<%BANNER%>

Lankesteriana

MISSING IMAGE

Material Information

Title:
Lankesteriana la revista científica del Jardín Botánico Lankester, Universidad de Costa Rica
Physical Description:
v. : ill. (some col.) ; 25 cm.
Language:
English
Creator:
Jardín Botánico Lankester
Publisher:
Jardi´n Bota´nico Lankester, Universidad de Costa Rica
Jardín Botánico Lankester, Universidad de Costa Rica
Place of Publication:
Cartago Costa Rica
Cartago, Costa Rica
Publication Date:
Frequency:
three times a year[2002-]
irregular[ former 2001]
three times a year
regular

Subjects

Subjects / Keywords:
Botany -- Periodicals -- Costa Rica   ( lcsh )
Epiphytes -- Periodicals -- Costa Rica   ( lcsh )
Orchids -- Periodicals -- Costa Rica   ( lcsh )
Plantkunde   ( gtt )
Botanische tuinen   ( gtt )
Genre:
periodical   ( marcgt )
serial   ( sobekcm )
Spatial Coverage:
Costa Rica

Notes

Language:
In English and Spanish.
Dates or Sequential Designation:
No. 1 (mayo 2001)-
Numbering Peculiarities:
Issues for May 2001-Oct. 2003 designated no.1-8; issues for Apr. 2004- designated vol. 4, no. 1-
General Note:
Latest issue consulted: Vol. 4, no. 1 (abr. 2004).
General Note:
International journal on orchidology.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
oclc - 48491453
lccn - 2001240973
issn - 1409-3871
System ID:
UF00098723:00033

MISSING IMAGE

Material Information

Title:
Lankesteriana la revista científica del Jardín Botánico Lankester, Universidad de Costa Rica
Physical Description:
v. : ill. (some col.) ; 25 cm.
Language:
English
Creator:
Jardín Botánico Lankester
Publisher:
Jardi´n Bota´nico Lankester, Universidad de Costa Rica
Jardín Botánico Lankester, Universidad de Costa Rica
Place of Publication:
Cartago Costa Rica
Cartago, Costa Rica
Publication Date:
Frequency:
three times a year[2002-]
irregular[ former 2001]
three times a year
regular

Subjects

Subjects / Keywords:
Botany -- Periodicals -- Costa Rica   ( lcsh )
Epiphytes -- Periodicals -- Costa Rica   ( lcsh )
Orchids -- Periodicals -- Costa Rica   ( lcsh )
Plantkunde   ( gtt )
Botanische tuinen   ( gtt )
Genre:
periodical   ( marcgt )
serial   ( sobekcm )
Spatial Coverage:
Costa Rica

Notes

Language:
In English and Spanish.
Dates or Sequential Designation:
No. 1 (mayo 2001)-
Numbering Peculiarities:
Issues for May 2001-Oct. 2003 designated no.1-8; issues for Apr. 2004- designated vol. 4, no. 1-
General Note:
Latest issue consulted: Vol. 4, no. 1 (abr. 2004).
General Note:
International journal on orchidology.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
oclc - 48491453
lccn - 2001240973
issn - 1409-3871
System ID:
UF00098723:00033


This item is only available as the following downloads:


Full Text

PAGE 1

INTERNATIONAL JOURNAL ON ORCHIDOLOGYISSN 1409-3871VOL. 13, No. 1 AUGUST 2013 PROCEEDINGSof theFOURTH SCIENTIFIC CONFERENCE ON ANDEAN ORCHIDSGuayaquil, Ecuador, October 31November 04, 2012Edited by ALEC M. PRIDGEON Royal Botanic Gardens, Kew Richmond, Surrey, TW9 3AB United Kingdom

PAGE 2

The Vice-Presidency of Research UNIVERSITY OF COSTA RICA is sincerely acknowledged for his support to the printing of this volume

PAGE 3

INTERNATIONAL JOURNAL ON ORCHIDOLOGY Copyright 2013 Lankester Botanical Garden, University of Costa Rica Effective publication date: July 30, 2013 Layout: Jardn Botnico Lankester. Cover: Catasetum tenebrosum Printer: MasterLitho Printed copies: 500 Printed in Costa Rica / Impreso en Costa RicaR Lankesterian a / International Journal on Orchidology

PAGE 4

Preface ALEC M. PRIDGEON Acknowledgments Molecular phylogenetics of Mormolyca (Orchidaceae: Maxillariinae) based on combined molecular data sets RAF AEL ARV ALO and KENNETH M. CAMERON Orchids without borders: studying the hotspot of Costa Rica and Panama DIEGO BOGARN, FRANCO PUPULIN, CLOTILDE ARROCHA and JORGE WARNER Conservation status and strategies for the preservation of orchids in the Soconusco region of southeast Mexico ANNE DAMON Orchids and eMonocot assembling research resources and facilitating collaborative taxonomy online LAUREN M. GARDINER, RUTH BONE and NIAMH M. KILGALLEN La pesadilla de Lindley la biologa sexual de Catasetum y Cycnoches GNTER GERLACH Long-term hurricane effects on populations of two epiphytic orchid species from Guanahacabibes Peninsula, Cuba ERNESTO MJICA, JOSEP RA VENTS, ELAINE GONZLEZ and ANDREU BONET Tropical orchid mycorrhizae: potential application in tropical orchid conservation, commercialization, and beyond JOEL TUPAC OTERO, ANA TERESA MOSQUERA and NICOLA S. FLANAGAN Pollination of slipper orchids (Cypripedioideae): a review ROBERT W. PEMBERTON Toward a global orchid taxonomic network FRANCO PUPULIN Orchid conservation: the next ten years PHILIP T SEA TON, HUGH W. PRITCHARD, D. M. PUSPIT ANINGTY AS and T R. MARKS Diversidad de orqudeas de las diferentes formaciones vegetales de los Andes Peruanos DELSY TRUJILLO IX X 1 13 27 33 39 47 57 65 75 93 103 TABLE OF CONTENTS continues

PAGE 5

SEM and phylogenetic analysis of naturalized and cultivated Epidendrum in Hawaii INGELIA P. WHITE, MICHAEL F FA Y, BRAD W. PORTER and KIMBERLEY CHINEN Tulasnella irregularis (Basidiomycota: Tulasnellaceae) from roots of Encyclia tampensis LAWRENCE W. ZETTLER, LAURA L. COREY, ALISHIA L. JACKS, LUKE T GRUENDER and ALYSSA M. LOPEZ POSTERS SYSTEMATICS Lepanthes en Puerto Rico: especiacin o inmigracin? PAUL BA YMAN GUPT A Development of a novel gene silencing method for orchids R. FRAZER, A. SCHULTE, B. POMAHACOV A, R. V AN VUGT and B. GRA VENDEEL Diversidad de orqudeas de los bosques altos de la Serrana de los DUV AN A. GARCA-RAMREZ and J. SANTIAGO GARCA-REVELO Taxonomy, molecular phylogenetics, reproductive isolation, and niche differentiation of the Specklinia endotrachys species complex (Orchidaceae: Pleurothallidinae) ADAM P. KARREMANS, FRANCO PUPULIN and BARBARA GRA VENDEEL Morphological and phylogenetic characterization of the diversity of the genus Vanilla FRANCISCO HERNANDO MOLINEROS-HURT ADO, R. T GONZLEZ-MINA, J. T OTERO and N. S. FLANAGAN Gavilea (Orchidaceae) MARA ISABEL MUJICA and FERNANDA PREZ Atlas of orchids of the state of Santa Catarina MARCELO VIEIRA NASCIMENTO Orchidacae of Campeche Island, Florianpolis, Santa Catarina MARCELO VIEIRA NASCIMENTO 113 119 131 131 132 132 133 133 134 134 TABLE OF CONTENTS II

PAGE 6

Cattleya labiata MARCELO VIEIRA NASCIMENTO OSCAR ALEJANDRO PREZ-ESCOBAR, PEDRO ORTIZ VALDIVIESO, EDICSON PARRASNCHEZ, CRISTIAN RINCN-USECHE and LIZETH KA THERINE RODRGUEZ Anotaciones sobre la composicin de la comunidad de orqudeas en la Reserva Natural Bosque de Yotoco (Valle del Cauca, Colombia) NHORA HELENA OSPINA-CALDERN, GINA ARROYO-GARCA and J. TUPAC OTERO Checklist and illustrated guide to the Cauca River Valleys orchids and the Andean foothills (southwestern Colombia) G. A. REINA-RODRGUEZ, N. H. OSPINA-CALDERN, ALEJANDRO CAST AO, IGNASI SORIANO and J. TUPAC OTERO Panam ZULEIKA SERRACN-HERNNDEZ, RAF AEL RINCN, EYV AR RODRGUEZ-QUIEL and DIEGO BOGARN Stelis should be used? RODOLFO SOLANO and GERARDO SALAZAR A newly recognized clade of Pleurothallis with Mesoamerican distribution M. WILSON, F PU P ULIN, F L ARCHIL A-MOR A LES, A. DAM ON and R SOL A NOGO M EZ A preliminary phylogenetic analysis of Pleurothallis sensu lato based upon nuclear and plastid sequences M. WILSON, C. BELLE, A. DANG, P. HANNAN, L. KELLOGG, C. KENYON, H. LOW, A. MOCHIZUKI, A. NGUYEN, N. SHEADE, L. SHAN, A. SHUM, T ST A YTON, C. VOLZ, B. VOSBURGH, H. WELLMAN and M. WOOLLEYECOLOGY Prosthechea aff. karwinskii LAURA L. CEDILLO, CARLOS GMEZ-ALONSO and IRENE VILA-DAZ Horizontal and vertical distributional patterns of epiphytic Orchidaceae in a cloud forest in Colombia MARCELA CUART AS-DOMNGUEZ 135 135 136 136 137 137 138 139 140 140 TABLE OF CONTENTS III

PAGE 7

Reproductive biology of Masdevallia coccinea and Masdevallia ignea in Guasca (Cundinamarca: Colombia) MNICA ADRIANA CUERVO MARTNEZ, RODRIGO BUSTOS SINGER and MARIA ARGENIS GMEZ BONILLA Cattleya quadricolor Lindl. LUZ NGELA GUERRERO, JISSEL PREZ-QUIROGA, MARA ALEJANDRA QUINTERO, ALBERTO ROJAS-TRIVIO & J. TUPAC OTERO Mycorrhizal and endophytic fungal communities associated with roots of Pseudorchis albida (Orchidaceae) PETR KOHOUT, TAMARA MALINOV, MELANIE ROY, MARTIN VOHNK and JANA JERSKOV The genus Neottia an early step in shift from autotrophy to mycoheterotrophy in orchids? TAMARA MALINOV, MILAN KOTILNEK, JANA JERSKOV, FRANCOIS-XA VIER JOLY and MARC-ANDR SELOSSE Endophytic fungi associated with natural populations of Vanilla species in south-west Colombia ANA TERESA MOSQUERA-ESPINOSA, J. TUPAC OTERO and NICOLA S. FLANAGAN Hongos micorrzicos de orqudeas en poblaciones naturales en los departamentos del Valle del Cauca y Antioquia, Colombia ANA TERESA MOSQUERA-ESPINOSA, PAUL BA YMAN and J. TUPAC OTERO Rodriguezia granadensis (Lindl.) Rchb.f. NHORA HELENA OSPINA-CALDERN, J. TUPAC OTERO and R. L. TREMBLA Y Distribution patterns of Cuitlauzina pendula La Llave & Lex (Orchidaceae) over its phorophytes at the Barranca de Cupatitzio National Park, in VERNICA A. PREZ-DECELIS, CARLOS GMEZ-ALONSO and IRENE VILA-DAZ Mating system and reproductive success of Cuitlauzina pendula La Llave & Lex (Orchidaceae) at the National Park Barranca del Cupatitzio of UruaVERNICA A. PREZ-DECELIS and IRENE VILA-DAZ 141 141 142 143 143 144 144 145 146 TABLE OF CONTENTS IV

PAGE 8

V Vanilla spp. (Orchidaceae) ALEJANDRO RECALDE, ALBERTO ROJAS-TRIVIO, JOEL TUPAC OTERO and NICOLA S. FLANAGAN Ceratobasidium lineages associated with two epiphytic orchids in Colombia RAF AEL BORGES DA SILV A VALADARES, ELKE JURANDY BRAN NOGUEIRA CARDOSO and JOEL TUPAC OTEROCONSERVATION SCIENCE PAUL BA YMAN GUPT A in vitro de Rhynchostele bictoniensis (Bateman) Soto Arenas & Salazar, en medio de cultivo Knudson C VINCENZO BERTOLINI, ANNE DAMON, JA VIER VALLE MORA and ANGEL ROJAS VELZQUEZ NA T ANAEL Research Group in Orchids, Ecology and Plant Systematics: an inter-institutional initiative for plant conservation and sustainable use in south-west Colombia NICOLA S. FLANAGAN, A. T MOSQUERA-ESPINOSA, R. T GONZLEZ, F H. MOLINEROS-HURT ADO, N. H. OSPINA-CALDERN, M. CUART AS-DOMNGUEZ, P. A. SILVERSTONE-SOPKIN, G. REINA, M. C. DIEZ, R. OSPINA-TORRES, J. D. ACKERMAN, P. BA YMAN and J. T OTERO Orchids of the cloud forests of Dapa (Valle del Cauca, Colombia): research and conservation of forest treasures TERRY LYNN GARTELMAN-GONZALEZ, OSCAR ALEJANDRO PREZ-ESCOBAR and EDICSON PARRA-SNCHEZ Distribution pattern, conservation status, and traditional therapeutic uses of orchids with particular reference to Solan district, Himachal Pradesh, India K. C. MAHANT, PROMILA PA THAK and KUMAR SHARMA VINA Y Orchid legislation in Santa Catarina, Brasil MARCELO VIEIRA NASCIMENTO 146 147 148 148 149 149 150 151 TABLE OF CONTENTS

PAGE 9

Avances para la conservacin de Masdevallia caudata Lindl. JUAN CAMILO ORDOEZ-BLANCO Orquideas de los bosques de niebla del suroccidente de Colombia y oportunidades para su conservacion JORGE OREJUELA-GARTNER Medicinal orchids of India and conservation measures for their sustainable management PA THAK PROMILA Plan de manejo para la conservacin de Cattleya quadricolor Lindl. en el Valle del Cauca, Colombia GUILLERMO ALBERTO REINA-RODRGUEZ and N. H. OSPINA-CALDERN Characterization of Brassolaeliocattleya Raye Holmes Mendenhall putatively transformed for resistance to Cymbidium mosaic virus NY AN STILL WELL, HEA THER MCCAFFERTY, YUN J. ZHU and INGELIA WHITE Pestiferous scale insects on native epiphytic orchids in south Florida: a new threat posed by exotic species LAWRENCE W. ZETTLER, JENNIFER A. ZETTLER, LARRY W. RICHARDSON, HALEIGH A. RA Y, JOHN P. MCCORMICK, ANDREW L. STICE and IAN STOCKS 151 152 152 153 153 154 TABLE OF CONTENTS VI

PAGE 10

Visit the new LA N K ESTERI A N A LANKESTERIANA LANKESTERIANA is indexed by B IOSIS ZB it is included in the databases of AO LANKESTERIANA the journal maintains since 2009 a web LA N K ESTERI A N A including the currrent issue, and LANKESTERIANA is com LANKESTERIANA The editors

PAGE 11

The Global Orchid Taxonomic Network at a click Now with a new user interface, the online database on taxonomic information by Lankester Botanical Gar free, im-mediately downloadable Hundredscations and other materials relative to orchid systematics, distribution and history are added to the database on new pages downloaded for free EPIDENDRA The Global Orchid Taxonomic Network

PAGE 12

IX PREFACE ALEC M. PRIDGEON LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.

PAGE 13

X Proceedings ALEC M. PRIDGEON LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.

PAGE 14

LANKESTERIANA. 2013MOLECULAR PHYLOGENETICS OF MORMOLYCA (ORCHIDACEAE: MAXILLARIINAE) BASED ON COMBINED MOLECULAR DATA SETS RAF AEL ARV ALO* & KENNETH M. CAMERON ABSTRACT Mormolyca Maxillaria Rufescens when similarity rpoC1, matK trnK intron, atpB-rbcL ycf1 ) and the nuclear ribosomal internal and external Mormolyca Mormolyca KEY WORDS MormolycaIntroduction et al. et al. Mormolyca Mormolyca Maxillaria rufescens Chrysocycnis embedded within it (Whitten et al. have been transferred into Mormolyca to achieve Mormolyca, The genus Mormolyca as originally circumscribed by Garay and Wirth (1959) was differentiated from Maxillaria Maxillaria rufescens Rufescens Mormolyca et al.

PAGE 15

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.2 LANKESTERIANA Chrysocycnis are Plants from both Mormolyca and the former Chrysocycnis Chrysocycnis M. ringens (Singer et al. of Mormolyca century by studies of unrelated terrestrial orchids in et al. et al. some of the Mormolyca the Rufescens et al. et al. Rufescens et al. Mormolyca Mormolyca Rufescens et al. et al. molecular data sets by increasing taxon and gene Mormolyca that can be used in subsequent evolutionary studies and taxonomic Materials and methods Taxon sampling ca. Mormolyca (Blanco et al. et al. et al. et al. Mormolyca

PAGE 16

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. ARV ALO & CAMERON Mormolyca3 Taxon Collector and number Source Herbarium 1 Brasiliorchis picta (Hook.) R.B.Singer, S.Koehler & Carnevali Whitten 2755 Brazil, cult. FLAS 2 Brasiliorchis schunkeana (Campacci & Kautsky) R.B.Singer, S.Koehler & Carnevali Whitten 1992 Brazil, cult. FLAS 3 Bifrenaria tetragona (Lindl.) Schltr. Whitten 93156 Brazil FLAS 4 Camaridium carinulatum (Rchb.f.) M.A.Blanco Arvalo 932 Colombia COL 5 Camaridium ochroleucum Lindl. Gerlach 2003 Brazil M 6 Christensonella ferdinandiana (Barb.Rodr.) Szlach., Mytnik, Grniak & Smiszek Koehler 0089 Brazil SP 7 Christensonella nardoides (Kraenzl.) Szlach. Whitten 2502 Ecuador, cult. Ecuagenera FLAS 8 Cryptocentrum peruvianum (Cogn.) C.Schweinf. Whitten 2322 Ecuador FLAS 9 Cryptocentrum sp. Arvalo 931 Colombia COL 10 Cyrtidiorchis alata (Ruiz & Pav.) Rauschert Whitten 2932 Ecuador, cult. FLAS 11 Cyrtidiorchis rhomboglossa (F.Lehm. & Kraenzl.) Rauschert Giraldo 17 Colombia COL 12 Eriopsis biloba Lindl. Whitten 3153 Ecuador QCA 13 Heterotaxis villosa (Barb.Rodr.) F.Barros Arvalo 902 Colombia COL 14 Heterotaxis violaceopunctata (Rchb.f.) F.Barros Whitten 2294 Brazil, cult. FLAS 15 Inti bicallosa (Rchb.f.) M.A.Blanco Whitten 2636, Panama FLAS 16 Inti chartacifolia (Ames & C.Schweinf.) M.A.Blanco Whitten 2752 cult. FLAS 17 Mapinguari auyantepuiensis (Foldats) Carnevali & R.B.Singer Whitten 2347 Ecuador FLAS 18 Mapinguari longipetiolatus (Ames & C.Schweinf.) Carnevali & R.B.Singer Atwood & Whitten 5075 Costa Rica SEL 19 Maxillaria farinosa Arvalo & Christenson, sp. nov. Arvalo 734 Colombia COL 20 Maxillaria splendens Poepp. & Endl. Koehler 0144 Brazil, cult. UEC 21 Maxillaria tenebrifolia Arvalo & Christenson, sp. nov. Arvalo 454 Colombia COL 22 Maxillariella procurrens (Lindl.) M.A.Blanco & Carnevali Whitten 2397 Ecuador, cult. FLAS 23 Mormolyca cf. acutifolia (Lindl.) M.A.Blanco 1: Arvalo 1071 Colombia, cult. Colomborquideas WIS 2: Giraldo 44 Colombia COL 24 Mormolyca cf. aureoglobula (Christenson) M.A.Blanco Arvalo 1069 Colombia, cult. Orqudeas del Valle WIS 25 Mormolyca chacoensis (Dodson) M.A.Blanco Arvalo 947 Per, cult., Agroriente Viveros COL TABLE

PAGE 17

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.4 LANKESTERIANA 26 Mormolyca culebrica Bogarn & Pupulin Whitten 2650 Pnama, cult. FLAS 27 Mormolyca dressleriana (Carnevali & J.T.Atwood) M.A.Blanco 1: Arvalo 1066 Pnama, cult. WIS 2. Arvalo 1065 Costa Rica, cult. WIS 28 Mormolyca fumea Bogarn & Pupulin Bogarn 5729 Costa Rica CR 29 Mormolyca gracilipes (Schltr.) Garay & Wirth Arvalo 1061 Colombia, cult., Orqudeas del Valle WIS 30 Mormolyca hedwigiae (Hamer & Dodson) M.A.Blanco 1: Koehler 0314 Guatemala, cult. ESA 2: Arvalo 1065 Honduras, cult. WIS 31 Mormolyca moralesii (Carnevali & J.T.Atwood) M.A.Blanco 1: Bogarn 3826 Costa Rica JBL 2: Bogarn 4139 Costa Rica JBL 32 Mormolyca peruviana C.Schweinf. Whitten 2497 Ecuador, cult. FLAS 33 Mormolyca polyphylla Garay & Wirth Arvalo 950 Ecuador, cult. Ecuagenera COL 34 Mormolyca pudica (Carnevali & J.L.Tapia) M.A.Blanco Arvalo 1068 Puerto Rico WIS 35 Mormolyca richii (Dodson) M.A.Blanco 1: Whitten 2362 Ecuador, cult. FLAS 2: Arvalo 1064 Ecuador, cult. WIS 36 Mormolyca ringens (Lindl.) Gentil Arvalo 1062 Colombia, cult. Orqudeas del Valle WIS 37 Mormolyca rufescens (Lindl.) M.A.Blanco 1: Arvalo 1073 U.S.A., cult. Marie Selby Botanical Gardens WIS 2: Arvalo 941 Per, cult., Agroriente Viveros WIS 3: Arvalo 1076 U.S.A., cult. Marie Selby Botanical Gardens WIS 4: Arvalo 1075 U.S.A., cult. Marie Selby Botanical Gardens WIS 5: Arvalo 942 Per, cult., Agroriente Viveros COL 6: Arvalo 943 Per, cult., Agroriente Viveros COL 38 Mormolyca sanantonioensis (Christenson) M.A.Blanco Arvalo 1070 Colombia, cult. Orqudeas del Valle WIS 39 Mormolyca schlimii (Linden & Rchb.f.) M.A.Blanco Giraldo 763 Colombia COL 40 Mormolyca schweinfurthiana Garay & Wirth Arvalo 956 Ecuador, cult. Ecuagenera COL 41 Mormolyca suareziorum (Dodson) M.A.Blanco Arvalo 945 Per, cult., Agroriente Viveros COL 42 Mormolyca cf. suareziorum (Dodson) M.A.Blanco Whitten 2758 Ecuador, cult. FLAS 43 Mormolyca cf. tenuibulba (Christenson) M.A.Blanco 1: Arvalo 878 Colombia COL 2: Arvalo 951 Ecuador, cult., Ecuagenera COL 3: Arvalo 1072 Colombia, cult. Colomborquideas WIS 44 Mormolyca sp. nov. A Arvalo 1063 U.S.A., cult., Marie Selby Botanical Gardens WIS 45 Mormolyca sp. nov. B Blanco 3108 Ecuador, cult. FLAS 46 Mormolyca sp. nov. C 1: Arvalo 1074 Colombia, cult. Colomborqudeas WIS 2: Arvalo 939 Per, cult., Agroriente Viveros COL 3: Arvalo 953 Per, cult., Agroriente Viveros COL TABLE Continued

PAGE 18

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. ARV ALO & CAMERON Mormolyca5 matK trnK intron, the atpB-rbcL rpoC1 gene, and the ycf1, along with the nuclear trnK, atpB-rbcL, rpoC1 and ITS from Whitten et al. ycf1 from Neubig et al. et al. et al. Data analysisPhylogenetic inference methods (Ronquist et al. Results Mormolyca, 47 Nitidobulbon nasutum (Rchb.f.) Ojeda & Carnevali Whitten 1869 Ecuador FLAS 48 Nitidobulbon proboscideum (Rchb.f.) Ojeda & Carnevali Atwood & Whitten 5056 Venezuela SEL 49 Ornithidium montezumae Arvalo & Christenson Arvalo 674 Colombia COL 50 Ornithidium cf. semiscabrum Lindl. Arvalo 588 Colombia COL 51 Ornithidium aggregatum (Kunth) Rchb.f. Arvalo 623 Colombia COL 52 Pityphyllum saragurense (Dodson) Whitten Whitten 3084 Ecuador, cult. QCA 53 Pityphyllum antioquiense Schltr. Whitten 2473 Ecuador, cult. FLAS 54 Rhetinantha acuminata (Lindl.) M.A.Blanco Whitten 2698 Ecuador FLAS 55 Rhetinantha notylioglossa (Rchb.f.) M.A.Blanco Koehler 0033 Brazil UEC 56 Sauvetrea alpestris (Lindl.) Szlach. Whitten 2551 Ecuador, cult. FLAS 57 Sauvetrea laevilabris (Lindl.) M.A.Blanco Whitten 2358 Ecuador, cult. FLAS 58 Trigonidium egertonianum Bateman ex Lindl. Arvalo 1060 cult. WIS 59 Trigonidium obtusum Lindl. Whitten 2997 cult. FLAS TABLE Continued

PAGE 19

Data set No. of ingroup taxa Aligned length No. of variable characters No. of parsimonyinformative characters No. of most parsimonious trees Tree length CI RI nrDNA 38 1368 546 (39.9%) 301 (22%) 126,660 1129 0.637 0.716 cpDNA 38 7242 1254 (17.3%) 521 (7.2%) 88,329 2155 0.650 0.706 totalDNA 38 8610 1801 (20.9%) 822 (9.5%) 8353 3373 0.629 0.688 TABLE LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA among all genera and within Mormolyca, as assessed were similar, but the Bayesian tree was more highly resolved within Mormolyca (Maxillaria farinosa, M. tenebrifolia, and Ornithidium montezumae Mormolyca into three clusters (showed with color branches on Mormolyca tree) are the earliest extant lineages to diverge from M. polyphyla, M. peruviana, M. schweinfurthiana, M. gracilipes, and M. ringens, ending with M. schlimii, which is sister to the single large clade containing all members of the former Rufescens Discussion the Maxillaria rufescens Chrysocycnis Mormolyca (Blanco et al. et al. Mormolyca M. polyphylla, arcuate column (Blanco et al. M. pudica et al. a more northern distribution, reaching all the way to Mormolyca M. schlimii include M. aurorae or M. fuchsii, which are known M. lehmanii, for M. gracilipes and M. schweinfurthiana

PAGE 20

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. ARV ALO & CAMERON Mormolyca material needs to be examined to make a conclusive Rufescens of these secrete small quantities of resin on the labellum et al. found as a result of this study (Mormolyca which is sister to the rest of the clade consisting of M. richii, M. hedwigiae, M. culebrica, and M. fumea. The et al. 2011) and considered a synonym of M. aureoglobula a distinct branch sister to M. culebrica The remaining Mormolyca Rufescens et al. of either Mormolyca rufescens M. acutifolia with M. rufescens are usually considered to be related to M. acutifolia A factor contributing to this taxonomic confusion is the fact that M. acutifolia M. dressleriana reunites what we are considering M. acutifolia along and now segregated (i.e. M. pudica, M. aureoglobula, M. sanantonioensis, M. moralesii M. tenuibulba FIGURE Mormolyca acutifolia; M. aureoglobula; M. chacoensis; M. culebrica; M. dressleriana; M. hedwigiae; M. peruviana; M. polyphylla; M. richii; M. ringens; M. rufescens; M. sanantonioensis; M. schweinfurthiana; M. suareziorum; M. tenuibulba; M. M. M.

PAGE 21

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA FIGURE

PAGE 22

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. ARV ALO & CAMERON Mormolyca9 FIGURE

PAGE 23

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.10 LANKESTERIANAof Mormolyca Mormolyca M. rufescens M. suareziorum, along with accessions of what we Mormolyca (Mormolyca M. rufescens that Mormolyca among these accessions are unresolved in our analyses, Mormolyca be reconsidered or even disregarded as a character currently underway in the search for unambiguous Mormolyca, and we gene PhyC (Russell et al. Mormolyca as a model LITERA TURE CITED Ornithidium and Maxillaria Mormolyca Maxillaria rufescens Maxillaria in: Maxillaria Maxillaria Maxillaria Maxillaria

PAGE 24

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. ARV ALO & CAMERON Mormolyca11 Mormolyca Cyrtoglottis Maxillaria Maxillaria acutifolia In Galeandra utility of ycf1 than matK. Polystachya (Orchidaceae) as Ecology and Evolutionary Biology, University of Mormolyca ringens Caladenia Chrysocycnis in: limits in Maxillaria Maxillaria and

PAGE 25

LANKESTERIANA

PAGE 26

LANKESTERIANA. 2013 OF COSTA RICA AND PANAMA DIEGO BOGARN 1,2,3 FRANCO PUPULIN 1,3,4 CLOTILDE ARROCHA 2 & JORGE WARNER 1123 4 ABSTRACT 2 2 KEY WORDS km2 values in the region (Ossenbach et al. Phylogenetic studies on the evolution of the family show of orchids, and a critical examination of their orchid establishment of a successful research system, whereas

PAGE 27

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.14 LANKESTERIANA Geography called the Isthmus of Panama that links North and intricate mountain range with the highest elevations Talamanca loses elevation towards central Panama in is the narrowest stretch of the isthmus, and elevations elevation mountain ranges but relatively isolated from Talama Geology et al. (1992), three major events favored by the convergent tectonics of the eastern submarine range led to the rise of the isthmus from FIGURE 2 FIGURE

PAGE 28

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. BOGARN et al. Orchids without borders15 FIGURE FIGURE

PAGE 29

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA FIGURE FIGURE

PAGE 30

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. BOGARN et al. Orchids without borders region of the isthmus was affected by the collision of the volcanic arc with northwestern South America Climate and vegetation close to the Equator and surrounded by two oceans, mountain chains with different elevational ranges, and et al. from the collision of local winds with the moist air of Panama the climate is warm and rainy, similar to et al. et al. FIGURE

PAGE 31

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA FIGURE Lepanthes Pleurothallidinae (the most diverse subtribe of the 4000 m) such as Brachionidium Lepanthes Pleurothallis Stelis Fernandezia Telipogon Kunth, and other terrestrial genera such as Aa and Petrichis et al. is Lepanthes et al. et al.

PAGE 32

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. BOGARN et al. Orchids without borders19 L. schizocardia and Panama showed that L. schizocardia is an endemic L. montis-narae L. sotoana both formerly treated as L. schizocardia et al. A review of the history of the orchidology in Costa Rica and Panama which mainly began in the nineteenth century with the ollection of Harvard and his colleagues over more than three Orchidaceae Powellianae Panamenses undertaken the systematic study of orchids of Panama, FIGURE A. B. Josef FIGURE

PAGE 33

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.20 LANKESTERIANA Field Guide to the Orchids of Costa Rica and Panama et al. Lepanthes Flora of Panama et al. Lepanthes is just an for the study of Orchidaceae in Pa in Costa Rica FIGURE FIGURE A. B. FIGURE FIGURE

PAGE 34

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. BOGARN et al. Orchids without borders21 countries to establish centers or institutions dedicated Rica are research centers that contributed greatly to et al. countries with the aim of having an active network of Royal Botanic Gardens, Kew, among others (Atwood Early in this century, the JBL managed to consolidate its own research system, which laid the foundation and other digital documentation, botanical access to literature and other original documentary Through this system the JBL has assumed the role FIGURE Aspasia epidendroides collected in Panama et Columbia occidentali

PAGE 35

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.22 LANKESTERIANA FIGURE Pleurothallis homalantha FIGURE

PAGE 36

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. BOGARN et al. Orchids without borders23 FIGURE Aspasia epidendroides

PAGE 37

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.24 LANKESTERIANA FIGURE Trichocentrum cebolleta et al. The Orchid Project of JBL and UCH The establishment o center in Panama is essential for the understanding of agreements with other botanical institutions such as at EP IDENDR A La Amistad International Park, a World Heritage site by

PAGE 38

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. BOGARN et al. Orchids without borders25 FIGURE FIGURE AC K NO W LEDG M ENTS. LITER A TURE CITED Lepanthes ovalis Dendrobium and Earina FIGURE

PAGE 39

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA Rodriguezia-Zygosepalum. Dryadella, Lepanthes and Pleurothallis Lepanthes Lepanthes Lepanthes L. schizocardia

PAGE 40

LANKESTERIANA. 2013CONSERVATION STATUS AND STRATEGIES FOR THE PRESERVATION OF ORCHIDS IN THE SOCONUSCO REGION OF SOUTHEAST MEXICO ANNE DAMON ABSTRACT RESUMEN KEY WORDS Soconusco region is situated in the southeastern aid channeled through a variety of social, economic, effective land management, and conservation of a wealthy country that could do much to satisfy the GLOSSARY

PAGE 41

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA which then feeds into the national and international Little has been achieved trying to work within the as vulnerable or in danger of extinction within the Guarianthe skinneri Soconusco or anywhere else must, therefore, take into that the best strategy is to work directly, intensively, of small amounts of money and materials, but it is to orchidarium at 1200 m for the rescue, conservation, rural communities in Soconusco have been established with a week of introductory training before work in vitro biology, ecology, and refuge sites such as mountain

PAGE 42

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. DAMON 29 and we may advance our understanding further if we et al. noted may include visibility, orientation, height above conditions, or in the case of deceit mechanisms, the et al. the stems and branches of their coffee bushes have resulted in the almost total elimination of the small and this interesting and revealing line of research, which Rhizoctonia et al. recent studies indicate that a dense and continuous (Rivas et al. et al. et al. 2011), which could indicate et al. of carbon and nitrogen (Julou et al. et al. et al et al. in vitro germination of orchid seeds indicate that, although the et al.

PAGE 43

and eventually die (Pereira et al. in situ symbiotic seed germination techniques, study of the ecological of recognition between fungus and orchid, invasion of of the digestion of fungal tissues by the orchid, which been registered within the Soconusco region, which in the initial stages involved collaboration with various but also throughout their distribution, and also where investment and collaboration are needed to enable et al. begin to answer some of the fundamental questions mentioned here, using remaining, common orchid majority of the Orchidaceae and the ecosystems that ACKNOWLEDGMENTS LITERA TURE CITED in in agroecosystems and forest fragments in southeast Cephalanthera damasonium city correlates orchid Ionopsis utricularioides LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.30 LANKESTERIANA

PAGE 44

In vitro symbiotic seed germination of (Orchidaceae) by Rhizoctonia Epidendrum conopseum in Natural History Publications (Borneo), Kota Kinabalu, LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. DAMON 31

PAGE 45

LANKESTERIANA

PAGE 46

LANKESTERIANA.ORCHIDS AND EMONOCOT ASSEMBLING RESEARCH RESOURCES AND FACILITATING COLLABORATIVE TAXONOMY ONLINE LAUREN M. GARDINER, RUTH BONE & NIAMH M. KILGALLEN *Herbarium, Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3AE, United Kingdom ABSTRACT and users of taxonomy, targeted at biodiversity and environmental scientists but also available to other users KEY WORDS colleagues around the world and need to access and share resources such as checklists, original such resources have been held by institutions and working on the taxa only under carefully controlled The distributed resources, online resources, and access for all ecology, and evolution are scattered and often restricted global initiatives have been addressing this issue by collections and making them freely available on the taxonomic resources, such as the International Plant Names Index (IPNI), Index Herbariorum (IH), and the are now available electronically and are continuously that data are increasingly accessible, resources for The eMonocot project In order to facilitate the aggregation of these

PAGE 47

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.34 LANKESTERIANA many of which are commercially and nutritionally grant to the Royal Botanic Gardens, Kew, Oxford rich, interactive tool of discovery, education, and research for a broad audience from the biodiversity accessible free of charge to anyone with access to an existing sources of data, and Scratchpads websites are modular content management systems, are already being created and maintained by a wide while also facilitating international collaboration single site (the Portal) using a range of additional enable monocot taxonomists to collate and share their Orchids and eMonocot terms of ecology and conservation, Orchidaceae is one of the eight families of monocots being targeted with additional content gathered by members of the

PAGE 48

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. GARDINER, BONE & KILGALLEN 35 FIGURE FIGURE

PAGE 49

FIGURE LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA University Press, and the editors of the series, Genera Orchidacearum illustrations, and slides streamed directly from the Developing new orchid Scratchpads is being used to lay a foundation for the taxonomic revision of the genus Eulophia and allied genera How eMonocot can help you and how you can help be part of eMonocot and the needs of the communities involved at the

PAGE 50

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. GARDINER, BONE & KILGALLEN can manage their orchid data and resources, aiding their own research, while contributing data to the ACKNOWLEDGMENTS. We wish to show our sincere gratitude

PAGE 51

LANKESTERIANA

PAGE 52

LANKESTERIANA.LA PESADILLA DE LINDLEY LA BIOLOGA SEXUAL DE CATASETUM Y CYCNOCHES GNTER GERLACH ABSTRACT Catasetum and Cycnoches is now common knowledge to orchid Catasetum Catasetum Cycnoches, C. Heteranthae section and those of C. Cycnoches Catasetum Catasetum Cycnoches Catasetum Catasetum two Cycnoches KEY WORDS Catasetum, CycnochesIntroduccin Catasetum y Cycnoches Heteranthae es marcado y bien En Cycnoches Cycnoches y en Mormodes es Catasetum son muy labelo, de Catasetum

PAGE 53

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.40 LANKESTERIANAPseudocatasetum Catasetum (del Griego kata seta Cycnoches Heteranthae, de la columna (a diferencia de Catasetum Catasetum su status Historia Catasetum macrocarpum, fue Monachanthus y Myanthus, constatando que exactly those of Catasetum Myanthus y Mona-chanthus Catasetum Monachanthus The Various Contrivances by which Orchids are Fertilised by Insects y On the three remarkable sexual forms of Catase-tum que Monachanthus Catasetum Cycnoches C. loddigesii C. cucullata (la cual, en realidad, C. loddigesii). de Surinam, le indujo a concluir que tanto Cycnoches como Catasetum C. cucullata C. loddigesii, Cycnoches en la FIGURA

PAGE 54

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. GERLACH Catasetum y Cycnoches41 George Ure Skinner, establecido en Guatemala la noticia de la existencia de una Cycnoches con C. ventricosum, Cycnoches C. ventricosum C. egertonianum de describir como C. ventricosum Catasetum y Cycnoches Catasetum y Cycnoches Catasetum FIGURA Catasetum schmidtianum

PAGE 55

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.42 LANKESTERIANAventral en forma de hendidura transversal y lleno de casos, tiene forma de casco, su columna es delgada y FIGURA Catasetum fuchsii FIGURA Catasetum juruenense

PAGE 56

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. GERLACH Catasetum y Cycnoches43 Todas l formas hermafroditas no funcionaron ni como machos Cycnoches secciones en Cycnoches que se diferencian s cortas con hasta cual el estigma es ventral en forma de hendidura FIGURA Catasetum barbatum

PAGE 57

rostradas, debajo de Catasetum En Cycnoches Catasetum, LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.44 LANKESTERIANA FIGURA Catasetum tenebrosum FIGURA Catasetum sanguineum FIGURA Cycnoches maculatum

PAGE 58

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. GERLACH Catasetum y Cycnoches45 LMINA Cycnoches maculatum En los dos casos de Catasetum y Cycnoches se Biologa reproductiva Catasetum y Cycnoches de abeja tiene un Catasetum visita una C. subgenus Pseudocatasetum Catasetum se hallan frecuentemente sobre abejas de C. subgenus Pseudocatasetum Catasetum y Cycnoches Catasetum Catasetum ( C. bicolor, C. cernuum, C. fuchsii, C. juruenense, C. pileatum, C. planiceps, C. sanguineum, C. schmidtianum y C. tenebrosum) y dos de Cycnoches ( C. pentadactylon y C. powellii) fueron investigados Coryanthes albertinae, C. albertinae

PAGE 59

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA en concentraciones Catasetum y Cycnoches En Cycnoches AGRADECIMIENTOS Catasetum y Cycnoches LITERA TURA CIT ADA Cycnoches Cycnoches nd Cycnoches and Catasetum Cycnoches Catasetum and Cycnoches and its et Am. Bonpland Catasetum Catasetum Catasetum Catasetum

PAGE 60

LANKESTERIANA.LONG-TERM HURRICANE EFFECTS ON POPULATIONS FROM GUANAHACABIBES PENINSULA, CUBA ERNESTO MJICA 1,4, JOSEP RA VENTS 2 ELAINE GONZLEZ 3 & ANDREU BONET 21 23 4 ABSTRACT Broughtonia cubensis Dendrophylax lindenii B. cubensis ground, in contrast to those of D. lindenii B. cubensis and number of living roots and D. lindenii. B. cubensis recovered, whereas those of D. lindenii did not. D. lindenii B. cubensis D. lindenii KEY WORDS and habitat changes (Kindlman et al. global warming, the frequency and severity of storms et al. cyclonic activity (Walker et al et al. 1999), with over 2000 hurricanes recorded from an environment in which disturbance regimes likely the abundance and distribution of organisms (Waide et al. dynamics (Lugo et al. et al.

PAGE 61

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA Robles et al. et al. et al. successive disturbances on the resilience of biological Our general goal was to determine recovery related to the degree of damage caused by Materials and methods Study area (Herrera et al. The species Broughtonia cubensis is endemic to et al Dendrophylax lindenii D. lindenii inhabits semideciduous forests and elevations et al. Data collection and analysis B. cubensis was Where orchids were most common, we established D. lindenii, we established 1000 m transects in the semideciduous To determine the effect of Hurricane Ivan on orchid Our orchid data included the number of individuals B. cubensis we collected information on number of leaves and leaf area, and for D. lindenii we calculated the number of living roots and mean length Hurricane Ivan, immediately afterwards (2004), and growth rate (RGR) and using transition matrix analyses for D. lindenii B. cubensis analyses are the m

PAGE 62

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. MJICA et al. 49 of leaf area for B. cubensis and mean root length in D. lindenii However, in our study we decided to use leaf area of of B. cubensis measured length and width of leaves of each individual D. lindenii, the only alternative was to calculate the mean Statistics Results Orchids and the phorophyte community 20 B. cubensis trees were Plumeria tuberculata Erythroxylum areolatum In the three 20 20 m D. lindenii Comocladia dentata Maba crasinervis Cedrela odorata Damage caused by Hurricane Ivan: height and DBH of phorophytes The severity of hurricane damage to B. cubensis p n p n D. lindenii was p< n pn Impact of Hurricane Ivan on populations of cubensis and Prior to Hurricane Ivan B. cubensis Plots 2004 2005 2006 2007 2008 2009 2010 2011 2012 1 120 77 88 85 84 81 84 73 66 2 51 36 46 43 41 42 42 45 46 3 72 50 52 55 54 55 45 27 18 4 46 43 52 50 48 50 49 42 41 5 88 77 86 89 93 95 100 137 132 Total 377 283 324 322 320 323 320 324 303 TABLE B. cubensis in 20

PAGE 63

D. lindenii had been much smaller than that of B. cubensis B. cubensis on their above ground and damage to D. lindenii Hurricane impacts on vegetative traits of and in 2004, B. cubensis leaf area did to the extent that in 2012 values exceeded Dendrophylax lindenii showed the same behavior as B. cubensis B. cubensis Hurricane impacts on reproductive effort and success for and B. cubensis Plots 2003 2004 2005 2006 2007 2008 2009 2010 2011 1 63 30 28 27 24 24 22 19 17 2 45 26 23 20 19 17 13 14 14 3 45 8 7 6 5 2 0 0 0 Total 153 64 58 53 48 43 35 33 31 TABLE D. lindenii in 20 FIGURE damage to B. cubensis FIGURE damage to D. lindenii LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.50 LANKESTERIANA Years Number of leaves Leaf area (cm2) n 2004 4.83 + 5.05 (a) 15.41 + 41.28 (ac) 242 2005 2.56 + 3.12 (b) 6.02 + 16.75 (b) 162 2006 3.17 + 3.56 (bc) 7.52 + 22.5 (b) 461 2007 3.38 + 3.98 (c) 9.08 + 31.68 (bc) 463 2008 3.31 + 3.31 (c) 13.02 + 47.6 (ac) 458 2009 3.16 + 4.79 (bc) 14.34 + 55.52 (ac) 461 2010 3.65 + 2.42 (c) 13.36 + 23.62 (ac) 447 2011 3.5 + 2.96 (c) 14.74 + 19.97 (ac) 454 2012 3.5 + 1.48 (c) 16.89 + 16.18 (c) 427 TABLE in B. cubensis. Trait

PAGE 64

Before Hurricane Ivan, nearly a third of adult D. lindenii slow, and the last four census years showed stagnation A y ear after the hurricane there was a slight, B. cubensis hurricane, D. lindenii Unfortunately, this was not sustained, and in all years by B. cubensis was reduced after the hurricane but D. lindenii, although no B. cubensisLANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. MJICA et al. 51 Years Number of living roots Mean length of living roots (cm) n 2003 8.67 + 3.54 (a) 10.19 + 4.88 (a) 153 2004 3.62 + 3.74 (b) 6.74 + 5.05 (b) 64 2005 6.51 + 3.53 (d) 8.67 + 5.22 (ac) 58 2006 6.45 + 3.14 (d) 11.88 + 5.49 (cd) 342 2007 5.74 + 2.63 (cd) 12.29 + 6.55 (cd) 304 2008 6.29 + 2.25 (d) 12.71 + 6.63 (d) 274 2009 5.87 + 3.79 (cd) 12.19 + 8.16 (cd) 301 2010 5.05 + 2.46 (c) 13.66 + 8.76 (de) 248 2011 6.21 + 2.95 (d) 14.83 + 8.98 (e) 243 TABLE D. lindenii based on root FIGURE B. cubensis annually FIGURE D. lindenii annually FIGURE B. cubensis. FIGURE D. lindenii.

PAGE 65

of D. lindenii Pollinator service for D. lindenii in the semideciduous Hurricane Ivan on demography of and B. cubensis but recovered a year later and was relatively stable even Dendrophylax lindenii in recent years the number of individuals has declined Broughtonia cubensis was dynamic with four of six for B. cubensis censuses for D. lindenii Broughtonia cubensis had a LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.52 LANKESTERIANA FIGURE B. cubensis. The 2003 data were FIGURE in D. lindenii. Years Flowers Fruits % 2004 768 163 21.2 2005 205 14 6.9 2006 639 6 0.9 2007 1019 10 0.9 2008 846 11 1.3 2009 1164 45 3.8 2010 1667 60 3.6 2011 1010 14 1.4 2012 1687 52 3 TABLE B. cubensis. Years Flowers Fruits % 2003 43 0 0 2004 0 0 0 2005 4 1 25 2006 18 5 28 2007 23 0 0 2008 46 6 13 2009 59 3 5 2010 60 3 5 2011 43 3 7 TABLE D. lindenii. Pairs of years Lambda () 2006-2007 1.0529 2007-2008 1.0364 2008-2009 0.9673 2009-2010 1.0011 2010-2011 1.0218 2011-2012 0.8953 2006-2012 0.9989 TABLE ) of B. cubensis

PAGE 66

FIGURE B. cubensis. in Biotropica FIGURE D. lindenii BiotropicaLANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. MJICA et al. 53 D. lindenii found within 90 cm2 Discussion Bayman et al

PAGE 67

of Tanner et al. (1991), the range of damage of a hurricane on a forest varies considerably from country Generally the studies carried out in the areas Gresham et al The height of B. cubensis associated with severity of hurricane damage to those D. lindenii Walker et al The height to which individual orchids are on the B. cubensis and the number of live roots of D. lindenii B. cubensis and average length of live roots of D. lindenii B. cubensis) and root (D. lindenii increase of leaf area in B. cubensis The growth rate of D. lindenii since Hurricane Ivan has been continuously decreasing, whereas the gradual recovery of B. cubensis has been affected by B. cubensis growth trend of D. lindenii LITERA TURE CITED growth and survival of the orchid Lepanthes rupestris TABLE D. lindenii based on matrix analyses Pairs of years Lambda () 2006-2007 0.9977 2007-2008 0.9171 2008-2009 1.4173 2009-2010 0.8966 2010-2011 0.9624 2006-2011 1.0541 LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.54 LANKESTERIANA

PAGE 68

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. MJICA et al. 55 Broughtonia cubensis Dendrophylax lindenii (Lindley) Bentham et Rolfe y Encyclia bocourtii in: Hurricane effects on soil organic matter dynamics and in: Manilkara bidentata Aspasia principissa

PAGE 69

LANKESTERIANA

PAGE 70

LANKESTERIANA.TROPICAL ORCHID MYCORRHIZAE: POTENTIAL APPLICATIONS IN ORCHID CONSERVATION, COMMERCIALIZATION, AND BEYOND JOEL TUPAC OTERO 1, 2* ANA TERESA MOSQUERA 3 & NICOLA S. FLANAGAN 31 23 ABSTRACT variety of fungi including Rhizoctonia Vanilla source resistance to Rhizoctonia KEY WORDS Rhizoctonia biological control Orchidaceae contains an estimated 25,000 different et al. decades to serious threats to the survival of many in orchids has been estimated at US $2 billion annually (Harron et al. is largely based on Phalaenopsis situ without reason that the whole of Orchidaceae with the genera Cymbidium, Dendrobium, Phalaenopsis, and Vanda extinction but that may become so unless trade is

PAGE 71

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA their survival from habitat destruction and ecosystem degradation, effects that are likely to be exacerbated may be limiting orchid distribution and abundances et al. still have to learn regarding orchid biology in natural also identify factors that determine distributions and are the maintenance of the levels of recruitment of et al. et al. et al. Orchidaceae (Kottke et al. et al. Valadares et al. Oncidiinae have also revealed moderate to high levels Ceratobasidium et al. et al. et al. (2012) showed a Although historically the greater focus has been that seedling establishment, rather than seed set, is and seedling establishment, in contrast, may be (Bidartondo et al. is crucial to orchid establishment in the wild, and et al. et al. et al. fungi involved in seed germination are not the same as et al. to the Rhizoctonia

PAGE 72

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. OTERO et al. 59 lineage (Atractiellomycetes, Pucciniomycotina) are mycobionts of orchids (Kottke et al. Epipactis microphylla (Selosse et al. Rhizoctonia Rhizoctonia can be Ceratobasidium, Thanatephorus (multinucleate), Tulasnella or Sebacina Rhizoctonia Rhizoctonia (Thanatephorus AG13), and binucleate Rhizoctonia (Ceratobasidium, Tulasnella, and Sebacina) have been divided in 15 et al. et al et al. et al. et al. gene region sequenced for the Rhizoctonia Ceratobasidium et al. et al. Coppensia doniana (Bateman correctly known as Gomesa doniana et al Notylia (Oncidiinae), Habenaria (Orchidinae), Cranichis Vanilla (Vanillinae), Epidendrum xanthinum (Laeliinae), Trizeuxis falcata Maxillaria Dichaea et al. Ceratobasidium clades distantly related to the fungi that are associated with Pterostylis Australia (Otero et al. Tulasnella have also been isolated from et al Laeliinae (Pereira et al. et al. Vanilla in Puerto Rico et al., for our understanding of the ecological interactions fungi at both the seed germination stage and in the large number of orchids native to northwestern facing the greatest conservation threats, either from Vanilla

PAGE 73

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA in vitro a large advantage to seedling growth over asymbiotic In Puerto Rico, seeds of both Tolumnia variegata Ionopsis utriculariodes were symbiotically germinated using fungi isolated et al Pterostylis et al Ceratorhiza and uninucleate Rhizoctonia isolated from Coppensia doniana Bateman ex Gomesa doniana (Bateman were also used successfully in the in vitro symbiotic et al that seeds of Vanilla a Ceratobasidium fungus isolated from Ionopsis utricularioides than from Tulasnella isolated from adult Vanilla considerable study may be needed in order to identify Additionally, biotechnological techniques need a formula for in-situ calcium alginate and combining orchid seeds and Epidendrum ibaguense Kunth to in Vanilla Vanilla serious threats from low genetic diversity, leading to germination of Vanilla calyculata Rhizoctoniaet al In addition to their functional role as orchid Rhizoctonia et al. Rhizoctonia solani Thanatephorus cucumeris cereals including rice and corn (Sneh et al. 1991) Rhizoctonia generally involves chemical and biological control as Rhizoctonia fungi of a means of limiting the use of synthetic agrochemicals that may be detrimental to both consumers and the Rhizoctonia using Trichoderma Chaetomium et al. Rhizoctonia Rhizoctonia Rhizoctonia fungi were isolated from a number of different orchid Rhizoctonia solani et al. RhizoctoniaThanatephorus .) used as a Vanilla et al. in controlled glasshouse conditions designed to Rhizoctonia solani in rice

PAGE 74

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. OTERO et al. Rhizoctonia solani control isolated et al. However, when the effect on inducing resistance Rhizoctonia solani et al. Rhizoctonia mechanism through which this effect is mediated and Conclusions a considerable amount of a priori study in order to ACKNOWLEDGMENTS LITERA TURE CITED Tulasnella (Homobasidiomycetes) associated in and the distribution of Lepanthes from the Rps1-klocus encode Phytophthora resistance rain forest by investigation of their host and fungal

PAGE 75

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA in architecture and evolutionary constraint within Vanilla Ceratobasidium Ceratobasidium and biocontrol of Rhizoctonia solani Ionopsis utricularioides Epidendrum secundum in vitro da germinacao de sementes de Coppensia doniana Epulorhiza Epidendrum secundum Epulorhiza epiphytica Rhizoctonia in situ of Epipactis microphylla (Neottieae, Orchidaceae)

PAGE 76

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. OTERO et al. Rhizoctonia in in Coppensia doniana

PAGE 77

LANKESTERIANA

PAGE 78

LANKESTERIANA. ROBERT W. PEMBERTON ABSTRACT Cypripedium Cypripedium Paphiopedilum Phragmipedium Paphiopedilum micranthum and Phragmipedium besseae frequently in Phragmipedium KEY WORDS Cypripedium, Mexipedium Phragmipedium, Paphiopedilum SelenipediumIntroduction Cypripedium Paphiopedilum Phragmipedium America (Pridgeon et al Selenipedium America (Pridgeon et al Mexipedium xerophyticum et al Cypripedium in Phragmipedium in the Andes), Cypripedium in North America, forests (Paphiopedilum in Southeast Asia), bogs (C. reginae in North America), and even tundra (C. passerinum C. bardolphianum with Phragmipedium kovachii et al Cypripedium, 12 from Paphiopedilum, and six from Phragmipedium. Selenipedium and Mexipedium the subarctic C. passerinum three from Phragmipedium P. reticulatum, P.

PAGE 79

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANAlindenii P. boisserianum (Pridgeon et al Pollination mechanism et al et al et al a distinctive feature that is readily the stigma, the insect reaches one of the anthers at a beneath the anther and out of through a lateral et al but some bumblebees (Bombus insect is too small, it and an anther without contacting either, neither of the stigma and anthers and the unidirectional Lasioglossum bees have of C. henryiet al Cypripedium pollination Cypripediumecies diverged earlier than the other genera (Guo et al Pollination by large bees, all Bombus Cypripedium Cypripedium Bombus C. tibeticum emerge from winter hibernation and search for nest which means that it has not yet established a nest and so is still searching for a suitable nest site (Li et al Cypripedium by bees belong to section Cypripedium are colorful and often have fragrance (Barkman et al

PAGE 80

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. PEMBERTON et al Cypripedium American C. reginae some Cypripedium belong to four genera with Lasioglossum Lasioglossum bees are the sole Cypripedium four Cypripedium Lasioglossum is Cypripedium in Asia, North America, Andrena Cypripedium in Asia, North America, Cypripedium C. reginae (North America), both in section Cypripedium Cypripedium plectrochilum C. arietinum (North America), both in section Arietinum Lasioglossum C. fasciculatum Emantiopetalum Cinetus Cypripedium is unique in being Andrena et al et al Cypripedium in different sections of the genus (Li et al Cypripedium bardolphianum and C. micranthum (section Sinopedilum Drosophila (Zheng et al C. bardolphianum and C. micranthum et al FIGURE Cypripedium tibeticum bumblebees searching for nest sites (Li et al. near the ground are thought to mimic a mouse hole, a Cypripedium

PAGE 81

Cypripedium sichuanense (section Trigonopedia) is et al Cypripedium fargesii (section Trigonopedia Cheilosia that eats et al Cladosporium fungal cultures have been isolated from Cypripedium has been studied only recently, and such research has Paphiopedilum pollination Paphiopedilum shades of green, brown, and maroon and are marked are often large and yellow, a color that contrasts to the the staminodes usually have distinctive markings P. dianthum P villosum from eggs have been found on and in the labellum, as seen in P. rothschildianum P bellatulatum (section Brachypetalum) is different Paphiopedilum Paphiopedilum P. dianthum Episyrphus et al P. hirsutissimum are et al belong to four subgenera (Brachypetalum, Polyantha, Paphiopedilum, Sigmatopetalum Paphiopedilum P. micranthum et al P. armeniacum et al Parvisepalum are brighter Paphiopedilum Paphiopedilum armeniacum is bright yellow, whereas P. micranthum and a yellow staminode that contrasts with the colors Paphiopedilum armeniacum is the LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA FIGURE Paphiopedilum dianthum Episyrphus et al. Paphiopedilum

PAGE 82

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. PEMBERTON only studied Paphiopedilum Paphiopedilum Phragmipedium pollination Phragmipedium et al Phragmipedium lindenii The stigma of P reticulatum Phragmipedium lindenii and P. reticulatum Phragmipedium boisserianum is also been observed in P schlimii Rolfe (Pridgeon et al P. longifolium Phragmipedium Phragmipedium pearcei and P. caudatum Phragmipedium longifolium Himantopetalum, Lorifolia, and Phragmipedium observed Ocyptamus antiphales (Walker), the female P. pearcei Phragmipedium is remarkably similar to Paphiopedilum Phragmipedium besseae are bright Ever since the sensational discovery of P. besseae in et al P. besseae P. besseae Phragmipedium besseae FIGURE Phragmipedium pearcei Ocyptanthes antiphales in Phragmipedium Phragmipedium and Paphiopedilum

PAGE 83

is some yellow coloration on the rim of the dorsal Phragmipedium besseae belongs to section Micropetalum Phragmipedium P besseae, are of the recently discovered P. kovachii Phragmipedium and Paphiopedilum staminode in Paphiopedilum Phragmipedium Phragmipedium and Paphiopedilum have been Selenipedium and Mexipedium Pollination of Selenipedium of Garay in Ecuador for three days Anthophora et al of Mexipedium (Soto et al and velvety, as in those of section Micropetalum of Phragmipedium Conclusions to the same taxonomic section usually have the same Cypripedium Paphiopedilum Phragmipedium Cypripedium C montanum, C reginae, Paphiopedilum armeniacum, and Phragmipedium longifolium C fasciculatum and Phragmipedium besseae, Cypripedium orchids in Quebec, LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA

PAGE 84

Species Pollinator types and species References Cypripedium acaule Aiton Bumblebees: Bombus spp. (queens) Stoutamire 1967; Primack & Stacy 1998; Davis 1986 C. arietinum R.Br. Bee: Lasioglossum sp. Stoutamire 1967 C. bardolphianum Drosophila spp. Zheng et al. 2010 C. calceolus L. Bees: Andrena spp.; Lasioglossum spp.; Nomada sp.; Colletes sp. Nilsson 1979; Kull 2008; Antonelli et al. 2009 C. candidum Muhl. ex Willd. Bees: Andrena sp.; Halictus spp.; Lasioglossum spp.; Augochlorella sp. Catling & Knerer 1980 C. fargesii Cheilosia sp. Ren et al. 2011; Ren et al. 2012 C. fasciculatum Kellogg Wasp parasitoids: Cinetus spp. (females) Ferguson & Donham 1999 P.F.Hunt & Summerh. Bees: Andrena spp. Bnziger et al. 2008; Bumblebees: Bombus spp. (workers); Zheng et al. 2011 Calliphora sp. C. guttatum Sw. Bees: Lasioglossum spp. Bnziger et al. 2005 C. henryi Rolfe Bees: Lasioglossum spp. Li et al. 2008b C. japonicum Thunb. Bumblebees: Bombus spp. (queens) Sun et al. 2009 C. macranthos Sw. Bumblebees: Bombus spp. (queens) Sugiura et al. 2002 C. micranthum Drosophila spp. (1?) Li et al. 2012 C. montanum Thunb. Bees: Andrena spp.; Ceratina sp.; Halictus sp.; Lasioglossum spp. Vance, unpubl. Salisb. Bees: miscellaneous, small; Osmia, Andrena Curtis 1954; Light & MacConaill 2006 C. passerinum Richardson Autogamous Catling 1990 C. plectrochilum Franch. Bees: Lasioglossum spp.; Ceratina sp. Li et al. 2008a C. reginae Walter Bees: Apis sp.; Hoplitis sp.; Megachile sp.; AnthophoraSyrphus spp.?; scarab beetle: Trichiotinus spp.? Edens-Meier et al. 2011; Vogt 1990 C. sichuanense : Scathophaga spp. Li et al. 2012 C. smithii Schltr. (=C. calicicola Schltr.) Bumblebees: Bombus spp. Li & Luo 2009 C. tibeticum King ex Rolfe Bumblebees: Bombus spp. (queens) Li et al. 2006 C. yunnanense Franch. Bee: Lasioglossum sp. Bnziger et al. 2008 Paphiopedilum armenicacum S.C.Chen Bees: Lasioglossum sp.; Ceratina sp.; Eristalis sp. Liu et al. 2005 P. barbigerum Allograpta sp.; Erisyrphus sp. Shi et al. 2008 P. bellatulum P. callosum P. charlesworthii P. dianthum Episyrphus sp. Shi et al. 2007 P. hirsutissimum Allobaccha sp.; Episyrphus sp. Shi et al. 2009 P. parishii Allographa sp. Bnziger 2002 P. micranthum Tang & F.T.Wang Bumblebees Edens-Meier et al. (in press) P. purpuratum Ischiodon sp. Liu et al. 2004 P. rothschildianum Dideopsis sp. Atwood 1994 P. villosum Betasyrphus sp.; Episyrphus sp.; Syrphus sp. Bnziger 1996 Phragmipedium besseae Dodson Wasp parasitoid: Tiphiidae sp. Pemberton, unpubl. & J.Kuhn P. boisserianum (Rchb.f. & Warsz.) Rolfe Autogamous Pridgeon et al. 1999 P. caudatum Syrphus sp. McCook 1989; Pemberton 2011 P. lindenii (Lindl.) Dressler & N.H.Williams Autogamous Pemberton 2011 P. longifolium (Warsz. & Rchb.f.) Rolfe Bee: Chlerogella sp.; Dodson 1966 Syrphus sp. Pemberton 2011 P. pearcei Ocyptamus sp. Pemberton 2011 & Senghas P. reticulatum (Rchb.f.) Schltr. Autogamous Pemberton 2011 TABLE et al. LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. PEMBERTON

PAGE 85

orchids usually have lower levels of fruit set than do orchids with rewards (Tremblay et al Cypripedium Ecuadorian Phragmipedium ACKNOWLEDGMENTS Phragmipedium Selenipedium on Cypripedium et al LITERA TURE CITED Mexipedium (Cypripedium calceolus Paphiopedilum rothschildianum Phragmipedium kovachii Paphiopedilum ) in Proceedings of the 14th Paphiopedilum villosum (Paphiopedilum in Cypripedium guttatum Cypripedium yunnanense and Cypripedium fragrance variation in Cypripedium Cypripedium Cypripedium candidum) in in nd Phragmipedium Trigonopedia and Sinopedilum LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA

PAGE 86

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. PEMBERTON Cypripedium acaule Cypripedium fargesii for Ren et al Cypripedium fargesii Paphiopedilum dianthum Paphiopedilum barbigerum Paphiopedilum hirsutissimum Phragmipedium xerophyticum Cypripedium Cypripedium macranthos rebunese Cypripedium japonicum Cypripedium reginae Cypripedium

PAGE 87

LANKESTERIANA

PAGE 88

LANKESTERIANA. FRANCO PUPULIN ABSTRACT The genesis and early establishment of the EPIDENDRA RESUMEN EPIDENDRA KEY WORDS databases, Orchidaceae, botanical nomenclature, EPIDENDRA history of science Sil publie lui-mme ses Orchides, la moiti sera dj connue set totalement impossible de produire hors de lEurope un travail parfait Veuillez exposer ces considrations votre ami et lui sous notre mutuelle autorit himself, half of them would be already known Apologia pro opere meo design of EPIDENDRA the global taxonomic network created and maintained by the Lankester Botanical it is hard to believe that more then ten years have researchers working at LBG as a sort of digital surrogate of a documentary archive, EP IDENDR A reasons that were not EP IDENDR A a posteriori of EP IDENDR A the databases are mostly accessed by students working worker of EP IDENDR A the magnitude of the results, but I can at least relate

PAGE 89

An exemplary story began editing Flora Brasiliensis, a monumental work for which he sought the assistance of the most distinguished botanists of the time to write the work was eventually concluded by Ignacio Urban Flora 1 A successor as the main editor of the Flora Brasiliensis B ), the botanist in Genera et species orchidearum novarum situation common during the nineteenth century LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA FIGURE

PAGE 90

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. PUPULIN It is a fact that the essential information on the identity of the organisms native to the biologically vaster documentation of biological variation, which is required for a full understanding of living diversity, If one looks at the botanical institutions that easy to see that they were almost exclusively located A across the Atlantic to include several distinguished institutions in North America and a few other research centers across the world, mostly in the cultural areas B) clearly reveals that decades of the second millennium, botany in general, organisms and the inventory of orchid diversity is FIGURE 2

PAGE 91

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA FIGURE in modern history, most of the essential documents and Naturalists and botanists A), and the B

PAGE 92

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. PUPULIN they formed a herbarium that, at the beginning of the twentieth century, was unequalled below the C D), who eventually became one of cited by Schlechter (1923) in his work on the orchid botanical research naming and describing their orchid A), Robert Allen Rolfe BC), Oakes Ames D that, within the framework of these societies, the role of I begin to consider these cabinet-celebrities as vampires nourishing their fools they condescendingly call collectors Rica (Ossenbach et al orchidologist and director of LBG for over 25 years, Selby Botanical Gardens had access to modern herbaria treatments for the Flora Costaricensis (Atwood & FIGURE

PAGE 93

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA FIGURE

PAGE 94

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. PUPULIN FIGURE

PAGE 95

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA relied on the scrutiny of materials and information not When, in 2001, I was hired to work as an orchid researcher at LBG, the taxonomic archives of the center factor limiting the growth of the biological sciences major limiting factor was the scarcity of information The advent of the Internet CROTY P ES a joint effort by the LBG and the Oakes Ames Orchid Gardens, the Royal Botanic Gardens, Kew, the Real It was a fortunate circumstance that, when the structure of EPIDENDRA was originally discussed, the use of the Internet was already established as the main electronic version of Index Kewensis gave rise to the International Plant Names Index (IPNI), a database of effort among the Royal Botanic Gardens, Kew, Harvard University Herbaria and the Australian BIBLIORCHIDEA which contains most of the existing With its 150,000 entries, it is maintained today by the electronic database consolidating over 200,000 other databases arose in the last decade, some of created by the London Orchid Society (Ontario, Sobralia Pages and The Stanhopea Pages, with images, and Until recent years, one common characteristic of nomenclatural databases was that they were mainly exsiccata for selected regions, allowing botanists to gain ready access

PAGE 96

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. PUPULIN tools for the retrieval of botanical information and the relatively modernity of the existing herbaria concerned with the retrieval of historical information characteristic of JBL databases was substantially concluded, and the intranet version of EPIDENDRA of Epidendrum, was an allusion to the old name tool, EPIDENDRA was designed to gather and make electronically available all the materials from the EPIDENDRA of EPIDENDRA has remained almost unchanged until EPIDENDRA s taxonomy mainly focused on the best model to be used in the elasticity of taxonomy as well as alternative FIGURE EPIDENDRA

PAGE 97

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA a system designed to reduce taxonomic decisions in the database to a minimum as an alternative to the necessity treated as equivalent doors to gain access to relevant seemed to be the best way to guarantee the easiest access that the taxonomic work and therefore the need of taxonomic literature through a careful study of original A of our system, which should have allowed a sort of before such botanical illustrations and drawings, P DF of EP IDENDR A materials) or a synonym, which is just a nomenclatural It is now quite clear for us that, to maintain an alternative taxonomies cannot be avoided, even when B The systematic framework Again, EP IDENDR A was fortunate in coinciding Genera Orchidacearum, the FIGURE EPIDENDRA

PAGE 98

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. PUPULIN scientists for years (Pridgeon et al. 1999, 2001, 2003, distribution, and summaries of our biological, ecologic, saw the light in 1999, the second in 2001, and the third Genera Orchidacearum the treatment of the largest subfamily of Orchidaceae, included an addendum with relevant nomenclatural Genera Orchidacearum reducing the effort by the staff working at EP IDENDR A to Natural variation EP IDENDR A individual characteristics and a tool to understand FIGURE Genera Orchidacearum constitute the systematic framework of EPIDENDRA

PAGE 99

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA FIGURE EPIDENDRA

PAGE 100

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. PUPULIN EP IDENDR A such as those of Guarianthe skinneri Kefersteinia parvilabris A daunting task kingdom suggest a grand total of 1,250,000 names, these, however, almost half are synonyms, and more A An estimation of the orchid names to be included in EP IDENDR A 55,000 are synonyms, and some 15,000 require further B EP IDENDR A concentrates mostly binomials actually included, EP IDENDR A only covers A EP IDENDR A every year, That EP IDENDR A could continue offering to the achieved by focusing the effort of data taxonomic FIGURE

PAGE 101

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA illustrations) for those taxa that can be more easily conserved vouchers, and on which the taxonomists EP IDENDR A has been instrumental in the creation historically relevant materials and literature, as well as research centers and students that contribute their Bulbophyllum Thouars or Dendrobium Ophrys Dactylorhiza EP IDENDR A to the taxonomy of the involved taxa but would require other skills to nourish the network with a rich and Given its actual coverage and the needs of local EP IDENDR A B likely that local botanists and naturalists will need C the global taxonomic orchid network, as scientists who deal with them also usually have unrestricted access to FIGURE EPIDENDRA FIGURE EPIDENDRA

PAGE 102

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. PUPULIN

PAGE 103

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.90 LANKESTERIANA Progressive access to essential documents related EP IDENDR A by a growing number of orchid researchers in the Latin AC K NO W LEDG M ENTS EP IDENDR A to the curators and staff of the herbaria and libraries that took EP IDENDR A LITERA TURE CITED In Flora costaricensis Genera et species orchidearum novarum A biologia no Brasil. Esboo histrico sobre a botnica e zoologia no Brasil FIGURE EPIDENDRA

PAGE 104

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. PUPULIN 91 Orchids in the life and work of Auguste R. Endrs Genera orchidacearum. Volume 1. General introduction, Apostasioideae, Cypripedioideae Genera orchidacearum. Volume 2. Orchidoideae (Part 1). Genera orchidacearum. Volume 3. Orchidoideae (Part 2), Vanilloideae. Oxford, Oxford Genera orchidacearum. Volume 4. Epidendroideae (Part 1). Oxford, Oxford University Genera orchidacearum. Volume 5. Epidendroideae (Part 2). Oxford, Oxford University Genera Orchidacearum. Volume 6. Epidendroideae (Part 3). Oxford, Oxford University EP IDENDR A inrd EPIDENDRA CROTYPES ) digital imaging documentation at in st botanical garden rich in information serving a country Rodrigues e a cincia no Brasil na segunda metade do Additamenta ad Orchideologiam Costaricensem in Proceedings of the 1st

PAGE 105

LANKESTERIANA

PAGE 106

LANKESTERIANA.ORCHID CONSERVATION: THE NEXT TEN YEARS PHILIP SEA TON 1 JONA THAN P. KENDON 2 HUGH W. PRITCHARD 1, DWI MURTI PUSPIT ANINGTY AS 3 & TIM R. MARKS 11 23 ABSTRACT KEY WORDS seed storage, habitat, reintroduction, germination, collection Environmental degradation attributable to human wonders of its marine life, can have little idea of the was clothed in dense forest of ebony and bamboo gradually accelerated and an environmental richness an impoverished life of the senses (our Although today we tend to associate deforestation landed in North America they found a hideous and Accounts of the enormous collections and

PAGE 107

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.94 LANKESTERIANAfrom the early days of the Orchid Review any, of the admirers of Orchids, who sit at home at the highest branches of some of these, is the home Cattleya varying forms of Cattleya gaskelliana are taken, the smaller ones and seedlings being left Cattleya labiata rich meadows and grasslands in the last 50 years (Walker et al miles (44 kilometers) south of Puerto Vallarta, tells of the time, scarcely 22 years ago, when Highway 200 Schomburgkia galeottiana Paphiopedilum fairrieanum Paphiopedilum vietnamense The fate of orchids this continuing loss of biodiversity in general, and of answer may lie in what has been called the Shifting the norm and uses that baseline to evaluate changes in One can only wonder if this is going to be the fate of many orchids are fated to be remembered only as dried ( Cyanopsitta spixii (Wagler)), which is now found only Environmentalists around the globe were delighted when Barack Obama vowed in his inaugural address to the failure to do so would betray our children and future that we are extremely unlikely to meet the target of Arctic ice shrank to its lowest seasonal minimum since et al. Ophrys sphegodes O. sphegodes and, although O. sphegodes is facultatively autogamous,

PAGE 108

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. SEA TON et al.95 O. sphegodes similarly to climate change, there is a risk that rates of Habitat conservation Ecuador (Seaton 2005) and La Planada Nature Reserve that habitats themselves may be subject to future et al their natural environment, seeds need to encounter a indicate that loss of such trees could have a disastrous Reintroductions for Cyrtopodium punctatum Cymbidium and Grammatophyllum speciosum et al Cypripedium macranthos endemics Epidendrum montserratense Nir in Angraecum longicalcar (Bosser) Senghas E. montserratense is commonly found still suffers from does the hot ash damage the host trees, but it also collections of seeds from E. montserratense are now Mangifera indica A. longicalcar in its natural habitat found that just nine large shoots had been cut off the rocks, leaving three

PAGE 109

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANAof fa and transferred to a shade house in the village were on methods for collecting highly germinable immature Seed baits and the collection of mature roots are being college Orchid Seed Stores for Sustainable Use (OSSSU) OSSSU, with its goal of st to create a global network of orchid seed banks, countries was held maintaining such a broadly based coalition, and gardens, research institutes, and universities from th countries have the resources to collect material from role in ex situ that seed is collected from as broad a genetic base as succeed in our mission to save orchids for future in conservation through To this end OSSSU has obtained funding to host two Maxillaria

PAGE 110

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. SEA TON et al. increasing awareness of the enormous diversity of the orchid family among orchid growers and the general behaviour and extended longevity when subjected same conditions to dry, store, and germinate seeds, showed that maintaining a high level of viability could range of Coelogyne Dendrobium of Vandopsis, Phalaenopsis, Cymbidium, and Arundina Gavilea littoralis Guarianthe aurantiaca (Seaton (Hay et al. that will increase our understanding of the basis of in vitro conditions for the successful asymbiotic However, the technique can yield variable results Seed storage temperature (C) -196 -70 -20 5 20 Tetrazolium viability (%) 68.3.6 Pre-storage germination 41.1.5 Germination on B5 and activated charcoal 46.9.1 35.4.3 35.2.8 29.5.6 14.9.4 TABLE Gavilea littoralis

PAGE 111

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA Storage duration (months) Initial 9 12 Species Coelogyne asperata Lindl. 35.4.7 1.9.5 Coelogyne foerstermannii Rchb.f. 81.5.4 5.4.4 Coelogyne pandurata Lindl. 99.5.3 6.8.0 Coelogyne rumphii Lindl. 64.7.6 1.1.5 Dendrobium macrophyllum A.Rich. 69.6.7 52.8.6 Dendrobium mirbelianum Gaudich. 94.5.3a0 Dendrobium stratiotes Rchb.f. 95.6.6 0.6.3 Xylobium undulatum (Ruiz & Pav.) Rolfe 94.0.9 81.3.7 a TABLE Coelogyne, Dendrobium, and Xylobium initially with Cattleya et al. The effect of storage on seed vitality can also be seen both lowered and increased across a range of Cattleya (Hosomi et al. G. speciosum can contain as many as two million seeds, but even Aerides odorata Ponerorchis graminifolia 2000), this may indicate that seed yields are equally moisture content, which has been shown to be critical to successful storage in Phalaenopsis amabilis hybrids (Schwallier et al times have varied from >50 to >500 days and could The next ten years oblems faced by the natural world remain as serious as ever, we believe that it is a mistake Capsule DWT (mg) Total seeds DWT (mg) Mean seed DWT (g) Total seeds/capsule Lindl. 4.8.4 1.9.2 0.7.1 2721 Ponerorchis graminifolia Rchb.f. 5.3.9 2.2.6 1.2.4 1722 TABLE

PAGE 112

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. SEA TON et al.99as resolution that during the last 100 years Cattleya trianae A. longicalcar, C. trianae is still cultivated by the local a number of recommendations designed to address the ) itself continues to hold meetings in association with conferences at which members are ad hoc to live for decades if not more than a century, some in vitro techniques with material conserved in a network Cypripedium and Paphiopedilum (horticultural value) and Dendrobium and Cymbidium (horticultural and medicinal value) are under threat from traditional medicine (Seaton et al There is no doubt that OSSSU has enabled more students to become engaged in orchid research activities, and it is no exaggeration to say that such a much wider audience outside the orchid community, & Butcher 2012) named the orchids Dendrophylax fawcettii Rolfe and Rhizanthella gardneri to raise funds to buy land for conservation in South Coryanthes kaiseriana Paphiopedilum rothschildianum et al. 2003) that teach schoolchildren about the wonders of the natural world based in a laboratory environment or studying orchids

PAGE 113

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.100 LANKESTERIANA context, the survival of reintroduced terrestrial orchids may be more successful if symbiotically raised material of dissemination of information about who is doing LITERA TURE CITED Scientist in: Cattleya viability and germination of Cattleya (Orchidaceae) Ophrys sphegodes Oryx in: Orchid conservation Paphiopedilum Parvisepalum, section Parvisepalum in Orchid conservation Phalaenopsis amabilis

PAGE 114

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. SEA TON et al.101 Cypripedium macranthos. Maxillaria Plant Heritage NCH News and moisture content on the viability of Cattleya aurantiaca in: Ex situ Cattleya land formerly managed for intensive agriculture in the of native orchids through seedling culture and

PAGE 115

LANKESTERIANA

PAGE 116

LANKESTERIANA.DIVERSIDAD DE ORQUDEAS DE LAS DIFERENTES FORMACIONES VEGETALES DE LOS ANDES PERUANOS DELSY TRUJILLO RESUMEN Eucalyptus globulus ABSTRACT Eucalyptus globulus forest have been PALABRAS CLA VE et al.

PAGE 117

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.104 LANKESTERIANA Vegetacin de la costa et al. muy abundantes durante la ocurrencia de los eventos literatura y material de herbario que se ha revisado, en debe a que las investigaciones en estas formaciones et al. Formaciones de Lomas et al. Chloraea pavonii era frecuente en las lomas cercanas a la ciudad

PAGE 118

TRUJILLO LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.105 Localidad Especies Voucher / Referencia Departamento de Lambayeque Cerro Reque Pterichis sp. Laos 2051 (USM) Laos 4574 (PRG) Laos 4603 (PRG) Llatas 342 (MO) Departamento de La Libertad Cerro Campana Pelexia matucanensis (Kraenzl.) Schltr. Angulo 765 (HUT) Lpez 710 (HUT, F) Cerro Cabras Malaxis andicola (Ridl.) Kuntze Angulo s.n. (HUT) Pelexia matucanensis (Kraenzl.) Schltr. Angulo 1309 (HUT) Departamento de Ancash Lomas de Casma Pelexia matucanensis (Kraenzl.) Schltr. Ferreyra 8049 (USM, MOL, F) Lomas de Mongon Pelexia matucanensis (Kraenzl.) Schltr. Leiva et al. 2008 Departamento de Lima Lomas de Lachay Aa weddelliana (Rchb.f.) Schltr. Cano 7101 (USM) WENT s.n. (MO) Lomas de Iguanil (Chancay) Chloraea pavonii Lindl. Ferreyra 8748 (USM, F) LimaaChloraea pavonii Lindl. Raimondi 471 (W) Ruiz s.n. (G) Amancaes Pelexia matucanensis (Kraenzl.) Schltr. Esposto s.n. (MOL) Chloraea pavonii Lindl. Esposto s.n. (MOL) Weberbauer 746 (F foto) San Jeronimo Chloraea pavonii Lindl. Maisch s.n. (USM) Cerro Agustino Pelexia matucanensis (Kraenzl.) Schltr. Soukup 2045 (USM, F) Weberbauer 5696 (F) Lomas de Atocongo Pelexia matucanensis (Kraenzl.) Schltr. Ferreyra 9514 (USM, F) Departamento de Ica Lomas de Amara Aa weddelliana (Rchb.f.) Schltr. Orellana 353 (MOL) Al sur de NascaaAa weddelliana (Rchb.f.) Schltr. Rahn 198 (USM) Departamento de Arequipa Lomas de Los Cerrillos Aa weddelliana (Rchb.f.) Schltr. Ferreyra 13455 (USM) Atiquipa Aa weddelliana (Rchb.f.) Schltr. Delgado 4021 Ferreyra 14034 (USM) TABLA Aa weddelliana Malaxis andicola y Pelexia matucanensis Leiva et al. de Pterichis entre Tillandsia

PAGE 119

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA FIGURA Aa weddelliana Stelis Chloraea septentrionalis Porphyrostachys pilfera Malaxis andicola Eucalyptus globulus

PAGE 120

TRUJILLO LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. Pterichis Tillandsiales Son comunidades vegetales muy Tillandsia (Bromeliaceae) que habitan sobre las lomas costeras a manera de una angosta faja gris ha registrado es una Aa A weddelliana que se ha registrado en las formaciones de lomas del Vegetacin del territorio andino El territorio andino o sierra se extiende desde los Formaciones vegetales de la zona altoandina de determinadas forma de vida y de crecimiento y a los Pajonal Festuca, Stipa, Calamagrostis y Poa : Aa aurantiaca, Aa erosa, Aa Myrosmodes nubigenum, Myrosmodes paludosa, Myrosmodes Pterichis triloba, y Pterichis Bofedal Distichia muscoides Nees y (Juncaceae), que crece a Distichia Myrosmodes Myrosmodes nubigenum, M. paludosa y M. pumilio Matorral Son formaciones abiertas de arbustos con Aa Altensteinia Chloraea septentrionalis, Cranichis Cyclopogon elatus, Cyrtochilum aureum, Elleanthus amethystinus, Elleanthus conifer, Epidendrum inamoenum, Epidendrum stictoglossum, Gomphichis macbridei, Gomphichis valida, Stenoptera montana, Stenoptera peruviana, Masdevallia amabilis, Pleurothallis spiralis, Pleurothallis virgata, Pterichis triloba, Pterichis Sudamerlycaste Sauroglossum schweinfurthianum y Stelis Liparis elegantula y Malaxis andicola acantilados,

PAGE 121

y musgos, helechos, hierbas Aa Chloraea septentrionalis, Cyrtochilum aureum, Gomphichis valida Elleanthus amethystinus, Epidendrum stictoglossum, Masdevallia amabilis, Masdevallia semiteres, Platystele rauhii, Pleurothallis virgata, Pterichis triloba, Stenoptera montana, Stenoptera peruviana, Stelis Sudamerlycaste Trichoceros tupaipi Masdevallia semiteres, Pleurothallis virgata, Stelis Trichoceros tupaipi. Polylepis los individuos de Polylepis no son muy densos se Epidendrum stictoglossum, Gomphichis valida, Malaxis andicola, Masdevallia amabilis y Pleurothallis spiralis de Polylepis weberbauer Buddleja incana Epidendrum excelsum Altensteinia Chloraea septentrionalis Cyclopogon elatus, Cyrtochilum aureum, Stenoptera peruviana, Masdevallia semiteres, Pleurothallis virgata y Stelis Formaciones vegetales de los valles interandinos Son los valles que se encuentra entre las estribaciones Matorral xeroftico que com Acacia, Cercidium, Tecoma, Jatropha, Monnina, Rubus y Croton, y entre Aa Altensteinia Cranichis ciliata, Epidendrum secundum, Malaxis andicola, Porphyrostachys pilifera Pelexia laxa, Ponthieva pseudoracemosa, Sauroglossum schweinfurthianum y Trichoceros Eucalyptus globulus estos bosques y a las dimensiones de los mismos E. globulus Cranichis ciliata, Malaxis andicola Pelexia laxa, Ponthieva pseudoracemosa, Sauroglossum schweinfurthianum y Trichoceros ndo se hicieron los trabajos LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA

PAGE 122

Zona altoandina Valle interandino Especies Paj Bof Mat P&R B.Poly A.Alt MatXero B.Euc TRIBU CRANICHIDEAE Subtribu Cranichidinae Cranichis ciliata Kunth Cranichis sp. Ponthieva aff. pseudoracemosa Garay Pterichis triloba (Lindl.) Schltr. Pterichis sp. Subtribu Prescottinae Aa aurantiaca D.Trujillo Aa erosa (Rchb.f.) Schltr. Aa spp. Kunth Gomphichis macbridei C. Schweinf. Gomphichis valida Rchb.f. Myrosmodes nubigenum Rchb.f. Myrosmodes paludosa (Rchb.f.) P.Ortiz Myrosmodes pumilio (Schltr.) C.A.Vargas Myrosmodes sp. Porphyrostachys pilifera (Kunth) Rchb.f. Stenoptera aff. peruviana C. Presl Stenoptera montana C. Schweinf. Subtribu Spiranthinae Cyclopogon elatus (Sw.) Schltr. Pelexia aff. laxa (Poepp. & Endl.) Lindl. Sauroglossum schweinfurthianum Garay TRIBU MALAXIDEAE Liparis elegantula Kraenzl. Malaxis andicola (Ridl.) Kuntze TRIBU CHLORAEAE Chloraea septentrionalis M.N. Correa TRIBU SOBRALIEAE Elleanthus amethystinus (Rchb.f. & Warsz.) Rchb.f. Elleanthus conifer (Rchb.f. & Warsz.) Rchb.f. TABLA Eucalyptus Polylepis TRUJILLO LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.109

PAGE 123

Zona altoandina Valle interandino Especies Paj Bof Mat P&R B.Poly A.Alt MatXero B.Euc TRIBU EPIDENDREAE Subtribu Laeliinae Epidendrum excelsum C.Schweinf. Epidendrum inamoenum Kraenzl. Epidendrum stictoglossum Hgsater & D.Trujillo Epidendrum secundum Jacq. Subtribu Pleurothallidinae Masdevallia amabilis Rchb.f. & Warsz. Masdevallia semiteres Luer & R.Escobar Platystele rauhii Luer Pleurothallis spiralis (Ruiz & Pav.) Lindl. Pleurothallis virgata Luer Stelis spp. TRIBU CYMBIDIEAE Subtribu Maxillariinae Sudamerlycaste sp. Subtribu Oncidiinae Cyrtochilum aureum (Lindl.) Senghas Trichoceros tupaipi Rchb.f. Trichoceros sp. TABLA contina LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.110 LANKESTERIANA AGRADECIMIENTOS. A los curadores de los herbarios LITERA TURA CIT ADA

PAGE 124

TRUJILLO LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.111 Pterichis in in controls on Tillandsia fog vegetation in coastal southern Polylepis (Rosaceae, Sanguisorbeae) en los Andes Aa

PAGE 125

LANKESTERIANA

PAGE 126

LANKESTERIANA.SEM AND PHYLOGENETIC ANALYSIS OF NATURALIZED AND CULTIVATED EPIDENDRUM INGELIA P. WHITE 1* MICHAEL F FA Y 2 BRAD W. PORTER 1 & KIMBERLEY CHINEN 11 2 ABSTRACT Epidendrum Epidendrum Epidendrum Epidendrum trnL-F gene Epidendrum from the rps16-trnK Epidendrum Epidendrum from Olomana KEY WORDS EpidendrumtrnL-F, rps16-trnK Epidendrum Epidendrum radicans are marked with yellow on the base of the labellum E obrienianum (jamiesonis x radicans) registered (orchid grower) made many hybrids in the 1940s in Hawaii using E. radicans, E. ibaguense Kunth, E. ellipticum Graham, E. arachnoglossum and E. cinnabarinum including E. Unfortunately, many of his hybrids today that are Epidendrum Materials and methods Scanning electron microscopy (SEM). An Epidendrum leaf 2 cm wide

PAGE 127

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.114 LANKESTERIANA Epidendrum collected Epidendrum ) trnL-F 25 trnLc trnLf trnL-F (Taberlet et al. trnL-F to include an Epidendrum ibaguense nucleotide P Plant et al rps16-trnK) the rate of erroneous base insertions associated with E. coli No. Plant labels Leaf fwt (g) Flower color and size (cm) Leaf size (cm) and stem color 1 Epi. Clem (Epi. C) 6 dull orange, yellow callus. W: 2.5, L: 3 W: 2, L: 6.5 2 Epi. Inge (Epi. I) 6 purplish red, yellow callus. W: 2.6, L: 3 W: 2, L: 10 3 Epi. Clay 6 6 bright red, yellow callus, red dots. W:2.6, L: 3 W: 1.6, L: 6.2 4 Epi. Clay 3 6 pure yellow. W: 2.2, L: 2.4. Pedicel: 2.7 W: 4.5, L: 1.8. Purple stem 5 Epi. Clay 7 6 pure yellow. W: 2.2, L: 2.4. Pedicel: 2.5 W: 2, L: 7.5 6 Epi. Clay 1 6 brownish orange. W: 2.9, L: 3 W: 2, L: 4.4 7 Epi.Epi. P) 6 bright red, yellow callus, red dots. W:3, L:3.3 W: 1.6, L: 6 8 Epi. Clay 2 6 possibly yellow/red W: 1.9, L: 5.7 9 Epi. Clay 8 6 possibly red/orange W: 1.3, L: 6 10 Epi. Clay 5 4.545 possibly red W: 1.3, L: 4.6 11 Epi. Clay 4 3.468 possibly red/purple W: 1.2, L: 4.5 12 Epi. small white (Epi. sm12) 6 white w/light purple base. W: 1.5, L: 1.7 W: 1.9, L: 7.5 TABLE Epidendrum

PAGE 128

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. WHITE et al. Epidendrum115 FIGURE (500x) of E. P and E. E. E. E. E. FIGURE E. P and E. E. E. E. E. in Genomics, Proteomics and Bioinformatics using a Results and discussion EpidendrumE. P) cultivar (E. E. E. Similar bulbous cell structures were found on E E. heights of E. P and E. belong to E. cells are seen on E. The two cultivars showed no detectable differences thinner transverse section of E. ) E. heights of E. P and E. E. E. I E. E. root tissues of the cultivated cultivar might be attributed to the abundant and continuous water received during

PAGE 129

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA FIGURE midribs (200x) of E. P and E. E. P E. Vascular bundle height of E. bundle height of E. FIGURE E. P and E. E. of E. E. E. E. P and the cultivated E. I might trnL-F E. cultivated Epidendrum accessions showed that at least Epidendrum E. E. E. E. P, and E. Epidendrum E. E. E. E. E. I belong to another E. P belongs E. I belongs to E. E. E. sw12 Epidendrum E. rps16-trnK Epidendrum 11 E.in E. E. I and E. IB (shorter 10 could be distinguished from the longer mono ( E.14 ( E. RP, and E. Epidendrum I and E. IB have the same Epidendrum I can be distinguished from E. IB as

PAGE 130

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. WHITE et al. Epidendrum rps16-trnK) can be used to distinguish related Epidendrum E. I is unique E. radicans, E. evectum, and E. obrienianum) become ACKNOWLEDGEMENTS Th Epidendruml Laboratory FIGURE trnL-F)

PAGE 131

Figure 1. Sequence alignment of the chloroplast locus Epcp-02 (rps16trnK) from Epidendrum Ingelia (EpiI), Epidendrum Ibaguense (EpiIB), Epidendrum Olomana (EpiO), Epidendrum Red Purple (EpiRP), and Epidendrum Clem (EpiC). EpiRP1 (C14) and EpiRP2 (C15) represent unique clones derived from the same plant. Forward and reverse primer sequence is underlined. Epcp02 EpiI 1 TTCTTGCTTCTTTTTGTGGA A CCCCCCCCCC------AACAAGGGGGGGATAACCTTTCT Epcp02 EpiIB 1 TTCTTGCTTCTTTTTGTGGA A CCCCCCCC --------AACAAGGGGGGGATAACCTTTCT Epcp02 EpiO 1 TTCTTGCTTCTTTTTGTGGA A CCCCCCCCCCCCCCCCAACAAGGGGGGGATAACCTTTCT Epcp02 EpiRP 1 TTCTTGCTTCTTTTTGTGGA A CCCCCCCCCCCCCC--AACAAGGGGGGGATAACCTTTCT Epcp02 EpiC 1 TTCTTGCTTCTTTTTGTGGA A CCCCCCCCCCCCCC--AACAAGGGGGGGATAA CCTTTCT Epcp02 EpiI 55 TCTTGTATTTG TATTGTACCTTTCTTTTTTTGATTAAAGAAAGCCGCTATTTTTTTTATC Epcp02 EpiIB 53 TCTTGTATTTG TATTGTACCTTTCTTTTTTTGATTAAAGAAAGCCGCTATTTTTTTTATC Epcp02 EpiO 61 TCTTGTATTTATATTGTACCTTTCTTTTTTTGATTAAAGAAAGCCGCTATTTTTTTTATC Epcp02 EpiRP 59 TCTTGTATTTATATTGTACCTTTCTTTTTTTGATTAAAGAAAGCCGCTATTTTTTTTATC Epcp02 EpiC 59 TCTTGTATTTATATTGTACCTTTCTTTTTTTGATTAAAGAAAGCCGCTATTTTTTTTATC Epcp02 EpiI 115 TCTATCTTTTCCTTATTTTTTTCCGCTCAAAGTTTGATTTTTTATGTTGTGCTAATTCAA Epcp02 EpiIB 113 TCTATCTTTTCCTTATTTTTTTCCGCTCAAAGTTTGATT TTTTATGTTGTGCTAATTCAA Epcp02 EpiO 121 TCTATCTTTTCCTTATTTTTTTCCGCTCAAAGTTTGATTTTTTATGTTGTGCTAATTCAA Epcp02 EpiRP 119 TCTATCTTTTCCTTATTTTTTTCCGCTCAAAGTTTGATTTTTTATGTTGTGCTAATTCAA Epcp02 EpiC 119 TCTATCTTTTC CTTATTTTTTTCCGCTCAAAGTTTGATTTTTTATGTTGTGCTAATTCAA Epcp02 EpiI 175 CGCAAATTTCTATATAATTTCTTGAAATT C GTTTTTTAAAAAGTCCATTTATATTGACAA Epcp02 EpiIB 173 CGCAAATTTCTATATAATTTCTTGAAATTTGTTTTTTAAAAAGTCCATTTA TATT GANNN Epcp02 EpiO 181 CGCAAATTTCTATATAATTTCTTGAAATTTGTTTTTTAAAAAGTCCATTTATATTGACAA Epcp02 EpiRP 179 CGCAAATTTCTATATAATTTCTTGAAATTTGTTTTTTAAAAAGTCCATTTATATTGA CAA Epcp02 EpiC 179 CGCAAATTTCTATATAATTTCTTGAAATTTGTTTTTTAAAAAGTCCATTTATATTGA CAA Epcp02 EpiI 235 TGG CGTATCAAACAAAT Epcp02 EpiIB 233 NNGGCGTATCAAACAAAT Epcp02 EpiO 241 TGG CGTATCAAACAAAT Epcp02 EpiRP 239 TGG CGTATCAAACAAAT Epcp02 EpiC 239 TGG CGTATCAAACAAAT FIGURE rps16trnK Epidendrum Inge (E. I), E. ibaguense ( E. IB), E.E. RP), E.E. Epidendrum from Olomana (E. Epidendrum from LITERA TURE CITED Epidendrum LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA

PAGE 132

LANKESTERIANA.TULASNELLA IRREGULARIS (BASIDIOMYCOTA: TULASNELLACEAE) FROM ROOTS OF ENCYCLIA TAMPENSIS IN SOUTH FLORIDA, AND CONFIRMATION OF ITS MYCORRHIZAL SIGNIFICANCE THROUGH SYMBIOTIC SEED GERMINATION LAWRENCE W. ZETTLER LAURA L. COREY, ALISHIA L. JACKS, LUKE T GRUENDER & ALYSSA M. LOPEZ AB STR A CT e.g Encyclia tampensis in vitro E. tampensis, Epidendrum amphistomum, Epidendrum nocturnum, and Prosthechea cochleata E. tampensis and E. nocturnum Tulasnella irregularis necessary for conservation RESU M EN e.g Encyclia tampensis in vitro E. tampensis, Epidendrum amphistomum, Epidendrum nocturnum y Prosthechea cochleata tercio de las semillas de E. tampensis y E. nocturnum (ambos inoculados) desarrollaron hojas cuando fueron Tulasnella irregularis KEY WORDS ITS sequencing, Basidiomycota, Tulasnella irregularis, Encyclia tampensis, Epidendrum

PAGE 133

Orchids occur naturally on all vegetated continents 1993), orchid diversity is richest in the New World et al agents (e.g with ex situ and in situ et al a growing number of studies have emerged in recent e.g et al. et al et al et al et al. et al et al et al. with ubiquitous basidiomycetes assignable to While interesting as this new information may be, diminutive seedlings on arboreal substrates is not et al. 2011) may hold in situ In nature, all orchids are thought to have a critical in vitro terrestrials that are notorious for having fastidious et al. e.g et al Zettler et al in vitro outcomes may or in situ, the use of Encyclia tampensis and sequencing was carried out to identify these strains, and in vitro symbiotic seed germination was Epidendrum amphistomum E. nocturnum Prosthechea cochleata E. tampensis and other LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.120 LANKESTERIANA

PAGE 134

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. ZETTLER et al. Tulasnella irregularis from Encyclia tampensis121Material and methods Orchid material and study site Roots and mature seeds of E. tampensis Quercus 1 2 3 4 FIGURES Encyclia tampensis E. tampensis seedlings of E. tampensis growing on the host tree, Quercus virginiana E. tampensis. E. tampensis Tulasnella irregularis

PAGE 135

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.122 LANKESTERIANAvirginiana 2) visible in various growth stages along the length E. tampensis Although E. tampensis is occasionally found in suitable for Q. virginiana E. tampensis, E. amphistomum, E. nocturnum, and Prosthechea cochleata E. tampensis is considered a sources were collected from E. tampensis (S194, S195, E. amphistomum E. nocturnum (S20), and P. cochleata 4 e.g et al et al. et al rains were initially distinguished Seed Source Orchid Date collected Notes S20 Epidendrum nocturnum 1 June 2002 Fakahatchee Strand, ca. 15 km S of FPNWR S177 Prosthechea cochleata 14 March 2009 S194 Encyclia tampensis 20 November 2011 Both S194 and S195 from two separate plants ca. 1 km SE of S195 Encyclia tampensis 20 November 2011 See above S196 Encycila tampensis 6 January 2012 Dry site ca. 100 m E of S197 Epidendrum amphistomum 28 June 2011 TABLE

PAGE 136

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. ZETTLER et al. Tulasnella irregularis from Encyclia tampensis123 et al. et al et al. Rhizoctonia and Epulorhiza et al. of these Epulorhiza Molecu Two of the fungi E. tampensis ) on a In vitro symbiotic seed germination for symbiotic seed germination closely followed the et al received the fungus isolated from the mature orchid six seed sources did not receive fungal inoculation tightly in aluminum foil to exclude light and incubated multivariate analysis of variance (P Results and discussion Root sections of E. tampensis e.g Pestalotia genera known to commonly associate with orchids worldwide, only Epulorhiza was evident in the with mostly submerged/adnate mycelium with entire et al. et al. et al. Three different strains of Epulorhiza were isolated, two of which originated from a different region of the mature

PAGE 137

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.124 LANKESTERIANA and closely resembled two other Epulorhiza strains Spiranthes brevilabris et al Epidendrum magnoliae Epi. conopseum et al Additional Epulorhiza strains have been isolated from Habenaria macroceratitis E. nocturnum Epulorhiza isolates are genetically similar remains unknown, but the use of In this study, sequencing of the ITS regions of ribosomal Epulorhiza isolates were Tulasnella irregularis only were these two strains of the same taxon, they both from an E. tampensis different growth stages in this orchid are nutritionally Seed germination and seedling development Both in vitro 100 days after E. tampensis seed sources well as seeds from E. nocturnum whereas seeds from the other two taxa (P. cochleata, E. amphistomum E. tampensis and E. nocturnum seeds inoculated with T. irregularis E. nocturnum) and S194 (E. tampensis), resulted in the based medium in the absence of fungi (control) largely T. irregularis had a stimulatory effect on seed germination detected between the two strains on seed germination nor any interaction between fungus and seed source seed, both fungal isolates mirrored one another in their sequencing results are in agreement that both strains Ecological implications Although orchid seeds do contain small traces of food reserves (Rasmussen 1995), E. tampensis and E. nocturnum are et al. (1999) for seeds of E. tampensis inoculated with a fungus (Epulorhiza E. magnoliae E. magnoliae and E. nocturnum darkness following inoculation with Epulorhiza (Zettler et al to be determined, but the evidence indicates that this T. irregularis E. tampensis relies on because the fungus required for germination and et al. (2001) and

PAGE 138

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. ZETTLER et al. Tulasnella irregularis from Encyclia tampensis125 In vitro Tulasnella irregularis) from Encyclia tampensis E. tampensis Quercus virginiana Orchid Seed Source 1n2# Seeds # Stage 0 # Stage 1 # Stage 2 # Stage 3 # Stage 4 # Stage 5*Mean % Germination UAMH 11543 P. cochleata S177 10 1,407 1,189 0 218 ------15.5 E. amphistomum S197 9 350 338 0 12 ------3.4 E. nocturnum S20 10 285 79 0 2 0 4 200 (70.2) 72.3 E. tampensis S194 10 384 40 0 0 0 5 339 (88.3) 89.6 E. tampensis S 195 9 504 231 3 13 6 4 231 (45.8) 54.2 E. tampensis S196 9 1,507 232 0 3 70 5 636 (42.2) 84.6 UAMH 11541 P. cochleata S177 10 1,438 1,272 0 166 ------11.5 E. amphistomum S197 9 235 228 0 7 ------3.0 E. nocturnum S20 10 410 128 0 0 0 19 263 (64.1) 68.8 E. tampensis S194 10 425 79 0 0 1 14 331 (77.9) 81.4 E. tampensis S195 10 597 296 3 6 3 51 238 (39.9) 50.4 E. tampensis S196 9 1,194 188 1 3 39 504 459 (38.4) 84.3 Control P. cochleata S177 4 709 709 ----------0.0 E. amphistomum S197 2 20 20 ----------0.0 E. nocturnum S20 5 199 199 ----------0.0 E. tampensis S194 5 220 219 0 1 ------0.5 E. tampensis S195 4 153 143 6 4 ------6.5 E. tampensis S196 5 909 908 0 1 ------0.112

PAGE 139

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA in vitro to determine if T. irregularis E. tampensis has been the subject of interest in recent years, but it is generally assumed that more common and/or generalists), whereas rare and/or restricted orchids target e.g orchids using in vitro In this study, E. nocturnum T. irregularis acquired from an orchid that e.g on Q. virginiana Encyclia tampensis, on e.g E. nocturnum conceivable that E. nocturnum as an associate of E. tampensis E. tampensis e.g E. nocturnum may be more restricted by lack of moisture, Epulorhiza has been isolated from E. nocturnum from a is also T. irregularis orchids live as associates in wetter habitats, lending The future of orchid conservation in south Florida E. tampensis, E. magnoliae), all e.g Dendrophylax lindenii E. amphistomum) are also found in the West Indies e.g et al e.g study orchid seed germination requirements in vitro as well as in situ, and a greenhouse located adjacent e.g USA Today a key role in orchid conservation this decade, and interactions, and highlight the need to identify, test (though symbiotic germination), and safeguard

PAGE 140

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. ZETTLER et al. Tulasnella irregularis from Encyclia tampensis ACKNOWLEDGMENTS Hoffman (Native Orchid Restoration Project) for collecting LITERA TURE CITED In vitro symbiotic seed germination orchid, Vanda coerulea in Orchid conservation Platanthera and Coeloglossum in Epulorhiza Platanthera (Orchidaceae) and a key to Epulorhiza in nd in germination, in vitro orchid Bletia purpurea Cyrtopodium punctatum in situ Epulorhiza isolates from

PAGE 141

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. LANKESTERIANA Rhizoctonia Ascorhizoctonia Ceratorhiza Epulorhiza Moniliopsis, and Rhizoctonia Ionopsis utriculariodes Epulorhiza epiphytica Orchidaceae in the genera Habenaria and Spiranthes germination of Habenaria macroceratitis germination and reintroduction of Spiranthes brevilabris Lindley, an endangered orchid native to and endangered terrestrial orchid Caladenia huegelii Epidendrum conopseum to germinate Encyclia tampensis in vitro (Epidendrum amphistomum in situ orchid (Epidendrum nocturnum in (Epidendrum conopseum

PAGE 142

POSTERSSYSTEMATICS ECOLOGY CONSERVATION SCIENCE

PAGE 144

LANKESTERIANA 12(3), December 2012. Universidad de Costa Rica, 2012. POSTERS Systematics131SYSTEMATICS Lepanthes en Puerto Rico: especiacin o inmigracin? PAUL BA YMAN GUPT A Lepanthes Lepanthes en Puerto Lepanthes basadas en secuencias del Development of a novel gene silencing method for orchids R. FRAZER 1 A. SCHULTE 2 B. POMAHACOV A 2 R. V AN VUGT 3 & B. GRA VENDEEL 1*123* Erycina pusilla as a model for orchid Erycina pusilla as a system for functional analysis will add an internationally valued system to the tools currently available for gene silencing cell division genes from Illumina HiSeq genome reads

PAGE 145

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.132 LANKESTERIANADiversidad de orqudeas de los bosques altos de la Serrana de los Paraguas, DUV AN A. GARCA-RAMREZ 1,2* & J. SANTIAGO GARCA-REVELO 1,212 colectas a nivel de sotobosque en doce localidades en Pleurothallis, Lepanthes, Stelis y Maxillaria Taxonomy, molecular phylogenetics, reproductive isolation, and niche differentiation of the Specklinia endotrachys species complex (Orchidaceae: Pleurothallidinae) ADAM P. KARREMANS 1,2,3* FRANCO PUPULIN 1,2,4 & BARBARA GRA VENDEEL 312 3 4 We combined a taxonomic study with molecular trnK-matK sequences Specklinia endotrachys modeling we intend to determine whether the lineages niche modeling indicates that differences in suitable S. endotrachys

PAGE 146

Vanilla planifolia V. planifolia Vanilla are registered for natural distribution of V. planifolia is controversial, Vanilla matK V. bicolor, V. helleri V. planifolia LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. POSTERS Systematics133Morphological and phylogenetic characterization of the diversity of the genus Vanilla FRANCISCO HERNANDO MOLINEROS-HURT ADO 1,2,3* R. T GONZLEZ-MINA 1,3 J. T OTERO 1,4,5 & N. S. FLANAGAN 1,612 34Biological Sciences 5 by Drosophila immigrans Gavilea (Orchidaceae) MARA ISABEL MUJICA 1* & FERNANDA PREZ 1,21 2 Gavilea aclarar la trayectoria evolutiva de los distintos rasgos

PAGE 147

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.134 LANKESTERIANAGavilea un valor de lambda cercano a cero, sugierendo que Atlas of orchids of the state of Santa Catarina MARCELO VIEIRA NASCIMENTO consisting of mangroves, dunes, beaches, and Araucaria famous is Laelia purpurata disclose clearly and objectively the occurrence of the basically to 1) research the 14 herbaria in the state of 2) review existing literature for Orchidaceae of Santa can be viewed at Orchidacae of Campeche Island, Florianpolis, Santa Catarina MARCELO VIEIRA NASCIMENTO

PAGE 148

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. POSTERS Systematics135 Dyckia encholirioides Acianthera pubescens, A. serpentula, A. saundersiana, A. sonderana; Aspidogyne bidentifera; Brassavola tuberculata; Campylocentrum aromaticum; Catasetum cernuum; Cattleya leopoldii; Cleistes macrantha; Encyclia odoratissima; Epidendrum fulgens; Gomesa crispa; Maxillaria picta; Notylia longispicata; O. diaphana); Oeceoclades maculata; Oncidium Ornithocephalus myrticola; Polystachya estrellensis; and Stanhopea graveolens.Cattleya labiata MARCELO VIEIRA NASCIMENTO Cattleya labiata It was described by English botanist John Lindley Cattleya labiata have always on the existence of more than one factor, including varieties of Cattleya labiata have been described based OSCAR ALEJANDRO PREZ-ESCOBAR 1* PEDRO ORTIZ VALDIVIESO 2 EDICSON PARRASNCHEZ 3 CRISTIAN RINCN-USECHE 4 & LIZETH KA THERINE RODRGUEZ 41 23 4

PAGE 149

LANKESTERIANA Acianthera Campylocentrum Epidendrum Lepanthes and two new records), Lockhartia Stelis Sw. and Telipogon Stelis spathulata y Stelis argentata Poulseria armata (Paulteria caimito) y Lauraceas, sin embargo los Eugenia Ficus insipida Anotaciones sobre la composicin de la comunidad de orqudeas en la Reserva Natural Bosque de Yotoco (Valle del Cauca, Colombia) NHORA HELENA OSPINA-CALDERN 1,2* GINA ARROYO-GARCA 2,3 & J. TUPAC OTERO 2,4,512 3 4 5 Checklist and illustrated guide to the Cauca River Valleys orchids and the Andean foothills (southwestern Colombia) G. A. REINA-RODRGUEZ 1* N. H. OSPINA-CALDERN 2 ALEJANDRO CAST AO 3, IGNASI SORIANO 4 & J. TUPAC OTERO 5 1,5*2 3 45Environmental LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.

PAGE 150

of dry forest remains) lead us to think that extinction LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. POSTERS Systematics Panam ZULEIKA SERRACN-HERNNDEZ 1* RAF AEL RINCN 1 EYV AR RODRGUEZ-QUIEL 1 & DIEGO BOGARN 1,212 collected at different sites of the reserve during three Epidendrum coronatum are considered Stelis should be used? RODOLFO SOLANO 1* & GERARDO SALAZAR 2 1 2 reconstruction of subtribe Pleurothallidinae has led to a new delimitation of Stelis, and the genus now heterogeneous (Stelis Stelis in its narrow sense (Stelis Crocodeilanthae, Dracontia,

PAGE 151

LANKESTERIANALANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.Effusiella, Elongatia, Lalexia, Mystacorchis, Niphanta, Physosiphon, Physothallis, Rhynchopera, Salpistele, Talpinaria, and Unciferia Stelis Stelis However, this consideration forgets the fact that segregated from Stelis ( Dracontia, Effusiella Lalexia, Mystacorchis transferred to Stelis related to Pleurothallis restrepioidesA newly recognized clade of Pleurothallis with Mesoamerican distribution M. WILSON 1* F PUPULIN 2 F L. ARCHILA-MORALES 3 A. DAMON 4 & R. SOLANO-GOMEZ 51*2Jardin Botanico Lankester, 3 45 Phylogenetic studies of Pleurothallis sensu lato Pleurothallis Pleurothallis aurita, P. bitumida, P. bogarinii, P. cobriformis, P. dorotheae, P. excavata, P. nitida, P. saccatilabia, P. sanchoi, P. scaphipetala, P. simulans, and two Pleurothallis subgenus Pleurothallis section Macrophyllae-Fasciculatae, but this section was segregated from Pleurothallis by Luer and along with P. section Pleurothallis subsection Acroniae was raised to generic level as Acronia et al., P. section Macrophyllae-Fasciculatae was alone segregated from Pleurothallis as genus Zosterophyllanthos. P. bogarinii, are listed under synonyms of Pleurothallis rpoB and matK sequences Pleurothallis sensu stricto clade but which is distinct Macrophyllae-Fasciculatae and from the P. section Pleurothallis subsection Acroniae P. section Macrophyllae-Fasciculatae Panama), strongly indicate that a new subgenus of PleurothallisLANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.

PAGE 152

A preliminary phylogenetic analysis of Pleurothallis sensu lato based upon nuclear and plastid sequences M. WILSON C. BELLE, A. DANG, P. HANNAN, L. KELLOGG, C. KENYON, H. LOW, A. MOCHIZUKI, A. NGUYEN, N. SHEADE, L. SHAN, A. SHUM, T ST A YTON, C. VOLZ, B. VOSBURGH, H. WELLMAN & M. WOOLLEY Pleurothallis sensu lato several segregate genera, including Acronia, Ancipitia, Colombiana, Elongatia, Lindleyalis, Lalexia (for P. ), Mirandopsis, Rhynchopera, Talpinaria, and Zosterophyllanthos, leaving a much smaller Pleurothallis sensu stricto by Pridgeon et al., Ancipitia, Colombiana, Mirandopsis, Pleurothallis, Lindleyalis, Rhynchopera, and Talpinaria formed a clade, indicating Pleurothallis Mirandopsis within Pleurothallis sensu stricto ( Antenniferae, Longiracemosae, and Macrophyllae-Racemosae), matK markers have been sequenced for the ycf1 and trnL-F Acronia, Ancipitia, Colombiana, Lindleyalis, Lalexia, Pleurothallis, Rhynchopera, and Talpinaria et al. Elongatia, only Elongatia excelsa, E. macrophylla, E. restrepioides, and E. sijmii Ancipitia/ Colombiana, Lalexia, Lindleyalis, Loddigesia, P. section MacrophyllaeFasciculatae P. excavata Rhynchopera Pleurothallis section Pleurothallis subsection Acroniae is not LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. POSTERS Systematics139

PAGE 153

LANKESTERIANALANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.140ECOLOGY Prosthechea aff. karwinskii LAURA L. CEDILLO 1 CARLOS GMEZ-ALONSO 2 & IRENE VILA-DAZ 1*1 2 Prosthechea karwinskii P. karwinskii de acuerdo a P. karwinskii tiene como Quercus desertcola.Horizontal and vertical distributional patterns of epiphytic Orchidaceae in a cloud forest in Colombia MARCELA CUART AS-DOMNGUEZ 1,21 2 25 trees with diameter at breast height distributed in three diameter categories small trees cm cm), and large individuals and located in at least three trees revealed Elleanthus Maxillaria aurea, and Stelis

PAGE 154

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. POSTERS Ecology141 determine if there were differences between different categories are associated stages Reproductive biology of Masdevallia coccinea and Masdevallia ignea in Guasca (Cundinamarca: Colombia) MNICA ADRIANA CUERVO MARTNEZ 1* RODRIGO BUSTOS SINGER 2 & MARIA ARGENIS GMEZ BONILLA 11 2 Masdevallia coccinea and Masdevallia ignea M. coccinea and the M. ignea Masdevallia coccinea and M. ignea differ the labellum is articulated at the base of the column, Masdevallia coccinea and M. ignea M. coccinea and M. ignea M. coccinea and M. igneaCattleya quadricolor Lindl. LUZ NGELA GUERRERO1, JISSEL PREZ-QUIROGA 1 MARA ALEJANDRA QUINTERO 1, ALBERTO ROJAS-TRIVIO 2* & J. TUPAC OTERO 2,31 2 3 C. las muestras con agua corriente, desinfectando con

PAGE 155

LANKESTERIANALANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.142 hasta observar desarrollo de colonias, las cuales sobre que juegan los microorganismos en los ecosistemas y teniendo en cuenta el escaso conocimiento que existe Mycorrhizal and endophytic fungal communities associated with roots of Pseudorchis albida (Orchidaceae) PETR KOHOUT 1,2 TAMARA MALINOV 3,4 MELANIE ROY 5 MARTIN VOHNK 1,2 & JANA JERSKOV 3,4*1 2 3 4 5 Pseudorchis albida in P. albida was dominated by Tulasnella Although the diversity and community assemblages

PAGE 156

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. POSTERS Ecology143The genus Neottia an early step in shift from autotrophy to mycoheterotrophy in orchids? TAMARA MALINOV 1,2 MILAN KOTILNEK1, JANA JERSKOV 1,2* FRANCOIS-XA VIER JOLY 1 & MARC-ANDR SELOSSE 31 23 a way of gaining nutrients, but the evolution of such Neottia ovata and N. cordata green N. nidus-avis N. ovata and 21 N. cordata different habitats and measured the natural content of mortality during two years of in situ Whereas N. ovata N. ovata and N. cordata localities, N. cordata never the forest individuals associated more often with Neottia NeottiaEndophytic fungi associated with natural populations of Vanilla species in southwest Colombia ANA TERESA MOSQUERA-ESPINOSA 1,2* J. TUPAC OTERO 1,3,4 & NICOLA S. FLANAGAN 1,21 23 4 The genus Vanilla (Orchidaceae) is of economic interest as the source of the natural vanilla fragrance, V. planifoliaV. subgenus Xanata, section Xanata) has a natural distribution in the Vanilla Vanilla, have an intimate ents during seedling establishment and often in mature little is known regarding the diversity of orchid mycor of Vanilla

PAGE 157

LANKESTERIANALANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.144 assays of symbiotic germination of Vanilla Thanatephorus, Sebacina, Ceratobasidium y Tulasnella Ceratobasidium Vanilla Ceratobasidium Hongos micorrzicos de orqudeas en poblaciones naturales en los departamentos del Valle del Cauca y Antioquia, Colombia ANA TERESA MOSQUERA-ESPINOSA 1,2* PAUL BA YMAN 3 & J. TUPAC OTERO 1,4,5123 45 Rodriguezia granadensis (Lindl.) Rchb.f. NHORA HELENA OSPINA-CALDERN 1,2* J. TUPAC OTERO 2,3,4 & R. L. TREMBLA Y 51 2 3 4 5 Rodriguezia granadensis

PAGE 158

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.145 de R. granadensis se encuentran en el callo del R. granadensis Eulaema Distribution patterns of Cuitlauzina pendula La Llave & Lex (Orchidaceae) over its phorophytes at the Barranca de Cupatitzio National Park, in Uruapan, VERNICA A. PREZ-DECELIS 1 CARLOS GMEZ-ALONSO 2 & IRENE VILA-DAZ 3*1 2 3 Cuitlauzina pendula This research was carried out at the Barranca de The objectives of this study were to 1) evaluate C. pendula abundance of C. pendula Cuitlauzina pendula POSTERS Ecology

PAGE 159

LANKESTERIANALANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.Mating system and reproductive success of Cuitlauzina pendula La Llave & Lex (Orchidaceae) at the National Park Barranca del Cupatitzio of Uruapan, VERNICA A. PREZ-DECELIS 1* & IRENE VILA-DAZ 21 2 Cuitlauzina pendula La Llave & were randomly selected, and the following manual the subject of viability of the seeds, treatments showed categories (X gl P Cuitlauzina pendula Vanilla spp. (Orchidaceae) ALEJANDRO RECALDE 1,2, ALBERTO ROJAS-TRIVIO 1,2* JOEL TUPAC OTERO 1,2,3 & NICOLA S. FLANAGAN 1,412 3 4 Vanilla fueron lavadas con agua corriente, se desinfectaron con

PAGE 160

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. POSTERS Ecology V. planifolia VanillaCeratobasidium lineages associated with two epiphytic orchids in Colombia RAF AEL BORGES DA SILV A VALADARES 1* ELKE JURANDY BRAN NOGUEIRA CARDOSO 1 & JOEL TUPAC OTERO 2,3,41 2 3 4 with the greatest biodiversity of orchids, with an Ionopsis utricularioides and Psygmorchis pusilla Ceratobasidium, known to be a common orchid isolated from I. utricularioides Ionopsis utricularioides was Psygmorchis pusilla subtribe Oncidiinae and Ceratobasidium was also

PAGE 161

LANKESTERIANALANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.CONSERVATION SCIENCE PAUL BA YMAN GUPT A generalmente require medios de cultivo y ambiente de Epidendrum y Dendrobium Ceratobasidium ha in vitro de Rhynchostele bictoniensis (Bateman) Soto Arenas & Salazar, en medio de cultivo Knudson C VINCENZO BERTOLINI 1,* ANNE DAMON 1 JA VIER VALLE MORA 1 & ANGEL ROJAS VELZQUEZ NA T ANAEL 21 2 Rhynchostele bictoniensis (Bateman) Soto

PAGE 162

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. POSTERS Conservation science149Research Group in Orchids, Ecology and Plant Systematics: an inter-institutional initiative for plant conservation and sustainable use in south-west Colombia NICOLA S. FLANAGAN 1* A. T MOSQUERA-ESPINOSA 1 R. T GONZLEZ 2, F H. MOLINEROS-HURT ADO 2,3 N. H. OSPINA-CALDERN 4 M. CUART AS-DOMNGUEZ 5, P. A. SILVERSTONE-SOPKIN 6 G. REINA 7 M. C. DIEZ 8 R. OSPINA-TORRES 9, J. D. ACKERMAN 10 P. BA YMAN 10 & J. T OTERO 3,1112Agronomy Program, Universidad del 3 4Ecology Program 5Acta Agronomica Journal, 910 Systematics is an alliance of researchers from several Sustainable Use of Vanilla always welcome in order to advance knowledge strategies for the conservation and sustainable use of Orchids of the cloud forests of Dapa (Valle del Cauca, Colombia): research and conservation of forest treasures TERRY LYNN GARTELMAN-GONZALEZ 1* OSCAR ALEJANDRO PREZ-ESCOBAR 2 & EDICSON PARRA-SNCHEZ 312 3 building for the conservation of wild orchids and annotated list of Orchidaceae in the cloud forests

PAGE 163

LANKESTERIANALANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.150 herbarium work were carried out, and material from Campylocentrum Epidendrum Lepanthes and a new record), Stelis and Telipogon with several community members in order to the last 30 years by the surrounding community Primary conservation strategies concerning habitats should be formulated and executed in concert with local community and environmental Distribution pattern, conservation status, and traditional therapeutic uses of orchids with particular reference to Solan district, Himachal Pradesh, India K. C. MAHANT 1* PROMILA PA THAK 2 & KUMAR SHARMA VINA Y 112Orchid Laboratory, The state of Himachal Pradesh in India situated made in the Solan district in the state of Himachal Pradesh during which frequent visits were made in also interviewed to gather information on traditional declining for a number of reasons, including habitat destruction and illegal and unregulated commercial collections for ornamental and/or medicinal threatened. even before their existence and biological/economic Hence, there is an urgent need to identify and document orchids from the

PAGE 164

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. POSTERS Conservation science151Orchid legislation in Santa Catarina, Brasil MARCELO VIEIRA NASCIMENTO has made the state and its orchids coveted by knowledge, and environmental education for the Laelia purpurata Laelia purpurata Rodrigues Rodrigues These laws, available at JUAN CAMILO ORDOEZ-BLANCO 1,212 Masdevallia caudata but is threatened and has not been studied to substantiate our research we visited ten communities and found Wild individuals were collected in order to study maintenance observations of ex situ (biology and formula, longevity, and ), and asymbiotic in vitro in the Botanical Garden ex situ In addition yielded a viable fruit set in a the most effective from geitonogamy and symbiotic of seeds obtained by different methods of natural or

PAGE 165

LANKESTERIANALANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.152 was carried out germinated on Orquideas de los bosques de niebla del suroccidente de Colombia y oportunidades para su conservacion JORGE OREJUELA-GARTNER de niebla del suroccidente colombiano, en los se han establecido recientemente reservas naturales Medicinal orchids of India and conservation measures for their sustainable management PA THAK PROMILA one of the highly evolved families of economically Indian orchids have been used extensively in various indigenous systems of medicine since the Vedic Vanda herbs including Malaxis acuminata, M. muscifera, Habenaria edgeworthii, and H. intermedia are highly cardiac (Eulophia dabia), dysentery (Satyrium nepalense), malignancy (Vanda testacea), nervous (Dendrobium nobileDactylorhiza hatagirea), Dactylorhiza hatagirea), and rheumatism (Rhynchostylis retusa have Though extensive research work

PAGE 166

LANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013. POSTERS Conservation science153 their biological status and suggests both in situ and ex situ conservation measures for their sustainable Plan de manejo para la conservacin de Cattleya quadricolor Lindl. en el Valle del Cauca, Colombia GUILLER M O AL B ERTO REIN ARODRGUEZ 1,2* & N H OS P IN ACA LDERN 3 1, 22 3 et al se fueron censados. A. excelsum G. ulmifolia F. insipida E. ulei in-situ debe incluir un incremento de la cantidad y la calidad del in vitro Characterization of Brassolaeliocattleya Raye Holmes Mendenhall putatively transformed for resistance to Cymbidium mosaic virus NY A N STILL W ELL 1 HE A THER MCCA FFERTY 2 YUN J. ZHU 2 & INGELI A WHITE 1*1 2 Orchids are infected by more than 50 different research, a Brassolaeliocattleya orchid was transformed virus using an Agrobacterium Brassolaeliocattleya Raye

PAGE 167

LANKESTERIANALANKESTERIANA 13(1), August 2013. Universidad de Costa Rica, 2013.154also contained kanamycin resistance for the selection control of a CaMV 35S transgenic lines, which have been selected for antibiotic in vitro inoculation assay to test Pestiferous scale insects on native epiphytic orchids in south Florida: a new threat posed by exotic species LAWRENCE W. ZETTLER 1* JENNIFER A. ZETTLER 2 LARRY W. RICHARDSON 3, HALEIGH A. RA Y 1,4 JOHN P. MCCORMICK 1,5 ANDREW L. STICE 1 & IAN STOCKS 61 2345 rescences of the ghost orchid, Dendrophylax lindenii, additional surveys were carried out in more remote (Asterolecanium epidendri Asterolecaniidae), brown soft scale (Coccus hesperidumval scale (Diaspis boisduvalii infestations were noted on Epidendrum amphistomum, E. nocturnum, E. rigidum, and Prosthechea cochleata Prosthechea cochleata and E. amphis-tomum, D. boisduvalii adds an addition