<%BANNER%>
Guyana chronicle
ALL ISSUES CITATION THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00088915/00241
 Material Information
Title: Guyana chronicle
Portion of title: Sunday chronicle
Physical Description: v. : ill. ; 45 cm.
Language: English
Publisher: Guyana National Newspaper Ltd.,
Guyana National Newspaper Ltd.
Place of Publication: Georgetown, Guyana
Publication Date: 4/1/2007
Copyright Date: 2005
Frequency: daily[nov. 21, 1983-]
daily (except monday)[ former dec. 1, 1975-nov. 30, 1983]
daily
regular
 Subjects
Subjects / Keywords: Newspapers -- Georgetown (Guyana)   ( lcsh )
Genre: newspaper   ( sobekcm )
Spatial Coverage: Guyana
Guyana -- Georgetown
 Notes
Dates or Sequential Designation: Vol. 1 (Dec. 1, 1975)-
Numbering Peculiarities: Publication suspended: Oct. 12-24, 1983.
General Note: Sunday ed. published as: Sunday chronicle.
 Record Information
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
Resource Identifier: oclc - 29013105
lccn - sn 93049190
sobekcm - UF00088915_00180
Classification: lcc - Newspaper N & CPR
System ID: UF00088915:00241
 Related Items
Preceded by: Guyana graphic

Full Text



S UNDA Y


The Chronicle is at http://www.guyanachronicle.com


. vO -fnmc-ai'a th inl dn3i d look whichh cr nc ., cUninbute- ito eating diorders tr or engagement ror-the fashion industry. the,media and
Svo l n ry inounmg women. .. advertising,' he said.
PARIS ;Reuters) France will not ban skinny inod- Countries like Spin, Italy, Brazil and India have taken steps WU TH E C MIPLIMENTS F A '
els from Paris catwalks but will introduce a volun- to keep underweight models off" their catwalks due to such con- W rl I1 4V4lll 1"
tary charter to make the fashion industry moe cerns, which drew wide media attention following the deaths of two
aware of the health risks of being very thin, the anorexic Latin American models in 2006.
Health Ministry said Friday. The French Health Ministrv official said a commission review- .
Designers. model agencies and others in the fas.h- ing the issue would not reciominend a blanket man. O .
ion industii hare been widely attacked for promoting ".We are %er) close to an agreement on a %olunlar. char-,


No joke:


4


-' .


TODAY'S encounter between home team West Indies ancd Sri Linka is sold out and the Local Organising Commttee of the Cncket
World Cup (CWC) is appealing to persons withoutt tickets to stay home, for the simple reason that there is none left to bUy.


No ticket? Stay home


3.-sI


Page thr


VLSA


4ia


* ~'l,.' *.* .9


Page three

Postmaster

shot in

$8M

robbery
Page ten


.v


F


SOLD OUT LOC Chairman, Dr. Frank Anthony, second from left, at the briefing. Also in picture are LOC CEO Karan Singh, left, and LOC member
Richard Haniff.


Need assistance? Please call Informalion Desk and asklor Malinda on Tel: 225-6870/2 Ext. 48
34-37 WATER STREET G EORGETOWN


A TICKET TO YOUR
DREAMS!
RESULTS HOTLINE 225-8902


-i


iF3- I :"
--" -";: ;.
":, .:';
Shi~tf^ '*


-r




Z SUNDAY CHRONICLE April 1, 2(


:: ' l' ,'l i .i i
I ll . if l iA. i
fll ir,'i rm j I~r', cI I ,;.
' iI'fl'-;,l f{...l{,l:f~liril~f.l;ijv


/ il', (:ii,w /(.i r l iff'! i1. 11 : if 1./(lJ(rf w J('l"
\Wia ,r, rhlh ,i)' ,f 'f, :l ./-,
^^ 'f)(pbi8i S^ int'fy rf


S- hIP j Ith
C -k4
*~


*-


?~


Ps3 NINTH

WE0iffT0 G]EL
_ ..- -..
K .,. ; .,'-. ',8


ENDO Wii


XBOX'360


psp. Ps2


Tl ki il1iu l


NINTENDO DS LIGHT


U1IIi,'


w.0
,:;-,.


4.:


: '.
: ,, ,


SII


.rn ;:_ i,. r-
lUlllf II't r{'.1" ii. \'ir',.fh',h,
llifI/,p.;r/irhlr li'i" ii,,,i y
I,',r ~l iI, r / 'r/.
.(l risdl.f I _.,g .


I


.---%s


df, hlyeitllll ji





SUiNDAYCliOdliCLE April fi 2007.. -- ...--.----.. 3


No joke:


By Faizool Deo


TODAY'S encounter between
home team West Indies and
Sri Lanka is sold out and the
Local Organising Committee
of the Cricket World Cup
(CWC) is appealing to
persons without tickets to
stay home, for the simple
reason that there is none left
to buy.
SThose persons with tickets
are encouraged to get to the
stadium early so that they can
get into the ground on time.
SChairman of the LOC and
Minister of Culture Youth and
Sport, Dr. Frank Anthony, said
people should not waithalf-an-
hour before the match to get to
the ground.
"The earlier the better -
we want to avoid queues."
The main concern at a press
briefing yesterday at the LOC
office on Middle Street was
that of keeping the packed
house hydrated.
Anthony, a medical doctor,
said there will be five gallon
bottles of water at the ground
and persons will be given water
for free.
But he and Chief Executive
Officer (CEO) of the LOC
Karan Singh suggested that


persons should also walk with
water.
Water in plastic bottles
(even those with labels on)
are now allowed in the
stadium, but according to
the LOC members,
International Cricket
Council regulations
restrict the corks from the
bottles being passed
though the gates with the
bottle. It therefore means
that all water bottles will
be stripped of their corks
at the gates.
The LOC members were
not sure if there was a limit on
the number of bottles a person
can carry in, but Singh said
three bottles per person might
be passed at the gate. I
What was certain is that
the LOC wants patrons to have
fun, but they must comply with
the rules of the ICC on the
prohibited items.
The prohibited items are:
dangerous weapons and
imitation weapons, firearms
and imitation firearms,
knives, explosives, fireworks
and flares, alcohol,
incendiary devices, illegal
drugs or.narcotics, mace or
pepper spray, can and tins and
PET (plastic) bottles other


than water in the plastic
bottles, or insect repellent or
sun screen in either of the
three; megaphones,
compressed air or gas
operated horns and flag
poles, cooler boxes larger
than 12"x12"x12" and they
must be soft and collapsible
since no hard or rigid cooler
boxes would be allowed.
Glass containers are also
banned and only those
containing medication or insect
repellent will be allowed.
Collapsible personal
umbrellas will be permitted,
as will be banners and flags
up to 5' x 3' long, providing
that, in the opinion of the
CWC they are not vulgar,
political, racial,
discriminatory, sexual in
nature, or display advertising
which conflict with the rights
of the partners/sponsors/
suppliers/vendors of the event
(in any language), or deemed
to be offensive to the other
spectators.


The only animals allowed
into the stadium will be guide
dogs, while only small
'transistor radios with ear pieces
or headphones will be allowed.
ICC Chief Executive
Malcolm Speed on Friday
called on musicians and merry-
makers, who traditionally
entertain crowds at Caribbean
cricket matches, to 'bring in the
noise' to the present World
Cup.
"There is a protocol to
allow musical items (into
venues). We want the Caribbean
atmosphere to be here."
He pointed out that the
security measures were common
for major sporting events all
around the world.
"We don't seek to take thie
West Indian flavour out of it. We
want to hear that noise. We want
to hear that enthusiasm."
Persons can now carry
conch shells, shak shaks and
other instruments into the
stadium with permission
from the LOC.


Prince Andrew due

here this week
THE Ministry of Foreign Affairs yesterday confirmed that
His Royal Highness Prince Andrew, Duke of York, will be
paying a short visit to Guyana this week as a guest of the
Government of Guyana.
During his visit, Prince Andrew'will meet President Bharrat
Jagdeo, the ministry announced in a statement.
It said the Prince will be accompanied by Mr. Yohan Eliasch.
a businessman who is interested in investing in Guyana.
His Royal Highness first 'visited Guyana in 2004 as part of
a Caribbean tour. During that visit the Prince met President
Jagdeo and called on Georgetown Mayor Hamilton Green.
While here, he also attended an eco-tourism exhibition sponsored
by the Iwokrama International Centre for Rainforest Conservation and'
Development and visited a number of organizations including the Sil-
vation Army Men's Social Centre.
Prince Andrew is the second son of Her Majesty Queen
Elizabeth II and the Duke of Edinburgh.


i" n'.: ALL VEHICLES FULLY AIR CONDITION
WITH IVD/TV SOUND SYSTEM AND
SS, SPECIALLIGHTINGfEFFECTS.
2 WEDDINGS,EISURE RIDES,
S AIRPORT, IC.
M -'my" SPECIAL WE0IIbNG RATES NOW Oil



S )RIVERS WANTED
H I, I 'AII


FREE TICKET 2007-03-31
LETTER BO m

|c S 8` SQ](9 (41](l)(0.8|,


S -RESULTS

DRAW DATE 2007-03-31


MID-0i


236


947


I.TTLE'-D

737


26

BUTTERFLY


MONDAY


TUESDAY
WEDNESDAY
THURSDAY
FRIDAY '


2007-03-26


2007-03-27
2007-03-28
2007-03-29
2007-03-30
2007-03-31


RESULTS
02 04 09 14 19
10 19 04 14 08
11 16 23 12 17
05 09 14 19 22
05 01 23 09. 07
21 02 12 07 26

0S SB


WE,0ILL
C IPUCHSSIP Y*I


Ui AfNMwfM


YOU, SHOP, WE SHIP AND DELIVER
.,q ,


B. WAL*MART
BUY1
DWI ,
M"" .. fCWCgg


.. ....... .-hI ,i hm "I II *m --- --w-. -i -m W M- EM l ,lk'ink "*, .. ... Jl iIt' *W- '. .i'

^ e-maill customerservice(a ha)int.net WEBSITE: w w.habint.net
..*...... O V 't, iJ-S9 AT'1 PUBLi'"!t'CAD L E CELEBS E.-T. BANK DEME-A.A.tvG.W


Rrui INTni


.. -
.1W '& .^^H^_H
,.8 '* .

'rrrn iTp .,


i>} -. rn ^-. .*H i j& *


q


I a a


~ ~


T -


""


~


WyITH S-


1


"" ,. : :'


---


AMY PRfmnliSUNr .II OlN tu UK ME ^iifiRnIM-





4'- SUNDAY CHRONICLE April 1, 2007,


South Africa

unions vow to

keep up pressure

on Zimbabwe

CAPE TOWN. (Reuters) South Africa's largest labour fed-
eration will keep up pressure on Zimbabwe. its general sec-
retary said yesterday, ahead of this week's protest oier the
deteriorating political and economic situation there.
The Congress of South African Trade Unions iCOSATU). a
member of the ruling tripartite alliance with the African Nauonal
Congress (ANCi, has lambasted Zimbabwe President Robert
Mugabe for "attacks on democracy and human rights".
COSATL's position sharply contrasts with the quiet diplo-
macy advocated by ANC leader Thabo Mbeki. South Africa's
President. who was named by the Southern African Develop-
ment Community (SADC'i to promote dialogue between Mugabe
and Zimbabwe's opposmon.
Mbeki said yesterday he %as confident nesr mediation could
help resohe that country's political criis,s but COSATU' .
Zweln.zima \'a\i said COSATLIU wouldd maintain pressure :on
Harare
"' e are proceedng ith the protest, \\e are not going to
let go because there i' a promise of dialogue." \-aki s.aid tester-
day after organised labour met ". iLh Mbeki in Cape Town.
Ae're hatine demonqnranions ,..n Tuesday and Wednesda, .
we're ha\ ing marches in Johannechurg ,and we'll be marching to
the Zimbabe ean High commissioner's office."
Tensions hate risen shapl., in Zimbabwe in the last two
weeks after police arrested and beat Morgan T'.vang-irai and other
actisis in a mose that spurred widespread international con-
demnation.
Ztmbabwe's annual inflation rate. at over 1.700 per centl. is
the highest in the world outside a war zone and oneinplo mnieni
current. stands at Si per cent Critics blame President Mucabe's
policies.
Va\i unions e.erned pressure t.: force the parties jinolhed to engage
in senous negotiations for a soluii':n to the cri.is.
Asked \\hat the unions %%anied to see Mbeki achiee. Va\'i
told Reuters 'A"\c. hope the arms xLill be twisted tor people to
engage senousl%, the arm of president Mugabe in particular "
He said COSATLI iwas hopeful of a break-through.


Lens'C'raff
0 P T I C A


CASH IN ON OUR PRE-EASTER SALE!!
Our new look for this Easter Holiday varies from:
Italian Designs, Titaniums, Flex 180 temples, Flex rim-less,
Bourgeois and Plastics, etc.

FREE EYE-EXAMINATIONS
FREE FRAMES
FREE REPAIRS (Depending
on damage)
NO UNE BIFOCALS AND
POLYCARBONATE
TRANSITIONS

AT UNBEATABLE PRICES!
PENSIONERS pay with NIS vouchers and
no additional charges
All NIS vouchers are accepted
Call for appointments Tel.#: 223-5865

LEgS CRAFT OPTICAL
"A different frame of mind"


Bush says Iran must


release British 'hostages'


By Jeremy Pelofsky

CAMP DAVID, Md.,
(Reuters) U.S. President
George W. Bush said yester-
day that Iran's detention of
15 British sailors and ma'-
rines was inexcusable and
called on Tehran to release
"the hostages" immediately.
The standoff, which has
helped push oil prices to six-
month highs at a time of
heightened Middle East ten-
sions over Iran's nuclear
programme, showed no signs of
easing.
Iranian President
Mahmoud Ahmadinejad ac-
cused London of mishandling
the aftermath of the March 23
capture of the British person-
nel in the northern Gulf after
Britain expressed concern over
Iranian "sabre rattling."
Iran's ambassador to Mos-
cow said the 15 Britons could
face punishment if found guilty
of illegally entering the Islamic
republic's territorial waters.
Britain, the biggest ally of
the United States in the war in
Iraq, insists its sailors were
seized well within Iraqi waters
while on a U.N.-backed mis-
sion to search for smugglers.
Bush said he supported
British Prime Minister Tony
Blair's efforts to resolve the
matter peacefully and rejected
the idea of swapping Iranians
held by the United States in
Iraq for the detained Britons.
"The Iranians must give
back the hostages. They're in-
nocent," Bush told a news con-
ference at the Camp David
presidential retreat with visit-
ing Brazilian President Luiz
Inacio Lula da Silva.
"The Iranians took these
people out of Iraqi waters, It's


inexcusable behaviour."
Britain's Sunday Telegraph
newspaper quoted a defence of-
ficial as saying London was
prepared to give Iran a guaran-
tee that Royal Navy ships
would never knowingly enter
Iranian waters without permis-
sion.
But it would not apologise
or say that the British boats
were in Iranian waters, the pa-
per said.
'NOT THE LEGAL AND
LOGICAL WAY'
Suggesting no solution was
imminent, Ahmadinejad under-
lined Iranian displeasure that
Britain turned to the U.N. Se-
curity Council and the Euro-
pean Union for support.
"The British government,
instead of apologising and ex-
pressing regret over the action
taken, started to claim that we
are in their debt and shouted in
different international councils,"
state radio quoted Ahmadinejad
as saying.
"But this is not the legal
and logical way for this issue."
After a meeting of EU for-
eign ministers in Germany,
Britain's Margaret Beckett said
she was worried by the Mos-
cow ambassador's words about
potential punishment.
"It is not the first person to
have made sabre-rattling noises,"
she told reporters in Bremen.
"The message 1 want to send is
I think everyone regrets that
this position has arisen. What
we want is a way out of it."
Beckett said Britain had
sent Iran a written reply to its
diplomatic note on the detention
of the sailors but had received
no response.
Iranian Foreign Ministry
spokesman Mohammad Ali
Hosseini said Tehran was "wait-


ing for the British government to
correct its behaviour," the state
broadcaster's Web site reported.
He also defended showing
some of the detainees on televi-
sion a move sharply criticised
by London and said Iran's
aim was to reassure their fami-
lies, the official IRNA news
agency reported.
Iran's Moscow ambassa-
dor, Gholamreza Ansari, told
Vesti-24 television on Friday,
according to a Reuters trans-
lation from the original Farsi,
"If there is no guilt they will
be freed but the legal process
is going on and has to be com-
pleted and if they are found
guilty they will face the pun-
ishment."
It was not clear on what au-
thority Ansari was speaking and


IRNA said yesterday he had
denied making the comments.
Foreign Minister
Manouchehr Mottaki said on
March 25 Iran might charge the
sailors with illegally entering its
waters.
Iran displayed three of the
Britons on television on Friday
and released a letter from one
saying she was being held be-
cause of "oppressive" British
and U.S. behaviour in Iraq.
London and Washington
accuse Iran of allowing so-
phisticated weapons used to
target their forces to be
brought into Iraq. (Addi-
tional reporting by Caren
Bohan in Washington,
Edmund Blair and Fredrik
Dahl in Tehran, and Adrian
Croft in London)


Teens confess to

starting fire near

Hollywood sign

LOS ANGELES. IReuters) Two lllinois teenagers face
felony arson charges after confessing to sparking the 150-
acre 160-hectare'i brush fire that blackened the sky over
Los Angeles' famed Hollywood sign with smoke and threat-
ened an apartment complex. police said yesterday.
The 16- and 17-year-olds. who were vacationing in Los An-
gele- %ith heir parents, turned themselves in to Burbank po-
lice and "ere transferred to the Los Angeles Police Department
on Friday
'The' 're facing felony charges of arson." said Los Angeles
Police Department officer Mike Lopez
He could not immediately% confirm press reports the boys
were released to their parents.
The blaze on Frida% quickly consumed acres of parched
vegetation and was subdued b3 nearly 200 firefighters and
water-dropping helicopters. It never put Hollywood's land-
mark sign. which is now made of steel, in imminent dan-
ger.


Applications are now being accepted for Student
Nurses at the School of Nursing St. Joseph Mercy
Hospital.
Minimum Criteria for Entrance:
1. Not less than four (4) subjects at the GCE 'O' Levels
(A,B, or C) or CXC Examinations of which one must
be English Language and a Science subject or
Mathematics, Grades 1,11 or 111.
2. Age 17 years.
September class:
Entry date: September, 2007
Applications close on: April 20, 2007.
Applicants are asked to tender application in writing to:
Director of the School of Nursing
St. Joseph Mercy Hospital.
130- 132 Parade Street,
Kingston,
Georgetown.


youMA Nabi.













We Wish All Our Customers, Friends & Our
MuslimBrothers & Sisters a Happy Youman Nabi

MOFHAMED RAHLM & SON

Lot 11 Public Road Beterverwagting E.C.D.


I






tiln WanAYCHNEILA 1


"__ _ _ __ .. H"I .-@ .'-..


Brazil flights

resume, many

stranded at airports
SAO PAULO, (Reuters) Brazilian air traffic controllers
returned to work early yesterday and flights slowly de-
parted from the country's airports, which were packed with
thousands of stranded travellers after about one-third of
all outgoing flights were delayed or cancelled.
Controllers returned to work after the government agreed
to a series of demands, including pay nses.
Brazil's airport authority, Infraero, said that because of the
six-hour strike 82 fhghis were cancelled and 101 delayed -
about a third of the 553 scheduled to take off.
Pobce were called to all major airponis to help deal with
passengers outraged at the delays. In Rio de Janiero, travellers
broke computers at airline counters, while staplers were thrown
at airline employees in Sao Paulo and protest signs were
scrawled on airport walls in Brasilia.
Air traffic controllers went on a hunger strike on Friday in
Brasilia's military-run control centre to protest poor work con-
ditions and equipment safety concerns. The strike spread to
other control centres and all flight departures were suspended
across the country.
Brazil's Air Force, which is in charge of air traffic control,
called the strike a mutiny and threatened to jail the strikers.
President Luiz Inacio Lula da Silva, on his way to meet with
U.S. President George W. Bush at Camp David, dispatched Bud-
get Minister Paulo Bernardo to meet with striking air traffic
controllers.
"The president ordered thai we brought things back to nor-
mal because it was a question of national security." said Social
Communications Minister Franklin Martins after a compromise
was reached with the strikers.
The incident follows months of persistent disruptions in
Brazil's air traffic system, which have stranded passengers and
delayed hundreds of planes.
Air traffic controllers have staged periodic work slowdowns
since Brazil's worst air crash last September. Two jets clipped
wings over the Amazon and one of them plunged into the rain
forest, killing all 154 people on board.
Military officials have said air traffic controllers may have
been partly to blame for the crash. Controllers hae complained
they are understaffed and forced to rely on faulty equipment..
Members of Congress and industry analysts have syg-
gested taking control of Brazil's air traffic system out of
military control.




















YOUMAN NAD!



n

~ ~ ~ / 9flet^ c> end--,


1j /s I..


9es, Wisaew&
M~
%0&(a % mw

9kcq^uiale


Panday wants fair




High Court hearing


(TRINIDAD EXPRESS) -
UNITED National Congress
(UNC) interim leader Basdeo
Panday has indicated he is
.willing to trust the courts to
decide fairly if he can regain
his status as a Member of
Parliament.
Saying that there were still
"some people of the Judiciary"
who were worthy of being
trusted, Panday was non-com-
mittal when asked if he believed
attorneys representing Parlia-
ment would represent him fairly
in the petition (tomorrow).
He said he would have to
"wait and see".
Panday was speaking to the
Express (Friday) after address-
ing hundreds of Spiritual Bap-
tists at their Liberation Day cel-
ebrations at City Hall, Port of
Spain.
Attorneys representing
Clerk of the House of .Rep-
resentatives, Jacqui
Sampson, filed a vacancy pe--
tition on Thursday, asking
the High Court to determine
if Panday's status as an MP
was automatically restored
after the Appeal Court
quashed his convictions on
April 24 and even after his
Couva North seat in the
House was declared vacant.
Panday disclosed (Friday)
that he was yet to be served
with the application and he did
not know if he would get a hear-
ing in the petition, which is
scheduled to come up for an ex-
parte hearing (tomorrow).


He said he left it up to his
lawyers to decide if he should
ask to be heard.
One lawyer, his daughter,
Mickela Panday, has already
fired off a letter to Sampson
that the questions framed in the
petition were not justiciable.
Earlier, at the celebrations he
attended, Spiritual Baptists paid
tribute to Panday for the UNC's
decision more than a decade ago-
when the party was in govern-
ment-to proclaim March 30 as
a special holiday for the religious
movement.,
"He must not leave unher-
alded. He is known as someone
who struggles," Bishop Carlotta
Jbhn told the audience, eliciting
lusty applause for the former
prime minister.
John is the General Secre-
tary of the local chapter of Evan-
gelical Spiritual Baptists.
Bishops of other districts,
including Canada, the United
Kingdom and Ireland, were also
in attendance.
In his address, Panday said
his decision to proclaim the
Baptist holiday was "simply an
act to demonstrate that all of us
are equal".
He equated individuals and
interest groups in society to
boats in a pond.
"You cannot lift up one
boat unless you fill the pond
with water, and then all the boats
will float," he said, indicating this
was a metaphor for his vision of
equality in Trinidad and Tobago.
Avoiding a direct attack on


The Institute of Chartered

Ni Accountants of Guyana.

Notice is hereby given in accordance with
Sections 3.4 of the Institute of Chartered
Accountants of Guyana Bye Laws; Practice
Certificates were issued to the following
persons for the year ending December 31,
2007:

Mt. Nizamudin Ali
Mr. Khalil Alli
Mr. Ronald Alli
Mr. Lance Atherley
Mr. Chandraballi Bisheswar
Mr. Clyde Douglas
Mr. Maurice Soloman
Mr. Winston Lynch
Mr. Harryram Parmesar
Mr. 'Christopher Ram
Mr. Robert Mc Rae
Mr. Harry Narine
Mr. Rameshwar Lal
S Nl. Rakesh, Lachana


the PNM government, Panday
said it was a "great sadness".
that the African Spiritual Park
which he had called for when he
was prime minister was not yet
a reality.
"But there is hope and
things change, and hopefully
it will be a change for the
better. I hope then you will
all be able to realise your
dream of being equal in soci-
ety," he said, possibly pre-


dicting a change in govern-
ment after general elections
this year.
Throughout his address,
Panday called on Spiritual Bap-
tists to continue their struggle
for recognition and equal treat-
ment.
He also congratulated
them on their tenacity in
keeping their religion when
it was practically outlawed
between 1917 and 1951.


Bush says Doha deal

can't be one-sided

By Jeremy Pelofsky
CAMP DAVID, Md., (Reuters) President George W. Bush
.said yesterday the United States was willing to make sub-
stantial cuts in farm subsidies to achieve a global free trade
deal but those concessions could not be one-sided.
At a joint news conference at the Camp David presidential
retreat in Maryland, Bush and Brazilian President Luiz Inacio
Lula da Silva both expressed optimism that the struggling Doha
round of trade talks would lead to a deal.
"I am leaving here very satisfied," said the .left-lean-
ing Lula, whose unlikely friendship with the conservative
Bush has grown closer lately.


Tenders are hereby invited to purchase the .
undermentioned properties:-

(1) Lot 365 Butterwood, Retrieve, Linden

(2) Lot 5 Salem Village, East Bank Essequibo.

(3) Lot 3 Section "C", Nabaclis, East Coast
Demerara

(4) N 1/2 of 44 Public Road, '1,-n. ini, .
Essequibo Coast.


Lot 8 Public Road, Goed Fortuin, West Bank
Demerara.

Lot 29 New Amsterdam, Berbice.


i7) Lot 207 Lusignan West, East Coasi Demerara.

(8) Lot 30 Second Street, Mon Repos. East Coast
De'erara.

Each Teinder must be placed in sicpcale
envelopes and addressed (o:
'The General Manager
Hand-in-Hand Trust
Corporation Inc
62-63 Middle Street
North Cttunimngsburg
Georgetown
Not later than April 10, 2007
( hC' Tirust (opor;atin i'scr\ewrs 1the 'ighlt t;
r'jic.t a Ic ider without ,,i\ in< i r' nm ).
L '~... ., . ,'' ., .* *' 1 ,,l .,,, ,,.-


5


5


miitv CH RONICLEt AhlHI 1':68 ,


4





6 SUNDAY CHRONICLE April 1,2007
1


Editorial)



Cricket



keeping



hope alive


Editorial Viewpoint


by Rickey Singh

BOB Woolmer's shocking
death, still being treated as
a case of murder, is un-
-doubtedly the most tragic
and traumatic occurrence
involving a high profile per-
sonality in the history of.
Cricket World Cup.
But there are also some
other striking precedents.
For instance, for the very
first time, teams from two of
Asia's internationally re-


nowned cricket nations, In-
dia and Pakistan, have been
eliminated at the preliminary
stage of a CWC tournament.
Ups6ts have been the
order of the day in matches
so far played, resulting in Sri
Lanka and Bangladesh
winning their places for the
'Super Eight' stage with En-
gland and even powerful
South Africa scrambling to
qualify for the finals against
current trophy holder Austra-
lia.


For our own home team
we can only hope that dis-
appointing performances do
not follow them into today's
crucial match against the Sri
Lankans who seem quite.
confident of reaching the fi-
nals to battle Australia.
It is only natural that the
country folks of all participat-
ing teams would like victory
for their own even
against the odds. We in the
West Indies are no different.
Therefore, "rallying round the
West Indies" is the unofficial
anthem that we keep sing-
ing in the face of losses al-
ready suffered.
That is why it was so
good, so very encouraging
that a rousing welcome was
organised to greet the West
Indies team on arrival Friday
at the Cheddi Jagan Interna-
tional Airport.
It would have been a
measure, of welcome
therapy for Brian Lara and
his colleagues who have to-
gether made us proud, on
numerous previous occa-
sions, as a great cricketing
region of the world.
They can do it again to-
day and move on to prove
their critics wrong and
strengthen the hopes of


fans across the entire re-
gion and the Diasporas in
going beyond the semi-fi-
nal.
So let the music play,
and let the International
Cricket Council's Chief Ex-
ecutive Malcolm Speed be
happy to know ,that in
Guyana he had come to ex-
perience the "joyful noise"
and much of the traditional
colourful behaviour in sup-
port of cricket that he has
missed in earlier matches
played at other venues for
CWC 07.
For their part, the
Guyana Government and
the Local Organising Com-
mittee would have been very
much encouraged, and
deservingly so, to have re-
ceived unambiguous en-
dorsements from Speed-
and, earlier, CWC Venue
Development Director
Donald Lockerbie. That is
for achievements both in
national stadium and ac-
commodation-readiness -
contrary to all the negative
reporting and doomsday
predictions.
At his press conference
on Thursday, shared with
LOC Chief Executive Officer
Karran Singh, Lockerbie


made clear: "All the talk that
was circulating about
matches being taken from
Guyana, I found ridicu-
lous..."
Unfortunately, some
sections of the local and re-
gional media seemed not to
have awakened to the fact
that there NEVER was any
switching of management
control from the Local
Organising Committee as
had been misleadingly re-
ported,
In the circumstances, it
may be quite appropriate to
repeat what the ICC's
Speed told a press confer-
ence on Friday, with Sports
and Culture Minister Frank
Anthony next to him:
"Your country has much


to be proud of. You have built
an outstanding. cricket
ground in a very short pe-
riod of time. I first came here
about two years ago and
the cane fields had just
been cleared and the play-
ing surface had just been
levelled. Nothing whatso-
ever had been built..."
Now, in place of those
cane fields proudly stands
the US$25 million Guyana
National Stadium which -
as I have expressed, from a
personal perspective in the
local and regional media -
should be considered for re-
naming after the illustrious
Clive Lloyd, identified as
one of the very great cap-
tains in the history of inter-
national cricket.


Today's slavery after abolition


- CARICOM must go beyond shouting 'compensation' calls


TODAY, as the Caribbean
region continues to lament
the consequences of the hor-
rors of the Trans-Atlantic
slave trade, let it be clearly
understood that the persis-
tence of modern day slavery.
in various forms, is certainly
no "all fool's day" joke on
this April 1 date in this sev-
enth year of the 21st century.
It is very much the dark,
shameful, degrading experience
across continents including
the'victims of our own Carib-
bean-Latin American region -
as being manifested in child sla-
very and trafficking for a hei-
nous sex trade and exploitation
of cheap labour for industry and
commerce.
The world-wide web is full
of case studies of the legacy of'
slavery, long after the abolition
of the Trans-Atlantic slave
trade; of the thriving businesses
in sex slavery and child slavery
in countries, including Britain.
While confessions including
those for the Church's role in
slavery are being made, and
genocidal tribal conflicts con-
tinue to affect millions of lives
in African states, it is also
healthy to recall the complicity
of those of the continent of Af-
rica in enslaving fellow Africans,
as well as the involvement in
later years of those of the con-
tinent of Asia who were driven
by the profit-motive to
sustain the awful system of
indenturcship.
Wheit we witness !he icie-
vision images of the Haitian
"boat people" risking their lives
:o find refuge in the United
States of America, it miay be


less difficult to count those who
die at sea than the many, includ-
ing child slaves, suffering and
dying in abject poverty and
scandalous racism right across
their border in the Dominican
Republic.
Yet, CARICOM govern-
ments conduct their businesses
with countries in this hemi-
sphere, including Haiti and the
Dominican Republic, as if un-
mindful of persistent forms of
modern slavery.
Of course, this should come
as no surprise if such govern-
ments have no compulsion to
speak out against the human
rights atrocities that continue as
a norm in states of Africa once
raided by Europe for centuries
Iohr ihe flourishing Trans-Atlan-
tic slave trade.
Now. as the Caribbean joins in
commemorating the 200th
anniversary of the abolition of the
Trans-Atlantic slave trade, there is
a crescendo of calls for erection of
appropriate monuments; for official
apologies and compensation from
those whose economic kingdoms
and political/military power are his-
torically rooted in the horrors of
man's inhumanity to man sla-
very.
There is a rising anger being
demonstrated with cries of "bar-
barism". genocidedc" and "holo-
caust" across the Caribbean
Community.
They are particularly nr'-
nounced in wl.?, -were tie main
rew,',nal centres of epic revolts
by the enslaved Haiti (led by
Toussaint L'Ouverture); Ja-
'maica (the Maroons); SurinameI
(the Bush Negroes) and
in (G;yana (the Berbicc uprising


of Cuffy and Accabre).
Inevitably, comparisons are
now being made with the Jew-
ish holocaust, and not without
good reason, by those demand-
ing reparations for slavery.
But it is also quite a just de-
mand of history for the descen-
dants pf slaves in whose
names compensation is officially




The


Column


being demanded to remember
that the greatest victims of the
longest and most massive holo-
caust were the aborigines of the
Americas.
History remains littered
with the destruction of the
American Indians the mass
murders, promoted suicides and
spread of diseases that had oc-
curred in the greedy quest for
wealth and power that had pre-
ceded and converged with the
Trans-Atlantic trade in human
cargo from Africa.
The really sad, tragic story
of our time as we celebrate -
if thal is the correct word the
abolition of the Trans-Atlantic
slave trade by an act of the Brit-
ish parliament, 1s the hauhnling
f r '


reminder of the persistence of
different forms of slavery.
Sources/Destinations

The most sinister of such
human degradation is'today
known simply by an official ac-
ronym TIP trafficking in
persons.
Read that to mean a crimi-,


nal operation involving,.accord-
ing to. the United Nations Of-
fice on Drugs and Crime
(UNDOC), approximately 27
million people who, at any
given time, may be entrapped in
a market in human commodity
valued around US$32 billion.
This commodity is sourced
from various member countries
of the United Nations and in-
cluding Asia, Africa, Eastern
Europe, Latin America and the
Caribbean, with common desti-
nations often being Japan, the
United States of America, Thai-
land, Italy. Turkey, Germany
and Israel. .
The modern day human
cargo, of trafficked persons as
fodder for the sex trade and/or


cheap and viciously exploited
labour, comes in different
nationalities, ethnicities and
colours. Some are children, less
than 10 years of age.
Among them are 21st cen-
tury descendants of victims of
the holocausts of the American
Indians and African slaves, and
also those from Asia who were
connected with the
degrading indenture system of
contractual servitude in British
colonies in the Caiibbean -
foremost being British Guiana
and Trinidad and Tobago.
Saying 'sorry' for slavery,
as Britain's Prime Minister
Tony Blair has done, could be a
first step towards a more prac-
tical response to compensate the
descendants of former slaves -
in the thinking, as expressed
list week by Barbados Prime
Minister Owen Arthur and
Guyana President, Bharrat
Jaigdeo.
More importantly, what is
CARICOM's common ap-
proach in determining the most
appropriate ways to secure and
utilise the reparation being
sought?
Monuments, whatever their
forms and locations, do have their
place in efforts to perpetuate re-
membrance. What may be more de-
sirable and give better meaning
to such monuments -
are sustainable human resource de-
velopment programmes and
projects that touch the lives of the
descendants of slaves as well as
those of their fellow citizens who
comprise the population of any
parish or district of our Caribbean
Community.
Observance of this
bicentenary of the abolition
of slavery has been proposed
by the current chairman of
CARICOM. Vincentian
Prime Minister Ralph.
Gonsalves, as an occasion for
both Europe and' our region


I


to forge a partnership for
"righting historic wrongs";
arid to "justly summon a
cleansing of the spirit and of
the historical decks-..."
For me, this moment in
time presents not only a chal-
lenge for Europe and the U.S. to
consider practical forms of com-
pensation to benefit the descen-
dants of slaves.
Also, for us as a Caribbean
people to engage in critical re-
examination of our institutions,
political parties, governments,
social organizations, and,
yes, the media, to better come
to terms with the racial and re-
ligious bigotry, the culture'of
class arrogance and social preju-
dices that remain barriers to
foster national and regional
unity.
Such an approach could
well influence more caring atti-
tudes for ensuring fundamental
human rights and, in so
doing, serve notice on govern-
ments to be ever vigilant against
crimes of human trafficking and
child labour that are notorious
manifestations of today's mod-
ern form of slavery.
This bicentenary of the
abolition of slavery may also be
a good time to revisit some very
significant and quite relevant
published works of our history,
culture and development.
Among them could be:
+ Eric Williams' "Capital-
ism and Slavery"; Walter
Rodney's "How Europe Under-
developed Africa"; CLR James'
"The Black Jacobins"; George
Lamming's "Natives of My
Person"; Clive Thomas' "The
Poor and the Powerless" and
Rex Nettleford's "Mirror Mir-
ror".
Let us all strive to be vigi-
lant against any form of sla-
very and the sin of racism
that was a core feature of the
economics ~f the slave trade.


Page 6 & 31 p65


I CHRONICLE

Editor-in-Chief: Sharief Khan
Editorial: 227-5216: 227-5204: 22-63243-9
Sports: 225-7174
After hours 226-3243-9
Fax: 227-5208
The Chronicle is at "ww.gu.anachronicle.com
e-mail address sundayeditor@'gumanachronicle.com
Lama A'enue, Bel Air Park. Georgelown. Gu.ana.


RICKEY


SINGH.






SUNDAY CHRONICLE April, ,2007


FROM the word out yesterday, there would be a lot of fine-
looking posses at the Guyana National Stadium at Providence
today.
But don't look on the mound or anywhere else for the Sour
Puss Posse. You won't find them there.
However, if you do spot any one of them, straying or lurking
around some comer, any place near the stadium, please send up a
shout quickly for Mr. Slowe or Mr. Speed to go after them.
And, please, please, make sure the TV camera crews, always
on the lookout for unusual scenes to beam and entertain the bil-
lions watching around the world, are alerted to catch Slowe and
Speed going after any members of-the Sour Puss Posse.
Just imagine Slowe and Speed after a pack of sour pusses at
full speed! Our photographers are on standby.
It's going to take some close watching to spot these sour pusses
because, with their sour puss escapades exposed for the world to
see, they can only show up at the Guyana National Stadium at
Providence in disguise.
They are ashamed to set foot at the stadium in their everyday
sour puss selves, because it was the same stadium they had been
trying to tell other Guyanese and the rest of the cricketing world
would not be ready in time for Cricket World Cup games.
It may be hard, because of the resounding joyous noise
since the first corker of a game Wednesday between Sri Lanka
and South Africa, to remember the mewling and the cater-
wauling the Sour Puss Posse had been trying to drown the
rest of us in.
They were at it from their fences day and night, meowing silli-
ness about the Guyana matches having to be shifted because the
stadium was not ready, that the ICC had had to speed in and wrest
control from Slowe and the LOC and all manner of asininities.
Such was the frequency and fury of the Sour Puss Posse, that
their mewling was even picked up by some overseas media and
there were serious doubts about the CWC Super Eight matches in
Guyana were still on.
On Tuesday and Wednesday last week, a colleague of mine in
Trinidad was desperately seeking definite word from me on whether
the Sri Lanka-South Africa match was still on, and whether the
games were still to be played in Guyana.
I was astounded too when a local colleague called and asked


Sc


)ur Puss






Posse






missing


me in all seriousness if I had heard anything definite about the games
coming off in Guyana.
But anything was likely with the way the Sour Puss Posse
had been carrying on.
Some in that band are old sour puss hands and the young ones
they have recruited and have under their paws, have little chance
of ever discovering real sweet cat glories.
One can only hope now that the sickening Sour Puss antics
have been skinned naked, the young sour puss followers would find glorious Wei
better succour at the stadium at Providence, with the sure word 'We have bee
from the likes of Slowe and Speed. Shhh, d
Here's the word from Speed (Chief Executive of the Interna- that the office
tional Cricket Council, Malcolm Speed) "Your country has much in disguise,
to be proud of. You have built an outstanding cricket ground in a You kn(
very short period of time..." tics at the m
He also endorsed the assessment of CWC Venue Development See wha
Director, Donald Lockerbie, that Guyana had done an excellent job the mascot v
in preparing for the mega event, commending everyone involved today and w
with pulling it off. checks just t
And he's so overjoyed, that he has begged for the traditional Poor ca
and unique noise of the Caribbean at the games. Yeah rig
And hear. Lockerbie to the Sour Puss Posse: "All the talk that bands of yo
was circulating about matches being taken from Guyana, I found around the
ludicrous." Posse in disj
And he congratulated Assistant Commissioner of Police Get a re
Paul Slowe for the "excellent manner" in which the security Check t
was implemented in line with the ICC master security plan. and you woi
Lockerbie said the CWC had set a standard and wanted to make And if
sure that the venues were not only finished but finished well. doing check
"There have never been more modem facilities in a Cricket I look like t
World Cup. We met the specifications." me, please?
And here's more from him for the Sour Puss Posse after that If y6ou


hEurope's search




for energy security


some lessons


By Dr. Patrick I. Gomes
(The writer is Guyana's Brussels-based Ambassador to the
EU)

FROM the recent Summit of the Heads of Government of the
European Union (EU) in early March this year, there are a
few aspects that may merit cunuisid t:". by us in the Carib-
bean, given growing concerns for energy security, attention i',
climate change and our need for effective policies and insti-
tutional mechanisms to sharpen our focus on food security as
a regional priority.
The European leaders at that March 9, 2007 Summit launched
a claim for world leadership in the fight against climate change. The
core of this consisted of Europe's 27 member states agreeing in prin-
ciple to ifcreGC ,hv three-fold its renewable energy use by the year
2020 and thereby contributing to a significant reduction of carbon
dioxide emissions.
Thisadmirable position, was described as an "historic mission"
by ChancellorAngelakMerkel of Germany, currently the EU's.Coun-
cil President. By such an identification of ambitious and credible


targets in its long range planning, Europe as a region has positioned
itself in "the vanguard" of the movement to save the planet by cre-
ating a low carbon economy with optimum use of renewable en-
ergy.
The convening of the EU's climate change summit has further
significance by demonstrating to the world that Europe intends to
pursue on many fronts its option for moral leadership through "soft
Dower".
This is n '' J9ose Barroso, European Commission President con-
sistently contrasts Europe's gh al political identity as different from
those nations exercising hegemonic powc' o.r aiming to be a milita-
ristic superpower or surrogate, with an arsenal of weapons of mass
destruction.
By this stance, Europe rejects actively fostering a new glo-
bal arms race with its wasteful diversion of resources and
chooses instead the improvement of the quality of human life
within Europe and a contribution to poverty reduction in the
world as a whole.
Moreover, the identification of .he agreo'd reduction ol"
greenhouse gas emissions by 20% in just more than 10 years.


based on 1990 levels, and a promise to go further to 30%, if
other nations follow suit, gives Europe leverage in the forth-
coming negotiations on the extension of the Kyoto Agreement
in 2012.
Europe's Climate Change Summit could also be taken as
an exercise in moral persuasion directed at such developing
countries as Brazil, and particularly China and India, whose
rapid economic expansion entails increased consumption of
oil and natural gas as fossil fuels but now have no special
obligations under the current Kyoto Agreement, which the
U.S. defiantly refuses to ratify.
But the EU's stance in taking the moral high ground for a lead-
ership role in the fight against climate change should be also seen
for its coherence and complementarity in long term policymaking
on energy, the environment and sustainable development.
This becomes apparent when the policy is seen as serving to
address both economic and geopolitical concerns.
By aiming to reduce excessive a2d inefficient energy uses
that intensify global warming, Europe is simultaneously mov-
ing to alleviate or overcome the region's present dependency
on its Russian neighbour to the east as its major source of oil
and natural gas. This latter aspect is particularly worrisome
to Germany and Poland whose vulnerability to supplies of gas
from Russia became a matter of great unease a year ago, when
Russia flexing political muscles, turned off supplies to the
Ukraine, demanding a higher price for its gas and thereby dis-
rupted the flow to elsewhere in Europe.
In this vein of demonstrating political muscle based on newly-
acquired "oil" wealth, tensions between Russia and another
neighbour, Belarus, were heightened in January this year when Mr.
Putin halted oil supplies to Westei.. Europe through pipelines
crossing Belarus.
hi an unequivocal and sharp response, the EU President Merkel
Please turn to'page ten


dnesday opening game: "It was truly a great first day.
n able to work as a team."
on't spread the word, but I have it from good sources
cials trying to catch members of the Sour Puss Posse
would be having a close look at even that cat" Mellow.
ow Mellow, the CWC mascot, who has been up to an-
atches?
at kind of trouble the Sour Puss Posse stir up? Mellow
will have to have his genuine ID at the ready at all times
would be subject to body searches and other security
o ensure he's who he seems he is.
t.
ght. Nobody's going to want to do close checks on the
ung women cricket fans on the'mound and elsewhere
ground to ,see if they are members of the Sour Puss
guise.
reality check sour pusses don't ever look so good.
the real ID cards of the members of the Sour Puss Posse
uld see what I mean.
you see me smiling while helping the security people
.s to unmask impostors from the Sour Puss Posse, and.
the cat that just had some good milk, don't call out to

spot a Sour Puss, call Speed and Slowe'- fast!






s sumASaY CmHROIILEpri1, 2007di


The hypocrisy


of aid


By Sir Ronald Sanders
(The writer is a business
consultant and former
Caribbean diplomat)
THE development ministers
of the world's most economi-
cally powerful nations the
G8 met in Berlin this
month to consider aid to de-
veloping countries.
The conference underlined
two things: first, aid is not a re-
sponse to need: it is a tool for
achieving the'objectives of the
donor; and second, there is a ri-
valry evolving between the G8
countries and new donor coun-
tries such as China and India us-
ing aid as a tool.
This second point is under-
scored by a report in the Lon-
don Financial Times that the G8
countries are concerned that
their efforts to link some aid to
performance-based criteria
"could be undermined by
emerging economies".
The G8 countries are Brit-
ain, Canada, France, Germany,
Italy, Japan, Russia and the
United States.
By "performance-based
criteria" they mean those con-
ditions that they have imposed
for decades on developing coun-
tries bilaterally and through
organisatipns such as the World
Bank arid the International
Monetary Fund (IMF).
I I should acknowledge
thai Ruskia is a newcomer to
the cotlective approach to
settilt conditionss for aid.
None~.IteIgs. Russia too has
used aid bilaterally to bolster
Russian! interests (and before
Russia. the interests of the
former Soviet Union).
In. A~n event, the G8 link
theiraidto developing countries
to the following conditions:
opening up the markets of de-
veloping countries to goods and
services from the industrialized
world. pri alization of State-


owned companies; deregulation;
low foreign debt and taxes.
For decades each of these
countries has used aid to influ-
ence or coerce developing coun-
tries into adopting positions
that suited the donor.
Aid was also withdrawn or
reduced either to punish devel-


oping countries for pursuing
policies that a donor country
considered to be inimical to its
interest, or simply because the
country or region concerned no
longer held any strategic inter-
est to the donor.
There was and is noth-
ing altruistic about aid from G8:
countries except in the most.
dire of circumstances such as,
the Asian Tsunami. And, even
then it is the people of these
countries- rather than their
governments who have re-
sponded fiagnificently to allevi-.
ate human suffering.
Years ago, at the United
Nations, the industrialized
nations promised to allocate
0.7 per cent of their gross 0ia-_;
tional income to aid; none of'
the G8 countries have yet
done so. Only the Scandina-
vian countries have been out-
standing in trying to meet
their commitment.


Then, in Scotland in 2005,
the G8 heads of government
made a commitment of US$50
billion in development aid. Al-
most two years later, they are
far from fulfilling their promise.
Now, at the Berlin meeting
the development ministers have
declared that their governments
must "keep" their pledges to in-
crease official development as-
sistance", including "doubling
their funding for Africa by
2010". i Not many people or
organizations are holding their
breath in the expectation that
these pledges will be met.
Tellingly, the G8 develop-
ment ministers invited China,
India, Brazil, South Africa and
Mexico: to their meeting as the


"next generation of potentially
large donor countries". It is
clear that the G8 expects these
countries as well as the oil-rich
Middle Eastern states to relieve
them of some of the responsi-
bilities of providing aid.
Increasingly then, moral
obligations for providing aid -
such as the exploitation of coun-
tries and their peoples are be-
ing shunted aside by:the rich na-
tions. They want what they re-
gard as the burden 6f aid to be
shared with other countries.
But, they also want to in-
fluence the purposes for which
aid is given and the amount of
latitude that such aid gives to
the recipient countries to re-
sist the conditions imposed by.


the G8 and the organizations
they control such as the IMF
and World Bank.
According to a London Fi-
nancial Time report G8 minis-
ters said "a global partnership
with emerging economies was
needed when setting bench-
marks for potential recipients".
The real message directed
at China and India both of
which have made substantial in-
vestments in Africa recently -
was simple: do not undermine
G8 efforts to constrain and di-
rect the policy options to devel-
oping countries by giving them
help that reduces their depen-
dence on the G8.
Of course, China and India
will be no more altruistic in de-


livering aid and investment in
developing countries than the
G8 have been.
They, too, are seeking to
influence decision-making and
to oversee the establishment of
conditions that best suit their
purposes.
But, if they do not join
the G8 agenda, their inde-
pendent participation in the
aid-giving process will reduce
the reliance of developing
countries on the G8 coun-
tries and their institutions,
and might broaden the scope
for some policies that com-
mand national consensus to
be adopted.
!(Responses to:
ronaldsanders29@hotmaiLcom)


Entrepreneurs of the region


on the road to integration


By Ruben Silie said that there are now institu-
tional mechanisms in place,
FOR almost half a century, some specialised in this area and
the subject of Latin American others of a political nature,
and Caribbean integration which will advance not only re-
has beep under discussion, lated ideas, but integration it-
and mudh has been said and self.
done in favour of attaining Among the players in-
this goah volved in integration, it is clear'
Yet, WLe still cannot antici- that gqvernmenis must play. a
pate when the Americas will be lead role. since they are respon-'
integratedin the medium of long sible for setung public policy..
lerm. Ho6ever, significant In this sense, there are many:
progress has been made in bring- sub-regional integration schemes
ing together diverse social iand now in operation. bur in tnsii-
economic players who are en- rtuional terms, their levels of in-
gaged in their own integration tegration differ. There are also a
actions. Although these actions number of summits at which
are not part of any scheme for-, : this issue is discussed, either
miily, agreed 'between stata ik .$ub-regionally or throughout the:
they point towards integration. contmminent.
Major initiatives have been In our time, which is
taken for achieving this goal, and marked by globalisation,
we must recognize that we are there are imperatives which
not stuck in the same spot as '" force countries to find ways
in earlier years It can also be;4- of integrating. It is increas-
__________ __ ingly true that the factors
.which affect or favour us
-- ". must be linked to interna-
tional considerations. Na-
tional identities are also, tak-
ing on a transnational aspect,
because large percentages of
0 1 countries' populations have


Cariba The Greater

Caribbean This Week


migrated within or outside
the region.
Who can deny that foreign
investment has grown signifi-
cantly? There might be coun-
tries where more investment is
needed than what currently ex-
ists, but in each of these, this is
a structural factor where trade.
and financial activity are con-
cerned. It is easy to note that
there is a large group of entre-
preneurs who condtiuct many
types of business with the
Greater Caribbean, without any
official connection;
This happens with com-
"mercial banks, household appli-
*ance distributors,;food produc-
ers, tourist groups and hoteliers,
airlines, construction compa-
nies, insurance companies, su-
permarket chains, fabric and gar-
ment manufacturers, consult-
ants, etc.
When we speak of capital


irvestmint, there is a tendency
to think about large
multinational companies, since
dtey .ap;bring in large sums of
money, gi;en their size. but the
ever .efforts made by
Si tre, forgotten.
' AleffjgW'rth "and Luis
G uarn .zo call them the
"capitalists of the tropics",
referri to the immigrants who
Sinvest heromecountries to
helpV' iup 'mall businesses,
and who almost always
informally generate more
occupation than capital from big
business.
These are all non govern-
ment plqers who have some
influence on actual integra-
tion. Their initiatives
mobilize trade in the region
before agreements are con-
cluded and formalised. The
Please see page nine


NOTICE


TAKE NOTICE that all Jurors summoned

to attend the DEMERARA CRIMINAL

ASSIZES on Tuesday, April 3, 2007 are

now required to report for duty on Tuesday,

April 17, 2007 at 8:30 am.



/ / ........ ..............

f'REGISTRAR

DatAd this 30th. da yc ,March 2007, ..






SUNRHMp1IJ. 42j" 9.


Iran:


By Gwynne Dyer

"I DON'T want to second-
guess the British after the
fact," said U.S. Navy
Lieutenant-Commander Erik
Horner, "but our rules of
engagement allow a little
more latitude. Our boarding
team's training is a little bit
more towards self-
preservation."
Does that mean that one of
his American boarding teams
would have opened fire if it had
been them in the two inflatable
boats that were surrounded by
Iranian Revolutionary Guard
fast patrol boats off the coast
of Iraq two Fridays ago?
"Agreed. Yes."
Just as well that it was a
British boarding team-, then. The
fifteen British sailors and
marines who were captured and
taken to Tehran for
"questioning" are undoubtedly
having an unpleasant time, but
they are alive, and Britain is
only involved in two wars, in
Iraq and Afghanistan. If it had
been one of Eriik Horner's


boarding teams, they would all
be dead, and the United States
and Iran would now be at war.
Lt-Cdr Horner is the
executive officer of the USS
Underwood, the American
frigate that works together with
HMS Cornwall, the British ship
that the captive boarding party
came from. Interviewed after the
incident by Terri Judd of "The
Independent," the only British
print journalist on HMS
Cornwall, he was obviously
struggling to be polite about the
gutless Brits, but he wasn't
having much success.
"The U.S. Navy rules of
engagement say we have not
only a right to self-defence but
also an obligation to self-
defence," Homer explained.
"(The British) had every
right in my mind and every
justification to defend
themselves rather than allow
themselves to be taken. Our
reaction was, Why didn't your
guys defend themselves?""
So there they are, eight
sailors and seven marines in two
rubber boats, with personal


of the region


0 m .


From page eight
list of players of this type who are seeking integration,
could be extended to include other organizations, such as aca-
demic, professional, religious, sporting, artistic and other bod-
ies.
The region's entrepreneurs are helping to advance the conclu-
sion of formal agreements by states, and by taking action, they are
helping to create an environment of integration. However, a certain
reticence which ties us to the historical notion of a national state
makes it difficult for us to consolidate a single integration scheme
in the region. This is why some persons understand that what is
needed is greater political will on the part of states.
Cognizant of the fact that the region is seeking to follow
a path of integration, it would be useful to deepen the dia-
logue surrounding the attainment of such an important ob-
jective for all the countries of the Greater Caribbean.
(**Dr. Ruben Sili6 Valdez is the Secretary General of the
Association of Caribbean States. The views expressed are not
necessarily the official views of the ACS. Feedback can be sent
to: mail@acs-aec.org)




One Surveyor Technician and one Ranger to

work in the Interior.
Attraclive salary offered.

Please send applications tW






Experienced Caterpillar
Mechanics
to work in the Interior.
Attractive salary offered
Please send a licalons t
10M 1i osoi/onupcl 2351/


weapons and no protection
whatever, sitting about a foot
(300 cm) above the water,
surrounded by six or seven
Iranian attack boats with
mounted machine guns.


"Defend yourself' by opening
fire, and after a single long burst
from half a dozen heavy
machine-guns there will be
fourteen dead young men and
one dead young woman in two
rapidly sinking inflatables, and
your country will be at war.
Seems a bit pointless, really.
It's a cultural thing, at
*bottom. Britain has a long
history of fighting wars and
taking casualties, but the
combat doctrines are less
hairy-chested. British rules
of engagement "are very
much de-escalatory, because
we don't want wars starting,"
explained Admiral Sir Alan
West, former First Sea Lord.
"Rather than roaring into
action and sinking everything
in sight we try to step back,
and that, of course, is why
our chaps were...able to be
captured and taken away."
That emollient British
approach is probably why the


Iranian Revolutionary Guard
chose to grab British troops
rather than Americans. It was
obviously a snatch operation:
the Iranians would not normally
have half a dozen attack boats
ready to go even if some
"coalition" boat checking Iraq-
bound ships for contraband did
stray across the invisible
dividing line into Iranian waters
(which the British insist they
didn't).
But it was not necessarily
an operation ordered from
the'top of Iran's government.
In fact, there is no single
source of authority in Iran's
curious system of "multiple
governments," as one
observer labelled the
imfpenetrably complex
division of responsibilities
and powers between elected
civilians and unelected
mullahs. The Revolutionary
Guards (who are quite
different from the regular
armed forces) enjoy
considerable autonomy
within this system.
According to the U.S.
authorities in Iraq, the five
Iranian diplomats arrested by
U.S. troops in a raid in Irbil in
Iraqi Kurdistan last January
were actually Revolutionary
Guards, and it would seem that




SALES CLERKS
DRIVER
PORTERS



99 First& Albert Streets, Alberttown.
Tel. 225.6160,223.5269


their colleagues want them back.
Kidnapping American troops as
hostages for an exchange could
cause a war, so they decided to
grab some Brits instead. And it
will probably work, after..a.
certain delay.
In this episode, the
American reputation for
belligerence served U.S. troops
well, diverting Iranian attention
to the British instead. In the
larger scheme of things, it is a
bit more problematic.
A quite similar snatch
operation against eeguall
belligerent Israelis last July
led to a month-long Israeli
aerial bombardment of
Lebanon and a retaliatory
hail of Hezbollah rockets on
northern Israeli cities. Well
over a thousand people were


dead by the end, although
nothing was settled.
Any day now, a minor clash
along Iraq's land or sea frontier
with Iran' could kill some
...Amexican troops and give
President Bush an excuse to
attack Iran, if he wants one -
and he certainly seems to. If the
Revolutionary Guards had got it
wrong that Friday and attacked
an American boarding party by
mistake, he would have his
excuse now, and bombs might
already be falling on Iran.
All the pieces are in
place, and the war could start
at any time.
(** Gwynne Dyer is a
London-based independent
journalist whose articles
are published in 45
countries.)


NOW AVAILABLE IN GUYANA!


STOCKS INCLUDE.
HEAVY DUTY LAMINATED & BRASS PADLOCKS
HEAVY DUTY STEEL PADLOCKS
DISCUS PADLOCKS
HIGH SECURITY STORE FRONT PADLOCKS AND HASPS
WEATHER TOUGH PADLOCKS
NIGHT LATCHES
JIMMY PROOF LATCHES
TITANIUM REINFORCED PADLOCKS


I 139 REGENT & LIGHT STREETS
U .A S TEL 226-2962,225-7011,225-7015 FAX: 226-1921
OUR HARDWARE STORE
0un ~ ef,


how to start a war


Entrepreneurs


TEL:225-4475/226-3243-9


MEELAUD-UN-NABI
Series on birth of Prophet Muhanmmad (o\vbp)
in the light of Qur'aan and Hladith.
by Dr. Tahir-ul-Qadri

T.V. Station: NTN Ch. 18 /69
I'very Friday from 5 to 5:30 pi
(II.Q. 14:5 & 45:14-15).

"Remind them of the Days ofAllaah.'.."





10 SUNDAY P.HRPNIRC Apri!,lq07


Europe's search...


Postmaster


shot in $8M


robbery
A POSTMASTER was shot yesterday morning when two
bandits waylaid the car he and another senior postal offi-
cial were in at New Amsterdam. Berbice, and fled with
$8.2M intended to pay old age pensioners.
Police said Kishore SeIlall. 35. in charge of the Nigg Post
Office on the Corentne. was in .enous condition at the Ne%%
Amsterdam Hospital after undergoing emergency surgery.
Medical sources told this newspaper he was shot in the
right side abdomen and his intestines were damaged.
Police said Chief Postmaster for New Amsterdam. Gangadar
Munesar, of Nurse Ville, had failed to get the regular security
escort to take the money to other post offices on the Corentyne.
Police said he then asked Sewlall, his friend, who also drives
taxi HB 1024, to take him with the money to other post of-
fices.
They were at the corner of
Republic Road and Ale\ander
Street in New Amsterdam .it
about 08:10h, when two men
who waiting there, held ihcmn
up and shot the driver in his.
abdomen, police said:
The bandits pulled both
men out of the car and droce i
away, police said, adding that
the vehicle was later found
.abandoned at Smithfield. onh h
the money gone.
Thebanditsowere at inig
just about a stone's throu- from
the New Amsterdam Post Of-
fice.
Officials said the money
stolen was to pay pensioners
through the post offices at SHOT: KISHORE SEWLALL
Albion, Whim, Everiham,
Number 51, and Springlands on the Corentyne Coast.
Sources said the two robbers were unmasked.
The money was in a carton in the trunk of the car, they
said.
Sewlall's wife, Indira Kumar, said he left home just before
08:00h to travel to New Amsterdam.
According to her, it is routine for him at this time of the
month to. uplift money to pay pensioners on the Corentyne.
The New Amsterdam Post Office was quickly closed
following the robbery which sent shockwaves across the
town.


From page seven

declared the action by Russia
was "not acceptable". She
further noted that even dur-
ing geopolitical tensions of
the U.S.-Soviet Cold War in
the 1970s/80s, Russia was a
reliable energy supplier to
Europe.
In talks between Merkel
and Putin, a few weeks later the
Russian President gave assur-
ance that he wanted to do all he
could to ensure stable oil sup-
plies to Western Europe and
would reduce dependence on
transit countries such as Belarus
and Ukraine to guarantee sup-
plies to Europe. But his deter-
mination to not back down in
the dispute with Belarus re-
mained steadfast and Putin even
went further by telling Russian
companies to cut output while
the Belarus transit dispute con-
tinued.
This had arisen from the
former wanting Russia to pay an
export duty of US$45 per tonne
of oil transported through
Belarus which came as a counter
move to Russia's demand for a
US$180 export duty on crude
oil it sells to Belarus.
None of those political
squabbles would have failed to
sharpen the resolve of Europe
under Germany's Presidency to
pursue a coherent policy link-
ing its shared concern for the
earth's climate with the eco-
nomic needs for stable supplies
of fuel for factories and homes
of its citizens.
It will be unwise to not re-
call that political and eco-
nomic interests are inevitably
linked with a wider .frame-
work of values, concerns and


ideology in which policies
take their raison d'etre,
whether this be the so-called
pragmatism or the economic
liberalism of social democ-
racy now prevailing in Eu-
rope.
As we in the Caribbean
ponder recent experiences of the
interest (political and otherwise)
of Venezuela's President Hugo
Chavez, passionate advocate of
social justice and a socialism of
the 21st century, the lessons of
Europe may be instructive in at
least a few ways.
The need for long term plan-
ning on a common Caribbean
Energy policy deserves more in-
tensive and urgent attention
than may be available to the cur-
rent capacity and resources of
the CARICOM Energy Work-
ing Group.
Over what period have the
energy needs of our economies
been projected? At what price
and with what benefits and
costs these will be obtained for
the drivers of our economies?
In my view, these are not
issues best addressed by tech-
nocrats alone and mainly
from the perspective of engi-
neers and economists. Surely
there is the dimension of the
political economy that must
be analysed. In whose eco-
nomic interests and to serve
what kind of long term politi-
cal vision for the Single Mar-
ket and Economy is the de-


bate taking place on long
term, medium and short term
requirements for the differ-
ent kinds of resource endow-
ments the Caribbean pos-
sesses?
For some the energy needs
in dealing with large scale natural
resource development and
management in agriculture,
forestry, timber and fishing as
for Belize, Guyana and
Suriname are likely to be quite
different when Trinidad &.
Tobago with hydrocarbons used
for exports, feed stock of heavy
industries, iron and steel,
fertilisers, smelters or the like.
But surely a common
denominator has to be increased
efficiency, reduced costs to
household consumers and
entrepreneurs as well as the
impact on the environment.
I wish to believe it is nec-
essary to avoid a naive and
simplistic description and
claim to "having" energy re-
sources when in fact the own-
ership and structure of those
resources are subject to the
political, economic and other
interests of multinational
corporations.
Questions of appropriate
tax policies of the external and
"domestic" sectors have long
been debated. But clearly there
is more than a taxation issue to
be addressed. The previous
work of indigenous technologi-
cal research, development,


VACANCIES

MINISTRY OF LABOUR, HUMAN SERVICES

& SOCIAL SECURITY

The Ministry of Labour, Human Services & Social Security invites
applications for the following positions:

(1) Probation & Social Services Officer
(2) Senior Probation & Social Services Officer

Kindly send all applications to:
Secretary
Public Service Commission
Fort Street, Kingston
Georgetown.

Closing date for applications is May 4, 2007.

Job description /Job specification for both positions can be
uplifted from the Personnel Department. Ministry of Labour,
Human Services & Social Security or from Personnel'Department,
Public Service Commission.

Tie vorThomas
Permanent Secretary'


CARIBBEAN COMMUNITY SECRETARIAT

STAFF VACANCY


SECRETARY TO THE TRUSTEES
CCS PENSION FUND


Applications are invited from interested and suitably
qualified nationals of Caribbean Community (CARICOM)
Member States and Assuoiate Members of the Caribbean
Community to fill the abovementioned position with
assigned duty station in Guyana.

Full details of this position may be obtained by accessing
the Secretariat's web page at

Applications with full curriculum details, including
nationality, date of birth, work experience, educational
qualifications, summary of professional skills and/or,
expertise, three referees (at least two of whom must be
familiar with the applicant's work), and other relevant
information, should be sent to the Adviser, Human
Resource Management, Caribbean Community
Secretariat, Turkeyen, Greater Georgetown, Guyana or by
email to applnhrm@caricom .og.

The Secretariat will commence considering applications
from April 20,2007.


transfer and commercialization
in bauxite as well as petroleum
by the universities in the region
may now need to be placed on
a different scale and realistic as-
sessments made of the level of
investment need for R&D to
guide the region's planning for
energy needs and the access to
or development of sustainable
resources.
In this regard, the recent
work undertaken for Guyana on
its options for a policy on re-
newable energy by the Eco-
nomic Commission for Latin
America and the Caribbean
(ECLAC) from its Port of Spain
Office could prove to be very
useful.
The high price of oil and
gas, substantial and growing
demand in both Eastern and
Western Europe due to a se-
vere winter has placed Rus-
sia in a powerful political and
economic position as the sup-
plier of about a quarter of gas
and oil consumed by Euro-
peans.
The measures adopted at
the EU's climate change and
energy summit were cer-
tainly precipitated by taking
account of the complex range
of geopolitical, economic,
trade and business policies
now facing the 27 nation
union and not merely the
grand moral imperative for
responsible stewardship of
our planet.










Google seeks



world of instant




translations


By Adam Tanner

MOUNTAIN VIEW, Calif.,
(Reuters) In Google Inc.'s
vision of the future, people
will be able to translate docu-
ments instantly into the
world's main languages, with
machine logic, not expert lin-
guists, leading the way.
Google's approach, called
statistical machine translation,
differs from past efforts in that
it forgoes language experts who
programme grammatical rules
and dictionaries into computers.
Instead, they feed docu-
ments humans have already
translated into two languages
and then rely on computers to
discern patterns for future
translations.
While the quality is not per-
fect, it is an improvement on
previous efforts at machine
translation, said Franz Och, 35,
a German who heads Google's
translation effort at its Moun-
tain View headquarters south of
San Francisco.
"Some people that are in
machine translations for. a long
time and then see our Arabic-
English output, then they say,
that's amazing, that's a break-
through," said Och.
"And then other people
who have never seen what ma-
chine translation was-... they
read through the sentence and
they say, the first mistake here
in line five it doesn't seem
to work because there is a mis-
take there." I
But for some tasks, a
mostly correct translation may
be good enough.
Speaking over lunch last
week in a Google cafeteria
famed for offering free,
healthy food, Och showed a
translation of an Arabic Web
news site into easily digest-
ible English.
Two Google workers speak-
ing Russian at a nearby table
said. however, that a translation


of a news site from English into
their native tongue was under-
standable but a bit awkward.

FEEDING THE MACHINE
Och, who speaks German,
English and some Italian, feeds
hundreds of millions of words
from parallel texts such as Ara-
bic and English into the com-
puter, using United Nations and
European Union documents as
key sources.
Languages without consid-
erable translated texts, such as
some African languages, face
greater obstacles.
"The more data we feed into
the system, the better it gets,"
said Och, who moved to the
United States from Germany in
2002.
The programme applies
statistical analysis, an approach
he hopes will avoid diplomatic
faux pas, such as when Russian
leader Vladimir Putin's transla-
tor miffed then German Chan-
cellor Gerhard Schroeder by call-
ing him the German "Fuehrer."
The word is verboten in that
context because of its associa-
tion with Adolf Hitler.
"I ,would hope that the
language model would say,
well, Fuehrer Gerhard
Schroeder is ... very rare but
Bundeskanzler Gerhard
Schroeder is probably 100
times more frequent than
Fuehrer and then it would
make the right decision,"
Och said.
The centre of Google's ef-
fort looks surprisingly modest.
Och shares a spartan office with
two others on his team, with
little clutter other than a shelf
of linguistic books above his.
desk. That's because the muscle
work is performed by machines.
So far, Google is offering its
own statistical machine transla-
tions of Arabic, Chinese and
Russian to and from English at
http://www.googlc.c.om/
language_tools. Third-party


software gives access on the site
to German and other languages,
Och said.
"So far, the focus is let's
make it really, really good," Och
said. "As part of a general
Google philosophy, once it's re-
ally useful and it has impact,
then there will be found ways
how to make money out of it."
Miles Osborne, a professor
at the University of Edinburgh,
who spent a sabbatical last year
working on the Google project,
praises Google's effort but sees
limitations.
"The best systems (e.g.
Google) can be very good indeed
for language pairs such as Ara-
bic-English," he said.
But he added software
will not overtake humans in
expert translations as it has
in playing chess; software
should be used for under-
,standing rather than polish-
ing documents.
"It may also be useful when
deciding whether to pay a hu-
man to do a good job: you
could imagine looking at Japa-
nese patent documents and see-
ing if they are relevant, for ex-
ample," he said.
Google chairman Eric
Schmidt also sees broad politi-
cal consequences of a world
with easy translations.
"What happens when we
have 100 languages in simul-
taneous translation? Google
and other companies are
working on statistical ma-
chine translation so that we
can on demand translate ev-
erything all the time," he told
a conference earlier this year.
"Many, many societies
have operated in language-
defined communities where
they really don't understand
and are not particularly sym-
. pathetic to other peoples'
views because of the barrier
of language. We're about to
have that breakthrough and
it is a huge thing."


3/31/2007, 11:00PM


.. ... ........ .... .... ... .......... .. .... ...... ................. .


Sniffer dogs find


second pirated


-DVD haul
KUALA LUMPUR, (Reuters) Two Malaysian dogs trained to sniff out DVDs have made
their second big discovery of pirated movies, leading investigators to a hidden stash worth
more than $430,000. a local newspaper said.
Lucky and Flo, two black Labradors, sniffed out at least 150,000 discs in a secret compart-
ment in a shop in the capital yesterday after anti-piracy officials, acting on a tip-off, raided the
place but failed to find an thing. the New Sunday Times said.
"They decided to call in the. canine brigade," it said. "Within minutes, the two Labrador re-
trieers snilfed Iou the hidden discs in a room that could only be accessed by the push of a button
hidden under a plug outlet."
Local media say movie pirates have put a bounty on the dogs after the hounds busted a fake
DVD ring last month in the southern state of Johor, sniffing out about $3 million worth of movie
and game discs in their first major successful operation.
Authorities say they are treating the threat seriously and have beefed up security around Lucky
and Flo.
Malaysia, which figures on a U.S. watchlist on piracy, has dramatically stepped up efforts to
rein in'copyright pirates as it negotiates a free-trade pact with the United States.
The dogs are being trialled by Malaysian domestic-trade officials in a joint effort with
the Motion Picture Association, which groups six major Hollywood film companies.


MAYOR AND COUNCILLORS

OF THE CITY OF GEORGETOWN







PROPERTY-OWNERS CARE PLAN

The Mayor and City Council invites property-owners to settle their
accounts under a Property-owners Care Plan.

Under this plan, defaulters could discuss with our competent tax staff
special arrangements to pay off their accounts. The Plan will expire
on April 30, 2007.

For more information, please call telephone number:
226-7963






lZ ______AY IU O.N.... !. ,_____..__ .. __ , . .. , A .SfNDAfiH MROfICE E riM; ,^orr
1 2" r r I I t ' )% t ' ' " ) J ) ) i( l " i ,m ,


TENDER


I .. I IIII


Gu. : Power& Light (GPL) Inc. 1., 1 ',:dt b ,i i 9ilebiddersforthe Supply
Of SafetbvGear, Personal Protective Equipment & C h-n,j,-,ollows:


LOTS


ITEMS i


1 Female Safety Shoes'
2 Female Safety Boots*
3 Male Safety Shoes"
4 Male Safety B '
5 Pole climbers/Lineman Safety Boots'
6 Short Rubber Boots (Non-Steel Toe)
7 Long Rubber Boots (Non-Steel Toe)
8 Long Rubber Boots (Steel Toe)'
9 All Weather Boots'
10 Helmets with Inners and Chinstraps'
11 Chinstraps for Hebl.nit-.
12 Suspension or Inners for Helmets
13 Ear Mufflers & Ear Plugs*
14 High '.-,li j Rubber Gloves wAith inrrn-i Liners*
15 Cotton Inners for HV rubber -:, *-,
16 Chemical Respirators ii:, replaceable cartridges'
17 Dust Masks
b Rubber ,
19 Workmen I -1.
20 Linemen Goggles'
21 i-: 0 Lens Goggles'
22 t i' I industriall)
23 Traffic Vests'
24 T .Ii, Cones
25 i, i, :. Coated Gloves'
26 Welder s Shield
27 Welder s Apron

Samples must be submitted along with tenders.

PERSONAL PROTECTIVE CLOTHING
28 Denim Pants
29 Khaki Pants
30 .. Blue Pants.
31 L E Polo T- i -
32 Jade Green Polo T
33 Grev PoloT- ',i
34 White Shirt Jacs
35 Light Grey Shirt Jacs
36 Blue l 0 : (Long Ei.- .ii
37. Blue Shirts (Shot Sleeved)
36 Cream Shirts (Long E '. .-..
39 ..:i Blue Overcoats. S..i Sleeved
40 Navy Blue Overcoats Long Sleeved
41 White Overcoats Short Sleeved
42 !.!h', ti Overcoats Long Sleeved
43 ? '.,''h Overalls Short Sleeved
44 V ',,r, i, C ..-,iA Long Sleeved
45 Navy Blue Overalls Short Sleeved
46 ":. : C . L ..j f" '1:
47 Rain Coats
48 Rain ..
*Swatches of material MUST be submitted with every tender.
A complete set of bid documents J, ,i., technical : ii 'If i for the listed
items) may be purchased for GS1,000 on submission of a *.' ;,-.. application to:
The Procurement and Inventory Manager
Guyana Power and Light Inc.
40 Main St., Georgetown.
Tenders must be accompanied by valid National Insurance (NIS) and Inland Revenue
(GRA) compliance certificates, and d-p.. .ii din the Tender Box provided at the
address above. Tenderers may bid for any or all of the lots listed.
.i3eaiipe for *-,;, i,,..-.i I'.h is 13:00 h (1.00 :Ir9 of Mu.ida'. 14th May. 2007.

Bid envelopes must be addressed as follows:

T-' l FOR SAFETY GEAR, PERSf I.. PROTECTiVE .U:i-'.i & CLOT -,

The Secretary to the Tender Board
Guyana Power and Light inc.
40 Main St., Georgetown. G. -PGATNS AND UoAIG'
h-tt p:///www,glp.licn.C of
S.be opened at 14:00 h (2.00 prr) on Tu,- .,1 15th May. 2007 in GPL s Board
Room. 275/279 .i St f r- :i in the presence of bidders/representatives.
GPL reserves th, right to reject any or all bids.


Agencies working
0m

on normalising


city water supply


THE Ministry of Agriculture
yesterday said there is
enough water in the East
Demerara Water Conservancy
to meet irrigation and domes-
tic consumption needs of
Georgetown and the Guyana
Water Incorporated (GWI).
The ministry, in a statement
to clarify issues concerning the
availability of water in the con-
servancy to the water company,
said that after a written request
from GWI management in early
January regarding the availabil-
ity of water to the Shelter Belt
in Georgetown ahead of the an-
ticipated El Nino like conditions,
the National Drainage and Irri-
gation Authority (NDIA) did
inspections which resulted in the
removal of blockages in the
Lama Canal.
It said it was further recom-
mended that the blockages be re-


moved mechanically and other
works done to conserve, adding
that the works commenced in
January and were halted Mon-
day after GWI reported the
discolouration of the water in
the Lama Canal.
The NDIA has since de-
ployed a pump to the affected
area to remove the discoloured
water, an exercise the ministry
said is expected to be completed
soon.
"The NDIA wishes to
assure the public that there is
adequacy of water in the con-
servancy to meet irrigation
and domestic consumption
needs of Georgetown and
GWI,". the Agriculture Min-
istry stated.
The NDIA and GWI are
"working together on problems
affecting GWFI. it said.
Reacting to the clamour for


Two suspects in

Buddy's robbery held
POLICE yesterday reported significant developments in Ihe
investigations into the robbery at the Brickdam.
Georgetown offices of the Buddy', company. lat March 16b
when two guns and cash were stolen and a guard shot.
Police said that during raids in several areas ot ihe iiy and
its environs yesterday morning, two men were held. jfl',r ihc$
were found with one of the stolen .32 Taurus pistols, 17 live
.32 rounds and two bullets proof vests.
Charges will be. laid shortly and investigations are con-
tinuing, police said.


Teen killed in road accident
CARRINGTON Pitman (Jnr), 15, of Dartmouth Village,
Essequibo, died Friday after he was hit by a vehicle while
riding a bicycle on the Westburg road, police said.
Police said the accident took place at about 11:15h.


potable supplies by
Georgetown residents, the wa-
ter company Friday announced
that it had resumed processing
from the Lama Canal flow.
The company said water
drawn from that source is
discoloured and must only be
used for external purposes, such
as flushing toilets.
GWI also advised adult
customers not to use that wa-
ter for human consumption and
to ensure that children do not
drink water from the taps.
It said the latest advisory
(Friday) remains in effect until
further notice.
GWI had also indicated
that every measure had been
exhausted to remove sedi-
' ment from the water supply,
with the aim of restoring nor-
mal service in the shortest
time possible.


Bani o





TWOgunen.riay af-

Ashb of$,8600 ash
and $15,00 in ceque
at osp Ply5r
Stret Loge
Geogetwn
Poic sai Ahb i




tune frma ak


MAYOR AND COUNCILLORS

OF THE CITY OF GEORGETOWN







Public Forum on Rates and Taxes

The Mayor and City Council invites all property-owners in Lacytown,
Bourda, Stabroek, North and South Cummingsburg, Kingston,
Queenstown; Alberttown to a Public Forum on Rates and Taxes on:

Date: Tuesday, April 10, 2007
Time: 5 pm

Place: Georgetown City Hall

City officials will be available to answer.questions on your accounts.

Residents in the abovementioned areas are asked to make a special effort
to attend.
'AbWSA .TOOS'teV





INDAY CHRONICLE April 1, 2007 13


HV/AIDS fight like cricket

UNAIDS Country Coordinator


NAIDS Country Coordina-
or for Guyana and
uriname, Dr. Ruben del
rado has likened the fight
against HIV/AIDS to that of


cricket, where a team effort
is crucial and everybody's
contribution makes a differ-
ence.
"Every wicket counts in


. EAM OUTREACH: members of the South African cricket
earn at the event. (Photo, courtesy UNAIDS)


PAY


YOUR



PHONED

THE
Ii n[:


cricket, and it's the same with
the fight against HIV and AIDS
- everybody's contribution
makes a difference," he said at
an HIV/AIDS forum at the Dor-
othy Bailey Youth Health Cen-
tre in Georgetown last week
which was attended by mem-
bers of the South African cricket
team.
According to a statement
from the UNAIDS office in
Guyana, Dr. del Prado was re-
ferring to the nail-biting one-
wicket victory of the South
African cricket team over Sri
Lanka in the Super 8 stage of
the ICC World Cup 2007
played at the Guyana Na-
tional Stadium at Providence,
East Bank Demerara
Wednesday.


Accompanied by Minister
of -Health, Dr Leslie
Ramsammy; Deputy Major of
Georgetown, Mr. Robert Will-
iams; UNICEF Guyana Repre-
sentative Johannes Wedenig,
and del Prado, the South Afri-
can visitors were escorted into
a crowded hall, full of young
people, media and onlookers.
Under banners calling
'Unite For Children, Unite
Against AIDS' the event un-
folded, hosted by local school-
children.
Noting that teamwork can
defeat AIDS, Ramsammy told
the assembly that HIV was a
global problem.
"We are all in this together,
and AIDS can only be beaten if
we work as a team".
Ramsammy was joined in
this by UNICEF Representa-
tive Wedenig, who said it was
heartening to see the peoples
of South Africa and Guyana
joining hands in a common


I.


4-,









WAY!


cause.
The cricketers showed what
was possible by making healthy
choices in life.
"Knowledge is power",
Wedenig said, "and by empow-
ering children with knowledge
to protect themselves, we can
win."
Speaking on behalf of the
South Africans, the team's field-
ing coach, Jonty Rhodes, said
that as well-known sportsmen,
they had the opportunity to
highlight problems.
South Africa had a high
prevalence of HIV, he said, so
the national cricket team was
committed to doing all they
could to raise awareness about
HIV, and fight the stigma and
discrimination that surrounded
it.
In a light-hearted question
and answer session with the
participating youth and media,
the final question from a young
man in the audience was: "What


would you do if HIV was a
cricket team and your team had
to defeat them?"
Jonty jokingly quoted what
he has just 'learned' from del
Prado sitting next to him:
"Cover your stump before you
hump," to roaring laughter from
the crowd.
The world-famous right-
handed batsman who
revolutionised fielding in his
playing days, reiterated the im-
portance of knowledge and
teamwork, skills and endurance
to successfully fight HIV -
similar to a winning a cricket
match.
The visit was organised
by the partnership between
the international Cricket
Council (ICC), UNAIDS,
UNICEF and the Caribbean
Broadcast Media Partnership
on HIV/AIDS, to highlight
the situation of children and
young people living with and
affected by HIV. I


_ -";.i'oaaMzwa r .


Save time and avoid the hassle of long lines by
paying. over the phone using the Touch Tone
Service of these banks:
DEMERARA
BANK
L A M r E


~~or


SBTI
"-f, fei peadm -Awma


Your account will be credited within 24 hours
Call your bank and find out how this system can
work for you.


OL~fl2.Wk~-~


i/,


REMEMBER


MTE FI IITSTINU lAIICESS iN YI
FEBRUARY 2007 BILL IS
A -, O AT ,', I ..


'Ir ~3~r~oaaec-r u~-~r


from the Management and Staff


'lll~aeo~----r~---I~--ql gag~ill~IL~aPU~--LII~--~ ~16--111 C -rp--`- IC


,r~


~B~,






1'4 SUNDAY CHRCLE April 1, 2007


By Shirley Thomas
WHILE the dominant empha-
sis is on Cricket World Cup
matches being played here,
not every visitor to Guyana
over the last few days would
have been preoccupied with
the fascination of the tourna-
ment.
Huddled in the bosom of
the pristine jungles of the


Essequibo over the last seventy
two hours, was a comparatively
small, but quite significant
group of tourists who had dif-
ferent interests, and never
spared a moment to even get
near the city with its buzz of
activities, and where the game
was being played.
Having arrived in Guyana
Thursday on the United States-
based cruise ship, the M.V.


Clipper Adventurer, the group
of nature lovers, aptly described
as eco tourists, passionately
embraced every moment and ev-
ery inch of what Guyana's rich
biodiversity has to offer.
The vessel, on its third
voyage to Guyana, had on
board about 108 tourists, 13
staff and 62 crew members
whose destination in Guyana
was Baganara, Essequibo, as


they were guests of Ever-
green Adventures, a local tour
company with a reputation
.for making a big impact on
the local tourism industry.
On arrival in Guyana, the
cruise ship docked off Baganara
in the Essequibo River, from
where the tourists were taken
on air and river tours.
The guests, the majority of
whom had a fascination with
bird watching and safari trekking,
were taken on guided tours of
the majestic Kaieteur Falls in
the Potaro, Saxacalli the long-
est beach in Essequibo Fort
Nova Zeelandia; Fort Kyk-Over-
al, Bartica and the awe inspir-
ing host Baganara resort.
At Saxacalli they were
expected to make presenta-
tion of gifts to the residents
of that Amerindian commu-
nity. Tour guide was Mr.
Abdul B, Sales and Market-
ing Manager, Evergreen Ad-
ventures.
The Clipper Adventurer
was described by its German-
born Captain Philipp Deckmann
(resident in the U.S.), .as being
eminently different from the
conventional cruise ships on
which entertainment features
prominently.
Deckmann said the Clipper
Adventurer is more of an edu-


One Stop Shopping!



bw Aviiase:..


*Steel Rods

*Steel Plates
*Steel Angles
*Steel Channels
*Steel Columns

*Steel Flats
*Steel "I" Beams
*Hollow Sections
*Galvanized Pipes
*Nails


- Both Mild Steel and High, Tensile. Diameters
6.00mm to 25.0mm
- Thicknesses 0.90mm (20g) to 3/4"
-Sizes I" to 4" ..
- Sizes (A)4" x 2" (B)6" x 3" (C)8" x 3" '
- Sizes (A)"x 6" x 2Slbs (B)B"x a"x 311bs- :
(C)8"x 8" x 58lbs -Lengths 40ft
- Sizes i"x 1/8" to 6'x V/"
- Sizes (A) 10" x 5 3/4" x 26 lbs (B) 8"x 5 1/4" x 18 Ibs
- Sizes 3/4"x 3/4" to 4-x4" -
-Sizes A" to 8"
- (A) All sizes Both wire and finishing
(B) Concrete 1 '/A" to 2 /9"
(c) Galvanized I '/" to 4"
(D) For sheets both Umbrella and Flat Head


*BRC Fabric -.Rolls of 7Sft sizes #65 #66 -#610
*Chain Link Fencing. 4ft to l2ft: Gauges 13 "/z 0 to 10


*Corrugated Sheets

*Baybed Wire
*Galvanized Purlins
*Ridgings

*Spikes
*Galvariized plain
Sheet
*Steel Pipes
AviMal1e 1 GAFOORS:




RM al (BMrie)


- Al Gauges- any length Incipfng
Pre-painted In five Col.our
- lOWN and Razor Wire types
- Any length available
Aluzinc and Pre-painted in four colours
in standard and special lengths- _
Oalvanized 4"- S"'- 6"

- 0.9mm I.5mm (20 to 166)


- Sch 40 "'/" to 8"


PhmF: 223-8091 223-8481 227-5888
ftn 2 5222 824-345
RM 28M-4512 284515
Mf : 337-4578 337-48 -337-8481


THE NAME YOU CAN TRUST


Ca Efor best, devfsc.


Not all about cricket


national tour vessel, and focuses
predominantly on education for
its clients.
As was evident, its clientele
were mature persons most of
whom were accomplished retir-
ees who opted for a quiet but
educational and rewarding pack-
age that included scientific ex-
ploits.
Deckman said the tour-
ists on board included several
scientists, historians, biolo-
gists, oncologists, medical
doctors and ecologists who
were able to mingle together
and share experiences.
The many facilities on
board include a library offering
books and study facilities for
the convenience of tourists and
there were usually about 2-3
lectures per day for the tvwo
week duration of the tour.
Some of the activities
strictly forbidden on board were
gambling; stage shows; intem-


Maintenance

contracts to be

awarded for

main roadways
CONTRACTS will be awarded this year for the mainte-
nance of six main thoroughfares as .the government con-
tinues to place emphasis on management of roadways coun-
trywide.
As a result, the administration has made available about
$200M for work on the East Bank and East Coast Demerara,
West Bank and West Coast Demerara roads and the Soesdyke/
Linden Highway, the Government Information Agehcy (GINA)
reported.
It said the contracts will cater for filling potholes, sealing
cracks, weeding and levelling verges, removing derelict vehicles
and clearing drains.
According to GINA, during 2003 and.2004, the govern-
ment hired consultants from Agile Assets Limited, a Texas
based company in the United States, to establish a data-
base, listing the conditions of the declared public road net-
works and develop a Routine Maintenance.Management
System (RMMS).
Subsequently, contracts were signed for 400 kilometres of
road networks and a three-year deal awarded for the East Coast,
East Bank and West Coast Demerara roadways.
Additional contracts were later awarded for the Soesdyke/
Linden Highway and Essequibo Coast and New Amsterdam to
Moleson Creek roads, GINA said.
GINA said, with the exception of the Soesdyke/Linden con-
tract which was completed in January 2007, the other contracts
ended during 2006, with about $647M spent on the works.
In addition, the government is expending- $100M to con-
tinue its safety engineering programme for the installation of
reflectorised spikes, street lights and pedestrian sidewalks in-
selected areas as well as painting road signs, markings and pe-
destrian crossings.
GINA said that scheme was developed in 2004 after a study
of fatal accidents which underscored the most dangerous sec-
tions along the entire road network. .
The need for remedial engineering work to improve
safety in each section was outlined and plans were designed
to meet it,. among the activities in keeping with e
government's commitment to develop and maintain the
country's infrastructure, the agency said.




Vacancies_ _


For stock clerks to check Invetory.

Must have two subject GCE or CXC.

Age limit must be 35 years & older.

Please sen your app.icateions
tv e T Per,'onnoe Department, Gafoors

Lot 1 lock X Houston Compele,
East -anik Demerara,.


perance drinking; dancing and
other forms of revelry; and al-
cohol consumption by the crew,
the.captain said.
The Clipper Adventurer of-
fers a two-week tour package at
a cost of US$6,000 and sets sail
from Belem in Brazil; travels the
rivers of the Amazon; Suriname,
Port of Spain and Venezuela.
At Baganara, those who had
exchanges with. the. media, ex-
pressed satisfaction with having
chosen Guyana as their destina-
tion, stating how impressed
they were with what the coun-
try has to offer.
And of the resort, one de-
clared: "It's fabulous! Exotic!
Intriguing! We could not have.
wished for a more comfortable
tourist destination."
They were also all loud
in praise for the food offered
by the operators of Evergreen
Adventures, at Baganara Re-
sort.


1


THE Clipper Adventurer on a previous trip to Guyana. (File photo)


the stabi'shd Leder






OUNMDm Agsmm- --*


p $M


4 V~ I.LW~ arr,.I .~.sr4fljf ww"r4w.~',r-i
- -"V'~~ f~tV~ .J~Ij ~*jj
/ '1 -~ ~4JSM I


- *1,. 4eq~~?-?9 4~fls~;- sr;p~ ~ ~ 'P
-I. !~ 'V ~ p. .4frr' ~q~:y& 44~~g%~.r ~'.b.'Lt:
.~ 'ta-


: N i ^ -.. .- .. 1--1. ,
.. ._ .. i.^ 'i-', 4 .'.'^ t S : ': *- .. . '- *
' --;r -.".:- T- ; .. 'i m- J/ ."' ' '- "'i
--A -, 5 .- ..
o -.%..- .-- --. ; ,'-. ; ..
.;.-rf .,;;- .... ,, "
-* -'.-i S kr.: .*.- .J . --,- .
. _- ..V. ..., -
a-. .. .- -. .' -.. .- ',- -
-I'..: *.: " : -
.'- ..,' -.. . .*.-. ,. ,, :. .,-- ,. ,- ,. . ; , ." ,




-- '-* ... ""-, ^ - - ". .. "-'" ^ y"^.^.- .- : :.' - .- ".i.=: "
. - .- *;.' 1 ...' .,,. -- ..,. ...-. -... :. -..., :, o *^;
., .' ^ *' ; *. -;/ ^ ^ ". = ...-, * ^ ^ *. .--. .*, ^-,

*.' 1 :i~li^ ^ '*'' *- ..-* -' ''* *~ -'**,* -".'*^ ^ ^ -" -_- ;. '"'^ l .';^ ^ 'i
-- - -; i" . --: --- .-4.T .
. ~' ... -. .,


.f'aF 'VI'
*1-~

I
* "I

a


A .*or ~ '~.


-.3,4.
'4
a..


*V


Best Network, Strongest Signal


el


_ 15


r^ r}y


/


/. 15


I


n-:^






16 ..... SUNDAY CiHRONICEi Apdl 1, 2007


i ...J t .- ,
i i. ?. .
.. *,, -* N
..o *: ..*. ).,,;,. ,,. . .. f. ', *,- -;,


fl II I ~ '~
4

.'~ ';~


5' ,.,.a..,j',. IP.**


V
1 *' ~
F
* ~


The 'theme of this year's Occupational Safety and Health Month "Safe
Practices, Healthy Workforce. Increased Production: offers a timely and
particularly important reminder of. the nexus between responsible
occupational safety and health practices and the economic well-being of
our coUntry. .

Over the years we have perhaps not paid sufficient attention to the institutionalization of
sound safety and. health practices :as an integral part of our respective workplace regimes.
While it is true that Gii-\ana has legislation in place that governs workplace practices and
while the Ministry of Lahoui. HuinianSetvices and Social Security hiasan Occupational Safety
and Health Department charged \iih particular safety and ;health-related monitoring and
training activities, it is no secret that many workplaces continue to fall well short of the
occupational safety and health standards .required under thelaw.

Our own in' eitigalions at the level of the Ministry tell us that in both the public and private
sectors adherence to god workplace safety and health practices is often the exception rather
than the rule. What was obtain at several, workplaces across the country are practices .that
continue to put at risk'thel general health of the workforce and which, by extension, place
additional constraints on our productive capacity.

It must by now be clear to both managers and employers in both the private and public
sectors that if Guyana is to met and sustain the standards necessary to ensure that the goods
and services that we produce are competitive on both the local and international markets, high
standards of safety and health practices must become an integral part. of the national
production "culture." With the advent of the CARICOM Single Market, for example, regional
importers of goods particularly food products 'from Guyana. are concerned that what we
export is produced under conditions that are hygienically safe and pose no .risk to consumers
elsewhere in the region.

;nood safety and health practices also assumes a particular significance when viewed against
ile backdrop of the growth of our"tourism sector and the importance of ensuring good safety
and health practices in the various sub-sectors liodx. entertainment, accommodation, nature
.resorts etc that comprise Hie tourism sector. These, in my view, are-clear examples of that
all-important relationship between sound safety and economic growth.

Occupational safety and health has also assumed ad added significance in the light of the
scourge of HIV/AIDS and that threat which the disease poses to our workforce in both the
public and private sectors. We have witnessed the crises that have confronted other countries
that have had to resort to importing skills. in order to try to compensate for losses in the
labour force resulting from HIV/AIDS.

I [ere in Guyana our own efforts to put in place programmes that seek to address the
challenge of [ IV/AIDS in the workplace have met with some measure of success. The
Government of Guyana has been instrumental in: securing both bilateral and multilateral
support in seeking to respond to IIIVIAIDS as a national concern. Institutions likethe UNDP,
the 11,O and PAlIAWHIO have been involved ini supporting us at a multilateral level while the
Government of the United States of America. partfictarly through the GHARP Programme,
lhas been providing bilateral support.

It has.s to be said. however, that for all the bilateral :and multilateral support that we continue
to receive coupled with .the efTorts of the Ministry of Health through the National AIDS
Programme Secretariat. our IIViADI)S workplace programmes still fiall'short if an adequate
response to (be crisis is not met.

I believe that at the level, of the public sector, senior ollicials ought to pay far more attention
to ensuring the etffctive implementation of IILV'AIDS workplace programmes. In the prvate
sector. particularly the productive sector. it is absolutely necessary that businessmen and
businesswomen come to see the implementation of workplace programmes as an integral part
of the production process rather than as an irritaint or a distraction from the substantive task.

For me the real significance of Occupati6nal Satet iand I health Month is that the occasion
finds us all having to shoulder the concerns of safety and health at the workplace.

Government. through agencies like the Ministry .of Labour and the Ministry of Health and. of
course, through thevarious heads ofSle. iencics. iiave a role to play. In this regard let me
say that I fully recognize the need Io sirciiglhein the Occupational Safety and Health
Department of my own Ministry to meet ile plepiin.miblhte:, of the health and safety
challenges confronting the nation's workforce We haI e iI find ways of allocating more
resources for the recruitment and training of personnel :and ibr ihe extensive field work that
we need to conduct in order to. ensure w..)rkplace trainingg and compliance \with OSH-
regulations and standards.

I do not. however, believe for a moment th; aill th'lelh cl'ori and all the resources should
come from government, I believe ihliai the prnaic actor mustl see the implementation, of
I IIV AII)S Workplace Prograiimmes as: inesinemi., in tlheI n respective enterprises since once
their.work fotbrces become affected by hli dfeiesilmeirlt' i -ses arc boundtosutler.

A another concern that I have is to do *with the clf'il that t \c' know. so very. little about the
status of'I IIV AIDS as a workplace issue in (Gu\.ii iWe hav cno clear idea of the extent to
which our \\orkforcc is affected and the iitl.ceii rate among the various categories of
workers. This in my opinion. is the kind otl' ii imii,.' that is directly linked to the
country's economic fortune. Accordingly. lei me say ih,, during the course of this year wec
shall be approaching both the Ministry ofl I Ilth .unid our friends in the donor community to
support an initiative, perhaps a workplace sure'. to' atll tempt to determine the infection rate
among the various ealegorics of workerss .

Occupational Safety and I Icalth Month iriusi 'sere ib renmiind all of us tlhe vital importance of
w working as a team to ensure tlhi \\c continue to.slrive Ibr and maintain high standards of
salely i and-healthI al tle workplace\ AlIof us haveijuail important roles to play.
\


I .


li~ ~


t ,.i* ~j*~ I


l April 28" 2007 marks another observance of World Occupational Safety and Health
Day, a day set aside by the ILO in recognition of worldwide efforts at reducing
industrial safety and healthaccidents artwork.

Here in Guyana, we observe the entire month of April as Occupational Safety and
Health Month and as such give our full support to the fight against industrial accidents and diseases.

Guyana being a developing third world country with limited financial resources must endeavor to maximize
effortsatprotectingourmostvaluableasset, ourpeople.

We must recognize that safety and health practices must start with each individual. There must also be a joint
effort by the social partners to work towards educating Guyanese workers about safety and health standards.

It is also of importance to include tech-voc schools and pre school leavers before they are swept up in the
world ofwork,

Public awareness programmes must be used as a vehicle to spread the message of safe work practices and
procedures in every sphere ofeconomic activity in Guyana.

The OSHAct of 1997, requires, that copies oftheAct be placed at vantage points in all workplaces. A visit to
most workplaces will reveal that this important aspect is hot being carried out.
NACOSH takes this opportunity to remind all workplaces/organizations that they have a moral and legal
duty.

MESSAGE FROM CHAIRMAN

Obligation to their employees for educating and advising them on the requirements of the OSH Act of
1997.

In today's modern society there are many complex work situations that might have a variety of hazards
waiting to surprise the inexperienced or uneducated worker. It is, therefore, imperative that all-concerned
make every effort to train and educate workers to empower them to work safely and make wise decisions
.with regard to theirhealthatwork.

There is a wide repository of information gathered over the years relating to accident causes and prevention,
most of which were garnered from actual incidents. This information is available to all workers, employers,
trade unions; in fact, anyone who has access to the.internet.

Workers' education programmes in safety and health can ha'e a very positive effect on accident prevention
and reduction. It is therefore beneficial and a valuable asset to invest in training of workers for improved
work place safety and health. .:

The National Advisory Council on Occupational Safety and Health salutes all workers and management on
this anniversary ofWorld Safety and HealthDay 2007.

We wish to encourage the tripartite principle and pledge to 'work in close support of making workplaces in
Guyana safer and healthierforthe benefitof all Guyanese.

Best wishes for a safe and productive 2007 and beyond.'

Winston A. Beresford
CHAIRMAN
CAGI The Employer's Organization is committed to the principles that


Safety at Work is an. important responsibility of all employers. Every
employer is required by. law in Guyana to have and operate productive
equipment, ensuring that no one is placed at risk of injury or death
because the employer bydesign or carelessness, omitted to install
adequate protection measures.

CAGI has over the years provided training which indicates that participants continue to gain
sound knowledge of various aspects of the act and its administration.

Some of the large productive enterprises e.g. GUYSUCO,. GP.L,-DDL.and Banks DIH
employ full time safety officers but many of the medium and smaller companies ignore the
safety requirements of the law and the importance of safety in the workplace resulting in
injury.

CAGI strongly recommends that companies encourage and install safety committees in the
company, consisting of workers and company management officials to review consistently
safety and health procedures and at the same time companies should endeavor to install
protective measures for e.g guards over working parts of machines etc. CAGI has and is
working with its members very closely with the Ministry of Labour and the Ministry of Health
to ensure compliance with safety and health regulations.


Bibi S. Ramclhan
Secretary -' : :: :
ConsultativeAssociation of(;taiiilei ndustisrLtd L. '.
157 Waterloo Street.
NorthCummingsburg
Georgetown
Tele:(592)- 2,6-4603/225-7170 ; "
Fax: (592)- 227-0725
Email: cagiii;solutions2 )0.netl . ,


~---~I-- u~rlinu r~~~r~srr~m~j 'LO.,,tia -arrtTh'S~-~Ur







U N A 1. 2 07 1


;mr ._i


Nbt ,%20
yc -,< JiIII1


Reflect on
-Retie





Prophet s life


- PresidentJagdeo in Youmun Nabi message

HERE is the text of President Bharrat Jagdeo's message for Youmun Nabi, the birth-,
day of the Prophet of Islam being observed today: .
"As we commemorate the birthday of the Holy Prophet Hazrat Muhammad, let us re-
flect on his life and success.
'Muhammad the Prophet, whose name means "Highly Praised", was born in Mecca on
April 20, 571 A.D.
On Youmun Nabi,' we celebrate a number of benefits bequeathed to the Ummah, including
revelation of the Holy'Qu'ran with its guidelines and the Prophet's life as an ever living guide
applicable to the personal, social, nauonal, and international areas of our own lives.
Muhammad the Prophet professed the -principles of universal brotherhood and equality
of: mankind. He 'assured fraternity among religious
communities and advocated for economic emancipa-

The Prophet was a liberator to all people,
and so people or Islam have a special mandate to
S,. disseminate his principles and.morals to all mant
kind.
In our celebration of this national festival, let
us also remember acts of kindness and charity to the
less fortunate, as was advised by him.
My government is proud of our legacy and will
continue to support the heritage of all our peoples
wIhich have been a foundation of pride and develop-
ment.
May the joy and happiness of Youmun Nabi en-
rich our nation with spiritual, cultural and moral val-
Sues, wlich are among` the lessons taught by the
PRESIDENT BHARRAT JAGDEO Prophet Muhammad.
On behalf of my government and the people
of Guyana, a happy Youmun Nabi to all, especially: to our Muslim brothers and sis-
ters."


"ALL praise is for Allah, Lord
of the Worlds and may the
peace and blessings of Allah
be showered on our master
Muhammad.
Dear respected brothers and
sisters across Guyana. I greet
you with the greeting of peace
of the religion of Hazrat
Muhammad (peace and bless-
ings of Allah be upon him): As
Salamu alaikumwa rahmatullahi
wa barakatuh!
Once again Youmun Nabi is
with us. We praise Allahu Ta'ala


and thank Him for giving us the
health, and the opportunity to
be able to celebrate the most
honoured birth of the Holy
Prophet Muhammad (peace
and blessings of Allah be upon
him).
This opportunity comes at,
a time when it is perhaps more
evident than ever that our nation
needs the message of Allah's. fi-
nal Prophet and Quide to all
mankind (peace and blessings of
Allah he upon him).
His message is one of an


IAC Youmunm..



Nabi message

THE Indian Arrival Committee (IAC) has joined in extend-
ing a peaceful and blessed Youmun Nabi to all Guyanese
on this festive and auspicious occasion.
"This auspicious occasion not only marks the birth and
death anniversary, but also the sacrifices arid challenges the Holy
Prophet Muhammad encountered in spreading Islam to the
world," the IAC said.
According to the IAC, the lesson of Youmun Nabi teaches,
in practical ways, the understanding of each other's religions
and moral values.
It is not the propagation but the permanency of hi.s mes-
sage that is deserving and is practiced throughout the world.
the committee said. .
"The IAC therefore, extends a peaceful and blessed
Youmun Nabito all our Muslim brothers and sisters."


all embracing monotheism
that obliterates all falsehood
regarding divinity, humanity
and the rest of creation: la
ilaha ilallah Muhammadur
rasulullah! There is no God
except Allah; Muhammad is
,;:the messenger of Allah! It is
a message from God Himself:
Allah, the Lord of Abraham,
Moses, Jesus and all the
great prophets sent to every
nation among men.
As Muslims it is we who
must learn, understand, practice
and uphold this message. We
must be people of monotheism
worshiping and loving none
save Allahu Ta'ala with all that
we have been given by Him.
We must be people of mo-
rality applying the values of
monotheism to our lives and
businesses and general dealings:
unwilling to go against the com-
mand of our One, Supreme,
Lord; maintaining honesty and
integrity and keeping to our
pledges and promises, regardless
of the costs in material terms.
We must be people of jus-
tice who live and judge by the
standard of Allah and His
Messenger (peace and bless-
ings of Allah be upon him):
we must not fall into evil due
to racial prejudice or due to
worldly lusts like greed and
Please turn to page 20


I I


The Federation .of Independent
Trade Unions of Guyana (FITUG)
finds it a privilege to extend to
NACOSH fraternal greetings on
the observance of Occupational
Safety and Health month.

Occupational Safety and Health is
a fundamental ingredient in any
Indii.lrial Relations System since
its workers are exposed to the
environment as well as the
machinery that is being used within the industry to propel the
production process.

The International Labour Organization (ILO) has recorded a
series of occupational diseases that is related to employees
who are exposed' to these various machineries during their
tenure on their jobs, and that is why it is important that
Occupational Safety and Health month should not be seen as a
time of jollification butinstead be used as a vehicle for the
purpose of imparting valuable safety information to the
general public on how to be safety conscious as they go about
their day-to-day activities.

This month should also be used as a safety awareness period.
whereby workers are sensitized on what types of safety
measures, as well as. protective devices are to be used within
their various work environiments. Workers should also be
sensitized on the various roles they can play or what is to be
expected ofihcni during an emergency.

As we continue to obserse Occupational Safety and Health .
month I trust that thoughts will remain centered on the safe4v
and health ofthe nation'sx orkforce.

Best wishes to you:

Yours faithfully .
Kenneth Joseph.
General Secretary


Mon
Launch of Month's
Activities Linden Hospital
Complex.

9
FASTER MON DAY
(Public Holiday)


23
National Safer Injection
Group-
Lamel at Kunikunini -
Protmoting Safer Injection
Practices.


30
Visit by XAC'OSH M.Ibers
to Injured workOr.
iotpihilized. at die OPHC.


iueiwoMiwi SAFElm AftD ItMErF M Aikur Atc TImTiflE'


Tue


10
OSH Semni.ar at Hotel
Tower by C.A .I.


17
Seminar at Madhiih4-.
NACOSH OSH Persoitel
Seminar at Uinlen
Hospital Complex by their
etafi.


Wed -
4
OSII Seminar.
Fneiuer? S iS 'ivisorp .
GPI.
G.T.&1.

Seiil riu l IRtt SAL
Aaimahia for Safety adi
Health ('omnlimiltee
Mii. of
Liabour N.V-i S |l.


18
GT&T to ld
OSH Senmiiar ti
ILeadterr ot'\V,,rkl !;h.-e
conuniniiec


-- 4. 4


24
'IV Prognrmme Region 2
and One-Day Seniinar ai
Caricon Rice Mills.
E-et.lih. for OSiH
Coninittce MtXlimbrci t1
- SMin ol
LaboiurNACOSlt.


25
to boLt
lilY .\tl)S'.'"tlpl--..
hitacatioti tot Nct
Ettiptot ccc


National Safer Injeclion (;-2 m \ I I.\\ I II


5 .

Min p l

12
" S il Stnili.a f'
H-:l loClf I.' -
*A.l.


1 Ir I i II'
\ t'I \let, 1 tml.


26
1 3SI ',.ittMIlhler


1. MIhoAU \cAs
11


F.-ri
13.'i |'llDYY
(!uli liolilday'.


13.


20
Min Af%: ,6-.r -;-; l.'i-or Councwil
tM i i. .i r ... i. ,I I H ..ll Tim t IS)': :' t t
"Prswl.s 1ho I'iI o1n W o hI!t ,o*. ihe gellnell I, '


27
Natiiolia A'crds .'etemony loti t*i1anonie., ldi'. i.
Wiinic,'ofSchioo'I Po.tier Comnitl.Iti 'i a liti \.' *
IKoe-l Person, 'cr Eiilecaion Ul rta [: 'i( i>,;: *-.
aititi.ld lthe criktriu re. "tood -h:tit., -
Mini Exjpo ( "ily lhdll i> Nain. *t;ii "l lhti-ii.j:i



1 I'Rm ,R \\1\ Sh f tO'm\\ \\it kl 1 i\S'.


- Message from Fazeel Ferouz, President of the

Central Islamic Organisation of Guyana (CIOG)


r -4j


-


..7=--...


--- -- *499


I I


r"'


e ---_I__--_ C I - - I -~r 1 '3


S17


SUNDAY CHRONICLE April 1, 2007





S. ........... ......... ................................... ........ .. .. . ......... . .. ... ...S N D i


From


cane


fields


to


Landmark


The Guil'kHW4Ua tienmw Stadiumq


Produced by the Government
Information Agency (GINA)
THERE were many skeptics
who felt it could not be
achieved because the physical
challenges and the dateline
seemed insurmountable but
President Bharrat Jagdeo, an
optimist, accepted the chal-
lenges and boldly began pur-
suing the goal of a national
sports facility.
Today, a magnificent struc-
ture, the Guyana National Sta-
dium at Providence, the host
venue for the 2007 Cricket
World Cup, (CWC) is a land-
mark achievement.
Located at Providence on
the East Bank Demerara, it is
the only architectural design of
its kind among the other CWC


host venues in the Caribbean.
The facility boasts a seat-
ing capacity of 15,000, a park-
ing space for about 4,000 ve-
hicles, a high security zone, con-
ference hall, club, administrative
office, VIP and media centre and
players' pavilion.
The Guyana National. Sta-
dium and the Sir Vivian Richards
Stadium in Antigua are the only
two facilities to be erected from
the grouftd for CWC.
HOW IT ALL BEGAN
Guyana's stadium had its
genesis in August 2003 when
President Jagdeo on a visit to In-
dia held discussions with offi-
cials of the Indian Government
for support in erecting a national
stadium.
The arrangements secured a


US$6M grant and a US$19M
soft loan from the Indian Gov-
ernment.
The following year, the
agreement was signed by former
Minister of Finance Saisnarine
Kowlessar and Representative
of the Export-Import (Exim)
Bank of India, Tarum Sharma.
Shortly after the agreement, tech-
nical experts from India visited
Guyana and engaged the govern-
ment in discussions on the con-
struction requirements.
In 2004, Guyana won the
bid to host CWC 2007 after be-
ing awarded the green package
that allows a country to host six
of the matches of the Super Eight
games.
Twelve countries had vied
for host venue status but
Guyana, Antigua, Barbados,


Grenada, Jamaica, St. Kitts, St.
Lucia, St Vincent and Trinidad
and Tobago were selected.
Shapoorji Paloonji and
Company Limited from India
was awarded the contract for the
construction of the stadium. Its
design was finalised through
agreements between the Guyana
Local Organising Committee
(LOC) and architectural compa-
nies from Barbados and Trinidad
and Tobago.
In August 2005 the first pile
was driven at the Providence
site. Work also began simulta-
neously on the playing surface
by Teraforma, initiating the
transformation of an empty plot
of land, once used as a cane field.
The pitch and field were
made with sand, clay, and a layer
of grass. It was built with a sub-
merged-drainage system capable


Stadium taking shape.
of taking off 90 per cent water.
Its durability was tested on sev-
eral occasions with practice
matches.
By January 2006, Technical
Consultant on the stadium Walter
Willis reported that it was over
35 per cent advanced. Interna-
tional Cricket Council (ICC) of-
ficials made frequent visits to as-
sess its progress.
More than 53 per cent of
the task was achieved by April
and the ICC gave encouraging
reports about Guyana's pre-
paredness..
CHALLENGES
It was, however, not all
smooth sailing for the stadium.
Inclement weather during the ini-
tial construction period had
caused major setbacks in comple-
tion deadlines.
Construction was also


threatened by a cement shortage
which had affected the Carib-
bean but the government, with
support from neighboring Ven-
ezuela, secured an adequate
stock to continue construction.
Concerns were also raised
about the preparation of the
main playing area and the prac-
tice pitch on the southern sec-
tion of the stadium.
Former West Indies fast
bowler and member of the ICC
Andy Roberts, on his tour of
Guyana's stadium, noted that the
practice pitch should have been
prepared simultaneously with
the main playing surface and
given at least one year to achieve
full maturity. The surface, how-
ever, developed satisfactorily
with intense preparation.
Meanwhile, work also be-
gan on sprucing up the Guyana
Cricket Club (GCC) and Everest





GT&T Business Office, 78 Church St, G/Town
Monday Friday until 18:00h
Saturday until 14:00h

Wireless Connections Regent Street, Georgetown
Downtown Ave of the Republic, Georgetown
Nigel's Supermarket Robb Street, Georgetown
Heritage Africa Lamaha Street, NC/Burg, Georgetown
Johnny P Supermarket 44-45 Robb& Light Sts, Bourda
S & J's Dageraad Avenue, Linden
Riverview Plaza Burnham Drive, Wismar
C & F Supermarket Bagotstown, EBD
Loncke's General Store Soesdyke, EBD
Budget Supercentre Lusignan, ECD
Dumay's Railway Embankment, Enmore
Super Value Store Dundee, Mahaicony
Country Side Pharmacy Stanleytown, WBD


Post Offices Countrywide/Bill Express
Monday Friday until 16:30h
Saturday until 12:00h

A. Ramdhanny & Sons 32 Sisters Village. Wales, WBD
Neighborhood Pharmacy 54 Second Ave. Bartica
Berbice Petroleum Est. Strand, New Amsterdam
Matadeen's Rosehall, Gorentyrie
R&S Shopping Centre Belvedere Public Rd Clyne
Parasram's Travel #78 Village, Cornver (on
Evan's General Store Rosignol, EBB
The County Medical Public Road, P3rIka
Imam Bacchus & Sons Affiance, ECE
Big Bird & Songs Charity, Pomeroon

* some locations open later, Sundays & holidays


(Th


for outstanding balances on your
February 2007 Bill is

Sse JndlS d APhIL 8E e ot .
e se ond Sunday in Every month) .T
-, -'7-_ ..- .... ',../ .. . W- .


The first piles being driven for the stadium.






ICllE April 1; 2007 19


ICC CWC officials conducting inspection at the stadium.


rounds for practice purposes. dium. President Jagdeo had
made a call for it to be given
PROUD MOMENTS a name reflective of the na-
By November 2006, the tional spirit, after it was com-
CC was convinced that Guyana only being called the Provi-
ad met most of the tasks for dence stadium. He also pro-
osting CWC. This- was the ap- posed that it be transformed
raisal given by Venue Develop- into a facility that could ac-
aent Director of the ICC Don commodate various sport dis-
,ockerbie after an assessment ciplines.
isit. One of the memorable mo-
The facility was named ments in the stadium project was
he Guyana National Sta- a special dedication ceremony


on November 8, 2006, attended
by Vice-President of India
Bhairon Singh Shekhwat, Presi-
dent Jagdeo and other govern-
ment officials.
President Jagdeo lauded the
architects, artisans and others in
the construction of a stadium
which he said is "truly a work
of art and a wonder to behold".
Hundreds'of Guyanese got
a first-hand look at the new fa-
cility after a trail run was staged


GUYANA'S INVESTMENT
FOR CWC
The private sector invested
billions in hotels to create suit-
able accommodation facilities
and services for the thousands of.
visitors anticipated for CWC.
About 12 new hotels in
Georgetown and its environs
were established from scratch,
while 38 already existing were
upgraded.


on February 16, 2007. The ex-
ercise was a requirement of the
ICC to test the operations of the
manually-operated scoreboard,
the media centre, security, trans-
portation, volunte&s and medi-
cal personnel.
The highlight of the
event was the 20/20 tourna-
ment between the Young
Warriors of Berbice and the
GCC team.
The government made tre-
mendous efforts preparing
Guyana for the mega event. Up-
grading of: the East Bank
Demerara road into a four-lane
highway, beautification and en-
hancement of Georgetown and
its environs, fencing and drain-
age structures and parking facili-
ties outside the stadium were all
part of the project.


Among the new projects
was the Buddy's International
Hotel, the first internationally
recognized facility to be estab-
lished, conveniently located next
to the stadium.
The hotel, which is ac-
commodating officials, teams,
media and sponsors for CWC,
boasts 250 rooms, a large pool
and bar area, an entertain-
ment arena with stage and
dressing rooms, a conference
room, two restaurants, dining
area and a tennis court, among
other amenities.
More than 2,000 rooms
were also secured under the Bed
and Breakfast programme that
began in January 2006. The
programme targeted household
proprietors, encouraging them to
provide a comfortable environ-
ment for visitors at a reasonable
price and to share the Guyanese.
hospitality.

THE FACILITATORS
The LOC was established in
. Guyana and other host countries
as a facilitating body for accom-
modation, hospitality and ser-
vices for CWC.
The sub-committees were
established for the overall plan-
ning and execution, public rela-


A landmark the National Stadium.


TRIAL match held at the stadium in February.


More hope for Hope from HAP


By Mark Ramotar

IEFORE Director of the Hope
children'ss Home, Ms.
amantha Finlayson met
Warrant Officer One James
avill and Master Sergeant
datt Wilson of the United
statess Embassy in Guyana last
veek, the children's home
he oversees at Enmore on
he East Coast Demerara was
n dire need of refit and re-
)air.
The needs of the home,
vhich was opened on February
11, 2001 and currently houses
12 children (15 girls and 27
)oys) of various backgrounds
id family situations, ranged
rom window replacement and
nesh screening, to school and
medical supplies.
Over the past six years, the
lome has had to unfortunately
urn away 213 children,
'inlayson said.
Although the home is being
nanaged on a modest budget, its
uture is beginning to look a little
righterr because of the assis-


tance from Cavill and Wilson and
the other team members of the
U.S. Embassy Humanitarian As-
sistance Programme (HAP).
According to Sergeant First
Class of the HAP Team and
Civil Affairs Officer at the em-
bassy, Curtis DeBruhl, the HAP
team "put their heads together
and began to make arrangements
to provide some much needed aid
to the children's home".
In an email to this newspa-
per, DeBruhl said they asked
Finlayson to create a "wish list"
of items that would be beneficial
to the children housed at the
home'
He said although the HAP
Team operates under a mea-
gre budget itself, the team was
able to solicit private donation
monies from leaders within
the Enmore community.
These donations contributed
enough funding to provide the
children's home with some of
the much-needed items that
were requested by Finlayson.
"By coordinating the efforts
of fellow HAP Team members


Sergeant First Class DeBruhl and HAP Team to collaborate with as well as replacement glass for
Staff Sergeant Blaisdell, Cavill a local furniture manufac- several of the windows through-
and Wilson were able to accom- turer to fabricate all new beds out the living and school por-
modate for some of the immedi- and mattresses for the chil- tions of the children's home.
ate needs of the home such as dren, as well as new dining An installation profes-
furniture and windows," the tables with benches. sional was even dispatched
email stated. Gafoor's donated free of from Gafoor's to repair the
DeBruhl said enough charge, all the window mesh for windows and install all the
money was raised to allow the the children's sleeping quarters new custom window screens


HAP HOPE: Director Ms. Samantha Finlayson, right, with some of the children of the Hope
Children's Home in Enmore.


on behalf of the owner and
management.
Although some needs have
been met, many still remain, and
efforts are ongoing to assist the
children's home.
Donation collection bins
have been placed with the Peace
Corps, Civil Defence Commiis-
sion (CDC), and within the U.S.
Embassy, all in Georgetown:
Medical supplies are still
greatly needed, as well as school
and educational supplies and
building materials for the Hope
Children's Home.
DeBruhl said an additional
venture the HAP Team is work-
ing to support is an agriculturni
fence project in union With the
Peace Corps in Region Two
(Pomeroon/Supenaam).
He said the U.S. Embassy
HAP Team was pleased to be
able to help the Hope
Children's Home, and wel-
comes the opportunity to as-
sist other organizations with
projects throughout the
Guyanese community in the
future.


tions and marketing, local gov-
ernment and civil society, trans-
portation and communication,
security, health and emergency
services.
The committee was chaired
by two former Ministers of Cul-
ture, Youth and Sport, Anthony
Xavier and Gail Teixeira. Dr.
Frank Anthony now holds this
portfolio.

GUYANA READY,
STADIUM READY
The government and the
Guyana LOC worked intensely
-to ensure that the stadium and
all the necessary arrangements
are in place for hosting the
games.
For the first time, Guyana
is hosting the Super Eight
matches for CWC, the third larg-
est sporting spectacle world-
wide.
During the event, Guyana
and the rest of the Caribbean
are under the watchful eyes of"
an estimated 2.2 billion view-
ers and the first match, played
last Wednesday at the Guyana
National Stadium at Provi-
dence between South Africa
and Sri Lanka has already
gone into the world record
books.






2 ..SUNlAY CHRONICLE April 1, 2007


From page

gluttony. We must c
and corruption
they may arise w
our homes, comm
our nation. All of. t
of the message of o
prophet Muhamm
and blessings of
upon him) which.
reflect.
Brothers and si
sure everyone will ag
message of the Ho
(peace and blessings
upon him) is indeed


I .-< ,' '

17. praiseworthy. However, I am
certain that many doubt
oppose evil whether it is practical and many
wherever more are at a loss as to how to
whetherr in go about living in accordance
unities or with such" lofty standards.
his is part Muslims should neither doubt
ur beloved its practicalitynor be ignorant
2ad .(peace of its methodology but unfortu-
Allalf-be nately many of Us are.
we need to This is nothing but a sign
S ::" that we are far away from our
sisters 1 am beloved Prophet (peace and
ree that the blessings of Allah be upon him)
ly Prophet in every respect. For it is in the
of Allah be noble example set by him (peace
J noble and and blessings of Allah be upon


. 2 0. 1i


him) that we find the practical
aspects and direction which
make the path to lofty charac-
ter clear and attainable.
It is only by studying him,
knowing, remembering and ex-
amining his illustrious-life that
we can truly understand how to
be purified human beings. -
Ultimately this is what
Youmun Nabi is about. It is
bringing into focus the life, sta-
tion and character of the most
perfect of human beings so that
we may reflect, be enlightened
and be spiritually revived for
our journey along the straight


path. -.....
A path shown to us by
Prophet Muhammad (peace
and blessings of Allah be upon
him) as a long and difficult one,
but one that has been well.
charted by him and made easy
by Allah through the. blessing'
associated with him (peace and
blessings of Allah be upon him).
If we seek to be close to
him we will be close to Allah,
if we obey him we -would have
obeyed Allah and if we
honour him we would be
pleasing Allah. So let us heed:
the advice of our learned and
remember him, obey and
honour him on Youmun Nabi
and as often as we can other-
wise so that we may. be close
to him and to his message, a


message whichh we should
take to our communities and
our nation that stands in such
dire need of it
On this day of Youmun
Nabi, let us remember the poor
and needy in our country; let
us pray for those who are sick
in our country, those who need
our love, care and attention.
Let us as we celebrate this aus-
picious event in the annals of
Islamic history, reach out to the
disadvantaged in the society and,
do.our best to alleviate their suf-
fering.
On this day of Youmun
Nabi, let us reflect on the role.
we can play in the ongoing
struggle to reduce poverty in
our country.
Let us take part in the fight


.- ..... .. NO. A:. ,A.l . H..A"T. .-,,;" .
* *'. ..;" .. * ..t i *f :,.;. '-?, : *"o ? ;. .. ",, .'.:.* : .. .: ,'". . . ?.. : > :" ,.' ( *-fr ; ?
. ... -. l .- = :: -" ,"^ ':"" ,: :V. '..,. _.- ". ". ,*,*'" : .,, .2 :..:';,"<.';,
... -.o-...* .,.:.... . *'_ :.. :" . .* *. '..:; r- ,- .. ... .. , . . .; :* '* .. .:ik^ **. ,. '- .*. ;(:.
-'P ,. . ^ sX -*A N:^?!."^:" .^; .5 ". - >:.. .. .s %


Though descended from nobility the Hoy ; -
SProphet Mohamad led by ex and
choose s". J.t'im-vt ofhi- -.
-morality. apsd90 s .. .. -
.-- --, -.- : ,-.. '

Let's all strive to emulate these qualities as we
join the Muslim community in celebrating. '- '


-. .. .


.4



--

'I
'-~.1

'~*1~~
I'


'-1


lIpCo.CO' 3'I


against the spread of HIV/AIDS
by educating ourselves, our
family and our community about
the great danger of HIV/AIDS.
.We should not discriminate
against any person who has
HIV/AIDS but be caring and
compassionate towards them.
What we do not know may hurt
us and others. Learn about the
virus and assist in preventing
the spread of this virus.
I pray for a blessed
Youmun Nabi and that Allah
accept from us and place us
firmly on the path of His
Chosen Messenger (peace
and blessings of Allah be
upon him) in order that we
may attain success in both
worlds."

MYL

Youmun

Nabi

greetings
THE Muslim Youth
League of Guyana (MYL)
has called on all Muslims
to observe Youmun Nabi
with special prayers today
for the solidarity, pros-
perity and integrity of the
Muslim community not
/only in Guyana but
throughout the world.
MYL, in .a Youmun
Nabi message, also urged
Muslims to play their part
in strengthening national
unity by emulating the foot-
steps of the Holy Prophet
Muhammad. and use his
teachings to "rekindle our
souls with the light lit by
him".
"When tribalism, politi-
cal turmoil, moral and social
chaos was rampant, a child
was born into poverty and
deprivation. He rose up to
become a man who by ex-
ample pioneered a new way
of life that heralded 'in a
worldwide admiration of
principles that changed the
course of civilisation," the
MYL said.
"Over 1400 years ago
was born the Greatest
Benefactor of Mankind,
Hazrat Muhammad, the
Prophet of Islam, fulfill-
ing the prophecy of the
finality of prophet-hood
on earth to guide man-
kind towards good," MYL
President Shabir
Hussain said in a state-
ment.
Hussain said the
Prophet Muhammad
changed mankind's way of
thinking towards the'recog-
nition of God and His com-
manrdments. "He influenced
people's behaviour and al-
tered their evil inclinations.
He came as a mercy onto
mankind and was emulated
in his character and dispo-
sition that helped trans-
formed brutal men into sa-
cred personalities."
"His life was a means
in which. rulers and sub-
jects alike, copied the art
of leadership, nation
building, taminly orienta-
tion, political stability,
-economic reforms -atd
last buit- ot- let piri*-
tii elev",, ". louswai-
SOL ;".'





SUDAY CHRONICLE April 1., 2007
I I I I II III ~ ~~ ~~i t I II I I I I I


CTOG
Central Islamic Organisation of Guyana
Motto:"Reaching the Unreached"
Woolford Avenue, Thomas Lands, Georgetown.
P.O. Box: 10245 Tel: 592-225-8654,225-6167, 227-1033 Fax: 592-227-2475
E-mail: contact@ciog.org.gy Website: www.ciog.org.gy


SOF TAE I'RTAraNNIVERSAR
^I OF ?OETMUMMD ?BA


Eid Meeladun-NAbi Festival of the Birth Anniversary
of Prophet Muhammad (PBUH)

"YOU have indeed in.the Messenger of Allah a beautiful
example for any one whose hope is in Allah and the Final
Day, and who engages much in the. Praise of
Allah.'"(Chapter33 Verse 21)

As no one can know Allah better than the Prophet
(PBUH), no one can know the Prophet(PBUH) better
:han Allah. THEREFORE THE Ouranic verse quoted is
the best evidence to establish that tie Holy Prophet
(PBUH)is the best example in character-for humanity.
The world has seen a lot of thinkers, who have
propounded moral theories on different occasions in
history but they are of no consequence whatsoever as
they are devoid of practical examples The philosophies
of Aristotle and Plato cold not make anyone good
Whereas the moral teachings of the Holy Prophet
Muhammad (PBUH) are not mere theories but practical
manifestations of moral principles which are
universally relevant and applicale foral times. We will
attempt by way of01 illustration to understand the conduct
of.this Noble Example

His Softness and Politeness
Muhammad was very a cheerful, easy, pleasant, polite
person. He was never rude or rough, never clamorous
or indecent. His cheerfulness was never
withdrawn from any one. Not even fOm those about
whom he warned his companions or from those he
himself was careful about. The Quran is witnessed to
his soft and noble character: "It is paitof the Mercy of
Allah that you does deal gently with'them. Were you
severe or harsh hearted, they wouldtiave broken away
from about you..."(3:159). He treated each one so
gently and politely that each one felt as someone
specialtohim.

His Forgiveness and Mercy
He went to Ta'if(a town at the outskirts of Makkah) to
invite its residents to Islam. They threw stones at him
and wounded him An angel came to him asking his
permission to destroy the town:He told the angel that
God had sent him a messenger of mercy, not ol
destruction. He forgave the people of Makkah who
forced him to leave his home and fought against
Muslims. Just before the peope.of Makkah accepted
Islam, a tribal leader came to theProphet and asked his
permission to impose a grain i'bargo on them. The.
prophet told him that he would not mae anyone. starve
because of their enmity tolslanorMuti s.

His Affection and devotion
In an age when children were often considered as
chattels especially the girls, the Prophet loved his own
children as well as others'. He would kiss then, ask
them to ride with him on his camel, an4ichat with them.
People of Arabia before Islam did not treat their
daughters as equals to their sons The prophet told
them that they are equal and should .e treated equally,
He told the Arabs that he was proud t61be the father. of
daughters. Women were treatedunjustly whether they
were daughters, wives or mothers. They were at the
mercy of the.men in their lives. The Prophet treated his
daughters; wives and even'ti foster mother with'
.dignity, and affectioft. He emphasized,"'The best among.
you is he who is best for his family and I am the best for *
my family". He was asked: "Who has more rights" .HHe
. .1 1. 7.


replied: Your mother, your mother, your motherthree
times, then said your father'. He said the paradise is
under the feetof mothers.
His Honesty and Truthfulness
Prophet Muhammad was very decent, very trulhtul in
speech and very trustworthy. He was known as
Amin(trustworthy) and Sadiq(truthful) since his
childhood Even his enemies acknowledged his
noble qualities. Once heavy rain damaged the House
of God at Makkah The Makkan leaders rebuilt the
House of God, but quareled over placing of the
"Black Stone". In short, Muhammad went there to
arbitrate among them. Every one was pleased to see
Amin and Sadiq The dispute was resolved
peacefully

Loving poor and the needy
Entertaining and .helping the poor and needy and
participating in their funerals were things the Prophet
always observed. He never showed contempt or
disgraced a poor man for his poverty. He stood for
the rightss of the poor, depressed, and deprived A
needy man once caught him by his neck saying: "0
Muhammad! Give me some thing!" His neck was
hurt. He did not frown at the needy man but gave him
what he could. Ali(May Allah be pleased with
him),the Prophets son-in-law said about the Prophet
that he spoke little and preferred silence. Whenever
he spokehie spoke gently, slowly and repeated some.
of his words. He saved himself from three faults and
advised others to do the same.
1. Not to curse others,
2 Not to seek others' faults.
.3. Not to insult others by reminding them of their
weaknesses.

The Power of Peace is stronger than the Power of
Violence

When Prophet Muhammad (PBUH) conquered
Mecca, the war criminals were brought before Him.
He said to them," GO you are free." His message of
peace is further emphasized in the statement, "you
cannot change someone's heart by use of force, but
through humility and kindness you can win his
heart."

Biblical Prophecies on the Advenf QMuhammad

The Biblical prophecies on the advent of the Prophet
Muhammad are evidence of the truth of Islam for
people who believe intheBible.

In Deuteronomy 18, Moses stated that God told him
"1 will raise up for them a prophet like you from
among their brothers, I will put my words in his
mouth, and he will tell them everything I command
him. It anyone does not listen to my words that the
prophet speaks in my name, I myself will call him to
account." (Deuteronomy 18:18-19)
From these verses we conclude that the prophet in
this prophecy must have the following three
characteristics.

1) Thathe willbe like'Moses
2) Thathe will come from the brothers of the
,':.,.Israelites, i.e.,the Ishmaelites
' 3) ThatGodwiilpufHiswords in tothe mouth of this
prophet and that he will declare what God commands


him Let us examine these three characteristics in
moredepth:
1) A prophet like Moses:
There.were hardly any two prophets who were so
much alike as Moses and Muhammad. Both were
given a comprehensive law'and code of life. Both
encountered their enemies and were victorious in
miraculous ways. Both were accepted as prophets
and statesmen. Both migrated following.
conspiracies to assassinate them. Analogies
between Moses and Jesus overlook not only the
above similarities but other crucial ones as well
These include the natural irth, the family lile, and
death of Moses and Muhammad but not Jesus
Moreover Jesus was regarded by his followers as the
Son of God and not exclusively as a prophet of God,
as Moses and Muhammad were and as Muslims
believe Jesus was So. this prophecy refers to the
Prophet Muhammad and not to Jesus. because
Muhammad is more liKe Moses than Jesus
2) Abraham had two sons, Ishmael and
Isaac (Genesis 21) Ishmael became the grandfather
of the Arab nation, and Isaac became the grandfather
of the Jewish nation The prophet spoken of was not
to come Irom among the Jews themselves, but from
among their brothers, i.e the Ishmaelites.
Muhammad, a descendant of Ishmael. is indeed this
prophet.

3) God wilt put His words in the mouth of this
prophet The words of God (The Holy Quran) were
truly put into Muhammad's mouth. God sent the
Angel Gabriel to teach Muhammad the exact words of
God (The Holy Quran) and asked him to dictate them
to the people as he heard them. The words are
therefore not his own. They did not come from his
own thoughts, but were out into his mouth by the
Angel Gabriel. During the life time of Muhammad and
under his supervision, these words were them
memorized and written by his companions. Also,this
prophecy in Deuteronomy mentioned that this
prophet will speak the words of God in the name of
God. If we looked to the Holy Quran, we will find that
all its chapter, except Chapter 9, are preceded or
begin with the phrase, in the Name of God, the Most
Gracious, the Most Merciful.
Note that God has said in the prophecy of
Deuteronomy 18. "If anyone does not listen to my
words that the prophet speaks in my name, I myself
will call him to account." (Deuteronomy, 18:19)

This means 1hat whoever believes in the Bible must
believe in what this prophet says, and this prophet is
the Prophet Muhammad.

What Others Say about Prophet Muhamamd

Michael H Hart wrote "The 100: A Ranking of the
Most Influenual Persons in History." He states thatthe
most influential person in all history was
Munammad, peace be upon him, withJesus second
Examine his actual words- "My choice of Muhammad
Ito lead tne list of the world's most influential persons
may surpriselsome readers and may be questioned
by others, but he was the only man in history who
was supremely successful on both the religious and
secularlevel."
George e.rnard ..haw, a famous writer and non-
Muslim says' "He must be called the Savior of


Humanity. I believe that if a man like him were to assume
the dictatorship of the modern world, he would succeed
* in solving its problems in a way that would bring it much
needed peace and happiness".
Then we found that K.S...Ram.akrishn.a.Rao, an Indian
(Hindu) professor of Philosophy, in iis booklet
"MuhammadtheProphet of Islam" calls him the "perfect
model for human life." Professor Ramakrishna Rao
explains his point by saying:
"The personality of Muhammad; it is most difficult to get
into the whole truth of it. Only a glimpse of it I can catch.
What a dramatic succession of picturesque scenes
Tnere is Muhammao the Prophet There is Muhammad
the Warrior. Muhammad the Businessman Mulhammad
the Statesman; Muhammad the Oralor Muhammad the
Reformer Muhammad the Refuge of Orphans
Muhammad the Prolector of Slaves. Muhammad the
Emancipator of Women. Munammad ,ihe Junqe
Muhammad the Saint All in 311 these inagniicent iolc:.
in all these departments or human activities, he is alik, a
heru '
Mahatm.a Gandhl, speaking on. the character of
Muhammad, peace be upon him, says in'Young India
"I wanted to know the besi of one who holds today
undisputed sway over the hearts of millions ol
mankind.., became more than convinced Ihal it was
not the sWord that won a place forlslam in those da s in.
the scheme of life. It was the rigid simplicity, the uner
self-effacement of the Prophet the scrupulous regard
for his pledges, his intense devotion to his friends and
followers, his inrreprdity, his learlessnp.ss. his absolute .
trust in God and In his own mission These and not tne
sword carried everything before them and surmounted
every obstacle, When I closed.the 2nid volume (of the
Prophet's biography), I was sorry there was not more'
for me to read of the great life."
S..aQjinN.i aidgthe famous poetess oflIndia says:
"It was the first religion that preached and practiced
democracy; for, in the mosque, whenthe call forprayer
is sounded and worshippers are gathered together, the
democracy of .Islam is embodied five times a day when
the peasant and king. kneel side by side and proclaim:
'God Alone Is Great'... I have been struck over and over
again by this indivisible unity of Islam that makes man
instinctively a brother."
The Prophet (PBUH) was a lighter for human equality
freedom, dignity, love and brotherhood and a
revolutionary against evil and social order
His life is all inclusive and therefore an answer t 31 all1
problems, individual and social which confront -
mankind
When Muhammad died at the age of 63, the woice o' ine
Arabian Peninsula had changed from paganism to the
worship of One God, from Iribal quarrels and wars 1o
national solidaity and cohesion: frodf drunkenness anrd
debauchery to sobriety and piety: from lawlessness ard
anarchy to disciplined living1 from uter moral'
bankruptcy to the highest standards of moral
excellence. Human history has' never known such a
complete transformation of a people"or a place belmicc or
since.
0 PEOPLE
THE LIFE OF PROPHET
MUHAMMAD (Peace be upon
him),IS THE BEST MODEL
FORYOWU


8 D, BRA. TL t 2 2t7.,

18 NORTH ROAD, BOURDA. TEL: 227-3802


------


: -- I






~~~~k.~~~~ _1IA IUU II.pn ,20


PNCR Youmun


Nabi message,
THE People's National Congress Reform (PNCR), in its
Yommun Nabi message, said the Holy Prophet Muhammad,
the last and final messenger of God to mankind, left a
great legacy for peoples of all races, nationalities, ages and
times.-
Today, it said, the Mushm faith is embraced by millions'
all over the world and ncltide people of every class and race.
The main opposition parry said the ideal society, which
Islam teaches, is based on brotherhood of the whole humanity
and equality of all men.
:- It said despite the current situation created by the govern-
ment. "our faith in the future of our nation 'allows us to hope
and work towards the eradication of all sources of oppression,
bigotry and intolerance and to do our best to promote the in-
\terests of the less fortunate among us."
'"In the circumstances we once again repeat our pledge to
work with all the forces in the society to build a nation on the
pillars of equality of opportunity and mutual respect for all; as
we strive to forge a common destiny for the people of our dear
land.
The People's.National Congress Reform extends best
wishes to all Guyanese on the occasion of Youman Nabi."


April observation to focus on


avoiding workplace accidents


BEGINNING today, the gov-
ernment will heighten its fo-
cus on improving conditions
and safety at the workplace to
counter work-related acci-
dents and diseases.
The Government Informa-
tion Agency (GINA) said the
thrust coincides with Guyana's
observance of .Occupational
Safety and Health (OS&H)
Month, under the theme 'Safe
practices, healthy workforce,
increased production'.
GINA said the.administra-
tion is concerned about the in-
creasing cases of accidents at
workplaces and, to address the
issue, has been advising that


OS&H committees be estab-
lished and advocating that it is
everyone's responsibility to be
actively involved in the monitor-
ing of the work environment.
OS&H Month will be
launched at Linden Hospital
Complex in Region Ten (Upper
Demerara/Berbice) and, as part of
the activities, the responsible de-
partment in the Ministry of
Labour will emphasise the impor-
tance through seminars and lec-
tures countrywide, GINA said.
According to GINA,
Labour Minister Manzoor
Nadir and staff of the Na-
tional Advisory Council on
Occupational Safety and


S :


Health (NACOSH) are ex-
pected to visit the Aroaima
Mining Complex and the
Russian Aluminum Company
(RUSAL) to conduct similar
exercises with management
personnel and employees.
GINA said Guyana Tele-
phone & Telegraph Company
(GT&T), Guyana Power &
Light (GPL) and the Consulta-
tive Association of Guyanese
Industries (CAGI) will also be
hosting'series for their respec-
tive staffers on the importance.
of practising OS&I-H.
On April 27, individuals
and companies will be
honoured for their exemplary
practices at a national awards
ceremony and symposium,
GINA announced.
It said workplace hazards
and exposures cause more than
160 million workers to fall ill
annually and the global estimate
of work-related deaths is about
1.1 million per year.
GINA said; in 1997, the
Guyana Parliament passed the
OS&H Act and it was promul-
gated in 1999.
The law being a major
movement in the transformation
of the labour sector, the govern-
ment since established a National


Occupational Safety and Health
Council, which is helping to for-
mulate regulations to enforce it.
With the assistance of the
International Labour
Organisation .(LO), Guyana is,
preparing regulations that relate
to occupational diseases, con-
,struction safety, personal pro-
tective equipment, mining and
chemicals, GINA said.
Other regulations are being
prepared for the agriculture,
forestry, mining, and industrial
and manufacturing sectors.
-Meantime, the Occupa-
tional Safety and Health Con-
. vention (Number 155) and Rec-
ommendation (Number 164),
both of 1981, provide for the
adoption of national occupa-
tional safety and health policies.
GINA said Guyana ratified
Convention Number 161 of
1985, which provides for the
establishment of enterprise-
level, occupational health ser-
vices designed to contribute to
the implementation of the
OS&H policy.
The convenant describes
the actions to be taken by
governments and within en-
terprises, to promote OS&H
and improve the work envi-
ronment, the agency said.


,:. -." '-
; .'.,-" -*. = ..-


'I




~'sx ~ -*~~4p~P-' L


INVITATION TO TENDER

PRE-STRESSED

CONCRETE POLES

Tenders are invited from Companies/Contractors
for the Supply of Pre-stressed Concrete Polesto
be used initially in the construction of a 69,000
Volts (69kV) Transmission Line linking the new
GUYSUCO generation plant at Skeldon with
GPL's No 53 Village power station.

Tender documents may be obtained during
business hours from Monday 26th March 2007
from the office of the:
Procurement & Inventory Manager
Guyana Power & Light Inc.,
40 Main Street, Georgetown.

The completed tender documents must be
submitted in plain sealed envelopes bearing no
identification of the tenderer. Envelopes shall be
clearly marked ITender Pre-stressed Concrete
Poles" on:the top, left hand side, and addressed
to the:
Secretary to the Tender Board
Guyana Power & Light Inc.
257-259 Middle Street, Georgetown.

The Tender Box is located in the office of the
Company Secretary at the address above.
Tenders should be submitted before 14:00 h on
Friday 20th April, 2007, and tenderers will be
notified of the date and place for opening of
tenders.
GPL reserves the right to reject any or all tenders
without assigning a reason, and does not bind
itself to awarding to the lowest bidder.


BA' * * *






SWOiAT HIMIIE April 1, 2007 :23


By James Stavridis
Admiral, U.S. Navy
Commander, U.S. Southern
Command
ON MARCH 5th, President
Bush announced important
new initiatives for the West-
ern Hemisphere.
From my point of view as
the Commander of United
States Southern Command, the
President's initiatives under-
score the vital connection we
share with the wonderful and di-
verse nations of the Americas.
Today, more than ever, common
interests interweave the fabric
of this beautiful hemisphere. We
share common challenges and
opportunities; and our futures
are inextricably linked.
At U.S. Southern Com-
mand, the military
organisation focused on the
32 nations and 13 territories
of Central America, South
America, and the Caribbean,
we devote a considerable
amount of energy to the
study of these challenges and


opportunities. We pursue a
host of programmes designed
to foster security, stability,
and goodwill in the region,
with the ultimate goal of en-
abling the spread of true pros-
perity to the 450 million
people living in this part of
the Americas.
The key to the future of
this great region is understand-
ing-- understanding'each other,
understanding our. shared chal-
lenges, and understanding the
promise of security cooperation
for our 'ared future.
When it comes to our phi-
losophy, the Southern Com-
mand motto directly reflects our
approach: "Partnership for the
Americas."
The first step in creating
lasting and beneficial partner-
ships is through building and
communicating understanding.
The U.S. shares numerous and
compelling linkages to the
people and societies in the
Americas.
Besides our geographical
and historical affinities, we
are linked by the common


values of democracy and re-
spect for human rights; we
are increasingly interdepen-
dent economically, with .40
per cent of U.S. trade flowing
north and south in this hemi-
sphere; and we share growing
human and cultural connec-
tions, with a large number of
Guyanese expatriates living
in the U.S.
At Southern Command, we
study these linkages and com-
municate their importance as we
strive to build and strengthen
relationships in the region,
through effective strategic com-
munication and interagency
partnering.
When you analyse the chal-
lenges we face together in the
region, you quickly realise that
no one nation big or small -
can successfully overcome
them. Illegal drug trafficking,
criminal activity, gangs, human
smuggling, terrorist financing and
recruitment, natural disasters -
none of these stop at a nation's
border. These challenges require
cooperative solutions; they re-
quire partnerships.


At U.S. Southern Com-
mand, we are committed to be-
ing good partners to being the
partner of choice throughout the
region. Every day, year-after-
year, we dedicate the majority
of our resources toward build-
ing the security capabilities of
our partners, while working to
encourage an environment of co-
operation among all of the na-
tions in the region.
This involves numerous
training exercises, educa-
tional programmes, technol.
ogy sharing, intelligence
sharing, security procure-
ment assistance, humanitar-
ian aid, and a myriad of other
programmes. We endeavour
to improve our region's abil-
ity to respond to today's and
tomorrow's security chal-
lenges. Through a steady im-


'Partnership for the Americas'


provement in security, we can
help create the conditions
that will enable this region to
counter the poverty and in-
equality that has gripped it
for so long.
U.S. Southern-Command
conducts many humanitarian
goodwill activities that directly
help those in need while provid-
ing needed training to our team
in addition to training exercises
and security cooperation
programmes.
As an example of our com-
mitment to the people of the re-
gion, our medical personnel treat
about 250,000 patients on an
annual basis, varying from rou-
tine prevention to the most se-
rious emergency cases.
In Guyana, we recently
donated a disaster relief ware-
house worth US$350,000
stocked with US$250,000
worth of medical supplies.
Our humanitarian
assistance programmes build
or refurbish a number of


^i INTEREST RATE FOR


THE SECOND

QUARTER 2007

The Public is hereby informed that all late
payments of tax will attract interest. The
Interest Rate for the second quarter (April 1,
2007 -June 30, 2007) is 19.54 percent per
annum.


The calculation of this interest rate is based
on the prime leading rate as published by the
Bank of Guyana plus 500 basis points.

Commissioner-General


sf.


WA .. -

a,, te Hol:. P prophett
-. on \\ hom lit e Nra ,~;:


a'' -'" lt 4 oui r hon U


S_ observe .thiis holy day.

From the Directors, Management
and Staff of: ,te new

n S building society ltd.


Special Prices For April Only..!


:-- ': :- "g-:r-:" : -i":'": 'sine :-':;:_X.5pt ._ ... 'G: '- -l,-- ..., -
____________ '-2 .:' 7'-. >., .-

- (-._ -_3i 8.,.;-^H^ h :-tn^! '-r d-,_.-..,. .-..


!.J 3/ .. 1s .... -fn ---~jr g ,-.- -.-.- -. --.-


f-gj I%1fi iIwwire Fin-isEi-urug ----....----....
-.hl : -Vpes .... -. -.-...-..-......--... ..


I "O/bcVpil
IIPt"0p00
..S8S-00
a a 0 0a

"7"-90-00
-~~ ao0 a
1O0% Off"-

100/o off:
o10/ off"


Wholesale


2-7 0.-00 -.ii
Iz-Z0 aC 3




Spec~iai Uri~es"
'** "c -- I _- _.. .-_ -


PRICES EXCLUDE Call Mr. Acklu 223-8601

.-RICES- E XC-- or Mr.. Rawat -225-3146
A"" -- : Moustonr ComrBplex


clinics, schools, community
centres, and wells throughout
Guyana. Every August
Guyana receives a Tropical
Medicine course that treats
hundreds of patients: We
provide the GDF (Guyana
Defence Force) between 10
and 20 professional military
courses and 10 to 15
seminars and working groups
that cover disaster
preparedness, intelligence
sharing and legal issues. We
are donating to the GDF
US$280,000 worth of radios
that can communicate from
Georgetown to the furthest
outposts in Guyana's border
regions to help with border
security and enforcement.
SAll of these efforts con-
.tribute to showing goodwill,
to building relationships, and
perhaps most importantly, to
building understanding.
As President Bush
Please see page 24


i


--:-


N
0
mlbT






Y ADIIIIS CHRONICLE A r 7


0 poill


cement


I-TCI

AFTER three months of op-
erali. ongoing monitoring
at the TCL Guyana Incorpo-
: rated iTGI).cement packag-
ing terminal has confirmed
that the facility is not harm-
ful to the environment, ac-
cording to the company which
began full operation here at
the beginning of the year.
In a statement Thursday,
* TGI said tests have established
that no pollutants are. being re-
leased in any aspect of the op-
eratio ns, including the
offloa ling of bulk cement from
cemert carriers.
It said the ongoing monitor-


utants from


bagging factory


reports

ing checks the quality of the air,
soil and water around the plant.
The bagging plant has been
supplying cement under the
TGI brand to the.local market
and the transhipment of bulk
cement is being carried out by
the M.V. Naftocement IV, a
specialis'ed cement carrier.
The bulk supplies are from
TCL Group plants in Trinidad
and Barbados, the company
said, adding that during a recent
offloading operation, TGI Plant
Manager, Mark Bender pointed
out that there was no seepage
when cement is pumped from
the vessel to the plant's silos.


It said Bender affirmed,
"TCL is committed to ensur-
ing: that its cement terminal
and packing plant is not
harmful to the environment
and it will continue to work
closely with the Environmen-
talt Protection Agency to
make certain the operation
remains safe."
TGI is a part of the TCL
Group's Health-Safety-Envi-
ronment Forum which was es-
tab ished in 2004, to bring to-
gether senior operations per-
sonnel and HSE personnel at
the TCL Group, as well as
other specially invited persons
such as worker representa-
tives.
TGI said the forum identi-
fies strategies and programmes


to improve the overall safety
performance of companies in the
group.
These strategies and
programmes are geared towards
achievement of the classic HSE
objective of "Zero Accidents,
Zero Incidents and No Harm to
People or Damage to Property
and the .environment", the com-


pany said.
-It said the three -cement-
manufacturing companies
within the TCL Group were re-
cently certified to the Interna-
tional Standards Organisation
(ISO) 14001:2004 Standard.
ISO 14001 is the world's most.
recognized and internationally,
accepted Environmental Man-


ae nmenl S 'in-em (EMSi.fraime-.
The state-of-the-art ce-
ment terminal was built in
Guyana at a cost of about
US$10 million and the com-
pany said the 8,000 tonne fa-
cility has significantly im-
proved the supply of cement
to Guyana.


NO SEEPAGE: TGI Plant Manager Mark Bender at a key connection in the plant system.
(Photo, courtesy TGI)


'Partnership for the Americas'
From page 23
recently announced, this summer we are sending a U.S. Hospital Ship, the Comfort, on a first-
time deployment to Central America, the Caribbean, and South America to visit various nations'
ports on both sides of the Panama Canal in order to treat upwards of 85,000 people who lack
access to medical care. The Comfort will visit Guyana to provide medical treatments not
-available at local hospitals.
This spring, we are also sending a specially configured U.S. Navy logistics ship on a seven-month
tour of the region to perform a variety of training and maintenance events focused on helping our
partners better secure their ports and coastal waters.
The President characterized his speech as "a speech that sets out a:direction for this country in
regards to our neighbourhood," the Americas.
g I truly believe this is the right time for all of us, inside and outside the U.S. government,
to work together on the challenges facing this hemisphere. By doing so, we can realise the
true promise of the Americas and it all begins with building and communicating true under-
standing, leading to a real and vibrant "Partnership for the Americas."


Sour Customers & Friends


I'AErP" r. 6Lq .',
MENDES .ID.
wwwifatifrwaatiunames teom


: .. -




S ...-.-..


- !. p,., .**- -

'"


* -


'-.4
~


'-.1
- .-
- ~....


m B, I






SUNDAY CHRONICLE' ApHI 1''2007','"'_'. , , .. . ._

.p .] .......
-saS nn -a I
.X^W HflB ^"--ll~t % ^^^m " ^ Jd--J^^ ^^^"


YA



DEMERARA HARBOUR BRIDGE
CLOSURE TO ROAD TRAFFIC


Channel 46

08:00 h Music Video
08:30 h Sanford & Son
09:00 h Indian Movie
12:00 h Football
14:00 h-Travelers Extreme
Live
15:00 h Movie
17:00 h Movie
19:00 h- Oldies aie Goldies
Live
20:00 h Khan's Family Time
20:3Q h Movie

NCN INC. CHANNEL 11

01:00 h Late Nite with GINA
03:00 h Movie
05:00 h Mystery of the Body
05:30 h Newtown Gospel V2
Hour
06:00 h NCN 6 0 Clock
News Magazine (R/B)
07:0Q 1h Voice of Victory
07:30 h Assembly of Prayer
08:00 h Lifting Guyana to
Greatness
08:30 h EID Programme
09:00 h Feature
09:15 h.- ICC CWC 2007 -
West Indies vs Sri Lanka (Live)
17:30 h Lutheran Men's
Fellowship
18:00 h Guysuco Round- Up
18:30 h Kala Milan
19:00 h Close Up
19:30 h Grow with IPED
20:35 h In Style
21:00 h Highlights West
Indies vs Sri Lanka
22:00 h NCN Week in
Review
23:00 h Movie

NTN Channel 18

05:00 h Sign On
05:10 h Meditation
05:30 h Quran This Morning
06:00 h R. Gossai General
Store presents Krishna Bhajans
06:15 h Jettoo's Lumber Yard
presents Krishna Bhajans
06:45 h Ma Ki Amrit Shakti
07:00 h Ramroop's Furniture
Store presents Religious
Teachings
07:30 h C. Dookie & Sons
presents Krishna Bhajans
07:45 h -Annandale Kali Devi
Shakti Mandir
08:05 h Sa Re Ga Ma
09:35 h Paul's Importer/
Distributor presents Shree
Ganesh
10:15 h Teleview Youman
Nabi 2007 Live
12:00 h Death Announcement
& In Memoriam
12:15 h NTN Indian Musical
Interlude
12:30 h India Bazaar presents
Luv & Kush
13:00 h Youman Nabi Live
14:00 h To be Announced
16:00 h Teaching of Islam


17:00 h Musical Waves Live
18:0Q h Birthday greetings/
Anniversary/Congratulations/
Death Announcements & In
Memoriam
19:00 h Mere Awhaz
Suno...Karaoke Live
20:00 h Kenstar Max Stardust
Awards
00:00 h Sign Off

VOG

08:00 h Christ is the Answer
08:30 h Message for the Hour
09:00 h Full Gospel Hour
09:30 h ICC/CWC Super 8 -
West Indies/Sri Lanka


13:00 h News
13:05 h Sports
13:10 h Death & Messages
13:15 h Catholic Broadcast
13:36 h Country Eastern and
Western
14:00 h ICC/CWC Super 8
West Indies/Sri Lanka
17:30 h Merundoi
18:00 h News
18:10 h Sports
18:15 h The Lord's Challenge
18:30 h -Church Calling
19:00 h Salute to Senior
Citizens
20:00 h Bible Reading
20:30 h Death & Messages
20:05 h Answers


ADVERTISE

WITH THE GUYANA


CHRONICLE

FOR THE BEST RESULTS.


A heartfelt greeting can
energize the weary
and encourage the
lonely.
Ruth 2:10.


iFP'iJM lil[ mIL 'T HiIH 1n I ,I[II.i iu f, Ir '


gM ll.l= .l.l... !.ll.l.ljll.J


* I I
* 1~"I15/20:30hrs 14:0 hrs
* "A GOODYEAR" "HAMKODEW\\-4NEE
I L KAR GAN E"
I pls '" with Akshav& katrina
S "LE DIVORCE" 16:30/20:30 his
* "ALEXANDER" *
SAMERICAN OUTLAW"
I I NOW INSTALLED LATEST SOUND SYSTEM I
I S T A R ITIV E MI


20:55 h Scripture Songs
21:00 h Holiness Hour
21:30 h Guyoil on the Move
22:00 h Mining in Focus
22:30 h Concert Hall
23:3t) h Death & Messages
(Repeat)
23:55 h News

98.1 Hot FM

06:00 h Sunday Kind of Love
with Rocky
10:00 h Music from the Heart
with Frederick
13:00 h GT&T Top 40
Countdown
18:00 h Basil P. Show


SUBJECT

TO

CHANGE

WITHOUT

NOTICE


Life is precious,
so cherish it. Say
NO to DRUGS
and YES to LIFE!
10- - -


For Sunday, April 1, 2007 -14:30h
For Monday, April 2, 2007 -14:00h
For Tuesday, April 3, 2007 -14:00h

For Ocean Going Vessels opening lasts about 1-1"2hrs








You are cordially invited
to
An Evening of Literature Part ViII
Theme: 'The Sporting Life'
Excerpts from Poetry & Prose by lan McDonald, Clive Lloyd,
Rohan Kanhai, D.H. Lawrence, John Betjeman & others
Coordinated by Petamber Persaud


OFFICIAL STATEMENT FROM

GLAXOSMITHKLINE INTERNATIONAL


.GlagSmithKline Gives Assurance On Vitamin C Levels In Ribena



As reported in the press, GlaxoSmithKline Consumer Healthcare
(GSK-CH) has accepted charges brought by the New Zealand
Commerce Communication (NZCC) and has given undertakings
to the Australian Competition and Consumer Commission (ACCC)
with regards to potentially misleading advertising statements and
low levels of vitamin C in some Ribena Ready4-to-Drink products
manufactured for the Australia and New Zealand markets.

GSK-CH can reassure consumers that the issues discussed with
the ACCC and NZCC only affects certain Ribena products.in
Australia and New Zealand.

Ribena has been a favourite with Guyana consumers for over five
years and we would like to reassure our consumers that thorough
laboratory testing has confirmed that vitamin C levels in Guyana
are as stated on the label.







"' '' "^- - -- -SUNDAY CHROMOCE Aprilk Off


COUNSELLING C I IS S IF IE D S 2 WPI.' ';-,-1I. .,<_
.. .. WANTED 5 , ll Jil' I .11
BLAND FOR SALE FOR HIRE C.Lun ,\%I. ij1,
LEGALS BEAUTY SALON PROPERTY FOR SALE EDUCATIONAL I1 \ it',,I1.
TO LET LEARN TO DRIVE HERBAL MEDICINE AUTO SALES ( >i *-il ti
Q--norz. Olam VI K10 UE: iri iTU I I I L i P i I I


ONE complete Banga
Mary fishing boat, 40 Hp
engine. Call 220-9882.



HERE'S an opportunity to
earn money while you sleep.
For information, visit the
website http://
towerofcash.ueuo.com
CONTROL your income
working from home filling 100
envelopes for US$500 or more
weekly. For information, send
stamped self-addressed envelope
to Nathaniel Williams. PO Box
12154 Georgetown, Guyana.



VIJAY'S Hair Salon, 207
Almond St., Queenstown,
Georgetown. Tel 226-0205.
Specialise in hair cuts, cold
wave, straw curls, hair
colouring, facial, acrylic and
nail design, etc.
ANN BEAUTY SALON.
FOR day and evening classes
in cosmetology also 6 week.
classes in nail artistry and air
brush design. Enrol now 132
Cummings Street Bourda.
223-8452.
INDRA'S Beauty Salon,
122 Oronoque Street, for cold
wave. straightening. facial,
manicure, scalp treatment and
design on nails. Also Beauty
Culture available. Tel. 227-
1601
Indulge and pamper
ourself at Nayelli Hair
Fashion. On Tuesdays and
Wednesday we offer 20, 30
and 40%- off on Manicure,
Pedicure, Spa Package (body
lightening. cellulite wraps and
body scrub). Contact us at 211
New Market St.. N/
Cummingsburg. Tel. 226-2124
NAYELLI SCHOOL OF
COSMETOLOGY is now offering
special .3-month Cosmetology
package beginning April 16,
2007. Evening classes beginning
April 16. 2007. Courses in Air
brushing Acrylic nails, Barbering.
Basic&Advance Hair Cutting passes.
Tel. 226-2124 or visit at 211 New
Market StreetNorth Cummingsburg.



FOR PROFESSIONAL
COMPUTER Repairs, Sales &
Services Call Kersting's Computer
Repairs & Sales Centre @ 227-
8361. 618-8283. Home & Office
Services available. 24 hrs
www.kerstings.org.



DOLLY'S Auto Rental

NAas e Amnrica-!n
712P. 226-3693. Email
do>:ysactorental y5vahoo conm
SNGH'S Auto Rental For
.e best rates in Guyana fully
a .o-matic. air conditioned and
CD -.ayer, in all vehicles. Tel.
612-2561.



LEARN to sew & design
Contact 223-8510 or 646-
9563.
SEWING done at Kitty
Home Studio.-Any type of
costume, clothing. Al'''',
Contact Sunita '.
227-6335.__
JEAN offers courses in
Dressmaking, fabric o-'-tlo'ir.'e'
curtains. .cushions, 'a
soft furnishing, flo-aI
arrangement, cake decoration.
153 Barr St., Kitty. 226-9548
610-4105.
FOR alil types of
dressmaking uniform and
altering at affordable.price
in Kitty and around .G/town.
Lot 45 Garnette Street, C/ville (
2 houses away from Sheriff
St.) Call Sharon 649-2358.


CXC Maths. Eng., etc. Jan./
June 2008. Register now. Call
Mr. Lee 227-7850.
NAIL courses last offer -
$4 500 each. Register now.
acrylic nails, designing, etc.
Michelle 227-7342, 222-3263.
SIX (6)-week crash courses
in nails, hair dressing
cosmetolcjy classes available.
Contact Sharon on 619-8780,
225-5426
PRACTICAL Electronic
Classes beginning in March. Call
Abdul's Electronics 226-6551
or 225-0391. Limited space
available. Book early
REAL ESTATE. Develop
training in'Real Estate and
become a billionaire with
acquiring the gift of a servant
and ability to solve problems.
E m a i I :
customercarerealty@yahoo.com
THE LANGUAGE INSTITUTE
INC. now registering for courses
for Adult, CXC and 3- 13 yrs. in
Spanish, French. Portuguese
and English as a foreign
language. Call 231-7303.
SAMAROO S Institute new
enroling students for CSEC
Examinations in January 2008.
Maths, POA. Special classes
beginning April 4. Maraj
Bul ding. Tel. 223-1971, 665-
2716.
TECHNICAL Studies
Institute, 136 Shell Road, Kitty,
Phone 225-9587. Electrical
Installation and Wiring, Air-
conditioning and Refrigeration,
Electronic and Television
repairs, Portuguese, Spanish,
Mathematics, English.
IMPERIAL COLLEGE is
currently registering students for
its full time (Forms 1 5)
afternoon lessons and evening
classes. Subjects offered: Maths.
English A, Social Studies, POA,
POB. OA and Information
Technology. Monthly fee $1
500 per subject. Tel. #'s 227-
7627. 615-8916, 615-8919.
FREE COMPUTER
COURSES, MATHS & ENGLISH
4 hours per week. Registration
fee $1 000, target group youths
16 23 years that are
underprivileged. FRIENDSHIP
YOUTH DEVELOPMENT
CENTRE, 10 11 MC Doom
Public Road, East Bank
Demerara. Phone 233-0617,
233-0654.


LAWS OF THINKING 20
divine principles for prosperity by
Dr E. Bernard Jordan visit
www.bishopjordon,com then
click at amazon.com and your
consciousness will change. New
York #1.



ENROL now at Shalom
Driving School. Lot 2 Croal
Street. Stabroek. You could also
obtain an International Driver's
Permit. Call 227-3869, 227-
3835, 227-7560, 622-8162, 611--
9038.


PRUDENTIAL School of
Motoring 248 Forshaw and
Oronoque Sts. "You train to Pass".
227-1063 226-7874, 644-7211.
collyben@networksgy.com_
ENROL now at Soman &
Sons Driving School. First
Federation B-uilding, Manget
Place & Croal Street. Manual
& automatic. Phone # 225-
4858, 622-2872, 646-7806.
R.K's Creating Masters in
Driving since 1979. Students
need security and comfort to
learn. Students must know who
they deal with. Driving is serious
business, not a fly by night
business. R.K's Institute of
Motoring, 125, Regent Road,
Bourda.


Indera Singh Massage. If you
need a balance massage try my
therapeutic massage combined
with reflexology. Cell 615-6665.
ESCAPE To Rest Massage
Therapy calms your thought-s,
alleviate pain, stress and body
tension. Ulelli Verbeke Certified
Massage Therapist. Tel. 592-
615-8T47. Home Services
available. http://
www.geocities.com/esca petorest.
SERENITY MASSAGE. Let
me help easy your pain from
cardiovascular and respiratory
disorder, swelling in the feet and
joints, poor circulation due to
diabetes, neck shoulder, and
upper and lower back pain,
curvatures of the spine, hamstring
and calf muscle pain due to
congestion of sacral nerves, and
stress. Call 227-4282 anytime.
153 Regent Street.



SPIRITUAL help from
Suriname for sickness,
problems, evil, etc. Tel. 220-
0708, 612-6417.



FOR a friend indeed -
mature- in his thoughts, thinking.
Call 654-5939.
MAGAZINE of Worldwide
Pen Friend. Information?
Send stamped envelope -
CFI, P O Box 12154
Georgetown, Guyana
FORTY-FIVE years old East
Indian male never married seeks
female companion between 20
and 55 yrs. Full details including
date of birth required. Write to
R.L. PO Box 12164. Bourda,
Georgetown, G.uyana.
GET A FRIEND! Get educated!
Get Married! Migratel...through the
CFI Telephone Friendship Link. Call
592-261-5079, twenry-four hours
daily.
WOULD you like to meet
single males atd females for
friendship/ serio 1 7 .1' _i1 ., r,,-'I -
Call the Junior. -- 1...1 1 ..'l-
r -.. -.. vice 1 :

SI.NGLE professionals arnd
other cn'ployed females 50s to
(0s yrs av.v-', i I;, r I i
fri e nd sh ip . ... -I. ,.
FOs please call the Junior/
Senior ,,i. [, i Service 138
80 .' i zzj-8237/648-
6098. M F 8:30 am 5- pm,
Sat. 10 am 4 pm.



REPAIRS to hydraulic
accumulators. Contact
Friendship Oxygen Limited.
Phone # 266-2171.
HELLO the doctor is back!
Have your gas stove repaired and
serviced also your kero range
change to gas. 220-4073/664-
2332.
TECHNICIANS available for
appliance repairs washers,
dryers, microwaves, stoves, deep
fr yers, etc. Call 622-4521/218-
0050.
FOR all your building
construction needs repairs,
painting and plumbing. Contact
AB Construction Services. Tel.
645-4587, 645-3897.
FOR all your construction
repairs, renovations, as well as
masonry, varnishing, plumbing
and. painting. Contact Mohamed
on 233-0591, 667-6644.


FOR low cost air
conditioner, refrigerator,
microwave, freezer, drink cooler
repairs and servicing electrical
and solar panel installation, call
225-4822, 231-3547.

1 Canadian
g" Immigration

We can assist you '
to Migrate to Canada.
Skilled Workers Iusii,
( I,,.. Students Refugees.
Work Permits.-
Spotnsorships, \lij i
for Refused Cases.
iili s Visas
Contact
Balwant Persaud &
AsCsociates Qrmlffed
nn-ratilo n Consultants
5'? lpper Robb and
OrrneuqSit ., tBouirdas
TeL, 22-145401, 12-830
(C'anada: 416-431-8845
w w.canadaitiigri1Fionhpa.Io n
Ipprvrci hy rhe (Cnadimal (Gf.
I vrepreenil rlnnis,



1 MAID. Apply 172 East
Field Drive, Nandy Park, EBD.
VACANCIES EXISTS FOR
TABLE-HAND AT PEARL'S
BAKERY. TEL. _231-_5816.
EXPERIENCED Dressmaker
No cutting good wages. Call
225-0571.
ONE Kitchen Assistant/
Salesperson. Please call 645-
8870, 222-4163.
1 EXPERIENCED Cook and
a computer literate person. Call
231-5171.
VACANCY EXIST FOR
WASHBAY ATTENDANTS
(MALES & FEMALES). CALL:
625-4380
VACANCIES one
experienced Cook and Pastry
Maker, one Domestic person. Call
231-6355.
1 OFFICE Assistant. Must'
have sound secondary
education. Attractive salary. Call
218-4863.
WANTED Labourers and
Operators needed to work in
sawmill. Call 233-2397 between
9am rand 5 prn, Mor. Fri.
ONE Nail Technician
needed, must be able to work
without supervision. Contact Ms.
Scott or 225-0196 or 629-7405.
ONE experienced
C,;,-,, .:l.,-. ]i :. :,,- experienced
*-,- .4 .. -. able to work
Linsupervised. 227-8538, 622-
4386.
FOR Porters. Apply: Avinash
Complex Water Street Call 226-
3361, 227-7829..
OFFICE Assistant. CXC
English and Mathematics 1 to
3 D Lama Ave., Bel Air Park.
225-4492. 225-9404.
S, rlachine Operator &
-,,i- :i.- D Lama Ave. EBel
Air Park. 225-4492, 225-9404.
TRUCK DRIVER. Porter and
Salesgirl. Contact P. Ramroop
and Sons. 1 C Orange Walk,
Bourda. Tel. 227-1451
'RECEPTIONIST/Computer
Tutor. Apply in person to CTC,
57 Upper Robb St.. Bourda
(between Oronoque and Albert

ACCOUNTS CLERK to work
in Kwakwani, Logging Cam.
C)XC Accounts or 3 years Boo-
kepIng experience. Tel. 623-
9889 or 225-2471.
'EXPERIENCED Porter boy.
experienced Salesgirl. Apply
Sanjay Variety Store. 9 America
&'Lbngden Streets. Tel. # 226-
6137 or 225-6401.
ONE (1) female Pastry
Maker, 1 malleTable Hand Baker.
Contact Hurry's Pastry Palace,
Lot 2 Bel Air Village,
Georgetown. Tel. 225-1949 or
227-6270.


SALES Clerks must have
knowledge of Maths and
English, 2 yrs working
experience. Apply in person with
written application to Lens,
Sheriff & Fourth Streets, C/ville.
DRIVER. Must have truck,
van, tractor & lorry Licence, 3
yrs. experience. Apply to Lens -
Sheriff & Fourth Sts., C/ville with
written application and 2
references.
MACHINIST, Welder,
Mechanic Electrician and
trainees with qualifications -
Accounts Clerk, Computer
literate. Apply 18 23 Eccles
Industrial Site, Eccles, EBD.
........ ----------------- --- --- ... .....e ...-.s......... :
VACANCY exists -
experienced Graphic Designer,
experienced Computer Operator.
Corporate Advocates. 137 A
Duncan Street, Bel Air Park. Tel.
# 223-7415/226-4147.
.ACCOUNTS CLERK for
Kwakwani and Georgetown
Offices of a logging/sawmilling
business. CXC Accounts or CAT
Level 2, computer knowledge, 2
yrs experience. Tel. 652-9475.
DYNAMIC, self-motivating
individuals, over 21, with access
to a computer, working full/part-
time, can earn in excess of G$75
000 00 per month. Limited
openings. Apply to:
caribbiz@gmail.com
PART-Time Manager. To
manage computer and literacy
programme for school drop outs
at Mc Doom, EBD. Apply PO Box
10676 G/town, Guyana or call
266-2171, between 1 pm and 5
pm, Monday to Friday.
25 LABOURERS.
Requirements: Must have a
recent Police Clearance.
Interested persons are asked to
apply in person to: Guyana
Furniture Manufacturing
Limited, 60 Industrial Estate,
Beterverwagting, East Coast
Demerara.
URGENTLY needed Cooks,
Cleaners, Receptionist,
Handyman, Canteen staff. Apply
in person with the following
documents Application, 2
references, Police Clearance,
Food Handler's Certificate, 1
passport size photo to: K&VC
Hotel, 233 South Rd.. Lacytown.-
2 EXPERIENCED female
Accounts Clerks 25-35 yrs. Must
have CXC Maths & Accounts.
Porters needed. Apply with hand
written application, Police
Clearance to Alabama Trading,
G/town, Ferry Stelling. Tel. 623-
1615.
ACCOUNTS SUPERVISOR.
Qualifications: 5 (CXCs)
. Mathematics & English
Language inclusive. Advance
Accounts or equivalent.
Experience minimum 3 years in
similar position. Apply in person
to: Friendship Oxygen Limited,
30 Friendship, EBD, between the
hours of 1 arid 4 prm.
ACCOUNTS SUPERVISOR.'
Oua1lifcations' 5 (CXCs)
Mathemratics & English
Language exclusive Advance
Accounts or equivalent.
Experience minimum 3 years in
similar positionr/Apply in-person
to: Friendship 11 ,,' ,.*-i Uim'ted,
30 Friendship. F ..-. the
hours of 1 and 4 pm.
VACANCIES exist one
Accounts Clerk, Salesclerk. Must
have experience in '..-I -
and electrical. One ....
Guard. Apply with written
_,::1_.- 1 Hamson General
I-., Regent Road Bourda.
PLANT OPERATOR.
Qualifications: two subjects-
(CXC) Maths and English, Grades
3 & 4 will be accepted.
Experience will'be an asset, but
not necessr. -ii /e salary
and other _-'. i: i eferably
.person living on EBD Apply in
person to: Friendship Oxygen
Limited, 30 Friendship, EBD.
between the hours of 1 and 4
p..rn
SENIOR AC OUTNS
CLERK. Experience two (2)
years in. a similar position.
Requirements: (a) fou (4) CXC
including Englis 1 &
Mathematics, (b) c rmputer
literate, (c) advance Accounts or
equivalent. Apply in person to:
Friendship Oxygen Li iited. 30
Friendship, EBD, br een the
hours of 2 and 4 pi


ONE Attendant and Bar
Attendant, one Supervisor, one
able-bodied Security, one Disc
Jockey do work and to be
trained in a wide range of
music. Indian Culture will be
an asset. Tel. 226-6527, 623-
7242 Tennessee Night Club.
Leonard.
One (1) Female Office
Assistant Must have knowledge
of Payroll, NIS, Filing and must
be computer literate. Must be
between the ages of 25 and 30
years old. Must have knowledge
of Maths & English and at least
two J2) years working experience.
Appy in person with a written
application and two (2) references
to: Len's, 136 Sheriff & Fourth
Sts., C/ville. Tel: 227-2486.





*Cr;iphic Artists

SSpeed T} pi-1':,
*One Pi'in-liy Staff


Q 1 iFi,'.ti,,.' a ,' 1 ,.
Training provided.
Interest and experience
an asset.


Apply to the Manager,
Executive Office Sorvices.
82 Albert Street & .. .,i
Road. Bourda. G lown.
Not laler than April 5, 200

APPLICATIONS are
invited from suitably qualified
persons for the vacant positions
of: Security Guards must be
able-bodies, Billing & Delivery
Clerks (between the ages of 27
and 35 years). .SaFes staff
(preferably male).
Requirements: Applicants must
have a sound secondary
background and previous
experience will be an asset.
Apply in person with
application, 2
recommendations (one of
which must be from the last
place of employment) and a
valid Police Clearance to: The
Managing Director. United
Investment Trading Co. Ltd.
200 Camp Street,
Georgetown.



ONE house lot for sale
situated at 779, Parika, East
Bank Essequibo. Tel. 260-
4108.
CULTIVATION lot
Soesdyke. East Bank
Demerara. Call J. Park 444-
6494. -
LAND WITH 2 HOUSES AT
41 AGRICULTURE RD.
TRIUMPH SIDELINE DAM.
CALL 263-5338
MAIN & Middle Sts.
opposite Palm Court 80ft. b)
i14 ft. Price $100M. Cali
648-9566
TRANSPORTED- 65 x
45, in Golden Grove. EBD -
$1.5M neg 226-3160 (Moe).
CARMICHAEL St. 75' x
250'. Charlotte St. 13 600
sq ft. Tel. 231-4310, 618-
7895.
LAND FOR SALE. LAND
FOR SALE OLEANDER
Gardens 89 ft by 152 ft. Price
$25M. Call: 612-0349.
TRANSPORTED 135' x
42' in Rose Hall Village -
$1.2M neg. 226-3160 (Moe),
336-6565 (Jtnet).
For sale by owner one
plot of land at Parika at the
rear of Mr. Boodhoo's General
Store with perfect roadway -
$5.5 million. Call 455-2512.
WHARF LANDS 17
ACRES riverside land, EBD. 6
ACRES riverside land, EBD.
Land in Supply, riverside, EBD.
TEL. 226-8148, 625-1624.


SERVICES DRESSMAKING HEAL E


--. .-- .- ....... ...... ... .............. ...................... .. ..................... . . . . .............


r ~'. '. i r (i~r i-ii L:.) e,~-.*l-.~ L. .L-., ~J;1zr r. L~~;ic ; ~ i ~;. ~..~,..;


m


nDrl2CRfiAWlKlil


RAACQAI--C


UMAI TU







SUNDPYCHRqNtICL April 1, 2007 27


LE RESSOUVENIR,
several lands and properties
with pool and without pool.
REPUBLIC PARK beautiful
property with pool on 3 lots of
and. TEL. 226-8148, 625-
1624.
SHERIFF Street $35M,
Duncan $15M, Atlantic
Gardens $5.5M, Queenstown
$35M, Bel Air Sprins 50M,
double. KEYHOMES 684-
1852, 628-0715, 231-8469.
SAILA PARK Vreed-en-
Hoop, Housing Scheme. House
lot or sale, near the public
road. Prime location, 2 miles
from V/Hoop Stelling.
Reasonable Price. Tel. # 225-
7670 or 254-0397.
HISTORY in Guyana.
River side land at $7M dollar.
Only 3 remaining at Good
Hope. Live on the edge of the
water. Phone God's Favourite
Realty. Mr. Indal 225-5198,
225-2626, 225-3068.
LAND OF CANAAN, east of
Public Road, half mile in, 60
acres developed, transported,
formerly used for sugarcane
cultivation. To be sold en bloc
or parcels of ten acres. NOW
3.2M per acre. No flooding.
218-2319.
SOESDYKE EASTERN
SIDE OF ROAD LAND OF
CANNAN 10 ACRES 20, 40
80 88 ACRES POKY DAM
HOUSE LOT 3M
PROVIDENCE RIVER PATH 15
ACRES AND MUCH MORE.
CALL RUQHAS 592-226-2803,
627-8891.
PARIKA 123 acres,
Parika 8 acres, West Bank -
40 acres, Land of Canaan -
137 acre, New Hope, EBD -
75 acres, East Bank 6 acres,
Diamond Public Road,
Meadow Bank 2 lots, Robb
St. (corner), West Coast 9
acres, West Coast 6 house
lots and many more 227-
0464, 646-3251.
DOUBLE LOT, SOUTH
RUIMVELDT PARK $6.9M or
$3.4M, each, VERSAILLES
125' x 67' in gated compound
$5.9M, 6 lots $3M each and 5
lots, property & rice mill Crane/
La Union $45M, 15 acres
Canal No. 1 $11.75M,
HIGHWAY LANDS farming
resort, sand pit, residence, LBI
$2.4M, Atlantic Gardens
6.9M, Campbellville
10.75M, Lamaha Gardens
14.75M, Cummings St $12M,
T1el: 226-8148, 625-1624.
EAST BANK DEMERARA
Friendship to Timehri house
lots, land for agricultural and
other development. PARIKA -
residential and commercial
lots. BAGOTVILLE
unfurnished house on % acre
land $3.8M negotiable.
ORANGESTEIN East Bank
Essequibo 2 house lots each
75-ft. x 150-ft. GOOD HOPE -
East Bank Essequibo one acre
of land with Orchard and
buildings $14M neg. Barnes
Mc Caskey Realty. Tel. 266-
5177, 613-2286.
JEWANRAM'S REALTY
"HAVE FAITH IN CHRIST
TODAY" LAND FOR SALE -
Georgetown: Blygezight,
D'Ancrade Street. North Rd.,
Dowding Street, David Street,
Lamaha Gardens,
Queenstown. EAST BANK
DEMERARA New
Providence, Diamond, Land of
Canaan (80 acres). Meadow
Bank, Republic Park. EAST
COAST DEMERARA -
Mahaicony, Mahaica, Enmore/
Foulis, Imax Garden,
Annandale, Courbane Park,.
Lusignan, Good Hope, Kissoon
Park, Earl's Court, Chateau
Margot, Success, Happy Acres,
Atlantic Gardens, Shamrock
Gardens, LBI. WEST COAST
DEMERARA Vreed-en-Hoop.
Versailles, La Grange.
OTHERS Port Mourant.
Demerara River Sand Hills.
JEWANRAM. CALL: 270-4470,
227-1988, 623-6431.
EAST Bank, Soesdyke
Highway Junction, gateway to
Brazil. 5 minutes to airport.
Main Public Road to New
Airport Highway,
approximately 60 acres for
residential, commercial, and
industrial uses Divided into 3
Sub divisions, approved plans
for present and immediate
development Phase #11
includes 1 4161 acre for hotel
construction. Approximately 2
acres for -,:.,-, coo or
apartment r. r."r, I, pa'rkjng
lot, swimming pool. ternims
court, grocery store garden!
park, etc. A!so allocated and
available for sale another
approximately 20 house !nts for
a security gated community.
Phase #2 approximately 25
acres presently vacant Phase
#3 is a presently working Sand
Pit. Asking only US$500 000.
Owner- 226-1742 or623-1317


LAND FOR SALE CANAL
#2 50 ACRES, 7 lots together.
CANAL #2 10 ACRES, 3 lots
together $15M, CANAL #1 15
ACRES $12M. HIGHV(WAY
LAND KURU KURU 60 ACRES -
7.75M, 1 LOT GROVE EBD -
$1.5M. TEL. 226-8148/625-
1624.


SEMICOL.A FT cnwIsH!




Parika/Leguan Neg.
Low-wood Oemerara River
a2 acres 6 million
Warehousetwarehouse6
space available
Lombard Street Neg.
Friendship Sawmill Neg.







SEMI-FURNISHED
apartments for overseas visitors.
Tel. 615-9514, 669-3787.
7 OGLE Front, ECD 3-room
top flat. 665-3387, 619-2095,
222-3364 Omar.
SHORT term rental
furnished room, suitable for
overseas visitors, Alberttown
area. Call 227-7322.
KITTY, Campbellville -
furnished and unfurnished 1,
3-bedroom apts. 233-6160.
KITTY one fully secure, 2-
bedroom a t. with telephone
from April 1. Tel. 227-6824.
FOR overseas
visitors apt. to rent in
Kitty. Call 226-1640.
FURNISHED house -
79 Atlantic Gdns. Call
220-6060, 626-2066.
FURNISHED flat to let for
overseas visitors. Call 226-
0242.
4 LAMAHA St.. Queenstown
1 3-bedroom apt. to rent $45
000 monthly. 'all 225-3370.
ONE two-bedroom bottom
flat with toilet and bath inside
and one (1) bedroom upstairs.
Contact M8 First St.. Chateau
Margot, ECD. Tel 220-4454.
WORLD CUP RENTALS 1
2 3 bedroom apts./flats fully
furnished (phone & parking) -
$30 000, $50 000. $60 000, $65
000, $75 000. Also rentals by the
day. Call 231-6236.
ONE small breezy apt.
suited for a single working person
or a student in Kitty. Call D.
Persaud 227-1256.
UNFURNISHED three-
bedroom top flat with one self-
contained bedroom and all
conveniences. Tel. 642-0636
BEL Air Park. fully furnished
and secured executive concrete
building with all modern
facilities. 642-0636.
REGENT St. business
place, large and secure ground
floor fo any type of businesses
642-0636.
EXECUTIVE Bel Air
Gardens US$2 000, New
Haven US$2 000. Call 225-
5198. 225-2626.
SEMI-FURNISHED two-
bedroom lower concrete 4lat.
East Street. Tel. 226-4245.
TO rent 1 2-bedrnom
bottorn floor, flt located 26 -
3 SI Liliendaal Tel. 222-34^6.
i 3-BEDROOM cottage -
89 Sparendaam H.,,.
Scheme. E C Dem ,:..i.
0217 or 231-8463.
3-BEDROOM top flat with
all amenities No children
please. FrOm the 1' April. Phone
227-7593.
ONE 4-bedroom apartment
top flat to rent, 390 republic
Park. 1 bottomrn fat for business.
644-2555.
ONE two-bedruom
apartment. Address 1687
National Avenue. Sruth
Ruirnveldt Park. Tel 218-2042,


FURNISHED flats for
overseas visitors. Phone 227-
2995.Ktty.
2.95. ... ........ ........................
2 1-BEDROOM apts,
situated 25 Hill St.,
Albouystown. Contact Nazim or
Sharmilla at the same address.
1 3-BEDROOM upper flat in
Queenstown $50 000. 227-
0571, 667-2390
SHORT TERM RENTALS
FOR OVERSEAS VISITORS.
PHONE 225-9944.
RESTAURANT $130 000
NEG. KEYHOMES 684-1852,
628-0715, 231-8469.
QUEENSTOWN US$25.
KEYHOMES 684-1852, 628-
0715,231-8469.
HAPPY ACRES US$1
.500. KEYHOMES 684-1852,
628-0715, 231-8469
BEL AIR GARDENS US$1
500. KEYHOMES 684-1852,
628-0715, 231-8469.
BEL AIR PARK US$800/
US$1 500. KEYHOMES 684-
1852, 628-0715, 231.-8469.
REPUBLIC Park 4-
bedroom upper flat on
storage bond. One business
place. 233-6160.
NEWTOWN, Kitty -
furnished apartment suited for
visitors. Tel. 621-3438, 609-
4899.
FURNISHED self-contained
apartment cable TV, internet
access, parking, short term
rental. Call 233-2770, 615-
5592.___
4-BEDROOM APARTMENT
TO FLAT DAVID ST., KITTY.
TELEPHONE PARKING $8
000. TELEPHONE 226-8148,
625-1624. _
FURNISHED/unfurnished,
houses, flats apts. for
residential/commercial
industrial purposes countrywide.
Tel, 227-4876 8 am 7pm,
609-8652 Ryan.
PRASHAD Nagar 5-
bedroom house, 3 bedrooms -
upstairs, 2 bedrooms -
downstairs. All AC. Could be
used for living and'office or
living. 227-0464, 646-3251.
FOR business available
soon in Jackson Street, Tucville
1 downstairs apartment,
suitable for cell store, pharmacy,
doctors' office, etc. Price
negotiable. Call 651-7571,
ONE three-bedroom
apartment furnished with
telephone working, hot and cold
water in Wortmanville area.
Tel. 227-7830 or 629-5946.
FURNISHED apts. For
overseas guest, long term,
Garnett St., C/ville. Contact Ms
Dee 223-1061. 622-2277.
FURNISHED/spacious
offices in central Georgetown,
near Law Courts and
commercial centre. Tel. 225-
5910, 226-4420.
BOTTOM flat, at 36 First.
Street, Alexander Village. G!T.
back building suitable for one
or two big persons. Contact
Dulari
NEW modern, spacious, 1
master bedroom apartment.
Fully furnished, secure,
mosquito proof. Subryanville -
226-3160 (Moe).
ONE 1-bedroom apartment
centrally located in Georgetown
$25 000 per month. Tel. 231-
9302, 622-.0792
FURNISHED 2-bedroom
and 1-bedroom flats situated in
Kitty, over looking the sea wall.
Suitable for overseas guest.
227-1871. 646-2939.
ONE fully furnished 3-
bedroom apt., 1 master fully
secure, telephone, etc. 31
Seaforth St. C/ville US$1 000
neg. Short or long term. Contact
Paul 231-3883
APARTMENTS (1.2.3.4-
bedroomed) $21 000,. S22 000,
$25 000, $35 000. $4.5 000, $50
000, Furnished $26 000 $80
000, Rooms- $12 000- $16 000.
Call 231-6236.
ONE four-bedroom fully
furnished house, self-contained
master bedroom, two additional
bathrooms, hot and cold water,
Jacuzzi, secure parking area,
seven mm drive from"cric,.et
stadium. Ideal for short term
overseas guest, groups,
families, couples. Contact 222-
2Z750. 681-5180, 663-8511.
BRAND new 2-bedroom
house by itself at 56 Land-of.
Canaan, EBD, close to air port
and 25 mins drive to
Georgetown. Fully, 'furn shl(-
with all amenities, telephi.w
parking, fully mosquito rrn o i
water tank. To rent to over. eno,
guest US$55 per niqht
reduced rates for longer ;fiav
Call 218-3827 horn) .
2712 (cell).


FURNISHED rooms for
single working male $4 500
week!.Te.6.._ 13-264.:
1-BEDROOM bottom flat.
80 Railway Line, Kitty. Call 227-
7410.
1 SPACIOUS 2-bedroom
room apartment rent $30 000
mth!y.Tel 663-6338.-
LARGE. business space to
rent. Ideal for school, computer
class W/sale or retail, office, etc.
Good security with tel., elec.,
generator. Call 225-0571.
RESIDENTIAL and
commercial properties. Prices
ranging from $50 000 to US$3
000. Furnished and unfurnished.
Tel. 226-1192, 623-7742.
EXECUTIVE house grilled
and meshed, bhot and cold water,
telephone AC, Blygezigth
Gardens. Rent negotiable. Tel.
226-9573.
1 FULLY furnished executive
house with garage, 1 top flat, 1
small bond 1 fully furnished
flat. 226-730, 613-4082.
BOTTOM flat 3-bedroom
$80 000 neg. C/ville, hot
and cold, self contained, etc.
Tel. 628-6855
ROOMS and apartments
to let on a daily/nightly basis
from $4 000 daily. Call 227-
3336/227-0902.
1 unfurnished apt.in Kitty.
Fully grilled, tiled, AC, water 24
hours, etc. Price ($45 000) neg.
Call 609-8315.
S UB RYA N V I LLE 2
BEDROOMS $60 000.
KEYHOMES 684-1852, 628-
0715, 231-8469.
SELF-CONTAINED rooms
for single working female. Also
2-bedroom houses. Call 665-
-4545. 4 pm 6pm.
FURNISHED American
styled apts. Suitable for a
couple or single person $4
000/$5 000 per day. Call
231-6429, 622-5776
3-BEDROOM apartment,
fully furnished in Craig St.,
Campbellville for overseas
guest. Short term. Call Tel. 223-
]329.
UNFURNISHED 2-
bedroom top flat Bent St.,
Wortmanville with overhead
tank $40 000. Call 648-7504.
218-0287, Z_.21.8.-0392.
3-BEDROOM HOUSE by
itself $75 000, 1 top flat, fully
furn. $75 000. Unique Realty.
Tel. 227-3551, 647-0856.
ONE fully furnished 2-
bedroom top flat to rent, short
term or long term. Alexander
Village. Cal 226-9046 or 668-
2747
APARTMENTS furnished
and unfurnished, suitable for
fore ners and local residents
226-1342, 615-3340
ONE two-bedroom bottom
flat to rent in Kitty, from the 1'
April. Please contact 231-4902
oi 613-8909.
TWO-BEDROOM BOTTOM
FLAT CENTRAL GEORGETOWN.
MENTORE/SINGH REALTY -
225-1017, 623-6136.
CWC rental two (2) flats
Regent Rbad. Bourda, Central
G/T. Inter-connectable, kitchen
facility. Can sleep seven (7)
persons and more on mattresses
Call Celina on 623-0439.
OFFICE or business space
to rent 1 spacious bottomrn flat
located at 77 Hadfield St.. Werk-
en-Rust, G/town. Contact
Lyndon Amsterdam or Rpysdale
Forde on Tel. 227-1656 or 227-
0676 during Office hours.
JEWANRAM'S REALTY.
"Have Faith in Christ, today.
227-1988, 623-6431, 270-4470.
E m a i l
ewanarealty@vyahoo.com
GEORGETOWN Lamaha and
New Garden Streets USS3 000,
High Street (office/residence) -
US$2 500. Kitty $60 000. $45
000. US$500 (F/Ft Caricim'
GuySuCo Gardens i_:. m '.,.,
EAST BANK: Scho.'. .* ,,
Eccles 'AA' (F/F) 1 1 ,.,
Diamond Li I '.'
Herstellling $60 000,
Baqotstown $60 0000. EAST
COAST: Courida Park .- US$3
000 (F/F, Atlantic Gardens -
US$2 00 /US31 000/US$500,
Happy Acres US.. ^,.- ni' 1 [ ",
200/US$500. B/V *-, ". .,'Le
; .-..'..... US$2 500. OQle -
.' 7'I.1..- '- :, 1.000. OFFICES:
Central Georgetown ... US$4
000, Georgetown $100 000/
$60 000, Regent St. h-inr0-/
Oueenstown US$2 ,,,,, -, r..i
US$1 500 North Road US$1
200. Brickdam. iUS$800. bond.
restaurants etc. V-rsailles .
executive .. US 3 000, 3-
Storloy d re .d -. tial i'ffice/bl ond
$ U :., ". Nandy Park -
US$650 .y .45 000,
-~ Kitty $75
SKersaint
Office ) $ ; 1, ,rt t v n
Office- f, 2, : .;X)q


FURNISHED rooms single
person only at Bachelor's
Adventure, ECD. Tel. 229-6149
- Gloria.
ATLANTIC Gdns., Railway
Embankment 2-bedroom, toilet
and bath,_bottom flat, parking
.FURNISHED ROOM -
DECENT SINGLE WORKING
FEMALE. TEL. 226-5035 (08:00
- 17:00 HRS.)
4-BEDROOM, 2-storey
house, 1 master, fully grilled,
overhead tanks, garage, large
yard space in Roxanne Gardens
@$80 000. Call 218-4734 or

ATLANTIC Gds.. Railway
Embankment. 2-bedroom, toilet
& bath, bottom flat. parking lot,
large yard space. Price neg. Tel:
220-779,.610-4560.


NICO.. LA-ATII MAN SINGI




ltEL AIR PARK US$i500 US$2000
CHATEAU MARGOT US$100 -USS1200
ATLARTIC GARDENS GS100,000 US $800
NEW HAVEN US$2000
HAPPY ACRES US $ 6 5 0
MIDDLE STREET CUMMINGSBURG
(OFFICEIRESiDEket) US$1500



BEL AIR PARK (TOP FLAT) US$700
COURIDA PARK (E.C.D) USS600-UJ$7100
HERSTELLING (LEB,D) US$600
PARSHAD NAGAR US$900-US$1000
Apartment building ideal for
World Cup Cricket US$150.00
per day with all amenttes.
Limited space available,
accessible. to public
transportation, also close to
Sheriff Street and
Buddy's Pool HalL.




LOT 194 Barr Street Kitty -
two-bedroorn apartment, bottom
flat -,$35 000 monthly. No pets.
no parking. Tel. 226-7810.
3-BEDROOM ,,p flt-' with
... in Bei Air ,i ..: $55
S ier mIonth -' '1, no
.: Contact Peteem- 227.
644-1004.
SUBRYANVILLE 2.
bedroom fully furnished. ipper
flat apartmernt. Secured. AC
telephone, parking, hot andi
cold. Call 613-6006. 226-1457
FULLY fenced and secure
concrete bond .- (84' x 32').
suitable for procesinsm plant.
factory storage, etc. at Public
Road, Mc Doom. Phone 226-
1903.
LUXURIOUS apartment for
overseas visitors, close to Sheriff
St. Fully furnished with AC. hot
& cold bath, etc. Transportation
available. Call 226-8990. 615-
1203.
EXECUTIVE houses 1)
themselves area Ogle, ,i: i,.i,
Gardens. Price $100 -00 t., ".,,
000 neg. Enquiries als. C ii 220-
7021. Cell 624-6527.
LG 4-bedroom furnished
house, 1 master, 2 living rooms.
3 washrooms, parking.: l i '.'ird
space ()US$1 .000. ,-i...
furnishedJand unfurnished. Call
226-2372..
FURNISHED and unfurnished
apartments one, two, three & four
bedrooms. Queenstown -
residential, from US$25 per day, long
term also available. Tel. 624-4225.
QUEENSTOWN, fully furnished
1 & 3-bedroom apartment with park-
ing space to rent Suitable for over-
seas visitors on short term basis.
Tel. # 226-5137/227-1843.
IMMEDIATELY available to
prOfessional working couple,
three bedroom top flat. Pully
grilled AC, overhead tank. No
pets. Public Road. Mc Doom,
-I Phone 226-1903.
HOUSE to rent .3
' .. h.. -,.;d at 1 89

Sectioni / i .,_ Dianmond.
EL D. Cal . 233-2175.
';'". i 5G1 2


1 FURNISHED 1-bedroom
to rent for female student,
worker. Contact 226-2365.
HOUSE to rent, top flat at.
Lot 9 Good Hope, ECD 2
bedrooms, toilet and bath
kitchen. Apartment to rent 7
Railway Embankment, Better
Hope top flat, toilet, bath,
kitchen. Contact Ram 624-
1909.
4-BEDROOM, 2-storey
house, 2 '/ baths, parking,
residential, etc. @ US$800;
furnished 3-bedroom
residential home @ US$1
800; furnished 2-bedroom top/
bottom apts. @ US$600,
residential. Others. Call 226-
2372.
TOP FLAT semi-furnished,
3 b/rooms $60 000 neg. House
by itself- $95 000, B.A. P. -
M.S$1 200 Section 'K' US$700
-US$6000 At. $35 000, $45
000 $55 000, $65 000 rooms,
bond, office business. Tel.
225-2709, 623-2591.
EXECUTIVE HOUSES/
OFFICES/APT. BEL AIR
GARDENS $1 500 to US$3
500; BEL AIR SPRINGS -
US$1 500; Queenstown,
Kingston. High Street
Subryanville US$3 000;
Eccles, Diamond, Bel Air Park
3-bedroom apt. US$800;
Prashad Nagar 5-bedroom
house USS1 200. TEL. 226-

EXECUTIVE house Bel
Air Park, 184 Eping Ave. &
Kaieteur Rd. Immaculate,
modern, convenient, secure
spacious, fully grilled A, air-
conditioned. 1 maste aned 2
bedrooms, 3 '/. baths, double
garage, etc. agents, embassies
and international
organizations are all welcome.
Call 277-3814 225-4413, 646-
9319, 619-9972, 614-0949 or
sharonxs@nyc.rr. com
CRICKET FANS two
double-bedroom apartments.
AC, hot and cold, fully
furnished, mosquito meshecf
security, grilled, telephone
parking space. breakfast
provided, residential area G/
town. US$120 per day. 226-
5369. 616-9110, 680-1482.
2-STOREY concrete bldg.,
in residential area, top 4-
bedroom (in master), hot/cold
telephone, fully furnished,
dining, kitchen; bottom 2-
bedroom apartment,
telephone, parking no repairs
US$1 560 monthly. Tel. 231-
4310, 618-7875.



ONE two-bedroom two-
storey house with small farm
in Timehri. Phone -- 642-9947.
3990 BARAMITA STREET.
South Ruimveldl Gardens.
Contact OWEN KING WITHIN.
SHELL Road Kitty,
Station St.. Kitty. Land only.
New Road. Vreed-en-Hoop.
WCD. 684-5885.
-GORDON STREET, KITTY
$12M OR FRONT $8M -
BACK $4M. TEL. 226-8148,
625-1624.
Lot 202 Section 'C
Enterprise, East Coast
Demerara, 2-storey concrete 5-
bedroom house. 611-8912.
227-3788.
BRAND new American
style house in highly
residential area $15M. Tel
227-4876. 8 am 7 pm;609.
8652 Ryan
ONE 2-storey 4-bedroomn
house with garage for sale.
Could accommodate two
families. Middle Rd., La
Penitence. Tel. 227-6262
ONE going business
orw ni'.E nne secured beautifully
,1..I. [ih,, one three-bedroorr,
houst fully -',ii- in New
Amsterdamri. -T .- -2500
2. FLAT concrete houses.
land 50 rods. Property at
Nismes Public Rd WBD. Price
negotiable. Cali 2'63-5490 0
am 6 prn.
ALBERT'OWN front land
- $7M neg.. Parais' double
klt two.sto e', c.tncrete S6.510,4
nag Telehobrn '- ?25 -3006.
6(18-3635
ATLANTIC Gardens two-
storeyed concrete and wooderf
i,! o repairs. vacant
. Price negotiable.

LAL'S Realty 231.-7325.
612-9574. Kingston .:41
Sneg North Road S40M neg.,
Prashad Nagar $30M, Bel Air
- $25M & $17M. Brickdam -
$120M neg., Kitty 111 .:
.$6M. Waterloo St ." .rj
neg.. New Roao. WCD $35M
neg., '.'-in-in $10M nea.
Good -,I.,I .-.i.. RuLmze!ght
Gardens $12M. Annandali -
$5.5M.


. -... ----- I -- -- -------~I"----------"~ ~"~I- --







--.- SUNDAY-CHRONICLE-Apri,-,o007


ONE two-bedroom house
with kitchen and toilet and
bath at Lot 48 Hibiscus Place.
Blankenburg. WCD. Call
Mahendra 227-0415.










TRANSPORTED concrete
front building with two self-
contained three-bedroom
apartments, no repairs. K. S.
RAGHUBIR Aency 225-
0545, E642-063 -.
NEW house fully
furnished, 2.5 bath, central AC.
25 miles from Disney World,
Florida. Price US$294 000
or neg. Phone No. 954-294-
7373.
4-BEDROOM concrete &
wooden house. Ketley St..
Charlestown. formerly Rudy's
Li uor Restaurant (corner lot)
- 18M neg. Contact 227-
6204.
FOR business or school,
tidy large property. central G!
town. for rent or sale. Also
house and apartments.
Excellent Realty. 227-8010.
,625-7090.
GUYANAESE overseas
owners of'buildings. trying to
manage your property/losing.
millions. Ederson Realty has
professional management
services 226-5496..
BRICKDAM-- vacant 2-
storey 4-bedroom colonial
mansion. Ideal international
hotel, insurance $4M/
JS$225 000. Ederpon's -226-
5496
G/TOWN central. Ideal
area for 5 3-storey buildings.
make 20 mini mails, monthly
rent pays mortgages $70M/
US$350 000. Ederson's -
226-5496.
ENTERPRISE Gardens -
business investment new 2-
storey concrete building.
Bottom general store -
$8.5M/US$42OO Ederson's
- 226-5496.
NORTH Ruimveldt
vacant 2-flat concrete
buildings. 4 luxurious
bedrooms, area for tennis.
swimming S12.4M!US$62
000. Ederson's 226-5496.
STRATHSPEY vacant
new. 3-bedroom wooden
building. If qualified move in
today $3.5M/US$18 000.
Ederson's 226-5496.
ATLANTIC Gardens -
vacant 2-sto.ey 5-bedroom
mansion S15M/US$75 000.
Ederson's 226-5496.
ROBB. Bourda Market 2-
storey building. Road to alley.
.50M!IUS$250 000. Owner
needs medical. Ederson's -
226-5496.
NORTH Rd. vacant 2-
storey concrete building. Ideal
insurance, internet. $25M/
US$125 000. Ederson's
226-5496.
NON Panel. ECD 2-
storey concrete modern design
mansion, front lawn. Ideal or
-- swimming $14M/
.J :- 000. Ederson's 226-
5496.
HAVE ,v u I -1] for
saie? AA E. : .. R;
oark We have buyers US
o silars. Ederson's 226-

SOESDYKE Pubhlc Rd. -
,ra-ant 2-storev ?-bedroonr
mansion Area for tennis
..T,-,,-,; pool $13M/
: derson's 226-

CAMP Robb 3 2-storey-
buildings. Ideal 4-storey
i.-mrrrir:',-' sublet 20 mini
T -31 .'.,' y mortgages -
.: ". Ui 000.
Ederson's 226-5496.
KINGSTON. near foreianr
embassies colonial mansion
Ideal international hotei -
$85M/US$425 000.
Ederson's 226-5496.
NEW Hone. EBD road.
ier. wvharf.''a. ships. ware
-:.: active eneral store -
S- US'60 0J. person's
,6-549.
B ECCLES- vacant nec
.-storev co:'cre.l- I ux riou;

Ederson's 226-5496.
CROALtStabioek- -new ?-
storey concr.'te 6 luxurious
beoroorm mansion. i i--'
,',,-", I hotel -
z '. Ederson's -
226-5496.
OVERSEAS Guvanese
lrotors who want new hospital.
co-ripuerised lab. X-ray- or
B 5 In- Uni inves! w.iseiv -
345M' "e &.:SS225 000..1
Ed"r.'oms 22 ;Zc T.6


ECCLES $14M, FRONT.
KEYHOMES 684-1852, 628-
0715, 231-8469.
MEADOW Bank two-storey,
concrete building (transport
available). 641-4295, 622-7859.
TRANSPORTED concrete
front building with two self-
contained three-bedroom
apartment, no repair, vacant
possession. 642-0636.
VLISSENGEN Road one
wooden and concrete building
suitable for fast food outlet -
$80M. 227-0464, 646-3251.
ONE complex with five (5)
buildings, land measures A23
ft. x 666 ft, approx. 3.110 acres
- US$906 000 negotiable.
Serious enquiries 227-0464,
646-3251.
ONE executive concrete
Property in South Ruimveldt
ar, reduced from $16.9M to
13M. Phone Ms Persaud 22-
5198, 225-3uj68, 225-2626.
FRIENDSHIP EBD. PUBLIC
RD. NEW CONCRETE 2-
STOREY 4-BEDROOM
LUXURIOUS MANSION. Ideal
for large family $12M/US$60
000. Ederson s 226-5496.
FOR overseas visitors.
Walking distance from Stadium,
Herstefling Public Road. Upper
flat 4 rooms, lower flat 3
rooms. Contact Edward. Tel.
612-8879, 265-3651, 683-9255,
233-2868. -
SALE. We have properties
for all purposes starting from $8
million upwards. Take action
according to your faith only.
Phone Mrs Persaud God
Favorite Realty 225-5198,
225-3068, 225-2709, 225-2626.
ONE two-bedroom concrete
house and land for sale, situate
at Lot 834 Yarrawkabra, East
Bank Demerara. Size of house -
37 ft. x 24 ft., size of land 200
x 130.7 201.68 x 156.56. Call
Mark 626-2002.
HAPPY ACRES modern
architectural building, two-
storeyed concreted, four-car
garage. All modern
conveniences, security hut and
toilet, hot and cold. viewing I
gallery, house 28 x 75'. land
51' x 100'.
HOUSE & land Chateau
Margot, ECD; Shell Rd ; Kitty.
Station St., Kitty Surbyanville:
Annandale. ECD: Pin. Hope.
EBD; LAND only Vreed-en-
Hoop WCD: Bella Dam. WBD -
50 x 100; Grove: EBD 40 x 80.
Tel. 684-5885.
PROPERTY in Bartica,
Region Seven for sale by owner.
Transported land one hundred
and eighty feet in length and
sixty feet in width, with three
residential buildings in perfect
condition with all conveniences
and a variety of bearing fruit
trees. Call 455-2512.
BLYGEZIGHT Gardens,
Georgetown two storey house
28' x 55' plus 15' verandah.
land 50' x 120' with fruit trees.
4 bedrooms including master. 2
verandas, front porch, 3
complete bathrooms, enclosed
garage for .2 cars fully grilled.
alarmed, pressurized overhead
with hot water, mosquito meshed,
AC. quiet neighbourhood in a
cul-de-sac. Call 231-5807.
CUMMINGS Lodge T1- ,
Cummings Street 1
Thomas Street US$600 000'
Middle Street $65 M, Camp
Street US$1.8Mr, Wellington
Street $100M, High Street -
$40M, Prashad Narar $22M.
Church Sreet US$650 000.
I. I:,,-,, 1. r Nandy Park -
: - ..' Bank $7M.
Doenrnif Road $85M and many
.. .. 227-0464. 646-3251
KITTY $4.5M -Tl
$7 5M. $i8.5M, 1iI l i: 1
ALBERTTOWN -Iri SOUTH
RD.- $7M, $12M SOUTH -New
house S8M & $, '. 1 St. -
'" LAND - j:- $- 7M.
-,. : ,, , $ '1 : 1 .i. -
Bank [double lot] i 1 .
Street- $5M. I'.l i : r
D:3mond $550 i.,"' lr,, ,.-
Pui,, r- J $7M. Call 231-
6236.
PROPERTIES for sale -
Good Hope 2-storey concrete
bldg., top 4 bedrooms kitchen.
dining, bottom 2 bedrooms
apartment, telephone, oarkinq.
No repairs S26M neg. Pent Sl
2-storey bldg. $6.5v neg. 2-
storey concrete bidg. in
residential area to 4
bedroorns, kitchen, dining.
bottom 2.-bedroom apartment.
no repairs S28Mr neg.
Queenstown 2-storey concrete
PI,1 vooden bldn., no repairs -
.,' n"a 2-stor'- ... i-,"
area, no repairs -, '
231-4310. 618-7 :.
PROPERTY in Parika f"-
sale by owner at the rear of : I
Building. One two-flat ',rin -',e I
building with land ,'.i -,iii
conveniences, twenty eiqht tfet
in length, and t.' -, l. feet in
width and bottorr *,ii, all living
accommodation. Top. three
rooms with toilet and bath. and
a large verandah Can be used
as residential, night spot,
restaurant or doctors,'clirmi. Call
455-25 2.


FOR sale by owner -
property at Public Road De
Hoop. Mahaica, ECD. Call 623-
2717
CORNER, NANDY PARK -
$15M. NICE. GANESH 611-
0315









"HAVE FAITH IN CHRIST TODAY"






Lemaha Gardens, Cal

Gardens, Aidc Gardens,
Happy As, .

Jewanrani's Realty
"AT'rusted Name"
227-1988,270-4470,623-6431
Email: jewanalrealtty@yahoo.com

BUY NOW !!!! ESPECIALLY
WHERE PROPERTIES ARE
APPRECIATING AT A GREATER
RATE THAN INFLATION. WE
HAVE RESIDENTIAL.
INDUSTRIAL, AGRICULTURAL,
COMMERCIAL AND SPECIAL
PURPOSES IN ESSEQUIBO,
DEMERARA AND BERBICE AT
AFFORDABLE PRICES AND
HAVING ALL UTILITY
-SERVICES. RESIDENTIAL: Bel
Air Park. Garnett Streets,
Section K. Blygezight Gardens,
Prashad Na ar, BB Ecces -
$14.5M & $30M, Campbellville
- $16.5M Kitty $10M, South Rd.
- $8M. D'Urban St.- $4.2M.
Regent St. $14.5M. Kitty -
$4.2M. Grove $4.5M & $10M.'
Diamond $8.5M, Prospect -
$15M. Goedverwagliring- Public
Road. Kersaint Park. Triumrrph -
S8.5M and $6.5M, Lusignan.
Annandale, Best Village (three
lots with house), Enmoreo Non
Pariel. RESIDENTIAL/
COMMERCIAL: Kingston -
$60M, Croal Street $60M,
Brickdam $130M. Queenstown
- $0rM Camp Street $60M &
Sr1 ;45M, Alexander Village
- $30M, Friendship $13M.
Palmryra $60M.
COMMERCIAL: JOHANNA
CECILIA, ORIGINALLY STORE
WITH B6ND $45.5M, Water
Street $35M & $70M,
Wellington Street US$2 000
000, (SUITABLE FOR A-MALL),
Regent Street $124M, $30M.
$25-M, and $45M. Camp Street -
$45M, Avenue of the Republic
- US$2M, High Street $75M.
Thomas Street $75M, Thomas
Street $75M, Stanleyvtown.
New Amsterdam $25M.
(WHARFAGE), New Amsterdam
- Land US$5 US$9 per sq. ft.
SUITABLE FOR RETAIL OUTLET.
SPECIAL PURPOSES: Kingston,
David Street, Duncan Street,
Quamina Street, Enmore,
Alexander Village $7.5M
Blankenburg 8 q / acres, and
16 lots $1 5M. New Hope. Mc
Doom. Friendship Soesdyke.
Sheet Anchor, terbice 46
houIselot-s or oil terminal.
Golden Fleece. EASTa BANK
DEMERARA WHERE
DEVELOPMENT IS TAKING
PLACE, BUY AHEAD OF THE
MOVEMENT Alexander
Village, Prospect, Diamond,
Grove. Craig, New Hope,
Friendship, Soesdyke. Mc Doom.
Aqricola. Meadow Bank.
HOUSELOTS: Campbellville.
David Street, Oronoque Street.
Kitty Public Road, Meadow
Brook Gardens, Lusignan.-
Enterprise, Earl's, Court.
Vryheid's Lust, Meadow Bank.
Craiq, Pouderoyen. La Grange.
AGRICULTURE: Land of Canaan
for aquaculture or housing
project 40 acres or 280 house
lots $140M, Johanna Cecilia -
40 acres $40M, Mahaicony -
100 acres 18M (rice or cattle).
DEMERARA RIVER ONE
ISLAND -40 ACRES (SUITABLE.
FOR RESORT OR
AGRICULTURE. Vreed-En-Rust.
left bank Demerara River.
SANDHILLS: 213 ACRES OR
APPROXIMATELY 785 000 000
TONNES OF WHITE SAND IN
COMMERCIAL QUANTITY AND
ACCESSIBLE BY THE
DEMERARA RIVER $100M,
suitable for making glass. filling
beaches and coristruLiction.
INDUSTRIAL: Coldigen. WE AT
SUGRIM'S REAL ESTATE
AGENCY GUIDES YOU EVERY
STEP OF THE WAY OF OWNING
YOUR OWN.PROPERTY. GIVE
US A CALL ON 226-4362 OR
E M A I L
srhomes2005@yahoo.com OR
COME IN AT LOT 1 HADFIELD
AND GEORGE STREETS,
WERK-EN-RUST,
GEORGETOWN.


BEL AIR Park $26M neg
executive Nandy Park $17M,
Eccles $17M new. KEYHOMES
- 615-8734, 628-0715. 231-
8469
ONE property with existing
manufacturing business. Owner
overseas, everything $10M
neg., one business property
between Camp and Wellington
Sts., on North Rd. 25M. Call
Naresh Persaud 225-9882,
650-2724.
NORTH Rd. $27M, Kitty-
$16M,' C/ville $16.5M
Queenstown $18M, Bel Air Park
- $22M, $30M & $60M, Lamaha
Gardens $30M, Regent St. -
$40M, Republic Park $21M,
Kingston -- $45M, Charlestown -
$3M and many more. Tel. 226-
1192, 623-7742.
ALBERTTOWN two-storey
front $12M neg., Water Street,
Agricola two storey three-
bedroom upper flat, lower -
flat kitchen. dining and living
room two toilets and baths -
$8.5M neg., and others. Roberts
Realty First Federation Life bldg.
- 227-7627, 227-3768, 644-
2099.
BRAINS REAL ESTATE &
AUTO SALES we buy and sell
properties and new and used
vehicles. One property to rent or
sell on Regent Street one land
to sell at Mc Doom $4.5M. TeL
# 223-6053 or 225-1001.
D'URBAN Street concrete
house on double lot suited for
business reduced from $16M
to $11.8M, North Ruimveldt -
$8M, East La Penitence before
Turning Point $7.5M. Phone
226-2626, 225-5198, 225-3068,
231-2064.
FOR SALE BY OWNER 2-
storey fully concreted house 5
bedrooms, 2 full bathrooms,
American fixture faucet, sink. toilet,
cabinet, hot water tank. eating
kitchen, built-in wardrobe, central
air-conditioner, car garage, front
view to Public Road.' Lot 6 Nandy
Park, EBD. Interested person only
to call. Day 226-7806: evening -
225-8410.
FOR sale 1 3-bedroom, 2
bathrooms, domestic dwelling.
situated at 194 Imax Housing
Scheme, Enterprise,, East Coast
Demerarara Contact telephone
No. 218-1472, between 08:00
hrs and 14:00 hrs.
BEAUTIFUL CONCRETE
PROPERTY REPUBLIC PARK -
$34M & $29M, Nandy Park -
S30M. Diamond $4.5M to
S14.5M. Ruimzeight Garden -
S31M, Enmore huge concrete
property reduced to $16 5M,
Subryanville en double lot;
Substantial properties iin
Queenstown & Lamaha
Gardens, Vlissengaen Road,
Sheriff St., GuySuCb Gardens,
Le Ressouvenir & Republic Park
with pool, Alberttown $22M,
Cummings St. $12M, Kitty -
S5.9M, Craig $7M, Mc Doom -
$4.5M_ Leonora $12.75M,
Crane Public Rd., land $3M &
S5M properties with rice mill -
$45M. 15 acres. Canal #1 -
$11.75M, Non Pariel $4.75,
Annandale $5M David St. -
$26M. TEL 226-8148/625-1624


1 KENMORE Upright
frostless freezer. Call 225-7900.
15 ACRES citrus farm for
sale, Parika backdam. #260-
4713.
-- -.. .. .. .. .........8............ ..
8 WEEKS old Doberman
puppies with vaccination
certificate. Call 225-5559, 619-
5505. ____
ONE Tacoma Pickup truck 4-
cylinder engine, in excellent
condition. Contact Ram .624-
1900.
TWO FIVE-DISH AND ONE
FOUR-DISH PLOUGHS.
CONTACT # 623-0957..
1 LISTER ARC WELDER 280
AMP, 220V AUXILLARY 628-
3245, 270-1709.
PARTS for twin tub washing
machines (new). Telephone 641-
2026,_.22T-006.o._... ...
NEW 18" Celestion frontline
11 speakers 2800 watts. Call
226-2913, 615-1203.
6 WEEKS old pitbull plups
fully vaccinated and dewormed.
Call .646-9456....31-1.074.
2 COMBINATION safes with
combination and key lock. Tel
223-6333 or 623-4446.
2 PURE Bred German
Shepherd young adults,
English bloodline. Call 625-
6006.
SHERWIN Williams Super
Paint 5-gls. pail and 1-gal. All
colours. Tel. 220-1014.
ONE (1) Lister generator
lightingplan 8, 500 watts.
Contact Tel. 225-3199.
2 POOLS Tables. Good
condition. Call 268-3548.
ONE L. T. D 550 cc
Kawasaki. Tel. 646-5599 or 621-
5883.
EARTH FOR SALE
DELIVERY TO SPOT. ALSO BOB
CAT RENTAL. CALL 626-7127.
ONE suite and one food cart
with deep fryer and hot plate.
Tel. 226-0170,
ONE 4-cylinder 3304 DI
used Caterpillar engine. Contact
Tel. 771-4187 or 624-2561.
1 PS 2 Game, in excellent
condition $29 000. Call 627-
8832.
2 MALE DACHSHUND
PUPS. CALL 222-5707.
SPECIAL low prices -
speakers, amplifier, mini
camcorder. TVs. microwave.
DVDCD burners., etc. 669-9386,
645-1059
ONE 7-piece dinette set.
one 2 500 watts generator used
X-box and play station games.
Call 227-3355.
2 HONDA pressure washers,
2 chain saws, 2 machines, 2
microwaves. 1 pump, 2 saws.
Call 265-5876.
ONE Honda 5Hp pressure
washer, excellent working
condition $60 000 neg. Te .
220-4058.
SALON EQUIPMENT.
CONTACT NUMBER 222-4966
COMPUTER WITH DESK -
$39 000. 227-1939, 223-9719.
2 580C H macs, 1 D4E
bull dozer. 1 TK Dump Truck.
Call 623-9566.
EX 100.HITACHI original
Japanese made, brand new. 312
final drive. Tel. 623-9455, 683-
1180.
INTEGRATED amplifier 800
watt and one pair speakers boxes,
1 600 watts each. Call 622-0267.
629-2239.
TWO Wedding oi-..? one
(1i long sleeve ., a uuJ one
shoulders $55 000. Used
only once. Tel. 233-3704.
AB Dick 375-2 colour. AB
Dick 360 paper & plate cutters,
plate burner. No machine with
Perf. Tel. 233-2439/233-2725.
COMPLETE tools box.
heavy-duty cable, chop saw
blades. saw bits, rip ing blades.
sander. Tel. 233-2439.- 233-
2725.
CARBIDE saw blades 9" x
10' brazer 1/8"- 1.5". Saw mill
bearing upright grinder, drill. Tel.
223-2439. 233-2725.
SUCCESSFUL printing and
paper business with 2 properties.
Contact Mr. Jodha at 223-2439.
233-2725 at 08:00 h .- 17:00 h.
4-HOLE Alloy rims 14" and
15" froin Singapore. Reasonable
riced. Contact Fazela Auto
Sales 276-0245. 628-4179.
BRAND new 6250 Waits
Coleman generators from USA -
$280 000 each negotiable. Call
276-0245, 628-4179. __
1 COMPLETE 6" Dredge. 2.
six-cylinder Perkins' engine, 1 -
Yaesu multi band radio with
antenna. 1 5" Lavador. 662-
2500.


DACHSHUND PUPS -
DEWORMED & VACCINATED.
DIAL 231-7685.
2 PRESSURE washers.
2500 PSI,1 Toyota engine and
transmission front wheel drive.
Call 220-3735.
PARTS for Dryers/
Washers. Thermostats, pumps.
motors, belts, valves, knobs,
etc. Technician available. Call
622-5776.
..... 57.6...... .. ... ........ .... ........... ..... .........
1 SIMONIZ Pressure
washer 2,700 PSI, new; 4 17'
mag rim with low profile tyres.
Call 228-2780.
1 BLACK Dell CPU P4 17
Ghz 512 RAM, 80G hard drive.
DVD ROM, excellent condition
$85 000. Call 627-8832.
FOUR (4) Slate pool
tables, USA made. Tel. 265-
2103 after lunch. Price $600
000 neg.
1 NEW Sansui DVD/VCR
unit, 1 new Panasonic Fax &
Copier Mach. Tel. 225-4937 -
William.
SHOCK treatment for
swimming pools. Phone 233-
0654, (8 am 4 pm). Mon. to
Fri.
CHLORINE tablets 3" for
swimming pools only. Phone
233-0654, (8 am 4 pm), Mon.
to Fri.
ROTTWEILER &
-Doberman pups, 4 months old.
vaccinated and dewormed.
Tel. # 222-5013.
TIBETIAN Terrier Pit Bull
Doberman pups. Tel. 227-
4584. 684-1276.
ONE Datsun engine and
gear box 120Y, good condition.
Price $40 000. Call 617-
8242- cell.
EARTH & reef sand
excavating, grading and
levelingof land also done.
Contact 628-3840 or 644-
7633.
1 MID Range speaker box, 2
12" eminences. 4 bullet
tweeters, 2 -- 10" horns, well
covered. Call 623-7875.
ELECTRIC oven, (1 000 W
auto transformer), new pressure
sprayer, single bed, 7-piece
dinette "set. Tel. 611-3153.
ONE Butcher shop in
Bourda Market. Contact 622-
4955. between 10 am and 5
Pm or 220-6440. anytime after
Sprn.
OPEL KADETT 1.8L fuel
injection, power steering,
Contact 226-6437 between 7
and 9 am, and 7 and 9 pm.
1 Bar-B-que grill $20
000, one large Avanti frifde -
$58 000. CaTl 646-5988. 226-
2053.
5 NEW ACs 18.5 adapters
for various models of Hp
Corpaq lap top computers -
$7 50. CalI Mark 618-6572.
FREON gas 11, 12, 22.
502, 134A & 404A. Also helium
for balloons and r .)r, gas.
Phone 233-0654, ., ,-im 4
pm), Mon. to Fri.
STALL # 96 Stabroek
Market. Contact Gaitri -- 222-
3345 weekdays after 5 pm
or any time on weekend or
Shobha 0011-651-2333(US).
OXYGEN and acetylene
gases. fast and efficient
service. 10 11 Mc Doom
Public Road, EBD. Phone 233-
0654 (8 am 4 pm). Mon. to
Fri.
NEW shipment of Lister.
Petter engines and generators
from 3 KVA to 20 KVA. Also
Lister welder. Contact 624-
3187.
2 CANNON colour copy
machines, computer monitor
transformers 4'5/60 KVA. Hp
LaserJet toner. Bulk office
upp'he: Tel. 223-2439, 233-

ULTRA quiet generating
set. 6 cyl. Perkins, 126 KVA
and (1) MF 185 tractor, 1 Petter
Engine & generator 6 KVA.
Contact 9 B New Rd., Vreed-
en-Hoop. Tel. 254-1195.
KEYBOARD Akita 54 Key
multi- functional, Lex MarK
portable Photo Printer, Vivitar
DVR 540 & 3780. Mustek DV
S4000 digital camera.
Telephone "225-3006, 61.8-
S3635.
SALE! SALE! SALE!
furniture sale All types for all
classes at unbeatable prices.
Free delivery: Morgan's
Furniture Store, 167 Charlotte
Street, Lacytown. Tel. #226-
4129. 4 doors, west of Camp
St.
RICE Mill No 5, all
modern machinery full
electrical packing and sealing
machine. No. 68 Corentyne.
Contact 338-4209/2319/2660.


__


EXECUTIVE CATEGORY
Gusuco Gardens neg,
Ie Ressouvenlir E0.B1 neg.
Courida Park ME.C.A) neg.


Bel Air Park-Neg,
Courida Park 351
L.B.I Eart Court.6SM
Oleander Gardens-Neg.
Vryheids Lust (for workshop) Neg
Quamina formerly Murray St,






SUNDAY CHRONICLE Apri J2007 .... .- .. 29


GOING away sale -
household appliances. 1 GE
large fridge with stablizer, 1
Whirlpool heavy duty washer.
Call Mark -618-6572 or 614-
9843.
1 DELL C521 Computer
AMD3200 (2.0 GHZ) 512MB
80GB 16X DVD-ROM, 17" flat
screen, new in box G$160
000. Tel. 233-2546, 623-0501.
ONE White Westinghouse
US imported, standing style,
non-frost freezer. Inside
measurements 12.0 cubic
feet. Inexpensive. Contact
Tony@ 680-1958.
HONDA Pressure washers. 1
Stihi Brush Cutter. 1 Lawnmower,
1 mitre saw, 1 air compressor, 1 2
/2" Plainer 1 Yamaha 6000
generator. 6all 267-2329.
BOAT for sale 96 tons
length 79 feet widpth 2
feet, depth 12.1 feet, steel
hull, CAT D353E 425 H
engine. Call Roxanne 225-
4076 or 680-6348.
1 USED 4.236 Perkins on
bed along with pressure pump,
gravel pump hose and other
accessories for mining $700
000. Tel. 233-6550, 628-0796
or 227-4040.
ONE (1) Mercedes Benz
ML 320 fully loaded, full kit;
one (1) RCA 65" TV and home
theatre; one (1) Sony Lap top;
one (1) bunk bed with mattress.
Call 614-7020._
4 MM '" 3/8" 1" ply
board. Waheed's General
Store, W % 113 Pike St., Kitty.
Tel. 226-7585, Fax: 226-7586
2 FISHING boats brand
new seine and engine, 48-ft. 4
Yamaha 40-Hp engine, 400-lb
Banga Mary 3-inch net ice box
holds 10 000-lb ice. el. 220-
5728, 650-9764.
(M!GRATION). Households
microwave, TV, VCR,
computer, music system car,
wardrobe, vanity, cameras,
head light Toyota SERA.
Much more. Phone 223-
1885, 642-3722.
1 3Ghz Celeron CPU 40
GB hard drive 256 MB RAM,
56K Fax modem, keyboard,
mouse, speakers, monitor,
DVD-ROM & or CD Burner,
floppy drive. Call 623-7875.
JQINER, Planer and Mort.
440 volt $500. 000, table saw
with engine $500 000, Drill
press, 440v, sander 440v,
ptaner 440v, band saw 240v.
Rael. 275-0208, Cell 626-

1 SILENT 50 KVA
Generator, Perkins engine, Key
start, diesel, 1 year old $3M;
1 19KVA generator Germin
engine $600 000. Rai. Tel.
275-0208, Cell 626-0350.
PUPS eight weeks old.
Vaccinated and dewormed,
German Shepherd and'
Labrador. Very affordable
prices. Ruimzelght Gardens,
WCD. Tel. 619-9853 or 269-
0671 -after 3 pm.
1 GX 90 Mark 11 car in
excellent condition. 1 Long
wheel Base Land Rover,
excellent condition. Quality
bloodline Pit Bull pups, 6
weeks old. Contact 645-4587,
645-3897, 613-1961.
2.4Ghz Celeron CPU 80
GB hard drive 256 MB RAM,
128 MB Video Card 56 K Fax
modem, keyboard. .mouse,
speakers monitor, DVD-ROM &
or CD Burner, floppy drive. Call
623-7875.
AUTO International the
American Spare Parts Dealer
and Service in all American,
European and Japanese
Spares. Automatic & standard
transmissions specialist. Tel.
223-0145, 225-5509, 628-
9793.
CAUSTIC soda, 55 lbs S4
640, alum, 55 lbs S5 800,
Soda ash. 55 lbs S8 700,
Sulphuric acid 45 gals $52
200, granular chlorine.
chlorine gas. Prices include
VAT. Phone 233-0654. (8 arn
4 pr), Mon. to Fri.
1 COMPLETE German
differential. 4-speed Bedford
gear box. GE complete, 7- ton
axle. Servo J model clutch and
pressure plate. Bella Housing.
1 Singer electrical and manual
.-..;r :titch sewing machine.
S. -.5692.
PLAYSTATION 2, X-BOY,
GAMECUBE & Nintendo 64
systems, game discs &
cartridges, DVD Players now in
stock: Many new relea'e-
including God-rf-A'-
Theft : -. *vdr 2, Grand
u-i.. -ulo Liberty & Vice City
Stories. Mortal Kombat
Armageddon, Fifa 2007 & lots
more. Best prices in the country.
"GAMESTATION VIDEO GAME
& DVD STORE Pouderoyen
Main Road, WBD. Mon Sat
- 10 am 8 pm. Call 609-81-"
611-9001. z,


COMPUTER Programmes
from $2 000 Photoshop 10,
Corel Draw 13, Office 2007,
2006 Quickbooks & Peach tree
Accounting, Point-of-Sale,
Encarta 2007, Typing and
children educational, ames
and much more. Call Anthony -
227-8010. 625-7090.
1 LONG Base canter MMC,
1 Short Base dump canter MMC,
1 forklift, 2-ton, 1 7-ton truck
dump ramp, 1 Honda 5600 watts
generator, 2 '-ton bucket with
hydraulic hose and control
valve. Contact 612-6165, 270-
4165 8 pm 5pm, 270-4102
5 pm 9 pm,
ONE HP slim line wireless
computer with dual layer DVD
Burner, 200 GHD 512mem.
memory card reader Windows
Vista US$1 000. ell E521,
250 GHD/G mem dual layer
DVD Burner, Windows Vista with
19" monitor (LCD) US$1 500.
1 ACER Computer, 19" LCD
mbnitor, 160 GHD, 512 mem,
dual layer DVD Burner, memory
card readers US$1 200.Call
Paul 231-3883, 626-1150.
ONE complete music set
with 8 bottoms 18" Fane
speakers, 6 upright tops with 15"
double speakers, -4 44T Drive
horns, QSC amplifiers,
equalisers, crossovers (Numark),
1 -32 amps Tum-up transformer
6 100 watts bullets. Also
metal hail spot lamps 18" x 15"
complete with wires, disco
rights, fogging machine. One
Nissan 4x complete with bed
liner, search lamps and winch.
Call 263-7305 or 618-8996.



I AE 81 COROLLA $320
000 NEGOTIABLE. TEL. # 628-
0054.
ONE TOYOTA
TUNDRA, F 150. TEL.
623-5534, 227-3717.
2000 MODEL TOYOTA
TACOMA. TEL. 610-3880
6 1 2 7 6 6 6.PRI CE
NEGOTIABLE.
1 HILUX 4X4- AC, CD
.PLAYER, ALARM, PJJ
SERIES $2.9M TEL,. 227-
2664."
TOYOTA Chaser GX 100
SSuzuki 750 katana M/blke Tel.
231-4586. 622-6448..
1 NISSAN B12 good
condition. a/c. doniact
Numbers: 610-9218 231-9140
1 MF 399 TRACTOR 580 C
Hymac, 1 Toyota Land Cruiser.
Call 616-9402
ONE Austin Maestro 500
car, one Austin Maestro 500
one ton van. 266-5013.
: 1 RZ MINIBUS MAGS,
MUSIC BGG. GOOD WORKING
CONDITION $950 010, CALL
218-4060. :'
ONE"AT 212 Toyota Carina
in very good condition. Call
624-0069. 621-9235 anytime.
1 DODGE Dacota Sport
pickup King Cab under 20 000
miles. Tel. 222-5741, 650-8393.
ACURA Legend and Nissan
300 ZX Sports, fully loaded,
leather, DVD. Tel. 226-6432,
623-2477.
ONE RZ Long Base minibus
in good working condition. BHH
685. Call # 660-4783. Price
reasonable.
TOYOTA Mark 11, SX 70.
Immaculate condition. Tel. 275-
0041.
TOYOTA Ipsum, executive
style, leather interior, double
sunroof. TV. DVD. 17" mags. 4-
wheel drive. Tel. 623-1988.
AE 81 SPRINTER -
excellent condition, AC. CD.
mags, etc. Tel. 681-3151.
1 ISUZU PICK UP IN
WORKING CONDITION. TEL.
226-4129.
192 CARINA fully powered
with spoiler and mags. Phone
268-3953.
ONE Corona AT 140, good
working condition. Price $260
000 Tel. 276-1415, 649-7849.
AT 192 S1.3M. AT 212 -
$1.6M. Mitsubishi Lancer -
$1.6M, RAV-4 $2.2M. Unique
Auto Sales 227-3551, 647-
0856
ROYAL Auto Sales. Toyota
Marino PHH. Blue, 14" rims
CD player. AC ..r.l condition
Price $1.1 -,,,iiiir. Tel. 227-
2664 or 609-9112.
CORl I A
i~z1l NZE PKK.
Red. DVD/TV, auto start. mags.
leather seats $2 9M neg. Royal
Auto Sales. Tel. 227-2664, 609-
9112.
G-TOURING Wagon .. Pjj
roof rack. rrao .I- ne
Rov, ,,uto Sales. Tel. 227-
2664, 609-9112.


1 LEYLAND DAF Truck,
GJJ Series. Tel. # 641-1127.
1 TOYOTA Hilux Surf NY
130 Grey, PJJ series, excellent
condition full accessories.
Price $3M. Calf623-9570
ONE AE 100 Ceres "manual"
15"mags, spoiler, fully powered,
7063 or 681-0788._- Vinny .
UNSTOPPABLE Auto Sales
10 RZ minibuses. Must go -
$650 000 up. Tel. 269-0259,


220-1324, 223-5324.
ONE RZ minibus, BHH
series, long base excellent
condition. Price $1.4M neg.
Call 227-3862, 622-6673.
1 TOYOTA 4 x 4, in excellent
condition with, all bars, 1 Nissan
4 x 4, NissanCaravan. Tel. 225-
8802, 629-5387.
ROYAL Auto Sales. 192
Carina description PJJ, Blue
colour 19" mags rims, CD player,
excellent condition. Price -
$1.5M neg. Tel. # 227-2664,
609-9112. .
ROYAL Auto Sales Hilux
Surf PHH, CD player AC, mag.
rims, crash bar, fog lights, rey
and cream, excellent condition.
Price $2 450 000 neg. Tel. #
227-2664, 609-9112.
ROYAL Auto Sales. Toyota
Ceres PHH Silver, DVD, AC
perfect condition. Price $1.1
million. Tel. # 227-2664, 609-
9112.
ROYAL Auto Sales Toyota
4 x 4 GDD, CD, AC, 15" mag
rims, Single Cab excellent
condition.Price $2.1 million
neg.T. # 227-2664, 609-9112.
NISSAN 4 x 4 GFF, mae
rims, crash bars, front and bac
.roll over bar excellent condition.
Price $1.1 million nag.
Available at Royal Auto Sales.
Tel. 227-2664, V609-9112.
ROYAL Auto Sales. Toyota
T-100- GKK, Dark Blue, 15" nms
CD player, AC, excellent
condition.. Price $3.2 million.
Tel. # 227-2664, 609-9112.
.ROYAL Auto Sales. 192
Carina, description PJJ, White,
.,17" mag rims, CD player, music
system very-good condition.
SPrice $1650-000. Tel. # 227-
2664 or 609-9112.
ROYAL Auto Sales. Hilux
Surf PHH White Crash bar
automatic, 5-door. Price $2.3
million neg'. Tel. # 227-2664 or.
609-9 12.'.- _-__ .
AT 100 COROLLA- PHH,
Blue, CD player, mags $1 150
000 neg. Ral Auto Sales. Tel.
227-26_4,_ 69- 911 2.
ROYAL Auto Sales. CRV -
PKK, Dark Blue, AC, CD player,
excellent condition. Price $3
450 000 neg. Tel. # 227-2664
04 609-9112..
HILUX Surf PGG, CD
player, AC, mag rims, crash bars,
Burgundy, excellent condition.
Price 2 250 000 neg. Tel. #
227-2664 or 609-9112. Available
at Royal Auto Sales.
.ROYAL Auto Sales. AT 212
PKK, White colour. mag rims
15", MP3 Blue Tooth player CD
deck, excellent condition. Price
$2.1 million. Tel. # 227-2664
or 609-9112.
KHAN'S AUTO SALES 3
RZ minibuses top series, music,
mags, etc. 225-9700, 609-6600.
Behind Bricdkdam Police Station.
Credit available.
1 RAV-4 full" loaded, flair
kit 20" chrome rirfs. DVD player,
AC $2.4M neg., 1 R6 Yamaha
2001 model. 1 motorcycle $850
000 neg. Tel. 229-6363 or 623-
3240.
KHAN'S AUTO SALES 2
Wagons, 2 small buses, 2 canter
trucks, 3 pick-ups 2 x 4 and 4 x 4.
225-9700, 609-6600. 233-2336,
anytime. Behind riril-d'rm
Police Station. Credit i-i.i.
KHAN'S AUTO SALES 2
AT 192 Carinas, one 212 Carina,
fully loaded with rmags, music
air-conditioner. 225-706o. 609-'
6600. Behind Brickdam Police
Station. Credit available.
KHAN'S AUTO SALES 1
Toyota 4-Runner, 5-door. rrags
side step bar, crash bar, fog
larrips air-conditioner, music
set. nickel rims, crystal liq htr- .-
225-9700. 609-6600, 233. .,
anytime. Credit available.
1 AT 170 Toyota Corona car.
Automatic, recently refurbished
split liohtk At', ..- .
-., rvv, PM. PS:
alloy wheels, tape deck $750
000. AE 81 Sprinter used front
burnper, gril, back wind shield
Tel. 619-5087, 218-3018.
KHAN'S AUTO SALES -
chean hea, cars from S300
Uoo), A 150 Lorona automatic,
AE 81 Corolla 5-forward mags,
2 HB 12 Sunny automatic.
nickel maa s, sun roof, fully
loaded. 225-9700. 609-6600.
233-2336. Behind Brick'g;-,
Police Station. Credit available.


1 TOYOTA Carina 212, PKK
series excellent condition. Call
218-4b63.
1 AE 81 TOYOTA Corolla,
automatic. Call 220-4538 after
4 o'clock.
TOYOTA Ipsum, executive
style, leather interior, double
sunroof, TV, DVD, 17" mag
1 BEDFORD truck, good
working condition 1 Leyland for
parts. Call 614-5634, 645-7527.
1 RZ minibus price $1 075
000. Price negotiable. Tel. No.
# 664-7688, Cell 661-2671.
ONE Honda Civic fully
loaded, immaculate condition.
Price $1 600 000. Tel. 227-2740.
ONE RAV-4 4-door fully
loaded, mint condition, T .DVD
6138.
SUNNY B15 2003 Model.
Finished only 6 000 miles.
Vehicle never registered -
$2.3M. Call 225-2611.
ONE AT 170 Carina & one
AE 100 Corolla both
automatic, fully powered,
excellent condition. Tel. 626-
, 7452. _____
1 AT 170 Carina PGG series
automatic, fullypowered, mags.
Tei. # 627-3438 price $850 0Do
neg.
1 BEDFORD Model 'M' 4x4
dump truck. Also TL spares.
-Contact 233-2423 working hrs.,
220-9353 after 7 pm.
............2..... .... .. .......... _... ..... ......... ..........
1 TOYOTA T 100 Extra
Cab 4 x 4, 5-speed. 2001 Toyota
Tacoma body parts. Call 629-

ONE AA 60 Carina, in
excellent working condition, needs
body work tape deck AC etc.
Tel. 617-4063/225-6236.
190E Mercedes Benz
Special Edition automatic,
fully powered, 2.6-cylinder, full
flair package and lots of extra.
Must see, needs minor work. sold
as is. Price $975 000. Phone
647-3000, 225-2503, 225-4631.
BMW 325i Convertible,
automatic, low mileage, leather
-curtain and CD players.
Excellent condition. $T.9M.
Phone 227-7677, 647-3000.
FORD Wrecker truck crash
nar ift bar needs minor works
sold as is Must see Price. $450
100 Phone 227-76,77 647-
3000
FORD Lincoln Limousine
BLACKI savep-seater first to
.arrive in Guyaa, Nees some
vork. sold asZthdiimertts
S2 5A or esffet. Phbohf225.
4631 6-17.3000
AT 192 CARINA. AE 100
.Oi'olla & Sprinter. Palero JR
Jeep Model M Truck Toyoa
ickup i RRF4 Awr.- 621-6037
227-2634 .
1 GJJ L. land Daf', doub-le
a.-e Truc. .'ilh nt hab dump 20-
c2 5 Tra', Price neg Call 6-10-

1 RZ minibus, EFI. cat eye,
L/Base. 1 AT 170 Corona. Al rin
excellent condition. Rhone 268-
3953. ___ ,__ ...
S 1 SUZUKI 75 P .'; Almost
new. Owner leaving country.
Phone 256-3749, Cell 685-
2260, 617-3721.
2 2 6 6.. . .. ... .... .. ......... ... .......
ONE Coaster bus in good
working condition. Contact
616-3736 or 660-1564. No
reasonable offer refused.
AT 170 Carina, 17" rims, 4
AGE, 20 valve engine, Pioneer
music system crystal lights.
Contact 641-4210.
1 AT 170 TOYOTA Corona
excellent condition mag
rims, fog lamps, original
spoiler. Price neg. Telephone
622-0322.
TOYOTA Nadia. 1999 2
000 cc, W/CD, ABS, 17" rims.
economic engine. PKK series -
$4.5 million negotiable. Tel
619-8066.
-1 TOYOTA D-na 1.5-ton
truck, 1997 model. 5-FWD
manual, Diesel, double wheel
i I-..-.. Terms available. Call

GX 71 Toyota Mark II Good
working condition and fully
powered. Price 3750,000
.,',-, _ -3410
AA 60 CARINA Price S200
000: one RT 100 gear box -
$20 000. Fl-.,'., 444-2461 or
622-6387. ,.', ii
2005 TOY' ^A
S i lacoma.
Access doors, Extended Cab
2003 Toyota Tundra, fully
loaded. 619-0063, 643-9891.
ONE Vauxhall Cavalier car.
excellent condition. Price -
$500 000 neg. No reasonable
offer refused. Tel. 220-3816
220-1505. 624-6428
580 C HYMAC with swarnpI)
tract. 10 tons (3) wheel roller, 3
Loris vibrating roller All in I
working conditins. Call
3404, 222-6708.


1 DUMP truck, 1 water
tender and 330 Timber Jack
Skidder all are in paod working
condition. For mor3 information
Contact: 264-2946.
ONE 2000 limited Toyota 4-
Runner powered leather seats,
sun roof, 20" rims, alarm
pioneer DVD Player, etc. Call
623-3122.
ONE Long Base Toyota RZ,
complete flair up, recently
sprayed over, excellent
condition $1 350 000. Tel.
220-4103, 616-0956.
ONE RN 36 Pick-up, sound
system, power steering, AC 4-
wheel drive $1M neg. Call
Shafeek 226-0262, 628-4812,
669-2228.
AT 170 CORONA EFI
excellent condition; 2 AT 192
Carina EFI fully powered.
Tel. 222-2905, 641-3821.
1 HONDA CRV Jeep Dark
Blue PKK series, W/ CD AC, etc.
4 0" ma rims (nickel). W/6
lugs. Tel. 231-0336, 625-3898.
AT 192 $1.3M, AT 212 -
$1.6M, Mitsubishi Lancer -
1.6M, RAV-4 $2.2M. Unique
uto Sales 227-3551, 647-
0856.
AT 192 $1 150 000, RAV-4
-PJJ series mags, roof rack etc.
$2.6M. Clean. Unique Auto
Sales 227-3551, 647-0856.
AT 192 $1.3M G-Touring
Wagon 17" rims, roof rack etc -
$1.5M, RAV-4 $2.6M. Unique
Auto Sales 227-3551, 647-
0856.
1 GJJ Leyland Daf, double
axle truck with hyhab, dump, 20-
cyd. Tray. Price neg. Cal 640-
23 65.Se H
1 AE 100 COROLLA, PHH
Series $ 1 150 000 neg., 1 AT
170 Corona PGG Series 45
engine $95d 000 neg. Call 222-
2640, 613-8221.
.AFORD 150 Pick Up, 3 doors
goda condition, CD/Tape player,
bubble tray dual air bag, ma
rims etc. $5.5M neg. Tel.22-
7416.



s22-4163. 645-8870
1 AE 100 COROLLA, 1 AT
192 Carna. 1 SV 40 Camry. AE
91 Corolla Wagon Owner
leaving cell ry Call2 645.

EFI, mags. automatic Excellen
ondrOli9n Pice $700,000 1
, Nissan FB' 13 tlck Gear

ON'E Toyota -Hiac minibLis
IrH ood con.iBion BJJ series
IK TE 3 0 diesel eriqinc
Contact Hazeline or Brenoa
iielephore Number 226-3978
1 -.ADIES motorcycle
80CC I EP 71 Siariel 4.door I
Toyota Townace minibus 1;'.
seater. No- reasonable offer
refused. Call 623-8682 Willie.
3 LONG Base RZsa, EFI
minibus, cat eye. mags, music
immaculate conditions, etc. 2
SBHH & 1.-.,BJJ series (6 log).
Contact, Dhannie 269-0258
680-3436 :
1 TOYOTA Townace small
bus, 12-seater good condition.
Priced to go $600 000. Contact
35 Seaforth St C/ville. Phone
231-1271, Cell 610-2037 -
Hyneter.
1 2000 model AT 212
Carina, fully loaded, DVD
Pioneer Surround 6-disc,
change remote start, alarm,
automatic17" chrome mag rims
and tyres, leather interior, very
low mileage. Call 613-0613,.
669-0724. '
DAVID Auto Sales. We buy
and sell used vehicles locate
238 South Rd. & Alexander
St. AT 170 Carina & Corolla,
AE 100. Sprinter & Corolla, AT
192 Carina,. 212 Carina,
'1-,:,it::h, Lancer, Lorng and
S !-i...rt e r ,;t,i.u: 22 1845
S Mon. F ..-,.r _*,
TOYOTA Mark 11 GX 91.
one owner only S1.4M. Toyota
1r ,,,i r r H series for
i 11 I r. ,ar number
F -i-' ..,I ' I, now arid
others aL Potes Auto Sales. Lot
2 George and Hadfield Street,
back of the Brickdam Cathedral
Church. Call 231-7432. 226-
5546, 226-9951.
r "iC,' es Toyota RZ
buses Short and Long Base'
Prices to go. Credit can be
arranged. Also small buses 3 for
1 /:'! ton and 1 ton canters.-212/
192 Carinnas 110 Corolla and
Sprinter, AE 100 Sprinter, AT
170 Carina/Corona Toyota Mark
2 GX 81 and 90. Buy now at
Dealers price Prices are noen
Contact K & N Auto Sales. 71
Brickdam and Light Streets.
opposite the Muslim lMn ...
Tel. 225-09Q, 7(-4040 or 650-
o4t.


FOR the best
reconditioned vehicles in stock
are IRZ minibus, EFI, new
model, cat eye, diesel; RZ, AT
192, 2004 Tacoma 4 x 4,
Tundra 4 x 4, AT 212, new
model, canter trucks. Credit and
Trade-in available at Paul
Camacho Auto Sales. 111
Croal St:, Stabroek, (between
Albert & Oronoque Sts.). Tel.
225-0773 (0), 629-7070 .
ONE Toyota Land Cruiser
FJ 80. Automatic transmission
3F engine, 4 500 cc engine,
EFI, fully powered, windows,
dor locks, self start alarm, AM/
FM, stereo and CD player,
automatic Def lock for four-
wheel drive inside, leather
seats, high and low ranged drive,
4 new Good Year tyres and mag
rims size (16) crash bar, fog
lamps, adjustable steering
wheel, roof rack back lights
grilled, back toe bar, 5 doors,
sun visor, power steering, new
12v battery, back and front
wiper, air conditioner,
excellent, power mirrors, fully
security system from theft, 2
years 10 months old, PJJ series,
immaculate condition
excellent interior and fuel-
consumption, well kept, never
went in the Interior. Owner
mi rating $8.6M, neg. 641-
2294.
NOW AVAILABLE TOP
QUALITY RECONDITIONED
VEHICLES: CARS: TOYOTA
CARINA AT 192; TOYOTA
STARLET EP 91 (4 DOORS);
TOYOTA VISTA ZZV 50;
MITSUBISHI LANCER CK 2A
FULLY LOADED TOYOTA
CUSTOMISED DELIVERY VAN
(21 DIESEL ENGINE),
ICKUPS: TOYOTA HILUX
EXTRA CAB LN 170
(AUTOMATIC) TOYOTA HILUX
EXTRA CAB LN 172 (5-SPEED
MANUAL) MITSUBISHI
CANTER TRUCK 2 TONS
ENCLOSED FOUR WHEEL-
DRIVE. ORDER EARLY AND
GET.THE BEST PRICES ON
DUTY FREE VEHICLES. FULL
AFTER SALES SERVICE AND
FINANCING. AVAILABLE DEO
MARAJ AUTO SALES, 207
SHERIFF AND SIXTH
STREETS, CAMPBELLVILLE.
226-4939/683-6322. A NAME
AND A SERVICE YOU CAN
TRUST.
NOW IN STOCK. Toyora
Corolla NZE 121 AE 110 EE
103 Hnnaa Civic EK3 & ES1
Toyota Hilux Extra Cab LN 172
LN 170, RZN 174 Toyota Hilux
Double Cab- YN 107. LN 107, LN
165 4 x 4 RZN 167 RZN 169
Toyola Hilux Single Cab LtJ
106 Toyota Hiiu Surf RZN
.185 'rN 130. KZN 185
'.-;Misubi-hi Canter FE 638E
FE6387EV Toyota Car;na -
AT 192 AT 212, Toyota
Marnno AE 100d Toyota Visla
AZv 50 Honda CRY RO1
Toyota RAV 4, ZCA 26, ACA
21 SXA 11, Toyota"Mark
IPSUM SXM 5 Tody6ta-Mark 2
GX 100, Lancer CK 2A, Toyota
.Corona Premio AT 210,
Toyota Hiace Diesel KZH110.
Mi subishi Cadia Lancer SC2A.
Toyota Corolla G-Touring
Wagon AE 100. Contact Rose
Ramdehol Auto Sales, 226
South Rd., Bourda.
Georgetown. *Tel. 226-
8953, 226-1973, 227-
3185. Fax. 227-3,185. -[We
give you the best cause
you deserve the best.
RECENT shipment from
Sinpapore Toyota Corona
GLF- $1.2M leathers, CD
changer alloy wheels etc):
Honda divic $1.4M (full
body kit CD' player, alloy
wheels)- Honda City' $1.5vM:
Toyota -cho Motor car 2000 -
$1.7M (leather, CD player, alloy
wheels, etc.), Nissan. March
1998 $850 000 (leathers, CD
player alloy wheels. 4 doors,
etc.), Suzuki Wagon R $800
000; Mitsubishi Toppo (1000cc)
$9800 000. All vehicles come
with leather interior, CD player,
Changer, low mileage-, alarm
systems alloy wheels. etc. ALL
PRICEd ARE NEGOTIABLE
AND QUOTED ON THE WHARF!
Let us order vehicles directly
from Japan and Singapore and
save you money! Contact
Fazela Auto Sales -276-0245
628-4179.

HIB IIH8


1 MAID age 45 50. I
Call 231-2977 ask fnb,
Bibi
ONE GENERAL LIVE-IN
DOMESTIC. CALL 225-6965.
648-3374.
WAITRESSES. Contact
Tel.# 220-7846, 644-4644.
WANTED 1 Domestic
'aid, between age 35 and 40.
,all 225-7900.
ONE General Domeostic
preferably fromrn the ECD. TPI
# 220-9Q "
1 WAITRESS Contact
Bat y 1 'B' Shell Rd.. Kitty.
Tel 227-0743.


- ~- I~tY-l- ._







30 SUNDAY CHRONICLE April 1, 2007


HIRE car Drivers to work in
reputable taxi service. Call
227-3336 or 231-4110.
ONE Receptionist to work
from 2:45- 11:00pm. Call 227-
3336 or 231-4110.
DISPATCHER & DRIVERS
TO WORK IN TAXI SERVICE.
TEL. 225-5075, 225-7364.
A HIRE CAR DRIVER TO
WORK CAR AROUND
GEORGETOWN AT TAXI
SERVICE 641-2284.
MAID FOR DOMESTIC
WORK. CALL 650-0655.
SECURITY GUARDS.
CALL SECURITY
SUPERVISOR. 624-5082.
AGES 30 50._
1 DOMESTIC. ATTRACTIVE
SALARY OFFERED. CALL 218-
4863.
DRIVER & Conductor for
Route 42 minibus. Call 231-
4599, 6 .2:- 3434:....................................
ONE Salesgirl to work in
shop on ECD. Age 17 26. Call
615-8121.
LAND or house to buy in
Lusignan or Mon Repos Area.
Call 615-8121
ONE mature Driver/
Mechanic, one able-bodied
Handyman. Tel. 227-1830 for
more information.
SKILLED'Carpenters and
masons. Apply in person to Mr.
Singh. Le -essouvenir
Compound. Tel. 625-0625.
ONE Salesgirl to work in a
gift and variety store, on
Regent Street. Tel. # 223-7864.
Payless Set More Shopping
Centre-
ONE LIVE-IN DOMESTIC
FROM THE COUNTRY. TEL.
226-0170. ...........
ONE experienced, reliable
honest person to take care of
sick person. 1 Washer for
Saturday only. Call 223-2206.
EXCAVATOR Operators to
work in the Interior. Interested
person can contact tel. # 225-
9703, 625-5136.
RESIDENTIAL AND
COMMERCIAL properties/
lands/business places/offices/
bonds and vehicles. Ready
buyers/tenants. TEL. 226-8148,
625-1624.
ONE live-in salesgirl to work
in shop, age 17 26. good
salary, free apartment. Call
618-7852.
GARDENER/Handyman
and Driver. Apply in person with
written application Mays
Shopping 98 Regent St., G
town.
SX C AVA T OR
OPERATORS, DRAGLINE
OPERATOR & BACKHOE
OPERATOR.. CONTACT # 623-
0957.
ASSISTANT Cook/
Creole, preferably male and
House Cleaner to work in
Georgetown. Tel. 625-1906.
HOUSEKEEPER/Cook
experience necessary. Age 4d
yrs and over. Salary
negotiable. 622-9961, 231-
9176
1 LIVE-IN Domestic
preferably from country area,
age 25--35 yrs. Tel. 226-1377
or 618-3646.
BARWOMAN. Must be
attractive and intelligent.
Call 222-4650, 222-3927,
649-9876.
BATTERIES buying old/
used scrap batteries. Any
quantity. Price $20 00 per lb.
CalI 665-1349.
1 BABYSITTER to live-
in Region #10 Linden. Tel.
# 641-1992. Home 442-
1417.
/2 DAY general Domestic,
between 18 and 30 yrs., will be
rained, from Georgetown. Call
225-2598.
ONE live-in Maid from
country to work in Georgetown,
ages 30 45 yrs. Tel. 226-7743,
6 6 5 -42. 3 8 ......................................................
` IY & SELL LANDS
AND PRU r-TS
NATIONWIDE. PLACE YOU
ADD WITH US FOR FREE.
CALL 226-9700
1 DRIVER, 1 Accounts
Clerk, 1 Handyman, Billing
Clerk. Porters. Hamid
General Store 244 Regent
St. 225-3811. 226-8961.
TWO mature males to
work in bodywork shop. Must
know to fill and spray.
CoiCt .Andrew at 32 Sheriff
& Dnadna wa Sts.. ,/ v .....
EXPERIENCED curry
cooks, counter servers. Apply
in person Hack's HaIaal
Restaurant. 5 commerce S.,
G/town. 9-11 am.


1 MAID for Domestic
work. Tel. 650-0655.
EXPERIENCED Cashiers.
Apply in person with written
application. Hack's Halaal
Restaurant, 5 Commerce St.
G/town. 9-11am.
ONE Bar Girl; one Kitchen
Girl to work. Accommodation can
be arranged. 220-5244 -
Jameel. 14 Public Road,
Vryheids Lust.__ ............
WAITRESS Cleaner. Must
be able to answer phone. Apply
in person to Hilton restaurant
I Garnett & Middleton Sts., C)
ville. Tel. 226-5818
EXPERIENCED Drivers,
Waiters, Kitchen Assistant,
Handyboys. Apply in person
Hack s Halaal Restaurant, 5
Commerce Street, G/town. 9 am
-11 am.
URGENTLY frame builders,
joiners, upholsterers, sewing
machine operators and
handyman. Apply at Modern
Furniture at 24 Hill & James
Sts., Albouystown or Call 225-
6810.
PLANNING your wedding?
Call on the experts at Trails and
Treassures, Wedding and Gift
Shop to make your dream day a
reality. Tel # 225-6296 or visit
us at 346 East St., N/C/Burg, G/
town
ONE Domestic worker to
wash, press, clean and do
general housework. Also she
should know how to deal with
children ages 10, 11 and 17.
Working hours 7 am 3 pm.
Interested person contact Eunice
Major at Tel. # 218-4524, 645-
2979 or 628-0756.
SIX (6) dogs (Doberman &
German Shepherd), 6 mths 2
Syrs $10 $20 000 instant cash.
contact Maryann RK's Security
Services, 172 Light & Charlotte
Streets Georgetown. Tel. 226-
7 41.. ..2. 5.072. ............... ....... -
AMBITIOUS and energetic
young person to assist n Real
Estate and other office work.
Must have secondary education
and be acquainted with
computer. East Bank residents
preferred. 266-51771, 613-2286.
ONE MALE COUNTER/
DELIVERY CLERK WITH
SOUND KNOWLEDGE IN
ENGLISH AND MATHS. ONE
CLERK TO ASSISt IN
REPACKAGING AND
BOTTLING. APPLY IN PERSON
WITH WRITTEN APPLICATION
TO BACCHUS DRUG STORE, 24
SAFFON & HOWES STS. TEL.
227-0230.
BOYS TO OPERATE
BOTTLE FILLING MACHINES
AND TO WORK AS
WAREHOUSE CLERKS. MALE
& FEMALE FACTORY
WORKERS TO WORK ON
PRODUCTION LINE AND FOR
LABELLING MACHINES.
THREE (3) PRODUCTION
ASSISTANTS WITH CXC
ENGLISH AND MATHS. APPLY
IN PERSON WITH WRITTEN
APPLICATION TO: TWINS
MANUFCATURING CHEMISTS,
30 INDUSTRIAL ESTATE,
RUIMVELDT.


',SP..,RT CHRONICLCV


Brilliant Invasor wins Dubai World Cup


By Justin Palmer

DUBAI, UAE (Reuters) -
Invasor lived up to his billing
as the world's best horse by
landing the Dubai World Cup
at Nad Al Sheba yesterday.
The Breeders' Cup Classic
winner, trained by Kiaran
McLaughlin and ridden by Pana-
manian teenager Fernando Jara,
outbattled fellow American
raider Premium Tap to land the
sport's richest prize $3.6 mil-
lion.
Invasor, who has now won
11 of his 12 lifetime starts,
reeled in long-time leader Pre-
mium Tap up the long straight
to prevail by 1-3/4 lengths. Bull-
ish Luck, trained in Hong Kong,
was third.
"It's fabulous, it just
doesn't get any better than
this," said McLaughlin, who
spent 10 years as a trainer in
Dubai before returning to the
U.S. in 2003.
"Premium Tap was dig-
ging in but we got on by and
won it in the end.
"He's a special horse. If I
made a mistake or Fernando did
he would overcome it he's that
good."
Jara, 19, rode a supremely-
confident race on a course he
had experienced just once. Turn-
ing for home, and with just Pre-
mium Tap in front of him, Jara
took a look around to see the re-
mainder of the field struggling,
got lower .in the saddle and
urged Invasor to go through the
gears.
"I can't believe it. It's a
race I've wanted to win since
I was little. I knew I had a lot
of horse and he ran on very
well," said Jara.
The expected showdown
between Invasor and the
Godolphin-owned Discreet Cat
never materialised.


I ~


Please contact:


Mr. G. Wynter on 333-3154/333-6628 Or I
Mr. Clifford Stanley on 618-6538/328-23041


GX 90 MARK 11, in
good condition. Contact
339-4525 or 613-
6990.
1 NISSAN Pathfinder
(V6 EFI), automatic, fully
powered. 330 Bedford
Dump Truck, just rebuilt.
Never used. Night Hawk
motorcycle. Tel. 338-
2345.
CAR Tech Enterprise -
honest, inritegrit quality
vehicles from $.8Mup,
Corolla L-Tourinm Caldina
Carina, Corolla I2E, Hiace
minibus, Ipsum, RAV-4, CRV.
'All vehicles are imported in
top quality and low mileage.
A.W. & H 79 Corriverton
Berbice 339-3073, 615-
0960/ Anna Catherina, West
Coast Demerara 644-9552.



2-STOREY house with
large land space, corner lot at
Edinburgh, East Bank Berbice.
Tel. 265-3419, 622-3879 -
Andy.
1 -- 3-STOREYED
building, newly built in the
heart of New
Amsterdam. Price
reduced drastically. Call
333-2457, 337-2348.


OXYGEN and acetylene
industrial gases #58 Village
Corentyne, Berbice. Phone 338-
2221 & 338-2335. (David
Subnauth).


GOING business place;
30ft x 35ft. 1-secured
beautifully tiled office 30ft x 25ft.
1-3 bedroom house fully grilled
in N/A.Call 333-2500.
UPPER flat of two-storeyed
building for business purposes -
located in Coburg Street (next to
Police Headquarters). Call
Telephone # 618-6634


CIIRCUITCityintemetCafe and
Computer School, Lot 2
D'Edward Village, W/C/B. All
Internet facilities,
hotocopying, Scanning and
ax Services. Tel. # 327-5369
or 625-7189.


CHU',C, View Hotel,
Main and King Street., NA
Tel: 333-2880. Gift Flower
and Souvenir Shop, Main &
Vryheid Streets # 333.3927


Previously unbeaten and
the only horse to have been
beaten Invasor when he tri-
umphed in the UAE Derby on
World Cup night last year,
Discreet Cat proved a major
disappointment and trailed in
last of seven under Frankie
Dettori.
The Italian jockey said Dis-
creet Cat was "beaten before
the turn".
Invasor completed a hat-


Jockey Fernando Jara
celebrates victory on
Invasor.
trick of victories for American-
trained challengers on World
Cup night, following wins for
Spring At Last (Godolphin
Mile) and Kelly's Landing
(Golden Shaheen).

ASIAN SUCCESS
There was also a double
success for Asia with the conti-
nent landing two Group One
prizes.
Hong Kong-based Ven-
geance of Rain produced an im-
pressive staying performance to
land the Dubai Sheema Classic
for South African trainer David
Ferraris.
The 43-year-old Ferraris
moved to Hong Kong in 2003
after securing four champion


'Sixhead',

'Deadly'

Denny ...

(From back page)
that the only point Lewis will
get to prove is how hard he
can hit the canvas.
The champion, who re-
vealed that he was just back
from 'Vietnam' (training in the
jungle), pointed out that he had
enough time to study Lewis and
there is no way he can lose his
title.
"Sixhead can't stand
pressure. I am going to pres-
sure him from the first round.
He can give but he can't
take. I can do both. It will be
licks like peas. Between last
year and now I have become
more deadly," Dalton declared.
"It will be problems all
night for 'Sixhead'. I don't even
think that this fight will go the
distance."
The Lewis/Dalton bout is
..* ,n a card that
the feature eve card that
is being promoted by McNeal
Enterprise and I Care promo-
tions of Guyana in collaboration
with Layne Productions of Bar-
bados in the joint venture.
Two Barbadian fighters
in heavyweight Curtis
Murray and junior middle-
weight Christopher 'Shaka'
Henry will be appearing on
the card.


trainer titles in his homeland.
Japan-trained Admire
Moon showed a fine turn of
foot to land the Dubai Duty
Free under jockey Yutaka
Take.
As impressive as Invasor
was, the most eye-catching dis-
play came from Asiatic Boy
who routed his rival to win the
UAE Derby by almost 10
lengths for South African trainer
Mike de Kock.
Jockey Weichong Marwing
proclaimed Asiatic Boy as the
"best horse I have ridden" and
the bookmakers were suitably
impressed, earning a 10-1 quote
from William Hill for the Breed-
ers' Cup Classic.
The Dubai World Cup is


set to be held only twice more
at Nad Al Sheba after Dubai
Racing Club officials yester-
day announced plans for a
"new iconic horseracing city"
to be built nearby.
The course, which will be
called Meydan will take over
staging the Dubai World Cup
from 2010.
Officials said prize-money
for the showpiece race will in-
crease from $6 million to $10
million in 2010.
"We wanted to develop a
world class facility and I can-
not think of any other race-
course in the world that will
rival it," said Dubai Racing
Club chairman Saeed Al
Tayer."


(From back page)
opening batsman Lendl Simmons was preferred to bat at eight
in the order at the expense of fast bowler Jerome Taylor their
quickest bowler, thus inexplicably weakening the bowling at-
tack.
At present only ahead 9f minors Ireland and Bangladesh in the
Super Eight points standings, as compared to the Sri Lankan who
are also on two points but with a superior net run-rate and a match
less in third position, West Indies' inconsistent batting has been
most worrisome.
In five matches so far, the West Indies much-touted batting line-
up, which could be compared with any of the other participating
teams, failed to score 250 with their 241 versus Pakistan in a win-
ning cause being the highest.
Skipper Brian Lara has been the most consistent batter
despite notching up just a solitary half-century while although
Marion Samuels and wicketkeeper Denesh Ramdin also have
a fifty each under their belts along with Shivnarine
Chanderpaul, the only batsman to score a hundred, the lack
of consistency is very much prevalent.
Of growing concern too is the-poor showing of Chris Gayle
and Ramnaresh Sarwan, two batsmen who must score heavily for
West Indies to succeed.
Both Gayle and Sarwan are yet to make a fifty and there isn't
a more ideal opportunity than today for both men, coupled with
elegance of Lara, Chandertpaul and others, to warm the heart of dis-
gruntled fans.
But, coming up against a Sri Lanka attack which comprises two
world class bowlers in that of left-arm pacer Chaminda Vaas and
off-spinner Muttiah Muralitharan, backed up by the energetic 23-
year-old speedster Lasith-Malifiga, who etched his name in the
record books a few days ago by becoming the first bowler to grab a
helmet-trick in international cricket, they are likely to have their
work cut out on a track that Vaas and especially Murali may relish
bowling on.
Sri Lanka's skipper Mahela Jayawardene has made it quite clear
recently that his charges are aiming to reclaim their swashbuckling
batting approach, a move that was integral in their 1996 World Cup
triumph after losing by one run to South Africa in a nail-biter in
last Wednesday's debut international match at the Guyana National
Stadium.
Jayawardene's side definitely possesses the necessary armoury
to achieve such an objective, led by the dangerous Sanath Jayasuriya
and the likes Upul Tharanga, Chamara Silva, Kumar Sangakkara,
Tillekeratne Dilchand, Russel Arnold and Jayawardene himself.
Taylor possibly would to be reinstated into the West. Indies
starting eleven and alongside fellow Jamaican Daren Powell,
Corey Collymore, Dwayne Smith and Dwayne Bravo, coupled
with the off-spin of Gayle and Samuels, surely will have a lot
of work to do.
West Indies and Sri Lanka previously met five times before in
World Cup Cricket with West Indies triumphing on four occasions
and Sri Lanka once.
The two teams' last engagement in a World Cup was in 2003,
when Sri Lanka won by six runs in Cape Town, South Africa.
Sri Lanka went on to.reach the semi-final but lost to Australia
by 48 runs via the'D/L Method.
The action starts at 09:30 h.
Teams: West Indies Brian Lara (captain), Christopher Gayle,
.--R' amnaresh Sarwan, Dwayne Bravo,
Shivnarine Chanderpau, aresh Sarwan, Dwayne Brav
Marion Samuels, Devon Smith, Denesh Ka,,-" Dwayne Smith,
Lendl Simmons, Kieron Pollard, Ian Bradshaw, Corey ConIY..re.
Dar.n Powell and Jerome Taylor.
Sri Larit2 Mahela Jayawardene (captain), Russel Arnold,
Marvin Atapattu, e" a Bandara, Tillekeratne Dilchand,
Dilhara Fernando, Sanath Jaya"-ira, Nuwan Kulasekara,
Fai'veez Maharuif, Lasith Malinga, Mulu u"r~ itan,
Khmar Sangakkara, Chamara" Silva; Updl Thalt-;, d,-" n
Chaminda Vaas.


I ~II~_^ I___


_ __ I _e_ ______





SUNDAY CHRONICLE April 1, 2007 31


RT CHRNI0


(From page 35)
from all cricket after the
World Cup final in Barbados
on April 28, is also this
'tournament's leading wicket-
taker with 12.-
WILD SWING
Bangladesh's inexperience in
a virtual Twenty20 match was
soon evident after captain Ricky
Ponting had won the toss and
decided to field.
McGrath bowled
-Shahriar Nafees in his sec-
ond over for one to equal
Akram's mark.
In his next over Aftab
Ahmed, who had sliced
Shaun Tait for six over
third man in the meantime,
was caught by Nathan
Bracken at mid-on from a
wild swing for 11.
Mohammad Ashraful fol-
lowed for six to an equally
unproductive slog which
soared high in the air to
Pointing waiting behind the
bowler.
Bracken started the slide
when ehad Tamim qbal caught
. by Brad Hogg at deep mid-on
for three jn his second over
with the new ball.
He returned to bowl the
final over and struck again
when captain Habibul
Bashar (24) pulled him
straight to Ponting at mid-
wicket.
Gilchrist and Hayden,
who had scored two centu-
ries in his last two innings,
were quickly into their stride
with some swift running and
full-blooded drives.
Hayden struck Tapash
Baisya, playing his first
game in the tournament,
for a brutal six over long-
on. In the same over the
bowler pulled up in his
delivery, tried again to
bowl, and decided to leave
the field.
Shane Watson left the
field with a calf strain af-
ter bowling the fourth ball
of his second over in the
Bangladesh innings.


In loving and ch
dear husb
THOMCIL RAMIL
of 2083 Mathew
USA & formerly
C/ville, Georgeto
life on Mi


rI


Hp SINCERE THANKS

I The husband, children /
and other sorrowing / '
relatives of the late
BIBIBAMEENA
FAZIA RAHIM who
died on March 15,
I 2007 would like to .
express their heartfelt u -
thanks and appreciation to all those who -
I sent cards, messages, telephoned, or in
any other way offered comfort and
: support to them during their time of .,
I bereavement.
Special thanks to the staff of the
Ministry of Home Affairs and the R.O.
I 'and staff GECOM "
(Plantain Walk) Office.
p- -- -- -- -- -- y


IN MEMORIAL
perished memory of a
)and and father
.OCHAN AKA BALLA
vs Avenue, Bronx, NY ..
of 77 Garnett Street,
Iwn who departed this
62i-h 9A00nr6A


p
.:...


, LU


Sadly missed by his loving wife Chandrowtie aka Pearly,
daughters Chandradai & Sharda of the USA, brothers
Seenauth, Sugrim, Ruby, Cecil & Ivan, grandchildren
Nanda & Ryan, brothers-in-law,
Sisters-in-law and others. -


WILLIAMS: In loving memory of
our dear MICHELLE ANGELA
WILLIAMS who departed this life
on March 30, 1988.
Loving memories we will never forget
Sadly missed along life's way
With silent thought and deep regret
We think of you everyday
No longer in our life to share
But in our hearts you are always there
This day is remembered and quietly kept
No words are needed, we shall never forget A
For those we love don't go away
They walk besides us everyday
Unseen and unheard, but always near "
So loved. So missed, and so very dear.
f- Remembered by her daughter Siephanie, mother Linda, sister Sandro,
. brothers Leon. Stephen, Trevor and Lonsdale, aunts, undes, other
relatives and friends.


-7c~~u


IN MEMORIAL


NEMDHARI, VIC: In loving memory of a
dear husband and father who physically
left us on March 26, 1994.


~i1~
b


A million times I've needed you
A million time I've cried
Your helping hand was always first
To render any aid you could
Your voice was always raised in praise
Your words were wise and good
Dear Dad, since you've gone away
The ones you loved so true
Try hard to carry on the way
We know you'd want us to


Forever in our hearts
Remembered with love by your dear wife,
daughter, granddaughters and son-in-law.


. ) The wife, children, brothers and
other relatives of the late
ABDOOL MAJEED GAFOOR
sincerely thank all those kind
persons who offered words of
sympathy, attended his funeral,
sent cards and flowers and in
many other ways supported us
in our recent bereavement.


Do not stand at my grave and weep;
I am not there; I do not sleep;
I am a thousand winds that blow;
I am the diamond glint on snow;
I am the sunlight on ripened grain
I am the gentle autumn rain

When you awaken in the morning 's hish
I am the swift uplifting rush
Of quiet birds in circled flight
I am the soft stars that shine at night

!i Do not stand at nvmy gave and cruy;
I aln ;;ot theIe; I did not die /


~ -


Pli'AlCEYU







eIt I NT
^ AIiII^Iii I$
GUYANA


In loving memory of a
beloved husband, father
and grandfather
BERNARD CHOY
102 Da Silva St., Newtown,
Kitty, who departed this life
on March 30, 1999.


a~-


It has been eight years since that sad day when we said good bye
But memories of you live on and shall never die
A wonderful husband, father and grandfather has gone to rest
You were a legend and an inspiration to us, we will always love you
Our love for you will never die, treasured memories keep you near
As time unfolds another year. You will remain deep in our hearts
Till memory fades and life departs. When family ties are broken and our
loved one has to part, it leaves a wound
that never heals deep within our hearts.

May God grant him eternal rest.

-Always remembered and forever loved by his loving wife,
children, daughters-in-law, sons-in-law, grandchildren, other
relatives and friends.


Tree of Life
Each leaf must fail'
The green, the gold, the great, the small
Each one in God's own time, He'll call
With perfect love, He gathers all
For everything there is a season
And a time for every matter under heaven
And all that remains is in a memory too beautiful


Lt-::::Im


a


IarcI1 I LU, LUUU.


,n~i


IT







SUNMDAYCHIONICLE Aon 1.2007


,7Er RT CHRONICt



Angry Inzamam dismisses



match-fixing allegations


By Waheed Khan

LAHORE, Pakistan (Reuters)
- Pakistan's World Cup cap-
tain, Inzamam-ul-Haq yester-
day angrily dismissed
rumours that his players
might have deliberately lost
theiri.natches to the West
Indies and Ireland and this
had led to the death of coach
Bob Woolmer.
An emotionally charged
Inzamam told a crowded
news conference, his first
since returning home after a
dismal show in the World
Cup, that some people and
the media had made it a habit
to malign the players and
make wild accusations after a
poor performance.
Pakistan's World Cup
campaign ended in tragedy
with coach Woolmer's murder
the day after the defeat by


By Mitch Phillips

LONDON, England (Reuters)
- Striker Salomon Kalou
headed a stoppage-time goal
to give Chelsea a dramatic 1-
0 win at Watford yesterday
that cut Manchester United's
lead back to six points and
kept the Premier League title
race alive.
With the regulation 90 min-
utes played at Vicarage Road,
the championship looked des-
tined for Old Trafford as United
had earlier roared back from a
goal down with half an hour left
to crush Blackburn Rovers 4-1.
But Chelsea, winners of the
last two titles, had Ivorian sub-
stitute Kalou to thank for a
strike in the second minute of
stoppage time that gave th,'
Londoners 72 points to
United's 78. with seven matches
left to play.
In yesterday's opening
game, Peter Crouch scored a
hat-trick as Liverpool beat
Arsenal 4-1 at Anfield to leap-
frog the Gunners into third
place on 57 points.
Down at the bottom,
Sheffield United are only one


Ireland. Angry fans burnt ef-
figies of Inzamam and other


INZAMAM-UL-HAQ
players and held mock buri-
als.
"These match-fixing alle-


point above the drop zone af-
ter losing 1-0 at Bolton Wander-
ers and Charlton Athletic beat
Wigan Athletic 1-0.
West Ham United defeated
Middlesbrough 2-0 while
Manchester City edged towards
safety with a 1-0 triumph at
Newcastle United. A last-minute
goal by lan Pearce earned
Fulham a 1-1 draw with Ports-
mouth.
Chelsea rounded off a
pulsating day of action with
a fine goal, Kalou meeting
Andriy Shevchenko's cross
with a well-placed header, and
a priceless win.
Manager Jose Mourinho
threw on extra attacking play-
ers in a desperate bid to break
the deadlock but Chelsea lacked
their usual fluency and struggled
to create clear-cut chances. \
Ivorian striker Didier
Drogba was denied by Watford
keeper Ben Foster, on loan from
Manchester United, in the first
half and Germany midfielder
Michael Ballack missed a great
chance in the second.
Asked if his team were two
minutes from handing the title
to United, Mourinho told Sky


IN


WILFORD V. LIM aka SUNNY LIM
Sunset MIrch 31, 2004
You fell asleep without saying good bye
But the memories of you will never die
We never lose the ones we love
For even though they're gone
Within the hearts of those who care your
.orv lingers on
No one else can truly feel trWe ;C.rrow that we bear
At may it help somehow today to knoiw that ';T care


I
I'


.I .ssed c yce; c.._ .' sons-in-!aw.
daughters-ir-Aaw. grand children, great granc
i ',ldren. gre r n-law. grand daughters-in-
brothers, Drothrs-,-la',,. sisters-in-la'
'*; aIleces. :,.,i ews other relatives and friends
Rest in Peace fully in God's C;a.c


nations are only rumours ...,
I have been captain for the
last three years and no one
said anything like this be-
fore," Inzamam said.
"When we were winning no
one said there was match-fixing
or there was disunity in the
team. No one said I run a one-
man show in the team."
He added: "I can tell you
this much. We are all terri-
bly disappointed at letting
the nation down and I again
apologise for that. But the
way the media has written
muck about me and the play-
ers it seems we are not Paki-
stanis. Do they realise the
hurt and anguish they are
causing to our families."
Inzamam has announced his
retirement from one-day
internationals and relinquished
the captaincy but said if the se-
lectors gave him a chance he


Sports: "I thiik so. Mathemati-
cally no, because there are still
21 points to play for, but if you
go eight points (behind) it's
much more difficult.
"It was a crucial goal, a
crucial victory. We are there
..


DIDIER DROGBA


still."
United deservedly trailed to
a 29th-minute Matt Derbyshire
goal but second-half strikes by
Paul Scholes, Michael Carrick,
Park Ji-sung and Ole Gunnar
Solskjaer secured a seventh suc-
cessive league win.
Nemanja Vidic will be out
for at least four weeks after suf-
fering a serious shoulder injury.
The long delay in treating the
centre back seemed to affect
United's concentration as poor
defending of a cross allowed
Derbyshire to knock in a loose
ball.

FANTASTIC SUPPORT
United were transformed
after the break and SchoIes
showed his class to level after
61 minutes, bursting past two
defenders before calmly beating
keeper Brad Friedel.
-? an Giggs then somehow
hit the bar in Irobt of an open
goal but Carrick spatcd Uniicd's
blushes when he Iired in the sec-
o t
Park tapped in the third
,,'ti' h I. outti,,,s froii tn a_' ai'-


was willing to play Test
matches.
"Because I think age is
no barrier in Pakistan cricket
and I can contribute to the
team. We have some fine
players and I am very opti-
mistic about the future."
Inzamam said the players
were devastated at the death of
Woolmer and insisted they were
as keen as anyone else to find
out what had happened with
him.
"If the investigators want
to question us again we are
willing to go again but the
board has said with legal ad-
visers."
He added: "We were not
the only ones treated as sus-
pects by Jamaican investiga-
tors and I have no experience
of how such cases are
handled. But they asked only
routine questions."


ter Friedel failed to hold a
Cristiano Ronaldo shot and
substitute Solskjaer com-
pleted the comeback.
"The great thing we showed
was the composure to not lose
our heads, keep our nerve and
keep on playing and by doing
that we kept on making chances
in the second half," United man-
ager Alex Ferguson told Sky
Sports.
"The intensity of our game
was absolutely fantastic but so
was the support that probably
put us over the line today."
'Liverpool never looked
back against Arsenal after
Crouch clipped in a near-post
effort in the fourth minute.
He headed his second late in
the first half and rounded off
the scoring nine minutes from
time for his first Liverpool hat-
trick.
Liverpool are two points
ahead of Arsenal, who have a
game in hand. Both look des-
tined for the Champions
League qualifying spots de-
spite fifth-placed Bolton mov-
ing to 50 points.


London detectives


to help with

Woolmer probe
By Adrian Croft

LONDON, England (Reuters) London police will send
leading detectives to Jamaica next week to review progress
in the investigation into the murder of Pakistan cricket
coach Bob Woolmer, they said yesterday.
Police in the British capital said they had received a request
from Jamaican authorities to send a small team of detectives to
re% iew the Woolmer investigation.
"A leam of four three deiectn es and one scenes-of-cnme
officer will arnve in Jamaica next week." they said in a state-
meni.
The team will be led by a detective superintendent
from Scotland Yard's Homi-
cide and Serious Crime
Command.
A chambermaid found
Woolmer. 58, unconscious in
his hotel room in Kingston on
March 18. shornlv after Paki-
,tan were ousted from the
Cricket World Cup after losing
to debutants Ireland.
A doctor failed to resusci-
tale him and he was pro-
nounced dead at a hospital.
Four days later. in an
announcement that stunned
the cricket world, police said
WVoolmer had been BOB WOOLMER
strangled.
London police said it was normal practice for a review to
take place soon after the start of an investigation and said Ja-
maican police remained.the main investigating force.

NO CLEAR SUSPECTS
Police ha e said there are no clear suspects in the case.
Jamaica deputy police commissioner Mark Shields. the
Brmish former Scotland Yard officer heading the Woolmer
investigation, has said frequently that he would have no
qualms asking for help from foreign police agencies if
needed.
The mystery stirred speculation that angry fans,
disgruntled players, gamblers or match-fixers were
involved.
Police said this week the killer's trail had-not gone cold but
they have revealed few leads. Closed circuit television from the
hotel is being exiimined and forensic tests on evidence from the
room have.not been completed.
A memorial service for the former England player will
be held in Cape Town on Wednesday, the Bob Woolmer
Trust Fund said on Friday. Woolmer was a coach of the
South African national team and lived in Cape Town for
more than 20 years.
His body is being held by Jamaican authorities pending an
inquest, the date of which has not been announced.
The seven-week World Cup culminates in the final on
April 28 in Barbados.


IOC to hold Austrian doping

hearings this week


ATHENS, Greece (Reuters) -
The International Olympic
Committee (IOC) will hold
two days of hearings this
week on an Austrian doping
affair that shook last year's
Winter Olympics.
The IOC's disciplinary
commission will meet on April
4-5 to hear the case of the Aus-
trian biathlon and cross-country
skiers, who were suspected of
dopin' and their premises were
raided by ltli;hn police and
tcstes during Ic Turin U(jnmees.
''s wilM ble


held on April 4. and 5 in
Lausanne," j !OC official
told Reuters.
The IOC had said in Febru-
ary the hearings had been de-
layed pending the report by Ital-
ian authorities but would be
held by mid-April.
A banned skiing coach's
presence at the athletes'
headquarters during the
Turin Games triggered a
night-time raid by the Italian
police and doping testers.
The coach. Waler Mayver.
fled ihc scene and crashed his car


into a police roadblock across
the border in Austria before be-
ing briefly admitted to a psy-
chiatric Clinic.
Ten athletes w ci tested on
the night of the raids for pos-
sible doping, but were all found.
to be clean.
The IOC has said the
case, which seriously em-
barrassed the Austrian
Olympic team and commit-
tee. would have no effect on
the Austrian city of
SaJzburig ,d diig' ,t. hI
the 20 14 Winter ;a'c'es.


EIast-gap Kaloukeeps Celsea tile hope alive


-


ia~i


I"


":'


---7






SUNDAY CHRONICLEApril. 1, 2007. 33


-'-


~i; ~


Windies losing sight of the




prize it is now 'Do or Die!'


By Colin E. Croft
Former West Indies fast
bowler

AFTER the opening salvoes
of the Super 8 round of the
CWC 2007, the smoke is now
clearing.
More vision is available and
the picture now shows that the
West Indies cricket team is
struggling to make the semi-fi-
nals of the CWC 2007.
If it were just for the wishes
and hopes of the seven million
people of the Caribbean and its


DWAYNE BRAVO

Diaspora, perhaps they would
continue on and even win the
CWC 2007, but words and
wishes are wind!
The truth be told, the
West Indies seemed to have
somehow lost the plot. They
looked particularly down, list-
less and hapless against New
Zealand.
All West Indians now hope
that they win this all-important
Super 8 game; v Sri Lanka. We
can only hope that, somehow,
they pick themselves up for
this important game. They have
no real choice.
Against New Zealand, they
looked like a team that was not
prepared, in every aspect, for
the game.
The team selection was fu-
tile, the batting was basically
superfluous, the bowling was
sporadic and the fielding as bad
as I have seen it at this level and,
so far, in this competition.
I do not know what Coach
Bennett King and his team
are aiming to produce, but
the entire team is simply pro-
ducing wonderful "hot-and-
cold" mediocrity.
There has been a call to
arms for supporters to come out
in -their numbers to support the
team against Sri Lanka and for
the rest of the games, with the
less than impressive turnouts so
far to the games.
With the astronomical
prices to attend the games; the
cheapest ticket in Guyana is
US$25, almost a fortnight's
wage for the average worker;
even the most ardent supporter
needs something to justify his/
her sometimes 100% sacrifice,
just for the sake of West Indies
cricket.
Except for the game
against Pakistan, the first of
the competition; that seems
so far in the distant past now;
the West Indies have become
poorer and poorer by the
game. No crowd could help
the players. They must help


themselves.
In the game against New
Zealand, the West Indies elected
to go with, supposedly, a long
batting line-up, including open-
ing batsman Lendl Simmons, in
for the fast bowler Jerome Tay-
lor.
One of the batting all-
rounders, Dwayne Smith, actu-
ally batted at No. 9. This was
the most stupid mistake, and
that was quite evident when the
team only amassed 177 in much
less than 50 overs, the team's
lowest scote to date, in the com-
petition.
To make things worse, the
West Indies only faced 44.4
overs, another cardinal sin in
one-day cricket. At the very
least, a team batting first should
face the full allotment of.50
overs.
The fault must'lie with
the West Indies batting line-
up and its productions.
Throughout the entire com-
petition so far, the batsmen
have flattered to deceive;
seeming to struggle.
Against Pakistan in the first
game of the competition, the
West Indies amassed only 241
from their allotted 50 overs.
The batting contributions
are as follows: Chris Gayle 2;
Shivnarine Chanderpaul 19;
Ramnaresh Sarwan 49; Marion
Samuels 63; Brian Lara 37;
Dwayne Bravo 16; Dwayne
Smith 32; as the West Indies
made 241-9 from their 50 overs.
Had it not been for the best
bowling and fielding that I have
seen from the West Indies team
in a very long time, the Paki-
stanis probably would have
won easily.
Against Zimbabwe, Chris
Gayle made 40, Shiv
Chanderpaul 21,


DWAYNE SMITH
Ranmnaresh Sarwan 12,
Marion Samuels 28, Brian
Lara 44 not out and Dwayne
Bravo made 22 not out, as the
West Indies made the re-
quired 204-4, in 47.5 overs, to
win by 6 wickets, with 13
balls to spare. This batting
'display was not particularly
convincing either.
Set to make 190 from 48
overs in the Duckworth/Lewis
calculations, the West Indies
made it from 38.1 overs, having
lost only two wickets. Chris
Gayle again failed 18, while his
opening partner Shivnarine
Chanderpaul made 102, the
team's first, and to date, only
hundred of the tournament. At
least, they seemed to have been
improving.


Then, came the two games
in the Super 8 against Aus-
tralia and New Zealand, the
games before the fatal and
almost decisive game against
Sri Lanka today.
In the West Indies first Su-
per -8 game, the opposition,
Australia, made an imposing
322. In reply, the West Indies
managed. only 219, with Chris
Gayle 2, Shivnarine
Chanderpaul 5, Ramnaresh
Sarwan 29, Marion Samuels 4,
Brian Lara 77, Dwayne Bravo
9 and Dwayne Smith 9. Had it
not been for the rejuvenated
Denesh Ramdin, who made 52,
the West Indies would have

I ..L o.. I


MUTTIAH MURALITHARAN
been beaten worse than the 103-
run margin.
Worse was to come.
By eliminating fast
bowler Jerome Taylor and in-
cluding opening batsman
Lendl Simmons, the West
Indies supposedly strength-
ened the batting line-up. This
still did not work, as they
made that paltry 177 all out,
in only 44.4 overs.
Gayle made 44,
Chanderpaul made 4, Sarwan
19, Samuels 9, Lara 37, Bravo
18, Ramdin 15, Simmons 14 not
out and Smith 8. New Zealand
won at a canter, posting the re-
quired runs and ending at 179,
with only three wickets down,
and in only 39.2 overs.
I do not know about you,
but most of these scores have
been 'BINGO' numbers", with
not many '0' numbers 'featur-
ing. except for Chanderpaul's
century.
The West Indies' batting
has been extremely poor to
date. No-one, perhaps except
Lara and Chanderpaul, notably
the most experienced of the
players, seemed either prepared
or ready to accept the respon-
sibilities.
To be honest, both
Dwayne Bravo and Dwayne
Smith should be dropped.
Unfortunately, the replace-
ments, wherever they are,
might be just as poor!
If the West Indies are to
qualify for the semi-finals, they
must beat all of the remaining
teams that they play in the Su-
per 8 Sri Lanka, South Africa,
Bangladesh and England. Even
without the pressures of having
lost the first two games to Aus-
tralia and New Zealand, this
would have been a difficult task,
even if all of the batsmen had
been batting well. The West In-
dian bowlers have simply not
had enough cushions to work
with.


Australia have looked tre-
mendously tough and ready to
defend their championship. I
doubt that there is anyone any-
where, not even in the Carib-
bean, who would not name
them for the final in Barbados.
The form batsman has been
Matthew Hayden, but Michael
Clarke and skipper Ricky
Ponting have also threatened to
blast the opponents.
Their bowling has come
to the fore too, with espe-
cially Brad Hogg being a rev-
elation on the slippery, low
and slow pitches that are
evolving as the competition
progresses.
New Zealand are doing their
normal efficiency, despite the
loss of key players. The captain,
Steven Fleming, just seems able
to absorb adversity, to carry on
regardless. Shane Bond is their
best bowler, and, to date, the
best of the competition, with his
great pace, accuracy, compo-
sure, wicket production and
frugality.
New Zealand are getting
better as the competition
moves along and are a good
bet for at least the semi-fi-
nals.
Sri Lanka may have had a
blip on their radars when they
just missed out, by the thick-
ness of a coat of paint, on beat-
ing South Africa a few days
ago, as the great slinger Lasith
Malinga's fifth wicket-taking
delivery in a row just missed
Robbie Petersen's off stump.
Malinga aside, there are so many
good, even great players on the
Sri Lankan team. Sanath
Jayasliriya has already had a
century, while Upal Tharanga,
Tillekeratne Dilshan, Russel
Arnold, Muttiah Muralitharan,
Chaminda Vaas and Dilharo
Fernando have all done excel-
lently.
It would be a very brave
person who would bet against
the fiery Sri Lankans not mak-
ing the semi-finals. If they play
to potential, they can go all the
way!
South Africa may be rated
No. 1 in the world, but they did
not look like that when they


LASITH MALINGA


were losing wicket after wicket
to Sri Lanka, as they seemed to
again wilt under pressure. They
did win, but it was not convinc-
ing at all.
The Proteas might be
bull-headed, aggressive and
abrasive, but captain Graeme
Smith and the even reliable
Jacques Kallis, as batsmen,


along with bowlers Makhaya
Ntini, Charl Langeveldt and
Andrew Hall will have to hold
more than their own to allow
South Africa to get to the
semi-finals and finals. They
can do it, but an entirely
100% effort would be needed
by the team!
I have said that both Ireland
and Bangladesh should create
upsets, and that possibility is
left to be seen, but England did
manage to wobble to their first
win; against the Irish. Michael
Vaughan, the English captain,
should really be dropped, so
out-of-form he seems. He does
seem, though, to have regained
his off-spinning ability, so there
probably would be uses for him
on the slower pitches, as there
would be for the improved


By Steve Keating

MIAMI, Florida (Reuters) -
Serena Williams fought off
two match points on her way
to an epic 0-6, 7-5, 6-3 come-
back win over world number
one Justine Henin to claim
,


her fourth Sony Ericsson
Open tennis title yesterday.
"It's just not in me to give up,
I just keep fighting," said Williams.
"I feel when I get down a part of
me plays better. I think all champi-
ons have that, when they get down
you can't hold them down.
"When I was down 5-01 kept
saying, come on. Even though I was
down, I never was out.
"I kept fighting, it was im-
portant not to surrender.
"I never threw up the white
flag," she told reporters.
Brushed aside in 26 min-
utes in the opening set and
broken by the Belgian to start
the second, Williams's title
hopes had appeared over.
But the muscular American,
backed by a vocal home crowd
at Crandon Park, gathered her
reserves and clawed her way
back into the contest, finally
gaining control after fending off
two match points with Henin
serving at 5-4 in the second set.
With the momentum and
crowd now firmly in her corner,
a ruthless Williams moved in for
the kill sweeping through the
next six games to take a 3-0 lead
in the third set, closing out the
two-hour 26-minute match with
a service winner on her first


Monty Panesar.
Andrew Flintoff, despite
all of his shenanigans, is still
England's talisman and Paul
Collingwood, on present
form, the team's best all-
around cricketer. England
does have an outside chance
to get to the semi-finals, but
it would be tough if they do
not improve.
This week, starting with this
game today featuring the West
Indies and Sri Lanka, would tell
its own story.
I hope, evqn expect, that we
could have a 600-run game to
appease the capacity crowd at
the new Guyana National Sta-
dium. I hopehiat they will not
be disappointed. Whatever hap-
pens, the fireworks are just
about to start. Hang on!


match point.
"I had many chances, many
opportunities," Henin told re-
porters. "Serena is a fighter, she
never gives up. It is tough to
close the matches against her
'because she goes for it.
"She's a champion and that
makes the difference from other
players."

RENEWED RIVALRY
It was the ninth meeting be-
tween the two but their first
since the Wimbledon semi-finals
nearly four years and the pas-
sage of time has done nothing to
dull their great rivalry.
Although Williams is ranked
18th, the final featured the WTA
Tour's two hottest players with
both women coming into the
showdown having lost just one
match this season.
Henin arrived at .the
championship contest riding
a 13-match unbeaten streak
including back-to-back titles
in Dubai and Doha while
Williams, playing her first
event since lifting her eighth
grand slam title at the Aus-
tralian Open, brought a 12-
match unbeaten run onto
Stadium court.
Ranked 95 at the start of
the year, Williams will move up
to number 11 tomorrow.
But to many who wit-
nessed her performances in
Melbourne and Miami, the 25-
year-old American has already
embarked on another reign as
the top player in women's ten-
nis having won the two biggest
titles of the year so far.
On the way to her 28th ca-
reer title, Williams dropped just
one set recording wins over
- world number one Henin and
Maria Sharapova, who held the
top spot before surrendering it
to the Belgian last week.
"I can only go up. I have no
points to defend until Cincin-
nati, I have nothing to lose," said
Williams, who will start her
clay-court preparations in two
weeks at the Family Cirde Cup
in Charleston.
"I'm playing with a no-
lose attitude and it's fun. I'm
not-going to stop here."


&~ .-~,
'a,,


Willim fiht back toM


wfin fouth iam i il







-34 .. -- ... ..- .." -"-- ::.; ; ::.:: .. ,., :" ; .;;; ;;';; :,;'; ;Y;- :.;.- -"YCHRONICLEt-F,:i; 2007


jPP T cSRT CHRONICLE


Phelps makes it six

out of six, eyes history


By Julian Linden

MELBOURNE, Australia
(Reuters) .Michael Phelps,
won a record-equalling sixth
gold medal at the world swim-
ming championships yester-
day to remain on course for
his historic bid to win eight
titles.
After a day when great
Australian lan Thorpe's name
was dragged into a drugs con-
troversy, the 21-year-old
Phelps beat his American team
mate Ian Crocker in a frantic
finish to win the 100 metres
butterfly final in 50.77 seconds.
Phelps put himself within
reach of the once-unimaginable
feat of winning eight gold med-
als at a single championships.
The only othfeman to win
six titles at a single world cham-
pionships was Thorpe, at
Fukuoka, Japan, in 2001.'
American Mark Spitz won
seven gold medals at the 1972
Munich Olympics.
It emerged yesterday that
Thorpe is being investigated
after a test last May returned
irregular levels of naturally-
occurring hormones.
But the .Australian Sports
Anti-Doping Authority said
there was no evidence to sug-
gest any doping offence.
Thorpe, who retired late last
year, will hold a news confer-
ence today.
The story may have cast a
shadow over yesterday's action
in the pool but Phelps is now
an overwhelming favourite to
complete his quest for eight
gold on today's final night of
competition by winning the 400
.individual medley and helping
the U.S. win the 4xl00 medley
relay.
"Honestly I thought I'd
botched the finish, I didn't
think the finish was very good.
but it ended up being good
enough," Phelps told reporters
after his latest success.

HARD DAY
"So far we're six for six and
we're definitely headed where
we want to go. But today's a
hard day I've got to be ready
to get up and get in the finals
and then have two solid races."
The 100 butterfly was al-
ways regarded as Phelps's
most difficult race with
Crocker having won the past
two world titles and holding
the world record.
Crocker led the race virtu-
ally throughout and looked the
likely winner as they ap-
proached the finish but, just as
he did at the 2004 Athens
Olympics, he mistimed his
lunge and had to take one last
stroke, allowing Phelps to get
his hands on the wall first.
Crocker had to settle for
the silver in 50.82 with Albert
Subirats of Venezuela grab-
bing the bronze in 51.82.


Libby Lenton enhanced her
claims as the outstanding female
swimmer of the championships
by anchoring Australia to a
world record in the 4x100 med-
ley relay to collect her fourth
gold medal.
Lenton teamed up with 14-
year-old backstroker Emily
Seebohm. breaststroke world
record holder Leisel Jones and
200 butterfly champion Jessicah
Schipper to win in 3:55.74, slic-
ing 0.56 off the mark Australia
set at last year's Common-
wealth Games in Melbourne.

ANOTHER DOUBLE
American teenager Kate
Ziegler beat Laure Manaudou of
France in a last-lap sprint to win
the women's 800 freestyle final
and complete the long-distance
double for the second time.
The 18-year-old Ziegler,
1500m winner on Tuesday,
trailed Manaudou when the pair
turned for home but surged past
her in"the last couple of strokes
to win in 8:18.52.







.
(gr -


MICHMAL PMtLPIS


The victory denied
Manaudou the chance to be-
come the first woman to win the
200-400-800 treble at the same
championship.
The U.S. won four of the
six finals yesterday to extend
their lead at the top of the
medal standings where they
have 18 gold in all.
Margaret Hoelzer upset
Zimbabwe's world and Olympic
champion Kirsty Coventry to
win the women's 200 back-
stroke final in 2:07.16, breaking
the championship record set by
China's He Cihong in Rome in
1994.
Ben Wildman-Tobriner led
an American one-two in the
men's 50 freestyle sprint, slasfh-
ing a quarter of a second offt his
personal best to win in 21.88
just in front of Cullen Jones.
Sweden's Therese
Alshammar broke through ,to
win the women's 50 butterfly
in 25.91 and capture her first.
world title in her fifth appear-
ance at the championships,
edging out Australia's defend-
ing champion Danni Miatke
and Inge Dekker of the Neth-
erlands.


West Indies lose the plot


By Paresh Soni
BBC Sport in Antigua

WEST Indies began the
World Cup with the dream of
becoming the first side to win
the trophy on home soil.
But the team were far from
convincing in their first round
gioup games and began the Su-
per 8 with defeats on successive
days against Au,,tralia and New
Zealand. Now they appear in
real danger of failing to qualify
for the semi-finals unless they
can lift their performances.
So what are the reasons for
their struggles'? BBC Sport
sought the opinion of respected
cricket writer Tony Becca of the
Jamaica Gleaner, who has been
covering the sport for 34 years.

WHAT'S WRONG
WITH THE BATTING?
Tony Becca: "We believe in
what is termed talent but as
we've seen with this current


crop of players, they play one
or two lovely cover drives and
are then back in the pavilion -
they are simply not disciplined
enough.
"These batsmen are the best
in the West Indies and play the
same way in club cricket. They
score the same number of runs;
there and in first-class cricket
and carry it over when they
play in the West Indies team.
Their attitude is terrible."

IS THE BALANCE OF
THE TEAM RIGHT?
TB: "They played an extra
batsman against New Zealand
and that is something I cannot
understand or support.
"I believe we should play
five or six batsman, a
wicketkeeper and four bowlers.
Of course there is a place for
good all-rounders but you can-
not go into a cricket match you
need to win thinking you can re-
strict or dismiss the opposition


with two main bowlers.
"Chris Gayle and Marion
Samuels hardly bowled for Jamaica
and are not selected for them to
bowl. And almost all the other
teams in the World Cup play with
four main bowlers and look for 10
overs from the others.
"We're looking for 30 overs
from makeshift bowlers and you
cannot play cricket like that. So
if you don't make 350 you've
virtually lost."

IS BRIAN LARA'S
CAPTAINCY A PROBLEM?
TB: "He baffles me. I know
why they keep Dwayne Smith
in the team to explore his po-
tential to win a game with the
bat, although he has never done
that.
"In the Pakistan game he hit 32
off 15 balls and took 3-36 but he
has barely bowled since and is still
in the team batting low down.
"But whatever Lara wants
Lara gets. I don't.think coach


S I I I I I -- I I I I L


By Lawrence Booth

WHEN Wisden Cricketers'
Almanack invited 100 ex-
perts around the world to
vote for their five top players
of the 20th century, a few
grumbled that two names
were shoo-ins: Don Bradman
and Sir Garfield Sobers.
Because if Bradman is the
greatest batsman of all-time, Sobers
remains peerless as an all-rounder:
8 032 Test runs at an average of
nearly 58, a total of 235 wickets
taken with a mixture of left-arm
seam bowling plus two types of
spin orthodox and wrist and a
close-catching ability second to few
if any. The only wonder was that
10 members of the Wisden panel
failed to nominate him.

ACHIEVEMENTS
Where do you start? With his
maiden Test century at Kingston
against Pakistan in 1957-58 which
turned into an undefeated 365 and
stood as a world record for 36
years'? With the six sixes he hit in
an over off Malcolm Nash for
Nottinghamshire against
Glamorgan at Swansea in 1968?
With his knighthood for his ser-
vices to the game in 1975? Or the
remarkable state that the 10 batsmen
with at the time of writing higher
Test averages than Sobers took only
half as many wickets (124) be-
tween them as he did by himself?
The options seem endless.

WHAT MAKES
HIM SPECIAL
To call Sobers Mr Adaptable
might sound like damnation with
faint praise, but here was a master
of all trades and a jack of none. His
versatility with the ball in particu-
lar led opponents to complain that
any team containing Sobers was
made up of 13 men. Yet for all that
it was his batting which allowed his
God-given talents to shine most
brightly. He was not merely a left-


handed stylist and an incorrigible
cavalier, but he made big scores too:
11 of his 26 Test hundreds were in-
nings of 150 or more. He could also
defend. At Lord's in 1966 he bat-
ted for 5V2 hours, most of them with
his cousin David Holford, to save
the Test. Nothing felt beyond hinm.

FINEST HOUR
It might not have been a Test
match, but with Sobers nearing
the end of his career against a
backdrop of personal problems,
a young Dennis Lillee desperate
to prove himself and Bradman
among the spectators, -the game
between Australia and the Rest
of the World at Melbourne in
January 1972 contained pres-
sures enough. After falling to
Lillee for a first-innings duck,
the 35-year-old Sobers re-
sponded with a scintillating 254
in the second. Said Bradman:
"Having seen all the players of
the last 50 years, I believe that
Sobers' was the greatest exhibi-
tion of batting seen in Austra-
lia. I have seen nothing equal to
it in this country."

ACHILLES HEEL





.- . .


.,..: : .- /ti, i~ '








Garfield Sobers returns
after his epic 254 against
Rest of the World.


Hard to believe, but his
bowling in the early days lacked
bite, and after 30 Tests he had
picked up just 31 wickets at an
average of nearly 50. As for
gaffes, few in Trinidad ever
quite forgave him for setting En-
gland 215 to win in 2 hours.
West Indies lost that game by
seven wickets and with three min-
utes to spare, before going on to lose
the series 1-0. Sobers later said that
"team-mates who denied all knowl-
edge of the decision were strangers
to the truth". If his overall cap-
taincy record (nine wins and 10 de-
feats in 39 Tests) was ordinary,
then it probably said as much about
the talent at his disposal at the time
as it did about his leadership skills.

HOW HISTORY
VIEWS HIM
As post-war cricket's second
great all-rounder after Keith Miller
and a precursor to the 1980s quar-
tet of lan Botham, Richard Hadlee,
Imran Khan and Kapil Dev. Never
were his all-round skills better dis-
played than during the series be-
tween England and the Rest of the
World in 1970, when he scored 588
runs at 73 and took 21 wickets,
more than anyone on either side.
Today, his name is synonymous-
with a brand of devil-may-care ad-
venture that few have ever been
able to match.

LIFE AFTER CRICKET
A long-running feud with Sir
Clyde Walcott meant that Sobers'
expertise was not used by West
Indies until he was appointed as
technical consultant to the coadh
Bennett King in 2004.
Until then he was a pun-
dit and an unofficial roving
* ambassador for the sport, but
in 2004 he was honoured by
the ICC who decided to name
their new annual Player-of-
the-Year Trophy after him.
The first winner was Rahul
Dravid. (Cricinfo)


| 4


BRIAN LARA
Bennett King has much of a'say
in the selection of the team."

IS BEING HOSTS
THE PROBLEM?
TB; "No, I don't think that
has had any effect. The reason
the home team has not won this
competition before is because
the hosts were never the best
team.
"South Africa had the best
chance in 2003 but they blew it
and here the West Indies were
not among the top four
favourites."

CAN THEY STILL
QUALIFY FOR THE
SEMI-FINALS?
TB: "No-one that is close
to West Indies cricket and is a
patriot is surprised by what is
happening here.
"Their chances of qualifying
were tight from the beginning
with Australia. New Zealand.
South Africa and Sri Lanka in
there but it's even tougher now
they have lost two games.
"Apart from the Pakistan
game in Jamaica the crowds have
been terrible, so the tournament
will not lose much even if they
fail to qualify, but it will be ter-
rible for the competition if the
home team does not make it."

WHAT DOES THE
FUTURE HOLD?
TB: "Cricket in this region
is very weak from the top right
down to the bottom, and a lot
of work needs to be done to
build it up back to where it was
20 years ago.
"People say it. is because we
don't have as many young boys
playing the game as they used
to. Certainly soccer has devel-
oped rapidly in the Caribbean
but the issue is dedication not
numbers.
"When I look at boys in our
society, they are not as focused
as girls in sport, school or the
workplace. They don't train as
hard as they used to 15, 20, 30
or 40 years ago and are suffer-
ing because of that
"As for Lara, he will go on
the tour of England because the
West Indies Cricket Board
(WICB) will not want people to
believe he was sacked because-
they failed in the World Cup.
"But that trip will be the
end of his tenure."


HEALTH TIPS


CRICKET
LOVELY
CRICKET!


M E |DIC A T IO 1 Remember to take with you to the game any medication you usually
ME D I CAi I take during the day, and take these as you normally would.


U Should you lose your medication while in Guyana, check with the

A message from the Ministry of Health nearest health care provider. Most medications are available at
supported by CARICOM & PAHO local pharmacies.


2 1 4 a 'I


........


IZS1I





SUNDAY CHRONICLE April 1, 2007


By Isaiah Chappelle

WEST Indies captain Brian
Lara's batting position was
down for review as the team
crafted a strategy for today's
crucial Cricket World Cup
Super Eight match against
Sri Lanka at the Providence
stadium.
Lara made the disclosure,
yesterday, in a pre-match media
conference at the stadium, re-
sponding to a question about his
batting at number five in the or-
der, contrary to the norm that
the best batsman goes in at
number three, especially when
the team was in trouble.
"That will be under.review
and discussion after the practice
session."
The captain acknowledged
that the team had not passed
250 runs, even when an extra
batsman was used in the last
match against Australia in which
they scored their lowest total.
Lara said these and other
situations were discussed at
"a couple" of meetings,
which he described as "good".
'There was a lot of food for
thought."
He said that the West Indies
was not playing smart cricket,


as against not being aggressive.
The captain contended that
the team's bowling and fielding'
were still 90 percent good.
"I feel it's our batting. We


did not go out and really domi-
nate."
Lara pointed out that the
team had won three of five en-
-counters, but declared that. they
could not afford to lose any-
more.
He was optimistic about
*his chances against the Sri
Lanka side, pointing out that
.their bowling performance
was good towards the end
against South Africa, but
their batting was not so good.
He said that every CWC


JG4 tta fotb i._a1;ibent

S in Baititd today
LAZIO will attack Wolves in the opening game of the -I'
Movement Promotions inaugural Regatta Football tourna-
ment which kicks off today at &be Bartica Community Cen-
tre ground.
-The knockoi competition
will see st reams clashing for the
first prize of $100 0o)0 Head of
T'1 Movement Promolions. I
Salam. aid that Parhliamentar.
Secretary )in the MNinkir of
Culture. Youth and Sport. Srete
Ninvalle. has accepted an in ina-
lion to declare the competition
open.
The promoter said that
Ninvalle will also deliver the
feature address and check on
STEVE NINVALLE the development of football in


Bartica while there.
Included in today 's double-header is a feature match be-
mteen Beacons of Barica and GF of Georgetow n Thai match
begins at 09-00 h. The other participating teams are Rainbno
United of Mahdia and Uprising of Georgetokwn
The team winning the tournament will also receive a set o(t
uniforms while second position is oronh $50 00l" and a -el ot
uniforms.
The competition concludes on April 5 and is being
sponsored by Modern Hotel, Neighbourhood Pharmac}.
Royo Fraser Mining Company, Double Platinum Inc. and
Steie's Construction.


match was important and he
said the players were still up-
beat and eager to go out and win
because while people might not
be in the stadia, they were at
home watching.
Lara contended that all
pitches in the Caribbean had a
certain characteristic and the one
at the Providence stadium
looked like Bourda's.
He said that pitches tend
to be better as the day
progresses and there was
something in the first ten
overs.
Asked about the seemingly
erratic way in which Dwayne
Smith was being used in the
team, the captain said the
bowler needed a pitch that had
something for the bowlers,
while pointing out that it was
difficult to get seven bowlers in.
He, also, related that
Lendl Simmons was not used
higher in the order because at
the stage of. the game, play-
ers with more experience
were needed.
Asked about his public
spat with selector Andy Rob-
erts, Lara said he was caught
by surprise at a press confer-
ence.
"It's something I need to
apologise for."
The captain refused to get
into the row about the price of
tickets, saying he did not have
an opinion when pressed on the
matter.
Sri Lanka coach Tom
Moody said the encounter was
going to be a big game for the
West Indies coming off two
losses.


Lara's batting position

S"It is a crunch game for th
down for rev eWest Indies. Itisalsoabiggan
down fo review Heid the Windie


looked a very good side and
their 2004 winning of the
Champions Trophy, showed
they could win a competition
and the only advantage Sri
Lanka had was psychological.
"When they are under pres-
sure, that's when they come out
and strike."
The coach, however, said
the team knew where the


TOM MOODY


Windies were vulnerablemand
they would concentrate on those
weak areas.
He said he was looking
for a better performance at
the top end.
Moody noted that there
would be a rally of support for
the West Indies, but po inted
out the crowd could miot g6 out
on the field and score runs"
Asked about his use of
record holder Lasith Malinga,
Moody replied: "A bowler like
Malinga you let him go. He is a
match-winner."
He related that the bowler
comes out of playing tennis
ball cricket that accounted for
his low bowling action.


Masters football


at Tucville tonight

A NUMBER of past outstanding footballers including two
past Caribbean stars will be on show tonight when a Mas-
ters double-header is played at the Conquerors ground in
Tucville.,
In the opening game set for 19:00 h old rivals Pele and
Santos will match skills. Among those playing for Pele are former
Trinidadian mid-fielder Larry Joseph who is at present on tour
in Guyana as manager of the United Petrotrin football club.
Also appearing tonight will be former Trinidadian defender
Brian Williams who will be lined up for the Rastafarian Patri-
archs against Thomas United in the second game of the double-
headers.
Among the locals who will be on show are Dennis
Hunte, Terrence Archer, Terry Nicholas, Selwyn Bailey,
Nicky Thompson, Jolyn Lewis, Kelvin Walcott, Christopher
King, Vibert Butts, Gordon Braithwaite and Neville
Wiltshire.


e
e
C


By John Mehaffey

ST JOHN'S, Antigua
(Reuters) Australia pace
bowler Glenn McGrath prof-
ited from some rash shots by
the youthful Bangladesh
batsmen in a rain-shortened
Super Eight match yesterday
to set a record for World Cup
wickets.
McGrath, 37, took threejfor
16 to break Wasim Akram's pre-
vious mark of 55 as Bangladesh
limped to 104 for six from their
22 overs. In reply the seasoned
Australian opening pair of
Adam Gilchrist and Matthew
Hayden played with almost
contemptuous ease to guide the
defending champions to a 10-.
wicket win with 8.1 overs to
spare.
Hayden (47) scored the
winning runs, with two
huge sixes off Saqibul
Hasan while Gilchrist
scored 59, his 50th one-day
half-century. The defend-
ing champions head the
second-round standings
with six points.
Play was delayed for five
hours at the Sir Vivian Richards
Stadium after torrential showers
over the past 24 hours in
Antigua soaked parts of the
outfield and an area near the
pitch.
When umpires Billy



BANGLADESH innings
T Iqbal c Hogg b Bracken 3
S. Nafees b McGrath 1
A. Ahmed c Bracken b McGrath 11
S. Hasan c wkpr Gilchnrist b Tart 25
M Ashraful c Ponting b McGrath 6
H. Bashar c Panting b Bracken 241
M. Mortaza not out 25
M. Rahim not out 2
Extras: (w-7) 7
Total. (6 wkts.,22 oversl 104
Fall of wickets: 1-4.2-8.3-25.4-37,5-
65.6-97.
Bowling: Bracken 4-0-20-2 (w-1).


Bowden and Aleem Dar de-:
cided the surface was fit for.i
play the match was reduced to
22 overs each with a maxi-M.
mum five overs for two of the
bowlers and four each for
three others.
MfcGratl. ci'ien the ne' s-
b.ll lor lhe ir, i nine in hI i-<
rujl hr.uiniamerit. hon .lcd hi, luit
I


WASIM AKRAM

quota, taking three for nine II
his initial four-over spell.
He equalled Akram's pre\ i
ous mark of 55, after starlin
the World Cup with 45, and ec-
tended the mark to 57 by the
time his day's work was corn
pleted.
McGrath, who will retire

(Please turn to page 31)



McGrath 5-0-16-3 (w-1), Taitt 4-0-284
1 (w-4). Watson 1.4-0-4-0, Hogg 5-0.Q4
20-0, Symonds 2.2-0-16-0 (w-1). ^
AUSTRALIA innings I
A. Gilchrist not out 59--
M. Hayden not out 47 1
Total: (without loss, 13.5 overs)106
Bowling. Mashrafe Mortaza 4-0-:
20-0, Tapash Baisya 2.5-0-35-0.,'
Allab Ahmed 0 1-0-1-0, Aboul
Razzak 3-0-15-0. Mohammacl
Rafique 3-0-21-0. Saqioul Hasanl,
0.5-0-14-0. 1
Points: Australia 2. Bangladesh 0


...big game for West Indies-Moody


--'Ir


Glenn McGrath's feat marks another significant moment
in the career of a bowler who is set to retire at the end of
the tournament. (BBC Sport)


McGrath sets record

as Aussies destroy

Bangladesh


F-..






'Sixhead', 'Deadly' Denny confident ahead of The Conclusion
By Jaffar Jamil with each promising victory at "I am a professional and into the seventh round claiming
Ihe Natonal Park on Saturday Dalton is an amateur. You that he needed to use the toilet.
WITH less than one week to "Dalton is a fighter without just have to look at the two The wacky ending thrust
what is expected to be the a head. He can't think in the fights we had before and you the junior middleweight belt
third and final showdown be- ring and L am going to hurt him." will see. Guyana's first world ground Dalton's waist but
tween 'Deadly' Denny Dalton Lewis said when contacted by champion said. '.' Atill left-many ambivalent
US^p^H^tR i^^ lB'th -_- .*u_._-_ ih-y*__. %--I cr-Mv. ,-_.-1% iTi 1-t 1.13 k.-IA-a I h.. __. . 4 ..1- 416- 16_.#d-_ IM-16- IHDi^Ll^^B^


and former worldUU welitetr- the Ch UJIInicle SpoUn yesterday
weight champion. Andrew "I still have another few
'Sixhead' Lewis, both sides yearn left in me and after deal-
have voiced- confidence of ihg with Dalton I widl be mov-
wearing the national-junior. ing onto bigger dthngs."
-middleweight belt following -. Lewis said that he plans ds-
'The Coincusioi' jng lis superior skills to keep at
. Dalton, the junior nuddle- .baybis bullish opponent whorio
.weight champion, ad Lewis 'Jh.tikeaed to a kite without a
- Weae-in lhib -ioods yesterday tail. -


4C


S


ihe lIIrsL uLight belWn ie anout wno-the better ugier
two. staged in October 2005. is as Lewis .was ahead on
ended in a rechnicaLdraw after points. -.
a clash oftheadsin the fourth "I took a year off m
round resulted it a gashW over body is lnow resle.Id I eiV
Lewis' eve.. inwjng-e' ird 'to e&-a
In hie rttrn called Utifih--'. point," ...
ished Business'and staged in ..oweveI- Dalton cIed
April of 21006.Lewis refhusdd to
fight after: less than a minute (Please tumn pagt 4 i ):1


S


III


Sell-out crowdexpected at Providence Stadium today...


Windies face Sri Lanka in


must-win Super Eight match


MaCl On .. The Real Thing

.. *rmicellil


eagieult 'K,:' i:
trs
Shells V "--
tibowvs
Cresle '1
Wheels


Edward B. Beharry &
tX .Tel: 227-1349, 2


By Vemen Walter
SURROUNDED by selection
rift and more so their lethar-
.gie performance in their two
preceding matches, it would
be interesting to see what the
West Indies have to offer,
'when they battle Sri Lanka
in a crucial Cricket World
Cup Super Eight match to-
day. at the Guyana National


Stadium at Providence.
Having sickly surrendered
to Australia and New Zealand
in their first two. matches
played in Antigua,.in this deci-
si\e phase of the prestigious
t.urrianient. the Caribbean boyv.
have found iheniselie, in a
must-wifi situation to keep their
hope'. alive fol a semi-final
birth .
H'"n '?er. whitherv little


tifie to resolve"several problem- Defeats at 'the hands of
atic issues that have arisen the Australia and New
lately, West Indies, World Cup Zealand were not insoluble
champions m 1975 and 1979 but the way that they were
and beaten finalist in 1983, will rendered was obviously pain-
certainly have.to pull to them- ful.
selves' together and improve Added to Tbe agony was
their cricket geherally if they are the amazing team' composi-
going to prvept another defeat. tion foi the New Zealand en-
With a large cro d e\peited to- counter, where specialist
da\. Guyanese \wil be looting
for the WV tndies (Please turi, to page 30)
"? JEW


,.-. -' -;., _ ._ .. ... ,-^ T .- :.' -
: [...... .. . .., . . .


CLICO'S
FIRE INSURANCE


,% N.r,,


* S .t' *6''


41 ii'- i-EGINA(592) 771-4310 NEW AMSTERDAM (592) 333-2650 PORT MOU.RANT (592) 336-6155; 336-6394
LINDEN (592) 624-2662:444-2838 PARIKA: (592) 260-4974/5 GEORGETOWN: (592) 226-2628-8
Printed and Published by Guyana National Newspapers Limited, LamaAvenue, Bel Air ParkGeorgetown. Telephone226-3243-9(General); Editorial: 227-5204, 227-5216. Fax:227-5208 SUNDAY, APRIL 1, 2007


ge l'& 3'p6T- 1


I




























nf.
t Lz


S


Not to be sold separately


'->


.. ,,r :1
,.! *.q. ^ .


LOCAL and international models sizzle in swimsuit by
Olympia Small-Sonaram and evening and cocktail cre-
ations by Derek Moore and Roger Gary. They were part of
the line-up for a fashion show put together by New York
based Guyanese designer Roger Gary at the Umana Yana
last evening. (Delano Williams photos)





















































1 5-
!,S


2'-
; -.. ,


"; ."
* ; '*"
*+' *


.-


.~~ ~ ,*_: .',






Page~IISundy~ hroncle Aprl 1 20


APES and humans have
common ancestors but should
they have the same rights?
An international movement
to give them "personhood" is
gathering pace.
What would Aristotle make
of it? More than 2,000 years
after the Greek philosopher
declared Mother Nature had
made all animals for the sake of
man, there are moves to put the
relationship on a more equal:
footing.
Judges in Austria are
considering whether a British
woman, Paula Stibbe, should
become legal guardian of a '
chimpanzee called Hiasl which
was abducted from its family
tribe in West Africa 25 years
ago.
The animal sanctuary where
'he has lived is about to close and,
to stop him being sold to a zoo,


Ms Stibbe hopes that she can
persuade the court he deserves
the same protection as a child.
Spanish MPs are also being
urged to back a similar
principle, one already endorsed
by the Balearic parliament and
held dear by the international
organisation The Great Ape
Project that apes be granted
the right to life, freedom and
protection from torture.
So should apes such as
those at London Zoo, which
opens its Gorilla Kingdom on
Thursday complete with gym
and climbing wall, get the same
rights as their zookeepers?
They need greater
protection in the eyes of the
law, says ian Redmond of the
UN's Great Apes Survival
Project, who believes welfare
groups could' use
guardiainsihip as a way to


Oh brother...


We share 99% of their DNA


-So


should apes have human rights?


rescue ill-treated apes.
Some rights are conferred on
apes but only because they are
endangered. And the
international trade ban is flouted
in Africa and South-East Asia,
where mothers are shot and their
infants shipped off as pets,,
circus performers or lab animals.,
Vivisection on apes is banned in
much of Europe but still goes on
in the'US and Japan.
"Apes are special because
they are so closely related to
us," says Mr Redmond.
"Chimpanzees and bonobos are


r. .41


Last look
SIERRA Leone's Bunce Island, from where tens of thousands of African captives were ex-
ported to North America and the West Indies, has an unsettling atmosphere.
"It vividly symbolises man's inhumanity to man," says Joe,Allie, head of history at the Uni-
versity of Sierra Leone.
The view from this pier was often the slaves' last view of Africa.
Founded around 1670, the old slave trading fort lies some 30km up the mouth of the
Sierra Leone River. (BBC)


our joint closest living relatives,
differing by only one per cent
of DNA so close we could
accept a blood transfusion or a
kidney. Gorillas are next, then
orang-utans."
But there is a stronger
cognitive argument, he says,
because the apes' intelligence
and ability to reason demands
our respect.


law. *
They have a similar lifespan
to humans and form strong
family bonds which they
maintain for life, she says. And
apes have displayed a
tenderness which could be
described as love, anxiety when'
separated, and fear, jealousy and
trauma.
"If I was an alien from


ORANG-UTANS can kiss and cuddle


"Show a gibbon a mirror
and the reaction suggests he
or she thinks the reflection is
another gibbon. But all the
great apes have passed the
'mirror self-recognition' test
and soon begin checking
their teeth or examining parts
of their body they couldn't see
without the mirror. This.self-
awareness surely suggests
that they know they exist."

Family ties
Apes also share a range of
human emotions, says zoologist
Charlotte Uhlenbroek, who
thinks they should be afforded
legal protection enshrined in


faculties that make them worthy
of moral consideration.
"Justice and consistent
thinking require that we treat
non-human animals who share
morally-relevant properties in a
respectful way, and that surely
means giving them the
opportunity to flourish and not
be tortured or subject to cruel
.or degrading treatment."
But Steve Jones, professor
of genetics at University of
London, says human rights are
a-construct which can't be
imposed on animals.
"Where do you stop? It
seems to-be that being human is
unique and nothing to do with
biology. Say that apes share
98% of human DNA and
therefore should have 98% of
human rights. Well mice share
90% of human DNA. Should
they get 90% of human rights?
And plants have more DNA
than humans."
Chimps can't speak but
'parrots can. Defining creatures


* Mars and looked at human ,-and allowing them rights based
society and a society of apes" on criteria invented by one


n iitar arWare & Tiles*


White

Coloured

Designed


6" x 6"

6" x 6"

6" x 6" /


'. .,
j "~
$


Toilet Sets low level coloured (seats extra)
Toilet Sets close-coupled; lever type (seats extra)


26.00

30.00

35.00


13,000.00
14,500.00


Toilet Sets close-coupled; push button (seats extra) 13,500.00
Lavatory basins with pedestals; white or coloured (fittings extra) 12,000.00

VAT N_-T i ncl ud d .

S , i v. -


THE chimpanzee (Pan troglodytes) is the most plentifu
of the great apes, its range almost spanning west anc
central equatorial Africa. Numbers estimated between
170,000 and 300,000.


then in terms of the emotional
'life I would see no distinct,
difference, although we; live
very different lives because of'
language and technology."
Giving them rights does
not mean throwing 'pen all
the .cage doors because some
zoos are important to
preserve the species, but it is
vital to establish a principle
that apes should hot be
treated like objects, she says.
Daniel Sokol, a medical
ethicist, says apes possess
cognitive and ,emotional


.group is itself an enormou!
. breach of human rights, he says
and one need look rio further.
than Austria in 1939 to see why
"Rights and responsibilities g(
together and I've yet to see a chiml
imprisoned for stealing a banan;
because they don't have a mora
sense of what's right and wrong. T(
give them rights is to give then
something without asking fo
anything in return."
There is a moral case t<
make about animal welfare
he says, but it has nothing t(
d6 :with science. (BBC)


Tiles
"


Sunday, Chronicle, April 1, 200


PageHII


v




SC nday ChrhlcAphr'I, 2007


nJe tOresr






It a Time


CI, TNC Support World's First Small-Scale Forestry

Project to Meet Kyoto Protocol Requirements


WITH logging mostly to
blame for the loss of more
than 75 percent of its forests,
China needs all the trees it
can get.
As early as this summer,


tree species on 1,200 acres of
degraded land in'the remote
town of Tengchong and includes
support for local communities.
Not only will the plan help
reconnect heavily divided


skyrocketed.
Although the Chinese
government has invested billions
of dollars toward forest
protection and restoration in the
last decade, the programs do not
meet Kyoto requirements nor do
they take into account


deliver multiple benefits.
"Forest conservation is not
just for the sake of ecosystems.
It provides a service to the
people, and without it they
suffer," says CI-China Director
Zhi Lu.
"Combined with


Project Will Reduce
Emissions Over Long
Term
Although the new small-
scale forestry project will not
have an immediate impact on
reducing China's greenhouse gas
emissions, its long-term
implications will.
In the wake of new
projections that China will
surpass the United States as
the world's largest emitter of
greenhouse gases by 2008,
the Tengchong reforestation
project provides a solid
example to other developing
nations on how to comply with
rigorous CDM criteria and
replicate them.
Among other standards,


CDM projects must reduce
carbon emissions and assist
developing nations in achieving
sustainable development. The
newly validated methodology
will serve as a guide for future
projects, which can adopt it at
lower cost and get faster CDM
approval.

Deforestation
Causes Climate
Change, Cascading
Problems
With climate change on
track to surpass habitat loss as
the leading threat to
biodiversity in the next century,
small-scale projects like this
present a clear way for
governments to combat
deforestation and its cascading
environmental problems.
Forests play a cruciaLrole in
our ecosystems. Their ability to
absorb carbon and capture water
helps stabilize the atmosphere.
Cutting and burning trees
accounts for more than 20
percent of all greenhouse gases
released into the air double the
amount emitted by the entire
transportation sector.
As seen in China,
deforestation can easily lead to
shortages in fresh water, harm
to wildlife, and increased
flooding..
On the other hand,
safeguarding forests can

Please turn to page VII


Cl and the 3M Foundation mark the opening of the first
reforestation site in China, part of a broader partnership
with Chinese forestry departments to design projects that
bring multiple benefits to the environment and .the
people.(CI/He Yi photo)


tree planting may begin as part
of the world's first small-scale
forestry project to meet strict
Kyoto Protocol requirements
for curbing climate change.
The project's validation by
the United Nations Clean
Development Mechanism
(CDM) last month clears, a
major technical hurdle .to
restoring forests not only in
China, but elsewhere, as other
countries would then be able to
model their efforts after China's
work.

Planting Trees in
Southwest China
A joint initiative between
Conservation International (CI)
and The Nature Conservancy
TNC) will restore damaged.
forests in the Mountains of
Southwest China Biodiversity
Hotspot.
It calls for planting native


habitat, the trees planted will
also. remove approximately
160,000 tons of carbon dioxide
from the atmosphere within the
first 30 years of
implementation.
The project is located in
Yunnan province, a traditionally
poor and rural region where
newfound economic
development has severely
strained the environment.
Swaths of forests have been
destroyed there to feed an
exponential growth in furniture;
paper, and other timber-based
industries.
A 1998 logging ban
invoked in multiple provinces
following disastrous Yangtze
River floods that killed
thousands. of people
exacerbates the enormous
pressure on companies to
acquire trees. Since then,
timber imports have


An incredible diversity of birds and mammals live in
Guyana's Kanuku Mountains, which are threatened by
forest burning, logging, and mining. (CI/John Martin Photo)


biodiversity conservation or aid
to communities.
CI is working closely with
China's State Forestry
Administration and provincial
departments to design other
reforestation projects that


logging bans and setting up
nature reserves, this
remarkable step forward
will contribute to overall
awareness and
improvement of the
'environment in China."


ONE Fish Processing Plant
Supervisor to work at Charity,
Essequibo Coast. Accommodation
will be provided.
Attractive salary. Call 223-5273/4




Applicants are invited for the position of a General
Manager for the HOTEL INDUSTRY.
Criteria for successful applicant are:
(I) Applicant for the above position must have the
relevant qualifications Hospitality, Tourism and
Communication would be an asset;
(ii) At least three (3) years experience in a similar
field;
(iii) Applicant will be fully in charge of a!ll
departments and should be able to make all
decision necessary for the smooth running of the
operations.
Salary negotiable
Send written application to PO.Box 101469


WANTED
One Sales Representative
Requirements:

CXC passes including Maths & English
3 years working experience in this field is a plus
Must be computer literate & possess a valid Driver's
License
Vibrant personality possessing good interpersonal
skills and ability to work independently.
Send applications along with CV to:

The Chief Executive Officer
16 Mudlot Kingston
Georgetown.
Tel: 223-5273/4


PROPERTY FOR SALE
VLISSENGEN ROAD











WOODEN AND CONCRETE BUILDING

SUITABLE FOR FAST FOOD OUTLET

BEYIWEEN POPEYE'S AND PIZZA HUf
SERIOUS ENQIUIRIES ONLY
$80 M

227-0404, 846-3251, 623-7590


NOTICE
MINISTRY OF AGRICULTURE
The Ministry of Agriculture has three established
telephone hotlines which farm&rs/fishermen can
call to seek assistance/clarification on issues
affecting them during the hours of 08:30 and
17:00.

The hotlines are 223-7291, 227-5049 and 225-
8310.


I 'I


^Pi^n







Pag~IV Sunday.Chronicle Ap~l 1, 2007..


South America's





Cosmic Race


By Terence Roberts
THE root of Vascconcellos'
concept of the "Cosmic Race"
is not specifically South
American, but derives from a
human value long imbedded
in the human instinct for bio-
logical and creative freedom.
It is impossible to place
people of different races, cul-
tures, etc, together, without
arousing their mutual curios-
ity.
Nevertheless it is crucially
important to trace the slippery
route where the myth of Euro-
pean, or any other racial human
superiority, first took rpot and
was propagated in words and
images, before beginning to
wither away due to the increas-
ing maturity of human thought.
The idea and myth of half-


animal half-human creatures
seemed to have obsessed the
imagination of Egyptians,
Asians, pre-Columbians, Creek
and Roman antiquity. Clearly
antique "primitive" then Euro-
pean man in adopting the myths
of these hybrid creatures, later
referred to as Satyrs,
Minotaurs, etc, were expressing
an immature but sensitive
awareness that the human con-
dition had origins in remote ani-
malistic features and brash in-
stincts vital to the most crude
and aggressively animalistic
methods of survival.
This awareness also
recognized that influences from
the dark continental womb of
Africa preceded Mediterranean
and European cultural examples
of fairer human skin.
The most recent archaeo-


logical reports on findings
(agreed to by scientists from
diverse races) concerning the
history of mankind, largely
prove that the human species
first emerged on the dark
continent, trekked into fer-
tile. Mediterranean/Asiatic
regions, adapted and evolved
into fairer people, who then
kept trekking into cooler re-
gions of Western Europe
where they evolved into even
fairer people, all this due to
their breaking down into iso-
lated sub-groups.
Such groups, made up hu-
mans still in the evolutionary
racial stages between dark origi-
nal man and fairer Asiatic man,
would find their way into pre-
historic pre-Columbian
America, where again various
nomadic sub-groups would be-


GNCB

GNCB is requesting the under-mentioned persons, or anyone
knowing their whereabouts, to kindly make contact with out
office situated at 77 Croal Street & Winter Place, Georgetown
or at telephone Numbers 225-4346,225-6971 or 225-9486, as a
matter of urgency.


NAME
Elvis Simon
Latchmin Sarjue &
Parmeshwar Singh
Edwin Persaud
Sewpaul Singh
Deochand Narain
William Lynton
Royston & Paula Blair
Millicent Taylor
Clarence Fraser
Rawle A. Phillips
J. N. Samaroo
Wilton Lindie
Mohamed Yasin
Winston Benjamin
Osafo Odinga
Michael Jupiter

Molly Johnson
Ignatious Kattow
Anthony Dundas
Anand Singh
Frank Samuels
Nankumarie Lochan &
Lochan Khairoo
Ingrid Pollard
Joseph Lewis


LAST KNOWN ADDRESS
Zorg, Essequibo

194 Meten-Meer-Zorg, West Coast Demerara
Better Success, Essequibo
Hyde Park, Mahaicony, East Coast Demerara
Lot 129 Amla Ave, Prashad Nagar, Georgetown
Ithaca Village, West Coast Berbice
17 Republic Ave, Mackenzie, Linden
2 Martin Luther Scheme, New Amsterdam, Berbice
56 Non Pariel, East Coast Demerara
76 Scottsburg, Corriverton, Berbice
46 Nandy Park, East Field, East Bank Demerara
Kimbia, Berbice River
79 'C' Bushlot Village, West Coast Berbice
11 Cummings Ville, New Amsterdam, Berbice
Triumph, East Coast Demerara
322 New Market Street, North Cummingsburg,
Georgetown
Danielstown, Essequibo Coast
Laluni Creek, Linden Highway
Laluni Creek, Soesdyke, Linden Highway
67 Garnett Street, Newtown, Kitty, Georgetown
3 Golden Grove, East Coast Demerara

4 Greenwich Park, East Bank Essequibo
342 Dageraad Avenue, Mackenzie, Linden
3195 Rosa Drive, South Ruimveldt Park, Georgetown


come isolated, leading to a diver-
sity of tribal people and cus-
toms' throughout the entire
Americas.
Satyrs, with their dark sun-
tanned, broad-nosed, curly-
haired features, definitely repre-
sented a hybrid human presence
rooted in the emergence :of
white European civilisatioi.
Europeans in those. an-
tique eras of their emerging
civilisation were not afraid to
identify. themselves with such
dark, earthy animalistic fea-
tures. In the 16th and 17th
centuries early Gaulish and
Flemish scientists began to
link the features of the Eu-
ropean fox to the finely chis-
eled features of men and
women among them. So con-
ducive was this metaphorical,
even vaguely biological link,
that the term "foxy" or "fbx"
would later come to refer to
certain women, especially
white women, with this


animal's facial and coy char-
acteristics.
The famous black Rock
Musician, Jimi Hendrix, a
highly intelligent and cultured
young man, sang the hit tune
"Foxy Lady" which clearly re-
ferred to certain white women
whose sensuality inspired this
line: "I see you down on the
scene, Foxy, you make me want
to get up and scream!"
Hendrix's knowledge of Euro-
pean art and antique mythology
clearly influenced his songs, and
the entire scene "Foxy Lady"
relates can be found in several
Baroque 17th century canvasses
by Rubens, and similar Euro-
pean painters of that era.
In many ways such paint-
ings, etchings, sculptures, draw-
ings, by perhaps the greatest,
the most broad-minded and cre-
atively egalitarian European
painters of the past, such as
Titian, Tiepolo, Goltzius,
Bosch, Bruegel, Rubens,


(Part 3)

Jordaens. and Delacroix, were a
prelude to a cultured, educated,
and civilised understanding of
human attraction between
people of different race and
colour. Persons whether Euro-
peans or not, with in-depth
knowledge of such painters and
their liberal human topics,
would probably bring a more in-
formed, normal, and cultured
appreciation to the sensitive
subject of miscegenation.
Knowledge and careful
study of specific works by
these artists which can be found
in some of the best European
Art Museums in cities like
Madrid, Venice, Brussels,
Antwerp, Vienna, Munich, and
Stockholm, no doubt helped in-
fluence paredasaic desires and
ideals behind the European.
settlement of tropical South
America. However, no continent
on earth has ever been without
the two opposite qualities of
aggression/affection, rejection/
acceptance, violence/pleasure,
etc.
Nevertheless such ideal
European works of art re-
fused to stagnate in negative
attitudes, but instead
visualised civilised values of
fertility, pastoral abundance,

Please turn to page VI


VACANCY

Hardware Technician

Job Summary:

Diagnose, troubleshoot and repair hardware and software problems.
Perform preventative maintenance on installed equipment, install add-on
components, set up and configure new systems, and provide advice to end
users on hardware and systems software issues.

Responsibilities:

*:+ Install, configure, and maintain a variety of computer equipment
including printers.
* Diagnose and repair hardware problems.
* Perform preventative maintenance and install upgrades and options.
+ Maintain inventory of supplies and equipment.
* Maintain documentation related to equipment, supplies and services, -
payments, warranty tracking, and repair history.


Qualifications


Experience:


Skills:


Five CSEC subjects.
A+ certificate


Minimum of two years experience in
computer repair activities.

Good Written and oral communications skills.


Remuneration: This wilt be dependent upon qualification and
relevant experience.

Application must be submitted by 30th March, 2007 to:


S 4


The Company Secretary/ Human Resources Manager
GTM Group of Insurance Companies
27-29 Robb & Hincks Streets
Georgetown
E-mail: gtmgroup@gtm-gy.com


____


Page IV" ,


Sunday. Chronicle April 1, 2007,


b:






Sunday ChronkileApril 1, 200i7


Pa V '


Convicted for constructing




chicken pen without permission


Counsel prayed in aid of
the interpretation of section
136 the provisions of sec-
tion 141. He contended that


THIRTY-six years ago the
Full Court of the Supreme
Court of Judicature affirmed
a magistrate's ruling that the


tion 136 of the Public Health
Ordinance, Chapter 145.
On appeal it was argued on
his behalf that Part XII of the


buildings and in particular with
regard to . . the keeping of
domestic animals, and the dis-
tance of any stable pen, byre,


'1 IBy George Barclay


construction of a chicken-pen
(building) without permission
of the Local Sanitary Author-
ity was an offence and'or-
dered that it be pulled down.
This decision resulted from
a legal battle between two legal
giants, Mr. Ashton Case, S. C.,
who represented the appellant,
Grahan the chicken pen builder
and.De Rusche, the Respon-
dent, who was represented by
Crown Counsel, Mr. Mohamed
Shahabuddeen, S.C, who ap-
peared, amicus curiae (as a
friend of the Court)
The big point that was de-
cided by the Full Court consti-
tuted by Chief Justice Joseph
A. Luckhoo and Justice Guya
Persaud dealt with whether of
not the Chicken pen was con-
sidered a building under the
Public Health law.
The facts of the case dis-
closed that the appellant, Gra-
ham, was convicted of the of-
fence of erecting a "building"
namely, a chicken pen, without
the approval of the local sani-
tary authority, contrary to sec-


Ordinance of which sections
136 and 141 formed part was
devoted to housing and district
planning and did not contem-


MR. ASHTON CHASE, S.C.

plate structures such as chicken
pen.
Section 141 provides that:
"The Board may make regu-
lations with respect to the erec-
tion and sanitary control of


stye or manure heap from the
building."......
Section 2 defines "build-
ing" to include "any house,
kitchen, storeroom, garage or
other outhouse, or part
thereof being part of any
premises, whether perma-
nent or temporary".
The Full Court held that
such a structure as the "chicken
pen" falls within the definition
of the word "building" in sec-
tion 2 of the Ordinance.
Hence the appeal was dis-
missed.
Chief Justice Luckhoo who
delivered the Full Court's judg-
ment noted that the facts as
found by the magistrate in the
matter were that the appellant
erected a new structure measur-
ing 22 feet by 13 feet 6 inches,
with a roof sloping from seven
feet to 6 feet 6 inches at Lot
630 East Ruimveldt, and that he
used that structure as a chicken
pen.
The evidence is that the
structure has been erected over
a new concrete floor, and stands


Foreign Ec\hange Market .cti i ilie
Summarn Indicators
Friday, March 2.3, 2007 -Thursday, .March 29, 2007


1. EXCHANGE RAILS
Bu.sing Rale Selling RKale
.\. 1[S Dollar NO1 ES OMHil: N(f'lf OTHER
Bank oft Broda 200.00 200.00 206.00 206,50
Bank ,of No jScntia 195.00 198,00 206.00 206.00
( i'/L:n Bajnk 195.00 199.00 204.00 204.25
i D.m-iraj Bank 197.00 199.00 211' in I 203.00
GBTI 196.00 198.00 204.00 204.00
RBGL 195.00 200.00 202.00 206.00
Bank Average 196.33 199.00 204.00 204.96

Nonbank Cambios Av. (5 largest) 200.72 204.28

BoG Average Market ExChange Rate: US$1.00 = GS201.75

B. Canadian Dollar
Bank Average 150 83 160 00 170.33 174-67

C. Pound Sterling

Bank Average 342 50 363.83 35. 17 390.50

D, Euro

Bank Avrage 230.00 248.75 260,00 268 75
E. Selected Caricom Exchange F. LIBOR -- US$ G. Prime Rate
Rates London Interbank Offered
Rate for Thur.. March 29, 2007
ITS $ GS 30.82
B1dosS = G$ 93.10 6 month, 5,3200(% .S S.25'-
j = 05$ 4.45 year 5 20)000,' G"uvuna ,A t.t) 14.52'
ECS= (.069.39
BelizcS = GS 97,.01
L-<1---L-- -A. I, J!u"tiutiU A,, at1vt.ituLki iwmK


on new uprights.
It is accepted, said the C. J.,
that the permission of the local
sanitary authority was not ob-
tained for its erection.
As a result, the appellant
was prosecuted for erecting a
building without approval,
contrary to section 136 of the
Public Health Ordinance, Chap-
ter 145, whereupon he was con-
victed, and an order was made
for the structure to be taken
down.
It is against the conviction
and order that the appeal was
brought.
According to the Chief
Justice, the short point to be
decided is whether the struc-
ture falls within the defini-


tion of the term "building" as
set out in section 2 of Chap-
ter 145. There, "building"
is defined to include "any
house, kitchen, storeroom,
garage or other out-house, or
part thereof being part of any
premises whether perma-
nent or temporary.'
Counsel for the appellant,
the CJ said, argued that Part XII
of the Ordinance, of which sec-
tions 136 and 141 form part, is
devoted to housing and district
planning, arid therefore does not
contemplate structures such as
a chicken pen. He submitted
that although the appellant
might have committed some
other offence there was no
contravention of section 136.


Dr. Mohamed
Shahabuddeen, S.C..


section' 141 authorises the
making of regulations relat-
ing to buildings intended for
human habitation only, and
that this is to be gathered
from the scene of Part XII as
a whole. For this purpose of
this case reference may be
Please turn to page VII


DEATH ANNOUNCEMENT


'' The death is announced of LEARTIS VIVIAN
RUDOLPH PATTERSON, racehorse enthusiast -
S and retired Headmaster of 75 Haley Street, ,
Wortmanville, formerly of Nurney Village
Corentyne, who die don Friday, March 23, 2007 at
age85.

He was the husband of Emma Lucretia Patterson
nee Benn of the USA, father of Baldwin, Lorrenzo,
Dr, Vivian Patterson, Lucretia Mayers, Pastor
Stephen Patterson, John, Charmaine Gordon,
Floyd all of the USA, Basil of Nevis, Justice Winston Patterson, Michael Patterson NIS
Manager, Skeldon, Joseph Patterson, Land Consultantand Viwet Brandford Headmistress
(Ag.) St. Mary's Secondary School.

Grandfather of Shavain, Mark, Deputy Sheriff, USA, Marvin Patterson, Attomey-at-law,
Pastor Preston Patterson, Wilfred, Marcia, Melisha, Eusl, Keisha, Gracie, Marcia,
Stephonne,Althea, Junior, Johnny, Matthew, Jr. Waynetta, Floyd (Jnr), Randy, Jamal and 29
others.

Great grandfather of eighteen.

Uncle of Urani & Daniel Jones: .Robert,.Walter & Oris Bagot, Osbert, Selvin, Donna & Pam
Peters, Murette Scott, Maylene & Desire Patterson: Christina, Gavin & Grenville Miller: Betsy
& Vernon Whyte: Merle, Ernest, Shirley, Rudolph & Lance Patterson and many others.

Cousin of His Grace, Bishop Randolph George, Reverend Justice James Pattrson, Dr.
Ronald Patterson of the Bhamas, Dr. Randolph Estwick of the USA, Gwendolyn, Collis,
Nathalie October, Compton, Eustace, Ivy, George, Lawerence & Phillip Patterson and many
others too numerous to mention.

Family of the Bagots, Hawkes, Octobers, Cummings, Collins, Jones, Millers, Jacksons,
Sanchos, Elliots, Whytes, Saigos; Peters and many others.

Friend of Dr. Berman Saunders of USA, Reverend Menza London, Mankarran Ramlal, Victor
Fileen, Mr. Fraser, Ramesh Sunich, Donald Caddie, Daniel Benn, Vilma King, George
Winston Humphrey and others.

Funeral Arrangements for the' late LEARTIS VIVIAN RUDOLPH PATTERSON will take
place from Merriman's Funeral Home on Monday, April 2, 2007 and Community tributes at the
Kildonan Community Centre. Culminating with a celebration service and interment at the
Auckline Presbyterian Church.

FUNERAL SCHEDULE

8 am 9am Viewing and Service at Merriman's Funeral Home, Lot 55 Bent Street,4
Werk-en-Rust, Georgetown.

1:00 pm Viewing and service at Nurney Village, Corentyne, Berbice and
Kildonan Village Community Centre, Corentyne, Berbice

.tv Home-going Service at Auckline Presbyterian Church 4
and interment in the Church yard.


_ _


M rriUl


t .A







Page VI- :" - - -.-.-.-.--.-.++ ..


Page~: -.-~-7- .:. Snday oiiiI~' &


A celebrated part of the huge painting "Feast of Venue Verticordia", or "Changer of Hearts",
depicting the development from satyr to romantic partner between dark male and fair
female, painted by Peter Paul Rubens in 1636-38, now in a Museum in Vienna, Austria.


National Insurance Scheme would like to announce the following
increases:-

INCREASE IN PENSIONS
All pensions that were in payment as at 31' December, 2006 will be
increased by 5% effective January 1, 2007.

MINIMUM PENSION
The minimum amount of Old Age and Invalidity Pensions will be increased
from $12,700.00 to $13,335.00 per month.

INCREASE IN INSURABLE EARNINGS CEILING

Effective March 1, 2007

MONTHLY
From $99,312.00 to $104,278.00

WEEKLY
From $22,918.00 to $24,064.00

INCREASE IN LIMIT FOR REIMBURSEMENT OF OVERSEAS
SICKNESS MEDICAL CARE COST

With effect from March, 2007

From: $993,120.00 to $1,042,780.00
N.B.

These increases are as a consequence of the increase in the minimum
wage in the Public Service that were announced in December, 2006.

Remember, the Insurable Income Ceiling is pegged at four (4) times the
minimum wage in the Public Service, while Overseas Sickness Medical
Care is pegged at ten (10) times the Monthly Insurable Earnings Ceiling.


BY ORDER OF MANAGEMENT


South America's...

From page IV
song and-dance, erotic attraction, the pleasure of wine shared among people whose fea-
tures and colour are different.
One of the first beloved European Baroque paintings which projected an ideal scene of interracial
pleasure containing a prelude to the "cosmic race" located anywhere, is Titian's "Bacchanal of the
Andrians" of 1525-27, hanging today in the Prado Museum of Madrid. The painting celebrates the
worship of Venus, Goddess of Love, but the scene takes place on the isolated island of Andria, a place
beloved by mythological Gods, where streams run with wine, not blood, where naked fair women
recline, sipping wine or dancing with dark-skinned male partners.
This profoundly suggestive painting shows a desired state of well-being without any psychologi-
cal conflict or drama, only the pleasure of nature's- uninhibited tropical pastorality. Who would not
wish such a project made real?
The discovery and settlement of South America was occurring at the same time such paint-
ings were being painted; indeed such paintings were partly influenced by the first paradisiacal
reports by sailors about the Caribbean islands and South America; in the same way that Sir
Thomas More's "treasonous" book "Utopia" is about an ideal South American society some-
where in the region of the Guianas, Brazil, and Venezuela.
In 1636 the Flemish Baroque painter, Rubens, would carry such themes further with his beautiful
huge egalitarian Baroque canvas titled: "Feast of Venue Verticordia", or "The Changer of Hearts", now
in a Viennese Museum. This staggeringly detailed painting has been described as a paean to Love, and
amidst its sensual nudes offering the fruits of the earth apples, grapes, corn, painted to suggest erotic
parts of male and female, Rubens has entwined three women of his race dancing and kissing dark-
skinned Satyrs and fully human black males.
Rubens continually painted Africans among nude and semi-nude Europeans, their common human-
ity linked by fun, drink, food and romance. Rubens painted the opposite of prejudicial fears about the
dark-skinned "other", and left us some of the most dignified and human drawings of Africans, at a time
when Africans were being taken across the Atlantic into slavery by other Europeans with a fraction of
civilised values others like Rubens possessed.
Jacob Jordaens is the other Flemish painter, a partner of Rubens, who in his canvasses depicted
the dark-skinned as equal in the family of God's children. His huge gorgeous painting: "The Allegory
of Fertility", of 1620, is perhaps the most joyous gathering of black and white in uninhibited pleasure
amidst an abundance of fruits and vegetables.
Jordaens would also paint Moses as white-skinned holding the hand of his African wife
Zipporah, in a precious 1650 canvas hanging in Antwerp today. The idea of the "cosmic race" is
in such works.







Choose Your Career!








For FREE information mail or fax this ad, or visit us online today!
FAX: 1-570-343-8462 W ww.PennFosterGlobal.com
Enter~ D# AEES4i7A-
ACCREDITATIONS AND APPROVALS. Penn Foster College and Penn Foster Career School are accredited by the Distance Education and
Training Council. Penn Foster College is licensed by the Arizona State Board for Private Postsecondary Education. Penn Foster Career
School is approved as an Authorized Provider of continuing education and training programs by the International Associationfor
Continuing Education and Training..
U.S. ASSOCIATE DEGREE PROGRAMS
61 Accounting i 409 Health information Technology
64 Applied Computer Science 68 Hospitality Manageient
PD \N 60 Business Manage.en. 2 Human Resourcesnagement
P W*"T ^- L* C63 Civil Engineering Technology i 403 internet Multimedia
406 Criminal justice and Design
SFO STER 405 Early Chidhood Education 80 Marketing
S 404 E-Commerce Administration 62 Mechanical Engineering 2
COLLEGE 165 Electrical Engineering Technology
Technology Q401 Paralegal studies
67 Electronics Technology : I 408 PC Maintenance Technology
S81 Finance [" 402 Web Programming
'42 Dressmaking & Design 40 Photographer
i fl ',-.*-.y-.-- D :0 6 Electrician 146 Physical Therapy Aide
I PI 1ENN UFO tE 79 Electronics Technician S8 Private Investigator
..... CARl. s SCH~x, U 94 Fitness & Nutrition n 160 Pfaon Bridal
E 30 Floral Design Consultant
CAREER DIPLOMA PROGRAMS U76 Freelance Writer 102 Professional Landscaper
.2 72 Appliance Repair 384 Furniture and Cabinet Maker 113 Professional Secretary
32 Artist i 07 High School (U.S. Diploma) 170 Small Business Owner
158 Auto Body Repair Technician R05 Hoediesarat. MangeenAide
04 Auto Repair Technician 14 HVAC Technician .-1 3 Telecommunications
2: 01 Basic Electronics 12 Interior Decorator Technician
390 Bookkeeping 23 Medical Office Assistant 35 Travel and
04 Carpenter 39 Medlcal Transcripionist Tourism Specialist
59 Caterer 33 Motorcycle Repair Technician [f 87 TVNCR Repair
"03 Child Day Care Management 08 Pralegal Technician
S105 Compuer Graphic Artist t 27 PC Repair 88 Veterinary Assistant
105 Computer Graphic Arnt 38 PC Specialist 83 Web Page Designer
SS Diesel Mechanics 1 84 Pharmacy Technician ,22 Wildlife/Foresuy
Conservation
Please send me FREE information on the College or Career School program I have selected above.
No obligation. Choose ONE only.
N AM E .............................. .... ............................................................... I ......... . ........ A G E ..............................
ADDRESS..................................... ... ............... .... ..APT...POS........ A T .. ... .. ...................
Ci .: 101 MTRY .......... .................. ..._ ........ ........: ......................... ............. PO S rAL CO O E.... ........................ ....
PHON ................................................. .. .... MAIL ............. ...._ _ ............................................. .......... .........
Mail entire ad to Penn Foster, Representative Guyana Educational Services. Inc., Dept. AEES47A,
- -...... .. -BoxIo494lft;-otaAlexande ., &iShe4Rasa,lJtty, GtargetoawaIiyan.. .....


.....,-,--NOUNCEMENT


.Sunday Cf ronil'ri 1,'N7


-"r


I






SunIa Choil AprU. i,21 Pag VI


One Forest At a


From page III
greatly benefit local
communities, who need
land to survive, but are
destroying it for short-term
economic gains. In the
tropics, millions of acres of


rain forest vanish annually
from encroaching
urbanization and farming.
A common agricultural
technique called slash and bum
- when vegetation is cut, dried,
and burned and the land
cultivated prevents growth on


the ground for generations once
farmers abandon their
overworked plots in search of
more fertile areas.
Through education and
on-the-ground training, CI
assists local communities in
adopting more eco-friendly


Convicted for constructing ...
From page V
made to para, (d) of section 141.
The judgment added "The Board. may make regulations with respect to the erection and sanitary
control of buildings and in particular with regard to .... The keeping of domestic animals, and the
distance of any stable, pen, byre sty or manure heap from any building...."
The judgment further stated, "We are of the opinion that para (d) contemplates a structure
such as the one which is the subject matter of this appeal, and that such a structure falls
within the definition of the word "building" in section 2 of the Ordinance.
After citing a number of legal authorities in support of the contention that the magistrate's
ruling was sound, Chief Justice Luckhoo added, "In our view the definition in section 2 of
the local Ordinance is much wider than that which was considered in Collins v. Greenwood
(supra.)
He added, "With this case can be compared the decision in the Mayor of South Shields v.
Wilson Bros. Ltd. (1901), 84 L.T.R (N.S.) 267, where it was held that a wooden structure being
under 20 feet each way and with a slanting roof of 12 feet high to be used as a stable, and
erected in the centre of enclosed private ground was a "new building" within the meaning of
the by-law.
The defendants occupied an open shed in the centre of the ground which was hoarded on all sides.
Against the open shed they put up the wooden structure complained of. There was no definition of
the term "new building", but it is, instructive to note that the by-law which prescribed the conditions
to be complied with where someone intends to erect a new building required the submission of plans
which must show, among other things, the dimension of rooms, the situation of fireplaces, stoves,
chimneys and flues, of water closets, privy, gully, drain, etc;
Notwithstanding that these conveniences did not form part of the shed, the court (in which (Chan-
nel J. sat) held that the by-law applied to the shed.
"As indicated above," Chief Justice Luckhoo declared, "We are of the view that the decision of the
magistrate should stand undisturbed. The appeal is dismissed and the conviction and order affirmed."
The Chief Justice added, We are grateful to Mr. Shahabuddeen for his assistance in this
matter, but we will not award costs to the respondent who did not appear at the hearing of this
appeal, and who, as far as we are aware, made no arrangements to brief counsel.


[ At e to E m lo e sIsured Perso s I


National Insurance Scheme, through its Local Offices and
its Camp& Bent Streets Office Records Section, has begun
the process of changing Temporary Social Security numbers
to Permanent Social Security Numbers.

The Temporary Social Security numbers are those beginning
with B-9..., GLO, LLO, ELO, BKLO, MLO, FWLO, PMLO,
MDLO, LELO, KPLO, MALO, CLO, NALO, BLO.

All insured persons with Temporary Social Security numbers
must visit the nearest National Insurance Office to make the
change.

NIS- OFFERING AND GUARANTEEING SOCIAL PROTECTION.


farming methods and
improving the way forests are
managed.
By doing so, communities
can explore livelihoods that are
less harmful to the land and
boost their physical well-being
with better access to the clean
air and water that only healthy
forests can provide,


Time


communities that live in those
regions.
CI's Center for
Environmental Leadership in
Business is helping to develop
conservation carbon projects in
China, where multinational
companies are increasing their
presence and showing interest
in investing in China's forests.


In October 2004, the 3M
Foundation committed $3
million to support CI's strategy.
CI is also working with
partners to get approval for
forestry projects that meet
Kyoto standards in Ecuador,
Madagascar, and the
Philippines. (Conservation
International)


International B T RE UT
Commitment to
Carbon Forestry AT
For the past three years, CI
has been designing projects that A
meet international climate
mitigation standards and TEL:225-4475/226-3243-9
support the biodiversity and ...................... ...................-...------. .


li


Sunday Chronicle ApQriI 1,2007,


Page VII


I






-.. ... .. --- -- ---,------,,y Ch o ic-.-p ,7,)4- 17,


Invitation for Bids (IFB)

Cooperative Republic of Guyana
Unserved Areas Electrification Programme Hinterland Project
Preparation Component
LO-H03/SF-GY.
Procurement Wind Turbine (supply and installation),
and Anemometers
ICB G-o2-2007

1. This Invitation for Bids follows the General Procurement Notice for this Project that appeared in
Development Business, issue no. 578 of 16"' March 2002.

2. The Government of Guyana has received financing from the Inter-American Development Bank
towards the cost of Unserved Areas Electrification Programme which includes a Hinterland Project
Preparation Component. As part of its Hinterland Strategy the Government intends to conduct several
demonstration projects and. it intends to apply part of the proceeds of this loan to payments under the
Contract for the procurement and installation of a wind turbine and anemometers. This contract will be,
financed from IDB loan resources. Bidding will be governed by the Inter-American Development
Bank's eligibility rules and procedures.

3. The Office of the Prime Minister invites sealed bids from eligible and qualified bidders for the supply of:

LotI Four (4) anemometers and four (4) data loggers and two (2) installation kits.
Lot 2 One (1) 15 kW wind generator of cut-in wind speed 8 mph or lower with suitable
controller for battery charging and support tower: 180 to 200 AH 12V deep cycle lead-acid
battery; and 10 kW. synchronous inverter, all to be delivered at Orealla, Region 6 with related
installation services.

The delivery period is thirty (30) to sixty (60) days from the award of each contract.

.4. Bidding will be conducted through the International Competitive Bidding (ICB) procedures specified in
the Inter-American Development Bank's Policies lor the Procurement of Works and Goods financed by
the Inter-American Development Bank, and is open to all bidders from Eligible Source Countries as
defined in the Policies.

5. Interested eligible bidders may obtain ilir!hir inoation from the Office oftthe Project Implementation
Unit at the Office of the Prinme Minister and inspect the Bidding Documents at the address given at
paragraph 7 below from March 15. 2007 to Mav 7, 2007, Mondays to Fridays during the hours 08:00 to
16:30h.

6. Qualifications requirements include: [ii' ider's Financial Capacity, Experience and Technical Capacity,
delivery schedule, responsiveness to aill lots. A margin of preference for eligible national contractors
shall not be applied. Additional details are provided in the Bidding Documents.

7. A complete set of Bidding Documents in English may be purchased by interested bidders in person or on
the submission of a written Application to the address below and upon payment of a non-refundable fee
of$5,000 Guyana dollars. The method of payment will be by cash or Manager's cheque,

Office of the Project Implementation Unit
Office of the Prime Minister
Wight's Lane
Singston
':"RGETO',.N,GUJYANA

The Bidding Documents ml nc sent to interested eligible bidders outside of Guyana in electronic form
at no cost. Request for Bidding Documents may be sent to the
e-mail address: uaep-piu@electricity.gov.gy.

8. Bids must be delivered to the address below before 09:00 h, Tuesday May 8,2007.
The Chairman
National Procurement and Tender Administration Board
(northwestern building)
Ministry of-Finance
Main & Urquhart Streets
Georgetown, Guyana

Electronic bidding will not be permitted. ,Late bids will be rejected. Bids will be opened in the presence
ofthe bidders' representatives or anyone who choose to attend in person by 09:00 hours, Tuesday, May
8,2007. All bids must be accompanied by Bid Security in an amount of:


Lot I
Lot 2


US $500 or G; 00.000
US $S IO, 0(I GOr'2,00t),0000


9. Bidders registered in Guya:na must subnit ihe relevant Guyana Revenue Authority and National
Insurance Scheme Compliance ',erliticafes indicating that they havc metl their Income Tax and NIS
obligations.


r -- --------- _










WORLD,



LEADER

I grew up in a large, close family. My parents and I
grandparents all have the kind of relationship I want;
I've had crushes throughout school, but I had high stan-
dards and didn't want to waste my time on the boys
where I lived.
There was only one guy I contemplated dating, but we
were friends and pretty much when we first met-and were
crushing on each other-we decided a relationship between
us wouldn't work. So I dated another boy.
Things started great. For awhile I thought someday
we'd have the kind of relationship my parents and grand-
parents have. However, when things got bad, the only one
I felt comfortable talking to was my guy friend. As things
got worse with the boyfriend, I talked even more to my
friend.
Finally last summer I tried breaking up with my boy-
friend. He didn't take it well, and for fear of what he'd do,
I stayed with him. In August my friend left for school.
We were hanging out one last time before he went, and I
decided to tell him I liked him as more than a friend. He
said he was feeling the same for me. I
Well, we ended up kissing. Hormones kind of took over,
and we had sex. We decided it was best not to tell anyone,
especially my boyfriend. After about a week though, guilt
kicked in and I told my boyfriend I cheated. He was furi-
ous, but forgave me. I promised him I would never talk to
my guy friend again.
That didn't work. I missed him, so we've been keep-
ing in touch. He always asks how things are going with
my boyfriend. I'm afraid to ask what he feels because I'm
afraid of the answer. I don't want to break up with my
boyfriend because I don't want to be alone.
Will someone please tell me what I should do!

BLYTHE
Blythe, in 1820 an American congressman from North
Carolina named Felix Walker made a speech which was both
tedious and full of nonsense. When his colleagues in Con-
gress criticized him, he assured them he hadn't been ad-
dressing them, but was merely saying what would go over
well in his home county of Buncombe, North Carolina .
Ever since then bunkum, or just plain bunk, have been
synonyms for claptrap. To "debunk" something is to take
the bunkum out of it. We understand why you are con-
fused. We are surrounded in bunkum, and no one seems to
notice.
In January we received the annual pocket almanac."The
Economist" magazine sends subscribers. The almanac lists
tiny Aruba as the place with the highest divorce rate, fol-
lowed closely by the United States.
It has always struck us as odd that the US, the tradi-
tional world leader in divorce, is also the country most pro-
lific in offering relationship advice to the rest of the world.
Perhaps the two facts are connected. According to the
director of the largest American marriage education organi-
zation, every couple has ten areas of incompatibility they
will never resolve. This isn't a problem, she clainis, be-
cause we know "absolutely" you can take any couple, put
them in a marriage class, and the women will "walk out .
and say, 'I married the most wonderful guy.'"' It's simply
a matter of learning a set of skills to make the relationship
work.
For decades this idea has persisted: there is a technique
to transform a poor choice of a partner into a good choice.
That idea is bunkum, and the divorce rate proves it.
Your parents and grandparents have given you the per-
fect example of what it means to be well-married. It is al-
most part of your DNA. They have shown you what to
look for.
But if you continue to ignore the warning signs of'
a bad relationship, you will help maintain the United I
States as a world leader in a most undesirable category.
WAYNE & TAMARA

Authors and columnists Wayne and Tamara
Mitchell. can be reached at
www.WayneAndTamara.com.
Send letters to: Direct Answers, PO Box 964,
Springfield, MO 65801- or email:
DirectAnswers@WayneAndTamara.com.
L- Ill ,-- ._ ,I !1 1I 11 I1 I1 Iil


--- ~9ur~-------u^rmrisrrnnl^~rl r~-mlt~r r q~*r~ri~x::


~ ~I q ~


p a96 HII


Sunday Chr.pniclets.Aptl 1,.200.,






~~ay ~ Y~26O'7' Paw~ IX"


LITERARY


Clive Lloyd's


Living for Cricket


By Petamber Persaud
LIVING for Cricket is about
the life and exploits of Clive
Lloyd as an extraordinary
cricket all-rounder- whose
childhood dream was "to play
cricket to the highest possible
level and to travel the world
doing it" that was his idea
of heaven.
That dream of Lloyd became
reality at time when the West
Indies team was coalescing into
world champion and when
world cricket was tested on all
fronts, surviving modifications,
controversies and "glorious un-
certainties".
The dream and reality were
the same differing only in the
course of making the dream a'
reality, a process which was en-
lightening, entertaining and in-'
spirational.
For the reality, we go to the
scorecard: Clive Lloyd played
490 first-class matches for
Guyana, Lancashire and the
West Indies, recording over


31,000 runs, averaging over
49.00, including 79 centuries,
114 wickets at an average of
36.00 and held 377 catches. In
the 87 ODIs he played, Lloyd
scored 1,977 runs, averaging
over 39. 00. He played 110 Test
matches, scoring 7,515 runs (av.
46.67), including 19 centuries
and held 90 catches.
The dream started in the
early 1950s in Queenstown,
Georgetown, Guyana, a few
years after Clive Hubert Lloyd
was born in 1944. Lloyd admit-
ted it was normal then to see "a
somewhat gangling youth either
wielding an oversized bat made
of local wood- left-handed or
bowling right-handed and hop-
ing to knock over the cardboard
box which served as the
wicket".
And he was in good com-
pany with his first cousin,.
Lance Gibbs, Colin Wilshire
and Richard Hector. The fa-
mous Demerara Cricket Club
of which he was a member for
"as long as he can remem-,


ber" was a few doors away and
"Robert Christiani lived just
up the road...the same
Christiani that we had heard
radio commentators talk
about and we had read about
playing for the West Indies in
far-off lands".
He tells how grateful he was
for the support he got from
Fred Wills and Berkeley Gaskin
andiothers in the early days of
his cricket career. A career that
almost aborted due to eye prob-
lem and lost of his father, the
breadwinner of the family. A
game he wanted to abandon
when he was dropped from the
West Indies team in 1973.
Because he was living for
cricket, he was able to make
many good decisions along the
way the first of which was to
quit his job at the hospital in or-
der to be included in tour party
for India and Sri Lanka, his first
Test call of duty. Later,.he was
involved in the Packer Affair, an
event that revolutioAised the
game night cricket under lights,


GUYANA SUGAR CORPORATION INC.




The Materials Management Department, Guyana
Sugar Corporation Inc (GuySuCo) as part of its
Procurement Policy requests the following


information annually.


Acopy of valid Business Registration.
A copy of audited Financial Statement for the
previous year.
A copy of tax certificates and social security
compliance in country of registered business.
Value Added Tax Registration Number


Kindly forward documents for the to the address below, stating
clearly Pre-qualification Documents on the envelope: -

Materials Management Department
Guyana Sugar Corporation Inc.
Ogle Estate,
Ogle, East Coast Demerara.
Guyana.
South America.

N.B. Failure to supply the above mentioned documents by April 30,
2007 will result in your Company's name being removed from
GuySuCo's Approved List of Suppliers for the year 2007.


artificial pitches, colour clothing
and white ball!
On the matter of cap-
taincy, Lloyd took the best of
each leader and was


Please see page XV


BUILDING CONSTRUCTION




d. L CPORATION

JM. JaduCorp.
Premier Real Estate Development & Construction Firm In Florida And
The Caribbean
Residential Commercial Lite Manufacturing Office Condo
Warehouse School Hospitality
Contact: U "Jonathan" Jadunandan
001 561-337-4788
Swww.jmadu.com
Jonathan jmiadu.com
or ujadu@yahoo.com
A State of Florida Certified General Contractor
Place Of The Toughest
Building Code In The World


Invitation to Tender
Office of the Regional Democratic- Council
Region #10, 19 Republic Avenue, Mackenzie, Linden


Contractors who have been pre qualified by
the Regional Tender Board of Region #10
(upper Demerara/Berbice) for 2007 are invited
to purchase bid documents for works to be
done in the following categories:
Category #1 BuildingsCategory #3 Roads
1. Rehabilitation of Magistrate Court
Christianburg- Wismar
2. Construction of Aroima Nursery
School, Berbice River
3. Renovation ofAnnex Bldg- Wismar
4. Rehabilitation of Agriculture Office
Bldg. Christianburg.
5. Rehabilitation of Teacher Qrts -
Retrieve.
6. Rehabilitation of Head teachers
Quarts Kwakwani.
7.. Rehabilitation of maternity ward
UDH- Blue Berry Hill.
8. Construction of Teachers Qrts -
Mount Carmel, Berbice River.
9. Rehabilitation of Teachers Qrts -
Anarika.
10. Rehabilitation of Teachers Qrts -
Hipani Oval.
11. Internal restructuring at Vivienne
Parris Health Centre- Mackenzie.

Category #2 Infrastructure
12. Construction of Administrative Boat
House- Kwakwani.
13. Construction of Administrative Boat
House Wismar.
14. Rehabilitation of fence, trestle &
generator hut One Mile Health
Centre.
15. Construction of Outhouse, water
tank trestle and incinerator 47 Miles
Health Post.
16. External works to Regional
Administrative Main Building -
Mackenzie.
17. Rehabilitation of fence, pure water
system, walkway and erosion
control Canvas City Nursery School.
18. Construction offence S.S.O.W. Qrts
Industrial Area McKenzie.
19. Rehab. of fence Wismar
Christianibuirn Secondary School.


20. Construction offence, Silver City Agri.
Plot.
Category #3 Roads
21. Rehabilitation of Bulletwood Street
Road- Phase#2.
22. Rehabilitation of Redwood Crescent
Road- Phase #2
23. Rehabilitation of Fairs Rust
Residential Road.
24. Rehabilitation of Access Road South
Amelia's Ward.
Tender document can be uplifted from the
Secretary Regional Tender Board, 19 Republic
Avenue, Linden from April 3, 2007 for non-
refundable fee as follow:
Category 1 $1,000
Category 2 -$1,500
Category 3- $2,500
The following requirements must be met;


Tenderers must be addressed to:


Chairman
Regional Tender Board
Region #10
Tenders are to submit with their
tenders Valid Certificate of
Compliance issued by the
Commissioner of IRD and General
Manager NIS.
The work tendered for must be clearly
marked at the top right hand corner of
the envelope.
Tenderers or their representatives
may be present at the opening of the
tenders on April 18,2007 when tender
closes and opens at.9 am.
The Tender Board is not bound to
accept the lowest tender and retains
the right to reject any tender without
assigning a reason.
Sgd. Henry Rodney (Mr.)
Regional Executive Officer
Region#10


I a-v u U.


Surda .Chronicie: A._


Pf] X *tC ,,,:


"&.aa















Invitation for Bids (IFB)


Cooperative Republic of Guyana
Unserved Areas Electrification Programme Hinterland Project
Preparation Component
LO-11o3/SF-GY
Procurement of Solar Home Systems and Accessories
ICB G-ol-2007


1. This Invitation for Bids follows the General Procurement Notice for this Project that appeared in
Development Business, issue no. 578 of 16h March 2002.
2. The Government of Guyana has received financing from the Inter-American Development 'Bank
towards the cost of Unserved Areas Electrification Programme which includes a Hinterland Project
Preparation Component. As part of its Hinterland Strategy the Government intends to conduct several
demonstration projects and it intends to apply part of the proceeds of this loan to payments under the
Contract for the procurement and installation of solar home systems. This contract will be financed from
IDB loan resources. Bidding will be governed by the Inter-American Development Bank's eligibility
rules and procedures.
3. The Office of the Prime Minister invites sealed bids from eligible and qualified bidders for the supply of:

Lot1 sixty two (62) Solar Home Systems, including batteries, cable, charge controller and
photovoltaic panels to be delivered at Capoey, Region 2 withrelated installation services.
Lot2 one hundred and four (104) Solar Home Systems, including batteries, cable, charge
controller and photovoltaic panels to be delivered at Kurukabaru, Region 8 with related
installation services.
Lot3 one hundred and four (104) Solar-Home Systems, including batteries, cable, charge
controller and photovoltaic panels to be delivered at Yarakita, Region I with related
installation services.
Lot 4 sixty nine (69) Solar Home Systems, including batteries, cable, charge controller and
photovoltaic panels to be delivered at Muritaro, Region 10 with related installation
services.
The delivery period is thirty (30) to sixty (60) days from the award of each contract.
4. Bidding will be conducted through the International Competitive Bidding (ICB) procedures specified in
the Inter-American Development Bank's Policies for the Procurement of Works and Goods financed by
the Inter-American Development Bank, and is open to all bidders from Eligible Source Countries as
defined in the Policies.
5. Interested eligible bidders may obtain further information from the Office of the Project Implementation
Uhit at the Office of the Prime Minister and inspect the Bidding Documents at the address given in
paragraph 7 below from'March 15, 2007 to May 7, 2007, Mondays to Fridays during the hours 08:00 to
16:30h.
6. Qualifications requirements include: Bidder's Financial Capacity, Experience and Technical Capacity,
delivery schedule, responsiveness to all lots. A margin of preference for eligible national contractors
shall not be applied. Additional details are provided in the Bidding Documents.
7. A complete set of Bidding Documents in English may be purchased by interested bidders in person or on
the submission of a written Application to the address below and upon payment of a non-refundable fee
of $5,000 Guyana dollars.
Office of the Project Implementation Unit
Office of the Prime Minister
Wight's Lane
Kingston
GEORGETOWN, GUYANA
The method of payment will be by cash or Manager's cheque. The Bidding Documents may be sent to
interested eligible bidders outside of Guyana in electronic form at no cost. Request for Bidding
Documents may be sent to the e-mail address: uaep-piu(electricity.gov.gy.
8. Bids must be delivered to the address below before 09:00 h, TuesdayMay 8, 2007.
The Chairman
National Procurement and Tender Administration Board
(northwestern building) .
Ministry of Finance
Main & Urquhart Streets
Georgetown, Guyana
Electronic bidding will not be permitted. Late bids will be rejected. Bids will be opened in the presence
of the bidders' representatives or anyone who choose to attend in person by 09:00 h, Tuesday May 8.
2007. All bids must be accompanied by Bid Security in an amount of US $4.250 orG $850,000.
9. Bidders registered in Guyana must submit the relevant Guyana Revenue Authority and National
Insurance Scheme Compliance Certificates indicating that they have met their Income Tax and NIS
obligations.


THE sixth annual Guyana Awards (Canada) Gala will take
place on Saturday, May 26, 2007, Guyana's Independence
Day, in the Grand York Ballroom at the Sheraton Park-
way Hotel, Toronto and is expected to feature the 'Who's
Who' in the Guyanese community.
This grand celebration of the highest levels of achievement
by Guyanese in Canada will feature an exciting programme of
entertainment including a special appearance by Byron Lee and
the Dragonaires, and performances by Victor Shim and Juno
Award winner Simone Denny.
This year's Gala promises to be a memorable evening, cel-
ebrating the achievements of the Guyanese Diaspora. Byron
Lee and the Dragonaires will be coming directly from Jamaica
to participate in the celebrations.
Initiated in 2000 as part of the Guyana Independence
commemorations, the Guyana Awards (Canada) recognizes
the contributions of individuals and organizations in the
Guyanese community toward the promotion and develop-
ment of Guyana, Guyanese Heritage and Culture in
Canada and the achievement of excellence by community
organizations and distinguished individuals.
Building on its successes in previous years, this year's event
will make a strong statement about the high standards of lead-
ership and excellence achieved by Guyanese in Canada and will
instill a sense of pride in the Guyanese community.
This premier event in the Guyanese community has won
tremendous support from Guyanese across Canada and another
sold out event is anticipated.
The Guyana Awards Gala is held under the distin-
guished patronage of the Consul General of Guyana.
The Consulate is urging members of the Guyanese commu-
nity in Canada to submit their nominations early for the Awards
in the following ten categories: Business Excellence, Academic
Excellence, Special Achievement, Leadership, Community Ser-
vice (organization), Community Service (individual) Lifetime
Achievement, Youth Award, Media and Exemplary Service (non-
Guyanese).
A panel of judges consisting of eminent persons from within
the Guyanese Community in Canada will evaluate the nomi-
nees and select the winners.
The Guyana Awards Gala is co-sponsored by
Moneygram, Atlas International Freight Forwarding inc.,
Shabnam Radio and Guyana Current. Hon. Consul Gen-
eral, Danny Doobay, has urged the business community
to support the Guyana Awards programme by ensuring full
sponsorship for each of the ten awards
Some notable winners of the Awards include:
* Judge Vibert Lampkin Lifetime Achievement
* Dr. Bhudendra Doobay Leadership
* Hon. Ovid Jackson Special Achievement ,
* Ken Singh Business Person
* Basil Punit Academic Excellence
* Eric Rodrigues Businessperson
* Ned Blair Community Service
* Cecil Moore'- Lifetime Achievement
* Clive Lloyd Lifetime Achievement
* Rohan Khanai Lifetime Achievement
* Lance Gibbs Lifetime Achievement
* Alvin Kallicharran Lifetime Achievement
* Roy Fredericks Lifetime Achievement (Posthumously)
* Joe Soloman Lifetime Achievement
* Basil Butcher Lifetime Achievement
* Councilor Sherene Shaw- Special Achievement
* Norman Sue Business Person
* Laura Creavalle Special Achievement
* Ron Fanfair Media
* Kissoon Naraine Community Service
* Kevin Samaroo Community Service
* Last Lap Linme- Community.Service
* Guyana Pioneer Fund Raising Group- Community Service
* Peel Guyanese Association Community Service
* Guyana Burn Care Unit Community Service
* Guyana Christian Charities Community Service
* Calgary Guyanese Association Community Service
(Please contact the Guyana Consulate (416-494-6040
ext. 22) for additional information and nomination forms.A
complete portfolio of Awards information and nomination
forms can be downloaded from the website http://
www.guyanaconsulate.com/. Nominations must be submit-
ted before April 10, 2007 to be considered. Additional in-
formation on sponsorship can be accessed by calling 416-
494-6040, ext. 29.)


Page X









Guyana Mt> ,ee

MODELS display the "Guyana Metagee" collection of designer Donna Ramsammy-James.
The collection, one of three by the Caribbean-based Guyanese fashion designer, is being dis- .
played as part of Banks DIH's "F/un, Food and Fashion Fiesta" which ends on April 7. -


SPEIUAL weaaing anniversary greetings are extended to
I Mr and Mrs Ravie Parkins of the USA who celebrates
their fourth anniversary on April 4. They get greetings
from their relatives and friends in Guyana.


SNEW YORK


sxUS$349


TRINIDAD
.-


i .-J .... ----.,,,"
FT. LAUDERDALE


TRAVELSPAN
GT Inc.
Call Us At Our
Corporate Office 69 Main Street, Georgetown.
Tel: 227-1701
Branch Office At 82 North Public Road,
Rosehall Town, Corentyne Berbice.
Tel: 337-5200
Book online @ www.travelspangt.com
or call your local Travel Agent.
SUPERIOR IN-FLIGHT SERVICE
HOT TOWEL SERVICE
FREE MOVIES FREE MEALS
FREE DRINKS GIVEAWAYS

FIRST CLASS SEATING
BRAND NEW STATE OF THE ART
B737-800
32 INCHES LEG ROOM
LEATHER SEATS
IN-FLIGHT REPRESENTATIVES
WARM AND WELL KNOWN FLIGHT
ATTENDANTS


UNITED STATES
MANHATTAN 110 W 34, Su 300 NY Tel: 212-268-4632
QUEENS 104-04 111 th St. Tel: 718-323-0606
121-10 Liberty Ave. Tel: 718-845-0437
BROOKLYN 1569 Flatbush Ave Tel: 718-859-3007
116 Nostrand Ave Tel: 718-774-9725
FT LAUDERDALE 4236 N.S Rd 7 Tel: 954-717-4124

TRINIDAD
CHAGUANAS Mid Centre Moll Tel: 868-665-3383/4
PORT OF SPAIN Capital City Mall Tel: 868-625-0800
VALPARK Volpark Shopping PIz Tel: 868-645-1604
SAN FERNANDO The Mall Mon Chagrin Tel: 868-652-4789


50'X36'= 3,600 Square Feet
100'X95',Transported Land
Built SOLID In April 2003, No Shortcuts Taken During Construction!
Located On Stelling Road, This Essequibo Coast House Contains
5 Bedrooms
#1= 9X13 (117 Sq. Ft.) #2= 14X19-(266 Sq. Ft.)
#3=11'X10'- (10 q.Ft.) #4= 11'X10'(110) =1110'-(10Sq.Ft.)
S#5 = 18'X13'/ I 6'X10' (294 Sq. Ft.)
Air Conditioned Master Bedroom[Office, 2 Full Bathrooms
10'X14'- Reinforced, Concrete Generator House = (140 Sq. Ft.)'
10'X14'- Vehicle Garage / Storage Building (280 Sq. Ft)
Extra Storage Building, Concrete Water Tank Stand For 6 Tanks
Wooden Water Tank Stand For 1 Tank, Furnished, Fully Fenced
Compound, Motion Sensor Security Lights
Fully Grilled Windows & Doors
Shown by appointment only
$22Million
Contact Information:
774-4624, 610-0238
email: Roberts@guyana.net.gy


i


;unday Chronicle Apnl 1, z00/


Page XI
























CAST Members of the Guyanese Roots and Rhythms show help Kirk Jardime up in a scene
where he tries to demonstrate the "hooks" of Guyanese cricket great Rohan Kanhai. The
show ends tonight at the National Exhibition Complex, Sophia.


MATICORE NIGHT: Ladies dance to the beat of Tassa drummers during the Guyanese Roots
and Rhythms Show which ends tonight at the National Exhibition Complex, Sophia.


HENRY Rodney make its through the feet of the moongazer as part of folkloric feature of
the Guyanese Roots and Rhythms Show which ends tonight at the National Exhibition
Complex, Sophia.


BUSH DI Dl: The Bush Di Di comes out among the audience as part of the folkioric feature
of the Guyanese Roots and Rhythms Show which ends tonight at the National Exhibition
Complex, Sophia.




MINISTRY OF HEALTH

y/ NATIONAL AIDS
PROGRAMME SECRETARIAT



A modern HIV/AIDS Centre is now open to the General Public
at the National AIDS Programme Secretariat, NAPS, College
Road and Hadfield Street.

If you are looking for any kind of up-to-date information on
STI/HIV/AIDS, come in to its office where you can also meet
with experts who can relate more information on this issue.
Learn about STI/HIV/AIDS in an atmosphere which is
comfortable and discrete. For more information, call 223-7138
or 223-7139. The centre opens, Monday ot Friday from
9am -4pm.


MISS GUYANA UNIVERSE 2006 Alat a Ernest (left) and model Chelan Yhap strike a pose
on the mound in the National Exhibit )n Complex, Sophia at the opening of the Guyana Gift
and Craft Show.







icie April 1,2007 XIIi


Will y






fooled


ou be


can have serious consequences. A town clerk in Canada had a
heart attack after his colleagues played an April Fool's joke
on him. They sent an e-mail saying the deadline for a big
project he was working on had been moved forward a week.
He survived, but the council passed a resolution banning April
Fool's jokes.
This also applies to the emotional, as well as the physical,
fallout. There is a fine line between catching someone out
and humiliating them or hurting their feelings.
"In Romania, during the Ceausescu era, one newspaper printed
an article as an April Fool's joke saying all political prisoners were
being freed," says Wainwright.
"People started turning up at prisons and waiting for family
and friends to be released. It didn't go down well when it was re-
vealed to be a hoax."
Saddam Hussein's feared son Uday was also reportedly a big
fan of the day and would pull pranks like telling people food ra-
tions were being lifted. Side-splitting stuff.
Online frenzy
The internet has given the day a whole new lease of life, says
Wainwright.
Gags include advertisements- for free coffee cup holders
asking users to click their mouse on an on-screen button. This
. somehow makes their disk drive open, hence the free cof-
fee cup holder.


today?


The art of fooling around


It's 50 years since Panorama pulled off the
most celebrated April Fool's spoof and duped
Britain and beyond about spaghetti crops in
Switzerland. So what makes a great April Fool's
joke?
Panorama's now infamous spaghetti-tree spoof is considered a
broadcasting milestone as it is believed to be the first time television
was used to stage an April Fool's hoax.
Made on budget of just 100, it told the tale of spaghetti har-
vesting in Switzerland and described how the seemingly bumper crop
was at risk of late frosts, creating a disastrous situation for growers
all over Europe.
The spoof documentary showed people in the Swiss Alps
plucking strands of spaghetti from trees and laying it on the
sun to dry. That it fooled so many was in part down to the fact
that pasta, at the time, was deeply exotic in a nation reared on
meat and two veg. Then there was the commentary provided in
serious, hushed tones by that giant of broadcasting, Richard
Dimbleby.
The hoax repeatedly tops lists of April Fool's gags, which typi-
cally include the one about moving Stonehenge to the base of Mount
Fuji in Japan, plans to make the whole M25 run clockwise and anti-
clockwise on alternate days, the internet being shut down for clean-
ing for 24 hours, whistling carrots,'left-handed hamburgers and Big
Ben going digital.
Part of the charm of April Fool's is that it's an equal-opportu-
nity day, say fans. From whoopee cushions to TV pranks broadcast
across the world, almost everybody has the chance to join in. It is a
global phenomenon, with most cultures having a version of it.

Fool's equation
But only a few gags achieve the longevity of the Panorama stunt,
which is still talked and written about across the world 50 years on.
So what makes a great April Fool's joke?
A really good gag needs to be both ridiculous and believable, say
those who have studied the craft. It's a hard trick to pull off and
most pranksters end up with jokes that are ridiculous, but not at all
believable, says Alex Boese, curator of the Museum of Hoaxes in
San Diego, California.
"The really good ones succeed at making us believe some-
thing that we recognize, in hindsight, we really shouldn't have
believed because it's completely preposterous," he says.
"In a humorous way they teach us something about the limits
of our own knowledge. They show us how unfamiliar many of the
things around us that we take -for granted are." -
The question has employed some of the world's finest
brains. The eminent wartime scientist Reginald Jones, who
headed the Directorate of Scientific Intelligence at the Air Min-
istry during World War II, researched the perfect April Fool's
gag. He came up with the equation: induction followed by in-
congruity.
'Trustworthy style'
"Basically he was saying lull them into a false sense of security,


then drop in absurdities that just keep getting more and more ex-
treme," says Martin Wainwright, author of the newly published
Guardian Book of April Fool's Day.
Both Boese and Wainwright rank the Panorama prank as the
best ever. It pulled off the trick of not only fooling the easily per-
suaded, but also left the sceptics with a nagging doubt about
whether it was true or not.
One of the things that makes it so great is that it was ex-
ecuted by a programme synonymous with sober and serious
reporting. Getting the authoritative figure of Dimbleby to do
the commentary was also a master move.
'Television was limited in those days to one BBC and one ITV
channel and it was possible for a programme like Panorama to hold
the nation's attention in a way inconceivable nowadays," says Wain-
wright.
"Small details like the ageing wicker harvest baskets added to
the realistic air. In his engaging and entirely trustworthy style,
Dimbleby told the audience 'we end Panorama tonight with a spe-
cial report from the Swiss Alps'. Cue the marvellous film, brilliant
commentary and the swelling music."

Political prisoners
There was always the risk
that it might offend, and some
people did complain to the
BBC, but most loved it. Tony
Frost e-mailed the BBC's On
This Day website with his
memories of the hoax he was
eight at the time.
"It wasn't until many
years later, when I was in i
my late teens, that I
realized this was perhaps .,
not the case [that spaghetti J,.
grew on trees]. Even now, as
an adult, I'm hopeful of
spotting one or two trees as
I drive around the country
and the Continent. It's one
of the great April Fool's .i,
jokes and one I'll always
cherish."
An indication of its quality i
is that every time it's shown,
people still fall for it, says Wain-
wright.
But there is a serious side
to pulling off a successful
prank. A gag should do no
harm and should not place -
anyone in a dangerous situa- ,
tion, say the experts.
Disregarding these rules


SPAGHETTI TREES: Why is Panorama's 50-year-old April
Fool Day about Spaghetti growing on trees the best April
Fool's hoax ever?
Wikipedia, the online encyclopaedia anyone can edit, is par-
ticularly exposed. Last year someone swapped the "protect" and
"delete" buttons on every page, so that anyone trying to stop an
article from being edited ended up deleting it.
But ultimately people either love it or loath April
Fool's Day. For all the hates there is one consolation
this year, it's not a work day so no mugs glued to desks
and no phones covered with sticky tape hopefully. (BBC
News Magazine)


W lo
Il i ..a.,.

o e j' t u, 'h
^'I [*^^(tIout v ~yet Ii C





Xv Sunday Chronicle April 1, 2007

--.
Tiny

animals

stop

W 'Australian

mine
THE discoieri of tins,
cate-delling animals
measuring just 4mm in
length has halted plans to
,..., develop a $10bn It5bni
mine in liestern
.Australia.
SE n t I r on mental P fti
protection officials rejected
the ion re nune proposal
fr rn morning giant Rio Tinto
hen I spec ies of
'.troglobitle "ere dJiscoered
The tnroglobie are t ing
cae-dvelling creatures
**. -which re.emIbe piders
They feed tin organic
matter deep underground
and ill die if e'.posed to
ultraviolet ioght outside their






M(IDELS Tenesha Harding (left) and Nadia Shung (right) are the faces of the original Polar beer in Guyana. At centre is former Miss Guyana World Olive
Go: tal, who is the Vice President (Marketing) for Polar Beer and Beverages. Gopual said some 500 to a million cases of Polar is smuggled into Guyana '
eve/ year. She said the popular grey tin Polar is designed for Venezuela, from where it is smuggled into Guyana. She said Polar Beer and Beverages now
holds the franchise for the bder in Guyana and she is urging Guyanese to buy the Polar in the bottle or in the blue tin. The chairman of
Western Australia's
SEnvironmental Protection
Authority (EPA), Wally
cor te Yo1V ur m Cox said'the proposed
... .. ..... -mine would cause the
.. extinction of at least five of
the newly-discovered
species.

S ;. ". -.. Approval process
4 iA Rio Tinto spokesman
"said the company would
Sr 'appeal against the decision.
"It's just part of being
in the mining business," said
X" ..the spokesman. "We
-'--' support the EPA process in
AJYA3,.JaX :cu Zzi s general."
-- 2----i--- 0.. A .-" 0 "Opposition environment
I.. spokesman Steve Thomas said
..4 ;.I.. .. %&- the EPA ruling put future
-..,developments in the state at
.9ml 'risk.
"Because [the
government has] upgraded
4 the requirements of the
A~1 mining sector in the
.. environmental approvals
process to find what's
There and find things," he

Rose Hall oustonComplex eyes but have long front
r.M Bagwandin Mr. Collin a. T 4gs or feelers to find
"el: 337-4649. Tel: 226-5717. ...'"Name".You.f.r ust their way around in. the
f ax:. 337-4650 Fax: 226-7897 dark. (BBC)






sunda~theA*"~_TFr"~0~i7" ----.-..__-.-. ~


Clive





Lloyd's

From page IX
cognisant of the ill-advised machination of others. He said
while "Sobers was an attacking skipper, always willing to take
a chance in an effort to win, Kanhai was cautious and defen-
sive. The perfect skipper, I felt, would have been a blend of
the two".
Lloyd made himself into one of the best captains of the game
even though he had little training in that area. But cricket was his
life and he was living for cricket and he learned very fast. Also he
had a few excellent precedents to follow including Frank Worrell
and Jackie Bond of Lancashire where Lloyd spent the happiest days
of his cricket career.
Aptly titled, the book, Living for Cricket, deliberately
and methodically describe the story of one of the game's
most successful captains his tears of despair, his shrieks
of triumph, his fears of- living apart from his family, see-
ing the hurt of his wife when he was bad-mouthed, deal-
ing with injuries, lost, bad umpiring, bad selection poli-
cies and insularity of island "peoples. And the writer did
not hold back his punches in describing the glory and dis-
repute of the game.
Living for Cricket is outspoken and also inspirational so
much so it can also be read as a manual for success or how
not to fail.
Because he 'was living for cricket, his book was well planned;
he was in command of the material he wanted to share.
Living for Cricket is made up of sixteen chapters, starting with,
"The Early Days" and moving chronologically to "The Future" re-
vealing the ups and downs of the game, the modifications, and the
debates. He gave insight into league cricket the happiest time of
his cricketing career, and World Series. Cricket the need to pay
cricketers their just dues so they can perform well.
On numerous occasions, he-admitted that money was not a mo-
tivating force in his cricket but he was always in the money good
cricket deserves handsome rewards.
He knew the mood of the fans/spectators and he
played them; keeping speech engagements, filling coach-
ing assignments and signing autographs, all part of the
game. You couldn't divorce the fame from the claim and
demand of the fan, no crowd no cricket, no crowd no
money no cricket.
All that apart, it is chapter fourteen "The Family Man" which
is the most poignant and charming to read; the superstar, the
"supercat" was a regular human in his relation to his wife,
Waveney, and two daughters.
SInthe final chapter, Lloyd declared, quoting Frank Sinatra, "Re-
grets I've had a few, but then again too few to mention".-
So it easy to see why the book should be a must read for any-
one who has any aspirations to be somebody.
The book is valuable to sportsmen and sports-
women, in particular, who aspire to get to the top of
their game.

Responses to this author telephone (592) 226-
0065 or e-mail: oraltradition2002@yahoo.com
Literary happening
*THE JOURNEY part VIII is set for Wednesday April
4, 2007 at Castellani House. The theme of this
evening of literature is 'this sporting life' featuring
sport and pastimes in literature from around the
world including 'Massa-day done' by Ian McDonald,
'The Rocking-Horse Winner' by D. H. Lawrence,
'Sonny Ramadin' by Cecil Grey, 'Seaside Golf' by
John Betjeman, 'Blasting for Runs' by Rohan
Kanhai, 'The Draught Players' by Berkley Semple,
'Juggler' by Richard Wilbur and 'Living for Cricket'
by Clive Lloyd
Just off the press is the second edition of 'Bibli-
ography of Guyana and Guyanese Writers' com-
piled and edited by Lal Balkaran, 'The Undimin-
ished Link' by Victor Waldron, Hansib 2007, and
'Cricket at Bourda'
You can now get THE GUYANA ANNUAL 2006/
2007 at Universal Bookstore, Austin Book Service,
Michael Ford Bookstore, Nigel's Supermarket, the
National Art Gallery, Castellani House, Sandra
.Goodchild of Guyenterprise Ltd., and from the
editor at telephone (592) 226-0065 or email:
oraltradition2002@yahoo.com -


TEL:2 25-447 5/226-3 243-9
u .-



Ab"V R-11S.. I- r-E CH O IL






. .. ......-. ... ..,., urday-. i '


S


CYRIL POTTER COLLEGE OF EDUCATION


Applications are invited from suitably qualified persons for entry to a programme of Teacher Training
leading to the Trained Teacher's Certificate.


Special emphasis will be placed on the training of
Seco&ndatrvyEe-VocationalPr.ograrammc..s


for the Secondary Academic and


ENTRY REQUIREMENTS.

1. The College accepts:
(i) CSEC General Proficiency grades I OR II acquired before June 1998 and grades I,
1IOR 111, from June 1998.
(ii) CSEC Basic Proficiency Grade I.
(iii) GCE 'O' Levels, Grades A, C OR E before June 1975 and GCE 'O' Levels, Grades
A, B, OR Cfrom June 1975-
(iv) The General Proficiency Grade Four (4) in Mathematics vill be accepted from
applicants for the Early Childhood, Primary Education Programmes and
Secondary Academic and Pre-Vocational Programmes whose options are not
Mathematics based, e.g. Modern Languages, Social Studies, Business Studies, Art,
English Language and Music.

2. All applicants must have currently acceptable qualifications in Enulish Language and
Mathematics.
The following programmes are available:-'

EAYLX-CHILDHQQDO
(a) A three-year Pre-Service Early Childhood Education Programme atTurkeyen.
(b) A three-year Distance Education In-Service Early Childhood Education
Programme at Region 1 (Mabaruma, Moruca, Port Kaituma), Region 2 (Anna
Regina), Region 3 (Vreed-en-Hoop), Region 4 (Georgetown), Region 6 (New
Amsterdam), Region 7 (Bartica, Kamarang), Region 9 (Annai, Lethem, Aishalton)
and Region 10 (Linden).

PRIMARY
(c) Athree-year Pre-Service Primary Programme atTurkeyen.
(d) A three-year Distance Education In-Service Primary Programme at Region 1
(Mabaruma, Moruca, Port Kaituma), Region 2 (Anna Regina), Region 3 (Vreed-
en-Hoop), Region 4 (Georgetown), Region 6 (New Amsterdam), Region 7
(Bartica, Kamarang), Region 9 (Annai, Lethem, Aishalton) and Region 10
(Linden).

SECONDARY
(e) Athree-year Pre-Service Secondary Pre-Vocational Programme (Home Economics,
Agricultural Science, Industrial Arts, Information Technology and Business
Studies) atTurkeyen.
(t) A three-year Pre-Service Secondary Academic Programme (English Language,
Mathematics, Social Studies, Science, Spanish, and Art) atTurkeyen.
(g) A three-year In-Service Secondary Academic Programme (English Language,
Mathematics, Social Studies, Science) at Region 2 (Anna Regina), Region 3
(Vreed-en-Hoop), Region 4 (Georgetown), Region 6 (Rose Hall) and Region 10
(Linden).


CONDITIONS FOR ENTRY


AGE AND YEARS OF SERVICE

Applicants for the In-Service Early Chiklhood Education, Primary and Secondary Programmes must
be over seventeen (17) years of age and must have been employed in a school for at least ONE academic
year before the comn mnc meni ti i in in!i.

Applicants tor the Pre-Service Ear'.V Childhood Education, Primary and Secondary Academic/Pre-
Vocational Programnies must have at-.ined a minimum age of seventeen (17) years on 2007-08-31.


QUALIFICFAQONS


Applicants desirous of entering the Early Childhood Education or Primary Pre-Service and In-
Service Programmes must have obtained:

(i) A rninimum of lour (4) GCE 'Y '..evel sbiects OR four (4) CSEC subjects at ONE (1) string
OR five (5) G(.E 'O' Level OR five (5) CSEC subjects at no more than TWO (2) sinrings.
(The subjects MUST include English Language, Grades 1-3 and Mathematics, Grades 1-4).
OR
(ii) A minimum of four (4) CSEC subjects, Grade 1, Basic Proficiency at no more than pne (1)I
sitting or a minimum of five (5) CSEC subjects, Grade 1, Basic Proficiency at no more than
two (2) sittings. Subjects passed must include English Language and Mathematics.,
OR
(iii) A pass at one of the Foundation lExaminations.(CPCE, GBET. GUIDE).
OR
(iv) A pass at the One -Year Certificate in Inudustrial and Social Studies programme offered by
the Critchlow Labour College.
OR
(v) Institute of Distance and Continuing Education (IDCE) Mathematics and English (CSEC
Equivalence) and Early Childhood years I and 2 programmes.

Persons applying for the three-year Pre-Vocational Programme must have obtained:
(i) A minimum of four (4) GCE 'O' Level subjects OR four (4) CSECsubjects at ONE sitting OR
five (5 GCE'O' Level OR five (5) CSEC subjects at no more than TWO sittings.


Applicants desirous of specializing in Agricultural Science
(ii) A certificate in Agriculture from the Guyana School ofAgriculture plus currently acceptable
qualifications in English Language and Mathematics.
OR
(iii) A Diploma in Agriculture from the Guyana School of Agriculture.

Applicants desirous of specializing in Home Economics
(iv) A certificate in Home Economics from Carnegie School of Home Economics and at least
TWO Home Economics subjects at the GCE 'O0' Level or CSEC Level plus currently
acceptable qualifications in English Language and Mathematics.
OR
* (v) A Diploma in Catering and Hospitality from the Carnegie School of Home Economics and
at least Home Economics Management or Clothing & Textiles at the GCE 'O' Level or
CSEC Level plus currently acceptable qualifications in English Language and Mathematics
OR
(vi) A Certificate in Garment Construction from the Carnegie School of Home Economics and
at least Food & Nutrition or Home Economics Management at the GCE '(' Level or CSEC
Level plus currently acceptable qualifications in English Language and Mathematics.
OR

Applicants desirous of specializing in Industrial Arts/Industrial Technology.
(vii) A Guyana Technical Education Examination Basic Craft Certificate or the Guyana
Industrial Training Centre Certificate or equivalent plus currently acceptable qualifications
in English Language and Mathematics.
OR
(viii) A Guyana Technical Education Examination Craft Certificate Part I or Parts I and II or
Advanced Craft Certificate or equivalent plus acceptable qualifications in English
Language and Mathematics.


(ix)


OR
A Guyana Technical Education Examination Certificate/Diploma.Part lor Parts I and It
or Parts I, II and III or equivalent.

Applicants desirous of specializing in Business Education
A Guyana Technical Education Examination Certificate in Commerce or Secretarial
Science or equivalent plus acceptable qualifications in English Language and Mathematics.


OR
(xi) A Guyana Technical Education Examination Diploma in Secretarial Science or .the
Ordinary Diploma in Commerce or equivalent.
OR
(xii) At least TWO subject areas at the CSEC Level in Business Studies.

Applicants desirous of specializing in Information Technology.
(xiii) A minimum of four (4) GCE '' Level subjects OR four (4) CSEC subjects at ONE sitting OR
five (5 GCE 'O' Level OR five (5) CSEC subjects at no more than TWO sittings. Applicants
must have a pass in Information Technology at CSEC level.

Applicants for the three-year Pre-Service Secondary Academic Programmes must have obtained:

A minimum of four (4) GCE 'O' Level subjects OR four (4) CSEC subjects at ONF sitting
and fivee (5) GCE 'O' Level OR five (5) CSEC subjects at no more than TWO sittings.
Applicants must have passes in TWO areas of specialization.


GENERAL INFORMATION

Application forms can be obtained from all Heads of Education Departments.

Before admission ro a Pre-Service Programme, successful applicants will be required to undergo a
medical examination by an approved Medical Officer.

Successful applicants to the Pre-Service F, ... .. ill be required to sign a bond to serve as a teacher
in Nursery, Prinmary, Secondary schools or Practical Industrial Centres in any part of Guyana for a
period of five (5) years immediately after completing the course.

Pre-Service students will receive a grant, which is subjectto revision fromrn time to time.

Successful applicants to the In-Service 7i ._, ,,-nr, .. il.1,.. required trosign a bond to serve as a teacher
in Nursery, Primary, or Secondary Schools in any part of Guyana for a period of three (3) years
immediately after completing the course.

Distance Education F r.... .- ill commence in July 2007. Completed application forms tfor these
Programmes must be returned to the Heads of Education Departments no later than 30' March.2007.

Distance Education tutorials will be held at least once per week for approximately four hours.

Face-co-Face sessions will he held duiiringt the vacation period for Distance Education In-Service
Programmres.

The Pre-Service and In-Service Secondary Progranmmun will commence in September 2007..
Completed application forms for these programmes must I e returned to the relevant Departments of
Education, no later than 15 h April 2007.


Page XVI


_L-Pe u nR ..







y hn Al ,20 Pag XI I


The Dentist Advises



Beating the

cost of dental

treatment
COST is definitely a major factor when considering den-
tal treatment in Guyana.
Why is it so expensive to have dental work don in the pri-
vate sector? Is the public being exploited by private dentists?
How could you know if your dentist is over charging you? Is
it possible for comprehensive dental care to be within the reach
of the low income citizen? Undoubtedly, these are burning ques-
tions and an attempt would be made to answer them.
Anyone who has made a deliberate effort to systematically
study and compare oral care delivery from an international per-
spective, would know that dental treatment is exceptionally
costly all over the world.
Many governments realize that the poor masses would not
be able to pay for treatment. In fact, when research done by
the renowned universities confirmed the enormity of the social
and economic impact on most countries, public health dentistry
was introduced as a specialized field of study.
So, since -1939 the strategy was to emphasize on preven-
tion with water fluoridation on the forefront. But even a na-
tional prevention program whose aim is to cut down cost, it-
self proved to be too expensive for some governments.
And in any case, it takes many years before a national pre-
vention programme manifests itself sufficiently to be obvious.
This fact alone often serves as a disincentive for economies to
spend scarce money on something not generally considered to
be a matter of life and death.
In addition, politicians and technocrats, quite understand-
ably so, could never be convinced that the oral health status of
the population is just as important as the numerous 'priority
services'.
Private practice has flourished mainly against the back-
drop of governments' inability to adequately provide den-
tal services for the population. As a result, numerous
quacks and charlatans openly exploit the population and
governments turn a blind eye to this unfortunate situa-
tion simply because the suffering public often has no other
place to turn to for help.
Furthermore, despite the fact that dentistry. is certainly the
most expensive career to pursue many private dentists have
capitalized on, and exploited the circumstances.
The criteria used for charging fees greatly depend on the
dentist himself. Naturally, the primary expense the patient pays
is the so-called overheads, which include rent, material, elec-
tricity, staff salaries and income tax.
Afte?'the dentist has added his personal earnings, the aver-
age cost of an extraction should be $2,500 and a filling $4500.
Prophylaxis should be in the vicinity of $6500.
Clearly, patients who prefer an air-conditioned, car-
peted office with Mozett paintings on the walls, where cof-
fee is served while you wait, must expect to pay dearly for
such luxuries.
Some dentists are encouraged and 'spoilt' by patients who
unflinchingly pay obviously unreasonable fees for simple con-
ventional procedures. And in some cases patients pay more for
simply who they are, especially business persons. Some people
erroneously evaluate the quality and standard by how much
they pay.
So, they assume that a dentist who charge high fees is bet-
ter than one who charge low fees. Incidentally, patients who
sometimes contemplate the question of quality of work must
be aware that this has far more relation to impropriety and neg-
ligence rather that the doctor's incompetence.
The first "step in ensuring that you are not exploited
by your dentist is to know what the prices various others
charge are. Dentists who display a list of their fees in the
waiting room of their clinics could be considered honest
because they cannot inflate their charges in a whimsical
fashion.
Try to find out and pay for a procedure before it is done.
If the dentist asks you to pay afterwards you feel psychologi-
cally insecure and may become exposed to exploitation. In ad-
dition, asking you to pay after the procedure instead of before,
could be a trick to force you into commitment with cost for
which you cannot escape. Wherever possible, always seek a
second opinion.
One can consult with any or even all of the dentists at the
Cheddi Jagan Dental Centre for a very small fee, .
Guyanese who fall in the low income bracket can have ad-
equate dental coverage by means of dental schemes similar to
that existing in other countries. Workers contribute a small
monthly fee monthly or weekly to a fund which pays a group
of private dentists to provide dental treatment for them.
This system differs somewhat from our own NIS in that it
is voluntary, the patient never pays the dentist directly, all the
dentists involved charge the same fee and every dental proce-
dure is accessible to the patient.
Apart from this, the participating dentists are monitored
and required to meet established ethical standards.
Private enterprises are especially attracted to these schemes
because the owners profit in one way or another.
Insurance companies also become involved with den-
tal schemes which can make a handsome profit while si-
multaneously benefiting their contributors.


My Sweet Lord


Storm in U.S. over chocolate Jesus
A New York gallery has angered a US Catholic group with its decision to exhibit a milk
chocolate sculpture of Jesus Christ.
The sLx-foot (' I.m sculpture. entled "My Sv eet Lord", depicts Jess Christ naked on the cross.
Catholic League head Bill Donohue called it "one of the worst assaults on Christian sensibidi-
ties eser".
The sculpture. b. artist Costmo Casallaro, will be displayed from Monday at Manhattan's
Lab Gallery
The Catholic League, which describes itself as the nation's largest Catholic civil rights
organisation, also criticised the timinung of the exhibition.
'The fact that they chose Holy Week shows this is calculated, and the timing is deliberate,"
Mr Donohue said.
He called for a boycott of the gallery and the hotel which houses it
'Overwhelming response'
The gallery's creative director, Matt Semler, said the gallery was considering its options in the wake of angry e-mails and tele-
phone calls.
"We're obviously surprised by the overwhelming response and offence people have taken," he said. "We are certainly in the
process of trying to figure out what we're going to do next"
Mr Semler said the timing of the exhibition was coincidentaL
Mr Cavallaro, the Canadian-born artist, is known for using food ingredients in his art, on one occasion painting a hotel room in
mozzarella cheese.
He used 200 pounds (90 kg) of chocolate to make the sculpture which, unusually, depicts Jesus without a loincloth.





FOR SALE

ALLEN'S ENTERPRISES LIMITED

[IN RECEIVERSHIP]


10 TONS RICE MILL COMPLEX AND LAND (44 AC RES1
LAND
Freehold interest fully developed commercial' agricultural land (44.2807 acres) situated at Plantation Coffee Grove
just off the Public Road. The land is bounded on the North and South by canals, the west by the seawall and the east
predominantly by the P public Road. 36 acres of the land is suitable for rice cultivation, housing development,
recreational/sports facility, amusement park, or hotel and restaurant.

PROXIMITY OF LAND
Approximately 10 minutes drive from Hampton Court Airstrip or the Anna R egina Commercial area. Persons
travelling from Georgetown can meet the site in about forty (40) minutes using a combination of Aird Road Travel.

UTILITIES :
The area benefits from electricity and telephone services, and ga rbage disposal is carried out by the Town Council
on Monday. Internet Service is also available on the Essequibo Coast.

RICE MILL COMPLEX :

The Rice Mill Complex occupies approximately 8.2 acres of land and includes:

* One (1) complete 10 tons rice mill
* Fairbank 40 tons Electronic Scale
* Kepler Weber 40 tons and 10 tons dryers plus 2 portable dryers
* Satake and Rimac Paddy Cleaners
* Satake Rice Whitening Machine
* Diesel Generators 440V/165KV A 3 PH
* Rotary Sifter with Motor and Switch Box


GBTI
^uso


The Rice Mill Complex also comprises of several structures four (4) Galvanised Bonds with so lid concrete floors,
Generator Room, Dryer Shed, two (2) Storage Rooms, Scale House/ Laboratory, Benab, Canteen, Residential! Office
Building and two (2) Drying Floors.

For serious offers please contact:

The R receiver! Manager
78 Church and Carmichael Streets
Georgetown

Or telephone 227-5568/227-5564/226-2119


For further details/ photographs on the Rice Mill Complex and Land, please visi t GBTIs website at
www.gbtibank.com. Click on Announcements'


Sunday chronicle April 1, 2007


Page XVII






Pag~'eXVffi ~ip~ay ChronicleApril I L2007


World Health Dav, 2007


N


Theme:

"Invest in health


Walter Rodney Chair Lectures

The University of Guyana
invites the Public to

The second lecture in the 2007 series
Guyana's Contribution to West Indies Cricket:
A Historical Interpretation
by
Professor Winston McGowan, A.A.
Walter Rodney Chair University of Guyana

Wednesday, April 4, 2007
17:00 h

National Library Auditorium
Main & Church Streets
Georgetown


build a safer future"


WORLD Health Day is cel-
ebrated annually on April 7
under the sponsorship of the
World Health Organization
(WHO).
This week we will be look-
ing at World Health Day under
the theme: "Invest in health,
build a safer future". We will ex-
amine the significance of the
theme which seeks to raise
awareness on the importance of
health to the growth and devel-
opment of a nation.

Origin
In the year 1948, the World
Health Organization held the
First World Health Assembly.
The Assembly decided to cel-
ebrate April 7, as World Health
Day.
This observance started in
1950 to create "awareness of a
specific health theme to high-
light a priority area of concern
for the World Health Organiza-
tion (WHO)". Activities
related to that particular theme
and the resources provided con-
tinues beyond April 7, which is,
the designated day for celebrat-
ing the World Health Day.


Significance of this
year's theme
The global goal of World
Health Day (WHD) 2007 is to
focus on international health se-
curity issues, to engage high-
level political interest in ad-
dressing these issues, and to
show the close link of health to
national and international secu-
rity agendas.
The concept of security ad-
dresses socioeconomic, natural
and man-made threats that jeop-
ardize people's own develop-
ment and rights. The UNDP's
(1994) Human Development
Report, New Dimensions of
Human Security; reports on
these types of threats that af-
fect people.
Among these, health secu-
rity is defined as guaranteeing
minimum protection from dis-
ease and unhealthy lifestyles,
along with food, environmental,
economic, community and po-
litical security. -
Public health systems
worldwide are repeatedly chal-
lenged by naturally occurring
emerging and re-emerging dis-
eases, environmental changes,
natural disasters, and accidental ""


or intentional release of differ-
ent agents which may constitute
public health emergencies.
Hence, global health secu-
rity serves as one of WHO's
priorities. The World Health
Report 2007 will be published
in August. Its theme is promot-
ing international health security.
This relates to acute public
health events that endanger the
collective health of groups of
people, and how to prevent
them and respond to them.
These include infectious disease
outbreaks and epidemics, and
the immediate health conse-
quences of natural disasters, in-
dustrial or chemical accidents
and conflicts.
According to WHO, the
theme for World Health Day &
the World Health Report 2007
is to show that in a globalized
world, health issues increasingly
presents new challenges that go
far beyond a national border and
that have impact on the collec-
tive security of all people.

ASPECTS OF INTERNA-
TIONAL HEALTH SECU-
RITY BEING ADDRESSED
Please see page XIX


-------------- - - - - --


QUESTION gl
Are self-employed persons entitled to I
Disablement Benefit and what are the qualifyin
conditions?


ANSWER

No. Self-employed persons are not covered for "


Disablement Benefit. This benefit is payable to an I
employed person who has suffered loss of I
Faculty due to an Industrial accident. -


There are no qualifying conditions to be satisfied I
for this benefit. However, the employed person .1
must be covered by National Insurance Scheme. 1

Do you have a question on N.I.S ? Then write/caUl

NIS M AIliRAG I


CO-OPERATIVE REPUBLIC OF GUYANA
MINISTRY OF PUBLIC WORKS AND COMMUNICATION
SEA AND RIVER DEFENCE DIVISION
TENDER NOTICE
Tenders are hereby invited from suitably qualified Contractors to undertake and
complete the following work for the Guyana Sea Defences Emergency Works
Project of the Ministry of Public Works and Communications, namely: -

River Defence Works at Gangaram Village, Canje, Region 6

Tender documents can be obtained from the Office of the PROJECT
MANAGER, GUYANA SEA DEFENCES-EMERGENCY WORKS
PROJECT AT FORT STREET, KINGSTON, GEORGETOWN during the
normal working hours from March 26,2007 to April 17,2007.

THE COST PER TENDER DOCUMENT IS G$5000.

Payment is NON-REFUNDABLE and should be made in favour of the
Permanent Secretary, Ministry of Public Works and Communications.

Tender Documents must be enclosed in a sealed envelope, bearing no identity of
the Tenderer and should clearly indicate on the top left-hand corner the works
tendered for.

Tender Document should be addressed to:

THE CHAIRMAN
NATIONAL PROCUREMENT AND TENDER ADMINISTRATION
BOARD
MINISTRY OF FINANCE
MAIN & URQUHART STREETS,
GEORGETOWN.

And deposited in the Tender Box at that address on/or before 09:00 h on Tuesday,
April 17, 2007.

Tender Documents will be opened at 09:00 h on Tuesday, April 17, 2007 in the
presence of Tendercrs or their representatives who choose to attend.

The Ministry of Public Works and Communications reserves the right to accept or
reject any or all Bids without assigning reasons) for such rejection.

Balraj Balram
Permanent Secretary


lI -------


C/O Dianne Lewis Baxter
Publicity and Public Relations Officer (ag)
National Insurance Scheme
Brickdam and Winter Place
P.O. Box. 101135
E-mail: pr_nis@solution2000.net
Tel: 227-3461.


,1


I


PaieXVMI


Sqnlay ChrFoic,JeApril 1, 2007,


I






Pa~e~XIX


WWF Guianas:

Safeguarding our

Marine Turtles
WWF Guianas is a non-profit environmental organization based
in Suriname, Guyana and French Guiana. We are a'sub-office of
the World Wildlife Fund International network whose primary
function is the protection of the world's wildlife and ecosystems.
WWF Guianas currently works on forest, species and freshwa-
ter conservation. Its species programme is designed to help pro-
tect many of the region's endangered and rapidly disappearing
fauna and flora. One species of very
special concern are marine turtles. As
part of a conservation effort, WWF
Guianas is pleased to share the follow-
ing important information.
Conservation of Marine Turtles
BCEAUSE marine turtles take
many years to become sexually ma-
ture, during which time they suffer
from many threats both as eggs,
hatchlings, juveniles and adults, it is
essential that everything possible is
done to protect the species and pre-
vent their total extinction. In Guyana,
there are some obvious actions that W F
can be taken:
Declare turtles endangered and establish laws to decrease
human-related mortalities.
These include protection of nesting sites and all stages of
growth.
Persons can choose to do the following:
Do not disturb turtles whilst they are nesting on the beach.
Do not dig up nests.
Do not collect and sell eggs.
Do not purchase or eat turtle eggs, and discourage others
from eating them as well.
If all else fails, report persons who poach, sell and or
consume turtle eggs.
If you are a fisherman, set your net away from turtle
nesting beaches. If you accidentally catch a turtle, carefully
detangle and release it from the net.
Together we can help ensure that marine turtles never dis-
appear from the beaches of Guyana!
Quiz q: Draw a poster (about 22 cm x 25 cm) that shows
how people can help protect marine turtles. Please send
answers to:
TURTLES
WWF Guianas
87A Ituni Street
Bel Air Park,
Georgetown,
Guyana


.OUMAN NAB


9MU 11dtim& i




3 w9(af2(2l f/ &


cywnn/ se l~t


MA-CORP

MACORP26 providence
East Bank Demerara
--.. . Tel: (592) 265-2367


From page XVIII

BY Pan American Health
Organization (PAHO)

Emerging and Re-
emerging Infectious
Diseases

Epidemics of infectious
diseases took their toll on
human lives and often resulted
in social disruption, political
instability and had tremendous
economic and social
consequences.
Most of these diseases are
caused mainly by environmen-
tal, ecological or demographic
factor which are spread world-
wide by travel and trade. The
spread of diseases can be attrib-
uted to human behavior and
population movements which
poses risks to global health se-
curity.

International Health
Regulations (IHR)

Recognizing the link be-
tween the globalization of trade
and travel and the spread of in-
fectious diseases, WHO began
identifying, verifying and re-
sponding to public health emer-
gencies of international concern.
The legal framework is the
recently adopted International
health regulations (2005), which
seeks to prevent, protect
against, control and provide a
public health response to the in-
ternational spread of disease in
ways that are commensurate
with and restricted to public


health risks-and which avoid
unnecessary interference with
international traffic and trade.
Scheduled to enter into
force in June 2007, the IHR
(2005) represents a major step
for international cooperation
and action in the fight
against the spread of epidem-
ics.

Public Health
Infrastructure
Public health emergencies
highlight the strengths and
weaknesses of the public health
infrastructure that is designed to
protect the population.
Detecting and responding to
a public health, emergency in-
volves all essential public health
activities, including surveillance,
health care services, laboratory
capacity, human resources and
communication between various
actors and the general public.

Promoting Health
Security through
Sustainable
Development in
Healthy Settings

Natural and man made di-


sasters, such as hurricanes,
earthquakes etc and large out-
breaks of new and re-emerging
infectious diseases are receiving
increasing attention in shared in-
ternational public health agenda.
In a globalized world,
large scale disasters not only
result in significant loss of
lives but often lead to a col-
lective sense of vulnerability
and insecurity in communi-
ties. International
health security requires a
larger and more effective in-
teraction between countries,
government etc. All sectors'"of
society and all citizens share
responsibility for health secu-
rity.


www.who.int/entity/world_health day/2007/en/
index.html
en.wikipedia.org/wk./world_health_day

Remember health leads to security and insecu-
rity leads to poor health!
You can also share your ideas and questions by
sending your letters to: "Our Environment", C/o
EIT Division. Environmental Protection Agency,
IAST Building, Turkeyen, UG Campus, GREATER
GEORGETOWN. Or email us at
eit.epaguyana@yahoo.comrtwith questions and
comments


SALE OF SPARE PARTS IN LOTS

Privatisation Unit (PU)/ NATIONAL INDUSTRIAL AND COMMERCIAL
INVESTMENTS LIMITED (NICIL) / AROAIMA MINING COMPANY (AMC)

Bids are hereby invited for the sale of SPARE PARTS located at AMO's Everton Plant, East Bank
Berbice on a "where is and as is basis".

Bids are invited for the following brands rid categories of inventory spare':-

Brands Brands Brands Categories

Manitowoc Mazda Pick Up Nordberg General Use
Komatsu Tractor Bob Cat Wisconsin Enginer,: Electrical
Fordson 550 Tractor Hyster Fork Lift MF Tractor Conveyor
Razz Scooter Austin Western Quincy Compressorl Compressor
Samurai Grove Crane Lincoin Electric Co. Hardware -
Northwest Dragline Caterpillar Pumps
Ford Bus Mini 850 :, Steam Power Plant
Mitsubishi Austin Maxi Calcine .
Quincy Compressor General Motors 'Backhoe

Between 08:00h -1'64:30h from Mondays to Fridays prospective biddersor their representativecan:-

Uplift an information package for the Everton Plant at a cost of G$1,000 and

Visit and inspect the various spare parts being offered.

Bids must be submitted to AMC at its Everton Plant location not later than May 16, 2007 at 14:00h.
Bids should be placed in a sealed envelope and titled (Bids for spare parts) and deposited at AMC's
Everton Plant.

The Tenderer must indicate what brand or category of spares they are bidding for and the price for all
spares in the brand or category since the sale is in lots or bundles.

The Bids should be addressed to:
The Plant Manager
Aroaima Mining Company Everton Plant-
Everton
East Bank Berbice
Tel. (592) 333-2233
Cel. (592) 623-3931

.-i..LJ0ICIUGIQq resqrysthq right to change the structure of any future spare parts sale.


Renewed efforts in the
building of basic public health
infrastructure and preparation
serve as key to the response. In .
addressing public health threats
of international concern, it is
important to acknowledge the
cdnpplexities of promoting and
maintaining health security.
In Guyana we are not be-
ipg left out, the Doctor and
staff of Enmore Polyclinic. is
;organizing a health fair on
Wednesday April 4, in obser-
vagice 'of World Health Day
2007.. There are other
oiganisations that will be
having different events to ob-
served World Health Day
2007.


World Health Da., 2007


Sun'd'ay A prldl6`AiO@l


. PaTielX






Sunday Chronicle April i '2007


Some Basics on the

Biotechnology of Cloning Part 2


In our column last week we
provided some basics on the
biotechnology of cloning. We
introduced the two basic types
as reproductive cloning and
therapeutic cloning. The latter
includes stem cell research
which has evoked some of the
most passionate and emotional
public debates until scientists
discovered the potential of us-
ing adult stem cells instead of
embryonic stem cells. Although
these two basic types of clon-
ing are those that have attracted
the most attention particularly
in the media and public domain,
technically, there are other
types of cloning, namely:
Molecular cloning or DNA
cloning; and
Genetic cloning
As the terminologies imply,
DNA cloning or recombinant
DNA technology relates to clon-
ing at the molecular level since
DNA is biochemically catego-
rized as a nucleic acid macro-
molecule (a large, long chain
molecule). Molecular cloning of
DNA is a highly technical pro-


cess involving the "teasing" or
cutting of a segment of the DNA
molecule using a special enzyme
called DNA ligase, a cartoon of
which we provided in a few of
our earlier articles last year.
While we do not wish to in-
timidate most of our lay read-
ers, it is desirable that we pro-
vide the diagram below (Figure
1) describing how DNA clones
are produced from the chromo-
somes. It is important to know
that the DNA cloning technol-
ogy is complemented by addi-
tional techniques of cloning the
"vectors" which would carry
the cloned "pieces" of DNA of
interest called cloning vectors.

What is a cloning
vector?
A cloning vector is a DNA
molecule that carries a "foreign"
DNA into a host cell and has the
capacity to reproduce copies of
itself inside a bacterial or yeast
cell. A good example, albeit un-
known to many lay readers, is
the process used in the produc-
tion of biotech insulin by "hu-
manizing" bacterial or yeast cells


to synthesize human insulin! A
number of these recombinant
DNA insulin products are cur-
rently on the market in Guyana
saving lives of diabetics.
Five types of cloning vectors are
categorized as:
Plasmid cloning vec-
tor a circular DNA molecule
which exists outside the chro-
mosome inside bacteria;
Cosmid cloning vec-
tor,
Phage cloning vector;
Bacterial artificial.
chromosome (BAC) cloning
vector;
Yeast artificial chro-
mosome (YAC) cloning vector;
We do not wish to go into
details of cloning vector type
definitions here for the sake of
the lay reader. The five types of
cloning vectors identified above
are used in the process of mo-
lecular or DNA cloning or re-
combinant DNA technology in
making, for example, yeast cells
capable of synthesizing insulin,
a process not naturally under-
Staken by yeasts.


GEOIEOWN PUBLIC HOSPITAL CORPORATION


WlCare

1. Tenders are invited from suitably qualified persons to provide the following services and
items at the Georgetown Public Hospital Corporation:

a) Maintenance services for the Mortuary Refrigeration System
b) Extension of the Mortuary
c Installation of Perkins Generator and Associate Hardware
d) Conversion of Hydraulic Liftto a Traction System
e) Dietary Items
f) Security Services

Tenderers can bid on any or all of the above-mentioned works separately.

2. Tender Documents can be obtained from the Cashier, Finance Department of the
Georgetown Public Hospital Corporation, New Market Street, from 09:00h to 15:00h
Monday to Friday upon payment of a non-refundable fee of $2000 each.

3. Each tender must be enclosed in a sealed envelope which does not in any way identify
the Tenderer and should be clearly marked on the top left hand corner "Tender for (specific
item(s))".

4. Tenders for items-a, b, and d must be addressed to The Chairman, National
Procurement & Tender Administration Board, Ministry of Finance and must be placed in the
Tender Box situated in the Ministry of Finance, Main & Urquhart Streets, Georgetown not
later than 09:00 hrs Tuesday 10th April 2007. Tenders will be opened immediately after the
closing period.

Tenders for items e and f must be addressed to The Chairman, National Procurement &
Tender Administration Board, Ministry of Finance and must be placed in the Tender Box
situated in the Ministry of Finance, Main & Urquhart Streets, Georgetown not later than
09:00h Tuesday 17th April, 2007. Tenders will be opened immediately after the closing
period.

5. Each Tender must be accompanied by a valid Certificate of Compliance from the
Commissioner of Inland Revenue Authority (IRD) and from the General Manager National
Insurance Scheme (NIS) in the name of the individual if the individual is tendering or
company if the company is tendering.

Tenderers or their representatives are invited to attend each of these openings.


6. T?'- Georgei,,n Public Hospital Corporation does not bind itself to accept the lowest or
anyTender.

Michael H. Khan
C, h f ,.:.'!:-, :jve Officer


EcoRI EcoRI EcoRt
I I i


ECoRI
I


W HUMAN
1 CHROMOSOME





YEAST ARTIFICIAL CHROMOSOME (YAC)




) COSMID




EcRI EcoRi EcoRI
I I i


BarmHl BamHl / BamHl\ a BmHi BafnH BamHl BamHl
RESTRICTION MAP
Average 4000-bp
fragment cloned into
plasmid or sequencing
vector PLASMID







- PARTIAL NUCLEOTIDE SEQUENCE -.
(from human fP-globin gene)
GGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGOCTGCTGGTGGTCTACCC
TGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTOCTGATGCTGTTATGG...


Figure 1 The DNA cloning process
What are some of the uses and potential uses of reproduc-
tive and therapeutic cloning?


Please turn to page
xxm


Guyana Micro-Projects Programme
Financed by the European Commission and the Cooperative Republic of Guyana


VACANCY


Community Development Officer


The European Commission in collaboration with the Government of
Guyana has implemented the Guyana Micro-Projects Programme
(GMPP) which targets the economic and social development of
communities in Guyana. Applications are invited from suitably qualified
persons to fill the position of Community Development Officer at the
Guyana Micro-Projects Office. The unit is managed by an international
consultancy company and the position advertised under this
announcement will be recruited by this consultancy company.

Details of the job description and requirements for the above position can
be uplifted from the address below during the period March 21 April 4,
2007.

Guyana Micro Projects Programme
109 E Barrack Street
Kingston
Georgetown
Original application should be sent to the above address no later than
15:30 hours on April, 6,2007.

IMPORTANT: The cover envelope should clearly state "Application for
Community Development Officer, not to be opened before April 6,
2007". The cover envelope should not state the name of the applicant.


rage xx


Average 400,000-bp -
fragment cloned into YAC ,_ "


I-


Average 40,000-bp
fragment cloned into cosmid


'------- '-----------'------


.-~----.I--_







Suda Choil pi 1 07P_ X


-m-


Esn

* ,: .. : . ..--,-.


*--- .....

THEPASSAGE
With his eyes wet, so that the edges of things were
blurred, Portia was truly like her mother. Years
ago Daisy had walked like that around the kitchen,
silent and occupied. Daisy was not black as he was;
her skin had been like the beautiful colour of dark
honey. She was always very quiet and gentle. But
beneath that soft gentleness there was something
stubborn in her, and no matter how conscientiously
he studied it all out, he could not understand the
gentle stubbornness of his wife.
He would exhort her and he would tell her all that
was in his heart and still she was gentle. And still she
would not listen to him but would go on her own way.
Then later there were Hamilton and Karl Marx and
William and.Portia. And this feel of real true purpose for
them was so strong that he knew exactly how each thing
should be with them. Hamilton would be a great scien-
tist and Karl'Marx a teacher of the Negro race and Will-
iam a lawyer to fight against injustice and Portia a doctor
for women and children.
And when they were even babies he would tell
them of the yoke they must thrust from their shoulders -
the yolk of submission and slothfulness. And when they
were a little older he would impress upon them that there
was no God, but that their lives were holy and for each
one of them there was this real true purpose. He would
tell it to them over and over, and they would sit together
far away from him and look with their big Negro-children
eyes at their mother. And Daisy would sit without listen-
ing, gentle and stubborn....
Then one night he found that Daisy had pierced
holes in little Portia's ears for ear-rings. And another time
a kewpie doll with feather skirts was on the mantelpiece
when he came home, and Daisy was gentle and hard and
would not put it away. He knew, too, that daisy was
teaching the children the cult of meekness. She told them
about hell and heaven. Also she convinced them of
ghosts and of haunted places. Daisy went to church ev-
ery Sunday and she talked sorrowfully to the preacher of
her own husband. And with her stubbornness she al-
ways took the children to the church, too, and they lis-
tened.

WHATTO DO
1. Read the extract until you think you have covered
all the information. Look carefully at what the language
is saying to you.
Do the following:
a) Draw up a table where you set up your own num-
ber of columns with headings, and a number of rows.
b) Number the boxes in the table to the order in which
the pockets of information are mentioned in the text.
c) Give information such as skin colour, personality,
beliefs, dreams, life style, and you can go on from here.
2. Write a composition of your own with adaptations
from the text.


THEPOEM

PRAYER
Come, let us also lift our hands,
We who do not remember the custom of prayer,
We who, except for the burning fire of love,
Do not remember any idol, any god.
Come, let us present a petition that Life, our beloved,
Will pour tomorrow's sweetness into today's poison;
That for those who have not strength for the burden
of the days,
May it make night and day weigh light on their eye-


lashes;
For those whose eyes have not strength for seeing
the face of dawn,
May it light some candle in their nights;,

For those for whose steps there is no assistance of
any road,
May it make some road luminous to their sight;
To those whose religion is pursuit of lying and hy-
pocrisy,
May there come capacity to shake off.the murderer's
hand.
The hidden secret of love is the fevered soul, with
which
Let us today make a covenant, and let its fever be
slaked;
The word of Truth, which in the heart like a thorn,
Let us today accept, and the anguish be wiped out.
Faiz Ahmed Faiz, Pakistan
(Translated by V. Keirnan)

What to Do
1. Tell in your own words what the poem is all about.
Discuss the poem with a friend, and then compare the
findings with your effort at Question 1.


Looking at Writing
The Facts of the Story

Exercise 1: Pretend you are a reporter for the Daily
News and that you were there when the impasse at
Bunny's took place. You took some notes for a news
story. Get all the facts together. Then write your story
and give it a headline.

Exercise 2: Read the story that you wrote for the Daily
News. The following questions will help you find out
whether you slanted your story.

1. Does your headline give anyone or faction a smash-
ing victory?
2. Were you fair to the internationals/locals who also
fought hard?
3. Did you exaggerate any of the facts or numbers in
your news article?
4. Did you express an opinion on the importance of
the event?
5. Did you impose your views on your readers or did
you simply expose the facts?
6. One way of imposing a point of view is to use loaded
words. Check your news story to see how you used
words like: liberty, democracy, freedom, and justice. Most
of these words are loaded because they carry with them
favourable meanings.

FACT & OPINION IN NEWSPAPERS

Although most newspapers try to be objective in writ-
ing the news, the choice of words and sometimes the
choice of facts sometimes slant the news.
Examine the newspapers carefully. and you will see
that they have an editorial page on which.the editor's opin-
ion is given, and also signed columns in which writers
express their opinions.
The exercise that follows should help you distin-
guish between the fact and opinion in the daily newspa-
pers.

Exercise 3:
1. Clip cartoons from the editorial page. Do you get


To gild refined gold, to paint the lily,
To throw perfume on the violet ...
Is wasteful and ridiculous excess.
William Shakespeare (1564-1616) King Lear IV.ii 11

the message the cartoonist wants to convey? Are politi-
cal cartoons a case of fact versus opinion or of fact ver-
sus emotion?
2. Cut out different editorials from different papers and
compare their points of view. Be on the lookout for
loaded words.
3. Compare news articles with editorials dealing with
the same subject.

The Paragraph Its Revision

A paragraph is a group of sentences that you, the
writer, make work as a team.

In the selection below, indicate by number, the sen-
tence or sentences that do not give information that fits
the flow of ideas expressed in the rest of the selection.
In other words, which sentences do not contribute to the
teamwork of the paragraph?

(1). Ceylon is an island of great natural wealth.
(2) Coconut palms and rice thrive in the warmth of
the coastal plains. (3) The island has a 725-mile
coastline. (4) In the hills, large plantations yield an
abundance of rubber. (5) Tea grows in profusion on
the mountain slopes of the interior. (6) Other agri-
cultural products of the island include quinine, ca-
cao, coffee, cinnamon, and citronella. (7) Quinine, a
medicine used mostly in treating malaria, is made
from the bark of the cinchona tree.

Remember that the sentences in a paragraph fit
together.

They may fit together in the following ways:

(1) Simply by telling about the same subject;

(2) By relating a single sequence of events;

(3) By explaining part of the same process, step by
step;

(4) By supplying the details necessary to prove the
truth of a general statement.

Explain by which of the four methods just described
each of the two paragraphs that follow was developed.

A. Looking through my field glasses, I spotted a wild
dog on a nearby mountains side. The animal looked al-
most like a kind of husky dog that people keep as pets
except for his air of wildness. As the wild dog loped
closer, I put down the glasses and raised my rifle. I
sighted carefully. The wolf was almost within a hundred
yards when I fired. That's when my alarm clock woke me.

B. Here's a trick that I learned. You can lift a piece
of ice with a piece of string without tying any knots.
First wet the end of the string thoroughly and lay it on
the ice. Then sprinkle some salt on the ice and string.
Wait ten seconds before lifting the string. The ice will
be frozen to the string.


Page XXI


Sunday Chronicle April 1, 2007







Page XXII Sunday Chronicle A~nl f, 2007


AN American astronaut will
run this year's Boston Mara-
thon on board the Interna-
tional Space Station.
Sunita Williams, 41, a US
Navy commander, will be tied
to a treadmill to combat the ef-
fect of weightlessness.
She qualified for a place by
finishing last year's Houston
Marathon in three hours 29
minutes and 57 seconds.
But she blasted off on
board the Discovery space
shuttle in December, prompting
her decision to try to run the
race in space on 16 April.
"I consider it a huge honou;
to qualify, and I didn't want my
qualification to expire without
giving it a shot," Ms Williams
told the race organizers, the
Boston Athletics Association
(BAA).
She has already. broken
the record for the length of
time in space by a woman,
and is poised to break the US
record for continuous time in
space before she returns
home in the summer.

'Pioneer'
In the past three years mara-
thon organizers have worked to
accommodate qualifiers who


cannot take to the streets of
Boston.
They have sent trophies,
water bottles and finishing line
tape to Iraq for troops stationed
there and plan a similar ship-
ment to Kosovo this
year. -
Ms Williams,
though, is the first
Boston marathon
runner to attempt
the course while or-
biting 210 miles -
(338km) above the
surface of the Earth.
"The Boston .'.
Marathon is the pin:- .
nacle of achievement
for most runners,"
said BAA spokesman i- -
Jack Fleming, who
said she would pioneer "a new.
frontier" with her run.
"For Suni to choose to run
the 26.2 miles (42.2km) in
space on Patriots Day is really
a tribute to the thousands of
marathoners who are running
here on Earth."

Extra challenge
Running in space will test
Ms Williams' physical fitness
in a variety of unusual ways.
Nasa has built a "vibration


isolation system" to keep the
space station steady as Ms
Williams runs, but this places
extra strain on the runner's hips
and shoulders.
"That harness gets hard on


her back and her shoulders or
her hips," said the astronaut's
sister, Dina Pandya.
"Her foot was going numb
because the strap was on her hip
so much."
And once Ms Williams fin-
ishes running she knows she
will not have access to many of
the home comforts available
back on Earth.
"She mentioned the other
day there's no hot bath," Ms
Pandya said. (BBC)


flORCOSCQ-P6


\
. '

',^ I






.' i '


" -~I-'. /

/

4


Astronaut





set for space





marathon


;Pa~e~i~Ik~


-Sunday Chronicle April 2007


ARIES -- _The items you have on your wish list are closer than ever to being
.yours today, thanks in part to the magnanimous charm you're displaying. You're
being generous with some powerful people, and they want to return the favour.
Graciously accept what they give you, and don't act as if you think you're
undeserving. Being unable to accept gifts isn't a sign of sophistication. It's a sign
that you feel guilty about something and you have nothing to feel guilty about!

TAURUS -- You will find a great deal of comfort in your daily routine today.
What might seem dull or boring to other people is something you will find very
rewarding. The patterns of your life are coming together to form a very interesting
picture, and it's one you should enjoy contemplating. All your questions are starting
to get answered, and this is a time when you should revel in your accomplishments
and savour your success.

GEMINI -- Your mental health depends on your physical health right now, so
make sure you're active today! When your blood is pumping and you're releasing
endorphins, your mind starts to see things in a much more positive light. Diet is
also an important consideration: avoid food that will make you feel bogged down
today, and try not to eat on the go eating junk food in your car, for example,
could lead to a grouchy mood this afternoon.

CANCER -- Your home should be your refuge from the world, so if it isn't serving
that purpose, you should address that problem today. Your first priority should
be creating a place of harmony, peace and safety so start researching design
ideas, do-it-yourself repairs and easy-to-implement security measures. These
changes-will happen only if you start working on them and the sooner you
start, the faster you'll get results!

LEO -- Something that you thought was vital to your happiness is leaving your
life, but this doesn't mean you're in for some blue times. All it means is that
you're in for a transition and it will be a lot more pleasant than you fear,
especially since you-have a very friendly person in your life who will be happy
to help you through it! Why not make it fun to learn how to get along with
something (or someone) you thought was so important. As it turns out, you're
fine without it.

VIRGO -- If you've been itching to buy something that's a bit out of your price
range, consider going in on it with someone else. Together, you two will have
more buying power, and you'll be able to get what you really want. Of course,'
this financial collaboration will also require some negotiation and cooperation, so
choosing the right person is important. Don't just pick someone who has the
money. Pick someone who knows.how to share.

LIBRA -- Romance might have to start taking a backseat in your life for a while.
- and not because you won't have anyone interested in getting romantic with
you (and vice versa). Rather, it's just that you have some more important things
to deal with. Taking care of business will help you clear your mind, and will give
you the ,energy that's necessary'to open up your heart to someone else. Taking a
break from wooing or being wooed will refresh your attitude, too.

SCORPIO -- Synergy is extremely important today and synergy requires more
than one element or idea. So you'd be wise to get involved in groups and mix it
up. Make an effort to consult other people about the decisions you're facing.
Toss some ideas back and forth. The more opinions you get, the better the outcome
will be. Yotu are already more powerful than ever, but by being part of a group,
you can be even more powerful.

SAGITTARIUS -- Do not underestimate the amount of time you need to spend
on preparation today in the coming days, being 'too prepared' will be much
better than being insufficiently prepared. So practice a bit more, do a bit more
research, and get yourself so ready for upcoming responsibilities that they are
second nature. The less separation you have between your mind, your words and
your actions, the better.

CAPRICORN -- Acting in an attention-getting way is highly advised today. So
don't be bashful! Your physical presence is important, so wear'something flashy
and' take extra care with your grooming today. If you're going to be noticed (and
you definitely will), you've got to look good! The stars say it's high time that
you got the acclaim you deserve, and they are offering you one or two chances to
ask for it today.

AQUARIUS -- Are you feeling intimidated by.someone whose intellectual prowess
is getting a lot of attention? That's nonsense! You are just as smart as this person,
albeit in different ways. It's tinie to understand your strengths, acknowledge your
weaknesses and admit that no one is perfect. Having true intelligence is all about
knowing that you don't know everything and having the maturity to admit it.
Your confidence should not be rooted in a score or a grade.

PISCES -- You'll have to be aggressive in a group situation today. There are
likely some strong personalities involved, and you need to make sure that yours
is just as powerful as everyone else's if you want to be heard. You may be dealing
with some people who are much better at talking than at listening you'll have
to fight for the attention you deserve, but if you fight with the velvety gloves of
wit and charm, you will be impossible to ignore.


. k





1 t A







n C A 1, 2007 Pa.e..


Some Basics on the


From page XX

The following is a list of some of the uses and potential uses
of cloning in human welfare according to various sources public
education resources:

Replacing organs and other tissues such as new skin.for
bum victims, brains cells for those with brain damage, spinal
rod cells for the paralyzed and complete new organs (hearts, liver,
kidney and lungs).

Infertility human cloning may provide couples and in-
dividuals who are unable to have children with another potential
option.

Replacement of a lost child parents who have lost a
child through an accident or an illness could blone an identical
I-, "replacement" child.


43


could be created to provide a source of transplant material f>i.r hean.!
lung, kidney and other major organ t ansplants.
Gene therapy cloning technology could be useJ to pre-'
vent, treat and cuire genetic disorders such as Alzheimer's dJaase.i
Parkinson's disease and even some heritable cancers, by c langingi
the expression of a person's genes.
Saving endangered species by boosting their nuhberri
through the creation of their clones.
Reversal of the ageing process once more is understood:
about the role that our genes play in the ageing process. The KJotho
gene has now been identified as the longevity gene.

Gene cloning process is depicted in the diagram at left i Figurq


"Creating organ transplant "donors" cloned "donors"


The basics of therapeutic cloning is illustrated in the diagram below:


'-a.





N


AL
" 4 '


I~. ~'l f


"I-!.
:, * ', '


~r'~'-~


It


~-rti-~7


We apologize for the poor resolution of our illustration last week.

Email address: caesarbiosafety@yahoo.com
1The National Biosafel Framewaork Project is executed under the auspices of thet Enironmental Protection Auency'-


Welcome to the 445"' edition of
"Champion Cookery Corner", a
weekly feature giving recipes and.
tips on cooking in Guyana.
- -
. ... 'r- :. ... . "
1H t C ai.' .raiia a tii t a iradl /fti i r,: I it"I /,r I G .,[ F,'i,'ai Fate. dI thi ould i ,ho, th, *.ut
season, but they are enjoyable year-round. Yeasty rolls are filled with currants or raisins andul
nuts, then topped with a cross of icing.
3-3/4 to 4-1V4 cups all-purpose flour
1 package active dry yeast .
I 1 teaspoon ground cinnamon
3/4 cup milk .
,.cup cooking oil
1'3 cup granulated sugar
* teaspoon salt
3 eggs .
2/3 cup currants or raisins
I slightly beaten egg white
1 cup sifted Champion Icing Sugar
1 tablespoon milk + extra
1/4 teaspoon vanilla


and stir 34 cup milk, the oil, granulated sugar and salt until warm (120 degrees to 130 degrees I). Add
lo Hour mixture along with whole eggs. Beat with an electric mixer on low speed for 30 seconds, scraping
bowl. Beat on high speed for 3 minutes.

Using a spoon stir in currants or raisins and as much of the remaining flour as you can mix in with .1I
wooden spoon. Turn out onto a 8 i:, i floured surface. Knead in enough remaining flou 1. d
moderately soft dough (3 to 5 minutes total). Shape into a ball.'Place dough i a greased bowl: 1111. .11. '. i-
grease surface. Cover and let rise until nearly double aboutt i2 hours).

Punch dough down. Turn out onto a floured surface. Cover and let rest 10 inunttes. Divide do(ii. iA..
portions; shape each portion into a smooth ball. Place balls 1- I.2 inches .ir..ii ui a greased b .i.-. t
Cover and let rise until nearly double (30 to 45 minutes). With a sharp ..- nili. a shallow I..*.
slash across each bun. Brush with egg white. Bake in a 375-degree F o- i 'r 12 io I min i'r. -'I1L
golden brown, Cool slightly.

In a mixing bowl combine Champion Icing Sugar, milk and vanilla. 1 ir hi i '.ii. a milk. I t. u I". .it
time, until it reaches drizzling consistency. Drizzle buns with icing. Serve warm,

Yield: 0 buns
SPO SORED B) Tmle 1M I -RERS F '

Baking Powder f1 T 4 ing suTA,
Custard IP'ode. i di Cuin ro.de,
Black Pcppci e y ialrin M u -..la


Figure 2 The gene cloning
process in a human


6' ;


OF '


; ,


d


Page XXB'


Sunday Chronicle April- 1, 2007



















GaC .


U


AN American Idol contestant
consistently criticised by the
show's judges is being
backed to win by a "vote for
the worst" campaign.
Top US radio presenter
Howard Stern is backing the
campaign, spearheaded by the
Vote for the Worst website, urg-
ing people to vote for Sanjaya
Malakar.
British judge Simon Cowell
has joked that he will quit if
Malakar wins.


I


b


< 4. I-.

Malakar, 17, is one of the
final nine contestants in the sing-
ing competition, watched by up
to 37 million US viewers.
On the last elimination
show, Cowell told the Wash-
ington state teenager: "I
don't think it matters any
more what we say, I genu-
inely don't.
"I think you're in your own
universe and if people like you,
good luck."
The sixth series of Ameri-


Sanjaya Malakar sported
for his last performance


- ks


can Idol reaches its climax in
May, with the winner landing a
recording contract.
'Karaoke contest'
The Vote for the Worst
website, which launched in
2004, calls the programme
"America's Largest Karaoke
Contest".
Its stated aim is to encour-
age people "to have fun with
American Idol and embrace its
suckiness by voting for the
people who the general public
and the producers are rooting
against".
Vote for the Worst's claimed
"victories" include Taylor
Hicks, who won the last series
of American Idol.
At his first audition, Hicks
had been told by Cowell that he
had no chance of success.
American Idol has been a hit
with audiences since the first
series in 2002 launched the ca-
reer of Kelly Clarkson, who has
gone on to achieve multi-plati-
num album sales and Grammy
awards.
Jennifer Hudson, a final-
ist in the 2004 series, won an
Oscar last month for her per-
formance in the film musical
Dreamgirls. (BBC)


Need Steel..?
We offer all these and more. -
STEEL FLATS


-Sizes
S1 'x 1,8 to 6"x

,7 Steel Plates

Thicknesses 0 90mm
.-. -: ",20guage to 34'
I Bea, s ; ..
w' ';_.. 10" x 5 3/4"
S8" x 5 1/4'"
Length 4Oft

., ..

4' 4 s 4,,4 *


honorary knighthood

U2 singer Bono has accepted more knowledgeable than me He said the accolade V
an honorary knighthood at a to talk about U2's music all help him secure talks a
ceremony in Dublin. I'll say is that, along with Third World debt with pc
Fellow band members The millions of others right across cans around the world.
Edge and Adam Clayton joined the world, I'm a huge fan," "An award like this
the frontman's wife and four Mr Blair wrote. ally really helps me
children at the British ambassa- The U2 singer's new title is through a few dooi
dor David Reddaway's official Knight Commander of the wouldn't get through
residence: Most Excellent Order of the that's the truth, that's the
The rock star and cam- British Empire (KBE). the world is," he said.
paigner, 46, is not entitled to be
called "Sir" because he is not a
:British citizen.
He said: "You have per-
mission to call me anything
you want except Sir." But he
did suggest alternatives:
"Lord of lords, your demi-
godness," he joked.
UK Prime Minister Tony
Blair described the star as an in- ,,
spiration in the fight against glo-
bal poverty, in a letter that was
, read out at the small gathering.
Bono has become a vocal
campaigner about issues of aid
and fair trade, particularly in .
i Africa.
"I'll leave it to others far -


wouldd
bout
oliti-
actu-
get
rs I
and
Sway


_ __


'


Bono receives