• TABLE OF CONTENTS
HIDE
 Front Cover
 Table of Contents
 Mycelial growth and sporulation...
 Survey, isolation and identification...
 Efficacy of hypovirulent binucleate...
 Detection, isolation and pathogenicity...
 Variability of Stenocarpealla macrospora...
 Control of Phytophthora black stripe...
 Boric acid controls Colletotrichum...
 Abstracts of papers presented during...






Title: Journal of Tropical Plant Pathology
ALL VOLUMES CITATION THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00090520/00001
 Material Information
Title: Journal of Tropical Plant Pathology
Series Title: Journal of Tropical Plant Pathology
Physical Description: Serial
Language: English
Creator: Philippine Phytopathological Society
Publisher: Philippine Phytopathological Society
Place of Publication: Laguna, Philippines
Publication Date: 2005
 Record Information
Bibliographic ID: UF00090520
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.

Table of Contents
    Front Cover
        Front Cover 1
        Front Cover 2
    Table of Contents
        Table of Contents 1
        Table of Contents 2
    Mycelial growth and sporulation of Phyllosticta musarum on different culture media and under varying light duration
        Page 1
        Page 2
        Page 3
        Page 4
        Page 5
        Page 6
        Page 7
        Page 8
        Page 9
        Page 10
        Page 11
        Page 12
        Page 13
        Page 14
        Page 15
    Survey, isolation and identification of two major viruses causing the sweetpotato virus disease (SPVD) complex in the Philippines
        Page 16
        Page 17
        Page 18
        Page 19
        Page 20
        Page 21
        Page 22
        Page 23
        Page 24
        Page 25
        Page 26
        Page 27
        Page 28
    Efficacy of hypovirulent binucleate Rhizoctonia sp. in suppressing sheath blight progression in rice
        Page 29
        Page 30
        Page 31
        Page 32
        Page 33
        Page 34
        Page 35
        Page 36
        Page 37
    Detection, isolation and pathogenicity of Xanthomonas albilineans, the cause of sugarcane leaf scald
        Page 38
        Page 39
        Page 40
        Page 41
        Page 42
        Page 43
        Page 44
        Page 45
    Variability of Stenocarpealla macrospora (Earle) Sutton, the cause of Stenocarpella disease complex in corn
        Page 46
        Page 47
        Page 48
        Page 49
        Page 50
        Page 51
        Page 52
        Page 53
        Page 54
        Page 55
        Page 56
        Page 57
        Page 58
        Page 59
        Page 60
        Page 61
        Page 62
        Page 63
        Page 64
        Page 65
        Page 66
        Page 67
        Page 68
        Page 69
    Control of Phytophthora black stripe disease of rubber in Matalam, Cotabato
        Page 70
        Page 71
        Page 72
        Page 73
        Page 74
        Page 75
        Page 76
    Boric acid controls Colletotrichum gloeosporioides in mango
        Page 77
        Page 78
        Page 79
        Page 80
    Abstracts of papers presented during 36th anniversary and annuel scientific meeting of pest management council of hte Philippines, Inc. held at PhilRice, science of city Muñoz, Nueva Ecija on May 3-6, 2005
        Page 81
        Page 82
        Page 83
        Page 84
        Page 85
        Page 86
        Page 87
        Page 88
        Page 89
        Page 90
        Page 91
        Page 92
Full Text


ISSN 0115-0804


JOURNAL OF TROPICAL

PLANT PATHOLOGY


VOLUME 41 NUMBER 1 & 2
January December 2005


Published by


The Philippine Phytopathological Society, Inc.
c/o Crop Protection Cluster
UP Los Banos, College, Laguna
4031 Philippines


$


'J4 i I IJ(Vk








JOURNAL OF TROPICAL PLANT PATHOLOGY
Published by the Philippine Phytopathological Society, Inc.


OFFICERS OF THE PHILIPPINE PHYTOPATHOLOGICAL SOCIETY, INC.


2004-2005


2005-2006


President
Vice President
Secretary
Treasurer
Auditor
Business Manager
PRO
Board Members



Ex-Officio


P.G. Gonzales
F.M. dela Cueva
T.U. Dalisay
L.M. DoLores
O.S. Opina
R.G. Bayot
MaA.G. Maghuyop
C.J.R. Cumagun
C.M. Vera Cruz
T.O. Dizon
M.B. Palacpac
R.A. Zorilla


President
Vice President
Secretary
Treasurer
Auditor
Business Manager
PRO
Board Members


Ex-Officio


F M. dela Cueva
C.J.R.Cumagun
E.Y. Ardales
L.M. Dolores
R.G. Bayot
R.A. Zorilla
T.O. Dizon
O S. Opina
C.B. Pascual
M.B. Palacpac/
F.A. dela Peia
T.U. Dalisay
P.G. Gonzales


EDITORIAL BOARD


Editor-In-Chief
Associate Editors

Circulation Manager


Teodora.O Dizon
Rizaldo G. Bayot
Christian Joseph R. Cumagun
Cecilia B. Pascual


SUSTAINING ASSOCIATES

AgChem Manufacturing Corporation
BASF Philippines, Inc.
Bayer CropScience
Syngenta Philippines, Inc.
Du Pont Far East, Inc.
Kemistar Corporation
Trans World Trading Co., Inc.


Cover photo


Sweetpotato infected with sweetpotato virus diseases (SPVD).


- ~- --~-"---~-a~~-~-~s~----- __s_---~---i*l~~u~uI~- I- I


~I~ ~li_~~~__~~__~~_~ _~__







JOURNAL OF TROPICAL PLANT PATHOLOGY


VOLUME 41 NUMBER 1 & 2 JANUARY TO DECEMBER 2005


CONTENTS


Mycelial growth and sporulation of Phyllosticta musarum on
different culture media and under varying light duration
BM Corcolon, TH Quimio, LL Ilag and AD Raymundo 1-15

Survey, isolation and identification of two major viruses causing
the sweetpotato virus disease (SPVD) complex in the Philippines
LM Dolores and MGN Yebron Jr. 16-28

Efficacy of hypovirulent binucleate Rhizoctonia sp. in
suppressing sheath blight progression in rice
RL Galang, CB Pascual and AL Lalap 29-37

Detection, isolation and pathogenicity of Xanthomanas albilineans,
the cause of sugarcane leaf scald
FM dela Cueva, MP de Ocampo, RT Luzaran and MP Natural 38-45

Variability of Stenocarpealla macrospora (Earle) Sutton, the
Cause of Stenocarpella disease complex in corn
Sutoyo and AD Raymundo 46-69

NOTE

Control of Phytophthora black stripe disease of rubber in
Matalam, Cotabao
NG Tangonan and EGG Butardo 70-76

Boric acid controls Colletotrichum gloeosporioides in corn
CJR Cumagun and AT Vitor 77-80


Abstracts of Papers presented during the 36h Anniversary and
and Annual Scientific Meeting of the Pest Management Council
of the Philippines, Inc. held at PhilRice, Science City of Mufioz,
Nueva Ecija on May 3-6, 2005 81-92






W140^






Journal of Tropical Plant Pathology 41:1-15


MYCELIAL GROWTH AND SPORULATION OF PHYLLOSTICTA
MUSARUM ON DIFFERENT CULTURE MEDIA AND UNDER
VARYING LIGHT DURATION


B.M. CORCOLON1, T.H. QUIMIO2, L. L. ILAG2
and A.D. RAYMUNDO3


Portion of the Ph. D. Dissertation of the senior author submitted to the Graduate
School, University of the Philippines Los Baios (UPLB), College, Laguna, Philippines.
Supported by a Lapanday Foods Corporation scholarship.

'Former Graduate Student, UPLB, presently Aerial Spray Manager, Lapanday Foods
Corporation, Lapanday Group of Companies, Davao City; 2Professor Emeritus and Retired
Professor and 3Professor, Crop Protection Cluster, UPLB, College, Laguna


ABSTRACT

Various culture media were tested to establish a suitable growth
medium for Phyllosticta musarum and the optimum conditions
favorable for its growth and sporulation. The most suitable medium
was identified and was used to establish pure cultures.

The addition of banana decoction on the V-8 medium did not
enhance the growth of Cardaba, Cavendish and Lakatan P. musarum
isolates when grown under continuous light conditions. The growth
of Lakatan and Cavendish isolates grown in V-8 medium was greatly
favored when exposed under varying light durations. However,
under continuous darkness growth of these isolates was not
enhanced.

The suitable medium and growth conditions identified for the
Cavendish isolate was Modified V-8 medium exposed to 8 hours
light and 16 hours darkness. Both growth and sporulation of the
freckle organism were favored using this medium and light duration.
For the Lakatan and Cardaba isolate, V-8 medium could support
growth and sporulation of P. musarum when exposed to the same
light duration.

Keywords: Phyllosticta musarum, banana, Cardaba, Cavendish, Lakatan, freckles


INTRODUCTION Ocfemia (1927) found that this species is
similar to that earlier described as Phoma
Banana freckle disease is caused by musae (Cke) Sacc. which was subsequently
Phyllosticta musarum (Cke) Van der Aa with redescribed as Macrophoma musae (Cke)
its teleomorph Guignardia musae Racib. Berl. & Vogl. From studies of freckle on
Carpenter (1919) first described the causal leaves and fruits of Cavendish banana.
organism as a new fungal species, Phoma Meredith (1968) reported that the pathogen
musae Carpenter. Reinking (1926) and should be named Phyllostictina musarum






Z Corcolon et al.


(Cke) syn. Phyllosticta musarum (Cke) Van
der Aa. However, after 1973, the pathogen
was named Phyllostictina musarum to
refer to the anamorph of the freckle
pathogen by several authors.
Based on earlier descriptions,
subconical, partly embedded, shining black
pycnidia are present in characteristic black
spot symptom of the disease. The pycnidia
are not beaked and the ostiole is not
conspicuous (Wardlaw, 1972). Conidia are
one-celled, obovoidal, ellipsoidal or short
cylindrical with a truncate base, broadly
rounded apically and conspicuously
indented. The dimensions of conidia are
usually 15-18 um x 9-10 ur. Conidia are
surrounded by a 1-3 um thick gelatinous
envelope. Perithecia are globose,
depressed, 70-220 um in diameter and
distinctly papillate. Their walls are 1-2 um
thick composed of dark brown cells. Asci
have eight ascospores, are clavate or
cylindrical usually with a short stalk and
measure 35-85 um x 20-25 um. Ascospores
are single-celled, ovoid or oblong ovoid and
17-22 um x 8-10 um. Spermatia cells are
aseptate, cylindrical or dumb-bell- shaped,
6-10 um long and 0.5 2.0 um wide (Jones,
2000).
Initial attempts made to isolate the
organism in culture proved to be
unsuccessful (Carpenter, 1919; Reinking,
1926; Ocfemia, 1927; Meredith, 1968).
Chuang (1981) reported the successful
isolation of P. musarum and artificial
inoculation of the isolated organism.
Although the organism was successfully
isolated, the cultural as well as
morphological characteristics have not been
fully described. Two types of isolates were
observed on V-8 agar media. One which
produced blackish minute and slow growing
colonies (ca. 5 mm in diameter in 2 months)
which was designated as M type isolate and
another which produced large blackish
green colonies (ca. 40 mm diameter in 7
days) and was designated as L type isolate.
Results of inoculation tests showed that the
M type isolate was P. musarum while the L
type was a saprophyte associated with the
diseased tissues. The M isolate produced
black pycnidia which contained hyaline,
obovoid conidia (10 22 x 6 13 um) with a


mucilaginous envelope and appendage.
Attempts to induce ascospore production on
various media with and without banana
tissue have not been successful.
This study was conducted to
ascertain the effect of different culture
media and light durations on the growth and
sporulation of different P. musarum
isolates.

MATERIALS AND METHODS

Isolation of P. musarum

Phyllosticta musarum was isolated from
three cultivars of banana namely,
Cavendish, Lakatan and Cardaba following
the procedure used by Chuang (1981).
Newly infected banana leaves of each
cultivar were collected in the field and
thoroughly washed with tap water. Small
leaf pieces were cut, surface-sterilized with
0.5% sodium hypochlorite solution for 2 min
and then blotted on sterilized filter paper.
Small sections (0.5 1.0 mm) of the
infected leaf that contain the pycnidia were
cut with a sterilized scalpel then placed in V-
8 culture media. Transfers of cultures were
made on sterile V-8 agar slants. Pure
cultures of P. musarum that were obtained
for each isolate were then used in the media
and light duration experiments.

Pathogenicity Test

Pathogenicity test was made on the
isolates from Cavendish, Cardaba and
Lakatan. Inoculation tests were made on
the leaves, detached and intact fruits of
these cultivars. The inoculum sources used
were pure cultures of the isolates and
infected leaf washings.

Mycelial Growth and Sporulation of P.
musarum Using Different Culture Media

An experiment to determine the effect of
various culture media on the growth of
different P. musarum isolates was
conducted. This study aimed to establish a
suitable growth medium for the freckle
causal organism.







Mcelial growth and sporulation3


The following were the three culture
media used in the experiment with the
corresponding composition
1. V-8 medium V-8 juice 10%
CaCO3 0.02%
Agar 1.5%
2. Modified V-8 medium
V-8 juice 10%
CaCO3 0.02%
Agar -1.5%
300g banana leaves
boiled in 1 li water
3. Banana decoction agar
300g banana leaves
Agar 1.5%
One liter of each culture media was
prepared and dispensed in Petri dishes
(approx. 15 ml/Petri dish). Four replicates
for each culture medium that were
inoculated with pure culture of each isolate
were prepared. This was done by planting
at the center of each dish a 5-mm agar disc
with fungi obtained from pure cultures of
each isolate. All plates were incubated at
room temperature and continuous light for
two months.
Mycelial radial growth (mm) of each
isolate grown in the different culture media
was measured. Sporulation was quantified
using a haemacytometer by counting the
number of conidia per plate after the 2-
month culture period.
A Completely Randomized Design
(CRD) was used in the experiment. Data on
radial growth and sporulation were
subjected to analysis of variance using the
Statistical Package for Social Sciences
(SPSS) program. The Fisher's Least
Significant Difference (FLSD) determined
significant differences among treatments.

Mycelial Growth and Sporulation of P.
musarum on Different Media and Under
Varying Light Durations

Since sporulation was not observed in all
banana isolates cultured in the different
media because of continuous exposure to
light which was the normal incubation
environment for growing fungi, an
experiment was conducted to determine if
exposure to different light durations can
induce sporulation of P. musarum.


Sporulation of many fungal species
commonly occurs in darkness; however
they do not sporulate unless briefly exposed
to UV light and other sources of light
(Rotem et al, 1978). Hence, the combined
effect of light duration and culture media on
sporulation as well as the combined effect
of these two factors on the growth of each
isolate was determined.
Agar discs from pure cultures of
each isolate were again placed in Petri
dishes containing the three media. The
same procedure of inoculation was
followed. Twenty plates of each culture
media were used with each isolate (4
replications per isolate) for the five light
duration treatments.
The following were the different light
durations used in the experiment:
1. Continuous light
2. 16 hours light, 8 hours darkness
3. 8 hours light, 16 hours darkness
4. 12 hours light, 12 hours darkness
5. Continuous darkness
For light duration treatments 1-4, the
plates were incubated in a culture cabinet
mounted with 20W fluorescent incandescent
lamps. Plates that were subjected to
continuous darkness were wrapped with
carbon paper. All plates were incubated at
room temperature at the Plant Pathology
Laboratory of the Research Department of
Lapanday Foods Corporation, Mandug,
Davao City.
All cultures were examined at
weekly intervals for radial growth and
sporulation starting at 7 days after the
transfer of agar disc and incubation under
the various light duration treatments. Linear
measurements was done to determine
radial growth. The same linear regression
equation Y + a + bX was used too
determine radial growth rate while
haemacytometer was used to estimate
degree of sporulation by counting conidia
produced for each plate after 2-months
incubation period.
A three-factor experiment in
Completely Randomized Design (CRD) was
used for this experiment. Data on the effect
of culture media and light duration and their
interaction on mycelial growth and
sporulation of the three isolates were


3


Mvcelial arowth and sDorulation






4 Corcolon et al.


subjected to analysis of variance using
SPSS program. Fisher's Least Significant
Difference (FLSD) determined significant
differences among treatments.

Mycelial Growth and Sporulation of P.
musarum Cavendish Isolate on Modified
V-8 Medium

The Modified V-8 medium (V-8 + banana
decoction) was identified as a potential
isolation medium for P. musarum. For
further evaluation, an experiment was
conducted to determine the effect of this
medium on the growth and sporulation of
the Cavendish isolate. It aimed to establish
a suitable culture medium for Cavendish
isolate.
Agar discs from pure culture of
Cavendish isolate were planted on Modified
V-8 medium and plates were exposed to
various light duration treatments. There
were four plates representing four replicates
for each light duration exposure. Weekly
measurements on the radial growth
diameter were made using a slide rule. The
same linear regression equation Y = a + bX
was used to determine the growth rate per
day of the freckle organism while a
haemacytometer was used to estimate
degree of sporulation by counting the
number of conidia produced per plate after
2 months for each treatment. Data on the
effects of various light durations on
Cavendish isolate grown in Modified V-8
medium were subjected to analysis of
variance using SPSS program. Fisher's
Least Significant Difference (FLSD)
determined significant differences among
treatments.

RESULTS AND DISCUSSION

Isolation of P. musarum

P. musarum was isolated from infected
leaves of the three cultivars of banana
namely, Cavendish, Lakatan and Cardaba
using V-8 as culture medium. Previous
reports by Chuang (1981) indicated the


suitability of V-8 as medium for the isolation
of this freckle pathogen. However, previous
results showed slower growth of the
organism in this medium.
The cultures that were isolated from
the three cultivars showed similar
characteristics. Blackish to grayish mycelial
growth was observed after 30 days
incubation period (Fig. 1). This observation
agrees with the blackish type of isolate that
Chuang (1981) observed. However, radial
colony growth observed was smaller
reaching only 5 mm maximum diameter
after 2 months. Chuang (1981) isolated two
types of colonies from diseased tissues and
designated as M type and an L type isolate
which produced large blackish colonies
attaining 40 mm diameter in 7 days. In the
present study, blackish to grayish mycelial
growth was observed on the growing
cultures attaining more than 30 mm after
one-month incubation period.

Pathogenicity Test

The severity of infection was highest on
Cardaba leaves using both pure cultures
and leaf washings. The incubation period
on leaves ranged from 10-27 days on
Cardaba, 8-44 days on Lakatan and 16-28
days on Cavendish. On the field inoculated
Cavendish fruits, incubation period ranged
from 4.5-11 days, Cardaba 38.3 days and
Lakatan 6.7 days. On detached fruits,
incubation period was 11 days on
Cavendish, 9.4-11 days on Lakatan and
11.6-15.8 days on Cardaba.

Mycelial Growth and Sporulation of P.
musarum Using Different Culture

Results show a similar growth response of
the three isolates to the different culture
media (Table 1, Fig. 2). Optimum growth
for the three isolates was observed in V-8
medium attaining an average radial growth
diameter of 38.71 mm, 35.35 mm and 34.24
mm for Cardaba, Lakatan and Cavendish,
respectively. Least radial growth on the
other hand, was observed when the isolates







Mycelial growth and sporulation 5


were grown in Banana decoction agar.
Modification of the V-8 medium by the
addition of banana decoction did not
enhance the growth of all isolates rather it
resulted to a smaller radial colony diameter
for all three isolates. The addition of banana
decoction could have diluted the nutrients
present in the V-8 juice resulting to a lower
concentration of these nutrients in the
Modified V-8 medium.
The same trend for growth rate was
observed in the three isolates grown in the
different culture media (Table 2). The
Cardaba isolate showed the highest growth
rate followed by Lakatan and Cavendish
when grown in the V-8 and Modified V-8
media, respectively. However, growth of the
Cardaba isolate was slower than the
Lakatan isolate when grown in the banana
decoction medium. Lowest growth rate
was observed in the Cavendish isolate
grown in banana decoction medium. The
slow growth can be attributed to the
absence of essential nutrients in this culture
medium that would support the optimum
growth of the freckle organism in vitro.
Sporulation was not observed in
cultures of the three isolates grown in the
different culture media under continuous
light after 41 days of incubation. This
agrees with previous findings that
continuous illumination with visible light was
inhibitory to spore differentiation of many
fungal species in culture (Turian, 1974).

Mycelial Growth and Sporulation of P.
musarum Using Different Media
and Light Duration

A varied response of the different isolates
to the combined effect of culture media and
light duration was observed (Table 3). For
the Cavendish isolate, optimum growth was
observed when grown in V-8 medium
regardless of the light duration treatment
except when grown under continuous
darkness. Radial growth was highest (31.86
mm and 31.38 mm) when subjected to 12 hr
light/12 hr dark and 8 hr light/16 hr dark,
respectively. Optimum growth however was
also observed when this isolate was grown


using the other two media but subjected to
specific light duration treatments. Growth
was not significantly different using modified
V-8 (29.00 mm) and banana decoction
(28.94 mm) when subjected to 8 hr light/16
hr dark and 16 hr light/8 hr dark,
respectively.
The Lakatan isolate showed a
similar response when grown using V-8
medium. Growth was optimum regardless
of the light duration treatment except when
the culture was subjected to continuous
darkness. Highest radial growth (29.63
mm) was, however, observed when the
isolate was grown in Banana decoction
medium and subjected to 16 hr light/8 hr
dark. Two other light duration treatments
gave optimum growth when the isolate was
grown in the same medium. These were 8
hr light/16 hr dark (28.38 mm) and 12 hr
light/12 hr dark (29.13 mm). Growth in the
Modified V-8 medium was also optimum
(29.50 mm and 28.44 mm) when the
cultures were subjected to 8 hr light/16 hr
dark and 16 hr light/8 hr dark, respectively.
Mycelial radial growth of the
Cardaba isolate was not significantly
affected by the different light duration
treatments when V-8 was used as culture
medium. Growth was optimum (29.50 mm)
when the culture was subjected to
continuous darkness. Growth was
significantly affected by the different light
duration treatments only when the isolate
was grown using the other two media.
Lowest radial growth (17.25 mm and 23.5
mm) was observed when subjected to
continuous darkness in both modified V-8
and Banana decoction medium,
respectively. However, optimum growth of
this isolate was also observed in both
media when subjected to 8 hr light/16 hr
dark.
For all isolates, sporulation was
significantly higher when the cultures were
subjected to 8 hr light/16 hr dark regardless
of the culture medium used (Table 4).
Highest sporulation was observed in
the Lakatan (140,840) and Cardaba
(145,920) isolates when V-8 was used as
culture medium but for Cavendish, cultures






6 Corcolon et al.


grown in Modified V-8 medium gave the
highest sporulation (83,294). The number of
conidia (67,620) however, was not
significantly higher when V-8 was used as
culture medium. Least sporulation was
observed when banana decoction was
used.
Growth rate was highest on
Cavendish isolate when subjected to 12 hr
light/12 hr dark followed by 16 hr light/8 hr
dark and 8 hr light/16 hr dark (Table 5). On
Cardaba and Lakatan isolates, highest
growth rates were observed on 16 hr light/ 8
hr dark exposures. For all isolates, growth
rates were lowest when exposed to either
continuous light or continuous dark.
On some necrotrophic pathogens,
induction of sporulation by light seems to
act only on asexual sporulation.
Phytophthora parasitica on papaya (Aragaki
and Hine, 1963), Helminthosporium
gramineum on barley (Houston and Oswald,
1946), Botrytis cinerea on geranium (Hyre,
1972) and Ascochyta pisi on peas (Rotem,
et al., 1978) require induction by light for
asexual sporulation in culture. With
Altemaria porn f sp. solani, sporulation in
culture is fully conditioned by previous
exposure to UV or sunlight (Rotem, 1978).
Sporulation in vitro is conditioned by
formation of nucleic acids or sporogenic
substances induced by irradiation (Turian,
1974).
Fig. 3 and 4 show the conidia of P.
musarum from freckle-infected leaves and
conidial formation from pure culture on V-8
medium exposed to 8 hr light/16 hr dark of
Cavendish Lakatan and Cardaba,
respectively.

Growth and Sporulation of P. musarum
Cavendish Isolate on Modified V-8
Medium

On Modified V-8 medium, longer light
exposures of 16 hr light/8 hr dark and 12 hr
light/12 hr dark proved to be favorable for
the growth of P. musarum (Table 6) with
26.25 mm and 26.81 mm radial growth
diameter, respectively. Exposure of the
Cavendish isolate to continuous light and
continuous darkness inhibited its growth in
vitro. However, sporulation of this isolate


was favored when exposed to 8 hr light/16
hr dark.
Highest sporulation was observed in
this light duration treatment with 79,040
spores followed by 16 hr light/8 hr darkness
with 67,325 spores. Sporulation on both
treatments was not significantly different.
The radial growth rate (Table 7) was
observed to be faster when the isolate was
exposed under 12 hr light/12 hr darkness.
The addition of banana decoction on the V-
8 medium combined with the right light
duration exposure proved to be the suitable
culture conditions for the isolation of
Cavendish isolate of P. musarum. In some
fungal species, the addition of leaf extracts
on the culture medium could substitute for
the induction of sporulation by light (Binder
and Lilly, 1975). In the present study, the
combined effect of light and V-8 plus
banana decoction on the growth and
sporulation of P. musarum was
demonstrated.
The Cavendish isolate established
in vitro produced small ovate to elongated
and rounded conidia. Immature conidia
were hyaline while the mature conidia are
blackish. Conidia from infected leaf samples
measured 5.1 x 4.9 u. Measurements made
on the conidia from pure culture had
average dimension of 4.2 x 4.8 u. For
comparison, conidia from Lakatan and
Cardaba infected leaf samples and from
pure culture were measured. Cardaba
conidia from pure culture and infected leaf
measured 6.1 x 5.3 u and 5.1 x 4.9 u,
respectively. On the other hand, Lakatan
conidia measured 4.8 x 4.7 u and 5.0 x 4.6
u for pure culture and infected leaf,
respectively. Ocfemia (1927) reported that
conidia dimension based on his
measurements were 8.5 20 u x 6.8 11
u. The conidia from Chuang's (1981)
Cavendish isolate measured 10-22 um x 6
-13 um. Conidiogenous cells measured by
Carpenter (1919) had dimensions of 4-11
um x 2.5-5.0 um.
Various culture media were tested to
establish a suitable growth medium P.
musarum and the optimum conditions
favorable for its growth and sporulation. The
most suitable medium was identified and
was used to establish pure cultures.






Mycelial growth and sporulation 7


The addition of banana decoction to
the V-8 medium did not enhance the growth
of Cardaba, Cavendish and Lacatan P.
musarum isolates when grown under
continuous light conditions. The growth of
Lakatan and Cavendish isolates in V-8
medium was greatly favored when exposed
under varying light durations. However,
under continuous darkness growth of these
isolates was not enhanced.
The suitable medium and growth
conditions identified for the Cavendish
isolate was Modified V-8 medium exposed
to 8 hr light and 16 hr darkness. Both
growth and sporulation of the freckle
organism were favored using this medium
and light duration. For the Lakatan and
Cardaba isolates, V-8 medium could
support growth and sporulation of P.
musarum when exposed to the same light
duration.

LITERATURE CITED

ARAGAKI, M and RB HINE. 1963. Effect of
radiation on sporangial production
of Phytophthora parasitica on
artificial media and detached papaya
fruit. Phytopathology 53:854-856.

BINDER, FL and VG LILLY. 1975.
Substitution of the radiation
requirement for sporulation by host
tissue in Dendrophoma obscurans.
Mycologia 67:1025-1031.

CARPENTER, CW. 1919. Banana freckle or
black spot disease. Rep. Hawaii
Agric. Exp. Sta. pp 36-40.

CHUANG, TY. 1981. Isolation of
Phyllostictina musarum, causal
organism of banana freckle. Trans.
Brit. Mycol. Soc. 77:670-671.


HOUSTON, BR and JW.
The effect of light
on conidium


Helminthosporium gramineum in
culture. Phytopathology 36:1049-
1055.

HYRE, RA. 1972. Effect of temperature and
light on colonization and sporulation of
the Botrytis pathogen on geranium.
Plant Dis. Reptr. 56:126-130.

JONES, DR. 2000. Freckle, pp.120-125. In:
JONES DR. (Ed.). Disease of
Banana, Abaca and Enset. CABI
Publishing, CAB International,
Wallingford, UK. 544 pp.

MEREDITH, DS. 1968. Freckle disease of
banana in Hawaii caused by
Phyllostictina musarum (Cke) Petr.
Ann. Appl. Biol. 62:329-340.

OCFEMIA, GO. 1927. Macrophoma musae
(Cke) Berl. and Vogl. and Phoma
musae Carpenter. Philipp. Agric. 15:
467-469.

REINKING, OA. 1926. Banana freckle and
leaf spot. Mycologia 18:185-186.

ROTEM, J, Y COHEN and E BASHI. 1978.
Host and environmental influences on
sporulation in vivo. Annu. Rev.
Phytopathol. 16:83-101.

TURIAN, G. 1974. Sporogenesis in fungi.
Annu. Rev. Phytopathol. 12:129-137.

WARDLAW, CW, 1972. Freckle or black
spot disease, pp. 711-713. In:
WARDLAW, CW. (Ed.) Banana
Diseases Including Plantain and
Abaca. 2nd Ed. Longman Group Ltd.
Green, London, UK. 878pp.


OSWALD. 1946.
and temperature
production by






8 Corcolon et al.


Table 1. Mycelial radial growth diameter (mm) of three banana isolates grown in three
culture media1


BANANA ISOLATE

Cavendish

Lakatan


V-8

34.24bc

35.35ab


RADIAL GROWTH

Modified V-8

29.96Cde

30.84cde


Banana Decoction

25.11'

29.42de


Cardaba 38.71a 33.13bcd 26.56e'

% CV = 9.33
'Average of four replicates.
Means having common letter are not significant at 5% level of significance using Fisher's
least significant-difference.








Table 2. Simple linear regression on mycelial radial growth of different Phyllosticta musarum isolates grown in three culture
media

BANANA ISOLATE CULTURE MEDIUM MODEL R R SQUARE

V-8 Y = -0.30 + 100.64X 0.9609 0.9233
Cavendish Modified V-8 Y = -0.36 + 100.96X 0.9303 0.8654
Banana Decoction Y = -0.23 + 100.61X 0.9556 0.9131
V-8 Y = -0.82 + 102.25X 0.9577 0.9172
Cardaba Modified V-8 Y = -0.63 + 101.89X 0.9389 0.8816
Banana Decoction Y = -0.33 + 101.09X 0.9724 0.9456
V-8 Y = -0.41 + 100.64X 0.8669 0.7514
Lakatan Modified V-8 Y = -0.62 + 101.93X 0.8901 0.7922
Banana Decoction Y = -0.40 + 101.22X 0.9640 0.9294












Table 3. Mycelial radial growth (mm) of three banana isolates grown in three culture media and various light duration after 32
days of incubation1


RADIAL GROWTH2


LIGHT DURATION V-8 Agar Modified V-8 Banana Decoction
Banana isolate Banana isolate Banana isolate


Cavendish Lakatan Cardaba Cavendish Lakatan Cardaba Cavendish Lakatan Cardaba


Continuous Light 30.11ab 28.56 a-f 29.50 a-d 23.40- 23.00-m 27.3 b-g 27.13 b-h 26.50 b-k 27.63 b-g
1
16 hours Light / 8 hours 29.65 abc 28.25 a-f 28.25 a-f 25.88 d-k 28.44 af 27.3 b-g 28.94 a-f 29.63 abc 25.75 e-k
Dark 1
8 hours Light /16 hours 31.38 a 28.88 a-f 28.50 a-f 29.00 a-f 29.50 a-d29.0 a-e 24.13 29.38 a-e 28.25 a-
Dark 6
12 hours Light / 12 hours 31.86 a 28.88 a-f 28.63 a-f 26.13 c-k 26.65 b-j 24.4 g- 27.63 b-g 29.13 a-e 27.63 b-g
Dark 4
Continuous Dark 27.00 b-i 22.88 klm 29.50 a-d 25.38 f-k 20.56 mn 17.2 n 21.25 Im 26.13 c-k 23.50 h-m
5
% CV = 9.68
1Average of four replicates
2Means having common letter are not significant at 5% level of significance using Fisher's least-significant-difference.


o
0
0








Table 4. Number of spores of three banana isolates grown in three culture media and various light duration after 32 days of
incubation1


LIGHT DURATION


V-8 Agar


CULTURE MEDIUM2

Modified V-8


Banana Decoction


Banana isolate Banana isolate Banana isolate
Cavendish Lakatan Cardaba Cavendish Lakatan Cardaba Cavendish Lakatan Cardaba
d-
Continuous Light 29269 d-j 34654 .h 20500 e-j 29077 d-j 22392 d-j 7435 J 17140 e' 14950 f-j 15060 'j
16 hours Light/8 hours 21480 d-j 22720 d- 40375 de 37000 g 25240 d-j 45400 cd 12141 hi 13301 g 9872 'i
Dark
8 hours Light/16 hours 67620 bc 14084 a 14592 a 83294 b 83966 70319 b 15090 f 15420 f' 27800 d-
Dark 0 0
12 hours Light /12 hours 33767 d-i 26467 d.j 28034 d- 26692 -j 26462 d- 9692 ij 7770 11340 hij 8970
Dark
de
Continuous Light 38240 f 24101 d- 22351 d-j 16370 e-j 23200 d-j 26200 -'j 13200 -j 21600 dj 16800 e
% CV = 37.66
1Average of four replicates
2Means having common letter are not significant at 5% level of significance using Fisher's least-significant-difference.










Table 5. Simple linear regression on radial growth of the different Phyllosticta musarum isolates grown under varying light duration


CULTIVAR TREATMENT MODEL R R SQUARE
Continuous Light Y= -0.04 + 99.79x 0.9863 0.9728
16 hours Light / 8 hours Dark Y= -0.22 + 98.51x 0.9663 0.9338
Cavendish 8 hours Light /16 hours Dark Y= -0.23 + 100.99x 0.9685 0.9380
12 hours Light /12 hours Dark Y= -0.05 + 99.34x 0.9807 0.9617
Continuous Dark Y= -0.02 + 99.91x 0.9562 0.9143
Continuous Light Y= -0.13 + 100.30x 0.9844 0.9690
16 hours Light/ 8 hours Dark Y= -0.004 + 99.56x 0.9859 0.9720
Cardaba 8 hours Light /16 hours Dark Y= -0.28 + 101.14x 0.9771 0.9545
12 hours Light /12 hours Dark Y= -0.13 + 200.29x 0.9857 0.9717
Continuous Dark Y= -0.43 + 99.83x 0.9731 0.9469
Continuous Light Y= -0.05 + 99.14x 0.9967 0.9934
16 hours Light / 8 hours Dark Y= -0.07 + 99.95x 0.9894 0.9781
Lakatan 8 hours Light /16 hours Dark Y= -0.25 + 100.91x 0.9899 0.9798
12 hours Light / 12 hours Dark Y= -0.04 + 99.32x 0.9837 0.9677
Continuous Dark Y= -0.36 + 97.31x 0.9664 0.9339







Mycelial growth and sporulation 1J


Table 6. Mycelial radial growth and number of spores of Cavendish isolate grown in Modified
V-8 medium at different light duration1


LIGHT DURATION RADIAL GROWTH TOTAL NUMBER OF SPORES
(mm)


Continuous Light 17.38 b 18860 b

16 hours Light/8 hours Dark 26.25 a 67325 a

8 hours Light/16 hours Dark 24.36 a 79040 a

12 hours Light/12 hours Dark 26.61a 20940 b

Continuous Dark 19.25 b 29438 b
% CV 8.45 16.02
1Average of four replicates.
Means having common letter are not significantly different at 5% level of significance using
Fisher's least significant-difference.





Table 7. Simple linear regression on mycelial radial growth (mm) of Cavendish isolate grown in
Modified V-8 medium under varying light duration


LIGHT CONDITION


Continuous Light

16 hours Light/8 hours Dark

8 hours Light/16 hours Dark

12 hours Light/12 hours Dark

Continuous Dark


MODEL R

L=-2.4983 + 0.0353 *Days 0.7920

L=-2.5530 + 0.0565*Days 0.9648

L=-2.6253 + 0.0540*Days 0.9817

L=-2.6436 + 0.0610*Days 0.9202

L=-2.6947 + 0.0495*Days 0.8968

Logit (L) = Ln[Y/(1-Y)] = Ln[Y/(!-Yo)] + rLt
Radial; Growth (Y)


R S UARE


0.6273

0.9309

0.9638

0.8468

0.8042







Mycelial growth and sporulation 14


CAVENDISH CARDABA LAKATAN

Figure 1. Banana isolates grown in V-8 culture medium after a 30-day
incubation period.










CARDABA





LAKATAN


CAVENDISH


V-8 MODIFIED V-8 BANANA DECOCTION

Figure 2. Growth of three banana isolates on different culture media after
a 41-day incubation period.






15 Corcolon et al.


i


i~.


4 ll~


Figure 3. Conidia of Phyllosticta musarum from freckle-infected Cavendish (a),
Lakatan (b) and Cardaba (c) leaf (100x).


Figure 4. Conidial formation from pure culture of Phyllosticta musarum Cavendish
(a), Lakatan (b) and Cardaba (c) isolates grown in V-8 medium exposed
to 8 hour Light/16 hour Dark.







Journal of Tropical Plant Pathology 41:16-28


SURVEY ISOLATION AND IDENTIFICATION OF TWO MAJOR
VIRUSES CAUSING THE SWEETPOTATO VIRUS DISEASE
(SPVD) COMPLEX IN THE PHILIPPINES


L.M. DOLORES and M.G.N. YEBRON, JR.


Supported by the Philippine Council for Agriculture Forestry and Natural Resources
Research and Development (PCARRD) and Intemational Service for the Acquisition of Agri-
Biotech Applications (ISAAA).

University Researcher and Graduate Assistant, respectively, Institute of Plant
Breeding, College of Agriculture, University of the Philippines Los Baios, College Laguna,
Philippines 4031.


ABSTRACT

A total of 32 sweetpotato virus isolates obtained from different sweetpotato
growing areas of the country were successfully established in the
screenhouse of the Institute of Plant Breeding, UP Los Bafos (UPLB). At
least three viruses were detected namely, Sweet Potato Feathery Mottle
Virus (SPFMV), Sweetpotato Chlorotic Stunt Virus (SPCSV), and
Sweetpotato Chlorotic Flecks Virus (SPCFV) with SPFMV as the most
prevalent followed by the SPFMV SPCSV mixtures. Mixtures of the three
viruses (SPFMV-SPCSV-SPCFV) were also detected with 15.6% incidence.
Each of the viruses was obtained via transmission to Ipomoea setosa using
specific vectors. SPFMV was transmitted using aphids (Aphis gossypii)
while the SPCSV was separated from the Sweetpotato Virus Disease
(SPVD) 'kulot" complex via whiteflies (Bemisia tabaci). Varied symptoms of
mottle, vein clearing, feathering and leaf distortion were observed on each
Ipomoea setosa or I. nil inoculated with the various isolates of SPFMV.
Five different strains caused different reactions to Chenopodium species.
In Chenopodium murale Nagbunga and Sapang developed the local lesion
reactions while these symptoms were not observed on this plant
inoculated with Saysain apd Binukawan isolates. On the other hand, only
the Tranca isolate induced chlorotic local lesion to C. amaranticolor.
SPCSV caused yellowin"'and leaf curl symptoms to L nil and I. setosa only
but none to other Chenopodium species. Both SPFMV and SPCSV were
successfully purified and exhibited a distinct to diffused bands in a CsCI
density gradient layer. Electron micrographs of both the partially purified
SPFMV and SPCSV preparations revealed the flexuous rods particles
expected of a typical poty and closterovirus, respectively. Reverse
Transcription- Polymerase Chain Reaction (RT-PCR) amplification of both
viruses also obtained the expected DNA fragments using the specific
primers for detecting these viruses.

Keywords: virus strains, enzyme-linked immunosorbent assay, sweetpotato virus disease
complex, sweetpotato






Dolores and Yebron 17


INTRODUCTION

Sweetpotato (Ipomoea batatas L) is an
important cash crop in the Philippines
occupying about 120,531 ha of the country's
agricultural land (BAS, 2004). In addition to
its traditional food use in marginal areas of
the country, the crop is emerging as an
industrial crop for value added foods like
noodles, feeds and starch products.
Sweetpotato provides household food
security because it stores well in the soil as
a famine reserve crop and performs well in
marginal soil. Thus, the low level of
agricultural inputs requirement, high
productivity per unit area, good nutritional
value and increasing demand for food
makes sweetpotato an ideal staple crop for
food security in subsistence economics
(Mukasa, 2003). However, production is
greatly hampered by pests and diseases
particularly viruses causing yield reductions
of up to 80% (Villegas et a/., 1996).
Sweetpotato Feathery Mottle Virus
(SPFMV) was detected as early as 1990
(Nazarea et al., 1990) using Enzyme-Linked
Immunosorbent Assay (ELISA). Villegas et
al. (1996) isolated SPFMV from the
sweetpotato virus disease complex known
locally as "kulot". The word "kulot" is a local
term that connotes severe curling symptom.
The disease has been noted in almost all of
the sweet potato growing areas of Central
Luzon region including Pampanga, Bataan,
Tarlac and Zambales. Jayasinghe and
Laranang (1996) have detected about
seven viruses by nitrocellulose membrane
(NCM) ELISA with SPFMV and the SPCSV-
SPFMV combined infection being the most
prevalent.
Several strains have already been
characterized, the common ones included the
Russet Crack, the Ordinary, the East African
and the Common strain group (Kreuze et al.,
2000). Souto et al. (2003) have identified 2
SPFMV strains, the Russet Crack (RC) and
the Common strain (C) from the US infected
sweet potato clones. Chavi et al. (1997) on
the other hand, reported a distinct strain of
SPFMV from Zimbabwe's sweetpotato clone


based on its nucleotide sequence data.
SPFMV is frequently identified as a
component of synergistic complex of
sweetpotato viruses mostly with whitefly
closterovirus (Chavi et al., 1997).
Sweetpotato Chlorotic Stunt Virus (SPCSV) is
the whitefly transmitted component of the
SPVD (Shaefers and Terry, 1976) first
described in Nigeria with very narrow host
range confined only to Convolvulaceae and
Solanaceae. This phloem restricted virus is
not mechanically transmitted. The synergistic
effect of SPFMV and SPCSV has been
reported (Gibson et al., 1998; Karyieja et al.,
2000) and the latest findings imply that
SPCSV enhances the replication of SPFMV
even in tissues that normally are not invaded
by the virus (Karyeija et al., 2000). Several
viruses have been found associated with the
sweetpotato vines having "kulot" or severe
leaf curl syndrome (Jayasinghe and
Laranang, 1996), however this virus disease
syndrome problem has not been sufficiently
characterized.

MATERIALS AND METHODS

Survey, Collection and Detection

Sweetpotato vines exhibiting virus and virus-
like symptoms were collected from different
sweetpotato growing areas of the country
including Laguna, Cavite, Central Luzon
Region, Bicol, Leyte and Bukidnon. Each of
vine cuttings was replanted in pots,
maintained in the greenhouse and were used
for virus detection and source of virus for
isolation. Symptoms were recorded and the
plants properly labeled. For virus detection,
the NCM ELISA test was utilized to identify
the specific viruses present in the plants. The
NCM ELISA kit was kindly provided by CIP
Peru and included antibodies from eight
viruses namely, Sweet Potato Feathery Mottle
Virus (SPFMV), Sweet Potato Chlorotic Stunt
Virus (SPCSV), Sweet Potato Mild Mottle
Virus (SPMMV), Sweet Potato Mild Speckling
Virus (SPMSV), Sweet Potato Latent Virus
(SwLV) C6 and Sweet Potato Caulimo like
Virus (SPCaMV).






18 Survey, isolation and identification


Isolation and Transmission

Each virus was isolated by mechanical or
insect transmission tests. Aphids (Aphis
gossypii) were used to separate SPFMV
from SPCSV while the SPCSV isolate was
transmitted by whitefly (Bemisia tabaci).
Each of the pure viruses was obtained
through a series of inoculations to
diagnostic hosts Ipomoea setosa/l. nil and
propagated in I. nil.

Host Range and Symptomatology

The different host plant species belonging to
Chenopodiaceae, Cucurbitaceae,
Solanaceae and Convulvulaceae were used
in this study. Each of the pure cultures of
the different virus isolates was inoculated
into the full-expanded seedlings of each
host plant species via mechanical
(SPFMV) or whitefly transmission (SPCSV).
Symptoms observed were recorded and
confirmed by NCM ELISA.

Virus Purification

Virus purification for SPFMV and SPCSV
was done following the protocol of Cohen et
al. (1988) with some modifications. The
purified virus preparation was obtained by
clarification in Borate buffer extracts using
chloroform and N-butanol (1g/10ml)
followed by differential centrifugation. The
partially purified virus was layered onto
CsCI gradient (0,10%,20%,30%,40%) in
20% sucrose borate buffer, after which
bands were collected, diluted and again
subjected to high speed centrifugation
(25,000 rpm for 5 hr) in 2 cycles.
For SPCSV purification, Nagbunga
and Saysain isolates were utilized to
inoculate I. nil. After 2 weeks of whitefly
inoculation, I. nil with symptoms such as
yellowing, stunting and vein clearing was
screened by NCM ELISA. Result showed
that only SPCSV was present.
Symptomatic leaves were
homogenized in 0.5 M borate buffer then
filtered through cheesecloth. Chloroform
(100 ml per 100 g sample) and butanol


(8%) were added and stirred for 3 min.
The mixture was centrifuged at 8,000 rpm
for 15 min. The aqueous layer was
collected and filtered through Kimwipes.
Triton X-100 was added dropwise to a final
concentration of 1%, and then stirred slowly
for 30 min at 4C. Fifty ml of sample was
layered on top of 20 ml sucrose cushion
then centrifuged for 6 hr at 12,000 rpm.
The pellet was collected, resuspended in 2
ml 0.05 borate buffer and left overnight at
4C. The suspensions were combined,
brought to 11 ml then 5.5 ml was layered
on each of two cesium chloride step
gradients (10, 20, 30, and 40% CsCi in
20% sucrose in 0.05 borate buffer). A thick
and very distinct light-absorbing band was
observed. This band was collected then
centrifuged at 20,000 rpm for 2 hr (2 cycles)
to remove unwanted materials. Purified
virus suspension of both SPFMV and
SPCSV were examined for the presence of
virus particles under an electron
microscope. at the National Institute of
Molecular Biology and Biotechnology
(BIOTECH), University of the Philippine Los
Baios (UPLB).

RNA Extraction

Total RNA was extracted from 100 mg of
symptomatic leaves of infected /. nil using
Trizol (Gibco, BRL Life Technologies,
England). Briefly, tissue was ground to a
fine powder in liquid nitrogen and
homogenized in 1.0 ml of Trizol reagent and
20 pl mercaptoethanol. After vortexing for
15-20 sec, the homogenate was incubated
at 56C for 5 min then centrifuged at 4,000
rpm for 10 min. The aqueous phase was
collected and incubated at room
temperature for 2-3 min then centrifuged at
4,000 rpm at 4C for 15 min. The aqueous
phase was collected and 750 pl isopropanol
and salt mixture (0.8 M sodium citrate,1.2 M
sodium chloride) were added. Total RNA
was precipitated by centrifugation at 14,000
rpm at 4C for 10 min. The RNA pellet was
washed with 1.0 ml of 75% ethanol and
dissolved in 50 pl of diethyl pyrocarbonate







Dolores and Yebron 19


(DEPC) treated
Austin,Texas).
Messenger RN
purified by Oligotex-d
manufacturer's instruction
Inc. Chatsworth, CA).

RT PCR Amplification

Different sets of primer
CP coding regions were
coat protein genes of
isolates. Primers ICF
were derived from the
of SPFMV Ch2 (Colir
should give an amplific
bp. Another set of prirr
fragment of 1 kb was
the full length CP gene
strain (Okada et. al, 20
pairs for amplifying the
70 homologue (HSP70
was also used.
The first strand
synthesized using an
SPFMV having known t4
the 3' end of the g
synthesis was accomr
volume of PCR reaction
3.0 pl was the first stran
1.0 pl dNTP (10mM d
and dTTP), 0.25 pl of
reverse primers, 5 pl o
0.5 pl of Taq DNA pol
PCR water. PCR was
Eppendorf thermal cycle
conditions: for CP amp
denaturation at 950C fo
950C for 30 s, primer ai
1min and DNA synthes
(35 cycles). A final 5 mi
720C was performed al
cycles and a 4C hold te

RESULTS AND

Survey, Collection and

A total of 32 virus iso
different growing areas
Cavite, Laguna, Bicol,


water (Ambion, were successfully established in the
screenhouse. Symptoms of virus infections
JA (mRNA) was varied from typical mottling to vein clearing,
t according to feathering, yellowing, purpling and severe
n (Qiagen, Qiagen leaf curling (Fig. 1). At least three viruses
were detected using NCM ELISA which
include SPFMV, SPCSV and SPCFV. Of
these, 62.5% were mixtures of SPFMV and
SPCSV, while 15.6% were mixtures of the t
rs derived from the three viruses (SPFMV-SPCSV-SPCFV).
Used to amplify the Only 9.37% were singly infected with
the different virus SPFMV, while 3.12% with SPCSV single
FMV1 and ICFMV 2 infection. Sweet Potato Chlorotic Fleck
Scoat protein gene Virus (SPCFV) on the other hand, did not
let et al., 1998) that exist alone but with two other coinfecting
nation product of 400 SPFMV and SPCSV. SPFMV was the most
lers obtaining DNA predominant virus in both single and mixed
designed to amplify infections (Fig. 2). Plants with single
of SPFMV- severe infection exhibited mild symptoms than
01). Specific primer those with mixed infection. None of the 32
heat shock protein virus collections reacted positively to the
h) gene of SPCSV other sweetpotato virus antisera namely,
SPMMV, SPLV, C6, SPMSV and SPCaLV
DNA (cDNA) was indicating that these viruses are probably
oligo dT primer for not yet present in the areas surveyed.
o have poly-A tail at Expression of virus symptoms varied from
enome. The DNA field to field and even between symptomatic
)lished in a 50 pl plants in the same location (Jayasinghe and
mixtures as follows: Laranang, 1996).
d synthesis product, The status of virus research in
IATP, dCTP, dGTP sweetpotato has reported at least 19 viruses
each forward and present in sweetpotato (Moyer et al., 1980;
if 10x PCR buffers, Kreuze et al., 2002) but the most widespread
ymerase and 40 pl virus infecting sweetpotato and the only one
performed using an previously studied in detail is the SPFMV. In
ir with the following many cases infection of sweetpotato exhibit
lification; template mild or no symptom but the presence of more
r 4 min followed by than one virus in a plant intensifies the
nnealing at 56C for degree or severity of symptoms. In the case
is at 72 OC for 90 s of virus "kulot" syndrome, the disease
n elongation step at problem has been associated to the
t the end of the 35 presence of these three viruses, SPFMV,
mperature. SPCSV and SPCFV. Jayasinghe and
Laranang (1996) have detected seven
)ISCUSSION viruses from the "kulot" virus complex
through NCM ELISA. As these viruses have
I Virus Detection been involved in this virus disease complex,
further studies onstrains are needed to study
fates obtained from the pathology of the diseases.
of Central Luzon,
Leyte and Bukidnon






20 Survey, isolation and identification


Isolation, Transmission and Host Range
Study

The two most prevalent viruses, SPFMV
and SPCSV were isolated by aphid and
whitefly transmission, respectively to /.
setosa and I. nil. These two viruses were
easier to separate from the virus complex
because of distinct vectors that transmit the
specific viruses. SPFMV was transmitted to
I. setosa and /. nil using A. gossypii,
nonpersistently while SPCSV was
transmitted to L nil by Bemisia tabaci after a
24 hr acquisition and inoculation feeding
periods. Both viruses were also transmitted
by graft inoculations to healthy /. setosa
seedlings while only SPFMV was sap
transmissible to I. setosa. Each virus was
distinguished by the symptoms induced on
these hosts. SPFMV induced the typical
vein clearing as well as mottling or
feathering symptoms while SPCSV caused
yellowing, vein clearing and chlorosis
symptoms (Fig. 3). Both SPFMV and
SPCSV were maintained in /. setosa since
transmission of single viruses to
sweetpotato caused mild symptoms only.
The other virus, SPCFV, was transmitted by
mechanical inoculations to /. setosa, but
was however difficult to separate from
SPFMV which is also mechanically
transmissible. Hence, only the two most
important viruses were characterized in this
report (SPFMV and SPCSV).
For host range study, five different
SPFMV isolates were compared based on
reactions to different hosts. Only the
SPFMV Tranca isolate caused chlorotic
local lesions to both Chenopodium murale
and C. amaranticolor while the Nagbunga
and Sapang isolates elicited chlorotic local
lesions to C. murale only but none to other
Chenopodium species. The Saysain and
Binukawan isolates did not cause any
symptom to these host plants (Table 1). In
i. setosa, the Tranca isolate induced
chlorotic spots on inoculated leaves, with
typical vein clearing on first degree leaves
while succeeding younger leaves exhibited
distinct vein clearing symptoms which
disappeared after 2 weeks. The four other


isolates caused the typical vein clearing
symptoms/ on /. setosa. In /. nil, varied
symptoms of feathering, mild to severe
mottling, vein clearing and crinkling were
observed. The other host plants including
Datura metel, D. stramonium, Nicotiana
glutinosa and N. benthamiana did not react
to any of the virus isolates. The SPCSV
isolate on the other hand, caused chlorosis,
yellowing and vein clearing with some
curling on /. setosa and I. nil but did not
infect any of the Chenopodium species.
Many strains of SPFMV have been
isolated and characterized in different parts
of the world. The most commonly
characterized are the Russet Crack and the
Common (C) strains. Moyer et al. (1980)
differentiated the two strains based on
reactions to /. purpurea and Chenopodium
species. The Common (C) strain does not
infect both host plant species. In this study
only the three virus isolates (Tranca,
Sapang and Nagbunga) caused local
lesions to Chenopodium species but not
Saysain and Binukawan. However, only the
Tranca isolate was able to induce local
lesion reactions to C. amaranticolor but not
the other virus isolates. The SPCSV
(Saysain and Tranca) isolates also caused
no symptoms to any of the Chenopodium
species. All symptoms observed were
confirmed by NCM ELISA. An overall
assessment on the host range data may
suggest differences among virus isolates
based on their reactions to differential host
plants. Further studies on their genetic
variation would strongly distinguish
differences in strains of each of the viruses
hence backing up results on biological
characterization.

Virus Purification and Electron
Microscopy

The purified SPFMV (Tranca isolate)
showed a diffuse band in CsCI density
gradient layer (Fig. 4a) yields from different
purifications ranged from 9-13 mg/with an
uncorrected A260/A280 nm of around 1.2.
The partially purified virus suspensions
showed flexuous rods under the electron







Dolores and Yebron Z1


microscope typical of SPFMV potyvirus
(Fig. 4b). When mechanically inoculated to
/. setosa, the typical vein clearing
symptom was produced. The purified virus
suspension of SPFMV reacted positively
to the SPFMV antiserum only but not to
the other seven antisera for sweetpotato
viruses included in the kit.
For SPCSV, the purified virus
suspension exhibited a very distinct band
(Fig. 5a) in CsCI gradient. Under the
electron microscope, the partially purified
virus revealed long flexuous rods typical of
a closterovirus group (figure not shown).
Similarly purified SPCSV suspension
reacted positively only against the SPCSV
antiserum but negative to the other seven
virus antibodies previously mentioned in
the NCM ELISA kit. Subsequently, all the
purified virions were directly utilized in RT-
PCR amplification with the different sets of
primers.

RT- PCR Amplification

The two sets of primers derived from the
CP genes of SPFMV-CH (ICFMV-1 and
ICFMV-2) and SPFMV-S (VCP-5 and
VCP-7) yielded amplification products of
400 bp and 1 kb, respectively: The 400 bp
was obtained from total RNA of Tranca,
Nagbunga, Sapang, Saysain and
Binukawan isolates (Fig. 6) while the
expected 1kb fragment was obtained from
the purified virions of the isolates (Fig. 7).
Similarly, VCP-5NCP-7 primers amplified
a 1 kb fragment from mRNA of inoculated
I. nil and from desiccated infected tissues
of the different virus isolates (Fig. 8). DNA
fragments were not obtained when RT-
PCR was conducted on RNA extracts of
healthy I. nil.
The SPCSV purified virus was
directly used in RT-PCR which gave the
expected 600 bp DNA fragment using the
Non East African specific primer pairs
CL43-NEA (Ishak et. al., 2003) for
Closteroviruses (Fig. 5b).
This study provides important
information on the virus disease complex
making up the virus "kulot" (Villegas et al.,


1992; Jayasinghe and Laranang, 1996) or
the sweet potato virus disease complex
(SPVD) as identified by other researchers
(Karyeija et al., 2000). The three viruses
(SPFMV, SPCSV, SPCFV), which were
positively identified from the survey by
NCM ELISA are no less significant in
sweetpotato productivity. Further studies
on characterization of both SPFMV and
SPCSV should be conducted to
understand the underlying theory of
synergism between these two viruses. In
the case of SPCFV, very little information
is available (Tairo et al., 2004). While its
impact to the "virus kulot complex" or
SPVD has yet to be realized, an
understanding on its etiology and
epidemiology would be very vital in
addressing the virus disease complex in
the Philippines

LITERATURE CITED

BUREAU OF AGRICULTURAL
STATISTICS (BAS). 2004.
Department of Agriculture, UP
Diliman, Quezon City.

CHAVI, F, Al ROBERTSON and BJM
VERDUIN. 1997. Survey and
characterization of viruses in
Sweetpotato from Zimbabwe.
Plant Dis. 81: 1105-1112

COHEN, J, R SOLOMON and G
LOBSTEIN. 1988. An improved
method for purification of
sweetpotato feathery mottle virus
directly from sweetpotato.
Phytopathology 78: 809-811.

COLINET, D, M NGUYEN, J KUMMERT
and P NEPOIVRE 1998.
Differentiation among potyviruses
infecting sweetpotato based on
genus specific reverse
transcription polymerase chain
reaction. Plant Dis. 82: 223-229.

GIBSON, RW, I MPEMBE, T ALICAI, EE
CAREY, ROM MWANGA, SE







22 Survey, isolation and identification


SEAL and HJ VETTEN. 1998.
Symptoms, etiology and serological
analysis of sweet potato virus
disease in Uganda. Plant Pathology
47:95-102.

ISHAK, JA, JF KREUZE, A JOHANSSON,
SB MUKASA, F TAIRO, FM EL-
ABBAS and JPT VALKONEN. 2003.
Some molecular characteristics of
three viruses from SPVD-affected
sweet potato plants in Egypt. Arch.
Viro. 148:2449-2460.

JAYASINGHE, U and LB LARANANG.
1996. Etiology of "Camote Kulot"
disease in Central Luzon,
Philippines. In: UPWARD Fieldnotes
Vol. 8(1):1999, 7-9p.

KARYEIJA, RF, JF KREUZE, RW GIBSON
and JPT VALKONEN. 2000. Two
serotypes of sweetpotato feathery
mottle virus in Uganda and their
interaction with resistance
sweetpotato cultivars.
Phytopathology 90:1250-1255.

KREUZE, JF, RF KARYEIJA, RW GIBSON
and JPT VALKONEN. 2000.
Comparisons of coat protein gene
sequences show that East African
isolates of sweetpotato feathery
mottle virus form a genetically
distinct group. Arch. Virol. 145:567-
574.

MOYER, J W, BB COLI, GG KENNEDY and
MF ABOU-GHADIER. 1980.
Identification of two sweetpotato
feathery mottle virus strains in North
Carolina. Plant Dis. 64:762-764.

MUKASA, SB, F TAIRO, JF KREUZE, A
KULLAYA, PR RUBAIHAYO and
JPT VALKONEN. 2003. Coat
protein sequence analysis reveals
occurrence of new strains of
sweetpotato Feathery Mottle Virus in


Uganda and Tanzania. Virus Genes
27(1):49-56.

NAZAREA, AP 1990. Detection of sweet
potato feathery mottle virus
(SPFMV) in sweet potato (Ipomoea
batatas) using indirect-enzyme
linked immunosorbent assay
(ELISA). Special Problem. UPLB-
CAS 17p.

OKADA, Y, A SAITO, M NISHIGUCHI, T
KIMURA, M MORI, K HANADA, J
SAKAI, C MIYAZAKI, Y MATSUDA
and T MURATA. 2001. Virus
resistance in transgenic sweet potato
[Ipomoea batatas L. (Lam)]
expressing the coat protein gene of
sweet potato feathery mottle virus.
Theor Appl. Genet. 103:743-75.

SCHAEFERS, GA and ER TERRY. 1976.
Insect transmission of sweetpotato
disease agents in Nigeria. 66:642-645.

SOUTO, ER, J SIM, J CHEN, RA
VALVERDE and CA CLARK. 2003.
Properties of strains of Sweet potato
feathery mottle virus and two newly
recognized potyvirus infecting sweet
potato in the United States. Plant
Dis. 87:1226-1232.

TAIRO, F, A KULLAYA and JPT
VALKONEN. 2004. Incidence of
viruses infecting sweetpotato in
Tanzania. Plant Dis. 88:916-920

VILLEGAS, LC., 1992. Detection of sweet
potato feathery mottle virus in
Ipomoea batatas (L.) Lam.
Undergraduate Thesis. UPLB-CAS.
45p.

VILLEGAS, LC, GL PAMULAKLAKIN, EE
BADUYA and NB BAJET. 1996.
Sweet potato feathery mottle virus: its
association with "kamote kulot" and its
effect on sweet potato yield. Phil.
Phytopathology 32(1):35-40.







Dolores and Yebron 23


ACKNOWLEDGMENT


We are grateful to ISAAA and PCARRD for
funding this project. And we are also thankful
to Drs. Randy Hautea and Desiree Hautea for
their comments, suggestions and support to


the project and to Dr. Wojcieck Kaniewski for
his critic and valuable suggestions in writing
this paper.


Table 1. Reactions of some host species to mechanical inoculation with five sweetpotato
feathery mottle virus isolates


HOST SPECIES Tranca Nagbunga Sapang Saysain Binukawan

Chenopodium murale chl I chl sp chl sp
C. quinoa
C. amaranticolor chl I
Datura metel -
D. stramonium
Nicotiana glutinosa -
N. benthamiana
Ipomoea setosa chl sp. vc on vc, Id vc vc severe Id
10 leaf,no
symp on
succeeding
leaves
I. nil ch sp, vc iv, chl, fea dw Ic, vc crinkling vc
Sweet potato mild vc vc, symp vc vc vc
recovered


Legend:
chl I chlorotic local lesion
svc severe vein clearing
vc vein clearing
iv interveinal chlorosis
sp spot


fea feathering
Id leaf distortion
dw downward
Ic leaf curling









Z4 Survey, isolation and identification


Figure 1. Sweetpotato infected with Sweetpotato Virus Disease (SPVD)
showing (a) yellowing, (b) vein clearing, (c) purpling, (d)
crinkling and (e) leaf distortion and stunting.


70" ,*,


60 ,(' ,



50 0,'



0 40"( 0



30 0''



20 --0


SPFMV only SPCSV only SPCFV only


SPFMV SPCSV mix SPFMV SPCSV-
SPCFV mix


virus combination


Figure 2. Results of NCM ELISA for different sweetpotato virus isolates
and collections.







Dolores and Yebron Zb


b
















Stunt Virus (SPCTV) showing different symptoms. a) I.
setosa with vein clearing, b). i. setosa exhibiting leaf
distortion, c) 1. setosa with vein clearing, vein clearing and
chlorosis, d) i. nil exhibiting crinkling and leaf distortion.







26 Survey, isolation and identification


Figures 4. Purification of Sweet Potato Feathery Mottle Virus (4) Band of
purified SPFMV in Cesium Chloride gradient (5) electron
micrograph of purified SPFMV virions.




12345678













Figure 5. Purification and PCR amplification of SPCSV using non-East African
specific primers (Tranca and Saysain). (A) Band of purified SPCSV
(arrow). (B) Agarose gel electrophoresis of PCR products of SPCSV
heat-shock protein 70 homolog gene (Hsp70h) amplified using Non-
east African (NEA)-specific primers (lane 1-M; 2-3 Tranca; 4-5
Nagbunga; 6-7 Saysain; 8 control).


~;fZ~ ~
1. a ~ 1, rs







Dolores and Yebron 27


1 2 3 4 5 6 7


400 bp -


Figure 6. Agarose gel electrophoresis of RT-PCR products using primers
ICFMV1 and ICFMV2. Lane 1- 1 kb Plus DNA marker, lane 2- Tranca
isolate, lane 3 Nagbunga isolate, 4- Sapang isolate, 5- Saysain isolate,
6- Binukawan isolate, 7- ppH20.


1 2 3 4 5










1 kb


- ,

. . . . .. -J''. ,


Figure 7.. Agarose gel electrophoresis of RT-PCR amplification products of RNA
templates using VCP-5 and VCP-7 primers. Well: 1- 1 kb Plus DNA
marker; 2- Nagbunga isolate; 3- Sapang isolate; 4- Saysain isolate; 5-
Tranca isolate; 6- negative control.







28 Survey, isolation and identification


Plant from
growth
chamber
0 M


*3^I*


Dessicated
leaf
material



rd


lO00bp


Figure 8. 1kb DNA fragment from RT-PCR of mRNA from inoculated
Ipomoea nil and desiccated leaf tissues.






Journal of Tropical Plant Pathology 41:29-37


EFFICACY OF HYPOVIRULENT BINUCLEATE RHIZOCTONIA SP. IN
SUPPRESSING SHEATH BLIGHT PROGRESSION IN RICE


R. L. GALANG1, C.B. PASCUAL2 and A.L. LALAP3


Portion of the thesis for Master of Science Degree of the senior author at CLSU.

1Instructor and 3Professor, Central Luzon State University (CLSU), Science City of
Muioz, Nueva Ecija, Philippines and 2University Researcher, Institute of Plant Breeding,
College of Agriculture, University of the Philippines Los Bahos, College, Laguna.


ABSTRACT

The effect of hypovirulent binucleate Rhizoctonia sp. in suppressing the
development of sheath blight in rice was studied. The factors employed
were: Factor A- hybrid rice such as Mestizo, Rizalina 28 and Rizalina 38;
Factor B- Rhizoctonia inoculation such as untreated control, virulent
Rhizoctonia solani isolate only, Rhv7 (isolate name of hypovirulent
binucleate Rhizoctonia) only, simultaneous application of Rhv7 and
virulent isolate, virulent isolate 3 days after Rhv7 application and virulent
isolate 5 days after Rhv7 application with 3 replications using 3 x 6 factorial
experiment in a completely randomized design.

Application of Rhv7 on the test plants 5 days before challenge-
inoculation with the virulent strain resulted in the reduced disease
incidence, lower relative lesion length and significant increase in
protection from sheath blight. Onset of disease development was also
delayed significantly. However, treatment of Rhv7 on the test plants 3 days
before inoculation of virulent isolate lowered percentage disease severity
but this is comparable to 5 days application of Rhv7 before challenge
inoculation with R. solani.

Rizalina 28 and Rizalina 38 had longer incubation period and had
lower relative lesion length than Mestizo which subsequently led to a
significantly higher protection from sheath blight. Likewise, percentage
disease severity was lowered in these two hybrids. These two hybrids
produced higher grain yield per pot than Mestizo in all treatments. Grain
yield per pot was highest in Rhv7 treated pots 5 days before inoculation
with virulent isolate.


Keywords: sheath blight, rice, biocontrol, hypovirulent binucleate Rhizoctonia






30 Galang, Pascual and Lalap


INTRODUCTION

Sheath blight disease of rice caused by
Rhizoctonia solani Kuehn. is an increasing
concern for rice production systems. The
disease is considered to be the second most
important disease of rice next to blast (IRRI,
1993). In southern Philippines, Indonesia
and Vietnam, this disease is particularly
destructive where rice-corn rotation is
practiced (Sharma et al, 1993). In fact, sheath
blight is more severe in rotation system than
in continuous paddy fields (Kim et al., 1992).
Under natural condition, sheath blight
is usually observed when the rice crop
reaches its full vegetative growth. The
infection usually starts at the base near the
water level and progresses upward in the leaf
blade (IRRI, 1993). This soil borne fungus
survives as mycelia on crops like corn,
sorghum, mungbean, weeds and crop debris
between cropping seasons and as sclerotial
bodies in the soil.
A considerable amount of information
on the control of sheath blight has been
reported. Several chemicals have been
successfully used to suppress R. solani
(Grover and Kataria, 1985; Kataria et al.,
1991). However, use of these fungicides is
not economical and hazardous to
environment and health. An effort to
incorporate sheath blight resistance in
breeding program worldwide has been
hampered by the lack of sources of
resistance.
The agricultural sector is now facing
escalating problems on pests and diseases of
agricultural crops, and with 82 million
Filipinos to feed, it is imperative that a
multidisciplinary approach of solving this
problem area of agriculture be developed.
Production of rice, which is the staple food of
Filipinos and other Asian countries, must be
increased. Biotic stresses like that of sheath
blight disease must therefore be addressed.
This study would give farmers an alternative
measure of controlling the disease not relying
solely on chemical fungicides. Reports have


demonstrated that hypovirulent binucleate
Rhizoctonia suppressed the Rhizoctonia
solani infection through induced resistance
(Cardoso and Enchandi, 1987; Poromarto et
al., 1998; Pascual et al., 2004). Information
from this study would be useful in future
researches regarding the potentials of
hypovirulent Rhizoctonia sp. as a biocontrol
agent against diseases of important crops. In
this study, the efficacy of hypovirulent
binucleate Rhizoctonia isolate Rhv7 in
controlling sheath blight in rice was
investigated. The response of different rice
hybrids to Rhv7 was also examined at CLSU
screenhouse.

MATERIALS AND METHODS

Preparation of Hypovirulent Binucleate
Rhizoctonia and Virulent R. solani Isolates

Rhv7, an isolate of hypovirulent binucleate
Rhizoctonia sp. (BNR) which was obtained
from the Institute of Plant Breeding, UP Los
Bahos, and used in this study has been
reported to control banded leaf and sheath
blight in corn and Fusarium wilt in tomato
(Pascual et al, 2000; Pascual et al, 2004:
Muslim et al., 2002). A virulent isolate of
Rhizoctonia solani belonging to AG1-IA
which was isolated from infected rice plant
was challenged by Rhv7.

Planting of Test Plants and Experimental
Design

A 3 x 6 factorial experiment arranged in a
Completely Randomized Design with three
replications was conducted using three rice
hybrids (Mestizo, Rizalina 28 and Rizalina
38), which were treated at 26-31 days after
transplanting or panicle initiation stage, as
Factor A and six inoculation treatments
(untreated control, virulent isolate of R. solani
only, Rhv7 only, simultaneous inoculation of
virulent R. solani and Rhv7, virulent R. solani
isolate inoculation 3 days after Rhv7
application on the test plants, virulent R.






Efficacy of hypovirulent binucleate 31


solani isolate inoculation 5 days after Rhv7
treatment) as Factor B. Four rice seedlings
transplanted in 3-gallon size plastic pail (used
as pot) were prepared per replication.
Fertilizer application was done at
transplanting at the rate of 120-60-60 kg of
NPK per ha. Plants were watered everyday in
the screenhouse.

Inoculation

Both Rhv7 and virulent R. solani isolates
grown on sterile sugarcane leaves were
inoculated following the procedure of Pascual
et al. (2004) with some modifications. Five
grams of 30-day old culture of hypovirulent
BNR Rhv7 in sugarcane substrate was
inoculated at the center of the basal portion
of rice tillers above the water level at 26 days
after transplanting following the assigned
treatments. Based on the aforementioned
treatment scheme, 5 g substrate with virulent
isolate of R. solani was likewise inoculated on
the test plants at the site where Rhv7 was
previously inoculated. High relative humidity
was maintained after inoculation by misting
the plants.
The following data were gathered to
determine the effect of the different
treatments:
1. Incubation period (days) the time
from inoculation to appearance of
symptoms.
2. Percent disease incidence sheath
blight incidence expressed in
percentage recorded at 30 days after
inoculation
3. Percent protection = A-B/A x 100
where A = relative lesion length of rice
seedlings without Rhv7 or inoculated
with virulent R. solani alone, B =
relative lesion length of rice seedlings
with Rhv7
4. Relative lesion length = (lesion length/
plant height) x 100, which was taken
from 16 tillers per pail (four tillers per
plant) randomly selected and


gathered at 10, 20 and 30 days after
inoculation
5. Yield
a. Total grain weight (g) from
each pot
b. Computed grain yield (ton/ha)
was calculated per replicate

Yield = (Ave. wt of grain/ plant)
(expected population/ha)(100-
MC/86) divided by 1000

Data Analysis

Analysis of variance was done using
Statistical Analysis System. Significant effects
were subjected to contrasts using Duncan's
Multiple Range Test (p = 0.05).

RESULTS AND DISCUSSION

Effect of Rhv7 on Different Parameters of
Disease Resistance

Incubation period. Test plants
challenge-inoculated with virulent R. solani
isolate 5 days after Rhv7 application showed
the longest incubation period of 4.3 days
among the treatments (Table 1). Treatment
with virulent R. solani isolate only had the
shortest incubation period (2.9 days) while the
untreated control and Rhv7 only did not
produce disease symptom. This finding
conformed with the result of Pascual et al.
(2000) where the report clearly indicated that
resistance was induced in the plant treated
with hypovirulent binucleate Rhizoctonia sp.
Among the rice hybrids, Rizalina 38
and Rizalina 28 had significantly longer
incubation period (5 and 4.6 days,
respectively) than Mestizol (2.3 days) which
suggest that Mestizo 1 was penetrated faster
by the pathogen than the other two hybrids.
Rizalina 38 had thicker and sturdier stems
than Mestizo 1. Agrios (1997) stated that
thicker culms and sturdier stems in plants act
as a pre-existing structural defenses for






32 Galang, Pascual and Lalap


plants which could delay onset of the disease
and slow down disease development.

Percent disease incidence. Treatment of
Rhv7 application 5 days before inoculation of
virulent isolate produced the lowest %
disease incidence followed by 3 days
incubation of Rhv7 on the test plant before
virulent isolate inoculation (Table 2).
Simultaneous application of Rhv7 and virulent
isolate exhibited the lowest disease incidence
while control and Rhv7 inoculations did not
show disease symptom. On the response of
hybrids on sheath blight, Rizalina 38 had the
lowest disease incidence which was
comparable with Rizalina 28 but significantly
lower compared with Mestizo 1.
Based on the results, test plants
treated with the binucleate Rhizoctonia Rhv 7
before challenge-inoculation with virulent R.
solani isolate had lower sheath blight
incidence than test plants without Rhv7. This
finding was similar to that of Villajuan-Abgona
et al. (1996) who obtained significantly lower
disease incidence on cucumber seedlings
subjected to increased pre-incubation period
of the hypovirulent binucleate Rhizoctonia.

Percent Protection. Five days of Rhv7
pre-incubation before challenge-inoculation
with R. solani recorded the highest
percentage of sheath blight protection of
65.1, 59.5, and 61.9% at 10, 20 and 30 DAI,
respectively (Table 3). Simultaneous
application of Rhv7 and virulent strain
exhibited the lowest percentage of protection,
i.e. 19.4, 15.6 and 12.4% at 10, 20, and 30
days after inoculation, respectively. Similar
results were earlier observed. Pascual et al.
(2004) discovered that Rhv7 was effective in
controlling BLSB in corn and that the primary
mechanism in the control of banded leaf and
sheath blight by hypovirulent binucleate
Rhizoctonia was induced resistance. This
result was consistent with that of Sneh et al.
(1989) who claimed that pretreatment of
cotton seedlings with non-pathogenic


Rhizoctonia isolates provided good protection
against pre- and post emergence damping-off
caused by a virulent strain of R. solani (AG
4).
Among the three hybrids evaluated in
this study, Rizalina 28 and Rizalina 38
showed significantly higher percentage of
protection than Mestizo 1.

Grain Yield and Computed Yield

Grain yield per pot and the computed yield
(Table 4) were significantly influenced both by
Rhizoctonia inoculation and by the hybrids
used. The untreated control and the earlier
application of Rhv7 before inoculation of
virulent isolate recorded the highest yield per
hectare followed by other treatments with
Rhv7, which had higher grain yield than
treatment with virulent isolate only. As
explained by Sneh et al. (1986), the protective
isolates of non-pathogenic Rhizoctonia sp.
were capable of promoting plant growth and
increasing crop yields in the field. Likewise,
Harris et al. (1994) reported that several
isolates of Rhizoctonia sp not only protected
seedlings of Capsicum from damping-off
disease but also increased shoot weights.
Both Rizalina 28 and Rizalina 38
registered similar grain yield per pot (127.6 g)
which was significantly higher than the grain
yield per pot of Mestizo 1 (44.2 g). The
significantly very low grain yield per pot of
Mestizo 1 could be attributed to the infection
of the hybrid during late vegetative stage by
P. oryzae aside from the sheath blight
pathogen inoculated on the test plants. The
computed yield revealed that Rizalina 38
registered a yield of 8.4 tons/ha and Rizalina
28 had 8 tons/ha. This result conformed to the
findings of the Rice Varietal Improvement
Group (2002) which showed that Rizalina 38
and Rizalina 28 have yield advantages over
Mestizo 1 by 12.1% and 2.8%, respectively.
Results of the experiments in this
study clearly demonstrated that earlier
application of hypovirulent Rhizoctonia sp. on






Efficacy of hypovirulent binucleate 33


the test plants before inoculation of virulent
Rhizoctonia provided better protection
against sheath blight disease of rice and
higher computed yield per hectare than plants
without Rhv7. Among the hybrids tested,
Rizalina 38 showed the lowest disease
incidence, had the greatest protection and
highest yield.

LITERATURE CITED

AGRIOS, GN. 1997. Plant Pathology. 4th
edition Academic Press. P.83.

CARDOSO, JE and E ENCHANDI. 1987.
Nature of protection of bean seedlings
from Rhizoctonia root by a binucleate
Rhizoctonia-like fungus.
Phytopathology 77:1548-1551.

GROVER, RK and HR KATARIA. 1985.
Management of Rhizoctonia solani
diseases with chemicals. Proc. Indian
Acad. Sci. (Plant Sciences) 94: 415-
431.

HARRIS, AR, DA SCHISLER, SM NEATE
and MH RYDER. 1994. Suppression
of damping-off caused by Rhizoctonia
solani and growth promotion in
bedding plants by binucleate
Rhizoctonia sp. Soil Biol. Biochem.
26:263-268.

IRRI, 1993. Proceedings, Rice Sheath blight
Management Workshop, Hangzhou,
China. IRRI, Los Baios, Philippines.

KATARIA, HR., U HUGELSHOPER and U
GISI. 1991. Sensitivity of Rhizoctonia
species to different fungicides. Plant
Pathol. 40: 203-211.

KIM, CH, LY KIM and M THERUHISA. 1992.
Changes in pattern of disease
incidence on rice in paddy-upland
rotation system. Research Reports of
the Rural Development


Administration, Crop Protection 34(1):
1-5.

MUSLIM, A, H HORINOUCHI and M
HYAKUMACHI. 2003. Control of
Fusarium crown and root rot of tomato
with HBNR in soil and rock wool
systems. Plant Disease 87:739-747.

PASCUAL, CB, AD RAYMUNDO and M
HYAKUMACHI. 2000. Efficacy of
hypovirulent binucleate Rhizoctonia
sp. to control banded leaf and sheath
blight in corn. J. Gen. Plant Pathol.
66:95-102.

PASCUAL, CB, AD RAYMUNDO and M
HYAKUMACHI. 2004. Suppression of
Rhizoctonia solani in corn by
hypovirulent binucleate Rhizoctonia
and the nature of protection. Phil.
Agric. Sci. 87:36-40.

POROMARTO, SH, BD NELSON and TP
FREEMAN. 1998. Association of
binucleate Rhizoctonia with soybean
and mechanism of biocontrol of
Rhizoctonia solani. Phytopathology
88:1056-1067.

RICE VARIETAL IMPROVEMENT GROUP
REPORT. National Cooperative Test.
Tarlac College of Agriculture,
Camiling, Tarlac, April 29, 2002.

SHARMA, RC, C DE LEON and MM PAYAK.
1993. Diseases of maize in South and
South-East Asia: problems and
progress. Crop Prot. 12:414-422.

SNEH, B, M I-AUSTER and Z PLAUT. 1989.
Mechanism of seedling protection
induced by a hypovirulent isolate of
Rhizoctonia solani. Can. J. Bot.
67:2135-2141.

SNEH, B, M ZEIDAN, M I-AUSTER, I
BARASH and Y KOLTIN. 1986.






34 Galang, Pascual and Lalap


Increased growth responses induced
by a non-pathogenic Rhizoctonia
solani. Can. J. Bot. 64:2372-2378.

VILLAJUAN-ABGONA, R, K KAGEYAMA and
M HYAKUMACHI. 1996. Biocontrol of


Rhizoctonia damping-off of cucumber
by non-pathogenic binucleate
Rhizoctonia. Eur. J. Plant Pathol.
102:227-235.


Table 1. Incubation period (days) of Rhizoctonia solani AG1-IA causing rice sheath
blight as affected by Rhv7 inoculation treatments and rice hybrids


RHIZOCTONIA HYBRID MEAN
INOCULATION
Mestizo 1 Rizalina 28 Rizalina 38



Untreated control 0.0 f 0.0 f 0.0 f 0.0

Virulent Only 2.3e 3.3cd 3.0de 2.9d

Rhv7 Only 0.f0 0.0f 0.0' 0.0e

Simultaneous 3.0de 3.0Cd 4.0Cd 3.3c
application of
Rhv7 and virulent
R. solani

3 days Rhv7 pre- 3.3c 4.0bc 4.0bc 3.8b
incubation
+ virulent R. solani

5 days Rhv7 pre- 3.3Cd 4.6ab 5.0a 4.3a
incubation
+ virulent R. solani

MEAN 2.0' 2.5x 2.7x


Means in rows and columns with the same
level by DMRT.


letters are not significantly different at 5%






Efficacy of hypovirulent binucleate 35


Table 2. Percent sheath blight disease incidence on three rice hybrids with different
inoculation treatments of Rhv7 and virulent Rhizoctonia solani isolates


RHIZOCTONIA HYBRID MEAN
INOCULATION
Mestizo 1 Rizalina 28 Rizalina 38



Untreated control 0.0 0.0 0.0 0.Od

Virulent Only 98.7 86.7 95.3 93.6a

Rhv7 Only 0.0 0.0 0.0 0.Od

Simultaneous 91.7 82.7 83.7 86.0a
application of
Rhv7 and R. solani

3 days Rhv7 pre- 77.0 64.7 49.0 63.6b
incubation
+ virulent R. solani

5 days Rhv7 pre- 51.3 49.3 31.3 44.Oc
incubation
+ virulent R. solani

MEAN 53.1x 47.2xy 43.2 y

Means in rows and columns with the same letters are not significantly different at 5%
level by DMRT.











Table 3. Protection of three rice hybrids from virulent Rhizoctonia solani isolate under different treatments of Rhv7, a binucleate
hypovirulent Rhizoctonia sp., at three periods after inoculation of virulent R. solani

PERCENT PROTECTION AT DIFFERENT DAYS AFTER INOCULATION (DAI) of R. SOLANI
TREATMENT 10 DAI 20 DAI 30 DAI
Mestizo Rizalina Rizalina Mean Mestizo Rizalina Rizalina Mean Mestizo Rizalina Rizalina Mean
1 28 38 1 28 38 1 28 38
Simultaneous
application of 7.9 35.6 14.7 19.4c 10.7 22.3 13.8 15.6c 6.1 20.7 10.7 12.4c
Rhv7 and
virulent R.
so/ani

Virulent R.
solani 30.7 54.1 67.6 50.8b 23.3 46.6 67.3 45.7b 21.4 41.9 65.7 43.0b
inoculation 3
days after
Rhv7
application

Virulent R.
solani 48.4 70.0 76.9 65.1a 52.2 63.3 63.1 59.98 53.7 64.5 67.6 61.9a
inoculation 5
days after
Rhv7
application

MEAN 29.0' 53.2x 53.2x 28.7y 44.0x 48.1x 27.1y 42.8x 48.0x
Means in rows and columns with the same letters are not significantly different at 5% level by DMRT.






Efficacy of hypovirulent binucleate 37


Table 4. Grain yield (g/pot) and computed yield per hectare (tons) as influenced by
hybrid and Rhizoctonia inoculation


RHIZOCTONIA
INOCULATION


HYBRID

Mestizo 1 Rizalina 28


Rizalina 38


MEAN
Grain yield Computed
(glpot) yield
(tonslha)


Untreated control

Virulent Only

Rhv7 Only

Simultaneous
application

3 days Rhv7 pre-
incubation
+ virulent isolate

5 days Rhv7 pre-
incubation
+ virulent isolate

MEAN


65.7

36.7

46.5


38.0


35.0


43.3

44.2 y


140.0

106.3

129.3


120.0


138.7


131.3

127.6x


147.0

121.7

114.3


121.3


126.7



134.7

127.6x


117.6a

88.2 b

96.7 b


88.2b 6



103.1ab 6


Mean
computed yield 3.0 y 8.0x 8.4x

Means in rows and columns with the same letters are not significantly different at 5%
level by DMRT.


7.55

5.7 c

6.2cb


-~---






Journal of Tropical Plant Pathology 41:38-45


DETECTION, ISOLATION AND PATHOGENICITY OF XANTHOMONAS
ALBILINEANS, THE CAUSE OF SUGARCANE LEAF SCALD


F.M. DELA CUEVA1, M.P. DE OCAMPO1, R.T. LUZARAN3
and M.P. NATURAL2


'University Researcher, Graduate Research Assistant, respectively, Institute of Plant
Breeding, UPLB, 2Professor, Crop Protection Cluster, UPLB, College, Laguna, and Plant
Pathologist, PHILSURIN Research Station, VMC Cpd, Victorias City.


ABSTRACT

Leaves with typical symptoms of sugarcane leaf scald were collected from
several commercial fields in Negros and Panay. Samples were processed
and analyzed using Xa-specific polymerase chain reaction (PCR) primers.
Sugarcane samples that yielded positive results in PCR amplification were
used in isolation using semi-selective medium and re-inoculated to
sugarcane to confirm the identity of the causal organism.

Polymerase chain reaction of collected samples using specific
primers, PGBL 1 and PGBL 2, yielded 438 base pairs DNA product. Bacterial
colonies of X. albilineans grown on Modified Wilbrink's Medium (MWM)
plates appeared transparent honey yellow. The single colonies were minute,
circular, moist and shiny. Pure culture of X. albilineans was maintained in
MWM slants and kept in a refrigerated condition to maintain their viability.
After three weeks from inoculation, using VMC98-79, leaves inoculated with
X. albilineans showed typical white pencil line streaks.

Keywords: Xanthomonas albilineans, leaf scald, sugarcane, polymerase chain reaction,
selective medium


INTRODUCTION

Leaf scald caused by Xanthomonas
albilineans (Ashby) Dowson is one of the
most widely distributed diseases of sugarcane
in the world. The disease is spread
mechanically by cutting implements, by
infected setts, (Ricaud et al., 1989) and
through aerial transmission (Autrey et al.,
1991). Infected setts are an important mode
of spreading the disease over long distances.
The disease is potentially serious and may
cause significant loss to cane yield and sugar


quality (Hoy and Grisham, 1994; Ricaud et
al., 1989). The pathogen causes sudden
wilting and death of mature stalks when the
disease is at its acute phase. Susceptible
cultivars also exhibit latent infections and this
allows build up and spread of the pathogen.
Latent phase of the disease contributes to the
movement of pathogen through quarantine.
Xanthomonas albilineans is restricted
to the xylem elements of the vascular bundles
in the white pencil line streaks. It is a Gram-
negative, rod-shaped (0.2-0.3 x 0.6-1.0 pm)
bacterium with a single polar flagellum. It






dela Cueva et al. 39


forms buff yellow, non-mucoid colonies (2-3
mm diameter) on sucrose peptone medium
(Ricaud and Ryan, 1989).
Leaf scald was responsible for heavy
losses in sugarcane at the beginning of the
century when noble canes, Saccharum
officinaru'n, was cultivated (Ricaud and Ryan,
1989). North (1926) reported that the disease
caused substantial crop losses in the
Northern Rivers cane growing district of New
South Wales, Australia. In Mauritius,
Shepherd (1928) as cited by Ricaud and
Ryan (1989) noted that reductions in cane
yield of the order of 10% occurred in the
highly susceptible variety White Fauna. Bates
(1969) as cited by Ricaud and Ryan (1989)
commented on the disastrous effects that leaf
scald caused in certain areas of British
Guiana in the early 1950s. In Queensland,
leaf scald has been regarded as an important
disease of sugarcane (Egan, 1971).
Outbreaks in the early 1900s caused heavy
losses in highly susceptible varieties. In the
Philippines, neither documented reports on
losses due to leaf scald nor biology of the
causal organism are available.
The impact of leaf scald on sugarcane
production can be minimized by appropriate
management practices. Genetic resistance to
the disease is heritable and is the most
effective and economic means of control. Leaf
scald can also be managed by production and
careful selection of disease-free planting
material and by proper sanitation to prevent
spread (Davis et al., 1994). Studies, however,
on the etiology of the causal organism, host-
pathogen interaction and mode of
transmission must be conducted to be able to
come up with effective management strategy.
This study was initiated to confirm the
presence of sugarcane leaf scald in the
Philippines, isolate and characterize causal
organism.

MATERIALS AND METHODS

Collection of Samples

Sugarcane leaves with typical pencil-line
symptoms were collected from different


sugarcane growing areas in Visayas. The
diseased samples were placed in plastic bags
and kept in a cold container and brought to
the laboratory. The isolates were labeled
according to the place of origin.

Isolation of X. albilineans Using
Selective Medium

The bacterium was isolated from infected
sugarcane leaves showing typical leaf scald
symptoms (pencil-line streaks and necrosis).
The diseased leaves were washed thoroughly
in running tap water to remove surface dirt and
wiped with 10% chlorox to disinfect the
surface. Two to three mm2 sections were cut
from the typical leaf scald symptoms and
transferred to a drop of sterile distilled water in
a flame-sterilized slide. The bacterial cells
were allowed to ooze from the tissues and
examined under the microscope. Using a
sterile wire loop, a loopful from the suspension
was streaked on previously plated Modified
Wilbrink's Medium (MWM) (peptone, 5 g,
sucrose, 20 g, potassium phosphate, 0.5 g,
magnesium sulfate, 0.25 g, yeast extrqct, 5 g,
potassium bromide, 5 g, benomyl, 2 mg, Ph
6.8, agar, 15 g).
The plates were incubated in an
inverted position for seven days at room
temperature. Isolated colonies showing typical
colony characteristics of X. albilineans were
selected and re-streaked onto previously
plated MWM slants.

Pathogenicity Test

Susceptible VMC 98-79 seedpieces were
sown in 20 cm clay pot with heat-disinfested
soil in the screenhouse. The seedpieces were
allowed to germinate until the first trifoliate
leaves appear. Test plants were grown with
four pots per isolate. The test plants were
inoculated with bacterial suspension of each
isolate late in the afternoon.
Bacterial inoculum from sugarcane
isolates were prepared from cultures grown
on MWM and were adjusted to a
concentration of 1x109 cells/ml. Bacterial
suspensions were either injected in the






40 Detection, isolation


spindle or inoculated by the decapitation
method (Autrey et al., 1991). Manual
decapitation of cane tops above growing
point, usually between the third and fourth
dewlap, were followed by application of
infected juice within a few minutes, by
brushing the cut tissue with a paintbrush
dipped in the inoculum. A wet soil condition
was maintained to provide necessary
moisture for the establishment of the
organism.
Control plants were inoculated with
sterile distilled water. All control pots were
grouped separately away from the inoculated
plants.
Isolation and purification of each
isolate from the infected leaves were done
and reinoculation to susceptible sugarcane
variety were performed to maintain the
pathogenic ability of each isolate.

Cultural and Morphological Characteristics
of Bacteria

Very dilute sterile water suspensions of the
different isolates were prepared. They were
streaked on the hardened surface of the MWM
with a loopful of diluted bacterial suspension
at different directions. The plates were
incubated in an inverted position for 3-7 days.
The individual colonies were examined for
color of colony; form (circular, irregular,
filamentous, punctiform, rhizoid, spindle);
surface (concentrically-ringed, contoured,
radiately ringed, rough, smooth); elevation of
growth (convex, effused, flat, pulvinate, raised,
umbonate); and margin (curled, entire, erose,
filamentous, lobate, undulate).

Physiological and Biochemical Tests

The leaf scald bacterium was identified
according to the protocol of Schaad et al.
(2001). Diagnostic tests include mucoid
growth on yeast extract dextrose CaCO3
(YDC), growth at 350C, growth on SX agar,
starch hydrolysis, esculin hydrolysis, protein
digestion and reaction in litmus milk, acid
production from glucose and utilization of


glycerol, and oxygen requirement.

Polymerase Chain Reaction (PCR)

A leaf diffusate sample was prepared by
soaking slices of leaf tissues in 1 ml sterile
water in a sterile microfuge tube overnight at
room temperature. The diffusate was
transferred by pipetting to a fresh tube and
centrifuged at 10,000 rpm for 10 min to
precipitate any bacteria. The pellet was
resuspended in an equal volume of water and
a 1 tl aliquot was used in a PCR assay (Pan
etal., 1997).
Specific primers developed by Pan
and co-workers (1997) were used in the
detection. This primer set includes the use of
forward primer PGBL 1 and the reverse
primer PGBL2 which yielded a 438 bp product
size. This primer was designed on the basis
of a multiple sequence alignment among
sequences of X. albilineans. Preparation of
PCR reaction mixture as well as thermal
cycling profile was done following the
published protocol.

RESULTS AND DISCUSSION

Collection of Infected Sugarcane Leaves

Sugarcane leaves showing typical pencil-line
streaks were collected from Iloilo and
Victorias City, Negros Occidental. The most
typical symptom of the disease was the
presence on the leaf lamina of a pencil-line
streak which follows the direction of the main
veins (Fig. 1). In the initial stages the streaks
were well defined but later they become more
diffuse. Leaf scald streaks often extend to the
tip or margin of the leaves where they cause
withering and necrosis of the leaf tissue which
progresses downward along the streaks with
age.

Isolation ofX. albilineans

Bacterial colonies of X. albilineans grown on
MWM slants appeared minute, circular, moist
and shiny transparent honey yellow after 4-6
days of incubation.






dela Cueva et al. 41


Pure culture of X. albilineans was
maintained in MWM slants and kept in a
refrigerated condition to maintain their
viability.
MWM was used successfully to detect
the pathogen in sugarcane in Guadeloupe
and the Dominican Republic, as well as in
Florida. It was also proved useful when
different isolation were compared directly for
detection of X. albilineans in symptomatic
and asymptomatic sugarcane stalks from a
commercial planting of cultivar CP78-1247 in
Florida (Davies et al., 1994). This selective
medium can greatly facilitate future effects to
study and control leaf scald disease in
sugarcane.

Pathogenicity Test

Susceptible VMC 98-79 variety was used in
the pathogenicity test. Three weeks after
inoculation, leaves inoculated with X.
albilineans showed typical white pencil line
streaks (Fig. 2). The streaks originated
usually at the tip of the leaf and occasionally
at the margin of the blade and ran along the
vessels at a certain angle to the midrib. Their
length was variable and oftentimes
progressed along the lamina reaching the leaf
sheath. The streaks were cream to yellow.
This observation conforms with Autrey et al.
(1991) wherein positive results were obtained
when its pathogenicity was tested in young
sugarcane plants. The bacteria was reisolated
and transparent honey yellow colonies similar
to isolates from naturally infected leaves were
recovered from the artificially inoculated
leaves. It was concluded that X. albilineans
had caused the disease. Control plants
inoculated with distilled water did not develop
symptoms. In Guadeloupe, several stalks of
the highly susceptible cultivar CP68 1026 that
were inoculated by the decapitation technique
with water (control plants) exhibited
symptoms in inoculated and non-inoculated
leaves 1 month after inoculation. It was
suspected that the decapitation of the stalks
enabled entry of the pathogen which was
present on the leaves before inoculation or


arrived on the cut section rapidly after the
capitation of the plants (Klett and Rott, 1994).

Gram Staining

All isolates were Gram-negative and rod-
shaped (Fig. 3). Gram negative bacteria do
not retain the primary dye after decolorizing
with alcohol and thus take up the orange color
of the counterstain.

Cultural and Morphological Characteristics
of Bacteria

Of the 17 isolates, isolate 7 was light yellow,
isolate 8 was light orange and isolate 17 was
orange in color. All the remaining isolates
were yellow, circular in form, have smooth
surface, flat elevation and entire margin.

Physiological and Biochemical Tests

All isolates were aerobic. Oxygen is a
universal component of cells provided by
water in large amounts. Molecular oxygen is
then required as final acceptor and co-
substrate for certain enzymes (Raymundo et
al., 1991).
Isolates were able to grow at 350C.
Turbidity was observed in Yeast salts (YS)
broth and growth at 280C and 350C was
observed and colony count for each isolate
was done. It was observed that after 4 days
of incubation, bacterial isolates grown at 280
has greater number of bacterial cells
compared to bacterial isolates grown at 350C.
Colony forming units per ml at 28C range
from 4.6 x 1011 to 10.5 x 1011 while at 350C,
colony forming units per ml range from 3.77 x
1011 to 6 x 1012. Bacterial isolates grown at
280C were significantly different at 5% level
by DMRT while bacterial isolates grown at
35C were statistically not significantly
different at 5% level by DMRT. X. albilineans
has an optimum growth at 280C and was able
to grow at 350C to a maximum of 370C. High
temperature can inhibit bacterial growth
resulting to a lesser number of bacterial cells.






42 Detection, isolation


All isolates were able to utilize
glucose, mannose, glycerol but did not utilize
arabinose. The isolates have yellow growth
on YDC but no growth on SX agar. Most of
the isolates were negative for starch and
some isolates (6, 8, 10 and 16) have partial
hydrolysis.

Detection of X. albilineans Using
Polymerase Chain Reaction

Polymerase chain reaction (PCR) product of
collected sugarcane samples using specific
primers, PGBL 1 and PGBL2, yielded 438
base pairs DNA product (Fig. 4). The results
confirmed that the bacterium that causes
pencil line symptoms on sugarcane leaves
collected from the fields was X.
albilineans. The PCR protocol that was
developed by Pan and co-workers is a simple,
sensitive, and rapid procedure for detecting
and identifying Xa, the causal agent of
sugarcane leaf scald disease. The protocol
worked directly on culture and leaf diffusate
samples without the need of DNA extraction
(Pan et al., 1997). It is a means of amplifying
in vitro sequence of the DNA fragment of an
organism.

CONCLUSION

The results of the study showed that
Xanthomonas albilineans was isolated from
sugarcane leaves that exhibited stripes and
white pencil-line streaks. The isolated
bacterium was able to infect sugarcane and
produced typical symptoms of leaf scald. The
leaf diffusate as well as the pure culture of
the bacterium produced strong bands
measuring 438 bp when assayed through
polymerase chain reaction using Xa-specific
primers. This indicates that X. albilineans is
present in the Philippines. Further studies
should be conducted to determine the extent
of distribution of the disease, biology and
diversity of the pathogen.


LITERATURE CITED

AUTREY, LJC, S SAUMTALLY, A DOOKUN,
S SULLIVAN and S DHAYAN. 1991.
Aerial transmission of the leaf scald
pathogen Xanthomonas albilineans
(Ashby) Dowson. 3rd Sugarcane
Pathology Workshop. 22-26 July 1991.
Mauritius, Abstract.

DAVIS, MJ, P ROTT, P BAUDIN and JL
DEAN. 1994. Evaluation of selective
media and immunoassays for
detection of Xanthomonas albilineans,
causal agent of sugarcane leaf scald
disease. Plant Dis. 78: 78-82.

EGAN, BT. 1971. Breeding for resistance to
leaf scald. Proc. Int. Soc. Sugarcane
Technol. 14: 920-924.

HOY, JW and MP GRISHAM. 1994.
Sugarcane leaf scald distribution,
symptomatology and effect on yield in
Louisiana. Plant Dis. 78:1083-1087.

KLETT, P and P ROTT. 1994. Inoculum
Sources for the Spread of Leaf Scald
Disease of Sugarcane Caused by
Xanthomonas albilineans in
Guadeloupe. J. Phytopathology 142:
283-291.

NORTH, DS. 1926. Leaf scald, a bacterial
disease of sugarcane. Colonial Sugar
Refining Co. Ltd. Agricultural Report
No. 8. Sydney, Australia. 80pp.

PAN, YB, MP GRISHAM and DM BURNER.
1997. A polymerase chain reaction
protocol for the detection of
Xanthomonas albilineans, the causal
agent of sugarcane leaf scald disease.
Plant Dis. 81:189-194.








dela Cueva et al. 43


PAN, YB, MP GRISHAM, DM BURNER, BL
LEGENDRE and Q WEI. 1999.
Development of polymerase chain
reaction primers highly specific for
Xanthomonas albilineans, the causal
bacterium of sugarcane leaf scald
disease. Plant Dis. 83:218-222.

RICAUD, C and CC RYAN. 1989. Leaf scald.
In: Ricaud, C, BT Egan, Gillaspie Jr,
CG Hughes, eds. Diseases of
Sugarcane. Major diseases.
Amsterdam, Netherlands: Elsevier
Science Publishers. pp. 39-58.






Table 1. Sugarcane leaf scald isolates and r


ISOLATE
1
2
3

4

5

6

7
8
9
10
11
12
13
14
15
16
17


VARIETY
K8892
K8887
FR95-2189

FR9 -238

FR 95-2194

FR95-706

HOCP92-631
CP72-2686
CP85-1382
CP81-1254
LCP85-384
HOCP93-750
CP84-1198
CP80-1743
CP88-1762
HOCP91-555
HOCP88-739


SCHAAD, NW, JB ONES and W CHUN.
2001. Laboratory Guide for
Identification of Plant Pathogenic
Bacteria. 3rd edition. APS Press. St.
Paul, Minnesota, USA. 373pp.

ACKNOWLEDGEMENT

We would like to thank Philippine Sugar
Research Institute Foundation, Inc.
(PHILSURIN) for the generous financial
support and Dr. Yong-bao Pan of USDA,
Houma Louisiana for the primers and control
samples.


)lace of collection.


PLACE OF COLLECTION
Iloilo
Iloilo
PHILSURIN Research Station, Victorias
City
PHILSURIN Research Station, Victorias
City
PHILSURIN Research Station, Victorias
City
PHILSURIN Research Station, Victorias
City
Cambao, Victorias City
Cambao, Victorias City
Cambao, Victorias City
Cambao, Victorias City
Cambao, Victorias City
Cambao, Victorias City
Cambao, Victorias City
Cambao, Victorias City
Cambao, Victorias City
Cambao, Victorias City
Cambao, Victorias City


----






44 Detection, isolation


Figure 1. Symptoms of sugarcane leaf scald disease


-Ii
Figure 2. Sugarcane leaves inoculated with Xanthmonas
alhilineans


Figure 3. Rod-snaped cells of isolated bacterium with
orange coloration after Gram staining indicating
a Gram negative reaction.






dela Cuevg et al. 45


Figure 4. Agarose gel electrophoresis of PCR
products using Xa specific promers.






Journal of Tropical Plant Pathology 41:46-69


VARIABILITY OF STENOCARPELLA MACROSPORA (EARLE)
SUTTON, THE CAUSE OF STENOCARPELLA DISEASE
COMPLEX IN CORN


SUTOYO1 and A.D. RAYMUNDO2


Supported by the Agricultural Research and Management Project, Agency for
Agricultural Research and Development, Ministry of Agriculture, Indonesia.

'Former graduate student, Crop Protection Cluster, College of Agriculture, University of
the Philippines Los Baios (UPLB), presently with the Assessment Institute for Agricultural
Technology, Central Java, Indonesia; and 2Professor (to whom correspondence should be
addressed), UPLB, College, Laguna, Philippines.


ABSTRACT

Variability of Stenocarpella macrospora was studied in culture and in host
plants. Isolates of the fungus were collected from 19 corn-growing areas in
the Philippines. Variability of S. macrospora indeed existed among isolates
studied. In culture, S. macrospora isolates differed in mycelial growth and
number of pycnidia produced per plate. In host plants, variability of the
isolates in incubation period, latent period, pycnidial production, lesion
size and percent disease severity existed. The more virulent isolates had
earlier incubation period and shorter latent period, produced more
pycnidia, elicited bigger lesion size and higher percent disease severity as
well as faster rate of increase in lesion size and apparent infection rate.
Isolates Sm-14 and Sm-13 were classified as the most virulent based on
principal component analysis on the susceptible inbred line, Pioneer 3012.

Keywords: Stenocarpella macrospora, pathogen virulence, Principal Component Analysis

Abbreviations: PCA Principal Component Analysis


INTRODUCTION

The first report on the occurrence of
Stenocarpella macrospora in the Philippines
(Stevens and Celino, 1931) mentioned that
the fungus can cause leaf spot in corn.
Dalmacio and Lozano (1987a) later reported
a complex of leaf blight, ear rot and stalk rot
of corn. At present, the disease is widely
distributed in Mindanao, the southern part of


the Philippines, where there is large-scale
production of corn (Alovera, 2001).
Aside from causing significant yield
loss in corn with the production of light-
weight, discolored ears and shriveled grains
weight, discolored ears and shriveled grains
(Olatinwo et al., 1999), the fungus also
produces the mycotoxins diplodiol and
chaetoglobosin K (Cutler et al, 1980a;
1980b).






Sutoyo and Raymundo 47


The disease has caused substantial
damage to corn in the Philippines (Dalmacio
and Lozano, 1987a; 1987b). Losses due to
ear rot were estimated at 20% in one area in
South Cotabato in 1985. It is currently a big
problem in seed production fields in cooler
areas in Mindanao where losses have been
estimated at 40% in some plantings.
In the United States, S. maydis
isolates generally were more pathogenic in
states where they originated (Young et al.,
1959). When isolates from Minnesota,
Missouri, and Oklahoma were inter-
exchanged for inoculation in each of the three
states, they proved generally most
pathogenic in the state of origin.
Based on the phenomenon of
intraspecific aversion, Hoppe (1936) has
differentiated strains of S. maydis. According
to him, 21 different strains were obtained
from 25 cultures isolated from as many ears
of corn collected in one field. Among 25
isolates from widely separated points
throughout the Corn Belt, 24 strains were
obtained. He concluded that the number of
strains of S. maydis apparently is very large.
One of the most promising control
measures of the complex diseases caused by
Stenocarpella spp. is the use of resistant
cultivars. To develop durable resistant corn
cultivars, it is essential to know the existence
of pathogenic variability of the fungus.
This study was undertaken to
determine the variability of isolates of S.
macrospora collected from different corn
growing areas in the Philippines. This
information could be useful in developing
resistant corn cultivars and in managing
epidemics of the disease under field
conditions.

MATERIALS AND METHODS

Collection and Isolation of S. macrospore
Stenocarpella leaf blight of corn samples from


different corn growing areas, 17 from
Bukidnon province, one each from General
Santos City and Cauayan, Isabela province
were collected. Small bits of infected tissues
(2-3 sq mm) of leaves were surface-sterilized
by immersion for 10 to 12 min in 3.5 percent
sodium hypochloride (NaOCI) and rinsed in
two changes of sterile distilled water after
which they were plated on slightly acidified
potato dextrose agar (PDA) and incubated at
room temperature. Mycelial growths
spreading from the tissue were aseptically
transferred to acidified oatmeal agar plate to
produce pycnidia (Alovera, 2001). The
formed pycnidia and their conidia inside were
observed under the microscope to determine
whether the fungus was S. macrospora. Pure
culture growth of the fungus was
subsequently transferred to slanted oatmeal
agar in test tubes.
The isolates were then cultured in
oatmeal agar following the technique of
Alovera (2001).

Cultural Variability

The 19 isolates were studied in culture. A 5
mm-diameter plug of mycelium from a 5 to 6
day-old culture was placed at the center of
agar plate containing 15 ml oatmeal agar with
two drops of 25% lactic acid. The plates were
maintained under room temperature and
continuous light for 30 days to achieve
maximum pycnidial production. The plates
were arranged in a completely randomized
design with four replications. To determine
the variability among isolates, the diameter of
mycelial growth and number of pycnidia
formed were observed.
The colony diameter per plate was
determined at 72 hours after incubation by
measuring perpendicularly two diameters of
the colony. The number of pycnidia per
plate was observed at 30 days after






48 Variability of Stenocarpella


incubation by counting the total number of
pycnidia formed in every plate.

Pathogenic Variability

The same 19 isolates of S. macrospora were
used for the study. Each isolate was cultured
on oatmeal agar for pycnidial production. A 5-
mm diameter plug of mycelium from a 5 to 6
day-old culture was placed at the center of
agar plate containing 15 ml oatmeal agar with
two drops of 25% lactic acid. The plates were
incubated under room temperature and
continuous light for more or less 30 days to-
allow abundant production of pycnidia.
Cultures with pycnidia were macerated using
a Warring blender and filtered through two
layers of nylon mesh to remove the agar
medium. The resulting suspensions were
adjusted to a concentration of 2 x 105 conidia
per ml. A wetting agent, Tween-20 was
added to the suspensions at the rate of one
drop per 200 ml after which the suspensions
were used for plant inoculation by the use of
hand held sprayer delivering a fine mist.
Corn inbred lines, Pioneer 3012 and
Pioneer 3023, which are susceptible and
resistant, respectively, to S. macrospora,
were utilized for the study. Three seeds were
sown in size 6 pots containing sterilized soil.
A 6 g complete fertilizer was applied in every
pot, 3 g at sowing and 3 g at 3 weeks after
sowing. Before inoculation, seedling stands
were thinned to 2 plants per pot which served
as a replication. The experiment was
arranged in a completely randomized design
with three replications. Three weeks after
sowing, the plants were sprayed with conidial
suspension. After inoculation, the plants were
covered with plastic bags for 20 hr. To
maintain an environment conducive to
disease development, plants were watered
daily and the surrounding area was sprayed
with water using a fine nozzle three! times a
day.


Assessment of pathogenic variability
was based on the leaf blight phase reaction
of plants. The following variables were
measured:
Incubation period (days). Incubation
period was considered as the time from
inoculation to first symptom appearance. It
was initially assessed one day after
inoculation and at 12-hour intervals. Each
treatment consisted of three replications and
each replication consisted of two plants.
Latent period (days). Latent period
was taken as the time from first symptom
appearance to first formation of pycnidia.
Formation of pycnidia was marked by the
production of tiny and black fruiting bodies
which mostly appeared at the center of
lesions. Each treatment consisted of three
replications and each replication consisted of
two plants.
Pycnidial production (days). Pycnidial
production was measured as the number of
pycnidia per unit area of lesion. The number
of pycnidia was counted on lesions which
have more or less the same size and shape.
Four lesions in each replication were
considered.
Lesion growth. Lesion size was
measured at different times. The length and
width of six individual lesions were measured
in every replication starting from the first
week up to the fifth week after inoculation and
at one-week intervals.
Percent disease severity (on the
seventh leaf). Percent disease severity was
initially assessed one week after inoculation
and at one-week intervals thereafter for five
weeks. From inoculation, the best symptoms
appeared only on the seventh leaf. This leaf
was located in the middle of the whorl at the
time of inoculation.
Rating was done by establishing
lesion size -categories and counting the
number of lesions in each category, starting
from the first week up to the fifth week after







Sutoyo and Raymundo 49


inoculation at one week-intervals. The lesion
size categories that frequently appeared
were; 0.5 x 1 mm2, 1 x 2.5 mm2, 2 x 5 mm2,
3 x 10 mm2, 4x15 mm2, and 5 x 20 mm2.
The data obtained were converted to


n
I Xi.
Percent disease severity = i=1
La


percentage diseased leaf area by considering
the leaf area of the assessed leaf after they
were fully extended. Percent disease severity
on each leaf was calculated with the following
equation:


7i

x 100


where: X, = lesion size categories
Yi = number of lesions at each lesion size category
La = area of the seventh leaf.


Data Analyses

The data obtained were subjected to analysis
of variance (ANOVA) in Completely
Randomized Design (CRD) using the general
linear model (GLM) procedure of SAS
software (SAS Institute, 1988). Least
significant difference (LSD) was used in


comparing the treatment means. Linear
regression analysis was used in estimating
the rates of increase in lesion growth. This
analysis was likewise done using the SAS
software. The rate of increase in percent
disease severity was calculated as apparent
infection rate (r) using Vanderplank's
equation (Vanderplank, 1963):


r = ( --) (log e -- -log e -- )
t2 tl 1 -X2 1 x

where: r = apparent rate of infection
tl = initial time of disease observation
t2 = final time of disease observation
log e = natural logarithm
xl = percent disease severity at t,
X2 = percent disease severity at t2


To classify the virulence among the
isolates tested, pathogenic variability data
were analyzed using Principal Component
Analysis (PCA) with PRINCOMP procedure
of SAS software (SAS Institute, 1988). The
components in PCA are arranged in


decreasing order of variance accounted for,
so that the first principal component accounts
for as much as possible of the variation in the
original data. Through the first component,
the virulence among isolates was sorted in
order.







50 Variability of Stenocarpella


RESULTS

From the collection of diseased corn leaves
taken from Bukidnon, Isabela and General
Santos City, 19 isolates (Table 1) were
identified as Stenocarpella macrospora
through reference to a descriptive keys of
Diplodia macrospora Earle (Sutton and
Waterston, 1966) with the revised name
Stenocarpella macrospora (Earle) Sutton
(Sutton, 1980).

Cultural Variability

Mycelial growth. Significant variation
in colony diameter, measured after 72 hrs of
incubation, among the 19 isolates was
observed with Sm-14, Sm-11, Sm-8, Sm-1,
Sm-9 showing the biggest colony diameter of
86.50, 85.50, 85.00, 84.88, 84.75 mm,
respectively (Table 2). Sm-7 had the
smallest colony diameter of 78.50 mm which
was not significantly different from Sm-16,
Sm-4, and Sm-10. All isolates produced
white aerial mycelia.

Production of pycnidia per plate.
Within 3 to 5 days of incubation, all isolates
showed white mycelial growth with several
white spots in the middle surfaces of colonies
as well as in the edge side of Petri dishes.
After 6 to 14 days of incubation, the white
spots started to become black fruiting bodies
as pycnidia. The isolates usually produced
pycnidia faster at the edge side of Petri
dishes than at the middle surface of colonies.
After 30 days of incubation, significant
variation in number of pycnidia per plate
among the 19 isolates was observed with
Sm-13 showing the highest number of pynidia
per plate of 501.25 followed then by Sm-4
with a mean of 333.00 (Table 2). Sm-7 and
Sm-2 showed the third and fourth highest
number of pycnidia per plate of 288.00, and
246.00, respectively which were significantly
different from the others. Sm-14 had the fifth
highest number of pycnidia per plate of


206.00 which was not significantly different
from Sm-16. Sm-15 had the lowest number
of pycnidia per plate of 54.75 which was not
significantly different from Sm-5, Sm-17, Sm-
3, Sm-l, Sm-11, and Sm-19.

Pathogenic Variability

Incubation period. The first symptom
was characterized by small yellowish lesions
with gray centers on the leaf tissues. The
average incubation period of 2.40 days on
Pioneer 3012 significantly differed from the
3.10 days observed on Pioneer 3023 (Table
3).
On Pioneer 3012, incubation period
significantly varied among isolates of S.
macrospora (Table 3). The shortest
incubation period was recorded in Sm-14 with
a mean of 2.00 days which was not
significantly different from those observed on
Sm-2, Sm-12, Sm-13, Sm-10, Sm-7, Sm-8
and Sm-17. The longest incubation period
with a mean of 3.00 days was recorded in
Sm-11 which was not significantly different
from that of Sm-19.
On Pioneer 3023, incubation period
also varied significantly among isolates of S.
macrospora (Table 3). The shortest
incubation period was recorded in Sm-14 with
a mean of 2.50 days which was not
significantly different from those of isolates
Sm-12, Sm-10, Sm-6, Sm-15 and Sm-13.
The longest incubation period was recorded
in Sm-11 with a mean of 4.50 days which was
not significantly different from that of Sm-5.

Latent period. The formation of
pycnidia was characterized by small and
black fruiting bodies appearing at the centers
of blight or lesions. They can be observed on
both abaxial and adaxial portions of leaves.
The average latent period on Pioneer 3012
with a mean of 32.23 days significantly
differed from Pioneer 3023 with a mean of
36.33 days (Table 4).






Sutoyo and Raymundo 51


On Pioneer 3012, latent period
significantly varied among isolates. The
shortest latent period was recorded in Sm-13
with a mean of 15 days which was
significantly different from the others. It was
followed by Sm-14 and Sm-7 with the same
means of 29.67 days. The longest latent
period was recorded in Sm-5 with a mean of
39.67 days.
On Pioneer 3023, latent period also
significantly varied among isolates. The
shortest latent period was recorded in Sm-10
with a mean of 31.33 days and the longest
latent period was recorded in Sm-1 with a
mean of 41.00 days.

Production of pycnidia. Pycnidial
production was assessed from single lesions
of almost the same size, approximately 1 cm
in length and 0.5 cm in width. The average
pycnidial production per unit area of lesion on
Pioneer 3012 of 14.51, significantly differed
from Pioneer 3023, 10.9 (Table 5).
On Pioneer 3012, pycnidial production
significantly varied among isolates (Table 5).
The highest number of pycnidia was recorded
in Sm-13 with a mean of 17.08 pycnidia per
0.5 sq cm of lesion which was not
significantly different from Sm-2, Sm-14, Sm-
12, and Sm-4. The lowest pycnidial
production was recorded in Sm-5 and Sm-15
with means of 12.08 and 12.50 pycnidia per
0.5 sq cm of lesion, respectively.
On Pioneer 3023, pycnidial production
also significantly varied among isolates
(Table 5). The highest number of pycnidia
was recorded in Sm-13 with a mean of 12.75
pycnidia per 0.5 sq cm of lesion which was
not significantly different from Sm-2, Sm-4,
Sm-14, Sm-12, and Sm-18. The lowest
pycnidial production was recorded in Sm-8
and Sm-3 with the same means of 8.92
pycnidia per 0.5 sq cm of lesion which was
not significantly different from Sm-6 and Sm-
5.

Lesion growth. Based, on the fifth-
week-observation, lesion sizes significantly


varied amrong isolates both on Pioneer 3012
and Pioneer 3023 (Table 6). The average
lesion sizes on Pioneer 3012, 6.54 sq mm,
significantly differed from Pioneer 3023, 2.76
sq mm. Lesion growth also differed between
Pioneer 3012 and Pioneer 3023 (Fig. 1). All
the rates of increase in lesion size were
significant both on Pioneer 3012 and Pioneer
3023.
On Pioneer 3012, based on the data
at the fifth week observation, the biggest
lesion size was recorded in Sm-14 with a
mean of 20.20 sq mm which was significantly
different from the others. The smallest lesion
size was recorded in Sm-6 with a mean of
2.96 sq mm. The highest rate of increase of
0.7257 in lesion size was recorded in Sm-14,
while the lowest rate of increase of 0.0689 in
lesion size was recorded in Sm-6.
On Pioneer 3023, based on the data
at the fifth week observation, the biggest
lesion size was recorded in Sm-14 with a
mean of 4.00 sq mm while the smallest lesion
size was recorded in Sm-5 with a mean of
0.90 sq mm. The highest rate of increase of
0.0810 in lesion size was also recorded in
Sm-14, while the lowest rate of increase of
0.0090 in lesion size was recorded in Sm-5.

Percent disease severity. On Pioneer
3012, percent disease severity significantly
varied among isolates (Table 7). Based on
the fifth week observation, Sm-14 caused the
highest percent disease severity (Fig. 2) with
a mean of 29.00 ,percent which was
significantly different from the others. The
highest apparent infection rate of 0.08472 per
unit per day was also recorded in Sm-14. The
lowest percent disease severity was recorded
in Sm-5 with a mean of 5.33 percent and with
an apparent infection rate of 0.07578 per unit
per day.
On Pioneer 3023, percent disease
severity also significantly varied among
isolates (Table 7). Based on the fifth week
observation, Sm-14 caused the highest
percent disease severity with a mean of
14.17 percent and with an apparent infection






52 Variability of Stenocarpella


rate of 0.07466 per unit per day. The lowest
percent disease severity was recorded in Sm-
5 with a mean of 3.83 percent and with an
apparent infection rate of 0.06738 per unit
per day.
The average percent disease severity
on Pioneer 3012, 16.11 percent, significantly
differed from Pioneer 3023, 9.48 percent.

Principal component analysis of
virulence of S. macrospora. Principal
component analysis using 5 descriptive
variables of 19 isolates on susceptible inbred
line, Pioneer 3012, showed that the variables
percent disease severity, lesion size,
pycnidial production, latent period and
incubation period had nearly equal absolute
weights in component 1 in the analysis (Table
8). Incubation period and latent period are
negatively represented in this component.
More than half of the total variance (67.88%)
is accounted for by component 1.
Component 2 is a linear combination
of the original variables which accounts for
maximum variance and is uncorrelated with
component 1. Component 2 explains a
smaller percentage (12.33%) of the total
variance with lesion size dominating the
coefficients. The other components explained
a much smaller proportion of the total
variance.
Based on the first component of
principal component analysis on the
susceptible inbred line, the virulence of 19
isolates of S. macrospora was classified into
three categories (Table 9). Six isolates are
categorized with high virulence, 6 isolates
with intermediate virulence, and 7 isolates
with low virulence.
The following regression model was
developed on susceptible inbred line;
Y= 25.412 6.930(IP) 0.378(LP) +
1.118(PP) + 0.502(LS)
where Y = percent disease severity
IP = incubation period
LP = latent period
PP = pycnidial production


LS = lesion size
with coefficient of determination (R2)
= 0.781
Principal component analysis using 5
descriptive variables of 19 isolates on
resistant inbred line, Pioneer 3023, showed
that the variables percent disease severity
and incubation period dominate the absolute
weights in component 1, followed by
variables lesion size, pycnidial production,
latent period which have nearly equal
contribution in this component (Table 10).
Incubation period and latent period are
negatively represented in this component.
More than half of the total variance (60.16%)
is accounted for by component 1.
Component 2 explains a smaller
percentage (18.28%) of the total variance
with pycnidial production and latent period
dominating the coefficients. The other
components explained a much smaller
proportion of the total variance.
Based on the first component of
principal component analysis on resistant
inbred line, the virulence of 19 isolates of S.
macrospora was classified into three
categories (Table 11). Seven isolates are
categorized with high virulence, 7 isolates
with intermediate virulence, and 5 isolates
with low virulence.
The following regression model was
developed on resistant inbred lines;
Y= 5.290 2.464(IP) 0.193(LP) +
1.638(PP) + 0.347(LS)
where Y = percent disease severity
IP = incubation period
LP = latent period
PP = pycnidial production
LS = lesion size

with coefficient of determination (R2)
= 0.847

DISCUSSION

The fungus grew well in oatmeal agar under
room temperature and continuous light






Sutoyo and Raymundo 53


confirming previous observations (Eddins,
1930; Latterell and Rossi, 1983; Alovera,
2001). Eddins (1930) reported that the
optimum temperature of the fungus was
between 25 and 320C. Latterell and Rossi
(1983) mentioned that oatmeal agar is the
most satisfactory medium for culturing this
fungus. Alovera (2001), likewise, found that
the fungus showed the most vigorous hyphal
growth in oatmeal agar. Under these
conditions, mycelial growth of S. macrospora
significantly varied among the 19 isolates
studied. This characteristic is similar to the
variation in mycelial growth among isolates of
S. maydis reported by Dorrance and Warren
(1999).
Alovera (2001) also observed that the
pycnidial formation of the fungus was most
abundant in oatmeal agar medium added
with lactic acid and exposed under
continuous light. Under this condition, S.
macrospora showed significant variation in
pycnidial production among the 19 isolates
tested. Dorrance and Warren (1999) also
reported significant differences in the number
of pycnidia produced per plate among
isolates of the closely-related S. maydis.
Some isolates can produce from
159.75 to 501.25 pycnidia per plate. With
these isolates that can produce more than
150 pycnidia per plate, it will be easy to
produce enough pycnidia for inoculation in,
for instance, host screening experiments.
Several isolates, particularly Sm-13 and Sm-
4, were very efficient in producing more than
300 pycnidia per plate.
The time from inoculation to first
symptom appearance significantly varied
among the 19 isolates. It ranged from 2.00 to
3.00 days on Pioneer 3012, and from 2.50 to
4.50 days on Pioneer 3023. In terms of
incubation period, Sm-14 caused the earliest
symptom appearance while Sm-11 caused
the last symptom appearance both on
susceptible and resistant inbred lines. This
variation indicates different degrees of
aggressiveness among the isolates. Pascual
and Raymundo(1993) observed that the


earliest incubation period in
Helminthosporium leaf spot of wheat was
elicited by the most virulent isolate.
The time from first symptom
appearance to first formation of pycnidia
significantly varied among the 19 isolates.
This latent period ranged from 15.00 to 39.67
days on Pioneer 3012 and ranged from 31.33
to 41.00 days on Pioneer 3023. In terms of
latent period, Sm-13 produced the earliest
pycnidia on Pioneer 3012 and Sm-10
produced the earliest pycnidia on Pioneer
3023. Sm-5, on the other hand, elicited the
longest latent period on Pioneer 3012 while
Sm-1 elicited the longest latent period on
Pioneer 3023.
The highest pycnidial production was
caused by Sm-13 both on Pioneer 3012 and
Pioneer 3023. In addition, this isolate also
caused the second highest percent disease
severity. It was also noted that Sm-14, the
most virulent isolate, produced a large
number of pycnidia. Pycnidial production or
sporulation capacity is an important measure
of fitness (Watson, 1970). It implies that
fitness and virulence are positively
associated.
Percent disease severity significantly
varied among the 19 isolates. This indicates
variation in virulence among the isolates.
Kappelman et al. (1965) had reported that
there was variation in virulence of the closely-
related species, S. maydis. The highest
percent disease severity was elicited by Sm-
14 indicating that it was the most virulent
isolate. Aside from producing the highest
percent disease severity, Sm-14 elicited the
biggest lesion size and shortest incubation
period. Pascual and Raymundo (1993) also
found that the most virulent isolate caused
the biggest lesion size in leaf spot of wheat.
Results showed that all variables
observed, incubation period, latent period,
pycnidial production, lesion size and percent
disease severity, significantly differed among
isolates implying that these components
could be used to detect variation in virulence
among isolates.






54 Variability of Stenocarpella


The differences in the observed
variables also indicated that there is a genetic
basis of virulence of the isolates. Since
virulence in pathogen is quantitatively
controlled-4Kappelman et al., 1965; Watson,
1970), the use of highly virulent isolates in
breeding programs would be an advantage.
This method is expected to result in the
selection of broad-based and durably
resistant corn populations.
Of the 19 isolates, six incited high
levels of percent disease severity, more than
20 percent, on Pioneer- 3012 indicating that
more or less one third of the isolates studied
had high levels of virulence and two third had
low to intermediate virulence. Kappernan et
al. (1965) reported that of 20 isolates of S.
maydis, collected from different corn growing
areas in the US, only 6 isolates had a high
level of virulence. This finding points to the
necessity of evaluating the relative virulence
of isolates and not to utilize easily obtainable
isolates for use in screening for resistance.
Based on the above results, it
appears that there is a need to consider the
use of selected isolates in developing
resistance to Stenocarpella leaf blight. For a
broader-based resistance, it is suggested that
a mixture of the most virulent isolates be
used while specific isolates may be used
when targeting specific type of resistance for
particular growing areas. ,
Principal component analysis (PCA) is
-a multivariate statistical teehnique which
reduces the dimension of a number of
variables-dimensional arrays by introducing a
set of linear combinations of the original
variables (Morrison, 1976). This technique
was used by Madden and Pennypacker
(1979) and Mora-Aguilera et al. (1996) in
studying plant disease epidemics. Pascual
and Raymundo (1993) also utilized PCA in
successfully identifying the main variables in
grouping isolates of Helminthosporium
sativum from wheat.
The first component in PCA was
utilized to sort in order the relative virulence
of S. macrospore isolates. The analysis on


susceptible inbred line showed that the first
component, which accounted for more than
half of the total variance (67.88%), has nearly
equal high correlation with all parameters
observed. Incubation period and latent period
are negatively represented in this component.
PCA analysis showed that this
method used in estimating the variability of S.
macrospora population helped in classifying
the relative virulence of the isolates in inciting
Stenocarpella leaf blight.

LITERATURE CITED

ALOVERA, RB. 2001. Effect of environmental
factors on Stenocarpella macrospora
(Earle) Sutton and disease-yield loss
relationship as affected by site of
inoculation and inoculum concentration
in corn (Zea mays L.). Unpublished
Ph.D. Thesis, University of the
Philippines Los Banos, College,
Laguna [Available at the UPLB Library]

CUTLER, HG, FG CRUMLEY, RH COX, RJ
COLE, JW DORNER, FM LATTERELL
and AE ROSSI. 1980a. Diplodiol: A
new toxin from Diplodia macrospora. J.
Agric. Food Chem. 28: 135-138.

CUTLER, HG, FG CRUMLEY, RH COX, RJ
COLE, JW DORNER, JP SPRINGER,
FM LATTERELL, JE THEN and AE
ROSSI. 1980b. Chaetoglobosin K: A
new plant growth inhibitor and toxin
from Diplodia macrospora. J. Agric.
Food Chem. 28: 139-142.

DALMACIO, SC and GP LOZANO. 1987a.
Note: leaf blight, ear rot and stalk rot of
corn caused by Diplodia macrovcora
Earle in the Philippines. Philipp.
Phytopathol. 23: 22-23.

DALMACIO, SC and GP LOZANO. 1987b.
Diplodia macrospora: A threat to corn
production in the Philippines. Philipp.
Phytopathol. 23: 28 (Abstr.).






Sutoyo and Raymundo oo


DORRANCE, AE and HL WARREN. 1999.
Comparison of Stenocarpella maydis
isolates for isozyme and cultural
characteristics. Plant Dis. 83: 675-680.

EDDINS, AH. 1930. Dry rot of corn caused
by Diplodia macrospora Earle.
Phytopathology 20:439-448.

HOPPE, PE. 1936. Intraspecific and
interspecific aversion in Diplodia.
Agric. Res. 53:671-680.

KAPPELMAN, AJ, DL THOMPSON and RR
NELSON. 1965. Virulence of 20
isolates of Diplodia zeae as revealed
by stalk rot development in corn. Crop
Sci. 5:541-543.

LATTERELL, FM and AE ROSSI. 1983.
Stenocarpella macrospora (=Diplodia
macrospora) and S. maydis (=D.
maydis) compared as pathogens of
corn. Plant Dis. 67:725-729.

MADDEN, LV and SP PENNYPACKER.
1979. Principal components analysis of
tomato early blight epidemics. J.
Phytopathol. 95:364-365.

MORA-AGUILERA, G, D NIETO-ANGEL, CL
CAMBELL, D TELIZ and E GARCIA.
1996. Multivariate comparison of
papaya ring spot epidemics.
Phytopathology 86: 70-78.

MORRISON, DF 1976. Multivariate Statistical
Methods. McGraw-Hill, New York.

OLATINWO, R, K CARDWELL, A MENKIR,
M DEADMAN and A JULIAN. 1999.
Inheritance of resistance to


Stenocarpella macrospora Earle ear
rot of maize in the mid-altitude zone of
Nigeria. European J. Pit. Pathol. 105:
535-543.

PASCUAL, CB and AD RAYMUNDO. 1993.
Analysis of Helminthosporium sativum
P, K & B in wheat. I. Variation in
culture and virulence. Philipp. Agric.
76:383-393.

SAS INSTITUTE, 1988. SAS/STAT: User's
Guide. SAS institute, Cary, North
Carolina.

STEVENS, FL and MS CELINO. 1931. Two
diseases caused by Diplodia. Philipp.
Agric. 20: 370-374.

SUTTON, BC and JM WATERSTON. 1966.
Diplodia macrospora. CMI Descriptions
of Pathogenic Fungi and Bacteria No.
83. Commonwealth Mycological
Institute, Kew, Surrey, England.

SUTTON, BC. 1980. The Coelomycetes.
Commonwealth Mycological Institute,
Kew, Surrey, England.

VANDERPLANK, JE. 1963. Plant Diseases:
Epidemics and Control. Academic
Press, New York. 349pp.

WATSON, IA. 1970. Changes in virulence
and population shifts in plant
pathogens. Annu. Rev. Phytopathol.
8:209-230.

YOUNG HC Jr, RD WILCOXSON, MD
WHITEHEAD, JE DEVAY, CO
GROGAN and MS ZUBER. 1959. An
ecological study of the pathogenicity of
Diplodia maydis isolates inciting stalk
rot of corn. Plant Dis. Reptr. 43:1124-
1129.






56 Variability of Stenocarpella


Table 1. Designation of 19 isolates of Stenocarpella macrospora collected from different corn
growing areas in Bukidnon, Isabela and General Santos City.



ISOLATE PLACE OF ORIGIN1

Sm-1 Poblacion, Libona, Bukidnon
Sm-2 Diklum, Manolo Fortich, Bukidnon
Sm-3 Impalutao, Impasugong, Bukidnon
Sm-4 Dalwangan, Malaybalay, Bukidnon
Sm-5 Aglayan, Malaybalay, Bukidnon
Sm-6 Bugcaon, Lantapan, Bukidnon
Sm-7 Cabanglasan, Bukidnon
Sm-8 Bagungtaas, Valencia, Bukidnon
Sm-9 CMU Experimental Station, Musuan, Bukidnon
Sm-10 Panatalan, Maramag, Bukidnon
Sm-11 Butong, Quezon, Bukidnon
Sm-12 Sinanguyan, Don Carlos, Bukidnon
Sm-13 Kitaotao, Bukidnon
Sm-14 Poblacion, Dangcagan, Bukidnon
Sm-15 Spring, Kibawe, Bukidnon
Sm-16 Magsaysay, Pangantucan, Bukidnon
Sm-17 Baraks, Kalilangan, Bukidnon
Sm-18 Cauayan, Isabela
Sm-19 General Santos City
1Barangay/place, city/municipality, province.






Sutoyo and Raymundo 57


Table 2. Colony diameter and number of pycnidia per plate of 19 isolates of Stenocarpella
macrospora in oatmeal agar medium


ISOLATE COLONY ISOLATE NUMBER OF PYCNIDIA
DIAMETER (mm)1 PER PLATE2

Sm-14 86.50 a Sm-13 501.25 a
Sm-11 85.50 ab Sm-4 333.00 b
Sm-8 85.00 abc Sm-7 288.00 c
Sm-1 84.88 abc Sm-2 246.00 d
Sm-9 84.75 abc Sm-14 206.00 e
Sm-17 84.13 bc Sm-16 190.50 ef
Sm-18 83.88 bcd Sm-10 159.75 fg
Sm-15 83.75 bcd Sm-8 142.50 g
Sm-19 83.63 bcd Sm-12 141.50 g
Sm-6 83.63 bcd Sm-18 140.25 g
Sm-5 83.50 bcd Sm-6 95.50 h
Sm-12 83.50 bcd Sm-9 94.75 hi
Sm-2 83.38 cd Sm-19 89.50 hij
Sm-3 83.13 cd Sm-11 80.50 hij
Sm-13 82.00 de Sm-1 61.50 hij
Sm-10 80.50 ef Sm-3 58.00 ij
Sm-4 80.13 ef Sm-17 57.25 j
Sm-16 79.75 f Sm-5 56.50 j
Sm-7 78.50 f Sm-15 54.75 j
Mean 83.16 157.74

Means of four replications taken 72 hours after incubation.
2Means of four replications taken 30 days after plating.
1,2Means with the same letter in the same column are not significantly different at
LSD(o.o5) = 2.08 (colony diameter); 37.08 (number of pycnidia per plate).
CV(%) = 1.77 (colony diameter); 16.60 (number of pycnidia per plate).







58 Variability of St nocarpella


Table 3. Incubation period on two different corn inbred lines, Pioneer 3012 and Pioneer 3023,
inoculated withl9 isolates of Stenocarpella macrospor.

PIONEER 3012 PIONEER 3023

Isolate incubation period (days)1 Isolate Incubation period (days)1

Sm-11 3.00 a Sm-11 4.50 a
Sm-19 2.67 ab Sm-5 4.25 ab
Sm-18 2.58 bc Sm-1 3.67 bc
Sm-6 2.50 bcd Sm-19 3.67 bc
Sm-9 2.50 bcd Sm-3 3.25 cd
Sm-4 2.50 bcd Sm-18 3.17 cde
Sm-5 2.50 bcd Sm-16 3.17 cde
Sm-3 2.50 bcd Sm-7 3.00 cde
Sm-1 2.50 bcd Sm-4 2.92 de
Sm-16 2.50 bcd Sm-9 2.92 de
Sm-15 2.42 bcd Sm-8 2.92 de
Sm-17 2.33 bcde Sm-2 2.83 de
Sm-8 2.33 bcde Sm-17 2.83 de
Sm-7 2.25 cde Sm-13 2.75 de
Sm-10 2.17 de Sm-15 2.75 de
Sm-13 2.17 de Sm-6 2.67 de
Sm-12 2.17 de Sm-10 2.58 de
Sm-2 2.00 e Sm-12 2.50 e
Sm-14 2.00 e Sm-14 2.50 e
Mean 2.40 A 3.10 B

Average of three replications, two plants for each replication.
Means with the same small letter in the same column are not significantly
different at LSD(o05) = 0.35 (Pioneer 3012); 0.71 (Pioneer 3023).
CV(%) = 8.84 (Pioneer 3012); 13.94 (Pioneer 3023).
Means with the different capital letter in the same row are significantly different
at 5% level based on t-test






Sutoyo and Raymundo 59


Table 4. Latent period on two different corn inbred lines, Pioneer 3012 and Pioneer 3023,
inoculated with 19 isolates of Stenocarpella macrospora

PIONEER 3012 PIONEER 3023

Isolate Latent period (days)1 Isolate Latent period (days)1

Sm-5 39.67 a Sm-1 41.00 a
Sm-3 37.00 ab Sm-11 40.33 ab
Sm-11 37.00 ab Sm-5 39.33 abc
Sm-6 36.00 abc Sm-7 39.33 abc
Sm-19 35.00 abcd Sm-4 39.00 abc
Sm-9 34.67 bcde Sm-9 38.33 abc
Sm-4 34.67 bcde Sm-16 38.00 abc
Sm-8 34.00 bcdef Sm-13 37.00 abcd
Sm-1 32.33 bcdef Sm-3 37.00 abcd
Sm-2 32.33 bcdef Sm-6 36.33 abcde
Sm-12 31.67 cdef Sm-2 36.00 abcde
Sm-18 31.67 cdef Sm-19 35.33 bcde
Sm-10 31.33 cdef Sm-15 34.67 cde
Sm-17 30.67 def Sm-14 34.67 cde
Sm-15 30.00 ef Sm-18 34.33 cde
Sm-16 30.00 ef Sm-8 34.33 cde
Sm-7 29.67 f Sm-17 32.00 de
Sm-14 29.67 f Sm-12 31.67 de
Sm-13 15.00 g Sm-10 31.33 e

Mean 32.23 A 36.33 B

1Average of three replications, two plants for each replication
Means with the same small letter in the same column are not significantly
different at LSD(o.05) = 4.98 (Pioneer 3012); 5.43 (Pioneer 3023).
CV(%) = 9.35 (Pioneer 3012); 9.05 (Pioneer 3023).
Means with the different capital letter in the same row are significantly different
at 5% level based on t-test.






60 Variability of Stenocarpella


Table 5. Pycnidial production of 19 isolates of Stenocarpella macrospora on two different corn
inbred lines, Pioneer 3012 and Pioneer 3023

PIONEER 3012 PIONEER 3023

Isolate Pycnidial production per Isolate Pycnidial production per
0.5 sq cm of lesion' 0.5 sq cm of lesion1

Sm-13 17.08 a Sm-13 12.75 a
Sm-2 16.42 ab Sm-2 12.75 a
Sm-14 16.33 ab Sm-4 12.42 a
Sm-12 16.17 ab Sm-14 12.25 ab
Sm-4 16.17 ab Sm-12 12.08 abc
Sm-10 15.83 bc Sm-18 12.00 abcd
Sm-18 15.75 bc Sm-10 11.50 bcde
Sm-7 15.00 cd Sm-7 11.33 cde
Sm-8 15.00 cd Sm-16 11.33 cde
Sm-9 14.50 de Sm-17 11.17 de
Sm-17 14.00 def Sm-11 11.08 e
Sm-19 13.83 ef Sm-19 10.75 ef
Sm-6 13.67 efg Sm-15 10.17f
Sm-16 13.08 fgh Sm-1 10.00 f
Sm-11 13.00 fgh Sm-9 10.00 f
Sm-1 12.67 gh Sm-6 9.08 g
Sm-3 12.58 gh Sm-5 9.00 g
Sm-15 12.50 h Sm-3 8.92 g
Sm-5 12.08 h Sm-8 8.92 g
Mean 14.51 A 10.92 B

SAverage of three reprications, four lesions samples for each replication.
Means with the same small letter in the same column are not significantly
different at LSD(o.o5) = 1.13 (Pioneer 3012); 0.88 (Pioneer 3023).
CV(%) = 4.71 (Pioneer 3012); 4.88 (Pioneer 3023).
Means with the different capital letter in the same row are significantly different
at 5% level based on t-test.







Sutoyo and Raymundo 61


Table 6. Lesion growth of 19 isolates of Stenocarpella macrospora on two corn inbred lines,
Pioneer 3012 and Pioneer 3023, at different time intervals and rate of increase in
lesion size (b)

LESION SIZE (sq mm)1
LINE/
ISOLATE Days after inoculation b2

7 14 21 28 353

PIONEER 3012
Sm-14 1.77 4.57 5.91 18.37 20.20 a 0.7257**
Sm-13 1.24 2.05 2.82 10.83 11.88 b 0.4299**
Sm-15 1.60 2.43 4.49 7.32 8.45 bc 0.2661**
Sm-10 1.16 2.00 4.62 7.62 8.44 bc 0.2885*
Sm-3 1.39 1.94 4.35 6.70 7.41 bc 0.2402**
Sm-7 1.01 1.88 2.45 5.82 6.73 bc 0.2200**
Sm-16 1.10 1.56 2.73 6.01 6.69 bc 0.2226**
Sm-4 0.95 1.74 2.68 6.17 6.55 bc 0.2234**
Sm-2 1.38 2.48 3.40 4.69 5.77 c 0.1576**
Sm-12 1.28 2.09 3.59 5.40 5.46 c 0.1670**
Sm-5 1.23 2.34 3.64 4.95 5.31 c 0.1541**
Sm-8 1.31 1.60 2.73 4.66 5.05 c 0.1507**
Sm-11 1.15 1.70 2.61 3.94 4.48 c 0.1272**
Sm-1 0.88 1.57 2.85 4.24 4.26 c 0.1357**
Sm-19 1.38 1.62 2.27 3.70 3.81 c 0.0991**
Sm-18 1.10 2.26 2.74 3.68 3.75 c 0.0963**
Sm-9 1.17 2.45 3.00 3.13 3.58 c 0.0783**
Sm-17 1.30 1.52 2.62 3.23 3.41 c 0.0705**
Sm-6 1.16 1.81 2.20 2.82 2.96 c 0.0689**

Mean 6.54 A


PIONEER 3023

Sm-14 1.63 2.67 2.94 3.60 4.00 a 0.0810**
Sm-13 1.69 2.19 2.51 3.30 3.70 ab 0.0731**
Sm-15 1.68 2.12 2.66 3.30 3.69 ab 0.0748**
Sm-9 1.41 2.18 2.65 2.81 3.44 abc 0.0668**
Sm-4 0.78 0.83 1.16 2.14 3.05 abcd 0.0800**
Sm-10 0.93 1.25 1.96 2.70 3.01 abcd 0.0801**
Sm-3 1.08 1.27 1.92 2.96 2.96 abcd 0.0779**







62: Variability of Stenocarpella


Table 6. Continued...


LESION SIZE (sq mm)1
LINE/
ISOLATE Days after inoculation b2

7 14 21 28 353

Sm-2 0.64 1.48 1.97 2.67 2.86 bcd 0.0809**
Sm-6 1.57 1.88 2.10 2.58 2.80 bcd 0.0448**
Sm-17 1.09 1.46 1.81 2.53 2.78 bcd 0.0640**
Sm-7 0.61 0.90 1.51 2.45 2.61 cd 0.0797**
Sm-8 0.97 1.13 1.58 2.15 2.57 cd 0.0601**
Sm-1 0.69 0.92 1.30 2.46 2.56 cd 0.0752**
Sm-16 0.99 1.16 2.09 2.38 2.53 cd 0.0611**
Sm-11 0.78 0.79 1.23 2.26 2.45 cd 0.0687**
Sm-12 0.83 1.04 1.49 2.27 2.32 d 0.0598**
Sm-18 0.64 0.71 0.86 1.70 2.13d 0.0563**
Sm-19 0.98 1.18 1.66 1.98 2.09 d 0.0428**
Sm-5 0.65 0.68 0.70 0.76 0.90 d 0.0090**

Mean 2.76 B

Average of three replications, six individual lesions for each replication.
2The computed slope of regression line.
**Highly significant
*Significant
Means with the same small letter in the same column are not significantly
different at 5% level based on LSD.
Means with the different capital letter in the same column are significantly
different at 5% level based on t-test






Sutoyo and Raymundo _,


Table 7. Percent disease severity caused by 19 isolates of Stenocarpella macrospora on two
corn inbred lines, Pioneer 3012 and Pioneer 3023, at different time intervals and
apparent infection rate (r)

PERCENT DISEASE SEVERITY1
LINE/
ISOLATE Days after inoculation r VALUES2

7 14 21 28 353

PIONEER 3012
Sm-14 3.67 8.00 16.33 27.00 29.00 a 0.08472
Sm-13 3.25 6.00 11.17 21.00 25.00 b 0.08196
Sm-12 3.20 6.50 14.00 20.83 24.83 bc 0.08221
Sm-15 3.30 6.17 10.17 19.50 21.83 cd 0.07508
Sm-10 2.65 3.17 6.83 12.83 21.83 cd 0.08315
Sm-7 2.60 3.50 9.83 17.83 21.17 de 0.08245
Sm-4 2.30 2.75 5.33 12.17 18.33 ef 0.08053
Sm-2 2.30 3.75 8.83 15.00 18.17 ef 0.08015
Sm-17 2.99 3.83 9.17 13.67 18.00 f 0.07990
Sm-16 1.90 2.67 6.33 10.83 15.33 fg 0.07983
Sm-18 1.88 2.83 8.50 12.33 14.83 g 0.07882
Sm-8 1.96 3.50 8.67 12.67 12.83 gh 0.07130
Sm-19 1.68 2.17 5.00 10.83 12.67 gh 0.07639
Sm-1 2.08 3.00 8.50 10.17 10.67 hi 0.06167
Sm-9 1.59 1.93 3.25 9.50 9.83 hi 0.06818
Sm-6 1.09 1.40 3.09 8.00 9.33 i 0.07979
Sm-3 1.25 1.92 4.83 8.17 8.67 i 0.07196
Sm-11 1.00 1.82 4.58 7.43 8.43 i 0.07892
Sm-5 0.67 1.08 1.79 3.00 5.33 j 0.07578

Mean 16.11 A


PIONEER 3023

Sm-14 2.00 4.42 7.17 12.17 14.17 a 0.07466
Sm-13 1.98 3.92 7.17 12.33 14.00 ab 0.07453
Sm-10 1.84 2.50 4.17 8.17 13.83 abc 0.07669
Sm-4 1.86 2.33 3.58 9.00 13.00 abc 0.07375
Sm-15 1.75 3.50 6.08 10.33 12.67 abc 0.07491
Sm-2 1.78 2.21 4.83 9.83 12.50 abc 0.07374







b4 Variability of Stenocarpella


Table 7. Continued ...


PERCENT DISEASE SEVERITY'
LINE/
ISOLATE Days after inoculation r VALUES2

7 14 21 28 353

Sm-7 1.70 2.25 3.83 8.00 11.83 abc 0.07317
Sm-18 1.66 2.25 3.50 7.67 11.50 abc 0.07289
Sm-17 1.88 2.67 5.83 8.83 11.33 bcd 0.06777
Sm-12 1.72 2.33 5.00 8.50 11.17 cd 0.07230
Sm-16 1.30 1.54 2.92 6.17 8.67 de 0.07054
Sm-19 1.28 1.71 3.50 6.00 7.83 ef 0.06713
Sm-6 1.00 1.30 2.21 6.17 7.17 efg 0.07265
Sm-8 1.05 1.14 2.10 5.17 7.00 efgh 0.06997
Sm-9 0.95 1.29 1.79 5.00 5.17 fghi 0.06206
Sm-1 1.05 1.63 2.50 4.83 5.17 fghi 0.05845
Sm-3 0.77 1.10 1.58 3.83 5.00 ghi 0.06837
Sm-11 0.77 1.07 1.54 3.50 4.33 hi 0.06298
Sm-5 0.60 0.68 0.88 1.92 3.83 I 0.06738

Mean 9.48 B

'Average of three replications, two plants for each replication.
Apparent infection rate (r): 1 x2 x,
r= ( ) (loge--------- log e --------)
t2 tl 1 X2 1 X,
Means with the same small letter in the same column are not significantly
different at 5% level based on LSD.
Means with the different capital letter in the same column are significantly
different at 5% level based on t-test.






Sutoyo and Raymundo 65


Table 8. Correlation coefficients based on the result of principal component analysis using the
descriptive variables of populations of Stenocarpella macrospora for reaction to
Stenocarpella leaf blight on susceptible inbred line, Pioneer 3012

COMPONENT1
VARIABLE
1 2 3 4 5

Incubation period -.455 0.061 -.524 0.688 0.203

Latent period -.424 0.133 0.818 0.252 0.266

Pycnidial production 0.435 -.593 0.225 0.587 -.256

Lesion size 0.407 0.791 0.073 0.342 -.294

Percent disease 0.508 0.039 -.037 0.051 0.858
severity
Percent of total 67.88 12.33 10.39 6.10 3.29
variance
Cumulative percentage 67.88 80.22 90.61 96.71 100
of variance

Component 1 is a linear combination of the original variables that has maximum variance among all
possible linear combinations.
Component 2 is a linear combination of the original variables which accounts for maximum variance
and is uncorrelated with the first component.
Component 3 is a linear combination of the original variables which accounts for maximum
variance and is uncorrelated with the first and second components.
Component 4 is a linear combination of the original variables which accounts for maximum variance
and is uncorrelated with the first, second and third components.
Component 5 is a linear combination of the original variables which accounts for maximum
Variance and is uncorrelated with the first, second, third and fourth components.






66 Variability of Stenocarpella


Table 9. Classification of isolates based on principal component analysis (PCA) of various
components of virulence of Stenocarpella macrospora on susceptible inbred line,
Pioneer 3012

ISOLATE PRIN- INCU- LATENT PYCNI- LESION PERCENT CLASSIFI-
CIPAL11 BATION PERIOD DIAL SIZE DISEASE CATION3
PERIOD (Days) PRO- (sq. mm) SEVERITY
(Days) DUCTION2 (%)

Sm-11 -2.74297 3.00 37.00 13.00 4.48 8.43 LV
Sm-5 -2.42557 2.50 39.67 12.08 5.31 5.33 LV
Sm-6 -1.61860 2.50 36.00 13.67 2.96 9.33 LV
Sm-3 -1.59534 2.50 37.00 12.58 7.41 8.67 LV
Sm-19 -1.46999 2.67 35.00 13.83 3.81 12.67 LV
Sm-1 -1.34876 2.50 32.33 12.67 4.26 10.67 LV
Sm-9 -1.17896 2.50 34.67 14.50 3.58 9.83 LV
Sm-16 -0.43695 2.50 30.00 13.08 6.69 15.33 IV
Sm-18 -0.33790 2.58 31.67 15.75 3.75 14.83 IV
Sm-8 -0.28562 2.33 34.00 15.00 5.05 12.83 IV
Sm-17 -0.05217 2.33 30.67 14.00 3.41 18.00 V
Sm-4 0.23037 2.50 34.67 16.17 6.55 18.33 V
Sm-15 0.23262 2.42 30.00 12.50 8.45 21.83 IV
Sm-7 1.03751 2.25 29.67 15.00 6.73 21.17 HV
Sm-2 1.34700 2.00 32.33 16.42 5.77 18.17 HV
Sm-12 1.49034 2.17 31.67 16.17 5.46 24.83 HV
Sm-10 1.50143 2.17 31.33 15.83 8.44 21.83 HV
Sm-13 3.80487 2.17 15.00 17.08 11.88 25.00 HV
Sm-14 3.84870 2.00 29.67 16.33 20.20 29.00 HV

'Principal 1is a measure of overall variables.
Number of pycnidia per 0.5 sq cm of lesion.
3LV = Low Virulence
IV = Intermediate Virulence
HV = High Virulence







Sutoyo and Raymundo


Table 10. Correlation coefficients based on the result of principal component analysis using
the descriptive variables of populations of Stenocarpella macrospore for reaction
to Stenocarpella leaf blight on resistant inbred line, Pioneer 3023

COMPONENT1
VARIABLE
1 2 3 4 5


Incubation period -.506 0.330 -.209 0.653 0.406

Latent period -.376 0.636 0.444 -.504 0.052

Pycnidial production 0.395 0.660 -.362 0.167 -.500

Lesion size 0.398 0.085 0.769 0.491 0.033

Percent disease 0.537 0.210 -.190 -.225 0.763
severity
Percent of total 60.16 18.28 15.96 3.69 1.92
variance
Cumulative percentage 60.16 78.44 94.39 98.08 100
of variance

1Component 1 is a linear combination of the original variables that has maximum
variance among all possible linear combinations.
Component 2 is a linear combination of the original variables which accounts for
maximum variance and is uncorrelated with the first component.
Component 3 is a linear combination of the original variables which accounts for
maximum variance and is uncorrelated with the first and second components.
Component 4 is a linear combination of the original variables which accounts for
maximum variance and is uncorrelated with the first, second and third components.
Component 5 is a linear combination of the original variables which accounts for maximum
variance and is uncorrelated with the first, second, third and fourth components.







68 Variability of Stenocarpella


Table 11. Classification of isolates based on principal component analysis of various
components of virulence of Stenocarpella macrospora on resistant inbred
line, Pioneer 3023


ISOLATE PRIN- INCU- LATENT PYCNI- LESION PERCENT CLASSI-
CIPAL11 BATION PERIOD DIAL SIZE DISEASE FICA-
PERIOD (Days) PRO- (sq. mm) SEVERITY TION3
(Days) DUCTION2 (%)

Sm-5 -3.90654 4.25 39.33 9.00 0.90 3.83 LV
Sm-11 -2.67964 4.50 40.33 11.08 2.45 4.33 LV
Sm-1 -2.15208 3.67 41.00 10.00 2.56 5.17 LV
Sm-3 -1.37067 3.25 37.00 8.92 2.96 5.00 LV
Sm-19 -1.06837 3.67 35.33 10.75 2.09 7.83 LV
Sm-8 -0.65400 2.92 34.33 8.92 2.57 7.00 IV
Sm-9 -0.62225 2.92 38.33 10.00 3.44 5.17 IV
Sm-6 -0.48332 2.67 36.33 9.08 2.80 7.17 IV
Sm-16 -0.41421 3.17 38.00 11.33 2.53 8.67 IV
Sm-7 0.07737 3.00 39.33 11.33 2.61 11.83 IV
Sm-18 0.45060 3.17 34.33 12.00 2.13 11.50 IV
Sm-4 0.94266 2.92 39.00 12.42 3.05 13.00 IV
Sm-17 1.16038 2.83 32.00 11.17 2.78 11.33 HV
Sm-15 1.30493 2.75 34.67 10.17 3.69 12.67 HV
Sm-2 1.33050 2.83 36.00 12.75 2.86 12.50 HV
Sm-12 1.48692 2.50 31.67 12.08 2.32 11.17 HV
Sm-13 1.97463 2.75 37.00- 12.75 3.70 14.00 HV
Sm-10 2.07189 2.58 31.33 11.50 3.01 13.83 HV
Sm-14 2.55118 2.50 34.67 12.25 4.00 14.17 HV

SPrincipal 1 is a measure of overall variables.
2Number of pycnidia per 0.5 sq cm of lesion.
LV = Low Virulence
I V = Intermediate Virulence
HV = High Virulence







Sutoyo and Raymundo 69


Figure 1. Small blight lesions on Pioneer 3023 (left) and bigger lesion on
Pioneer 3012 (right) produced by isolate Sm-13, 3 weeks after
inoculation.


Figure 2. Manifestations of the highest percent severity produced by
isolate Sm-14 of Stenocarpella macrospora, 5 weeks after
inoculation.







Journal of Tropical Plant Pathology 41: 70-76

NOTE

CONTROL OF PHYTOPHTHORA BLACK STRIPE DISEASE
OF RUBBER IN MATALAM, COTABATO


N.G. TANGONAN and E.G.G. BUTARDO


Respectively, Project Leader & University Professor and Research Assistant, Plant
Pathology Research Laboratory, USM Agricultural Research Center and Philippine Rubber
Research Center (PhilRubber), University of Southern Mindanao 9407 Kabacan, Cotabato,
Telefax: (064) 248-2610 Email: niang~cnan@qaiI.com


ABSTRACT

A severe incidence of black stripe disease caused by Phytophthora
palmivora Butler on the tapping panel of rubber (Hevea brasiliensis
Muell. Arg.) was noted in a rubber plantation of eight-year-old trees
at Matalam, North Cotabato. Symptoms and signs of black stripe of
rubber are described. On-farm trials using ten fungicides as
treatments were done on diseased trees. Results showed that the
most effective fungicides in controlling black stripe disease of
rubber were mancozeb, metalaxyl, oxadiyl, and benomyl.

Keywords: black stripe, Hevea brasiliensis, Phytophthora palmivora, tapping panel


INTRODUCTION

Hevea brasiliensis is the source of virtually all
the world's rubber production. Rubber
growing in Mindanao is one of the most
profitable agro-industrial ventures and
natural rubber is considered its most
indispensable product with a wide range of
technological and industrial uses (PCARRD,
1997).
Rubber is facing fearful problems from
diseases, of which at least 40 have been
reported (Sdoodee, 2004). The potential
threat that diseases pose on rubber is real;
proper disease diagnosis is crucial as a first
step towards appropriating the right disease
management strategy or control measures
(Tangonan et al., 2005).


Phytophthora disease remains one of
the most destructive diseases of most
economically important crops (Tangonan,
1999). Phytophthora disease problems in
rubber are characterized by the following
symptoms: seedling blight and shoot tip blight
(at nursery stage), black stripe (a tapping
panel disease), and splitting/cracking of the
bark and/or collar part of the tree (Tangonan
and Butardo, 2005).
Rubber farmers in Mindanao control
rubber diseases by different approaches, or
more commonly they do not adopt
appropriate control measures at all. Existing
data derived from such control practices
implemented are lacking. Considering the
nature of the pathogens and the prevailing






Tangonan and Butardo 71


climatic regime, empirical data are needed to
evaluate incidence and severity of black
stripe tapping panel disease of rubber caused
by P. palmnivora and test or screen fungicides
for their effectiveness and long term usage
(Tangonan et al., 2005).
This research focused on confirming
the incidence of black stripe disease caused
by Phytophthora palmivora on 8-year-old
rubber trees in a plantation at Salvacion,
Matalam, North Cotabato and formulate
effective control strategy against the disease.

MATERIALS AND METHODS

Collection and Isolation of the Pathogen

A severely infected rubber plantation at
Salvacion, Matalam, Cotabato owned by Mr.
Rogelio M. Raymundo was visited and
surveyed. Previously, the owner came to the
University to ask for help on his rubber
plantation particularly as it concerned the
incidence of what he described as a "serious
and common disease." To confirm initial field
disease diagnosis, specimens of diseased
tapping panel were collected and brought to
the laboratory for direct microscopic
examination. Isolation of the fungal pathogen
followed tissue planting technique and grown
in V-8 Agar (200ml V-8 juice, Campbell Soup
Company Inc., 20g agar, and 800ml water,
pH was adjusted to 6.0 with 10% sodium
hydroxide). Pure cultures were obtained and
kept for characterization study.


On-farm Field Evaluation of Fungicides
Against Phytophthora Black Stripe of
Rubber

After disease diagnosis, Mr. Raymundo
offered the use of a portion of his rubber
plantation for an experiment aimed at treating
his black stripe-infected rubber trees. A
fungicide field trial was then set up or
conducted in the sampled one ha area. This
also served as on-farm and extension demo-
outreach of the University of Southern
Mindanao to showcase appropriate
technologies used as interventions to control
or minimize the effect of black stripe disease
of rubber.
Ten locally available fungicides were
tested in the field for efficacy against
Phytophthora black stripe. These were:
mancozeb (Dithane M-45), copper hydroxide
(Funguran-OH), captain (Captan), methyl
thiophanate (Topsin 70), fosetyl-AI (Aliette
80), chlorothalonil (Rover), copper
oxychloride (Vitigran Blue), methyl DL-N
(Ridomil MZ), and oxadixyl (Sandofan).
Sampled trees were tagged and
painted for color coding of treatments. The
treatments, mixed with sticker, were applied
by brushing method for better penetration on
the panel. Disease assessments were done
by measuring the lesions (mm) with the use
of a tape measure. Each experimental unit
had 15 trees replicated three times. A total of
495 trees were included in the study.
Efficacy of fungicides was based on the
arbitrary rating scale below:


Percentage disease severity was based on the disease index below:


DI (%) =


ONo+ 1N1 + 3N3+ 5N5+ 7N7


X 100


7 (N)

where: ONo..........7N7 = number of plants showing the rate of 0, 1, 3, 5, and 7,
7 = Highest rating scale
N = Total number of sampled plants
Percentage degree of control was computed using the formula below:






72 Control of Phytophthora


I %DC=


% DI untreated % DI Treated
%DI untreated x 100


Efficacy of the ten fungicides was assessed using the following arbitrary rating scale:


Degree of Control
75-100
51-74
50 and below


Efficacy
Very Effective
Moderately effective
Not effective


RESULTS AND DISCUSSION

Field Observations
Black stripe incidence on 8-yr-old rubber
trees at Salvacion, Matalam was observed at
100% incidence. Though there were a few
other diseases, it was black stripe that was
very common on the tapping panel. Latex
flow was noted to have been affected
because of the fissures on the tapping panel
of severely infected trees (Fig. 1).
Symptoms

The early symptoms of black stripe are not
obvious: series of sunken and slightly
discolored areas just above the tapping
panel. Later, vertical fissures appear in the
renewing bark; when these were removed,
dark vertical lines are visible. As the infection
progresses, the stripes coalesce forming
broad lesions, finally spreading the full width
of the panel. When the disease is severe, it
extends vertically in the wood as far as 15 cm
below the tapping cut and 2-5 cm upwards on
the regenerating bark. Pads of coagulated
latex sometimes form beneath the bark
causing extensive bark splitting and bleeding
(Fig. 1).

Morpho-Cultural Characteristics
of the Pathogen


Phytophthora palmivora grows abundantly on
V-8 agar medium. The fungus completely fills
in the entire medium or Petri plate up to 90
mm at 300C in 2 to 3 months of incubation.
The colonies are white, aerial, and cottony in
pure culture (Fig. 2). The sporangia are
lemon-shaped and measure from 34.5 57.5
um x 27.5 49.0 pm and oospores with 22
pm to 28 pm (Fig. 3).

Efficacy of Fungicides Against
Phytophthora Black Stripe

Mean disease severity infections of black
stripe (measured based on apparent lesion
length, mm) against ten fungicides is shown
in Table 1. Mancozeb, metalaxyl, oxadixyl,
and benomyl were found effective in
controlling black stripe disease of the tapping
panel of rubber trees after 6 months of bi-
monthly consecutive applications of various
fungicide treatments. The mean infections of
black stripe disease were reduced from an
initial disease rating of 265.75 to a final
rating after 6th assessment of 12.33 mm;
271.75 to 12.33 mm, 299.17 to 13.33 mm,
and 284.92 to 15.17 mm, respectively (Table
1). This means that the application of
fungicides significantly reduced the infection
of black stripe at the rates used. This
comparison was significant at the 2nd
assessment after brushing or application of


I







Tangonan and Butardo /1i


treatments and became more pronounced
until the third assessment. Chlorothalonil,
methyl thiophanate, fosetyl-AI, and captain
also gave comparable results by reducing
black stripe infections (measured through the
apparent lesion length) from an initial disease
rating (DR) of 298.83 to a final rating value of
16.33 mm, 271.67 to 18.33 mm, 305.67 to
26.83 mm, and 251.65 to 21.17 mm but not
as effective as the four fungicides first
mentioned above. Next in rank was copper
oxychloride with 281.75 disease infection and
was reduced to 38.75 mm. Slightly effective
result was noted from the ones treated with
copper hydroxide with a mean initial DR
infection of 274.42 and reduced only to 66.1o
mm. Meanwhile, untreated trees as expected
had increased disease infection from an initial
DR of 256.92 mm and increased to 298.17
mm mean infection (Table 1). Mean disease
infection (mm) of Phytophthora black stripe
as influenced by 10 fungicides in six
treatment applications at Raymundo Farm,
Salvacion, Matalam, Cotabato.
Meanwhile Table 2 indicates the
degree of control provided by the ten
fungicides applied to black stripe-infected
rubber trees at Salvacion, Matalam,
Cotabato. Mancozeb, as shown also in Table
1, provided the highest degree of control at
89.84 (Very Effective) together with oxadixyl
at 88.10; chlorothalonil at 85.40; methyl
thiophanate and metalaxyl at 84.13; captain at
83.49; benomyl at 82.22; fosetyl-AI at 77.77;
copper hydroxide at 60.95 (Moderately
Effective); copper oxychloride at 47.62 (Not
Effective); and the untreated control at 0.00
(Not Effective).
Thus, the application of fungicides to
black stripe-infected rubber trees effectively
inhibited the growth and development of P.
palmivora. Generally, black stripe diseased
trees were able to recover with up to 89.84
degree of control.


SUMMARY AND CONCLUSION

The study aimed to confirm the disease
incidence at Salvacion, Matalam, North
Cotabato and to formulate effective control
strategies against black stripe disease of
rubber caused by Phytophthora palmivora in
the same area.
Black stripe percentage infection was
found high in Matalam, Cotabato (up to
100%). Fungicides such as mancozeb,
oxadixyl, chlorothalonil, methyl thiophanate,
metalaxyl, captain, and benomyl were the
very effective fungicides noted in controlling
black stripe after three months of six bi-
monthly consecutive application of
treatments. These fungicides significantly
reduced the severity of infection of black
stripe-infected trees. With monitoring by the
researchers, treated rubber trees were able
to recover after 6 months of treatment
application thereafter.

LITERATURE CITED

PCARRD. 1997. The Philippines
Recommends for Rubber, Series No.
33-B, DOST, Los Bafos, Laguna, pp
25-34.

SDOODEE, R. 2004. Phytophthora diseases
of rubber: Diversity and management
of Phytophthora in Southeast Asia.
Australian Centre for International
Research Canberra.

TANGONAN, NG. 1999. Host index of plant
diseases in the Philippines 3rd ed,
Philippine Rice Research Institute-
University of Southern Mindanao,
Kabacan, Cotabato, 408 pp.

TANGONAN, NG. 2005. Updates of rubber
diseases in the Philippines. Inter-






74- Control of Phytophthora


national Rubber Conference at
Waterfront Hotel, Lanang, Davao City,
November 22-24, 2005.

TANGONAN, NG and EGG BUTARDO.
2005. Phytophthora causing leaf blight
and stem cracking attacks rubber.
USM RDEP Monitor 25(3):18.

TANGONAN, NG, EGG BUTARDO, JA
PECHO and CP RUANO. 2005.
Managing major diseases of rubber.
USM RDEP Monitor 25(3): 17.


ACKNOWLEDGMENT

The authors express their gratitude to the
Department of Agriculture-Bureau of
Agricultural Research (DA-BAR), Quezon
City, through its Crop Protection Network for
funding this project. Ms. Vilma E. Solilap and
Ms. Cecirly O. Gonzales, former research
assistants, are also acknowledged for their
part in the conduct of this study.


Table 1. Mean disease severity infection of Phytophthora black stripe as influenced by ten
fungicides in six treatment applications at Raymundo's Rubber Farm, Salvacion,
Matalam, Cotabato


TREATMENT


Control
Mancozeb
Copper hydroxide
Captan
Methyl thiophanate
Fosetyl-Al
Chlorothalonil
Copper
oxychloride
Metalaxyl
Oxadixyl
Benomyl
CV (%)
DR Disease Rating


INITIAL
DR
256.92
265.75
274.42
251.65
271.67
305.67
298.83
281.75

271.75
299.17
284.92


ASSESSMENT


1"S
263.17c
217.67ab
246.33bc
222.67bc
264.33"
239.75"
218.17ab
256.67bc

186.67a
193.83a
246.50b
9.48


2nd
269.75e
120.33a
188.17d
120.67a
141.33ab
219.33d
149.08ab
168.08c

114.92a
136.33ab
129.92a
11.53


3rd
272.50e
73.33a
125.50c
90.25ab
97.08ab
182.17d
69.17a
147.25cd

83.502
111.58"
87.58a
15.75


4th
284.679
47.08abc
117.50e
59.92a-d
68.25bcd
173.42'
59.17a-d
775.5cd

36.25a
78.006
45.50ab
15.71


5th
290.83e
19.17a
92.25c
39.00a
36.83a
136.92d
45.00ab
71.17bc

20.67a
32.22a
28.75a
22.18


6 "
298.17e
12.33a
66.10d
21.17abc
18.33abc
36.83c
16.33ab
38.75c

12.33a
13.33a
15.17a
21.93


Means with the same letter superscripts are not significantly different at 5% level of probability using
DMRT.


LL


__






Tangonan and Butardo/


Table 2. Percentage degree of control of ten fungicides against black stripe of rubber at
Raymundo's Rubber Farm, Salvacion, Matalam, Cotabato.


Treatments Degree of Control Efficacy

Control 0.00 Not Effective
Mancozeb 89.84a Very Effective
Copper hydroxide 60.95b Moderately Effective
Captan 83.49-a Very Effective
Methyl thiophanate 84.13a Very Effective
Fosetyl-AI 77.77a Very Effective
Chlorothalonil 85.402 Very Effective
Copper oxychloride 47.62b Not Effective
Metalaxyl 84.13" Very Effective
Oxadixyl 88.10" Very Effective
Benomyl 82.22a Very Effective


Figure 1. Extensive spilling of latex on black stripe-infected tree
of productive stage of rubber







76 Control of Phytophthora


Figure 2. Pure culture of Phytophthora palmivora showing white,
aerial and cottony structure.


Figure 3. Morphological structures of sporangia of P. palmivora
(a ovoid, b spherical, c forming vesicle, d -
releasing zoospore).







Journal of Tropical Plant Pathology 41:77-80


BORIC ACID CONTROLS COLLETOTRICHUM
GLOEOSPORIOIDES IN MANGO


C. J. R. CUMAGUN and A.T. VITOR


Associate Professor 3 and Former Undergraduate Student, respectively, Crop Protection
Cluster, University of the Philippines Los Banos College, Laguna.


ABSTRACT

Anthracnose caused by Colletotrichum gloeosporioides is a major post-
harvest disease in mango in the Philippines. The effect of boric acid was
tested on the disease severity of harvested mango fruits. A significant
reduction of 72-88% anthracnose severity was obtained compared to the
control (P = 0.05). Boric acid did not inhibit mycelial growth of C.
gloeosporioides in vitro, indicating that the disease controlling effects of
boric acid could have resulted from the activation of defense mechanism
in mango fruits.

Keywords: boric acid, Colletotrichum gloeosporioides, induced resistance, mango anthracnose


INTRODUCTION

Anthracnose, caused by Colletotrichum
gloeosporioides, is one of most serious
post-harvest problems of mango. Infection
can occur year round and can result in
blossom blight, excessive shelling after bloom,
cracking or stunting of young fruit and latent
infections prior to harvest (Pordesimo, 1977).
Losses of decay of fresh produce can be
reduced to a certain extent by minimizing
mechanical damage, maintaining the natural
resistance of the produce and storing at
optimal conditions such as low temperature
and high CO2 (15-20%) atmosphere.
However, these beneficial practices may not
be sufficient to protect the harvest produce
from fungal infection.
The application of antifungal agents is
by far the most effective method to control


post-harvest diseases (El Ghaouth et al.
1992). However, chemical control
programmes face imminent problems. First,
there are reports of increasing number of
fungicide-tolerant post-harvest pathogens
(Spotts and Cervantes, 1986). Second, the
public is resistant to fungicide-treated
produce. Most importantly, the current
concern about the environment indicates a
need to limit application of fungicides for plant
disease control. Moreover, quiescent
infections induced by C. gloeosporioides
makes chemical control less effective. For
pesticide-free produce and better
environment, there is a growing need to
develop alternative approaches for control of
post-harvest diseases. One innovative
approach that is being actively pursued for
plant protection is the method of induced
resistance.







78 Cumagun and Vitor


Studies on induced resistance for
plant disease control in the Philippines are
very limited. In mango, the use of a non-
pathogenic mutant of C. gloesporioides has
been explored to control anthracnose but no
further studies were done (Ugay, 2004).
Vitor (2004) screened nine chemicals
as potential elicitors of mango resistance
against C. gloeosporioides in vivo. She
found boric acid, chitosan, isonicotinic acid
and benzothiadiazole to be most promising.
Boron (active ingredient: boric acid) is
a mild chemical that is used by growers as a
fertilizer spray to improve fruit set. Boric acid
has been found to be very effective in
managing Eutypa dieback of grapevines
(Rolshausen and Gubler, 2005) and
Streptomyces scab of potatoes (Maheshwari
and Saini, 1994). However, the mechanism of
action of boric acid has not yet been explored.
The objective of the study is test boric acid as
a potential elicitor of resistance of mango
against C. gloeosporoides.

MATERIALS AND METHODS

In Vivo Test

A pathogenic strain of C. gloeosporoides
was isolated from naturally infected mango
(cv. Carabao) fruit and maintained in potato
dextrose agar slants at 40C. Boric acid at
different concentrations (2.5%, 5%, 7.5%,
10%) were prepared by dissolving in distilled
water. Inoculation was done by dropping 10
pl of 1x 106 conidia per mm on three marked
areas of the unripe mango fruits 24 hr after
placement of boric acid. Inoculated fruits
were laid on plastic trays and placed inside
plastic bags supplied with abundant moisture.
Plastic bags were removed after four days
and fruits were incubated at 280C. Three
replicates were made for each treatment.


Test for Induced Resistance


Seven-day old fungal disc (6 mm) of C.
gloeosporioides was inoculated into PDA
plates amended with 2 ml of boric acid
containing using four concenttrations (250,
500, 750 and 1000 ppm). Five replicates
were used for each concentration. Plates
were incubated under 20 Watt fluorescent
light at 280C. Growth measurements in mm
were determined when the growth on the
control reaches the edge of the plates.

RESULTS AND DISCUSSION

The use of boric acid significantly reduced
anthracnose severity compared to the
untreated control (Fig. 1 and Fig. 2).
Regardless of the varying concentrations of
boric acid used, the levels of disease control
were similar. No phytotoxic effect of boric
acid on the fruit was observed even at the
highest concentration; thus, boric acid can
be an ideal post harvest treatment that
necessitates blemish free products yet
environmentally safe and relatively non-toxic
to consumers.
Boric acid showed minimal or no
inhibitory effects on the mycelial growth of C.
gloeosporioides (Fig. 3), suggesting that
control of anthracnose could be due to the
activation of natural resistance mechanism
of the mango fruit. Increasing concentration
of the chemical did not further inhibit the
growth supporting the absence of typical
dose-response curve. This is an evidence
suggesting that reduction in anthracnose
severity results not from direct effects of the
chemical on the pathogen but from a fruit
reaction to the chemical. Mild or absence of
fungitoxicity and the absence of a typical
dose-response correlation known for toxic
compounds are two important criteria of
induced resistance (Steiner and Schonbeck,
1995). Conidial germination in the peel of fruit
treated with boric acid was microscopically
examined. Germination of conidia treated








Boric acid controls (9


with boric acid was about 78% as
compared to 96% in the untreated control
(data not shown), which further supports our
hypothesis of the mild toxicity of the chemical.
We surmised the possibility of
chemical elicitors such as boric acid to elicit
the resistance mechanism of the mango fruits
by delaying the decay and increasing the
concentration of antifungal compounds like
resorcinols present in the mango peel (Droby
et al., 1986). The latter test should be verified
by extraction and quantitative analysis of the
chemical.

LITERATURE CITED

DROBY, S, D PRUSKY, B JACOBY and A
GOLDMAN. 1986. Presence of an
antifungal compound and its relation
in the latency of Alternaria alternate in
unripe peel of mango fruits.
Physiological and Molecular Plant
Pathology 29:173-183.

EL GHAOUTH, A, J ARUL, J GRENIER and
A ASSELIN. 1992. Antifungal activity
of chitosan on two postharvest
pathogens of strawberry fruits.
Phytopathology 82:398-402.

MAHESHWARI, SK and LC SAINI. 1994.
Evaluation of boric acid against
common scab disease Streptomyces
scabies of potato. Test of
agrochemicals and cultivars. 15:28-29.

PORDESIMO, AN. 1977. Diseases of mango
and papaya. In: P.M. Halos et al., eds.


Proceedings of the Symposium on
Philippine Phytopathology. Phil.
Phytopathol. Soc., Inc., College,
Laguna. pp 152-153.

ROLSHAUSEN, PE and WD GUBLER. 2005.
Use of boron for the control of Eutypa
dieback of grapevines. Plant Dis.
89:734-758.

SPOTTS, RA and LA CERVANTES. 1986.
Populations, pathogenicity, and
benomyl resistance to Botrytis spp.,
Penicillium spp. and Mucor piriformis
in packing houses. Plant Dis. 70:10-
108.

STEINER, U and SCHONBECK. 1995.
Induced resistance in monocots. In:
Induced Resistance to Diseases in
Plants. Hammerschmidt, R. and Kuc,
J. Kluwer Academic Publishers,
Netherlands. 86-100.

UGAY, VL. 2004. Induced resistance in
'Carabao' mango (Mangifera indica L.)
fruit to Colletotrichum gloeosporioides
Penz. by its non-pathogenic mutant.
Ph.D. Thesis, University of the
Philippines Los Banos, College,
Laguna.

VITOR, AT. 2000. Induced resistance of
mango (Mangifera indica L.) against
Colletotrichum gloeosporioides Penz.
using different chemical elicitors.
B.S.A. Thesis, University of the
Philippines Los Bafhos, College,
Laguna. 79p.








bU Cumagun and Vitor


60


40 0
30-

20

10


0 2.5 5 7.5 10
Boric acid concentration (%)

Figure 1. Disease severity of anthracnose on mango fruits treated with
different levels of boric acid. Disease severity is based on
percentage inoculated area infected.


Figure 2. Symptom development of anthracnose on mango fruits treated with
different levels of boric acid 6 days after inoculation.










Figure 3. Growth of C. gloeosporioides on PDA
amended with different concentrations
(ppm) of boric acid.







ABSTRACTS OF PAPERS PRESENTED
DURING THE 36TH PMCP ANNIVERSARY AND SCIENTIFIC CONFERENCE
HELD AT PHILRICE, NUEVA ECIJA ON MAY 3-6, 2005


Paper Presentation

Innovation and enterprise in science and
technology: the science plus paradigm
in pest management. P. S. Teng

Innovation has become a core activity in
many business and scientific enterprises
and is considered key to remain competitive
in a globalized economy. Education and
research institutions are subject to the
same drivers as private corporations with
respect to product and service
differentiation, and market definition. The "I
& E" paradigm enshrines thinking and tools
to convert new ideas into opportunities for
growth. Education institutions face
increasing challenges to incorporate "I & E"
into their curricula so that their graduates
have skill sets that positively differentiate
them in the marketplace. An illustrative
curriculum to impart "I & E" skills would
include a) Basic science entrepreneurial
skills such as Grantsmanship (How to write,
submit and win a competitive grant) and
Resource Mobilization (How to develop an
integrated RM strategy and plan); b) Adding
value to a proposal, such as etiquette and
protocols for success in relationship
building, and Risk Communication theory
and tools; c) Product development, such as
Defining the pathway of product concept to
blockbuster, and Developing and keeping
FTO (Freedom to Operate); and d)
Sourcing ideas and innovations, such as
Nurturing innovation, and Nurturing an
entrepreneurial environment and culture. In
a science and technology environment, a
"Science Plus" grounding renders
competitive advantage for developing and
offering services in pest management. At
various levels, the role of "Sparks" and
"Shapers" require recognition, nurturing and
room for expression. Innovation is also
increasingly about teamwork, and the
creative combination of disciplines and
perspectives purposefully assembled. This
is particularly important for IPM. Firms that
innovate on impulse are poor performers.


Innovation audit management audits help
reveal deficiencies in organizations, some
of which may be corrected by skills
development or structural change in the
organization.

Association of phytoplasmas with
papaya crown yellows (PCY) disease A
new disease of papaya in Northern
Mindanao. R.G. Billiones, M.P.Natural,
K.S. Gibb, C.V. Streten, L.Trans-Nguyen,
C.M. Vera Cruz and E.Y. Ardales

"Papaya crown yellows" (PCY) disease of
unknown etiology was first observed in
Northern Mindanao in 2001. PCY is
hypothesized to be associated with
phytoplasma because its symptoms are
similar to phytoplasma diseases of papaya
in Australia. To investigate its etiology, leaf
samples from PCY-infected plants and
leafhoppers from Misamis Oriental and
Bukidnon were subjected to polymerase
chair reaction (PCR) using phytoplasma-
specific primers. All PCY-infected samples
from Natumolan, Misamis Oriental and
Malitbog, Bukidnon were positive to
phytoplasmas using the fU5/rU3 and
fU5/m23sr universal primers but none gave
positive signals to group-specific primer Tuf
140/r1150. All symptomless samples gave
no amplified products on all occasions.
One leafhopper from Nasalaban, Misamis
Oriental identified as Nephotettix
nigropictus gave positive signals to both
universal and group specific primers. RFLP
analyses of the 16S rRNA gene indicated
that the phytoplasmas associated with PCY
disease was identified to Ca P. aurantifolia
-TBB and SPLL-V4 strains, the
phytoplasmas associated with papaya
yellow crinkle and papaya mosaic in
Australia. The leafhopper phytoplasma, on
the other hand, was distinct from all
phytoplasma reference samples but
sequence analysis of the 16S rRNA gene
showed that it was 98% similar to maize
bushy stunt phytoplasma. There was no







82 Abstracts of papers presented


evidence to show that the leafhopper was
one of the vectors of PCY disease.

Epidemiology and control of freckle
disease in commercial banana
plantations. BM Corcolon and AD
Raymundo

The epidemiology and control of the banana
freckle disease, caused by Phyllosticta
musarum, was studied in two commercial
banana plantations in Guihing, Davao del
Sur and Tampakan, South Cotabato. The
development of freckle symptoms on the
leaves and fruits of three banana cultivars
were characterized and analyzed.
Correlation analysis was used to determine
the relationships among disease
development, sporulation, and weather
factors in the two plantations. Yield loss due
to the disease was likewise quantified.
The severity of freckle leaf infection
was highest on cultivar Cardava using both
pure culture and infected leaf washing as
sources of inoculum. The incubation period
of freckle on the leaves ranged from 10 to
27 days on Cardava, 8 to 44 days on
cultivar Lacatan, and 16 to 28 days on
cultivar Cavendish. On the fruits, incubation
period on field-inoculated immature
Cavendish fruit ranged from 4.5 to 6 days
using infected leaf washing and 5.25 to 7.5
days using pure culture. The incubation
period on detached mature harvestable
Cavendish fruit was 11 days. Disease on
field-inoculated Lacatan and Cardava fruits
has average incubation periods of 6.7 and
38.3 days, respectively, while on detached
immature fruits, the values were 9.4 to 11
days and 11.6 to 15.8 days, respectively.
At the Guihing plantation, only
rainfall had a major influence on the
development of freckle disease. Sporulation
of P. musarum was affected by rainfall,
temperature and relative humidity. Disease
severity, number of leaves with symptoms
and youngest leaf with symptoms were
highly correlated with the amount of conidia
produced. At the Tampakan plantation,
rainfall and temperature were the major
weather factors affecting freckle
development while relative humidity, leaf


wetness, and temperature influenced
pathogen sporulation. There was significant
correlation between total number of leaves,
disease severity, number of leaves with
symptoms, youngest leaf with symptoms
and the amount of population. Spore
trapping indicated that conidia of P.
musarum could be dispersed by wind. In
the absence of an effective fungicidal
control method, production losses were
highly significant due to rejections and
downgrading of infected fruits. Fruit
rejection and downgrading to Class B due
to freckle disease were 53 and 51 percent,
respectively. Total production loss due to
rejection and downgrading was valued at
P40,821 per hectare per year.

Induced resistance in 'Carabao' Mango
(Mangifera indica L.) fruit to
Colletotrichum gloeosporioides Penz by
its non-pathogenic mutant. V.P. Ugay
and L.L. Ilag

A UV mutant of Colletotrichum
gloeosporioides penz. that is non-
pathogenic to mango fruit, non-toxin
producing and non-antagonistic to its wild
type counterpart, was used to induce
resistance against anthracnose in
harvested mature green 'Carabao' mango
fruits. The mutant grew profusely and
sporulated abundantly in potato dextrose
agar in a wide range of pH (4-9) and
germinated in 10 hr.
Spray inoculation on freshly
harvested mango fruits of spore suspension
(107 conidia ml') of the non-pathogenic
mutant in 20 hr prior to challenge with the
wild type isolate (104 conidia ml'1)
significantly reduced anthracnose severity
by 14% and disease incidence by 39%.

Genetic variation and segregation of
DNA polymorphism in Gibberella zeae
detected with AFLP and RAPD markers.
CJR Cumagun, H.K. Parzies and T.
Miedaner

A parent cross between two
deoxynivalenol-producing Gibberella zeae







Abstracts of papers presented 83


FG24 (Szeged, Hungary) x FG3211
(Sersheim, Germany) belonging to lineage
7 was analyzed for segregation of
polymorphic markers among 153 progeny
using Amplified Fragment Length
Polymorphism (AFLP) and Random
Amplified Polymorphic DNA (RAPD). Fifty
six RAPD primers and 31 AFLP primer
combinations were screened for
polymorphism between the parents. High
proportion of segregation distortion among
progeny was observed using selected
primers. Genetic distance of the two
parents was compared to isolates lineage 7,
Z-3639 (Kansas) and lineage 6, R-5470
(Japan). Rate of polymorphism between Z-
3639 and R-5470 was about three to four
times greater than between FG24 and
FG3211. Isolate Z-3639 was closely
associated to FG24 and FG3211 whereas
R-5470 was genetically separated based on
cluster analysis, thus confirming their
lineage grouping. Genetic distances among
the four parents using AFLP and RAPD
markers were correlated, but association
between molecular markers and the
aggressiveness of G. zeae population
could not be established.

Histological and molecular
characterization of orchid mycorrhizal
fungi (OMF) in the Philippines. J.I. Yago,
T.H. Quimio and M.B. Brown

The study was conducted to examine and
characterize the different isolates of
Ganoderma sp., an orchid mycorrhizal
fungus in the Philippines. Specifically,
it aimed to examine the morphological and
histological characteristics of pathogenic
Ganoderma sp. and to determine the
differences between pathogenic and non-
pathogenic isolates by polymerase chain
reaction (PCR). Twelve isolates were
collected, isolated and characterized.
Taxonomic characterizations of both
macroscopic and microscopic features were
made. Out of the twelve Ganoderma
isolates, ten were documented as non-
pathogenic rad two were pathogenic in
axenicialy culti.red orchids. However, not ai!


non-pathogenic isolates were mycorrhizal in
nature. Only five were found to be effective
mycorrhizal symbiots. The isplateU MBFI
obtained from BIOTECH, VAIMAaboratory
was the most effective mycorrhizal
symbiont. Histological studies showed that
pelotons developed inside the epidermal
and cortical cells of roots treated with
isolate MBFI.
Confirmatory tests were conducted
with the use of polymerase chain reaction
(PCR) for differentiating the pathogenic
from the non-pathogenic Ganoderma
isolates. The use of internal transcribed
spacers (ITS) primers such as ITS 1 (5'
TCCGTAGGTGAACCTGCGG 3') AND ITS
4 (5' TCCTCCGCTTATTGATATGC 3')
were effective in differentiating isolates that
were pathogenic from non-pathogenic
Ganoderma. A PCR product obtained of
about 580 bp was seen on both non-
pathogenic and pathogenic isolates,
however additional bonds were amplified
with a PCR product of 520 bp observed on
pathogenic isolates.

Production of RTBV- and RTSV-specific
antisera using cloned and expressed
rice tungro virus coat protein genes.
M.G. Maramara Babb, A.A. Dela Cruz and
J.C. Duque

Tungro is the most important virus disease
of rice today. It is caused by a joint infection
of rice tungro bacilliform virus (RTBV) and
rice tungro spherical virus (RTSV). We have
successfully used the RTBV coat protein
(CP) gene for RTBV-specific antisera
production. Traditional procedure of RTBV
and RTSV antigen preparation is being
hindered by the low virus concentration in
the plant because of the double
RTBV/RTSV infection. It is difficult to
biologically separate RTBV from RTSV and
vice versa, coupled with the long, tedious
process of virus purification. Because of
this, serology cannot be applied to large
scale indexing which requires enormous
amount of specific antisera and a consistent
supply of antigen for immunization
ourposes







_ _Abstract of papers presented


Previously, we have cloned the
Maligaya strain CP gene of RTBV. In this
study, this gene was successfully
expressed in Escherichia coli cells as a
55KDa protein on SDS-PAGE. The CP
transcript, bound to a Maltose-Binding
Protein, was affinity-purified and used to
induce RTBV-specific antisera production in
rabbit. The RTBV-CP from immune bleed
was successfully detected by indirect
enzyme-linked immunosorbent assay
(ELISA) and Western blot using both the
anti-Maltose Binding Protein serum and anti
whole-RTBV serum. The RTBV-specific
antisera is now being optimized for large-
scale application while the RTSV-CP,
cloned from a Maligaya strain of the tungro
virus is currently being affinity-purified to
produce RTSV-specific antisera.
This innovative technique greatly
reduced the inconvenience brought by the
strenuous traditional procedure of antigen
preparation and purification. The antisera
produced can be used as many laboratories
and researchers for immunological, genetic
and epidemiological applications. As
equally important, the coat protein genes
can be tapped for coat protein-mediated
resistance in transgenic rice as done by
other researchers on other crops.

Use of thymol to manage Meloidogyne
spp. and Ralstonia solanacearum in
fresh market tomato. P. Ji, J.R. Rich, M.T.
Momol and S.M. Olson.

Efficacy of a plant-derived volatile
compound thymol was evaluated under
greenhouse and field conditions to root-knot
nematodes and bacterial wilt on tomatoes
caused by Meloidogyne spp. and Ralstonia
solanacearum, respectively. In two
greenhouse trials, soil infested with
Javanese root-knot nematodes were
treated with three concentrations of thymol.
Tomato seedlings (cv. Solar set) were
transplanted into treated soils and galling
and eggs of nematodes on roots were
enumerated. Application of thymol at a
concentration of 100, 200, or 400 ppm (mg
per liter of soil) significantly reduced root


gall indices and egg numbers compared to
the untreated control. Thymol treatment at
400 ppm was the most effective, which
eliminated eggs on the roots and provided
the largest reduction in root galling. In
separate greenhouse trials, thymol
treatment of soils infested with R.
solanscearum, at 400 or 700 ppm of
thymol, reduced population of this bacterial
pathogen to undetectable levels and 700
ppm of thymol prevented bacteria! wilt
development completely on tomato. Thymol
was further evaluated in a field trial for
management of root knot and bacterial wilt.
The field was artificially inoculated with M.
arenaria and R. solanacearum and thymol,
with and without 1,3 dichloropene (1,3-D),
was applied trough drip irrigation lines
under polyethylene mulch. Application of
thymol at a broadcast rate of approximately
73 kg/ha significantly reduced bacterial wilt
on tomato (cv. Solar Fire). Bacterial wilt
incidence reached 97.6% in untreated field
plots while in thymol-treated plots only
26.2% of plants wilted at the end of the
season. Application of thymol in conjunction
with acibenzolar-S-methyl (Actigard) on
tomato provided significant reductions of
nematode galling on roots and bacterial wilt
incidence compared with thymol applied
alone. Combined use of thymol, Actigard
and 1,3-D showed to be the most effective
in reducing root knot and bacterial wilt.
These studies indicate that thymol is
effective in control of Meloidogyne spp. and
R. solanacearum and has the feasibility to
be used as a soil biofumigant for integrated
disease management in tomato production.

Efficacy of hypovirulent binucleate
Rhizoctonia sp. to control sheath blight
in rice caused by Rh;zoctonia solani
Kuhn. R.L. Galang, C.B. Pascual and A.L.
Lalap

The efficacy of hypovirulent binucleate
Rhizoctonia sp. to control sheath blight in
rice caused by Rhizoctonia solani Kuhn
was studied. The factors used were: factor
A- hybrid rice: Mestizo 1, Rizalina 28, and
Rizalina 38; and Factor B- Rhizoctonia







ALstracts of papers presented bb


inoculation: untreated control, virulent
isolate only, Rhv7 isolate only,
simultaneous application of Rhv7 and
virulent isolate, 3 days Rhv7 pre-inoculation
+ virulent isolate and 5 days Rhv7 pre-
inoculation + virulent isolate with three
replications. Pre-incubation of Rhv7 for 3
and 5 days on the test plants before
challenge-inoculation with the virulent strain
resulted in the suppression of disease
incidence, lower relative lesion length, and
significantly increased protection from
sheath blight disease. There was also
significant delay on the onset of disease
development.
Rizalina 28 and Rizalina 38 had
longer incubation period and were equally
efficient in lowering relative lesion length
than Mestizo 1. This led to a significantly
higher protection from sheath blight
disease. Interaction between hybrid and
Rhizoctonia inoculation showed that 3 days
and 5 days of Rhv7 pre-incubation on
Rizalina 28 and Rizalina 38 before
challenge inoculation can comparably lower
relative lesion of sheath blight by 30 days.
These hybrids challenge-inoculated after 3
and 5 days of Rhv7 pre-incubation
significantly increased percentage
protection and provided higher grain yield
per pot, and higher computed yield per
hectare than plants without Rhv7.

Genetic mapping of pathogenicity and
aggressiveness of Gibberella zeae
(Fusarium graminearum) towards wheat.
C.J.R. Cumagun, R.L. Bowden, J.E.
Jurgenson, J.F. Leslie and T. Miedaner

Gibberella zeae is the major fungal
pathogen of Fusarium head blight of wheat
and produces several mycotoxins harmful
to humans and domesticated animals. We
identified loci associated with pathogenicity
and aggressiveness on an Amplified
Fragment length Polymorphism (AFLP)-
based genetic map of G. zeae in a cross
between a lineage 6 nivalenol producer
from Japan and a lineage 7 deoxynivalenol
producer from Kansas. Ninety-nine progeny
and the parents were tested in the


greenhouse in two years. Progeny
segregated qualitatively 61:38 for
pathogenicity:nonpathogenicity. The trait
maps to linkage IV adjacent to loc; that
affect colony pigmentation, perithecium
production, and trichothecene toxin amount.
Among the 61 pathoGenic progeny, the
amount of disease induced
(aggressiveness) varied quantitatively. Two
reproducible quantitative trait loci (QTL) for
aggressiveness were detected on linkage
group I by simple internal analysis. A QTL
linked to the TR15 locus (trichodiene
synthase in the trichotecene pathway gene
cluster) explained 51 percent of the
variation observed and a second QTL
some 50 cM away, 29% of the phenotypic
variation. TR15 is tightly linked to the locus
controlling trichothecene toxin type. The two
QTLs, however, were likely part of the same
QTL by composite interval analysis.
Progeny that produced deoxynivalenol
were, on average, about twice as
aggressive as were those producing
nivalenol. No transgressive segregation in
this interlineage cross suggests that
relatively few loci for pathogenicity or
aggressiveness differ between lineage 6
and 7.

Evaluation of local banana cultivars for
resistance to Radopholus similis and
Meloidogyne incognita under
greenhouse condition. D.C. Pantastico,
R.A. Zorilla, T.O. Dizon, D.M. Hautea, I.
Van den Bergh and D. de Waele

Different local cultivars of banana (Musa
acuminata) were evaluated for resistance to
two important nematode species,
Radopholus similis and Meloidogyne
incognita in the greenhouse. Three foreign
cultivars were used as resistant and
susceptible checks. Plant growth
parameters, root damage and number of
nematodes recovered were taken.
The plant growth parameters of the
uninoculated and inoculated tissue- cultured
banana plants were compared. For R.
similis, results showed that inoculated
plants had decreased growth







86 Abstracts of papers presented


measurements. In terms of root weight, the
inoculated cultivars Binalatong, Yangambi
Km 5 and M. acuminata had higher value
than the rests. For M. incognita, the
uninoculated cultivars Bungulan had the
highest plant height while Lakatan Cavite
had the highest shoot and root weight.
On root damage assessment, Grand
Naine, Yangambi Km 5, Umalag and Gros
Michel had higher percent necrosis due to
R. similis while Pisang Jari Buaya had the
lowest. On the number of R. similis per 5 g
fresh roots, cultivars Umalag, Bungulan,
Grand Naine and Lakatan Cavite exhibited
the highest count while Pisang Jari Buaya,
the lowest count. Cultivars Umalag,
Bungulan and Grand Naine had 239, 183
and 1167 total egg-laying females of M.
incognita, respectively. Grand Naine, Gros
Michel and Bungulan had the highest
average number of M. incognita per 5 g of
fresh roots compared to other cuitivars.
Pisang Jari Buaya showed the least
average nematode count.

Unraveling the cause of namamarako in
bittergourd (Momordica charantia L.). D.
Peters, N. Konster, M. Cabfilan, C.H.
Ralatero, K. Verhoeven, F. Makamba and
C. Relevante

'Namamarako' (NMK) or maleness
tendency is recently considered the most
serious production constraint in commercial
ampalaya (bittergourd) production in the
Philippines. Typical symptoms include leaf
wrinkling followed by thickening of the older
leaves that appear shiny or plastic in
appearance. Eventually, the older leaves
most often exhibit yellow patches and the
number of female flowers is severely
reduced, hence the term 'namamarako.' In
severe infection, affected plants are stunted
and even male flowers are hardly produced.
For many years, the real cause of this
'disorder' has puzzled bittergourd farmers,
agriculturists, seed industry people, and
crop scientists within and outside the
country. At some point, a genetic or
physiological disorder was either proposed
but no clear evidence was obtained. An


intensive collaborative research work
between Wageningen Agricultural
University and East West Seed Co.
researchers finally led to the identification of
the causal pathogen. Mechanical
transmission tests (sap inoculation, leaf
bruising, razorbladee' and pin-prick
methods) as well as transmission tests
using known vectors of plant viruses
(aphids, whiteflies, thrips, and leafhoppers)
were studied. Two methods of grafting (cleft
and wedge-type) were also tested. It was
found that NMK was not transmitted
mechanically but can be transmitted
through grafting and also transmitted
through aphids (Aphis gossypii and Myzus
persicae). The mode of transmission is in a
persistent manner with at least 20
viruliferous aphids giving 100% infection
rate. Using serology and electron
microscopy, it was determined that the
cause of the disorder is a virus serologically
related or identical to the cucurbit aphid-
borne yellows virus (CABYV) that was first
isolated in France in 1992 (Lecoq, et al.,
1992). Further studies using molecular
approach (immnocapture RT-PCR and
sequence analysis of coat protein) revealed
96% homology between NMK and CABYV,
indicating that both viruses are strains of
each other. This research breakthrough has
led to the development of the first DAS-
ELISA antisera based on the NMK
Philippine isolate that is now being used for
the proper detection, diagnosis and host
plat resistance screening work that will
eventually benefit our bittergourd farmers
nationwide.

Use of improved cultivars and clean
planting materials as tools for managing
banana diseases. M.A.G. Maghuyop, I.
Van den Bergh, V.N. Roa, K.H. Borromeo
and A.B. Molina, Jr.

Banana is the most important fruit crop in
the Philippines in terms of area planted and
volume. It is also the number one
agricultural export commodity. Recently,
however, A number of diseases, notably the
banana bunchy top-top virus (BBTV) and







Abstracts of papers presented


the Fusarium wilt, devastated the small
scale banana industry of the country. The
spread of these diseases was so alarming
that it became epidemic in Northern
Luzon, devastating the many small holder
banana plantings in the region. Hence,
research and development efforts to
alleviate this problem shifted towards
management of the diseases and
rehabilitating the country.
High-yielding Musa hybrids with
known resistances to certain diseases are
available through INIBAP's partner breeding
institutions. These improved cultivars have
been made available in the Philippines
through National repository, Multiplication
and Dissemination Centers which are in
IPB-UPLB and BPI-DNCRDC. The use of
disease-free tissue cultured planting
materials of the improved disease-resistant
as well as local cultivars can help in
lowering the disease inoculum efficiently
through time. Coupled with improved
cultural management, these are very cost
effective tools for managing banana
diseases. This approach could help
rehabilitate the banana industry of the
country.

Poster Presentation

Nitrogen fertilization and severity of
bacterial leaf blight, Xanthomonas
oryzae pv. oryzae (ex Ishiyama) Swings
et al., in relation to yield of hybrid rice.
G.B. Amar, M.P. Natural, O.S. Opina and
R.P. Robles

Bacterial Leaf Blight is the major disease of
hybrid rice both in F1 and hybrid rice seed
production. In ordinary rice, BLB causes
about 20-30% loss (Ou, 1985) and up to
50% (Huang et al, 1997). It is considered as
destructive because it infects rice from
seedling to maturity stage.
In rice culture, nitrogen (N) is an
indispensable fertilizer to produce better
yield by a) increasing dry matter
accumulation for grain filling and b) raising
the number of filled grains per panicle.
However, when BLB is present, excess N


increases its severity particularly on
susceptible variety. Hence, for hybrid
production, disease management is
recommended to focus on the proper
application of nitrogen fertilizers.
The study was conducted to a).
determine the effects of nitrogen fertilization
on severity of BLB, b). identify the effects of
N and BLB on yield of PSBRc72 and c).
identify the amount of N that can be
recommended for the management of BLB.
Results showed that N affects both
BLB severity and yield of PSBRc72H,
particularly panicle development and
percentage of filled grains. BLB does not
cause significant negative effects on yield of
PSBRc72H during the dry season, however
it is severe during the wet season on plants
applied with N higher than 60 kg N/ha which
caused increased number of filled spikelets.
N can be applied up to 120 kg N/ha in dry
season, higher than that causes an
increase in infection and number of unfilled
spikelets. In wet season, N should be
applied at optimum of 60 kg N/ha, for lesser
BLB infection, better grain filling and better
yield.

Assessment of ornamental shrubs for
resistance to three Meloidogyne species.
J. Sharma and J.R. Rich

Ornamental plant production and
subsequent landscape uses are multi-billion
dollar industries in the southern U.S.A. In
the state of Florida alone, the industry is
value at over one billion dollars (U.S)
annually. Meloidogyne spp. (root-knot
nematodes) often damage ornamental
plants in the landscape and infected plants
lose aesthetic value due to stunting,
chlorosis, wilting and leaf margin necrosis.
Use of indigenous (native) plants in
landscapes is of interest because of low
maintenance requirements, and possible
resistance to pests including plant-parasitic
nematodes. We assessed production of
three root-knot nematode species
Meloidogyne arenaria, M. incognita, and M.
javanica on five plant taxa native to the
southern U.S.A. The plant taxa included







88 Abstracts of papers presented


were: Hydrangea quercifolia 'Oakleaf,'
Viburnum obovatum 'Densa,' Itea virginica,
'Little Henry,' Illicium parviflorum, and
Clethra alnifolia 'Ruby Spice.' In addition,
three commonly grown non-native shrubs,
Ligustrum japonicum 'Texanum,' Ilex
crenata 'Compacta,' and Buxus microphylla
'Wintergem,' were included in the study and
served as susceptible, positive controls. An
interaction between plant taxa and
Meloidogyne spp. was observed, and gall
formation and nematode eggs were
abundant on roots of the three non-native
taxa. Among the plant species tested,
highest gall rating (10) was observed on
roots of I. Crenata 'Compacta' infected with
M. incognita, but highest number of eggs
(6397 eggs/g of roots) was observed in
plants of this cultivar inoculated with M.
javanica. Few or no galls were observed on
roots of the five native plant taxa, and
nematode eggs were recovered only from
roots of I. Virginica 'Little Henry' inoculated
with M. arenaria and M. javanica (13 and 20
eggs/g of roots, respectively). Fresh weight
of shoots and roots was not affected by
nematode inoculation. Due to lack of root
gall development or little or no reproduction
on the native taxa, we conclude that these
are resistant or immune to the three species
of Meloidogyne. Landscape plantings of
these plants, therefore, might be suitable as
an alternative to overuse of commonly
grown shrubs that are susceptible to these
root-knot nematodes. Landscape plantings
of these plants, therefore might be suitable
as an alternative in soil infested with these
species of_Meloidogyne.

Identification of recombinant inbred
lines for Maligaya blast isolate
resistance. J.P. Rillon and A.L. Lalap

Two hundred two RIL lines were evaluated
for resistance to Maligaya isolate under
blast nursery condition. Results showed
that three lines were highly resistant to the
disease in all weeks of evaluation. These
were LxT 392, LxT403 and LxT 447 while
Lxt 446 was resistant on the 28 DAS up to
56 DAS. LxT154 and Lxt 413 showed no


lesion only from 21 DAS up to 42 DAS.
Four lines (Lxt 178, LxT 188, LxT 50 and
LxT 96) were rated highly resistant only
from 21 DAS to 28 DAS while LxT 160, LxT
165, LxT 187, LxT 189 and LxT 407 were
resistant on the 21 DAS. During the
different weeks of evaluation, a decreasing
number of resistant lines and increasing
number of susceptible lines to to the
disease were observed. For detailed
evaluation of resistance of lines against
blast, it should be up to panicle blast
evaluation to really identify the resistance of
the lines. However, the results showed that
late evaluation could be more informative
than early evaluation because some lines
tend to change the reaction up to the later
stages of rice growth and development.

Induced screening of hybrid rice and
component lines to rice tungro virus
(RTV) and green leafhopper (GLH). N.J.C.
Francisco, M.G. Maramara-Babb and J.T.
Dalet

Rice tungro is a composite disease caused
by rice tungro bacilliform virus (RTBV) and
rice tungro spherical virus (RTSV), and
transmitted in a semi-persistent manner by
the insect vector, green leafhopper (GLH).
In this study, a total of 64 hybrid rice and
component lines were evaluated for their
reactions to rice tungro virus and its vector,
with Matatag 9 and Taichung Native 1
(TN1) as resistant and susceptible checks,
respectively using the induced method of
inoculation. Almost all of the inoculated
plants have been infected with rice tungro
disease and have shown a high percentage
reduction in height and high degree of leaf
discoloration. On the first trial, 8 lines
showed tolerance to RTV while there were
9 lines during the second trial. Matatag 9
only exhibited a tolerance reaction while the
rest of the test entries showed a susceptible
reaction, some even more susceptible than
the check TN1. The result confirmed
previous reports that hybrid rice and
component lines do not possess the
gene(s) coding for resistance to RTV and
GLH.







Abstracts of papers presented OU


Bio-efficacy of epiphytic and endophytic
bacteria against rice panicle blight
pathogens. M.S. Desamito, P.S. Torrena,
R.G. Corales, B.D. Tadeo, H.R. Rapusas,
R.T. Cruz and H.X. Truong

Rice panicle blight (RPB) has been reported
as newly emerging disease in North
Cotabato, South Cotabato and Zamboanga
City in 2003 and 2004. The disease posed
a serious problem since yield reduction
reaches up to 70% in the infected fields.
The disease is caused by the bacterial
pathogen complex. Burkholderia glumae
(Kurita and Tabei) Urakami et al. and
Pseudomonas fuscovaginae Miyajima, Tanii
and Akita were prevalent in the infected
seeds (57% and 17%, respectively).
Spraying 17-day old seedlings of varieties
IR 64, PSB Rc 82, SL8H, Mestizo 1, and
Mestizo 3 at 17 day old showed a virulent
and mild isolates of B. glumae and a
virulent isolate of P. fuscovaginalis.
Inoculation of these pathogens by injecting
the 70-day old rice plant induced the
unfilled and and briwn spikelets. Only
endophytic B. pumilus isolates # 5,6,16 and
52, Klebssiella pneumoniae,
Corynebacterium genitalium and B. cepacia
had compatible and synergetic growth
together with P. fuscovaginae while B.
pumilus 21 was antagonistic to B. glumae.
Bio-efficacy test the endophytic isolates is
going on.

Epidemiology of sweet potato viruses in
Central Luzon. E.A. Vasquez, M.K.
Palomar, E. Barsalote and L.B. Laranang

Based on 2000-2003 surveys and
serological testing for sweetpotato viruses
in Central Luzon, the commercial
sweetpotato growing areas in Tarlac were
heavily infected with the 8 known viruses
[Sweetpotato Feathery Mottle (SPFMV),
Sweetpotato Mild Mottle Virus (SPMMV),
Sweetpotato Latent Virus (SPLV),
Sweetpotato Chlorotic Fleck Virus
(SPCFV), C-6, Sweetpotato Mild Speckling
Virus (SPMSV), Sweetpotato Caulimo-like
Virus (SPCalV) and Sweetpotato Chlorotic


Stunt Virus (SPCSV)] mostly in combination
of 2-6 viruses simultaneously infecting the
plant. In terms of incidence and number of
viruses, Paniqui ranked the first followed by
Moncada, Gerona and Capas, Tarlac.
Infection in Bataan was lower than Tarlac.
The factors contributing to the spread of
sweetpotato viruses were the source and
quality of the planting materials, the
insect vectors and alternate hosts. The
practice of getting healthy-looking infected
planting materials from hot spot areas such
as Paniqui or Moncada or bringing them to
Capas or Bataan back to Tarlac every
cropping season perpetuated sweetpotato
virus infection. Inter-field infection was
facilitated by the presence of two insect
vectors, aphids (Aphis gossypii Glover and
Myzus persicae Sulzer- vectors of SPFMV,
SPLV, SPMSV) and whiteflies (Bemesia
tabaci Gennadius- vector of SPMMV,
SPCFV, SPCSV). Several weed species
which are alternate hosts of the vectors also
harbor viruses of sweetpotato.

Enhancing yield of onion (Allium cepa
L.) through mychorrhizal inoculant in
Meloidogyne graminicola-infested soil.
E.B. Gergon, M.B. Brown, and S.A. Miller

Meloidogyne graminicola or rice root-knot
nematode (RKN) and vesicular arbuscular
mychorrhizae (VAM) are both colonizers
exerting contrary effects. RKN reduces
growth and yield of onion while VAM help
absorb nutrients, particularly P, and fight
infection by soil-borne pathogens. The
interaction between RKN and VAM in onion
was studied in P-deficient and completely
fertilized soil in the greenhouse and
naturally M. graminicola infested field at
different fertilizer levels. VAM significantly
increased seedling vigor, height and top
weight of yellow Granex and Red Creole in
nematode-free and infested NPK-deficient
soils and onion yield in NPK-amended soil.
Mixture of Glomus mosseae, G.
fasciculatum and 'Mykovam' increased
yellow Granex's bulb weight and diameter
by 54% and 24%, respectively and Red
Creole's by 23% and 13% correspondingly,







90 Abstracts of papers presented


in sterile soil. In nematode-infested soil,
same mixture increased bulb weight of
Yellow Granex by 26.2% and diameter by
96.4% while Red Creole's increased by
23% and 13%, respectively, with G.
mosseae alone. Results indicate that VAM
increased the tolerance of Yellow Granex to
M. graminicola resulting in increased yield.
Field trial showed that VAM pre-inoculated
Yellow Granex have better growth and yield
performance than those without VAM. In
one experiment, onion yield was
comparable with plants that received full-
recommended fertilizer. In another
experiment, inoculated Yellow Granex
performed better than those without VAM at
low N and available soil P indicating that
additional P and high N were unnecessary
in the field used in this study. This also
shows that VAM can help in substantially
reducing the inorganic fertilizer inputs for
Yellow Granex production especially when
there is sufficient available soil P. VAM,
however, did not show positive effect on
growth and yield performance of Red
Creole in this study.

Identification of two blast resistance
genes Pib and Pita using DNA markers
in IRRI-bred rice varieties. L.A. Ebron, Y.
Fukuta, E. Araki, R.E.M. Santos, M.J.T.
Yanoria, N. Kobayashi and M. Yokoo

Using PCR-based dominant
markers, which were designed based on
the sequence information of blast
resistance genes Pib and Pita, 42 IRRI-bred
rice varieties were evaluated for the
presence of these two genes. This
evaluation was compared with that
conducted by Ebron et al. (2004) who
previously identified these genes among
these varieties using a differential system
involving Philippine blast isolates Pyricularia
grisea Sacc. A primer set for Pita was able
to detect DNA fragments in 26 varieties,
and these results agreed with those of
previous analyses. DNA fragments were
detected in 40 varieties using a primer set
for Pib, suggesting the presence of Pib.
Among these varieties, PSBRc1, IR56, and


IR70 were not previously estimated to
harbor Pib. On the other hand, DNA
fragments were not detected in two
varieties, IR54 and PSBRc18, previously
estimated to harbor Pib. An allelism
analysis will be needed to confirm the
presence of Pib in these five varieties. We
demonstrated that the primer set for Pita
could be a complementary method of gene
identification.

Occurrence and damage potential
assessment of nematodes in different
banana cultivars in Oriental Mindoro,
Philippines. R.A. Zorilla, T.O. Dizon, F.S.P.
dela Cruz, Jr., J.I. Orajay, D.M. Hautea, I.
Van den Bergh and D. De Waele

The team surveyed 27 sites (barangays) in
9 municipalities in the province of Oriental
Mindoro. A total of 108 root samples from
eleven banana cultivars were collected.
Root damage assessment expressed as %
dead roots and % root necrosis were
obtained which ranged from 0-44% and 0-
46.0%, respectively. The most predominant
nematode species found were Radopholus
similis, Helicotylenchus multicinctus,
Pratylenchus spp., Rotylenchus reniformis
and Meloidogyne spp. Banana cultivars
Lakatan and Saba yielded high nematode
density compared with other cultivars.
Some cultivars such as Latundan, Lakatan
and Saba showed positive reaction to root-
knot nematode infection.

Diversity of Peronosclerospora spp.
causing downy mildew in sugarcane
(Saccharum officinarum L.). A.A.
Gumarang, F.M. dela Cueva and C.B.
Pascual

Morphological and molecular
characterization of isolates of
Peronosclerospora spp. causing downy
mildew of sugarcane (Saccharum
officinarum L.) were conducted. Isolates
were collected from sugarcane growing
areas in the Philippines. Measurements of
spore size of the isolates as well as DNA
extraction from spores were done. Isolates






Abstracts of papers presented 91


from Cagayan/lsabela had the largest
conidial size and Tarlac had the smallest.
Isolates were confirmed to be of the genus
Peronosclerospora by the
Peronosclerospora Genus specific (PGS)
primer, rep (REP, ERIC, and BOX) primers
produced polymorphic bands among
isolates but only the ERIC primer
differentiated the isolates based on location.
DNA fingerprints were analyzed from rep
primers using the NTSYS 1.8 software.
Davao isolates were genetically distinct
from Negros isolates as evidenced by the
banding patterns produced by the ERIC
primer. Data on genetic diversity of isolates
based on rep-PCR primer fingerprints will
be used for phylogenetic analysis.
Development of species-specific primers
will be explored and utilized for effective
and accurate pathogen identification.

Field evaluation of biofumigation for
bacterial wilt management in
solanaceous crops. R.G. Bayot, V.P.
Justo, J.P. Dangan and J.A. Kukegaard

The objective of the study was to evaluate
the potential of "biofumigation" as a
component of the integrated management
of bacterial wilt of solanaceous crops. Most
crucifers or Brassicaceous plants have high
glucosinolates (GSL) in their tissues, which
release isothiocyanates (ITCs) when
acted upon by the enzyme myrosinase
during tissue maceration. Biofumigation
seeks to exploit the potent, naturally
occurring ITCs released by cruciferous
plants for bacterial wilt suppression.
Crucifers wastes of broccoli,
cabbage, cauliflower, mustard and radish
were evaluated in various fields known to
have high incidence of bacterial wilt. Plant
materials were either hauled to the
experimental fields from nearby farms, or
suitable crops grown in the area and their
wastes used as fumigants. Freshly
collected materials were either chopped into
small pieces or macerated using Viking GB
350 shredder machine and incorporated
into the soil at a rate of 5 kg tissues per
square meter. Untreated plots and plots


treated with non-Brassica tissue (sweet
potato) served as control or check.
Eggplant or tomato seedlings were
transplanted to plots 4 weeks after tissue
incorporation. Wilt incidence was monitored
in all treatments up to harvest.
At NCPC bacterial wilt nursery (clay
loam soil) with high incidence of bacterial
wilt, plots treated with broccoli, and mustard
tissues had 42.6% and 48.4% wilt
incidence, respectively, compared to 90.5%
wilt incidence in untreated plots. In Liliw,
Laguna (mid-elevation, silt loam soil), 28%
of tomato plants wilted in untreated plots
compared to 5.2%, 8.4% and 11.0% in plots
treated with broccoli, radish and mustard
tissues respectively. In Majayjay, Laguna
(mid-elevation, silt loam) two trials were
conducted. In the first trial, 61.3% of the
tomato plants, wilted in untreated plots
compared to 31.7% and 44.7% wilt
incidence in plots treated with radish and
mustard, respectively. In the second trial,
plots treated with broccoli and cauliflower
had 16.7% and 22.3% wilt incidence,
respectively, compared to 47.2% in
untreated plots. The other biofumigants
were not significantly different from the
control. In Asingan, Pangasinan (silt loam
soil) two trials were conducted. In the first
trial, 26.3% of eggplants wilted in untreated
plots while in plots treated with radish and
mustard as biofumigants, 9.7% and 14.2%
of the plots wilted, respectively. In the
second trial, significantly lower wilt
incidence was observed in plots treated
with cabbage (20%), radish (15%) and
mustard (20%) compared with untreated
plots (31.7%). In Lumban, Laguna (silt loam
soil), the results were not conclusive due to
very low wilt incidence (3%) in the
experimental area.
The results indicated that broccoli,
mustard and radish tissues have the
potential as biofumigants against bacterial
wilt of Solanaceous crops.

Relationship of NMK Luteovirus with the
vector, Aphis gossypii Clover. M.L.J.
Sison, L.M. Dolores, C.H. Balater, M.G. N.
Yebron and C.B. Pascual






Abstracts of papers presented


Ampalaya, Momordica charantia L., is
among the cucurbits of high economic
importance. In terms of hectarage and
total produciton, it ranks second to squash.
The total area accounted for by DA-BAS in
1999 was 8,129 ha. The increasing interest
in ampalaya production coincided with the
occurrence of the "Namamarako or NMK"
(maless) syndrome. It was reported that
NMK was a cucurbit aphid-borne yellow
virus (CABYV). This study was conducted
to determine the virus vector relationship
associated with NMK. Results showed that
aphids can acquire the virus given a feeding
time of 24 hr (Acquisition Access Period -
AAP). In addition to knowing the most
effective AAP, it is also important to
determine the length of time that the aphids
will be able to transmit the virus effectively
(Inoculation Access Period-lAP). It was
observed that as early as 6 hr, aphids can
already transmit the virus but the most
effective IAP were 24 and 36 hr wherein 70
and 90 percent of the plants exhibited
NMK. These treatments which showed
symptoms for NMK virus gave positive


results with ELISA test. Results also
showed that 10 aphids can effectively
transmit the virus but at a lower percentage.
Twenty aphids gave a 100 percent
transmission which means that all plants
showed a positive symptom of NMK virus.


No abstract

Disease reaction and yield performance
of introduced varieties of sugarcane.
F.M. dela Cueva, C.R. Untal, R.T. Luzarran
and A.A. Gumarang

Host Status of eight woody ornamentals
to three Meloidogyne species. J. Sharma
and J.R. Rich.

improvement of rice variety and hybrid
parental lines for resistance to fundal
diseases through genetic engineering.
E.S. Avellaroza, R.G. Espiritu, R.R.
Aldemita, J.S. Rillon, A.A. Alfonso, J.F. Nilo,
M.M. Rosario, M.I. Revita, R.T. Miranda,
D.C.A. Galan and N.S. Garcia




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs