|
![]() |
|
| UFDC Home |
myUFDC Home | Help | RSS
|
|
ALL VOLUMES
CITATION
PDF VIEWER
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Full Citation | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
STANDARD VIEW
MARC VIEW
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Downloads | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Full Text | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
PAGE 1 University of Florida | Journal of Undergraduate Research | Volume 13, Issue 3 | Sum m er 2012 1 Comparative S tudy of the L arginine NO P athway G ene E xpressions between H uman and P orcine P ulmonary A rtery E ndothelial C ells in R esponse to L ipopolysaccharide Siripong Rojanasthien and Dr. Karina Krotova College of Liberal Arts and Sciences, University of Florida Lipopolysaccharide (LPS) is found in the outer membrane of gram negative bacteria and acts as an endotoxin The endothelium functions as a barrier to gram negative infection in the blood. We studied the effects of LPS on gene expressions rel ated to the L arginine NO pathway, with a focus on the inducible form of nitric oxide synthase (iNOS) and two types of arginase (Arg 1 and Arg 2) in response to different concentrations of LPS in human pulmonary artery endothelial cells (HPAEC) and porci ne pulmonary artery endothelial cells (PPAEC). We demonstrated significant differences in response to LPS between HPAEC and PPAEC. While we found that both PPAEC and HPAEC responded to LPS by up regulation of classical inflammation genes, PPAEC were much more responsive to LPS in gene expressions, and could survive in higher concentration s of LPS. iNOS and Arg 2 were induced by LPS alone only in PPAEC. We also showed that without iNOS induction in response to high concentration s of LPS, HPAEC faced a lmost total cell death and that the addition of an NO donor, NOC 18, protected HPAEC from toxic effects of LPS. INTRODUCTION Gram negative bacteremia is the 13 th leading cause of death in the U.S. It affects about 400,000 people, causing roughly 100,000 deaths annually in the U.S. alone 1 Infection by gram negative bacteria could cause septic shock within hours which can affect multiple parts of the body, including the heart, b rain, kidney, liver, and intestines, while causing low blood pres sure, rapid heart rate, fever, lightheadedness, and shortness of breath 2 4 Bacteremia and septic shock are caused by the rele ase of endotoxin into the blood stream 4 LPS is a part of the outer membrane of gram negative bacteria that acts as an endotoxin by binding to the CD14/TLR4/MD2 receptor complex on various cells. In this study, we compared the effects of LPS on gene expression related to the L arginine NO pathway in the pulmonary artery endothelial cell of porcine and human origins : CAT 1, CAT 2B, Arg 1, Arg 2, and iNOS iNOS is a n inducible isoform of nitric oxide synthase. Once induced by stimulatory signals, iNOS produce s a robust amount of NO, which helps cell s fight infection and plays a major role in airway tone 5 iNOS has been reported to be up regulated in endothelial cells by LPS 6, 7 Arginase is an enzyme that competes with iNOS for the same substrate, L arginine and converts it to urea and L ornithine Ornithine from arginase could be involved in the synthesis of collagen and polyamine regulation of cell proliferation in wound s and inflammation 8 10 Arginase and NOS enzymes are expressed simultaneously under a wide variety of inflammatory conditions 11 Arginase activity in some circumstances limit s production of NO by iNOS 12 An i ncrease in arginase expression has been shown to lower the effects of iNOS activation and cytotoxic response in macrophage s 13 Increases in iNOS expres sion could also limit arginase activity by releasing NG hydroxy L arginin e an intermediate in NO synthesis and a potent inhibitor of arginase 14 There are two types of arginase, type I and II which are different genes and found in different chromosomes 15 Type 1 arginase (Arg 1) is cytosolic and mostly expressed in the liver, while type 2 arginase (Arg 2) is found in mitochondria and expressed in extrahepatic tissue s 16 This experiment studied the response to LPS in Arg 1 and Arg 2 expression in addition to iNOS expression. We also studied the expression of CAT 1 and CAT 2B, two members of the cationic amino acid transporters (CAT). CAT 1 and CAT 2B are en coded by separate genes, but perform the same task with nearly ide ntical substrate patterns 17, 18 CAT proteins provide a major entry for cat ionic amino acid in non epithelial cells. They supply L arginine for the synthesis of NO by NOS, and for the production of urea and L ornithine 19 21 Another common response of endothelial cell s to LPS is up regulation of ICAM 1 22 ICAM 1 is involved in both innate and adaptive immune response s to bacterial infection facilitating interaction between antigen presenting cells and T cells and the translocation of leukocytes from blood vessels through endothelial cells to sites of inflammation 23 We used ICAM 1 expr ession to confirm that our cells respond to LPS. PAGE 2 S IRIPONG R OJANASTHIEN AND DR K ARINA K ROTOVA University of Florida | Journal of Undergraduate Research | Volume 13, Issue 3 | Sum m er 2012 2 MATERIALS AND METHOD S Reagents All cell culture reagents unless specified were purchased from Invitrogen ( Carlsbad, CA). All chemicals not specified are from Sigma Aldrich (St. Louis, MO). 1 hydroxy 2 oxo 3, 3 bis(2 aminoethyl) 1 triazene (NOC 18), an NO donor, was obtained from Santa Cruz Biotechnology ( Santa Cruz, CA). Cell C ulture and T reatment Porcine pulmonary artery endothelial cells (PPAEC) were isolated from the main pulmonary artery of 6 7 month old pigs using collagenase digestion as previously reported 24 Third to sixth passage cells in a monolayer cu lture were maintained in a RPMI 1640 medium containing 4% fetal bovine serum and antibiotics (10 u/ mL penicillin, 100 g/ mL streptomycin, 20 g/ mL gentamicin, and 2 g/ mL Fungizone) and were used 2 or 3 days after confluence. Human pulmonary arter y endothelial cells (HPAEC) were purchased from Lonza (Walkersville, MD) and cultured in EBM 2 media (Lonza) supplemented with 5% FBS, antibiotics, and growth factors (Bullet Kit, Lonza). HPAEC were used at passage 3 to 6. Confluent HPAEC and PPAEC were tr eated with 0, 1, mL LPS ( E. coli 011:B4, Sigma) in EBM 2 media supplemented with 1% FBS incubated at 37C with air 5% CO 2 for 24 h. We also treated HPAEC with 100 ng/ mL IFN mL IFN mL TNF mL IL iNOS up regulation. Measurement of G ene E xpression by R eal time PCR The t otal RNA was isolated from PPAEC and HPAEC using the RNeasy Mini kit (Qiagen, Valencia, CA) and treated with DNAse I (Ambion ) according to the 20 primers and High Capacity RNA to cDNA Kit (Applied Biosystem, Foster City, CA). Relative quantification real time PCR was done using Power SYB R Green PCR Master Mix (Applied Biosystems, Warrington, UK) in a 7500 Real time PCR System (Applied Biosystems). The PCR primers used are summarized in Table 1 and Table 2. All samples were run in duplicates. Melting curve analyses for amplification produc ts indicated one specific product for each gene and no primer dimer formation. Gene actin and T method 25 Cell V iability and C ytotoxicity A ssay To see the toxic effects of LPS on cell viabilities of PPAEC and HPAEC, we treated confluence cells in 96 multiwell clear bottom plates for 24 h. Cell survival was measured with PrestoBlue Table 1 Human R eal T ime PCR P rimers Gene Access number Primers: Sequence (5' > 3') Actin NM_001101 GCCAACCGCGAGAAGATGA CATCACGATGCCAGTGGTA Arginase I NM_000045 GGAGACCACAGTTTGGCAAT CCACTTGTGGTTGTCAGTGG Arginase II NM_001172 AAGCTGGCTTGATGAAAAGGC GCGTGGATTCACTATCAGGTTGT CAT 1 NM_003045 ATCTGCTTCATCGCCTACTT TAGCAGTCCATCCTCAGCGATG CAT 2B U76369 TTCTCTCTGCGCCTTGTC AA CCATCCTCCGCCATAGCA TA ICAM1 NM_000201 GCTATGCCTTGTCCTCTTG ATACACACACACACACACGC iNOS AF068236 GGTGGAAGCGGTAACAAAGG TGCTTGGTGGCGAAGATGA VCAM NM_001078 CAAATCCTTGATACTGCTCATC TTGACTTCTTGCTCACAGC Table 2. Porcine R eal T ime PCR P rimers Gene Access number Primers: Sequence (5' > 3') actin U07786 GGACCTGACCGACTACCTCA GCGACGTAGCAGAGCTTCTC actin U07786 CCAGCACCATGAAGATCAAG ACATCTGCTGGAAGGTGGAC Arginase I AY039112 TGAAAGATTACGGGGACCTG CTTTTCCCACAGACCTTGGA Arginase II NM_009705 CACCCCTCACCACTTCATCT GAAAATCCTGGGAGTTGTGG CAT 1 NM_001012613.1 ATGGCCTTCCTCTTTGACCT GGCTGGTACCGTAAGACCAA CAT 2B NM_001110420.1 TTCTCTCTGCGCCTTGTCAA (CAT 2A) TTGAAAAGCAACCCATCCTC CATCCTCCGCCATAGCATA ICAM AF156712.1 GCCCAATTGAAGCTGAATGT CACCTGGGTCTGGTTCTTGT iNOS U59390 CCCTTCAATGGCTGGTACAT ATCCTTCTGCCCACTTCCTC GAPDH U48832 ACCCAGAAGACTGTGGATGG AAGCAGGGATGATGTTCTGG PAGE 3 COMPARATIVE STUDY OF L ARGININE NO PATHWAY GENE EXPRESSIONS IN RESPONSE TO LPS University of Florida | Journal of Undergraduate Research | Volume 13, Issue 3 | Sum m er 2012 3 RESULTS Cytotoxic E ffects of LPS in HPAEC and PPAEC HPAEC and PPAEC were treated with different concentrations of LPS ranging from 0 / mL for 24 h. In both cell lines mL LPS did not cause cell death. Treatment of PPAEC with 100 mL LPS only slightly decreased the survival rate to mL LPS showed only 132% survival rate (Figure 1) Figure 1. Survival of PPAEC treated with 0 mL LPS and HPAEC treated with 0 mL LPS without and with IFN Survival rate measured from the total amount of cellular nucleic acids. mL LPS decreases cell survival of both PPAEC and HPAEC but more so in HPAEC where only 13% of cells survive. *P < 0.05 and **P < 0.001 compared to the untreated cells. Effects of LPS on G ene E xpressions in HPAEC Since most of the HPAEC treated with 100 mL LPS died, we tested the effect of 1 and 10 mL LPS on the expression of genes involved in the arginine NO pathwa y We also used ICAM 1 as a marker of cellular response to LPS. HPAEC treated with LPS for 24 h showed increased mRNA expression of ICAM 1 with no significant change in the expression of the genes involved in the arginine NO pathway, except CAT 2B. We could not detect iNOS and Arg 1 mRNA expression in the control and the treated cells. The e xpression of Arg 2 and CAT 1 did not change with LPS treatments. Since we saw no changes in the expression of iNOS or Arg 2, we added IFN mediator of inflammation that can increase the response of endothelial cells to LPS 26 28 Althou gh IFN by itself did not up regulate any studied gene the a ddition of IFN these LPS treatments decreased the expressions of Arg 2, CAT 1 and CAT 2B mRNAs when compared with the corresponding treatments without IFN regulated ICAM when add ed to cells treated with LPS but not by itself ( Figure 2 ). Still, we found no iNOS mRNA Induction of iNOS E xpression by a C ocktail We tried to find the right treatment to induce iNOS expression in HPAEC. Published studies of iNOS showed that the gene can be induced in human endothelial cells with the right combination of cytokines and that the maximum of iNOS expression can be detected after 6 to 8 h 29 Hence, we treated HPAEC with several combinations of cytokines and LPS for a shorter period of 8 h. We found that TNF expression and caused no change in Arg 2 or CAT 1 expression (data not shown). However, HPAEC treated with LPS and IFN regulation of iNOS mRNA by 301.4 times compared to the non treated cells. The highest increase of 560 times in iNOS expression was detected in cells mL LPS and a cocktail of 10 ng/ mL TNF mL IFN mL IL Treatment with this cocktail also caused more up regulation of CAT 1, CAT 2B and ICAM 1 when compared to the treatment with LPS and IFN both treatments, the expressions of Arg 2 were significantly lower than the control (Figure 3) ** 0 50 100 150 0 1 10 100 Survival Rate (%) LPS (g/mL) HPAEC * 0 50 100 150 0 1 10 100 Survival Rate (%) LPS ( g/mL) PPAEC PAGE 4 S IRIPONG R OJANASTHIEN AND DR K ARINA K ROTOVA University of Florida | Journal of Undergraduate Research | Volume 13, Issue 3 | Sum m er 2012 4 Figure 2 Response of mRNAs expression to 1 100 ug/mL LPS with and without 100 ng /mL IFN arterial endothelial cells (HPAEC) treated for 24 h in EBM 2 complete media supplemented with 1% FBS. Treatment with IFN regulation of Arg 2, CAT 1, and CAT 2B mRNAs, but ICAM 1 is up regulated with treatment with both LPS and IFN nitric oxide synthase mRNA are not detectable with these treatments. The b ars represent the mean of relative quantification S.D. *P < 0.05 compared to the untreated cells. **P < 0.05 compared to cells treated with LPS of the same concentration alone. Figure 3 Induction of inflammatory response related genes by treatment of HPAEC with 10 ug/mL LPS and 100 ng/mL IFN LPS and cocktail (100 ng/mL IFN 4 ng/mL IL 2complete media supplemented with 1% FBS. Only Arg 2 is down regulated by either treatment. iNOS, ICAM, CAT1, and CAT 2B are up regulated with both. The a ddition of cocktail to treatment with LPS significantly increases the expression of iNOS, CAT1, and CAT 2B when compared with treatment with LPS + IFN 1 mRNA detected. Bars represent mean of relative quantification S.D. *P < 0.05 compared to the control, ** P < 0.005 compared to treatment with LPS + IFN * 0 2 4 0 1 10 0 +IFN 1 +IFN 10 +IFN LPS ( g/mL) hArginase 2 * ** ** 0 5 10 0 1 10 0 +IFN 1 +IFN 10 +IFN LPS ( g/mL) hICAM * ** ** ** 0 1 2 3 4 5 0 1 10 0 +IFN 1 +IFN 10 +IFN LPS ( g/mL) hCAT 1 * ** ** ** 0 2 4 0 1 10 0 +IFN 1 +IFN 10 +IFN LPS ( g/mL) hCAT 2B * 0.0 1.0 2.0 3.0 4.0 5.0 Control LPS+ IFN LPS+ Cocktail hArg 2 0.0 1.0 2.0 3.0 4.0 5.0 Control LPS+ IFN LPS+ Cocktail hCAT1 * ** 0 20 40 60 80 100 Control LPS+ IFN LPS+ Cocktail hCAT 2B * 0 5 10 15 20 Control LPS+ IFN LPS+ Cocktail hICAM 1 PAGE 5 COMPARATIVE STUDY OF L ARGININE NO PATHWAY GENE EXPRESSIONS IN RESPONSE TO LPS University of Florida | Journal of Undergraduate Research | Volume 13, Issue 3 | Sum m er 2012 5 Effects of LPS on G ene E xpressions in PPAEC PPAEC was subject to the same LPS treatments as HPAEC. Stimulation of PPAEC with h was sufficient to elicit significant changes in mRNA expression of iNOS, ICAM, Arg 1, Arg 2, CAT 1 and CAT 2B. An increase in LPS treatment concentration to but it did not increase any other mRNA expression iNOS mRNA expression was the most highly up regulated with an increase of more than a thousand fold when compared with the non treated cells. The t LPS resulted in decreased mRNA expressions of all genes and thus could be associated with cytotoxic effect and enhanced cell death ( Figure 4 ). Additions of human IFN to LPS treatments did not show any significant difference in the expressions of the genes studied (data not shown). The lack of effects of human IFN that IFN specific and that human IF N not work on porcine cells 30 Figure 4. Up regulation of the L arginine 100 ug/mL LPS in porcine pulmonary artery endothelial cells (PPAEC) treated for 24 h in EBM 2 media supplemented with 1% FBS. Bars represent mean of relative quantification S.D. *P < 0.05 compared to the untreated cells. **P < 0.001 compared to the untreated cells. NO P rotects HPAEC from T oxic E ffects of LPS We wanted to know whether NO was responsible for the we treated HPAEC with LPS and an NO donor, NOC 18, LPS killed them, while almost 80% of the cells survived with the addition of NOC 18 S urvival rates between cells treated with the two concentrations NOC 18 were the same (Figure 5) DISCUSSION The t reatment of cells with toxic LPS mimics gram negative bacterial infection and stimulates inflammatory responses. We look ed for differences in gene expression s ** ** 0 500 1000 1500 2000 0 1 10 100 LPS ( g/mL) piNOS * 0 2 4 6 8 10 0 1 10 100 LPS ( g/mL) pICAM * 0 20 40 60 80 0 1 10 100 LPS ( g/mL) pArg 1 ** ** ** 0 10 20 30 40 0 1 10 100 LPS ( g/mL) pArg 2 * 0 2 4 6 8 10 0 1 10 100 LPS ( g/mL) pCAT I * 0 2 4 6 8 10 0 1 10 100 LPS ( g/mL) pCAT 2B PAGE 6 S IRIPONG R OJANASTHIEN AND DR K ARINA K ROTOVA University of Florida | Journal of Undergraduate Research | Volume 13, Issue 3 | Sum m er 2012 6 related to the L arginine NO pathway in response to LPS in endothelial cells from two species: human and porcine iNOS, the inducible form of NOS, is not constitutively expressed in most cells and has to be induced by cytokines and bacterial products 31 5 Regulation of iNOS is complex and varies among spec ies and cell types 31 LPS can induce iNOS in certain cell types. For example, i n mouse macrophage s LPS caused up regulation of iN OS, Arg 1, Arg 2 and other genes 32 LPS has also been shown to induce iNOS mRNA expressio n in human macrophage cells 33 iNOS is required for macroph age s to produce reactive nitroge n species (R N S) which plays a role in eliminating pathogen s including gram negative bacteria. Unlike macrophage s e ndothelial cells primarily act as a barrier and a biosensor membrane between the blood stream and other tissue s 34 W e found that PPAEC responded to LPS by a robust induction of iNOS, which suggest ed that PPAEC were capable of producing NO in response to gram negative infection, a role normally performed by macrophage s I n HPAEC we were unable to induce iNOS expression with the same LPS treatment given to PPAEC for 24 h iNOS mRNA expression was undetectable in HPAEC even when we used concentration than those used to induce iNOS in murine and porcine endothelial cells. This concentration of LPS was so toxic that the treatment killed 85% of HPAEC We confirmed that HPAEC responded to LPS since ICAM 1 was induced by LPS in both HPAEC an PPAEC Inflammation increased the expression of ICAM 1 a gene which coded for an essential protein for arrest and extravasation of leukocytes to the site of inflammation 23 In the arginine NO pathway, CAT 1 and CAT 2B provide the substrate for NOS and arginase 19, 35 CAT 1 has been shown to be expressed constitutively in various cell types, except in adult hepatic cells 17, 18 On the other hand, CAT 2B was fou nd only after treatments with LPS or cytokines. We showed that CAT 2B was up regulated by LPS in both HPAEC and PPAEC ; h owever, CAT 1 was only induced in PPAEC While LPS alone cannot induce iNOS, the addition of cytokines to LPS treatment was able to stimulate iNOS expression. We found that although IFN induce iNOS expression, the addition of IFN to LPS or to IL This result was consistent with a published study by Asano K et al 29 The requirement of IFN the activation of iNOS in HPAEC could be due to its role in the enhancement of TLR signal transduction. IFN cytokine that mediates immunity and inflammat ory interactions, such as macrophage activation and cellular inflammation. IFN expression, induce required transcription factors for certain TLR responsive genes, promote activation of NF shut down the feedback inhibition of activation by TLR in human and murine macrophage 26,36 Specifically IFN n to up regulate expression of TLR 4 a main recept or for LPS on cell surface s in human mononuclear phagocytes 37 Although TNF has been implicated in septic shock and inflammation treatment with TNF with LPS caused no change in iNOS mRNA expression in HPAEC Thus, TNF in HPAEC 38 39 Another striking difference in the up regulation of iNOS mRNA was the fact that, unlike the up regulation of iNOS in PPAEC which could be detected after 24 h the up regulation of iNOS in HPAEC produced via the combination of LPS and cytokines could only be detected after 8 h and not 24 h This could be due to the difference in magnitude of up regulation. Th ese data were consistent with iNOS mRNA expression in human hepatocyte s in which the peak expression was detected after 8 h of treatment with LPS and cytokines and then decreased until becoming undetectable after 48 h 5 The fact that LPS alone induce s ICAM 1 but not iNOS, Arg 1, or Arg 2 indicate s that HPAEC them sel ves do not perform some of the functions of macrophage s such as the elimination of gram negative bacteria via production of NO Instead HPAEC act as cells that facilitate cellular immunity by the up regulation of adhesion molecule s (ICAM) which attract s leukocytes to the site of inflammation PPAEC could perform such a task, but not HPAEC LPS also showed dramatic difference s in the induction of arginases in HPAEC and PPAEC There are two types of arginase : t he cytosolic Arg 1 is mostly expressed in the liver, while Arg 2 is expressed in extrahepatic tissues 16 We found that HPAEC constitutively expressed only the Arg 2 isoform, while PPAEC expressed both Arg 1 and Arg 2. LPS up regulated both Arg 1 and Arg 2 in PPAEC Since ornithine, a product of arginase, could be involved in the synthesis of collagen and the reg ulation of polyamines t he up regulation of these arginases suggested that PPAEC may respond better to LPS exposure in the context of wound healing. HPAEC did not up regulate Arg 2 upon LPS exposure. In our attempt to induce iNOS the addition of IFN to LPS or cocktail actually led to down regulation of Arg 2 in HPAEC Ultimately, t his illustrated that HPAEC respond ed to LPS and cytokines very differently from PPAEC 8 10 We also found different sensitivities between HPAEC and PPAEC to LPS. While even low concentratio n s of LPS w ere able to increase gene expression in PPAEC dramatically they could tolerate LPS in high amount s as demonstrated by high survivability in LPS concentration that was very toxic to HPAEC Less than 20% of HPAEC of iNOS expression at high concentrations of LPS cause excessive cell death in HPAEC ? Studies have shown that LPS induced apoptosis in ovine and bovine endothelial cells 40 43 However, the apoptotic effects of LPS can be inhibited by the overexpression of iNOS via suppression PAGE 7 COMPARATIVE STUDY OF L ARGININE NO PATHWAY GENE EXPRESSIONS IN RESPONSE TO LPS University of Florida | Journal of Undergraduate Research | Volume 13, Issue 3 | Sum m er 2012 7 of caspase 3 like protease activity in sheep pulmonary artery endothelial cells 44, 45 We speculated that the iNOS up regulation also protected PPAEC from cell death at high concentrations of LPS, an d due to the lack of iNOS expression HPAEC could not tolerate high LPS concentration. We showed that the presence of NOC 18, an external donor of NO, rescued HPAEC from LPS induced cell death. In summary, we demonstrated that the same cell type from two species of mammals responded very differently to LPS. PPAEC were more responsive to LPS than HPAEC in regards to induction of genes in the L arginine NO pathway PPAEC responded to low concentrations of LPS by induction of all of the genes studied: Arg 1, Arg 2, CAT 1, CAT 2B, and iNOS. In HPAEC, LPS could only induce CAT 2B. Due to the difference in up regulation of iNOS, we found that PAECs could survive in a medium with the amount of LPS that was deadly to HPAEC. We showed that, with an external source o f NO, HPAEC could also survive in that toxic media. The absence of NO production by iNOS in HPAEC could be the reason that most HPAEC died in concentrated LPS media. The different mechanisms in regulation of response to LPS between PPAEC and HPAEC are stil l to be investigated. REFERENCES 1. Bannerman DD, Goldblum SE. Direct effects of endotoxin on the endothelium: barrier function and injury. Lab Invest. Oct 1999;79(10):1181 1199. 2. Marx JA, Hockberger RS, Walls RM, Adams J, Rosen P. Rosen's emergency medicine concepts and clinical practice. Mosby/Elsevier [ScienceDirect]. 3. Fink MP. Textbook of critical care 5th ed. Philadelphia, Pa.: Elsevier Saunders; 2005. 4. RS M. Severe sepsis and septic shock. In: Fauci AS HT, eds., ed. Harrison 's Principles of Internal Medicine 17 ed. New York, NY: McGraw Hill; 2008:chap 265. 5. Geller DA, Billiar TR. Molecular biology of nitric oxide synthases. Cancer Metastasis Rev. Mar 1998;17(1):7 23. 6 Vo PA, Lad B, Tomlinson JA, Francis S, Ahluwalia A. autoregulatory role of endothelium derived nitric oxide (NO) on Lipopolysaccharide induced vascular inducible NO synthase expression and function. J Biol Chem. Feb 25 2005;280(8):7236 7243. 7. Wilcox JN Subramanian RR, Sundell CL, et al. Expression of multiple isoforms of nitric oxide synthase in normal and atherosclerotic vessels. Arterioscler Thromb Vasc Biol. Nov 1997;17(11):2479 2488. 8. Kepka Lenhart D, Mistry SK, Wu G, Morris SM, Jr. Arginase I: a limiting factor for nitric oxide and polyamine synthesis by activated macrophages? Am J Physiol Regul Integr Comp Physiol. Dec 2000;279(6):R2237 2242. 9. Li H, Meininger CJ, Hawker JR, Jr., et al. Regulatory role of arginase I and II in nitric oxide, poly amine, and proline syntheses in endothelial cells. Am J Physiol Endocrinol Metab. Jan 2001;280(1):E75 82. 10. Albina JE, Abate JA, Mastrofrancesco B. Role of ornithine as a proline precursor in healing wounds. J Surg Res. Jul 1993;55(1):97 102. 11. Morris SM, Jr. Enzymes of arginine metabolism. J Nutr. Oct 2004;134(10 Suppl):2743S 2747S; discussion 2765S 2767S. 12. Gotoh T, Mori M. Arginase II downregulates nitric oxide (NO) production and prevents NO mediated apoptosis in murine macrophage derived R AW 264.7 cells. J Cell Biol. Feb 8 1999;144(3):427 434. 13. Hey C, Boucher JL, Vadon Le Goff S, Ketterer G, Wessler I, Racke K. Inhibition of arginase in rat and rabbit alveolar macrophages by N omega hydroxy D,L indospicine, effects on L arginine utilizat ion by nitric oxide synthase. Br J Pharmacol. Jun 1997;121(3):395 400. 14. Daghigh F, Fukuto JM, Ash DE. Inhibition of rat liver arginase by an intermediate in NO biosynthesis, NG hydroxy L arginine: implications for the regulation of nitric oxide biosynth esis by arginase. Biochem Biophys Res Commun. Jul 15 1994;202(1):174 180. 15. Gotoh T, Araki M, Mori M. Chromosomal localization of the human arginase II gene and tissue distribution of its mRNA. Biochem Biophys Res Commun. Apr 17 1997;233(2):487 491. 16. Wu G, Morris SM, Jr. Arginine metabolism: nitric oxide and beyond. Biochem J. Nov 15 1998;336 ( Pt 1):1 17. 17. Deves R, Boyd CA. Transporters for cationic amino acids in animal cells: discovery, structure, and function. Physiol Rev. Apr 1998;78(2):487 5 45. 18. Closs EI. Expression, regulation and function of carrier proteins for cationic amino acids. Curr Opin Nephrol Hypertens. Jan 2002;11(1):99 107. 19. Mann GE, Yudilevich DL, Sobrevia L. Regulation of amino acid and glucose transporters in endotheli al and smooth muscle cells. Physiol Rev. Jan 2003;83(1):183 252. 20. Closs EI, Simon A, Vekony N, Rotmann A. Plasma membrane transporters for arginine. J Nutr. Oct 2004;134(10 Suppl):2752S 2759S; discussion 2765S 2767S. 21. San Martin R, Sobrevia L. Gest ational diabetes and the adenosine/L arginine/nitric oxide (ALANO) pathway in human umbilical vein endothelium. Placenta. Jan 2006;27(1):1 10. 22. Park HS, Chun JN, Jung HY, Choi C, Bae YS. Role of NADPH oxidase 4 in lipopolysaccharide induced proinflamma tory responses by human aortic endothelial cells. Cardiovasc Res. Dec 1 2006;72(3):447 455. 23. Lawson C, Wolf S. ICAM 1 signaling in endothelial cells. Pharmacol Rep. Jan Feb 2009;61(1):22 32. 24. Block ER, Patel JM, Sheridan NP. Endotoxin protects against hyperoxic decrease in membrane fluidity in endothelial cells but not in fibroblasts. Lab Invest. Feb 1986;54(2):146 153. 25. Livak KJ, Schmittgen TD. Analysis of relative gene expression data usi ng real time quantitative PCR and the 2( Delta Delta C(T)) Method. Methods. Dec 2001;25(4):402 408. 26. Hu X, Ivashkiv LB. Cross regulation of signaling pathways by interferon gamma: implications for immune responses and autoimmune diseases. Immunity. Oct 16 2009;31(4):539 550. 27. Geiger M, Stone A, Mason SN, Oldham KT, Guice KS. Differential nitric oxide production by microvascular and macrovascular endothelial cells. Am J Physiol. Jul 1997;273(1 Pt 1):L275 281. 28. Walter R, Schaffner A, Schoedon G. D ifferential regulation of constitutive and inducible nitric oxide production by inflammatory stimuli in murine endothelial cells. Biochem Biophys Res Commun. Jul 15 1994;202(1):450 455. 29. Asano K, Chee CB, Gaston B, et al. Constitutive and inducible nit ric oxide synthase gene expression, regulation, and activity in human lung epithelial cells. Proc Natl Acad Sci U S A. Oct 11 1994;91(21):10089 10093. 30. Batten P, Yacoub MH, Rose ML. Effect of human cytokines (IFN gamma, TNF alpha, IL 1 beta, IL 4) on p orcine endothelial cells: induction of MHC and adhesion molecules and functional significance of these changes. Immunology. Jan 1996;87(1):127 133. 31. Knowles RG, Moncada S. Nitric oxide synthases in mammals. Biochem J. Mar 1 1994;298 ( Pt 2):249 258. 32. Salimuddin, Nagasaki A, Gotoh T, Isobe H, Mori M. Regulation of the genes for arginase isoforms and related enzymes in mouse macrophages by lipopolysaccharide. Am J Physiol. Jul 1999;277(1 Pt 1):E110 117. PAGE 8 S IRIPONG R OJANASTHIEN AND DR K ARINA K ROTOVA University of Florida | Journal of Undergraduate Research | Volume 13, Issue 3 | Sum m er 2012 8 33. Weinberg JB. Nitric oxide production and nitri c oxide synthase type 2 expression by human mononuclear phagocytes: a review. Mol Med. Sep 1998;4(9):557 591. 34. Aird WC. Endothelial cell heterogeneity. Critical Care Medicine. 2003;31(4):S221 S230. 35. Hatzoglou M, Fernandez J, Yaman I, Closs E. Regulat ion of cationic amino acid transport: the story of the CAT 1 transporter. Annu Rev Nutr. 2004;24:377 399. 36. Schroder K, Sweet MJ, Hume DA. Signal integration between IFN[gamma] and TLR signalling pathways in macrophages. Immunobiology European Macrophage and Dendritic Cell Society. 2006/9/14/ 2006;211(6 8):511 524. 37. Bosisio D, Polentarutti N, Sironi M, et al. Stimulation of toll like receptor 4 expression in human mononuclear phagocytes by interferon gamma: a molecular basis for priming and synergism w ith bacterial lipopolysaccharide. Blood. May 1 2002;99(9):3427 3431. 38. Yang SK, Wang YC, Chao CC, Chuang YJ, Lan CY, Chen BS. Dynamic cross talk analysis among TNF R, TLR 4 and IL 1R signalings in TNFalpha induced inflammatory responses. BMC Med Genomics. 3:19. 39. Bradley JR. TNF mediated inflammatory disease. J Pathol. Jan 2008;214(2):149 160. 40. Bannerman DD, Sathyamoorthy M, Goldblum SE. Bacterial lipopolysaccharide disrupts endothelial monolayer integrity and survival signaling events throu gh caspase cleavage of adherens junction proteins. J Biol Chem. Dec 25 1998;273(52):35371 35380. 41. Frey EA, Finlay BB. Lipopolysaccharide induces apoptosis in a bovine endothelial cell line via a soluble CD14 dependent pathway. Microb Pathog. Feb 1998;2 4(2):101 109. 42. Hoyt DG, Mannix RJ, Gerritsen ME, Watkins SC, Lazo JS, Pitt BR. Integrins inhibit LPS induced DNA strand breakage in cultured lung endothelial cells. Am J Physiol. Apr 1996;270(4 Pt 1):L689 694. 43. Hoyt DG, Mannix RJ, Rusnak JM, Pitt B R, Lazo JS. Collagen is a survival factor against LPS induced apoptosis in cultured sheep pulmonary artery endothelial cells. Am J Physiol. Aug 1995;269(2 Pt 1):L171 177. 44. Ceneviva GD, Tzeng E, Hoyt DG, et al. Nitric oxide inhibits lipopolysaccharide i nduced apoptosis in pulmonary artery endothelial cells. Am J Physiol. Oct 1998;275(4 Pt 1):L717 728. 45. Tzeng E, Kim YM, Pitt BR, Lizonova A, Kovesdi I, Billiar TR. Adenoviral transfer of the inducible nitric oxide synthase gene blocks endothelial cell apoptosis. Surgery. Aug 1997;122(2):255 263. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MILLISECOND | CLASS.METHOD | MESSAGE |
|---|---|---|
| 0 | sobekcm_page_globals.constructor | |
| 0 | sobekcm_page_globals.constructor | Application State validated or built |
| 0 | sobekcm_database.verify_item_lookup_object | |
| 2254 | sobekcm_page_globals.constructor | Navigation Object created from URI query string |
| 2254 | sobekcm_database.verify_item_lookup_object | |
| 2255 | sobekcm_page_globals.display_item | Retrieving item or group information |
| 2255 | sobekcm_page_globals.get_entire_collection_hierarchy | Retrieving hierarchy information |
| 2255 | sobekcm_assistant.get_entire_collection_hierarchy | |
| 2255 | cached_data_manager.retrieve_item_aggregation | |
| 2255 | cached_data_manager.retrieve_item_aggregation | Found item aggregation on local cache |
| 2255 | item_aggregation_builder.get_item_aggregation | Found 'all' item aggregation in cache |
| 2255 | system.web.ui.page.page_load (ufdc.page_load) | |
| 2255 | sobekcm_page_globals.constructor.on_page_load | |
| 2255 | html_echo_mainwriter.add_style_references | Adding style references to HTML |
| 2255 | html_echo_mainwriter.add_text_to_page | Reading the text from the file and echoing back to the output stream |
| 2283 | html_echo_mainwriter.add_text_to_page | Finished reading and writing the file |