• TABLE OF CONTENTS
HIDE
 Front Cover
 Table of Contents
 Front Matter
 Enhancement, enzymatic activity...
 Molecular characterization of important...
 Plasmodiophora brassicae Wor. pathotypes...
 Response of two carrot (Daucus...
 Biological control of the banana...
 Elucidation of mechanism of resistance...
 Host range and virus-vector relationship...
 Abstracts of papers presented during...
 Back Matter
 Back Cover














Group Title: Journal of Tropical Plant Pathology
Title: Journal of tropical plant pathology
ALL VOLUMES CITATION THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00090520/00048
 Material Information
Title: Journal of tropical plant pathology
Series Title: Journal of tropical plant pathology.
Alternate Title: Journal of Philippine phytopathology
Philippine phytopathology
Physical Description: v. : ill. (some col.) ; 26 cm.
Language: English
Creator: Philippine Phytopathological Society
Publisher: Philippine Phytopathological Society
Place of Publication: Philippines
College Laguna
Publication Date: January-December 2006
Frequency: semiannual
regular
 Subjects
Subject: Plant diseases -- Periodicals -- Philippines   ( lcsh )
Plants, Protection of -- Periodicals -- Philippines   ( lcsh )
Genre: periodical   ( marcgt )
 Notes
Dates or Sequential Designation: v. 1, no. 1 (January 1965)-
General Note: Title from cover.
General Note: "Official publication of the Tropical Plant Pathology."
 Record Information
Bibliographic ID: UF00090520
Volume ID: VID00048
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
Resource Identifier: oclc - 54382605
issn - 0115-0804

Table of Contents
    Front Cover
        Front Cover 1
        Front Cover 2
    Table of Contents
        Table of Contents
    Front Matter
        Front Matter
    Enhancement, enzymatic activity and survival of trichoderma spp. in soil
        Page 1
        Page 2
        Page 3
        Page 4
        Page 5
        Page 6
        Page 7
        Page 8
        Page 9
    Molecular characterization of important corn pathogens by polymerase chain reaction
        Page 10
        Page 11
        Page 12
        Page 13
        Page 14
        Page 15
        Page 16
    Plasmodiophora brassicae Wor. pathotypes in Benguet
        Page 17
        Page 18
        Page 19
        Page 20
        Page 21
        Page 22
        Page 23
        Page 24
    Response of two carrot (Daucus carota L.) cultivars to varying levels of root-knot nematode (Meloiodogyne hapla Chitwood) inoculum
        Page 25
        Page 26
        Page 27
        Page 28
        Page 29
        Page 30
        Page 31
        Page 32
        Page 33
        Page 34
        Page 35
    Biological control of the banana burrowing nematode, Radopholus similis with selected nematophagous fungi
        Page 36
        Page 37
        Page 38
        Page 39
        Page 40
    Elucidation of mechanism of resistance of tomato agaisnt tobacco mosiac virus using protoplasts
        Page 41
        Page 42
        Page 43
        Page 44
        Page 45
        Page 46
        Page 47
        Page 48
    Host range and virus-vector relationship of luteovirus causing the namamarako (NMK) syndrome of ampalaya
        Page 49
        Page 50
        Page 51
        Page 52
        Page 53
        Page 54
        Page 55
        Page 56
        Page 57
        Page 58
    Abstracts of papers presented during the 37th anniverary and annual scientific conference of the pest management council of the Philippines Inc., held at Grand Regal Hotel, Davao City on May 2-5, 2006
        Page 59
        Page 60
        Page 61
        Page 62
        Page 63
        Page 64
        Page 65
        Page 66
        Page 67
        Page 68
        Page 69
        Page 70
        Page 71
        Page 72
        Page 73
        Page 74
        Page 75
    Back Matter
        Page 76
    Back Cover
        Page 77
        Page 78
Full Text



ISSN 0115-0804':


VOLUME 42 NUMBER 1 & 2
I -....... r .. ,, Q/t' t"


The Philippine Phytopathological Society, Inc.
c/o Crop Protection Cluster








JOURNAL OF TROPICAL PLANT PATHOLOGY
Published by the Philippine Phytopathological Society, Inc.


OFFICERS OF THE PHILIPPINE PHYTOPATHOLOGICAL SOCIETY, INC.


2005-2006


2006-2007


President
Vice President
Secretary
Treasurer
Auditor
Business Manager
PRO
Board Members



Ex-Officio


F.M. dela Cueva
C.J.R. Cumagun
E.Y. Ardales
L.M. DoLores
R.G. Bayot
R.A. Zorilla
T.O. Dizon
O.S. Opina
C.B. Pascual
F.A. dela Pefia
T.U. Dalisay
P.G. Gonzales


President
Vice President
Secretary
Treasurer
Auditor
Business Manager
PRO
Board Members



Ex-Officio


C.J.R. Cumagun
F.A. dela Pefia
C.B. Pascual
L.M. Dolores
N.L. Opina
R.A. Zorilla
P.G. Gonzales
T.O. Dizon
R.G. Bayot
J.B. Balidion
R.T. Luzaran
F.M. dela Cueva


EDITORIAL BOARD


Editor-In-Chief
Associate Editors

Circulation Manager


Teodora O. Dizon
Rizaldo G. Bayot
Christian Joseph R. Cumagun
Teodora O. Dizon


SUSTAINING ASSOCIATES

AgChem Manufacturing Corporation
BASF Phils., Inc.
Bayer CropScience, Inc.
DuPont Far East, Inc.
Kemistar Corporation
Leads Agri Product Corporation
Syngenta Phils., Inc.
TransWorld Trading Co., Inc.


Cover photo: Symptoms of namamarako (NMK) disease of ampalaya.


I


--








ini ia&iA nc TpaDif',At DI AMYT D&TLK'I A(WV


VQLUME 42 NUMBER 1 & 2


CON



Enhancement, enzymatic activity and survival o-
spp. in soil
Christian Joseph R. Cumagun

Molecular characterization of important corn pat
polymerase chain reaction
Cecilia B. Pascual, Cherry A. Relevante and Akl

Plaemodiophora brassicae Wor. pathotypes in I
e ward $. Tad-awtn, Maria Theresa P. Baclili


Response of two carrot (Daucus carota L.) culti
varying leversbf rodt-knot nematode (Meloidog)
Chitwood) inoculum
Merannyl. M. Abuan and Luciana M. Villanueva

Biological control of the banana burrowing nem
Radopholus similis with selected nematophagol
Marita S. Pinli and Christian Joseph R. Cumagu

Elucidation of mechanism of resistance of tomal
tobacco mosaic virus using protoplasts
Teodora O. Dizon and Lolita M. Dolores

Host range and virus-vector relationship of lutec
the namamarako (NMK) syndrome of ampalaya
Lolita M. Dolores, Ma. Luz J. Sison and Medinc
N. Yebron Jr.

Abstracts of Papers presented during the 37th Al
Annual Scientific Conference of the Pest Manag
3f the Philippines held at Grand Regal Hotel, De
May 2-5, 2006


JANUARY TO DECEMBER 2006


CENTS



richoderma

1-9

gens by

A. Gumarang 10-16

nguet

11-24

sto
'haple

25-35

de,
'ungi
36-42

against

43-50

us causing

edeun
51-62

versary and
lent Council
o City on
63-81










oumal OT I ropical Plant Patnology 42:1-i


ENHANCEMENT, ENZYMATIC ACTIVITY AND SURVIVAL
OF TRICHODERMA SPP. IN SOIL


Christian Joseph R. Cumagun

Associate Professor 3, Crop Protection Cluster, College of Agriculture, University of the
)hilippines Los Banos, College, Laguna.


ABSTRACT

Eight isolates of Trichoderma were tested for their ability to inhibit the growth of
Rhizoctonia solani (causal organism of sheath blight of rice) and produce volatile
compounds in dual culture test, and for their cellulolytic rates using the
dinitrosalicylic acid (DNS) method. All isolates inhibited growth of R. solani and
produced volatile compounds. T. harzianum (94-022) and T. longibrachiatum
(32895) catalyzed the highest amount of glucose indicating the highest rate of
cellulolysis. T. harzianum (94-016) was irradiated under ultraviolet (UV) light for
improved biocontrol ability. Reduction in growth of R. solani in vitro due to volatile
compounds produced by the irradiated mutant isolate was not significant
compared to the wild type (P = 0.05). Population density in non-sterile soil,
recorded as colony forming units (cfu), of selected isolates of Trichoderma
decreased from day 1 to day 35 and increased up to day 75. T. harzianum (94-
016) and T. viride (94-055) continued to decrease in population, suggesting the
need to add food base to prolong their survival.

(ey words: enzymatic activity, Rhizoctonia solani, survival, Trichoderma spp.


Gangopadhayay and Chakrabarti, 1982). focus of current studies. Cumagun and Ilag
-ive to 80% reduction in rice grain yield due (1997a) proposed that mycoparasitism (in
o this disease was reported in the Philippines vitro) and enzyme-mediated antibiosis (in
Ou, 1972). The unspecialized sheath blight vivo) were the principal mechanisms of
pathogen R. solani has a wide host range in biocontrol of T. harzianum against R. solani.
ice-based cropping systems infecting Parasitism of sclerotia was very evident in an
nungbean (web blight, root and stem rot) agar plate environment but the phenomenon
ind corn (banded blight) following rice (Mew was questionable in natural soil environment
it al, 1980). No resistant varieties against the (Cumagun and Ilag, 1997b). Our previous
>athogen have so far been found; breeding is results showed that Trichoderma was not
edious and chemical control is expensive effective in non-sterile soils (Cumagun and
I __ 4_ 4inA\ A- *-i.. _- > I _nr 4(10\1







2 Cumagur


sample of enhancing biocontrol L water) ) at 28uC.
apavizas et al.,1982). Little is also
ut the enzymatic mechanism of the UV-irradiation of T. harzianum (94-0
in the pathogen. Chitin was
ted by Cumagun and Ilag (1997a) Aliquots (1 ml) of a conidial suspensi
hancer of biocontrol ability of T. conidia per ml) of isolate 94-016 were
when added in sterile and natural on PDA and immediately exposed
irradiation for 90 min. Irradiation was p
iduction of volatile compounds was by Mineralight Lamp (Model UVG-11
ted on the four isolates of T. uncovered plates were irradiated
that were tested in vitro against R. distance of 9 cm from the surface to th
imagun et al., 1997a). Coconut The irradiated plates were cover(
)ical of T viride isolates (Rifai, 1969; incubated at 250C under fluorescer
)91), suggesting the presence of Two colonies developed and were isol
poundss that are inhibitory to PDA. Conidia from the two colonies
growth (Dennis and Webster. 1971). first irradiation were arown on Pr


termine the metabolic fungi were studied following!
T harrianmnim in nnn- hiv P ll t a1 N110QR fnllin







Enhancement, enzymatic 3


patnogen at least two- at the same temperature. I ne plate
thirds of the medium were removed and the bottom I
surface newly transferred mycelial disc (5 n
R. solani were inverted over on
3 = Trichoderma and the plate containing each of the Tnr
pathogen each colonized isolates and sealed with parafilm i
one-half of the medium plate containing mycelial disc of R.
surface and neither inverted over an non-inoculated I
organism appeared to served as control. Each test
dominate the other including the control was replica
times. The plates were incubated u
t= Pathogen overgrew condition at 280C. Radial growth i
Trichoderma at least two- measured after 24 hr and
thirds of the medium differences among treatments were
surface and appeared to by a statistical software PLABI
withstand invasion by Friedrich Utz, University of H<
Trichoderma Stuttgart, Germany).

5 = Pathogen completely Enzyme Assay
overgrew Trichoderma and
occupied the entire In culturing for fungal extract, 2-L E
medium surface flasks were filled with 1 L minimal r
the following composition: 6 g NaN(
late of Trichoderma was MgSO4, 0.52 KCI, 1.52 g KHPO,
itagonistic to R. solani if the MgSO4, 0.52 KCI, 1.52 g KHPO4,
'or a given comparison (when extract and traces of FeS04.71
or a given comparison (when ZnSO4.H20 and water. Ditnitrosal
3 nearest whole class number) (DNS) method was employed
)ut not highly antagonistic if the determination of reducing sugars
or = 3. 1925). One ml of 106 spores
ng the procedure of Garcia suspension was inoculated to a 25
:ion of the pathogen's growth containing 40 ml minimal medium
,d by measuring the percentage was added with 1 ml
adial growth (% IRG) after 4 carboxymethylcellulose (CMC) as
=G = 100[R1-R2]/R1]. R1 is the for cellulase production. Culture fl<
al distance grown by the incubated for 7 days at room tempel
he direction of the antagonist shaker (150 rpm). At the en(
, R2 represents the distance incubation period, fungal growth w
ie between inoculum positions off and the filtrate was collected
.n and the antagonist (treated). -,,, i r filtrnt, nf ar nh finnal ft


(oH=4.81 ar


",, r. ,,, V~a,3 ,, ,-r ,=Y CA maintained at 50"C. Three ml DNS re







4 Cumac


were cooled and absorbance in a per cent IRG (Fig. 1). This was supported
spectrohotometer was read at 550 nm. The the same rating the isolates were classic
amount of glucose catalyzed was estimated (Class 1) and the parasitism observed for
from a previously prepared standard curve isolates through microscopic observations.
using a simple linear regression analysis. Isolate 32895 (T. longibrachiath
catalyzed the highest amount of gluc
Survival of Selected Trichoderma (Table 2). The amount of glucose cataly;
Isolates in Soil by isolate 94-022 was similar to
Conidia of selected isolates were added to longibrachiatum. In previous experiment,
harzianum (94-022) exhibited a h
100 g portions of air-dry soil in 250-m haanm (94-022) ex ed a
beakers at 1 x 104 per fg. The conidia were competitive saprophytic ability in rice sti
added with enough water to adjust the buried in soil (Cumagun et al., 1996). 1
moisture in all samples at 50% and the fungal trait was confirmed in this study us
DNS method.
containers were covered with parafilm to me o
prevent water evaporation. The soils were All isolates of Tchoderma produ3
assayed with the dilution-plate method using volatile compounds with slates 328
modified TME. Modified TME contained one- 32891 and 32895 exhibiting the greal
half the usual amount of the nystatin reduction of R. solani growth (Fig. 2). A
concentration of the TME medium described inhibition (or stimulation) of the pathogen v
concentration of the TME medium described considered to be caused by vola
by Papavizas and Lumsden in 1982 (100 mg dered o be cus
metabolites produced by Trichoder
each of neomycin sulfate, bacitracin, penicillin otes podud by T
G, 25 mg chlortetracycline HCL, 20 mg slates (Dennis and Webster971).
nystatin and 500 mg sodium propionate in 1 L growth of R soanwas stimulated by
of V-8 juice agar). harzianum (94-016, 94-022) and T. viride (
of V-8 juice agar).
055) while the rest of the isolates w
RESULTS AND DISCUSSION inhibitory. Previous test for the presence
volatile compounds of T. harzianum (94-0
A simple method of genetic manipulation of 94-016, and 94-022) showed negative rest
Trichoderma for improved bioprotectant (Cumagun and Ilag, 1997b). The proba
activity is by UV irradiation of promising reason for this inconsistency could be
isolates (Harman and Tronsmo, 1992). In the inadequate incubation period of Trichoden
experiment, the irradiated mutant T. The experiment this time employed at lea,
harzianum (94-016), which originally formed 48 hr-old culture of the biocontrol agent
yellow pigment on PDA became dark green greater exposure to the pathogen within
with no pigment. There was no observed plate. Dennis and Webster (1971) report
imnrnvoment nf this iqnlate hrn mna nn that Trichoderma isolates producing vola


solani (LSD5% = 18.79) due to volatile
compounds in comparison to the wild isolate
94-016 was observed. Therefore, no further
study was made on the enhancement phase
of isolate 94-016. In contrast, certain biotypes
of T. harzianum suppressed the saprophytic
growth of R. solani more effectively than the
wild strains (Papavizas et al., 1982). All
isolates oft- Trichoderma were Pighly
antagonistic to R Solani on the account of


particularly T. viride and tentatively identified
one inhibitory metabolite as acetaldehyde.
Survival of T. harzianum (94-016) and
T. viride (94-055) in soil decreased
continuously up to 75 days in, soil while the
rest of the isolates began to increase after 35
days (Fig. 3). This result suggests that some
isolates can survive for such period without a
food base. Similar downward trend of
survival was reported by Papavizas (1982) for







Enhancement, enzymatic U


I. farlnarurrF I duueu o soUI rupuilaUlIU
density in cfu decreased after 35 days. After
75 days the population was reduced to less
than 30% and after 130 days to less than
10% for all isolates tested (Papavizas, 1982).
Fluctuation in temperature and moisture
content may limit growth of biocontrol fungi in
soil (Knudsen and Bin, 1990) but should not
be the main cause in this experiment
because the set-ups were covered with
parafilm to avoid water evaporation.
According to Lockwood (1977), soil
fungistasis theoretically should prevent
conidia from germinating and preserve them
in soil for a long time. Papavizas (1982)
postulated that some conidia are lysed in soil
without first germinating or they may
germinate in response to nutrient released by
soil and subsequently lyse in the absence of
adequate food base needed for growth and
sporulation. It is therefore recommended that
food base be amended in soil to prolong the
survival of Trichoderma.

LITERATURE CITED

Bell DK, HD Wells and Markham CR. 1982.
In vitro antagonism of Trichoderma
species against six fungal plant
pathogens. Phytopathology 72:379-
382.

Bissett J. 1991. A revision of the genus
Trichoderma. II. Infrageneric
classification. Can. J. Bot. 69:2357-
2372.

Cumagun CJR and Lapis DB. 1993. Practical
approach in mass production. of
Trichoderma spp. as a means of
biological control against sheath blight
of rice. Phil. Agr. 76:251-257.

Cumagun CJR, Ilag LL and Manalo JO.
1996. Competitive saprophytic ability
of Trichoderma spp. in relation to rice
sheath blight disease management. In:


rl ccu;u i ly UI L I i alZsii ia ILCI I ICdLIUl I
Mycological Congress 96', Seiburisha,
Chiba, p.111.

Cumagun CJR and Ilag LL. 1997a.
Enhancing the efficacy of
Trichoderma harzianum Rifai by chitin
amendment against sheath blight of
rice. Phil. Phytopathol. 33(2):72-86.

Cumagun CJR and Ilag LL. 1997b.
Parasitism of sclerotial bodies of
Rhizoctonia solani Kuehn by
Trichoderma harzianum Rifai and
Penicillium oxalicum Currie and Thom.
Phil. Phytopathol. 33(1):17-26.

Cumagun CJR, Hockenhull J and Lubeck M.
2000. Characterization of
Trichoderma isolates from Philippines
rice fields by UP-PCR and rDNA-ITS1
analysis: Identification of UP-PCR
markers. J. Phytopathol. 143:109-115.

Dennis C and Webster J. 1971. Antagonistic
properties of species groups of
Trichoderma. II. Production of volatile
antibiotics. Trans. Brit. Mycol. Soc.
57:41-48.

Gangopadhayay S. and Chakrabarti NK.
1982. Sheath blight of rice. Rev.
Plant Pathol. 61:451-461.

Garcia EF. 1991. Screening of fungal
antagonists to control Sclerotium
cepivorum. In: D. F. Jensen et al,
(eds). New approached in Biological
Control of Soil-borne Diseases.
IOBCM/PRS Bulletin, Copenhagen pp.
79-81.

Harman GE and Tronsmo A. 1992. Methods
of genetic manipulation for the
production of improved bioprotectant
fungi. In: D. F. Jensen et al., (eds).
New approaches in biological control
_X __:aB ? -- *: -- 1rM-/^ A Airf-%nft







6 Cumagun


Bulletin, Copenhagen, pp. 181-187.

Knudsen GR and Bin I. 1990. Effects of
temperature, soil moisture, and wheat
bran on growth of Trichoderma
harzianum from alginate pellets.
Phytopathology 80:724-727.

Lapis DB 1994. Biological control of sheath
blight of rice. Phil. Agr. 77(2):189-199.

Lewis JA and Papavizas GC. 1984. A new
approach to stimulate population
proliferation of Trichoderma species
and other potential biocontrol fungi
introduced into natural soils.
Phytopathology 74:1240-1244.

Lockwood JL. 1977. Fungistasis in soils. Biol.
Rev. 52:1-43.

Mew TW, Rosales AM and Elazegui FA.
1980. Ecology of the rice sheath blight
pathogen: saprophytic survival. IRRN
5:15.

Ou SH. 1972. Rice Diseases. Commonwealth
Mycological Institute, Surrey, England.
368 p.

Papavizas GC. 1982. Survival of Trichoderma
harzianum in soil and in pea and bean
rhizospheres. Phytopathology 72:121-
125.


Papavizas GC, Lewis JA and El Moity TH.
1982. Evaluation of new biotypes of
Trichoderma harzianum for tolerance
to benomyl and enhanced control
capabilities. Phytopathology 72:126-
132.

Papavizas GC and Lumsden RD. 1982.
Improved medium for isolation of
Trichodema spp. from soil. Plant
Disease 66:1019-1020.

Rifai MA. 1969. A revision of the genus
Trichoderma. Mycol. Papers 116:1-
56.

Sumner JB. 1925. A more specific reagent for
the determination of sugar in urine. J.
Biol. Chem. 65:393.

Weindling R. 1932. Trichoderma lignorum as
parasite of other soil fungi.
Phytopathology 22: 837-845.

ACKNOWLEDGEMENT

I thank Mr. Jaime Caracuel for the laboratory
assistance and Dr. Lina L. Ilag for the use of
the Postharvest Pathology Laboratory. This
work was funded by the UPLB Basic
Research Project No 99.9.







Enhancement, enzymatic 7


Table 1. Trichoderma isolates used in this study


ISOLATE CODE NUMBER ORIGIN

Trichoderma harzianum a 94-015 IRRI, Los Banos
Trichoderma harzianum b 94-016 IRRI, Los Banos
Trichoderma harzianumc 94-022 IRRI, Los Banos
Trichoderma viride d 94-054 Batangas
Trichoderma viride e 94-055 Batangas
Trichoderma saturnisporum 32890 Taiwan
Trichoderma reesei 32891 Taiwan
Trichoderma longibrachiatum 32895 Taiwan
a-e Morphological and molecular based identification (Cumagun et al., 2000).


Table 2. Amount of glucose catalyzed by the
dinitrosalisylic reagent (DNS) method


different isolates of Trichoderma using the


ISOLATE ACCESSION ABSORBANCE GLUCOSE
NUMBER (550 nm) CATALYZED
(mg/ml)

Trichoderma harzianum 94-015 0.13 0.20
Trichoderma harzianum 94-016 0.52 <0.20
Trichoderma harzianum 94-022 0.165 0.26
Trichoderma viride 94-054 0.09 <0.20
Trichoderma viride 94-055 0.65 <0.20
Trichoderma saturnisporum 32890 0.14 <0.20
Trichoderma reesei 32891 0.09 <0.20
Trichoderma longibrachiatum 32895 0.27 0.30








8 Cumagun



100


70 -
co 60
80
"8 50

40

"E 20

0
94-016 94-016 94-i lats 32890 32891 32895 Control
(irradiated)



Figure 1. Percent inhibition of radial growth (%IRG) of Rhizoctonia solani using different
isolates of Trichoderma (94-016 and 94-016 irradiated = harzianum; 94-054 =
T. viride; 32890 = T. satumisporum; 32891 = T. reesei; and 32895 = T.
longibrachiatum). Control set-up consisted of R. solani alone.



35
S30 --
S25 -





0
o 20
15

<10
25, ~ GPrO ~ L O








Enhancement. enzymatic 9







12 0

8

6
S---94-015
4 1-- 94-016
D i 94-022 6
E 2 94-054
Z -W---94-055


0 12 35 75

Days


Figure 3. Survival of different isolates of Trichoderma (94-015, 94-016 and 94-022 = T.
harzianum; 94-054 and 94-055 = T. viride) in non-sterile soil. Colonies were isolated
using modified Trichoderma medium E.








Journal of Tropical Plant Pathology 42:10-16


MOLECULAR CHARACTERIZATION OF IMPORTANT CORN
PATHOGENS BY POLYMERASE CHAIN REACTION


Cecilia B. Pascual', Cherry A. Relevante2 and Alain A. Gumarang3

1University Researcher, 2Formerly, University Research Associate and 3University
Research Associate; Institute of Plant Breeding, College of Agriculture, UP Los Batios, College,
Laguna.


ABSTRACT

Most of the corn varieties are susceptible to many diseases resulting to reduced
yield and seed quality. Mixed infection is usually observed in hybrids and OPVs
in many corn-growing areas. A sound knowledge of the ecology of the pathogens
and epidemiology of the diseases has resulted in the improvements in the
methodology used such as selective-diagnostic media. Although they can be
isolated, identification of most corn pathogens is time-consuming and labor-
intensive procedure that require skills. Rapid PCR protocols using genus/
species-specific primers and ITS primers were optimized to rapidly detect corn
pathogens such as Erwinia chrysanthemi pv zeae causing bacterial stalk rot,
Rhizoctonia solani causing banded leaf and sheath blight, Peronosclerospora
philippinensis causing downy mildew and Stenocarpella macrospora causing leaf
blight, ear rot and stalk rot.

Key words: corn pathogens, species-specific primer, PCR, pathogen detection


INTRODUCTION

The current methods for identification of most
pathogens of corn and other crops, and for
differentiation between species, mostly rely
on physiological markers and morphological
traits. Another technique is the expressed
characteristic symptoms after host
inoculation. These methods are quite simple
and inexpensive in terms of materials used
but they can be labor intensive and time
consuming where results can be obtained
after several weeks. Besides, assessments
using these procedures are subjective to
some extent and considerable experience is
required for reliable diagnosis. At present,
there is demand for a simple, rapid and


reliable methods for detection and
identification of pathogen species that do not
use morphological characters. There is
considerable potential in the use of molecular
technology (Henson and French, 1993) like
Polymerase Chain Reaction (PCR). They are
highly sensitive and specific. Ribosomal
rDNA genes are also useful for phylogenetic
and taxonomic studies because they are
highly conserved but exhibit interspecies
differences (White et al., 1990). Universal
primers of internal transcribed region (ITS) of
rDNA are now available for investigation by
PCR amplification.
A number of diseases affecting corn
are of economic importance. Others are
potentially destructive if given the right







Pascual et al. 11

condition for epidemic development. The dried for 1 hr and resuspended in 100 il TE
condition for epidemic development. The buffer (10 mM Tris-HCI, pH 7.5 and 0.1 mM
following are the important corn diseases in EDTA). DNA of same isolate was pooled and
the Philippines and their causal organism: 100 pl TE buffer was added. DNA was
Bacterial stalk rot caused by Erwinia treated with 5 pi RNAse, incubated at 37C
chrysanthemi pv zeae (Sabet) Victoria or for 1 hr, and extracted with 500 il
Pectobacterium chrysanthemi pv zeae phenol/chloroform/isoamyl alcohol (25:24:1).
(Kelman), ear and stalk rots caused by After RNAse digestion and phenol-
Diplodia macrospora or Stenocarpella chloroform-isoamyl alcohol-extraction, the
macrospora (Earle), banded leaf and sheath DNA concentration was estimated by running
blight caused by Rhizoctonia solani (KOhn), the samples together with undigested lambda
downy mildew caused by Peronosclerospora DNA of known concentration on 1% agarose
philippinensis (Weston) Shaw and other leaf gel at 50 V/cm for 45 min. The gel was
diseases. Most of these diseases require stained in 0.5 pg/ml ethidium bromide
time, effort and skills for correct identification, solution for 15 min and photographed. The
Investigations were made to find the PCR DNA samples were stored in the freezer until
assay that can rapidly detect them. use.

MATERIALS AND METHODS DNA Extraction of Pectobacterium
chrysanthemi
DNA Extraction of Fungal Pathogens chsanthemi
DNA of P. chrysanthemi, also known as
Genomic DNA of D. macrospora, P. Erwinia chrysanthemi pv zeae was extracted
philippinensis and R. solani isolates obtained following the method of Nassar et al. (1996)
from different corn-growing areas in the with some modifications. The isolate was
Philippines were extracted following the grown overnight at 300C in 2 ml Luria broth.
procedure of Lee and Taylor (1990) with One and a half (1.5) ml of the culture was
some modifications. Pure cultures of D. centrifuged in sterile microfuge tubes at
macrospora and R. solani were grown on 12,000 rpm for 30 sec. Bacterial cells were
oatmeal broth and potato dextrose broth, resuspended and washed 2x in 1 ml 50x TE
respectively while spores of P. philippinensis buffer (500 mM Tris-HCI, 50 mM EDTA, pH
were collected from purely downy mildew- 8.0). Supernatant was discarded and cell
infected leaves that were aseptically to pellet was resuspended in 650 pl of
sporulate. Frozen mycelial mats of spores extraction buffer. A 100 of lysis solution,
were ground in liquid nitrogen with a sterile ea n b A 10 of lsis solution
mortar and pestle, transferred into 1.5 ml 1% SDS and 50 Tg of Proteinase K were
serially added. The mixed suspension was
microcentrifuge tubes, suspended in 500 pl
lysis buffer (50 mM Tris-HCI, pH 7.4, 50 mM incubated at 370C until preparation is clear.
EDTA, 3% sodium dodecyl sulfate and 1% The mixture was deproteinized by sequential
mercaptoethanol), vortexed, and incubated at addition of phenol-chloroform-isoamyl alcohol
650C for 1 hr in a water bath. The samples (25:24:1 v/v) and phenol-chloroform (1:1 v/v).
were extracted twice with 500 (P1 The aqueous phase was collected.
were extracted twice with 500 pl A 1 ml of 70% ethanol was added to
phenol/chloroform/isoamyl alcohol (25:24:1 suspension to precipitate DNA. The
After centrifugation, DNA w the suspension to precipitate DNA. The
vvv). ngwas solution was mixed by slow inversion of the
precipitated by adding 10 pi 3M sodium tube and was centrifuged for 5 min at 8000
acetate and 500 pl1 isopropanol into the rpm. The supernatant was discarded. The
aqueous phase and centrifuged for 5 min. resuspended DNA pellet is a minimum
The pellets were rinsed with 70% ethanol, air-











U pl.) ot iA I t DTrrer, piM .u Dana was generarea aner
I by eyeball estimation [agarose of S. macrospora isolates
)resis of DNA extract with DNA primer pair. Result was cc
iunt (? DNA)]. work of Xia and A
.trannrnmrIlln mnurli. Th


PCR amplification of the genomic DNA <
corn pathogens was performed using th
universal primers, ITS1 and ITS4 except in I
philippinensis where PG
(Peronosclerospora genus specific) prime
from CIMMYT was used and in I
chrysanthemi, where species-specific prime
(from pectolytic enzyme produced by EC
(Nassar et al., 1996) was utilize
Amplification reactions were performed in 1
p.l reaction volumes containing 1x Ta
incubation buffer, 40 p.M each of dATF
dCTP, dGTP and dTTP, 0.3 pM primer, 50 n
of genomic DNA, 1 U Taq DNA Polymeras
(Gibco, BRL) and sterile PCR water (Gibci
BRL). Amplification was done on PT(
Cooled Thermal Cycler using the following
reaction conditions: initial denaturation ,
930C for I min followed by 29 cycles of 1 mi
denaturation at 930C, annealing for 2 min
530C and extension for 2 min at 720C with
final extension of 5 min at 720C. Five (5) pl (
each reaction was analyzed on 1% agaros
gel run at 50 V for 45 min in 0.5x TAE buffe
For P. philippinensis and E.chrysantherr
which used specific primers, the
corresponding primers were also tested i
other genus and species to confin
specificity.
For R. solani, restriction enzyme
such as EcoR1, Hinfl and Mbol were used t
digest the amplified ITS rDNA region f(
detection of variation among sub-species <
R. solahi AG1.

RESULTS AND DISCUSSION

The products of PCR assay of differed
important corn pathogens are presented i
Fig. 1, 2, 3 and 4. An approximately 575 b


I~cylUlI uI ULIIII yC lI IUs uI uilILlly LIlad IL "I
be useful in identification and detection of th
genus Stenocarpella. Previous studies hav
shown that the non-coding and variable
complex ITS regions and the coding ar
conserved region of 5.8S rRNA, which ai
within the scope of amplification by means i
ITS primers in this study, are useful
determining close genealogical relationship
(Martinez-Culebras et al., 2003). Specie!
specific primer can be designed from th
sequence of the amplified ITS rDNA of th
pathogen, which is currently being develop
under a DA-BAR project of the institute.
A 720 bp size ITS rDNA of R. sola,
which was digested with three restrictic
enzymes resulted to grouping of R. sola,
AGI into -IA, -IB and -IC (Pascual et a,
2000). Similar to the findings of Liu & Sincla
(1993), we found the same fragment size (
rDNA-ITS region of AG1 subgroups an
restriction sites using the three
endonucleases (Fig 2). The amplifie
fragment length of AG1-IA was estimated 1
be 720 bp, but genetic differences in IT
region among AG1-IA isolates were n<
observed. PCR-RFLP (polymerase chai
reaction-random fragment lengi
polymorphism) was useful only i
differentiating the three subgroups of AG
(AG1-IA, AG1-IB andAG1-IB).
ITS1-ITS2, ITS3-ITS4 and ITS1-ITS
primer pairs and different PCR condition
were tested, but the different prime
combinations and conditions could not yiel
single band for P. philippinensis and th
pattern is not reproducible. The same rest
was demonstrated in other reports. I
philippinensis had a much larger size of IT
region compared to other species. The on
specific primer that worked is th
Peronosclerospora genus specific (PGS


IL Irlvlrvulal











II I ll F IIc VI I II llVIIVI I I # tlI IVt I I .l II
)wny mildew pathogen of corn is an obligate
irasite and it cannot be cultured artificially,
) have devised a protocol of inducing
iorulation and collecting pure spores of P.
lilippinensis for genomic DNA extraction
ised on the method of Bonde et al. (1984)
th some modifications.
After optimizing the PCR condition
*ing primer pair ADE1 (5'-
ATCAGAAAGCCCGCAGCCAGAT-3') and
)E2 (5'-
TGTCCCCGATCAGGATGGTTTGTCGTGC
') obtained from pectate lyases-encoding
,nes specific to P. chrysanthemi pv zeae, a
!0 bp band was produced. The same result
is been demonstrated by Nassar et al.
996). No band was detected on the controls
>ed such as P. carotovora, Ralstonia
dlanacearum and negative control, which
)nfirmed the specificity of this primer as a
ol for bacterial stalk rot identification and
btection in corn and other crops affected by
chrysanthemi pv zeae.
The techniques described herein may
it rid of the need for pure culture isolation
)ecifically in downy mildew and bacterial
alk rot pathogens. There are quick DNA
:traction assays for use with infected corn
materials that eliminate pathogen isolation
ior to PCR (Hoisington et al., 1994,
IBIONET, 2001). These techniques
gether with traditional disease diagnostics,
lould provide rapid, accurate diagnosis of
ost corn pathogens leading to a more
fective disease management.

LITERATURE CITED

VIBIONET. 2001. Third Annual Progress
Report on Marker Assisted Selection
for the Transfer of Downy Mildew
Resistance in Philippine Maize
Inbreds A Research Project
Component of the Asian Maize
Biotechnology Network (AMBIONET).


inde MR, Peterson GL, Dowler WM, May B.
1984. Isozyme analysis to differentiate
species of Peronosclerospora causing
downy mildew in maize.
Phytopathology 74:1278-1283.

mnson JM and French R. 1993. The
polymerase chain reaction and plant
disease diagnosis. Annual Rev
Phytopathol. 31:81-108.

)isington D, Khairallah M and Gonzalez-de
Leon D. 1994. Laboratory Protocols:
CIMMYT Applied Molecular Genetics
Laboratory. Second Edition. Mexico
D.F.: CIMMYT.

e SB and Taylor JW. 1990. Isolation of
DNA from fungal mycelia and single
spores, In: Innis, MA, Gelfand DH,
Sninsky JJ and White TJ (eds) PCR
Protocols: a Guide to methods and
applications. Academic Press. San
Diego pp. 282-287.

j ZL and Sinclair JB. 1993. Differentiation
of intraspecific groups within
anastomosis group 1 of Rhizoctonia
solani using ribosomal DNA internal
transcribed spacer and isozyme
comparisons. Can. J. PI. Pathol.
15:272-280.

artinez-Culebras PV, Querol A, Suarez-
Fernandez MB, Garcia-Lopez MD and
Barrio E. 2003. Phylogenetic
relationships among Colletotrichum
pathogens of strawberry and design of
PCR primers for their identification. J.
Phytopathol. 151:135-143.

assar A, Darrasse A, Lemattre M,
Kotoujansky A, Dervin C, Vedel R and
Bertheau Y. 1996. Characterization
of Erwinia chrysanthemi by


___







14 Molecular characterization


pectinolytic isozyme polymorphism
and restriction fragment length
polymorphism analysis of PCR-
amplified fragments of pal genes.
Appl. and Environ. Micro. 62(7):2228-
2235.

Pascual CB, Toda T, Raymundo AD and
Hyakumachi M. 2000.
Characterization by conventional
techniques and PCR of Rhizoctonia
solani isolates causing banded leaf
and sheath blight in maize. PI. Pathol.
49(1):108-118.

White TJ, Bruns T, Lee SB and Taylor J.
1990. Amplification and direct
sequencing of fungal ribosomal RNA
genes for phylogenetics. Pages 315-


322. In: PCR Protocols: A guide to
methods and applications. MA Innis,
DH Gelfand, JJ Sninsky and TJ White,
(eds.). Academic Press, San Diego,
CA.

Xia Z and Achar PN. 2001. Random amplified
polymorphic DNA and polymerase
chain reaction markers for the
differentiation and detection of
Stenocarpella maydis in maize seeds.
J. Phytopathol. 149:35-44.

ACKNOWLEDGMENT

This work was part of projects supported by
CIMMYT, PCARRD, DA-BAR and UPLB-
Basic Research. We thank Ms. Amalia Ilagan
for technical assistance.








Pascual et al. 15


V)
E
(n,


575 bp


Figure 1. PCR amplification of ITS region of 6 Stenocarpella
macrospora isolates. Lanes Left to right: M= 1000
bp DNA Ladder and 6 isolates.


M 1 2 3 4


M 1 2 3 4


M 1 2 3 4


Figure 2. DNA restriction digest patterns of Rhizoctonia solani for nuclear
ribosomal RNA genes of ITS region by endonucleases EcoRI (a), Hinfl
(b) and Mbol (c). Lanes 1-4 are AG1-IA, AG1-IB, AG1-IB and AG1-IC,
respectively.








16 Molecular characterization


1 2 3 4 5 6 7





Figure 3. Fingerprints of P. philippin







genus specific primer. Lane
3 = negative control, 4.12 :.
.. ., .., ..





Figure 3. Fingerprints of P. philippin
genus specific primer. LanD
seedling previously expose
3 = negative control, 4-12 :





1 2 3 4 5 6 7 8













Figure 4. Pectobacterium chrysanthet
specific primer pair ADE1-A[
Lane 2 = P. carotovora, Lan,
Lane 4 = negative control, LU
chrysanthemi pv. zeae


9 10 11 12













sis using Peronosclerospora
= Marker, 2 = symptomless
to point source of inoculum,
ifected samples.





10 11 12 13 14













pv. zeae fingerprint using species
2. Lane 1= 1kb ladder marker,
t.-.k






























2. Lane I= 1kb ladder marker,
= Ralstonia solanacearum, and
is 5-14 = isolates of P.







Journal or I ropical iPant Patnology 42:1 -24


'LLAiMULUIUH'U
PATH01


Bernard S. Tad-awan', Maria The

'Associate Professor, Department
State University (BSU), La Trinidad, Bengu
La Trinidad, Benguet.




Collections of Plasmodiophora brass
as well as single spore-derived cul
subjected to the European clubroot c
pathotype make-up based on clubbi
for each host line.
Two collections from La Trini
and 19/31/31. A single spore-deri%
through the modified technique w;
Buguias collection was designated a!
In order of virulence base
Pathotype 31/31/31 was virulent on ,
on the universally susceptible cult
followed by ECD 07, 06, 08, 10, 09
19/31/31 was virulent on seven EC[
(Giant Rape Commercial) followed b!
The SSDC Pathotype 16/16/
75.83% and 71.66% indices, respect
only on ECD 07, 06 and 05, with EC
index.

Key words: pathotype, single spore-derivec


INTRODUCTION

Clubroot, caused by Plasmodiophoi
brassicae Wor., is a disease of world-wic
importance inflicting severe losses on three
important brassicae species, Brassic
oleracea, B. napus and B. rapa (Crute et a
1983).
In the highlands of Northern Luzoi
estimated clubroot incidence on crucifers ,


IKA $/KARIL7;At WUK.
'ES IN BENGUET


sa P. Baclili2 and Cristina D. Bidang2

Plant Pathology, College of Agriculture, Bengu
2BSA Graduate, major in Plant Pathology, BSI



ABSTRACT

e from La Trinidad and Buguias, Benguet
a from the La Trinidad collections were
rentall (ECD) host lines and assessed for
and consequent assigned denary values

i were designated as Pathotypes 31/31/31
culture (SSDC) from Pathotype 31/31/31
designated as Pathotype 16/16/19. The
athotype 21/23/31.
n the 25% cut-off disease index, the
an ECD host lines with the highest (100%)
r, ECD 05 (Chinese cabbage Granaat),
id ECD 14 (63.33%). Likewise, Pathotype
nes with the highest (79.17%) on ECD #7
CD 10, 05, 09, 06, 14 and ECD 08,
was virulent only on ECD 05 and 10, with
sly. The Pathotype 21/23/31 was virulent
07 as having the highest (66.67%) disease


ilture, European clubroot differential host lines


10 to 50% was reported in Baguio/La Trinidc
and Atok, respectively (Joerdens-Roettgi
and Agpad-Verzola, 1984). The disease
progressed among other crucifer-growir
areas of Atok, La Trinidad and Buguias (Tai
awan, 1986). Since then, an outbreak he
occurred where 38% of the 710 ha planted
crucifers and inspected from 1989 to 19E
had the disease (personal communication
With this situation, Tad-awan (240l







18 Tad-awan et al.


estimated, based on the assumptions that
with the average production of cabbage from
clubroot-root-free areas at 55 t/ha, a 20%
yield loss to the 38% of the 710 ha or 269.8
ha of clubroot-infected areas and a price of 4
pesos kg'1, almost 12 million pesos per
cropping would have been lost due to
clubroot disease. Cabbage production in the
highlands of the Cordillera averages around
76% of the country's total production from
1989 to 1993 peaking at 80.81% in 1992.
The pathogen is a soil-borne, obligate
biotroph, of the Kingdom Protista
(Alexopoulos et al., 1996), which can survive
in the soil without access to its host for up to
15 years (Mattusch, 1977).
Little information is available on the
pathotype make-up of Plasmodiophora
brassicae infecting crucifer crops in the
Philippines. Understanding the pathotype
make-up of the pathogen may greatly help in
managing clubroot disease. A known
pathotype is recommended to be used in
selecting resistant entries.
Pathotype is a genetically and often
geographically-distinct group of pathogens
within species infecting a set of plant
varieties. Its identification depends on the
host genotype and can be assessed through
use of established European clubroot
Differential host lines or ECD series as
proposed by Buczacki et al. (1975) and
subsequently used by various researchers.
The system of identification involves
inoculation of spore suspension of
Plasmodiophora brassicae collection or single
spore-derived cultures (SSDC) to three
Brassica species with five genotypes of each
species. The denary values for each
inoculated differential host line exhibiting
clubroot disease are summed up for each
species and these describe the pathotype of
tiie isolate. For instance, a pathotype is
identified as ECD 16/31/31 if its spores infect
differential host 05 (ss. Pekinensis cv.
Granaat of B. rapa); host 06 and 07 of B.
napus and all lines of B. oleracea.


Two separate studies were
conducted, one from October, 2001 to March,
2003 and another from May, 2004 to October,
2005 at the BSU Greenhouse Experimental
area (1) to compare two techniques of
producing SSDC of Plasmodiophora
brassicae; (2) to determine the pathotypes of
bulk isolates and SSDC under greenhouse
condition, and (3) to determine the virulence
of the known pathotypes.

MATERIALS AND METHODS

Isolate Collection and Pathotype
Determination

One clubbed root, each collected from La
Trinidad and Buguias, designated as bulk
isolates, was separately multiplied on
Chinese cabbage (F1 Hybrid Super 60)
planted in lime-free potting mix peat, sand
and garden soil (1:1:1, v/v/v).
After multiplication, the isolates were
separately macerated using mortar and
pestle and sieved in eight layers muslin cloth.
Using haemacytometer, spore count was
made from the suspension. Inoculum
suspension from each isolate at 1 X 106
spores ml-' was added separately to lime-free
potting mix to form inoculum slurry. The
slurry was placed onto furrows from lime-free
potting mix; two on each plastic tray.
Thirty seeds of each of the 15
European clubroot differential (ECD) host
lines were sown onto the inoculum slurry. The
plants were maintained for 7 wk and
evaluated for clubbing severity following the
rating scale of Williams (1966).
The collections (appropriately called
population after passing through ECD testing)
were evaluated for pathotype based on the
clubbing and assigned denary values
(Buczacki et al., 1975). From the clubbed
root lines, the disease indices were also
noted based on Some et al., 1996 from 0 (no
gall) to 100 (all plants with grade 3 galls). A
cut-off score of 25% was used to classify
reactions as virulent or not. The same








Plasmodiophora brassicae 1!


procedure for pathotyping was follow
the wqinnip anor-dririved culture


Obtaining Single Spore-derive
(SSDC)

From a clubbed root of one of 1


r f,


d Culture


Trinidad, spore suspension at
concentration of 1 X 103 spores ml-1 wa
prepared and used for single spring.
Two methods, the first technique
modified from that of Jones and Ingrar
(1982); and the second modified from Som
et al., (1996) of single spring were use4
With that modified from Jones and Ingrai
(1982), a drop of spore suspension wa
spread over 1% water agarose earlik
poured on a Petri plate. A single spore wa
marked out using a spore punch mounted o
a dummy microscope objective. The disc (
agarose with the single spore was lifted an
transferred using sterilized needle to the ro4
hair of each 2 day-old Chinese cabbag
seedling earlier grown in moistened tissu
paper. The inoculated seedlings wer
incubated for 24 hr under dark condition
before transplanting onto sterilized pottin
mix.
With that from Some et al. (1996),
drop of spore suspension was spread ovw
1% water agarose earlier poured on a glas
slide. The agarose was sliced to 1 mm
After scanning at 100X magnification, th
section with a spore was removed usin
sterilized needle and was inoculated o
roothair of a 2 day-old Chinese cabbag
seedling earlier grown in moistened tissu
paper, incubated and transplanted ont
potting mix similarly with that of the fin
method.
Clubbed roots resulting from th
single spore infection were counted. One <
the clubbed roots was multiplied on Chines
cabbage (F1 Hybrid Super 60) as earli(
employed. From the resulting clubbed root
inoculum was generated and subjected f<


The disease index (D.I.) wa
determined as used by Some et al (1996) as

D.I. = (0 X) + (25 X n) + (50 X n) + (100 X n
no + n, + n2 + n3

The disease index varied from 0 (n
gall) to 100 (all plants with grade 3 gall
based from Williams, 1966). A cut-off score (
25% was used to classify reactions a
virulent or not virulent.

RESULTS

Production of Single Spore-Derived
Cultures

Fourteen of the 220 plants (Fig. 1), eac
inoculated with a single spore, produce
clubbing using the technique modified froi
that of Jones and Ingram (1982) wil
concomitant success rate of 6.36% (Table
Fig. 2). On the other hand, no plant, among
the 100 plants, inoculated following th
technique modified from that of Some et a
(1996) had clubbing.
The means of singling out a single
spore from the first technique via the use (
the dummy objective as well as the greatE
number of seedlings inoculated would hav
greatly contributed to its success rate.

Pathotype Designations

The two La Trinidad collections (LTBC) wei
designated as Pathotypes 31/31-/31 an
19/31/31 (Table 2, Fig. 3 and 4). The fir
pathotype as named was able to caus
clubbing on all the ECD host lines. As sucl
the pathotype was more virulent than th
second pathotype. Said Pathotype (31/31/3'
can, thus, be used as a good candidate 1
screen for resistance in any crucifer breedir
program. On the other hand, the presence i
this virulent pathotype would indicate ii
difficulty in disease management. Knowing
its presence in La Trinidad should comp
researchers to find better ways of dealing







20 Tad-awan et E


with it. Avoiding its spread to places whei
not found through quarantine can be a goc
means of prevention. The Pathotyp
19/31/31 was not only able to cause clubbir
on ECD host 03 (B. rapa ssp. Rapifera line i
and 04 (B. rapa ssp. Rapifera line AabbCC (
fodder turnips) but caused clubbing on ,
other lines. ECD 04 was found to be the mo
resistant (Scott, 1985) as confirmed I:
Toxopeus et al. (1986) to show a high degree
of resistance to virulent populations of
brassicae.
The SSDC, earlier derived froi
Pathotype 31/31/31 was designated E
Pathotype 16/16/19. The Buguias populatic
was designated as Pathotype 21/23/31.
In terms of virulence based on th
25% cut-off disease index, the La Trinida
bulk isolate Pathotype 19/31/31 was virulei
on seven ECD host lines (# 5, 6, 7, 8, 9, 1
and 14) with the highest index (79.17%) c
ECD #7 (Giant Rape Commercial). Th
pathotype infected the same host lines wil
that of Pathotype 31/31/31 but instead i
ECD #7 as the having the highest disease
index. Pathotype 31/31/31 had the high!
disease index (100%) on the universal
susceptible cultivar, ECD #5 (Chines
cabbage Granaat) followed by ECD #
(87.5%) and ECD #6 (83.33%).
The SSDC Pathotype 16/16/19 we
virulent only on ECD #5 and #10, wit
75.83% and 71.66% indices, respectively!
The Buguias bulk isolate Pathotype 21/23/3
was virulent only on ECD #5, 6 and 7, wit
ECD #7 having the highest (66.67%) disease
index.

RECOMMENDATIONS

Considering the presence of a viruler
pathotype of Plasmodiophora brassicae in L
Trinidad, Benguet, quarantine measure
against its spread is paramount.
For purposes of selection or breedin
for resistance for certain crucifer crops a
component of disease management, the us


of the identified virulent pathotype
recommended as inoculum source.
Other crucifer growing areas in tt
Philippines should be assessed for tt
pathotype make-up and be compared to wh
have been assessed so far within the count
and countries where crucifer seeds are beir
imported from.

LITERATURE CITED

Alexopulos CJ, Mims CW and Blackwell P
1996. Introductory Mycology. Jol
Wiley and Sons, Inc. New York, USj
Pp. 751-756.

Buczacki ST, Toxopeus H, Mattusch I
Johnston TD, Dixion GR ar
Hobolith LA. 1975. Study
physiologic specialization
Plasmodiophora brassicae proposal
for attempted rationalization throuc
an international approach. Trans. Br
Mycol. Soc. 65: 290-303.

Crute IR, Phelps K, Barnes A, Buczacki S
and Crisp P. 1983. the relations
between genotypes of three brassica
species and collections I
Plasmodiophora brassicae. F
Pathol. 32:415-420.

Joerdens-Roettger D and Agpad-Verzol,
1984. Plasmodiophora brassicae c
crucifers. FAO Plant Protectic
Bulletin 32: 78-80. d. K. Zammaran
(ed.).

Jones DR and Ingram DS. 198;
Characterization of isolates derive
from single resting spores
Plasmodiophora brassicae an
studies of their interaction. PI. Pathc
31-93Q-9?4A


Mattusch P. 1977. Epi
of crucifers. In


demiology of clubro
: Proceedings <







-I00IIIuuIuPIIuI0 0J II I


V VUI VI 111I I 'I IVV %1%I 11 1 l 1Il L-U. .J. I .
Buczacki and PH Williams. Unviersity
of Wisconsin, Madison, USA. pp. 24-
48.

Some A, Manzanares MJ, Laurens F,
Thomas G and Roxel F. 1996.
Variation for virulence on Brassica
napus L. amongst Plasmodiophora
brassicae collections from France and
derived single-spore isolates. PI.
Pathol. 45:432-439.

rad-awan BS. 1986. Survey, pathogenicity
and chemical control of clubroot
(Plasmodiophora brassicae Wor.) on
chinese cabbage (Brassica rapa ssp.
pekinensis). MS Thesis. Benguet
State University. La Trinidad,
Benguet.

F&d-awan BS. 2000. Participatory approach
to technology development of clubroot
disease management in Benguet. Ph.
D. Dissertation. Benguet State
University. La Trinidad, Benguet.


I VAVi^U 3 I I., ILI I I .,.\ *1 1sI IVIMlLUa V I I I .
1986. Physiological specialization in
Plasmodiophora brassicae: An
analysis by international experiment.
Trans. Brit. Mycol. Soc. 87:279-287.

Nilliams PH. 1966. A system for
determination of races of
Plasmodiophora brassicae that infect
cabbage and rutabaga.
Phytopathology 56:624-626.

ACKNOWLEDGMENT

rhe authors wish to thank Ms Angela
Pinnegar and Dr. Dave Astley of the Genetic
Resources Unit, Horticulture Research
international and Dr. Geoffrey R. Dixon of the
3reen Gene International, U. K. for sharing
ECD host lines; and the Flemish Inter-
Jniversity Council, Belgium through the
'hilippines-Institutional University
Cooperation Programme (PIUC) for financial
assistance to one study.







22 -ad-awan et al


Table 1. Number of single spore-derived cultL



TECHNIQUE NO. OF PLANTS
iNOCULATED

I. Single spore 220
inoculation
II. Single spore 100
inoculation
I modified from Jones and Ingram (1982), 1I














AII


Figure 1. Chinese cabbage seedlings


















Figure 2. Two of the 14 single sp


produced



NO. OF PLANTS % SUCCE S
WITH CLUBROOT

14 636

0 0.00

modified from Some et al. (1996)


















ich inoculated with a single spore.


















i-aerived culture clubbed roots.


















iAim








Figure 3. Fifteen ECD host lines e
one of the collections (LI









A


Figure 4. ECD seedlings from a La
Pathotype (A), the SSDi
16/16/19 (B) and the Bu!
21/31/31 (C).


B C
er inoculated with spore suspension of
C1).













-inidad collection (LTBC2) designated as
rom La Trinidad designated as Pathotype
as collection designated as Pathotype


nasrrrooru~rrrora urassrca~ Lu





able 2. Pathotype Designations of the Collections ar


CD LTB C 1
OST No. of Disease Pathotype No. of
NE Plants with Index Design- Plants with
Clubroot ation Clubroot

01 7 6.67 31 7
02 9 7.50 7
03 15 23.33 0
04 8 6.67 0
05 30 100.00 30
06 30 83.33 31 24
07 30 87.50 30
08 30 80.83 22
09 30 71.67 29
10 29 75.00 29
11 11 13.40 31 8
12 12 15.80 6
13 8 7.50 13
14 28 63.33 25
15 15.83 5


Single Spore-Derived Cultures (SSDC)


BC2 SSDC FROM LTB C 1
ease Pathotype No. of Disease Pathc
ex Design- Plants Index Desig
ation with Clubroot ation

6.67 19 0
9.17 0
0
0
60.83 30 75.83
52.50 31 0
79.17 0
32.50 0
55.83 '0
65.00 30 71.66
9.17 31 8 8.33
5.00 11 14.17
15.00 0
34.16 0
3.33 5 4.16







Joumal of Tropical Plant Pathology 42:25-35


RESPONSE OF TWO CARROT (DAUCUS CAROTA L.)1CULTIVARS
TO VARYING LEVELS OF ROOT-KNOT NEMATODE
(MELOIDOGYNE HAPLA CHITWOOD) INOCULUM


Merannyl M. Abuan' and Luciana M. Villanueva2

'Former Undergraduate Student and 2Professor, respectively, Department of Plant
Pathology, Benguet State University, La Trinidad, Benguet.

ABSTRACT

The effect of Meloidogyne hapla parasitism on the growth and yield of two carrot
cultivars, New Improved Kuroda and Tokita Kuroda was studied under
greenhouse conditions. The plants were individually inoculated with 0, 50, 100,
500, 1,000 and 5,000 juveniles per pot. Data on the fresh root weight, gall index,
number of galls on secondary roots, number of galls or damaged areas on tap
root, number of egg masses and final nematode populations in the roots and
yield were obtained at the completion of the trial. A statistical design of Complete
Randomized blocks with treatments arranged according to a 2 x 6 factorial model
(cultivars x Pi) was established and each experimental unit (one plant growing
per pot) was replicated five times with two plants per replicate.
Fresh top weight was not significantly affected by M. hapla in both
cultivars tested. However, root gall index, number of galls on secondary roots,
number of galled or damaged areas on tap roots, number of egg masses and
nematodes in the roots increased significantly as the Pi was increased in both
cultivars. The tap root quality was significantly affected by nematode inoculation
in New Improved Kuroda compared to Tokita Kuroda. In the former cultivar, all
the inoculated plants were not able to produce marketable yield. At lower Pi,
Tokita Kuroda was able to produce marketable roots but not at 1000 and 5000
juveniles per pot.

Key words: Meloidogyne hapla, carrot, New Improved Kuroda, Tokita Kuroda,
inoculum levels


INTRODUCTION Quebec, Canada. Symptoms of M. hapla
infection include galling, large proliferation of
Root-knot nematodes (Meloidogyne spp.) are secondary roots and tap root malformation
serious pests of carrots worldwide. For such as severe forking and stunting (Vrain,
instance, Belair (1992) reported that the 1982 as cited by Belair, 1992). In Michigan,
northern root-knot nematode, Meloidogyne USA, M. hapla has long been recognized as
hapla Chitwood, is a major pest of carrot in an economic pest of carrot production







26 Abuan and Vilanueva


(Townshend and Davidson, 1962). Reduction
of marketable carrot yields in excess of 25%
can occur as a result of M. hapla infection
(Berney and Bird, 1992).
Several root-knot nematodes, such as
Meloidogyne chitwoodi and M. fallax, pose an
increasing threat to European agriculture.
They are of particular concern as they are
able to multiply and attack most European
crops, including potato and carrot. Their
danger was recognized by their designation
as quarantine organisms in May, 1998
(Korthals and Molendisk, 2002).
In the Philippines, especially in
Benguet, root-knot nematode has already
been found affecting the production of
carrots. Depending on the variety and
nematode population densities, the nematode
could significantly affect the quality of the tap
root making them commercially undesirable.
According to Townshend and Davidson
(1962), many carrots are discarded in the
fresh market and processing industry
because of tap root galling due to M. hapla
infection. The more number of nematodes
present/penetrating the roots, the more
damage is done on plants. But in the case of
susceptible variety, even at low inoculum
level, the quality and quantity of carrots could
be significantly reduced. In the Netherlands,
no complete resistant cultivars of carrot were
found yet on root-knot nematodes. The most
successful control strategy for M. chitwoodi
and M. fallax is fallow (Korthals and
Molendisk, 2002).
The study was conducted to
determine the effect of varying levels of root-
knot nematode inoculum on the growth and
yield of two carrot cultivars.

MATERIALS AND METHODS

Identification of Meloidogyne species

Identification of the species of Meloidogyne
infecting carrot, perinneal pattern was done


using adult female of the nematode.

Preparation of Nematode Inoculum

The nematode inoculum was propagated on
Impatiens sp. in the greenhouse. Galled roots
were washed carefully with tap water to
remove adhering soil particles. The mature
egg masses were picked from the infected
roots and placed in a blue sieve lined with
tissue paper. The blue sieve was later fitted
into a plastic dish filled with about 10 ml of
distilled water for 24 hours. This allowed the
hatched larvae to pass through the sieve to
the water and the egg shells of the first stage
larvae to remain. The resulting suspension
contained a pure population of second stage
juveniles of Meloidogyne hapla which served
as the inoculum.

Inoculation of the Root-knot Nematode

Seeds of two carrot cultivars were sown in
previously prepared 20 cm-diameter clay pots
containing about 5 kg heat-sterilized soil. Five
carrot seeds were sown per pot and later
thinned out to maintain only one seedling per
pot. Second stage juveniles were introduced
in 4 splits starting a month after sowing. They
were inoculated by placing into the root zone
and later covered again with soil.
Uninoculated plants were provided to serve
as control.
The treatments included in this study
were two carrot cultivars (Tokita Kuroda and
New Improved Kuroda) and six inoculum
levels (0, 50, 100, 500, 1,000, and 5,000
juveniles per pot). The full factorial
combination (2 x 6) of treatments was
arranged in a Completely Randomized
Design with five replications with two plants
per replicate.
All the cultural management practices
in carrot production such as weeding;
wartering, fertilization and control of pests
except nematodes were employed uniformly







response of two carrot 27


n all the treatments to ensure good growth
and yield. At the termination of the
experiment, the following data were gathered:
resh top weight, yield, root gall index,
lumber of galls on secondary roots; number
if galled or damaged areas on tap roots; and
final nematode population in the roots. To
estimate the nematode damage, the rating
;cale of Belair (1992) was used: 0 no
palling, no forking, no stunting, marketable; 1
1-10 galls on secondary roots with light
working, no stunting, marketable; 2 10-50
jalls, non-coalesced, tap root with light
working, no stunting, marketable; 3 50-100
jalls with some coalesced, forking, no
stunting, unmarketable; 4 more than 100
jalls with many coalesced, severe forking
and moderate stunting, unmarketable; and 5 -
nore than 100 galls, mostly coalesced,
severe stunting, unmarketable. Determination
)f the final nematode population in the roots
vas done by washing the secondary roots
;eparately and about 10 g of the root
samples were fixed in FAA and stained in
)oiling acid fuchsin. Later, the roots were
washed with tap water to remove excess
tainn. The stained roots were crushed
between two glass slides and were observed
or the presence of nematodes at different
growth stages.
The data were analyzed statistically
sing Analysis of Variance (ANOVA) and
treatment means were separated using
)uncan's Multiple Range Test (DMRT).

RESULTS AND DISCUSSION

Identification of Meloidogyne species

Based on perinneal pattern, the species
affecting carrots was identified as
Meloidogyne hapla Chitwood (Fig. 1).

Fresh Top Weight

Root-knot nematode infection has no


significant effect on fresh top weight in either
:ultivar, although Tokita Kuroda had
numerically lower top weight than New
improved Kuroda. Likewise, no significant
interaction was noted between cultivar and
nematode inoculum level (Fig. 2). Although
lot significant at p=0.05, plants inoculated
vith 100 juveniles Ipot had heavier top weight
han uninoculated plants and those
noculated with 50 juveniles/pot. This was
rue in both cultivars tested although Tokita
(uroda had heavier fresh top weight than
lew Improved Kuroda.
These results are similar to the
findings of Prot et al. (1994) that low
populations of M. graminicola may to some
extent stimulate the growth of rice cv UPLRi-
5. However, these were contrary to the
findings of Bird (1970) that at high inoculum
evel, the growth of tomato plants was
significantly reduced when compared with the
ininoculated control and those inoculated
with lower levels of M. javanica. Wallace
1971) has proposed the hypothesis that
differences in plants responses to parasitism
)y M. javanica are the result of an interaction
between stimulatory and inhibitory processes
n the plant. The level of plant response must
depend on factors such as the ratio between
he number of nematodes and the food
sources supplied by the plant. Growth of
oot tips invaded by Meloidogyne juveniles is
frequently temporarily inhibited. The
esumption of growth of root tips and the
formation of galls may create a drain on the
plant resources in shoot tissue resulting in
suppression of shoot growth. The amount of
sourcess diverted, however, would be
directly related to the intensity of infection.
Low infection levels frequently stimulate plant
growth whereas high nematode densities
suppress plant growth and yield (Wallace,
1971). In addition, temporary inhibition of
root growth also interrupts the synthesis of
cytokinins and gibberellins which are
produced in root apices. Decreasing







28 ADUan ana villlanueva


synthesis of growth regulators in young plants
when they are most vulnerable to nematode
damage, probably, has profound influence on
plant growth.

Root Gall Index

The most obvious morphological response to
infection by Meloidogyne is the characteristic
galling or knotting of the host plant's roots,
hence its common name. Regardless of
inoculum level used, New Improved Kuroda
had significantly higher root gall index than
Tokita Kuroda. Likewise, inoculum levels had
also significant effect on the root galling
index. The effect of cultivar and inoculum
level interaction on the root gall index was
significant (Fig. 3). The root gall index
increased dramatically in New Improved
Kuroda with increasing nematode inoculum
whereas it increased very little in Tokita
Kuroda. For instance, New Improved Kuroda
plants inoculated with the highest level of root
knot nematode (5,000 juveniles/pot) had
significantly higher root gall index (4.9) than
Tokita Kuroda which received the same
number of juveniles with only 3.7. According
to Dropkin (1954) galls usually develop one
or two days after juvenile penetration, and are
often the first symptoms observed on an
infected plant. On a susceptible plant, gall
size is related to the number of nematodes in
the tissue. Galls induced by M. hapla are
usually smaller than those produced by the
other common Meloidogyne species and
characteristically have numerous lateral roots
protruding from them. In contrast to giant cell
formation, gall development is not essential
for normal nematode growth and
development. Consequently, gall and giant
cell formation are usually considered to be
separate, but associated phenomena
(Webster, 1969).

Number of Galls on Secondary Roots


Figure 4 shows the difference between the
two cultivars tested in terms of the number of
galls on secondary roots. Apparently, the
number of galls was significantly higher in
New Improved Kuroda than in Tokita Kuroda
4 mo after planting. Similarly, as the
inoculum level was increased there was a
corresponding increase in the number of galls
counted. Plants inoculated with 5,000
juveniles per pot gave significantly greater
number of galls on secondary roots
compared to those inoculated with 1,000,
500, 100 and 50 juveniles/pot. Although
much lower number of galls was exhibited by
plants treated with lower levels of nematode
inoculum, it was significantly different from
the uninoculated plants.
The interaction between cultivar and
inoculum level was highly significant. Variety
Tokita Kuroda had fewer number of galls on
secondary roots (557.10) when inoculated
with the highest inoculum level (5,000
juveniles/pot) compared to New Improved
Kuroda with 1337 when inoculated with the
same number of nematodes. This indicates
that the latter cultivar is more susceptible to
root knot nematode than the former.

Number of Galled or Damaged
Areas on Tap Roots

Cultivar response to Meloidogyne sp. on the
basis of damaged areas on tap roots was
also taken. Apparently, the two cultivars
showed varied response to nematode
infection. New Improved Kuroda showed
significantly higher number of damaged areas
which was caused by the penetration of
Meloidogyne sp. (121.5) compared to Tokita
Kuroda with only 21.3. The difference
between the two cultivars was highly
significant.
Likewise, the number of galled or
damaged areas on tap root was significantly
affected by inoculum levels. Galled or







Response of two carrot


increasing level of nematode inoculum. The
highest mean number of galls was recorded
on plants inoculated with 5,000 juveniles/ pot.
This was followed closely by those plants
inoculated with 1,000, 500, 100 and 50
juveniles/pot. As expected, no galls or
damage was observed on the uninoculated
plants.
Highly significant interaction was
noted between cultivar and inoculum levels
(Fig. 5). The highest number of galls or
damaged areas was recorded on New
Improved Kuroda inoculated with 5,000
juveniles/ pot, followed by the same variety
inoculated with 1,000, 500, 100 and 50
juveniles/pot. The number of galls or
damaged areas on plants inoculated with the
lowest level of inoculum in the above cultivar
was significantly higher than on plants treated
with the highest number of juveniles in Tokita
Kuroda.

Number of EggMasses in the Roots

Based on the above parameter, significant
differences were noted between the two
carrot cultivars used. Significantly higher
number of eggmasses was recorded on New
Improved Kuroda than Tokita Kuroda with
means of 6.3 and 3.2, respectively. With the
average number of eggs per eggmass of 350,
New Improved Kuroda had 2,205 while Tokita
Kuroda had 1,120 eggs. This further
indicates that the nematode developed faster
in the former cultivar than in the latter.
The number of eggmasses in the
roots was also significantly affected by
inoculum levels. Plants inoculated with the
highest level of inoculum gave the highest
number of eggmasses while those inoculated
with the lowest inoculum gave also the lowest
mean number of eggmasses. Statistical
analysis revealed significant interaction
between carrot cultivar and inoculum level
(Fig. 6). New Improved Kuroda gave the


inoculated with 5,000 juveniles/pot. On the
other hand, Tokita Kuroda gave significantly
lower number of eggmass than New
Improved Kuroda. Below 500 juveniles/pot,
no eggmasses were recorded in the former
variety.

Number of Nematodes in the Roots

The number of nematodes recovered from
10g roots of the two cultivars differed
significantly (Fig. 7). Significantly higher
number of juveniles penetrated the roots of
New Improved Kuroda than Tokita Kuroda
with means of 27.9 and 18.6, respectively.
Similarly, inoculum levels significantly
affected the number of nematodes in the
roots. Apparently, as the inoculum level was
increased, the number of nematodes that
penetrated the roots also increased.
Based on the above parameter, no
significant interaction, however, was noted
between cultivar and inoculum levels used
(Fig. 7).

Marketable Yield

Yields of the two cultivars differed in
response to nematode infection and the
difference was significant at 5% level. Being
more susceptible to root-knot nematode
infection, New Improved Kuroda had
significantly lower marketable yield than
Tokita Kuroda with 19.0 and 31.4 g,
respectively. Likewise, marketable yield was
also significantly affected by inoculum levels
used. As the inoculum level was increased,
the weight of marketable roots decreased. In
fact, at 1000 and 5000 juveniles/pot, no
marketable yield was obtained.
In the more susceptible variety, New
improved Kuroda, only the uninoculated
plants produced marketable yield (Fig. 8).
Due to severe nematode infection, the quality
of the tap roots was greatly affected. The











SII IIU Il i l.d ,, Y I I IIp I %l .
malformation such as light to severe forking.
On the other hand, in Tokita Kuroda only
those plants inoculated with 1,000 and 5,000
juveniles/pot did not produce marketable
yield. Those inoculated with lower levels of
inoculum (50 and 100 juveniles/pot) gave
slightly higher yield than the uninoculated
plants but the difference was not significant.

Non-Marketable Yield

Significantly higher non-marketable yield was
recorded in New Improved Kuroda than in
Tokita Kuroda. Similarly, inoculum level
significantly affected the non-marketable
yield. Plants inoculated with higher levels of
inoculum (100, 500 and 1000 and 5000
juveniles/pot) gave significantly higher non-
marketable yield than those inoculated with
50 juveniles/pot. In both cultivars used,
uninoculated plants did not produce non-
marketable yield (Fig. 8). The non-marketable
yield of New Improved Kuroda was
significantly higher in all the inoculum levels
used than the less susceptible cultivar, Tokita
Kuroda.
Carrot is a very susceptible host to M.
hapla (Vrain et al., 1981 as cited by Belair,
1992). High densities of nematode at
planting (several hundreds/100 cm3 soil)
induced loss of weight of foliage and of roots,
extreme malformations (forking of storage
roots) and a total loss of the crop. Quality
requirements for carrot production are long
and smooth tap (storage) roots but even with
low densities of root-knot nematodes (less
than 40/100 cm3 soil) storage roots can be
malf\rm drl nanrA imnm -rl afaKlb l~fhka nn h fthir


VJLIIcI III iMCUllllll b, IIUW"jVtI, d I Ildvc UVccll
proposed for nematode-induced decreases in
crop productivity. This includes reduction in
photosynthetic rate (Wallace, 1974), nutrient
translocation (Oteifa and Elgindi, 1962) and
alteration in growth regulator balance (Bird,
1974).
LITERATURE CITED

Barker KR, Shoemaker PB and Nelson LA.
1976. Relationship of initial population
densities of Meloidogyne incognita
and M. hapla to yield of tomato. J.
Nematol. 8:232-239.

Belair G. 1992. Effect of cropping sequences
on population densities of
Meloidogyne hapla and carrot yield in
organic soil. J. Nematol. 24(3):450-
456.

Berney MF and Bird GW. 1992. Distribution
of Heterodera carotae and
Meloidogyne hapla in Michigan carrot
production. Supplement to J. Nematol.
24(25):776-778.

Bird AF. 1970. The effect of nitrogen
deficiency on the Growth of
Meloidogyne javanica at different
population levels. Nematologica
16:13-21.

Bird AF. 1974. Plant response to root-knot
nematode. Ann. Rev. Phytopathol.
12:69-85.
I'% u U i fL" A I t- J -I -- -- --








Response of two carrot 31


fallax: A dream? Nematology. Int. J. Wallace HR. 1971. The influence of the
Fundamental and Appl. Nematol. Res. density of nematode populations on
4(2):233. plants. Nematologica 17:154-66.

Oteifa BA and Elgindi DM. 1962. Influence of Wallace HR. 1974. The Influence of root-knot
parasitic duration of Meloidogyne nematode Meloidogyne javanica on
javanica (Treub) on host nutrient photosynthesis and on nutrient
uptake. Nematologica 8:216-220. demand by roots of tomato plants.
Nematologica 20:27-33.
Prot JC, Villanueva LM and Gergon EB.
1994. The potential of increased Webster JM. 1969. The host-parasite
nitrogen supply to mitigate growth and relationships of plant parasitic
yield reductions of upland rice cultivar nematodes. Adv. Parasitol. 13:225-
UPLRi-5 caused by Meloidogyne 250.
graminicola. Fundamentals of Appl.
Nematol. 17 (5): 445-454. ACKNOWLEDGMENT

Townshend JL and Davidson TR. 1962. We would like to thank the Benguet State
Some weed hosts of the Northern University for the financial support and to Ms.
root-knot nematode Meloidogyne Teresita D. Masangcay and Ms. Nordalyn B.
hapla (Chitwood, 1948) Ontario, Can. Pedroche for the technical assistance.
J. Bot. 40:543-548.

















Pt
















Figure 1. Perinneal pattern of Meloidogyne hapla isolated from carrot.








i M3Tokita Kuroda [a New Improved Kuroda

30

25






1




0 5 100 500 1000 5000
Number of juveniles per pot

Figure 2. Effect of carrot variety x inoculum level interaction on fresh top weight. In
each inoculum level, bars with the same letter are not significantly
different at P=0O05 using Duncan's Multiple Range Test (DMRT)











Response of two carrot dj


IDTokita Kuroda


E New Improved Kuroda


f f


0


50 100 500
Number of Juveniles / Pot


1000


5000


Figure 3. Effect of carrot variety x inoculum level on root gall index. In
each inoculum level, bars with the same letter are not
significantly different at P=0.05 using Duncan's Multiple Range
Test (DMRT)


E Tokita Kuroda


D New Improved Kuroda


cd c
e de 5
f ef -d

h gh


0 50 100 500 1000 5000


Number of Juveniles / Pot



Figure 4. Effect of carrot variety x inoculum level on secondary roots. In each
inoculum level, bars with the same letter are not significantly different
at P=0.05 using Duncan's Multiple Range Test (DMRT)


1600


1400


1200


1000


800


600


400


200

0I











34 Abuan and Villanueva


I Tokita Kuroda


C3 New Improved Kuroda


cc




f5




so50 100 500 1000


250


20U


150


100


50


Number of Juveniles / Pot


Figure 5. Effect of carrot variety x inoculum level on galls or damaged areas on
tap roots. In each Inoculum level, bars with the same letter are not
significantly different at P=0.05 using Duncan's Multiple Range Test
(DMRT)


Sr Tokita' Kuroda n New Improved Kuroda


61
S4-

2,ea d -J~ ~J~~


100


500


1000


5000


Number of Juveniles / Pot



Figure 6 Effect of carrot variety x inoculum level on galls or damaged areas
on number of egg masses in Og roots. In each inoculum level, bars
with the same letter are not significantly different at P=0.05 using
Duncan's MIultiple Range Test (DMRT)


5000


0 -









Response of two carrot 35


[ L-"Tokita Kuroda


C3 New Improved Kuroda


_zi L~l L


100


500


1000


5000


Number of Juveniles / Pot


Figure 7. Effect of carrot variety x inoculum level on galls or damaged areas
on number of nematodes in 10g roots. In each inoculum level, bars
with the same letter are not significantly different at P=0.05 using
Duncan's Multiple Range Test (DMRT)


C New Improved Kuroda I


d d d d


50 100 500
Number of Juveniles / Pot


1000


5000


Figure 8, Effect of carrot variety x inoculum level on marketable yield (g). In
each inoculum level, bars with the same letter are not significantly
different at P=0.05 using Duncan's Multiple Range Test (DMVRT)


ed

d d d


---~-1----- --~~ I-


h


I -Tokita Kuroda







Journal of Tropical Plant Pathology 42:36-42


BIOLOGICAL CONTROL OF THE BANANA BURROWING NEMATODE,
RADOPHOLUS SIMILIS WITH SELECTED NEMATOPHAGOUS FUNGI


Marita S. Pinili1 and Christian Joseph R. Cumagun2'

1Graduate Research Assistant, Crop Science Cluster Institute of Plant Breeding, and
2Associate Professor, Crop Protection Cluster, College of Agriculture, University of the
Philippines Los Baios, College, Laguna.


ABSTRACT

The burrowing nematode, Radopholus similis, is the most important banana
root pathogen in tropical and subtropical regions of the world. The efficacy of
Paecilomyces lilacinus, Penicillium oxalicum and Metarrhizium anisopliae were
evaluated on R. similis. In vitro assay indicated that the three fungal isolates
are capable of infecting R. similis. High percentage mortality of 95.2%, 93.1%
and 80.4% caused by P. lilacinus, P. oxalicum and M. anisopliae, respectively,
was observed 12 days after inoculation. Treatments were comparable with
phenamiphos (NemacurlOG) and significantly different from the untreated
control (P = 0.05). Plant height, pseudostem girth, root weight, number of
functional leaves obtained from banana cv. Lakatan inoculated with fungal
isolates were significantly different compared to the untreated control. P.
lilacinus was comparable to phenamiphos, with reduced percentage root
necrosis whereas P. oxalicum and M. anisopliae were ineffective.

Key words: Radopholus similis, Paecilomyces lilacinus, Penicillium oxalicum, Metarrhizium
anisopliae


INTRODUCTION

Radopholus similis is one of the most
important nematode species attacking
bananas in vast commercial plantations
(Cavendish type) in Central and South
America with potential damage on plantain
and cooking bananas in the lowlands of
Eastern and Central Africa and the Caribbean
as well in Asia and the Pacific (Sarah et al.,
1996). In the Philippines, R. similis has
become a problem when large volume of
planting materials of Giant Cavendish from
Central America were commercially raised by
farmers in the early 1970s (Davide, 1982).


Surveys on the occurrence and
distribution associated with Giant Cavendish
in Davao, Mindanao, Philippines revealed
Meloidogyne spp. and R. similis as the main
species found widely distributed and more
destructive than the other species (Davide
and Gargantiel, 1974; Davide and Zarate,
1977; Boncato and Davide, 1980). Recently,
Zorilla et al. (2004) found the same genera of
nematodes, in addition to Helicotylenchus
multicinctus, which were prevalent in Oriental
Mindoro, a province in Luzon, Philippines.
R. similis caused two types of
damages on banana. First, the destruction of
the root and corm tissues which impairs water










DISCUSSION number and size of root lesions due to R.
similis. However, P. oxalicum and M.
Parasitic action of P. lilacinus, P. oxalicum anisopliae did not reduce root necrosis of
and M. anisopliae increased mortality of R. banana. In contrast, use of purified extracts of
similis. Spore suspension of 250,000 per ml P. oxalicum provided 69 to 85% control
inoculated to 1,000 R. similis parasitized based on banana root lesions (Molina and
nematodes 12 days after inoculation. Davide, 1986). This could be attributed to
However, nematodes were not directly different strains used in the study. Once
parasitized but were found immobile. Cuticle again, P. lilacinus has proven itself effective
disintegration can be attributed to toxic in controlling R. similis using another banana
metabolites detrimental to nematodes. P. cultivar'Lakatan'.
lilacinus, P. oxalicum and M. anisopliae are
capable of producing toxins lilacinin, oxalic LITERATURE CITED
acid and destruxins, respectively (Arai et al.,
1973; Friis et al., 1969; Kaijiang and Roberts, Arai T, Mikami, Fukushima K, Utsumi T,
1986). Other enzymes may be expressed Yazawa K. 1973. A new antibiotic
during the course of infection; however, these leucinostatin derived from
were not evaluated on this study. The Paecilomyces lilacinus. J. Antibiot.
effectiveness of these nematophagous fungi 26:157-161.
specifically P. lilacinus were already
evaluated both in vitro and in vivo using Boncato AA and Davide RG. 1980.
Meloidogyne incognita in tomato and Radopholus similis on Cavendish
Globodera rostochiensis (potato cyst) and on banana in Davao del Norte. I. Host
R. similis in 'Cavendish' banana, respectively, range and relative distribution and
Comparative studies showed that P. lilacinus density. Phil. Agric. 63:111-119.
can parasitize eggs and vermiform
nematodes resulting in reduced number of Davide RG. 1982. Studies on Nematodes
nematodes by 13.1% as compared with the Affecting Bananas in the Philippines.
nematicide which gave 12.1% (Generalao Philippine Agriculture and Resources
and Davide, 1986; Zorilla, 1990). Other fungi Foundation, Inc. p. 175.
evaluated are Arthrobotrys cladodes and
Penicillium anatolicum immobilizing and Davide RG and Zarate FA. 1977. Host
killing R. similis larvae, parasite relationship and control of
Phenamiphos completely immobilized plant parasitic nematodes associated
and killed nematodes as early as 4 days upon with banana. NSDB Tech. J. 2:9-13.
nematode immersion giving 100% mortality.
Nemacur is an organophosphate nematicide Davide RG and Gargantiel FT. 1974. Survey
available as water-soluble liquids, have low of nematodes associated with banana
volatility, can be applied on or before planting in the Philippines. Phil. Phytopathol.
having specific effect on nematodes. P. 10:1-2.
lilacinus applied as soil drench were able to
reduce the degree of infection of R. similis on Friis P, Hasselager E and Krogh P. 1969.
'Lakatan' which is comparable to Isolation of citrinin and oxalic acid
phenamiphos. Similar studies by Generalao from Penicillium viricatum Westling
and Davide (1986) also showed that both and their nephrotoxicity in rats and
substrate soil incorporation and soil drench pigs. Acta Pathol. Microbiol. Scand.
application of P. lilacinus, P. anatolicum and 77:559-560.
A. cladodes can significantly reduced the







40 Biological control


Generalao LC and Davide RG. 1986. IPGRI, Montpellier Cedex, France. 47
Biological control of Radopholus p.
similis on banana with three
nematophagous fungi. Phil. Stirling GR. 1991. Biological control of plant
Phytopathol. 22:36-41. parasitic nematodes. CAB
International, England.
Jatala P, Kaltenback PR and Bacangel M.
1979. Biological control of Tandingan IC and Davide RG. 1986.
Meloidogyne incognita and Biological control of Tylenchulus
Globodera pallida on potatoes, semipenetrans on citrus and
Nematology 11:303. Radopholus similis on banana with
Paecilomyces lilacinus and Penicillium
Kaijiang L .and Roberts DW. 1986. The anatolicum. Phil. Phytopathol. 22:42-
production of destruxins by the 48.
entomogenous fungus, Metarrhizium
anisopliae var. major. J. Invert. Pathol. Zorilla RA. 1990. Efficacy of nematophagous
47:120-122. fungi for the biological control of
tomato root knot, Meloidogyne
Marin DH, Barker KR and Sutton TB. 2000. incognita Chitwood and potato cyst
Efficacy of "ABG-9008" against nematode, Globodera rostochiensis
burrowing nematode (Radopholus Well. in the Philippines. Ph.D. Thesis.
similis) on banana. Nematropica 30:1- Department of Plant Pathology. UP
9. Los Baros, College, Laguna. 115p.

Molina GC and Davide RG. 1986. Evaluation Zorilla RA, Dizon TO, dela Cruz FS, Orajay
of microbial extracts for nematicidal JI, Hautea DM, Van den Bergh I and
activity against .plant parasitic De Waele D. 2004. Occurrence and
nematode Meloidogyne incognita and damage potential assessment of
Radopholus similis. Phil. Agric. nematodes in different barana
67:361-371. cultivars in Oriental Mindoro. In: Pest
Management Council of the
Sarah JL, Pinochet J and Stanton J. 1996. Philippines, Inc. Proceedings. p. 120.
The Burrowing Nematodes of
Bananas, Radopholus similis Cobb, ACKNOWLEDGMENT
1913. Musa Pest Fact Sheet No. 1
INIBAP 2p. The authors thank Ms. Arienne G. Castillo,
National Crop Protection Center, University of
Spiejer PR and De Waele D. 1997. Screening the Philippines Los Baros for providing the
of Musa germplasm for resistance and fungal isolates. This work was funded by the
tolerance to nematodes. INIBAP Katholieke Universiteit Leuven, Belgium
Technical Guidelines. INIBAP and Project.








Pinili and Cumagun 41


Table 1. Mean percentage mortality of Radopholus similis at 4, 8 and 12 days after inoculation
with different fungal isolates

MORTALITY (%)
TREATMENT 4 days after 8 days after 12 days after
inoculation inoculation inoculation

Paecilomyces lilacinus 4.4a 13.6a 95.2a
Paecilomyces oxalicum 4.8a 13.5a 93.1 a

Metarrhizium anisopliae 1.8b 7.4b 80.4b

Phenamiphos 100c


same letters are not significantly different among tree
;t at 5% level of significance.










Hyhlpntai oye laiuB


i. Hyphal penetratio
arasitism of the ner




El


A. Penicillium oxalicu
body, B. Completely
tail with spores and m


lomyces lilacinus, B.
jy and C. Infected he;


M
mplete
region.




I


causing disintegration of the nem,
integrated head region, and C. Ini
elia.


etarrhizium anisopliae causing disintegr
rapped nematode in hyphae and C. Hypt


Figure


YIVIVYIUUI VVII~IVI


I II ~-r


ISpl~-qll


~


I


A I ^ IR







JuullaId u! ,pu-lud r-dilt rdu!iuluyy 9L.'4o-o


ELUCIDATION OF MECHANISM OF RESISTANCE OF TOMATO
AGAINST TOBACCO MOSAIC VIRUS USING PROTOPLASTS


Teodora O. Dizon and Lolita M. Dolores

Respectively, Research Associate Professor and University Researcher, Crop Science
Cluster-Institute of Plant Breeding, College of Agriculture, University of the Philippines Los
Bafios, College, Laguna.


ABSTRACT

Leaf protoplasts of tomato variety Marikit was successfully isolated with enzyme
solution used. More protoplasts were obtained using younger leaves and leaf
sections than older and whole leaves.
The mechanism of resistance to tobacco mosaic virus (TMV) of two
resistant varieties, Acc. 549 and TMC 106, was elucidated using protoplasts.
The resistant varieties exhibited symptomless reaction upon TMV inoculations
unlike the susceptible varieties, Marikit and VC 11-1, which showed severe
mosaic symptoms. The TMV-inoculated protoplasts of both susceptible varieties
showed positive reaction with very intense yellow color in ELISA test. this
implied a high virus concentration on the protoplasts and that the virus may have
rapidly multiplied and spread from cell to cell with the leaf tissues. In the
resistant varieties, protoplasts of Acc. 549 gave slight yellow color reaction in
contrast with the protoplasts of TMC 106, which yielded a negative colorless
reaction in the ELISA test. Using local lesion host, Nicotiana glutinosa, resistant
variety Acc. 549 induced necrotic local lesion s from 1-wk old inoculum, while
TMC 106 did not produce any lesion even from 4-wk old inoculum source. On
the contrary, susceptible varieties Marikit and VC 11-1 induced necrotic lesions
even from 4 wk-old inoculum source.

Keywords: tomato, tobacco mosaic virus, protoplasts

INTRODUCTION (Otsuki et al., 1972a), physiological (Otsuki
et al., 1972b), and biological studies (Sakai
Protoplasts are cells without cell wall. They and Takebe, 1972).
are easily isolated using mixtures of enzymes Elucidation of mechanism of disease
(Kassanis and White, 1974). The potential resistance can either be explained
application of protoplasts in physiological and morphologically or biochemically which is
genetic studies of plants and in recombinant easily understood with diseases due to
DNA studies in microorganisms has been bacteria, nematodes or fungi. However,







44 Dizon and Dolores


(1974). The multiplication and spread of Extraction was done in 0.1 M phosphate
cucumber mosaic virus viruses inside the buffer, pH 7.2 and 1% mercaptoethanol.
protoplasts of susceptible melon variety were Clarification of virus sap was done with 8%
noted (Hirai and Amemiya, 1989). butanol (v/v) and low speed centrifugation
Several assays to test the infectivity of (5,000 g for 15 min). The virus was
the virus in the protoplasts have been precipitated with 6% polyethylene glycol
mentioned These include local lesion host (PEG) and 4% NaCI and low speed
(Takebe et al., 1968), enzyme-linked centrifugation. Resulting supernatant was
immunosorbent assay (ELISA) (Clark and further purified by high speed centrifugation
Adams, 1977) and fluorescent antibody (25,000 rpm for 2 hr) and low speed
staining technique (Otsuki and Takebe, centrifugation (10,000 g for 15 min). Infected
1973). plants were kept and maintained in the
In the Philippines, no attempt has greenhouse
been made to isolate protoplasts of tomato
and to elucidate the mechanism of resistance Antiserum Production
to tomato against tobacco mosaic virus using
protoplasts. Antiserum to TMV was raised in 2/2 mo-old
This study aims to (a) identify rabbit by giving a single intravenous injection
resistant and susceptible varieties of tomato, containing 1 mg/ml TMV. After 1 wk rest
(b) isolate and optimize conditions for period, the 2n, 3rd and 4th implied via
isolation of tomato protoplasts, (c) isolate intramuscularly route were given at 200 ug,
purify and propagate tobacco mosaic virus 200 g and 100 ug, respectively, for 3 wk. The
(TMV) and, (d) assay the infectivity of TMV- rabbits were allowed to rest for another 2 wk
infected leaves and protoplasts using ELISA until a final booster shot at 500 ug was given.
and local lesion hosts. The final bleeding was performed 7 to 10
days after the booster shot.
METHOLODOGY
Isolation of Protoplasts
Identification of Susceptible and Resistant
Sources Seeds of susceptible tomato variety were
planted in pots and properly maintained in the
Various germplasm of tomato were evaluated greenhouse. Healthy leaves were collected
for resistance to TMV. The disease from 3 to 4 wk-old plants. Leaves were taken
screening technique and rating scales early in morning, washed thrice with sterile
developed being used at the Institute of Plant distilled water and blotted dry using sterile
breeding, UPLB were followed. The identified filter paper.
resistant as well as susceptible varieties were Leaves were treated either as smaii
used in the study. The symptoms developed lesions (1-2 mm2) or as whole. Leaves were
on these varieties were described, cut gently into small sections using a share,
fame-sterilized scalpel blade before placing in
Collection, Purification and Propagation of enzyme solution. The whole leaf, on the other
the TMV hand, was cut slightly into narrow strip with
flame-sterilized, sharp scalpel blade ,c
An important virus isolate found infecting expose the tissue and allowing the enzyme
tomato was used in the study. TMV was solution to penetrate the cut tissues by
propagated in tomato var. Marikit. The virus applying low vacuum for 5 min. The effect of
was purified according to the modified the age of leaf on protoplast yield was also
procedure of Gooding and Hebert (9l67). determined. Younger leaves were taken from








Elucidation of mechanism of resistance 4!


the upper most part of the plant, the shoots susceptible and resistant varieties harvest
while older leaves were taken from the lower after 1, 2, 3 and 4 wk from inoculatior
branches of the plant. Similarly, protoplasts isolated from thes
Different enzyme solutions with tomato varieties were also assayed using thi
varying concentration of enzymes such as method.
cellulase 'Onosuka' R 10 (ca. 11,000 units/g)
and macerozyme R 10 (ca. 450 units/g) from .RESULTS AND DISCUSSION
Yakult Honsha Co., Ltd., Japan and
pectinase (EC 3,2,1,1.5) from Sigma Identification of Resistant and Susceptible
Chemicals Corporation, were used. Sources
Potassium dextran sulfate at 0.05% was
obtained from Wako Pure Chemical Susceptible tomato varieties, Marikit ad Vi
Industries Ltd., Japan. The percentage of the 11-1 and resistant, Acc 49 and TMC 10
enzymes varied from 1.0 to 3.0% for cellulase were selected from various tomat
and 0.3 to 0.5% for macerozyme. Manitol at germplasm and used in the study.
0.5M to 0.75M was used. In all the tests,
one gram (fresh weight) of leaf samples was Virus Identification and Symptomatology
placed in 20 ml enzyme solution contained in
clean Erlenmeyer flask. The solution with the Virus isolates obtained belong to tobamoviru
samples was then placed on a rotary shaker group possessing rigid rod particles under th
(about 60 excursions per min). Protoplast electron microscope. This yellow isolat
yield was monitored on an hourly basis by from tomato induced systemic mosai
decanting one drop of the solution using symptoms to Nicotiana tabacum and reacte
clean Pasteur pipet and examining under the positively against the TMV antiserum i
microscope. The number of protoplasts was ELISA tests. Both the resistant tomat
counted using haemacytometer. entries (Acc 549 and TMC 106) exhibit
symptomless appearance with TM'
Inoculation of TMV inoculation while both susceptible (Marik
- A I rl/ A A A \ -.-^-1. .---J -.- ____.^ :


LInfes WIL l V.OIVI IvidilllllUI, pn .1. r-ULUpl~ d ts
were then mixed with the TMV. Resistar
and susceptible plants were likewise
mechanically inoculated with the pure culture
of TMV and infected leaves harvested after 1
2, 3, and 4 wk from inoculation. Tissues fror
these plants were used as source of inoculur
in the subsequent inoculations to local lesiol
host.

Assay of Infectivity

Infectivity of TMV on leaves of resistant an,
susceptible tomato varieties as done usin!
local lesion host, Nicotiana glutinosa and b
ELISA. Lesions appearing on the half lee
assay host were counted/estimated. Th,
-, -fl A I --- -- 1


Isolation of Leaf Protoplasts

Enzyme solution that provided good result!
contained the following 05% cellulast
'Onozuka' R 10, 0.5% macerozyme R10
0.75M Mannitol, 0.05% potassium dextral
sulfate, pH 7.5. Tomato protoplasts were
successfully isolated from leaf tissues. The,
were perfectly round and bright green (Fig
2). Younger leaf tissues yielded more
protoplasts than older leaves (Fig. 3). Mear
number of protoplasts was 163 x 103 per m
on older tissues. The protoplasts from youn!
and old leaves started to be released on thi
second hour of incubation and increased a,
"n I J : . J "1 . . I .








46 Dizon and Dolores


the softness of the tissues that enzyme
mixture can easily penetrate the mesophyll
cells.
Small leaf sections yielded more
protoplasts than whole leaf (Fig. 4).
Protoplasts from leaf sections were obtained
on the second hour of incubation, while
release of protoplasts from whole leaf was
noted on third hour of incubation. This could
be attributed to the availability of cut surfaces
that are exposed to the enzyme solution. In
both experiments, it was observed that more
debris was present in the solution containing
the leaf section than on whole leaf.

Assay of Infectivity

The two resistant (Acc 549 and TMC 106)
and two susceptible tomato entries, Marikit
and VC 1101 inoculated with pure cultures of
TMV were harvested staggered 1, 2, 3 and 4
wk post-inoculation which then served as the
sources of inocula to N. glutinosa. The TMV
from 1 wk-old Acc 549 induced 2.5 necrotic
lesions to the assay host while the 2, 3 and 4
w-old sources of inocula did not cause any
lesion. The other resistant entry, TMC 106
on the other hand did not elicit any lesion to
the assay host using the .different sources of
inocula harvested from 1 to 4 wk post-
inoculation. Such results suggest that TMV
has been able to enter the resistant tomato,
Acc 549 only for a certain period of time (one
wk) but was not able to multiply or spread
from cell to cell within the plant. The virus
particles were localized within the small leaf
area as evidenced by necrotic local lesions
on the assay host. Negative reactions of both
the local lesion host and ELISA results of he
assay from the second to fourth week-old
inocula revealed that the virus might have
already died inside the cell.
In the other resistant tomato, TMC1
06, the virus was not able to enter the plant.
-I _ ----- -I "* Jl .--.. .-. 1- &K


from 7 to 8.5 after the first week and more
than 15 lesions on the third week. The
number of lesions could hardly be counted
since the lesions coalesced after the third
week. Results of ELISA tests conformed to
these results giving positive reaction only to
both susceptible varieties and to 1 wk-old Acc
549 (Table 1).

Isolated Protoplasts

The isolated protoplasts of both susceptible
varieties showed positive reaction with an
intense yellow color suggesting high virus
concentration on the protoplasts (Table 2).
This implied that the virus had multiplied and
spread from cell to cell within the leaf tissue.
In the resistant entries, protoplasts of Acc 549
gave only a slight yellow color reaction to the
antibody suggesting much lower virus
concentration while the TMC 106 protoplasts
produced negative reaction.
Th~ce finrlinne whnwn that TMV was


varieties but not in the TMC 10O
_ntrv In caqp nf Ac. 549 where


resistant


1 .- 1 ./ ..I I -. .--. -- ---
suggesting that the virus was able to enter
the plant only in low concentration and did
not multiply in t;ie plant. This conformed with
our infectivity assay findings for Acc 549
(Table 1) giving lesions only for 1 wk-old
source but none on 2 to 4 wk-old sources of
inocula. These findings conform with the
result of Hirai and Amemiya (1989). They
found that cucumber mosaic virus infected
cells of susceptible melon variety, Earl,
increased with time after inoculation, while in
resistant variety, Kohimeuri, virus infected
cells were localized within a small area.
Based on these results, two types of
resistance were exhibited by the tomato
entries. TMC 106 is immune to TMV while
Acc 549 displayed 'hypersensitive type' of
resistance. The virus in Acc 549 was able to
enter the plant only for short period of time,
:- - -i _- ;- 4-6 1-


IIIVGIU%-, cxl\l ri







Elucidation of mechanism of-resistance 41


formation of necrotic local lesions.

LITERATURE CITED

Clark ME and Adams AN. 1977.
Characteristics of the microplate
method of enzyme-linked
immunosorbent assay for the
detection of plant viruses. J. Gen.
Virol. 34:475-583.

Cocking EC. 1972. Plant Cell Protoplasts -
Isolation and Development. Annu.
Rev. Plant Physiol. 23:29-30.

Hirai S and Amemiya Y. 1989. Studies on
the resistance of melon cultivars to
cucumber mosaic virus. I. Virus
multiplication in leaves of mesophyll
protoplasts from a susceptible and a
resistant cultivars. Ann. Phytopathol.
Soc. Jap. 55:458-465.

Kassanis B and White RF. 1974. A
simplified method of obtaining tobacco
protoplasts for infection with tobacco
mosaic virus. J. Gen. Virol. 24:447-
452.

Otsuki Y, Takebe I, Honda Y and Matsii C.
1972a. Ultrastructure of infection of
tobacco mesophyll protoplasts by


tobacco mosaic virus. Virology 49:
188-194.

Otsuki Y, Takebe I, Honda Y and Matsii C.
1972b. Tobacco mosaic virus
multiplication and expression of the N
gene in necrotic responding tobacco
varieties. Virology 50:45-50.

Otsuki Y and Takebe I. 1973. Infection of
tobacco mesophyll protoplasts by
cucumber mosaic virus. Virology
52:433-438.

Sakai F and Takebe I. 1972. A non-coat
protein synthesized i. tobacco
mesophyll protoplasts 3cted by
tobacco mosaic virus. Mol. Gen.
Genet. 113:93-96.

Takebe I, Otsuki Y and Aoki S. 1968.
Isolation of tobacco mesophyll cells in
intact and active state. Cell Physiol.
9:115-124.

ACKNOWLEDGMENT

The authors would like to thank Ms. Araceli
R. Alcachupas for the technical support for
the study. This study was supported by the
UPLB Basic Research Program (Study No.
96-6).







48 Dizon and Dolores


Table 1. Results of infectivity assays to tobac(
resistant tomato varieties


VARIETY REACTION TO AC
TMV INO(

Marikit Susceptible




VC 11-1 Susceptible




Acc 549 Resistant




TMC 106 Resistant



SNumber of weeks harvested from TMV inocul
2 Number of lesions on Nicotiana glutinosa.
3 Reaction to TMV antiserum, negative to TM'


nosaic virus (TMV) of two susceptible and two



DF LOCAL LESION ELISA TEST3
-UM1 TEST2

7.0 +++
12.0 +++
>15 (coalesced) +++
coalesced +++

8.5 +++
13.0 +++
>15 (coalesced) +++
coalesced +++

2.5 +
0
0
0

0
0
0
0
)n.

- positive to TMV.










Ilucidation ot mechanism OT resistance ..


-a

r;

i~.


i






i:


figure 1. Reaction OT resistant, ACC o4
tomato varieties to tobacco n


C 7 l l, a u 3ouok3il p.U ,I1 IVla ,i lyi I. /







50 Dizon and Dolores


400
350 -- Young
0
T 35I---*- Old
S300--ld
| 250-
o 200
0
C 150-
S100-
Z 50 -
0
1 2 3 4 5 6

Time (Hour)

Figure 3. Effect of leaf age on yield of tomato protoplasts.





500
450 -- Leaf section
S400 -- -*- Whole leaf
S350
j 300
- 250
2
_ 200
o 150
1Z 100
50
02 3 4 5 6 7
1 2 3 4 5 6 7


Time (Hour)


Figure 4. Effect of type of leaf samples on yield of tomato protoplasts.








Journal of Tropical Plant Pathology 42:51-62


host plant species from 13 families of plants were tested foi


cucurbitaceous species namely, (Jucurnita pepo (Luccninl), Lurra acuianguir
(patola ridge), and Trichosanthes anguina (snakegourd) showed viral
symptoms 4 wk after inoculation. No weed species developed the viral
symptoms upon inoculation but ELISA results yielded positive for five weed


ctor, host range

4TRODUCTION


Ampalaya is among the cucurbits of economic small and backyard growers. However, the
importance to vegetable industry. It is increasing interest in ampalaya production
presently considered as one of the top coincided with the occurrence of malady that
moneymakers among vegetable growers, affects a lot of farmers in Luzon. This
especially in Luzon. Ampalaya ranks second problem commonly termed namamarako
to squash in terms of hectarage planted and results to very low yield because the affected
total production in the country. In 1999, the plants become stunted. Has poor flowering
area planted to ampalaya was 8,129 ha as and bears few fruits. The namamarako


,---- .


LW -1-rr








52 Dolores et al.


1 the dry season of disease of ampalaya.
I in Pangasinan, La
igas, Cavite and MATERIAL!


I rne c
!ported th,
)me in fe
Nueva E
later obs
aguna,

al identified
suggest
o known
:luding th
initiated 1
amarako
tute of PI;


factor transmitting them to
th the aphids. Test plants v
4 \ l f O i*rfl n f 1rJirnr.+1 In+n


production. This led to reduction in the host plant species from 13 host plant families
incidence of NMK in EWSC plantings. were used in this study. Ten to 25 test plants
With the continuous effort of the East from each host anpr.i n halnnninn tn


S LI I L 1i. I1 I
viral infei
e physiolc
> stress ou
nalady. A


~I I rr








Host ranae and virus-vector 53


Virus-Vector Relationship of CABYV
Luteovirus Associated with NMK
Syndrome

Mass rearing of Aphis gossypii.
Colonies of aphids, Aphis gossypii, were
collected from ampalaya, eggplant and
pepper (Fig. 1). Mass rearing of aphids
using seedlings of eggplant was successful.
Rearing of aphids was also tried on "kundol"
plants, however, the insects did not survive
long.
Aphid adults used for infestation were
collected and transferred to detached leaves
of eggplant. The leaves were placed in pans
lined with moistened tissue paper. The
detached stems were covered or rolled with
wet cotton to keep the leaves fresh for at leasi
3 days.
To test if the reared aphids were free
of NMK, about 100 nymphs were infested on
healthy ampalaya seedlings and allowed tc
feed on the plants for 24 hr. Disease
symptom was observed on the plant anc
negative infection would mean that the aphids
were virus-free. The virus-free insects were
used throughout the experiment.

Determination of Most Effective
Acquisition Access Period

Batches of first to second instar non-
viruliferous aphids were allowed to feed or
NMK infected seedling for the periods: 0.5, 1
8 and 24 hr. After feeding, 10 nymphs, 5 foi
each leaf (first two leaves), were allowed tc
feed on test plants. Only the AAP was variec
while IAP was set for 24 hr. All the aphids
were removed after IAP and the plants were
observed for NMK symptoms. Ten seedlings
(4 day-old) were used per treatment. Ter
ampalaya seedlings were also infested with
NMK-free aphids and served as control.
A second batch of infestation was
conducted. As suggested, the IAP was
changed from 24 to 36 hr because of the
"persistent" characteristic of the virus. The


to 20 individuals per plant, to ensure a more
efficient inoculation of the pathogen. Aphids
were allowed to feed (AAP) on NMK infected
plant for 24, 36, 48 and 60 hr and were
introduced to the ampalaya seedlings for an
IAP of 36 hr.

Determination of Inoculation Access
Period

The experiment was conducted with the
following IAP: 0.08, 0.33, 0.67, 2, 6, 12, 24
and 36 hr. The AAP was set at 24 hr. Leal
samples from these treatments were
submitted for confirmation of the virus using
ELISA.
Another set of experiment was
conducted which include the following IAP:
0.5, 1, 12, 24, 26 and 48 hr. Twenty aphids
instead of ten per plant were used.

Vector Number and Transmission

Determination of effective number of vectoi
for NMK transmission, was conducted using
the following treatments: one, five, ten and 15
aphids. Results obtained from these
experiment was the basis for the conduct ol
the experiment on latent period anc
transmission of NMK.

Latent Period and Retention

Twenty second instar nymphs were allowed
an AAP of 36 hr. The aphids were
individually caged on separate test seedlings
and were serially transferred at 24-hr interva
to fresh sets of plants. From each set oi
transfers, the cumulative percentage of first
transmissions were recorded and retention of
persistence was noted as the time period
from leaving source plants to the las
successful transmission in the serial transfer.

RESULTS AND DISCUSSION

Unae* Dnna anrn Tranemiu~inn nf Culirhit








A4 Dolores et al


Luteovirus Causing NMK in Ampalaya

4 total of 36 host plant species from 13
families of plants including Amaranthaceae,
Chenopodiaceae, Compositae, Cruciferae,
,ucurbitaceae, Leguminosae, Solanaceae,
Aizoceae, Asteraceae, Cyperaceae,
Passifloraceae, Poaceae and Portulacaceae
were tested for their reaction to the NMK
uteovirus using viruliferous aphids (Aphis
7ossypii) in persistent manner (Table 1). Of
these only three cucurbitaceous species
lamely, Cucurbita pepo (Zucchini), Luffa
acutangula (patola ridge) and Trichosanthes
anguina (snakegourd) showed viral symptoms
t wk after inoculation (Fig. 2). No weed
species developed the viral symptoms upon
noculation but ELISA results yielded positive
or five weed host species viz., Trianthema
portulacastrum L. (Horse purslane), Eclipta
prostrata (L.) (False daisy), Cyperus rotundus
_. (Purple nutsedge), Echinocloa colona (L.)
-ink (Jungle rice) and Portulaca oleracea L.
'Common purslane) (Table 2). Symptoms
)f zucchini (C. pepo) showed distinct vein
handing 2 wk after inoculation and severe
/ein banding and yellowing and moderate
stunting of the plant 4 wk after inoculation
:Fig. 2).
In L. acutangula, the NMK luteovirus
causedd chlorosis and yellowing on the leaves
3 wk after inoculation (Fig. 2). The plants
were apparently looking healthy except for the
yellowing symptoms but yielded very high
absorbance reading in the ELISA test. This
indicates very high concentration of the virus
n the leaves of L. acutangula even though
:he plant is not exhibiting severe symptom.
Trichosanthes anguina on the other
land, showed yellowing of the tip of the
eaves (Fig. 2) as early as two weeks after
noculation. Yellowing symptoms spread
throughoutt the different parts of the leaves
but not the entire leaf became yellow. ELISA
:est confirmed the presence of the virus.
Five more weeds species namely,
Trianthema portulacastrum L. (Horse


Cyperus rotundus L. (Purple nutsedge),
Echinocloa colona (L.) Link (Jungle rice) and
Portulaca oleracea (L.) (Common purselane)
:Fig. 3) were found susceptible hosts of NMK
uteovirus with apparently no symptoms of
/iral infection, but gave positive results in
ELISA tests. These plants were repeatedly
:ested to confirm the presence of the virus.
Back inoculation test to M. charantia showed
yellowing and positive ELISA results
indicating that these weeds are alternate
losts of NMK luteovirus (Table 3).
The other three cucurbitaceous
species namely, Citrullus lanatus, Cucumis
nelo and C. sativus did not show the typical
MMK virus symptoms although Lecoq et al.
:1992) found these host plant species positive
'or CABYV.
Based on the results obtained on
transmissionn and host plant reaction to the
ocal CABYV isolate, data suggest the
potential of the three cucurbitaceous as well
as the five weed species as viable alternate
losts of NMK disease in the field.

Acquisition Access Period

This study on AAP was conducted to
Determine the most effective feeding time/
duration for the aphids to effectively acquire
:he virus. In this experiment, it was observed
:hat all the plants from Treatments IV (24 hr)
:o VIII (60 hr) showed symptom of NMK
starting at 21 days after inoculation (Table 4).
This means that as early as 24 hr, aphids can
acquire the virus and effectively transmit it to
ts host. Results of ELISA test, confirmed
:hat the plants were infected with NMK virus.
This has practical applications in the conduct
3f the study on the screening for resistance to
:he disease. In knowing the most effective
4AP, experimental error can be avoided and
a more uniform treatment can be applied. It
will also provide information on the proper
management of the vector and the virus in
actual field production of the crop. The
decision to control the vector and eventually
4L- ~-4 -C 4 .L4-- -1:_ -__ ...:1l ,J.4-- -4 -- 4L








Host range and virus-vector 57


Table 1. Reaction of different plant species to Namamarako (NMK) luteovirus using aphid
(Aphis gossypii) transmission

NO. OF SUSCEPTIBLE
TEST HOST COMMON SYMPTOMATIC CHECK SYMPTOM ELISA
NAME PLANTS/10 (Jadestar L. TEST
PLANTS variety)


Amaranthaceae
Gomphrena globosa


Chenopodiaceae
Chenopodium murale


C. quinoa
C. amaranticolor
Compositae
Lactuca sativa
Cruciferae
Brassica campestris
spp. juncea
B. campestris spp.
pekinensis
Cucurbitaceae
Benincasa hispida
Citrullus lanatus
Cucumis melo
C. sativus
Cucurbita moshata
C. pepo
Lagenaria siceraria
Luffa acutangula

L. cylindrica


Trichosanthes anguina
Leguminosae
Arachis hypogeae
Vigna sinensis
Phaseolus vulgaris
Solanaceae
Capsicum anuum
Lycopersicon
esculentum
Nicotiana glutinosa
N. tabacum
Physalis floridana
Solanum melongena


globe
amaranth

nettle
leaved
goosefoot
quinoa
goosefoot

lettuce

mustasa

pechay


waxgourd
watermelon
muskmelon
cucumber
squash
zucchini
bottlegourd
patola
(ridge)
patola
(smooth)
Esperanza
snakegourd

peanut
cowpea
snap bean

pepper
tomato


tobacco

eggplant


NA not applicable, negative to NMK virus, + positive to NMK virus.


NA

NA


NA
NA

NA

NA

NA


NA
NA
NA
NA
NA
yellowing
NA
yellowing

NA


yellowing

NA
NA
NA

NA
NA

NA
NA
NA
NA


+++


, ,








58 Dolores et al.


Table 2. Reactions of weed species to Namamarako (NMK) luteovirus using aphid (Aphis
gossypii) transmission

NO. OF SUSCEPTIBLE
TEST HOST COMMON SYMPTOMATIC CHECK SYMPTOM ELISA
NAME PLANTS/10 (Jadestar L. TEST
PLANTS variety)


Aizoaceae
Trianthema
portulacastrum L.

Asteraceae
Eclipta prostrata (L.)
L.


Cyperaceae
Cyperus iria L.



Cyperus rotundus L.


Passifloraceae
Passiflora foetida L.

Poaceae
Cynodon dactylon
(L.) Gaertn
Digitaria ciliaris
(Retz.) Koel.
Echinocloa colona
(L.) Link

Eleusine indica (L.)
Gaertn

Portulacaceae
Portulaca oleracea
L.


Horse
purslane,
toston

False daisy




Rice
flatsedge,
Payung-
payung
Purple
nutsedge,
mutha

Melon-
melonan

Bermuda
grass
Crabgrass

Jungle rice


Goosegrass,
Bakis-
bakisan

Common
purslane


No
apparent
symptom

No
apparent
symptom


NA



No
apparent
symptom

NA


NA

NA

No
apparent
symptom

NA


No
apparent
symptom


NA not applicable, negative to NMK virus, + positive to NMK virus.







Host range and virus-vector 59


Table 3. Confirmatory test for back-inoculated weed species to ampalaya variety Jadeslar L.
using aphid (Aphis gossypii) transmission

NO. OF SUSCEPTIBLE SYMPTOM ON
TEST HOST COMMON SYMPTOMATIC CHECK on Jadestar L. ELISA
NAME PLANTS/2 (Jadestar L. variety TEST
PLANTS variety)
Aizoaceae
Trianthema Horse 2 + yellowing ++
portulacastrum L. Purslane,
toston
Asteraceae
Eclipta prostrata False daisy 2 + yellowing ++
(L.) L.
Purple
Cyperaceae nutsedge, 2 + yellowing ++
Cyperus rotundus L. mutha
+ positive to NMK virus.



Table 4. Transmission of Namamarako (NMK) virus in ampalaya at different Acquisition
Access Periods (AAP)

NO. OF PLANT
TREATMENT AAP (hr) NO. OF INFECTED/10 ELISA
APHIDS/PLANT PLANTS TEST
I 0.5 10 0
II 1 10 0 *
III 8 10 0 *
IV 24 10 1/5
V 24 20 10 +
VI 36 20 10 +
VII 48 20 10 +
VIII 60 20 10 +
No ELISA test done, + positive for NMK virus.











aoie o. i ransmission oi fnamamaifraU (~rI\ vit
Periods (IAP)

IAP NO. OF
TREATMENT (hr) APHIDS/
PLANT


I 0.08 10
II 0.33 10
III 0.67 10
IV 2 10
V 6 10
VI 12 10
VII 24 10
VIII 36 10
negative for NMK virus, + positive for NMK virn


II dlilpalaya d Ullil i It II UVLUILIUI I -,uCo


NO. OF NO. OF DAYS
PLANTS FOR ELISA
FECTED/10 OCCURRENCE TEST
PLANTS OF INITIAL
SYMPTOMS
0
1 19 DAI
1 14 DAI
3 18 DAI
3 14 DAI +
5 17 Dai +
7 18 DAI +
9 15 DAI +
DAI days after infestation.


U vvlvl~~vul.








Host range and virus-vector 61


Figure 1. Aphis gossypii adults and nymphs used in the study.


Cucurbita pepo (Zucchini)


Luffa acutangula


Trichosanthes anguina Ampalaya variety Jadestar L.


Figure 2. Symptoms of Namamarako on Cucurbitaceous species: inoculated,
(upper), healthy (lower), ampalaya variety Jadestar L. (susceptible
check).

















- -


-1216lo


aM


---a -


~B~C~19i~ -








loumal of Tropical Plant Pathology 42:63-81


Wageningen Agricultural University, electron microscopy, the
gen, The Netherlands, and 3Plant disorder is found to be a
n Service, Wageningen, The related or identical to thE
ids. borne yellows virus (CABW


SI_. rll_:- *L... L


disorder' has puzzled bittergourd Host Range and Virus-Vector I
, agriculturists, seed industry people, of Namamarako Luteovirus.
>p scientists within and outside the MLJ Sison, MGN Yebron and
At some point, a genetic or a IPB-CA, UPLB.
>gical disorder was either proposed








34 Abstracts of Papers


cucurbitaceous species namely, Cucurbita inoculation using an initial population (Pi) of
Depo (Zucchini), Luffa acutangula (Patola 20 females. Quezon R. similis, population
ridge) and Trichosanthes anguina had the lower average total individual count
(Snakegourd) showed viral symptoms four at 4 weeks, but drastically increased on the
weeks after inoculation. No weed species 5t and 6h week and suddenly dropped on the
Developed the viral symptoms upon succeeding time. Davao population also
noculation but ELISA results yielded positive appeared to be more pathogenic as
for five (5) weed host species viz. Triantheme evidenced by the degree of root necrosis
Dortulacastrum L. (Horse purslane), Eclipta incited on the root systems. The cultivar
orostrata (L.) (False daisy), Cyperus rotundus Grande Naine displayed its susceptibility to
L. (Purple nutsedge), Echinocloa colona (L.) the burrowing nematode infection while the
Link (Jungle rice) and Portulaca oleracea L. Yangambi Km5 proved its resistant
(Common purslane). characteristic, which conformed to the
The results on the study of virus- previous studies. Local cultivar, Latundan
vector relationship showed that the aphids (AAB) was more susceptible to the infection
can acquire the virus as early as 24 hours compared with Lakatan (AA). Studies showed
and can effectively transmit it at 24-36 hours that there exist variability in the reproduction
after inoculation. Results also showed that rate and pathogenicity among R. similis from
10-15 aphids can already can an effective different geographic origins and that Musa
virus transmission but 20 aphids gave 100% susceptibility or resistance to the nematode
transmission. For serial transmission and attack is dependent on the genotype,
atent period, the aphids were able to transmit genome present and on whether it is diploid
the virus with high percentage within 2 days or triploid. The in vitro reproduction rate
then went down to 50% in the next 3" and 4h assessment can also serves as an indicator
Jay. It was also noted that as the aphids of the differences in pathogenicity of R.
were transferred from one plant to the other, similis.
a decrease in the number of the insects was
Performance Evaluation of Improved
observed to be retained. Banana Varieties in the Philippines. AB
Molina', EU Ato2, SS Crucido3, FR Neri4, BE
Reproduction Rate and Assessment of Temanel5, I Van den Bergh', KH Borromeo'
Damage Potential of Davao and Quezon ,Temane, Van den Bergh KHBorromeo
Damage Potential of Davao and Quezon and VO Sinohin', 'International Network for
Province Populations of Radopholus
Province Populations of Radopholus the Improvement of Banana and Plantain -
similis (Cobb) Thome on Four Banana Asia Pacific (INIBAP-AP), c/o IRRI, GS
Cultivars (Musa sp.). RA Zorilla, MS Pinili, Khh Hall, C 4030 Lau, 2locos
A A ..* --,--- -V r ^. ...I Khush Hall, College, 4030 Laauna luocos


Two separate comparative studies were
conducted, the in vitro assessment of
reproduction rate of Davao and Quezon
populations of Radopholus similis using
carrot disc culture and their damage
assessment on Lakatan (AA), Latundan
[AAB), Grand Naine (AAA) and Yangambi
Km5 (AAA) under greenhouse condition.
Between the two populations of R. similis, the
Davao population had the highest


Davite, 4Don Mariano Marcos Memorial State
University, Bacnotan, La Union, 5Quirino
State College, Diffun, Quirino

INIBAP-introduced varieties and local
:ultivars from the National Repository
Centers were evaluated for their adaptability,
field performance and disease resistance
jnder various agro-ecological situations in
Luzon. Virus-indexed tissue-cultured planting







Abstracts of Papers 65


FHIA 21, FHIA 23, FHIA 25 and local banana
varieties (Bungolan and Lakatan) were
provided to collaborating institutes (Quirino
State College, Cavite State University, Don
Mariano Marcos Memorial State University,
Ilocos Sur Polytechnic State College) and
farmer-cooperators to conduct farmer-
participatory evaluation trials to determine
local adaptability in terms of their agronomic
characteristics and resistance to local banana
diseases. These were evaluated under
improved production system appropriate to
tissue-cultured plantlets to obtain optimum
yield performance. While variations were
observed among locations, it was observed
that the introduced varieties were generally
more resistant to important diseases like
BBTV, Sigatoka and Fusarium wilt compared
to Lakatan, and Bungolan. Bunch weights
and number of hands of introduced hybrids
were higher than local cultivars, although the
former matured longer. While initial
observation indicates that the introduced
hybrids were not as preferred in terms of our
local taste compared to the local cultivars,
some varieties such as FHIA 23 has similar
taste as Bungolan. FHIA 21 and FHIA 18
were observed with good potential for
processed usage such as banana chip, flour,
and bread. The introduced varieties offer an
expanded cultivar options for small scale
growers whose local varieties have been
seriously ravaged by BBTV and Fusarium
wilt. These varieties may enrich cultivar
diversity and stability in the agroecosystem.
Comparative Reactions of Introduced and
Local Varieties of Banana to Banana
Bunchy top Virus. FM Dela Cueva, TO
Dizon, FS Dela Cruz, LA Gueco, OP
Damasco and AB Molina, Jr. IPB, UPLB and
INIBAP-AP

Twenty-one introduced and six local varieties
of banana planted in the IPB Germplasm
Collection were evaluated for resistance to
BBTV under natural conditions. Types of
nvmntnme and normvnt infrptinn nor woriPht


were recorded. All varieties exhibited
characteristic symptoms of the disease but
the degree of infection varies. Variations on
symptom expressions were also noted
among the different varieties. Symptoms
ranged from marginal chlorosis, narrowing of
leaves, leaf necrosis, stunting and eventual
death of the infected plants. Infection was
first recorded from cv Quarenta Diaz, a local
cultivar. An infected plant from this cultivar
served as the focal source of inoculum that
spread to another plant within the same plot
and eventually to the plants in the adjacent
plots. It was interestingly noted that when
FHIA 17 and FHIA 18 were planted near cv
Quarenta Diaz, the varieties exhibited typical
symptoms of the disease but there was a
delay in symptom expression and disease
spread. Similar observations were recorded
from FHIA 01 AACV Rose, SH3640 and
TMBx1378.

Evaluation of Resistance of Local Banana
Cultivars for Resistance to Radopholus
similis (Thorne) under Greenhosue
Condition. TO Dizon, MS Pinili, RA Zorilla,
FS dela Cruz, I Van den Bergh, D de Waele
and DM Hautea. IPB and CPC, UPLB and
Katholieke Universiteit Leuven-Belgium

Reduction on plant height, pseudostem girth
at base, shoot and root weight and number of
healthy leaves were observed when tissue
cultures local banana cultivars were
inoculated with Radopholus similis (Davao
isolate).
Damage on inoculated roots as
measured by percentage dead roots ranged
from 4.2 to 100% while percent root necrosis
ranged from 29.4 to 100%. Of the 16 local
cultivars including eight collections of
Lakatan, three were found resistant. These
were Ambon, Rawari and Cuarenta Dias.
Others were either intermediate or
susceptible to R. similis.

Evaluation of Resistance of Local Banana










'u.. .. .v ...Iw .vu. i*..^^ rv ,, w vw~w ay..r
icognita (Chitwood) under Greenhouse
condition. TO Dizon, MS Pinili, RA Zorilla,
S dela Cruz, I Van den Bergh, D de Waele
nd DM Hautea. IPB and CPC, UPLB and
atholieke Universiteit Leuven-Belgium

wenty (20) local banana cultivars showed
trying reactions when uninoculated plant
without inoculation) and inoculated plants
,ere compared in terms of plant height,
seudostem girth at base, shoot and root
,eight and number of healthy leaves.
Roots of all cultivars evaluated were
ot necrotic -when inoculated with M.
icognita. The number of juveniles and egg-
lying females varied with cultivars, but the
Dunts recovered from infected roots were
iw compared with the initial count
iggesting that M. incognita did not
produce in almost all cultivars. Based on
>ot galling index (score of 0 to 5), cultivars
ulay Baguio (1.0), Ambon (1.4), Datu (1.8),
andili (2.0) and Tiparot (2.8) were found
msistant to M. incognita.

'ccurrence and Assessment of Root
amage Potential of Parasitic Nematodes
associated with Different Banana
ultivars in Quezon, Mindoro and Quirino
rovinces. RA Zorilla, FS de la Cruz, TO
izon, MH Magpantay, MS Pinili, JI Orajay,
C Pantastico, AG Castillo, D de Waele and
M Hautea. IPB and CPC, UPLB and
atholieke Universiteit Leuven-Belgium

survey of banana cultivars and nematodes
associated with them were conducted in the
provinces of Quezon, Mindoro Oriental and
uirino from later part of 2002 to May, 2005.
Based on the total number of root
imples collected the banana varieties
)mmonly grown in the three areas consisted
Saba, Latundan and Lakatan. Of the lesser
lown varieties, Seforita, Morado and
ampuhin (Dwarf Cavendish) were also


ummon in ine inree areas surveyed.
however, there are more banana varieties
)und in Quezon and Oriental Mindoro than in
luirino Province.
Population, occurrence and
revalence of nematode species associated
fith banana were also carried out in the three
reas surveyed. Of the nematode species
lentified, percent occurrence differed in the
reas. Surveyed Radopholus similis (65%)
nd Helicotylenchus multicinctus (59%) were
)und abundant in Quezon Province while
felicotylenchus multicinctus (87%) and
'ratylenchus (80%) were highest in Oriental
lindoro. The number of nematodes obtained
Iso differed among varieties. In Quezon
province, Saba and Morado had the most
umber of nematode count per 10 g roots
whilee Lakatan and Saba had the most
umber of nematode count per 10 g roots in
lindoro compared with other cultivars.
Root damage assessment based on
percent dead roots, percent root necrosis and
)ot galling were also noted. Percent dead
>ots were highest in Latundan in both
'uezon and Quirino while Saba had the most
umber of dead roots in Oriental Mindoro.
Response of banana varieties to root
scrosis differed in the areas surveyed.
variety Reynis had the most number of root
scrosis in Quezon, Inabaniko in Oriental
indoro and Morado in Quezon Province.
Root knot nematode infection based
i the root galling indices ranged from trace
..0) to moderate (4.0) for varieties Saba,
akatan and Latundan in the three areas
irveyed.

ature and Extent of Plant-Parasitic
ematode Problems in Florida USA
otton. and Peanut Production. JR Rich,
V Barber, WD Thomas, CL Brasher and MC
onahoe. University of Florida, 155 Research
Dad, Quincy, FL 32351, U.S.A
inmErCAfl edu.


"~''~~'~' C~P"~'







stracts oT Papers 67


Florida U.S.A., cotton and peanut are
ajor agronomic crops and are produced on
eater than 38,000 and 59,000 ha,
spectively, each year. Due to limited
:onomic opportunities for production of
her crops, cotton and peanut are mono-
Itured or grown in shortened rotation
quences which increase nematode
oblems in these crops. The most damaging
*matode species affecting peanut are
eloidogyne arenaria and Pratylenchus
achyurus; while on cotton, M. incognita and
>tylenchulus reniformis are most damaging.
ist surveys of nematode problems and
esence in Florida agronomic crops have
*en limited and were conducted 15-30 years
lo. Significant cropping pattern shifts have
ice occurred in Florida agronomic crops
th large increases in cotton and peanut
oduction and dramatic decreases in field
rn and soybean production. A survey was
inducted late summer and fall of 2004 and
peated in 2005 in the major agronomic crop
oduction areas of Florida. Selection of
tton and peanut fields for sampling was
ndom to provide unbiased nematode assay
suits. A soil sample for nematode analysis
presented 8-12 cores to 25 cm-deep taken
ndomly from a 10 hectare area in farmer
Ids. Soil in a 100 cm3 sub-sample was
ocessed using the modified sugar flotation-
ntrifugation extraction method. A total of
,0 farmer fields representing greater than
10 ha were sampled, and within these fields,
er 250 soil samples were collected. Results
owed that over 50% of the soil samples
Id nematode population densities capable
causing damage to a following crop.
Iditionally, damage caused by P.
achyurus was identified as an emerging
oblem in peanut and a greatly increased R.
niformis presence Was found in cotton.
Irvey results indicate that changes in
arida field crop production patterns have led
increased nematode population densities
id increased nematode distribution
nitlonrigc in FInrirld nanl it anri rt~inn


oduction. Nematode management methods
id research needs will be discussed in
lation to these new survey data.
ematoxicity of Paecilomyces lilacinus
horn) Samson Metabolite Against the
ce Root-Knot Nematode (Meloidogyne
raminicola Golden and Birchfield). RM
apasin1 and GA Rendon2, Leyte State
diversity, Baybay, Leyte
ie nematoxicity of Paecilomyces lilacinus
Ilture filtrate and mycelial extract against
eloidogyne graminicola was investigated: to
'aluate the efficacy of P. lilacinus culture
rate at different concentrations on second
age larvae and eggs of M. graminicola in
ro; compare the efficacy of P. lilacinus
Iture filtrate aqueous fraction with the
ycelial extract against the nematode larvae
id eggs and to determine the activity of the
ied ethyl acetate fractions.
M. graminicola larvae immersed for 48
>urs in 100% concentration of P. lilacinus
Iture filtrate had 100% larval mortality while
ily 7.12% and 18.72% mortality was
corded, after 6 and 12 hr immersion,
spectively. Toxic metabolites present in the
Iture filtrate affected the larvae as there
3re no galls produced in rice seedlings at
10% concentration. The culture filtrate also
iited egg hatching as shown by lesser galls
oduced in rice seedling roots. The mycelial
tract was found more potent compared with
Iture filtrate extract, however, both fractions
'ected the larvae and eggs of M.
aminicola.
The dried ethyl acetate fraction gave
;.51% mortality at concentration of 500
3/ml, followed by 76.91% at concentration
400 mg/ml. A lethal concentration (LC) of
15 was attained at 300 mg/ml. Sixteen
Actions Were recovered from the crude dried
tract of the fungus using vacuum liquid
romatography (VLC). Fractions 5, 6 and 7
ive 39% nematode mortality suggesting the
esence of nematoxic compounds in these
actions.








68 Abstracts of Papers


Efficacy of Integrated Use of Thymol and
Acibenzolar-S-methyl in Managing
Bacterial Wilt and Root-Knot Nematodes
on Tomato. P Ji, M Momol, JR Rich, SM
Olson and JB Jones. University of Florida,
NFREC/IFAS, 155 Research Road, Quincy,
FL32351, USA, and Plant Pathology
Department, University of Florida,
Gainesville, FL 32611, USA.
jrich@ifas.ufl.edu.

Bacterial wilt and root-knot nematodes,
incited by Ralstonia solanacearum and
Meloidogyne spp., respectively, cause
significant damage and yield loss in
commercial tomato production in the
southeastern United States and the efficacy
of current approaches for management of
these diseases is limited. A two-year field
study was conducted to develop field
application methods of thymol as a new pre-
plant soil fumigant for control of bacterial wilt
and root-knot nematodes in tomato
production. In addition, acibenzolar-S-methyl
(Actigard), which induces plant systemic
resistance was applied in conjunction with
thymol to evaluate if disease suppression
could be enhanced compared with thymol or
acibenzolar-S-methyl alone. The test sites
were artificially infested with Ralstonia
solanacearum and Meloidogyne javanica,
and three days later thymol was applied
through drip irrigation lines under
polyethylene mulch at broadcast rate of 73
kg/ha in both years 2004 and 2005.
Acibenzolar-S-methyl was applied as foliar
spray at a concentration of 25 mg/liter.
Application of thymol significantly reduced
bacterial wilt on tomato in both years of the
trial. Bacterial wilt incidence reached 97.6%
and 95.2% in untreated plots in 2004 and
2005, respectively, while in thymol-treated
plots only 26.2% and 22.6% of plants wilted
at the end of the season. Furthermore,
application of thymol in conjunction with
acibenzolar-S-methyl significantly reduced
bacterial wilt incidence in both years


compared with thymol or acibenzolar-S-
methyl applied alone. Nematode galling on
roots was significantly reduced in the field
plots treated with thymol and acibenzolar-S-
methyl compared to the untreated control.
Tomato yield (cv FL 47) was evaluated only
in 2005 trial; thymol treated plots produced
significantly higher marketable yield than
untreated plots and thymol treatment in
combination with acibenzolar-S-methyl
significantly increased tomato yield compared
with thymol or acibenzolar-S-methyl applied
alone. These results indicate that thymol
applied through drip irrigation lines for soil
fumigation is highly effective in controlling
bacterial wilt but only moderately effective to
manage root-knot nematodes. The integrated
use of thymol and acibenzolar-S-methyl was
shown to be feasible in managing these
diseases and increasing tomato yield in
commercial tomato production.
Efficacy Evaluation of Stored
Nematophagous fungi Against Root-knot
Nematodes, Meloidogyne spp. RA Zorilla,
AG Castillo, TD Reyes and SM Calderon,
CPC, CA, UPLB, College, Laguna.
Rootknot nematodes (RKN), Meloidogyne
spp. has been the bane of many crop plants
and ornamentals. The discovery and success
of Paecilomyces lilacinus as efficient
parasites of RKN intensified biological
studies. Nematophagpus fungi such as
Metarrhizium anisopliae and Penicillium
oxalicum were being developed with higher
virulence and prolonged shelf life to
determine stability and storage life. Both
fungal isolates were stored at room
temperature and refrigerator for one, two and
three months. The fungi were inoculated as
spore suspension of 4x106 spores/ml or as
10g substrates mixed in soil of a 3-wk old
seedlings of tomato, eggplant, okra and
sweet pepper. The experiment was carried
out with 7 replications with control plots
containing root-knot nematodes only.
Greenhouse evaluation indicated no
significant differences on the infectivity of the







Abstracts of Pacers 6


refrigerated and room temperature store
fungi against RKN in tomato, eggplant, okr
and sweet pepper. Lower root galling indice
(0.66-1.33) were observed in P. oxalicur
spore suspension and soil mixed inoculate
sweet pepper. Percentage reduction c
infestation caused by both fungi ranged fror
50% to 85.7% for all crops.
Infectivity of the nematophagous fun(
were also tested against root-knot nematode
eggs in vitro. Results showed % parasitisr
was highest on Water Agar (WA) plate
grown with P. oxalicum with 94.3%. Infectivit
of M. anisopliae on RKN was 72%, 72 hour
after immersion.
In both laboratory and greenhous
evaluation, fungal isolates tested wer
effective against RKN. Substrates c
nematophagous fungi were infective eve
after one, two and three months storage E
room and refrigerated conditions.
Evaluation of Crucifers as "Biofumigants
Against Root-knot Nematodes c
Solanaceous Crops. RA Zorilla, AG Castillc
JP Dangan, VP Justo, TD Reyes, RG Bayc
anrt I Kiirlkanrri P(Pr P.A I IPI R r.nllhnF


A study which evaluate th
susceptibility or resistance of brassicas t
RKN revealed that after 6 wk, radish has th
least number galls and nematode count
followed by chaism and broccoli while
mustard, pechay and cauliflower were mor
preferred by the root-knot larvae but wer
less susceptible than tomato.
Laboratory toxicity test of brassic
extracts against RKN larvae indicated th,
radish, chaism, and broccoli extracts at 1:1
dilution effectively killed the nematode larva
48 hr after than the 1:100 and 1:1000 dilutior
Brassicas such as cabbagE
cauliflower and broccoli planted in a natural
root knot nematode infested plots i
Majayjay, Laguna showed that there was
significant reduction of nematode counts i
broccoli 2 mo after which gave 1.5 to 2.
(trace) root gall index ratings compared wit
cabbage and cauliflower.
When twelve varieties were grown i
farmers' field at the same area at the rate (
10 kg leaves and roots as soil incorporatio







70 Abstracts of PaDers


or Aninracnose un oaraoao Lile ,uulaWts was conmrmea oy sexual cro'
Z Ditan and OS Opina, CPC, CA, with standard tester strains. Thirty-four (8
ege, Laguna were mating type A' and six (15%) were
Twenty isolates were further characterized
terized forecast system for fertility and vegetative compatibility gi
e on mango, referred hereto as (VCG) in the laboratory and tested for 1
has been developed to identify stalk rot aggressiveness under
en environmental conditions are conditions across two environments using
for mango anthracnose infection toothpick inoculation method. In
ride alternative and cost effective greenhouse trials, inhibition of seec
fungicide application. MangoMan emergence, seedling height, fresh and
Models that transform daily weight were also determined. Analysis
nperature and duration (in hr) of fertility revealed 50% of the population v
nto disease severity values which female fertile. Significant (P = 0
basis for fungicide spray differences in aggressiveness toward cor
nations. Results of field evaluation some isolates were observed for 1
hat MangoMan assisted spray experimental locations while vegeta
required fewer fungicide compatibility grouping by pairing nit mut,
to achieve similar level of identified 19 vegetative compatibility gro
antrol and yield components for this population with a genotype diversity
;ith farmer's practice of calendar- 0.95. All isolates were pathogenic to (
ly program using azosxystrobin seedlings and mature plants compare
.5 SC). The disease levels non-inoculated control. The predominance
ng to MangoMan spray schedules G. fujikuroi mating population A suggests
cantly lower than the unsprayed Philippine corn is contaminated
calendar-based spray using fumonisins.
(Melody Dou 67 WP) while the
and quality were significantly Identification and Moleci
igoMan assisted spray program Characterization of Leaf-Spliti
provided added benefit over the Sugarcane Downy Mildew in Bogo, Ci
actice spray schedule and the and Its Relationship with Other Dov
)ntrol. Mildew Species. CB Pascual, FM c
Cueva AA (,imarnnn .IF \/illa 2nrl











morprologically and molecularly to detect 31/31/31 but instead of ECD


showed that Bogo isolates are distinct trom (100%) on the universally susceptible cultivar,
others and identified to be P. miscanthi while ECD #5 (Chinese cabbage Granat) followed
some isolates from Tarlac. belonged to P by ECD #7 (87.5%) and ECD #6 (83.33%).
sacchari and majority were P. philippinensis. The SSDC Pathotype 16/16/19 was
virulent only on ECD #5 and #10, with
POSTER PRESENTATION 75.83% and 71.66% indices, respectively.
The Buguias bulk isolate pathotype
Pathotype Identification of 21/23/31 was virulent only on ECD #5, 6 and
Plasmodiophora brassicae Wor. in 7, with ECD #7 having the highest (66.67%)
Benguet. BS Tad-awan, MaTP Baclili and disease index.
CD Bidang, Benguet State University, La
Trinidad, Benguet. Host Suitability of Five Lettuce Cultivars
to Root-knot Nematode, Meloidogyne
Clubroot disease, caused by Plasmodiophora incognita. NB Pedroche, LM Villanueva and
brassicae, is one of the most serious D.De Waele, Benguet State University, La







72 Abstracts of Papers


Kiat-ong and NB Pedroche, Benguet State Survey on the diseases of cabbage
University, La Trinidad, Benguet. and lettuce was conducted from December
2004 to December 2005 to determine the
A survey was conducted in strawberry most prevalent and the existence of new
growing areas in La Trinidad and Tuba, ones. Samples were collected from the
Benguet to determine the etiology of the two growing areas of Atok, Buguias and La
new diseases observed namely, strawberry Trinidad, Benguet.
crimp and Verticillium wilt. The above ground Results of the survey showed the
symptoms -of the strawberry crimp disease presence of Mycosphaerella leaf spot also
include stunted growth, reddened leaves, known as Ring Spot on Cabbage and Dry
small curled or crinkled leaves (crimp), leaf spot or head rot on lettuce in Atok and
deformed buds and flowers and a reduction in Buguias. Both diseases were not locally
flowering and fruiting. There are no reported reported.
below ground symptoms with this disease. Ring spot caused by Mycosphaerella
Using their morphological characteristics, the brassicicola on cabbage cv 'Scorpio' and
nematode was identified as Aphelenchoides 'Rareball' had brown to black lesions
fragariae. Based on the criteria proposed by measuring 0.3-1.2 cm. Brown perethecia are
Fortuner and Memy (1973), A. fragariae scattered on the spot surface or arranged in
could be considered an active parasite of a concentric pattern. Microscopic observation
strawberry in Benguet. revealed that the asci contained four to eight
On the other hand, initial symptom of ascospores. The disease infected cabbage
Verticillium wilt-infected plants is stunting, plants at heading stage and had often been
Outer leaves exhibit marginal and interveinal identified as Alternaria leaf spot.
browning, followed by eventual collapse. The disease was found in the mid
Inner leaves remain green but are stunted and high elevations of the municipalities of
and exhibit brownish black streaks or Buguias (Cotcot, Amlimay, Bangao,
blotches. Using their morphological and Lengaoan and Natubleng), Atok (Calasipan,
cultural characteristics, the pathogen was Cattubo, Lower and Upper Enlangad) and
identified as Verticillium sp. The fungal Kibungan (Madaymen).
disease is present in most of the areas Ring Spot is common in these areas
surveyed. This is the first report of the because of high relative humidity that
occurrence of the strawberry crimp disease favored ascospore development which is
caused by the foliar nematode and responsible in causing infection of Cabbage
Verticillium wilt in the country. It is believed plants.
that these diseases were carried through the Dry leaf spot or head rot of lettuce, on
imported planting materials, the other hand, was found in Buguias (Loo
and Poblacion) and La Trinidad (Balili and
Ring Spot (Mycosphaerella brassicicola) Betag-Swamp Area). The disease is caused
and Leaf spot (Xanthomonas anoxopodis by Xanthomonas axonopodis pv vitians and
pv. vitians): New Diseases of Cabbage and may have been confused with other bacterial
Lettuce in Benguet. AL Nagpala, LD Lando, diseases of lettuce such as soft rot.
JC Perez, AA Basalong, RK Tudayan, CD On lettuce, the lesions start out as
Ba-a and JP Galeng, Benguet State small water-soaked spots. The black spots
University, La Trinidad, Benguet. enlarge with age and may turn light brown to
gray. The tissues become paper-thin and







Abstracts of Papers 73


blighted, In wet weather, the spots may rot
and fall off.

Bio-Efficacy Evaluation of Non-
Bacteriocin Enterococcus faecalis Strain
TH10 for Rice Blast Management. MS
Desamito, MS Manalo, LV Marquez, Ohira,
HX Truong, PhilRice, Munoz, Nueva Ecija.
3119, E-mail:
truonghoaixuan@iphilrice()qov. ph

Blast is one of the most serious diseases of
rice (Oryza sativa L.) in South and Southeast
Asia. Disease is caused by Pyricularia grisea
Sacc. and prevalent in rainfed lowland,
upland and cool elevated rice ecologies,
sometimes in irrigated lowland. Yield
reduction due to blast infection of HYVs such
as PSB Rc 82, PSB Rc 14, IR 60, NSIC 122
during wet season 2005 ranged from 30% to
60%. Infected rice crop residues and humid
conditions are important factors that induce
the disease development and severity.
Resource-poor farmers commonly do
not use fungicide for blast disease control
due to its high cost input besides only one
blast-specific fungicide is marketed locally.
Resistant varieties are the most economical
option for the disease management.
However, breakdown of resistance can occur
within a few seasons associated with variable
pathogen population. Biological control
agents in rice ecosystem have recently been
explored for the blast management. Neither
of these agents was commercially formulated.
This paper reports the bio-efficacy of
BTO liquid containing E. faecalis TH10, a
non-bacteriocin lactic acid bacteria strain
derived from the fermentation product of
herbs for the rice blast management. The
evaluation was carried out both in nursery
and field trial. Foliar spray of BTO suspension
(1%) or released through irrigation water
within 5-day before or after the blast
inoculation when seedlings (variety NSIC
112) has reached 14 days old (nursery trial)


incidence and severity index. This antifungal
BTO formulation has great potential for
commercialized locally as an alternative
option for long-term rice blast disease
management.

Simple Formulation of Bacterial Inoculant
for Rice Crop Health Management. MS
Desamito, RG Corales, BD Tadeo, RT Cruz
and HX Truong*. PhilRice, Maligaya, Muioz,
Nueva Ecija, 3119, Email:
truonghoaixuan@philrice(gqov.ph

An inoculant prototype was formulated using
bacteria isolated from rice ecology. These are
the bacteria isolates of Bacillus subtilis, B.
macerans, Actinomyces sp., and B. pumilus.
antagonistic to the pathogen of bacterial leaf
blight, panicle blight, sheath blight, rice blast,
bakanae, and brown spot in an in vitro assay,
and root growth promoter Klebsiella
pneumoniae, Corynebacterium genitalium,
Pseudomonas stutzeri, Paenibacillus
polymyxa, Arthrobacter histidinolovoran and
C. aquaticum. The bacteria were produced in
0.04% crude protein and shaken at 200 rpm
for 48 hr. These were harvested by
centrifuging at 8000 rpm for 10 min; then their
pellets were mixed with starch (V: 10V) and
air-dried. Bio-efficacy field evaluation was
conducted for three consecutive seasons at
PhilRice Central Experiment Station (Mufoz,
Nueva Ecija). Treatments such as application
of the powdered inoculant via irrigation water
(1.2 kg inoculant ha-') at 20, 40, 60 days after
transplanting (DAT), and negative check were
laid out in a RCBD with four replications.
Comparison of treatment means were
analyzed by Fisher's Test on ANOVA.
Disease incidence and severity of bakanae
and sheath blight incidence, and yield
performance were monitored and recorded at
30, 55, 90 DAT and at harvest, respectively.
Application of inoculant thrice reduced the
incidence of bakanae and sheath blight and
increased root growth by 25-50% and







(4 mutstdurLb U1 rdpeab


Characterization ana laentiTicatlon OT
Prevalent Races of Xanthomonas oryzae
pv oryzae in Major Growing Areas in the
Philippines for Effective Breeding and
Gene Deployment Strategies to Bacterial
Blight Disease. MaGM Babb'*, FA Dela
Pefa1, AA. Dela Cruz1, MaJC. Duque1, JJ
Tagubase2, GB Amar1, LM Perez', L M
Borines3, EO Espejo3, J Duque2, C Casiwan1,
S Adriano1, Philippine Rice Research Institute
1Central Experiment Station, Maligaya,
Science City of Muhoz, 3119 Nueva Ecija
(*Author for correspondence; email:
ginababb@philrice .gov.ph); 2Midsayap
experiment Station, Bual Norte, Midsayap
9410 North Cotabato; and Department of
Pest Management, Leyte State University
(LSU), ViSCA, 6521-A Baybay, Leyte,
Philippines

Xanthomonas oryzae pv. oryzae (Xoo) is the
causal organism of bacterial leaf blight
disease in rice. Bacterial blight is one of the
most devastating rice diseases in tropical
areas and has been reported as a serious
constraint in rice production in irrigated and
rainfed lowland environments.
This study currently focuses on the
collection, characterization and identification
of prevailing Xoo races in major rice growing
areas that will lead to the development of
location-specific technology by developing
cultivars with resistance genes corresponding
to the prevalent Xoo races identified in the
specific rice growing areas. The Xoo races
were characterized through inoculation into
established rice differential varieties and
evaluation of disease reactions.
Preliminary inoculation using some of
these isolates together with three known
races, namely, Race 1-PXO61, Race 2-
PXO86 and Race 6-PX099 was conducted. It
was generally observed that the lesions
produced by the diagnostic races on the NIL's
were shorter, even the IR24 susceptible


reaction OT IiKIu4 (resistant to rVAul) ana
IRBB7 (resistant to PX086) were expected.
IRBB21 was supposed to be resistant
to PXO99 but in this phenotyping it produced
long lesions to PXO99. This may suggest that
Xa21 resistance gene may have started to
break down. In Mindanao where bacterial
blight is endemic, only 20 virulent Xoo were
successfully isolated and pure cultured. Of all
the isolates tested, only isolate 299 from
Mlang Cotabato had the same BB disease
reaction pattern with Race 9. The rest of the
isolates just slightly resembled with other BB
races.
The information generated from this
study will eventually help breeders and
researchers into designing specific breeding
program and develop disease management
strategies to efficiently control bacterial blight
disease. The main goal of this endeavor is to
generate a database of Xoo races distribution
in the Philippines.

Host Status of Weeds to Meloidogyne spp.
JR Rich, R Kaur, JA Brito and MV Barber.
(University of Florida, IFAS/NFREC, 155
Research Road, Quincy, FL 32351 USA;
University of Florida, Bldg. 970 Natural Area
Drive, Gainesville, FL-32614, USA,
iLmmrYufl _edu).

Root-knot nematodes (Meloidogyne spp.)
cause significant losses worldwide. The host
range of root-knot nematodes in agriculturally
important plants is broad and well-defined,
however, little is known about their host range
on weed species. Weeds are ubiquitous in
agricultural production and may increase
nematode populations resulting in greater
losses from nematodes to crop plants. Of the
hundreds of problematic weeds known
worldwide, only about 97 have been identified
as hosts of various Meloidogyne spp. Even
fewer weeds have been studied or reported
as hosts of the most widespread and







abstracts of Paoers 75


Arenaria include Ipomoea tricolor,
Jacquemontia tamnifolia, Physalis angulata,
whereas, some of the weed hosts reported
for M. incognita includes Biden alba, Celosia
argentea, Chenopodium spp., Cleome
viscose, Cynodon dactylon, Cyperus
rotundus, Fumaria capreolata, Macrophilium
lathyroides, Malva sylvestris, Setaria spp.,
Sida acuta, and Verbena officinalis. Weed
hosts for M. javanica include Convolvulus
arvensis, Cyperus rotundus, Malva parviflora,
Salpichroa origanifolia, Tamarix gallica, and
Sida rhombifolia. The recognition of weed
species as hosts to plant-parasitic nematodes
is an important element for nematode
management. Currently, we are studying the
host status of three Meloidogyne spp. (M.
arenaria, M. incognita, M. javanica) on
common weeds associated with agronomic
crops in southern USA. Individual weed
species were inoculated with 3000 eggs/plant
of M. arenaria, M. incognita, M. javanica in
greenhouse trials. Plants were allowed to
grow for 70 days after inoculation, and then
reproduction factor (Rf = final nematode
population/ initial nematode population) was
used to measure host status of the root-knot
nematodes on individual weed species. Of
the 15 weed species studied thus far,
Dichondra repens was a good host of M.
arenaria (Rf=21.65), M. incognita (Rf=21.62)
and M. javanica (Rf=21.80). Abutilon
theophrasti was also found excellent host of
M. javanica (Rf=178), followed by M.
incognita (Rf=47.6) and M. arenaria (Rf=3.2).
Echinochloa* muricata was a good host for M.
arenaria (Rf=3.67), a poor host for M.
incognita (Rf=0.63) and a non-host for M.
javanica. Host status of common weeds to
Meloidogyne spp. should be determined for
additional weeds to allow more precise
recommendations for growers to manage
weed hosts of root-knot nematodes.

Response of Some Ornamental and


RA Zorilla and RV Rasgo, CPC, College of
Agriculture, UP Los Banos, College, Laguna.

An experiment was conducted to determine
the response of some ornamental and
medicinal crops to root-knot nematode
(Meloidogyne spp.) infection. Thirteen
different ornamental and seven medicinal
crops were used. Prior to the actual
experiment, a survey of the root-knot
nematode was also conducted in Los Bafios
and Bay, Laguna.
Among the twenty crops tested,
eleven were found to be susceptible to root-
knot nematode infection, seven of which were
ornamentals and four were medicinal crops.
Nine out of twenty were found to be resistant
to the nematode.
The root weight of the plants was
affected by the root-knot nematode infection.
Inoculated plants got higher root weights than
uninoculated. The shoot weight on the other
hand was not affected. Reduction in height
was also observed. Higher height increments
were observed on the uninoculated than the
inoculated.
No direct relationship between
disease severity and the total number of
nematodes recovered from 2-gram galled
roots was observed. Moreover, the nematode
population failed to produce high number of
Egg Laying Females (ELF).
No direct relationship between
disease severity and total number of egg
masses present in the whole root system was
observed.
In general, test crops with higher
disease severity obtained higher nematode
counts extracted from 300 gram soil samples
than the test crop with lower disease severity.
Resistant crops obtained the lowest values.
At least one root-knot species attacked each
crop species.

Reaction of Hybrid Rice Component Lines







Abstracts of PaDerE


Reformina, V. Gutierrez, W. Tagle, B.,
Sinangote and MGM. Babb, Leyte State
University, ViSCA, Baybay, Leyte and
PhilRice, Maligaya, Science City of Murioz,
Nueva Ecija.

The Philippine has gone into hybrid rice
production and its commercialization due to
the yield advantage offered by this
technology over the best inbred cultivars. A
limiting factor however, is the susceptibility of
the hybrid rice component lines to disease
and insect pests. This study aims to
determine the reaction of hybrid rice
component lines to major diseases (bacterial
blight, sheath blight and tungro) and insect
pests (rice black bug and brown planthopper).
Eighty hybrid rice component lines were
evaluate against ten Philippine Xanthomonas
oryzae pv. oryzae (PXO) races (12 isolates),
one Rhizoctonia solani isolate and rice
tungro virus disease. the reaction of the same
lines was also evaluated against the rice
black bug (RBB) and brown planthopper
(BPH). Five lines (BB-2, BB-3, PR3 B, PR6 B,
PR11 B) showed resistance to all PXO races.
Many of the lines showed a reaction pattern
similar to IRBB4 indicating the presence of
Xa4 gene in these lines. None of the lines
showed resistance to sheath blight. Ten lines
however showed intermediate (I) reaction,
namely: BB-1, BB-2, IR 72, LP0330,
LP0345, LP0368, PR26016 B-B-B, Rizalina
28 and UPR1201-1-53. Moreover, all lines
showed susceptible reaction to rice tungro
disease. Line R2-6 showed high resistance,
PR4 and IR60819R, moderate resistance,
and GU199 was intermediate in reaction to
RBB. Most of the line showed intermediate
reactions to BPH. Two lines (AR-3219-3-36,
28B and IR68997B) were found resistant and
eight of them showed moderate resistant
reaction to BPH, namely, PR26243-69-1-6-1-
1, CAN 8502, PJ3-5, IR68888 B, IR62161R,
IR 59606-119-3R, IR34686 R and PRSRc34.


Rillon, MSV Duca and UG Duque, PhilRice,
Science City of Munoz, Nueva Ecija.

Growing of resistant varieties has been
considered essential for suppressing disease
outbreaks and one way to increase yield is to
reduce losses to diseases. It is the most
preferred strategy for disease management.
The test varieties such as PSB Rc18, PSB
Rc28, PSB Rc72H and PSB Rc82 were re-
evaluated for major rice diseases. PSB Rc18,
PSB Rc 72H and PSB Rc28 had intermediate
reaction to tungro upon their released as
variety but result of re-evaluation showed
susceptible reaction to the disease. In PSB
Rc28 and PSB Rc82, result showed resistant
to intermediate reaction to blast disease.
Among the major rice disease it is tungro and
blast disease caused changed in varietal
reaction. The disease reaction of test
varieties to bacterial leaf blight and sheath
blight disease did not change drastically.
Since the release of the varieties, resistance
remains through time. Varieties with resistant
reaction to major rice disease after the re-
evaluation can be considered in breeding
programs.

Nematicidal Activity of Garden Balsam
and Garden Spurge Extracts Against the
Root-knot Nematode (Meloidogyne
incognita) in Tomato (Lycopersicon
esculentum), DD Amodia, BT Dionio and LC
Generalao, University of Southeastern
Philippines, Apokon Campus, Tagum City

Crude extracts of mature garden balsam
fruits and garden spurge (whole plant)
applied as drenched were evaluated for their
nematicidal activity against the root-knot
nematode, Meloidogyne incognita, using 2-
mo old tomato (Hybrid-7) plants as test host.
Root and top weight of infested
tomato plants were not significantly affected
by the application of mature garden balsam
fruit extract and garden spurge extract. Root








MUbll dULb U1 r-pebI


Leaves snowing Dlast lesions or paniuces w
neck blast symptoms were collected frc
farmers' fields in Luzon (Nueva Eci
Pangasinan, Isabela, Cagayan and Orien
Mindoro), Visayas (Leyte, Iloilo, Negr
Occidental, Bohol, Samar and Bilir
Province) and Mindanao (Agusan del Sur a
South Cotabato).
Collection from the same variE
within the same barangay/municipality thou
different farmers' fields were treated as or
More so, collections from promising line
traditional and unidentified varieties were r
included.
There were 88 blast sample
collected from differ(
barangays/municipalities and varieties
several rice growing areas in the Philippine
Forty-two were from Luzon, 18 from t
Visayas and 28 from Mindanao. PSB Rc
(18%) and PSB Rc82 (17%) in Luzon; NS
Rc112 (38%) in the Visayas; and NS


ULI Il VdIl ILICu I Ui pIJC LIIIy L 110 %uIIJJI
season of 2006.

Pest Injuries as Affected by NI
Application in Hybrid Rice Cultivation. E
Valdez, MS Manalo, CE Constantino and I
dela Peia. Crop Protection Division, PhilRi(
Science City of Muioz, Nueva Ecija.

A study was conducted at PhilRice Cent
Experiment Station (CES) using transplant
hybrid rice varieties Mestizo 1, 2 and 3 (V
Season 2004 to Wet and Dry Seasons
2005) to determine the effects of NI
application to pest injuries in different hyb
rice varieties. The treatments were as follov
T1 = 120-0-0 kg NPK/ha; T2 = 120-40-0
NPK/ha; T3 = 120-0-40 kg NPK/ha; T4 = 1;
40-40 kg NPK/ha; T5 = 120-40-40 kg NPK/
+ 20 kg ZnSO4/ha; T6 = 120-40-40
NPK/ha + Si; T7 = 120-40-90 kg NPK/ha; a







S/r-wou aio L UI r Cai;


Ip or Asian mlovar .5 omaro Tiela snowea nal 3i./I/o were
Dl 3fc4ra r cMnr anr, ,a ar Rnrl R 'o0/. hKInnn +fn hinm~r A


de, South Australia. Plant Pathology, Ohio State Unive
Madison Avenue, Wooster, OH 44691-41
primers OPD 07, 11, 15 ,18, 20 and
!0 were used to analyze the diversity Bacterial wilt caused by Ral
s Taiwanese, Indonesian and the solanacearum, is the major limiting fac
)ine biovar 3 strains of R. eggplant production in tropical cour
icearum isolated from tomato. Each The reported bacterial wilt resistant egg
Save a different set of amplified along with IPB advanced lines
products to the different group of screened for resistance to strains o
isolates. Sahn cluster analysis of the solanacearum. High yielding bacteria
plates resolved ten genetic groups at susceptible commercial variety of egg
similarity level with bootstrap P value were grafted onto eggplant roots
%%. Of these, 4 groups were the resistant to bacterial wilt. The gr
nese, 1 group was the Philippines seedlings were planted in the dis
5 groups were the Indonesian nursery The efficacy of diff
s. Among the Asian isolates rootstock-scion combinations







Abstracts of Papers 81


Efficacy of Brassica Green Manure two soil types (20 x 103). Five days after
Against Bacterial Wilt and Soft Rot treatment with mustard biofumigant, the
Pathogens in Clay Loam and Sandy Loam population of indigenous Bacillus spp.
soil. RG Bayot, VP Justo, JJ Gerard, P. increased 32 fold (23.6 x 105 cfu per gram
Dangan and J Kirkegaard, CPC-NCPC, soil). Five days after treatment with mustard
UPLB and CSIRO*, Canberra, Australia biofumigant, the population of indigenous
Bacillus spp. increased 32 fold (23.6 x 105 cfu
The influence of soil texture in the efficacy of per gram soil) in clay loam soil, 5 fold (21.9 x
biofumigation was determined using 103) in sandy loam soil and 79 fold (15.8 x
rifampicin-resistant strain of Ralstonia 105) in 1:1 soil mixture. The result indicates
solanacearum (Rs) under laboratory and that biofumigation has no adverse effects on
greenhouse conditions. Clay loam (rice field indigenous Bacillus spp. in the soil, instead
soil), sandy loam soil and a 1:1 (v/v) mixture the organic matter added to the soil may even
of the two soil types were used in the enhance their population. In fields with low
experiment. The population of Rs was population of indigenous Bacillus spp. that
reduced only eight times (8x) in clay loam soil are antagonistic to the bacterial wilt
treated with 5% (fresh weight, wlw) mustard pathogen, the synergistic or additive effect of
tissues compared with 228 fold and 100 fold the biofumigant and antagonists may not be
population reduction in sandy loam and 1:1 observed.
(v/v) mixture of the two soil types, The effect of biofumigation on the
respectively, 5 days after treatment. In the survival of the soft-rot pathogen,
greenhouse study, only mustard reduced wilt Pectobacterium carotovorum pv. carotovorum
incidence significantly in clay loam soil. in (Pcc), in the soil with different textural grade
sandy loam soil, all the biofumigants tested was evaluated because of concerns that
(mustard, radish and bonchoi) reduced the Brassica wastes may introduce the soft-rot
bacterial wilt incidence significantly ranging pathogen to the field. Rifampicin-resistant
from 8 42% compared to untreated sandy strain of Pcc was used in the experiment
loam soil with 75% wilt incidence. The 100 following the procedure used in Rs. Mustard
ppm volatile oil of mustard (VOM) was used biofumigant reduced the population of Pcc 32
as positive control where wilt incidence in fold in clay loam soil. 20 fold in both sandy


The influence of biofumigation on the
population of indigenous Bacillus spp. in the
soil was also determined. The population of
indigenous Bacillus spp. was lower in sandy
loam soil (5 x 103 cfu per gram) than in clay
loam soil (73 x 103) and in 1:1 mixture of the


in both clay loam and sandy loam soil after
biofumigation. It is recommended that fresh
biofumigant should be used to minimize
possible introduction of the soft rot pathogen
in the field.













Membership In the PPS is prerequisite to publishing in the Journal of Tropical Plant Pathology,
at least one author must be a members of the Society. The editorial Board, however, may rel,
this rule for contributions of exceptional merit. It may also invite distinguished scientists
contribute articles of interest tot eh Society.

Manuscript, must be reports of original research, excerpt of meritorious reviews, and should n
have been published elsewhere. The decision of the Editorial Board to accept or reje
manuscript is final.

The manuscript should be typed on one side of 81/2x11 inch paper, double spaced throughout.

Papers other than Notes may be organized conveniently under: Title, Author(s), Authors; positic
and address, Abstract, Keywords, Introduction, Materials and Methods, Results, Discussion (i
Results and Discussion) and Literature Cited, Acknowledgcment.

In the test, citations should be by name-and year system, e.g. Molina (1996), Ou and NuqL
(1980), Ou et al. (1990) if more than two authors.


Tables should be numbered consecutively, and each typed on a separate page. They must
descriptive headings and should be understandable without reference to the text. F
containing tables should follow Literature Cited and should be numbered accordingly.

Figures should be prepared as camera-ready copy. The size and arrangements of figure (gn
lines, drawings and photographs) should conform to journal page size. Combine illustratic
composite cuts when possible, and label each unit to correspond with the text figure refer
using consecutive letters. Label each illustration in pencil on the reverse side with the i
number and authors' name. Captions for figures should be typed together on a sep
numbered page following the tables.

Manuscripts should be submitted on previously scanned and virus-free 31/2 size hard disl
The diskette should be labeled with the type of software used and the version number. A
copy of the manuscript exactly matches the disk file must be supplied.

1. See latest issue of the journal for more details on the format of paper to e submitted to the jou

. Articles published are not paid but author's foot the bill for reprints.

IBSCRIPTION: Communications should be addressed to the Treasurer, PPS, c/o Crop Protection Cluster, Bio


nce Bldg., UPLB, College, Laguna 4031. It is sent free to r
r (domestic) or $30.00 per copy elsewhere. Postage free a


members in good standing. For others, it is Php300.00 p







University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs