
associated with rearing them on non-host foods
such as pollen. Future studies should attempt to
rear N. californicus over multiple generations on
irradiated spider mite eggs and compare demo-
graphic effects (e.g., longevity, reproductive po-
tential, etc.) with those when using other food
sources or host stages.


ACKNOWLEDGMENTS

This research was conducted as partial fulfillment of
the requirements of a Master of Science degree in Agri-
cultural Sciences at Florida A & M University, Tallahas-
see, FL. Support for this research was provided by the
U.S. Department of Agriculture, Animal and Plant
Health Inspection Service through cooperative agree-
ments 99-1001-0209-CA, 00-8100-0209-CA and 01-
8100-0755-CA with the Florida A & M University Cen-
ter for Biological Control. Mention of a trademark or
proprietary product does not constitute endorsement of
the product by the USDA or imply its approval to the ex-
clusion of other products that may be suitable. The au-
thors would like to thank Tim Holler, Norm Leppla,
Lance Osborne, Todd Shelly, and John Sivinski for their
helpful reviews of this manuscript.


REFERENCES CITED

CARPENTER, J. E., S. BLOEM, AND J. H. HOFMEYR 2003.
Acceptability and suitability of eggs of false codling
moth (Lepidoptera: Tortricidae) from irradiated par-
ents to parasitism by Trichogrammatoidea crypto-
phlebiae (Hymenoptera: Trichogrammatidae). Biol.
Control (in press).
CASTAGNOLI, M., AND S. SIMONI. 1999. Effect of long-
term feeding history on functional and numerical re-
sponse of Neoseiulus californicus (Acari: Phytoseii-
dae). Exp. and Appl. Acarology 23: 217-234.
COSSENTINE, J. E., J. LEMIEUX, AND Y. ZHANG. 1996.
Comparative host suitability of viable and non-via-
ble codling moth (Lepidoptera: Tortricidae) eggs for
parasitism by Trichogramma platneri (Hymenop-
tera: Trichogrammatidae). Environ. Entomol. 25:
1052-1057.
CRANSHAW, W. S., AND D. C. SCLAR. 2001. Spider Mites.
Colorado State University Fact Sheet No. 5.507.
CROFT, B. A., R. W. MILLER, R. D. NELSON, AND P. H.
WESTIGARD. 1984. Inheritance of early stage resis-
tance to formetanate and cyhexatin in Tetranychus
urticae Koch (Acarina: Tetranychidae). J. Econ. En-
tomol. 77: 574-578.
DAMON, R. A., JR., AND W. R. HARVEY. 1987. Experimen-
tal Design, ANOVA, and Regression. Harper and
Rowe, New York, 508 pp.
DICKE, M., M. W. SABELIS, AND M. DE JONG. 1988. Anal-
ysis of prey preference in phytoseiid mites by using
an olfactometer, predation mode and electrophore-
sis. Exp. and Appl. Acarology 5: 225-241.
FELDMANN, A. M. 1975. Induction of structural chromo-
some mutations in males and females of Tetranychus
urticae Koch (Acarina: Tetranychidae). In Proceed-
ings of the symposium on the sterility principle for
insect control. Jointly organized by the International
Atomic Energy Agency and FAO, Vienna, 1974.
GOULD, F., C. R. CARROLL, AND D. J. FUTUYMA. 1982.
Cross-resistance to pesticides and plant defenses: a
study of the two-spotted spider mite. Entomol. Exp.
et Appl. 31: 175-180.
GRAFTON-CARDWELL, E. E., Y. OUYANG, AND R. A.
STRIGGOW. 1997. Predacious mites (Acari: Phytosei-
idae) for control of spider mites (Acari: Tetrany-
chidae) in nursery citrus. Environ. Entomol. 26: 121-
130.
HAMLEN, R. A., AND R. K. LINDQUIST. 1981. Comparison
of two Phytoseiulus species as predators of two-spot-
ted spider mites on greenhouse ornamentals. Envi-
ron. Entomol. 10: 524-527.
HELLE, W., AND M. W. SABELIS [eds.]. 1985a. Spider
mites: Their biology, natural enemies and control,
Volume 1 Part A. Elsevier, Amsterdam, 406 pp.
HELLE, W., AND M. W. SABELIS [eds.]. 1985b. Spider
mites: Their biology, natural enemies and control,
Volume 1 Part B. Elsevier, Amsterdam, 458 pp.
HENNEBERRY, T. J. 1964. Effects of gamma radiation on
the fertility of the two-spotted spider mite and its
progeny. J. Econ. Entomol. 57: 672-674.
IAEA. 2000. Area-Wide Control of Fruit Flies and Other
Insect Pests: Joint Proceedings of the International
Conference in Area-Wide Control of Insect Pests and
the 5th International Symposium of Fruit Flies of
Economic Importance, 1998, Penang, Malaysia, Keng-
Hong Tan (ed.). Published by IAEA in collaboration
with Penerbit Universiti Sains Malaysia, Pulau Pi-
nang, 782 pp.











MCMURTRY, J. A., AND B. A. CROFT. 1997. Life-styles of
phytoseiid mites and their roles in biological control.
Annu. Rev. Entomol. 42: 291-321.
NAVAJAS, M., J. LAGNEL, J. GUTIERREZ, AND P. BOUR-
SOT. 1998. Species-wide homogeneity of nuclear ribo-
somal ITS2 sequences in the spider mite Tetranychus
urticae contrasts with extensive mitochondrial C01
polymorphism. Heredity 48: 742-752.
NICETIC, O., D. M. WATSON, G. A. BEATTIE, A. MEATS,
AND J. ZHENG. 2001. Integrated pest management of
two-spotted spider mite Tetranychus urticae on
greenhouse roses using petroleum oil and the preda-
tory mite Phytoseiulus persimilis. Exp. and Appl. Ac-
arology 25: 37-53.
OATMAN, E. R., J. A. MCMURTRY, F. E. GILSTRAP, AND V.
VOTH. 1977. Effect of release ofAmblyseius californi-
cus on the two-spotted spider mite on strawberry in
southern California. J. Econ. Entomol. 70: 638-640.
OSBORNE, L. S., L. E. EHLER, AND J. R. NECHOLS. 1985.
Biological control of the two-spotted spider mite in
greenhouses. University of Florida, Mid-Florida Re-
search and Education Center, Apopka, FL, Technical
Bulletin 853, 40 pp.
PENN, S. 1999. The potential role of nuclear techniques
to facilitate the use of biological control agents, an


December 2003


industry perspective, pp. 79-81. In Use of Nuclear
Techniques in Biological Control: Managing Pests,
Facilitating Trade and Protecting the Environment.
Consultants Group Meeting, Vienna, Austria, 14-18
April 1997, 89 pp.
PICKETT, C. H., AND F. E. GILSTRAP. 1986. Natural ene-
mies associated with spider mites (Acari: Tetrany-
chidae) infesting corn in the high planes region of
Texas. J. Kansas Entomol. Soc. 59: 524-536.
ROY, M., J. BRODEUR, AND C. CLOUTIER. 1999. Seasonal
abundance of spider mites and their predators on
raspberry in Quebec, Canada. Environ. Entomol. 28:
735-747.
SAS INSTITUTE, INC. 1994. SAS/STAT user's guide. Ver-
sion 6. SAS Institute, Cary, NC.
SCHAUSBERGER, P., AND B. A. CROFT. 1999. Predation
on and discrimination between con- and heterospe-
cific eggs among specialist and generalist phytoseiid
mites (Acari: Phytoseiidae). Environ. Entomol. 28:
523-528.
UF/IFAS. 2002. Woodybug: Insect & Mites, Mites Sec-
tion, http://woodypest.ifas.ufl.edu/mites.htm.
VET, L. E. M., AND M. DICKE. 1992. Ecology of infochem-
ical use by natural enemies in a tritrophic context.
Annu. Rev. Entomol. 37: 141-172.


Florida Entomologist 86(4)







Bloem et al.: Trapping C. cactorum with Sterile Females


PERFORMANCE OF STERILE CACTOBLASTIS CACTORUM
(LEPIDOPTERA: PYRALIDAE) FEMALES IN LURING MALES TO TRAPS

STEPHANIE BLOEM1, JAMES E. CARPENTER2 AND KENNETH A. BLOEM3
'Center for Biological Control, Florida A&M University
College of Engineering Sciences, Technology and Agriculture, Tallahassee, FL 32317

2United States Department of Agriculture, Agricultural Research Service
Crop Protection and Management Research Unit, Tifton, GA 31794

3USDA-APHIS-PPQ-CPHST, at Florida A&M University, CESTA
Center for Biological Control, Tallahassee, FL 32307

ABSTRACT

Cactoblastis cactorum (Berg) (Lepidoptera: Pyralidae) is renown for its control of invasive
cacti (Opuntia spp.). Its accidental arrival in Florida and its rapidly expanding range along
the Gulf coast pose an imminent threat to native Opuntia spp., especially in the southwest-
ern U.S. and Mexico. Adequate survey techniques are crucial in order to delineate the rate
of spread of this invasive species. Virgin female-baited sticky traps have been effective in de-
tecting C. cactorum adult males in areas where visual surveys failed to detect larval damage.
However, the use of fertile females in traps placed beyond the currently infested area is dis-
couraged because an escaped fertile female might establish a breeding population and ex-
pand the infested area. In this study we compare the attractiveness and the longevity of
fertile and irradiated (sterile) females deployed as bait in traps. Traps baited with females
sterilized with gamma radiation were as effective as traps baited with unirradiated (fertile)
females in detecting populations of feral C. cactorum male moths.

Key Words: invasive species, Opuntia, cactus moth, survey, SIT

RESUME

Cactoblastis cactorum (Berg) (Lepidoptera: Pyralidae) es un insecto bien conocido por su
efectividad como agent de control biol6gico de species invasoras de cactus (Opuntia spp.).
La llegada accidental de C. cactorum al estado de Florida y su rdpida expansion a lo largo de
la costa del Golfo de M6jico, representan una amenaza real para las species nativas de
Opuntia spp., especialmente en areas del suroeste de los Estados Unidos y M6jico. El desar-
rollo de t6cnicas adecuadas de detecci6n es de suma importancia para poder delinear la dis-
tribuci6n y expansion de esta especie. Trampas que utilizan hembras virgenes como cebo
atractivo han sido efectivas en la detecci6n de machos de C. cactorum en areas donde no se
ha detectado la presencia de esta especie por dano en plants. Sin embargo, el uso de hem-
bras virgenes f6rtiles como cebo en trampas colocadas fuera del area de infestaci6n no es re-
comendable debido a que si las hembras se escapan podrian establecer un nuevo foco de
infestaci6n. En este studio, la atractividad y longevidad de hembras f6rtiles como cebo en
trampas se compare con la atractividad y longevidad de hembras irradiadas (est6riles). Las
trampas con hembras est6riles resultaron igualmente eficaces en su habilidad de detecci6n
y capture de machos silvestres de C. cactorum.
Translation provided by author.


The cactus moth, Cactoblastis cactorum (Berg)
(Lepidoptera: Pyralidae) is renown for its control
of invasive cacti (Opuntia spp.) in Australia (Dodd
1940), and it has been cited as one of the most suc-
cessful examples of biological control of weeds
(Sweetman 1936). However, the accidental ar-
rival ofC. cactorum in Florida (Habeck & Bennett
1990; Dickel 1991), first detected in 1989, has
raised concerns about its potential impact on na-
tive Opuntia in the southern United States and
Mexico (Johnson & Stiling 1998; Zimmermann et
al. 2001). Pemberton (1995) estimated that infes-


stations ofC. cactorum should be able to survive as
far north as Charleston, South Carolina, San An-
tonio, Texas, and the lower altitude areas of New
Mexico, Arizona and California. Current distribu-
tional information published in Hight et al. (2002)
suggests that the range ofC. cactorum is expand-
ing by 50-75 km per year. Although specific inter-
actions cannot be predicted at this time, estab-
lishment of C. cactorum in the southwestern U.S.
and Mexico could have devastating effects on the
landscape and biodiversity of native desert eco-
systems, and on the forage and vegetable Opuntia







Florida Entomologist 86(4)


industries in these areas (Sober6n et al. 2001;
Zimmermann et al. 2001).
No satisfactory method of control has been
identified for C. cactorum (Habeck & Bennett
1990; Stiling 2002). Because many of the Opuntia
species in the U.S. are associated with sensitive
ecological areas, widespread use of pesticides is
not recommended (Leibee & Osborne 2001). The
use of insect pathogens does not appear to hold
promise, as most Lepidopteran viruses and para-
sitic nematodes have non-selective modes of ac-
tion and could negatively impact other native
Lepidoptera present in the area of infestation. In
its native habitat in South America, a number of
natural enemies have been found attacking C. cac-
torum, including members of the families Braco-
nidae, Ichneumonidae, Chalcididae and Tachinidae
(Habeck & Bennett 1990; Pemberton & Cordo
2001). However, most of the species are generalist
parasitoids and their host range and potential
non-target effects would have to be carefully scru-
tinized before their release would be approved in
the U.S. (Pemberton & Cordo 2001). Our research
is focusing on the potential application of the Ster-
ile Insect Technique (SIT) and the phenomenon of
inherited or F, sterility to help study and manage
the spread ofC. cactorum (Carpenter et al. 2001a,
b). SIT/F1 sterility is a species-specific pest control
tactic that could be used to eradicate new or local-
ized infestations, protect environmentally sensi-
tive areas, or establish a barrier to prevent further
geographic range expansion.
The ability to quickly detect new infestations,
accurately delimit the size of an infestation (i.e.,
the leading edge of an expanding population), and
assess population trends are of critical importance
to the successful application of any strategy using
SIT/F1 sterility. Unfortunately, although females
produce a pheromone that attracts males, no syn-
thetic pheromone has been identified yet for C. cac-
torum, which makes continuous insect monitoring
especially difficult. Hight et al. (2002) reported on
the use of sticky traps baited with virgin female C.
cactorum to corroborate field damage and better
understand the current distribution of the species
in Florida and Georgia. However, trapping beyond
the leading edge of the currently infested area us-
ing fertile females is not recommended. Here, we
compare the ability of laboratory-reared, virgin fer-
tile females to attract male C. cactorum into sticky
traps with that of females treated with a sterilizing
dose of 200 Gy. The results are discussed in the con-
text of developing an SIT program for C. cactorum
management in the U.S. and elsewhere.

MATERIALS AND METHODS

Test Insects

Cactoblastis cactorum used in these experi-
ments came from a laboratory colony maintained


at the USDA-ARS Crop Protection and Manage-
ment Research Unit in Tifton, Georgia. Larvae
were reared on cladodes of Opuntia ficus-indica
(L.) Miller inside plastic boxes that were kept at
26C + 1C, a photoperiod of 14:10 (L:D), and 70%
relative humidity as described by Carpenter et al.
(2001b). As larvae matured, cocoons were col-
lected every 2-3 days from the containers. Pupae
were then extracted from the cocoons and sorted
by gender.
Three "types" of adult virgin females were
tested in the field for their ability to attract C. cac-
torum males to sticky traps: untreated control fe-
males (Ua9), females that were treated with a
reproductively sterilizing dose of radiation as pu-
pae (Tp ), and females that were irradiated and
sterilized as adults (Ta9). Untreated control fe-
males were obtained by placing pupae in a screen
cage (30.5 by 30.5 by 30.5 cm) and allowing them
to emerge at the above mentioned conditions.
Sterile females that were treated as pupae were
obtained by holding pupae in a 473 ml plastic con-
tainer until pharate adults had formed inside the
pupal skins. Mature pupae that were within 12 h
of emerging were placed in individual 30 ml plas-
tic cups and irradiated with 200 Gy of gamma ra-
diation using a Cobalt60 Gammacell 220 irradiator
(J.L. Shepherd & Associates, San Fernando, CA;
dose rate of 15.47 Gy/min). Treated pupae were
then held at the conditions described above and
allowed to emerge. Sterile females that were
treated as adults were obtained by placing pupae
in a screen cage as above (for control females) and
allowing them to emerge. Fully closed females
were removed every 24-36 h, placed individually
in 30 ml plastic cups, and irradiated with 200 Gy
as described for pupae. For all groups, only adult
females that were less than 48 h old were used in
the trapping experiments.

Traps and Sites

Females, either untreated (Ua9), treated as
pupae (Tp9), or treated as adults (Ta9), were
placed individually inside modified plastic film
(35 mm photographic) canisters and used to bait
Pherocon 1-C wing traps. The film canisters had
two 2 by 2 cm screened windows cut into them
and were provisioned with a small square of O.
ficus-indica. A cotton wick was fitted through a
hole cut in the top of the canisters to provide the
females with moisture. Velcro glued to the bot-
tom of the canisters allowed the canisters to be at-
tached to the inside tops of the wing traps, which
also were fitted with Velcro (Fig. 1). Canisters
with females were transported to the field in a
small cooler.
Experiments were conducted in the proximity
of a salt marsh estuary on the southern banks of
the Brunswick River in Glynn County, Georgia,
west of U.S. Highway 17. A large area was chosen


December 2003







Bloem et al.: Trapping C. cactorum with Sterile Females


a --


Fig. 1. Photograph of Pherocon 1-C sticky trap.


within the estuary with naturally occurring
patches of 0. stricta (Haworth) Haworth plants.
Ten patches with cactus plants between 0.5-1.5 m
in height were selected for the experiments. Two
or three hollow metal stakes were placed in the
ground at a height of approximately 0.75 m
within each patch on which to attach the traps.
All of the cactus patches were separated from one
another by at least 10 m. The trap stakes within
a patch were separated by no less than 4 m.

Overall Trap Performance

Ten Pherocon 1-C traps baited with Ua9's and
10 baited with Ta9's were deployed on 11 April
2003 and serviced every three days until 1 May
2003. Two traps, one with each type of female,
were placed in each of the 10 cactus patches. Dur-
ing each trap servicing, the number of C. cac-
torum males captured in each trap was recorded,
the traps were re-baited with canisters contain-
ing fresh Ua Y and Ta Y, and the placement of the


two treatments within each patch was alternated.
The traps were serviced a total of six times.

Daily Trap Captures and Female Field Longevity

Ten untreated females (Ua9), 10 females that
had been treated with 200 Gy as mature pupae
(Tp Y) and 10 females that had been treated with
200 Gy as newly emerged adults (Ta9) were used
to bait 30 Pherocon 1-C traps. Three traps, one of
each type (Ua9, Tp Ta9), were affixed to the
metal stakes at random within each of the 10 cac-
tus patches. Traps were first deployed on 19 July
2003. Cactus patches were visited every 24 h and
each trap was examined to determine whether
the female was alive and how many male C. cac-
torum had been captured. Traps that captured
males received a new sticky bottom. Traps were
then rotated clock-wise among the three trap po-
sitions within each cactus patch. Daily observa-
tions, trap servicing, and trap rotation continued
until all females died.


:4-







Florida Entomologist 86(4)


Statistical Analysis

Trap capture data for both experiments were
not normally distributed. Since log,1 and arcsine
transformations did not normalize the data, the
GLM-RANK procedure was used to test for treat-
ment effects in the daily trap capture and field
longevity study, and the GLM-TTEST procedure
for unequal variances was used to test for treat-
ment effects on trap capture in the overall trap
performance study (SAS 1989). The mean longev-
ity of females used as bait in traps was analyzed
using GLM and the Waller-Duncan K-ratio t test
(SAS 1989).

RESULTS AND DISCUSSION

In the overall trap performance trial, where
traps were checked for captures every three days,
we found no significant difference (P > 0.2353) be-
tween the mean (S.D.) number of males captured
in traps baited with untreated females (Ua9 =
3.20 4.24) and those baited with sterile females
(Ta9 = 3.25 4.33). In the daily trap capture
study, no significant differences (P > 0.1039) were
seen in the overall mean (S.D.) number of male
C. cactorum captured in Pherocon 1-C traps
baited with Ua9 (10.7 7.3), Tp9 (7.2 5.5), or
Ta 9 (7.5 6.7). The trend in cumulative trap cap-
tures for the traps baited with the three female
types also was similar (Fig. 2). In addition, the
mean (S.D.) longevity in days for control and
treated females used to bait the traps was not sig-
nificantly different (P > 0.6504). Untreated fe-
males lived an average of 6.70 0.72 d. Treated
females irradiated as mature pupae or as adults


--U adult --T adult T pupa
120
S100-"""-
al oo ,
s 80 - ^ -


S40
S20
0 ---
1 2 3 4 5 6 7 8 9 10 11
Days

Fig. 2. Cumulative total C. cactorum males captured
in sticky traps (n = 10 per female type) baited with C.
cactorum females that were untreated (U adult),
treated with a reproductively sterilizing dose of radia-
tion (200 Gy) as pupae (T pupa), and treated with a re-
productively sterilizing dose of radiation (200 Gy) as
adults (T adult). All females were caged in the trap for
the length of their life.


lived an average of 7.56 0.80 d and 7.60 0.81 d,
respectively.
Hight et al. (2002) reported finding infesta-
tions of C. cactorum along the coast as far north
as Folly Island near Charleston, South Carolina
and as far west as St. George Island, Franklin
County, Florida. Several previously unreported
inland infestations were also identified in Orange
and Osceola Counties halfway "up" the Florida
peninsula. Cactoblastis cactorum infestations
were discovered by looking for damaged cladodes
exhibiting mucilage from larval entry holes or
"whitened" cladodes that had fallen to the ground
(Stiling 2002). Surveys are often visually based
on large Opuntia species that are common in
yards, such as 0. ficus-indica and 0. stricta. How-
ever, searching for damage on smaller Opuntia
species that are common in natural areas and
roadsides is difficult because they are often hid-
den in native vegetation. Virgin female-baited
sticky traps were able to detect the presence of
C. cactorum at a beach site with numerous low
growing 0. pusilla (Haworth) Haworth but where
no larval damage was yet evident. During 2003,
several additional surveys for plant damage by
C. cactorum were conducted along the west coast
of Florida (St. Joe Peninsula, Mexico Beach, Pan-
ama City, and Pensacola). Based upon sightings
of larval damage in 0. ficus-indica and 0. stricta,
the current westward limit ofC. cactorum infesta-
tion is at Pensacola Beach on the west end of
Santa Rosa Island in Escambia County (Hight
et al. 2003).
The results suggest that the use of females ster-
ilized with radiation will be just as effective as
unirradiated (fertile) females in detecting popula-
tions of feral C. cactorum male moths. Reliable use
of traps baited with irradiated females will allow
for more widespread monitoring and surveying of
areas beyond the current known limit of
C. cactorum distribution without fear of establish-
ing a new breeding population if the traps, once
deployed, are vandalized or destroyed by people or
wildlife. Based on our data for mean daily trap
captures (Fig. 3) and female longevity, traps baited
with irradiated females could be serviced once per
week because females continued to attract males
into the traps until they died. Although the num-
ber of males captured per living female was great-
est on day 1, this does not necessarily mean that
1-d-old females are more attractive than older fe-
males. The male capture on day 1 could have been
influenced by the presence of more males on that
day. Additional trapping studies are ongoing to in-
vestigate the attractiveness of females at different
ages, and the effectiveness of different trap densi-
ties, trap types, and trap heights.
The efficiency of the virgin female-baited traps
relative to the absolute number of C. cactorum
males present in a given area has not yet been de-
termined. However, experiments to address this


December 2003







Bloem et al.: Trapping C. cactorum with Sterile Females


-4- U adult -+- T adult -0- T pupa


S4



2


0
1 2 3 4 5 6 7 8 9 10 11
Female age (d)

Fig. 3. Effect of female age and female treatment on
the ability of C. cactorum females to lure male C. cac-
torum males into sticky traps (n = 10 per female type).
Females were untreated (U adult), treated with a repro-
ductively sterilizing dose of radiation (200 Gy) as pupae
(T pupa), and treated with a reproductively sterilizing
dose of radiation (200 Gy) as adults (T adult).



question are planned for late 2003 and 2004 in
South Africa and Florida. Release-recapture
studies with marked male C. cactorum and esti-
mates of population density for feral C. cactorum
will be used to determine sticky trap efficiency.

ACKNOWLEDGMENTS

We thank Robert Caldwell, Susan Drawdy and Rob-
ert Giddens (USDA-ARS-CPMRU Tifton GA) for their
exceptional technical assistance. We thank Richard
Layton (Univ. of Georgia) for his assistance with the sta-
tistical analysis of the data. We also thank Dr. Stephen
Hight (USDA-ARS-CMAVE Tallahassee, FL) and Dr.
Russ Mizell (Univ. of Florida) for their helpful reviews of
this manuscript.

REFERENCES CITED

CARPENTER, J. E., K. A. BLOEM, AND S. BLOEM. 2001a.
Applications of F, sterility for research and manage-
ment of Cactoblastis cactorum (Lepidoptera: Pyrali-
dae). Florida Entomol. 84: 531-536.
CARPENTER, J. E., S. BLOEM, AND K. A. BLOEM. 2001b.
Inherited sterility in Cactoblastis cactorum (Lepi-
doptera: Pyralidae). Florida Entomol. 84: 537-542.


DICKEL, T. S. 1991. Cactoblastis cactorum in Florida
(Lepidoptera: Pyralidae: Phycitinae). Tropical Lepi-
doptera 2: 117-118.
DODD, A. P. 1940. The Biological Campaign against
Prickly Pear. Commonwealth Prickly Pear Board,
Brisbane, Australia, 177 pp.
HABECK, D. H., AND F. D. BENNETT. 1990. Cactoblastis
cactorum Berg (Lepidoptera: Pyralidae), a Phycitine
new to Florida. Entomology Circular 333. Florida
Department of Agriculture and Consumer Services.
Division of Plant Industry.
HIGHT, S. D., S. BLOEM, K. A. BLOEM, AND J. E. CARPEN-
TER. 2003. Cactoblastis cactorum (Lepidoptera:
Pyralidae): Observations of courtship and mating
behaviors at two locations on the Gulf Coast of Flor-
ida. Florida Entomol. 86: 400-408.
HIGHT, S. D., J. E. CARPENTER, K. A. BLOEM, S. BLOEM,
R. W. PEMBERTON, AND P. STILING. 2002. Expanding
geographical range of Cactoblastis cactorum (Lepi-
doptera: Pyralidae) in North America. Florida Ento-
mol. 85: 527-529.
JOHNSON, D. M., AND P. D. STILING. 1998. Distribution
and dispersal ofCactoblastis cactorum (Lepidoptera:
Pyralidae), an exotic Opuntia-feeding moth, in Flor-
ida. Florida Entomol. 81: 12-22.
LEIBEE, G. L., AND L. S. OSBORNE. 2001. Chemical con-
trol of Cactoblastis cactorum (Lepidoptera: Pyrali-
dae). Florida Entomol. 84: 510-512.
PEMBERTON, R. W. 1995. Cactoblastis cactorum (Lepi-
doptera: Pyralidae) in the United States: An immi-
grant biological control agent or an introduction of the
nursery industry? American Entomol. 41: 230-232.
PEMBERTON, R. W., AND H. A. CORDO. 2001. Potential
and risks of biological control of Cactoblastis cac-
torum (Lepidoptera: Pyralidae) in North America.
Florida Entomol. 84: 513-526.
SAS INSTITUTE. 1989. SAS User's Guide. SAS Institute,
Cary, NC.
SOBERON, J., J. GOLUBOV, AND J. SARUKHAN. 2001. The
importance of Opuntia in Mexico and routes of inva-
sion and impact of Cactoblastis cactorum (Lepi-
doptera: Pyralidae). Florida Entomol. 84: 486-492.
STILING, P. 2002. Potential non-target effects of a biolog-
ical control agent, prickly pear moth, Cactoblastis
cactorum (Berg) (Lepidoptera: Pyralidae), in North
America, and possible management actions. Biologi-
cal Invasions 4: 273-281.
SWEETMAN, H. L. 1936. The Biological Control of Insects
with a Chapter on Weed Control. Comstock, Ithaca,
New York, 461 pp.
ZIMMERMANN, H. G., V. C. MORAN, AND J. H. HOFF-
MANN. 2001. The renowned cactus moth, Cactoblas-
tis cactorum: its natural history and threat to native
Opuntia in Mexico and the United States ofAmerica.
Diversity and Distributions 6: 259-269.







Florida Entomologist 86(4)


December 2003


CACTOBLASTIS CACTORUM (LEPIDOPTERA: PYRALIDAE):
OBSERVATIONS OF COURTSHIP AND MATING BEHAVIORS
AT TWO LOCATIONS ON THE GULF COAST OF FLORIDA


STEPHEN D. HIGHT1, STEPHANIE BLOEM2, KENNETH A. BLOEM3 AND JAMES E. CARPENTER4
'USDA-ARS-CMAVE at Florida A&M University, Center for Biological Control, Tallahassee, FL 32317

2Center for Biological Control, Florida A&M University, Tallahassee, FL 32317

3USDA-APHIS-PPQ-CPHST, at Florida A&M University, Center for Biological Control, Tallahassee, FL 32307

4USDA-ARS-CPMRU, Tifton, GA 31794

ABSTRACT

Cactoblastis cactorum (Berg) has become an invasive pest of Opuntia spp. along the coastal
areas of southeastern United States from the panhandle of Florida to South Carolina.
Spread of this insect into cactus dominated natural areas of the United States and Mexico
and into agricultural opuntia fields of Mexico is raising concerns within international gov-
ernments and conservation organizations. Interest is growing in using the Sterile Insect
Technique (SIT) to manage C. cactorum populations. Information on courtship and mating
behaviors of this insect is important in the development and application of SIT. We con-
ducted mating table studies and determined that this moth exhibits simple rather than elab-
orate mating behaviors and that courtship and mating take place briefly during morning
twilight. Typically, females initiate calling, males respond to females, and copulation are
complete before sunrise. Successfully mated females attract males within a short period
(mean of 5.2 min), while unsuccessful females continue calling for about 40 minutes. Mating
pairs remain in copula for a mean of 31.8 min. Generally, mated females are busy oviposit-
ing the first few nights after mating, not exhibiting additional mating behaviors. A release
of marked males revealed that males stay near the release site and can be recovered and
identified for subsequent population estimate studies. This study on courtship/mating be-
havior is helpful to the ongoing C. cactorum research to develop a successful SIT program,
identify the female calling pheromone, improve monitoring traps, and develop a technique
to estimate adult moth population abundance.

Key Words: cactus moth, invasive pest, Opuntia, sterile insect technique

RESUME

Desde su accidental llegada al estado de Florida, Cactoblastis cactorum (Berg) se ha con-
vertido en una especie invasora atacando species de Opuntia a lo largo de areas costeras del
sureste de los Estados Unidos desde Florida hasta Carolina del Sur. La invasion de C. cac-
torum tanto en areas naturales con predominancia de cactaceas en Estados Unidos y M6jico
como en plantaciones agricolas de Opuntia en M6jico estan causando gran preocupaci6n a
gobiernos internacionales y a organizaciones que se ocupan de la conservaci6n de recursos
biol6gicos. Sin embargo, el interns en utilizar la T6cnica del Insecto Est6ril (TIE) para con-
trolar poblaciones de C. cactorum esta aumentando simultaneamente. Para desarrollar y
aplicar la TIE de manera efectiva es important obtener informaci6n sobre el cortejo y com-
portamiento de c6pula de este insecto. En este studio de campo determinamos que el com-
portamiento de c6pula de C. cactorum es relativamente simple y que el apareamiento ocurre
durante un period bastante corto, just antes del amanecer. En general, las hembras
comienzan a llamar a los machos, los machos responded y la c6pula se inicia y terminal antes
de que salga el sol. Las hembras que logran copular tipicamente llaman a los machos por
corto tiempo (5.2 min), mientras que las hembras que no se aparean continuan llamando por
40 minutes. La c6pula dura un tiempo promedio de 31.8 minutes. En general las hembras
que copulan la primera noche se dedican a ovipositar durante la noche siguiente y no se in-
volucran en actividades de cortejo. Realizamos una liberaci6n de machos coloreados con
polvo fluorescent que demostr6 que los machos permanecen en las areas donde fueron lib-
erados y que pueden ser identificados sin problema al copular con hembras en mesas de
cortejo. Nuestros resultados son tiles para el desarrollo de la TIE y asimismo para la iden-
tificaci6n de la feromona de c6pula, para mejorar el sistema de trampeo y para desarrollar
un m6todo para calcular el tamaio de la poblaci6n absolute de esta especie.
Translation provided by author







Mating Behavior of Cactoblastis cactorum


The control of invasive cacti in the genus Opun-
tia by the cactus moth, Cactoblastis cactorum
(Berg), is often cited as the most famous example
of successful classical biological control of weeds
(Dodd 1940; Moran & Zimmermann 1984). How-
ever, the unintentional arrival of C. cactorum into
Florida in 1989 (Habeck & Bennett 1990) has
raised concerns for the survival of rare native
Opuntia in the Florida Keys (Johnson & Stiling
1996). Of even greater concern is the potential
westward spread of C. cactorum into areas of the
United States and Mexico that are rich in Opuntia
diversity (Sober6n et al. 2001; Zimmermann et al.
2000; Stiling 2002). Recently, Hight et al. (2002)
reported on the expanding range ofC. cactorum in
North America. By summer 2002, the moth had
spread as far north as Folly Island near Charles-
ton, South Carolina and as far west as St. George
Island, Florida (Hight et al. 2002). In a 2003 sur-
vey of the western Florida panhandle, we found
the new western limit ofC. cactorum at Pensacola
Beach, Florida, near the border with Alabama.
Even though the worldwide successes ofC. cac-
torum as a biological control agent of weedy
Opuntia have been carefully documented (Sweet-
man 1936; Dodd 1940; Pettey 1948; Julien & Grif-
fiths 1998), little information on the insects'
mating habits is available. Dodd (1940) reported
that mating of C. cactorum in Australia took place
during the early morning hours, from daylight
until about 0730 hours, and that copulation was
never observed at night or after 2100 hours. He
also stated that adults of C. cactorum usually re-
mained inactive during daylight hours and sat
motionless in vegetation near their host plants.
Pettey (1948) reported that C. cactorum mating at
Uitenhage, South Africa only occurred early in
the morning, during daylight of the first and sec-
ond days after adult emergence. He reported that
moths were active only after sunset until a little
after sunrise, except in areas where temperatures
were high.
The purpose of the present study was to docu-
ment the courtship and mating behaviors of C.
cactorum in Florida. In particular, we were inter-
ested in precisely documenting the field behaviors
associated with mating, as we are investigating
the possibility of using the Sterile Insect Tech-
nique (SIT) to manage populations ofC. cactorum
in the United States (Carpenter et al. 2001a).
This technique relies on the ability of mass
reared, irradiated, and released insects to effec-
tively compete and mate with a feral population.
Knowledge of the targeted species mating behav-
ior is of crucial importance to the development
and successful application of the SIT. We also are
developing trapping technology that would allow
more extensive and efficient surveys to be con-
ducted for C. cactorum. An improved understand-
ing of courtship and mating behaviors would be
useful in improving trap design and in identifying


pheromones associated with the sexual communi-
cation of this species.

MATERIALS AND METHODS

Test Insects

Cactoblastis cactorum used in these experi-
ments were reared in laboratory colonies at the
USDA-ARS laboratories in Tallahassee, FL and
Tifton, GA. Rearing procedures generally fol-
lowed those described in Carpenter et al. (2001b).
Cocoons were collected every 2-3 days from colony
containers. Pupae were extracted from the co-
coons and sorted by gender. Sorted pupae were
placed in a screen cage (30.5 x 30.5 x 30.5 cm) or
individually into 0.3 ml plastic cups with card-
board lids and allowed to emerge inside growth
chambers at 26C, a photoperiod of 14:10 (L:D),
and 60% relative humidity. Virgin females (<24 h
post emergence) were placed individually in small
plastic cups and kept in a refrigerator (5C) to
slow their physiological ageing and activity. In
the laboratory, two-thirds of one anterior wing of
each female was excised with small scissors to
prevent flight. Each female was returned to its
plastic cup and transported to the field in an open
cooler under natural light. Newly emerged males
were collected and placed as a group in a 475 ml
plastic container. Males were chilled, colored
with fluorescent powder (Day Glo Corp., Cleve-
land, OH), and transported to the field under nat-
ural light in a small cooler.

Mating Tables

Individual mating tables were similar to the
ones described by McBrien & Judd (1996) with
the following exceptions: the diameter of the mat-
ing arena was 17.5 cm to accommodate the larger
sized female C. cactorum, the height of the Tef-
lon tape barrier was 5 cm, the Teflon tape bar-
rier was lightly dusted with talc, and the tables
did not have roofs (Fig. 1). Communal mating ta-
bles were constructed on a base of plywood (61 x
61 x 1.5 cm) that was painted gray (Valspar
American Tradition, oil based paint, light gray,
#48220). A circular Teflon tape barrier (50 cm
diameter x 5 cm high) was glued to the arena and
dusted with talc. Four metal legs (0.5 m high)
were attached to the plywood base with metal
brackets (Fig. 2).
Patches of cactus plants between 0.50-1.50 m
in height were selected for placement of both indi-
vidual and communal mating tables. Individual
mating tables were attached to hollow metal
stakes placed in the ground at a height of approx-
imately 0.75 m and located at the edge of the cac-
tus patches. Communal mating tables (mounted
on their legs) were also placed next to cactus
patches.







Florida Entomologist 86(4)


Fig. 1. Small mating table used in determining courtship and mating behaviors at St. Marks National Wildlife
Refuge (7 July 2003) and Alligator Point, FL (8 July 2003), and determining precise timing of mating events at Al-
ligator Point (15-18 July 2003).


Mating tables were set-up in the same fashion
for each set of observations. A small (2 x 2 cm) sec-
tion of 0. stricta was placed in the middle of the
mating arena of each individual table. One,
clipped-wing, virgin female C. cactorum was re-
leased into each arena. In communal tables, sev-
eral cladodes of fresh 0. stricta were placed inside
the arena and 7-12 clipped-wing females were
placed in the center of each mating arena. Time of
female deployment varied for each experiment.
All times reported are in Eastern Daylight Sav-
ings Time on a 24-hour atomic clock.

Study Sites

Experiments were conducted in July 2003 at
two locations in Florida along the Gulf of Mex-
ico-St. Marks National Wildlife Refuge
(N3004', W8410') and Alligator Point (N29054',
W8423'). Abundant naturally occurring patches
of native Opuntia stricta (Haworth) Haworth
heavily damaged by C. cactorum are present at
both locations. Infested 0. ficus-indica (L.) Miller
is also common among houses at Alligator Point
as a planted and naturalized species. At St.
Marks, the plants are located along a dike that


separates the Gulf of Mexico and a salt marsh es-
tuary Twenty individual mating tables and two
communal mating tables were established at St.
Marks, each separated by no less than 10 m from
one another.
At Alligator Point, plants of 0. stricta and 0. fi-
cus-indica are distributed along open (un-fenced)
front-yards of beach houses along the Gulf of
Mexico. For the first set of observations (morning
of 8 July), 12 individual mating tables and a sin-
gle communal table were placed near infested
cactus patches. Each table was separated from
one another by no less than 3 m. For the second
set of observations (mornings of 15-18 July), 15
mating tables were placed in groups of five
around three heavily infested cactus patches in
the same vicinity as those used for the first obser-
vations. Tables within a group were separated
from each other by about 1 m.

Mating Behavior

At St. Marks, 47 marked male C. cactorum
were released along the dike on the opposing side
of mating tables. Releases were made at 1730
hours on 6 July 2003 to insure that males would


December 2003







Mating Behavior of Cactoblastis cactorum


Fig. 2. Communal mating table used in determining courtship and mating behaviors at St. Marks National
Wildlife Refuge (7 July 2003) and Alligator Point, FL (8 July 2003).


be present in the area. The minimum distance be-
tween male release points and the location of the
mating tables was 10 m. Females were placed in
individual and communal mating tables at 2000
hours and tables were observed every hour from
2100 hours until 0700 hours on 7 July 2003. Moth
activity was observed using flashlights with red
lenses. Moths found in copula were collected into
small plastic cups and the hour noted during
which each mating pair was collected. Insects
were transported back to the laboratory and the
type of each male (i.e., marked or wild) captured
in copula was identified using ultraviolet light to
detect the presence or absence of the Day Glo
dye. The total number of mating pairs recorded
from individual and communal mating tables and
the type of male involved in each mating (feral or
released) was determined. Female mating status
was confirmed by determining the presence or ab-
sence of a spermatophore in the bursa copulatrix
as suggested by Ferro & Akre (1975).
After the first night of observations at St.
Marks, the general timing of mating activities for
C. cactorum was determined. Observations at Al-
ligator Point were modified to take advantage of
these findings. Forty-one marked males were re-
leased at Alligator Point at 2200 hours on 7 July
2003. Twelve females were placed in individual
mating tables and 12 additional females were


placed in the communal table at 2130 hours. Mat-
ing tables were checked every 5-10 minutes be-
tween 0500-0700 hours on 8 July 2003 and all
mating activities observed were recorded. Pairs in
copula were collected in plastic cups and taken to
the laboratory where male type and female mat-
ing status were confirmed.

Precise Timing of Mating Events

Fifteen individual mating tables were set-up
as described above on four consecutive nights (14
to 17 July 2003) at Alligator Point to more accu-
rately document the duration of all events associ-
ated with C. cactorum mating. Newly emerged,
clipped-wing virgin females were prepared each
day and placed in the mating arenas between
2200-2400 hours. Observations began at 0500
hours each morning and continued uninterrupted
until all mating activities ceased. The following
mating behavior events were recorded: time fe-
male initiated calling posture, time female termi-
nated calling posture, time first male responded
to calling female, time last male responded to
calling female, time copula was initiated, and
time copula was terminated. Verification of suc-
cessful copula was confirmed in the laboratory by
the presence of a spermatophore in the female
upon dissection. Light intensity was measured in







Florida Entomologist 86(4)


the early morning hours of 18 July with a HOBO
data logger (Onset Computer Corp., Pocasset, MA).

Female Refractory Period

Females that successfully mated at Alligator
Point during the precise timing experiments were
observed on subsequent mornings to determine
whether they produced an eggstick, resumed a
calling posture, and/or were attractive to males.
The five females that mated on the morning of 15
July 2003 were placed on individual mating ta-
bles at the same time and in the same manner as
each group of 15 new females on evenings of 15-17
July 2003. Three females that mated on the morn-
ing of 16 July 2003 and six females that mated on
the morning of 17 July 2003 were observed on the
morning of 18 July 2003. Any eggsticks that were
produced were collected, the time of oviposition
noted, and the number of eggs counted.

RESULTS

Weather conditions for each morning's obser-
vation were relatively similar. Skies were mostly
clear, temperatures were 25-27C, and relative
humidity was 95-100%. Rain never occurred dur-
ing our observation periods and winds were vari-
able, differing most mornings in relation to speed
and/or direction.

Mating Behavior-St. Marks National Wildlife Refuge

No mating activity was observed between 2100
hours on 6 July 2003 and 0500 hours on 7 July
2003. At each hourly observation, females were
motionless and most were perched on host plant
material. However, when observations were made
during the 0600 hours check on 7 July 2003, 89%
of the females (32 of 36) were found to be engaged
in courtship/mating activities and males were ob-
served flying around the mating tables. Twenty-
one females (58%) were positioned in a typical
calling posture (abdomen protruding upwards
through the wings and held at an angle approxi-
mating 450), eleven females (31%) were found in
copula and four females (11%) were still inactive.
Seven of the copulating females were in individ-
ual tables and four in the communal tables (three
in one and one in the other). By 0625 hours, all
mating pairs had disengaged from one another.
Mating tables were again visited at 0630 hours
and the number of females observed in the calling
position had decreased to 15 (42%). Males could
still be seen flying around the area, but no addi-
tional mating pairs were formed. When tables
were checked at 0700 hours only three females
(8.33%) remained in the calling position and no
males were observed flying in the vicinity of the
tables. When C. cactorum pairs were examined
under UV light, six males were identified as be-


longing to the released group while the remaining
five were feral males. Dissection confirmed that
all copulating females had a spermatophore in
the bursa copulatrix.

Mating Behavior-Alligator Point

Even though mating tables were under almost
continuous observation from 0500 hours on 8 July
2003, no courtship/mating activities were ob-
served until 0545 hours when 6 of 22 females as-
sumed a calling posture. Two females placed on
the communal mating table became entrapped in
excessive dew and were not included in the re-
ported outcomes. In total, nine mating pairs (41%
of observed females) were collected on 8 July
2003. The first mating pair was found at 0545
hours. Thereafter, mating pairs were observed at
0550 hours (2 pair), 0552 hours (1 pair), 0553
hours (2 pair), 0611 hours (1 pair), and 0612
hours (2 pairs). Females continued to call until
0647 hours. During the entire observation period,
three (14%) females did not participate in court-
ship/mating activities. Males and females re-
mained in copula for a short period of time. Most
pairs disengaged from one another in less than 30
min (range 14-29 min). When captured pairs were
examined in the laboratory, all males were deter-
mined to be feral. Dissection confirmed that eight
of nine mated females retained a spermatophore
in the bursa copulatrix.

Precise Timing of Mating Events

A temporal description of C. cactorum court-
ship and mating behaviors observed during the
mornings of 15-18 July 2003 is summarized in Ta-
ble 1. Events related to the rising sun during
these mornings are also presented in Table 1. All
courtship and mating activities were concen-
trated during a two-hour period (0528-0733
hours), beginning each day between astronomical
and nautical twilight when skies had just started
to lighten. Activity ended soon after sunrise. The
majority of C. cactorum completed all measured
courtship/mating events before sunrise, including
initiation of female calling (100%), male response
to female (100%), initiation of copula (100%), cop-
ula termination (96%), and female calling termi-
nation (77%). In fact, the mean time between the
initiation of calling behavior by females and the
last male seen responding to the females was only
16 min (0602-0618 hours). Light intensity mea-
sured each minute during the evening/morning of
17/18 July 2003 was negligible from 2054 to 0628
hours and did not increase until 0629 hours when
the intensity was measured at 43 lum/m2.
Initiation of calling posture by females was im-
mediately followed by the response of males (fly-
ing around the mating tables, landing inside the
mating arenas, and attempting copulation with


December 2003







Mating Behavior of Cactoblastis cactorum


TABLE 1. TEMPORAL DESCRIPTION OF COURTSHIP AND MATING BEHAVIORS OF Cactoblastis cactorum, AND SUNRISE
EVENTS AT ALLIGATOR POINT, FL, 15-18 JULY 2003. SUNRISE EVENTS CALCULATED FROM U.S. NAVAL OB-
SERVATORY WEBSITE . TIMES ARE REPORTED IN EASTERN DAYLIGHT SAVINGS
TIME ON 24-HOUR CLOCK.

Time (hours) or duration (min)

Behaviors n Range Mean (SD)

Initiation of Y calling posture 54 0528-0624 0602 (9 min)
Termination of Y calling posture 31 0610-0711 0644 (12 min)
Response of first S to calling Y 35 0540-0631 0603 (10 min)
Response of last S to calling Y 20 0603-0635 0618 (9 min)
Initiation of copula 25 0540-0615 0601 (10 min)
Termination of copula 23 0610-0733 0633 (16 min)
Duration of calling for Y that did not mate 31 12-66 40.5 (13.0)
Duration of calling for Y that mated 23 1-17 5.2 (4.2)
Duration of copula 23 18-113 31.8 (18.4)
Sunrise Events'
Sunrise 4 0646-0648 0647 (1 min)
Civil Twilight begins 4 0619-0621 0620 (1 min)
Nautical Twilight begins 4 0547-0549 0548 (1 min)
Astronomical Twilight begins 4 0512-0514 0513 (1 min)

1Definitions of these events were derived from (Seidelman 1992): Sunrise = time when the Sun's upper edge of the disk is on the
horizon; Civil Twilight = begins in the morning when the center of the Sun is geometrically 6 degrees below the horizon; Nautical
Twilight = begins in the morning when the center of the sun is geometrically 12 degrees below the horizon; Astronomical Twilight
= begins in the morning when the center of the Sun is geometrically 18 degrees below the horizon.


the females). We did not observe any elaborate
courtship behavior by the male after landing next
to the female nor prior to attempting copulation.
Mating pairs were formed soon after the male
landed next to the female. In a few instances, fe-
males moved away from the male. Females suc-
cessful at attracting males remained in the
calling posture for a short time (mean of 5.2 min).
Unsuccessful females continued calling for 40
min. Mating pairs remained in copula for a short
time period (mean of 31.8 min), however, one pair
remained in copula for 113 min. Females that did
not secure a mate remained in the calling posture
beyond the time when males were seen flying
near the mating tables.
Figure 3 displays the proportion of females (n =
57) involved in calling or mating activities over
time. The time between 0606 and 0645 hours was
when the highest proportion of females was ob-
served to be in a calling posture. The period between
0601 through 0635 hours was when the greatest
number of females was found to be in copula.

Female Refractory Period

Thirteen of the 14-mated females produced an
average of 1.4 eggsticks/female their first night
after mating. The eggsticks averaged 37 eggs/egg-
stick. Only one female exhibited calling behavior
on its first morning after mating. This female did
not attract a male and died by the next morning
without producing an eggstick, although dissec-


tion revealed successful mating had occurred. On
the second night after mating, only three of the
eight mated females produced eggsticks; one egg-
stick/female averaging 28 eggs/eggstick. One fe-
male called for 71 min without attracting a male.
This female had produced two eggsticks its first
night after mating but did not produce an egg-
stick after its second calling event. Of the five fe-
males that mated on the morning of 15 July and
followed a third night/morning, two females pro-
duced two eggsticks (mean of 19 eggs/eggstick),
one female died, and two females were idle.

DISCUSSION

Behaviors associated with courtship and mat-
ing in Pyralidae vary from elaborate and interac-
tive sequences to simple straightforward
behaviors. For example, males attract females
through acoustic signaling from song perches,
such as in Symmoracma minoralis Snellen
(Heller & Achmann 1995). Stationary males of
Galleria melonella (L.) produce 0.5 to 1 s bursts of
wing fanning and are approached by attracted fe-
males (Flint & Merkle 1983). Ephestia elutella
(Hiibner) males approach pheromone-producing
females, engage in head-to-head posturing while
positioning their abdominal scent structures in
close proximity to the female antennae and at-
tempt copulation from the head-to-head position
(Phelan & Baker 1990). Other species of Pyral-
idae exhibit very simple courtship behaviors, with







Florida Entomologist 86(4)


-6r-calling ---- copula 0- inactive


c'jo e c n o iI o cn N c' c i o in in o -- ; N "
000000000000000000000000000
LO 0 ,0 0 0 0 0 0 0. M LO 0 0 0 0 0 0 0 0 0 0 0 0 0

NC C) M C 4 in in o 0 .-i- CM CM Oe -T W 0 CD QD 0 0 i- M CRT CWN
o o 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 9 0 0 0 0 0 0


Time (hours)
Fig. 3. Average times (in 5 min intervals) when females exhibited various courtship and mating behaviors at Al-
ligator Point, FL during the mornings of 15-18 July 2003.


males locating pheromone-emitting females and
quickly attempting copulation by lateral abdomi-
nal thrusts under the female wing without any
behavioral embellishments, such as in the navel
orange worm, Amyelois transitella (Walker)
(Phelan & Baker 1990).
Our results indicate that mating behavior in
C. cactorum closely matches the description for
simple courtship behavior given by Phelan &
Baker (1990). In our field studies, the initiation of
calling posture by virgin female C. cactorum inside
mating arenas was almost immediately followed
by the response of males (flying around the mating
tables, landing inside the mating arenas, and at-
tempting copulation with the females) and the for-
mation of mating pairs. The behavior sequences
observed for C. cactorum closely match observa-
tions described for the lesser mulberry pyralid
(Glyphodes pyloalis Walker) by Seol et al. (1986).
They reported that the random flight of males con-
tinued for several tens of seconds after the females
were first observed in a calling position and that
males and females were observed in copula almost
immediately after encountering one another.


With respect to timing of sexual activity, Wysoki
et al. (1993) studied the reproductive behavior of
the honeydew moth [Cryptoblabes gnidiella (Mil-
liere)]. They found that mating in this pyralid oc-
curred 1-2 h before dawn (beginning at 0345 hours
and ending around 0530 hours) and that duration
of copulation averaged 100 min (range 70-145
min). Peak periods of sexual activity in the pyra-
lids studied by Phelan & Baker (1990) varied in
their distribution from 0-2 h subsequent to the ini-
tiation of scotophase to 2-0 h prior to the initiation
of photophase. Vetter et al. (1997) reported that fe-
male carob moth (Ectomyelois ceratoniae Zeller)
initiate calling in the fourth through seventh hour
of scotophase and all calling terminates during the
first hour of photophase. Carob moths mate during
the fourth and eighth hours of scotophase and
pairs remain in copula for an average of 2.35 0.84
h. Flint & Merkle (1983) reported that Greater
wax moth adults remain in copula for only a few
minutes, yet, upon dissection, 82% of the female
moths had sperm in the spermatheca.
Our observations on C. cactorum identified
that no mating activity occurred during the scoto-


December 2003







Mating Behavior of Cactoblastis cactorum


phase between 2100 hours and 0500 hours, 6-18
July 2003. During the 4 mornings of detailed ob-
servations, moth courtship/mating activities were
restricted to a two-hour period (0528-0733 hours).
A high percentage of insects initiated courtship/
mating behaviors [female posturing (98%), male
response (98%), and copulation (100 '1 before
civil twilight (0620 hours), the limit at which twi-
light illumination is sufficient for terrestrial ob-
jects to be clearly distinguished (Seidelman
1992). In fact, five females began calling (four of
which began copula) just before nautical twilight
(0548 hours), the time when general outlines of
ground objects are distinguishable, but visual de-
tails are not clear (Seidelman 1992). This was
about one hour before sunrise occurred. All but
two matings were complete before sunrise. We
conclude that the peak period of sexual activity
for C. cactorum begins between nautical and civil
twilight and ends before sunrise.
The underlying physiology responsible for the
production of the C. cactorum male sex attractant
is unknown; however, the female appears to be re-
ceiving stimuli that initiate the mating process
before the beginning of nautical twilight. Astro-
nomical twilight, the time at which the Sun be-
gins to illuminate the sky (Seidelman 1992),
occurred during our observations at 0513 0.01
hours. Molecular scattering of ultraviolet radia-
tion and imperceptible sky illumination in the
high altitudes of the troposphere and strato-
sphere (Lee & Hernandez-Andres 2003) present
at this time may be providing the stimuli for
female C. cactorum to initiate their physiological
and behavioral courtship/mating behaviors.
We saw no evidence of elaborate courtship be-
haviors after the male landed next to the female,
nor prior to copulation. Mating pairs were formed
soon after the male landed and only in a few in-
stances did the female move away from the male.
Mating pairs remained in copula for a short pe-
riod of time (mean of 31.8 min) and almost 100%
of the females were found to contain a spermato-
phore in the burse copulatrix upon dissection.
The limited observations on female refractory
period revealed no subsequent matings by mated
females. The two mated females that exhibited
calling postures failed to attract males and did
not produce eggsticks after their second calling
event. The average number of eggsticks produced
per female was similar to reports from Australia
(Dodd 1940) and South Africa (Zimmermann et
al. 2000). However, additional observations over
the life of mated females are planned to conclu-
sively determine the number of matings per fe-
male and their oviposition outcomes.
Opuntia spp. occur naturally from southern
Canada to South America and form a continuous
distribution across the southern U.S. from Florida
through the states along the Gulf of Mexico (Ben-
son 1982). The potential spread of C. cactorum to


the opuntia-rich areas of the western U.S. and
Mexico could have devastating effects on the land-
scape and biodiversity of this region. Our new dis-
covery of C. cactorum on the western border of
Florida intensifies the concern and shortens the
time in which this insect will likely spread into the
southwest. Biological control of C. cactorum is not
a recommended pest control tactic because of the
non-target concerns compiled by Pemberton &
Cordo (2001). Irradiation studies have determined
the dose at which C. cactorum males and females
are 100% sterile and at which the deleterious ef-
fects of substerilizing doses inherited by the F,
generation are minimized (Carpenter et al. 2001b).
An SIT program is the most plausible approach for
controlling C. cactorum along its leading edge to
limit geographical range expansion and to eradi-
cate isolated populations in front of the leading
edge. SIT could also be used as an abatement pro-
gram to protect rare and endangered Opuntia spp.
Studies on mating behavior reported herein have
advanced the development of a successful SIT pro-
gram. We have demonstrated that a proportion of
marked males stay near their release site and can
be recovered and identified. We have determined
that mating behaviors are simple and straightfor-
ward, that the majority of mating behaviors are
initiated and completed before sunrise, that suc-
cessful matings last, on average, 37 min (female
calling plus duration of copula), and that, for the
most part, females are busy ovipositing the first
few nights after mating, not exhibiting additional
mating behaviors. Our mating behavior study is
also helpful to the ongoing C. cactorum research to
isolate and identify the female calling pheromone.
Bioassays testing the attractiveness of pheromone
components and blends may need to be conducted
under natural lighting with observations being
made between nautical and civil twilight. Our ob-
servations will also be useful in efforts to improve
traps used for monitoring, and to develop a tech-
nique to estimate adult moth population numbers.

ACKNOWLEDGMENTS

We thank Nathan Herrick, John Mass, Carla Evans,
(USDA-ARS-CMAVE Tallahassee, FL), Robert Cald-
well, Susan Drawdy, and Robert Giddens (USDA-ARS-
CPMRU Tifton, GA) for their technical assistance. We
also thank Dr. Robert Meagher (USDA-ARS-CMAVE
Gainesville, FL), Dr. Russ Mizell (Univ. of Florida), and
Nathan Herrick for their helpful reviews of this manu-
script. Appreciation is expressed to St. Marks National
Wildlife Refuge and homeowners of Alligator Point for
allowing us to conduct our studies on their properties.

REFERENCES CITED

BENSON, L. 1989. The Cacti of the United States and
Canada. Stanford University Press, Stanford, CA.
CARPENTER, J. E., K. A. BLOEM, AND S. BLOEM. 2001a.
Applications of F, sterility for research and manage-











ment of Cactoblastis cactorum (Lepidoptera: Pyral-
idae). Florida Entomol. 84: 531-536.
CARPENTER, J. E., S. BLOEM, AND K. A. BLOEM. 2001b.
Inherited sterility in Cactoblastis cactorum (Lepi-
doptera: Pyralidae). Florida Entomol. 84: 537-542.
DODD, A. P. 1940. The Biological Campaign Against
Prickly Pear. Commonwealth Prickly Pear Board,
Brisbane, Australia.
FERRO, D. N., AND R. D. AKRE. 1975. Reproductive mor-
phology and mechanics of mating of the codling
moth, Laspeyresia pomonella. Ann. Entomol. Soc.
America 68: 417-424.
FLINT, H. M., AND J. R. MERKLE. 1983. Mating behavior,
sex pheromone responses, and radiation steriliza-
tion of the Greater Wax Moth (Lepidoptera: Pyral-
idae). J. Econ. Entomol. 76: 467-472.
HABECK, D. H., AND F. D. BENNETT. 1990. Cactoblastis
cactorum Berg (Lepidoptera: Pyralidae), a Phycitine
new to Florida. Florida Dept. of Agric. and Cons. Serv.
Division of Plant Industry. Entomology Circular 333.
HELLER AND ACHMANN. 1995. Ultrasound communica-
tion in the pyralid moth species Symmoracma mi-
noralis (Lepidoptera: Pyralidae: Nymphulinae).
Entomol. Gen. 20: 1-9.
HIGHT, S. D., J. E. CARPENTER, K. A. BLOEM, S. BLOEM,
R. W. PEMBERTON, AND P. STILING. 2002. Expanding
geographical range of Cactoblastis cactorum (Lepi-
doptera: Pyralidae) in North America. Florida Ento-
mol. 85: 527-529.
JOHNSON, D. M., AND P. D. STILING. 1996. Host specific-
ity of Cactoblastis cactorum (Lepidoptera: Pyral-
idae), an exotic Opuntia-feeding moth, in Florida.
Environ. Entomol. 25: 743-748.
JULIEN, M. H., AND M. W. GRIFFITHS. 1998. Biological
Control of Weeds: A World Catalogue of Agents and
their Target Weeds. 4th Edition. CABI Publishing, UK.
LEE, R. L., JR., AND J. HERNANDEZ-ANDRES. 2003. Mea-
suring and modeling twilight's purple light. Appl.
Optics 42: 445-457.
MCBRIEN, H. L., AND G. J. R. JUDD. 1996. A Teflon@-
walled mating table for assessing pheromone-based
mating disruption. J. Entomol. Soc. British Colum-
bia 93: 121-125.


December 2003


MORAN, V. C., AND H. G. ZIMMERMANN. 1984. The bio-
logical control of cactus weeds: achievements and
prospects. Biocontrol News Inf. 5: 297-320.
PEMBERTON, R. W., AND H. A. CORDO. 2001. Potential
and risks of biological control of Cactoblastis cac-
torum (Lepidoptera: Pyralidae) in North America.
Florida Entomol. 84: 513-526.
PETTEY, F. W. 1948. The biological control of prickly
pear in South Africa. Sci. Bull., Dept. ofAgric. Union
of South Africa 271: 1-163.
PHELAN, P. L., AND T. C. BAKER. 1990. Comparative
study of courtship in twelve Phycitine moths (Lepi-
doptera: Pyralidae). J. Ins. Beh. 3: 303-326.
SEIDELMAN, P. K. (ed.). 1992. Explanatory Supplement to
the Astronomical Almanac. Univ. Science Books, NY.
SEOL, K. Y., H. HONDA, AND Y. MATSUMOTO. 1986. Mat-
ing behavior and sex pheromone of the lesser mulberry
Pyralid, C. ....'i"' pyloalis Walker (Lepidoptera:
Pyralidae). Appl. Entomol. Zool. 21: 228-235.
SOBER6N, J., J. GOLUBOV, AND J. SARUKHAN. 2001. The
importance of Opuntia in Mexico and routes of inva-
sion and impact of Cactoblastis cactorum (Lepi-
doptera: Pyralidae). Florida Entomol. 84: 486-492.
STILING, P. 2002. Potential non-target effects of a bio-
logical control agent, prickly pear moth, Cactoblastis
cactorum (Berg) (Lepidoptera: Pyralidae), in North
America, and possible management actions. Biol. In-
vasions 4: 273-281.
SWEETMAN, H. L. 1936. The Biological Control of Insects
with a Chapter on Weed Control. Comstock, Ithaca,
NY. 461 pp.
BETTER, R. S., S. TATEVOSSIAN, AND T. C. BAKER 1997.
Reproductive behavior of the female carob moth, (Lep-
idoptera: Pyralidae). Pan-Pacific Entomol. 73: 28-35.
WYSOKI, M., S. B. YEHUDA, AND D. ROSEN. 1993. Repro-
ductive behavior of the honeydew moth, Cryptoblabes
gnidiella. Invert. Reprod. Developm. 24: 217-223.
ZIMMERMANN, H. G., V. C. MORAN, AND J. H. HOFF-
MANN. 2000. The renowned cactus moth, Cactoblas-
tis cactorum: its natural history and threat to native
Opuntia in Mexico and the United States of Amer-
ica. Div. Distrib. 6: 259-269.


Florida Entomologist 86(4)







Yee et al: Infestation by Scirtothrips perseae


COMPARISON OF SCIRTOTHRIPS PERSEAE (THYSANOPTERA: THRIPIDAE)
INFESTATION LEVELS ON AVOCADO FRUIT AND LEAVES

W. L. YEE', B. A. FABER, P. A. PHILLIPS AND J. L. RODGERS
Cooperative Extension, University of California, 669 County Square Drive, Ventura, CA 93003

'Current Address: United States Department of Agriculture-Agricultural Research Service
Yakima Agricultural Research Laboratory, 5230 Konnowac Pass Road, Wapato, WA 98951

ABSTRACT

Avocado fruit can be severely damaged by Scirtothrips perseae (Thysanoptera: Thripidae) in
southern California. Scirtothrips perseae is found on leaves and fruit, but its prevalence on
one versus the other substrate has not been documented. In this study, the occurrence and
infestation levels of S. perseae on avocado leaves and fruit during late spring and summer
were compared at three sites in Ventura and Santa Barbara Counties, California, from 1998-
2000. In all sites and years, adult and larval S. perseae were more abundant on young leaves
than on small fruit from early to mid June. After leaves matured and hardened with increas-
ing temperatures from late June through August, overall S. perseae populations generally
declined. However, populations became proportionally higher on fruit than on leaves com-
pared with earlier in the season. This usually resulted in equal numbers on the two sub-
strates and sometimes in higher numbers on fruit late in the season. The change in relative
S. perseae abundance on leaves and fruit between pre- and post-leaf hardening indicates con-
trol efforts need to be made shortly before leaves harden and become unsuitable for S. per-
seae feeding and oviposition or shortly after the first thrips move onto fruit.

Key Words: Scirtothrips perseae populations, avocado leaves, fruit, leaf development, fruit
development

RESUME

La fruta del aguacate puede ser dahada severemente por Scirtothrips perseae (Thysanop-
tera: Thripidae) en el sur de California. Scirtothrips perseae se encuentra sobre las hojas y
las frutas, pero la prevalencia de substrato sobre el otro no ha sida documentada. En este es-
tudio, los niveles de ocurrencia e infestaci6n de S. perseae en las hojas y en la fruta de agua-
cate durante el final de la primavera y el verano fueron comparadas en tres sitios en los
condados de Ventura y de Santa Barbara, California desde 1998 hasta 2000. En todos los si-
tios y todos los anos, los adults y las larvas de S. perseae fueron mas abundantes en las ho-
jas tiernas que en las frutas pequenas desde el principio hasta la mitad de junio. Despu6s
que las hojas maduraron y endurecieron con el aumento de la temperature desde el final de
junio hasta el final de agosto, la poblaci6n de total de S. perseae decline generalmente. No
obstante, la poblaci6n se converti6 proporcionalmente mas alta en las frutas que en las hojas
comparada con al principio de la estaci6n. Esto usualmente result en numerous iguales sobre
los dos substratos y a veces numeros mas altas sobre la fruta en la 6poca posterior de la es-
taci6n. El cambio en la abundancia relative de S. perseae sobre las hojas y las frutas entire
el pre-endurecimento y el pos-endurecimiento de las hojas indica que las medidas de control
deben ser realizadas un poco antes de cuando las hojas se endurecen y se vuelven no apro-
piadas para la alimentaci6n y la oviposici6n de S. perseae o un poco despu6s de que los trips
se movieron encima de la fruta.


Scirtothrips perseae Nakahara (Thysanoptera:
Thripidae) is a serious pest of avocado, Persea
americana Miller, in southern California, USA
(Hoddle et al. 1998). Discovered in 1996 in Ven-
tura County, CA (Hoddle & Morse 1997), and de-
scribed in 1997 (Nakahara 1997), S. perseae has
been responsible for millions of dollars in damage
as a result of its feeding on and scarring of avo-
cado fruit (Hoddle et al. 1998), with losses to the
California avocado industry in 2000-2001 esti-
mated at $8.65 million (Hoddle et al. 2003). Even
though our understanding of S. perseae biology is


increasing (Hoddle et al. 2000, 2001; Hoddle
2002), little is known about the relationship be-
tween S. perseae populations on avocado leaves
and fruit, and the factors influencing their preva-
lence on one versus the other substrate. Factors
related to infestation on fruit are of particular in-
terest because economic damage caused by thrips
feeding primarily occurs on fruit. The feeding re-
sults in scarring and downgrading or rejection of
fruit in packinghouses. To better understand
S. perseae field ecology and to develop less insec-
ticide-oriented pest control strategies, it is neces-







Florida Entomologist 86(4)


sary to investigate patterns of substrate use by
S. perseae and to relate them to patterns of leaf
and fruit development.
Feeding on leaves and fruit of various hosts by
other thrips species is well documented. The cit-
rus thrips, Scirtothrips citri (Moulton), feeds on
leaves and fruit of citrus (Metcalf & Flint 1962).
The pear thrips, Taeniothrips inconsequens (Uzel)
(Felland et al. 1995), bean thrips, Hercothrips fas-
ciatus (Pergande) (Metcalf & Flint 1962), and the
flower thrips, Frankliniella occidentalis (Pergande)
(which is well known to feed in flowers) (Salguero-
Navas et al. 1991), also feed on foliage and fruit of
their hosts. On avocado, the greenhouse thrips,
Heliothrips haemorrhoidalis Bouche, feeds on
mature leaves and fruit (Smith 1929; Bekey 1986).
In this study, infestation levels of S. perseae on
avocado leaves and fruit are compared and their
relationships with periods of leaf and fruit devel-
opment are described. We hypothesized that
S. perseae stays on leaves that are young, but
moves onto fruit as leaves mature and harden
during late spring and early summer, accounting
for high populations and damage observed on
fruit during this time.

MATERIALS AND METHODS

Study Sites

Data were collected from three orchards that
were untreated with insecticides (with one excep-
tion, see below) and that had 'Hass' avocado trees
in Santa Barbara and Ventura Counties, CA, from
1998-2000. Trees were 10-18 years old and 4.6-
6.2 m tall. Orchards were located in the cities of
Carpinteria (Santa Barbara County), Somis, and
Moorpark (both Ventura County). These sites rep-
resented coastal (cool temperature), intermediate
(moderate temperature), and inland (warm tem-
perature) (Kimball & Brooks 1959) distributions
of S. perseae, respectively. Moorpark was treated
once with an insecticide (abamectin) in June 2000.
Temperatures were determined within the three
sites throughout the season using StowAway XT1
temperature loggers (Onset Computer Corp, Pocas-
set, MA). Loggers were hung from branches in the
canopy. Data were recorded daily every 30 min.

Sampling for S. perseae on Leaves and Fruit

Numbers of adult and larval S. perseae were re-
corded by visually examining 100 leaves and 100
fruit on the trees at the three sites from June
through August 1998 and 1999 and from June
through July 2000 when fruit first appeared.
Adults and larvae were large enough so that a
hand lens was not required. Flowers were not ex-
amined because they last only about 24 h (Bergh
1973) and because the western flower thrips,
F occidentalis, is the predominant species in them,


not S. perseae (Hoddle 1999). Younger, three-quar-
ters expanded leaves (Hoddle 2002) were sampled,
but when these were unavailable, older, hardened
leaves had to be sampled. Upper and lower sur-
faces of leaves were examined, although the major-
ity of thrips was found on lower surfaces. Lengths
of all leaves and fruit were measured. Dates when
the majority of leaves began to harden were re-
corded. Hardening of leaves was determined visu-
ally. The youngest leaves were mostly reddish
brown; older but still young, three-quarters ex-
panded leaves were light green and flexible. Hard-
ened old leaves were dark green, shinier, and rigid.
In 1998, 20 leaves and 20 fruit from five trees
were randomly sampled. In the case of leaves, ran-
dom sampling occurred within young leaves (un-
less absent) and not among all leaves. Thrips were
congregated on young leaves, so whether the
thrips were dispersed or aggregated in the tree de-
pended on the amount of leaf flush present. In
1999 and 2000, 10 leaves and 10 fruit from 10
trees were randomly sampled. Sampled leaves and
fruit were located 1.5-2.0 m above ground, a height
chosen for practicality. In all years, sampling was
conducted approximately every one or two weeks.
Exceptions to the above protocol in 1998 were
as follows. On 10 June in Somis, 20 leaves and 20
fruit from only three trees were sampled. In three
cases, there were no fruit present in two or three
out of the five trees designated for sampling. Thus,
on 25 June in Somis, 20 leaves on each of two trees
were matched with 20 fruit from two neighboring
trees. On 11 and 29 June in Moorpark, 20 leaves
on each of three trees were matched with 20 fruit
from three neighboring trees.

Statistics

To compare S. perseae infestation levels on fruit
and leaves, the Mann-Whitney U-test was con-
ducted on data within individual dates. The hy-
pothesis tested was that the medians of thrips
populations on fruit and leaves were the same
(i.e., populations had the same statistics of loca-
tion [Sokal and Rohlf 1981]). Numbers on fruit
and leaves from the same tree were paired and
considered replicated observations (n = 5 and 10
trees/date and 10 and 20 leaves or fruit/date, ex-
cept n = 3 on 10 June 1998 in Somis). When there
were many or all zero data on fruit or leaves, the t-
test was used to compare the paired samples after
counts were transformed (square root + 1). Stat-
graphics Plus (1997) was used for all analyses.

RESULTS

Temperatures

Mean weekly temperatures at Carpinteria, So-
mis, and Moorpark from 1998-2000 are shown in
Fig. 1. Carpinteria was the coolest site, Somis was


December 2003






Yee et al: Infestation by Scirtothrips perseae


A 1998
H somis

4'


H Moorpark


--- Carpinteria
-o- Somis
-v- Moorpark

v^o-^


H Carpinteria
6-9 6-16 6-23 6-30 7-7 7-14 7-21 7-28 8-4 8-11 8-18

B 1999 --

H Somis H -Moorpark






H Carpinteria

6-9 6-16 6-23 6-30 7-7 7-14 7-21 7-28 8-4 8-11 8-18

C 2000 H Moorpark

H Somis





H Carpinteria


6-16 6-23 6-30


7-7 7-14 7-21


Beginning Week
Fig. 1. Weekly temperatures in (A) 1998, (B) 1999, and (C) 2000 at Carpinteria, Somis, and Moorpark, Califor-
nia, study sites. H and arrows indicate sample dates when leaves began to harden.
intermediate, and Moorpark was the warmest. occurred the latest at Carpinteria, except during
Gradually increasing temperatures in late June 2000 (Fig. 1). Mean high temperatures at Carpinte-
were associated with initial leaf hardening, which ria in June, July, and August in 1998-2000 were


0
0
U)


C-
a)




c)
a)







Florida Entomologist 86(4)


22.2, 24.3, and 24.6C, respectively (no data for
August 2000). At Somis, mean high temperatures
were 27.7, 29.4, and 30.6C, respectively, and at
Moorpark, they were 28.9, 30.6, and 31.8C, respec-
tively. Sustained high temperatures in early and
mid July were generally followed by overall de-
clines in adult (Figs. 2-4) and larval (Figs. 5-7)
S. perseae populations during late July and August.

Infestation Levels on Leaves and Fruit

In general, for all sites and years, adult S. per-
seae were found in significantly higher numbers
on leaves than fruit when fruit were first seen in
early June (Figs. 2-4). However, as leaves hard-
ened from June into July, differences were usu-
ally not seen between substrates. This trend was
also generally true of larvae, although larval
abundance was significantly higher on fruit than
on leaves after leaves hardened during late sea-
son in several cases (Figs. 5-7). Noteworthy sig-
nificant site-specific patterns were as follows.

Carpinteria

At Carpinteria in 1999, a protracted period of
sporadic leaf flush following initial leaf hardening
coincided with higher populations of adults (Fig.
2B) and larvae (Fig. 5B) on leaves than fruit from
22 June to 10 August. This period with higher
thrips numbers on leaves was longer than for the
other two years.

Somis

At Somis in 2000, adult numbers were higher
on leaves than on fruit for all but one sample date
(Fig. 3C). However, in 1998 and 1999, larval num-
bers were higher on fruit than leaves on three
dates in July and August of each year (Figs. 6A
and 6B, respectively).

Moorpark

At Moorpark in 1999, adult numbers were
higher on fruit than leaves on one date (Fig. 4B).
In 1998, larval numbers were also higher on fruit
than leaves on two dates in August (Fig. 7A) and
in 1999 on three dates in August (Fig. 7B).

Relationships Between Infestation Levels and Leaf and
Fruit Lengths

Younger leaves were approximately the same
lengths from June to August. There was no corre-
lation between adult and larval infestation levels
and leaf lengths (P > 0.05). Thus declines in S. per-
seae abundance on leaves were not related to leaf
lengths, but were associated with when leaves
hardened at Somis in 1998 and 2000, Moorpark in
2000, and Carpinteria in 1998 and 1999.


Fruit lengths increased from 0.5-6 cm during
June to August. Increases in S. perseae abun-
dance on fruit were positively correlated with
fruit lengths up to mid July, but they were not
positively correlated over the season (P > 0.05).
Thrips were first seen on 0.5-1.4 cm long fruit.
Numbers were highest on 3-4 cm long fruit, but
numbers declined on fruit >5 cm long (Figs. 2-7).

DISCUSSION

The results support our hypothesis that S. per-
seae tends to stay on young leaves until they ma-
ture and harden during early summer. Despite
the later onset of leaf hardening at the coolest
site, the sequence of events that resulted in infes-
tation on fruit was the same at all three sites.
Growth flush was followed by simultaneous hard-
ening of leaves and fruit appearance (and absence
of flowers), which seemed responsible for S. per-
seae movement onto developing fruit. In general,
these events were also associated with gradually
increasing temperatures that probably caused
rapid leaf development and hardening.
Our results suggest adult S. perseae prefer
young leaves that are 15-17 cm long over small
fruit that are <1.5 cm, at least as resting or feed-
ing sites. However, larger fruit 3-4 cm long may be
more preferred than smaller fruit, and perhaps
more than young leaves. Within fruit, those 2.5-
5.4 cm in diameter are preferred over those
smaller or larger for oviposition (Hoddle 2002),
and immature fruit 2.85 cm in diameter (2.87 lar-
vae/fruit) apparently are preferred for oviposition
over undersides of three-quarters expanded im-
mature leaves (1.53 larvae/leaf) (Hoddle 2002). In
our study, however, it was unclear if the higher
adult and larval numbers on the 3-4 cm long fruit
compared with the smaller fruit were caused by
an actual preference for larger fruit or a lack of
suitable leaves. In other thrips, T palmi Karny
and F occidentalis, there is an apparent prefer-
ence for foliage and flowers over fruit of cucumber
(Rosenheim et al. 1990).
Leaves clearly are larval developmental sites
for S. perseae (Hoddle & Morse 1998; Hoddle
2002). However, adults probably cannot feed on or
oviposit into mature leaves and this may force
them onto fruit. We have also observed larvae
congregating on leaf stems when populations on
leaves are high. This suggests larvae can also
move from leaves to fruit after leaf resources are
depleted by high feeding activity.
Interestingly, in its native subtropics, where
'Hass' avocado tree phenology is different than in
the United States (Teliz 2000), S. perseae seems to
rarely infest fruit (Phillips 2003). In Mexico, fruit
appear in February during leaf flush (Phillips
2003) rather than at or near the end of leaf flush,
as it usually did at our study sites. In Mexico,
thrips are also found feeding on and scarring foli-


December 2003






Yee et al: Infestation by Scirtothrips perseae


Carpinteria

H 1998


Leaves


--- Leaf Length
-0- Fruit Length


1.2

0.9

0.6

0.3


I TT ---
I.


6-9 6-24 7-21 7-28 8-4 8-18 8-25


6-15 6-22 6-29


7-5 7-13 7-20 7-27


8-3 8-10 8-17


21 E
18 LU
U)
15 +1
-.-
12 ~
9 -
6 U
3 0
3 4--
0 -

21
18
15
12
9
6
3
0


6-13 6-21 6-27 7-11 7-18 7-25
Fig. 2. Numbers of adult S. perseae + SE on leaves and fruit at Carpinteria, California in (A) 1998, (B) 1999, and
(C) 2000 related to leaf and fruit lengths. H = leaves began to harden. Asterisks indicate significance detected by
the Mann-Whitney U-test or t-test (*P < 0.05, **P < 0.01, ***P < 0.001).


iI


A


I



mA


- 18
-15
- 12
9
6
3
0






Florida Entomologist 86(4)


Somis
3.5
3.0 H 1998 18
3.0 A-- 18
2.5 15
2.0 Leaves -*- Leaf Length 12
1.5 I Fruit -C- Fruit Length

1.0 6

0.5 3
uL 0.0 0
0 6-10 6-25 7-20 8-3 8-17 8-24
1.0
a) 21 E
S1999 B 2
SUH 18 L

cn **
+) 15 +1
12
0.5 2
T19
SI h 6 ,U
S3 0

0.0 0 .
S6-14 6-21 6-28 7-5 7-12 7-19 7-26 8-2 8-24
_0
< 21
S1.4 2000 C
z H 18

1.0 15
12

0.6 9
6

0.2 -3
0
6-14 6-23 6-30 7-13 7-21
Fig. 3. Numbers of adult S. perseae + SE on leaves and fruit at Somis, California in (A) 1998, (B) 1999, and (C)
2000 related to leaf and fruit lengths. H = leaves began to harden. Asterisks indicate significance detected by the
Mann-Whitney U-test or t-test (*P < 0.05, **P < 0.01, ***P < 0.001).


December 2003






Yee et al: Infestation by Scirtothrips perseae


1998


-- Leaf Length
Leaves Fruit Length
- Fruit


6-11 6-29 7-14 7-27 8-11 8-20


6-10 6-21 6-28 7-5 7-12 7-19 7-28 8-11 8-25


' 0


21 E
o
18
CO
15 +1
12 0
C
9 4
6 2
LL
3 L
4-
0

21
18
15
12
9
6
3
0


6-14 6-23 6-30 7-5 7-12 7-26


Fig. 4. Numbers of adult S. perseae + SE on leaves and fruit at Moorpark, California in (A) 1998, (B) 1999, and
(C) 2000 related to leaf and fruit lengths. H = leaves began to harden. Asterisks indicate significance detected by
the Mann-Whitney U-test or t-test (*P < 0.05, **P < 0.01, ***P < 0.001).


Moorpark


0.6



0.4



0.2


18

15

12


0.0

0.3



0.2



0.1



0.0

0.9


0.6



0.3



0.0






Florida Entomologist 86(4)


Carpinteria


1998 A


i- Leaves
[C- Fruit


L~i ~-


14
12
10
8
6


6-9 6-24 7-21 7-28 8-4 8-18 8-25


6-15 6-22 6-29 7-5 7-13 7-20 7-27 8-3 8-10 8-17


21 E
18 u
15 +1
12 i
9
-4-,
6 2
U-
3 0
4-
0 U)

21
18
15
12
9
6
3


0 ,I- H T E --i-,, ,0 0
6-13 6-21 6-27 7-11 7-18 7-25
Fig. 5. Numbers of larval S. perseae + SE on leaves and fruit at Carpinteria, California in (A) 1998, (B) 1999, and
(C) 2000 related to leaf and fruit lengths. H = leaves began to harden. Asterisks indicate significance detected by
the Mann-Whitney U-test or t-test (*P < 0.05, **P < 0.01, ***P < 0.001).


18
- 15
-12
9
6
3
0


V


December 2003






Yee et al: Infestation by Scirtothrips perseae


Somis


H 1998


I Leaves
m Fruit


A


-- Leaf Length
-0- Fruit Length


18
16
14
12
10
8
6
4
2
0


6-28 7-5 7-12 7-19 7-26 8-2 8-24
6-28 7-5 7-12 7-19 7-26 8-2 8-24


18

15

12

9

6

3

0


21 ?

0)
18 LU
15 +1
t-
12 ]
C-
a)
9 "

6 -
LL
3 0
4-
0 a)


21
18
15
12
9
6
3
0


6-14 6-23 6-30 7-13 7-21


Fig. 6. Numbers of larval S. perseae + SE on leaves and fruit at Somis, California in (A) 1998, (B) 1999, and (C)
2000 related to leaf and fruit lengths. H = leaves began to harden. Asterisks indicate significance detected by the
Mann-Whitney U-test or t-test (*P < 0.05, **P < 0.01, ***P < 0.001).


- 2 -2 **
aii i j -' -
6-10 6-25 7-20 8-3 8-17 8-24


6-14 6-21






Florida Entomologist 86(4)


Moorpark


6-11 6-29 7-14 7-27 8-11 8-20


6-10 6-21 6-28 7-5 7-12 7-19 7-28 8-11 8-25

** H 2000 C





Abamectin treatment





6-14 6-23 6-30 7-5 7-12 7-26


18

15

12

9

6

3

0


21 E
18 uj
()
15 +1
12 D
C:
9 -j

6 _
L.
3 0
>4-
0
-J


20


15


10


5


0


Fig. 7. Numbers of larval S. perseae + SE on leaves and fruit at Moorpark, California in (A) 1998, (B) 1999, and
(C) 2000 related to leaf and fruit lengths. H = leaves began to harden. Asterisks indicate significance detected by
the Mann-Whitney U-test or t-test (*P < 0.05, **P < 0.01, ***P < 0.001).


December 2003







Yee et al: Infestation by Scirtothrips perseae


age early in the season prior to fruit set. In addi-
tion, thrips populations are low by the time of
fruit set, when temperatures are often well above
29C (P A. Phillips, unpublished). Laboratory
data show that S. perseae develops poorly at high
temperatures. When held at 30C, 61% fewer lar-
vae emerged from leaves than at 25C (Hoddle &
Morse 1998). Temperatures were still relatively
cool and thrips populations were high at the be-
ginning of fruit set at our three study sites. The
combined evidence suggests southern California
avocado growing conditions have contributed to
the current pest status of S. perseae. It must be
noted, however, that the phenology of leaf flush
and hardening even within southern California
varies from year to year. Thus leaves and fruit
may not always be present at the same time,
which may alter the patterns seen in this study.
The change in relative S. perseae abundance
on leaves and fruit between pre- and post-leaf
hardening indicates control efforts need to be
made shortly before leaves harden and become
unsuitable for S. perseae feeding and oviposition
or shortly after the first thrips move into fruit. In-
secticide treatments may need to be considered
when a threshold of 3-5 thrips larvae per leaf is
reached, as this corresponds later to 6-15% eco-
nomic damage of fruit when treatments are not
applied (Yee et al. 2001). Future studies need to
determine more precisely how the timing of leaf
growth flush in relation to fruit set can be used to
predict potential movement of S. perseae from
leaves onto fruit and to prevent scarring damage.

ACKNOWLEDGMENTS

We thank Dave Hutter, Steve Moore, and Jim Wehr
for allowing us use of their orchards, and Mark Hoddle
for reviewing an earlier version of the manuscript. This
research was supported in part by the California Avo-
cado Commission.

REFERENCES CITED

BEKEY, R. 1986. Greenhouse thrips emerging as num-
ber one avocado pest. Calif. Avocado Society Year-
book, 1986. 70: 99-102.
BERGH, B. 0. 1973. The remarkable avocado flower. Ca-
lif. Avocado Society Yearbook. 57: 40-41.
FELLAND, C. M., D. A. J. TEULON, L. A. HALL, AND D. F.
POLK. 1995. Distributional management of thrips
(Thysanoptera: Thripidae) on nectarine in the mid-
Atlantic region. J. Econ. Entomol. 88: 1004-1011.
HODDLE, M. S. 1999. The biology and management of
the avocado thrips, Scirtothrips perseae Nakahara
(Thysanoptera: Thripidae). http://www.biocontrol.ucr.
edu/avocadothrips.html#


HODDLE, M. S. 2002. Oviposition preferences of Scirto-
thrips perseae Nakahara (Thysanoptera: Thripidae)
in southern California orchards. Pan-Pacific Ento-
mol. 78: 177-183.
HODDLE, M. S., AND J. G. MORSE. 1997. Avocado thrips:
a serious new pest of avocados in California. Calif.
Avocado Society Yearbook. 81: 81-90.
HODDLE, M. S., AND J. G. MORSE. 1998. Avocado thrips
update. Citrograph. 83: 6-7.
HODDLE, M. S., J. G. MORSE, P. PHILLIPS, AND B. FABER
1998. Progress on the management of avocado
thrips. Calif. Avocado Society Yearbook. 82: 87-100.
HODDLE, M. S., J. G. MORSE, W. L. YEE, AND P. A. PHIL-
LIPS. 2000. Further progress on avocado thrips biol-
ogy and management. Calif. Avocado Society
Yearbook. 83: 105-125.
HODDLE, M. S, J. G. MORSE, W. L. YEE, AND P. A. PHIL-
LIPS. 2001. Further progress on avocado thrips biol-
ogy and management. Calif. Avocado Society
Yearbook. 83: 105-114, 116-125.
HODDLE, M. S., K. M. BETTER, AND J. G. MORSE. 2003.
The economic impact of Scirtothrips perseae Naka-
hara (Thysanoptera: Thripidae) on California avo-
cado production. Crop Protection. 22: 485-493.
KIMBALL, M. H., AND F. A. BROOKS. 1959. Plant climates
of California. Calif. Agric. 13: 7-12.
METCALF, C. L., AND W. P. FLINT. 1962. Destructive and
useful insects. Their habits and control (4th ed.).
McGraw-Hill, New York.
NAKAHARA, S. 1997. Scirtothrips perseae (Thysanop-
tera: Thripidae), a new species infesting avocado in
southern California. Insecta Mundi. 11: 189-192.
PHILLIPS, P. A. 2003. Avocado thrips, Scirtothrips per-
seae Nakahara, in its native home: Mexico and Gua-
temala. Abstract of paper presented at the Pacific
Branch Meetings of the Entomological Society of
America, Tucson, AZ, 25 May 2003.
ROSENHEIM, J. A., S. C. WELTER, M. W. JOHNSON, R. F.
L. MAU, AND L. R. MINUTO. 1990. Direct feeding
damage on cucumber by mixed-species infestations
of Thrips palmi and Frankliniella occidentalis
(Thysanoptera: Thripidae). J. Econ. Entomol. 83:
1519-1525.
SALGUERO-NAVAS, V. E., J. E. FUNDERBURK, S. M. OLSON,
AND R. J. BESTEAR. 1991. Damage to tomato fruit by
the western flower thrips (Thysanoptera: Thripi-
dae). J. Econ. Entomol. 26: 436-442.
SMITH, R. H. 1929. Thrips injury to avocados. Calif. Av-
ocado Association Yearbook. p. 130.
SOKAL, R. R., AND F. J. ROHLF. 1981. Biometry. The
principles and practice of statistics in biological re-
search (2nd ed.). W. H. Freeman. New York.
STATGRAPHICS PLUS. 1997. Version 3 for windows. Man-
guistics, Rockville, MD.
TELIZ, D. 2000. El aguacate y su manejo integrado. Edi-
ciones Mundi-Prensa, Mexico, D.F. ISBN 968-7462-
15-9, 219 pp.
YEE, W. L., P. A. PHILLIPS, J. L. RODGERS, AND B. A.
FABER 2001. Relationships between Scirtothrips
perseae (Thysanoptera: Thripidae) populations on
avocado leaves, fruit, and scarring damage on fruit.
Environ. Entomol. 30: 932-938.







Florida Entomologist 86(4)


December 2003


ATTRACTION OF COLORED PLASTICIZED CORRUGATED BOARDS TO
ADULT STABLE FLIES, STOMOXYS CALCITRANS (DIPTERA: MUSCIDAE)

J. E. CILEK
John A. Mulrennan, Sr. Public Health Entomology Research and Education Center
College of Engineering Sciences, Technology and Agriculture, Florida A & M University
4000 Frankford Avenue, Panama City, FL 32405

ABSTRACT

The attraction of colored plasticized corrugated boards covered with adhesive to trap adult
stable flies was investigated on Florida panhandle beaches. Colors consisted of blue, red, or-
ange, and three types of white (horizontal ribbed, vertical ribbed, or opaque). Boards mea-
sured 67.3 cm (length) by 31.7 cm (height) and were placed on slotted wooden stakes, 30 m
apart, along a linear transect. Fly collections were significantly (P < 0.05) greater on blue
boards than on orange and white but there was no difference between red and blue boards.
Spectral reflectance of boards peaked at 503 nm for blue, 638 nm for red, while orange and
the 3 types of white boards peaked at about 630 nm. Blue boards exhibited the lowest reflec-
tive intensity when compared with the rest of the colors. Because stable flies were collected
from all boards it is surmised that the boards provided leeward surfaces on which to land or
remain perched in the windy beach environment. Significantly more flies were collected
from the leeward side of boards compared with the windward side. Moreover, the boards may
have provided vertical platforms for adult stable fly assembly, thermoregulation, and/or
mating. Adhesive-treated corrugated plasticized boards may be a suitable method for luring
stable flies away from human or animal hosts in recreation areas to reduce annoyance from
biting pests.

Key Words: traps, management, control, behavior, biting fly

RESUME

La atracci6n de los adults de la mosca de establo hacia tablas plastificadas de colors y co-
rrugadas y cubiertas con un adhesive para atrapar las moscas fue investigada en las playas
del noroeste de la Florida. Los colors consistieron en azul, rojo, anaranjado, y tres classes de
blanco (cordoncillado horizontalmente, cordoncillado verticalmente, u opaco). La tablas me-
dian 67.3 cm (de largo) por 31.7 cm (de alto) y fueron puestas sobre estacas de madera con una
ranura separadas por 30 m, por un transecto lineal. El numero de moscas recolectadas fueron
significativamente mayores (P < 0.05) en las tablas en azul que en las tablas anaranjadas o
blancas pero no habia una diferencia entire las tablas rojas y las azules. La reflexi6n espectral
de las tablas fue mas alta en 503 nm para la azul, 638 nm para la roja, mientras que la mas
alta para la anaranjada y las tres classes blancas fueron arrededor de 630 nm. Las tablas azu-
les exhibieron la intensidad reflective mas baja cuando fue comparada con el resto de los co-
lores. Puesto que las mosca de establo fueron recolectadas de todas las tablas, se asume que
las tablas proven superficies sotaventos para aterrizar o quedar posadas en el ambiente ai-
roso de la playa. El numero de las moscas recolectadas del lado sotavento de las tablas fue sig-
nificativamente mayor comparado con el lado barlavento. Ademas, las tablas pudieron
proven plataformas verticales para la congregaci6n de los adults de la mosca de establo, la
termoregulaci6n y/o el apareamiento. Las tablas plastificadas corrugadas tratadas con adhe-
sivo pueden ser un m6todo apropiado para atraer las moscas del establo fuera de los hospe-
deros humans y animals en areas de recreo para reducir las picaduras de estas plagas.


Adult stable flies Sr. ... calcitrans [L.]) are
primarily blood-feeding pests of cattle. These
flies, however, can be serious biting pests of hu-
mans when their primary animal hosts are ab-
sent. Oftentimes stable flies negatively impact
the use of recreational areas (Newson 1977). Con-
gregations of host-seeking stable flies, primarily
associated with cold front passage, occur regu-
larly on Florida's panhandle beaches from late
summer through fall (King & Lenert 1936;
Hogsette et al. 1987). A considerable amount of


research has been conducted on the biology and
management of this pest in an effort to minimize
its impact on tourism (Simmons 1944; Hogsette et
al. 1981; Dukes & Hallmon 1984; Hogsette et al.
1987; Jones et al. 1991).
The major control effort is targeted against
adult fly populations because stable fly larval
habitats are not present along the beaches. Aeri-
ally applied insecticides provide only temporary
control and are constrained by prevailing
weather conditions. Moreover, public concern and







Cilek: Stable Fly Attraction to Colored Boards


environmental issues associated with area-wide
application of pesticides within or near coastal
ecosystems is increasing. Methods that minimize
the application of pesticides while allowing indi-
viduals to manage biting pests in their immediate
environment may be advantageous. This study
was initiated to evaluate the attractiveness of col-
ored corrugated plasticized boards covered with
adhesive, as traps, against adult stable flies on
Florida panhandle beaches.

MATERIALS AND METHODS

This study was conducted on a sandy beach on
the Gulf of Mexico (Panama City Beach), Bay
County, Florida where stable flies often congregate
after the passage of cold fronts. Corrugated plasti-
cized boards, 67.3 cm length by 31.7 cm height
(Aluma Panel, Cumming, GA), were evaluated as
trapping surfaces. Plastic boards were used be-
cause they were easily obtainable and would re-
tain their rigidity in the high humidity and winds
of coastal environments. Each board was com-
posed of two outer smooth surfaces sandwiched be-
tween an inner series of parallel grooves and
ridges (referred to here as "ribbing") to strengthen
the material. Red, blue, orange, and 3 types of
white (i.e., horizontal ribbing or vertical ribbing,
visible through the boards when held up to a
bright light, and opaque no visible ribbing) were
obtained from the manufacturer. These colors
were chosen for testing based on previous work by
Agee and Patterson (1983), Waldbillig (1968), Wil-
liams (1973), Ruff (1979), and Mihok et al. (1995).
Evaluation of ribbing orientation on the white
boards corresponded to work conducted by Pickens
(1991) with electrocution grids. He recorded that
flies were attracted to high-contrast, narrow
width, multiple-edge patterns. The red, blue, and
orange boards were horizontally ribbed in order to
prevent buckling by winds on the beach. The rib-
bing was not visible through those panels.
Boards were completely covered with a thin,
approximately 0.3 cm3, film of brushable Tangle-
trap Insect Coating@ (Tanglefoot, Grand Rapids,
MI) and placed vertically about 60 cm from the
ground surface in slotted 5 cm by 5 cm by 122 cm
wooden stakes. Stakes were placed 30 m apart in
an east to west linear transect parallel to the
shoreline approximately 50 m from the water's
edge. Each board faced north-south (i.e., into the
wind) with the longest edge parallel with the
ground.
From September 18 through November 14,
during 1996 and 1998, boards were set out when
stable flies were observed on the beaches, usually
within 24 h after passage of a cold front with sus-
tained northerly winds. After 24 h, the total num-
ber of flies on each side of the board was counted
separately and recorded. Boards were randomly
placed along the transect and used once for each


24 h collection period. The 24-hr collection period
used 3 of each color and type of board for a total of
18 panels. Wind speed was monitored using an
electronic anemometer (Turbo MeterF, Ben
Meadows Co., Atlanta, GA) and averaged 9.3 + 0.3
km/hr while wind direction during testing was
primarily north-northwest.
Reflectance measurements of the colored boards
used a USB 2000 Fiber Optic Spectrophotometer
(Ocean Optics, Inc., Dunedin, FL) a UV2 UV-Vis
detector, 1.2 mm lens, 25 um slit, and its bundled
software that reads from 200 to 850 nm. A 12 volt
tungsten bulb was attached to the top of an
acrylic plastic box, 3 cm away from and angled at
35 degrees to a horizontal surface containing the
flat sample (10 cm square). A fiber optic cable was
set 3 cm away from the same flat sample, and an-
gled 35 degrees to it, pointed at the center of the
light spot produced by the tungsten bulb. The ref-
erence standard was black polyester cloth, and
the sample measurements were subtracted from
the intensities recorded for this standard from
400 to 850 nm using Excel and a laptop PC.

Statistical Analyses

The mean number of flies per color and side,
per year, was transformed via Ix + 1 before anal-
ysis and subjected to analysis of variance (SAS
Institute 1990). No significant interaction be-
tween year and panel color was observed for data
collected during both years (F = 0.45; df 5, 492; P
= 0.814). Therefore, data were summarized by
color. In addition, no significant interaction be-
tween year and panel surface was observed for fly
collection data from leeward and windward board
surfaces (F = 0.07; df 5, 984; P = 0.996). Data were
pooled and compared by board surface. Mean sep-
aration of fly data from board surface, by color,
used Student-Neuman-Keuls (P < 0.05), whereas
Student's t (P < 0.05) was used to compare overall
fly numbers on leeward and windward board sur-
faces (Sokal & Rohlf 1981). The overall data set
consisted of 14 collection days for each year.

RESULTS AND DISCUSSION

Significantly more stable flies were collected
from blue boards compared with orange or the 3
types of white boards (Table 1). There was no dif-
ference between the number of flies on the blue or
red boards. Also stable fly abundance on red, or-
ange, and the three types of white boards did not
differ from each other. Flies on white boards with
horizontal or vertical ribbing were not signifi-
cantly different, nor did the opacity of the board
increase collections. Spectral analyses revealed
that the reflectivity of blue boards peaked at 503
nm, at 638 nm for red, at 630 nm for orange and
opaque, while the white horizontal and vertical
ribbed boards peaked at 632 nm (Fig. 1). Blue ex-







Florida Entomologist 86(4)


TABLE 1. COMPARISON OF MEAN STABLE FLY (SE) ABUN-
DANCE ON ADHESIVE-TREATED PLASTICIZED
CORRUGATED BOARDS OF VARIOUS COLORS AND
ORIENTATIONS ON A FLORIDA PANHANDLE
BEACH ALONG THE GULF OF MEXICO.

Mean no. flies
Treatment n (SE)

Blue 84 209.7 23.4 a
Red 84 194.6 27.9 ab
White (opaque) 84 125.9 16.2 b
White (horizontal ribbing) 84 120.2 17.2 b
White (vertical ribbing) 84 123.6 17.4 b
Orange 84 125.6 20.4 b
Overall board orientation
Board facing leeward side 504 116.0 7.0 A
Board facing windward side 504 33.9 2.7 B

"Means followed by the same letter are not significantly dif-
ferent (>0.05) using Student-Newman-Keuls test (for lower
case letters) or t-test (for upper case letters).


3500



3000



2500



2000



1500


hibited the lowest reflectance intensity compared
with the rest of the other colors.
Stable fly preference for variously colored and
reflective surfaces have been reported by a vari-
ety of workers. Williams (1973) showed that
translucent Alsynite panels were more effective
at capturing stable flies than panels painted ei-
ther red or black. Ruff (1979) found white flat
panels of the same material were most attractive
while horizontally corrugated gold panels were
least attractive. Cilek (2002) reported that un-
painted inflated beach balls (with blue, yellow,
red, and white diamond-shaped panels) covered
with adhesive were more attractive than solid
white, black or black/white balls. Mihok (2002a)
reported that cloth traps with vertical blue and
black contrasting surfaces appeared to attract
S.'r.,,.. spp. in Kenya. Also traps composed of
pure cotton dyed with phthalogen blue, that ex-
hibited low reflectance at a peak wavelength of
466 nm, would be the ideal for attracting these
species (Mihok 2002b).


1000 blue red



500



0


Wavelength (nm)

Fig. 1. Spectral reflectance curves of various colors and types of plasticized corrugated boards.


December 2003







Cilek: Stable Fly Attraction to Colored Boards


Agee and Patterson (1983) cited several au-
thors who felt that some species of biting flies
landed preferentially on low-reflective surfaces
rather than on certain colors. Later, Allan et al.
(1987) stated that host-seeking stable flies were
attracted to low-intensity wavelengths ranging
from 360 nm [UV] to 550 nm [blue-green]. This
explained the reason why S. calcitrans collections
were greatest on blue boards. It is unknown why
the blue and red boards were not significantly dif-
ferent when collection abundance was compared.
Although these two colors substantially differed
in intensity and wavelength reflectance peaks,
greater variation occurred between these fly col-
lections than collections from the rest of the col-
ored boards.
Each board probably provided leeward wind-
breaks that allowed flies to land and remain
perched in the windy environment. In fact, stable
fly abundance was significantly greater on the
leeward side of boards compared with the wind-
ward side (Table 1). Broce et al. (1991) reported
that stable flies often oriented, and preferably
landed, on the leeward side of objects. But just as
importantly, these panels may have provided ver-
tical platforms for adult stable fly assembly,
thermoregulation, and/or mating (Buschman &
Patterson 1981).
It was not the intent of this study to examine
stable fly trapping efficiency of the colored boards
with that of a trap standard (e.g., Alsynite cylin-
ders [Broce 1988]). However, because the Alsynite
cylinder is a standard method to sample stable
flies it may be of interest to compare the flies
caught per cm2 of both traps in similar habitats.
Cilek (2002) reported that adhesive-treated Al-
synite cylinders placed on northwest Florida
beaches caught an average of 0.004 0.001 flies
per cm2 while the colored boards, in this study, av-
eraged 0.070 0.004 flies per cm2.
Adhesive-treated plasticized corrugated boards
proved to be a quick and inexpensive way to trap
stable flies in the coastal environs. This type of
board is readily available in a variety of sizes and
colors from local print and office supply sources so
that the general public could fabricate this trap to
reduce annoyance from host-seeking flies.
Whether this trap would be useful to reduce sta-
ble flies on beach and other recreational areas, or
animal facilities, warrants further investigation.


ACKNOWLEDGMENTS

I thank Mary Ann Olson and Jamie Coughlin for
their assistance in data collection. Special appreciation
is extended to Dave Carlson, USDA, Center for Medical,
Agricultural, and Veterinary Entomology, Gainesville,
for conducting the spectral analyses. This study was
conducted under research/collecting permits 08239621
and 98073111 from the Florida Department of Environ-
mental Protection, Division of Recreation and Parks.


REFERENCES CITED

AGEE, H. R., AND R. S. PATTERSON. 1983. Spectral sen-
sitivity of stable, face, and horn flies and behavioral
responses of stable flies to visual traps (Diptera:
Muscidae). Environ. Entomol. 12: 1823-1828.
ALLAN, S. A., J. F. DAY, AND J. D. EDMAN. 1987. Visual
ecology of biting flies. Ann. Rev. Entomol. 32: 297-316
BROCE, A. B. 1988. An improved Alsynite trap for stable
flies, Stomoxys calcitrans (Diptera: Muscidae). J.
Med. Entomol. 25: 406-409.
BROCE, A. B., J. R. SCHWENKE, AND K. E. HAMPTON.
1991. Landing pattern of stable flies (Diptera: Mus-
cidae) on the Alsynite cylinder trap: effect of wind
speed and direction. J. Med. Entomol. 28: 730-733.
BUSCHMAN, L. L., AND R. S. PATTERSON. 1981. Assembly,
mating, and thermoregulating behavior of stable flies
under field conditions. Environ. Entomol. 10: 16-21.
CILEK, J. E. 2002. Attraction of beach ball decoys to
adult Stomoxys calcitrans (Diptera: Muscidae). J.
Med. Entomol. 39: 127-129.
DUKES, J. C., AND C. F. HALLMON. 1984. Laboratory
tests for control of adult stable flies. J. Florida Anti-
Mosq. Assoc. 55: 6-9.
HOGSETTE, J. A., J. P. RUFF, AND C. J. JONES. 1987. Sta-
ble fly: biology and control in northwest Florida. J.
Agric. Entomol. 4: 1-11.
HOGSETTE, J. A., J. P. RUFF, AND M. J. MCGOWAN. 1981.
Stable fly integrated pest management (IPM) in
northwest Florida. J. Florida Anti-Mosquito Associa-
tion 52: 48-52.
JONES, C. J., J. A. HOGSETTE, R. S. PATTERSON, D. E.
MOLINE, G. D. PROPP, J. F. MILIO, L. G. RICKARD,
AND J. P. RUFF. 1991. Origin of stable flies (Diptera:
Muscidae) on west Florida beaches: electrophoretic
analysis of dispersal. J. Med. Entomol. 787-795.
KING, W. V., AND L. G. LENERT. 1936. Outbreaks of Sto-
moxys calcitrans L. ("dog flies") along Florida's
northwest coast. Florida Entomol. 19: 32-39.
MIHOK, S. 2002a. The development of a multipurpose
trap (the Nzi) for tsetse and other biting flies. Bull.
Entomol. Res. 92: 385-403.
MIHOK, S. 2002b. Biting flies-the Nzi trap. http://infor-
matics.icipe.org/nzi/index/htm (accessed June 18,
2003)
MIHOK, S., E. K. KANG'ETHE, AND G. K. KAMU. 1995.
Trials of traps and attractants for Stomoxys spp.
(Diptera: Muscidae). J. Med. Entomol. 32: 283-289.
NEWSON, H. D. 1977. Arthropod problems in recreation
areas. Ann. Rev. Entomol. 22: 333-353.
PICKENS, L. G. 1991. Battery-powered electrocuting
trap for stable flies (Diptera: Muscidae). J. Med. En-
tomol. 28: 822-830.
RUFF, J. P. 1979. Trapping effectiveness of several combi-
nations of colors and textures of sticky traps for stable
flies, Stomoxys calcitrans. Mosq. News 39: 290-292.
SAS INSTITUTE. 1990. SAS procedures guide, version 6,
3rd ed. SAS Institute, Cary, NC.
SIMMONS, S. W. 1944. Observations on the biology of the
stable fly in Florida. J. Econ. Entomol. 37: 680-685.
SOKAL, R. R., AND F. J. ROHLF. 1981. Biometry, 2nd ed.
Freeman, San Francisco, CA.
WALDBILLIG, R. C. 1968. Color vision of the female sta-
ble fly, Stomoxys calcitrans. Annals Entomol. Soc.
America. 61: 789-791.
WILLIAMS, D. F. 1973. Sticky traps for sampling popula-
tions of Stomoxys calcitrans. J. Econ. Entomol. 66:
1279-1280.







Florida Entomologist 86(4)


VISUAL RESPONSES OF LYGUS LINEOLARIS AND LYGOCORIS SPP.
(HEMIPTERA: MIRIDAE) ON PEACHES

ANA LEGRAND AND LORRAINE LOS
Department of Plant Science, University of Connecticut, Storrs, CT 06269

ABSTRACT

The visual response of Lygus lineolaris (Palisot de Beauvois) and insects in the genus Lygo-
coris to pink and white sticky traps was evaluated in a peach orchard. Pink traps signifi-
cantly captured more tarnished plant bugs. For the entire season, the mean (S.E)number
ofL. lineolaris per trap was 1.29 0.064 for pink traps and 0.72 0.067 for white traps. In
contrast, both trap colors performed similarly in their average timing of capture and ability
to track the occurrence of fruit injuries. Unlike L. lineolaris, few Lygocoris insects were cap-
tured and no difference was detected between captures from each trap color.

Keywords: Tarnished plant bug, sticky traps, catfacing insects

RESUME

La respuesta visual de Lygus lineolaris (Palisot de Beauvois) y de insects del g6nero Lygo-
coris hacia trampas pegajosas de color rosado y blanco fue evaluada en un huerto de du-
razno. Las trampas rosadas capturaron significativamente mas chinches deslustrados de
plants. En la estaci6n entera, el numero promedi6 ( S.E.) de L. Lineolaris por trampa fue
1.29 0.064 para las trampas y rosadas 0.72 0.067 para las trampas blancas. En contrast,
ambos colors de pas trampas dieron resultado similares en el promedio del tiempo de la cap-
tura y la abilidad para rastrear la ocurrencia del dano en las frutas. Al contrario de L. line-
olaris, pocos insects del g6nero Lygocoris fueron capturados y ninguna diferencia en el
numero de insects capturados en cada color de trampa fue detectada.


One of the pest problems encountered by peach
growers is the complex of'catfacing' insects which
includes the tarnished plant bug Lygus lineolaris
(Palisot de Beauvois), Lygocoris spp. and several
species of stink bugs. Insects in this complex can
cause serious fruit injury, they are highly mobile
and difficult to monitor (Hogmire 1984). The feed-
ing injuries on fruit cause fruit deformation, scar-
ring, water-soaked areas and gummosis (Rings
1958). The most abundant catfacing insect is
L. lineolaris which is a serious pest of several cul-
tivated plants, having a host range of over 120
plant species in 30 plant families found in the
U.S. (Snodgrass et al. 1984). It reproduces and
overwinters in weedy groundcover, hedgerows or
fields adjacent to peach orchards. Adults move
into the orchard in the spring. Feeding by this in-
sect can cause blossom and fruit drop from bloom
to about 30 days after bloom (Rings 1958). Other
Hemiptera reported to feed on peaches include in-
sects in the genus Lygocoris. Lygocoris spp. and
the tarnished plant bug produce similar types of
injury (Rings 1958). Species in this group include
Lygocoris quercalbae (Knight) (the white oak
plant bug), Lygocoris caryae (Knight) (the hickory
plant bug) and Lygocoris omnivagus (Knight).
These species closely resemble each other and are
usually referred to as oak-hickory bugs (LeFevre
1984; Leahy 1991).


Guidelines exist on how to readily monitor L. lin-
eolaris in apples using white sticky traps (Prokopy
et al. 1980; Prokopy et al. 1982; Coli et al. 1985), but
similar information is lacking for peach growers
concerned about tarnished plant bugs and oak-hick-
ory bugs. Thus, we investigated the visual response
of tarnished plant bugs and oak-hickory bugs to two
sticky trap colors. Compared to direct counts, limb
jarring and net sweeps, sticky traps have been
shown to be the most effective method of detecting
L. lineolaris adults (Prokopy et al. 1982; LeFevre
1984) and Lygocoris spp. (LeFevre 1984). We com-
pared pink and white sticky traps for two reasons.
First, previous work in Connecticut (LeFevre 1984)
and in Massachusetts (Leahy 1991) indicated that
pink sticky traps may be useful in monitoring Lygo-
coris spp. Traps painted with Pink Tiara (Pitts-
burgh Paints Co.) gave the most consistent results
as compared to other colors tested (LeFevre 1984).
Second, while some extension publications state
that white sticky traps could be used for L. line-
olaris monitoring in peaches, Hogmire (1995) noted
that white traps have been used without success in
peach orchards. The objective of this work was to
test the response of both tarnished plant bugs and
Lygocoris bugs to the aforementioned trap colors. In
addition, we collected data on the fruit injury ob-
served throughout the season to determine how
well trap catches tracked injury occurrence.


December 2003







Legrand & Los: Visual Responses of L.lineolaris


MATERIALS AND METHODS
Trap Color Evaluation
The experiment was carried out in two sections
of a commercial orchard. One section was located
in a block of 4 year old trees and the second sec-
tion in a block of 14 year old trees. Rows in the
younger block were planted to the varieties 'Red
Haven' and 'Harbelle Bailey'. The variety in the
older block was 'Jersey Queen'. Experimental sec-
tions, which were located on the periphery of the
block, did not receive insecticide applications but
received only applications of sulfur as a fungicide.
Twelve trees were selected for the experiments in
each section. Traps were hung vertically on
branches in the canopy approximately at 1.8-2 m
high for the old trees and 1.5-1.6 m high for the
young trees. Traps were placed at this height be-
cause traps placed higher in the tree canopy have
been shown to capture more oak-hickory bugs
than traps placed at a lower height (LeFevre
1984). The canopy was divided into quadrants ac-
cording to NE, NW, SE, and SW orientation. One
trap was placed per quadrant and the same num-
ber of pink and white traps were used for each ori-
entation. Thus, every tree started with 2 white
and 2 pink traps. Due to branch pruning early in
the season, two trees retained only one trap of
each color in the canopy. White traps were pur-
chased from Gempler's (Belleville, WI) and pink
traps were made by painting the same plastic sub-
strate used in Gempler's white sticky traps (16 x
19.8 cm). The plastic rectangles were painted with
Pittsburgh Paints' Pink Tiara (Pittsburgh, PA)
and then covered with Tangle-Trap sticky coating
(Tangle Foot Co., Grand Rapids, MI). Pink Tiara
has similar spectral reflectance pattern as peach
petals with a peak at 435-440 nm, lower reflec-
tance in the yellow green range and with a second
highest peak around 610nm (LeFevre 1984).
Traps were checked weekly and any L. line-
olaris or Lygocoris bugs were removed and taken to
the laboratory for removal of sticky material and
identification. Removal of Tangle-Trap was accom-
plished by rinsing the specimens in BioShield cit-
rus paint thinner (EcoDesign Co., Santa Fe, NM).
Traps were cleaned of insects or were changed as
needed. Traps were set out on April 21 (before petal
fall) and monitoring of traps stopped well after har-
vest time on September 9, 1999. In addition to
weekly trap inspections, the presence of stink bugs
was determined through limb jarring because ex-
tremely few were being caught by the traps. This
was done to assess the presence of these other 'cat-
facing' insects. Each week, 6 trees without traps re-
ceived three limb strikes with a rubber-coated rod
and a beating sheet received any dislodged insects.
Fruit Injury Inspections
At the same time the traps were inspected,
damage to fruit was recorded as follows. Just af-


ter shuck-split on May 20, ten fruit per tree were
randomly selected and marked by placing a
wooden clothespin on the same branch as the
fruit. Pins were placed far enough away from the
fruit so there would be little interference to the
insects. Five fruit were at a height level of 1.8-2 m
and 5 others were at a lower level of 1-1.3 m in the
old trees. In the young trees, fruit were selected
irrespective of height since the canopy was more
compact. Compass coordinates were randomly
generated and used to select the fruit around the
tree. These same 10 fruit per tree were inspected
weekly to determine the presence of new injuries.
Damage to fruit was classified according to the
size of the injury as follows: pin holes, punctures,
large holes and catfacing deformation. As the
fruit grew, pin hole injuries usually turned to
punctures and eventually became holes on the
fruit. Fruit inspections stopped before harvest
time on August 3.
Statistical Analysis
Data from trap captures were checked for nor-
mality and homogeneity of variances. The data
for tarnished plant bug and Lygocoris spp. cap-
tures were transformed using the transforma-
tions log,1 and a log,1 (x + 1) respectively. To
determine trap color effect on insect captures,
trap data were analyzed using Proc GLM (SAS
Institute 2000). Trap captures were classified ac-
cording to trap color, orientation, tree on which
the trap hung, and orchard block. The analysis
took into consideration that each tree had two
traps of the same color tested and trees were
treated as a fixed effect to control for any differ-
ences associated with the trees. Data were aggre-
gated over all sampling dates and the means for
each tree were analyzed. Preliminary analysis
showed no difference in the results from each or-
chard block, thus the data were pooled into one
analysis.
A second analysis was performed to determine
if trap color influenced the average time to insect
capture. If one trap color captured more insects
but was delayed in detecting them it would not be
very useful. The average time of insect capture
was calculated by determining when during the
field season each insect was captured (e.g., the
first weekly sampling corresponded to day 7 after
traps were set out) and considering the total num-
ber of insects caught through the season. These
data were analyzed using Proc GLM (SAS Insti-
tute 2000) and were not transformed.
Data from the various categories of fruit inju-
ries were summed into one variable to give the to-
tal number of injuries for each fruit on a given
sample day. Means were obtained for each sample
date and weekly increments were calculated to
determine how well trap captures tracked these
increments. Fruit injury increments reflect only
the new injuries appearing in any given week. In







Florida Entomologist 86(4)


addition, these data were used in a partial Spear-
man rank correlation analysis where the fruit in-
jury observed in the tree was correlated to the
trap captures (L. lineolaris and Lygocoris spp.) on
that tree. The partial analysis adjusted for the
two different orchards sections used.

RESULTS

Both pink and white traps performed well in
capturing tarnished plant bugs during the whole
season. Figure 1 shows the mean number of L.
lineolaris captured weekly for each trap color. The
two traps show the same seasonal trends but pink
traps significantly captured more insects (Table
1). The mean number of tarnished plant bugs cap-
tured per pink trap was 1.29 0.064 and that of
white traps was 0.72 0.067. In addition to trap
color, trap orientation and tree on which the trap
hung had significant effects on L. lineolaris trap
captures. The traps in the NE, NW, SE and SW
quadrants captured an average of 1.28 0.09,
0.81 + 0.09, 1.18 0.09 and 0.74 0.09 L. line-
olaris, respectively. We also found a significant in-
teraction between orientation and trap color. The
differences in trap captures between the two col-
ors were not as large in the NE and SW quadrants


as compared with the SE and NW quadrants.
However, pink traps consistently had larger
mean captures of tarnished plant bug across
quadrants. Trap captures of Lygocoris were not
influenced by trap color (Table 1). Very few Lygo-
coris were captured throughout the season and
this may be preventing a clear assessment of trap
color effect. Lygocoris spp. were caught between
June 3 and August 3 and the mean number cap-
tured weekly per trap was 0.05 0.007 for pink
traps and 0.03 0.007 for white traps. With the
exception of the tree effect, other sources of vari-
ation listed in Table 1 did not have a significant
effect on the mean number of Lygocoris captured.
Sticky traps captured very few stink bugs and
limb-jarring sampling detected few and not until
the end of the season. Also, very few L. lineolaris
and no Lygocoris were captured using this samp-
ling method.
In addition to testing the effect of trap color on
the number of tarnished plant bug captures, we
also examined which trap color detected insects
earlier. Both trap colors had a similar average
time for all L. lineolaris captures (F = 0.27; df =
1,64; P = 0.61). The mean in days was 77.9 1.09
for pink traps and 78.6 1.09 for white traps.
Trap orientation also did not have a significant


4/28 5/6 5/13 5/20 5/27 6/3 6/10 6/17 6/24 7/1 7/8 7/15 7/22 7/29 8/3 8/12 8/19 8/26 9/2 9/9

Date


4

4-
2
0)


c






0-
n
c-
3 E





(D
2 E

E
C


E


_c


Fig. 1. Weekly trap captures of tarnished plant bug Lygus lineolaris (Palisot de Beauvois) as influenced by pink
(-*-) or white (-o-) sticky trap color. Weekly increments in fruit injury through the season (-+-) are also
shown.


December 2003







Legrand & Los: Visual Responses ofL.lineolaris


TABLE 1. RESULTS OF ANOVA FOR THE EFFECTS OF TRAP COLOR, ORIENTATION AND TREE FROM WHICH THE TRAP HUNG
ON THE NUMBER OF TARNISHED PLANT BUG (TPB) Lygus lineolaris (PALISOT DE BEAUVOIS) AND Lygocoris
SPP. CAPTURED BY TRAPS.

TPB Lygocoris spp.

Source of variation df F P F P

Orientation 3,61 9.54 <0.0001 0.53 0.6637
Trap color 1,61 42.56 <0.0001 3.36 0.0715
Tree 23,61 4.04 <0.0001 1.71 0.0492
Orientation x color 3,61 3.92 0.0127 0.23 0.8760


effect on average time of captures (F = 2.01; df =
3,64; P = 0.12). Captures by both trap colors
tracked very well the pattern of fruit injury occur-
rence through the season. Early in the season
when none or few plant bugs were captured, no
injuries were detected on the fruit (Fig. 1). Then,
as the number of insects captured increased, the
number of injuries per fruit rose as well. On July
1, when both traps showed a peak in insect cap-
tures we also observed a peak in injuries per fruit.
The tree by tree correlation analysis showed that
trap captures on a given tree did not correlate
well to the amount of fruit injury observed on the
tree. Correlation coefficients were 0.39 (P = 0.07)
for white traps and 0.35 (P = 0.11) for pink traps.

DISCUSSION

The results of this project indicate that visual
traps should be considered for monitoring tar-
nished plant bug in peach orchards. Visual traps
have been shown to be an effective monitoring
method for thrips (Gillepsie & Vernon 1990;
Childers & Brecht 1996), flea beetles (Adams &
Los 1986) and apple blotch leafminers (Green &
Prokopy 1986). In apples, white sticky traps have
been useful for determining if tarnished plant
bug populations are sufficiently great to merit in-
secticide application (Prokopy et al. 1987) and for
detection of other mirid species present in apple
orchards (Boivin et al.1982). In addition, they are
very practical because they also work well in
monitoring the European apple sawfly (Owens &
Prokopy 1978).
Pink Tiara was a trap color selected by LeFe-
vre (1984) because its spectral reflection pattern
closely mimicked the color of peach flower petals.
Our results show that this color is highly attrac-
tive to L. lineolaris but it is difficult to assess why
this is happening. When most insects were
trapped, all of the petals were gone and only de-
veloping fruit were present. Thus, the color did
not mimic any particular peach resource for the
insect. Developing fruits have a spectral reflec-
tance pattern more similar to leaves (LeFevre
1984) and fruit did not start turning pink until
the end of July or August. Although no significant


differences were found among several colors
tested, LeFevre's (1984) work indicated that L.
lineolaris tended to be attracted by light colors
such as gloss white and yellows over dark colors
such as red and black. A similar result was ob-
served by Prokopy et al. (1979) where L. lineolaris
were attracted to traps painted gloss white, Zn
white, Zoecon Yellow and to clear plexiglass. Zn
white and gloss white traps were considered su-
per normal mimics of apple bud and blossom re-
flectance patterns. Because L. lineolaris was also
captured in clear plexiglass in numbers compara-
ble to the light colors, Prokopy et al. (1979) con-
cluded that this insect does not specifically orient
to colors mimicking those of apple structures.
Nevertheless, L. lineolaris is exhibiting some
color discrimination since they were captured
more often by light color traps (Prokopy et al.
1979; LeFevre 1984) and they preferred pink over
white traps. It may be possible that the pink traps
captured more insects because they provided a
better visual contrast against the peach foliage.
The response by Lygocoris spp. to the two colors
could not be determined because too few were
caught to discern any trap color effect. Neverthe-
less, both trap colors were useful in detecting
their presence through the season.
Although L. lineolaris is more attracted by the
pink colored traps, white and pink traps perform
similarly in other aspects. Both trap colors have
similar average times of insect capture and both
tracked well the timing of fruit injury. White or
pink trap captures in a given tree did not corre-
late well with the fruit injuries observed in that
tree probably due to the high vagility of L. line-
olaris and Lygocoris insects. This result confirms
the utility of these visual traps because there is
less concern that, for example, a trap will only re-
flect insect activity in its host tree. This quality is
desirable in common orchard situations where
one trap monitors a large area. For instance, the
recommended use of sticky traps to monitor tar-
nished plant bug in apple orchards is at least one
trap per 3 acres (Coli 2003). Further evaluation of
pink traps should be done in order to assess their
effectiveness in integrated pest management pro-
grams for L. lineolaris in peach orchards.











ACKNOWLEDGMENTS

We are grateful to John Lyman and Lee Servadio
from Lyman Orchards for kindly facilitating use of the
orchard and for coordinating their many activities with
our schedule. We credit Christine Palmer, Sophie Collin-
Duval and Tracy Van Rye for their great assistance in
the field and in processing the samples. Also, we thank
Martin Kulldorff for statistical advice and the anony-
mous reviewers for their valuable comments. This
project was funded through the University of Connecti-
cut IPM Program.

REFERENCES CITED

ADAMS, R., AND L. LOS. 1986. Monitoring adult corn flea
beetles (Coleoptera: Chrysomelidae) in sweet corn
fields with color sticky traps. Environ. Entomol. 15:
867-873.
BOIVIN, G., R. K. STEWART, AND I. RIVARD. 1982. Sticky
traps for monitoring phytophagous mirids (Hemi-
ptera: Miridae) in apple orchard in southwestern
Quebec. Environ. Entomol. 11: 1067-1070.
CHILDERS, C. C., AND J. K. BRECHT. 1996. Colored sticky
traps for monitoring Frankliniella bispinosa (Mor-
gan) (Thysanoptera: Thripidae) during flowering cy-
cles in citrus. J. Econ. Entomol. 89: 1240-1249.
COLI, W. M., T. A. GREEN, T. A. HOSMER, AND R. J.
PROKOPY. 1985. Use of visual traps for monitoring
insect pests in the Massachusetts apple IPM pro-
gram. Agric. Ecosystems Environ. 14: 251-265.
COLI, W. 2003. New England Apple Pest Management
Guide. Cooperative Extension Publication for the
New England states.
GILLEPSIE, D. R., AND R. S. VERNON. 1990. Trap catch of
western flower thrips (Thysanoptera: Thripidae) as
affected by color and height of sticky traps in mature
greenhouse cucumber crops. J. Econ. Entomol. 83:
971-975.
GREEN, T. A., AND R. J. PROKOPY. 1986. Visual monitor-
ing trap for the apple blotch leafminer moth, Phyl-
lonorycter crataegella (Lepidoptera: Gracillariidae).
Environ. Entomol. 15:562-566.


December 2003


HOGMIRE, H. 1984. Insect monitoring in West Virginia
peach orchards. Horticultural News 64:10-13.
HOGMIRE, H. 1995. Mid-Atlantic Orchard Monitoring
Guide. Northeast Regional Agricultural Engineering
Service, Publication 75. Cooperative Extension Ser-
vice, Ithaca, NY.
LEAHY, K. 1991. Catfacing by oak and hickory plant
bugs in Massachusetts peach orchards. Fruit Notes
56:7-9. University of Massachusetts.
LEFEVRE, V. F. 1984. Development of monitoring tech-
niques for plant bugs (Hemiptera: Miridae) that
cause catfacing damage to peaches in Connecticut.
MSc. Thesis. University of Connecticut.
OWENS, E. D., AND R. J. PROKOPY. 1978. Visual monitor-
ing trap for European apple sawfly. J. Econ. Ento-
mol. 71: 576-578.
PROKOPY, R. J., R. G. ADAMS, AND K. I. HAUSCHILD.
1979. Visual responses of tarnished plant bug adults
on apple. Environ. Entomol. 8: 202-205.
PROKOPY, R. J., W. M. COLI, R. G. HISLOP, AND K. I.
HAUSCHILD. 1980. Integrated management of insect
and mite pests in commercial apple orchards in Mas-
sachusetts. J. Econ. Entomol. 73:529-535.
PROKOPY, R. J., G. HUBBELL, R. G. ADAMS, AND K. I.
HAUSCHILD. 1982. Visual monitoring trap for tar-
nished plant bug adults on apple. Environ. Entomol.
11: 200-203.
PROKOPY, R. J., S. L. BUTKEWICH, AND T. A. GREEN.
1987. Timing the tarnished plant bug: a tale of frus-
tration. University of Massachusetts. Fruit Notes
52(2): 20-24.
RINGS. R. W. 1958. Types and seasonal incidence of
plant bug injury to peaches. J. Econ. Entomol. 51: 27-
32.
SAS INSTITUTE. 2000. SAS/STAT User's Guide: Statis-
tics, Version 8. SAS Institute, Cary, NC.
SNODGRASS, G. L., W. P. SCOTT, AND J. W. SMITH. 1984.
Host plants and seasonal distribution of the tar-
nished plant bug (Hemiptera: Miridae) in the Delta
of Arkansas, Louisiana, and Mississippi. Environ.
Entomol. 13: 110-116.


Florida Entomologist 86(4)







Persad & Hoy: Laboratory Culturing ofLysiphlebus testaceipes


MANIPULATION OF FEMALE PARASITOID AGE ENHANCES LABORATORY
CULTURE OF LYSIPHLEBUS TESTACEIPES (HYMENOPTERA: APHIDIIDAE)
REARED ON TOXOPTERA CITRICIDA (HOMOPTERA: APHIDIDAE)

ANAND B. PERSAD AND MARJORIE A. HOY
Department of Entomology and Nematology, University of Florida
P.O. Box 110620, Gainesville, FL 32611- 0620

ABSTRACT

Cultures of the endoparasitoid Lysiphlebus testaceipes Cresson (Hymenoptera: Aphidiidae)
on the brown citrus aphid, Toxoptera citricida Kirkaldy (Homoptera: Aphididae), previously
have been reported to be difficult to establish. In this study, L. testaceipes colonies were ini-
tiated from parasitized brown citrus aphids obtained from field-collected citrus foliage in
Florida and successfully maintained for >25 generations in the laboratory. To enhance col-
ony rearing methods, several aspects of the parasitoid's biology were examined. An evalua-
tion of foraging by single or multiple females determined that the presence of multiple
females did not influence mean progeny yield per female. However, the mean number of
progeny produced by mature (25-49 and 49-73 h) L. testaceipes females was higher than that
produced by younger (1-25 h) females over a 24-h period. In all three parasitoid age classes,
each reared on second-, third- or fourth-instar aphid hosts, significantly more mummies con-
taining L. testaceipes formed on a paper coffee filter covering the soil surface compared to the
number of mummies formed on citrus foliage. Mummy formation off foliage has not been re-
ported for this aphid-parasitoid complex in citrus. Mated females of L. testaceipes with ac-
cess to honey and water and without access to aphids or honeydew lived longer than females
that had access to aphid hosts and honeydew. These data provide novel findings on the biol-
ogy of L. testaceipes when parasitizing the brown citrus citrus, particularly on mummifica-
tion sites, and allowed us to develop a protocol for routine large-scale rearing of L. testaceipes
on brown citrus aphids on citrus.

Key Words: Lysiphlebus testaceipes, Toxoptera citricida, laboratory cultures, host instar, cit-
rus

RESUME

Las crias de el endoparasitoide Lysiphlebus testaceipes (Cresson) (Hymenoptera: Aphidiidae)
sobre el afido de citricos de color caf6, Toxoptera citricida Kirkaldy (Homoptera: Aphididae),
previamente han sido reportada dificiles de establecer. En este studio, colonies de L. testa-
ceipes fueron iniciadas de afidos de citricos de color caf6 parasitados obtenidos del follaje de
citricos recolectado en el campo y exitosamente mantenidos por >25 generaciones en el labo-
ratorio. Para mejorar los m6todos de cria de la colonia, various aspects de la biologia del pa-
rasitoide fueron examinados. Una evaluaci6n del forraje de hembras individuals o hembras
multiples determine que la presencia de hembras multiples no tuvo influencia sobre el pro-
medio de progenie por hembra. Sin embargo, el numero promedio de progenie producido por
hembras de L. testaceipes maduras (25-49 y 49-73 h) fue mas alto de lo que fu6 producido por
hembras mas jovenes (1-25 h) en un period de 24-h. En todas las tres classes de edad del pa-
rasitoide, cada cria en afidos hospederos en el segundo-, tercero- o cuatro-estadio, significa-
tivamente mas momias contenian L. testaceipes formado sobre un papel filtro de caf6 que
cubria la superficie del suelo compararada con el numero formado sobre el follaje de citricos.
La formaci6n de las momias no puestas sobre el follaje no ha sido reportado para este com-
plejo de afido-parasitoide. Hembras de L. testaceipes apareadas con acceso a miel y agua y sin
acceso a los afidos o a la miel del rocio vivieron mas tiempo que las hembras con acceso a los
afidos hospederos o a la miel del rocio. Estos datos proven descubrimientos nuevos sobre la
biologia de L. testaceipes en la parasitizaci6n del afido de citricos de color caf6, particular-
mente en los sitios de momificaci6n, y nos permitieron desarrollar un protocolo para la cria
rutinaria en gran escala de L. testaceipes sobre el afido de citricos de color caf6 en los citricos.


The brown citrus aphid, Toxoptera citricida control program for the brown citrus aphid, the
Kirkaldy (Homoptera: Aphididae), currently oc- endoparasitoid Lipolexis oregmae (Gahan) (=
curs on citrus throughout Florida where it is an scutellaris Mackauer, Miller et al. 2002) (Hy-
efficient vector of citrus tristeza virus (CTV) menoptera: Aphidiidae) was imported from Guam
(Costa & Grant 1951). In a classical biological and released in citrus groves throughout Florida







Florida Entomologist 86(4)


(Hoy & Nuygen 2000). Another aphid parasitoid,
Lysiphlebus testaceipes Cresson (Hymenoptera:
Aphidiidae), already occurs in Florida and also
has been recorded parasitizing brown citrus
aphids (Michaud 1999; Yokomi & Tang 1996).
Existing accounts on the biology of L. testa-
ceipes on brown citrus aphid are scarce; Carver
(1984), Yokomi & Tang (1996), Michaud & Brown-
ing (1999) and Persad & Hoy (2003) have dealt
specifically with this aphid-parasitoid complex.
The biology of L. testaceipes on other aphid spe-
cies is better known and include: Schuster &
Starks (1975), Stary et al. 1988, Stadler & Volkl
(1991), Volkl & Stadler (1991), Grasswitz & Paine
(1992), Vansteenis (1994), Stechmann et al.
(1996), Pike et al. (1997), Fernandes et al. (1997,
1998), Elliot et al. (1999), Rodrigues et al. (2001),
Rodrigues & Bueno (2001), Gonazales et al.
(2002), Tang et al. (2002).
Previous studies were conducted to determine
whether competition with L. testaceipes would af-
fect establishment of L. oregmae in Florida (Per-
sad & Hoy 2003). The intra- and interspecific
interactions of both parasitoids on the brown cit-
rus aphid were investigated in the laboratory and
the data obtained suggest that L. testaceipes
would not exclude L. oregmae during interspecific
interactions and so may not affect its establish-
ment in Florida. To conduct these competition
studies, cultures of L. oregmae were maintained
on brown citrus aphids on potted citrus in the lab-
oratory using the method of Hill (2002), Walker
(2002) and Hill & Hoy (2003). However, no protocol
for rearing L. testaceipes on brown citrus aphids on
citrus existed, so several attempts were made to
initiate cultures from field-collected parasitoids.
Some researchers have reported that L. testa-
ceipes is not easily cultured in the laboratory on
brown citrus aphids. Carver (1984) was unsuc-
cessful in rearing L. testaceipes on this host in the
laboratory in Australia and considered oviposi-
tion by L. testaceipes in brown citrus aphids as an
'egg trap' because parasitism rates were high but
adult emergence was low. Michaud & Browning
(1999) failed to establish colonies ofL. testaceipes
on brown citrus aphid in Puerto Rico, even when
parasitoids were used that were derived from
brown citrus aphid populations exhibiting high
rates of emergence of L. testaceipes adults.
This study describes the initiation and contin-
ued propagation ofL. testaceipes colonies on brown
citrus aphid in the laboratory for >25 generations
after initial failures to establish thriving colonies.
In an effort to understand the initial failures and
to standardize a laboratory rearing system, sev-
eral evaluations were conducted. To determine the
nutrient requirements of adult L. testaceipes, sur-
vivorship of adult parasitoids with and without
nutrients and the longevity of newly emerged fe-
males when allowed access to aphids and honey-
dew was evaluated. To resolve whether competing


L. testaceipes females affected progeny yield in
cages, the mean number of progeny produced per
female in colonies initiated from single females
versus yield when the aphids were exposed to mul-
tiple (6) females, was evaluated. The relationships
between female parasitoid age, mating status and
aphid host stage on mummy location and progeny
production also were investigated.

MATERIALS AND METHODS

Initiation of Laboratory Cultures of L. testaceipes
on Brown Citrus Aphid on Potted Citrus

Brown citrus aphids were collected from young
citrus foliage obtained from citrus groves in 15
counties in Florida between August and Decem-
ber 2001. Approximately 350 L. testaceipes adults
were collected from field populations and used to
initiate cultures. Care was taken to ensure that
the collected aphids consisted solely of brown cit-
rus aphids using the guidelines provided by Hal-
bert & Brown (1996). Some of the leaves had
mummified brown citrus aphids, indicating the
presence of parasitoids. All collected foliage was
held between crumpled sheets of absorbent paper
in air-inflated plastic bags in the laboratory at 22-
24C, 55-65% RH and 16:8 h light:dark cycle. Con-
densation in each bag was wiped off twice daily.
Under these conditions, citrus foliage could be
maintained for 8 to 10 days, allowing parasitized
aphids that were not yet mummified to be held
sufficiently long to obtain adult L. testaceipes.
This holding system allowed greater numbers of
adult L. testaceipes to be collected than is obtained
if only mummies are sampled.
Adult parasitoids that emerged were exam-
ined under the stereomicroscope. Apart from two
species of hyperparasitoids, L. testaceipes was
identified, using the guidelines of Evans & Stange
(1997), as the only primary parasitoid emerging
from field-collected brown citrus aphids. Emer-
gence of L. testaceipes occurred mostly in the
morning and adults were collected at 800, 1200 h
daily by aspirator into 6 x 1.5 cm plastic vials.
Groups of up to 20 parasitoids that emerged on
the same day were held together in similar vials.
Honey-saturated paper strips and moistened cot-
ton was supplied within each vial and these were
supplied whenever parasitoids were stored.
Mating pairs always were observed within 1 h
of introducing parasitoids into the vials. Six pre-
sumably mated females were introduced into a 60
x 60 x 60 cm mesh (size 40/ mm2) cage which con-
tained six potted citrus plants; each plant was in-
fested with 200 to 250 brown citrus aphids of
mixed instars. Water was provided on a moist cot-
ton pad on the cage top and honey strips were at-
tached to the upper corners of each cage. Adult
L. testaceipes progeny emerging 9 to 10 d later
were collected by aspirator and the cycle was re-


December 2003







Persad & Hoy: Laboratory Culturing ofLysiphlebus testaceipes


peated. In addition, parasitoid cultures were ini-
tiated with single L. testaceipes females in cages
containing individual potted plants. Progeny
from both culture systems were released into a 35
x 35 x 35 cm plexiglass cage to mix before re-in-
troduction to cultures in an effort to preserve
their genetic diversity.
The identity ofL. testaceipes from our cultures
was confirmed by Peter Stary, Institute of Ento-
mology, Academy of Sciences, Czech Republic.
Specimens ofL. testaceipes were deposited at the
Florida Department of Agriculture and Consumer
Services, Division of Plant Industry, Gainesville,
as voucher specimens 2002- 1742- 901. Cultures
were routinely screened by extracting random
samples upon emergence and observing these
specimens under the dissecting microscope to en-
sure that only L. testaceipes were present in our
rearing cages. All parasitoid adults used to start
cultures were screened to confirm identity and es-
tablish sex ratios before introduction into cages
with aphid-infested citrus plants.
The use of recently emerged female parasi-
toids (24 h or less) to initiate colonies resulted in
similar numbers of progeny as that of the L. testa-
ceipes parents and hence colonies did not increase
in size. It was observed that when older (24- to 30-
h-old) females were used, more progeny were ob-
tained. To obtain mature females, all newly
emerged L. testaceipes of both sexes (approx. 6:
ratio of 1:1.5, and 25 to 30 individuals) were
stored in 6 x 1.5 cm plastic vials for 24 to 30 h be-
fore allowing them access to aphids.
Inspections of mummies located on citrus foli-
age in these laboratory colonies revealed that
most were still intact, with no emergence holes.
Surprisingly, the numbers of mummies on foliage
with exit holes were considerably lower than the
numbers of adults obtained in the cages. Because
L. oregmae was found to produce mummies on the
soil surface when reared on brown citrus aphid
(Hill 2002; Walker 2003; Hill & Hoy 2003) we ex-
amined the cages containing L. testaceipes and
mummies containing L. testaceipes were noticed
on the soil surface. To confirm that the excess
L. testaceipes adults were coming from mummies
on the soil surface, paper coffee filters were placed
around the base of the potted plants. Parasitized
aphids were observed walking or falling down to
the base of the plant 5 to 6 d after adult L. testa-
ceipes had been introduced into the cages and the
mummies formed were sometimes firmly attached
to the coffee filters. To quantify and confirm these
results, and to develop a suitable rearing system
for L. testaceipes on the brown citrus aphid, we
conducted the following experiments.
Effect of Nutrients on Survival (days) ofL. testaceipes
Adults
Survival in days of L. testaceipes reared on
brown citrus aphid was unknown, so adults were


held with or without nutrients and survivorship
was determined. Mummies of brown citrus
aphids containing L. testaceipes were collected
from both citrus foliage and the coffee filter on the
soil surface and placed individually in gelatin
capsules (size 00). Emerging adult L. testaceipes
were allowed to mate and were placed singly in 6
x 1.5 cm plastic vials, which contained a piece of
fluted paper. Parasitoids were either offered no
nutrients, water in moist cotton, pure honey on
paper strips (0.75 x 2.5 cm) or both water and
honey strips. Fifteen parasitoids of each sex were
examined in each treatment.
To determine the effect of oviposition on lon-
gevity, 15 mated L. testaceipes females were
housed in individual vials. These were allowed ac-
cess to an excess of aphids (approx. 100 of mixed
stages) on citrus foliage. The foliage was inserted
into each vial and replaced every 12 h so that
these female parasitoids had access to aphid hon-
eydew, honey strips and water. Observations were
made daily and a record of mortality kept. Com-
parisons of survival times of parasitoids that
were not allowed to oviposit were made by
ANOVA and LSD using Statview ver. 5.0 (SAS In-
stitute 1999).
Effects of Using Young and Mature L. testaceipes
Females on Total Parasitoid Progeny Production
in Single vs Multiple (6) Parasitoid Culture Systems
Because Shekar (1956) had reported that
L. testaceipes reared onAphis gossypii Glover pro-
duced maximum progeny per day when mature (3
d), we compared total offspring produced by young
and mature L. testaceipes reared on brown citrus
aphid. Also, we compared total progeny produced
per female in two culture systems to determine if
competition/ interference during host seeking by
multiple L. testaceipes females occurred.
Brown citrus aphid mummies containing
L. testaceipes were collected from both coffee fil-
ters and citrus foliage from colony cages and
stored individually in size 00 gelatin capsules in
the laboratory. Ten female L. testaceipes were al-
lowed to mate with one-d-old males upon emer-
gence and a single female was introduced into
each of 10 mesh (size 40/ mm2) (60 x 60 x 60 cm)
cages within one h of emergence (young females).
Mating occurred readily and generally lasted
from 40 to 80 sec. Each cage contained six potted
citrus plants each infested with 200 to 250 brown
citrus aphids of mixed stages. Ten mated L. testa-
ceipes females also were initially kept in vials for
24 h (mature females, 25-h-old) in the laboratory
before introducing them individually into each of
ten similarly prepared mesh cages. For evalua-
tions of multiple females, mated young (1-h-old)
L. testaceipes females were introduced into each
often mesh cages in groups of six and this was re-
peated using mature (25-h-old) females. Both
young and mature parasitoids were provided with







Florida Entomologist 86(4)


honey and water and were allowed to remain in
the cage until death.
Mean total progeny obtained from cages in
which single parasitoid females were introduced
was compared to the mean produced by each fe-
male in a cage with 6 females and comparisons
also were made between total progeny produced
by young females and mature females in both cul-
ture systems (1 vs 6). These data were arcsine
transformed and analyzed by ANOVA, using Stat-
view ver. 5.0 (SAS Institute 1999) at the 5% sig-
nificance level.

Effect of Age and Mating Status of L. testaceipes
Females Over a 24-H Period on Mummy Location
and Adult Parasitoid Emergence

To resolve the effects of female parasitoid age
and mating status on mummy location and prog-
eny, the following experiment was conducted. The
trial was conducted for 24 h because the survivor-
ship data indicated that ovipositing females only
lived for an average of 1.4 d. Plastic wrap was
placed around the base of a potted flushing citrus
plant (24 cm tall) and taped around the base of
the plant stem to form a barrier to aphids migrat-
ing down the stem toward the soil. A circular pa-
per coffee filter was slit and placed on top of the
wrap and secured in place with 3M Scotch tape.
Forty alate brown citrus aphids were placed using
a damp sable hair-brush (size 000) onto young
leaves of a potted citrus plant and left for 24 h.
Alates were removed and the first-instar (L1)
aphids present were allowed to molt to the third
instar (L3); this stage was used to standardize
possible variation in progeny production because
of aphid size. Excess L3 aphids were removed to
leave 100 L3 aphids on the plant, which was then
covered with a plexiglass cylinder (13 cm diame-
ter and 45 cm tall) with mesh tops and side win-
dows. Plants prepared in this way did not require
water for the duration of the experiments.
On emergence (usually between 900 and 1100
h), 10 female parasitoids were randomly collected
and allowed to mate with one-day males (because
younger males did not mate as readily) in 4 x 1 cm
glass vials. After mating (<1 h), a single L. testa-
ceipes female was introduced onto each of 10
plants. Each plant was pre-infested with 100 L3
T citricida and the parasitoid was left on the
plant for 24 h (1-25 h age class). Citrus infested
with L3 brown citrus aphids yielded mummies
which were located on both foliage and the coffee
filter by day 6 after introducing L. testaceipes.
Mummies were collected from both locations, la-
beled as to source and held individually in size 00
gelatin capsules until emergence.
Ten L. testaceipes females were held individu-
ally in vials for 24 h and allowed to mate (as de-
scribed above); each was then introduced
individually into cages containing citrus with L3


T citricida and left for 24 h (25-49 h age class). Ten
L. testaceipes females also were similarly treated
and allowed to mate, but held for 48 h before intro-
duction into cages containing plants for 24 h (49-
73 h age class). All female L. testaceipes were in-
troduced into the test cylinders between 1000 and
1200 h. Ten replicates of each of the three parasi-
toid age groups were evaluated for mummy loca-
tion and total adult L. testaceipes progeny.
The experiment was repeated using virgin
L. testaceipes females for each of the age classes (1-
25, 25-49 and 49-73 h). Trials in which the parasi-
toid had died or could not be found after 24 h in all
experiments were discarded. Mummies found on
foliage and on the paper coffee filter (soil) were
counted and transferred on the tip of a dampened
hairbrush individually to gel capsules. The number
of mummies and the percentage adult eclosion
from both locations were recorded for each age
group. Data were arc-sine transformed before anal-
ysis using the Students t-test (SAS Institute 1999).

Effect of T citricida Host Instar on L. testaceipes
Mummy Location and Percentage Adult Emergence

To resolve the effects of host instar on mummy
location and adult emergence, we kept the age of
females constant and tested all four instars of
brown citrus aphid. Each of 10 potted citrus plants
was infested with 100 L1, L2, L3 or L4 T citricida
by allowing the L1 to molt to the desired stage. A
mated L. testaceipes female that was 24 to 30 h old
was then introduced into each of 10 potted citrus
plants containing each host instar and covered
with a plexiglass cylinder. The plants were left in
the laboratory for 24 h, after which the parasitoid
was located and removed. Trials in which the par-
asitoid died or could not be found were not used in
further analyses. The number of L. testaceipes
mummies and adults emerging at each location
(foliage versus soil surface) were recorded for each
aphid stage tested and percentage adult emer-
gence was determined. Data were analyzed as de-
scribed in the preceding section.

RESULTS AND DISCUSSION

Effect of Nutrients on Survival (days) ofL. testaceipes
Adults

Adults of both sexes lived significantly (P <
0.05) longer when given both water and honey
strips (Table 1). The data suggest that L. testa-
ceipes needs both free water and an energy source
for optimal survival. Mated females (data not
shown and treated separately), when provided
with water and honey and allowed constant ac-
cess to aphids, lived a mean (SD) of 1.4 (1.3) d
(N = 15), which was comparatively shorter than
mated females that were not allowed to oviposit
(mean SD of 3.7 (2.7) days (N = 15). Some fe-


December 2003







Persad & Hoy: Laboratory Culturing ofLysiphlebus testaceipes


TABLE 1. MEAN (S.D.) SURVIVAL (DAYS) OF NEWLY
EMERGED AND MATED L. testaceipes ADULTS.*

Treatment Males Females

No water or honey 1.0 0.8 c1 1.2 1.3 b
Water only 1.6 1.1 b 1.8 1.4 b
Honey only 0.9 0.7 c 1.4 0.5 b
Water and honey 2.8 2.6 a 3.7 2.7 a

*At 22-24C, 55-65% RH and16:8 h photoperiod. Means fol-
lowed by the same letters within a column are not significantly
(P > 0.05) different by ANOVA and LSD.


males died while still attempting to oviposit and
the urge for newly emerged adults to oviposit till
death may have contributed to the failure of our
initial colonies.

Effects of Using Young and Mature L. testaceipes
Females on Total Parasitoid Progeny Production
in Single vs Multiple (6) Parasitoid Culture Systems

Young females produced equal numbers (F =
0.02, df = 19, P = 0.88, n = 10, ANOVA) of total
progeny whether introduced into cages as single
females (Mean + SD = 6.5 3.6) or groups of six
(4.7 3.8). Total L. testaceipes progeny produced
per mature female in which single (27.4 12.8) or
multiple (31.3 + 14.7) females were introduced
were not significantly different (F = 1.08, df = 19,
P = 0.31, n = 10, ANOVA). These data suggest that
competition/interference during host seeking by
multiple L. testaceipes females may not have a
significant effect on progeny yield when aphids
are abundant.
However, younger L. testaceipes females (1-25
h after emergence) produced significantly fewer
(6.5 3.6) progeny compared to mature females
(27.4 12.8) (F = 53.8, df = 19, P = 0.0001, n = 10,


ANOVA) in single-female cultures. Likewise, in
multiple-female cultures, young females also pro-
duced significantly fewer progeny (4.7 3.8) per
female when compared to mature females (31.3
14.7) (F = 54, df = 19, P < 0.0001, n = 10, ANOVA).
This deficit in total progeny production by
younger females may have been a contributing
factor to the low yields in our initial cultures
when females were allowed access to aphids im-
mediately upon emergence. It is common, when
rearing short-lived aphid parasitoids, to intro-
duce newly emerged females into cages as soon as
possible in order to optimize their reproductive
potential (Hill 2002; Walker 2002; Hill & Hoy
2003), but when rearing L. testaceipes on the
brown citrus aphid this is counter productive.
Weisser (1994) observed that older Lysiphlebus
cardui Marshall (Hymenoptera: Aphidiidae) fe-
males produced significantly more progeny than
younger females when reared onAphis fabae Sco-
poli (Homoptera: Aphididae); he attributed this to
increased patch residence time by older females.

Effect of Age and Mating Status of L. testaceipes
Females Over a 24-H Period on Mummy Location
and Adult Parasitoid Emergence

Significantly (P < 0.05) more mummies con-
taining L. testaceipes were located on the paper
coffee filter located on the soil surface and signif-
icantly (P < 0.05) more adults emerged from those
mummies whether mated or unmated females
were used (Table 2). Mated L. testaceipes females
produced more adult progeny if exposed to hosts
when they were 25-49 or 49-73 h old than the fe-
males in 1-25 h age class. Virgin and mated fe-
males produced the maximum number of progeny
if they were in the 25-49 h age interval. Shekar
(1956) observed maximum oviposition in L. testa-
ceipes reared onA. gossypii on day 3, when para-


TABLE 2. NUMBER OF MUMMIES AND PERCENTAGE OF L. testaceipes ADULTS PRODUCED BY MATED AND VIRGIN FE-
MALES IN THREE AGE CLASSES* IN A 24 H PERIOD ON L3 BROWN CITRUS APHIDS.

Mean S.D. number of mummies on Mean S.D. percentage adults closing from

Foliage Coffee filter P value Foliage Coffee filter P value

Mated
1-25** 2.3 1.8 b 19.4 + 5.7 a' <0.0001 20.5 20.1 b 68.5 18.8 a 0.0012
25-49 6.1 2.5 b 37.6 15.9 a 0.0001 3.3 20.9 b 76.3 11.3 a <0.0001
49-73 6.9 4.5 b 28.6 14.7 a 0.0020 25.1 + 22.8 b 73.3 22.3 a 0.0056
Virgin
1-25 1.1 1.0 b 9.4 + 3.6 a 0.0007 6.4 5.2 b 55.5 15.0 a <0.0001
25-49 1.2 1.1 b 19.8 + 6.4 a 0.0002 8.1 + 6.9 b 75.8 17.4 a <0.0001
49-73 2.5 1.5 b 8.6 4.3 a 0.0003 5.5 6.8 b 59.0 17.2 a <0.0001

*When 100 L3 brown citrus aphids are exposed to parasitoids at 22-24C, 55-65% RH and 16:8 h photoperiod.
*Three holding intervals (h) used after adult emergence to produce the three age classes.
Means + S.D followed by the same letters in a row are not significantly different by Students t-test (SAS Institute 1999).







434 Florida Entomologist 86(4) December 2003


sitoids were allowed access to aphids for one-h
periods on 3 consecutive days. This suggests that
mature females ofL. testaceipes also may produce X 51
more progeny when utilizing other aphid hosts. c. .
Mated L. testaceipes females produced signifi- 0
cantly more mummies and progeny than virgin
females in all three age classes (Table 2, F =
13.54, df = 59, P = 0.03, n = 10 ANOVA). Although | 1 C 1
virgins of some parasitoid females may produce c 6 d 5 s
fewer progeny compared to mated females, in +1 +1 +1 +1
other parasitoid species the reverse may occur, or X O c c
progeny yield may not differ (Godfray 1994).
Michaud (1994) reported that virgin and mated
females of L. testaceipes had similar parasitism r O ci
rates on Aphis fabae Linneaus, while Shekar c
(1956) recorded that virgin females of L. testa- q +i +i +i +i
ceipes took from 2 to >30 times longer to begin ovi- C s
position in Aphis gossypi and had reduced
fecundity. These combined reports suggest that
oviposition behavior in L. testaceipes may be in-
fluenced by aphid species. U =
0+ 00+
Effect of T citricida Host Instar on L. testaceipes v
Mummy Location, Percentage Adult Emergence
H
There was no significant (P > 0.05) difference,
in the number of mummies containing L. testa- 5 O
ceipes located on foliage and on the coffee filter z +1 +1 +1 +1
when first instar (L1) brown citrus aphids were 6 0 -
parasitized by L. testaceipes (Table 3). However, o
significantly (P < 0.05) more mummies formed on < +
the coffee filter than on foliage for all other T cit- r
ricida instars tested (L2, L3 and L4) (Table 3). c 1 -i
The percentage of adult L. testaceipes emerging +1 +1 +1 +1
from mummies located on the coffee filter was sig-
nificantly (P < 0.05) higher than on the foliage for & C I
all instars of brown citrus aphids tested (Table 3).
Mean percentage ofL. testaceipes female progeny
that emerged from L1 and L4 hosts on foliage was t C c 0
not significantly different to that observed on the 8 8
coffee filter; however, significantly more females
emerged from mummies of L2 and L3 aphid hosts
on the coffee filter than on the foliage (Table 3).
Generally, more female parasitoids than males are
produced from larger aphid hosts (Godfray 1994) o
and our data are consistent with this because L4 -
hosts produced more females than males whether + +1 +1 +1
they formed on the foliage or on the coffee filter. m I c cd
However, the observation that mummies on foliage | ci
originating from L2 and L3 aphid hosts produce a +1
male-biased sex ratio (66-70%) while mummies on r
the coffee filter from these same-sized hosts pro- + +I +I +1
duce female-biased sex ratio (27-38% males) is in- r
teresting and needs further evaluation. '
The mean number of mummies containing L.
testaceipes that occurred on the foliage was not
significantly different from that observed on the <
coffee filter when L1 hosts were parasitized (Ta- b
ble 3). However, L2, L3 and L4 hosts produced sig- 6
nificantly more mummies on the coffee filter than
on foliage (Table 3). Dissection of uneclosed mum- 1 X -







Persad & Hoy: Laboratory Culturing ofLysiphlebus testaceipes


mies from citrus foliage in 0.8% saline under a
dissecting microscope revealed many dead late-
instar larvae, prepupae, or pupae ofL. testaceipes.
Stary (1989) termed this phenomenon 'incom-
plete parasitization'. In our study, mummies on
the foliage produced higher rates of incomplete
parasitization (73-85%) compared to that ob-
served from mummies on the coffee filter (5-56%).
Factors which cause more L1 hosts to produce
mummies on foliage and mummies that exist on
foliage to have greater rates of incomplete para-
sitism and a male-biased sex ratio are unknown.
Mummy location in Lipolexis oregmae also has
been studied in the laboratory (Hill 2002;, Walker
2002; Hill & Hoy; 2003). Lipolexis oregmae mum-
mifies on (or in) the soil and mummy location is
independent of brown citrus aphid instar. Mum-
mification on (or in, because coffee filters would
prevent movement of aphids into the soil) the soil,
however, has not been described previously for
L. testaceipes reared on brown citrus aphid on cit-
rus in Florida. The mechanism controlling move-
ment of parasitized aphids to areas where there is
greater chance of predation or fungal infections is
unknown (Godfray 1994). Chow and Mackauer
(1999) reported that the percentage of mummifi-
cation off the plant of the aphid Acyrthosiphon
pisum (Harris) when parasitized by Ephedrus
californicus (Baker) varied with aphid density.
However, the location of brown citrus aphid mum-
mies containing L. testaceipes does not appear to
be dependent on aphid host density. When brown
citrus aphids, in densities of 40 or 200, were par-
asitized by single L. testaceipes females in labora-
tory trials (data not shown) a mean ( SD)
percentage of 60.2 (13.2) and 71.3 (17.4), respec-
tively, were produced on the coffee filter (P = 0.28,
n = 10, Students t-test).
Mummy location also was investigated in a cit-
rus grove adjacent to the Department of Entomol-
ogy and Nematology, University of Florida,
Gainesville, in fall 2001 and spring and summer of
2002. Young citrus foliage was infested with 200-
250 brown citrus aphids of mixed stages and were
covered with mesh sleeves. When a single female
L. testaceipes was allowed access to these aphids,
mummies were formed off the foliage in signifi-
cantly higher quantities than on the foliage. Pot-
ted citrus plants in mesh cages also were placed in
the grove and produced similar results (Persad &
Hoy, unpublished data). This suggests that move-
ment of brown citrus aphids containing L. testa-
ceipes to the soil is not restricted to laboratory
colonies. Thus, these results indicate that analysis
of parasitism by L. testaceipes of brown citrus
aphid in the field in Florida should not be limited
to examining the mummies occurring on foliage.
In field evaluations in Puerto Rico, Yokomi &
Tang (1996) concluded L. testaceipes is an ineffec-
tive parasitoid of the brown citrus aphid because
they observed an emergence rate of ca. 4.0% from


mummies located on field-collected citrus foliage.
Michaud (1999) also commented on the low occur-
rence of emergence holes in mummies located on
citrus terminals and observed that, despite the
ubiquitous presence of L. testaceipes, rates of par-
asitism were generally too low to affect brown cit-
rus aphid populations. Despite these negative
evaluations of L. testaceipes as a parasitoid of the
brown citrus aphid, our data suggest parasitism
by L. testaceipes may be more extensive in citrus
in Florida than previously recognized.

Rearing Protocol

The data in Tables 1 and 3 indicate that
younger L. testaceipes females produce fewer
progeny and often die shortly after being allowed
constant exposure to aphids. In contrast, female
parasitoids produced more progeny if their expo-
sure to aphids was delayed for at least 24 h; it is
unknown whether this effect is behavioral or
physiological. This information is, however, cru-
cial to the following guidelines for initiating and
maintaining cultures of L. testaceipes on the
brown citrus aphid:
Hold newly emerged adult parasitoids in vials
with access to water and honey for 24 h before
they are allowed access to aphids. Six potted cit-
rus plants (prepared as described above), each in-
fested with 200-250 brown citrus aphids of mixed
instars, will yield 32 to 150 adult L. testaceipes
(Mean SD = 85 61, n = 17 culture cages) when
6 mated mature (24-30-h-old) females are allowed
to parasitize their hosts until death. This protocol
was used in summer 2002 to initiate 5 separate
L. testaceipes cultures from field-collected citrus
foliage infested with brown citrus aphid. Success-
ful and expanding cultures resulted in all cases
and populations increased within one generation
using this protocol, indicating that no genetic se-
lection of this parasitoid was needed to propagate
it on brown citrus aphid.

ACKNOWLEDGMENTS
The authors appreciate the assistance ofRu Nguyen,
A. Jeyaprakash, Alison Walker, Reginald Wilcox and
Justin Harbison. This work was supported in part by
funds from the Davies, Fischer and Eckes Endowment
and TSTAR-Caribbean. This is University of Florida Ag-
ricultural Experiment Station Journal Series R-09001.

REFERENCES CITED
CARVER, M. 1984. The potential host ranges in Australia
of some imported aphid parasites (Hymenoptera: Ich-
neumonoidea: Aphidiidae). Entomophaga 29: 351-360.
CHOW, A. AND M. MACKAUER 1999. Altered dispersal
behavior in parasitised aphids: parasitoid mediated
or pathology. Ecol. Entom. 24: 276-283.
COSTA, A. S., AND T. J. GRANT. 1951. Studies on trans-
mission of tristeza virus by the vector, Aphis citrici-
dus. Phytopathology 41: 105-113.











ELLIOT, N. C., J. A. WEBSTER, AND S. D. KINDLER 1999.
Developmental response of Lysiphlebus testaceipes
to temperature. Southwest Entomol. 24: 1-4.
EVANS, G., AND P. STANGE. 1997. Parasitoids associated
with the brown citrus aphid in Florida (Insecta: Hy-
menoptera) Entomology Circular 384, Florida De-
partment Agriculture and Consumer Services,
Division of Plant Industry, Gainesville.
FERNANDES, O. A., R. J. WRIGHT, AND K. H. BAUMGAR-
TEN. Use of rubidium to label Lysiphlebus testaceipes
(Hym.:Braconidae) a parasitoid of greenbugs (Hom.:
Aphididae) for dispersal studies. Environ. Entomol.
26: 1167-1172.
GODFRAY, H. C. J. 1994. The immature parasitoid, pp.
225-259; In Parasitoids Behavioral and Evolution-
ary Ecology. Princeton University Press, Princeton,
New Jersey.
GONZALES, W. L., E. FUENTES-CONTRERAS, AND H. M.
NIEMEYER 2002. Host plant and natural enemy im-
pact on cereal aphid competition in a seasonal envi-
ronment. Oikos 96: 488- 491.
GRASSWITZ, T. R. AND T. D. PAINE. 1992. Kairomonal ef-
fect of an aphid cornicle secretion on Lysiphlebus
testaceipes (Cresson) (Hym. Aphidiidae). J. Insect
Behav. 5: 447-457.
HALBERT, S. E., AND L. G. BROWN. 1996. Toxoptera citri-
cida Kirkaldy, Brown citrus aphid-identification, biol-
ogy and management strategies. Fla. Dept. Agric. and
Conserv., Div. Plant Industry, Entomol. Cir. No. 374.
HILL, S. 2002. Interactions between the red imported
fire ant, Solenopsis invicta and the parasitoid Li-
polexis scutellaris potentially affecting a classical bi-
ological control agent of Toxoptera citricida. M.S.
Thesis Department of Entomology and Nematology,
University of Florida, Gainesville. 46 pp.
HILL, S. L., AND M. A. HOY. 2003. Interactions between
the red imported fire ant Solenopsis invicta and the
parasitoid Lipolexis scutellaris potentially affecting
a classical biological control agent of the aphid Tox-
optera citricida. Biological Control 27: 11-19.
HOY, M. A., AND R. NUYGEN. 2000. Classical biological
control of brown citrus aphid. Release of Lipolexis
scutellaris. Citrus Industry 81(10): 24-26.
MICHAUD, J. P. 1994. Differences in foraging behavior
between virgin and mated aphid parasitoids (Hy-
menoptera: Aphidiidae). Can. J. Zool. 72: 1597-1602.
MICHAUD, J. P. 1999. Sources of mortality in colonies of
brown citrus aphid Toxoptera citricida. Biocontrol
44: 347-367.
MICHAUD, J. P., AND H. W. BROWNING. 1999. Seasonal
abundance of the brown citrus aphid Toxoptera citri-
cida and its natural enemies in Puerto Rico. Fla. En-
tomol. 82: 425-447.
MILLER, R., K.S. PIKE., AND P. STARY. 2002. Aphid par-
asitoids (Hymenoptera: Aphidiidae) on Guam. Mi-
cronesica 34: 87-103.
PERSAD, A. B., AND M. A. HOY. 2003. Intra- and inter-
specific interactions between Lysiphlebus testaceipes
and Lipolexis scutellaris on Toxoptera citricida. J.
Econ. Entomol. 96: 564-569.
PIKE, K.S., P. STARY, AND T. MILLER. 1997. Small grain
parasitoids (Hym.: Aphelinidae and Aphidiidae) of
Washington: Distribution, relative abundance, sea-
sonal occurrence and key to North American species.
Environ. Entomol. 26: 1299-1311.


December 2003


RODRIGUES, S. M. M., AND V. H. P. BUENO. 2001. Para-
sitism rates of Lysiphlebus testaceipes (Cresson)
(Hym.: Aphidiidae) on Schizaphis graminum (Rond.)
and Aphis gossypii Glover (Hem.: Aphididae). Biol.
Control 30: 625-629.
RODRIGUES, S. M. M., V. H. P. BUENO, AND J. S. S.
BUENO-FILHO. 2001. Development and evaluation of
an open-rearing system for the control of Aphis gos-
sypii Glover (Hem.: Aphididae) by Lysiphlebus testa-
ceipes Cresson (Hym.:Aphidiidae) in greenhouses.
Biol. Control 30: 433-436.
SAS INSTITUTE, INC. 1999. Statview version 5.0. SAS
publishing, Berkeley, CA.
SCHUSTER, D. J., AND K. J. STARKS. 1975. Preference of
Lysiphlebus testaceipes (Cresson) (Hymenoptera:
Aphidiidae) for greenbug (Hem.: Aphididae) resis-
tant and susceptible small grain species. Environ.
Entomol. 4: 887-888.
SHEKAR, P. S. 1956. Mating, oviposition and discrimina-
tion of hosts by Aphidius testaceipes (Cresson) and
Praon Aguti (Smith) primary parasites of aphids.
Ann. Entomol. Soc. Am. 50: 370-375.
STADLER, B., AND W. VOLKL. 1991. Foraging patterns of
two aphid parasitoids, Lysiphlebus testaceipes (Cres-
son) and Aphidius colemani (Hymenoptera: Aphidi-
idae) on banana. Entomol. Exp. Appl. 58: 221-229.
STARY, P. 1989. Incomplete parasitization in aphids and
its role in pest management (Hymenoptera: Aphidi-
idae) Acta Entomol. Bohemoslov. 86: 356-367.
STARY, P., J. P. LYON, AND F. LECANT. 1988. Biocontrol
of aphids by the introduced Lysiphlebus testaceipes
(Cresson) (Hymenoptera: Aphidiidae) in Mediterra-
nean France. J. Appl. Entomol. 105: 74-87.
STECHMANN, D. H., W. VOLKL, AND P. STARY. 1996. Ant
attendance as a critical factor in the biological con-
trol of the banana aphid, Pentalonia nigronervosa
Coq. (Hom.: Aphididae) in Oceania. J. Appl. Ento-
mol. 120: 119-123.
TANG, Y. Q., A. A. WEATHERSBEE, AND R. T. MAYER
2002. Effect of neem extract on the brown citrus
aphid (Hom.: Aphididae) and its parasitoid Lysiphle-
bus testaceipes Cresson (Hym.: Aphidiidae). Environ.
Entomol. 31: 172-176.
VANTEENIS, M. J. 1994. Intrinsic rate of increase of Ly-
siphlebus testaceipes Cresson (Hym. Braconidae), a
parasitoid of Aphis gossypii (Hem.: Aphididae) at dif-
ferent temperatures. Entomol. Exp. Appl. 75: 151-
157.
VOLKL, W., AND B. STADLER 1991. Interspecific larval
competition between Lysiphlebus testaceipes and
Aphidius colemani (Hym.: Aphidiidae). J. Appl. En-
tomol. 111: 63-71.
WALKER, A. M. 2002. Physiological and behavioral fac-
tors affecting parasitism of Toxoptera citricida by Li-
polexis scutellaris. M.S. Thesis, Department of
Entomology and Nematology, University of Florida,
Gainesville.
WEISSER, W. 1994. Age dependent foraging behaviour
and host-instar preference of the aphid parasitoid
Lysiphlebus cardui. Entomol. Exp. Appl. 70: 1-10.
YOKOMI, R. K., AND Y. Q. TANG. 1996. A survey of para-
sitoids of brown citrus aphid (Homoptera: Aphid-
idae) in Puerto Rico. Biol. Control 6: 222-225.


Florida Entomologist 86(4)







Arbogast et al.: Trap Catch of Lasioderma serricorne


LASIODERMA SERRICORNE (COLEOPTERA: ANOBIIDAE):
SPATIAL RELATIONSHIP BETWEEN TRAP CATCH AND DISTANCE
FROM AN INFESTED PRODUCT

R. T. ARBOGAST1, P. E. KENDRA2 AND S. R. CHINI1
'USDA-ARS Center for Medical, Agricultural and Veterinary Entomology, P.O. Box 14565, Gainesville, FL 32604

2USDA-ARS Subtropical Horticultural Research Station, 13601 Old Cutler Road, Miami, FL 33158

ABSTRACT

The cigarette beetle, Lasioderma serricorne (Fabricius), was selected as a representative
stored-product beetle to test the validity of contour mapping of trap catch for pest monitoring
in warehouses and retail stores. Three experiments, each replicated 5 times, were conducted
in a 3.2 x 9.0-m aluminum shed. Each experiment involved releasing beetles at a single point
and recording the numbers captured after 6, 24, and 48 h in each of 14 baited pitfall traps dis-
tributed over the floor of the shed. The experiments differed only with respect to the point of
release. Beetles were released passively from rearing boxes placed at one of 3 release points,
and consecutive contour maps of trap catch tracked their dispersal from each point. As the
beetles dispersed and total trap catch increased, the outlying traps captured increasingly
more insects, but cumulative trap catch remained highest near the release points. The rate
of capture was highest immediately after release and declined with time, rapidly at first and
then more slowly until it became nearly constant. The cumulative numbers captured by any
trap after 6, 24, and 48 h decreased exponentially with distance from the point of release. The
observed spatial patterns of trap catch relative to sources of infestation and the inverse re-
lationship of trap catch to distance from a source support the validity of contour mapping as
a means of monitoring stored-product insects and locating foci of infestation.

Key Words: pest monitoring, trapping, spatial analysis, stored-product insects, cigarette beetle

RESUME

El escarabajo del cigarillo, Lasioderma serricorne (Fabricius), fue seleccionado como un re-
presentante de un escarabajo de products almacenados para probar la validez de un mapa
de contorno de los especimenes capturados en trampas para un monitoreo de los almacenes
y tiendas comerciales. Se realizaron tres experiments, cada uno con 5 replicas, en un cober-
tizo de lauminio de 3.2 x 9.0-m. Cada experiment envolvia liberar los escarabajos en un solo
punto y registrar en numero capturados despu6 de 6, 24, y 48 h en cada una de las 14 tram-
pas con cebo de caida "pitfall" distribuidas sobre en piso del cobertizo. Los experiments va-
riaron solamente con respeto del punto de la liberaci6n.Los escarabajos fueron liberados en
una manera pasiva de las cajas de cria puestos en uno de los tres puntos de liberaci6n, y su
dispersion fue rastreada usando mapas contornos consecutivos de los especimenes captura-
dos en cada punto. Mientras que los escarabajos se disparsaron y el numero total de los es-
pecimenes capturado aument6, las trampas remotas capturaron progresivamente mas
insects, pero el numero acumulativo de los especimenes capturados en las trampas cerca de
los puntos donde fueron liberados permaneci6 en mas alto. La raz6n de la capture fue la mas
alto inmediatamente despu6s de la liberaci6n y baj6 con el tiempo, rapidamente al principio
y luego mas despacio hasta que qued6 casi constant. El numero acumulativo de escarabajos
capturados en cualquier trampa despu6s de 6, 24, y 48 h baj6 exponencialmente segun la dis-
tancia del punto de liberaci6n. Los patrons espaciales observados de los escarabajos captu-
rados en las trampas en relacci6n de las fuentes de infestaci6n y la relaci6n inversa de los
escarabajos capturados a la distancia de la fuente apoya la valid6z de loos mapas contornos
como un medio papa hacer un monitoreo de insects de products almacenados y localizar los
focos de infestaci6n


The cigarette beetle, Lasioderma serricorne wide variety of commodities, including both plant
(Fabricius), is arguably the most ubiquitous of all and animal materials (Howe 1957; LeCato 1978;
stored-product insects. It occurs throughout the Ashworth 1993), and is one of several beetle pests
tropical and subtropical regions of the world, and that commonly infest warehouses and retail
although it is restricted by low temperature and stores (Arbogast et al. 2000, 2002).
humidity, it occurs commonly in warm buildings Regular monitoring for insect pests in build-
throughout the temperate regions. It breeds on a ings, such as rice, flour and provender mills,







Florida Entomologist 86(4)


warehouses, and retail stores, has assumed
greater importance as more emphasis is placed on
integrated pest management. A combination of
trapping and spatial analysis of trap catch by con-
tour mapping has shown considerable promise as
a reliable and practical method of monitoring
(Brenner et al. 1998; Arbogast 2001; Subraman-
yam et al. 2002; Fields & White 2002) and has al-
ready gained some acceptance by the pest control
industry. The value of the method lies in its abil-
ity to locate as well as detect infestation and in
the utility of contour maps for documentation and
communication. The maps provide graphic, easily
understood evidence of insect infestation and the
effectiveness of control intervention. They are
thus of considerable value in communicating in-
sect problems to managers and to maintenance,
sanitation, and pest control personnel.
The method rests on the tacit assumption that
there is a relationship between trap catch (num-
ber captured by a trap in a specified period of
time) and proximity to a source of infestation. Al-
though the results of studies in commercial ware-
houses, processing plants, and retail stores (Rees
1999; Arbogast et al. 2000, 2001, 2002; Campbell
et al. 2002) have supported this assumption, ex-
perimentation in a less complex environment is
needed to verify its validity and to determine the
quantitative nature of the relationship. The
present paper reports the results of such experi-
mentation, using L. serricorne as a representative
stored-product beetle.

MATERIALS AND METHODS

Laboratory cultures of L. serricorne were es-
tablished with adults collected from ground
cumin in a Gainesville, FL household in Decem-
ber 1999. The insects were reared at 27 1C and
60 5% RH with a 12-h photoperiod on a diet of
whole wheat flour (10 parts), white cornmeal (10
parts), and brewers' yeast (1.5 parts). Each cul-
ture was contained in a 0.95-1 mason jar capped
with filter paper over screen.
Experiments were conducted in an aluminum
shed (about 3.2 x 9.0 m) between June and October
2001. The walls and ceiling of the shed were cov-
ered with sheet rock over styrofoam insulation to
moderate temperature changes, and the wooden
floor, which was elevated about 0.25 m above a con-
crete slab supporting the shed, was covered with
asphalt floor tile. Fourteen pitfall traps (Dome
Traps, Trece, Inc., Salinas, CA) baited with ciga-
rette beetle pheromone lures and a food attractant
oil provided with the traps were positioned on the
floor as illustrated in Figs. 1-3. No heating or air
conditioning was used to regulate temperature. Air
temperature at floor level was monitored with
HOBO temperature loggers (HO-001-02, Onset
Computer Corp., Bourne, MA) placed at the trap
sites and set to record temperature at 1-h intervals.


We conducted three experiments, all of which
involved releasing beetles and monitoring trap
catch over a 48-h period. The experiments dif-
fered only with respect to the point of release,
which was either at the center of the shed (Fig. 1),
near the southwest corner (Fig. 2), or near the
northeast corner (Fig. 3). Each experiment was
replicated 5 times. For each replicate (48-h trap-
ping run), 2000 newly emerged adults were col-
lected from cultures (46-47 d old) and divided
equally between 2 plastic boxes (19 x 14 x 9.5 cm),
each containing a shallow layer (about 300 ml) of
the rearing diet. The boxes were placed side by
side on the floor of the shed at one of the release
points, and the lids were removed. All releases
were made between 10:00 and 11:00 am, and the
number of beetles in each trap was recorded after
6, 24 and 48 h. The beetles remaining in the boxes
after 48 h were counted and the number remain-
ing was subtracted from 2000 to obtain the num-
ber that had dispersed. The shed was disinfested
between replicates by removing the plastic boxes
and vacuuming all beetles from the walls, floor
and ceiling. Also, the traps were emptied, cleaned,
and provided with fresh oil, but pheromone lures
were replaced only between experiments. The
HOBOs were launched at the beginning of each
replicate, and temperature data were downloaded
at the end.
The numbers of beetles captured at each trap
site were averaged over the five replicates of each
experiment, and contours of mean trap catch
were drawn for 6, 24 and 48 h using Surfer 8
(Golden Software, Inc., Golden, CO) (Figs. 1-3).
The Multiquadric function (Radial Basis Func-
tions) was used as the interpolation algorithm
with default values of the function parameters R2
(smoothing) and h (anisotropy). Radial Basis
Functions comprise a group of interpolation
methods that attempt to honor data points (that
is, they are exact interpolators). The Multiquad-
ric method is considered by many to be the best in
ability to fit a data set and to produce a smooth
surface (Krajewski & Gibbs 1996; Golden Soft-
ware 2002), and with most small data sets (<250
observations), it produces a good representation
of the data (Golden Software 1999).
Variation in rate of capture with time follow-
ing release was examined by determining the cu-
mulative number of beetles captured in each
replicate 6, 24, and 48 h after release. The totals
were averaged over the 15 replicates, and the re-
gression of mean cumulative total on hours fol-
lowing release was plotted and analyzed (Fig. 4).
The influence of distance from a source of infesta-
tion on numbers of insects captured was exam-
ined by combining the results of the three
experiments, calculating mean trap catch for each
distance, and plotting and analyzing the regres-
sion of mean trap catch on distance 6, 24, and 48
h after release (Fig. 5). The number of observa-


December 2003







Arbogast et al.: Trap Catch of Lasioderma serricorne


<- NORTH


6 HOURS





-5




'\ U,

S'


Of-ii--r1
0 1 2 3


0 1 2 3


METERS FROM LEFT FRONT CORNER
Fig. 1. Contour maps illustrating the changing spatial distribution of Lasioderma serricorne, as indicated by
trap catch 6, 24, and 48 h after the beetles were released at the center of the shed. The release point is indicated by
a solid square and trap positions by solid circles. The contours indicate mean numbers captured (5 replicates).


tions contributing to each mean ranged from 5 to
20. SigmaPlot 2001 (SPSS, Chicago, IL) was used
for all regression analyses.
The mean, minimum, and maximum tempera-
tures at each trap position were determined for
each experiment, and isothermal maps were
drawn to portray spatial variation in temperature
over the floor of the shed. Isothermal analysis was
done with Surfer 8 as already described for con-
tour analysis of trap catch.
Hourly temperature records were used to cal-
culate hourly means, minima, and maxima,
which were then plotted against time of day to il-
lustrate overall diurnal variation during the 15
trapping runs (Fig. 6A). The maximum tempera-
ture difference (temperature range = maximum -
minimum) among trap sites was determined for
each hour of each replicate and used to calculate
the mean, minimum, and maximum hourly
ranges for the 15 replicates combined. These
ranges were then plotted against time of day to il-
lustrate spatial variation and diurnal changes in
spatial variation (Fig. 6B).


Mean, minimum, and maximum tempera-
tures, calculated for each replicate (14 trap sites x
48 hours = 672 temperature records), were used
to examine the association of temperature with
the number of beetles leaving the boxes (dispers-
ing) and with the total number that were cap-
tured. Spearman's rank order correlation
coefficient (R) was calculated for the pooled data
(15 replicates) using SigmaStat 2.03 (SPSS Sci-
ence, Inc., Chicago, IL). Correlation analysis was
chosen because none of the variables were fixed at
a constant level, and all contained sampling vari-
ability. The nonparametric Spearman rank order
correlation was used, because we could not as-
sume bivariate normality and common variance.

RESULTS AND DISCUSSION

Contours of trap catch 6, 24, and 48 h after re-
lease (Figs. 1-3) tracked the dispersal of beetles
from the release point (source of infestation). In-
tuitively, we would expect the probability of cap-
turing an insect at a fixed point in time to


w
Z
n 7-
0

z
I-

0









w
- -
LL
1 4-

u -

S2-

L.
2 1-


1 10
5


L 0
Mean
Number
Captured







Florida Entomologist 86(4)


-- NORTH


0 1 2 3


- 15


--5


U0

Mean
Number
Captured


f 1
0 1


2 3


METERS FROM LEFT FRONT CORNER

Fig. 2. Contour maps illustrating the changing spatial distribution of Lasioderma serricorne, as indicated by
trap catch 6, 24, and 48 h after the beetles were released near the southwest corner of the shed. The release point
is indicated by a solid square and trap positions by solid circles. The contours indicate mean numbers captured (5
replicates).


increase with proximity to a source of infestation.
We would also expect the probability of capture at
a fixed distance from a source to increase with
time. The temporal changes in contour pattern
observed with all three release points were con-
sistent with these expectations. As the beetles
dispersed and total trap catch increased, the out-
lying traps captured more insects, but cumulative
trap catch remained highest near the release
point. This pattern of change in consecutive con-
tour maps simulates temporal changes in contour
pattern that have been observed in retail stores
with infested products (Arbogast et al. 2000). In-
fested products in stores often harbor continu-
ously breeding populations of insects that provide
a more or less constant source of dispersing in-
sects. Placing traps in an infested store is analo-
gous to releasing insects in our shed experiments
after the traps were already in place, but time is
measured from trap placement rather than from
insect release. We have observed that sources
focii) of infestation in stores are first detected by
the closest traps; the number of insects captured


and the area in which the captures occur increase
steadily over time, so that the contour pattern
surrounding a focus intensifies and spreads out-
ward (Arbogast et al. 2000).
We expected the beetles to disperse equally in
all directions unless their freedom of movement
was constrained by the walls of the shed, but this
did not happen. When the beetles were released
at the center of the shed, movement was predom-
inately toward the midpoint of the north wall
(Fig. 1). The same bias in dispersal pattern was
evident when the beetles were released near the
southwest corner (Fig. 2). Although this direc-
tional bias in dispersal from the release point
shows that factors other than proximity to a focus
of infestation can influence trap catch, it did not
render trapping and contour analysis ineffective
as a means of locating these foci. In both cases,
and also when the beetles were released near the
northeast corner (Fig. 3), the greatest number of
beetles captured after 6, 24, or 48 h were captured
by the traps nearest the release point. Although
real world situations are more complex, so that


December 2003







Arbogast et al.: Trap Catch of Lasioderma serricorne


E- NORTH


S15


10


-5


1 0
Mean
Number
Captured


METERS FROM LEFT FRONT CORNER

Fig. 3. Contour maps illustrating the changing spatial distribution of adult Lasioderma serricorne, as indicated
by trap catch 6, 24, and 48 h after the beetles were released near the northeast corner of the shed. The release point
is indicated by a solid square and trap positions by solid circles. The contours indicate mean numbers captured (5
replicates).


locating infestation is more difficult, studies in
commercial warehouses (Arbogast et al. 2002)
and retail stores (Arbogast et al. 2000) have, nev-
ertheless, shown the method to be useful.
The rate of capture in the shed was highest im-
mediately after release of the beetles and declined
with time, rapidly at first and then more slowly un-
til it became nearly constant (Fig. 4). Without fur-
ther research, we can only speculate about the
cause of this initially rapid decline, but we would
expect such a temporal pattern if there were a burst
of dispersal immediately after release, followed by a
decline and eventual stabilization of dispersal at a
much lower rate. The same pattern should also oc-
cur when a trap is first set in an infested building,
such as a pet store, if the rate of capture is posi-
tively correlated with the number of insects avail-
able to be captured. In this case, the rate of capture
would decline as the adult population becomes de-
pleted and would eventually stabilize when recruit-
ment of adults from infested commodities just
balances their removal. In a trapping study of Plo-
dia interpunctella (Hiibner) and various beetles in-


'I 250
a- ass(aos);
. ,
S n = 14.6(1.9)t
i 200 Adj. R= 0.998
F F= 1316, P< 0,01
150

I 100
C-,
2 50


0 10 20 30 40 50
t= Hours After Release
Fig. 4. Variation in rate of capture of adult Lasio-
derma serricorne with elapsed time (t) after release.
Mean cumulative totals (n) are based on all trap sites,
replicates, and experiments combined (210 observa-
tions). Error bars indicate standard errors of the means.
The numbers in parentheses are standard errors associ-
ated with estimates of the parameters a and b in the fit-
ted equation: n = at.







Florida Entomolo


a,
a. 25
En
a,
S20
a,
m 15
0
S 10
E
Z 5
z
c 0
a,

SII
C 40


6-hr Trapping Period

n = 15.7(3.26)e-0.55'0.0102)d
Adj. R2 = 0.721
F =57.7, P< 0.01






1 2 3 4 5 6 7 8 9

S24-hr Trapping Period

n = 25.7(4.65)e-0.310(0068)d










48-hr Trapping Period
Sn = 33.3 (5.42)e-0250(0.056)d
SAdj. R2 = 0.562
F = 29.2, P< 0.01
."












*


1 2 3 4 5 6 7 8 9
d = Distance of Trap from Source (m)

Fig. 5. Relationship between mean number of adult
Lasioderma serricorne per trap (n) and distance (d) of
the traps from a source of infestation (point of release)
after 6, 24, and 48 h. The plots are based on all 3 exper-
iments (points of release) combined. The number of
counts in each mean ranged from 5 to 20. The numbers
in parentheses are standard errors associated with esti-
mates of the parameters a and b in the fitted equation:
n = ae d.



testing pet and department stores, Arbogast et al.
(2000) found that the relationship between days of
trapping and cumulative numbers captured over
periods of 4-5 days was well described by straight
lines. However, these authors noted some evidence
that the rate of capture may actually have de-
creased with time during the first day or two.
The number of beetles (n) that had been cap-
tured by any trap in the shed 6, 24, or 48 h after
release declined as an exponential decay function
of distance (d) from the source of infestation (Fig.
5). The effect of distance on numbers captured be-
came less pronounced with time as the dispersing


gist 86(4) December 2003



35
A
30

25

20

15
Mean
-- Maximum & Minimum
10
06 12 18 00 06 12 18 00 06 12

,-.................. .......... .........


06 12 18 00 06 12 18 00 06 12
Eastem Standard Time
Fig. 6. Variation in temperature on the floor of the
shed with time of day. (A) Mean, minimum, and maxi-
mum temperatures for each hour based on temperature
records for all trap sites, replicates, and experiments
combined (210 records). The maxima and minima for
each time of day are the highest and lowest tempera-
tures recorded for that time over the course of the entire
study. (B) Mean, minimum, and maximum temperature
ranges (differences between trap sites with the highest
and lowest readings) for each time of day. Ranges were
determined for each hour of each replicate, and all rep-
licates were then combined to determine mean, mini-
mum, and maximum ranges for the study. The range of
each temperature statistic can be read from the top of
the shading representing that statistic.



beetles spread out and occupied more of the shed.
Pierce (1994) successfully located infestations of
L. serricorne and pyralid (phycitine) moths using
a triangulation method based on the assumption
(implied although not explicitly stated) that there
is an inverse relationship between trap catch and
the distance of the trap from a source of infesta-
tion. The results of the present study, as well as
Pierce's success in locating infestations, support
the validity of his assumption.
Temperature inside the shed varied over the
course of the study (Fig. 6), but the seasonal range
of variation was apparently insufficient to affect
dispersal of beetles from the point of release, or the







Arbogast et al.: Trap Catch of Lasioderma serricorne


TABLE 1. NUMBERS OF CIGARETTE BEETLES THAT DISPERSED FROM RELEASE SITES AND NUMBERS THAT WERE CAP-
TURED IN PITFALL TRAPS DURING 48-H TRAPPING PERIODS.

Beetles dispersed' Beetles trapped2

Trapping run Total Percentage Total Percentage3

Experiment 1: Beetles released at center of shed
27-29 Jun 1570 78.5 251 16.0
10-12 Jul 1629 81.4 326 20.0
17-19 Jul 1103 55.2 150 13.6
23-25 Jul 1334 66.7 162 12.1
06-08 Aug 1923 96.2 319 16.6
Experiment 2: Beetles released near southwest corner of shed
14-16 Aug 1507 75.4 220 14.6
23-25 Aug 938 46.9 80 8.5
28-30 Aug 1558 77.9 326 20.9
05-07 Sep 1498 74.9 217 14.5
10-12 Sep 976 48.8 297 30.4
Experiment 3: Beetles released near northeast corner of shed
19-21 Sep 838 41.9 142 17.0
24-26 Sep 683 34.2 119 17.4
02-04 Oct 1060 53.0 83 7.8
09-11 Oct 1198 59.9 172 14.4
15-17 Oct 1745 87.2 188 10.8

'Number of beetles out of 2,000 that dispersed from the plastic boxes at the release point during the 48-h trapping run.
Combined number of beetles captured by 14 traps during the 48-h trapping run.
'Of the beetles that dispersed, the percentage that were trapped.


numbers captured. The number of beetles (out of a
possible 2000) that dispersed from the diet during
any 48-h trapping run ranged from 683 to 1923,
and the total number of dispersing beetles cap-
tured by the 14 traps ranged from 80 to 326 (Table
1). Correlation analysis of data pairs for all three
experiments combined showed no significant asso-
ciation between number of beetles dispersed and
mean (R = 0.12, P = 0.67), minimum (R = 0.11, P
= 0.70), or maximum (R = 0.15, P = 0.58) tempera-
ture. Correlation analysis also indicated no signif-
icant association between trap catch and mean (R
= 0.36, P = 0.18), minimum (R = 0.38, P = 0.15), or
maximum (R = 0.35, P = 0.19) temperature. The
temperature range among trap sites varied with
time of day, but the ranges of the means, maxima,
and minima never exceeded 0.4, 1.0, and 2.7C, re-
spectively (Fig. 6B). A frequency distribution of the
temperature ranges for all experiments, replicates
and hours combined (720 ranges) showed that
86.5% were <1.0C and that 99.0% were <1.9C.
Consequently, isothermal maps showed very weak
temperature gradients on the floor of the shed, and
comparison of these maps with contour maps of
trap catch revealed no clear effect of temperature
gradients on movement of the beetles.
Several studies have shown that a combina-
tion of trapping and contour analysis of trap catch
provides a useful, albeit less than perfect, method


for monitoring stored product insects and locating
foci of infestation in buildings such as ware-
houses, mills, and retail stores (Rees 1999; Arbo-
gast et al. 2000, 2001, 2002; Campbell et al.
2002). The spatial pattern of trap catch relative to
sources of infestation indicated by the contour
maps in the present study, and the inverse rela-
tionship of trap catch to distance from the source,
further support the validity of contour mapping
as a method of monitoring stored-product insects
and locating foci of infestation. Although the ac-
tion of one or more factors other than distance
from a source of infestation was evident in two of
the experiments, the highest trap catch, never-
theless, occurred at one of the sites closest to the
source. Campbell et al. (2002), however, noted
that high trap captures in the warehouse portion
of a food processing plant may have resulted from
three distinct factors: proximity to a large infesta-
tion, proximity to a major route of insect move-
ment, and proximity to a major source of
attractive odor. The influence of various factors
(in addition to proximity of infestation) on the
spatial distribution of trap catch clearly needs
further investigation.
Contouring has some advantages over the tri-
angulation method used by Pierce (1994). One
advantage is the utility of contour maps in docu-
menting and communicating insect problems, as











already noted. Another is the fact that traps need
not be arranged in a regular rectangular array as
required by Pierce's method, a requirement that
cannot always be satisfied in commercial settings.
Contouring software employs various algorithms
to create regular arrays of data points by interpo-
lation between irregularly spaced observations,
and contours are then fitted to the interpolated
values at these points. This advantage, however,
is not as great as it may appear at first glance, be-
cause the more widely an arrangement of traps
deviates from a regular rectangular array, the
weaker the agreement between observed and pre-
dicted values at the trap sites. Arbogast et al.
(2003) examined this and other sources of error in
predicting insect distribution by trapping and
contour analysis, and pointed out measures that
can be taken to minimize them.

ACKNOWLEDGMENTS

Melanie Gray and Christopher Samuelson assisted
with many aspects of the study, and we appreciate their
untiring efforts in rearing insects, setting up experi-
ments, making observations, and tabulating data. We
are indebted to S. M. Ferkovich, F. H. Arthur, and two
anonymous reviewers for their critical review of an ear-
lier version of the manuscript and for their helpful sug-
gestions. The use of trade, firm, or corporation names in
this publication is for the information and convenience
of the reader. Such use does not constitute an official en-
dorsement or approval by the United States Depart-
ment of Agriculture or the Agricultural Research
Service of any product or service to the exclusion of oth-
ers that may be suitable.

REFERENCES CITED

ARBOGAST, R. T. 2001. Monitoring for stored product
pests. Pest Control Technology. 29: 74-77.
ARBOGAST, R. T., P. E. KENDRA, S. R. CHINI, AND J. E.
MCGOVERN. 2003. Meaning and practical value of
spatial analysis for protecting retail stores. In P. F.
Credland. (ed.). Advances in Stored Product Protec-
tion, Proceedings of the 8th International Working
Conference on Stored-Product Protection. York, UK
(July 22-26, 2002). CAB International, Wallingford,
UK, in press.
ARBOGAST, R. T., P. E. KENDRA, R. W. MANKIN, AND R.
C. MCDONALD. 2002. Insect infestation of a botani-


December 2003


cals warehouse in north-central Florida. J. Stored
Prod. Res. 38: 349-363.
ARBOGAST, R. T., P. E. KENDRA, R. W. MANKIN, AND
J. E. MCGOVERN. 2000. Monitoring insect pests in
retail stores by trapping and spatial analysis. J.
Econ. Entomol. 93: 1531-1542.
ASHWORTH, J. R. 1993. The biology ofLasioderma serri-
corne. J. Stored Prod. Res. 29: 291-303.
BRENNER, R. J., D. A. FOCKS, R. T. ARBOGAST, D. K.
WEAVER, AND D. SHUMAN. 1998. Practical use of spa-
tial analysis in precision targeting for integrated
pest management. Amer. Entomol. 44: 79-101.
CAMPBELL, J. F., M. A. MULLEN, AND A. K. DOWDY. 2002.
Monitoring stored-product pests in food processing
plants with pheromone trapping, contour mapping,
and mark-recapture. J. Econ. Entomol. 1089-1101.
FIELDS, P. G., AND N. D. G. WHITE. 2002. Alternatives to
methyl bromide treatments for stored-product and
quarantine insects. Annu. Rev. Entomol. 47: 331-359.
GOLDEN SOFTWARE. 1999. Surfer 7 user's guide. Golden
Software, Inc., Golden, CO.
GOLDEN SOFTWARE. 2002. Surfer 8 user's guide. Golden
Software, Inc., Golden, CO.
HOWE, R. W. 1957. A laboratory study of the cigarette
beetle, Lasioderma serricorne (F.) (Col., Anobiidae)
with a critical review of the literature on its biology.
Bull. Entomol. Res. 48: 9-56, 2 pi.
KRAJEWSKI, S. A., AND P. L. GIBBS. 1996. Understand-
ing contouring. Gibbs Associates, Boulder, CO.
LECATO, G L. 1978. Infestation and development by the
cigarette beetle in spices. J. Georgia Entomol. Soc.
13: 100-105.
PIERCE, L. H. 1994. Using pheromones for location and
suppression of phycitid moths and cigarette beetles
in Hawaii-a five-year study, pp. 439-443. In E.
Highley, E. J. Wright, H. J. Banks, and B. R. Champ
(eds.). Stored Product Protection, Proceedings of the
6th International Working Conference on Stored-
Product Protection. Canberra, Australia (April 17-
23, 1994). CAB International, Wallingford, UK.
REES, D. 1999. Estimation of the optimum number of
pheromone baited flight traps needed to monitor
phycitine moths (Ephestia cautella and Plodia inter-
punctella) at a breakfast cereal factory-a case
study, pp. 1464-1471. In Z. Jin, Q. Liang, Y. Liang, X.
Tan, and L. Guan (eds.). Stored Product Protection,
Proceedings of the 7th International Working Con-
ference on Stored-Product Protection. Beijing, PRC
(October 14-19, 1998). Sichuan Publishing House of
Science and Technology, Chengdu, PRC.
SUBRAMANYAM, B. H., J. CAMPBELL, AND K. KEMP. 2002.
It's in the detail for retail. Pest Control. May 2002:
26-28.


Florida Entomologist 86(4)







Genc et al.: Biology of Phaon Crescent Butterfly


LIFE HISTORY AND BIOLOGY OF PHYCIODES PHAON
(LEPIDOPTERA: NYMPHALIDAE)


HANIFE GENC, JAMES L. NATION AND THOMAS C. EMMEL
Department of Entomology & Nematology, University of Florida, Gainesville, FL 32611-0620

ABSTRACT

The butterfly Phyciodes phaon (Edwards), the Phaon crescent, was reared in the laboratory
on its host plant, Phyla nodiflora (L.) Greene, at 27 C with 16:8 (L:D) photoperiod and fluo-
rescent lighting. Eggs are laid in clusters on the underside of host leaves and hatch in about
5 days. Newly hatched larvae aggregate and feed on the underside of the leaf. Later instars
disperse on the host plant and continue to feed on the leaves. Larvae develop through five in-
stars based on head capsule, weight, and size measurements. The duration of each instar
and the pupal stage were determined. Adults mate 2-3 days after emergence, and females
begin laying eggs after 2 more days. The life cycle from egg to adult requires 23-31 days. The
butterfly is easy to rear and mating occurs in laboratory cages under artificial lighting. The
butterfly has been reared continuously in the laboratory for about 3 years with no evidence
of disease in the colony.

Key Words: Phyciodes phaon (Edwards), butterfly, Phaon crescent, Nymphalidae, Lepidop-
tera, insect-host plant interaction, Phyla nodiflora (L.) Greene, Verbenaceae

RESUME

La mariposa, Phyciodes phaon (Edwards), fue criada en el laboratorio en su plant hospe-
dera, Phyla nodiflora (L.) Greene, a los 27 C con un fotoperiodo de 16:8 (L:D) e iluminaci6n
florescente. Los huevos son puestos en grupos en el env6z de la hoja del hospedero y se eclo-
sionan en aproximadamente 5 dias. Las larvas recien nacidas se agregan y se alimentan en
el envez de las hojas. Los estadios tardios se dispersan en la plant hospedera y continuan
alimentandose sobre las hojas. Las larvas pasan por cinco estadios basado sobre la capsula
de la cabeza, el peso y las medidas del tamano. La duraci6n de cada estadio y el estado pupal
fue determinada. Los adults se aparearan 2-3 dias despu6s de la salida, y las hembras em-
piezan poner huevos 2 dias despu6s. El ciclo de vida desde el huevo hasta el adulto require
23-31 dias. La mariposa es facil criar y el apareamiento ocurre en el laboratorio bajo ilumi-
naci6n artificial. La mariposa ha sida criada continuamente en el laboratorio por alrededor
de 3 aios sin evidencia de una enfermedad en la colonia.


Species of the butterfly genus Phyciodes Hueb-
ner (Nymphalidae) are restricted to the Americas,
and many of the species are tropical. There are 12
species in the United States that have been di-
vided into three species-groups (Scott 1994). The
Phaon crescent, Phyciodes phaon (Edwards), oc-
curs in Florida (Opler & Krizek 1984; Minno &
Minno 1999) and is distributed from coastal North
Carolina throughout the southern parts of the Gulf
States to southern Texas and westward to south-
ern California, and sometimes migrates north to
Iowa and Nebraska. The Phaon crescent adult is
characterized by a strong contrasting orange and
black coloring of the forewings and upper side of
the hindwings. The undersides of the hindwings
are pale with brown markings. The Phaon crescent
is distinguished from other Phyciodes species by
having a creamy yellow band evident across both
upperside and underside of the forewing.
The host plant utilized by the Phaon crescent
in Florida is Phyla nodiflora (L.) Greene (previ-
ously described as Lippia nodiflora L.) in the Ver-


benaceae (Riley 1975), and it is known by a
number of common names including fog fruit, frog
fruit, matchweed, capeweed, creeping Charlie
and match heads (Verdcourt 1992). It is a peren-
nial herb with long creeping stems and small
white to light yellow flowers with a purple center
(Fig. 1). It is widely distributed in the southern
United States. It roots readily at the nodes and
spreads as a ground cover. Leaves are opposite,
wedge shaped, thick, leathery, and finely serrated
along the edges but rounded at the tip. The plant
prefers moist areas and disturbed habitats such
as along roadsides and sidewalks, and the mar-
gins of wetlands and rivers. Two other butterflies
reported to use Phyla nodiflora as a larval host
are the common buckeye, Junonia coenia Hiibner,
and the white peacock,Anartia jatrophae Munroe
(Minno & Minno 1999). Little is known about the
biology of P. phaon. The aim in this paper is to de-
scribe the life history, biology and immature
stages of P. phaon feeding on its host plant in the
laboratory.







Florida Entomologist 86(4)


Fig. 1. Phyla nodiflora used as a larval food plant by the Phaon crescent.


MATERIALS AND METHODS

During the summer of 1999, P phaon adults
(n = 30) were captured in the vicinity of Gaines-
ville, Florida. Eggs were obtained from these
adults by placing them in a screen cage with pot-
ted host plants, P. nodiflora. Adults were given
access to 10% honey solution or Fruit Punch
Gatorade on small cotton balls. Eggs were re-
moved daily, counted, and kept in a Petri dish on
moist filter paper. Larvae were fed freshly cut
host-plant material. Larval food was changed ev-
ery other day by transferring all larvae to new
plants. Pupae were harvested daily, and trans-
ferred to a new cage with a potted host plant. The
colony was maintained under controlled labora-
tory conditions at 27C, 16:8 (L:D) h photoperiod.
The number ofinstars was determined from data
collected from 10 larvae examined each day. Shed
larval head capsules were collected, measured,
and preserved in 70% ethyl alcohol. Larvae also
were weighed and their length measured daily for
the 10 individuals to determine the number of
instars. Larvae were weighed individually. Data
were analyzed by one way ANOVA with Statpak
(Northwest Analytical, Inc., Portland, OR), and


when the F value was significant, means were
separated by Fisher's Least Significant Differ-
ence. Significance was accepted with P < 0.05.

RESULTS

Description of Phyciodes phaon Edwards Immature
and Adult Stages

Eggs

Females laid eggs in clusters on the undersur-
face of host leaves (Fig. 2A). In the laboratory, as
few as 5 and as many as 187 eggs occurred in clus-
ters. Sometimes eggs were stacked on top of each
other. The light green eggs were elliptical, about
0.63 0.03 mm in length and 0.36 0.01 mm in
diameter (N = 25 eggs) with a flattened base and
slight depression at the micropyle. They were
sculptured with 18-20 vertical raised ridges (Fig.
2A, B). Development to hatching required 5.1
0.3 days at 27C, and the color of the egg changed
from light green to brownish black at about 4 days
as the mandibles and head of the larva became
visible through the chorion.


December 2003







Genc et al.: Biology of Phaon Crescent Butterfly


Fig. 2. A composite photo of some developmental stages of the Phaon crescent Phyciodes phaon. A, A cluster of
eggs on the underside of the host plant; B, Scanning electron micrograph (SEM) of an egg cluster; C, Newly hatched
first instars on the underside of a leaf; D, The fourth instar; E, A P. phaon pupa attached by the cremaster to a stem
of the host plant; F, An adult butterfly.


Larvae

Larvae developed through five instars. Larval
weight, length, and head capsule measurements
(n = 10) in each instar are shown in Table 1. The
first instar was olive green to olive brown, with
long setae over the body (Fig. 2C). The head was
cream colored with two large brown to black
patches. The legs and prolegs were light brown
and tarsal segments were black to brown. The
anal prolegs were dark brown. Antennae were
cream in color, with brown basal area. The la-
brum was brown, the labial and maxillary palpi
were light cream in color, and ocelli were black.
The facial suture margins were darkened. Head
capsule setae were numerous and oriented ante-
riorly. Brown and cream spots were randomly dis-
tributed on the integument. First instars ate
their eggshells and stayed aggregated on the un-
derside of the leaf, typically spinning some silk
web on the leaf. Generally, larvae rested on top of
the silk web, but sometimes larvae rested and fed
beneath part of it. They ate small amounts of the
underside of the leaf, creating a small pit, which
they continued to enlarge as they fed on internal
leaf tissue. The duration of the first instar in the
laboratory was 3.6 0.8 days (n = 25).
The second instar was light brown in color
with dark subdorsal bands. Each segment con-
tained a row of short, branching small spines. The


head was black with two long cream dorsal
stripes extending posterior to the neck. The
mouthparts were dark brown. The head capsule
setae were more numerous than in the first in-
star. The integument was textured with brown,
dark brown, and cream spots. The longitudinal,
dorsal and subdorsal bands were more evident in
the second instar than in the first instar. The tho-
racic legs were light brown or cream in color with
the tarsal claws darkened. The spiracles were
brown. The duration of the second instar was 3.8
+ 0.8 days (n = 25).
Third instars were similar in appearance to
second instars, but cream patches on the head
capsule were more evident. Third instars gener-
ally rested on the upper side of leaves and fed on
the edges. They no longer aggregated, but distrib-
uted themselves over the whole plant. They spent
4.1 0.8 days in the third instar (n = 25).
Fourth and fifth instars were similar in ap-
pearance to each other and to third instars (Fig.
2D). These last two instars consumed a large
quantity of host leaves. The duration of the fourth
instar was 4.3 0.8 days (n = 25), and duration of
the fifth instar was 3.9 0.8 days (n = 25).

Prepupae

Mature larvae attached with the cremaster to a
stem, leaf or other support and remained in a cres-







Florida Entomologist 86(4)


TABLE 1. MEASUREMENTS OF HEAD CAPSULE, WEIGHT, AND LENGTH OF LARVAL PHYCIODES PHAON IN EACH INSTAR
(MEAN + SD, N = 10).

Head capsule
Instar measurements (mm) Weight (mg) Length (mm)

First 0.296 + 0.008 a 5.1+ 0.7 a 2.06 0.08 a
Second 0.593 0.008 b 15.5 4.9 b 6.07 0.12 b
Third 0.798 0.004 c 37 4.8 c 12.63 0.43 c
Fourth 1.295 0.007 d 81 7 d 18.95 0.83 d
Fifth 1.90 0.007 e 163 9 e 28.3 0.67 e
LSD* 0.0063 0.0054 0.0456

*LSD = Fisher's Least Significant Difference between any two means. The means within a column followed by a different letter
are different from each other (P < 0.05) (ANOVA and Fisher's Least Significant Difference tests).


cent shape about 8-10 hours. Then, hanging
straight down, they changed within 2-3 minutes
into the characteristic pupal shape and appearance.

Pupae

Pupae were initially very soft and light tan,
speckled with black and white (Fig. 2E). They had
darker and paler areas over the wings, and a
brown "U-shaped" mark around the front of the
head. Some pupae were very dark, almost black, in
color, but the cause of this color variation was not
explored. The pupal abdomen consisted of 10 seg-
ments, with the 10th segment bearing the cremas-
ter by which pupae attached to a support. Pupae
measured 12.2 0.1 mm in length, 5.8 0.1 mm in
width (measured dorsoventrally in the thoracic re-
gion), and weighed an average 82 40 mg (n = 25).
The duration of the pupal stage was 4.6 0.8 days.

Adults

Males and females were similar in appearance
(Fig. 2F). The wingspan was 30.7 0.02 mm in
females and 23.4 0.01 mm in males (n = 25).
Mating pairs often rested quietly together 4-5
hours. Mated females started laying eggs about 2
days after mating. A single female laid from 200-
250 eggs (n = 25). Adults survived in the labora-
tory about 2 weeks. The duration from egg to
adult was 23-31 days at 27C, 16:8 (L:D) photo-
period in the laboratory.

DISCUSSION

Species in the genus Phyciodes are believed to
be a monophyletic group based upon mitochon-
drial DNA sequences (Wahlberg & Zimmermann
2000). Most of the species feed as larvae on host
plants in the family Asteraceae and Acanthaceae
(Scott 1994; Brock & Kaufman 2003). In addition
to feeding upon the Asteraceae, P picta also colo-
nizes Convolvulaceae, and larvae of the phaon
crescent feed on several species in the genus
Phyla in Verbenaceae and one species in Acan-


thaceae (Scott 1994; Wahlberg 2001). Larval food
plants for several species are still unknown
(Brock & Kaufman 2003).
The ranges of the phaon crescent and pearl
crescent overlap in northern Florida and parts of
the southern United States, but the larval host
plants belong to two different plant families, the
Verbenaceae and Asteraceae, respectively (Oliver
1982; Emmel & Kenney 1997; Brock & Kaufman
2003). Oliver (1982) succeeded in achieving hand-
paired matings between adults of the phaon cres-
cent and pearl crescent, and obtained F1 hybrids
from some crosses that would feed upon both P.
nodiflora and various asters.
In our study, adult phaon crescents mated
readily in small to large laboratory cages, and
cage size and lighting seemed not to be critical.
Although the host plant is widely available in
much of the southern United States, it also can be
cultured easily in small pots. Remarkably, during
three years of rearing the butterfly we have seen
no evidence of disease. These ease-of-rearing
characteristics and the availability of the host
plant all year in the Gainesville area (and possi-
bly further north in protected places) make the
phaon crescent a potentially useful teaching tool
in schools and a convenient display butterfly for
butterfly houses. Moreover, the Phaon crescent
seems to be a valuable model butterfly for further
research in genetics, mating behavior, pheromone
biology, and physiology.

ACKNOWLEDGMENTS

We thank Drs. Jerry Butler, Oscar Liburd, and Si-
mon Yu for comments and suggestions on the manu-
script. The University of Florida supported the work by
JLN and TCE, and Hanife Gene was partially supported
by the Government of Turkey. Florida Agricultural Ex-
periment Station Journal Series No. R-09077.

LITERATURE CITED

BROCK, J. P., AND K. KAUFMAN. 2003. Butterflies of
North America. Houghton Mifflin Co., New York. 384
pp.


December 2003







Genc et al.: Biology of Phaon Crescent Butterfly


EMMEL, T. C., AND B. KENNEY. 1997. Florida's Fabulous
Butterflies. Tampa, FL, World Publications. 96 pp.
KARTESZ, JOHN T. 1994. A Synonymized Checklist of the
Vascular Flora of the United States, Canada, and
Greenland. Vol. 2, Timber Press, Inc., Portland, OR.
MINNO, M. C., AND M. MINNO. 1999. Florida Butterfly
Gardening: A Complete Guide to Attracting, Identi-
fying, and Enjoying Butterflies of the Lower South.
Gainesville, FL. University Press of Florida. 210 pp.
OLIVER, C. G. 1982. Experimental hydridization be-
tween Phyciodes tharos and P. phaon (Nymphal-
idae). J. Lepidopterists' Soc.
OPLER, P. A., AND G. O. KRIZEK. 1984. Butterflies East
of the Great Plains: An Illustrated Natural History.
Baltimore, Johns Hopkins University Press. 294 pp.
RILEY, N. D. 1975. A Field Guide to the Butterflies of the
West Indies. London, Collins. 224 pp.


SCOTT, J. 1994. Biology and systematics of Phyciodes
(Phyciodes). Papilio New Series 7:1-12.
VERDCOURT, B. 1992. Verbenaceae. Rotterdam Kew,
Published on behalf of the East African Govern-
ments by Balkema, Royal Botanic Gardens distribu-
tor. 155 pp.
WAHLBERG, N. 2001. The phylogenetics and biochemis-
try of host-plant specialization in melitaeine butter-
flies (Lepidoptera: Nymphalidae). Evolution 55: 522-
537.
WAHLBERG, N., AND M. ZIMMERMANN. 2000. Pattern of
phylogenetic relationships among members of the
tribe Melitaeini (Lepidoptera: Nymphalidae) in-
ferred from mitochondrial DNA sequences. Cladis-
tics 16: 347-363.







Florida Entomologist 86(4)


December 2003


IDENTIFYING HOST STRAINS OF FALL ARMYWORM (LEPIDOPTERA:
NOCTUIDAE) IN FLORIDA USING MITOCHONDRIAL MARKERS

R. L. MEAGHER, JR. AND M. GALLO-MEAGHER2
'Center for Medical, Agricultural and Veterinary Entomology, Agricultural Research Service
U.S. Department of Agriculture, Gainesville, FL 32608

2University of Florida, Agronomy Department and Plant Molecular and Cellular Program
Gainesville, FL 32611-0300

ABSTRACT

Two molecular techniques were used to identify host strains of fall armyworm, Spodoptera
frugiperda (J. E. Smith) from male moths captured in pheromone-baited traps in north-cen-
tral and central Florida. Moths collected in 1998 were analyzed using direct detection of mi-
tochondrial DNA (mtDNA) RFLPs generated from restriction endonuclease digestion of
total DNA, while moths collected in 2000 and 2001 were analyzed using a mitochondrial cy-
tochrome oxidase subunit I (COI) gene PCR-RFLP marker. Both techniques could distin-
guish between rice and corn strain moths, however, the COI PCR-RFLP marker was more
robust as indicated by a time interval experiment that showed that moths held for up to 15
days in a "bucket trap" could still be used for strain diagnosis. In a field study, our strategy
gave results consistent with expectations. Rice strain moths were common in habitats with
large areas of small grasses, corn strain moths were common in large areas planted to corn,
and habitats with mixed large- and small-grass plantings contained both strains. Our meth-
odology of combining pheromone traps with PCR-RFLP analysis will provide a valuable
sampling system to determine the population ecology habits and strain isolating mecha-
nisms of fall armyworm populations in numerous habitats, including overwintering areas of
southern Florida.

Key Words: Spodoptera frugiperda, host strain identification, PCR-RFLP

RESUME

Dos t6nicas moleculares fueron utilizadas para identificar razas hospederas del cogollero,
Spodoptera frugiperda (J. E. Smith) a partir de polillas machos capturadas en trampas ce-
badas con feromonas en la region centro-norte y central de Florida. Las polillas colectadas
en 1998 fueron analizadaas utilizando la detecci6n direct de los PLFR (Polimorfismo en la
Longitud de los Fragmentos de Restricci6n [RFLP en ingles]) del ADN mitocondrial
(mtADN) generados a partir la digerti6n por la endonucleasa de restricci6n del ADN total,
mientras que las polillas colectadas en el 2000 y 2001 fueron analizadas utilizando un mar-
cador PCR-RFLP de la subunidad I del gen citocromo oxisasa (COI) miticondrial. Ambas t6c-
nicas pudieron distinguir entire las razas de polillas del arroz y las del maiz, sin embargo, el
marcador COI PCR-RFLP fue masrobusto tal como lo indico un experiment de intervalo de
tiempo en el cual las polillas que se mantuvieron en una "trampa de balde" hasta por 15 dias,
todavia podian ser utilizadas para diagnosticar su raza. En un studio de campo realizado,
nuestra estrategia produjo resultados consistentes con las expectativas. Las razas de polillas
de del arroz fueron communes en habitats con amplias areas de pastos bajos, las razas de po-
lillas del maiz fueron mas comunes en amplias areas sembradas con maiz, y en areas sem-
bradas con una mezcla de pastos altos y bajos se consiguieron ambas razas. Nuestra
metodologia de combinar las trampas de feromonas con el andlisis de PLFR-PCR proveerd
un important sistema de muestreo para determinar habitos ecol6gicos de las poblaciones y
los mecanismos de aislamiento de Is poblaciones de cogollero en numerosos habitats, inclu-
yendo las areas de hibernaci6n en el sur de Florida


Fall armyworm, Spodoptera frugiperda (J. E. Prowell 1998). One strain was identified from
Smith), is a migratory polyphagous pest that at- populations feeding on corn and sorghum (corn
tacks several important crops such as maize, sor- strain), and the other strain was identified from
ghum, forage grasses, rice, cotton and peanuts populations feeding on rice and bermudagrass
(Luginbill 1928; Sparks 1979; Knipling 1980). (rice strain). Strains exhibit polymorphisms at
Two morphologically indistinguishable host five allozyme loci (Pashley 1986), in their mito-
strains have been identified that are possibly in chondrial DNA (mtDNA) (Pashley 1989; Lu &
the initial stages of speciation (Pashley 1986; Adang 1996) and in their nuclear DNA (Lu et al.







Meagher & Gallo-Meagher: Fall Armyworm Strains in Florida


1992). Additionally, a tandemly repeated (189 bp)
DNA sequence has been shown to be unique to
the rice strain (Lu et al. 1994). Two recent tech-
niques have been used to improve strain discrim-
ination, including one that uses amplified
fragment-length polymorphisms (AFLPs) (Mc-
Michael & Prowell 1999), and another that em-
ploys amplification of a region of the
mitochondrial cytochrome oxidase C subunit I
gene (COI) followed by restriction enzyme diges-
tion (PCR-RFLP) (Levy et al. 2002).
Strain identification is important because re-
search has shown biological, behavioral, toxico-
logical, and host genotypic differences between
strains. Both strains attained similar larval and
pupal weights when fed bermudagrass or rice, but
when reared on maize, corn strain larvae attained
larger weights (Pashley et al. 1995; Veenstra et al.
1995). Behavioral reproductive incompatibilities,
such as the lack of successful mating between
corn strain females and rice strain males, have
been tentatively identified (Pashley & Martin
1987), although successful matings were achieved
with moths held in culture for over three years
(Whitford et al. 1988). Temporal partitioning of
calling/mating times has been presented as a
strain isolation mechanism (Pashley et al. 1992).
Rice strain larvae were shown to be more suscep-
tible to various insecticides such as carbaryl, di-
azinon, cypermethrin, methyl parathion, and
methomyl, while corn strain larvae were more
susceptible to carbofuran (Pashley et al. 1987b;
Adamczyk et al. 1997). Rice strain larvae were
also more susceptible to transgenic Bacillus thur-
ingiensis Berliner (Bt) cotton than corn strain lar-
vae (Adamczyk et al. 1997). Laboratory and field
studies have shown distinct differences in feeding
of bermudagrass genotypes, with rice strain lar-
vae generally able to gain more weight and con-
sume more plant material than corn strain larvae
(Pashley et al. 1987a; Quisenberry & Whitford
1988).
Although fall armyworm overwinters in south-
ern Florida counties and can build up large popu-
lations in central and north-central Florida
(Pashley et al. 1985; Mitchell et al. 1991), strain
identification of Florida populations is limited.
Late instar larvae collected from corn in southern
Florida (Hendry Co.) were identified as corn strain
in 1983 and 1984 (Pashley et al. 1985). Both corn
and rice strain populations were identified from
southern Florida, although no information regard-
ing location or collection habitat were provided
(Pashley 1988). Corn strain larvae were collected
in early 1989 from southern Florida, but again col-
lection sites and habitats were not disclosed (Pash-
ley et al. 1992). Strain identification of populations
from non-overwintering areas in north or central
Florida has not been attempted. The objective of
this research was to identify the host strain of fall
armyworm moths collected from sex pheromone


traps for periods up to 15 days in north-central and
central Florida using suitable molecular methods.

MATERIALS AND METHODS

Moth Collection

Standard plastic Unitraps (bucket traps)
baited with commercial fall armyworm sex pher-
omone [(Z)-9-tetradecen-l-ol acetate, (Z)-11-
hexadecen-1-ol acetate and (Z)-7-dodecen-l-ol
acetate; either Scentry (Ecogen, Inc., Langhorne,
PA) or Scenturion (Scenturion, Inc., Clinton,
WA) lures] were placed in field locations in 1998,
2000, and 2001. All traps contained insecticide
strips (Hercon Vaportape II containing 10% 2,2-
dichlorovinyl dimethyl phosphate, Hercon Envi-
ronmental Co., Emigsville, PA) to kill the moths.
In 1998, locations in Alachua Co., FL were used to
collect moths. One was near the Dairy and Agron-
omy Forage Research Unit of the University of
Florida, and the second location was a commer-
cial corn field near the town of Alachua. The re-
search unit was located in the northern half of the
county and contained plantings of field corn and
pasture grasses.
In 2000, three traps were placed along State
Route 121 in Levy Co., FL. Several hundred hect-
ares of forage grasses bordered the route. In 2001,
three traps were placed at the University of Flor-
ida Range Cattle Research and Education Center
in Ona, FL. This center has over 1150 h of natural
and improved forage grasses. Two traps were also
placed beside sugarcane plantings in the Ever-
glades Agricultural Area near the University of
Florida Everglades Research and Education Cen-
ter, Belle Glade, FL, and the USDA, ARS, Sugar-
cane Field Station, Canal Point, FL. Fall
armyworm larvae were also collected from Ona
and resulting adults were analyzed to determine
their host strain.

Interval Testing

This test was designed to determine if the host
strain of moths held for up to 15 d in a pheromone
trap could still be accurately identified. Fall ar-
myworms used in this test were reared in the lab-
oratory on a pinto bean-based artificial diet
according to the procedures of Guy et al. (1985).
Pupae were sexed and placed in 163-ml (5.5 oz.)
paper cups (Sweetheart, Chicago, IL) that were
placed in 24 x 24-cm screen cages for eclosion. Pu-
pae were maintained under reversed photoperiod
(14:10, light:dark) in an environmental chamber
held at 26C and 70% RH. Adult males had access
to cotton balls saturated with distilled water and
a honey-sugar solution. Live male moths aged 2-5
d were placed in bucket traps with insecticide
strips and removed for testing at 1, 2, 4, 7, 10 and
15 d. Moths usually died within an hour after ex-







Florida Entomologist 86(4)


posure to the insecticide strips. Three to 10 moths
were sampled for each time point.

Total DNA Extraction and Strain Identification

Two techniques were used to identify strains.
For both techniques, total DNA was extracted
from one fall armyworm adult that was ground in
liquid nitrogen and then homogenized in 1 ml of
extraction buffer (100 mM Tris-HC1, pH 7.5, 20
mM EDTA, pH 8, 500 mM NaC1, 2% (w/v) SDS).
The remainder of the extraction procedure was
performed according to Lu et al. (1992) except
that final resuspension of the DNA was in 100 pl
of TE buffer (10 mM Tris, 1 mM EDTA, pH 8.1).
The technique of Lu & Adang (1996) was em-
ployed to identify strains of moths collected in
1998. Approximately 50 pg of total DNA was dou-
ble-digested with the endonucleases HaeIII and
Mspl, and 8 pg of the digested DNA was electro-
phoresed on a 1% agarose gel in TBE buffer. Gels
were then stained with ethidium bromide and vi-
sualized under UV illumination. The corn strain
produces four mitochondrial bands of 5.5, 4.3, 3.8
and 1.3 kb (cannot see this smaller band due to
masking by nuclear DNA), while the rice strain
produces only two bands of 10.4 and 4.4 kb.
Strain identification of moths collected in 2000
and 2001 was accomplished using a mitochondrial
PCR-RFLP marker (Levy et al. 2002). Two PCR
primers (5'GAGCTGAATTAGGGACTCCAGG3'-
forward and 5'ATCACCTCCACCTGCAGGATC3'-
reverse) flanking a diagnostic Mspl restriction
site (CCGG) within the mitochondrial COI gene
sequence were used to amplify a 569 bp product.
The PCR mixture contained 25 ng of total DNA,
0.25 pM primers, 200 pM dNTPs, 0.5 U Taq poly-
merase, and lx PCR buffer (Perkin Elmer Gene-
Amp kit) in a total volume of 25 pl. Amplification
conditions were as follows: denaturation, 94C for
30 sec; annealing, 58C for 1 min; extension, 72C
for 1 min, with a final cycle extension of 72C for
10 min. Reactions were run for 40 cycles in a ther-


mal cycler (MJ Research). Following amplifica-
tion, 5 pl of the PCR mixture was used for Mspl
digestion and the resulting products were sur-
veyed using 2% agarose gel electrophoresis. The
corn strain PCR product contains the Mspl re-
striction site while this site is missing in the rice
strain product. Consequently, Mspl digestion of
the corn strain 569 bp PCR product results in two
bands of 497 bp and 72 bp, whereas this PCR
product from the rice strain moths is unrestricted
and remains intact.

RESULTS AND DISCUSSION

Both corn and rice strain moths were collected
from north-central and central Florida (Table 1).
Digestion of total DNA with HaeIII fragments ge-
nomic DNA made observation of mtDNA frag-
ments easier. Digestion of mtDNA with Mspl
produced three visible bands of 5.4, 4.3, and 3.8
kb representing corn strain moths, and two bands
of 10.4 and 4.3 kb representing rice strain moths
as previously established by Lu & Adang (1996)
(Fig. 1). The size of the mtDNA genome of fall ar-
myworm was estimated as approximately 14.8 kb
(Lu & Adang 1996). The smallest band (1.3 kb)
from corn strain moths was not visible because of
masking by nuclear DNA. This method therefore
resulted in a "3-band pattern" and "2-band pat-
tern" of corn and rice strain moths, respectively
(Lu & Adang 1996). The PCR-RFLP marker cor-
rectly identified corn strain moths by way ofMspI
digestion of the 569 bp COI amplified fragment
into two bands of 497 bp and 72 bp (Fig. 2). The
rice strain PCR product was not digested by MspI
(Levy et al. 2002).
Rice strain moths predominated in large areas
of small grasses such as Levy Co. Rt. 121 and Ona
(Table 1), while corn strain moths were found
more frequently in the only large corn site tested
in Alachua Co. (Table 1). Mixed areas of corn and
small grasses, and the peanut habitat contained
moths of both strains. The agroecosystem near


TABLE 1. CORN AND RICE STRAINS OF FALL ARMYWORM ADULT MALES COLLECTED IN PHEROMONE TRAPS AT DIFFERENT
FIELD SITES IN FLORIDA, 1998, 2000, 2001. MOTHS COLLECTED IN 1998 WERE ANALYZED USING THE METHOD
OF LU & ADANG (1992); MOTHS COLLECTED IN 2000 AND 2001 WERE ANALYZED USING THE METHOD OF LEVY
ET AL. (2002).

Strains (No.)

Location Date Habitat Corn Rice

Dairy/Forage, Alachua Co. 4/22, 5/29, 6/12/98 grass, corn 3 1
Corn fields, Alachua Co. 5/25/98 corn 7 1
Levy Co., Rt. 121 8/10, 8/14, 8/16/00 grass 1 13
Levy Co. 8/20, 9/3/01 peanuts 17 10
Everglades Agric. Area 8/17/01,11/14/01 sugarcane 1 6
Ona, RCREC 6/7, 7/12, 8/30, 11/14/01 grass 0 39
Ona, RCREC 11/14/01 colony 0 5


December 2003






Meagher & Gallo-Meagher: Fall Armyworm Strains in Florida


1 2 3 4 5


C-
*
U-


III L
Fig. 1. Fall armyworm total DNA
HaeIII and MspI. Lanes 1-3 and 5 are cor
4 is a rice strain.


the peanut site also contained large t
ture, easily accessible by moths. Th
presence of both strains was expected
is not known which strain is physiol
ter adapted to peanut as a host pla
studies of peanut host plant resistance


ratory colonies that were probably corn strain
(Leuck & Skinner 1971; Garner & Lynch 1981;
Lynch et al. 1981), although strain analysis was
not performed on these colonies. Further studies
are underway to determine whether one strain is
better adapted to peanuts than the other. The
Everglades Agricultural Area also contained
- 10.4 kb moths of both strains. The habitat in this area is
dominated by large grasses such as sugarcane
- 5.4 kb and corn and small grasses such as rice and "wild"
- 4.4 kb grass species. Larger sample sizes from these
- 3.8 kb habitats are needed to determine which strain is
more common in this important and fragile agro-
ecosystem.
Previous physiological studies suggested that
rice strain larvae were more specialized and af-
fected by their host plant than were corn strain
larvae (Pashley et al. 1995; Veenstra et al. 1995).
However, larval collections in the field disclosed
that rice strain larvae occur in both large and
small grass habitats, whereas corn strain larvae
rarely occupied small grass habitats (Pashley
1988; Pashley et al. 1995; McMichael & Prowell
1999). Our study detected few corn strain moths
in small grass habitats (Levy Co. Rt. 121, Ona).
Although host-plant specialization is likely medi-
ligested with ated by adult behavioral attributes rather than
n strain, lane larval physiological characteristics (Pashley et al.
1995), studies determining adult attributes such
as mating behavior and ovipositional preference
have not provided clear results.
racts of pas- Pheromone traps provide a convenient means
lerefore, the of collecting wild males in the field and represent
, although it one of the few methods of directly trapping adult
ogically bet- fall armyworm. However, such field-collected
nt. Previous specimens may be in traps for up to two weeks be-
e used labo- fore they can be analyzed, with significant degra-


- M


1 kb
750 bp

500 bp

250 bp


72 bp


Fig. 2. Time interval experiment showing that adult fall armyworm held for up to 15 days could still be used for
strain diagnosis by using the COI PCR-RFLP marker. All laboratory-reared moths from a corn strain colony were
killed in the traps and exposed to outdoor climate for 1, 2, 4, 7, 10 or 15 d before collection for strain diagnosis. Pos-
itive controls included freshly collected corn [C] and rice [R] strains and the negative control was a PCR reaction
containing no DNA template (-). M = 1 kb ladder.


M id 2d 4 d 7d 10 d I15d IC R







Florida Entomologist 86(4)


dation of DNA likely. Therefore, it is necessary
that the diagnostic molecular techniques em-
ployed for strain identification be robust enough
to distinguish between the strains under these
field conditions. The time interval experiment
showed that moths held for at least 15 d could
still be used for strain diagnosis when using the
COI PCR-RFLP marker (Fig. 2). In comparison,
results from the non-PCR based mt DNA RFLP
method of Lu & Adang (1996) were highly vari-
able and this method could not be used to identify
strains held in traps longer than four days (data
not shown). Therefore, the PCR-based method
now makes it possible to obtain consistent and ac-
curate strain identification of moths collected by
standard pheromone trapping methods.
The combination of the pheromone trapping
method with PCR-RFLP provide a valuable sam-
pling system. Biological attributes such as strain
isolating mechanisms, intra- and inter-strain
mating behavior, and within-field populations in
monocot and dicot crops are potential future stud-
ies. Additionally, strain analysis of overwintering
fall armyworm populations in southern Florida is
a important component to understanding popula-
tion flow of this neotropical migrant.


ACKNOWLEDGMENTS

We thank Raul Villanueva and Lanying Wen (Univer-
sity of Florida) for technical assistance, and P. Mislevy
(UF-RCREC), B. Scully (UF-EREC), and G. Nuessly
(UF-EREC) for their assistance in collections made at
their respective locations. R. Nagoshi (USDA-ARS) and
J. Maruniak (University of Florida) provided helpful re-
views of the manuscript. The use of trade, firm, or cor-
poration names in this publication is for the information
and convenience of the reader. Such use does not consti-
tute an official endorsement or approval by the United
States Department of Agriculture or the Agricultural
Research Service of any product or service to the exclu-
sion of others that may be suitable.


REFERENCES CITED

ADAMCZYK, JR., J. J., J. W. HOLLOWAY, B. R. LEONARD,
AND J. B. GRAVES. 1997. Susceptibility of fall army-
worm collected from different plant hosts to selected
insecticides and transgenic Bt cotton. J. Cotton Sci.
1: 21-28.
GARNER, J. W., AND R. E. LYNCH. 1981. Fall armyworm
leaf consumption and development on Florunner
peanuts. J. Econ. Entomol. 74: 191-193.
GUY, R. H., N. C. LEPPLA, J. R. RYE, C. W. GREEN, S. L.
BARETTE, AND K. A. HOLLIEN. 1985. Trichoplusia ni,
pp. 487-494. In P. Singh & R. F. Moore [eds.], Hand-
book of insect rearing, vol. 2. Elsevier, Amsterdam.
KNIPLING, E. F. 1980. Regional management of the fall
armyworm-a realistic approach? Florida Entomol.
63: 468-480.
LEUCK, D. B., AND J. L. SKINNER 1971. Resistance in
peanut foliage influencing fall armyworm control. J.
Econ. Entomol. 64: 148-150.


LEVY, H. C., A. GARCIA-MARUNIAK, AND J. E. MARU-
NIAK. 2002. Strain identification of Spodoptera fru-
giperda (Lepidoptera: Noctuidae) insects and cell
line: PCR-RFLP of cytochrome oxidase C subunit I
gene. Florida Entomol. 85: 186-190.
Lu, Y., AND M. J. ADANG. 1996. Distinguishing fall ar-
myworm (Lepidoptera: Noctuidae) strains using a
diagnostic mitochondrial DNA marker. Florida En-
tomol. 79: 48-55.
Lu, Y.-J., M. J. ADANG, D. J. ISENHOUR, AND G. D.
KOCHERT. 1992. RFLP analysis of genetic variation
in North American populations of the fall armyworm
moth Spodoptera frugiperda (Lepidoptera: Noctui-
dae). Molecular Ecol. 1: 199-208.
Lu, Y.-J., G. D. KOCHERT., D. J. ISENHOUR, AND M. J.
ADANG. 1994. Molecular characterization of a strain-
specific repeated DNA sequence in the fall army-
worm Spodoptera frugiperda (Lepidoptera: Noctu-
idae). Insect Mol. Biol. 3: 123-130.
LUGINBILL, P. 1928. The fall armyworm. USDA Tech.
Bull. 34. 92 p.
LYNCH, R. E., W. D. BRANCH, AND J. W. GARNER 1981.
Resistance ofArachis species to the fall armyworm,
Spodoptera frugiperda. Peanut Sci. 8:106-109.
MITCHELL, E. R., J. N. MCNEIL, J. K. WESTBROOK, J. F.
SILVAIN, B. LALANNE-CASSOU, R. B. CHALFANT, S. D.
PAIR, V. H. WADDILL, A. SOTOMAYOR-RIOS, AND F. I.
PROSHOLD. 1991. Seasonal periodicity of fall army-
worm, (Lepidoptera: Noctuidae) in the Caribbean
basin and northward to Canada. J. Entomol. Sci. 26:
39-50.
MCMICHAEL, M., AND D. P. PROWELL. 1999. Differences
in amplified fragment-length polymorphisms in fall
armyworm (Lepidoptera: Noctuidae) host strains.
Ann. Entomol. Soc. Am. 92: 175-181.
PASHLEY, D. P. 1986. Host-associated genetic differenti-
ation in fall armyworm (Lepidoptera: Noctuidae): a
sibling species complex? Ann. Entomol. Soc. Am. 79:
898-904.
PASHLEY, D. P. 1988. Current status of fall armyworm
host strains. Florida Entomol. 71: 227-234.
PASHLEY, D. P. 1989. Host-associated differentiation in
armyworms (Lepidoptera: Noctuidae): an allozymic
and mitochondrial DNA perspective. In H. D.
Loxdale & J. den Hollander (eds.), Electrophoretic
studies on agricultural pests. pp. 103-114. Claren-
don, Oxford.
PASHLEY, D. P. 1993. Causes of host-associated varia-
tion in insect herbivores: an example from fall army-
worm. In K. C. Kim & B. A. McPheron (eds.),
Evolution of insect pests/patterns of variation. pp.
351-359. Wiley, NY.
PASHLEY, D. P., AND J. A. MARTIN. 1987. Reproductive
incompatibility between host strains of the fall ar-
myworm (Lepidoptera: Noctuidae). Ann. Entomol.
Soc. Am. 80: 731-733.
PASHLEY, D. P., A. M. HAMMOND, AND T. N. HARDY.
1992. Reproductive isolating mechanisms in fall ar-
myworm host strains (Lepidoptera: Noctuidae). Ann.
Entomol. Soc. Am. 85: 400-405.
PASHLEY, D. P., S. J. JOHNSON, AND A. N. SPARKS. 1985.
Genetic population structure of migratory moths:
the fall armyworm (Lepidoptera: Noctuidae). Ann.
Entomol. Soc. Am. 78: 756-762.
PASHLEY, D. P., S. S. QUISENBERRY, AND T. JAMJANYA.
1987a. Impact of fall armyworm (Lepidoptera: Noc-
tuidae) host strains on the evaluation of bermuda
grass resistance. J. Econ. Entomol. 80: 1127-1130.


December 2003







Meagher & Gallo-Meagher: Fall Armyworm Strains in Florida


PASHLEY, D. P., T. N. HARDY, AND A. M. HAMMOND.
1995. Host effects on developmental and reproduc-
tive traits in fall armyworm strains (Lepidoptera:
Noctuidae). Ann. Entomol. Soc. Am. 88: 748-755.
PASHLEY, D. P., T. C. SPARKS, S. S. QUISENBERRY, T.
JAMJANYA, AND P. F. DOWD. 1987b. Two fall army-
worm strains feed on corn, rice and bermudagrass.
Louisiana Ag. 30: 8-9.
PROWELL, D. P. 1998. Sex linkage and speciation in Lep-
idoptera. In D. Howard & S. Berlocher (eds.), End-
less forms: species and speciation. pp. 309-319.
Oxford, NY.
QUISENBERRY, S. S., AND F. WHITFORD. 1988. Evalua-
tion of bermudagrass resistance to fall armyworm


(Lepidoptera: Noctuidae) influence of host strain
and dietary conditioning. J. Econ. Entomol. 81: 1463-
1468.
SPARKS, A. N. 1979. A review of the biology of the fall ar-
myworm. Florida Entomol. 62: 82-87.
VEENSTRA, K. H., D. P. PASHLEY, AND J. A. OTTEA. 1995.
Host-plant adaptation in fall armyworm host
strains: comparison of food consumption, utilization,
and detoxication enzyme activities. Ann. Entomol.
Soc. Am. 88: 80-91.
WHITFORD, F., S. S. QUISENBERRY, T. J. RILEY, AND J.
W. LEE. 1988. Oviposition preference, mating com-
patibility, and development of two fall armyworm
strains. Florida Entomol. 71: 234-243.







Florida Entomologist 86(4)


December 2003


ATTRACTIVENESS AND EFFECTIVENESS OF AN ARTIFICIAL DIET FED
TO HYBRID IMPORTED FIRE ANTS, SOLENOPSIS INVICTA x RICHTERI
(HYMENOPTERA: FORMICIDAE)

JAMES T. VOGT
USDA, ARS Biological Control of Pests Research Unit, P.O. Box 67, Stoneville, MS 38776

ABSTRACT

Attractiveness of freeze-dried and reconstituted entomophage diet to hybrid fire ants (Sole-
nopsis invicta x richteri) was investigated in choice tests using freeze-killed, crushed cricket
(Acheta domestic L.) as a standard. Worker ants were strongly attracted to both crickets
and reconstituted diet. Foragers collected approx. 27 times more reconstituted diet than
freeze-dried diet, and collected statistically equivalent amounts of artificial diet and crickets
(36.0 7.0 and 26.0 0.3 mg/h, respectively). Even though workers were strongly attracted
to the artificial diet, all measures of colony growth (mean mass of brood, workers, and queen)
were at least 30% lower in colonies fed sugar water + artificial diet than in colonies fed sugar
water + crickets or sugar water + artificial diet + crickets. While this diet may have some
utility as a bait for monitoring fire ants in the field, it offers no advantage over a standard
diet of crickets and sugar water for rearing fire ants in the laboratory.

Key Words: Colony growth, laboratory rearing, foraging, bait

RESUME

La atracci6n de alimentos entom6fagos reconstituidos y liofilizados hacia Solenopsis invicta
x richteri fue investigada en un experiment de preferencia usando como un grills (Acheta
domestic L.) molidos y matados por congelaci6n. Las hormigas trabajadoras fueron fuerte-
mente atraidas de igual manera hacia los grillos y el alimento reconstituido. Las hormigas
colectoras de alimentos colectaron la dieta reconstituida aproximadamente 27 veces mas
que la dieta liofilizada, y colectaron estatisticamente una misma suma de dieta artificial y
grills (36.0 7.0 y 26.0 0.3 mg/h, respectivamente). Aunque las hormigas trabajadoras s6n
fuertemente atraidas a la dieta artificial, todas las medidas del crecimiento de la colonia
(promedio de cantidad de cria, trabajadoras, y reina) fueron por lo menos 50% mas bajas en
las colonies alimentadas con agua zucarada+dieta artificial en comparaci6n con colonies al-
imentadas con agua azucarada+grillos o agua zucarada+dieta artificial+grillos. Mientras
que esta dieta puede tener algun utilisaje como cebo para el chequeo de hormigas de fuego
en el campo, no ofrece ninguna ventaja sobre la dieta de grillos y agua azucarada para la cri-
anza de hormigas en el laboratorio.


Translation provided by Demian Kondo.


Various diets have been proposed for rearing
imported fire ants (Solenopsis invicta Buren, Sole-
nopsis richteri Forel, and Solenopsis invicta x rich-
teri, the red, black, and hybrid imported fire ants,
respectively) (Khan et al. 1967; Bhatkar & Whit-
comb 1970; Banks et al. 1981; Porter 1989); how-
ever, none have proven satisfactory without whole
insects, offered separately or as a diet component.
I tested the attractiveness of a liver and
ground beef-based artificial entomophage diet
(Cohen, U.S. Patent #5,834,177. November 10,
1998) to foraging hybrid imported fire ants, S. in-
victa x richteri. For a description of the diet, see
Cohen & Smith (1998). This diet was tested be-
cause it has been used to successfully rear several
generations of Ci., ..P.., .'i rufilabris (Burmeis-
ter). A reasonable start to assessing potential
benefit of the diet to fire ant colonies would be to
test its palatability; thus, we addressed the fol-


lowing questions: Does attractiveness of the diet
warrant further study on its use as a supplement
for laboratory colonies? Is the diet more attractive
in its freeze-dried form or its reconstituted form?
Is fresh diet more attractive than freeze-dried
and reconstituted diet? Finally, an experiment
was conducted to determine growth of laboratory
colonies fed the artificial diet, crickets (Acheta do-
mestica L.), or a combination of both.

MATERIALS AND METHODS

Diet Attractiveness

Colonies of S. invicta x richteri were collected
from the field (Oktibbeha Co., MS) and main-
tained in trays (56 cm L x 44 cm W x 12 cm H)
with castone nests (150 mm x 25 mm), a water
source (150 mm x 25 mm test tube filled with







Vogt: Growth of Hybrid Fire Ant Laboratory Colonies


water, and plugged with cotton), and 1 M sucrose
solution in a 150 mm x 15 mm test tube plugged
with cotton. All colonies had a functional queen,
50,000-100,000 workers, and 15-20 g of brood.
Colonies were fed crickets 2x/week, occasionally
supplemented with boiled hen's egg yolk. Crickets
and egg yolk were removed from the colonies 2 d
prior to all tests to insure uniform levels of hun-
ger. All trials took place in a climate-controlled
room (28C, approx. 60% RH). Hybrid status of
colonies was confirmed by chemotaxonomy
(Vander Meer & Lofgren 1990).
In experiment 1, freeze-killed crickets, freeze-
dried entomophage diet, and reconstituted ento-
mophage diet (2:1 diet:water by weight) were
tested for recruitment time and attractiveness to
foraging ants. Crickets were macerated using a
mortar and pestle prior to testing. Macerated
crickets and reconstituted diet were similar in
consistency, with the exception of some small (<3
mm2) pieces of exoskeleton in the macerated
crickets; freeze-dried diet was composed of fine (5
to 40 pm) particles with relatively few larger,
stringy solids. Four test colonies were used; each
was connected to a foraging arena (41.75 cm L x
27.5 cm W x 12 cm H tray) with Tygon tubing.
Diets were placed in the barrels of 10 ml syringes
cut at the 7 cc mark to present a 154 mm2 surface
area of diet. Each syringe contained 3 cc of the ap-
propriate diet. Syringes were placed in the forag-
ing arena, equidistant to the arena entrance
(approx. 15 cm). A pair of observers, each observ-
ing 2 colonies, recorded discovery time and re-
cruitment time for each syringe. Recruitment was
assumed to have taken place once 10 foragers
were present at the food surface. Once recruit-
ment had taken place, the number of ants on the
surface of the food sources was estimated at timed
intervals. As foragers removed material from the
syringes, the plunger was pushed forward so that
the surface area presented to foragers remained
constant.
In experiment 2, freeze-dried and reconsti-
tuted entomophage diets were presented in 1 oz
plastic souffle cups. Each cup had 2 small (ap-
prox. 3 mm dia.) holes cut in the side for ant ac-
cess, and a plastic lid to minimize desiccation of
the material. Cups containing diet were pre-
weighed to the nearest 0.01 g, dried for 24 h at
60C and re-weighed. Water (Millipore) was then
added to the reconstituted diet treatment (2:1 wa-
ter:diet ratio), exposed to the ants, weighed again,
then dried for 24 h at 60C to obtain dry weight of
material removed. Eight controls (4 freeze-dried
and 4 reconstituted) were placed in the room out-
side of the ant colonies. Paired cups were placed
directly in colony trays; care was taken to place
the cups equidistant from nest cells. Ants were al-
lowed to forage for approx. 5 h (exact time noted
for each cup), then all cups with were removed
along with their contents, dried, and weighed.


In experiment 3, foraging ants were allowed
access to reconstituted entomophage diet and a
cricket standard, to compare attractiveness/re-
trieval rate. Prior to conducting this experiment,
samples of macerated cricket (N = 6) were
weighed, dried for >24 h at 60C, and reweighed
to obtain water content. Data were used to ex-
press retrieval rates in terms of dry weight. Pre-
sentation of food sources was done in the same
manner as in experiment 2.
In experiment 4, freeze-dried, reconstituted
diet (commercially prepared and canned approx.
3 yr. prior to testing) and fresh diet (made the day
prior to testing) were presented to foraging ants
using the same methods as in experiment 2. Wa-
ter content of fresh and reconstituted material
was obtained by weighing samples of each (N = 3),
drying them in a 60C oven for >24 h, and re-
weighing them.
Discovery and recruitment data were sub-
jected to Proc Mixed (Little et al. 1996) to test for
differences between treatments, with colony as a
blocking factor. Timed observations from experi-
ment 1 were analyzed as a randomized complete
block with repeated measures and subjected to
Proc Mixed to test for differences in attraction be-
tween treatments, and changes in attraction over
time. Data from the other experiments were ana-
lyzed using Proc Mixed with source colony as a
random blocking factor to test for differences in
retrieval or attractiveness between treatments.
Analysis of variance was used to examine controls
for differences between treatments. Data are pre-
sented as mean + SE, and were tested for signifi-
cance at the a = 0.05 confidence level.

Growth of Laboratory Colonies

An experiment was designed to compare col-
ony growth of hybrid fire ant colonies fed sugar
water (SW) + crickets (C), SW + artificial diet
(AD), and SW + C + AD. Colonies (n = 15) were
collected from the field (Oktibbeha Co., MS) and
standardized just prior to beginning the experi-
ment. Each standard colony contained 1 physo-
gastric queen, 5 g workers, and 2 g brood.
Colonies were housed in trays (41.75 cm L x 27.5
cm W x 12 cm H) and provided a castone nest
(150 mm x 25 mm), water, and 1 M sugar solution.
Crickets and artificial diet were offered sepa-
rately in 1 oz. plastic souffle cups, with small (0.3
mm) holes drilled in the side for forager access,
and lids to slow desiccation of the contents. Cups
were checked daily for mold or desiccation, and
replaced as necessary. Colonies were provided the
appropriate foods ad libitum for a total of 8 wk,
replacing diet cups at least every 2 d. The experi-
mental design was a completely randomized de-
sign replicated 5 times. Data were analyzed using
Proc Mixed followed by Least Squares Means to
test for treatment effects on queen mass, total







Florida Entomologist 86(4)


brood mass, total worker mass, and total colony
mass (live weights). Data are reported as mean +
SE.

RESULTS
Diet Attractiveness

Experiment 1. Foraging ants discovered all
food sources in <4 min, and recruited within <13
min. No significant differences existed in discov-
ery or recruitment times (P > 0.05), which were
quite variable (e.g., recruitment to freeze-dried
diet ranged from 5.9 to 12.8 min). In a mixed
model with colony, treatment (food type), and
time as fixed effects, and colony by treatment as
the subject of the repeated statement, treatment
(F = 36.2; df = 2,6; P = 0.0004) and time (h) (F =
4.9; df = 22,198; P < 0.0001) significantly influ-
enced number of foragers per bait (Fig. 1).
Experiment 2. Pre- and post-drying weights of
freeze-dried diet indicated 2 to 6% water content,
so dry weight after exposure to the ants was sub-
tracted from dry weight prior to exposure to ob-
tain amount of diet retrieved. Data were
corrected for time exposed to foragers, yielding
material retrieved in g/h. Foragers removed ap-
prox. 27 times more reconstituted diet from the
cups than freeze-dried diet in terms of dry weight
(F = 28.5; df = 1,7; P = 0.001) (Fig. 2). Controls
(freeze-dried and reconstituted) remained un-
changed during the course of the experiment.
Experiment 3. Freeze-killed crickets used in
this trial averaged 67.1 0.4% water. Based on
time-corrected data, entomophage diet controls
gained an average of 2.4 1.0 g/h, and cricket con-
trols lost an average of 2.4 0.4 g/h; these
amounts were applied to post-feeding dry weights
as a correction factor. Dry weight of material re-
trieved by the ants was statistically indistin-
guishable for the two treatments (F = 4.45; df =
1,7; P = 0.073) (Fig. 3).


120
---- Crickets
-0 Freeze-dried diet
- 100 - Reconstituted diet





40

S20

0
~ 0 --------------------

0 1 2 3 4 5
Time (h)

Fig. 1. Foraging activity of S. invicta x richteri during
timed observations at 3 food sources.


o
0



0



0o
0
|0


10


.08


:06 1


.04


.02

0n0n._


reconstituted freeze-dried
Diet

Fig. 2. Retrieval rate (g dry weight/h) for S. invicta x
richteri foraging on reconstituted v. freeze-dried ento-
mophage diet.


Experiment 4. Fresh entomophage diet con-
tained an average of 68.7 0.9% water, while
reconstituted diet contained a statistically indis-
tinguishable average of 71.7 0.3% water (P =
0.12). Controls lost an average of 0.03 g during
the course of the trial; this amount was the same
between treatments (P = 0.10), and was sub-
tracted from post-feeding data. Since water con-
tent of the treatments was similar, I analyzed wet
weight of diet retrieved. In approx. 4 h, foragers
collected similar amounts of fresh and reconsti-
tuted diet (0.49 0.11 g and 0.40 0.08 g, respec-
tively) (P = 0.09).

Growth of Laboratory Colonies

Eight weeks after beginning the experiment,
all measures of colony fitness and/or growth were
significantly lower in colonies fed SW + AD than
colonies fed SW + C or SW + AD + C (Table 1).
Growth of colonies fed SW + AD appeared to keep


0.04


S0.03

0.02


S0.01


0.00


artificial diet


crickets


Fig. 3. Retrieval rates (g dry weight/h) for S. invicta
richteri foraging on entomophage diet v. crickets.


December 2003


0







Vogt: Growth of Hybrid Fire Ant Laboratory Colonies


TABLE 1. MEAN (SE) MASS OF HYBRID IMPORTED FIRE ANT COLONIES FED 3 DIFFERENT DIETS FOR 8 WK.

Queen mass Brood mass Worker mass Total mass
Treatment (mg) (mg) (mg) (mg)

Sugar water + crickets 20.0 2.0 a' 24.0 5.1 a 15.1 3.0 a 39.1 7.8 a
Sugar water + artificial diet 14.1 1.3 b 4.3 4.3 b 5.6 3.7 b 9.9 7.9 b
Sugar water + crickets + artificial diet 24.1 1.3 a 23.2 3.9 a 10.6 2.2 ab 33.7 5.8 a

Means in a column followed by the same letter are not significantly different (Least Squares Means, P > 0.05).


pace with growth in other treatments until ap-
prox. 4 wk into the experiment, but data were
only collected at 8 wk. No apparent differences in
worker size, color, or behavior were noted at the
end of the experiment.

DISCUSSION

Discovery, recruitment, and retrieval rates in-
dicate that the entomophage artificial diet is
readily taken by laboratory fire ant colonies. Ac-
tual consumption was not measured, but foragers
appeared to store large amounts of the diet in and
around nest cells. Reconstituting the diet prior to
presenting it to colonies increased the rate of re-
trieval. Low P-value for the analysis in experi-
ment 4 suggests that fresh diet may be slightly
more attractive than reconstituted diet; however,
foragers were highly attracted to reconstituted
diet in all experiments.
Fire ant colonies denied insect prey may canni-
balize larvae (Sorensen et al. 1983) or produce ab-
normal, unmelanized workers (Williams et al.
1987). Workers appeared normal at the end of the
colony growth study (e.g., no apparent change in
color or size). While workers were not observed
cannibalizing larvae during the experiment, that
behavior could have contributed to the sharp de-
cline in brood for colonies fed SW + AD. The de-
cline in brood could explain lower queen weight in
those colonies, as queen fecundity and ovarian de-
velopment is tightly linked to presence of 4th in-
star larvae (Tschinkel 1995). The total mass of
colonies fed SW + AD was 75% lower than mass of
colonies fed SW + C. Porter (1989) reported that
colonies fed crickets, sugar water, and an artificial
diet based on Bhatkar and Whitcomb (1970) also
exhibited growth indistinguishable from colonies
fed crickets and sugar water only.
The artificial entomophage diet tested in these
studies may have some utility as an attractive bait
for monitoring fire ant presence or activity in the
field, or as a hydratable carrier for toxins in home
bait stations; however, it offers no advantage alone
or in combination with a standard cricket diet for
rearing fire ant colonies in the laboratory.


ACKNOWLEDGMENTS

I thank J. R. Davis (USDA-ARS-BCMRRU) for ex-
pert technical assistance and maintenance of laboratory
colonies. S. D. Porter and F. M. Davis provided helpful
comments on an earlier version of the manuscript. R. K.
Vander Meer (USDA-ARS-CMAVE) confirmed hybrid
status of laboratory colonies. T. Kondo (Auburn Univer-
sity) provided translation. D. Boykin (USDA-ARS) pro-
vided statistical advice.

LITERATURE CITED

BANKS, W. A., C. S. LOFGREN, D. P. JOUVENAZ, C. E.
STRINGER, P. M. BISHOP, D. F. WILLIAMS, D. P.
WOJCIK, AND B. M. GLANCEY. 1981. Techniques for
collecting, rearing, and handling imported fire ants.
USDA Tech. Bull. AATS-S-21, 9 pp.
BHATKAR, A. P., AND W. H. WHITCOMB. 1970. Artificial
diet for rearing various species of ants. Florida Ento-
mol. 53: 229-232.
COHEN, A. C., AND L. K. SMITH. 1998. A new concept in
artificial diets for Chrysoperla rufilabris: The effi-
cacy of solid diets. Biol. Control 13: 49-54.
KHAN, A. R., H. B. GREEN, AND J. R. BRAZZEL. 1967.
Laboratory rearing of the imported fire ant. J. Econ.
Entomol. 60: 915-917.
LITTELL, R. C., G. A. MILLIKEN, W. W. STROUP, AND R.
D. WOLFSINGER 1996. SAS System for Mixed Mod-
els. SAS Institute, Cary, NC. 633 pp.
PORTER, S. D. 1989. Effects of diet on the growth of lab-
oratory fire ant colonies (Hymenoptera: Formicidae).
J. Kansas Entomol. Soc. 62: 288-291.
SORENSEN, A. A., T. M. BUSH, AND S. B. VINSON. 1983.
Factors affecting brood cannibalism in laboratory
colonies of the imported fire ant, Solenopsis invicta
Buren (Hymenoptera: Formicidae). J. Kansas Ento-
mol. Soc. 56: 140-150.
TSCHINKEL, W. R. 1995. Stimulation of fire ant queen fe-
cundity by a highly specific brood stage. Ann. Ento-
mol. Soc. America 88: 876-882.
VANDER MEER, R. K., AND C. S. LOFGREN. 1990. Chemo-
taxonomy applied to fire ant systematics in the
United States and South America. p. 75-84. In R. K.
Vander Meer, K. Jaffe, and A. Cedeno [eds.], Applied
Myrmecology: a world perspective. Westview Press,
Boulder, CO.
WILLIAMS, D. F., R. K. VANDER MEER, AND C. S. LOF-
GREN. 1987. Diet-induced nonmelanized cuticle in
workers of the imported fire ant, Solenopsis invicta
Buren. Arch. Insect Biochem. Physiol. 4: 251-259.







Florida Entomologist 86(4)


December 2003


ANTS (HYMENOPTERA: FORMICIDAE) ON NON-NATIVE NEOTROPICAL
ANT-ACACIAS (FABALES: FABACEAE) IN FLORIDA

JAMES K. WETTERER1 AND ANDREA L. WETTERER2
'Wilkes Honors College, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458

2Department of Ecology and Evolutionary Biology, Columbia University, New York, NY 10027


ABSTRACT

One of the best-known symbioses in the Neotropics is the association between ant-acacias
and Pseudomyrmex ants that live in the acacia's hollow thorns. We surveyed ants on two spe-
cies of ant-acacia, Acacia cornigera (L.) and Acacia sphaerocephala Schlechtendal & Cha-
misso, growing outside their native range at five sites in Florida. We found eleven ant species:
five native Florida ants (Brachymyrmex sp. nr. obscurior, Camponotus floridanus (Buckley),
Pseudomyrmex cubaensis (Forel), Pseudomyrmex ejectus (Smith), and Pseudomyrmex elong-
atus IM l,.i N two Neotropical exotics (Camponotus sexguttatus (Fabr.) and Pseudomyrmex
gracilis iF i, .. and four Old World exotics (Monomorium floricola (Jerdon), Paratrechina
longicornis (Latreille), Pheidole megacephala (Fabr.), and Technomyrmex albipes (Smith)).
Only the two Neotropical exotics, Ps. gracilis and C. sexguttatus, inhabited thorns with holes
that appeared to have been perforated by ants as entrances. For Ps. gracilis, and perhaps also
for C. sexguttatus, their association with ant-acacias in Florida represents the reconstitution
in an exotic locale of a facultative symbiosis evolved in the Neotropics.

Key Words: Acacia-ants, ant-plants, Camponotus, Pseudomyrmex, symbiosis

RESUME

Una de las simbiosis Neotropicales mas conocidas es la asociaci6n entire los cornizuelos y las
hormigas de Pseudomyrmex que viven en las espinas ahuecadas del corizuelo. Estudiamos
las hormigas en dos species del cornizuelo, Acacia cornigera (L.) y Acacia sphaerocephala
Schlechtendal & Chamisso, creciendo fuera de su rango native en cinco sitios de la Florida.
Encontramos once species de la hormiga: cinco hormigas nativas de la Florida (Brachy-
myrmex sp. nr. obscurior, Camponotus floridanus (Buckley), Pseudomyrmex cubaensis
(Forel), Pseudomyrmex ejectus (Smith), yPseudomyrmex elongatus Ni .. 1. dos ex6ticas Neo-
tropicales (Camponotus sexguttatus (Fabr.) y Pseudomyrmex gracilis Fl ... .y cuatro ex6ti-
cas del Viejo Mundo (Monomorium floricola (Jerdon), Paratrechina longicornis (Latreille),
Pheidole megacephala (Fabr.), y Technomyrmex albipes (Smith)). Solemente las ex6ticas Neo-
tropicales, Ps. gracilis y C. sexguttatus, ambas habitaban las espinas con los agujeros que
aparecian haber sido perforados como entradas por las hormigas. Para Ps. gracilis, y quizas
tambi6n C. sexguttatus, esta asociaci6n con los cornizuelos en la Florida represent la recon-
stituci6n en un locale ex6tico de una simbiosis facultativa desarrollada en el Neotr6pico.


Translation provided by author


One of the best-known Neotropical symbioses
is the association between Acacia trees and
Pseudomyrmex ants (Belt 1874; Janzen 1966;
1967; Holldobler & Wilson 1990). Thirteen Neo-
tropical Acacia species are "ant-acacias," special-
ized myrmecophytes that house ants in their
thorns and provide ants with extrafloral nectaries
and nutritious Beltian bodies (Seigler & Ebinger
1995). Thirteen Neotropical Pseudomyrmex ant
species obligately live in ant-acacias. Nine of
these species vigorously defend the Acacia from
herbivory and overgrowth by vines, whereas the
other four provide little or no defense (Ward
1993). In addition, numerous other ant species
live opportunistically in ant-acacias, but also nest
elsewhere, typically in hollow twigs (Wheeler


1913). Only two of these facultative symbionts,
Pseudomyrmex gracilis (Fabr.) and Camponotus
planatus Roger, are known to show specialized
behaviors in exploiting ant-acacia thorns.
The present study was motivated by our obser-
vation in September 1999 of Pseudomyrmex ants
living in an ant-acacia tree growing at Mounts
Botanical Garden in West Palm Beach, Florida.
We noticed a thorn on an Acacia cornigera (L.)
tree that had a round hole indicative of an ant en-
trance. Breaking open the thorn, we found it full
of adult Pseudomyrmex gracilis ants and brood.
This unexpected discovery of ants inhabiting
domatia of a non-native myrmecophyte con-
trasted with an earlier finding concerning an-
other well-known Neotropical myrmecophyte,







Wetterer & Wetterer: Ants on Non-native Ant-acacias


Cecropia obtusifolia Bertol. In Hawaii, where nei-
ther Cecropia nor ants are native, Wetterer (1997)
found no ants inhabiting the hollow trunks and
branches of the exotic Cecropia obtusifolia trees
that grow abundantly in the disturbed lowlands.
In the present study, we wished to determine
what ant species live on and in exotic ant-acacias
growing in Florida, a region devoid of both native
ant-acacias and obligate acacia-ants.

METHODS AND RESULTS

We contacted and visited numerous botanical
gardens around Florida looking for live ant-aca-
cia specimens, and found ant-acacias growing at
four locations in addition to Mounts Botanical
Garden: Fairchild Tropical Garden in Miami,
University of South Florida Botanical Garden in
Tampa, Walt Disney World in Orlando, and on the
property of G. Joyner in West Palm Beach.
On 10 May 2000, at Fairchild Tropical Garden,
we collected ants on three ant-acacias: one bull-
horn acacia tree, Acacia cornigera; and two bee
wattles, Acacia sphaerocephala Schlechtendal &
Chamisso. We found five ant species: Brachy-
myrmex cf. obscurior, Camponotus floridanus
(Buckley), Monomorium floricola (Jerdon),
Pseudomyrmex cubaensis (Forel), and Techno-
myrmex albipes (Smith) (Table 1). We found no
ant entrance holes on any thorns.
On 13 May 2000, at Mounts Botanical Garden,
we collected ants on one A. cornigera, grown from
seed. We found four ant species: Paratrechina lon-
gicornis (Latreille), Pseudomyrmex cubaensis,
Pseudomyrmex ejectus (Smith), and Pseudo-
myrmex gracilis (Table 1). As in December 1999,
we again noted smooth, round ant entrance holes
on thorns of this tree. The ants inhabiting the hol-
lowed thorns were Ps. gracilis.
On 19 May 2000, at University of South Flor-
ida Botanical Garden, we collected ants on one
small A. cornigera. We found a single Ps. gracilis
worker (Table 1) but did not observe any ant en-
trance holes.
On 21 May 2000, at Animal Kingdom, a part of
Walt Disney World, we collected ants on one A.
cornigera growing in a planter in the Africa sec-
tion. The tree was purchased in Miami; the store
had received it from a customer (J. Thompson,
pers. comm.). On this tree we found Brachy-
myrmex cf. obscurior workers on the trunk (Table
1). We found one thorn with a smooth, round ant
entrance hole. We broke open this one thorn and
found Camponotus sexguttatus (Fabr.) workers
and brood inside (Table 1).
On 12 June 2000, on Alexander Street in West
Palm Beach, we collected ants on anA. cornigera
grown from seed by G. Joyner. This tree differed
from the well-pruned trees we had examined in
botanical gardens because it had many dead
branches and twigs, which we were free to break


open. We also broke open many dead and live
thorns. We found four ant species: Brachymyrmex
cf. obscurior, Pheidole megacephala (Fabr.),
Pseudomyrmex elongatus (Mayr), and
Pseudomyrmex ejectus (Table 1). Inside many
dead twigs, we found Ps. ejectus colonies with
brood, including alates. In a few dead thorns we
found Pheidole megacephala, Pseudomyrmex
elongatus, and Pseudomyrmex ejectus, in some
cases with brood. None of the entrance holes to
these thorns were smoothly rounded, suggesting
that none were created by ants.

DISCUSSION

We found eleven ant species living on or in ex-
otic ant-acacia trees in Florida. Five of these ant
species are native to Florida (Brachymyrmex cf.
obscurior, Camponotus floridanus, Pseudomyrmex
cubaensis, Pseudomyrmex ejectus, Pseudomyrmex
elongatus), though the last three are also found in
the Neotropics (native/exotic designations from
Deyrup et al. 1988, 1989). Two ant species we
found are New World exotics (Camponotus sexgut-
tatus and Pseudomyrmex gracilis) and four are
Old World exotics (Monomorium floricola,
Paratrechina longicornis, Pheidole megacephala,
and Technomyrmex albipes). Of greatest interest
were Ps. gracilis and C. sexguttatus, the only ants
we found inhabiting Acacia cornigera thorns that
appeared to have been perforated by ants.
Pseudomyrmex gracilis ranges from Argentina
to Texas and the Caribbean (Kempf 1972; Jaffe &
Lattke 1994) and has invaded Hawaii and Florida
(Beardsley 1979; McGlynn 1999). The earliest Ps.
gracilis records in Florida were from Miami ca.
1960 (Whitcomb et al. 1972). By 1970, Ps. gracilis
was common throughout southeastern Florida, as
far north as West Palm Beach (Whitcomb et al.
1972), and by 1988, Ps. gracilis was found from
the Florida Keys north to Duval County, near the
Georgia border (Johnson 1986; Deyrup et al.
1988, 1989). Pseudomyrmex gracilis opportunisti-
cally nest in acacias, providing little or no defense
for the tree, but also commonly nests in hollow
branches, twigs, and stems, as well as building
crevices (Buren & Whitcomb 1977; Cassani 1986;
Ward 1993; Klotz et al. 1995). Wheeler (1942)
found that Ps. gracilis, "though a very frequent
tenant of dead twigs and Cordia domatia in re-
gions where there are no Acacias, nevertheless
exhibits a strong proclivity not only to inhabit the
spines of these plants [ant-acacias], wherever
they are available, but also to perforate them at
the same point, to visit the foliar nectaries and to
collect food-bodies."
Camponotus sexguttatus ranges from Argen-
tina to Nicaragua and the Caribbean (Kempf
1972) and has invaded Florida and Hawaii (Mc-
Glynn 1999). The earliest known Florida speci-
mens date to 1993 (Deyrup et al. 2000). Our







Florida Entomologist 86(4)


TABLE 1. ANTS ON TWO SPECIES OF EXOTIC ANT-ACACIAS (ACACIA CORNIGERA AND ACACIA SPHAEROCEPHALA) IN FLORIDA.

Acacia cornigera Acacia sphaerocephala

M F D U W F F

Brachymyrmex "obscurior" X X X X X
Camponotus floridanus X
Camponotus sexguttatus X
Monomorium floricola X X
Paratrechina longicornis X
Pheidole megacephala X
Pseudomyrmex cubaensis X X X
Pseudomyrmex ejectus X X
Pseudomyrmex elongatus X
Pseudomyrmex gracilis X X
Technomyrmex albipes X X X

M = Mounts Botanical Garden, F = Fairchild Tropical Garden, D = Walt Disney World, U = University of South Florida Arbore-
tum, W = West Palm Beach.


observation is the first record ofC. sexguttatus in-
side the thorns of an ant-acacia. It is unclear
whether the C. sexguttatus simply occupy previ-
ously prepared thorns or if they perforate and hol-
low out the thorns themselves, as do another
species of carpenter ant, C. planatus. Camponotus
planatus ranges from Columbia to Texas and the
Caribbean (Kempf 1972) and has invaded Florida,
Hawaii, and the Galapagos Islands (McGlynn
1999). Like Ps. gracilis, Wheeler (1942) consid-
ered C. planatus "of special interest" because of its
specialized behaviors in exploiting ant-acacias.
Wheeler (1913) observed C. planatus workers per-
forating a new thorn, indicating that this species
does not merely take possession of thorns exca-
vated and abandoned by other ants, but actually
opens and excavates its own acacia thorns.
Wheeler (1913) considered it "extraordinary that
C. planatus, which throughout tropical America
so constantly lives in hollow twigs, should be able
in widely separated localities to utilize the acacia
thorns as perfectly and in precisely the same
manner as the regular Pseudomyrmas." Cam-
ponotus planatus occurs in southernmost Florida
(Deyrup et al. 1988), though we did not find any
on the ant-acacias we examined.
The native range of A. cornigera trees in Cen-
tral America and Mexico (Seigler & Ebinger 1995)
overlaps with the native ranges of both Ps. graci-
lis and C. sexguttatus ants. Thus, for Ps. gracilis,
and perhaps also C. sexguttatus, their association
withA. cornigera in Florida represents the recon-
stitution in an exotic locale of a facultative symbi-
osis evolved in the Neotropics. Seigler and
Ebinger (1995) report that naturalized popula-
tions ofA. cornigera occur in the Caribbean and in
southern Florida. In the future, we hope to study
the ant fauna of these and other non-native ant-
acacias populations.


ACKNOWLEDGMENTS

We thank S. Cover for ant identification; M. Wetterer
for comments on this manuscript; S. Wetterer for field as-
sistance; R. Wunderlin at the Institute for Systematic
Botany at the University of South Florida and K. Perkins
at the University of Florida Herbarium for information
on ant-acacia specimens collected in Florida; J. Thomp-
son for information on the acacia at Walt Disney World;
G. Joyner for information on and access to his acacia; and
Florida Atlantic University for financial support.

REFERENCES CITED

BEARDSLEY, J. W. 1979. Notes and exhibitions:
Pseudomyrmex gracilis mexicanus (Roger). Proc. Ha-
waiian Entomol. Soc. 23: 23.
BELT, T. 1874. The Naturalist in Nicaragua. J. Murray.
London, England.
BUREN, W. F., AND W. H. WHITCOMB. 1977. Ants of cit-
rus: some considerations. Proc. Internat. Soc. Citri-
cult. 2: 496-498.
CASSANI, J. R. 1986. Arthropods on Brazilian pepper-
tree, Schinus terebinthifolius (Anacardiaceae), in
south Florida. Florida Entomol. 69: 184-196.
DEYRUP, M., N. CARLIN, J. TRAGER, AND G. UMPHREY.
1988. A review of the ants of the Florida Keys. Flor-
ida Entomol. 71: 163-176.
DEYRUP, M., L. DAVIS, AND S. COVER 2000. Exotic ants in
Florida. Trans. American Entomol. Soc. 126: 293-326.
DEYRUP, M., C. JOHNSON, G. C. WHEELER, AND J.
WHEELER 1989. A preliminary list of the ants of
Florida. Florida Entomol. 72: 91-101.
HOLLDOBLER, B., AND E. O. WILSON. 1990. The ants.
Harvard University Press, Cambridge, MA. 732 pp.
JAFFE, K. AND J. LATTKE. 1994. Ant fauna of the French
and Venezuelan Islands in the Caribbean,. pp. 181-
190. In D. F. Williams [ed.]. Exotic ants: Biology im-
pact, and control of introduced species. Westview
Press, Boulder, CO. 332 pp.
JANZEN, D. H. 1966. Coevolution of mutualism between
ants and acacias in Central America. Evolution 20:
249-275.


December 2003







Wetterer & Wetterer: Ants on Non-native Ant-acacias


JANZEN, D. H. 1967. Fire, vegetation structure, and the
ant xAcacia interaction in Central America. Ecology
48: 26-35.
JOHNSON, C. 1986. A north Florida ant fauna (Hy-
menoptera: Formicidae). Insecta Mundi 1:243-246.
KEMPF, W. W. 1972. Catalogo abreviado das formigas
da regiao neotropical (Hymenoptera: Formicidae).
Stud. Entomol. 15:3-344.
KLOTZ, J. H., J. R. MANGOLD, K. M. VAIL, L. R. DAVIS,
JR., AND R. S. PATTERSON. 1995. A survey of the ur-
ban pest ants (Hymenoptera: Formicidae) of penin-
sular Florida. Florida Entomol. 78: 109-118.
MCGLYNN, T. P. 1999. The worldwide transfer of ants:
geographical distribution and ecological invasions. J.
Biogeogr. 26: 535-548.
SEIGLER, D. S., AND J. E. EBINGER 1995. Taxonomic re-
vision of the ant-acacias (Fabaceae, Mimosoideae,
Acacia, Series Gummiferae) of the New World. Ann.
Missouri Botan. Gard. 82: 117-138.


WARD, P. S. 1993. Systematic studies on Pseudomyrmex
acacia-ants (Hymenoptera: Formicidae: Pseudomyr-
mecinae). J. Hymenopt. Res. 2: 117-168.
WETTERER, J. K. 1997. Ants on Cecropia in Hawaii. Bio-
tropica 29: 128-132.
WHEELER, W. M. 1913. Observations on the Central
AmericanAcacia ants, pp 109-139. In K. Jordan and
H. Eltringham [eds.]. Transactions of the Second En-
tomological Congress 1912, Watson & Viney Ltd.,
London. 489 pp.
WHEELER, W. M. 1942. Studies of Neotropical ant-
plants and their ants. Bull. Mus. Comp. Zool. 90: 1-
262.
WHITCOMB, W. H., H. A. DENMARK, W. F. BUREN, AND J.
F. CARROLL. 1972. Habits and present distribution
in Florida of the exotic ant, Pseudomyrmex mexica-
nus (Hymenoptera: Formicidae). Florida Entomol.
55: 31-33.







Florida Entomologist 86(4)


December 2003


TAXONOMY AND BEHAVIOR OF PHOTURIS TRIVITTATA SP. N.
(COLEOPTERA: LAMPYRIDAE: PHOTURINAE); REDESCRIPTION
OF ASPISOMA TRILINEATA (SAY) COMB. N. (COLEOPTERA:
LAMPYRIDAE: LAMPYRINAE: CRATOMORPHINI)

JAMES E. LLOYD1 AND LESLEY A. BALLANTYNE2
1Department of Entomology and Nematology, University of Florida
P.O. Box 110620, Gainesville, FL 32611-0620, USA

2School of Agriculture, Charles Sturt University, P.O. Box 588, Wagga Wagga, N.S.W. 2678, Australia

ABSTRACT
Photuris trilineata (Say) is assigned to Aspisoma Laporte, and the type female is re-
described. Photuris triuittata sp. n. is described from behavior voucher specimens, and be-
havioral data are presented and discussed. Aspects of abdominal segmentation and aedeagal
structure ofAspisoma and Photuris are described.

Key Words: flash patterns, ecology, predation, neotropical fireflies

RESUME
Photuris trilineata (Say) es asignado alAspisoma Laporte, y el tipo de hembra es redescrito.
Photuris triuittata sp. n. se describe de acuerdo a los comportamientos de los especimenes
comprobantes y los datos de los comportamientos son presentados y discutidos. Aspectos so-
bre la segmentaci6n abdominal y el edeago del Aspisoma y Photuris son descritas.


Translation provided by author.


Say (1835) described Lampyris trilineata from
a female now housed in the Museum of Compara-
tive Zoology at Harvard University. Olivier (1886)
assigned L. trilineata to Photuris but did not ex-
amine the type and appears to have based his ac-
tion on the similarity of the described color
patterns. Lloyd tentatively assigned the behavior
voucher specimens included here to Photuris tri-
lineata (Say), but after locating and examining
the type female of L. trilineata he determined
that trilineata should be assigned to Aspisoma
and that his specimens were of a new species.
Olivier's collection in the Paris Museum was ex-
amined by Ballantyne in November 1993. Oliv-
ier's methodical collection often reflects the
chronology of his published work, and standing in
the Olivier collection under Photuris trilineata
(Say) were specimens of Photuris which are con-
specific with the specimens described below.
Lampyris trilineata Say is assigned to Aspisoma;
Olivier's firefly apparently has remained un-
named, and is herein described as Photuris triuit-
tata. JEL provided the biological data; LAB
provided the taxonomic framework.

Taxonomy

Taxonomic characters follow Ballantyne
(1987a, 2000) with exception of abdominal seg-
mentation and aedeagal structures, which are


discussed separately below. Descriptions are or-
dered so that features on the dorsal surface are
described in sequence from the anterior to poste-
rior end, and then the ventral surface is described
in the same manner. This facilitates handling un-
der the microscope. Length, measured as median
length of pronotum plus maximum length of an
elytron, is sometimes a misleading representation
since the pronotum droops in pinned specimens,
and the specimen will always appear shorter than
the figure given. The length of the head, which
may protrude to a variable extent in males, is not
included. Measurements (i.e., lengths) taken at
the longest and widest areas respectively, such as
pronotal width, greatest head width in anterior
aspect, are used on a comparative rather than ab-
solute basis (Lampyrids being soft bodied are sub-
ject to much distortion)-for example the distance
between the antennal sockets is given as a func-
tion of the nearest convenient point of reference,
the width of an antennal socket.
McDermott (1964) distinguished the Photuri-
nae with a "membranous labrum arising from the
ventral surface of a strongly sclerotized clypeus."
The nature of the labrum was reinterpreted by
John Lawrence (1987): in the cantharoids there is
probably never a well-developed clypeus sepa-
rated from the frons by a complete frontoclypeal
suture. In most Lampyridae the labrum is at least
slightly sclerotized and separated from the clypeus







Lloyd & Ballantyne: Taxonomy and Behavior ofPhoturus trivittata


by a strip of membrane. The anterior strongly
sclerotized plate on the Photurinae head is here
interpreted as the labrum.
While specimens were still soft and flexible
many aedeagi were extruded by the collector
(JEL), and remain attached to the specimen, usu-
ally with the basal piece still encased between
ventrite 9 and tergite 9 (the "aedeagal sheath" of
Ballantyne 1987a, b), and often hidden. Some
aedeagi were removed and mounted on transpar-
ent points, using transparent glue, and re-
mounted beneath the specimen (specimens were
softened for 2-3 days in a humid atmosphere in an
airtight container with moist sand with a few
drops of Lysol to retard mold).
The two specimens selected for scanning elec-
tron microscopy were dried pinned specimens
which had the aedeagus extended. They were
mounted on aluminum stubs using double sided
semitransparent tape and coated with gold in a
Denton Vacuum Desk II Cold Sputter Etch Unit,
and examined in a Hitachi 570 scanning electron
microscope at an accelerating voltage of 15 KV.
The operation was carried out as part of a class
exercise in the Department of Entomology and
Nematology at the University of Florida in
Gainesville, under the direction and assistance of
Prof. Harvey Cromroy. The type female of Lampy-
ris trilineata Say was not dissected, and drawings
represent the specimen in its actual state at the
time of examination. Specimens are currently
housed in the JEL collection in Gainesville
(JELC), or the Florida State collection of Arthro-
pods (FSCA).
Abdominal segmentation. Abdominal segmen-
tation is interpreted from Ballantyne (1987a,
1992). Terminology of the ventral abdominal
plates has varied. Green (1956) used "sternite" for
the median half of each ventral segment in Photi-
nus and considered the lateral area on each side
the pleurite, which is narrowly inflexed dorsally
and bears the spiracles. Crowson (1972) called the
ventral abdominal plates "ventrites" but (page 39)
referred the spiracles to the "inflexed edges of the
sternal plates." A refinement of the definition of
the term "ventrite" in the Lampyridae was pro-
posed (Branham & Archangelsky 2000).
The abdomen ofAspisoma and Photuris males
(Figs. 4 and 15) consists of 8 visible tergites, al-
though the first may be difficult to distinguish.
Segments 2-8 are distinguishable ventrally. The
light organs occupy the ventral plates of seg-
ments 6 and 7. Ventrite 8 is well developed al-
though it is usually shorter than 7. Ventrite 9
(which surrounds the aedeagus) is usually visible
externally, protruding beyond the posterior mar-
gin of ventrite 8, and completely covered dorsally
by the relatively large tergite 8.
The Aspisoma abdomen is broad, flattened, ta-
pering at front and behind (Figs. 3 and 4); the dor-
sally reflexed lateral margins of the ventrites


bear the spiracles which are covered by the lat-
eral tergal margins and difficult to see in pinned
specimens; the light organ in males and females
occurs in ventrites 6 and 7 (Figs. 3 and 4) but may
be considerably retracted from the lateral areas
in females; depressions in lateral areas of ven-
trites 6 and 7 probably house sense organs (Lloyd
& Ballantyne, pers. obs.); ventrite 8 is transverse,
about half as long and wide as 7, with the median
posterior margin emarginate; aedeagal sheath
(= ventrite and tergite 9) when visible externally
is turned on its side; tergite 8 about as long as, but
narrower than, tergite 7.
The male Photuris abdomen (Fig. 15) has ven-
trites 6 and 7 often medially emarginate posteri-
orly; ventrite 8 always tapers posteriorly, is
usually about half as long as 7, although some-
times retracted beneath 7; the median posterior
margin of ventrite 7 always has a pointed projec-
tion of varying length; tergite 8 often has lateral
margins reflexed; aedeagal sheath ventrite and
lateral projections of aedeagus sometimes visible
behind ventrite 8. The female abdomen has light
organs apparently contained in ventrites 6 and 7;
ventrite 8 tapers posteriorly and may be medially
incised (Fig. 16).
Aedeagal structure. The aedeagus ofAspisoma
most closely approaches that of the Luciolinae
(Ballantyne 1987a, b, 2000), in having a clearly
defined median lobe, lateral lobes (which may be
slightly longer or shorter than the median lobe),
and an elongate well defined basal piece. The me-
dian lobe is elongate, slender, and often medially
carinate along the dorsal surface; lateral margins
of the median lobe can expand and are variably
developed. Small hooks may arise from the inner
face of the lateral lobes and in A. physonotum
they engage against the median dorsal carina of
the median lobe (Ballantyne 1992).
The aedeagus of Photuris spp. consists of me-
dian and lateral lobes and a basal piece, and
paired long slender processes extending from the
sides of the basal piece (Figs. 17 and 18). These
pieces "splay" to varying degrees in pinned speci-
mens, and the full extent of the basal piece is not
always visible in specimens where the aedeagus
is still attached to the abdomen.
Barber (1951) described the Photuris aedea-
gus: "sides of the 'basal piece' are produced into
long slender, clubbed, lateral processes extending
beyond the apex of a slender median lobe". McDer-
mott (who completed Barber's manuscript after
his death), included figures (Figs. 2 and 3) of Pho-
turis lucicrescens aedeagus which was unlabeled
but described in the text as having "the lateral
lobes fuse with the dorsal surface of the median
lobe at about basal third, and are armed inter-
nally opposite this point with a strong transverse
ridge, which is sharply angulate at inner third".
McDermott (1962) figured 3 unlabeled Photuris
spp. aedeagi and (1964) referred to the Photuris







Florida Entomologist 86(4)


aedeagus with 2 long slender lateral processes,
but did not determine their origin. Lloyd (1979,
1981) pictured a copulating Photuris spp. pair,
and attributed the lateral processes of the aedea-
gus to the basal piece (as Ballantyne does here)
(Lloyd 2002); the picture shows that these pieces
remain outside the female during intromission.
Photuris trilineata was used (as Photuris sp.)
as the outgroup in a cladistic analysis of Austra-
lian Luciolini (Ballantyne & Lambkin 2000).

Aspisoma trilineata (Say) comb. n.
Figs. 1-3

Lampyris trilineata Say, 1835, p. 157.
Photuris trilineata (Say).Olivier, 1886, p. 232;
1910, p. 52. McDermott, 1966, p. 92 (misiden-
tification).
Type. Holotype female, Mexico (Museum of Com-
parative Zoology, Harvard University).
Redescription of type female. Length:13.7 mm.
Color: Pronotum dingy yellow with dark brown
markings on median area of dorsal surface (Fig.
1); pronotum largely semitransparent, and pale
pink and yellow fat body visible through the cuti-
cle; mesonotum light brown; mesoscutellum dark
brown, darker in posterior area; elytra medium
brown, with lateral, apical and sutural margins,









fA










LO
LO

1 2 4
Figs. 1-4. (1-3) Aspisoma trilineata holotype female:
(1) dorsal aspect of pronotum and left elytron (position
of hair swirl pattern indicated on pronotum); (2) ventral
surface of epipleural margin of left elytron; (3) ventral
surface of terminal abdomen. (4) Aspisoma physonotum
male: ventral surface of terminal abdomen. Scale lines
are 1 mm. FB, fat body; LO, light organ; ST9, ventrite 9.


and longitudinal interstitial lines dingy yellow
(Fig. 1); head yellow; antennae, palpi and labrum
light brown; ventral surface of pro- and mesotho-
rax medium brown, of metathorax moderately
dark brown; legs medium brown with dark brown
tarsi; abdominal ventrites yellow with brown
mottling; compact light organ material defined in
median area of ventrite 7 only, although ventrite
6 bears a diffuse median area of fat body (Fig. 3).
Body covered with fine short pale setae, which
have been abraded in certain areas. Pronotum
(Fig. 1) 4.2 mm long, 6 mm wide; with dense cov-
ering of short fine pale setae; setal swirls originate
in positions marked (Fig. 1); dorsal surface with
median ridge extending posteriorly from anterior
margin for about 13 length of the pronotum; ante-
rolateral corners of pronotum rounded obtuse;
posterolateral corners rounded; lateral margins
diverging posteriorly along most of their length,
and widely flattened especially in the posterior
half. Elytra (Fig. 1) 9.5 mm long; convex-sided
when closed; laterally explanate margins well de-
veloped, especially in anterior /2 (Fig. 2); 4 inter-
stitial lines present, of which the most lateral line
is evanescent anteriorly and posteriorly; epipleu-
ron and sutural ridge extending to and around
apex of elytron. Head small, completely retracted
into and beneath pronotum in resting condition;
greatest head width 2.2 mm; smallest interocular
width 0.8 mm; antennal sockets separated by
more than width of an antennal socket; head not
depressed between eyes; mouthparts well devel-
oped. Terminal ventrites as figured (Fig. 3).

Photuris trivittata sp. n.
(Fig. 23 habitus)

Type Specimens (Currently housed in JELC,
Gainesville). Holotype male: MEXICO. Tabasco:
27 km w Cardenas at CSAT, 1980, J E Lloyd
(M805*). Paratypes: same locality as holotype,
16.X.1980, 3 males (M809*, M8010*, M8015*);
18.X.1980, 1 male (M8027* used for SEM);
23.X.1980, 1 male (M8048*); 28.X.1980, 3 males,
1 female (M80104*, M80108*, M80103*,
M80116); same locality and collector as for holo-
type, 1980: 16.X.1980, 1 female (M8050), 1 male
(M803, CSAT); 17.X.1980, 1 female (M8025);
20.X.1980, 1 male (M8037); 21.X.1980, 2 males
(M8044 macerated, M8047), 1 female (M8046); 23
X.1980, 3 males (M8052, 8053, 8055), 1 female
(M8049); 28.X.1980, 2 males (M80109, 80114), 5
females (M80106, M80111-113, 80115). Carde-
nas, nr hotel Siglo XX, 27.X.1980, J E Lloyd, 1
male (M8093*), 1 female (M8059) (JELC). Can-
cun, Quintana Roo State, D Thomas & J Burne,
10.VIII.1990, 1 male (FSCA). Chiapas: Palenque,
D. Thomas, 16-20.V.1985, 1 male, 2 females
(FSCA); Parque Lag. Belgica, D Thomas, J
Burnie, 5-6. VII.1989, 1 female (FSCA); 5 mi N Ix-
huatan, B Ratcliffe, C Messenger, 9-16.IX.1985, 1


December 2003







Lloyd & Ballantyne: Taxonomy and Behavior ofPhoturus trivittata


female (FSCA); Lago Montebello, D Thomas, J
Mackley, 15.VI.1985, 1 female (FSCA); Simojovel,
D Thomas, 23.VIII.1987, 1 female (FSCA); Chi-
coasen Dam area, D & A Thomas, 10.IX.1988, 1
female (FSCA). Comitan, 31 mi SE of Chis, Burke
et al., at light, 17.VI.1965, 2 females. Veracruz,
Dos Amates Mun. Catemaco, P Hubbell, 4-
14.XI.1972, 1 female. BELIZE. Orange walk, Sept
1986, D Thomas, 1 male, 1 female (FSCA).
COSTA RICA. Guanacaste, 2.7 mi NE La Cruz on
Pan Amer. Hwy, 27.IX.1961, Hubbell et al.,
1 female (pink), GUATEMALA. Dept. Isabel,
Quirigua, 11.1.1937, 240 ft C. Roys, 1 male (pink);
Peten, Pasion River at Cambio, 20.IV.1935,
Hubbs-Vander Schalie, 1 female (pink); Su-
chitepe-quez, Dept. E of Cocales, 400-500 m,
2.XII. 1983, fish on grnd, J Schuster, 2 females
(JELC); Peten Tikal, 100 ft, I. Cantrall, 1 female
7.II.1956, at light at camp (pink), 1 female
17.II.1956 (pink), 1 female 13.III.1956 (pink), 1
female 31.III.1956 (pink). HONDURAS. Dept.
Morazan, Esc. Agr. Pan. Zamborano, T Hubbell,
2550 ft 18.VIII.1948 (vega Yeguare R., 1 female
(pink); 2600 ft (hortaliza), 13.VII.1948, 2 females
(pink); 2600 ft (creek bank) 19.VII.1948, 2 males
(pink); 2600 ft 30.VII.1948, 1 female (pink). Tela,
6.IV.1923, T Hubbell, 1 male, 1 female (pink).
(Specimens "*" in the collection of JEL may
bear a green label "semiosystematic voucher spec-
imen, James E Lloyd". A further lettered and
numbered label on each specimen relates to field
records kept by the collector.)
Male. Length: 13-15 mm long holotypee 14 mm).
Color: Pronotum yellow with median brown
markings (Figs. 5-10), semitransparent; fat body
visible through cuticle in posterolateral corners is
yellow, in median area is pink; mesoscutellum and
metanotal plates yellow; elytra brown, with broad
lateral, narrow apical and narrow sutural mar-
gins yellow, and 2-3 longitudinal yellow intersti-
tial lines; (Figs. 11 and 12 show variation; the
coloration gives the appearance of 3-4 brown
stripes); head yellow, anterior margin of labrum
dark brown; antennae brown, basal portion of all
segments narrowly yellow; maxillary palpi mostly
brown, penultimate segment yellow at base, en-
larged terminal segment yellow on inner face; la-
bial palpi yellow; ventral prothorax yellow; legs 1
yellow with brown tarsi, brown apices of tibiae,
and brown markings on femora at inner and outer
basal and apical surfaces; mesopleura brown, me-
sosternum yellow; legs 2 marked as for legs 1 ex-
cept for basal tarsomere which is brown at apex
only; ventral metathorax brown; basal abdominal
ventrites dingy to brownish yellow, semitranspar-
ent and fat body is visible through cuticle; light or-
gan in ventrites 6 and 7 creamy yellow; ventrite 8
yellow; basal abdominal tergites medium brown,
terminal 3 tergites pale yellow.
Pronotum 3.3-3.9 mm long; 5.2-5.9 mm wide;
setal swirl pattern distinctive (Fig. 19); pronotal


10

9n



10


14

LO




15 16


17 18


Figs. 5-18. Photuris triuittata sp. n. (5-10) Dorsal
surface of pronotum (5) M805 detail-dense stippling
represents dark brown markings, less dense stippling
represents pink fat body, least dense stippling repre-
sents yellow fat body; (6) M80116 female; (7) M809
male; (8) M8010 male; (9) M80104 female; (10) M8015
male (single dotted line represents extent of fat body
visible through cuticle). (11, 12) dorsal surface of left
elytron (11) M8027 male; (12) M809 male. (13, 14) ante-
rior aspect of head (13) M8048 male; (14) right side only
M80116 female. (15, 16) ventral view of terminal ab-
dominal segments (15) M8027 male; (16) M80116 fe-
male. (17, 18) aedeagus (17) left lateral M805 holotype
male; (18) dorsal M805 holotype male. Scale lines are 1
mm. BP, basal piece of aedeagus; EO, ejaculatory orifice;
LL, lateral lobe aedeagus; LO, light organ; ML, median
lobe aedeagus.


punctures small, shallow, separated by up to their
width and evenly distributed over dorsal surface;
hypomera open in front; lateral pronotal margins
diverging along anterior half or more with some
convergence in posterior area; anterolateral cor-
ners obliterated; posterolateral corners rounded
obtuse; anterior margin narrowly explanate; lat-
eral margins widely flattened along their length
and anterior area as wide as posterior area; out-
line as figured (Figs. 5 and 19). Elytra with 3 in-
terstitial lines well defined by their pale color but
not well elevated relative to the sutural ridge
(Fig. 23); epipleuron not extending posteriorly
beyond mid point of elytron; sutural ridge evan-







Florida Entomologist 86(4)


Figs. 19-21. Photuris triuittata sp. n. Electron micrographs. (19) M8027 male, dorsal surface of pronotum, dotted
scale line 1.36 mm; (20) M80108 male, anterior aspect of head, antennal sockets, dotted scale line 0.5 mm; (21)
M8027 male, dorsal aspect of aedeagus, dotted scale line 0.75 mm.


December 2003






Lloyd & Ballantyne: Taxonomy and Behavior ofPhoturus trivittata


I


j.


.


g.


Figs. 22a-1. Chart traces of Photuris trivittata flashes, except for "d" an Aspisoma sp., detected in the field with
a photomultiplier system, recorded on magnetic tape, then chart traced at two different speeds. Horizontal axis is
time; vertical axis, relative intensity. Time scale is indicated by bars: bar in "b" applies to b, e, h; bar in "d" applies
to all others. (a) Single flash of male; (b) five single flashes in sequence emitted by a perched male; (c) modulated
flash of about 8.3 Hertz (Hz, cps); (d) modulated flash of co-active Aspisoma sp. with form similar to that of certain
flashes emitted by P. trivittata, but at a much slower modulation rate, averaging 4.8 Hz (5.3 and 4.2 Hz); (e) flashes
of female with short train of rapid flashes; (f, g) individual female flashes; (h) train of bimodal rapid flashes of a
perched male; (i-l) male flashes from train in "h".


escent before elytral apex. Head slightly to mod-
erately exposed in front of pronotum in
withdrawn condition; gently excavated between
eyes; eyes widely separated on ventral surface;
greatest head width 2.8-3.3 mm; antennal sockets
close but not contiguous (Figs. 13 and 20); mouth-
parts well developed, apical segment of labial


palpi lunate (Figs. 13 and 20); labrum wider than
long, well sclerotized, separated from head by an
inflexible suture and bearing short rounded pro-
jections along its anterior margin; antenna
length 2-3 times greatest head width; flagellar
segment 1 short, half as long as flagellar segment
2, remaining flagellar segments long, slender,


b.


H-I
0.5 sec.


0.2 sec.


h.




tLM IlUl







Florida Entomologist 86(4)


Fig. 23. Habitus of Photuris trivittata male from
near Cardenas, Tabasco, Mexico. Note the distinctive
and diagnostic (for the present) elytral vittae. The split,
median pronotal vitta in Cardenas specimens differs
considerably from vittae occurring in North American
Photuris species. This is a carbon dust drawing by
Laura Line.


simple, much longer than wide, and narrowing to-
wards apex. Abdomen with median posterior
margin of ventrite 8 narrowly prolonged and api-
cally rounded (Fig. 15). Aedeagus (Figs. 17, 18,
and 21) with median lobe narrowing at apex, not
projecting posteriorly beyond apices of lateral
lobes; lateral lobes closely approximate dorsally,
narrowly overlapping at base in ventral aspect,
and shallowly excavated in apical 1/5; aedeagus
bearing elongate slender projections bearing sense
organs on their apical inner surface (Fig. 21).
Female. Length: 13 mm long. Macropterous;
colored as for male; head slightly smaller than
that of male (Fig. 14); light organ in ventrites 6, 7;
ventrite 8 narrowing posteriorly, median poste-
rior margin emarginate (Fig. 16).

Flashing and Ecology

Photuris trivittata was observed on the cam-
pus of the Agriculture School at Cardenas,
Tabasco, Mexico, at the edge of small woods along
an irrigation ditch and mowed roadside. Occur-


(


December 2003


ring with it at this site were about a dozen flash-
ing species of Photinus, Photuris, and Aspisoma.
Female trivittata hunted males of at least one
other Photuris species in an adjacent field, and an
Aspisoma species near the woods, via aggressive
mimicry (sensu Wickler 1968; Pasteur 1982;
Lloyd 1964, 1984). At a nearby site near an irriga-
tion canal, this same firefly displayed a sedentary
flashing-feeding behavior previously unreported
for Photuris fireflies.
Evening flashing activity at the ditch site be-
gan about one-half hour after sunset (x-bar = 33
min, 1.5 crep (i.e., civil twilight duration, see
Neilsen 1963); range = 24-40 min, 1.1-1.8 crep; n
= 6, 17-28 Oct 1980), in the shrubs and under-
story, and quickly moved up and around the can-
opy foliage of the trees. The most common male
flashing pattern observed at this site was a short
flash (base duration ca 52 mSec, Fig. 22a), that
was emitted in continuous sequence at 1.2-1.4
sec, quite-regular intervals (Fig. 22b; 27.2C; Ta-
ble 1). Perched males also emitted this pattern,
and they as well as flying males could be at-
tracted (via penlight) close from 20-30 meters
above ground, by flashing a short flash immedi-
ately after each of their flashes. On one occasion
about 15 males were seen perched in a low tree,
each facing outward with head and neck ex-
tended, flashing this pattern. This pattern was
also emitted amongst and around the tips of the
fronds of oil palms at the second site.
Males high in the trees at the first site occa-
sionally appeared to emit a bimodal flash pattern,
with the two peaks appearing 20-30 mSec apart.
However, photo-multiplier recordings of what
were verbally noted as this "fast double", showed
that it was a short flicker of 3-4 modulations (Fig.
22c) with a mean modulation rate of ca 8.0 Hertz.
The mean pattern period of this signal was 2.4 sec
(27.2C; Table 1). This pattern is similar in form
to that of a co-active Aspisoma species at this
ditch site, but the modulation rates of the two are
different (cf. Figs. 22c, d). Male P trivittata some-
times emitted a longer flash, which had an esti-
mated duration of about 300 mSec.
Across campus at the second site, near a large
irrigation canal, male and female Photuris of two
species perched in aggregations on the seed-
heads of a tall Bahia grass, Paspalum virgatum.
They "mouthed", chewed or licked, the seeds,
which were coated with a sticky material. Each of
the two mixed groups observed numbered 20-30
individuals and extended along the canal about
30 ft. The groups were about 200 ft apart and a
few isolated individuals perched and flashed in
the grass extending along the canal bank between
them. Males and females on the grass heads emit-
ted sequences (trains) of short flashes, and fire-
flies in these aggregations had a tendency to flash
together in bouts of up to about 1 minute dura-
tion, separated by relatively dark periods.







Lloyd & Ballantyne: Taxonomy and Behavior ofPhoturus trivittata


TABLE 1. FLASH DATA FROM ELECTRONIC RECORDING AND STOPWATCH MEASUREMENTS. FLICKER MODULATION RATES
ARE EACH FOLLOWED BY THE NUMBER OF MODULATIONS USED TO CALCULATE THE RATE INDICATED. MEANS
ARE INDICATED BY "x"; STANDARD DEVIATION BY "S". NUMBERS IN BRACKETS ARE ID NUMBERS OF INDIVID-
UAL MALES ON CHART RECORDS THAT ARE ARCHIVED WITH THE VOUCHER SPECIMENS AND FIELD NOTE BOOKS.

A. Data from photo-multiplier recordings

Male no. Observations x s.d. Temp.


Short flash period
1. 1.35, 1.35, 1.36
3. 1.19, 1.18, 1.18, 1.18, 1.18, 1.17, 1.14, 1.16
4. 1.27, 1.23, 1.24, 1.22, 1.20, 1.20, 1.20, 1.21,
1.22, 1.22, 1.22, 1.23, 1.23, 1.24, 1.24, 1.22, 1.22 (perched)


1.25, 1.24, 1.23, 1.25, 1.25, 1.23
1.25, 1.25, 1.24, 1.24
1.24, 1.26, 1.25, 1.18, 1.19, 1.11, 1.19, 1.23, 1.23, 1.23
1.28, 1.28, 1.27, 1.27, 1.25, 1.27, 1.23, 1.20,
1.22, 1.24, 1.23, 1.22, 1.21, 1.21, 1.21
Combine 5 males @ 27.2C: x = 1.23 Sec., s.d. = 0.02


Flicker pattern period
9. 1.80, 2.26, 1.94
10. 2.30
11. 2.48
Combine 2 males @ 27.2C: x = 2.39 Sec., s.d. = 0.13

Flicker modulation rate
9. 9.6/3, 9.6/2, 8.9/3, 8.8/3, 9.0/3
10. 8.5/3, 8.2/3
11. 7.5/4, 7.4/4
Combine 2 males @ 27.2C: x = 8.0 Sec., s.d. = 0.6

Short flash duration
Y = 70 flashes (8 males) pm-recorded; 64 flashes from 8 males usable:
8 flashes, 2 males: x = 53 mSec, r = 51-56 mSec, 26.1C, 23-X-80.
6 flashes, 1 male: x = 48 mSec, r = 46-51 mSec, 25.8C, 26-X-80.
50 flashes, 5 males: x = 52 mSec, r = 48-62 mSec, 27.2C, 28-X-80.

B. Flash pattern period data from stop watch records
3 males: 1.4 1.4 1.4; = 1.4, 26.1C
3 males: 1.4 1.4 1.4; = 1.4, 26.1C
6 males: 1.4, 1.3-1.4; x = 1.4, 26.1C
2 males: 1.6 1.6; = 1.6, 24.4C
1 male: 1.3, 26.7C


26.1C
25.8C
27.2C


27.2C
27.2C
27.2C
27.2C


25.8C
27.2C
27.2C




25.8C
27.2C
27.2C


Flash rate within an individual's train was not
constant. A few (5-15) rhythmic flashes were emit-
ted in rapid succession, then rate slowed and be-
came much less regular (Fig. 22e). Brief (ca 10-sec,
25.8C) recordings of the flashes of several individ-
uals on seeds suggest that there may be sexual dif-
ferences. In a sample of four males and four females,
the flashes of two males are nearly all bimodal,
while those of females are all unimodal (Figs. 22e-1).
Male flashes are longer on average (duration 91
mSec versus 75 mSec for females). In the short
bouts of regular, rhythmic flashing, the flash rate of


males is lower (x = 2.8 Hz versus x = 3.4 for females;
Table 1). However, no overt sexual behavior such as
mounting or rapproachment was observed.
Several kinds of insects occurred on the grass,
including mosquitoes, crane flies, leaf beetles,
roaches, grasshoppers, and moths, all apparently
feeding on the seeds, except for a cone-headed ka-
tydid that was eating another insect. Photuris
trivittata captured and fed upon mosquitoes,
crane flies and beetles. To our knowledge, this is
the only time that adult Photuris have been found
eating prey other than Lampyridae in the field,































Fig. 24. Known distribution of P. triuittata as pres-
ently recognized, from specimens located in several col-
lections.


though captive specimens have fed upon other in-
sects. Firefly prey (Photinus, Pyractomena) pro-
vides defensive chemical substances that
Photuris fireflies use in their own defense (Eisner
et al. 1997 and refs). However, non-firefly prey
may also be captured by Nearctic Photuris, but
because they don't glow while being eaten, go un-
noticed. In the field adjacent to the first site, fe-
male P. triuittata perched down in dense grass
within a foot of the ground, flashed responses to
flash patterns of Photuris males of another spe-
cies and attracted them to within 1 meter dis-
tance. Photuris triuittata occurs broadly through
Central America, from southern Mexico to Costa
Rica (Fig. 24), and its predation certainly has had
an important influence on the signaling behavior
of other lampyrids, and perhaps the behavior of
other insects as well.

ACKNOWLEDGMENTS

Ballantyne thanks Prof. Harvey Cromroy and Mr.
Bill Carpenter of the Department of Entomology and
Nematology at the University of Florida in Gainesville
for helpful advice, criticism, and patience during the
preparation of specimens for SEM work; Dr. John Capin-
era for accommodation within the Department of Ento-
mology and Nematology; Dr. Robert Ballantyne for
support and encouragement and critical comments. Bal-
lantyne undertook this project while on sabbatical leave
at the University of Florida in 1993. Lloyd thanks the
curators and collection managers for the loan of speci-
mens: D. Furth, Harvard University, whom he especially
wishes to thank for bringing the recently rediscovered
neotropical insect collection of Thomas Say-which in-
cluded Say's L. trilineata-to his attention; M.F. O'Brien
and R.D. Alexander, The University of Michigan; N. Lad-
kin, M.A. Houck, and R.W. Sites, Texas Tech University;
V. Scott, The University of Colorado; Drs. Awinash Bhat-
kar and Stitzer-Bhatkar for the invitation to visit the


December 2003


Cardenas campus (CSAT = Colegio Superior de Agricul-
tura Tropical), and for locating and guiding him to vari-
ous firefly localities; John Sivinski, Skip Choate, Joseph
Cicero, Scotty Long, Tom Walker, and Marc Branham for
reading part or all of the manuscript at various stages of
development; Flora MacColl, Pamela Howell, Seth Am-
bler, and Mike Sanford, for considerable technical assis-
tance in preparing the manuscript and computer
enhancement of the figures; Laura Line for preparing
the carbon dust habitus drawing (Fig. 23); Sara Diaz-
Barreto for preparing the Resumen; and several stu-
dents in his Honors firefly classes for finding the lati-
tudes and longitudes of various collection localities.
Approved for publication as Florida Agriculture Experi-
ment Station Journal Series Number R-08250.

REFERENCES CITED

BALLANTYNE, L. A. 1987a. Further revisional studies on
the firefly genus Pteroptyx Olivier (Coleoptera:
Lampyridae: Luciolinae). Transactions of the Amer-
ican Entomological Society 113: 117-170.
BALLANTYNE, L. A. 1987b. Lucioline morphology, taxon-
omy and behaviour: a reappraisal. (Coleoptera,
Lampyridae). Transactions of the American Entomo-
logical Society 113: 171-188.
BALLANTYNE, L. A. 1992. Revisional studies on flashing
fireflies. Unpublished Ph.D. thesis. University of
Queensland, Brisbane, Australia.
BALLANTYNE, L. A. AND C. LAMBKIN. 2000. The Lampy-
ridae of Australia (Coleoptera: Lampyridae: Lucioli-
nae: Luciolini). Memoirs of the Queensland Museum
46: 15-93.
BARBER, H. S. 1951. North American fireflies of the ge-
nus Photuris. Smithsonian Miscellaneous Collection
117: 1-58.
BRANHAM, M. A., AND M. ARCHANGELSKY. 2000. Descrip-
tion of the last larval instar and pupa of Lucidota
atra (G. A. Olivier, 1790) (Coleoptera: Lampyridae),
with a discussion of abdominal segmentation homol-
ogy across life stages. Proceedings of the Entomolog-
ical Society of Washington 102: 869-877.
CROWSON, R. A. 1972. A review of the classification of
the Cantharoidea (Coleoptera), with the definition of
two new families, Cneoglossidae and Omethidae. Re-
vista de la Universidad de Madrid 21: 35-77.
EISNER, T., M. A. GOETZ, D. E. HILL, S. R. SMEDLEY, AND
J. MEINWALD. 1997. Firefly "femmes fatales" acquire
defensive steroids (lucibufagins) from their firefly
prey. Proceedings of the Academy of Natural Science
94: 9723-9728.
GREEN, J. W. 1956. Revision of the nearctic species of
Photinus (Lampyridae: Coleoptera). Proceedings of
the California Academy of Science XXVIII: 561-613.
LAWRENCE, J. F. 1987. Rhinorphidae, a new beetle fam-
ily from Australia, with comments on the phylogeny
of the Elaterformia. Invertebrate Taxonomy 2: 1-53.
LLOYD, J. E. 1964. Notes on flash communication in the
firefly Pyractomena disperse (Coleoptera: Lampy-
ridae). Annals of the Entomological Society of Amer-
ica 57: 260-261.
LLOYD, J. E. 1979. Sexual selection in luminescent bee-
tles, pp. 293-342. In M. S. Blum and N. A. Blum
(eds.), Sexual Selection and Reproductive Competi-
tion in Insects. Academic Press, New York.
LLOYD, J. E. 1981. Mimicry in the sexual signals of fire-
flies. Scientific American 245: 138-145.


Florida Entomologist 86(4)







Lloyd & Ballantyne: Taxonomy and Behavior ofPhoturus trivittata


LLOYD, J. E. 1984. Occurrence of aggressive mimicry in
fireflies. The Florida Entomologist 67: 368-376.
LLOYD, J. E. 2002. 62. Lampyridae Latreille 1817, pp.
187-196. In R. H. Arnett, Jr., M. C. Thomas, P. E.
Skelley and J. H. Frank (eds.), Vol. 2, American Bee-
tles, Polyphaga: Scarabaeoidea through Curculion-
oidea. CRC Press, Boca Raton, FL.
MCDERMOTT, F. A. 1962. Illustrations of the aedeagi of
the Lampyridae (Coleoptera). Coleopterists' Bulletin
16: 21-27.
MCDERMOTT, F. A. 1964. The taxonomy of the Lampy-
ridae. Transactions of the American Entomological
Society 90: 1-72.
MCDERMOTT, F. A. 1966. Lampyridae Pars. 9. Coleop-
terorum Catalogus (Junk-Schenkling) (Ed. Sec), 1-
149 (Luciolini, 98-118).


NIELSEN, E. T. 1963. Illumination at twilight. Oikos 14:
9-21.
OLIVIER, E. 1886. Etudes sur les Lampyrides. Annales
de la Soci6t6 Entomologique de France: 201-246.
OLIVIER, E. 1910. Pars 9. Lampyridae. Coleopterorum
Catalogus (Junk-Schenkling).
PASTEUR, G. 1982. A classificatory review of mimicry
systems. Annual Review of Ecology and Systematics
13: 169-200.
SAY, T. 1835. Descriptions of new North American co-
leopterous insects, and observations on some al-
ready described. Boston Journal of Natural History
I: 151-157.
WICKLER, W. 1968. Mimicry in plants and animals.
World University Library London.







Florida Entomologist 86(4)


EFFECT OF IMIDACLOPRID ON WING FORMATION
IN THE COTTON APHID (HOMOPTERA: APHIDIDAE)

HUGH E. CONWAY1, TIMOTHY J. KRING1 AND RON MCNEW2
'Department of Entomology, University of Arkansas, Fayetteville, AR 72701

2Agricultural Statistics Lab., University of Arkansas, Fayetteville, AR 72701


The cotton aphid,Aphis gossypii Glover, is con-
sidered one of the most important pests of many
vegetable and field crops (Leclant & Deguine
1994). In 2002, aphids were present in 70% of US
cotton fields, infesting 9.4 million acres of cotton
(Williams 2003).
Imidacloprid is an effective systemic insecti-
cide (Nauen et al. 1998) with a high degree of re-
sidual activity against cotton aphids although the
compound is slow acting (Boiteau & Osborn
1997). Imidacloprid acts on the nicotinic acety-
choline receptor, causing the insect to reduce or
stop feeding, and reduces mobility (Gourment et
al. 1994; Boiteau & Osborn 1997).
As a result of casual observations of an in-
creased proportion of alate aphids in imidacloprid-
treated fields compared to untreated fields, labora-
tory spray tests were conducted on apterous adult
aphids to evaluate the extent of wing formation
and fecundity in offspring due to exposure to imi-
dacloprid. Increased wing formation due to insecti-
cide treatment has not previously been reported.
Probit analysis using five application rates
from 0 to 0.05 Lb ai/A imidacloprid (Provado
1.6F, Bayer Corporation, Kansas City, MO 64120)
were used to establish an LC50 for imidacloprid of
0.122 ppm (0.0125 Lb ai/A). In imidacloprid-
treated fields, aphids may not obtain a lethal
amount of insecticide because of insufficient dos-
age, inadequate coverage, or active avoidance of
insecticide residues (Kerns & Gaylor 1992).
Each treatment was replicated eight times on
greenhouse-produced four-leaf stage cotton
(Deltapine 51 and Deltapine 428B; Delta and
Pine Land Company, Scott, MS 38772). Ten pots
(1 plant/pot) were used in each replication. Ten
adult apterous cotton aphids were transferred
onto each of the four true leaves of each plant
with a fine camel hair brush. Treatments were
applied to cotton plants in a spray booth (Re-


search Track Sprayer SB6-079, DeViries Manu-
facturing, Hollandale, MN 56045). The aphids
were allowed to settle and recounted to insure all
leaves contained 10 aphids prior to treatment.
Five plants were randomly selected and
sprayed with the LC50 solution of 0.0125 Lb ai/A
imidacloprid and the other five plants were
sprayed with water. Following spraying, plants
were allowed to dry and placed in a chamber at 20
3C, (13:11, L:D). Aphids were counted on each
of the four leaves/plant 48 h post-treatment to
check mortality and to establish the number of
surviving adults for fecundity assessment. The 48
h reading was selected based on mortality assess-
ment from probit analysis. Ten days post-treat-
ment, aphids on each leaf were examined and
classified as either apterous or alate based on the
presence or absence of wings or wing pads. All
replicates were sampled using the same protocol
with a total of 80 plants sampled (4 leaves/plant;
10 plants/replicate; 8 replicates). Data on wing
formation with logo1 transformed means and on
fecundity were analyzed by analysis of variance
with means separated using PROC GLM,
ANOVA, and t-tests (SAS institute 1997, 1999).
Two days post-treatment 89.2% (0.11) of the
aphids survived in the control and 51.4% (+0.13)
in imidacloprid treatments (SE). No significant
difference occurred among replications. A signifi-
cant difference (P < 0.0001) in wing formation was
observed between treatments (Table 1). Imidaclo-
prid-treated plants had 12.0% (1.30) alate off-
spring compared with 2.0% (+0.24) in the control
plants. Further, a significant decrease (P <
0.0003) in fecundity of treated aphids occurred
with aphids on control plants having 9.2 0.97
offspring per adult and aphids on imidacloprid
plants having 4.9 0.50 offspring.
Alate aphids can migrate, have a longer devel-
opmental time, produce fewer offspring, and have


TABLE 1. EFFECT OF IMIDACLOPRID ON WING FORMATION OF OFFSPRING AND THE FECUNDITY OF SURVIVING ADULT
COTTON APHIDS.

Treatment Wing Formation SE (%) Fecundity SE (offspring/adult)

Water control 2 0.24 b 9.2 0.97 a
Imidacloprid (0.0125 Lb ai/A) 12 1.30 a 4.9 0.50 b

Means in the same column followed by the same letter are not significantly different, df = 79, P < 0.05 (LSD, SAS Institute 1997).
Wing formation data were log,, transformed. Percentage non-transformed data are shown in the table.


December 2003







Scientific Notes


an increased risk of mortality when moving than
apterous aphids (Noda 1959; Dixon 1977). Addi-
tionally, alatiform nymphs and adults are more
tolerant than the apterous form to pesticides, pos-
sibly due to size difference, amount of sclerotiza-
tion, and/or difference in behavior (Crafton-
Cardwell 1991).
The formation of wings is influenced by prena-
tal (inside the mother), postnatal (early nymph),
and a combination of both prenatal and postnatal
conditions (Dixon 1998).Aphis gossypii has devel-
opmental flexibility as late as the second instar
(Shaw 1970). The longer the delay, before wing de-
velopment, the quicker the aphids respond to
rapid environmental changes (Dixon 1998). Our
results could be due to either prenatal or postna-
tal effects.
Crowding and nutritional factors are the two
main forces involved with the production of alates
in most aphids (Dixon 1998). Colonies with fewer
than three aphids seldom produce alates, while
colonies with three or more aphids often produce
alate offspring (Reinhard 1927). Unfortunately,
research has not identified the relative impor-
tance of nutrition versus crowding, and just two
aphids can promote wing induction from tactile
stimulation (Muller et al. 2001). Aphids on a more
nutritious host produce more offspring and are
less likely to move frequently. However, on poor
quality hosts, aphids are more restless and more
likely to contact other aphids, producing a crowd-
ing response (Tamaki & Allen 1969). The physical
influence of spray likely induced movement and
may have simulated crowding in some of the
aphids in our tests, but this influence was con-
trolled because the control plants received a wa-
ter spray.
Imidacloprid treatment induced increased
wing formation in the cotton aphid independent
of aphid crowding and associated decline in plant
quality due to aphids or plant senescence. Imida-
cloprid reduces aphid feeding and may lower
plant nutrition; these effects may cause wing pro-
duction. Further, the production of wings could be
caused by the insecticide acting on the endocrine
system in a way similar to that of precocenes
(Hardie 1986; Hardie et al. 1996) or by the impact
of the insecticide on the plant, or a combination of
these or another unknown mechanism.

SUMMARY

When treated with imidacloprid, cotton aphids
produce a significantly higher percentage of alate
offspring with significantly fewer offspring per
adult. In addition to potential increased emigra-
tion by alate aphids, an increase in the proportion
of alate aphids among survivors of an imidaclo-
prid treatment may have further caused a de-
crease in the number of aphids in the treated field
because alate aphids required a longer develop-


mental time, produced fewer offspring, and had
an increased risk of mortality. An increase in the
proportion of alate offspring could ultimately de-
crease the overall number of aphids in the field
and thus increase the apparent efficiency of the
insecticide. Conversely, applications of imidaclo-
prid could serve to worsen area-wide problems via
increasing the dispersal of winged aphids to other
fields, assuming the surviving alates are fit and
disperse normally.

REFERENCES CITED

BOITEAU, G., AND W. P. L. OSBORN. 1997. Behavioral ef-
fects of imidacloprid, a new nicotinyl insecticide, on
the potato aphid, Macrosiphum Euphorbiae (Tho-
mas) (Homoptera: Aphididae). Can. Entomol. 129:
241-249.
GRAFTON-CARDWELL, E. E. 1991. Geographical and
temporal variations in response to insecticides in
various life stages of Aphis gossypii (Homoptera:
Aphididae) infesting cotton in California. J. Econ.
Entomol. 84: 741-749.
DIXON, A. F. G. 1977. Aphid ecology: Life cycles, poly-
morphism and population regulation. Ann. Rev.
Ecol. System. 8:329-353.
DIXON, A. F. G. 1998. Aphid Ecology, 2nd ed. Chapman
& Hall, London, UK.
GOURMET, C., A. D. HEWING, F. L. KOLB, AND C. A.
SMYTH. 1994. Effect of imidacloprid on nonflight
movement of Rhopalosiphum padi and subsequent
spread of barley yellow dwarf virus. Plant Dis. 78:
1098-1101.
HARDIE, J. 1986. Prococenes and morph differentiation
in female aphids. In Holman, J. Pelikan, and J.
Dixon (eds.), Population structure, genetics, and tax-
onomy of aphids and thysanopterons. The Hague:
SPG Academic Publishing pp. 145-157.
HARDIE, J., G. NONG, T. TIMAR, P. SEBOK, AND D.
HONDA. 1996. Precocenes derivatives and aphid
morphogenesis. Arch. Insect Biochem. Physiol. 32:
493-501.
KERNS, D. L., AND M. J. GAYLOR 1992. Behavior of cot-
ton aphid exposed to sublethal doses of three insec-
ticides. Southwest. Entomol. 17: 23-27.
LECLANT, F., AND J. P. DEGUINE. 1994. Cotton aphids,
pp. 285-323, In G. A. Mathews and J. P. Tunstall
(eds.), Insect pests of cotton, C. A. B., UK.
MULLER, C. B., I. S. WILLIAMS, AND J. HARDIE. 2001.
The role of nutrition, crowding and interspecific in-
teractions in the development of winged aphids.
Ecol. Entomol. 26: 330-340.
NAUEN, R., K. TIETJEN, K. WAGNER, AND A. ELBERT.
1998. Efficacy of plant metabolites of imidacloprid
against Myzus persicae and Aphis gossypii (Homop-
tera: Aphididae). Pestic. Sci. 52: 53-57.
NODA, I. 1959. The emergence of winged viviparous fe-
male in aphid VII. On the rareness of the production
of the winged offspring from the mothers of the
same form. Jap. J. Appl. Entomol. Zool. 3: 272-280.
REINHARD, H. J. 1927. The influence of parentage, nu-
trition, temperature, and crowding on wing produc-
tion in Aphis gossypii Glover. Texas Agric. Exp. Sta.
Bul. 353: 1-19.
SAS INSTITUTE. 1997. JMP, Windows Version 3.2.1, SAS
Institute, Inc., Cary, NC.







476 Florida Ento



SAS INSTITUTE. 1999. SAS/STAT User's Guide, Win-
dows Version 8, SAS Institute, Inc., Cary, NC.
SHAW, M. J. P. 1970. Effects of population density on
alienicolae of Aphis fabae Scop. II. The effect of isola-
tion on the development of form and behavior of
alate in a laboratory clone. Ann. Appl. Biol. 65: 205-
212.


Im


ologist 86(4) December 2003



TAMAKI, G., AND W. W. ALLEN. 1969. Competition and
other factors influencing the populations dynamics of
Aphis gossypii and Macrosiphoniella sanbori on
greenhouse chrysanthemums. Hilgardia 39: 447-505.
WILLIAMS, M. R. 2003. Beltwide cotton insect loss esti-
mates: 2002, In Proceeding of the Beltwide Cotton
Conferences. Nat. Cotton Council Am., Memphis, TN.







Scientific Notes


HOMALODISCA COAGULATA (HEMIPTERA: CICADELLIDAE)
EMBRYONIC DEVELOPMENT AT CONSTANT TEMPERATURES

A. K. AL-WAHAIBI1' AND J. G. MORSE1
'Dept. of Entomology, Univ. of California, Riverside, CA 92521, U.S.A.

2College of Agriculture, Sultan Qaboos Univ., Sultanate of Oman


Homalodisca coagulata (Say) (glassy-winged
sharpshooter), a species exotic to California, is an
important vector of the xylem-limited bacterium,
Xylella fastidiosa, which causes diseases on sev-
eral crops and ornamentals including Pierce's dis-
ease of grapes, citrus variegated chlorosis, phony
peach disease, almond leaf scorch, alfalfa dwarf,
and oleander leaf scorch (Blua et al. 1999; UCOP
2000;Varela et al. 2001). Little is known about the
developmental biology of H. coagulata. Eggs of
this insect are laid below the epidermis of leaves
as a cluster of eggs oriented nearly parallel to one
another. The number of eggs per egg mass on chry-
santhemums averages 8.8 eggs (range: 1-30)
(A.K.A., unpublished data). Data regarding the ef-
fect of temperature on the development of the egg
stage of this insect are lacking. Such data are use-
ful for two basic purposes: cold storage of eggs for
later use in rearing parasitoids (Leopold & Yocum
2001) (needed because of reproductive dormancy
of female sharpshooters during fall and winter)
and the ability to predict egg hatch in the field.
Egg masses were produced by caging field-
collected leafhoppers on small chrysanthemum
plants (rooted cuttings) in sleeve cages at 23C.
Plants were checked every 12 h for fresh egg
masses. Egg masses were then immediately incu-
bated in situ (inside leaves intact on plant) in
growth chambers set at different temperatures:
10, 15, 20, 25, 30, 32, 33, 35, and 40C. For all
temperature treatments, RH was set at ca. 50%,
and the light regime at 14:10 L:D. Temperature
inside the chambers was recorded using HOBO
data loggers (Onset Computer Co., Bourne, MA)
in order to arrive at actual incubation tempera-
tures (11.5, 16.7, 19.7, 25.6, 31.2, 32.9, 33.4, 35,
and 40.4C) which corresponded respectively to
the set temperatures stated earlier. During em-
bryonic development, egg masses were checked
daily (at or above 20C); or weekly (10, 15C) until
eye spots became faintly visible within eggs, and
then daily afterwards. When hatching was immi-
nent (large dark eye spots), leaves containing egg
masses were excised and placed inside petri
dishes with moist tissue paper. This allowed eas-
ier and more accurate observation of emergence
of nymphs from individual eggs within an egg
mass. At this stage, egg masses were monitored in
the morning and evening. Records of time of
hatching of each egg and stage of development for
each egg mass were kept. Developmental periods
and rates were calculated and plotted against ac-


tual mean temperatures. Linear regression was
used to arrive at estimates of the minimum devel-
opmental threshold and degree-days required for
development. ANOVA on arcsine transformed
data was used to compare egg hatch rates (pro-
portion of hatched nymphs). Statistical analyses
were done using JMP IN (SAS Institute 1996).
Complete development (for at least 1 egg) oc-
curred at all temperatures except 11.5 and 40.4C.
At 11.5C, development was retarded and aborted
during early stages of eye spot formation; egg
masses desiccated at 40.4C. The relationship be-
tween development rate and temperature was lin-
ear for temperatures in the range 16.7 to 25.6C,
peaked at ca. 32.9C, and then declined at higher
temperatures (Fig. 1). Regression of the linear
part of the curve yielded the linear equation
shown in Fig. 1. From the linear equation, it is es-
timated that H. coagulata requires 113.8 degree
days to complete embryonic development with a
minimum developmental threshold temperature
of 11.9C. Hatch rate (proportion of hatched


'> 0.14
0.12
43
S0.1

' 0.08
0.06
004
0.04
'B .


10 15 20 25 30 35 40
Temperature (C)

Fig. 1. The relationship between mean embryonic de-
velopment rate and temperature for H. coagulata.
16.7C, n = 255, SEM = 0.00007; 19.7C, n = 465, SEM
= 0.00013; 25.6 C, n = 212, SEM = 0.00089; 31.2 C, n =
202, SEM= 0.00105; 32.9 C, n = 133, SEM = 0.00099;
33.4C, n = 137, SEM = 0.00074; 35 C, n = 25, SEM =
0.00189 (n is the number of eggs held at indicated tem-
peratures, and SEM is the standard error of the mean).
Linear regression equation for the three lower temper-
atures is shown. The dotted line represents extrapola-
tion of the linear portion of the curve to the temperature
at which development rate equals zero.











nymphs) did not differ significantly among tem-
peratures in the low range (16.7-32.9C). How-
ever, hatch rate was significantly lower at 33.4
than at 19.7C (Fig. 2). Hatch rate was also signif-
icantly lower at 35C than at all other tempera-
ture treatments except 33.4C (Fig. 2).


r
o 0.4
s-r
4)
0

Q 0.2


16.7 19.7 25.6 31.2 32.9 33.4 35
Temperature (C)

Fig. 2. The effect of temperature on the hatch rate of
H. coagulata eggs. Hatch rate is based on the proportion
of hatched eggs per egg mass for each of the tempera-
ture treatments. Original data were arcsine trans-
formed and ANOVA was conducted on transformed
data. Means represented by columns were calculated by
back transformation of means produced by ANOVA.
Bars through the top of columns are 95% confidence lim-
its of the means. Means topped by the same letter are
not significantly different (P = 0.0001, Tukey-Kramer
HSD). The number of replicates shown within the top of
each column refers to the number of egg masses held at
each temperature.


December 2003


This work provides an important tool to pre-
dict the time of hatch ofH. coagulata eggs in the
field. It also indicates that constant temperatures
equal to or above 35C will result in high mortal-
ity and that development is incomplete at ca.
11.5C. It appears that the optimal temperature
range for successful development of eggs of H. co-
agulata is in the 16.7-32.9C range. Work is un-
derway to investigate the circadian rhythm of
nymphal hatch at different temperatures.

SUMMARY

Development rate of Homalodisca coagulata
(Say) was linearly related to temperature from
16.7 to ca. 30C. It is estimated that H. coagulata
requires 113.8 degree-days from oviposition to
egg hatch, with a minimum developmental
threshold of 11.9C. At higher temperatures,
hatch rate was significantly reduced, especially at
350C.

REFERENCES CITED

BLUA, M. J., P. A. PHILLIPS, AND R. A. REDAK. 1999. A
new sharpshooter threatens both crops and orna-
mentals. Calif. Agric. 53: 22-25.
LEOPOLD, R. A., AND G. D. YOCUM. 2001. Cold storage of
parasitized and unparasitized eggs of the glassy-
winged sharpshooter, Homalodisca coagulata, p. 65.
In M. A. Tariq, S. Oswalt, and T. Esser (eds.). Proceed-
ings of the Pierce's disease research symposium, Dec.
5-7, 2001, Coronado Island Marriott Resort, San Di-
ego, CA. Calif. Dept. Food & Agric., Sacramento.
SAS INSTITUTE. 1996. JMP IN version 3. Cary, NC.
UCOP 2000. Report of the University of California
Pierce's disease research and emergency response task
force. Univ. Calif. Office of the President, Oakland, CA.
VARELA, L. G., R. J. SMITH, AND P. A. PHILLIPS. 2001.
Pierce's disease. Univ. Calif. Agric. & Nat. Res. Publ.
21600. Univ. Calif., Oakland. 20 pp.


Florida Entomologist 86(4)







Scientific Notes


DIFFERENTIAL ATTRACTION OF A PARASITOID TO DEAD HOST ANTS

C. R. SMITH' AND L. E. GILBERT2
'Department of Biological Science, Florida State University, Tallahassee, FL 32306-1100
csmith@bio.fsu.edu

2Fire Ant Laboratory, Brackenridge Field Laboratory, Section of Integrative Biology
University of Texas, Austin, TX 78712
lgilbert@mail.utexas.edu


The red imported fire ant (RIFA), Solenopsis
invicta Buren (Hymenoptera: Formicidae), is a
major economic pest that has spread throughout
the southern United States and beyond in the
mere 60 years since its introduction to Mobile, Al-
abama (Vinson 1997). Efforts to control its spread
without the use of non-specific and environmen-
tally harmful pesticides (Banks 1990) has led re-
searchers to explore every available option,
including the use of a parasitoid fly as a biocon-
trol. A species-specific phorid fly parasitoid of the
RIFA in its native South America, Pseudacteon
tricuspis, has been introduced into areas infested
with the RIFA in the southern United States, in-
cluding sites around Austin, Texas, where this
study was conducted (Gilbert & Patrock 2002).
In South America, many different species of
Pseudacteon flies parasitize the RIFA (Disney
1994; Porter & Pesquero 2001), and these species
differ in the context of their attraction to the ants.
Some flies are more likely to be attracted to ants
at their mound, as is the case with P tricuspis,
while others to ants foraging away from the
mound (Orr et al. 1997). In the introduced popu-
lations in Austin, Texas, the flies have most com-
monly been seen attacking worker ants naturally
at nuptial flight swarms, but have also been found
at mound disturbances and at food baits with
workers. The flies can also be attracted by pre-
senting them with dead S. invicta workers; using
freshly killed and crushed ants is a very effective
method of attracting the flies.
Pseudacteon tricuspis flies are known to mate
at the same place as they attack their hosts (Por-
ter 1998). Although only females lay eggs on the
ants, males will typically hover over the ants and
often "harass" them; the male fly behavior is "ha-
rassment" in that they elicit an alarm response
from the worker ants. While both sexes are at-
tracted to the host ant, whether males arrive
first, disturb the ants and attract females, fe-
males arrive first and attract males, or both
males and females are equally likely to find their
host ants, has not been reported.
In this study we investigated the relative at-
traction of the flies to two ant castes (workers and
female reproductives, and documented the sex
ratio of flies attracted. The sex ratio of the first fly
to arrive was also noted in order to gain insight
into whether fly sex is important in host location.


Given the flies' attraction to workers partici-
pating in nuptial flight swarms, and the role of
ant sexual in inducing nuptial flight worker be-
havior (Obin & Vander Meer 1994), we investi-
gated the possible role of winged female sexual
(alates) in attracting the flies. Boxes that con-
tained equal weights of either dead workers or
alates (0.5 grams ants crushed a la mortar and
pestle) were paired. The date of death (by freez-
ing) and the colony of origin of both ant castes
(workers and female sexual) in each pairing
were identical. The boxes in each pair were placed
1 meter apart in an area where P tricuspis had
been consistently recovered. If multiple pairs
were used per trial, 15 minute observation period,
the pairs were separated by 20 meters and the re-
sults for all pairs in the trial were pooled, thus
making any conclusions more conservative; 1, 2,
or 3 pairs were used per trial. Boxes were sepa-
rated by 1 meter so that the flies would be able to
detect both boxes and choose between the two, yet
far enough away so that the choice they made
would be distinct. Pairs of boxes were separated
by 20 meters in order to increase the area over
which flies were attracted; independence of pairs
was not considered since the data over all pairs
was pooled. Flies attracted to the ants in the
boxes were aspirated, sexed, and released at the
conclusion of each 15 minute trial. After their col-
lection, females were confirmed to be P. tricuspis
via their ovipositor, but males were only posi-
tively identified to family and behaviorally identi-
fied to species; low hovering over corpses or live
ants by the males is sufficient to distinguish this
species since no other phorids in the area have
been previously attracted to S. invicta, whether
live or dead (personal observation). Since our
methods included sampling the flies with replace-
ment, efforts were made to spatially and tempo-
rally segregate samples.
A follow-up experiment was performed pairing
crushed alates with an equal weight of crushed
crickets (control), using the same protocol de-
scribed for the above experiment. This was done
in order to assess the flies' ability to detect alates
in the absence of workers.
A significantly greater number of P tricuspis
were collected at the worker boxes in comparison
with the alate boxes (Mann-Whitney U-test, n =
12 trials, U = 26.5, p < 0.01), 51 flies were col-







Florida Entomologist 86(4)


elected at the workers versus 23 at the alates.
However, when alates were paired with crickets
(n = 7), only in one of the trials was a fly collected
at the alates, none were collected at the crickets;
at the conclusion of each trial the presence of flies
was verified using dead crushed workers. No flies
were ever observed trying to attack the ant cadav-
ers. All trials were performed in areas where flies
had been collected within the past 48 hours and
during meteorological conditions within the ac-
tive range of P tricuspis.
The sex ratio (female: male) of the first flies ar-
riving at the boxes, the "discovering flies" (1:2.4, n
= 17), was similar to that of the total collected
(1:2.2, n = 74) (x2 = 2.88, p > 0.05, d.f. = 1).
This study shows that dead alates are attrac-
tive primarily in the context of nearby dead work-
ers since alates alone proved to be only weakly
attractive to P tricuspis. Dead workers on the
other hand are very effective in attracting the
flies. Fresh dead workers appear to be just as at-
tractive, if not more so, as live workers (personal
observation). It appears the workers are the pri-
mary source of long range cues that attract this
fly to its host. Thus, using dead workers to assess
fly presence is an effective tool for monitoring.
This method is essential in drought-prone Texas
because it can be employed independent of ant ac-
tivity and density.
The similarity between the sex ratio of the dis-
covering fly and that of all flies collected during
the observation periods indicates that both sexes
are equally likely to discover their hosts. There-
fore, it is unlikely that either males or females at-
tract the other to mate at the site of their host, but
instead, it is the host that attracts both of them.
The use of odors of both dead and living work-
ers as host orientation cues may account for the
tendency of species like P tricuspis to be associ-
ated with mounds versus foraging trails (e.g., Orr
et al 1997).
The authors wish to thank R. Patrock, C.
Wuellner, S. Porter, L. Morrison and all of the


staff at BFL for their help, patience, encourage-
ment and advice. Funding was provided by the
A.Y. Blattstein Memorial Fellowship (C.S.) and
The State of Texas Fire Ant Research and Man-
agement Project (L.G.).

SUMMARY

In a field study conducted in Austin, Texas, a
greater number of Pseudacteon tricuspis, a spe-
cies-specific phorid fly parasitoid of the red im-
ported fire ant (RIFA), were collected at worker
corpses than alate corpses. Neither sex of fly dis-
covered corpses more frequently than the other.

REFERENCES CITED

BANKS, W. A. 1990. Chemical control of the imported
fire ants, pp. 596-603. In R. K. Vander Meer, K. Jaffe,
and A. Cedeno [eds.], Applied Myrmecology: A World
Perspective. Westview Press, Boulder, CO. USA.
DISNEY, R. H. L. 1994. Scuttle flies: The Phoridae. New
York: Chapman and Hall.
GILBERT, L.E. AND R.J.W. PATROCK. 2002. Phorid flies
for the biological suppression of imported fire ant in
Texas: Region specific challenges, recent advances
and future prospects. Southwestern Entomologist
Supplement 25: 7-17.
OBIN, M. S., AND R. K. VANDER MEER. 1994. Alate semi-
ochemicals release worker behavior during fire ant
nuptial flights. J. Entomol. Sci. 29: 143-151.
ORR, M. R., S. H. SEIKE, AND L. E. GILBERT. 1997. For-
aging ecology and patterns of diversification in
dipteran parasitoids of fire ants in south Brazil.
Ecol. Entomol. 22: 305-314.
PORTER, S. D. 1998. Biology and behavior of Pseudac-
teon decapitating flies (Diptera: Phoridae) that par-
asitize Solenopsis fire ants (Hymenoptera:
Formicidae). Fla. Ent. 81(3):292-309.
PORTER, S. D., AND M. A. PESQUERO. 2001. Illustrated
key to Pseudacteon decapitating flies (Diptera:
Phoridae) that attack Solenopsis saevissima complex
fire ants in South America. Fla. Ent. 84: 691-699.
VINSON, S.B. 1997. Invasion of the red imported fire ant
(Hymenoptera: Formicidae). Am. Entomol. 43: 23-39.


December 2003







Scientific Notes


COMMERCIAL ADOPTION OF BIOLOGICAL CONTROL-BASED IPM
FOR WHITEFLIES IN POINSETTIA

R. G. VAN DRIESCHE AND S. LYON
Department of Entomology, University of Massachusetts, Amherst, MA 01003


The whiteflies Bemisia argentifolii Bellows
and Perring and Trialeurodes vaporariorum
Westwood continue to be the most important in-
sect pests in commercial poinsettia (Euphorbia
pulcherrrima Willd. ex Koltz) production in the
northeastern United States. Most crops are chem-
ically treated to suppress whiteflies, either pre-
ventatively with pot applications at planting of
the systemic insecticide imidacloprid (Mara-
thon) or, later in the crop cycle, with foliage ap-
plications of various other insecticides. In the fall
of 2000, a survey of 22 Massachusetts poinsettia
growers found they used an average of 8.3 pesti-
cide applications for this pest, at a cost of $0.14 +
$0.02 (SE) per plant (Van Driesche et al. 2002).
Significantly, only 7 of 22 growers were able to
achieve full season whitefly suppression with
only the use of Marathon at planting; the other
15 growers all needed to apply additional foliar
pesticides later.
As an alternative approach, the use of parasi-
toids for suppression of whiteflies in poinsettia
crops has been developed over the past decade
(Hoddle and Van Driesche 1996, 1999a,b; Hoddle
et al. 1996a,b, 1997a,b,c,d, 1998, 1999, 2001; Van
Driesche et al. 1999a,b, 2001a,b, 2002). Unlike
most implementation of augmentative biological
control, the release pattern and rate was not based
on testimonials but rather replicated controlled
research trials in experimental and commercial
greenhouses. This research considered three ini-
tial parasiotids (Encarsia formosa Gahan, E. for-
mosa Beltsville strain, and Eretmocercus eremicus
Rose and Zolnerowich), three release patterns
(constant, front end loaded and back end loaded)
and three release rates (3, 1 and 0.5 females per
plant per week), as well as in combination with in-
sect growth regulators. Cost of use, while at first
uneconomical ($2.70 per plant per season) was re-
duced steadily through research and changes in
product price, reaching $0.25 per plant (including
the cost of shipping) (Van Driesche et al. 2002), a
93% reduction in cost.
Here, we report results of the first large scale
commercial adoption of this biological control pro-
gram, which was implemented by one of the larg-
est Massachusetts poinsettia growers in 2002 on
the grower's initiative. A single large greenhouse
with 15,408 potted plants (wholesale value,
$77,737) was managed through releases of
E. eremicus (purchased from Syngenta) released
at 0.5 females per stem. Whitefly populations
were monitored in alternate weeks by staff of our
laboratory and an employee of the producer, using


the same protocol as employed in Van Driesche et
al. (2002). The grower purchased, received, and
released his own parasitoids. Here we report on
the degree of suppression obtained and the degree
of grower satisfaction with the outcome in terms
of crop quality and production cost. We also dis-
cuss management errors that occurred and how
they affected the ease of maintaining biological
control.
The greenhouse range under biological control
management was divided into east and west
blocks that were separated by an internal space
for movement of machinery. Both sections were
physically inside one very large greenhouse
(23,520 ft2 = 2219 m2). The trial began 9 Septem-
ber, 2002 when the range was filled with un-
treated plants (potted in mid-August in another
greenhouse), which were immediately sampled to
measure whitefly density. The trial ended 4 De-
cember, once the majority of plants had been re-
moved for sale. A total of 14,625 plants were
initially placed under biological control, 7894 in
the east and 6731 in the west blocks. Approxi-
mately 16 October, the grower introduced an ad-
ditional 783 "Winter Rose" poinsettia plants from
a different greenhouse, for a final total of 15,408
plants in the test area. This variety has crumpled
bracts, creating a false rose appearance. These
plants had not been treated with Marathon
prior to their introduction into the biological con-
trol area and were highly infested with whiteflies
(4.2 1.1 SE live nymphs and pupae per leaf
when introduced). These plants were placed as a
group on the far west side and acted as an undes-
ired source of adult whiteflies for the remainder of
the plants in the test greenhouse, especially those
in the west block.
In the east block, 6 parasitoid releases were
made, in weeks 3, 6, 7, 8, 9, 10 (on 25 September;
16,23 and 30 October; and 6 and 13 November, re-
spectively) and three insect growth regulator ap-
plications (using Enstar II because Precision,
the material used in our previous tests, was no
longer available) were made in weeks 4, 5, and 9
(2 and 10 October and 5 November). These appli-
cations were timed to suppress whiteflies at mid-
crop but before bract coloration. (We did not rec-
ommend the third treatment, which was only ap-
plied by the grower because the other half of the
greenhouse was being treated). Whiteflies were
suppressed below the at-harvest target threshold
of 2.0 live nymphs and pupae per leaf for the en-
tire cropping period and at harvest had 1.1 0.1
SE live nymphs and pupae per leaf (Fig. 1).







Florida Entomologist 86(4)


December 2003


-o--whitefly nymphs +
pupae
---whitefly adults


Enstar II


East Greenhouse


Enstar II


2

0
9/11 9/25 10/9 10/23 11/6 11/20 12/4

7 West Greenhouse
6
Enstar II Enstar II

4 /
3
2
/11 6 i



9/11 9/25 10/9 10/23 11/6 11/20 12/4


West (Winter Rose)


01
9/11 9/25 10/9 10/23 11/6 11/20 12/4
Date

Fig. 1. Densities of live whiteflies per leaf in poinset-
tia in three parts of a greenhouse managed with re-
leases of the parasitoid Eretmocerus eremicus near
Boston, Massachusetts in 2002.



West block was filled with plants one week be-
fore east block. The grower made 8 parasitoid re-
leases, in weeks 2, 3, 6, 7, 8, 9, 10,11 (on 18 and 25
September; 16, 23, and 30 October; and 6, 13 and
20 November, respectively). Enstar II was applied
three times, in weeks 4, 5, and 9 on the same dates
as East block. West block whitefly counts exceeded
the target threshold (2.0) on two dates each in Oc-
tober and November and had 4.0 0.5 SE live
nymphs and pupae per leaf at sale on 4 December
(Fig. 1). Higher whitefly densities in West block
were caused in large measure by the introduction
on 16 October of the "Winter Rose" plants. The
edge of the block in contact with the "Winter Rose"
plants was the most strongly affected. At harvest,
west block plants exceeded our target threshold,
but grower assessment of plant quality was favor-
able and plants were readily sold.


"Winter Rose" plants, which were placed next
to the west block plants on 16 October, were also
sampled weekly. These plants had 4.2 1.1 SE
live nymphs and pupae per leaf when introduced,
but this increased to 6.4 2.4 SE within 1 week.
We immediately recommended treatment with
Marathon@, as removal to another greenhouse
was not possible. Marathon@ was not applied un-
til 30 October. In addition, this block of plants was
treated twice with foliar applications of Enstar
II (10 October and 6 November), even though it
was difficult to obtain effective coverage. At har-
vest, this group of plants had 3.8 0.5 SE live
nymphs and pupae per leaf.
Costs of the parasitoid releases (inclusive of
shipping) and the IGR applications for the east
and west blocks were $0.10 per plant and $0.14, re-
spectively. This was based on the application of two
packages of 10,000 E. eremicus pupae on each re-
lease date. This number of pupae and the numbers
of plants in the test greenhouse, together with an
assumed 50/50 sex ratio and 70% emergence rate,
suggests a parasitoid release rate of ca. 0.45 fe-
males per plant was achieved. The price for biolog-
ical control in this trial is lower than in previous
trials because fewer total applications were made,
in part because the grower did not start the biolog-
ical control program until ca 3 weeks after plant-
ing, and applied an IGR in 3 weeks (rather than 2
as recommended), thus reducing the number of
parasitoid applications in his 15 week crop from an
expected 13 to actual 6-8. However, it is notewor-
thy that even this reduced frequency maintained
control, in the absence of a source of whitefly-con-
taminated plants (i.e., the "Winter Rose" plants).
The per plant cost of whitefly control in this
crop ($0.10 to $0.14 for the parasitoids, including
shipping, and the IGR applications) compares to
$0.14 for chemical control (exclusive of labor) for
the same grower in 2001, when he applied Mara-
thon and nine other pesticides (one or more
applications of each) to suppress whiteflies in
the same greenhouse.
An exit interview with the grower found a high
level of satisfaction with the biological control
program. Production of this crop (as part of a
Massachusetts extension effort to assist growers
interested in implementing biological control
measures) has demonstrated that sufficient infor-
mation exists for northeast poinsettia growers to
be successful in use of biological control for white-
fly management and produce crops that meet the
target threshold for whitefly suppression, with
consequent good market acceptance. Costs were
also acceptable to the grower relative to his past
need for application of ten different pesticide
products in a comparable crop in the previous
year. This is the first published demonstration of
successful implementation of biological in poin-
settia in the United States at a price competitive
with pesticides, meeting fully all grower concerns.







Scientific Notes


SUMMARY

Releases of Eretmocerus eremicus at the re-
duced rate of 0.5 females per plant per week, com-
bined with three mid-season applications of the
insect growth regulator kinoprene (Enstar II),
successfully maintained densities of live
nymphs+pupae of pest whiteflies (Bemisia argen-
tifolii) at or below threshold (2 per leaf), barring
management errors (introduction of highly in-
fested plants). This program had a cost of $0.10-
0.14 per plant, including the cost of the pesticide,
the parasitoids and their shipping. This price was
equal to or lower than the average cost of chemi-
cal control ($0.14 per plant) for 22 Massachusetts
poinsettia growers whose pesticide application
records were examined in a separate survey. This
trial demonstrates that effective whitefly biologi-
cal control on poinsettia can be achieved in the
northeastern United States at prices competitive
with current pesticide use.

REFERENCES CITED

HODDLE, M., AND R. G. VAN DRIESCHE. 1996. Evalua-
tion of Encarsia formosa (Hymenoptera: Aphelin-
idae) to control Bemisia argentifolii (Homoptera:
Aleyrodidae) on poinsettia (Euphorbia pulcherrima):
A lifetable analysis. Florida Entomol. 79: 1-12.
HODDLE, M. S., AND R. G. VAN DRIESCHE. 1999a. Eval-
uation of inundative releases of Eretmocerus ere-
micus and Encarsia formosa Beltsville strain in
commercial poinsettia stock plants. J. Econ. Ento-
mol. 92: 811-824.
HODDLE, M. S., AND R. G. VAN DRIESCHE. 1999b. Eval-
uation of Eretmocerus eremicus and Encarsia for-
mosa Beltsville strain in commercial greenhouses
for biological control of Bemisia argentifolii on col-
ored poinsettia plants. Florida Entomol. 82: 556-569.
HODDLE, M. S., R. VAN DRIESCHE, J. SANDERSON, AND
M. ROSE. 1996a. A photographic technique for con-
structing life tables for Bemisia argentifolii (Ho-
moptera: Aleyrodidae) on poinsettia. Florida
Entomol. 79: 464-468.
HODDLE, M. S., R. G. VAN DRIESCHE, AND J. P. SANDER-
SON. 1996b. Greenhouse trials of Eretmocerus cali-
fornicus Howard (Hymenoptera: Aphelinidae) for
control of Bemisia argentifolii Bellows and Perring
(Homoptera: Aleyrodidae) on poinsettia in North-
eastern U.S.A. IOBC/WPRS Bull. 19: 55-58.
HODDLE, M. S., R. G. VAN DRIESCHE, AND J. P. SANDER-
SON. 1997a. Biological control of Bemisia argentifolii
(Homoptera: Aleyrodidae) on poinsettia with inun-
dative releases of Encarsia formosa "Beltsville
strain" (Hymenoptera: Aphelinidae): Can parasitoid
reproduction augment inundative releases? J. Econ.
Entomol. 90: 910-924.


HODDLE, M., R. G. VAN DRIESCHE, AND J. SANDERSON.
1997b. Biological control ofBemisia argentifolii (Ho-
moptera: Aleyrodidae) on poinsettia with inundative
releases of Eretmocerus eremicus (Hymenoptera:
Aphelinidae): Do release rates and plant growth af-
fect parasitism? Bull. Entomol. Res. 88: 47-58.
HODDLE, M., R. G. VAN DRIESCHE, AND J. SANDERSON.
1997c. Biological control of Bemisia argentifolii (Ho-
moptera: Aleyrodidae) on poinsettia with inundative
releases of Encarsia formosa (Hymenoptera: Aphe-
linidae): Are higher release rates necessarily better?
Biol. Control 10: 166-179.
HODDLE, M. S., R. G. VAN DRIESCHE, J. S. ELKINTON,
AND J. P. SANDERSON. 1997d. Discovery and utiliza-
tion of Bemisia argentifolii (Homoptera: Aleyrodi-
dae) patches by Eretmocerus eremicus and Encarsia
formosa (Beltsville strain) (Hymenoptera: Aphelin-
idae) in greenhouses. Entomol. Exp. Appl. 87: 15-28.
HODDLE, M., R. G. VAN DRIESCHE, AND J. SANDERSON.
1998. Biology and utilization of the whitefly parasitoid
Encarsia formosa. Ann. Rev. Entomol. 43: 645-649.
HODDLE, M. S., J. P. SANDERSON, AND R. G. VAN DRIE-
SCHE. 1999. Biological control ofBemisia argentifolii
(Hemiptera: Aleyrodidae) on poinsettia with inunda-
tive releases of Eretmocerus eremicus (Hymenop-
tera: Aphelinidae): does varying the weekly release
rate affect control? Bull. Entomol. Res. 89: 41-51.
HODDLE, M. S., R. G. VAN DRIESCHE, S. M. LYON, AND J.
P. SANDERSON. 2001. Compatibility of insect growth
regulators with Eretmocerus eremicus (Hymenop-
tera: Aphelinidae) for whitefly (Homoptera: Alyero-
didae) control on poinsettia: I. Laboratory Assays.
Biol. Control 20: 122-131.
VAN DRIESCHE, R. G., J. P. SANDERSON, AND M. S. HOD-
DLE. 1999a. Integration of IGRs and low rates of
Eretmocerus eremicus for whitefly control in poinset-
tia. IOBC WPRS Bull. 22 (1): 61-64.
VAN DRIESCHE, R. G., S. M. LYON, M. S. HODDLE, S.
ROY, AND J. P. SANDERSON. 1999b. Assessment of
cost and performance of Eretmocerus eremicus (Hy-
menoptera: Aphelinidae) for whitefly (Homoptera:
Aleyrodidae) control in commercial poinsettia crops.
Florida Entomol. 82: 570-594.
VAN DRIESCHE, R. G., M. S. HODDLE, S. LYON, AND J. P.
SANDERSON. 2001a. Compatibility of insect growth
regulators with Eretmocerus eremicus (Hymenop-
tera: Aphelinidae) for whitefly control (Homoptera:
Alyerodidae) control on poinsettia: II. Trials in com-
mercial poinsettia crops. Biol. Control 20: 132-146.
VAN DRIESCHE, R. G., M. S. HODDLE, S. ROY, S. LYON,
AND J. P. SANDERSON. 200 1b. Effect of parasitoid re-
lease pattern on whitefly (Homoptera: Aleyrodidae)
control in commercial poinsettia. Florida Entomol.
84: 63-69.
VAN DRIESCHE, R. G., S. LYON, K. JACQUES, T. SMITH,
AND P. LOPES. 2002. Comparative cost of chemical
and biological whitefly control in poinsettia: is there
a gap? Florida Entomol. 85: 488-493.







Florida Entomologist 86(4)


MOLE CRICKETS (ORTHOPTERA: GRYLLOTALPIDAE) IN JAMAICA

J. H. FRANK AND T. J. WALKER
Entomology & Nematology Dept., University of Florida, Gainesville, FL 32611-0630


The only species of mole cricket reported for Ja-
maica in Gowdey's (1926a,b, 1928) catalogue of the
insect fauna is Scapteriscus didactylus (Latreille).
That mole cricket species was the subject of many
reports in Puerto Rico in the latter part of the 19th
century and first half of the 20th because of its de-
structiveness to cultivated crops and grasses (e.g.,
Barrett 1902). Seemingly, in every West Indian is-
land where it occurs, it has been blamed as a pest;
yet, nothing seemed to have been published about
it in the Jamaican literature. The contrast-many
reports from Puerto Rico and other West Indian is-
lands where S. didactylus occurs, but none from
Jamaica-did not make sense, because entomolo-
gists of the Jamaica Department of Agriculture
(later Ministry of Agriculture) published numer-
ous reports about other pest insects. For that rea-
son, we decided to verify existence ofS. didactylus
in Jamaica by examining specimens of mole crick-
ets in Jamaican collections. Our effort had a bio-
geographic focus (the history of colonization of the
West Indies by mole crickets) and a practical im-
plication. The practical implication was that we
have worked with biological control agents of
Scapteriscus mole crickets in Florida, and could
have offered help in Jamaica if help had been
needed; on the other hand, if some natural enemy
had been suppressing S. didactylus populations in
Jamaica, information that we might glean from
Jamaica could be useful in other islands.
The senior author, newly employed by the Sugar
Research Department (SRD) of the Sugar Manu-
facturers' Association (of Jamaica), encountered
mole crickets in Jamaica as pest insects. The one
incident was in January 1969. The locality was
Gray's Inn, an agricultural estate near Buff Bay in
the parish of Portland, where he was called by
Brian Michelin (Farm Manager) to examine and
recommend treatment for this occurrence. A field of
banana had been replanted with sugarcane (this
was done, as usual in planting sugarcane, by plant-
ing cut sections of sugarcane stem), and mole crick-
ets were damaging the roots and shoots produced
by the cut sections. Recommendations for insecti-
cidal treatment were given, and specimens were
collected and placed in vials of alcohol in the SRD
collection. The specimens were not submitted for
expert identification by specialists and are no
longer available. There was no evidence of mole
cricket damage to sugarcane in Jamaica from 1972
to the present (Trevor Falloon, pers. comm.). This
assertion corroborates an earlier report by Frank
& Bennett (1970) based on lack of mention of these
pests in the pre-1970 literature on Jamaican agri-
cultural pests and the direct observations by the


senior author in 1969-1970. Other entomologists in
Jamaica (Dionne Newell and Eric Garraway, pers.
comm.) confirmed these findings not just for sugar-
cane but for all other crops. It is said that hindsight
is a good teacher. The senior author should, in
1969, have sent specimens for expert identification
because no key to the West Indian mole cricket spe-
cies was then available; the key by Nickle & Cast-
ner (1984) was 15 years in the future.
Gowdey (1926a) does not specify how he iden-
tified most insects whose names appear in his cat-
alogue. In his introduction, he acknowledges
obligations to various specialists in England,
Canada, and the USA. Among these, he mentions
J. A. G. Rehn, of the Academy of Natural Sciences
of Philadelphia, a specialist in Orthoptera. It is
thus possible that Rehn examined a mole cricket
specimen that Gowdey sent to him, or made a pre-
sumption, or that Gowdey himself made a pre-
sumption without sending a specimen to Rehn.
Unfortunately, Rehn (1909) had earlier cata-
logued S. didactylus as being present in Cuba-
which later was denied by others, summarized by
Frank et al. (2002): S. didactylus does not occur in
Cuba. Thus, Rehn may have allowed his pre-
sumptions to get in the way of hard evidence (ex-
amination of specimens) at least once and
perhaps twice. In St. Croix (U.S. Virgin Islands)
S. abbreviatus Scudder had been misidentified as
S. didactylus (Frank & Keularts 1996).
The specimens housed in the Institute of Ja-
maica are the best evidence of identity of the mole
cricket species in Jamaica. There are only five, and
all are Scapteriscus abbreviatus. The earliest spec-
imen (1) has no label and is from Gowdey's collec-
tion (teste Dionne Newell), presumably collected
before 1926. All of the other specimens are from
the parish of Kingston and St. Andrew. Collection
data are: (2) St. Andrew, Sandy Gully nr. Barbican,
7-VII-1957, Peter Drummond, (3) Kingston, be-
neath seashells at foot of Paradise Street, 9-IX-
1961, K. Eldemire, (4) St. Andrew, Port Royal, 14-
1-1975, Donna Clark, (5) Kingston, Sutton Street,
9-V-1992, E. Sterling. These data suggest restric-
tion of mole crickets to one parish (Kingston and
St. Andrew), but evidence of mole crickets in Port-
land Parish (above) suggests a wider distribution.
The first specimen ofS. abbreviatus is from the col-
lection that Gowdey assembled. It was the first
general collection of insects formed by a Depart-
ment of Agriculture entomologist (Gowdey 1926a).
This is crucial evidence because Gowdey (1926a,b,
1928) acknowledges the presence only of S. didac-
tylus in Jamaica. A misidentification was made.
The mole cricket present in Jamaica is S. abbreuia-


December 2003







Scientific Notes


tus (not S. didactylus). We must presume that S.
abbreviatus arrived in Jamaica before 1926, possi-
bly in ship ballast to Port Royal or to the port of
Kingston, or both, as it is believed to have done in
Cuba, Haiti, Puerto Rico, and St. Croix in the West
Indies, and Florida and Georgia in the USA. Re-
striction of S. abbreviatus to the vicinity of its port
of arrival (the parish of Kingston and St. Andrew),
because adults are flightless, may account for the
lack of widespread damage by it. Its presumed
presence in Portland Parish on Jamaica's north
coast is then more interesting, and suggests a sep-
arate arrival, perhaps at Buff Bay, or Port Antonio.
Neither of us has visited Jamaica in many
years. We have not interviewed golf course super-
intendents about insect damage to turfgrass. It is
golf course superintendents who may bear the
brunt of damage by pest mole crickets, if there is
any, because of the highly attractive habitat that
they provide to these insects.
This note would not have been possible with-
out the collaboration of Mrs. Dionne Newell (Nat-
ural History Department, Institute of Jamaica)
who lent the five mole cricket specimens housed
in the Institute's collections, and Dr. Eric Garra-
way (University of the West Indies, Mona, Kings-
ton) and Mr. Trevor Falloon (Sugar Industry
Research Institute, Mandeville) who made help-
ful comments. We acknowledge critical reviews of
the manuscript of this note by Drs. Pauline
Lawrence and Norman Leppla (University of
Florida). This is Florida Agricultural Experiment
Station Journal Series No. R-09469.

SUMMARY
One species of mole cricket is proven to occur
in Jamaica, and it is Scapteriscus abbreviatus
Scudder. It is not native to Jamaica, and it arrived


there before 1926. This species occasionally dam-
ages crops, but has not heretofore in print, to the
best of our knowledge, been reported to do so in
Jamaica. In the West Indian islands of St. Croix
and Cuba, S. abbreviatus was apparently misi-
dentified as S. didactylus (Latreille), and here we
report that the same misidentification was made
in Jamaica in the 1920s, uncorrected until now.

REFERENCES CITED

BARRETT, O. W. 1902. The change, or mole cricket
(Scapteriscus didactylus Latr.) in Porto Rico. Porto
Rico Agric. Exp. Stn. Bull. 2: 1-19.
FRANK, J. H., AND F. D. BENNETT. 1970. List of the
sugar cane arthropods of Jamaica. Sug. Manuf. As-
soc., Sug. Res. Dept., Tech. Bull. 1/70: 1-24.
FRANK, J. H., AND J. L. W. KEULARTS. 1996. Scap-
teriscus abbreviatus (Orthoptera: Gryllotalpidae), a
minor pest on St. Croix, US Virgin Islands. Florida
Entomol. 79: 468-470.
FRANK, J. H., R. E. WOODRUFF, AND M. C. THOMAS.
2002. Mole crickets (Orthoptera: Gryllotalpidae) in
Grenada, West Indies. Entomotropica 17: 207-212.
GOWDEY, C. C. 1926a. Catalogus Insectorum Jamaicen-
sis. Dept. Agric., Jamaica, Entomol. Bull. 4(1): 1-114,
i-xiv.
GOWDEY, C. C. 1926b. Catalogus Insectorum Jamaicen-
sis. Dept. Agric., Jamaica, Entomol. Bull. 4(2): 1-11.
GOWDEY, C. C. 1928. Catalogus Insectorum Jamaicen-
sis. Dept. Sci. Agric., Jamaica, Entomol. Bull. 4(3): 1-
45, i-iii.
NICKLE, D. A., AND J. A CASTNER 1984. Introduced spe-
cies of mole crickets in the United States, Puerto
Rico, and the Virgin Islands (Orthoptera: Gryllotalp-
idae). Ann. Entomol. Soc. America 77: 450-465.
REHN, J. A. G. 1909. A catalog of the Orthoptera of Cuba
and the Isle of Pines. Cuba: Estaci6n Central
Agron6mica, Report 2: 175-206.







Florida Entomologist 86(4)


December 2003


NEW HOST RECORDS FOR TWO SPECIES
OF GONATOCERUS (HYMENOPTERA: MYMARIDAE),
EGG PARASITOIDS OF PROCONIINE SHARPSHOOTERS
(HEMIPTERA: CLYPEORRHYNCHA: CICADELLIDAE), IN PERU

GUILLERMO LOGARZO1, SERGUEI V. TRIAPITSYN2 AND WALKER A. JONES3
1USDA-ARS, South American Biological Control Laboratory, Hurlingham, Buenos Aires, Argentina

2Department of Entomology, University of California, Riverside, CA 92521

3Beneficial Insects Research Unit, USDA, ARS, Kika de la Garza Subtropical Agricultural Research Center
2413 E. Highway 83, Weslaco, TX 78596


Exploration for egg parasitoids of proconiine
sharpshooters (Hemiptera: Clypeorrhyncha: Cica-
dellidae: Cicadellinae: Proconiini) was conducted
by the senior author in Junin State of Peru during
May 2002 as part of the ongoing classical bio-
logical control program against glassy-winged
sharpshooter, Homalodisca coagulata (Say), in
California (Jones 2001). Adults of Pseudometopia
amblardii (Signoret), P phalaesia (Distant) and
Oncometopia n. sp. were collected by hand and
caged on Satsuma mandarin, Citrus reticulata
var. satsuma Blanco, trees in the Fundo Genova
farm orchard near La Merced, Chanchamayo
County, which is surrounded by a tropical jungle.
These sentinel egg masses were obtained and
marked on the leaves (individual eggs and egg
masses of Oncometopia n. sp. are much larger
than those of P amblardii and P. phalaesia) and
then were exposed to parasitization for 1-3 days
prior to their removal and shipment to University
of California, Riverside (UCR) and USDA-APHIS-
PPQ Mission (Edinburg, Texas) quarantine labo-
ratories under appropriate importation permits.
Two species in the family Mymaridae (Hy-
menoptera), both belonging to the ater species-
group of the genus Gonatocerus Nees, which is
known to contain egg parasitoids of proconiine
sharpshooters in the New World (Triapitsyn et al.
2002), and one species in the family Trichogram-
matidae (Hymenoptera) emerged in quarantine
from these samples. Four female specimens of this
trichogrammatid, an undescribed species belong-
ing to an undetermined genus near Zagella Gi-
rault, was reared at the UCR facility from an egg
mass of P. amblardii, or P. phalaesia. Its female
antennal clava is two-segmented whereas that of
Zagella species, some of which parasitize eggs of
proconiine sharpshooters in Argentina and south-
eastern USA, are three-segmented (Triapitsyn
2003). According to J. D. Pinto (UCR, pers. comm.),
this unnamed genus is quite common and diverse
in the Neotropical region. This is the first reported
host association for any of its members.
The two mymarids were G. triguttatus Girault
and an undetermined species of Gonatocerus near
ashmeadi Girault. Two females and one male of


G. triguttatus emerged at UCR quarantine from a
single egg mass of P amblardii, or P phalaesia.
Previous known host records of G. triguttatus in-
clude 0. clarior (Walker), O. sp., and H. coagulata
in Texas and northeastern Mexico (Triapitsyn &
Phillips 2000; Jones 2001; Triapitsyn & Hoddle
2001; Triapitsyn et al. 2002) and also 0. nigricans
(Walker) in central Florida (Triapitsyn et al.
2002). A species very closely related to G. trigutta-
tus, G. metanotalis (Ogloblin), was reared by the
senior author during December 2000 and Janu-
ary 2001 in Misiones, Salta, and Tucuman Prov-
inces of Argentina from sentinel eggs of the
proconiine sharpshooter Tapajosa rubromargin-
ata (Signoret) on citrus (Citrus spp.) leaves. A cul-
ture of G. metanotalis has been successfully
maintained since March 2002 at the USDA-
APHIS Mission quarantine laboratory using eggs
of a factitious host, H. coagulata.
Numerous female and male adults of G. sp.
near ashmeadi emerged from egg masses of all
three proconiine sharpshooter species from Peru,
varying in body size in direct correlation with the
size of the host's egg. This is the first known
record of an egg parasitoid attacking a host in the
genus Pseudometopia Schmidt. Parasitoids were
given time to mate and then females were ex-
posed to egg masses ofH. coagulata on Euonymus
japonica Thunberg leaves at the UCR and on
leaves of three plant species (hibiscus, Hibiscus
rosa-sinensis L. var. "Brilliant Red", sweet potato,
Ipomoea batatas (L.) Lamarck, and cowpea, Vigna
unguiculata (L.) Walpers) at the USDA-APHIS
Mission quarantine laboratories, respectively.
Colonies of this species were successfully estab-
lished at both facilities. At UCR quarantine, three
full generations were maintained at 20.5-25.5C
and 30-50% RH. Under these conditions, the de-
velopmental period of G. sp. near ashmeadi from
egg to adult was 16-18 days. The UCR colony was
lost after females of the fourth generation wasps.
The two colonies of this species at the USDA-
APHIS Mission quarantine were lost in the first
and second generations.
Taxonomically (based solely on morphology),
G. sp. near ashmeadi from Peru seems to be con-







Scientific Notes


specific to an undetermined, and possibly unde-
scribed, species of Gonatocerus reared in January
2001 by the senior author in Santa Clara, Salta
Province of Argentina from sentinel eggs of T ru-
bromarginata on citrus leaves. Both these forms
are definitely different from, but nevertheless re-
lated to, G. ashmeadi Girault, a common egg par-
asitoid of H. coagulata and other proconiine
sharpshooters in the USA and northeastern Mex-
ico (Triapitsyn et al. 2002), and also to an unde-
scribed species of Gonatocerus from Tamaulipas,
Mexico, which was reported as an unusual form of
G. ashmeadi by the same authors (S. V. Tria-
pitsyn, unpublished data).
All proconiine sharpshooter and parasitoid
specimens resulting from this study were deter-
mined by Pedro Lozada (Senasa, Lima, Peru) and
S. V. Triapitsyn, respectively; vouchers specimens
of the parasitoids are deposited in the Entomol-
ogy Research Museum, University of California
at Riverside, California, and those of proconiine
sharpshooters (along with some specimens of Go-
natocerus) were deposited in Senasa, Lima, Peru.
We thank Laura Varone (USDA-ARS South
American Biological Control Laboratory, Hurling-
ham, Buenos Aires, Argentina) for assistance in
the field, Vladimir V. Berezovskiy (Department of
Entomology, University of California, Riverside,
CA) for help with quarantine work and specimen
preparation, as well as David J. W. Morgan
(Pierce's Disease Control Program, California De-
partment of Food and Agriculture, Mount Rubid-
oux Field Station, Riverside, CA) and Isabelle
Lauziere (Quarantine Laboratory, USDA-APHIS-
PPQ Mission Plant Protection Center, Moore Air
Base, Edinburg, TX) for supplying fresh egg
masses of glassy-winged sharpshooter and assis-
tance in rearing the parasitoids in quarantine.
This project was funded by USDA-APHIS and
USDA-ARS.

SUMMARY

Exploration for egg parasitoids of proconiine
sharpshooters was conducted in Junin State of
Peru in May 2002. Adults of three leafhopper spe-
cies, Pseudometopia amblardii, P phalaesia, and
Oncometopia n. sp., were collected and caged on


Satsuma mandarin trees in an orchard near La
Merced. Two species of the mymarid wasp genus
Gonatocerus, G. triguttatus and G. sp. near ash-
meadi, emerged from these egg masses, the latter
from all three hosts but the former from eggs of
P amblardii, or P phalaesia. These are the first
known records of egg parasitoids of Pseudome-
topia species and also new host records for both
species of Gonatocerus. An undetermined tri-
chogrammatid species of a genus near Zagella
was also reared from an egg mass of P amblardii,
or P phalaesia.

REFERENCES CITED

JONES, W. A. 2001. Classical biological control of the
glassy-winged sharpshooter, pp. 50-51. In Proceed-
ings of the Pierce's Disease Research Symposium,
December 5-7, 2001, Coronado Island Marriott Re-
sort, San Diego, California. California Department
of Food and Agriculture, Copeland Printing, Sacra-
mento, CA, 141 pp.
TRIAPITSYN, S. V. 2003. Taxonomic notes on the genera
and species ofTrichogrammatidae (Hymenoptera)-
egg parasitoids of the proconiine sharpshooters
(Homoptera: Cicadellidae: Proconiini) in southeast-
ern USA. Trans. American Entomol. Soc. (in press).
TRIAPITSYN, S. V., L. G. BEZARK, AND D. J. W. MORGAN.
2002. Redescription of Gonatocerus atriclavus Gi-
rault (Hymenoptera: Mymaridae), with notes on
other egg parasitoids of sharpshooters (Homoptera:
Cicadellidae: Proconiini) in northeastern Mexico.
Pan-Pacific Entomol. 78: 34-42.
TRIAPITSYN, S. V., AND M. S. HODDLE. 2001. Search for
and collect egg parasitoids of glassy-winged sharp-
shooter in southeastern USA and northeastern Mex-
ico, pp. 133-134. In Proceedings of the Pierce's
Disease Research Symposium, December 5-7, 2001,
Coronado Island Marriott Resort, San Diego, Cali-
fornia. California Department of Food and Agricul-
ture, Copeland Printing, Sacramento, CA, 141 pp.
TRIAPITSYN, S. V., M. S. HODDLE, AND D. J. W. MORGAN.
2002. A new distribution and host record for Gonato-
cerus triguttatus in Florida, with notes on Ac-
mopolynema sema (Hymenoptera: Mymaridae).
Florida Entomol. 85: 654-655.
TRIAPITSYN, S. V., AND P. A. PHILLIPS. 2000. First host
record of Gonatocerus triguttatus (Hymenoptera:
Mymaridae) from eggs of Homalodisca coagulata
(Homoptera: Cicadellidae), with notes on the distri-
bution of the host. Florida Entomol. 83: 200-203.







Florida Entomologist 86(4)


December 2003


ANASA TRISTIS (HETEROPTERA: COREIDAE) DEVELOPMENT, SURVIVAL
AND EGG DISTRIBUTION ON BEIT ALPHA CUCUMBER AND AS PREY
FOR COLEOMEGILLA MACULATA (COLEOPTERA: COCCINELLIDAE)
AND GEOCORIS PUNCTIPES (HETEROPTERA: LYGAEIDAE)

SILVIA I. RONDON1, DANIEL J. CANTLIFFE1 AND JAMES F. PRICE2
1University of Florida, Horticultural Sciences Department, Gainesville, FL 32611

2Gulf Coast Research and Education Center, P.O. Box 111565, Bradenton, FL 34203


The Beit alpha cucumber, Cucumis sativus L.,
a crop grown under protective structures in the
Middle East, is a new greenhouse commodity in
Florida that will compete in the marketplace with
the traditional Dutch-type cucumber (Shaw et al.
2000). While it produces a seedless fruit with a
thin smooth skin like the Dutch cultivars, produc-
tivity can be much higher than other cucumbers.
The Beit alpha cucumber can be grown success-
fully year-round in greenhouses but pests must
be controlled for optimal production. The Pro-
tected Agriculture Project of the Horticultural
Sciences Department at the University of Florida
(www.hos.ufl.edu/ProtectedAg/) is seeking to im-
plement biological control and reduce insecticide
use as part of an integrated pest management
program for this crop. Some of the common
cucumber pests encountered by the project are
aphids, spider mites, thrips, and whiteflies.
During the spring of 2002, a sporadic pest, the
squash bug, Anasa tristis DeGeer (Heteroptera:
Coreidae), infested the Beit alpha cucumber crop
in the project's greenhouse three weeks before
harvest and caused considerable damage. The
squash bug is considered an important pest of cu-
curbits in open fields in the U.S. (Beard 1940;
Nechols 1987; Cook & Neal 1999). Host prefer-
ence includes squash, pumpkin, cucumber, and
melon (Nechols 1987; Bonjour & Fargo 1989). Im-
portant natural enemies of the squash bug are
the tachinids, Trichopoda pennipes (Fab.), and
sceleonids, Eumicrosoma spp. (Metcalf & Metcalf
1993; Van Driesch & Bellows 1996). We evaluated
3rd instar larvae and adults of the two predators,
Coleomegilla maculata DeGeer, and Geocoris
punctipes (Say), as candidates to control the
squash bug. These predators were selected be-
cause they are being used extensively to control
other pests in the project's greenhouses. We also
observed the location and number of eggs depos-
ited by adults in the crop, and the development
and survival of squash bug nymphs on Beit alpha
cucumber.
The spatial distribution of egg masses in the
greenhouse indicated the presence of female
squash bugs and subsequent nymphs. Squash
bug egg mass distribution on Beit alpha cucum-
ber was determined by randomly selecting 20 cu-
cumber leaves in each of the lower, middle, and


upper levels of cucumber plants. Counts were
made every other day for three weeks. Beit alpha
plants were 3.7 m tall and each level was approx-
imately 1.2 m wide. For each plant level and day,
the number of egg masses and eggs per mass were
counted (n = 20). Plants in the outside row proxi-
mal to the east wall screen were used because the
pest appeared there first.
Squash bug adults (n = 20) were collected from
the Beit alpha cucumber crop and taken to the
laboratory (28 April). The colony was maintained
at 21C and 65% RH with a 16:8 (L:D) photo-
period. The squash bugs and cucumber plant
material were kept in 3.8-liter Mason jars and
egg masses were collected daily. Five egg masses
from a single day were transferred to individual
7-cm plastic cups and kept moist with wet cotton
balls. After the eggs hatched, about 20 nymphs
were removed from each mass (n = 100) and iso-
lated in individual 10 cm diameter plastic cups.
Daily observations were made until individuals
died. Each nymph was fed one-fourth of a Beit al-
pha cucumber leaf and a section of cucumber
fruit. Food was replaced every two days. The de-
velopmental period was recorded for eggs and
first and second instar nymphs.
To test squash bugs as prey, an experimental
unit was used consisting of a section of Beit alpha
cucumber leaf, a predator, and five first instars of
the squash bug in an 8.2 cm diameter petri dish
(Fisherbrand, Suwanee, GA) sealed with para-
film. Third instar and adult predators were used
based on the results of a pilot experiment. Preda-
tors were not fed 8 h prior to the experiments. The
control consisted of five prey without a predator.
The mean number of prey consumed per day by
each kind of predator was recorded and LSD was
used to determine significant differences among
treatment means (SAS Institute 2002).
Most egg masses were laid in the upper level of
the crop, since it was frequented by the adults, av-
eraging 11 1.6. The mean number of egg masses
in the middle third was 6 1.2 and in the lower
third 3 0.8 (LSD, 0.05 = 4.75). Combining data
from all locations, the average number of eggs laid
per mass was of 20 3.3. Egg masses were
roughly circular (Fig. 1). The squash bug nymphs
reared on Beit alpha cucumber advanced through
the 2nd instar only. Bonjour and Fargo (1989)




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs


TRACE ROUTE

Total Execution Time: 50 Milliseconds

MILLISECOND   CLASS.METHODMESSAGE
0sobekcm_page_globals.constructor
0sobekcm_page_globals.constructorApplication State validated or built
0sobekcm_database.verify_item_lookup_object
0sobekcm_page_globals.constructorNavigation Object created from URI query string
0sobekcm_database.verify_item_lookup_object
0sobekcm_page_globals.display_itemRetrieving item or group information
0sobekcm_page_globals.get_entire_collection_hierarchyRetrieving hierarchy information
0sobekcm_assistant.get_entire_collection_hierarchy
0cached_data_manager.retrieve_item_aggregation
0cached_data_manager.retrieve_item_aggregationFound item aggregation on local cache
0item_aggregation_builder.get_item_aggregationFound 'all' item aggregation in cache
0system.web.ui.page.page_load (ufdc.page_load)
0sobekcm_page_globals.constructor.on_page_load
0html_echo_mainwriter.add_style_referencesAdding style references to HTML
0html_echo_mainwriter.add_text_to_pageReading the text from the file and echoing back to the output stream
49html_echo_mainwriter.add_text_to_pageFinished reading and writing the file