• TABLE OF CONTENTS
HIDE
 Front Cover
 Index
 Copyright
 Main
 Back Cover














Title: Lankesteriana
ALL VOLUMES CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00098723/00014
 Material Information
Title: Lankesteriana la revista científica del Jardín Botánico Lankester, Universidad de Costa Rica
Physical Description: v. : ill. (some col.) ; 25 cm.
Language: English
Creator: Jardi´n Bota´nico Lankester
Jardín Botánico Lankester
Publisher: Jardi´n Bota´nico Lankester, Universidad de Costa Rica
Jardín Botánico Lankester, Universidad de Costa Rica
Place of Publication: Cartago Costa Rica
Cartago Costa Rica
Publication Date: December 2005
Frequency: three times a year[2002-]
irregular[ former 2001]
three times a year
regular
 Subjects
Subject: Botany -- Periodicals -- Costa Rica   ( lcsh )
Epiphytes -- Periodicals -- Costa Rica   ( lcsh )
Orchids -- Periodicals -- Costa Rica   ( lcsh )
Plantkunde   ( gtt )
Botanische tuinen   ( gtt )
Genre: periodical   ( marcgt )
Spatial Coverage: Costa Rica
 Notes
Language: In English and Spanish.
Dates or Sequential Designation: No. 1 (mayo 2001)-
Numbering Peculiarities: Issues for May 2001-Oct. 2003 designated no.1-8; issues for Apr. 2004- designated vol. 4, no. 1-
General Note: Latest issue consulted: Vol. 4, no. 1 (abr. 2004).
General Note: International journal on orchidology.
 Record Information
Bibliographic ID: UF00098723
Volume ID: VID00014
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
Resource Identifier: oclc - 48491453
lccn - 2001240973
issn - 1409-3871

Downloads

This item has the following downloads:

00012-2005 ( PDF )


Table of Contents
    Front Cover
        Front Cover
    Index
        Index
    Copyright
        Copyright
    Main
        Page 163
        Page 164
        Page 165
        Page 166
        Page 167
        Page 168
        Page 169
        Page 170
        Page 171
        Page 172
        Page 173
        Page 174
        Page 175
        Page 176
        Page 177
        Page 178
        Page 179
        Page 180
        Page 181
        Page 182
        Page 183
        Page 184
        Page 185
        Page 186
        Page 187
        Page 188
        Page 189
        Page 190
        Page 191
        Page 192
        Page 193
        Page 194
        Page 195
        Page 196
        Page 197
        Page 198
        Page 199
        Page 200
        Page 201
        Page 202
        Page 203
        Page 204
        Page 205
        Page 206
        Page 207
        Page 208
        Page 209
        Page 210
        Page 211
        Page 212
        Page 213
        Page 214
        Page 215
        Page 216
        Page 217
        Page 218
    Back Cover
        Back Cover
Full Text
mI




ISSN 1409-3871



LANKESTERIANA

VOL. 5, No. 3 DICIEMBRE 2005

Molecular systematics of Telipogon (Orchidaceae: Oncidiinae) and its
allies: nuclear and plastid DNA sequence data
NORRIS H. WILLIAMS, W. MARK WHITTEN & ROBERT L. DRESSLER 163

Una nueva especie de Elaphoglossum secci6n Elaphoglossum
(Lomariopsidaceae) en Costa Rica
ALEXANDER Fco. ROJAS ALVARADO 185

Nuevos taxa de helechos arborescentes (Filicales: Cyatheaceae) en
Costa Rica
ALEXANDER Fco. ROJAS ALVARADO 191

Sinopsis de Neomirandea (Asteraceae: Eupatorieae) en Costa Rica
ALEXANDER RODRIGUEZ G. 201

Pleodendron costaricense (Canellaceae), a new species for Costa Rica
BARRY E. HAMMEL & NELSON A. ZAMORA 211


















LA REVISTA CIENTIFICA DEL JARDIN BOTANICO LANKESTER
UNIVERSIDAD DE COSTA RICA











LANKESTERIANA
LA REVISTA CIENTIFICA DEL JARDIN BOTANICO LANKESTER
UNIVERSIDAD DE COSTA RICA






Copyright C 2005 Jardin Botinico Lankester, Universidad de Costa Rica
Fecha efectiva de publicaci6n / Effective publication date: 30 de diciembre del 2005

Diagramaci6n: Christian Rodriguez O.
Diseno de Portada: Werner Naranjo A.

Imprenta: Litografia Ediciones Sanabria S.A.
Tiraje: 500 ejemplares

Impreso en Costa Rica / Printed in Costa Rica


R Lankesteriana / La revista cientifica del Jardin Botanico
Lankester, Universidad de Costa Rica. No. 1
(2001)-- -- San Jose, Costa Rica: Editorial Universidad
de Costa Rica, 2001--
v.
ISSN-1409-3871

1. Botanica Publicaciones peri6dicas, 2. Publicaciones
peri6dicas costarricenses



0








LANKESTERIANA5(3):163-184. 2005.


MOLECULAR SYSTEMATICS OF TELIPOGON (ORCHIDACEAE:
ONCIDIINAE) AND ITS ALLIES: NUCLEAR AND PLASTID DNA
SEQUENCE DATA

NORRIS H. WILLIAMS'3, W. MARK WRITTEN1, AND ROBERT L. DRESSLER1'2

'Florida Museum of Natural History, University of Florida, Gainesville, FL 32611, USA
2Jardin Botanico Lankester, Universidad de Costa Rica, apdo. 1031-7050, Cartago, Costa Rica
3Author for correspondence: orchid@flmnh.ufl.edu

ABSTRACT. Phylogenetic relationships of Telipogon Kunth, Ornithocephalus Hook. and related genera
(Orchidaceae: Oncidiinae) were evaluated using parsimony analyses of data from the internal transcribed
spacers of nuclear ribosomal (nrITS DNA) and three plastid regions (matK, trnL-F, and the atpB-rbcL
intergenic spacer region). In addition to an analysis of 81 OTU's for ITS only, we used a matrix of 30 taxa
for combined nuclear and plastid analyses. Stellilabium is embedded within Telipogon and should be merged
with the latter genus. Telipogon consists of two South American clades and a Central American clade. One
Stellilabium clade is sister to the Central American clade of Telipogon, and the second Stellilabium clade is
sister to all of the Central American species of Telipogon and Stellilabium. Ti. [,:... *.. ..::. is a member of the
Telipogon alliance. The genus Dipterostele is not supported by this work. Nomenclatural changes are made
transferring Stellilabium to Telipogon.

RESUMEN. Se evaluaronlasrelacionesfilogeneticasde Telipogon, O..:. .0....i:..' . ... .... .iinii. I Orchidaceae:
Oncidiinae) mediante analisis de parsimonia de datos de espaciadores de ADN ribosomal nuclear (nrITS) y de
tres regions de ADN de plastidios (matK, trnL-F y la region espaciadora intergenica atpB-rbcL). Ademas de
un analisis de 81 OTU con ITS, se us6 una matriz de 30 taxa para realizar analisis combinados de ADN nuclear
y de plastidios. Stellilabium aparece anidado dentro de Telipogon. Este present dos clados sudamericanos
y uno centroamericano. Un clado de Stellilabium es hermano del clado centroamericano de Telipogon; el
segundo clado de Stellilabium es hermano de todas las species centroamericanas de Telipogon y Stellilabium.
IF l:... .,. .: es un miembro del grupo de Telipogon. El genero Dipterostele como tal no se justifica, segfin
este studio. Se realizan cambios nomenclatoriales para transferir las species de Stellilabium a Telipogon.

KEY WORDS / PALABRAS CLAVE: If-* ;:.'. *',. R. Ornithocephalus, Stellilabium, Telipogon, Oncidiinae,
Orchidaceae


The phylogenetic placements of Telipogon Kunth
and its relatives (formerly in subtribe Telipogoninae),
Ornithocephalus Hook. and its relatives (formerly in
subtribe Ornithocephalinae), F-. ~.. K, L..,,. Kunth
and Fernandezia Ruiz & Pav. (formerly in subtribe
Pachyphyllinae), and Lockhartia Hook. (formerly in
subtribe Lockhartiinae) have been unclear for many
years, although most authors now agree that these
taxa belong in Maxillarieae (Dressler 1993) and
are related to subtribe Oncidiinae (sensu Dressier
1993). Telipogoninae and Ornithocephalinae have
been separated from Oncidiinae on the basis of four
pollinia versus two in the Oncidiinae. Dressier (1993)
included i. '.. I. b//,-.: Fernandezia, and Lockhartia
in the Oncidiinae. Our earlier analyses (Whitten et al.
2000) showed that these groups all belong within the
Oncidiinae, and we later reported on 10 species in these
alliances, which we analyzed using a combined matrix


of ITS/matk/trnL-F for a total of 79 species (Williams
et al. 2001a). The species studied here represent a
broad sampling of species from both Central America
(primarily Panama and Costa Rica) and northern South
America (primarily Ecuador).
The relationships of the Telipogon i-.. 1..* I..,.'.
- Ornithocephalus alliances were demonstrated in our
earlier study, but the systematic position of Lockhartia
was not satisfactorily resolved at that time (Williams
et al. 2001a,b). The Telipogon Pachyphyllum -
Ornithocephalus alliances are sister groups embedded
within the Oncidiinae. In those studies Lockhartia was
an isolated group within the Oncidiinae, but the three-
gene analysis did not resolve its closest relatives. Here
we expand on -1, i ,i,1.1.. discuss the Telipogon alliance
in more detail, and present some preliminary data on
the Ornithocephalus alliance. Our larger analyses of
the Oncidiinae (634 species for ITS, 252 species for








LANKESTERIANA


ITS/matK/trnL-F) show that Lockhartia is sister to the
Telipogon Pachyphyllum Ornithocephalus alliance
(Williams & Whitten 2003, and unpublished in prep.).
The systematic position of IH *;:.. 1...'..7. Rchb.f.
has been disputed in the past. Szlachetko (1995)
placed If-*i; :.. ,.... .. with C:( .....- i Eloyella,
Hintonella, and Phymatidium in subtribe Hintonellinae
of his tribe Ornithocephaleae, whereas Dressler (1993)
placed II. i,. ...... r1 with Telipogoninae, and Dodson
(pers. comm.) also considered inclusion within
Telipogoninae. We address this question by analyzing
a range of species in both alliances.

MATERIALS AND METHODS

Specimens Table 1 list taxa examined, vouchers,
and GenBank numbers for all sequences. Samples for
DNA extraction were taken from wild collected plants,
cultivated plants, or from herbarium material.
Molecular techniques DNA extraction, purifi-
cation, PCR amplifications, sequencing, alignments,
primers, etc. were the same as in Williams et al.
(2001a), except as described below. All data matrices
are available upon request from NHW (orchid@flmnh.
ufl.edu).
The PCR protocol for the atpB-rbcL intergenic
spacer was 94 C for 2 min, 94 C for 45 sec, 62 oC 1
min, 72 oC for 75 sec, 32 cycles, and a final extension
of 72 oC 2 min. The primer sequences used are given
in Table 2. The original atpB-rbcL intergenic spacer
primers used for this group were those of Chiang et al.
(1998), but 1 l, i I., ....., .1.I i, shown in Table 2.
Data matrices Two data matrices were used: 1)
an 81-OTU matrix was analyzed for ITS alone which
included ITS 1 and ITS 2, the included 5.8S region,
and portions of the flanking 18s and 26s regions; and
2) a 30-taxon subset of that matrix was used for both
ITS analyses and individual and combined analyses
of matK, trnL-F and the atpB-rbcL intergenic spacer.
We were unable to obtain useable sequence data for
Phymatidium for the trnL-F study and for Telipogon
ariasii for the atpB-rbcL intergenic spacer region, so
those two matrices contain only 29 taxa.
Outgroup choice Outgroup choice was determined
by our analyses of Oncidiinae (Williams et al. 2001a,
b, Williams & Whitten 2003) and by our expanded
analysis of 634 taxa for ITS alone and 252 taxa for
ITS/matK/trnL-F. We used Lockhartia as the outgroup
in the large ITS only matrix and Fernandezia tica and
i. l:. .., "l"I,, sp. as the outgroup in the combined
nuclear and plastid analyses.
Data analysis PAUP* 4.0b10 (Swofford 2000) was


used on a PowerMac G4 computer for all analyses with
the following search strategies under Fitch parsimony
(unordered characters, equal weight to all changes, Fitch
1971): 1000replicatesrandomtaxonentry, MULTREES
on, and SPR swapping holding only 10 trees/replicate
to reduce time spent in swapping on large numbers of
trees in each replicate. After completing the random
replicates, all shortest trees found were then used as the
starting trees in a search with a limit of 10 000 trees with
swapping to completion on these trees. Tree statistics
for the analyses are given in Table 3. We performed
the following analyses: individual analyses of 30 taxa
for ITS, matK, trnL-F, and the atpB-rbcL intergenic
spacer; a combination of the three plastid regions;
a combined ITS + plastid dataset; and an individual
analysis for the 81 OTU ITS only matrix. Support was
determined by bootstrap analysis performed in PAUP*
and by Bayesian analysis performed in MrBayes 3.0B
(Huelsenbeck & Ronquist 2001) on the combined
plastid + ITS matrix. The parameters for the Bayesian
analysis were as follows: Iset nst 2 rates equal; set
autoclose yes; mcmcp ngen 2,000,000 printfreq=100
samplefreq 10 nchains 4 savebrlens yes; mcmc;
sumt; burin=200,000 contype halfcompat. The
analysis was repeated with rates gamma. In each case
the first 10 000 trees were omitted and the majority rule
consensus tree obtained in PAUP* from the remaining
trees. The two Bayesian analyses yielded the same
topologies, identical to those of parsimony analyses.

RESULTS

Analysis of individual matrices-ITS The
ITS analysis included 795 characters, of which 375
were variable and 301 (38%) potentially parsimony
informative, resulting in eight trees of 914 steps
[CI=0.58 (0.54 with uninformative characters
excluded), RI 0.79]. Figure 1 is one tree with branch
lengths and bootstrap support (BS).
Telipogon alliance: The ITS analysis of a
moderately supported (75%BS) Telipogon alliance has
a basal polytomy with H. 1;,:.. i.. ... i. the Trichoceros
clade (100%BS), the Telipogon ariasii-pulcher-
dalstromii clade (100%BS), and the strongly supported
remainder of the group with 100%BS. This latter
branch comprises the Telipogon nervosus-vargasii
clade (100%BS), sister to a weakly supported clade
(74%BS) of South American Stellilabium (100%BS)
+ a weakly supported (78%BS) clade of Central
American Stellilabium (100%BS) + Central American
Telipogon (98%BS). Within the Central American
Telipogon clade, T. butcher is sister to a strongly


Vol. 5, No 3








WILLIAMS et al. -Molecular systematics of Telipogon


supported (100%BS) clade of five additional species
from Central America.
Ornithocephalus alliance: Within the strong-
ly supported Ornithocephalus alliance (99%BS),
Phymatidium is sister to a moderately supported
clade (84%BS) consisting of two clades each with
100%BS support: one clade of Zygostates alleniana
+ Dipteranthus ,....:7. ....i.. and a second clade of
Eloyella sister to a weakly supported (59%BS) clade of
Hintonella sisterto a 100%BS clade of Ornithocephalus
..;: .... + Sphyrastylis dalstromii.

Analysis of individual matrices-trnL-F This
analysis had 1252 characters, 298 were variable and
149 (12%) were potentially parsimony informative, and
yielded 1458 trees with a length of 425 steps [CI 0.80
(0.68 with uninformative characters excluded),
RI=0.84]. Figure 2 is one tree with branch lengths and
bootstrap values.
Telipogon alliance: The trnL-F only analysis shows
a strongly supported (93%BS) Telipogon alliance with
a weakly supported (68%BS) clade of. ,. :i:....... If.i
and Trichoceros sister to the strongly supported
(94%BS) remaining ingroup. The ingroup consists
of a strongly supported (100%BS) Telipogon ariasii-
pulcher-dalstromiii clade and a weakly supported clade
(56%BS) comprising a strongly supported (100%BS)
South American Stellilabium clade of three species
sister to a weakly supported (50%BS) clade consisting
of a strongly supported (100%BS) Telipogon nervosus-
vargasii clade, and a moderately supported (76%BS)
Central American clade which consists of a strongly
supported (97%BS) Stellilabium clade of four species
and a strongly supported (99%BS) Telipogon clade
of six species. In this analysis T butcheri is within
the clade of the other Central American species of
Telipogon.
Ornithocephalus alliance: The trnL-F analysis
produced a strongly supported (100%BS) Ornitho-
cephalus alliance consisting of two clades: a strongly
supported clade of (96%BS) Zygostates alleniana +
Dipteranthus -...:.'i. i.... and a moderately supported
(77%BS) clade of Eloyella sister to a weakly supported
(59%BS) clade of Ornithocephalus ..:i,.,,,. +
Sphyrastylis dalstromii + Hintonella mexicana.

Analysis of individual matrices-matK The
individual matK analysis consisted of 1331 included
characters, 284 were variable and 151 (11%) were
potentially parsimony informative, and yielded four
trees of 434 steps [CI=0.76 (0.64 with uninformative
characters excluded), RI 0.83]. Figure 3 is one tree


with branch lengths and bootstrap values.
Telipogon alliance: In this analysis the Telipogon
alliance is weakly supported (62%BS) with
HIIf. i.. i.. "... sister to a weakly supported (53%BS)
remainder of the alliance. The strongly supported
(100%BS) Trichoceros clade is sister to the moderate-
ly supported (88%BS) remainder of the alliance. The
remainder of the alliance consists of a strongly sup-
ported (100%BS) Telipogon ariasii-pulcher-dalstromii
clade + a strongly supported (99%BS) clade consisting
of a weakly supported (66%BS) South American clade
of three species of Stellilabium with 100%BS sup-
port sister to a strongly supported (99%BS) Telipogon
nervosus-vargasii clade. The Central American clade
with 83%BS support consists of a strongly supported
(100%BS) clade of four species of Central American
Stellilabium and the strongly supported (100%BS)
clade of six species of Central American Telipogon. In
this analysis, as in the trnL-F analysis, T butcheri was
not resolved from the other Central American species
of KTIqhpugn
Ornithocephalus alliance: The Ornithocephalus
alliance (99%BS) consists of a trichotomy of
Phymatidium + a strongly supported clade (99%BS)
of Zygostates alleniana + Dipteranthus ,.... l'i.. ,.
and a strongly supported (98%BS) unresolved clade
of Eloyella, Hintonella and a moderately supported
(84%BS) clade of Ornithocephalus ..~:i.., +
Sphyrastylis dalstromii.

Analysis of individual matrices-atpB-rbcL
intergenic spacer The individual atpB-rbcL
intergenic spacer analysis consisted of 1499 included
characters, of which 530 were variable and 220 (15%)
were potentially phylogenetically informative [CI=0.81
(0.65 with uninformative characters excluded),
RI=0.75], and yielded three trees of 761 steps. Figure
4 shows one tree with branch lengths above the lines
and bootstrap values below the lines.
Telipogon alliance: The analysis of this intergenic
spacer region yielded two clades: a weakly supported
(68%BS) Telipogon alliance andamoderately supported
(88%BS) Ornithocephalus alliance. H. ...
+ Trichoceros (98%BS) forms a trichotomy with a
weakly supported (81%BS) remaining Telipogon +
Stellilabium clade. This large ingroup has the following
groups: a strongly supported (100%BS) Telipogon
pulcher-dalstromii clade sister to the weakly supported
remaining species (56%BS) consisting of a polytomy
consisting of a strongly supported (100%BS) South
American clade of three species of Stellilabium sister
to a strongly supported (100%BS) Telipogon nervosus-


LANKESTERIANA5(3):








LANKESTERIANA


vargasii clade; a moderately supported (65%BS)
Central American clade of four species of Stellilabium
with S. bullpenense sister to a moderately supported
(78%BS) clade of the other three species from Central
America; and a strongly supported (100%BS) clade of
the six Central American species of K, hpigmi Within
the Central American Telipogon clade, T parvulus is
sister to a moderately supported (82%BS) clade of T
biolleyi-butcheri-caulescens-seibertii-panamensis,
and within that clade is a weakly supported (70%BS)
yet unresolved polytomy of T biolleyi-butcheri-
caulescens-seibertii.
Ornithocephalus alliance: This alliance with 88
% bootstrap support consists of a strongly supported
(96%BS) Zygostates alleniana + Dipteranthus
i-,.i...7i. .. sister to a moderately supported
(75%BS) clade of Hintonella sister to a moderately
supported (85%BS) clade of a polytomy of Eloyella
+ Sphyrastylis dalstromii and a weakly supported
(76%BS) Ornithocephalus ',..i..... + Phymatidium
f d. '. -:

Analysis of the combined plastid matrix of matK/
trnL-F/atpB-rbcL intergenic spacer- The combined
matrix consisted of4082 characters, ofwhich 1112 were
variable and 520 (13%) were potentially parsimony
informative. The analysis yielded four trees of 1634
steps [CI=0.79 (0.65 with uninformative characters
excluded), RI=0.80]. The combined matrix yielded a
tree which most resembles the matK only results, but
with better resolution and stronger support for several
clades. Figure 5 shows one tree with branch lengths
above the lines and bootstrap values below the lines.
Telipogon alliance: The Telipogon alliance is
strongly supported (94%BS) with If-:..,..... .r +
the Trichoceros clade (100%BS) sister to the strongly
supported (100%BS) remainder of the alliance, which
forms two strongly supported clades: a strongly
supported (100%BS) Telipogon ariasii-pulcher-
dalstromii clade, and the strongly supported (100%BS)
remainder. The latter clade has two supported clades:
a weakly supported clade (59%BS) consisting of the
strongly supported (100%BS) South America clade of
three species of Stellilabium + the strongly supported
(100%BS) Telipogon nervosus-vargasii clade; and
the moderately supported (86%BS) Central American
two groups of Telipogon (100%BS) and Stellilabium
(100%BS). Within the Central American Telipogon
clade, T parvulus is sister to the moderately supported
(79%BS) other five species, and within that five species
group only T panamensis is resolved. Within the
Central American Stellilabium clade, S. bullpenense is


sister to the strongly supported (96%BS) clade of S.
aciculare + (S. barbozae + S. monteverdense 96%BS).
Ornithocephalus alliance: This strongly supported
alliance (100%BS) has two major clades: Zygostates
alleniana + Dipteranthus i-,.i.:..*i. ... with 100%BS
support is sister to a strongly supported (96%BS) clade
within which Phymatidium is sister to a moderately
supported (83%BS) trichotomous clade ofEloyella +
Hintonella + a moderately supported (71%BS) clade
of Ornithocephalus .. i...i + Sphyrastylis dalstromii.

Analysis of the combined ITS/plastid data set
- The combined nuclear and plastid matrix had 4859
characters, of which 1487 were variable and 821 (17%)
were potentially parsimony informative. The analysis
yielded 30 trees of 2568 steps [CI 0.71 (0.59 with
uninformative characters excluded), RI=0.79]. Figure
6 shows one of the trees obtained.
Telipogon alliance: The strongly supported(98%BS)
Telipogon alliance consists of IH.I ;.. ..... i.. and the
Trichoceros clade (100%BS) forming a p: ..i. i. 1li,
the strongly supported (97%BS) remainder of the
alliance, which has two major clades: the Telipogon
ariasii-pulcher-dalstromii clade with 100%BS and the
remainder of the alliance with 100%BS. The Telipogon
nervosus-vargasii clade (100%BS), the clade of three
South American species of Stellilabium (100%BS) and
the strongly supported (94%BS) Central American
Stellilabium clade (100%BS) + Central American
Telipogon clade (100%BS) form a trichotomy. The
Central American Stellilabium clade has S. bullpenense
sister to a weakly supported (67%BS) three species
clade, within which is the strongly supported
(100%BS) S. barbozae-monteverdense clade. The
Central American Telipogon clade has T butcher
sister to the strongly supported (96%BS) remaining
five unresolved species.
Ornithocephalus alliance: This strongly supported
(100%BS) alliance consists of Phymatidium sister to
a weakly supported (57%BS) clade of the remainder
which consists of a strongly supported (100%BS)
Zygostates alleniana + Dipteranthus -,.i..:..ii.,,.
sister to a strongly supported (100%BS) trichotomy of
Eloyella +Hintonella+ a strongly supported (100%BS)
clade of Ornithocephalus ,.. ....*i + Sphyrastylis
dalstromii.

Bayesian analysis of the combined ITS/plastid
data set Figure 7 is the tree obtained by Bayesian
analysis of the combined plastid and ITS data sets.
The monophyly of the Telipogon and Ornithocephalus
alliances is supported by 100% posterior probability


Vol. 5, No 3








WILLIAMS et al. -Molecular systematics of Telipogon


of each alliance. Strongly supported clades within
the Telipogon alliance, as indicated by 100% posterior
probability, are: Trichoceros; Telipogon + Stellilabium;
the Telipogon ariasii-pulcher-dalstromii clade; the
Telipogon nervosus-vargasii clade; the SouthAmerican
Stellilabium clade; the Central American Stellilabium
clade; and the Central American Telipogon clade.
The Ornithocephalus alliance shows 100% posterior
probability support for Ornithocephalus :i,.. ,i.
+ Sphyrastylis dalstromii as well as for Eloyella +
Hintonella + Ornithocephalus + Sphyrastylis and for
Zygostates alleniana + Dipteranthus -,. .. :.i.i.., .

Expanded ITS analysis of 81 taxa in Telipogon,
Ornithocephalus, Pachyphyllum alliances The
ITS only matrix had 682 characters, of which 414 were
variable and 352 (52%) were potentially parsimony
informative. The analysis yielded 251 trees of 1333
steps [CI=0.49 (0.46 with uninformative characters
excluded), RI=0.89]. Figure 8 shows one tree with
bootstrap values and branch lengths. This expanded
ITS analysis includes an additional eleven species
of the Ornithocephalus alliance and allows us to
place IIf. ;..,. ... ii.'r with the Telipogon alliance and
not with the Ornithocephalus alliance with more
confidence. The bootstrap analysis, with Lockhartia as
the outgroup, shows a strongly supported (100%BS)
group of three clades: the strongly supported (96%BS)
Ornithocephalus alliance; the strongly supported
(100%BS) T. I., i,, *..,., alliance; and the moderately
supported (78%BS) Telipogon alliance. The Telipogon
alliance has three parts: 1) a strongly supported
(100%BS) Trichoceros clade; 2) a moderately
supported (90% BS) Telipogon clade of SouthAmerican
species; and 3) a moderately supported (78%BS)
clade of IH- i;... ".. .....i sister to a strongly supported
(100%BS) clade comprised of Stellilabium and the
remaining species of Telipogon.
The first clade, Trichoceros, is still under study and
will not be discussed further at this time. The second
clade, the Telipogon venustus-T ariasii group, is
strictly South American. Two accessions of T venustus
are sister to polytomy of T valenciae and the T
ariasii-T falcatus clade. Within this latter clade (with
86%BS), T falcatus is sister to a strongly supported
clade (100%BS) of eight species. Telipogon ariasii-T.
frymirei have 91 %BS and T chrysocrates-T andicola
have 87%BS.
This third clade consists of a strongly supported
(100%BS) South American clade of Telipogon
klotzscheanus-nern ...-1... ,,. i... sister to a clade with
moderate support (74%BS) consisting of a strongly


supported (100%BS) South American Stellilabium
clade and a moderately supported (84%BS) clade of
two Central American groups: a strongly supported
(100%BS) clade of Stellilabium species and a strongly
supported (98%BS) clade of Telipogon species. The
Central American Stellilabium clade of six species
consists of a strongly supported clade (100)%BS) of
S. aciculare, S. smaragdinum, and a species from the
Dominican Republic (Stellilabium sp. n660, recently
described by Ackerman, 2004, as a new species of
Telipogon) sister to a weakly supported (63%BS)
clade of(S. barbozae + monteverdense 100%BS) + S.
bullpenense. The Central American Telipogon clade
consists of T butcheri sister to a strongly supported
(100%BS) clade of the remaining 18 species of
Telipogon. Within the large clade of 18 species, the only
groups resolved are the following: two accessions of T
parvulus with 99%BS; T griesbeckii (two accessions)
+ T olmosii with 58%BS; and a six species group with
64%BS which includes a weakly supported (63%BS)
two species clade of T panamensis and T personatus.

Ornithocephalus alliance: This expanded ITS
analysis of the Ornithocephalus alliance with 96%BS
support has two accessions ofPhymatidiumfrn *i-. .,
sister to a moderately supported (90%BS) remainder
of the alliance. This group includes a strongly sup-
ported (100%BS) clade of Eloyella, Hintonella, and
(C:, 1.... .- ..t sister to a strongly supported (100%BS)
clade of Ornithocephalus and Sphyrastylis species.
This latter clade has Sphyrastylis embedded within
Ornithocephalus. The second major clade in this alli-
ance is the strongly supported (99%BS) Zygostates +
Dipteranthus clade. Within this clade, D. pellucidus is
sister to a clade with 70%BS of D. ....'di. 7.. .. sister
to a strongly supported (100%BS) D. obliquus + Z. lu-
nata + Z. alleniana clade.

DISCUSSION

Molecular analyses -An analysis of 634 species in
the Oncidiinae for ITS and 252 species for ITS/matK/
trnL-F (Williams et al. 2001a,b, Williams & Whitten
2003, and unpublished) established that the Telipogon
.. 7: .. i .:11. Ornithocephalus Lockhartia alliances
are sister groups embedded within the Oncidiinae.
These earlier works and data reported here establish
that IIf i:.. i.. .. i. is a part of the Telipogon alliance.
Taxonomic implications in the Telipogon alliance
-Garay and Romero (1998) reinstated the genus
Dipterostele Schltr. for a number of species of
Stellilabium. We sampled one of those species, S.


LANKESTERIANA5(3):








LANKESTERIANA


hystrix, which Dressier (1999) places in Stellilabium
sect. Dipterostele. The molecular data (100% bootstrap
support for four genes, 100% posterior probability
from Bayesian analysis) place S. hystrix as sister to
a clade with Stellilabium pogonostalix, a species
Dressler places in Stellilabium sect. Stellilabium and
which Garay and Romero do not place in Dipterostele.
Furthermore, the large analysis of ITS places S.
hystrix within a clade containing S. boliviense and
S. pogonostalix (Fig. 8) and five Ecuadorian species,
which shows that Stellilabium section Dipterostele is
not monophyletic. Dressler (1999) discusses a number
of characters that distinguish these two sections of
Stellilabium, and if Dipterostele were recognized, then
the South American species of Stellilabium would have
to be placed in at least three distinct genera. Stellilabium
is not monophyletic (Figs. 1-8) and is embedded within
Telipogon. Unless Telipogon is broken into three genera
and Stellilabium into at least two genera representing
the Central American clade and the South American
clade (many more if Dipterostele is recognized),
there is no way to have a monophyletic group without
merging all of these groups into Telipogon. Dressler's
Stellilabium sect. Taeniorhachis is not monophyletic
and has Stellilabium sect. Rhamphostele embedded
within it. At this time, more taxa are needed to resolve
relationships of species usually placed in Stellilabium,
but the "Stellilabium habit," which is essentially small
flowers and a tendency to leaflessness at maturity, has
arisen at least twice, once in South America and once
in Central America, possibly from two different groups
of KTihIgnii
Braas and Liickel (1982) based their genus
Darwiniella on Trichoceros ,. .-!. Garay & Dunst.
(Dunsterville & Garay 1972), and Dressier (1999)
states that it "is surely a robust member of this group",
referring to Stellilabium sect. Stellilabium. Material of
this species has not been available, but Dodson (2004)
considers Darwiniella a synonym of Stellilabium.
The species listed as Stellilabium sp. D. Dod 168 from
the Dominican Republic in the 81 OTU ITS analysis
was initially identified as S. ,,.. .....i.:7. ..,. (Kraenzl.)
Garay, but Ackerman has concluded that it is a new
species and has named it Telipogon niri Ackerman in
a separate publication (Ackerman 2004). This is the
only species of the Telipogon alliance known from the
Caribbean area.
Telipogon consists of three groups: 1) a Central
American clade from Panama and Costa Rica; 2)
one South American clade of Telipogon klotzs-
cheanus-nervosus-vargasii; and 3) a second South
American clade of T. venustus and the T. ariasii-va-


lenciae complex. The combined plastid/ITS analysis
places II I,:...... i...i sister to all of the combined
Telipogon + Stellilabium clades, with Trichoceros sis-
ter to this group (Fig. 6). If Stellilabium is combined
with Telipogon, IIf-:. ; i.. i. r must also be placed in
Telipogon. Although Trichoceros is vegetatively dis-
tinct from the other members of the Telipogon alliance,
the flowers are an extreme manifestation of the pseu-
docopulation / mimicry pollination complex of char-
acters. We prefer to maintain it as a separate genus
because of the distinctive vegetative morphology and
easily recognized field characters, such as the distinc-
tive gray-green sheen of the succulent leaves, the dis-
tinct pseudobulbs, and the rambling, vine-like habit.
Atthis time we make formaltransfers below of species
of Stellilabium to Telipogon. Ackerman has already
made one such combination in naming Telipogon niri
Ackerman in a separate publication (Ackerman 2004)
for a species from the Dominican Republic shown in
Fig. 8 as Stellilabium sp. D. Dod 168. In essence, most
of the species of Stellilabium are just small versions of
Telipogon that often become leafless at maturity.


Nomenclatural Changes

Telipogon acicularis (Dressier) N.H. Williams &
Dressier, comb. nov.
Basionym: Stellilabium aciculare Dressier, Harvard
Pap. Bot. 4(2): 471-472, f. 1E-F 1999.

Telipogon alticola (Dodson & R. Escobar) N.H.
Williams & Dressier, comb. nov.
Basionym: Stellilabium alticolum Dodson & R.
Escobar, Orquideologia 20(1): 48. 1998.

Telipogon anacristinae (Pupulin) N.H. Williams &
Dressier, comb. nov.
Basionym: Stellilabium anacristinae Pupulin,
Harvard Pap. Bot. 8(1): 30, f. 1A-G. 2003.

Telipogon andinus (L.O. Williams) N.H. Williams
& Dressier, comb. nov.
Stellilabium andinum (L.O. Williams) Garay &
Dunst., Orchids Venezuela: 1004. 1979.
Basionym: Cordanthera andina L.O. Williams,
Lilloa 6: 244. 1941.

Telipogon astroglossus Rchb. f., Xenia Orchid. 1: 16,
t. 7, f. II, 12-19. 1854.
SStellilabium astroglossum (Rchb. f.) Schltr., Die
Orchideen 530. 1914.


Vol. 5, No 3








WILLIAMS et al. -Molecular systematics of Telipogon


The epithet atropurpurea is occupied in Telipogon
by Telipogon atropurpurea D.E. Benn. & Ric.
FernAndez, Publ. Mus. Hist. Nat. Univ. Nacion.
Mayor San Marcos, Bot. 36: 9 (1992), and/or by
Telipogon atropurpurea D.E. Benn. & Ric. FernAndez,
Orquideophilo 5: 27 (1997). Either way, a new name
is needed for the species known as Stellilabium
atropurpureum P. Ortiz, Orquideologia 23(1): 24
(31), (2004), and we publish here the following name
for this species:

Telipogon ortizii N.H. Williams & Dressier, nom. nov.

The epithet honors Pedro Ortiz, who named the
species originally.

Telipogon barbozae (J.T. Atwood & Dressier) N.H.
Williams & Dressier, comb. nov.
Basionym: Stellilabium barbozae J.T. Atwood &
Dressier, Selbyana 16(2): 239, f. 1. 1995.

Telipogon bennettii (Dodson & R. Escobar) N.H.
Williams & Dressier, comb. nov.
Stellilabium bennettii (Dodson & R. Escobar)
Christenson, Icon. Orchid. Peruviarum pl. 773.
2001.
Basionym: Trichoceros bennettii Dodson & R.
Escobar, Icon. Pl. Trop. II (2): t. 195. 1989.

Telipogon bergoldii (Garay & Dunst.) N.H.Williams
& Dressier, comb. nov.
Stellilabium ,. 4.. ..: (Garay & Dunst.) Carnevali
& G.A. Romero, in G.A. Romero & G. Carnevali,
Orchids Venezuela, ed. 2: 1147. 2000.
Darwiniella ,.'.. !../.: (Garay & Dunst.) Braas
& Lickel, Die Orchidee 33(5): 169. 1982, nom.
illeg.
Darwiniera ,.'. ./.. (Garay & Dunst.) Braas &
Lickel, Die Orchidee 33 (6): 212. 1982.
Basionym: Trichoceros ,.' . -./..- Garay & Dunst.,
Venez. Orchids Ill. 5: 310. 1972.

Telipogon boliviensis (R. Vasquez & Dodson) N.H.
Williams & Dressier, comb. nov.
Basionym: Stellilabium boliviense R. VAsquez &
Dodson, Icon. P1. Trop. 6: t. 592. 1982.

Telipogon boylei (J.T. Atwood) N.H. Williams &
Dressier, comb. nov.
Basionym: Stellilabium boylei J.T. Atwood, Icon.
P1. Trop. 14: t. 1392. 1989.

Dipterostele boylei (J.T. Atwood) Garay & G.A.


Romero, Harvard Pap. Bot. 3: 57. 1998.

Telipogon bullpenensis (J.T. Atwood) N.H. Williams
& Dressier, comb. nov.
Basionym: Stellilabium bullpenense J.T. Atwood,
Icon. P1. Trop. 14: t. 1393. 1989.

The epithet butcheri is occupied in Telipogon by
Telipogon butcheri Dodson & R. Escobar, Orquide-
ologia 18: 278 (1993) and the species known as
Stellilabium butcheri Dressier, Harvard Pap. Bot. 4(2):
472-473, f. 1G (1999) needs a new name. Telipogon
chiriquensis is already taken and T panamensis is tak-
en. We publish here the following name for the species
known as Stellilabium butcheri Dressier:

Telipogon butchii N.H. Williams & Dressier, nom. nov.

The specific epithet refers to the affectionate nick-
name used by everyone who knew Henry Butcher.


Telipogon campbelliorum (J.T. Atwood) N.H.
Williams & Dressier, comb. nov.
Basionym: Stellilabium campbelliorum J.T. Atwood,
Icon. P1. Trop. 14: t. 1394. 1989.

Telipogon distantiflorus (Ames & C. Schweinf.) N.H.
Williams & Dressier, comb. nov.
Basionym: Stellilabium :'..,..-i' i .i.l.. Ames & C.
Schweinf., Sched. Orchid. 8: 70. 1925.
Dipterostele :....:.n6i. .,,..' (Ames & C. Schweinf.)
Garay & G.A.Romero, Harvard Pap. Bot. 3: 57.
1998.

Telipogon erratus (Dressier) N.H. Williams &
Dressier, comb. nov.
Basionym: Stellilabium erratum Dressier, Lankes-
teriana: 2: 11-13, f. 1. 2001.

Telipogon fortunae (Dressier) N.H. Williams &
Dressier, comb. nov.
Basionym: Stellilabium fortunae Dressier, Harvard
Pap. Bot. 4(2): 473, f. 1B-D. 1999.


The epithet frymirei is occupied in Telipogon by
Telipogon frymirei Dodson, Icon. P1. Trop. 10: t. 991
(1984), and the species known as Stellilabiumfrymirei
Dodson, Icon. P1. Trop. 5: t. 495 (1982) needs a new
name. We publish here the following name for this
species:


LANKESTERIANA5(3):








LANKESTERIANA


Telipogon embreei N.H. Williams & Dressier, nom. nov.

The epithet honors the late Alvin Embree, who
accompanied us on many field trips, found numerous
new species of orchids, and was present at the
collection of the type specimen of this species.

Dipterostele frymirei (Dodson) Garay & G.A.
Romero, Harvard Pap. Bot. 3: 57. 1998.


Telipogon helleri (L.O. Williams) N.H. Williams &
Dressier, comb. nov.
Basionym: Stellilabium helleri L.O. Williams,
Brittonia 14: 443. 1962.
Dipterostele helleri (L.O. Williams) Garay & G.A.
Romero, Harvard Pap. Bot. 3: 57. 1998.

The epithet hirtzii is occupied in Telipogon by
Telipogon hirtzii Dodson & R. Escobar, Icon. P1.
Trop. II (6): t. 590 (1989) and the species known as
Stellilabium hirtzii Dodson, Icon. P1. Trop. 10: pl.
982 (1984) needs a new name. We publish here the
following name for this species:

Telipogon alexii N.H. Williams & Dressier, nom. nov.

The epithet honors the same person.

Telipogon hystrix (Dodson) N.H. Williams &
Dressier, comb. nov.
Basionym: Stellilabium hystrix Dodson, Icon. P1.
Trop. 5: t. 496. 1982.
Dipterostele hystrix (Dodson) Garay & G.A.
Romero, Harvard Pap. Bot. 3: 57. 1998.

Telipogon ibischii (R. Vasquez) N.H. Williams &
Dressier, comb. nov.
Basionym: Stellilabium ibischii R. VAsquez, Lind-
leyana 13(2): 61. 1998.

Telipogonjostii (Dodson) N.H.Williams & Dressier,
comb. nov.
Basionym: Stellilabium jostii Dodson, Nat. Ecuad.
Orch. 5: 1180.2004.

Telipogon lankesteri Ames, Sched. Orchid. 3: 23.
1923.
Stellilabium lankesteri (Ames) Dressier, Novon
7(2): 124. 1997.
Dipterostele lankesteri (Ames) Garay & G.A.
Romero, Harvard Pap. Bot. 3: 57. 1998.


The epithet lueri is occupied in Telipogon by


Telipogon lueri Dodson & D.E. Benn., Icon. P1.
Trop. II(2): t. 190 (1989), and the species known as
Stellilabium lueri Dodson & R. VAsquez, Icon. P1. Trop.
II(4): t. 381 (1989) needs a new name. We publish here
the following name for this species:

Telipogon calueri N.H. Williams & Dressier, nom. nov.

The epithet refers to the first two initials of the name
of the same person, Carl A. Luer.

Dipterostele lueri (Dodson & R. VAsquez) Garay &
G.A. Romero, Harvard Pap. Bot. 3: 57. 1998.

Telipogon microglossus (Schltr.) N.H. Williams &
Dressier, comb. nov.
Stellilabium microglossum (Schltr.) Dodson, Icon.
P1. Trop. 4: pl. 334. 1980.
Basionym: Dipterostele microglossa Schltr., Repert.
Spec. Nov. RegniVeg. 8: 106. 1921.

Telipogon ,.:....,.:f.... Kraenzl, Ann. Naturhist.
Hofmus. 33: 14. 1920.
Stellilabium ,ii, :-6i. *i-, .. (Kraenzl.) Garay, J.Arnold
Arbor. 50: 446. 1969.
Dipterostele ;,.:...i. :.,.r (Kraenzl.) Schltr., Repert.
Spec. Nov. RegniVeg. Beih. 19: 70. 1923.

Telipogon monteverdensis (J.T. Atwood) N.H.
Williams & Dressier, comb. nov.
Basionym: Stellilabium monteverdense J.T. Atwood,
Icon. P1. Trop. 14: t. 1395. 1989.

Telipogon morganiae (Dodson) N.H. Williams &
Dressier, comb. nov.
Basionym: Stellilabium morganiae Dodson, Icon. P1.
Trop. 1: t. 335. 1980.
Dipterostele morganiae (Dodson) Braas & Liickel,
Die Orchidee 33: 175. 1982.

Telipogon morii (Dressier) N.H.Williams & Dressier,
comb. nov.
Basionym: Stellilabium morii Dressier, Harvard Pap.
Bot. 4(2): 473, fig. 1H. 1999.

Telipogon pampatamboensis (Dodson & R. Vasquez)
N.H. Williams & Dressier, comb. nov.
Basionym: Stellilabium pampatamboense Dodson &
R. VAsquez, Icon. P1. Trop. II(4): t. 382. 1989.

Telipogon perlobatus (Senghas) N.H. Williams &
Dressier, comb. nov.
Basionym: Stellilabium perlobatum Senghas, J.


Vol. 5, No 3








WILLIAMS et al. -Molecular systematics of Telipogon


Orchideenfreund 1: 172. 1994.

The species known as Stellilabium peruvianum
D.E. Benn. & Christenson, Lindleyana 13(2): 86-
88, f. 30 (1998) needs a new name, as the epithet is
used in Telipogon already by Telipogon peruvianus
T. Hashim., Bull. Natl. Sci. Mus., Tokyo, B 16: 21
(1990). We publish here the following name for the
species known as Stellilabium peruvianum D.E. Benn.
& Christenson:

Telipogon selbyanus N.H. Williams & Dressier, nom. nov.

The epithet honors the Marie Selby Botanical
Gardens, an organization which has promoted the
scientific study of orchids for three decades.

Telipogon pogonostalix Rchb.f, Linnaea 41: 72. 1876.
Stellilabium pogonostalix (Rchb. f.) Garay & Dunst.,
Venez. Orchids Ill. 2: 336. 1961.
Sodiroella ecuadorensis Schltr., Repert. Spec.
Nov. Regni Veg. Beih. 8: 108. 1921, is a synonym
according to Dodson (1998: 50-51).

Telipogon pseudobulbosus (D.E. Benn. & Christ-
enson) N.H. Williams & Dressier, comb. nov.
Basionym: Stellilabium pseudobulbosum D.E. Benn.
& Christenson, Lindleyana 13(2): 88, f. 31. 1998.

Telipogon smaragdinus (Pupulin & M.A. Blanco)
N.H. Williams & Dressier, comb. nov.
Basionym: Stellilabium smaragdinum Pupulin &
M.A. Blanco, Lankesteriana 5: 28-30. 2002.

Telipogon standleyi Ames, Sched. Orch. 9: 53, f.
9. 1925.
Stellilabium standleyi (Ames) L.O. Williams,
Brittonia 14: 46. 1962.
Dipterostelestandleyi (Ames) Garay & G.A. Romero,
Harvard Pap. Bot. 3: 58. 1998.

Telipogon tanii (Dodson) N.H. Williams & Dressier,
comb. nov.
Basionym: Stellilabium tanii Dodson, Icon. P1. Trop.
1: t. 337. 1980.
Possibly Stellilabium astroglossum (Rchb.f.) Schltr.,
Orchideen: 530. 1914,fide Kew Monocot List
Dipterostele tanii (Dodson) Garay & G.A. Romero,
Harvard Pap. Bot. 3: 58. 1998.

Telipogon tsipiriensis (Pupulin) N.H. Williams &
Dressier, comb. nov.
Basionym: Stellilabium tsipiriense Pupulin, Harvard


Pap. Bot. 8(1): 30, f. 2A-H, L. 2003.

The epithet vasquezii is occupied in Telipogon by
Telipogon vasquezii Dodson, Selbyana 7: 358 (1984),
and the species known as Stellilabium vasquezii
Dodson, Icon. P1. Trop. 6: t. 593 (1982) needs a new
name. There is already (or will be, see above) a
Telipogon boliviensis, so we publish here the following
name for the species known as Stellilabium vasquezii
Dodson:

Telipogon roberti N.H. Williams & Dressier, nom. nov.

The epithet honors the same person, but refers to his
first name, Roberto, latinized as Robertus (Genitive
Roberti).

Dipterostele vasquezii (Dodson) Garay & G.A.
Romero, Harvard Pap. Bot. 3: 58. 1998.
Non Telipogon vasquezii Christenson, Icon. Orchid.
Peruv.: t. 784. 2001, nom. illeg.

The epithet vulcanicum is occupied in Telipogon by
Telipogon vulcanicum Dodson & Hirtz, Nat. Ecuad.
Orch. 5: 1186 (2004), thus the species known as
Stellilabium vulcanicum Dodson & Hirtz, Nat. Ecuad.
Orch. 5: 1181 (2004) needs a new name. We publish
here the following name for this species:

Telipogon reventadorensis N.H. Williams & Dressier,
nom. nov.

The epithet refers to the location (Volcan Reventador,
Ecuador) where the type was collected.


The work reported here .k !ii i,,1, establishes that
HII.J I, ..,... i.Jr is not associated with members of
the Ornithocephalus alliance as Szlachetko (1995)
suggested, but rather is firmly associated with the
Telipogon alliance in the Oncidiinae. Reichenbach
originally placed this species in his genus Hofmeistera
(De Pollinis Orchidearum 30. 1852), but later in
the same year ,pp ii,.ill, decided that this name
was too close to Hofmeisteria Walp. [published in:
Repertorium Botanices Systematicae 6: 106. 1846
("1847") as a member of the Asteraceae], and re-
named it II. i.. ,.. .
The current work (as well as previous work, Whitten
et al. 2000, Williams et al. 2001 a, b, Whitten et al.
2005) shows that the Fernandezia / Pachyphyllum
group is associated with these alliances, rather than with
Dichaea as Szlachetko (1995) suggested. Fernandezia
and i. 7I.. ... 77,, form a clade with 100%BS in the 81


LANKESTERIANA5(3):








LANKESTERIANA


taxon ITS analysis. A more comprehensive study of the
Fernandezia / F. i :. .- i., ,b.' group is underway.

Taxonomic implications in the Ornithocephalus
alliance -Toscano de Brito and Dressier (2000) trans-
ferred all species of Sphyrastylis to Ornithocephalus
based on morphological studies, and studies ofpollina-
rium morphology and leaf anatomy also supported this
transfer (Toscano de Brito 1994, 1998). The molecular
data presented here (Fig. 8) confirm this decision. In
the ITS trees Zygostates is nested within Dipteranthus,
but until we have a more comprehensive study of the
Ornithocephalus alliance we refrain from making these
nomenclatural changes.

Biogeographic implications -The Central Amer-
ican Telipogon clade (Fig. 8) has very little sequence
divergence for ITS, and only moderate sequence
divergence for the combined plastid regions. The
Stellilabium component of this clade has more ITS
divergence among species than the Telipogon compo-
nent. The lack of sequence divergence in the Telipogon
component suggests rapid evolution of this group from
a South American introduction.

ACKNOWLEDGMENTS. We thank Mario Blanco, Stig
Dalstrom, Ron Determann, Calaway H. Dodson,
Lorena Endara, Gtinter Gerlach, Cordelia Head, Andres
Maduro, Erich Michel, Jos6 Portilla, Franco Pupulin,
Gustavo Romero, and Jorge Warner for plant specimens
and access to collections. We thank Wendy Zomlefer
for many constructive comments on the manuscript.
This work was supported by NSF grants DEB 9815821
to NHW and DEB 9509071 to WMW, by grants from
the American Orchid Society Fund for Education and
Research, and the Florida Museum of Natural History.


LITERATURE CITED
Ackerman, J.D. 2004. Notes on the Caribbean orchid
flora. V New species, combinations and records.
Lankesteriana 4: 47-56.
Braas, L.A. & E. Lickel. 1982. Darwiniella, eine neue
Gattung der Subtribus Telipogoninae Schltr. Die
Orchidee 33: 167-176.
Chiang, T.Y, B.A. Schaal & C.I. Peng. 1998.
Universal primers for amplification and sequencing
a noncoding spacer between the atpB and rbcL
genes of chloroplast DNA. Bot. Bull. Acad. Sin.
39: 245-250.
Dodson, C.H. 1998. New orchid species and combi-
nations from Ecuador-Fascicle 6. Orquideologia


21: 3-60.
Dodson, C.H. 2004. Native Ecuadorian Orchids 5:
1014.
Dressier, R.L. 1993. Phylogeny and Classification of
the Orchid Family. Dioscorides Press. Portland,
OR. 314 p.
Dressier, R.L. 1999. A reconsideration of Stellilabium
and Dipterostele. Harvard Pap. Bot. 4: 469-473.
Dunsterville, G.C.K. & L.A. Garay. 1972. Venezuelan
Orchids Illustrated 5: 310.
Fitch, W.M. 1971. Toward defining the course of
evolution: minimal change for a specific tree
topology. Syst. Zool. 20: 406-416.
Garay, L.A. & G.A. Romero-Gonzalez. 1998.
Schedulae Orchidum. Harvard Pap. Bot. 3: 53-62.
Huelsenbeck, J.P & F. Ronquist. 2001. MrBayes:
Bayesian inference of phylogenetic trees.
Bioinformatics 17: 754-755.
Sun, Y, D.Z. Skinner, G.H. Liang & S.H. Hulbert.
1994. Phylogenetic analysis of Sorghum and related
taxa using internal transcribed spacers of nuclear
ribosomal DNA. Theor. Appl. Genet. 89: 26-32.
Swofford, D.L. 2000. PAUP*: Phylogenetic Analysis
Using Parsimony (*and Other Methods). Version
4.0b2. SinauerAssoc., Sunderland, Mass.
Szlachetko, D.L. 1995. System Orchidalium. Fragm.
Flor. Geobot. Suppl. 3: 1-152.
Taberlet, P, L. Gielly, G. Pautou & J. Bouvet. 1991.
Universal primers of amplification of three non-
coding regions of chloroplast DNA. P1. Mol. Biol.
17: 1105-1109.
Toscano de Brito, A.L.V 1994. Systematic studies
in the subtribe Omithocephalinae (Orchidaceae).
Ph. D. thesis, University of Reading, Reading,
England.
Toscano de Brito, A.L.V 1998. Leaf anatomy of
Omithocephalinae (Orchidaceae) and related
subtribes. Lindleyana 13: 234-258.
Toscano de Brito, A.L.V & R.L. Dressier.
2000. New combinations in Ornithocephalus
(Omithocephalinae: Orchidaceae) and description
of a new species from Mesoamerica. Lindleyana
15: 252-256.
Whitten, W.M., N.H. Williams & M.W. Chase. 2000.
Subtribal and generic relationships of Maxillarieae
(Orchidaceae) with emphasis on Stanhopeinae:
combined molecular evidence. Amer. J. Bot. 87:
1842-1856.
Whitten, WM., N.H. Williams, R.L. Dressier, G.
Gerlach & F. Pupulin. 2005. Generic relationships of
Zygopetalinae (Orchidaceae: Cymbidieae): combined
molecular evidence. Lankesteriana 5: 87-108.


Vol. 5, No 3








WILLIAMS et al. -Molecular systematics of Telipogon


Williams, N.H., M.W. Chase, T. Fulcher & W.M.
Whitten. 2001a. Molecular systematics of the
Oncidiinae based on evidence from four DNA
sequence regions: expanded circumscriptions
of Cyrtochilum, Erycina, Otoglossum, and
Trichocentrum and a new genus (Orchidaceae).
Lindleyana 16: 113-139.
Williams, N.H., M.W. Chase & W.M. Whitten. 2001b.


Table 1.Vouchers and GenBank accessions.


Phylogenetic position of Miltoniopsis, Caucaea,
a new genus, Cyrtochiloides, and relationship of
Oncidium phymatochilum based on nuclear and
chloroplast DNA sequence data (Orchidaceae:
Oncidiinae). Lindleyana 16: 272-285.
Williams, N.H. & W.M. Whitten. 2003. Molecular
phylogenetics and generic concepts in the
Maxillarieae (Orchidaceae). Lankesteriana 7: 61-62.


Table 1. Vouchers and GenBank
accessions.
Taxon Voucher Herb. ITS trnL-F matK atpB-rbcL
spacer
S.. ..... .' marileoniae Rchb.f. Whitten 2949 FLAS DQ315817

Dipteranthus ;.....'.-r...., (Lindl.) Pabst Chase 103 K AF350508 AF350666 AF350587
Dipteranthus obliquus (Schnee) Garay Gerlach FLAS D
& Dunst. 93/3251
Dipteranthus pellucidus (Rchb.f.) Cogn. Whitten 2792 FLAS DQ315819

Eloyella thienii Dodson Whitten 1833 FLAS DQ315820 DQ315916 DQ315888 DQ315792
Fernandezia ionanthera (Rchb.f. & Whitten FLAS A239390 AF239582 AF239486
FLAS AF239390 AF239582 AF239486
Warsz.) Schltr. 97069
Fernandezia sp. Chase 89096 K AF350506 AF350664 AF350585
Fernandezia tica Mora-Ret. & J.B. Maduro 240 MO DQ315821 DQ315917 DQ315889 DQ315793
Garcia
Hintonella mexicana Ames Williams s.n. FLAS DQ315822 DQ315918 DQ315890 DQ315794
i.. ,.. .,'.: eumicroscopica (Rchb. Chase 112 K AF350510 DQ315919 AF350589
f.) Rchb.f. #1
.) Rhb eumicroscopica (Rchb. Whitten 2690 FLAS DQ315823

Lockhartia amoena Endres & Rchb.f. Chase 84101 K AF350515 AF350673 AF350594

Lockhartia oerstedii Rchb.f Whitten s.n. FLAS AF350514 AF350672 AF350593
Ornithocephalus grexanserinus UF98009 FLAS DQ315824
Dressier & Mora-Ret.
Ornithocephalus .,-i,..: Lindl. Blanco 2645 USJ AF350507 AF350665 DQ315891
Gerlach
Ornithocephalus ... Rchb.f. 93/904 M DQ315825

Ornithocephalus kruegeri Rchb.f. 93/3569 M DQ315826

Gerlach
933569 M D31582

Ornithocephalus myrticola Lindl. 92/3881 M DQ315827

Pachyphyllum sp. Chase 87105 K DQ315828

Pachyphyllum sp. Whitten 2313 FLAS DQ315829


LANKESTERIANA5(3):








LANKESTERIANA


Pachyphyllum sp. Whitten 2453 FLAS DQ315830

Pachyphyllum sp. Whitten 1614 FLAS DQ315832 DQ315920 DQ315892 DQ315795

Pachyphyllum sp. Whitten 1703 FLAS DQ315833

Pachyphyllum cuencae Rchb.f. Whitten 2537 FLAS DQ315831

Phymatidiumf,'. i:. .:..; Lindl. Whitten 1831 FLAS DQ315834 DQ315893 DQ315796

Sphyrastylis dalstromii Dodson Williams s.n. FLAS DQ315835 DQ315921 DQ315894 DQ315797

Sphyrastylis escobariana Garay Whitten2693 FLAS AF350509 AF350667 AF350588 DQ315
Dalstrom
Sphyrastylis sp. 2355Dalstrom SEL DQ315836

Stellilabium aciculare Dressier Dressier 3617 MO DQ315837 DQ315922 DQ315896 DQ315798
Stellabium barbozaeAtwood& Pupulin 4710 USJ DQ315838 DQ315923 DQ315897 DQ315799

Stellilabium boliviense R.Vasquez & Dalstrom SEL D
Dodson2397 SEL DQ315839
Dodson 2397
Stellilabium bullpenense Atwood Pupulin 4729 USJ DQ315840 DQ315924 DQ315898 DQ315800

Stellilabium hystrix Dodson Whitten 1824 FLAS DQ315841 DQ315925 DQ315899 DQ315801

Stellilabium monteverdense Atwood Pupulin 4731 USJ DQ315842 DQ315926 DQ315900 DQ315802
Stellilabium pogonostalix (Rchb.f.) Chase 123 K AF350511 AF350669 DQ315901
Garay & Dunst.
Stellilabium smaragdinum Pupulin & Whitten2155 FLAS DQ315844
M.A. Blanco
Stellilabium sp.= Telipogon niri D. Dod 168 NY DQ315843
Ackerman____ __D. Dod 168 NY D__________315843__
Ackerman
Stellilabium sp. Whitten 2530 FLAS DQ315845

Stellilabium sp. Whitten 2531 FLAS DQ315846

Stellilabium sp. Whitten 2532 FLAS DQ315847

Stellilabium sp. Whitten 2533 FLAS DQ315848

Stellilabium sp. Hirtz 7103 QCNE DQ315849 DQ315927 DQ315895 DQ315803

Telipogon :,......., C. Schweinf. Maduro 253 FLAS DQ315850

Telipogon andicola Rchb.f. Escobar 3603 FLAS DQ315851

Telipogon ariasii Dodson & D.E. Benn. Maduro 235 FLAS DQ315852 DQ315928 DQ315902

Telipogon biolleyi Schltr. Maduro 242 FLAS DQ315853 DQ315929 DQ315903

Telipogon ". .. .....* Dressier Maduro 138 FLAS DQ315854
Telipogon butcher Dodson & R. Maduro 208 FLAS DQ315855 DQ315930 DQ315904 DQ315805
Escobar
Telipogon caulescens Dressler #1 Maduro 168 MO DQ315856 DQ315931 DQ315905 DQ315806


Vol. 5, N 3








WILLIAMS et al. -Molecular systematics of Telipogon


Gerlach
Telipogon caulescens Dressier #2 02/3089 M DQ315857
Telipogon chiriquensis Dodson & R. Maduro 192 FLAS DQ315858
Escobar
Telipogon chrysocrates Rchb.f. Escobar 2673 FLAS DQ315859

Telipogon costaricensis Schltr. photo FLAS DQ315860

Telipogon dalstromii Dodson Maduro 233 FLAS DQ315861 DQ315932 DQ315906 DQ315807

Telipogonfalcatus Linden & Rchb.f. Escobar 3353 FLAS DQ315862

Telipogonfrymirei Dodson D79on FLAS DQ315863
Telipogon griesbeckii Dresser #1 Maduro 169 MO DQ315864

Telipogon griesbeckii Dressier #2 Maduro 169 FLAS DQ315865

Gerlach
Telipogon klotzscheanus Rchb.f. 95/3136 FLAS DQ315866
Telipogon maduroi Dresser Maduro 190 MO DQ315867

Telipogon medusae Dressier Maduro 209 MO DQ315868

Telipogon monticola L.O. Williams Maduro 241 MO DQ315869
Gerlach
Telipogon nervous (L.) Druce 94/38 M DQ315870 DQ315933 DQ315907 DQ315808

Telipogon olmosii Dressier Maduro 213 MO DQ315871 DQ315 DQ315
Telipogonpanamensis Dodson & R. Maduro 194 MO DQ315872 DQ315934 DQ315908 DQ315809
Escobar
Telipogon parvulus C. Schweinf. #1 Williams s.n. FLAS DQ315873 DQ315935 DQ315909 DQ315810

Telipogon parvulus C. Schweinf. #2 Maduro 193 PMA AF350513 AF350671 AF350592

Telipogon personatus Dressier Maduro 214 PMA DQ315874
Gerlach 97-
Telipogon pulcher Rchb.f. 3608 M DQ315875 DQ315936 DQ315910 DQ315811

Esioon ebrtii Dodson & R. Maduro 191 PMA DQ315876 DQ315937 DQ315911 DQ315812

Telipogon sp. Whitten 2412 FLAS DQ315877

Telipogon sp. Whitten 2413 FLAS DQ315878
Telipogon valenciae Dodson & R. Escobar 4015 FLAS DQ315879
Escobar
Gerlach
Telipogon vargasii C. Schweinf. 952450 M DQ315880 DQ315938 DQ315912 DQ315813
Hirtz et al.
Telipogon venustus Schltr. #1 2302 FLAS DQ315881
Gerlach
2302 D31588
Telipogon venustus Schltr. #2 03/1489 M DQ315882
Trichoceros .. (Humb. & Whitten 1803 FLAS DQ315883
Bonpl.) Kunthl
Trichoceros muralis Lindl. No voucher DQ315884 DQ315940 DQ315914 DQ315814


LANKESTERIANA5(3):








LANKESTERIANA


Trichoceros ,-...a,-...., Kunth Chase 138 K AF350512 AF350670 AF350591 DQ315

Trichoceros sp. Whitten2353 FLAS DQ315885 DQ315939 DQ315913 DQ315815
Gerlach
Zygostates alleniana Kraenzl. 952428 M DQ315886 DQ315941 DQ315915 DQ315816
Gerlach
Zygostates lunata Lindl. 92/3883 M DQ315887



Table 2. Primers used in this study.
Region Primer name Sequence Reference
ITS forward 17 SE acgaattcatggtccggtgaagtgttcg Sun et al. (1994)
ITS reverse 26 SE tagaattccccggttcgctcgccgttac Sun et al. (1994)
trnL-F forward C cgaaatcggtagacgctacg Taberlet et al. (1991)
trnL-F reverse F atttgaactggtgacacgag Taberlet et al. (1991)
matK forward 56F acttcctctatccgctactcctt Williams et al. (2001)
matK reverse 1520R cggataatgtccaaataccaaata Williams et al. (2001)
atpB-rbcL intergenic spacer atpBmax
atpBm axF ..i ...i.-iI..i- ..11 ..1. .
forward
atpB-rbcL intergenic spacer
atpB-rbL intergeni spaer atpBmaxR tcacaacaacaaggtctactcg
reverse


Table 3. Statistics from PAUP* analyses of separate and combined data matrices for the combined data set of
30 taxa in the Telipogon and Ornithocephalus alliances and 81 OTU's for the ITS only analysis.

matK atpB-rbcL Combined ITS and ITS only
ITS trnL-F olastid
ITS trnL-_spacer plastid 30 taxa 81 OTU's
# included positions in 795 1252 1331 1499 4082 4859 682
matrix
# variable sites 375 298 284 530 1112 1487 414
# phylogenetically 301 149 151 220 520 821 341
informative sites
# of trees (Fitch) 8 1458 4 3 4 30 252
# of steps 914 425 434 761 1634 2568 1311
CI 0.58 0.80 0.76 0.81 0.79 0.71 0.49
CI excluding non-
CI excluding non- 0.54 0.68 0.64 0.65 0.65 0.59 0.46
informative sites
RI 0.79 0.84 0.83 0.75 0.80 0.79 0.88
Ave. # of changes per
variable site (# steps/# 2.44 1.43 1.53 1.44 1.47 1.73 3.17
var. sites)


Vol. 5, No 3








WILLIAMS et al. -Molecular systematics of Telipogon


54 45 Fernandezia tica
25 Pachyphyllum sp. W1614
213
213 Hofmeisterella eumicroscopica
4
Telipogon biolleyi

4 Telipogon caulescens

2 2 Telipogon panamensis
100 L Telipogon seibertii
63 13
98 Telipogon parvulus
I 4 Telipogon butcher
43
3- 49
78 25 Stellilabium aciculare
8960 Stellilabium bullpenense

31 100 47 Stellilabium barbozae
74 100 55 Stellilabium monteverdense
37
47 69 I Stellilabium hystrix
75 24
100 Stellilabium pogonostalix
100100 43
0 Stellilabium sp. H7103

58 Telipogon nervous

42 100 44 Telipogon vargasii
75 78 Telipogon ariasii

82 28 Telipogon pulcher
100 35
Telipogon dalstromii

L52 Trichoceros sp. W2353
10015 Trichoceros muralis
41 7
100 38 Ornithocephalus inflexus
25 100 3 Sphyrastylis dalstromii
43 59 71 Hintonella mexicana

44 100 104 Eloyella thienii
84 63
71 E45 Zygostates alleniana
68
99 100 Dipteranthus grandiflorus
91
Phymatidium falcifolium
50 changes


Fig. 1. One of eight trees for the limited ITS only analysis, with branch lengths (ACCTRAN optimization) above
lines, bootstrap values below lines. Nodes that collapse in the strict consensus tree are indicated with a small
black square.


LANKESTERIANA5(3):







LANKESTERIANA


6
6 Fernandezia tica

Pachyphyllum sp. W1614
35
Hofmeisterella eumicroscopica

68 9 Trichoceros sp. W2353
100 7 Trichoceros muralis
25
3 2 Telipogon ariasii
17 9 Telipogon dalstromii

15 100 4 Telipogon pulcher
15
93 Telipogon biolleyi
STelipogon butcheri

9 Telipogon caulescens
99 Telipogon seibertii

10 Telipogon panamensis
94 Telipogon parvulus
76
3 3 Stellilabium aciculare
69 15 Stellilabium bullpenense

97 8 Stellilabium barbozae
S100 5 Stellilabium monteverdense

11 8 Telipogon nervous
56 100 Telipogon vargasii
4
2 Stellilabium hystrix

13 4 Stellilabium sp. H7103
100 2 Stellilabium pogonostalix

3 1 Ornithocephalus inflexus
7 5 Sphyrastylis dalstromii
5 59 15 Hintonella mexicana

18 d77 39 Eloyella thienii

100 9 11 Zygostates alleniana
S24
96 Dipteranthus grandiflorus
-- 5 changes
Fig. 2. One of 1458 trees for the limited trnL-F only analysis, with branch lengths (ACCTRAN optimization)
above lines, bootstrap values below lines. Nodes that collapse in the strict consensus tree are indicated with a
small black square.


Vol. 5, No 3








LANKESTERIANA5(3): WILLIAMS et al. -Molecular systematics of Telipogon 179


,8 Fernandezia tica

Pachyphyllum sp. W1614

3
Hofmeisterella eumicroscopica

10 3 Trichoceros sp. W2353
100 2 Trichoceros muralis
4 4
62 2 Telipogon ariasii
19 11 Telipogon dalstromii
100 3
4 13 Telipogon pulcher
53 2
Telipogon biolleyi
5
Telipogon butcheri

13 Telipogon caulescens
6 100 Telipogon panamensis
88 2
STelipogon parvulus

4 Telipogon seibertii
83 7
Stellilabium aciculare

75 Stellilabium barbozae
14 13 91 5
4- 7 _100 Stellilabium monteverdense
100 7-- 100 7
100
99 Stellilabium bullpenense

9 12 Telipogon nervous
9 Telipogon vargasii
2 14
66 3 Stellilabium hystrix
17 IV 5- Stellilabium pogonostalix
100 I 10
Stellilabium sp. H7103

5 18 Omithocephalus inflexus
S 8 Sphyrastylis dalstromii
10 I 9
Hintonella mexicana
3 I 20
Eloyella thienii

10 i --11 Phymatidium falcifolium
99 20
8 -- Zygostates alleniana
99-_ 22
9 2e Dipteranthusran srandiflorus
5 changes


Fig. 3. One of four trees for the limited matK only analysis, with branch lengths (ACCTRAN optimization) above
lines, bootstrap values below lines. Nodes that collapse in the strict consensus tree are indicated with a small
black square.







LANKESTERIANA


11
Fernandezia tica

Pachyphyllum sp. W1614
61
61 Hofmeisterella eumicroscopica

Telipogon biolleyi

70 Telipogon butcher
Telipogon caulescens
3
82- 1 Telipogon seibertii
17 12
100 Telipogon panamensis
STelipogon parvulus
018 Stellilabium aciculare

S21 Stellilabium barbozae


Stellilabium bullpenense
16
14 Telipogon nervous
100O 2 Telipogon vargasii
-31 9
S 25 8 Stellilabium hystrix
68 / 81 5
21 Stellilabium pogonostalix

SStellilabium sp. H7103

16 6 Telipogon dalstromii
100 5 Telipogon pulcher

r Trichoceros sp. W2353.
L 7
99 98 [ Trichoceros muralis

12 Ornithocephalus inflexus
S76 43 Phymatidium falcifolium

85 8 18 Sphyrastylis dalstromii

73 Eloyella thienii
12 26 Hintonella mexicana
88 13
887 Zygostates alleniana
96 1 Dipteranthus grandiflorus
10 changes

Fig. 4. One of three trees for the limited atpB-rbcL intergenic spacer region analysis, with branch lengths
(ACCTRAN optimization) above lines, bootstrap values below lines. Nodes that collapse in the strict consensus
tree are indicated with a small black square.


Vol. 5, No 3








LANKESTERIANA5(3): WILLIAMS et al. -Molecular systematics of Telipogon 181


25 Fernandezia tica

SPachyphyllum sp. W1614
104
104 Hofmeisterella eumicroscopica
36 10
28 Trichoceros sp. W2353
100 12 Trichoceros muralis

11 Telipogon ariasii
20
53 3 Telipogon dalstromii
100 12
27 10 1Telipogon pulcher
94 3
S 3 Telipogon biolleyi
54-_ 6 Telipogon butcher

Telipogon caulescens
79 8

S15
100 100 Telipogon panamensis
Telipogon parvulus
29 29
86 Stellilabium aciculare
17
96 31 Stellilabium barbozae
37 | 56
S96 56 Stellilabium monteverdense
S100 5 Stellilabium bullpenense
100 28
100 28 Telipogon nervous
100 Telipogon vargasii
38 27
59 90 27 4 Stellilabium hystrix
51 14 Stellilabium pogonostalix
100 22
SStellilabium sp. H7103

18 53 Ornithocephalus inflexus
34 71-31 Sphyrastylis dalstromii
83 18 45 Hintonella mexicana
19 18 78
96 Eloyella thienii
42 51 Phymatidium falcifolium
100 43
1 22 43 Zygostates alleniana
58
100 Dipteranthus grandiflorus
10 changes

Fig. 5. The one of four trees for the combined plastid data set for the limited analysis, with branch lengths
(ACCTRAN optimization) above lines, bootstrap values below lines. Nodes that collapse in the strict consensus
tree are indicated with a small black square.







LANKESTERIANA


47
47Fernandezia tica
28
SPachyphyllum sp. W1614
191
191 Hofmeisterella eumicroscopica

60 1634 Telipogon ariasii
90 3Telipogon dalstromi SOUTH AMERICA
100 128
8 Telipogon pulcher
I 3
Telipogon biolleyi
Telipogon caulescens
8 Telipogon seibertii
21 14
1 14 Telipogon parvulus
97 60 18 Telipogon panamensis CENTRALA

Telipogon butcher
47 50
I 0 Stellilabium aciculare
9419 41
45 7 52 Stellilabium barbozae
87 59
98 100 Stellilabium monteverdense
64 60
S-60 Stellilabium bullpenense
100
39
50 9 Telipogon nervous S
43 | SOUTH AMERICA
100 -4 Telipogon vargasii
45 37
-- 11 7Stellilabium hystrix
24 SOUTH Ar
91 Stellilabium pogonostalix

92 100 4- Stellilabium sp.H7103
- 16
)0 150 Trichoceros sp. W2353
100 15E Trichoceros muralis


ERICA


ERICA


73
38 7 Ornithocephalus inflexus
25 100 36 Sphyrastylis dalstromii
42 1 771 Hintonella mexicana
100 104
45 100 14 Eloyella thienii

69 46 Zygostates alleniana
100 100 Dipteranthus grandiflorus
90
Phymatidium falcifolium
50 changes

Fig. 6. One of 30 trees for the combined ITS plus plastid data set analysis, with branch lengths (ACCTRAN
optimization) above lines, bootstrap values below lines. Nodes that collapse in the strict consensus tree are
indicated with a small black square.


Vol. 5, No 3







WILLIAMS et al. -Molecular systematics of Telipogon


Fernandezia tica
Pachyphyllum sp. W1614
Hofmeisterella eumicroscopica
Trichoceros sp. W2353


Trichoceros muralis
100
64 (- Telipogon ariasii o
100 Telipogon dalstromii D w

89 TTelipogon pulcher O
Telipogon biolleyi

Telipogon caulescens

52 Telipogon panamensis 0
100 Telipogon seibertii
Telipogon parvulus

Telipogon butcher
100 z
Stellilabium aciculare w
100
0 Stellilabium barbozae
100100 Stellilabium monteverdense
100
Stellilabium bullpenense

100 Telipogon nervous <
Telipogon vargasii
80 2


0
100 Stellilabium hystrix <
100 1Stellilabium pogonostalix
Stellilabium sp. H7103 U

100 Ornithocephalus inflexus
84 Sphyrastylis dalstromii
100 Hintonella mexicana

98 Eloyella thienii

100 100 Zygostates alleniana
Dipteranthus grandiflorus
Phymatidium falcifolium

Fig. 7. The majority rule consensus tree for the Bayesian analysis of the combined ITS plus plastid data set with
posterior probability values above lines.


LANKESTERIANA5(3):








LANKESTERIANA


SChytroglossa marileoniae
19Eloella thienii
S 7 16 Ornithocephalus grexanserinus
52 7 14 1 Ornithocephalus iridifolius
52 _14 10:01 SDhvrastvlis dalstromi Omrithocepha
17 14 Sphyrasylis escobarana n ocep
S100 2 Sphyrastylis sp. SD2355 alliance
91 21 rritocephalus kruegeria
Ornithocephalus myrticola
20 71 Dipteranthus grandiflorus
1 ipteranthus obliquus
3 Zgostates alleniana
99 100 Zyostates lunata
Dipteranthus pellucidus
Phymatidum falcifolium
S[ Hofmeisterella eumicroscopica 1
100 Hofmeisterella eumicroscopica 2
16 Telipogon klotzcheanus SOUTH AF
100 Telipogon nervous
100 Telipogon vargasii
10 Stellilabium aciculare
Stellilabium sp. D168
21 41 100- Stellilabium smaragdinum
9 r- Stellilabium Darbozae
78 100 7 100 Stellilabium monteverdense
63 Stellilabium bullpenense
Telipogon ampliflorus
Telipogon biolleyl
Telpogon caulescens 1
34 Telipogon caulescens 2
100 17 Telipogon chiriquensis
100I Telpogon costaricensis
84 Telpogon maduroi
Telipogon monticola
22 Telipgon panamensis
100 Telipogon personatus
Telipogon seibertii
TeIlpogon griesbeckii 1
0 Telipogon griesbeckii 2
4.. 10 Telipogon olmosii
1 14 98 Te pogon parvulus 2
Telipogon parvulus 1
74 Telipogon medusae
Telipogon bombiformis
Tel ogon butcheri
SStellabium boliviense
SStellilabium pogonostalix
Stellilabium sp. w2531
Stellilabium sp. w2530
12 Stellilabium hystrix
27 98 Stellilabium sp. w2532
10 Stellilabium sp. H7103
u100 Stellilabium sp. w2533 2
16 9 Telipogon venustus 2
78 10O Telipogon venustus 1 3
Telipogon ariasii.
STelipogon frymirei
S1 e12 ipogon chrysocrates C
I L r Tellpogon anaicola
90 17 -- Telipogon pulcher
13 10 Tel'pogon sp. w2413
13 100 Telipogon dalstromii
1 86 Telipogon sp. w2412
1 Telipogon falcatus
-- Telipogon valenciae
Trichoceros parviflorus
26 Trichoceros sp. w2353
I Trichoceros antennifer Trichoceros
100 Trichoceros muralis
7 Fernandezia ionanthera
71 Pachyphyllum sp. W2453
82 15 Fernandezia sp.
I27 Femandezia t.Ca Pachyphyllum/Fernande
100 Pachyphyllum sp. C87105
Pach y lhum cuencae alliance
Pac yphyllum sp. W1703
60 Pachyphyllum sp. W2313
Pachyphyllum sp. W1614
- Lockhartia amoena
Lockhartia oerstedi Ioutgroup
- 5 changes


lus








6IERICA


zia


Fig. 8. One of 251 trees for ITS only for 81 taxa, with branch lengths (ACCTRAN optimization) above lines,
bootstrap values below lines. Nodes that collapse in the strict consensus tree are indicated with a small black
square. Branch lengths for terminal branches and for extremely short (<7) branches omitted for clarity. See text
for bootstrap values for the South American Stellilabium clade and the T ariasii-T venustus clade.


Vol. 5, No 3








LANKESTERIANA5(3): 185-189. 2005.


UNA NUEVA ESPECIE DE ELAPHOGLOSSUM SECCION
ELAPHOGLOSSUM (LOMARIOPSIDACEAE) EN COSTA RICA

ALEXANDER Fco. ROJAS ALVARADO
Jardin Botinico Lankester, Universidad de Costa Rica, apdo. 1031-7050, Cartago, Costa Rica.
afrojasa@yahoo.com

ABSTRACT. The new species Elaphoglossum lenticulatum, sect. Elaphoglossum subsect. Pachyglossa, is
described here. This species is segregated from E. proximum (J. Bommer) H. Christ because of entire (vs.
ciliate), persistent (vs. deciduous) and bigger rhizome scales, lanceolate (vs. lanceolate-oblong) blade, and
less dense and bigger blade scales.

RESUMEN. Se describe la nueva especie Elaphoglossum lenticulatum de la secci6n Elaphoglossum subsecc.
Pachyglossa. Se diferencia de E. proximum (J. Bommer) H. Christ por escamas del rizoma enteras (vs.
ciliadas), persistentes (vs. deciduas) y mas grandes, lamina foliar lanceolada (vs. lanceolado-oblonga) y
escamas de la lamina menos densas y mas grandes.

PALABRAS CLAVE / KEW WORDS: Elaphoglossum, Lomariopsidaceae, Pteridophyta, Costa Rica.


Mickel (1992) describe 33 species nuevas de
Elaphoglossum de Mesoamerica, de las cuales 13
species pertenecen a la secc. Elaphoglossum subsecc.
Pachyglossa y 12 estan presents en Costa Rica.
Rojas (1996a) refiere una especie costarricense de
Elaphoglossum secc. Elaphoglossum. Rojas (1996b)
describe 12 especie nuevas de Elaphoglossum de
Costa Rica y Panama; de ellas, tres son de la secc.
Elaphoglossum y todas estan presents en Costa
Rica. Rojas (1997) public 14 species nuevas de
Elaphoglossum de Mesoamerica; siete de ellas de la
secc. Elaphoglossum y s61o E. panamense present en
Costa Rica. Posteriormente, Rojas (2002) comunica
cuatro registros nuevos de la secc. Elaphoglossum
de Costa Rica, y describe (Rojas 2003) 12 species y
registra dos species mas de la subsecc. Pachyglossa de
Mexico y Centroamerica, de las cuales cinco species
nuevas y los dos nuevos registros estan presents en
Costa Rica. En el present trabajo se describe una
especie nueva mas.
Se utilizaron distintos tratamientos taxon6micos
(Mickel 1991, 1995, Mickel & Beitel 1988, Proctor
1985, 1989) y articulos sobre Elaphoglossum, que
incluyen species de Costa Rica (Mickel 1992, Rojas
1996a, 1996b, 1997, 2002, 2003), y se revisaron las
colecciones del Herbario Nacional de Costa Rica (CR)
y del Instituto Nacional de Biodiversidad (INB).

Elaphoglossum lenticulatum A. Rojas, sp. nova

TIPO: COSTA RICA. Guanacaste: Liberia, Parque
Nacional Guanacaste, Cuenca del Rio Tempisque,
Volcan Cacao, entire la ramificaci6n del sendero a la


Estaci6n Maritza y la punta del cerro, 10056'08"N,
85027'10"W, 1300-1600 m, 5 febr 1998, A. Rojas &A.
Soto 4266 (Holotipo: CR, isotipos: INB, MO). Fig. 1.

Species nova haec a Elaphoglosso mitorrhizo
Mickel similis, sed rhizomatis squamis maioribus
bicoloribusque, laminae squamis ovatis maioribusque
dignoscenda.

Epifitas; rizoma de 1-2 mm de diametro, largamente
reptante; escamas del rizoma de 1.5-2.5 (-3.0) x 1-2
mm, ovadas, bicoloras, pardo-amarillentas con el centro
y a veces el apice negruzcos, lustrosas, adpresas, con
margen entero; frondas de 7-21 cm, distantes 20-35 mm
entire si; filopodios de 4-8 mm de largo; estipite de 1/3-
2/3 del tamafio de la fronda; escamas del estipite de 1-3
x ca. 1 mm, ovadas a ovado-lanceoladas, bicoloras a
concoloras, pardo-amarillentas, adpresas a ligeramente
patentes, con margen entero; lamina de 5.5-12 x 2.5-
3.5 cm, lanceolada, cartacea, base anchamente cuneada
terminando atenuadamente, apice agudo a acuminado;
escamas de la costa de 1-2 x 0.5-1 mm, ovadas, pardas,
con margen ciliado; escamas de la lamina de 0.5-1 x
0.3-0.6 mm, ovadas a deltado-lanceoladas, pardas a
pardo-oscuras, medianamente densas, con margen
dentado a corto-ciliado, ciliado en la base; hidatodos
ausentes; frondas f6rtiles de 11.0-22.5 cm; estipite de
2/5-3/4 del tamafio de la fronda; lamina f6rtil de 5-7 x
1.6-1.8 cm, lanceolada a angostamente lanceolada, base
anchamente cuneada, apice acuminado; escamas de la
lamina presents s61o en el estipite y la costa, similares
a las de la fronda est6ril; escamas interesporangiales
ausentes.








LANKESTERIANA


DISTRIBUCION. Conocida s61o de la Cordillera de
Guanacaste y la Cordillera de Tilaran, Costa Rica,
1200-2000 m. Especie endemica.

PARATIPOS: COSTA RICA. Alajuela: Valverde Vega,
Cordillera Central, Alto Palomo, cercanias de la
cascada y punta del cerro, 10010'50"N, 84018'42"W,
1800-2000 m, 9 mayo 1995, A. Rojas et al. 1816
(CR, INB, MO); San Ramon, Reserva Biol6gica
Monteverde, Cordillera de Tilaran, Estacin Aleman's,
10022'00"N, 84048'00"W, 1200-1500 m, 20 mayo
1995, A. Rojas 1876 (CR, INB, MO). Guanacaste:
Fila del Volcan Cacao, 1400-1520 m, 22 sept 1986,
L Chac6n & A. Chac6n 2291 (CR); Parque Nacional
Guanacaste, Cordillera de Guanacaste, Estaci6n Cacao,
10055'45"N, 85028'15"W, 1100-1500 m, 5 sept 1996,
A. Rojas & M. Mata 3065 (CR, INB, MO).

Esta especie se parece a E. mitorrhizum Mickel por
la forma y el tamafio de la lamina, pero se diferencia
por las escamas del rizoma mas grandes (1.5-3.0 x
1-2 mm vs. 0.5-1.0 x 0.3-0.8 mm), bicoloras (vs.
concoloras), pardo-amarillentas con el centro oscuro
(vs. pardo-oscuras a negruzcas) y margen entero a
ondulado (vs. ciliado) y las escamas de la lamina mas
grandes (0.5-1 x 0.3-0.6 mm vs. 0.2-0.5 x 0.2-0.3
mm), medianamente densas (vs. dispersas) y con el
margen dentado (vs. ciliado). Tambi6n se parece a E.
proximum (J. Bommer) H. Christ por las escamas del
rizoma densas y escamas de la lamina pardo-oscuras
a negruzcas, pero difiere por las escamas del rizoma
enteras (vs. ciliadas), persistentes (vs. deciduas) y mas
grandes (1.5-3.0 x 1-2 mm vs 0.7-1.5 x 0.5-1.0 mm),
lamina lanceolada (vs. lanceolado-oblonga) y escamas
de la lamina menos densas y con margen entero a corto
y dispersamente ciliado (vs. margen densa y largamente
ciliado) (Figs. 1 y 2, Cuadro 1).

ETIMOLOGIA. El epiteto lenticulatum (con aspect de
lenteja) se refiere a las escamas de la lamina grandes y


pardo-oscuras, que se asemejan a pecas.

AGRADECIMIENTOS. A Carlos O. Morales por las
correcciones del latin, a los herbarios del Museo
Nacional de Costa Rica (CR) y del Instituto Nacional
de Biodiversidad (INB), por permitirme utilizar sus
colecciones, y a los revisores an6nimos del manuscrito
por sus comentarios.

LITERATURE CITADA
Mickel, J.T. 1992. New species of the fern genus
Elaphoglossum from Mesoamerica. Novon 2: 368-
382.
Mickel, J.T. 1991. Elaphoglossum. In: Tryon, R.M. &
R.G. Stolze (eds.). Pteridophyta of Peru. Part IV 17.
Dryopteridaceae. Fieldiana, Bot. n.s. 27: 111-166.
Mickel, J.T. 1995. Elaphoglossum. In: Moran, R.C.
& R. Riba (eds.). Flora Mesoamericana. Vol. 1.
Psilotaceae a Salviniaceae. Univ. Nac. Aut6noma
de Mexico. Mexico D. F. p. 250-283.
Proctor, G.R. 1985. Ferns of Jamaica, a guide to the
Pteridophytes. British Museum. p. 486-518.
Proctor, G.R. 1989. Ferns of Puerto Rico and the Virgin
Islands. Mem. New York Bot. Gard. 53: 169-175.
Rojas, A.F. 1996a. Aportes a la Flora Pteridophyta
Costarricense. I. Informes. Brenesia 45-46: 1-6.
Rojas, A.F. 1996b. Twelve New Species of
Elaphoglossum from Costa Rica and Panama.
Brenesia 45-46: 7-26.
Rojas, A.F. 1997. Fourteen New Species of
Elaphoglossum (Elaphoglossaceae) from Meso-
america. Brenesia 47-48: 1-16.
Rojas, A.F. 2002. New species, new combinations
and new distributions in neotropical species of
Elaphoglossum (Lomariopsidaceae). Rev. Biol.
Trop. 50: 966-1006.
Rojas, A.F. 2003. New taxa in the Elaphoglossum sect.
Elaphoglossum subsec. Pachyglossa (Lomario-
psidaceae) from Mexico and Central America. Rev.
Biol. Trop. 51: 1-32.


Vol. 5, N 3








ROJAS Nueva especie de Elaphoglossum


Cuadro 1. Comparaci6n de caracteristicas morfol6gicas entire Elaphoglossum lenticulatum, E. mitorhizum
y E. proximum.

Caracteristica E. lenticulatum E. mitorhizum E. proximum
Largo de las escamas del 1 0 0
1.5-3.0 0.5-1.0 0.7-1.5
rizoma (mm)
Ancho de las escamas 1-2 0- -
1-2 0.3-0.8 0.5-1
del rizoma (mm)
bicolor, pardo-
Color de las escamas del concolor, pardo-oscuro a concolor, pardo a pardo-
amarillento con el centro
rizoma negruzco oscuro
oscuro
Margen de las escamas
e a entero a ondulado ciliado ciliado
del rizoma
Densidad de las escamas
densas dispersas densas
del rizoma
Forma de la lamina
Slanceolada lanceolada lanceolado-oblonga
foliar
Largo de las escamas de 2-05
0.5-1 0.2-0.5 0.5-1
la lamina (mm)
Ancho de las escamas de 0 6 0
0.3-0.6 0.2-0.3 0.3-0.8
la lamina (mm)
Margen de las escamas entero a dentado, ciliado ciliao
ciliado ciliado
de la lamina en la base
Densidad de las escamas
dea medianamente densas dispersas densas
de la lamina


LANKESTERIANA 5(3):










LANKESTERIANA


Vol. 5, N 3


uso NAOoNAU DE COSTA CA
'R nro NAC1ONAL 0232802
Ou f Osumo astu, Jtuu
D60(RT'uwW~


FLORA DE CDSTA RICA TBoB
Lomarlopsidaceae dup.=3 CR
Elaphoglossum proxiP (J. Br) I, trlst
Det. Alexander Rojas, 05/02/1998
Guanacaste: Cant6n de Liberia. P.N. Guanacaste.
Cuenca del Tempisque. Volcan Cacao, entree la
ramlficaclon del Sendero a la Eatacion MaritaY y
la Punta del Cerro.
10*56'08"N 86527'10"W 1300 1600 m
Epifita, con luz media y material organica media,
a menudo con musgos.


Alexander Rojaa 4266 5 I 1(I
& A. Soto
IMSTITUTO NHACI(AL DE BIODIv8 SMID (Il)
h c.hIolia a el Ilurl S lMil hiu ( )


Fig. 1. Tipo de Elaphoglossum lenticulatum (A. Rojas & A. Soto 4266, CR): a. Habito. b. Detalle del rizoma.
c. Detalle de la lamina foliar.








Rojas Nueva especie de Elaphoglossum


1mm











Fig. 2. Elaphoglossum lenticulatum (A. Rojas & A. Soto 4266, CR): a. Escamas de la lamina. c. Escamas del
rizoma. E. proximum (A. Rojas 3392, CR): b. Escamas de la lamina. d. Escamas del rizoma.


IANKESTERIANA 5(3):











LANKESTERIANA 5(3): 191-200. 2005.


NUEVOS TAXA DE HELECHOS ARBORESCENTES
(FILICALES: CYATHEACEAE) EN COSTA RICA

ALEXANDER Fco. ROJAS ALVARADO
Jardin Botanico Lankester, Universidad de Costa Rica, apdo. 1031-7050, Cartago, Costa Rica.
afrojasa@yahoo.com

ABSTRACT. New species are described and new combinations are made in the fern genera Cnemidaria and
Cyathea from Costa Rica. Cnemidaria chiricana (Maxon) A. Rojas is considered here a species different from
C. mutica (H. Christ) R.M. Tryon, and C. mutica var. contigua (Maxon) Stolze is included as a variety of the
former. Cyathea povedae A. Rojas is here described as a new species and compared to C. fulva (M. Martens
& Galeotti) Fee. The hybrid between Cyathea stolzei A.R. Sm. ex Lellinger and C. ursina (Maxon) Lellinger
mentioned by Smith & Grayum (1988) is here described.

RESUMEN. Cnemidaria chiricana (Maxon) A. Rojas se consider una especie diferente a C. mutica (H. Christ)
R.M. Tryon; C. mutica var. contigua (Maxon) Stolze se trata como una variedad de C. chiricana. Cyathea
povedae A. Rojas se describe como especie nueva y se compare con C. fulva (M. Martens & Galeotti) Fee.
Ademas, aqui se describe el hibrido entire Cyathea stolzei A.R. Sm. ex Lellinger y C. ursina (Maxon) Lellinger,
mencionado por Smith & Grayum (1988).

PALABRAS CLAVE / KEW WORDS: Cnemidaria, Cyathea, Cyatheaceae, tree ferns / helechos arborescentes,
Pteridophyta, Costa Rica.


Tryon (1970) divide la familiar Cyatheaceae con base
en caracteres de las escamas, presencia o ausencia de
indusio y venaci6n. Asf, caracteriza a Cnemidaria C.
Presl por tener escamas no conformes y no setadas
y lamina con venas reticuladas, y a Cyathea Sm. por
tener escamas no conformes y no setadas, lamina sin
venas reticuladas y soros indusiados. Estos soros no
indusiados son caracteristicos de Trichopteris Spreng.,
un sin6nimo de Cyathea, como fue indicado por
Lellinger (1987).
Stolze (1974) define al g6nero Cnemidaria como
plants con rizoma compact (no arborescente),
frondas pinnadas a pinnado-pinnatifidas, venas
costales comuinmente formando areolas y esporas
con poros ecuatoriales. Este concept es apoyado por
otros autores, como Lellinger (1989) y Moran (1995),
en tanto que Cyathea es caracterizada por incluir
plants con tallo comuinmente arborescente, frondas
principalmente bipinnado-pinnatifidas (raramente
menos divididas), venas costales o costulares no
formando areolas y esporas sin poros ecuatoriales
(Tryon 1976, Lellinger 1989, Moran 1995).

Cnemidaria. Stolze (1974) consider que todas las
species de nervadura libre presents en Costa Rica
son, en realidad, variedades de Cnemidaria mutica (H.
Christ) R.M. Tryon, e indica que las variaciones en
tamano de las frondas, incision de las pinnas y Apice de
los segments son caracteres traslapados. Como puede


observarse en la clave del g6nero Cnemidaria de Costa
Rica, las variedades mencionadas se agrupan de mejor
forma en dos species, cada una con dos variedades;
con ello se reconoce nuevamente el nombre C.
chiricana (Maxon) R.M. Tryon (sensu Tryon 1970).
La combinaci6n C. mutica var. contigua (Maxon)
Stolze (Stolze 1974) es, asf, sin6nimo de C. chiricana
var. contigua.

Cnemidaria chiricana (Maxon) R.M. Tryon var.
contigua (Underw. ex Maxon) A. Rojas, comb. nova

Hemitelia contigua Underw. ex Maxon, Contr. U.S.
Natl. Herb. 16: 32. 1912. Tipo: Costa Rica, 5 mi. S
of Cartago, Maxon 523 (NY!, frag. US).
Cyathea contigua (Underw. ex Maxon) Domin,
Pteridophyta: 263. 1929.
Cnemidaria contigua (Underw. ex Maxon) R.M.
Tryon, Contr. Gray Herb. 200: 52. 1970.
Cnemidaria mutica (H. Christ) R.M. Tryon var.
contigua (Maxon) Stolze, Fieldiana, Bot. 37: 37-38.
1974.

Tallo compact, de 2-5 cm de diametro; frondas de
1.2-1.6 x 0.3-0.5 m; estfpite estramfneo, liso o con
espinas diminutas, la base escamosa, las escamas 5-
15 x 2-4 mm, lanceoladas, bicoloras, con un ancho
margen blanco, o casi concoloras y blanquecinas, con
una franja pardo-clara a negruzca; lamina pinnado-








LANKESTERIANA


pinnatifida, reducida gradualmente a un Apice
pinnatifido; raquis glabro, o muy dispersamente peloso
abaxialmente; pinnas basales 5-8 x 1.5-2.0 cm, pinnas
medias 18-25 x 2.5-4.0 (-5.0) cm, incisas 1/2-3/4 hacia
la costa, sesiles a cortamente pediculadas; segments
subenteros excepto en los Apices serrulados), obtusos
a raramente subagudos, unidos por senos agudos,
angostos; segments no mas de 1.5 veces mas largos
que anchos mas alli del seno; nervaduras 7-10 (-12)
pares por segment, una a dos veces bifurcadas; tejido
laminar entire las nervaduras glabro; soros inframedios


a supramedios, en una sola linea entire el margen del
segment y la c6stula; indusios casi semicirculares, en
el lado costular del receptaculo.

HABITAT. Bosque muy hdmedo premontano y bosque
pluvial premontano.
DISTRIBUCION. Cordillera Central y region norte de la
Cordillera de Talamanca, Costa Rica, 1200-2200 m.
Variedad end6mica.
EJEMPLAR REPRESENTATIVE. A. Rojas 1076 (CR, INB,
MO).


Clave de las species de Cnemidaria de Costa Rica

1. N ervaduras de la base entire los segm entos libres ............................................................. ............. ............. 2
1. Nervaduras de la base entire los segments comunmente fusionandose en areolas costales ........................ 5

2. Frondas de 1.2-1.6 (-2) x 0.3-0.6 m; estfpite de 1/5-1/12 de la longitud de la fronda; pinnas medias de 18-30 x
2.5-4 (-5) cm; segments de las pinnas medias 1-2 veces mas largos que anchos; pinnas incisas de 1/2-3/4 hacia
la costa; venas sim ples a bifurcadas .................. .......................................................3
2. Frondas de 2-3 m x (0.5-) 0.8-1.4 m; estfpite de 1/3-1/5 de la longitud de la fronda; pinnas medias de 30-70 x
(-5) 7-25 cm, segments de las pinnas medias (2-) 3-8 veces mas largos que anchos; pinnas incisas mas de 3/4
hacia la costa; venas 2-5 veces bifurcadas o pinnadas............................................................ ................. 4

3. Estfpite no espinoso; raquis peloso en ambas superficies, segments con el Apice obtuso a agudo...................
......................................... ....................... .............................................. C chirican a var. ch irican a
3. Estfpite comunmente espinoso; raquis glabro o dispersamente peloso s6lo en el lado abaxial, segments con el
Apice agudo a acuminado.............................. ................ C. chiricana var. contigua

4. Segmentos basales de las pinnas medias libres o al menos separados y unidos por una costa alada; segments
de las pinnas medias lobados a crenados, con la nervadura de los 16bulos comunmente pinnada....................
...................................................................................................................... C m utica v ar. g ran d is
4. Segmentos basales de las pinnas sesiles; segments de las pinnas medias enteros, con la nervadura comunmente
2 a 4 veces bifurcada................................................................................ .....................C m utica var. m utica

5. Pinnas incisas aprox. 7/8 o raramente las pinnas basales libres; segments con el Apice agudo a acuminado;
areolas costulares a m enudo presents ......................................................................................... C. horrida
5. Pinnas incisas 1/2-7/8; segments con el Apice obtuso o redondeado; areolas costulares ausentes.................6

6. Pinnas medias de 18-30 cm de largo, incisas 1/3-1/2 hacia la costa..................................C. choricarpa
6. Pinnas medias de 33-47 cm de largo, incisas 1/2-7/8 hacia la costa.......................................C. cocleana


Cyathea. Rojas (2001) indica que Cyatheafulva (M.
Martens & Galeotti) Fee es un grupo complejo, del
cual separa C. onusta H. Christ e indica que el material
de Costa Rica, Panama, Colombia y Venezuela puede
corresponder a otra especie mas relacionada con C.
caracasana (Klotzsch) Domin.

Cyathea povedaeA. Rojas, sp. nova


Cerro Nara, 9"29'40" N, 84"00'50" W, 900-1000 m,
23 jul 1998, A. Estrada et al. 1674 (Holotipo: CR).
Fig. 1.

A Cyathea fulva (M. Martens & Galeotti) FHe
similis, sed stipitis squamis pardalibus (vs. aureis),
laminae costulae venaeque squamis albidis (vs. luteo-
pardalibus vel pardalibus), plans (vs. .' ./-i;. i ,. ..!, I


TIPO: COSTA RICA. San Jos6: Dota, Zona Protectora "**i..i


Vol. 5, N 3








ROJAS Nuevos taxa de helechos arborescentes


Tallo de 2-7 m de alto, de 8-12 cm de diAmetro, con
frondas caedizas dejando cicatrices; frondas de (2-) 2.5-
3.5 m de largo; estipite espinoso, pajizo a pardo, opaco,
con caspilla parda; escamas del estipite de (10-) 15-30
x 2-5 mm, lanceoladas, concoloras o casi concoloras,
pardas a pardo-oscuras, a veces con un angosto margen
mis claro; limina bipinnado-pinnatifida a tripinnada,
reducida gradualmente a un apice pinnatifido; raquis
glabro a escuamuloso, con caspilla parda a amarillenta
formada de escuimulas diminutas; pinnas s6siles
o pediculadas, el pediculo de 0-1 (-1.5) cm; pinnas
medias (-40) 50-75 (-85) x (12-) 17-24 cm, lanceolado-
oblongas; costas glabras o casi glabras, a menudo
dispersamente cubiertas de diminutas escuimulas
amarillentas a pardo-amarillentas mezcladas con
tricomas hialinos de 0.1-0.3 mm; pinnulas (6-) 8-12 x
(1.2-) 1.5-2.6 cm, s6siles a cortamente pediculadas, el
pediculo hasta 2 mm; c6stulas glabras a puberulentas
y escamosas, los tricomas de 0.1-0.3 mm, hialinos a
amarillentos, generalmente adpresos, las escamas
anchamente ovadas, pAlidas a amarillentas; segments
de las pinnulas medias 12-20 pares, 3-5 mm de ancho,
enteros a serrulados; vena media de las pinnulas glabra
o con pelos hialinos patentes s6lo en la parte terminal
del haz, glabra a medianamente pilosa y escamosa, las
escamas 1-3 mm de largo, ovadas, con Apice agudo a
caudado, blanquecinas a amarillentas, plans excepto
en el apice de los segments con escamas a veces
levemente abolladas), con pelos de 0.5-2 mm de largo,
patentes, hialinos, a veces tambi6n con pelos de 0.2-0.5
mm de largo, hialinos a pardos, adpresos, retorcidos;
nervaduras 8-10 pares por segment, bifurcadas, glabras
o dispersamente pilosas en ambas superficies, los
pelos 0.2-0.5 mm, blanquecinos a pardo-amarillentos,
patentes, abaxialmente a menudo mezclados con pelos
0.1-0.3 mm, adpresos, retorcidos; tejido laminar entire
las nervaduras glabro o con pelos de 0.2-0.5 mm,
blanquecinos, patentes; soros subcostales; parAfisos
mis cortos que los esporangios, inconspicuos; indusio
globoso, que rodea completamente al recepticulo,
evanescente en la madurez.

HABITAT. Bosque muy himedo tropical, transici6n a
premontano, bosque pluvial premontano y bosque
pluvial montano.
DISTRIBUCION. Cordillera de Tilarin, vertiente norte
de la Cordillera Central, Cordillera de Talamanca y
serranias del Pacifico, 500-1600 m. Especie conocida
s6lo en Costa Rica.

PARATIPOS: COSTA RICA. Alajuela: Alajuela,
Cordillera Central, Cariblanco, camino a Virgen del


Socorro, 1015'25"N, 8410'20"W, 720-870 m, 11
sept 1994, A. Rojas 1429 (CR, INB, MO). Cartago:
near Moravia and along the road toward Turrialba,
951'N, 8326'W, 1000 m, 19-20 Dec 1966, W Burger
& W Ramirez 3964 (CR, NY). Lim6n: Lim6n, Valle
de la Estrella, Reserva Indigena Chirrip6, Chirrip6
Abajo, Almirante, 946'N, 8320'W, 1060-1330 m,
10 ago 1995, A. Rojas 2212 (INB, MO). Puntarenas:
Coto Brus, Zona Protectora Las Tablas, Cordillera de
Talamanca, Las Alturas de Cot6n, Estaci6n Biol6gica
Las Alturas, sendero a Cerro Echandi, postes 1-7,
857'15"N, 8250'10"W, 1580-1620m, 19 dic 1993,A.
Rojas 719 (CR, INB). San Jos6: Dota, Zona Protectora
Cerro Nara, 929'40"N, 8400'50"W, 800-900 m, 3
dic 1997, A. Estrada et al. 1387 (CR).

OTROS ESPECIMENES ESTUDIADOS: COSTA RICA.
Alajuela: San Ram6n, Los Angeles, Reserva Biol6gica
Monteverde, Pocosol, 1017'N, 8410'W, 720 m,
19 Feb 1992, E. Bello 4401 (INB); Reserva Forestal
San Ram6n, N of the station, ca. 2 km, 1012'40"N,
8636'20"W, 1000-1300 m, 28 Mar 1991, J Bittner
891 (CR), 13 Feb 1992, J Bittner 1260 (CR); Reserva
ForestalVirgen del Socorro, 1016'30"N, 8410'20"W,
720 m, 10 Jan 1993, J Bittner 1664 (CR, INB), J
Bittner 1665 (CR); Reserva Forestal San Ram6n, trail
on S of the field station, 1012'40"N, 8636'20"W,
1050 m, 6 Feb 1993, J Bittner 1683 (CR), Cariblanco,
800 m, 3 dic 1964, C. Nisman 113 (CR); 4 km SE de
Fortuna, 2.5 km SW sobre brecha, 1030'N, 8500'W,
ca. 500 m, 29 abr 1983, B. Perez et al. 371 (CR);
Upala, Bijagua, Finca Zapote, 1045'N, 8504'W,
500-530 m, 9 jul 1994, A. Rojas 1279 (INB). Cartago:
Turrialba, 800 m, 17 Jun 1932, W Kupper 1593 (CR);
Tapanti, 22 sept 1964, C. Nisman 17 (CR). Lim6n:
Lim6n, Cerro Muchilla, Fila Matama, Cordillera
de Talamanca, 947'40"N, 8306'30"W, 850 m, 8
abr 1989, R. Robles & A. Chac6n 2726 (CR, INB).
Puntarenas: About 2 km SE of Monteverde, 1018'N,
8448'W, 1500-1550 m, 18-21 Mach 1973, W Burger
& J Gentry 8677 (CR, F); upper Rio Burn, 2010 m,
19 Aug 1983, L. G6mez et al. 21779 (CR); drenaje del
Rio Coto Brus, 1470 m, 22 feb 1965, C. Nisman 150
(CR); Coto Brus, San Vito de Java, Jardin Botinico
Las Cruces, 1400 m, 14 dic 1982, B. Perez & C. Wille
241 (CR), 15 dic 1982, B. Perez & C. Wille 253 (CR);
Coto Brus, Zona Protectora Las Tablas, Cordillera de
Talamanca, Las Alturas de Cot6n, Estaci6n Biol6gica
Las Alturas, sedero a Cerro Echandi, postes 1-7,
857'15"N, 8250'10"W, 1580-1620 m, 19 dic 1993,
A. Rojas 767 (INB). San Jos6: ca. 1000 m, along Rt. 2,
11.6 kmN of San Isidro del General, 16 Jun 1989, D.


IANKESTERIANA 5(3):








LANKESTERIANA


Conant 4412 (CR), Tarraz6, San Lorenzo, Naranjillo,
camino a Quepos, 933'N, 8402'W, 600-700 m, 31
jul 1998, A. Rojas et al. 4711 (INB).

Cyathea povedae difiere de Cyathea fulva (M.
Martens & Galeotti) FHe por tener un tallo mis delgado
(8-12 cm de diametro vs. 12-16 cm), frondas caedizas
dejando cicatrices al morir (vs. persistentes dejando
la base de los estipites); escamas del estipite pardas
a pardo oscuro (vs. amarillentas a pardo-rojizas) y
escamas del tejido, costas y vena central de las pinnas
secundarias blanquecinas (vs. pardo-amarillentas
a pardas), plans (vs. abolladas) con las paredes
laterales (las que se unen a las c6lulas adyacentes) muy
resaltadas (vs. poco evidentes), pelos hialinos en las
c6stulas pero no en las venas (vs. en las c6stulas y las
venas) y tejido laminar glabro o piloso abaxialmente
(vs. siempre glabro, Figs. 1-3). Por las escamas blancas
y aplanadas en la lamina se parece a Cyatheapallescens
(Sodiro) Domin, de Colombia, Ecuador y Peri, pero
difiere por escamas del estipite plans (vs. crespas),
pardo-oscuras y concoloras (vs. blanquecinas a pardas,
cuando son pardas entonces bicoloras), escamas de las
costas secundarias y terciarias sin escamas estrelladas
(vs. con escamas estrelladas), tejido laminar a menudo
con tricomas blanquecinos patentes (vs. sin ellos)
y distribuci6n altitudinal diferente [500-1600 m vs.
(1500-) 2200-3300 m].

Por las escamas del estipite doradas y las del tejido
laminar abolladas, Cyathea fulva parece estar muy
relacionada con C. suprastrigosa (H. Christ) Maxon, de
la cual difiere principalmente por la ausencia de pinnas
subafleboides (vs. cominmente presentss, escamas de
la lamina completamente pardas, con apice acuminado
y entero (vs. apice blanquecino y ancho, a menudo
ramificado en cilios) y ausencia de pelos en el haz de
la lamina (vs. pelos estrigosos en el haz). C. povedae
parece estar mas emparentada con C. onusta H. Christ
por las escamas del estipite pardas a pardo-oscuras y
las escamas de la lamina blanquecinas; difiere de C.
onusta por tener un tallo de 8-12 cm de diametro [vs.


5-8 (-10) cm], frondas de (2-) 2.5-3.5 m de largo (vs.
1-2 m), estipite escamoso s6lo en la base (vs. escamoso
a todo su largo), raquis no escamoso (vs. escamoso en
el dorso), pinnas secundarias de (6-) 8-13 cm de largo
(vs. 4-7 cm de largo), segments de (8-) 10-15 x 3-
5 mm (vs. segments de 5-8 x 2-3 mm), nervaduras
glabras a dispersamente escamosas (vs. densamente
escamosas) y las escamas plans (vs. abolladas).

Cyathea fulva habitat en M6xico y Centroamerica
hasta Nicaragua. Aparentemente, los registros
sudamericanos de esta especie correspondent a
determinaciones err6neas de Cyathea aurea Klotzsch,
C. caracasana (Klotzsch) Domin (s. 1.) o C. /,..l...
Sterb., principalmente, junto con algunas entidades
no reconocidas taxon6micamente de C. caracasana,
que requieren de mis studios. Incluso las variedades
de Cyathea caracasana probablemente correspondent a
species vAlidas, pero los especimenes fragmentarios
y la escasez de informaci6n sobre caracteristicas del
tallo, asi como sobre el tamafio de las frondas, hacen
dificil la delimitaci6n de estos taxa. Al menos Cyathea
caracasana var. maxonii (Underw.) R.M. Tryon
es notablemente diferente y geogrAficamente esta
separada.

Una caracteristica que ayuda a diferenciar Cyathea
fulva, C. povedae y C. caracasana (de Sudamerica)
son los pelos blanquecinos, patentes y largos; en las
pinnulas de C. fulva los pelos estdn restringidos s6lo
a las c6stulas, en C. povedae los pelos pueden estar en
c6stulas, venas y tejido laminar, y en C. caracasana se
hallan en c6stulas y venas inicamente, o no existen. Un
caso critic en la delimitaci6n de Cyathea caracasana
es C. caracasana var. boliviensis (Rosenst.) R.M.
Tryon, ya que present pelos largos como los de C.
.,'..i. pero en menor densidad y con escamas
abundantes sobre las c6stulas.

ETIMOLOGIA. Esta especie es dedicada al reconocido
dendr6logo costarricense Luis Poveda, por sus innu-
merables contribuciones a la flora de Costa Rica.


Clave de las species de Cyathea con indusio globoso en Costa Rica

1. Caspilla del estipite blanca..... ...............................................C. divergens var. divergens

1. C aspilla del estipite parda o ausente................................................................... ........................................ 2

2. Estipite atropurpfireo basalmente, castafio distalmente, brillante, inerme; caspilla ausente; plants generalmente
epifitas; pinnulas pediculadas, el pediculo 4-8 mm...................................................................C. gracilis

2. Estipite pardo-amarillento a pardo oscuro, opaco, espinoso; caspilla present; plants terrestres o raramente (C.
divergens) epifitas; pinnulas s6siles o pediculadas, el estipite hasta 3 mm........................ .............. 3


Vol. 5, N 3








ROJAS Nuevos taxa de helechos arborescentes


3. Escamas del peciolo doradas a pardo-amarillentas, haz y env6s con muchos pelos blanquecinos patentes......4

3. Escamas del peciolo pardas a pardo oscuro; haz y env6s con pelos blanquecinos dispersos o ausentes...........5

4. Estipite cominmente con pinnas subafleboides en la base; escamas de la c6stula y la vena central de los
segments blanquecinas a amarillentas (raro ambarinas), abundantes; tejido laminar entire las nervaduras
piloso; (2200-) 2500-3000 m ...... .......................................................................................... C. suprastrigosa

4. Estipite sin pinnas subafleboides en la base; escamas de la c6stula y la vena central de los segments pardas,
escasas a ausentes; tejido laminar entire las nervaduras glabro; 300-1200 (-1600) m........................C. :,. ....

5. Escamas costulares color ambar a pardas....................................... ...................C. caracasana var. maxonii

5. Escam as costulares blancas a am arillentas.................................................... ............................................ 6

6. Frondas de 1-2 m, estipite escamoso a todo lo largo; raquis escamoso en el dorso; pinnulas 4-7 cm de largo;
segments de 5-8 x 2-3 mm; nervaduras densamente escamosas. .......... .............. C. onusta

6. Frondas de (2-) 2.5-3.5 m, estipite escamoso s6lo en la base; raquis no escamoso; pinnulas (6-) 8-13 cm de
largo; segments de (8-) 10-15 x 3-5 mm; nervaduras glabras a dispersamente escamosas...............C. povedae


Rojas (2001) menciona err6neamente la existencia
en Costa Rica de Cyathea caracasana var. boliviensis
y de C. c. var. meridensis (H. Karst.) R.M. Tryon,
al interpreter inapropiadamente la clave de Tryon
(1976), debido a que en Costa Rica existen tres
formas reconocibles de C. caracasana var. maxonii.
Una de ellas se halla en la Cordillera de Tilarin y en
la Cordillera Central; se caracteriza por las escamas
del estipite ovado-lanceoladas, pardo-oscuras y casi
concoloras, con un leve margen mis claro, segments
cortos y anchos, tejido laminar coriAceo y pardo
oscuro al secar. La forma tipica tiene escamas del
estipite pardo-amarillentas, con la base y el margen
pardo oscuro, segments largos y angostos, tejido
laminar cartAceo y pajizo a pardo amarillento al secar.
Finalmente, existe una variedad en zonas altas de la
Cordillera de Talamanca, que difiere de la variedad
tipica por las escamas del estipite pardas a pardo-rojizas
y pelos estrigosos en el tejido laminar; se asemeja a C.
suprastrigosa, pero con escamas de las c6stulas pardo-
oscuras y escasas.

En la zona norte de Costa Rica, Smith &
Grayum (1988) descubrieron plants que presentan
caracteristicas intermedias entire C. stolzei A.R. Sm. ex
Lellinger y C. ursina (Maxon) Lellinger, al comparar
en un cuadro y en ilustraciones various caracteres, como
escamas del estipite y del raquis, nimero de pinnas,
incision de las pinnas, entire otros caracteres, que
evidencian un process de hibridaci6n.

Cyathea x smithiana A. Rojas, nothosp. nova

TIPO: COSTA RICA. Heredia: Sarapiqui, La Guaria,
Cerros Los Arrepentidos, entrando por el cementerio,


Tecnoforest delNorte S.A., 10"28'10"N, 84"01'40"W,
100-160 m, 6 jul 1998, A. Rojas & A. Soto 4693
(Holotipo: CR, isotipos: INB, MO, NY). Figs. 2 y 3.

Tallo hasta 0.3 m de alto, 1-3 cm de diimetro;
frondas de 1-1.3 m de largo; estipite dispersamente
muricado, pardo-amarillento a pardo, puberulento,
los pelos menos de 0.2 mm, blanquecinos a pardo-
amarillentos; escamas del estipite 5-10 x 1.0-2.5 mm,
linear-lanceoladas, bicoloras, con un delgado margen
blanco; caspilla ausente; limina pinnado-pinnatifida,
reducida gradualmente a un Apice pinnatifido; raquis
similar al estipite en indumento; pinnas incisas ca.
1/2 entire el margen y la costa, s6siles o escasamente
pediculadas; pinnas medias 10-14 x 2.5-3.0 cm;
costas glabrescentes o puberulentas, dispersamente
escamosas, las escamas 1.5-3.0 x 0.3-1.0 mm, ovadas
a lanceoladas, pardas; segments de las pinnas medias
15-20 pares, 4-5 mm de ancho, enteros; nervaduras 5-
8 pares por segment, simples o una vez bifurcadas;
tejido laminar entire las nervaduras glabro; soros
medios o ligeramente supramedios; parifisos mis
largos que los esporangios, conspicuous, blanquecinos
o hialinos; indusio escuamiforme, adpreso a la
superficie de la lamina.

HABITAT. Bosque muy h6medo tropical y bosque
muy h6medo tropical, transici6n a premontano.
DISTRIBUCION. Vertiente norte de la Cordillera Central,
Costa Rica, 100-1000 m. Hibrido end6mico.

PARATIPOS: COSTA RICA. Heredia: Cerros Sardinal,
ca. 2 km N of Chilamate de Sarapiqui (Finca La
Martita), 10"28'N, 8404'W, ca. 80-160 m, A. Smith


IANKESTERIANA 5(3):








LANKESTERIANA


et al. 1780 (CR, MO, UC).

ETIMOLOGIA. Este hibrido es dedicado a Alan Reid
Smith, quien lo not6 y lo comunic6 primeramente,
junto con Michael H. Grayum, pero sin asignarle un
nombre cientifico.

AGRADECIMIENTOS. A Carlos O. Morales por la
correcci6n del latin, a los curadores del Herbario
Nacional de Costa Rica (CR), del Instituto Nacional
de Biodiversidad (INB), de la Universidad Nacional
Aut6noma de M6xico (MEXU) y del New York
Botanical Garden (NY) por permitirme utilizar
sus colecciones. A los revisores an6nimos por sus
comentarios.

LITERATURE CITADA
Lellinger, D.B. 1987. The disposition of Trichopteris
(C. il.. .. .\,) i. Fern J. 77: 90-94.
Lellinger, D.B. 1989. The ferns and fern-allies from Costa


Rica, Panama, and the Choc6. Part I. Pteridologia 2A:
338-358.
Moran, R.C. 1995. Cnemidaria y Cyathea. In:
Davidse, G., M. Sousa & S. Knapp. (eds.). Flora
Mesoamericana. Vol. 1. Psilotaceae a Salviniaceae.
Univ. Nac. Aut6noma de M6xico. M6xico, D.F. p.
90-103.
Rojas, A.F 2001. Nuevas species, nombres
nuevamente utilizados y nuevas distribuciones en los
helechos arborescentes (Filicales: C:. ,Ii 1. .. I para
el neotr6pico. Rev. Biol. Trop. 49: 453-466.
Smith, A.R. & M.H. Grayum. 1988. Cyathea stolzei x
ursina, a distinctive tree fern hybrid from Costa Rica.
Amer. Fern J. 78: 105-108.
Stolze, R.G. 1974. A taxonomic revision of the genus
Cnemidaria (C. Iii. ..i. i Fieldiana, Bot. 37: 1-98.
Tryon, R.M. 1970. The classification of the C. ,li. 11
Contr. Gray Herb. 200: 3-53.
Tryon, R.M. 1976. A revision of the genus Cyathea.
Contr. Gray Herb. 206: 19-98.


Vol. 5, N 3









ROJAS Nuevos taxa de helechos arborescentes


HEfdPARIO HACIONAI. DR OOIgTA RICA (CR)


Fig. 1. Ejemplar tipo de Cyatheapovedae (A. Estrada et al. 1674, CR): a. Esp6cimen. b. Escamas del estipite.
c. Detalle de la limina. Cyatheafulva (J Mickel et al. 5373, MEXU): d. Escamas del estipite. e. Detalle de la
lImina.


IANKESTERIANA 5(3):








LANKESTERIANA


30 mm


20 mm


Fig. 2. Cyatheapovedae (A. Rojas et al. 4711, INB): a. Base del estipite. b. Escama del estipite. c. Detalle de la
limina.


Vol. 5, N 3








LANKESTERIANA 5(3):


ROJAS Nuevos taxa de helechos arborescentes


_A.


'1--/


r - . .4 _:






.:






'I -

p.



If
b cY





I,...


E


Fig. 3. Fronda de: a. Cyathea stolzei (A. Rojas &A. Soto 4692, INB). b. C. x smithiana (A. Rojas &A. Soto 4693,
INB). c. C. ursina (A. Rojas &A. Soto 4691, INB).


S:

t

i.
rr
-'


a



50 cm


r
I
rl


-A'






-~-I
''ii ...''-'

r 1. ... .
I 7-,~-

r A.


-~( I .

-* -

JIjl


-L -;* C
'I '


I


*^-








LANKESTERIANA


a








'I J '














dj


Fig. 4. Pinna media de: a. Cyathea stolzei (A. Rojas & A. Soto 4692, INB). b. C. x smithiana (A. Rojas &A. Soto
4693, INB). c. C. ursina (A. Rojas & A. Soto 4691, INB). Base de los estipites de: d. Cyathea stolzei (A. Rojas
&A. Soto 4692, INB). e. C. x smithiana (A. Rojas &A. Soto 4693, INB). f. C. ursina (A. Rojas &A. Soto 4691,
INB).


'I

1'
















.1


10 cm


10 mm


Vol. 5, N 3








LANKESTERIANA 5(3):201-210. 2005.


SINOPSIS DE NEOMIRANDEA (ASTERACEAE: EUPATORIEAE)
EN COSTA RICA

ALEXANDER RODRIGUEZ G.
Institute Nacional de Biodiversidad (INBio), apdo. 22-3100, Santo Domingo, Heredia, Costa Rica.
arodrig@inbio.ac.cr

ABSTRACT. The Costa Rican species of the genus Neomirandea (Asteraceae: Eupatorieae) are treated in a
synopsis. A new species is described and illustrated and its relationships are discussed.

RESUMEN. Se realize una sinopsis de las species del g6nero Neomirandea (Asteraceae: Eupatorieae) de Costa
Rica. Se describe e ilustra una nueva especie y se comentan sus afinidades.

PALABRAS CLAVE / KEW WORDS: Asteraceae, Neomirandea, Neomirandea pendulissima, Costa Rica


Neomirandea es un g6nero con alrededor de 28
species, incluyendo la descrita en este trabajo,
de las cuales 15 estan presents en Costa Rica. Se
distribuye desde Mexico hasta Colombia y su centro
de diversificaci6n abarca Costa Rica y Panama.
Este g6nero se caracteriza por estar constituido
por arbustos o arbolitos pequefios, en algunos casos
arbustos subescandentes; son epifitas o plants
terrestres; estas generalmente crecen en suelos ricos
en material organica; ademas, tienen hojas opuestas,
menos frecuente verticiladas, venaci6n pinnada o
palmada, capitulos discoides, con el receptaculo
desnudo o cortamente pubescente, bracteas involu-
crales subimbricadas, las internal facilmente
deciduas, las externas persistentes, estilos a veces
con la base alargada, corola a menudo pubescente en
la superficie intema, constituida por celulas anchas,
cuadradas, con las paredes laterales no situadas,
aquenios prismaticos, con un vilano cerdoso (King &
Robinson 1987).
En ausencia de notas que indiquen si la especie es
epifita o crece en suelos ricos en material organica,
algunas species pueden resultar dificiles de
identificar, incluso en el nivel gen6rico, principalmente
las pertenecientes al subg6nero Critoniopsis, las


cuales no poseen la base del estilo alargado ni la
corola pubescente en la superficie internal. Entre los
generos mas afines a Neomirandea tenemos Critonia
P Browne y Bartlettina R. King & H. Rob., que
pertenecen a la misma tribu y comparten, entire otros
caracteres, tipo de habito, posici6n de hojas, tipo de
capitulos, fl6sculos y aquenios, bracteas involucrales
intemas deciduas, receptaculo desnudo o pubescente,
corola glabra en la superficie internal y base del
estilo no alargada. Estos g6neros se distinguen de
Neomirandea principalmente debido a que presentan
celulas de la corola delgadas, con las paredes laterales
sinuadas.
Se han publicado various studios taxon6micos
sobreNeomirandea, g6nero que se basa enEupatorium
araliifolium Less. Trece species fueron reconocidas
por King & Robinson (1970), quienes aportaron una
clave dicot6mica de las mismas. Entre 1972 y 1975
se publicaron 11 species nuevas y una clave de las
species de Panama (King & Robinson 1975). Entre
1976 y 1985 se agregaron tres species nuevas, de las
cuales dos fueron publicadas por los autores citados.
Una sinopsis del g6nero en Costa Rica se present
a continuaci6n, incluyendo una clave y la descripcion
de un nuevo taxon.


CLAVE DE LAS SPECIES DE NEOMIRANDEA DE COSTA RICA

1.Hojas con el margen marcadamente serrado o lobado, env6s con nervadura conspicua
2 Lamina foliar fuertemente dentada o con 5-16 lobulos cortos e irregulares, nervadura palmada, base cordada,
subcordada, obtusa a cuneada, env6s con glandulas resinosas
3 Peciolos no alados; corola con la superficie intema pubescente; ramitas terminales generalmente con tallitos
y env6s de las hojas densam ente tom entosos................................. .................................... N. angularis
3" Peciolos alados, alas compuestas de dientes conspicuous, dispersos e irregulares; corola con la superficie
intema glabra; ramitas terminales glabrescentes a puberulentas ............................................. N. burgeri
2" Lamina foliar dentada (raras veces cortamente lobada en N. standleyi), nervadura pinnada a subpinnada,
base obtusa a corto-cuneada, env6s eglanduloso








LANKESTERIANA


4 Arbustos terrestres, lefiosos; hojas hasta 27 x 14 cm, con 9-12 pares de nervios secundarios; capitulos con
pedicelos hasta de 17 mm de largo, bracteas involucrales en 6-8 series, fl6sculos lila; aquenios 3.5-4.5 mm de
largo, vilano 3/4 o del mismo largo que los fl6sculos..................................................... ............. N. guevarii
4" Arbustos epifitos o sobre troncos en descomposici6n, sufruticosos; hojas hasta 41 cm x 24 cm, con 4-8 pares
de nervios secundarios; capitulos con pedicelos hasta de 8.5 mm de largo, bracteas involucrales en 3-4 series,
fl6sculos levemente lila a rosados; aquenios 2-2.5 mm de largo, vilano igual o escasamente mas largo que los
fl 6 scu lo s ............................................................................... ............. ........................ .................. N sta n d ley i
1 Hojas con el margen entero, subentero a esparcidamente dentado, env6s con nervadura conspicua a oscuramente
visible
5. Hojas verticiladas, entire 3 y 4 por nudo
6 Hojas 3 por nudo, hasta 7.55 x 2 cm, peciolos hasta 1 cm de largo, nervadura oscuramente visible, con
3-4 pares de nervios secundarios, enves con inconspicuas glandulas resinosas, en ocasiones ausentes;
inflorescencias entire 5-15 x 3-15 cm, pedunculos 2-5 cm de largo; capitulos con 4-5 fl6sculos, corola 4-5
mm de largo, con lobulos glandulares; Cordilleras de Guanacaste, Tilaran y Talamanca.........................
....................................................................................................... N. costaricensis
6" Hojas 3 o 4 por nudo, hasta 30 x 9 cm, peciolos hasta 9.5 cm de largo, nervadura conspicua, con 8-12 pares
de nervios secundarios, enves sin glandulas resinosas; inflorescencias entire 30-50 x 10-20 cm, pedunculos
5-15 cm de largo; capitulos con 12-16 fl6sculos, corola 6.5-7 mm de largo, con lobulos eglandulosos;
Cordillera de Talamanca y en Puriscal-Los Santos .................................. ................. N. pendulissima
5" Hojas opuestas, 2 por nudo
7 Hojas con peciolos 1.5-9 cm de largo, nervadura conspicuamente visible en ambas superficies,
eglandulosas en el env6s; corola esparcida a densamente pubescente en la superficie intema
8 Capitulos solitarios, con 13-24 fl6sculos, bracteas involucrales en 3 6 4 series; aquenios con pelos
diminutos y antrorsos en las costillas; hojas con lamina hasta 16 x 8.5 cm, peciolos hasta 8 cm de largo;
200-2 150 m de elevaci6n ........................................... ............................ ..................... N araliifolia
8" Capitulos 3 a 8 en glom6rulos o solitarios, con 1 a 6 fl6sculos, bracteas involucrales en 5 6 6 series;
aquenios glabros, menos frecuente con pelos diminutos y antrorsos en las costillas; hojas con lamina
hasta 10.5 x 6.5 cm, peciolos hasta 4.5 cm de largo; 1100-3150 m de elevacion
9 Capitulos solitarios o 2 6 3 por glom6rulo, pedunculos 1-5 mm de largo, con 4-6 fl6sculos; aquenios
glabros; enves de las hojas nunca barbado; 1100-3150 m de elevaci6n....................... N. turrialbae
9" Capitulos 3 a 8 por glom6rulo, s6siles o subs6siles, con 1 6 2 fl6sculos; aquenios glabros a
pubescentes en las costillas; enves de las hojas en ocasiones barbado en las axilas entire el nervio
central y los secundarios; 2300-3000 m de elevaci6n.................................................... N. psoralea
7" Hojas subs6siles o peciolos hasta 1.5 cm de largo excepto N. arthodes hasta 4.5 cm de largo), nervadura
obscura a conspicuamente visible en ambas superficies, con o sin glandulas en el env6s; corola sin pelos
en la superficie intema
10 Hojas subs6siles o peciolos hasta 0.4 cm de largo, apice obtuso o agudo; bracteas involucrales
intemas hasta 2.75 mm de largo; corola con esparcidas glandulas resinosas sobre toda la
superficie extem a ..................... ......... ........................................................... N allenii
10" Hojas pecioladas, peciolos hasta 3.5 cm de largo, apice agudo o acuminado (raras veces
obtuso en N. eximia); bracteas involucrales intemas hasta 8 mm de largo; corola sin glandulas
sobre la superficie extema, si presents entonces unicamente en el lado extemo de los lobulos
11 Capitulos con 12 a 15 fl6sculos; bracteas involucrales en 5 6 6 series, las extemas ovado-
orbiculares, hasta 2.25 mm de ancho, las intemas hasta 8 mm de largo
12 Tallitos solidos o fistulosos; hojas eglandulosas en el env6s; peciolos hasta 3.5 cm de
largo; capitulos con pedicelos hasta 7 mm de largo, con 11 6 12 fl6sculos, lobulos de la
corola eglandulosos; aquenios glabros.......................................................... N. arthodes
12" Tallitos solidos; hojas con glandulas resinosas en el env6s (al menos en hojas nuevas);
peciolos hasta 1 cm de largo; capitulos con pedicelos hasta 20 mm de largo, con 12 a 15
fl6sculos, lobulos de la corola glandulares; aquenios con pelos diminutos y antrorsos en
las costillas.............................................. ... ............. ... ............... N camr osa
11" Capitulos con 4 a 10 fl6sculos; bracteas involucrales en 3 6 4 series, las extemas


Vol. 5, N 3








RODRIGUEZ Sinopsis de Neomirandea (Asteraceae)


oblongas a oblongo-ovadas, hasta 1.25 mm de ancho, las intemas hasta 5 mm de largo
13 Inflorescencias 10-35 cm x 6-36 cm; capitulos con 7 a 10 fl6sculos, pedicelos
hasta 18 mm de largo; entrenudos de ramitas terminales con hojas reducidas y
sim ilares a escam as ............................................................................ N exim ia
13" Inflorescencias 4-20 x 4-20 cm; capitulos con 4 6 5 fl6sculos, pedicelos hasta
12 mm de largo; entrenudos de ramitas terminales carentes de hojas reducidas y
similares a escamas
14 Ramitas terminales y ejes de inflorescencias esparcida, densa y cortamente
pilosos; hojas hasta 12.5 x 5.5 cm; peciolos hasta 1.5 cm de largo; nervios
secundarios en 5 a 8 pares, ficilmente visible en el env6s; aquenios
glabrescentes; 1500-2000 m de elevaci6n ...................................... N. croatti
14" Ramitas terminales glabrescentes, ejes de la inflorescencia esparcidamente
puberulentos; hojas hasta 8.5 cmx 3 cm; peciolos hasta 0.8 cm de largo; nervios
secundarios en 2 6 3 pares, oscuramente visible en el env6s; aquenios glabros
o con diminutos y antrorsos pelos sobre las costillas; 550-1300 m de elevaci6n
........................................ ................................................ N p a ra sitica


Neomirandea allenii R.M. King & H. Rob., Rhodora
74 (798): 273-274. 1972.

DISTRIBUCION. Costa Rica a Colombia. En Costa
Rica la encontramos en los bosques muy himedos
de la vertiente caribe de la Cordillera de Talamanca,
alrededor de 700 m de elevaci6n.
FENOLOGIA. Flores enjulio.
Neomirandea allenii se distingue de las otras
species del g6nero presents en Costa Rica por sus
reducidos peciolos, los cuales son casi obsoletos o no
sobrepasan 4 mm de largo, por el apice de las hojas
obtuso o agudas y por sus fl6sculos esparcidamente
glandular-resinosos en toda la superficie extema;
ademas, se distingue por ser un arbusto epifito, con
hojas enteras a diminutamente denticuladas, nervadura
pinnada, bracteas involucrales extemas oblongas a
oblongo-ovadas, fl6sculos glabros en la superficie
intema y por los aquenios esparcidamente pilosos. En
Costa Rica se conocen solamente dos especimenes
de esta especie. Se podria confundir con las afines
N. eximia y N. parasitica, aunque 6stas se distinguen
facilmente por los peciolos mas largos, entire 2 y 12
mm.

ESPECIMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Lim6n: Talamanca, Crorifia, camino a Amubri,
Quebrada Crori y Quebrada Lumbeta., 09025'15"N,
82059'00"W, 800 m, 13 jul 1989,A. Chac6n 167(CR);
fila de exploraci6n minera entire el Rio Sukut y Rio
Carbri, Muragubishi, 09022'50"N, 82056'50"W, 700
m, 14jul 1989, G. Herrera 3285 (CR, INB).

Neomirandea angularis (B.L. Rob.) R.M. King & H.
Rob., Phytologia 19: 307. 1970.


Eupatorium angulare B.L. Rob., Contr. Gray Herb.
96: 19. 1931. E. fistulosum B.L. Rob., Proc. Boston
Soc. Nat. Hist. 31: 249. 1904.

DISTRIBUCION. End6mica en Costa Rica. Se encuentra
en bosques himedos y pluviales de la vertiente
pacifica en Puriscal-Los Santos y en ambas vertientes
en las Cordilleras de Guanacaste, Tilarin, Central y de
Talamanca, 400-2350 m de elevaci6n.
FENOLOGIA. Flores en abril y entire julio y noviembre.

Neomirandea angularis se reconoce por ser
un arbusto terrestre, con pubescencia densamente
tomentosa en ramitas terminales, hojas ampliamente
ovadas, a menudo con un gran numero de lobulos
cortos, connervadura palmada a subpalmada, env6s con
abundantes glandulas resinosas y fl6sculos pubescentes
en la superficie intema. Esta especie es afin a N. burgeri;
sin embargo, esta ultima present peciolos alados, los
fl6sculos son glabros en la superficie intema y las
parties vegetativas generalmente glabrescentes. Otras
species relacionadas son N. panamensis R.M. King
& H. Rob. y N. folsomiana M.O. Dillon & D'Arcy,
ambas end6micas en Panama.

ESPECIMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Alajuela: San Ramon, Cordillera de Guana-
caste, Monteverde, San Gerardo Biological Station,
trail to Garden, 500 m E of Station, 10022'N, 84048'W,
1200 m, 1 Jul 1995, D. Penneys 567 (INB). Cartago:
Cartago, Reserva Forestal de Rio Macho, Rio Queveri,
camino al ICE, 9042'50"N, 83050'10"W, 2200 m, 22
abr 1998, E. .!, r .* 1528 (INB); El Guarco, La Sierra,
cruce a San Cristobal, 09044'50"N, 83058'45"W,
1900-2005 m, 19 sept 1987, A. Rodriguez 2481 (INB).


IANKESTERIANA 5(3):








LANKESTERIANA


Heredia: Sarapiqui, Rara Avis, cerca 15 km al SO de
Horquetas, 10017'N, 84002'W, 400-600 m, 28 nov
1989, 0. Vargas 330 (INB). San Jose: Aserri, Zona
Protectora Cerros de Escazu, El Cedral, 09050'55"N,
84007'55"W, 2350m, 11 sept 1993, J.F Morales 1715
(INB).

Neomirandea araliifolia (Less.) R.M. King & H. Rob.,
Phytologia 19: 307. 1970.
Eupatorium araliifolium Less., Linnaea 6: 403-404.
1831.

DISTRIBUCION. M6xico a Panama. En Costa Rica se
le encuentra en los bosques himedos, muy hfimedos
y pluviales de la vertiente pacifica en Puriscal-Los
Santos y en ambas vertientes en las Cordilleras de
Guanacaste, Tilaran, Central y de Talamanca, 200-
2150 m de elevaci6n.
FENOLOGIA. Flores entire diciembre y abril.

Neomirandea araliifolia se reconoce por ser
un arbusto epifito o terrestre, con hojas enteras a
denticuladas, peciolos alargados, nervadura pinnada,
con nervios visible, eglandulosas en el enves de la
lamina, fl6sculos pubescentes en la superficie intema
y aquenios con diminutos y antrorsos pelos en las
costillas. Muy similar aN. psoralea y a N. turrialbae, de
las cuales result muy dificil de distinguir en condici6n
est6ril; se diferencia ya que estas ultimas poseen
capitulos con menor numero de fl6sculos, entire 1 y 6
(vs. 13 a 24 fl6sculos). Ademas, N. psoralea a menudo
tiene el enves de las hojas barbado en las axilas entire
el nervio central y los secundarios y capitulos s6siles o
subs6siles en glom6rulos.

ESPECIMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Alajuela: San Carlos, Cordillera de Tilaran,
Fortuna al Lago Arenal, 10029'40"N, 84043'20"W,
500 m, 2 abr 1994, B. Hammel 19555 (INB). Lim6n:
Cordillera de Talamanca, Reserva Biol6gica Hitoy
Cerere, 300 m aguas debajo de la confluencia del Rio
Hitoy Cerere, margen izquierda por la fila que lleva al
Cerro Bob6cara, 0939'00"N, 83002'45"W, 200 m, 20
abr 1989, G. Herrera 2428 (INB). Puntarenas: Coto
Brus, Parque Intemacional La Amistad, Cordillera
de Talamanca, Estaci6n Pittier, Sendero Altamira,
09001'30"N, 82057'40"W, 1670 m, 28 ene 1995, L.
Angulo 3 (INB); Puntarenas, Cordillera de Tilaran,
Monteverde, Sendero Tranquilo, 1.5 km SE of Cerro
Amigos, 10018'N, 84048'W, 1400 m, 27 Febr 1995, D.
Penneys 174 (INB). San Jose: Aserri, Zona Protectora


Cerros de Escazu, El Cedral, 09050'30"N, 84006'35"W,
2105 m, 30 dic 1993, J.. Morales 2190 (INB).

Neomirandea arthodes (B.L. Rob.) R.M. King & H.
Rob., Phytologia 19: 308. 1970.
Eupatorium arthodes B.L. Rob., Contr. Gray Herb.
68: 8. 1923.

DISTRIBUCION. Costa Rica y Panama. En Costa Rica se
encuentra en bosques pluviales de ambas vertientes
de la Cordillera de Talamanca, 1300-1900 m de
elevaci6n.
FENOLOGIA. Flores enjulio.
Neomirandea arthrodes se reconoce por ser un
arbusto escandente a subescandente, terrestre, con
hojas cortamente denticuladas, eglandulosas, nervadura
pinnada, con nervios oscuramente visible en el env6s,
capitulos con bracteas involucrales extemas ovado-
orbiculares y fl6sculos glabros en la superficie intema.
Esta especie se encuentra muy relacionada con N.
carnosa; sin embargo, esta ultima present hojas con
glandulas resinosas en el env6s (al menos en hojas
nuevas), lobulos de la corola glandulares, peciolos
mas cortos, hasta 10 mm de largo (vs. 2 a 45 mm de
largo) y pedicelos mas largos, hasta 20 mm (vs. 1 a 7
mm). Tambi6n se podria comparar con N. araliifolia,
N. eximia y N. psoralea.

ESPECIMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Cartago: Paraiso, Parque Nacional Tapanti,
camino a la represa Tapanti, en borde de la carretera,
09045'20"N, 83047'00"W, 1300 m, 20 jul 1994,
Q. Jimenez 1614 (INB); El Guarco, Cordillera de
Talamanca, bosque residual en el cruce de San
Cristobal Norte, 09046'54"N, 83059'36"W, 1900
m, 18 jun 1997, J.E Morales 6198 (INB). Heredia:
Reserva Forestal Cordillera Volcanica Central,
refugio Cerro Dantas, Cerro Chompipe, 10005'12"N,
84003'32"W, 1800 m, 6 jul 2002, R. Kriebel 391
(INB).

Neomirandea burgeri R.M. King & H. Rob.,
Phytologia 24(4): 282-283. 1972.
Neomirandea grosvenorii R.M. King & H. Rob.,
Phytologia 29(5): 354-356. 1975.

DISTRIBUCION. End6mica en Costa Rica. Se encuentra
en bosques pluviales de la vertiente caribe en las
Cordilleras Central y de Talamanca; tambi6n en la
vertiente pacifica de la Cordillera de Talamanca y en
los Cerros de EscazP, 2300-2750 m de elevaci6n.


Vol. 5, N 3








RODRIGUEZ Sinopsis de Neomirandea (Asteraceae)


FENOLOGIA. Flores en febrero, abril, julio, septiembre
y diciembre.

Neomirandea burgeri se distingue de las otras
species del g6nero que habitan en Costa Rica por
presentar peciolo alados, en los que las alas consistent
de dientes irregulares y dispersos a lo largo del peciolo;
ademas, se distingue por ser un arbusto terrestre, con
hojas ampliamente ovadas, irregularmente lobadas,
nervadura palmada a subpalmada, env6s con glandulas
resinosas y fl6sculos glabros en la superficie intema.
Esta especie es afin a N. angularis; sin embargo,
esta ultima nunca tiene peciolos alados, los fl6sculos
son pubescentes en la superficie intema y las parties
vegetativas son generalmente mas pubescentes.
Otras species relacionadas son N. panamensis y N.
folsomiana, ambas end6micas en Panama, pero ambas
se distinguen porque no muestran el peciolo alado o
6ste es levemente alado en la parte distal. Esta especie
tambi6n podria compararse con N. standleyi.

ESPECiMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Heredia: Upper Volcan Barva, Atlantic Slope
ca. 0.5 km below (to N of ) main trail to Laguna
Barva descending via old Sendero del transecto,
10008'18"N, 84006'33"W, 2750 m, 28 Abr 1992, B.
Boyle 800 (CR); Lim6n: Cordillera de Talamanca,
Atlantic slope, unnamed cordillera between the Rio
Terbi and the rio Sini, 09006'N, 82058'W, 2650 m, 13
Sept 1984, G. Davidse 29056 (CR); San Jose: Zona
Protectora Cerros de Escazu, El Cedral, 09051'21"N,
84008'36"W, 2300 m, 15 jul 2004, A. Estrada & G.
Vega 3593 (CR), 10050'55"N, 84007'55"W, 2350 m,
11 sept 1993, J.. Morales 1715 (CR, INB).

Neomirandea carnosa (Kuntze) R.M. King & H. Rob.,
Phytologia 19: 308. 1970.
Eupatorium carnosum Kuntze, Revis. Gen. P1. 1:
337. 1891.

DISTRIBUCION. Costa Rica y Panama. En Costa Rica se
le encuentra en bosques pluviales de la vertiente caribe
de la Cordillera de Talamanca; en la vertiente pacifica
en la Fila Costefia sur y en la Cordillera de Guanacaste,
1300-1900 m de elevaci6n.
FENOLOGIA. Flores entire junio y noviembre.

Neomirandea carnosa se distingue por ser un arbusto
epifito, con hojas enteras a denticuladas, glandulares,
con nervadura pinnada, oscuramente visible en
el env6s, bracteas involucrales extemas ovado-
orbiculares y fl6sculos glabros en la superficie intema.


Esta especie esta muy relacionada con N. arthrodes;
sin embargo, esta ultima carece de glandulas resinosas
en el env6s de la lamina, sus peciolos y pedicelos
podrian llegar a ser mas largos y los lobulos de la
corola son eglandulosos. Tambi6n podria compararse
con N. araliifolia, N. eximia y N. psoralea.

ESPECiMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Alajuela, Upala, Parque Nacional Volcan
Tenorio, Estaci6n Biol6gica Heliconia, 1042'10"N,
85002'40"W, 718 m, 19 jul 2001, J.L. Ch6vez
1250 (INB); sector Alto Los Brenes, 10043'08"N,
85002'13"W, 650 m, 21 ago 2001, J.L. Ch6vez 1299
(INB). Guanacaste: La Cruz, Santa Cecilia 9 km S,
08045'N, 83009'W, 1200 m, 20 ago 1993, V Ramirez
67 (INB); Parque Nacional Guanacaste, Estacion
Pitilla, Fila Orosilito y Sendero Nacho, 11 02'00"N,
85024'30"W, 700 m, 12 nov 1990, P. Rios 202 (INB);.
Puntarenas: Golfito, Fila Costefia, 8045'N, 83009'W,
650 m, 6 abr 1997, W Huber &A. ;ri\iilenhoKr 756
(INB).

Neomirandea costaricensis R.M. King & H. Rob.,
Phytologia 19: 308. 1970.

DISTRIBUCION. Costa Rica yNicaragua. En Costa Rica se
le encuentra en bosques pluviales de ambas vertientes
en las Cordilleras de Guanacaste, Tilarin, Central y de
Talamanca, 400-2350 m de elevaci6n.
FENOLOGIA. Flores entire abril y octubre.

Neomirandea costaricensis se distingue de las
otras species del g6nero presents en Costa Rica por
presentar hojas verticiladas characterr compartido con
N. pendulissima), con 3 hojas por nudo; ademas, es un
arbusto epifito, con nervios de las hojas oscuramente
visible en el env6s, bracteas involucrales con
glandulas resinosas, fl6sculos glabros en la superficie
intema y lobulos de la corola glandular-resinosos.
Se podria comparar con N. pendulissima, la cual se
distingue por tener 3 6 4 hojas por nudo y lamina
foliar e inflorescencias mas grandes (ver adelante
comentarios sobre esta ultima). Tambi6n es similar a
N. parasitica, la cual se distingue facilmente debido a
que posee hojas opuestas, nunca verticiladas.

ESPECiMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Cartago: El Guarco, Parque Nacional Tapanti-
Macizo de la Muerte, La Esperanza del Guarco,
09041'35"N, 83052'03"W, 2840 m, 21 abr 1999, M.
Alfaro 125 (INB). Guanacaste: Parque Nacional
Guanacaste, Estaci6n Mengo, Volcan Cacao, 10055'N,


IANKESTERIANA 5(3):








LANKESTERIANA


85028'W, 1250 m, 15 jul 1989, I IABio 190 (INB).
Heredia: San Rafael, Reserva Forestal Cordillera
Volcanica Central, Cerro Chompipe, 10005'13"N,
84004'23"W, 2100 m, 16 mayo 1997, B. Gamboa
1399 (INB); Parque Nacional Braulio Carrillo, Volcan
Barva, 10008'05"N, 84006'20"W, 2800 m, 6 oct 1989,
G. Rivera 75 (INB). San Jose: Dota, Reserva Forestal
Los Santos, camino a Providencia de Dota, 9036'37"N,
83049'33"W, 2900 m, 25 jun 1997, B. Gamboa 1581
(INB).

Neomirandea croatii R.M. King & H. Rob., Phytologia
29(5): 352-353. 1975.

DISTRIBUCION. Costa Rica y PanamA. En Costa Rica
se encuentra en los bosques pluviales de la vertiente
caribe de la Cordillera de Talamanca y en la vertiente
pacifica de la Cordillera de Tilaran, 1500-2000 m de
elevaci6n.
FENOLOGIA. Flores en marzo y abril.

Neomirandea croatii se distingue de las otras
species del g6nero presents en Costa Rica por
presentar tallitos densa y cortamente hirsutos; ademas,
es un arbusto epifito, a veces crece sobre troncos en
descomposici6n, tiene lamina foliar con el margen
denticulado y nervadura pinnada, capitulos con
bracteas involucrales extemas oblongas a oblongo-
ovadas y fl6sculos glabros en la superficie intema.
Se podria comparar con N. costaricensis, N. eximia y
N. parasitica, que se diferencian por mostrar tallitos
glabrescentes o apenas puberulentos.

ESPECIMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Guanacaste: Tilaran, Cordillera de Tilaran,
1 km SW from Santa Elena Reserve, along road,
10020'N, 84048'W, 1500 m, 26 Mar 1995, D.
Penneys 284 (INB). Lim6n: Talamanca, Cordillera
de Talamanca, Quebrada Kuisa, de union del Rio
Lori hasta el Sendero de Ujarras a San Jose Cab6car,
09022'55"N, 83014'10"W, 2000 m, 25 mar 1993,
A. Fern6ndez 834 (INB). Puntarenas: Puntarenas,
Cordillera de Tilaran, Reserva Biol6gica Monteverde,
Estaci6n El Valle, 10018'45"N, 84046'23"W, 1500
m, 21 abr 1995, A. Azofeifa 84 (INB); Santa Elena,
Sendero Orquideas, 10008'16"N, 84047'55"W, 1520
m, 15 mar 1996, K. Martinez 555 (INB).

Neomirandea eximia (B.L. Rob.) R.M. King & H.
Rob., Phytologia 19: 309. 1970.
Eupatorium eximium B.L. Rob., Contr. Gray Herb.
73: 11. 1924.


DISTRIBUCION. Costa Rica y Panama. En Costa Rica
se encuentra en bosques muy himedos y pluviales de
ambas vertientes en las Cordilleras de Guanacaste,
Tilarin, Central y de Talamanca, 70-2500 m de
elevaci6n.
FENOLOGIA. Flores entire enero y abril, ademis en agosto
y noviembre.

Neomirandea eximia se distingue de las otras espe-
cies del g6nero por mostrar frecuentemente entrenu-
dos de ramitas terminales con hojas reducidas y simi-
lares a escamas, product de un aparente crecimiento
abortive de las hojas; ademas, es un arbusto epifito,
s61oo ocasionalmente terrestre, hojas con el margen en-
tero a diminutamente denticulado, nervios la mayoria
oscuramente visible en el env6s, nervadura pinnada,
capitulos con bracteas involucrales extemas oblongo-
ovadas y fl6sculos glabros en la superficie intema. Esta
especie es muy variable en cuanto a presencia y abun-
dancia de glandulas resinosas en el enves de las hojas,
bracteas involucrales y fl6sculos; tambi6n la pubescen-
cia en aquenios es variable.
Neomirandea eximia podria compararse con N.
arthrodes, N. carnosa, N. croatii y N. parasitica; de
6stas es dificil de distinguir vegetativamente (ver
la clave y las discusiones pertinentes). Tambi6n, es
similar a N. chiriquensis R.M. King & H. Rob., especie
end6mica en Panama; sin embargo, se diferencian
debido a que en esta ultima los entrenudos de las
ramitas terminales carecen de hojas reducidas y la
lamina foliar generalmente es mas ancha, hasta 6.5 cm
(vs. hasta 4 cm).

ESPECIMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Cartago: Paraiso, Parque Nacional Tapanti,
alrededores de la estaci6n, 09045'N, 83047'W, 1200
m, 27 febr 1997, A. Rodriguez 2035 (INB). Limon:
Limon, El Progreso, siguiendo la fila a Cerro Matama,
09047'20"N, 83007'30"W, 1600 m, 23 abr 1989, G.
Herrera 2742 (INB). Puntarenas: Buenos Aires,
Parque Nacional La Amistad, sendero a Cerro Cab6car,
09020'43"N, 83022'54"W, 2800 m, 8 sept 2000,
A. .!i/...* 3371 (INB); Cerro Hoffmann, 09006'N,
82059'W, 2000-2500 m, 7 ago 1997, J. Quesada 1980
(INB); Puntarenas, Cordillera de Tilaran, San Luis,
Rio Veracruz, Monteverde, 10015'10"N, 84047'30"W,
1100 m, 22 nov 1993, Z. Fuentes 576 (INB).

Neomirandea guevarii R.M. King & H. Rob.,
Phytologia 24(4): 283-284. 1972.
DISTRIBUCION. End6mica en Costa Rica. Se le encuentra


Vol. 5, N 3








RODRIGUEZ Sinopsis de Neomirandea (Asteraceae)


en bosques pluviales de la vertiente caribe en las
Cordilleras de Tilarin, Central y de Talamanca, 1300-
1600 m de elevaci6n.
FENOLOGIA. Flores en febrero y marzo.

Neomirandea guevarii se reconoce por ser un
arbusto terrestre, con hojas gruesa e irregularmente
dentadas, nervadura pinnada, facilmente visible en
ambas superficies, inflorescencias amplias y fl6sculos
pubescentes en la superficie intema.

ESPECIMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Alajuela: Reserva Biol6gica Monteverde
Atlantic slope, 10018'N, 84046'W, 1250-1550 m, 1
Mar 1992, W Haber 11038 (INB). Cartago: Paraiso,
Parque Nacional Tapanti-Macizo de la Muerte, Alto
El Roble, 09043'35"N, 83051'24"W, 2140 m, 16
mar 2002, E. Alfaro 3914 (INB); Estaci6n Tapanti,
Rio Grande de Orosi, sector la represa, 09045'20"N,
83047'00"W, 1300 m, 8 mar 1995, G. Mora 528
(INB); bosque primario en el Sendero Arboles Caidos,
09044'53"N, 83046'55"W, 1600 m, 31 mar 1995, J.F.
Morales 3822 (INB). Lim6n: Talamanca, Cordillera
de Talamanca, along Quebrada Kuisa, (triburary of Rio
Lori) near crossing of Ujarras-San Jos6 Cab6car trail,
09020'30"N, 83014'00"W, 2100 m, 13 Mar 1993, M.
Grayum 10284 (INB).

Neomirandeaparasitica (Klatt) R.M. King & H. Rob.,
Phytologia 19: 309. 1970.
Eupatorium parasiticum Klatt, Ann. K.K. Naturhist.
Hofmus. 9: 357. 1894.

DISTRIBUCION. End6mica en Costa Rica. Se encuentra
en bosques pluviales sobre ambas vertientes en las
Cordilleras de Guanacaste y Tilarin, 550-1300 m de
elevaci6n.
FENOLOGiA. Flores la mayor parte del afio.

Neomirandea parasitica se reconoce por ser un
arbusto epifito o crecer en troncos en descomposici6n,
por presentar hojas pequefias, hasta 8.5 cm de largo y
3 cm de ancho, con el margen subentero a denticulado,
nervios oscuramente visible en el env6s, nervadura
pinnada, capitulos con bricteas involucrales extemas
oblongo-ovadas y fl6sculos glabros en la superficie
intema. Esta especie en ocasiones se confunde con N.
costaricensis, pero esta ultima present hojas temadas.
Tambi6n es muy afin a N. eximia y probablemente se
hibridiza con 6sta; se distinguen porque N. parasitica
posee capitulos con menor numero de fl6sculos, entire
4 y 5 (vs. 7 a 10 fl6sculos). En la Flora de Nicaragua


(Turner 2001) se incluy6 esta especie err6neamente, ya
que el unico esp6cimen citado por el autor (Neill 2314,
MO) y tratado como Eupatorium parasiticum Klatt
corresponde realmente a N. costaricensis.

ESPECiMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Alajuela: Guatuso, Parque Nacional Volcan
Tenorio, El Pil6n, sector Los Teflideros, 1042'16"N,
84059'32"W, 800 m, 9 jul 2000, J.L. Chavez 608
(INB); Upala, Parque Nacional Guanacaste, Estacion
San Ramon, Dos Rios, Sendero El Argentino,
10052'50"N, 85024'05"W, 550 m, 27 ene 1995, F
Quesada 207 (INB). Guanacaste: Liberia, Parque
Nacional Guanacaste, Estaci6n Cacao, Sendero
Maritza, 10055'43"N, 85028'10"W, 1100 m, 9 febr
1995, L. Angulo 73 (INB); Estaci6n Pitilla, Sendero
Nacho, 11002'00"N, 85024'30"W, 700 m, 2 febr 1991,
P. Rios 334 (INB); Tilaran, 1-2 km west of Lago de
Cote, 13 km north of Tilaran, 10035'N, 84056'W, 800-
900 m, 24 Aug 1993, W Haber 11655 (INB).

Neomirandeapendulissima Al. Rodr., sp. nova

TIPO: Costa Rica. Puntarenas: Coto Brus, Parque
Intemacional La Amistad, Estaci6n Pittier, Rio Cot6n,
Aguas Calientes, 09001'30"N, 82057'40"W, 1000 m,
1 febr 1995, L. Angulo & IVCurso de Paratax6nomos
26 (holotipo: INB, isotipos: CR, MO). Fig. 1.

A congeneribus verticillis foliorum usque tri- vel
i... ,7;.li.,i,, vestitis et inflorescentiis longioribus
pendulisque drr i

Arbusto lefioso, epifito. Tallitos teretes, estriados,
glabros, solidos, no fistulosos. Hojas verticiladas, entire
3 y 4 por nudo; peciolos 4-9.5 cm de largo; lamina 12-
21 x 4-9 cm, eliptica a ovado-eliptica, base obtusa a
cuneada, margen subentero, crenado a esparcida y
conspicuamente dentado, apice agudo o acuminado,
nervadura pinnada, glabrescente a esparcidamente
puberulenta en ambas superficies, con 8 a 12 pares
de nervios secundarios evidentes en el haz y en el
env6s, eglandulosas en el lado abaxial. Inflorescencias
de largas paniculas, 30-50 x 10-20 cm, pedunculos
5-15 cm de largo, conspicuamente p6ndulas, ejes
puberulentos. Capitulos discoides; pedicelos 1-5
mm de largo; bricteas involucrales en 3 o 4 series
desiguales, las intemas mas largas, subimbricadas,
oblongas a oblongo-lanceoladas, apice agudo, menos
frecuente obtuso, puberulentas principalmente hacia
el margen, series extema 1.25-1.5 x 0.5-0.75 mm,
persistent, series intema 4-6 x 0.75-1 mm, facilmente


IANKESTERIANA 5(3):








LANKESTERIANA


decidua; receptaculo 0.75-1 mm de diametro, aplanado,
cortamente pubescente; fl6sculos 11 a 16, corola 6.5-
7 mm de largo, hipocrateriforme, lila, glabra en la
superficie extema e intema, lobulos 0.35-0.5 mm
de largo, levemente mas largos que anchos, glabros,
eglandulosos y papilosos en la superficie extema, lisos
en la superficie intema, anteras 1.25-1.5 mm de largo
(sin incluir apendice apical), apendice 0.25-0.3 mm de
largo, oblongo-ovado, mas largo que ancho, hialino,
base del estilo alargada, glabra. Aquenios 2-2.5 mm de
largo, prismaticos, pentacostados, con pelos antrorsos
y diminutos en las costillas; vilano una series de 30 a


B.


D. E.


0.5cm


40 cerdas capilares, 5.5-6.5 mm de largo, con tamafio
similar al de los fl6sculos, con diminutos tricomas
antrorsos.

DISTRIBUCION. Especie end6mica en Costa Rica.
Habita en bosques pluviales de la vertiente caribe de
la Cordillera de Talamanca; en la vertiente pacifica se
hall en Puriscal-Los Santos, a 1000 m de elevaci6n.
FENOLOGIA. Flores entire enero y febrero.

Neomirandeapendulissima se reconoce por producer
3 6 4 hojas por nudo e inflorescencias muy largas y


'II
.1


3cm


Fig. 1. Neomirandea pendulissima Al. Rodr. (L. Angulo & IVCurso de Parataxdnomos 26, INB).
A. Habito. B. Capitulo. C y D. Fl6sculo. E. Aquenio.


Vol. 5, N 3








RODRIGUEZ Sinopsis de Neomirandea (Asteraceae)


pendulas; ademas, se distingue por ser un arbusto
epifito, por sus hojas con alargados peciolos, con margen
subentero, crenado a esparcida y conspicuamente
dentado, eglandulosas en el env6s, con nervadura
pinnada facilmente visible, fl6sculos glabros en la
superficie intema, con lobulos cortos y eglandulosos en
la superficie extema, y aquenios con pelos antrorsos y
diminutos en las costillas.
En este g6nero, otras species con hojas en verticilos
son N. costaricensis y N. ternata R.M. King & H. Rob.;
sin embargo, estas ultimas se distinguen debido a que
siempre tienen 3 hojas por nudo, los peciolos mas cortos
(0.1-0.9 cm), la lamina mas pequefia (1-10 x 0.3-4.2 cm)
y las inflorescencias mas cortas (5-25 x 8-20 cm).
ETIMOLOGiA. El epiteto latinopendulissima hace alusion
a las inflorescencias conspicuamente p6ndulas.

PARATIPO: Costa Rica. San Jose: Dota, Nara, 2 km
camino a San Isidro, 09030'15"N, 84000'00"W, 1000
m, 13 ene 2003, F Morales 10206 (CR, INB, MO).

Neomirandea psoralea (B.L. Rob.) R.M. King & H.
Rob., Phytologia 19: 308. 1970.
Eupatorium psoraleum B.L. Rob., Proc. Boston
Soc. Nat. Hist. 31: 253. 1904. Neomirandea biflora
R.M. King & H. Rob., Phytologia 29(5): 351-352.
1975.

DISTRIBUCION. End6mica en Costa Rica. Se le
encuentra en bosques pluviales de ambas vertientes
en las Cordilleras Central y de Talamanca, 2300-3000
m de elevaci6n.
FENOLOGIA. Flores entire abril y septiembre.

Neomirandea psoralea se distingue de las otras
species del g6nero que habitan en Costa Rica por
tener 3-11 capitulos s6siles o subs6siles por glom6rulo,
cada capitulo con 1 6 2 fl6sculos; ademas, es un
arbusto epifito, ocasionalmente escandente, con hojas
enteras, eglandulosas, peciolos alargados, entire 0.5 y
4.5 cm de largo, nervadura pinnada, nervios visible,
en ocasiones env6s barbado en las axilas formadas
entire el nervio central y los secundarios, y fl6sculos
pubescentes en la superficie intema. Esta especie esta
muy relacionada con N. araliifolia y N. turrialbae;
sin embargo, estas ultimas poseen capitulos con
pedicelos entire 2 y 9 mm de largo, agrupados o no
en glom6rulos, con mayor numero de fl6sculos por
capitulo, entire 3 y 24, lobulos de la corola menos
incisos en el limbo, aquenios glabros o con tricomas
diminutos y antrorsos en las costillas (vs. glabros) y a
menudo se distribuyen a menor elevaci6n, entire 200


y 3150 m de elevaci6n.

ESPECiMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Cartago: El Guarco, Reserva Forestal
Los Santos, Estaci6n Ojo de Agua, 09037'16"N,
83049'43"W, 3000 m, 26 jun 1997, B. Gamboa
1596 (INB). Heredia: Barva, Parque Nacional
Braulio Carrillo, Cordillera Central, Estaci6n Barva,
10007'49"N, 84007'32"W, 2680 m, 17 sept 1994,
E. Lepiz 538 (INB); 10007'40"N, 84008'10"W,
2630 m, 22 mayo 1990, G. Rivera 326 (INB);
10007'22"N, 84007'15"W, 2300 m, 24 jun 1990,
G. Varela 122 (INB). Lim6n: Talamanca, Parque
Nacional La Amistad, Tararia, Cerro Kasir y Cerro
Nai, 09012'40"N, 83004'04"W, 3000-3100 m, 20 jul
2000, E. Alfaro 3242 (INB).

Neomirandea standleyi (B.L. Rob.) R.M. King & H.
Rob., Phytologia 19: 308. 1970.
Eupatorium standleyi B.L. Rob., Contr. Gray Herb.
77:40. 1926.
Eupatorium brenesii Standl., Publ. Field Mus. Nat.
Hist., Bot. Ser. 18(4): 1461. 1938.

DISTRIBUCION. Costa Rica y Panama. En Costa Rica
se encuentra en bosques muy hfimedos y pluviales de
ambas vertientes de las Cordilleras de TilarAn, Central
y de Talamanca, 530-2050 m de elevaci6n.
FENOLOGIA. Flores entire diciembre y marzo.

Neomirandea standleyi se reconoce por ser un
arbusto sufruticoso, a menudo subescandente, con
tallitos poco o nada lignificados, epifito o creciendo
sobre troncos en descomposici6n, con hojas dentadas,
nervadura pinnada y fl6sculos esparcidamente
pubescentes en la superficie intema. Esta especie es
muy afin a N. homogama (Hieron.) H. Rob. & Brettell,
de Panama, Colombia y Ecuador, pero los capitulos de
esta tienen mayor numero de fl6sculos entiree 14 y 21
vs. 5 a 12) en la mayoria de los casos, los fl6sculos
generalmente mas largos, entire 5 y 7 mm (vs. 4.5-5
mm) y bracteas involucrales ovadas (vs. oblongas a
elipticas).

ESPECiMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Cartago: Paraiso, Parque Nacional Tapanti,
entrada al Sendero Arboles Caidos, 09043'54"N,
83046'48"W, 1450 m, 18 febr 2000, L. Acosta 343
(INB); alrededores de la estaci6n Tapanti, 09045'N,
83047'W, 1200 m, 27 febr 1997, A. Rodriguez 2042
(INB). Lim6n: Pococi, Parque Nacional Braulio
Carrillo, estaci6n Quebrada Gonzalez, Sendero La
Palma y alrededores, 10009'15"N, 83056'15"W,


IANKESTERIANA 5(3):








LANKESTERIANA


530 m, 5 abr 1999, A. Rodriguez 4747 (INB).
Puntarenas: Puntarenas, Sendero La Catarata, por el
rio, 1016'20"N, 84049'30"W, 1100 m, 5 mar 1993, Z.
Fuentes 198A (INB). San Jose: Vazquez de Coronado,
Parque Nacional Braulio Carrillo, Cordillera Central,
cerca de 5 km N del tunel Zurqui, 10006'10"N,
83058'40"W, 1100 m, 5 dic 1995, B. Hammel 20007
(INB).

Neomirandea turrialbae R.M. King & H. Rob.,
Phytologia 30(1): 10, f. 1975.

DISTRIBUCION. End6mica de Costa Rica. Se le
encuentra en bosques pluviales de ambas vertientes
de las Cordilleras de TilarAn, Central y de Talamanca,
1100-3150 m de elevaci6n.
FENOLOGIA. Flores en abril y mayo y entire agosto y
octubre.

Neomirandea turrialbae se reconoce por ser un
arbusto, raras veces un bejuco, epifito o terrestre, con
capitulos solitarios u ocasionalmente en glomerulos de
2 6 3 capitulos, la mayoria pedicelados, pedicelos hasta
5 mm de largo, con 4 a 6 fl6sculos pubescentes en la
superficie intema, hojas enteras, eglandulosas, peciolos
alargados, entire 0.5 y 4.5 cm de largo, nervadura
pinnada y facilmente visible. Esta especie esta muy
relacionada con N. psoralea y N. araliifolia; podria
considerarse como un estado intermedio entire ambas
species debido a que compare caracteristicas entire
ellas. Se ha mantenido separada debido a que el numero
de fl6sculos por capitulo es constant y diferente al
de las species mencionadas antes, entire 3 y 6 por
capitulo (vs. 1 6 2 fl6sculos en N. psoralea y 13 a 24
en N. araliifolia). Ademas, N. psoralea posee capitulos
siempre sesiles en glomerulos, 16bulos de los fl6sculos
generalmente mas incisos y aquenios siempre glabros
(vs. diminuto-pubescentes en las costillas o glabros),
mientras que N. araliifolia posee capitulos con mayor
numero de fl6sculos. En esta sinopsis se interpreta que
N. turrialbae es una especie variable por la presencia
o la ausencia de tricomas en la superficie extema de la


corola y en los aquenios.

ESPECIMENES REPRESENTATIVES EXAMINADOS. COSTA
RICA. Puntarenas: Coto Brus, Parque Nacional La
Amistad, Cerro Echandi, 0901'57"N, 82049'19"W,
3000-3150 m, 14 abr 1998, E. Alfaro 1625 (INB);
Parque Intemacional La Amistad, paramo del Cerro
Echandi, 09001'57"N, 82049'19"W, 3000-3150 m,
13 ago 1997, J. Quesada 1993 (INB); Puntarenas,
Reserva Biol6gica Monteverde, Quebrada Veracruz,
10015'N, 84048'W, 1600 m, 11 ene 1990, E. Bello
1744 (INB); Cerro Ojo de Agua, Estaci6n Leonel
Hemandez, 10014'46"N, 84046'00"W, 1600 m,
24 ago 1993, E. Bello 5241 (INB), E. Bello 5269
(INB).

AGRADECIMIENTOS. El autor desea agradecer a Claudia
Arag6n por la preparaci6n de la ilustraci6n, a Francisco
Morales por el aporte de nuevos especimenes y de
fotografias de Neomirandea pendulissima y a Frank
Almeda por su ayuda en la diagnosis latina.

LITERATURE CITADA
King, R.M. & Robinson, H. 1970. Studies in
the Eupatorieae (Compositae). A new genus,
Neomirandea. Phytologia 19: 304-310.
----- & ----------. 1975. Studies in the
Eupatorieae (Asteraceae). Two new species of
Neomirandea. Phytologia 30: 9-14.
--------------& ----------. 1975. Compositae. In:
Woodson, R.E. Jr. & Schery, R.W. (ed.). Flora of
Panama. Ann. Missouri Bot. Gard. 62: 981-991.
---- & ----------. 1985. Studies in the
Eupatorieae (Asteraceae). Additional species from
Tropical America. Phytologia 58 (4): 258-272.
-------------- & ----- ---. 1987. The Genera of
Eupatorieae (Asteraceae). Syst. Bot. Monogr. 22:
1-581.
Turner, B.L. 2001. Asteraceae. In: Stevens, W.,
C. Ulloa, A. Pool & O. Montiel (eds.). Flora de
Nicaragua. Monogr. Syst. Bot. Missouri Bot.
Gard. 85(1): 2452-2467.


Vol. 5, N 3








LANKESTERIANA5(3): 211-218. 2005.


PLEODENDRON COSTARICENSE (CANELLACEAE), A NEW SPECIES
FOR COSTA RICA

BARRY E. HAMMEL1' 2 AND NELSON A. ZAMORA2' 3
'Missouri Botanical Garden, PO. Box 299, St. Louis, Missouri 63166, USA.
2Instituto Nacional de Biodiversidad (INBio), apdo. 22-3100, Santo Domingo, Heredia, Costa Rica.
3Organizaci6n para Estudios Tropicales (OET), apdo. 676-2050, San Pedro, Costa Rica.

ABSTRACT. Pleodendron costaricense, a very rare, lowland rainforest tree known from southern Pacific Costa
Rica is described and illustrated. Its only congener, P. macranthum, grows about 2000 km to the northeast,
in Puerto Rico. The only other member of the family Canellaceae known from Central America is the mostly
West Indian, Canella winterana, which reaches the Yucatan Peninsula of Mexico.

RESUMEN. Se describe e ilustra Pleodendron costaricense, una especie de arboles muy rara en el bosque
lluvioso de bajura del Pacifico Sur de Costa Rica. La unica otra especie congenerica, P. macranthum, se
encuentra ca. 2000 km al nordeste, en Puerto Rico. Hasta ahora, la unica especie de Canellaceae conocida en
Centroamerica era Canella winterana, principalmente de las Antillas, que llega a la Peninsula de Yucatan en
Mexico.

KEY WORDS / PALABRAS CLAVE: Canellaceae, Pleodendron, Central America, Costa Rica, West Indies, disjunct


The new species of Pleodendron (Canellaceae) de-
scribed below was discovered in Costa Rica just as
the rediscovery of Takhtajania perrieri (Capuron)
Baranova & J.-E Leroy (Winteraceae) in Madagascar
was making news (e.g., Schatz et al. 1998, Schatz
2000). Though coincidental, these discoveries nev-
ertheless merit mention together, their respective
families being sister taxa (e.g., Karol et al. 2000) and
among those often considered most closely related
to (or least changed from), the earliest angiosperms.
Such so-called living fossils always stimulate consid-
erable interest; the study of their morphology, biology
and ecology can give us insight into what the world
was like millions of years ago.

The disjunct ocurrence of Pleodendron in Costa
Rica and Puerto Rico adds another data point to our
understanding of the complex biogeography of the
region. But what kind of research program is most
productive of such discoveries? In our view, general
surveys, especially those coupled to a Flora project,
can be more productive than efforts to find one specific
item. Takhtajania perrieri was for many years the
object of a concerted exploration of the type locality,
but was only recollected as a result of a general
botanical inventory of a different area (Schatz et al.
1998). Even that material might still lay incorrectly and
tentatively determined (Schatz 2000) were it not for
the stimulus provided through the Generic Tree Flora
c.r I\ ..,..._...." (Schatz 2001) project. The evidence of
Pleodendron, coupled with numerous other examples


from the Manual de Plantas de Costa Rica project,
although anecdotal, clearly demonstrates the value of
general surveys and flora projects in stimulating major
discoveries (e.g., Zamora et al. 2004a). We challenge
fund-raisers and grant reviewers, in the current
theatre of difficult times, to reconsider the value of
generalized research; the rewards are great, many, and
unpredictable.

Pleodendron costaricense N. Zamora, Hammel & R.
Aguilar, sp. nova

TYPE: Costa Rica; Puntarenas, canton de Parrita, cuenca
del Rio Pirrfs-Damas; Parrita, pie del Cerro Cabeza
de Chancho, camino al Carmen, valle del Rio Palo
Seco, 300 m, 26 mar 2000 (fl), N. Zamora et al. 2986
holotypee: INB, isotypes: BH, CR, JBSD, K, MO, P
U, US). Fig. 1.

Dijtert a Pleodendro macrantho floribus multo
minoribus, petalis circa dimidium brevioribus.
(It differs from P. macranthum by its much smaller
flowers, the petals shorter by ca. 1/2).

Tree, 15-35 m tall; external bark gray and white,
weakly fissured and scaly; internal bark pale pink,
aromatic; twigs pale gray, glabrous, lenticelate
near apex, often with clusters of bud scale scars,
presumably produced during periods of slow growth;
terminal buds 9 x 2 mm, ovate-falcate, the young
leaves convolutely folded and their margins minutely








LANKESTERIANA


ciliate; stipules lacking. Leaves distichous; petiole 5-
12 mm long, canaliculate above, articulate at the base;
lamina 7-15.5 x 3.5-5.5 cm, oblong, basally obtuse
to acute, sometimes weakly decurrent, apically acute
to slightly acuminate, with an acumen to 7 mm long,
glabrous on both surfaces, glossy above when dry,
the midrib impressed above, raised below and turning
reddish when dry, the major lateral veins 12-13 pairs,
the tertiary venation conspicuously reticulate on both
sides, the margin entire and weakly revolute near the
base when dry; numerous, clear, gland dots visible
(most readily on upper surface) only with hand lens;
flavor peppery hot. Flowers solitary, or in fasciculate
clusters of 2-4 flowers, axillary or slightly supra-
axillary, sometimes spread along leafless portions of
twigs and there born axillary to congested bud scale
scars. Pedicels 2-5 mm long, often with numerous,
spirally arranged, imbricate bracteoles, the lower
ones ca. 0.5 mm, the distal ones 1-3 mm, circular or
semicircular. Floral buds globose, ca. 6 x 6 mm. Calyx
cupular or campanulate, glabrous, 3-lobed, with a short
tube 1-1.5 mm, the lobes 1-1.5 mm long, rounded and
slightly imbricate, minutely ciliate. Petals 12, free,
apically obtuse to rounded, glabrous, in three distinct
series, the outer 3 petals 5-7 x 3.5-4.5 mm, ovate,
succulent (1.3-1.5 mm thick), the next 3 petals 5-7 x
1.6-2.5 mm, lanceolate, succulent (1.0-1.3 mm thick),
the innermost 6 petals equal, 3.7-5.3 x 1.5-2 mm,
elliptic, membranaceous (c. 0.5 mm thick), basally
valvate, apically irregularly imbricate, internally
faintly striate by the impression of the androecium.
Androecium of connate stamens, a staminal column
surrounding the ovary, the lower portion 3-5 mm long,
the upper portion comprised of ca. 24, bisporangiate,
longitudinally and extrorsely dehiscent thecae, 1.5-2
mm long, the thecae sessile and dorsally adnate to the
staminal column (as the ovary develops, the staminal
column appears to split longitudinally and detach
circumscissiley at the base). Ovary 4.5-4.8 x 2.3 mm,
bottle-shaped, glabrous, unilocular, the placentation
parietal with ca. 6 rows of paired ovules, the ovules
numerous, reniform; stigma capitate, ca. 6-lobed. Fruit
a berry, 2.5 x 3 cm, oblate, green, smooth, and slightly
glaucous; seeds many, 4-5 x 4 mm, ovate to oblong or
somewhat reniform, black, shiney, the funicular scar
impressed and rounded; endosperm not ruminate.

PARATYPES: COSTA RICA. Puntarenas: Cant6n de
Osa, Peninsula de Osa, Rancho Quemado, camino a
Chiquer6n, 200 m, 15 ago 1998 (fr), R. A...i.l,, 5509
(INB); 30jul 1999 (fr), R. A. ;i.,, 5705 (CR, F, INB,
MO, NY, P, UPR, US); 11 febr 2000 (fl), R. A.,,Ii.,,


5934 (INB, CR, K, MO, U, US); Cant6n de Parrita,
cuenca del Rio Pirrfs-Damas; Parrita, pie del Cerro
Cabeza de Chancho, camino al Carmen, valle del Rio
Palo Seco, 300 m, 26 febr 2000 (fl), R. A, i.,, 6007
(CR, G, HULE, INB); 7 febr 2000 (fl), B. Hammel
22049 (BH, BM, CR, JVR, INB, K, MEXU, MO, NO,
NY, P, PMA, QCA, QCNE, SPF, TEX, UPR, US), 21
febr 2000 (fl), B. Hammel 22063 (CAS, COL, CR,
EAP, F, INB, MICH, MO, US, USJ), 3jul 2003 (fl, fr.),
J. Salazar et al. 2622 (BH, JBSD). San Jos6: Cant6n
de Tarrazu, Zona Protectora Cerro Nara, cuenca del
Rio Naranjo y Paquita, faldas del Cerro Nara, bosques
arriba de Quebrada Salitrillo, junto al camino, 250 m,
18 mar 1999 (sterile), A. Rodrtguez & V Ramirez 4682
(INB, CR, MO).

HISTORY OF DISCOVERY. Given the combined expertise
of botanists in Costa Rican along with the essentially
instant and global collaboration possible through
the Internet, any fertile, native plant that we can't
immediately place to family is motive for much
excitement. When this plant first came to our attention,
sometime after August 1998, having only a rather
meager collection with fruits, we remained puzzled
by it for several months, and anxiously awaited the
appearance of better material, especially flowers,
for more than a year. Our ephemeral conjectures
included such families as Annonaceae, Capparaceae,
Ebenaceae. This large, lowland rainforest tree, with
Annona- or Diospyros-like leaves, but with baccate
fruits with numerous, small, black seeds, had us all
stumped. As time wore on, our determination to get
to the bottom of the mystery grew. In an evening
of carefully examining, dissecting, squeezing, and
sniffing the specimens, generally of highly animated
consultation among numerous botanists then present
at the Instituto Nacional de Biodiversidad (INBio),
a strong smell memory that of the fruits and seeds
of Virola (Myristicaceae) came to us on crushing
the seeds of our mystery plant. Although all Costa
Rican Myristicaceae have fruits with a single, large
seed, we opened Cronquist (1981) to see if some
odd, South American genus might fit our plant. More
than anything else it was our quirky smell memory,
and Cronquist's treatment of Canellaceae as closely
related (and described on the immediately subsequent
page) to Myristicaceae, that got us on track. The
description of Canellaceae fit our plant to a tee, and
the thrill was tangible. Leaf material sent for DNA
analysis to a colleague working on the phylogeny
of the early angiosperms placed our plant squarely
within Canellaceae (Elizabeth Zimmers, pers. com.).


Vol. 5, No 3








HAMMEL & ZAMORA Pleodendron costaricense (Canellaceae)


And finally, flowering material, gathered more than a
year after the original collection, also confirmed our
identification.

Why, one might now ask, did it take us so long, to
figure out the family of this plant? First, it wasn't
really very long, by "Takhtajanian" standards; the first
collection of Takhtajania perrieri remained without
definite placement as to family, as well as undescribed,
for 54 years (Schatz 2000). More to the point, however,
is the tautological observation that we can't know what
we don't know. Canellaceae had never been found in
Costa Rica, are known from Mesoamerica and there,
essentially only from the Yucatan of Mexico only by
one species, Canella winterana (L.) Gaertn., none of
us trying to figure out the mystery hardly remembered
having heard of the family, let alone had ever had
direct experience with it, and we hadn't yet invited
our "Internet" colleagues into the search. Thus, in
retrospect, we came to a solution of our mystery as
quickly as we did, in part because of experience, and
in part, as is often the case with such matters, because
of luck.

PHENOLOGY. Flowering material of Pleodendron cos-
taricense has been collected in February and March.
Not all flowers open at the same time; anthesis occurs
as a successive process. We also noted that in a partic-
ular season, some branches apparently did not flower
at all. The fully mature flowers (Figs. 2 & 3, C), re-
main globose, the petals + erect and spreading to only
a small, circular opening. Fruits are nearly mature by
late July and last into August.

MORPHOLOGY, RELATIONSHIPS & BIOGEOGRAPHY. This
species is recognized as belonging to the Canellaceae
by virtue of its alternate, entire, exstipulate, coriaceous,
aromatic leaves, and flowers with three sepals, stamens
connate into a staminal column with extrorse anthers,
and an ovary with parietal placentation that in fruit is
a berry.

Two (Canella and Warburgia) of the six genera of
Canellaceae have consistently five-merous corollas
and androecia (e.g., Tieghem 1899, Wilson 1966). In
addition Warburgia is five-carpellate. Cinnamodendron
and Cinnamosma are variable in merosity of corolla,
androecium and ovary (e.g., Schatz 2001, Wilson
1966). Canella has two carpels, and Cinnamodendron
has 2-4 carpels (J. Salazar, pers. com.). Capsicodendron
(Occioni 1943) and Pleodendron have three-merous
corollas and ovaries. The petals of Canella are basally


connate and Cinnamosma has a salverform corolla.
All other genera have free petals. Pleodendron
ekmanii Urb. was described from sterile material
from Haiti, but preliminary evidence indicates that it
is more likely conspecific with one of the species of
Cinnamodendron known from the Greater Antilles (J.
Salazar, pers. com). Pleodendron macranthum (Baill.)
Tiegh. has been interpreted as having 11 or 12 petals
in four "false" (Baillon 1882) series of three petals
each, or more decidedly as 12 petals disposed in four
alternate verticels (Tieghem 1899, Little et al. 1988).
In his comparative study of the floral morphology of
the genera of Canellaceae, Wilson (1966: 340) found
P. macranthum's 12 petals to be in just two series of
six, each with an apparent "alternation of large and
small petals." Thus, Pleodendron has essentially
three-merous flowers throughout (3 sepals, 12 petals,
24 bisporangiate thecae, 6 carpels; see Table 1).

Thus considered, the only sure floral differences
between the two known species of Pleodendron,
P. macranthum, and P. costaricense, are the much
smaller peduncles and petals in the latter (less than 1/2
as long as those of P. macranthum). The fruits of the
two are also quite different (see Fig. 3, D & E). Other
possible floral differences are subject to interpretation,
e.g., in mature flowers of P. costaricense we see three
series (3+3+6) of petals (Fig. 1, H), the outer two
thicker than the inner one, whereas P. macranthum has
been interpreted to have four (3+3+3+3) or two (6+6)
series. Nevertheless, the transverse sections through
the median part of a flower of P. macranthum (Wilson
1966: 338, Fig. 16) and P. costaricense (Fig. 1, H) are
very similar.

Besides P. costaricense, the only other member of the
Canellaceae that occurs in Central America is the rela-
tively widespread, mostly West Indian Canella winter-
ana, which reaches the Yucatan Peninsula of Mexico.
Otherwise, this family of only about 15 species is
known from southern Florida (Canella), the West Indies
(Canella, Cinnamodendron, Pleodendron), northeast-
ern South America (Canella, Cinnamodendron), south-
eastern Brazil (Capsicodendron, Cinnamodendron),
southeastern Africa (Warburgia), and Madagascar
(Cinnamosma). Pleodendron costaricense, apparently
typical for most New World members of the family
(e.g., Zanoni 2004), is of very local distribution, so
far known from only two, rather distant sites, along
the southern pacific coast of Costa Rica, at 200-300 m
elevation. The species itself is disjunct by about 2000
km from its presumed phylogenetically closest rela-


LANKESTERIANA5(3):








LANKESTERIANA


tive, Pleodendron macranthum (Puerto Rico).

The fossil record of the Canellaceae is insufficient
to reveal much about its biogeographic history, but
two genera have been recognized in Tertiary deposits
of Latin America. Hollick and Berry (1924) describe
leaves of Canella from beds estimated as Pliocene
in age from Bahia, Brazil, and Graham and Jarzen
(1969) report pollen of Pleodendron from the middle
Oligocene of Puerto Rico.

Although apparently rare, a possible phytogeographic
relation between southern Costa Rica (or southern
Central America) and the Caribbean is demonstrated
by several species (in other families) that we know to
be disjunct between Costa Rica and the West Indies,
e.g., Pera c '.... rt..i, Griseb. (Euphorbiaceae),
Ziziphus chloroxylon (L.) Oliv. (Rhamnaceae), and
Freziera grisebachii Krug & Urb. (Theaceae). If
we were also to include taxa such as Colpothrinax
and Acoelorraphe -i,;iir (Griseb. & H. Wendl.)
H. Wendl. ex Becc. (Arecaceae) that are endemic to
the Mesoamerican/Caribbean region, the list would
certainly be much larger. Fournier (1966), G6mez P
(1986), and Zamora et al. (2004b) also mention this
phytogeographic relationship. Within Mesoamerica,
recent general floristic work has uncovered Costa
Rican species of Nyssa and Tetranema disjunct
with their geographically nearest congeners in
Mexico and Honduras, respectively, as well as
species of Amelanchier, Bakeridesia, Bouvardia,
(-, ...... ,.., ,,- .i,.. Deherainia, Gymnosporia, Hinto-
nia, Maytenus, Oecopetalum, and Reccia that are
disjunct from as far north as Mexico, and no closer
than Belize (Zamora et al. 2004a). Rather than a direct
relationship with South America, as is especially
common with species of the wet lowlands of southern
Central America, such species as Pleodendron
costaricense seem to have arrived via a much more
complex, northern route.

Within the Canellales (Canellaceae + Winteraceae),
the widespread, Neotropical Drimys granadensis L.f.
(Winteraceae) is P. costaricense's geographically
closest relative. It can be found as close as 1000 m
upslope and a few km to the east of the P. costaricense
localities, but probably got there by a much different
route, via the ancient, Southern Hemisphere temperate
forests (e.g., Berry et al. 2004). The discovery of
Pleodendron costaricense is another data point
supporting the growing conclusion (e.g., Burnham &
Graham 1999, Wendt 1993) that the forests of Central


America have a more complex origin than previously
thought.

HABITAT, DISTRIBUTION AND CONSERVATION. We know of
only two mature individuals and one sapling of this
species, in the wild. All occur on the Pacific lowlands
of southern Costa Rica, in tropical wet forest formation
(Tosi 1969), on well-drained soils with red clays.
Although both mature individuals produce abundant
fruits with seed, we have found only one seedling and
have not been able to germinate any seeds. Both of these
individuals occur at the edge of roads; the Parrita plant
along a much-traveled gravel road, recently improved
to provide access to a hydroelectric project, and the
Osa plant along a more or less abandoned logging trail
(Fig. 3, A & B). None of these individuals occurs on
land with a governmental conservation category that
prohibits logging.

To say that Pleodendron costaricense is rare and
endangered is almost an understatement; the formal
IUCN Red List rating of this species calculates
to be, unambiguously, Critically Endangered (CR
D). Although the mature individuals hardly seem
reproductively viable, the one known sapling from the
Cerro Nara area, and the one we have nurtured from
the single seedling encountered, do insert a minor note
of hope.

Far too rare to have any known economic use,
Pleodendron costaricense nevertheless merits all
possible effort to bring it back from the verge of
extinction. It is a living dinosaur that harbours
information about the history of the Earth; its tenuous
hold at the edge of roads should make it a poster-child
for campaigns to save the biogeographic libraries that
such species and the forests around them represent.
Some members of the Canellaceae are locally well
known in other parts of the world, and especially
because of their aromatic essential oils, have been
used for condiment, tonic, stimulants, incense, and
herbal medicine [e.g., Canella winterana Canella
bark, Cinnamodendron corticosum Miers False
Winter's bark, Cinnamosma fragrans Baill. Saro
oil, Warburgia sartoris (Bertol. f.) Chiov. Pepper
bark]. Human nature leads common folk the world
over always to ask "what's it used for?" and to assume
(formerly to esteem, now more often to suspect) the
work of a field botanist as equivalent to "looking for
medicines." Sometimes we scientists are caught up in
such efforts, witness the recent and passing wave of
bioprospecting, but what really drives us is this thrill


Vol. 5, No 3








HAMMEL & ZAMORA Pleodendron costaricense (Canellaceae)


of discovery. During the last 15 years, in the course of
a general botanical inventory of Costa Rica, aimed, in
part, at the production of a modern flora of the country,
we have recorded nearly 1000 new species or country
records, numerous of them representing significant
disjuncts from their previous known ranges or closest
relatives (see Zamora et al. 2004a for a more complete
account, and e.g., Grayum & Hammel 1995, Hammel
& Zamora 1990, 1993, for specific examples).
Although some are more exciting than others, every
single species found new, or recorded new distribution,
is full of related bytes of information about the history
of life; that is what motivates our science.

ACKNOWLEDGMENTS. We thank illustrator Silvia Troyo
for her interpretation of this species; her fine drawing
essentially obviates the 452 words (of detailed
description) that supplement it. We thank George
Schatz and Jackeline Salazar for comments on an early
draft of this paper, and the latter also for providing us
with much helpful information on Canellaceae, and
for the use of her photo of the fruits of Pleodendron
macranthum. We also thank Alan Graham for helpful
suggestions concerning biogeography and paleobotany
of Canellaceae. This research was possible due
to cooperation agreement between Ministerio de
Ambiente y Energia (MINAE) and Instituto Nacional
de Biodiversidad (INBio), economic support from
donors and the network of taxonomists that contribute
to complete the national biodiversity inventory of
Costa Rica.

LITERATURE CITED
Baillon, M. 1882. Un nouveau Cinnamodendron. Bull.
Mens. Soc. Linn. Paris 1: 317-319.
Berry, RE., W.J. Hahn, K.J. Sytsma, J.C. Hall &
A. Mast. 2004. Phylogenetic relationships and
biogeography of Fuchsia (Onagraceae) based on
noncoding nuclear and chloroplast DNA data. Amer.
J. Bot. 91: 601-614.
Burnham, R.J. & A. Graham. 1999. The history of
neotropical vegetation: new developments and
status. Ann. Missouri Bot. Gard. 86: 546-589.
Cronquist, A. 1981. An integrated system of
classification of flowering plants. Columbia Univ.
Press, New York.
Fournier O., L.A. 1966. Botany of Cocos Island,
Costa Rica. In: Bowman, R.I. (ed.). The Galapagos:
Proceedings of the Symposium of the Galapagos
International Scientific Project. Univ. Calif. Press,
Berkeley. p. 183-186.


G6mez P, L.D. 1986. Vegetaci6n de Costa Rica. In:
G6mez P, L. D. (ed.). Vegetaci6n y clima de Costa
Rica. Vol. 1. Edit. UNED, San Jose.
Graham, A. &D.M. Jarzen. 1969. Studies in neotropical
paleobotany. I. The Oligocene communities of
Puerto Rico. Ann. Missouri Bot. Gard. 56: 308-
357.
Grayum, M.H. & B.E. Hammel. 1995. The genus
Tetranema (Scrophulariaceae) in Costa Rica with
two new species. Phytologia 79: 276-279.
Hammel, B.E. & N.A. Zamora. 1990. Nyssa
talamancana (Cornaceae), an addition to the
remnant Laurasian Tertiary flora of southern Central
America. Brittonia 42: 165-170.
S& 1993. Ruptiliocarpon (Lepidobo-
tryaceae): a new arborescent genus and tropical
American link to Africa, with a reconsideration of
the family. Novon 3: 408-417.
Hollick, A. & E.W. Berry. 1924. A late Tertiary flora
from Bahia, Brazil. Johns Hopkins Univ. Studies
Geol. 5: 1-136.
Karol, K.G., Y. Suh, G.E. Schatz & E.A. Zimmer.
2000. Molecular evidence for the phylogenetic
position of Takhtajania in the Winteraceae: inference
from nuclear ribosomal and chloroplast gene spacer
sequences. Ann. Missouri Bot. Gard. 87: 414-432.
Little, Jr., E.L. 2000. Arboles de Puerto Rico y las
Islas Virgenes. U.S. Dept. Agriculture. Agriculture
Handbook No. 449-S.
Occhioni, P 1943. Sobre a nomenclatura de uma
especie da familiar "Canellaceae". Rev. Brasil Biol.
3: 481-486.
Schatz, G.E. 2000. The rediscovery of a Malagasy
endemic: Takhtajania perrieri (Winteraceae). Ann.
Missouri Bot. Gard. 87: 297-302.
2001. Generic Tree Flora of Madagascar. The
Cromwell Press, St. Louis.
PP Lowry & A. Ramisamihantanirina. 1998.
Takhtajania perrieri rediscovered. Nature 391: 133-
134.
Tieghem, P van. 1899. Sur les Canellacees. J. Bot.
(Morot) 13: 266-276.
Tosi, J.A., Jr. 1969. Mapa ecol6gico, Repdblica de
Costa Rica; segdn la clasificaci6n de zonas de vida
del mundo de L.R. Holdridge. Centro Cientifico
Tropical, San Jose.
Wendt, T. 1993. Composition, floristic affinities, and
origins of the canopy tree flora of the Mexican
Atlantic slope rain forests. In: Ramamoorthy, T.P,
R. Bye, A. Lot & J. Fa (eds.). Biological Diversity
of Mexico, Origins and Distribution. Oxford Univ.
Press, New York. p. 595-680.


LANKESTERIANA5(3):








LANKESTERIANA


D i fE




'2 mm 2E mm
2 mm 2 mm


Fig. 1. Pleodendron costaricense N. Zamora, Hammel & R. Aguilar. -A. Branch with flower buds. -B. Nearly
mature flower and buds on stem below leaf. -C. Lateral view of flower with four petals removed, showing one of
the first series and second series, and two of the third. -D. Median longitudinal section of flower. -E. Lateral view
of flower with all petals removed showing split and circumscissile androecium. -F. Top view of mature flower. -G.
Top view of flower with outer two series of petals removed. -H. Median transverse section of flower. -I. Top view
of androecium and stigma. -J. Lateral view of three thecae. -K. Terminal bud. -L. Transverse section of terminal
bud. -M. Median transverse section of fruit. -N. Branch with fruits. -0. Seed. (A-L from the type, Zamora et al.
2986; M-O from Aguilar 5705.).


Vol. 5, No 3








HAMMEL & ZAMORA Pleodendron costaricense (Canellaceae)


Wilson, T.K. 1966. The comparative morphology
of the Canellaceae. IV. Floral morphology and
conclusions. Amer. J. Bot. 53: 336-343.
Zamora, N., B.E. Hammel & M.H. Grayum. 2004a.
Novelties. In: Hammel, B.E., M.H. Grayum, C.
Herrera & N. Zamora (eds.), Manual de plants de
Costa Rica. Vol. I. Introducci6n. Monogr. Syst. Bot.
Missouri Bot. Gard. 97: 217-240.
& 2004b. Vegetation. In:


Hammel, B.E., M.H. Grayum, C. Herrera & N.
Zamora (eds.). Manual de plants de Costa Rica.
Vol. I. Introducci6n. Monogr. Syst. Bot. Missouri
Bot. Gard. 97: 91-216.
Zanoni, T.A. 2004. Canellaceae. In: Smith, N., S.A.
Mori, A. Henderson, D.W. Stevenson & S.V Heald
(eds.). Flowering Plants of the Neotropics. Princeton
Univ. Press, Princeton. p. 81.


Table 1. Summary of distinguishing floral characters of genera of Canellaceae, and of Pleodendron costaricense.
Data compiled from Baillon (1882), Little et al. (1988), Occioni (1943), J. Salazar (pers. com.), Schatz (2001),
Tieghem (1899), Wilson (1966).
No. of Series
No. Petals of Fusion of Petals No. of Thecae No. of Carpels
of Petals
Canella 5 1 basally connate 20 2

Capsicodendron 6 or 8 2 free 12-20 3

Cinnamodendron 6 or 10 2 free 14-20 2-4
connate (corolla
Cinnamosma 3--6 1 connate (corolla 14-20 3--5
salverform)
Pleodendron macranthum 12 4 (2) free 24 6

Pleodendron costaricense 12 3 (2) free 24 6

Warburgia 10 2 free 20 5


Fig. 2. Pleodendron costaricense N. Zamora, Hammel & R. Aguilar. Branch with mature flowers seen from
above. (Photo from type gathering, Zamora et al. 2986, by R. Aguilar.)


LANKESTERIANA5(3):








LANKESTERIANA


Fig. 3. A-D, Pleodendron costaricense N. Zamora, Hammel & R. Aguilar. -A. Parrita locality and individual
(arrow). -B. Osa locality and individual (trunk in front of R. Aguilar, person on left; other person is L. Bohs).
-C. Branch with flower buds and open flower. -D. Fruiting branch. -E. Pleodendron macranthum (Baill.) Tiegh.
Fruiting branch (Salazar et al. 2409; BH, JBSD).


Vol. 5, No 3



































March S 19 420 7
hiten tatinal o'fe ic
on NwopcialOcid
Inent 1 1-ldSlxA




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs


TRACE ROUTE

Total Execution Time: 59 Milliseconds

MILLISECOND   CLASS.METHODMESSAGE
0sobekcm_page_globals.constructor
0sobekcm_page_globals.constructorApplication State validated or built
0sobekcm_database.verify_item_lookup_object
0sobekcm_page_globals.constructorNavigation Object created from URI query string
0sobekcm_database.verify_item_lookup_object
0sobekcm_page_globals.display_itemRetrieving item or group information
0sobekcm_page_globals.get_entire_collection_hierarchyRetrieving hierarchy information
0sobekcm_assistant.get_entire_collection_hierarchy
0cached_data_manager.retrieve_item_aggregation
0cached_data_manager.retrieve_item_aggregationFound item aggregation on local cache
0item_aggregation_builder.get_item_aggregationFound 'all' item aggregation in cache
0system.web.ui.page.page_load (ufdc.page_load)
0sobekcm_page_globals.constructor.on_page_load
0html_echo_mainwriter.add_style_referencesAdding style references to HTML
0html_echo_mainwriter.add_text_to_pageReading the text from the file and echoing back to the output stream
59html_echo_mainwriter.add_text_to_pageFinished reading and writing the file