Title: Florida Entomologist
ALL VOLUMES CITATION DOWNLOADS THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00098813/00022
 Material Information
Title: Florida Entomologist
Physical Description: Serial
Creator: Florida Entomological Society
Publisher: Florida Entomological Society
Place of Publication: Winter Haven, Fla.
Publication Date: 2004
Copyright Date: 1917
 Subjects
Subject: Florida Entomological Society
Entomology -- Periodicals
Insects -- Florida
Insects -- Florida -- Periodicals
Insects -- Periodicals
 Notes
General Note: Eigenfactor: Florida Entomologist: http://www.bioone.org/doi/full/10.1653/024.092.0401
 Record Information
Bibliographic ID: UF00098813
Volume ID: VID00022
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: Open Access

Downloads
Full Text



Knight & Nayar: Electrophorectic Identification of Culex species


IDENTIFICATION OF FOUR COMMON CULEX (CULEX) (DIPTERA:
CULICIDAE) SPECIES FROM FLORIDA WITH ISOENZYME ANALYSIS

J. W. KNIGHT AND J. K. NAYAR
Florida Medical Entomology Laboratory, and Department of Entomology and Nematology
IFAS/University of Florida, 200 9th Street, S.E., Vero Beach, FL 32962

ABSTRACT

Females of four common Culex (Culex) species from Florida were analyzed for isoenzymes
using polyacryamide gel electrophoresis. Ten enzymes that yielded 11 putative loci were
studied. Most of the loci showed diagnostic characteristics in the four species, but four of the
loci (glycerol-3-phosphate dehydrogenase [Gpd-2], hexokinase [Hk], isocitrate dehydroge-
nase [Idh-1], and malate dehydrogenase [Mdh]) could be used in sequence to identify the
four Culex species. Culex salinarius and Cx. p. quinquefasciatus could be separated from Cx.
restuans and Cx. nigripalpus by Mdh locus. Culex salinarius could be distinguished from Cx.
p. quinquefasciatus by Hk locus and Cx. nigripalpus could be distinguished from Cx. restu-
ans, by Idh-1 and/or Gpd-2 loci. Randomly combined specimens of these four Culex species
were identified accurately by using these enzyme loci.

Key Words: Mosquito identification, Culex species, Culex nigripalpus, Culex pipiens quin-
quefasciatus, Culex restuans, Culex salinarius, isoenzyme analysis, Florida

RESUME

Las hembras de cuatro species comunes de Culex (Culex) de Florida fueron analizadas para
isoenzimas usando un gel poliacrilamida de electroforesis. Diez enzimas que produjeron 11
loci (lugares) putativas fueron estudiados. La mayoria de los loci mostraron caracteristicas
diagnosticadas en las cuatro species, pero cuatro de los loci (glicerol-3-fosfato-deshidroge-
nasa [Gpd-2], hexocinasa [Hk], isocitrato-deshidrogenasa [Idh-1], y el malato-deshidroge-
nasa [Mdh]) pudieron ser utilizados en secuencia para identificar las cuatro species de
Culex. Culex salinarius y Cx. p. quinquefasciatus pudieron ser separadas de Cx. restuans y
Cx. nigripalpus por el locus de Mdh. Culex salinarius pudieron ser distinguidas de Cx. p.
quinquefasciatus por el loci de Hk y Cx. nigripalpus pudieron ser distinguidas de Cx. restu-
ans, por los loci Idh-1 y/o Gpd-2i. Especimenes de las cuatro species de Culex, combinados
al azar fueron identificados correctamente utilizando estos loci de enzimas.


Mosquitoes belonging to the Culex (Culex) spe-
cies have been shown to be among the important
epizootic or epidemic vectors of arboviruses in-
cluding St. Louis encephalitis (SLE) virus and
West Nile Virus (WNV) in the United States (Tsai
& Mitchell 1989, CDC 2002). Accurate identifica-
tion of field-collected Culex mosquitoes is essen-
tial for epidemiological and control efforts. Field-
collected specimens of females of Culex (Culex)
species are often difficult to identify, because
adult collections are commonly made with vari-
ous trapping methods and, unfortunately, the
characteristic patterns of scales used to identify
Culex adult females are frequently rubbed off by
the devices or simply lost as the mosquito ages
with the result that unidentified Culex species
are lumped together as Culex spp. for identifica-
tion and for virus analysis. During the last 30
years, several attempts have been made to iden-
tify field-collected Culex mosquitoes by methods
other than the morphological methods. These in-
clude identification of Culex species by isoenzyme
electrophoresis in Indiana (Saul et al. 1977; Cor-
saro & Munstermann 1984) and by a species-


diagnostic polymerase chain reaction assay
(Crabtree et al. 1995; Miller et al. 1996; Crabtree
et al. 1997). Since some Culex species present in
Florida are different from species found in other
parts of the United States, the objective of this
study was to identify females of Florida's four
common Culex (Culex) species (Cx. nigripalpus
Theobald, Cx. pipiens quinquefasciatus Say, Cx.
restuans Theobald and Cx. salinarius Coquillett)
by using isoenzyme electrophoresis.

MATERIALS AND METHODS

Mosquito Collection

Egg rafts of the four Culex species were col-
lected in oviposition pans containing oak leaf and/
or hay infusion from the field at the Florida Med-
ical Entomology Laboratory (Knight & Nayar
1999) from January through April 2003 when all
four species are present (O'Meara & Evans, 1983;
Provost 1969). Individual egg rafts were allowed
to hatch in the laboratory in vials and the first in-
stars of each species were identified (Dodge 1966;







Florida Entomologist 87(1)


Haeger & O'Meara 1983). Larvae from 16 to 20
egg rafts from each species were reared, one raft
per tray, to the adult stage. The identification of
newly emerged adults was reconfirmed by mor-
phological characters before samples of females
were frozen to be used later in polyacrylamide gel
electrophoresis.
In order to confirm our results, 6 individuals/
gel of each of the four Culex species, each individ-
ual representing a different family, were ran-
domly processed for the previously determined
four diagnostic enzyme loci as described in the
Results section below. A total of 24 individuals of
each Culex species, each individual representing
a different family, were processed.

Electrophoretic Methods

Preparation of individual mosquitoes, buffer
systems and electrophoretic protocols were the
same as were described by Black and Munster-
mann (1996). Mini-Protean II Cell (Mini-verti-
cal electrophoretic system from Bio-Rad
Laboratories, Hercules, CA) was used for these
studies. Each female was homogenized in 30 pl of
loading buffer (20% sucrose, Triton X-100 [0.5%],
Tris-citrate pH 7.0 electrode buffer and trace
amount of bromophenol blue tracking dye), and
centrifuged for 10 min at 2,000 g. The superna-
tant (24 pl) was dispensed equally (3 pl) into 8,
0.5-ml Eppendorf tubes and frozen at -80C until
used for electrophoresis. At the time of electro-
phoresis, a 1.0-pl sample was loaded into each
lane of the gel. Using this method we could ana-
lyze up to 16 enzyme loci from each mosquito
(Nayar et al. 2002).
Ten enzyme systems were analyzed and are
listed by name, abbreviation and Enzyme Com-
mission number: aconitase hydratase (Acoh, EC
4.2.1.3); adenylate kinase (Ak-2, EC 2.7.4.3); glyc-
erol-3-phosphate dehydrogenase (Gpd-2, EC
1.1.1.8); glucose-6-phosphate isomerase (Gpi, EC
5.3.1.9); hexokinase (Hk-2-4, EC 2.7.1.1 scored as
one enzyme); isocitrate dehydrogenase (Idh-1 and
Idh-2, EC 1.1.1.42); malate dehydrogenase (Mdh,
EC 1.1.1.37), malate dehydrogenase (NADP+)/
malic enzyme (Mdhp-2/Me, EC 1.1.1.40); phos-
phogluconate dehydrogenase (Pgd, EC 1.1.1.44),
and phosphoglucomutase (Pgm, EC 5.4.2.2.).
Three females, each from a separate family, were
analyzed on each gel, and eight gels were assayed
for each group of four species plus controls. Refer-
ence females of Aedes aegypti L. (ROCK strain)
were also included in each run.

Statistical Analysis

Genetic variation was analyzed with a BIO-
SYS-2 Program for desktop computer (Black
1997). This program is a modification ofBIOSYS-
1 (Swofford & Selander 1981).


TABLE 1. ALLELE FREQUENCIES IN FOUR CULEX SPECIES
(CS = CX. SALINARIUS, CR = CX. RESTUANS,
CQ = CX. P. QUINQUEFASCIATUS AND CN = CX.
NIGRAIPALPUS). TWENTY-FOUR SPECIMENS,
EACH FROM A SEPARATE FAMILY, WERE ANA-
LYZED FROM EACH SPECIES.

Species
Locus & Rf values CS CR CQ CN


Acoh
95
100
105
Ak-2
90
95
100
Gpd-2
100
120
Gpi


0.000
0.875
0.125

1.000
0.000
0.000


0.000
0.208
0.792

1.000
0.000
0.000


0.083
0.917
0.000

0.000
0.000
1.000


1.000
0.000
0.000

0.000
1.000
0.000


1.000 1.000 1.000 0.083
0.000 0.000 0.000 0.917


0.000
1.000
0.000
0.000

0.917
0.083
0.000

0.000
0.000
0.625
0.292
0.083

0.667
0.000
0.167
0.167


86
93
100
Idh-1
100
107
133
147
153
Idh-2
94
97
100
111
Mdh
83
100
Mdhp-2
95
100
103
108
Pgd
67
100
Pgm
87
100
109


0.000
0.000
0.083
0.917

0.000
0.000
1.000

0.000
1.000
0.000
0.000
0.000

0.000
1.000
0.000
0.000


0.000
0.000
1.000
0.000

0.000
0.000
1.000

1.000
0.000
0.000
0.000
0.000

1.000
0.000
0.000
0.000


0.042
0.000
0.833
0.125

0.000
0.375
0.625

0.000
0.000
1.000
0.000
0.000

0.000
1.000
0.000
0.000


0.000 1.000 0.000 1.000
1.000 0.000 1.000 0.000


0.042
0.333
0.000
0.625


1.000
0.000
0.000
0.000


0.000
0.875
0.125
0.000


1.000
0.000
0.000
0.000


0.792 0.083 0.125 0.000
0.208 0.917 0.875 1.000


0.167
0.833
0.000


0.458
0.542
0.000


0.000
0.958
0.042


0.333
0.542
0.125


The eleven variable enzymes are Acoh = aconitase hy-
dratase;Ak-2 = adenylate kinase; Gpd-2 = glycerol-3-phosphate
dehydrogenase; Gpi = glucose-6-phosphate isomerase; Idh-1
and Idh-2 = isocitrate dehydrogenase; Hk = hexokinase; Mdh =
malate dehydrogenase; Mdhp-2 = malate dehydrogenase
(NADP+); Pgd = phosphogluconate dehydrogenase; and Pgm =
phosphoglucomutase.


March 2004






Knight & Nayar: Electrophorectic Identification of Culex species



le


CS CR Aa CQ CN
I u II I II I


Hk


:x1"


Idh-2

Idh-1




1h

Gpd-2




Gpd-1


1 7


7 13


Fig. 1. Isoenzyme profiles of four enzymes (six loci, Mdh, Hk, Idh-1 and Idh-2, and Gpd-1 and Gpd-2). In Figs.
la-ld, individuals numbered 1-3, 4-6, 8-10 and 11-13 represent known Culex salinarius (CS), Cx. restuans (CR), Cx.
p. quinquefasciatus (CQ) and Cx. nigripalpus (CN), respectively. Individual numbered 7 (Aa) is Aedes aegypti con-
trol. Figs. le-lh, are used to identify unknown individuals as described in the text, except that individual numbered
7 (CQ) Cx. p. quinquefasciatus was used as a control.


r.l


~:~-ta.
:':.







Florida Entomologist 87(1)


RESULTS

Allele frequency data for four Culex species
from Florida are presented in Table 1. Compari-
son of the frequency values of enzyme loci showed
that even though most of the enzyme loci have dif-
ferences in Rfvalues that could separate different
species from each other, the Rfvalues in only four
of the loci (Gpd-2, Hk, Idh-1 and Mdh) were dis-
tinctive enough to be used to separate the four
species (Table 1; Fig. 1). These four loci are as fol-
lows: malate dehydrogenase (Mdh) is monomor-
phic in Cx. salinarius and Cx. p. quinquefasciatus
at .M/..' ', and in Cx. nigripalpus and Cx. restuans
at Mdh83 (Table 1; Fig. la). Hexokinase (Hk), that
is represented by three-banded pattern and some-
times by a six-banded polymorphic pattern
(Tabachnick & Howard 1982), is slower in Cx.
salinarius (Hk86'6/93) than in the other three Culex
species (Cx. restuans Hk100, Cx. p. quinquefascia-
tus Hk100 and Cx. nigripalpus Hk93,100,93/100) (Table 1;
Fig. Ib). Isocitrate dehydrogenase-1 (Idh-1) is
polymorphic in Cx. salinarius Idh-1133, 133/147,133/153
but homozygous in the other three species (Cx.
restuans Idh-107, Cx. p. quinquefasciatus Idh-100
and Cx. nigripalpus Idh-1133) (Table 1; Fig. Ic).
Glycerol-3-phosphate dehydogenase (Gpd-2120 100/
120) is moving faster in Cx. nigripalpus in one al-
lele than the other three species (Cx. restuans
Gpd-2100, Cx. salinarius Gpd-2100, and Cx. p. quin-
quefasciatus Gpd-2100) (Table 1; Fig. Id). Since
Gpd-2 in Cx. nigripalpus is sometimes heterozy-
gous, caution is needed in using it as a distin-
guishing character. From this information we
developed a key to separate the four Culex species
(Table 2).
Further analysis of the data in Table 1 showed
that Cx. p. quinquefasciatus exhibited a low num-
ber of alleles per locus (1.3 0.1), the lowest per-
centage of polymporphic loci (23.1%) and the
lowest Hardy-Weinberg heterozygosity (0.054 +
0.03) from the other three species (Cx. nigripal-
pus, 1.6 + 0.2, 46.2% and 1.95 + 0.07; Cx. restuans,
1.3 + 0.1, 30.8% and 0.091 + 0.05; and Cx. salinar-
ius, 1.8 + 0.2, 69.2% and 0.207 0.05, respec-
tively). Since Cx. p. quinquefasciatus was
monomorphic for the four enzyme loci chosen to
be used in the key (Table 2), we used it as a con-
trol instead ofAe. aegypti (ROCK strain) to iden-


tify other Culex species. Thus, using Cx. p.
quinquefasciatus as a control (#7 in Figs. le-lh)
and the key (Table 2), we were able to identify cor-
rectly 24 randomly selected individuals of all four
Culex species (Figs. le-lh, only 12 individuals are
shown in these Figs.). Individuals numbered 3, 5,
8, 10, 11 and 13 (Fig. le) had a faster moving Mdh
allele and represented either Cx. salinarius or Cx.
p. quinquefasciatus, whereas individuals num-
bered 1, 2, 4, 6, 9 and 12 had a slower Mdh allele
representing either Cx. restuans or Cx. nigripal-
pus. Individuals numbered 5, 8, 10 and 13 (Fig.
If) had a slower moving Hk allele that identified
it as Cx. salinarius, and distinguished it from the
other two faster moving individuals numbered 3
and 11 that were identified as Cx. p. quinquefas-
ciatus. Individuals that represented either Cx.
restuans or Cx. nigripalpus and were numbered
1, 4, 9 and 12 (Fig. Ig) had a faster moving Idh-1
allele that identified it as Cx. nigripalpus, and
distinguished it from a slower moving Idh-1 allele
in individuals numbered 2 and 6 that were iden-
tified as Cx. restuans. Culex nigripalpus individu-
als numbered 1, 4, 9 and 12 were identified by
using Gpd-2 enzyme loci. The most common Gpd-
2 in Cx. nigripalpus was faster than Gpd-2 in the
other three Culex species (Fig. lh).

CONCLUSION

Our results show that Culex (Culex) species
from Florida can be unambiguously distinguished
from each other by using four isozymes (Mdh, Hk,
Idh-1 and Gpd-2) in sequence. These studies sug-
gest that from various types of trapping collec-
tions for Culex species, those individuals that
cannot be identified to separate species with stan-
dard morphological characters can be identified
by isoenzyme analysis, instead of pooling them to-
gether as Culex spp. It is worth pointing out here
that the four species of mosquitoes used in this
study were collected from January through April,
when all four species were present in Florida. It is
possible that some of the isoenzyme systems may
show some degree of polymorphism when these
species of mosquitoes are collected at different
times of the year or from different locations as ob-
served in Cx. nigripalpus (Nayar et al. 2002) and
Cx. p. quinquefasciatus (Nayar et al. 2003).


TABLE 2. ELECTROPHORETICE KEY FOR IDENTIFICATION OF OUR COMMON CULEX (CULEX) SPECIES IN FLORIDA.

1. Mdh, faster, monomorphic ............................ Cx. salinarius or Cx. p. quinquefasciatus (2)
Slower, monomorphic ......................................Cx. restuans or Cx. nigripalpus (3)
2. Hk, slower ................ ............................................. Cx. salinarius
Faster, monomorphic. .................................... ............. Cx. p. quinquefasciatus
3. Idh-1, faster, monomorphic;
Gpd-2, faster, usually monomorphic ................ ............................Cx. nigripalpus
Both Idh-1 and Gpd-2 slower, monomorphic ............... ...................... Cx. restuans


March 2004







Knight & Nayar: Electrophorectic Identification of Culex species


Therefore, a word of caution may be appropriate.
A broader application of this technique to identify
Culex species from other areas must be confirmed
with samples from different localities before this
technique should be used outside Florida.
Isoenzyme analysis by electrophoresis tech-
nique is reliable, accurate and simple to perform
once the electrophoretic equipment is set-up in
the laboratory (Black & Munstermann 1996) and
a person is trained to run the equipment. This
technique is especially useful when freshly col-
lected or frozen Culex mosquitoes are to be used
for virus analysis or surveillance during different
seasons of the year; however, this technique can-
not be used for dead or dried specimens. Isoen-
zyme analysis is less expensive and faster than
the PCR technique for DNA identification of dif-
ferent Culex species (Miller et al. 1996; Crabtree
et al. 1995, 1997), but DNA analyses can be used
for dead or dried specimens.

ACKNOWLEDGMENTS

This article is Florida Agricultural Experimental
Station Journal Series No. R-09582.

REFERENCES CITED

BLACK, W. C. IV. 1997. Biosys-2. A Computer Program
for the Analysis of Allelic Variation in genetics. Col-
orado State University, Ft. Collins, CO.
BLACK, W. C. IV., AND L. E. MUNSTERMANN. 1996. Mo-
lecular taxonomy and systematics of arthropod vec-
tors, pp. 438-470. In B. J. Beaty, and W. C. Marquardt
(eds.). The Biology of Disease Vectors. University
Press of Colorado, Niwot, CO.
CDC. 2002. Provisional surveillance summary of the
West Nile Virus epidemic-United States, January
to November. MMWR. 51: 1129.
CORSARO, B. G., AND L. E. MUNSTERMANN. 1984. Iden-
tification by electrophoresis of Culex adults (Diptera:
Culicidae) in light-trap samples. J. Med. Entomol.
21: 648-655.
CRABTREE, M. B., H. M. SAVAGE, AND B. R. MILLER
1995. Development of a species-diagnostic poly-
merase chain reaction assay for the identification of
Culex vectors of St. Louis encephalitis virus based on
interspecies sequence variation in ribosomal DNA
spacers. Am. J. Trop. Med. Hyg. 53: 105-109.


CRABTREE, M. B., H. M. SAVAGE, AND B. R. MILLER
1997. Development of a polymerase chain reaction
assay for differentiation between Culex pipiens pipi-
ens and Cx. p. quinquefasciatus (Diptera: Culicidae)
in North America based on genomic differences iden-
tified by subtractive hybridization. J. Med. Entomol.
34: 532-537.
DODGE, H. R. 1966. Studies on mosquito larvae. II. The
first-stage larvae of North American Culicidae and
of world Anophelinae. Can. Entomol. 98: 337-393.
HAEGER, J. S., AND G. F. O'MEARA. 1983. Separation of
first-instar larvae of four Florida Culex (Culex). Mos-
quito News 43: 76-77.
KNIGHT, J. W., AND J. K. NAYAR 1999. Colonization of
Culex nigripalpus Theobald (Diptera: Culicidae) by
stimulation of mating using males of other mosquito
species. J. Am. Mosq. Control Assoc. 15: 72-73.
MILLER, B. R., M. B. CRABTREE, AND H. M. SAVAGE.
1996. Phylogeny of fourteen Culex mosquito species,
including the Culex pipiens complex, inferred from
the internal transcribed spacers of ribosomal DNA.
Insect Mol. Biol. 5: 93-107.
NAYAR, J. K., J. W. KNIGHT, AND L. E. MUNSTERMANN.
2002. Temporal and geographic genetic variation in
Culex nigripalpus Theobald (Diptera: Culicidae), a
vector of St. Louis encephalitis, from Florida. J. Med.
Entomol. 39: 854-860.
NAYAR, J. K., J. W. KNIGHT, AND L. E. MUNSTERMANN.
2003. Temporal and geographic genetic variation in
Culex pipiens quinquefasciatus Say (Diptera: Culi-
cidae) from Florida. J. Med. Entomol. 40: 882-889.
O'MEARA, G. F., AND F. D. S. EVANS. 1983. Seasonal pat-
terns of abundance among three species of Culex
mosquitoes in a south Florida wastewater lagoon.
Ann. Entomol. Soc. 76: 130-133.
PROVOST, M. W. 1969. The natural history of Culex ni-
gripalpus. In St. Louis encephalitis in Florida. Flor-
ida State Board of Health. Monogr. No. 12: 46-62.
SAUL, S. H., P. R. GRIMSTAD, AND G. B. CRAIG, JR. 1977.
Identification of Culex species by electrophoresis.
Am. J. Trop. Med. Hyg. 26: 1009-1012.
SWOFFORD, D. L., AND R. B. SELANDER 1981. BIOSYS-
1: a FORTRAN program for the comprehensive anal-
ysis of electrophoretic data in population genetics
and systematics. J. Heredity 72: 281-283.
TABACHNICK, W. J., AND D. J. HOWARD. 1982. Genetic
control of hexokinase variation in insects. Biochem.
Genet. 20: 47-57.
TSAI, T. F., AND C. J. MITCHELL. 1989. St. Louis enceph-
alitis, pp. 113-143. In T P. Monath (ed.), The Arbovi-
ruses: Epidemiology and Ecology. Vol. IV. CRC Press,
Boca Raton, FL.







Florida Entomologist 87(1)


March 2004


SAFETY OF A NOVEL INSECTICIDE, SUCROSE OCTANOATE,
TO BENEFICIAL INSECTS IN FLORIDA CITRUS

J. P. MICHAUD'2 AND C. L. MCKENZIE'3
'University of Florida, Citrus Research and Education Center, 700 Experiment Station Road, Lake Alfred, FL 33881

2Agricultural Research Center-Hays, Kansas State University, 1232 240th Ave., Hays, KS 67601

3USDA, ARS Horticultural Research Laboratory, 2001 South Rock Rd., Ft. Pierce, FL 34945

ABSTRACT

Laboratory trials were used to estimate the toxicity of sucrose octanoate to beneficial insects
representing four insect orders of importance in biological control in Florida citrus. First in-
stars of the ladybeetles Cycloneda sanguine L., Curinus coeruleus Mulsant, Harmonia ax-
yridis Pallas and Olla v-nigrum Mulsant (Coleoptera: Coccinellidae) and the lacewing
Chrysoperla rufilabris Burmeister (Neuroptera: Chrysopidae) survived topical sprays of su-
crose octanoate at 8,000 ppm without significant mortality, a concentration corresponding to
twice the recommended field rate required to kill aphids and other soft bodied pests. Simi-
larly, adults of the red scale parasitoid, Aphytis melinus De Bach (Hymenoptera: Aphelin-
idae) and second instars of the predatory bug Orius insidiosus (Say) (Hemiptera:
Anthocoridae) survived 24 h exposures to residues of 8,000 ppm sucrose octanoate on leaf
disks without significant mortality. The efficacy of sucrose octanoate as a contact insecticide
against various homopteran pests of citrus, combined with its low toxicity to key beneficial
insects in the citrus ecosystem, suggest that it may be a valuable material for incorporation
into IPM programs for Florida citrus.

Key Words: Aphytis melinus, Curinus coeruleus, Cycloneda sanguine, Harmonia axyridis,
Olla v-nigrum, Orius insidiosus, sucrose octanoate

RESUME

Pruebas de laboratorio fueron usadas para estimar la toxicidad de octanoate de sucrosa para
insects ben6ficos representantes de cuatro ordenes. Larvas de primer estadi6 de los cocine-
lidos Cycloneda sanguine L., Curinus coeruleus Mulsant, Harmonia axyridis Pallas y Olla
v-nigrum Mulsant y el cris6pido Chrysoperla rufilabris Burmeister sobrevivieron asper-
ciones topicales de octanoate de sucrosa en dosis de 8,000 ppm sin mortalidad significativa,
una concentraci6n corespondiente al double de la dosis necesaria para matar afidos y otras pl-
agas hom6pteras en citricos. En forma parecida, adults del parasitoide de la escama roja,
Aphytis melinus De Bach (Hymenoptera: Aphelinidae) y ninfas de segundo estadi6 de Orius
insidiosus (Hemiptera: Anthocoridae) sobrevivieron sin mortalidad significativa un period
de 24 h expuestos a dosis residuales de octanoate de sucrosa de 8,000 ppm aplicadas en dis-
cos de hoja. La eficacia del octanoate de sucrosa como insecticide de contact contra varias
plagas hom6pteras de citricos, en combinaci6n con su toxicidad baja contra insects ben6fi-
cos en el ecosystema citricola, sugiere que este material puede ser valioso para inclusion en
programs de IPM en citricos en la Florida.
Translation provided by author


One of the challenges of insect control with
pesticides in agricultural IPM programs is
achieving selection and kill of target pests while
minimizing mortality to beneficial insects. How-
ever, phytophagous pest insects typically are
more resistant to synthetic toxins than are preda-
cious and parasitic insects due to the evolution of
mechanisms for detoxification of plant secondary
compounds (Croft 1990). This problem might be
overcome by the development of more selective
compounds with modes of action specific to pest
insects, or by selective application techniques
such as spot treatments that permit the survival


of beneficial insects in untreated refuges. Effec-
tive IPM programs require, or are in need of, new
materials with novel modes of action that can be
applied in rotation with existing pesticides to
avoid strong directional selection for resistance
development in pest populations.
Sucrose octanoate is one of a series of synthetic
sugar esters that are analogues of compounds
naturally occurring in the glandular trichomes of
wild tobacco, Nicotiana gossei Domin. Sugar es-
ters, also known as acyl sugars or polyol esters,
are a relatively novel class of insecticidal com-
pounds produced by reacting sugars with ali-







Michaud & McKenzie: Safety of Sucrose Octanoate


phatic or aromatic fatty acids (Puterka et al.
2003). Sucrose esters are benign to the environ-
ment, occur naturally in plants and are commer-
cially synthesized for use in the food industry
(Chortyk et al. 1996). The exudates of glandular
trichomes ofN. gossei have been known for many
years to contain compounds with insecticidal ac-
tivity (Thurston & Webster 1962). It was deter-
mined during the last decade that the primary
insecticidal compounds within these glandular
trichomes are sucrose esters (Buta et al. 1993,
Pittarelli et al. 1993). Synthetic sucrose esters
that are similar in structure to those that natu-
rally occur in N. gossei have comparable insecti-
cidal activity (Chortyk et al. 1996). Both natural
and synthetic sucrose esters have been shown to
have contact toxicity with very rapid knockdown
of soft-bodied arthropods, including aphids (Neal
et al. 1994), whiteflies (Liu et al. 1996) and psyl-
lids (Puterka & Severson 1995). Feeding and ovi-
positional deterrence to mites (Neal et al. 1994),
whiteflies (Liu & Stansly 1995) and leafminers
(Hawthorne et al. 1992) also have been demon-
strated with sucrose esters.
Although the mode of action is unknown, it has
been suggested that sugar esters affect the insect
cuticle causing death by rapid desiccation (Thurs-
ton & Webster 1962). Parr and Thurston (1968)
observed that topical applications ofN. gossei tri-
chome exudates applied to larvae of Manduca
sexta (L.) turned the cuticle transparent and
caused rapid loss of body fluids followed by death.
Similarly, Liu and Stansly (1995) observed that
nymphs of the whitefly Bemisia argentifolia Per-
ring and Bellows dried quickly and detached from
the leaf surface when treated with N. gossei ex-
tracts.
McKenzie and Puterka (2000) demonstrated
an LC90 (topical spray) for sucrose octanoate rang-
ing from 4,000-7,360 ppm for nymphs of the Asian
citrus psyllid, Diaphorina citri Kuwayama, an
important disease vector in citrus. Other work
has demonstrated good insecticidal activity
against the brown citrus aphid, Toxoptera citri-
cida (Kirkaldy) at even lower concentrations
(McKenzie, unpublished data). Although the
safety of sucrose esters for beneficial insects in
citrus has not yet been examined, Stansly and Liu
(1997) found that they had little or no effect on
the whitefly parasitoid Encarsia pergandiella
Howard. In order to ascertain the safety of su-
crose octanoate for natural enemies in citrus, we
selected candidate species for testing that repre-
sented four different orders of beneficial insects
known to be important in biological control of
homopteran pests, the primary targets of this ma-
terial. Aphytis melinus De Bach (Hymenoptera:
Aphelinidae) is a primary parasitoid of the Cali-
fornia red scale. The green lacewing C'i.. I !i.,
rufilabris Burmeister (Neuroptera: Chrysopidae),
and the insidious flower bug, Orius insidiosus


(Say) (Hemiptera: Anthocoridae), are both gener-
alist predators of many small arthropods in cit-
rus, including mites, aphids, psyllids and thrips.
We also tested four species of ladybeetles, Curi-
nus coeruleus Mulsant, Cycloneda sanguine L.,
Harmonia axyridis Pallas, and Olla v-nigrum
Mulsant (Coleoptera: Coccinellidae) that are all
important predators of homopteran citrus pests
(Michaud 1999, 2002a; Michaud et al. 2002).

MATERIALS AND METHODS

Adult beetles of each of the four coccinellid spe-
cies were maintained in 1-L ventilated glass
mason jars (~100-130/jar) filled with strips of
shredded wax paper for their first 9-12 days of life
following emergence. During this period, beetles
were fed a diet of frozen eggs of Ephestia sp. and
bee pollen with water provided on a cotton wick.
Mated adult females were transferred to individ-
ual plastic Petri dishes (5.5 cm dia x 1.0 cm) and
provisioned with Ephestia eggs and water encap-
sulated in polymer beads. Eggs were harvested
daily in the Petri dishes and held in an incubator
at 24C, 60 + 5% RH under fluorescent light (P:S-
16:8) and hatched ca. 3.5 0.5 days later under
these conditions. Newly hatched larvae were
placed in individual plastic Petri dishes (as above)
and reared on Ephestia eggs and water beads on a
laboratory bench at 24 2C, 60 5% RH, with
fluorescent lighting (P:S = 16:8). Larvae were
used for experiments when they were 24 6 h old.
Eggs of C. rufilabris were obtained from Bene-
ficial Insectary (Redding, CA) and held in an incu-
bator at 24 1C until hatching. Larvae used in
experiments were 24 6 h old.
Adult A. melinus were obtained from Rincon-
Vitova Insectaries Inc. (Ventura, CA). Adults
were fed a diluted honey solution and used in ex-
periments when they were 36-60 h old.
Newly hatched nymphs of 0. insidiosus were
obtained from Entomos, LLC (Gainesville, FL).
Nymphs were provided with frozen Ephestia eggs
and water beads and used in experiments when
they molted to the second instar.

Topical Sprays

The Potter Precision Spray Tower (Burkard
Manufacturing Co. Ltd., Rickmansworth Herts,
UK) permits delivery of a standardized dose of an
insecticide at a specified concentration with a con-
sistent droplet size under controlled conditions.
The Potter tower has been used previously to de-
termine the toxic concentrations of various con-
ventional pesticides to beneficial insects in citrus
(Michaud 2001, 2002b). First instars of each coc-
cinellid species (n = 20) were treated directly with
a 1.0-ml aqueous solution of sucrose octanoate at
8000 ppm. Control larvae (n = 20) were treated
with 1 ml of distilled water. Larvae were reared to







Florida Entomologist 87(1)


adulthood in individual Petri dishes (as above) on
a diet of frozen Ephestia eggs. Estimates of mor-
tality incorporated all mortality through to emer-
gence of adults. Data were corrected for control
mortality by Abbott's correction (Abbott 1925)
and analyzed with a Chi-square, Goodness-of-fit
Test (a = 0.05).

Leaf Residues

Due to their high activity levels, adult parasi-
toids and Orius nymphs were exposed to leaf resi-
dues instead of topical sprays. Leaf disks were
punched from clean grapefruit leaves that had
been washed in a 0.5%-sodium hypochlorite solu-
tion. Adaxial sides of the leaf disks (n = 25) were
then sprayed with a 1.0 ml-aqueous solution of su-
crose octanoate at 8000 ppm in the Potter Spray
Tower; control disks (n = 25) were sprayed with 1
ml distilled water. Treated leaf disks were placed
in individual Petri dishes (5.0 cm dia x 1.0 cm) and
insects were transferred individually to each dish.
Adult A. melinus were provided with a droplet
of diluted honey on the lid of the Petri dish and
mortality was assessed after 24 h. Nymphs of O.
insidiosus were confined on the leaf disks for 24 h,
removed to clean dishes, and reared to adulthood
on a diet of frozen Ephestia eggs and water beads.
The mortality estimate for 0. insidiosus incorpo-
rates all mortality from nymph through adult
stage. Data from all experiments were adjusted
for control mortality by Abbott's correction (Ab-
bott 1925) and analyzed by a Chi-Square, Good-
ness-of-Fit test (a = 0.05).

RESULTS AND DISCUSSION

Treatment mortality was never significantly
different from control mortality for any species of
beneficial insect in any trial (Table 1). The fact
that sugar esters seem to have active toxicity only


in liquid form (Puterka & Severson 1995) may
have influenced the results obtained for 0. insid-
iosus and A. melinus with leaf disk residues. Yet
these authors showed residual activity to newly
closed nymphs. Contact with residues is proba-
bly the primary form of exposure for foraging nat-
ural enemies, so the lack of activity is significant.
Similarly, Stansly and Liu (1997) found low toxic-
ity of natural and synthetic sugar esters toE. per-
gandiella, an important parasitoid of the
silverleaf whitefly, and concluded that these ma-
terials would be compatible with biological con-
trol ofB. argentifolia in vegetable fields.
Materials demonstrating toxicity to beneficial
insects in laboratory trials warrant further testing
under field conditions before it can be concluded
they pose a risk to biological control under real-
world conditions (Croft 1990). This does not appear
to be the case for sucrose octanoate. These labora-
tory trials demonstrate the lack of toxicity of su-
crose octanoate for insects representing four
different orders of beneficial insects that include
most natural enemy species important for biologi-
cal control in citrus. We conclude that sucrose oc-
tanoate appears to have good potential for
inclusion in IPM programs designed to manage ho-
mopteran pests in citrus, with a low probability of
adverse side effects on important beneficial species.
Plant chemical defenses are rarely 100% effec-
tive against herbivores, so advantages accrue to
plants that can spare natural enemies, or even en-
courage their recruitment. The fact that sucrose oc-
tanoate has contact toxicity against certain
herbivorous insects and mites, but not against lar-
val predators, raises interesting questions regard-
ing its mode of action. Are beneficial insects
resistant to sucrose octanoate because its binding
sites on the cuticle are lacking or insensitive? If so,
characterizing differences in cuticular chemistry be-
tween resistant and susceptible insects may provide
insights into the mode of action of sugar esters.


TABLE 1. PERCENT MORTALITY OF BENEFICIAL INSECTS TREATED WITH TOPICAL SPRAYS OR 24 H EXPOSURE TO LEAF
RESIDUES OF A 2% SUCROSE OCTANOATE SOLUTION (=8000 PPM).

Adjusted
Insect Order: Family Beneficial species Life stage n mortality (%)' P

Topical sprays @ 2%
Coleoptera: Coccinellidae Curinus coeruleus 1st instar larvae 20 5.3 ns
Cycloneda sanguinea 20 10.9 ns
Harmonia axyridis 20 0.0 ns
Olla v-nigrum 20 4.7 ns
Neuroptera: Chrysopidae Chrysoperla rufilabris 20 0.0 ns
Leaf residue @ 2%
Hemiptera: Anthocoridae Orius insidiosus 2nd instar nymphs 25 0.0 ns
Hymenoptera: Aphelinidae Aphytis melinus adults 25 0.0 ns

Values were adjusted for control mortality using Abbott's correction (Abbott 1925).


March 2004







Michaud & McKenzie: Safety of Sucrose Octanoate


ACKNOWLEDGMENTS

We thank Dr. Gary J. Puterka of the Appalachian
Fruit Research Station, USDA-ARS, Kearneysville, WV
for supplying the experimental compound and reviewing
the manuscript, Drs. R. Stuart and C.W. McCoy for addi-
tional reviews, and L. Tretyak for technical support. This
work was supported by the Florida Agricultural Experi-
ment Station and grants from the Florida Citrus Produc-
ers Research Advisory Council and USDA, APHIS and
approved for publication as Journal Series No. R09154.

REFERENCES

ABBOTT, W. S. 1925. A method of computing the effective-
ness of an insecticide. J. Econ. Entomol. 18: 265-267.
BUTA, J. G., W. R. LUSBY, J. W. NEAL, JR., R. M. WA-
TERS, AND G. W. PITTARELLI. 1993. Sucrose esters
from Nicotiana gossei active against greenhouse
whitefly, Trialeurodes vaporariorum. Phytochem.
22: 859-864.
CHORTYK, O. T., J. G. POMONIS, AND A. W. JOHNSON.
1996. Synthesis and characterizations of insecticidal
sucrose esters. J. Agric. Food Chem. 44: 1551-1557.
CROFT, B. A. 1990. Arthropod biological control agents
and pesticides. John Wiley & Sons, New York. 723 pp.
HAWTHORNE, D. J., J. A. SHAPIRO, W. M. TINGEY, AND
M. A. MUTSCHLER. 1992. Trichome-borne and artifi-
cially applied acylsugars of wild tomato deter feed-
ing and oviposition of the leafminer Liriomyza
trifolii. Entomol. Exp. Appl. 65: 65-73.
LIU, T-X., AND P. A. STANSLY. 1995. Toxicity and repel-
lency of some biorational insecticides to Bemisia ar-
gentifolii on tomato plants. Entomol. Exp. Appl. 74:
137-143.
LIU, T-X., P. A. STANSLY, AND O. T. CHORTYK. 1996. In-
secticidal activity of natural and synthetic sugar esters
against Bemesia argentifolii (Homoptera: Alyrodidae).
J. Econ. Entomol. 89: 1233-1239.
MCKENZIE, C. L., AND G. J. PUTERKA. 2000. Activity of
sugar esters to Asiatic citrus psyllid (AsCP). Pro-
ceedings of the International Society of Citriculture,
Congress-2000, December 3-7, Orlando, FL.


MICHAUD, J. P. 1999. Sources of mortality in colonies of
the brown citrus aphid, Toxoptera citricida. Biocon-
trol 44: 347-367.
MICHAUD, J. P. 2001. Relative toxicity of six insecticides
to Cycloneda sanguine and Harmonia axyridis (Co-
leoptera: Coccinellidae). J. Entomol. Sci. 37: 83-93.
MICHAUD, J. P. 2002a. Biological control of Asian citrus
psyllid in Florida: A preliminary report. Entomol.
News 113: 216-222.
MICHAUD, J. P. 2002b. Non-target impacts of acaricides
on ladybeetles in citrus: A laboratory study. Florida
Entomol. 85: 191-196.
MICHAUD, J. P., C. C. MCCOY, AND S. FUTCH. 2002. La-
dybeetles as biological control agents in citrus. Cit-
rus Industry 83 (3): 24-27.
NEAL, J. W., JR., J. G. BUTA, G. W. PITTARELLI, W. R.
LUSBY, AND J. A. BENZ. 1994. Novel sucrose esters
from Nicotiana gossei: Effective biorationals against
selected horticultural insect pests. J. Econ. Entomol.
87: 1600-1607.
PARR, J. C., AND R. THURSTON. 1968. Toxicity of Nicoti-
ana and Petunia species to larvae of the tobacco
hornworm. J. Econ. Entomol. 61: 1525-1531.
PITTARELLI, G. W., J. G. BUTA, J. W. NEAL, JR., W. R.
LUSBY, AND R. M. WATERS. 1993. Biological pesticide
derived from Nicotiana Plants. U.S. Patent No.
5,260,281.
PUTERKA, G. J., AND R. F. SEVERSON. 1995. Activity of
Sugar esters isolated from the trichomes of Nicoti-
ana gossei to pear psylla (Homoptera: Psyllidae). J.
Econ. Entomol. 88: 615-619.
PUTERKA, G. J., W. FARONE, T. PALMER, AND A. BAR-
RINGTON. 2003. Structure-function relationships af-
fecting the insecticidal and miticidal activities of
sugar esters. J. Econ. Entomol. 96: 636-644.
STANSLY, P. A., AND T. X. LIU. 1997. Selectivity of insec-
ticides to Encarsia pergandiella (Hymenoptera:
Aphelinidae), an endoparasitoid of Bemisi argenti-
folii (Hemiptera: Aleyrodidae). Bull. Entom. Res. 87:
525-531.
THURSTON, R., AND J. A. WEBSTER 1962. Toxicity of Nic-
otiana gossei Domin to Myzus persicae (Sulzer). En-
tomol. Exp. Appl. 5: 233-238.







Florida Entomologist 87(1)


March 2004


PHYLLOCNISTIS CITRELLA (LEPIDOPTERA: GRACILLARIIDAE)
AND ITS PARASITOIDS IN CITRUS IN ECUADOR

ERNESTO CANARTE BERMiDEZ1, NESTOR BAUTISTA MARTINEZ2, JORGE VERA GRAZIANO2,
HUGO CESAR ARREDONDO BERNAL3, AND ANTONIO HUERTA PANIAGUA2
'Instituto Nacional Aut6nomo de Investigaci6n Agropecuaria, Casilla postal 100
Estaci6n Experimental Portoviejo. Portoviejo-Ecuador

2Instituto de Fitosanidad. Colegio de Postgraduados. Montecillo, Texcoco, M6xico 56230

3Centro Nacional de Referencia de Control Biol6gico. Km 1.5 Carr. Tecoman-Estaci6n FFCC. Tecoman, Col. 28120

ABSTRACT

The objectives of this study were to determine the population fluctuations of the citrus leaf-
miner, Phyllocnistis citrella, and its parasitoids in three locations of Ecuador, to identify and
determine the geographic distribution of P. citrella parasitoids within Ecuador, and to estab-
lish which of eleven citrus species supported higher numbers of P. citrella and its parasi-
toids. The highest population density of P. citrella occurred during the dry season. The
highest infestations in three localities were in Lodana (43.8%) in October, in Riochico
(45.7%) in November, and in La Uni6n (17.3%) in December. The greatest percentages of par-
asitism occurred in Lodana in March (60%), in Riochico in January (18.9%), and La Uni6n
in December (50%). The species Ageniaspis citricola Logvinovskaya, Galeopsomyia sp., and
Elasmus tischeriae Howard were identified with 28.4, 2.2, and 0.07% parasitism, respec-
tively. Although this is the first report ofA. citricola in Ecuador, it is widely distributed in the
main citrus producing zones of the country. Orange and grapefruit yielded higher numbers
of citrus leafminers and their natural enemies than other citrus species.

Key Words: citrus leafminer, Phyllocnistis citrella, Gracillariidae, biological control

RESUME

Se determine el porcentaje de infestaci6n de el minador de hoja de los citricos, Phyllocnistis
citrella y, sus parasitoides; se identifico y documents la distribuci6n geografica de los para-
sitoides de P. citrella y se estableci6 la preferencia de P. citrella y sus parasitoides a once es-
pecies de citricos. La mayor densidad poblacional de P. citrella se present durante la 6poca
seca, observandose en Lodana la infestaci6n mas alta en octubre con 43.8%; en Riochico en
noviembre (45.7%) y en La uni6n en diciembre con 17.4%. El parasitismo se present con
mayor intensidad en Lodana en marzo con 60%, en Riochico en enero (18.9%) y La Uni6n con
50% en diciembre. Se identificaron las especiesAgeniaspis citricola Logvinovskaya, Galeop-
somyia sp. y Elasmus tischeriae con 28.4. 2.2 y 0.07% de parasitismo, respectivamente.
Siendo este el primer report de A. citricola en Ecuador, ampliamente distribuido en las
principles zonas citricolas del pais. Se denota cierta preferencia de P. citrella y sus parasi-
toides hacia las species de naranja y pomelos.

Translation provided by author


The citrus leafminer (CLM), Phyllocnistis cit-
rella Stainton, is a pest of plants in the Rutaceae
family. CLM mine leaves, surface tissue of young
shoots and stems, and less frequently the fruit
(Sponagel & Diaz 1994). The lamina of mined
leaves dries and rolls, reducing leaf area and re-
ducing photosynthetic activity of the plant.
CLM is native of Asia (Knapp et al. 1995). Today,
it is found in nearly all citrus-growing regions of
the world. In America it was reported for the first
time in 1993 in Florida, U.S.A. (Heppner 1993), and
later in different regions of the U.S.A. In Ecuador, it
was reported in 1995 in the province of Manabi (IN-
IAP 1995, 1996; Valarezo & Cafarte 1997). In a pe-
riod of six months CLM invaded almost the entire


Ecuadorian coast and later the interior regions. In-
festations of 97.14% were observed in Manabi, and
it was estimated that numbers of fruits of West In-
dies lime, (Citrus aurantifolia (Christmann) Swin-
gle) decreased up to 45% and yield decreased 48%
(Valarezo & Cafarte 1998).
Several different insecticides are used against
this pest, but these may involve undesirable ef-
fects on the environment, including interference
in control of the pest by natural enemies (Guerra
et al. 1997). Biological control is the best option
for controlling this pest (Peia 1997).
In many areas a reduction in the pest popula-
tion has been observed because of the presence of
a diversity of natural enemies. However, activity of







Bermudez et al.: Parasitoids of Phyllocnistis citrella


these natural enemies is variable and their value
as a factor in the regulation of CLM populations
differs in different geographical areas. This makes
it necessary to determine the effect of climate and
natural enemies on populations of the pest to es-
tablish their real value as CLM regulators.
Thirty-nine species of Hymenoptera have been
observed attacking CLM in its native area (Hepp-
ner 1993). Most of them are Eulophidae, but also
Encyrtidae, Elasmidae, Eurytomidae and Ptero-
malidae have been reported. In America, seven
parasitoids have been reported in Honduras,
seven species in Colombia, the same number in
Cuba (Gonzalez et al. 1995), and eight species
have been reported each in Florida and Mexico
(Perales et al. 1997).
The objectives of this study were to determine
the population fluctuations of P citrella and its
parasitoids in three locations of Ecuador, to iden-
tify and determine the geographic distribution of
P citrella parasitoids within Ecuador, and to es-
tablish which of eleven citrus species P citrella
and its parasitoids prefer.

MATERIALS AND METHODS

Phyllocnistis citrella and parasitoid popula-
tion fluctuations were determined from Septem-
ber 2000 to March 2001 in Lodana, Riochico, and
La Uni6n in the province of Manabi, Ecuador.
Each location represents a different type of man-
agement system. In Lodana, leaves infested with
CLM were collected every 10 days in a four-hect-
are West Indies lime orchard in which only neem
(aqueous extract and oil) was applied. In Rio-
chico, leaves were collected weekly in a 12-hect-
are West Indies lime orchard in which synthetic
organic pesticides were used. In La Uni6n, leaf
collection was done every 15 days in a five-hect-
are coffee (Coffea arabica L.) plantation in which
sweet orange (C. sinensis (L.) Osbeck) and man-
darin orange (C. reticulata Blanco), were planted
at 50-80 trees/ha. For the samples, mandarin or-
ange trees were selected. In this system no pesti-
cides were applied.
Percent infestation of CLM in the three sites
was determined by selecting 10 trees and collect-
ing from them 60 lime shoots in Lodana, 20 in
Riochico and 20 in La Uni6n. These shoots were
no larger than 20 cm. Total number of leaves and
mined leaves were counted on each shoot, and the
percentage of infestation was calculated.
For percent parasitism of CLM, 50 leaves were
collected from 10 trees (five leaves per tree) in
each location. The leaves from the middle and
lower thirds of the trees were selected from devel-
oped shoots (15 to 20 cm) with third instars and
pupal chambers of CLM.
The evaluations of emergence of CLM or its par-
asitoids were carried out daily for 22 days. Leaves
were checked to record parasitoids that did not


emerge due to the effect of management, prema-
ture drying of leaves, or abiotic factors. The recov-
ered parasitoid pupae were confined in trays with
moistened cotton until emergence of the adults.
For the geographic distribution of the parasi-
toids of P. citrella in Ecuador, collections were
done in 38 sites of 18 municipalities of the prov-
inces of Manibi, Guayas, and Los Rios (coastal re-
gion), Loja and Azuay (mountain region), and the
Napo province (eastern region) (Fig. 1).
In each of the 38 sites, 100 leaves with CLM
third instars or pupal chambers were collected
once. The leaves were placed in transparent plas-
tic bags 30.4 x 25.2 cm lined with absorbent paper
to maintain the moisture necessary for the miner,
or its parasitoids, to emerge. Twenty-five leaves
were placed in each bag; bags were inflated,
sealed with rubber bands, and hung with cords in-
side the greenhouse until the parasitoids were re-
covered. The parasitoids were identified with the
keys of Schauff and La Salle (1996).
To determine the preference of P citrella and
its parasitoids for different species of citrus, 11
species of the national collection of citrus at the
Portoviejo Experimental Station were evaluated.
For each sample, 20 shoots per citrus species and
around 100 leaves with CLM third instars and
pupal chambers were collected; these data were
used to calculate the percentage of parasitism.

RESULTS AND DISCUSSION

Percent Infestation of P. citrella and its Parasitoids
On 6881 leaves examined, it was observed that
in Lodana in October, December, and February,


5. Azuay
6. Loja


Fig. 1. Municipalities where collections were done to
determine the presence of P. citrella parasitoids in Ec-
uador, 2000.







Florida Entomologist 87(1)


there were slightly higher percentages of infesta-
tion than on other dates (43.8%, 30.4%, and
38.5%, respectively). During these months there
were periods when sprouting was 100% (Fig. 2),
coinciding with the months of greatest P. citrella
infestation. Similar results were found by Curt-
Diaz et al. (1998) and Valarezo and Cafarte
(1997). Parasitism of 58.7% was found in Novem-
ber, 53% in February, and 60% in March.
In Riochico, the highest values of infestation
(45.7%, 40.8%, and 45.5%, respectively) were ob-
served in September, October, and November.
Flushing was quite uniform and not higher than
50% in any month. Flushing in the dry months of
September, October, and November was 49.4%,
49.2%, and 47.2%, respectively, i.e., slightly high,
while in the rainy season, (January to March)
flushing decreased (Fig. 3). This reduction in
flushing and infestation in the citrus of this loca-
tion during the rainy season is possibly associ-
ated with the fact that during this period of
precipitation diseases such as anthracnose
(Gloeosporium limetticola R. E. Clausen) appear.
These diseases cause shriveling of almost all of
the tender shoots, or deform the tissue, interrupt-
ing normal development of the insect. As a result,
the percentages of these variables fall substan-
tially, and more so when growers do not use any
type of control against the disease. This is consis-
tent with the results of studies done by Robles
and Medina (1997).
Parasitism was low, possibly due to the grow-
ers' frequent applications of pesticides. The high-
est percentage of parasitism, 18.9%, was observed


SEP OCT NOV DE'
120 I I I

100-- W N


in January. This is compatible with observations
of Nuiez and Canales (1999) and Probst et al.
(1999), in terms of the lower values of parasitism
when insecticides are applied frequently.
In La Uni6n, in spite of the high increase in
sprouting, no increase was observed in CLM from
January to March; in fact, there was a decrease in
population density, with the highest value in
December with infestation of 17.4%. During the
dry months, September to December, constant
sprouting of about 25% was observed in the cit-
rus. With the rainy season (January), sprouting
intensity increased significantly, reaching 75% in
February and 100% in March of the same year
(Fig. 4). This is due to the fact that the citrus trees
are grown in association with coffee, and physio-
logically have only one major sprouting period per
year, which is activated with the first rainfalls in
January. In December there was greater parasit-
ism ('1.1 ,, coinciding with the date of greatest in-
festation by CLM.
The low CLM population densities are possibly
due to the combined action of biological regula-
tors that exert natural control of the pest under
this system of production (Mendoza 1995;
Castaio 1996; Valarezo & Cafarte 1998; Nuiez y
Canales 1999). It is clear that the action of bene-
ficial organisms is favored by the fact that in this
region no pest control measures are carried out in
the coffee-citrus plantations.
Comparing the means, it can be seen that par-
asitism is different among the locations. The
highest was in Lodana (47.6%), followed by La
Uni6n (25.7%), and Riochico (11.6%). Pesticide


JAN


FEB MAR


I I I J


80

60


20 -


28

-27.5

-27

26.5 E
1-
26

25.5

25


SEP OCT NOV DEC JAN FEB MAR


---flushing -- parasitism -x infest --temp


Fig. 2. Percent infestation of P. citrella and its parasitoids, and sprouting in lime in Lodana Ecuador. 2000-2001.


March 2004






Bermudez et al.: Parasitoids of Phyllocnistis citrella


SEP OCT NOV DEC JAN


FEB MAR


26.5

26

25.5

25 E

24.5

24

23.5


SEP OCT NOV DEC JAN FEB MAR

--*-flushing parasitism ----infest --temp


Fig. 3. Percent infestation of P. citrella and its parasitoids and sprouting in lime in Riochico, Ecuador. 2000-2001.

applications were different in each location. In ticides, natural substances, and mineral oils, con-
Lodana, during the 2000-2001 period, insecticide training at least 10 different active ingredients. In
(cypermethrin) was applied only once. In Rio- La Uni6n, no control measures were carried out.
chico, insecticides were applied every two weeks This suggests that pest management methods
or monthly, using diverse synthetic organic insec- may influence the percentage of parasitism.


SEP OCT NOV DEC


JAN FEB MAR


25.5
25
24.5
24
23.5
23
22.5
22
21.5
21


SEP OCT NOV DEC JAN FEB MAR

I-- flushing ---parasitism -- infest --+temp


Fig. 4. Percent infestation of P. citrella and its parasitoids, and sprouting in mandarin orange in La Uni6n, Ec-
uador. 2000-2001.







Florida Entomologist 87(1)


It is assumed that the parasitoid Ageniaspis
citricola Logvinovskaya arrived in Ecuador from
Peru, where it was introduced in 1996 as part of a
national program of classical biological control of
CLM. Most of the parasitoids were released in Pe-
ruvian citrus-producing zones, including the bor-
der towns of Tumbes and Piura. Rates of
parasitism here reached 98% (Nufiez & Canales
1999). Based on the presence of P citrella in the
18 municipalities near the border (Fig. 1), a possi-
ble route of entry of the parasitoid was through
the border province of Loja (Ecuador), and it ad-
vanced northwards through Azuay, Guayas,
Manabi, Los Rios, and finally Napo.

Geographic Distribution of Parasitoid Species
of P. citrella in Ecuador

A total of 4388 leaves infested with CLM were
analyzed to determine the presence of parasitoids
in the coastal, mountain and eastern regions. The
following species were identified:Ageniaspis citri-
cola (Hymenoptera: Encyrtidae), Galeopsomyia
sp. (Hymenoptera: Eulophidae), and Elasmus tis-


cheriae Howard (Hymenoptera: Elasmidae). The
latter two also were reported in Colombia
(Castaio 1996). The predominant species was
A. citricola (Table 1). As this is the first record of
this parasitoid in Ecuador, its discovery has im-
portant implication for the country's citrus pro-
duction. Parasitism observed for this parasitoid
varied between 13.3% and 79.3%. It is important
to note the presence ofA. citricola in the eastern
region; since between the coast and this region
there is a natural barrier, viz, the Andes Moun-
tains. Movement of plant material apparently
spreads the pest.
Ageniaspis citricola is a highly effective para-
sitoid ofP. citrella, achieving 28.4% mean parasit-
ism throughout Ecuador, while in one of the zones
79.3% of the leafminers were parasitized by this
species (Table 1). Rates of parasitism ofP. citrella
have been reported as 80% in Florida, U.S.A. (Me-
dina et al. 1997), and 100% in Australia (Peia
1997). In Ecuador, A. citricola is the predominant
species, relative to other species, which had low
incidences. Valarezo and Caiarte (1998) reported
that in Ecuador Elasmus sp. was the most widely


TABLE 1. GEOGRAPHIC DISTRIBUTION OF PARASITOIDS OF PHYLLOCNISTIS CITRELLA IN ECUADOR AND PERCENTAGE OF
PARASITISM.

% parasitism
Leaves Total
Province/Municipality analyzed A. citricola Galeopsomyia sp. E. tischeriae parasitism

Manibi Province (coastal region)
Portoviejo 1825 18.31 2.45 0.09 20.85
Santa Ana 715 45.97 6.48 0.00 52.45
Jipijapa 490 18.08 3.15 0.00 21.23
Pichincha 187 29.56 0.87 0.00 30.43
Chone 154 27.89 0.53 0.00 28.42
Pajan 139 35.88 1.18 0.00 37.06
Junin 110 13.34 2.96 0.00 16.30
Flavio Alfaro 97 13.33 0.00 0.00 13.33
Olmedo 86 20.95 0.00 0.00 20.95
Bolivar 83 28.43 0.00 0.98 29.41
24 de Mayo 82 50.00 0.00 0.00 50.00
Sucre 70 79.31 6.90 0.00 86.21
Guayas Province (coastal region)
Municipio Guayaquil 76 25.81 0.00 0.00 25.81
Los Rios Province (coastal region)
Quevedo 81 14.00 2.00 0.00 16.00
Buena F6 85 17.14 2.86 0.00 20.00
Loja Province (mountain region)
Municipio Malacatos 5 -
Azuay Province (mountain region)
Santa Isabel 5 -
Napo Province (Eastern region)
Coca 98 16.67 5.00 0.00 21.67
Mean 28.42 2.15 0.07 30.63


March 2004







Bermudez et al.: Parasitoids of Phyllocnistis citrella


TABLE 2. SPECIES OF PARASITOIDS OF P. CITRELLA AND THE DEVELOPMENTAL STAGES THEY ATTACK.

Parasitoid Biological stage attacked

Ageniaspis citricola Logvinovskaya Eggs, larva I
Galeopsomyia spl Girault Larva II, III, prepupa and pupa
Elasmus tischeriae Howard Larva II, III and pupa


distributed species, followed by Horismenus and
Galeopsomyia, which are present in five, four and
two of the nine municipalities studied, respec-
tively. Table 2 presents the developmental stages
that are attacked by the parasitoids.
The success of A. citricola as a parasitoid of
P citrella can be explained by its specific and gre-
garious character, which makes it more efficient
(Hoy & Nguyen 1994), and more competitive
(Nunez & Canales 1999), compared with the na-
tive generalist species. Native parasitoids survive
on alternate hosts, such as leafminers of other
cultivated plants or weeds, as in the case of Leu-
coptera coffella Guerin in coffee (Mendoza 1995;
Bautista et al. 1997; Bautista et al. 1998; Valar-
ezo & Canarte 1998). This characteristic would
explain the fact that, during this study, only two
of the 11 species that had been reported up to
1998 were found (INIAP 1996a; Valarezo &
Canarte 1998).
Since, from the beginning of the study, the pre-
dominance of A. citricola in Londana, Riochico,
and La Uni6n, Manibi, was evident, the number
of parasitoids present in each CLM pupa chamber
was quantified. On 2503 infested leaves, it was
determined that 69.3% of the chambers had three
pupae ofA. citricola, 23.14% had two pupae, and
7.6% had one, four or five pupae. Occasionally, up
to six pupae ofA. citricola per CLM chamber were
observed, still within the range reported by
Nunez and Canales (1999), who found between
two and nine pupae arranged like "sausages."


Preferences of P. citrella and its Parasitoids for Eleven
Citrus Species
Between 50% and 75% of the plants in the Na-
tional Citrus Collection at the time of evaluation
were flushing. Infestation data seem to denote a
certain preference of CLM for some species and
varieties. It can be seen in Table 3 that Washing-
ton navel oranges (naranja 'Washington navel'),
and red and white grapefruit (pomelo 'rojo' y
'blanco') have slightly higher rates of infestation
(37.4%, 35.1%, and 33.1%, respectively). Several
authors have mentioned a differential behavior of
CLM toward certain species of citrus. In this re-
gard, Gonzalez et al. (1995) report that navel or-
anges are more susceptible than other types of
citrus. This greater susceptibility of some variet-
ies also could be related to leaf size (Zhang et al.
1994) as well as to their thickness and consis-
tency (Latif & Yunnes 1951). Singh and Azam
(1986) contend that miners prefer more succulent
leaves with a thin cuticle. In this study, the differ-
ence in parasitism among the species was
marked, with very high percentages ofA. citricola
(74.2%) in white grapefruit, compared with the
low percentages in tangorr" and "chonera" man-
darin orange with only 2.6 and 4.4% parasitism,
respectively (Table 3).

CONCLUSIONS
1. The highest percent infestation of P. citrella
occurred during the dry season. The highest


TABLE 3. INFESTATION AND NATURAL BIOLOGICAL CONTROL BY PHYLLOCNISTIS CITRELLA IN ELEVEN CITRUS SPECIES
IN MANABI, ECUADOR.

Species Common name Flushing (%) Infestation (%) Parasitism (%)

C. aurantium Naranja agria 50 14.37 21.43
C. reticulata Mandarina Cleopatra 75 23.87 7.22
Tangor 50 26.31 2.63
C. reticulata Mandarina chonera 50 27.06 4.44
C. grandis Toronja 50 27.56 45.45
C. sinensis Naranja valencia 75 29.89 53.57
C. aurantifolia Lim6n sutil 75 30.61 40.91
C. reticulata x C. paradisi Tangdielo 50 32.76 13.51
C. paradisi Pomelo blanco 75 33.07 74.19
C. paradisi Pomelo rojo 50 35.10 52.83
C.sinensis Naranja Wston. navel 50 37.43 56.38











infestations in three localities were as follows:
in Lodana (43.8%) in October, in Riochico
(45.7%) in November, and in La Uni6n (17.4%)
in December.
2. The greatest intensity of parasitism occurred
in Lodana in March (60%), in Riochico in Jan-
uary (18.9%), and in La Uni6n in December
(50%).
3. The species A. citricola, Galeopsomyia sp.,
and E. tischeriae were identified at 28.4%,
2.2%, and 0.1% parasitism, respectively. Al-
though this is the first report ofA. citricola in
Ecuador, it is widely distributed in the main
citrus producing zones of the country.
4. A preference of P. citrella for varieties of or-
ange and grapefruit over other citrus types
was noted. The most preferred was Washing-
ton navel oranges.


ACKNOWLEDGMENTS

The authors thank the Ministry of Agriculture and
Livestock of Ecuador and the Executive Unit of Compet-
itive Funds of the Program of Modernization of Agricul-
tural Services (PROMSA) and World Bank for their
financial support of this work. Also, we thank the au-
thorities of the National Autonomous Institute of Agri-
cultural Research (INIAP-Ecuador) for the technical
facilities they made available in the development of this
study.

REFERENCES CITED

BAUTISTA M. N., J. L. CARRILLO, AND H. BRAVO. 1997.
Enemigos naturales y uso del nim (Azadirachta in-
dica A. Juss) para el control del minador de la hoja
de los citricos (Phyllocnistis citrella Stainton) (Lepi-
doptera: Gracillariidae) en el estado de Veracruz In
Simposium Internacional de Control Biol6gico del
Minador de la Hoja de los Citricos (Memorias) Guad-
alajara, M6xico. 1997. SAGAR, 33 p.
BAUTISTA, N., O. MORALES, J. CARRILLO, AND H BRAVO.
1998. Mortalidad de Phyllocnistis citrella con un
aceite mineral y nim. Revista de Manejo Integrado
de Plagas. Costa Rica. No. 50 1998. p. 29-33.
CASTANO, O. P. 1996. El minador de la hoja de los citri-
cos (Phyllocnistis citrella, Stainton) In XXII Con-
greso Sociedad Colombiana de Entomologia.
Cartagena de Indias. Julio 17 a 19 de 1996 (Memo-
rias). Universidad de Caldas. Facultad de Ciencias
Agropecuarias p. 9-23.
CURTI-DIAZ, S.; U. DIAZ-ZORRILLA, J. LOREDO-ZALAZAR,
R. SANDOVAL, L. PASTRANA-APONTE, AND C. RO-
DRIGUEZ-CUEVAS. 1998. Manual de Producci6n de
Naranja para Veracruz y Tabasco. Libro T6cnico. No.
2. CIRGOC. INIFAP. SAGAR. M6xico. 175 p.
GONZALEZ, C., M. BORGES, A. CASTELLANOS, N.
GONZALEZ, L. VAZQUEZ, AND M. GARCIA. 1995. Phyl-
locnistis citrella Stainton. Minador de la hoja de los
citricos. In II Taller Nacional sobre el Minador de Hoja
de los Citricos Phyllocnistis citrella Stainton. Institute
de Investigaciones de Citricos, La Habana, Cuba. 35 p.
GUERRA, L., J. MARTINEZ, D. MARTINEZ, F. GONZALEZ,
R. MONTERO, H. QUIROZ, J. SANCHEZ, V. RODRIGUEZ,
AND M. BADII. 1997. Biologia y control del minador


March 2004


de la hoja de los citricos Phyllocnistis citrella Stain-
ton (Lepidoptera: Gracillariidae), en el Estado de
Nuevo Le6n. Facultad de Ciencias Biol6gicas;
UANL; INIFAP-SAGAR, M6xico. 4 p.
HEPPNER, J. B. 1993. Citrus leafminer Phyllocnistis cit-
rella in Florida (Lepidoptera: Gracillariidae: Phyl-
locnituinae). Tropical Lepidoptera 4(1): 49-64.
HoY, M., AND R. NGUYEN. 1994. Control clasico del mi-
nador de la hoja de los citricos en la Florida. Citrus
Industry. p. 22-25.
HoY, M., AND R. NGUYEN. 1996. Departamento Nacio-
nal de Protecci6n Vegetal. Secci6n Entomologia. Est-
aci6n Experimental Portoviejo. Informe Anual
T6cnico. Ecuador. 69 p.
HoY, M., AND R. NGUYEN. 1996a. Departamento Nacio-
nal de Protecci6n Vegetal. Secci6n Entomologia. Es-
taci6n Experimental Tropical Pichilingue. Informe
Anual T6cnico. Ecuador. 56 p.
INSTITUTE NATIONAL AUTONOMO DE INVESTIGACIONES
AGROPECUARIAS (INIAP). 1995. Departamento Na-
cional de Protecci6n Vegetal. Secci6n Entomologia.
Estaci6n Experimental Portoviejo. Informe Anual
T6cnico. Ecuador. 81 p.
KNAPP, J., L. G. ALBRIGO, H. W. BROWNING, R. C. BUL-
LOCK, J. B. HEPPNER, D. G. HALL, M. A. HOY, P.
NGUYEN, J. E. PENA, AND P. A. STANSLY. 1995. Cit-
rus leafminer Phyllocnistis citrella Stainton. A new
pest of Florida citrus. In Citrus leafminer workshop.
Florida Cooperative Extension Service. Institute of
Food and Agriculture Sciences. University of Florida
Gainesville. 26 p.
LATIF, A., AND C. YUNNES. 1951. Food-plants of citrus
leaf-miner (Phyllocnistis citrella Stainton) in the
Punjab. Bull Ent. Res. 42: 311-316.
MEDINA, V., M. ROBLES, AND H. ARREDONDO. 1997.
Manejo integrado del minador de la hoja en lim6n
mexicano, avances preliminares. In Simposium In-
ternacional Control Biol6gico del Minador de la Hoja
de los Citricos (Memorias). Guadalajara. M6xico. 33
p.
MENDOZA, J. 1995. El minador de la hoja del cafe Perile-
ucoptera coffeella y su control. INIAP, EET Pichil-
ingue. Ecuador. 17 p.
NUNEZ, E., AND A. CANALES. 1999. Ageniaspis citricola.
Controlador del minador de la hoja de los citricos.
Experiencia Peruana. Servicio Nacional de Sanidad
Agraria. Peru. 87 p.
PENA, J. E. 1997. Estado actual del control biol6gico del
minador de la hoja de los citricos Phyllocnistis cit-
rella Stainton. University of Florida. Tropical Re-
search and Education Center. Homestead, FL. 6 p.
PERALES, M., H. ARREDONDO, E. GARZA, AND C. DIAZ.
1997. Control biol6gico del minador de la hoja de los
citricos en Colima. In Simposium Internacional.
Control biol6gico del minador de la hoja de los citri-
cos (Memoria). Guadalajara, M6xico. 1997. SAGAR.
33 p.
PROBST, K., L. PULSCHEN, J. SAVERBORN, AND C. ZE-
BITZ. 1999. Influencia de various regimenes de uso de
plaguicidas sobre la entomofauna del cultivo de to-
mate en las tierras altas del Ecuador. Revista
Manejo Integrado de Plagas. Costa Rica. No. 54.
p. 53-62.
ROBLES, M., AND V. MEDINA. 1997. Fluctuaci6n del daio
del minador de la hoja de los citricos en lim6n mexi-
cano. In: Simposium Internacional Control Biol6gico
del Minador de la Hoja de los Citricos (Memorias).
Guadalajara, M6xico. 33 p.


Florida Entomologist 87(1)







Bermudez et al.: Parasitoids of Phyllocnistis citrella


SCHAUFF, E. M., AND J. LASALLE. 1996. Citrus leafminer
parasitoids identification. Workshop Identification
Manual. Systematic Entomology Laboratory. USDA,
National Museum of Natural History. NHB 168,
Washington, D.C. 20560. USA. 28 p.
SINGH, J. V., AND K. M. AZAM. 1986. Seasonal Phylloc-
nistis citrella Stainton occurrence population dy-
namics leafminer. In Andhra Pradesh. Indian
Journal Ent. 48 (1): 38-42.
SPONAGEL, K. W., AND F. J. DiAZ. 1994. El minador de la
hoja de los citricos Phyllocnistis citrella. Un insecto
plaga de importancia econ6mica en la citricultura de


Honduras. La Lima Cortes. 1994. Fundaci6n Hon-
durefia de Investigaci6n Agricola. FHIA. pp. 1-31.
VALAREZO, O., AND E. CANARTE. 1997. El minador de la
hoja, nueva plaga de los citricos Phyllocnistis citrella
en Ecuador. IICA-CreA-PROCIANDINO-INIAP
(plegable).
VALAREZO, O., AND E. CANARTE. 1998. El minador de la
hoja de los citricos Phyllocnistis citrella en el litoral
ecuatoriano. INIAP-COSUDE. 68 p.
ZHANG, A., C. LEARY, AND W. QUARLES. 1994. IPM for
citrus leafminer Practioner (In Chinese) 16(8): 10-
13.







Florida Entomologist 87(1)


March 2004


HIGH-FIDELITY PCR ASSAY DISCRIMINATES BETWEEN
IMMATURE LIPOLEXIS OREGMAE AND LYSIPHLEBUS TESTACEIPES
(HYMENOPTERA: APHIDIIDAE) WITHIN THEIR APHID HOSTS

ANAND B. PERSAD, AYYAMPERUMAL JEYAPRAKASH AND MARJORIE A. HOY
Department of Entomology and Nematology, University of Florida, Gainesville, FL 32611

ABSTRACT
Species-specific molecular markers were developed to identify and distinguish between two
parasitoids of the brown citrus aphid, Toxoptera citricida Kirkaldy, in Florida. PCR primers
were developed for Lysiphlebus testaceipes Cresson and Lipolexis oregmae Gahan (= scutel-
laris Mackauer) with DNA sequences from the internal transcribed spacer (ITS) region be-
tween the 5.8S and 28S nuclear rRNA genes. With High-fidelity PCR, the L. testaceipes-
specific primer produced a 520-bp band while that ofL. oregmae resulted in a 270-bp band.
Eggs of both parasitoids within their aphid hosts could be detected by 6 h after oviposition,
but 100% detection rates only occurred after 24 h. A sensitivity analysis indicated that a par-
asitoid egg within a single aphid could be detected 100% of the time when combined with
DNA from up to 36 unparasitized aphids. A single first instar parasitoid could be detected
by High-fidelity PCR when the parasitized aphid was combined with up to 500 unparasitized
aphids, indicating a high level of sensitivity. Species-specific primers detected both imma-
ture parasitoid species within aphids commonly found in citrus in Florida, including Aphis
craccivora Koch, Aphis gossypii Glover, Aphis spiraecola Patch, Toxoptera aurantii Boyer
and T citricida. This High-fidelity PCR assay provides an efficient method to monitor estab-
lishment ofL. oregmae in citrus groves in this classical biological control program in Florida.

Key Words: High-fidelity PCR, Toxoptera citricida, Lysiphlebus testaceipes, Lipolexis oreg-
mae, citrus

RESUME
Los marcadores moleculares especificos de las species fueron desarrollados para identificar y
distinguir entire dos parasitoides del afido pardo de los citricos, Toxoptera citricida Kirkaldy, en
la Florida. Se desarrollaron cebadores (= primers) de PCR para Lysiphlebus testaceipes Cres-
son y Lipolexis oregmae Gahan (= scutellaris Mackauer) usando secuencias de ADN de la re-
gi6n del separador transcrito internal (STI) entire los genes 5.8S y 28S del rARN nuclear.
Usando PCR de Alta-fidelidad, el cebador especifico de L. testaceipes produjo una banda de
520-bp (pares de bases) mientras que el de L. oregmae result en una banda de 270-bp. Los
huevos de ambos parasitoides dentro de sus hospederos afidos pudieron ser detectados a los 6
horas despu6s de la oviposici6n, pero una tasa de 100% de detecci6n solamente ocurrio despu6s
de 24 horas. Un analysis de sensibilidad indic6 que un huevo del parasitoide dentro de un solo
afido podian ser detectado 100% de las veces cuando fue combinado con ADN de hasta con 36
afidos no parasitados. Un solo parasitoide en la primera estadia podia ser detectado por el PCR
de Alta-fidelidad cuando el afido parasitado fu6 combinado con hasta 500 afidos no parasita-
dos, indicando un alto nivel de sensibilidad. Los cebadores especificos de las species detecta-
ron ambas species de parasitoides inmaduros dentro los afidos encontrados frecuentemente
en los citricos en la Florida, incluyendo Aphis craccivora Koch, Aphis gossypii Glover, Aphis
spiraecola Patch, Toxoptera aurantii Boyer y T citricida. Este ensayo de PCR de Alta-fidelidad
provee un m6todo eficaz para realizar un monitoreo del establecimiento de L. oregmae en los
huertos de citricos en este program de control biol6gico clasico en la Florida.


The brown citrus aphid, Toxoptera citricida
Kirkaldy (Homoptera: Aphididae), currently oc-
curs throughout Florida and is a threat to citrus
because it is the most efficient aphid vector of cit-
rus tristeza virus. In an effort to control T citri-
cida, the parasitoid Lipolexis oregmae (Gahan)
(= scutellaris Mackauer, Miller et al. [2002])
(Hymenoptera: Aphidiidae) was imported, mass
reared and released in a classical biological con-
trol program (Hoy & Nuygen 2000). Another aphi-
diid, Lysiphlebus testaceipes Cresson, is abundant
in citrus groves and also parasitizes T citricida.


Sampling for L. oregmae is difficult because
mummified T citricida containing L. oregmae are
found off the citrus plant (Hill & Hoy 2003). The
majority of mummies of T citricida containing
L. testaceipes also may occur off citrus foliage
(Persad & Hoy 2003a). Thus, collection of T citri-
cida on foliage before mummification has oc-
curred is necessary to monitor for establishment
and abundance ofL. oregmae.
To determine if L. oregmae has established,
aphids on foliage were collected in citrus groves
and held in air-inflated plastic bags in the labora-







Persad et al.: High-fidelity PCR Assay for Immature Aphid Parasitoids


tory for 7-9 d so that adult parasitoids could
emerge. With this technique, adults ofL. oregmae
and L. testaceipes emerged from field-collected
samples taken from citrus groves throughout Flor-
ida. However, because mortality of immature par-
asitoids may occur under these conditions due to
mold, it is likely that the abundance ofL. oregmae
is underestimated, resulting in loss of critical data.
Dissections and microscopic examinations of
immature parasitoids of both species revealed
that they are similar in appearance after the first
instar (Persad & Hoy, unpublished data) and,
thus, morphology is not adequate to resolve the
identity of immature parasitoids within field-col-
lected aphids.
To resolve these problems, we developed and
evaluated a molecular assay to detect immature
L. testaceipes and L. oregmae within T citricida
and other aphid hosts found on citrus in Florida.

MATERIALS AND METHODS


Cultures


Cultures of T citricida and L. oregmae were
maintained on potted citrus in 63 x 63 x 63 cm
mesh cages in the laboratory at 22-24C and 55-
65% RH and 16 L: 8 D as described by Hill & Hoy
(2003) and Walker (2002). Cultures of L. testa-
ceipes were initiated from field-collected popula-
tions of parasitoids on T citricida in citrus groves
throughout Florida (Persad & Hoy 2003a). Adult
parasitoids that emerged were held in batches of
20-30 individuals in 2.5 x 6 cm plastic vials with
moistened honey-saturated paper strips for 24 h.
One batch ofL. testaceipes was released onto nine
potted citrus plants that were each infested with
250-300 aphids of mixed instars in a 63 x 63 x 63
cm mesh cage in the laboratory under similar con-
ditions.


DNA Extractions

Genomic DNA from individual adults ofL. testa-
ceipes, L. oregmae and T citricida was extracted
with PUREGENE reagents by the method sug-
gested by the manufacturer (Gentra Systems, Min-
neapolis, MN) and resuspended in 50 pl sterile
water. For screening large populations of field-col-
lected specimens, genomic DNA was extracted from
batches of adults by grinding in 50pl Chelex (Bio-
Rad, Hercules, CA) resin and treating the extracts
for 1 h at 60C and 5 min at 94C (Edwards & Hoy
1993). One microliter of PUREGENE or Chelex
preparations was used for High-fidelity PCR.

Primers

PCR primers for the amplification of four in-
sect mitochondrial gene fragments (12S, 16S, COI
and NADH) (Kambhampati & Smith 1995) and
nuclear rRNA primers (5.8S-F and 28 S-R) (Por-
ter & Collins 1991) (Table 1) were used to amplify
extracted DNA.

High-fidelity PCR Protocol

High-fidelity PCR was performed in a 50-pl re-
action volume containing 50 mM Tris, pH 9.2, 16
mM ammonium sulfate, 1.75 mM MgC1,, 350 pM
each of dATP, dGTP, dCTP, dTTP, 800 pmol of
primers, 1 unit Tgo DNA polymerase and 5 units
of Taq DNA polymerase (Roche Molecular Bio-
chemicals) (Barnes 1994). Reactions were over-
laid with 50 pl of mineral oil and High-fidelity
PCR was conducted with three linked tempera-
ture profiles: (i) To eliminate possible template
secondary structure, hot-start PCR at 94C for 2
mins was used for 1 cycle followed by (ii) 10 cycles,
each consisting of denaturation at 94C for 10 s,
annealing at 49C for 30 s and 40C for 30 s for


TABLE 1. PRIMERS USED FOR AMPLIFICATION OF LYSIPHLEBUS TESTACEIPES, LIPOLEXIS OREGMAE AND TOXOPTERA
CITRICIDA DNA.

Primer Sequence Gene segment

SR-J-14199 5'-TACTATGTTACGACTTAT- 3' Mitochondrial 12S rRNA
SR-N-14594 5'-AAACTAGGATTAGATACCC-3'
LR-J-13017 5'-TTACGCTGTTATCCCTAA-3' Mitochondrial 16S rRNA
LR-N-13398 5'-CACCTGTTTAACAAAAACAT-3'
CI-J-1632 5'-TGATCAAATTTATAAT-3' Mitochondrial CO I
CI-N-2191 5'-GGTAAAATTAAAATATAAACTTC-3'
N5-J-7502 5'-CTAAAGTTGATGAATGAACTAAAG-3' Mitochondrial NADH+ NADH5
N4-N-8925 5'-GCTCATGTTGAAGCTCC-3'
5.8 S-F 5'-GTGAATTCTGTGAACTGCAGGACACATGAAC-3' Nuclear rRNA ITS-2
28 S-R 5'-ATGCTTAAATTTAGGGGGTA-3'
LO-ITSF 5'-GGCCAGTTGTCGAGTCC-3' ITS-2
LT-ITSF 5'-CTAGCGATAAATGAATGTTC-3'

LO = Lipolexis oregmae and LT= Lysiphlebus testaceipes







Florida Entomologist 87(1)


ITS-2 and mitochondrial gene segments, respec-
tively, and elongation at 68C for 1 min 20 s and
(iii) 20 cycles, each consisting of denaturation at
94C for 10 s, annealing at 49C for 30 s, and ex-
tension at 68C for 1 min 20 s plus an additional
20s for each consecutive cycle. PCR products
were separated on a 2% agarose gel, stained with
ethidium bromide and photographed under UV
light.
The PCR products were ligated into a PCR
2.1 TOPO vector and used to transform compe-
tent One Shot E. coli cells with subsequent
ampicillin selection following the manufac-
turer's directions (Invitrogen, Carlsbad, CA).
Clones were incubated overnight in Luria-Ber-
tani (LB) medium on plates containing ampicil-
lin, IPTG and X-gal. Sixteen clear colonies were
randomly picked from each plate and separately
cultured for 16 h in 5 ml of LB medium. Plasmid
DNA was extracted with a QIAGEN Plasmid
Mini-prep Kit (QIAGEN, Inc., Valencia, CA). All
plasmids were incubated and digested with
EcoR1 and visualized on a 1% agarose gel to ver-
ify that the inserts corresponded to the expected
size of the PCR products. Three clear colonies
containing plasmids with the inserts were re-
cultured in 50 ml of LB medium with ampicillin
for each species. Plasmids were extracted with
QIAGEN Plasmid Midi-prep kits. DNA inserts
were sequenced with a Perkin-Elmer Applied
Biosystems ABI PRISM Automated DNA se-
quencer located at the University of Florida In-
terdisciplinary Center for Biotechnology,
Research Core Facility.

Accuracy of Species-Specific Primers

Once primers were designed based on the se-
quences obtained, ten adults each ofL. testaceipes
and L. oregmae and each of 10 third instars of
T citricida were placed individually into 0.5-ml
thick-walled eppendorf tubes each containing 50
pl of 5% Chelex resin suspension. A pestle was
made by slowly heating a standard pipette tip
which was then inserted into an empty 0.5-ml ep-
pendorf tube so that the tip assumed the shape of
the base of the tube to form a close-fitting pestle.
New pestles were used to grind each adult speci-
men, a procedure which lasted 30 to 40 sec. After
grinding, each tube was placed in a water bath at
60C for one h. The tubes were collected and
placed in a Perkin-Elmer DNA Thermal Cycler
model 480 at 94C for 5 mins after which samples
were centrifuged for 30 sec.
High-fidelity PCR was used to evaluate the
specificity of the assay by subjecting 10 replicates
of DNA from L. testaceipes, L. oregmae and T cit-
ricida to either primer. PCR products were sepa-
rated on a 2% agarose gel, stained with ethidium
bromide and photographed under UV light.


Detection of Parasitoid Eggs and First-instars

Third instars of T citricida were exposed to
single oviposition opportunities by each parasi-
toid in petri-dish arenas and returned to potted
citrus plants in the laboratory. After periods of 6,
12, 18, 24 and 48 h during which aphids were ex-
posed to parasitoids, individual aphids were
ground in 50 pl of Chelex and incubated for 1 h to
extract DNA from the parasitoid eggs. Under lab-
oratory rearing conditions, eggs of L. testaceipes
and L. oregmae hatch after 55 h and 75 h, respec-
tively (Persad & Hoy 2003b). Ten aphids were ex-
posed to each parasitoid species and evaluated by
the High-fidelity assay for each of the five-time in-
tervals. Sub-groups of exposed aphids were rou-
tinely dissected 4 d after assumed oviposition
and, if parasitism was below the expected 98-
100% (Persad & Hoy 2003b), then the group and
the PCR results observed were rejected.
The experiment was repeated to detect parasi-
toid larvae 70 h after exposing aphid hosts to
L. testaceipes or L. oregmae, respectively (first in-
stars eclose at 55 and 61 h, respectively, Persad &
Hoy 2003b). High-fidelity PCR was used to deter-
mine the presence of eggs or larvae of both para-
sitoid species in each of 10 trials with the aim of
finding the earliest time after the oviposition op-
portunity when 100% of 10 trials resulted in de-
tection of parasitoid eggs or larvae in T citricida.

Other Hosts of L. testaceipes and L. oregmae and Sensi-
tivity of the Assay

Because other aphids are found in citrus
groves in Florida and both L. testaceipes and
L. oregmae are known to parasitize aphids other
than T citricida (Fasulo & Halbert 1998; Hoy &
Nguyen 2000), four additional aphid species were
collected from the field and greenhouse cultures
were initiated.Aphis spiraecola Patch,A. gossypii
Glover, and Toxoptera aurantii Boyer were main-
tained on potted citrus, while A. craccivora Koch
was cultured through several generations on pot-
ted eggplants.
In a preliminary experiment, 10 third instars
of each aphid species were exposed individually to
females of either L. testaceipes or L. oregmae in
petri-dish arenas. After exposure for 24 h, High-
fidelity PCR assays were conducted and these
confirmed that parasitoid DNA was present in all
exposed aphids.
Because field samples may involve hundreds
or thousands of aphid individuals of different spe-
cies, we wanted to determine whether aphids
could be pooled, yet still yield qualitative data for
presence/absence of L. testaceipes or L. oregmae.
Ten replicates of High-fidelity PCR were con-
ducted on samples containing ratios of one para-
sitized (24 h after oviposition opportunity) to nine
unparasitized third instars of brown citrus


March 2004







Persad et al.: High-fidelity PCR Assay for Immature Aphid Parasitoids


aphids. Incremental increases of nine unparasit-
ized aphids (ratios of 1: 9, then 1: 18, followed by
1: 27, etc.) were evaluated with High-fidelity PCR
until detection dropped from 100% to under 50%.

Interspecific Interactions ofL. testaceipes
and L. oregmae

Each of eight third instars of T citricida was
exposed individually to an L. oregmae female in a
petri-dish arena, and immediately afterwards the
same aphid was exposed to a L. testaceipes female
in the method described by Persad & Hoy (2003b).
After the oviposition opportunities, the aphid was
returned to a potted citrus plant for 24 h. The ex-
periment was repeated with the reverse oviposi-
tion sequence. The DNA from single aphids in all
trials was extracted with Chelex and High-fi-
deltiy PCR was performed on each to determine if
the DNA from more than one parasitoid within a
single aphid would affect the specificity of the
L. testaceipes or L. oregmae primer.

Other Parasitoids

To determine whether the presence of DNA
from other parasitoid species would give false
positives we tested additional aphid parasitoids,
some of which may occur in Florida; these in-
cluded Lysiphlebus japonica Ashmead (obtained
in 70% alcohol, from the Florida Department of
Agriculture and Consumer Services, Division of
Plant Industry, Gainesville), Aphelinus gossypi
Timberlake, Aphidius colemani Vierick, Aphidius
ervi Haliday and Aphidius matricariae Haliday,
(all obtained alive from BioBest International)
and the hyperparasitoids Alloxysta megourae
complex and Pachyneuron aphidisi Bouche (field-
collected live specimens from Florida, identified
by guidelines of Evans and Stange [1997]). Ten
specimens of each parasitoid species were ground
individually in 50 pl Chelex and the DNA was
tested with the primers for both L. testaceipes and
L. oregmae in High-fidelity PCR.

RESULTS AND DISCUSSION

Primers

Mitochondrial 12S and NADH primers pro-
duced no discernible PCR products when used
with DNA from L. testaceipes and L. oregmae. Only
the 16S and COI primers produced discernible
DNA bands of the expected size (data not shown).
The PCR products obtained with thel6S primers
were cloned and sequenced (GenBank accession
numbers AY498553 through and including
AY498558) because sequence differences are ex-
pected to be higher than with the COI fragment
(Simon et al. 1994). The entire 0.55 kb ITS-2 PCR
products ofL. oregmae were cloned and sequenced


but only 398 bp of the 0.75 kb product from L.
testaceipes could be sequenced because the 3' end
was 'AT rich and difficult to sequence. The cloned
sequences of the PCR products from T citricida, L.
testaceipes and L. oregmae were aligned by
CLUSTAL W. Unfortunately the 16 S rRNA se-
quences from L. testaceipes and L. oregmae dis-
played low sequence divergence (14.8%) and no
species-specific primers could be designed. How-
ever, the sequence divergences of the nuclear ITS-
2 region for L. testaceipes and L. oregmae and T cit-
ricida were high, allowing species-specific forward
primers to be designed (Table 1). An L. oregmae-
specific forward primer (LO-ITSF 5'-GGCCAGT-
TGTCGAGTCC-3') and an L. testaceipes-specific
forward primer (LT-ITSF 5'-CTAGCGATAAAT-
GAATGTTC-3') were designed after obtaining the
complete ITS-2 sequence from L. oregmae (Gen
Bank accession no. AY498553) and a partial ITS-2
sequence from L. testaceipes (Gen Bank accession
no. AY498554). PCR products from L. testaceipes-
specific primers produced 520 bp bands while
those ofL. oregmae produced 270 bp bands (Fig. 1).

Accuracy of Species-Specific Primers

Both primers yielded bands specific to the re-
spective adult parasitoid in each of the 10 repli-
cates and both primers failed to detect DNA from
T citricida (Fig. 1).


i~ rcyr~tprcrc

U fL'r~Ili(ICrr

U ft'Ua UI%

I. (1(1U it/I


/. citriwhil
Marker VI



L t('recipitf


I tI) cu/nti


1120 control
Marker VI


Fig. 1. High-fidelity PCR products obtained with
parasitoid species-specific primers and DNA extracted
from adults of Lysiphlebus testaceipes (520 bp), Li-
polexis oregmae(270bp) and Toxoptera citricida (no
bands).


1







Florida Entomologist 87(1)


Detection of Parasitoid Eggs and First-instars

As early as 6 h after exposure to L. testaceipes
and L. oregmae, 34 and 46%, respectively, of the ex-
posed third instars of brown citrus aphids pro-
duced PCR products. For both parasitoids, all
aphids that contained eggs could be detected 24 h
after oviposition opportunities (Fig. 2). Because
parasitoid larvae contain more DNA than parasi-
toid eggs, all aphids containing first instars yielded
PCR products with their respective primers in all
trials with High-fidelity PCR (data not shown).

Other Hosts of L. testaceipes and L. oregmae
and Sensitivity of the Assay

Table 2 indicates that six species of aphids
commonly associated with citrus in Florida were
all parasitized by L. oregmae when single oviposi-
tion opportunities were allowed in the laboratory.
The data suggest that L. oregmae can parasitize
and successfully complete its life cycle in all aphid
hosts tested and thus may parasitize other aphid
species in Florida citrus groves. This oligophagous
nature ofL. oregmae is expected (Stary & Zeleny
1983; Hoy & Nguyen 2000) and, the ability to sur-
vive on other pest aphids may be advantageous to
the parasitoid. Field collections of aphids for stud-
ies on the establishment of L. oregmae should
therefore include any aphid species encountered
on plants in, and adjacent to, citrus groves, in-
cluding weeds, ornamentals or vegetables.


1120 control
C-

-Marker VI







,h




0 H20 control

_. Marker VI

Fig. 2. Detection of eggs of Lysiphlebus testaceipes
and Lipolexis oregmnae within third instars of Toxoptera
citricida with species-specific primers 24 h after expos-
ing aphids to parasitoid females.


TABLE 2. DETECTION RATES WHEN UNPARASITIZED APHIDS WERE MIXED WITH ONE THIRD INSTAR APHID PARASITIZED'
BY LYSIPHLEBUS TESTACEIPES OR LIPOLEXIS OREGMAE.

No. of unparasitized aphids added to one parasitized aphid and detection rates

Aphid species L. oregmae % Detection L. testaceipes % Detection

Aphis spiraecola (c) 452 100 45 100
54 70 54 40
63 40 -
Aphis gossypii (c) 36 100 45 100
45 40 54 40
Aphis craccivora (v) 36 100 45 100
45 60 54 70
54 20 63 10
Toxoptera citricida (c) 36 100 36 100
45 40 45 50
54 20
Toxoptera aurantii (c) 18 100 27 100
27 70 36 40
36 00 -

'24 h after five aphid species reared on citrus (c) or vegetables (v) were exposed to either parasitoid in the laboratory.
In each trial there were 10 replicates; all trials started with 1 parasitized: 9 unparasitized and were increased serially by adding
an additional 9 unparasitized aphids until detection dropped below 50%.


March 2004







Persad et al.: High-fidelity PCR Assay for Immature Aphid Parasitoids


When a single L. testaceipes or L. oregmae egg
was present in a third instar of the brown citrus
aphid and 36 unparasitized third instars of the
brown citrus aphid were combined, all assays
were positive for their respective parasitoid (Ta-
ble 2). DNA from a pooled maximum of 36 aphids
thus can be used in analyses of field-collected
T citricida for determining presence of either
parasitoid. The assay also detected eggs of both
parasitoids within third instars of the other five
aphid species. The maximum number of unpara-
sitized aphid third instars that can be added to a
single parasitized third instar aphid and provide
100% detection rate ranged from 18 to 45 individ-
uals for the other five aphid species. The decline
in detection was variable with aphid species; for
example, T aurantii detection failed when 36 un-
parasitized aphids were added to one parasitized
aphid, while the same concentration gave 100%
detection in T citricida (Table 2).
Because these trials were conducted with
aphids containing 24-h-old eggs, there is a high
probability that eggs older than 24 h and all par-
asitoid larval and pupal stages will be detected
because more parasitoid DNA will be present.
This is substantiated by the observation that
when one first instar was mixed with 500 unpara-
sitized T citricida, a PCR product was always ob-
tained in the 10 replicates with High-fidelity PCR
assay (data not shown). These data indicate the
assay is suitable for qualitative analyses of large
batches of field-collected aphid samples to deter-
mine whether L. oregmae larvae are present.

Interspecific Interactions between Parasitoids

Interspecific interactions produced single
brown citrus aphids containing eggs or larvae of
both L. testaceipes and L. oregmae. A PCR product
specific to each parasitoid was obtained from the
aphids tested (Fig. 3) and similar results were ob-
tained in the reverse oviposition sequence (data
not shown). In Figure 3, a PCR product was not
obtained when the L. testaceipes primer was
tested on aphid 6 (Fig. 3, lane 8); however, a PCR
product was obtained with the L. oregmae primer
(lane 18) suggesting that only the L. oregmae fe-
male oviposited and injected its DNA into aphid
6. The opposite probably happened with aphid 3,
because only DNA from L. testaceipes was found
(Fig. 3, lane 5). The experiment indicates that the
assay can detect the presence of eggs of both par-
asitoid species when they co-occur in a single
aphid. Hence, tests on field-collected material
should detect the presence of either parasitoid
species as early as 24 h after parasitoids oviposit.

Other Parasitoids

DNA extracted from the additional seven par-
asitoid species produced no PCR products with ei-


their species-specific primer. To confirm that the
quality of the DNA was not an issue, we subjected
the extracted DNA from each additional parasi-
toid species to the universal 5.8 S-F and 28 S-R
primers. All PCR reactions produced bands,
which confirm that the DNA was amplifiable. Ab-
sence of bands with the species-specific primers
confirms the specificity of the primers for the tar-
get parasitoids.

CONCLUSIONS

This High-fidelity PCR assay is highly specific
and sensitive, providing a relatively inexpensive
tool for sampling large aphid populations. The
standard practice of holding and monitoring field
samples of foliage for up to two weeks in order to
collect emerged adults is a labor-intensive and
time-consuming process which can be affected by
parasitoid mortality (Persad & Hoy, unpublished
data). The presence of immature L. testaceipes
and L. oregmae parasitoids as young as 24-h old
can be determined by High-fidelity PCR and, if
samples are stored for 70 h, then larger groups of
up to 500 aphids can be sampled in a single assay.
Currently this assay is being used to evaluate the
establishment of L. oregmae on several aphid
hosts on citrus and other plants near L. oregmae
release sites in Florida.


liC
CI








E5 2
Sf-c
C.J q











H20 controls
Marker VI




T]20 nclnirls
Marker VI


Fig. 3. The presence of both Lysiphlebus testaceipes
and Lipolexis oregmae in single third instars of Tox-
optera citricida did not affect the accuracy of the spe-
cies-specific primers.











ACKNOWLEDGMENTS

The authors appreciate the technical assistance of
Ru Nguyen, Lucy Skelley and Reginald Wilcox. This
work was supported in part by funds from the Davies,
Fischer and Eckes Endowment and TSTAR-Caribbean.
This is University of Florida Agricultural Experiment
Station Journal Series R-09753.

REFERENCES CITED

BARNES, W. M. 1994. PCR amplification of up to 35-kb
DNA with high-fidelity and high yield from bacte-
riophage templates. Proc. Natl. Acad. Sci. USA 91:
2216-2220.
EDWARDS, O. R., AND M. A. HOY. 1993. Polymorphism in
two parasitoids detected by random amplified poly-
morphic DNA polymerase chain reaction. Biol. Con-
trol 3: 243-257.
EVANS, G., AND P. STANGE. 1997. Parasitoids associated
with the brown citrus aphid in Florida (Insecta: Hy-
menoptera) Entomology Circular 384, Florida De-
partment Agriculture and Consumer Services,
Division of Plant Industry, Gainesville.
FASULO, T. R., AND S. E. HALBERT. 1998. Aphid pests of
citrus. Cooperative Extension Service, Institute of
Food and Agricultural Sciences, University of Flor-
ida, Gainesville. Bulletin ENY-811: 1-4.
HILL, S., AND M. A. HOY. 2003. Interactions between the
red imported fire ant Solenopsis invicta and the par-
asitoid Lipolexis scutellaris, potentially affecting a
classical biological control agent of Toxoptera citri-
cida. Biological Control 27: 11-19.


March 2004


HoY, M. A., AND R. NUYGEN. 2000. Classical biological
control of brown citrus aphid. Release of Lipolexis
scutellaris. Citrus Industry 81(10): 24-26.
KAMBHAMPATI, S., AND P. T. SMITH. 1995. PCR primers
for the amplification of four insect mitochondrial
gene fragments. Insect Mol. Biol. 4: 233-236.
MILLER, R., K. S. PIKE, AND P. STAR. 2002. Aphid para-
sitoids (Hymenoptera: Aphidiidae) on Guam. Micro-
nesica 34: 87-103.
PERSAD, A. B., AND M. A. HOY. 2003a. Manipulation of
female parasitoid age enhances laboratory cultures
of Lysiphlebus testaceipes reared on Toxoptera citri-
cida. Florida Entomol. 86: 429-436.
PERSAD, A. B., AND M. A. HOY. 2003b. Intra- and inter-
specific interactions between Lysiphlebus testaceipes
and Lipolexis scutellaris on Toxoptera citricida. J.
Econ. Entomol. 96: 564-569.
PORTER, C. H., AND F. H. COLLINS. 1991. Species-diag-
nostic differences in a ribosomal DNA internal tran-
scribed spacer from the sibling species Anopheles
freeborni and Anopheles hermsi (Diptera: Culicidae).
Am. J. Trop. Med. Hyg. 45: 271-279.
SIMON, C., F. FRATI, A. BECKENBACH, B. CRESPI, H. LIU,
AND P. FLOOK. 1994. Evolution, weighting and phylo-
genetic utility of mitochondrial gene sequences and a
compilation of conserved polymerase chain reaction
primers. Ann. Entomol. Soc. Amer. 87:651-701.
STARY, P., AND J. ZELENY. 1983. Aphid parasitoids from
Vietnam (Hymenoptera: Aphidiidae). Acta. Entomol.
Bohemoslov. 86: 356-367.
WALKER, A. M. 2002. Physiological and behavioral factors
affecting parasitism of Toxoptera citricida by Lipolexis
scutellaris. M.S. Thesis, Department of Entomology
and Nematology, University of Florida, Gainesville.


Florida Entomologist 87(1)







Lapointe et al.: Copper and Diaprepes Root Weevil


EFFECT OF DIETARY COPPER ON LARVAL DEVELOPMENT
OF DIAPREPES ABBREVIATUS (COLEOPTERA: CURCULIONIDAE)

STEPHEN L. LAPOINTE1, ALBERT A. WEATHERSBEE III1, HAMED DOOSTDAR2 AND RICHARD T. MAYER3
'USDA-ARS, U.S. Horticultural Research Laboratory, 2001 South Rock Road, Ft. Pierce, FL 34945

2Morse Enterprises Limited, Inc., 151 SE 15 Road, Miami, FL 33129

3USDA-ARS, Arthropod-Borne Animal Diseases Research Laboratory, P.O. Box 3965
University Station, Laramie, WY 82072

ABSTRACT

Larvae of the Diaprepes root weevil, Diaprepes abbreviatus (L.), were reared from hatching
on an artificial diet containing four concentrations of two copper compounds, cupric sulfate
(CuSO,) or cupric hydroxide [Cu(OH),]. Negative effects of copper on insect development
were observed only for early instars. Survival of larvae from hatching to 4 weeks of age was
significantly affected by the copper compounds compared with the artificial diet alone, and
greater mortality was associated with CuSO, compared with Cu(OH)l. The two compounds
had equivalent effects on larval weight gain of early instars. Weight gain was negatively cor-
related with increasing copper concentration. No effect of copper was observed on late in-
stars maintained on these diets beyond the initial 4 weeks. Larval and pupal period, weight
gain, and survival of late instars were statistically similar. No effect on larval survival or
weight gain was observed when copper solutions were applied at nonphytotoxic levels to two
varieties of citrus rootstock. The potential for manipulating citrus tree copper content to con-
trol this pest is discussed.

Key Words: Citrus, heavy metal, artificial diet

RESUME

Se criaron larvas del cucurlionido Diaprepes abbreviatus (L.), sobre una dieta artificial con
cuatro concentraciones de dos compuestos de cobre, sulfato de cobre (CuSO,) o hidroxido de
cobre [Cu(OH)]. Los efectos negatives del cobre sobre el desarrollo del insecto fueron obser-
vados solamente en larvas de estadios tempranos. La supervivencia de larvas desde eclosion
del huevo hasta 4 semanas de edad fue afectada significativamente por los compuestos de co-
bre comparado con la dieta artificial sola, y mas mortalidad fue asociada con CuSO, com-
parado con Cu(OH). Los dos compuestos tuvieron efectos equivalentes en el aumento de
peso de larvas de estadios tempranos. El aumento del peso fue correlacionado negativa-
mente con el aumento en la concentraci6n de cobre. No se observe ningun efecto del cobre en
las larvas de estadios mayores (>30 d). Para estas larvas, el period larval y pupal, el au-
mento de peso, y la supervivencia eran similares estadisticamente cuando fueron criadas en
todos los tratamientos de dieta incluyendo el control. No se observe ningun efecto sobre au-
mento larval de peso o la supervivencia cuando las soluciones de cobre fueron aplicadas en
los niveles nofitot6xicos a dos variedades de patrons de citricos. El potential para manipu-
lar el contenido de cobre en arboles de citricos para controlar este plaga se discute.


Translation provided by author.


Predation of tree roots by larvae of the Dia-
prepes root weevil, Diaprepes abbreviatus (L.),
has become a major arthropod constraint to pro-
ductivity of citrus in Florida. Copper compounds
(fixed copper and Bordeaux mixture) have been
widely used as fungicides and bacteriocides in cit-
rus to control scab, melanose, blast (Pseudomonas
syringae), and other pathogens. Copper com-
pounds are inexpensive and broad-spectrum. Ap-
proximately one half of the United States citrus
crop is treated with copper-based fungicides rep-
resenting the largest single use of copper as a fun-


gicide (Gianessi & Puffer 1992). Copper ions
destroy proteins in plant tissues and the phyto-
toxicity of copper fungicides has led to replace-
ment with safer chemical fungicides when
available. However, copper fungicides are applied
to over half of Florida's orange crop acreage, and
over 75% of the state's grapefruit to control dis-
eases such as brown rot, melanose, scab, Alterna-
ria brown spot, and greasy spot (Florida
Cooperative Extension Service 2000). Copper ac-
cumulates in the soil and can become phytotoxic
to citrus rootstocks at high concentrations, espe-







Florida Entomologist 87(1)


cially to young trees in acidic soils (Alva et al.
2000). In soils with pH 8.2, copper content up to
400 mg kg1 (ppm) was not phytotoxic to Swingle;
in soils with pH 5.7 and 6.2, significant growth re-
duction occurred when copper levels exceeded 200
mg kg-1 (Alva et al. 2000).
Observations in this laboratory led us to hy-
pothesize that copper content in the root tissue of
citrus rootstocks might confer resistance to the
Diaprepes root weevil through inhibition of its di-
gestive enzymes such as polysaccharide hydrolyz-
ing enzymes known to degrade plant material
(Doostdar et al. 1997). The purpose of the re-
search reported here was to document the effect
of diet-incorporated copper on survival and
growth ofD. abbreviatus larvae.

MATERIALS AND METHODS

Diet Incorporation

Diaprepes root weevils were obtained from a
laboratory colony maintained by the U.S. Horticul-
tural Research Laboratory, Ft. Pierce, FL. Larvae
were reared on artificial diet according to Lapointe
and Shapiro (1999). Neonate larvae (<24 h old)
were placed in cups (PC100 1-oz. cups and lids, Jet
Plastica, Harrisburg, PA) containing either a com-
mercially prepared insect diet (product no. F1675,
Bio-Serv, Inc., Frenchtown, NJ) or the same diet
with one of three concentrations of cupric sulfate
(CuSO4*5H20, Sigma Chemical Co.) or cupric hy-
droxide [Cu(OH)2, Sigma Chemical Co.]. The pH of
the prepared diets was tested and adjusted to 7.0
while the diets were still liquid. Treatments con-
sisted of control (diet only) and the equivalent of
250, 500, and 1,000 ppm Cu for each of the two
copper compounds. Ten neonates were placed in
each of thirty cups per treatment for a total of
2,100 larvae. Initial weight of larvae was approxi-
mately 0.1 mg (Lapointe 2000). Diet cups infested
with larvae were kept in sealed plastic bags in an
incubator at 27C, 24:0 D:L. At 27 d after infesta-
tion of the diet cups, surviving larvae were recov-
ered from individual cups, counted, and weighed.
Survival of early instars from neonate to 27 d was
expressed as percent survival per cup and trans-
formed (arcsine) to normalize variance. Larval
survival and weights were analyzed by ANOVA
and means compared by Tukey's Honestly Signifi-
cant Differences (HSD) test (SAS Institute 1999).
Nontransformed means of larval survival are pre-
sented. For larval weights, "diet cups" was used as
the error term because larvae were nested within
cups. Thirty larvae were randomly selected from
each treatment and placed individually in cups
containing fresh diet of the respective treatment.
These larvae were replaced in the incubator and
allowed to complete development. Survival, larval
period, pupal period, and adult weight upon emer-
gence were recorded and analyzed by ANOVA.


Greenhouse Trial

The effect of soil copper concentration on sur-
vival and growth ofD. abbreviatus larvae feeding
on the roots of two citrus varieties was evaluated
in greenhouse trails by using a factorial design.
The citrus plants used in the experiment were
one-year-old seedlings of Swingle citrumelo [Cit-
rus paradisi Macf. x Poncirus trifoliate (L.) Raf]
and Sun Chu Sha mandarin (C. reticulata Blanco)
potted individually in 946-cm3 containers with
180 g of potting soil (Metromix 500, Scotts,
Marysville, OH). A range of soil copper concentra-
tions (0, 50, 150, or 300 ppm) was established by
amending the soil (180 g) in each pot with 0, 9, 27,
or 54 mg copper applied as soluble copper chloride
in 100 ml water to each container. Treatments
were applied as two partial applications ten days
apart. Each treatment was replicated 15 times.
Total number of plants was 120 (15 replications x
2 citrus species x 4 copper concentrations). Each
container was infested 30 d after the final copper
application with 5 neonatal larvae (<24-h-old).
The experiment was maintained in a greenhouse
and plants were watered (100 ml per pot) twice
weekly. The number and mean fresh weight of
surviving larvae in each container, dry weights of
plant roots, and height of plant shoots were re-
corded after eight weeks. Data were analyzed by
the General Linear Models Procedure (SAS Insti-
tute 1999) to determine if soil treatments or cit-
rus varieties affected the outcome of the
experiment.

RESULTS

Diet Incorporation

The dose of copper had no effect on survival of
early instars (F = 0.57; df= 2, 174; P = 0.57). How-
ever, there was an effect of Cu source (F = 9.71; df
= 1, 174;P < 0.01). Both Cu sources reduced larval
survival of early instars compared with the con-
trol. Survival was reduced by 20% with Cu(OH)2
and by 33% with CuSO4 compared with the con-
trol (Table 1). There was a significant effect of Cu
on the weight gain of larvae that survived to 27 d
(F = 66.3; df = 6, 29; P < 0.01). There was no inter-
action between rate and Cu source (P = 0.30), so
data for the two sources were combined and the
rates were compared with the control. The mean
weight of larvae reared on diet containing the low
rate (250 ppm) of copper was not different from
that of larvae reared on the control diet (12 ppm);
the medium rate (500 ppm) of copper reduced lar-
val weight by 27% and the high rate (1,000 ppm)
by 82% compared with the control (Fig. 1) (a =
0.05, Tukey's HSD).
There was no effect of gender (F = 0.53; df = 1,
121; P = 0.47) or of treatment (F = 0.66; df = 6,
121; P = 0.68) on larval period (124.8 2.9 d, n =


March 2004







Lapointe et al.: Copper and Diaprepes Root Weevil


TABLE 1. MEAN ( SEM) SURVIVAL (n = 30) AND WEIGHT OF EARLY INSTARS OF THE DIAPREPES ROOT WEEVIL AFTER
FEEDING FOR 27 D ON ARTIFICIAL DIET CONTAINING BACKGROUND (12 PPM), CUPRIC SULFATE OR CUPRIC HY-
DROXIDE INCORPORATED AT THREE RATES.

Copper source Rate (ppm) Survival (%) Weight (mg) n

CuSO4 250 48.2 3.2 a 44.2 2.5 ab 137
CuSO4 500 58.0 4.6 a 36.6 2.2 bc 159
CuSO4 1000 49.1 3.5 a 7.8 0.5 d 139
Cu(OH)2 250 61.5 3.4 ab 41.4 2.1 ab 170
Cu(OH)2 500 60.4 3.7 ab 32.8 2.0 c 172
Cu(OH)2 1000 64.6 5.5 ab 9.5 0.7 d 167
Diet only 12 77.2 5.0 b 47.7 2.5 a 201

CuSO4 all 51.8 2.2 a 435
Cu(OH), all 62.1 2.5 b 509
Diet only 12 77.2 5.0 c 201

Means within columns and sections followed by the same letter are not significantly different (a = 0.05, Tukey's HSD after a sig-
nificant ANOVA).


135). The experimental design did not allow for
statistical comparison of larval survival of late in-
stars. However, survival ranged from 53 to 73%
and was not associated with the copper com-
pounds or concentration (Table 2). There was no
effect of treatment on pupal period (F = 1.6; df = 6,
121; P = 0.15). Mean ( SEM) pupal period was
18.9 0.4 d (n = 128). Upon emergence, female
adults were heavier than males (F = 43.1; df = 1,
120; P < 0.01), but there was no effect of incorpo-
ration of copper compounds on adult weight (F =


m 40
E

30


cu 20
20
-J


Copper content (ppm)

Fig. 1. Effect of rate of incorporation of copper in ar-
tificial diet on live weight of early instars of Diaprepes
root weevil after 27 d at 26C. Background copper con-
centration in artificial diet was 12 ppm. Bars are SEM
(n > 200). Means with the same letter do not differ sig-
nificantly at a = 0.05 by Tukey's HSD after a significant
ANOVA.


0.9; df = 6, 120; P = 0.50). Mean ( SEM) male
weight was 280.5 5.1 mg (n = 62); mean female
weight was 349.6 8.4 mg (n = 66).

Greenhouse Trial

Soil amendments with copper, applied as cop-
per chloride, did not affect survival (F = 0.15; df =
3, 112; P = 0.93) or weight gain (F = 0.11; df = 3,
105; P = 0.96) of D. abbreviatus larvae over the
range of concentrations evaluated in this experi-
ment. After eight weeks, the mean ( SEM) num-
ber of larvae surviving per container was 2.0 0.1
(n = 120 containers). The grand mean ( SEM) of
weight of surviving larvae after eight weeks
across all treatments was 196.4 6.6 mg (n = 113
containers with surviving larvae). There was no
effect of copper treatments on the dry weights of
citrus roots (F = 0.01; df = 3, 112; P = 0.99) or
height of the plant shoots (F = 1.03; df = 3, 112; P
= 0.38). The overall means for dry weight of roots
and height of shoots were 4.4 0.3 g (n = 120) and
50.4 1.4 cm (n = 120), respectively.
The numbers (F= 1.15; df= 1, 114;P = 0.29) and
weights (F = 0.10; df= 1, 114;P = 0.76) of surviving
larvae were similar whether the insects fed on the
roots of Swingle citrumelo or Sun Chu Sha manda-
rin. However, the dry weight of roots (F = 50.66; df
= 1, 114; P < 0.01) and height of plant shoots (F =
95.35; df = 1, 114; P < 0.01) differed by citrus vari-
ety. Both the mean root weight and shoot height for
Swingle citrumelo (5.9 0.4 g and 60.0 1.5 cm, n
= 60) were greater than those for Sun Chu Sha
mandarin (2.8 0.3 g and 40.7 + 1.4 cm, n = 60) al-
though the plants were similar in age and size
when the experiment was initiated. The differ-
ences in the values for plant measurements were
due to inherent differences between the two citrus
varieties. No interactions between copper treat-
ment and citrus variety were detected for any of
the measured variables in the experiment.







Florida Entomologist 87(1)


TABLE 2. SURVIVAL OF LATE INSTARS, LARVAL AND PUPAL PERIODS, AND MEAN WEIGHT OF ADULTS AT EMERGENCE OF
DIAPREPES ROOT WEEVIL REARED ON ARTIFICIAL DIET CONTAINING BACKGROUND COPPER (12 PPM) OR COP-
PER SULFATE OR COPPER HYDROXIDE INCORPORATED AT THREE RATES.

Adult weight (mg)
Copper Rate Survival Larval Pupal
source (ppm) (%) period (d) period (d) Males n Females n

CuSO4 250 70 121.5 6.5 18.1 0.8 279.2 12.6 10 377.0 37.1 11
CuSO4 500 57 130.1 9.7 19.4 1.1 270.5 12.4 5 350.5 16.4 12
CuSO4 1000 73 128.4 5.7 17.7 1.2 259.7 9.8 13 335.0 16.2 9
Cu(OH)2 250 57 120.4 7.5 20.3 0.9 289.9 23.8 8 369.0 12.9 9
Cu(OH)2 500 57 121.8 9.7 18.4 0.6 294.9 7.3 10 334.9 12.6 7
Cu(OH)2 1000 53 133.6 8.9 21.1 1.2 281.7 12.2 6 354.0+ 21.8 10
Diet only 12 60 117.8 5.7 18.5 0.7 291.3 13.1 10 312.8 14.1 8

Means within columns are not significantly different (a = 0.05, ANOVA).


DISCUSSION

Heavy metals are known to have adverse bio-
logical effects on insect development (Rayms-
Keller et al. 1998; Bischof 1995). For example, 33
ppm copper resulted in 50% mortality of larval
Aedes aegypti (Rayms-Keller et al. 1998), and re-
tarded development was observed in copper-con-
taminated larvae of Lymantria dispar (Bischof
1995). The toxicity of heavy metals to insects can
be synergized by several factors including hypoxia
(van der Geest et al. 2002) and the presence of
other heavy metal ions (Fargasova 2001). How-
ever, the strategic use of a heavy metal ion for con-
trolling an insect pest is restricted by issues of
phytotoxicity and long-term contamination of soil.
To circumvent these problems, citrus seedlings
might be treated in nurseries to raise the concen-
tration of copper in roots before transplanting,
thereby conferring a degree of protection to soil in-
sects such as D. abbreviatus. However, in this
study, treatment of seedlings with nonphytotoxic
levels (<300 ppm) of copper in solution did not con-
fer resistance to larval D. abbreviatus.
The toxicity of copper to plant tissue and bio-
availability of copper in the environment are
known to increase with increasing soil acidity
(Alva et al. 2000). The pH of ingested plant tissue
by a root weevil would be approximately neutral,
the same as that of the artificial diet used in our
tests. According to Alva et al. (2000), critical Cu
concentration for phytotoxicity in the roots of
Swingle citrumelo seedlings ranged from 62 mg
kg-1 in Myakka fine sand (pH 5.7) to 270 mg kg1 in
Candler fine sand (pH = 6.5).
Diet-incorporation assays have been success-
fully employed to identify compounds with nega-
tive effects on the developmental biology of
D. abbreviatus (Shapiro et al. 1997, 2000; Weath-
ersbee & Tang 2002). In our tests, significant mor-
tality compared with the control diet was
associated with CuSO4 but not Cu(OH)2, although
the magnitude of the effect was not large and,


curiously, did not vary with the concentration of
copper. Mean weight gain of larvae reared on ei-
ther source of copper cation at a concentration of
250 ppm was equivalent to that of larvae reared
on the control. Significant inhibition of growth of
early instars only occurred at higher concentra-
tions (500 and 1,000 ppm). There was no discern-
ible effect of copper amendments on survival,
larval and pupal development, or weight gain on
larvae >30 d old. Similarly, larvae ofL. dispar ex-
posed from the 4th instar were less susceptible to
heavy metals than larvae exposed from hatching
(Gintenreiter et al. 1993). From these data, we
conclude that the concentration of copper re-
quired in root tissue to significantly inhibit devel-
opment and survival ofD. abbreviatus is too high
to avoid phytotoxic effects.

ACKNOWLEDGMENTS

We thank Hunter Smith for technical assistance
with bioassays. Research was financed in part by Coop-
erative Research and Development Agreement 58-
3K95-9-657 between ARS and Morse Enterprises Lim-
ited, Inc., Miami, FL. Mention of a trademark or propri-
etary product does not constitute a guarantee or
warranty of the product by the U.S. Department of Ag-
riculture and does not imply its approval to the exclu-
sion of other products that may also be suitable.

REFERENCES CITED

ALVA, A. K., B. HUANG, AND S. PARAMASIVAM. 2000. Soil
pH affects copper fractionation and phytotoxicity.
Soil Science Society of America Journal 64: 955-962.
BISCHOF, C. 1995. Heavy metal concentrations of the
endoparasitoid Glyptapanteles liparidis Bouche (Hy-
menoptera) in contaminated Lymantria dispar lar-
vae (Lepidoptera). Bull. Environ. Contam. Toxicol.
55: 533-539.
DOOSTDAR, H., T. G. MCCOLLUM, AND R. T. MAYER
1997. Purification and characterization of an endo-
polygalacturonase from the gut of West Indies sugar-
cane rootstalk borer weevil (Diaprepes abbreviatus
L.) larvae. Comp. Biochem. Physiol. 118B: 861-867.


March 2004







Lapointe et al.: Copper and Diaprepes Root Weevil


FARGASOVA, A. 2001. Winter third- to fourth-instar lar-
vae of Chironomus plumosus as bioassay tools for as-
sessment of acute toxicity of metals and their binary
combinations. Ecotoxicol. Environ. Saf. 48: 1-5.
FLORIDA COOPERATIVE EXTENSION SERVICE. 2000. Flor-
ida Crop/Pest Management Profiles: Citrus (Oranges/
Grapefruit). Document CIR 1241, Pesticide Informa-
tion Office, Food Science and Human Nutrition De-
partment, Florida Cooperative Extension Service,
Institute of Food and Agricultural Sciences, Univer-
sity of Florida. http://edis.ifas.ufl.edu.
GIANESSI, L. P., AND C. A. PUFFER 1992. Fungicide use
in U.S. crop production: Washington, D.C., Resources
for the Future, Quality of the Environment Division
(variously paged).
GINTENREITER, S., J. ORTEL, AND H. J. NOPP. 1993. Ef-
fects of different dietary levels of cadmium, lead,
copper, and zinc on the vitality of the forest pest in-
sect Lymantria dispar L. (Lymantriidae, Lepid).
Arch. Environ. Contam. Toxicol. 25: 62-66.
LAPOINTE, S. L. 2000. Thermal requirements for devel-
opment of Diaprepes abbreviatus (Coleoptera: Cur-
culionidae). Environmental Entomol. 29: 150-156.
LAPOINTE, S. L., AND J. P. SHAPIRO. 1999. Effect of soil
moisture on development of Diaprepes abbreviatus
(Coleoptera: Curculionidae). Florida Entomol. 82:
291-299.


RAYMS-KELLER, A., K. E. OLSON, M. MCGAW, C. ORAY,
J. O. CARLSON, AND B. J. BEATY. 1998. Effect of
heavy metals on Aedes aegypti (Diptera: Culicidae)
larvae. Ecotoxicol. Environ. Saf. 39: 41-47.
SAS INSTITUTE, INC. 1999. StatView Reference. Cary,
NC.
SHAPIRO, J. P., K. D. BOWMAN, AND H. S. SMITH. 1997.
Resistance of citrus rootstocks and Glycosmis penta-
phylla against larval Diaprepes abbreviatus (Co-
leoptera: Curculionidae) in live root or diet-
incorporation assays. Florida Entomologist 80: 471-
477.
SHAPIRO, J. P., K. D. BOWMAN, AND S. L. LAPOINTE.
2000. Dehydrothalebanin, a source of resistance
from Glycosmis pentaphylla against the citrus root
weevil Diaprepes abbreviatus. J. Agric. Food Chem.
48: 4404-4409.
VAN DER GEEST, H. G., W. J. SOPPE, G. D. GREVE, A.
KROON, AND M. H. S. KRAAK. 2002. Combined effects
of lowered oxygen and toxicants (copper and diazi-
non) on the mayfly Ephoron virgo. Environ. Toxicol.
Chem. 21: 431-436.
WEATHERSBEE, A. A. III, AND Y. Q. TANG. 2002. Effect
of neem seed extract on feeding, growth, survival,
and reproduction of Diaprepes abbreviatus (Co-
leoptera: Curculionidae). J. Econ. Entomol. 95:
661-667.







Florida Entomologist 87(1)


March 2004


EXTERNAL MORPHOLOGY OF ABDOMINAL SETAE FROM MALE AND
FEMALE HYLESIA METABUS ADULTS (LEPIDOPTERA: SATURNIIDAE)
AND THEIR FUNCTION

JESSICCA RODRIGUEZ1, JOSE VICENTE HERNANDEZ2, LIZETTE FORNES2, ULF LUNDBERG3,
CARMEN-LUISA AROCHA PIIANGO3 AND FRANCES OSBORN1
'Instituto de Investigaciones en Biomedicina y Ciencias Aplicadas, Universidad de Oriente, Cumand, Venezuela

2Laboratorio de Comportamiento, Dept. Biologia de Organismos, Universidad Sim6n Bolivar, Caracas, Venezuela

3Centro de Medicina Experimental, Instituto Venezolano de Investigaciones Cientificas, Caracas, Venezuela

ABSTRACT

Hylesia metabus is a species of moth, distributed principally in northeastern Venezuela. Fe-
male moths use their abdominal setae to cover their egg masses. Contact with these setae
can cause a severe dermatitis in humans. Setae from males do not produce these symptoms.
The external morphology of the abdominal setae in male and female moths was described
and the effect of the setae on ant behavior was studied. We classified the setae into four
types, S1, S2, S3 and S4. In females, two of these types were found in the dorsal region; S1
and S2 show a porous structure and measure 2000 lim and 155 lim in length, respectively.
In the ventral part of the abdomen we observed three setae types, S1, S3 which are 190 im
long and have small barbs along their length directed towards the apex, and S4 which have
numerous barbs at the base, but further up flatten out, with barbs along both sides, before
tapering off at the apex. S4 also were found in the lateral zones of the abdomen and were the
predominant type of setae covering the egg masses. Only S1 setae were found in males. Egg
masses not covered by setae were examined and transported by Pheidole ants, whereas cov-
ered eggs were largely avoided. The morphology of the S3 and S4 setae types suggests that
these may be related to the urticating properties reported for the moth. Ant avoidance of se-
tae covered eggs suggests that these protect the eggs from at least some predators.

Key Words: Urticating moth, egg protection, ants

RESUME

Hylesia metabus es una especie de Lepid6ptero, distribuida principalmente en el noreste de
Venezuela. Las hembras adults cubren sus huevos con sus setas abdominales. El contact
con estas setas causa una several dermatitis en los humans. Las setas provenientes de los
machos no produce tales sintomatologias. Se describio la morfologia externa de las setas
abdominales en mariposas machos y hembras y se studio el efecto de las setas sobre el com-
portamiento de las hormigas. Las setas se clasificaron en cuatro tipos, S1, S2, S3 y S4. En
las hembras, dos de estos tipos se encontraron en la region dorsal; S1 y S2, las cuales pre-
sentan una estructura porosa y con una longitud de 2000 im y 155 im respectivamente. En
la parte ventral del abdomen se observaron tres tipos de setas, S1, S3, que miden 190 im de
largo y tienen pequenas espinas a lo largo de la seta, dirigidas hacia el apice y S4, que pre-
sentan espinas en la base, para luego aplanarse, con espinas a los lados, antes de volver a
afilarse hacia el apice. Las S4 se encuentran tambi6n en las zonas laterales del abdomen y
son el tipo de seta predominante cubriendo los huevos. En los machos, el inico tipo de seta
present son las S1. Grupos de huevos separados de la postura y desprovistos de setas fueron
examinados y cargados por hormigas del g6nero Pheidole, mientras que 6stas evitaron con-
tacto con las posturas cubiertas de setas. La morfologia de las S3 y S4, sugiere que 6stas po-
drian estar relacionadas con el efecto urticante de las mismas. La evasion por parte de las
hormigas de los huevos cubiertos por las setas indica que 6stas protegen los huevos de por
lo menos algunos depredadores.
Translation provided by author


Urticating hairs or setae are found in species era Acyphas and Euproctis in the Lymantridae
belonging to 13 families and four superfamilies in and in the genus Hylesia in the Saturniidae.
the order Lepidoptera. In most cases larvae have The genus Hylesia is a Neotropical moth dis-
urticating setae, and it is only in a few species that tribute in the Americas from Mexico to Argen-
they are found on adults, for example in the gen- tina (Lamy et al. 1984). Hylesia metabus







Rodriguez et al.: Morphology of Setae from Hylesia metabus


(Cramer) 1775, (common name "Palometa Pe-
luda"), is distributed principally in mangrove
swamps in northeastern Venezuela (Fornes &
Hernandez 2001). The abdomens of the adult fe-
males are exceedingly hairy and the females use
these hairs to cover their egg masses. It has been
speculated that the hairs protect the eggs from
predators and parasites, although this has not
been demonstrated. Although Hylesia metabus
moths normally inhabit mangrove swamps,
swarming adult moths are attracted by lights of
nearby towns and arrive in the thousands, releas-
ing the urticating hairs into the air. Exposure to
hairs from female moths leads to severe urticarial
and papilovesicular dermatitis. Hairs from male
moths are not urticating.
Studies of the external morphology ofH. meta-
bus adult females have been undertaken, (Lamy
& Lemaire 1983; Olivares & Vasquez 1984) and
different types of setae have been described.
Lamy & Lemaire (1983) described what they
called "flechettes" assuming that these were the
only setae to have urticating properties. Later,
Vasquez (1990) reported three different types of
setae present on female abdomens, and consid-
ered that two of these types were urticating.
Nonetheless, the only setae illustrated are simi-
lar to those previously described by Lamy & Le-
maire (1983). No detailed description of the
external morphology of the different setae found
on female abdomens and egg nests is known to us.
Neither has anyone described the non urticating
setae from male abdomens. Here we describe the
setae from male and female abdomens and from
the egg nests of Hylesia metabus moths. In addi-
tion we studied the effect of the setae covering the
egg masses on ant behavior in order to ascertain
if these protect the eggs from foraging by the ants.

MATERIALS AND METHODS

Preparation of Samples for Scanning Electron
Microscopy (SEM)

Male and female Hylesia metabus pupae, and
the hairballs used by the females to cover their
egg masses were collected from mangrove
swamps close to the town ofYaguaraparo, Cajigal
District, Sucre State, Venezuela. The pupae were
maintained until the eclosion of the adults in the
Biological Control Laboratory, at the Instituto de
Investigaciones en Biomedicina y Ciencias Apli-
cadas, Universidad de Oriente, Cumand, Venezu-
ela. The larvae were maintained at 24 2C,
relative humidity; 60 5% and a photoperiod of
12:12 (L:D). For SEM, abdomens from moths, and
egg nests, were cut in pieces of approximately 1
mm3, placed in glass vials and dehydrated in an
oven at 40C for 48h in the presence of silica gel.
The abdomens were divided into three sections:
dorsal, ventral, lateral, with each section being


further divided into anterior (towards the tho-
rax), middle, and posterior (towards the oviposi-
tor). Some of the abdomens were scraped to
remove the hairs before being divided into equal
sized sections as described above. The samples
were coated with gold/palladium and observed in
a Philips SEM 505 and a JEOL T-300 scanning
electron microscope (Stobbart & Shaw 1964).

Behavioral Experiments

The experiments with ants were carried out at
the Universidad Sim6n Bolivar, Caracas, Venezu-
ela, following the methodology used by Osborn &
Jaffe (1998) with some modifications. We used
Pheidole sp. for the purposes of this study, as it is
commonly found in the vegetation and thus prob-
ably regularly encounters lepidopteran eggs and
larvae. Two colonies ofPheidole sp. were collected
in the surroundings of the university and main-
tained in the laboratory in plastic bowls of 1-m
diameter and 50-cm depth, at a constant temper-
ature of 25C and a relative humidity of 70-80%.
A metal tripod 40 cm high was put in each bowl on
which we placed a glass platform of 20 cm3 as the
foraging area. Two plastic lids of 5-cm diameter
and 1-cm depth were placed on the glass plat-
forms, and in these we put pieces of soft netting,
one soaked in water and the other soaked in a 1:1
ratio of water and honey. In addition, every two
days insects collected with entomological nets
were placed on the foraging area.
For the bioassays, we placed an egg nest, with
or without setae, on the foraging area of one of the
ant colonies. Eggs without setae were prepared by
removing the setae with forceps and washing the
eggs with distilled water. The behavior of the ants
was then observed during 15 mins. The egg nests,
with or without setae, were tested separately, one
after the other (the first to be tested was chosen
randomly), with each pair of assays being consid-
ered an experiment. Nine replicates were per-
formed, alternating between colonies so that each
colony participated in only one experiment on any
given day.
The results of the replicates were analyzed by
a Wilcoxen-Mann-Whitney test, comparing each
response by the ants (exploration, touching, walk-
ing over and transport of the eggs) towards setae-
less, and setae-covered eggs separately (Siegel &
Castellan 1988).

RESULTS

External Morphology of the Setae

The hairs (or setae) of adult moths are distrib-
uted in lateral bands along the abdomen. In the
dorsal (anterior, middle and posterior) sections of
female abdomens we observed two types of setae
which we shall refer to as types S1 and S2 (Fig. 1).







Florida Entomologist 87(1)


4A


Figs. 1-6. 1) General view of the dorsal region of the female abdomen showing setae types S1 and S2. Note the
blunt apex of the S1 setae. Bar = 38 lm. 2) Detail of abdominal setae types S1 and S2. Note the porous nature of
the setae (arrow). Bar = 32 lm. 3) Detail of the base of a S1 type setae. B: base of setae. Lp: Large pocket Bar = 13
lm. 4) General view of an S3 type setae (S3). Bar = 20 lm. 5) Detail of the base of an S3 type setae. Note the blunt-
ness of the barbs. Sp: small pocket. (A) Bar = 7 jm. 6) Detail of the apex of an S3 type setae. Note the sharpness of
the barbs (Ba). Bar = 5 im.


S1 type setae were approximately 2 mm long, setae were between 182 and 220 pm long and
with a diameter of 5 to 5.3 pm at the base and were similar to S1 setae in that they also showed
variable widths of between 4.6 and 24 pm along a very porous lattice type structure. They were cy-
the rest of their length. These setae showed a very lindrical at the base, with a diameter of 5.5 to 6
porous lattice type structure and the apices of the pm, but then fanned out in the shape of a shield,
setae were blunt (Figs. 2 and 3, Table 1). S2 type with the apex in the form of a W (Fig. 1, Table 1).


March 2004







Rodriguez et al.: Morphology of Setae from Hylesia metabus


TABLE 1. MEASUREMENTS OF THE DIFFERENT TYPES OF ABDOMINAL SETAE FROM MALE AND FEMALE H. METABUS
MOTHS.

Width at base (im) Maximum width (Im) Length (mm) Width of pocket opening (irm)

Setae type Av. Std. Dev. Av. Std. Dev. Av. Std. Dev. Av. Std. Dev.

S1 5.1 0.1 11.0 6.3 29.1 2.0 7.3 0.2
S2 5.7 0.1 46.0 2.7 12.8 0.2 7.7 0.4
S3 2.9 0.2 8.0 0.7 15.0 0.19 4.0 0.6
S4 5.5 1.2 58.6 3.8 32.0 1.0 7.0 0.4

N=20.


In the ventral sections of female abdomens we
identified three types of setae; S1 type setae (al-
ready described) were abundant in the ventral
anterior part of the abdomen. S3 type setae were
predominant in the middle ventral area, they
were approximately 190 pm long, with a diameter
of 2.5 to 3.1 pm at the base (Figs. 4 and 5, Table 1).
They were smooth, without any holes or pores
(Fig. 4). Along their length were small barbs, di-
rected towards the pointed distal end. At the base
of the setae these had rounded points which be-
came sharper towards the apex (Figs. 5 and 6). S4
type setae were abundant in the ventral posterior
part of the abdomen; they were approximately 1
mm long and showed a more complex morphology
(Figs. 7-10); the base of the setae had a diameter
of 4.2 to 7.5 pm and the surface was made up of
numerous barbs (Fig. 8, Table 1), further up, the
setae flattened out to a width of approximately 60
pm, with triangular barbs along both sides (Fig.
9, Table 1). Towards the apex, the setae thinned
out into a thin cylindrical tube where, in some
photographs, secretion drops were observed (Fig.
10, Sd). S4 setae were also found in the lateral
sections of the female abdomens, where they were
the only type of setae observed.
The S1, S2 and S4 setae were inserted in pock-
ets with diameters of 7 to 7.7 pm (Figs. 1, 3, 5, 8,
11, Table 1), and S3 setae in pockets with diame-
ters of 3.2 to 4.6 pm (Figs. 5 and 11, Table 1).
These pockets varied in density depending on
their position on the abdomen. In the dorsal parts
of the abdomen where types S1 and S2 were lo-
cated, the pockets had a density of approximately
1000/mm2 (Fig. 5) The pockets on the lateral parts
of the abdomen, where the S4 type setae were
located had a density of 3500/mm2 (Fig. 8) In the
ventral zone of the abdomen, the large pockets,
holding S1 and S4 setae, had a density of 2000/
mm2, and in the ventral middle zone, where the
S3 setae were located, the small pockets were
very abundant; approximately 50000 / mm2, and
tightly packed, so that the cuticle could not be
seen (Fig. 5). In the anterior ventral part of the
abdomen only large pockets could be observed. In
Figure 11, the abrupt change between the middle
and anterior parts of the abdomen can be seen.


In the egg nests the dominant type of setae ob-
served was S4, although S1 and S3 setae were
also present (not shown) In males only S1 type se-
tae were found.

Behavioral Experiments

Definition of Behavioral Responses of Ants.
Preliminary experiments with eggs allowed us to
define the following behavioral responses of the
Pheidole ants towards the larvae: (1) Exploration:
ants touch the eggs with their antenna for a pe-
riod of >1 sec., (2) Touch: ants touch the eggs with
their mandibles for a period of >1 sec., (3) Walk
over: ants walk over the eggs, (4) Transport: ants
transport the eggs towards their nests.

Behavioral Responses of the Ants to Eggs with and
without Setae

Table 2 shows the results of the experiments
with the ants. It can be observed that there is a
significant difference between treatments for the
exploration and carrying behaviors with a total of
19 ants exploring uncovered egg masses com-
pared with 0 ants exploring covered egg masses. A
total of 16 ants carried uncovered egg masses to
their nest compared with 0 ants carrying covered
egg masses. In fact, the ants seemed to largely ig-
nore the covered egg masses, and avoided contact
with them.

DISCUSSION

This study represents a first detailed descrip-
tion of the morphology of the setae of adult male
and female Hylesia metabus moths. Based on
morphological characteristics, we have classified
the setae into four distinct types that we have
called S1, S2, S3, and S4, respectively.
Due to their porous nature and lack of sharp
points or barbs, S1 setae are unlikely to be urti-
cating. Furthermore S1 was the only type of setae
found in male moths which do not have urticating
properties. S2 type setae, observed from the dor-
sal zone of female abdomens, and structurally
similar to S1 are also unlikely to be urticating.







Florida Entomologist 87(1)


Figs. 7-11. 7) General view of the lateral region of the female abdomen showing setae type S4. Note the curved
nature of the setae. Bar = 76 lim. 8) Detail of the base of an S4 type setae. Lp: large pocket. Bar = 10 lim. 9) Detail
of the middle section of an S4 type setae. Note the lateral barbs (A). Bar = 23 lim. 10) Detail of the apex of an S4
type setae. Note the secretion drop (Sd). Bar = 210 lim. 11) Detail of the change in pocket sizes between the anterior
ventral and middle ventral regions of the female abdomen. Sv: anterior ventral region, Mv: middle ventral region,
Sp: small pocket. Bar = 20 lim.


The S3 and S4 types of setae are found only in
females and may be related to the urticating
properties. The urticating setae found on larvae
belonging to the genus Thaumetopoea (Notodon-
tidae) show a similar length (150-250 pm) and
share some structural similarities with the S3 se-
tae of the Hylesia moths, i.e., small, sharp barbs


pointing towards the distal end (Lamy & Novak
1988). Urticating setae similar to the S3 type
have been described from several species of Hyle-
sia moths (Lamy & Lemaire 1983). These authors
reported that in H. metabus the setae were 100 to
225 pm in length. Further descriptions of these
setae report a density of 50000 setae/mm2, as


March 2004







Rodriguez et al.: Morphology of Setae from Hylesia metabus


TABLE 2. RESPONSES OF PHEIDOLE SP. ANTS TO SETAE-LESS AND SETAE-COVERED EGG MASSES OF H. METABUS.

Eggs Eggs Probability of difference
Ant behavior without setae with setae Value of Z between treatments

Exploration 18 0 -2.842 0.014*
Walk over 22 8 -0.287 0.796
Touch with mandibles 10 0 -1.835 0.258
Carry 16 0 -2.85 0.014*

The numbers refer to the total number of ants that behaved in a certain way to the egg nests for all nine replicates.
*Significant difference between treatments.
N=9.


found in this study (Lamy et al. 1984; Pelissou &
Lamy 1988).
Setae similar to the S4 type have not, as far as
we know, been previously described. Nonetheless,
their morphology (sharp barbs at the base, and
triangular barbs further up) suggests that they
may have urticating properties. The secretion
drops observed at the apex of one of these setae
also suggests that they contain a liquid sub-
stance. Biochemical studies have demonstrated
the presence of a kallikrein-like substance (asso-
ciated with increased vascular permeability and
the production of pain) in the urticating hairs of
female H. metabus moths (Lundberg et al. 2002).
Furthermore, the setae are associated with the
ovipositor in female moths and are the most
abundant type of setae in the egg nests which are
known to be very urticating (personal experience
of three of the authors).
Although several species of larvae having urti-
cating setae with different morphologies have
been described (e.g., Perlman et al. 1976; Press et
al. 1977), the information on setae from adult
moths is scarce. Apart from H. metabus, the only
other species of moth reported as having more
than one type of urticating setae isAnaphe venata
(Notodontidae: Thaumetopoinae). Nevertheless,
although the setae on A. venata are different in
size and posture, both types of setae show the
same structure: they are sharp at both ends and
square when cut transversally, with barbs on all
four sides. (Lamy 1984; Lamy et al. 1984). In this
species, the female moths release the urticating
setae by means of abdominal contractions, plac-
ing them over the eggs, in a similar way to that of
H. metabus (Lamy 1984; Lamy et al. 1984).
Behavioral experiments with ants suggest that
they are not repelled by the abdominal hairs cover-
ing the egg nests (no alarm behavior was re-
corded), but rather ignore or avoid them. The eggs
of some species of insects, e.g., Gastrophysa cyanea
(Coleoptera: Chrysomelidae) contain oleic acid
which repel several species of ants (Howard et al.
1982). The hairs covering H. metabus eggs may
simply hide the eggs from the ants. This suggests
that the urticating characteristics of the hairs may
be directed towards avian or mammal predators.


In conclusion, we have characterized four dis-
tinct classes of setae present in the abdominal
wall of male and female adults of Hylesia meta-
bus. We have chosen to call these different types
of setae S1, S2, S3, and S4. In the egg nests, the
S4 type of setae is the predominant type. This
study thus represents the first description of four
morphologically different types of setae from one
species of moth, two of which are probably urti-
cating.
Setae covered eggs seem to be protected from
predation by ants, although the setae seem to act
as a physical barrier rather than a chemical one.


ACKNOWLEDGMENTS

The authors thank Srs. Andr6s Villegas and Norb-
erto Pino for assistance in the collection of the H. meta-
bus moths and egg nests, and the Centro de Ingenieria
de Superficies-Universidad Sim6n Bolivar and Glen
R6driguez for technical assistance. This study was sup-
ported in part by the Consejo de Investigaci6n of the
Universidad de Oriente, Project No. CI-5-1901-0820198
and by FONACIT (Fondo de Investigaci6n Regional) to
FO, and the Universidad Sim6n Bolivar to JVH.

REFERENCES CITED

FORNES, L., AND J. V. HERNANDEZ. 2001. Reseia
hist6rica e incidencia en la salud ptblica de Hylesia
metabus (Cramer). (Lepidoptera: Saturniidae) en
Venezuela. Entomotropica 16(2): 137-141.
HOWARD, D. F., M. S. BLUM, T. H. JONES, AND D. W.
PHILLIPS. 1982. Defensive adaptions of eggs and
adults of Gastrohysa cyanea (Coleoptera: Chryso-
melidae). J. Chem. Ecol. 8: 453-462.
LAMY, M. 1984. La processionnaire du colatier:Anaphae
venata Butler (Lepidoptere: Thaumetopoeidae): pap-
illon urticant d'Afrique. The cola processionary
moth: Anaphae venata Butler (Lepidoptere: Thau-
metopoeidae): an urticating moth from Africa [Mor-
phology, cause of human diseases]. Insect Science
and its Application 5(2): 83-86.
LAMY, M., AND C. LEMAIRE. 1983. Contribution a la
syst6matique des Hylesia: etude au microscope 6lec-
tronique a balayage des "flechettes" urticantes. Sys-
tematics of the Hylesia spp. study with scanning
electronic microscopy. Bulletin de la Societ6 Ento-
mologique de France 88(3/4): 176-192.











LAMY, M., AND F. NOVAK. 1988. Mise en place et dif-
f6renciation de lappareil urticant de la Chenille pro-
cessionnaire du ch6ne (Thaumetopoea processionea
L.) (L6pidopt6res, Thaumetopoeidae) au course de son
d6veloppment larnaire. Annales des Sciences Na-
turelles, Zoologie, Paris. 13 S6rie 9(1): 55-65.
LAMY, M., M. H. PASTUREAUD, F. NOVAK, AND G. DU-
COMBS. 1984. Papillons urticants dAfrique et
dAm6rique du sud (g. Anaphae etg. Hylesia): Contri-
bution du microscope lectronique a balayage a
1'etude de leur appareil urticant et a leur mode d'e
action. Urticating moths of Africa (genus Anaphae)
and of South America (genus Hylesia). Bulletin de la
Society Zoologique de France 109(2): 163-177.
LUNDBERG, U., F. R. OSBORN, Z. CARVAJAL, A. GIL, B.
GUERRERO, AND C. L. AROCHA-PIiANGO. 2002. Isola-
tion and partial characterization of a proteasen with
kallikrein-like activity from the egg nests of Hylesia
metabus (Cramer 1775) (Lepidoptera: Saturiidae),
preliminary communication. Revista Cientifica
12(2)97: 102.
OLIVARES, M. A., AND L. N. VASQUEZ. 1984. Morfologia
externa de escamas de Hylesia sp. a nivel de mi-
croscopia electr6nica. IX Congreso Venezolano de
Entomologia, Abstract No. 69, Tachira, Venezuela.
1984.


March 2004


OSBORN, F., AND K. JAFFE. 1998. Chemical ecology of
the defense of two butterfly larvae against ants. J.
Chem. Ecol. 24(7):1173-1186.
PELISSOU, V., AND L. LAMY. 1988. Le Papillon Cendre:
Hylesia metabus (Cramer (= H. urticans) Floch et
abonnenc) (Lepidopteres Saturniidae) Papillon urti-
cant de guyane Francaise: Etude Cytologique de Son
Appareil Urticant. Insect Science and its Application
9(2)185-189.
PERLMAN, F., E. PRESS, J. A. GOOGINS, A. MALLEY, AND
H. POAREA. 1976. Tussockosis: Reactions to Douglas
Fir Tussock moth. Annals of Allergy 36:302-307.
PRESS, E., J. A. GOOGINS, H. POAREO, K. JONES, F. PERL-
MAN, AND J. EVERETTE. 1977. Health to timber and
forestry workers from the Douglas Fir Tussock moth.
Archives of Environmental Health 32: 206-210.
SIEGEL, S., AND J. CASTELLAN. 1988. Nonparametric
statistics for the behavioral sciences. McGraw Hill.
New York, London. 399 pp.
STOBBART, R. H., AND J. SHAW. 1964. Salt and water
balance: excretion, pp. 189-235. In R. Rockstein
(Ed.), The Physiology of Insects, Vol. 3. Academic
Press, New York, London. 350 pp.
VASQUEZ, L. N. 1990. Estudio bioecol6gico y tactics de
control de la Palometa Hylesia metabus Crammer.
en el oriented de Venezuela. Saber 3(1): 14-20.


Florida Entomologist 87(1)







Matthews & Gonzalez: Nesting Biology


NESTING BIOLOGY OF ZETA ARGILLACEUM (HYMENOPTERA:
VESPIDAE: EUMENINAE) IN SOUTHERN FLORIDA, U.S.

ROBERT W. MATTHEWS AND JORGE M. GONZALEZ
University of Georgia, Department of Entomology, Athens, GA 30602, USA

ABSTRACT

Zeta argillaceum (L.), a common neotropical wasp, is established in Florida. The character-
istic mud potter-like nests are easily recognized. They prey on geometrid caterpillars. Their
nests are reused by various arthropods, forming an ecological web similar to that of other
mud dauber wasps. Prey, inquilines, parasites, and scavengers found inside the nests are
presented.

Key Words: Pachodynerus erynnis, Pachodynerus nasidens, Anthrax sp., Melittobia austral-
ica,Anthrenus sp., Macrosiagon sp., Chalybion californicum

RESUME

Zeta argillaceum (L.) es una avispa neotropical muy comun y esta establecida en Florida. El-
las construyen nidos de barro en forma de vasija, faciles de reconocer. Sus hospedadores son
larvas de geom6tridos. Sus nidos son reutilizados por various artr6podos y forman una red
ecol6gica similar al de otras avispas constructoras de nidos de barro. Se presentan en este
trabajo los hospedadores, inquilinos, parasitos y carroneros encontrados dentro de los nidos.

Translation provided by author.


Zeta is a small neotropical eumenine wasp ge-
nus with 4 species that range from Mexico to Ar-
gentina and also Trinidad, in the West Indies
(Bertoni 1934; Bodkin 1917; Callan 1954; Car-
penter 1986b, 2002; Carpenter & Garcete-Barrett
2002; Giordani Soika 1975; Martorell & Escalona
S. 1939; Rocha 1981a, b). Zeta argillaceum (L.)
(Fig. 1) is probably one of the commonest potter
wasps in South America. It is well adapted to ur-
ban environments; it is easy to find its distinctive
mud nest attached to house walls (Garcete-Bar-
rett, pers. comm.). The nests can be also found in
sheltered spots under bridges, electric poles and
eaves (Bodkin 1917; Chavez 1985; Rocha 1981b)
and can be easily transported on ships, thereby
expanding its distribution (Bertoni 1934). The
mud cell normally appears uniformly colored, but
if not it is often due to subsequent closures of the
original emergence hole by inquilines or opportu-
nistic "renter" species (Bertoni 1911).
Recently introduced into the Southern United
States (Menke & Stange 1986; Stange 1987), Z.
argillaceum appears to be expanding its range.
Like mud daubers in the genera Trypoxylon and
Sceliphron, Z. argillaceum nests harbor not only
its offspring but also numerous other arthropods,
including scavengers, parasites and predators,
and their nests could be used to teach ecological
interactions (Matthews 1997).
Menke & Stange (1986) summarized the nest-
ing biology of Z. argillaceum. They relied heavily
on Taffe (1979) who studied the biology of Zeta
canaliculatum (=Z. argillaceum) in Trinidad. A
similar approach was used to study Z. argillacea


(=Z. argillaceum) in Brazil (Rocha & Raw 1982).
In many aspects the general biology resembled
that of the related Z. abdominale (Drury) (in some
cases using its synonym Eumenes colona Saus-
sure) studied in Jamaica by Freeman & Taffe
(1974), Taffe & Ittyieipe (1976), and Taffe (1978,
1979, 1983). Detailed accounts of the inquilines
and parasites of Z. argillaceum in Brazil and in


Fig. 1. Zeta argillaceum female, lateral view. Ruler
marking are in mm. Inset is portrait of head, frontal
view.







Florida Entomologist 87(1)


Venezuela are given by Bruch (1904), Rocha
(1981a, 1981b), Rocha & Raw (1982) and Chavez
(1985). Here we present the first biological data for
this species from North America, and demonstrate
that it is well established in southern Florida.
MATERIALS AND METHODS
Seventy-three cells of Zeta argillaceum were
collected from the roofs of two beach shelters at
Hutchinson Boulevard, Martin County, Florida


on 28 July 2003. Cells were dissected and con-
tents recorded. Live material was reared under
laboratory conditions (25C, 70% RH) and identi-
fied. Voucher specimens were deposited in the en-
tomological collection of the Georgia Museum of
Natural History, Athens, Georgia.
RESULTS AND DISCUSSION
Nests of Zeta argillaceum consist of rounded,
pot-like cells (Fig. 2). Nest clusters contained up


nuhm-ninmu11111111iur


Figs. 2-5. 2, Five-celled nest of Zeta argillaceum. Left arrow indicates plug sealing entrance to cell. Right arrow
shows open entrance of a cell. Ruler marking are in mm. 3, Caterpillar prey stocked in cell ofZ. argillaceum. 4, Egg
(arrow) attached with a silk thread to the cell wall; egg is 3 mm long. 5, unidentified spider using cell as shelter.


March 2004







Matthews & Gonzalez: Nesting Biology


to 15 cells. Most contained 4-7 cells, but isolated
single cell nests were also found. Most nests in
our sample were old and many had been reused,
suggesting that the site had been occupied for
some time. Taffe (1979) found that Z. argillaceum
had 6 generations per year in Trinidad, each re-
quiring about 60 days. In subtropical Florida it is
probable that the species can have up to 4-5 gen-
erations, leading us to infer that the site had been
used for at least a year.
Cells measured 14-18 mm in diameter (Fig. 2)
and about 9-13 mm height. Eleven cells were re-
cently made, and contained paralyzed but respon-
sive caterpillars representing two unidentified
species of Geometridae. Larvae of this lepi-
dopteran family are reported as common prey of
Z. argillaceum elsewhere (Callan 1954; Rocha
1981a). One cell (Fig. 3) contained 19 geometrid
caterpillars (15 of one species) and a newly
hatched wasp larva. The wasp's egg (Fig. 4) is sus-
pended in the empty cell.
Many of the remaining cells (52 of 62) were re-
used by other arthropods. This rate of reuse was
higher than previously found in Brazil (42.75%)
and Trinidad (42.72%), where the wasp is very
common (Rocha 1981b; Taffe 1979). It appears
that Z. argillaceum builds a new nest each time,
as there are no reports of it re-using old nests. Ta-
ble 1 lists the arthropods found in the cells of
Z. argillaceum. Two other Eumeninae, Pacho-
dynerus nasidens (Latreille) and P erynnis (Lepe-
letier) were found reusing Z. argillaceum cells.
Pachodynerus nasidens, the most widespread spe-
cies in the genus and distributed from the U.S. to
Argentina, but not in Chile, and also in the Anti-
lles (Carpenter 1986a; Willink & Roig-Alsina
1998), use the cells by dividing them in two by
adding a wall in the middle, so from each Z.
argillaceum cell 2 P nasidens wasps will emerge.
These wasps reused 24 Z. argillaceum cells. In
Brazil, P nasidens also are recorded to build two


cells inside of reused cells of Z. argillaceum
(Rocha 1981a, b). Pachodynerus erynnis, the only
red-marked Pachodynerus in the U.S. (J. M. Car-
penter, pers. comm.), and restricted to the south-
east (Carpenter 1986a; Willink & Roig-Alsina
1998), use the cells unmodified so that only one
individual of this species emerges per Z. argilla-
ceum cell. Apparently only two Z. argillaceum
cells in our sample were reused by P. erynnis.
However, two other Z. argillaceum cells contained
dead and mummified larvae of Noctuidae, which
could have been prey of that wasp, as found by
Krombein (1967). The sphecid C/..,,l. i..i. califor-
nicum (Saussure) also reused Z. argillaceum cells
(one wasp found in a cell). Taffe (1979) reported
cells ofZ. argillaceum being reused in Trinidad by
Trypoxylon sp. and Amobia sp. The later was
probably a parasite of Trypoxylon. Rocha (1981a,
b) found that Trypoxylon sp. and Pachodynerus
nasidens were the most common inquilines in old
nests ofZ. argillaceum in Brazil.
Some of the mortality factors for Z. argilla-
ceum and the opportunistic wasps were a bee fly
(Anthrax sp., Diptera: Bombyliidae), the Austra-
lian wowbug (Melittobia australica, Hymenop-
tera: Eulophidae) and one individual of
Macrosiagon sp. (Coleoptera: Rhipiphoridae), a
known parasite of Eumeninae (Krombein 1967;
Genaro 1996), that was found dead inside one old
cell. Melittobia australica was found parasitising
Z. argillaceum in two of the cells, and P nasidens
in 4 reused cells. Mold was consuming the prey
caterpillars in one cell. Taffe (1979) also mentions
mold attack, cuckoo wasps (Chrysididae), Ichneu-
monidae and especially Melittobia sp. (=M. aus-
tralica) as the most important mortality factors in
this potter wasp in Trinidad as well as in Z. ab-
dominale in Jamaica. Melittobia australica was
also found parasitising different Eumeninae in
Venezuela including Z. argillaceum (Chavez
1985; Gonzalez 1994; Gonzalez & Teran 1996).


TABLE 1. CONTENTS OF 73 ZETA ARGILLACEUM NEST CELLS COLLECTED IN MARTIN CO., FLORIDA, U.S.

Order (Family) Species Habits No. of Cells Used

Hymenoptera (Vespidae) Zeta argillaceum* Maker 11
Hymenoptera (Vespidae) Pachodynerus erynnis Re-user 2 (+2)**
Hymenoptera (Vespidae) Pachodynerus nasidens Re-user 24
Hymenoptera (Sphecidae) Chalybion californicum Re-user 1
Hymenoptera (Eulophidae) Melittobia australica*** Parasite 6
Coleoptera (Rhipiphoridae) Macrosiagon sp. Parasite 1
Diptera (Bombyliidae) Anthrax sp. Parasite 1
Coleoptera (Dermestidae) Anthrenus sp. Scavenger 10
Psocoptera Scavenger 1
Aranea Using nests as shelter 4
Empty 10

*1 cell with a newly hatched wasp larva contained 19 prey larvae. Another cell had a recently laid wasp egg.
**2 specimens of P. erynnis were found in 2 cells. Two other cells had larvae of Noctuidae caterpillars, typical prey ofP. erynnis.
***1 on Z. argillaceum, 5 on P. nasidens.







Florida Entomologist 87(1)


At least two species of scavengers were also
found. Ten of the Z. argillaceum cells contained
carpet beetles (Anthrenus sp. Coleoptera: Derm-
estidae), while Psocoptera were found only in 1
old cell. Web remnants and live spiders were
present in four old cells, which probably served
as shelters (Fig. 5). Many other insects present
in Florida are also potential users ofZ. argilla-
ceum nests, such as Crematogaster ants, that
also have been found using old nest cells (Bodkin
1917).
Clearly the persistence of the mud pots of Z.
argillaceum after the emergence of their original
progeny provides a home for a diverse community
of opportunists and nest associates. The composi-
tion of this community no doubt differs from loca-
tion to location, but generally includes other
cavity-nesting Hymenoptera and their parasites,
scavengers and associates. In this small sample
we found a community involving some 10 arthro-
pod species. Thus, such nests are potentially use-
ful for teaching ecological concepts as well as
helping to maintain biological diversity in rela-
tively urban environments by providing shelter
and food to other species of arthropods.

ACKNOWLEDGMENTS

We thank Bolivar Garcete-Barrett and James M.
Carpenter for comments and providing relevant litera-
ture. J.M. Carpenter also kindly identified the Pacho-
dynerus spp. The study was partially supported by
NSF Grant 0088021, R.W. Matthews Principal Investi-
gator.

REFERENCES CITED

BERTONI, A. 1911. Contribuci6n a la biologia de las avis-
pas y abejas del Paraguay (Hymenoptera). An. Mus.
Nac. Hist. Nat. Buenos Aires 22: 97-146.
BERTONI, A. 1934. Contribuci6n al conocimiento de los
Eumeneidos. El antiguo g6nero Eumenes Latr (s.
lat.) (Nuevo punto de vista para la clasificaci6n).
Rev. Soc. Cient. Paraguay 3(4): 109-122.
BODKIN, G. E. 1917. Notes on some British Guiana Hy-
menoptera. Trans. Entomol. Soc. Lond. 1917: 297-321.
BRUCH, G. E. 1904. Le nid de l'Eumenes canaliculata
(Oliv.) Sauss. et observations sur deux de ses para-
sites. Rev. Mus. La Plata 11: 223-226.
CALLAN, E. MC. 1954. Observations on Vespoidea and
Sphecoidea from the Paria Peninsula and Patos Is-
land, Venezuela. Bol. Entomol. Venez. 9(1-4): 13-26.
CARPENTER, J. M. 1986a. A synonymic generic checklist
of the Eumeninae (Hymenoptera: Vespidae). Psyche
93: 61-90.
CARPENTER, J. M. 1986b. The genus Pachodynerus in
North America (Hymenoptera: Vespidae: Eumeni-
nae). Proc. Entomol. Soc. Wash. 88(3): 572-577.
CARPENTER, J. M. 2002. Return to the subspecies con-
cept in the genus Zeta (Hymenoptera: Vespidae; Eu-
meninae). Bol. Mus. Nac. Hist. Nat. Paraguay 14 (1-
2): 19-24.
CARPENTER, J. M., AND B. R. GARCETE-BARRETT. 2002.
A key to the Neotropical genera of Eumeninae (Hy-


menoptera: Vespidae). Bol. Mus. Nac. Hist. Nat.
Paraguay 14 (1-2): 52-73.
CHAVEZ, A. H. 1985. Morfologia, ciclo de vida y compor-
tamiento de Zeta argillaceum (L.) (Hymenoptera:
Eumenidae). [Trabajo de ascenso] Barquisimeto,
Lara, Venezuela. Universidad Centro Occidental
Lisandro Alvarado. 74 pp.
FREEMAN B. E., AND C. A TAFFE. 1974. Population dy-
namics and nesting behaviour of Eumenes colona
(Hymenoptera) in Jamaica. Oikos 25: 388-394.
GENARO, J. A. 1996. Nest parasites (Coleoptera, Diptera,
Hymenopteran) of some wasps and bees (Vespidae,
Sphecidae, Colletidae, Megachilidae, Anthophori-
dae) in Cuba. Carib. J. Sci. 32(2): 239-240.
GIORDANI SOIKA, A. 1975. Sul genere Zeta. Boll. Mus.
Civ. Venezia 27: 111-135.
GONZALEZ, J. M. 1994. Taxonomia, biologia y compor-
tamiento de avispas parasiticas del g6nero Melit-
tobia Westwood (Hymenoptera: Eulophidae) en
Venezuela. Ph.D. Thesis. Maracay, Aragua: Univer-
sidad Central de Venezuela. 118 pp.
GONZALEZ, J. M., AND J. B. TERAN. 1996. Parasitoides
del g6nero Melittobia Westwood (Hymenoptera: Eu-
lophidae) en Venezuela. Distribuci6n y Hospederos.
Bol. Entomol. Venez. N.S. 11(2): 139-147.
KROMBEIN, K. V. 1967. Trap nesting wasps and bees:
life histories, nests and associates. Washington,
D.C.: Smithsonian Institution Press. 570 pp.
MARTORELL, L. F., AND A. ESCALONA SALAS. 1939. Addi-
tional insect records from Venezuela. J. Agric. Univ.
Puerto Rico 23(4): 233-255.
MATTHEWS, R. W. 1997. Teaching ecological interac-
tions with mud dauber nests. Am. Biol. Teacher
59(3): 152-158.
MENKE, A. S., AND L. A. STANGE. Delta campaniforme
rendalli (Bingham) and Zeta argillaceum (Linnaeus)
established in southern Florida, and comments on
generic discretion in Eumenes s.l. (Hymenoptera:
Vespidae: Eumenidae). Florida Entomol. 1986.
69(4): 697-702.
ROCHA, I. R. D. 1981a. Biologia e ecologia da vespa
solitaria Zeta argillacea (Hymenoptera, Eu-
menidae). Ci6ncia e Cultura 33: 87-92.
ROCHA, I. R. D. 1981b. Inquilinos em c6lulas vazias de
Zeta argillacea (L. 1758) (Hymenoptera, Eu-
menidae). An. Soc. Entomol. Brasil. 10: 187-197.
ROCHA, I. R .D., AND A. RAW. 1982. DinAmica das popu-
lacoes da vespa Zeta argillacea. An. Soc. Entomol.
Brasil. 11: 57-78.
STANGE, L. 1987. Zeta argillaceum on the move. Sphe-
cos (15): 1.
TAFFE, C. A. 1978. Temporal distribution of mortality in
a field population of Zeta abdominale (Hymenop-
tera) in Jamaica. Oikos 31: 106-111.
TAFFE, C. A. 1979. The ecology of two West Indian spe-
cies of mud-wasps (Eumenidae: Hymenoptera). Biol.
J. Linn. Soc. 11: 1-17.
TAFFE, C. A. 1983. The biology of the mud-wasp Zeta ab-
dominale (Drury) (Hymenoptera: Eumenidae). Zool.
J. Linn. Soc. 77: 385-393.
TAFFE, C. A., AND K. ITTYIEIPE. 1976. Effect of nest sub-
strata on the mortality ofEumenes colona saussure
(Hymenoptera) and its inquilines. J. Anim. Behav.
45: 303-311.
WILLINK, A., AND A. ROIG-ALSINA. 1998. Revision del
g6nero Pachodynerus Saussure (Hymenoptera:
Vespidae, Eumeninae). Contr. Am. Entomol. Inst.
30(5): 1-117.


March 2004







Aluja & Pifero: Low-tech Fruit Fly Attractant


TESTING HUMAN URINE AS A LOW-TECH BAIT FOR ANASTREPHA SPP.
(DIPTERA: TEPHRITIDAE) IN SMALL GUAVA, MANGO, SAPODILLA
AND GRAPEFRUIT ORCHARDS

MARTIN ALUJA AND JAIME PIiERO
Institute de Ecologia, A. C., Apartado Postal 63, 91000 Xalapa, Veracruz, Mexico

ABSTRACT

We evaluated the attractiveness of three aqueous dilutions of human urine (HU 50, 25, and
12.5%) to adults of pestiferous and nonpestiferousAnastrepha species (Diptera: Tephritidae)
in small guava, grapefruit, mango, and sapodilla orchards with glass McPhail traps. As con-
trol treatments we used a commercially available hydrolyzed protein bait (Captor Plus)
and tap water. In the guava orchard, the three urine dilutions were as effective as hydro-
lyzed protein in attracting A. fraterculus. Also, when 25 and 50% urine were used, 93 and
96%, respectively, of the adults captured were females. In the grapefruit orchard, protein-
baited traps captured significantly moreA. ludens than urine-baited traps. In the mango or-
chard, both A. obliqua and A. serpentina were more attracted to hydrolyzed protein than to
any other bait treatment. In the sapodilla orchard, traps baited with 50% urine surpassed
all other treatments in the capture of A. serpentina and A. obliqua. Our findings indicate
that human urine performs as well or better than hydrolyzed protein in certain types of or-
chards. They also support the notion that there is no "universal" Anastrepha bait. We con-
clude that human urine is a viable, low-tech alternative Anastrepha bait for subsistence or
low income, small-scale fruit growers in rural Latin America.

Key Words:Anastrepha, Tephritidae, human urine, hydrolyzed protein, trapping, attractants

RESUME

Evaluamos el potential atractivo de 3 diluciones acuosas de orina humana (OH 50, 25 y
12.5%) para adults de species plaga y no plaga deAnastrepha (Diptera: Tephritidae) en pe-
queios huertos de guayaba, toronja, mango y chico zapote utilizando trampas McPhail de
vidrio. Los tratamientos control consistieron de protein hidrolizada (Captor Plus) y agua.
En la huerta de guayaba, las tres diluciones de orina fueron igual de efectivas que la pro-
teina hidrolizada en capturarA. fraterculus. A diluciones de 25 y 50% de orina, el 93 y 96%,
respectivamente, de las captures fueron hembras. En la huerta de toronja, las trampas ce-
badas con protein capturaron significativamente mas adults que aquellas cebadas con
orina. Un resultado similar se obtuvo en la huerta de mango donde se capturaron adults de
A. obliqua yA. serpentina. En la huerta de chico zapote, las trampas cebadas con orina al
50% superaron a todos los demas tratamientos capturando significativamente mas adults
deA. serpentina. Nuestros resultados indican que la orina tiene un potential atractivo sim-
ilar o en algunos casos mayor que la protein hidrolizada en ciertos tipos de huertos. Tam-
bi6n apoyan la noci6n de que no existe un cebo "universal" paraAnastrepha. Concluimos que
la orina humana represent una alternative viable de baja tecnologia para pequeios pro-
ductores de bajo ingreso o subsistencia en areas rurales de America Latina.

Translation provided by author.


In recent years, there has been renewed inter-
est in developing more efficient baits and traps
for monitoring economically important fruit flies
(Diptera: Tephritidae). Even though most re-
sources have been invested in developing Medfly
(Ceratitis capitata [Wiedemann]) traps (e.g.,
Heath et al. 1995, 1996a, 1997; Epsky et al. 1995,
1999; Katsoyannos et al. 1999a, b), there have
been some interesting trap developments for
Anastrepha spp. (Heath et al. 1995, 1997; Thomas
et al. 2001), Rhagoletis spp. (Liburd et al. 1998;
Prokopy et al. 2000; Stelinski & Liburd 2001),
and Toxotrypana curvicauda Gerstaecker (Heath
et al. 1996b).


A common theme in the approach followed to
develop this new generation of traps has been
finding optimal combinations of visual and chem-
ical elements and the desire to find appropriate
substitutes for liquid-based traps such as the
McPhail (Epsky et al. 1995; Epsky & Heath
1997). Given the need to monitor female numbers
in adult fruit fly populations (Casafia-Giner et al.
2001), there has been renewed interest in evalu-
ating protein- and plant-based attractants. Al-
though some of the resulting female-targeted
traps have shown promising results (Heath et al.
1997; Epsky et al. 1999; Katsoyannos et al. 1999a,
b), they still have to overcome questions of cost







Florida Entomologist 87(1)


and manageability (e.g., susceptibility of traps to
dust or theft). Cost considerations are of para-
mount importance given the trend toward phas-
ing out large-scale governmental support for fruit
fly management, and the subsequent transfer to
growers of the responsibility for funding manage-
ment and eradication programs. The situation in
Latin America is particularly critical because
large quantities of fruit are still produced by sub-
sistence or resource-poor, small-scale growers
who cannot afford expensive monitoring and
management tools (Aluja & Liedo 1986; Aluja
1996, 1999). Furthermore, market niches for or-
ganically grown fruit are continuously expanding.
As a result, the need for biorational management
schemes has become more critical than ever.
In the case of flies in the genusAnastrepha, the
challenge for developing a substitute for the
McPhail trap is particularly difficult. This liquid-
based trap, developed in the early 1900s (McPhail
1937, 1939), is still widely used throughout Latin
America in spite of its inefficiency and high cost
(Aluja et al. 1989; Aluja 1999). However, it some-
times outperforms the recently developed dry-
based substitutes (e.g., Heath et al. 1995, 1997)
because adult flies are attracted to the humid en-
vironment in and around it, particularly during
the dry season. The biggest challenge in develop-
ing an effective substitute to the McPhail trap is
the occurrence of at least seven economically
important Anastrepha species (A. fraterculus
[Wiedemann], A. grandis [Macquart], A. ludens
[Loew], A. obliqua [Macquart], A. serpentina
[Wiedemann], A. striata [Schiner], and A. sus-
pensa [Loew]; Aluja 1994), and the evidence that
not all species respond with equal intensity to a
single bait (Aluja et al. 1989). As discussed by
Aluja (1999) and Aluja et al. (2001), the most ef-
fective Anastrepha attractant will likely end up
being a complex aromatic bouquet containing na-
tive host fruit and food-based odors, as well as
sexual pheromones. Formulating such a lure and
assembling a trap that is easy to handle and also
visually attractive to all the economically impor-
tant Anastrepha species will take time. But even
if such a trap design is ever produced, its cost may
be prohibitive especially given the low purchasing
power of the vast majority of fruit growers in
Latin America. Therefore, developing cheap, low-
tech baits and traps that are easily accessible to
local growers should remain a high priority.
An inexpensive alternative fruit fly bait was
studied by Hedstr6m (1988) in Costa Rica. This
author tested human urine (HU) in a guava or-
chard, and found that McPhail traps baited with
this naturally occurring compound (50% dilution
in water) captured 10 times more A. striata and
A. obliqua adults than traps baited with the com-
mercially available torula yeast. In a laboratory
study with A. ludens, A. obliqua, A. serpentina,
and A. striata adults, Pifiero et al. (2002) found


that responses toward human urine depended on
previous diet (e.g., protein-fed adults responded
weakly to baits), reproductive state (responses
were always greater in sexually mature individu-
als than sexually immature individuals), and sex
(female responses were greater than male re-
sponses, particularly for sexually mature individ-
uals) and, importantly, such responses varied
among species. More recently, Pifiero et al. (2003)
determined that McPhail traps baited with hu-
man urine captured a high proportion of sexually
immatureA. obliqua andA. serpentina females in
a commercial mango orchard (cultivar Manila).
Here, we report the results of a study aimed at
determining the attractiveness of three aqueous
dilutions of human urine in glass McPhail traps.
In an effort to make this study as useful as possi-
ble to subsistence or small-scale, resource poor
farmers, we tested this naturally occurring com-
pound in four types of environments (guava,
grapefruit, mango, and sapodilla orchards), com-
paring its effectiveness against the commercially
available hydrolyzed protein bait (Captor Plus)
and tap water.

MATERIALS AND METHODS

Study Sites

We worked in Cosautlan, Apazapan, and
Tuzamapan (central Veracruz, Mexico), in small,
unsprayed guava (Psidium guajava [L.]), grape-
fruit (Citrus paradise [Macfadyn]), mango
(Mangifera indica [L.]), and sapodilla (Manilkara
zapota [L.] P. Royen) orchards, during the period
of September 1995 to July 1997. Exact location of
study sites, orchard characteristics, and fly trap-
ping dates for each orchard are shown in Table 1.

Bait Treatments

Five bait treatments were evaluated in
McPhail traps: 50%, 25%, and 12.5% water dilu-
tions of human urine (HU50, HU25 and HU12.5,
respectively), hydrolyzed protein (Captor Plus,
Agroquimica Tridente S.A. de C.V. Mexico, D.F.; 10
ml of protein per 1 of water), and tap water (control
treatment). Each trap was baited with 200 ml of
the particular bait. The HU50, HU25, and HU12.5
dilutions were prepared by mixing 100, 50 and 25
ml of human urine in 100, 150 and 175 ml of tap
water, respectively. To avoid modifying bait pH
values, we did not use Borax as a preservative.
The human urine stemmed from a single
source (JP) because more donors could not make a
commitment for the entire study period (1995-
1997). The donor was a healthy 26-year old male
who followed a strict diet free of coffee, alcohol, vi-
tamin supplements, food condiments such as hot
chilies, and who did not smoke. Food ingested in-
cluded vegetables, fruits, rice, meat, chicken, and


March 2004








Aluja & Pifiero: Low-tech Fruit Fly Attractant


In

(0



10
II
01] 1


a

2
0
bfj
M
Ci




2
a










C)
0
'EI
0

C)





0
0
0
(-)











0
0cl
o



ca

















b
C
0



CO~







0
a,














0
z
z=










z








a=










o


C11




04.0
-i




Cd,
So




o S




-? 0 c<

>






I?
SBS








Zs







cc
OS
01













CQ]



hi






o
hi-



as
oD
*I


C1 0 0
C11 C11 C11
(M X X


N
o
0

N
d
c-fl


occasionally fish. This diet was started 15 days
prior to the initiation of the first set of experi-
ments and maintained throughout the study pe-
riod. The donating individual underwent a
medical checkup to determine possible kidney
damage or any metabolic disorder. His urine was
chemically characterized by a local laboratory
(Laboratorio Hernandez-Blazquez, Coatepec, Ve-
racruz, Mexico) and the results (exact informa-
tion in Pifiero et al. 2002) indicated that urea and
ammonia contents fell within the normal ranges
for a healthy individual (normal ranges: 20-30 g/
100 ml for urea and 0.5-0.9 g/100 ml for ammonia;
Bell et al. 1961; Anonymous 1981). Even though
we acknowledge that there can be variability in
the chemical composition of human urine due to
factors such as age and the quality and quantity
of food ingested (Bell et al. 1961; Langley 1971;
Anonymous 1981), we believe that the two compo-
nents critical for the study (urea and ammonia)
varied relatively little throughout the study be-
cause the human urine used was always provided
by a single, healthy individual who also followed a
strict diet. Furthermore, we note that variability
in bait composition is a common problem faced by
researchers even when buying commercially pro-
duced protein-based baits. Hence, we believe that
all appropriate procedures were followed.

Trap Placement and Servicing Procedure

Five fruit trees of similar size and fruit load
were selected within each of the four orchard
types, except in the sapodilla orchard, where 20
trees were used (see below). Tree canopy size
ranged between 4-6 m for grapefruit, guava and
sapodilla and 10-12 m for mango. Five glass
McPhail traps, each baited with one of the five dif-
ferent bait treatments, were placed at equidistant
locations (over 2 m apart in all cases and up to 8
m in some) in the interior portion of each tree can-
opy. However, in the sapodilla orchard, only one
trap was placed per tree because branches were
too thin and, hence, trees would have not sup-
ported all five traps. Every three days traps were
inspected, cleaned, and re-baited. This procedure
was carried out 20 times in each one of the or-
chards. Trap positions were systematically ro-
tated each servicing day. Even though we
acknowledge that placing 5 traps in the same tree
may have caused interaction between the baits,
we believe that given the relatively large size of
the tree canopies in which traps were hung, and
the fact that trap positions within the canopy
were systematically rotated every three days,
such a possible effect was most likely negligible.
Besides, as our goal was to test human urine in
low-tech, resource poor scenarios, orchards were
small and therefore the number of trees available
to us, with the exception of the sapodilla orchard,
was not enough to test each bait in different trees.


*3
1~ d

ac
i- ifi'3

3 '^
"- 1


a1 ^
OS S-$


C


N


"k



OC3







Florida Entomologist 87(1)


Species and sex were determined for all adults
captured. All females of the predominant fly spe-
cies captured by traps in each orchard were exam-
ined under a dissecting stereomicroscope to
determine the presence or absence of developed
ovaries (a measure of sexual maturity), by the
methods of Martinez et al. (1995). Also, in each or-
chard, ten pH readings were taken at different in-
tervals with a portable pH meter (Cole-Parmer
Model 59000-20, Chicago, IL, USA) for each one of
the bait treatments.

Statistical Analyses
Since McPhail traps commonly capture adults
of up to 12Anastrepha species, statistical analyses
were conducted only on the predominant species
in each orchard (one or two species are normally
abundant; Aluja et al. 1996). One-way analyses of
variance (ANOVA) were carried out on fly/trap/
day (FTD) values, pooling males and females for
each fly species. FTD values represent the total
number of adults captured per trap per day (Cele-
donio-Hurtado et al. 1995). Data were square-root
transformed (X + 0.5) to homogenize variances but
in the figures we present untransformed mean
(SE) values. In all cases, ANOVAs were followed
by Fisher-protected LSD separations of treatment
means. For the most representative fly species in
each orchard type, linear regression analyses
were conducted to further determine the degree of
relationship between the three concentrations of
human urine evaluated and attractiveness to
adult flies. Comparisons of the numbers of females
versus males of a particular species and bait treat-
ment were performed with nonparametric Mann-
Whitney tests. All analyses were carried out at the
0.05% level of significance, with the software Sta-
tistica (StatSoft 1999).

RESULTS
Bait pH Values
Since there were no differences in pH values
for similar bait treatments among orchards (F =
0.86, df = 3, 178, P > 0.05), we report global pH
values for each bait (i.e., pooled over all orchards).
The ANOVA indicated that there were differences
in the pH values among the bait treatments (F =
16.71, df= 4, 178,P < 0.0001). The mean (SE) pH
value of water (6.7 0.15) was significantly lower
than the mean (SE) pH values of the three hu-
man urine concentrations (among which there
were no significant differences; 7.58 + 0.21, 7.87 +
0.27, and 8.17 + 0.26, for HU12.5, HU25, and
HU50, respectively), and was significantly lower
than that of hydrolyzed protein (7.25 0.23).

Guava Orchard

Altogether, 105 adults of four Anastrepha spe-
cies were captured. The proportion of each species


in the sample was as follows: A. fraterculus
(84.8%), A. ludens (9.5%), A. striata (3.8%) and
A. obliqua (1.9%). Consequently, results reported
next refer only toA. fraterculus. Traps baited with
human urine (all three concentrations) and hy-
drolyzed protein captured similar numbers of
adults of this species and more adult flies than
water-baited traps (F = 5.05, df = 4, 295, P <
0.001) (Fig. 1). A regression analysis confirmed
the lack of association between the concentra-
tions of human urine evaluated and the number
of adultA. fraterculus captured by traps (F = 0.48,
P = 0.50, R2 = 0.04). Notably, 93% and 96%, re-
spectively, of the adults captured by traps baited
with either HU25 or HU50 were females (Table
2A).

Grapefruit Orchard

A total of 101 adults of fourAnastrepha species
were captured (A. ludens 71.3%, A. obliqua
25.7%, A. fraterculus 2%, and A. distinct 1%).
Hence, what follows refers only to A. ludens be-
cause A. obliqua is not a pest of citrus. Traps
baited with hydrolyzed protein captured the
greatest number of adults of this species (F =
29.33, df = 4, 295, P < 0.001). In turn, human
urine-baited traps captured statistically similar
numbers of adults, and captured more flies than
water-baited traps (Fig. 2). A regression analysis
further corroborated that captures were indepen-
dent of the concentration of human urine evalu-
ated (F = 0.58, P = 0.46, R2 = 0.04).
Hydrolyzed protein attracted significantly
more A. ludens females than males (Table 2B).
Furthermore, numerically more sexually mature
than immature A. ludens females were captured
by traps baited with hydrolyzed protein.


Psidium guajava (1995)


HU12.5 HU25 HU50 Protein Water
Bait treatment
Fig. 1. Mean (SE) number (fly/trap/day) of adult A.
fraterculus captured by McPhail traps containing three
dilutions of human urine (HU) (12.5%, 25%, and 50%),
hydrolyzed protein, or water (control). Study was con-
ducted in 1995 in Cosautlan, Veracruz, M6xico, in an
unsprayed non-commercial guava orchard. Means with
different letters are significantly different (Fisher LSD
test, a = 0.05).


March 2004







Aluja & Pifiero: Low-tech Fruit Fly Attractant


TABLE 2. PROPORTIONS OF ANASTREPHA SPP. MALES AND FEMALES CAPTURED BY MCPHAIL TRAPS BAITED WITH EI-
THER THREE AQUEOUS DILUTIONS OF HUMAN URINE (HU) (12.5, 25, AND 50%) OR HYDROLYZED PROTEIN IN
GUAVA, GRAPEFRUIT, MANGO AND SAPODILLA ORCHARDS.


Species


Treatment


A) Psidium guajava
A. fraterculus


B) Citrus paradisi
A. ludens
C) Mangifera indica
A. obliqua
A. serpentina




D) Manilkara zapota
A. serpentina



A. obliqua


N % Females % Males


HU12.5
HU25
HU50
Protein


Protein


Protein
HU12.5
HU25
HU50
Protein


HU12.5
HU25
HU50
Protein
HU12.5
HU25
HU50
Protein


P value'


0.52
0.03
0.03
0.10


'Comparisons of the numbers of males and females of a particular species were performed through Mann Whitney U tests.


Mango Orchard

In this orchar
captured by traps
most abundant s
ture), followed b


Fig. 2. Mean (S
ludens captured by
tions of human uri


(0.9%), and A. alveata (Stone) (0.9%). Results re-
fer only to the first two species (we chose to in-
d, 226 Anastrepha adults were clude A. obliqua as this species is the common
.Anastrepha serpentina was the pest of mangos in the region). Traps baited with
species (87.1% of the total cap- hydrolyzed protein captured more A. obliqua and
y A. obliqua (11.1%), A. ludens A. serpentina adults than traps baited with any
other bait treatment (F = 3.94, df = 4, 320, P =
0.004; F = 7.88, df = 4, 320, P < 0.001, respec-
Citrus paradisi (1995) tively). Furthermore, there was no relationship
between the number of adult A. obliqua and
AA A. serpentina and the concentrations of human
urine tested (F = 0.00, P = 1.00, R2 = 0.00;F = 0.01,
P = 0.96, R2 = 0.00, respectively) (Fig. 3).
The three human urine-based treatments, as
well as protein, attracted similar numbers of
A. serpentina males and females (Table 2C). In-
terestingly, human urine-baited traps captured
B numerically more sexually immature than ma-
2 ture A. serpentina females (62.5% vs. 37.5%,
HU25 HU50 Protein Water 54.6% vs. 45.4%, and 69.2% vs. 30.8% HU12.5,
Bait treatment HU25, and HU50, respectively) whereas traps
E) number (fly/trap/day) of adult A. baited with hydrolyzed protein captured a greater
McPhail traps containing three dilu- proportion of sexually mature (65.6%) than im-
ne (HU) (12.5%, 25%, and 50%), hy- mature (34.4%) females.


drolyzed protein, or water (control). Study was
conducted in 1995 in Tuzamapan, Veracruz, M6xico, in a
mixed, unsprayed grapefruit/coffee orchard. Means
with different letters are significantly different (Fisher
LSD test, a = 0.05).


Sapodilla Orchard

Overall, 876Anastrepha adults were captured.
Of these, 80.4% were A. serpentina, 18.3% were







Florida Entomologist 87(1)


1.2-
1-

M 0.8

0.6-

EL 0.4-


Mangifera indica (1996)

SA. serpentina
- A. obliqua


0.2 6B B B
o ^- 7- .4 - -- C
HU12.5 HU25 HU50 Protein Water
Bait treatment
Fig. 3. Mean (SE) number (fly/trap/day) of adult
Anastrepha serpentina and A. obliqua captured by
McPhail traps containing three dilutions of human
urine (HU) (12.5%, 25%, and 50%), hydrolyzed protein,
or water (control). Study was conducted in 1996 in
Apazapan, Veracruz, M6xico, in an unsprayed, commer-
cial mango orchard (Manila cultivar). Means with dif-
ferent letters are significantly different (Fisher LSD
test, a = 0.05).



A. obliqua and 1.3% were A. ludens. Data shown
below refer only to the first two species. Traps
baited with HU50 surpassed all other treatments
in capturing A. serpentina and A. obliqua adults
(F = 10.19, df = 4, 315, P < 0.001 and F = 6.11, df
= 4, 315, P < 0.001, respectively). There were no
significant differences among the other baits (i.e.,
hydrolyzed protein, HU25 and HU12.5), but each
of these captured more flies than traps with water
(Fig. 4).
Data summarized in Table 2D indicates that
all bait treatments attracted similar numbers of
A. serpentina males and females. In the case of
A. obliqua, only protein-baited traps captured
more females than males. HU25 was the only


2.5

2

- 1.5

ot.s
2 1

0.5

0


Manilkara zapota (1997)


SA. serpentina
- A. obliqua


FB /

b. . .


a
a --- b
*- - Cc


HU12.5 HU25 HU50 Protein Water
Bait treatment


Fig. 4. Mean (SE) number (fly/trap/day) of adult
Anastrepha serpentina and A. obliqua captured by
McPhail traps containing three dilutions of human
urine (HU) (12.5%, 25%, and 50%), hydrolyzed protein,
or water (control). Study was conducted in 1997 in
Apazapan, Veracruz, M6xico, in an unsprayed, commer-
cial sapodilla orchard. Means with different letters are
significantly different (Fisher LSD test, a = 0.05).


treatment attracting more sexually immature
(75.5%) than mature (24.5%) A. serpentina fe-
males. HU12.5, HU50, and hydrolyzed protein at-
tracted similar numbers of immature and mature
A. serpentina females (58.1 vs. 41.9%, 56.2 vs.
43.8%, and 51.8 vs. 48.2% of sexually immature
vs. mature females, respectively).

DISCUSSION

We found that human urine-baited traps were,
in certain cases (i.e., guava and sapodilla or-
chards), similar or superior to protein-baited
traps with respect to the total number of adult
A. fraterculus, A. obliqua and A. serpentina cap-
tured. In other cases (i.e., mango and grapefruit
orchards), traps baited with human urine cap-
tured fewer adults than traps baited with hydro-
lyzed protein. We also found that with one
exception sapodillaa orchard), human urine con-
centrations tested did not vary significantly in
their attractiveness to flies. The latter has impor-
tant practical implications as a farmer could fill
more traps with a small amount of human urine.
Our results partially confirm those obtained by
Hedstr6m (1988). That is, we also found that hu-
man urine is attractive toAnastrepha adults, but
not to the extent this author did. Some possible
explanations for the latter are: (1) differences in
the nature of the commercially available baits
used by Hedstr6m (torula yeast) and us (hydro-
lyzed corn protein), (2) possible effect of bait aging
since Hedstr6m did not replace the urine con-
tained in traps throughout his study, (3) the eco-
logical characteristics of the study orchard and
the fact thatA. striata was the predominant spe-
cies in Hedstr6m's study (a species not evaluated
here), (4) differences in population size, and (5),
probable differences in attractiveness of the hu-
man urine used in both studies.
The favorable response to human urine shown
by A. fraterculus adults in the guava orchard, and
in some instances (e.g., sapodilla orchard) by
A. obliqua and A. serpentina, suggests that indi-
viduals of these Anastrepha species could be re-
sponding to nitrogenous compounds such as
ammonia present in human urine (Pifiero et al.
2003). Given that ammonia plays an important
role in attracting fruit flies (e.g., Morton & Bate-
man 1981; Bateman & Morton 1981; Mazor et al.
1987; Prokopy et al. 1992; Epksy et al. 1995; Heath
et al. 1995), and that some ammonium salts (e.g.,
ammonium acetate or carbonate) and amines (e.g.,
methylamine, putrescine) are also known to at-
tract adults ofA. suspense (e.g., Burditt et al. 1983;
Thomas et al. 2001), A. striata, A. obliqua (e.g.,
Hedstr6m & Jim6nez 1988), and A. ludens (e.g.,
Robacker 1995; Robacker et al. 1996; 1997; Heath
et al. 1997; Thomas et al. 2001), a study aimed at
identifying the attractive elements of human urine
toAnastrepha spp. is, in our opinion, warranted.


March 2004







Aluja & Pifiero: Low-tech Fruit Fly Attractant


Bateman & Morton (1981) and Mazor et al.
(1987) clearly demonstrated a close relationship
between ammonia concentration and attraction
of female C. capitata to protein-based baits. In our
case, however, we did not find such an association
as all three human urine dilutions were similarly
attractive to adultA. fraterculus,A. ludens,A. ser-
pentina and A. obliqua in the guava, grapefruit,
and mango orchards. The notable exception was
the sapodilla orchard, in which the less-diluted
human urine (HU 50%) was significantly more at-
tractive to A. serpentina and A. obliqua than any
other human urine dilution. Robacker (1995)
found results similar to current data. Liquid baits
with different concentrations of ammonia and
amines were similar in attractiveness over a
range of over 10x, but became less attractive at
very high concentrations. The latter can be ex-
plained by the fact that pH regulates emission of
ammonia, amines, acids, and other ionizable com-
pounds. At pH > 9, emission of ammonia in-
creases greatly and can become repellent,
depending on the concentration in the bait. Bate-
man & Morton (1981) and Mazor et al. (1987),
also determined that adult females responded
more strongly to baits with pH values between 7
and 8.5, a result later confirmed by Robacker et
al. (1993), Robacker & Flath (1995) and Robacker
& Bartelt (1997). We note, that such pH values co-
incided with the pH values found for the three hu-
man urine concentrations used in our study
(average pH values of approximately 8 in all three
cases).
In guava trees, HU25 and HU50 attracted sig-
nificantly more A. fraterculus females than males
and, in the sapodilla orchard, the same baits also
attracted more females than males of bothA. ser-
pentina andA. obliqua. This agrees with previous
results found for A. serpentina in a mango or-
chard (Pifiero et al. 2003), and in a laboratory set-
ting (Pifiero et al. 2002). Given that Pifiero et al.
(2002) controlled the proportion of females and
males in the experimental population, we are con-
fident that our results in the field do not reflect a
situation in which more females than males were
present and as a consequence, more females were
captured. Furthermore, in our study HU25 at-
tracted a large proportion of sexually immature
A. serpentina females when tested in the sapo-
dilla orchard.
Interestingly, we found important differences
in the response to human urine byA. obliqua and
A. serpentina adults according to the type of or-
chard and other conditions prevalent where trap-
ping was performed. For example, in the mango
orchard (1996), traps baited with hydrolyzed pro-
tein captured the highest numbers of both A. ser-
pentina and A. obliqua adults. In contrast, in the
sapodilla orchard (1997) traps baited with HU50
captured more adults of both species than pro-
tein-baited traps. Since the two orchards are ad-


jacent to each other, we believe that such
differences might be due to variations in the type,
abundance, and quality (i.e., nutritional value) of
host fruits, both within and outside the orchards
(e.g., presence of wild hosts). For instance, at the
time the study was carried out in the mango or-
chard, there was very little fruit left on trees, and
there was no fruit available in the contiguous sa-
podilla orchard. Thus, the higher capture of
A. serpentina adults in protein-baited traps
(when compared to urine-baited traps) may be ex-
plained in terms of protein hunger, since sapo-
dilla fruit is an important protein source for
A. serpentina adults (Jacome et al. 1999). In con-
trast, when trapping took place in the sapodilla
orchard (in 1997), fruit was abundant and traps
baited with hydrolyzed protein were not as at-
tractive to adult A. serpentina as urine-baited
traps. This clearly illustrates that the effective-
ness of an attractant depends on the prevailing
ecological conditions in a given orchard (Robacker
1992; Celedonio-Hurtado et al. 1995; Heath et al.
1997; Epsky et al. 1999), as well as on adult phys-
iological state (Robacker 1991; Robacker et al.
1996; Rull & Prokopy 2000; Pifiero et al. 2002).
The latter aspects, in addition to others such as
annual variations in adult fly populations in fruit
orchards (Aluja et al. 1996), must be considered in
the design of fruit fly monitoring systems and un-
derscores the challenge faced by those trying to
develop a replacement for the McPhail trap for
use in orchards in which flies in the genus Anas-
trepha are predominant.
As a final point, we would like to address the
economic benefit of using cost-free human urine.
In Mexico, the value of a liter of a commercially
available protein-based bait (e.g., Captor Plus@)
is approximately USD $6.00 (10.9/1 US dollars/
Mexican peso). Considering that each trap is
baited with 10-40 ml of bait diluted per liter of
water, the cost of the bait per trap is USD $0.06-
0.20. The latter multiplied by 52 (weeks in a year)
raises the cost of the bait per trap per year to ca.
USD $3.10-10.40 (average of $6.75). Considering
that in Mexico a glass McPhail trap costs USD
$4.00, and the placement of 10-20 traps in an or-
chard (USD $40.00-80.00), the total cost of trap
placement and servicing per year would range be-
tween USD $46.75 and 86.75 or ca $510.00-
945.00 Mexican pesos (not considering salaries).
In the case of commercially available Anastrepha
spp. synthetic lures (multi-component lure) and
yellow plastic traps the cost in the US (not consid-
ering handling and shipping charges to Mexico)
ranges between USD $3.30-4.50 and 8.50 per dis-
penser (lure) and trap, respectively (Great Lakes
IMP, Vestaburg, MI; IPM Technologies, Portland,
OR). All the latter would be unmanageable for a
subsistence farmer (one that uses all his fruit for
self-consumption) and hard to handle for a small-
scale producer selling fruit locally. Therefore the











alternative of using a cost-free bait like human
urine becomes highly attractive.
In conclusion, we believe that human urine
represents a low-tech alternative Anastrepha bait
for subsistence or low income, small-scale fruit
growers in rural areas in Latin America who can-
not afford costly inputs such as commercial baits
and traps. Human urine was capable of attracting
adult flies of various species ofAnastrepha and, at
least in two orchards (guava and sapodilla), it per-
formed as well as, or even better, than a commer-
cially available protein bait. Even though in some
instances human urine did not attract as many
flies as hydrolyzed protein, qualitatively it proved
to be equal or superior to this bait (i.e., it usually
attracts more females than males and a large pro-
portion of sexually immature females). A poor
farmer would have access to a cost-free trap by
simply reusing a two-liter plastic bottle of a soft
drink or serum flask (see Salles 1996) and filling it
with human urine diluted in water. There will
sometimes be a trade off between cost and trap
quality/efficiency, but for growers accustomed to
regularly loosing between 60 to 100% of their har-
vest because of fruit fly damage, the benefit of a
cheap, low-technology and relatively efficient trap
would be very valuable. If such growers could be
alerted in a timely fashion of an increasing influx
of flies into their orchards or backyard gardens
from surrounding native vegetation, they could
protect their fruit by, for example, bagging it
(Fang 1989). Further, if the bait is particularly at-
tractive to sexually immature females, even a low
capture rate could reduce fruit damage to the ex-
tent of allowing the production of a certain pro-
portion of clean fruit (i.e., free of larvae) for local
markets. One should keep in mind that the prin-
cipal objective of peasant farmers in Latin Amer-
ica is not to produce fruit for export markets but
for in-house consumption or local markets that do
not demand blemish-free products.

ACKNOWLEDGMENTS

We thank Alejandro Vazquez, Isabel Jacome and Oc-
taviano Diaz for technical support, and Juan Velandia
(Cosautlan, Veracruz), Leticia Lagunes (Apazapan, Ver-
acruz) and Alicia Falc6n (Tuzamapan, Veracruz), for al-
lowing us to conduct our studies in their orchards. We
express our gratitude to Francisco Diaz-Fleischer, Di-
ana P6rez-Staples, and Juan Rull-Gabayet (Instituto de
Ecologia, A.C.), as well as Ben Normark, Sara Hoff-
mann, Lisa Provencher, Matt Gruwell, Barry Sello (Uni-
versity of Massachusetts), and two anonymous referees,
for reviewing preliminary versions of this manuscript.
We also acknowledge Dan Bennack (independent con-
sultant) for helpful suggestions on content, Mildred Ro-
driguez (Instituto de Ecologia, A.C.) for technical
assistance during manuscript preparation and Jesis
Reyes Flores (former director of the Campana Nacional
Contra Moscas de la Fruta, Mexico) for encouraging us
to undertake this study and Jorge Hernandez Baeza
(Director General de Sanidad Vegetal, Mexico) to pub-


March 2004


lish it. This study was financed by the Mexican Cam-
paia Nacional Contra Moscas de la Fruta, Direcci6n
General de Sanidad Vegetal, Secretaria de Agricultura,
Ganaderia y Desarrollo Rural, Pesca y Alimentaci6n
(Convenio INECOL-DGSV-SAGARPA-IICA). This arti-
cle reports the results of research only. Mention of a pro-
prietary product does not constitute an endorsement or
a recommendation by the Instituto de Ecologia, A.C.


REFERENCES CITED

ALUJA, M. 1994. Bionomics and Management of Anas-
trepha. Annu. Rev. Entomol. 39: 151-174.
ALUJA, M. 1996. Future trends in fruit fly management,
pp. 309-320. In B. A McPheron and G. J. Steck (eds.),
Economic Fruit Flies: a World Assessment of their
Biology and Management. St. Lucie Press, DelRay
Beach, Florida.
ALUJA, M. 1999. Fruit fly (Diptera: Tephritidae) re-
search in Latin America: myths, realities and
dreams. An. Soc. Entomol. Brasil 28: 565-594.
ALUJA, M., AND P. LIEDO. 1986. Future perspectives on
integrated management of fruit flies in Mexico, pp.
12-48. In M. Mangel J. R. Carey and R. E. Plant
(eds.), Pest Control: Operations and Systems Analy-
sis in Fruit Fly Management. Springer, Berlin.
ALUJA, M., M. CABRERA, J. GUILLEN, H. CELEDONIO,
AND F. AYORA. 1989. Behaviour ofAnastrepha ludens,
A. obliqua andA. serpentina (Diptera: Tephritidae) on
a wild mango tree (Mangifera indica) harbouring
three McPhail traps. Insect Sci. Appl. 10: 309-318.
ALUJA, M., H. CELEDONIO-HURTADO, P. LIEDO, M. CA-
BRERA, F. CASTILLO, J. GUILLEN, AND E. Rios. 1996.
Seasonal population fluctuations and ecological im-
plications for management of Anastrepha fruit flies
(Diptera: Tephritidae) in commercial mango orchards
in Southern Mexico. J. Econ. Entomol. 89: 654-667.
ALUJA, M., F. DIAZ-FLEISCHER, D. R. PAPAJ, G. LAGUNES,
AND J. SIVINSKI. 2001. Effects of age, diet, female
density, and the host resource on egg load in Anas-
trepha ludens and Anastrepha obliqua (Diptera: Te-
phritidae). J. Insect Physiol. 47: 975-988.
ANONYMOUS. 1981. GEIGY Scientific Tables. CIBA-
GEIGY Ltd. Basle, Switzerland.Cornelius Lenter, ed.
BATEMAN, M. A., AND T. C. MORTON. 1981. The impor-
tance of ammonia in proteinaceous attractants for
fruit flies (Diptera: Tephritidae). Australian J. Agric.
Res. 32: 883-903.
BELL, G. H., J. N. DAVIDSON, AND H. SCARBOROUGH.
1961. Textbook of Physiology and Biochemistry. The
Williams and Wilkins Company.
BURDITT, A. K., T. P. MCGOVERN JR., AND P. D. GREANY.
1983. Anastrepha suspense (Loew) (Diptera: Tephri-
tidae) response to chemical attractants in the field.
Proceedings of the Florida State Hort. Soc. 96:222-226.
CASANA-GINER V., A. GANDIA-BALAGUER, M. M.
HERNANDEZ-ALAM)S, C. MENGOD-PUERTA, A. GAR-
RIDO-VIVAS, J. PRIMO-MILLO, AND E. PRIMO-YiUFERA.
2001. Attractiveness of 71 compounds and mixtures
to wild Ceratitis capitata (Diptera: Tephritidae) in
field trials. J. Econ. Entomol. 94: 898-904.
CELEDONIO-HURTADO, H., M. ALUJA, AND P. LIEDO.
1995. Adult population fluctuations of Anastrepha
species (Diptera: Tephritidae) in tropical habitats of
Chiapas, Mexico. Environ. Entomol. 24: 861-869.
EPSKY, N. D., AND R. R. HEATH. 1997. Exploiting the in-
teractions of chemical and visual cues in behavioral


Florida Entomologist 87(1)







Aluja & Pifiero: Low-tech Fruit Fly Attractant


control measures for pest tephritid fruit flies. Flor-
ida Entomol. 81: 273-282.
EPSKY, N. D., R. R. HEATH, A. GUZMAN, AND W. L.
MEYER 1995. Visual cue and chemical cue interactions
in a dry trap with food-based synthetic attractant for
Ceratitis capitata andAnastrepha ludens (Diptera: Te-
phritidae). Environ. Entomol. 24: 1387-1395.
EPSKY, N. D., J. HENDRICHS, B. I. KATSOYANNOS, L. A.
VASQUEZ, J. P. Ros, A. ZUMREOGLU, R. PEREIRA, A.
BAKRI, S. I. SEEWOORUTHUN, AND R. R. HEATH.
1999. Field evaluation of female-targeted trapping
systems for Ceratitis capitata (Diptera: Tephritidae)
in seven countries. J. Econ. Entomol. 92: 156-164.
FANG, M. N. 1989. Studies on using different bagging
materials for controlling melon fly on bitter gourd
and sponge gourd. Bulletin of the Taichung District
Agriculture Improvement Station 25: 3-12.
HEATH, R. R., N. D. EPSKY, A. GUZMAN, B. D. DUEBEN,
A. MANUKIAN, AND W. L. MEYER 1995. Development
of a dry plastic insect trap with food-based synthetic
attractant for the Mediterranean and Mexican fruit
flies (Diptera: Tephritidae). J. Econ. Entomol. 88:
1307-1315.
HEATH, R. R., N. D. EPSKY, B. D. DUEBEN, AND W. L.
MEYER 1996a. Systems to monitor and suppress
Mediterranean fruit fly (Diptera: Tephritidae) popu-
lations. Florida Entomol. 79: 144-153.
HEATH, R. R., N. D. EPSKY, A. JIMENEZ, B. D. DUEBEN,
P. J. LANDOLT, W. L. MEYER, M. ALUJA, J. RIZZO,
M. CAMINO, F. JERONIMO, AND R. M. BARANOWSKI.
1996b. Improved pheromone-based trapping sys-
tems to monitor Toxotrypana curvicauda (Diptera:
Tephritidae). Florida Entomol. 79: 37-48.
HEATH, R. R., N. D. EPSKY, B. D. DUEBEN, J. RIZZO, AND
F. JERONIMO. 1997. Adding methyl-substituted am-
monia derivatives to a food-based synthetic attrac-
tant on capture of the Mediterranean and Mexican
fruit flies (Diptera: Tephritidae). J. Econ. Entomol.
90: 1584-1589.
HEDSTROM, I. 1988. Una sustancia natural en la cap-
tura de moscas de la fruta del g6nero Anastrepha
Schiner (Diptera: Tephritidae). Rev. Biol. Trop. 36:
269-272.
HEDSTROM, I., AND J. JIMENEZ. 1988. Evaluaci6n de
campo de sustancias atrayentes en la capture de
Anastrepha spp. (Diptera: Tephritidae), plaga de fru-
tales en Am6rica Tropical. II. Acetato de amonio y
torula boratada. Rev. Brasileira Entomol. 32: 319-322.
JACOME, I., M. ALUJA, AND P. LIEDO. 1999. Impact of
adult diet on demographic and population parameters
on the tropical fruit fly, Anastrepha serpentina
(Diptera: Tephritidae). Bull. Entomol. Res. 89: 165-175.
KATSOYANNOS, B. I., R. R. HEATH, N. T. PAPADOPOULOS,
N. D. EPSKY, AND J. HENDRICHS. 1999a. Field evalu-
ation of Mediterranean fruit fly (Diptera: Tephri-
tidae) female selective attractants for use in
monitoring programs. J. Econ. Entomol. 92: 583-589.
KATSOYANNOS, B. I., N. T. PAPADOPOULOS, R. R. HEATH,
J. HENDRICHS, AND N. A. KOULOUSSIS. 1999b. Eval-
uation of synthetic food-based attractants for female
Mediterranean fruit flies (Dip., Tephritidae) in
McPhail-type traps. J. Appl. Entomol. 123: 607-612.
LANGLEY, L. L. 1971. Physiology of Man. Van Nostrand
Reinhold Company, New York.
LIBURD, O. E., S. R. ALM, R. A. CASAGRANDE, AND S. PO-
LAVARAPU. 1998. Effect of trap color, bait, shape, and
orientation in attraction of blueberry maggot (Diptera:
Tephritidae) flies. J. Econ. Entomol. 91: 243-249.


MARTINEZ, I., V. HERNANDEZ-ORTIZ, AND R. LUNA. 1995.
Desarrollo y maduraci6n sexual en Anastrepha ser-
pentina (Wiedemann) (Diptera: Tephritidae). Acta
Zool. Mexicana (nueva series) 65: 75-88.
MAZOR, M., S. GOTHILF, AND R. GALUN. 1987. The role of
ammonia in the attraction of females of the Mediter-
ranean fruit fly to protein hydrolysate baits. Ento-
mol. Exp. Appl. 43: 25-29.
MCPHAIL, M. 1937. Relation of time of day, temperature,
and evaporation to attractiveness of fermenting solu-
tion to Mexican fruit fly. J. Econ. Entomol. 30: 793-799.
MCPHAIL, M. 1939. Protein lures for fruit flies. J. Econ.
Entomol. 32: 758-761.
MORTON, T. C., AND M. A. BATEMAN. 1981. Chemical
studies on proteinaceous attractants for fruit flies,
including the identification of volatile constituents.
Australian J. Agric. Res. 32: 905-916.
PINERO, J., M. ALUJA, M. EQUIHUA, AND M. M. OJEDA.
2002. Feeding history, age and sex influence the re-
sponse of four economically important Anastrepha
species (Diptera: Tephritidae) to human urine and
hydrolyzed protein. Folia Entomol. Mexicana 41:
283-298.
PINERO, J., M. ALUJA, A. VAZQUEZ, M. EQUIHUA, AND J.
VARON. 2003. Human urine and chicken feces as
fruit fly (Diptera: Tephritidae) attractants for re-
source-poor growers. J. Econ. Entomol. 96: 334-340.
PROKOPY, R. J., D. R. PAPAJ, J. HENDRICHS, AND T. T. Y.
WONG. 1992. Behavioral responses of Ceratitis capi-
tata flies to bait spray droplets and natural food. En-
tomol. Exp. Appl. 64: 247-257.
PROKOPY, R. J., S. E. WRIGHT, J. L. BLACK, X. P. HU,
AND M. R. MCGUIRE. 2000. Attracticidal spheres for
controlling apple maggot flies: commercial-orchard
trials. Entomol. Exp. Appl. 97: 293-299.
ROBACKER, D. C. 1991. Specific hunger in Anastrepha
ludens (Diptera: Tephritidae): Effects on attractive-
ness of proteinaceous and fruit-derived lures. Envi-
ron. Entomol. 20: 1680-1686.
ROBACKER, D. C. 1992. Effects of shape and size of col-
ored traps on attractiveness to irradiated, laboratory-
strain Mexican fruit flies (Diptera: Tephritidae). Flor-
ida Entomol. 75: 230-241.
ROBACKER, D. C. 1995. Attractiveness of a mixture of
ammonia, methylamine and putrescine to Mexican
fruit flies (Diptera: Tephritidae) in a citrus orchard.
Florida Entomol. 78: 571-578.
ROBACKER, D. C., AND R. J. BARTELT. 1997. Chemicals
attractive to Mexican fruit fly from Klebsiella pneu-
moniae, and Citrobacter freundii cultures sampled
by solid-phase microextraction. J. Chem. Ecol. 23:
2897-2915.
ROBACKER, D. C., AND R. A. FLATH. 1995. Attractants
from Staphylococcus aureus cultures for Mexican
fruit fly,Anastrepha ludens. J. Chem. Ecol. 21: 1861-
1874.
ROBACKER, D. C., W. C. WARFIELD, AND R. F. ALBACH.
1993. Partial characterization and HPLC isolation of
bacteria-produced attractants for the Mexican fruit
fly,Anastrepha ludens. J. Chem. Ecol. 19: 543-557.
ROBACKER, D. C., D. S. MORENO, AND A. B. DEMILO.
1996. Attractiveness to Mexican fruit flies of combi-
nations of acetic acid with ammonium/amino attrac-
tants with emphasis on effects of hunger. J. Chem.
Ecol. 22: 499-511.
ROBACKER, D. C., A. B. DEMILO, AND D. J. VOADEN.
1997. Mexican fruit fly attractants: Effects of 1-pyr-
roline and other amines on attractiveness of a mix-







50 Florida Ento



ture of ammonia, methylamine, and putrescine. J.
Chem. Ecol. 23: 1263-1280.
RULL, J., AND R. J. PROKOPY. 2000. Effect of food on at-
traction of apple maggot flies, Rhagoletis pomonella
(Walsh), of different physiological states, to odor-
baited traps. Bull. Entomol. Res. 90: 77-88.
SALLES, L. A. 1996. Inexpensive traps made with dis-
posable plastic containers: case of serum hospital
flask, p. 54. In Proceedings of 2nd. meeting of the
Working Group on Fruit Flies of the Western Hemi-
sphere, 3-8 November 1996, Vifia del Mar, Chile.


Im


ologist 87(1) March 2004



STATSOFT, INC. 1999. Statistica for Windows. Computer
program manual. Tulsa, OK.
STELINSKI, L. L., AND O. E. LIBURD. 2001. Evaluation of
various deployment strategies of Imidacloprid-
treated spheres in highbush blueberries for control
of Rhagoletis mendax (Diptera: Tephritidae). J.
Econ. Entomol. 94: 905-910.
THOMAS, D. B., T. C. HOLLER, R. R. HEATH, E. J. SALI-
NAS, AND A. L. MOSES. 2001. Trap-lure combinations
for surveillance of Anastrepha fruit flies (Diptera:
Tephritidae). Florida Entomol. 84: 344-351.







Deyrup & Cover: Leptothorax of the Southeast


A NEW SPECIES OF THE ANT GENUS LEPTOTHORAX FROM FLORIDA,
WITH A KEY TO THE LEPTOTHORAX OF THE SOUTHEAST
(HYMENOPTERA: FORMICIDAE)


MARK DEYRUP1 AND STEFAN COVER2
1Archbold Biological Station, P.O. Box 2057, Lake Placid, FL 33862

2Dept. of Entomology, Museum of Comparative Zoology, Harvard University
26 Oxford Street, Cambridge, MA 021??

ABSTRACT

A new species of myrmicine ant is described from Florida: Leptothorax palustris is known
from workers and associated queens and males collected in a marsh and in frequently
flooded pinelands in the Apalachicola National Forest in northwestern Florida. Nests are
near the surface in root mats that extend into small open sandy hummocks. The species re-
sembles Leptothorax texanus Wheeler, a species of adjacent well-drained sandy sites, differ-
ing primarily in the structure of the petiole and postpetiole and color. Leptothorax davisi
Wheeler is synonymized with Leptothorax texanus Wheeler (new synonymy); this is based on
extensive and previously unknown variability in L. texanus, even in single sites and within
nest series. An illustrated key is presented for the identification of the eleven species of Lep-
tothorax known from the Atlantic Coastal states north through North Carolina, with the ad-
dition of Alabama.

Key Words: southeastern ants, Apalachicola National Forest, Osceola National Forest

RESUME

Se describe una nueva especie de hormiga Myrmicinae de Florida. Leptothorax palustris se
conoce con base en obreras, reinas y machos asociadas, colectados en ci6negas y bosques
humedos de pino en el Apalachicola National Forest del noreste de Florida. Los nidos son su-
perficiales en pequeios promomontorios de arena. Este especie se parece a Leptothorax tex-
anus Wheeler, una especie de de areas cercanas pero mas arenosas y con mejor drenaje.
Leptothorax texanus se distingue de L. palustris por la structure del peciolo y postpeciolo,
y su color. Leptothorax davisi Wheeler se convierte en sin6nimo de Leptothorax texanus
Wheeler (nuevo sinonimo); 6sta cambio se establece con base en la extrema variaci6n, hasta
ahora desconocida, de L. texanus al interior de sitios y nidos particulares. Se incluye una
clave ilustrada de las once species de Leptothorax conocidas de los estados de la costa atlan-
tica hasta North Carolina, incluyendo Alabama.


Translation provided by author.


Members of the genus Leptothorax are gener-
ally timid and retiring ants that do not recruit
strongly to baits and are often specialized in their
choice of nesting places. It is not remarkable,
therefore, that species of Leptothorax may be
overlooked, even in relatively well-known coun-
tries such as the United States, with its long his-
tory of assiduous myrmecologists. The species
described below seems to have escaped detection
up to now because it occurs in an unusual habitat
(frequently flooded and burned pine forests),
where it probably conducts most of its foraging
hidden under a loose layer of pine needles and
leaves. The first known specimens were collected
in pitfalls by David Lubertazzi in a study of ant
associations in selected vegetation types in the
Apalachicola National Forest, near Tallahassee,
Florida.


For a diagnosis of the genus Leptothorax, see
the character states in the various couplets of the
keys provided by Bolton (1994). A rough diagnosis
of the genus as it appears in the U.S. is as follows:
petiole with two segments; antennal scrobes lack-
ing; petiole not quadrate in lateral view; head and
body with some erect hairs; antennae with three
conspicuously enlarged terminal segments; pro-
podeal spines or teeth present; postpetiole at-
tached normally, not affixed to the dorsal surface
of the gaster.
The species described below would belong to
the former subgenus Myrafant, which was re-
cently revived by MacKay (2000). We hesitate to
use this subgenus until it has been reviewed in a
wider context. The Florida species Leptothorax
torrei (Aguayo), for example, seems to fit comfort-
ably into the revived Myrafant as currently de-







Florida Entomologist 87(1)


fined, but is not included in the Myrafant
revision, presumably because its resemblance to
species traditionally included in Myrafant is
likely to be due to convergence. It is possible that
Myrafant will eventually be recognized as a valid
subgenus, or even as a genus (Hdlldobler & Wil-
son 1990), but it would be best if this occurred in
a more general review of the subgroups presently
combined in Leptothorax.

Leptothorax palustris Cover and Deyrup, new species
(Figs. 1-2)

Diagnosis of Worker

Distinguished from all other Nearctic Lepto-
thorax by the following combination of character
states: head with fine, longitudinal, well-sepa-
rated dorsal carinae, otherwise shining; mesos-
oma with fine, longitudinal, well-separated dorsal
carinae, anastomosing dorsally; propodeal spines
slender, acute, projecting distinctly upward from
the smoothly convex dorsum of the mesosoma;
postpetiole in dorsal view almost twice as wide as
petiole, and almost as long as wide, shining; color
yellowish, head yellowish brown. Most similar to
L. texanus Wheeler (Fig. 3), but postpetiole rela-
tively longer, color lighter.


Description of Holotype Worker

Features visible in lateral view described from
left side. Measurements in mm: Total length
(length of head excluding mandibles, + length of
mesosoma, excluding propodeal spines, + length
of petiole, postpetiole, gaster): 2.90; head length
0.65; head width 0.50; length of mesosoma: 0.93;
length of petiole: 0.25; length of postpetiole: 0.27;
length of gaster: 0.80. Head: dorsum with fine,
well-separated, longitudinal, irregular carinae,
with scattered, short cross-carinae; interstices
weakly shining; clypeus with a strong median ca-
rina, separated by a distance equal to about half
its length from the sublateral longitudinal cari-
nae, a lateral carina also present on each side;
malar space slightly more than 1.5 times maxi-
mum length of eye; antennae with 12 joints. Meso-
soma: evenly convex in profile; dorsum with a few
coarse carinae forming a rough network, inter-
stices weakly shining; pronotum and mesopleu-
ron each with several irregular, indistinct
longitudinal carinae, interstices weakly shining;
metapleuron with five distinct longitudinal cari-
nae, interstices shining; propodeal spines long,
slender, in lateral view spine making a 135 degree
angle with the dorsum of the mesosoma; petiole in
profile concave ventrally, with a small, sharp an-


Fig. 1. Worker of Leptothorax palustris n. sp.: lateral habitus view; frontal view of head; dorsal view of postpet-
iole. Length of ant: 2.9 mm.


March 2004







Deyrup & Cover: Leptothorax of the Southeast


I
I,
I/
'V


Fig. 2. Alate queen of Leptothorax palustris n. sp.:
lateral habitus view; frontal view of head. Length of ant:
5.0 mm


gle at anterior border; node of petiole with a blunt
anterior angle, no posterior angle; postpetiole in
dorsal view shining anteriorly, minutely rough-
ened posteriorly; 1.8 times as wide as petiole;
postpetiole as long as wide when measured from
side to side at midlength, and along midline from
convex anterior to convex posterior borders.
Gaster: shining, without sculpture. Dorsum of
head and body with sparse, flattened, parallel-
sided hairs, erect on head and mesosoma; slightly
retrorse on petiole, postpetiole, and gaster. Color:
translucent dark yellow, dorsum of head brown,
middle and hind femora with wide postmedian
bands of brownish yellow.

Diagnosis of Queen

Queens of some North American Leptothorax
are unknown or undescribed; this diagnosis in-
cludes only species from southeastern North
America. Distinguished from these by the follow-
ing combination of character states (Fig. 2): me-
sopleuron shining, with only a few fine carinae
near edges (unlike L. smith Baroni Urbani,
schaumii Roger; bradleyi Wheeler); propodeal
spines long, slender (unlike pergandei Emery, bra-
dleyi); propleuron with conspicuous irregular car-
inae (unlike tuscaloosae Wilson, torrei (Aguayo),
pergandei); petiole in profile triangular with a sin-


gle conspicuous dorsal angle, not rounded dorsally
(as in allardycei (Mann)), or truncate and biangu-
late (as in longispinosus Roger and texanus
Wheeler); maximum length of eye slightly shorter
than malar space (unlike curvispinosus Mayr).

Description of Paratype Dealate Queen from Nest
of Holotype

Methods as for holotype. Measurements in
mm: total length: 4.96; head length: 0.82; head
width: 0.77; length of mesosoma: 1.25; length of
petiole: 0.37; length of postpetiole: 0.35; length of
gaster (segments except first strongly retracted):
1.40. Head: dorsally with well-separated longitu-
dinal irregular carinae with scattered cross-cari-
nae, interstices shining; clypeus shining, with
longitudinal carinae: one median carina, a sublat-
eral and lateral on each side, right side with a
submedian carina, absent on the left side; malar
space 1.2 times maximum length of eye; antennae
with 12 joints. Mesosoma: pronotum with a few
strong carinae forming an irregular network an-
teriorly, becoming weak and longitudinal posteri-
orly, interstices shining; mesonotum with dense,
longitudinal, slightly irregular carinae, inter-
spaces shining; mesopleuron shining, smooth,
with small irregular carinae along dorsal, ventral,
posterior borders, transverse mesopleural suture
strongly developed, slightly foveolate; propodeum
with strong longitudinal carinae, propodeal
spines elongate, slender, acute. Petiole in profile
with a single, strong, dorsal angle, not truncate,
ventrally concave, with a small, sharp angle at
anterior border. Postpetiole dorsally minutely
roughened, 1.50 times as wide as long. Gaster
shining, without sculpture. Pilosity of head and
body as in worker. Color: translucent dark yellow,
dorsum of head and apex of gaster brown.

Diagnosis of Male

Males of some North American Leptothorax
are unknown or undescribed. Even in the South-
east there are two species, smith and tuscaloo-
sae, whose males are unknown, at least to us.
Male palustris are distinguished from other
known southeastern species by the following
character states: node of petiole low and rounded,
hardly more declivitous posteriorly than anteri-
orly (unlike texanus, whose declivity is high and
abruptly declivitous posteriorly); color black (un-
like torrei, curvispinosus, allardycei); mesonotum
not conspicuously bulbous anteriorly and over-
hanging posterior edge of pronotum (as inpergan-
dei); antennae with a four-segmented antenna
club (unlike bradleyi, which has no antennal club;
we suspect that smith, whose workers resemble
those of bradleyi in many ways, has similar
males); mesonotum lacking the conspicuous
parapsidal furrows found in longispinosus.







Florida Entomologist 87(1)


SNI


Fig. 3. Worker of Leptothorax texanus: lateral habitus view; frontal view of head; dorsal view of postpetiole.
Length of ant: 3.2 mm.


Description of Paratype Male from Nest of Holotype

Methods as for holotype. Measurements in
mm: total length: 3.27; head length: 0.52; head
width: 0.60; length of mesosoma: 0.93; length of
petiole: 0.25; length of postpetiole: 0.20; length of
gaster: 0.77; length of forewing: 2.20. Head: mi-
nutely reticulate dorsally, smooth below middle
ocellus; faintly sculptured behind ocelli; length of
eye 1.10 times the distance between edge of eye
and lateral ocellus; antennae with 13 joints, last
four conspicuously enlarged to make an elongate
club. Mesosoma: pronotum minutely, faintly retic-
ulate, weakly shining; mesonotum without
parapsical furrows, roughened with irregular,
shallow, longitudinal depressions, irregularly mi-
nutely reticulate; midline near anterior border
impunctate; mesopleuron shining, smooth except
for irregular shallow depressions usually associ-
ated with insertions of hairs; metapleuron and
propodeum faintly, minutely reticulate, weakly
shining. Petiolar node smooth, shining, in profile
low and rounded, posterior declivity only slightly
steeper than anterior declivity. Postpetiole shin-
ing, with a conspicuous submarginal band of
irregular shallow depressions and minute reticu-


lations. Gaster smooth, shining. Color: blackish
brown; tarsi yellowish white; antennae, mandi-
bles, trochanters, apices of femora light brown;
wings, including veins, whitish.

Type localities, as Appear on Specimen Labels

Holotype: Florida: Liberty Co., Apalachicola
Nat'l. For., 14-V-2000, S. Cover & M. Deyrup. 0.4
mi. S. jet. For. Serv. Rds. 107 & 126, 3012.38'N,
8445.88'W., elev. under 200', seasonally flooded
shrub marsh. Nest in open, a tiny open hole. Nest
chambers less than 2" deep, in root mat on fine
white sand. Found by cookie bait. Same data for
71 paratype workers, 1 dealate paratype queen as-
sociated with holotype, 3 paratype dealate queens
associated with paratype workers, 3 alate
paratype queens associated with paratype work-
ers, 1 paratype male associated with holotype, 3
paratype males associated with paratype workers.

Additional Material Examined

Two workers: Florida: Columbia Co., Osceola
National Forest, 5 km. east of Lake City on Route
90, 3011.516N, 8231'977W, 28-VIII-2001, pine


March 2004







Deyrup & Cover: Leptothorax of the Southeast


flatwoods, J. R. King, collector; 1 worker: same lo-
cality, habitat, collector as previous, site:
3017.100'N, 82028.813W, 27-30-VIII-2001; 1
worker: same locality, habitat, collector as previ-
ous site: 3017.077'N, 82E28.770W.

Deposition of Type Material

Holotype, 2 paratype workers from nest of ho-
lotype, dealate queen and male from nest of holo-
type, 9 paratype workers: Museum of
Comparative Zoology, Harvard University, Cam-
bridge, Massachusetts; 8 workers, one queen, one
male: National Museum of Natural History,
Smithsonian Institution, Washington, D.C.; 3
workers, one queen, 1 male: Los Angeles County
Museum, Los Angeles, California; 7 workers, one
queen: Florida State Collection of Arthropods,
Gainesville, Florida; 4 workers, one queen: The
Natural History Museum, London; remaining
type material temporarily in the arthropod collec-
tion of the Archbold Biological Station, Lake
Placid, Florida.

Etymology

palustris, Latin, from palus (feminine) =
marsh, and the suffix -tris, = belonging to, or a
place where; feminine ending in apposition to
palus, not Leptothorax (masculine).

Position in Taxonomic Guides

In Creighton (1950) workers key to texanus
davisi, couplet 17 of Leptothorax key. In Mackay
(2000) workers dead-end at couplet 43, as the dor-
sum of the postpetiole is neither "reticulo-rugose"
nor "punctate or granulose."

DISCUSSION

The collections of this species are from a marsh
or from low flatwoods. We believe it is a wet-site
species from the same lineage as the dry-site spe-
cies Leptothorax texanus, which it strongly resem-
bles in size, pilosity, and general morphology (Fig.
3). The two species differ in the shape of the pro-
file of the petiole (in workers, queens, males), in
the relative length and width of the postpetiole of
the worker (Figs. 1 and 3), and in color.
Leptothorax palustris is presently known from
the Apalachicola and Osceola National Forests. In
these preserves it probably benefits from the
management practices of low stocking and occa-
sional fires. Its populations would probably suffer
from attempts to promote dense stocking of trees
or heavy site preparation, as occur in many pri-
vately managed pine stands. We appreciate the
enlightened, multi-use management of the for-
ests that provides a rich diversity of species, in-
cluding native ants. It is probable that the species


occurs in marshes and flatwoods in Georgia and
Alabama.
The first known specimens were collected in
pitfall traps, and this seems a good way to sample
for the species. In a site where the species is
known to occur, it can be baited with cookie
crumbs. Our experience is that members of this
species accept shortbread cookie crumbs with an
enthusiasm not always seen in Leptothorax spe-
cies, and immediately return to the nest. This may
be the only practical way to find a nest, because
the nest entrances that we have seen are com-
pletely unmarked holes about 2 mm in diameter.

Synonymy of Leptothorax texanus Wheeler
and L. davisi Wheeler

Preparation of a diagnosis for L. palustris lead
to an examination of L. texanus and L. davisi,
which are the species most similar, and probably
most closely related to palustris. In Mackay's use-
ful recent revision of a large portion of North
American Leptothorax (2000), the former subspe-
cies L. texanus davisi is raised to species level, on
the basis of several character states. These in-
clude differences in the sculpture of the head (tex-
anus is described as having the central region
"nearly smooth and shining," davisi "punctate,
with the central region covered with longitudinal
striae"); the postpetiole of davisi is covered "with
poorly defined punctures," while that oftexanus is
"coarsely reticulo-rugose or punctate." The term
"punctate" as used in MacKay's descriptions of
these species and other Leptothorax in his revi-
sion refers to sculpture that would traditionally
be considered granulate, or inscribed with fine re-
ticulations. There are no actual punctures, except
for those from which hairs emerge. The "striae" in-
volved are not impressed lines, but fine, irregular
carinae, often superimposed on the reticulate
background. Allowing for these variances in ter-
minology, the differences in surface sculpture
used by Mackay to define texanus and davisi can
be found within populations and within nest se-
ries in Florida. The postpetiole of davisi is de-
scribed as "wider." This is not upheld by
examination of specimens from the non-overlap-
ping supposed ranges of the species. The difficulty
surrounding this feature is shown in Mackay's di-
agnostic line drawings: the supposedly narrower
postpetiole of texanus is actually shown as wider
in relation to its length and wider in relation to
the petiole, than that of davisi. The shape of the
petiole in profile is described as "definitely trun-
cate" in davisi, "not really truncate" in texanus.
Although all specimens we have seen show some
evidence of a "truncate" petiolar node, the sharp-
ness of the anterior and posterior angles is highly
and continuously variable within sites (such as
the Archbold Biological Station) and through the
ranges of texanus and davisi. For all these charac-







Florida Entomologist 87(1)


ter states, the variation seen in the 173 specimens
(ABS collection) from throughout Florida is par-
ticularly convincing, with every permutation of
the texanus and davisi diagnostic character states
represented in this one set of specimens. We think
that the problem in understanding the relation-
ship between davisi and texanus is the under-
standable result of insufficient specimens when
these taxa were first established, and insufficient
specimens on hand for the subsequent reviews by
Creighton (1950) and Mackay (2000).
We therefore propose the synonymy of Lep-
tothorax texanus Wheeler and Leptothorax davisi
Wheeler under the senior name Leptothorax texa-
nus (new synonymy). We do not retain davisi as
a subspecies because it seems that the features
used to define that subspecies are not clearly con-
fined to a region, as is normally required for a geo-
graphic subspecies. There is, however, some
apparent geographic variation within L. texanus.
The type series from Texas does show unusually
strong rugose carinae on the mesosoma, while the
types of davisi, from New Jersey, have unusually
weak mesosomal carinae. The zone ofintergrada-
tion, however, seems to occupy most of the range
of the species. This analysis may not be the final
word on the texana-davisi question. Leptothorax
texanus, as presently understood, has one of the
largest ranges of any North American Leptotho-
rax. It is still possible that it is a complex of two or


more species; at present, however, we have no ev-
idence of this.

Identification ofLeptothorax of Southeastern
North America

The Leptothorax fauna of the Southeast has
not been reviewed in its entirety since Creighton's
Ants of North America (1950). Seven of the south-
eastern species appear in Mackay's revision
(2000), with species accounts that include a small
literature review for each species. Our aim is to
make it easy to identify known southeastern spe-
cies, and to facilitate the recognition of any unre-
ported or undescribed species that may occur in
the Southeast. For this purpose we define the area
as the Atlantic Coastal states from Florida
through North Carolina, with the addition of Ala-
bama. North of this area there are several addi-
tional species of Leptothorax, including the
unresolved L. muscorum complex. Following the
key is a brief summary of the natural history of
each species. Included are suggestions for finding
colonies of these species in the hope of encourag-
ing further collections from the Southeast. The
known distribution of several species includes sig-
nificant (and improbable) gaps in the Southeast.
The surface sculpture on Leptothorax is best
viewed with a diffused light source, such as a flu-
orescent light.


KEY TO Leptothorax WORKERS OF SOUTHEASTERN NORTH AMERICA

la. Mesosoma in lateral profile with a conspicuous impression between the mesonotum and the propodeum
(Fig. 4, A:la) (throughout Southeast) ........................................pergandei Emery
lb. Mesosoma not conspicuously impressed between the mesonotum and propodeum ....................... 2
2a. Head and body, except gaster, covered with coarse, raised reticulations (Fig. 4, B: 2a) (tropical FL)
allardycei (Mann) 2b. Head and body not covered with coarse, raised reticulations .................. 3
3a. Propodeal spines in lateral view short and triangular, no longer than the width of an eye, as in Fig.4, C: 3a ..4
3b. Propodeal spines in lateral view slender, usually longer than the width of an eye, as in Fig. 4, E: 3b ........ 5
4a. Head in frontal and lateral views with conspicuous, irregular, longitudinal carinae (Fig. 4, C: 4a)
(probably throughout Southeast, except tropical FL) .................. ........... bradleyi Wheeler
4b. Head in frontal and lateral views largely shining and lacking sculpture, with only a few delicate carinae
around the eye and frontal ridges Fig. 4, D: 4b), or, in larger specimens, head mostly granulate,
not shining, with delicate carinae almost hidden in granulate background (throughout Southeast,
except tropical FL). ................. ........................................ schaumii Roger
5a. Head and mesosoma not shining and without conspicuous sculpture; only a few hairs on head and body,
these hairs short and broadened; postpetiole unusually large (Fig. 4, E: 5a) (tropical FL) torrei (Aguayo)
5b. Head and mesosoma partially shining or strongly sculptured; hairs various (occasional specimens
ofL. curvispinosus lack conspicuous sculpture; this species more northern, without enlarged
postpetiole) .............................................................. ........... 6
6a. Dorsum of mesosoma mostly smooth shining; color usually dark brown, legs and antennae pale yellow
(Fig. 4, F) (AL, NC) ....................................................... tuscaloosae Wilson
6b. Dorsum of mesosoma either with obvious fine carinae, or not shining, or both .......................... 7


March 2004





Deyrup & Cover: Leptothorax of the Southeast


la


4a 3a
^^sssJ


4b


3b
b 5a
A


Fig. 4. Southeastern species of Leptothorax. Number-letter combinations, such as "la", refer to character states
used in the key to species. Species: A: pergandei, B: allardycei, C: bradleyi, D: schaumii, E: torrei, F: tuscaloosae,
G: smith, H: longispinosus, I: curvispinosus, J: palustris. Drawings not to scale.

7a. Head and body dark reddish brown; sides of head with conspicuous, irregular, closely spaced carinae
(Fig. 4, G: 7a) (throughout Southeast, except tropical FL) ...................... smith Baroni Urbani
7b. Head and body not dark reddish brown; sides of head without closely spaced carinae ................... .8


9a






8a
1







Florida Entomologist 87(1)


8a. Propodeal spines in lateral view about as long as basal face of petiole (as in Fig. 4, I: 8a); sides of mesosoma
with strong, subparallel carinae (as in Fig 4, H: 8a) ................ ......................... 9
8b. Propodeal spines in lateral view shorter than basal face of petiole (Fig. 4, J: 8b); sides of mesosoma
with fine, irregular carinae that are not parallel (Fig. 4, J: 8c) .................................. 10
9a. Blackish; head in frontal view with delicate, longitudinal ridges, but otherwise shining (Fig. 4, H: 9a)
(southern Appalachians) ................................................ longispinosus Roger
9b. Yellowish or yellowish brown; head in frontal view not shining (Fig. 4, I) (Southeast,
into north FL) ........... ................... ................... .curvispinosus Mayr
10a. Blackish, sometimes with dark red on the mesosoma; postpetiole in dorsal view much wider than long
(Fig.3) (throughout Southeast) ................................................ texanus Wheeler
10b. Yellowish, head usually darker than body; postpetiole in dorsal view about as long as wide
(Fig.l; Fig. 4, J) (north FL) .................................................... palustris, n. sp.


Abbreviated Notes on Species (Alphabetical)

L. allardycei. Tropical Florida, Caribbean.
Nests are usually in hollow twigs or vines on liv-
ing trees, occasionally in sawgrass culms at edges
of marshes; in Bahamas sometimes in fallen
twigs. Often in poisonwood (Metopium toxiferum).
Nocturnal. Usually pale yellow, occasionally
brownish yellow.
L. bradleyi. Central Florida north into Georgia
and Alabama; probably in the Carolinas as well.
Similar in color and morphology to L. smith, but
propodeal spines shorter and few conspicuous
carinae on side of mesosoma. Nests are usually in
large, living pines, especially Pinus elliottii and
P palustris in open areas. A member of the
longleaf pine ecosystem. Sometimes attracted to
peanut butter or jelly baits on tree trunks, but the
nest is seldom accessible.
L. curvispinosus. North Florida, throughout
remainder of Southeast, but often rare in south-
ern part of range. In mature hardwood forests in
southern edge of range, often in brushy areas and
open forest farther north. Nests are usually in
hollow twigs or weed stems on ground, but may be
in dead twigs or branches up to about 1 m above
ground. Yellowish color and non-shining head dis-
tinguish this species from all sympatric south-
eastern Leptothorax, but similar to L. ambiguus
Emery, which occurs to the north and can be dis-
tinguished by shorter and wider propodeal spines
(see Creighton 1950). The latter species might
possibly occur at higher elevations in the south-
ern Appalachians. Attracted to sweet baits.
L. longispinosus. A northern species extending
south at mid elevations in the southern Appala-
chians. Usually found in mesic forest or forest
edges. Nests are in hollow twigs or nuts on the
ground or buried in leaf litter, occasionally under
bark of dead trees. Dark color combined with
long, straight propodeal spines are diagnostic in
the Southeast. Attracted to sweet baits; individu-
als of this species and some other Leptothorax
spend a long time licking solid baits, but quickly


fill up at liquid baits such as jelly, making them
easier to trail back to the nest.
L. palustris. See comments, under discussion
of the species.
L. pergandei. New Jersey through Florida,
west into Nebraska and Arizona. The strongly im-
pressed suture between the mesonotum and pro-
podeum is diagnostic throughout its range.
Usually found in open forests or forest edges, in-
cluding both well-drained and poorly drained
sites; has been found in salt marshes. Nests are
usually in hollow twigs or nuts, usually buried in
leaf litter; occasionally nests in soil. May be deep
yellow, brown or black; occasionally bicolored.
Readily carries shortbread crumbs back to nest.
L. schaumii. Central Florida north into south-
ern Maine, west into Texas. An arboreal species
with short spines and the head shining, the latter
character state visible at low magnification in the
field. Nests are usually in dead branches or under
loose bark on live hardwoods or conifers, usually
the former. Can be either blackish brown or yel-
low, sometimes bicolored. Somewhat attracted to
peanut butter or jelly baits.
L. smith. Central Florida north into the mid-
Atlantic states and west into Ohio. Nests are usu-
ally in standing dead trees in open areas. In Flor-
ida usually found in pine snags. A dark reddish
brown species similar in color and morphology to
bradleyi, distinguished by long propodeal spines
and conspicuous carinae on the sides of the meso-
soma. This is the same species as L. wheeleri
M. R. Smith, a name that became preoccupied
when the genus Macromischa was synonymized
with Leptothorax (Baroni Urbani 1978). Some-
what attracted to peanut butter or jelly baits, but
the nest is seldom accessible.
L. texanus. Central Florida west to Texas,
north to New Jersey. In the Southeast this species
and the larger L. pergandei are the only dark,
shining Leptothorax found foraging on the ground
in open areas. Some southeastern queens are
blackish, others a striking brick red. Nests are in
soil, usually only a few inches below the surface.


March 2004







Deyrup & Cover: Leptothorax of the Southeast


Often forages under a thin surface layer of litter.
Can be baited with shortbread crumbs.
L. torrei. Tropical Florida and the Caribbean.
This tiny yellow species with short scale-like hairs
cannot be mistaken for other southeastern Lep-
tothorax. Somewhat similar in appearance to Car-
diocondyla wroughtonii (Forel), which is also
yellowish with an expanded postpetiole, but the lat-
ter species has no scale-like hairs. Leptothorax tor-
rei is usually obtained by sifting or extracting litter.
L. tuscaloosae. Known from Alabama and
North Carolina; presumably occurs in the inter-
vening states. Nests have been found at the bases
of large trees in mesic hardwood forest areas (Wil-
son 1950). A dark brown, shiny species with pale
legs and antennae, L. tuscaloosae is not likely to
be confused with other southeastern Leptothorax.

ACKNOWLEDGMENTS

We thank David Lubertazzi for bringing us the first
specimens of L. palustris, and we thank Lloyd Davis,
Zachary Prusak, and Joshua King for contributing spec-


imens of other species of southeastern Leptothorax. We
thank Pedro F. Quintana-Ascencio for preparing the
Spanish abstract. Our research was supported by the
Archbold Biological Station and by the Museum of Com-
parative Zoology, Harvard University. The expedition
that produced the type material ofL. palustris was sup-
ported by the Wilson Ant Collection Fund.

LITERATURE CITED

BARONI URBANI, C. 1978. Material per una revision
dei Leptothorax neotropicali al sottogenere Macro-
mischa Roger. Entomologica Basiliensia 3: 395-618.
BOLTON, B. 1994. Identification guide to the ant genera
of the world. Harvard University Press, Cambridge,
MA. 222 pp.
CREIGHTON, W. S. 1950. The ants of North America.
Bull. Mus. Comp. Zool. Harvard 104: 1-585.
HOLLDOBLER, B., AND E. 0. WILSON. 1990. The ants.
Harvard University Press, Cambridge, MA. 732 pp.
MACKAY, W. P. 2000. A review of the New World ants of
the subgenus Myrafant (Genus Leptothorax). Hy-
menoptera: Formicidae. Sociobiology 36: 265-444.
WILSON, E. O. 1950. A new Leptothorax from Alabama
(Hymenoptera: Formicidae). Psyche 57: 128-130.







Florida Entomologist 87(1)


March 2004


MOVEMENT AND RESIDUAL ACTIVITY OF DELTAMETHRIN IN A GOLF
COURSE FAIRWAY UNDER TWO POST-TREATMENT IRRIGATION TIMINGS

YULU XIA', MIKE A. FIDANZA2, AND RICK L. BRANDENBURG1
'Department of Entomology, North Carolina State University, Raleigh, NC 27606

2Division of Science, Berks-Lehigh Valley College, The Pennsylvania State University
P.O. Box 7009, Reading, PA 19610-6009

ABSTRACT

The impacts of two post-treatment irrigation timings on the field efficacy and residual activ-
ity of deltamethrin against nymphs of the southern mole cricket, Scaptericus vicinus Giglio-
Tos, and the tawny mole cricket, S. borellii Scudder, as well as movement of deltamethrin in
the turfgrass profile, were investigated in 1998. Deltamethrin followed by irrigation 24 h af-
ter treatment provided the best mole cricket control versus immediate irrigation in both
field and greenhouse studies. Regardless of irrigation timing, grass clippings had the highest
residual levels of deltamethrin followed by the thatch layer. Clipping residues were higher
with post 24 h irrigation than immediate irrigation with few residues in the upper soil pro-
file (top 5 cm).

Key Words: mole crickets, deltamethrin, irrigation, residue, Scapteriscus borellii, Scap-
teriscus vicinus

RESUME

El impact de dos tiempos diferentes del riego despu6s del tratamiento sobre la eficaz en el
campo y la actividad residual del deltametrin contra las ninfas del grillotopo sureno, Scap-
tericus vicinus Giglio-Tos, y del grillotopo aleonados, S. borellii Scudder, y el movimiento del
deltametrin en el perfil del c6sped, fueron investigados en 1998. El Deltametrin seguido por
el riego 24 horas despu6s del tratamiento suplio el mejor control del grillotopo versus el riego
inmediato en ambos studios en el campo y en el invernadero. Prescindiendo del tiempo de
riego, los recortes de grama tenian el nivel mas alto de residue de deltametrin seguidos por
la capa de paja seca enrollada en la base de la grama viva. Los residues en los recortes fueron
mas altos con el riego hecho 24 horas despu6s que en el riego inmediato con pocos residues
en el perfil superior del suelo (los primeros 5 cm).


Deltamethrin [(S)-a-cyano-3-phenoxybenzyl
(1R,3R)-cis-2,2-dimethyl-3-(2,2-dibromo-vinyl)cy-
clopropanecarboxylate] is a pyrethroid insecticide
used for the management of a variety of insect
pests. Typically irrigation is recommended imme-
diately after treatment with pyrethroid insecti-
cides when used to control of mole crickets or
other soil-inhabiting turfgrass insect pests. This
recommendation is partly based on the assump-
tion that immediate irrigation aids in moving the
insecticide downward into the soil where the tar-
get pests are located. However, current research
suggests that the effect of irrigation timings on
insecticide efficacy is not consistent (Xia & Bran-
denburg, unpublished). For example, in prelimi-
nary work, immediate post-treatment irrigation
did not provide better control of mole crickets ver-
sus delayed irrigation. It is also unclear how irri-
gation timings affect the residual toxicity and the
movement (i.e., residue distribution in the grass,
thatch, and the upper soil) of insecticides. Mole
crickets are the most serious pest of golf course
turfgrasss in the southeastern U.S. and an under-


standing of how to improve pesticide efficacy is
critical (Brandenburg 1997). Therefore, the objec-
tives of this study were to: (1) compare field effi-
cacy and greenhouse residual activity of
deltamethrin under immediate and delayed irri-
gation timings against mole cricket nymphs and
(2) determine deltamethrin residue levels in turf-
grass clippings, thatch, and upper soil under two
irrigation timings.

MATERIALS AND METHODS

Field Efficacy Experiment

This test was conducted on a bermudagrass,
Cynodon dactylon (L.) Pers., fairway at Fox Squir-
rel Golf Course in Brunswick County, NC, on 1
Sep 1998. Plots were established in an area with
consistent mole cricket damage throughout and
arranged in a completely randomized design with
four replicates per treatment. Plot sizes were 7.5
x 7.5 m. Soapy water samplings (Short & Koehler
1979) prior to the experiment indicated that the







Xia et al.: Movement and Residual Activity of Deltamethrin


population was approximately 70% southern
mole cricket, Scapteriscus vicinus Giglio-Tos, and
30% tawny mole cricket, S. borellii Scudder. The
thatch layer was 1.3 cm thick and dry. Both soil
(at 10 cm) and air temperatures at the time of ap-
plication were 30C. Soil at the test site was clas-
sified as a mineral soil with a pH of 6.2 and 0.46%
humic matter.
Deltamethrin (DeltaGard 5 SC, AgrEvo USA
Co., Wilmington, DE) was applied with a boom
sprayer (R & D Sprayers Inc., Opelousas, LA)
mounted on a Turf-Gator (Deere & Co., Moline,
IL) calibrated to deliver 209 L/ha with ten 8003
nozzles. Plots in treatment one were treated with
deltamethrin at a rate of 140 g a.i./ha followed
immediately with irrigation. The second delta-
methrin application (treatment two) was applied
and irrigated 24 h later. The golf course irrigation
system was used to apply approximately 0.6 cm
water each time. The normal golf course irrigation
schedule was followed thereafter. Approximately
0.3 cm of rainfall occurred 3.5 h after treatments.
The mole cricket damage rating system of Cobb
and Mack (1989) was used to evaluate control.
Damage was rated on a 0-9 scale based on the oc-
currence of fresh surface damage on nine subgrids
of a frame (1 x 1 m) where 0 indicates no damage
and 9 (damage observed at all 9 subgrids) indi-
cates severe damage. Damage was rated at 7, 14,
21, and 28 days after treatment (DAT) by making
five random frame ratings per replicate each time.

Greenhouse Residual Activity Experiment

Soil cores were taken from the field plots at 0,
1, 4, 7, 14, 21, and 28 DAT by using PVC pipe
chambers (15.5 cm long and 10.5 cm in diam).
Three cores were sampled per plot on each sample
day. The PVC chamber was hammered into the
soil until the top of the chamber was level with the
turfgrass surface. Chambers containing the soil
cores were taken to a greenhouse at North Caro-
lina State University in Raleigh, N.C. Three 3rd to
5th instar mole crickets (>80% tawny mole crick-
ets) were placed on the surface of each chamber to
crawl through the soil core on the same day. Mole
cricket nymphs used in this study were collected
from golf course fairways by the soapy water
flushing method (Xia & Brandenburg, unpub-
lished) and kept in a laboratory with house cricket
diet and small earthworms for 14 days before ini-
tiating the study. Both ends of the chamber were
covered with plastic petri dishes tied together by
rubber bands. Mortality was checked 72 h later.
All data were transformed (square root of X +
0.5 arcsine for percentage data) prior to statisti-
cal analysis. Analysis of variance (ANOVA,
MEANS, SAS Institute 1990) was used to conduct
analysis of variance among treatments and to
compute means and standard errors of dependent
variables. Waller-Duncan K-ratio T-test was used


to compare mole cricket damage ratings and mor-
tality means between the treatments.

Laboratory Residue Analysis

Samples of grass clippings, thatch, and soil in
upper 5 cm depths were taken from the untreated
and deltamethrin treated plots at 0, 4, and 14
DAT. Grass clippings and thatch were taken with
a hand trowel. Soil samples were taken with a
standard soil sampler (2.0 cm in diam) (Lesco,
Inc., Rocky River, OH). All samples were placed in
Ziploc plastic bags and immediately placed in a
freezer.
Gas chromatography analysis of deltamethrin
residue on grass clippings, thatch, and soil was
conducted at EN-CAS Analytical Laboratories
(Winston-Salem, NC). The procedures for delta-
methrin analysis in grass, thatch, and soil fol-
lowed EN-CAS Analytical Laboratories Method
No. ENC-7/89, entitled "Analytical method for the
simultaneous determination of alpha-R-delta-
methrin, cis-deltamethrin, trans-deltamethrin,
and/or tralomethrin in soil samples by gas chro-
matography" (EN-CAS Analytical Laboratory, in-
ternal publication, issued May 22, 1990). Residue
levels of deltamethrin were the sum of alpha-R,
cis, and trans isomers.

RESULTS

Field Efficacy Experiment

Twenty four hour deltamethrin post-treatment
irrigation had numerically the lowest mole cricket
damage ratings consistently during the experi-
mental period (Table 1), and was the only treat-
ment with significantly lower damage ratings
compared to the untreated control at 7 and 14
DAT (Table 1). There were no significant differ-
ences in damage ratings between the untreated
control, or deltamethrin with immediate post-
treatment irrigation at 7, 14, 21, and 28 DAT

Greenhouse Residual Activity Experiment

Results of the greenhouse test showed a simi-
lar trend as the field efficacy test. Mole cricket
mortality from deltamethrin with delayed irriga-
tion was significantly higher than all other treat-
ments at 0 and 1 DAT (Table 2). Mole cricket
mortality from deltamethrin with irrigation 24 h
later was significantly higher than the untreated
control at 0, 1, 4, 7, and 14 DAT. Deltamethrin fol-
lowed by immediate irrigation provided higher
mortality than the untreated on 0, 1, and 7 DAT.

Laboratory Residue Analysis

Results of the residue analysis indicated that
bermudagrass clippings had the highest delta-







Florida Entomologist 87(1)


TABLE 1. FIELD EFFICACY OF DELTAMETHRIN AND BIFENTHRIN AGAINST NYMPHS OF SOUTHERN AND TAWNY MOLE
CRICKETS, 1998.

Mole Cricket Damage Rating1'2
Rate
Insecticide/irrigation timing g (a.i.)/ha 7 DAT 14 DAT 21 DAT 28 DAT

Untreated 4.1b 4.0 b 4.3 a 4.0 a
Deltamethrin/immediate 140 3.1 ab 3.5 ab 4.4 a 3.7 a
Deltamethrin/24 h later 140 2.3 a 2.2 a 2.6 a 2.8 a
Bifenthrin/immediate 120 2.7 ab 3.4 ab 3.5 a 3.2 a

'Mole cricket damage rating ranged from 0 to 9, 0 = no damage and 9 = severe damage.
Means followed by the same letter in each column are not significantly different (a = 0.05, Waller-Duncan K-ratio T-test).


methrin residue levels, followed by thatch, and the
soil at 0, 4, and 14 DAT (Fig. 1). Deltamethrin res-
idues in the upper 5 cm soil were very low, ranging
from less than 0.02 to 0.04 ppm under either irri-
gation timing during the experimental period. The
deltamethrin residues in thatch were similar be-
tween the two irrigation timings at 0, 4, and 14
DAT. Analysis of clippings indicated that delta-
methrin residues were consistently higher with ir-
rigation 24 h later versus immediate irrigation.

DISCUSSION

Results of this study indicate that post-treat-
ment irrigation timing affects field efficacy and
residual activity of deltamethrin against mole
cricket nymphs. Irrigation timings also influ-
enced the movement of deltamethrin into the
turfgrass profile. Delayed irrigation resulted in
greater deltamethrin residue on bermudagrass
leaf clippings when compared to immediate irri-
gation. However, only traces of deltamethrin res-
idue were found in soil under either irrigation
timing. Results indicate that field efficacy, resid-
ual activity, and deltamethrin residue levels in
leaf clippings are related.
Deltamethrin with delayed irrigation provided
better mole cricket control than immediate irriga-
tion. This trend was observed in the field study
and reinforced in the greenhouse bioassay. How-


ever, mole crickets in the small and closed PVC
chambers had an increased chance to contact
grass leaves compared to the real situations in
the field. This could have contributed to the high
mole cricket mortality in the delatmethrin with
delayed irrigation in the greenhouse bioassay be-
cause deltamethrin residues in leaf clippings un-
der irrigation 24 h later were higher than with
immediate irrigation.
This study underscores the challenges in man-
aging soil insect pests in turfgrass: how to move
insecticides into the soil where the target insects
live. Neither immediate nor delayed irrigation
improved movement of the insecticide into soil in
this study. The physical properties of delta-
methrin, turfgrass mowing height, and thatch
layer thickness were the main factors that con-
tributed to low deltamethrin residues in the soil
profile. Deltamethrin is almost insoluble in water
(<0.1 mg/L) and has a moderately high partition
coefficient (4.6 at 25C). This indicates that irri-
gation water cannot easily carry the chemical into
the soil, and the compound tends to bind to or-
ganic matter (i.e., grass, thatch, and decayed or-
ganic matter in soil). This explains why
deltamethrin was mainly retained by clippings
and not the thatch. This result is different from
other insecticides which are mainly retained by
the thatch layer (Niemczyk 1987; Niemczyk &
Krueger 1987; Schleicher et al. 1995). Fox Squir-


TABLE 2. GREENHOUSE BIOASSAY OF RESIDUAL ACTIVITY OF DELTAMETHRIN AND BIFENTHRIN AGAINST NYMPHS OF
SOUTHERN AND TAWNY MOLE CRICKETS, 1998.

% mole cricket mortality, 72 h after infestation12
Rate
Insecticide/irrigation timing g (a.i.)/ha 0 DAT 1 DAT 4 DAT 7 DAT 14 DAT 21 DAT 28 DAT

Untreated 2.8 a 0 a 0 a 0 a 2.8 a 5.6 a 2.8 a
Deltamethrin/immediate 140 72.2 b 56.9 b 9.7 ab 30.5 c 36.1 ab 22.2 a 5.60 a
Deltamethrin/24 h later 140 94.5 c 90.3 c 25.0 b 30.5 c 61.1 b 25.0 a 13.9 a
Bifenthrin/immediate 120 41.8 b 41.7 b 18.1 ab 16.3 b 5.6 a -

1Means followed by the same letter in each column are not significantly different (a = 0.05, Waller-Duncan K-ratio T-test).
'Mole cricket nymphs were exposed to treated soil cores for 72 h.
The bifenthrin treatment was dropped due to low residue activity.


March 2004








Xia et al.: Movement and Residual Activity of Deltamethrin




Sdeltamethrin, irrigated 24 h
later
Odeltamethrin, irrigated
... ... immediately
I untreated


soil thatch grass clippings
A: 0DAT


soil thatch grass clippings

B: 4 DAT


soil thatch grass clippings


C: 14 DAT

Fig 1. Deltamethrin residue (recovered ppm) in soil, thatch, and grass clippings at 0 (A), 4 (B), and 14 (C) DAT.











rel Golf Course fairways were seldom dethatched.
Over time, this resulted in a thick thatch layer.
Also, grass cut height in the fairway was higher
than many other golf courses in North Carolina.
Deltamethrin provided 100% control of 3rd
to 5th instar mole cricket nymphs a week after
treatment in another greenhouse bioassay test
using 19 L plastic buckets (Xia & Brandenburg,
unpublished). Based on this study and the un-
published data, it appears that a major obstacle
in achieving maximum deltamethrin efficacy in
the field is the difficulty of moving the product
past the grass and thatch into the soil. A gran-
ular formulation may provide better control
versus sprayable formulations because limited
quantities of insecticides in granular formula-
tions will be retained on the grass. This has
been demonstrated with the herbicide pen-
dimethalin, which is noted for its tendency to be
retained in the thatch layer (Gasper et al.
1994). Round, small, and heavy granular parti-
cles of an insecticide may help to improve mole
cricket control since they have a better chance
of avoiding grass leaves and the upper portion
of the thatch layer. Another alternative is to de-
thatch the turf prior to insecticide application.
Verticutting removes the thatch layer and may
help insecticides penetrate into the soil. Sub-
surface application may be the best way to
avoid the retention by grass and thatch. How-


March 2004


ever, few golf courses have subsurface applica-
tion equipment.

REFERENCES CITED

BRANDENBURG, R. L. 1997. Managing mole crickets: de-
veloping a strategy for success. Turfgrass Trends. 6
(1): 1-8.
COBB, P. P., AND T. P. MACK. 1989. A rating system for
evaluating tawny mole cricket, Scapteriscus vicinus
Scudder, damage (Orthoptera: Gryllotalpidae). J.
Entomol. Sci. 242: 142-144.
GASPER, J. J., J. R. STREET, S K. HARRISON, AND W. E.
POUND. 1994. Pendimethalin efficacy and dissipa-
tion in turfgrass as influenced by rainfall incorpora-
tion. Weed Sci. 42: 586-592.
NIEMCZYK, H. D. 1987. The influence of application tim-
ing and posttreatment irrigation on the fate and ef-
fectiveness of isofenphos for control of Japanese
beetle (Coleoptera: Scarabaeidae) larvae in turf-
grass, J. Econ. Entomol. 80: 465-470.
NIEMCZYK, H. D., AND H. R. KRUEGER 1987. Persistence
and mobility of isozofos in turfgrass thatch and soil.
J. Econ. Entomol. 80: 950-952.
SAS INSTITUTE. 1990. SAS/STAT user's guide, version
6.10. SAS Institute, Cary, NC.
SCHLEICHER, L. C., P. C. SHEA, R. N. STOUGAARD, AND
D. R. TUPY. 1995. Efficacy and dissipation of dithi-
opyr and pendimethalin in perennial ryegrass (Lo-
lium perenne) turf. Weed Sci. 43: 140-148.
SHORT, D. E., AND P. G. KOEHLER. 1979. A sampling
technique for mole crickets and other pests in turf-
grass and pasture. Florida Entomol. 62 (3): 282-283.


Florida Entomologist 87(1)







Dobbs & Brodel: Nonindigenous Insects in Aircraft


CARGO AIRCRAFT AS A PATHWAY FOR THE ENTRY
OF NONINDIGENOUS PESTS INTO SOUTH FLORIDA

THOMAS T. DOBBS AND CHARLES F. BRODEL
USDA, Animal and Plant Health Inspection Service, Plant Protection and Quarantine
Miami Inspection Station, P.O. Box 59-2136, Miami, FL 33159

ABSTRACT

Cargo aircraft arriving at Miami International Airport from foreign origins were randomly
selected and inspected from September 1998 to August 1999 for the presence of live hitch-
hiking insects. An overall infestation (= approach) rate of 10.4% was found, with the rate for
aircraft arriving from Central American countries noticeably greater at about 23%. Quaran-
tine-significant taxa from 33 families in five orders were detected, with members of Lepi-
doptera and Coleoptera most frequently encountered. More than 40% of infested aircraft
contained multiple insect taxa. No correlation was established between the presence of
hitchhiking insects and the time of day (night vs. day) during which cargo was loaded at
points of origin or the nature of cargo on board. Quarantine-significant organisms arrived in
cargo aircraft during all months of the year. Significant seasonality (dry season vs. wet) was
observed for pests on flights arriving from Central America, with separate peaks noted in
May and October.

Key Words: aircraft, exotic pests, nonindigenous organisms, pathway, Florida

RESUME

Los aviones de carga arrivados al Aeropuerto Internacional de Miami de origen extranjero
fueron seleccionados al azar para ser inspeccionados desde Septembre 1998 hasta Agosto
1999 para la presencia de insects vivos introducidos al pais. Se encontr6 un grado de infes-
taci6n (= abordamiento) total de 10.4%, con un grado notablemente mayor en aproximada-
mente 23% de los aviones procedentes de los paises Centroamericanos. Las classes de insects
(taxa) significativas para la cuarentena perteneciendo de 33 families y cinco ordenes fueron
detectados, con miembros de Lepid6ptera y de Cole6ptera fueron los mas frecuentemente en-
contrados. Mas del 40% de los aviones infestados tenian multiples classes de insects. No fu6
establecida una correlaci6n entire la presencia de los insects en el avi6n y la hora del dia (la
noche vs. el dia) cuando el cargamento fu6 cargado en los puntos de origen 6 la naturaleza
del cargamento en el avi6n. Los organismos significativos para la cuarentena llegaron en
aviones de cargamento durante todos los meses del aio. Las plagas observadas en las avio-
nes variaron significativamente segun la estaci6n (la estaci6n seca vs la estaci6n lluviosa),
con poblaci6nes mas altas durante mayo y octubre.


Preventing the entry and subsequent estab-
lishment of nonindigenous (= adventive sensu
Wheeler & Hoebeke 2001) organisms into the
United States has been one of the primary mis-
sions of the U.S. Department of Agriculture's An-
imal and Plant Health Inspection Service, Plant
Protection and Quarantine (APHIS-PPQ). Path-
ways of entry that it actively monitors include
passenger baggage, cargo, international mail, for-
eign garbage, and conveyances such as ships,
trains, cars, trucks, and aircraft.
APHIS-PPQ has long been aware that aircraft
have the potential to transport insects both inter-
nationally and domestically. For several decades,
Agency officials issued annual springtime alerts
for inspectors to monitor aircraft arriving from
Panama and the Canal Zone for the presence of
hitchhiking scarab beetles. Two scarab genera of
primary interest were Liogenys (L. macropelma
Bates, in particular) and Geniates. In addition,


APHIS officials annually monitor U.S. airports in
regions infested with the Japanese beetle, Popillia
japonica Newman, to ensure that domestic aircraft
do not transport this pest to non-infested areas.
Researchers also have been aware of the con-
nection between aircraft and the dissemination of
insect species from one region to another. Swain
(1952) predicted more than a half century ago that
aircraft would become a major distributor of insect
pests. He reported that nearly 3000 species of in-
sects from 293 families had already been detected
traveling aboard aircraft. Also, he attributed the
invasion of the Hawaiian Islands by the Oriental
fruit fly to abandoned exclusionary precautions in-
volving military aircraft from the Mariana Islands
during World War II. Of the insects introduced
into Guam during the 1980s, Schreiner (1991)
concluded that four species of Noctuidae and sev-
eral species of Coleoptera and Homoptera proba-
bly arrived as hitchhikers in the holds or cabin







Florida Entomologist 87(1)


areas of aircraft. McGregor (1973) stated that
many future accidental introductions of exotic in-
sects into North America would likely occur via
this pathway. Sailer (1978) argued for the creation
of ecological barriers around areas of major for-
eign traffic, such as international airports, to con-
tain introductions of nonindigenous insects.
Despite this awareness by government agen-
cies and researchers, the literature contains few
formalized studies that investigated aircraft as a
pathway for insect introduction. Of these few
studies, none focused on infestation rates (re-
ferred to as approach rates by regulatory officials)
of foreign-arriving aircraft. In addition, none con-
centrated on hitchhiking insects of potential eco-
nomic significance to agricultural crops, forests,
and ornamentals. Most of the work instead has
focused on insects of public health importance.
Studies conducted in Australia (Russell et al.
1984; Davidson 1990), Japan (Otaga et al. 1974;
Takahashi 1984), New Zealand (Laird 1951), the
Philippines (Basio et al. 1970), Singapore (Goh et
al. 1985), and the United States (Evans et al.
1963) spotlighted hitchhiking insects that vector
human pathogens or parasitize livestock. Other
researchers (Sullivan et al. 1958; Russell 1987)
studied how well insects survive in various com-
partments of jet aircraft.
Airports in Florida, subtropical South Florida
in particular, are primary arrival sites for cargo
aircraft transporting large quantities of foreign-
grown perishable products such as cut flowers,
vegetables, fruits, and ornamental plants. From
1994 to 2000, the tonnage of perishable commod-
ities imported into Florida by cargo aircraft
slightly more than doubled (Klassen et al. 2002).
Over this same period, the number of quarantine-
significant pest detections resulting from inspec-
tion of these commodities increased 1.7-fold
(Klassen et al. 2002). More than 19,000 cargo
flights arrived at Miami International Airport in
2002 (APHIS-PPQ, unpublished); this number is
projected to increase as consumption of perish-
able items throughout the U.S. increases.
Steady increases in cargo flight arrivals and
tonnage of perishables into Florida will likely be
accompanied by increased numbers of nonindige-
nous insect species that become established. Flor-
ida has a history of vulnerability to successful
invasion by such organisms. For the period 1970-
1989, about as many adventive arthropods annu-
ally became established in Florida as in all other
areas of the continental United States combined
(Frank & McCoy 1992). Only Hawaii exceeds
Florida in the number of adventive arthropods
that become established each year (Beardsley
1979). This vulnerability to invasion has affected
the composition of the fauna of Florida over time.
An estimated 15-25% of all major taxonomic
groups in South Florida are considered to be non-
indigenous, in stark contrast to 1.7% for other re-


gions within the continental United States (Ewel
1986). About 1000 of the 12,500 arthropods in
Florida, or about 8%, are nonindigenous (Frank &
McCoy 1995).
Given the vulnerability of Florida to invasion
by insects, ever-increasing arrivals of cargo air-
craft into Florida, and a lack of knowledge about
cargo aircraft as an entry pathway for adventive
organisms of potential economic impact, APHIS-
PPQ in Miami undertook a study to determine:
(1) overall and regional approach rates for cargo
aircraft arriving at Miami International Airport,
(2) the number of insect taxa aboard cargo air-
craft, (3) the taxonomic composition of inter-
cepted organisms, (4) potential day/night
differences in approach rates, (5) approach rate
differences based on cargo type, and (6) seasonal
differences in the number of organisms detected.

MATERIALS AND METHODS

Sample Size and Selection

In 1996, approximately 23,000 cargo aircraft
arrived in Miami, Florida, from foreign origins
(APHIS-PPQ, unpublished), which equates to
about 60 arrivals per day. To detect an infestation
(= approach) rate as low as 1% with a 95% level of
confidence, a sample size of 730 aircraft was se-
lected, and two aircraft were randomly selected
and inspected each day of the study period. The
study was conducted over a 12-month period from
1 September 1998 to 31 August 1999. This dura-
tion would enable seasonal effects involving rain-
fall and temperature to be detected, at least for the
most frequently sampled regions and countries.
To select samples, each day was divided into 96
quarter-hour increments. The increments were
sequentially numbered with midnight to 12:14
AM being increment number one, 12:15 to 12:29
AM being increment number two, and so on.
Daily, a random number table was used to select
two numbers from one to 96 that corresponded to
particular quarter-hour increments. The first for-
eign cargo aircraft scheduled to arrive during or
after the selected increment was designated as a
sample.

Sample Inspection Process

The regular workforce of approximately 150
APHIS-PPQ officers in Miami was specially
trained and equipped to assist with this study.
(Most APHIS-PPQ officers have subsequently
been transferred into the newly created Depart-
ment of Homeland Security, although duties re-
lating to aircraft inspections remain unchanged.)
When a sample aircraft arrived, the assigned of-
ficer immediately inspected the cockpit and galley
areas for live hitchhiking organisms (i.e., insects,
snails, slugs, and weed seeds). Unconsumed fresh


March 2004







Dobbs & Brodel: Nonindigenous Insects in Aircraft


fruits found in these areas were bagged in plastic
to be examined later for commodity-associated in-
sects and diseases. Flight crew members were
asked to provide the exact time when the aircraft
departed from the foreign airport from which it
was arriving. The officer remained at the aircraft
location throughout the cargo offloading process,
during which time all surfaces of palletized cargo
were inspected for hitchhiking organisms. When
offloading was completed, the officer intensively
examined the floors, walls, other surfaces, and air
space within all cargo compartments for hitchhik-
ing pests.
During and after the inspection, the officer re-
corded all pertinent information concerning the
aircraft and the inspection on a specially designed
data form to which were attached the cargo man-
ifest and the U.S. Customs general declaration.

Identification of Specimens

All live specimens found associated with sam-
pled aircraft were submitted to APHIS-PPQ local
specialists for immediate identification. All deter-
minations were made to the lowest taxon possi-
ble. When local specialists were unable to perform
specific identifications, specimens were for-
warded to national specialists located in Wash-
ington, DC, Beltsville, MD, Columbus, OH, and
Miami, FL, depending on the type of organism in-
tercepted. Specimens could not always be identi-
fied to the species or generic level because of the
poor condition of material, lack of specialists or
scientific knowledge for certain taxonomic
groups, and taxonomic keys based on a single sex.
Following identification, specimens were cate-
gorized as either quarantine-significant (QS) or
non-quarantine-significant (NQS). QS taxa are
defined as species of plant-feeding insects, mites,
or mollusks, plant-infecting pathogens, or weed
seeds that are not known to occur, or are not
widely distributed, in the United States. Speci-
mens belonging to plant-feeding groups, but iden-
tified only to the family or generic level, are also
placed in this category because they could poten-
tially represent QS taxa. NQS taxa are species
that are widely distributed in the United States
and/or are categorized by APHIS-PPQ as not
likely to pose a significant threat to U.S. agricul-
ture, forests, and ornamentals.
We did not classify the relative risk levels of
QS taxa. Instead, individual interceptions were
simply grouped into one of the two categories out-
lined above, a practice that is widely used within
APHIS-PPQ when making quarantine decisions.

Data Collection and Analysis

All data relating to the sampled aircraft were
collected from specially designed data forms com-
pleted by the officers, or from official federal doc-


uments associated with the aircraft. Selected
data were compiled into a local database. In addi-
tion, all data on QS taxa were recorded in the na-
tional Port Information Network (PIN) database
which contains all pest interception reports since
1985. References to new records in this study im-
ply that a given QS taxon did not appear in PIN in
association with (1) aircraft as an entity, apart
from any transported cargo, and/or (2) a particu-
lar U.S. port of entry, e.g., Miami.
Countries were grouped into one of the follow-
ing regions for purposes of calculating regional
approach rates: Central America, South America,
West Indies, Europe, and Other. Trinidad was
considered to be part of South America, not the
West Indies, in keeping with other federal prac-
tices. Mexico was included among Central Ameri-
can countries. Canada and Taiwan were grouped
in the artificial category "Other".
A comparison of data for aircraft loaded during
daylight hours versus those for aircraft loaded at
night was made to determine if bright lights nec-
essary for nighttime cargo operations attracted
nocturnal fliers, thus increasing approach rates.
The comparison was difficult because the precise
time during which aircraft are loaded at the point
of origin is not recorded by airline personnel. Air-
craft logbooks, however, consistently reflect the
time at which aircraft depart. Our experience at
Miami International Airport has shown that com-
mercial aircraft nearly always depart immediately
after cargo loading is complete. Time of departure
was therefore used as a close approximation of the
time when cargo was loaded. Aircraft with depar-
ture times between 7:00 AM and 7:00 PM were
considered to be loaded during daylight hours,
while those departing between 7:00 PM and 7:00
AM were considered to be night-loaded. Efforts
were focused on cargo aircraft arriving from Cen-
tral America since approach rates from this region
were substantially higher than those observed
from any other. Departure times for seven aircraft
from this region were not available. Temporal
analyses also were performed on the Auchenor-
rhyncha, Noctuidae and Scarabaeidae found.
These three groups were repeatedly intercepted
during the study and are either primarily noctur-
nal or generally attracted to lights. Each was ex-
amined to determine if time of loading had any
effect on their presence as hitchhikers.
To determine if certain types of cargo were
more attractive to hitchhiking organisms, the
commodities being transported were divided into
two broad categories, regulated and non-regu-
lated, with the approach rates of each examined.
Regulated cargoes are agricultural in nature and
are generally inspected on arrival by APHIS-
PPQ. Plants or plant products make up the bulk
of these items. Non-regulated cargoes are miscel-
laneous items not considered to be derived from
agricultural sources.







Florida Entomologist 87(1)


Investigations into potential aspects of season-
ality were restricted to Central America since air-
craft arriving from that region experienced a far
greater approach rate than did aircraft from any
other region. Central America has essentially two
seasons, wet and dry (Alfaro 2000). The onset of
the wet season varies slightly from year to year
but begins around May and lasts for approxi-
mately six months. For the purposes of our analy-
ses, we considered the wet season to be from 1
May through 31 October, and the dry season to be
from 1 November through 30 April. Aircraft were
grouped into one these two categories and the ap-
proach rate for each was examined.
The G-test of independence (Sokal & Rohlf
1981) was used to determine if the presence of QS
organisms in sampled cargo aircraft varied inde-
pendently of or was correlated with (1) the time of
departure from foreign origins, (2) the nature of
the cargo loaded aboard and (3) the season of de-
parture. For the time and season of departure,
only the data pertaining to aircraft originating in
Central America were included in the G-test. Re-
garding the nature of cargo, sampled aircraft
from all geographic regions were included. In all
cases, G values were adjusted by Williams' correc-
tion for 2 x 2 contingency tables (Sokal & Rohlf
1981) and then compared with the critical value
of chi square at the 5% significance level and 1 de-
gree of freedom.

RESULTS AND DISCUSSION

Approach Rates by Region and Country

Aircraft were sampled from 38 countries dur-
ing the study, with QS organisms detected in air-
craft arriving from 17 of these. The overall pest
approach rate for foreign cargo aircraft arriving
at Miami International Airport was 10.4% (Table
1). The approach rate for Central America (23.2%)
was substantially greater than rates observed for
any other region. Aircraft from all sampled coun-
tries in Central America contained QS organisms.
Approach rates for individual countries within
Central America varied slightly, with Costa Rica,
El Salvador, Guatemala, and Honduras all
greater than 23%. Mexico and Panama were ap-
proximately 10 percentage points lower. The ap-
proach rate for Nicaragua was substantially
greater ('".- I, although this figure might be less
reliable than others for the region due to the com-
paratively smaller sample size. The mean ap-
proach rate of more than 23% was at least four
times that seen from any other region.
Approach rates for South American countries
ranged from 0 to 15.9%, with a mean of 5.8%. Air-
craft from six of the ten sampled countries con-
tained QS pests. Small sample sizes for Argentina
(7), Bolivia (4), and Uruguay (1) produced ques-
tionable approach rates for these countries. Ecua-


dor had the highest approach rate for the region,
followed by Trinidad. Rates observed for Peru and
Colombia were noticeably lower. The approach
rate for Argentina was also quite high, although
the sample size (7) was relatively small. More air-
craft were sampled from Colombia (155) than
from any other country during the study, reflect-
ing the tremendous volume of goods it exports to
Miami. Most of those aircraft transported perish-
able cut flowers that could be attractive to phy-
tophagous pests but, despite that, the observed
approach rate almost equaled the mean rate for
the region. Large numbers of aircraft from Brazil,
Chile, and Venezuela were sampled, but very few
were infested.
Approach rates for countries within the West
Indies also varied considerably, ranging from 0 to
18%. Infested aircraft originated from just three
countries in the region-Jamaica, Haiti, and the
Dominican Republic. The approach rate for Haiti
(18%) was more than twice that of any other coun-
try in the region, albeit from a comparatively
small sample size of 11. In contrast, Bahamas
and the Dominican Republic, the two countries in
the region with the largest number of sampled
aircraft, had lesser approach rates of 0 and 2.9%,
respectively.
We made no inferences about approach rates
for other regions because sample sizes were usu-
ally small. The lone infested aircraft from France
can be called into question. The scarab beetle
found on board belonged to a genus (Dyscinetus)
known only from the Western Hemisphere (En-
dr6di 1985). More likely, this insect actually en-
tered the aircraft during a fueling stopover in
Canada. In general, more data are necessary to
better understand the risks associated with cargo
aircraft from these areas.

Diversity of Intercepted Taxa

Various QS organisms were intercepted from
infested aircraft samples. In total, 151 insects
from 33 families in five orders were represented,
along with one plant pathogen (citrus canker in
aircraft stores from Argentina) (Table 2). All in-
sect specimens were adults except two. A larva of
Crocidosema aporema (Walsingham) was found
in the emptied hold of an aircraft from Guatemala
and likely originated from boxes of beans on
board. In the second case, a tettigoniid nymph
was found aboard an aircraft transporting fruits
and live plants from Costa Rica.
Lepidoptera comprised the largest single com-
ponent of captured specimens, followed closely by
Coleoptera (Fig. 1). These findings generally
agree with those of Frank & McCoy (1992), who
noted that the two most numerous orders of non-
indigenous organisms reported new to Florida
since 1971 were Lepidoptera and Coleoptera.
Conspicuous by their absence were interceptions


March 2004








Dobbs & Brodel: Nonindigenous Insects in Aircraft


TABLE 1. APPROACH RATES BY COUNTRY AND REGION FOR CARGO AIRCRAFT ARRIVING AT MIAMI INTERNATIONAL AIR-
PORT, 1 SEP. 1998-31 AUG. 1999.


Aircraft sampled (n)


Aircraft infested (x)


Central America
Costa Rica
El Salvador
Guatemala
Honduras
Mexico
Nicaragua
Panama

Region
South America
Argentina
Bolivia
Brazil
Chile
Colombia
Ecuador
Peru
Trinidad
Uruguay
Venezuela

Region
West Indies
Antigua
Aruba
Bahamas
Barbados
Cayman Is.
Cuba
Dominica
Dominican Republic
Grenada
Haiti
Jamaica
St. Kitts
St. Lucia
St. Vincent
Turks & Caicos

Region

Europe
France
Luxembourg
Netherlands
Spain
Region

Other
Canada
Taiwan


Approach rate
(xln)100 (%)


25.0


Overall 703 73 10.4

*Origin questionable







Florida Entomologist 87(1)


March 2004


TABLE 2. QUARANTINE-SIGNIFICANT ORGANISMS INTERCEPTED IN FOREIGN CARGO AIRCRAFT ARRIVING AT MIAMI IN-
TERNATIONAL AIRPORT, 1 SEP. 1998-31 AUG. 1999.

Organism Origin Frequency

COLEOPTERA

Chrysomelidae
Alticinae, species Mexico 1
Acalymma sp.a'b Ecuador 1
Guatemala 1
Altica sp.'b El Salvador 1
Amphelasma sp.'a,,c Honduras 1
Colaspis sp. El Salvador 1
Honduras 2
Epitrix sp.'a, El Salvador 1
Exora encaustica (Germar)'ba' El Salvador 1
Longitarsus sp.a Ecuador 1
Malacorhinus irregularis (Jacoby)'a,,c El Salvador 1
Metachroma sp.a Costa Rica 1
Rhabdopterus sp. Costa Rica 1
Typophorus sp. El Salvador 1
Curculionidae
Curculionidae, species El Salvador 1
Brachycerinae, species El Salvador 1
Cleogonus sp.',b El Salvador 1
Conotrachelus sp. El Salvador 1
Elateridae
Conoderus pictus (Candeze)'a, El Salvador 1
Conoderus rodriguezi Candeze Costa Rica 1
Guatemala 1
Scarabaeidae
Anomala sp. Costa Rica 2
Guatemala 1
Honduras 1
Nicaragua 1
Trinidad 1
Cyclocephala sp. Ecuador 1
El Salvador 1
Honduras 1
Panama 1
Diplotaxis sp. Mexico 1
Dyscinetus sp. France (?) 1
Euetheola bidentata Burmeister'a,,c El Salvador 1
Liogenys quadridens (Fabricius) Ecuador 1
Liogenys sp. Colombia 1
Ecuador 1
Manopus sp. Colombia 1
Phyllophaga sp. Colombia 1
Guatemala 2
Tomarus sp. El Salvador 1
Guatemala 2
Trinidad 1

New find in Miami aircraft.
bNew find in aircraft nationwide.
'New Miami record, all sources.
dNew U.S. record, all sources.
'Immature stage.







Dobbs & Brodel: Nonindigenous Insects in Aircraft


TABLE 2. (CONTINUED) QUARANTINE-SIGNIFICANT ORGANISMS INTERCEPTED IN FOREIGN CARGO AIRCRAFT ARRIVING
AT MIAMI INTERNATIONAL AIRPORT, 1 SEP. 1998-31 AUG. 1999.

Organism Origin Frequency

Tenebrionidae
Blapstinus sp. Costa Rica 1
Trinidad 1

HEMIPTERA: Auchenorrhyncha

Auchenorrhyncha, species Costa Rica 1
Cercopidae
Prosapia sp.'b,' Costa Rica 1
El Salvador 1

Cicadellidae
Cicadellidae, species Honduras 2
Typhlocybinae, species Mexico 1
Dikraneurini, species Panama 1
Chlorotettix sp.',b,'d Honduras 1
Exitianus sp.abcd Honduras 1
Graphocephala sp.'a,, Ecuador 1
Haldorus sp.a'bcd Haiti 1
Tagosodes sp.'a, c El Salvador 2
Cixiidae
Cixiidae, species Mexico 1
Pintalia sp.'a,~ Honduras 1

Nogodinidae
Bladina vexans Kramer'abd Colombia 1

HEMIPTERA: Heteroptera
Cydnidae
Cydnidae, species Guatemala 1
Lygaeidae
Nysius sp. Nicaragua 1
Miridae
Phylinae, species Ecuador 1
Reuteroscopus sp.',b Mexico 1
Sixeonotus sp.ab El Salvador 1
Tropidosteptes chapingoensis Carvalho & Rosas'abd Colombia 1
Tropidosteptes sp. Guatemala 1
Pentatomidae
Berecynthus hastator (Fabricius)" El Salvador 1

Rhopalidae
Jadera sp. Costa Rica 1

Rhyparochromidae
Rhyparochromidae, species El Salvador 1
Prytanes sp. Guatemala 1
ISOPTERA
Kalotermitidae
Cryptotermes sp.'a, Honduras 1

aNew find in Miami aircraft.
bNew find in aircraft nationwide.
'New Miami record, all sources.
New U.S. record, all sources.
'Immature stage.








Florida Entomologist 87(1)


March 2004


TABLE 2. (CONTINUED) QUARANTINE-SIGNIFICANT ORGANISMS INTERCEPTED IN FOREIGN CARGO AIRCRAFT ARRIVING
AT MIAMI INTERNATIONAL AIRPORT, 1 SEP. 1998-31 AUG. 1999.

Organism Origin Frequency


LEPIDOPTERA

Arctiidae
Arctiidae, species
Empyreuma sp.ab,',d

Crambidae
Crambidae, species


Elachistidae
Elachistidae, species

Gelechioidea
Gelechioidea, species
Gelechiidae, species
Geometridae
Geometridae, species


Eupethecia sp.,'b

Gracillariidae
Phyllocnistis sp.a,''
Noctuidae
Noctuidae, species







Catocalinae, species

Copitarsia sp.
Elaphria sp.
Eulepidotis mabis Guen6ee'ba,,d
Ophisma sp.ab,,d
Pararcte schneideriana (Stoll)ab',d
Phalaenophana fadusalis Walker'a,',,d

Notodontidae
Notodontidae, species

Oecophoridae
Stenomatinae, species

Pyraloidea
Pyraloidea, species
Pyralidae, species


Colombia
Dominican Republic


Costa Rica
Nicaragua


Costa Rica


Dominican Republic
Guatemala


Costa Rica
Ecuador
Guatemala
Nicaragua
Panama
Guatemala


Colombia


Costa Rica
Guatemala
Haiti
Honduras
Mexico
Nicaragua
Panama
Costa Rica
Mexico
Colombia
Costa Rica
Costa Rica
Nicaragua
Ecuador
Costa Rica


Costa Rica


Costa Rica


Guatemala
El Salvador
Peru


"New find in Miami aircraft.
bNew find in aircraft nationwide.
'New Miami record, all sources.
dNew U.S. record, all sources.
'Immature stage.







Dobbs & Brodel: Nonindigenous Insects in Aircraft


TABLE 2. (CONTINUED) QUARANTINE-SIGNIFICANT ORGANISMS INTERCEPTED IN FOREIGN CARGO AIRCRAFT ARRIVING
AT MIAMI INTERNATIONAL AIRPORT, 1 SEP. 1998-31 AUG. 1999.

Organism Origin Frequency

Sphingidae
Sphingidae, species Venezuela 1
Tineidae
Acrolophinae, species Colombia 1
Tortricidae
Crocidosema aporema (Walsingham)'b,' Guatemala 1
ORTHOPTERA
Gryllidae
Gryllidae, species Costa Rica 1
Allonemobius sp.,b Honduras 1
Gryllus capitatus Saussure Ecuador 1
Gryllus sp. Colombia 1
Costa Rica 3
Guatemala 2
Honduras 3
Jamaica 1
Tetrigidae
Tettigidea sp.,b',d El Salvador 1
Tettigoniidae
Tettigoniidae, species Costa Rica 1
Honduras 1
Bucrates capitatus (De Geer) Colombia 1
Conocephalus sp. Honduras 1
Neoconocephalus punctipes (Redtenbacher)' 'b'd El Salvador 1
PLANT PATHOGEN
Xanthomonas axonopodis Starr & Garces pv. citri (Hasse) Dye Argentina 1

New find in Miami aircraft.
bNew find in aircraft nationwide.
'New Miami record, all sources.
dNew U.S. record, all sources.
'Immature stage.


of Diptera and Hymenoptera. Members of these
orders might be comparatively less attracted to
light, QS groups such as leafminers and gall
midges tend to be difficult to detect due to their
small size, and relatively few QS taxa occur in
these orders.
A sizable number of organisms intercepted
during the study represented new records for
APHIS-PPQ. These are denoted with superscripts
in the list of taxa (Table 2). Of the 151 pests iden-
tified from infested aircraft, 32 (21%) belonged to
taxa that had not previously been intercepted in
cargo or passenger aircraft at U.S. ports of entry.
Moreover, 13 (9%) of them had never been inter-
cepted in conjunction with any pathway of entry.

Pests Per Infested Aircraft

Officers intercepted 151 QS organisms from
the 73 infested aircraft. Some of these aircraft


contained multiple organisms. The data indicate
an inverse curvilinear relationship between the
number of infested aircraft and the number of QS
taxa per infested aircraft (Fig. 2). Accordingly,
59% of the infested aircraft had only one QS
taxon, while 41% contained more than one, in-
cluding one aircraft with 18. No other aircraft had
more than seven QS pests.
Some infested aircraft harbored multiple indi-
viduals of the same taxon. For example, one air-
craft sample contained a male and female of
Tomarus (Coleoptera: Scarabaeidae). In such sit-
uations, the risk of establishment would presum-
ably increase due to the presence of potential
mating pairs.

Diurnal Patterns

Approach rates for all insect groups combined
were not significantly different (G-test for indepen-







Florida Entomologist 87(1)


Orthoptera
12.6%
Hemiptera:
Auchenorrhyncha
10.6% /

Hemiptera:
Heteroptera
7.3%
Plant Pathogenj
0.7%
Isoptera Lepidoptera
0.7% 36.4%


Coleoptera
31.8%


Fig. 1. Relative proportions of quarantine-significant
taxa captured in foreign cargo aircraft arriving at Mi-
ami International Airport, 1 Sep. 1998-31 Aug. 1999.


dence;p > 0.05) for day versus night loading (Table
3). This apparent lack of correlation between time
of loading and the presence of QS organisms sug-
gests that APHIS-PPQ should continue to monitor
cargo aircraft throughout the day.
Approach rates for the three primarily noctur-
nal groups also were not significantly different



45


40-


42 35-
L

S 30-


1 25
C
20-
0

O 15-
.03


TABLE 3. NUMBERS OF INFESTED CARGO AIRCRAFT FROM
CENTRAL AMERICA: CORRELATION OF DEPAR-
TURE TIME AND APPROACH RATE AT MIAMI IN-
TERNATIONAL AIRPORT."

Departure Not Approach
Time Infested Infested Rate

Day 14 62 18.4%
Night 35 89 28.2%

("G3 of 2.488 not significant a:o


(G-test for independence;p > 0.05) for day versus
night loading (Table 4). The daylight condition
during which loading took place was independent
of Noctuidae, Scarabaeidae, and Auchenorrhyn-
cha later being found aboard the aircraft. These
results are somewhat surprising because these
groups are generally attracted to lights. In expla-
nation, some actual loading times might have dif-
fered substantially from recorded departure
times. Also, some nocturnal hitchhikers might
have entered aircraft during nighttime loading
operations and subsequently made several round
trips before being detected and incorrectly associ-
ated with day-loaded aircraft.


1 2 3 4 5 6 7 18

Number of quarantine-significant taxal infested aircraft

Fig. 2. Numbers of quarantine-significant taxa found aboard infested foreign cargo aircraft arriving at Miami In-
ternational Airport, 1 Sep. 1998-31 Aug. 1999.


March 2004







Dobbs & Brodel: Nonindigenous Insects in Aircraft


TABLE 4. NUMBERS OF CENTRAL AMERICAN CARGO AIRCRAFT INFESTED WITH NOCTUIDAE, SCARABAEIDAE AND
AUCHENORRHYNCHA: CORRELATION OF DEPARTURE TIME AND APPROACH RATE AT MIAMI INTERNATIONAL
AIRPORT.

Pest Departure Time Infested Not Infested Approach Rate

Noctuidae" Day 5 71 6.6%
Night 9 115 7.3%
Scarabaeidaeb Day 5 71 6.6%
Night 4 120 3.2%
Auchenorrhynchac Day 3 73 3.9%
Night 6 118 4.8%

"GO of 0.029 not significant at X2o0,.
'bGO of 1.121 not significant at X',,,.
'Gd of 0.085 not significant at X o ,.


Nature of Cargo

Demonstrating that higher approach rates re-
sult when cargo aircraft transport particular
types of cargo might enable APHIS-PPQ manag-
ers to assign greater priority to inspection of those
aircraft. Analysis of the data (Table 5), however,
showed that approach rates for cargo aircraft
were not dependent on whether regulated or non-
regulated cargo was being transported (G-test for
independence;p > 0.05). These results point to the
need to inspect all foreign cargo aircraft arriving
at Miami International Airport, regardless of the
type of cargo being transported. Despite these re-
sults, though, it is conceivable that particular
commodities, regulated and non-regulated alike,
might serve to attract specific kinds of hitchhik-
ing pests both before and during the cargo aircraft
loading process. We note that 65% of the cargo air-
craft sampled contained regulated agricultural
material.

Seasonality Patterns

Monthly approach rates for aircraft from all or-
igins were consistently greater in the spring and
summer, with additional isolated peaks of 10% or
greater in October and December (Fig. 3). QS or-
ganisms arrived at Miami International Airport


TABLE 5. NUMBERS OF INFESTED CARGO AIRCRAFT FROM
ALL ORIGINS: CORRELATION OF CARGO TYPE
AND APPROACH RATE AT MIAMI INTERNA-
TIONAL AIRPORT.A'"

Not Approach
Type Infested Infested Rate

Regulated 51 397 12.8%
Non-regulated 22 217 10.1%

"16 samples were either empty or contained indeterminable
cargo.
'bGa of 0.951 not significant at X'5o,.


via foreign cargo aircraft during all months of the
year.
A pattern of seasonality emerged for Central
America, but not for other regions. The infestation
pattern for Central America (Fig. 4) resembled
that for all regions combined (Fig. 3). Distinct
peaks occurred in October and May, with the in-
festation percentage from April through August
remaining at a generally high level. Unlike the
pattern for all regions, however, the peak in Octo-
ber was as great as that in May. Approach rates
for cargo aircraft arriving from Central America
were significantly greater during the wet season
there (about 29% from May through October) than
during the dry season (about 16% from November
through April) (G-test for independence;p < 0.05)
(Table 6). Despite this seasonal difference, rates
during the dry season were not low enough, in our
opinion, to warrant deployment of personnel away
from this pathway. Only in September and No-
vember did the percentage of infestation fall be-
low 10 (Fig. 4). Additionally, there were two
distinct peaks in January and April.
The pattern of total numbers of QS organisms
per month (Fig. 5) largely resembled that for the
percentage of infested aircraft per month (Fig. 3).
The results for June, however, differed markedly.
The percentage of infested aircraft for June was
only moderate (Fig. 3), but the number of pests
was exceptionally large (Fig. 5). This difference is
attributable to an unusually large number of in-
tercepted organisms (18) aboard a single aircraft
from El Salvador (see Fig. 2).
We recognize that oceanographic and atmo-
spheric factors, combined with latitude, influence
when the wet and dry seasons begin and end an-
nually in Central America (Alfaro 2000). Given
these, it would be beneficial to gather multiple
years of data for this region to improve under-
standing of any seasonality patterns. To obtain a
similar understanding for the West Indies, much
greater numbers of cargo aircraft would have to
be sampled annually from a larger number of is-
land countries. It might be more difficult to eluci-






Florida Entomologist 87(1)


2


5-
S10


-0n nH nHnH n HlH
Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug
'98 '99
Months
Fig. 3. Percent infested foreign cargo aircraft arriving from all origins at Miami International Airport, 1 Sep.
1998-31 Aug. 1999.


date seasonal patterns for South America due to
its wide spectrum of topography, vegetation, lati-
tudes, and bodies of water.
CONCLUSIONS
Our study demonstrated an overall pest infes-
tation rate of 10.4% for foreign-arriving cargo air-
craft at Miami International Airport. Cargo
aircraft arriving from Central America had a
much greater infestation rate of about 23%. In
other words, almost one in four cargo aircraft ar-


riving from Central American countries harbored
live, nonindigenous organisms of potential eco-
nomic impact to U.S. agriculture, forests, and or-
namentals. Cargo aircraft arriving from these
countries represent a potentially significant path-
way for the introduction of adventive insects into
South Florida. During the study, QS organisms
arrived every month of the year, although peaks
seemed to emerge in the fall and spring. The di-
versity of taxa encountered was substantial, with
intercepted QS insects representing 33 families
in five orders. Members of the Lepidoptera and


n n


E-L'I


Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug


Months


Fig. 4. Percent infested foreign cargo aircraft arriving from Central America at Miami International Airport, 1
Sep. 1998-31 Aug. 1999.


60
S50-
40-
"o 30-
S20o
S10
0
0


F]H


March 2004







Dobbs & Brodel: Nonindigenous Insects in Aircraft


TABLE 6. NUMBERS OF INFESTED CARGO AIRCRAFT FROM
CENTRAL AMERICA: CORRELATION OF SEASON
OF DEPARTURE AND APPROACH RATE AT MIAMI
INTERNATIONAL AIRPORT."

Not Approach
Season Infested infested rate

Wet 34 84 28.9%
Dry 14 75 15.7%

(G3 of 4.996 significant at X o0(1.

Coleoptera were most prevalent. Time of cargo
loading and the types of cargo on board had no
bearing on whether a particular aircraft con-
tained QS organisms.
How to reduce the risks associated with this
potential threat is the next question facing
APHIS-PPQ managers. In recent years, calls for
the formulation of offshore risk mitigation strate-
gies have arisen within the regulatory and scien-
tific communities of the United States (National
Plant Board 1999, Shannon 1999, Klassen et al.
2002). Components of these strategies concerning
commercial shipments have existed for decades
and include pre-clearance programs, pest-free
zones, cold treatments, and hot water treatments
(Klassen et al. 2002).
Applied to cargo aircraft, such strategies
might include one or more of the following for
particular regions, countries, or even specific air-
ports judged to be high-risk for hitchhiking in-
sects: (1) periodically applying residual
pesticides to the walls, floor, and ceiling of cargo
holds; (2) placing insecticide-impregnated baits


throughout the holds; (3) deploying sodium vapor
lamps around aircraft during night loading so
that fewer insects are attracted (Naumann &
McLachlan 1999); (4) removing vegetation serv-
ing as potential pest reservoirs within a certain
radius of cargo aircraft loading sites; (5) using
black lights in vegetative areas away from air-
craft to capture moths, beetles and other noctur-
nal fliers; (6) using compressed air to clean out
cargo holds prior to loading; and (7) installing
overlapping flexible plastic flaps in cargo door-
ways to impede the entry and exit of hitchhiking
pests.
Additional surveys of cargo aircraft from coun-
tries and regions not adequately sampled in this
study would provide useful information that could
be incorporated into an overall strategy for miti-
gating the risks associated with this pathway. Ex-
panding the present study to include passenger
and private aircraft would provide additional in-
formation that APHIS-PPQ managers could use to
formulate improved pest exclusion practices.

ACKNOWLEDGMENTS
We thank the following USDA, ARS, Systematic En-
tomology Laboratory personnel for their valuable assis-
tance with insect identifications: David Adamski, John
Brown, Thomas Henry, Alex Konstantinov, Steven Lin-
gafelter, Stuart McKamey, Gary Miller, David Nickle,
Michael Pogue, and Alma Solis. Appreciation is also ex-
tended to Steven Passoa, USDA, APHIS, PPQ, Museum
of Biodiversity, Ohio State University, for identifying
numerous specimens of Lepidoptera. We express our
gratitude to Fernando Lenis for his assistance with
graphics production, and Thomas Skarlinsky and Will-
iam Tang for specimen curation and preparation. We


nHF


Sep Oct Nov Dec Jan
'98 '99


Feb Mar Apr May Jun Jul Aug


Months


Fig. 5. Number of quarantine-significant organisms (QSOs) intercepted in foreign cargo aircraft arriving at Mi-
ami International Airport, 1 Sep. 1998-31 Aug. 1999.











thank Julieta Brambila, Barney Caton, Michael Shan-
non, and A. G. Wheeler for critically reviewing an ear-
lier version of the manuscript.

REFERENCES CITED

ALFARO, E. J. 2000. Some characteristics of the precipi-
tation annual cycle in Central America and their re-
lationships with its surrounding tropical oceans.
Top. Meteor. Oceanog. 7(2): 99-115.
BASIO, R. G., M. J. PRUDENCIO, AND I. E. CHANCE. 1970.
Notes on the aerial transportation of mosquitoes and
other insects at the Manila International Airport.
Philippine Entomologist 1 (5): 407-408.
BEARDSLEY, J. W. 1979. New immigrant insects in Ha-
waii 1962 through 1976. Proceedings of the Hawai-
ian Entomological Society 23: 35-44.
DAVIDSON, S. 1990. Screw-worm stowaways-assessing
the risk. Rural Research 146: 29-31.
ENDRODI, S. 1985. The Dynastinae of the World. Dr. W.
Junk Publishers, Dordrecht, Netherlands. 800 pp.
EVANS, B. R., C. R. JOYCE, AND J. E. PORTER 1963. Mos-
quitoes and other arthropods found in baggage com-
partments of international aircraft. Mosquito News
23: 9-12.
EWEL, J. J. 1986. Invasibility: lessons from South Flor-
ida, pp. 214-230. In H. A. Mooney and J. A. Drake
(eds.). Ecology of Invasions of North America and
Hawaii. Springer-Verlag, New York.
FRANK, J. H., AND E. D. McCOY. 1992. The immigration
of insects to Florida, with a tabulation of records
published since 1970. Florida Entomologist 75: 1-28.
FRANK, J. H., AND E. D. McCOY. 1995. Invasive adven-
tive insects and other organisms in Florida. Florida
Entomologist 78: 1-15.
GOH, K. T., S. K. NG, AND S. KUMARAPATHY. 1985. Dis-
ease-bearing insects brought in by international air-
craft into Singapore. Southeast Asian J. Trop.
Medicine and Public Health 16 (1): 49-53.
KLASSEN, W., C. F. BRODEL, AND D. A. FIESELMANN.
2002. Exotic pests of plants: current and future threats
to horticultural production and trade in Florida and
the Caribbean Basin. Micronesica Suppl. 6: 5-27.
LAIRD, M. 1951. The accidental carriage of insects on
board aircraft. J. Royal Aeronautical Soc. 55: 735-743.
MCGREGOR, R. C. 1973. The emigrant pests: a report to
Dr. Francis J. Mulhern, Administrator, Animal and
Plant Health Inspection Service, Hyattsville, MD.
NATIONAL PLANT BOARD. 1999. Safeguarding American
Plant Resources: A Stakeholder Review of the
APHIS-PPQ Safeguarding System. APHIS, USDA,
Washington, DC. 133 pp.


March 2004


NAUMANN, I. D., AND K. MCLACHLAN. 1999. Aircraft dis-
insection, unpublished report, Australian Quaran-
tine and Inspection Service. 125 pp.
OTAGA, K., I. TANAKA, Y. ITO, AND S. MORII. 1974. Sur-
vey of the medically important insects carried by in-
ternational aircraft to Tokyo International Airport.
Japanese J. Sanitary Zool. 25: 177-184.
RUSSELL, R. C. 1987. Survival of insects in the wheel
bays of a Boeing 747B aircraft on flights between
tropical and temperate airports. Bull. World Health
Organization 65(5): 659-662.
RUSSELL, R. C., N. RAJAPAKSA, P. I. WHELAN, AND W. A.
LANGSFORD. 1984. Mosquito and other insect intro-
ductions to Australia aboard international aircraft,
and the monitoring of disinsection procedures, pp.
109-142. In M. Laird (ed.). Commerce and the
Spread of Pests and Disease Vectors. Praeger, New
York.
SAILER, R. I. 1978. Our immigrant fauna. Bulletin En-
tomol. Soc. of America 23: 3-11.
SCHREINER, I. H. 1991. Sources of new insects estab-
lished on Guam in the post World War II period. Mi-
cronesica Suppl. 3: 5-13.
SHANNON, M. 1999. Challenges in safeguarding Florida
and the U.S. against invasive pests, pp. 11-13. In
W. Klassen (Chair). Mitigating the effects of exotic
pests on trade and agriculture, Part A. The Carib-
bean. Proceedings of T-STAR Workshop-X, 16-18
June, 1999, Homestead, Florida. Cooperative State
Research, Education, and Extension Service,
USDA.
SOKAL, R. R., AND F. J. ROHLF. 1981. Biometry, 2nd ed.
V. H. Freeman and Co., San Francisco. 859 pp.
SULLIVAN, W. N., F. R. Du CHANOIS, AND D. L. HAYDEN.
1958. Insect survival in jet aircraft. J. Econ. Ento-
mol. 51(2): 239-241.
SWAIN, R. B. 1952. How insects gain entry, pp. 350-355.
In F. C. Bishop (Chairman) et al. (eds.). Insects: the
Yearbook of Agriculture, 1952. U.S. Government
Printing Office, Washington, D.C.
TAKAHASHI, S. 1984. Survey on accidental introductions
of insects entering Japan via aircraft, pp. 65-80. In
M. Laird (ed.). Commerce and the Spread of Pests
and Disease Vectors. Praeger, New York.
WHEELER, A. G., JR., AND E. R. HOEBEKE. 2001. A his-
tory of adventive insects in North America: their
pathways of entry and programs for their detection,
pp. 3-15. In Detecting and monitoring invasive spe-
cies. Proceedings of the Plant Health Conference
2000: Raleigh, North Carolina. USDA, APHIS, PPQ,
Center for Plant Health Science and Technology, Ra-
leigh, NC.


Florida Entomologist 87(1)







Scientific Notes


NATURAL HISTORY OF THE FLAT BUG ARADUS GRACILICORNIS
IN FIRE-KILLED PINES (HETEROPTERA: ARADIDAE)


MARK DEYRUP1 AND JACKSON G. MOSLEY2
1Archbold Biological Station, P.O. Box 2057, Lake Placid, FL 33862

2P.O. Box 994, 720 Grove St., Bowling Green, FL 33834


The Aradidae (Heteroptera) is a widely distrib-
uted family of characteristically flat bugs, includ-
ing 128 species in North America north of Mexico,
of which 84 are in the genus Aradus (Taylor
2002). Most species ofAradus feed on fungi, espe-
cially fungi associated with dead trees (Froe-
schner 1988). A European species,A. laeviusculus
Reuter, is known to be associated with fungi
found on fire-killed or fire-damaged conifers (Lap-
palainen & Simola 1998).
Aradus gracilicornis Stal is a relatively small
(4.8-5.8 mm in length) black species. Adults are
most easily recognized by the unusually long and
slender antennae and the whitish wings with
black markings (Fig. la). A redescription of the
species, including genitalic structures, has been
provided by Heiss (1993). It occurs from North
Carolina south through Florida (also Cuba), west
into New Mexico (Froeschner 1988). Blatchley
(1926) reported specimens collected from under
the bark of oak, and by sweeping along the mar-
gin of a pond. Our study was intended to provide
more information on the natural history of this
species. This is part of a larger effort to document
the relationship between fire and insects in natu-
ral habitats of south Florida.
The Archbold Biological Station (ABS) is a pri-
vate research field station in south-central penin-
sular Florida, Highlands Co. Most habitats of the
ABS are managed by relatively small control
burns in an attempt to mimic natural fire fre-
quencies attributed to lightning. On 12 February,
2001, an accidentally ignited fire burned over 300
ha of the ABS under drought conditions with a
high wind. This intense fire killed large numbers
of south Florida slash pine (Pinus elliottii densa
Little & Dorman). In March, 2002, we began a
study to determine whether A. gracilicornis
breeds in fire-killed trees.
The main building of the ABS is located at
2010'50"N, 81021'00"W. Our study site was west
of the main buildings in pine flatwoods and sea-
sonal pond habitats with sparsely distributed
P elliottii. Bands of bark about 60 cm wide encir-
cling the tree were taken from 55 trees of varying
sizes. The outer bark of south Florida slash pine is
made up of fine loose layers, between which the
A. gracilis conceal themselves. Each band of bark
was broken into pieces 3 cm x 3 cm or smaller and
placed in a sifter with a 5 mm mesh. The bark was
then shaken vigorously, and the sifted bark bits


extracted into cups of alcohol with a Tulgren fun-
nel. Collections began on 8 March 2002, and
ended on 10 June 2002. Voucher specimens are in
the ABS collection of arthropods.
Aradus gracilis can occur in large numbers in
fire-killed Pinus elliottii, and a few fire-killed
trees could probably produce hundreds, if not


Fig. 1.Aradus gracilicornis. A: Adult male; length
of specimen 5.2 mm. B. Head of nymph; length of speci-
men 5.6 mm.







Florida Entomologist 87(1)


thousands of individuals. Specimens were ex-
tracted from 27 of the 55 trees sampled. Bugs per
sample ranged from 1 to 68. Six samples had
more than 20 individuals. Considering the width
of the band of bark removed from each tree (about
60 cm), it seems likely that some trees produce
hundreds ofA. gracilicornis. This high population
after a large fire might not be typical of all sites.
The annual occurrence of small fires at the ABS
may increase or stabilize the local reservoir of in-
dividuals that colonize dead trees, relative to sites
where fires are larger but less frequent.
The great majority of specimens were nymphs:
418 out of 444 specimens. The scarcity of adults in
samples spread out over three months suggests
that adults leave their natal tree soon after their
final molt.
In our study, larger trees produced proportion-
ately more A. gracilicornis. Aradus gracilicornis
occurred in all 13 of the largest trees (over 60 cm
dbh) sampled, and in less than half the trees in
smaller size classes. Since the bands of bark are
larger on large trees than small trees, compari-
sons are based on numbers of bugs/m sq. of bark
surface sampled. The 13 trees over 60 cm dbh pro-
duced an average of 19.1 bugs/m sq. (range: 2.7-
46.3), compared to 1.4 bugs/m sq. in 21 trees 45-
60 cm dbh (range: 0.0-4.7). At this point it does
not seem appropriate to analyze these results sta-
tistically because it is unlikely that the insects
are responding directly to tree size, but rather to
the occurrence of certain fungi that, in this in-
stance, were more abundant in large trees. It is
even possible that the progression of decomposi-
tion is faster in small trees, and most of the flat
bugs had left the small trees earlier in the year.
One reason why we sampled so many small trees
was that A. gracilis were found in a small tree in
early February of 2002. Although our project ex-
tended over three months, it was still a relatively
short-term study following a single fire.
Aradus gracilicornis nymphs that were found in
bark were usually associated with a thin, dry fun-
gal film occurring between layers of outer bark.
Several of these nymphs were reared to maturity.
This showed that the elongation of the antennae oc-
curs suddenly at the last molt. At the final molt
there is also a change in antennal markings: the an-
tennae, which in the nymph are black with a white
band (Fig. Ib), become entirely black. Banded an-
tennae occur in adults of a few species of Aradus,
such as the North American species A. uniforms
Heidemann andA abbas Bergroth, and the holarc-
tic speciesA. signaticornis Sahlberg. The function of
this conspicuous banding, which occurs in both
sexes as well as nymphs, is unknown. It seems un-
likely that there is visual communication between
nymphs ofA. gracilicornis inhabiting dark cavities
in pine bark. It is possible thatA. gracilis belongs to
a lineage that had white antennal bands in the
adult, and this pattern is vestigial in the nymph.


The bark of fire-killed pines retains a rich
fauna for more than a year after the fire, long af-
ter the first flush of scavengers, mostly phloem-
consuming scavengers such as Ips (Scolytinae)
and Melanophila (Buprestidae), have left the
tree. The following arthropods occurred in sam-
ples with nymphs of A. gracilicornis. These ar-
thropods are not necessarily close associates of
this species; we present them to place A. gracili-
cornis in the context of the arthropod assemblage
found in dead pines at a particular stage of de-
composition. The number following the name of
an arthropod indicates the number of samples
(out of 27) that had both A. gracilicornis and the
arthropod listed; numbers of individuals are not
tallied. Polyxenida, Polyxenidae, Polyxenus sp.
(1); Pseudoscorpionida, unidentified to family
(14); Araneida, Clubionidae (1), Salticidae (1), Th-
omisidae (1), unidentified to family (3); Collem-
bola, unidentified to family (9); Dermaptera,
Labidiidae, Marava pulchella (Serville) (4); Pso-
coptera, unidentified to family (4); Coleoptera,
Carabidae, Tachyta nana inornata (Say) (8); Ptili-
idae, Ptinella sp. (7); Curculionidae, Cossonus
corticola Say (3), Platypus flavicornis (Fabricius)
(1); Elateridae, unidentified larvae (10); Trogos-
sitidae, unidentified larvae (2); Histeridae, Platy-
soma parallelum (Say) (2), Plegaderus
transversus Say (2), Becanius punctifroms Le-
Conte (1); Tenebrionidae, Corticeus thoracicus
(Melsheimer) (1), Hymenorus sp. (2); Anthribidae,
Euparius paganus Gyllenhal (1); Cerambycidae,
unidentified larva (1); Buprestidae, unidentified
larva (1); Colydiidae, Colydium nigripenne Le-
Conte (1); Sphindidae, Sphindus americanus Le-
Conte (1); Staphylinidae, Nacaeus tenellus
(Erichson) (1), Coproporus sp. (1); Coleoptera, lar-
vae unidentified to family (6).
We thank Elena Rhodes and David Zeltser for
assisting with the field work. We thank Ernst
Heiss (Tyroler Landesmuseum, Austria) for re-
viewing this paper and providing useful sugges-
tions on biology, taxonomy and literature on
Aradidae. Steven Taylor (Illinois Natural History
Survey) provided valuable advice on the natural
history of Aradidae. This study was supported by
the Archbold Biological Station.

SUMMARY

Aradus gracilicornis is the first aradid known
to benefit significantly from the fires that are a
normal feature of most natural pine habitats in
southeastern North America. It is probable that
there are additional species of aradids that con-
gregate in fire-killed trees in the Southeast, or in
parts of the Southwest where fires occur regu-
larly. Many insect species that breed in fire-killed
pines, such as Scolytinae in the genera Ips,
Pityophthorus, Dendroctonus, Orthotomicus, and
Xyleborus, also occur on the ABS in wind-thrown


March 2004







Scientific Notes


or felled trees. There is no reason to believe thatA.
gracilicornis is restricted to fire-killed trees, but it
is clearly a member of the large group of insects
that are associated with fire in the Southeast.

REFERENCES CITED

BLATCHLEY, W. S. 1926. Heteroptera or true bugs of
eastern North America, with special reference to the
faunas of Indiana and Florida. The Nature Publish-
ing Co., Indianapolis. 1116 pp.
FROESCHNER, R. C. 1988. Family Aradidae Spinola,
1837 (=Dysodiidae Reuter, 1912; Meziridae Osha-


nin, 1908), the flat bugs, pp. 29-46. In T J. Henry and
R. C. Froeschner, eds. Catalog of the Heteroptera, or
true bugs, of Canada and the United States. E. J.
Brill Co., New York. xix + 958 pp.
HEISS, E. 1993. Type revision of neotropicalAradus de-
scribed by C. Stal (Heteroptera, Aradidae). Mitt.
Muinch. Entomol. Ges. 83: 119-125.
LAPPALAINEN, H., AND H. SIMOLA. 1998. The fire-
adapted flatbug Aradus laeviusculus Reuter (Het-
eroptera, Aradidae) rediscovered in Finland (North
Karelia, Koli National Park). Entomol. Fennica 9: 3-4.
TAYLOR, S. 2002. Aradidae (flatbugs). (revised March
2002). Internet:http://www.inhs.uiuc.edu/~sjtaylor/
Aradidae/flatbug.html







Florida Entomologist 87(1)


March 2004


IDENTITY AND FIRST RECORD OF THE SPITTLEBUG
MAHANARVA BIPARS (HEMIPTERA: AUCHENORRHYNCHA: CERCOPIDAE)
ON SUGARCANE IN COLOMBIA

DANIEL C. PECK1, JAIRO RODRIGUEZ CH. AND LUIS A. GOMEZ3
1Department of Entomology, New York State Agricultural Research Station, Cornell University, 630 W. North
Street, Geneva, NY 14456

2Centro Internacional de Agricultura Tropical (CIAT), Cali, Colombia

3Centro de Investigaci6n de la Cana de Azicar de Colombia (CENICANA), Cali, Colombia


Spittlebugs (Hemiptera: Auchenorrhyncha:
Cercopidae) are widespread pests of sugarcane in
the Neotropics (Fewkes 1969). Adult injury is ex-
pressed as a chlorosis known as froghopper burn
that leads to losses in sugar content, juice purity
and overall stalk and sugar yields (Dinardo-
Miranda 2002). Sugarcane fields in Colombia
have been notably free from serious spittlebug at-
tacks and a damaging outbreak has not been doc-
umented until now.
In 2002, growers in the coffee zone of the An-
dean region reported severe infestations of spit-
tlebugs in sugarcane fields used for gur ("panela")
production. The problem was first detected in the
locality of San Jose (vereda Santa Ana, municipio
Guatica, department Risaralda) in 2000, but the
incipient damage was not cause for concern until
now. This region was visited in September 2002 to
document the incident and determine the identity
of the spittlebug species involved.
Two infested fields were visited on 24 Septem-
ber 2002 on a farm at Guatica (518'N, 7549'W)
where the owner first noted the infestation 8
months earlier. In this production system, sugar-
cane stands are of mixed ages due to selective
harvesting, and stems in all age classes were at-
tacked; some stems as young as 1-2 months old
were infested with nymphs. A high proportion of
stems were infested in each field; the chlorotic
streaks attributed to adult feeding, however, were
not evident. The infested area in the first field
(1624 m elevation) was approximately 2 ha with
76.2% of stems infested (n = 21, var Puerto Rico
61632). Mean infestation was 4.7 nymphs and 1.1
adults per stem. The infested area in the second
field (1663 m elevation, mixed sugarcane variet-
ies) was approximately 0.5 ha, with 43.1% of
stems infested (n = 43, mixed varieties) with an
average of 1.8 nymphs and 0.3 adults per stem.
Agronomists from other areas around Guatica
also reported problems with persistent spittlebug
populations in sugarcane under the same produc-
tion system. To date, however, spittlebugs have
not been detected in the nearest fields of sugar-
cane under industrial sugar production (24 km
north). This will be an important frontier to mon-
itor in the next few years as Colombia moves to


prohibit preharvest burning by 2005 (Cenicaia
1998); a shift to green production may open op-
portunities for emergent spittlebug pests in ex-
tensive sugarcane production systems.
The spittlebug was identified as Mahanarva
bipars (Walker). Voucher specimens were depos-
ited in the Cornell University Insect Collection
under Lot #1227. This is the first definitive report
of this species from Colombia and from sugarcane.
The original species description was based on an
unknown number of adults collected in South
America. Walker (1858) placed bipars in the ge-
nus Sphenorhina Amyot & Serville, and this was
later moved to Tomaspis Amyot & Serville by La-
llemand (1912) and then to Mahanarva Distant
by Fennah (1968). No specific locality data or
other information were recorded for the type spec-
imens. To our knowledge, there are no other ac-
counts of M. bipars in the literature, meaning no
available information on distribution, biology,
host plants, size, or color pattern variation.
The genus Mahanarva is known from Costa
Rica, Panama and throughout South America.
There are 32 described species (pers. comm. M.
Webb), of which several are known as forage grass
or sugarcane pests. The most important pest spe-
cies are reported from Brazil, Colombia and Ecua-
dor. Mahanarva posticata (Stal) and M.
fimbriolata (Stal) are found on sugarcane (Guag-
liumi 1973; Dinardo-Miranda et al. 2001; Garcia
2002), and M. spectabilis on forage grasses (DCP,
pers. observe ) in Brazil. Mahanarva trifissa (Ja-
cobi) feeds on forage grasses in southeastern Co-
lombia (Peck 2001; CIAT 2002). Mahanarva
andigena (Jacobi) occurs on sugarcane in north-
western Ecuador (Mendoza 1999; Fors 2000, DCP
personal observation). The other known grass-
feeding species include M. indicate Distant, M.
mura (China & Myers), M. phantastica (Breddin),
M. quadripunctata (Walker), and M. tristis (F.).
Mahanarva costaricensis (Distant) is the only
known species to specialize on non-grasses, re-
ported from Calathea (Marantaceae) and Helico-
nia (Heliconiaceae) (V. Thompson, Dept. Biology,
Roosevelt University, unpublished).
Additional locality records for M. bipars were ob-
tained from specimens housed in the Natural His-







Scientific Notes


Fig. 1. Known global distribution of Mahanarva bi-
pars.

tory Museum (UK, 3 specimens), Universidad del
Valle (Colombia, 2 specimens) and the Universidad
Nacional sede Palmira (Colombia, 6 specimens). To-
gether with our field collections, all known reports
of M. bipars are listed below and mapped (Fig. 1).
This species has only been collected from the Co-
lombian departments of Cauca, Choc6, Risaralda
and Valle del Cauca, representing the Pacific coast
east to the central cordillera of the Andes.
COLOMBIA: Cauca, El Trueno, rio Naya, XI-
1984, coll. Camilo Hurtado. Choco, Quibd6, "on
weeds", XI-1983, coll. Velez; Tutunend6, "on
weeds", XI-1983, coll. Velez; Proparicio Urriabo,
20-V-1987. Risaralda, Guatica, Santa Ana, 24-IX-
2002, 1624-1663 m elevation, coll. J. Rodriguez.
Valle del Cauca, Cali, X-1989, coll. Ramirez H.;
Calima, 20-VII-1981, coll. Chaves; Palmira, 3-X-
1978, coll. Acevedo; Valle, IV-1978.
Mahanarva bipars is distinguished from other
Mahanarva and other Colombian grass-feeding
spittlebugs by characteristic genitalia and color
pattern. Males of the genus have a pair of simple
horn- or scimitar-shaped aedeagal processes be-
tween one third and one half the length of the


aedeagal shaft. These are usually positioned per-
pendicular to and approximately half-way up the
shaft; if downturned they do not reach the base of
the aedeagus. In M. bipars, these processes emerge
from the widest point of the aedeagus and reach
their greatest width (in lateral aspect) half-way
along their length and then taper evenly to the tip;
the tip of the aedeagal shaft is rounded, without an
apical tooth or projection. The gonopore is apical.
Like other neotropical grass-feeding species of
spittlebugs (Rodriguez et al. 2002), adult M. bi-
pars are sexually dimorphic. Compared to fe-
males, males are smaller with respect to certain
body size measurements (Table 1). There is signif-
icant variation in the color patterns of the wings
based on partial to complete reduction in the or-
ange markings over the brown to dull black dor-
sum (Fig. 2). Compared to females, males
exhibited less reduction in the orange patch mak-
ing their coloration more conspicuous.
Similar to M. andigena and M. posticata, spit-
tle masses are aerial. Younger nymphs tend to be
found within young rolled leaves while older
nymphs occur on the older lower leaves where the
leaf sheath begins to separate from the stem.
Adults were most commonly observed in the
rolled up leaves that form the apical shoots, or un-
der the leaf sheaths. Oviposition sites were not
determined. This insect is being managed locally
by removing old leaves from the stem (reducing
protective sites for nymphs to establish spittle
masses) and use of the insecticide chlorpyrifos.
Although M. bipars is the first documented sug-
arcane spittlebug pest of economic importance in
Colombia, three other species are at least present
in sugarcane and do represent species that should
be monitored. The Central American pasture and
sugarcane pest Prosapia simulans (Walker) was
reported for the first time in Colombia in 1999
(Peck et al. 2001). Given persistent populations in
Brachiaria pastures of the Cauca Valley, this spe-
cies is being locally monitored for its presence in
sugarcane. There is a particular concern that sug-
arcane will become a more susceptible habitat to
this species when preharvest burning is prohib-
ited. Another spittlebug species of known concern
to sugarcane producers in Colombia is M. andi-


TABLE 1. SIZE (MM) OF ADULT MAHANARVA BIPARS COLLECTED FROM SUGARCANE (COLOMBIA: RISARALDA, GUATICA)
(MEAN -SE, RANGE, N = 13 FEMALES AND 9 MALES).

Head capsule Body length Body length Anterior wing
Sex Width without wing with wing Body width Stylet length length

Male 2.41+ 0.08 a 10.22 0.73 a 10.99 0.40 a 5.23 0.26 a 1.19 0.05 a 8.97 0.43 a
(2.25 2.52) (8.57 11.07) (10.50 11.71) (4.86 5.57) (1.14 1.29) (8.36 -9.79)
Female 2.68 + 0.10 b 11.98 0.63 b 12.14 0.45 b 5.82 0.33 b 1.42 0.13 b 9.63 0.36 b
(2.52 2.84) (10.79 12.86) (11.36 12.86) (5.36 -6.36) (1.21 1.79) (8.93 10.07)
For each column, means followed by different letters are significantly different at P < 0.05 (t-test).






Florida Entomologist 87(1)


(7


Male


Qb


Fig. 2. Most common color pattern variation exhibited dorsally in adult Mahanarva bipars.


gena. This species was first documented in Colom-
bia in 1999 and is reported from Johnson grass
(Sorghum halepense) and sugarcane on the south
Pacific coast (JRC & DCP, personal observation).
Over the last 5 years this species emerged as a
highly injurious pest for sugarcane production on
the Pacific coast of Ecuador (Mendoza 1999; Fors
2000). Finally, according to reports received by CE-
NICANA, Aeneolamia sp. has been reported on
sugarcane near Cucuta in the department of Norte
de Santander (LAG, pers. observe .
SUMMARY
Mahanarva bipars (Walker) is identified as the
species causing the first spittlebug outbreak in
Colombian sugarcane. Information on the biology,
host plants and geographic range are absent from
the literature. Therefore, we summarize field ob-
servations on infestation levels and location of
feeding sites, laboratory observations on size and
adult color pattern variation, and known locality
information that indicates distribution is re-
stricted to western Colombia.
REFERENCES CITED
CENTRO DE INVESTIGATION DE LA CANA DE AZUiCAR DE
COLOMBIA (CENICANA). 1998. Informe Annual
1998, Cenicaia, Cali, Colombia.
CENTRO INTERNATIONAL DE AGRICULTURE TROPICAL
(CIAT). 2002. Annual Report 2002. Project IP-5.
Tropical Grasses and Legumes: Optimizing Genetic
Diversity for Multipurpose Use. CIAT, Cali, Colom-
bia. 271 pp.
DINARDO-MIRANDA, L. L., J. M. G. FERREIRA, AND P. A.
M. CARVALHO. 2001. Influ6ncia da 6poca de colheita
e do gen6tipo de cana-de acucar sobre a infestacio de
Mahanarva fimbriolata (Stal) (Hemiptera: Cercopi-
dae). Neotrop. Entom. 30: 145-149.
DINARDO-MIRANDA, L. L., V. GARCIA, AND V. J. PARAZZI.
2002. Efeito de inseticidas no control de Maha-


narva fimbriolata (Stal) (Hemiptera: Cercopidae) e
de nematoides fitoparasitos na qualidade tecnolog-
ica e na produtividade da cana-de-acucar. Neotrop.
Entom. 31: 609-614.
FENNAH, R. G. 1968. Revisionary notes on the new
world genera of cercopid froghoppers (Homoptera:
Cercopoidea). Bull. Entomol. Res. 58: 165-190.
FEWKES, D. W. 1969. The biology of sugar cane froghop-
pers, pp 283-307. In J. R. Williams, J. R. Metcalfe, R.
W. Mungomery and R. Mathes [eds.], Pests of sugar
cane. Elsevier, Amsterdam.
FORS, L. A. 2000. El salivazo a6reo Mahanarva andi-
gena. Sugar J., Oct. pp. 28-31.
GARCIA, J. F. 2002. T6cnica de criacgo e tabela de vida de
Mahanarva fimbriolata (Stal, 1854) (Hemiptera:
Cercopidae). Masters thesis, Escola Superior de Ag-
ricultura "Luiz de Queiroz", Universidade de Sao
Paulo, Piracicaba. 59 pp.
GUAGLIUMI, P. 1973. Pragas da Cana-de-Agucar: Nordeste
do Brasil. Institute do Augcar e do Alcool (Colecio
Canavieira No. 10), Rio de Janeiro. pp. 69-204.
LALLEMAND, V. 1912. Homoptera Fam. Cercopidae.
Genera Insectorum Fasc 143. 167 pp.
MENDOZA, J. 1999. El salivazo: una plaga potential de
la cana de azucar en el Ecuador. Carta Informativo,
Centro de Investigaci6n de la Cana de Azucar de Ec-
uador CINCAE aio 1: 1-6.
PECK, D. C. 2001. Diversidad y distribuci6n geografica
del salivazo (Homoptera: Cercopidae) asociado con
gramineas en Colombia y Ecuador. Rev. Colombiana
Entomol. 27: 129-136.
PECK, D. C., U. CASTRO, F. LOPEZ, A. MORALES, AND J.
RODRIGUEZ. 2001. First records of the sugar cane
and forage grass pest, Prosapia simulans (Ho-
moptera: Cercopidae), from South America. Florida
Entomol. 84: 402-409.
RODRIGUEZ CH., J., D. C. PECK, AND N. CANAL. 2002. Bi-
ologia comparada de tres species de salivazo de los
pastos del g6nero Zulia (Homoptera: Cercopidae).
Rev. Colombiana Entomol. 28: 17-25.
WALKER, F. 1858. Homoptera. Insecta saundersiana: or
characters of undescribed insects in the collection of
William Wilson Saunders, Esq. 1858: 1-117.


March 2004


Female


m m I







Scientific Notes


SIMULTANEOUS DETECTION OF VAIRIMORPHA INVICTAE
(MICROSPORIDIA: BURENELLIDAE) AND THELOHANIA SOLENOPSAE
(MICROSPORIDIA: THELOHANIIDAE) IN FIRE ANTS BY PCR

STEVEN M. VALLEYS DAVID H. OI1, JUAN A. BRIANO AND DAVID F. WILLIAMS'
'Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS
1600 SW 23rd Drive, Gainesville, Florida, 32608, USA

2South American Biological Control Laboratory, USDA-ARS, Bolivar 1559 Hurlingham
Buenos Aires Province, Argentina


Microsporidia are obligate intracellular proto-
zoan parasites of eukaryotes (Mathis 2000). Two
species of microsporidia, Thelohania solenopsae
(Knell et al. 1977) and Vairimorpha invictae (Jou-
venaz and Ellis 1986) have been reported to be ef-
fective biological control agents against the fire
ant, Solenopsis invicta (Williams et al. 1999,
Briano and Williams 2002). Unfortunately, be-
cause the life cycles of these pathogens remain
unknown, diagnosis is principally limited to mi-
croscopic examination of ant homogenates for the
characteristic spore stage. This limitation has
hampered epidemiological studies, the elucida-
tion of potential intermediate hosts, and descrip-
tion of the complete life cycle. While a number of
PCR-based methods have been developed for de-
tection of T solenopsae (Snowden et al. 2002,
Valles et al. 2002) none are available for V invic-
tae. By exploiting nucleotide sequence differences
in the 16S rRNA genes of T solenopsae and V in-
victae, we provide a PCR-based method capable of
detecting infection of fire ants by either pathogen.
V invictae-infected colonies of S. invicta were
collected in Argentina (near San Javier, Santa Fe
Province) in April 2003. Infections were deter-
mined by the observation of V invictae spores in
wet mount preparations of macerated adult ants
under a phase-contrast microscope (400X, Briano
and Williams 2002). In addition, 1 S. invicta
(Santa Fe Province) and 2 S. richteri (Entre Rios
Province) colonies with dual infections (V invictae
and T solenopsae) were collected in Argentina in
April 2003. S. invicta were keyed to species
(Trager 1991) and verified as "invicta-like" by
chemotaxonomy (Vander Meer and Lofgren 1990).
Genomic DNA was extracted from adult ants as
described by Valles et al. (2002).
PCR was carried out with primer pairs specific
for the 16S rRNA gene of T solenopsae (pl,
5'CGAAGCATGAAAGCGGAGC and p2, 5'CAG-
CATGTATATGCACTACTGGAGC) and V invictae
(p90, 5'CACGAAGGAGGATAACCACGGT and
p93, CGCAATCAGTCTGTGAATCTCTTCA). The
microsporidian-specific primers were designed by
aligning the T solenopsae (accession number AF
134205) and V invictae 16S rRNA gene sequences
with the Vector NTI 7.1 program (Informax, Inc.,
Bethesda, MD) and choosing unique areas from
each species. A published nucleotide sequence for


the 16S rRNA gene was available in GenBank for
a Vairimorpha sp. thought to be V invictae (acces-
sion number AF031539). To verify that this se-
quence corresponded to the V invictae 16S rRNA
gene, we amplified a fragment of the gene from V
invictae with primers p90 and p93. The 791 bp
amplicon was purified by separation on a 1.2%
agarose gel, ligated into pGEM-T easy (Promega,
Madison, WI), and used to transform Solopack
Gold supercompetent E. coli DH5a cells (Stat-
agene, La Jolla, CA). Insert-positive clones were
sequenced by the Interdisciplinary Center for Bio-
technology Research, University of Florida. Three
replicates were sequenced.
PCR was conducted by the hot start method in
a PTC 100 thermal cycler (MJ Research,
Waltham, MA) under the following optimized tem-
perature regime: 1 cycle at 94C for 2 min, then 35
cycles at 94C for 15 sec, 55C for 15 sec, and 68C
for 45 sec, followed by a final elongation step of 5
min at 68C. The reaction was conducted in a 50-
pl volume containing 2 mM MgC12, 200 pM dNTP
mix, 1 unit of Platinum Taq DNA polymerase (In-
vitrogen, Carlsbad, CA), 0.4 pM of each primer,
and 0.5 ul of the genomic DNA preparation (10 to
100 ng). PCR products were separated on a 1.2%
agarose gel and visualized by ethidium bromide
staining. For all experiments, positive and nega-
tive controls were run alongside treatments.
The fragment of the 16S rRNA gene that we
amplified from V invictae (host S. invicta) was
identical to the sequence reported previously by
Moser et al. (1998). Despite being found in S. rich-
teri, they suspected that the microsporidian with
which they were working was V invictae. Indeed,
Briano et al. (2002) reported that T solenopsae
and V invictae could infect either ant species, S.
invicta or S. richteri. This conclusion was con-
firmed by successful detection of V invictae from
S. invicta and S. richteri with V invictae-specific
primers, p90 and p93.
Figure 1 demonstrates the specificity of the
primer pairs for each species 16S rRNA gene. As
reported by Valles et al. (2002), the T solenopsae-
specific primer pair, pl and p2, produced a 318 bp
amplicon exclusively from T solenopsae-infected
S. invicta (column 2). Similar specificity was ob-
served for the 16S rRNA gene of V invictae with
primers p90 and p93; a 791 bp amplicon was pro-







Florida Entomologist 87(1)


800


400


Fig. 1. Banding patterns on a 1.2% agarose gel after multiplex PCR with 16S rRNA-specific oligonucleotide
primers. Column 1, molecular weight markers expressed as base pairs (bp);, column 2, DNA prepared from T sole-
nopsae-infected S. invicta, oligonucleotide primers pl and p2 (T solenopsae-specific); column 3, DNA prepared from
T solenopsae-infected S. invicta, oligonucleotide primers p90 and p93 (V invictae-specific); column 4, DNA prepared
from V invictae-infected S. invicta, oligonucleotide primers pl and p2 (T solenopsae-specific); column 5, DNA pre-
pared from V invictae-infected S. invicta, oligonucleotide primers p90 and p93 (V invictae-specific); column 6, mix-
ture of DNA prepared from V invictae-infected S. invicta and T solenopsae-infected S. invicta, oligonucleotide
primers pl and p2 (T solenopsae-specific), and p90 and p93 (V invictae-specific); column 7, DNA prepared from T
solenopsae- and V invictae-infected S. invicta, oligonucleotide primers pl and p2 (T solenopsae-specific), and p90
and p93 (V invictae-specific); column 8, DNA prepared from uninfected S. invicta, oligonucleotide primers pl and
p2, and p90 and p93.


duced exclusively from V invictae-infected S. in-
victa (column 5). In cases where an ant colony was
infected with both organisms, each microsporid-
ian species could be discerned in a single multi-
plex reaction containing both primers sets (Fig. 1,
lanes 6 and 7). Again, V invictae was successfully
detected in either S. invicta or S. richteri.
Microscopic detection of these microsporidia is
labor intensive and limited to known stages of de-
velopment. The multiplex PCR method to detect
T solenopsae and V invictae offers a number of
advantages over traditional microscopy, includ-
ing, increased sensitivity, specificity, and the abil-
ity to identify all developmental stages. Thus,
multiplex PCR decreases the risk of misidentifi-
cation and will facilitate epizootiological studies
concerned with these pathogens.
We thank Chuck Strong for technical assistance
and R. Vander Meer for identifying the ant species
by gas chromatography. We also thank R. M.
Pereira and J. L. Capinera who provided helpful
reviews of a previous version of the manuscript.

SUMMARY

A PCR-based method capable of detecting The-
lohania solenopsae and/or Vairimorpha invictae
infection in the red imported fire ant, Solenopsis


invicta, was developed. Multiplex PCR allows si-
multaneous detection of both species of microspo-
ridia in a single reaction.

REFERENCES
BRIANO, J. A., AND D. F. WILLIAMS. 2002. Natural occur-
rence and laboratory studies of the fire ant pathogen
Vairimorpha invictae (Microsporida: Burenellidae)
in Argentina. Environ. Entomol. 31: 887-894.
BRIANO, J. A., D. F. WILLIAMS, D. H. OI, AND L. R.
DAVIS, JR 2002. Field host range of the fire ant
pathogens Thelohania solenopsae (Microsporida:
Thelohaniidae) and Vairimorpha invictae (Mi-
crosporida: Burenellidae) in South America. Biol.
Control 24: 98-102.
JOUVENAZ, D. P., AND E. A. ELLIS. 1986. Vairimorpha in-
victae n. sp. (Microspora: Microsporidia), a parasite of
the red imported fire ant, Solenopsis invicta Buren
(Hymenoptera: Formicidae). J. Protozool. 33: 457-461.
KNELL, J. D., G. E. ALLEN, AND E. I. HAZARD. 1977.
Light and electron microscope study of Thelohania
solenopsae n. sp. (Microsporida: Protozoa) in the red
imported fire ant, Solenopsis invicta. J. Invertebr.
Pathol. 29: 192-200.
MATHIS, A. 2000. Microsporidia: emerging advances in
understanding the basic biology of these unique or-
ganims. Int. J. Parasitol. 30: 795-804.
MOSER, B. A., J. J. BECNEL, J. MARUNIAK, AND R. S.
PATTERSON. 1998. Analysis of the ribosomal DNA se-


March 2004


1 2 3 4 5 6 7 8



*A&W



%MONO







Scientific Notes


quences of the microsporida Thelohania and Vairi-
morpha of fire ants. J. Invertebr. Pathol. 72: 154-159.
SNOWDEN, K. F., K. LOGAN, AND S. B. VINSON. 2002.
Simple, filter-based PCR detection of Thelohania so-
lenopsae (Microspora) in fire ants (Solenopsis in-
victa). J. Eukaryot. Microbiol. 49: 447-448.
TRAGER, J. C. 1991. A revision of the fire ants, Solenopsis
geminata group (Hymenoptera: Formicidae: Myr-
micinae). J. New York Entomol. Soc. 99: 141-198.
VALLEYS, S. M., D. H. OI, O. P. PERERA, AND D. F. WILL-
IAMS. 2002. Detection of Thelohania solenopsae (Mi-
crosporidia: Thelohaniidae) in Solenopsis invicta


(Hymenoptera: Formicidae) by multiplex PCR. J. In-
vertebr. Pathol. 81: 196-201.
VANDER MEER, R. K., AND C. S. LOFGREN. 1990. Chemo-
taxonomy applied to fire ant systematics in the
United States and South America. pp. 75-84. In R.
Vander Meer, K. Jaffe and A. Cedeno [eds.]. Applied
myrmecology, a world perspective. Westview Press,
Boulder, CO. 741 pp.
WILLIAMS, D. F., G. J. KNUE, AND J. J. BECNEL. 1999.
Discovery of Thelohania solenopsae from the im-
ported fire ant, Solenopsis invicta, in the United
States. J. Invertebr. Pathol. 71: 175-176.







Florida Entomologist 87(1)


March 2004


OVERWINTERING OF APHELINUS NEAR PARAMALI
(HYMENOPTERA: APHELINIDAE), AN INTRODUCED PARASITE
OF THE COTTON APHID IN THE SAN JOAQUIN VALLEY, CALIFORNIA


KRIS GODFREY' AND MICHAEL MCGUIRE2
1California Department of Food and Agriculture, Pest Detection/Emergency Projects
3288 Meadowview Road, Sacramento, CA 95832

2USDA-ARS, Shafter Research and Extension Center, Shafter, CA 93263


Natural biological control influencing cotton
aphid population dynamics in the San Joaquin
Valley does not maintain cotton aphid [Aphis gos-
sypii Glover (Homoptera: Aphididae)] densities at
low levels throughout the year. In the late fall
through late spring, native insect parasites, gen-
eralist arthropod predators, and fungi typically
maintain cotton aphid densities at non-pest sta-
tus (Rosenheim et al. 1997, Godfrey et al. 2001, K.
Godfrey and M. McGuire, unpublished data).
However, in mid to late season cotton, the action
of the natural enemies often appears to be mini-
mal. The arthropod predator complex loses effec-
tiveness due largely to hemipterous predators
(reduviids and nabids) feeding upon lacewing lar-
vae, another group of predators that feed heavily
upon aphids (Rosenheim et al. 1993, Rosenheim
and Cisneros 1994). Also, at this time, the native
parasites and fungi are at their lowest levels
(Godfrey et al. 2001, K. Godfrey and M. McGuire,
unpublished data). Hot, dry climatic conditions
that are not conducive for parasite survival and/
or fungal growth exist at this time (Tang and
Yokomi 1995, Godfrey et al. 2001).
In an attempt to increase the amount of biolog-
ical control on cotton aphid in mid to late season
cotton, a cooperative project began in 1996 to con-
struct a natural enemy complex using natural en-
emies not currently found in California to
compliment the existing natural enemy complex.
After four years of research, two parasite species,
Aphelinus near paramali and Aphelinus gossypii
Timberlake (Hymenoptera: Aphelinidae), were
identified as the first components of the intro-
duced natural enemy complex. In field cage stud-
ies conducted in cotton over 4 years (1996-1999),
these parasites reduced cotton aphid densities 10-
38% as compared to the densities of cotton aphid
in cages without parasites present (K. Godfrey, J.
McLaughlin, and M. McGuire, unpublished data).
Distribution of both parasites began at ten nurs-
ery sites in 2000. The nursery sites were moni-
tored to determine if the parasites had begun to
overwinter and establish at the sites.
Both parasites were obtained from researchers
in Florida. Aphelinus near paramali (ANP) was
thought to have been initially collected from crape
myrtle aphid (Tinocallis kahawaluokalani
(Kirkaldy)) on crape myrtle in Florida in the spring


of 1995. However, additional host range studies
demonstrated that ANP would not attack crape
myrtle aphid, but preferred cotton aphid, green
peach aphid (Myzus persicae (Sulzer)), black citrus
aphid (Toxoptera aurantii (Fonscolombe)), and
spirea aphid (Aphis spiraecola Patch; Homoptera:
Aphididae) (Y. Tang, L. Osborne, and R. Yokomi,
unpublished data). Female wasps preferred
younger aphid instars for oviposition and would
host feed on all aphid instars. The adult females
survived 10-20 days, laid about 120 eggs, and fed
upon about 25 aphids at 21C (Y. Tang, L. Osborne,
and R. Yokomi, unpublished data).Aphelinus gos-
sypii (AG) was collected in southern China in July
1997 and passed through quarantine in Florida.
Host preference studies have shown that cotton
aphid and black citrus aphid are the preferred
hosts, while spirea aphid is a less acceptable host
(Yokomi and Tang 1995). The size of the adult par-
asite produced is greatest when AG is reared on
cotton aphid (Yokomi and Tang 1995). Female AG
host fed on all aphid instars. They survived from 5-
17 days and had a mean fecundity of 57 eggs
(range 20-115; Tokumaru and Takada 1996).
All parasites were reared at the California De-
partment of Food and Agriculture Biological Con-
trol Program in Sacramento. Each species was
maintained in a greenhouse at daytime tempera-
tures (16 hours) of 24C (3C) and nighttime tem-
peratures (8 hours) of 20C (3C) with
supplemental lighting (600 watt high pressure so-
dium lights). ANP was reared on green peach
aphid on potted green pepper plants, while AG
was reared on cotton aphid on potted hibiscus
plants. The parasites were reared on different
host aphids and plants to insure that there was no
cross contamination of parasite colonies. ANP was
periodically tested to insure that it would accept
cotton aphid as readily as green peach aphid.
Given the above rearing conditions, parasite
mummies (i.e., mummified aphids containing par-
asite pupae) could be found about 7 days after
adult parasites were introduced into a cage, and
new adult parasites began to emerge from the
mummies in about 3-5 days. Approximately 56%
(range 44-63%) of all ANP mummies produced
adults within 7 days of the first adult emergence,
and 60% (range 55-67%) of AG mummies pro-
duced adults. The sex ratio was approximately 1:1.







Scientific Notes


The nursery sites were established in Merced,
Madera, and Kern Counties in and around cotton
fields. Each nursery was located on a corner of a
cotton field and was 8 rows wide by 10 m in
length. The nursery was not sprayed with insecti-
cides during the cotton-growing season. Most
sites had other habitats that were favorable for
cotton aphid throughout the year in close proxim-
ity to the nursery. Beginning in July of each year,
each site was sampled weekly by examining 40 to
80 cotton plants for the presence of cotton aphid.
Once cotton aphids were found, weekly releases of
both parasites began and continued until the cot-
ton at each site was defoliated. To make a release,
brown paper bags containing leaves with parasite
mummies that were about to emerge (i.e., adult
emergence within 2-5 days) were opened and
placed between cotton plants along a single row
in the nursery prior to 10:00 am. No special ac-
commodations were necessary to protect the
mummies from predation. The densities of native
arthropod predators were at their lowest levels at
the time of the releases. In addition, ants were not
abundant at any of the nursery sites.
A total of 74,650 ANP mummies and 189,140
AG mummies were released at the 10 sites from


2000 through 2002 (Table 1). Approximately 2
weeks after the parasite releases began, samples
of cotton leaves with aphids and mummies were
collected weekly. These aphids and mummies
were held in the laboratory (24C, 12L:12D) for
adult parasites to emerge. The sites were sampled
on a weekly basis until approximately 2 weeks af-
ter cotton harvest. After that time, the areas
around the nursery site that harbored cotton
aphid were sampled at approximately monthly
intervals. Any aphids or parasite mummies found
in these samples were returned to the laboratory
and held for parasite emergence. The number and
identity of the parasites was recorded for each
sample site and date.
A total of 813 ANP, 349 AG, and 7,038 native
aphidiid parasites were recovered from the nurs-
ery sites (Table 2). The introduced aphelinids
could be distinguished from the native aphidiids
using family characteristics. The aphidiids recov-
ered belonged to the genera Lysiphlebus, Aphid-
ius, and Diaeretiella. A small number (38) of
native aphelinids were also recovered. These indi-
viduals could be distinguished from ANP and AG
because they had more than 15 setae in the trian-
gular area at the base of the forewing. ANP and


TABLE 1. THE TOTAL NUMBER OF ANP AND AG MUMMIES RELEASED AT EACH PARASITE NURSERY SITE AND THE DATES
OF PARASITE RELEASES IN THE SAN JOAQUIN VALLEY FROM 2000 THROUGH 2002.

2000 2001 2002
(Dates of Release) (Dates of Release) (Dates of Release)

Nursery Site ANP AG ANP AG ANP AG

Madera 1 1,700 2,480 4,950 8,800 600 1,700
(7/19/00-10/11/00) (7/11/01-10/11/01) (7/18/02-9/10/02)
Madera 2 1,500 2,080 4,250 5,500 1,100 4,700
(8/1/00-10/11/00) (8/8/01-10/11/01) (7/18/02-9/10/02)
Madera 4 1,800 2,480 4,450 5,800 600 2,200
(7/19/00-10/11/00) (8/1/00-10/11/00) (8/21/02-9/10/02)
Merced 3 1,400 2,180 4,150 5,050 600 1,200
(7/27/00-10/11/00) (7/24/01-10/3/01) (8/21/02-9/10/02)
Kern 1 700 3,900 3,750 2,850 4,050 16,900
(7/27/00-9/21/00) (8/1/01-10/10/01) (7/10/02-10/23/02)
Kern 2 1,050 3,550 3,850 3,000 1,850 11,600
(7/17/00-9/28/00) (7/25/01-10/3/01) (7/10/02-10/9/02)
Kern 3 1,600 4,855 5,350 4,650 2,150 19,750
(7/27/00-10/12/00) (7/18/01-10/10/01) (7/10/02-10/30/02)
Kern 4 1,950 5,305 2,950 1,150 2,250 21,150
(7/27/00-10/12/00) (8/8/01-9/27/01) (7/10/02-10/30/02)
Kern 5 1,950 5,355 4,650 2,850 1,850 17,500
(8/4/00-10/12/00) (7/18/01-10/3/01) (7/10/02-10/2/02)
Kern 6 1,700 5,455 3,250 2,000 2,650 13,150
(7/27/00-10/12/00) (8/1/01-9/27/01) (7/10/02-10/30/02)













TABLE 2. THE TOTAL NUMBER OF PRIMARY PARASITES RECOVERED FROM NURSERY SITES IN THE SAN JOAQUIN VALLEY IN 2000-2002. PARASITE RELEASES WERE CONDUCTED
FROM JULY THROUGH NOVEMBER. OVERWINTERING SAMPLING WAS CONDUCTED FROM DECEMBER THROUGH JUNE.

ANP AG Native Aphidiidae

Site Time of Season 2000 2001 2002 2000 2001 2002 2000 2001 2002

Madera 1 Jul.-Nov. 4 6 0 0 0 0 28 7 0
Dec.-Jun. 0 0 0 0 0 0 0 4 0

Madera 2 Jul.-Nov. 36 4 1 1 1 1 21 0 47
Dec.-Jun." 0 0 0 0 0 0 0 0 0

Madera 4 Jul.-Nov. 5 15 1 1 0 0 23 0 79
Dec.-Jun." 0 0 0 0 0 0 0 0 0

Merced 3 Jul.-Nov. 4 3 0 3 0 0 21 19 0
Dec.-Jun. 1 3 0 0 0 0 0 5 0

Kern 1 Jul.-Nov. 0 14 83 0 lb 123 198 359 76
Dec.-Jun. 0 3 2 0 0 0 25 49 17

Kern 2 Jul.-Nov. 12 4 30 6 0 22 729 689 32
Dec.-Jun. 0 0 0 0 0 0 9 102 1

Kern 3 Jul.-Nov. 19 103 235 6 3 77 1,094 117 64
Dec.-Jun. 0 0 0 0 1 0 0 236 7
Kern 4 Jul.-Nov. 24 33 31 10 0 27 657 244 129
Dec.-Jun. 0 0 0 0 0 0 7 16 10
Kern 5 Jul.-Nov. 44 13 44 12 0 27 643 644 56
Dec.-Jun. 0 0 0 0 0 0 0 4 58

Kern 6 Jul.-Nov. 13 4 19 2 0 25 155 202 140
Dec.-Jun. 0 0 0 0 0 0 2 6 7

In 2001 and 2002, overwintering sites for Madera 1, 2, and 4 were located at one site due to the close proximity of the three sites.
bAG recovered approximately 1 month after an early season release at this site.







Scientific Notes


AG have 2-5 setae in this area of the forewing (Ze-
havi and Rosen 1988).
The majority of all parasites were recovered
during the cotton season when releases were
made (Table 2). This is not surprising considering
that this is when cotton aphid densities are the
largest. In general, the density of aphids in Mad-
era and Merced Counties was less than in Kern
County. In 2000, cotton aphid densities in cotton
began to increase in mid-July and peaked in mid
to late September with densities of 1.25-3.75
aphids per leaf in Madera and Merced Counties
and 25-50 aphids per leaf in Kern County. In
2001, the density increase began later in the sea-
son and peaked in mid-August at 2-5 aphids per
leaf in Madera and Merced, and 10-15 aphids per
leaf in Kern. Numbers of aphids in all counties
declined about 3-fold in mid-September. The cot-
ton aphid populations in 2002 were much lower
than in previous years. In Madera and Merced
Counties, only 1 site had significant aphid num-
bers (5 aphids per leaf), and the other three sites
had less than 1 aphid per leaf throughout the cot-
ton season. In Kern County, cotton aphid densi-
ties began to increase in mid-July, but peaked in
September at 3-5 aphids per leaf. Cotton aphid
densities when cotton was not in the field (Decem-
ber to June) for all years remained at less than 1
aphid per leaf on alternate hosts.
Both parasites were recovered during the time
of parasite releases with more ANP recovered
than AG (Table 2). However, only ANP was recov-
ered at 2 of the 10 nursery sites during the winter
and early spring, suggesting that it could over-
winter in the San Joaquin Valley. At the first
nursery site, Merced 3, ANP was recovered in
samples in February 2001 and 2002 (Table 2). A
total of 6,150 ANP had been released in this nurs-
ery during the cotton seasons of 2000-2002 (Table
1). This site was adjacent to a river with winter
vegetation that supported sufficient aphid densi-
ties to allow ANP to overwinter.
The second nursery site where ANP was found
to overwinter was in Kern County (Kern 1). ANP
was recovered in samples collected in April 2002
and March 2003 (Table 2). A total of 8,500 ANP
had been released in this nursery during the cot-
ton seasons of 2000-2002 (Table 1). This nursery


site was adjacent to a nectarine orchard with win-
ter ground cover that provided habitat for the cot-
ton aphid in the winter and spring.

SUMMARY

In an attempt to increase the amount of biologi-
cal control exerted on the cotton aphid in the San
Joaquin Valley, two aphelinids parasites were im-
ported, evaluated for their ability to reduce cotton
aphid densities, and released at ten nursery sites
from 2000 through 2002. One of the parasites,
ANP, was recovered for two consecutive years at
two of the ten nursery sites. These recoveries sug-
gest that ANP may be able to overwinter in the San
Joaquin Valley and may have begun to establish.

REFERENCES CITED
GODFREY, K., D. STEINKRAUS, AND M. McGUIRE. 2001.
Fungal pathogens of the cotton and green peach
aphids in the San Joaquin Valley. Southwestern En-
tomol. 26: 297-303.
ROSENHEIM, J., AND J. CISNEROS. 1994. Biological con-
trol of the cotton aphid, Aphis gossypii, by generalist
predators. Proc. Beltwide Cotton Conf. pp. 1000-1002.
ROSENHEIM, J., L. WILHOIT, AND C. ARMER. 1993. Intra-
guild predation and biological control of the cotton
aphid, Aphis gossypii. Proc. Beltwide Cotton Conf.
pp. 730-732.
ROSENHEIM, J., L. WILHOIT, P. GOODELL, E. GRAFTON-
CARDWELL, AND T. LEIGH. 1997 Plant compensation,
natural biological control, and herbivory by Aphis
gossypii on pre-reproductive cotton: the anatomy of a
non-pest. Entomol. Expt. Appl. 85: 45-63.
TANG, Y., AND R. YOKOMI. 1995. Temperature-depen-
dent development of three hymenopterous parasi-
toids of aphids (Homoptera: Aphididae) attacking
citrus. Environ. Entomol. 24: 1736-1740.
TOKUMARU, S., AND H. TAKADA. 1996. Numbers of eggs
deposited and host feeding in Aphelinus gossypii
Timberlake (Hymenoptera: Aphelinidae), a parasi-
toid of Aphis gossypii Glover (Homoptera: Aphid-
idae). Japan J. Appl. Entomol. and Zool. 40: 242-244.
YOKOMI, R., AND Y. TANG. 1995. Host preference and
suitability of two aphelinids parasitoids (Hy-
menoptera: Aphelinidae) for aphids (Homoptera:
Aphididae) on citrus. J. Econ. Entomol. 88: 840-845.
ZEHAVI, A., AND D. ROSEN. 1988. A new species ofApheli-
nus (Hymenoptera: Aphelinidae) from Israel, with
notes on the mali group. Israel J. Entomol. 22: 101-108.







Florida Entomologist 87(1)


March 2004


BELONUCHUSAGILIS, A FOURTH SPECIES OF THIS GENUS
(COLEOPTERA: STAPHYLINIDAE) REPORTED FROM FLORIDA

J. H. FRANK
Entomology and Nematology Department, University of Florida, Gainesville, FL 32611-0630


From 1915 until 1991,Belonuchus rufipennis (F.)
and B. pallidus Casey were the only species of this
genus reported from Florida (Frank 1986, Smetana
1995). The adults are 4.6-9.0 mm long and, like the
larvae, are predatory. The former is the more wide-
spread in Florida and elsewhere in the eastern and
southern USA. The latter seems restricted to cen-
tral and southern Florida. I have often encountered
both, under fallen, decomposing citrus fruits, where
they feed on smaller insects including fly larvae and
perhaps larvae of nitidulid beetles.
Then, in the 1990s, Smetana (1991, 1995) re-
ported B. gagates Erichson from the Florida Keys
and from Chekika State Recreation Area in Dade
County, without habitat information, but with
collection records as early as 1971. I have never
detected this species in Florida, but had in Ja-
maica in 1969-1972 found it to be an ecological ho-
mologue of the foregoing two species: it likewise is
widespread and abundant in fallen, decomposing
citrus fruits. Adults ofB. gagates are totally black
and easily distinguished from those of the other
two species, which are bicolored, red and black. It
seemed obvious that B. gagates is an adventive
species in Florida, having arrived somehow from
the West Indies, where it is known not only from
Jamaica but also from the Bahamas, Cuba, His-
paniola, Montserrat, and the US Virgin Islands
(St. John and St. Thomas) (Blackwelder 1943).
The only other species known from Jamaica is
B. agilis Erichson, which I never found in fallen
citrus fruits in 1969-1972. Blackwelder (1943) re-
ported it also from Cuba, and listed one habitat as
"on Ceiba (silk-cotton tree)." Its habitat neverthe-
less remained mysterious to me until 1985, when
I found adults to be plentiful in the yellow flower
bracts of Heliconia caribaea Lamarck in the John
Crow Mountains of Portland Parish in eastern Ja-
maica I now have various records of Belonuchus
spp. in Heliconia spp. flower bracts from several
countries, which I will discuss in a later paper. I
state here, without further detail, that I also col-
lected specimens ofB. agilis in Heliconia bracts in
the Dominican Republic in 1987. It seems to me
that B. agilis is not an exact ecological homologue
of the foregoing species because I have not found
it to colonize the habitat provided by fallen citrus
fruits in Jamaica or the Dominican Republic (I
have been denied permission to visit Cuba by the
US Treasury Department).
On 9 July 2003, a "multilure trap" in a mango
tree in the 7400 block of SW 139th Terrace, Miami,
Florida, caught a staphylinid beetle which was
later submitted to me for specific identification


(the collector was Division of Plant Industry In-
spector Gwen Myres). It was a female ofB. agilis,
lacking the apices of both antennae and some tar-
someres. Specimens of this species may easily be
distinguished from other adult Belonuchus in
Florida by being black, with the last two abdomi-
nal segments largely yellow. The species poses no
threat to agriculture because adults and larvae
are predacious. The method of arrival of this spe-
cies is unknown, so by default we may call it ad-
ventive (it arrived). I do not know whether it
arrived in Florida as an immigrant (by wind-as-
sisted flight, or as a hitchhiker aboard an aircraft,
from Cuba or Jamaica or the Dominican Republic;
if it arrived in an aircraft, it may have been a con-
taminant of cut Heliconia flowers from Jamaica
or the Dominican Republic; if it arrived naturally,
its most likely source is Cuba), or (vastly less
likely) it was introduced (someone imported it de-
liberately without permit [no permit has ever
been issued]). There are thus two native species
(B. rufipennis and B. pallidus) and two adventive
species (B. gagates and B. agilis) of this genus in
Florida. One of these (B. pallidus) is precinctive
to Florida (is known from nowhere else and pre-
sumably evolved here). Definitions of these terms
are given by Frank & McCoy (1990, 1995). It
seems highly unlikely that a specimen ofB. agilis
would have been taken in a "multilure trap" on a
mango tree in southwestern Miami (far from Mi-
ami airport) unless the species were established,
at least temporarily, in southern Florida.
In this note, I am reporting B. agilis for the
first time from the Dominican Republic and Flor-
ida. I made value judgments with inadequate
data. I believe that this species has been present
in the Dominican Republic for hundreds or thou-
sands of years, but has simply been overlooked by
collectors, and may thus be called native. I believe
that it has arrived recently in Florida. If my as-
sumptions are correct, the year of first record
proves little when comparing the faunas of south
Florida and the Greater Antilles. There is no evi-
dence that the species was "introduced" (the un-
fortunate vocabulary in general use) to either the
Dominican Republic or Florida.
I thank M. C. Thomas and P. E. Skelley for re-
viewing a manuscript draft. This is Florida Agricul-
tural Experiment Station journal series R-09669.

SUMMARY

Belonuchus agilis Erichson (Coleoptera: Sta-
phylinidae), native to Cuba, Jamaica, and the Do-







Scientific Notes


minican Republic, is newly reported from
southern Florida, USA, a state and continental
record for an adventive species.


REFERENCES CITED

BLACKWELDER, R. E. 1943. Monograph of the West In-
dian beetles of the family Staphylinidae. United
States Natn. Mus. Bull. 182: i-viii, 1-658.
FRANK, J. H. 1986. A preliminary checklist of the Sta-
phylinidae (Coleoptera) of Florida. Florida Entomol.
69: 363-382.


FRANK, J. H., AND E. D. McCOY. 1990. Endemics and ep-
idemics of shibboleths and other things causing
chaos. Florida Entomol. 73: 1-9.
FRANK, J. H., AND E. D. McCOY. 1995. Precinctive insect
species in Florida. Florida Entomol. 78: 21-35.
SMETANA, A. 1991. Belonuchus minax Erichson, 1840
redescription and lectotype designation (Coleoptera:
Staphylinidae). Coleopts. Rdsch. 61: 49-50.
SMETANA, A. 1995. Rove beetles of the subtribe Philon-
thina of America north of Mexico (Coleoptera: Sta-
phylinidae). Classification, phylogeny, and
taxonomic revision. Memoirs on Entomology, Inter-
national 3: i-x, 1-946.




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs