Citation

Material Information

Title:
Object 3-4. FASTA file for Strawberry RenSeq probes
Series Title:
Barbey PhD Dissertation
Creator:
Barbey, Christopher
Language:
English

Subjects

Genre:
dataset ( sobekcm )

Notes

Acquisition:
Collected for University of Florida's Institutional Repository by the UFIR Self-Submittal tool. Submitted by Christopher Barbey.

Record Information

Source Institution:
University of Florida Institutional Repository
Holding Location:
University of Florida
Rights Management:
Copyright Creator/Rights holder. Permission granted to University of Florida to digitize and display this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.

Full Text
>augustus_masked-Fvb1-1-processed-gene-115.6:1027:1147:Parent=augustus_masked-Fvb1-1-processed-gene-115.6-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-115.6:1027-1147||RAPiDGENOMICS_rs1205_00001
TTTGTAATTCGGAGGGAATCGATCAACCAAATGGCTCGAGTGATCAAGAAGATGGAAATGATGAGCAGCTCATCACTCAGGGGTTTTACATATGTTTAGGACTTGGAATTTTTGTTGGGT
>augustus_masked-Fvb1-1-processed-gene-115.6:1147:1267:Parent=augustus_masked-Fvb1-1-processed-gene-115.6-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-115.6:1147-1267||RAPiDGENOMICS_rs1205_00002
TCTGGGGAGTCTGTGGGAGTTTGATATTCAAGAGGTCATGGAGATATGCATACTACAACTTCTTAAATGCTTTAATTGATTGGCTTTATGTGAGGGTAGCTTTGATGAGACGGCAATTAA
>augustus_masked-Fvb1-1-processed-gene-115.6:120:240:Parent=augustus_masked-Fvb1-1-processed-gene-115.6-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-115.6:120-240||RAPiDGENOMICS_rs1205_00003
TCATTCCTTTCAAAAGCACAATCTTTGGACCTCTCCAATAATAAGTTCTCAAAGTTAGATTCCTTCTTGTGTGCAACAACACTCAGTTACTTAAACTATCTTGATCTCTCAAGCAACCAT
>augustus_masked-Fvb1-1-processed-gene-115.6:180:300:Parent=augustus_masked-Fvb1-1-processed-gene-115.6-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-115.6:180-300|2x||RAPiDGENOMICS_rs1205_00004
TCCTTCTTGTGTGCAACAACACTCAGTTACTTAAACTATCTTGATCTCTCAAGCAACCATATATCTGGAGAACTTCCGGATTGTTGGGAGCAATTTGGAGATCTAGTCTTTCTTGATTTG
>augustus_masked-Fvb1-1-processed-gene-115.6:240:360:Parent=augustus_masked-Fvb1-1-processed-gene-115.6-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-115.6:240-360||RAPiDGENOMICS_rs1205_00005
ATATCTGGAGAACTTCCGGATTGTTGGGAGCAATTTGGAGATCTAGTCTTTCTTGATTTGAGTAACAATACTTTTGCTGGAAACATTCCTTCTACAATGGGTTCATTATCTTCTATTGAG
>augustus_masked-Fvb1-1-processed-gene-115.6:300:420:Parent=augustus_masked-Fvb1-1-processed-gene-115.6-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-115.6:300-420|2x||RAPiDGENOMICS_rs1205_00006
AGTAACAATACTTTTGCTGGAAACATTCCTTCTACAATGGGTTCATTATCTTCTATTGAGACACTGAAGCTAGATAACAACATGTTTGTGGGAGAATTGCCTTCATCCTTGAAGAATTGC
>augustus_masked-Fvb1-1-processed-gene-115.6:360:480:Parent=augustus_masked-Fvb1-1-processed-gene-115.6-mRNA-1_4::augustus_masked-Fvb1-1-processed-gene-115.6:360-480||RAPiDGENOMICS_rs1205_00007
ACACTGAAGCTAGATAACAACATGTTTGTGGGAGAATTGCCTTCATCCTTGAAGAATTGCACGAATTTAAGAGCTTTTGATGTTGAAAACAATGAATTATCCGGACCTATACTTGAATGG
>augustus_masked-Fvb1-1-processed-gene-115.6:600:720:Parent=augustus_masked-Fvb1-1-processed-gene-115.6-mRNA-1_6::augustus_masked-Fvb1-1-processed-gene-115.6:600-720||RAPiDGENOMICS_rs1205_00008
ACCATCTCTGGGAATATACCCAAATGTCTCAGTAATTTGACTTCTTTCGCTCAGAAATGGAATCCAAAACTAACCGTCAGTCATGGCTATACAAGTCGGGAAGGGACCGATGATTCTACA
>augustus_masked-Fvb1-1-processed-gene-115.6:720:840:Parent=augustus_masked-Fvb1-1-processed-gene-115.6-mRNA-1_7::augustus_masked-Fvb1-1-processed-gene-115.6:720-840||RAPiDGENOMICS_rs1205_00009
CTTGGATTGTGGTACGATGACGATATATCCATTATATGGAAAGGAATATTGTCCAAATACAAAAGTACGCTGGGACTTGTAAGGAGTATTGATTTCTCGAGCAACAAGTTAACAGGGGAG
>augustus_masked-Fvb1-1-processed-gene-115.6:907:1027:Parent=augustus_masked-Fvb1-1-processed-gene-115.6-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-115.6:907-1027||RAPiDGENOMICS_rs1205_00010
GGTATTTGAATTTGTCATACAACAACTTGTCTGGAAAAATTCCAATAGTAACTCAGGTTCAAAACTATGATGCCTCTTCGTTTGATGGAAATCCTCAGCTTTGTGGAATTCCGCTTGAGC
>augustus_masked-Fvb1-1-processed-gene-130.3:1080:1200:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_10::augustus_masked-Fvb1-1-processed-gene-130.3:1080-1200||RAPiDGENOMICS_rs1205_00011
TTATTGAAGCTCAGCAAGTTGAAGAGTCTGTCTCTTTCTCTCAACGATTTCGTCGGCACGCTGCCGCGTTCTCTCTCCAAGCTTGCGTATTTGGAGAGCTTGGATCTCAGCTCGAACAAT
>augustus_masked-Fvb1-1-processed-gene-130.3:1140:1260:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_10::augustus_masked-Fvb1-1-processed-gene-130.3:1140-1260|2x||RAPiDGENOMICS_rs1205_00012
CTGCCGCGTTCTCTCTCCAAGCTTGCGTATTTGGAGAGCTTGGATCTCAGCTCGAACAATTTCACCGGTTCTATTCCGAGCTGGCTCTGTGAAGATCCCGGGAACAGCTGGAAGGAGCTG
>augustus_masked-Fvb1-1-processed-gene-130.3:1200:1320:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_11::augustus_masked-Fvb1-1-processed-gene-130.3:1200-1320||RAPiDGENOMICS_rs1205_00013
TTCACCGGTTCTATTCCGAGCTGGCTCTGTGAAGATCCCGGGAACAGCTGGAAGGAGCTGTATCTTCAGAACAATAAGTTCGGCGGGACTATTCCTCCATCTATTAGCAACTGTACTCAT
>augustus_masked-Fvb1-1-processed-gene-130.3:1260:1380:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_11::augustus_masked-Fvb1-1-processed-gene-130.3:1260-1380|2x||RAPiDGENOMICS_rs1205_00014
TATCTTCAGAACAATAAGTTCGGCGGGACTATTCCTCCATCTATTAGCAACTGTACTCATCTTGTGGCGCTAGATTTGAGCTTCAATTATCTCACTGGCACCATCCCTTCGAGCTTGGGG
>augustus_masked-Fvb1-1-processed-gene-130.3:1320:1440:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_12::augustus_masked-Fvb1-1-processed-gene-130.3:1320-1440||RAPiDGENOMICS_rs1205_00015
CTTGTGGCGCTAGATTTGAGCTTCAATTATCTCACTGGCACCATCCCTTCGAGCTTGGGGTCATTGTCGAAGCTGAGAGACTTGATCATTTGGTTGAATCAGCTCAGCGGGGAGATTCCG
>augustus_masked-Fvb1-1-processed-gene-130.3:1440:1560:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_13::augustus_masked-Fvb1-1-processed-gene-130.3:1440-1560||RAPiDGENOMICS_rs1205_00016
CAGGAGCTGATGTATCTCGGGTCACTGGAGAATCTTATTCTCGACTTCAATGAGCTGACCGGGACGATGCCTGTTGGGCTGAGCAACTGCACCAACTTGAGCTGGATTTCGCTGGCGAAC
>augustus_masked-Fvb1-1-processed-gene-130.3:1500:1620:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_13::augustus_masked-Fvb1-1-processed-gene-130.3:1500-1620|2x||RAPiDGENOMICS_rs1205_00017
GGGACGATGCCTGTTGGGCTGAGCAACTGCACCAACTTGAGCTGGATTTCGCTGGCGAACAACAAGTTGAGTGGCGAGATTCCTGCCTGGATTGGGAAGCTTCCGAAGCTGGCGATACTT
>augustus_masked-Fvb1-1-processed-gene-130.3:1560:1680:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_14::augustus_masked-Fvb1-1-processed-gene-130.3:1560-1680||RAPiDGENOMICS_rs1205_00018
AACAAGTTGAGTGGCGAGATTCCTGCCTGGATTGGGAAGCTTCCGAAGCTGGCGATACTTAAGCTCAGTAACAACTCGTTCTATGGGAACATTCCACCGGAGCTGGGTGACTGTAAGAGC
>augustus_masked-Fvb1-1-processed-gene-130.3:1620:1740:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_14::augustus_masked-Fvb1-1-processed-gene-130.3:1620-1740|2x||RAPiDGENOMICS_rs1205_00019
AAGCTCAGTAACAACTCGTTCTATGGGAACATTCCACCGGAGCTGGGTGACTGTAAGAGCTTGATATGGTTGGATCTCAATACAAACTTGTTGAATGGTTCGATCCCTCCTGGGCTTTTC
>augustus_masked-Fvb1-1-processed-gene-130.3:180:300:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-130.3:180-300|2x||RAPiDGENOMICS_rs1205_00020
TGTCTGTTCTCCGGCGTCTTCTGCAAACAAACCCGAGTCTCCTCCATCGACCTCAGCTTCATCCTCTTGTCCACCAACCTCACTGTTGTCTCCACTTTCTTGATGACCATTGATTCTCTT
>augustus_masked-Fvb1-1-processed-gene-130.3:1800:1920:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_16::augustus_masked-Fvb1-1-processed-gene-130.3:1800-1920||RAPiDGENOMICS_rs1205_00021
AATGATGGAAGTAAGGAGTGCCATGGAGCAGGGAACTTGCTCGAGTTTGCTGGGATAAGGCAAGAGCAATTGACCAGGCTATCGACAAGAAACCCCTGCAACTTCACTAGAGTTTATAGA
>augustus_masked-Fvb1-1-processed-gene-130.3:1920:2040:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_17::augustus_masked-Fvb1-1-processed-gene-130.3:1920-2040||RAPiDGENOMICS_rs1205_00022
GGTATTCTCCAACCAACATTTAATCACAATGGGACGATGATTTTTCTTGATATTTCACATAATAGGTTATCCGGTAGCATTCCAAAAGAGATTGGGAGTATGTACTATCTCTATATTCTG
>augustus_masked-Fvb1-1-processed-gene-130.3:2160:2280:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_19::augustus_masked-Fvb1-1-processed-gene-130.3:2160-2280||RAPiDGENOMICS_rs1205_00023
GGCCTTTCCATGCTGATGGAGATTGATTTGTCAAACAATCATCTGTCTGGAATGATTCCAGATTCAGGGCAGTTTGAGACATTCCCTGCTTACAGATTCATGAACAATTCAGACCTTTGT
>augustus_masked-Fvb1-1-processed-gene-130.3:2640:2760:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_23::augustus_masked-Fvb1-1-processed-gene-130.3:2640-2760||RAPiDGENOMICS_rs1205_00024
GGTGGTTTTGGTGATGTATACAAGGCCCAATTGAAGGATGGCAGCATTGTAGCCATCAAGAAATTGATCCATATCAGTGGACAAGGTGATCGTGAATTCACTGCTGAAATGGAAACTATC
>augustus_masked-Fvb1-1-processed-gene-130.3:2760:2880:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_24::augustus_masked-Fvb1-1-processed-gene-130.3:2760-2880||RAPiDGENOMICS_rs1205_00025
GGGAAGATCAAGCACCGAAACCTTGTTCCGCTCCTTGGATACTGCAAAGTAGGAGAAGAACGGCTTTTAGTTTACGAGTACATGAAGTATGGGAGTTTAGATGATGTTTTACATGACCAG
>augustus_masked-Fvb1-1-processed-gene-130.3:2880:3000:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_25::augustus_masked-Fvb1-1-processed-gene-130.3:2880-3000||RAPiDGENOMICS_rs1205_00026
AAGAAAGGTATCAAACTGAGTTGGTCTGCGAGGAGGAAGATTGCCATTGGGTCTGCAAGGGGACTGGCCTTTCTTCACCACAATTGCATTCCTCATATCATTCATAGGGACATGAAATCG
>augustus_masked-Fvb1-1-processed-gene-130.3:3000:3120:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_26::augustus_masked-Fvb1-1-processed-gene-130.3:3000-3120||RAPiDGENOMICS_rs1205_00027
AGCAACGTCCTGCTCGATGAGAACTTGGAAGCCAGGGTCTCTGATTTTGGAATGGCAAGGCTAATGAGTGCAATGGACACTCATTTGAGTGTGAGCACTCTGGCAGGCACACCTGGTTAT
>augustus_masked-Fvb1-1-processed-gene-130.3:3360:3480:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_29::augustus_masked-Fvb1-1-processed-gene-130.3:3360-3480||RAPiDGENOMICS_rs1205_00028
GTAGCTTGCGCCTGTTTGGATGATAGGCATTTGCGCCGCCCTACGATGATTCAAGTCATGGCAATGTTCAAGGAGATCCAAGCAGGATCCGGAATGGATTCCCAGTCAACCATAGCCACC
>augustus_masked-Fvb1-1-processed-gene-130.3:360:480:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_4::augustus_masked-Fvb1-1-processed-gene-130.3:360-480||RAPiDGENOMICS_rs1205_00029
AAGTGCAGCCCTCTCCTCACCTCCATAGATCTTGCTCAGAACACCTTGTCCGGCCCAATCTCTACTCTCTCCAACTTGGGCTCCTGCTCCGGTTTGAAGTCTCTTAACCTCTCCTCCAAT
>augustus_masked-Fvb1-1-processed-gene-130.3:480:600:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_5::augustus_masked-Fvb1-1-processed-gene-130.3:480-600||RAPiDGENOMICS_rs1205_00030
CTACTCGATTTCAATGTCAAAGACTCGACGCCGTTCGGCCTCTCGCTCCATGTCCTCGACCTCTCCTTCAACAAGATTTCCGGCCCCGCCGTGCCGTGGATCTTATCCAACGGCTGTGCT
>augustus_masked-Fvb1-1-processed-gene-130.3:720:840:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_7::augustus_masked-Fvb1-1-processed-gene-130.3:720-840||RAPiDGENOMICS_rs1205_00031
TTCGGCGACTGCTTGGTTCTCGACCGCCTCGACATCTCCGGGAACAAATTATCCAGCGACGTCGCAAATGCTCTCTCTTCCTGCAGCCACCTCACGTTTCTCAACATCTCCATCAACCAT
>augustus_masked-Fvb1-1-processed-gene-130.3:780:900:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_7::augustus_masked-Fvb1-1-processed-gene-130.3:780-900|2x||RAPiDGENOMICS_rs1205_00032
GTCGCAAATGCTCTCTCTTCCTGCAGCCACCTCACGTTTCTCAACATCTCCATCAACCATTTCTCCGGCCCGATTCCGGCCGTTCCCGCCGAGAAGCTTAAGTTTCTTTCCCTCTCCGGG
>augustus_masked-Fvb1-1-processed-gene-130.3:840:960:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_8::augustus_masked-Fvb1-1-processed-gene-130.3:840-960||RAPiDGENOMICS_rs1205_00033
TTCTCCGGCCCGATTCCGGCCGTTCCCGCCGAGAAGCTTAAGTTTCTTTCCCTCTCCGGGAACGAGTTCCAAGGTACAATTCCACCGAGCTTGCTGGGTTCATGTGAGTCGCTACTGGAG
>augustus_masked-Fvb1-1-processed-gene-130.3:960:1080:Parent=augustus_masked-Fvb1-1-processed-gene-130.3-mRNA-1_9::augustus_masked-Fvb1-1-processed-gene-130.3:960-1080||RAPiDGENOMICS_rs1205_00034
CTTGATCTTTCGATGAACAATCTCTCCGGTACTGTTCCCGACGCATTGAGCTCGTGTGCTTCGCTGGAGACTCTCGACATTTCCGCCAACTTCTTCACCGGCGAGCTGCCCGTCGAGACT
>augustus_masked-Fvb1-1-processed-gene-187.12:0:120:Parent=augustus_masked-Fvb1-1-processed-gene-187.12-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-187.12:0-120||RAPiDGENOMICS_rs1205_00035
ATGGTTTCAGTAGGGGAACTTATTGCAGGGGCTGCTCTGGGATCCCTATTCGGAAAGCTGTACAACGGCGTCGAGAAACTACTGATCAACAAGTCCACACAGTTCACGCCCCTACTCGAA
>augustus_masked-Fvb1-1-processed-gene-187.12:120:240:Parent=augustus_masked-Fvb1-1-processed-gene-187.12-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-187.12:120-240||RAPiDGENOMICS_rs1205_00036
AACATCAAATCAACGCTCCACTCTCTACATCCCTTGATCAAAGAGATAGAGCACCACAACATCGAATTAAATCTCTCAAACAAGGAAGTTGAGGATTTCAAAAAGGTGATGTTCAAGGGC
>augustus_masked-Fvb1-1-processed-gene-187.12:180:300:Parent=augustus_masked-Fvb1-1-processed-gene-187.12-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-187.12:180-300|2x||RAPiDGENOMICS_rs1205_00037
ATCGAATTAAATCTCTCAAACAAGGAAGTTGAGGATTTCAAAAAGGTGATGTTCAAGGGCGTGGAGCTGGTTGAGAAGTTGTTGAAAGTTCGAAACTGGTACAAGAACCCTAGCTACAGA
>augustus_masked-Fvb1-1-processed-gene-187.12:480:600:Parent=augustus_masked-Fvb1-1-processed-gene-187.12-mRNA-1_5::augustus_masked-Fvb1-1-processed-gene-187.12:480-600||RAPiDGENOMICS_rs1205_00038
TGTTTGGCAAGCATGGCGTTCATGTTTATTGTTGTCGCAGGGACAGCAAGTTGGTCTGTGTTTGGTGTAACTGGCAATGGTGTATGGTTGGTCTGCAAATTGTTTTGGACTTTGTTTCGT
>augustus_masked-Fvb1-1-processed-gene-187.12:60:180:Parent=augustus_masked-Fvb1-1-processed-gene-187.12-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-187.12:60-180|2x||RAPiDGENOMICS_rs1205_00039
TACAACGGCGTCGAGAAACTACTGATCAACAAGTCCACACAGTTCACGCCCCTACTCGAAAACATCAAATCAACGCTCCACTCTCTACATCCCTTGATCAAAGAGATAGAGCACCACAAC
>augustus_masked-Fvb1-1-processed-gene-192.1:0:120:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-192.1:0-120||RAPiDGENOMICS_rs1205_00040
ATGGAAGCAGCTGCTTCATCGTCCTCAACTTCTTCATCATCTAGTCCACCCTCTAATTGGGAGCATGATGTGTTCCTCAGTTTCAGGGGCAAGGACACCCGCCATGGTTTCACAGACCAT
>augustus_masked-Fvb1-1-processed-gene-192.1:1039:1159:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-192.1:1039-1159||RAPiDGENOMICS_rs1205_00041
TAGGATCACACTTGTATGGTAGGGAGATAGATGAATGGTTAGAGGTATTGTATAGACTGGACGAAGAGCTGGATAAAGATATTTTTAGTGTGCTCCAAATAAGTTTTGATGGATTACATG
>augustus_masked-Fvb1-1-processed-gene-192.1:1099:1219:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-192.1:1099-1219|2x||RAPiDGENOMICS_rs1205_00042
ACGAAGAGCTGGATAAAGATATTTTTAGTGTGCTCCAAATAAGTTTTGATGGATTACATGAGACTGATAAGAAAATCTTTTTGGACATTGCATGTTTCTTCAATGGTGAGGATCATGTTC
>augustus_masked-Fvb1-1-processed-gene-192.1:120:240:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-192.1:120-240||RAPiDGENOMICS_rs1205_00043
TTATACTTTGCTCTGAATCAGAGAGGAATTGACACATATAGGGATGCAGAGAAACTTCCAAGGGGAAAATACATGTCTTTAGAACTTGTGGAAGCAATTCAGGAGTCAAGGTTTGCCGTC
>augustus_masked-Fvb1-1-processed-gene-192.1:1279:1399:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_4::augustus_masked-Fvb1-1-processed-gene-192.1:1279-1399||RAPiDGENOMICS_rs1205_00044
TCAATAAATATTTGATTAAGATTGAAAGGAAGAAACTGTGGATGCATGATTTACTACGGTGCTTGGGTTGGCATATTGTCCGTAGAGAATCTGTTGTCCCAGGTAAACGTAGCAGGTTGT
>augustus_masked-Fvb1-1-processed-gene-192.1:1996:2116:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-192.1:1996-2116||RAPiDGENOMICS_rs1205_00045
CTGGATTCACAGGTTTAGAATTGCCAAACAAGTTCTCAGGCTTGAGGTCTTTGACAACACTAAACCTAGGTGGATGTAATCTCGCAGAAGGTGCAATCCCTGATGACATTGGTCATTTAT
>augustus_masked-Fvb1-1-processed-gene-192.1:2116:2236:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-192.1:2116-2236||RAPiDGENOMICS_rs1205_00046
TCTCATTGCAGAGTCTTGATTTAAGTGAGAACGACTTTTTCACCATACCTGAAAGCATCTCCCAGCTTTCTGAGCTTACAGAAATTTCGCTGTTTAAGTGTAGCAATCTACAGTCATTGC
>augustus_masked-Fvb1-1-processed-gene-192.1:2403:2523:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-192.1:2403-2523||RAPiDGENOMICS_rs1205_00047
TTTCGTTTAGGAAATCTGGAAGTACTCGATCTTTCCTACTGCCAACACTTGAAGAAGGTCCCTGACTTGAACGGGGTTCCAAATCTTAAGAAACTGAACCTTGAAGGTTGTGAAAAGCTA
>augustus_masked-Fvb1-1-processed-gene-192.1:2643:2763:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-192.1:2643-2763||RAPiDGENOMICS_rs1205_00048
CTTTCAGGATGTTCAAAATTGAAAGAGTTTCCAGAGATTAATGGAGATATGGGGAAATTTTCACAACTGCATTTAGATGGGACGGCGTTAAAGTATCTGCCAATACCAATGAAGCAATTT
>augustus_masked-Fvb1-1-processed-gene-192.1:2940:3060:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-192.1:2940-3060||RAPiDGENOMICS_rs1205_00049
AGTCTGGATTTGGGTGAAAATGATTTGGTGATTATACCTAATGAACTTGGTAGACTATCCTTTTTGCAGAGATTGGATTTCAGTGGAAACAATTTAGTCAGTGTACCAAATGAAATTGGT
>augustus_masked-Fvb1-1-processed-gene-192.1:300:420:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-192.1:300-420|2x||RAPiDGENOMICS_rs1205_00050
CTTGAATGCAAGAAACTGAGGGGACTGGAAGTTCTTCTGGTTTTTTACCATGTAGATCCATCCGAGATAAGGAAGCAAGCTGGAGGGTTGGGCATGGAGATTGCCAAGCATGAGATGGAT
>augustus_masked-Fvb1-1-processed-gene-192.1:3389:3509:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-192.1:3389-3509||RAPiDGENOMICS_rs1205_00051
TAGTTCGTGGATTGGATTTTCTCTATTTGTTGTTTTCGAAATCCTTGAGAAAGAAGATTTCGACAGCAGTTGGGAATCAGAGGAGACTATTTGTGAATTTTATACCAATTTTGGGTGTGA
>augustus_masked-Fvb1-1-processed-gene-192.1:3509:3629:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-192.1:3509-3629||RAPiDGENOMICS_rs1205_00052
AAATTCACTTGTTTTCCAAAATTTCCCTGACTTCAGGACTGGTCCATATGGACTTTGTTGCTATGAACCACGGGTTGGGAAATTTGGTGGCTTGTTCGATAAATTAGTACTTCAAGCTAC
>augustus_masked-Fvb1-1-processed-gene-192.1:4287:4407:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_4::augustus_masked-Fvb1-1-processed-gene-192.1:4287-4407||RAPiDGENOMICS_rs1205_00053
CAGTGTCAGGTTATTAGTGCATTGTTTACAACCGTTAACCCAGAATTAGAGGTTGTAATGTGTGGGAGCCGTCTAGTTTATCAGCAAGATTTACAAGACTTGATCCGTTCATTGACTGCA
>augustus_masked-Fvb1-1-processed-gene-192.1:60:180:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-192.1:60-180|2x||RAPiDGENOMICS_rs1205_00054
GAGCATGATGTGTTCCTCAGTTTCAGGGGCAAGGACACCCGCCATGGTTTCACAGACCATTTATACTTTGCTCTGAATCAGAGAGGAATTGACACATATAGGGATGCAGAGAAACTTCCA
>augustus_masked-Fvb1-1-processed-gene-192.1:749:869:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-192.1:749-869||RAPiDGENOMICS_rs1205_00055
CTTTGGGGAGAGCAATATAAATATAGACACTATCAAAAGAGGGATCAGGTTATTGAAGAAGGTACTATGCAAGAAAAAGGTGCTTATCATACTAGATGATGTTGACAAACTTAAACAACT
>augustus_masked-Fvb1-1-processed-gene-192.1:919:1039:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-192.1:919-1039||RAPiDGENOMICS_rs1205_00056
AAGGATTTCAGGTCATATGTCAACAAGCCTTCAAGAAAAATGATCCACCAGTTGAGTTTGTAGAGCTGTCCAAGAGTTTCGTAAAATATGCCAGTGGCCTTCCTTTAGCTCATAAAGTTC
>augustus_masked-Fvb1-1-processed-gene-192.1:979:1099:Parent=augustus_masked-Fvb1-1-processed-gene-192.1-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-192.1:979-1099|2x||RAPiDGENOMICS_rs1205_00057
TAGAGCTGTCCAAGAGTTTCGTAAAATATGCCAGTGGCCTTCCTTTAGCTCATAAAGTTCTAGGATCACACTTGTATGGTAGGGAGATAGATGAATGGTTAGAGGTATTGTATAGACTGG
>augustus_masked-Fvb1-1-processed-gene-200.6:0:120:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-200.6:0-120||RAPiDGENOMICS_rs1205_00058
ATGATGGTGTTCAAATCCCAACTCGGGGATATCAAATCCATTATGCACTCTTTGGAACCACTGATCAAGGAGATGACAGAGTGTGGGAAGGAGTTGGATGGTCAAGGGGAGGAGCTAGAG
>augustus_masked-Fvb1-1-processed-gene-200.6:1014:1134:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-200.6:1014-1134|2x||RAPiDGENOMICS_rs1205_00059
GGTCAGCCAATAGAGATTTGGCAAAAAAGAGTACTGGAATGGTCTAGAGGTTCTTCTGTTCTTGAGTCTGAACATGATTTGCTTGATTGCCTCCAAAGTAGCTTAGATGTTTTGGATGAA
>augustus_masked-Fvb1-1-processed-gene-200.6:120:240:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-200.6:120-240||RAPiDGENOMICS_rs1205_00060
AATCTTAGAGTGGATACGGAGGAAGGAGTGGAGCTTATTCGGAAATGCTCGAAAGCCAGCGGGTTTAAGAAGTTTAAGTATGGCAGCCGGCTTGTTGAATTGGGTAGGTCACTTCAGAGG
>augustus_masked-Fvb1-1-processed-gene-200.6:1316:1436:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-200.6:1316-1436||RAPiDGENOMICS_rs1205_00061
CAGGAAGGACAACAAGTATAGTGATGGCTATTACACTGAGCACTTCGTTACACAGCATGACATGCTTAGGGAGTTGGCTATCCGACAGATGAGTCAGGAACCGCTACAACAGAGAATGAG
>augustus_masked-Fvb1-1-processed-gene-200.6:1531:1651:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-200.6:1531-1651||RAPiDGENOMICS_rs1205_00062
ATGAAGAGTTCTCATCTACATGGCAAAACTTGCAACTACCAGAAGCAGAGGTTTTAATTTTGAATTTTCAAACAAAGTATTATGCCTTACCTGTGTTCGTAGAGAAAATGAATAAACTGA
>augustus_masked-Fvb1-1-processed-gene-200.6:1651:1771:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-200.6:1651-1771||RAPiDGENOMICS_rs1205_00063
AGACTCTAGTACTCACCAGTTACAGTACGAGTCCTACCGAGTTGAATAACTTTCAACTAGTTGATTCGATACCGAGTTTAAAGAGAATCAGATTGGAGAGAATTTCAATTCCTTCCATAA
>augustus_masked-Fvb1-1-processed-gene-200.6:180:300:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-200.6:180-300|2x||RAPiDGENOMICS_rs1205_00064
GGGTTTAAGAAGTTTAAGTATGGCAGCCGGCTTGTTGAATTGGGTAGGTCACTTCAGAGGCTGTTGGGGATATTGAAGGTGCAGGGAATAAGGGATGTGAAGATGGCATTAGTTTCGGTG
>augustus_masked-Fvb1-1-processed-gene-200.6:2131:2251:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_6::augustus_masked-Fvb1-1-processed-gene-200.6:2131-2251||RAPiDGENOMICS_rs1205_00065
TGAAGGAATTGCCTGAAGACATTGGAGAATTGTGCAGCTTAGAAAGGCTCAACATGAGGCAGTGCTCGAGATTGAATGAGTTGCCTTCTTCAGTTTTGGATCTTGAACACTTGAAGGAAG
>augustus_masked-Fvb1-1-processed-gene-200.6:2251:2371:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_7::augustus_masked-Fvb1-1-processed-gene-200.6:2251-2371||RAPiDGENOMICS_rs1205_00066
TGACATGCGATGAAGAGACAGAAATTTTATGGGAACCCTTCTTACCCTATCTGACAAACATGCACATTAAGGTTGTGAAAGAAGATATCAACCTCAATTGGCTCCACAAGTCTCATTTCT
>augustus_masked-Fvb1-1-processed-gene-200.6:240:360:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-200.6:240-360||RAPiDGENOMICS_rs1205_00067
CTGTTGGGGATATTGAAGGTGCAGGGAATAAGGGATGTGAAGATGGCATTAGTTTCGGTGAGGAATATTGAGAATGTGGTGCAGAGAATTGAAGGGAATTGTGTGATACAGAACATTCAG
>augustus_masked-Fvb1-1-processed-gene-200.6:360:480:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_4::augustus_masked-Fvb1-1-processed-gene-200.6:360-480||RAPiDGENOMICS_rs1205_00068
TCTCAGAAAATTGAAGGGTGGTGTGCTGTGCCTGAGCCTCCGACTGTTACGGTTGGATTGGATGTGCCTCTGAGGGAATTGAAAATGAAGCTCTTTACTTATGGAGTTTCGATGGTGATA
>augustus_masked-Fvb1-1-processed-gene-200.6:420:540:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_4::augustus_masked-Fvb1-1-processed-gene-200.6:420-540|2x||RAPiDGENOMICS_rs1205_00069
GATGTGCCTCTGAGGGAATTGAAAATGAAGCTCTTTACTTATGGAGTTTCGATGGTGATAGTTACTGCTCCCGGAGGATGTGGGAAAACTACCCTGGCTACAAAGTTGTGCCAAGATGCA
>augustus_masked-Fvb1-1-processed-gene-200.6:60:180:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-200.6:60-180|2x||RAPiDGENOMICS_rs1205_00070
CTGATCAAGGAGATGACAGAGTGTGGGAAGGAGTTGGATGGTCAAGGGGAGGAGCTAGAGAATCTTAGAGTGGATACGGAGGAAGGAGTGGAGCTTATTCGGAAATGCTCGAAAGCCAGC
>augustus_masked-Fvb1-1-processed-gene-200.6:610:730:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-200.6:610-730|2x||RAPiDGENOMICS_rs1205_00071
TTGTCCAAGAGCTATATCATCGAACGGGTGCCAAAGTGCCTGATTTCCAAAGTGAAGTAACAGCAGTTAGCTGGCTGCAGCAATTTCTGAAGCAAACAGGACAAAACCCTATGTTGTTGG
>augustus_masked-Fvb1-1-processed-gene-200.6:670:790:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-200.6:670-790||RAPiDGENOMICS_rs1205_00072
CAGCAGTTAGCTGGCTGCAGCAATTTCTGAAGCAAACAGGACAAAACCCTATGTTGTTGGTCCTGGATGATGTCTGGGCTGGATCAGAATTTATTCTGGAGAAGTTTGATAAATTAAAAA
>augustus_masked-Fvb1-1-processed-gene-200.6:730:850:Parent=augustus_masked-Fvb1-1-processed-gene-200.6-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-200.6:730-850|2x||RAPiDGENOMICS_rs1205_00073
TCCTGGATGATGTCTGGGCTGGATCAGAATTTATTCTGGAGAAGTTTGATAAATTAAAAATGACAAATTGCAAGATATTGGTTACATCAAGGTCTAGTTTTCCAAGATTTGGTTCTCCAT
>augustus_masked-Fvb1-1-processed-gene-200.7:0:120:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-200.7:0-120||RAPiDGENOMICS_rs1205_00074
ATGGCAGTGGCGTTTGATGGACAAGCAGTTTTCCAAGCATTATACAATGTTGTCAGTGAAGTGATTGAGAAGAATACAATATTTAAATCCCAGCTTGTAGATATCAAATCAGCACTAGAC
>augustus_masked-Fvb1-1-processed-gene-200.7:1029:1149:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-200.7:1029-1149||RAPiDGENOMICS_rs1205_00075
ATAGTAGAACATTGTAAGGGATTTCCACTTGCCATTACAGTGATTGGGAGATCACTTTGTGGGCAGCCTTTGGAGATCTGGCAAAAGAGAGTAATTGAATGGACTAAAGGTTCATCCATT
>augustus_masked-Fvb1-1-processed-gene-200.7:120:240:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-200.7:120-240||RAPiDGENOMICS_rs1205_00076
TGTTTAGAACCACTGATTGAAGTGATACCAGAGTACGGAAAGGAATTGGATCGGCCAGAGGAGGAACTACAGAAGTTTACAATACAAATGAAGGAGGGAATTCAGCTGATTCACAAGTGC
>augustus_masked-Fvb1-1-processed-gene-200.7:1209:1329:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-200.7:1209-1329|2x||RAPiDGENOMICS_rs1205_00077
GAAAATAGTGTCATCAAGGAATGTTTCATGGATCTTGGTTCATTTCCTGAGGACCAAAGAATATCTGCTACCATCGTCATTGATATATGGTCAATGTTATATAAGATAGAAGAAGACATG
>augustus_masked-Fvb1-1-processed-gene-200.7:1603:1723:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-200.7:1603-1723||RAPiDGENOMICS_rs1205_00078
ATGGAGACTTCTCAGCTACATGGCCTAACATGGAATTACCACAAGCAGAGGTTCTAATTCTGAATTTTCAGTCAAAGAAATATGCCTTGCCCGAATTTCTGGAGAAAGTGGATAAATTAA
>augustus_masked-Fvb1-1-processed-gene-200.7:180:300:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-200.7:180-300|2x||RAPiDGENOMICS_rs1205_00079
GAGGAACTACAGAAGTTTACAATACAAATGAAGGAGGGAATTCAGCTGATTCACAAGTGCTCCAAAGTTCGTGCGTGGAATGCGTACAAGAGACACAAATACGCAAACGAACTTGTTGAA
>augustus_masked-Fvb1-1-processed-gene-200.7:1843:1963:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-200.7:1843-1963||RAPiDGENOMICS_rs1205_00080
GCAAGGACCCTGTGCAGTTGGATAATTTGGAAAAGATATCTTTATTCATGTGCAAAGTCAGTAAAGCTTTTAGCAACTGTTCCAGCCAACTTGTAGATCTATTGCCAAATGTGGTGGAAA
>augustus_masked-Fvb1-1-processed-gene-200.7:1963:2083:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_4::augustus_masked-Fvb1-1-processed-gene-200.7:1963-2083||RAPiDGENOMICS_rs1205_00081
TAAACATTGATTATTGCAATGATTTGGTGGAACTGCCTGCCATGCTTTGTGACCTGATTCCCCTTAAAAAGCTTAGTATCACCAATTCTCACAAGCTATCTGCCTTACCTGAAGAAATAG
>augustus_masked-Fvb1-1-processed-gene-200.7:2083:2203:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_5::augustus_masked-Fvb1-1-processed-gene-200.7:2083-2203||RAPiDGENOMICS_rs1205_00082
GAAAGTTAGTGAACTTAGAAGTGTTGAGGGTTAGGTCTTGTACAGACTTGTCAGAGCTGCCAGACTCAATTCGGCACCTCAAAATGTTAAGTTTTCTGGACATATCTGATTGCTATAGTA
>augustus_masked-Fvb1-1-processed-gene-200.7:2203:2323:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_6::augustus_masked-Fvb1-1-processed-gene-200.7:2203-2323||RAPiDGENOMICS_rs1205_00083
TGAAGGAGCTCCCTGAACACATTGGTGAAATGTGCAGCCTAGAAACGCTAAATATGAGACAATGCTCAAGACTGCAAGAGTTGCCTGAATCAGTGTTGGATCTTGAACAGTTGGAGGATG
>augustus_masked-Fvb1-1-processed-gene-200.7:2323:2443:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_7::augustus_masked-Fvb1-1-processed-gene-200.7:2323-2443||RAPiDGENOMICS_rs1205_00084
TGATTTGTGATGAAGAGACTGAAATATTATGGAAACCGTTCTTGCCCATTCTCCAAAACATACATATCAGGGTAGTGAAAGAAGATATCAACTTGAATTGGCTCCACAAGTTTCCATCTT
>augustus_masked-Fvb1-1-processed-gene-200.7:480:600:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_5::augustus_masked-Fvb1-1-processed-gene-200.7:480-600||RAPiDGENOMICS_rs1205_00085
CCACCTCTTACAGTTGGACTGGAGGGGCCTTTGAAAGAATTGAAGCTAATGCTTCTTAAGGATGGGGTATCGATGCTTGTGCTCACTGCTCCAGGAGGATGCGGGAAAACTACATTGGCA
>augustus_masked-Fvb1-1-processed-gene-200.7:691:811:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-200.7:691-811|2x||RAPiDGENOMICS_rs1205_00086
TTGTACAAGAGCTTTGTCAACGCAAGGGTTCCCAGGTACCTGATTTCCAAACTGACGTAAGTGCAGTCGACTGGCTGCAAGAATTCGTAAAGCAAACAGATCCTTTGCTGTTGGTTTTGG
>augustus_masked-Fvb1-1-processed-gene-200.7:811:931:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-200.7:811-931|2x||RAPiDGENOMICS_rs1205_00087
ATGATATTTGGTCTGAATCCGAATCCCTTCTTGAGAAGCTTGATGAATTGAAAATTGCAAATCACAAGATTCTGGGGACATCTAGATTTGCATTTCCAAGATTATGTCCTCCATATTATT
>augustus_masked-Fvb1-1-processed-gene-200.7:871:991:Parent=augustus_masked-Fvb1-1-processed-gene-200.7-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-200.7:871-991||RAPiDGENOMICS_rs1205_00088
ATCACAAGATTCTGGGGACATCTAGATTTGCATTTCCAAGATTATGTCCTCCATATTATTTAGAGTCCTTGAATGAAAAAGATGCAACAGCACTTTTTTATCATTCAGCATCATTGGGAG
>augustus_masked-Fvb1-1-processed-gene-246.5:1080:1200:Parent=augustus_masked-Fvb1-1-processed-gene-246.5-mRNA-1_10::augustus_masked-Fvb1-1-processed-gene-246.5:1080-1200||RAPiDGENOMICS_rs1205_00089
GGGAGGAACATGCAGAGACCTCAGCCTCAGTGTTCTTTGATTCCTGGAGGTGGGTTAAACTGTCTGAGAATTCCAGGGGCAAAGCCTCTTGTTTGTGGCTCACTTCTTCCAAGCTCATCA
>augustus_masked-Fvb1-1-processed-gene-246.5:240:360:Parent=augustus_masked-Fvb1-1-processed-gene-246.5-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-246.5:240-360||RAPiDGENOMICS_rs1205_00090
ACTAAGGTCTTGGACACTTGGGTTGGACCAGATGTGTGTTCTTACAAAGGAGTCTTCTGTGCAGATTCTGAGGATGGCCAAACCATTGTGGCTGGAATAGATCTCAATCATGCCAATCTC
>augustus_masked-Fvb1-1-processed-gene-246.5:480:600:Parent=augustus_masked-Fvb1-1-processed-gene-246.5-mRNA-1_5::augustus_masked-Fvb1-1-processed-gene-246.5:480-600||RAPiDGENOMICS_rs1205_00091
CTTGACCTCAGTAACAACCAATTCTCAGGCCCCTTCCCCACAACCACATTATACATTCCCGACCTCATTTACCTTGACCTCAGGTTCAACAACTTCACTGGTTCAATTCCTGATGAGCTC
>augustus_masked-Fvb1-1-processed-gene-246.5:540:660:Parent=augustus_masked-Fvb1-1-processed-gene-246.5-mRNA-1_5::augustus_masked-Fvb1-1-processed-gene-246.5:540-660|2x||RAPiDGENOMICS_rs1205_00092
GACCTCATTTACCTTGACCTCAGGTTCAACAACTTCACTGGTTCAATTCCTGATGAGCTCTTCCACAAAAACCTTGATGCCATTTTTCTCAACAACAACCAATTTGAAGGTGAGCTACCC
>augustus_masked-Fvb1-1-processed-gene-246.5:840:960:Parent=augustus_masked-Fvb1-1-processed-gene-246.5-mRNA-1_8::augustus_masked-Fvb1-1-processed-gene-246.5:840-960||RAPiDGENOMICS_rs1205_00093
GATGTGAGCTTCAATTCTCTGATGGGTCATTTGCCAGACACAATCTCTTGCCTCCAAGAAATTGAAGTACTCAACTTGGCACACAACAAGCTCTCTGGGGTTTTACCAGACCTGGTTTGC
>augustus_masked-Fvb1-1-processed-gene-270.5:0:120:Parent=augustus_masked-Fvb1-1-processed-gene-270.5-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-270.5:0-120||RAPiDGENOMICS_rs1205_00094
ATGGGGTTGTCATCTTCTTCTTCTTCCTCACTTTACAACTTCTCTGCTCCTGTTTGTTCATGGCCTGGAGTGTTCTGTGATTCAGAAAATGAATATATCATTAACTTAGTTGCTTCTGGT
>augustus_masked-Fvb1-1-processed-gene-270.5:1200:1320:Parent=augustus_masked-Fvb1-1-processed-gene-270.5-mRNA-1_11::augustus_masked-Fvb1-1-processed-gene-270.5:1200-1320||RAPiDGENOMICS_rs1205_00095
AACAGCTGCCCCATTGCTGCAAACCCAACCCTTTTAAACAGTCGAGTTGCGAAGGACAAGCACAAGGAGCTAAAGCTTGCTTTGGCTTTGGCCCTCTCAATGGTGTGTCTGCTTGTTGGT
>augustus_masked-Fvb1-1-processed-gene-270.5:1320:1440:Parent=augustus_masked-Fvb1-1-processed-gene-270.5-mRNA-1_12::augustus_masked-Fvb1-1-processed-gene-270.5:1320-1440||RAPiDGENOMICS_rs1205_00096
TTGCTACTCCTAGCAGTTGGTTGCAGAAGGAAAACAAGAATGTGGGAAGTAAAGCCAACTTCATACAAGGAAGAACAAAATATATCAGGCCCCTTTTCCTTCCAGACTGACTCCACTACT
>augustus_masked-Fvb1-1-processed-gene-270.5:1440:1560:Parent=augustus_masked-Fvb1-1-processed-gene-270.5-mRNA-1_13::augustus_masked-Fvb1-1-processed-gene-270.5:1440-1560||RAPiDGENOMICS_rs1205_00097
TGGGTGGCAGATGTTAAGCAAGCAACGTCAGTCCTTGTAGTGATTTTTGAGAAGCCATTGCTGAACTTCACATTTGCAGACCTCTTATCAGCAACGTCAAATTTTGACCGTGGAACACTT
>augustus_masked-Fvb1-1-processed-gene-270.5:1680:1800:Parent=augustus_masked-Fvb1-1-processed-gene-270.5-mRNA-1_15::augustus_masked-Fvb1-1-processed-gene-270.5:1680-1800||RAPiDGENOMICS_rs1205_00098
GAGTATCTTGGTCGAATCAAGCACCCCAATCTTGTGCCATTGACTGGATACTGCTTAGCTGGGGAGCAAAGAATTGCTATCTATGATTACATGGAGAATGGAAACCTTCAGAATTTGCTT
>augustus_masked-Fvb1-1-processed-gene-270.5:1920:2040:Parent=augustus_masked-Fvb1-1-processed-gene-270.5-mRNA-1_17::augustus_masked-Fvb1-1-processed-gene-270.5:1920-2040||RAPiDGENOMICS_rs1205_00099
CGTCACAAGATTGCTCTAGGTGCTGCCCGAGCATTGGCATTTCTACACCATGGTTGCTCATCTCCAATTATTCATAGAGATGTTAAAGCTAGTAGTGTTTATCTAGATTATGACTTGGAG
>augustus_masked-Fvb1-1-processed-gene-270.5:2160:2280:Parent=augustus_masked-Fvb1-1-processed-gene-270.5-mRNA-1_19::augustus_masked-Fvb1-1-processed-gene-270.5:2160-2280||RAPiDGENOMICS_rs1205_00100
ACCCCAAAGACTGATGTATATTGCTTTGGAGTTGTTCTTTTTGAGCTCATTACTGGGAAGAAACCAGCTGGTGATGATTATCCGGAGGACAAAGATGGAACTCTGGTGAGTTGGGTCAGA
>augustus_masked-Fvb1-1-processed-gene-270.5:540:660:Parent=augustus_masked-Fvb1-1-processed-gene-270.5-mRNA-1_5::augustus_masked-Fvb1-1-processed-gene-270.5:540-660|2x||RAPiDGENOMICS_rs1205_00101
TTGAATCTTGCTGGAAATGAGATTCATGGCAGGGACTCTGATTTTGCAGAGATGAAATCCATTACTAGTCTTAACATTTCCGGGAATGTGTTCAAGGGTTCAGTGATGGGTGTGTTTATG
>augustus_masked-Fvb1-1-processed-gene-270.5:660:780:Parent=augustus_masked-Fvb1-1-processed-gene-270.5-mRNA-1_6::augustus_masked-Fvb1-1-processed-gene-270.5:660-780|2x||RAPiDGENOMICS_rs1205_00102
GAGCTGTTGGAGGTGATTGACCTGAGCAAGAACCAGTTTGAAGGTCACATTTCTCAGGTACAATTCAATGCTAGCTATAATTGGTCTCATGTGGTTTATTTAGACCTGTCTGAGAATCAG
>augustus_masked-Fvb1-1-processed-gene-270.5:720:840:Parent=augustus_masked-Fvb1-1-processed-gene-270.5-mRNA-1_7::augustus_masked-Fvb1-1-processed-gene-270.5:720-840||RAPiDGENOMICS_rs1205_00103
CAATTCAATGCTAGCTATAATTGGTCTCATGTGGTTTATTTAGACCTGTCTGAGAATCAGCTTGGTGGAGAAATCTTTCATAATTTGACTGGAGTCCAAAATCTCAAGCACCTAAATCTA
>augustus_masked-Fvb1-1-processed-gene-270.5:780:900:Parent=augustus_masked-Fvb1-1-processed-gene-270.5-mRNA-1_7::augustus_masked-Fvb1-1-processed-gene-270.5:780-900|2x||RAPiDGENOMICS_rs1205_00104
CTTGGTGGAGAAATCTTTCATAATTTGACTGGAGTCCAAAATCTCAAGCACCTAAATCTAGCACACAATAGATTTACTAGGCAGAACTTCCCTGGAGTTGAAATGTTTTCTGGTTTGGAA
>augustus_masked-Fvb1-1-processed-gene-99.3:109:229:Parent=augustus_masked-Fvb1-1-processed-gene-99.3-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-99.3:109-229||RAPiDGENOMICS_rs1205_00105
GTGAAGCACTGATCGATTTGCTTACAGCACTGAATGATTCCAATGGCCGAATTGAATGGAATAATCATTTTGTCAGCCCATGTTTTAGCTGGGCTCATGTCACTTGTACAAATGGCAATG
>augustus_masked-Fvb1-1-processed-gene-99.3:1150:1270:Parent=augustus_masked-Fvb1-1-processed-gene-99.3-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-99.3:1150-1270||RAPiDGENOMICS_rs1205_00106
ATCTGAAATCAGGAGAGAAAGGCTTGGACTGGCCAACAAGGAAGCGCATCGCTTTTGGTGCAGCCAATGGCTTGGAGTATTTACATGAGAATTGCAATCCCAAGATTATCCACCGGGACT
>augustus_masked-Fvb1-1-processed-gene-99.3:1270:1390:Parent=augustus_masked-Fvb1-1-processed-gene-99.3-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-99.3:1270-1390||RAPiDGENOMICS_rs1205_00107
TGAAGGCTGCAAACATTCTTCTAGATGATGATTTTGAGCCTGTTCTTGGAGACTTTGGGCTAGCAAAGCTGGTTGATACAAAAGCAACTCATGTTACTACTCAAGTGCGTGGCACCATGG
>augustus_masked-Fvb1-1-processed-gene-99.3:1390:1510:Parent=augustus_masked-Fvb1-1-processed-gene-99.3-mRNA-1_3::augustus_masked-Fvb1-1-processed-gene-99.3:1390-1510||RAPiDGENOMICS_rs1205_00108
GTCATATTGCCCCTGAATATCTGTCCACTGGAAAATCTTCAGAAAAGACTGATGTTTTTGGATACGGTATCACCCTTCTCGAACTAGTCACTGGTCAGCGTGCAATAGATTTTGCTCGGC
>augustus_masked-Fvb1-1-processed-gene-99.3:1545:1665:Parent=augustus_masked-Fvb1-1-processed-gene-99.3-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-99.3:1545-1665||RAPiDGENOMICS_rs1205_00109
ATCAAGAAGCTGCAGAGAGAAAATAGGCTTGATGACATTGTGGATGGAAATATGAAGACCTATGATGTAAAAGAAGTCGGGACTGTCATTCAGGTTGCATTGCTCTGCACCCAGAGCTCA
>augustus_masked-Fvb1-1-processed-gene-99.3:1665:1785:Parent=augustus_masked-Fvb1-1-processed-gene-99.3-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-99.3:1665-1785||RAPiDGENOMICS_rs1205_00110
CCCGAGGACCGTCCAACAATGGCAGAAGTGGTTAGATTGCTGCAGGGAGTAGATTTAGCAGAGAGATGGGCTGAGTGGGAGCAGCTTGAAGATGTAAGGAGTCGTGAATTCTCGCTCGTG
>augustus_masked-Fvb1-1-processed-gene-99.3:311:431:Parent=augustus_masked-Fvb1-1-processed-gene-99.3-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-99.3:311-431||RAPiDGENOMICS_rs1205_00111
GGACTTTCAAGATAATAGTCTAACGGGTCCGTTACCTGTTTATCTTGCCAACTTGACACATCTCCAGAATCTAAACTTTGCAAATAATAACTTCAGAGGTCCTATACCGGATAGTTGGAG
>augustus_masked-Fvb1-1-processed-gene-99.3:664:784:Parent=augustus_masked-Fvb1-1-processed-gene-99.3-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-99.3:664-784||RAPiDGENOMICS_rs1205_00112
TTTCAACCAAGAAATCAAAACTTGGAAGAGTTATAACTTTGGCAAGTTGTGGCATTACGATACTTCTTTTTATCGGGGCTATATTTGGATATCGATATTATCACATGAACAAACTGAAGC
>augustus_masked-Fvb1-1-processed-gene-99.3:808:928:Parent=augustus_masked-Fvb1-1-processed-gene-99.3-mRNA-1_1::augustus_masked-Fvb1-1-processed-gene-99.3:808-928||RAPiDGENOMICS_rs1205_00113
GTGAATATGACTGCAAAATATCCTTTGGCCAATTGAGAAGATTTTCTTGGCGTGAAATTCAACTTGCCACAGATAATTTCGATGAGAGTAACATAATTGGACAGGGAGGCTTTGGAAGAG
>augustus_masked-Fvb1-1-processed-gene-99.3:928:1048:Parent=augustus_masked-Fvb1-1-processed-gene-99.3-mRNA-1_2::augustus_masked-Fvb1-1-processed-gene-99.3:928-1048||RAPiDGENOMICS_rs1205_00114
TTTACAGAGGTGTTCTCTCAGACAATGTAAAAATTGCAGTTAAACGCCTTACGGACTATAACAGTCCTGGTGGAGAGGCTGCATTCCTGAGAGAAGTACAACTTATTAGTGTTGCTGTTC
>augustus_masked-Fvb1-2-processed-gene-13.4:180:300:Parent=augustus_masked-Fvb1-2-processed-gene-13.4-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-13.4:180-300|2x||RAPiDGENOMICS_rs1205_00115
CTTAGCAGAGCCTACACTGCTCTCCAGGCATGGAAATCAGCAATCTCTGATGACCCAACTAAGGTCTTGGACACTTGGGTTGGACCAGATGTGTGTTCTTACAAAGGAGTCTTCTGTGCA
>augustus_masked-Fvb1-2-processed-gene-13.4:300:420:Parent=augustus_masked-Fvb1-2-processed-gene-13.4-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-13.4:300-420|2x||RAPiDGENOMICS_rs1205_00116
GATTCTGAGGATGGCCAAACCATTGTGGCTGGAATAGATCTCAATCATGCCAATCTCAAAGGCACTCTTGTCAAAGAGCTCTCCTTTCTAACTGAAATGTCCCTGATCCATCTCAACAGC
>augustus_masked-Fvb1-2-processed-gene-13.4:360:480:Parent=augustus_masked-Fvb1-2-processed-gene-13.4-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-13.4:360-480||RAPiDGENOMICS_rs1205_00117
GGCACTCTTGTCAAAGAGCTCTCCTTTCTAACTGAAATGTCCCTGATCCATCTCAACAGCAACAGATTTTCAGGCTTAATTCCTGACACTTTCAGAGACCTCAACTCTCTCCAAGAGCTT
>augustus_masked-Fvb1-2-processed-gene-13.4:420:540:Parent=augustus_masked-Fvb1-2-processed-gene-13.4-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-13.4:420-540|2x||RAPiDGENOMICS_rs1205_00118
AACAGATTTTCAGGCTTAATTCCTGACACTTTCAGAGACCTCAACTCTCTCCAAGAGCTTGACCTCAGTAACAACCAATTCTCAGGCCCCTTCCCCACAACCACATTATACATTCCCAAC
>augustus_masked-Fvb1-2-processed-gene-13.4:600:720:Parent=augustus_masked-Fvb1-2-processed-gene-13.4-mRNA-1_6::augustus_masked-Fvb1-2-processed-gene-13.4:600-720||RAPiDGENOMICS_rs1205_00119
AACAAAAACCTTGATGCCATTTTTCTCAACAACAACCAATTTGAAGGTGAGCTACCCCAGAGTTTAGGGAATGCACAAGCTTCTGTCATCAACTTAGCTAACAACAAGTTCAGTGGCAAC
>augustus_masked-Fvb1-2-processed-gene-13.4:720:840:Parent=augustus_masked-Fvb1-2-processed-gene-13.4-mRNA-1_7::augustus_masked-Fvb1-2-processed-gene-13.4:720-840||RAPiDGENOMICS_rs1205_00120
TTCCCAAGTAACTTTGGGTTCATGGGCACCAAACTGAAGGAGATTTTGTTCCTCAATAATCAACTAACTGGTTGCATTCCTGAAGGAGTTGGGCTTTTTTCTGAGATCCAAGTCTTTGAT
>augustus_masked-Fvb1-2-processed-gene-13.4:960:1080:Parent=augustus_masked-Fvb1-2-processed-gene-13.4-mRNA-1_9::augustus_masked-Fvb1-2-processed-gene-13.4:960-1080||RAPiDGENOMICS_rs1205_00121
CTGAAAAGCCTAGTGAATCTTACTGTTGCTTACAATTTCTTTTCTGGGTTCAGCCAGGAATGTGCCAAATTGTATTACAGGAATGTGGGGTTTGATTTCTCATTGAACTGCATTCCTGGG
>augustus_masked-Fvb1-2-processed-gene-166.4:1020:1140:Parent=augustus_masked-Fvb1-2-processed-gene-166.4-mRNA-1_9::augustus_masked-Fvb1-2-processed-gene-166.4:1020-1140|2x||RAPiDGENOMICS_rs1205_00122
CTGGACATTTCCGGCAACTTCTTCACCGGCGAGTTGCCCATCGAGACTATATTGAAGCTCAGCAAGTTGAAGAGTCTGTCTCTTTCTCTCAACGATTTCGTCGGCACTCTGCCGCGTTCT
>augustus_masked-Fvb1-2-processed-gene-166.4:120:240:Parent=augustus_masked-Fvb1-2-processed-gene-166.4-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-166.4:120-240||RAPiDGENOMICS_rs1205_00123
CTCCCCAAACCTACCCTTCTCTCCAATTGGCTCCCTGACCAAAACCCATGTCTGTTCTCCGGCGTCTTCTGCAAACAAACCCGAGTCTCCTCCATCGACCTCAGCTTCATCCCCTTGTCC
>augustus_masked-Fvb1-2-processed-gene-166.4:1680:1800:Parent=augustus_masked-Fvb1-2-processed-gene-166.4-mRNA-1_15::augustus_masked-Fvb1-2-processed-gene-166.4:1680-1800||RAPiDGENOMICS_rs1205_00124
GATCTCAATACAAACTTGCTGAATGGTTCAATCCCTCCTGGGCTTTTCAAACAATCTGGTAACATTGCGGTGAATTTTGTTGCTTCCAAGACGTATGTGTATATCAAGAATGATGGAAGT
>augustus_masked-Fvb1-2-processed-gene-166.4:2100:2220:Parent=augustus_masked-Fvb1-2-processed-gene-166.4-mRNA-1_18::augustus_masked-Fvb1-2-processed-gene-166.4:2100-2220|2x||RAPiDGENOMICS_rs1205_00125
GATCTCTCGAGCAACAGCCTCGATGGAAGCATTCCTCAGACTTTGGTTGGCCTTTCCATGCTGATGGAGATTGATTTGTCAAACAATCATCTTTCTGGAATGATTCCAGATTCAGGGCAG
>augustus_masked-Fvb1-2-processed-gene-166.4:240:360:Parent=augustus_masked-Fvb1-2-processed-gene-166.4-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-166.4:240-360||RAPiDGENOMICS_rs1205_00126
ACCAACCTCACTGTTGTCTCCACTTTCTTGATGACCATTGATTCTCTTCAATCCCTCACTCTCAAATCCACGGCCCTCTCCGGCCCGGTTTCTTTTCCGGCGAAATCCAAGTGCAGCCCT
>augustus_masked-Fvb1-2-processed-gene-166.4:2400:2520:Parent=augustus_masked-Fvb1-2-processed-gene-166.4-mRNA-1_21::augustus_masked-Fvb1-2-processed-gene-166.4:2400-2520||RAPiDGENOMICS_rs1205_00127
TTGCTTATTGTTTTAATTGAAACCAGGAAAAGGCGGAAAAAGAAGGATTCAAGTCTTGATGTTTATGTGGACAGTCGTTCCCACTCGGGTACCGCCTGGAAGCTAACAGGTGCCCGAGAA
>augustus_masked-Fvb1-2-processed-gene-166.4:600:720:Parent=augustus_masked-Fvb1-2-processed-gene-166.4-mRNA-1_6::augustus_masked-Fvb1-2-processed-gene-166.4:600-720||RAPiDGENOMICS_rs1205_00128
CTAGTCCTCAAGGGGAACAAGATCACCGGGGACATGAGTGTCTCCGGGTGCAAGAAGCTCGAGATTCTTGATTTCTCCTCGAACAATTTCACCGTCGAGATTCCATCGTTCGGCGACTGC
>augustus_masked-Fvb1-2-processed-gene-166.4:900:1020:Parent=augustus_masked-Fvb1-2-processed-gene-166.4-mRNA-1_8::augustus_masked-Fvb1-2-processed-gene-166.4:900-1020|2x||RAPiDGENOMICS_rs1205_00129
GGTACAATTCCACCCAGCTTGCTGGGTTCATGTGAGTCGCTACTGGAGCTTGATCTTTCGATGAACAATCTCTCCGGTACCGTTCCCGACGCATTGAGCTCGTGTGCTTCGCTGGAGACT
>augustus_masked-Fvb1-2-processed-gene-19.11:120:240:Parent=augustus_masked-Fvb1-2-processed-gene-19.11-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-19.11:120-240||RAPiDGENOMICS_rs1205_00130
GCTCACTACATCAAGCAGCGCCAGCTGCTCTACTACCGCGACGAGTTCGGCGACCGCGGTGAGCTCGTGAAAGTCGACCCTTCTCTGGTTTTCGAGAACCCGAGACTCCGAAATGCTTAC
>augustus_masked-Fvb1-2-processed-gene-19.11:180:300:Parent=augustus_masked-Fvb1-2-processed-gene-19.11-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-19.11:180-300|2x||RAPiDGENOMICS_rs1205_00131
GAGCTCGTGAAAGTCGACCCTTCTCTGGTTTTCGAGAACCCGAGACTCCGAAATGCTTACATAGCATTGCAAGCTTGGAAGAAGGCTATTCTCTCTGACCCTTTCAATCTCACTGGTGAC
>augustus_masked-Fvb1-2-processed-gene-19.11:240:360:Parent=augustus_masked-Fvb1-2-processed-gene-19.11-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-19.11:240-360||RAPiDGENOMICS_rs1205_00132
ATAGCATTGCAAGCTTGGAAGAAGGCTATTCTCTCTGACCCTTTCAATCTCACTGGTGACTGGGTCGGATCTGGTGTGTGCAGCTACACCGGGGTGTTCTGTGCTCCGGCTCTCGACAAC
>augustus_masked-Fvb1-2-processed-gene-19.11:300:420:Parent=augustus_masked-Fvb1-2-processed-gene-19.11-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-19.11:300-420|2x||RAPiDGENOMICS_rs1205_00133
TGGGTCGGATCTGGTGTGTGCAGCTACACCGGGGTGTTCTGTGCTCCGGCTCTCGACAACAGCTCGATCCGAACCGTCGCCGGCATTGACCTCAACCACGGCGATATTGCTGGGTACTTG
>augustus_masked-Fvb1-2-processed-gene-19.11:360:480:Parent=augustus_masked-Fvb1-2-processed-gene-19.11-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-19.11:360-480||RAPiDGENOMICS_rs1205_00134
AGCTCGATCCGAACCGTCGCCGGCATTGACCTCAACCACGGCGATATTGCTGGGTACTTGCCGGAGGAGCTTGGGCTGCTTACAGATCTTGCATTGTTCCACATCAACTCCAACAGGTTC
>augustus_masked-Fvb1-2-processed-gene-19.11:420:540:Parent=augustus_masked-Fvb1-2-processed-gene-19.11-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-19.11:420-540|2x||RAPiDGENOMICS_rs1205_00135
CCGGAGGAGCTTGGGCTGCTTACAGATCTTGCATTGTTCCACATCAACTCCAACAGGTTCTGCGGGACTGTGCCGCACAAATTCCGGAACCTGAAGCTGCTTTACGAGCTTGACATCAGT
>augustus_masked-Fvb1-2-processed-gene-19.11:480:600:Parent=augustus_masked-Fvb1-2-processed-gene-19.11-mRNA-1_5::augustus_masked-Fvb1-2-processed-gene-19.11:480-600||RAPiDGENOMICS_rs1205_00136
TGCGGGACTGTGCCGCACAAATTCCGGAACCTGAAGCTGCTTTACGAGCTTGACATCAGTAACAACCGCTTCGCCGGCAAGTTCCCGCATGTTGTGCTTCATCTCCCGGAGCTCAAGTTT
>augustus_masked-Fvb1-2-processed-gene-19.11:540:660:Parent=augustus_masked-Fvb1-2-processed-gene-19.11-mRNA-1_5::augustus_masked-Fvb1-2-processed-gene-19.11:540-660|2x||RAPiDGENOMICS_rs1205_00137
AACAACCGCTTCGCCGGCAAGTTCCCGCATGTTGTGCTTCATCTCCCGGAGCTCAAGTTTTTGGATCTGAGGTTCAATGAGTTCGAGGGGACTGTGCCCAAGGAGCTGTTTGACAAGGAC
>augustus_masked-Fvb1-2-processed-gene-19.11:600:720:Parent=augustus_masked-Fvb1-2-processed-gene-19.11-mRNA-1_6::augustus_masked-Fvb1-2-processed-gene-19.11:600-720||RAPiDGENOMICS_rs1205_00138
TTGGATCTGAGGTTCAATGAGTTCGAGGGGACTGTGCCCAAGGAGCTGTTTGACAAGGACTTGGATGCTATTTTCATCAACCACAATCGGTTCAGGTTCAATCTGCCTGACAATTTCGGG
>augustus_masked-Fvb1-2-processed-gene-19.11:720:840:Parent=augustus_masked-Fvb1-2-processed-gene-19.11-mRNA-1_7::augustus_masked-Fvb1-2-processed-gene-19.11:720-840||RAPiDGENOMICS_rs1205_00139
AACTCACCGGTTTCCGTTATTGTTCTCGCCAACAACAAGTTCCATGGCTGCGTTCCGGCGAGCTTGGGCAACATGTCAAACTTGGATGAGATAATTATGATGAATAATGGGTTCAGGTCG
>augustus_masked-Fvb1-2-processed-gene-19.11:840:960:Parent=augustus_masked-Fvb1-2-processed-gene-19.11-mRNA-1_8::augustus_masked-Fvb1-2-processed-gene-19.11:840-960||RAPiDGENOMICS_rs1205_00140
TGCTTGCCGGAGGAGATAGGGATGCTGAAGAACTTGACGGTGTTCGACGTGAGCTACAATCAGTTCTTGGGGCCGCTGCCGGACACAATTGGAGGGATGGTGAGTCTTGAGCAGCTCAAT
>augustus_masked-Fvb1-2-processed-gene-193.4:0:120:Parent=augustus_masked-Fvb1-2-processed-gene-193.4-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-193.4:0-120||RAPiDGENOMICS_rs1205_00141
ATGTCTGCAGCATCTTCAAGATGGCATCCTTTAAAGCCAATCAAAATCAGTTTTGAAATGATATTGAAGGTATGGGTTTATTGGCTGATGGTACTCAATATGCTCAAAATCAGTTTTGCA
>augustus_masked-Fvb1-2-processed-gene-27.2:0:120:Parent=augustus_masked-Fvb1-2-processed-gene-27.2-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-27.2:0-120||RAPiDGENOMICS_rs1205_00142
ATGACAACACCAAAACCTTGTCTATACACCCTTCTCTTCCTCATCTTCCTCATCCATGCCGACTCTCAGTCCCTTCAAGACAAGCAACTAGTAGTCCTGCTTAAGTTAAAGTCATACTGG
>augustus_masked-Fvb1-2-processed-gene-27.2:120:240:Parent=augustus_masked-Fvb1-2-processed-gene-27.2-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-27.2:120-240||RAPiDGENOMICS_rs1205_00143
CTATCTCCACCGGCCCTCAGCCATTGGACTTCATCATCAAACTCTAGCTCCCACTGTAGCTGTCCTGAGATCACCTGCACCGAGAACTCCGTTACCGGATTAGTTCTCTACAACGTAAAC
>augustus_masked-Fvb1-2-processed-gene-27.2:300:420:Parent=augustus_masked-Fvb1-2-processed-gene-27.2-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-27.2:300-420|2x||RAPiDGENOMICS_rs1205_00144
GGTGATAACTACCTCCCGGGAGATTTTCCCTTGTCTCTCTACAACTGCTCCAAGTTAGAGTACTTGGACCTGTCGCAGAACTACTTTGTGGGAACTATTCCTGACGACATCGACAGATTG
>augustus_masked-Fvb1-2-processed-gene-27.2:360:480:Parent=augustus_masked-Fvb1-2-processed-gene-27.2-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-27.2:360-480||RAPiDGENOMICS_rs1205_00145
TACTTGGACCTGTCGCAGAACTACTTTGTGGGAACTATTCCTGACGACATCGACAGATTGCCTAAGCTGCAGACGCTCATTCTCGCCGGCAACAACTTCTCTTGTTTGACTAACATCTTG
>augustus_masked-Fvb1-2-processed-gene-27.2:420:540:Parent=augustus_masked-Fvb1-2-processed-gene-27.2-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-27.2:420-540|2x||RAPiDGENOMICS_rs1205_00146
CCTAAGCTGCAGACGCTCATTCTCGCCGGCAACAACTTCTCTTGTTTGACTAACATCTTGGCAAGACCAAAATCTGCTATTTTCGCGTTGAAATCAGAATCCAACAAAATTTTACTTGAT
>augustus_masked-Fvb1-2-processed-gene-3.9:0:120:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-3.9:0-120||RAPiDGENOMICS_rs1205_00147
ATGATTCTCCAAGTCGAGCTCGATGGTGTCAAGTCGAGAGCGAAGCCCAGCCGAGGCATAAAATGCCTCTCGAGTCGGGCGAGGTCGAGTCGCGAGCTGTTGTGTCAAGGTCGAGCCTCG
>augustus_masked-Fvb1-2-processed-gene-3.9:1094:1214:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-3.9:1094-1214|2x||RAPiDGENOMICS_rs1205_00148
CGAACTACAAAAGATACTTCTTCGTGAGATTCTAAAGGAAAGAAAGTTAAAGGTGACAAGTTTAGCTAGAGGAATCAGTATGATCAAGGAAAGATTGCAACACAAAAGTGTTCTCTTAGT
>augustus_masked-Fvb1-2-processed-gene-3.9:1214:1334:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-3.9:1214-1334|2x||RAPiDGENOMICS_rs1205_00149
TCTTGATGATGTGAGTGACATGAATCAGTTAAACAACTTAGCCCGTCAATGTAGTTGGTTCGGAACGGGTAGTAGAATCATCATAACAACAAGGGATAAGAAATTGCTGAGATGTCATGG
>augustus_masked-Fvb1-2-processed-gene-3.9:1334:1454:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_5::augustus_masked-Fvb1-2-processed-gene-3.9:1334-1454|2x||RAPiDGENOMICS_rs1205_00150
TGTTCATCCTGATCTAATATACGAGGTCCAGGAATTGGATAGTCATGATGCTCTCGAGCTTTTTAGTATGAATGCCTTTAAAAGAAGTCGGCCTTTGGATGATTATGCAGAACTCACAGA
>augustus_masked-Fvb1-2-processed-gene-3.9:1394:1514:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_6::augustus_masked-Fvb1-2-processed-gene-3.9:1394-1514||RAPiDGENOMICS_rs1205_00151
TTTTAGTATGAATGCCTTTAAAAGAAGTCGGCCTTTGGATGATTATGCAGAACTCACAGAACGTGCAGTGCGATACGCTCAAGGCCTTCCATTAGTTTTGACTGTTTTAGGTTCTTCTCT
>augustus_masked-Fvb1-2-processed-gene-3.9:140:260:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-3.9:140-260||RAPiDGENOMICS_rs1205_00152
GCACATGCTGCTGCGAACAAACCCCATTGTACGCACCAGGGAGGCCGAAGATGACGACTTTCTTGTCCTTGAAAAGGTCTTTGAGAGGAGTGGTGGAGAATACTTTTTCTCTATCACTGT
>augustus_masked-Fvb1-2-processed-gene-3.9:1514:1634:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_7::augustus_masked-Fvb1-2-processed-gene-3.9:1514-1634||RAPiDGENOMICS_rs1205_00153
ACGCGGTGGAAGTATGGAGCTATGGGAAGCTGCATTAGATGGTTCCGAAAGCCGTGAAATTAAAGATGTTCTGAAGATAAGTTTTGATGGATTGGATCACAGAGTGAAGGAAGCTTTTCT
>augustus_masked-Fvb1-2-processed-gene-3.9:1634:1754:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_8::augustus_masked-Fvb1-2-processed-gene-3.9:1634-1754||RAPiDGENOMICS_rs1205_00154
TGACATTGCATGTTTCTTTAAAGGTGAAGATAGAGAACACGTGATAAAGACTATTAAAGCATGTGGCGGCGAAGAACATTTTATTAATGTGCTCATAGAAAAGGCCCTCATCAGTGTTCG
>augustus_masked-Fvb1-2-processed-gene-3.9:1694:1814:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_8::augustus_masked-Fvb1-2-processed-gene-3.9:1694-1814|2x||RAPiDGENOMICS_rs1205_00155
ATGTGGCGGCGAAGAACATTTTATTAATGTGCTCATAGAAAAGGCCCTCATCAGTGTTCGATACGGGCCAATGGGCCCATACCCGGGGGATAAGATTTGGATGCATGACTTGATTGAAGA
>augustus_masked-Fvb1-2-processed-gene-3.9:1754:1874:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_9::augustus_masked-Fvb1-2-processed-gene-3.9:1754-1874||RAPiDGENOMICS_rs1205_00156
ATACGGGCCAATGGGCCCATACCCGGGGGATAAGATTTGGATGCATGACTTGATTGAAGAAATGGGTAGAGATATAGTTCACGAACAGTCACCCGATGACCCTGGAAATCGTAGCAGGTT
>augustus_masked-Fvb1-2-processed-gene-3.9:2037:2157:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-3.9:2037-2157||RAPiDGENOMICS_rs1205_00157
CGCTATTCTGGAGTTGTTGATGGTCTGCCAAATAGCTTAAGGGTGATTGATTGGCCTGACTGTCCCCTACAAGTTTTGCCATCCCATACCCTTCCAAGAGAGCTTTCTGTAATCCATATG
>augustus_masked-Fvb1-2-processed-gene-3.9:2319:2439:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-3.9:2319-2439||RAPiDGENOMICS_rs1205_00158
GAAGTGGATCCTTCTGTTGGATTCCTCGATAGACTTAATCATTTGAGTCTTGAGGGCTGCTGTAGGCTTGAGACTGTTCCAATGGAAGTTAGTTGGAAATCCATGAGGTCTCTTCTGGTT
>augustus_masked-Fvb1-2-processed-gene-3.9:2439:2559:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-3.9:2439-2559||RAPiDGENOMICS_rs1205_00159
CCCCATTGTGGAAGGCTTGAGAATTTCCTAAACATTGTGCACGAGATTGCGTCCCTTAAAACGTTGTCATTAAGTGGCAGTGGCATAAAAGAACTGCACTCCTGGATTGGACGTTGCACT
>augustus_masked-Fvb1-2-processed-gene-3.9:2559:2679:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-3.9:2559-2679||RAPiDGENOMICS_rs1205_00160
TCCTTGGAACATTTGGAGTTGGATGGTACTCCAATCAAACAACTGCCTTCAACAATTGGAAATCTTACTTCTGTGACAGAACTGTGGCTGTCTGGAACTCTCCTTAAAGAATTGCCGTAT
>augustus_masked-Fvb1-2-processed-gene-3.9:260:380:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-3.9:260-380||RAPiDGENOMICS_rs1205_00161
GAAACGCGTCAGGAAGGAAATTTCCCCCTCAACACCTTTGCTTTTCTCAGTTATTTCAGATTTGAGAATCCAATCAACTCTGCCTATTTCTTCTCCAAACTCCAAAAACACTTTGACAGT
>augustus_masked-Fvb1-2-processed-gene-3.9:2679:2799:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_5::augustus_masked-Fvb1-2-processed-gene-3.9:2679-2799||RAPiDGENOMICS_rs1205_00162
TCGATTGGATGTCTCACTTCCTTGGTGACTTTGGATGCGTGTAGAAGTCTCATTGAAGTACTGCCTTCATCAATTGGGGATCTCACTTCGTTAAGAAAACTGTACATGTCTGAAACTCCT
>augustus_masked-Fvb1-2-processed-gene-3.9:2799:2919:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_6::augustus_masked-Fvb1-2-processed-gene-3.9:2799-2919||RAPiDGENOMICS_rs1205_00163
CTTAAAGAATTGCCTTCATCAATTGGGGATCTCACTTCGTTAAGAGAACTGTACATGTTTGAAACTCCTCTTAAAGAATTGCCTTCATCAATTGGGTGCCTCACCTCTTTAAGAGAATTG
>augustus_masked-Fvb1-2-processed-gene-3.9:2919:3039:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_7::augustus_masked-Fvb1-2-processed-gene-3.9:2919-3039||RAPiDGENOMICS_rs1205_00164
GATGTGTCTGATACTCTGGTTGAAAAATTGCCTTCATCAATTGGGAATCTCACTTCCTTGAAGGAATTGTGGCTGAATTATACTCTCATTGAAAAATTGCCTCCGTCAGTTGAGAATCTC
>augustus_masked-Fvb1-2-processed-gene-3.9:3039:3159:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_8::augustus_masked-Fvb1-2-processed-gene-3.9:3039-3159||RAPiDGENOMICS_rs1205_00165
ACTTCCTTGGAGAGTTTGGAGCTGTCTAAAACTCCTCTTAAAGAATTGCCTTCATCAATTGGGAATCTCACTTCCTTGAAGAAATTGAGGCTGAATAATACTCTCATTGAAAAATTGCCT
>augustus_masked-Fvb1-2-processed-gene-3.9:3099:3219:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_8::augustus_masked-Fvb1-2-processed-gene-3.9:3099-3219|2x||RAPiDGENOMICS_rs1205_00166
GGGAATCTCACTTCCTTGAAGAAATTGAGGCTGAATAATACTCTCATTGAAAAATTGCCTCCGTCAGTTGGGAATCTCACTTCCTTGGAGAGTTTGGAGCTGTCTAAAACTCCTCTTAAA
>augustus_masked-Fvb1-2-processed-gene-3.9:3159:3279:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_9::augustus_masked-Fvb1-2-processed-gene-3.9:3159-3279||RAPiDGENOMICS_rs1205_00167
CCGTCAGTTGGGAATCTCACTTCCTTGGAGAGTTTGGAGCTGTCTAAAACTCCTCTTAAAGAATTGCCTTCATCAATTGGTTCTCTCACTTCTTTAAGAAAATTGGACGCTTCTGAAACT
>augustus_masked-Fvb1-2-processed-gene-3.9:3519:3639:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_12::augustus_masked-Fvb1-2-processed-gene-3.9:3519-3639||RAPiDGENOMICS_rs1205_00168
CATGATCATCCTGGTTCACTATTGTTTCCCCAGCTACATGATTTAAGTTTTACAGGATTCGAATTATCAGTGGTGTCTGATTTTCTAACGAATCTGGATTGCAAGTCCACATTACAGAGT
>augustus_masked-Fvb1-2-processed-gene-3.9:3759:3879:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_14::augustus_masked-Fvb1-2-processed-gene-3.9:3759-3879||RAPiDGENOMICS_rs1205_00169
AATTTAAGATATATACAGCTGGATGATTGCGTATTGTTGGAAAGATTTTCGAAATTGTCAGACATACTGGAACAGAAAGACACTCCGGGACTTCTTCGCCGGATGAAATTGTCTAATTGC
>augustus_masked-Fvb1-2-processed-gene-3.9:4065:4185:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-3.9:4065-4185||RAPiDGENOMICS_rs1205_00170
GGTCATGAAACTGGTGATATGTGTGAAATTTTGGTAAGAATCCCTAGGAATCTGAAGGCTGAGAAAATAGGATTTGTTGTCTGTGTTGTTTTTGGAATTACAAAAGAACTTTATTGCCCT
>augustus_masked-Fvb1-2-processed-gene-3.9:412:532:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-3.9:412-532||RAPiDGENOMICS_rs1205_00171
GTCACTTGTACAGCGCTTTGCGTGACAAGGGAATCTTCACCTTCATGGATGATCAGCTCATACGAGGAGAAGAAATATCACCGGCGTTAATCCAAGCAATCGAACAGTCGAAGATTTCAA
>augustus_masked-Fvb1-2-processed-gene-3.9:4185:4305:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-3.9:4185-4305||RAPiDGENOMICS_rs1205_00172
GAATCTGTCCTAGTGACGGTTGTGATTGATGAAGAAGAGTATGCAAATTATGGCCGCTGGCACTATTTTGAAGCAAGAGCAACAGAGTCATCCGCTCATGATCATGTATTAGTGTGTCTG
>augustus_masked-Fvb1-2-processed-gene-3.9:4305:4425:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-3.9:4305-4425||RAPiDGENOMICS_rs1205_00173
ATATGTATTGCTTTCAAGGAGCTAGAGTTGGTGGATCGTGTGGTTCGAGTTATGTGTCGTGGCTATAATGGGCCGTTGCCCCTAAAAAGTTTCGGGGTCCACCTGCTGGCTAATATGCAA
>augustus_masked-Fvb1-2-processed-gene-3.9:472:592:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-3.9:472-592|2x||RAPiDGENOMICS_rs1205_00174
TACGAGGAGAAGAAATATCACCGGCGTTAATCCAAGCAATCGAACAGTCGAAGATTTCAATCGTTGTGCTCTCTGAACACTATGCCTCCTCCAAGTGGTGTTTGGATGAACTTGTCAAGA
>augustus_masked-Fvb1-2-processed-gene-3.9:532:652:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-3.9:532-652||RAPiDGENOMICS_rs1205_00175
TCGTTGTGCTCTCTGAACACTATGCCTCCTCCAAGTGGTGTTTGGATGAACTTGTCAAGATCCTCGACTGCAAGGAAAAAATTCAACAAATCGTTCTGCCAGTTTTCTTCAAAGTCGATC
>augustus_masked-Fvb1-2-processed-gene-3.9:592:712:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-3.9:592-712|2x||RAPiDGENOMICS_rs1205_00176
TCCTCGACTGCAAGGAAAAAATTCAACAAATCGTTCTGCCAGTTTTCTTCAAAGTCGATCCCTCGGATGTACGAAATCACAGAGGTAGCTTTGGGGAGGGACTTGCCAATCTGGAACGCA
>augustus_masked-Fvb1-2-processed-gene-3.9:652:772:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-3.9:652-772||RAPiDGENOMICS_rs1205_00177
CCTCGGATGTACGAAATCACAGAGGTAGCTTTGGGGAGGGACTTGCCAATCTGGAACGCAAATTCAAAGATCAGGACCAGGTCCAGGAATGGAAGACTGCTCTCTTCCGAGCAGCTAGTT
>augustus_masked-Fvb1-2-processed-gene-3.9:914:1034:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-3.9:914-1034||RAPiDGENOMICS_rs1205_00178
GATACAGAAGCTTTTAGGTGTCGAGGGAAGAGATGTTCATATGGTAGGGATATGGGGGGCTGGTGGAATTGGTAAGACAACAATTGCCAAAGCTGTCTATAACTCAATTGCTCAAAAATT
>augustus_masked-Fvb1-2-processed-gene-3.9:974:1094:Parent=augustus_masked-Fvb1-2-processed-gene-3.9-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-3.9:974-1094|2x||RAPiDGENOMICS_rs1205_00179
TGGTGGAATTGGTAAGACAACAATTGCCAAAGCTGTCTATAACTCAATTGCTCAAAAATTTGATGGGAGTTGTTTTTTAGAAAATGTTAGAGACAACTCAGAGGGGGCCAGAGGCTTGGT
>augustus_masked-Fvb1-2-processed-gene-49.21:0:120:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-49.21:0-120||RAPiDGENOMICS_rs1205_00180
ATGTTCAATTTTGTCTGTTTGATCACCGTTTTCTCGGTTGCCGCGGGGGCGTCAAGCCAAGAAAATATTCATCATCTTCAAGCAATGAGAGAAAAGGCATCGTTGGTTTCATTCATGTCC
>augustus_masked-Fvb1-2-processed-gene-49.21:1020:1140:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_9::augustus_masked-Fvb1-2-processed-gene-49.21:1020-1140|2x||RAPiDGENOMICS_rs1205_00181
TTGAATGGAACCATCCCCTCCCAACTATGCCTAATGAGAAAGCTGGAACGGGTATATCTGTCGAATAATTCACTCTCTGGTGAGATTCCATCTGAACTTGGTGGCATTCCCCATCTAGGC
>augustus_masked-Fvb1-2-processed-gene-49.21:1080:1200:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_10::augustus_masked-Fvb1-2-processed-gene-49.21:1080-1200||RAPiDGENOMICS_rs1205_00182
TCGAATAATTCACTCTCTGGTGAGATTCCATCTGAACTTGGTGGCATTCCCCATCTAGGCCTTCTAGATTTATCGAGAAACAAGCTTTCTGGTTCGATCCCAGATAATTTCGAAAACCTA
>augustus_masked-Fvb1-2-processed-gene-49.21:1140:1260:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_10::augustus_masked-Fvb1-2-processed-gene-49.21:1140-1260|2x||RAPiDGENOMICS_rs1205_00183
CTTCTAGATTTATCGAGAAACAAGCTTTCTGGTTCGATCCCAGATAATTTCGAAAACCTATCCCAGTTAAGAAGGCTAATGCTCTACGAGAATCAACTCTCGGGGACCATACCACCAAGT
>augustus_masked-Fvb1-2-processed-gene-49.21:120:240:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-49.21:120-240||RAPiDGENOMICS_rs1205_00184
GGGATTGTTTCAGACCCTCACCGTGCTCTAAAGGACTGGAATTCTAATATGGACGATGTTCATTTTTGTAATTGGACTGGCATCAGATGCAACAATGCTAGAAACCAAGTTGTGGAGCTC
>augustus_masked-Fvb1-2-processed-gene-49.21:1200:1320:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_11::augustus_masked-Fvb1-2-processed-gene-49.21:1200-1320||RAPiDGENOMICS_rs1205_00185
TCCCAGTTAAGAAGGCTAATGCTCTACGAGAATCAACTCTCGGGGACCATACCACCAAGTCTAGGAAAGTGCATCAACTTAGAGATTCTAGACCTTTCTCACAATCAAATGTCTGGGGTG
>augustus_masked-Fvb1-2-processed-gene-49.21:1260:1380:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_11::augustus_masked-Fvb1-2-processed-gene-49.21:1260-1380|2x||RAPiDGENOMICS_rs1205_00186
CTAGGAAAGTGCATCAACTTAGAGATTCTAGACCTTTCTCACAATCAAATGTCTGGGGTGATTCCTAGTGAAGTTGCAGGGTTAAGGAGCTTGAAGTTGTACTTGAACTTGTCAAGTAAT
>augustus_masked-Fvb1-2-processed-gene-49.21:1320:1440:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_12::augustus_masked-Fvb1-2-processed-gene-49.21:1320-1440||RAPiDGENOMICS_rs1205_00187
ATTCCTAGTGAAGTTGCAGGGTTAAGGAGCTTGAAGTTGTACTTGAACTTGTCAAGTAATCACTTACATGGAGAGGTACCAATGGAGCTAAGTAAAATGGACATGGTGCTAGCAATAGAC
>augustus_masked-Fvb1-2-processed-gene-49.21:1380:1500:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_12::augustus_masked-Fvb1-2-processed-gene-49.21:1380-1500|2x||RAPiDGENOMICS_rs1205_00188
CACTTACATGGAGAGGTACCAATGGAGCTAAGTAAAATGGACATGGTGCTAGCAATAGACCTGTCTTCCAATAATCTTTCTGGCACAATCCCATCGCAACTTGGGAGCTGCATTGCCCTC
>augustus_masked-Fvb1-2-processed-gene-49.21:1440:1560:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_13::augustus_masked-Fvb1-2-processed-gene-49.21:1440-1560||RAPiDGENOMICS_rs1205_00189
CTGTCTTCCAATAATCTTTCTGGCACAATCCCATCGCAACTTGGGAGCTGCATTGCCCTCGAGTCCCTAAACATTTCATCAAATTCTTTACAAGGTCCTGTCCCGGTCTCAATAGGAAAG
>augustus_masked-Fvb1-2-processed-gene-49.21:1500:1620:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_13::augustus_masked-Fvb1-2-processed-gene-49.21:1500-1620|2x||RAPiDGENOMICS_rs1205_00190
GAGTCCCTAAACATTTCATCAAATTCTTTACAAGGTCCTGTCCCGGTCTCAATAGGAAAGTTGCCTTTTCTGGAGAAACTTGATGTATCTTCAAACCAGTTGGTTGGAGAAATACCAGAA
>augustus_masked-Fvb1-2-processed-gene-49.21:1560:1680:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_14::augustus_masked-Fvb1-2-processed-gene-49.21:1560-1680||RAPiDGENOMICS_rs1205_00191
TTGCCTTTTCTGGAGAAACTTGATGTATCTTCAAACCAGTTGGTTGGAGAAATACCAGAATCTCTGGAGCAATCCTTGACTCTCAAGGAACTTAACTTCTCTTTCAACAACTTCTCCGGA
>augustus_masked-Fvb1-2-processed-gene-49.21:1680:1800:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_15::augustus_masked-Fvb1-2-processed-gene-49.21:1680-1800||RAPiDGENOMICS_rs1205_00192
AATGTATCAAACAAAGGCGCCTTTTCTTTGCTGACCGCGGACTCTTTCCTCGGAAATGCTGGCCTCTGTGGCTCAATAAAAGGCATGCCAAGCTGCAAGAAGAAGAATACTCATCATTTG
>augustus_masked-Fvb1-2-processed-gene-49.21:180:300:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-49.21:180-300|2x||RAPiDGENOMICS_rs1205_00193
CATTTTTGTAATTGGACTGGCATCAGATGCAACAATGCTAGAAACCAAGTTGTGGAGCTCGATCTTAGTGGAAAGTCCTTAAGAGGCACTATTTCACCAGCTTTATCTAATCTTTCTTCC
>augustus_masked-Fvb1-2-processed-gene-49.21:1800:1920:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_16::augustus_masked-Fvb1-2-processed-gene-49.21:1800-1920||RAPiDGENOMICS_rs1205_00194
GCTATAATCTCAGTCCTGCTGTCATTAATCATCACGCCCATTTTTTGCGTAGTTAGTTACCCCCTCATGCACAGGTCAAAAATCCGAAGGCACCTTGGAATATTCAATGATGAGGAATTG
>augustus_masked-Fvb1-2-processed-gene-49.21:2040:2160:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_18::augustus_masked-Fvb1-2-processed-gene-49.21:2040-2160||RAPiDGENOMICS_rs1205_00195
TTTGGGCACGTCTACAAGGGTGTCCTTCATGATAACACAGTAATTGCTGTCAAAGTTTTGGATTTAAAGACAGAAGAAGAGATTTCTGGAAGTTTTAAAAGGGAATGCCAGGTCCTGAAG
>augustus_masked-Fvb1-2-processed-gene-49.21:2160:2280:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_19::augustus_masked-Fvb1-2-processed-gene-49.21:2160-2280||RAPiDGENOMICS_rs1205_00196
AGAACCAGACACAGAAATTTGATTAGAATCATCACTGCTTGCAGTAGACCAGACTTTAAGGCTCTCGTTCTGCCATTGATGTCGAATGGGAGCCTCGAGAGGCATCTTTACTCGTCGTCA
>augustus_masked-Fvb1-2-processed-gene-49.21:2280:2400:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_20::augustus_masked-Fvb1-2-processed-gene-49.21:2280-2400||RAPiDGENOMICS_rs1205_00197
TCAAGCCATTGTGGATTGAATCTAATTCAGCTGGTGAGCATCTGCAGTGATGTAGCTGAAGGAGTGGCCTATTTGCATCATCATTCTCCTGTTAGAGTTGTACACTGTGATCTCAAACCA
>augustus_masked-Fvb1-2-processed-gene-49.21:240:360:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-49.21:240-360||RAPiDGENOMICS_rs1205_00198
GATCTTAGTGGAAAGTCCTTAAGAGGCACTATTTCACCAGCTTTATCTAATCTTTCTTCCTTAACCATTCTTGATTTGTCAAGCAACTTCTTTGAAGGTCACATTCCAAGAGAGTTAGGC
>augustus_masked-Fvb1-2-processed-gene-49.21:2400:2520:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_21::augustus_masked-Fvb1-2-processed-gene-49.21:2400-2520||RAPiDGENOMICS_rs1205_00199
AGCAACATTCTACTAGATGATGACCTGACAGCTTTGGTTACTGATTTTGGAATTGCAAGACTGATCAAAGGTGAAGACGAGACTATTCCCATGACTGACTCGACATCCTTCAACTCAGCA
>augustus_masked-Fvb1-2-processed-gene-49.21:2520:2640:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_22::augustus_masked-Fvb1-2-processed-gene-49.21:2520-2640||RAPiDGENOMICS_rs1205_00200
GATGGCTTGTTATGTGGATCCATTGGCTATATAGCTCCTGGTATGTACTTTTCTACAATAACGAAATTGAAATATGTGCATTCTACTAGTAATATTCACGTTGATGTTTCACCATATGCA
>augustus_masked-Fvb1-2-processed-gene-49.21:2640:2760:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_23::augustus_masked-Fvb1-2-processed-gene-49.21:2640-2760||RAPiDGENOMICS_rs1205_00201
GAATATGGAATGGGAAAATGTGCTTCGACTCAGGGAGATGTATTCAGCTTTGGGGTGCTTCTGTTAGAAATTGTTACAGGAAGGCGGCCAACAGATGTTGATTTTCACAAAGGTTCAAGC
>augustus_masked-Fvb1-2-processed-gene-49.21:2880:3000:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_25::augustus_masked-Fvb1-2-processed-gene-49.21:2880-3000||RAPiDGENOMICS_rs1205_00202
ATTCTGGAGTTGATTGAGATTGGTCTTATGTGCACACAGCACAATCCTTCACTGAGACCAAACATGCAGGATGTTGCTCATGAAATGAGCCGGGTGAAGGAGTACATATCCAATCCTTCA
>augustus_masked-Fvb1-2-processed-gene-49.21:300:420:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-49.21:300-420|2x||RAPiDGENOMICS_rs1205_00203
TTAACCATTCTTGATTTGTCAAGCAACTTCTTTGAAGGTCACATTCCAAGAGAGTTAGGCTTTCTTTCTCTGCTAACAGAACTCAGCTTGTCATCAAATCTTCTTGAAGGAAACATTGCA
>augustus_masked-Fvb1-2-processed-gene-49.21:360:480:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-49.21:360-480||RAPiDGENOMICS_rs1205_00204
TTTCTTTCTCTGCTAACAGAACTCAGCTTGTCATCAAATCTTCTTGAAGGAAACATTGCAGCTGAGCTTGGTTTACTTCATAGATTGGTGTATCTTGATTTGGGAAGCAACAAACTAGAG
>augustus_masked-Fvb1-2-processed-gene-49.21:420:540:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-49.21:420-540|2x||RAPiDGENOMICS_rs1205_00205
GCTGAGCTTGGTTTACTTCATAGATTGGTGTATCTTGATTTGGGAAGCAACAAACTAGAGGGTGAAATTCCAATGCCGCTTTTCTGCAATCACTCTTCTAATTCTCTGCAGTACATAGAC
>augustus_masked-Fvb1-2-processed-gene-49.21:480:600:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_5::augustus_masked-Fvb1-2-processed-gene-49.21:480-600||RAPiDGENOMICS_rs1205_00206
GGTGAAATTCCAATGCCGCTTTTCTGCAATCACTCTTCTAATTCTCTGCAGTACATAGACTTGTCTAACAATTCTTTGAGCGGCAAAATTCCCTTAACAAAAGGATGTGAGCTGAAAAAA
>augustus_masked-Fvb1-2-processed-gene-49.21:540:660:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_5::augustus_masked-Fvb1-2-processed-gene-49.21:540-660|2x||RAPiDGENOMICS_rs1205_00207
TTGTCTAACAATTCTTTGAGCGGCAAAATTCCCTTAACAAAAGGATGTGAGCTGAAAAAACTGAGGTTTCTTCTACTTTGGTCCAATCATCTAGCTGGACAGGTTCCTGCAGCACTTTCA
>augustus_masked-Fvb1-2-processed-gene-49.21:60:180:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-49.21:60-180|2x||RAPiDGENOMICS_rs1205_00208
GAAAATATTCATCATCTTCAAGCAATGAGAGAAAAGGCATCGTTGGTTTCATTCATGTCCGGGATTGTTTCAGACCCTCACCGTGCTCTAAAGGACTGGAATTCTAATATGGACGATGTT
>augustus_masked-Fvb1-2-processed-gene-49.21:600:720:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_6::augustus_masked-Fvb1-2-processed-gene-49.21:600-720||RAPiDGENOMICS_rs1205_00209
CTGAGGTTTCTTCTACTTTGGTCCAATCATCTAGCTGGACAGGTTCCTGCAGCACTTTCAAACTCCTCGAAGCTCGAATGGCTTGACATAGAGTCCAACATGCTAAGCGGGGAGCTGCCA
>augustus_masked-Fvb1-2-processed-gene-49.21:660:780:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_6::augustus_masked-Fvb1-2-processed-gene-49.21:660-780|2x||RAPiDGENOMICS_rs1205_00210
AACTCCTCGAAGCTCGAATGGCTTGACATAGAGTCCAACATGCTAAGCGGGGAGCTGCCATCGGAGATTGTAGCGAAAATGCCACAGTTGCAGTACCTCTACTTGTCCTACAATGGCTTT
>augustus_masked-Fvb1-2-processed-gene-49.21:720:840:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_7::augustus_masked-Fvb1-2-processed-gene-49.21:720-840||RAPiDGENOMICS_rs1205_00211
TCGGAGATTGTAGCGAAAATGCCACAGTTGCAGTACCTCTACTTGTCCTACAATGGCTTTGTCAGCCATGACGGTAACACTAACCTTGAACCTTTTTTAACCTCTCTAGTTAATGCCTCT
>augustus_masked-Fvb1-2-processed-gene-49.21:840:960:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_8::augustus_masked-Fvb1-2-processed-gene-49.21:840-960||RAPiDGENOMICS_rs1205_00212
AACTTTCAAGAGCTTGAATTAGCTGGGAATAATCTCGGGGGAGAGATACCGCCTATTATTGGTGATCTTTCGACAAATCTTGTTCAAGTTCATTTAGATGATAATCTCCTTTATGGTTCA
>augustus_masked-Fvb1-2-processed-gene-49.21:960:1080:Parent=augustus_masked-Fvb1-2-processed-gene-49.21-mRNA-1_9::augustus_masked-Fvb1-2-processed-gene-49.21:960-1080||RAPiDGENOMICS_rs1205_00213
ATCCCTCCTCACATTTCAAACCTTGTCAACCTCACCCTCTTGAACTTGTCTAGTAACCATTTGAATGGAACCATCCCCTCCCAACTATGCCTAATGAGAAAGCTGGAACGGGTATATCTG
>augustus_masked-Fvb1-2-processed-gene-59.0:0:120:Parent=augustus_masked-Fvb1-2-processed-gene-59.0-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-59.0:0-120||RAPiDGENOMICS_rs1205_00214
ATGGTTTTACTGGGGAGATTCCAGAGATTACAGCATGTAGTGAGACAATGCAGTATTTTGATACCTCAGAAGCTGGATGTCTCTGGTAATGGTTTACTAGGAGAGATACCTCAGAAGCTT
>augustus_masked-Fvb1-2-processed-gene-59.0:120:240:Parent=augustus_masked-Fvb1-2-processed-gene-59.0-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-59.0:120-240||RAPiDGENOMICS_rs1205_00215
TACAACATGACTTACCTTGAAATCCTTGACCTGCATAAAAACCAGCTCAATGGAAGCATCCCACCAGACCTTGGAAACCTGTCCAGATTACAATTTCTGGATCTGTCACAAAATTTGCTT
>augustus_masked-Fvb1-2-processed-gene-59.0:240:360:Parent=augustus_masked-Fvb1-2-processed-gene-59.0-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-59.0:240-360||RAPiDGENOMICS_rs1205_00216
TCTGGGTTGATTCCTTCTTCTCTTGGAAATCTATCAAATTTGACCTATTTTAACCTCTCCTCCAATGACCTGTCAGGCATTATTCCCACAACAGTCGAAGGGTACGGCCGTTATGCTTTC
>augustus_masked-Fvb1-2-processed-gene-59.0:300:420:Parent=augustus_masked-Fvb1-2-processed-gene-59.0-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-59.0:300-420|2x||RAPiDGENOMICS_rs1205_00217
TCCAATGACCTGTCAGGCATTATTCCCACAACAGTCGAAGGGTACGGCCGTTATGCTTTCATTAACAACCCTTATCTCTGTGGTTCCCCTCTGGACCAGCCTTGCTCAGCAAATGGTAAT
>augustus_masked-Fvb1-2-processed-gene-59.0:360:480:Parent=augustus_masked-Fvb1-2-processed-gene-59.0-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-59.0:360-480||RAPiDGENOMICS_rs1205_00218
ATTAACAACCCTTATCTCTGTGGTTCCCCTCTGGACCAGCCTTGCTCAGCAAATGGTAATGGTACTGGGATTTCTACTTCGAGGAAACCCAAGGCTCTTCGATTGTCTGCCATCATTGCA
>augustus_masked-Fvb1-2-processed-gene-59.0:480:600:Parent=augustus_masked-Fvb1-2-processed-gene-59.0-mRNA-1_5::augustus_masked-Fvb1-2-processed-gene-59.0:480-600||RAPiDGENOMICS_rs1205_00219
ATTGTTGCTGCTGCCCTGATTCTTGCTGGAGTTTGTCTAGTATTCATAATGAACATCATAGCTCGCAGAAAGAAGGTAGATGATGTGACAATGGTAATTGAGAGCACACCACTTGGTTCA
>augustus_masked-Fvb1-2-processed-gene-59.0:600:720:Parent=augustus_masked-Fvb1-2-processed-gene-59.0-mRNA-1_6::augustus_masked-Fvb1-2-processed-gene-59.0:600-720||RAPiDGENOMICS_rs1205_00220
ACTGATTCAAATGTGATTATTGGGAAGTTGGTTCTCTTCAGCAAAAGTTTGCCTTCAAGGTATGAAGACTGGGAATCAGGCACAAAAGCTTTGCTTGACAAAGAATGTATAATAGGTGGT
>augustus_masked-Fvb1-2-processed-gene-59.0:720:840:Parent=augustus_masked-Fvb1-2-processed-gene-59.0-mRNA-1_7::augustus_masked-Fvb1-2-processed-gene-59.0:720-840||RAPiDGENOMICS_rs1205_00221
GGATCACTTGGCACTGTCTACAGAACTACGTTTGAAGGTGGCATCTCGATTGCAGTGAAGAAGCTTGAGACTCTGGGAAGGATCAGAAACCAAGAAGAATTTGAGCAAGAAATTGGACGA
>augustus_masked-Fvb1-2-processed-gene-63.3:0:120:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-63.3:0-120||RAPiDGENOMICS_rs1205_00222
ATGCATCTCAATTCTCAGGAAGGTTCGAGACAGAGTGAGGGCAAAGAAGACAGCGCACTGTCTAAAGAAGGCAAAGAAGAACTGGAGTCGGACACGCTGCAGAGAAAGCGAGAAAATTCT
>augustus_masked-Fvb1-2-processed-gene-63.3:1220:1340:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_5::augustus_masked-Fvb1-2-processed-gene-63.3:1220-1340||RAPiDGENOMICS_rs1205_00223
CGGAACGGGTAGTAGAATCATCATAACAACAAGGGATAAGAAATTGCTGAGAAGTCTTGGTGTTCATCCTGATCTAATATACGAGGTCCAGGAATTGGATAGTCATGATGCTCTCGAGCT
>augustus_masked-Fvb1-2-processed-gene-63.3:176:296:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-63.3:176-296||RAPiDGENOMICS_rs1205_00224
GCACATGCTGCTGCGAACGAACCCCAGTGTACGCACCAGGGAGGCCGAAGACGACGACTTTCTTGTCCTTGAAATGGTCTTTGAGAGGAGTGGTGGAGAATTTAGAGGAGACGCCCTCGT
>augustus_masked-Fvb1-2-processed-gene-63.3:1839:1959:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-63.3:1839-1959||RAPiDGENOMICS_rs1205_00225
GGCACAAACAACGTTAGAGGCATCAAGGTGGAGCTACCCAAGGATTCAGATGTGTTACGTTTATGTGCTACTTCTTTCTCCAGCATGAAAAATCTTAAACTTGTCATATGCCGAGCGGGA
>augustus_masked-Fvb1-2-processed-gene-63.3:2121:2241:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-63.3:2121-2241||RAPiDGENOMICS_rs1205_00226
CGTTTGATAAATCTGACATCAATAAATCTCCGTGATTGTCAATACTTAACAAAAGTGTCAGACTTATCAGGGATCCCAAACTTACAAAGTTTGATACTAGATAGCTGCGAAAATCTAGTT
>augustus_masked-Fvb1-2-processed-gene-63.3:2241:2361:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-63.3:2241-2361||RAPiDGENOMICS_rs1205_00227
GAAGTGCATCCTTCTGTTGGATTCCTCGATAGACTTAATTGTTTGGATCTTTCGCGCTGCTGTAGGCTTGAGACTGTTCCAATGGAAGTTAGTTGGAAATCCATGAGGTCTCTTCTGGTT
>augustus_masked-Fvb1-2-processed-gene-63.3:2361:2481:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-63.3:2361-2481||RAPiDGENOMICS_rs1205_00228
CCCTATTGTCGAAGGCTTGAGAATTTCATAAACATTGTGCACGAGATTGAGTCCATTAAAAAGTTGGACTTAAGTTTCAGTGGCATAAAAGAACTGCACTCCTGGATTGGACATTGCACT
>augustus_masked-Fvb1-2-processed-gene-63.3:2481:2601:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-63.3:2481-2601||RAPiDGENOMICS_rs1205_00229
TCCTTGGAACATTTGGCCTTGGATGGTACTCCAATCAAACAACTGCCTTCAACGATTGGAAATCTTACTTCTTTGACAGAACTGGGGCTGTCTCGAACTCTCCTTAAAGAATTGCCTTGT
>augustus_masked-Fvb1-2-processed-gene-63.3:2601:2721:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_5::augustus_masked-Fvb1-2-processed-gene-63.3:2601-2721||RAPiDGENOMICS_rs1205_00230
TCGATTGGATGTCTCACTTCCTTGGTGACTTTGGATGCGTGGGGAAGTCTCATCGAAGTACTGCCTTCATCAATTGGGGATCTCACTTCGTTAAGATCATTGGACATGTCTAAAACTCCT
>augustus_masked-Fvb1-2-processed-gene-63.3:2721:2841:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_6::augustus_masked-Fvb1-2-processed-gene-63.3:2721-2841||RAPiDGENOMICS_rs1205_00231
CTTAAAGAATTGCCTTCATCAATTGGGTGTCTCACTTCCTTGTGGCGATTAGACGCTTCTGAAACTCTCATTGAAGGATTGCCTTTGTCAATTGGAAATCTCATTGGCCTTGAACGTTTA
>augustus_masked-Fvb1-2-processed-gene-63.3:2841:2961:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_7::augustus_masked-Fvb1-2-processed-gene-63.3:2841-2961||RAPiDGENOMICS_rs1205_00232
GAACTAAGAGGATGTGCAAACCTTACAAATGTGCCACACAGTGTTTACGGAGGGCTGCAAGGTCTACATGACTTAGACCTCTCTTGGTGCCCAAAACTGGTTACATTTCCAAGTAGGGCG
>augustus_masked-Fvb1-2-processed-gene-63.3:2961:3081:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_8::augustus_masked-Fvb1-2-processed-gene-63.3:2961-3081||RAPiDGENOMICS_rs1205_00233
AGCGGTTTGGTTTCCTCAAGTTCAGAATCTCTTCTTCTGATGCTTCCAACTGATTCAAACAATGGGCATGATCATCCTGGTTCACTATTGTTTCCCCAGCTACATGATTTAATTTTTGAA
>augustus_masked-Fvb1-2-processed-gene-63.3:3081:3201:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_9::augustus_masked-Fvb1-2-processed-gene-63.3:3081-3201||RAPiDGENOMICS_rs1205_00234
GGATGCGAATTATCAGCGGTGTCTGATTTTCTAACGAATCTGGATTGCAAGTCCACATTGGAAAGACTTAATCTATCAGGAATCAATTTCGATAGTCTTCCGGCATGCATCGGCAAATTT
>augustus_masked-Fvb1-2-processed-gene-63.3:3201:3321:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_10::augustus_masked-Fvb1-2-processed-gene-63.3:3201-3321||RAPiDGENOMICS_rs1205_00235
CTCAATCTGGATTCTCTTTATTTGGGTGGTTGCAAGAGGCTTCGAGACATTTCAGAACTTCCTCCAAATTTAAGATATATAGAGCTGGATGATTGCGTATTGTTGGAAAGGTTTTCGAAA
>augustus_masked-Fvb1-2-processed-gene-63.3:329:449:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-63.3:329-449||RAPiDGENOMICS_rs1205_00236
AGGTGAGGATACACGCAACAATTTCACAGGTCACTTGTACAGCGCTTTGCGTGACAAGGGAATCTTCACCTTCATGGATGATCAGCTCATACGAGGAGAAGAAATATCACCGGCGTTAAT
>augustus_masked-Fvb1-2-processed-gene-63.3:3321:3441:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_11::augustus_masked-Fvb1-2-processed-gene-63.3:3321-3441||RAPiDGENOMICS_rs1205_00237
TTGTCAGACATACTGGAACAGAAAGACACTCCGGGACTTATTCGCCGGATGACATTGTCTAATTGCAATAGATTGATGGATAATCTTGGCATAGACTTGGTGTCGAAGATGGCAAAAGCA
>augustus_masked-Fvb1-2-processed-gene-63.3:3573:3693:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-63.3:3573-3693||RAPiDGENOMICS_rs1205_00238
GGTCATGAAATTGGTGATATGTTTGAAATTTTGATAAGAACCCCTAGGAATCTGAAGGCTGAGAAAATAGGATTGGTTGTCTGTGTTGTTTTTGAAATTACAAAAGAACTTGGCAGTAAA
>augustus_masked-Fvb1-2-processed-gene-63.3:3813:3933:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-63.3:3813-3933||RAPiDGENOMICS_rs1205_00239
ATTGCTTTCAAGGAGCTAGAGTTGGTGGATCGTGTGGTTCGAGTTATGTGTAAACATAGGTTGCTCCTAAAAAGTTTCGGGGTCCACCTGGCTAATATGCAAGAGAATGATGGTGATCAT
>augustus_masked-Fvb1-2-processed-gene-63.3:389:509:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-63.3:389-509|2x||RAPiDGENOMICS_rs1205_00240
AATCTTCACCTTCATGGATGATCAGCTCATACGAGGAGAAGAAATATCACCGGCGTTAATCCAAGCAATCGAACAGTCGAAGATTTCAATCGTTGTGCTCTCTGAACACTATGCCTCCTC
>augustus_masked-Fvb1-2-processed-gene-63.3:569:689:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-63.3:569-689||RAPiDGENOMICS_rs1205_00241
CGTTCTGCCAGTTTTCTTCAAAGTCGATCCCTCGGATGTACGAAATCACAGAGGTAGCTTTGGGGAGGGACTTGCCAATCTGGAACGCAAATTCAAAGATCAGGACCAGGTCCAGGAATG
>augustus_masked-Fvb1-2-processed-gene-63.3:740:860:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-63.3:740-860||RAPiDGENOMICS_rs1205_00242
GCATCACTCTGAATCCAGTATTATTGGGGAAATCGTTGCACATATATCAAAGGAACACGTCAACAGCACAGATTTGGATGTGGCCGAGTACCAAGTAGGAATACAACATCGTGTGCAAGC
>augustus_masked-Fvb1-2-processed-gene-63.3:980:1100:Parent=augustus_masked-Fvb1-2-processed-gene-63.3-mRNA-1_3::augustus_masked-Fvb1-2-processed-gene-63.3:980-1100||RAPiDGENOMICS_rs1205_00243
TGATGGGAGTTGTTTTTTAGAAAATGTTAGAGAAAACTCAGAGGGGGCCAGAGGCTTGGTCGAACTACAAAAGATACTTCTTCGTGAGATTCTAAAGGAAAGAAAGTTAAAGGTGACAAG
>augustus_masked-Fvb1-2-processed-gene-81.13:360:480:Parent=augustus_masked-Fvb1-2-processed-gene-81.13-mRNA-1_4::augustus_masked-Fvb1-2-processed-gene-81.13:360-480||RAPiDGENOMICS_rs1205_00244
CTCCCCGAATCCTTATCCAACCTCACTCGCCTCCGTCGACTCATCCTCTCCGGAAACTCGTTCTCCGGTCATATACCCACTTCATTTGGGTCTCTTTCTAATCTAGAAGAGCTTTTCCTC
>augustus_masked-Fvb1-2-processed-gene-81.13:480:600:Parent=augustus_masked-Fvb1-2-processed-gene-81.13-mRNA-1_5::augustus_masked-Fvb1-2-processed-gene-81.13:480-600||RAPiDGENOMICS_rs1205_00245
GACAACAATAAACTCCAAGGTTCGATCCCTCCCAGTTTCAACAACCTGGTCAGGTTGAACCGGCTGGAAGTCCAAGCTAACACTCTCAGCGGCGAGCTTCCAAACCTCAGCTCACTCACA
>augustus_masked-Fvb1-2-processed-gene-81.13:780:900:Parent=augustus_masked-Fvb1-2-processed-gene-81.13-mRNA-1_7::augustus_masked-Fvb1-2-processed-gene-81.13:780-900|2x||RAPiDGENOMICS_rs1205_00246
TCAATCCCGGCACACCTCTTCTCCCACCCATCTCTCCAGCAGCTCACTCTCTCCTTCAACCACTTCACCTCCCTCCAAACCTCAACCGGAGTCCAAAGCCAGCTCATCGCCGTCGACCTC
>augustus_masked-Fvb1-2-processed-gene-98.20:123:243:Parent=augustus_masked-Fvb1-2-processed-gene-98.20-mRNA-1_2::augustus_masked-Fvb1-2-processed-gene-98.20:123-243||RAPiDGENOMICS_rs1205_00247
ATAGAATCATGTCTGAAGCAGATGGAGGAAGGCGTTGAGCTCGCAGGCTATCCTAAGTGGAACAACAAGAGGCCTCAGTACACTGATCAACTTTTTGAGTTGGAGGAATCCCTTAAGAGA
>augustus_masked-Fvb1-2-processed-gene-98.20:3:123:Parent=augustus_masked-Fvb1-2-processed-gene-98.20-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-98.20:3-123||RAPiDGENOMICS_rs1205_00248
GAGGTTATAATGGAGTTTAAACCCCTACTCAAGACCATTAAATCCACTTTCGTTTCTTTACAACCGGTGATCCAGCAGATAGGAATGCACAATGCTGAGTTGAATCTTCCGGACGAGGAA
>augustus_masked-Fvb1-2-processed-gene-98.20:63:183:Parent=augustus_masked-Fvb1-2-processed-gene-98.20-mRNA-1_1::augustus_masked-Fvb1-2-processed-gene-98.20:63-183|2x||RAPiDGENOMICS_rs1205_00249
CAACCGGTGATCCAGCAGATAGGAATGCACAATGCTGAGTTGAATCTTCCGGACGAGGAAATAGAATCATGTCTGAAGCAGATGGAGGAAGGCGTTGAGCTCGCAGGCTATCCTAAGTGG
>augustus_masked-Fvb1-3-processed-gene-0.12:154:274:Parent=augustus_masked-Fvb1-3-processed-gene-0.12-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-0.12:154-274||RAPiDGENOMICS_rs1205_00250
TGACGCAAGGCGAGGACATCTTGCAACACATTCTAACTGATTTCGGGCTTAAAAGTGTAAAAGAACTGAGACAGTTTCTACAGCAAAAGAGGTATCTGGTTGTCTTAGACAATGTCTGGA
>augustus_masked-Fvb1-3-processed-gene-0.12:274:394:Parent=augustus_masked-Fvb1-3-processed-gene-0.12-mRNA-1_3::augustus_masked-Fvb1-3-processed-gene-0.12:274-394||RAPiDGENOMICS_rs1205_00251
GTACACAAGAGTCGAGTATCATTGTGAATGTCTTACCAAATGGTGCTCCTGGGAGTAAGATGATTATAACTAGTCGTATTTCTAATGTCGTCTATTGTCATGACTCCAAGCACATCCATG
>augustus_masked-Fvb1-3-processed-gene-0.12:334:454:Parent=augustus_masked-Fvb1-3-processed-gene-0.12-mRNA-1_3::augustus_masked-Fvb1-3-processed-gene-0.12:334-454|2x||RAPiDGENOMICS_rs1205_00252
TGATTATAACTAGTCGTATTTCTAATGTCGTCTATTGTCATGACTCCAAGCACATCCATGATTTGAGTAATGGGTTGTCACCGGAAGTGGCTAAGAATCTGTTCAGAATGAAGGTTCTCG
>augustus_masked-Fvb1-3-processed-gene-0.12:34:154:Parent=augustus_masked-Fvb1-3-processed-gene-0.12-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-0.12:34-154||RAPiDGENOMICS_rs1205_00253
GTAAACTCTTCCAACACTTGGTGGATGAAGAGCCAAAGCTTTCAACAATTGGTGTCATCGGGATCCACCCTGGCAAGTTTGGTTTTCAAGAGTTGTTTGAGTGCAGGGTTTGGGTTCGAG
>augustus_masked-Fvb1-3-processed-gene-154.9:2040:2160:Parent=augustus_masked-Fvb1-3-processed-gene-154.9-mRNA-1_18::augustus_masked-Fvb1-3-processed-gene-154.9:2040-2160||RAPiDGENOMICS_rs1205_00254
AATTTGGGCCATAATAATATATCTGGAGCGATTCCAGAAGAGCTTGGGAAATTGAAGGACCTTAACATTCTTGATCTCTCGAGCAACAGCCTTGATGGTAGCATTCCTCAGACTTTGGTT
>augustus_masked-Fvb1-3-processed-gene-154.9:2280:2400:Parent=augustus_masked-Fvb1-3-processed-gene-154.9-mRNA-1_20::augustus_masked-Fvb1-3-processed-gene-154.9:2280-2400||RAPiDGENOMICS_rs1205_00255
GGCTACCCATTAAGTCCCTGTGGAGCTGCTTCTGGGGCAAATGGAAATGGGCACCAGAAGTCTCATCGACAAGCGTCCTTGGCAGGCAGTGTGGCAATGGGGCTACTGTTCTCCCTTTTC
>augustus_masked-Fvb1-3-processed-gene-154.9:3240:3360:Parent=augustus_masked-Fvb1-3-processed-gene-154.9-mRNA-1_28::augustus_masked-Fvb1-3-processed-gene-154.9:3240-3360||RAPiDGENOMICS_rs1205_00256
GACAATAATCTTGTTGGTTGGGTGAAACAGCATGCTAAATTAAAAATAAGTGATGTTTTTGATCCAGAGCTCATGAAAGAGGACCCGACCCTAGAGATTGAGCTGTTGCAGCACTTAAAG
>augustus_masked-Fvb1-3-processed-gene-191.0:0:120:Parent=augustus_masked-Fvb1-3-processed-gene-191.0-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-191.0:0-120||RAPiDGENOMICS_rs1205_00257
ATGTGGGATCTCAATCGCTCTCCAGATCACAACGACGACGGTGCTAATTCGCAACAGTTCTGCTTCCCAGTTCTTGAAATGGGACCCACGCCGGGAGCGGTGGCTGGCAGTGTTGCCGCT
>augustus_masked-Fvb1-3-processed-gene-191.0:120:240:Parent=augustus_masked-Fvb1-3-processed-gene-191.0-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-191.0:120-240||RAPiDGENOMICS_rs1205_00258
GAGCTGGTTGCATCTTCCTCTTCTTCATCATCAGCTCGTCGCTGCAAGTACGATATGTTTTTGAGTTTCAGGGGTCCTGACACTCGAAGGAGTATTACATCTGAATTATATGTGCGGCTG
>augustus_masked-Fvb1-3-processed-gene-191.0:180:300:Parent=augustus_masked-Fvb1-3-processed-gene-191.0-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-191.0:180-300|2x||RAPiDGENOMICS_rs1205_00259
TTGAGTTTCAGGGGTCCTGACACTCGAAGGAGTATTACATCTGAATTATATGTGCGGCTGCATAAACAGAGAGGAATTAAAACATTCATGGATGATCGAGATCTTGAAGTAGGGGATGCT
>augustus_masked-Fvb1-3-processed-gene-191.0:420:540:Parent=augustus_masked-Fvb1-3-processed-gene-191.0-mRNA-1_4::augustus_masked-Fvb1-3-processed-gene-191.0:420-540|2x||RAPiDGENOMICS_rs1205_00260
GAAGACCAGAACAGAATTCTTCCACTTTTCTATAATGTCGAGCCTACTAATGTACGGTTTCAGAAGAGGAGTTTCGAGGAAGCTTTCAACAAGCATGAAAGCTCTGGGGGGAAGTTACCG
>augustus_masked-Fvb1-3-processed-gene-191.0:60:180:Parent=augustus_masked-Fvb1-3-processed-gene-191.0-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-191.0:60-180|2x||RAPiDGENOMICS_rs1205_00261
TGCTTCCCAGTTCTTGAAATGGGACCCACGCCGGGAGCGGTGGCTGGCAGTGTTGCCGCTGAGCTGGTTGCATCTTCCTCTTCTTCATCATCAGCTCGTCGCTGCAAGTACGATATGTTT
>augustus_masked-Fvb1-3-processed-gene-23.12:120:240:Parent=augustus_masked-Fvb1-3-processed-gene-23.12-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-23.12:120-240||RAPiDGENOMICS_rs1205_00262
CTAGACTACATTATGGAGGGGGGAAGACATGTCTTGGGTATGGAAGCAAGTGCTGGATACGGGGTATCACAAACAATGTCCTCAACTTCTTCTTTGGTAGAAGAGTGTTTGTACGGAAGG
>augustus_masked-Fvb1-3-processed-gene-23.12:1320:1440:Parent=augustus_masked-Fvb1-3-processed-gene-23.12-mRNA-1_12::augustus_masked-Fvb1-3-processed-gene-23.12:1320-1440||RAPiDGENOMICS_rs1205_00263
TCCGATCTGTTGTCATCAGATTCGGTTGATAGTTTGCAATTACAGCAGGTCGCTTATAAAGCCGGCGATGCTGAACTCCCCTCCTGTGGGGGCTGCGGTGTGTTGGGCTCCCAGATTGTT
>augustus_masked-Fvb1-3-processed-gene-23.12:1440:1560:Parent=augustus_masked-Fvb1-3-processed-gene-23.12-mRNA-1_13::augustus_masked-Fvb1-3-processed-gene-23.12:1440-1560||RAPiDGENOMICS_rs1205_00264
TTCGCCGCCGGCCTGACACCCGCCGGCCATTTCGTTACAAATTTCACCAACTCTACTTGGCATAGAGATGTTTACGTCTTCGAAACTGACCCCGACAAGCAGCCTCCTAGTGATACAAGT
>augustus_masked-Fvb1-3-processed-gene-23.12:1800:1920:Parent=augustus_masked-Fvb1-3-processed-gene-23.12-mRNA-1_16::augustus_masked-Fvb1-3-processed-gene-23.12:1800-1920||RAPiDGENOMICS_rs1205_00265
ACAAGTCCCGTCTACTGCTTCGATGTAGCTCAGCCAGACAGAAAATGGAGGAGAGTCGATTCCATGTGCGAATGTGGCCCTTTCCCTTTTGTTAACAGAGCTCTGGTCCTGGACCTCCCT
>augustus_masked-Fvb1-3-processed-gene-23.12:2040:2160:Parent=augustus_masked-Fvb1-3-processed-gene-23.12-mRNA-1_18::augustus_masked-Fvb1-3-processed-gene-23.12:2040-2160||RAPiDGENOMICS_rs1205_00266
CCAATGTTGCCTAAGGAATTTGATTTCGCATGTGTATGTTACATCCTCCATATAGGAGGTCAGAAAGCCTGCCTTGTTGCCCCCGAAATGAGTCGCCCAGAGGGACAAGCACCTAAATTT
>augustus_masked-Fvb1-3-processed-gene-23.12:2160:2280:Parent=augustus_masked-Fvb1-3-processed-gene-23.12-mRNA-1_19::augustus_masked-Fvb1-3-processed-gene-23.12:2160-2280||RAPiDGENOMICS_rs1205_00267
AATCAAGTTGGGAGTCATAAGACAAGGGGTGTTGCCATTCCGTTTCAATTTGAAGTTGATATCACCAAGATCAACAAGGACACCAAGAATTGTTTGATCCTCCAGTTCCTGCCTACTCGT
>augustus_masked-Fvb1-3-processed-gene-23.12:360:480:Parent=augustus_masked-Fvb1-3-processed-gene-23.12-mRNA-1_4::augustus_masked-Fvb1-3-processed-gene-23.12:360-480||RAPiDGENOMICS_rs1205_00268
CTATACAATGATGTTACAGTCAGACAACATTTTGACCTCCAAGCATGGGTTTGTGTTTCAAAAGAGTTTGATGTTCTGAGGATTACACAACACATTTATGAGTCACTCACCTCTAAAGCT
>augustus_masked-Fvb1-3-processed-gene-23.12:600:720:Parent=augustus_masked-Fvb1-3-processed-gene-23.12-mRNA-1_6::augustus_masked-Fvb1-3-processed-gene-23.12:600-720||RAPiDGENOMICS_rs1205_00269
AAGCGTCCCCTCGAGTCTGGAGCACATGGAAGTAAGATTATTGTCACTACACGCAATGAGGATGTTGCAAGTATGATGGGTACTCTTTCACCTCAACCGGACTTTCTAAAGCCACTATCT
>augustus_masked-Fvb1-3-processed-gene-23.12:660:780:Parent=augustus_masked-Fvb1-3-processed-gene-23.12-mRNA-1_6::augustus_masked-Fvb1-3-processed-gene-23.12:660-780|2x||RAPiDGENOMICS_rs1205_00270
GATGTTGCAAGTATGATGGGTACTCTTTCACCTCAACCGGACTTTCTAAAGCCACTATCTGAGGAAGATGGCTGGTTGTTATTTGAAAAACATGCCTTCACAAGTAGAGGAGTTTGCGGA
>augustus_masked-Fvb1-3-processed-gene-23.12:840:960:Parent=augustus_masked-Fvb1-3-processed-gene-23.12-mRNA-1_8::augustus_masked-Fvb1-3-processed-gene-23.12:840-960||RAPiDGENOMICS_rs1205_00271
GCCCTTAAATCCCTTGGGGGTCTCATACGTTCTAAACTACAGTCCGATGAATGGGACTGTGAGATGTGGGAATTGCCACAGGAGGAGAGTGACATTCTGCCGTCACTTTTGTTGAGCTAT
>augustus_masked-Fvb1-3-processed-gene-23.12:900:1020:Parent=augustus_masked-Fvb1-3-processed-gene-23.12-mRNA-1_8::augustus_masked-Fvb1-3-processed-gene-23.12:900-1020|2x||RAPiDGENOMICS_rs1205_00272
GAGATGTGGGAATTGCCACAGGAGGAGAGTGACATTCTGCCGTCACTTTTGTTGAGCTATGTGCATTTGCCTCCACATCTCAAGCGGTGTTCCATGTTTCCCAAAAACACTCTCAACCTA
>augustus_masked-Fvb1-3-processed-gene-23.12:960:1080:Parent=augustus_masked-Fvb1-3-processed-gene-23.12-mRNA-1_9::augustus_masked-Fvb1-3-processed-gene-23.12:960-1080||RAPiDGENOMICS_rs1205_00273
GTGCATTTGCCTCCACATCTCAAGCGGTGTTCCATGTTTCCCAAAAACACTCTCAACCTACCCAACACCTCCAGCTATGGTCACCGCCTTCAACGCTGCCATGAACCACCACATAAGTCA
>augustus_masked-Fvb1-3-processed-gene-52.1:0:120:Parent=augustus_masked-Fvb1-3-processed-gene-52.1-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-52.1:0-120||RAPiDGENOMICS_rs1205_00274
ATGGCAGTGGAGTTACTCGGAGGAGCAGTATTTAGTCTGCTGTATGATGGGGTTAAGAAAGCGATTGGAAAGACTGGGACTTTCAAGTACCTTCTCAGAGATATCAAATCCACGCTAGAG
>augustus_masked-Fvb1-3-processed-gene-52.1:120:240:Parent=augustus_masked-Fvb1-3-processed-gene-52.1-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-52.1:120-240||RAPiDGENOMICS_rs1205_00275
TCTTTGAACAAACTACATGCCACGGCCATCCGAGAAATTGGTGAGTATAACCTTGAATTGGGTCTCCCAAATGATGAAATTGAAGACCTCAGAGAACAAATGGAGGAAGGAGCAAAGCTT
>augustus_masked-Fvb1-3-processed-gene-52.1:60:180:Parent=augustus_masked-Fvb1-3-processed-gene-52.1-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-52.1:60-180|2x||RAPiDGENOMICS_rs1205_00276
GCGATTGGAAAGACTGGGACTTTCAAGTACCTTCTCAGAGATATCAAATCCACGCTAGAGTCTTTGAACAAACTACATGCCACGGCCATCCGAGAAATTGGTGAGTATAACCTTGAATTG
>augustus_masked-Fvb1-3-processed-gene-6.15:1080:1200:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_10::augustus_masked-Fvb1-3-processed-gene-6.15:1080-1200||RAPiDGENOMICS_rs1205_00277
TTGAGTGGAGAAGTCCCGGTTTCGCTGTTGGAAAAACTTCCTTGGATGGAGAGGTTCAACTTCTCTTACAATAACTTGACACTTTGTGCTTCTGATATCTCCACGGAAACCCTCCAGAAA
>augustus_masked-Fvb1-3-processed-gene-6.15:120:240:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-6.15:120-240||RAPiDGENOMICS_rs1205_00278
AACTTAGTTGCTTCTGGTTTAGAACTCTCTGGTTCTATTCCTGATACCACTGTTGGGAAGCTAACAAAGCTTCAATCTTTGGACCTTAGCAACAACAAAATCACTGCTTTGCCATCTGAT
>augustus_masked-Fvb1-3-processed-gene-6.15:1200:1320:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_11::augustus_masked-Fvb1-3-processed-gene-6.15:1200-1320||RAPiDGENOMICS_rs1205_00279
TCCTTCTTTGGTGCTACAAACAGCTGCCCCATTGCTGCAAACCCAACCCTTTTAAGAAGTCGAGTTGCTGAGGACAAGCACAAGGGACTAAAGCTTGCTTTGGCTTTGGCCCTCTCAATG
>augustus_masked-Fvb1-3-processed-gene-6.15:1560:1680:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_14::augustus_masked-Fvb1-3-processed-gene-6.15:1560-1680||RAPiDGENOMICS_rs1205_00280
TTTGACCGTGGAACACTTCTGGCTGAAGGGAAGTTTGGACCTGTTTACAGAGGATTTCTGCCTGGTGGAATACATGTAGCAGTGAAAGTATTAGTGCATGGTTCTACATTGACAGACCAG
>augustus_masked-Fvb1-3-processed-gene-6.15:180:300:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-6.15:180-300|2x||RAPiDGENOMICS_rs1205_00281
CTAACAAAGCTTCAATCTTTGGACCTTAGCAACAACAAAATCACTGCTTTGCCATCTGATTTGTGGAGCTTAGGCTCACTCAAGAACCTTAATCTATCTCATAACCAGATTTCTGGGTCC
>augustus_masked-Fvb1-3-processed-gene-6.15:1800:1920:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_16::augustus_masked-Fvb1-3-processed-gene-6.15:1800-1920||RAPiDGENOMICS_rs1205_00282
AACCTTCAGAACTTGCTTCATGACTTGCCGCTTGGTGTTCAAACAACTGAGGACTGGAGCACAGATACATGGGAAGAAAATGACAAGAATGGCATTCAACATGTTGGTTCTGAAGGGTTG
>augustus_masked-Fvb1-3-processed-gene-6.15:2040:2160:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_18::augustus_masked-Fvb1-3-processed-gene-6.15:2040-2160||RAPiDGENOMICS_rs1205_00283
CTAGATTATGACTTGGAGCCAAGGTTATCTGATTTTGGACTGGCCAAGATTTTCGGCAGTGGTTTAGATGAAGAGATCTCTCTTGGGTCACCTGGCTATGTGCCACCAGAGTTCTCTCAG
>augustus_masked-Fvb1-3-processed-gene-6.15:2280:2400:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_20::augustus_masked-Fvb1-3-processed-gene-6.15:2280-2400||RAPiDGENOMICS_rs1205_00284
CTGGTGAGTTGGGTCAGAGGATTGGTTAGGAAGAACGAAGTGTCCAGCACTATTGATCCGAAAATTCGTGACACAGGGCGTGATGACCAAATGGAGGAAGCACTCAAGATAGGATATCTG
>augustus_masked-Fvb1-3-processed-gene-6.15:240:360:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_3::augustus_masked-Fvb1-3-processed-gene-6.15:240-360||RAPiDGENOMICS_rs1205_00285
TTGTGGAGCTTAGGCTCACTCAAGAACCTTAATCTATCTCATAACCAGATTTCTGGGTCCTTGCCTAACAACATTGGCAACTTTGGCCTACTTGAAAGCTTTGATATTTCAAGCAACAAT
>augustus_masked-Fvb1-3-processed-gene-6.15:360:480:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_4::augustus_masked-Fvb1-3-processed-gene-6.15:360-480||RAPiDGENOMICS_rs1205_00286
TTTTCTGGTGAGATTCCTGCAGCTATAAGCTCACTTATCAGTCTGAGAGTTCTTAGGCTCAGTCAAAATGGGTTTGAAATGGGCATTCCTTCAGGGATTGTGGGTTGCCACTCTTTGGTT
>augustus_masked-Fvb1-3-processed-gene-6.15:420:540:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_4::augustus_masked-Fvb1-3-processed-gene-6.15:420-540|2x||RAPiDGENOMICS_rs1205_00287
AGTCAAAATGGGTTTGAAATGGGCATTCCTTCAGGGATTGTGGGTTGCCACTCTTTGGTTGAGATTGATCTTTCATCCAATAGATTGAATGGGTCTCTTCCTGATGGTTTTGGTGCTGCT
>augustus_masked-Fvb1-3-processed-gene-6.15:480:600:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_5::augustus_masked-Fvb1-3-processed-gene-6.15:480-600||RAPiDGENOMICS_rs1205_00288
GAGATTGATCTTTCATCCAATAGATTGAATGGGTCTCTTCCTGATGGTTTTGGTGCTGCTTTTACTAAGCTGAAAAGCTTGAATCTTGCTGGAAATGAGATTCATGGCAGGGACTCTGAT
>augustus_masked-Fvb1-3-processed-gene-6.15:60:180:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-6.15:60-180|2x||RAPiDGENOMICS_rs1205_00289
TCTGCTCCTGTTTGTTCATGGCCTGGAGTGTTCTGTGATTCAGAAAATGAATATATCATTAACTTAGTTGCTTCTGGTTTAGAACTCTCTGGTTCTATTCCTGATACCACTGTTGGGAAG
>augustus_masked-Fvb1-3-processed-gene-6.15:600:720:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_6::augustus_masked-Fvb1-3-processed-gene-6.15:600-720||RAPiDGENOMICS_rs1205_00290
TTTGCAGAGATGAAATCCATTACTAGTCTTAACATTTCTGGGAATGTGTTCAAGGGTTCAGTGATGGGTGTGTTTATGGAGCTGTTGGAGGTGATTGACCTGAGCAAGAACCAGTTTGAA
>augustus_masked-Fvb1-3-processed-gene-6.15:780:900:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_7::augustus_masked-Fvb1-3-processed-gene-6.15:780-900|2x||RAPiDGENOMICS_rs1205_00291
GACCTGTCTGAGAATCAGCTTGGTGGAGAAATTTTTCATAATGTGACTGGAGCCCAAAATCTCAAGCACCTAAATCTAGCACACAACAGATTTACCAGGCAGAAATTCCCTAGAGTTGAA
>augustus_masked-Fvb1-3-processed-gene-6.15:840:960:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_8::augustus_masked-Fvb1-3-processed-gene-6.15:840-960||RAPiDGENOMICS_rs1205_00292
CTCAAGCACCTAAATCTAGCACACAACAGATTTACCAGGCAGAAATTCCCTAGAGTTGAAATGTTTTCTGGTTTGGAATACCTTAATTTGTCGAAAACTAGTCTTACTGGTCATATTCCT
>augustus_masked-Fvb1-3-processed-gene-6.15:960:1080:Parent=augustus_masked-Fvb1-3-processed-gene-6.15-mRNA-1_9::augustus_masked-Fvb1-3-processed-gene-6.15:960-1080||RAPiDGENOMICS_rs1205_00293
CGTGAACTTTTTCAGTTGAGTACGTTGAGTACACTCGATCTTTCTGAGAACAATCTGATAGGTCAAATTCCATTACTGAGTCTAGAGAGTCTACAAGTTCTTGATGTTTCATTCAACAAT
>augustus_masked-Fvb1-3-processed-gene-62.7:1217:1337:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-62.7:1217-1337||RAPiDGENOMICS_rs1205_00294
GAAGCTCTTCAGCTCTTTAGTTGGAAAGCCTTTAAGAAAGATTATCCCAAAGAAAGATTATAGGGAACTGTCTAAGAGTATATTGGATTATGCCAGAGGCCTTCCATTAGCTCTAAAGAT
>augustus_masked-Fvb1-3-processed-gene-62.7:1277:1397:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-62.7:1277-1397|2x||RAPiDGENOMICS_rs1205_00295
TAGGGAACTGTCTAAGAGTATATTGGATTATGCCAGAGGCCTTCCATTAGCTCTAAAGATTCTAGGATCTTTTCTGTATAAGAGAGATCGAGGTGATTGGGAAAGTACAGTAGCCAAGCT
>augustus_masked-Fvb1-3-processed-gene-62.7:1337:1457:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-62.7:1337-1457||RAPiDGENOMICS_rs1205_00296
TCTAGGATCTTTTCTGTATAAGAGAGATCGAGGTGATTGGGAAAGTACAGTAGCCAAGCTAAAGAAAGATCCTATTGATCAGGCACTCTTTAAAGCTCTCAGAATAAGTTATGATGGTTT
>augustus_masked-Fvb1-3-processed-gene-62.7:1397:1517:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-62.7:1397-1517|2x||RAPiDGENOMICS_rs1205_00297
AAAGAAAGATCCTATTGATCAGGCACTCTTTAAAGCTCTCAGAATAAGTTATGATGGTTTCGATAAGATGAGCAAACAAGTTTTTCTCGATGTTGCATGTTTCCTCAAGGGGTATGACAA
>augustus_masked-Fvb1-3-processed-gene-62.7:1457:1577:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_3::augustus_masked-Fvb1-3-processed-gene-62.7:1457-1577||RAPiDGENOMICS_rs1205_00298
CGATAAGATGAGCAAACAAGTTTTTCTCGATGTTGCATGTTTCCTCAAGGGGTATGACAAAGAGCACGTAATTCAAATACTAGATAGCTCTTTTGGCTTTGACACTCGTATCGTGATAAG
>augustus_masked-Fvb1-3-processed-gene-62.7:1517:1637:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_3::augustus_masked-Fvb1-3-processed-gene-62.7:1517-1637|2x||RAPiDGENOMICS_rs1205_00299
AGAGCACGTAATTCAAATACTAGATAGCTCTTTTGGCTTTGACACTCGTATCGTGATAAGTGTTCTAATTGAGAAATCTCTGTTAACCCTTTTTGACAACCGTGCGGATATGCATGATCT
>augustus_masked-Fvb1-3-processed-gene-62.7:1577:1697:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_4::augustus_masked-Fvb1-3-processed-gene-62.7:1577-1697||RAPiDGENOMICS_rs1205_00300
TGTTCTAATTGAGAAATCTCTGTTAACCCTTTTTGACAACCGTGCGGATATGCATGATCTGATTCAAGAAATGGGAAGGGAAATTGTCCGGTTGGAGTTTGAGCAGGAGACTGGACAACG
>augustus_masked-Fvb1-3-processed-gene-62.7:1749:1869:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-62.7:1749-1869||RAPiDGENOMICS_rs1205_00301
GGAACAGAAGCAATTAGAAGCATAGCCATATGCTTGCCTAAAGTGGAGGAGTTAGCTTGGAATTGGAATCCAAAAGCCTTCTCTAAGATGTCTAAACTGAAGTTTCTCAAAATGCAAAAT
>augustus_masked-Fvb1-3-processed-gene-62.7:1869:1989:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-62.7:1869-1989||RAPiDGENOMICS_rs1205_00302
TTGGTTTTATGTCAAGGCCCTAAATATATTCCTGATGCCATAAGCGTTCTTGAATGGACTTCGTATCCATCAAAATCTCTTCCAACAAACTTTCAGCCAGTGGAACTTATTGAGATTATT
>augustus_masked-Fvb1-3-processed-gene-62.7:2475:2595:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_3::augustus_masked-Fvb1-3-processed-gene-62.7:2475-2595||RAPiDGENOMICS_rs1205_00303
CCCGCCGGCCTCAGTTTTGATTTAAACCCAGTTGTTGAGTCGGATCACCTTTGTTTATTCCTTTTGCCTTCAAAACATTACCTTGAAAACATTGGTTTTCTCTTGGAAACCACGTGTGCT
>augustus_masked-Fvb1-3-processed-gene-62.7:2595:2715:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_4::augustus_masked-Fvb1-3-processed-gene-62.7:2595-2715||RAPiDGENOMICS_rs1205_00304
AAAAGAAGCAACGCATGCTTGAAGGTGAAGGGGTGTGGTGTCCGTGATCTGTACAAGCAAGACCTGAAAGAACTCGAAGAACTCAACTTAATAATGAATCGATGCACTAGATTTTGTGAC
>augustus_masked-Fvb1-3-processed-gene-62.7:2715:2835:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_5::augustus_masked-Fvb1-3-processed-gene-62.7:2715-2835||RAPiDGENOMICS_rs1205_00305
AATAACTTGGTTCTTATGATGAACAGACTCCCTCTTTCTGAGGCGTTCAGTTTTGTAGTTTCTGGAAATGACATTCCCGAGTGTTTCGAAACTAGTGTGGAGCGAAACTGGGCGAACATA
>augustus_masked-Fvb1-3-processed-gene-62.7:3122:3242:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-62.7:3122-3242||RAPiDGENOMICS_rs1205_00306
GTATGGTGAAGAAGCAGGTAAGGCGGCAAGCGAAGGGCTTGATGCAGCAGGACATGCCATAGGAACTGCATGGACTGTTTACAAGATCCGAAAGGCATTGAACCCAAAAAGTGCTATCAA
>augustus_masked-Fvb1-3-processed-gene-62.7:375:495:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-62.7:375-495||RAPiDGENOMICS_rs1205_00307
GTTGAGAGATACCACCTGAGAACCTCCACGTCTTCTGCTTCAGCTTCGAAATGGAAGTACGACGTGTTTTTGAGTTTCCGGGGTGAAGATACCCGCAGGAACTTCACGGACCATTTATAT
>augustus_masked-Fvb1-3-processed-gene-62.7:555:675:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-62.7:555-675|2x||RAPiDGENOMICS_rs1205_00308
ACAACTCTTTCTTCGAAGCTATTGGCTTCAATTGAACACTCAAGGTTTGCAGTTGTTGTTCTTTCGCGAAACTATGCTTCTTCCACTTGGTGCTTGGTTGAGCTTGTTAAGATTGTTGCT
>augustus_masked-Fvb1-3-processed-gene-62.7:675:795:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_3::augustus_masked-Fvb1-3-processed-gene-62.7:675-795|2x||RAPiDGENOMICS_rs1205_00309
TGCATGGGAAAGACGGGGACTATTCTGCCAATCTTTTATGAGGTGGATCCCTCTGATGTGAGACATCAGAGAGGGAGCTTTGCCGAGGCCTTTGCTGAACATGAAGAGAAGTTTTATGGG
>augustus_masked-Fvb1-3-processed-gene-62.7:938:1058:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-62.7:938-1058|2x||RAPiDGENOMICS_rs1205_00310
ATTTGCATCATCAGAGTCCTCAGAGAATTTGGTTGGAATTGATTCCAAGCTGATGGGAATAGATTTTCTTTTAGAAACAAAAGCAAAGGATGTCTGCTTTCTAGGAATATGGGGTATGGG
>augustus_masked-Fvb1-3-processed-gene-62.7:998:1118:Parent=augustus_masked-Fvb1-3-processed-gene-62.7-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-62.7:998-1118||RAPiDGENOMICS_rs1205_00311
AGATTTTCTTTTAGAAACAAAAGCAAAGGATGTCTGCTTTCTAGGAATATGGGGTATGGGTGGGATAGGGAAGACAACCCTTGCTAGACTTGTTTATCAAAGAATCTCTCATCTTTTTGA
>augustus_masked-Fvb1-3-processed-gene-86.11:0:120:Parent=augustus_masked-Fvb1-3-processed-gene-86.11-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-86.11:0-120||RAPiDGENOMICS_rs1205_00312
ATGGTTATAGTAGGGGAACTTGTAGGGGGTGCTGTTCTTGGAGCAGCATTTGGGGTGTTGTTTGATGTTGTCAAGAAAGCAGTTGACAAGCCTACTACCTTTAAACCCCTCCTTGAGAAT
>augustus_masked-Fvb1-3-processed-gene-86.11:1170:1290:Parent=augustus_masked-Fvb1-3-processed-gene-86.11-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-86.11:1170-1290||RAPiDGENOMICS_rs1205_00313
GACTACAATACAAAAATCATGGATTTTTCCTTGTCAGAATGGGCGCCAGCGGAAGGAAAGTTGCATGTGTCAACAAAAATTTGTGGCACAATGGGTTACATTGATCCTGAATACTTGAGA
>augustus_masked-Fvb1-3-processed-gene-86.11:1294:1414:Parent=augustus_masked-Fvb1-3-processed-gene-86.11-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-86.11:1294-1414||RAPiDGENOMICS_rs1205_00314
GTCATTTGTCTGTGAAGAGTGATGTGTATAGCTTTGGCGTTGTGCTGCTTGAGATGCTAACAGGGTTAAAGACAATCGATTTTAACCGCCCTAAGGAACAAATCAAACTGGTTGATTGGG
>augustus_masked-Fvb1-3-processed-gene-86.11:1414:1534:Parent=augustus_masked-Fvb1-3-processed-gene-86.11-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-86.11:1414-1534||RAPiDGENOMICS_rs1205_00315
CTACACCACTTCTTTGTGATGAAACAAAGTTGCAAACCATCATGGATGAGCAGATGGAGGGACAATGTTCTTCCCAGGAAGCATTACACACAGCAGAGCTTACACTAAGATGTTTACAAA
>augustus_masked-Fvb1-3-processed-gene-86.11:240:360:Parent=augustus_masked-Fvb1-3-processed-gene-86.11-mRNA-1_3::augustus_masked-Fvb1-3-processed-gene-86.11:240-360||RAPiDGENOMICS_rs1205_00316
AAGCTTGTCCAGAAGTCATCAAAGGTCAGTAAGTGGAACTGCGTGAAGTCTTATTACATGGATCAACTTATTGAATTGGATGCTTCTCTTAAAAGACTTTTCCAAATATTGATGGTACAA
>augustus_masked-Fvb1-3-processed-gene-86.11:300:420:Parent=augustus_masked-Fvb1-3-processed-gene-86.11-mRNA-1_3::augustus_masked-Fvb1-3-processed-gene-86.11:300-420|2x||RAPiDGENOMICS_rs1205_00317
GATCAACTTATTGAATTGGATGCTTCTCTTAAAAGACTTTTCCAAATATTGATGGTACAAGGAGTAAGGGATGCAAAGGAGACCTTAATTTTGGCAAGAAAGAACACTAGCCAGCTTACT
>augustus_masked-Fvb1-3-processed-gene-86.11:571:691:Parent=augustus_masked-Fvb1-3-processed-gene-86.11-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-86.11:571-691||RAPiDGENOMICS_rs1205_00318
TGAAACATAAACATGTGTCCTCCACAGTGTTGGTTACACCAGCTAACGCTAACCAACAAGTCACGGTTCACAGGAACAAAATTTCCAATGCGAGCAGTAGAGCAGGAACAAGTCGAGTTT
>augustus_masked-Fvb1-3-processed-gene-86.8:0:120:Parent=augustus_masked-Fvb1-3-processed-gene-86.8-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-86.8:0-120||RAPiDGENOMICS_rs1205_00319
ATGGAGGAGGGGATAAAGATTGTTAAAAAGTGCTCCAAGGTTCGTAAGTGGCACATCTACAAGAAGTACAAGTACGACAACAAGCTTCTTGGATGGGATAGTGCTCTTGAAAGACTGTTA
>augustus_masked-Fvb1-3-processed-gene-86.8:120:240:Parent=augustus_masked-Fvb1-3-processed-gene-86.8-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-86.8:120-240||RAPiDGENOMICS_rs1205_00320
AAGGTACTGCAGGCGCAGGGAGTAAGGGATGGGAAGGAGACCTTGCTCTCGGTAAAGAGGATAGAGAGGACGGTCACTGAGATTGAAACGAGTAGTATCATTTTAGAGTCAGGGGTTGAG
>augustus_masked-Fvb1-3-processed-gene-86.8:60:180:Parent=augustus_masked-Fvb1-3-processed-gene-86.8-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-86.8:60-180|2x||RAPiDGENOMICS_rs1205_00321
AAGAAGTACAAGTACGACAACAAGCTTCTTGGATGGGATAGTGCTCTTGAAAGACTGTTAAAGGTACTGCAGGCGCAGGGAGTAAGGGATGGGAAGGAGACCTTGCTCTCGGTAAAGAGG
>augustus_masked-Fvb1-3-processed-gene-86.8:667:787:Parent=augustus_masked-Fvb1-3-processed-gene-86.8-mRNA-1_2::augustus_masked-Fvb1-3-processed-gene-86.8:667-787||RAPiDGENOMICS_rs1205_00322
AAGACCAAAGAATCCCAGTTACTGCCCTCATTGATATGTGGACAGAGTTATATGAGCAGCTAGATGAAGATACGCTGTGTGTTGCATACCTCCAGAGGCTCACCAACCGAAGTCTGGCTA
>augustus_masked-Fvb1-3-processed-gene-86.8:853:973:Parent=augustus_masked-Fvb1-3-processed-gene-86.8-mRNA-1_1::augustus_masked-Fvb1-3-processed-gene-86.8:853-973||RAPiDGENOMICS_rs1205_00323
AGGAAATTAGCATTGACTATTGCAATGATTTGGTGGAAATGCCTGCTGACCTATGTGATCTTATTCATCTAAGGAAGCTCAGTGTCACCAACTCACATAAGCTTCTTGCCTTACCTGAAG
>augustus_masked-Fvb1-4-processed-gene-108.9:0:120:Parent=augustus_masked-Fvb1-4-processed-gene-108.9-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-108.9:0-120||RAPiDGENOMICS_rs1205_00324
ATGGCCTCCGCCGTGCCCGAAACCCTAAGCCGCGAGCAGTACGTCTACATGGCCAAGCTCGCCGAGCAAGCCGAGCGCTACGAGGAGATGGTCAACTTCATGGAGAAGCTCGTCGTCGCC
>augustus_masked-Fvb1-4-processed-gene-108.9:1041:1161:Parent=augustus_masked-Fvb1-4-processed-gene-108.9-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-108.9:1041-1161|2x||RAPiDGENOMICS_rs1205_00325
CTGTATCAAAGAGGTGCTTTTGCAAAAGCCTTTAACAAGCATGATACTAATTATGTTAACGACAGAGCCAAAGTGCGAAGGTGGAGAAGTGCTTTTACAAAACTCAGTGGCATCGCTGGA
>augustus_masked-Fvb1-4-processed-gene-108.9:1315:1435:Parent=augustus_masked-Fvb1-4-processed-gene-108.9-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-108.9:1315-1435|2x||RAPiDGENOMICS_rs1205_00326
TGTTTCTGAGTTTCACCGGGGAAACCCGCAAAGGTTTCACTCACTTCTTGTACAAAGCCCTGCAAAGGCGAGGACTCAAAGTTTTCAGGGATCAAGAACTGGAACGAGGTACCAACATCT
>augustus_masked-Fvb1-4-processed-gene-108.9:1375:1495:Parent=augustus_masked-Fvb1-4-processed-gene-108.9-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-108.9:1375-1495||RAPiDGENOMICS_rs1205_00327
TGCAAAGGCGAGGACTCAAAGTTTTCAGGGATCAAGAACTGGAACGAGGTACCAACATCTCTTCAAACCTCTTTGCTGCAATCGAAGAGTCGAGATTTGCCATTGTTGTCCTCTCGCCGA
>augustus_masked-Fvb1-4-processed-gene-108.9:1435:1555:Parent=augustus_masked-Fvb1-4-processed-gene-108.9-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-108.9:1435-1555|2x||RAPiDGENOMICS_rs1205_00328
CTTCAAACCTCTTTGCTGCAATCGAAGAGTCGAGATTTGCCATTGTTGTCCTCTCGCCGAAGTACGCTTCTTCTACTTGGTGCTCGGACGAACTTACAAAGATTATGGAGTGCGTGGAAG
>augustus_masked-Fvb1-4-processed-gene-108.9:1495:1615:Parent=augustus_masked-Fvb1-4-processed-gene-108.9-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-108.9:1495-1615||RAPiDGENOMICS_rs1205_00329
AGTACGCTTCTTCTACTTGGTGCTCGGACGAACTTACAAAGATTATGGAGTGCGTGGAAGTTAAGGGCACAACAATTCTCCCAATATTCTATAAGGTGAAGCCGACGAGTTTACTGTATC
>augustus_masked-Fvb1-4-processed-gene-108.9:240:360:Parent=augustus_masked-Fvb1-4-processed-gene-108.9-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-108.9:240-360||RAPiDGENOMICS_rs1205_00330
GAGGAGGGCCGCCGCAACGAGGACCACGTCGCGCTCGTCAAGCAGTACAGATCTAAAGTCGAGACCGAGCTAACGGCGATATGCGCCGGAATTCTGGACCTCCTGCAGTCGCACCTGGTG
>augustus_masked-Fvb1-4-processed-gene-108.9:360:480:Parent=augustus_masked-Fvb1-4-processed-gene-108.9-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-108.9:360-480||RAPiDGENOMICS_rs1205_00331
CCGTCGGCCACCGCCGGCGAGTCGAAGGTGTTTTACTTGAAGATGAAGGGGGATTACCATCGGTACCTTGCTGAGTTTAAGAACGGCGATGAGAGGAAGGCTGCTGCTGAGGACACTATG
>augustus_masked-Fvb1-4-processed-gene-108.9:801:921:Parent=augustus_masked-Fvb1-4-processed-gene-108.9-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-108.9:801-921|2x||RAPiDGENOMICS_rs1205_00332
AAAGCCCTGCAAAGGCGAGGACTCAAAGTATTCAGAGATCAAGAACTAGAAAGAGGCACAAACATCTCTTCAAACCTCTTTGCTGCAATTGAAGAGTCGAGGTTTGCCATTGTTGTCCTC
>augustus_masked-Fvb1-4-processed-gene-108.9:981:1101:Parent=augustus_masked-Fvb1-4-processed-gene-108.9-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-108.9:981-1101||RAPiDGENOMICS_rs1205_00333
GTGGAAGTTAAGGGCACAACAATTCTCCCAATATTCTATAAGGTGAAGCCGACGAGTTTACTGTATCAAAGAGGTGCTTTTGCAAAAGCCTTTAACAAGCATGATACTAATTATGTTAAC
>augustus_masked-Fvb1-4-processed-gene-116.1:1138:1258:Parent=augustus_masked-Fvb1-4-processed-gene-116.1-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-116.1:1138-1258||RAPiDGENOMICS_rs1205_00334
AGATTAAACCGGGGGAGCCTGTTTTGGATTGGCCTACAAGAAAGAGGGTGGCTTTAGGCACAGCCCGTGGCTTAGAATACCTACATGAACATTGTAATCCTAAGATCATTCATCGAGATG
>augustus_masked-Fvb1-4-processed-gene-116.1:1258:1378:Parent=augustus_masked-Fvb1-4-processed-gene-116.1-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-116.1:1258-1378||RAPiDGENOMICS_rs1205_00335
TTAAGGCAGCAAATGTATTACTTGATGAAGATTTTGAAGCAGTTGTTGGTGATTTCGGCCTGGCAAAGTTGGTGGATGTTAGAAAGACTAACGTGACAACTCAAGTTCGTGGGACAATGG
>augustus_masked-Fvb1-4-processed-gene-116.1:1378:1498:Parent=augustus_masked-Fvb1-4-processed-gene-116.1-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-116.1:1378-1498||RAPiDGENOMICS_rs1205_00336
GCCACATAGCCCCCGAATACTTGTCTACTGGGAAGTCATCGGAAAGGACGGATGTTTTTGGCTATGGGATTATGCTTTTAGAGATTGTAACAGGACAGCGGGCAATTGATTTCTCACGAT
>augustus_masked-Fvb1-4-processed-gene-116.1:1533:1653:Parent=augustus_masked-Fvb1-4-processed-gene-116.1-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-116.1:1533-1653||RAPiDGENOMICS_rs1205_00337
GTCAAGAAGTTAGAAAGGGAAAAAAGACTGGATGCTATAGTAGATGGAAATCTGGATGGCACTTACAACATCCAAGAGGTAGAAATGATGATCCAAGTTGCGCTGCTTTGTACCCAAGGA
>augustus_masked-Fvb1-4-processed-gene-116.1:1653:1773:Parent=augustus_masked-Fvb1-4-processed-gene-116.1-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-116.1:1653-1773||RAPiDGENOMICS_rs1205_00338
TCCCCTGAAGATCGTCCATTAATGTCGGAGGTGGTACGTATGCTGGAAGGAGAGGGTCTGGCTGAGCGGTGGGAAGAATGGCAGCATGTTGAAGTTACTCGCAGGCAAGAGTACGAGAGA
>augustus_masked-Fvb1-4-processed-gene-116.1:284:404:Parent=augustus_masked-Fvb1-4-processed-gene-116.1-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-116.1:284-404||RAPiDGENOMICS_rs1205_00339
TGCATTGCAAGGAAATGGCATAACCGGTGAAATACCAAAAGAGTTTGGAGATCTAACAAGTTTGGCCACCTTGAATTTGGAAGATAATAATTTAAGTGGTGCAATACCATCTTCCCTTGG
>augustus_masked-Fvb1-4-processed-gene-116.1:796:916:Parent=augustus_masked-Fvb1-4-processed-gene-116.1-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-116.1:796-916||RAPiDGENOMICS_rs1205_00340
GTGAAGTTGACCGAAGGATTGCATTTGGTCAGTTGAAAAGATTTTCATGGAGGGAACTGCAGCTAGCTACAGAAAACTTCAATGAGAAAAATGTTTTAGGACAAGGGGGTTTTGGAAAAG
>augustus_masked-Fvb1-4-processed-gene-116.1:916:1036:Parent=augustus_masked-Fvb1-4-processed-gene-116.1-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-116.1:916-1036||RAPiDGENOMICS_rs1205_00341
TCTATAAAGGAGTGTTATCTGATAATACAAAAATTGCTGTTAAACGGCTGACCGATTATGAAAGTCCTGGGGGAGATGCAGCTTTTCAGCGTGAAGTTGAAATGATAAGCGTAGCTGTTC
>augustus_masked-Fvb1-4-processed-gene-133.6:0:120:Parent=augustus_masked-Fvb1-4-processed-gene-133.6-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-133.6:0-120||RAPiDGENOMICS_rs1205_00342
ATGGAGTTTGCCACCAGCATTGCAGAGAACGTCTTGGGTAGGCTAGCTTCTTATGCTTCCCAAAAGATATCCTTGGCATGGGGTGCCCAACTTGAGCTCACCAAGCTCAACAAGACTTTA
>augustus_masked-Fvb1-4-processed-gene-133.6:360:480:Parent=augustus_masked-Fvb1-4-processed-gene-133.6-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-133.6:360-480||RAPiDGENOMICS_rs1205_00343
AAAGTGAAAGAGATTAGAGAACGACTTGTTGAGATTGATAATGAAAAGAGAGAGTTTTCTCTTATTCAAGTCGCTCAACTGGCCGAAGATCATTGTGCGCCCAGACGAGTGCATGATGAC
>augustus_masked-Fvb1-4-processed-gene-133.6:420:540:Parent=augustus_masked-Fvb1-4-processed-gene-133.6-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-133.6:420-540|2x||RAPiDGENOMICS_rs1205_00344
CTTATTCAAGTCGCTCAACTGGCCGAAGATCATTGTGCGCCCAGACGAGTGCATGATGACAGAAGGATCACAACTTCCACAGTTGAGGCTTCAAGTGTTATTGGGAGAGAAGGTGACAAA
>augustus_masked-Fvb1-4-processed-gene-133.6:480:600:Parent=augustus_masked-Fvb1-4-processed-gene-133.6-mRNA-1_5::augustus_masked-Fvb1-4-processed-gene-133.6:480-600||RAPiDGENOMICS_rs1205_00345
AGAAGGATCACAACTTCCACAGTTGAGGCTTCAAGTGTTATTGGGAGAGAAGGTGACAAACAACAGATTCTCAAGCACCTGTTGAATGACACTGATTTCTCCAGTGAGGAGAATGTGTCT
>augustus_masked-Fvb1-4-processed-gene-133.6:540:660:Parent=augustus_masked-Fvb1-4-processed-gene-133.6-mRNA-1_5::augustus_masked-Fvb1-4-processed-gene-133.6:540-660|2x||RAPiDGENOMICS_rs1205_00346
CAACAGATTCTCAAGCACCTGTTGAATGACACTGATTTCTCCAGTGAGGAGAATGTGTCTGTTATTTCCATTGTTGGATTAGGAGGGTTGGGGAAAACAACACTTGCTAAATTGGTGTAT
>augustus_masked-Fvb1-4-processed-gene-134.6:1020:1140:Parent=augustus_masked-Fvb1-4-processed-gene-134.6-mRNA-1_9::augustus_masked-Fvb1-4-processed-gene-134.6:1020-1140|2x||RAPiDGENOMICS_rs1205_00347
TCGCTGGAGACTCTCGACATTTCCGGCAACTTCTTCACCGGCGAGCTGCCCGTCGAGACTTTATTGAAGCTCAGCAAGTTGAAGTCTGTGTCTCTTTCTCTCAACGATTTCGTGGGCACT
>augustus_masked-Fvb1-4-processed-gene-134.6:1080:1200:Parent=augustus_masked-Fvb1-4-processed-gene-134.6-mRNA-1_10::augustus_masked-Fvb1-4-processed-gene-134.6:1080-1200||RAPiDGENOMICS_rs1205_00348
TTATTGAAGCTCAGCAAGTTGAAGTCTGTGTCTCTTTCTCTCAACGATTTCGTGGGCACTCTGCCGCGTTCTCTCTCCAAGCTTGCGCATTTGGAGAGCTTGGATCTCAGCTCCAACAAT
>augustus_masked-Fvb1-4-processed-gene-134.6:1380:1500:Parent=augustus_masked-Fvb1-4-processed-gene-134.6-mRNA-1_12::augustus_masked-Fvb1-4-processed-gene-134.6:1380-1500|2x||RAPiDGENOMICS_rs1205_00349
TCATTGTCGAAGCTGAGAGACTTGATCCTTTGGTTGAATCAGCTCAGCGGGGAGATTCCGCAGGAGCTGATGTATCTCGGGTCACTGGAGAATCTTATTCTCGACTTCAATGAGCTGACC
>augustus_masked-Fvb1-4-processed-gene-134.6:1980:2100:Parent=augustus_masked-Fvb1-4-processed-gene-134.6-mRNA-1_17::augustus_masked-Fvb1-4-processed-gene-134.6:1980-2100|2x||RAPiDGENOMICS_rs1205_00350
AATAGGTTATCCGGTAGCATTCCAAAAGAGATTGGGAGCATGTACTATCTCTATATTCTGAATTTGGGCCATAATAATATATCTGGAGCGATTCCAGAAGAGCTTGGGAAATTGAAGGAC
>augustus_masked-Fvb1-4-processed-gene-134.6:2520:2640:Parent=augustus_masked-Fvb1-4-processed-gene-134.6-mRNA-1_22::augustus_masked-Fvb1-4-processed-gene-134.6:2520-2640||RAPiDGENOMICS_rs1205_00351
GGTGCCCGAGAAGCATTGAGCATTAACCTTTCCACATTTGAGAAGCCACTTCAAAAGCTCACATTTGCAGATCTTCTTGAGGCTACCAATGGTTTCCACAATGACAGTCTTATTGGCTCT
>augustus_masked-Fvb1-4-processed-gene-134.6:3120:3240:Parent=augustus_masked-Fvb1-4-processed-gene-134.6-mRNA-1_27::augustus_masked-Fvb1-4-processed-gene-134.6:3120-3240||RAPiDGENOMICS_rs1205_00352
GTCCCTCCAGAATACTACCAGAGCTTCAGATGTTCTACAAAAGGCGATGTTTATAGTTATGGTGTAGTATTGCTCGAGCTGCTAACAGGAAGACGTCCTACAGATTCAGCTGATTTTGGT
>augustus_masked-Fvb1-4-processed-gene-15.17:0:120:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-15.17:0-120||RAPiDGENOMICS_rs1205_00353
ATGTTGGTTAGCTTTGGGATTGGGCTTGATCTTGTTAAAGGCATTGATTCAATATCTGAAGGGAGGGACTGCGAAAAAGAATTGGTTGACACACTCAAATGTCGTTCCTTATTGTTAGAC
>augustus_masked-Fvb1-4-processed-gene-15.17:1080:1200:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_10::augustus_masked-Fvb1-4-processed-gene-15.17:1080-1200||RAPiDGENOMICS_rs1205_00354
AGATTTAAGATCAGCATTGGATGGGGGGATCATGAAAACTTGGATTACTTGGAGGGTAAGGGTAACTACTTGAGAGTTCATGATCTTAATGCAAGCTCCCTTGCGGCTACTGGAATCAGT
>augustus_masked-Fvb1-4-processed-gene-15.17:120:240:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-15.17:120-240||RAPiDGENOMICS_rs1205_00355
TCGGATGAGAACGGCTGGGTAAGAATGCATGATGTGGTGCGTGATGTAAACATGTATATAGCCTCTGAAGAGTTGGCACAAATGAAGAATGATCATCAGCTTAAAAGGAGAATCATGTTG
>augustus_masked-Fvb1-4-processed-gene-15.17:1200:1320:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_11::augustus_masked-Fvb1-4-processed-gene-15.17:1200-1320||RAPiDGENOMICS_rs1205_00356
TTGTTGTTCAAGAAAACTGAGACTCTCGAGTTAAAAATGAAGAATTTGAGAGATCCTCTCAATGTGCTGGATGTAAACTATTGTGCAAACTTGGAGTCACTTCAACTGGAAGACTGTGAT
>augustus_masked-Fvb1-4-processed-gene-15.17:1320:1440:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_12::augustus_masked-Fvb1-4-processed-gene-15.17:1320-1440||RAPiDGENOMICS_rs1205_00357
TCTCTAGAATATCTGATTGACATGACACTTGTGGAACATACTCGACGAAGCGTCTTCCCTGTCTTGAAGGACCTGAGAATCACCGGAGCAAAAATGCTGAAAGAGATTTTTCATGGTGAC
>augustus_masked-Fvb1-4-processed-gene-15.17:1440:1560:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_13::augustus_masked-Fvb1-4-processed-gene-15.17:1440-1560||RAPiDGENOMICS_rs1205_00358
CTGCCGCCGGGGTCGCTTCCGAAACTAGAAGTTGTATTTTTAATGGATCTACCTGCATTGACGACTATTTGGACCCTTGAATCTGGTTATGTGGGAGATTTGGCAGTTCTCCGTTCAATG
>augustus_masked-Fvb1-4-processed-gene-15.17:1560:1680:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_14::augustus_masked-Fvb1-4-processed-gene-15.17:1560-1680||RAPiDGENOMICS_rs1205_00359
AACATAAAGAGTTGCAAGTCACTAGAAGCAATTTTTGGCTTGGAAGGATCGGAGCATCATGTTGAAGAGATCAAGTTTCTTAGTTTGAAAGATTTGAACCTTGAATATCTACCAAGCTTC
>augustus_masked-Fvb1-4-processed-gene-15.17:1680:1800:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_15::augustus_masked-Fvb1-4-processed-gene-15.17:1680-1800||RAPiDGENOMICS_rs1205_00360
ATCGGAATCAGCAAAAGTACTTGTAAAGGACCGGAAAGGGAACCAGAAGTCAGCAGTCTCTACTCAACTAGTTCGACCGTTGAATATTCACATTTCTCTGACCCCAAGGTGTTTCTTTTC
>augustus_masked-Fvb1-4-processed-gene-15.17:240:360:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-15.17:240-360||RAPiDGENOMICS_rs1205_00361
AGGCAAGGAGCGGAATTGAAGCACTGGCAGCGCAAGAATAATGTTATCACGGAATCTACTCACTGTTGTTTATTGACCACTAATATGAGTAGTACAACTGAGCTTTTACTGTTGGTGACC
>augustus_masked-Fvb1-4-processed-gene-15.17:360:480:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-15.17:360-480||RAPiDGENOMICS_rs1205_00362
GCAGAATATGCGCTAAAGCTGCCGGCCACAATTTTCGATGGAATGGAAGATCTCAAGGTTTTAATGATCATGGGTTCAATTCTTCCATCCCTTCCATTCTTAAAGAATCTTCGAACCCTC
>augustus_masked-Fvb1-4-processed-gene-15.17:420:540:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-15.17:420-540|2x||RAPiDGENOMICS_rs1205_00363
TTAATGATCATGGGTTCAATTCTTCCATCCCTTCCATTCTTAAAGAATCTTCGAACCCTCATTCTACTGAGTTGTGATCTCGTTTTTGATGTGCTTGGAGAGCTACGGACACTCATGGTA
>augustus_masked-Fvb1-4-processed-gene-15.17:480:600:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_5::augustus_masked-Fvb1-4-processed-gene-15.17:480-600||RAPiDGENOMICS_rs1205_00364
ATTCTACTGAGTTGTGATCTCGTTTTTGATGTGCTTGGAGAGCTACGGACACTCATGGTACTCGATTTAAGTGGATCTGACATCGAACAGTTGCCTGAATCATTCAAAAATTTATCCAAT
>augustus_masked-Fvb1-4-processed-gene-15.17:540:660:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_5::augustus_masked-Fvb1-4-processed-gene-15.17:540-660|2x||RAPiDGENOMICS_rs1205_00365
CTCGATTTAAGTGGATCTGACATCGAACAGTTGCCTGAATCATTCAAAAATTTATCCAATCTGAGACTCTTGAATTTGAAGGGATGTAGCAGGCTTAAAGAAATCTCACCCGGTGTTATA
>augustus_masked-Fvb1-4-processed-gene-15.17:600:720:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_6::augustus_masked-Fvb1-4-processed-gene-15.17:600-720||RAPiDGENOMICS_rs1205_00366
CTGAGACTCTTGAATTTGAAGGGATGTAGCAGGCTTAAAGAAATCTCACCCGGTGTTATATCGAGTTTATCTCGACTAGAAGAATTGTACATGTATGATAGCTTTCAACATTGGGTGGTT
>augustus_masked-Fvb1-4-processed-gene-15.17:660:780:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_6::augustus_masked-Fvb1-4-processed-gene-15.17:660-780|2x||RAPiDGENOMICS_rs1205_00367
TCGAGTTTATCTCGACTAGAAGAATTGTACATGTATGATAGCTTTCAACATTGGGTGGTTGACAAACTGGGCTCAGTAGAAACAACCAATTGGATCTCTCAATTGGGGGATGCGGAAGAA
>augustus_masked-Fvb1-4-processed-gene-15.17:720:840:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_7::augustus_masked-Fvb1-4-processed-gene-15.17:720-840||RAPiDGENOMICS_rs1205_00368
GACAAACTGGGCTCAGTAGAAACAACCAATTGGATCTCTCAATTGGGGGATGCGGAAGAAGTCGACATGTGGAAGAGACTCAACAGATTGGCCGTTGCCTCAATAACGTCTGATCAGGTG
>augustus_masked-Fvb1-4-processed-gene-15.17:840:960:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_8::augustus_masked-Fvb1-4-processed-gene-15.17:840-960||RAPiDGENOMICS_rs1205_00369
TCTCAACTGGAGGATGAGAAAAGCAGCGAACCAGAGGAAGACGACGACCTTGGAGATCTGTATGCAGAGTATGTTAAAGAATTGGAAAACTACGACCACCTCACAAGGTGGGCCGACTCT
>augustus_masked-Fvb1-4-processed-gene-15.17:960:1080:Parent=augustus_masked-Fvb1-4-processed-gene-15.17-mRNA-1_9::augustus_masked-Fvb1-4-processed-gene-15.17:960-1080||RAPiDGENOMICS_rs1205_00370
AAGGACTGGGGAGTTGGGTTACTTTCGGAGTTACTCTCCTTGTCATATTTGACTACTTTAGAAGTGGTTTTACCACCAATTGACATTCTGCGAACCAGTAAGCTGTTTCATAAGCTTGAA
>augustus_masked-Fvb1-4-processed-gene-7.11:1118:1238:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_6::augustus_masked-Fvb1-4-processed-gene-7.11:1118-1238||RAPiDGENOMICS_rs1205_00371
CAAAAAAGATCTGCCTGTGGAAGGATTTTCAGAGCTGTCCAAGTGTTTCATAAATTATGTGGAAGAGCTTCCCTTAGGTCTTAAAATCGTTGGAAGCTCTTTGTACAATAGAGATCTAGA
>augustus_masked-Fvb1-4-processed-gene-7.11:120:240:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-7.11:120-240||RAPiDGENOMICS_rs1205_00372
TCCCATTTAGACCACCAACTGGAGTTCTGTCAAGTATTCAAGACTTTCAAGGACGACCGGGAGCTTGAAATCGGATCTGAGATCTCTCCGAAGCTATTAACCGCCGTCGAACATTCTCAT
>augustus_masked-Fvb1-4-processed-gene-7.11:1238:1358:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_7::augustus_masked-Fvb1-4-processed-gene-7.11:1238-1358||RAPiDGENOMICS_rs1205_00373
GACATGGGAAAGTGCTTGGGACAGACTAAAGAAAGGCTCTGATGCAAAGATTTTTAATTCACTCAAAATAAGTTATGATGCACTAGATTACATGGAGAAAAACATTTTTCTGGATGTTGC
>augustus_masked-Fvb1-4-processed-gene-7.11:1358:1478:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_8::augustus_masked-Fvb1-4-processed-gene-7.11:1358-1478||RAPiDGENOMICS_rs1205_00374
ATTCTTCTACAAGGGGATGAACAAGGGGCGAGTTATTGAATTGCTTAAGAGCTGTGACTTTAGTGCCCGTTATGGGATAGAAGTTCTTATTGAGAAATCTCTGATAACTATTGATGTGGT
>augustus_masked-Fvb1-4-processed-gene-7.11:1737:1857:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-7.11:1737-1857||RAPiDGENOMICS_rs1205_00375
GAATTGCCTAATTTGAAACATATGGATCTTGGTGACTCCAATAATTTGAAGAAGATCCCAGATTTCACAGGTATGTCGAATCTTGAGGAATTGAATCTTGCATTTTGTGAGGGTTTAGTT
>augustus_masked-Fvb1-4-processed-gene-7.11:1977:2097:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-7.11:1977-2097||RAPiDGENOMICS_rs1205_00376
TCCTACTGCTCAAAACTAAAGATTCCAGAATTTGGAGAAGGGATGGAAAACCTGTGTCACCTTATCATACCCGGTACTGCTACTGAGGAACTACCTTCATCAATTGAACATATGGTTGGT
>augustus_masked-Fvb1-4-processed-gene-7.11:2457:2577:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_7::augustus_masked-Fvb1-4-processed-gene-7.11:2457-2577||RAPiDGENOMICS_rs1205_00377
CTCCCGTCGAATTGGTATTTACAAGTGTGGGCAGATGATTGTGATTCCTTAAAAAAGTTGTCAGAACCATCACAGCAGGGCACATCCTCCAATTTGGTGGGCTTTCGTTTATCAACTGTG
>augustus_masked-Fvb1-4-processed-gene-7.11:2652:2772:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-7.11:2652-2772||RAPiDGENOMICS_rs1205_00378
GGAATCTCCCGGGACTTTCTCTCATACAGCTGTACTGTTCGTCCATCATTTGATATTCTAAGTCCTGGAAGTAGAATCTCAGAGTGGTTTGATATTCGAAGCGAGGGAGGCTCATTGACT
>augustus_masked-Fvb1-4-processed-gene-7.11:2772:2892:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-7.11:2772-2892||RAPiDGENOMICS_rs1205_00379
GTGGAGCTGCCTCCGGATCGGAAAAATTGTAAATCAAAGTGGATGGGCATTGTGTTTTGTGTTGTTTTTGCCGATCTGAAAGAACCTCACACTCTTGAGAATGATGAGTTCGTAATTGAA
>augustus_masked-Fvb1-4-processed-gene-7.11:2892:3012:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-7.11:2892-3012||RAPiDGENOMICS_rs1205_00380
GGTCTATCGCCAGCGGTTGGTGTTAAACACATTCATGATTCAAAAAAGCACTTTATGCGTCTAACAAATACGAAGCGGCATATGAAGGGAGATAATCTTTGGGTGTCTTTTATGCCTCGT
>augustus_masked-Fvb1-4-processed-gene-7.11:300:420:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-7.11:300-420|2x||RAPiDGENOMICS_rs1205_00381
GCCAAGATTATCGAGTTCATGGAACCCGGAGATAAGAGAGTTCTCCCGGTTTTTCTTAATGTGGATCCGTCGGACGTTCGACATCAGAGGAATAGCTTTACTGAAGCCTTTGCTAAGCAT
>augustus_masked-Fvb1-4-processed-gene-7.11:3012:3132:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-7.11:3012-3132||RAPiDGENOMICS_rs1205_00382
GGTCAAATCCGGGATACCACAAGCTGCTCTTTTACGTTCTCATTCGATGCGTATTGTGATTCTTGGCGGCATCCTCGTATTCCATGCCCGAATTGTGTGAAGAGATGTGGAGCCCGATTG
>augustus_masked-Fvb1-4-processed-gene-7.11:3375:3495:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-7.11:3375-3495||RAPiDGENOMICS_rs1205_00383
GTAAAATTACTCAAGATTAGCTGTCTTTTGTATATAAAGGATTGCAGTGAAGCATATCCTTTCTGGTTTGCGCAGACCCCTTTTGATCTCATCTTCTTCACCAAGAAGATGTCATCACAA
>augustus_masked-Fvb1-4-processed-gene-7.11:3495:3615:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-7.11:3495-3615||RAPiDGENOMICS_rs1205_00384
TTTCCACCTCTGGATTCAAACAAGGATAACGATTTTCACCCTCTTCCTGGTTCAGAACCTCCATCATCATTACCTTCAGGGTCTAAACCAGGTCTCAACAAATATGCTCTTGCTGGTGCT
>augustus_masked-Fvb1-4-processed-gene-7.11:3652:3772:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-7.11:3652-3772||RAPiDGENOMICS_rs1205_00385
ATATTGGGGTGATGAGCGGTGCAGCCCTTTATATAAGGGAGGACATGAACATTACATCAACTCAGCTAGAGATCTTGGTTGGTTCCCTAAATGTGTGTTCTTTGATTGGATCCATTGCCT
>augustus_masked-Fvb1-4-processed-gene-7.11:3772:3892:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-7.11:3772-3892||RAPiDGENOMICS_rs1205_00386
CAGGCAAGACTTCGGATTGGATTGGGAGGCGTTACACTATAGTCCTGGCTGCAGTAACTTTTCTAATAGGGGCAGTTCTGATGGGACTAGCACCATCTTTCTTGTTCCTTATAGCTGGAA
>augustus_masked-Fvb1-4-processed-gene-7.11:3892:4012:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-7.11:3892-4012||RAPiDGENOMICS_rs1205_00387
GAGTGGTGGCCGGGATTGGTGTTGGATATTCACTTATGATTGCCCCGGTTTATGTAGCAGAGCTCTCGCCGGCTCTTACACGTGGCTTTCTGACCTCCCTCCCTGAGGTGTTCATCAATG
>augustus_masked-Fvb1-4-processed-gene-7.11:4012:4132:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-7.11:4012-4132||RAPiDGENOMICS_rs1205_00388
GTGGAATACTACTAGGGTACATCTCCAACTATGCTTTGTCCGGCCTCCCACAGAACTTGAATTGGAGACTTATGCTTGGACTTGCAGCATTTCCGGCGTTTGCTGTTGCTGTCGGCGTGT
>augustus_masked-Fvb1-4-processed-gene-7.11:4154:4274:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-7.11:4154-4274||RAPiDGENOMICS_rs1205_00389
GTGGTTGGTGATGAAAGGCCGGTTAGACGAAGCGAAGCAGGTTTTGATAAGAACATCTGAAAGCAAGGAGGAAGCTGAATTGAGGCTCAAAGAGATAGCAAGAGCAGCTAATTCAATGCC
>augustus_masked-Fvb1-4-processed-gene-7.11:4274:4394:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-7.11:4274-4394||RAPiDGENOMICS_rs1205_00390
TGCAACTTCTTCAAGCAATTGGAGTGGGCAAGGGGTTTGGAGAGACTTATTGTTGAGGCCCACTAGGCCCATTCGCCGCATTCTCATTGCCGCCATTGGTGTCAATTTCTTCATGCAAGC
>augustus_masked-Fvb1-4-processed-gene-7.11:4394:4514:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-7.11:4394-4514||RAPiDGENOMICS_rs1205_00391
TTCCGGCAATGATGCCGTCGTGTATTACAGCCCGGAAGTTTTCAGGGACGCCGGAATTCAAAACAAGAAGCAGCTTGTTGGTGTGACAATACTCATGGGCATTGCCAAGACCTTCTTTGT
>augustus_masked-Fvb1-4-processed-gene-7.11:4514:4634:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-7.11:4514-4634||RAPiDGENOMICS_rs1205_00392
TTTGATATCAGCTCTGTTCTTGGACTCGTATGGCAGGAGGCCACTTTTGCTTTTGGGCTCAATCGGCATGGCATTCTCGTTAGCTGCATTGGGCCTGGGCTCCAAGTTTCTTGAATATTC
>augustus_masked-Fvb1-4-processed-gene-7.11:4634:4754:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_5::augustus_masked-Fvb1-4-processed-gene-7.11:4634-4754||RAPiDGENOMICS_rs1205_00393
AATTGACAAGCCCACATGGGCTATTGGGTTGTGTGTGGTGGCGGTGTGTTCGGCCGCTTCATTCTTCTCCATTGGGCTTGGGCCCATCACATGGGTGTACTCATCGGAGATTTTCCCAAT
>augustus_masked-Fvb1-4-processed-gene-7.11:4754:4874:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_6::augustus_masked-Fvb1-4-processed-gene-7.11:4754-4874||RAPiDGENOMICS_rs1205_00394
GAGGTTAAGGGCCCAAGGTTCAAGCTTGGCGATAGGGGTGAACCGATTGGTGAGTGGCTTGGTGGCAATGACATTTCTAAGCATTTCTCGGGAGATAACATTTGGAGGTATGTTTTTCAT
>augustus_masked-Fvb1-4-processed-gene-7.11:4874:4994:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_7::augustus_masked-Fvb1-4-processed-gene-7.11:4874-4994||RAPiDGENOMICS_rs1205_00395
GCTCGCGGGGATAATGGTGGTGGGTACAATTTTCTTTTACTTCTGCTTGCCGGAAACAAAAGGAAAAAACTTAGAAGAAATCGAGGCTCTCTTCGAGGATGAGTATGACAAGGAGAACCG
>augustus_masked-Fvb1-4-processed-gene-7.11:518:638:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-7.11:518-638||RAPiDGENOMICS_rs1205_00396
ATGTGAACGTGAGCTTACAGATGTCATTGTGAAGAGTGTATGGGAGAAATTACGTCCTACGATCACATTGTCTAATTCCGAAGAAAAGTTAGTCGGAATGGATTTTAGACTTGGGCAAAT
>augustus_masked-Fvb1-4-processed-gene-7.11:60:180:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-7.11:60-180|2x||RAPiDGENOMICS_rs1205_00397
CGTTGGAAATACGACGTTTTCTTGAGTTTCAGAGGTGAAGACACGCGCTGGGGTTTCATCTCCCATTTAGACCACCAACTGGAGTTCTGTCAAGTATTCAAGACTTTCAAGGACGACCGG
>augustus_masked-Fvb1-4-processed-gene-7.11:698:818:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-7.11:698-818|2x||RAPiDGENOMICS_rs1205_00398
TGGAGTGGGTAAGACCACCCTTGCTAAGCTAGTGTACGAGAAAATTTTGCATAATTTTGAAGTGGCTGAGTTTCTTGTTGATGTCAGGAAGTCTCGCGGTAAACTAGTGAATCTTCAGAA
>augustus_masked-Fvb1-4-processed-gene-7.11:818:938:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-7.11:818-938|2x||RAPiDGENOMICS_rs1205_00399
ACAGGTTCTTTTCCCAGTCTTGAAGGAAAATGTTTCACAAGTTTGGGATGAGTACAAAGGAACTTTTTTCATTAGAAGATGCTTGTCCAATAAAAAGGTTCTTCTCGTTGTTGATGATGT
>augustus_masked-Fvb1-4-processed-gene-7.11:878:998:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-7.11:878-998||RAPiDGENOMICS_rs1205_00400
AACTTTTTTCATTAGAAGATGCTTGTCCAATAAAAAGGTTCTTCTCGTTGTTGATGATGTTGATAGCTGTGACCTCCAAAAACAGTTGGCCGGACATAAATCATGGTTTGGTGAGGGGAG
>augustus_masked-Fvb1-4-processed-gene-7.11:938:1058:Parent=augustus_masked-Fvb1-4-processed-gene-7.11-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-7.11:938-1058|2x||RAPiDGENOMICS_rs1205_00401
TGATAGCTGTGACCTCCAAAAACAGTTGGCCGGACATAAATCATGGTTTGGTGAGGGGAGCAGAATCATTGTTACAACTAGAGATGAACGTGTGCTCATTGAGAATGACATAGAAATATC
>augustus_masked-Fvb1-4-processed-gene-76.3:1030:1150:Parent=augustus_masked-Fvb1-4-processed-gene-76.3-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-76.3:1030-1150||RAPiDGENOMICS_rs1205_00402
GAAAACCTGATGAGGAACCGCTATGTTGGGACAAGAGACTCAAAATCGCTATTGGAGCTGCTAGAGTCTTGAGTTTGTTGCACATTTTACAAATTATTCACAGAGATGTCACACCCTCAA
>augustus_masked-Fvb1-4-processed-gene-76.3:120:240:Parent=augustus_masked-Fvb1-4-processed-gene-76.3-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-76.3:120-240||RAPiDGENOMICS_rs1205_00403
ATCAAGTTTTCACTGGAGTTTCTAAAGCCGGTGATTGAAAACATAGGTAAGCATAATGAAGAACTGATTCTCCCAGATGAAGAAATAGAGCATCTTATAACAGAAATGAAGCAGGGCGTA
>augustus_masked-Fvb1-4-processed-gene-76.3:360:480:Parent=augustus_masked-Fvb1-4-processed-gene-76.3-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-76.3:360-480||RAPiDGENOMICS_rs1205_00404
GGAGTAAGGGATGCAAAGGAGACCTTAATTTTGGCAAGAAAGAACACTAGCCAGCTTACTGAATCGGAAAAGGATGGAAAGGAGACCTTAGAATTGGCAAGAAAATACACTGAACAATCA
>augustus_masked-Fvb1-4-processed-gene-76.3:60:180:Parent=augustus_masked-Fvb1-4-processed-gene-76.3-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-76.3:60-180|2x||RAPiDGENOMICS_rs1205_00405
TTTGATGTTGTCAAGAAAGCAGTTGACAAGCCTACTACTTTTAAATCCCTCCTTGAGAATATCAAGTTTTCACTGGAGTTTCTAAAGCCGGTGATTGAAAACATAGGTAAGCATAATGAA
>augustus_masked-Fvb1-4-processed-gene-85.10:0:120:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-85.10:0-120||RAPiDGENOMICS_rs1205_00406
ATGCATGATTTACTAAGGTGCTTGGGTTGGCATATTGTCCGCAGAGAATCTTCTGCTCACCCCGGAAATCGGAGCAGACTGTGGCTCGATGACAACAAACACAAATATGAAACGAGAAGG
>augustus_masked-Fvb1-4-processed-gene-85.10:1092:1212:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-85.10:1092-1212||RAPiDGENOMICS_rs1205_00407
AGTTTAGATTTGAGTGAAAACAGTTTCTCAAGCATACCTGAAAGCATCTGTCAACTTCCTGAGCTTAGAGAGATTTCTTTGCGTGGTTGTGACAATCTAGACTCGTTGCCCGCAGATCCT
>augustus_masked-Fvb1-4-processed-gene-85.10:1348:1468:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-85.10:1348-1468||RAPiDGENOMICS_rs1205_00408
GATATCATCCTACAGTTGAGGTTCCAGAGGATTCCACCCAGACCCAAGTACTACCTTTATCGTCTCCTTCATCCTCCGGTTTGAAACTTGATCAGGAAATAGTTCCAACAAACTCTACCA
>augustus_masked-Fvb1-4-processed-gene-85.10:1468:1588:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-85.10:1468-1588||RAPiDGENOMICS_rs1205_00409
TCAATGTACTAGTACCTTCATCATCTTCTTCCGCCTTTAATTTGGAAAAGCTTCTTCCAGAGCCTTCATCATCTAGGTCATCTACGTCTTGGACTTATGATGTCTTCCTCAGTTTCAGGG
>augustus_masked-Fvb1-4-processed-gene-85.10:1528:1648:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-85.10:1528-1648|2x||RAPiDGENOMICS_rs1205_00410
AGCCTTCATCATCTAGGTCATCTACGTCTTGGACTTATGATGTCTTCCTCAGTTTCAGGGGTGAGGACACCCGCAATAATTTTACAGATCATTTATACAATGCTCTGTGCCGGAGAGGTA
>augustus_masked-Fvb1-4-processed-gene-85.10:1588:1708:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-85.10:1588-1708||RAPiDGENOMICS_rs1205_00411
GTGAGGACACCCGCAATAATTTTACAGATCATTTATACAATGCTCTGTGCCGGAGAGGTATTGATACATTTAGGGATACGGAAGAACTTCAGATGGGAAATTCCATTGCACCAGAACTTC
>augustus_masked-Fvb1-4-processed-gene-85.10:1648:1768:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-85.10:1648-1768|2x||RAPiDGENOMICS_rs1205_00412
TTGATACATTTAGGGATACGGAAGAACTTCAGATGGGAAATTCCATTGCACCAGAACTTCGGAAAGCAATTAAAGGATCACAGTTTGCAATCATCATTCTTTCCCCCATGTACGCTACTT
>augustus_masked-Fvb1-4-processed-gene-85.10:1708:1828:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-85.10:1708-1828||RAPiDGENOMICS_rs1205_00413
GGAAAGCAATTAAAGGATCACAGTTTGCAATCATCATTCTTTCCCCCATGTACGCTACTTCATCATGGTGTCTAGATGAACTTGCATATATTCTTGAATGCAAGAAAGTGACAGGCCTTC
>augustus_masked-Fvb1-4-processed-gene-85.10:1768:1888:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-85.10:1768-1888|2x||RAPiDGENOMICS_rs1205_00414
CATCATGGTGTCTAGATGAACTTGCATATATTCTTGAATGCAAGAAAGTGACAGGCCTTCCGGTTTTTTATCATGTCAAACCATCTGAGGTAAGAAAGCAAACCGGAAATTTTGGCAGGG
>augustus_masked-Fvb1-4-processed-gene-85.10:1828:1948:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_5::augustus_masked-Fvb1-4-processed-gene-85.10:1828-1948||RAPiDGENOMICS_rs1205_00415
CGGTTTTTTATCATGTCAAACCATCTGAGGTAAGAAAGCAAACCGGAAATTTTGGCAGGGCTTTTACTAAGCATGAAAAGATATTCATTGACAATATATGCAAGGTGGAAAAGTGGAGGC
>augustus_masked-Fvb1-4-processed-gene-85.10:1997:2117:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-85.10:1997-2117||RAPiDGENOMICS_rs1205_00416
GAAAGAATCAGAAGTCATTGAGGAAATAACTGAAAGGATCTCAAACATACTGAACCAGAGGTCATCCCCTCCTGACAGAGGTTTAATAGGAATGGATGCACGTGTAGAAACAGTGGTGTC
>augustus_masked-Fvb1-4-processed-gene-85.10:2057:2177:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-85.10:2057-2177|2x||RAPiDGENOMICS_rs1205_00417
GTCATCCCCTCCTGACAGAGGTTTAATAGGAATGGATGCACGTGTAGAAACAGTGGTGTCTTACTTGGATCTAGGGTCAGATAAGGTTCTTACCATAGGTATTTGGGGGATGGGGGGCAT
>augustus_masked-Fvb1-4-processed-gene-85.10:2117:2237:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-85.10:2117-2237||RAPiDGENOMICS_rs1205_00418
TTACTTGGATCTAGGGTCAGATAAGGTTCTTACCATAGGTATTTGGGGGATGGGGGGCATTGGTAAGACTACCCTTGCAAAAGAAGTTTACAAGGAGATTCATAACCTATTTCATGTTAG
>augustus_masked-Fvb1-4-processed-gene-85.10:2177:2297:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-85.10:2177-2297|2x||RAPiDGENOMICS_rs1205_00419
TGGTAAGACTACCCTTGCAAAAGAAGTTTACAAGGAGATTCATAACCTATTTCATGTTAGTGGCTTTGTTCGCAATGTTAGATTGCAATCACAAGTGGAGTTGCAGAAACTTGTTTGTGA
>augustus_masked-Fvb1-4-processed-gene-85.10:2237:2357:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-85.10:2237-2357||RAPiDGENOMICS_rs1205_00420
TGGCTTTGTTCGCAATGTTAGATTGCAATCACAAGTGGAGTTGCAGAAACTTGTTTGTGAGTCTTTCTTTGGGGATGGTTACGTAGACACTGTTAAAAAGGGTTCAAAATGGACCAGGTT
>augustus_masked-Fvb1-4-processed-gene-85.10:2297:2417:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-85.10:2297-2417|2x||RAPiDGENOMICS_rs1205_00421
GTCTTTCTTTGGGGATGGTTACGTAGACACTGTTAAAAAGGGTTCAAAATGGACCAGGTTATTACAGAAAAAGGTGCTTCTTGTTCTAGACGATGTTGATGACTTAAAACAAATTACAAA
>augustus_masked-Fvb1-4-processed-gene-85.10:2357:2477:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-85.10:2357-2477||RAPiDGENOMICS_rs1205_00422
ATTACAGAAAAAGGTGCTTCTTGTTCTAGACGATGTTGATGACTTAAAACAAATTACAAATTTAGTACCAGGTGGATCGGCCTGTGAAGAGAACTTTTGGGGTCCAGGGAGTCGACTCAT
>augustus_masked-Fvb1-4-processed-gene-85.10:2417:2537:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-85.10:2417-2537|2x||RAPiDGENOMICS_rs1205_00423
TTTAGTACCAGGTGGATCGGCCTGTGAAGAGAACTTTTGGGGTCCAGGGAGTCGACTCATTATAACAACTAGAGATAGAAGAACATTGACAGAGCTTGGAGTTCTAGAACATAAAATCTA
>augustus_masked-Fvb1-4-processed-gene-85.10:2477:2597:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_5::augustus_masked-Fvb1-4-processed-gene-85.10:2477-2597||RAPiDGENOMICS_rs1205_00424
TATAACAACTAGAGATAGAAGAACATTGACAGAGCTTGGAGTTCTAGAACATAAAATCTATGAGGTTGAAAAACTAAATGATAAGGAAGCTTATCAGCTTCTGTGTCGGAAAGCCTTCAA
>augustus_masked-Fvb1-4-processed-gene-85.10:2537:2657:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_5::augustus_masked-Fvb1-4-processed-gene-85.10:2537-2657|2x||RAPiDGENOMICS_rs1205_00425
TGAGGTTGAAAAACTAAATGATAAGGAAGCTTATCAGCTTCTGTGTCGGAAAGCCTTCAAGAAGGTCAATCCCCCCAAGGAGTTTGTAGAGCTGTCCAAGAGTTTTCTGAAATATGCTTG
>augustus_masked-Fvb1-4-processed-gene-85.10:2777:2897:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_7::augustus_masked-Fvb1-4-processed-gene-85.10:2777-2897|2x||RAPiDGENOMICS_rs1205_00426
TCAAATAAGTTTTGATGGATTACATACTGTAGATAAAAAGATCTTTCTAGACATTGCTTGTTTCTTCAATGGCGAGGATGTTGTTCGTGTGAAGAAGATACTGAAAGGTTGTGGATTTTC
>augustus_masked-Fvb1-4-processed-gene-85.10:2837:2957:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_8::augustus_masked-Fvb1-4-processed-gene-85.10:2837-2957||RAPiDGENOMICS_rs1205_00427
TTTCTTCAATGGCGAGGATGTTGTTCGTGTGAAGAAGATACTGAAAGGTTGTGGATTTTCTTCCCGAATAGGAATAACTAACCTCGTTGACAAATCTCTGGTTAAAATTGCAAAGGGTAA
>augustus_masked-Fvb1-4-processed-gene-85.10:285:405:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-85.10:285-405||RAPiDGENOMICS_rs1205_00428
TTTAAGCAGGATGTGCCCGTACAATATCCGTCTAAACACTTGCGGCTTTTGGAATGGCATGAATGTCCTCTAGAATCTCTGTCATCTTGGTTTTCATCGCGACAGAGGCTGGTTGAACTC
>augustus_masked-Fvb1-4-processed-gene-85.10:3273:3393:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-85.10:3273-3393||RAPiDGENOMICS_rs1205_00429
TTTGTGGATGTGCTCTTATCTTATCCCTCTAAAAAATTACGGCTTTTGGAATGGCATGAATGTCCTCTAAAATCTCTATTTTCTTGGTTTACATCTGAACTACTGCTGGTTGAACTCAAG
>augustus_masked-Fvb1-4-processed-gene-85.10:3432:3552:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-85.10:3432-3552||RAPiDGENOMICS_rs1205_00430
GTTTATCAGGTGATCAACACGCTAGTACACATGGATCTTTCCTACTGCCAATATTTAATTATGACCCCACACTTGGGTGCGGTCCCAAATCTTGAGACATTGATTCTTGAAGGTTGTACA
>augustus_masked-Fvb1-4-processed-gene-85.10:3552:3672:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-85.10:3552-3672||RAPiDGENOMICS_rs1205_00431
GAGTTATTAGAGGTTGTCGGCTATTCATATATGCATCTTCCACATCTGGTTCTATTGAATTTGAAAGGTTGCGTGAGTCTAAGGAAGCTTCCAGAGATAATGAACTTGACATCTCTTCGA
>augustus_masked-Fvb1-4-processed-gene-85.10:3672:3792:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_3::augustus_masked-Fvb1-4-processed-gene-85.10:3672-3792||RAPiDGENOMICS_rs1205_00432
ACCTTTATTCTTTCAGGATGTACAAACCTCCGAAAGTTTCCTCAGATAGTGGGAAACATGGATTCTTTAGAACTTTATTTAGATGGCACGGCTTTCGGATATCTTCCTGAGCAGCTGAGA
>augustus_masked-Fvb1-4-processed-gene-85.10:3972:4092:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_5::augustus_masked-Fvb1-4-processed-gene-85.10:3972-4092|2x||RAPiDGENOMICS_rs1205_00433
AGAGAAGTGCCCGAGTCCATTTCATCTCTTAAGAATCTCAAACTTCTGTGTTTCCATGGATGCGCTGAGTTACGCATGCCGTACATTTTACCAGGTTTGATATCTTTGAGAACATTAAAT
>augustus_masked-Fvb1-4-processed-gene-85.10:4032:4152:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_6::augustus_masked-Fvb1-4-processed-gene-85.10:4032-4152||RAPiDGENOMICS_rs1205_00434
TGCGCTGAGTTACGCATGCCGTACATTTTACCAGGTTTGATATCTTTGAGAACATTAAATCTAGGAGGATGCAATTTTGCAGAAGGAGACATCTCTGATGAAACTGGAATTGGCACCTTA
>augustus_masked-Fvb1-4-processed-gene-85.10:4092:4212:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_6::augustus_masked-Fvb1-4-processed-gene-85.10:4092-4212|2x||RAPiDGENOMICS_rs1205_00435
CTAGGAGGATGCAATTTTGCAGAAGGAGACATCTCTGATGAAACTGGAATTGGCACCTTAATCTCGCTGCAGAGTTTGGATCTGAGTGAGAACAATTTTTCAAGCATACCTGAAAGCATC
>augustus_masked-Fvb1-4-processed-gene-85.10:4152:4272:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_7::augustus_masked-Fvb1-4-processed-gene-85.10:4152-4272||RAPiDGENOMICS_rs1205_00436
ATCTCGCTGCAGAGTTTGGATCTGAGTGAGAACAATTTTTCAAGCATACCTGAAAGCATCTCTAAACTTCCTGAGCTTAGAGAGATTTCTTTGCGTGGTTGTGACAATCTAGAATTGTTG
>augustus_masked-Fvb1-4-processed-gene-85.10:4272:4392:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_8::augustus_masked-Fvb1-4-processed-gene-85.10:4272-4392||RAPiDGENOMICS_rs1205_00437
CTAGGAGATCCTCCTGCTTCAGCAAAAAATGTGGATATACGGGGTTGTACTATGCTGACAAATTGTTCCGATGAGTGGCTGAGATTGGCTTCAGATGAGGGCTTGCGTATCAGAAACTGT
>augustus_masked-Fvb1-4-processed-gene-85.10:4392:4512:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_9::augustus_masked-Fvb1-4-processed-gene-85.10:4392-4512||RAPiDGENOMICS_rs1205_00438
CGAAAATGGGATTATCGGTGTCCTCTCATGACCTTGAGTGTGCAGTTCGATGAATTAAGTGAAACTCCCTATCCTTATCATCCGATGGCTCCAAGAATTGCCACACATCAACATTCAAAT
>augustus_masked-Fvb1-4-processed-gene-85.10:447:567:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_1::augustus_masked-Fvb1-4-processed-gene-85.10:447-567||RAPiDGENOMICS_rs1205_00439
GTTTATCAGCTGAACTCGCTAATACACATGGATCTTTCCAACTGCCGATGTTTAACCATGACACCGGACTTCAGCGCGGTCCCAAATCTTGAGACATTGATCCTTGAAGGTTGTACAGAG
>augustus_masked-Fvb1-4-processed-gene-85.10:567:687:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_2::augustus_masked-Fvb1-4-processed-gene-85.10:567-687||RAPiDGENOMICS_rs1205_00440
TTATCAGAGGTTCACTGGTCAACTATGCGTCTCCAACATCTGGTTTTATTGAATTTGAAAGGTTGTGTGAATCTAAAGGAGCTTCCAGATATAATCGAGTTGAGATGTCTTCGAACCTTT
>augustus_masked-Fvb1-4-processed-gene-85.10:807:927:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_4::augustus_masked-Fvb1-4-processed-gene-85.10:807-927||RAPiDGENOMICS_rs1205_00441
CATTTGAGAAGCCTTGCTTTACTAAATCTGAGCGGGTGCAAGAACCTCCGAAAACTTCCTTTCTCCACTAGGGGTATCACTGGTATGACATCCCTGAAGTTCCTCTGTTTGTCATCGTGT
>augustus_masked-Fvb1-4-processed-gene-85.10:927:1047:Parent=augustus_masked-Fvb1-4-processed-gene-85.10-mRNA-1_5::augustus_masked-Fvb1-4-processed-gene-85.10:927-1047||RAPiDGENOMICS_rs1205_00442
TCAAGGATGACAACACTGTCAGATGACATACACCGCTTGGAATTCTTAGAGGAGCTTGATGTGTGTGATACTGCTATAGTAAGAGTGCCCGTGTCCATTTCATCCCTTAAGAACTTCTGT
>augustus_masked-Fvb2-1-processed-gene-14.4:109:229:Parent=augustus_masked-Fvb2-1-processed-gene-14.4-mRNA-1_1::augustus_masked-Fvb2-1-processed-gene-14.4:109-229||RAPiDGENOMICS_rs1205_00443
GAAATGCTTTGCATGCTTTGAGAAGTAGGCTCATTGATGCCACCAATGTTCTTCAGAGTTGGGACCCAACTCTGGTCAATCCCTGCACCTGGTTCCATGTTACCTGTGATGCCAATAACC
>augustus_masked-Fvb2-1-processed-gene-14.4:314:434:Parent=augustus_masked-Fvb2-1-processed-gene-14.4-mRNA-1_1::augustus_masked-Fvb2-1-processed-gene-14.4:314-434||RAPiDGENOMICS_rs1205_00444
GGAGCTTTATAGAAATGATATAGGAGGTAAAATCCCAAAGGAGTTGGGGAATTTGAAATACCTTGTTAGCATGGATTTGTATGGCAACAGATTTGAAGGGAAAATCCCAAAATCTTTCTC
>augustus_masked-Fvb2-1-processed-gene-14.4:602:722:Parent=augustus_masked-Fvb2-1-processed-gene-14.4-mRNA-1_1::augustus_masked-Fvb2-1-processed-gene-14.4:602-722||RAPiDGENOMICS_rs1205_00445
CGAGGTGACTTGGCCTGTCAAGATCTGTTCCATGTCTAAAAGACATCATGCATTTCAAGAGTTCTGTGAGGGAACAAAAGATTCTTTAAACCCATTGCCTTGTGCAGCCCATGGTGATTC
>augustus_masked-Fvb2-1-processed-gene-181.3:0:120:Parent=augustus_masked-Fvb2-1-processed-gene-181.3-mRNA-1_1::augustus_masked-Fvb2-1-processed-gene-181.3:0-120||RAPiDGENOMICS_rs1205_00446
ATGTTCCACTTTTTGGGATCTGCTACTAAAATTGTCGGTCAATCAATGCTTAGCTGCTTCGACCCTCCTCACTTCTTTCACTATATGAACCCCCTCACACCTCTGCTCTTTCTTCACTTC
>augustus_masked-Fvb2-1-processed-gene-181.3:1200:1320:Parent=augustus_masked-Fvb2-1-processed-gene-181.3-mRNA-1_11::augustus_masked-Fvb2-1-processed-gene-181.3:1200-1320||RAPiDGENOMICS_rs1205_00447
CTTGCAAACTGCGGGATTAAGATGAAGCTGGAGGACTGGAAGCCTGCGCAGACCTATTACTATGACTACATTGATTTGTCTTGGAATCAGATTACGGGCAGTCCGATTGGATTGCTGAAC
>augustus_masked-Fvb2-1-processed-gene-181.3:1320:1440:Parent=augustus_masked-Fvb2-1-processed-gene-181.3-mRNA-1_12::augustus_masked-Fvb2-1-processed-gene-181.3:1320-1440||RAPiDGENOMICS_rs1205_00448
AAGACGGATTTTTTGGTGGGTTTTTGGGCTTCTGGAAACAAGTTGAAGTTTAATCTTGAGAGCTTGAGGATTGTGCAGACATTGAAGCACTTGGATGTATCAAGGAATTTGGTATTGGGG
>augustus_masked-Fvb2-1-processed-gene-181.3:1440:1560:Parent=augustus_masked-Fvb2-1-processed-gene-181.3-mRNA-1_13::augustus_masked-Fvb2-1-processed-gene-181.3:1440-1560||RAPiDGENOMICS_rs1205_00449
AAGGTGCCTAACGCACTGATTGGGCTTGACAGACTGAACGTGAGCTATAATCATCTGTGTGGACAACTCCCGGCCACCAAGTTTCCGGCTTCAGCATTTTTGGGGAACGATTGTCTCTGC
>augustus_masked-Fvb2-1-processed-gene-181.3:240:360:Parent=augustus_masked-Fvb2-1-processed-gene-181.3-mRNA-1_3::augustus_masked-Fvb2-1-processed-gene-181.3:240-360||RAPiDGENOMICS_rs1205_00450
CACGTGGACGACGAAACCGGCCTGCTCGCCTTCAAGTCAGGCATCACAGCCGACCCCTCCAACATGCTCACCTCATGGAAGAAAGGCACCGACTGCTGCACCTGGTCCGGCGTACAATGC
>augustus_masked-Fvb2-1-processed-gene-181.3:300:420:Parent=augustus_masked-Fvb2-1-processed-gene-181.3-mRNA-1_3::augustus_masked-Fvb2-1-processed-gene-181.3:300-420|2x||RAPiDGENOMICS_rs1205_00451
AACATGCTCACCTCATGGAAGAAAGGCACCGACTGCTGCACCTGGTCCGGCGTACAATGCGACAACAACCGCGTCACACAGCTGTTCGTCACCGGCCAACCCGACAAGCCCAACTCCTTT
>augustus_masked-Fvb2-1-processed-gene-181.3:480:600:Parent=augustus_masked-Fvb2-1-processed-gene-181.3-mRNA-1_5::augustus_masked-Fvb2-1-processed-gene-181.3:480-600||RAPiDGENOMICS_rs1205_00452
CAGGATCTCAGAAACCTCACCGGTCCTTTCCCGGCTTTTGTTTTCCACCTCCCCAATCTCGAGTACGTGTACATCGAAAACAGCAAGCTCTCGGGTCGGATACCCACTTCCATCGGCAAC
>augustus_masked-Fvb2-1-processed-gene-181.3:600:720:Parent=augustus_masked-Fvb2-1-processed-gene-181.3-mRNA-1_6::augustus_masked-Fvb2-1-processed-gene-181.3:600-720||RAPiDGENOMICS_rs1205_00453
TTGACCCAACTCGATGTACTCAGCTTTTACTTCAACCGGTTTACCGGTCCGATCCCGAGCTCAATTTCTAAGCTGACTCAGTTGACTCAGCTCAAACTCGGCGGCAACAGTTTAACCGGG
>augustus_masked-Fvb2-1-processed-gene-181.3:960:1080:Parent=augustus_masked-Fvb2-1-processed-gene-181.3-mRNA-1_9::augustus_masked-Fvb2-1-processed-gene-181.3:960-1080||RAPiDGENOMICS_rs1205_00454
AACTTCAAGACCCTCGACACACTTGATCTTGGTCACAATATGTTAACAGGCACTGTGCCGACTACACTTGCTAAGTTGACCAAGATCTTCAATCTCGATCTTTCAAATAATCAACTTGTG
>augustus_masked-Fvb2-1-processed-gene-204.9:1975:2095:Parent=augustus_masked-Fvb2-1-processed-gene-204.9-mRNA-1_2::augustus_masked-Fvb2-1-processed-gene-204.9:1975-2095||RAPiDGENOMICS_rs1205_00455
CAAGCACGGTATACAAATGTGTTCTTAAGAATTGTAAGCCAGTAGCGATCAAGAGACTCTACTCTCATCATCCACCGTGCTTGAAGGAGTTTGAGACAGAACTTGAAACAGTTGGCAGTA
>augustus_masked-Fvb2-1-processed-gene-28.0:1036:1156:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_5::augustus_masked-Fvb2-1-processed-gene-28.0:1036-1156||RAPiDGENOMICS_rs1205_00456
GACTTTCGCTTTCTTCGAATCAATTGACAGGGCCAATCCCATATTCTGTAGGAAATCTTAGCAACCTAATTGAGTTAGATTTTTTCTCAAATCATTTGCACAGTTCCATTCCTGAGTCCT
>augustus_masked-Fvb2-1-processed-gene-28.0:1156:1276:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_6::augustus_masked-Fvb2-1-processed-gene-28.0:1156-1276||RAPiDGENOMICS_rs1205_00457
TATTCAATCTCACAAATCTCGTGACGCTTTATCTAGATAGTAACAGACTGAGCGGCAAAGTGAATTTCTCCATGTTTCAAAAGCTGCAAAATCTCCTCATACTGTATCTCTCTGGAAATA
>augustus_masked-Fvb2-1-processed-gene-28.0:1276:1396:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_7::augustus_masked-Fvb2-1-processed-gene-28.0:1276-1396||RAPiDGENOMICS_rs1205_00458
AATTGGAATTGTTGCTCGAAGAGACAAGACATACGAATGCAACAACTTTTCCAAATTTTATAACTCTAGGATTGGGTTCTTGCAACATAACCCAGTTCCCAAGTTTCCTAAGATATCAAA
>augustus_masked-Fvb2-1-processed-gene-28.0:1396:1516:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_8::augustus_masked-Fvb2-1-processed-gene-28.0:1396-1516||RAPiDGENOMICS_rs1205_00459
AAAATTTGCGATGGCTGGATCTTGCTGAGAATGGAATGCATGACCAAGTACCGAGATGGATGTGGAATGTAAGCAAAGAAAGTTTGACGGTTATGAACATTTCTCATAACTTCCTTTCTG
>augustus_masked-Fvb2-1-processed-gene-28.0:1516:1636:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_9::augustus_masked-Fvb2-1-processed-gene-28.0:1516-1636||RAPiDGENOMICS_rs1205_00460
GCTTTGACCAACCTCCAGATGTTCTTTTGTGGAGTGGCTTACAACTCTTGGATCTTTCGTCCAACACGATTCAGGGATCGCTACCGATACCTTCACCATCAATCGAGTACTATGTAGTTT
>augustus_masked-Fvb2-1-processed-gene-28.0:1636:1756:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_10::augustus_masked-Fvb2-1-processed-gene-28.0:1636-1756||RAPiDGENOMICS_rs1205_00461
CAGACAACAAGCTAAGTGGGCAAGTTTTACCTCTGATTTGCAATCTGACTTCTCTGAAGTACCTTGATTTGTCAAACAACAACTTGAGTGGGATGCTGCCACAGTGTCTTGGGAAGTTCA
>augustus_masked-Fvb2-1-processed-gene-28.0:1756:1876:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_11::augustus_masked-Fvb2-1-processed-gene-28.0:1756-1876||RAPiDGENOMICS_rs1205_00462
GTAAAAATCTGCGAGTTTTACATCTTGGAAACAACTCTTTTGAAGGCCACCTCCCCGAAGCATACACAAGCAGTCTAACCATGATTGATGTTAGTAACAATAAGCTGCAGGGAATCTTGC
>augustus_masked-Fvb2-1-processed-gene-28.0:180:300:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_2::augustus_masked-Fvb2-1-processed-gene-28.0:180-300|2x||RAPiDGENOMICS_rs1205_00463
TTTGCTTCTGTTGGTGAGGGTGCTTATCCAAGGGTTTTGTCATGGAAACCAGCTGCTGCTAAAGAATGCTGCTCATGGGACGGGGTCAAGTGCGATGAGAAGACAGGTCATGTCATTAGC
>augustus_masked-Fvb2-1-processed-gene-28.0:1876:1996:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_12::augustus_masked-Fvb2-1-processed-gene-28.0:1876-1996||RAPiDGENOMICS_rs1205_00464
CCAGGTCATTGGCAAATTGTTTGATGCTTGAGTTTCTTGTTATATCAAACAATGAGTTCAGAGATGTTTTCCCTTTTTGGTTGGGAACTCTCCCAGGGTTGAGACTCTTGGCAATGCACC
>augustus_masked-Fvb2-1-processed-gene-28.0:1996:2116:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_13::augustus_masked-Fvb2-1-processed-gene-28.0:1996-2116||RAPiDGENOMICS_rs1205_00465
ATAATGGATTCCATGGGGTGATAAGGAAACCTGAAAAGAATCCAGATCATTTTCTTCAGTTGCACATTCTTGATCTATCTTTCAATAATTTCTCAGGCAACTTCCCCTTTGAATACATTT
>augustus_masked-Fvb2-1-processed-gene-28.0:2116:2236:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_14::augustus_masked-Fvb2-1-processed-gene-28.0:2116-2236||RAPiDGENOMICS_rs1205_00466
TCTCTGGAAATGCAATCAAAGGTATCACTTCCGATCAGTTCACATACCTGAAGACAACCGCAGATGTTGTTTATGATCCTTCATATCATGGCGGGTATTTCTCCTTCACAATGACAAATA
>augustus_masked-Fvb2-1-processed-gene-28.0:2236:2356:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_15::augustus_masked-Fvb2-1-processed-gene-28.0:2236-2356||RAPiDGENOMICS_rs1205_00467
AAGGTGTGAACAGATTCTATCCCAAGATTCGAGAGGACTTTGCAGCCATTGACATCTCAAGCAACAATTTTGAAGGTGAGATTCCTGAGTTTATTGGGGACCTGACGGGGCTTCGTTTGC
>augustus_masked-Fvb2-1-processed-gene-28.0:2296:2416:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_15::augustus_masked-Fvb2-1-processed-gene-28.0:2296-2416|2x||RAPiDGENOMICS_rs1205_00468
GCAACAATTTTGAAGGTGAGATTCCTGAGTTTATTGGGGACCTGACGGGGCTTCGTTTGCTAAATATGTCGAACAACATTCTCACTGGTTTGATCCCCTCATCCTTGGGAAAATTAAAGT
>augustus_masked-Fvb2-1-processed-gene-28.0:240:360:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_3::augustus_masked-Fvb2-1-processed-gene-28.0:240-360||RAPiDGENOMICS_rs1205_00469
AAAGAATGCTGCTCATGGGACGGGGTCAAGTGCGATGAGAAGACAGGTCATGTCATTAGCCTTGATCTTAGTAGCAGTTACCTCTCCGGTTCTATCGATTCCAACAGCACCCTCTTCCAC
>augustus_masked-Fvb2-1-processed-gene-28.0:2476:2596:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_17::augustus_masked-Fvb2-1-processed-gene-28.0:2476-2596||RAPiDGENOMICS_rs1205_00470
CACAGATTTCATTTCTTGCAAAGTTCAATGTCTCTCACAACAATCTCAGTGGTCTTATTCCTCGTGGTTCCCAGTTTGCTACATTTGACAGTACTTCATATGAAGGAAACCTGGGGTTGT
>augustus_masked-Fvb2-1-processed-gene-28.0:2716:2836:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_19::augustus_masked-Fvb2-1-processed-gene-28.0:2716-2836||RAPiDGENOMICS_rs1205_00471
GATCTGTGAGTGGCATGCTAGTTGGAGTGGTTCTTGCAGATGTCCTCCTCACAAGGAAGCGTGAGTATTTTCTTGAGATTGTTGGCATACTAATCAGACTAATGAAAAGGAAAAGAAAGA
>augustus_masked-Fvb2-1-processed-gene-28.0:360:480:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_4::augustus_masked-Fvb2-1-processed-gene-28.0:360-480||RAPiDGENOMICS_rs1205_00472
CTTGTTCATCTTCAGAGGCTGAACCTTGCCGACAATGACTTCAATCAATCTCAAATTCCTACTACCATCAGGAATCTTCCCATGCTTCATTATCTTAACCTCTCTGGCTCATTCTTTTCT
>augustus_masked-Fvb2-1-processed-gene-28.0:556:676:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_1::augustus_masked-Fvb2-1-processed-gene-28.0:556-676||RAPiDGENOMICS_rs1205_00473
ATCTCTTTGGTTTTTTGCCGGCATTTGAACAAACTAGTCCTCTAATGTCACTCAGAGTTTCCAGAACAAGGTTTTCAGGAAGCCTTCCCTTTTCAATTAAAAAGCTTGATTCACTGAACG
>augustus_masked-Fvb2-1-processed-gene-28.0:856:976:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_3::augustus_masked-Fvb2-1-processed-gene-28.0:856-976|2x||RAPiDGENOMICS_rs1205_00474
TCCCATCTTCTCTTGGTAATCTCATCCAGCTTACAACACTTTCGCTTGCAACAAATCAACTAACTGGTCCAATCCCATCTTCTCTAGGAAAACTTATCCAGCTCACTGAGTTAGACCTCT
>augustus_masked-Fvb2-1-processed-gene-28.0:916:1036:Parent=augustus_masked-Fvb2-1-processed-gene-28.0-mRNA-1_4::augustus_masked-Fvb2-1-processed-gene-28.0:916-1036||RAPiDGENOMICS_rs1205_00475
TAACTGGTCCAATCCCATCTTCTCTAGGAAAACTTATCCAGCTCACTGAGTTAGACCTCTCTGGTAATGATTTTGGTGGTTACATCCCATCTTCCATCGGAAATCTCAACCAGCTCGTAA
>augustus_masked-Fvb2-1-processed-gene-31.9:180:300:Parent=augustus_masked-Fvb2-1-processed-gene-31.9-mRNA-1_2::augustus_masked-Fvb2-1-processed-gene-31.9:180-300|2x||RAPiDGENOMICS_rs1205_00476
CTTTTGCTACTTATTGATGATGTATGGACACCTTTTTCCTTGGAAAATATTGGAATTCCTGCACCGACCAGAGCCAATGGTGACGCTGGAATTTGGATCGATGGTGAATGGAAACATTAA
>augustus_masked-Fvb2-2-processed-gene-122.4:0:120:Parent=augustus_masked-Fvb2-2-processed-gene-122.4-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-122.4:0-120||RAPiDGENOMICS_rs1205_00477
ATGGTTTTGAAGAAGCAGAGAGTATCTATTCCATTTCCATTACGGATATCTATTCCTTCAGCTTCTTTATGGGCGGTGGATGTTTTCTTAAGTTGTGACCATGAAGACATTTTCTGCTCC
>augustus_masked-Fvb2-2-processed-gene-122.4:120:240:Parent=augustus_masked-Fvb2-2-processed-gene-122.4-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-122.4:120-240||RAPiDGENOMICS_rs1205_00478
CACTTGTACCACAAGTTGCAGTCTCGAGGAATTTGTACTTTCCTGGATGGCCATGAATTTGCAAGAAACACAACCCCTCTTGAGCTCTATGGTGCAATCGAAGAATCGAGGTTTGCCATT
>augustus_masked-Fvb2-2-processed-gene-122.4:180:300:Parent=augustus_masked-Fvb2-2-processed-gene-122.4-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-122.4:180-300|2x||RAPiDGENOMICS_rs1205_00479
GCAAGAAACACAACCCCTCTTGAGCTCTATGGTGCAATCGAAGAATCGAGGTTTGCCATTGTTGTTCTCTCGCAAAACTATGCTTCTTCTCCACGGCGCTTGAATGAGCTTTCCAAAACT
>augustus_masked-Fvb2-2-processed-gene-122.4:240:360:Parent=augustus_masked-Fvb2-2-processed-gene-122.4-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-122.4:240-360||RAPiDGENOMICS_rs1205_00480
GTTGTTCTCTCGCAAAACTATGCTTCTTCTCCACGGCGCTTGAATGAGCTTTCCAAAACTCTCGAGTGCATGAAAGATAGGAACAGGATTCTACCGATATTTCATGATTATTTATGTCAC
>augustus_masked-Fvb2-2-processed-gene-122.4:60:180:Parent=augustus_masked-Fvb2-2-processed-gene-122.4-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-122.4:60-180|2x||RAPiDGENOMICS_rs1205_00481
GCTTCTTTATGGGCGGTGGATGTTTTCTTAAGTTGTGACCATGAAGACATTTTCTGCTCCCACTTGTACCACAAGTTGCAGTCTCGAGGAATTTGTACTTTCCTGGATGGCCATGAATTT
>augustus_masked-Fvb2-2-processed-gene-13.6:1080:1200:Parent=augustus_masked-Fvb2-2-processed-gene-13.6-mRNA-1_10::augustus_masked-Fvb2-2-processed-gene-13.6:1080-1200||RAPiDGENOMICS_rs1205_00482
CTGCTGGGGAAGGGGACTGTGGGGGCCACTTACAAGATCATGATGAACGGCTGGGATGATGTGGCGGTGGTGAAGAGGGTGAGGGAGAGGAAGGTTCACGGCAAGGAAGTTGAGGCGTGG
>augustus_masked-Fvb2-2-processed-gene-13.6:120:240:Parent=augustus_masked-Fvb2-2-processed-gene-13.6-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-13.6:120-240||RAPiDGENOMICS_rs1205_00483
CGCTCCAACTCCCTCGCCTCCTGGTCTCAATCCACCGACCCCTGTGCCGGGTCATGGCTCGGCGTCACCTGCGACCCGAAAACCCGTCGGGTCACCAAGCTTGTCCTCGAGAATCTCAAC
>augustus_masked-Fvb2-2-processed-gene-13.6:1200:1320:Parent=augustus_masked-Fvb2-2-processed-gene-13.6-mRNA-1_11::augustus_masked-Fvb2-2-processed-gene-13.6:1200-1320||RAPiDGENOMICS_rs1205_00484
TTGAGAATCATCGGCGAGTTGAAGCACGCTAACATTGCGAGTCTGAGAGCTTACCACAGCTCCAACTACGAGCTTCTTTTAGTGTATGATTTTTATGCCAATGGAAGTCTGCATTCTCTT
>augustus_masked-Fvb2-2-processed-gene-13.6:1440:1560:Parent=augustus_masked-Fvb2-2-processed-gene-13.6-mRNA-1_13::augustus_masked-Fvb2-2-processed-gene-13.6:1440-1560||RAPiDGENOMICS_rs1205_00485
CATGGTAACCTCAAGTCGTGCAATGTGTTGATAGATGACATGGGGAATGCTTGTATTGCTGACATTGGCCTAAAACAGCTCTTGGTTGGTCAGAGTTCGTCTTATGATGCCTACAGTGCG
>augustus_masked-Fvb2-2-processed-gene-13.6:180:300:Parent=augustus_masked-Fvb2-2-processed-gene-13.6-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-13.6:180-300|2x||RAPiDGENOMICS_rs1205_00486
GGCGTCACCTGCGACCCGAAAACCCGTCGGGTCACCAAGCTTGTCCTCGAGAATCTCAACCTCACCGGTCCCATTCAACCCCTCACCGCACTCGACCGCCTCAAGCTCCTCAGCCTCAAC
>augustus_masked-Fvb2-2-processed-gene-13.6:1800:1920:Parent=augustus_masked-Fvb2-2-processed-gene-13.6-mRNA-1_16::augustus_masked-Fvb2-2-processed-gene-13.6:1800-1920||RAPiDGENOMICS_rs1205_00487
CAGGTTGGTTTGATTTGTGTGGCTGCGCAGCCAAAAGATCGTCCAACGATGAACATGGTGCGCAATATGATCGAGGACATTAGGAAGAAGGGTGTTAGAGAAGATGGGACTGTGTCTATT
>augustus_masked-Fvb2-2-processed-gene-13.6:480:600:Parent=augustus_masked-Fvb2-2-processed-gene-13.6-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-13.6:480-600||RAPiDGENOMICS_rs1205_00488
CGGCTGTCTAAACTATTAACTCTGCGGCTCGAGTCCAACTCGCTCACCGGCTTCGGCGACGCGTCGTCTGCTCCGTTCACCGATTTCAATGTCTCCAACAACGACCTCGCCGGAAAAATC
>augustus_masked-Fvb2-2-processed-gene-132.5:0:120:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-132.5:0-120||RAPiDGENOMICS_rs1205_00489
ATGGCTTCTCCTGCAATAGACCTTCTGATTGGCAAAATAGTATCGTTTCTTGAAAGTGAAGTCTCATTGCTAGAAGGAGTTCATGATGAGCTAGGAGAAGTCAAGCTTGAGCTGTTAACC
>augustus_masked-Fvb2-2-processed-gene-132.5:1045:1165:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-132.5:1045-1165|2x||RAPiDGENOMICS_rs1205_00490
AGAGTCATGTTCATCAGATTGAACCTCTTAATACAAGTGATGCTTGGGATCTTTTCTCCAGAAGAGCATTCTCTAGTGTGAGAGACAAGTCTTGTCCACCAGAGCTTCAACTCATAGCTA
>augustus_masked-Fvb2-2-processed-gene-132.5:1105:1225:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-132.5:1105-1225||RAPiDGENOMICS_rs1205_00491
GAAGAGCATTCTCTAGTGTGAGAGACAAGTCTTGTCCACCAGAGCTTCAACTCATAGCTAGGGAGCTCGTAGGAAAATGTGAAGGCTTACCTCTAGGACTCGTGGCTTTGGGTTCGCTCA
>augustus_masked-Fvb2-2-processed-gene-132.5:1165:1285:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-132.5:1165-1285|2x||RAPiDGENOMICS_rs1205_00492
GGGAGCTCGTAGGAAAATGTGAAGGCTTACCTCTAGGACTCGTGGCTTTGGGTTCGCTCATGTCAACCAAAAGATTTGTGTCCGAGTGGAAGAAAGTTTACAATGGCATGAGTTGGGAGC
>augustus_masked-Fvb2-2-processed-gene-132.5:120:240:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-132.5:120-240||RAPiDGENOMICS_rs1205_00493
ATGAAGGCCTTCTTGGAGGATGCAGAAAGGAAGGGAGCTCTCGGTGAAGTAGAGAAAACATGGGTGGCAAATGTGAGAGATGTCTCCATTGACGTAGAAGACATCATGGATGAGTTCACG
>augustus_masked-Fvb2-2-processed-gene-132.5:1225:1345:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_7::augustus_masked-Fvb2-2-processed-gene-132.5:1225-1345||RAPiDGENOMICS_rs1205_00494
TGTCAACCAAAAGATTTGTGTCCGAGTGGAAGAAAGTTTACAATGGCATGAGTTGGGAGCTCAGCAATAATCCGACACTTGAAGTAGTGAAGAGCATTTTGTTGCTAAGCTTCAATGATC
>augustus_masked-Fvb2-2-processed-gene-132.5:1285:1405:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_7::augustus_masked-Fvb2-2-processed-gene-132.5:1285-1405|2x||RAPiDGENOMICS_rs1205_00495
TCAGCAATAATCCGACACTTGAAGTAGTGAAGAGCATTTTGTTGCTAAGCTTCAATGATCTATCTCACCGACTCAAGCACTGCTTCTTATATTTCTGCATTTTTCCAGAAGATGACACCA
>augustus_masked-Fvb2-2-processed-gene-132.5:1345:1465:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_8::augustus_masked-Fvb2-2-processed-gene-132.5:1345-1465||RAPiDGENOMICS_rs1205_00496
TATCTCACCGACTCAAGCACTGCTTCTTATATTTCTGCATTTTTCCAGAAGATGACACCATTAAGGGGAAAAGGCTAGTTCGGTTGTGGATAGCAGAGGGATTTATTGAACAAGTTAGAG
>augustus_masked-Fvb2-2-processed-gene-132.5:1405:1525:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_8::augustus_masked-Fvb2-2-processed-gene-132.5:1405-1525|2x||RAPiDGENOMICS_rs1205_00497
TTAAGGGGAAAAGGCTAGTTCGGTTGTGGATAGCAGAGGGATTTATTGAACAAGTTAGAGGGGCTCAGCCAGAAGAGATAGCTGAGAGCTACCTAGCAGAGCTAACTTGCCGCTGTATGC
>augustus_masked-Fvb2-2-processed-gene-132.5:1585:1705:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_10::augustus_masked-Fvb2-2-processed-gene-132.5:1585-1705||RAPiDGENOMICS_rs1205_00498
TGCGAGAACTTGCAATTTCAATTTCAGAAGAACTGAAGTTTTGTACTACGTATAATAAGAATGAAACAAAAGAAGACAGACGAGCTCCACGCCGCCTTTCAATACAAGGATGCTCTGGAG
>augustus_masked-Fvb2-2-processed-gene-132.5:1733:1853:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-132.5:1733-1853||RAPiDGENOMICS_rs1205_00499
CTTTCAAGGCACACAAGCACCAGCAAGCATATATAAGCTGCAGAGTCTGCAAATTTTGGATTCAATCGTGGTAGGAAGTGAGTTGATCAAACAACTTCAGCGCATGACCCGACTCGCTAC
>augustus_masked-Fvb2-2-processed-gene-132.5:1853:1973:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-132.5:1853-1973||RAPiDGENOMICS_rs1205_00500
ATTAGGCTTGGCGAATGTGAAGGAAGCCCATGAGATAGACTTATGCAAGTCAATTGAAAGCATGAAACTGATTGAATGCTTAACTGTGAAGACAAGTAGTGAGGATGAGGTGTTACGCAT
>augustus_masked-Fvb2-2-processed-gene-132.5:1973:2093:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-132.5:1973-2093||RAPiDGENOMICS_rs1205_00501
GGATGCATTGTTGGCGGCTCCTCCTCTGCTGCAAACACTTGTTTTAACCGGAAAGTTAAACAAGGTTCCGCTCTGGTTTCTCTCACTTGAGAGCCTTGCTGTCTTGTATTTGCATTGGTC
>augustus_masked-Fvb2-2-processed-gene-132.5:2093:2213:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-132.5:2093-2213||RAPiDGENOMICS_rs1205_00502
AAGATTAACAGAAGACTTTCTTCCTCACATTCATGCACTACCTAATCTGACCAACCTTTGGCGATGCAATGCATATGTAGGAAACCAGTTGCTCTTTCAAACTGGGTTCCAAAAGCTTGC
>augustus_masked-Fvb2-2-processed-gene-132.5:2213:2333:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-132.5:2213-2333||RAPiDGENOMICS_rs1205_00503
TGCTTTGTACCTAACCAATTTTCCTCAGTTGAATCTGATCACCATAGAGAAGGGGGCAATGCCGGCATTGAAGACGATGGACATTTCTGAATGCATGGAGTTAAAGCGCTTGCCTCGCGG
>augustus_masked-Fvb2-2-processed-gene-132.5:240:360:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-132.5:240-360||RAPiDGENOMICS_rs1205_00504
TATCAGACAAACAAGCGAAGAAGTTGGGGTCCGTTCACAAAAGCCTTCAGTAAGACACTACGTCTCCCACAAAACATTTGGGAGAGGCATCGGATTGCCACAAAGTTGCAGAAGATCATG
>augustus_masked-Fvb2-2-processed-gene-132.5:2416:2536:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-132.5:2416-2536||RAPiDGENOMICS_rs1205_00505
TAGGTAAGGAGCTTGAATGGTTTTGTGTTGTGGCTTGGCATCTTTGGCATGATAGAAACAACTGTGTTCATGGCAAGGAAGTAGTCTCGGTTGATGTCTTGGTTCGAAATGTGGTGTCCT
>augustus_masked-Fvb2-2-processed-gene-132.5:2536:2656:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-132.5:2536-2656||RAPiDGENOMICS_rs1205_00506
GGTGGGAGAGGTTAGAAGGAGTTGAAGAGAGAAACACAAATCCAAGCTCTGCAAATCATAGTAATAATGGAGTTAGAGAGACTATAAGATGGAGCAAACCCAGATCAGGGTTTATAAAGC
>augustus_masked-Fvb2-2-processed-gene-132.5:2656:2776:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-132.5:2656-2776||RAPiDGENOMICS_rs1205_00507
TTAACATTGACGGGGCTATTGATACTCATGAAGGGGTCTTTGGTACTGGTGCAGTGTGTAGGAATGACCAAGGTCACTGCTTAGGAGTTTTGGCTGCTCCAGGGACGGGGTATCTAAGTC
>augustus_masked-Fvb2-2-processed-gene-132.5:2776:2896:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-132.5:2776-2896||RAPiDGENOMICS_rs1205_00508
CTCACGCAGTAGAAGTGATGGCGTTGGTTCATGGTTTGTATTTTTGTCGAAGCGCTGGGTTTACTCACATAGAGATTGAGGGAGATGCCATGAGTGTATTTGCAGCTTTGGATAACTCAG
>augustus_masked-Fvb2-2-processed-gene-132.5:2896:3016:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-132.5:2896-3016||RAPiDGENOMICS_rs1205_00509
TAGATGACTTTAGTAATGAAGGTGCCCTTTTGGACGAAGCAAAGGTTATTGTAGTTGGGGTTTCATTCCTAGAGATGGAAATAAGGCAGCTCATATGGTCGCCAGAGCGGCTTTATTCCT
>augustus_masked-Fvb2-2-processed-gene-132.5:3055:3175:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-132.5:3055-3175||RAPiDGENOMICS_rs1205_00510
AGGCACAACACTCTGTTCCTGTAGTTAAAGGGCTATCATGGTCCTTCTATGACTCTAGCTGCCCTAAGCTTGACTCCATTGTAAGGAAGCAGCTCAAGAAGGTCTTCAAGGAAGACATTG
>augustus_masked-Fvb2-2-processed-gene-132.5:3225:3345:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-132.5:3225-3345||RAPiDGENOMICS_rs1205_00511
GGATGTGATGGGTCAGTTTTACTGGATGGATCAGCGAGTGGTCCAAGTGAGCAGCAGGCACCTCCAAACCTGAGTTTGAGAGCCAAGGCCTTCCAAATCATCAATGACCTCCGTGAGATT
>augustus_masked-Fvb2-2-processed-gene-132.5:3420:3540:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-132.5:3420-3540||RAPiDGENOMICS_rs1205_00512
TCAGGTGGCCCTGAATATGAAGTACCACTGGGAAGAAAGGATGGACTAAACTTTGCAACAAGGAATGAAACCCTTGCTAACCTCCCCGCACCAACAAGCAACACCACAAAACTCCTCACA
>augustus_masked-Fvb2-2-processed-gene-132.5:3540:3660:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-132.5:3540-3660||RAPiDGENOMICS_rs1205_00513
GATCTTGCCAAGAAAAACTTGGACGCCACTGATGTCGTTGCTCTATCTGGTGGCCACACCATCGGCCTTGGCCACTGCACCTCCTTCACTGGCAGGTTATATCCGACTCAAGATGCTAGT
>augustus_masked-Fvb2-2-processed-gene-132.5:360:480:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-132.5:360-480||RAPiDGENOMICS_rs1205_00514
AAAACAATCAAAGATATTCCAGAGAGAAGCCGGCGTTATGGTTCTTTACGCACACTGGCGGAGCCACACCAAGACCAAGGGGTGCCATGGCACCCCCCACACATTTTGATGATGGTTAAT
>augustus_masked-Fvb2-2-processed-gene-132.5:3660:3780:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-132.5:3660-3780||RAPiDGENOMICS_rs1205_00515
ATGGACAAAACTTTTGCCAATGACCTTAAGCAAGTGTGTCCAGCAGCCGACACAAACGCCACAACCGTGCTTGATATCCGCTCGCCTGACACATTCGACAACAAGTACTACGTTGATCTC
>augustus_masked-Fvb2-2-processed-gene-132.5:3780:3900:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-132.5:3780-3900||RAPiDGENOMICS_rs1205_00516
ATGAACCGCCAAGGTCTATTCACATCGGACCAAGATTTGTACACAGATAAAAGAACACGCGACATTGTCACTAGCTTCGCCGTCAACCAGACATTGTTCTTCGAGAAGTTTGTTCATTCC
>augustus_masked-Fvb2-2-processed-gene-132.5:3900:4020:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-132.5:3900-4020||RAPiDGENOMICS_rs1205_00517
ATGATCAAGATGGGGCAATTGAGCGTGCTAACTGGTTCGAAAGGTGAAATTCGCGCTAATTGCTCAATGAGGAACTCAGACAACGCTAATTACTTGAGCTCCGTGGTGGAAGAGGATGAA
>augustus_masked-Fvb2-2-processed-gene-132.5:745:865:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-132.5:745-865||RAPiDGENOMICS_rs1205_00518
CCTGGATTACAGTCTCACAAAGTTATACTATTGAAGATCTGTTTCGAGTCATGATCAATGAACTCTTTGCAGCGGCACAAATAGATGTTCCTCAAAACTTGAGCAACATGAGTTATAGAC
>augustus_masked-Fvb2-2-processed-gene-132.5:805:925:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-132.5:805-925|2x||RAPiDGENOMICS_rs1205_00519
AACTCTTTGCAGCGGCACAAATAGATGTTCCTCAAAACTTGAGCAACATGAGTTATAGACATTTAGTGGAATTGCTTGTCCACTACTTGCAGCCAAGGAGGTATATGATTGTCTTAGATG
>augustus_masked-Fvb2-2-processed-gene-132.5:865:985:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-132.5:865-985||RAPiDGENOMICS_rs1205_00520
ATTTAGTGGAATTGCTTGTCCACTACTTGCAGCCAAGGAGGTATATGATTGTCTTAGATGATGTGTGGGACACAAATCTTTGGAGATCCATAGATGTTGCACTTCCCAAAGGAACTCATG
>augustus_masked-Fvb2-2-processed-gene-132.5:925:1045:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-132.5:925-1045|2x||RAPiDGENOMICS_rs1205_00521
ATGTGTGGGACACAAATCTTTGGAGATCCATAGATGTTGCACTTCCCAAAGGAACTCATGGTAGCCGCATCATGCTTACAACTAGGAACAAAGACATAGCTTCTTTGGCGTTTGGAGTCG
>augustus_masked-Fvb2-2-processed-gene-132.5:985:1105:Parent=augustus_masked-Fvb2-2-processed-gene-132.5-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-132.5:985-1105||RAPiDGENOMICS_rs1205_00522
GTAGCCGCATCATGCTTACAACTAGGAACAAAGACATAGCTTCTTTGGCGTTTGGAGTCGAGAGTCATGTTCATCAGATTGAACCTCTTAATACAAGTGATGCTTGGGATCTTTTCTCCA
>augustus_masked-Fvb2-2-processed-gene-192.1:0:120:Parent=augustus_masked-Fvb2-2-processed-gene-192.1-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-192.1:0-120||RAPiDGENOMICS_rs1205_00523
ATGATTGCTTTACAGGTTCCTCCTGAAATGGAAGAGAGCGGCAAGTCTGAGGCCCACTTGACCTCCGCAGCGGCTTTTGTGGAGGGTGGAATCCAGGAAGCCTGTGATGATGCTTGCAGT
>augustus_masked-Fvb2-2-processed-gene-192.1:279:399:Parent=augustus_masked-Fvb2-2-processed-gene-192.1-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-192.1:279-399||RAPiDGENOMICS_rs1205_00524
TTTCTAAGCATGCAAGCTTTCCTTGCGGATGCGGAGACCAACACAGCAAAAACCAAAGGAGAGATATTGTGGGTCGCAAGCATCAGAGACTTGGCCTATGATGTTGAAGATATTATTGAT
>augustus_masked-Fvb2-2-processed-gene-192.1:399:519:Parent=augustus_masked-Fvb2-2-processed-gene-192.1-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-192.1:399-519||RAPiDGENOMICS_rs1205_00525
GAATTCATGTATCACATGTATGAGAAGCAAAGTGGGGGTCGACTTCCAAGGGGGCTACAAAAAACCATTAGCGCTCCCCAGAAGCTCTGGTTCAGGCGAAAAATTGCAAAGAAGTGTCAG
>augustus_masked-Fvb2-2-processed-gene-192.1:519:639:Parent=augustus_masked-Fvb2-2-processed-gene-192.1-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-192.1:519-639||RAPiDGENOMICS_rs1205_00526
AAACTTAATGAAATGATCAAAGCCATACCAGTGAGGAATCAAAGATATGGTGTTGGCCATCTAGGAGGAGCAGCTACATCTGAAGATATTCATAAATTGGTGCAGAACCAAGCGGAGTCC
>augustus_masked-Fvb2-2-processed-gene-192.1:579:699:Parent=augustus_masked-Fvb2-2-processed-gene-192.1-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-192.1:579-699|2x||RAPiDGENOMICS_rs1205_00527
CTAGGAGGAGCAGCTACATCTGAAGATATTCATAAATTGGTGCAGAACCAAGCGGAGTCCTCTATATTCATTATGGAAGACGAACTGGTTGGGATTGAAGGCAAGAAGCAAATACTAATG
>augustus_masked-Fvb2-2-processed-gene-192.1:639:759:Parent=augustus_masked-Fvb2-2-processed-gene-192.1-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-192.1:639-759||RAPiDGENOMICS_rs1205_00528
TCTATATTCATTATGGAAGACGAACTGGTTGGGATTGAAGGCAAGAAGCAAATACTAATGGGATGGCTCATGGATGAAGAGCAACACCAAACTATTATATCTGTGGTTGGCATGGGAGGT
>augustus_masked-Fvb2-2-processed-gene-192.1:699:819:Parent=augustus_masked-Fvb2-2-processed-gene-192.1-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-192.1:699-819|2x||RAPiDGENOMICS_rs1205_00529
GGATGGCTCATGGATGAAGAGCAACACCAAACTATTATATCTGTGGTTGGCATGGGAGGTTCTGGAAAGACAACTCTAGCTGCCAAGGCCTTCTACAACGAAAGGGTAAAGGGGCGTTTC
>augustus_masked-Fvb2-2-processed-gene-192.1:759:879:Parent=augustus_masked-Fvb2-2-processed-gene-192.1-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-192.1:759-879||RAPiDGENOMICS_rs1205_00530
TCTGGAAAGACAACTCTAGCTGCCAAGGCCTTCTACAACGAAAGGGTAAAGGGGCGTTTCCATTGTTGTGCGTGGATTACCGTTTCCCAAACTTATGATGTGGTACACTTATTTCGAAGC
>augustus_masked-Fvb2-2-processed-gene-192.1:819:939:Parent=augustus_masked-Fvb2-2-processed-gene-192.1-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-192.1:819-939|2x||RAPiDGENOMICS_rs1205_00531
CATTGTTGTGCGTGGATTACCGTTTCCCAAACTTATGATGTGGTACACTTATTTCGAAGCTTGATCAAGGAACTCTACATATCAAGGAAGGAAGATATCCCTGCAAATTTGAATGCCATG
>augustus_masked-Fvb2-2-processed-gene-192.1:879:999:Parent=augustus_masked-Fvb2-2-processed-gene-192.1-mRNA-1_7::augustus_masked-Fvb2-2-processed-gene-192.1:879-999||RAPiDGENOMICS_rs1205_00532
TTGATCAAGGAACTCTACATATCAAGGAAGGAAGATATCCCTGCAAATTTGAATGCCATGAGCCGCATGGAATTGATAGAGTTACTAGTTAACTACTGTTGTTCTGTTGTGATACTTTTG
>augustus_masked-Fvb2-2-processed-gene-192.7:0:120:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-192.7:0-120||RAPiDGENOMICS_rs1205_00533
ATGGGGCTATCACTGAGCTTGTGGGATGGTCGCATGCTTTCGGCACCAGTAATTCTCTTTGTGTTTCATTTCTTTGTTTTTGCCAACTCTCTAAACTCTCTGCAGCAGCCATCATCTTTC
>augustus_masked-Fvb2-2-processed-gene-192.7:1020:1140:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_9::augustus_masked-Fvb2-2-processed-gene-192.7:1020-1140|2x||RAPiDGENOMICS_rs1205_00534
ATCCCTGCTTCTTTGGCTACCCTTAGCCAACTGTCACATCTGTCCCTTGATAATAATCATTTCAGCGGTTACATCCCATCTTCTCTTGGTAATCTCATCCAGCTTACAACACTTTCGCTT
>augustus_masked-Fvb2-2-processed-gene-192.7:120:240:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-192.7:120-240||RAPiDGENOMICS_rs1205_00535
TGCCATGACGATGAGAGCTTGGCATTGCTCCAGTTTAAGCAAAGCTTTGTAATCGACGAATTTGCTTCTGTTGGTGAGGGTGCTTATCCAAGGGTTTTGTCATGGAAACCAGCTGCTGCT
>augustus_masked-Fvb2-2-processed-gene-192.7:1200:1320:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_11::augustus_masked-Fvb2-2-processed-gene-192.7:1200-1320||RAPiDGENOMICS_rs1205_00536
GAGTTAGACCTCTCTGGTAATGATTTTGGTGGTTACATCCCATCTTCCATCGGAAATCTCAACCAGCTCGTAAGACTTTCGCTTTCTTCGAATCAATTAACAGGGCCAATCCCATCTTCT
>augustus_masked-Fvb2-2-processed-gene-192.7:1320:1440:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_12::augustus_masked-Fvb2-2-processed-gene-192.7:1320-1440||RAPiDGENOMICS_rs1205_00537
GTAGGAAATCTTAGCAATCTAATTGAGTTGGATTTTTTCTCAAACCATTTGCACAGTTCCGTTCCTGAGTCCTTATTCAATCTCACAAATCTCGTGACGCTTTATCTAGATAGTAATAGA
>augustus_masked-Fvb2-2-processed-gene-192.7:1440:1560:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_13::augustus_masked-Fvb2-2-processed-gene-192.7:1440-1560||RAPiDGENOMICS_rs1205_00538
CTGAGCGGCAAAGTGAATTTCTCCATGTTTCAAAAGCTGCAAAATCTCCTCATACTGTATCTCTCTGGAAATAAATTGGAATTGTTGCTCGAAGAGACAAGACATACGAATGCAACAACT
>augustus_masked-Fvb2-2-processed-gene-192.7:1680:1800:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_15::augustus_masked-Fvb2-2-processed-gene-192.7:1680-1800||RAPiDGENOMICS_rs1205_00539
GTACCGAGATGGATGTGGAATGTAAGCATAGAAAGTTTGACGGTTATGAACATTTCTCATAACTTCCTTTCTGGCTTTGACCAACCTCCAGATATTCTTTTGTGGAGTGGCTTACAACTC
>augustus_masked-Fvb2-2-processed-gene-192.7:1800:1920:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_16::augustus_masked-Fvb2-2-processed-gene-192.7:1800-1920||RAPiDGENOMICS_rs1205_00540
TTGGATCTTTCGTCCAACATGATTCAGGGATCGCTACTGATACCTTCACCATCAATCGAGTACTATGTAGTTTCAGACAACAAGCTAAGTGGGCAAGTTTTACCTCTGATTTGCAATCTG
>augustus_masked-Fvb2-2-processed-gene-192.7:1920:2040:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_17::augustus_masked-Fvb2-2-processed-gene-192.7:1920-2040||RAPiDGENOMICS_rs1205_00541
ACTTCTCTGAAGTACCTTGATTTGTCAAACAACAACTTGAGCGGGATGCTGCCACAGTGTCTTGGGAAGTTCAGTAAAAATCTGCGAGTTTTACATCTTGGAAACAACTCTTTTGAAGGC
>augustus_masked-Fvb2-2-processed-gene-192.7:2040:2160:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_18::augustus_masked-Fvb2-2-processed-gene-192.7:2040-2160||RAPiDGENOMICS_rs1205_00542
CACCTCCCGGAAGCATACACAAGCAGTCTAATCATGATTGATGTTGGTAACAATAAGCTGCAGGGAATCTTGCCCAGGTCATTGGCAAATTGTTTGATGCTTGAGTTTCTTGTTATATCT
>augustus_masked-Fvb2-2-processed-gene-192.7:2160:2280:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_19::augustus_masked-Fvb2-2-processed-gene-192.7:2160-2280||RAPiDGENOMICS_rs1205_00543
AACAATGAGTTCAGTGATGTTTTCCCTTTTTGGTTGGGAACTCTCCCAGGGTTGAGACTCTTGGCAATGCACCATAATGGATTCCATGGGGTGATAAGGAAACCTGAAAAGAATCCAGAC
>augustus_masked-Fvb2-2-processed-gene-192.7:2280:2400:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_20::augustus_masked-Fvb2-2-processed-gene-192.7:2280-2400||RAPiDGENOMICS_rs1205_00544
TACTTTCTTCAGTTGCACATTCTTGATCTATCTTTCAATAATTTCTCAGGCAACTTCCCCTTTGAATACATTTTCTCTGGAAATGCAATCAAAGGTATCACTTCCGATCAGTTCACATAC
>augustus_masked-Fvb2-2-processed-gene-192.7:2400:2520:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_21::augustus_masked-Fvb2-2-processed-gene-192.7:2400-2520||RAPiDGENOMICS_rs1205_00545
CTGAAGACAACCGCAGATGTTGTTTATGATCCTTCATATCATGGCGGGTATTTCTCCTTCACAATGACAAGTAAAGGTGTGAACAGATTCTATCCCAAGATTCGAGAGGACTTTGCAGTC
>augustus_masked-Fvb2-2-processed-gene-192.7:2580:2700:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_22::augustus_masked-Fvb2-2-processed-gene-192.7:2580-2700|2x||RAPiDGENOMICS_rs1205_00546
GGGCTTCGTTTGCTAAATATGTCGAACAACATTCTCACTGGTTTGATCCCCTCATCCTTGGGAAAATTAAAGTTGCTTGAATCGTTGGACCTTTCACAGAACAAACTCTCAGGGGAGATC
>augustus_masked-Fvb2-2-processed-gene-192.7:2640:2760:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_23::augustus_masked-Fvb2-2-processed-gene-192.7:2640-2760||RAPiDGENOMICS_rs1205_00547
GGAAAATTAAAGTTGCTTGAATCGTTGGACCTTTCACAGAACAAACTCTCAGGGGAGATCCCTCGTCAACTGGCACAGATTTCATTTCTTGCGAAATTCAATGTCTCTCACAACAATCTC
>augustus_masked-Fvb2-2-processed-gene-192.7:2760:2880:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_24::augustus_masked-Fvb2-2-processed-gene-192.7:2760-2880||RAPiDGENOMICS_rs1205_00548
AGTGGTCTTATTCCTCGTGGTTCCCAGTTTGCTACCTTTGACAGTACTTCATATGAAGGAAACCTGGGGTTGTGTGGAGATCCATTGCCAAAGAAATGCGGCAATGATGCTCCTCCGTTG
>augustus_masked-Fvb2-2-processed-gene-192.7:2880:3000:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_25::augustus_masked-Fvb2-2-processed-gene-192.7:2880-3000||RAPiDGENOMICS_rs1205_00549
CCACCTCCTACAGAAGAAGATGATGATTCTGATTCTGGAATTGAATTGGATTGGAAATTTGTACTAGCAGGATCTGTGAGTGGCATGCTAGTTGGAGTGGTTCTTGCAGATGCCCTCCTC
>augustus_masked-Fvb2-2-processed-gene-192.7:480:600:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-192.7:480-600||RAPiDGENOMICS_rs1205_00550
GGTCAAATCCCATCTGAAATTTCTCAGTTGTCCAAGTTGTCGTCCCTGGACCTATCCTCCAATACTGATAGTACTGGTGAAAGATCCCTGATGCTAAACCAGTCCAATCTAAAAAGGCTG
>augustus_masked-Fvb2-2-processed-gene-192.7:60:180:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-192.7:60-180|2x||RAPiDGENOMICS_rs1205_00551
GTGTTTCATTTCTTTGTTTTTGCCAACTCTCTAAACTCTCTGCAGCAGCCATCATCTTTCTGCCATGACGATGAGAGCTTGGCATTGCTCCAGTTTAAGCAAAGCTTTGTAATCGACGAA
>augustus_masked-Fvb2-2-processed-gene-192.7:600:720:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-192.7:600-720||RAPiDGENOMICS_rs1205_00552
GTTCAGAACTTAACCAGTCTAGAAAAGCTTCATCTCAGCTCCGTCCTCATTTCTGCACCAGTACCCGATTCTGTGGCAAATTTACCATTTCTGACATCTCTCCTCCTAGAGTATTGTGAT
>augustus_masked-Fvb2-2-processed-gene-192.7:720:840:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_7::augustus_masked-Fvb2-2-processed-gene-192.7:720-840||RAPiDGENOMICS_rs1205_00553
CTGCGAGGCCATTTCCCGGTAAGTATTTTAAAACTACAAAGTTTAAAGTTTCTTAATGTAGAATCCAATCCAGATCTCTTTGGTTTTTTGCCGGCATTTGAACAAACTAGTCCTCTAATG
>augustus_masked-Fvb2-2-processed-gene-192.7:840:960:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_8::augustus_masked-Fvb2-2-processed-gene-192.7:840-960||RAPiDGENOMICS_rs1205_00554
TCACTCAGAGTTTCCAGAACAAGGTTTTCAGGAAGCCTTCCCTTTTCAATTAAAAAGCTTGATTCACTGAACGAATTAGTTGCCAGTCGATGCAATTTTTCAGGTCTGCTTCCATCTTCA
>augustus_masked-Fvb2-2-processed-gene-192.7:900:1020:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_8::augustus_masked-Fvb2-2-processed-gene-192.7:900-1020|2x||RAPiDGENOMICS_rs1205_00555
GATTCACTGAACGAATTAGTTGCCAGTCGATGCAATTTTTCAGGTCTGCTTCCATCTTCACTCGGAAATCTTAGGCAGCTGGTTTATTTAGACCTTTCAAATAACACACTTAGTGGCTCC
>augustus_masked-Fvb2-2-processed-gene-192.7:960:1080:Parent=augustus_masked-Fvb2-2-processed-gene-192.7-mRNA-1_9::augustus_masked-Fvb2-2-processed-gene-192.7:960-1080||RAPiDGENOMICS_rs1205_00556
CTCGGAAATCTTAGGCAGCTGGTTTATTTAGACCTTTCAAATAACACACTTAGTGGCTCCATCCCTGCTTCTTTGGCTACCCTTAGCCAACTGTCACATCTGTCCCTTGATAATAATCAT
>augustus_masked-Fvb2-2-processed-gene-198.0:240:360:Parent=augustus_masked-Fvb2-2-processed-gene-198.0-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-198.0:240-360||RAPiDGENOMICS_rs1205_00557
GTCACCCAGATCACTCTCGACCCCGCCGGCTACTCCGGCACCCTCACCCCTCAAATTTCTCAGCTCACCCATCTATCCACTCTCGACCTCTCCGAAAACTCCTTCTTCGGCCCAATCCCA
>augustus_masked-Fvb2-2-processed-gene-198.0:540:660:Parent=augustus_masked-Fvb2-2-processed-gene-198.0-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-198.0:540-660|2x||RAPiDGENOMICS_rs1205_00558
GATCTCAGCTTCAACAAGATCACCGGATCACTCCCCAGACTCCCACCAAAGCTCTTAGAACTCGCTCTCAAAAGCAACTCGTTATCCGGGCCCTTGTCGAAATCGTCCTTTGACGGATTG
>augustus_masked-Fvb2-2-processed-gene-198.0:600:720:Parent=augustus_masked-Fvb2-2-processed-gene-198.0-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-198.0:600-720||RAPiDGENOMICS_rs1205_00559
CTCGCTCTCAAAAGCAACTCGTTATCCGGGCCCTTGTCGAAATCGTCCTTTGACGGATTGTCTCAGCTGGAGGTGGTCGAGCTCAGCCAGAACTCGTTCTCCGGTACATTACAGTCATGG
>augustus_masked-Fvb2-2-processed-gene-198.0:660:780:Parent=augustus_masked-Fvb2-2-processed-gene-198.0-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-198.0:660-780|2x||RAPiDGENOMICS_rs1205_00560
TCTCAGCTGGAGGTGGTCGAGCTCAGCCAGAACTCGTTCTCCGGTACATTACAGTCATGGTTCTTCCTCATCCCTTCCCTCCAACAAGTCGACCTAGCCAATAACAGCCTGACAGGTGTC
>augustus_masked-Fvb2-2-processed-gene-198.0:780:900:Parent=augustus_masked-Fvb2-2-processed-gene-198.0-mRNA-1_7::augustus_masked-Fvb2-2-processed-gene-198.0:780-900|2x||RAPiDGENOMICS_rs1205_00561
GACATCGCCAGGCCTGGCTCCGGCAGAGGCGGCGAGCTCGTGGCGGTCGACTTAAGCTTCAACAGAATCGAAGGCTACGCGCCCGCGAACTTCGCGGCATTTCCGAGGCTGTCGTCGCTG
>augustus_masked-Fvb2-2-processed-gene-227.17:1080:1200:Parent=augustus_masked-Fvb2-2-processed-gene-227.17-mRNA-1_10::augustus_masked-Fvb2-2-processed-gene-227.17:1080-1200||RAPiDGENOMICS_rs1205_00562
CCTGCGCAGACCTATTACTATGACTACATTGATTTGTCTTGGAATCAGATTACGGGCAGTCCGATTGGATTGCTGAACAAGACTGATTACTTGGTGGGTTTTTGGGCTTCTGGAAACAAG
>augustus_masked-Fvb2-2-processed-gene-227.17:1200:1320:Parent=augustus_masked-Fvb2-2-processed-gene-227.17-mRNA-1_11::augustus_masked-Fvb2-2-processed-gene-227.17:1200-1320||RAPiDGENOMICS_rs1205_00563
TTGAAGTTTAATCTTGAGAGCTTGAGGATTGTGCAGACATTGAAGCACTTGGATGTATCAAGGAATTTGGTATTCGGGAAGGTGCCTAAGGCAGTGATTGGGCTTGACAGACTGAACGTG
>augustus_masked-Fvb2-2-processed-gene-227.17:240:360:Parent=augustus_masked-Fvb2-2-processed-gene-227.17-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-227.17:240-360||RAPiDGENOMICS_rs1205_00564
GACAAGCCCAACTCCTTTTTATCCGGTACAATCTCTCCCTCCCTCTCAAAGCTCACATTCCTCAGCGGCATCTATCTCCAGAATCTCAGAAACCTCACCGGTCCCTTCCCGGCTTTTCTT
>augustus_masked-Fvb2-2-processed-gene-227.17:360:480:Parent=augustus_masked-Fvb2-2-processed-gene-227.17-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-227.17:360-480||RAPiDGENOMICS_rs1205_00565
TTCCACCTCCCCACTCTCAAGTACGTCTACATCGAAAACAGCCAGCTCTCGGGTCGGATACCCGCTTCCGTCGGCAACTTGACCCAACTCGAAGCACTCAGCTTTTACTTCAACCGCTTC
>augustus_masked-Fvb2-2-processed-gene-227.17:480:600:Parent=augustus_masked-Fvb2-2-processed-gene-227.17-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-227.17:480-600||RAPiDGENOMICS_rs1205_00566
ACCGGTCCGATCCCGAGCTCAATTTCTAAGCTGACTCAGTTGACTCAGCTCAAACTCGGCGGCAACATATTAACCGGGTCGATCCCAAACGGCATCAAAAACCTTAACAAGCTCACATTT
>augustus_masked-Fvb2-2-processed-gene-227.17:660:780:Parent=augustus_masked-Fvb2-2-processed-gene-227.17-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-227.17:660-780|2x||RAPiDGENOMICS_rs1205_00567
GAGCTCCGAATTCTCAGGCTTTTCCGCAATAAATTTACTGGGAAAATCCCAGCTTCAATCTCTGCTTTGGCGCCAAAATTGATCTACCTTGAGCTTGGCCACAATGCATTGACCGGTCAA
>augustus_masked-Fvb2-2-processed-gene-227.17:840:960:Parent=augustus_masked-Fvb2-2-processed-gene-227.17-mRNA-1_8::augustus_masked-Fvb2-2-processed-gene-227.17:840-960||RAPiDGENOMICS_rs1205_00568
TTAACAGGCACTGTGCCGACCACACTTGCTAATTTGACCAAGATCTTCAATCTCGATCTTTCAAATAATCAACTTGTGGATCCATTTCCGCAGCTGAATGTGAAAGGCATTGAGTCACTT
>augustus_masked-Fvb2-2-processed-gene-227.17:900:1020:Parent=augustus_masked-Fvb2-2-processed-gene-227.17-mRNA-1_8::augustus_masked-Fvb2-2-processed-gene-227.17:900-1020|2x||RAPiDGENOMICS_rs1205_00569
TCAAATAATCAACTTGTGGATCCATTTCCGCAGCTGAATGTGAAAGGCATTGAGTCACTTGATTTGTCTTACAACAAGTTCCATCTGAAGGAGATTCCGAAATGGGTTACTTCTTCGCCG
>augustus_masked-Fvb2-2-processed-gene-227.17:960:1080:Parent=augustus_masked-Fvb2-2-processed-gene-227.17-mRNA-1_9::augustus_masked-Fvb2-2-processed-gene-227.17:960-1080||RAPiDGENOMICS_rs1205_00570
GATTTGTCTTACAACAAGTTCCATCTGAAGGAGATTCCGAAATGGGTTACTTCTTCGCCGATTATTTACTCTCTGAAGCTTGCAAACTGCGGGATTAAGATGAAGCTGGAGGACTGGAAG
>augustus_masked-Fvb2-2-processed-gene-35.1:1145:1265:Parent=augustus_masked-Fvb2-2-processed-gene-35.1-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-35.1:1145-1265||RAPiDGENOMICS_rs1205_00571
TCCCGAGTCTGCATATGTTTACACAATTGTCAAAGAAGTTTGGGAGAAATTGAATCGTACTTTGTCAACTAAATCGAGAGACCTCTTTGGGAATTTAAGTCATGATCAAGCACAACATGT
>augustus_masked-Fvb2-2-processed-gene-35.1:120:240:Parent=augustus_masked-Fvb2-2-processed-gene-35.1-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-35.1:120-240||RAPiDGENOMICS_rs1205_00572
CAGGGTTTAACTTGGAAGAAGATTGATACCTTTATCTATGATAGACTTGAAGTAGGAGCTGAAATTGAATATGCTCTGGAGGCAGCAATCGAGAAGTCAAAGATTTCGATAATTGTTTTC
>augustus_masked-Fvb2-2-processed-gene-35.1:1281:1401:Parent=augustus_masked-Fvb2-2-processed-gene-35.1-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-35.1:1281-1401||RAPiDGENOMICS_rs1205_00573
GAATTGCAACAACAAATTTCAACTTCTGAGACTCCAATTTTGGAAGCAAATTCTTGGACTGCTATAGCCACATCAAGCAGCTTGGAGATCGAGAACCAAGACTATAGAATTCCAACAATG
>augustus_masked-Fvb2-2-processed-gene-35.1:1401:1521:Parent=augustus_masked-Fvb2-2-processed-gene-35.1-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-35.1:1401-1521||RAPiDGENOMICS_rs1205_00574
GCAATGTCATCAGCAGCCACAGAGCAGACCACTTCGATGATAAGCAACGACGAGCATCACACCCCGACTAGTGGTTCTGGTGCATCTTCTAGTCCAAAGCTATTAACAGAAGAAAATCTA
>augustus_masked-Fvb2-2-processed-gene-35.1:1521:1641:Parent=augustus_masked-Fvb2-2-processed-gene-35.1-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-35.1:1521-1641||RAPiDGENOMICS_rs1205_00575
GACCGCTTTGTTGAAGAACCAGAGTCTGAGAGTGCAGTGGTTGCAGTTGCTAGAAGTACTCTGAGAAACATCTCCCAATCTCATTTTAGTGATGGAATACTCCTCAGCAAGATAAGAGAA
>augustus_masked-Fvb2-2-processed-gene-35.1:240:360:Parent=augustus_masked-Fvb2-2-processed-gene-35.1-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-35.1:240-360||RAPiDGENOMICS_rs1205_00576
TCACAAGGCTACGCCTCTTCTAGGTGGTGCTTGGATGAACTTGTGCACATACTGAAATGCAAGAAAAGATATGGACGGACTGTTGTACCTGTGTTTTACGAGATAGATCCGTCAGTTGTA
>augustus_masked-Fvb2-2-processed-gene-35.1:300:420:Parent=augustus_masked-Fvb2-2-processed-gene-35.1-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-35.1:300-420|2x||RAPiDGENOMICS_rs1205_00577
AAGAAAAGATATGGACGGACTGTTGTACCTGTGTTTTACGAGATAGATCCGTCAGTTGTACGGAAACAAGAGAAGAGTTATGCAGATGCATTTGTGAAACATGAAAAAAGTTTCAAGTAC
>augustus_masked-Fvb2-2-processed-gene-35.1:360:480:Parent=augustus_masked-Fvb2-2-processed-gene-35.1-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-35.1:360-480||RAPiDGENOMICS_rs1205_00578
CGGAAACAAGAGAAGAGTTATGCAGATGCATTTGTGAAACATGAAAAAAGTTTCAAGTACCACATGGACAAGGTGCTCATTTGGAGGGATGCTCTGTCAGCTGCAGCCGCCCTATCTGGA
>augustus_masked-Fvb2-2-processed-gene-35.1:500:620:Parent=augustus_masked-Fvb2-2-processed-gene-35.1-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-35.1:500-620||RAPiDGENOMICS_rs1205_00579
TCCGGAGTCTGCATTTGTTTACACAATTGTCAAAGAAACTTGGGAGAAATTGGATTGTATCTCGTCAACTAAATCGAGGGACCTCTTTGGGATTGAAAGGCAGCTTCTTCATCAACAAAT
>augustus_masked-Fvb2-2-processed-gene-35.1:657:777:Parent=augustus_masked-Fvb2-2-processed-gene-35.1-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-35.1:657-777||RAPiDGENOMICS_rs1205_00580
GTTATGAATACTTCTGGTGCTGCACATGTACTCCCTCGAGACCAGTATGATGTCTTTCTCAGTTTTAGAGGTTCAGACACACGCCGGACATTTACTGGCGATCTTTATCAGGGTTTAACT
>augustus_masked-Fvb2-2-processed-gene-35.1:717:837:Parent=augustus_masked-Fvb2-2-processed-gene-35.1-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-35.1:717-837|2x||RAPiDGENOMICS_rs1205_00581
AGTTTTAGAGGTTCAGACACACGCCGGACATTTACTGGCGATCTTTATCAGGGTTTAACTTGGAAGAATATTGATACCTATATTGATAATAGACTCGAAAGAGGAGATGAAATTGAATGT
>augustus_masked-Fvb2-2-processed-gene-35.1:837:957:Parent=augustus_masked-Fvb2-2-processed-gene-35.1-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-35.1:837-957|2x||RAPiDGENOMICS_rs1205_00582
TCCCTGGAGGAAGCAATTGAGCAATCAAAGATTTCGATAATTGTTTTCTCACAAGACTACGCTTCTTCTAGGTGGTGCTTGGATGAACTTGTGCACATACTGAAATGCAAGAAAAGATAT
>augustus_masked-Fvb2-2-processed-gene-37.6:0:120:Parent=augustus_masked-Fvb2-2-processed-gene-37.6-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-37.6:0-120||RAPiDGENOMICS_rs1205_00583
ATGGCGGTGGCGACAATCGGAGCGGCGTCGCTCGCTCCGGTCTTCCAAGAGCTCTGCGATCAAGTCACTCAAGCGATGCAGAAGAACACCAAGCTCAAAGCCATCCTGGGCTTTCTCCAC
>augustus_masked-Fvb2-2-processed-gene-37.6:120:240:Parent=augustus_masked-Fvb2-2-processed-gene-37.6-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-37.6:120-240||RAPiDGENOMICS_rs1205_00584
TCCACGCTCAATTCGTTCAAAAATCGAGTCATCCAGCCGGTCCAAGAAGGCCGCCGGATTATGTACAACCAAGACTACCAGATCGAGTCCGCCGTCGTCGAATTGCAGAAGGGGGCGAAG
>augustus_masked-Fvb2-2-processed-gene-37.6:180:300:Parent=augustus_masked-Fvb2-2-processed-gene-37.6-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-37.6:180-300|2x||RAPiDGENOMICS_rs1205_00585
ATGTACAACCAAGACTACCAGATCGAGTCCGCCGTCGTCGAATTGCAGAAGGGGGCGAAGCTAGTGGCGAAGGTCTCCAGGCTCCGATCTTGTAGCTATTTCTGGCTGGACAGTTACGCG
>augustus_masked-Fvb2-2-processed-gene-37.6:300:420:Parent=augustus_masked-Fvb2-2-processed-gene-37.6-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-37.6:300-420|2x||RAPiDGENOMICS_rs1205_00586
AAGAAGCTTCTGGATTTGGATAGGCACTTGAGGAGTCTGATGGAGGCGACTTGGGGGGAGGAGGTTAGGGTTGTGAGGCAGCAGAGCAGGGAAGTGAGGGAACTGATGGATGGGATGGTT
>augustus_masked-Fvb2-2-processed-gene-37.6:840:960:Parent=augustus_masked-Fvb2-2-processed-gene-37.6-mRNA-1_8::augustus_masked-Fvb2-2-processed-gene-37.6:840-960||RAPiDGENOMICS_rs1205_00587
CTGCAGAGAGAGGTGTGTATTCTGAGATGGCAGATGGCCAAGAATGCGACCGAGTCTTTGGATTGGGTGAGGAAAATGGAGAGGGCGGTGAGTGAGATCGTAAGCAATGTGGGAGTGCTG
>augustus_masked-Fvb2-2-processed-gene-72.21:0:120:Parent=augustus_masked-Fvb2-2-processed-gene-72.21-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-72.21:0-120||RAPiDGENOMICS_rs1205_00588
ATGGCTGAGCTCCACCCAATTTCCACATTCACCCTCCTCTTCCTCACCACCCTCCTGTCCTTTTCCGTCATTTCCCACTCCCAGCAGCCCCTCCTCAGCCCCGCCGAGCAAGACTCCGTC
>augustus_masked-Fvb2-2-processed-gene-72.21:120:240:Parent=augustus_masked-Fvb2-2-processed-gene-72.21-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-72.21:120-240||RAPiDGENOMICS_rs1205_00589
TACCGCGTCCTCGACTCCGTCAACCCCCACGTCCCCTGGCGCACCCTCTTCCCCGATGACCTCTGCTCCTACGGCCCCCACGGCGTCGTCTGCGACTTCTTCACAAACGACACCAACCCA
>augustus_masked-Fvb2-2-processed-gene-72.21:1200:1320:Parent=augustus_masked-Fvb2-2-processed-gene-72.21-mRNA-1_11::augustus_masked-Fvb2-2-processed-gene-72.21:1200-1320||RAPiDGENOMICS_rs1205_00590
CTTTGTGTTGATGATGAGGGTTTAAGGTCTGCAAAGGGTTTAGGGTTTGGGGAGTTGAAGGTGTGCAGCAAACAGCAGAGACCCAATCCTGCCCATTTCACAGTGGATTCTTCTTCTTCA
>augustus_masked-Fvb2-2-processed-gene-72.21:480:600:Parent=augustus_masked-Fvb2-2-processed-gene-72.21-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-72.21:480-600||RAPiDGENOMICS_rs1205_00591
CTTGTTTCACCCCTCAGTGGCGTTCTACGTAATTTCACCAGTTTAAGGAGGGCGGTTCTGACCGGGAACGGGTTCTACGGCAACGTTCCGGACTCCGTCGCCGATATGGTCAACCTGGAA
>augustus_masked-Fvb2-2-processed-gene-72.21:540:660:Parent=augustus_masked-Fvb2-2-processed-gene-72.21-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-72.21:540-660|2x||RAPiDGENOMICS_rs1205_00592
ACCGGGAACGGGTTCTACGGCAACGTTCCGGACTCCGTCGCCGATATGGTCAACCTGGAAGAGCTGACTCTCGCCAGAAACAAACTCGGGGGCGAAATTCCGGTGAGCTTTGCCAGACTG
>augustus_masked-Fvb2-2-processed-gene-72.21:600:720:Parent=augustus_masked-Fvb2-2-processed-gene-72.21-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-72.21:600-720||RAPiDGENOMICS_rs1205_00593
GAGCTGACTCTCGCCAGAAACAAACTCGGGGGCGAAATTCCGGTGAGCTTTGCCAGACTGAAGAAGCTGAAGGTTCTCGACCTTGGTGGAAACTCCTTCGCCGGAGAAGTGCCGGAGTCG
>augustus_masked-Fvb2-2-processed-gene-72.21:840:960:Parent=augustus_masked-Fvb2-2-processed-gene-72.21-mRNA-1_8::augustus_masked-Fvb2-2-processed-gene-72.21:840-960||RAPiDGENOMICS_rs1205_00594
TTCAACAACTCCGGCGTGCCGGTGTTCTTGTCGGAGATGACACAGCTTAAAACGGTGTCGTTGAGTGGGAACAAGCTGGGAGGGCAGATTCCGGAGATATGGAGCAAGATGGGGGGTATT
>augustus_masked-Fvb2-2-processed-gene-72.21:960:1080:Parent=augustus_masked-Fvb2-2-processed-gene-72.21-mRNA-1_9::augustus_masked-Fvb2-2-processed-gene-72.21:960-1080||RAPiDGENOMICS_rs1205_00595
TTGGGAATTGGGCTTTCTGGGATGGGACTGGTTGGGAAAATCCCAGGTTCAATGGGGTTGTATTTGAGAAATGTAAGGTACTTGGGGCTTGATAATAACAAGCTGGAAGGGACAGTGCCT
>augustus_masked-Fvb2-2-processed-gene-74.14:0:120:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-74.14:0-120||RAPiDGENOMICS_rs1205_00596
ATGAAACGTAATAGAGATGATGGACACATGGTCTTGCCAGTTTTTTATAAGGTGGAACCATCCCATGTTGGGAAGCAGACTGAAACTTTCGGAAAAGCCTTTGCCAAACTGGTTGAAGAG
>augustus_masked-Fvb2-2-processed-gene-74.14:1049:1169:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_8::augustus_masked-Fvb2-2-processed-gene-74.14:1049-1169||RAPiDGENOMICS_rs1205_00597
TCATATAGCATGTTTTTTCATAGGAAGGGAGAAAGAGTTTACAATTACAGTACTGAGCAACCTTGAATTTTATACAAGAATTGGAATTCAAAATCTAGTCAATCGATGTTTAGTTCAAGT
>augustus_masked-Fvb2-2-processed-gene-74.14:1305:1425:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-74.14:1305-1425||RAPiDGENOMICS_rs1205_00598
GGTACAAAAACTATTGAGGGTCTCATGCTCAACCTAATCACTACGGAAACTACGCTTTCCAAGACTATTTTCAAAAGTAAGAACAAACGATATCATGCTGAAGAGTATGATGGGAATTGT
>augustus_masked-Fvb2-2-processed-gene-74.14:1425:1545:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-74.14:1425-1545||RAPiDGENOMICS_rs1205_00599
TCAACAAGGCATCGGCCTGGTTTCTTCTCATGGATATCAAATAACTTTTCCTCCAGAGAGTTAGATTCATATAAGGCGAACTTCAAAACAGAGGCGTCTAAAAAGATGCACAATCTTCAA
>augustus_masked-Fvb2-2-processed-gene-74.14:1730:1850:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-74.14:1730-1850||RAPiDGENOMICS_rs1205_00600
TCATTCACTTGGTCTTGTTACAACTTCAGACTTGTCAGGACTCTCTAACCTCGAGAGATTAATCCTTGAAGGTTGCACGAACATTTCTGAGATTGATGACTCCATTGGTGAACTCGAGAA
>augustus_masked-Fvb2-2-processed-gene-74.14:1850:1970:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-74.14:1850-1970||RAPiDGENOMICS_rs1205_00601
ACTCGTTTTCCTGAATGTCACAGACTGCAAAAATCTCAAGAAGCTCCCGGAAACAATTGACAGGTTGACATCTCTGCAGGAACTAAACCTTTCTGGTTGTTCAAACCTTTCTCTTCATGC
>augustus_masked-Fvb2-2-processed-gene-74.14:209:329:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-74.14:209-329||RAPiDGENOMICS_rs1205_00602
GTATGAAGCACAGCTGATTGAAAATATTGTTGAGGACATTGGAGATAAACTCGAATCCAAAGTACTAAATGTTGCTCCCCATGCGATTGGAATAGATGATCGTGTGAAAGACATAAACAA
>augustus_masked-Fvb2-2-processed-gene-74.14:2147:2267:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-74.14:2147-2267||RAPiDGENOMICS_rs1205_00603
CATTTTCCTTCATGGAAACAAGATTCCTAATTGGTACAAGTACAGGGGTGAAACCGCCATGTCTATCATTGTTCCTTCCCATCCTAAACTCAAGATCACAGGCTTAAATGTCTGTGTTGT
>augustus_masked-Fvb2-2-processed-gene-74.14:2267:2387:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-74.14:2267-2387||RAPiDGENOMICS_rs1205_00604
ATACACAAGACGTGGAAAAATTGAGGATATTTGCACCTCACCGATTGTAAAAGCCAGTAACGAAGCGAAAGGTGTTATGTGGTCGTATTGCCCTGTCAGTGTAGGTCTTCCAAAAGAGAA
>augustus_masked-Fvb2-2-processed-gene-74.14:2387:2507:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-74.14:2387-2507||RAPiDGENOMICS_rs1205_00605
TGAAAAGATGTCATGGCTAAGCCATTGGCAGTTTGAGAATGACGAGTTAGAGTGTGGGGAAGAACTACGTGTTTCTGTGGATACCGACTACATGTATGTTCCGATCTTGATAAAGGAGCT
>augustus_masked-Fvb2-2-processed-gene-74.14:269:389:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-74.14:269-389|2x||RAPiDGENOMICS_rs1205_00606
AGTACTAAATGTTGCTCCCCATGCGATTGGAATAGATGATCGTGTGAAAGACATAAACAAGTGGTTAAGAGATGGATCAACTGATGTTGGTGTAGCTGGGATTTATGGAATGGGTGGGAT
>augustus_masked-Fvb2-2-processed-gene-74.14:329:449:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-74.14:329-449||RAPiDGENOMICS_rs1205_00607
GTGGTTAAGAGATGGATCAACTGATGTTGGTGTAGCTGGGATTTATGGAATGGGTGGGATTGGCAAAACCACCATTGCAAAAGCTGCCTATAACATGAACTTCGCTAACTTTCAAGGAAG
>augustus_masked-Fvb2-2-processed-gene-74.14:449:569:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-74.14:449-569||RAPiDGENOMICS_rs1205_00608
TAGCTTTCTTGCAGATATTAGAGCAACTTCCAAACACCCTAATGGTTTGGTTCGCTTGCAAACGCAACTTTTATCGGATATCCAGAAGCGGAAGCCAAAGAAGATATACAATGTTGATGA
>augustus_masked-Fvb2-2-processed-gene-74.14:509:629:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-74.14:509-629|2x||RAPiDGENOMICS_rs1205_00609
AACGCAACTTTTATCGGATATCCAGAAGCGGAAGCCAAAGAAGATATACAATGTTGATGAAGGAAAGAGCCGGATCAAGCAATTTGTACGTTCCAAAAGAGTTCTTATTGTTCTTGATGA
>augustus_masked-Fvb2-2-processed-gene-74.14:569:689:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-74.14:569-689||RAPiDGENOMICS_rs1205_00610
AGGAAAGAGCCGGATCAAGCAATTTGTACGTTCCAAAAGAGTTCTTATTGTTCTTGATGATGTAGAGGATTCAGACCAATTTAGTGCAATTCTTGAAATGCGAGAATCTTTTGGTCACGG
>augustus_masked-Fvb2-2-processed-gene-74.14:60:180:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-74.14:60-180|2x||RAPiDGENOMICS_rs1205_00611
TCCCATGTTGGGAAGCAGACTGAAACTTTCGGAAAAGCCTTTGCCAAACTGGTTGAAGAGCGTTTCAAGGATGAGATTGGCAAGGTGGAAGAGTGGAGAAGATCTCTGAGAGATGTTTCC
>augustus_masked-Fvb2-2-processed-gene-74.14:809:929:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-74.14:809-929||RAPiDGENOMICS_rs1205_00612
TTTTAGACAAGCCCATCCTATCAAAAGCTACACGGAGCTTTCTACAGCTGCAGTACAACATTGTGGAGGTCTTCCGTTAGCTATTCAAGTTTTGGGGTCTTCTCTGTTTGGACTGGATGT
>augustus_masked-Fvb2-2-processed-gene-74.14:869:989:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-74.14:869-989|2x||RAPiDGENOMICS_rs1205_00613
TTGTGGAGGTCTTCCGTTAGCTATTCAAGTTTTGGGGTCTTCTCTGTTTGGACTGGATGTGGATCTTTGGAAAGAGGCAATTGCAAAATTGGACGTGTTTCTTGATGAAAAAGTTCAGGA
>augustus_masked-Fvb2-2-processed-gene-74.14:929:1049:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_7::augustus_masked-Fvb2-2-processed-gene-74.14:929-1049||RAPiDGENOMICS_rs1205_00614
GGATCTTTGGAAAGAGGCAATTGCAAAATTGGACGTGTTTCTTGATGAAAAAGTTCAGGAAGTTCTAAGAGTAAGCTATTATGGTACTCGACTAGATCCTCATGACCAAAGTTTATTCCT
>augustus_masked-Fvb2-2-processed-gene-74.14:989:1109:Parent=augustus_masked-Fvb2-2-processed-gene-74.14-mRNA-1_7::augustus_masked-Fvb2-2-processed-gene-74.14:989-1109|2x||RAPiDGENOMICS_rs1205_00615
AGTTCTAAGAGTAAGCTATTATGGTACTCGACTAGATCCTCATGACCAAAGTTTATTCCTTCATATAGCATGTTTTTTCATAGGAAGGGAGAAAGAGTTTACAATTACAGTACTGAGCAA
>augustus_masked-Fvb2-2-processed-gene-81.10:120:240:Parent=augustus_masked-Fvb2-2-processed-gene-81.10-mRNA-1_2::augustus_masked-Fvb2-2-processed-gene-81.10:120-240||RAPiDGENOMICS_rs1205_00616
CAAGGTAACTCTCAAAGCTTGTTGTTAACTTCATGGAACACTTCTGTGCCTCTGTGCCAATGGAGAGGCCTGAAATGGGTTTTCTCCAACGGCTCTGTTTTGCCTTGCAATGACATGTCC
>augustus_masked-Fvb2-2-processed-gene-81.10:1200:1320:Parent=augustus_masked-Fvb2-2-processed-gene-81.10-mRNA-1_11::augustus_masked-Fvb2-2-processed-gene-81.10:1200-1320||RAPiDGENOMICS_rs1205_00617
TTGAGGGAAGGTAGTTGCAAAGATGGGAGCTTGTGTGTGCCTGTAATAAAGCAATTGGGCCGCATTCGCCATGAGAATTTGATTCCATTGAGAGCTTTCTATCAGGGGAAGCGAGGGGAG
>augustus_masked-Fvb2-2-processed-gene-81.10:1615:1735:Parent=augustus_masked-Fvb2-2-processed-gene-81.10-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-81.10:1615-1735||RAPiDGENOMICS_rs1205_00618
GTTACAAGGCACCGGAGCTTCAAAAGATGAAGAAATGCAATTCTCGGACGGATGTGTATGCATTTGGGATTTTGCTATTGGAAATTCTGATAGGCAAGAAGCCTGGTAAAAGTGGAAGGA
>augustus_masked-Fvb2-2-processed-gene-81.10:1735:1855:Parent=augustus_masked-Fvb2-2-processed-gene-81.10-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-81.10:1735-1855||RAPiDGENOMICS_rs1205_00619
GTGGCGAATTCGTGGATTTGCCTTCACTGGTCAAAGTGGCAGTTCTGGAGGAGACAACATTGGAGGTTTTTGATGTGGAGGTATTGAAGGGAATAAGGAATCCCATGGAAGAAGGTTTGG
>augustus_masked-Fvb2-2-processed-gene-81.10:1855:1975:Parent=augustus_masked-Fvb2-2-processed-gene-81.10-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-81.10:1855-1975||RAPiDGENOMICS_rs1205_00620
TTCAGGCATTGAAACTTGCAATGGGTTGCTGCGCTCCAGTTGCTTCGGTTAGACCCTCCATGGATGAAGTTGTGAAGCAGTTGGAAGAGAACAGACCAAGGAATAGGTCTGCTTTGTACA
>augustus_masked-Fvb2-2-processed-gene-81.10:240:360:Parent=augustus_masked-Fvb2-2-processed-gene-81.10-mRNA-1_3::augustus_masked-Fvb2-2-processed-gene-81.10:240-360||RAPiDGENOMICS_rs1205_00621
TCACCCCATTGGACCAATCTTTCTCTCTCCAGAGACCCAAGTCTCCACCTTTACTCTCTTCAGCTCCCCTCTGCTAATCTCTCTGGTTCACTACCCAGAGAAATAGGGGAGTTTTCTATG
>augustus_masked-Fvb2-2-processed-gene-81.10:360:480:Parent=augustus_masked-Fvb2-2-processed-gene-81.10-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-81.10:360-480||RAPiDGENOMICS_rs1205_00622
CTTAGAAGCTTGTACCTTAATGTCAATTCATTGAGTGGGACCATCCCACTTGAGCTTGGTTATAGCTCTTCACTTTCTGAAATTGATTTGGGGAGCAATTTGTTCACTGGGGCTTTAGCT
>augustus_masked-Fvb2-2-processed-gene-81.10:480:600:Parent=augustus_masked-Fvb2-2-processed-gene-81.10-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-81.10:480-600||RAPiDGENOMICS_rs1205_00623
CCATCTGTGTGGAACTTGTGTGAGAATCTTGTCTCGCTTCGGCTTCATGCTAATTTGTTAACTGGGCCTGTTCCTGAGCCTGCATTGCCCAATTCTACCTGCAAAGATTTGCAGGTTCTT
>augustus_masked-Fvb2-2-processed-gene-81.10:600:720:Parent=augustus_masked-Fvb2-2-processed-gene-81.10-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-81.10:600-720||RAPiDGENOMICS_rs1205_00624
GATTTGGGTGACAACAAGTTTTCAGGGAACTTTCCTGAATTTGTGACCCAGTTTGGTGGGCTTAAGGAGCTTGATCTTGGGAAAAACATGATTTCGGGTCCGATTCCTGTGAGTTTGGGT
>augustus_masked-Fvb2-2-processed-gene-81.10:660:780:Parent=augustus_masked-Fvb2-2-processed-gene-81.10-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-81.10:660-780|2x||RAPiDGENOMICS_rs1205_00625
CTTAAGGAGCTTGATCTTGGGAAAAACATGATTTCGGGTCCGATTCCTGTGAGTTTGGGTAAGCTGGAACTTGACAAGTTGAACCTTTCACACAATAATTTTAGTGGGGTGTTGCCAGTT
>augustus_masked-Fvb2-2-processed-gene-81.10:720:840:Parent=augustus_masked-Fvb2-2-processed-gene-81.10-mRNA-1_7::augustus_masked-Fvb2-2-processed-gene-81.10:720-840||RAPiDGENOMICS_rs1205_00626
AAGCTGGAACTTGACAAGTTGAACCTTTCACACAATAATTTTAGTGGGGTGTTGCCAGTTTTTGGAGGATCAAAGTTTGGTGTGGAGGCTTTTGAGGGGAACAACCCTGGACTTTGTGGG
>augustus_masked-Fvb2-2-processed-gene-81.10:960:1080:Parent=augustus_masked-Fvb2-2-processed-gene-81.10-mRNA-1_9::augustus_masked-Fvb2-2-processed-gene-81.10:960-1080||RAPiDGENOMICS_rs1205_00627
CACAAGAAGAAGAACAGCAGCGCGGAGAGTGATTATGAGTTGGAGGAAGGAGACGATGAAGAAAATGGGGGTCTTGGTGATGGTGGTGGTGATCAGGGAAGGCTTATATTGTTTCAGGGT
>augustus_masked-Fvb2-2-processed-gene-94.4:0:120:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_1::augustus_masked-Fvb2-2-processed-gene-94.4:0-120||RAPiDGENOMICS_rs1205_00628
ATGGAGTTTGCCACTAGCATTGCTGAGAATGTCCTGGGAGGGCTAGCTTCCTATGCTTCCCAAGAGGTCTCTTTGGCATGGGGTGCCCAACTTGAGCTCACAAAGCTCACGAAGACTTTA
>augustus_masked-Fvb2-2-processed-gene-94.4:1020:1140:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_9::augustus_masked-Fvb2-2-processed-gene-94.4:1020-1140|2x||RAPiDGENOMICS_rs1205_00629
CCCCAAAAAGACTGCATGTCCTTGTTCATCAAAAGGGCATTCAAGAAAGCAGAGGAGCAACGCTGTCCACGCTTGATAGAAATTGGAGAGGATATTGTGAACAAGTGTGGAGAAGTTCCT
>augustus_masked-Fvb2-2-processed-gene-94.4:1080:1200:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_10::augustus_masked-Fvb2-2-processed-gene-94.4:1080-1200||RAPiDGENOMICS_rs1205_00630
CGCTGTCCACGCTTGATAGAAATTGGAGAGGATATTGTGAACAAGTGTGGAGAAGTTCCTTTAGCTGTAGCAACTCTAGGGAGCATGCTCTATTTCAACAGAGAGCCACACCGATGGCTG
>augustus_masked-Fvb2-2-processed-gene-94.4:1140:1260:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_10::augustus_masked-Fvb2-2-processed-gene-94.4:1140-1260|2x||RAPiDGENOMICS_rs1205_00631
TTAGCTGTAGCAACTCTAGGGAGCATGCTCTATTTCAACAGAGAGCCACACCGATGGCTGAGTGTGAGAGATGATGACATGTGGAGTATAGGAAATGATTATATTCTACCTACACTCAAA
>augustus_masked-Fvb2-2-processed-gene-94.4:1260:1380:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_11::augustus_masked-Fvb2-2-processed-gene-94.4:1260-1380|2x||RAPiDGENOMICS_rs1205_00632
TTGAGCTATGATGCATTGCCACAACACTTGAAACCATGTTTTGCATTTTGTTCACTTTTCCCAAAGGATTTTGAATTCCATAGTGACTTTCTGGTTTACCTGTGGGTAGCACAAGGGTAC
>augustus_masked-Fvb2-2-processed-gene-94.4:360:480:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-94.4:360-480||RAPiDGENOMICS_rs1205_00633
AAAGTGAAAGAAATTAGAGAGCGACTAACTGAAATTGAGAAAGATAAGACTGAGTTTGATCTCGTTGAGATGACCAAGATAGCTGATGATCATAGTGTGCCCCAAGGGATGCAATACAAT
>augustus_masked-Fvb2-2-processed-gene-94.4:420:540:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_4::augustus_masked-Fvb2-2-processed-gene-94.4:420-540|2x||RAPiDGENOMICS_rs1205_00634
CTCGTTGAGATGACCAAGATAGCTGATGATCATAGTGTGCCCCAAGGGATGCAATACAATCAAAGAGAAACTGATTCTTTGGTAGAGGCTTCAAGAGTTATTGGGAGAGATGATGATAAA
>augustus_masked-Fvb2-2-processed-gene-94.4:540:660:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_5::augustus_masked-Fvb2-2-processed-gene-94.4:540-660|2x||RAPiDGENOMICS_rs1205_00635
GAGCTAATTTTTAGTCATCTCTTACATAACACTGATATCTCTAATGAGGATAATGTTTCTGTTATTTCAATCCTTGGGATGGGGGGATTGGGTAAGACAACTCTGGCTAAATTGGTGTAC
>augustus_masked-Fvb2-2-processed-gene-94.4:600:720:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-94.4:600-720||RAPiDGENOMICS_rs1205_00636
GTTATTTCAATCCTTGGGATGGGGGGATTGGGTAAGACAACTCTGGCTAAATTGGTGTACAATGATAGCGTGGTAGAGGAGAATTTTGAGGTCAAAATGTGGGTATGTGTCCCAGAAAAC
>augustus_masked-Fvb2-2-processed-gene-94.4:660:780:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_6::augustus_masked-Fvb2-2-processed-gene-94.4:660-780|2x||RAPiDGENOMICS_rs1205_00637
AATGATAGCGTGGTAGAGGAGAATTTTGAGGTCAAAATGTGGGTATGTGTCCCAGAAAACTTTGAAGTCAAATCATTAATTCTCAAGAATATCAATGCTACAACTGATCAAAAATGTGAG
>augustus_masked-Fvb2-2-processed-gene-94.4:720:840:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_7::augustus_masked-Fvb2-2-processed-gene-94.4:720-840||RAPiDGENOMICS_rs1205_00638
TTTGAAGTCAAATCATTAATTCTCAAGAATATCAATGCTACAACTGATCAAAAATGTGAGGATGAAAGTTTGGACCGTATGAAAAGAAGTTTGCAAGATACTTTGAGAGGTACAAAGTTT
>augustus_masked-Fvb2-2-processed-gene-94.4:780:900:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_7::augustus_masked-Fvb2-2-processed-gene-94.4:780-900|2x||RAPiDGENOMICS_rs1205_00639
GATGAAAGTTTGGACCGTATGAAAAGAAGTTTGCAAGATACTTTGAGAGGTACAAAGTTTTTGTTAGTGTTAGATGATGTTTGGGATACGGAGTCTATTGGAGTAACACCAGAAAAATGG
>augustus_masked-Fvb2-2-processed-gene-94.4:960:1080:Parent=augustus_masked-Fvb2-2-processed-gene-94.4-mRNA-1_9::augustus_masked-Fvb2-2-processed-gene-94.4:960-1080||RAPiDGENOMICS_rs1205_00640
CAAAATAGATCAGTTGCTTTACTTGTGAATCCTTCATACATGCATTCTTTGAAAGGTCTTCCCCAAAAAGACTGCATGTCCTTGTTCATCAAAAGGGCATTCAAGAAAGCAGAGGAGCAA
>augustus_masked-Fvb2-3-processed-gene-111.14:1080:1200:Parent=augustus_masked-Fvb2-3-processed-gene-111.14-mRNA-1_10::augustus_masked-Fvb2-3-processed-gene-111.14:1080-1200||RAPiDGENOMICS_rs1205_00641
GAATCTGTGAATGAGATTAATCTGGAGAACAATAGCTTGAGTGGGAGGGTCTCATTTTCTTCAGCTAAATTTGGGCACAGGATGAAGTTGTATGGAAACCCAGAGCTTTGTGTTGACGAT
>augustus_masked-Fvb2-3-processed-gene-111.14:240:360:Parent=augustus_masked-Fvb2-3-processed-gene-111.14-mRNA-1_3::augustus_masked-Fvb2-3-processed-gene-111.14:240-360||RAPiDGENOMICS_rs1205_00642
GTCTCCGAGCTCAGCTTCGGCTACGTCTCCGACTTCACCTCCAACCCGCCCTGCTCCTCCTCCGCCTTCTTCAGCCCTCTCCTCTTCTCCGCCTTCCCTTTCCTCCGCAAGCTCTTCTTC
>augustus_masked-Fvb2-3-processed-gene-111.14:480:600:Parent=augustus_masked-Fvb2-3-processed-gene-111.14-mRNA-1_5::augustus_masked-Fvb2-3-processed-gene-111.14:480-600||RAPiDGENOMICS_rs1205_00643
GGCGTTCTACGTAATTTCACCAACTTGAGGAGGGCAGTTCTCACTGGGAACGGGTTCTACGGCAACGTACCGTACTCCGTTGCCGATATGGTCAACCTGGAAGAGCTGACTCTCGCCAGA
>augustus_masked-Fvb2-3-processed-gene-111.14:720:840:Parent=augustus_masked-Fvb2-3-processed-gene-111.14-mRNA-1_7::augustus_masked-Fvb2-3-processed-gene-111.14:720-840||RAPiDGENOMICS_rs1205_00644
CTGTTGAAGCTGGACCTGAGCTCGAATGGGTTTTCCGGCGAAATCCCGGCGATCATTAGAAACCTGCGGAGGCTGGAGCTGTTGGACCTGAGCTACAACCGGTTCAACAACTCCGGCGTG
>augustus_masked-Fvb2-3-processed-gene-195.0:0:120:Parent=augustus_masked-Fvb2-3-processed-gene-195.0-mRNA-1_1::augustus_masked-Fvb2-3-processed-gene-195.0:0-120||RAPiDGENOMICS_rs1205_00645
ATGTCGCACCTTAACTTCCTCCTCCTCCTCCTTCAGTTTTCTCTGTTCTTCATCAACCATGTCCAAGCCCTCACTTCCCCTTCAGACATCTCAGCTCTCAAGGCCTTCAAAGCCTCAATC
>augustus_masked-Fvb2-3-processed-gene-195.0:120:240:Parent=augustus_masked-Fvb2-3-processed-gene-195.0-mRNA-1_2::augustus_masked-Fvb2-3-processed-gene-195.0:120-240||RAPiDGENOMICS_rs1205_00646
CAACCCTCCTCCATTCCCTCCTGGTCTTGCCTAGCCTCATGGGACTTCACCTCCGACCCATGCACCCTCCCTCACCGAATCCACTTCACCTGCGGCGTCACCTGCTCACCTGACTCCACC
>augustus_masked-Fvb2-3-processed-gene-195.0:300:420:Parent=augustus_masked-Fvb2-3-processed-gene-195.0-mRNA-1_3::augustus_masked-Fvb2-3-processed-gene-195.0:300-420|2x||RAPiDGENOMICS_rs1205_00647
TCTCAGCTCACCCATCTCTCCACTCTCGACCTCTCCGAAAACTCCTTCTTCGGCCCAATCCCATCCTCCATTTCCTCCCTCTCTTACCTCCAAATCCTGACCCTCCGATCCAACTCCTTC
>augustus_masked-Fvb2-3-processed-gene-195.0:360:480:Parent=augustus_masked-Fvb2-3-processed-gene-195.0-mRNA-1_4::augustus_masked-Fvb2-3-processed-gene-195.0:360-480||RAPiDGENOMICS_rs1205_00648
CCATCCTCCATTTCCTCCCTCTCTTACCTCCAAATCCTGACCCTCCGATCCAACTCCTTCTCCGGCTCTCTCACTCCCTCCATCACCAAGCTCAAGTCTTTAGAATCTCTAGACATTTCC
>augustus_masked-Fvb2-3-processed-gene-195.0:600:720:Parent=augustus_masked-Fvb2-3-processed-gene-195.0-mRNA-1_6::augustus_masked-Fvb2-3-processed-gene-195.0:600-720||RAPiDGENOMICS_rs1205_00649
GAACTCGCCCTCAAAAGCAACTCGCTATCCGGGCCCTTGTCGAAATCGTCCTTCGACGGATTGTCTCAGCTGGAGGTGGTCGAGCTCAGCCAGAACTCGTTCTCCAATACGTTACAGTCA
>augustus_masked-Fvb2-3-processed-gene-195.0:840:960:Parent=augustus_masked-Fvb2-3-processed-gene-195.0-mRNA-1_8::augustus_masked-Fvb2-3-processed-gene-195.0:840-960||RAPiDGENOMICS_rs1205_00650
TTCAACAGAATCGAAGGCTACGCGCCCGCGAACTTCGCGGCATTTCCGAGGCTGTCGTCGCTGTCGGTTCGTTACAACAGGCTACGTGGCAAGATCCCAGTAGAGTACGGGAAGAACAAG
>augustus_masked-Fvb2-3-processed-gene-195.0:960:1080:Parent=augustus_masked-Fvb2-3-processed-gene-195.0-mRNA-1_9::augustus_masked-Fvb2-3-processed-gene-195.0:960-1080||RAPiDGENOMICS_rs1205_00651
TCGTTGAAGCGGTTGTACTTAGATGGTAACTTTCTGAACGGGCAACCACCGCCGGCGTTGTTAACCGGAAGTTCGGGAATCTCCGGCAGCTTGGGGGATAATTGTCTACAGGGGTGTCCG
>augustus_masked-Fvb2-3-processed-gene-234.6:180:300:Parent=augustus_masked-Fvb2-3-processed-gene-234.6-mRNA-1_2::augustus_masked-Fvb2-3-processed-gene-234.6:180-300|2x||RAPiDGENOMICS_rs1205_00652
GGCGTACAATGCGACAACAACCGCGTCACACAGCTGTCCGTCACCGGCCAACCCGACAAGCCCAACTCCTTTTTATCCGGTACAATCTCTCCCTCCCTCTCAAAGCTCACATTCCTCAAC
>augustus_masked-Fvb2-3-processed-gene-234.6:360:480:Parent=augustus_masked-Fvb2-3-processed-gene-234.6-mRNA-1_4::augustus_masked-Fvb2-3-processed-gene-234.6:360-480||RAPiDGENOMICS_rs1205_00653
CTCCCCAATCTCAAGTACGTGTACATCGAAAACAGCAAGCTCTCGGGTCGGATACCCGCTTCCATCGGCAACTTGACCCAACTCGATGCACTCAGCTTTTACTTCAACCGGTTCACCGGT
>augustus_masked-Fvb2-3-processed-gene-234.6:540:660:Parent=augustus_masked-Fvb2-3-processed-gene-234.6-mRNA-1_5::augustus_masked-Fvb2-3-processed-gene-234.6:540-660|2x||RAPiDGENOMICS_rs1205_00654
ATTTTAACCGGGTCGATCCCAAACGGCATCAAAAACCTCAACAAGCTCACATTTTTGACTCTCGAGCGAAACGGGTTGTCGGGTCCCATTCCCGACTTCTTCGCCTCATTTCCCGAGCTC
>augustus_masked-Fvb2-3-processed-gene-234.6:600:720:Parent=augustus_masked-Fvb2-3-processed-gene-234.6-mRNA-1_6::augustus_masked-Fvb2-3-processed-gene-234.6:600-720||RAPiDGENOMICS_rs1205_00655
CTCGAGCGAAACGGGTTGTCGGGTCCCATTCCCGACTTCTTCGCCTCATTTCCCGAGCTCCGAATTCTCAGGCTTTCCCGCAATAAATTTACCGGGAAAATCCCAGCTTCAATCTCTGCT
>augustus_masked-Fvb2-3-processed-gene-234.6:720:840:Parent=augustus_masked-Fvb2-3-processed-gene-234.6-mRNA-1_7::augustus_masked-Fvb2-3-processed-gene-234.6:720-840||RAPiDGENOMICS_rs1205_00656
TTGGCGCCAAAATTGATCTACCTTGAGCTTGGCCGCAATGCATTGACCGGTCAAGTCCCAGCGTTTCTAGGAAACTTCAAGACCCTCGACACACTTGATCTTGGTCACAATATGTTAACA
>augustus_masked-Fvb2-3-processed-gene-36.12:1080:1200:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_10::augustus_masked-Fvb2-3-processed-gene-36.12:1080-1200||RAPiDGENOMICS_rs1205_00657
CTTTTTCGGTTGGAGGAGCTTCGGGTGGGTAATAATTCTCTGATTGGTGAAATTCCTGATCAGATTGCGAAATGCAGCTTGTTACAGGCTCTTGATCTTGAAGGTAACCGCTTTGTGGGT
>augustus_masked-Fvb2-3-processed-gene-36.12:1200:1320:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_11::augustus_masked-Fvb2-3-processed-gene-36.12:1200-1320||RAPiDGENOMICS_rs1205_00658
CAGTTTCCGTTGTTTTTGGGAGGGATGAAGAGCTTGAAGGTGTTGTCTTTGGGTGGGAATTTGATCTCGGGTACCATCCCTTCGAGTTTGGGGTCACTTTTGGGGCTGGAGTCGTTGAAT
>augustus_masked-Fvb2-3-processed-gene-36.12:1260:1380:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_11::augustus_masked-Fvb2-3-processed-gene-36.12:1260-1380|2x||RAPiDGENOMICS_rs1205_00659
TTGATCTCGGGTACCATCCCTTCGAGTTTGGGGTCACTTTTGGGGCTGGAGTCGTTGAATCTGAGCGGTAATAATCTGACAGGGGAAGTTCCGGTTGAGGTCATGCAGCTAGGCAACTTG
>augustus_masked-Fvb2-3-processed-gene-36.12:1380:1500:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_12::augustus_masked-Fvb2-3-processed-gene-36.12:1380-1500|2x||RAPiDGENOMICS_rs1205_00660
ACTAGCTTGAACTTGAGTAATAACAAGTTTTCGGGTGAGGTTCTTGGGAATGTAGGAGCATTGAGGAGTTTGCAGGTTTTGAATGTGAGCAATTGTGGGCTTTCGGGTAGCGTCCCTGCG
>augustus_masked-Fvb2-3-processed-gene-36.12:1500:1620:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_13::augustus_masked-Fvb2-3-processed-gene-36.12:1500-1620|2x||RAPiDGENOMICS_rs1205_00661
AGTATTGGAGGTTTGATGAGGCTTGCTACGCTGGATTTGAGTAAACAAAAGCTTTCTGGCGAGTTGCCTACTGAGGTTTTTGGGCTGCCAAATTTACAAGTGGTTGCCTTGCAAGAGAAT
>augustus_masked-Fvb2-3-processed-gene-36.12:1620:1740:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_14::augustus_masked-Fvb2-3-processed-gene-36.12:1620-1740|2x||RAPiDGENOMICS_rs1205_00662
CAGTTGTCTGGGGATGTTCCTCAAGGTTTTAGTAGCTTGACTGGTTTAATCTACCTAAATCTCTCCTCCAATGCCTTCACTGGTGTTATTCCATCCACTTATGGATATCTACGGTCACTG
>augustus_masked-Fvb2-3-processed-gene-36.12:1680:1800:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_15::augustus_masked-Fvb2-3-processed-gene-36.12:1680-1800||RAPiDGENOMICS_rs1205_00663
CTCTCCTCCAATGCCTTCACTGGTGTTATTCCATCCACTTATGGATATCTACGGTCACTGACTGTTCTATCTTTGTCAAAGAATCGCATTTCCGGTGTGATCCCACCAGAGCTTGGAGAT
>augustus_masked-Fvb2-3-processed-gene-36.12:1860:1980:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_16::augustus_masked-Fvb2-3-processed-gene-36.12:1860-1980|2x||RAPiDGENOMICS_rs1205_00664
GATGTCTCTCGGCTGTCTAGTTTGGAAGAGCTGGATTTAGATCATAATAAACTGACAGGTGAAATACCGGAGGAAATTTCCAAATGCTCTGCTCTGACTTCATTATTGTTAGAGGGTAAT
>augustus_masked-Fvb2-3-processed-gene-36.12:1980:2100:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_17::augustus_masked-Fvb2-3-processed-gene-36.12:1980-2100|2x||RAPiDGENOMICS_rs1205_00665
CTACTTTCAGGTCCAATACCAAACTCCTTGCCTTTGTTATCGAACCTTGTGGTGTTAGATCTTTCCTCAAACCAGTTGAGTGGATCGATCCCGGAAAATATTTCACTCATTCCTCACTTG
>augustus_masked-Fvb2-3-processed-gene-36.12:2040:2160:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_18::augustus_masked-Fvb2-3-processed-gene-36.12:2040-2160||RAPiDGENOMICS_rs1205_00666
CTTTCCTCAAACCAGTTGAGTGGATCGATCCCGGAAAATATTTCACTCATTCCTCACTTGAAGTCCTTGAATTTGTCTGACAACAACCTATCTGGTAAGATTCCAGACCCATTGGGTTCT
>augustus_masked-Fvb2-3-processed-gene-36.12:2100:2220:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_18::augustus_masked-Fvb2-3-processed-gene-36.12:2100-2220|2x||RAPiDGENOMICS_rs1205_00667
AAGTCCTTGAATTTGTCTGACAACAACCTATCTGGTAAGATTCCAGACCCATTGGGTTCTAAATTCAGTGGTTCTGTCTTCGCGAGGAACCCGAGTTTATGTGGGAAACCATTGGACAGA
>augustus_masked-Fvb2-3-processed-gene-36.12:2160:2280:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_19::augustus_masked-Fvb2-3-processed-gene-36.12:2160-2280||RAPiDGENOMICS_rs1205_00668
AAATTCAGTGGTTCTGTCTTCGCGAGGAACCCGAGTTTATGTGGGAAACCATTGGACAGAGAATGTGGAGATGCAAAACGGAGAAGGAGAAACAGGTTGATTTTATTAATTGCGGTGGCT
>augustus_masked-Fvb2-3-processed-gene-36.12:2280:2400:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_20::augustus_masked-Fvb2-3-processed-gene-36.12:2280-2400||RAPiDGENOMICS_rs1205_00669
GCTGGTGGAGCTTTGCTTCTGTTATTGTGTTGTTGTGGCTATGTTTACAGCCTCTTCCGCTGGCGTAAGAAGCTTCGAGAAATGGTAACTGGGGAGAAGAAGCGCCCCAGTCCAGGTAGT
>augustus_masked-Fvb2-3-processed-gene-36.12:240:360:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_3::augustus_masked-Fvb2-3-processed-gene-36.12:240-360||RAPiDGENOMICS_rs1205_00670
GCCGGCCGACTCTCCGACGAGCTCTCCGCCCTCCGTGACCTCCGGAAGCTCAGCCTCCACACAAACAACTTCAGCGGCTCCATCCCTCCCTCTCTCTCCCAATGCGTGTTGCTACGCGCC
>augustus_masked-Fvb2-3-processed-gene-36.12:2400:2520:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_21::augustus_masked-Fvb2-3-processed-gene-36.12:2400-2520||RAPiDGENOMICS_rs1205_00671
GCAAGTTCAGGCGGAGAGAGATCTGGTCGCGGAAGTGGAGACAATGGAGGTCCAAAACTCGTTATGTTCAATAACAAGATTACATTTGCAGAGGCACTAGAAGCAACAAGACAATTTGAT
>augustus_masked-Fvb2-3-processed-gene-36.12:2520:2640:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_22::augustus_masked-Fvb2-3-processed-gene-36.12:2520-2640||RAPiDGENOMICS_rs1205_00672
GAGGAAAATGTGTTGAGCAGGGGAAAGTATGGATTGGTATTCAAGGCTTCATTCCAAGATGGAATGGTGCTCTCAATTCGACGCCTTCCTGCTTCTTCTCTTGGTGTGCTCGATGAAGAG
>augustus_masked-Fvb2-3-processed-gene-36.12:2760:2880:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_24::augustus_masked-Fvb2-3-processed-gene-36.12:2760-2880||RAPiDGENOMICS_rs1205_00673
AACTTGGCCACTCTGCTCCAAGAGGCTTCTCACCAAGATGGTCATGTACTAAATTGGCCAATGCGGCATCTCATTGCACTCGGCATTGCTAGAGGAATAGCTTTCCTCCACTCAGTCTCA
>augustus_masked-Fvb2-3-processed-gene-36.12:3000:3120:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_26::augustus_masked-Fvb2-3-processed-gene-36.12:3000-3120||RAPiDGENOMICS_rs1205_00674
TCCACCACAGTTGGTACATTAGGCTATGTGTCACCAGAAGCAATACTAACCGGGCAAGCAACAAGAGAAGCGGATGTGTACAGTTTTGGAATTGTTCTGTTGGAAATCCTCACCGGAAAG
>augustus_masked-Fvb2-3-processed-gene-36.12:420:540:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_4::augustus_masked-Fvb2-3-processed-gene-36.12:420-540|2x||RAPiDGENOMICS_rs1205_00675
AACCTCCAAATCCTCGCCCTTTCTCACAACTCCCTCTCCGGAAAAATCTCCGGCGACATTCCGGCGAGCCTCCGGTACCTTGATCTTTCTTATAATGCATTCACCGGTGACATTCCGGTC
>augustus_masked-Fvb2-3-processed-gene-36.12:480:600:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_5::augustus_masked-Fvb2-3-processed-gene-36.12:480-600||RAPiDGENOMICS_rs1205_00676
CCGGCGAGCCTCCGGTACCTTGATCTTTCTTATAATGCATTCACCGGTGACATTCCGGTCAACTTCTCCGCCGACTCGCGGCTCCAGTTCATCAATTTCTCCTTCAACCAGTTCACCGGC
>augustus_masked-Fvb2-3-processed-gene-36.12:600:720:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_6::augustus_masked-Fvb2-3-processed-gene-36.12:600-720||RAPiDGENOMICS_rs1205_00677
GGCGTTCCGGCGACCATCGGCCGGCTCCAGACGCTTCAGTATCTCTGGCTGGACTCGAACCGGTTAACCGGTACGATCCCTTCTGCTATCTCCAACTGCTCCTCCCTCATACATTTCAGC
>augustus_masked-Fvb2-3-processed-gene-36.12:840:960:Parent=augustus_masked-Fvb2-3-processed-gene-36.12-mRNA-1_8::augustus_masked-Fvb2-3-processed-gene-36.12:840-960||RAPiDGENOMICS_rs1205_00678
AATGGGAATGATGACTCTTCTTCTTCTTCACTGAGGATAGTGGATCTAGGGTTCAATGCGCTCACGGGAATTGTGCCGCCGCAAAATGCAAGGTGTTCAAGTATCTTGGAGGTTCTGGTT
>augustus_masked-Fvb2-3-processed-gene-70.7:0:120:Parent=augustus_masked-Fvb2-3-processed-gene-70.7-mRNA-1_1::augustus_masked-Fvb2-3-processed-gene-70.7:0-120||RAPiDGENOMICS_rs1205_00679
ATGCTGCAAAACCACACCCTCCTCTCCACCTTCTTCTTCTTCACACTCTTATGTCTTTCTCTCTCCAACCCAACCCCAAAGGACACTCTTCCCTTGCTCGCATTCAAAGCCTCGTCGGAC
>augustus_masked-Fvb2-3-processed-gene-70.7:120:240:Parent=augustus_masked-Fvb2-3-processed-gene-70.7-mRNA-1_2::augustus_masked-Fvb2-3-processed-gene-70.7:120-240||RAPiDGENOMICS_rs1205_00680
CGCTCCAACTCCCTCGCTACGTGGGCCGAATCCACCGATCCCTGTGCCGGGTCATGGCTCGGCGTCACCTGCGACCCGAAAACCTGTCGGGTCACCAAGCTTGTCCTCGAGAATCTCAAC
>augustus_masked-Fvb2-3-processed-gene-70.7:1200:1320:Parent=augustus_masked-Fvb2-3-processed-gene-70.7-mRNA-1_11::augustus_masked-Fvb2-3-processed-gene-70.7:1200-1320||RAPiDGENOMICS_rs1205_00681
GGCGAGTTGAAGCACGCCAACATTGCGAGGCTGAGAGCTTACCACAGCTCCAACTACGAGCTTCTCTTGGTGTGTGATTTTTATGCCAATGGAAGCCTCCATTCTCTTCTGCACGGGTTT
>augustus_masked-Fvb2-3-processed-gene-70.7:1320:1440:Parent=augustus_masked-Fvb2-3-processed-gene-70.7-mRNA-1_12::augustus_masked-Fvb2-3-processed-gene-70.7:1320-1440||RAPiDGENOMICS_rs1205_00682
CGAGGACAGGGGAGGGCGCGGTTGGATTGGAGCACAAGGCTGAAGCTAGCATTGGGCTGTGCCGAAGGACTAGCCTTCATCCACGGCTCCGGCAAGGGGAAGATGTACCATGGTAACCTC
>augustus_masked-Fvb2-3-processed-gene-70.7:1680:1800:Parent=augustus_masked-Fvb2-3-processed-gene-70.7-mRNA-1_15::augustus_masked-Fvb2-3-processed-gene-70.7:1680-1800||RAPiDGENOMICS_rs1205_00683
GTGGAGTGGGTTAACTTGGCTGTGAAGAAAGAGTGCGGTACATGGGAGGTTTTTGATTTCGAGCTGTCAAGTGACAAGGAGATGGAGGAGGAAATGTGGGCGCTTTTCCAGGTTGGTTTG
>augustus_masked-Fvb2-3-processed-gene-70.7:480:600:Parent=augustus_masked-Fvb2-3-processed-gene-70.7-mRNA-1_5::augustus_masked-Fvb2-3-processed-gene-70.7:480-600||RAPiDGENOMICS_rs1205_00684
CGGCTGTCTAAGCTGTTAACTCTACGGCTCGAGTTCAACTCGCTCACTCGCTTCGGCGATGCGTCGTCTGCTCTGTTCGCCGATTTCAATGTCTCCAACAACGACCTAGCCGGAAAAATC
>augustus_masked-Fvb2-3-processed-gene-70.7:720:840:Parent=augustus_masked-Fvb2-3-processed-gene-70.7-mRNA-1_7::augustus_masked-Fvb2-3-processed-gene-70.7:720-840||RAPiDGENOMICS_rs1205_00685
CCACCGGAAGGCAAGCACCACTCGGAACACGTCGTTCTGATCAGCGTCAGCGTCGCGCTTGGGCTCATGGTGATCGCCGGCGCCGTCGCACGGTGGCGGAAGTGGAAGAAGAAGAGCAGC
>augustus_masked-Fvb2-3-processed-gene-70.7:840:960:Parent=augustus_masked-Fvb2-3-processed-gene-70.7-mRNA-1_8::augustus_masked-Fvb2-3-processed-gene-70.7:840-960||RAPiDGENOMICS_rs1205_00686
AGCAGCGCAGCTCTTGTTGTCGGGGTCGGCGGCGGGAAGCCCAAGGCGGCGGCTAACGGATACAGTTACGTGAGAAGGCACTTCGGGTCCCGGGAATTGAAATCTGGCGGGTCCCACAGA
>augustus_masked-Fvb2-3-processed-gene-70.7:960:1080:Parent=augustus_masked-Fvb2-3-processed-gene-70.7-mRNA-1_9::augustus_masked-Fvb2-3-processed-gene-70.7:960-1080||RAPiDGENOMICS_rs1205_00687
TACCATTATGGGCCTGGTGGGCCGAGGGAAAGCGAAGAGATGGTGGTGCTGGGGGGATGCAACCCCGGTGTCGGTAAAGTCGGCGATGTGGTAAATGCATCGGCGGAGCTGCTGGGGAAG
>augustus_masked-Fvb2-4-processed-gene-105.5:0:120:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-105.5:0-120||RAPiDGENOMICS_rs1205_00688
ATGTGTCAAGAAGCTATCCCCGATGACATTGGTTGCTTGTCCTCTGTGCAACAATTGGATCTTAGTGGAAATAATTTTGTTACCTTTCCGTCAAGCATCAAAAGGCTTTCTAGTCTTCAT
>augustus_masked-Fvb2-4-processed-gene-105.5:1026:1146:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-105.5:1026-1146||RAPiDGENOMICS_rs1205_00689
GTCGGAATTGATTTTGGACTTGGGGAACTGGGTATTCTATTAGCTCCTGAGGTGAATGATGTTCGATTTGTAGGAATATGGGGTATGGGTGGGATTGGTAAGACAACTCTTGCTAAACTA
>augustus_masked-Fvb2-4-processed-gene-105.5:1086:1206:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-105.5:1086-1206|2x||RAPiDGENOMICS_rs1205_00690
GTTCGATTTGTAGGAATATGGGGTATGGGTGGGATTGGTAAGACAACTCTTGCTAAACTAGTATTTGAGAGATTTCCCATCAGTTTGAGGTGGGCAAGTTTCTTCTCAATGTTAGAGAAG
>augustus_masked-Fvb2-4-processed-gene-105.5:1146:1266:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-105.5:1146-1266||RAPiDGENOMICS_rs1205_00691
GTATTTGAGAGATTTCCCATCAGTTTGAGGTGGGCAAGTTTCTTCTCAATGTTAGAGAAGTTTCTTCAAAACATGGCTCTAGTTAATTTTCAAAAACAGCTTCTTTACCCAATCTTGAAG
>augustus_masked-Fvb2-4-processed-gene-105.5:120:240:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-105.5:120-240||RAPiDGENOMICS_rs1205_00692
GTATTTTGGTTGCAGAGGTGCCAAAGGCTTCAACAATTACCAGATCTTCCATCAAACAGTTCATTACAAATATATGCAGACGGTTGCAGTTCATTGGAAATGTTGTCAGAACCATCAGAG
>augustus_masked-Fvb2-4-processed-gene-105.5:1206:1326:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-105.5:1206-1326|2x||RAPiDGENOMICS_rs1205_00693
TTTCTTCAAAACATGGCTCTAGTTAATTTTCAAAAACAGCTTCTTTACCCAATCTTGAAGGAAAATATTGCACAAGTTTGGGATGAACAAGAAGGAACCTTTTTCATTAGGAAATGCTTT
>augustus_masked-Fvb2-4-processed-gene-105.5:1266:1386:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-105.5:1266-1386||RAPiDGENOMICS_rs1205_00694
GAAAATATTGCACAAGTTTGGGATGAACAAGAAGGAACCTTTTTCATTAGGAAATGCTTTTCTAATAAAATGGTTCTTCTCATTCTTGATGATGTTGATCACGTTAACCAACTACAATTA
>augustus_masked-Fvb2-4-processed-gene-105.5:1326:1446:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-105.5:1326-1446|2x||RAPiDGENOMICS_rs1205_00695
TCTAATAAAATGGTTCTTCTCATTCTTGATGATGTTGATCACGTTAACCAACTACAATTACTGGCTGGAAAAAGATCTTGGTTTGGTACAGGAAGCAGAATTATTGTTACAACTAGAGAT
>augustus_masked-Fvb2-4-processed-gene-105.5:1386:1506:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-105.5:1386-1506||RAPiDGENOMICS_rs1205_00696
CTGGCTGGAAAAAGATCTTGGTTTGGTACAGGAAGCAGAATTATTGTTACAACTAGAGATGAATGTTTGTTCATTGAACATGATATAGAAATAACCTTTAAGGTAGTGGGACTAAATGAC
>augustus_masked-Fvb2-4-processed-gene-105.5:1446:1566:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-105.5:1446-1566|2x||RAPiDGENOMICS_rs1205_00697
GAATGTTTGTTCATTGAACATGATATAGAAATAACCTTTAAGGTAGTGGGACTAAATGACAATGAAGCTCTTGAGCTCTTTAGTCAGAACGCATGTAAGAAGGATCAGCCTGATGAAGAG
>augustus_masked-Fvb2-4-processed-gene-105.5:1506:1626:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_6::augustus_masked-Fvb2-4-processed-gene-105.5:1506-1626||RAPiDGENOMICS_rs1205_00698
AATGAAGCTCTTGAGCTCTTTAGTCAGAACGCATGTAAGAAGGATCAGCCTGATGAAGAGTTTTTGCAATTGTCAAAGTGTTTCATAGACTATGCCAAAGGGCTTCCATTAGCACTTAAA
>augustus_masked-Fvb2-4-processed-gene-105.5:1566:1686:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_6::augustus_masked-Fvb2-4-processed-gene-105.5:1566-1686|2x||RAPiDGENOMICS_rs1205_00699
TTTTTGCAATTGTCAAAGTGTTTCATAGACTATGCCAAAGGGCTTCCATTAGCACTTAAAGTTCTGGGACACTCTTTGTATAAGAGAGGTATAGATGAGTGGATTGGTGCATTGGATAAG
>augustus_masked-Fvb2-4-processed-gene-105.5:1626:1746:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_7::augustus_masked-Fvb2-4-processed-gene-105.5:1626-1746||RAPiDGENOMICS_rs1205_00700
GTTCTGGGACACTCTTTGTATAAGAGAGGTATAGATGAGTGGATTGGTGCATTGGATAAGCTTAAGAATGATCCTGATACAGAGATTTTTAGTTCACTGAAGCTGAGTTATGATGGGTTG
>augustus_masked-Fvb2-4-processed-gene-105.5:1686:1806:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_7::augustus_masked-Fvb2-4-processed-gene-105.5:1686-1806|2x||RAPiDGENOMICS_rs1205_00701
CTTAAGAATGATCCTGATACAGAGATTTTTAGTTCACTGAAGCTGAGTTATGATGGGTTGTGTGAAATGAGCAAGAGTATTTTTCTTGATGTTGCTTTCTTACACAAGGGGAAGAACAAG
>augustus_masked-Fvb2-4-processed-gene-105.5:1746:1866:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_8::augustus_masked-Fvb2-4-processed-gene-105.5:1746-1866||RAPiDGENOMICS_rs1205_00702
TGTGAAATGAGCAAGAGTATTTTTCTTGATGTTGCTTTCTTACACAAGGGGAAGAACAAGAAGAGAATAATTGACATACTGGACAGAACTTGTGACTTTTCCAGTCTTTATGGGTTAAAT
>augustus_masked-Fvb2-4-processed-gene-105.5:1806:1926:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_8::augustus_masked-Fvb2-4-processed-gene-105.5:1806-1926|2x||RAPiDGENOMICS_rs1205_00703
AAGAGAATAATTGACATACTGGACAGAACTTGTGACTTTTCCAGTCTTTATGGGTTAAATGTTCTCATTGAGAAATCTCTCTTGACAATTGAGAGGGGTAGTACGGTAGAGATGCATGAT
>augustus_masked-Fvb2-4-processed-gene-105.5:1866:1986:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_9::augustus_masked-Fvb2-4-processed-gene-105.5:1866-1986||RAPiDGENOMICS_rs1205_00704
GTTCTCATTGAGAAATCTCTCTTGACAATTGAGAGGGGTAGTACGGTAGAGATGCATGATTTGATTCAAGAAATGGCATGGGAAATTGTTCGTCTAGAGTCTCGTGATGAACCTGGTCGA
>augustus_masked-Fvb2-4-processed-gene-105.5:2040:2160:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-105.5:2040-2160||RAPiDGENOMICS_rs1205_00705
GACTTGCCAAACTTGAAATATATGGATCTTCAGAATTCTAAAAATTTGACCAAGACCCCAGATGTCACAGGTATTCCGAATCTTGAGGTGTTGGAACTTCAACTATGTACTCGTTTAGTT
>augustus_masked-Fvb2-4-processed-gene-105.5:2160:2280:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-105.5:2160-2280||RAPiDGENOMICS_rs1205_00706
GAGATCCACCCATCCATTGCCATCCACAAAAAACATCGACATTTAGAGCTTCATGGGTGTGCAGGTATTAGTAGTTTACCTAGAGAGATAGAAATGAATTCTCTTGAGCTGTTTGGACTT
>augustus_masked-Fvb2-4-processed-gene-105.5:2397:2517:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-105.5:2397-2517||RAPiDGENOMICS_rs1205_00707
GCGAGGCGGACTGACCTTCGCGAGGCGAACCAGAATTCGCGAGACGAACCGGACTTTGCGAGGCGAACCGCACTTCATGAGACGAACCGGAATTCGCGAGGTGAACTGCACTTCGCGAGG
>augustus_masked-Fvb2-4-processed-gene-105.5:240:360:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-105.5:240-360||RAPiDGENOMICS_rs1205_00708
TTGAGGAGATCTTCCATCAAATCTCAGGGATTTTCTTTCACTTCCGCCAATTGCTTTGGACTGGTTGATAATGAAGGCTGTAATAATGGAATATATTCAATGCTGAGACGATTGGCCACT
>augustus_masked-Fvb2-4-processed-gene-105.5:2592:2712:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-105.5:2592-2712||RAPiDGENOMICS_rs1205_00709
CGTCTTAAATACCTCGATCTGGATGATTGCTCAAAACTTGACAAACTCCCAGAGAACTTGGGGAAAATGGAGAGTTTGGAGGAGCTTCGCATTAGTGGAAATGCAATAACAGAGCCGCCA
>augustus_masked-Fvb2-4-processed-gene-105.5:2712:2832:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-105.5:2712-2832||RAPiDGENOMICS_rs1205_00710
CACTTCATCACTCTTTTGAGAAATCTCAAAGACCTACATTTCAGAAGATCGTGTATAAGGAAGCTTGACGGTGGACTTTGGGGCATATTCGCAAGAAAGAGCCTGGAACCTTTGGGCTTG
>augustus_masked-Fvb2-4-processed-gene-105.5:2832:2952:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-105.5:2832-2952||RAPiDGENOMICS_rs1205_00711
ATGTTGCCTTCTCTAAGGGATTTACGCTCTTTGGAGTCATTAAATCTGGTTGATCATAATCTCTGTCAAGGAGCTCTCCCGGATGATATAGGCTATTGCATGCCATCTCTAGAATACTTG
>augustus_masked-Fvb2-4-processed-gene-105.5:363:483:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-105.5:363-483||RAPiDGENOMICS_rs1205_00712
GGGATCTCCACTGATTATGATAACTTCTCTTTCAATATCATAACTCCTGGAAGTAAACTTTCAGACTGGTTCACGTTCCAAAGTGAGGGAAGTTTACTAACTGTGGAGCTTCCTCCTCCG
>augustus_masked-Fvb2-4-processed-gene-105.5:483:603:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-105.5:483-603||RAPiDGENOMICS_rs1205_00713
GATTCCTGGACATCATCAAAGTGGATGGGGCTTGCTTTTTGCATCATGTTTGCTGATGATCCAGCAGCTTCTCTTGAATATGACTATTCAACAATTAAATGTTCATCAGAAGGGATGAAC
>augustus_masked-Fvb2-4-processed-gene-105.5:603:723:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-105.5:603-723||RAPiDGENOMICS_rs1205_00714
CCTCTCTTTAGGCAGTTGGGGAAAAAGGGCGAAATTGTGAAAGATCACTTTTGGGTATTTTATTTGCATCGTCAAAGGTATTGGAATGAAACCACAACCAGTACTAGTCATGTTAGGTTT
>augustus_masked-Fvb2-4-processed-gene-105.5:753:873:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-105.5:753-873||RAPiDGENOMICS_rs1205_00715
CCCCTCGAACAATCACATATTGCCATTGTAGTTCTCTCGCCAAATTATGCTACTTCTGGGTGGTGCTTGGATGAACTTGCAAAGATCTTCGAATCCATGGAAACAAGGGATAACGCAATC
>augustus_masked-Fvb2-4-processed-gene-105.5:906:1026:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-105.5:906-1026||RAPiDGENOMICS_rs1205_00716
CTTGATCATTACTTGATGTTTTTGTTTATATCTGAGAGAGAGCTCATCAAACTCGTCGTCAAATGTGTTTGGAGAAAGGTGCGTCCTACAATCACATTGTCACACTCTGCAGACAAGTTA
>augustus_masked-Fvb2-4-processed-gene-105.5:966:1086:Parent=augustus_masked-Fvb2-4-processed-gene-105.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-105.5:966-1086|2x||RAPiDGENOMICS_rs1205_00717
AAATGTGTTTGGAGAAAGGTGCGTCCTACAATCACATTGTCACACTCTGCAGACAAGTTAGTCGGAATTGATTTTGGACTTGGGGAACTGGGTATTCTATTAGCTCCTGAGGTGAATGAT
>augustus_masked-Fvb2-4-processed-gene-157.5:0:120:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-157.5:0-120||RAPiDGENOMICS_rs1205_00718
ATGGCTGCTTCTCCTTCCTCTTACAGATGCCGCTATCATGTCTTCTTGAGTTTTAGGGGTGAAGATACACGCAAGGGATTTACCGATCATCTCTATAGAGCTTTGGAGTTGGCAGGAATT
>augustus_masked-Fvb2-4-processed-gene-157.5:1016:1136:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-157.5:1016-1136|2x||RAPiDGENOMICS_rs1205_00719
AATGTTAATGGTTGAAAAGTTACCTGAGGAAGAATCACTTGAGCTTTTCAGTTGGCATGCTTTTAGACAAGCCCATCCTATCAAAAGCTACACGGAGCTTTCTACAGCTGCAGTACAACA
>augustus_masked-Fvb2-4-processed-gene-157.5:120:240:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-157.5:120-240||RAPiDGENOMICS_rs1205_00720
CACACGTTCAGAGACGATGATGAAATTGAGAGAGGAGCAGAGATAGCAGTAGAGCTGCAGAAGGCTATCCAGGAATCATATGTATCACTAATCGTGTTTTCCGAGGATTATGCTTCCTCA
>augustus_masked-Fvb2-4-processed-gene-157.5:1316:1436:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_8::augustus_masked-Fvb2-4-processed-gene-157.5:1316-1436||RAPiDGENOMICS_rs1205_00721
TCATATAGCATGTTTTTTCATAGGAAGGGAGAAGGATTTTACAATTACAGTACTGAGCAACCCTAAAGTTTTTACAAGAATTGGAATTCAAAATCTAGTCAATCGATGTTTAGTGCAAAT
>augustus_masked-Fvb2-4-processed-gene-157.5:1436:1556:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_9::augustus_masked-Fvb2-4-processed-gene-157.5:1436-1556||RAPiDGENOMICS_rs1205_00722
TGATCGTGACAGGTTAATCATGCATCAATTACTTATTGACATGGCAAGGGGAATTGTTCGCGAAGAGTCAAAGGACCCTGGAGAACGTAGCAGAGTGTGGCAGAAGGATGCATCTGATGT
>augustus_masked-Fvb2-4-processed-gene-157.5:180:300:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-157.5:180-300|2x||RAPiDGENOMICS_rs1205_00723
AAGGCTATCCAGGAATCATATGTATCACTAATCGTGTTTTCCGAGGATTATGCTTCCTCAAGATGGTGTTTGGACGAGCTTGCCAAGATCATGAAACGTAATAGAGATGATGGACACATG
>augustus_masked-Fvb2-4-processed-gene-157.5:1812:1932:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-157.5:1812-1932||RAPiDGENOMICS_rs1205_00724
CAACTACTTCTGCTCAATAATGTAAATTTCAGTGGTGCCTGTGATGAGTTTCCGAAGACATTATCATGGTTATCTTGGCAAGGGCTTCTTTGGGAATCTATACCAAAGGAATTTCCTTTG
>augustus_masked-Fvb2-4-processed-gene-157.5:1995:2115:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-157.5:1995-2115||RAPiDGENOMICS_rs1205_00725
CATCTGCCAAAACTAAAAATCCTTGATCTCAGTCATTCACTTGGTCTTGTTACAACTTCAGACTTGTCAGGACTCTCTAACCTCGAGAGATTAATCCTTGAAGGTTGCACGAACATTTCT
>augustus_masked-Fvb2-4-processed-gene-157.5:2115:2235:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-157.5:2115-2235||RAPiDGENOMICS_rs1205_00726
GAGATTGATGACTCCATTGGTGAACTCGAGAAACTCGTTTTCCTGAATGTCACAGACTGCAAAAATCTCAAGAAGCTCCGGGAAACAATTGACAGGTTGACATCTCTGCAGGAGCTAAAC
>augustus_masked-Fvb2-4-processed-gene-157.5:2235:2355:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-157.5:2235-2355||RAPiDGENOMICS_rs1205_00727
CTTTCTGGTTGTTCAAACCTTTCTCTTCATGCTAATACAGCTACTGATTTGAGGAATTTCTTCATCCTGTTATCAAATAAATCTTGGCAATCAATTTGGTCGCGGGTATCACCAAGCAGA
>augustus_masked-Fvb2-4-processed-gene-157.5:2355:2475:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-157.5:2355-2475||RAPiDGENOMICS_rs1205_00728
AGTGTTGAACCAACAGGTTTCTCATTGGTACAGTTACCACATTCTTTAGTAAGCTTGAACCTGGCTTATTGCAATCTATCAGAGATTTTCAGCGATCTTAGCATCTTCTCCTCACTAAAG
>augustus_masked-Fvb2-4-processed-gene-157.5:240:360:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-157.5:240-360||RAPiDGENOMICS_rs1205_00729
AGATGGTGTTTGGACGAGCTTGCCAAGATCATGAAACGTAATAGAGATGATGGACACATGGTCTTGCCAGTTTTTTACAAGGTGGATCCATCCCATGTTAGGAAGCAGACTGGCACTTTC
>augustus_masked-Fvb2-4-processed-gene-157.5:2475:2595:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-157.5:2475-2595||RAPiDGENOMICS_rs1205_00730
AAGCTGGATCTAAGTGGCAATCTATTTGCGAGTTTACCTGGAAACATGAAGAGTCATACAGCACTCGAGTCTCTTAATCTATACAGATGCACAAACCTCATAACGATTCCGGAGGTTCCA
>augustus_masked-Fvb2-4-processed-gene-157.5:2595:2715:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_6::augustus_masked-Fvb2-4-processed-gene-157.5:2595-2715||RAPiDGENOMICS_rs1205_00731
CCAAGTTTAAATTTTTTGTTTGCAAGCGACTGTACAGCAATGAAAATATATTCACCAAGTATTTTCACTTGGAAACTCCACGGTTGTCGCGAATTAGTTGAAGTAAGAAACCTCTTCAGT
>augustus_masked-Fvb2-4-processed-gene-157.5:2715:2835:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_7::augustus_masked-Fvb2-4-processed-gene-157.5:2715-2835||RAPiDGENOMICS_rs1205_00732
ATAAAGCCATTGATCAGCGAGCTTGATGTGGAAATGATAAGAAATATGGGGTTGTACAATTTGGAACCCTTTGGAGGCACCGATGAGCTTGAAATGTTCAATTGCATGTCACATACAACC
>augustus_masked-Fvb2-4-processed-gene-157.5:2853:2973:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-157.5:2853-2973||RAPiDGENOMICS_rs1205_00733
GGTCTGTATGAATGTGGTATATTCTGCATTTTCCTTCATGGAAACAAGATTCCTAATTGGTACAAGTACAGGGGTGAAACCGCCATGTCTATCATTGTTCCTTCCCATCCTAAACTCAAG
>augustus_masked-Fvb2-4-processed-gene-157.5:2973:3093:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-157.5:2973-3093||RAPiDGENOMICS_rs1205_00734
ATCACAGGCTTAAATGTCTGTGTCGTATACACAAGAGGTGGAAAGATTGAGGATATTTGCACCTCACCGATTCTAAAAGTCAGTAACGAAGCGAAAGGTGTTATGTGGTCGTATTCCCCT
>augustus_masked-Fvb2-4-processed-gene-157.5:300:420:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-157.5:300-420|2x||RAPiDGENOMICS_rs1205_00735
GTCTTGCCAGTTTTTTACAAGGTGGATCCATCCCATGTTAGGAAGCAGACTGGCACTTTCGGAGAAGCGTTTGCCAAACTTGAAGAGCGTTTCAAGGAGGAGATTGGCAAGGTGGAAGAG
>augustus_masked-Fvb2-4-processed-gene-157.5:3093:3213:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-157.5:3093-3213||RAPiDGENOMICS_rs1205_00736
GTCAGTGTAGGTCTTCCAAAAGAGAATGAAAAGATGTCATGGCTAAGCCATTGGCAGTTTGAGAATGACGAGTTAGAGTGTGGGGAAGAACTGCGTGTTTCTGTGGATACCAACTACATG
>augustus_masked-Fvb2-4-processed-gene-157.5:3213:3333:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-157.5:3213-3333||RAPiDGENOMICS_rs1205_00737
TATATTCCGATCTTGATAAAGGAGCTTGCAGTCCAACTTGTGTACGAGCATGAGCATGATGAAAATGAGGGCAAGGCATCTAATGGTATGCAATTATCAGATCATGATGTAGGTGTTGCA
>augustus_masked-Fvb2-4-processed-gene-157.5:3333:3453:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-157.5:3333-3453||RAPiDGENOMICS_rs1205_00738
ACTCAACACGAGGCACCTTATTGGAGCCAGGGTGTTCTCATCGGACATGTATCGGCACCGAAGTATCAAATTTGGCCGGGCACATACTTCCTTTGCAATCATCACAACGTAGCTTATCAT
>augustus_masked-Fvb2-4-processed-gene-157.5:476:596:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-157.5:476-596||RAPiDGENOMICS_rs1205_00739
GTATGAATCACAGCTGATCGAAAATATTGTTGAGGATATTGGAAATAAACTCGAACCCAAAGTACTAAATGTTGCCCCCCATGCGATTGGAATAGATGATCGTGTGAAAGATATAAACAA
>augustus_masked-Fvb2-4-processed-gene-157.5:60:180:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-157.5:60-180|2x||RAPiDGENOMICS_rs1205_00740
GAAGATACACGCAAGGGATTTACCGATCATCTCTATAGAGCTTTGGAGTTGGCAGGAATTCACACGTTCAGAGACGATGATGAAATTGAGAGAGGAGCAGAGATAGCAGTAGAGCTGCAG
>augustus_masked-Fvb2-4-processed-gene-157.5:656:776:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-157.5:656-776|2x||RAPiDGENOMICS_rs1205_00741
TGGCAAAACCACCATTGCAAAAGCTGCCTATAACATGAACTTCGCTAACTTTCAAGGAAGTAGCTTTCTTGCAGATATTAGAGCAACTTCAAAACACCCTAATGGTTTGGTTCGCTTGCA
>augustus_masked-Fvb2-4-processed-gene-157.5:896:1016:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-157.5:896-1016|2x||RAPiDGENOMICS_rs1205_00742
TGTAAACGATTCAGACCAATTCAGTGCAATTCTTGAAATGCGAGAATCTTTTTGTCCCGGAAGTAAGATTATCATAACTACCAGAAATCAACACTTACAAATCACAAATGGGATTTCTGA
>augustus_masked-Fvb2-4-processed-gene-157.5:956:1076:Parent=augustus_masked-Fvb2-4-processed-gene-157.5-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-157.5:956-1076||RAPiDGENOMICS_rs1205_00743
AAGTAAGATTATCATAACTACCAGAAATCAACACTTACAAATCACAAATGGGATTTCTGAAATGTTAATGGTTGAAAAGTTACCTGAGGAAGAATCACTTGAGCTTTTCAGTTGGCATGC
>augustus_masked-Fvb2-4-processed-gene-159.0:120:240:Parent=augustus_masked-Fvb2-4-processed-gene-159.0-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-159.0:120-240||RAPiDGENOMICS_rs1205_00744
GTCAATCCCCACGTCCCCTGGCGCACCCTCTTCCCCGACGACCTCTGCGCCTACGGCCCTCACGGCGTCGTCTGCGACTTCTTCACAAACGACACTCACCCAAACGTCGTTTCCGTCCAC
>augustus_masked-Fvb2-4-processed-gene-159.0:360:480:Parent=augustus_masked-Fvb2-4-processed-gene-159.0-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-159.0:360-480||RAPiDGENOMICS_rs1205_00745
TACCGCTGCTTCAACCAAACCACCACCGTCGTTTCCGTCCCGGATGTCGCGGCGTGTTTCACGCCGGGTCTGGAGGAGCTCGTCTTCATTGACAACCCATCTCTTGTTTCACCCCTCAGT
>augustus_masked-Fvb2-4-processed-gene-159.0:660:780:Parent=augustus_masked-Fvb2-4-processed-gene-159.0-mRNA-1_6::augustus_masked-Fvb2-4-processed-gene-159.0:660-780|2x||RAPiDGENOMICS_rs1205_00746
AACCTTGGTGGAAACTCCTTCGCCGGAGAAGTGCCGGAGTCGGTGGGGAGCCTCCCGGAGCTGTTGAAGCTGGACCTGAGCTCGAATGGGTTTTCCGGCGAAATCCCGGCGAGCATTAGA
>augustus_masked-Fvb2-4-processed-gene-197.8:240:360:Parent=augustus_masked-Fvb2-4-processed-gene-197.8-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-197.8:240-360||RAPiDGENOMICS_rs1205_00747
CTGGTGGCGAAGGTCTCCAGGCTCCGATCATGTAGCTATTTCTGGCTGGACAGTTACGCGAAGAAGCTTCTGGATTTGGATAGGCACTTGAGAAGTCTGATGGAGGCGACTTGGGGGGAG
>augustus_masked-Fvb2-4-processed-gene-197.8:360:480:Parent=augustus_masked-Fvb2-4-processed-gene-197.8-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-197.8:360-480||RAPiDGENOMICS_rs1205_00748
GAGGTTAGGGTTGTGAGGCAGCAGAGCAGGGAGGTGAGGGAACTGATGGATGGGATGGTTGGGAGGATGTTTGATGCTTATAAGAAGGTGATGGAGGCCGAGAAGGTGCCGGTGATGACA
>augustus_masked-Fvb2-4-processed-gene-197.8:540:660:Parent=augustus_masked-Fvb2-4-processed-gene-197.8-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-197.8:540-660|2x||RAPiDGENOMICS_rs1205_00749
TTTCAGAGGCTGTTTGAGGCTGTGAGGGAGGCGCGGGAGAAGAGGGAGGCGCCGCCGTGGATGATTGTGGCACTGGTTTTGGATATTGAGATGACAATGTACTCGGTGCAGCCGTTTTTG
>augustus_masked-Fvb2-4-processed-gene-197.8:60:180:Parent=augustus_masked-Fvb2-4-processed-gene-197.8-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-197.8:60-180|2x||RAPiDGENOMICS_rs1205_00750
CAAGTCACCCAAGCGATGCAGAAGCATACCAAGCTCAAAGCCATCCTGGGCTTTCTCCACTCCACGATCAATTCGTTCAAAGATCGAGTCATCCAGCCGGTCCAAGAAGGCCGCCGGATT
>augustus_masked-Fvb2-4-processed-gene-197.8:600:720:Parent=augustus_masked-Fvb2-4-processed-gene-197.8-mRNA-1_6::augustus_masked-Fvb2-4-processed-gene-197.8:600-720||RAPiDGENOMICS_rs1205_00751
ATGATTGTGGCACTGGTTTTGGATATTGAGATGACAATGTACTCGGTGCAGCCGTTTTTGGAGGAGATGGCGGCGCATAACAGGGTGTTGGGACGGCCTAAGGAGGAGGTGAGGAGTTTC
>augustus_masked-Fvb2-4-processed-gene-197.8:660:780:Parent=augustus_masked-Fvb2-4-processed-gene-197.8-mRNA-1_6::augustus_masked-Fvb2-4-processed-gene-197.8:660-780|2x||RAPiDGENOMICS_rs1205_00752
GAGGAGATGGCGGCGCATAACAGGGTGTTGGGACGGCCTAAGGAGGAGGTGAGGAGTTTCCGAGTGGAGATGGAGAAGGGGTTGGAGGTGGTGAGGAGGAGCGGCCGGGTTGGTAAGAAG
>augustus_masked-Fvb2-4-processed-gene-197.8:720:840:Parent=augustus_masked-Fvb2-4-processed-gene-197.8-mRNA-1_7::augustus_masked-Fvb2-4-processed-gene-197.8:720-840||RAPiDGENOMICS_rs1205_00753
CGAGTGGAGATGGAGAAGGGGTTGGAGGTGGTGAGGAGGAGCGGCCGGGTTGGTAAGAAGTGGGAGGGATTCAGCAAGAAGAAGTATGAGTGTATTGTTGAGCTGTTGGGGCTGAATCAG
>augustus_masked-Fvb2-4-processed-gene-197.8:780:900:Parent=augustus_masked-Fvb2-4-processed-gene-197.8-mRNA-1_7::augustus_masked-Fvb2-4-processed-gene-197.8:780-900|2x||RAPiDGENOMICS_rs1205_00754
TGGGAGGGATTCAGCAAGAAGAAGTATGAGTGTATTGTTGAGCTGTTGGGGCTGAATCAGTGTATGCAGAGAGAGGTGTGTATTCTGAGATGGCAGATGGCCAAGAATGCGACAGAGTCT
>augustus_masked-Fvb2-4-processed-gene-224.0:1080:1200:Parent=augustus_masked-Fvb2-4-processed-gene-224.0-mRNA-1_10::augustus_masked-Fvb2-4-processed-gene-224.0:1080-1200||RAPiDGENOMICS_rs1205_00755
GAGCTGCTGGGGAAGGGGACTGTGGGGGCCACTTACAAGATCATGATGAACGGCTGGGATGACGTGGCGGTGGTGAAGAGGGTGAGGGAGAGGATGATGGTTCACGGTAAGGAAGTGGAG
>augustus_masked-Fvb2-4-processed-gene-224.0:1560:1680:Parent=augustus_masked-Fvb2-4-processed-gene-224.0-mRNA-1_14::augustus_masked-Fvb2-4-processed-gene-224.0:1560-1680||RAPiDGENOMICS_rs1205_00756
AGTGCGCCGGAGTTGATCATGCCGAGTAGTTTTAGTCCCAACAAGTACTCTCGCAAGTGCGATGTGTATAGCTTTGGGGTGGTTTTGATGGAGATTTTGACGGGGAGGATGGCGGGGGAG
>augustus_masked-Fvb2-4-processed-gene-224.0:480:600:Parent=augustus_masked-Fvb2-4-processed-gene-224.0-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-224.0:480-600||RAPiDGENOMICS_rs1205_00757
ACTCGGCTGTCTAAGTTGTTAACTCTACGGCTCGAGTTCAACTCGCTCACCTGCTTCGGCGACGCGTCGTCTGCTCTGTTCACCGATTTCAATGTCTCCAACAACGACCTCGCCGGAAAA
>augustus_masked-Fvb2-4-processed-gene-224.0:60:180:Parent=augustus_masked-Fvb2-4-processed-gene-224.0-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-224.0:60-180|2x||RAPiDGENOMICS_rs1205_00758
TCTCTCTCCAACCCAACCCCAAACGACACTCTTCCCTTGCTCGCATTCAAAGCCTCGTCGGACCGCTCCAACTCCCTCGCCACCTGGGCCGAATCCACCGATCCCTGTGCCGGGTCATGG
>augustus_masked-Fvb2-4-processed-gene-224.0:600:720:Parent=augustus_masked-Fvb2-4-processed-gene-224.0-mRNA-1_6::augustus_masked-Fvb2-4-processed-gene-224.0:600-720||RAPiDGENOMICS_rs1205_00759
ATCCCTCGGTTTCTGGAGAAGTTCGGTGAGGCGTCGTTTACGGGAAACGCGCGGCTCTGCGGGAAGCCGCTGCCAAACGACTGCCCTATTCCGATGGCCGTCAAGCCGCCGTCACAAGCG
>augustus_masked-Fvb2-4-processed-gene-224.0:960:1080:Parent=augustus_masked-Fvb2-4-processed-gene-224.0-mRNA-1_9::augustus_masked-Fvb2-4-processed-gene-224.0:960-1080||RAPiDGENOMICS_rs1205_00760
CACAGATACCGTTATGGGCCTGGTGGGCCGAACGGGCCGAGGGAAAGCGAAGAGATGGTGGTGCTGGAGGGATTGAACCCCGGTGTCGGTAAAGTCGGCGATGTGCTAAATGCGTCGGCG
>augustus_masked-Fvb2-4-processed-gene-249.4:1140:1260:Parent=augustus_masked-Fvb2-4-processed-gene-249.4-mRNA-1_10::augustus_masked-Fvb2-4-processed-gene-249.4:1140-1260|2x||RAPiDGENOMICS_rs1205_00761
CAGATTGCGAAATGCAGCTTGTTACAGGCTCTTGATCTTGAAGGTAACCGCTTTGCGGGTCAGTTTCCGTTGTTTTTGGGAGGGATGAAGAGCTTAAAGTTGTTGTCTTTGGGTGGGAAT
>augustus_masked-Fvb2-4-processed-gene-249.4:1560:1680:Parent=augustus_masked-Fvb2-4-processed-gene-249.4-mRNA-1_14::augustus_masked-Fvb2-4-processed-gene-249.4:1560-1680||RAPiDGENOMICS_rs1205_00762
GAGTTGCCTACTGAGGTTTTTGGGCTGCCAAATTTACAAGTGGTTGCCTTGCAAGAGAATCAGTTATCTGGGGATGTTCCTCAAGGTTTTAGTAGCTTGACTGGTTTAGTCTACCTAAAT
>augustus_masked-Fvb2-4-processed-gene-249.4:1920:2040:Parent=augustus_masked-Fvb2-4-processed-gene-249.4-mRNA-1_17::augustus_masked-Fvb2-4-processed-gene-249.4:1920-2040||RAPiDGENOMICS_rs1205_00763
GAAATACCAGAGGAAATTTCCAAATGCTCTGCTCTGACTTCATTATTGTTAGAGGGTAATCAACTTTCAGGTCCAATACCGAACTCCTTGCCTTTGTTATCGAACCTTGTGGTGTTAGAT
>augustus_masked-Fvb2-4-processed-gene-249.4:1980:2100:Parent=augustus_masked-Fvb2-4-processed-gene-249.4-mRNA-1_17::augustus_masked-Fvb2-4-processed-gene-249.4:1980-2100|2x||RAPiDGENOMICS_rs1205_00764
CAACTTTCAGGTCCAATACCGAACTCCTTGCCTTTGTTATCGAACCTTGTGGTGTTAGATCTTTCCTCCAACCAGTTGAGTGGAGCAATCCCGGCTAATATTTCACTAATTCCTCAGTTG
>augustus_masked-Fvb2-4-processed-gene-249.4:240:360:Parent=augustus_masked-Fvb2-4-processed-gene-249.4-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-249.4:240-360||RAPiDGENOMICS_rs1205_00765
GCCGGCCGACTGTCCGACGAACTCGCCGCCCTCCGTGACCTACGGAAGCTCAGCCTCCACACCAACAACTTCAACGGCTCCATCCCTCCCTTTCTCTCCCAATGCGTGTTGCTACGCGCC
>augustus_masked-Fvb2-4-processed-gene-249.4:2880:3000:Parent=augustus_masked-Fvb2-4-processed-gene-249.4-mRNA-1_25::augustus_masked-Fvb2-4-processed-gene-249.4:2880-3000||RAPiDGENOMICS_rs1205_00766
ATGGTCCATGGTGATGTGAAGCCGCAAAATGTTCTCTTCGACGCTGATTTTGAAGCCCACCTGTCGGAATTTGGATTAGACCGGTTAACCATAATCTCACCAAAACCCTCATCCTCATCA
>augustus_masked-Fvb2-4-processed-gene-249.4:3120:3240:Parent=augustus_masked-Fvb2-4-processed-gene-249.4-mRNA-1_27::augustus_masked-Fvb2-4-processed-gene-249.4:3120-3240||RAPiDGENOMICS_rs1205_00767
AAGCCGGTGATGTTCACCGAAGAAGAAGACATTGTGAAATGGGTGAAGAAGCAACTACAAAGAGGCCAAATCACAGAGCTGTTAGAGCCCGGACTGCTTGAGCTGGACCCGGAGTCATCA
>augustus_masked-Fvb2-4-processed-gene-249.4:360:480:Parent=augustus_masked-Fvb2-4-processed-gene-249.4-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-249.4:360-480||RAPiDGENOMICS_rs1205_00768
GTCTACCTCCACGCCAACTCACTCTCCGGCGACCTCCCGCCGGCGATTCTCAACCTCACCAACCTCCAAATCCTCGCCCTTTCTCACAACTCCCTCTCCGGAAAAATCTCCGGCGAATTT
>augustus_masked-Fvb2-4-processed-gene-249.4:720:840:Parent=augustus_masked-Fvb2-4-processed-gene-249.4-mRNA-1_7::augustus_masked-Fvb2-4-processed-gene-249.4:720-840||RAPiDGENOMICS_rs1205_00769
GCCGACGACAACGCGCTCCGAGGTCTAATTCCGGCGACTCTCGGCGCCATTCCGAAGCTTCAGGTGGTTTCTTTAGCTCGGAACAGCTTATCAGGCTCAGTCCCCACAGCTTTATCATGC
>augustus_masked-Fvb2-4-processed-gene-249.4:960:1080:Parent=augustus_masked-Fvb2-4-processed-gene-249.4-mRNA-1_9::augustus_masked-Fvb2-4-processed-gene-249.4:960-1080||RAPiDGENOMICS_rs1205_00770
CTTAGAAGCAATCGCATTGGCGGCGCGTTTCCGAACTGGTTCAGCAATGTGACTACGTTGAGGGTTTTCGATGTTTCTGGAAACTTGTTTTCGGGTGGATTGCCTCCCGAAATCGGCAAT
>augustus_masked-Fvb2-4-processed-gene-30.15:1020:1140:Parent=augustus_masked-Fvb2-4-processed-gene-30.15-mRNA-1_9::augustus_masked-Fvb2-4-processed-gene-30.15:1020-1140|2x||RAPiDGENOMICS_rs1205_00771
TTAACTGGAAGTTCGGGAATCTCCGGCAGCTTGGGGGATAATTGTCTACAGGGGTGTCCGTCTTCAGCGAAGCTGTGCCTTCCGTCGCAGAAATCAAACGCGATATGCAAGCAAGCCTAT
>augustus_masked-Fvb2-4-processed-gene-30.15:420:540:Parent=augustus_masked-Fvb2-4-processed-gene-30.15-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-30.15:420-540|2x||RAPiDGENOMICS_rs1205_00772
TCCGGCTCTCTCACTCCCTCCATCACCAAGCTCAAGTCTTTAGAATCTCTAGACATTTCCCACAATTCCCTAATAGGATTCCTCCCAAACTCCATGGCTTCTTTATCCAACTTAAGAAGA
>augustus_masked-Fvb2-4-processed-gene-30.15:480:600:Parent=augustus_masked-Fvb2-4-processed-gene-30.15-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-30.15:480-600||RAPiDGENOMICS_rs1205_00773
CACAATTCCCTAATAGGATTCCTCCCAAACTCCATGGCTTCTTTATCCAACTTAAGAAGACTCGATCTCAGCTTCAACAAGATCACCGGATCACTCCCCAGACTCCCACCAAAGCTCTTA
>augustus_masked-Fvb2-4-processed-gene-30.15:720:840:Parent=augustus_masked-Fvb2-4-processed-gene-30.15-mRNA-1_7::augustus_masked-Fvb2-4-processed-gene-30.15:720-840||RAPiDGENOMICS_rs1205_00774
TGGTTCTTCCTCATCCCTTCCCTCCAGCAAGTCGACCTAGCCAATAACAGCCTGACAGGTGTCGACATCGCGAGGCCTGGCTCCGGCAGAGGCGGCGAGCTCGTGGCGGTCGACTTAAGC
>augustus_masked-Fvb2-4-processed-gene-30.15:900:1020:Parent=augustus_masked-Fvb2-4-processed-gene-30.15-mRNA-1_8::augustus_masked-Fvb2-4-processed-gene-30.15:900-1020|2x||RAPiDGENOMICS_rs1205_00775
CTGTCGGTTCGTTACAACAGGCTACGTGGCAAGATCCCAGTAGAGTACGGGAAGAACAAGTCGTTGAAGCGGTTGTACTTAGATGGTAACTTTCTGAACGGGCAACCACCGCCGGCTTTG
>augustus_masked-Fvb2-4-processed-gene-39.3:0:120:Parent=augustus_masked-Fvb2-4-processed-gene-39.3-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-39.3:0-120||RAPiDGENOMICS_rs1205_00776
ATGGAAGAGCTGGTGTATTCACGTTTGAGCTTCAGTTATGAAAGATTAAAGGATGACACTACTCGATCATGTTTTCTGTATTGTGCAATGTATCCTGAAGATCATCAAATTGAAGCCAGA
>augustus_masked-Fvb2-4-processed-gene-39.3:120:240:Parent=augustus_masked-Fvb2-4-processed-gene-39.3-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-39.3:120-240||RAPiDGENOMICS_rs1205_00777
GATCTGATAGAATATTGGATATGGGAGGGTTTGCTTGGTGATGGGGGAAGGATACAGGCCAACATATGGAAGGGTGAAATGATTTTGGCTGATCTTAAAGATTCTTGCCTGCTGGACAAT
>augustus_masked-Fvb2-4-processed-gene-39.3:240:360:Parent=augustus_masked-Fvb2-4-processed-gene-39.3-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-39.3:240-360||RAPiDGENOMICS_rs1205_00778
GTTGATGCAGATGGTGGTGTTGATTGTGTCAAAATGCATGACTTAATAAGGGATATGGCAATTGGTATTACAAATACGAGTCCTCGATTCGTCATTAGTTCTGGGGTTGGAGTAGAAAAG
>augustus_masked-Fvb2-4-processed-gene-39.3:360:480:Parent=augustus_masked-Fvb2-4-processed-gene-39.3-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-39.3:360-480||RAPiDGENOMICS_rs1205_00779
GCATCACTTGGTAAGGAGGGGATTGAAGATGTTGAGAGGATTTCAATTATGTATAATGAATTGAAATGCCTTCCTGGAAAACCATTGTGTTCCAAGCTCTCCTGTTTGCTGCTGCAGTAT
>augustus_masked-Fvb2-4-processed-gene-39.3:574:694:Parent=augustus_masked-Fvb2-4-processed-gene-39.3-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-39.3:574-694||RAPiDGENOMICS_rs1205_00780
AGCTTGGTTTCCTACAAAACTTTAAGAGTCTCTACAAGGGTGCCATGCCCTCAGGAGCTCTAGGTGCCCTGAAGATACTGCAAATCAGTTACTGTAACTCTTTAGAGAGTGTACTCAACC
>augustus_masked-Fvb2-4-processed-gene-39.3:60:180:Parent=augustus_masked-Fvb2-4-processed-gene-39.3-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-39.3:60-180|2x||RAPiDGENOMICS_rs1205_00781
ACTCGATCATGTTTTCTGTATTGTGCAATGTATCCTGAAGATCATCAAATTGAAGCCAGAGATCTGATAGAATATTGGATATGGGAGGGTTTGCTTGGTGATGGGGGAAGGATACAGGCC
>augustus_masked-Fvb2-4-processed-gene-39.3:694:814:Parent=augustus_masked-Fvb2-4-processed-gene-39.3-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-39.3:694-814||RAPiDGENOMICS_rs1205_00782
CAAGGCTGATTGAACACCTCGGAAACCTTGAAGAACTTTCGGTTGAGCATTGTCCGAAATTGGAGGTGGTGATAGAGGAGGAGCAGTCGTACCACAATGCTCAAGTCAGCCTGCCAAGAT
>augustus_masked-Fvb2-4-processed-gene-8.0:0:120:Parent=augustus_masked-Fvb2-4-processed-gene-8.0-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-8.0:0-120||RAPiDGENOMICS_rs1205_00783
ATGACCACCCAAACAGATATTGCTTCTTCTTCTTCTCCTCCTCCTCCGATCCCTCGATGGATATACGATGTCTTCCTAAGTTTCAGAGGCACAGACACCCGCAATAGTTTTACAGATTTT
>augustus_masked-Fvb2-4-processed-gene-8.0:120:240:Parent=augustus_masked-Fvb2-4-processed-gene-8.0-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-8.0:120-240||RAPiDGENOMICS_rs1205_00784
CTTTATAACACTCTGAAACAGAAAGGCATAAACACATTTAGGGATAATGAAGAACTTGAGAGGGGGAAAGAAATTGCTCCGGAACTCTTGAAGGCAATTGAAGAATCAAGATATGCAATT
>augustus_masked-Fvb2-4-processed-gene-8.0:180:300:Parent=augustus_masked-Fvb2-4-processed-gene-8.0-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-8.0:180-300|2x||RAPiDGENOMICS_rs1205_00785
AGGGGGAAAGAAATTGCTCCGGAACTCTTGAAGGCAATTGAAGAATCAAGATATGCAATTGTCGTTCTTTCAGAAAATTATGCCGATTCATCTTGGTGTTTGGATGAGGTTGCCAAGGTC
>augustus_masked-Fvb2-4-processed-gene-8.0:240:360:Parent=augustus_masked-Fvb2-4-processed-gene-8.0-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-8.0:240-360||RAPiDGENOMICS_rs1205_00786
GTCGTTCTTTCAGAAAATTATGCCGATTCATCTTGGTGTTTGGATGAGGTTGCCAAGGTCGTCGAATGCATGAAACTGATGGGACAGACAGTAGTCCCAGTTTTCTATCATGTGGATCCG
>augustus_masked-Fvb2-4-processed-gene-8.0:300:420:Parent=augustus_masked-Fvb2-4-processed-gene-8.0-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-8.0:300-420|2x||RAPiDGENOMICS_rs1205_00787
GTCGAATGCATGAAACTGATGGGACAGACAGTAGTCCCAGTTTTCTATCATGTGGATCCGTTTGAGGTGCGAAGACAAAAAGGGAGTTTCGAGAAAGCTTTCGCCAAGCATGAAATACGA
>augustus_masked-Fvb2-4-processed-gene-8.0:360:480:Parent=augustus_masked-Fvb2-4-processed-gene-8.0-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-8.0:360-480||RAPiDGENOMICS_rs1205_00788
TTTGAGGTGCGAAGACAAAAAGGGAGTTTCGAGAAAGCTTTCGCCAAGCATGAAATACGATTCAAGGACAATCCAGAGAAGGTGAAAAGGTGGAGATCTGCTCTTACCGATGTGGCTAAT
>augustus_masked-Fvb2-4-processed-gene-8.0:60:180:Parent=augustus_masked-Fvb2-4-processed-gene-8.0-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-8.0:60-180|2x||RAPiDGENOMICS_rs1205_00789
ATATACGATGTCTTCCTAAGTTTCAGAGGCACAGACACCCGCAATAGTTTTACAGATTTTCTTTATAACACTCTGAAACAGAAAGGCATAAACACATTTAGGGATAATGAAGAACTTGAG
>augustus_masked-Fvb2-4-processed-gene-8.2:1125:1245:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-8.2:1125-1245||RAPiDGENOMICS_rs1205_00790
GGCACGACTGCAATGGAAGCTATATTACTTGATTCGCCACAACCAGAGAATGTTCGCTTCAATGTTGATCCTTTCTCAAAGATGTCCAAGCTAAGATTGCTCAAAATTAAAAACGTTCAC
>augustus_masked-Fvb2-4-processed-gene-8.2:1245:1365:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-8.2:1245-1365||RAPiDGENOMICS_rs1205_00791
CTTTTTGGAGAGGTTAAATGTCTCTCTAATGAGTTGCAACTTCTCGAGTGGCATGTCTGTCCATTACATTCTTTGCCGTCAGACTTCCAGTCTGATAAGCTTGTTGAACTTAGACTGCAG
>augustus_masked-Fvb2-4-processed-gene-8.2:1401:1521:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-8.2:1401-1521||RAPiDGENOMICS_rs1205_00792
CAGTGGAGAATGCTAAAGTTCATTGATATGAGTTATTCCCAATACTTGATGAAGACTCCAGATTTCAGTGAAGTTCCAAATCTTGAGACGTTGATACTTGAAGGCTGTATAAGATTGGTT
>augustus_masked-Fvb2-4-processed-gene-8.2:143:263:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-8.2:143-263||RAPiDGENOMICS_rs1205_00793
CCTTGATTACTTGGATATGCATAACATGAATGGAGTATGTACCGTAGGCGTTTTGGGTATGGGGGGCATCGGTAAGACAACTATTGCCCAGGAAGTTTGTGACAGGATATACGGTCAGTT
>augustus_masked-Fvb2-4-processed-gene-8.2:1521:1641:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-8.2:1521-1641||RAPiDGENOMICS_rs1205_00794
GAGGTTCACACATCCGTTGGAGTCCTCGAAAAACTTAGTTTATGGAATATGGGAGATTGCAAATCTGTTAAGAGCCTTCCAGCATTCCTTCGGTTGGAGTCCCTTGTAACTTTAAAGCTC
>augustus_masked-Fvb2-4-processed-gene-8.2:1641:1761:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-8.2:1641-1761||RAPiDGENOMICS_rs1205_00795
TCCGCCTGCTCGAAGCTGAAGAAGTTTCCTAAAATCGAAGGATGTATGCAACGCTTGTCGGAGCTTCATCTAGATGGGACTGCCATAGAGGAATTACCTCAGTCGATTGATCGTCTGACT
>augustus_masked-Fvb2-4-processed-gene-8.2:1761:1881:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-8.2:1761-1881||RAPiDGENOMICS_rs1205_00796
GGTCTTACTCTTTTGAATTTAGAAGACTGCAAAAATCTTTTTCGTATTCCTAGTACCATTCGATCCTTGAAATCTCTGAAACGTCTAATTCTTACAGGTTGCTCAGAACTTAGTGACATA
>augustus_masked-Fvb2-4-processed-gene-8.2:1881:2001:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-8.2:1881-2001||RAPiDGENOMICS_rs1205_00797
CCTGACGATCTGAGTTGTGTAGAATGTCTGGAGGAGCTTGATATCAGTGGAACTGCTATAAGAGACTTCACAGGCATCGAAGGAATGAAGAATCTGAAGTCCCTATCTCTAAGAGGGTCT
>augustus_masked-Fvb2-4-processed-gene-8.2:2001:2121:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_6::augustus_masked-Fvb2-4-processed-gene-8.2:2001-2121||RAPiDGENOMICS_rs1205_00798
AGAAACTCAACCCCAAAATCATGGCATTCGGCGGTCTTGGGTTGTTTGGGGATGGTTAAAAGCAGCGATGCTCCCTTGAGATTGTCACTGCCTACGTCCTTCTCAGGTTTATGTTCTTTG
>augustus_masked-Fvb2-4-processed-gene-8.2:203:323:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-8.2:203-323|2x||RAPiDGENOMICS_rs1205_00799
GGGGGGCATCGGTAAGACAACTATTGCCCAGGAAGTTTGTGACAGGATATACGGTCAGTTTGAGGCTTACAGCTTTGTTCCAAAAGTAAGAGAAGTATCTGGAAAAGAAGGGTTAGTTCA
>augustus_masked-Fvb2-4-processed-gene-8.2:2061:2181:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_6::augustus_masked-Fvb2-4-processed-gene-8.2:2061-2181|2x||RAPiDGENOMICS_rs1205_00800
AGCAGCGATGCTCCCTTGAGATTGTCACTGCCTACGTCCTTCTCAGGTTTATGTTCTTTGACAGAGCTAAACATAAATGATTGCAATCTGATTGATGGAGTGATACCCAATGATCTTGGC
>augustus_masked-Fvb2-4-processed-gene-8.2:2121:2241:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_7::augustus_masked-Fvb2-4-processed-gene-8.2:2121-2241||RAPiDGENOMICS_rs1205_00801
ACAGAGCTAAACATAAATGATTGCAATCTGATTGATGGAGTGATACCCAATGATCTTGGCAATCTAGTCTTATTGAAGAGATTAAATCTGAGTGGTAATAACTTTGTTCATCTACCGGAA
>augustus_masked-Fvb2-4-processed-gene-8.2:2181:2301:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_7::augustus_masked-Fvb2-4-processed-gene-8.2:2181-2301|2x||RAPiDGENOMICS_rs1205_00802
AATCTAGTCTTATTGAAGAGATTAAATCTGAGTGGTAATAACTTTGTTCATCTACCGGAAAGCATCTCTCAGCTCTCCAAGCTTGAATCTCTCTACCTGAGAAACTGTAGCAAGCTGCAA
>augustus_masked-Fvb2-4-processed-gene-8.2:2241:2361:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_8::augustus_masked-Fvb2-4-processed-gene-8.2:2241-2361||RAPiDGENOMICS_rs1205_00803
AGCATCTCTCAGCTCTCCAAGCTTGAATCTCTCTACCTGAGAAACTGTAGCAAGCTGCAATTACTGCCTAAGAACCTTCCATTGAGTCTTCGAGATGTGAATGCAGAAGATTGTCAGTCG
>augustus_masked-Fvb2-4-processed-gene-8.2:23:143:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-8.2:23-143||RAPiDGENOMICS_rs1205_00804
AGCTGAATCAGAAGTTGTGCAAGAGATTGTAGGATACATTTTCAACAAACTAACTTATCAAACAATCTCAAGTCGTCCCTGCACGGAGTTAGTTGGCATAGATTCTCGAGTAAACAAACT
>augustus_masked-Fvb2-4-processed-gene-8.2:2361:2481:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_9::augustus_masked-Fvb2-4-processed-gene-8.2:2361-2481||RAPiDGENOMICS_rs1205_00805
CTGACAGATTATCCAGATCAATTCAAAGTATGGACTTCCACTGTTTCAGGAATGACTACTATTAGTTCCATCATTTCATCCAAACATCAAACATATTCTGCTACTCATCAGGCCGGGAAA
>augustus_masked-Fvb2-4-processed-gene-8.2:2481:2601:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_10::augustus_masked-Fvb2-4-processed-gene-8.2:2481-2601||RAPiDGENOMICS_rs1205_00806
ATCTCACACACATGGATTGCATCTACTATCCCGGGACGTAGCATCTTCAGTTGTTGCACATCATCAGATAACCATCAACAACGGAAGCTAGTTGAGGATTTGTCGTTGCCAAATCAAGTG
>augustus_masked-Fvb2-4-processed-gene-8.2:2619:2739:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-8.2:2619-2739||RAPiDGENOMICS_rs1205_00807
CTACTCGATTACAAGTCAAGCCCCATTAGTTCTGGTTGTCATGGAGATGAAATTCCCGAGTGGTTCAGCAATGTAGATTCAAACAGTTACATAGGACAACGCATACCTCCAGGACTGGAA
>augustus_masked-Fvb2-4-processed-gene-8.2:263:383:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-8.2:263-383||RAPiDGENOMICS_rs1205_00808
TGAGGCTTACAGCTTTGTTCCAAAAGTAAGAGAAGTATCTGGAAAAGAAGGGTTAGTTCATTTACAGAAGCAACTTATTTCTGACATCTTGATGGAATCTAATGTGAATATACAAAGTAT
>augustus_masked-Fvb2-4-processed-gene-8.2:2739:2859:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-8.2:2739-2859||RAPiDGENOMICS_rs1205_00809
GATGAGGAACAGTGGATGGGGGTTTCTGTTGTCTTCTTAGTCAAGGGACATCCTCCTGTCTCGGAGATTGAACCGGAAACTTCTAACTATTTCTATAAATGCATAGTTGGAACTGAAGAT
>augustus_masked-Fvb2-4-processed-gene-8.2:2859:2979:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-8.2:2859-2979||RAPiDGENOMICS_rs1205_00810
TTTCAACTGAGTCCGATTCTCCTTGACTGGGACAAATATCTTGGCTCACTTCCATTCAGTTCTCATTTTCTTTTCTTTTTCTACGTACCTCGCCTCTACTTCTCCTCCAAGAATTTAAAT
>augustus_masked-Fvb2-4-processed-gene-8.2:2979:3099:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-8.2:2979-3099||RAPiDGENOMICS_rs1205_00811
CAATCACGTTTAATATGCGCCTTCTTTTGGACCAATAACCCACGCATGGAGGTCCAGAAATGTGGGATTCGCCTACTATTCGAGCAAGGGATTCCAGAATTCATCCAAACATACATGCCA
>augustus_masked-Fvb2-4-processed-gene-8.2:3099:3219:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-8.2:3099-3219||RAPiDGENOMICS_rs1205_00812
CCTGCTTTTGGTCAAGACCGCAAACATAAGGTCATCTGTGAATTCCCTGCGTCTTCAGAAAGCGAAAATGTTGATGAAACTTCAATTGATTCTGGATGGTTAAGTCTACAAATTGGTGGC
>augustus_masked-Fvb2-4-processed-gene-8.2:323:443:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-8.2:323-443|2x||RAPiDGENOMICS_rs1205_00813
TTTACAGAAGCAACTTATTTCTGACATCTTGATGGAATCTAATGTGAATATACAAAGTATTAAAAGGGGAATCGACATAATGAGCCAGAGATTTTGCACTAAGAGAGTTCTTATCATTCT
>augustus_masked-Fvb2-4-processed-gene-8.2:3309:3429:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-8.2:3309-3429||RAPiDGENOMICS_rs1205_00814
GAACTAAAGCAGAGTGCTCAAAATTATGATTTTCTTACAAGGGGATGCCCGGCGTGGTTCAACCCTGAAGTTGGGGAGCAGGTATTAATCCAGTTGCTGCCTAATCAGAATCTCCACAAG
>augustus_masked-Fvb2-4-processed-gene-8.2:3429:3549:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-8.2:3429-3549||RAPiDGENOMICS_rs1205_00815
AATAAGAAATGGATGGGACTTGCTCTATGCGCATCATTCGTAGTGGACAAGCATACAGTACAAAACGATTATCAAGTTTTTTGTAGACTCCAAAGGGCCAGATCTCATTCTGTGGGATTT
>augustus_masked-Fvb2-4-processed-gene-8.2:3549:3669:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-8.2:3549-3669||RAPiDGENOMICS_rs1205_00816
AACATGTCATTGGACTGTAAAACCGTCATGATGCCTGGCACGCATCAACTTTTGGTTCTTTATATTCCACGGGCAGTGATTCCTGAACTGTTCATTCAAACACCATCAGAAGAAATCTGC
>augustus_masked-Fvb2-4-processed-gene-8.2:3669:3789:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-8.2:3669-3789||RAPiDGENOMICS_rs1205_00817
ACTGTCTATACAACCCGTAGCCCTGGTGTAAGGGTCGAACTCTGTGGGCTTCGTGTTTTGTACCCGCAAGATTTACCAGAGTTTGTTCAGACAATCATGCATTGCATATTCCGCAGCTCA
>augustus_masked-Fvb2-4-processed-gene-8.2:3789:3909:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-8.2:3789-3909||RAPiDGENOMICS_rs1205_00818
GGTGCGCCCCCTGAGGTCGTTTATAATAAATTGATCAAAGATTGGTTAAGTTTGATAAGATTGCCAAGTCATAAAATCCACGCTTCACGCGAAGGTGATTCCAGTAAGCAAGAGGGAAAA
>augustus_masked-Fvb2-4-processed-gene-8.2:383:503:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-8.2:383-503||RAPiDGENOMICS_rs1205_00819
TAAAAGGGGAATCGACATAATGAGCCAGAGATTTTGCACTAAGAGAGTTCTTATCATTCTTGATGATGTGGATGACTTGGAACAATTGAAAGCTCTGTGCGGTCATGGTTGGTTTGGCTC
>augustus_masked-Fvb2-4-processed-gene-8.2:3945:4065:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-8.2:3945-4065||RAPiDGENOMICS_rs1205_00820
GACTGGTCTACAAGTCACTTGGCTTGTACGTTCCCTGGAATCGGAATTCCCGAATGGTTCATGACTGTAGGCAAAAGCGACACTGCTCAAATCCAACTGAGTCCAAGTTTGTTTTACGAG
>augustus_masked-Fvb2-4-processed-gene-8.2:4065:4185:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_2::augustus_masked-Fvb2-4-processed-gene-8.2:4065-4185||RAPiDGENOMICS_rs1205_00821
GGTAGTTGGATGGGAGTTGCTGTGTGTGCTTCTCTATCCATCCACGAACATCCAAACGCAGTCTTCTCTGTTCATGACATTTTCTGTTTTCTGGAGTCTAATATTACCAACAGCGGTGTT
>augustus_masked-Fvb2-4-processed-gene-8.2:4185:4305:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_3::augustus_masked-Fvb2-4-processed-gene-8.2:4185-4305||RAPiDGENOMICS_rs1205_00822
GTCCGTTTTATGTTCCCTACAGACAATGAAATGTGGTCGCATGCATGCGATTTTGTCTGCTTCGTCTACTTACCTTGTGTACTATTTCCTGAATCCTGGAATCAGAGCGATAATCTGAAT
>augustus_masked-Fvb2-4-processed-gene-8.2:4305:4425:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-8.2:4305-4425||RAPiDGENOMICS_rs1205_00823
GCTACTGTTGGGTCCAGCAGCACAGGCTTAGGAGTACAGAATTGTGCCATTCGTCTAGTATTTGAGGAGGATTTGACTGATGTTACAGAAATGTTGTCTCTCTGCAACTTACGTGCACAT
>augustus_masked-Fvb2-4-processed-gene-8.2:443:563:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_4::augustus_masked-Fvb2-4-processed-gene-8.2:443-563|2x||RAPiDGENOMICS_rs1205_00824
TGATGATGTGGATGACTTGGAACAATTGAAAGCTCTGTGCGGTCATGGTTGGTTTGGCTCAGGGAGTAAAGTCATAATAACATCAAGGGATAGACAATTGCTGCTTACATATGGGATTAG
>augustus_masked-Fvb2-4-processed-gene-8.2:503:623:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-8.2:503-623||RAPiDGENOMICS_rs1205_00825
AGGGAGTAAAGTCATAATAACATCAAGGGATAGACAATTGCTGCTTACATATGGGATTAGAGAGGACCGTATATATAGTGTTAGGCTATTGAGTGATGTGGAAGCCCTTCAGCTGTTTAG
>augustus_masked-Fvb2-4-processed-gene-8.2:563:683:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_5::augustus_masked-Fvb2-4-processed-gene-8.2:563-683|2x||RAPiDGENOMICS_rs1205_00826
AGAGGACCGTATATATAGTGTTAGGCTATTGAGTGATGTGGAAGCCCTTCAGCTGTTTAGTTGGAAATCCTTCAAGAAATATAAGGTCCAAGAAGATTTTCTCCAACTATCAAAGAAGGT
>augustus_masked-Fvb2-4-processed-gene-8.2:623:743:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_6::augustus_masked-Fvb2-4-processed-gene-8.2:623-743||RAPiDGENOMICS_rs1205_00827
TTGGAAATCCTTCAAGAAATATAAGGTCCAAGAAGATTTTCTCCAACTATCAAAGAAGGTTGTGGAATATGCTCATGGGCTTCCATTAGCTATTGAACTTCTGGGTTCCTTGCTCTTTGG
>augustus_masked-Fvb2-4-processed-gene-8.2:683:803:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_6::augustus_masked-Fvb2-4-processed-gene-8.2:683-803|2x||RAPiDGENOMICS_rs1205_00828
TGTGGAATATGCTCATGGGCTTCCATTAGCTATTGAACTTCTGGGTTCCTTGCTCTTTGGTAAAGACATAAAAGTATGGACAAGTGCATTGGATAGACTAAAAGCAGGAAATCCTACCAA
>augustus_masked-Fvb2-4-processed-gene-8.2:803:923:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_7::augustus_masked-Fvb2-4-processed-gene-8.2:803-923|2x||RAPiDGENOMICS_rs1205_00829
AAAAATTGTTAATGTGTATAAAGTAAGTTTTGATGCCTTGGAAGACACAGAAAAGGAAGTATTTCTGGACATTGCATGTTTCTTTAAAGGAGAAGACAAAGATCGTGTAATAAGAATACT
>augustus_masked-Fvb2-4-processed-gene-8.2:83:203:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_1::augustus_masked-Fvb2-4-processed-gene-8.2:83-203|2x||RAPiDGENOMICS_rs1205_00830
AACAATCTCAAGTCGTCCCTGCACGGAGTTAGTTGGCATAGATTCTCGAGTAAACAAACTCCTTGATTACTTGGATATGCATAACATGAATGGAGTATGTACCGTAGGCGTTTTGGGTAT
>augustus_masked-Fvb2-4-processed-gene-8.2:863:983:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_8::augustus_masked-Fvb2-4-processed-gene-8.2:863-983||RAPiDGENOMICS_rs1205_00831
ATTTCTGGACATTGCATGTTTCTTTAAAGGAGAAGACAAAGATCGTGTAATAAGAATACTAGAAAGTAAGTCTGGCTACAGCCCAGACATAGATATAGAAGTTCTCATGGATAAATCTAT
>augustus_masked-Fvb2-4-processed-gene-8.2:923:1043:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_8::augustus_masked-Fvb2-4-processed-gene-8.2:923-1043|2x||RAPiDGENOMICS_rs1205_00832
AGAAAGTAAGTCTGGCTACAGCCCAGACATAGATATAGAAGTTCTCATGGATAAATCTATAGTAAATCTCCTTGGAAGAAAAGTGGAGTTACATGATAGGATACAAGAACTGGGCTGGGA
>augustus_masked-Fvb2-4-processed-gene-8.2:983:1103:Parent=augustus_masked-Fvb2-4-processed-gene-8.2-mRNA-1_9::augustus_masked-Fvb2-4-processed-gene-8.2:983-1103||RAPiDGENOMICS_rs1205_00833
AGTAAATCTCCTTGGAAGAAAAGTGGAGTTACATGATAGGATACAAGAACTGGGCTGGGACATTGTTCGTCGACAAAAGCCGTACAAAGGTAGTAGGTTATGGCTTCTCAAGGATATCAT
>augustus_masked-Fvb3-1-processed-gene-107.3:0:120:Parent=augustus_masked-Fvb3-1-processed-gene-107.3-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-107.3:0-120||RAPiDGENOMICS_rs1205_00834
ATGGGTCGCAAGACGAAGGTGAAATTCGGACACGTGCCGCGCTTGAGATGCTCGGAGGCGGTTCCACAAGATGACCGGATTAGTGGGAGTGGCTCTGGAAAAACCACTCTTGTTAAGGAG
>augustus_masked-Fvb3-1-processed-gene-107.3:145:265:Parent=augustus_masked-Fvb3-1-processed-gene-107.3-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-107.3:145-265||RAPiDGENOMICS_rs1205_00835
CTTACTTTGGTGAGAGGATCCTGTTCCTGACGGTGTCACAATCTCCGGATGTAGATGATCTCAAGGCCAAGATTTTGGGGTTCATTATGGGGGGTCAAGTTCTGAGTCCCACTTCTGTGC
>augustus_masked-Fvb3-1-processed-gene-107.3:265:385:Parent=augustus_masked-Fvb3-1-processed-gene-107.3-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-107.3:265-385||RAPiDGENOMICS_rs1205_00836
TTCCTCAAATGAACTTTCAATTTGAATGGAACAACCCAACAAAGACCCTGGTGGTTTTGGATGATGTTTGGTCACTCTCAACGCTTCAGCCACTGCTCTTCAACATTCCTGGGTGTAAAA
>augustus_masked-Fvb3-1-processed-gene-107.3:325:445:Parent=augustus_masked-Fvb3-1-processed-gene-107.3-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-107.3:325-445|2x||RAPiDGENOMICS_rs1205_00837
ATGATGTTTGGTCACTCTCAACGCTTCAGCCACTGCTCTTCAACATTCCTGGGTGTAAAACCCTAGTGGTTTCACGTGTCAAATTCCCAACTGCTGTTAAAGCCACCTATGACGTGGAGT
>augustus_masked-Fvb3-1-processed-gene-107.3:385:505:Parent=augustus_masked-Fvb3-1-processed-gene-107.3-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-107.3:385-505||RAPiDGENOMICS_rs1205_00838
CCCTAGTGGTTTCACGTGTCAAATTCCCAACTGCTGTTAAAGCCACCTATGACGTGGAGTTTCTGGGTGAAGACGAAGCAGTGTCTTTGTTTTGCCACTCTGCTTTTGGCCAAAAGTCGA
>augustus_masked-Fvb3-1-processed-gene-107.3:899:1019:Parent=augustus_masked-Fvb3-1-processed-gene-107.3-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-107.3:899-1019||RAPiDGENOMICS_rs1205_00839
AGATGGAGATATATACAGCAGTTGCTATGACATCTCAGTTACACAACATGATGTCTTGCGAGACCTTGCTCTTCATTTGAGTAATAATGGCTCCATAAATCAACGAACTCGATTACTGAT
>augustus_masked-Fvb3-1-processed-gene-13.10:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-13.10-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-13.10:120-240||RAPiDGENOMICS_rs1205_00840
TCAATTCCTCTGAATTGGACTTCCGGTGATTGCTGCAGTTGGGAGGGCATCTCTTGTAACCGGGGTGGTTCGGTCACTCATTTGAGCTTACCCTCCAAAGGCCTCAAACTCAAAGGAGGT
>augustus_masked-Fvb3-1-processed-gene-13.10:1260:1380:Parent=augustus_masked-Fvb3-1-processed-gene-13.10-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-13.10:1260-1380|2x||RAPiDGENOMICS_rs1205_00841
GGTTTTCAAGGTGGGGAATTGCCAGGTGATCTTGGCGTGGTGAATTTCGATGGACTCCAAAATCTTCGGCTTTTGTCTTTAGATGATTGTGGCTTCACTGGTCAAATACCTGCATGGTTG
>augustus_masked-Fvb3-1-processed-gene-13.10:1440:1560:Parent=augustus_masked-Fvb3-1-processed-gene-13.10-mRNA-1_13::augustus_masked-Fvb3-1-processed-gene-13.10:1440-1560||RAPiDGENOMICS_rs1205_00842
CCTAGTTGGTTGGGGAATCTTCCAAGGCTCAAGTTTTTGAACTTGGGGGCCAACCTAATTTCAGGTGACCTTCCAAAGGAACTCTGTAGGCTACCAATGTGGATGTTCGAAAACACTACT
>augustus_masked-Fvb3-1-processed-gene-13.10:1560:1680:Parent=augustus_masked-Fvb3-1-processed-gene-13.10-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-13.10:1560-1680||RAPiDGENOMICS_rs1205_00843
GCTACTCAAGAAGATGATATTGAGCTTGAATTGCCCGTCTATGGATCGCGAGGTCCTACCTTGTTTGTACAGGTTACATTGTCTTACTTTCCTATTGCAATGGACTTAAAGAGCAATAAC
>augustus_masked-Fvb3-1-processed-gene-13.10:1620:1740:Parent=augustus_masked-Fvb3-1-processed-gene-13.10-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-13.10:1620-1740|2x||RAPiDGENOMICS_rs1205_00844
TTGTTTGTACAGGTTACATTGTCTTACTTTCCTATTGCAATGGACTTAAAGAGCAATAACATTAGTGGGAGCATACCTATTGAGATTGGCCAAGTGCAGCTTCTCCGTCATTTGGATCTT
>augustus_masked-Fvb3-1-processed-gene-13.10:1740:1860:Parent=augustus_masked-Fvb3-1-processed-gene-13.10-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-13.10:1740-1860|2x||RAPiDGENOMICS_rs1205_00845
AGCAACAACAGCTTCACCGGAAACATCCCCGAGCAGATATCTAACCTCAAGAACCTCGAGACATTGTCACTTTTCAAGAATCATTTGTCCGGGAAGATTCCGTCCTCACTGACGAGGCTT
>augustus_masked-Fvb3-1-processed-gene-13.10:1800:1920:Parent=augustus_masked-Fvb3-1-processed-gene-13.10-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-13.10:1800-1920||RAPiDGENOMICS_rs1205_00846
ACATTGTCACTTTTCAAGAATCATTTGTCCGGGAAGATTCCGTCCTCACTGACGAGGCTTAATTTTCTGAAAGACTTTAATGTCTCATACAATAACCTTGAAGGCGAAATCCCAACAAGC
>augustus_masked-Fvb3-1-processed-gene-13.10:300:420:Parent=augustus_masked-Fvb3-1-processed-gene-13.10-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-13.10:300-420|2x||RAPiDGENOMICS_rs1205_00847
AATTCACTTGATGGTTCGATAGAGCCAAGTAGTGGCTTCTTCTTGTCCTTGAGTCATCTTGAGGTACTTGATTTGAGCTATAACCTTCTTTCCGGAGAGCTACCACTTTCTCTACCATCC
>augustus_masked-Fvb3-1-processed-gene-13.10:60:180:Parent=augustus_masked-Fvb3-1-processed-gene-13.10-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-13.10:60-180|2x||RAPiDGENOMICS_rs1205_00848
CATGCATGCAACCAAACTGAACGCAGCTCTCTTCAATCCTTCGCCCTCACCTTGTCTACTTCAATTCCTCTGAATTGGACTTCCGGTGATTGCTGCAGTTGGGAGGGCATCTCTTGTAAC
>augustus_masked-Fvb3-1-processed-gene-13.10:600:720:Parent=augustus_masked-Fvb3-1-processed-gene-13.10-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-13.10:600-720||RAPiDGENOMICS_rs1205_00849
TTCAATAATTTCAATGGTAGTATATCTCAGGGAATAGGGGAGTGTTCCCAACTAAAGGTTTTTCGAGCCGGGAACAATAACCTTTCTGGATTACTTCCACAAGATATCTATAGTGCTACC
>augustus_masked-Fvb3-1-processed-gene-13.10:900:1020:Parent=augustus_masked-Fvb3-1-processed-gene-13.10-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-13.10:900-1020|2x||RAPiDGENOMICS_rs1205_00850
GAAGGTTCTCTGCCCCCATCTCTGATGAATTGCACTGACCTTAGAGAGTTGAATCTCGGCATCAACCATTTGGAAGGTAATATCTCTACCTTCAATTTCTCAAAACTAAGTAAACTCAGT
>augustus_masked-Fvb3-1-processed-gene-155.9:0:120:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-155.9:0-120||RAPiDGENOMICS_rs1205_00851
ATGGATATCTATGTCTACTTCAACCCTATTTCTCGCCTCATTCTTCAGTTCCTGCTCCTGTTAATCTTAGCCCCTTCATGCCTAAACACCAGTAGTACTGTGGAGTCATGCATGGAGAAA
>augustus_masked-Fvb3-1-processed-gene-155.9:1080:1200:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-155.9:1080-1200||RAPiDGENOMICS_rs1205_00852
TCCAATAGAATGGAGTCGCTAGATTTGAGTGGTTGTGGGCTGGAAGGTGAGTTGCCTAGTTCATTAGGAATGCTGAAAAGCCTGCAACGACTTTACCTCGGCTACAACTCTTTTCGGGGA
>augustus_masked-Fvb3-1-processed-gene-155.9:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-155.9:120-240||RAPiDGENOMICS_rs1205_00853
GAGAGACAGGCGCTTCTCAACTTTAAGCAATATCTTATTGATCGATCTGGGAGGCTTTCTTCTTGGGTTGGTCATCAATGCTGTGAATGGAGAGGGATTTCGTGCAACAACCACACAGGT
>augustus_masked-Fvb3-1-processed-gene-155.9:1200:1320:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-155.9:1200-1320||RAPiDGENOMICS_rs1205_00854
TCCTTTCCTGAATCTATTATTAGCAACTTATCATCATCCCTCAAGACACTGGACTTGGGTGGTAATCTTTTCAATGGTCCCATTCCTGAAAGTTTGGGACAACTCAGTCAGCTCGTTAGC
>augustus_masked-Fvb3-1-processed-gene-155.9:1560:1680:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-155.9:1560-1680||RAPiDGENOMICS_rs1205_00855
AGGAATGCTGGAATCTCAGGTGCAATACCAGAAGGATGGATGTCTAATATCTCTTCCCAAATCCAAAGTTTGGATTTATCCAACAATCAAATAAGCGGAAAGCTTCCCCTCCAATTCAAC
>augustus_masked-Fvb3-1-processed-gene-155.9:1680:1800:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-155.9:1680-1800||RAPiDGENOMICS_rs1205_00856
TTTCCAGATCTGCGCGTGATACATTTCGGCCACAATCAATTTTATGGAACTATTCCATCATCTATCTGCAGCATTCAATATCTGGGCACCCTTGCTCTGAATAACAATCAGTTATCCGGA
>augustus_masked-Fvb3-1-processed-gene-155.9:1800:1920:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-155.9:1800-1920||RAPiDGENOMICS_rs1205_00857
GAATTCCCTAAAGAATGGAGTTTGTGGAGCGACATATTCTCTGTGGATGTCTCAAACAACAATCTGACTGGTGAAATTCCCAGATCGATGGGCATTCCAAGTTCTCTTTATATATTAAAG
>augustus_masked-Fvb3-1-processed-gene-155.9:1920:2040:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-155.9:1920-2040||RAPiDGENOMICS_rs1205_00858
ATGGCCAACAATCAGTTAAGCGGAGAAATTCCTTCCGCCTTGCAAAATTGCTTATTTTTGGAAAGACTTTCTCTTGGAGGCAACGAATTCACCGGAAGCATACCTTCTTGGATAGGATCA
>augustus_masked-Fvb3-1-processed-gene-155.9:2040:2160:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_18::augustus_masked-Fvb3-1-processed-gene-155.9:2040-2160||RAPiDGENOMICS_rs1205_00859
AAGGTATCCGGATTCCAAGTGCTACAATTGCGATCAAACTCGTTAAGCGGACATATTCCTCACCAACTGTGCAGTCTTCCTCACCTTCAATTCCTAGACCTTGGTCACAACAGATTTTCA
>augustus_masked-Fvb3-1-processed-gene-155.9:2160:2280:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_19::augustus_masked-Fvb3-1-processed-gene-155.9:2160-2280||RAPiDGENOMICS_rs1205_00860
GGGACTATTCCCAAGTGTTTGAATAACTTGACTTCTCTAGTCTCTGGTCCGGATAATGGTTGGGATTCCTTTAGTGGCTTTGAGGAAACAACCGCGACTACAAAAGGAAGAGAAAGTGAA
>augustus_masked-Fvb3-1-processed-gene-155.9:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-155.9:240-360||RAPiDGENOMICS_rs1205_00861
CGTATTGTCAGGCTAGATCTTCGTAATCCATATCCATATCCATCCAGTGTGTTTTATCATTACAGGTGGAAGGACATCAAATTTGATGAATCTTGTTTAGGGGGTAAGTTACATCCTTCA
>augustus_masked-Fvb3-1-processed-gene-155.9:720:840:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-155.9:720-840||RAPiDGENOMICS_rs1205_00862
TCTAATTGCCAAATTGATGGAAACCAGGTTCCACTCTCGCTACCAACAATTAACTTCACATCTCTTTTGGTCCTTGATGTGTCATATAACCATATAAATTCTTCATTTCCTAAATGGCTG
>augustus_masked-Fvb3-1-processed-gene-155.9:780:900:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-155.9:780-900|2x||RAPiDGENOMICS_rs1205_00863
TCTCTTTTGGTCCTTGATGTGTCATATAACCATATAAATTCTTCATTTCCTAAATGGCTGTTTAATCTTACTAGTCTTACAAAACTCGATTTAGGGGGTAATCCTTTCCTTGGCCCCTCT
>augustus_masked-Fvb3-1-processed-gene-155.9:840:960:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-155.9:840-960||RAPiDGENOMICS_rs1205_00864
TTTAATCTTACTAGTCTTACAAAACTCGATTTAGGGGGTAATCCTTTCCTTGGCCCCTCTCTTGAAGAATTCGTAAGACTAAAAGCTGTAGAACACCTTGACTTAGGGGGCATTGGACTC
>augustus_masked-Fvb3-1-processed-gene-155.9:900:1020:Parent=augustus_masked-Fvb3-1-processed-gene-155.9-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-155.9:900-1020|2x||RAPiDGENOMICS_rs1205_00865
CTTGAAGAATTCGTAAGACTAAAAGCTGTAGAACACCTTGACTTAGGGGGCATTGGACTCAAAGGTCAATTACTTCCCAAATTCTTCGGAAACTTGTGCAAGCTAAAGTCATTAGATCTT
>augustus_masked-Fvb3-1-processed-gene-16.0:0:120:Parent=augustus_masked-Fvb3-1-processed-gene-16.0-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-16.0:0-120||RAPiDGENOMICS_rs1205_00866
ATGCCGAAACACTCCTGGAGGCAAGAGAGCAAGCTGATTCCGTTGTCAAGCATCTTAAATATTCTTGCTTGCTTTTGGATAGTGCAGAAGATGGATGTGTACTGTGTAAGGATGCATGAT
>augustus_masked-Fvb3-1-processed-gene-16.0:1045:1165:Parent=augustus_masked-Fvb3-1-processed-gene-16.0-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-16.0:1045-1165||RAPiDGENOMICS_rs1205_00867
AATTTCTACCACCTGGGTCTCTATTCAAGTTGAAGGTATTGAAGGTAGAAGATTGTTACAACTGGTGGAATATACTTTTACCATCAACATTGTTACATAGACTACCAAATTTGGAAGAAT
>augustus_masked-Fvb3-1-processed-gene-16.0:1165:1285:Parent=augustus_masked-Fvb3-1-processed-gene-16.0-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-16.0:1165-1285||RAPiDGENOMICS_rs1205_00868
TAATTGTTCGTCGGACGGACGGGAGTGAATATATGTTTGGGTATGAAGCCGTGCTTGTGTTGCGACAATTAAAGTTGAAAAAGATAAAATTGGAGGAACTACCAATGTTGTGCTATGAAA
>augustus_masked-Fvb3-1-processed-gene-16.0:205:325:Parent=augustus_masked-Fvb3-1-processed-gene-16.0-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-16.0:205-325||RAPiDGENOMICS_rs1205_00869
ATCTTAGCTTCACTGGCCTTTCATTACTGCCCAAATCATTCGCTCTCCTAACCAACCTCACAGCTTTGTATTTAGATGATTGTGATCTTCGAAGAATTGACACTTCCATACTGGGAAAAC
>augustus_masked-Fvb3-1-processed-gene-16.0:265:385:Parent=augustus_masked-Fvb3-1-processed-gene-16.0-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-16.0:265-385|2x||RAPiDGENOMICS_rs1205_00870
CAGCTTTGTATTTAGATGATTGTGATCTTCGAAGAATTGACACTTCCATACTGGGAAAACTCAAAAAGCTTGAGATGCTGAGTATGAGAAATTCACGTCTGTATGAGTTGTCGGTAGAAA
>augustus_masked-Fvb3-1-processed-gene-16.0:445:565:Parent=augustus_masked-Fvb3-1-processed-gene-16.0-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-16.0:445-565||RAPiDGENOMICS_rs1205_00871
CCTCCAAACTGATATCAAAGCTGCATGATTTAGAAGAACTGTATATGCAAGGATTTTGGAAGTGGAAGCACTTGTGGACTAACGGACGAGGAGGAGTCAATGATACCTTTACTAATGCTA
>augustus_masked-Fvb3-1-processed-gene-16.0:565:685:Parent=augustus_masked-Fvb3-1-processed-gene-16.0-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-16.0:565-685||RAPiDGENOMICS_rs1205_00872
GCTTTGACGAGGTAACTAGCTTGTCAAAATTAAGAGTTTTGAAGGTTACAATCGGGGGTGATGAATATAACCCTAAATATGTTGAGTTGAAAATGAATTTGGTTGAGTTTGATATATGTA
>augustus_masked-Fvb3-1-processed-gene-16.0:685:805:Parent=augustus_masked-Fvb3-1-processed-gene-16.0-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-16.0:685-805||RAPiDGENOMICS_rs1205_00873
TTGGTTGTTTATACGAGGCTGTTTTATCCGAGCCATACAAGAAGTTATATGATCGACATCGTCATATCTCAATATGCTTGCTTGTCATGATCAGTCACTTTCCGGAGTGGTTTCGCTACG
>augustus_masked-Fvb3-1-processed-gene-16.0:805:925:Parent=augustus_masked-Fvb3-1-processed-gene-16.0-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-16.0:805-925||RAPiDGENOMICS_rs1205_00874
AGATAATGAAGAAAGCAGAGACACTTCACTACTCTTGGTGCCAAAGGTTAATCGACATATTTGTGGAATCTGAGCATGGGAGGTTACAGAGACTGAAGCATCTGCATATAGTGGGTTCCA
>augustus_masked-Fvb3-1-processed-gene-16.0:925:1045:Parent=augustus_masked-Fvb3-1-processed-gene-16.0-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-16.0:925-1045||RAPiDGENOMICS_rs1205_00875
GGAGTCAAGACATCACGGAGGTGGATCCTGCAATAACATGGGTTCCAAGAAAGCCTGTGTTCAAGAATTTGGAAGAGTTGTATCTGGATGAACTGGATTGTGCAGAGTTACGTGCAGTTC
>augustus_masked-Fvb3-1-processed-gene-18.5:0:120:Parent=augustus_masked-Fvb3-1-processed-gene-18.5-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-18.5:0-120||RAPiDGENOMICS_rs1205_00876
ATGAAGACACTTATTGTAATAGTTGCGGTACTCTTGGCTAGTACTAGTTGGGCCGTGCGAGCATGTCCGCCATCAGACCGGGCGGCCCTGCTCGCTTTCAAAGCGAGCCTCCACGAGCCC
>augustus_masked-Fvb3-1-processed-gene-18.5:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-18.5-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-18.5:240-360||RAPiDGENOMICS_rs1205_00877
CCTATTTTCGAACGTGCCAAAAGAACCGGCTACATGACCGGTACCATCTCGCCGGCCATATGCCGCCTCACTCGCCTCTCCAGCATCACCATCGCCGACTGGAAGGGCATCTCCGGCGAG
>augustus_masked-Fvb3-1-processed-gene-18.5:360:480:Parent=augustus_masked-Fvb3-1-processed-gene-18.5-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-18.5:360-480||RAPiDGENOMICS_rs1205_00878
ATTCCCCGGTGCATCTCCAACTTACCATTCCTCCGGATCCTTGACCTCATCGGAAACAAGCTCACCGGACCTCTTCCTTCTGACATCGGCCGCCTCCAGCGCCTCACCGTCCTCAACGTC
>augustus_masked-Fvb3-1-processed-gene-18.5:480:600:Parent=augustus_masked-Fvb3-1-processed-gene-18.5-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-18.5:480-600||RAPiDGENOMICS_rs1205_00879
GCCGACAATCAAATCTCCGGTCCCATCCCCGAGTCTCTCACGAAGATCTCGTCCCTCATGCACCTCGACCTCCGCAACAACAAGATTTCCGGTAAGTTGCCGCAAGATTTTAACCGACTT
>augustus_masked-Fvb3-1-processed-gene-18.5:540:660:Parent=augustus_masked-Fvb3-1-processed-gene-18.5-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-18.5:540-660|2x||RAPiDGENOMICS_rs1205_00880
CACCTCGACCTCCGCAACAACAAGATTTCCGGTAAGTTGCCGCAAGATTTTAACCGACTTACAATGCTCAGCCGCGCTTTGCTCAGCAAGAACATGCTCACTGGTCCCATCCCTGCCTCC
>augustus_masked-Fvb3-1-processed-gene-18.5:600:720:Parent=augustus_masked-Fvb3-1-processed-gene-18.5-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-18.5:600-720||RAPiDGENOMICS_rs1205_00881
ACAATGCTCAGCCGCGCTTTGCTCAGCAAGAACATGCTCACTGGTCCCATCCCTGCCTCCATCTCTCAAATCTACCGTCTTGCTGATCTTGATCTCTCTCTTAACCAACTCTCCGGTCCC
>augustus_masked-Fvb3-1-processed-gene-18.5:840:960:Parent=augustus_masked-Fvb3-1-processed-gene-18.5-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-18.5:840-960||RAPiDGENOMICS_rs1205_00882
CGAAACGACCTCCATGGTTTCATACCAAACGTGTTTGGTCCGAGATCCTACTTCACTGTCATGGACTTGTCGTTCAATAGATTGAGAGGTAATATTCCGTCGACCATCTCGTCGGCTTCG
>augustus_masked-Fvb3-1-processed-gene-18.5:900:1020:Parent=augustus_masked-Fvb3-1-processed-gene-18.5-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-18.5:900-1020|2x||RAPiDGENOMICS_rs1205_00883
ATGGACTTGTCGTTCAATAGATTGAGAGGTAATATTCCGTCGACCATCTCGTCGGCTTCGTACGTCGGTCACTTGGATTTGAGCCACAACCATCTCTGTGGGAAGATTCCGGTCGGTTCC
>augustus_masked-Fvb3-1-processed-gene-18.5:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-18.5-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-18.5:960-1080||RAPiDGENOMICS_rs1205_00884
TACGTCGGTCACTTGGATTTGAGCCACAACCATCTCTGTGGGAAGATTCCGGTCGGTTCCCCTTTCGACCACCTTGAAGCATCGTCGTTTACTTTCAATGATTGCTTATGTGGGAAGCCT
>augustus_masked-Fvb3-1-processed-gene-204.6:1020:1140:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-204.6:1020-1140|2x||RAPiDGENOMICS_rs1205_00885
GATCTAAATTTCACTGGTCTTTCCAAACTCTGCACACTTGACCTTGCTACTAATCGTTTTTCTGGCTTCCTTCCAAATTCACTTGCATACTGTCGTGAGTTGAAAACCTTAAGCCTGGCT
>augustus_masked-Fvb3-1-processed-gene-204.6:1080:1200:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-204.6:1080-1200||RAPiDGENOMICS_rs1205_00886
TCTGGCTTCCTTCCAAATTCACTTGCATACTGTCGTGAGTTGAAAACCTTAAGCCTGGCTAAGAATGAGTTACGGGGTTCAGTCCCTGAAGACTTTGCCAAACTCACATCCCTTTTCTTT
>augustus_masked-Fvb3-1-processed-gene-204.6:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-204.6:120-240||RAPiDGENOMICS_rs1205_00887
GCACTCAAGGGATTTGCAGGAAACCTTACAAGCGGGGCTATTATCACAGCATGGTCCAGGAACTCACATTGCTGCGAATGGGATGGTGTGGTTTGTGAGATTGTGAATAATGGGACAGCT
>augustus_masked-Fvb3-1-processed-gene-204.6:1200:1320:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-204.6:1200-1320||RAPiDGENOMICS_rs1205_00888
CTCTCATTGTCAAATAACAGCTTTGTAAACTTATCTGGGGCACTGTCTGTGCTACAGCAGTGCAAAAACCTCACCACTCTTATTCTTACCAAAAATTTCCTTGGTGAGGAAATTCCCAAA
>augustus_masked-Fvb3-1-processed-gene-204.6:1260:1380:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-204.6:1260-1380|2x||RAPiDGENOMICS_rs1205_00889
TGCAAAAACCTCACCACTCTTATTCTTACCAAAAATTTCCTTGGTGAGGAAATTCCCAAAAATGCAAGTGGCTTTGAAAGTTTAATGGTTTTAGCACTTGGGAATTGTGCTCTAAAAGGC
>augustus_masked-Fvb3-1-processed-gene-204.6:1380:1500:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-204.6:1380-1500|2x||RAPiDGENOMICS_rs1205_00890
CAAATTCCAGCTTGGTTATTGAGATGCAGGAAGTTGCAAGTCCTTGATTTGTCATGGAATCACTTGGATGGTAGTATCCCTTCGTGGATTGGTCAGATGGAGAAATTGTTTTATGTGGAC
>augustus_masked-Fvb3-1-processed-gene-204.6:1560:1680:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-204.6:1560-1680||RAPiDGENOMICS_rs1205_00891
ATATCTACAAATTGCACCCAATCATATCTTACTGCCTCTGCTGGCATCCCGCTATTTGTGAAGCGAAATAAGAGTGCTAATGGACTGCAATACAACCAGGCATCAAGTTTTCCACCTTCA
>augustus_masked-Fvb3-1-processed-gene-204.6:1680:1800:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-204.6:1680-1800||RAPiDGENOMICS_rs1205_00892
ATATACTTGAGCAATAATAGAATCAATGGATCAATCTGGCCTGAAGTCGGACGACTGAAACAGCTCCATGTTTTGGATTGGAGCAGGAACAACATTACTGGGACCATTCCCAGCTCAATC
>augustus_masked-Fvb3-1-processed-gene-204.6:1740:1860:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-204.6:1740-1860|2x||RAPiDGENOMICS_rs1205_00893
CAGCTCCATGTTTTGGATTGGAGCAGGAACAACATTACTGGGACCATTCCCAGCTCAATCTCAGAGATGGAGAACTTGGAAACATTGGATTTATCATGGAATAATCTGTATGGTTCCATC
>augustus_masked-Fvb3-1-processed-gene-204.6:180:300:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-204.6:180-300|2x||RAPiDGENOMICS_rs1205_00894
AACTCACATTGCTGCGAATGGGATGGTGTGGTTTGTGAGATTGTGAATAATGGGACAGCTGCAAGCAAAGTCAGAGTCACCAAGTTGTTTCTTCCCAGCATGAGTCTTAATGGAACGATT
>augustus_masked-Fvb3-1-processed-gene-204.6:1800:1920:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-204.6:1800-1920||RAPiDGENOMICS_rs1205_00895
TCAGAGATGGAGAACTTGGAAACATTGGATTTATCATGGAATAATCTGTATGGTTCCATCCCTCCATCACTTAGCAAGCTCACATTCTTGTCAAAGTTTAGTGTGGCAAATAATCACTTG
>augustus_masked-Fvb3-1-processed-gene-204.6:1860:1980:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-204.6:1860-1980|2x||RAPiDGENOMICS_rs1205_00896
CCTCCATCACTTAGCAAGCTCACATTCTTGTCAAAGTTTAGTGTGGCAAATAATCACTTGCATGGAGTCATTCCCAATGAAGGACAGTTCTTGAGCTTTCCCAATTCAAGCTTTGAAGGC
>augustus_masked-Fvb3-1-processed-gene-204.6:2160:2280:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_19::augustus_masked-Fvb3-1-processed-gene-204.6:2160-2280||RAPiDGENOMICS_rs1205_00897
AGGGAAGCTGAGAATCAAATTGATGATTTTGATGAGGAACACAGTAGGCCTCACAGGTTATCTGAAGCACTTGCATCTTCAAAATTGGTGCTTTTTCAGAATGCTGGTTGTAAGGATTTC
>augustus_masked-Fvb3-1-processed-gene-204.6:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-204.6:240-360||RAPiDGENOMICS_rs1205_00898
GCAAGCAAAGTCAGAGTCACCAAGTTGTTTCTTCCCAGCATGAGTCTTAATGGAACGATTTTGCGCTCCTTGGGTGGATTGGATCAGCTGCAATTGCTTAATCTTTCAATGAATCATCTT
>augustus_masked-Fvb3-1-processed-gene-204.6:2520:2640:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_22::augustus_masked-Fvb3-1-processed-gene-204.6:2520-2640||RAPiDGENOMICS_rs1205_00899
AGGTTGTTAATTTACTCTTACATGGAGAATGGAAGCTTGGATTATTGGCTGCATGAAAGTGTCAACGGAATTTCACCTCTGAAATGGGATGTAAGACTTAAGATAGCTCAAGGTGCTGCT
>augustus_masked-Fvb3-1-processed-gene-204.6:2640:2760:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_23::augustus_masked-Fvb3-1-processed-gene-204.6:2640-2760||RAPiDGENOMICS_rs1205_00900
CACGGATTGGCTTACTTGCATAAGGGCTGTCAGCCAAATATTGTGCATCGAGATATAAAAACAAGCAACATTCTTCTCGATGAAAAATTTGAAGCTCATCTGGCTGATTTTGGTCTTTCA
>augustus_masked-Fvb3-1-processed-gene-204.6:2880:3000:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_25::augustus_masked-Fvb3-1-processed-gene-204.6:2880-3000||RAPiDGENOMICS_rs1205_00901
GGTGTTGTTCTTCTTGAACTTGTAACTGGCAGAAGACCTGTTGAAGTGTGCAAAGGGAAAAACTGCAGAGATTTGGTATCATGGATGTTTCAGATGAGACGTGAGAAGAGAGAGGAGGAA
>augustus_masked-Fvb3-1-processed-gene-204.6:3000:3120:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_26::augustus_masked-Fvb3-1-processed-gene-204.6:3000-3120||RAPiDGENOMICS_rs1205_00902
ATTATAGATTCATCAATCTGGAACAAGGGTCATGAGAAGCAGCTTTTGCAGGTACTTGACGTTGCCTGTAAATGCCTAGATCCCAATCCCAGGCAGAGACCCTTTATTGAAGAAGTTGTA
>augustus_masked-Fvb3-1-processed-gene-204.6:360:480:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-204.6:360-480||RAPiDGENOMICS_rs1205_00903
CGAGGTGTATTGCCAGCAGAGCTATCAAACTTGAAGCGGCTGGAAGTTCTTGATTTGAGCTATAACAGGCTTTCAGGACCAGTTTCAGGTGTGCTTGTTAGTTTGAAATCCATTAAAGTG
>augustus_masked-Fvb3-1-processed-gene-204.6:480:600:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-204.6:480-600||RAPiDGENOMICS_rs1205_00904
CTGAACATTTCAAGCAATTCAATCAATGGTGACTTATCTGAGCTAGTGGGTTTACCAAATCTTGTGGTATTCAACATAAGCAATAATTCATTCACTGGTCAGTTCAATCCTCAAATTTGT
>augustus_masked-Fvb3-1-processed-gene-204.6:60:180:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-204.6:60-180|2x||RAPiDGENOMICS_rs1205_00905
CTTGGTTCTTCGTTGGGTCTTGATGCCCCAATCCAATCCTGTGATCCTAGTGATCTTCTTGCACTCAAGGGATTTGCAGGAAACCTTACAAGCGGGGCTATTATCACAGCATGGTCCAGG
>augustus_masked-Fvb3-1-processed-gene-204.6:600:720:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-204.6:600-720||RAPiDGENOMICS_rs1205_00906
AGCTCTTCCAATGCACTTCGTATTCTTGATATGTCTTTGAACCGTTTCACCGGCAGTCTTGAAGGCTTAGGCAATTGTAGCACATCTCTCCAGCAATTGCACTTGGACTTCAATTCATTT
>augustus_masked-Fvb3-1-processed-gene-204.6:720:840:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-204.6:720-840||RAPiDGENOMICS_rs1205_00907
GCAGGCCAGCTACCTGAATCTTTGTATTCTTTTTCGGCCTTGGAGCAGCTTTCAGTCTCTGGGAACTCTCTTTCTGGCCAAATAAGCAACAGACTAAGTAAGTTCTCTAGACTCAAGACA
>augustus_masked-Fvb3-1-processed-gene-204.6:840:960:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-204.6:840-960||RAPiDGENOMICS_rs1205_00908
TTACTCGTTTGTGGAAACCAATTTTTTGGTGAACTTCCTAATGTGTTTGGGAACCTTAGTCGACTAGAACAGTTAGTTGCACATTCAAATTTTTTATCTGGGCCATTGCCTTCAACTTTG
>augustus_masked-Fvb3-1-processed-gene-204.6:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-204.6-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-204.6:960-1080||RAPiDGENOMICS_rs1205_00909
GCACTCTGCTCAAATCTTCGAGTGCTTGATCTTCGAAACAATTCTCTATCAGGTTCTATTGATCTAAATTTCACTGGTCTTTCCAAACTCTGCACACTTGACCTTGCTACTAATCGTTTT
>augustus_masked-Fvb3-1-processed-gene-245.9:0:120:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-245.9:0-120||RAPiDGENOMICS_rs1205_00910
ATGCACCTCACTGTTGTTCACTATTTTCTTGTTTTATTTGTGGCCTCTTTGTATGTACACACCGGTTTCTGTCTTGGTGATGGACTTCCAAGCAGTTTGGGATCATCATGCATCGAGGAA
>augustus_masked-Fvb3-1-processed-gene-245.9:1080:1200:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-245.9:1080-1200||RAPiDGENOMICS_rs1205_00911
TCTGGATGCTCTCTGACGAGCGCATTCCCAGTTTCCATAGGAAAGCTAAAAAGCCTAGTGCATCTTCAGCTTAATTTCAATAATATCTGGGGCTCAATTCCAGAATCTGTTGGAAACTTG
>augustus_masked-Fvb3-1-processed-gene-245.9:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-245.9:120-240||RAPiDGENOMICS_rs1205_00912
GAGAGACGAGCTCTTCTCACCTTCAAACAGGATCTCATTGATCGCGCTGGTAGGCTTTCTTCTTGGGCAGGTCATGATTGCTGTCAGTGGAAAGGAATTTCATGCCACAATCTTACTGGT
>augustus_masked-Fvb3-1-processed-gene-245.9:1200:1320:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-245.9:1200-1320||RAPiDGENOMICS_rs1205_00913
TCGTGTTTGAAAACACTTGTCCTGTCTGATAATTCTATGAACGGGTCCATTCCAGAAAGTCTAGGACAACTGTCTGAGCTAGTTGAGTTATCTCTGTATAATAATTCCTGGGAAGGGATT
>augustus_masked-Fvb3-1-processed-gene-245.9:1320:1440:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-245.9:1320-1440||RAPiDGENOMICS_rs1205_00914
ATAACTGAAGCTCACTTTAGAAATCTCACCAGCTTGAAAAAATTTGTTTTATGGACATATGAACCCATCCCCCTTACTTTTAAGGTGTCTAATGAGTGGGTTCCTCCTTTCAAGCTTAAC
>augustus_masked-Fvb3-1-processed-gene-245.9:1440:1560:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_13::augustus_masked-Fvb3-1-processed-gene-245.9:1440-1560||RAPiDGENOMICS_rs1205_00915
TATATTGAAATTGGGAATTGTCAAGTAGGTCCAACCTTTCCGGTCTGGCTTATATCTCAGACTGAGCTAGTTCATGTCCTGCTTTACAATATTAATATCTCGGACTCCATACCAGAGAAC
>augustus_masked-Fvb3-1-processed-gene-245.9:1560:1680:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-245.9:1560-1680||RAPiDGENOMICS_rs1205_00916
TGGTTGTTGAAGATATCCTCCCGAGTCAAAATTCTGATTATATCTACCAACCAAATTGGTGGAAAGCTTCCATTGCAAATGGATTTCCCAAACTTAGAGGTTTTTGATTTAAGTTATAAT
>augustus_masked-Fvb3-1-processed-gene-245.9:1680:1800:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-245.9:1680-1800||RAPiDGENOMICS_rs1205_00917
CAACTTGAGGGTCCACTTCCACTTTGGTCCAATAATACATACCTCCTTGATCTTAGAAGCAATTTATTCTCCGGGCCAATGCCCTCAAACTTTGGCCAATTAATGCCCAAGTTAGGACAA
>augustus_masked-Fvb3-1-processed-gene-245.9:180:300:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-245.9:180-300|2x||RAPiDGENOMICS_rs1205_00918
TCTTGGGCAGGTCATGATTGCTGTCAGTGGAAAGGAATTTCATGCCACAATCTTACTGGTCACGTTGTAAGGATGGACCTCCGGAATGAGTGTCCATATGTTGACGAAGATGAAGCGACA
>augustus_masked-Fvb3-1-processed-gene-245.9:1800:1920:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-245.9:1800-1920||RAPiDGENOMICS_rs1205_00919
TTGTATCTCTCTGAGAATAATCTTAATGGTAGTATTCCAAAATCTCTTGGCAACATGCAAAGCTTATTTATCCTTAACCTAAGAAGCAACCAATTGTCAGGAGAATTTCCTCCGTTGTGG
>augustus_masked-Fvb3-1-processed-gene-245.9:1920:2040:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-245.9:1920-2040||RAPiDGENOMICS_rs1205_00920
AATTCTTGGCAAGATATAGTTGTTGTGGATGTGGGTAACAACAGTCTCTCTGGTCACATACCCAGCTCAATGGGTGTCCCAAGTTCTCTTGAGATATTGAAGTTGAACGACAACAAATTT
>augustus_masked-Fvb3-1-processed-gene-245.9:1980:2100:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-245.9:1980-2100|2x||RAPiDGENOMICS_rs1205_00921
CCCAGCTCAATGGGTGTCCCAAGTTCTCTTGAGATATTGAAGTTGAACGACAACAAATTTGAAGGCGAAATTCCTTCTTCCCTTCGAAATTGCTCTTCTCTGAAAAGTATTGATCTTGGA
>augustus_masked-Fvb3-1-processed-gene-245.9:2040:2160:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_18::augustus_masked-Fvb3-1-processed-gene-245.9:2040-2160||RAPiDGENOMICS_rs1205_00922
GAAGGCGAAATTCCTTCTTCCCTTCGAAATTGCTCTTCTCTGAAAAGTATTGATCTTGGAGGCAACAAGATTACTGGAATTGTACCATCATGGATAGGCCTAGACATGCCCCGGTTGACT
>augustus_masked-Fvb3-1-processed-gene-245.9:2100:2220:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_18::augustus_masked-Fvb3-1-processed-gene-245.9:2100-2220|2x||RAPiDGENOMICS_rs1205_00923
GGCAACAAGATTACTGGAATTGTACCATCATGGATAGGCCTAGACATGCCCCGGTTGACTACGCTAAGATTGAGTTCCAACTATCTACGTGGACATATTCCCCGTCAACTGTGCAATCTT
>augustus_masked-Fvb3-1-processed-gene-245.9:2160:2280:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_19::augustus_masked-Fvb3-1-processed-gene-245.9:2160-2280||RAPiDGENOMICS_rs1205_00924
ACGCTAAGATTGAGTTCCAACTATCTACGTGGACATATTCCCCGTCAACTGTGCAATCTTCAACACCTTCATCTTCTAGACCTCAGTCACAACAACTTTTCGGGTACTATTCCCAAGTGT
>augustus_masked-Fvb3-1-processed-gene-245.9:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-245.9:240-360||RAPiDGENOMICS_rs1205_00925
CACGTTGTAAGGATGGACCTCCGGAATGAGTGTCCATATGTTGACGAAGATGAAGCGACATATGCCCAACAATTGGCTTATAATCAGTCTTTCTTGAGAGGTAAGATAAATCCTTCTTTA
>augustus_masked-Fvb3-1-processed-gene-245.9:2460:2580:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_21::augustus_masked-Fvb3-1-processed-gene-245.9:2460-2580|2x||RAPiDGENOMICS_rs1205_00926
TCGTCAAACAATTTAGAAGGTGAGATCCCAGAAGAAATAAGCAGTCTAGTTGCATTGGGTACCCTCAACTTGTCGATGAATCAGTTAAGTGGAAACATTCCCTCTCAAATTGGAAATTTG
>augustus_masked-Fvb3-1-processed-gene-245.9:2640:2760:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_23::augustus_masked-Fvb3-1-processed-gene-245.9:2640-2760||RAPiDGENOMICS_rs1205_00927
TTTGCTTCTTTAACCTCATTGTCGCACTTGAACTTGTCTTACAACAACTTAGCGGGAAGAATTCCTTCAGGCAACCAACTCCAGACACTTGAAGATTCATCCATTTACAAAGGTAACCCA
>augustus_masked-Fvb3-1-processed-gene-245.9:360:480:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-245.9:360-480||RAPiDGENOMICS_rs1205_00928
CTTAGCTTGAAGCATTTACATTACCTAGACCTTAGCCGGAATGATTTTCAAGGGATTCAAATTCCAACGTTCTTTGGGCAGCTCAGAAGTTTGAGGTATCTCAATGTCTCCTATGCAGCA
>augustus_masked-Fvb3-1-processed-gene-245.9:480:600:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-245.9:480-600||RAPiDGENOMICS_rs1205_00929
TTTGGGGGAGACATACCTTCTTCTTTTGCTAACTTGTCGAACTTAAACCATCTTGACGTCAGTCGAAATTTCTTTGAAACATCTTCGAAAAACTTGGATTGGATTTCTCATCTCTCTTCC
>augustus_masked-Fvb3-1-processed-gene-245.9:60:180:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-245.9:60-180|2x||RAPiDGENOMICS_rs1205_00930
ACCGGTTTCTGTCTTGGTGATGGACTTCCAAGCAGTTTGGGATCATCATGCATCGAGGAAGAGAGACGAGCTCTTCTCACCTTCAAACAGGATCTCATTGATCGCGCTGGTAGGCTTTCT
>augustus_masked-Fvb3-1-processed-gene-245.9:600:720:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-245.9:600-720||RAPiDGENOMICS_rs1205_00931
CTGAAGTACATCAATCTAGGAAATCTATACCTTGGCAGCAGAGGAGAAAGTTGGTTTTATGCTATTAATATGCTTCCTTCCCTGTTAGAGCTACGTTTGTCTTCGTGCCGAATTCACCAA
>augustus_masked-Fvb3-1-processed-gene-245.9:660:780:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-245.9:660-780|2x||RAPiDGENOMICS_rs1205_00932
GCTATTAATATGCTTCCTTCCCTGTTAGAGCTACGTTTGTCTTCGTGCCGAATTCACCAAACCCTTCCCCTCTCACTGCAAACCACTAACCTCACATCACTTTTGGTCCTTGACATATCA
>augustus_masked-Fvb3-1-processed-gene-245.9:720:840:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-245.9:720-840||RAPiDGENOMICS_rs1205_00933
ACCCTTCCCCTCTCACTGCAAACCACTAACCTCACATCACTTTTGGTCCTTGACATATCATATAATGATATTAATTCTTCATTTCCCACCTGGCTTTTTAATCTCACCAACCTCAAGCAA
>augustus_masked-Fvb3-1-processed-gene-245.9:780:900:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-245.9:780-900|2x||RAPiDGENOMICS_rs1205_00934
TATAATGATATTAATTCTTCATTTCCCACCTGGCTTTTTAATCTCACCAACCTCAAGCAACTTGATCTGAGCAACAACCTTTTCGGCCGTCTCATTCCCAGTGAATTTTCAAACCTCAAA
>augustus_masked-Fvb3-1-processed-gene-245.9:840:960:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-245.9:840-960||RAPiDGENOMICS_rs1205_00935
CTTGATCTGAGCAACAACCTTTTCGGCCGTCTCATTCCCAGTGAATTTTCAAACCTCAAAATTCTGGAAGACCTTCGTCTGTCTAGAATGGGACTCAAAGGTCAAATTCCACAACTGAAA
>augustus_masked-Fvb3-1-processed-gene-245.9:900:1020:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-245.9:900-1020|2x||RAPiDGENOMICS_rs1205_00936
ATTCTGGAAGACCTTCGTCTGTCTAGAATGGGACTCAAAGGTCAAATTCCACAACTGAAAGGAAATATCTGCAATCTAAAGTCCTTAGATCTTTCAGAGAACGATTTTGAAACAGGGGTT
>augustus_masked-Fvb3-1-processed-gene-245.9:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-245.9-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-245.9:960-1080||RAPiDGENOMICS_rs1205_00937
GGAAATATCTGCAATCTAAAGTCCTTAGATCTTTCAGAGAACGATTTTGAAACAGGGGTTCATGAGTTCTTCCGAACTTTGTCAGATTGTCCGAATAAGACAATAGAAGCACTGGATTTG
>augustus_masked-Fvb3-1-processed-gene-246.12:0:120:Parent=augustus_masked-Fvb3-1-processed-gene-246.12-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-246.12:0-120||RAPiDGENOMICS_rs1205_00938
ATGGACCTCCGAAATACATATGTAGATACCTACCATGAGGTTGAAAACCAGTCCATTACTAACTTGATATCACTTTTAGTCCTTGACCTATCTAGTAATTTTTTCCAATCCACATGGCTT
>augustus_masked-Fvb3-1-processed-gene-246.12:1020:1140:Parent=augustus_masked-Fvb3-1-processed-gene-246.12-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-246.12:1020-1140|2x||RAPiDGENOMICS_rs1205_00939
AACAAACTCACTGGAATCCTAGAGCCACTGAAATTGCACGTTTTACAATTGCGATCCAACTTTCTAAGTGGAAATATTCCCCAACAACTGTGCAATCTTCCACACCTTCATATCTTGGAC
>augustus_masked-Fvb3-1-processed-gene-246.12:1080:1200:Parent=augustus_masked-Fvb3-1-processed-gene-246.12-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-246.12:1080-1200||RAPiDGENOMICS_rs1205_00940
TTTCTAAGTGGAAATATTCCCCAACAACTGTGCAATCTTCCACACCTTCATATCTTGGACCTCAGCCATAACAACATTTCCGGGACAATTCCGACGTGTTTGAGTAACTTGACTAATCTA
>augustus_masked-Fvb3-1-processed-gene-246.12:1140:1260:Parent=augustus_masked-Fvb3-1-processed-gene-246.12-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-246.12:1140-1260|2x||RAPiDGENOMICS_rs1205_00941
CTCAGCCATAACAACATTTCCGGGACAATTCCGACGTGTTTGAGTAACTTGACTAATCTAGTCTCTGGGTACCCTCCTGATGCCTATGAAGGTGACGACGAGTTAACAACAGTTATCATG
>augustus_masked-Fvb3-1-processed-gene-246.12:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-246.12-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-246.12:120-240||RAPiDGENOMICS_rs1205_00942
TTAAATCTCATCACTAGCCTCAAATCTCTTGAACACCTGGACTTATTTGGCATGGGCTTTAAAGGTCAGATACCTCCGATCATAGGACATCTGTGCAAGCTAAAGATGTTAAATCTTGCA
>augustus_masked-Fvb3-1-processed-gene-246.12:1200:1320:Parent=augustus_masked-Fvb3-1-processed-gene-246.12-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-246.12:1200-1320||RAPiDGENOMICS_rs1205_00943
GTCTCTGGGTACCCTCCTGATGCCTATGAAGGTGACGACGAGTTAACAACAGTTATCATGAAAGGAAGAGAACTTGTCTATAGCGGTGATCATACACTAGCTTATGTAAATACAATTGAT
>augustus_masked-Fvb3-1-processed-gene-246.12:360:480:Parent=augustus_masked-Fvb3-1-processed-gene-246.12-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-246.12:360-480||RAPiDGENOMICS_rs1205_00944
TCATTTCCAGAATCTTTTCAATACTTACCATCCTTGAGAACACTAGACCTCTATTCTAATCGTATGAACGGTTCCATAACTCCTCAAAGCTTGGGACAACTCTCTCAGCTAGTAGATCTG
>augustus_masked-Fvb3-1-processed-gene-246.12:420:540:Parent=augustus_masked-Fvb3-1-processed-gene-246.12-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-246.12:420-540|2x||RAPiDGENOMICS_rs1205_00945
CGTATGAACGGTTCCATAACTCCTCAAAGCTTGGGACAACTCTCTCAGCTAGTAGATCTGTCTTGGAATTCATGGAAGGGAGTTCTAAGTGAAATGCATTTCGTAAACGTTACGAGACTA
>augustus_masked-Fvb3-1-processed-gene-246.12:600:720:Parent=augustus_masked-Fvb3-1-processed-gene-246.12-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-246.12:600-720||RAPiDGENOMICS_rs1205_00946
GTTTTCAATGTGAATGATGGCTGGCTTCCCCCATTCAACCTCCGCACAATTTACATTCCAGACTGCAATGTGGGTCCTGTGTTTCCGGTATGGTTTCAATCTCAAACTCAACTAGTTGAT
>augustus_masked-Fvb3-1-processed-gene-246.12:720:840:Parent=augustus_masked-Fvb3-1-processed-gene-246.12-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-246.12:720-840||RAPiDGENOMICS_rs1205_00947
GTCGTCCTTGATAATGTTGGAATTTCAGGAAGTCTACCTTCAATTTGCCCAGTGCAACATATGGTAAGCCTCTCTTTAACAAACAATCAGTTTTGTGGAGAGTTCCCTCAAGAATGCAAT
>augustus_masked-Fvb3-1-processed-gene-246.12:840:960:Parent=augustus_masked-Fvb3-1-processed-gene-246.12-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-246.12:840-960||RAPiDGENOMICS_rs1205_00948
AAGTGGAGCAAAATATCAATCGTGGATGTCTCACACAACAATCTCTCTGGTAATATTCCCAGTTCAATAGGCATGCTAAGTTCACTTGAAGTGTTAAAGAAGAACAACAATCATTTTAGA
>augustus_masked-Fvb3-1-processed-gene-246.12:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-246.12-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-246.12:960-1080||RAPiDGENOMICS_rs1205_00949
GAAGAAATTCCCTCTTCCTTACAAAATTGCTTTGATTTGTTTCATGTTTACTTCAGTGGCAACAAACTCACTGGAATCCTAGAGCCACTGAAATTGCACGTTTTACAATTGCGATCCAAC
>augustus_masked-Fvb3-1-processed-gene-249.5:0:120:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-249.5:0-120||RAPiDGENOMICS_rs1205_00950
ATGTTACTGTTCGTGTCTTTGTGCCTGTGTACTAGTACTACTGTGGTAGAATCATGCGTGGAGGAAGAGAGACAGACACTTCTCAGCTTCAAGCAAGATCTTATTGATCGATCTGGAAGG
>augustus_masked-Fvb3-1-processed-gene-249.5:1080:1200:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-249.5:1080-1200||RAPiDGENOMICS_rs1205_00951
AGTTCATTAGGAATGCTGAAAAGCCTGCAGCATCTTGTCCTTGGCGGCAACGCTTTTGGGGGATCCATTCTTGAAGTTATTATTGGCAACTTTTCACCATCCTTAGAGACACTTGACCTC
>augustus_masked-Fvb3-1-processed-gene-249.5:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-249.5:120-240||RAPiDGENOMICS_rs1205_00952
CTTTCTTCTTGGACGGGTCGGCAATGCTGTCTATGGAGGGGGATTTCGTGCAACAACCACACAGGTCGTGTTGTCAAGCTTGATCTCCGTAATCCATATGTTGAGTATTTTGATCGGTGG
>augustus_masked-Fvb3-1-processed-gene-249.5:1320:1440:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-249.5:1320-1440||RAPiDGENOMICS_rs1205_00953
CTCACAAGATTAAGGTCTCTACTTTTGAGTACAACCCGACTTGTGCCCATCATTTTCAATTTGACTGATTATGAATGGATTCCTCCTTTCAAGCTCCATAGAATTGCCATGGAGAATTGC
>augustus_masked-Fvb3-1-processed-gene-249.5:1440:1560:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_13::augustus_masked-Fvb3-1-processed-gene-249.5:1440-1560||RAPiDGENOMICS_rs1205_00954
CGAGTAGGCCCTGGCTTCCCTTTGTGGCTTCAATCTCAAACAGAGCTTTTCGATATCACACTTCATAATGCTGAAATCTCTGGTACAATACCAGAGGAATGGCTCTCTAAGATATCTTCC
>augustus_masked-Fvb3-1-processed-gene-249.5:1500:1620:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_13::augustus_masked-Fvb3-1-processed-gene-249.5:1500-1620|2x||RAPiDGENOMICS_rs1205_00955
CTTCATAATGCTGAAATCTCTGGTACAATACCAGAGGAATGGCTCTCTAAGATATCTTCCCATATCCAATCTTTGGATTTATCTTACAATCAAATAAGCGGAAAGCTTCCGTTTCAATTC
>augustus_masked-Fvb3-1-processed-gene-249.5:1560:1680:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-249.5:1560-1680||RAPiDGENOMICS_rs1205_00956
CATATCCAATCTTTGGATTTATCTTACAATCAAATAAGCGGAAAGCTTCCGTTTCAATTCTACTCCTTTCCAAATCTCATTTACATAATTTTAAGCCATAATCAATTTGATGGAACTATT
>augustus_masked-Fvb3-1-processed-gene-249.5:1620:1740:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-249.5:1620-1740|2x||RAPiDGENOMICS_rs1205_00957
TACTCCTTTCCAAATCTCATTTACATAATTTTAAGCCATAATCAATTTGATGGAACTATTCCATCATCTATTTGCAGCATTGAATCTCTATATACCCTTGCTCTGAATAACAATCAGTTA
>augustus_masked-Fvb3-1-processed-gene-249.5:1680:1800:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-249.5:1680-1800||RAPiDGENOMICS_rs1205_00958
CCATCATCTATTTGCAGCATTGAATCTCTATATACCCTTGCTCTGAATAACAATCAGTTATCCGGAGAATTCCCTAAAGAATGGAGCTTGTGGAGCAACATAGGAAGTGTGGATGTCTCA
>augustus_masked-Fvb3-1-processed-gene-249.5:1800:1920:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-249.5:1800-1920||RAPiDGENOMICS_rs1205_00959
AACAACAATTTGTCTGGTAACTTTCCAAGCTCGATGGGTATTCCAAGTTCTCTTTATCTATTAAAGATGGACAACAATCAGTTAAGCGGAAAAATTCCTTCCGCCTTGCAAAATTGCTCA
>augustus_masked-Fvb3-1-processed-gene-249.5:1920:2040:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-249.5:1920-2040||RAPiDGENOMICS_rs1205_00960
TTTTTTAACGGACTTTTTCTTGGAGGCAACAATTTCACTGGAAGCATACCTTGTTGGATAGGATCAAAAGTATCTACATTCTCAGCGCTGCAGTTGCGATCAAACTCTTTAAGTGGACAC
>augustus_masked-Fvb3-1-processed-gene-249.5:1980:2100:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-249.5:1980-2100|2x||RAPiDGENOMICS_rs1205_00961
GGATCAAAAGTATCTACATTCTCAGCGCTGCAGTTGCGATCAAACTCTTTAAGTGGACACATTCCTCACCAACTGTGCAGTCTTCCTTCCCTTCAGATCCTAGACCTTAGTCACAACAGA
>augustus_masked-Fvb3-1-processed-gene-249.5:2040:2160:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_18::augustus_masked-Fvb3-1-processed-gene-249.5:2040-2160||RAPiDGENOMICS_rs1205_00962
ATTCCTCACCAACTGTGCAGTCTTCCTTCCCTTCAGATCCTAGACCTTAGTCACAACAGATTTTCAGGGATTATTCCCAAGTGTTTAAATAACTTGACTGCTCTAGTCTCTGGTCATGGT
>augustus_masked-Fvb3-1-processed-gene-249.5:2100:2220:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_18::augustus_masked-Fvb3-1-processed-gene-249.5:2100-2220|2x||RAPiDGENOMICS_rs1205_00963
TTTTCAGGGATTATTCCCAAGTGTTTAAATAACTTGACTGCTCTAGTCTCTGGTCATGGTGGCTGGAGGGTCTCTGGGGCTTTTGAGGTAATAACCGTAACTGCAAAAGGAAGAGAAAGT
>augustus_masked-Fvb3-1-processed-gene-249.5:2160:2280:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_19::augustus_masked-Fvb3-1-processed-gene-249.5:2160-2280||RAPiDGENOMICS_rs1205_00964
GGCTGGAGGGTCTCTGGGGCTTTTGAGGTAATAACCGTAACTGCAAAAGGAAGAGAAAGTGAATACTTCACTAGCGCAATGTTTCTGACCATTATTGACCTTTCTTCAAACGATTTAGAA
>augustus_masked-Fvb3-1-processed-gene-249.5:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-249.5:240-360||RAPiDGENOMICS_rs1205_00965
GACGCTGCAGAGTACTGGAACTCCACTAAGTTTGAAGAATCTGGCTTGGGGGGTAAATTAAATCCTTCTTTGCTTGGTTTGAAACATTTGAGTTACTTAGACTTGAGCGAGAATAATTTT
>augustus_masked-Fvb3-1-processed-gene-249.5:2520:2640:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_22::augustus_masked-Fvb3-1-processed-gene-249.5:2520-2640||RAPiDGENOMICS_rs1205_00966
CTTCAGACGCTGGTTGATCCATCTATTTATGAGGGCAATTCACTTTGTGGATTTCCACTTCCAAAATGCCCAGAAGACGAAGACAACATGCATGAGTCTCATGTACATGAGAAACTAGAA
>augustus_masked-Fvb3-1-processed-gene-249.5:2640:2760:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_23::augustus_masked-Fvb3-1-processed-gene-249.5:2640-2760||RAPiDGENOMICS_rs1205_00967
CACGGAGATGATGAGGAAAAACTTGGTTTCTATACCAGTGCGGTGCTCGGCTTTATCATAGGCTTTTGGAGTGTGTGTGGCACATTGATATTGAAAAAGTCATGGAGGTATGCCTATTTT
>augustus_masked-Fvb3-1-processed-gene-249.5:360:480:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-249.5:360-480||RAPiDGENOMICS_rs1205_00968
CAAGGGATTAACATTCCTAACTTCATCGGAGAGCTAACAAGTTTGACGTATCTCAATCTTTCAAATTCAGTGTCTGGTTCATTTGTGGGAGAGATCCCGCCATCTCTTGGTAACCTCTCA
>augustus_masked-Fvb3-1-processed-gene-249.5:480:600:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-249.5:480-600||RAPiDGENOMICS_rs1205_00969
AACTTGAACTATCTTGACCTTGGTTTTGGGCTTGATTCTGATTCTTATTCCAAAAACATGAATTGGCTTTCTCATCTGTCTTCCCTAAAATACATCAATCTAAGGTCTGTGGACATTAGC
>augustus_masked-Fvb3-1-processed-gene-249.5:600:720:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-249.5:600-720||RAPiDGENOMICS_rs1205_00970
AGCACAGGAGTAGGTTGGCTACATGCTATTAACAAGCTTCCTTCGCTCTTAGAGTTGCATTTGACATTTTGTTCTATCGGTGGAAACCAGCTTCCATTATCGCTTCCCACTATTAACTTC
>augustus_masked-Fvb3-1-processed-gene-249.5:660:780:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-249.5:660-780|2x||RAPiDGENOMICS_rs1205_00971
TTGACATTTTGTTCTATCGGTGGAAACCAGCTTCCATTATCGCTTCCCACTATTAACTTCACATCACTGTTGATCCTCGATTTGTCATACAACTATATCGATTCTTTGTTTCCTAAGTGG
>augustus_masked-Fvb3-1-processed-gene-249.5:720:840:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-249.5:720-840||RAPiDGENOMICS_rs1205_00972
ACATCACTGTTGATCCTCGATTTGTCATACAACTATATCGATTCTTTGTTTCCTAAGTGGATGTTTAATCTTACTAGTCTTACAAAACTCGATCTAAAGGGGAATCCTTCCATTAGCCCC
>augustus_masked-Fvb3-1-processed-gene-249.5:780:900:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-249.5:780-900|2x||RAPiDGENOMICS_rs1205_00973
ATGTTTAATCTTACTAGTCTTACAAAACTCGATCTAAAGGGGAATCCTTCCATTAGCCCCTCTCTTGATGGATTTGTAAGACTAAAATCTTTAGAACACCTTGACTTATGGAGCGTTGGA
>augustus_masked-Fvb3-1-processed-gene-249.5:840:960:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-249.5:840-960||RAPiDGENOMICS_rs1205_00974
TCTCTTGATGGATTTGTAAGACTAAAATCTTTAGAACACCTTGACTTATGGAGCGTTGGACTCAAAGGTCAATTACTTCCCAAATTCTTTGGAAATTTGTGCAACCTAAAGTCATTACAT
>augustus_masked-Fvb3-1-processed-gene-249.5:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-249.5-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-249.5:960-1080||RAPiDGENOMICS_rs1205_00975
CTTCCAGCCAACCAGTTTGATGGGGGGCTTGAAGACTTTTTGAGTGGTTTTTCAAATTGCTCATCCAATATAATGGAGTCACTAGAATTGGCAAATTGTGGGCTGGAAGGTGAGTTGCCT
>augustus_masked-Fvb3-1-processed-gene-265.6:107:227:Parent=augustus_masked-Fvb3-1-processed-gene-265.6-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-265.6:107-227||RAPiDGENOMICS_rs1205_00976
GGTCGTATTTTTAAACCTCTCTGAGTTTCATCTCACTGGCACCATTCCTCCTGAGCTAGGAAACCTATCATTTCTTGCTGGGATGCGCCTAGAAAATAACAGCTTCCATGGAACTATCCT
>augustus_masked-Fvb3-1-processed-gene-265.6:1115:1235:Parent=augustus_masked-Fvb3-1-processed-gene-265.6-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-265.6:1115-1235||RAPiDGENOMICS_rs1205_00977
GGAAGCTACAACAGAAATGACCTTGTTACCTAATCCTCTTTGGAGACAAGTTTCACACTTAGAACTTCTAAAGGCAACAGATGGGTTCAATGAAAGCAACATACTCGGCTCTGGGGGTTT
>augustus_masked-Fvb3-1-processed-gene-265.6:1235:1355:Parent=augustus_masked-Fvb3-1-processed-gene-265.6-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-265.6:1235-1355||RAPiDGENOMICS_rs1205_00978
TGGCACAGTATATAAAGGCATCTTATCGGATGGGATGGATGGGATAGAGGTTGCAATAAAGGTTTTCAATTTAGAAGTAGCAGGGGCTCTCGGGAGTTTTGATAATGAATGTCAAATGCT
>augustus_masked-Fvb3-1-processed-gene-265.6:1355:1475:Parent=augustus_masked-Fvb3-1-processed-gene-265.6-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-265.6:1355-1475||RAPiDGENOMICS_rs1205_00979
AAGCAATATTTGTCATCGAAATCTTCTCAAAATCATCAGTTGTTGCAGTCAAAGAGACTTCAAAGCCGTGGTACTGAACTACATGCCTAATGGGAGTCTTGATAAATGGTTGTATTTAGA
>augustus_masked-Fvb3-1-processed-gene-265.6:1715:1835:Parent=augustus_masked-Fvb3-1-processed-gene-265.6-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-265.6:1715-1835||RAPiDGENOMICS_rs1205_00980
GATGAGTTTGAAGCAGTGGGTTGCAAATTCTCTGTTTCCAGATGGAATAGTTGTAGTTTTCGATGCCAATTTATTTGGGACTCAAGAGAACAATGATTTTGTGAGCAAGGAGTGTTTATC
>augustus_masked-Fvb3-1-processed-gene-265.6:1835:1955:Parent=augustus_masked-Fvb3-1-processed-gene-265.6-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-265.6:1835-1955||RAPiDGENOMICS_rs1205_00981
ATCCCTTATGAGATTGGCTCTGAAGTGTTGCTCAGAATCGCCAGAAAAGAGGGTAAGTAGCCACGCTCAAAAAATCAAGATAAAGTTTTTGAAGGACGCTGCAGAAGGTGCGGTGTTAAA
>augustus_masked-Fvb3-1-processed-gene-265.6:385:505:Parent=augustus_masked-Fvb3-1-processed-gene-265.6-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-265.6:385-505||RAPiDGENOMICS_rs1205_00982
AACTTCCAAATGAGATTGGTGCTTTAGATTTGGAGTCACTGTTTGTTCAAGAAAACAGCCTAGAAGGTCTTGTTCCTGCAGGTGTCTTCAACATGTCTAATATGACTACTCTGAATCTAT
>augustus_masked-Fvb3-1-processed-gene-265.6:505:625:Parent=augustus_masked-Fvb3-1-processed-gene-265.6-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-265.6:505-625||RAPiDGENOMICS_rs1205_00983
TTGGTAACCGTTTGAATGGCAGGATTCCAGACAATTTGTGTAGGAATCTCCCTAATCTTCAAGGATTGAATTTGGCTTACTACCAATTTGAGGGTTCACTTCCTTCAAGCTTAGAGCAGT
>augustus_masked-Fvb3-1-processed-gene-265.6:755:875:Parent=augustus_masked-Fvb3-1-processed-gene-265.6-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-265.6:755-875||RAPiDGENOMICS_rs1205_00984
GGGCAACATTCCTAGTTCAATTGGGAACTCCCTAAGCCTAGCACTCCTGGATTTATCCAACAAAAGTCTTTCTGGAGTCATTCCAAAGTCTCTAGAAGCACTCTCACGTCTCCAATCTCT
>augustus_masked-Fvb3-1-processed-gene-265.6:995:1115:Parent=augustus_masked-Fvb3-1-processed-gene-265.6-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-265.6:995-1115||RAPiDGENOMICS_rs1205_00985
ATGCAAAACGAAAGCAGCTGAAAGATCTCTCCCAAAGTATATAATAATAGGCATCTTGCCAGCAATTATTCTCATAGTAGGCCTTGCTTCCATGATGATGCTCCGCAGAAAAAGGAATGT
>augustus_masked-Fvb3-1-processed-gene-265.8:1133:1253:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-265.8:1133-1253||RAPiDGENOMICS_rs1205_00986
GATGAGTATGAGGCTAGGTGGGCTTCTAGTGCTGTCCCTATTTTTCTTTTCTGCAATGGGACAGCTTCCTTCACAGGATATATTGGCGCTGCTCGCATTCAAGAAGGGTATCAAGCATGA
>augustus_masked-Fvb3-1-processed-gene-265.8:1253:1373:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-265.8:1253-1373||RAPiDGENOMICS_rs1205_00987
TCCTACTGGTTTTGTGCTCAGTTCTTGGAATGATGAGTCCATTGACTTCAATGGTTGTCCTGCTTCATGGAATGGGATTATATGTAATGGTGGAAATGTTGCTGGAGTTGTGCTTGATAA
>augustus_masked-Fvb3-1-processed-gene-265.8:1313:1433:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-265.8:1313-1433|2x||RAPiDGENOMICS_rs1205_00988
TGCTTCATGGAATGGGATTATATGTAATGGTGGAAATGTTGCTGGAGTTGTGCTTGATAATTTGAGTCTCTCTGCGGATGTGGACTTGAGTGTGTTTTCAAATCTGACGAAGCTTCTGAA
>augustus_masked-Fvb3-1-processed-gene-265.8:1373:1493:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-265.8:1373-1493||RAPiDGENOMICS_rs1205_00989
TTTGAGTCTCTCTGCGGATGTGGACTTGAGTGTGTTTTCAAATCTGACGAAGCTTCTGAAACTTTCCATGGCCAACAATATGATATCTGGGAAATTTCCTGACAATATTGCAGACTTCAA
>augustus_masked-Fvb3-1-processed-gene-265.8:1493:1613:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-265.8:1493-1613||RAPiDGENOMICS_rs1205_00990
CAACCTCGAGTTTCTTGACCTCTCCAACAATTTGTTTTCTTCATCTTTACCACCTGGAATTGGTAAGTTGGGGAGCTTAAGGAACCTCTCATTAGGTGGCAACAACTTCTCAGGCTCCAT
>augustus_masked-Fvb3-1-processed-gene-265.8:1853:1973:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-265.8:1853-1973||RAPiDGENOMICS_rs1205_00991
AAATGCCACACATGTTGACTTTAGTGGCAATATGTTTACAAGTTCCGGTTCCCAGGGGCAGATGTTTTTACCTCGTCTTTCTGAGAGTATCAAGTACTTGAATCTTTCCCACAACCAGCT
>augustus_masked-Fvb3-1-processed-gene-265.8:2203:2323:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-265.8:2203-2323||RAPiDGENOMICS_rs1205_00992
GACCAATCAACATGGTGACTTCAACAACTCTCCGCATCCTGAATCTTTCCTCGAATGGGCTTACTGGTAAGTTGCCTTTGCTGACTGGAAGTTGTGCTGTACTTGATCTATCCAAGAACA
>augustus_masked-Fvb3-1-processed-gene-265.8:2443:2563:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-265.8:2443-2563||RAPiDGENOMICS_rs1205_00993
ATCTCAATCTGTCCCATAATTCTCTCAGTAGTTCTATAGCAAGTGTTATAACACAGTATCCAAAGATCAGTGTCCTTGATCTCAGTTCTAACCAGTTAGATGGCACAGTTCTTGCTGAGT
>augustus_masked-Fvb3-1-processed-gene-265.8:2563:2683:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-265.8:2563-2683||RAPiDGENOMICS_rs1205_00994
TGCTAAGCATGCCTACTCTGCAAGAGCTCCACCTTGAAAATAATTTACTGTCTGGGTCAATTAACATCTCATCTCCTTTGTTCAACCAATCAAATCTTCAGGTTCTTGATCTTTCTCAGA
>augustus_masked-Fvb3-1-processed-gene-265.8:2623:2743:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-265.8:2623-2743|2x||RAPiDGENOMICS_rs1205_00995
TTAACATCTCATCTCCTTTGTTCAACCAATCAAATCTTCAGGTTCTTGATCTTTCTCAGAACCGGCTTAGTGGCTATTTTCCTGATCAATTTGGTTCACTCAATGGGCTTAAAGTGCTCA
>augustus_masked-Fvb3-1-processed-gene-265.8:2683:2803:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-265.8:2683-2803||RAPiDGENOMICS_rs1205_00996
ACCGGCTTAGTGGCTATTTTCCTGATCAATTTGGTTCACTCAATGGGCTTAAAGTGCTCAATATTGGGAGAAATAATTTTTCTGGCTCTCTGCCAACTTCAATGTCTGACATGAGCACAC
>augustus_masked-Fvb3-1-processed-gene-265.8:2743:2863:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-265.8:2743-2863|2x||RAPiDGENOMICS_rs1205_00997
ATATTGGGAGAAATAATTTTTCTGGCTCTCTGCCAACTTCAATGTCTGACATGAGCACACTAAGCTCATTAGACATTTCGCAGAATCATTTCACAGGTCCCCTTCCAAATAACTTGCCAA
>augustus_masked-Fvb3-1-processed-gene-265.8:2803:2923:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-265.8:2803-2923||RAPiDGENOMICS_rs1205_00998
TAAGCTCATTAGACATTTCGCAGAATCATTTCACAGGTCCCCTTCCAAATAACTTGCCAAACAGTCTTGAATTCTTTAATGCTTCATATAATGATCTTTCTGGGGATGTCCCAGAAAATC
>augustus_masked-Fvb3-1-processed-gene-265.8:3043:3163:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-265.8:3043-3163||RAPiDGENOMICS_rs1205_00999
CACTTGTCAAAGTTATTATTATAGTCTCCTGTGTGGTTGTTGTCTTCATTCTTCTTCTGCTTGCTATCTTCATTCATTACATTCGCATGTCAAGGAGAATCCCATCAGGGCATACTGCAA
>augustus_masked-Fvb3-1-processed-gene-265.8:3283:3403:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-265.8:3283-3403||RAPiDGENOMICS_rs1205_01000
AAATTATCAGCTCTGGTGAAAAAGTCAAAGCTGTAAGTGACTTTTCCCCTTCAAAGAACAGCCATTTCTCTTGGTCACCAGAATCCGGAGATTCCTATATTGCGGAAAACCTTGCCAGAC
>augustus_masked-Fvb3-1-processed-gene-265.8:3403:3523:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-265.8:3403-3523||RAPiDGENOMICS_rs1205_01001
TGGATGTGAGATCACCAGATAGATTGGTTGGTGAGCTTCATTTTCTTGATGAAACAATCGCATTAACACCTGAGGCGCTGTCAAGGGCTCCTGCTGAGGTTTTGGGGAGAAGCAGCCATG
>augustus_masked-Fvb3-1-processed-gene-265.8:3874:3994:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-265.8:3874-3994||RAPiDGENOMICS_rs1205_01002
AAGCAACAAATGTTCTGTTGGATGGGTCTGATCTGAATGCCCGAGTTGCTGATTACTGCCTCCACCGCCTCATGACACAAGCTGGCACCATTGAACAGATTCTTGATGCTGGTGTCTTAG
>augustus_masked-Fvb3-1-processed-gene-265.8:4860:4980:Parent=augustus_masked-Fvb3-1-processed-gene-265.8-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-265.8:4860-4980||RAPiDGENOMICS_rs1205_01003
ACTGCAATGATCTGCTATAATCTGGCACTGGCTATAAGCATGATTGGCATCTCAGAATCGCTTGCTCTTGGTCAGTCTCTAGGAATATCTGCCAGCACTCTAACAAAAGTGTTTAACTCT
>augustus_masked-Fvb3-1-processed-gene-278.10:1080:1200:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-278.10:1080-1200||RAPiDGENOMICS_rs1205_01004
CCGTTCTCGTTCGAAACAGAGTCCGGGACATCCTGGGTCGCCGACATCAAGGAGCCAACTTCCGCGCAGGTTGTCATGTTCGAGAAGCCGCTCATGAACTATCTCACCTTCAAAGACCTC
>augustus_masked-Fvb3-1-processed-gene-278.10:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-278.10:120-240||RAPiDGENOMICS_rs1205_01005
TCAGTCCAAAGCTTCAATCTTTCTTGGTTCCAAAACCAAAGTACTCCCAACTGCTCAAACCCACCCATCACACAAATCAACCTCCATTCCCGAAACCTCAGCGGCATAGTCTCATGGAAG
>augustus_masked-Fvb3-1-processed-gene-278.10:1962:2082:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-278.10:1962-2082||RAPiDGENOMICS_rs1205_01006
AGATATAAAGGAGAGTGGGGCGATGAGGAAGAAGAAAACCAAGATAGCGTGGTAATGGTGGGGGAAGATGAAGGAGCAGTCTGGAATACTCTCGGAGTAATCGAGCCGAACCGGCTTAGG
>augustus_masked-Fvb3-1-processed-gene-278.10:2246:2366:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-278.10:2246-2366||RAPiDGENOMICS_rs1205_01007
CGACGATTTAGTTGCCCAAATCCTGAACAAGATAAGCGAATCAGAAGACATAAGATCATTCTCGGAGGTGTGCAAGCAGTGGTTAAGAGTACAACGTCTAAACCAAACATCGCTTCGGGT
>augustus_masked-Fvb3-1-processed-gene-278.10:2366:2486:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-278.10:2366-2486||RAPiDGENOMICS_rs1205_01008
CGACGTCGGCTTCCCCCAGATTTTACTTACCAGATTCCCGAACCTGCAAGAGTTGAGAGTTCCCAGAGTATGGGAGGTTACAAAAGAAAAGCCCAGTAAAGAAGCGTGGTATCCAACCGA
>augustus_masked-Fvb3-1-processed-gene-278.10:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-278.10:240-360||RAPiDGENOMICS_rs1205_01009
TACCTCAGAAACATGTCTCATCTTCAATCCCTTGATCTGTCAAACAACTCCCTCAAAGGCTCCGTCCCAGGTTGGTTTTGGTCTCTCCCAACCTTACTCCAAGTCGACCTCTCCAAGAAC
>augustus_masked-Fvb3-1-processed-gene-278.10:2572:2692:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-278.10:2572-2692||RAPiDGENOMICS_rs1205_01010
GGAAAAGTGCAGAGGTGGTTCCGAAAGTGCAGAATGAAGTTTCTGCTAGTTCAGAGCAGGCGAAAGCTAAGCCGACTAAAGCTGAAAGGCGTGCCCTGCAGGAGGCTCAACGTGCTGCTA
>augustus_masked-Fvb3-1-processed-gene-278.10:2695:2815:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-278.10:2695-2815||RAPiDGENOMICS_rs1205_01011
CTGAGGGAAGAAAACCTACCCCTGTATCTGGAGGAGGAGCTACGAGTAAACCTGTAAAGCAGTCTTCCCAGAAGAAAGAGATGCAAAAGAAAGAAACTACTGCCGTTGCATCTTCAGTGG
>augustus_masked-Fvb3-1-processed-gene-278.10:2815:2935:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-278.10:2815-2935||RAPiDGENOMICS_rs1205_01012
TTGCTTCAGAAAAGAAGGGTGGTGATCGGCCAACAGATAGGAGGAAAGATGTTCCTCCTCCACGTATGCAGTTTGATGATAAGAGCCGAGTGGAAAAGGCAAAAAAGCGCTCTGTGGTTA
>augustus_masked-Fvb3-1-processed-gene-278.10:2935:3055:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-278.10:2935-3055||RAPiDGENOMICS_rs1205_01013
ATCAAACAGAAGCTAAAAACAGAGTTGAATTGTTCCAGCATTTGCCTCAATATGAACGAGGAACTCAGCTTCCAGATCTCGAGTCGAAATTTTTTCAACTTGATCCCATGCATCCTGCCA
>augustus_masked-Fvb3-1-processed-gene-278.10:300:420:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-278.10:300-420|2x||RAPiDGENOMICS_rs1205_01014
TCCGTCCCAGGTTGGTTTTGGTCTCTCCCAACCTTACTCCAAGTCGACCTCTCCAAGAACAAGTTCGGCGGCAGCTTCGGCATCGAAACCGCTTCACTTTCGTCAGTTCAAAAACTCAAC
>augustus_masked-Fvb3-1-processed-gene-278.10:3063:3183:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-278.10:3063-3183||RAPiDGENOMICS_rs1205_01015
GTTGGACTGAAGTACTTGGCCGGGGATATATCTGGGGGTAATGCTCGTTGCATTGCAATGCTTAAAGCGTTTCAGGAAGCCATTAGTGACTACTCTACGCCACCACAGAAAACTCTTGTT
>augustus_masked-Fvb3-1-processed-gene-278.10:3183:3303:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-278.10:3183-3303||RAPiDGENOMICS_rs1205_01016
CGAGATTTAACGGCAAATATCAGTAGTTACGTCTCATTTTTCATCGAATGCAGGCCACTTTCTATTAGCATGGGAAATGCTATTAGGTTTATAAAGAGTCGTGTTGCAAAATTGCCATTA
>augustus_masked-Fvb3-1-processed-gene-278.10:3303:3423:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-278.10:3303-3423||RAPiDGENOMICS_rs1205_01017
AGCCTTTCTGAGTCTGAAGCTAAATCCACACTTTGTTCAGAAATTGACCGATTTCTAAATGACAAGATAATTGTTGCTGATAAGGTAATAGTTAGGCATGCTGCTACAAAGATTAGAGAT
>augustus_masked-Fvb3-1-processed-gene-278.10:3423:3543:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-278.10:3423-3543||RAPiDGENOMICS_rs1205_01018
GGTGATGTTCTACTCACATATGGATCATCATGTGTTGTTGAGATGATTTTCCTATATGCCCATGAACTCGGGAAACAGTTTCGTGTTGTGATTGTAGACTCGCGTCCAAAGCTTGAAGGC
>augustus_masked-Fvb3-1-processed-gene-278.10:3543:3663:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-278.10:3543-3663||RAPiDGENOMICS_rs1205_01019
CAAGCATTATTTCATAGACTGGTAGCAAAGGGCCTGACTTGTACGTATACTCATATAAATGCTGTGTCCTATATCATGCATGAAGTAACACGAGTGTTTCTGGGAGCTGCCTCAGTATTA
>augustus_masked-Fvb3-1-processed-gene-278.10:3663:3783:Parent=augustus_masked-Fvb3-1-processed-gene-278.10-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-278.10:3663-3783||RAPiDGENOMICS_rs1205_01020
TCTAATGGAACCGTATATTCAAGAGTTGGAACTGCATGTGTTGCTATGGTTGCTCACTCATTTTGCATTCCAGTCTTAGTCTGCTGTGAAGCTTATAAGTTTCATGAAAGAGTACAGCTT
>augustus_masked-Fvb3-1-processed-gene-28.1:0:120:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-28.1:0-120||RAPiDGENOMICS_rs1205_01021
ATGCTCATGGAAAGGCCTCACCTGTTCACCACAAGGCCATGTGACTCCCTAAATCTCTGGAATGCTGGCATAGTTGGCAGTTTACACCTTCCAACTCTCACAGCCTTGCCTAGTCTTCAA
>augustus_masked-Fvb3-1-processed-gene-28.1:1020:1140:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-28.1:1020-1140|2x||RAPiDGENOMICS_rs1205_01022
ATAACTGGTCCTGTGCCACCCTCTATTACCAATGGTACTCGGCTTCGAGTGTTCGATCTCAGCGCTAATCTCTTCACGGGGAATGTTCCTTCAGGGTTTTGCTCCTCCAATGCTCCCTCA
>augustus_masked-Fvb3-1-processed-gene-28.1:1080:1200:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-28.1:1080-1200||RAPiDGENOMICS_rs1205_01023
AGCGCTAATCTCTTCACGGGGAATGTTCCTTCAGGGTTTTGCTCCTCCAATGCTCCCTCAGCTTTGGAAAAGATACTTCTAGCCAACAATTTCCTCTCCGGGACTGTGCCATCAGAACTT
>augustus_masked-Fvb3-1-processed-gene-28.1:1140:1260:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-28.1:1140-1260|2x||RAPiDGENOMICS_rs1205_01024
GCTTTGGAAAAGATACTTCTAGCCAACAATTTCCTCTCCGGGACTGTGCCATCAGAACTTGGAAACTGCAAGAGCCTAAGGGCTCTTGACCTGAGTTTCAACAGTTTGAGTGGTGCAATT
>augustus_masked-Fvb3-1-processed-gene-28.1:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-28.1:120-240||RAPiDGENOMICS_rs1205_01025
AATCTGTACTTGCAAGGCAATTCTTTCTCTGCTTCTGATCTTTCTGTTTCCAACATTACCTCATGTAGACTTGTAACAGTTGACTTGTCCTCAAACAACATCACCAGCCCTATCCCTGTT
>augustus_masked-Fvb3-1-processed-gene-28.1:1320:1440:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-28.1:1320-1440||RAPiDGENOMICS_rs1205_01026
ACTGGTGAAATCCCAGAAGGCATCTGCGTCAATGGGGGAAACCTGGAAACCCTGATTCTCAACAATAATCTCATTTCTGGAGCCATTCCACAGTCCATTGGCAGCTGCACCAATATGGTT
>augustus_masked-Fvb3-1-processed-gene-28.1:1440:1560:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_13::augustus_masked-Fvb3-1-processed-gene-28.1:1440-1560||RAPiDGENOMICS_rs1205_01027
TGGGTGTCACTATCTAGCAACCGGCTTACTGGAGCAATCCTTTCAGGTATTGGAAATCTCCTTAAGCTTGTTATACTCCAGTTGGGTAATAATTCACTGTCTGGTCAGATTCCACCAGAG
>augustus_masked-Fvb3-1-processed-gene-28.1:1560:1680:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-28.1:1560-1680||RAPiDGENOMICS_rs1205_01028
CTTGGCAAGTGTCAAAGTCTCATTTGGCTTGACCTAAACAGCAATGACCTAAATGGTTCTATACCTTCAGAACTTGCTAACCAGGCCGGCCTAGTCCATCCTGGAATTGTTTTTTGGAAG
>augustus_masked-Fvb3-1-processed-gene-28.1:1680:1800:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-28.1:1680-1800||RAPiDGENOMICS_rs1205_01029
CAGTTTGCATTTGCTAGAAATGAGGGTGGTACAGCTTGCAGGGGTGCAGGAGGACTAGTTGAGTTTGAGGGAGTCCGACCTCAGAGACTCGAAAGTTTACACATGGTTCATTCTTGCCCA
>augustus_masked-Fvb3-1-processed-gene-28.1:180:300:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-28.1:180-300|2x||RAPiDGENOMICS_rs1205_01030
TCATGTAGACTTGTAACAGTTGACTTGTCCTCAAACAACATCACCAGCCCTATCCCTGTTCAGTCTTTTCTTGAGGGTTGTGAGCATCTGGCCTCGGTCAACCTCTCTGGTAATTCAATC
>augustus_masked-Fvb3-1-processed-gene-28.1:1800:1920:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-28.1:1800-1920||RAPiDGENOMICS_rs1205_01031
TCAACTAGAATTTACACAGGGTTGACAGTTTACACATTCACCAACAATGGAAGCATGATCTTCCTTGACATTCCTTACAATACCTTGTCTGGGACTATTCCCTCAAACTTAGGTACACTG
>augustus_masked-Fvb3-1-processed-gene-28.1:1860:1980:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-28.1:1860-1980|2x||RAPiDGENOMICS_rs1205_01032
TTCCTTGACATTCCTTACAATACCTTGTCTGGGACTATTCCCTCAAACTTAGGTACACTGTCCTATTTGCAAGTCTTCAATCTAGGACACAATATGTTAGGTGGAAGTATTCCAGAAAGC
>augustus_masked-Fvb3-1-processed-gene-28.1:1920:2040:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-28.1:1920-2040||RAPiDGENOMICS_rs1205_01033
TCCTATTTGCAAGTCTTCAATCTAGGACACAATATGTTAGGTGGAAGTATTCCAGAAAGCTTTGGAGGATTGAAAGCAATTGGAGTCCTGGATCTCTCTCACAATAATCTCCAAGGTTAT
>augustus_masked-Fvb3-1-processed-gene-28.1:1980:2100:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-28.1:1980-2100|2x||RAPiDGENOMICS_rs1205_01034
TTTGGAGGATTGAAAGCAATTGGAGTCCTGGATCTCTCTCACAATAATCTCCAAGGTTATGTCGCAGGATCTTCGGGGAGTCTCTCTTTCATTAGTGACCTTGATGTATCTAACAACAAC
>augustus_masked-Fvb3-1-processed-gene-28.1:2040:2160:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_18::augustus_masked-Fvb3-1-processed-gene-28.1:2040-2160||RAPiDGENOMICS_rs1205_01035
GTCGCAGGATCTTCGGGGAGTCTCTCTTTCATTAGTGACCTTGATGTATCTAACAACAACCTCACTGGTCTCATCCCTTCCGGAGGTCAGCTTACCACTTTCCTACCATCCAGATATGAG
>augustus_masked-Fvb3-1-processed-gene-28.1:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-28.1:240-360||RAPiDGENOMICS_rs1205_01036
CAGTCTTTTCTTGAGGGTTGTGAGCATCTGGCCTCGGTCAACCTCTCTGGTAATTCAATCCCAGGAGGGAGTTTCCGCTTTGGTGCTTCTTTGCGTCAGCTTGACATCTCTAGAAACCAG
>augustus_masked-Fvb3-1-processed-gene-28.1:300:420:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-28.1:300-420|2x||RAPiDGENOMICS_rs1205_01037
CCAGGAGGGAGTTTCCGCTTTGGTGCTTCTTTGCGTCAGCTTGACATCTCTAGAAACCAGATTTCGGATTCGTCCTTGTTGACTTGCCAGAATCTTAATCTGCTCAATGTTTCCGGTAAC
>augustus_masked-Fvb3-1-processed-gene-28.1:360:480:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-28.1:360-480||RAPiDGENOMICS_rs1205_01038
ATTTCGGATTCGTCCTTGTTGACTTGCCAGAATCTTAATCTGCTCAATGTTTCCGGTAACAAGCGCACCGGAAAGCTGAGTGGTTCTATCTTGTCTGGCAAGAATCTGACAACACTTGTC
>augustus_masked-Fvb3-1-processed-gene-28.1:420:540:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-28.1:420-540|2x||RAPiDGENOMICS_rs1205_01039
AAGCGCACCGGAAAGCTGAGTGGTTCTATCTTGTCTGGCAAGAATCTGACAACACTTGTCCTTTCATACAATGCTTTGTCAGGGGAGATGCCAAACACTTTCCTGGAAAGCGCCTCAGCA
>augustus_masked-Fvb3-1-processed-gene-28.1:480:600:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-28.1:480-600||RAPiDGENOMICS_rs1205_01040
CTTTCATACAATGCTTTGTCAGGGGAGATGCCAAACACTTTCCTGGAAAGCGCCTCAGCATCACTCAAGTATTTGGATCTCTCAAGCAACAATTTCACTGGAAAGTTTGCAAGCCTTGAT
>augustus_masked-Fvb3-1-processed-gene-28.1:540:660:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-28.1:540-660|2x||RAPiDGENOMICS_rs1205_01041
TCACTCAAGTATTTGGATCTCTCAAGCAACAATTTCACTGGAAAGTTTGCAAGCCTTGATTTCGGGCAGTGCAGCAGCCTCACTTTGCTGAAACTATCACACAATAATCTCTATGGGGAT
>augustus_masked-Fvb3-1-processed-gene-28.1:600:720:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-28.1:600-720||RAPiDGENOMICS_rs1205_01042
TTCGGGCAGTGCAGCAGCCTCACTTTGCTGAAACTATCACACAATAATCTCTATGGGGATGAGTTTCCTTCAAGCCTTGCCAACTGTCAAGCTTTGGAGACACTGAACCTGACTAGTAAT
>augustus_masked-Fvb3-1-processed-gene-28.1:720:840:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-28.1:720-840||RAPiDGENOMICS_rs1205_01043
AAGTTGCAGGACAAGATTCCAGGTGCTTTGTTGGGAAATCTCAAGAAATTGAGGCAACTCTTTCTGGGTCGTAATCAGTTTTCTGGTGTAATTCCAGCTGAATTAGGAAAGGCCTGTGGG
>augustus_masked-Fvb3-1-processed-gene-28.1:840:960:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-28.1:840-960||RAPiDGENOMICS_rs1205_01044
ACACTCCAGGAGCTTGATATTTCTGATAGCAGTCTTACTGGTGAATTGCCTTCAAGTTTTGTGTCATGCACTTATTTGGTTACTCTCAATCTTGGTCGCAATCAGCTATCAGGAAATTTC
>augustus_masked-Fvb3-1-processed-gene-28.1:900:1020:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-28.1:900-1020|2x||RAPiDGENOMICS_rs1205_01045
GTGTCATGCACTTATTTGGTTACTCTCAATCTTGGTCGCAATCAGCTATCAGGAAATTTCCTCAATACAGTTGTGAGTAAGCTTCCTAGTTTGAGATATCTTTATGTACCCTTCAACAAC
>augustus_masked-Fvb3-1-processed-gene-28.1:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-28.1-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-28.1:960-1080||RAPiDGENOMICS_rs1205_01046
CTCAATACAGTTGTGAGTAAGCTTCCTAGTTTGAGATATCTTTATGTACCCTTCAACAACATAACTGGTCCTGTGCCACCCTCTATTACCAATGGTACTCGGCTTCGAGTGTTCGATCTC
>augustus_masked-Fvb3-1-processed-gene-280.1:600:720:Parent=augustus_masked-Fvb3-1-processed-gene-280.1-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-280.1:600-720||RAPiDGENOMICS_rs1205_01047
CTCACCGGTTATGTCCCAAAACACTTGAATCTCAACTTGACCCAGATCGATTTCTCCGGTAATAAACTCGAAGGAAGAATACCCAGTTCCATTACTCTGCTCGAAAACCTCCAAAGCTTG
>augustus_masked-Fvb3-1-processed-gene-280.1:660:780:Parent=augustus_masked-Fvb3-1-processed-gene-280.1-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-280.1:660-780|2x||RAPiDGENOMICS_rs1205_01048
AATAAACTCGAAGGAAGAATACCCAGTTCCATTACTCTGCTCGAAAACCTCCAAAGCTTGAATCTTTCGTCTAACACACTCAATGGCGAGATACCCACTTCGTTTGGGGACCTCATTTCC
>augustus_masked-Fvb3-1-processed-gene-280.1:780:900:Parent=augustus_masked-Fvb3-1-processed-gene-280.1-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-280.1:780-900|2x||RAPiDGENOMICS_rs1205_01049
CTCACAAACGTTTCTCTAGCTTCGAATTCATTATCCGGGCCGATACCCGAGTCCATTTCAGCCATTCCCGGGTTAGTTCATCTTGATCTGAGCTCGAATCAGCTCAATGGCTCAATCCCC
>augustus_masked-Fvb3-1-processed-gene-280.1:840:960:Parent=augustus_masked-Fvb3-1-processed-gene-280.1-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-280.1:840-960||RAPiDGENOMICS_rs1205_01050
GCCATTCCCGGGTTAGTTCATCTTGATCTGAGCTCGAATCAGCTCAATGGCTCAATCCCCAAGTTCCTGTCTGATATGAAGAGCTTGAAGCATTTGAATCTTGCCAACAATAACTTCCGG
>augustus_masked-Fvb3-1-processed-gene-291.1:1000:1120:Parent=augustus_masked-Fvb3-1-processed-gene-291.1-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-291.1:1000-1120||RAPiDGENOMICS_rs1205_01051
ATTTGAGCAACAATCAACTAATTGGTGAGCTGACACTTCCAGAAGATTTCATTGAGAGGCTTGGGAAGAGATTGGTGCTAAGAGGAAACAATGGGCTATGTACAAGCAATTCACTTCACA
>augustus_masked-Fvb3-1-processed-gene-291.1:1120:1240:Parent=augustus_masked-Fvb3-1-processed-gene-291.1-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-291.1:1120-1240||RAPiDGENOMICS_rs1205_01052
ACAAGGAGAACATTTCTGGCTATGTGATAGCTCCTTTGTGTTTGAATCCAAGAGGGCTGGGAGATCAAAACCCAACTGAGTCTGTGAGAATGAAGCCATTGGATCAAAACCCTGTTCAGG
>augustus_masked-Fvb3-1-processed-gene-291.1:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-291.1-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-291.1:240-360||RAPiDGENOMICS_rs1205_01053
GAGTTTTTGGGGATTCTTGAGGTAATGGGTGCCCTTCTTGAGGACTCTGATTGGGCTCTAGAGCACCCACAACCATGTACTGAGACTCCATGGCCTGGTGTTGAATGTGAGATTGGGGAT
>augustus_masked-Fvb3-1-processed-gene-291.1:360:480:Parent=augustus_masked-Fvb3-1-processed-gene-291.1-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-291.1:360-480||RAPiDGENOMICS_rs1205_01054
GAAGACCCTCCAATGTTTCATGTCACAAAGATACATATTGGCCCTGATATTCTCACCCCTCCTTGCAAATCCGCTGCTTCTTTATCAGAGTCCCTTCTCAAATTACCATACTTACAGACC
>augustus_masked-Fvb3-1-processed-gene-291.1:480:600:Parent=augustus_masked-Fvb3-1-processed-gene-291.1-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-291.1:480-600||RAPiDGENOMICS_rs1205_01055
CTCTCAATATTTAGTTGCTTTACAACATCACAAGTCACTCTTTCTCCAAAGCTCTTTGGTGCATTGTCTTCCTTGGAACACCTAACCCTTGTGTCCAATCCAACTCTCTCAGGTGAAATT
>augustus_masked-Fvb3-1-processed-gene-291.1:720:840:Parent=augustus_masked-Fvb3-1-processed-gene-291.1-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-291.1:720-840||RAPiDGENOMICS_rs1205_01056
TACAACAACTTGAGTGGTCAAATACCAGAAGAAATTGGGGGGTTGGAGAGTTTGACCATTTTGGATTTAAGCCGGAATGTTCTTGAAGGTCAGGCACCCTCCTCTATTGGTCAGCTTAAA
>augustus_masked-Fvb3-1-processed-gene-291.1:880:1000:Parent=augustus_masked-Fvb3-1-processed-gene-291.1-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-291.1:880-1000||RAPiDGENOMICS_rs1205_01057
GGCCATTACCCAACTTCCTCTCTTCCTTGAAGAATCTTACTGCTCTTTCTCTAGACAACAATAGCCTCACTGGGACTGTTCCTCCAAATTTGGAGACCCTTCCAAGTCTGGATTTGCTGA
>augustus_masked-Fvb3-1-processed-gene-294.8:1020:1140:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-294.8:1020-1140|2x||RAPiDGENOMICS_rs1205_01058
TGTGGAGGTTTGCCGCTTTTGATAGTCACTGTTGCAAGATCTCTGAAAGACGGTACATTACATGAATGGAAAGATACTTTAAGACGACTGAAGGAGTTTGATGGAGAAGAACTGATAAAT
>augustus_masked-Fvb3-1-processed-gene-294.8:1080:1200:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-294.8:1080-1200||RAPiDGENOMICS_rs1205_01059
CATGAATGGAAAGATACTTTAAGACGACTGAAGGAGTTTGATGGAGAAGAACTGATAAATAAAACATACGCTGCTATTGAGTGGAGTTACGATAAATTGAAAAGTGACGAGCTTAAGTCA
>augustus_masked-Fvb3-1-processed-gene-294.8:1140:1260:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-294.8:1140-1260|2x||RAPiDGENOMICS_rs1205_01060
AAAACATACGCTGCTATTGAGTGGAGTTACGATAAATTGAAAAGTGACGAGCTTAAGTCAGTATTCTTGCTCTGTGCAAGTGAGGGTGGGAGTGACAATTCTGTTGATATCCTTAGCTTG
>augustus_masked-Fvb3-1-processed-gene-294.8:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-294.8:120-240||RAPiDGENOMICS_rs1205_01061
CAAACTCGAGTTTGTGAATTGGGTTATGCCAGAGAAGGCATGGAGCATGTTGTTGAAACAGAGGAAAGAAAAGGTAAAAAGATTGAAACAGAGGTCCAGAACTGGCTGACTAAAGTGGAT
>augustus_masked-Fvb3-1-processed-gene-294.8:1200:1320:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-294.8:1200-1320||RAPiDGENOMICS_rs1205_01062
GTATTCTTGCTCTGTGCAAGTGAGGGTGGGAGTGACAATTCTGTTGATATCCTTAGCTTGTTGAAATACAGTATGGGGCTGGGTTTCATAAAGAATGCAGATACACTGGAAAAAGCATGG
>augustus_masked-Fvb3-1-processed-gene-294.8:1320:1440:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-294.8:1320-1440||RAPiDGENOMICS_rs1205_01063
GATGCATTGAATTCACTGCTTAAAAAGCTTCAGCATTCTTGCCTGTTGCTAGATATTGTTCAACATGGTAATTATGAATGGGTCAGAATCCATGATCTTGTAAAACATGTTGCGAAACTT
>augustus_masked-Fvb3-1-processed-gene-294.8:1920:2040:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-294.8:1920-2040||RAPiDGENOMICS_rs1205_01064
TCACCTGATGTTATATCCAAGTTGAAACGACTCGAAGAGTTGAGAATGGGAAAGAACAGCTTTAACAAATGGGAGGCTGGAAGAGTCGGCGAGACTAAAAGAAGTAATGCAAGCCTTGAA
>augustus_masked-Fvb3-1-processed-gene-294.8:2040:2160:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_18::augustus_masked-Fvb3-1-processed-gene-294.8:2040-2160||RAPiDGENOMICS_rs1205_01065
GAGTTAACGTGTTTGCCTCGGCTAACCGCATTACATATACATATCCCAGATGCCACCATACTTCCAGCAGATTTGTTCACCACTAGTGAGTTGGAGAGATTCCAAATTTGTATCGGTTCC
>augustus_masked-Fvb3-1-processed-gene-294.8:2520:2640:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-294.8:2520-2640||RAPiDGENOMICS_rs1205_01066
CAATTTATGGAAGTGGTAATTTCTATAGAAGAATCTAATAAGGAACTTGCAGAGAACTTTTTTCCCCAACTACAAGATTTGGAGCTAAATGGCCTTCCAAACCTCACTAAATTCTGCTCA
>augustus_masked-Fvb3-1-processed-gene-294.8:2640:2760:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-294.8:2640-2760||RAPiDGENOMICS_rs1205_01067
TCAACATGTGAGAGATTAGAAGACTGTACAGAAAGTGCTGGAATCTGTGAAGAAGTTGAAGAGATAGACTCAAAAAGAAACCTGGATTTTGTGATACAACACTTTCTTTTTGAAAATAAG
>augustus_masked-Fvb3-1-processed-gene-294.8:3000:3120:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-294.8:3000-3120||RAPiDGENOMICS_rs1205_01068
ACAACACCTATGTTTGTTTTTTCAAAACTAACATATGTGAGATTTGAAAATTTACCCCAACTTAAGAGTTTTTATCCAGGATTGCATTCTACGAAGTGGCCGTCACTCCTAACTTTAGCG
>augustus_masked-Fvb3-1-processed-gene-294.8:3219:3339:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-294.8:3219-3339||RAPiDGENOMICS_rs1205_01069
GATTCATTCCCCAACTTGGAAACTTTAGGCTTCGACATAACGGAGAACTGGGATAGTCCGCCACTCCACTTGTTGAGGAACCTCAAGTTTCTTTGTAGTAATGCACACACCAACTCATCT
>augustus_masked-Fvb3-1-processed-gene-294.8:3339:3459:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-294.8:3339-3459||RAPiDGENOMICS_rs1205_01070
TTGATTTCCCTTGAGCAATTATTTGGTCTTGAAAAAGTCAATGGAGAAATACAAGCAGCTGGGGATGTGACCTTTCCGTTTTTACGAGAGTTGCACCTTCACGGGATGCGGAAGCTGATG
>augustus_masked-Fvb3-1-processed-gene-294.8:3459:3579:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-294.8:3459-3579||RAPiDGENOMICS_rs1205_01071
AATCTTGGGGATGATAGCTTCGGACTAGCAGGCCTATATTTTCCAAAAGTGGAAATTCTAGTGTTAGAGGACTGTGACAGCTTACAGAATTTAAGATCGTCCGCAATATCCTTTAACTAT
>augustus_masked-Fvb3-1-processed-gene-294.8:3819:3939:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-294.8:3819-3939||RAPiDGENOMICS_rs1205_01072
AAATTCCCGTCCTTGGAAAATTTATGGATGAGTGGTTGCACTCAACTGGAGGGATTCATCCTTGATGTTACTACGGATAAAAATAGACTGCTTGGCAATGAGATCGAAGACATCGAGAGT
>augustus_masked-Fvb3-1-processed-gene-294.8:3975:4095:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-294.8:3975-4095||RAPiDGENOMICS_rs1205_01073
GTTGAATTGCCGAAGTTGACGAGGTTGACTCTCAAGGGTCTAACCAAGTTGACCACAATATGGAATAAACAAATACAGAACACATCAGCAGCACCATTCGATTGTGAAAATCTACAGCAT
>augustus_masked-Fvb3-1-processed-gene-294.8:420:540:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-294.8:420-540|2x||RAPiDGENOMICS_rs1205_01074
GCTAAACCAGAAGAGATGTGTATCCAAGACTATGAGGCCTTTGATTCAAGGACTTCAACTGCAATGGCTGTAATCAACGAACTAAGAAATTCTAATACCTACATGATTGGGGTGTACGGT
>augustus_masked-Fvb3-1-processed-gene-294.8:4335:4455:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-294.8:4335-4455||RAPiDGENOMICS_rs1205_01075
CTCAATGACTTGGGAGTGTTTAATTGCGACAAAGTTGACATATTTGCTGAAGAGTTTTCAAGTTTCCAAGAAAAGCTCGACGGGAACAATTCCAGTACTCTTATTAATCGGCAATTTCTC
>augustus_masked-Fvb3-1-processed-gene-294.8:4470:4590:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-294.8:4470-4590||RAPiDGENOMICS_rs1205_01076
GATTCATTTCCCAACTTGGAGCGATTGAGCTTGGAGGTAATGGAGTTCTCCAATGGTCCACTCCCAGCAGCAGCGCAGTTTTTTGGTAAACTAAAGATACTTGCGGTTTATTGTCTAGAG
>augustus_masked-Fvb3-1-processed-gene-294.8:4710:4830:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-294.8:4710-4830||RAPiDGENOMICS_rs1205_01077
ATGAAGAAGCTGATGCATCTAGGCCAGGATGATGAGGAGGATAACTCACAATCAGCTACTCGCATCCCAAATATTCCAAACCTTCAAACTCAGTTCGCAAATGGTTGTCACGGCTTAAGG
>augustus_masked-Fvb3-1-processed-gene-294.8:4830:4950:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-294.8:4830-4950||RAPiDGENOMICS_rs1205_01078
AATCTGAGATCATCTGCAATATCCTTCGACAATCTAACAACTTTGCAAGCAAGTGTTTGCAAAAGGTTGGAGTACTTGATAACATACTCCATGGCCAACAGCTTAACGCTACAGCTGATA
>augustus_masked-Fvb3-1-processed-gene-294.8:720:840:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-294.8:720-840||RAPiDGENOMICS_rs1205_01079
CCGGCTGGAAGAGCAGATCTAATAAGCAACAGAATCAAAGATAAGAAGACTCTTGTGATCCTGGATGATGTCTGGGAGAGCATTGATTTGGAGGCTGTTGGTCTTCCTCGCATGGCGACT
>augustus_masked-Fvb3-1-processed-gene-294.8:780:900:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-294.8:780-900|2x||RAPiDGENOMICS_rs1205_01080
CTGGATGATGTCTGGGAGAGCATTGATTTGGAGGCTGTTGGTCTTCCTCGCATGGCGACTCTCAAAATCTTGTTGACTTCACGAACTAGGCTATTATTAGCTAAAGACATGGGTACACAA
>augustus_masked-Fvb3-1-processed-gene-294.8:900:1020:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-294.8:900-1020|2x||RAPiDGENOMICS_rs1205_01081
AAAGAGTTTCTTCTCGAAGTATTGAACAAAGAAGAAAGTTGGAGATTATTTCAGAAAATGGCGGGTGATATTGTTGAAAATCCCGATATACAAACAATAGCAGCCCAAGTCGCTGAGAAA
>augustus_masked-Fvb3-1-processed-gene-294.8:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-294.8-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-294.8:960-1080||RAPiDGENOMICS_rs1205_01082
GCGGGTGATATTGTTGAAAATCCCGATATACAAACAATAGCAGCCCAAGTCGCTGAGAAATGTGGAGGTTTGCCGCTTTTGATAGTCACTGTTGCAAGATCTCTGAAAGACGGTACATTA
>augustus_masked-Fvb3-1-processed-gene-39.5:0:120:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-39.5:0-120||RAPiDGENOMICS_rs1205_01083
ATGCCATCTTCTTCTTTGAATTGGTCTTCGAACGATTGCTGCACATGGGAAGGCATCACTTGTGATACAGTTGGTCGAGTTATACATGTGTGTCTTCCCTCCAAAGGGCTCAAACTCAAA
>augustus_masked-Fvb3-1-processed-gene-39.5:1080:1200:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-39.5:1080-1200||RAPiDGENOMICS_rs1205_01084
GGGGCAATGAAGATATTGATGTATTCCAAAAGCCTAGTATTCCTAGCCTTTCCAGGAAGCTTTGTAGGCGAAGAAATGCCCGATGATCTTGGCATGGTTGATTTTTATGGATTCCAAAAC
>augustus_masked-Fvb3-1-processed-gene-39.5:1140:1260:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-39.5:1140-1260|2x||RAPiDGENOMICS_rs1205_01085
TTTGTAGGCGAAGAAATGCCCGATGATCTTGGCATGGTTGATTTTTATGGATTCCAAAACCTTCGATTTTTATCTCTAGCTGGCTGTGAGCTCACTGGTCATATACCTGCATATTTATCC
>augustus_masked-Fvb3-1-processed-gene-39.5:1200:1320:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-39.5:1200-1320||RAPiDGENOMICS_rs1205_01086
CTTCGATTTTTATCTCTAGCTGGCTGTGAGCTCACTGGTCATATACCTGCATATTTATCCAAATTCGAAAAGCTAGAGCTCTTGTTTCTTGGAAACAATAGATTCACAGGGTCAATTCCT
>augustus_masked-Fvb3-1-processed-gene-39.5:1260:1380:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-39.5:1260-1380|2x||RAPiDGENOMICS_rs1205_01087
AAATTCGAAAAGCTAGAGCTCTTGTTTCTTGGAAACAATAGATTCACAGGGTCAATTCCTAGTTGGTTAGGGAATCTTCCAAGGCTCTATTCTTTCGACTTGTCATTCAACCTCCTCTCA
>augustus_masked-Fvb3-1-processed-gene-39.5:1320:1440:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-39.5:1320-1440||RAPiDGENOMICS_rs1205_01088
AGTTGGTTAGGGAATCTTCCAAGGCTCTATTCTTTCGACTTGTCATTCAACCTCCTCTCAGGTGAGTTTCCCAAAGAGCTTTGTAGACTGCCAATGTTGATATCGAAAGGAACTGCAGCT
>augustus_masked-Fvb3-1-processed-gene-39.5:1440:1560:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_13::augustus_masked-Fvb3-1-processed-gene-39.5:1440-1560||RAPiDGENOMICS_rs1205_01089
CAAGTAGAGGATGATGATCTTGAATTACCTATCTACTCACTCATAGCATCGCTTTTACAATACAAATTGTCTTACTTTCCTATAGCGATAAGCATGGGCAATAACACCATTAGTGGGAGC
>augustus_masked-Fvb3-1-processed-gene-39.5:1620:1740:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-39.5:1620-1740|2x||RAPiDGENOMICS_rs1205_01090
TTGTCAGGCAACATTCCAGATCAAATATCGAACTTGAAGAGCTTGGAGCACTTGGATCTCTCTGGGAATCATTTGTCCGGAAAAATCCCATTATCATTTACAAGGCTTACTTTCTTGAAC
>augustus_masked-Fvb3-1-processed-gene-39.5:1680:1800:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-39.5:1680-1800||RAPiDGENOMICS_rs1205_01091
TCTGGGAATCATTTGTCCGGAAAAATCCCATTATCATTTACAAGGCTTACTTTCTTGAACTTTTTTAATGTGTCATACAATAATCTGGAAGGTACAATACCAGCAAACACGCAACTCCAA
>augustus_masked-Fvb3-1-processed-gene-39.5:180:300:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-39.5:180-300|2x||RAPiDGENOMICS_rs1205_01092
TCCCACAATTCACTTTATGGTTCACTTGATCAAACTGAATTCTTCTCATCTTTGAGTCGTCTTGAAATCCTGGATTTGAGCTATAACTTCCTATTTGGAGAATTACCCCTTTCTCTTCCA
>augustus_masked-Fvb3-1-processed-gene-39.5:1800:1920:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-39.5:1800-1920||RAPiDGENOMICS_rs1205_01093
AGCTTCAATGCTTCTGCATTTGAGGGAAATGCAAACCTTTGTGGTGCTCCACTTCCAAATAAGTGCCTGCCGGTTGAAGACAAGGATGCTAATAACAGAAACAGCCGTGATGATGTGGGG
>augustus_masked-Fvb3-1-processed-gene-39.5:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-39.5:240-360||RAPiDGENOMICS_rs1205_01094
CTTGAAATCCTGGATTTGAGCTATAACTTCCTATTTGGAGAATTACCCCTTTCTCTTCCATCAATCCGAAGGCTGGATTTGTCCAGCAACCACTTTCATGGTTCAATTCCATCTTCATTC
>augustus_masked-Fvb3-1-processed-gene-39.5:300:420:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-39.5:300-420|2x||RAPiDGENOMICS_rs1205_01095
TCAATCCGAAGGCTGGATTTGTCCAGCAACCACTTTCATGGTTCAATTCCATCTTCATTCTTCCAACATGCTTGGAATTTGACGAGTTTTAATATCAGTAACAACACCTTCTCAGGTTCT
>augustus_masked-Fvb3-1-processed-gene-39.5:360:480:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-39.5:360-480||RAPiDGENOMICS_rs1205_01096
TTCCAACATGCTTGGAATTTGACGAGTTTTAATATCAGTAACAACACCTTCTCAGGTTCTATCCCATCCTCTATTTGTCTTGATTCAATTCCTTTGATACAACTATTGGACTTTTCCTTC
>augustus_masked-Fvb3-1-processed-gene-39.5:840:960:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-39.5:840-960||RAPiDGENOMICS_rs1205_01097
AACAATTTGGAAGGCAACTTTTCAGTGCTTGACTTCTCCAAACTTAGTCAGCTTACTAAATTAGATTTAGGGGGTAATAACCTCAGCGGTATCATTCCCAGAAGCCTTTACTCATGCAAG
>augustus_masked-Fvb3-1-processed-gene-39.5:900:1020:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-39.5:900-1020|2x||RAPiDGENOMICS_rs1205_01098
TTAGATTTAGGGGGTAATAACCTCAGCGGTATCATTCCCAGAAGCCTTTACTCATGCAAGTCCTTGAAAGCAATTCGAATATCCCAAAACAATCTAGAGGGAGAAATACATCCTGATATT
>augustus_masked-Fvb3-1-processed-gene-39.5:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-39.5-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-39.5:960-1080||RAPiDGENOMICS_rs1205_01099
TCCTTGAAAGCAATTCGAATATCCCAAAACAATCTAGAGGGAGAAATACATCCTGATATTCTATTGTTGACATTATTATCGTTCTTGTCGCTTGGTCATAATAGATTGACCAATCTCACT
>augustus_masked-Fvb3-1-processed-gene-39.8:0:120:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-39.8:0-120||RAPiDGENOMICS_rs1205_01100
ATGCCTAATCATCTCATGTCTTTTTGCACTCTCCTGTTCTGCTGTTTCATCTCGAGCATCATTTCTACAAACCATGCGTGCAACAATTTGGATCATGACTCTCTTCGGTCCTCTTTCTAT
>augustus_masked-Fvb3-1-processed-gene-39.8:1080:1200:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-39.8:1080-1200||RAPiDGENOMICS_rs1205_01101
TTGAGCTTAAACGATCTAGAGGGACAAATACAACGTGAGATTCTTTCACTTGAGTCCTTGTCCTTCCTCTCTCTTTCACGGAACAGACTGACCAATGTCACAGGGGCATTGAAGATACTG
>augustus_masked-Fvb3-1-processed-gene-39.8:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-39.8:120-240||RAPiDGENOMICS_rs1205_01102
CTGCCTTCTCTAAATTGGTCTTCTAGTGATTGTTGCCACTGGGAGGGGATCAGTTGTGATGAGAATGGTAGAGTCACAAGTTTATTGTTGCCCTCCAAAGGTCTCGAAGGTGTGATTTCA
>augustus_masked-Fvb3-1-processed-gene-39.8:1200:1320:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-39.8:1200-1320||RAPiDGENOMICS_rs1205_01103
ATGGGTTTCAAAAATATCGGAGTAGTCATTCTCTCAGGGAATTTCGTAGGTGAAGAACTGCCTGGTGGTGATGACAATAATGGTTCAATGTTCAAGAATCTCCGACTTTTTGGTATAGCT
>augustus_masked-Fvb3-1-processed-gene-39.8:1260:1380:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-39.8:1260-1380|2x||RAPiDGENOMICS_rs1205_01104
CCTGGTGGTGATGACAATAATGGTTCAATGTTCAAGAATCTCCGACTTTTTGGTATAGCTGACTGCCAACTTACAGGTCAAATACCTAGATGGTTGTCCAACCTCAAGAAACTAGAAGCT
>augustus_masked-Fvb3-1-processed-gene-39.8:1320:1440:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-39.8:1320-1440||RAPiDGENOMICS_rs1205_01105
GACTGCCAACTTACAGGTCAAATACCTAGATGGTTGTCCAACCTCAAGAAACTAGAAGCTCTCGACCTATCTTCGAATAGACTCACTGGATCAATACCTGCTTGGTTAGGAGATCTTCCT
>augustus_masked-Fvb3-1-processed-gene-39.8:1380:1500:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-39.8:1380-1500|2x||RAPiDGENOMICS_rs1205_01106
CTCGACCTATCTTCGAATAGACTCACTGGATCAATACCTGCTTGGTTAGGAGATCTTCCTAATCTCTTCTTCATTAGCTTGAATAATAACTCATTTTCCGGTGAACTTCCAAAGGAACTT
>augustus_masked-Fvb3-1-processed-gene-39.8:1440:1560:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_13::augustus_masked-Fvb3-1-processed-gene-39.8:1440-1560||RAPiDGENOMICS_rs1205_01107
AATCTCTTCTTCATTAGCTTGAATAATAACTCATTTTCCGGTGAACTTCCAAAGGAACTTTCCAGACTACAAGCATTGCAATCCCAAAAGGATGCATCGCAGGGCCATGGCTTTTTTGAA
>augustus_masked-Fvb3-1-processed-gene-39.8:1560:1680:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-39.8:1560-1680||RAPiDGENOMICS_rs1205_01108
TTGCCAGTCTACACTCAACGCACAAATGCATCCGTTACTGACTTGCAGTACAACTATATTTCCAACTTGCCTCGAGCAATTTACCTCAGGAACAACAGTCTGAGTGGCAACATACCATCT
>augustus_masked-Fvb3-1-processed-gene-39.8:1680:1800:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-39.8:1680-1800||RAPiDGENOMICS_rs1205_01109
GAAATTGGTCATTTGCAACTTCTTCATGAGTTTGATCTTAGCGTCAACAACTTTGTTGGAGAGATTCCAAACGAAATGTCTAACCTCACAAACTTGGAGAGATTAGACCTCTCAAGAAAT
>augustus_masked-Fvb3-1-processed-gene-39.8:1740:1860:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-39.8:1740-1860|2x||RAPiDGENOMICS_rs1205_01110
GAGATTCCAAACGAAATGTCTAACCTCACAAACTTGGAGAGATTAGACCTCTCAAGAAATCACTTGTCTGGCGGAATCCCAGCTTCACTATCAAATCTTCATTTCTTGGCTTCATTTAGT
>augustus_masked-Fvb3-1-processed-gene-39.8:180:300:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-39.8:180-300|2x||RAPiDGENOMICS_rs1205_01111
GAGAATGGTAGAGTCACAAGTTTATTGTTGCCCTCCAAAGGTCTCGAAGGTGTGATTTCACCTTCACTTGGAAACCTCACACAACTCTCCCACCTCAATCTTTCCCACAATCAACTCTCT
>augustus_masked-Fvb3-1-processed-gene-39.8:1800:1920:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-39.8:1800-1920||RAPiDGENOMICS_rs1205_01112
CACTTGTCTGGCGGAATCCCAGCTTCACTATCAAATCTTCATTTCTTGGCTTCATTTAGTGTTGCATACAATAATCTCCAAGGACAAATACCATCAGGCACTCAACTCCAAGGCTTTAGC
>augustus_masked-Fvb3-1-processed-gene-39.8:1920:2040:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-39.8:1920-2040||RAPiDGENOMICS_rs1205_01113
ACCACTGCCTATGAGGGAAATCCCGGACTTTGTGGTGCCCCGCTTCCAAATCATTGTCAACCAACAAATGGAAGTCCTACTACTACAAACACTGAAGATGGACTTGACAACGGGAATGAA
>augustus_masked-Fvb3-1-processed-gene-39.8:300:420:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-39.8:300-420|2x||RAPiDGENOMICS_rs1205_01114
GGTCCTTTAGGAACCGGTCTCTTTTCATCCTTGAGTCGTCTCCAGATTCTTGATTTGAGCTATAACCATCTTTCGGGAGTGTTGCCGTTGTCAATACCATTTGTTTCTATTCGAGTGGTT
>augustus_masked-Fvb3-1-processed-gene-39.8:480:600:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-39.8:480-600||RAPiDGENOMICS_rs1205_01115
AATTTGAGTAGTCTGAATGTCAGTGACAATCTTATTACTGGCAAAATTCCATCCTCTATTTGTCTCTCTTCTTCTTTGGTCAAAATCTTGGATTTCTCCAAAAATGAATTTAGTGGTATG
>augustus_masked-Fvb3-1-processed-gene-39.8:600:720:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-39.8:600-720||RAPiDGENOMICS_rs1205_01116
ATTCCTGTTGGATTAGGGAATTGTTCGAAATTGGAGGTCTTTCGCGCAGGGTTTAATAATCTCTCAGGGACTCTTCCTAGTGATCTTTATGATGCTCTCACCCTTCAAGAAATATCATTG
>augustus_masked-Fvb3-1-processed-gene-39.8:720:840:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-39.8:720-840||RAPiDGENOMICS_rs1205_01117
CCTTCAAATAAGCTTTCTGGATCCTTTAGTGATAATATTGTCTATCTTAGTAACCTCACAATCTTGGAGATCTACTTCAACCAGCTGAGTGGAACACTTCCCTCCCATATTGGGAAACTC
>augustus_masked-Fvb3-1-processed-gene-39.8:840:960:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-39.8:840-960||RAPiDGENOMICS_rs1205_01118
TCCAAATTGAAACTCATGCTCCTTCATTTTAACAACCTTCAAGGTTTTCTACCCCAATCGTTGATGAGTTGTACAAATCTTGTGGAACTGAATCTTGGATTTAATCACTTGGAAGGAAAC
>augustus_masked-Fvb3-1-processed-gene-39.8:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-39.8-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-39.8:960-1080||RAPiDGENOMICS_rs1205_01119
ATCTCCCTTCTTGATTTCTCCAAACTTGGTCAACTTGCTAAACTTGATTTTGTGAGCAATCACTTCACTGGTGTCATACCAAGAAGCCTTTACTCATGCAAGTCACTGGGAGCGCTTCGA
>augustus_masked-Fvb3-1-processed-gene-5.13:1140:1260:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-5.13:1140-1260|2x||RAPiDGENOMICS_rs1205_01120
AGCCTGCAACGACTTTACCTCGGCTACAACTCTTTTTGGGGATCCATTCCTGAATCTATTTTCAGCGACTTATCATCATCCCTCAAGACACTGTTCTTGGGTGATAATCTTTTCAATGGT
>augustus_masked-Fvb3-1-processed-gene-5.13:1200:1320:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-5.13:1200-1320||RAPiDGENOMICS_rs1205_01121
TTCAGCGACTTATCATCATCCCTCAAGACACTGTTCTTGGGTGATAATCTTTTCAATGGTTCCATTCCTGAAAGTTTGGGACAACTCAGTCAGCTCGTTAGCCTTGATCTGTCTTCTAAT
>augustus_masked-Fvb3-1-processed-gene-5.13:1320:1440:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-5.13:1320-1440||RAPiDGENOMICS_rs1205_01122
TCATGGGAAGGCAGTTTAAAGGAAGCCCATTTCATAAATCTCACCAGCTTAAAGGATATAGGTTTGACCACAAGACGACCTGTGCCTATCATTTTCAACTTGACCGATTATGAATGGATT
>augustus_masked-Fvb3-1-processed-gene-5.13:1440:1560:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_13::augustus_masked-Fvb3-1-processed-gene-5.13:1440-1560||RAPiDGENOMICS_rs1205_01123
CCTCCTTTCAAGCTCCAATCACTTTCCATGGACAACTGTCGAGTAGGCCCTGGTTTTCCGGTATGGCTTCAATCGCAAACCGAGCTATCATATGTCCAAGTTTGGAATGCTGGAATCTCA
>augustus_masked-Fvb3-1-processed-gene-5.13:1560:1680:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-5.13:1560-1680||RAPiDGENOMICS_rs1205_01124
GGTGCAATACCAGAAGGATGGATGTCTAATATCTCTTCCCAAATCCAAAGTTTGGATTTGTCTTACAACCAAATCAGCGGAATGCTTCCGTTCCAATTCAACTTTCCAAATCTGGAGTAC
>augustus_masked-Fvb3-1-processed-gene-5.13:1620:1740:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-5.13:1620-1740|2x||RAPiDGENOMICS_rs1205_01125
TCTTACAACCAAATCAGCGGAATGCTTCCGTTCCAATTCAACTTTCCAAATCTGGAGTACATATACTTCAGCCACAATCAATTTGATGGCACTATTCCATCATCTATCTGCAGCATTCAA
>augustus_masked-Fvb3-1-processed-gene-5.13:1680:1800:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-5.13:1680-1800||RAPiDGENOMICS_rs1205_01126
ATATACTTCAGCCACAATCAATTTGATGGCACTATTCCATCATCTATCTGCAGCATTCAATCTCTATATTCCCTTTCTCTAAACAACAATCAGTTTTCTGGAGAATTCCCTAAAGAATGG
>augustus_masked-Fvb3-1-processed-gene-5.13:1740:1860:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-5.13:1740-1860|2x||RAPiDGENOMICS_rs1205_01127
TCTCTATATTCCCTTTCTCTAAACAACAATCAGTTTTCTGGAGAATTCCCTAAAGAATGGAGTTTGTGGAGCCGCATAACCTTTGTGGATGTCTCAAACAACAATTTGTCTGGTAATATT
>augustus_masked-Fvb3-1-processed-gene-5.13:180:300:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-5.13:180-300|2x||RAPiDGENOMICS_rs1205_01128
TCTTGGGTTGGTCATCAATGCTGTGAATGGAGAGGGATTTCGTGCAACAACCACACAGGTCGTATTGTCAGGCTTGATCTTCGTAATCCATATCCATATCCATCCAGCTGGAACTACACC
>augustus_masked-Fvb3-1-processed-gene-5.13:1800:1920:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-5.13:1800-1920||RAPiDGENOMICS_rs1205_01129
AGTTTGTGGAGCCGCATAACCTTTGTGGATGTCTCAAACAACAATTTGTCTGGTAATATTCCAAGCTCGATGGGTATTCCAAGTTCTCTTTTTATATTAAAGATGGACAACAATCAGTTA
>augustus_masked-Fvb3-1-processed-gene-5.13:1860:1980:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-5.13:1860-1980|2x||RAPiDGENOMICS_rs1205_01130
CCAAGCTCGATGGGTATTCCAAGTTCTCTTTTTATATTAAAGATGGACAACAATCAGTTAAGCGGAGAAATTCCTTCTGCCTTGCAAAATTGCTCAACTTTGCGAAGACTTTCTCTTGGA
>augustus_masked-Fvb3-1-processed-gene-5.13:1920:2040:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-5.13:1920-2040||RAPiDGENOMICS_rs1205_01131
AGCGGAGAAATTCCTTCTGCCTTGCAAAATTGCTCAACTTTGCGAAGACTTTCTCTTGGAGGCAACAAATTCACCGGAAGCATACCTTCTTGGATAGGATCAAAGGTATCCGGATTCCAA
>augustus_masked-Fvb3-1-processed-gene-5.13:2100:2220:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_18::augustus_masked-Fvb3-1-processed-gene-5.13:2100-2220|2x||RAPiDGENOMICS_rs1205_01132
CCTCACCTTCAGTTCCTACACCTTGGTCACAACAGATTTTCAGGGACTATTCCCAAGTGTTTGAATAACTTAACTGCTCTAGTCTCTGGTCCGGATCGCTGGGGTATCTTTAGTGACTTA
>augustus_masked-Fvb3-1-processed-gene-5.13:2160:2280:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_19::augustus_masked-Fvb3-1-processed-gene-5.13:2160-2280||RAPiDGENOMICS_rs1205_01133
TTGAATAACTTAACTGCTCTAGTCTCTGGTCCGGATCGCTGGGGTATCTTTAGTGACTTAGAGGAAACATCCGTGACTACAAAAGGAAGAGAAATTGAATACTTAACTTCACAGGCGATG
>augustus_masked-Fvb3-1-processed-gene-5.13:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-5.13:240-360||RAPiDGENOMICS_rs1205_01134
CGTATTGTCAGGCTTGATCTTCGTAATCCATATCCATATCCATCCAGCTGGAACTACACCAAATTTAATGAATCTTGTTTAGAGGGCAAGTTACATCCTTCTCTGGTTGGCTTGAAACAT
>augustus_masked-Fvb3-1-processed-gene-5.13:2640:2760:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_23::augustus_masked-Fvb3-1-processed-gene-5.13:2640-2760||RAPiDGENOMICS_rs1205_01135
GACAACATGCATGGGCCTGATGGACAAGAGAAAAAAGATCACGGAGATGATGAGGAAAAGCTTGGTTTCTATACCAGCACGGTGCTTGGATTCATCATAGGCTTTTGGAGTGTGTGCGGC
>augustus_masked-Fvb3-1-processed-gene-5.13:300:420:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-5.13:300-420|2x||RAPiDGENOMICS_rs1205_01136
AAATTTAATGAATCTTGTTTAGAGGGCAAGTTACATCCTTCTCTGGTTGGCTTGAAACATTTGAGTTACTTAGACCTAAGCCAGAATTGTTTTCATGGGATTCACATTCCTAACTTCATT
>augustus_masked-Fvb3-1-processed-gene-5.13:360:480:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-5.13:360-480||RAPiDGENOMICS_rs1205_01137
TTGAGTTACTTAGACCTAAGCCAGAATTGTTTTCATGGGATTCACATTCCTAACTTCATTGGTGACCTAACAAGTTTGAGGTATCTCAGTCTTTCATGTTATTCGTGGTTTGGTTCATTT
>augustus_masked-Fvb3-1-processed-gene-5.13:840:960:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-5.13:840-960||RAPiDGENOMICS_rs1205_01138
ACAAAACTCGATTTAGGGGGTAATCCTTCCCTTCGCCCCTCTCTTGAAGAATTCGTAAGACTAAAAGCTCTAGAACACCTCGATTTACAGTGGGTTGGACTCAAAGGTCAATTACTTCCC
>augustus_masked-Fvb3-1-processed-gene-5.13:900:1020:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-5.13:900-1020|2x||RAPiDGENOMICS_rs1205_01139
CTAAAAGCTCTAGAACACCTCGATTTACAGTGGGTTGGACTCAAAGGTCAATTACTTCCCAAATTCTTCGGAAACTTGTGCAAGCTAAAGTCATTAGATCTTTCATATAACGAGATTGAT
>augustus_masked-Fvb3-1-processed-gene-5.13:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-5.13-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-5.13:960-1080||RAPiDGENOMICS_rs1205_01140
AAATTCTTCGGAAACTTGTGCAAGCTAAAGTCATTAGATCTTTCATATAACGAGATTGATGGGGGGATCCAAGACTTTTTGAGTGGTTTTTCAAATTGCTCATCCAATAGAATGGAGTCG
>augustus_masked-Fvb3-1-processed-gene-51.4:0:120:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-51.4:0-120||RAPiDGENOMICS_rs1205_01141
ATGTCCACAATAATGATCATATCTTTAACTGATAATCAGCTCTCAGGCAACCTCCCACCAAACATAGGTCTTGGGCTTCCGAATCTGCAAGAGTTCTACATAGCAGGAAATAAACTAAGT
>augustus_masked-Fvb3-1-processed-gene-51.4:1088:1208:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-51.4:1088-1208||RAPiDGENOMICS_rs1205_01142
AGGGATATTGTCAGCAATGTTCATAGTGTCCTCCGTTTGGATAGTGATACTATGTAGAAGAAACAATGTGGAAGCTGCAGAAGAGAATGAACTGTTACCTCAACTTCTATGGAGAGTTTC
>augustus_masked-Fvb3-1-processed-gene-51.4:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-51.4:120-240||RAPiDGENOMICS_rs1205_01143
GGAGTAATCCCCATATCCATCTCCAACGCCACTCGGCTCACAAAAATAGATATGGGAGAAAACTTTCTTTCAGGCTTTATTCCTAACACACTATGTGCTTTAACAAATCTTGAGTGGCTT
>augustus_masked-Fvb3-1-processed-gene-51.4:1208:1328:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-51.4:1208-1328||RAPiDGENOMICS_rs1205_01144
ACACATTGAACTTGTTAGAGCAACAAATGCATTTGATGAAAGAAACTCACTTGGCACTGGTGGTTTTGAAAGAAACTCACTTGGCACTGGTGGTTTTGGCTCAGTCTATGAAGGAACATT
>augustus_masked-Fvb3-1-processed-gene-51.4:1328:1448:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-51.4:1328-1448||RAPiDGENOMICS_rs1205_01145
TTCTGGTGGGATAAATGTGGCCATAAAGGTTTTCAATTTACAGCTAGAAGAGGCCTTCAAGAGTTTCGATATTGAGTGTGAAATGCTAAGCAACATTCGTCATCGAAATCTTATTAAAAT
>augustus_masked-Fvb3-1-processed-gene-51.4:1448:1568:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-51.4:1448-1568||RAPiDGENOMICS_rs1205_01146
CATCACTTGTTGCAGTCAAATTGATTTCAAAGCCGTGGTACTGAACTACATGCCTAACGGGAGCCTTAAGAAGTGGTTATATTCTCCAAACTGGTATTTAAACATCCTGCAGAGATTGAG
>augustus_masked-Fvb3-1-processed-gene-51.4:1568:1688:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-51.4:1568-1688||RAPiDGENOMICS_rs1205_01147
TATTATGATAGATGTTGCATCGGCATTGGAATACCTTCATCATGGTTATGAACCATCTGTTGTTCACTGTGATTTGAAACCCAGATGTATCCTACTGGATGAGGATATGAGTGCACATGT
>augustus_masked-Fvb3-1-processed-gene-51.4:180:300:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-51.4:180-300|2x||RAPiDGENOMICS_rs1205_01148
AACTTTCTTTCAGGCTTTATTCCTAACACACTATGTGCTTTAACAAATCTTGAGTGGCTTTCCTTATATGCGAATCATTTAACTATCGATACTACTACTCAGGAAGTAAATGTTCTCTCT
>augustus_masked-Fvb3-1-processed-gene-51.4:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-51.4:240-360||RAPiDGENOMICS_rs1205_01149
TCCTTATATGCGAATCATTTAACTATCGATACTACTACTCAGGAAGTAAATGTTCTCTCTTGCTTGGAAAATCTCAAAATGTTGAGGCACTTGGACTTCAATACAAACCCATTAAATGCC
>augustus_masked-Fvb3-1-processed-gene-51.4:360:480:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-51.4:360-480||RAPiDGENOMICS_rs1205_01150
TACCTCCCAATTTCCTTCTTTCGAAATCTATCTACATCACTTCAGGATGTTTATCTATACGACTGCAACTTGAGAGGTAATGTACCTGATGATGTAGGCAACTTGAGCAGCTTGACAGTT
>augustus_masked-Fvb3-1-processed-gene-51.4:488:608:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-51.4:488-608||RAPiDGENOMICS_rs1205_01151
CTCTATACCTTCTTGTTTGGGTCACCTGGTCACTGCACTAAGATATCTCTACTTACATTCCAATTTGTTGAGTTCCACAATACCATCTAGTTTGTGGGGATTGACATATATCTTGGATCT
>augustus_masked-Fvb3-1-processed-gene-51.4:60:180:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-51.4:60-180|2x||RAPiDGENOMICS_rs1205_01152
AACATAGGTCTTGGGCTTCCGAATCTGCAAGAGTTCTACATAGCAGGAAATAAACTAAGTGGAGTAATCCCCATATCCATCTCCAACGCCACTCGGCTCACAAAAATAGATATGGGAGAA
>augustus_masked-Fvb3-1-processed-gene-51.4:608:728:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-51.4:608-728||RAPiDGENOMICS_rs1205_01153
ATACTTGTCATTCAATAACCTAAGTGGATCTCTCTCGGAAGATGTTGGTAATTTAAAAGCTGTCATAGTTATAGATTTATCAAACAACCACTTATCCAGTAGTATACCGAGTAGCATTGG
>augustus_masked-Fvb3-1-processed-gene-51.4:728:848:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-51.4:728-848||RAPiDGENOMICS_rs1205_01154
GAATCTACAAACGTTGCAGAATCACTCCTTGGAGAATAACAACTTCAAAGGCTTTATTCGTAGTTCACTTGGAAAATCCCTCAGCTTGGTACTTTTGGACTTGTCCAAAAACAATCTGTC
>augustus_masked-Fvb3-1-processed-gene-51.4:968:1088:Parent=augustus_masked-Fvb3-1-processed-gene-51.4-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-51.4:968-1088||RAPiDGENOMICS_rs1205_01155
ATTTGTGTCGAGTGGGAAGCTCTGTGGTGCATACCGATTCCATGTCCAAGCATGCAAGAATAGTACATTTGAAGCACATTCAATTAAATCAAGCAGATCCATCTCGAAGTACATTATCCT
>augustus_masked-Fvb3-1-processed-gene-6.13:1080:1200:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-6.13:1080-1200||RAPiDGENOMICS_rs1205_01156
CCTAGAAGCCTCTACTCGTGCAAGTTCTTGAAAGCAATTCGAGTGAGCTATAATAATCTAGAGGTTCAAATACAGCCTGAAATTGCTTCATTGCAATCCCTGTCCTTCCTCTCACTGGGA
>augustus_masked-Fvb3-1-processed-gene-6.13:1260:1380:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-6.13:1260-1380|2x||RAPiDGENOMICS_rs1205_01157
CTTGTAGTCTTATCATTAGCATCCAGTTTTGTAGGTGAGGAATTTCCTACTGATCTTGGGAAAGCTGATTTTGATGGATTCCAAAATCTTCGAGTTTTGGATTTGAGTTCCTGTAACCTT
>augustus_masked-Fvb3-1-processed-gene-6.13:1320:1440:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-6.13:1320-1440||RAPiDGENOMICS_rs1205_01158
AAAGCTGATTTTGATGGATTCCAAAATCTTCGAGTTTTGGATTTGAGTTCCTGTAACCTTACTGGTCAACTCCCTTTATGGCTATCAAAGCTCAGAAAGTTAGAGTACTTGACTCTGAAT
>augustus_masked-Fvb3-1-processed-gene-6.13:1440:1560:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_13::augustus_masked-Fvb3-1-processed-gene-6.13:1440-1560||RAPiDGENOMICS_rs1205_01159
CATAATAGAATCACAGGCTCAATCCCAAGTTGGATAGGGAGTCTTCCTAGGCTCTATTCTATAATCATGGACTTCAACCTACTTTCAGGTAAAATTCCAAAGGAACTGTGGATGCTCCTT
>augustus_masked-Fvb3-1-processed-gene-6.13:1500:1620:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_13::augustus_masked-Fvb3-1-processed-gene-6.13:1500-1620|2x||RAPiDGENOMICS_rs1205_01160
ATAATCATGGACTTCAACCTACTTTCAGGTAAAATTCCAAAGGAACTGTGGATGCTCCTTATGTTGGTATCTGAACAAGCTGCAGCTACTGTGGGTACTGCTCTTGATCTGCCTATCTTC
>augustus_masked-Fvb3-1-processed-gene-6.13:1560:1680:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-6.13:1560-1680||RAPiDGENOMICS_rs1205_01161
ATGTTGGTATCTGAACAAGCTGCAGCTACTGTGGGTACTGCTCTTGATCTGCCTATCTTCTACCCCAGTGTTGATTATTCAAAACCTATACAGTACAATTACTTGTATTACGAAGCAATG
>augustus_masked-Fvb3-1-processed-gene-6.13:1620:1740:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-6.13:1620-1740|2x||RAPiDGENOMICS_rs1205_01162
TACCCCAGTGTTGATTATTCAAAACCTATACAGTACAATTACTTGTATTACGAAGCAATGATATCCCTAAAAAGCAACAACCTATATGGGAACATACCTTCTGAGATTGGCCAATCGCAG
>augustus_masked-Fvb3-1-processed-gene-6.13:1680:1800:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-6.13:1680-1800||RAPiDGENOMICS_rs1205_01163
ATATCCCTAAAAAGCAACAACCTATATGGGAACATACCTTCTGAGATTGGCCAATCGCAGCTTCTGACATATTTGGATCTTAGCAACAACAACTTGTCCGGTAATATTCCAGAACAGACA
>augustus_masked-Fvb3-1-processed-gene-6.13:1740:1860:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-6.13:1740-1860|2x||RAPiDGENOMICS_rs1205_01164
CTTCTGACATATTTGGATCTTAGCAACAACAACTTGTCCGGTAATATTCCAGAACAGACAGCTAACATAAAGGGCATGCGGCAGTTGGATCTCTCCATGAACCAATTGTCTGGAAATATC
>augustus_masked-Fvb3-1-processed-gene-6.13:180:300:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-6.13:180-300|2x||RAPiDGENOMICS_rs1205_01165
TGGGAAGGCATTACTTGTAGTCGAGATGGTTGGGTCACCCATTTGCAGTTACCCTCCAAAGGGCTCAAACTCAAAGGAGATATTTTCCCCTCATCCTCACTTGCAAATCTCACACATCTC
>augustus_masked-Fvb3-1-processed-gene-6.13:1800:1920:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-6.13:1800-1920||RAPiDGENOMICS_rs1205_01166
GCTAACATAAAGGGCATGCGGCAGTTGGATCTCTCCATGAACCAATTGTCTGGAAATATCCCCATGTCTTTCACAAGTCTTCATTTCTTATCAAAACTCAACGTCTCCTTCAATAATCTT
>augustus_masked-Fvb3-1-processed-gene-6.13:1920:2040:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-6.13:1920-2040||RAPiDGENOMICS_rs1205_01167
GAAGGGCCAATACCATCAAGCACTCAGCTCCAAAGTTTTGATGCTTCTGAGTTTGAGGGGAATCTGAATCTTTGTGGTGACCCACTTCCAAATAAGTGTAAGAGAACTAAGGGCACTGAT
>augustus_masked-Fvb3-1-processed-gene-6.13:2040:2160:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_18::augustus_masked-Fvb3-1-processed-gene-6.13:2040-2160||RAPiDGENOMICS_rs1205_01168
GAACCTGATATGAACAGCACAGATGCAGACATGAAGGAGCATCAATTTCCATGGTTTTATATTTCTGCTGCACTTGGGTTCATTATAGGATTTTGGGGAGTCTTTGGTTCTTTAGTATTA
>augustus_masked-Fvb3-1-processed-gene-6.13:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-6.13:240-360||RAPiDGENOMICS_rs1205_01169
GGGCTCAAACTCAAAGGAGATATTTTCCCCTCATCCTCACTTGCAAATCTCACACATCTCACTCACTTGAATCTCTCACACAATTCCCTTTCTGGTTCTCTAGATCAAAGTGAAACCTTC
>augustus_masked-Fvb3-1-processed-gene-6.13:480:600:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-6.13:480-600||RAPiDGENOMICS_rs1205_01170
CATGGTGTGATTCCATCTTCTTTTTTCCAACAGGCTTGGAAGTTGACTGGTTTCAATGTCAGTAACAACACCTTCTCAGGTCCTATCCCATCCTCTATTTGTCTTCCTTCTTCCACGTTA
>augustus_masked-Fvb3-1-processed-gene-6.13:60:180:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-6.13:60-180|2x||RAPiDGENOMICS_rs1205_01171
ATGTCATTGTTTACTCGTAATATTCATTCATGCATCCAAACACAACGTACTTCTCTATTGTCCTTTGCCCTCGCTCTCTCTTCTCCTTCCTTAAACTGGACTTCTGGTAATTGTTGCTAT
>augustus_masked-Fvb3-1-processed-gene-6.13:600:720:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-6.13:600-720||RAPiDGENOMICS_rs1205_01172
CGACACCTTGATTTTTCCTTGAATAATTTCAATGGTAGTATTCCTCGTGGATTTGGGGAGTGTTCCAAGTTGCAGGTTCTTCGTGCCGGTCACAATTACCTATCAGGATCGCTTCCAGAA
>augustus_masked-Fvb3-1-processed-gene-6.13:720:840:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-6.13:720-840||RAPiDGENOMICS_rs1205_01173
GATATCTTTAATTCTACCTCACTTGAAGAGATCTCACTACCTCTAAATTCATTGAATGGAGCAATCAGTGATGGCATTGTCAACCTCATCAACCTCACATCACTTGATCTCTCCTATAAC
>augustus_masked-Fvb3-1-processed-gene-6.13:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-6.13-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-6.13:960-1080||RAPiDGENOMICS_rs1205_01174
CTTGTTGAACTTCGTATGGGAGCCAACAACTTGGGAGGTGATATCTCCATGCTCGATTTTTCAAAACTCAGCCAACTTAGTAAACTTGACTTGCGGATGAATAACTTCTTTGGTGTCTTA
>augustus_masked-Fvb3-1-processed-gene-7.7:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-7.7-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-7.7:120-240||RAPiDGENOMICS_rs1205_01175
TCTTCTCCTCAGTTGAATTGGACTTCCGCCGATTGTTGCAGTTGGGAGGGCATCACATGTGACCTGCAGGGTCGTAGTTGGATCACTCATTTGCAGTTACCTTCCAAAAGACTTAAACTC
>augustus_masked-Fvb3-1-processed-gene-7.7:1200:1320:Parent=augustus_masked-Fvb3-1-processed-gene-7.7-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-7.7:1200-1320||RAPiDGENOMICS_rs1205_01176
AATATCAGTGAAGCAATGAAGAGACTGACGGGTTGCAAACGCCTTGTTGTTCTATCCTTGGCATCTAGTTTTGTAGGTGAGGAACTTCCGACTGATCTTGGGAAAGCTGATTTTGATGGA
>augustus_masked-Fvb3-1-processed-gene-7.7:1320:1440:Parent=augustus_masked-Fvb3-1-processed-gene-7.7-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-7.7:1320-1440||RAPiDGENOMICS_rs1205_01177
TTCCAAAATCTTCGAATTTTGGATTTCAGTTCCTGTAACCTTACTGGCCAACTCCCTTTATGGCTATCAAAGCTCAGAAAGTTAGAGTACTTGGAGCTGAGTCATAATAGAATCACAGGC
>augustus_masked-Fvb3-1-processed-gene-7.7:1500:1620:Parent=augustus_masked-Fvb3-1-processed-gene-7.7-mRNA-1_13::augustus_masked-Fvb3-1-processed-gene-7.7:1500-1620|2x||RAPiDGENOMICS_rs1205_01178
CTACTTTCAGGTAAAATTCCAAAGGAACTGTTGATGCTTCCTATGTTAGTATCTGAACAAGCTGCAGCTCAAGTGGATCGTACTGCTAGTGATCTGCCTATCTTCCACTCCAGTGTTGAT
>augustus_masked-Fvb3-1-processed-gene-7.7:180:300:Parent=augustus_masked-Fvb3-1-processed-gene-7.7-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-7.7:180-300|2x||RAPiDGENOMICS_rs1205_01179
GACCTGCAGGGTCGTAGTTGGATCACTCATTTGCAGTTACCTTCCAAAAGACTTAAACTCAAACAAGGTATTTTCCCCTCATCCTCACTTGGAAATCTCACACACCTCACCCACTTGAAT
>augustus_masked-Fvb3-1-processed-gene-7.7:1800:1920:Parent=augustus_masked-Fvb3-1-processed-gene-7.7-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-7.7:1800-1920||RAPiDGENOMICS_rs1205_01180
ATGCAGTTTTTGGATCTCTCCATGAACCAATTGTCTGGAAACATCCCAGCATCTGTCACAAGTCTTCATTTCTTATCAAAATTCAACGTCTCCTACAATAATCTTGAAGGGCCAATACCA
>augustus_masked-Fvb3-1-processed-gene-7.7:1920:2040:Parent=augustus_masked-Fvb3-1-processed-gene-7.7-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-7.7:1920-2040||RAPiDGENOMICS_rs1205_01181
TCAAGCACTCAGCTCCAAAGTTTCGACGCTTCTGCGTTTGAGGGGAATCTGAAACTTTGTGGTGATCCGCTTCCAAATAAGTGTAAGAGAACAAAGGGCACTGATGAACCTGATATGAAC
>augustus_masked-Fvb3-1-processed-gene-7.7:2040:2160:Parent=augustus_masked-Fvb3-1-processed-gene-7.7-mRNA-1_18::augustus_masked-Fvb3-1-processed-gene-7.7:2040-2160||RAPiDGENOMICS_rs1205_01182
AACACAGATGCAGACATGAAGGAGCAGCAATTTCCATGGTTTTATGTTTCCGCTGCACTTGGGTTCATTATAGGATTTTGGGGAGTCTTTGGTCCTTTAGTATTTCTGAAGAAATGGAGG
>augustus_masked-Fvb3-1-processed-gene-7.7:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-7.7-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-7.7:240-360||RAPiDGENOMICS_rs1205_01183
AAACAAGGTATTTTCCCCTCATCCTCACTTGGAAATCTCACACACCTCACCCACTTGAATCTCTCCCACAATTCACTTTATGGCTCTCTAGATCAAACTCAACTCTTCTTGTCCTTGAAC
>augustus_masked-Fvb3-1-processed-gene-7.7:600:720:Parent=augustus_masked-Fvb3-1-processed-gene-7.7-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-7.7:600-720||RAPiDGENOMICS_rs1205_01184
TCCTTCAATGATTTCAATGGTAGTATTCCTCGTGGACTTGGGAAGTGTTCCAAACTGCAGGTTTTTCTTGCTGGTCACAATTACCTGTCAGGATCACTTCCAGAAGATATCTATAATGCT
>augustus_masked-Fvb3-1-processed-gene-7.7:720:840:Parent=augustus_masked-Fvb3-1-processed-gene-7.7-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-7.7:720-840||RAPiDGENOMICS_rs1205_01185
ACCACAGTTGAAGAGATCTCACTACCTCTAAATTCACTGAACGGAGCAATCAGTGATGGCATTGCCAAGCTCATCAACCTCACAACACTTGATCTCTCCTATAACCAATTGAGTGGTATG
>augustus_masked-Fvb3-1-processed-gene-7.7:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-7.7-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-7.7:960-1080||RAPiDGENOMICS_rs1205_01186
GGAGCCAACGACTTGGGAGGTAATATCTCCATGTTCGATTTCTCCAAACTCAGCCGACTTAGTAAACTTGACTTGCGGATGAATAACTTCTTTGGTGTCTTACCGAGAAGCCTCTACTCG
>augustus_masked-Fvb3-1-processed-gene-7.8:0:120:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-7.8:0-120||RAPiDGENOMICS_rs1205_01187
ATGGCTAATGCATTCCTTTTCTTCTTTCTCTTGATACTTTCTTCCAATATCATACTTGAAAACATTCATGCTTGCATTCAAAGTGAGCGCAGATCTCTGCTGTCATTTGCTCTCACTCTG
>augustus_masked-Fvb3-1-processed-gene-7.8:1080:1200:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-7.8:1080-1200||RAPiDGENOMICS_rs1205_01188
CTATCGTTGAAATCCTTGTCCTTCCTGTCGCTTGGTAATAATACATTGACCAATGTTACAGGAGCAATGAAGATATTGATGCGTTCCACAAGTCTGGTTTTCTTATCCTTGACAACTAGT
>augustus_masked-Fvb3-1-processed-gene-7.8:1140:1260:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_10::augustus_masked-Fvb3-1-processed-gene-7.8:1140-1260|2x||RAPiDGENOMICS_rs1205_01189
GGAGCAATGAAGATATTGATGCGTTCCACAAGTCTGGTTTTCTTATCCTTGACAACTAGTTTTGTAGGTGAGGAACTACCAGCTGATCTTGGCATTGTTCAAGACTTTGATGGATTCCAG
>augustus_masked-Fvb3-1-processed-gene-7.8:120:240:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-7.8:120-240||RAPiDGENOMICS_rs1205_01190
TCATCTCCTCAGTTGAATTGGACTTCCTCCGATTGTTGCGATTGGGAGGGGATCACATGTAAACAGGATGGTTGGATCACTCATTTGCAGTTACCTTCCAAAGGACTTAAACTCAAACAA
>augustus_masked-Fvb3-1-processed-gene-7.8:1260:1380:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_11::augustus_masked-Fvb3-1-processed-gene-7.8:1260-1380|2x||RAPiDGENOMICS_rs1205_01191
AATCTTCGACTTCTGGATTTGAGTTATTGTGAACTCACTGGTCAGATACCCTTATGGTTATCCAAGCTCAAAAAGCTGCAGATGTTGAACCTGTATTCTAATAGGCTATCAGGGTCAATA
>augustus_masked-Fvb3-1-processed-gene-7.8:1320:1440:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-7.8:1320-1440||RAPiDGENOMICS_rs1205_01192
TCCAAGCTCAAAAAGCTGCAGATGTTGAACCTGTATTCTAATAGGCTATCAGGGTCAATACCAACATGGTTAGGGACTCTTCCAATGCTCTTTAATATTGGCTTGGAAAGCAACCTACTT
>augustus_masked-Fvb3-1-processed-gene-7.8:1380:1500:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_12::augustus_masked-Fvb3-1-processed-gene-7.8:1380-1500|2x||RAPiDGENOMICS_rs1205_01193
CCAACATGGTTAGGGACTCTTCCAATGCTCTTTAATATTGGCTTGGAAAGCAACCTACTTTCAGGTGAGTTTCCAAAGGAACTATATGGACTACCAGCTTTGGTATCTACACAAACACCA
>augustus_masked-Fvb3-1-processed-gene-7.8:1440:1560:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_13::augustus_masked-Fvb3-1-processed-gene-7.8:1440-1560||RAPiDGENOMICS_rs1205_01194
TCAGGTGAGTTTCCAAAGGAACTATATGGACTACCAGCTTTGGTATCTACACAAACACCAGCTCAAGTGGATGATATTGATCTTGAATTGGCTATCTACGGATACAAAGGCGCAACATTA
>augustus_masked-Fvb3-1-processed-gene-7.8:1560:1680:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-7.8:1560-1680||RAPiDGENOMICS_rs1205_01195
GTACAATACAAATTGTCTTACTTTCCTCCAGCTATATACATAGGCAATAATACCATCAATGGGAACATACCTACTGAGATTGGTCAGTTGCAGCTTCTCCACATATTAAGTCTTAGCAAC
>augustus_masked-Fvb3-1-processed-gene-7.8:1620:1740:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_14::augustus_masked-Fvb3-1-processed-gene-7.8:1620-1740|2x||RAPiDGENOMICS_rs1205_01196
GGGAACATACCTACTGAGATTGGTCAGTTGCAGCTTCTCCACATATTAAGTCTTAGCAACAACACCTTCTCCGGAAACATTCCAGAGAACATGTCCAACCTAAAAAACTTGGAGATATTG
>augustus_masked-Fvb3-1-processed-gene-7.8:1680:1800:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-7.8:1680-1800||RAPiDGENOMICS_rs1205_01197
AACACCTTCTCCGGAAACATTCCAGAGAACATGTCCAACCTAAAAAACTTGGAGATATTGGATCTCTCCATGAATCATTTGTCTGGAAAAATCCCACCTTCATTGGCGAGTCTCAACTTC
>augustus_masked-Fvb3-1-processed-gene-7.8:1740:1860:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_15::augustus_masked-Fvb3-1-processed-gene-7.8:1740-1860|2x||RAPiDGENOMICS_rs1205_01198
GATCTCTCCATGAATCATTTGTCTGGAAAAATCCCACCTTCATTGGCGAGTCTCAACTTCTTGTCATCTTTCAATGTCTCGTACAATAATCTTGAGGGACAAATACCAGCAAGTACTCAG
>augustus_masked-Fvb3-1-processed-gene-7.8:180:300:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-7.8:180-300|2x||RAPiDGENOMICS_rs1205_01199
AAACAGGATGGTTGGATCACTCATTTGCAGTTACCTTCCAAAGGACTTAAACTCAAACAAGGTATTTTTCGATCATCCTCACTTGGAAACCTCACACATCTCACCCACTTGAATCTCTCT
>augustus_masked-Fvb3-1-processed-gene-7.8:1800:1920:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_16::augustus_masked-Fvb3-1-processed-gene-7.8:1800-1920||RAPiDGENOMICS_rs1205_01200
TTGTCATCTTTCAATGTCTCGTACAATAATCTTGAGGGACAAATACCAGCAAGTACTCAGCTCCAAAGCTTCAATGCCTCTGCTTTTGAGGGGAACCCCAAAATTTGTGGTGCACCACTT
>augustus_masked-Fvb3-1-processed-gene-7.8:1920:2040:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_17::augustus_masked-Fvb3-1-processed-gene-7.8:1920-2040||RAPiDGENOMICS_rs1205_01201
TCAAATGAATGCCTACCAAATCCAAAGAAGGGAAATGAGGAAGACAACAACAACCATGGTTTTCTGGACATTATGGGGCAACAAATTCCATGGCTTTCAGTTGTCCTTGGGTTCACTGTA
>augustus_masked-Fvb3-1-processed-gene-7.8:2092:2212:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-7.8:2092-2212||RAPiDGENOMICS_rs1205_01202
AGAGCTACCATCTTCTTTACCATCCCAAAAACATCCGGAAGCTTGATTTGTCCAGCAATCACTTGCATGGTGCAATTCCAAATTCATTCTTTCAAAAAGCTTTGAATTTGACTAGTTTCA
>augustus_masked-Fvb3-1-processed-gene-7.8:2152:2272:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-7.8:2152-2272|2x||RAPiDGENOMICS_rs1205_01203
ACTTGCATGGTGCAATTCCAAATTCATTCTTTCAAAAAGCTTTGAATTTGACTAGTTTCAATGTTAGCAACAACACATTCTCAGGTTCTATCCCATCATCAATTTGTCTTCATTCTTCTC
>augustus_masked-Fvb3-1-processed-gene-7.8:2212:2332:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_2::augustus_masked-Fvb3-1-processed-gene-7.8:2212-2332||RAPiDGENOMICS_rs1205_01204
ATGTTAGCAACAACACATTCTCAGGTTCTATCCCATCATCAATTTGTCTTCATTCTTCTCCCTTGATTAGGCTATTGGATTTTTCATTCAACGAATTTAGTGGCAATATTTCTCAAGGAC
>augustus_masked-Fvb3-1-processed-gene-7.8:2332:2452:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-7.8:2332-2452||RAPiDGENOMICS_rs1205_01205
TAGGGGAGTGTTCCAAACTGCCAGCTTTTCATGCTGGTCACAATAACTTGTCAGGTTTACTTCCAAATGATATCTACAATGCTACCACACTTGAAGAAATTGCTTTACCTCACAATTCAC
>augustus_masked-Fvb3-1-processed-gene-7.8:240:360:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-7.8:240-360||RAPiDGENOMICS_rs1205_01206
GGTATTTTTCGATCATCCTCACTTGGAAACCTCACACATCTCACCCACTTGAATCTCTCTCACAATTCGATTTCTGGTTCACTAGACCAAAGTACTGGATTCTTCTTGTCTTTGAATCAT
>augustus_masked-Fvb3-1-processed-gene-7.8:2452:2572:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-7.8:2452-2572||RAPiDGENOMICS_rs1205_01207
TATATGGAGCCATTAGTGAAAGAATTGCCAACCTCACAAACCTCTCAATCCTTGACCTCAACACTAATGGATTGACTGGCGTGCTCCCTAAAAGCATTGGCAAGCTCTCCAAATTGAAAC
>augustus_masked-Fvb3-1-processed-gene-7.8:2572:2692:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-7.8:2572-2692||RAPiDGENOMICS_rs1205_01208
TCTTACTCCTTCAATTCAATAATCTTGAAGGTTCTGTGCCCCCATCTTTGATGAATTGCACAAGCCTTGCAGAATTGAATATGGGATTCAAGAATTTGGAAGGTAGTATCTCTGAGCTTA
>augustus_masked-Fvb3-1-processed-gene-7.8:2692:2812:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-7.8:2692-2812||RAPiDGENOMICS_rs1205_01209
ATTTTGCCAGACTTATCAGCCTCAGTAAACTTGATCTTGGGAAGAATCGCCTCACCGGTATGTTTCCAGTGAGCCTTCACTTTTGCAAGTACCTGAAAGCAATTCGGCTGAGTGTCAATG
>augustus_masked-Fvb3-1-processed-gene-7.8:2812:2932:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-7.8:2812-2932||RAPiDGENOMICS_rs1205_01210
ATCTAGAAGAAATACAACCTGATATTCAGTCATTGAAGTTCTTGTCCTTCCTCTCGCTTGGTTATAACAGAATGATCAATATCGCCAAGGCAATGAAGATACTGATGCATTGCAAAAATC
>augustus_masked-Fvb3-1-processed-gene-7.8:2932:3052:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-7.8:2932-3052||RAPiDGENOMICS_rs1205_01211
TTGTAGTCCTATCCCTTTCATCTAATTTTGTAGGTGAGGAATTTCCGGATGATCTTGGCGTGGCTGATTTTGATGGTTTCCAAAATCTTCGAATGTTAGCTTTGGGTAAATGTGAGCTGA
>augustus_masked-Fvb3-1-processed-gene-7.8:300:420:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_3::augustus_masked-Fvb3-1-processed-gene-7.8:300-420|2x||RAPiDGENOMICS_rs1205_01212
CACAATTCGATTTCTGGTTCACTAGACCAAAGTACTGGATTCTTCTTGTCTTTGAATCATTTGGAGATCCTTGATTTGAGCTATAACCTTCTTTCCGGAGAGCTACCATCTTCGTTCTTC
>augustus_masked-Fvb3-1-processed-gene-7.8:360:480:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-7.8:360-480||RAPiDGENOMICS_rs1205_01213
TTGGAGATCCTTGATTTGAGCTATAACCTTCTTTCCGGAGAGCTACCATCTTCGTTCTTCGAACATGCTTGGAATTTGACTAGTTTCAATGTGAGGAACAACAACTTTTCAGGTTGTATT
>augustus_masked-Fvb3-1-processed-gene-7.8:420:540:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_4::augustus_masked-Fvb3-1-processed-gene-7.8:420-540|2x||RAPiDGENOMICS_rs1205_01214
GAACATGCTTGGAATTTGACTAGTTTCAATGTGAGGAACAACAACTTTTCAGGTTGTATTCCATCCTCTACTTGTGTTCATGATTACTCACCATCAATAAGGCTGTTGGATTTTTCCTAC
>augustus_masked-Fvb3-1-processed-gene-7.8:480:600:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_5::augustus_masked-Fvb3-1-processed-gene-7.8:480-600||RAPiDGENOMICS_rs1205_01215
CCATCCTCTACTTGTGTTCATGATTACTCACCATCAATAAGGCTGTTGGATTTTTCCTACAATACATTCAGTGGCAATATACCTCATGGACTAGCAGAGTGCTCCAAACTTCAGGTTTTT
>augustus_masked-Fvb3-1-processed-gene-7.8:60:180:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_1::augustus_masked-Fvb3-1-processed-gene-7.8:60-180|2x||RAPiDGENOMICS_rs1205_01216
AACATTCATGCTTGCATTCAAAGTGAGCGCAGATCTCTGCTGTCATTTGCTCTCACTCTGTCATCTCCTCAGTTGAATTGGACTTCCTCCGATTGTTGCGATTGGGAGGGGATCACATGT
>augustus_masked-Fvb3-1-processed-gene-7.8:600:720:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_6::augustus_masked-Fvb3-1-processed-gene-7.8:600-720||RAPiDGENOMICS_rs1205_01217
CGTGCTGGTTACAATAACCTCTCAGGATTACTTCCAGTAGAGATGTATAATGCTACCACACTAGAAGAAATTTCATTACCTGCTAATTCTCTTTCTGGAGTCCTCAGTGAAGGAATGCTT
>augustus_masked-Fvb3-1-processed-gene-7.8:720:840:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_7::augustus_masked-Fvb3-1-processed-gene-7.8:720-840||RAPiDGENOMICS_rs1205_01218
CAACTTGTGAACCTCACAATCCTTGATCTCTCCTATAACCAATTGAGTGGTATGCTCCCTCACCATATTGGCATCTTCTCTAAGTTGAAACTCCTGGTTCTTGACTTCAACAGTCTAGAA
>augustus_masked-Fvb3-1-processed-gene-7.8:840:960:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_8::augustus_masked-Fvb3-1-processed-gene-7.8:840-960||RAPiDGENOMICS_rs1205_01219
GGTACTTTGCCCCCATCTCTTACGAATTGCATGAACCTTGTAGAACTACGCCTTGCAAACAACTTCTTCGGAGGAGAAATCAGCAGGATTAACTTCTCTAATTTTATTCAGCTCAGTAAA
>augustus_masked-Fvb3-1-processed-gene-7.8:960:1080:Parent=augustus_masked-Fvb3-1-processed-gene-7.8-mRNA-1_9::augustus_masked-Fvb3-1-processed-gene-7.8:960-1080||RAPiDGENOMICS_rs1205_01220
CTTGACCTACGGAAAAATAACTTCACTGGTCCCTTCCCAATAAGCCTGTATTCATGCAAGTCCTTGAAAGCAATTCGACTGAGCTATAATTATCTAGAGGGAGAAATACAGCCTGAGATT
>augustus_masked-Fvb3-2-processed-gene-144.4:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-144.4-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-144.4:0-120||RAPiDGENOMICS_rs1205_01221
ATGGCCACTGCAGCACAAACCAACATCAGCACAGACCATTCTGCCCTTCTTGCTCTCAGATCTCGTATCACCAACGACCCTCAAAGCATGCTCTTGACCAACTGCTCAGCCCCTAGCTCC
>augustus_masked-Fvb3-2-processed-gene-144.4:120:240:Parent=augustus_masked-Fvb3-2-processed-gene-144.4-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-144.4:120-240||RAPiDGENOMICS_rs1205_01222
ATTTGTAACTGGGTTGGCGTTACTTGTGGTGCACGGCATCTTCGAGTTACTGTCTTGAATTTCTCTTACATGGGTGTCTCAGGCACTATTCCTCCAGAGCTAGCAAACCTATCATTTCTT
>augustus_masked-Fvb3-2-processed-gene-144.4:240:360:Parent=augustus_masked-Fvb3-2-processed-gene-144.4-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-144.4:240-360||RAPiDGENOMICS_rs1205_01223
GTTGAGCTGCGCTTCAATAATAACAGTTTCCATGGTACCATTCCCCAAGAATTGTCTCGTTTGCGCCGCCTGAAGTATCTTAGCTTTGGATTCAACAACTTCAAAGGAACCATTCCCTCA
>augustus_masked-Fvb3-2-processed-gene-144.4:300:420:Parent=augustus_masked-Fvb3-2-processed-gene-144.4-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-144.4:300-420|2x||RAPiDGENOMICS_rs1205_01224
TTGCGCCGCCTGAAGTATCTTAGCTTTGGATTCAACAACTTCAAAGGAACCATTCCCTCATGGATAGGGTCCTTATCGCAACTTAAAGTCTTCAGCTTGTACGGTAATCAGTTTTCAGGT
>augustus_masked-Fvb3-2-processed-gene-144.4:360:480:Parent=augustus_masked-Fvb3-2-processed-gene-144.4-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-144.4:360-480||RAPiDGENOMICS_rs1205_01225
TGGATAGGGTCCTTATCGCAACTTAAAGTCTTCAGCTTGTACGGTAATCAGTTTTCAGGTATAATGCCGATAGACATCTTCAACTCATCTGCAGTGGAACTAATTGATCTTAGGTTCAAC
>augustus_masked-Fvb3-2-processed-gene-144.4:490:610:Parent=augustus_masked-Fvb3-2-processed-gene-144.4-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-144.4:490-610||RAPiDGENOMICS_rs1205_01226
AACCACACCTGGGAAAGTCCAAGGACAATTGCGTCGATGCTCCCGTCCGACAGCAACCGGAAAGCCAAGTTGGAGGCCCACTCCCATCGCTGCCGGACGAGACCCCAATAGATGAGTTGA
>augustus_masked-Fvb3-2-processed-gene-144.4:60:180:Parent=augustus_masked-Fvb3-2-processed-gene-144.4-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-144.4:60-180|2x||RAPiDGENOMICS_rs1205_01227
TCTCGTATCACCAACGACCCTCAAAGCATGCTCTTGACCAACTGCTCAGCCCCTAGCTCCATTTGTAACTGGGTTGGCGTTACTTGTGGTGCACGGCATCTTCGAGTTACTGTCTTGAAT
>augustus_masked-Fvb3-2-processed-gene-169.3:867:987:Parent=augustus_masked-Fvb3-2-processed-gene-169.3-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-169.3:867-987||RAPiDGENOMICS_rs1205_01228
TCAAAACATCAAGGGTTCGGTGAAACTAAGGATAGTAACCTTGATAATGCTAGAGAATTGGATATGAAGAGGAAACGAAATAGGGAGAAAGCAAATGAGAATGGCTCGGAGCAGGAAGCT
>augustus_masked-Fvb3-2-processed-gene-246.10:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-246.10-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-246.10:0-120||RAPiDGENOMICS_rs1205_01229
ATGGGCAACTATATCCTCTTTCTGTTGTTGCGTCAGTATTTGCTGATTACTAGTGAAATTTGTTTGGGTGCGAAATGCATTGACGAAGAGAGACGAGTGCTTCTCACGTTCAAACACCAC
>augustus_masked-Fvb3-2-processed-gene-246.10:120:240:Parent=augustus_masked-Fvb3-2-processed-gene-246.10-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-246.10:120-240||RAPiDGENOMICS_rs1205_01230
CTTACTGATCCTTCCGGCAGGCTTTCATCTTGGTCAAACGGCGACAATTGCTGTCAATGGAATGGTCTTTCATGCGACAACCAGACTGGCCACATTGTAAAGATGGGTCTCCGAAATCCA
>augustus_masked-Fvb3-2-processed-gene-246.10:180:300:Parent=augustus_masked-Fvb3-2-processed-gene-246.10-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-246.10:180-300|2x||RAPiDGENOMICS_rs1205_01231
AATGGTCTTTCATGCGACAACCAGACTGGCCACATTGTAAAGATGGGTCTCCGAAATCCATATCCATACGGCCATTATGATGACGAGTGGTATTTCATGGACTACCAACAGTCTTGCTTG
>augustus_masked-Fvb3-2-processed-gene-246.10:472:592:Parent=augustus_masked-Fvb3-2-processed-gene-246.10-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-246.10:472-592||RAPiDGENOMICS_rs1205_01232
GAGTGAGTTGGTTACATTATGTCAACATGCTTCCCTCACTGTTAGAGTTGCATTTATCTGCATGTGGCATGGATTCAAACCAGCTTCCACTCTCATTACCAACCCTTAACTTCACATCCC
>augustus_masked-Fvb3-2-processed-gene-246.10:592:712:Parent=augustus_masked-Fvb3-2-processed-gene-246.10-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-246.10:592-712||RAPiDGENOMICS_rs1205_01233
TTTCAGTCCTTGATATGTCTGAAAATTCTTTCAATTCTTCGATTCCAAGCTGGTTTTCTAATCTGACAAGTCTAAGCACACTTGATCTACACGGCAATTCTTTTGTTGGTCCCATTCCCA
>augustus_masked-Fvb3-2-processed-gene-246.10:60:180:Parent=augustus_masked-Fvb3-2-processed-gene-246.10-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-246.10:60-180|2x||RAPiDGENOMICS_rs1205_01234
TGTTTGGGTGCGAAATGCATTGACGAAGAGAGACGAGTGCTTCTCACGTTCAAACACCACCTTACTGATCCTTCCGGCAGGCTTTCATCTTGGTCAAACGGCGACAATTGCTGTCAATGG
>augustus_masked-Fvb3-2-processed-gene-246.10:652:772:Parent=augustus_masked-Fvb3-2-processed-gene-246.10-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-246.10:652-772|2x||RAPiDGENOMICS_rs1205_01235
ATCTGACAAGTCTAAGCACACTTGATCTACACGGCAATTCTTTTGTTGGTCCCATTCCCAATGAATTTGCAAGCTTCAAAAATCTCGAGCACCTTGATTTATCAGCTAATTCCCTTGAAG
>augustus_masked-Fvb3-2-processed-gene-246.10:712:832:Parent=augustus_masked-Fvb3-2-processed-gene-246.10-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-246.10:712-832||RAPiDGENOMICS_rs1205_01236
ATGAATTTGCAAGCTTCAAAAATCTCGAGCACCTTGATTTATCAGCTAATTCCCTTGAAGGTCAGATTCCCCAATTCATTGGGAACTTTTGTACCCTAAAGGAGGTAGGTGTCGCCGACT
>augustus_masked-Fvb3-2-processed-gene-253.5:1242:1362:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-253.5:1242-1362||RAPiDGENOMICS_rs1205_01237
CTCAGGATTAAATCTGCTCCCCAATTCCTTCCTAGTTCATTAAGAACTTTGAAATGGAGTTGGTATCCTTCCAAATTTCTTCCAACTAGTTACCGACCAAACTTACTTGTTGAGCTTAAG
>augustus_masked-Fvb3-2-processed-gene-253.5:1510:1630:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-253.5:1510-1630||RAPiDGENOMICS_rs1205_01238
ATGGGACTGTGTTTGAGAAAAGAACTTCATCATTGAAAATCGGCTTTTGGAATTTATTCGCAAAAAAGAGTTTGGAGCCTCTGGGATCGCTTTGTCCTTCACTAAGGGAGTTGCAGTTTT
>augustus_masked-Fvb3-2-processed-gene-253.5:1630:1750:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-253.5:1630-1750||RAPiDGENOMICS_rs1205_01239
TGACAACGTTGAGTCTCAATGAGTGTAAACTTTGTGAAGGTGCACTACCTGATGATATTGGCTATTGCATGCCATTCCTTGAAGTCTTGTATCTCACTGGAAATAATTTTGTTACTCTCC
>augustus_masked-Fvb3-2-processed-gene-253.5:1750:1870:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-253.5:1750-1870||RAPiDGENOMICS_rs1205_01240
CTGCAAGCATAAAATGCCTGTCTGAGTTTCACTTGATTGATTTGAATAGGTGCAAAAGGCTTCAACAATTGCCGGATCTTCCACCAAGTGCAAGATTAGAAGTCCGGGTTGATGATTGTG
>augustus_masked-Fvb3-2-processed-gene-253.5:1870:1990:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-253.5:1870-1990||RAPiDGENOMICS_rs1205_01241
CTTCCTTGAAGATGTTGTCAAAACAAACAAAACTGTGCGGACTCACCGGTTGGGACTACTGTTTTTATTTAACATCAGTCAATAGCTTTGGATTGGTTGATGATGAAGGATGGAATAATG
>augustus_masked-Fvb3-2-processed-gene-253.5:191:311:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-253.5:191-311|2x||RAPiDGENOMICS_rs1205_01242
GATTACATTGTCAAATTCGAAAGACAAGTTAGTTGGGATTGATTATGGACTTATTGAAATGAGTGGATTTTTAGCTCTTGAGGTGAATGATGTTCGATTTATAGGGATATGGGGCATGGG
>augustus_masked-Fvb3-2-processed-gene-253.5:1990:2110:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-253.5:1990-2110||RAPiDGENOMICS_rs1205_01243
GAATATTTTCGGTGCTGAAGCAATTTGCTGCTCAGTTACCCTCACTACCGAGAATGTCTCCAAACTTTGACATATTCTCGATCATAAGTCCTGGAAGCAAAATCTCAGCCTGGTTAAATA
>augustus_masked-Fvb3-2-processed-gene-253.5:2110:2230:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-253.5:2110-2230||RAPiDGENOMICS_rs1205_01244
TTCAAAGTGAGGGAGATACATTGACTGTGGAGCTACCTTCGCATCAAGAATCATGCAGACCAAAGTGGATGGGAATTGTGTTGTGTGTTGTTTTTGCAAATCATAAACCTGCAGTCGATC
>augustus_masked-Fvb3-2-processed-gene-253.5:2230:2350:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-253.5:2230-2350||RAPiDGENOMICS_rs1205_01245
TGGAGGTAGATGAATTTGTAATTCGATGTTTTTCTCAAGTGACTTCTCGTCCCTTCCGGGCCAAAATGGCAAGCCATGTTATGGGAGATCACATTTGGATATTTTATCTGCCTGTTGAAC
>augustus_masked-Fvb3-2-processed-gene-253.5:2350:2470:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-253.5:2350-2470||RAPiDGENOMICS_rs1205_01246
AAATTCTGGATACCGGAGCAAATCTCATCAGCTTCTTGTTTAAAGCATATCATTCAACGTGGAGTATGGGGCGCATACCGAAAATTCCATGCCCAAATAGTGTCAAGAGGTGTGCAGCCC
>augustus_masked-Fvb3-2-processed-gene-253.5:2470:2590:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-253.5:2470-2590||RAPiDGENOMICS_rs1205_01247
GTTTGGTCTGCGAGGAAGACTTGAAAGAGCTCGACAATGACACAAGGAGCACCTTTAAGCGCAGTCGTGAATATAGTGACACTGAGGAGGCGGAAGAACTTCCAGGTGGAAGTGGAAGTG
>augustus_masked-Fvb3-2-processed-gene-253.5:251:371:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-253.5:251-371||RAPiDGENOMICS_rs1205_01248
GAGTGGATTTTTAGCTCTTGAGGTGAATGATGTTCGATTTATAGGGATATGGGGCATGGGTGGAGTGGGTAAGACAACTCTTGCTAAGCTAGTGTTTCAAAGGCTTTCTCATCATTTTGA
>augustus_masked-Fvb3-2-processed-gene-253.5:551:671:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-253.5:551-671|2x||RAPiDGENOMICS_rs1205_01249
TGTTGATCACTATAACCAACTAGAAATATTGGTCGGAAATAAATCTTGGTTTGGTGATGGAAGCAGAATTATTGTCACAACTAGAGATGAACGTCTGCTTATCGAGCATGATATAGAGTT
>augustus_masked-Fvb3-2-processed-gene-253.5:611:731:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-253.5:611-731||RAPiDGENOMICS_rs1205_01250
AAGCAGAATTATTGTCACAACTAGAGATGAACGTCTGCTTATCGAGCATGATATAGAGTTATCATTTAAGGTTGAAGGATTAAATGACCACAGATCTCTTGAGCTCTTCAGTCAGAATGC
>augustus_masked-Fvb3-2-processed-gene-253.5:776:896:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-253.5:776-896||RAPiDGENOMICS_rs1205_01251
GACAATTCCTATTCCAACTATGTATGATTCGCTCAAACTAAGTTATGATATGCTAGATGACATGCAGAAGAGCATTTTTCTGGATGTTGCGCATTTCTACAAGGGGATAGAAAAGGGGCA
>augustus_masked-Fvb3-2-processed-gene-253.5:896:1016:Parent=augustus_masked-Fvb3-2-processed-gene-253.5-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-253.5:896-1016||RAPiDGENOMICS_rs1205_01252
AGTAATTGATATATTGGAAAGCTGTGGTCTTTGTGGTTGTATTGGGATAGATGTTTTGATTGAGAAATCTCTAATAATCATTGAGAGATTCGACATTGTTGGTATGCATGATGTAGTACA
>augustus_masked-Fvb3-2-processed-gene-277.12:1020:1140:Parent=augustus_masked-Fvb3-2-processed-gene-277.12-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-277.12:1020-1140|2x||RAPiDGENOMICS_rs1205_01253
CTATTGTTGAAATCATTATCGTTCTTGTCGCTTGGTCATAATAGATTGACCAATCTCACTGGGGCAATGAAGATATTGATGTATTGCAAAAGCCTAGTATTCCTAGCCTTTCCAGGAAGC
>augustus_masked-Fvb3-2-processed-gene-277.12:1200:1320:Parent=augustus_masked-Fvb3-2-processed-gene-277.12-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-277.12:1200-1320||RAPiDGENOMICS_rs1205_01254
CTTCGATTTTTATCTCTAGCTGAGTGTGAGCTCACTGGTCATATACCTGCATATTTATCTAAGTTCAAAAAGCTAGAGCTCTTGTATCTTGGAAACAATAGAATCACAGGGTCAATTCCT
>augustus_masked-Fvb3-2-processed-gene-277.12:1260:1380:Parent=augustus_masked-Fvb3-2-processed-gene-277.12-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-277.12:1260-1380|2x||RAPiDGENOMICS_rs1205_01255
AAGTTCAAAAAGCTAGAGCTCTTGTATCTTGGAAACAATAGAATCACAGGGTCAATTCCTAGTTGGTTAGGGAATCTTCCAAGGCTCTATTCTATCGACTTGTCATCCAACCTCCTCTCG
>augustus_masked-Fvb3-2-processed-gene-277.12:1440:1560:Parent=augustus_masked-Fvb3-2-processed-gene-277.12-mRNA-1_13::augustus_masked-Fvb3-2-processed-gene-277.12:1440-1560||RAPiDGENOMICS_rs1205_01256
CAAGTAGAGGATGATGATCTTGAATTACCTATCTACTCACTCAAAGGTGCATTGGTTTTACAATACAAATTGTCTTACTTTCCTATAGCGATAAGCATGGGCAGTAACACCATTAGTGGG
>augustus_masked-Fvb3-2-processed-gene-277.12:1560:1680:Parent=augustus_masked-Fvb3-2-processed-gene-277.12-mRNA-1_14::augustus_masked-Fvb3-2-processed-gene-277.12:1560-1680||RAPiDGENOMICS_rs1205_01257
AGCATACCTGTTGAGATTGGTCAATTGAAGCTTCTCCATTACCTGTGGCTTAGCAACAGTAACTTGTCAGGCAACATTCCAGATCAAATATCGAACTTGAAGAGCTTGGAGCAGTTGGAT
>augustus_masked-Fvb3-2-processed-gene-277.12:1920:2040:Parent=augustus_masked-Fvb3-2-processed-gene-277.12-mRNA-1_17::augustus_masked-Fvb3-2-processed-gene-277.12:1920-2040||RAPiDGENOMICS_rs1205_01258
GGGAATGATGACGACAGTGAAGTTCCATGGCTTCATATTTTCGTTGCTCTTGGTTTCATAGTTGGATTTTGGGGAGTTTGTGGCCCTCTGGTGCTCAAGAAGAAGTGGAGGTATGCATAC
>augustus_masked-Fvb3-2-processed-gene-277.12:600:720:Parent=augustus_masked-Fvb3-2-processed-gene-277.12-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-277.12:600-720||RAPiDGENOMICS_rs1205_01259
CTCGAAGAAATTTCATTACCTCAAAATTCACTATCTGGAGACATAAGTGAAAGAATTGTCAACCTCGACAGTCTCAGAATCCTGGACCTCAACTCTAATGGATTCAGTGGCATGCTCCCT
>augustus_masked-Fvb3-2-processed-gene-277.7:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-277.7-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-277.7:0-120||RAPiDGENOMICS_rs1205_01260
ATGTCTTATTGCACTCTCCTGTTCTGCTGTTTCATCTCGAGCACCATTTCTACAAACCATCTGTGCAACAATTTGGATCATGACTATCTTCGGTCCTCTTTCGATCTGCCTTCTCTAAAT
>augustus_masked-Fvb3-2-processed-gene-277.7:240:360:Parent=augustus_masked-Fvb3-2-processed-gene-277.7-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-277.7:240-360||RAPiDGENOMICS_rs1205_01261
CTCACACAACTCTCCCACCTCAATCTCTCCCACAATCAACTCTCTGGTCCTTTAGGAACCGGTCTCTTTTCATCCTTGAGTCATCTCCAGATTCTTGATTTGAGCTATAACCATCTTTCG
>augustus_masked-Fvb3-2-processed-gene-277.7:360:480:Parent=augustus_masked-Fvb3-2-processed-gene-277.7-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-277.7:360-480||RAPiDGENOMICS_rs1205_01262
GGAGTGTTGCCGTTGTCAATACCATTTGTTTCTATTCGAGTGGTTGACTTGTCTAGCAATCTATTCAATGGAACAACTCCATCTTCCTTCCTACCGCATGCCCCGAATTTGAGTAGTCTG
>augustus_masked-Fvb3-2-processed-gene-277.7:580:700:Parent=augustus_masked-Fvb3-2-processed-gene-277.7-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-277.7:580-700||RAPiDGENOMICS_rs1205_01263
TAAACCTCACAATCTTGGAGATCTACTTCAACCAGCTGAGTGGAACACTTCCCTCCCATATTGGGAAACTCTCCAAATTGAAACTCATGCTCCTTCATTTCAACAACCTTCAAGGTTTTC
>augustus_masked-Fvb3-2-processed-gene-277.7:60:180:Parent=augustus_masked-Fvb3-2-processed-gene-277.7-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-277.7:60-180|2x||RAPiDGENOMICS_rs1205_01264
CTGTGCAACAATTTGGATCATGACTATCTTCGGTCCTCTTTCGATCTGCCTTCTCTAAATTGGTCTTCTAGTGATTGTTGCCACTGGGAGGGGATCAGTTGTGATGAGAATGGTAGAGTC
>augustus_masked-Fvb3-2-processed-gene-277.7:700:820:Parent=augustus_masked-Fvb3-2-processed-gene-277.7-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-277.7:700-820||RAPiDGENOMICS_rs1205_01265
TACCCCCATCTTTGATGAGTTGTACAAATCTTGTGGAACTGAATCTTGGATTTAATCACTTGGAAGGAAACATCTCCCTTCTTGATTTCTCCAAACTTGGTCAACTTGCTAAACTTGATT
>augustus_masked-Fvb3-2-processed-gene-277.7:820:940:Parent=augustus_masked-Fvb3-2-processed-gene-277.7-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-277.7:820-940||RAPiDGENOMICS_rs1205_01266
TTGTGAGCAATCACTTCACTGGTGTCATACCAAGAAGCCTTTACTCATGCAAGTCACTGGGAGCGCTTCGTCTGAGCTTAAACGATCTAGAGGGACAAATACAACCTGAGATTCTTTCAC
>augustus_masked-Fvb3-2-processed-gene-277.7:940:1060:Parent=augustus_masked-Fvb3-2-processed-gene-277.7-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-277.7:940-1060||RAPiDGENOMICS_rs1205_01267
TTGAGTCCTTGTCCTTCCTCTCTCTTTCACGGAACAGACTGACCAATGTCACAGGGGCATTGAAGATACTGATGAGTTTCAAAAATATCGGAGTAGTCATTCTTTCAGGGAATTTCGTAG
>augustus_masked-Fvb3-2-processed-gene-298.15:120:240:Parent=augustus_masked-Fvb3-2-processed-gene-298.15-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-298.15:120-240||RAPiDGENOMICS_rs1205_01268
TACTTAGGCATCTTCAAATCATGGACCGGCACCGACTGCTGCCACAAATGGTACGGTGTCAGCTGCGACCAGGGAACCCGCCGTGTAGCCGACATAAACCTCCGTGGAGAATCCGAGGAC
>augustus_masked-Fvb3-2-processed-gene-298.15:180:300:Parent=augustus_masked-Fvb3-2-processed-gene-298.15-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-298.15:180-300|2x||RAPiDGENOMICS_rs1205_01269
AGCTGCGACCAGGGAACCCGCCGTGTAGCCGACATAAACCTCCGTGGAGAATCCGAGGACCCTATTTTCGAACGTGCCAAAAGAACTGGCTACATGACCGGTACCATCTCACCGGCCATC
>augustus_masked-Fvb3-2-processed-gene-298.15:540:660:Parent=augustus_masked-Fvb3-2-processed-gene-298.15-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-298.15:540-660|2x||RAPiDGENOMICS_rs1205_01270
CACCTCGACCTCCGCAACAACAAGATTTCCGGTACGTTGCCGCAAGATTTCAACCGACTTACAATGCTCAGCCGCGCTTTGCTCAGCAAAAACATGCTCACCGGTCCGATTCCAGCCTCC
>augustus_masked-Fvb3-2-processed-gene-298.15:60:180:Parent=augustus_masked-Fvb3-2-processed-gene-298.15-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-298.15:60-180|2x||RAPiDGENOMICS_rs1205_01271
GCATGTCCGTCATCAGACAGGGCGGCCCTGCTCGCTTTCAAAGCGAGCCTCCACGAGCCCTACTTAGGCATCTTCAAATCATGGACCGGCACCGACTGCTGCCACAAATGGTACGGTGTC
>augustus_masked-Fvb3-2-processed-gene-298.15:600:720:Parent=augustus_masked-Fvb3-2-processed-gene-298.15-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-298.15:600-720||RAPiDGENOMICS_rs1205_01272
ACAATGCTCAGCCGCGCTTTGCTCAGCAAAAACATGCTCACCGGTCCGATTCCAGCCTCCATCTCTCAAATCTACCGTCTCGCCGATCTTGACCTCTCTCTCAACCAGCTCTCCGGTCCG
>augustus_masked-Fvb3-2-processed-gene-298.15:720:840:Parent=augustus_masked-Fvb3-2-processed-gene-298.15-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-298.15:720-840||RAPiDGENOMICS_rs1205_01273
ATTCCGGCTTCCCTAGGCAAAATGGCCGTCCTCGCAACCCTAAACCTCGACTGTAACAACATCACAGGAACTATTCCACCGAGTTTGATAGTTTCAGGTATCAGCAACTTGAACTTGAGC
>augustus_masked-Fvb3-2-processed-gene-300.11:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-300.11:0-120||RAPiDGENOMICS_rs1205_01274
ATGGCGGAGGCGAGGATCGGTTGCATTGCCACTATTACCTGGCTATGGGATCAAGTGAAGCGTCGGTTCAGTTACATGGTCGAAAATTCGCAGGATAATCAAGTATTGGTTGACATGGAT
>augustus_masked-Fvb3-2-processed-gene-300.11:1091:1211:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-300.11:1091-1211||RAPiDGENOMICS_rs1205_01275
CAAAGTCCTACTGACCACAAGGATATGGAATGTTTGTCATGCCATGGAGTGTCAAACAAAGATCACACTCAACATTCTCTCAGAACAAGATTCTTGGGCCTTGTTTGTGAGTAAAGCAAG
>augustus_masked-Fvb3-2-processed-gene-300.11:1571:1691:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-300.11:1571-1691||RAPiDGENOMICS_rs1205_01276
GCAAGCTGATTCCGTTGTCAAGCATCTTAAATATTCTTGCTTGCTTTTGGATAGTGAAGAAGATGGATGTGTGAGGATGCATGATGTTGTCCGGGATGCAGCCATTCAAATTGTGCAATC
>augustus_masked-Fvb3-2-processed-gene-300.11:1751:1871:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_10::augustus_masked-Fvb3-2-processed-gene-300.11:1751-1871|2x||RAPiDGENOMICS_rs1205_01277
TAAAGGCTGCCTTGCAATCTCACTAATGAGGAATTATATTTGCGAGCTTCCCAAAAATCTGGTATGTCCAAAACTCCAGATTTTGTTACTAAACCGTAATTTCTTTTTAGAACATATACC
>augustus_masked-Fvb3-2-processed-gene-300.11:180:300:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-300.11:180-300|2x||RAPiDGENOMICS_rs1205_01278
TTGAGTTTCAGAGGATCTGACACTCGCAAGGGGATTACATTCGACATATACGATCGACTTAACACGAGAGGAATTAAAACGTTCATGGATGCGCAAGGACTTCAAGTAGGGGATGTTATT
>augustus_masked-Fvb3-2-processed-gene-300.11:1871:1991:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-300.11:1871-1991|2x||RAPiDGENOMICS_rs1205_01279
AGAAACATTCTTCCACTGTCCAAATGAATTAAGGGTACTAGATCTTAGCTTCACTAGCCTTTCATTACTGCCCAAATCATTCGGTCTCCTAACCAACCTCACAGCTTTGTATTTAGATGA
>augustus_masked-Fvb3-2-processed-gene-300.11:2171:2291:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_14::augustus_masked-Fvb3-2-processed-gene-300.11:2171-2291||RAPiDGENOMICS_rs1205_01280
GCTGCATGATTTAGAAGAACTGTATATGCAAGGATTTTGGGAGTGGGAGCGCTTGGTGCCTAACGCTGAGGAAGAAGAAGGAGAAGTCAATGATACCTTTACTAATGCTAGCTTTGACGA
>augustus_masked-Fvb3-2-processed-gene-300.11:240:360:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-300.11:240-360||RAPiDGENOMICS_rs1205_01281
AACACGAGAGGAATTAAAACGTTCATGGATGCGCAAGGACTTCAAGTAGGGGATGTTATTACTCCCGCTCTCTTGGCAGCAATCAAAGAATCAAGGTTTGCAATTGTTGTTCTCTCCCAA
>augustus_masked-Fvb3-2-processed-gene-300.11:2411:2531:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_16::augustus_masked-Fvb3-2-processed-gene-300.11:2411-2531||RAPiDGENOMICS_rs1205_01282
CCACAAGCCTGGTTTATACGAGACTGGTTTATACGAGCCATACATGAAGAAGTTACATGATCAACATCGTCATATCTCAATATCCTTGCCTGTCATGACCAGTCACTTACCGGAGTGGTT
>augustus_masked-Fvb3-2-processed-gene-300.11:2531:2651:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_17::augustus_masked-Fvb3-2-processed-gene-300.11:2531-2651||RAPiDGENOMICS_rs1205_01283
TCGCGATGAGATAATGAAGAAAGCAGAGACGCTTCGCTACTCTTGGTGCCACAGGTTAATAGACATATTTGTGGAATCTGAGCATGGGAGGTTACAAAGACTGAAGCATCTGCGTATAGT
>augustus_masked-Fvb3-2-processed-gene-300.11:2651:2771:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_18::augustus_masked-Fvb3-2-processed-gene-300.11:2651-2771||RAPiDGENOMICS_rs1205_01284
GGGTTACATGAGTCGAGACATCACGGAGGTGGATCCTGCAATAACATGGGTTCCAAGAAAGCCTGTGTTCGAGAATTTGGAAGAGTTGCGTCTGCATAAACTGGATTGTGCAGAGTTGTG
>augustus_masked-Fvb3-2-processed-gene-300.11:2771:2891:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_19::augustus_masked-Fvb3-2-processed-gene-300.11:2771-2891||RAPiDGENOMICS_rs1205_01285
TGCCGTTCAATTTCTACCACCTGGGTCTCTATTCAAGTTGAAGGTATTGAAGGTAAAAAGTTGTTACAATTGGGGGAATATACTTTTACCATCAACATTGTTACAGAGATTACCAAATTT
>augustus_masked-Fvb3-2-processed-gene-300.11:2891:3011:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_20::augustus_masked-Fvb3-2-processed-gene-300.11:2891-3011||RAPiDGENOMICS_rs1205_01286
GGAAGGATTAATTGTTCGTTGGACAGACGGGAGTGAATATTTGTTTGGGTATGAAGCCTTGCTTGTGTTGCGACAATTAAAGTTGAAAAAGATAAATTTGTGTGATCTAGCAACAGTAAG
>augustus_masked-Fvb3-2-processed-gene-300.11:300:420:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-300.11:300-420|2x||RAPiDGENOMICS_rs1205_01287
ACTCCCGCTCTCTTGGCAGCAATCAAAGAATCAAGGTTTGCAATTGTTGTTCTCTCCCAAAATTACGCTTCTTCTGCTTGGTGTTTGGAGGAACTTAGAGAGATTTGTCTGTCCATGGAA
>augustus_masked-Fvb3-2-processed-gene-300.11:3011:3131:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_21::augustus_masked-Fvb3-2-processed-gene-300.11:3011-3131||RAPiDGENOMICS_rs1205_01288
CATATGTGAGGGACCTGCCCCGCCTGCGATGCTCCAGAATCTTCAAAGTTTGTCCATTAAGAGGTGCAAACATTTGCAGGGAAGTCTCTTCACCTCTGATGTTGCTCAATGTCTTTCTCA
>augustus_masked-Fvb3-2-processed-gene-300.11:3131:3251:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_22::augustus_masked-Fvb3-2-processed-gene-300.11:3131-3251||RAPiDGENOMICS_rs1205_01289
GTTGAATTTCTTAGAATTACACAATTGCCTCTTGTTGGAAAGGATAGTTGAAGCAAGCAACAAGAAGACCGTCTTTCCAAAATTGAAGCGATTAAGTTTGAAGGAACTTCCAATGTTATA
>augustus_masked-Fvb3-2-processed-gene-300.11:3251:3371:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_23::augustus_masked-Fvb3-2-processed-gene-300.11:3251-3371||RAPiDGENOMICS_rs1205_01290
CAAAAGTACTACTTTTGATATCGAGTGTCCTTCATTGGAGAAAATGTATCTGAAGGGTTATGTTCCACCGGAACAATTGAGACTGAGAAAGATAGCATTGTCCACGGTTAGCATATGTGA
>augustus_masked-Fvb3-2-processed-gene-300.11:3371:3491:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_24::augustus_masked-Fvb3-2-processed-gene-300.11:3371-3491||RAPiDGENOMICS_rs1205_01291
TGGACCTTCTCGACTCCCACCTGCAATGTTCCAGAATCTGCAAAGTTTGTCCATAGAGTGGTGCAAGTCAGACGGAAGTCTCTTCACCTATGATGTTGCTCAGTGTCTTTGCCAGCTGAA
>augustus_masked-Fvb3-2-processed-gene-300.11:3491:3611:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_25::augustus_masked-Fvb3-2-processed-gene-300.11:3491-3611||RAPiDGENOMICS_rs1205_01292
TTCTTTGAAGTTAATGTATTGCCCACTGTTGGAAAGGATAGTTGAAGCAAGCAACAAGAAGACCGTCCTTCCAAAATTAAAGCGATTGCATTTGGAGGAACTTCCAATGTTGTACTATGA
>augustus_masked-Fvb3-2-processed-gene-300.11:420:540:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-300.11:420-540|2x||RAPiDGENOMICS_rs1205_01293
GACAACAGAATTTTGCCACTTTTTTATCATGTTGATCCTACTGATGTTCGATATCAGAAGAAGGGAAGTTTCAAAGAAGCTTTGTATAAGCATGAAACCTCTGGGCGGCACAGAATGGAA
>augustus_masked-Fvb3-2-processed-gene-300.11:480:600:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-300.11:480-600||RAPiDGENOMICS_rs1205_01294
AAGGGAAGTTTCAAAGAAGCTTTGTATAAGCATGAAACCTCTGGGCGGCACAGAATGGAAAAGGTGAAGGAGTGGAAAGCTGCGTTAAACAAAGTAGCCAATATCTCTGGGTGGAATACA
>augustus_masked-Fvb3-2-processed-gene-300.11:60:180:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-300.11:60-180|2x||RAPiDGENOMICS_rs1205_01295
CGTCGGTTCAGTTACATGGTCGAAAATTCGCAGGATAATCAAGTATTGGTTGACATGGATGCCTCTGCATCTCTTCCTTCTTCATCGTCAGCAGTACTTGAATGGAAGTATGATGTTTTT
>augustus_masked-Fvb3-2-processed-gene-300.11:611:731:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-300.11:611-731||RAPiDGENOMICS_rs1205_01296
AACTGAGAGAGCACTTACCGAAGCCATTTTGGAACTTCTCAGCAGTAAAATTGTACCTGATGCAATTGAGTCCACTGGAGATTTCCAAGCATTTGAAGCAACAAGAGTAGCCATGGATGA
>augustus_masked-Fvb3-2-processed-gene-300.11:671:791:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-300.11:671-791|2x||RAPiDGENOMICS_rs1205_01297
TGCAATTGAGTCCACTGGAGATTTCCAAGCATTTGAAGCAACAAGAGTAGCCATGGATGAGGTTTGGGAGGCCTTTAAAGACGACAAGGTCACTGCCATTGGTGTCTACGGCATGGGAGG
>augustus_masked-Fvb3-2-processed-gene-300.11:731:851:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-300.11:731-851||RAPiDGENOMICS_rs1205_01298
GGTTTGGGAGGCCTTTAAAGACGACAAGGTCACTGCCATTGGTGTCTACGGCATGGGAGGAGTTGGCAAGACAACCTTGGTGGAACATGTTGGTGCACAAGCCCGGAAAAGTGGGATTTT
>augustus_masked-Fvb3-2-processed-gene-300.11:791:911:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-300.11:791-911|2x||RAPiDGENOMICS_rs1205_01299
AGTTGGCAAGACAACCTTGGTGGAACATGTTGGTGCACAAGCCCGGAAAAGTGGGATTTTTGATTGTGTGACCAAGTGTGTCGTATCCCAACATCCTGATTTTGAAAAACTTCAAGAGAC
>augustus_masked-Fvb3-2-processed-gene-300.11:851:971:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-300.11:851-971||RAPiDGENOMICS_rs1205_01300
TGATTGTGTGACCAAGTGTGTCGTATCCCAACATCCTGATTTTGAAAAACTTCAAGAGACGTTGGCAGAGCAGCTGGGCTTCGAATTACCTGAGAAGACAGAAACTGGAAGAGCAGCTAG
>augustus_masked-Fvb3-2-processed-gene-300.11:911:1031:Parent=augustus_masked-Fvb3-2-processed-gene-300.11-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-300.11:911-1031|2x||RAPiDGENOMICS_rs1205_01301
GTTGGCAGAGCAGCTGGGCTTCGAATTACCTGAGAAGACAGAAACTGGAAGAGCAGCTAGATTGAGAAAGGAGATAAAGAAAAGGGAAAAAATCCTTATAATCTTGGACGACATTTGGGA
>augustus_masked-Fvb3-2-processed-gene-302.6:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-302.6:0-120||RAPiDGENOMICS_rs1205_01302
ATGGCCTCAAGCTCCCAGACAATCTCTGCATCTCCTTCTTCATCAGCTCCTTGGAAGTATGATGTGTTCCTGAGTTTCAGGGGTCCTGACACTCGCAAGGGTATCACGTCTGAACTATAC
>augustus_masked-Fvb3-2-processed-gene-302.6:1042:1162:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-302.6:1042-1162||RAPiDGENOMICS_rs1205_01303
GTTTTAAATCCCTTTTGTTCTTCTTCTGTATGTCTGCATATTACAAAAAGATATCGTTGGCGATTGTTGCTGTAATTGTGACATGGATGGGTTGCAAGGCCATTAAGGGGATATGGACTC
>augustus_masked-Fvb3-2-processed-gene-302.6:1162:1282:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-302.6:1162-1282||RAPiDGENOMICS_rs1205_01304
AAGTAAAGCGTCGGATAAGTTACATGGTCGGAAAGTCGCAGGATAATCAAGGAGCGGTTAACTTGAATGCCTCTGAATCTCTTGCTTCATCATCAGAACCTCGTCGCCCGAAGTATGATG
>augustus_masked-Fvb3-2-processed-gene-302.6:120:240:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-302.6:120-240||RAPiDGENOMICS_rs1205_01305
CATCGACTGCAGGGGAGGGGAACTAAAACATTCATGGATGATCGAGATCTTCAAGTAGGGGATGTTATTTCTCCCACTCTCTTAGCAGCAATCAAAGAATCAAGGTTTGCAATTGTTGTT
>augustus_masked-Fvb3-2-processed-gene-302.6:1222:1342:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-302.6:1222-1342|2x||RAPiDGENOMICS_rs1205_01306
ACTTGAATGCCTCTGAATCTCTTGCTTCATCATCAGAACCTCGTCGCCCGAAGTATGATGTGTTTTTGAGTTTCAGGGGTCCTGACACTCGAAGGAGTATTACAACTGAATTAAATATGC
>augustus_masked-Fvb3-2-processed-gene-302.6:1282:1402:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-302.6:1282-1402||RAPiDGENOMICS_rs1205_01307
TGTTTTTGAGTTTCAGGGGTCCTGACACTCGAAGGAGTATTACAACTGAATTAAATATGCGGCTGCATAACAGAGGCATTGCAACATTCATGGATGAACGAGATCTTGAAGTAGGGGATG
>augustus_masked-Fvb3-2-processed-gene-302.6:1402:1522:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-302.6:1402-1522||RAPiDGENOMICS_rs1205_01308
CTATATCTCCCACTCTACTAAAAGCAATTGAAGAATCAAGGTTTGCAATTGTTGTCCTTTCTCCAAACTATGCCTCTTCTACTTGGTGTTTGGAGGAACTTGCCAAGATCTGTGAGTGCA
>augustus_masked-Fvb3-2-processed-gene-302.6:1522:1642:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-302.6:1522-1642||RAPiDGENOMICS_rs1205_01309
TGAAAGACCAGAACAGAATTCTTCCACTTTTCTATAATGTCGAGCCTACTAATGTACGGTTCCAGAAGAGGAGTTTCGAAGATGCTTTCAAGGAGCATGAAAGCTCTGGGCGACACACAT
>augustus_masked-Fvb3-2-processed-gene-302.6:1582:1702:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-302.6:1582-1702|2x||RAPiDGENOMICS_rs1205_01310
TCCAGAAGAGGAGTTTCGAAGATGCTTTCAAGGAGCATGAAAGCTCTGGGCGACACACATCAGAGAAGGTGCAGCGGTGGAAGGATGCTTTGAGCAAAGTGGCCAGTTTCTCTGGGTGGG
>augustus_masked-Fvb3-2-processed-gene-302.6:1718:1838:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-302.6:1718-1838||RAPiDGENOMICS_rs1205_01311
GACTGATAGAGAACTTGTGGAGGCAGTTGTAGATTCTGTGTGCAAAAGAATACAACCTCATGACGTTGAGTTTACAATGTCCACCGGAGATTTTGAAGCATATAAAGCAACAAGAAAAGC
>augustus_masked-Fvb3-2-processed-gene-302.6:180:300:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-302.6:180-300|2x||RAPiDGENOMICS_rs1205_01312
GATGTTATTTCTCCCACTCTCTTAGCAGCAATCAAAGAATCAAGGTTTGCAATTGTTGTTCTCTCGCCGGATTATGCTTTTTCTACTTGGTGTTTGCAGGAACTTAGAGAGATTTGTCTG
>augustus_masked-Fvb3-2-processed-gene-302.6:1838:1958:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-302.6:1838-1958||RAPiDGENOMICS_rs1205_01313
CATGGGTGAGGTTATGAAGGTGCTTACAGATGATGACGTCACAGCCATTGGGGTCTACGGCATGGGGGGCGTCGGCAAGACAACCCTGGTGAAACATGTCGCTGCTAAATGCATAAAAAG
>augustus_masked-Fvb3-2-processed-gene-302.6:1898:2018:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-302.6:1898-2018|2x||RAPiDGENOMICS_rs1205_01314
CATGGGGGGCGTCGGCAAGACAACCCTGGTGAAACATGTCGCTGCTAAATGCATAAAAAGTGGGATTTTTCATGGTGTGATTATGGCTGTCGTTTCACAAAATCCTGATTTCAAAAAACT
>augustus_masked-Fvb3-2-processed-gene-302.6:2018:2138:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-302.6:2018-2138|2x||RAPiDGENOMICS_rs1205_01315
TCAAGACGAATTGGCAGAGCAGTTGGGCTTCAAATGGTCGGAGAATACAGAAATGGGAAGAATTGGTAGATTGAATAAGGAGATAATGAGAAAAGAAAAACTCCTTATAATCTTGGACGA
>augustus_masked-Fvb3-2-processed-gene-302.6:2078:2198:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-302.6:2078-2198||RAPiDGENOMICS_rs1205_01316
AATTGGTAGATTGAATAAGGAGATAATGAGAAAAGAAAAACTCCTTATAATCTTGGACGATGTTTGGGGGAGAACAGAGTTGTTAAAGATAGGGATTAGCTACAAGGAGCTTCAAAAGTG
>augustus_masked-Fvb3-2-processed-gene-302.6:2198:2318:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-302.6:2198-2318||RAPiDGENOMICS_rs1205_01317
CAAGTCCAAAGTGCTACTCACCACAAGGAGATTGAATGTATGTCATGACATGAATTGCCAAGAAAAGATCAGCCTCAACGTTCTCTCAAACAAAGATTCTTTGACCTTGTTTCTAAGAAA
>augustus_masked-Fvb3-2-processed-gene-302.6:2258:2378:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-302.6:2258-2378|2x||RAPiDGENOMICS_rs1205_01318
AGAAAAGATCAGCCTCAACGTTCTCTCAAACAAAGATTCTTTGACCTTGTTTCTAAGAAATGCAAGAATAATGTCTTTTGAGTCCACCACATTTGAGAAAGTGGTGAAGAGGGTAGCTGG
>augustus_masked-Fvb3-2-processed-gene-302.6:2378:2498:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-302.6:2378-2498|2x||RAPiDGENOMICS_rs1205_01319
AGAATGTAAGGGTCTACCGATTGCACTGATAGCTGTTGCAAGGGCACTCGGAGATAAGGACCTGGTGGAATGGGAAAAAGCAGCACAACGACTAGAGAAGTCGCAAACTGCCAATCCTGA
>augustus_masked-Fvb3-2-processed-gene-302.6:240:360:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-302.6:240-360||RAPiDGENOMICS_rs1205_01320
CTCTCGCCGGATTATGCTTTTTCTACTTGGTGTTTGCAGGAACTTAGAGAGATTTGTCTGTCCATGGAAGACAACAGTAGAATCCTGCCACTTTTTTATGATGTTGATCCTACTGATGTG
>augustus_masked-Fvb3-2-processed-gene-302.6:2438:2558:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-302.6:2438-2558||RAPiDGENOMICS_rs1205_01321
CCTGGTGGAATGGGAAAAAGCAGCACAACGACTAGAGAAGTCGCAAACTGCCAATCCTGACCACGGGGAAGATGCATTTGAATGTATAAAATTAAGCTATGATTACTTGAAAAATGAGGA
>augustus_masked-Fvb3-2-processed-gene-302.6:2498:2618:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-302.6:2498-2618|2x||RAPiDGENOMICS_rs1205_01322
CCACGGGGAAGATGCATTTGAATGTATAAAATTAAGCTATGATTACTTGAAAAATGAGGAGTACAAGTCATTCTTCCTACTCTGTTGTTTATTCCCAGAAGATGATGTTATCAATATAGA
>augustus_masked-Fvb3-2-processed-gene-302.6:2558:2678:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-302.6:2558-2678||RAPiDGENOMICS_rs1205_01323
GTACAAGTCATTCTTCCTACTCTGTTGTTTATTCCCAGAAGATGATGTTATCAATATAGAAGACTTGTTTAGGTATGCAATCGGGATAGGATTGTTTCGAGATGCCGAGACAATATGCGA
>augustus_masked-Fvb3-2-processed-gene-302.6:2618:2738:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-302.6:2618-2738|2x||RAPiDGENOMICS_rs1205_01324
AGACTTGTTTAGGTATGCAATCGGGATAGGATTGTTTCGAGATGCCGAGACAATATGCGAAGCCAGAGGAACAGCACATACGGTGGTCAAGTACTTGATAGATTGTAGCTTGCTTTTGAA
>augustus_masked-Fvb3-2-processed-gene-302.6:2678:2798:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-302.6:2678-2798||RAPiDGENOMICS_rs1205_01325
AGCCAGAGGAACAGCACATACGGTGGTCAAGTACTTGATAGATTGTAGCTTGCTTTTGAAAAGTGGTTATGTAACTTATGTTACATGTGTAAGGATGCATGATGTCGTCCGAGATACAGC
>augustus_masked-Fvb3-2-processed-gene-302.6:2798:2918:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_10::augustus_masked-Fvb3-2-processed-gene-302.6:2798-2918||RAPiDGENOMICS_rs1205_01326
CCTGAATATTGCAAAATCTGAAGGTGGGCATCGGTTTTTGGTAAAAGCTGGATGTGGTTTAGATTATTGGCCAAGTCGATTACTAGACGAAGGCTGCACTGCTATTTCACTAATGCATCA
>augustus_masked-Fvb3-2-processed-gene-302.6:300:420:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-302.6:300-420|2x||RAPiDGENOMICS_rs1205_01327
TCCATGGAAGACAACAGTAGAATCCTGCCACTTTTTTATGATGTTGATCCTACTGATGTGCGACATCAGAAGAGGAGTCTCAAAGAAGCTAAAGATGATCAAGTTTATGCCGTTGGGGTG
>augustus_masked-Fvb3-2-processed-gene-302.6:3014:3134:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-302.6:3014-3134||RAPiDGENOMICS_rs1205_01328
TCCTCTCACTTTAGAGGAGCCGGATCCGTTGGATATCACTCACGAAAGAATTGTCAGGATTCCATCCAAACTGTTATCAAAGTTGCGTAGTCTAGAAGAACTCTACCTGCTATGTGATTT
>augustus_masked-Fvb3-2-processed-gene-302.6:3134:3254:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-302.6:3134-3254||RAPiDGENOMICS_rs1205_01329
TGGGGAGTGGGGAAGCGAGGTTGATGGAGAAGGGGACGAAACCAATTCTGCCTTTGATGAGGTAACTGGCTTGTCAAAATTAAGAATTCTGCATGTTTGGATCTCCGATGCAGAATGTAT
>augustus_masked-Fvb3-2-processed-gene-302.6:3374:3494:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-302.6:3374-3494||RAPiDGENOMICS_rs1205_01330
GAAACTTGACTCGATCAGTAACTTCCCGGACTGGTTTTTCAACATGGTGATAAACAAAGCTGAGAAGCTATGCTGGTATTGCCCACAGACTGGTTTAATCGACGTTTTTGTGGAATATGA
>augustus_masked-Fvb3-2-processed-gene-302.6:360:480:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-302.6:360-480||RAPiDGENOMICS_rs1205_01331
CGACATCAGAAGAGGAGTCTCAAAGAAGCTAAAGATGATCAAGTTTATGCCGTTGGGGTGTACGGCATAGGAGGCGTCGGCAAGACAACTGTGGTGAAACATGTCAGTGCACAAGCCTGC
>augustus_masked-Fvb3-2-processed-gene-302.6:3614:3734:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-302.6:3614-3734||RAPiDGENOMICS_rs1205_01332
AGAGTTATATCTGGCTAGTGATTGCGCGGAGTTATGTGCTGTTGAATTTCTAAAACCTGGGTCTCTATGCAGTTTGAAGTTATTGAACATAAAATTTTGTTACAACTGGGGGAATGTGCT
>augustus_masked-Fvb3-2-processed-gene-302.6:3734:3854:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-302.6:3734-3854||RAPiDGENOMICS_rs1205_01333
TTTACCATCAACATTGTCTGAGAGACTACCAAATTTGGAAGAACTAGAGTGTCGGTCAATGGACGAGATTGAATATGTGTTTGGGTATGAAGCAGCGTTACTGGAGACAGAACAATCAAA
>augustus_masked-Fvb3-2-processed-gene-302.6:3854:3974:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-302.6:3854-3974||RAPiDGENOMICS_rs1205_01334
ATTGAGAAGGATAGAATTGTCTTATCTAAGGAGAGTAAGAAGCCTATGTGAGGGACCTACTCCTCCTGCAATGTTTCAGAATCTTCAAACTTTGTCCATTGAATGGTGCAAGCAGTTGCG
>augustus_masked-Fvb3-2-processed-gene-302.6:3974:4094:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-302.6:3974-4094||RAPiDGENOMICS_rs1205_01335
GGGAAGTCTCTTCACCTATGATGTTGCTCAGTGTCTTTCTCAGTTGACTTGCTTTTATTTAGCGGATTGTCCCTTATTGGAAAGGATAGTTGAAGCAAGTAACAAGAAGACTGTCCTTCC
>augustus_masked-Fvb3-2-processed-gene-302.6:4094:4214:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_10::augustus_masked-Fvb3-2-processed-gene-302.6:4094-4214||RAPiDGENOMICS_rs1205_01336
AAAATTGAAGCGACTACATTTAATGTTACTTCCAATGTTGTACTATGAAAGTGCTACTTTTGATATTGAGTGTCCTTCATTGGAAGAATTGGAATTGTGGAGCAGCCCCAAGTTTTCAGT
>augustus_masked-Fvb3-2-processed-gene-302.6:420:540:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-302.6:420-540|2x||RAPiDGENOMICS_rs1205_01337
TACGGCATAGGAGGCGTCGGCAAGACAACTGTGGTGAAACATGTCAGTGCACAAGCCTGCAAAAATGGGATTTTTGATCATGTTATTATGGCTGTCGTTTCACAAAATCCTGATTTTGAA
>augustus_masked-Fvb3-2-processed-gene-302.6:480:600:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-302.6:480-600||RAPiDGENOMICS_rs1205_01338
AAAAATGGGATTTTTGATCATGTTATTATGGCTGTCGTTTCACAAAATCCTGATTTTGAAAAACTTCAAGATGCATTGGCAGAGCAGTTGGGCATCAAATTGTTGGAGGAGACAGAAATT
>augustus_masked-Fvb3-2-processed-gene-302.6:540:660:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-302.6:540-660|2x||RAPiDGENOMICS_rs1205_01339
AAACTTCAAGATGCATTGGCAGAGCAGTTGGGCATCAAATTGTTGGAGGAGACAGAAATTGGAAGAATTGGTGGATTGAATAAGGAGATAATGAGAAGAGAAAAACTCCTTACAATCTTG
>augustus_masked-Fvb3-2-processed-gene-302.6:60:180:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-302.6:60-180|2x||RAPiDGENOMICS_rs1205_01340
GATGTGTTCCTGAGTTTCAGGGGTCCTGACACTCGCAAGGGTATCACGTCTGAACTATACCATCGACTGCAGGGGAGGGGAACTAAAACATTCATGGATGATCGAGATCTTCAAGTAGGG
>augustus_masked-Fvb3-2-processed-gene-302.6:693:813:Parent=augustus_masked-Fvb3-2-processed-gene-302.6-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-302.6:693-813||RAPiDGENOMICS_rs1205_01341
TCTACCGATTTTTATGAAGTAGCCAGAAAGGTAGCTAGAGAATGTGCTGGTCTACCAGTTGCATTGATTGCAGTTGCAAGGGCTCTTGGAGATAAAGATTTTGAAGACTGGAAAGAAGCT
>augustus_masked-Fvb3-2-processed-gene-303.3:1020:1140:Parent=augustus_masked-Fvb3-2-processed-gene-303.3-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-303.3:1020-1140|2x||RAPiDGENOMICS_rs1205_01342
AGTATACTTGATCTAGGTCAGAATCAGCTCACTGGTATCTTACCAAGTAGCCTTTACTCATGCAAGTCTCTTAGAGCGATTCGACTGAGTAGGAACGATTTAGAAGGAGAAATTCAACCT
>augustus_masked-Fvb3-2-processed-gene-303.3:1080:1200:Parent=augustus_masked-Fvb3-2-processed-gene-303.3-mRNA-1_10::augustus_masked-Fvb3-2-processed-gene-303.3:1080-1200||RAPiDGENOMICS_rs1205_01343
TGCAAGTCTCTTAGAGCGATTCGACTGAGTAGGAACGATTTAGAAGGAGAAATTCAACCTGAGATTCTATCTTTGTCATCGTTGTCCTTCCTCTCGCTTGGTTTCAATAGGTTGACCAAT
>augustus_masked-Fvb3-2-processed-gene-303.3:1200:1320:Parent=augustus_masked-Fvb3-2-processed-gene-303.3-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-303.3:1200-1320||RAPiDGENOMICS_rs1205_01344
ATCTCAAAGGCAATGAGGATATTGGGGCGTTGCAAAAGTCTTGTATTCATATCCTTTGCAAATGGTTTTCAAGGTGGGGAATTGCCAGGTGATCTTGGCGTGGTTAATTTCGATGGACTC
>augustus_masked-Fvb3-2-processed-gene-303.3:1500:1620:Parent=augustus_masked-Fvb3-2-processed-gene-303.3-mRNA-1_13::augustus_masked-Fvb3-2-processed-gene-303.3:1500-1620|2x||RAPiDGENOMICS_rs1205_01345
ATTTCAGGTGACCTTCCAAAGGAACTCTGTAGGCTACCAATGTGGATGTTCGAAAACACTACTGCTACTCAAGAAGATGTTGAATTGCCCGTCTATGGATCGCAAGGTCCTACCTTGTTT
>augustus_masked-Fvb3-2-processed-gene-303.3:1560:1680:Parent=augustus_masked-Fvb3-2-processed-gene-303.3-mRNA-1_14::augustus_masked-Fvb3-2-processed-gene-303.3:1560-1680||RAPiDGENOMICS_rs1205_01346
ACTGCTACTCAAGAAGATGTTGAATTGCCCGTCTATGGATCGCAAGGTCCTACCTTGTTTGTACAGTACACATTGTCTTACTTTCCTTTTACAATGGACTTAAAGAGCAATAACATCAGT
>augustus_masked-Fvb3-2-processed-gene-303.3:1620:1740:Parent=augustus_masked-Fvb3-2-processed-gene-303.3-mRNA-1_14::augustus_masked-Fvb3-2-processed-gene-303.3:1620-1740|2x||RAPiDGENOMICS_rs1205_01347
GTACAGTACACATTGTCTTACTTTCCTTTTACAATGGACTTAAAGAGCAATAACATCAGTGGGAGCATACCTATTGAGATTGGCCGAGTGCAGCTTCTCCGTCATTTGGATCTTAGCAAC
>augustus_masked-Fvb3-2-processed-gene-303.3:1680:1800:Parent=augustus_masked-Fvb3-2-processed-gene-303.3-mRNA-1_15::augustus_masked-Fvb3-2-processed-gene-303.3:1680-1800||RAPiDGENOMICS_rs1205_01348
GGGAGCATACCTATTGAGATTGGCCGAGTGCAGCTTCTCCGTCATTTGGATCTTAGCAACAACAGCTTCACCGGAAACATCCCGGAGCAGATATCTAACCTCAAGAACATGGAGACATTG
>augustus_masked-Fvb3-2-processed-gene-303.3:1920:2040:Parent=augustus_masked-Fvb3-2-processed-gene-303.3-mRNA-1_17::augustus_masked-Fvb3-2-processed-gene-303.3:1920-2040||RAPiDGENOMICS_rs1205_01349
CTCCAGAGCTTTAGTGCCTCCGCATTTGAGGGGAATCCGAAACTTTGTGGCGCTCCACTTCCAACTGAGTGTCAACAAGCTAAGGGCAATGATTCAAATAACAATGAAAATAGTACGGAG
>augustus_masked-Fvb3-2-processed-gene-303.3:2040:2160:Parent=augustus_masked-Fvb3-2-processed-gene-303.3-mRNA-1_18::augustus_masked-Fvb3-2-processed-gene-303.3:2040-2160||RAPiDGENOMICS_rs1205_01350
GATGAGGATGAATATCAGATTCCATGGTTGCATGTTTCTGTTATTCTTGGGTTCATTTTAGGATTTTGGGGTGTCTGTGGCCCTTTGGTGCTTAAGAAGAAGTGGAGGTATGCATATTTT
>augustus_masked-Fvb3-2-processed-gene-307.5:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-307.5:0-120||RAPiDGENOMICS_rs1205_01351
ATGGCTAATGCATTCCTTTTCTTCCTGCTCTTGATATTCTCTTCCAATATCATACTTGAAAATATTCATGCTTGCAACCAAAGCGAGCGCAGCTCTCTGCTGTCGTTTTCTCTCACTCTG
>augustus_masked-Fvb3-2-processed-gene-307.5:1080:1200:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_10::augustus_masked-Fvb3-2-processed-gene-307.5:1080-1200||RAPiDGENOMICS_rs1205_01352
TGCAAGTACCTGAAAGCAATTCGGCTGAGTGCCAATGATCTAGAAGGAGAAATACAACCTGATATTCAGTCATTGAAGTCCTTGTCCTTCCTCTCGCTTGGTTATAACAGAATGACCAAT
>augustus_masked-Fvb3-2-processed-gene-307.5:120:240:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-307.5:120-240||RAPiDGENOMICS_rs1205_01353
TCATCTCCTCAGCTGAATTGGACTTCCACCGATTGTTGTTATTGGGAGGGTATAACATGTAATCAGGGTGGTTGGATAACCCATTTGCAGTTGCCTTCCAAAGGACTTAAACTCAAAGAA
>augustus_masked-Fvb3-2-processed-gene-307.5:1200:1320:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-307.5:1200-1320||RAPiDGENOMICS_rs1205_01354
ATCGCCAAGGCAATGAAGATACTGATGCATTGCAAAAATCTTGTAGTCCTATCCTTTTCATCTAGTTTTGTAGGTGAAGAATTTCCGGATGATCTTGGCAAGGTTGATTTTGATGGTTTC
>augustus_masked-Fvb3-2-processed-gene-307.5:1320:1440:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_12::augustus_masked-Fvb3-2-processed-gene-307.5:1320-1440||RAPiDGENOMICS_rs1205_01355
CAAAATCTTCGAATGTTATCTTTGGGTAAATGTGAGCTGACAGGTCAACTACCTGTATGGCTATCTAAGCTCAAGAAACTAAAGATCTTGGCTCTTGGGTCCAATAGAATCACAGGAACA
>augustus_masked-Fvb3-2-processed-gene-307.5:1380:1500:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_12::augustus_masked-Fvb3-2-processed-gene-307.5:1380-1500|2x||RAPiDGENOMICS_rs1205_01356
CTATCTAAGCTCAAGAAACTAAAGATCTTGGCTCTTGGGTCCAATAGAATCACAGGAACAATTCCTAGTTGGTTGGGGACTCTTCCAAGGCTCTTTCGTATAAGTTTGGAAAATAACCAA
>augustus_masked-Fvb3-2-processed-gene-307.5:1440:1560:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_13::augustus_masked-Fvb3-2-processed-gene-307.5:1440-1560||RAPiDGENOMICS_rs1205_01357
ATTCCTAGTTGGTTGGGGACTCTTCCAAGGCTCTTTCGTATAAGTTTGGAAAATAACCAACTTTCAGGTGTATTTCCGAAAGAGCTTTGTAAACTACCAATGTTAGTATCTGAAAGCTCT
>augustus_masked-Fvb3-2-processed-gene-307.5:1560:1680:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_14::augustus_masked-Fvb3-2-processed-gene-307.5:1560-1680||RAPiDGENOMICS_rs1205_01358
ACAGCTCAAGATGATGATATTTATCTTGAATTGCCCTTGTATGGATTTCAGGGTCCAACATTAGTGCAGTACAAATTCTCTTTTTTCCCTCCTGCAATAAACATAGGCAATAATACCATT
>augustus_masked-Fvb3-2-processed-gene-307.5:1680:1800:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_15::augustus_masked-Fvb3-2-processed-gene-307.5:1680-1800||RAPiDGENOMICS_rs1205_01359
AGTGGGAACATACCTACTGAGATTGGTCAACTGCAGCTTCTTCATACACTGAGTCTTAGCAAAAACAACTTTTCCGGCCACATTCCACAGCAACTGTCCGACCTCAAAAACTTGGAGAAA
>augustus_masked-Fvb3-2-processed-gene-307.5:180:300:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-307.5:180-300|2x||RAPiDGENOMICS_rs1205_01360
AATCAGGGTGGTTGGATAACCCATTTGCAGTTGCCTTCCAAAGGACTTAAACTCAAAGAAGGTATTTTTCCATCATCTTCACTTGGAAATCTCACACATCTCACCCACTTGAATCTCTCC
>augustus_masked-Fvb3-2-processed-gene-307.5:1800:1920:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_16::augustus_masked-Fvb3-2-processed-gene-307.5:1800-1920||RAPiDGENOMICS_rs1205_01361
TTGGATCTCTCCATGAATCATTTGTCTGGACAAGTCCCATTGTCATTGACTAGTGTCAACTTCTTGTCATCTTTTAATGTCTCATACAATAATCTTGAAGGAGAAATACCAACAAGTACT
>augustus_masked-Fvb3-2-processed-gene-307.5:300:420:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-307.5:300-420|2x||RAPiDGENOMICS_rs1205_01362
CACAATTCACTTTACAGTACACTAGATCAAAGTACTGGATTCTTCTCGTCTTTGAATCATTTGACGACCCTGGATTTGAGCTATAACCTTCTTTTCGGAGAGCTACCATCTTCTTTACCA
>augustus_masked-Fvb3-2-processed-gene-307.5:360:480:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-307.5:360-480||RAPiDGENOMICS_rs1205_01363
TTGACGACCCTGGATTTGAGCTATAACCTTCTTTTCGGAGAGCTACCATCTTCTTTACCATTCCAAAACATCCAAACGCTTTATTTGTCCAGCAATCACTTACATGGTGCAATTCCATCT
>augustus_masked-Fvb3-2-processed-gene-307.5:420:540:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-307.5:420-540|2x||RAPiDGENOMICS_rs1205_01364
TTCCAAAACATCCAAACGCTTTATTTGTCCAGCAATCACTTACATGGTGCAATTCCATCTTCATTTTTCCAACAAGCTTGGAATTTGACTAGTTTCAATGTTAGCAACAACACATTCTCA
>augustus_masked-Fvb3-2-processed-gene-307.5:480:600:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-307.5:480-600||RAPiDGENOMICS_rs1205_01365
TCATTTTTCCAACAAGCTTGGAATTTGACTAGTTTCAATGTTAGCAACAACACATTCTCAGGTTCTATCCCATCATCAATTTGTCTTCATTCTTCACCCTTGATTACGCTATTGGACTTC
>augustus_masked-Fvb3-2-processed-gene-307.5:60:180:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-307.5:60-180|2x||RAPiDGENOMICS_rs1205_01366
AATATTCATGCTTGCAACCAAAGCGAGCGCAGCTCTCTGCTGTCGTTTTCTCTCACTCTGTCATCTCCTCAGCTGAATTGGACTTCCACCGATTGTTGTTATTGGGAGGGTATAACATGT
>augustus_masked-Fvb3-2-processed-gene-307.5:600:720:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-307.5:600-720||RAPiDGENOMICS_rs1205_01367
TCATTCAATGAATTTAGTGGCGATATTTCTCAAGGACTAGGAGAGTGTTCCAAACTGAAAGCTTTTCGTGCTGGTCACAATAACTTGTCAGGTTTACTTTCAGATGATATCTACAATGCT
>augustus_masked-Fvb3-2-processed-gene-307.5:720:840:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-307.5:720-840||RAPiDGENOMICS_rs1205_01368
ACCACACTTGAAGAAATTGCTTTACCTCACAATTTGCTAAACGGACCCATTAGTGAAAGAATTGCCAACCTCACAAACCTCTCAATCCTTGACCTCAACACTAATGGATTGATTGGCGTG
>augustus_masked-Fvb3-2-processed-gene-307.5:960:1080:Parent=augustus_masked-Fvb3-2-processed-gene-307.5-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-307.5:960-1080||RAPiDGENOMICS_rs1205_01369
GGATTCAACAATTTGGAAGGGAATATCTCTCAGCTTAATTTTTCCAGACTTATCAAACTCAGTAAGCTTGAGCTTGGGAAAAATAATCTCACTGTCATGTTTCCAATAAGCCTTTACTCT
>augustus_masked-Fvb3-2-processed-gene-307.7:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-307.7-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-307.7:0-120||RAPiDGENOMICS_rs1205_01370
ATGGCTAATGCATTACTTTTCTTGTTATTCTTGACGTTAGCTTCCAGTATCATATTTGAAATCGTTCATGCTTGCGACCAAAGCGAACGCAGCTCTCTGCTGTCGTTTGCTCGCACTCTT
>augustus_masked-Fvb3-2-processed-gene-307.7:1260:1380:Parent=augustus_masked-Fvb3-2-processed-gene-307.7-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-307.7:1260-1380|2x||RAPiDGENOMICS_rs1205_01371
GCATCTAGTTTTGTAGGTGAGGAACTTCCGACTGATCTTGGGAAAGATTTTGATGGATTCCAAAATCTTCGAATTTTGGATTTCAGTTCCTGTAACCTTACTGGTCAACTCCCTTTATGG
>augustus_masked-Fvb3-2-processed-gene-307.7:1440:1560:Parent=augustus_masked-Fvb3-2-processed-gene-307.7-mRNA-1_13::augustus_masked-Fvb3-2-processed-gene-307.7:1440-1560||RAPiDGENOMICS_rs1205_01372
ATCCCAAGTTGGATAGGGAGTCTTCCTAGGCTCTATTCTATAATCATGGATTTCAATCTACTTTCAGGTAAAATTCCAAAGGAACTGTGGATGCTTCCTATGTTAGTATCTGAACAAGCT
>augustus_masked-Fvb3-2-processed-gene-307.7:1560:1680:Parent=augustus_masked-Fvb3-2-processed-gene-307.7-mRNA-1_14::augustus_masked-Fvb3-2-processed-gene-307.7:1560-1680||RAPiDGENOMICS_rs1205_01373
GCAGCTCAAGTGGATCGTACTGCTAGTGATCTGCCTATCTTCCACTCCAGTGTTGATAATGCAAGACCTTTACAGTACAATTTCTTGTATTACGCACCATATATATCCCTAAAAAGCAAT
>augustus_masked-Fvb3-2-processed-gene-307.7:360:480:Parent=augustus_masked-Fvb3-2-processed-gene-307.7-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-307.7:360-480||RAPiDGENOMICS_rs1205_01374
TATCTCCAAGTTATAGATTTGAGCTATAACCTTCTCTTTGGAGTGTTACCATCTTCTCTACCATACAGTCATATTCAGATGGTGGATTTTTCCAGCAATCGCTTACATGGTGTGATTCCA
>augustus_masked-Fvb3-2-processed-gene-307.7:60:180:Parent=augustus_masked-Fvb3-2-processed-gene-307.7-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-307.7:60-180|2x||RAPiDGENOMICS_rs1205_01375
ATCGTTCATGCTTGCGACCAAAGCGAACGCAGCTCTCTGCTGTCGTTTGCTCGCACTCTTTCTTCTCCTCAGTTGAATTGGACTTCCGCCGATTGTTGCAGTTGGGAGGGCATCACATGT
>augustus_masked-Fvb3-2-processed-gene-307.7:840:960:Parent=augustus_masked-Fvb3-2-processed-gene-307.7-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-307.7:840-960||RAPiDGENOMICS_rs1205_01376
CTCCCTCTCCATCTTGGGAAGCTCTCAAAGTTGAAACACATACTCCTTGATTTCAACTATCTGGAAGGCTCATTACCTCTATCCCTGATGAATTGCACAAAACTAGTTGAACTACGTATG
>augustus_masked-Fvb3-2-processed-gene-308.15:1200:1320:Parent=augustus_masked-Fvb3-2-processed-gene-308.15-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-308.15:1200-1320||RAPiDGENOMICS_rs1205_01377
AATTTGCTAAGACTTTCTCTTGGAGGCAACAATTTCACCGGAAGCATACCTTCTTGGATAGGATCAAAGGTATCCGGACTCGAAATGCTACAATTGCGATCAAACTCTTTAAGCGGACAT
>augustus_masked-Fvb3-2-processed-gene-308.15:1260:1380:Parent=augustus_masked-Fvb3-2-processed-gene-308.15-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-308.15:1260-1380|2x||RAPiDGENOMICS_rs1205_01378
GGATCAAAGGTATCCGGACTCGAAATGCTACAATTGCGATCAAACTCTTTAAGCGGACATATTCCTCACCAACTGTGCAGTCTTCCTCTCCTTCAGTTCCTAGACCTTGGTCACAACAGA
>augustus_masked-Fvb3-2-processed-gene-308.15:1380:1500:Parent=augustus_masked-Fvb3-2-processed-gene-308.15-mRNA-1_12::augustus_masked-Fvb3-2-processed-gene-308.15:1380-1500|2x||RAPiDGENOMICS_rs1205_01379
TTTTCAGGGACTATTCCCAAGTGTTTGAATAACTTGACTGCTCTAGTCTCTGGTCTGTATAATGGCTGGGTTATCTTTAGTGACTTTGAGGAAACAACCGTGACTACAAAAGGAAGAGAA
>augustus_masked-Fvb3-2-processed-gene-308.15:1440:1560:Parent=augustus_masked-Fvb3-2-processed-gene-308.15-mRNA-1_13::augustus_masked-Fvb3-2-processed-gene-308.15:1440-1560||RAPiDGENOMICS_rs1205_01380
AATGGCTGGGTTATCTTTAGTGACTTTGAGGAAACAACCGTGACTACAAAAGGAAGAGAAAGTGAATACTTCACTAGACAGGCGATGCTTCTGACCGTTATTGATCTTTCTTCAAACGAT
>augustus_masked-Fvb3-2-processed-gene-308.15:1560:1680:Parent=augustus_masked-Fvb3-2-processed-gene-308.15-mRNA-1_14::augustus_masked-Fvb3-2-processed-gene-308.15:1560-1680||RAPiDGENOMICS_rs1205_01381
TTAGAAGGTGAAATTCCTGAAGAAATAAGCAGCCTCCTTTCATTGGGTACCTTGAACTTGTCCATGAATCAATTGAGTGGAAGTATCCCCTCCAAGATCGGAAACTTGTACCGGCTCGAA
>augustus_masked-Fvb3-2-processed-gene-308.15:1920:2040:Parent=augustus_masked-Fvb3-2-processed-gene-308.15-mRNA-1_17::augustus_masked-Fvb3-2-processed-gene-308.15:1920-2040||RAPiDGENOMICS_rs1205_01382
AAAGATCACGGAGATGATGAGGAAAAGCTTGGTTTCTATACCAGCGCGGTGCTTGGATTCATCATAGGCTTTTGGAGTGTGTGCGGCACATTGATATTGAAAAAGTCATGGAGGTATGCT
>augustus_masked-Fvb3-2-processed-gene-308.15:360:480:Parent=augustus_masked-Fvb3-2-processed-gene-308.15-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-308.15:360-480||RAPiDGENOMICS_rs1205_01383
CTGAGCGGTTTTTCAAATTGTTCATCAAACAGAATGGAGTCACTAGAATTATCAAATTGTGGGCTGGAAGGGGCATTGCCTAGTTCATTAGGATTGCTGAAAAGCCTCCAGCATCTTGAC
>augustus_masked-Fvb3-2-processed-gene-308.15:600:720:Parent=augustus_masked-Fvb3-2-processed-gene-308.15-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-308.15:600-720||RAPiDGENOMICS_rs1205_01384
AATCTCACAAGATTAAAGTATATAGGTTTGACCACAGAACGACCTGTGCCTATCATTTTCAACTTGACCGATTATGAATGGATTCCTCCTTTCAAGCTCCGGTCACTTTTCATGGACAAC
>augustus_masked-Fvb3-2-processed-gene-308.15:840:960:Parent=augustus_masked-Fvb3-2-processed-gene-308.15-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-308.15:840-960||RAPiDGENOMICS_rs1205_01385
TCCCAAATCCAAAGTTTGGATTTATCCAACAATCAAATAAGCGGAAAGCTTCCCCTCCAATTCAACTTTCCAGATCTGAACGAGATATATTTCAGCCACAATCAATTTGATGGAACTATT
>augustus_masked-Fvb3-2-processed-gene-308.15:960:1080:Parent=augustus_masked-Fvb3-2-processed-gene-308.15-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-308.15:960-1080||RAPiDGENOMICS_rs1205_01386
CCATCATCTATTTGCAGCATTCAATCTCTATCTTCCCTTGCTCTGAATAACAATCAGTTAATCGGAGAATTCCCTAAAGAATGGAGTTTGTGGAGCCGCATAGGCTTTGTGGATGTCTCA
>augustus_masked-Fvb3-2-processed-gene-309.4:1019:1139:Parent=augustus_masked-Fvb3-2-processed-gene-309.4-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-309.4:1019-1139|2x||RAPiDGENOMICS_rs1205_01387
AGGGGCATTGCCTAGTTCATTAGGATTGCTGAAAAGCCTCCAGCATCTTGACTTGGGTGGTAATCTTTTCAATGGTTCCATTCCTGAAAGTTTGGGACAACTCAGTCAGCTCGTTAGGCT
>augustus_masked-Fvb3-2-processed-gene-309.4:1079:1199:Parent=augustus_masked-Fvb3-2-processed-gene-309.4-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-309.4:1079-1199||RAPiDGENOMICS_rs1205_01388
TAATCTTTTCAATGGTTCCATTCCTGAAAGTTTGGGACAACTCAGTCAGCTCGTTAGGCTTGATCTGTCTTATAATTCATGGGAAGGCAGTTTAAGGGAAGCCCATTTCATAAATCTCAC
>augustus_masked-Fvb3-2-processed-gene-309.4:1139:1259:Parent=augustus_masked-Fvb3-2-processed-gene-309.4-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-309.4:1139-1259|2x||RAPiDGENOMICS_rs1205_01389
TGATCTGTCTTATAATTCATGGGAAGGCAGTTTAAGGGAAGCCCATTTCATAAATCTCACAAGATTAAAGTATATAGGTTTGACCACAGAACGACCTGTGCCTATCATTTTCAACTTGAC
>augustus_masked-Fvb3-2-processed-gene-309.4:1319:1439:Parent=augustus_masked-Fvb3-2-processed-gene-309.4-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-309.4:1319-1439||RAPiDGENOMICS_rs1205_01390
AGGCCCTGGTTTTCCTGTATGGCTTCAATCGCAAACCGAGCTCTCATATGTCCGAGTTTCGAATGCTGGAATCTCAGGTGCAATACCAGAAGGATGGATGTCTAATATCTCTTCCCAAAT
>augustus_masked-Fvb3-2-processed-gene-309.4:1679:1799:Parent=augustus_masked-Fvb3-2-processed-gene-309.4-mRNA-1_12::augustus_masked-Fvb3-2-processed-gene-309.4:1679-1799||RAPiDGENOMICS_rs1205_01391
TCTGACTGGTGAAATTCCCAGATCGATGGGCATTCCAAGTTCTCTTTATATATTAAAGATGAACAACAATCAGTTAAGCGGAGAAATTCCTTCCGCCTTGCAAAATTGCTCAAATTTGCT
>augustus_masked-Fvb3-2-processed-gene-309.4:180:300:Parent=augustus_masked-Fvb3-2-processed-gene-309.4-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-309.4:180-300|2x||RAPiDGENOMICS_rs1205_01392
TCTTGGGTTGGTCATCAATGCTGTGAATGGAGAGGGATTTCGTGCAACAACCACACAGGTCGTATTGTCAGGCTAGATCTTCGTAATCCATATCCATATCCATCTCTATATCTATCTAGT
>augustus_masked-Fvb3-2-processed-gene-309.4:2399:2519:Parent=augustus_masked-Fvb3-2-processed-gene-309.4-mRNA-1_18::augustus_masked-Fvb3-2-processed-gene-309.4:2399-2519||RAPiDGENOMICS_rs1205_01393
TCAGACGCTCCTTGATCCATCTATTTATGAGGGCAATTCACTTTGTGGATTTCCCCTTCCAAAATGCCCAGAAGACGAAGACAACATGCATGAGCCTGATGTACAAGAGAAAAAAGATCA
>augustus_masked-Fvb3-2-processed-gene-309.4:2637:2757:Parent=augustus_masked-Fvb3-2-processed-gene-309.4-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-309.4:2637-2757||RAPiDGENOMICS_rs1205_01394
CTCCTCGTTGGTGCCGGCACGATCCATTGGCAGAGGAAGGATCACATTGAAGAGAGGAAAAGCTTTCGACCAACTCCATCGACTGGGTCCACCGAAGTTGCCAAAAAAGTTGGGGAGGGT
>augustus_masked-Fvb3-2-processed-gene-309.4:359:479:Parent=augustus_masked-Fvb3-2-processed-gene-309.4-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-309.4:359-479||RAPiDGENOMICS_rs1205_01395
GTATCTCAATCTTTCATATTCTTCGTGGTCTGGTTCATATGTGGGAGAGATTCCACCATCTCTTGGTAACCTCTCAAACTTGAACTATCTTGACCTCAGTGTTGCTGATGACTTCAGTGA
>augustus_masked-Fvb3-2-processed-gene-309.4:479:599:Parent=augustus_masked-Fvb3-2-processed-gene-309.4-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-309.4:479-599||RAPiDGENOMICS_rs1205_01396
TGTTTATTCCAAAAGCTTGAATTGGCTTTCTCATCTCTCTTTCCTGAAATACCTAAACCTCGGAGGTGCGAACCTTAACAACACCGGAGTAAGTTGGCTGCATGCTGTTAACATGCTTCC
>augustus_masked-Fvb3-2-processed-gene-309.4:779:899:Parent=augustus_masked-Fvb3-2-processed-gene-309.4-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-309.4:779-899|2x||RAPiDGENOMICS_rs1205_01397
TAATCCTTTCCTTCGCCCCTCTCTTGATGAATTCGTAAGACTAAAAGCTGTAGAACACCTTGACTTATGGGGCATTGGACTCAAAGGTCAATTACTTCCGTTTGTAAATATATGCAAGCT
>augustus_masked-Fvb3-2-processed-gene-309.8:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-309.8:0-120||RAPiDGENOMICS_rs1205_01398
ATGGCCTCCTCCTCTTCATCATCGTCAACTCGCAGCTGGAAGTATGATGTCTTTTTGAGTTTCAGGGGTACTGACACTCGCAAAGGGATTGCAAACGAGATCTGCAATCGACTTAGTAGT
>augustus_masked-Fvb3-2-processed-gene-309.8:1022:1142:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-309.8:1022-1142|2x||RAPiDGENOMICS_rs1205_01399
GATCAGCCTCAAAGTTCTCTCAGATCAAGATTCTTGGACCTTGTTCGTGAGAAATGCAGGAACAATTTCTTTCAAGTCCACTTCGTTTAAGGAAGTGGCAAGGAGGGTAGCTTCAGAGTG
>augustus_masked-Fvb3-2-processed-gene-309.8:1082:1202:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-309.8:1082-1202||RAPiDGENOMICS_rs1205_01400
AACAATTTCTTTCAAGTCCACTTCGTTTAAGGAAGTGGCAAGGAGGGTAGCTTCAGAGTGTAAGGGTCTACCGATTGCATTGATAGCTGTTGCAAGGGCACTCGGAGATGAGGACCAGGA
>augustus_masked-Fvb3-2-processed-gene-309.8:120:240:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-309.8:120-240||RAPiDGENOMICS_rs1205_01401
AGAGGAATCAAAACGTTCATGGATGAGCAAGGACTTGAAGTAGGGGATGTTATTTCTCCCGCACTCATAAAGGCAATTAAAGAGTCAAGGTTTGCAATGGTAATTCTCTCGAAAAATTAC
>augustus_masked-Fvb3-2-processed-gene-309.8:1202:1322:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-309.8:1202-1322||RAPiDGENOMICS_rs1205_01402
GGAATGGGAGAAGGCAGCTGAACGACTAGAGCAGTCGCAATATGTCAATCCTAACCATGAGGAAGATGCATTCCGATGTATAAGATTAAGCTATGATTACTTGAAAAATGAAGATCACAA
>augustus_masked-Fvb3-2-processed-gene-309.8:1442:1562:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-309.8:1442-1562||RAPiDGENOMICS_rs1205_01403
AGGTAGATTAGTTACAGTGGTCAAGTACCTGAAAAATTGTAGCTTGCTTTTGGATAGCCGGAAAAAAGGATGTGTAAAGATGCATGATGTCATCCGAGATACAGCCATTCAAATTGCCGA
>augustus_masked-Fvb3-2-processed-gene-309.8:1562:1682:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_10::augustus_masked-Fvb3-2-processed-gene-309.8:1562-1682||RAPiDGENOMICS_rs1205_01404
ATCTGAAGATGGGCATCGGTTTTTGGTGGAAGCTGGTCGTGGTTTAAAGGGTTGGCTGCCACGAGGATTACATGAAGGCTGCACTGCTATTTCACTGATGTGGAATGAAATTCGCAAGCT
>augustus_masked-Fvb3-2-processed-gene-309.8:1622:1742:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_10::augustus_masked-Fvb3-2-processed-gene-309.8:1622-1742|2x||RAPiDGENOMICS_rs1205_01405
ACGAGGATTACATGAAGGCTGCACTGCTATTTCACTGATGTGGAATGAAATTCGCAAGCTACCTGAAGAAGAGCTGGTATGTCCAAATCTCCAGATTTTATTACTAAACAGGAATTATGA
>augustus_masked-Fvb3-2-processed-gene-309.8:1922:2042:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_13::augustus_masked-Fvb3-2-processed-gene-309.8:1922-2042||RAPiDGENOMICS_rs1205_01406
GCTTGAAATTCTTAGTATGAGAGGTTGTCCCAGGGAGAAATTGTCTAGAGAAATAGGACATTTGACCAATCTAAGGATTTTGGACGTCAATCGCTTTAAGTTACTATTCGCAAGGAGAGT
>augustus_masked-Fvb3-2-processed-gene-309.8:2042:2162:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_14::augustus_masked-Fvb3-2-processed-gene-309.8:2042-2162||RAPiDGENOMICS_rs1205_01407
AGGAATGGTTACAATTCCACCTAAAGTGATATCGAAGTTGCAAGAATTAGAAGAATTGTACATGCTGTACTGTGGATTTGAGGAACCAGAAGAAAAAACCAATATTATTATGTTTGATGA
>augustus_masked-Fvb3-2-processed-gene-309.8:2162:2282:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_15::augustus_masked-Fvb3-2-processed-gene-309.8:2162-2282||RAPiDGENOMICS_rs1205_01408
GTTAGCTGGTTTATCAAATTTGAAAATATTGCAGGTTGGCTTATCTGATGAAAGTTTCATCCGTAAAAATGTTGAGGTCGCACCGGATTGGGATTACTTTTGTATAACTATCAACGGCAG
>augustus_masked-Fvb3-2-processed-gene-309.8:2282:2402:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_16::augustus_masked-Fvb3-2-processed-gene-309.8:2282-2402||RAPiDGENOMICS_rs1205_01409
AAGCTCCAGCTACACTCCATTCGAACATGGAGATCGTAATTCAAGATCCTTGTTTCTTAATGGAGCAACCATCAGTACCTTGCCTGATTGGTTTATCAAAGCGGTGACAGAGAAAACAGA
>augustus_masked-Fvb3-2-processed-gene-309.8:2402:2522:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_17::augustus_masked-Fvb3-2-processed-gene-309.8:2402-2522||RAPiDGENOMICS_rs1205_01410
GAAGCTACAGTATGACCGCTGTAGAGGAATGAGTGACATTGTTATGGAATATGACCATGGGAGGTTACATAAACTCAAGCATCTCACAGTTAAAACTTCTCCTCACTTGAAAGAATTGAT
>augustus_masked-Fvb3-2-processed-gene-309.8:2642:2762:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_19::augustus_masked-Fvb3-2-processed-gene-309.8:2642-2762||RAPiDGENOMICS_rs1205_01411
AAATCTCAAGCTGTTTCAGGTGTTTTATACTCCGAATTTGAGGAGTGTATCAGAATTTGTACAGAGACTACCAAATCTGGAGAAACTAGATTTAAACTGGATGAACAAATTGGAATATGT
>augustus_masked-Fvb3-2-processed-gene-309.8:2762:2882:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_20::augustus_masked-Fvb3-2-processed-gene-309.8:2762-2882||RAPiDGENOMICS_rs1205_01412
GTTCAGATGCGAAGGGTTCGAGCCAGAACAGTCAAAACTGAGCGAGATGCATTTGTTGTTTCAAGTAGCACTAAGAAGCATATGTAGTGGTCCTGCCCCACGTGCAATGTTCCAAAGTCT
>augustus_masked-Fvb3-2-processed-gene-309.8:2882:3002:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_21::augustus_masked-Fvb3-2-processed-gene-309.8:2882-3002||RAPiDGENOMICS_rs1205_01413
TAAAATTTTGACCATTTCCACGTGCCTGCGGCTGCAAAGTCTGTTCGCATCTGATGTAGCTCAGTGTCTTGTTCAATTGGAAGACCTTCTTGTAGAGAGTTGCCATTTGTTGGAAAGAGT
>augustus_masked-Fvb3-2-processed-gene-309.8:360:480:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-309.8:360-480||RAPiDGENOMICS_rs1205_01414
TTCAAAGAAGCTTTCTCTAAGCACGATACCTCTAAGCGACATGAATCAGAGAAGGTGGAGCAATGGAGAGCTGCTCTAGAAAAAGTGGCCAATATCTCAGGGTGGAATACAAATGATTTC
>augustus_masked-Fvb3-2-processed-gene-309.8:782:902:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-309.8:782-902|2x||RAPiDGENOMICS_rs1205_01415
ATTGGCAGATCTGCTGGGCTTCGAATTAAAAGAGAAGACAGAAGCTGGAAGAGCAGCTATGTTGCATAAGGAGATCATGAGAAAAGAAAAACTCCTGATAATTGTGGACGATGTCTGGGA
>augustus_masked-Fvb3-2-processed-gene-309.8:902:1022:Parent=augustus_masked-Fvb3-2-processed-gene-309.8-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-309.8:902-1022|2x||RAPiDGENOMICS_rs1205_01416
GAGAACAGACTTGTCAAAGATAGGGATTCCCACCTACAATGAGCTTCAAAAGTGCAAGTCCAAAGTGCTACTCACCACCAGGAGATTGAATGTCTGTAATGCCATGAAGTGCCATGAAAA
>augustus_masked-Fvb3-2-processed-gene-40.17:1741:1861:Parent=augustus_masked-Fvb3-2-processed-gene-40.17-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-40.17:1741-1861||RAPiDGENOMICS_rs1205_01417
ATACAGGTTCACCACTAGAAGTCAGTGGTCACCATCGATGGGTACTTTCTGTTGCTCTTGGCATTAGTTGTACATTTGTTATTTCTGTGATGCTGCTTGTTTGTTGGGTGCATTGGTACA
>augustus_masked-Fvb3-2-processed-gene-40.17:1888:2008:Parent=augustus_masked-Fvb3-2-processed-gene-40.17-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-40.17:1888-2008||RAPiDGENOMICS_rs1205_01418
TGCAGCAAGATTATGAATTAGATATAAGTCATCTGAAGAGGTTTTCCTATCGTGAATTGCAACTTGCAACAAGCAATTTTAGTTCCAAGAACATCCTAGGACAAGGTGGATATGGAGTTG
>augustus_masked-Fvb3-2-processed-gene-40.17:2008:2128:Parent=augustus_masked-Fvb3-2-processed-gene-40.17-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-40.17:2008-2128||RAPiDGENOMICS_rs1205_01419
TTTATAAAGGATGTCTTCCTAATAGAACACTGGTGGCAGTTAAGAGACTTAGAGATCCAAATTTCACTGGAGAAGTTCAGTTCCAAACTGAAGTTGAAATGATAGGCTTGGCTTTGCATC
>augustus_masked-Fvb3-2-processed-gene-40.17:2227:2347:Parent=augustus_masked-Fvb3-2-processed-gene-40.17-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-40.17:2227-2347||RAPiDGENOMICS_rs1205_01420
AGACATGTCGAGATAGACCATCATTGGATTGGAACAGAAGACTGTGTATCGCCCTTGGGGCTGCCCGTGGACTTGTATACTTGCACGAACAGTGTAATCCAAAAATTATTCACAGGGATG
>augustus_masked-Fvb3-2-processed-gene-40.17:2467:2587:Parent=augustus_masked-Fvb3-2-processed-gene-40.17-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-40.17:2467-2587||RAPiDGENOMICS_rs1205_01421
GACACATAGCTCCGGAGTATCTATCCACAGGACAGTCTTCTGAAAAGACTGATGTTTTTGGATTCGGGATACTGCTTCTTGAGCTCATAACAGGACAGAAGGCATTAGATGCTGGAAATG
>augustus_masked-Fvb3-2-processed-gene-40.17:2624:2744:Parent=augustus_masked-Fvb3-2-processed-gene-40.17-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-40.17:2624-2744||RAPiDGENOMICS_rs1205_01422
GCATCGTCCATCTGGTGTATTCATAAGCTGCATGAATATAGTTTTTCCCTTGCACAAGAATCCATTTGTTTACTGTTTTCTATTGTGGGATCAAGTTTTGCCTCTTGTCGACATGCAGGT
>augustus_masked-Fvb3-2-processed-gene-40.17:264:384:Parent=augustus_masked-Fvb3-2-processed-gene-40.17-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-40.17:264-384||RAPiDGENOMICS_rs1205_01423
GCGAAATGCTTGGAAACTGGTGAGACTGTGGCCATAAAGAAGGTTTTACAGGACAGAAGGTATAAGAACAGGGAACTTCAATTGATGCGCGTAATGGATCATCCAAATGTGATTTGTTTG
>augustus_masked-Fvb3-2-processed-gene-40.17:384:504:Parent=augustus_masked-Fvb3-2-processed-gene-40.17-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-40.17:384-504||RAPiDGENOMICS_rs1205_01424
AAGCATTGTTTCTTCTCTACAACAAGCAAAAATGAGCTTTTTCTCAATTTGGTTATGGAATATGTTCCGGAGACCATGTATCGGGTTATAAAGCATTACAGCAATGCAAACCAGAGAATG
>augustus_masked-Fvb3-2-processed-gene-40.9:720:840:Parent=augustus_masked-Fvb3-2-processed-gene-40.9-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-40.9:720-840||RAPiDGENOMICS_rs1205_01425
AATCTTTCGTCTAACACACTCGATGGCGAGATACCCACTTCGTTTGGGGACCTCATTTCCCTCACAAACGTTTCTCTAGCTTCGAATTCATTATCCGGGCCGATACCCGAGTCCATTTCA
>augustus_masked-Fvb3-2-processed-gene-54.1:1913:2033:Parent=augustus_masked-Fvb3-2-processed-gene-54.1-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-54.1:1913-2033|2x||RAPiDGENOMICS_rs1205_01426
GATGTTTCTACCTCGTCTTTCTGAGAGTATCAAGTACTTGAATCTTTCCCACAACCAGCTTACGGGGTCATTGGTGGGTGGCAGCGAGCTTCAGATATTTGAGAACCTGAAGGTGTTGGA
>augustus_masked-Fvb3-2-processed-gene-54.1:2033:2153:Parent=augustus_masked-Fvb3-2-processed-gene-54.1-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-54.1:2033-2153|2x||RAPiDGENOMICS_rs1205_01427
TCTTAGCTACAACCAGCTGTCTGGAGAATTACCTGGATTTAATTTTGTATATGACCTCCAGGTCCTCAAACTTAGCAACAACAGATTTACTGGAGTTGTTCCCAATGGCCTAATAAAAGG
>augustus_masked-Fvb3-2-processed-gene-54.1:2263:2383:Parent=augustus_masked-Fvb3-2-processed-gene-54.1-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-54.1:2263-2383|2x||RAPiDGENOMICS_rs1205_01428
TTACTGGTAAGTTGCCTTTGCTGACTGGAAGTTGTGCTGTACTTGATCTATCCAAGAACAAATTCGAAGGAAATTTAACCAGGATGGTGAAATGGGGGAACATTGAATACCTTGATCTAA
>augustus_masked-Fvb3-2-processed-gene-54.1:2323:2443:Parent=augustus_masked-Fvb3-2-processed-gene-54.1-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-54.1:2323-2443||RAPiDGENOMICS_rs1205_01429
AATTCGAAGGAAATTTAACCAGGATGGTGAAATGGGGGAACATTGAATACCTTGATCTAAGTCAAAATCTTCTGACAGGACCCTTCCCTGATGTCACTCCGCAGTTTTTGCGTTTAAATT
>augustus_masked-Fvb3-2-processed-gene-54.1:3523:3643:Parent=augustus_masked-Fvb3-2-processed-gene-54.1-mRNA-1_12::augustus_masked-Fvb3-2-processed-gene-54.1:3523-3643||RAPiDGENOMICS_rs1205_01430
GCACTTCTTATAAGGCAACACTTGATAACGGGCTGTTCTTGACAGTTAAGTGGTTGAGAGAAGGGGTGGCAAAGCAGAAAAAGGAGTTTGCCAAGGAGGCTAAGAAATTTGCGAATATGA
>augustus_masked-Fvb3-2-processed-gene-54.1:3994:4114:Parent=augustus_masked-Fvb3-2-processed-gene-54.1-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-54.1:3994-4114||RAPiDGENOMICS_rs1205_01431
GCTACCGCGCCCCAGAGCTGGCTGCTTCCAAGAAGCCACTGCCCTCCTTCAAGTCTGATGTTTATGCCTTTGGAGTGATATTGTTGGAACTTTTAACTGGAAGGTGCGCTGGTGATGTGA
>augustus_masked-Fvb3-2-processed-gene-54.1:4731:4851:Parent=augustus_masked-Fvb3-2-processed-gene-54.1-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-54.1:4731-4851||RAPiDGENOMICS_rs1205_01432
CTTAGTATTGATGAAGAGATGACATGTGTCAAGGTTGCTGGATCAGAGGAAGCTTATATGGCGGCTAAACCCTTGTTCCTTTCCATGGGGAAGAACACAGTTTATTGTGGTGGAGCAGGA
>augustus_masked-Fvb3-2-processed-gene-54.1:87:207:Parent=augustus_masked-Fvb3-2-processed-gene-54.1-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-54.1:87-207||RAPiDGENOMICS_rs1205_01433
GTTGGATTGCCCAATGTTGGGAAATCTACTCTTTTCAACACTCTGACGAAGCTTTCGATACCGGCTGAGAACTTCCCTTTCTGCACAATTGAACCCAATGAAGCCAGGGTCAACATTCCT
>augustus_masked-Fvb3-2-processed-gene-68.4:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-68.4:0-120||RAPiDGENOMICS_rs1205_01434
ATGGGAAAATATATCCTCTTTCTGTTGTTGCTCATTACTAGTGAACTTTGTTTGGGTGATGAACTTCCAGGCGATGTGAAATGCATTGACGAAGAGAGACAAGTGCTTCTCACCTTTAAA
>augustus_masked-Fvb3-2-processed-gene-68.4:1080:1200:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_10::augustus_masked-Fvb3-2-processed-gene-68.4:1080-1200||RAPiDGENOMICS_rs1205_01435
TTGCTGGAAAGCGAATTACCTGCCTCCATAGGAAAGTTACAGAAATTGCAATATCTCAGCATCGCGTTCAACTACTTCTTTGGATCAATTCCAGAATCTATTGGAAACTTATCATCCTTG
>augustus_masked-Fvb3-2-processed-gene-68.4:1392:1512:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-68.4:1392-1512||RAPiDGENOMICS_rs1205_01436
TTTGTCGTCTGGCTTCAATCACAAACTGAATTGTTAAATGTCATACTTAGTGGTACTGGAATTTCGAGCATACCAGAGGACTGGTTGTTGAAGATATCATCCCAAGTTGAGCGTTTGGAT
>augustus_masked-Fvb3-2-processed-gene-68.4:1512:1632:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-68.4:1512-1632||RAPiDGENOMICS_rs1205_01437
TTTTCCAACAATCAAATCCAAGGAAAGCTTCCATTTCAATCCAAGTTTCCAAAATTGCTTATACTAGATTGGAGTCGCAATCGATTTTGCAAGTCTATTCCCTTAAATTTTGGACAACTA
>augustus_masked-Fvb3-2-processed-gene-68.4:1632:1752:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-68.4:1632-1752||RAPiDGENOMICS_rs1205_01438
ATGCCAAATCTACGGGAGTTGGTACTGTCTGATAATCATTTAGATGTTACAATTCCACCCTCTATTTGTGAAATTCCACATATTTTGATCCTTTCTCTAAGAAACAATCAGCTATCTGGA
>augustus_masked-Fvb3-2-processed-gene-68.4:180:300:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-68.4:180-300|2x||RAPiDGENOMICS_rs1205_01439
TGGAATGGTCTTTCATGCGACAACCACACTGGCCACATTGTAAAGATGGATCTCCGGAACCCATATCCATACACAGCTTTCAATGAAGAGTGGGATTCCATGGACTACCAACAGTCTTGC
>augustus_masked-Fvb3-2-processed-gene-68.4:1992:2112:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-68.4:1992-2112||RAPiDGENOMICS_rs1205_01440
GTCAAGTCTGTTGGGAAGTTTAAGGAAACAAAACGAACTGCTGGTATCTCTACATCTGATATCATAATGAGGATTGTCAAAGATTACAACCAGTATGTGATGCGCAATTTGGACCGTGGG
>augustus_masked-Fvb3-2-processed-gene-68.4:240:360:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-68.4:240-360||RAPiDGENOMICS_rs1205_01441
CCATATCCATACACAGCTTTCAATGAAGAGTGGGATTCCATGGACTACCAACAGTCTTGCTTGAGTGATAAGATAAATCCTTCTTTGCTTAGCTTAAAGCAATTATATTACTTAGACCTA
>augustus_masked-Fvb3-2-processed-gene-68.4:300:420:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-68.4:300-420|2x||RAPiDGENOMICS_rs1205_01442
TTGAGTGATAAGATAAATCCTTCTTTGCTTAGCTTAAAGCAATTATATTACTTAGACCTAACCTGGAATGATTTTCAAGGGATTCAAATTCCCAACTTCTTTGGCCGGCTTACGAGCTTG
>augustus_masked-Fvb3-2-processed-gene-68.4:600:720:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-68.4:600-720||RAPiDGENOMICS_rs1205_01443
CTCGGAGGAGTTGACCTTGGGTGGGCAGGAGTCAGTTGGTTACATACTGTCAACATGCTTCCCTCATTACTAGAGTTGCATTTATCTGCATGTGGCATTGATTCAAACCAGCTTCCACTC
>augustus_masked-Fvb3-2-processed-gene-68.4:660:780:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-68.4:660-780|2x||RAPiDGENOMICS_rs1205_01444
CCCTCATTACTAGAGTTGCATTTATCTGCATGTGGCATTGATTCAAACCAGCTTCCACTCTCTTTACCGACCCTTAACTTCACATCCCTTTCAGTCCTTGATATGTCTGCAAATTATTTC
>augustus_masked-Fvb3-2-processed-gene-68.4:720:840:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-68.4:720-840||RAPiDGENOMICS_rs1205_01445
TCTTTACCGACCCTTAACTTCACATCCCTTTCAGTCCTTGATATGTCTGCAAATTATTTCAATTCTTCGATTTCCGGCTGGTTTTCTAGTCTGACCAGTTTAAGGACACTTGATCTAAGC
>augustus_masked-Fvb3-2-processed-gene-68.4:780:900:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-68.4:780-900|2x||RAPiDGENOMICS_rs1205_01446
AATTCTTCGATTTCCGGCTGGTTTTCTAGTCTGACCAGTTTAAGGACACTTGATCTAAGCCACAATTCTTTCGTTGGTTCCATTCCTACTGAATTTGCTAGCTTCCGATATCTTGAACAC
>augustus_masked-Fvb3-2-processed-gene-68.4:840:960:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-68.4:840-960||RAPiDGENOMICS_rs1205_01447
CACAATTCTTTCGTTGGTTCCATTCCTACTGAATTTGCTAGCTTCCGATATCTTGAACACCTTGATTTATCAGCTAATCAACTTCAAGGTCAAATTCCTGAACTCATTGGGAACTTTTGT
>augustus_masked-Fvb3-2-processed-gene-68.4:900:1020:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-68.4:900-1020|2x||RAPiDGENOMICS_rs1205_01448
CTTGATTTATCAGCTAATCAACTTCAAGGTCAAATTCCTGAACTCATTGGGAACTTTTGTTCCCTAAAGACATTAAATCTTGCTGATAACTTGTTTGAGAAGGAAGGTATTCGAGATGTT
>augustus_masked-Fvb3-2-processed-gene-68.4:960:1080:Parent=augustus_masked-Fvb3-2-processed-gene-68.4-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-68.4:960-1080||RAPiDGENOMICS_rs1205_01449
TCCCTAAAGACATTAAATCTTGCTGATAACTTGTTTGAGAAGGAAGGTATTCGAGATGTTTTGAATGGTCTCGCAGACTGTTCAAATACCAGACTAGAGTTACTAGATTTGTCTCTCAAT
>augustus_masked-Fvb3-2-processed-gene-68.9:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-68.9-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-68.9:0-120||RAPiDGENOMICS_rs1205_01450
ATGGCTCAATATAACGAGAAAATGGATCGGCCAAAGAAGGAAATGGAAGCTTTAGAAGGAGTTATGAAGAAGGGCCAAGAGCTCGTCATCAAGTGCTCAAAGATTAGGGGGTGGAACCCC
>augustus_masked-Fvb3-2-processed-gene-68.9:120:240:Parent=augustus_masked-Fvb3-2-processed-gene-68.9-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-68.9:120-240||RAPiDGENOMICS_rs1205_01451
TTCAGAAAGTTCAAGTATGCCAAGCAACTTCTCGAATGGGACGAATCTCTTAAAAGGCCCTTGGAGAATCTCCAACTGCAAGAAGCAATGCATATAATGAAGATGGGGGTCGCGGTTGAT
>augustus_masked-Fvb3-2-processed-gene-68.9:180:300:Parent=augustus_masked-Fvb3-2-processed-gene-68.9-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-68.9:180-300|2x||RAPiDGENOMICS_rs1205_01452
TTGGAGAATCTCCAACTGCAAGAAGCAATGCATATAATGAAGATGGGGGTCGCGGTTGATGATATGCATCGCGTGATAATGAAACAAAAATCTGGAGAAAGTTCAAGTTGTAGTACACGA
>augustus_masked-Fvb3-2-processed-gene-68.9:240:360:Parent=augustus_masked-Fvb3-2-processed-gene-68.9-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-68.9:240-360||RAPiDGENOMICS_rs1205_01453
GATATGCATCGCGTGATAATGAAACAAAAATCTGGAGAAAGTTCAAGTTGTAGTACACGACTTGAACTTCCACCGCTTGTAGTTGGAATGGATGCTCCTCTGAAGGACTTTGAAAGAAAA
>augustus_masked-Fvb3-2-processed-gene-68.9:60:180:Parent=augustus_masked-Fvb3-2-processed-gene-68.9-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-68.9:60-180|2x||RAPiDGENOMICS_rs1205_01454
GTTATGAAGAAGGGCCAAGAGCTCGTCATCAAGTGCTCAAAGATTAGGGGGTGGAACCCCTTCAGAAAGTTCAAGTATGCCAAGCAACTTCTCGAATGGGACGAATCTCTTAAAAGGCCC
>augustus_masked-Fvb3-2-processed-gene-73.8:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-73.8-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-73.8:0-120||RAPiDGENOMICS_rs1205_01455
ATGTCACATTTGAGATTCCTTATTTTAAGAAGCAATCACTTGTCTGGAGAATTCCCTCGAGCATGGAGTCTGTGGCCAGGTATAGAGGTTGTAGACCTCTCAAACAACAATTTGACCGGC
>augustus_masked-Fvb3-2-processed-gene-73.8:120:240:Parent=augustus_masked-Fvb3-2-processed-gene-73.8-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-73.8:120-240||RAPiDGENOMICS_rs1205_01456
AATATCACCAGTTCAATGGGTGTCCCCAGCTCACTATGGGTATTGAATCTGAGCAACAACAATTTCACGGGTCAAATTCCTTCTTCTCTTTTACAAGACTGCACAGAGTTGGTGAGTATT
>augustus_masked-Fvb3-2-processed-gene-73.8:180:300:Parent=augustus_masked-Fvb3-2-processed-gene-73.8-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-73.8:180-300|2x||RAPiDGENOMICS_rs1205_01457
AATTTCACGGGTCAAATTCCTTCTTCTCTTTTACAAGACTGCACAGAGTTGGTGAGTATTGATCTTGCAGGCAATAAATTCACAGGAGGCATACCTCTACAGGCTAGATCACCTGTGTCA
>augustus_masked-Fvb3-2-processed-gene-73.8:240:360:Parent=augustus_masked-Fvb3-2-processed-gene-73.8-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-73.8:240-360||RAPiDGENOMICS_rs1205_01458
GATCTTGCAGGCAATAAATTCACAGGAGGCATACCTCTACAGGCTAGATCACCTGTGTCATCCAACTTACGTAGGCTCCAATTGCGATCGAACTCTTTAAGCGGACATATACCCAATCAA
>augustus_masked-Fvb3-2-processed-gene-73.8:300:420:Parent=augustus_masked-Fvb3-2-processed-gene-73.8-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-73.8:300-420|2x||RAPiDGENOMICS_rs1205_01459
TCCAACTTACGTAGGCTCCAATTGCGATCGAACTCTTTAAGCGGACATATACCCAATCAATTGTGCTCTCTTCAATCTCTACATGTCATTGACCTTAGCCGTAACACCTTTTCAGGGACC
>augustus_masked-Fvb3-2-processed-gene-73.8:480:600:Parent=augustus_masked-Fvb3-2-processed-gene-73.8-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-73.8:480-600||RAPiDGENOMICS_rs1205_01460
GATGGCTCTATTGCCCTTTTGTCTGATTATCATCAGACGACCAGGTTGACATTGAAGGGACAAGAACTGATATATAACAAGACTCTTGGTTTGGTGAATAGCATTGACTTCTCATCAAAT
>augustus_masked-Fvb3-2-processed-gene-73.8:540:660:Parent=augustus_masked-Fvb3-2-processed-gene-73.8-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-73.8:540-660|2x||RAPiDGENOMICS_rs1205_01461
CAAGAACTGATATATAACAAGACTCTTGGTTTGGTGAATAGCATTGACTTCTCATCAAATCACTTGGAAGGTGAAATCCCTGAAGGTATAAGCAGCCTCATTGCCTTGGGAACGTTGAAC
>augustus_masked-Fvb3-2-processed-gene-73.8:60:180:Parent=augustus_masked-Fvb3-2-processed-gene-73.8-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-73.8:60-180|2x||RAPiDGENOMICS_rs1205_01462
GCATGGAGTCTGTGGCCAGGTATAGAGGTTGTAGACCTCTCAAACAACAATTTGACCGGCAATATCACCAGTTCAATGGGTGTCCCCAGCTCACTATGGGTATTGAATCTGAGCAACAAC
>augustus_masked-Fvb3-2-processed-gene-73.8:600:720:Parent=augustus_masked-Fvb3-2-processed-gene-73.8-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-73.8:600-720||RAPiDGENOMICS_rs1205_01463
CACTTGGAAGGTGAAATCCCTGAAGGTATAAGCAGCCTCATTGCCTTGGGAACGTTGAACTTGTCCAGAAATCATTTGACCGGAAACATTCCCTCAGATATTGGAAACTTGCGGTGGCTG
>augustus_masked-Fvb3-2-processed-gene-73.8:660:780:Parent=augustus_masked-Fvb3-2-processed-gene-73.8-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-73.8:660-780|2x||RAPiDGENOMICS_rs1205_01464
TTGTCCAGAAATCATTTGACCGGAAACATTCCCTCAGATATTGGAAACTTGCGGTGGCTGGAAACCCTTGATCTTTCACACAATCACCTCTCCGGGCGGATTCCACAAAGTATCTCTTCA
>augustus_masked-Fvb3-2-processed-gene-74.0:1020:1140:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-74.0:1020-1140|2x||RAPiDGENOMICS_rs1205_01465
TTAGAGTCGCTTAAATTGTCCGAAAATATGTTGGAAGGTGAACTGCCTGCCGCCTTAGGAATGATAGAAAATCTTAAGAAACTCGACCTCCATTCAAACCAACTTTCTGGTCCAATTCCA
>augustus_masked-Fvb3-2-processed-gene-74.0:1080:1200:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_10::augustus_masked-Fvb3-2-processed-gene-74.0:1080-1200||RAPiDGENOMICS_rs1205_01466
ATGATAGAAAATCTTAAGAAACTCGACCTCCATTCAAACCAACTTTCTGGTCCAATTCCACAATCCATTGGTAATTTATCATCTTTGAAAACACTGAACATCTCTGATAATCATATGAAT
>augustus_masked-Fvb3-2-processed-gene-74.0:1140:1260:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_10::augustus_masked-Fvb3-2-processed-gene-74.0:1140-1260|2x||RAPiDGENOMICS_rs1205_01467
CAATCCATTGGTAATTTATCATCTTTGAAAACACTGAACATCTCTGATAATCATATGAATGGGTCCATTCCTGAAAGTTTGGGAGAACTCTCTCAGCTAGTTTTCCTAGATCTATCTTCG
>augustus_masked-Fvb3-2-processed-gene-74.0:1200:1320:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-74.0:1200-1320||RAPiDGENOMICS_rs1205_01468
GGGTCCATTCCTGAAAGTTTGGGAGAACTCTCTCAGCTAGTTTTCCTAGATCTATCTTCGAACTCGTGGGAAGGCAATCTAACTGAAGCCCATTTCCGAACTCTCACAAAGCTGAAGTCT
>augustus_masked-Fvb3-2-processed-gene-74.0:1260:1380:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-74.0:1260-1380|2x||RAPiDGENOMICS_rs1205_01469
AACTCGTGGGAAGGCAATCTAACTGAAGCCCATTTCCGAACTCTCACAAAGCTGAAGTCTTTTGCAGTCAGCACAGACCGACCTATGTCCCTCATTTTTAACGTGGCTCATGACTGGGTT
>augustus_masked-Fvb3-2-processed-gene-74.0:180:300:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-74.0:180-300|2x||RAPiDGENOMICS_rs1205_01470
AGACGAGCACTTCTCAGTTTCAAAGCAAATGTTTCTGATCCTTCCGGCAGGCTTTCATCTTGGGTGGGTCTGGATTGCTGTCGATGGAAAGGGATTTCATGCAGCAACCGTACAGGTCAC
>augustus_masked-Fvb3-2-processed-gene-74.0:240:360:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-74.0:240-360||RAPiDGENOMICS_rs1205_01471
TGGGTGGGTCTGGATTGCTGTCGATGGAAAGGGATTTCATGCAGCAACCGTACAGGTCACGTTGCAAAGATGGACCTCCCAAACCCGAATTACGATCAAGAGAATGGCTTCGATTTGGGG
>augustus_masked-Fvb3-2-processed-gene-74.0:300:420:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-74.0:300-420|2x||RAPiDGENOMICS_rs1205_01472
GTTGCAAAGATGGACCTCCCAAACCCGAATTACGATCAAGAGAATGGCTTCGATTTGGGGACTTCTTTGATGGGTCACATCAATCCTTCTTTGCTTAGCTTAAAGAAGTTGTATCACCTT
>augustus_masked-Fvb3-2-processed-gene-74.0:360:480:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-74.0:360-480||RAPiDGENOMICS_rs1205_01473
ACTTCTTTGATGGGTCACATCAATCCTTCTTTGCTTAGCTTAAAGAAGTTGTATCACCTTGACCTAAGCGGAAATGAATTTGGACTCCAAATTCCTAATTTCTTTGGGAAGCTTACAAGT
>augustus_masked-Fvb3-2-processed-gene-74.0:420:540:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-74.0:420-540|2x||RAPiDGENOMICS_rs1205_01474
GACCTAAGCGGAAATGAATTTGGACTCCAAATTCCTAATTTCTTTGGGAAGCTTACAAGTTTGAGGTATCTTAATCTCTCCTATATTTATTCTGCCGTAGAGATTCCCTCAACTCTTGGT
>augustus_masked-Fvb3-2-processed-gene-74.0:480:600:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-74.0:480-600||RAPiDGENOMICS_rs1205_01475
TTGAGGTATCTTAATCTCTCCTATATTTATTCTGCCGTAGAGATTCCCTCAACTCTTGGTAACCTCTCAAACTTGAACTACCTTGACCTCAAAGTTGATTATTTCAATGGTCTTTATTCC
>augustus_masked-Fvb3-2-processed-gene-74.0:60:180:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-74.0:60-180|2x||RAPiDGENOMICS_rs1205_01476
GTTGCTCACTACTTGCTCTTTCTTTTTCTGGCATCTTCATACCTGCACGGTACTTCTCAAGTGTGTTTGGGAGATGGACTTCCGAGTGGTGTGAGATCATCATCATGCATCGAGGAAGAG
>augustus_masked-Fvb3-2-processed-gene-74.0:600:720:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-74.0:600-720||RAPiDGENOMICS_rs1205_01477
GAAAACTTGAATTGGCTTTCTCATCTCTCTTCCCTGAAGTACCTCAATCTTGGAGGTTCGGACCTTAGCAGCACAGGACTAAGTTGGCTACATAATGTCAACATGCTTCCTTCACTCTTA
>augustus_masked-Fvb3-2-processed-gene-74.0:720:840:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-74.0:720-840||RAPiDGENOMICS_rs1205_01478
GAGTTGCATTTGTCTACGTGTGGAATTCAAATTCCACACTCCCCGCTGCGGTCAGTGAACTTCACATCCCTATTGGTTCTTGATATATCATCGAATGCTATCAATTCTTCATTTCCCAGC
>augustus_masked-Fvb3-2-processed-gene-74.0:840:960:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-74.0:840-960||RAPiDGENOMICS_rs1205_01479
TGGATTTTTAATCTTACCAACCTCAAAAAACTTGATGCATCTGGCAATTCTTTCCAAGGTCAAATTCCCAAAGTCTTTGGTAGATTCTGCAGCCTAAGGATATTAGATCTTTCTGATAAC
>augustus_masked-Fvb3-2-processed-gene-74.0:900:1020:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-74.0:900-1020|2x||RAPiDGENOMICS_rs1205_01480
CAAATTCCCAAAGTCTTTGGTAGATTCTGCAGCCTAAGGATATTAGATCTTTCTGATAACTCGTTCAGTGGTGGTTTGGAAGAGGTTTTGAATGACTTCTCAAACTGCACAAGTCACATA
>augustus_masked-Fvb3-2-processed-gene-74.0:960:1080:Parent=augustus_masked-Fvb3-2-processed-gene-74.0-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-74.0:960-1080||RAPiDGENOMICS_rs1205_01481
TCGTTCAGTGGTGGTTTGGAAGAGGTTTTGAATGACTTCTCAAACTGCACAAGTCACATATTAGAGTCGCTTAAATTGTCCGAAAATATGTTGGAAGGTGAACTGCCTGCCGCCTTAGGA
>augustus_masked-Fvb3-2-processed-gene-76.7:1271:1391:Parent=augustus_masked-Fvb3-2-processed-gene-76.7-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-76.7:1271-1391||RAPiDGENOMICS_rs1205_01482
CGAAGTACATTACTTGAATTTGAGCAACAACAAATTCAGCCAAGAAATTCCATTTCAATTGGGGAAATTAGTCCATTTGTCCGAGCTAGACTTGAGTCATAATTCACTTGAAGGTCAGAT
>augustus_masked-Fvb3-2-processed-gene-76.7:131:251:Parent=augustus_masked-Fvb3-2-processed-gene-76.7-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-76.7:131-251|2x||RAPiDGENOMICS_rs1205_01483
TCTTGATCTGTCTAGGAATCACTTTTCCGGTCATATTCCACCAGAAATTGGTCTTCTAAAAAATCTTGAGGTCCTTCACTTGAATGAAAACCAATTAAATGGCTTAATTCCTGACGAGAT
>augustus_masked-Fvb3-2-processed-gene-76.7:1391:1511:Parent=augustus_masked-Fvb3-2-processed-gene-76.7-mRNA-1_12::augustus_masked-Fvb3-2-processed-gene-76.7:1391-1511||RAPiDGENOMICS_rs1205_01484
ACCATCAGAAATGACCCAGATGCAGAGCTTGGAGATTCTGAATCTCTCCCACAATAATCTTTCCGGTTCAATACCCGAAAATTTTGAACAAATGCAAAGCTTGGTTCAGATCGACATATC
>augustus_masked-Fvb3-2-processed-gene-76.7:1511:1631:Parent=augustus_masked-Fvb3-2-processed-gene-76.7-mRNA-1_13::augustus_masked-Fvb3-2-processed-gene-76.7:1511-1631||RAPiDGENOMICS_rs1205_01485
CTACAACCAGTTGCAGGGTCCCGTCCCAAAAAACAAACCATTTCAAGATGCTGCTCATTTGGAAGGCAATGACGGATTGTGTGGCAATATTGCAGGACTTGAGCCCTGCCCCTCCCTGGA
>augustus_masked-Fvb3-2-processed-gene-76.7:1751:1871:Parent=augustus_masked-Fvb3-2-processed-gene-76.7-mRNA-1_15::augustus_masked-Fvb3-2-processed-gene-76.7:1751-1871||RAPiDGENOMICS_rs1205_01486
CAAAAGGCAGGACACAGAGCAAAGCAATGGGCAGTTGAAAGACGTTTTTTCCATATCTGAATTTGATGGAAGAAAAACTTACGACGAAATCATCAAGGCAACGAATGATTTTGATGACCT
>augustus_masked-Fvb3-2-processed-gene-76.7:1871:1991:Parent=augustus_masked-Fvb3-2-processed-gene-76.7-mRNA-1_16::augustus_masked-Fvb3-2-processed-gene-76.7:1871-1991||RAPiDGENOMICS_rs1205_01487
CTATTGCATTGGAAAGGGAGGATCCGGAAGTGTCTACAAGGCAAAGCTGCTATCAGGCAGCATAGTTGCCGTGAAGAAACTCGATTCAGTACTTGAGGGTGAGGAGTCGTCTCAGAAGGA
>augustus_masked-Fvb3-2-processed-gene-76.7:191:311:Parent=augustus_masked-Fvb3-2-processed-gene-76.7-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-76.7:191-311||RAPiDGENOMICS_rs1205_01488
AAATCTTGAGGTCCTTCACTTGAATGAAAACCAATTAAATGGCTTAATTCCTGACGAGATTAGTCACATTAAGTCTCTTTCTGAGCTTGCTCTGAGCCAGAACAGTCTAAAAGGTAGGAT
>augustus_masked-Fvb3-2-processed-gene-76.7:791:911:Parent=augustus_masked-Fvb3-2-processed-gene-76.7-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-76.7:791-911||RAPiDGENOMICS_rs1205_01489
AACCAACCAATTGACAGGTCCACTCCCCAAAAGCTTGAAAATGTGCAAGAGTTTAACAAGTTTGTCCCTTCCAAATAACCATTTGACAGGCAATGTATCTGAAGTATTTGGTGCCTATCC
>augustus_masked-Fvb3-2-processed-gene-76.7:911:1031:Parent=augustus_masked-Fvb3-2-processed-gene-76.7-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-76.7:911-1031||RAPiDGENOMICS_rs1205_01490
AAATCTTCGGTATGTGGATCTTAGCCACAACAACTTCTACGGGGAAATTTCACCCATGTGGGGACAATGTCCTCAGTTAACAACCCTGCGAATCGCAGGAAACATCCTTACTGGTAGCAT
>augustus_masked-Fvb3-2-processed-gene-78.3:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-78.3-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-78.3:0-120||RAPiDGENOMICS_rs1205_01491
ATGGGTAATTTGAGTGGTTTGAAAATATCTGTAGCCCCAGATAGCTATACAACATTTCTGTACCAGGAGAAATTTGGGATAGCTTCAGAAGGAAGAGTGCTTGAATACGGCACCATCTTT
>augustus_masked-Fvb3-2-processed-gene-78.3:120:240:Parent=augustus_masked-Fvb3-2-processed-gene-78.3-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-78.3:120-240||RAPiDGENOMICS_rs1205_01492
AACCCTGATAATATCCTAGACCTCTCAAACAATAACTTATCAGGCACAATTCCAAGCTCTGTTGGTTTGCTTACTTCACTCGGATTCTTGTTACTTTCAGGCAACACATTTTCAGGTGAA
>augustus_masked-Fvb3-2-processed-gene-78.3:240:360:Parent=augustus_masked-Fvb3-2-processed-gene-78.3-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-78.3:240-360||RAPiDGENOMICS_rs1205_01493
GTTCCTTCTTCCTTGAAGAACTTTACTGACATGAAGAGTCTTGATCTTGGTGACAATAAATTTTCTGGAAGAAATCCAACTTGGATCGGTGAAAGTATGCTATCTCTATGGATTTTACGC
>augustus_masked-Fvb3-2-processed-gene-78.3:300:420:Parent=augustus_masked-Fvb3-2-processed-gene-78.3-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-78.3:300-420|2x||RAPiDGENOMICS_rs1205_01494
TTTTCTGGAAGAAATCCAACTTGGATCGGTGAAAGTATGCTATCTCTATGGATTTTACGCCTGACAATGAACTCATTTAGTGGAAACATCCCTTCACAACTGTGTGGCCTTTCAACTCTT
>augustus_masked-Fvb3-2-processed-gene-78.3:475:595:Parent=augustus_masked-Fvb3-2-processed-gene-78.3-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-78.3:475-595||RAPiDGENOMICS_rs1205_01495
GAAAATTGCAGGCTGTGACTAAAGGAAGAGTGATTGAATATTATCCTCACTCTGTATACATTGTCAACAGTCTTGATCTCGCAAACAATTACCTATCAGGAGAAACGCCTGTGGAGCTGA
>augustus_masked-Fvb3-2-processed-gene-78.3:535:655:Parent=augustus_masked-Fvb3-2-processed-gene-78.3-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-78.3:535-655|2x||RAPiDGENOMICS_rs1205_01496
TTGTCAACAGTCTTGATCTCGCAAACAATTACCTATCAGGAGAAACGCCTGTGGAGCTGACAAGCCTTGTAAGGTTGGGAACCTTGAATTTGTCAAGGAATCACTTGACAGGAATTATCC
>augustus_masked-Fvb3-2-processed-gene-78.3:595:715:Parent=augustus_masked-Fvb3-2-processed-gene-78.3-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-78.3:595-715||RAPiDGENOMICS_rs1205_01497
CAAGCCTTGTAAGGTTGGGAACCTTGAATTTGTCAAGGAATCACTTGACAGGAATTATCCCAGCAAAGATTGGGAACTTGGAGTGGATAGAAACTCTTGATCTATCAATGAATCAACTTT
>augustus_masked-Fvb3-2-processed-gene-78.3:655:775:Parent=augustus_masked-Fvb3-2-processed-gene-78.3-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-78.3:655-775|2x||RAPiDGENOMICS_rs1205_01498
CAGCAAAGATTGGGAACTTGGAGTGGATAGAAACTCTTGATCTATCAATGAATCAACTTTCAGGTTCAATCCCACCAAGCATGGTTTCTTTGACATTTTTGAGTTGTCTCAATCTGTCAC
>augustus_masked-Fvb3-2-processed-gene-78.3:715:835:Parent=augustus_masked-Fvb3-2-processed-gene-78.3-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-78.3:715-835||RAPiDGENOMICS_rs1205_01499
CAGGTTCAATCCCACCAAGCATGGTTTCTTTGACATTTTTGAGTTGTCTCAATCTGTCACACAATCACTTGTCTGGAAAAGTCCCGACAGGTAGCCAGTTTAGCACTCTTGTTGATCCAT
>augustus_masked-Fvb3-2-processed-gene-78.3:775:895:Parent=augustus_masked-Fvb3-2-processed-gene-78.3-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-78.3:775-895|2x||RAPiDGENOMICS_rs1205_01500
ACAATCACTTGTCTGGAAAAGTCCCGACAGGTAGCCAGTTTAGCACTCTTGTTGATCCATCAATTTATGAAGGCAATGCTGCTCTTTGTAGGTCTCACGTTCCAAGTGAAGATGGACAAG
>augustus_masked-Fvb3-2-processed-gene-78.3:835:955:Parent=augustus_masked-Fvb3-2-processed-gene-78.3-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-78.3:835-955||RAPiDGENOMICS_rs1205_01501
CAATTTATGAAGGCAATGCTGCTCTTTGTAGGTCTCACGTTCCAAGTGAAGATGGACAAGACGATAGTGAACTCGAAAAGCTATGGATCATCAGCAGCATGGTAGCAGGTTTCATAGTAG
>augustus_masked-Fvb3-2-processed-gene-78.3:955:1075:Parent=augustus_masked-Fvb3-2-processed-gene-78.3-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-78.3:955-1075||RAPiDGENOMICS_rs1205_01502
GGTTCTGGGGAGTTTGTGGGAGTTTGGTCATGATCAAGTCCTGGAGACATGCCTATTTCAACTTCCTTGACAAAGTGAAGTATGCTCTAGTTGATTTTGTTTCAGACATTGTAAAGCATC
>augustus_masked-Fvb3-2-processed-gene-8.1:0:120:Parent=augustus_masked-Fvb3-2-processed-gene-8.1-mRNA-1_1::augustus_masked-Fvb3-2-processed-gene-8.1:0-120||RAPiDGENOMICS_rs1205_01503
ATGGCATTTATACTCGAATTGGGCACAGCTAAAACCTTTAACTCACTCTTGGAACTTTTGGATACCCGGTTTTTCACTTGTGGGTTTTGCTGTGTTTATTGGTATCTTTGCGAGTTTGTT
>augustus_masked-Fvb3-2-processed-gene-8.1:120:240:Parent=augustus_masked-Fvb3-2-processed-gene-8.1-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-8.1:120-240||RAPiDGENOMICS_rs1205_01504
CTCATGGCCTTTTCTTCTTCTGTGTGTCTTTTCCTTGTTGGGTTTCTTCTTTATGCAGGCAAGGGGTTTGCTGAAATGCCTTTCTCAGATGATGAGGTTCCACTAGAGATGGAAAAAGAG
>augustus_masked-Fvb3-2-processed-gene-8.1:540:660:Parent=augustus_masked-Fvb3-2-processed-gene-8.1-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-8.1:540-660|2x||RAPiDGENOMICS_rs1205_01505
GCATTGTCTTCCTTGGAACACCTAACCCTTGTGTCCAATCCAACTCTCTCAGGTGAAATTCCCTCAAGTTTGTCCCAAATTTCTAGCTTAAGGATTATGAGTTTGTCACAGAACAATTTA
>augustus_masked-Fvb3-2-processed-gene-8.1:660:780:Parent=augustus_masked-Fvb3-2-processed-gene-8.1-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-8.1:660-780|2x||RAPiDGENOMICS_rs1205_01506
CAAGGGAAAGTCCCTAGCAAGATTGGTAGTTTGGTCAGCTTAGAGCAACTTGACTTGAGTTACAACAACTTGAGTGGTCAAATACCAGAAGAAATTGGAGGGTTGGAGAGTTTGACCATT
>augustus_masked-Fvb3-2-processed-gene-93.3:1020:1140:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-93.3:1020-1140|2x||RAPiDGENOMICS_rs1205_01507
AATAGGGAAGGATATTGTCCAGAGGCGCTTGAGAAGTGGGCTCAAAAAATCCTGAAGAGGTGTGAAGGTCTACCCCTTGCAATTTCAGCTGTTGGTACTGCGCTAGCAAATAAGCCTCAA
>augustus_masked-Fvb3-2-processed-gene-93.3:1080:1200:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_10::augustus_masked-Fvb3-2-processed-gene-93.3:1080-1200||RAPiDGENOMICS_rs1205_01508
TGTGAAGGTCTACCCCTTGCAATTTCAGCTGTTGGTACTGCGCTAGCAAATAAGCCTCAAACTACACTAGAGTGGAAGAACTTTCATGACAGCCTCGGATCGGATGTTCCAAAAATTATA
>augustus_masked-Fvb3-2-processed-gene-93.3:1140:1260:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_10::augustus_masked-Fvb3-2-processed-gene-93.3:1140-1260|2x||RAPiDGENOMICS_rs1205_01509
ACTACACTAGAGTGGAAGAACTTTCATGACAGCCTCGGATCGGATGTTCCAAAAATTATAAGCCGTAGTTGGGAGCTAAGTTACAAGGATCTTTCAAGCAATCTTAAAACTTGCTTCTTG
>augustus_masked-Fvb3-2-processed-gene-93.3:120:240:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_2::augustus_masked-Fvb3-2-processed-gene-93.3:120-240||RAPiDGENOMICS_rs1205_01510
GGGAGGATGGAGGCCTATCTAAAGAAGTCAGAAGCTGAGATGGATGAAAGCAAAGAAGGGCTTCAAGCTCGTCTAAAACAGATCCGAGATGTAGCCTTTTCCATTGAAGATGCTCTTGAC
>augustus_masked-Fvb3-2-processed-gene-93.3:1200:1320:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-93.3:1200-1320||RAPiDGENOMICS_rs1205_01511
AGCCGTAGTTGGGAGCTAAGTTACAAGGATCTTTCAAGCAATCTTAAAACTTGCTTCTTGTACTTTGGCATGTTTCCAGAAGACTACTCCATCAGCAGGGAGAGACTAATTCGCTTGTGG
>augustus_masked-Fvb3-2-processed-gene-93.3:1260:1380:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_11::augustus_masked-Fvb3-2-processed-gene-93.3:1260-1380|2x||RAPiDGENOMICS_rs1205_01512
TACTTTGGCATGTTTCCAGAAGACTACTCCATCAGCAGGGAGAGACTAATTCGCTTGTGGGTCGCTGAAGGATTTGTGAAGCCACACAGAACAAAAAGGATAGAGCTTGTTGCAGAAGGT
>augustus_masked-Fvb3-2-processed-gene-93.3:1320:1440:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_12::augustus_masked-Fvb3-2-processed-gene-93.3:1320-1440||RAPiDGENOMICS_rs1205_01513
GTCGCTGAAGGATTTGTGAAGCCACACAGAACAAAAAGGATAGAGCTTGTTGCAGAAGGTTATCTGAATGAACTCGTTGAAAGAAATTTGGTTGTGGTCACTGCCAGGGAAATCGATGGA
>augustus_masked-Fvb3-2-processed-gene-93.3:1440:1560:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_13::augustus_masked-Fvb3-2-processed-gene-93.3:1440-1560||RAPiDGENOMICS_rs1205_01514
CGAGTCAAGCTTTGTCGTGTTCTAAACCTTGTTCGTGACTTCATCATTCCAAAAGCGAAGCATTTCATCACTGTCCTCGAAGCCAACAGTGCTGACAGCATTCTTCATGACACCCCAGGT
>augustus_masked-Fvb3-2-processed-gene-93.3:1560:1680:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_14::augustus_masked-Fvb3-2-processed-gene-93.3:1560-1680||RAPiDGENOMICS_rs1205_01515
AAGGAAATTCGACGTCTTTCTGTTCAATGCAATATCAACTTATTAAGAACAAAAGACTTGAGTCTTCTGCGTACATTACTAGTGTTTGGGGACTTTGAGGGGAAGACTACTGTTACTAGT
>augustus_masked-Fvb3-2-processed-gene-93.3:1680:1800:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_15::augustus_masked-Fvb3-2-processed-gene-93.3:1680-1800||RAPiDGENOMICS_rs1205_01516
TCTGAAATTCAAAAGGTTCTAAAAACCTGTAAACTTTTAAGGGTTTTAGATTTGCAAGGTGCATCTCTTTTGGAGAACTTTCCTAAATATGTAAAGAGTCTCACCCTCTTAAGGTACTTA
>augustus_masked-Fvb3-2-processed-gene-93.3:1920:2040:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_17::augustus_masked-Fvb3-2-processed-gene-93.3:1920-2040||RAPiDGENOMICS_rs1205_01517
CACCGTTTGCGCCATCTTCTAGTCTATCGCCATGATATCAAGAATTACGTGAGTTTCGGAGCTGTACAAGGAGTGAATCTTTCTGCATGTAATATTGGAGCTTTAAGTCGCATACAAAAG
>augustus_masked-Fvb3-2-processed-gene-93.3:2040:2160:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_18::augustus_masked-Fvb3-2-processed-gene-93.3:2040-2160||RAPiDGENOMICS_rs1205_01518
TTAACGCTGATTAAGGTGGAAAACAACAGTAAAATCATAGAAGGCTTGGGAGAGTTAAAGAGTCTTAAGAGGTTGGGGATGATAGATCTCAAAAGAGAGGATGGACGCCGATTGTGTTTA
>augustus_masked-Fvb3-2-processed-gene-93.3:2160:2280:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_19::augustus_masked-Fvb3-2-processed-gene-93.3:2160-2280||RAPiDGENOMICS_rs1205_01519
GCAGTTGAGAAAATGGAGCATCTTTCCACATTTGATGTTCAATCAACAAGCGAGGACGAAATTCTTGATTTGGATCATATGAAATCTCCTCCACTCCATCTCCAACATCTATACATGAAG
>augustus_masked-Fvb3-2-processed-gene-93.3:2280:2400:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_20::augustus_masked-Fvb3-2-processed-gene-93.3:2280-2400||RAPiDGENOMICS_rs1205_01520
GGGAGACTAGAAGGCATACCAAAGTGGGTTCCTCAACTTCATAGCTTAGTAAAGGGTGGTTTGAAGTGGTCAAAACTGAAAGCTGCAGCCAATCCACTTGAGGCCCTTCAAGAATTGCCT
>augustus_masked-Fvb3-2-processed-gene-93.3:240:360:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_3::augustus_masked-Fvb3-2-processed-gene-93.3:240-360||RAPiDGENOMICS_rs1205_01521
AAGTACTTGCTTCATGTCCCAAATCATTCCCACACTTATAAGATCTCTCGGTTGGTACACCGCGTTGGTCATGCAGTCCCAGATCGGAGAGCAAGCTCCAAATTGGCCTCCAGAATCGCT
>augustus_masked-Fvb3-2-processed-gene-93.3:2400:2520:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_21::augustus_masked-Fvb3-2-processed-gene-93.3:2400-2520||RAPiDGENOMICS_rs1205_01522
CATCTGTTGGAGCTCGAGCTGGCGAACTACTACGAAGGGAAAGAGTTAATATTCAAAGCTGCCACATTCAAGAAACTAATGATACTAAGTCTAGACATATTTGATGGACTGAATTTCATG
>augustus_masked-Fvb3-2-processed-gene-93.3:2520:2640:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_22::augustus_masked-Fvb3-2-processed-gene-93.3:2520-2640||RAPiDGENOMICS_rs1205_01523
GCAGTTGAGTCAAGGGCAATGCCTATGCTTCAGAAGTTAACCATGTCTAGATGCCAGAATTTGAAGCTTCTTCCAGTATTTGCCCCTGATGATCTGAAATCCCTGAAAGAAGTGCTGCTA
>augustus_masked-Fvb3-2-processed-gene-93.3:2640:2760:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_23::augustus_masked-Fvb3-2-processed-gene-93.3:2640-2760||RAPiDGENOMICS_rs1205_01524
TATGATATGTGCACTGAATTCATCGCTAACTTTGAAAGAGATGGAGAAGGCCGTGAGGTGTTTCAGCATGTCGGAATTATCAAGTCTTTTATTCTTGGAAGAAACCATCCCCATTTCACT
>augustus_masked-Fvb3-2-processed-gene-93.3:360:480:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-93.3:360-480||RAPiDGENOMICS_rs1205_01525
GACGTTGAAAAGCAGATTGATTTTGTTCTGAAACTAGATGGAATTCATCATTCAGAGAAAGGTAGCTCAACCACAACATCGCAGGGAAATGATGAATCGGCTCCCAGCCACCCTGAAGAA
>augustus_masked-Fvb3-2-processed-gene-93.3:420:540:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_4::augustus_masked-Fvb3-2-processed-gene-93.3:420-540|2x||RAPiDGENOMICS_rs1205_01526
GGTAGCTCAACCACAACATCGCAGGGAAATGATGAATCGGCTCCCAGCCACCCTGAAGAAGATGAAACAGTTGGCTTTGAGGAGGCCCAAAAGCAACTGTCCAAACAGTTTATGGAGAGA
>augustus_masked-Fvb3-2-processed-gene-93.3:480:600:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-93.3:480-600||RAPiDGENOMICS_rs1205_01527
GATGAAACAGTTGGCTTTGAGGAGGCCCAAAAGCAACTGTCCAAACAGTTTATGGAGAGAAATTCAAGACGTTTGGCGATATCAATTGTAGGTCCTGGCGGCTCAGGCAAAACCACTCTC
>augustus_masked-Fvb3-2-processed-gene-93.3:540:660:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_5::augustus_masked-Fvb3-2-processed-gene-93.3:540-660|2x||RAPiDGENOMICS_rs1205_01528
AATTCAAGACGTTTGGCGATATCAATTGTAGGTCCTGGCGGCTCAGGCAAAACCACTCTCGTAAAGAATGTTTACAAGAGCAAGGAAGTTCGTGGGTTCTTTCACTGTCATGCTTGGATC
>augustus_masked-Fvb3-2-processed-gene-93.3:600:720:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-93.3:600-720||RAPiDGENOMICS_rs1205_01529
GTAAAGAATGTTTACAAGAGCAAGGAAGTTCGTGGGTTCTTTCACTGTCATGCTTGGATCGATGTCTCACATCCATTTGTAGCCATCAAGCTCTTGCTAAACATCTTGAGAAAATTGGAC
>augustus_masked-Fvb3-2-processed-gene-93.3:660:780:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_6::augustus_masked-Fvb3-2-processed-gene-93.3:660-780|2x||RAPiDGENOMICS_rs1205_01530
GATGTCTCACATCCATTTGTAGCCATCAAGCTCTTGCTAAACATCTTGAGAAAATTGGACCCAGAAAGCAACATGCAAGAACCAATTCTACAGGAAGATACAAATGATCTGAAGGAGAGA
>augustus_masked-Fvb3-2-processed-gene-93.3:720:840:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-93.3:720-840||RAPiDGENOMICS_rs1205_01531
CCAGAAAGCAACATGCAAGAACCAATTCTACAGGAAGATACAAATGATCTGAAGGAGAGACTGAGACTAGCTTTGAGTAATAAGCGGTTTGTGATCGTCTTAGATAACATTGGCAGCAAA
>augustus_masked-Fvb3-2-processed-gene-93.3:780:900:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_7::augustus_masked-Fvb3-2-processed-gene-93.3:780-900|2x||RAPiDGENOMICS_rs1205_01532
CTGAGACTAGCTTTGAGTAATAAGCGGTTTGTGATCGTCTTAGATAACATTGGCAGCAAACAGAATTTGGAGAGCATTGCAAGTGCCTTACCATATGGTTTATCTGGGAGTAAGATAATC
>augustus_masked-Fvb3-2-processed-gene-93.3:840:960:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-93.3:840-960||RAPiDGENOMICS_rs1205_01533
CAGAATTTGGAGAGCATTGCAAGTGCCTTACCATATGGTTTATCTGGGAGTAAGATAATCTCAACCAGTCGTAACTCAGATGTAGTTTCTAGTTTTGTTTCCTCCGAGTATACCCATGAT
>augustus_masked-Fvb3-2-processed-gene-93.3:900:1020:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_8::augustus_masked-Fvb3-2-processed-gene-93.3:900-1020|2x||RAPiDGENOMICS_rs1205_01534
TCAACCAGTCGTAACTCAGATGTAGTTTCTAGTTTTGTTTCCTCCGAGTATACCCATGATTTGAGTCTGGGGATACCATGGAAAAATGCTTGGTATCTATTCTGCAAGAAGGCTTTTCAA
>augustus_masked-Fvb3-2-processed-gene-93.3:960:1080:Parent=augustus_masked-Fvb3-2-processed-gene-93.3-mRNA-1_9::augustus_masked-Fvb3-2-processed-gene-93.3:960-1080||RAPiDGENOMICS_rs1205_01535
TTGAGTCTGGGGATACCATGGAAAAATGCTTGGTATCTATTCTGCAAGAAGGCTTTTCAAAATAGGGAAGGATATTGTCCAGAGGCGCTTGAGAAGTGGGCTCAAAAAATCCTGAAGAGG
>augustus_masked-Fvb3-3-processed-gene-128.2:0:120:Parent=augustus_masked-Fvb3-3-processed-gene-128.2-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-128.2:0-120||RAPiDGENOMICS_rs1205_01536
ATGCTTCAGATCTTAGACATTGGTCATAACAACTTTTCAGGGACCATTCCCACATGTTTGAGTAATCTGACTTCTCTAATCACAGTTAAGTTGGGAAGTTATTGGTATGCTTATTTTGAT
>augustus_masked-Fvb3-3-processed-gene-128.2:120:240:Parent=augustus_masked-Fvb3-3-processed-gene-128.2-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-128.2:120-240||RAPiDGENOMICS_rs1205_01537
TACTATGAGGAGACAACAATTATCTCAAAAGGAAGAGAACTCGAGTATGGCATTAGAAATGTTCAATGGACTTTAAGGTATGTGAAAAGCATTGATCTTTCATCAAATAACTTAGATGGT
>augustus_masked-Fvb3-3-processed-gene-128.2:360:480:Parent=augustus_masked-Fvb3-3-processed-gene-128.2-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-128.2:360-480||RAPiDGENOMICS_rs1205_01538
CTCTCGCACAACCATCTCTCTGGCGAAATTCAGCAGAGCTTGTCTTCGTTAAACTTCTTGTCTCACTTAAATTTGTCATACAACAACTTGAGCGGGAGAATTCCATCGGGCAACCAACTC
>augustus_masked-Fvb3-3-processed-gene-128.2:420:540:Parent=augustus_masked-Fvb3-3-processed-gene-128.2-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-128.2:420-540|2x||RAPiDGENOMICS_rs1205_01539
TCTCACTTAAATTTGTCATACAACAACTTGAGCGGGAGAATTCCATCGGGCAACCAACTCCAAACACTCGACGATCCATCTATTTATGGGCACAATCCCTTGTTGTGTGGGTTTCCTCTG
>augustus_masked-Fvb3-3-processed-gene-128.2:480:600:Parent=augustus_masked-Fvb3-3-processed-gene-128.2-mRNA-1_5::augustus_masked-Fvb3-3-processed-gene-128.2:480-600||RAPiDGENOMICS_rs1205_01540
CAAACACTCGACGATCCATCTATTTATGGGCACAATCCCTTGTTGTGTGGGTTTCCTCTGAATAAGTGCCCTCAAAATGACATGTCTCATGCAGAAGATAACAAAGATCATGAAGATGAT
>augustus_masked-Fvb3-3-processed-gene-128.2:60:180:Parent=augustus_masked-Fvb3-3-processed-gene-128.2-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-128.2:60-180|2x||RAPiDGENOMICS_rs1205_01541
AGTAATCTGACTTCTCTAATCACAGTTAAGTTGGGAAGTTATTGGTATGCTTATTTTGATTACTATGAGGAGACAACAATTATCTCAAAAGGAAGAGAACTCGAGTATGGCATTAGAAAT
>augustus_masked-Fvb3-3-processed-gene-128.2:600:720:Parent=augustus_masked-Fvb3-3-processed-gene-128.2-mRNA-1_6::augustus_masked-Fvb3-3-processed-gene-128.2:600-720||RAPiDGENOMICS_rs1205_01542
AACGACAAGTTTGGTTTGTATATATACCAGCGCCGTGCTCGGTTTCATCATAAGCTTTTGGGGCGTTTGCGGCACATTGATCCTGAACAAGTCATGGAGGCACATGTATTTTCATTTCTT
>augustus_masked-Fvb3-3-processed-gene-20.2:0:120:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-20.2:0-120||RAPiDGENOMICS_rs1205_01543
ATGAAAGCCTCAGGCTGCATACTATCTTTCCTTTTTGTCTTCTCTTCTATCTCATCCATCTCTTTAGCTCTTACAGATGCCGAAGCGTCCTTTCTTACCCGTCGCCAGCTGCTAACGCTC
>augustus_masked-Fvb3-3-processed-gene-20.2:120:240:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-20.2:120-240||RAPiDGENOMICS_rs1205_01544
CCGGAAGGCGGTGACCTACCTGAAAACTTCGAAAATGGGGTCCAGCTTAACATGGAGTTCCCTAACCCTAGGCTTCGACGTGCATACATTGCACTCCAGGCCTGGAAGAAGGCAATCTAC
>augustus_masked-Fvb3-3-processed-gene-20.2:1200:1320:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_11::augustus_masked-Fvb3-3-processed-gene-20.2:1200-1320||RAPiDGENOMICS_rs1205_01545
GTGCCTCAACAACCTCCCAAGGTGGAGACACCAAAGCCGCCACAGACTCCTCATGTCCAACCACCTCCAGTGCACTCTCCCCCACCGGCTCCGGTCCACTCTCCACCACCTCCGGTGAAA
>augustus_masked-Fvb3-3-processed-gene-20.2:1320:1440:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_12::augustus_masked-Fvb3-3-processed-gene-20.2:1320-1440||RAPiDGENOMICS_rs1205_01546
TCTCCACCACCACCGGCACCGGTTCACTCCCCACCACCCCCAGTGCACTCTCCTCCACCACCGGTTAACTCTCCTCCTCCACCAGTCCACTCTCTACCCCCACCAGTACACTCCCCACCA
>augustus_masked-Fvb3-3-processed-gene-20.2:1680:1800:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_15::augustus_masked-Fvb3-3-processed-gene-20.2:1680-1800||RAPiDGENOMICS_rs1205_01547
CCTCCGGTGAAGTCTCCACCTCCACCGGCACCGGTATCCTCTCCGCCACCTCCGGTGAAGTCTCCACCACCACCGGCACCGGTCTACTCTCCACCACCACCGGCACCGATCTCCTTTCCA
>augustus_masked-Fvb3-3-processed-gene-20.2:1800:1920:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_16::augustus_masked-Fvb3-3-processed-gene-20.2:1800-1920||RAPiDGENOMICS_rs1205_01548
CCACCACCAGTGAAGTCTCCCCCACCACCAGCATCGGTCCACTCTCCACCACCCCTGGTGCAATCTCCACCTCCTGCCTCACCACCACCGGCACCGGTCCACTCTCCACCACCTCCAGTG
>augustus_masked-Fvb3-3-processed-gene-20.2:1920:2040:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_17::augustus_masked-Fvb3-3-processed-gene-20.2:1920-2040||RAPiDGENOMICS_rs1205_01549
CAGTCTCCACCACCAGCCTCTCCTCCACCGGTCGCAGCACCACCACCAGACGACTTCGTGCTACCACCAAACCTGGGATTCCAATACCAATCACCTCCTCCACCTATGTTCCCAGGCTAC
>augustus_masked-Fvb3-3-processed-gene-20.2:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-20.2:240-360||RAPiDGENOMICS_rs1205_01550
TCCGACCCCCTAAAGACAACTGCCAACTGGGTTGGTCCTGATGTATGCCATTACAAGGGAGTCTTCTGTGAGAAGGCACTCGATGACCCAAAACTCGACGTGGTGGCATCCATTGATCTT
>augustus_masked-Fvb3-3-processed-gene-20.2:480:600:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_5::augustus_masked-Fvb3-3-processed-gene-20.2:480-600||RAPiDGENOMICS_rs1205_01551
AAACTCCTCTACGAGTTTGACATTAGCAACAACCGCTTCGTGGGTGAATTCCCTAGTGTCTATGCATGCCTTCCGAGCCTCACGTACTTGGACATCAGGTACAACGAGTTTGAGGGGTGT
>augustus_masked-Fvb3-3-processed-gene-20.2:600:720:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_6::augustus_masked-Fvb3-3-processed-gene-20.2:600-720||RAPiDGENOMICS_rs1205_01552
CTGCCAGCTGAGCTCTTCAATAAGAATCTGGATGCCATATTCGTCAACAACAACAGGTTTGGATGCACCATTCCTGAAACCGTCGGCAACTCTAACGTCTCGGTTCTTGTCATAGCGAAC
>augustus_masked-Fvb3-3-processed-gene-20.2:840:960:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_8::augustus_masked-Fvb3-3-processed-gene-20.2:840-960||RAPiDGENOMICS_rs1205_01553
ATCACGGTGTTGGACATCAGTTCCAACTCGTTCAACGGCATCATGTCAAAATCGTTCAAGATCGATAACGTGGAGGAGTTCAGCCTTGCAAACAATCAACTCACCGGGTTTGTTCCTGAG
>augustus_masked-Fvb3-3-processed-gene-20.2:900:1020:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_8::augustus_masked-Fvb3-3-processed-gene-20.2:900-1020|2x||RAPiDGENOMICS_rs1205_01554
ATCGATAACGTGGAGGAGTTCAGCCTTGCAAACAATCAACTCACCGGGTTTGTTCCTGAGAGCATCTGCAAGCTGCCCGGGTTGAAGAACTTCACATACTCCAACAACTTCTTCAACGGC
>augustus_masked-Fvb3-3-processed-gene-20.2:960:1080:Parent=augustus_masked-Fvb3-3-processed-gene-20.2-mRNA-1_9::augustus_masked-Fvb3-3-processed-gene-20.2:960-1080||RAPiDGENOMICS_rs1205_01555
AGCATCTGCAAGCTGCCCGGGTTGAAGAACTTCACATACTCCAACAACTTCTTCAACGGCGCAGCCAAAGAATGTGTGCCAACCTCAAGGAATGACATTGTGATGGACGACTCGAGCAAC
>augustus_masked-Fvb3-3-processed-gene-208.4:0:120:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-208.4:0-120||RAPiDGENOMICS_rs1205_01556
ATGATGGATAGCTTGTGTGCAGGCCTATTCAAGCCTACCGGCTATCGCTTCCACATCCAAATTGTTGCTCACTACTTGCTCTTTCTTTTTCTGGCATCTTCATATCTGCAGACTTCTCAA
>augustus_masked-Fvb3-3-processed-gene-208.4:1080:1200:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_10::augustus_masked-Fvb3-3-processed-gene-208.4:1080-1200||RAPiDGENOMICS_rs1205_01557
CACAGACTAGAGTCGCTTGATTTGTCTGTAAACCAATTTTATGGTTCAATTCCAGAAATTATTGGTAATTTATCATCCTTGGAAAAACTGGACATCTCTTGGAATCATATGAATGGGTCC
>augustus_masked-Fvb3-3-processed-gene-208.4:1200:1320:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_11::augustus_masked-Fvb3-3-processed-gene-208.4:1200-1320||RAPiDGENOMICS_rs1205_01558
ATTCCTGCAAATTTGGGACAACTCTCTCAGCTAGTTCACCTAGATCTATCTTGGAATTCGTGGGAAGGCATTTTAACAGAAGTCCATTTCCAAACTCTCACAAAGTTAGAGTCTTTTGCT
>augustus_masked-Fvb3-3-processed-gene-208.4:1320:1440:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_12::augustus_masked-Fvb3-3-processed-gene-208.4:1320-1440||RAPiDGENOMICS_rs1205_01559
ATAAGCACAGAGCAACCTTTCTCCCTCAGTTTGAATGTGGCTCATGACTGGGTTCCTCCTTTCCAGCTTGATTCACTCGACATTGTTAACTGCAGAGTAGGTCCTGCCTTTGGGATGTGG
>augustus_masked-Fvb3-3-processed-gene-208.4:1440:1560:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_13::augustus_masked-Fvb3-3-processed-gene-208.4:1440-1560||RAPiDGENOMICS_rs1205_01560
CTTCGATCTCAAACTGAATTAACGCATCTTAGGCTCAGAAATACTGGAATATCAGACTCCATACCAGAGGAATGGTTCTTGACGATATCTTCCAAACTCACATATGTGGATTTGTCCAAC
>augustus_masked-Fvb3-3-processed-gene-208.4:1500:1620:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_13::augustus_masked-Fvb3-3-processed-gene-208.4:1500-1620|2x||RAPiDGENOMICS_rs1205_01561
ATACCAGAGGAATGGTTCTTGACGATATCTTCCAAACTCACATATGTGGATTTGTCCAACAACCAAATTCGTGGAAAGCTTCCATTTCACATGAACTCCCCATCTTTGTATCATATAGAT
>augustus_masked-Fvb3-3-processed-gene-208.4:1560:1680:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_14::augustus_masked-Fvb3-3-processed-gene-208.4:1560-1680||RAPiDGENOMICS_rs1205_01562
AACCAAATTCGTGGAAAGCTTCCATTTCACATGAACTCCCCATCTTTGTATCATATAGATCTGAATCATAATGTGTTCGAGGGCCCTCTGCCACAATGGTCTAGTGCTGCCTCCTATCTC
>augustus_masked-Fvb3-3-processed-gene-208.4:1680:1800:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_15::augustus_masked-Fvb3-3-processed-gene-208.4:1680-1800||RAPiDGENOMICS_rs1205_01563
GATCTTCGAAGCAACTCTTTTTCCGGGCCAATTCCCTCAAACTATGATCAATTGTTGCCTAACTTGGCAGAACTGTACCTGTCTGACAATAATCTGAGTGGTAGTATACCACCCTCTTTA
>augustus_masked-Fvb3-3-processed-gene-208.4:1740:1860:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_15::augustus_masked-Fvb3-3-processed-gene-208.4:1740-1860|2x||RAPiDGENOMICS_rs1205_01564
AACTTGGCAGAACTGTACCTGTCTGACAATAATCTGAGTGGTAGTATACCACCCTCTTTATGCAACATGTCAAGTTTGACAGTCCTTATTTTAAGAAGCAATCACTTGTCTGGAGACTTC
>augustus_masked-Fvb3-3-processed-gene-208.4:1800:1920:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_16::augustus_masked-Fvb3-3-processed-gene-208.4:1800-1920||RAPiDGENOMICS_rs1205_01565
TGCAACATGTCAAGTTTGACAGTCCTTATTTTAAGAAGCAATCACTTGTCTGGAGACTTCTCTCGAGCATGGAGTATGTGGCCATATATACAAGCTGTAGATGTCTCATACAACGATTTG
>augustus_masked-Fvb3-3-processed-gene-208.4:1860:1980:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_16::augustus_masked-Fvb3-3-processed-gene-208.4:1860-1980|2x||RAPiDGENOMICS_rs1205_01566
TCTCGAGCATGGAGTATGTGGCCATATATACAAGCTGTAGATGTCTCATACAACGATTTGACCGGCAATATCACCAGTTCAATGGGTGTCCCGAGCTCACTATGGGTATTGAATCTGAGC
>augustus_masked-Fvb3-3-processed-gene-208.4:1920:2040:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_17::augustus_masked-Fvb3-3-processed-gene-208.4:1920-2040||RAPiDGENOMICS_rs1205_01567
ACCGGCAATATCACCAGTTCAATGGGTGTCCCGAGCTCACTATGGGTATTGAATCTGAGCAACAACCATTTCACGGGTCAAATTCCTTCTTCTCTATTCCAAAACTGCACAAATTTGTGG
>augustus_masked-Fvb3-3-processed-gene-208.4:1980:2100:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_17::augustus_masked-Fvb3-3-processed-gene-208.4:1980-2100|2x||RAPiDGENOMICS_rs1205_01568
AACAACCATTTCACGGGTCAAATTCCTTCTTCTCTATTCCAAAACTGCACAAATTTGTGGAGTATTGATCTTGCAGGAAATAAATTTACAGGAGGCATACCTCTACCTCTACAGACAAGA
>augustus_masked-Fvb3-3-processed-gene-208.4:2040:2160:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_18::augustus_masked-Fvb3-3-processed-gene-208.4:2040-2160||RAPiDGENOMICS_rs1205_01569
AGTATTGATCTTGCAGGAAATAAATTTACAGGAGGCATACCTCTACCTCTACAGACAAGATCACCTGTGTCATCCAACTTACGTAGGATCCAATTGCGATCGAACTCGTTAAGCGGACAT
>augustus_masked-Fvb3-3-processed-gene-208.4:2160:2280:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_19::augustus_masked-Fvb3-3-processed-gene-208.4:2160-2280||RAPiDGENOMICS_rs1205_01570
ATTCCCAACCGATTATGCTCTCTTCAATCTCTGCATGTCATTGATCTTAGCCGTAACAACTTTTCAGGGACCATTCCCAAATGTTTGTATAATTTGACTGCTTTGGCTTTTGGTAATGAC
>augustus_masked-Fvb3-3-processed-gene-208.4:2280:2400:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_20::augustus_masked-Fvb3-3-processed-gene-208.4:2280-2400||RAPiDGENOMICS_rs1205_01571
ACTGATACGGGTGATAGCACTCTCTCCGATTTTTATGATGATCCTTATCATGAGGCTACCACCTTGACATTGAAGGGACAAGAACTGGTGTATAACAAGACTCTGCCTTTGGTGAATACC
>augustus_masked-Fvb3-3-processed-gene-208.4:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-208.4:240-360||RAPiDGENOMICS_rs1205_01572
GATTGCTGTCGATGGAAAGGGATTTCATGCAACAACCGTACAGGCCACGTTGCACAGATGGACCTCCGTAACCCGAATTATCATCCAGAGTATGACTCCTCCGACCAGGATACTTCTTTG
>augustus_masked-Fvb3-3-processed-gene-208.4:2400:2520:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_21::augustus_masked-Fvb3-3-processed-gene-208.4:2400-2520||RAPiDGENOMICS_rs1205_01573
ATTGATTTCTCATCAAATCACTTAGATGGTGAAATCCCTGAAGGTATAAGCAGCCTTATTGCCTTGGGGACGTTGAACTTGTCCAGAAATCATCTGACCGGAAACATTCCCTTAAAGATT
>augustus_masked-Fvb3-3-processed-gene-208.4:2520:2640:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_22::augustus_masked-Fvb3-3-processed-gene-208.4:2520-2640||RAPiDGENOMICS_rs1205_01574
GGAAACTTGCGATGGCTTGAAACTCTTGATCTCTCGCACAATCACCTCTCCGGACATATTCCACACAGTCTCTCTTCATTAACCTCTTTGTCTCACTTGGACTTGTCTCACAACAACTTG
>augustus_masked-Fvb3-3-processed-gene-208.4:2880:3000:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_25::augustus_masked-Fvb3-3-processed-gene-208.4:2880-3000||RAPiDGENOMICS_rs1205_01575
GGCACATTGGTTATGAAGAAATCATGGAGGTATGCCTATTTCCTATTCTTTGACAAAATACAAGAGAGGGCAGAATTGTTCATCGCAGTGCGAGTGGCTCGTTGGCAAAGGAAGACTTGA
>augustus_masked-Fvb3-3-processed-gene-208.4:360:480:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-208.4:360-480||RAPiDGENOMICS_rs1205_01576
GGGGGTAACATCAATCCTTCTTTGCTTAGCTTAAAGAAGTTGTATAGCCTTGACCTAAGCGGAAATGATTTTCCACGACTCCGAATTCCTGATTTCTTTGGGAAGCTTACAAGTTTGAGG
>augustus_masked-Fvb3-3-processed-gene-208.4:480:600:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_5::augustus_masked-Fvb3-3-processed-gene-208.4:480-600||RAPiDGENOMICS_rs1205_01577
TATCTTAATCTCTCCTATGTTTCATTTAAGGGAGAGATTCCCCCAACTCTTGGTAACCTCTCAAATTTGAACTATCTTGACCTCAATAGTTATTACTATGACTATTGTTATTCCAATAAC
>augustus_masked-Fvb3-3-processed-gene-208.4:600:720:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_6::augustus_masked-Fvb3-3-processed-gene-208.4:600-720||RAPiDGENOMICS_rs1205_01578
TTGAATTGGCTTTCTCATCTCTCTTCCCTAAAGTACCTCAATCTTGGAGGTGTTAACCTCAGCAGCTTAGCAGGAAGTTGGCTACATGATGTCAACATGCTTCCTTCACTCTTGGAGTTG
>augustus_masked-Fvb3-3-processed-gene-208.4:660:780:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_6::augustus_masked-Fvb3-3-processed-gene-208.4:660-780|2x||RAPiDGENOMICS_rs1205_01579
AGCAGCTTAGCAGGAAGTTGGCTACATGATGTCAACATGCTTCCTTCACTCTTGGAGTTGCATTTGTTTAATTGCCAAATTCAAAAGCTTCCACAATCCCAGCTGCGGTCAGTGAACTTC
>augustus_masked-Fvb3-3-processed-gene-208.4:720:840:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_7::augustus_masked-Fvb3-3-processed-gene-208.4:720-840||RAPiDGENOMICS_rs1205_01580
CATTTGTTTAATTGCCAAATTCAAAAGCTTCCACAATCCCAGCTGCGGTCAGTGAACTTCACATCCCTCTTGGTTCTTGATATATCAGGGAATTATATTGATTATTCATTTCCCAGCTGG
>augustus_masked-Fvb3-3-processed-gene-208.4:780:900:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_7::augustus_masked-Fvb3-3-processed-gene-208.4:780-900|2x||RAPiDGENOMICS_rs1205_01581
ACATCCCTCTTGGTTCTTGATATATCAGGGAATTATATTGATTATTCATTTCCCAGCTGGATTTTTAATCTTACCAACCTCAAAAAACTTGATGCATCTGGCAATTTGTTCGGTCCCATC
>augustus_masked-Fvb3-3-processed-gene-208.4:840:960:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_8::augustus_masked-Fvb3-3-processed-gene-208.4:840-960||RAPiDGENOMICS_rs1205_01582
ATTTTTAATCTTACCAACCTCAAAAAACTTGATGCATCTGGCAATTTGTTCGGTCCCATCCCTGTTGAACTTGCAAACCTCAAGTCTTTGGAAGACCTTAATTTAATGGCCACTTCTGCC
>augustus_masked-Fvb3-3-processed-gene-208.4:960:1080:Parent=augustus_masked-Fvb3-3-processed-gene-208.4-mRNA-1_9::augustus_masked-Fvb3-3-processed-gene-208.4:960-1080||RAPiDGENOMICS_rs1205_01583
CAAGGTCAAACTCCCAAAGTCTTTTGTAGATTGCGCAGCCTAAGGATATTAGATCTTTCTGAAAACTCGTTCAGTGGTGGTTTGGAAGAGGTTTTGAATGGCTTCTCAAACTGCACAAGT
>augustus_masked-Fvb3-3-processed-gene-225.0:60:180:Parent=augustus_masked-Fvb3-3-processed-gene-225.0-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-225.0:60-180|2x||RAPiDGENOMICS_rs1205_01584
ATACCTCAGAAGCTGGATGTCTCTGGTAATGGTTTACGAGGAGAGATACCTCAGAAGCTTTACAACATGACTTACCTTGAAATCCTTGACCTGCATAAAAACCAGCTCAATGGAAGCATC
>augustus_masked-Fvb3-3-processed-gene-23.2:1080:1200:Parent=augustus_masked-Fvb3-3-processed-gene-23.2-mRNA-1_10::augustus_masked-Fvb3-3-processed-gene-23.2:1080-1200||RAPiDGENOMICS_rs1205_01585
CCCTGTGATAAACATGGACTGCCAATGTCGCCTCCTCCGGCCAAACAGGACAGTTCGGCAGATGACAGCAGTGATTCGGATTATGATGACAGCGATGAGGATAGTTCGAGTCAGAGTGAT
>augustus_masked-Fvb3-3-processed-gene-23.2:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-23.2-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-23.2:240-360||RAPiDGENOMICS_rs1205_01586
TCCAACACCACCCTCTGCGACGCCGCCAAGCCCTTCCGCCACCTCCTCTCCCTCACACTCGCCAACTGCTCCGACGACGTTGCTCTCTCCTTCACCGCCCTCAAGTCCCTCTCCACTCTC
>augustus_masked-Fvb3-3-processed-gene-23.2:900:1020:Parent=augustus_masked-Fvb3-3-processed-gene-23.2-mRNA-1_8::augustus_masked-Fvb3-3-processed-gene-23.2:900-1020|2x||RAPiDGENOMICS_rs1205_01587
AAGTTCCTGTCTGATATGAAGAGCTTGAAGCATTTGAATCTTGCTAACAATAACTTTCAGGGAGTCATTCCTTTCAATGTGTCGTTCATTAGTAAGTTGGCTGTGTTCAAGATTAGTAGG
>augustus_masked-Fvb3-3-processed-gene-23.2:960:1080:Parent=augustus_masked-Fvb3-3-processed-gene-23.2-mRNA-1_9::augustus_masked-Fvb3-3-processed-gene-23.2:960-1080||RAPiDGENOMICS_rs1205_01588
GGAGTCATTCCTTTCAATGTGTCGTTCATTAGTAAGTTGGCTGTGTTCAAGATTAGTAGGAACAGCAATTTGTGCTACAACCATTCGGTTCTTTCGTCGAAATTGAAGCTCGGCATTGCT
>augustus_masked-Fvb3-3-processed-gene-248.6:0:120:Parent=augustus_masked-Fvb3-3-processed-gene-248.6-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-248.6:0-120||RAPiDGENOMICS_rs1205_01589
ATGATGTCTACTAAAGAGTTTGAAGCATTTGAAGCAACAAGACAAGCCATGGATGAGCTCATGGAGGCATTTGGAAATGATGAGGTGACTGCCATTGGGGTCTATGGAATGGGAGGGGTT
>augustus_masked-Fvb3-3-processed-gene-248.6:120:240:Parent=augustus_masked-Fvb3-3-processed-gene-248.6-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-248.6:120-240||RAPiDGENOMICS_rs1205_01590
GGGAAGACAACCATGGTGAAACATGTTGGTGAACAAGCACAAAAAATGGGGCTGTTTCATCATGTGATTACGGCTGTTGTGTCCCCAAGACCTGACTTGAGAAAAGTCCAAGGCACATTT
>augustus_masked-Fvb3-3-processed-gene-248.6:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-248.6-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-248.6:240-360||RAPiDGENOMICS_rs1205_01591
TCAGATCTGCTGAACTTGAAATTTGAGGAGGAGACAGAAATGGAAAGAGCTGCCAGGTTGAGGCAGAAGATAACAAGAGGAAGCAGGATCCTCATAATCTTGGATGACATTTGGGACAGA
>augustus_masked-Fvb3-3-processed-gene-248.6:360:480:Parent=augustus_masked-Fvb3-3-processed-gene-248.6-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-248.6:360-480||RAPiDGENOMICS_rs1205_01592
GTAGACTTGTCGAGCATTGGAATTCCTAGCTACAACGAGCTTCAAAGATGCAACTCCAAAGTCCTACTAATCAGACGGAGATTGAATGTTTGTCATTCCATGGAGAGCCAGGCAAACATT
>augustus_masked-Fvb3-3-processed-gene-248.6:420:540:Parent=augustus_masked-Fvb3-3-processed-gene-248.6-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-248.6:420-540|2x||RAPiDGENOMICS_rs1205_01593
GTCCTACTAATCAGACGGAGATTGAATGTTTGTCATTCCATGGAGAGCCAGGCAAACATTCAACTCAATATCTTGTCAGAAGAAGATGCTTGGAACCTGTTTGTGAAGGAAACGAGAAAG
>augustus_masked-Fvb3-3-processed-gene-248.6:480:600:Parent=augustus_masked-Fvb3-3-processed-gene-248.6-mRNA-1_5::augustus_masked-Fvb3-3-processed-gene-248.6:480-600||RAPiDGENOMICS_rs1205_01594
CAACTCAATATCTTGTCAGAAGAAGATGCTTGGAACCTGTTTGTGAAGGAAACGAGAAAGTCTATTGATGAGTCAACAAATTTCTATGATGTAGCAAGGACAGTGGCAAGAGAATGTGCT
>augustus_masked-Fvb3-3-processed-gene-248.6:540:660:Parent=augustus_masked-Fvb3-3-processed-gene-248.6-mRNA-1_5::augustus_masked-Fvb3-3-processed-gene-248.6:540-660|2x||RAPiDGENOMICS_rs1205_01595
TCTATTGATGAGTCAACAAATTTCTATGATGTAGCAAGGACAGTGGCAAGAGAATGTGCTGGTATTCCAGTTGCATTGATAGCAGTTGCGAGGGCGCTTAAAGATAAAGGTTTTGAAGAA
>augustus_masked-Fvb3-3-processed-gene-248.6:60:180:Parent=augustus_masked-Fvb3-3-processed-gene-248.6-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-248.6:60-180|2x||RAPiDGENOMICS_rs1205_01596
ATGGAGGCATTTGGAAATGATGAGGTGACTGCCATTGGGGTCTATGGAATGGGAGGGGTTGGGAAGACAACCATGGTGAAACATGTTGGTGAACAAGCACAAAAAATGGGGCTGTTTCAT
>augustus_masked-Fvb3-3-processed-gene-248.6:660:780:Parent=augustus_masked-Fvb3-3-processed-gene-248.6-mRNA-1_6::augustus_masked-Fvb3-3-processed-gene-248.6:660-780|2x||RAPiDGENOMICS_rs1205_01597
TGGAAAGAAGCAGCTCGACGTCTTCAGATGTCTCAACATGCAAACGTTGATGATGATGAGAGAGTTGTGTATGAATGTATAAAGTTATGTTATGATTACTTGGACTGTAATGATGCCAAG
>augustus_masked-Fvb3-3-processed-gene-248.6:780:900:Parent=augustus_masked-Fvb3-3-processed-gene-248.6-mRNA-1_7::augustus_masked-Fvb3-3-processed-gene-248.6:780-900|2x||RAPiDGENOMICS_rs1205_01598
TCTTGCTTCTTGCTTTGCTGCTTATTCCCTGAAGATTATGATATCCAAAGTGAAGAACTGATGAAGTTTGGATTCGGAATAGGATTGTTTCGACATGTCAACAGCACAATAGAAGATGCA
>augustus_masked-Fvb3-3-processed-gene-248.7:0:120:Parent=augustus_masked-Fvb3-3-processed-gene-248.7-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-248.7:0-120||RAPiDGENOMICS_rs1205_01599
ATGGATGGATGCGTAAGGATGCATGATGTGATTCGGGAGATAACCATGTCAATTGCCTTGTCAGTTGATGGCCACAGGGTTTTGGTAAAAAATAGTTGTGAACTAATAGATTGGCCGGTG
>augustus_masked-Fvb3-3-processed-gene-248.7:120:240:Parent=augustus_masked-Fvb3-3-processed-gene-248.7-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-248.7:120-240||RAPiDGENOMICS_rs1205_01600
GATGCAGACGAGGGCTTCTCGGCAATCTCACTTATGGAGAACGGCATTTGCAAGCTTCCTCAAGAATTGGTATGCTCAAAACTCCTTATATTATCATTAAAAGGGAATAGTTACTTAGAA
>augustus_masked-Fvb3-3-processed-gene-248.7:180:300:Parent=augustus_masked-Fvb3-3-processed-gene-248.7-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-248.7:180-300|2x||RAPiDGENOMICS_rs1205_01601
CAAGAATTGGTATGCTCAAAACTCCTTATATTATCATTAAAAGGGAATAGTTACTTAGAAGAGATCCCAGAATCATTTTTCCAATGGCTGAATGCATTAAGGGTCCTAGATCTTAGAGGT
>augustus_masked-Fvb3-3-processed-gene-248.7:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-248.7-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-248.7:240-360||RAPiDGENOMICS_rs1205_01602
GAGATCCCAGAATCATTTTTCCAATGGCTGAATGCATTAAGGGTCCTAGATCTTAGAGGTACTAGTATTTCAGTACTTCCTCTATCATTCAGTCTCCTGACCAACCTCCAAGCTTTGTAT
>augustus_masked-Fvb3-3-processed-gene-248.7:300:420:Parent=augustus_masked-Fvb3-3-processed-gene-248.7-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-248.7:300-420|2x||RAPiDGENOMICS_rs1205_01603
ACTAGTATTTCAGTACTTCCTCTATCATTCAGTCTCCTGACCAACCTCCAAGCTTTGTATTTGGATTATTGCAACAAGAGAAGAATTGACATATCTATACTAGGCCATCTGAAGAAACTT
>augustus_masked-Fvb3-3-processed-gene-248.7:360:480:Parent=augustus_masked-Fvb3-3-processed-gene-248.7-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-248.7:360-480||RAPiDGENOMICS_rs1205_01604
TTGGATTATTGCAACAAGAGAAGAATTGACATATCTATACTAGGCCATCTGAAGAAACTTGAGATTCTTAGTATGACAGAATGTCGTATTAAGGAATTCCCAAAAGAAATAGGAAATTTG
>augustus_masked-Fvb3-3-processed-gene-248.7:480:600:Parent=augustus_masked-Fvb3-3-processed-gene-248.7-mRNA-1_5::augustus_masked-Fvb3-3-processed-gene-248.7:480-600||RAPiDGENOMICS_rs1205_01605
ACCAATTTAAGGATGTTTAAGTTCAGCAGTAGTCTTGGTATTAAGAGAACTCCATCTCAAGTGATATCAAGGTTGGAAAAATTAGAAGAACTTTACTTGCAATGTAAGTTTGGGGACTGG
>augustus_masked-Fvb3-3-processed-gene-248.7:600:720:Parent=augustus_masked-Fvb3-3-processed-gene-248.7-mRNA-1_6::augustus_masked-Fvb3-3-processed-gene-248.7:600-720||RAPiDGENOMICS_rs1205_01606
GGTCGAAAAGTTGGAGGACGCTATTCCTCTTCTTTCGGTAAGAATGCTGAGTTTCATGACGTAACTGGCTTGTCACGTTTGAATTTGCTGCAGGTTTCCCTATCTGATGCACAGTGCTTG
>augustus_masked-Fvb3-3-processed-gene-269.4:1320:1440:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_12::augustus_masked-Fvb3-3-processed-gene-269.4:1320-1440||RAPiDGENOMICS_rs1205_01607
AAGATACTTCTAGCTAACAATTTCCTCTCCGGGACTGTCCCATCAGAACTTGGAAACTGCAAGAACTTAAGAGCTATTGACCTGAGTTTCAACAGTTTGAGTGGTGCAATTCCTTCAGAA
>augustus_masked-Fvb3-3-processed-gene-269.4:1560:1680:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_14::augustus_masked-Fvb3-3-processed-gene-269.4:1560-1680||RAPiDGENOMICS_rs1205_01608
CTCATTTCTGGAGCCATTCCAGAGTCTATTGGCAGCTGCACCAATATGATTTGGGTGTCACTATCTAGCAACCGGCTTACTGGAGCAATCCCTTCAGGTATTGGAAATCTCATTAAGCTT
>augustus_masked-Fvb3-3-processed-gene-269.4:180:300:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-269.4:180-300|2x||RAPiDGENOMICS_rs1205_01609
TGGAAAGGCCTGACTTGCTCTGAAGGCCATATCATCACCCTTGACCTCTCCTATTTTGGTCTCATTGGAAGTCTTCACCTTCCAACTCTCACAGCCTTGCCGAGTCTTCAAAATCTGTAC
>augustus_masked-Fvb3-3-processed-gene-269.4:1800:1920:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_16::augustus_masked-Fvb3-3-processed-gene-269.4:1800-1920||RAPiDGENOMICS_rs1205_01610
GAGCTTGCTAACCAGGCCGGCCTAGTCAATCCTGGAATTGTTTCTGGGAAGCAGTTTGCATTTGTTAGAAATGAGGGTGGTACAGCTTGCAGGGGTGCAGGAGGTTTAGTTGAGTTTGAG
>augustus_masked-Fvb3-3-processed-gene-269.4:1920:2040:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_17::augustus_masked-Fvb3-3-processed-gene-269.4:1920-2040||RAPiDGENOMICS_rs1205_01611
GGAGTCCGACCTCAGAGACTCGAAAGTTTACCTATGGTTCATTCTTGCCCATCAACCAGAATTTACACAGGGTTGACAGTTTACACATTCACCAGCAATGGAAGCATGATCTTCCTTGAC
>augustus_masked-Fvb3-3-processed-gene-269.4:2040:2160:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_18::augustus_masked-Fvb3-3-processed-gene-269.4:2040-2160||RAPiDGENOMICS_rs1205_01612
ATTTCCTACAATTCCTTGTCTGGGTCTATTCCCGCAAACCTAGGTAATCTGTCCTATTTGCAAGTCTTCAATCTAGGACACAATATGTTAGGTGGAAATATTCCAGAGAGCTTTGGAGGA
>augustus_masked-Fvb3-3-processed-gene-269.4:2160:2280:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_19::augustus_masked-Fvb3-3-processed-gene-269.4:2160-2280||RAPiDGENOMICS_rs1205_01613
TTGAAAGCAATCGGAGTCCTGGATCTCTCTCACAATAATCTTCAAGGTTATGTCCCAGGATCTTTGGGGACTCTCTCTTTCCTGAGTGACCTTGATGTATCTAACAACAACCTCACCGGT
>augustus_masked-Fvb3-3-processed-gene-269.4:2280:2400:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_20::augustus_masked-Fvb3-3-processed-gene-269.4:2280-2400||RAPiDGENOMICS_rs1205_01614
CTCATCCCTTCTGGAGGTCAGCTTACCACTTTCCCAGCATCCAGATATGAGAACAACTCTGGCCTTTGTGGGTTACCCCTGCCACCGTGTGGCTCTCAAAGACATTCAGCAGAGAGATTC
>augustus_masked-Fvb3-3-processed-gene-269.4:2400:2520:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_21::augustus_masked-Fvb3-3-processed-gene-269.4:2400-2520||RAPiDGENOMICS_rs1205_01615
AAGGGAAAGAAGCCGTCTATGGCTTCAGAAATGGTCATTGGTATTACATTCTTTCTCTTCTGTATCCTTCTTATACTTGCATTAGCTCTATATCGAGTGAAGAAATACCAGCAGAAAGAG
>augustus_masked-Fvb3-3-processed-gene-269.4:2520:2640:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_22::augustus_masked-Fvb3-3-processed-gene-269.4:2520-2640||RAPiDGENOMICS_rs1205_01616
GCAAAGAGTGAAAAATATATTGAAAGCCTTCCGACTTCAGGGAGCAGCAGCTGGAAACTTTCTGGTGTGGCTGAGCCTCTCAGCATCAATGTAGCTACATTTGAGAAACCTTTGTGGAAG
>augustus_masked-Fvb3-3-processed-gene-269.4:2640:2760:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_23::augustus_masked-Fvb3-3-processed-gene-269.4:2640-2760||RAPiDGENOMICS_rs1205_01617
CTTACCTTTGCCCATTTACTTGAAGCCACCAATGGTTTCAGTGCAGATAGCTTGATTGGTTCTGGAGGATTTGGTGAGGTGTATAAGGCACAATTGGGAGATGGCTGTGTTGTTGCAATC
>augustus_masked-Fvb3-3-processed-gene-269.4:3240:3360:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_28::augustus_masked-Fvb3-3-processed-gene-269.4:3240-3360||RAPiDGENOMICS_rs1205_01618
TACAGTTATGGTGTTATACTGCTAGAGCTTCTCTCAGGAAGAAGGCCTATAGACCCATCAGTGTTTGGTGATGACAACAACCTTGTTGGATGGGCAAAGCAGCTTCAAAGAGAAAAGAGA
>augustus_masked-Fvb3-3-processed-gene-269.4:3360:3480:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_29::augustus_masked-Fvb3-3-processed-gene-269.4:3360-3480||RAPiDGENOMICS_rs1205_01619
TGGGATCAGATACTTGACGCTGAGTTGTTGACACAGACATCTGGTGAGGCTGAACTATACCAGTATCTGAATATTGCCTTTGAGTGCCTAGACGACAGGCCATTCAGGCGTCCAACAATG
>augustus_masked-Fvb3-3-processed-gene-269.4:360:480:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-269.4:360-480||RAPiDGENOMICS_rs1205_01620
CTTGTAACAGTTGACTTGTCCTCCAACAACTTCACAAGCCCTCTTCCGGTTGGGTCTTTTCTTGAGGGTTGTGAGCATCTGGCCTCGGTCAACCTCTCTGGTAATTCAATCCCAGGAGGA
>augustus_masked-Fvb3-3-processed-gene-269.4:60:180:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-269.4:60-180|2x||RAPiDGENOMICS_rs1205_01621
GCTTCTAATGAGGATGTGGTGAAGAAGCTTTTGTTGGAGTTCAAGCAATCCTCTGTTCAATCTGACCCTCATGGTTTCTTATCTGACTGGAAATCTGATTCTTCAACTGCTCTTTGTTCA
>augustus_masked-Fvb3-3-processed-gene-269.4:600:720:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_6::augustus_masked-Fvb3-3-processed-gene-269.4:600-720||RAPiDGENOMICS_rs1205_01622
GGAAAGCTGAGTGGTTCTATCTTGTCTGGCAAGAATCTGACAACACTTGACCTTTCATACAATTATTTGTCGGGGGAGATACCAAACACTTTCCTGGAAAGCGCCTCGGCATCACTCAAG
>augustus_masked-Fvb3-3-processed-gene-269.4:840:960:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_8::augustus_masked-Fvb3-3-processed-gene-269.4:840-960||RAPiDGENOMICS_rs1205_01623
TCAAGCCTTGTCAACTGTCAAGCTTTGGAGACACTGAACCTGACTAGTAATAAGTTGCAGGACAAGATTCCAGGTGCTTTGTTGGGAAATCTCAAGAAATTGAGGCAACTCTTTCTGGGT
>augustus_masked-Fvb3-3-processed-gene-269.4:960:1080:Parent=augustus_masked-Fvb3-3-processed-gene-269.4-mRNA-1_9::augustus_masked-Fvb3-3-processed-gene-269.4:960-1080||RAPiDGENOMICS_rs1205_01624
CGTAATCAGTTTTCTGGTGTAATTCCAGCTGAATTAGGAAAGGCCTGTGGGACACTTCAGGAGCTTGATATTTCTGATAACATTCTTACTGGTGAATTGCCTTCAAGTTTTGTGTCATGC
>augustus_masked-Fvb3-3-processed-gene-270.7:0:120:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-270.7:0-120||RAPiDGENOMICS_rs1205_01625
ATGAATGAAGAACAAGCATCAAACTCTCCTCATCTAGACACCATGGTCTCCAATGGCCTCACCATCAAAACCTCCTCAAACACTTCCACAACCAAAACAACAACAGGTAAAGACAGTTCC
>augustus_masked-Fvb3-3-processed-gene-270.7:1080:1200:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_10::augustus_masked-Fvb3-3-processed-gene-270.7:1080-1200||RAPiDGENOMICS_rs1205_01626
TGTTCTGTGGTTAAAGGAGAAGCTAGTGGACAATCTGAAGGTTTGGCTGATGAGGAGAGTGAGGTGGTTACGACTAGAGGGAGGTACATTAATTTGGAGATGGGGAAATGCAAAGAGCCT
>augustus_masked-Fvb3-3-processed-gene-270.7:120:240:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-270.7:120-240||RAPiDGENOMICS_rs1205_01627
TTGCCTTCTCCAAACATCCAATCCTCCCCTATCTACTCTCCTTCTCTAATCTCCCCACCTTCCTCAGCATTTGTCTCAGCTCTTCAATCCCCATATATCTCTCCAAGAGTCTTAAGCCCA
>augustus_masked-Fvb3-3-processed-gene-270.7:1200:1320:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_11::augustus_masked-Fvb3-3-processed-gene-270.7:1200-1320||RAPiDGENOMICS_rs1205_01628
AATTTGGAGGCTTGGATTGAGCCTGTTGTGGGAAGGAATTCGTTCAAGAGGTCGAAGCACAAGAAGTCGAAAAGTGGGAATTGCAAGAGCTTGGGGAGCAGTGTGATATGCATAAATGGG
>augustus_masked-Fvb3-3-processed-gene-270.7:1500:1620:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_13::augustus_masked-Fvb3-3-processed-gene-270.7:1500-1620|2x||RAPiDGENOMICS_rs1205_01629
CGGAACTTTGAGGAGCAAGAGTTTGAGGCATTCAAGAGGGTGAAGAGGGAGTTGTTCAGGGACATGCCTTATTTGATTGTGATTGATAATCTTGAGACTGAGAGGGAGTGGTGGGAAGGG
>augustus_masked-Fvb3-3-processed-gene-270.7:1620:1740:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_14::augustus_masked-Fvb3-3-processed-gene-270.7:1620-1740|2x||RAPiDGENOMICS_rs1205_01630
AAGGATTTACATGACTTGATCCCAAGGAACACAGGAGGGTCTCATCTCATCATCACTAGTAGATTGTCCAAGGTAATGAATTTTGACACCATGCAGCTCCCGCCATTGCCTGTTTCAGAT
>augustus_masked-Fvb3-3-processed-gene-270.7:1680:1800:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_15::augustus_masked-Fvb3-3-processed-gene-270.7:1680-1800||RAPiDGENOMICS_rs1205_01631
AGATTGTCCAAGGTAATGAATTTTGACACCATGCAGCTCCCGCCATTGCCTGTTTCAGATGCAATGGTTTTGATTAGAGGGAGGAAAAAGAAAGAGTACCCTTCTGAGGAGTTGGAGTAT
>augustus_masked-Fvb3-3-processed-gene-270.7:2040:2160:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_18::augustus_masked-Fvb3-3-processed-gene-270.7:2040-2160||RAPiDGENOMICS_rs1205_01632
AAAGCAAACGTTCTTGCCTCAAGAATGCTTCTTGTTGGTGCCTGGTTTGCCCCAACTCCTATTTCCTTGACTCTTCTTACCACTGCAGCTAAGAATATGCCTGCCACTAAAAGCCGGCTC
>augustus_masked-Fvb3-3-processed-gene-270.7:2160:2280:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_19::augustus_masked-Fvb3-3-processed-gene-270.7:2160-2280||RAPiDGENOMICS_rs1205_01633
AGGAAGTGGACTAATTGCATGAGTGTCACATTCGGTTGCTTCACACCTCAAACATGGAAGAATACTGAAGAAGATTCAGCCCTTCTTCTTGTTAAGTTAGGACTAGCGCGAACAGCCAAG
>augustus_masked-Fvb3-3-processed-gene-270.7:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-270.7:240-360||RAPiDGENOMICS_rs1205_01634
AAACCCCAAGAAAGCCCAACTCACCAACAACAACCACCAATCTCCTACACTCACTCAGATGACATCCCAAGCAGTTCATACACACCCCCATCAGACCAGTACGAGTACTCAGACAATGAC
>augustus_masked-Fvb3-3-processed-gene-270.7:2400:2520:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_21::augustus_masked-Fvb3-3-processed-gene-270.7:2400-2520||RAPiDGENOMICS_rs1205_01635
GTGAACTTAGACCATCTATGGGCTACTGCATTCCTCGTTTTCGGGTTCAAATCCGAGCCTCCTCTTGTCCAACTCAAGGCAATCGACATGGTTCTATACATAAAAAAGACAGCCCTCCCA
>augustus_masked-Fvb3-3-processed-gene-270.7:2640:2760:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_23::augustus_masked-Fvb3-3-processed-gene-270.7:2640-2760||RAPiDGENOMICS_rs1205_01636
TGTCACGGCTCGCTGTGCTGGAAGAACAAGCTGCAAAGTAACCAGAGAGTGGACGAGTACGTATGGCAAGACGTGACGTTGCTCAAAGCGACATTGCTGGAGACGAGAGCGAAACTGCTT
>augustus_masked-Fvb3-3-processed-gene-270.7:360:480:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-270.7:360-480||RAPiDGENOMICS_rs1205_01637
CCAATGAAGCTCAAGTTCGACTCTTCAGCCCCTCCAAGAATCTCGTTCTCCTTTCCTGTCCCTCGAATCTCATTTGCCAAAGGAGGCTCTGTTTCCCCTGCTCGAAACTCAAATGCTAAG
>augustus_masked-Fvb3-3-processed-gene-270.7:480:600:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_5::augustus_masked-Fvb3-3-processed-gene-270.7:480-600||RAPiDGENOMICS_rs1205_01638
CTGAGAAGCTGTGACGTCTACATTGGGTTCCACGGTCAAAACCCAAACATGGTTCGATTCTGCAAGTGGCTTAAGTCCGAGCTTGAGCTTCAGGGCATTGCTTGTTTCGTTGCTGACAGG
>augustus_masked-Fvb3-3-processed-gene-270.7:840:960:Parent=augustus_masked-Fvb3-3-processed-gene-270.7-mRNA-1_8::augustus_masked-Fvb3-3-processed-gene-270.7:840-960||RAPiDGENOMICS_rs1205_01639
TTGATGAGGTGTAGTGAATTTAAGCTGGAGGCTAATGAGGGTAACTGGAGGAGCATTGTGTCGAAAGCCGCCGGGGTTTTGAGGGCAAAGCTTGGGAGGAAGAGCGTGTCTTTGAGTGAG
>augustus_masked-Fvb3-3-processed-gene-280.1:420:540:Parent=augustus_masked-Fvb3-3-processed-gene-280.1-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-280.1:420-540|2x||RAPiDGENOMICS_rs1205_01640
CTCACCGGACCTCTTCCTTCTGACATCGGCCGCCTCCAGCGCCTCACCGTCCTCAACGTCGCCGACAATCAAATTTCCGGTCCCATCCCCGAGTCTCTCACGAAGATCTCGTCCCTCATG
>augustus_masked-Fvb3-3-processed-gene-280.1:720:840:Parent=augustus_masked-Fvb3-3-processed-gene-280.1-mRNA-1_7::augustus_masked-Fvb3-3-processed-gene-280.1:720-840||RAPiDGENOMICS_rs1205_01641
ATTCCGGCCTCTCTAGGCAAAATGGCCGTCCTCGCAACGCTGAACCTAGACTGTAACAACATCACCGGAACTATTCCCCCGAGTTTGATAGTTTCAGGTATCAGCAACTTGAACTTGAGC
>augustus_masked-Fvb3-3-processed-gene-283.7:212:332:Parent=augustus_masked-Fvb3-3-processed-gene-283.7-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-283.7:212-332||RAPiDGENOMICS_rs1205_01642
CAGGGAACAGGTCACGAAGGCGTTAAAGAATGATAAGGTCAATGTGATTGGGGTCTATGGAAAGGGAGGAGTAGGGAAGACAACTATGGTGAAACATGCAAGTGCACAAGCCCAAAAGGA
>augustus_masked-Fvb3-3-processed-gene-283.7:272:392:Parent=augustus_masked-Fvb3-3-processed-gene-283.7-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-283.7:272-392|2x||RAPiDGENOMICS_rs1205_01643
AAAGGGAGGAGTAGGGAAGACAACTATGGTGAAACATGCAAGTGCACAAGCCCAAAAGGATAGTCTTTTTAATCATGTGGTCGAGGTTTCTGTATCCCAAAGTCCTGATCTGAGAAAAAT
>augustus_masked-Fvb3-3-processed-gene-289.0:1022:1142:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_5::augustus_masked-Fvb3-3-processed-gene-289.0:1022-1142|2x||RAPiDGENOMICS_rs1205_01644
AATCGCCCTCAACATTCTATCAAAAGAAGATTCTTGGAACTTGTTTCTGAGAAATGCAGGAACAATTTCTTTTGAGTCCACCTCGTTTAAGGAAGTGGCATGGAGGGTAGCTGGAGAGTG
>augustus_masked-Fvb3-3-processed-gene-289.0:1142:1262:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_6::augustus_masked-Fvb3-3-processed-gene-289.0:1142-1262|2x||RAPiDGENOMICS_rs1205_01645
TAAGGGTCTACCTATTGCATTGAAAGTTGTTGCAAGGGCACTCAGAGATGAGGACCAGGAGGAATGGGAGAAGGCAGCTAAACGACTAGAGCAGTCGAAATATGTCAATCCCAGCCATGA
>augustus_masked-Fvb3-3-processed-gene-289.0:120:240:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-289.0:120-240||RAPiDGENOMICS_rs1205_01646
AGTGGCATTAAAACGTTCATGGATGAACCAGATCTTAGAGTAGGGGATACCATTTCGCCCACTCTCATGAAGGCAATTAAAGAGTCGAGGTTTGCAATCGTAATTTTCTCGCAAAATTAC
>augustus_masked-Fvb3-3-processed-gene-289.0:1382:1502:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_8::augustus_masked-Fvb3-3-processed-gene-289.0:1382-1502|2x||RAPiDGENOMICS_rs1205_01647
AGAAGACTTGTTCCGGTACACGATCGGAAAAAGATTGTTTCGAGATGCCGAAACAATGGAAGAAGCCAGAGGAATAGTAGTTTCAGTGGTCAAGTACCTGAAAAATTCTGGCTTGCTTTT
>augustus_masked-Fvb3-3-processed-gene-289.0:1562:1682:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_10::augustus_masked-Fvb3-3-processed-gene-289.0:1562-1682||RAPiDGENOMICS_rs1205_01648
TATTGCACAATCTGAAGATGGGCATCGGTTTTTTGTGAAAGCTGGCTGTGGTTTAAAGGGTTGGCCGCCACGCGGATTACATGAAGGCTGCACTGCAATTTCACTGATGAACAACGGAAT
>augustus_masked-Fvb3-3-processed-gene-289.0:1862:1982:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_12::augustus_masked-Fvb3-3-processed-gene-289.0:1862-1982|2x||RAPiDGENOMICS_rs1205_01649
CCTCCAAGCTTTGTATTTAGATGATTGCCGCAAATTAATTGACATTTCCGTAGTGGGGAAACTTAGCAAGCTTGAAATTCTTAGTATGAGAGACTGTCCCGGGGGGAAATTGTCGAGAGA
>augustus_masked-Fvb3-3-processed-gene-289.0:1922:2042:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_13::augustus_masked-Fvb3-3-processed-gene-289.0:1922-2042||RAPiDGENOMICS_rs1205_01650
ACTTAGCAAGCTTGAAATTCTTAGTATGAGAGACTGTCCCGGGGGGAAATTGTCGAGAGAAATAGGACATTTGACCAATCTGAGGATTTTGGACGTCAATCGCTCTTGGGGAGAATTCAA
>augustus_masked-Fvb3-3-processed-gene-289.0:2282:2402:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_16::augustus_masked-Fvb3-3-processed-gene-289.0:2282-2402||RAPiDGENOMICS_rs1205_01651
TTGGAATTACTTTTGTATAACCATCAAGGGCAGATGCACCAGCTCAAAAGACTGCCACTGTTTCTACGAACAAGGAGATCGTAATTCAAGATCCTTGTTTCTTAATGGAGCAACCATCAG
>augustus_masked-Fvb3-3-processed-gene-289.0:2522:2642:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_18::augustus_masked-Fvb3-3-processed-gene-289.0:2522-2642||RAPiDGENOMICS_rs1205_01652
CAAGCATCTCACGGTTGAATCTTCTGACTTGAAAGAGTTGATGAACACAACAAGACGAGTTGAAACAGGACCCGTGTTTGAGAATTTGGAAGAGTTGCATCTGATATATCTGTACCACCT
>augustus_masked-Fvb3-3-processed-gene-289.0:2762:2882:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_20::augustus_masked-Fvb3-3-processed-gene-289.0:2762-2882||RAPiDGENOMICS_rs1205_01653
GGAGATACTAGATTTAAAAGGTACGTTCGAATTGAAATATGTGTTTAGATGCGAAGGGTTCGAGCCAAAACAAGCAAAACTGAGAGAGATGCATTTGTCGTGGCTATTAGCACTAAGAAG
>augustus_masked-Fvb3-3-processed-gene-289.0:2882:3002:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_21::augustus_masked-Fvb3-3-processed-gene-289.0:2882-3002||RAPiDGENOMICS_rs1205_01654
CATATGTAGTGGTCCTGCCCCACGTGCAATGTTCCAAAGTCTTAAAATTTTGACCATTTCCAGGTGTGTGACGCTGCAAAGTCTGTTCACATGTGATGTATCCCAATGTCTTGTTCAATT
>augustus_masked-Fvb3-3-processed-gene-289.0:60:180:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-289.0:60-180|2x||RAPiDGENOMICS_rs1205_01655
TTCAGGGGTCCTGACACTCGCAAAGGGATTGCAAACGAGATCTACAATCGACTTAGTACAAGTGGCATTAAAACGTTCATGGATGAACCAGATCTTAGAGTAGGGGATACCATTTCGCCC
>augustus_masked-Fvb3-3-processed-gene-289.0:842:962:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-289.0:842-962||RAPiDGENOMICS_rs1205_01656
GTTGCACAAGGAGATAATGGGAAAAGAAAAGCTCCTTATAATCTTGGACGATGTATGGGATAAAATAAAGTTGTCAAAGATAGGGATTCCCCCCTACAATGAGCTTCAAAAGTGTAAGTC
>augustus_masked-Fvb3-3-processed-gene-289.0:902:1022:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-289.0:902-1022|2x||RAPiDGENOMICS_rs1205_01657
TAAAATAAAGTTGTCAAAGATAGGGATTCCCCCCTACAATGAGCTTCAAAAGTGTAAGTCCAAAGTGCTACTCACCACGAGGAGATTGAGTGTCTGTAATGCCATGCAGTGCCATGAAAA
>augustus_masked-Fvb3-3-processed-gene-289.0:962:1082:Parent=augustus_masked-Fvb3-3-processed-gene-289.0-mRNA-1_5::augustus_masked-Fvb3-3-processed-gene-289.0:962-1082||RAPiDGENOMICS_rs1205_01658
CAAAGTGCTACTCACCACGAGGAGATTGAGTGTCTGTAATGCCATGCAGTGCCATGAAAAAATCGCCCTCAACATTCTATCAAAAGAAGATTCTTGGAACTTGTTTCTGAGAAATGCAGG
>augustus_masked-Fvb3-3-processed-gene-292.13:1004:1124:Parent=augustus_masked-Fvb3-3-processed-gene-292.13-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-292.13:1004-1124||RAPiDGENOMICS_rs1205_01659
TGCCCTTCAGAAAGCAATTCAAGAGTCCAGAATTTCTATCGTCGTCTTTTCGGAGAATTATGCTTCCTCTGAGTGGTGCTTGGAAGAACTCGTCAGCATTCTTCACTGTAAAGAATCAAA
>augustus_masked-Fvb3-3-processed-gene-292.13:1124:1244:Parent=augustus_masked-Fvb3-3-processed-gene-292.13-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-292.13:1124-1244||RAPiDGENOMICS_rs1205_01660
GCAACAACTGGTTTACCCTGTTTTTTACAACGTAGATCCATCGGATGTACGACATCAAAGAGGTAGTTTTGGCCAAGCACTAGCTCACCACGAAAGCAGATTAAAAGACAACTTGGAGAA
>augustus_masked-Fvb3-3-processed-gene-292.13:1184:1304:Parent=augustus_masked-Fvb3-3-processed-gene-292.13-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-292.13:1184-1304|2x||RAPiDGENOMICS_rs1205_01661
AGGTAGTTTTGGCCAAGCACTAGCTCACCACGAAAGCAGATTAAAAGACAACTTGGAGAAAGTCACGAGATGGAGGGAAACCCTTACAAAAGCATCAAATCTCTCTGGCCTGCATTTCAT
>augustus_masked-Fvb3-3-processed-gene-292.13:1244:1364:Parent=augustus_masked-Fvb3-3-processed-gene-292.13-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-292.13:1244-1364||RAPiDGENOMICS_rs1205_01662
AGTCACGAGATGGAGGGAAACCCTTACAAAAGCATCAAATCTCTCTGGCCTGCATTTCATAGATGGAAGGTACTGCTCTGCTTGCATATGCTTACAAAATTTCTCACAAAATATAAAAGC
>augustus_masked-Fvb3-3-processed-gene-292.13:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-292.13-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-292.13:240-360||RAPiDGENOMICS_rs1205_01663
GGGACTATTCCCAAGTGTTTGAATAACTTGACTGCTCTAGTCTCTGGTCCGGATGACTGGAATATCTATAGTGAATTTGAGGAAACAACCGCGACTACAAAAGGAAGAGAAAGTGAATAC
>augustus_masked-Fvb3-3-processed-gene-292.13:360:480:Parent=augustus_masked-Fvb3-3-processed-gene-292.13-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-292.13:360-480||RAPiDGENOMICS_rs1205_01664
TTCTCTGACCAGGCAAGGCTTCTGACCATTATTGACCTTTCTTCAAACGATTTAGAAGGTGAAATTCCTGAAGAAATTAGCAGCCTCGTTTCATTGGGTACCTTGAACTTGTCCATGAAT
>augustus_masked-Fvb3-3-processed-gene-292.13:540:660:Parent=augustus_masked-Fvb3-3-processed-gene-292.13-mRNA-1_5::augustus_masked-Fvb3-3-processed-gene-292.13:540-660|2x||RAPiDGENOMICS_rs1205_01665
CTCTCCCAGAACCGGCTCTCAGGACACATTCCTCAAAGTCTCTCAAATATGACATTCTTGTCTCACTTGAACTTGTCTCACAACAAGTTGACCGGAAGGATCCCATCAGGCAACCAACTT
>augustus_masked-Fvb3-3-processed-gene-292.13:60:180:Parent=augustus_masked-Fvb3-3-processed-gene-292.13-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-292.13:60-180|2x||RAPiDGENOMICS_rs1205_01666
CGAAGACTTTCTCTTGGAGGCAACAAATTCACCGGAAGCATACCTTCTTGGATAGGATCAAAGGTATCCGGATTCCAAGTGCTACAATTGCGATCAAACTCGTTAAGCGGACATATTCCT
>augustus_masked-Fvb3-3-processed-gene-292.13:884:1004:Parent=augustus_masked-Fvb3-3-processed-gene-292.13-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-292.13:884-1004||RAPiDGENOMICS_rs1205_01667
TTTTAGAGGTGAGGATACACGCAACAATTTCACAGGCCATTTGCACAGCAATTTGGTCCGGAAAGGAATCAAAACCTTCATAGACGATGAAGGACTTGGAAGAGGAGATGAGCTATCACA
>augustus_masked-Fvb3-3-processed-gene-292.13:944:1064:Parent=augustus_masked-Fvb3-3-processed-gene-292.13-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-292.13:944-1064|2x||RAPiDGENOMICS_rs1205_01668
GAAAGGAATCAAAACCTTCATAGACGATGAAGGACTTGGAAGAGGAGATGAGCTATCACATGCCCTTCAGAAAGCAATTCAAGAGTCCAGAATTTCTATCGTCGTCTTTTCGGAGAATTA
>augustus_masked-Fvb3-3-processed-gene-38.8:2027:2147:Parent=augustus_masked-Fvb3-3-processed-gene-38.8-mRNA-1_8::augustus_masked-Fvb3-3-processed-gene-38.8:2027-2147||RAPiDGENOMICS_rs1205_01669
TACGGGGTCATTGGTGGGTGGCAGCGAGCTTCAGATATTTCAGAACCTGAAGGTGTTGGATCTTAGCTACAACCAGCTGTCTGGAGAATTGCCTGGATTTAATTTTGTATATGACCTCCA
>augustus_masked-Fvb3-3-processed-gene-38.8:2977:3097:Parent=augustus_masked-Fvb3-3-processed-gene-38.8-mRNA-1_7::augustus_masked-Fvb3-3-processed-gene-38.8:2977-3097||RAPiDGENOMICS_rs1205_01670
TGAGAAAGTTTCCGAGTTCTTCCTTCTATCCAGGGAATACGCGTTTGTGGTTCCCAAATGGTGGTCCTCCTGGATCAAACAGTTCTGAAGCTGAACATTCAAAAAGGAAACCATTCAGCA
>augustus_masked-Fvb3-3-processed-gene-38.8:3808:3928:Parent=augustus_masked-Fvb3-3-processed-gene-38.8-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-38.8:3808-3928||RAPiDGENOMICS_rs1205_01671
ACCGACCAGGAAGAAAAGGTCCGCCATTGACCTGGGCCCAAAGACTCAAAATTGCAGTTGATGTTGCACGCGGCCTGAACTACCTCCATTTTGATCGTGCTGTTCCGCATGGTAACCTTA
>augustus_masked-Fvb3-3-processed-gene-38.8:4168:4288:Parent=augustus_masked-Fvb3-3-processed-gene-38.8-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-38.8:4168-4288||RAPiDGENOMICS_rs1205_01672
TCTCTGGCGAAGGAGGAGGGGCAGATTTGACTGATTGGGTGAGGTTGAGGGTAGCAGAAGGTCGTGGCTCAGATTGTTTTGATGCTACATTAGTGACTGAGATGGGAAATCCAGCAGCAG
>augustus_masked-Fvb3-3-processed-gene-59.4:120:240:Parent=augustus_masked-Fvb3-3-processed-gene-59.4-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-59.4:120-240||RAPiDGENOMICS_rs1205_01673
TTCTTGTCTCACTTGAACTTGTCTCACAACAAGTTAACCGGGAGGATCCCATCAGGCAACCAGCTTCAAACGCTGGATGATTCATCTATTTATGGGGGCAATTCACTTTGTGGATTTCCA
>augustus_masked-Fvb3-3-processed-gene-59.4:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-59.4-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-59.4:240-360||RAPiDGENOMICS_rs1205_01674
CTTCCAAAATGCCCAAAAGAAGACGAAGACAACATGCATGAGCCTCGTGCACATGAGAAACAAGATCACGGAGATGATGAGGAAAAGCTTGGTTTCTATACCAGTGCGGTGCTCGGATTC
>augustus_masked-Fvb3-3-processed-gene-59.6:0:120:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-59.6:0-120||RAPiDGENOMICS_rs1205_01675
ATGGGCCTCAAAGGTCAGATACCTCCGATCATAGGACATCTGTGCAAGCTAAAGATGTTAAATCTTGCAGAAAACAGTTTTAATGGATCTCTTTTCTCAAGTTGTCGAGATATTGAGGGG
>augustus_masked-Fvb3-3-processed-gene-59.6:1028:1148:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-59.6:1028-1148||RAPiDGENOMICS_rs1205_01676
CGAGTTAACAACAGTCATCATGAAAGGAAGAGAACTTGTCTATAGCGGTGATCATACACTAGCTTATGTAAATACAACTGATTTTTCGTCTAATAATTTAGAAGGTGAAATTCCTGAAGA
>augustus_masked-Fvb3-3-processed-gene-59.6:1148:1268:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-59.6:1148-1268||RAPiDGENOMICS_rs1205_01677
CATAAGCTCTCTCGTCGGGTTGAATTCCTTGAACTTGTCGAAGAACCATTTAGTTGAAAAGATTTCATGGAAGTTCGGAAACTTAACCAAGTTGGAAACTCTTGATCTCTCACACAACCA
>augustus_masked-Fvb3-3-processed-gene-59.6:120:240:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-59.6:120-240||RAPiDGENOMICS_rs1205_01678
ATGGCAAGTGAATTGCAGTATCTCGACCTCAGTTTCAACTCTCTTTCCGGGTCATTTCCAGAATCTTTTCAATACTTACCATCCTTGAGAACACTAGACCTCTCTTCTAATCGTATGAAC
>augustus_masked-Fvb3-3-processed-gene-59.6:1208:1328:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-59.6:1208-1328|2x||RAPiDGENOMICS_rs1205_01679
GATTTCATGGAAGTTCGGAAACTTAACCAAGTTGGAAACTCTTGATCTCTCACACAACCACCTTTCAGGAGAGATTCCCCAAAGCTTTTCTTCTTTGACCTCCTTGTCTCACTTGGGCTT
>augustus_masked-Fvb3-3-processed-gene-59.6:1328:1448:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_5::augustus_masked-Fvb3-3-processed-gene-59.6:1328-1448|2x||RAPiDGENOMICS_rs1205_01680
GTCTTACAATAACCTGTCTGGAAGAATTTCTTCAGGTTTCCAACTTCAAACACTGGATAATTCATCCTACTTGGAGAATCCATTTCTGTGGTTTTCCTCTTTCATCCAAGTGCGAGGGAG
>augustus_masked-Fvb3-3-processed-gene-59.6:180:300:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-59.6:180-300|2x||RAPiDGENOMICS_rs1205_01681
GAATCTTTTCAATACTTACCATCCTTGAGAACACTAGACCTCTCTTCTAATCGTATGAACGGTTCCATTACTCCTCAAAGCTTGGGACAACTCTCTCAGCTAGTCCACCTAGATCTGTCT
>augustus_masked-Fvb3-3-processed-gene-59.6:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-59.6:240-360||RAPiDGENOMICS_rs1205_01682
GGTTCCATTACTCCTCAAAGCTTGGGACAACTCTCTCAGCTAGTCCACCTAGATCTGTCTTGGAATTCATGGAAGGGAGTTCTAAGTGAAATGCATTTCGTAAACGTTACGATACTAGAG
>augustus_masked-Fvb3-3-processed-gene-59.6:300:420:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-59.6:300-420|2x||RAPiDGENOMICS_rs1205_01683
TGGAATTCATGGAAGGGAGTTCTAAGTGAAATGCATTTCGTAAACGTTACGATACTAGAGACATTTCAAATAAGCACAGAGAAACCAACTTTGTCATCATCATCCCTCGTTTTCAATGTG
>augustus_masked-Fvb3-3-processed-gene-59.6:360:480:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-59.6:360-480||RAPiDGENOMICS_rs1205_01684
ACATTTCAAATAAGCACAGAGAAACCAACTTTGTCATCATCATCCCTCGTTTTCAATGTGACTGATGACTGGCTTCCCCCATTCAGCCTTTGCACAATTTACATTCGAGACTGCAATGTG
>augustus_masked-Fvb3-3-processed-gene-59.6:495:615:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-59.6:495-615||RAPiDGENOMICS_rs1205_01685
TTGCCTAACAATGACATTGATGGAAAGTTTCCGTTCCAATTCAAGTTCCCGAAAATACATTTCATGGATTTGAGTCACAATCAATTTGAGGGTACACTCCATATATCGCAAGTTAATGCT
>augustus_masked-Fvb3-3-processed-gene-59.6:555:675:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-59.6:555-675|2x||RAPiDGENOMICS_rs1205_01686
TTCATGGATTTGAGTCACAATCAATTTGAGGGTACACTCCATATATCGCAAGTTAATGCTCCTCAATTACAAATATTGTATCTTTCTAATAATCATTTCAATGGAACCATTCCACCTTCA
>augustus_masked-Fvb3-3-processed-gene-59.6:60:180:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-59.6:60-180|2x||RAPiDGENOMICS_rs1205_01687
AATCTTGCAGAAAACAGTTTTAATGGATCTCTTTTCTCAAGTTGTCGAGATATTGAGGGGATGGCAAGTGAATTGCAGTATCTCGACCTCAGTTTCAACTCTCTTTCCGGGTCATTTCCA
>augustus_masked-Fvb3-3-processed-gene-59.6:615:735:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-59.6:615-735||RAPiDGENOMICS_rs1205_01688
CCTCAATTACAAATATTGTATCTTTCTAATAATCATTTCAATGGAACCATTCCACCTTCAATTTGCCAAGTGCAACATATGGTAAGCCTCTCTTTAACAAACAATCAGTTTTGTGGAGAG
>augustus_masked-Fvb3-3-processed-gene-59.6:788:908:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-59.6:788-908||RAPiDGENOMICS_rs1205_01689
TGGCAACAAACTCACAGGAATCCTACCTAAATGGATGGGGTTAGAGCCACTGAAATTGCACGTTTTACAATTGCGATCCAACTTTCGAAGTGGAAATATTCCCCAACAACTGTGCAATCT
>augustus_masked-Fvb3-3-processed-gene-59.6:848:968:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-59.6:848-968|2x||RAPiDGENOMICS_rs1205_01690
CGTTTTACAATTGCGATCCAACTTTCGAAGTGGAAATATTCCCCAACAACTGTGCAATCTTCCACACCTTCATATCCTGGACCTCAGCCATAACAACATTTCAGGGACAATTCCGACGTG
>augustus_masked-Fvb3-3-processed-gene-59.6:908:1028:Parent=augustus_masked-Fvb3-3-processed-gene-59.6-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-59.6:908-1028||RAPiDGENOMICS_rs1205_01691
TCCACACCTTCATATCCTGGACCTCAGCCATAACAACATTTCAGGGACAATTCCGACGTGTTTGAGTAACTTGACTAATCTAGTCTCTGGGTACCCTCCTGATGCCTATGAAGGTGACGA
>augustus_masked-Fvb3-3-processed-gene-60.9:0:120:Parent=augustus_masked-Fvb3-3-processed-gene-60.9-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-60.9:0-120||RAPiDGENOMICS_rs1205_01692
ATGGACTTCAGTGGCAACCAACTCACTGGAATACTACCTAAGTGGATAGGGTCAGAGCTATCAAAATTGGAAGTTTTGCAATTGCGATTCAACTTTTTAAGCGGAAATATTCCCCAACAG
>augustus_masked-Fvb3-3-processed-gene-60.9:120:240:Parent=augustus_masked-Fvb3-3-processed-gene-60.9-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-60.9:120-240||RAPiDGENOMICS_rs1205_01693
TTGTGCGATCTTCAATTCCTCCATATCCTAGACCTCAGCCATAACAACATTTCAGAGACTATTCCGACGTGTATGAGTAACACGACCACTCTACGCTCTAATGTATCCTCTTGGAGATTT
>augustus_masked-Fvb3-3-processed-gene-60.9:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-60.9-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-60.9:240-360||RAPiDGENOMICS_rs1205_01694
TATGTTGGTTACGACGAGTTAACCACAGTTATCATGAAAGGAAGAGAACTTGACTATAGCATTCAGCATACATTACATATGGTGATGAGCATTGATTTTTCCTCTAATAATTTCGAAGGC
>augustus_masked-Fvb3-3-processed-gene-60.9:60:180:Parent=augustus_masked-Fvb3-3-processed-gene-60.9-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-60.9:60-180|2x||RAPiDGENOMICS_rs1205_01695
TCAAAATTGGAAGTTTTGCAATTGCGATTCAACTTTTTAAGCGGAAATATTCCCCAACAGTTGTGCGATCTTCAATTCCTCCATATCCTAGACCTCAGCCATAACAACATTTCAGAGACT
>augustus_masked-Fvb3-3-processed-gene-66.12:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-66.12-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-66.12:240-360||RAPiDGENOMICS_rs1205_01696
GCCACAAAAATGGATCGAAAGCTCATGTTTATAATTGTTTTCCCTGTTTTTGGAACACTTCTACTTTCACTTGCCTTCCTTGGGATTGCCTTGGTTAGGAAAAGAAGAAACAAAAGGCAG
>augustus_masked-Fvb3-3-processed-gene-66.12:60:180:Parent=augustus_masked-Fvb3-3-processed-gene-66.12-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-66.12:60-180|2x||RAPiDGENOMICS_rs1205_01697
ATACCCAAAAATTTTGAACAAATGCAAAGCTTGGTTCAGATCGACATATCCTACAACCAGTTGCAGGGTCCCGTCCCAAAAAACAAACCATTTCAAGATGCTGCTCATTTGGAAGGCAAT
>augustus_masked-Fvb3-3-processed-gene-66.12:600:720:Parent=augustus_masked-Fvb3-3-processed-gene-66.12-mRNA-1_6::augustus_masked-Fvb3-3-processed-gene-66.12:600-720||RAPiDGENOMICS_rs1205_01698
GAAATAAGGGCGTTAATAGAGATACGGCACCGGAACATTGTCAAACTTCGTGGTTTCTGTTCACACGCCCATCACTCGTTTTTGGTCTATGACTACCTAGAAAAGGGTAGCTTGGCTTCA
>augustus_masked-Fvb3-3-processed-gene-66.12:720:840:Parent=augustus_masked-Fvb3-3-processed-gene-66.12-mRNA-1_7::augustus_masked-Fvb3-3-processed-gene-66.12:720-840||RAPiDGENOMICS_rs1205_01699
AAGTTGAGCAAAGAAGACGAACCTAACAAACTGGATTGGAGCATAAGGGTGAGGATAGTGAAAGGTGTAGCTCATGCCCTTTCTTATATGCATCATGACTGCTCACCCCCTATAGTGCAC
>augustus_masked-Fvb3-3-processed-gene-66.12:840:960:Parent=augustus_masked-Fvb3-3-processed-gene-66.12-mRNA-1_8::augustus_masked-Fvb3-3-processed-gene-66.12:840-960||RAPiDGENOMICS_rs1205_01700
CGAGACATATCAAGCAACAACATTTTGCTCAATCACGAATATGAGCCTTGTGTTTCAGACTTCGGCACTGCTAAGCTTCTAAATGCAGACTCATCAAATTGGACTGCCCGTGCAGGCACA
>augustus_masked-Fvb3-3-processed-gene-66.12:979:1099:Parent=augustus_masked-Fvb3-3-processed-gene-66.12-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-66.12:979-1099||RAPiDGENOMICS_rs1205_01701
AGCTGGCTTACACAATGAAGGTAACTGAGAAATGCGATGTTTATAGCTTTGGGGTGCTGGCACTGGAAGTGATAATGGGGAAGCGGCTGGGTGAAATCATCTCCTCCTTTTCGTCTCAAT
>augustus_masked-Fvb3-3-processed-gene-77.5:0:120:Parent=augustus_masked-Fvb3-3-processed-gene-77.5-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-77.5:0-120||RAPiDGENOMICS_rs1205_01702
ATGAGAGCTTCAAGTTTCTATGATTGTTTTTGCTCTCTAGTTTGCCTTACCTTGTGCCTGGAGCAGCGTCAGTTGTTTGCATTTGCTTCTGCTTCTATTAATTCCGCTTCTGAAGCAGAG
>augustus_masked-Fvb3-3-processed-gene-77.5:180:300:Parent=augustus_masked-Fvb3-3-processed-gene-77.5-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-77.5:180-300|2x||RAPiDGENOMICS_rs1205_01703
ACCTATAATCCCAGTACTAGTAATGCCATTAACTCTTCCGGAAACCCAGAAGCAAATGCAAGCGCTTGCAACGGTGCTTGGAGTGGTGTTTCATGCAACAAAGCTGGAAGCGTGAGCAAC
>augustus_masked-Fvb3-3-processed-gene-77.5:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-77.5-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-77.5:240-360||RAPiDGENOMICS_rs1205_01704
AGCGCTTGCAACGGTGCTTGGAGTGGTGTTTCATGCAACAAAGCTGGAAGCGTGAGCAACATAAGCCTTTCCGATTTTGGTTTACAAGGTACGCTGCATGAATTCTTGTTCTCCTCCTTC
>augustus_masked-Fvb3-3-processed-gene-77.5:360:480:Parent=augustus_masked-Fvb3-3-processed-gene-77.5-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-77.5:360-480||RAPiDGENOMICS_rs1205_01705
CCTAATCTTGAATATCTGGACCTCAGCTTCAATAAACTCTTCGACATCATCCCACCTCAGATCAGTTCCCTCACCAAACTTGTGTATCTTCATCTAAGCAATAATCAGTTTTCAGGGAGA
>augustus_masked-Fvb3-3-processed-gene-77.5:420:540:Parent=augustus_masked-Fvb3-3-processed-gene-77.5-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-77.5:420-540|2x||RAPiDGENOMICS_rs1205_01706
ATCAGTTCCCTCACCAAACTTGTGTATCTTCATCTAAGCAATAATCAGTTTTCAGGGAGAATCCCACTAGAAATCGGTCTTCTAAGAAATCTAACCTTCCTTAATCTCCATGATAATAAT
>augustus_masked-Fvb3-3-processed-gene-77.5:480:600:Parent=augustus_masked-Fvb3-3-processed-gene-77.5-mRNA-1_5::augustus_masked-Fvb3-3-processed-gene-77.5:480-600||RAPiDGENOMICS_rs1205_01707
ATCCCACTAGAAATCGGTCTTCTAAGAAATCTAACCTTCCTTAATCTCCATGATAATAATCTTAATGATATTATTCCTAAACAGATAGGACACCTGAAATCTCTCATGGAGCTAGGATTA
>augustus_masked-Fvb3-3-processed-gene-86.15:0:120:Parent=augustus_masked-Fvb3-3-processed-gene-86.15-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-86.15:0-120||RAPiDGENOMICS_rs1205_01708
ATGGCAATGGGGATAACTTGTTGGATGTTGTTTATCGTAACCCTAAGCGCAAGTCTCATTCATGAAGCATACACTCTCTCAGAGGTAGAAGTTTTGCTTAAATTCAAGGCGAGCATTGTT
>augustus_masked-Fvb3-3-processed-gene-86.15:120:240:Parent=augustus_masked-Fvb3-3-processed-gene-86.15-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-86.15:120-240||RAPiDGENOMICS_rs1205_01709
GATCCCTTATATGTGCTCAGTGGTTGGAAAACAACAAAGCCTGGCTATTATCCATGTTGGTGGTTAGGCATTCAGTGCAATAATGAAGGGAAGGTCATTGAATTGTCCTTAGATGACTTC
>augustus_masked-Fvb3-3-processed-gene-86.15:180:300:Parent=augustus_masked-Fvb3-3-processed-gene-86.15-mRNA-1_2::augustus_masked-Fvb3-3-processed-gene-86.15:180-300|2x||RAPiDGENOMICS_rs1205_01710
TGGTTAGGCATTCAGTGCAATAATGAAGGGAAGGTCATTGAATTGTCCTTAGATGACTTCAAGCTAGCCGGGCAACTTCCACCCGAACTCGGACAACTTTCGGCTCTCCAGACTCTAAAA
>augustus_masked-Fvb3-3-processed-gene-86.15:240:360:Parent=augustus_masked-Fvb3-3-processed-gene-86.15-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-86.15:240-360||RAPiDGENOMICS_rs1205_01711
AAGCTAGCCGGGCAACTTCCACCCGAACTCGGACAACTTTCGGCTCTCCAGACTCTAAAACTAGATTCAAACAACATCACAGGAACAATACCAGCTGAGCTTGGTAACCTAAAGGGACTA
>augustus_masked-Fvb3-3-processed-gene-86.15:300:420:Parent=augustus_masked-Fvb3-3-processed-gene-86.15-mRNA-1_3::augustus_masked-Fvb3-3-processed-gene-86.15:300-420|2x||RAPiDGENOMICS_rs1205_01712
CTAGATTCAAACAACATCACAGGAACAATACCAGCTGAGCTTGGTAACCTAAAGGGACTAGTGGAGCTCAATTTTAGCTGCAACAAGTTAACCGGGAAAATCCCATCCGGACTTGGAAGC
>augustus_masked-Fvb3-3-processed-gene-86.15:360:480:Parent=augustus_masked-Fvb3-3-processed-gene-86.15-mRNA-1_4::augustus_masked-Fvb3-3-processed-gene-86.15:360-480||RAPiDGENOMICS_rs1205_01713
GTGGAGCTCAATTTTAGCTGCAACAAGTTAACCGGGAAAATCCCATCCGGACTTGGAAGCCTTCCGAACCTCGTGAAAGCTGATTTTTCCAACAATGACAACTTATGTTGGGATTTTTGG
>augustus_masked-Fvb3-3-processed-gene-86.15:60:180:Parent=augustus_masked-Fvb3-3-processed-gene-86.15-mRNA-1_1::augustus_masked-Fvb3-3-processed-gene-86.15:60-180|2x||RAPiDGENOMICS_rs1205_01714
CATGAAGCATACACTCTCTCAGAGGTAGAAGTTTTGCTTAAATTCAAGGCGAGCATTGTTGATCCCTTATATGTGCTCAGTGGTTGGAAAACAACAAAGCCTGGCTATTATCCATGTTGG
>augustus_masked-Fvb3-4-processed-gene-0.1:141:261:Parent=augustus_masked-Fvb3-4-processed-gene-0.1-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-0.1:141-261||RAPiDGENOMICS_rs1205_01715
AAAGGGATTACAGCCCAAATACGCGATCGACTTCATAGAAGTGGCATTATAACGTTCATGGATGAACCAGATCTTAAAGTAGGGGATACTATTTCGCCCACCCTCATAAAGGCAATTAAA
>augustus_masked-Fvb3-4-processed-gene-0.1:21:141:Parent=augustus_masked-Fvb3-4-processed-gene-0.1-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-0.1:21-141||RAPiDGENOMICS_rs1205_01716
ATATCGTTGGCGATTGTTGCGGTAAGAAACTTGAATGCCTCTGAATCTCTTGCTTCATCATCAGAACCTCTTCGCTGGAAGTATAATGTGTTTTTGAGTTTCAGGGGTCCTGACACTCGC
>augustus_masked-Fvb3-4-processed-gene-0.1:269:389:Parent=augustus_masked-Fvb3-4-processed-gene-0.1-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-0.1:269-389||RAPiDGENOMICS_rs1205_01717
ACCACCTGATGCAATTGAATCCACAAGAGATTTCCAAGAATATGAAGCAACAACACAAGCCATGAACAAGGTTAAAAAGGCGCAAACTAATGACCAGACCACTGCCGTTGGTGTCTATGG
>augustus_masked-Fvb3-4-processed-gene-0.1:417:537:Parent=augustus_masked-Fvb3-4-processed-gene-0.1-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-0.1:417-537||RAPiDGENOMICS_rs1205_01718
GACATATTAGCAGATCTGCTGGGCTTCAAATTAAAAGAGAAGACAGAAGCTGGAAGAGCAGATAAGTTGCATAAGGAGATCATGAGAAATGAAAAACTCCTGATAATTGTGGATGATGTT
>augustus_masked-Fvb3-4-processed-gene-0.1:81:201:Parent=augustus_masked-Fvb3-4-processed-gene-0.1-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-0.1:81-201|2x||RAPiDGENOMICS_rs1205_01719
TCAGAACCTCTTCGCTGGAAGTATAATGTGTTTTTGAGTTTCAGGGGTCCTGACACTCGCAAAGGGATTACAGCCCAAATACGCGATCGACTTCATAGAAGTGGCATTATAACGTTCATG
>augustus_masked-Fvb3-4-processed-gene-10.8:1020:1140:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-10.8:1020-1140|2x||RAPiDGENOMICS_rs1205_01720
AGACTTGGTCAACTTCGTAAACTTGTCTTCGTCAGTAATCATTTTACTGGTATCTTGCCAATAAGCCTTTACTCATGCAAGTCCCTTAGAGCAATTCAATTAAGCCACAACAACCTAGAG
>augustus_masked-Fvb3-4-processed-gene-10.8:1140:1260:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-10.8:1140-1260|2x||RAPiDGENOMICS_rs1205_01721
GGACAAATACAACCCGAGATTGCCTCATTAAAACACTTATCCTTCCTCGCACTTTCTGGGAACAGACTGACCAATCTCACAGGTGCTATGGATATATTGAAGGGCTGCAGAAATCTCACT
>augustus_masked-Fvb3-4-processed-gene-10.8:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-10.8:120-240||RAPiDGENOMICS_rs1205_01722
TTTGCCCTCACTCTGTCTTCTCCTTCCTTAAATTGGACTAGCTTGGATTGTTGCAAATGGGAAGGCATTACTTGTGATGCGGTTGGTCGAGTAACCCATTTGCACCTATCCTCCAAAGGC
>augustus_masked-Fvb3-4-processed-gene-10.8:1200:1320:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-10.8:1200-1320||RAPiDGENOMICS_rs1205_01723
AACAGACTGACCAATCTCACAGGTGCTATGGATATATTGAAGGGCTGCAGAAATCTCACTGTACTCATTCTTTCATACAACTTCATAGGTGAAGAAATGCCAGATGGTGATCACATCGCT
>augustus_masked-Fvb3-4-processed-gene-10.8:1440:1560:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_13::augustus_masked-Fvb3-4-processed-gene-10.8:1440-1560||RAPiDGENOMICS_rs1205_01724
AGAATCACAGGTTCAATTCCTACTTGGTTGGGGACTTCTCCAACACTTTTTTCTATAAACTTGCGGTCCAACCTAATCTCAGGTCAAATTCCAAAAGAACTTTGCACACTACCAATGTTG
>augustus_masked-Fvb3-4-processed-gene-10.8:1680:1800:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-10.8:1680-1800||RAPiDGENOMICS_rs1205_01725
TCTATAATGTTAGGCAACAATAGCATCAGTGGCAATATACCTACTGAAATCGGGAAGTTGCAACTTCTCCATATATTGGATCTCAGCGCCAACCAGGTGTCCGGCAACATTCCAGACCAA
>augustus_masked-Fvb3-4-processed-gene-10.8:1740:1860:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-10.8:1740-1860|2x||RAPiDGENOMICS_rs1205_01726
CAACTTCTCCATATATTGGATCTCAGCGCCAACCAGGTGTCCGGCAACATTCCAGACCAAATATCGAATCTCAACAACTTGGAGACTCTGGATCTTTCAATGAATCATTTGTCAGGAGAA
>augustus_masked-Fvb3-4-processed-gene-10.8:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-10.8:180-300|2x||RAPiDGENOMICS_rs1205_01727
GAAGGCATTACTTGTGATGCGGTTGGTCGAGTAACCCATTTGCACCTATCCTCCAAAGGCCTCAAACTCAAAGGAGATCTTTTTTCCTCATCATCACTCAGTAATCTCACACATCTAACC
>augustus_masked-Fvb3-4-processed-gene-10.8:1800:1920:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_16::augustus_masked-Fvb3-4-processed-gene-10.8:1800-1920||RAPiDGENOMICS_rs1205_01728
ATATCGAATCTCAACAACTTGGAGACTCTGGATCTTTCAATGAATCATTTGTCAGGAGAAATCCCAGCTTCATTGGCGCATCTTAGTTTCTTGTCATCTTTAAATGTCTCATATAATAAT
>augustus_masked-Fvb3-4-processed-gene-10.8:1860:1980:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_16::augustus_masked-Fvb3-4-processed-gene-10.8:1860-1980|2x||RAPiDGENOMICS_rs1205_01729
ATCCCAGCTTCATTGGCGCATCTTAGTTTCTTGTCATCTTTAAATGTCTCATATAATAATTTGGAAGGAGAAATACCAAAAAGCACTCAGCTACAAGGCTTGAATGTCTCAGCATTTGAG
>augustus_masked-Fvb3-4-processed-gene-10.8:1920:2040:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_17::augustus_masked-Fvb3-4-processed-gene-10.8:1920-2040||RAPiDGENOMICS_rs1205_01730
TTGGAAGGAGAAATACCAAAAAGCACTCAGCTACAAGGCTTGAATGTCTCAGCATTTGAGGGGAATCCAAAGCTTTGTGGTTCCCCGCTTCTAAATCCGTGCCAACCATTCAATGGTACT
>augustus_masked-Fvb3-4-processed-gene-10.8:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-10.8:480-600||RAPiDGENOMICS_rs1205_01731
GGTGCAATTCCATCATCCTTCTTCCAACAAGCAAAGAACTTGTCTCATTTCAATGTCACGAACAACCAATTCACAGGTTATATCCCCTCCCCTATTTGTGTCCACTCTTCCTCTTTGATT
>augustus_masked-Fvb3-4-processed-gene-10.8:60:180:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-10.8:60-180|2x||RAPiDGENOMICS_rs1205_01732
TCCATTTCATCTACACATATTCATGCATACTCCTCAAGTGAAAGAACCTCTCTCTTGTCTTTTGCCCTCACTCTGTCTTCTCCTTCCTTAAATTGGACTAGCTTGGATTGTTGCAAATGG
>augustus_masked-Fvb3-4-processed-gene-10.8:720:840:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-10.8:720-840||RAPiDGENOMICS_rs1205_01733
GATATCTATAATTCTACCGCACTAGAAGAACTTGCAATCCCTGCAAATTCTTTTAGAGGGGGCATCAGTAACAGAATTGTTAAACTTACTAACCTCACAGTCCTTGACCTCTACCTGAAT
>augustus_masked-Fvb3-4-processed-gene-10.8:960:1080:Parent=augustus_masked-Fvb3-4-processed-gene-10.8-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-10.8:960-1080||RAPiDGENOMICS_rs1205_01734
ATGGAACTGAATCTAGGATTCAACCTTTTGGACGGAGATATCTCAGCTTATAATTTCTCTAGACTTGGTCAACTTCGTAAACTTGTCTTCGTCAGTAATCATTTTACTGGTATCTTGCCA
>augustus_masked-Fvb3-4-processed-gene-12.5:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-12.5:0-120||RAPiDGENOMICS_rs1205_01735
ATGGATTCAATCACCACTGAATTCGCAGCCTCTTCCTCTTCTGCTACGACTCATCAGTCGTGGACTTATGATGTCTTTCTGAGTTTCAGAGGTGATGATACACGCAACACTTTCGTAGCC
>augustus_masked-Fvb3-4-processed-gene-12.5:1052:1172:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-12.5:1052-1172|2x||RAPiDGENOMICS_rs1205_01736
TGACATATACAAGGTGGAGAAGTTAAGTCATCATGAAGCATTAGAGCTATTCAACTTTAATGCCTTCCAAGATCATAGACACAAGGAAGATTATGTTGAACTTGTCAAGAATGTCCTCCT
>augustus_masked-Fvb3-4-processed-gene-12.5:1112:1232:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-12.5:1112-1232||RAPiDGENOMICS_rs1205_01737
TGCCTTCCAAGATCATAGACACAAGGAAGATTATGTTGAACTTGTCAAGAATGTCCTCCTTTATGCTCAAGGGCTTCCATTGGCTCTAGAAGTTTTGGCTGCAGACTTACGTGGTAGAGA
>augustus_masked-Fvb3-4-processed-gene-12.5:1172:1292:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-12.5:1172-1292|2x||RAPiDGENOMICS_rs1205_01738
TTATGCTCAAGGGCTTCCATTGGCTCTAGAAGTTTTGGCTGCAGACTTACGTGGTAGAGATGTAAATCAATGGAAATATGCATTGGACAGTTATAGAAGTCTTCCCAAGCAAGAGATTCA
>augustus_masked-Fvb3-4-processed-gene-12.5:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-12.5:120-240||RAPiDGENOMICS_rs1205_01739
CATTTGCACAGCAATTTGGTCCGAAAGGGAATCAGAACCTTCTTGGACGATGATGGACTCAGAAGAGGAGTAGAGATATCATCCGAGCTACACAAAGCAATTGAAGAGTCAAAAGTTTCA
>augustus_masked-Fvb3-4-processed-gene-12.5:1292:1412:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-12.5:1292-1412|2x||RAPiDGENOMICS_rs1205_01740
GGAAGTTCTGAAAATAAGTTATCATGCACTTGAACATTCGATCAAAGAAGTTTTTCTTCATATTGCTTGCTTTTTCAAAGGCAAAAGTAAGGATTATGTAACACAGATACTAGAAGCCTG
>augustus_masked-Fvb3-4-processed-gene-12.5:1614:1734:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-12.5:1614-1734||RAPiDGENOMICS_rs1205_01741
GGATCAGATAAAGTTCAAGGCATCGTGATTAATAACTGGAATGACATGGGAGAAAAGATATGTTTGAGTAGTAAAAGCTTCTCAACATTGAAAAATCTTCGAGTCTTCATAATTTCTGGC
>augustus_masked-Fvb3-4-processed-gene-12.5:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-12.5:180-300|2x||RAPiDGENOMICS_rs1205_01742
AGAAGAGGAGTAGAGATATCATCCGAGCTACACAAAGCAATTGAAGAGTCAAAAGTTTCAATCGTTGTGTTCTCTGAAACTTATGCTTCTTCAAAGTGGTGCTTGGAAGAACTTGTGAAG
>augustus_masked-Fvb3-4-processed-gene-12.5:2004:2124:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-12.5:2004-2124||RAPiDGENOMICS_rs1205_01743
ATTATGCCAAGTTTGAAATCTATCGATTTGTCATATTGTTATGGTCTAACAAAACTGGCGCACTTCTCTAGATTCCCAAATTTAGTGGATTTGAATCTAAGTGGCTGTAAAAATTTGGTT
>augustus_masked-Fvb3-4-processed-gene-12.5:2124:2244:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-12.5:2124-2244||RAPiDGENOMICS_rs1205_01744
GGAGTTGATCCTTCCATTGGCTTTCTGAAGAATCTCCTTAGTTTGAACCTTGGATTCTGCGAGAAACTTAAGAACTTTGAGATTATGGAAGAGATGAAATCCTTAAAATGTCTGGATTTA
>augustus_masked-Fvb3-4-processed-gene-12.5:2244:2364:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-12.5:2244-2364||RAPiDGENOMICS_rs1205_01745
CGGGGGACTGCCATCAAAGAAATTTCTTCATCAATTGGACATCTCATTAGTCTTGAAAAGTTAATTTTGCGAGAATGCGCAAGACTTACAAATGTATCAAGCAGCATTTTTGAGTTGCAG
>augustus_masked-Fvb3-4-processed-gene-12.5:2364:2484:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-12.5:2364-2484||RAPiDGENOMICS_rs1205_01746
CATCTGCGGCATCTTGATCTGTTTTGGTGCGACAGTCTAGTTACATTTCCAACCAATTCAGGATTTTCAACCAGTTTACAGGGCAAACACTATGATCCTTTATTCGTCTCTCTGGACAGT
>augustus_masked-Fvb3-4-processed-gene-12.5:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-12.5:240-360||RAPiDGENOMICS_rs1205_01747
ATCGTTGTGTTCTCTGAAACTTATGCTTCTTCAAAGTGGTGCTTGGAAGAACTTGTGAAGATTCTCGAGTGTAAAGAGTCAAAGAAACAAATGGTTTACCCTGTATTTTATAAGGTAGAT
>augustus_masked-Fvb3-4-processed-gene-12.5:2484:2604:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-12.5:2484-2604||RAPiDGENOMICS_rs1205_01748
TGCACGAATCTCAAAGAAATTTTGAAATTTCCACGAGAAATAGATGGCTTGAATGTAAGGTGCTGCCGTGCATTGAAAATAATATCAAAGCTGTCAAACATATTGGAAGGTAAAGATTCA
>augustus_masked-Fvb3-4-processed-gene-12.5:2604:2724:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-12.5:2604-2724||RAPiDGENOMICS_rs1205_01749
AAGATGATTCCTCGTACGAACTTGTATTCCTGCAATGTATTGTGCCAAAATCTGGCTCAGATGAAGAAAAGTCATTTACGCGATGATTCCGCTGAAGCTGCTCCGTTGTCGGCTCTCTTT
>augustus_masked-Fvb3-4-processed-gene-12.5:2724:2844:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-12.5:2724-2844||RAPiDGENOMICS_rs1205_01750
CTCTCATGTCAGCAATCTGAATTCGAGGTTTTATATCCTGTCGATATGTTGCCTCCCAAAGAGTATCCCTCGTCTTCCGAAGAGGGTCCGTCGTCTGCGGAAGAGGATCGATTATATGCC
>augustus_masked-Fvb3-4-processed-gene-12.5:2844:2964:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-12.5:2844-2964||RAPiDGENOMICS_rs1205_01751
GAAAGTGGAGTTCCAGTGTGGTTCTCCTGGCGTAACACTGGAGAAAATTGGCCAGCATACAAGTTGAAAATTGAATTTCCCGGAGATTTCAATTGGGAGAACAGGGGATTGGCATTTTGT
>augustus_masked-Fvb3-4-processed-gene-12.5:2964:3084:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-12.5:2964-3084||RAPiDGENOMICS_rs1205_01752
GCTCAAAGTTATGAAACATTTAAGGGACCATATTTCAGATTCTGTGCTATCTACATTAATGGAGTACGCATCAAGGAACCATCCGAGAAGCCAGAAGAGCATCCGTGGAGGTTGTCAGAA
>augustus_masked-Fvb3-4-processed-gene-12.5:300:420:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-12.5:300-420|2x||RAPiDGENOMICS_rs1205_01753
ATTCTCGAGTGTAAAGAGTCAAAGAAACAAATGGTTTACCCTGTATTTTATAAGGTAGATCCATCGGATGTGCGAAACCAAAATGGTAGTTTTGGTAAAGCACTGGCTGATCATGAATGC
>augustus_masked-Fvb3-4-processed-gene-12.5:3084:3204:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-12.5:3084-3204||RAPiDGENOMICS_rs1205_01754
GATCATTTGTGGTTGTACTACATTCCATTCCATACTATAATAAGACGACTCAGTGAGAGTGGTTTACCGCCACCGTCCATGTGTCTGGTCAAGTTTGAATTTGAAGTTAAGGGGGGAAAG
>augustus_masked-Fvb3-4-processed-gene-12.5:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-12.5:360-480||RAPiDGENOMICS_rs1205_01755
CCATCGGATGTGCGAAACCAAAATGGTAGTTTTGGTAAAGCACTGGCTGATCATGAATGCACATTCAAGGATCGGTTGGAGAAAGTTGTGAGATGGAGGGAAGCTCTTACAAAAGCAGCC
>augustus_masked-Fvb3-4-processed-gene-12.5:512:632:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-12.5:512-632||RAPiDGENOMICS_rs1205_01756
TAATGAATCTAGGTTTATTGATGCAATCCTGGAAGAAGTTTCAGCAAAACTATTACACCGTACATATTTAAATGTGGCGAAGTACCCAGTTGGAATGGAATCTCGTGTAGAAGATATGCT
>augustus_masked-Fvb3-4-processed-gene-12.5:572:692:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-12.5:572-692|2x||RAPiDGENOMICS_rs1205_01757
TACATATTTAAATGTGGCGAAGTACCCAGTTGGAATGGAATCTCGTGTAGAAGATATGCTTAAACTTTTGAGTGTTGGGGGAAATGGTGTTCAAATGGTAGGGATATGGGGAGTTGGAGG
>augustus_masked-Fvb3-4-processed-gene-12.5:632:752:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-12.5:632-752||RAPiDGENOMICS_rs1205_01758
TAAACTTTTGAGTGTTGGGGGAAATGGTGTTCAAATGGTAGGGATATGGGGAGTTGGAGGAATAGGCAAAACTACACTTGCTAAAGCAGTTTACAATTCAGTTGCTCATCAATTTGAAGA
>augustus_masked-Fvb3-4-processed-gene-12.5:692:812:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-12.5:692-812|2x||RAPiDGENOMICS_rs1205_01759
AATAGGCAAAACTACACTTGCTAAAGCAGTTTACAATTCAGTTGCTCATCAATTTGAAGATAGTTGCTTTTTGGCAAATGTTAGAGAAGAGTCGATGACATCTGGAGGCTTTGTCCGTCT
>augustus_masked-Fvb3-4-processed-gene-12.5:812:932:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-12.5:812-932|2x||RAPiDGENOMICS_rs1205_01760
ACAAAAGATATTGTTTTCTGAGATTCTAGGGTGGAAAGATTTTTGTCCTTCTAGTGTTGATAGAGGAATCACTCTGATAAAACAAACAATGAGCAATAAAAGAGTGCTCTTAATTCTTGA
>augustus_masked-Fvb3-4-processed-gene-12.5:872:992:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-12.5:872-992||RAPiDGENOMICS_rs1205_01761
TAGAGGAATCACTCTGATAAAACAAACAATGAGCAATAAAAGAGTGCTCTTAATTCTTGATGATGTGAATCATTTGAACCAATTGAACAATTTAGTAGGAAATCCTAATTGGTTTGGTTC
>augustus_masked-Fvb3-4-processed-gene-12.5:932:1052:Parent=augustus_masked-Fvb3-4-processed-gene-12.5-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-12.5:932-1052|2x||RAPiDGENOMICS_rs1205_01762
TGATGTGAATCATTTGAACCAATTGAACAATTTAGTAGGAAATCCTAATTGGTTTGGTTCAGGCAGTAGAATAATCATAACAACTAGAGATAAGCATTGCTTAACTGGTCACGATGTCAA
>augustus_masked-Fvb3-4-processed-gene-14.13:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-14.13:0-120||RAPiDGENOMICS_rs1205_01763
ATGGCTAATGGCTTCCTTGTCCTCCTCCTCCTTTTCATATTCTCTACTTTCGTTACAAATATTCATGCATGCAATCAAACTGAACGCAGCTCTCTTCAATCCTTCGCCCTCACCTTGTCT
>augustus_masked-Fvb3-4-processed-gene-14.13:1320:1440:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_12::augustus_masked-Fvb3-4-processed-gene-14.13:1320-1440||RAPiDGENOMICS_rs1205_01764
CAAAATCTTCGGCTTTTGTATTTAGATGGTTGTGGCTTCACTGGTCAAATACCTGCATGGTTGTCTAAGCTCAAGAAGCTAGAGGTCTTGGATATGTCTTATAATAGTATCACTGGTTCC
>augustus_masked-Fvb3-4-processed-gene-14.13:1380:1500:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_12::augustus_masked-Fvb3-4-processed-gene-14.13:1380-1500|2x||RAPiDGENOMICS_rs1205_01765
TTGTCTAAGCTCAAGAAGCTAGAGGTCTTGGATATGTCTTATAATAGTATCACTGGTTCCATTCCCAGTTGGTTGGGGAATCTTCCAAGGCTCAAGTTTTTGAACTTGGGGGCCAACCTA
>augustus_masked-Fvb3-4-processed-gene-14.13:1500:1620:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_13::augustus_masked-Fvb3-4-processed-gene-14.13:1500-1620|2x||RAPiDGENOMICS_rs1205_01766
ATTTCAGGTGACCTTCCAAAGGAACTCTGTAGGCTACCAATGTGGATGTTCGAAAACACTACTGCTACTCAAGAAGATGATATTGAGCTTGAATTGCCCGTCTATGGATCGCTATTGTGG
>augustus_masked-Fvb3-4-processed-gene-14.13:1560:1680:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_14::augustus_masked-Fvb3-4-processed-gene-14.13:1560-1680||RAPiDGENOMICS_rs1205_01767
ACTGCTACTCAAGAAGATGATATTGAGCTTGAATTGCCCGTCTATGGATCGCTATTGTGGGTACAGTACACATTGTCTTACTTTCCTCTTGCAATGGGCTTAAAGAGCAATAACATTAGT
>augustus_masked-Fvb3-4-processed-gene-14.13:1620:1740:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_14::augustus_masked-Fvb3-4-processed-gene-14.13:1620-1740|2x||RAPiDGENOMICS_rs1205_01768
GTACAGTACACATTGTCTTACTTTCCTCTTGCAATGGGCTTAAAGAGCAATAACATTAGTGGGAGCATACCTATTGAGATTGGCCAACTGCAGCTCCGTCAGTTGGATCTTAGCAACAAC
>augustus_masked-Fvb3-4-processed-gene-14.13:1680:1800:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-14.13:1680-1800||RAPiDGENOMICS_rs1205_01769
GGGAGCATACCTATTGAGATTGGCCAACTGCAGCTCCGTCAGTTGGATCTTAGCAACAACAGCTTCACCGGAAACATCCCGGAGCAGATATCTAACCTCAAGAACATAGAGACATTGTCA
>augustus_masked-Fvb3-4-processed-gene-14.13:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-14.13:180-300|2x||RAPiDGENOMICS_rs1205_01770
AATCGGGGTGGTTCGGTCACTCATTTGAGCTTACCCTCCAAAGGCCTCAAACTCAAAGGAGGTGATTTCCCTTCTTCGTCACTGGAAAATCTCACACATCTAACCCACCTCAACCTCTCC
>augustus_masked-Fvb3-4-processed-gene-14.13:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-14.13:240-360||RAPiDGENOMICS_rs1205_01771
GGTGATTTCCCTTCTTCGTCACTGGAAAATCTCACACATCTAACCCACCTCAACCTCTCCCATAATTCACTTGATGGTTCGATAGAGCCAAGTAGTGGCTTCTTCTTGTCCTTGAGTCAT
>augustus_masked-Fvb3-4-processed-gene-14.13:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-14.13:360-480||RAPiDGENOMICS_rs1205_01772
CTTGAGGTACTTGATTTGAGCTATAACCTTCTTTCCGGAGAGCTACCACTTTCTCTACCATCCATCAATATTCAGATTGTGGATTTGTCCAACAATAACTTCCATGGTGCAATTCCATCT
>augustus_masked-Fvb3-4-processed-gene-14.13:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-14.13:480-600||RAPiDGENOMICS_rs1205_01773
TCATTTTTTCAGCAAGCTAGAAACTTGAATAGTTTCAATGTGAGCAACAATACCCTGTTAGGCTCTATCCCCTCATCGGTTTGTCTTAATTCTTCACCCTTCATTAGGTTATTGGACTTC
>augustus_masked-Fvb3-4-processed-gene-14.13:720:840:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-14.13:720-840||RAPiDGENOMICS_rs1205_01774
ACCACGCTTGAAGAAGTTGCAATACCTTTCAACTCGATTTATGGAGTCATTAGTGACAGAATTGTCAACCTCACCAACCTTGCAATTCTTGACCTACACTTCAATCAATTGAGTGGCATG
>augustus_masked-Fvb3-4-processed-gene-14.13:840:960:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-14.13:840-960||RAPiDGENOMICS_rs1205_01775
ATCCCCTTCCACATTGGGAAACTCTCCAAGTTAAAAAACTTGTTCCTCCAATTCAACAACCTTGAAGGTTCTCTGCCCCCATCTCTGATGAATTGCACTGACCTTAGAGAGTTGAATCTC
>augustus_masked-Fvb3-4-processed-gene-14.13:960:1080:Parent=augustus_masked-Fvb3-4-processed-gene-14.13-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-14.13:960-1080||RAPiDGENOMICS_rs1205_01776
GGCATCAACCATTTGGAAGGTAATATCTCTACCTTCAATTTCTCAAGACTAAGTAAACTCAGTATACTTGATCTGGGTAAGAATCAGCTCACTGGTATCTTACCAAGTAGCCTTTACTCA
>augustus_masked-Fvb3-4-processed-gene-15.8:1110:1230:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-15.8:1110-1230||RAPiDGENOMICS_rs1205_01777
AGCGATGCTACTATCGAAATTGAGCCTGCAATGTCGGAGTCAAATGAAATAGTTAAATTAAGAATACGAGCTACTAGTGAAACTGAGCCTACAATGCCAAAGTTGACTGAAGATTTTGAA
>augustus_masked-Fvb3-4-processed-gene-15.8:1603:1723:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-15.8:1603-1723||RAPiDGENOMICS_rs1205_01778
CTGACACTCGGAGGGGAATTACTTCTCAATTATATGATCAGCTGCATAACAAGAGAAGAATTGCAACATTCATGGATGATCGAGATCTTGAAGTAGGGGATGCTATATCTCCCACTCTAC
>augustus_masked-Fvb3-4-processed-gene-15.8:1663:1783:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-15.8:1663-1783|2x||RAPiDGENOMICS_rs1205_01779
TTGCAACATTCATGGATGATCGAGATCTTGAAGTAGGGGATGCTATATCTCCCACTCTACTAAAAGCAATTGAAGAATCATGGTTTGCAATTGTTGTCCTTTCTCCAAACTATGCCTCTT
>augustus_masked-Fvb3-4-processed-gene-15.8:1783:1903:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-15.8:1783-1903|2x||RAPiDGENOMICS_rs1205_01780
CTACTTGGTGTTTGGAGGAACTTGCGAAGATCTGTGAGTGCATGAAAGACCAGAACAGAATTCTTCCGCTTTTCTATAAGGTCGAGCCTACTAATGTGCGGTTCCAGAAGAGGAGTTTTG
>augustus_masked-Fvb3-4-processed-gene-15.8:187:307:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-15.8:187-307||RAPiDGENOMICS_rs1205_01781
GAGAAGGGGATAAACGGAGCCAAATTTCAGATGTGTTGTCCCAGTATGACATGACAGTTATGGATTACCCTCGGCAATATGTGAATTGTCCACTGCTGCCACTGGAGATGATTCATCACT
>augustus_masked-Fvb3-4-processed-gene-15.8:2021:2141:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-15.8:2021-2141||RAPiDGENOMICS_rs1205_01782
AACTGATACAGAACTTCTGGAGAAAATTGTGGATTCTGTGTTCAAAAGAATACAATCTTTTGACGTTGAGTTTACAATGTCCACCCGAGATTTTGAAGCGTATGAAGCAACAAGAAAATC
>augustus_masked-Fvb3-4-processed-gene-15.8:2201:2321:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-15.8:2201-2321|2x||RAPiDGENOMICS_rs1205_01783
AATGGGCGGAGTCGGCAAGACAACCCTGGTAAAACATGTCGCTGCTCAATCCTGCAAAAATGGGATTTTTCATCATGTGGTTATGGCTGTTGTATCCCAAAGCCCCAACGTTGAAAGAAT
>augustus_masked-Fvb3-4-processed-gene-15.8:2381:2501:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-15.8:2381-2501||RAPiDGENOMICS_rs1205_01784
TAGAAGAGCCTCTAGATTGTATAAAGAGATAATGAGGAAAGACAATATCCTCATAATCTTGGACGACATTTGGGGGTTTATAGATTTGTCCAGAATAGGAATTCCCAGCTATGACCTGCT
>augustus_masked-Fvb3-4-processed-gene-15.8:2441:2561:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-15.8:2441-2561|2x||RAPiDGENOMICS_rs1205_01785
GGACGACATTTGGGGGTTTATAGATTTGTCCAGAATAGGAATTCCCAGCTATGACCTGCTCAAAAAATGCAATTCTAAAGTCTTAATCACCACGAGAAAATTGCATGTTTGTAATTCCAT
>augustus_masked-Fvb3-4-processed-gene-15.8:2561:2681:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-15.8:2561-2681|2x||RAPiDGENOMICS_rs1205_01786
GGACAGCCAAGCAAGCATTCCTCTCAATATCTTATCAGAACAAGATTCTTGGAGCTTGTTTGTGAAGAAAACAAAAAGATCTTTTGAATCAACCACTTTTGAGGGTGTAGCGAGAAAGGT
>augustus_masked-Fvb3-4-processed-gene-15.8:2621:2741:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-15.8:2621-2741||RAPiDGENOMICS_rs1205_01787
TGTGAAGAAAACAAAAAGATCTTTTGAATCAACCACTTTTGAGGGTGTAGCGAGAAAGGTTGCTGGAGAATGTAGGGGTCTACCCATTGCTCTGATAGCAGTTGCAAGGGCACTTGGAGA
>augustus_masked-Fvb3-4-processed-gene-15.8:2921:3041:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-15.8:2921-3041|2x||RAPiDGENOMICS_rs1205_01788
AATAGAAGGCTTGTTCAGGTATGCAATTGGGAAAGGATTGTTTCGAGACACCGACACAATATATGAAGCCAGAGCAATAGCTGACACAGTGGTCAAGCACCTGATCGATTCTAGCTTGCT
>augustus_masked-Fvb3-4-processed-gene-15.8:2981:3101:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-15.8:2981-3101||RAPiDGENOMICS_rs1205_01789
ATATGAAGCCAGAGCAATAGCTGACACAGTGGTCAAGCACCTGATCGATTCTAGCTTGCTTTTGGATTGTGAATATGATGGACATGTAAGGATGCACGATGTCGTCCGGGATACAGCCAT
>augustus_masked-Fvb3-4-processed-gene-15.8:307:427:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-15.8:307-427||RAPiDGENOMICS_rs1205_01790
TTCTTCGATCAAGTGAAGGTTGGTTGTCATTGGCGGGACAACAGAATGTACTGCTGATGCACTGTGAAAGAGGAGGATGGCCCGTGCTTGCCTTTATGCTTGCAGCTCTTTTGCTATACC
>augustus_masked-Fvb3-4-processed-gene-15.8:3161:3281:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-15.8:3161-3281|2x||RAPiDGENOMICS_rs1205_01791
GGATTGGTCATGTCGATCACATGAAGACTACTATGCTATCTCACTAATGGGGAATGAACTTCACAGTCTGCCCGATGAGTTGATATGTCCAAATATCCAGATTTTATTACTACAAGGGAA
>augustus_masked-Fvb3-4-processed-gene-15.8:3221:3341:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-15.8:3221-3341||RAPiDGENOMICS_rs1205_01792
TCACAGTCTGCCCGATGAGTTGATATGTCCAAATATCCAGATTTTATTACTACAAGGGAATCGGTATTTAAATGAGATCCCAGAGACCTTTTCCCAAAGTCGAAATGAATTAAGAGTCTT
>augustus_masked-Fvb3-4-processed-gene-15.8:3341:3461:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_12::augustus_masked-Fvb3-4-processed-gene-15.8:3341-3461||RAPiDGENOMICS_rs1205_01793
AGATCTTAGCCGTACCAACATTTCATTGCTGCCCCAATCATTCAGTCTCCTGACCAAGCTCCAAGCTCTGCATCTAGATTTTTGCCGCAAAGCAGTTGACATTTCCATAGTTGGAAAACT
>augustus_masked-Fvb3-4-processed-gene-15.8:3401:3521:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_12::augustus_masked-Fvb3-4-processed-gene-15.8:3401-3521|2x||RAPiDGENOMICS_rs1205_01794
CCAAGCTCTGCATCTAGATTTTTGCCGCAAAGCAGTTGACATTTCCATAGTTGGAAAACTTAAGAAGCTTGAGATTCTTAGTATGAGACACTATCCTCTTACGGAGCTGTCCAGAGAAAT
>augustus_masked-Fvb3-4-processed-gene-15.8:3461:3581:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_13::augustus_masked-Fvb3-4-processed-gene-15.8:3461-3581||RAPiDGENOMICS_rs1205_01795
TAAGAAGCTTGAGATTCTTAGTATGAGACACTATCCTCTTACGGAGCTGTCCAGAGAAATAGGAAATTTGACCAATCTAAGGATGTTGGATATCGGTGGCCGTAGTTCTAAACGTGGTTC
>augustus_masked-Fvb3-4-processed-gene-15.8:3581:3701:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_14::augustus_masked-Fvb3-4-processed-gene-15.8:3581-3701||RAPiDGENOMICS_rs1205_01796
TAAAGGTGGAGGTATTGTCACAATTCCATCTGAAGTGATATCAAAGCTGCATGGATTAGAAGAATTGTACATGATGTACTGTGGATTTGTGCACTGGGAAAGTCCAATTGAGGGAGAAGG
>augustus_masked-Fvb3-4-processed-gene-15.8:3701:3821:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-15.8:3701-3821||RAPiDGENOMICS_rs1205_01797
AGATGAAATCAATATTGGCTTTGGTGAGCTAGCTGGTTTATCAAAGTTGAAAAATTTGCAGGTTTCCTTACCTAATGCAGAATGCATCCCTAAAAATGTTGAGGTCGAACCGGGTTGGTT
>augustus_masked-Fvb3-4-processed-gene-15.8:3821:3941:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_16::augustus_masked-Fvb3-4-processed-gene-15.8:3821-3941||RAPiDGENOMICS_rs1205_01798
TTACTTTGATATACGTATTGGCGAATGCACAAGCGATCGATATTATCAGTTTGATTGTAAATCAAGATCCTTGCTTCTTCGTAAAATAACCATCAGTACCTTGCCTGATTGGTTTATCAA
>augustus_masked-Fvb3-4-processed-gene-15.8:4061:4181:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_18::augustus_masked-Fvb3-4-processed-gene-15.8:4061-4181||RAPiDGENOMICS_rs1205_01799
TATGGGTGATTCCTATGTGTACGTGAAAGAGTTGATGAACACAACAAGACGAGTTGAAACAGGACCGGTGTTTGAGAATTTGGAAGAGTTGCATCTGATACATCTAATCCACCTTGAGGA
>augustus_masked-Fvb3-4-processed-gene-15.8:4181:4301:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_19::augustus_masked-Fvb3-4-processed-gene-15.8:4181-4301||RAPiDGENOMICS_rs1205_01800
GTTGTTGGTTGGTGAGTTACCACCTAGGTCTCTCTTCAATCTCAAGGTATTGCATATGAATCGTTGGTTTATCTTGAAGAGTGTATCAAAATTTGTACATAGACTACCAAATCTGGAGAA
>augustus_masked-Fvb3-4-processed-gene-15.8:427:547:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-15.8:427-547||RAPiDGENOMICS_rs1205_01801
GTAAAAGTTACACGGGGGAGCAGAGGACTCTTGATATGGTTTACAAGCAGGCTCCAAAAGAGCTTCTCCATCTGTTGGCTTCTATAAACCCACAACCTTCGCAGCTTAGATATCTTCAGT
>augustus_masked-Fvb3-4-processed-gene-15.8:4301:4421:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_20::augustus_masked-Fvb3-4-processed-gene-15.8:4301-4421||RAPiDGENOMICS_rs1205_01802
ACTATATCTGAATTTGATGAAGGAAATGGAATATGTGTTTGGATGTGAAGGGTGTGAGCCAGAACAATCAAAACTGAGCGAGATGCATTTGTTGTCTCAAAAAGCACTAAGAAGCATATG
>augustus_masked-Fvb3-4-processed-gene-15.8:4421:4541:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_21::augustus_masked-Fvb3-4-processed-gene-15.8:4421-4541||RAPiDGENOMICS_rs1205_01803
TAATGGTTCGGCTCCATGTGCAATGTTTCGGAGTCTTAAAACCTTGACCGTGTACCATTGCGAGCTGCTGCAAAGTCTGTTCACATCTAATGTAGCTGAGTATCTTGTTCTATTGGAAGA
>augustus_masked-Fvb3-4-processed-gene-15.8:4661:4781:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_23::augustus_masked-Fvb3-4-processed-gene-15.8:4661-4781||RAPiDGENOMICS_rs1205_01804
CAATGCTACCACTGTTGATATTGAGTGTCCTTCATTGGAACGATTGGTGGTGGTGGATTGCCCCCAGCTTCCATTTTCAACCTCTTCCGATCTCTTCCAATCCTTCGAAAGCAGGAACCA
>augustus_masked-Fvb3-4-processed-gene-15.8:547:667:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-15.8:547-667||RAPiDGENOMICS_rs1205_01805
ATATTTCACGAAGAAATCCGGGTGCTGATTGGCCTCCATCAGATACACCTCTATTTTTGGATTGTCTGATACTTAGAAACCTTCCACTTTTTGATGACGGAAAAGGTTGCAGGCCCCTCA
>augustus_masked-Fvb3-4-processed-gene-15.8:67:187:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-15.8:67-187||RAPiDGENOMICS_rs1205_01806
TTTTTGACTGTTGCTTCTCCACCAATGTGTTGGAAGATGAGTACAAAGTGTACTTGGGTGGCATTACAGCCCAGCTACAGGACTACTTCCCTGATGCTTCTTTCATGGTGTTTGACTTCA
>augustus_masked-Fvb3-4-processed-gene-15.8:768:888:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-15.8:768-888||RAPiDGENOMICS_rs1205_01807
GCAGAGTGTGTGCTGGTGGAAATGGATATCTGTTGTTGTGTTCAAGGGGATGTGGTAGTCGAGTGTATCCACCTGTATGAAGATCAGGTTCATGAGGAGATGATGTTCAGAGTTATGTTT
>augustus_masked-Fvb3-4-processed-gene-15.8:990:1110:Parent=augustus_masked-Fvb3-4-processed-gene-15.8-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-15.8:990-1110||RAPiDGENOMICS_rs1205_01808
GTACTTTTTTCGTATGCTGATGATGGTCTGCCTAGTCTCACCACAGTTGTGGCAAGTGATGATGGAAATGAGACAGAGACTGCTTCACCTGAGCAATCTTATGAGGTGGAAGAAATCTTC
>augustus_masked-Fvb3-4-processed-gene-154.7:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-154.7:0-120||RAPiDGENOMICS_rs1205_01809
ATGTCTGTTTTCTTTCATGCTTTCGATGAATCAGTAGATCCCAAGATAGAGGAAATTCTTGAGAGATTAGACTTGATTGTTAGCTGGAAAGATGCCCTTAATTTGAAAGCAGGTGCTAGG
>augustus_masked-Fvb3-4-processed-gene-154.7:1142:1262:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-154.7:1142-1262||RAPiDGENOMICS_rs1205_01810
GACTCGTCATTTTTCATATATGAGACATCGTTGTAGTGACTTTGAGAATTTTGAGGCTTTACATGAAGCTAAGTATCTGCGCACCTTCCTACCGCTACAACTAACAGAATTTTGGAGTGA
>augustus_masked-Fvb3-4-processed-gene-154.7:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-154.7:120-240||RAPiDGENOMICS_rs1205_01811
CACAGACTCTCAACGAGAGTGATACTCCCTTCGACTTCTCTGGTAGACGACTCTGGTGTCTATGGAAGGTACGAAGATAAGGAGACCATGACTAGGTTGTTATTATGGAACGATGCTAGT
>augustus_masked-Fvb3-4-processed-gene-154.7:1382:1502:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-154.7:1382-1502||RAPiDGENOMICS_rs1205_01812
ACATCTAAAGCACCTGAATTTGTCATGGACTTCAATCCAGAAGCTACCTGATACAGTGTGTTCTTTGTGTAATTTGCAAACTTTGTTGTTGTCACATTGTGAAGCTCTTGTTCATTTGCC
>augustus_masked-Fvb3-4-processed-gene-154.7:1502:1622:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-154.7:1502-1622||RAPiDGENOMICS_rs1205_01813
AGCCAACTTGGGAAGACTCACAAATTTGCGCCATCTTGATATTGGAGATATGCGAGGCACACATTTGAAAAAGATGCCACCACATATGGGCAAATTGAAAGATCTCCAAATGTTAAGTGA
>augustus_masked-Fvb3-4-processed-gene-154.7:1742:1862:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_13::augustus_masked-Fvb3-4-processed-gene-154.7:1742-1862||RAPiDGENOMICS_rs1205_01814
CGAAGCCAAAATGTGGGAAAAGAAGTCTCTAACTCACCTAGTCTTAAAATTCGGAGGTTATACTGAAGATTCACATAAAGATAGAGAAGTTCTCAATAACCTCCAACCTCATACCAATTT
>augustus_masked-Fvb3-4-processed-gene-154.7:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-154.7:180-300|2x||RAPiDGENOMICS_rs1205_01815
TATGGAAGGTACGAAGATAAGGAGACCATGACTAGGTTGTTATTATGGAACGATGCTAGTGGCCCATCGTGGGCATGGGTGGGATTGGAAAGACCACCATTGCTCAGCTCTTGTACAATG
>augustus_masked-Fvb3-4-processed-gene-154.7:1910:2030:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-154.7:1910-2030||RAPiDGENOMICS_rs1205_01816
CTACCCTCCCTTACCGAGCTTCTTGCCACCACTGGTCTCTGTAGGTCCTGAGTTTTATGGTAACGATACCACTGTAATTAATCCTTTTAGATCTCTGCAAATTTTGGAATTCAAAAACAT
>augustus_masked-Fvb3-4-processed-gene-154.7:2030:2150:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-154.7:2030-2150||RAPiDGENOMICS_rs1205_01817
GAGGAGATGGCAAGAGCGGTCTTATGTTGGAGACAACAAAGAAAGGGGAGCTTTTCCTAGTCTCTCTAGGCTTCATCTGGAGGATTGTCCTAAGCTAATCGGAATATTACCATTAGATTG
>augustus_masked-Fvb3-4-processed-gene-154.7:2150:2270:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-154.7:2150-2270||RAPiDGENOMICS_rs1205_01818
CTTCCCCATGCTTCAATCGCTGAGAGTCTTGAATGCCAATATAGAAGGCATTACAATGTCACAAGGATCAAAATGCCCTGAACTAAGTAAGCTGAGAATGTATGATTGCTGGAATTTTGG
>augustus_masked-Fvb3-4-processed-gene-154.7:2270:2390:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-154.7:2270-2390||RAPiDGENOMICS_rs1205_01819
TTATTTTCCTGAGGGAGGGCTGCATGCTCCCAACTTGACCGTTATAGATATCGATGGATGCAGTAATTTGAGGTCACTACCAGAACACATGAACACCCTTCTTCCATCTCTCGAGTCTAT
>augustus_masked-Fvb3-4-processed-gene-154.7:2390:2510:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-154.7:2390-2510||RAPiDGENOMICS_rs1205_01820
GTCCATAGGACTTTGTCCAAAACTGGAATCATTTCCAGAAGGGGGATTGCCATCAAATTTGAAGTCACTGAATATACGTTCCTGCAAAAGACTCATTGCAAACCGAATGCAATGGGGACT
>augustus_masked-Fvb3-4-processed-gene-154.7:2510:2630:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-154.7:2510-2630||RAPiDGENOMICS_rs1205_01821
GCAGGAACTCACCTCTCTCGAAGTCTTGACAATTGACTTCATAAGATGTGAGGATCCAGAATCATTTCCGGAGGAGGGCCTGATGCCAATCTCTCTTGTCTCTCTCTCCATCTACGATCT
>augustus_masked-Fvb3-4-processed-gene-154.7:2630:2750:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-154.7:2630-2750||RAPiDGENOMICS_rs1205_01822
TTTGAATATGAAGACCATTAAAGGCAAGGAGTTGAGACACCTCAGCTCGCTTCCAAGAATGGAAATATGGGGATGCCCCATGCTCGAGTGCTTGCCAGATGAAGGGCTTCCGGCTTCTCT
>augustus_masked-Fvb3-4-processed-gene-154.7:2750:2870:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-154.7:2750-2870||RAPiDGENOMICS_rs1205_01823
TACTTGTCTAAGAATAGAGGGATGTCCTTTGCTGAAGCAAAGATGCCACAGAGACCAAGGGGAAGATTGGCCCAAGATTGCTTACATCTCCAACATATGGATCGATGGAAACCGATATCA
>augustus_masked-Fvb3-4-processed-gene-154.7:302:422:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-154.7:302-422||RAPiDGENOMICS_rs1205_01824
AATTACACAAACGATTTATGGGTCTGTTACTTCAAGCAACTGTGCCATCACACACCTAAATTTACTCCAAGTTAAGCTCAAGGAGGCTTTGATGGGGAAGAAGTTTCTCTTTGTCCTTGA
>augustus_masked-Fvb3-4-processed-gene-154.7:422:542:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-154.7:422-542||RAPiDGENOMICS_rs1205_01825
TGATGTTTGGAACGAGAATTATCTCCACTGGGATGTCTTTAGGTGTCCCTTTAAGTTTGGGGTGCGTGGAAGTAGGATCATTGTCACAACACGAAATGAAGGTGTTGGATCTATGATGGG
>augustus_masked-Fvb3-4-processed-gene-154.7:482:602:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-154.7:482-602|2x||RAPiDGENOMICS_rs1205_01826
GGTGCGTGGAAGTAGGATCATTGTCACAACACGAAATGAAGGTGTTGGATCTATGATGGGTACTCTTCCAACTCATTATCTATTGCAAATATCTGAAGAGGACTGTCGGTCACTATTTGC
>augustus_masked-Fvb3-4-processed-gene-154.7:542:662:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-154.7:542-662||RAPiDGENOMICS_rs1205_01827
TACTCTTCCAACTCATTATCTATTGCAAATATCTGAAGAGGACTGTCGGTCACTATTTGCAAAACATGCCTTCAGAAATGCAGATCACAGTGCATATCCAAATTTAGAAGTAATTGGGAA
>augustus_masked-Fvb3-4-processed-gene-154.7:602:722:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-154.7:602-722|2x||RAPiDGENOMICS_rs1205_01828
AAAACATGCCTTCAGAAATGCAGATCACAGTGCATATCCAAATTTAGAAGTAATTGGGAAACAAATTGTTAAGTGTAAGGGTCTTCCTTTGGCTGCCAAATCACTTGGTGGTCTCTTGTG
>augustus_masked-Fvb3-4-processed-gene-154.7:662:782:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-154.7:662-782||RAPiDGENOMICS_rs1205_01829
ACAAATTGTTAAGTGTAAGGGTCTTCCTTTGGCTGCCAAATCACTTGGTGGTCTCTTGTGCTCTAAATTGAATTTGGAAGAATGGGAGAAGGTACTGAAGAGTGACATATGGGAACTTGC
>augustus_masked-Fvb3-4-processed-gene-154.7:722:842:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-154.7:722-842|2x||RAPiDGENOMICS_rs1205_01830
CTCTAAATTGAATTTGGAAGAATGGGAGAAGGTACTGAAGAGTGACATATGGGAACTTGCAGATAAAGGGAGTGCCATTTTGCCGGCTTTATGGCTAAGCTATTACTACCTTCCTTCACA
>augustus_masked-Fvb3-4-processed-gene-154.7:782:902:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-154.7:782-902||RAPiDGENOMICS_rs1205_01831
AGATAAAGGGAGTGCCATTTTGCCGGCTTTATGGCTAAGCTATTACTACCTTCCTTCACATCTCAAGCGTTGTTTTGCTTATTGTTCGATATTTCCCAATGGTTATGTATTTGAAAGATC
>augustus_masked-Fvb3-4-processed-gene-154.7:842:962:Parent=augustus_masked-Fvb3-4-processed-gene-154.7-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-154.7:842-962|2x||RAPiDGENOMICS_rs1205_01832
TCTCAAGCGTTGTTTTGCTTATTGTTCGATATTTCCCAATGGTTATGTATTTGAAAGATCAGAATTGATATTTTTGTGGATGGCTGAAGATCTGTTGCAACCCAAAAACAAGAAAACAAT
>augustus_masked-Fvb3-4-processed-gene-156.9:1075:1195:Parent=augustus_masked-Fvb3-4-processed-gene-156.9-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-156.9:1075-1195||RAPiDGENOMICS_rs1205_01833
TTCATAACTTTGTGAGGATGGCTCTACCTGAACATGTTGAGGAGATTACTGATTCACTACTTGAAGGAGCCTTCACCACTGTTGATGAAGCTTGCAATCAAACCATCAAAAGACAACAGA
>augustus_masked-Fvb3-4-processed-gene-156.9:1195:1315:Parent=augustus_masked-Fvb3-4-processed-gene-156.9-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-156.9:1195-1315||RAPiDGENOMICS_rs1205_01834
GAATTAAAGAGTCCTTAATGCTGATATTCGAAATTGAAATCGGATATTCTACAGAATCCCCAACAAACCGAAAGGATATAAGTGATGTCGTATCTGAGTTGCACTCCATTAGGAACAATC
>augustus_masked-Fvb3-4-processed-gene-156.9:151:271:Parent=augustus_masked-Fvb3-4-processed-gene-156.9-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-156.9:151-271||RAPiDGENOMICS_rs1205_01835
ATTGTGAGAGTTTAGAATTCCTATCCATAAAAGGCAACTCTTTCGAGGGGCTCATTCCATCATCTATGAAAAACCTGAGAGGCCTTCGAGAGTTGGACCTTTCCCGAAACAATTTGTCAG
>augustus_masked-Fvb3-4-processed-gene-156.9:211:331:Parent=augustus_masked-Fvb3-4-processed-gene-156.9-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-156.9:211-331|2x||RAPiDGENOMICS_rs1205_01836
CATCTATGAAAAACCTGAGAGGCCTTCGAGAGTTGGACCTTTCCCGAAACAATTTGTCAGGACATATTCCGCAATTCTTTGAGGGCTTTGGAAACTTGGAGAATCTGAACCTATCGTTCA
>augustus_masked-Fvb3-4-processed-gene-156.9:271:391:Parent=augustus_masked-Fvb3-4-processed-gene-156.9-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-156.9:271-391||RAPiDGENOMICS_rs1205_01837
GACATATTCCGCAATTCTTTGAGGGCTTTGGAAACTTGGAGAATCTGAACCTATCGTTCAATCACTTATCGGGGGAAGTACCAGTTGAAGGTGTTTTTAAGAATGCAAGTGCAACATCAA
>augustus_masked-Fvb3-4-processed-gene-156.9:31:151:Parent=augustus_masked-Fvb3-4-processed-gene-156.9-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-156.9:31-151||RAPiDGENOMICS_rs1205_01838
ACTTGTTCAGAAACCAACTTTTTGGTTCCCTTCCTGTGGAGATTGGCAAGTTGAGGAATTTAGGTGAGCTTGATGTTTCTGAAAATATGTTATGGGGAGAGCTTCCTAACAGCCTTGGTG
>augustus_masked-Fvb3-4-processed-gene-156.9:331:451:Parent=augustus_masked-Fvb3-4-processed-gene-156.9-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-156.9:331-451|2x||RAPiDGENOMICS_rs1205_01839
ATCACTTATCGGGGGAAGTACCAGTTGAAGGTGTTTTTAAGAATGCAAGTGCAACATCAATTGTTGGAAACACCGCACTTTGCAGAGGTATTGCAGAGCTTCGACTACCTATGTGCAAAT
>augustus_masked-Fvb3-4-processed-gene-156.9:391:511:Parent=augustus_masked-Fvb3-4-processed-gene-156.9-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-156.9:391-511||RAPiDGENOMICS_rs1205_01840
TTGTTGGAAACACCGCACTTTGCAGAGGTATTGCAGAGCTTCGACTACCTATGTGCAAATCTGAAGTGTCTAAAGCAAGAGATTTGTCTCGTATAATGAAAATTGTTGTGTCCTTCGAAT
>augustus_masked-Fvb3-4-processed-gene-156.9:511:631:Parent=augustus_masked-Fvb3-4-processed-gene-156.9-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-156.9:511-631||RAPiDGENOMICS_rs1205_01841
CTGCATTTACTCTTTTGGTAATTGCTATGGTGTTATCCTTTTTACTTCATCGTAAGAAAATGAAAGCAATTGAGTTGAGCTCTCTAGGGAACTCTGTTTTGCAAGTGTCATATGCTGCTC
>augustus_masked-Fvb3-4-processed-gene-156.9:738:858:Parent=augustus_masked-Fvb3-4-processed-gene-156.9-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-156.9:738-858||RAPiDGENOMICS_rs1205_01842
AGGCTCGATATCGCCATCAATGTTGCTTCTGCATTGGATTATCTTCACAATCATTGTGAAACACCAATAGTTCATTGTGATCTCAAACCAAGTAATGTCCTTTTGGATAGTGAGTTGACT
>augustus_masked-Fvb3-4-processed-gene-156.9:91:211:Parent=augustus_masked-Fvb3-4-processed-gene-156.9-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-156.9:91-211|2x||RAPiDGENOMICS_rs1205_01843
TAGGTGAGCTTGATGTTTCTGAAAATATGTTATGGGGAGAGCTTCCTAACAGCCTTGGTGATTGTGAGAGTTTAGAATTCCTATCCATAAAAGGCAACTCTTTCGAGGGGCTCATTCCAT
>augustus_masked-Fvb3-4-processed-gene-156.9:955:1075:Parent=augustus_masked-Fvb3-4-processed-gene-156.9-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-156.9:955-1075||RAPiDGENOMICS_rs1205_01844
AATATGGTATGGGAAGTGAGGTGTCAACATGTGGAGATGTGTACCACTTTGGCATTCTATTGTTAGAAATGTTTCCCAGGAAGAGTCCCACTGATCCTCTGTTCAACGACGGCTTGAATC
>augustus_masked-Fvb3-4-processed-gene-173.11:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-173.11:0-120||RAPiDGENOMICS_rs1205_01845
ATGTCCGCAGGCTCCACCTTGGCTCCAAATTTGTCTGATTCCGGCTCTCCATTGGGTGGTAAGATAAATCCTTCCCTGCTCAAATTAGAGTATCTCCACTTCCTTGACCTAAGTGACAAT
>augustus_masked-Fvb3-4-processed-gene-173.11:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-173.11:120-240||RAPiDGENOMICS_rs1205_01846
CTTTTTGAAGGAATGCAAATTCCTAGCTTCTTAGGTTCTCTTAAAAGCATAAGTCATCTGGACCTTTCTGACTCGGGGTACTTCCATGGGACTGTTCCTCATCAACTGGGAAATCCATCG
>augustus_masked-Fvb3-4-processed-gene-173.11:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-173.11:240-360||RAPiDGENOMICS_rs1205_01847
AGTCTCGTCTACCTCAGTCTAAGTGGTTTAGATGGTCTCAAGGTTGAGAACCTTCAATGGCTTTCTAGTTTTTCTCGACTGAAACACCTGGATTTGAGTTCCGTAAATCTTAGCAAAGCA
>augustus_masked-Fvb3-4-processed-gene-173.11:300:420:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-173.11:300-420|2x||RAPiDGENOMICS_rs1205_01848
CTTTCTAGTTTTTCTCGACTGAAACACCTGGATTTGAGTTCCGTAAATCTTAGCAAAGCATCTGATCATTGGTTGCAAGTGATGAACATGCTCCCCTATTTGGCTGAGCTACATATCTCC
>augustus_masked-Fvb3-4-processed-gene-173.11:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-173.11:360-480||RAPiDGENOMICS_rs1205_01849
TCTGATCATTGGTTGCAAGTGATGAACATGCTCCCCTATTTGGCTGAGCTACATATCTCCCACTGTGGACTTGATTACATTCCCCCTCTACCTATCGTGAACTTTACTTCACTTGCAATA
>augustus_masked-Fvb3-4-processed-gene-173.11:420:540:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-173.11:420-540|2x||RAPiDGENOMICS_rs1205_01850
CACTGTGGACTTGATTACATTCCCCCTCTACCTATCGTGAACTTTACTTCACTTGCAATAATTGATATATCTGAGAACGAATTTTATTCCTTGATCCCGAAGTGGTTTTTCAGTCTTCCA
>augustus_masked-Fvb3-4-processed-gene-173.11:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-173.11:480-600||RAPiDGENOMICS_rs1205_01851
ATTGATATATCTGAGAACGAATTTTATTCCTTGATCCCGAAGTGGTTTTTCAGTCTTCCAAATCTAGTTTCTCTTAATCTCTATGATTCTGATTTCTTAGGTCCCAATCCTATCATGTCA
>augustus_masked-Fvb3-4-processed-gene-173.11:540:660:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-173.11:540-660|2x||RAPiDGENOMICS_rs1205_01852
AATCTAGTTTCTCTTAATCTCTATGATTCTGATTTCTTAGGTCCCAATCCTATCATGTCACCCAATATCACTTCTCTCAAGGAAATTGATTTCAGATCGAACTGTCTTAGTCAAGATATA
>augustus_masked-Fvb3-4-processed-gene-173.11:600:720:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-173.11:600-720||RAPiDGENOMICS_rs1205_01853
CCCAATATCACTTCTCTCAAGGAAATTGATTTCAGATCGAACTGTCTTAGTCAAGATATACCAGAGTGGTTATTTCACCAAAGAAACCTCACCTCATTGAAATTAGGAAACAATCTACTC
>augustus_masked-Fvb3-4-processed-gene-173.11:660:780:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-173.11:660-780|2x||RAPiDGENOMICS_rs1205_01854
CCAGAGTGGTTATTTCACCAAAGAAACCTCACCTCATTGAAATTAGGAAACAATCTACTCCAAGGATCACTTCCTAGGTCCATCGGATTGACATCCATTGTTACTCTTGACCTGCGTCAT
>augustus_masked-Fvb3-4-processed-gene-173.11:720:840:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-173.11:720-840||RAPiDGENOMICS_rs1205_01855
CAAGGATCACTTCCTAGGTCCATCGGATTGACATCCATTGTTACTCTTGACCTGCGTCATAATAAGTTGGAAGGGAAGATCCCAAACTCTTTGGGAAATCTTTGCGGCTTGATGGTTCTT
>augustus_masked-Fvb3-4-processed-gene-173.11:780:900:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-173.11:780-900|2x||RAPiDGENOMICS_rs1205_01856
AATAAGTTGGAAGGGAAGATCCCAAACTCTTTGGGAAATCTTTGCGGCTTGATGGTTCTTAACCTGTCCATGAACAATTTCATCGTTGCAAATGTATCAGAAATCTTTGAGAGTTTGTCT
>augustus_masked-Fvb3-4-processed-gene-173.11:840:960:Parent=augustus_masked-Fvb3-4-processed-gene-173.11-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-173.11:840-960||RAPiDGENOMICS_rs1205_01857
AACCTGTCCATGAACAATTTCATCGTTGCAAATGTATCAGAAATCTTTGAGAGTTTGTCTTGGTGTGGTTCAGATCGATTAAACTCGTTGTCATTAGGGTATAATAATCTTTCGGGTAGT
>augustus_masked-Fvb3-4-processed-gene-178.4:1106:1226:Parent=augustus_masked-Fvb3-4-processed-gene-178.4-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-178.4:1106-1226||RAPiDGENOMICS_rs1205_01858
CTGGTTCTGTGAGACTCTTGTTAAGTTTCCAAATATAGATGAGAGGAGTTTGCATGGTCAGGACGTGGTGCAACAAGCCGGGGCAGTCATCAGCGTCTCAGAAACAGAGATCAATGGACG
>augustus_masked-Fvb3-4-processed-gene-178.4:307:427:Parent=augustus_masked-Fvb3-4-processed-gene-178.4-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-178.4:307-427|2x||RAPiDGENOMICS_rs1205_01859
ATAGAAAAGGACACGATGTGTTTTTGAGTTTTAGAGGTGAGGATACACGCACAGGTTTTGCACGTTATCTATACGAAGCTTTAGAGAAAGAAGGAATCAAGACATTTTTTGATGATAAAA
>augustus_masked-Fvb3-4-processed-gene-178.4:427:547:Parent=augustus_masked-Fvb3-4-processed-gene-178.4-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-178.4:427-547|2x||RAPiDGENOMICS_rs1205_01860
AGCTCAAGAAAGGAGATGAAATAGCAGTTACACTACTCGAAGCAATAGAAGCATCAGAGATTTCTATCATTCTACTCTCAAAAAACTATGTTTCGTCAAGGTGGTGTTTGGCTGAACTTG
>augustus_masked-Fvb3-4-processed-gene-178.4:806:926:Parent=augustus_masked-Fvb3-4-processed-gene-178.4-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-178.4:806-926|2x||RAPiDGENOMICS_rs1205_01861
AAAGGAAAAATCACTTGAAAGGTTCGTCTCAATACGCCCACCAGGTGGAAATGACGAAATAGTCATCTACATGACTTCATCAGCTAAGGACAAGAATTTCCAGAATTGCCAGTCAATGCT
>augustus_masked-Fvb3-4-processed-gene-178.4:866:986:Parent=augustus_masked-Fvb3-4-processed-gene-178.4-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-178.4:866-986||RAPiDGENOMICS_rs1205_01862
AGTCATCTACATGACTTCATCAGCTAAGGACAAGAATTTCCAGAATTGCCAGTCAATGCTGCGGAGCTTAAGCCAATTTGACCCGCTGAACCTTTGGCAGCAGCGTGACGTTTCAAATAA
>augustus_masked-Fvb3-4-processed-gene-178.4:95:215:Parent=augustus_masked-Fvb3-4-processed-gene-178.4-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-178.4:95-215||RAPiDGENOMICS_rs1205_01863
TTTGTGTGGAAATCCAAGTTTAACGGGGCAGGTTCCTTGCGAGAAGAAGAGGAACCAGTTTGTTATTCCGGTCGTTGTGTCAATTATTGTCATGTTATTGGTCTCATCCATTGCAGCAGC
>augustus_masked-Fvb3-4-processed-gene-178.4:986:1106:Parent=augustus_masked-Fvb3-4-processed-gene-178.4-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-178.4:986-1106||RAPiDGENOMICS_rs1205_01864
AAATTTCAGACGAGAGTTGAAAAAGCTGATGAAAAAAGAGCTGCCTCCTCCAAGAATGTTTGTGAAAGGAAAATATGTGGGTGGGTATGATGAGGTGAGTAAACTTATAAAAGAAGAGCC
>augustus_masked-Fvb3-4-processed-gene-203.15:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-203.15-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-203.15:0-120||RAPiDGENOMICS_rs1205_01865
ATGGTGCCGACCTGCTTGATGTTGTTTACCCTAGTTGTTGACCTAAGTATAAACTTTGTTCCCTCGGTGTATGGAGCGCCACCCCTCTCGGAGGCGAAGGCCTTACTTGCATTCAAGAAC
>augustus_masked-Fvb3-4-processed-gene-203.15:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-203.15-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-203.15:120-240||RAPiDGENOMICS_rs1205_01866
AGATTAACAGATCCGCAGAAAGTGCTCCAGAGCTGGGATGCCACCCTTATCACACCTTGCACTTGGTTACATGTGAGGTGCAACCAAGACAATAAGGTTACTGCAGTCGATCTAGTTGGT
>augustus_masked-Fvb3-4-processed-gene-203.15:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-203.15-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-203.15:180-300|2x||RAPiDGENOMICS_rs1205_01867
ACTTGGTTACATGTGAGGTGCAACCAAGACAATAAGGTTACTGCAGTCGATCTAGTTGGTTCGAACCTCTCTGGAAATTTAGTACCTGAACTCGGACTGCTTCCAGCTCTACAATATCTG
>augustus_masked-Fvb3-4-processed-gene-203.15:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-203.15-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-203.15:240-360||RAPiDGENOMICS_rs1205_01868
TCGAACCTCTCTGGAAATTTAGTACCTGAACTCGGACTGCTTCCAGCTCTACAATATCTGAGATTGGGTAGAAACAATATCGCAGGAACCATTCCAGCTGAGCTTGGTAACCTGAAGAGT
>augustus_masked-Fvb3-4-processed-gene-203.15:300:420:Parent=augustus_masked-Fvb3-4-processed-gene-203.15-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-203.15:300-420|2x||RAPiDGENOMICS_rs1205_01869
AGATTGGGTAGAAACAATATCGCAGGAACCATTCCAGCTGAGCTTGGTAACCTGAAGAGTCTCGGGGTACTCGACTTGAGTAACAACAAATTAACTGGGAAAGTCCCCTCCCAAATTGCA
>augustus_masked-Fvb3-4-processed-gene-203.15:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-203.15-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-203.15:360-480||RAPiDGENOMICS_rs1205_01870
CTCGGGGTACTCGACTTGAGTAACAACAAATTAACTGGGAAAGTCCCCTCCCAAATTGCAAGCATCCCACGCCTTCGATTGGCAGACATTTCCAACAACAATAATCTGTGTTGGAACTTT
>augustus_masked-Fvb3-4-processed-gene-203.15:60:180:Parent=augustus_masked-Fvb3-4-processed-gene-203.15-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-203.15:60-180|2x||RAPiDGENOMICS_rs1205_01871
CCCTCGGTGTATGGAGCGCCACCCCTCTCGGAGGCGAAGGCCTTACTTGCATTCAAGAACAGATTAACAGATCCGCAGAAAGTGCTCCAGAGCTGGGATGCCACCCTTATCACACCTTGC
>augustus_masked-Fvb3-4-processed-gene-211.5:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-211.5:0-120||RAPiDGENOMICS_rs1205_01872
ATGGCGGAACTAGCAATTCCGTTATCATTGATGATGGCCGAGAAGGCGATGAGCTTGTTTGAAAGATGCAAGGTCAACGACGGAAGTCATAATATCCATGATGATGTTGAAATAGCCTAC
>augustus_masked-Fvb3-4-processed-gene-211.5:1020:1140:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-211.5:1020-1140|2x||RAPiDGENOMICS_rs1205_01873
GTTTCAGCTATTGCTACTTTGCTGGCAAACAAGCCACAAACTCCAGTTGAGTGGAAGAAGTTACATGAAAGCCTTGGGTCTGAAATCAGACCTCATTTTAGTCTTTCGATTATTAGCCGT
>augustus_masked-Fvb3-4-processed-gene-211.5:1080:1200:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-211.5:1080-1200||RAPiDGENOMICS_rs1205_01874
TTACATGAAAGCCTTGGGTCTGAAATCAGACCTCATTTTAGTCTTTCGATTATTAGCCGTGTCTTGCAGCCAAGTTACATGCATCTTCCGAGCCATCTAAAGATATGTTTTTCTTACTTT
>augustus_masked-Fvb3-4-processed-gene-211.5:1140:1260:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-211.5:1140-1260|2x||RAPiDGENOMICS_rs1205_01875
GTCTTGCAGCCAAGTTACATGCATCTTCCGAGCCATCTAAAGATATGTTTTTCTTACTTTGGCATGTTTCCAGAAGACTATTCCATCAGCCGTGATAGGCTGATTCGGTTGTGGTCAGCT
>augustus_masked-Fvb3-4-processed-gene-211.5:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-211.5:120-240||RAPiDGENOMICS_rs1205_01876
AAATGTCTGAAGAAGATGCAAGCCTATCTAGGGGACTCCGAAGAGATTGATGAAGGCAGCCTAATGCTTCAAAATCGTGTTGAAGAGGTCCAAACTCTGGCTTATGAAATTGAAGACGCT
>augustus_masked-Fvb3-4-processed-gene-211.5:1200:1320:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-211.5:1200-1320||RAPiDGENOMICS_rs1205_01877
GGCATGTTTCCAGAAGACTATTCCATCAGCCGTGATAGGCTGATTCGGTTGTGGTCAGCTGAGGGATTTATAACTCCGGGAAAGGGACAAACAATGGAGGAAGCTGGGGAAAGTTATCTC
>augustus_masked-Fvb3-4-processed-gene-211.5:1260:1380:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-211.5:1260-1380|2x||RAPiDGENOMICS_rs1205_01878
GAGGGATTTATAACTCCGGGAAAGGGACAAACAATGGAGGAAGCTGGGGAAAGTTATCTCAATGAACTCATTGGAAGGAATTTGGTTCGTGTCACCACAAGAGAGATGGATGGTCGTGCA
>augustus_masked-Fvb3-4-processed-gene-211.5:1320:1440:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_12::augustus_masked-Fvb3-4-processed-gene-211.5:1320-1440||RAPiDGENOMICS_rs1205_01879
AATGAACTCATTGGAAGGAATTTGGTTCGTGTCACCACAAGAGAGATGGATGGTCGTGCAAGGAGTTGTCGTGTTTTGAACCTTGTTCGTGAGTTCATTATTTCAAAAGCGGGGAACTTC
>augustus_masked-Fvb3-4-processed-gene-211.5:1440:1560:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_13::augustus_masked-Fvb3-4-processed-gene-211.5:1440-1560||RAPiDGENOMICS_rs1205_01880
ATCACTGTATTGGAACCATACTGCAGTATTCATTCAGGGGAGAAAATTCGGCGCCTTTCAGTTCAAAATGTCAATATCAATTTGTTAAAGGCCAAGGATTTGAGTCATATTCGTACCTTA
>augustus_masked-Fvb3-4-processed-gene-211.5:1620:1740:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_14::augustus_masked-Fvb3-4-processed-gene-211.5:1620-1740|2x||RAPiDGENOMICS_rs1205_01881
TACTTGAGGGTGTTAGATTTGCAAGGTGTACCTTTGAAGAACTTCCCTGATAGTGTAATTGGTCTCCCCCTCTTAAGGTACTTAAATCTGAGCCAAACTGAGATTAAATCAGTTCCAAAG
>augustus_masked-Fvb3-4-processed-gene-211.5:1680:1800:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-211.5:1680-1800||RAPiDGENOMICS_rs1205_01882
GGTCTCCCCCTCTTAAGGTACTTAAATCTGAGCCAAACTGAGATTAAATCAGTTCCAAAGTCCGTCGGCAATCTTGCATTTTTGCAAACCTTGAATCTTAAGCACACACATGTGACCAGC
>augustus_masked-Fvb3-4-processed-gene-211.5:1740:1860:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-211.5:1740-1860|2x||RAPiDGENOMICS_rs1205_01883
TCCGTCGGCAATCTTGCATTTTTGCAAACCTTGAATCTTAAGCACACACATGTGACCAGCTTACCAAAAAAGATTTATGAACTCCAGGATATGCGTCATCTTTTACTTTATAGCTGTGAT
>augustus_masked-Fvb3-4-processed-gene-211.5:1800:1920:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_16::augustus_masked-Fvb3-4-processed-gene-211.5:1800-1920||RAPiDGENOMICS_rs1205_01884
TTACCAAAAAAGATTTATGAACTCCAGGATATGCGTCATCTTTTACTTTATAGCTGTGATGTTACTTCTGGTGTGGCACAAGGAGTTGAGGTTCCTGCTGGCAACATAGGAGCTTTGTCT
>augustus_masked-Fvb3-4-processed-gene-211.5:1920:2040:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_17::augustus_masked-Fvb3-4-processed-gene-211.5:1920-2040||RAPiDGENOMICS_rs1205_01885
TCCATACAGAAGTTGTTTCTAATCAAGGTGAAGAAACAAAGAAAAGTAGTCCTTAAAGCCTTGGGAGAGTTAATTTCTCTCCGGAAGTTGGGGTTGGTAGACCTTGAGAGAGAACATGGA
>augustus_masked-Fvb3-4-processed-gene-211.5:2040:2160:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_18::augustus_masked-Fvb3-4-processed-gene-211.5:2040-2160||RAPiDGENOMICS_rs1205_01886
AGAGAATTATGTTGTTCCATACAGAAAATGGCAGAGCTTTCAACACTTGATATACGATCAACAGGTGAGGAAGAGTATCTTGATTTGGATCATATGAACTCCCCAGCTGGGCCTCCTAGC
>augustus_masked-Fvb3-4-processed-gene-211.5:2160:2280:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_19::augustus_masked-Fvb3-4-processed-gene-211.5:2160-2280||RAPiDGENOMICS_rs1205_01887
TATCTCCAACATCTCTCTTTGACAGGGCGCCTGGAGAAACTGCCGCAGTGGATTTCCCAGCTTCATAGTCTGGCTAGGATTGCTCTAAATGGATCAAAATTGGATGCTGACTCCAGCTCA
>augustus_masked-Fvb3-4-processed-gene-211.5:2280:2400:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_20::augustus_masked-Fvb3-4-processed-gene-211.5:2280-2400||RAPiDGENOMICS_rs1205_01888
CTTGAGACCCTCCAAGATTTGCCTAATCTTGTGGAGCTCGAGTTGGTTGACTTTTGTACTGGGCATTTGTTGAAGTTCAGAGCTAAAAAGTTCAAGAAACTAAAGGCATTACGTATTGAG
>augustus_masked-Fvb3-4-processed-gene-211.5:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-211.5:240-360||RAPiDGENOMICS_rs1205_01889
CTTGACAAGTTCATGGCACAGATTCCACATCACTTCCACAGCAACATGTTCTCTCAGAAGCTCCACGAATTTGCACATTACCGCACAGAAAGGAATGCAAAACTTGAGTTCTCCACCAAG
>augustus_masked-Fvb3-4-processed-gene-211.5:2400:2520:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_21::augustus_masked-Fvb3-4-processed-gene-211.5:2400-2520||RAPiDGENOMICS_rs1205_01890
AAATTTGATGAGCTAGATTTGATGATAATCGAGGATGGAGCCATGCCTGAGCTTAAGAGACTAACGTTGTCTAAATGTCGAAATCTAAAGTTGTTCCTCTTTGGCATTGGTAGTATTATG
>augustus_masked-Fvb3-4-processed-gene-211.5:420:540:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-211.5:420-540|2x||RAPiDGENOMICS_rs1205_01891
CCAAGTTACAGCACAAGACAGAGAGATAGTTTGATCCACCAAGTTCTTGCAGAAGAAGAAATCGTAGGCTTCAAGGAGCCTAGAGAAAGACTTACCAAACAGTTGATGGAAGCAGATCTG
>augustus_masked-Fvb3-4-processed-gene-211.5:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-211.5:480-600||RAPiDGENOMICS_rs1205_01892
ATCGTAGGCTTCAAGGAGCCTAGAGAAAGACTTACCAAACAGTTGATGGAAGCAGATCTGAGGCTGTTGATGATTTTTATTGTTGGTCCGGGAGGCTCCGGAAAAACCACTGTCGCGAAG
>augustus_masked-Fvb3-4-processed-gene-211.5:540:660:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-211.5:540-660|2x||RAPiDGENOMICS_rs1205_01893
AGGCTGTTGATGATTTTTATTGTTGGTCCGGGAGGCTCCGGAAAAACCACTGTCGCGAAGAATGTTTATGAGAGCGATAGCATTCAAGAATTTTTTGATGGACTTGCTTGGATTGATGTG
>augustus_masked-Fvb3-4-processed-gene-211.5:600:720:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-211.5:600-720||RAPiDGENOMICS_rs1205_01894
AATGTTTATGAGAGCGATAGCATTCAAGAATTTTTTGATGGACTTGCTTGGATTGATGTGTCTCGCCCTTCTAAAGCAGAAGAAGATCAAACAGCAGAACTCAGTCACCTGAAGGGAAAG
>augustus_masked-Fvb3-4-processed-gene-211.5:660:780:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-211.5:660-780|2x||RAPiDGENOMICS_rs1205_01895
TCTCGCCCTTCTAAAGCAGAAGAAGATCAAACAGCAGAACTCAGTCACCTGAAGGGAAAGAGGTTTGTGGTTATTTTGGATAATGTTTGGACAACAAATGATCTGGAACGTATTACAAAT
>augustus_masked-Fvb3-4-processed-gene-211.5:720:840:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-211.5:720-840||RAPiDGENOMICS_rs1205_01896
AGGTTTGTGGTTATTTTGGATAATGTTTGGACAACAAATGATCTGGAACGTATTACAAATGCTTTGCCAAAAGGATTGCTTGGGAGTAAAGTAATCATAATTACTCGTAACTCTGATATA
>augustus_masked-Fvb3-4-processed-gene-211.5:780:900:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-211.5:780-900|2x||RAPiDGENOMICS_rs1205_01897
GCTTTGCCAAAAGGATTGCTTGGGAGTAAAGTAATCATAATTACTCGTAACTCTGATATAGCTTCTGCTCGTGCAGAGTCCTCCGAGTATATCCATGATTTGTGTAGCGGATTATTATGG
>augustus_masked-Fvb3-4-processed-gene-211.5:840:960:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-211.5:840-960||RAPiDGENOMICS_rs1205_01898
GCTTCTGCTCGTGCAGAGTCCTCCGAGTATATCCATGATTTGTGTAGCGGATTATTATGGAAAGATGCCTGGTCTCTGTTTTGCAACAAGGCTTTCAAACTTACTGCAGGATATTGTCCG
>augustus_masked-Fvb3-4-processed-gene-211.5:900:1020:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-211.5:900-1020|2x||RAPiDGENOMICS_rs1205_01899
AAAGATGCCTGGTCTCTGTTTTGCAACAAGGCTTTCAAACTTACTGCAGGATATTGTCCGCCTGAGCTCCAAGAGTGGGCTAAAAAGTTCTTGAAGAAGTGTGAAGGTCTGCCCCTTGCA
>augustus_masked-Fvb3-4-processed-gene-211.5:960:1080:Parent=augustus_masked-Fvb3-4-processed-gene-211.5-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-211.5:960-1080||RAPiDGENOMICS_rs1205_01900
CCTGAGCTCCAAGAGTGGGCTAAAAAGTTCTTGAAGAAGTGTGAAGGTCTGCCCCTTGCAGTTTCAGCTATTGCTACTTTGCTGGCAAACAAGCCACAAACTCCAGTTGAGTGGAAGAAG
>augustus_masked-Fvb3-4-processed-gene-229.5:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-229.5:0-120||RAPiDGENOMICS_rs1205_01901
ATGAATAGGTCTGCTTTATTCAAACCTACCATGCACCTCACTGTTGTTCACTATTTTCTTGTTTTATTTGTGGCCTCTTTGTATGTACACACCGGTTTCTGTCTTGGTGATGGACTTCCA
>augustus_masked-Fvb3-4-processed-gene-229.5:1080:1200:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-229.5:1080-1200||RAPiDGENOMICS_rs1205_01902
AAGACAATGAAAGCACTGGATTTGTCTGAATGCTCTCTGACAAGCACATTCCCAGCTTCTGTAGGAAAGCTAAAAACCCTAGAGCATCTTCTGCTTGATTTCAATAATATCTGGGGCTCA
>augustus_masked-Fvb3-4-processed-gene-229.5:1140:1260:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-229.5:1140-1260|2x||RAPiDGENOMICS_rs1205_01903
GTAGGAAAGCTAAAAACCCTAGAGCATCTTCTGCTTGATTTCAATAATATCTGGGGCTCAATTCCAGAATCTGTTGGAAACTTGTCGTCTTTGAAAACACTTGTCCTGTCTGGTAATTTT
>augustus_masked-Fvb3-4-processed-gene-229.5:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-229.5:120-240||RAPiDGENOMICS_rs1205_01904
AGCAGTTTGGGATCATCATGCATTGAGGAAGAGAGACGAGCTCTTCTCACCTTCAAGCAGGATCTCATTGATCACACTGCTAGGCTTTCTTCTTGGGCAGGTCATGATTGCTGTCAGTGG
>augustus_masked-Fvb3-4-processed-gene-229.5:1200:1320:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-229.5:1200-1320||RAPiDGENOMICS_rs1205_01905
ATTCCAGAATCTGTTGGAAACTTGTCGTCTTTGAAAACACTTGTCCTGTCTGGTAATTTTATGAACGGGTCCATTCCAGAAAGTCTAGGACAACTGTCTGAGCTAGTTGAGTTATCTCTG
>augustus_masked-Fvb3-4-processed-gene-229.5:1260:1380:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-229.5:1260-1380|2x||RAPiDGENOMICS_rs1205_01906
ATGAACGGGTCCATTCCAGAAAGTCTAGGACAACTGTCTGAGCTAGTTGAGTTATCTCTGCGTTATAATTACTGGGAAGGGATTATAACTGAAGCTCACTTTAGAAATCTCACCAGCTTG
>augustus_masked-Fvb3-4-processed-gene-229.5:1440:1560:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_13::augustus_masked-Fvb3-4-processed-gene-229.5:1440-1560||RAPiDGENOMICS_rs1205_01907
TGGGTTCCTCCTTTCAAGCTTAACTATATTAAAATTGGGAATTGTCAAGTAGGTCCAACCTTTCCGCTCTGGCTTATATCTCAGACTGAACTAGTTTATGTCCAGCTTTACAATACTAGT
>augustus_masked-Fvb3-4-processed-gene-229.5:1560:1680:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_14::augustus_masked-Fvb3-4-processed-gene-229.5:1560-1680||RAPiDGENOMICS_rs1205_01908
ATCTCGGACTCCAGACCAGAGAACTGGTTGTTGAAGATATCCTCCCGAGTCATAATTCTGAGTCTATCTAACAACCAAATTGGGGGAAAGCTTCCATTGCAAATGGATTTCCCAAACTTG
>augustus_masked-Fvb3-4-processed-gene-229.5:1680:1800:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-229.5:1680-1800||RAPiDGENOMICS_rs1205_01909
GGGGTTTTTGATTTAAGTTATAATCAACTTGAGGGCCCACTTCCACTTTGGTTGTCCAATAATACATACCAGCTTGATCTAAGAAGCAATTTATTCTCCGGGCCCATGCCCTCAAACTTC
>augustus_masked-Fvb3-4-processed-gene-229.5:1740:1860:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-229.5:1740-1860|2x||RAPiDGENOMICS_rs1205_01910
AATACATACCAGCTTGATCTAAGAAGCAATTTATTCTCCGGGCCCATGCCCTCAAACTTCGGCCAATTAATGCCCAACTTACAATACTTGCATCTCTCTGAGAATAATCTGAATGGTAGT
>augustus_masked-Fvb3-4-processed-gene-229.5:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-229.5:180-300|2x||RAPiDGENOMICS_rs1205_01911
GATCTCATTGATCACACTGCTAGGCTTTCTTCTTGGGCAGGTCATGATTGCTGTCAGTGGAAAGGAATTTCATGCGACAACCTTACTGGTCAAGTTGTAAGGGTGGACCTCCGAAATGAT
>augustus_masked-Fvb3-4-processed-gene-229.5:1800:1920:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_16::augustus_masked-Fvb3-4-processed-gene-229.5:1800-1920||RAPiDGENOMICS_rs1205_01912
GGCCAATTAATGCCCAACTTACAATACTTGCATCTCTCTGAGAATAATCTGAATGGTAGTATTCCAAAATCTCTTTCCAACATGCAAGACTTGTTTATCCTTTCCCTAAGAAGCAACCAA
>augustus_masked-Fvb3-4-processed-gene-229.5:1860:1980:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_16::augustus_masked-Fvb3-4-processed-gene-229.5:1860-1980|2x||RAPiDGENOMICS_rs1205_01913
ATTCCAAAATCTCTTTCCAACATGCAAGACTTGTTTATCCTTTCCCTAAGAAGCAACCAATTGTCAGGAGAATTTCCTCAAGCATGGAGTTCTTGGCAAGATATAGCTGTTGTGGATGTG
>augustus_masked-Fvb3-4-processed-gene-229.5:1920:2040:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_17::augustus_masked-Fvb3-4-processed-gene-229.5:1920-2040||RAPiDGENOMICS_rs1205_01914
TTGTCAGGAGAATTTCCTCAAGCATGGAGTTCTTGGCAAGATATAGCTGTTGTGGATGTGGGTAACAACAGTCTCTCTGGTCAGATTCCCAGCTCAATGGGTGTCCCAAGTTCTCTTGCG
>augustus_masked-Fvb3-4-processed-gene-229.5:2040:2160:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_18::augustus_masked-Fvb3-4-processed-gene-229.5:2040-2160||RAPiDGENOMICS_rs1205_01915
ATATTGAAGTTGAACGACAACAAATTTGAAGGTGAGATTCCTTCTTCCCTTAGAAATTGCTCTTCTATGGAGAGTATTGATCTTGGAGGCAACAAAATTACTGGAAATGTACCATCATGG
>augustus_masked-Fvb3-4-processed-gene-229.5:2160:2280:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_19::augustus_masked-Fvb3-4-processed-gene-229.5:2160-2280||RAPiDGENOMICS_rs1205_01916
ATAGGCCTAGACATGCCCCAGTTGTCTATGTTAAGATTGAGATCCAACTATCTACGTGGACATATTCCCGGTCAATTGTGCAATCTTCAATACCTTCATCTTCTAGACCTCGGTCACAAC
>augustus_masked-Fvb3-4-processed-gene-229.5:2280:2400:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_20::augustus_masked-Fvb3-4-processed-gene-229.5:2280-2400||RAPiDGENOMICS_rs1205_01917
AATTTTTCCGGTACTATTCCCAAGTGTTTGAATAACCTGAGTACTCTGGCATATGATAATTCCAGTGGTGGTGAGAGAACCTTTTTTACTTACACTGAAGAAACAACAGTGAATTCAAAA
>augustus_masked-Fvb3-4-processed-gene-229.5:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-229.5:240-360||RAPiDGENOMICS_rs1205_01918
AAAGGAATTTCATGCGACAACCTTACTGGTCAAGTTGTAAGGGTGGACCTCCGAAATGATTATCCATATGTTGGATTAATGTCATATACCCAAGGATTGGCTTATGGTCAGTCTTTCTTG
>augustus_masked-Fvb3-4-processed-gene-229.5:2400:2520:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_21::augustus_masked-Fvb3-4-processed-gene-229.5:2400-2520||RAPiDGENOMICS_rs1205_01919
GGACAAGAACTTGTGTACATGGACACTCTGCAGTTTGTAGCCAGCATTGATCTCTCATCAAACAATTTAGAAGGTGAAATCCCTGAAGAAATAAGCAGTCTTGTTGCATTGGGTACCCTC
>augustus_masked-Fvb3-4-processed-gene-229.5:2580:2700:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_22::augustus_masked-Fvb3-4-processed-gene-229.5:2580-2700|2x||RAPiDGENOMICS_rs1205_01920
TTGGAAACTCTTGATCTCTCACACAACAAGCTTTCAGGACGGATCCCTAAAAGTTTTGCTTCTTTAACCTCATTGTCGCACTTGAACTTGTCTTACAACAACTTGGCGGGAAGAATTCCT
>augustus_masked-Fvb3-4-processed-gene-229.5:2640:2760:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_23::augustus_masked-Fvb3-4-processed-gene-229.5:2640-2760||RAPiDGENOMICS_rs1205_01921
TCTTTAACCTCATTGTCGCACTTGAACTTGTCTTACAACAACTTGGCGGGAAGAATTCCTACAGGCTTCCAACTCCAGACACTTGAAGATTCATCCATTTATGAAGGTAATCCGTTACTG
>augustus_masked-Fvb3-4-processed-gene-229.5:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-229.5:480-600||RAPiDGENOMICS_rs1205_01922
TATCTCAATGTCTCCGATGCATCATTTGGGGGAGACATACCTTCTTCTTTTGCTAACTTGTCAAACTTAAACCATCTTGACATAAGTCGAAATTTCTTCAAAACATCTTTGAAAAACTTG
>augustus_masked-Fvb3-4-processed-gene-229.5:60:180:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-229.5:60-180|2x||RAPiDGENOMICS_rs1205_01923
GTTTTATTTGTGGCCTCTTTGTATGTACACACCGGTTTCTGTCTTGGTGATGGACTTCCAAGCAGTTTGGGATCATCATGCATTGAGGAAGAGAGACGAGCTCTTCTCACCTTCAAGCAG
>augustus_masked-Fvb3-4-processed-gene-229.5:720:840:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-229.5:720-840||RAPiDGENOMICS_rs1205_01924
CTGTCTTTTTGCAAAATTAACCAAACCCTTCCCCTCTCACTGCAAACCACTAACCTCACATCCCTTTTGGTCCTTGATATATCATATAATGATATTAGTTCTTCATATCCCAGCTGGCTT
>augustus_masked-Fvb3-4-processed-gene-229.5:780:900:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-229.5:780-900|2x||RAPiDGENOMICS_rs1205_01925
TCCCTTTTGGTCCTTGATATATCATATAATGATATTAGTTCTTCATATCCCAGCTGGCTTTTTAATCTTACCAACCTCAAGCAACTTGATCTGAGCTACAATTTTTTCGGCCGTCTCATT
>augustus_masked-Fvb3-4-processed-gene-229.5:840:960:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-229.5:840-960||RAPiDGENOMICS_rs1205_01926
TTTAATCTTACCAACCTCAAGCAACTTGATCTGAGCTACAATTTTTTCGGCCGTCTCATTCCCAGAGAATTTTCAAACCTCAAATTTCTGGAAGACCTTTATCTGTCTGGAATGACACTC
>augustus_masked-Fvb3-4-processed-gene-229.5:900:1020:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-229.5:900-1020|2x||RAPiDGENOMICS_rs1205_01927
CCCAGAGAATTTTCAAACCTCAAATTTCTGGAAGACCTTTATCTGTCTGGAATGACACTCGAAGGTCAAATTCCACAACTCGAAGGAAATATCTGCAATCTAAAGTCCTTAGATCTTTCA
>augustus_masked-Fvb3-4-processed-gene-229.5:960:1080:Parent=augustus_masked-Fvb3-4-processed-gene-229.5-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-229.5:960-1080||RAPiDGENOMICS_rs1205_01928
GAAGGTCAAATTCCACAACTCGAAGGAAATATCTGCAATCTAAAGTCCTTAGATCTTTCAGTGAACAAATTTGAAACAGGGGTTCACGAGTTTTTCAGCACTTTGTCAGATTGTCCGAAT
>augustus_masked-Fvb3-4-processed-gene-229.6:1089:1209:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-229.6:1089-1209||RAPiDGENOMICS_rs1205_01929
GAATGGTTGTTGAAGATATCTTCCCAACTTACATGGTTGGATTTATCTTACAACCAAATCCGTGGGAAGCTTCCACTTCAAATGAACTTCCAATCTTTGTTAGTATTACATTTGAGTTAT
>augustus_masked-Fvb3-4-processed-gene-229.6:1209:1329:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-229.6:1209-1329||RAPiDGENOMICS_rs1205_01930
AATCAATTTGAGGGCCTTCTGCCACATTGGTCTAGTGACGCTGCCGCATGGGTCGATCTTCGAAGCAATTCATTTTCCGGGCCAATTCCCTCAAACTACGATCAACTGTGGCCTAAATTG
>augustus_masked-Fvb3-4-processed-gene-229.6:1269:1389:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-229.6:1269-1389|2x||RAPiDGENOMICS_rs1205_01931
CGAAGCAATTCATTTTCCGGGCCAATTCCCTCAAACTACGATCAACTGTGGCCTAAATTGGAACAGTTGTATCTGTCTGACAATCATCTGCATGGTAGTATACCACCTTCTTTGTGTAAC
>augustus_masked-Fvb3-4-processed-gene-229.6:1329:1449:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-229.6:1329-1449||RAPiDGENOMICS_rs1205_01932
GAACAGTTGTATCTGTCTGACAATCATCTGCATGGTAGTATACCACCTTCTTTGTGTAACATGTCACGTTTAGGAATTCTCTTGTCAAGAAGCAATCACTTGTCTGGAGAATTCCCTCGA
>augustus_masked-Fvb3-4-processed-gene-229.6:1389:1509:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-229.6:1389-1509|2x||RAPiDGENOMICS_rs1205_01933
ATGTCACGTTTAGGAATTCTCTTGTCAAGAAGCAATCACTTGTCTGGAGAATTCCCTCGAGAATGGAGTATGTGGCCGAGTATAAAGATTGTAGATGTCTCAGACAACAATTTGGCTGGC
>augustus_masked-Fvb3-4-processed-gene-229.6:1449:1569:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-229.6:1449-1569||RAPiDGENOMICS_rs1205_01934
GAATGGAGTATGTGGCCGAGTATAAAGATTGTAGATGTCTCAGACAACAATTTGGCTGGCAATATCCCCAGTATTATGGGTGTTCCCAGCTCACTATGCATATTGAGTCTGAGCGAAAAC
>augustus_masked-Fvb3-4-processed-gene-229.6:1569:1689:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-229.6:1569-1689||RAPiDGENOMICS_rs1205_01935
AGTTTCGAGGGTCCAATTCCTTCTTCTATATTTGAAAACTGCACCAAGTTGTTGAGTATTGATCTTGGAGGCAATAGATTGACTGGAAGCATACCTTTATGGACAAGATCATTTGTATCA
>augustus_masked-Fvb3-4-processed-gene-229.6:1689:1809:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-229.6:1689-1809||RAPiDGENOMICS_rs1205_01936
TCTAAGTTATATATGCTACGTTTGCGATCCAACTCTGTGAGTGGACAAATCCCCTGGCGACTGTGCTCTCTTCAATTTCTTCATATCATAGACCTTGGCCACAACTACTTTTCAGGGACC
>augustus_masked-Fvb3-4-processed-gene-229.6:1809:1929:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-229.6:1809-1929||RAPiDGENOMICS_rs1205_01937
ATTCCCAAATGTTTGTATAATTTGACTGGCTTGATGGCCTATGGTAATGACACTGGTATAGGTTCATCTAGTTATCTTGAGACGACTAGCTTGACATTGAAGGGACAAGAACTGGTGTAT
>augustus_masked-Fvb3-4-processed-gene-229.6:1947:2067:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-229.6:1947-2067||RAPiDGENOMICS_rs1205_01938
AAATCAACTGACTGGAACATTCCCTCAAAGATTGGAAGCTTGCGGAGGCTGGAAACTCTTGATCTCTCACACAATCACCTCTCCGGCCACATTCCTCAAAGTTTTTCTTCATTAACCTCT
>augustus_masked-Fvb3-4-processed-gene-229.6:2007:2127:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-229.6:2007-2127|2x||RAPiDGENOMICS_rs1205_01939
GATCTCTCACACAATCACCTCTCCGGCCACATTCCTCAAAGTTTTTCTTCATTAACCTCTTTGTCTCATTTGAACTTGTCTCACAACAACTTGTCCGGAAGAATTCCTTCAGGTAACCAA
>augustus_masked-Fvb3-4-processed-gene-229.6:2067:2187:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-229.6:2067-2187||RAPiDGENOMICS_rs1205_01940
TTGTCTCATTTGAACTTGTCTCACAACAACTTGTCCGGAAGAATTCCTTCAGGTAACCAACTTCAAACACTCGATGATTCATCCATTTATGATGGCAATCCATCCTTGTGCGGGGTGCCT
>augustus_masked-Fvb3-4-processed-gene-229.6:2307:2427:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-229.6:2307-2427||RAPiDGENOMICS_rs1205_01941
GGCTTTTGGAGTGTTTGTGGCACATTGGTTATGAAGAAATCATGGAGGTATGCCTATTTTCAGTTCTTTGATAACATACAAGAGAAGGCAGCTAGAATCTTAACATATAAGAGAAGGCAG
>augustus_masked-Fvb3-4-processed-gene-229.6:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-229.6:240-360||RAPiDGENOMICS_rs1205_01942
TCAAACTTGAACTATCTTGACCTCAAAAATTATGTCAATGGTGGTTATTCCAAAAACTTGAATTGGCTTTCTCATCTTTCTTCTCTAAGGTACCTCAATCTTGGAGGTGTAGACTTAAGC
>augustus_masked-Fvb3-4-processed-gene-229.6:2543:2663:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-229.6:2543-2663||RAPiDGENOMICS_rs1205_01943
TTTGAGATCAGCATGCATGGAGGACGAGAGACAAGCGCTTCTCAGCTTCAGACACGATCTTGCAGATCCTTCCGGTAGGCTTTCGTCTTGGATTGGTTACGATTGCTGTCAACGGAGAGG
>augustus_masked-Fvb3-4-processed-gene-229.6:2603:2723:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-229.6:2603-2723|2x||RAPiDGENOMICS_rs1205_01944
TGCAGATCCTTCCGGTAGGCTTTCGTCTTGGATTGGTTACGATTGCTGTCAACGGAGAGGGATTTCATGCAACAACCTCACTGGTCATGTTGTGAAAATGGACCTCAGTAACACATATTG
>augustus_masked-Fvb3-4-processed-gene-229.6:2663:2783:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-229.6:2663-2783||RAPiDGENOMICS_rs1205_01945
GATTTCATGCAACAACCTCACTGGTCATGTTGTGAAAATGGACCTCAGTAACACATATTGTCAACATGACTATTTGGAGTGGGATGAGGTGGCTTACAGAAGGTCTCTATTGAAGGGTAA
>augustus_masked-Fvb3-4-processed-gene-229.6:2783:2903:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-229.6:2783-2903||RAPiDGENOMICS_rs1205_01946
GCTAAATCCTTCATTTCTCACCTTGACACATTTAGATTACTTGGACCTAAGCTGCAATGATTTTGAACTTCCGTTTTTCATAGGACAGCTTAAAAGTTTGAGGTATCTCAATCTCTCTTC
>augustus_masked-Fvb3-4-processed-gene-229.6:2903:3023:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-229.6:2903-3023||RAPiDGENOMICS_rs1205_01947
CTTTTCATCATCTCAGGGAGAAATCCCACCTCATTTTGGTAACCTTTCAAACTTGAGCTATCTAGACCTCAGTGCAAATTTTTTGTTGACTTTAACTTCCAGAAACTTGAACTGGCTTTC
>augustus_masked-Fvb3-4-processed-gene-229.6:3023:3143:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-229.6:3023-3143||RAPiDGENOMICS_rs1205_01948
TCAACTCTCTTCCCTTAAATACCTCAGTCTGCAATATGTGGATCTTACCAAAACAGGAGTGAGTTGGTTCCATGCTGTAAACAAGCTTCCCTCATTGTTAGAGTTACATTTGTCTCTATG
>augustus_masked-Fvb3-4-processed-gene-229.6:3143:3263:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-229.6:3143-3263||RAPiDGENOMICS_rs1205_01949
CCAAATTGGAAGCATTCCACTCTCAGTGCCAAAGATAAACATCACATCACTTTTGATCCTTGACATGTCAAAAAACTATATCTCATCTTCAATTCCCAGCTGGTTGTTTAACCTTACCAG
>augustus_masked-Fvb3-4-processed-gene-229.6:3263:3383:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-229.6:3263-3383||RAPiDGENOMICS_rs1205_01950
CCTCATAAAATTGAATCTAAGTGACACTTCTTTCGGTGGCTCCATTAGTTGGGAATCGGCAAGCTTCAAAGATCTGGAAGACCTTGACTTATCTAGTAATAGATTTGAAGGTCCTATTCC
>augustus_masked-Fvb3-4-processed-gene-229.6:3383:3503:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-229.6:3383-3503||RAPiDGENOMICS_rs1205_01951
TAACATCATTGGGAATTCCACCAAGCTAAAGATCATCAATTTGTCACACAACAAATTTGTGGGGGCAATTCCAGAGCGTTTTCTTGGTTGTTCAGGCTGTAGAAATGATACATTAGAGCT
>augustus_masked-Fvb3-4-processed-gene-229.6:3503:3623:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-229.6:3503-3623||RAPiDGENOMICS_rs1205_01952
CTTAGATTTGTCTTTTAATATGCTGGAATGCAAATTGCCGGACTCCTTAGGCATGCTGCATAATTTACAGTATCTGAACCTTCAGTCCAACTCTTTTTGGGGCACAATTCCAGAGTCTAT
>augustus_masked-Fvb3-4-processed-gene-229.6:3563:3683:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-229.6:3563-3683|2x||RAPiDGENOMICS_rs1205_01953
TAATTTACAGTATCTGAACCTTCAGTCCAACTCTTTTTGGGGCACAATTCCAGAGTCTATAGGAAACTTGTCATCCTTGCAAACTCTAGACCTCAGTTATAATCATATGAATGGGTCAAT
>augustus_masked-Fvb3-4-processed-gene-229.6:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-229.6:360-480||RAPiDGENOMICS_rs1205_01954
AATACAGGGGTAAGTTGGCTACATGATGTCAACATGCTTCCCTCACTCTTAGAGTTGCATTTGTCTACTTGCCAAATCAATGAAAACCAGCTTCCGCTCTCCCTGCACGCCCTTAACTTT
>augustus_masked-Fvb3-4-processed-gene-229.6:3623:3743:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-229.6:3623-3743||RAPiDGENOMICS_rs1205_01955
AGGAAACTTGTCATCCTTGCAAACTCTAGACCTCAGTTATAATCATATGAATGGGTCAATTCCTAGAAGTTTGGGAGAACTCTCTCAGCTAGTTCACCTAGATCTGTCACATAATTCCTG
>augustus_masked-Fvb3-4-processed-gene-229.6:3683:3803:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-229.6:3683-3803|2x||RAPiDGENOMICS_rs1205_01956
TCCTAGAAGTTTGGGAGAACTCTCTCAGCTAGTTCACCTAGATCTGTCACATAATTCCTGGGAAGGCAATCTATCAGAATTCTATTTCAAAAATCTCACCAGGTTAAAGTCTTTGGTAGT
>augustus_masked-Fvb3-4-processed-gene-229.6:3743:3863:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-229.6:3743-3863||RAPiDGENOMICS_rs1205_01957
GGAAGGCAATCTATCAGAATTCTATTTCAAAAATCTCACCAGGTTAAAGTCTTTGGTAGTAACCACAGATCAACCTATGTCTCTCATTTTTTATGTGTCTTATCAGTGGGCTGCTCCTTT
>augustus_masked-Fvb3-4-processed-gene-229.6:3863:3983:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_12::augustus_masked-Fvb3-4-processed-gene-229.6:3863-3983||RAPiDGENOMICS_rs1205_01958
CAAGCTCTACACAATTGACATTAGGAATTGTAGCATAGGTCCTTCCTTTCCTGCATGGCTTCAGTCTCAAACTGAACTACTGGCTGTCACCCTTTCAAATACTAACATCTCAGATTCCAT
>augustus_masked-Fvb3-4-processed-gene-229.6:3983:4103:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_13::augustus_masked-Fvb3-4-processed-gene-229.6:3983-4103||RAPiDGENOMICS_rs1205_01959
GCCAGAGGAGTTGTTCTTGAAGTTGTGTTCCCAAATCAAATACTTGGATTTATCTTACAACCAAATCCATGGAAGGCTTCCATTGCAAATGACATGTCCAAGTCTGTATCATATAGATTT
>augustus_masked-Fvb3-4-processed-gene-229.6:4363:4483:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-229.6:4363-4483||RAPiDGENOMICS_rs1205_01960
ATATGAAAAGTATTGATCTCGGAAGCAACCAATTCACTGGAAACCTGCCTTCAATGCTGCCAGCAGAATTGTTCATCCTGCGGCTACGATCCAACTTTTTCAGTGGGCATATACCCCAAT
>augustus_masked-Fvb3-4-processed-gene-229.6:4603:4723:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-229.6:4603-4723||RAPiDGENOMICS_rs1205_01961
ACTATGATAGCTACTTTGAGCAACTCACATTGATGTCAAAAGGAACAGAACTGACGTATAACACGACTGTATTTTTCGTCAACATCATTGATCTTTCATCAAACAATTTAGAAGGCGAAA
>augustus_masked-Fvb3-4-processed-gene-229.6:4663:4783:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-229.6:4663-4783|2x||RAPiDGENOMICS_rs1205_01962
ACACGACTGTATTTTTCGTCAACATCATTGATCTTTCATCAAACAATTTAGAAGGCGAAATCCCTGAAGGAGTAAGTAGCCTCATTGGATTAGGTACGTTGAACTTGTCAAGAAATCACC
>augustus_masked-Fvb3-4-processed-gene-229.6:4723:4843:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-229.6:4723-4843||RAPiDGENOMICS_rs1205_01963
TCCCTGAAGGAGTAAGTAGCCTCATTGGATTAGGTACGTTGAACTTGTCAAGAAATCACCTAAGCGGACAGATTCCCTCCAAGATTGGAAATTTGAGATGGTTGGAAACTCTTGATCTCT
>augustus_masked-Fvb3-4-processed-gene-229.6:4783:4903:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-229.6:4783-4903|2x||RAPiDGENOMICS_rs1205_01964
TAAGCGGACAGATTCCCTCCAAGATTGGAAATTTGAGATGGTTGGAAACTCTTGATCTCTCACAGAATCATCTATCAGGATCGATTCCTCAGAGTTTGTCTTCTTTAACCTCCTTGTCTC
>augustus_masked-Fvb3-4-processed-gene-229.6:4903:5023:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-229.6:4903-5023|2x||RAPiDGENOMICS_rs1205_01965
ACTTGAATTTGTCCTATAACAACTTGGCTGGAAGAATTCCCTCGAGCACACAGCTTACTACACTTAATGATTCATCAATATACGAAGGCAATTCATTGTTGTGTGGAGTTCCTCTCGCAG
>augustus_masked-Fvb3-4-processed-gene-229.6:5083:5203:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-229.6:5083-5203||RAPiDGENOMICS_rs1205_01966
ATGACAACGGAAAGCTTGGTTTGTACGGTAGCAGTGTACTGGGCTTTATCATAGGCTTTTGGGGTGTTTGTGGCGCATTGCTTGTGAAGAACTCATGGAGGTATGCTTACTTTCAATTCT
>augustus_masked-Fvb3-4-processed-gene-229.6:720:840:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-229.6:720-840||RAPiDGENOMICS_rs1205_01967
GATCTTTCATCAAACTCGTTGGATAGTGGTTTGGAAGAGGTTTTGAAAGGTGTCTCAAACTGTACAAAGTATAGATTAGAGTCACTTGATTTGTCCAACAATATGGTGGAAGGTGAACTC
>augustus_masked-Fvb3-4-processed-gene-229.6:840:960:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-229.6:840-960||RAPiDGENOMICS_rs1205_01968
CCCGCAGCCTTAGGAATGCTAGAAAATCTGAAGGAACTGGACCTCACTTCAAACCAATTTTCCGGTCCCAGGGTCCCATTCCACAATCTATTGCTAGTTTATCATCCTTGGAAACACTGG
>augustus_masked-Fvb3-4-processed-gene-229.6:969:1089:Parent=augustus_masked-Fvb3-4-processed-gene-229.6-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-229.6:969-1089||RAPiDGENOMICS_rs1205_01969
CTTGATTCAGTCGACATTGTTGCCTGCAGGGTAGGTCCTGCCTTTGGGGTATGGCTTCAATCTCAAACTCAGTTAACTCATCTCACGCTTAGTAATACTGGAATCTCAGATTTCCAACCA
>augustus_masked-Fvb3-4-processed-gene-232.10:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-232.10-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-232.10:0-120||RAPiDGENOMICS_rs1205_01970
ATGGGAAGGCAGTTTAACCGAAGCCCATTTCATAAATGGAAAATACTTATCAGCCACAATCAATTAGATGGCACTATTCCATCATCTATCTGCAACATTCAATCTCTATTATCCCTTGCT
>augustus_masked-Fvb3-4-processed-gene-232.10:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-232.10-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-232.10:240-360||RAPiDGENOMICS_rs1205_01971
CCAAGTCATCTTCTTATATTAAAGATGGACAACAATCAGTTAAGCGGAGAAATTCCTTCCGCCTTGCAAAATTGCTCATTTTTGCTGAGACTTTCTCTTGGAGGCAACAATTTCACTGGA
>augustus_masked-Fvb3-4-processed-gene-232.10:300:420:Parent=augustus_masked-Fvb3-4-processed-gene-232.10-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-232.10:300-420|2x||RAPiDGENOMICS_rs1205_01972
GCCTTGCAAAATTGCTCATTTTTGCTGAGACTTTCTCTTGGAGGCAACAATTTCACTGGAGGCATACCTTCTTGGATAGGATCAAAGGTATCCATTTTAATAGTGCTTCAATTGCGATCA
>augustus_masked-Fvb3-4-processed-gene-232.10:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-232.10-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-232.10:360-480||RAPiDGENOMICS_rs1205_01973
GGCATACCTTCTTGGATAGGATCAAAGGTATCCATTTTAATAGTGCTTCAATTGCGATCAAACTCTTTAAGTGGACATATTCCTCACCAACTGTGCAGTCTTCCTTTCCTTCAGTTCCTA
>augustus_masked-Fvb3-4-processed-gene-232.10:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-232.10-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-232.10:480-600||RAPiDGENOMICS_rs1205_01974
GACCTTGGTCACAACAGATTTTCAGGGACTATTCCCAAGTGTTTGAATAATTTGACTTCTCTAGTCTCTGGTCCGAATAATAGCTGGATTTTCTTTAGTGCCTTTGAGGAAACAACCGCG
>augustus_masked-Fvb3-4-processed-gene-232.10:600:720:Parent=augustus_masked-Fvb3-4-processed-gene-232.10-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-232.10:600-720||RAPiDGENOMICS_rs1205_01975
ACTATAAAAGGAAGAGAAAGTGAATACTTCACTAGCCAGGCAAGGCTTCTGACCATTATTGACCTTTCTTCAAACGATTTAGAAGGTGAAATTCCTGAAGAAATAAGCAGCCTTCTTTCA
>augustus_masked-Fvb3-4-processed-gene-232.10:780:900:Parent=augustus_masked-Fvb3-4-processed-gene-232.10-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-232.10:780-900|2x||RAPiDGENOMICS_rs1205_01976
AACTTGTACCGGCTCGAAACTTTTGACCTCTCCCAGAACCGGCTCTCAGGACACATTCCTCAAAGTCTTGCAAATATGACATTTTTGTCTCACTTGAACTTGTCTCACAACAAGTTGACC
>augustus_masked-Fvb3-4-processed-gene-232.10:840:960:Parent=augustus_masked-Fvb3-4-processed-gene-232.10-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-232.10:840-960||RAPiDGENOMICS_rs1205_01977
CAAAGTCTTGCAAATATGACATTTTTGTCTCACTTGAACTTGTCTCACAACAAGTTGACCGGAAGGATCCCATTAGGCAACCAACTTCAAACGCTCGTTGATCCGTCTATTTATGAGGGC
>augustus_masked-Fvb3-4-processed-gene-232.10:960:1080:Parent=augustus_masked-Fvb3-4-processed-gene-232.10-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-232.10:960-1080||RAPiDGENOMICS_rs1205_01978
AATTCACTTTGTGGATTTCCACTTCCAAAATGCCCAAAAGACGAAGACAACATTCATGAGCCTCATGTACATGAGAAACAAGATCACGGAGACGATGATGAAAAGCTTGGTTTCTATACT
>augustus_masked-Fvb3-4-processed-gene-238.20:1298:1418:Parent=augustus_masked-Fvb3-4-processed-gene-238.20-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-238.20:1298-1418|2x||RAPiDGENOMICS_rs1205_01979
ACAGCTTCCTCCGCAGGATATATTGGCGCTGCTTGCATTCAAGAAGGGTATCAAGCATGATCCTACTGGTTTTGTGCTCAGTTCTTGGAATGATGAGTCCATTGACTTCAATGGTTGTCC
>augustus_masked-Fvb3-4-processed-gene-238.20:1658:1778:Parent=augustus_masked-Fvb3-4-processed-gene-238.20-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-238.20:1658-1778|2x||RAPiDGENOMICS_rs1205_01980
TGGTAAGTTGGGGAGCTTAAGGAACCTCTCATTAGGTGGCAACAACTTCTCAGGCTCCATTCCAGATTCCATTTCAGGGCTGTCTGCAATCCAGTCGTTGGATTTGAGTCGCAACTCCTT
>augustus_masked-Fvb3-4-processed-gene-238.20:1718:1838:Parent=augustus_masked-Fvb3-4-processed-gene-238.20-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-238.20:1718-1838||RAPiDGENOMICS_rs1205_01981
TCCAGATTCCATTTCAGGGCTGTCTGCAATCCAGTCGTTGGATTTGAGTCGCAACTCCTTTTCAGGGCTGCTGCCGTCCTCATTGACAAAGCTGTCGAGTCTGGTATCTCTAAATCTTTC
>augustus_masked-Fvb3-4-processed-gene-238.20:1778:1898:Parent=augustus_masked-Fvb3-4-processed-gene-238.20-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-238.20:1778-1898|2x||RAPiDGENOMICS_rs1205_01982
TTCAGGGCTGCTGCCGTCCTCATTGACAAAGCTGTCGAGTCTGGTATCTCTAAATCTTTCTTCAAATGGCTTAACCAAGAGCTTACCTAAGGGGTTTGATCTAATGTCAAGTCTAGATGT
>augustus_masked-Fvb3-4-processed-gene-238.20:1838:1958:Parent=augustus_masked-Fvb3-4-processed-gene-238.20-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-238.20:1838-1958||RAPiDGENOMICS_rs1205_01983
TTCAAATGGCTTAACCAAGAGCTTACCTAAGGGGTTTGATCTAATGTCAAGTCTAGATGTGCTTGACTTGCATGGCAATATGCTTGATGGTCCTCTGGATAAGGCATTTCTGATGGAAGC
>augustus_masked-Fvb3-4-processed-gene-238.20:1898:2018:Parent=augustus_masked-Fvb3-4-processed-gene-238.20-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-238.20:1898-2018|2x||RAPiDGENOMICS_rs1205_01984
GCTTGACTTGCATGGCAATATGCTTGATGGTCCTCTGGATAAGGCATTTCTGATGGAAGCAACTGCCACACATGTTGACTTTAGTGGCAATATGTTTACAAGTTCTGGTTCACAGGGCCA
>augustus_masked-Fvb3-4-processed-gene-238.20:301:421:Parent=augustus_masked-Fvb3-4-processed-gene-238.20-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-238.20:301-421||RAPiDGENOMICS_rs1205_01985
TTACTGATATCCATCAACAATATTCTACAGGTGCATTTGAAGATCCTGATATCATCCATGTTGATGATACTGTGGATCCTGTGAGGGATTTAGAGATTATCAGTGCAGAATTGCGTCTTA
>augustus_masked-Fvb3-4-processed-gene-238.20:3268:3388:Parent=augustus_masked-Fvb3-4-processed-gene-238.20-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-238.20:3268-3388||RAPiDGENOMICS_rs1205_01986
GCCAAGATATCCATAAACGTGCTCCACCAAACCCCTCTGGTGCTCGAGGAGCAGAGAGTGCTGGTGCTTTGGTTGTTTCGGCTGGTGATCTTGTGGCTTCACGGAAAGGATCGTCATCTG
>augustus_masked-Fvb3-4-processed-gene-238.20:423:543:Parent=augustus_masked-Fvb3-4-processed-gene-238.20-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-238.20:423-543||RAPiDGENOMICS_rs1205_01987
CTCCACTTGAAAGCTCTTCCCAATTTCTTGAGCTCATCATTTTCTAGGGATTATGCTACTCGTTTATCTATATATTTTGAGAGAGCTATATCATGTGTTTTGCAGGACATTGAATTCATG
>augustus_masked-Fvb3-4-processed-gene-238.20:4689:4809:Parent=augustus_masked-Fvb3-4-processed-gene-238.20-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-238.20:4689-4809||RAPiDGENOMICS_rs1205_01988
GTATATGATGTTTATACCGGACCAAATGGTTTACTTTATGGAGAGAATTTGCTACCACGGTTATTCATAGATTCTTCCACTATTGATCCACAAACATCTCGAAAGCTTTCTACCATTGTC
>augustus_masked-Fvb3-4-processed-gene-238.20:5203:5323:Parent=augustus_masked-Fvb3-4-processed-gene-238.20-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-238.20:5203-5323||RAPiDGENOMICS_rs1205_01989
ATATACGGAGCTCTGTGAGGATGGCCATGAAACCAAGGACTTCTCCTGTGTATTTCGCCATTATTACTCTGGCAAGAATGAGATTTAGTTTGACTGATGTTAATGTATACCTCTTGGCAG
>augustus_masked-Fvb3-4-processed-gene-254.10:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-254.10-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-254.10:0-120||RAPiDGENOMICS_rs1205_01990
ATGGAACCAGCACCTTTACTCCTCACTCTCCTCCTCCTCCTCCTCTCCTCCACTACCCTCTCCGCCAAGACCACCACCACTCCCTCCCTCCCTCCAACTCCACCCCCAACTCCGCCCCCA
>augustus_masked-Fvb3-4-processed-gene-254.10:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-254.10-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-254.10:120-240||RAPiDGENOMICS_rs1205_01991
ACTCACTCTCCAACTCCCACTACCCCCTCAAGCCCCTCCTCAAGCTCCTCCTCATCATCTCTAGACCCCAAACAAGTAAGAGCCCTCCAATCCCTCAACATCCCAACTTCCAAAGACCCA
>augustus_masked-Fvb3-4-processed-gene-254.10:1200:1320:Parent=augustus_masked-Fvb3-4-processed-gene-254.10-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-254.10:1200-1320||RAPiDGENOMICS_rs1205_01992
TCGAATCAGAGTGATCATCATCATGGGCCGAATAAGGTTGTTCTTGGTGTGGCAATTGCGCTTTCTTCCATTGTGTTCCTCATCATTTTCTTGATTCTTTGCTCAAAGTGGTGTGGGTGA
>augustus_masked-Fvb3-4-processed-gene-254.10:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-254.10-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-254.10:480-600||RAPiDGENOMICS_rs1205_01993
ACCGGCGTCTGGCTCGCCCGCCTCCAGAACCTCACCGATCTCACCGTCTCCAACGTCCAAGTCAATGCCAGTGGCCCTTTCGTCATTCTCGGCAACTTGAAGAAGCTCAGGTCCGTCACC
>augustus_masked-Fvb3-4-processed-gene-254.4:1249:1369:Parent=augustus_masked-Fvb3-4-processed-gene-254.4-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-254.4:1249-1369||RAPiDGENOMICS_rs1205_01994
TGGCTGCATTGATGTCAGTGAAGAAGGAGATGAAGGATGAGTTGCTTGTAATGGGTGGGTGGGATATCAACTCGGTTGATCCATGCACTTGGAACATGGTGGCTTGCTCTGCTGAGGGAT
>augustus_masked-Fvb3-4-processed-gene-254.4:1454:1574:Parent=augustus_masked-Fvb3-4-processed-gene-254.4-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-254.4:1454-1574||RAPiDGENOMICS_rs1205_01995
GTTGCTACAAAACAATCAGTTATCTGGTCCCATCCCATCTGAGATAGGGAGGCTTTCGCAGCTTGAAACTCTGGACCTTTCGGGTAACCAGTTTTCTGGAAACATTCCGAGTTCTTTGGG
>augustus_masked-Fvb3-4-processed-gene-254.4:1658:1778:Parent=augustus_masked-Fvb3-4-processed-gene-254.4-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-254.4:1658-1778||RAPiDGENOMICS_rs1205_01996
TGTCACAGGGAACAGCTTTCTTTGCAATCCTTCGTCAACAGACTCAACACGAATCTGCATGGATGTGTCAAAACCAGTAAATGGTAACATGACTCGACCTCTCAATCAAAAGTGCATTGT
>augustus_masked-Fvb3-4-processed-gene-254.4:1778:1898:Parent=augustus_masked-Fvb3-4-processed-gene-254.4-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-254.4:1778-1898||RAPiDGENOMICS_rs1205_01997
GCCTTGCATTAGATATACTAATACTCAGGGGCATTTTCTCACAGATACAGGTTCACCACTAGAAGTCAGTGGTCACCATCGATGGGTACTTTCTGTTGCTCTTGGCATTAGTTGTACATT
>augustus_masked-Fvb3-4-processed-gene-254.4:2428:2548:Parent=augustus_masked-Fvb3-4-processed-gene-254.4-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-254.4:2428-2548||RAPiDGENOMICS_rs1205_01998
TGAAAGCTGCAAACATTTTGCTTGACCAAAATTTTGAAGCTGTCGTTGGTGATTTTGGGCTTGCTAAATTGTTAGATCAGAGGGAATCACATGTCACTACTGCAGTGCGGGGCACTGTAG
>augustus_masked-Fvb3-4-processed-gene-254.4:2700:2820:Parent=augustus_masked-Fvb3-4-processed-gene-254.4-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-254.4:2700-2820||RAPiDGENOMICS_rs1205_01999
GTTCGAACCTTACATGAGGAGAAGAGACTGGAAGTGCTAGTGGACAGGGATCTAAAAGGATGTTTTGATGTAACCGAGCTTGAAACATGCGCGGAGTTGGCTCTGCAATGCACTCAGTCA
>augustus_masked-Fvb3-4-processed-gene-254.4:2820:2940:Parent=augustus_masked-Fvb3-4-processed-gene-254.4-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-254.4:2820-2940||RAPiDGENOMICS_rs1205_02000
AGCCCCAACCTCCGGCCCAAGATGTCAGATGTCTTAAAGATCTTGGAAGGTCTTGTTGAGCAATCAGTACAGTCAGAAGATCCACAAGGTGGCACCAACCCATCTGACATCAGGACTTGC
>augustus_masked-Fvb3-4-processed-gene-254.4:669:789:Parent=augustus_masked-Fvb3-4-processed-gene-254.4-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-254.4:669-789||RAPiDGENOMICS_rs1205_02001
ATGAAAGGCGAAGCAAACATAGCATACATATGTTCACGTTTCTATCGGGCTCCTGAACTAATTTTTGGTGCAACGGATTATACAACTTCAATTGATATCTGGTCAGCTGGCTGTGTCTTA
>augustus_masked-Fvb3-4-processed-gene-257.12:1080:1200:Parent=augustus_masked-Fvb3-4-processed-gene-257.12-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-257.12:1080-1200||RAPiDGENOMICS_rs1205_02002
TGCTTACCGGACAGGCCTAAACAGAAGTCATCGAAAGAATGCCAAGCTGTGGTGAGCAAGCCAGTGGATTGCAGCAAGGCCAAGTGTGGAGGTGGCGGAGTGCCCTCAAAGCCGCCAGCA
>augustus_masked-Fvb3-4-processed-gene-257.12:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-257.12-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-257.12:360-480||RAPiDGENOMICS_rs1205_02003
AATGGGGCTGACATTGCAGGATACCTTCCTGCCGAGTTAGGCCTGTTGCAGGAGCTTGCCGTGTTCCACATCAACTCCAACAGGTTCTGTGGTATTGTGCCCCCAAGCTTTTGCAGGATG
>augustus_masked-Fvb3-4-processed-gene-257.12:720:840:Parent=augustus_masked-Fvb3-4-processed-gene-257.12-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-257.12:720-840||RAPiDGENOMICS_rs1205_02004
AACAACTTCGAGGGTTGCATTCCTAGCAGCATTGGGAAAATGAGGAACTTGAACGAGCTCCTCTTCTCTAACAACAAGCTAGGCGGGTGTGTGCCTCCCGAGCTCTTCCAGATCTCCAAC
>augustus_masked-Fvb3-4-processed-gene-257.12:780:900:Parent=augustus_masked-Fvb3-4-processed-gene-257.12-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-257.12:780-900|2x||RAPiDGENOMICS_rs1205_02005
CTCTTCTCTAACAACAAGCTAGGCGGGTGTGTGCCTCCCGAGCTCTTCCAGATCTCCAACATCACTGTGTTGGACATCAGTTCCAACTCGTTCAGCGGCATCATGTCAAAATCGTTCAAG
>augustus_masked-Fvb3-4-processed-gene-27.10:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-27.10:0-120||RAPiDGENOMICS_rs1205_02006
ATGGCTGATATATCCCGAAGCCCAGATTTGCAAACAATTCAAGGCACATTGGTAAATCAGCTGGGAATAGAAATGGGGGAGGATGAAGAAAAAGAAAGAGCAAGTAGTCTGAGGGAGAGG
>augustus_masked-Fvb3-4-processed-gene-27.10:1080:1200:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-27.10:1080-1200||RAPiDGENOMICS_rs1205_02007
GTCTTTGATCTTAGCTATACTGGTATTTCAGTACTACCCTCTACATTCAGTCTTCTCACCAACCTCCAAGCCTTGTATTTGGATTGCTGTAGTAAAATAACTGATGTATCCGTACTCGGG
>augustus_masked-Fvb3-4-processed-gene-27.10:1140:1260:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-27.10:1140-1260|2x||RAPiDGENOMICS_rs1205_02008
AACCTCCAAGCCTTGTATTTGGATTGCTGTAGTAAAATAACTGATGTATCCGTACTCGGGAGGCTGAAGAAAATTGAGATTCTTAGTTTGAGAAAATTTCCTCATAAGGTGTTGCCCAAA
>augustus_masked-Fvb3-4-processed-gene-27.10:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-27.10:120-240||RAPiDGENOMICS_rs1205_02009
ATCATGGGTGGACAGAGGATCCTGATTATCTTGGATGACGTTTGGGAGATAATTGATTTGTCGAGCATTGGAATTCCTAGCTATGACGAGCTTCAAAGATGCAATTCCAAGGTCCTGCTC
>augustus_masked-Fvb3-4-processed-gene-27.10:1200:1320:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-27.10:1200-1320||RAPiDGENOMICS_rs1205_02010
AGGCTGAAGAAAATTGAGATTCTTAGTTTGAGAAAATTTCCTCATAAGGTGTTGCCCAAAGAGATAGGAAATCTGACCAGTCTAAGGATGCTGGACGTCACTGGTGGATATGTTCACAAA
>augustus_masked-Fvb3-4-processed-gene-27.10:1320:1440:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_12::augustus_masked-Fvb3-4-processed-gene-27.10:1320-1440||RAPiDGENOMICS_rs1205_02011
ATTCCATCGAAAGTGATATCTAGGCTGCATAGACTGGAAGAATTGTACCTGAAATGTGAATTTGGGGACTGGGGAAGTGAAGTCGAAGAAGGACTAGGAGAAACAAATGCGGACTTTGAT
>augustus_masked-Fvb3-4-processed-gene-27.10:1440:1560:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_13::augustus_masked-Fvb3-4-processed-gene-27.10:1440-1560||RAPiDGENOMICS_rs1205_02012
GAGATAATTGGCTTGTTCCGTTTAAATGTTTTGAAGGTTTACATAACTGATGTAGCTTGCTTACCCACAAAAATTGGGTACTTTGAGCCGACTTGGATGAAATTTGACATATGCATCACC
>augustus_masked-Fvb3-4-processed-gene-27.10:1560:1680:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_14::augustus_masked-Fvb3-4-processed-gene-27.10:1560-1680||RAPiDGENOMICS_rs1205_02013
AGATACCTGTCTTCAGAGATAATTCTTGCTCCGAATGATAAAGCTTCAAGAACCTTGACTCTTGACAGAACAATCAATGGCTTACCGGATTGGTTTATCAATGTGGTGACAGAGAAAGCA
>augustus_masked-Fvb3-4-processed-gene-27.10:1680:1800:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-27.10:1680-1800||RAPiDGENOMICS_rs1205_02014
GAAAAACTGGTGTACAGAGATTGTAAGGGAGTAAACAACATTGTTAAGGAATATGACCACGGGAGATTACATGGGCTGAAACATCTCTCTCTCATTGGGTGCCTTGAGAACTTGGAAGAG
>augustus_masked-Fvb3-4-processed-gene-27.10:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-27.10:180-300|2x||RAPiDGENOMICS_rs1205_02015
TCGAGCATTGGAATTCCTAGCTATGACGAGCTTCAAAGATGCAATTCCAAGGTCCTGCTCACTACAAGGATCAGGAATATTTGTCATTCTTTGGGGTGCCAAGCTCATATTCCCCTCAAT
>augustus_masked-Fvb3-4-processed-gene-27.10:1800:1920:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_16::augustus_masked-Fvb3-4-processed-gene-27.10:1800-1920||RAPiDGENOMICS_rs1205_02016
TTGATAAATGCAACAACTTGGGATCCAAGTAAAGCTGTGTTTGAGAGCTTGGAAGTGTTGCATCTCCAGCATTTGCAACACCTCAAGGAGTTATGTGTATGCGAATTACCACTGGGGTCT
>augustus_masked-Fvb3-4-processed-gene-27.10:1920:2040:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_17::augustus_masked-Fvb3-4-processed-gene-27.10:1920-2040||RAPiDGENOMICS_rs1205_02017
CTTTGCAATCTCAAGTTGTTGAAAGTACAAACTTGCTGCAACTTGGTGAATGCACTTTTACCACCAAAATTGTTGCAGAGACTAACAAATCTGGAAACAATATTTTGTGTAAATATGGAA
>augustus_masked-Fvb3-4-processed-gene-27.10:2040:2160:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_18::augustus_masked-Fvb3-4-processed-gene-27.10:2040-2160||RAPiDGENOMICS_rs1205_02018
CACATGAAACATGTGTTTGGATCTGAAGGGCTTGATCTCGGAACGATTCTTTTGACAAAATTGAGGGAGATGAGATTGTGTGCTCTGTTCGAACTCATAAGCATCTGGAGTGGTCCGGCT
>augustus_masked-Fvb3-4-processed-gene-27.10:2160:2280:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_19::augustus_masked-Fvb3-4-processed-gene-27.10:2160-2280||RAPiDGENOMICS_rs1205_02019
CCATGTGCAGTCTTTGGGAATCTTAAAGTTTTGGCAGTCTGCAAGTGTACAAAACTGAACAGTCTATTCCCATCTGATGTAGCTCAGTCTCTTGTGCAATTGGAAGACCTCTCTATAGAG
>augustus_masked-Fvb3-4-processed-gene-27.10:2280:2400:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_20::augustus_masked-Fvb3-4-processed-gene-27.10:2280-2400||RAPiDGENOMICS_rs1205_02020
CGCTGCCCTAACTTGGGTAAAGTTATTGAAGCAGGCAACAGCTTGAACGAATATATCTTTTTTCCAGAATTGAAGAAATTAGCTTTGATAAATCTTCCAGAGCTAACATGGTTCTGCACT
>augustus_masked-Fvb3-4-processed-gene-27.10:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-27.10:240-360||RAPiDGENOMICS_rs1205_02021
ACTACAAGGATCAGGAATATTTGTCATTCTTTGGGGTGCCAAGCTCATATTCCCCTCAATGTCCTATCAGAAGAAGATTCTTTGAAGTTATTCATGAAGATTTTGAGAAAGCCGTTTCAT
>augustus_masked-Fvb3-4-processed-gene-27.10:2400:2520:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_21::augustus_masked-Fvb3-4-processed-gene-27.10:2400-2520||RAPiDGENOMICS_rs1205_02022
GAAAATGGTTGTATTGGTATTGAGTGCCCTCTATTGGAATACTTGTATGTGGATAACTGCCCCCAGTTTCTAAACTCTGCTTCTGCTTCTGTTAAACTCAATGATCAACAACATTTGAAT
>augustus_masked-Fvb3-4-processed-gene-27.10:300:420:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-27.10:300-420|2x||RAPiDGENOMICS_rs1205_02023
GTCCTATCAGAAGAAGATTCTTTGAAGTTATTCATGAAGATTTTGAGAAAGCCGTTTCATGAATCTACCGATTCCTATGATGAAGAGAGAAACATAGTCAGAGAATGCGCTGGTCTCCCC
>augustus_masked-Fvb3-4-processed-gene-27.10:420:540:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-27.10:420-540|2x||RAPiDGENOMICS_rs1205_02024
AATGTATTGGAACAAGCTGCAAGAGCACTTGGGCATAAATACGTGGAAGAATGGAATGAAGCAGTTTCAAAGGCATTTGGAGATAACGATGATGAATTGCAAATCGCAGCGCGAGAACTA
>augustus_masked-Fvb3-4-processed-gene-27.10:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-27.10:480-600||RAPiDGENOMICS_rs1205_02025
GCAGTTTCAAAGGCATTTGGAGATAACGATGATGAATTGCAAATCGCAGCGCGAGAACTAAATGCATCTCAACTTGTCCACAGAGATACATTTAAAAGAATAAAGTTAAGCTATCATACC
>augustus_masked-Fvb3-4-processed-gene-27.10:540:660:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-27.10:540-660|2x||RAPiDGENOMICS_rs1205_02026
AATGCATCTCAACTTGTCCACAGAGATACATTTAAAAGAATAAAGTTAAGCTATCATACCTTGAGGTTTGATGATGCTAAGTCATTGTTCTTGCTTTGCTGCATGTTTCCAGAAGATTAT
>augustus_masked-Fvb3-4-processed-gene-27.10:60:180:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-27.10:60-180|2x||RAPiDGENOMICS_rs1205_02027
CTGGGAATAGAAATGGGGGAGGATGAAGAAAAAGAAAGAGCAAGTAGTCTGAGGGAGAGGATCATGGGTGGACAGAGGATCCTGATTATCTTGGATGACGTTTGGGAGATAATTGATTTG
>augustus_masked-Fvb3-4-processed-gene-27.10:600:720:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-27.10:600-720||RAPiDGENOMICS_rs1205_02028
TTGAGGTTTGATGATGCTAAGTCATTGTTCTTGCTTTGCTGCATGTTTCCAGAAGATTATGATATCCCAATTGAAGAATTGTTAAAGTACGGGATTGGAAAAGGTCTGTTTCAGTATTCT
>augustus_masked-Fvb3-4-processed-gene-27.10:660:780:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-27.10:660-780|2x||RAPiDGENOMICS_rs1205_02029
GATATCCCAATTGAAGAATTGTTAAAGTACGGGATTGGAAAAGGTCTGTTTCAGTATTCTGATACATTGCAAGAAGCTAGAGACAGAGCAAATTCTATGGTTGCATACCTTAAAGCTTCG
>augustus_masked-Fvb3-4-processed-gene-27.10:720:840:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-27.10:720-840||RAPiDGENOMICS_rs1205_02030
GATACATTGCAAGAAGCTAGAGACAGAGCAAATTCTATGGTTGCATACCTTAAAGCTTCGGGGTTGCTTTTGGATGGCAAGAAGGGATGCATAAGGATGCATTGTGACATCCGAAATGTG
>augustus_masked-Fvb3-4-processed-gene-27.10:900:1020:Parent=augustus_masked-Fvb3-4-processed-gene-27.10-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-27.10:900-1020|2x||RAPiDGENOMICS_rs1205_02031
CTGAAGGATTGGCCAATGGATGCTCATGAAGGCTACTCAGCAATCTCACTAATGAGAAACAAACTTAACAAGCTTCCGGAAACTTTGGTATGTTCCGAACTCCAACTTTTACTGCTGCAA
>augustus_masked-Fvb3-4-processed-gene-34.1:1200:1320:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-34.1:1200-1320||RAPiDGENOMICS_rs1205_02032
CCTAATTTGGAGGCTTGGATTGAACCTGTCGTGGGGCGAAATTTGTTCAAGAGGGCGAAGCACAAGAAGTCGAAAAGTGGGAATTGCAAGAGCTTGGGGAGCAGTGTGATATGCATAAAT
>augustus_masked-Fvb3-4-processed-gene-34.1:1260:1380:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-34.1:1260-1380|2x||RAPiDGENOMICS_rs1205_02033
CACAAGAAGTCGAAAAGTGGGAATTGCAAGAGCTTGGGGAGCAGTGTGATATGCATAAATGGGGTTCCTGGCATTGGGAAGACTGAGCTTGCATTGGAGTTTGCTTACAGGTATTCGCAA
>augustus_masked-Fvb3-4-processed-gene-34.1:1320:1440:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_12::augustus_masked-Fvb3-4-processed-gene-34.1:1320-1440||RAPiDGENOMICS_rs1205_02034
GGGGTTCCTGGCATTGGGAAGACTGAGCTTGCATTGGAGTTTGCTTACAGGTATTCGCAACGGTACAGGATGGTGTTGTGGATCGGGGGTGAAGCTAGGTATTTTAGGCAGAACATATTG
>augustus_masked-Fvb3-4-processed-gene-34.1:1380:1500:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_12::augustus_masked-Fvb3-4-processed-gene-34.1:1380-1500|2x||RAPiDGENOMICS_rs1205_02035
CGGTACAGGATGGTGTTGTGGATCGGGGGTGAAGCTAGGTATTTTAGGCAGAACATATTGAATCTGTCTCAGAATTTGGGGTTGGATGTGAGTGCTGATCCGGAGAAGGATCGGGGGAGA
>augustus_masked-Fvb3-4-processed-gene-34.1:1440:1560:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_13::augustus_masked-Fvb3-4-processed-gene-34.1:1440-1560||RAPiDGENOMICS_rs1205_02036
AATCTGTCTCAGAATTTGGGGTTGGATGTGAGTGCTGATCCGGAGAAGGATCGGGGGAGAATCCGGAACTTTGAGGAGCAAGAGTTTGAGGCATTCAAGAGGGTGAAGAGGGAGTTGTTT
>augustus_masked-Fvb3-4-processed-gene-34.1:1560:1680:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_14::augustus_masked-Fvb3-4-processed-gene-34.1:1560-1680||RAPiDGENOMICS_rs1205_02037
AGGGACATGCCTTATTTGATTGTGATTGATAATCTTGAGACTGAGAGGGAGTGGTGGGAAGGGAAGGATTTACATGACTTGATCCCAAGGAACACAGGAGGGTCTCATGTCATCATCACT
>augustus_masked-Fvb3-4-processed-gene-34.1:1800:1920:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_16::augustus_masked-Fvb3-4-processed-gene-34.1:1800-1920||RAPiDGENOMICS_rs1205_02038
TATCTAATGAAGTTTGATGAGAAATTGGGGAGGCTGAGCTTTGGTTTGTGGCTGGTTGGGTCACTGCTTTCGGAACTAGCCATTGCTCCTTCTGCTCTATTTGAAGCTATCAACCAAATT
>augustus_masked-Fvb3-4-processed-gene-34.1:1920:2040:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_17::augustus_masked-Fvb3-4-processed-gene-34.1:1920-2040||RAPiDGENOMICS_rs1205_02039
CAACTTGATGATGGATCACCTTGTCCTTACTTGAGCATCACTGAAGAGCAGTACTGCAAAAACAATCGTTTCCTGATGAAAGTCTTGTCTTTTTGCTTCGCCGTGTTACAAGAATCGATG
>augustus_masked-Fvb3-4-processed-gene-34.1:2280:2400:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_20::augustus_masked-Fvb3-4-processed-gene-34.1:2280-2400||RAPiDGENOMICS_rs1205_02040
AAGAAGCCATTCGGAAATTGGATTCAGTTTCATCCCATAACTCAGGTGTATACAAAGCGGAAAGAAGGTTTAGTAGCTGCCAAGGCAACAGTTCAGGGCATAAGGAAAATTGGCAATCCA
>augustus_masked-Fvb3-4-processed-gene-34.1:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-34.1:240-360||RAPiDGENOMICS_rs1205_02041
AGCCCAAAACCCCAAGAAAGCCCAACTCACCAACAACAACCAATCTCCTACACTCACTCTGATGACATCCCAAGCAGTTCATACACACCCCCATCAGACCAGTATGAGTACTCAGACAAT
>augustus_masked-Fvb3-4-processed-gene-34.1:2520:2640:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_22::augustus_masked-Fvb3-4-processed-gene-34.1:2520-2640||RAPiDGENOMICS_rs1205_02042
CCACTCGCAATCAGGGCCTTCACAACCTTCTCCAGATGCAACTCGGCATTGGAACTCTTAAAGGTGTGCACAAACGTACTCGAGGAAGTGGAGAAGTCTTTCGTCTCCCAAATACAAGAT
>augustus_masked-Fvb3-4-processed-gene-34.1:2760:2880:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_24::augustus_masked-Fvb3-4-processed-gene-34.1:2760-2880||RAPiDGENOMICS_rs1205_02043
CTTCTTCGGGGCGGTCATTTCGACAGCGGGGAGGAGTTGTGCAGAACTTGCATTAGTATCAGAACAGTGATGCTGGGTCACAACCACACTCAAACCTTGGCAGCTCAAGAGACCTTGGCA
>augustus_masked-Fvb3-4-processed-gene-34.1:600:720:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-34.1:600-720||RAPiDGENOMICS_rs1205_02044
AGGGCTAAGTACTCGGACACTCAGAGCCAGGAGATTGCAGACAGAGTCATCTGCTCTGTTACTTATGGAGTTGTGGTTGTTACTAGTTCGAGTTTTCTTAACCACTTGAGCTTGGAGGAA
>augustus_masked-Fvb3-4-processed-gene-34.1:840:960:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-34.1:840-960||RAPiDGENOMICS_rs1205_02045
GGGTTGATGAGGTGTAGTGAGTTTAAGCTGGAGGCTAATGAGTGTAACTGGAGGAGCATTGTGTCCAAAGCGGCTGGGGTTTTGAGGGCAAAGCTTGGGAGGAAGAGTGTGTCTTTGAGT
>augustus_masked-Fvb3-4-processed-gene-34.1:960:1080:Parent=augustus_masked-Fvb3-4-processed-gene-34.1-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-34.1:960-1080||RAPiDGENOMICS_rs1205_02046
GAGATTGAGGCTGTTGATGAGCTGCCTTTTCCGAGGAACAGGTTTTTCGTGGGGAGAGAGAAGGAGATGATGGAAATCGAAACGGCTTTGTTTGGTTCTTGTGGGGATTATTTGGAGCAG
>augustus_masked-Fvb3-4-processed-gene-43.12:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-43.12-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-43.12:480-600||RAPiDGENOMICS_rs1205_02047
AATAATTTCAATGGTAGTATTTCTGATGGGTTAGGCAAATGTTTGAAACTTCGTATTTTTCGTGCTGGTCGCAATAACCTCTCAGGAATACTTCCAACTGATTTTTCTAATGCTACCAAG
>augustus_masked-Fvb3-4-processed-gene-43.12:720:840:Parent=augustus_masked-Fvb3-4-processed-gene-43.12-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-43.12:720-840||RAPiDGENOMICS_rs1205_02048
ATTAGTATTGGTAAGCTTTCCAAATTGAAAGTCTTGCGCCTTCAGTTCAACTATCTAACAGGATCTTTGCCCTTATCTTTGATGAATTGCACCAACCTGATAGAATTGAATCTTGGATAC
>augustus_masked-Fvb3-4-processed-gene-43.12:780:900:Parent=augustus_masked-Fvb3-4-processed-gene-43.12-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-43.12:780-900|2x||RAPiDGENOMICS_rs1205_02049
GGATCTTTGCCCTTATCTTTGATGAATTGCACCAACCTGATAGAATTGAATCTTGGATACAACAATTTGGACGGCAACTTTTCAGTGCTTGACTTCTCCAAACTTAGTCAGCTTACTAAA
>augustus_masked-Fvb3-4-processed-gene-43.3:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-43.3-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-43.3:0-120||RAPiDGENOMICS_rs1205_02050
ATGTTGATATCGAAAGGAACTGCAGCTCAAGTAGAGGATGATGATCTTGAATTACCTATTTACTCAGTCAAAGGTGCAGTGGTTTTACAATACAAATTGTCTTACTTTCCTGTAGCGATA
>augustus_masked-Fvb3-4-processed-gene-43.3:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-43.3-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-43.3:120-240||RAPiDGENOMICS_rs1205_02051
AGCATGGGCAATAACACCATTAGTGGGAGCATACCTGTTGAGATTGGTCAATTGAAGCTTCTCCAATACCTGGGGCTTAGCAACAATAACTTGTCAGGCAACATTCCAGATCAAATATCG
>augustus_masked-Fvb3-4-processed-gene-43.3:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-43.3-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-43.3:180-300|2x||RAPiDGENOMICS_rs1205_02052
CTCCAATACCTGGGGCTTAGCAACAATAACTTGTCAGGCAACATTCCAGATCAAATATCGAACTTGAAGAACTTGGAGCAGTTGAATCTCTCTCGGAATCATTTGTCCGGAAAAATCCCA
>augustus_masked-Fvb3-4-processed-gene-43.3:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-43.3-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-43.3:240-360||RAPiDGENOMICS_rs1205_02053
AACTTGAAGAACTTGGAGCAGTTGAATCTCTCTCGGAATCATTTGTCCGGAAAAATCCCATTATCATTTACAAGTCTTACTTTCTTGAAATATTTTAATGTGTCATACAATAATCTGGAA
>augustus_masked-Fvb3-4-processed-gene-43.3:300:420:Parent=augustus_masked-Fvb3-4-processed-gene-43.3-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-43.3:300-420|2x||RAPiDGENOMICS_rs1205_02054
TTATCATTTACAAGTCTTACTTTCTTGAAATATTTTAATGTGTCATACAATAATCTGGAAGGTTCAATACCAGCAAACACGCAGCTCCAAAGCTTCAATGCTTCTGCATTTGAGGGAAAT
>augustus_masked-Fvb3-4-processed-gene-43.3:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-43.3-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-43.3:360-480||RAPiDGENOMICS_rs1205_02055
GGTTCAATACCAGCAAACACGCAGCTCCAAAGCTTCAATGCTTCTGCATTTGAGGGAAATGCAAATCTTTGTGGTGTTCCACTTCCAAATAAGTGCCTGCCGGATGAAGACAAGGATGCT
>augustus_masked-Fvb3-4-processed-gene-43.3:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-43.3-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-43.3:480-600||RAPiDGENOMICS_rs1205_02056
AATAGCAGGAACAGCCGAGATGATGAGGGGAATGATGACGACGGTGAAGTTCCATGGCTTCATATTTTCGTTGCTCTTGGGTTCATTGTTGGATTTTGGGGAGTTTGTGGCCCTCTGGTG
>augustus_masked-Fvb3-4-processed-gene-49.4:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-49.4:0-120||RAPiDGENOMICS_rs1205_02057
ATGGTTCGAGGCTTAAGCTTTCTTCTCATTTTGATGTCATTGTTTACGCATAATATTCATGCTTGCATCCAAACACAACGTACTTCTCTCTTGTCCTTTGCCCTCGCTCTATCTTCTCCT
>augustus_masked-Fvb3-4-processed-gene-49.4:1080:1200:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-49.4:1080-1200||RAPiDGENOMICS_rs1205_02058
AAAGCAATTCGAGTGAACTATAATAATCTAGAGGTTCAAATACAGCCTGAAATCCTTTCATTGAAATCCCTGTCCTTCCTCTCACTCGGTATGAACAAACGTTTGACGAATGTCAAAGAG
>augustus_masked-Fvb3-4-processed-gene-49.4:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-49.4:120-240||RAPiDGENOMICS_rs1205_02059
TCCTTAAACTGGACTTCTGGTAATTGTTGCTATTGGGAAGGCATTACTTGTAATCGAGATGGTTGGGTCACTCATTTGCAGTTACCTTCCAAAGGGCTCAAACTCAAAGAAGGTATTTTC
>augustus_masked-Fvb3-4-processed-gene-49.4:1200:1320:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-49.4:1200-1320||RAPiDGENOMICS_rs1205_02060
GCGATGAAGATACTGATGGGTTGCAAACGCCTTGTAGTCCTATCATTAGCATCTAGTTTTGCAGGTGAGGAATTTCCGACTGATCTTGGGAAAGCTGGTTTTGATGGATTCCAAAATCTT
>augustus_masked-Fvb3-4-processed-gene-49.4:1320:1440:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_12::augustus_masked-Fvb3-4-processed-gene-49.4:1320-1440||RAPiDGENOMICS_rs1205_02061
CGAGTTTTGGATTTGAGTTCCTGTAACCTTACTGGTCAACTCCCTTTATGGCTATCAAAGCTAAGAAAGCTAGAGTTCTTGGATCTGAGTCATAATAGAATCACAGGCTCAATCCCAAGT
>augustus_masked-Fvb3-4-processed-gene-49.4:1560:1680:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_14::augustus_masked-Fvb3-4-processed-gene-49.4:1560-1680||RAPiDGENOMICS_rs1205_02062
GTAGATCTTACTGCTATTGATCTGCCTATCTTCTACCCCAGTGATGATCATTCAAGACCTTTACAGTACAATTACTTGTATTACGAAGCATCTATATCACTAAAGAGCAATAACCTACAT
>augustus_masked-Fvb3-4-processed-gene-49.4:1620:1740:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_14::augustus_masked-Fvb3-4-processed-gene-49.4:1620-1740|2x||RAPiDGENOMICS_rs1205_02063
TTACAGTACAATTACTTGTATTACGAAGCATCTATATCACTAAAGAGCAATAACCTACATGGGAACATACCTTCTGAGATTGGCCAATCGCAGCTTCTAACAACTTTGTATCTTAGCAAC
>augustus_masked-Fvb3-4-processed-gene-49.4:1680:1800:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-49.4:1680-1800||RAPiDGENOMICS_rs1205_02064
GGGAACATACCTTCTGAGATTGGCCAATCGCAGCTTCTAACAACTTTGTATCTTAGCAACAACAACATCTCCGGTAATATTCCAGAACAGATAGCTAACCTCAAGGGCATGCAGATTTTG
>augustus_masked-Fvb3-4-processed-gene-49.4:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-49.4:180-300|2x||RAPiDGENOMICS_rs1205_02065
GGTTGGGTCACTCATTTGCAGTTACCTTCCAAAGGGCTCAAACTCAAAGAAGGTATTTTCCCCTCATCCTCACTTGCAAATCTCACACATCTCACTCACTTGAATCTCTCACACAATTCC
>augustus_masked-Fvb3-4-processed-gene-49.4:2040:2160:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_18::augustus_masked-Fvb3-4-processed-gene-49.4:2040-2160||RAPiDGENOMICS_rs1205_02066
GACATGGAGCAGCAATTTCCATGGTTCTATGTTTCCGCTACACTTGGGTTCATTATAGGATTTTGGGGAGTCTTTGGTCCTATAGTATTTCTGCAGAAATGGAGGTATGCATATTACCAT
>augustus_masked-Fvb3-4-processed-gene-49.4:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-49.4:240-360||RAPiDGENOMICS_rs1205_02067
CCCTCATCCTCACTTGCAAATCTCACACATCTCACTCACTTGAATCTCTCACACAATTCCCTTTCTGGTTCTCTAGATCAAAGTGAAATCTTCTTGTCCTTGAATCATCTCGAAATCCTA
>augustus_masked-Fvb3-4-processed-gene-49.4:300:420:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-49.4:300-420|2x||RAPiDGENOMICS_rs1205_02068
CTTTCTGGTTCTCTAGATCAAAGTGAAATCTTCTTGTCCTTGAATCATCTCGAAATCCTAGATTTGAGCTTTAACCTTCTCTTTGGAGTGTTACCATCTTTTCTACCATCCAGTCATATT
>augustus_masked-Fvb3-4-processed-gene-49.4:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-49.4:360-480||RAPiDGENOMICS_rs1205_02069
GATTTGAGCTTTAACCTTCTCTTTGGAGTGTTACCATCTTTTCTACCATCCAGTCATATTCAGTTGGTGGATTTTTCCAGCAATCGCTTACATGGTGCTATTCCATCTTCTTTTTTCCAA
>augustus_masked-Fvb3-4-processed-gene-49.4:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-49.4:480-600||RAPiDGENOMICS_rs1205_02070
CAAGCTTGGAATTTGACTAGTTTCAATGTCAGTAACAACACCTTTTCTGGTCCTATCCCATCCTCTATTTGTCGACATTCTTCTTCCTTGTTACGACACCTTGATTTTTCCTTGAATAAT
>augustus_masked-Fvb3-4-processed-gene-49.4:60:180:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-49.4:60-180|2x||RAPiDGENOMICS_rs1205_02071
GCTTGCATCCAAACACAACGTACTTCTCTCTTGTCCTTTGCCCTCGCTCTATCTTCTCCTTCCTTAAACTGGACTTCTGGTAATTGTTGCTATTGGGAAGGCATTACTTGTAATCGAGAT
>augustus_masked-Fvb3-4-processed-gene-49.4:600:720:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-49.4:600-720||RAPiDGENOMICS_rs1205_02072
TTCAATGGTAGTATATCTCGTGGATTTGGGAAGTGTTCCAAGTTGCAGGTTTTTCGTGCTGGCAACAATTACCTGTCCGGATCGCTTCCAGAAGATATCTATAACGCTACCACAGTTGAA
>augustus_masked-Fvb3-4-processed-gene-49.4:660:780:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-49.4:660-780|2x||RAPiDGENOMICS_rs1205_02073
GGCAACAATTACCTGTCCGGATCGCTTCCAGAAGATATCTATAACGCTACCACAGTTGAAGAGATCTCACTACCTCTAAATTCATTGAATGGAGTAATGAGCGATGGAATTGCCAACCTC
>augustus_masked-Fvb3-4-processed-gene-49.4:720:840:Parent=augustus_masked-Fvb3-4-processed-gene-49.4-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-49.4:720-840||RAPiDGENOMICS_rs1205_02074
GAGATCTCACTACCTCTAAATTCATTGAATGGAGTAATGAGCGATGGAATTGCCAACCTCATCAACCTCACAACTCTTGATCTCTCCTATAACCAATTGAGTAGTGTGCTCCCTCTCCAT
>augustus_masked-Fvb3-4-processed-gene-6.11:1020:1140:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-6.11:1020-1140|2x||RAPiDGENOMICS_rs1205_02075
CTTCTTAACCTCAACGCCAATTCTTTTCGGGAATCCATTCCTGAATCTATTTTCAGCGACTTATCATCATCCCTCAAGACACTGGACTTGGGTGGTAATCTTTTCAATGGTTCCATTCCT
>augustus_masked-Fvb3-4-processed-gene-6.11:1080:1200:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-6.11:1080-1200||RAPiDGENOMICS_rs1205_02076
TTATCATCATCCCTCAAGACACTGGACTTGGGTGGTAATCTTTTCAATGGTTCCATTCCTGAAAGTTTGGGACAACTCAGTCAGCTCGTTAGGCTTGATTTGTCTTATAATTCATGGGAA
>augustus_masked-Fvb3-4-processed-gene-6.11:1140:1260:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-6.11:1140-1260|2x||RAPiDGENOMICS_rs1205_02077
GAAAGTTTGGGACAACTCAGTCAGCTCGTTAGGCTTGATTTGTCTTATAATTCATGGGAAGGCAGTTTAAGGGAAGCCCATTTCATAAATCTCACGAGATTAAAGTATATACGTTTGACC
>augustus_masked-Fvb3-4-processed-gene-6.11:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-6.11:120-240||RAPiDGENOMICS_rs1205_02078
CACACAGGTCGTATTGTCAGGCTAGATCTTCGTAATCCATATCCATTTAATGATTACAGCTGGAACAACACCAAATTTGATGAATCTTGTTTAGGGGGTAAGTTACATCCTTCTCTACTT
>augustus_masked-Fvb3-4-processed-gene-6.11:1200:1320:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-6.11:1200-1320||RAPiDGENOMICS_rs1205_02079
GGCAGTTTAAGGGAAGCCCATTTCATAAATCTCACGAGATTAAAGTATATACGTTTGACCACAGACCGACATGTGCCTATCATTTTCAACTTGACTGATTATGAATGGATTCCTCCTTTC
>augustus_masked-Fvb3-4-processed-gene-6.11:1440:1560:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_13::augustus_masked-Fvb3-4-processed-gene-6.11:1440-1560||RAPiDGENOMICS_rs1205_02080
CCAGAGGAATGGATGTCTAATATCTCTTCCCAAATCGAAAGTTTGGATTTATCCAACAATCAAATAAGCGGAAAGCTTCCCCTCCAATTCAACTTTCCAGATCTGCGCGGGATAGAATTT
>augustus_masked-Fvb3-4-processed-gene-6.11:1560:1680:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_14::augustus_masked-Fvb3-4-processed-gene-6.11:1560-1680||RAPiDGENOMICS_rs1205_02081
GGCCACAATCAATTTGATGGAACTATTCCATCATCTATTTGCAGCATTCAATATCTGGACACCCTTGCTCTGAATAACAATCAGTTATTCGGAGAATTCCCTAAGGAATGGAGTTTGTGG
>augustus_masked-Fvb3-4-processed-gene-6.11:1680:1800:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-6.11:1680-1800||RAPiDGENOMICS_rs1205_02082
AGCCGCATAGGCTTTGTGGATGTCTCAAACAACAATCTGACTGGTGAAATTCCCAGATCGATGGGCATTCCAAGTTCTCTTTTTGTATTAAAGATGGACAACAATCAGTTAAGCGGAGAA
>augustus_masked-Fvb3-4-processed-gene-6.11:1740:1860:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-6.11:1740-1860|2x||RAPiDGENOMICS_rs1205_02083
ATGGGCATTCCAAGTTCTCTTTTTGTATTAAAGATGGACAACAATCAGTTAAGCGGAGAAATTCCTTCTGCCTTCCAAAATTGCTCATTTTTGCAGAAACTTTCTCTTGGAGGCAACAAT
>augustus_masked-Fvb3-4-processed-gene-6.11:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-6.11:180-300|2x||RAPiDGENOMICS_rs1205_02084
TGGAACAACACCAAATTTGATGAATCTTGTTTAGGGGGTAAGTTACATCCTTCTCTACTTGGCTTGAAACATTTGAGTTACTTAGACCTAAGCCAGAATTGTTTTCATGGAATTCACATT
>augustus_masked-Fvb3-4-processed-gene-6.11:1800:1920:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_16::augustus_masked-Fvb3-4-processed-gene-6.11:1800-1920||RAPiDGENOMICS_rs1205_02085
ATTCCTTCTGCCTTCCAAAATTGCTCATTTTTGCAGAAACTTTCTCTTGGAGGCAACAATTTCACCGGAAGCATACCTTCTTGGATAGGATCAAAGGTATCCGGATTCACAGTGCTACAA
>augustus_masked-Fvb3-4-processed-gene-6.11:1860:1980:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_16::augustus_masked-Fvb3-4-processed-gene-6.11:1860-1980|2x||RAPiDGENOMICS_rs1205_02086
TTCACCGGAAGCATACCTTCTTGGATAGGATCAAAGGTATCCGGATTCACAGTGCTACAATTGCGATCAAACTCTTTAAGCGGACATATTCCTCACCAACTGTGCAGTCTTCCTCACCTT
>augustus_masked-Fvb3-4-processed-gene-6.11:1980:2100:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_17::augustus_masked-Fvb3-4-processed-gene-6.11:1980-2100|2x||RAPiDGENOMICS_rs1205_02087
CAGTTCCTAGACCTTGGTCACAACAGATTTTCAGGGACTATTCCCAAGTGTTTGAATAACTTGACTGCTCTAGTCTCTGGTCCGGATAATAGTTGGGGTATCTTTAGTGAGTATACCAAT
>augustus_masked-Fvb3-4-processed-gene-6.11:2040:2160:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_18::augustus_masked-Fvb3-4-processed-gene-6.11:2040-2160||RAPiDGENOMICS_rs1205_02088
TTGACTGCTCTAGTCTCTGGTCCGGATAATAGTTGGGGTATCTTTAGTGAGTATACCAATAGTGAGTATGAGGAAACAACCGCGACTACAAAAGGAAGAGAAAGTGAATACTTCCCTAGC
>augustus_masked-Fvb3-4-processed-gene-6.11:2640:2760:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_23::augustus_masked-Fvb3-4-processed-gene-6.11:2640-2760||RAPiDGENOMICS_rs1205_02089
GTGTGCGGCATATTGATATTGAAAAAGTCATGGAGGTATGCTTATTTTCAATTCTTTGATCGCATTAAAGATAGAGTAGCACTTGCAATTGAATTGAGAGCAGCTCGTCTCCAAAGAAGA
>augustus_masked-Fvb3-4-processed-gene-6.11:300:420:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-6.11:300-420|2x||RAPiDGENOMICS_rs1205_02090
CCTAACTTCATTGGTGACCTAACAAGTTTGAGGTATCTCAATCTTTCATATGTTTCGTGGTCTGGAGAGATTCCACCATCTCTTGGTAACCTCTCAAACTTGAACTATCTTGACCTCAGT
>augustus_masked-Fvb3-4-processed-gene-6.11:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-6.11:360-480||RAPiDGENOMICS_rs1205_02091
TCTGGAGAGATTCCACCATCTCTTGGTAACCTCTCAAACTTGAACTATCTTGACCTCAGTGCTGATTTCATCAGTGATGTTTATTCCAAAAGCTTGAATTGGCTTTCTCATCTCTCTTCC
>augustus_masked-Fvb3-4-processed-gene-6.11:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-6.11:480-600||RAPiDGENOMICS_rs1205_02092
CTGAAATACCTAAACCTCGGAGGTGCGAACCTTAAGAATACCGGAGTAAGTTGGCTGCATGCTGTTAACATGCTTCCTTCACTCTTAGAGTTGCGTTTGTCTAATTGCCAAATTGATGGA
>augustus_masked-Fvb3-4-processed-gene-6.11:540:660:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-6.11:540-660|2x||RAPiDGENOMICS_rs1205_02093
GCTGTTAACATGCTTCCTTCACTCTTAGAGTTGCGTTTGTCTAATTGCCAAATTGATGGAAATCAGGTTCCACTCTCGCTACCAACTATTAACTTGACATCTCTTTTGGTCCTTGATATG
>augustus_masked-Fvb3-4-processed-gene-6.11:60:180:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-6.11:60-180|2x||RAPiDGENOMICS_rs1205_02094
AGGCTTTCTTCTTGGGTTGGTCATCAATGCTGTGAATGGAGAGGGATTTCGTGCAACAACCACACAGGTCGTATTGTCAGGCTAGATCTTCGTAATCCATATCCATTTAATGATTACAGC
>augustus_masked-Fvb3-4-processed-gene-6.11:600:720:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-6.11:600-720||RAPiDGENOMICS_rs1205_02095
AATCAGGTTCCACTCTCGCTACCAACTATTAACTTGACATCTCTTTTGGTCCTTGATATGTCGAATAACGATATAAATTCTTCATTTCCTAAATGGCTGTTTAATCTTACTAGTCTTTCA
>augustus_masked-Fvb3-4-processed-gene-6.11:660:780:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-6.11:660-780|2x||RAPiDGENOMICS_rs1205_02096
TCGAATAACGATATAAATTCTTCATTTCCTAAATGGCTGTTTAATCTTACTAGTCTTTCAAAACTGGATTTAGGGTATAATCTTTTCATTCGCCCTTCTCTTGATGAATTCGTAAGACTA
>augustus_masked-Fvb3-4-processed-gene-6.11:720:840:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-6.11:720-840||RAPiDGENOMICS_rs1205_02097
AAACTGGATTTAGGGTATAATCTTTTCATTCGCCCTTCTCTTGATGAATTCGTAAGACTAAAAGCTCTAGAACACCTTGACTTAGGGGGCATTAGACTCAAAGGTCAATTACTTCCGTTT
>augustus_masked-Fvb3-4-processed-gene-6.11:780:900:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-6.11:780-900|2x||RAPiDGENOMICS_rs1205_02098
AAAGCTCTAGAACACCTTGACTTAGGGGGCATTAGACTCAAAGGTCAATTACTTCCGTTTGTAAATTTATGCAAGCTAAAGTCACTTTATCTTACAGCCAACGAATTTGATGGGGGGATT
>augustus_masked-Fvb3-4-processed-gene-6.11:840:960:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-6.11:840-960||RAPiDGENOMICS_rs1205_02099
GTAAATTTATGCAAGCTAAAGTCACTTTATCTTACAGCCAACGAATTTGATGGGGGGATTGAAGAGTTTCTGAGTGGTTTTTCAAATTGTTCATCAAACAGAATGGAGTCACTAGAATTA
>augustus_masked-Fvb3-4-processed-gene-6.11:960:1080:Parent=augustus_masked-Fvb3-4-processed-gene-6.11-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-6.11:960-1080||RAPiDGENOMICS_rs1205_02100
TCAAATTGTGGGCTGGAAGGGGCATTGCCTAGTTCATTAGGAAAGCTGAAAAGCCTTCAGCTTCTTAACCTCAACGCCAATTCTTTTCGGGAATCCATTCCTGAATCTATTTTCAGCGAC
>augustus_masked-Fvb3-4-processed-gene-66.10:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-66.10-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-66.10:0-120||RAPiDGENOMICS_rs1205_02101
ATGGTTTTGAGCATCCCAAGTGTATCAGCTCGTCAGTGGACGCATGATGTATTTTTGAGTTTCAGGGGTGAAACCCGCCATGGTTTTGTATCCCATTTATATGATGAACTGGAAAGCAAA
>augustus_masked-Fvb3-4-processed-gene-66.10:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-66.10-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-66.10:240-360||RAPiDGENOMICS_rs1205_02102
TCTTCTACTTGGTGTTTGGATGAACTCACAAAGATTCTTCAGTCCATGGAAGGGAGGGACAGAATTCTGCCAATTTTCTATGATGTAGATCCTTCTCATGTACGACATCAACTGGGGACT
>augustus_masked-Fvb3-4-processed-gene-66.10:300:420:Parent=augustus_masked-Fvb3-4-processed-gene-66.10-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-66.10:300-420|2x||RAPiDGENOMICS_rs1205_02103
AGAATTCTGCCAATTTTCTATGATGTAGATCCTTCTCATGTACGACATCAACTGGGGACTTCTGCAGAAGCCTTTGCTATGCATGAAGAAAATTCTAGGGAAAGCAAAGAGAAGTTGGAC
>augustus_masked-Fvb3-4-processed-gene-66.10:482:602:Parent=augustus_masked-Fvb3-4-processed-gene-66.10-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-66.10:482-602||RAPiDGENOMICS_rs1205_02104
GTCTGAAAGAGAACTTCTTAAACGAATTGTGAAATTCGTCTGCAACAAGGTACTTCAAGTTCCACCACGGCCTATTCCAATTGAGTTCAATGGGCAGCCTACCGAAGTTTTTGAATCAAT
>augustus_masked-Fvb3-4-processed-gene-66.10:60:180:Parent=augustus_masked-Fvb3-4-processed-gene-66.10-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-66.10:60-180|2x||RAPiDGENOMICS_rs1205_02105
TTCAGGGGTGAAACCCGCCATGGTTTTGTATCCCATTTATATGATGAACTGGAAAGCAAAGGGATTAACACATTCATGGATGCGGAAGAGCTGGAAGTAGGGAAGGCTATTTCTCCAAAT
>augustus_masked-Fvb3-4-processed-gene-66.10:660:780:Parent=augustus_masked-Fvb3-4-processed-gene-66.10-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-66.10:660-780||RAPiDGENOMICS_rs1205_02106
AGCAGTCCCCTAAGTCGTCGGGAGCTAATTGGTCGTTGCTTAGTCTCCTGTGTCTTCGTCATCCTTACTCACTTGGTCCTCTCAGTGATCCCTCGCTTCTTCTCCGCCCTCTCCTTTCTA
>augustus_masked-Fvb3-4-processed-gene-66.10:780:900:Parent=augustus_masked-Fvb3-4-processed-gene-66.10-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-66.10:780-900||RAPiDGENOMICS_rs1205_02107
ACCCAACTCGCTCTCTCGGCTCCGTTGCTTCTGCTTCTCCTGGGTTTTGGCGGATGGTGCAGAAGAACGCTTCTCAGATCAAAAGCTTCTGCTCCGGCTTTCGTCTTCTTCAATATTCTC
>augustus_masked-Fvb3-4-processed-gene-7.7:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-7.7:0-120||RAPiDGENOMICS_rs1205_02108
ATGGAGCTGGGAAGGATGTGCCTCCTGCATGTTCATGCAATCTCAGCTATAGTGCTTCTCCTGCATATCAGTTGTGGTGCTTGTGCTAATGTGACGAGGTGTGTAGAGAGGGAAAGGGAA
>augustus_masked-Fvb3-4-processed-gene-7.7:1020:1140:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-7.7:1020-1140|2x||RAPiDGENOMICS_rs1205_02109
TTTGAATCATCCTGTGCTCAAAATTCCTTAGAGATTCTGGATTTGACCAGTAATAACTTTACAGGGTCATTCCCTGATATGACAAGATTTCAGGCATTACGGGAATTATATCTCCGTAGA
>augustus_masked-Fvb3-4-processed-gene-7.7:1080:1200:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-7.7:1080-1200||RAPiDGENOMICS_rs1205_02110
ACAGGGTCATTCCCTGATATGACAAGATTTCAGGCATTACGGGAATTATATCTCCGTAGAAATAAGTTAAATGGAACAATCCCAGAAAGTATTGGGAACATGTCGAAGCTAGAGACAATC
>augustus_masked-Fvb3-4-processed-gene-7.7:1140:1260:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_10::augustus_masked-Fvb3-4-processed-gene-7.7:1140-1260|2x||RAPiDGENOMICS_rs1205_02111
AATAAGTTAAATGGAACAATCCCAGAAAGTATTGGGAACATGTCGAAGCTAGAGACAATCGGTGTTAGTCACAATGATTTGGAAGGAGTGATTACAGAAGCTCATTTCTCAAAGCTCTCC
>augustus_masked-Fvb3-4-processed-gene-7.7:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-7.7:120-240||RAPiDGENOMICS_rs1205_02112
GCGCTGCTTGCTATCAAACAAGACCTGGTGATTAACTCCACTCGACTCTCTTCGTGGGGAGCTGAAGCTATAAATCAAGATTGTTGCGCATGGGAAGGAGTCCACTGTGACCACCTGACT
>augustus_masked-Fvb3-4-processed-gene-7.7:1200:1320:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-7.7:1200-1320||RAPiDGENOMICS_rs1205_02113
GGTGTTAGTCACAATGATTTGGAAGGAGTGATTACAGAAGCTCATTTCTCAAAGCTCTCCAAGTTAGGGTTTTTGTATTTGTCCTCAAACTTCCTAGTTTTAGACTTCCATTCTGAATGG
>augustus_masked-Fvb3-4-processed-gene-7.7:1260:1380:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-7.7:1260-1380|2x||RAPiDGENOMICS_rs1205_02114
AAGTTAGGGTTTTTGTATTTGTCCTCAAACTTCCTAGTTTTAGACTTCCATTCTGAATGGATTCCTCCTTTTCAATTGGAATCACTAGTGCTGAACTCTTGCAAGATGGGGCCGTTATTT
>augustus_masked-Fvb3-4-processed-gene-7.7:1320:1440:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_12::augustus_masked-Fvb3-4-processed-gene-7.7:1320-1440||RAPiDGENOMICS_rs1205_02115
ATTCCTCCTTTTCAATTGGAATCACTAGTGCTGAACTCTTGCAAGATGGGGCCGTTATTTCCAAAATGGCTTCAAACACAGAAAAATCTCCGCCAGCTTTCTCTTTCTGATGTTGGAATT
>augustus_masked-Fvb3-4-processed-gene-7.7:1440:1560:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_13::augustus_masked-Fvb3-4-processed-gene-7.7:1440-1560||RAPiDGENOMICS_rs1205_02116
TCTGATACTATTCCAAGTTGGTTTTGGGATTTATCACATAATAAGTTAGAGTTGGATCTTTCTTGCAATGAGATTAAAGGAACATTCGCAGATTTAAGATTCGAGTTTGCGTATCAGCCT
>augustus_masked-Fvb3-4-processed-gene-7.7:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-7.7:180-300|2x||RAPiDGENOMICS_rs1205_02117
GCTGAAGCTATAAATCAAGATTGTTGCGCATGGGAAGGAGTCCACTGTGACCACCTGACTGGACATGTTGATCAGCTTCATCTTGGAGGGGAGGTGTTGTCTTCGCAAGGCGAACTCCTT
>augustus_masked-Fvb3-4-processed-gene-7.7:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-7.7:240-360||RAPiDGENOMICS_rs1205_02118
GGACATGTTGATCAGCTTCATCTTGGAGGGGAGGTGTTGTCTTCGCAAGGCGAACTCCTTGATTACATACCTTTTAAAGGTACACTTAGTCCTAAACTCATTGAGTTGCAGCAATTAGTA
>augustus_masked-Fvb3-4-processed-gene-7.7:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-7.7:360-480||RAPiDGENOMICS_rs1205_02119
TATATAGACCTAAGTTCAAATAGGTTACAACCGAGCCCAATTCCAGGTTTCATTGGTTCTTTGTCCCATATGAGATACCTTGATCTCTCTGAAGCTGGCTTTGTCGGTGAAATTCCATAT
>augustus_masked-Fvb3-4-processed-gene-7.7:420:540:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-7.7:420-540|2x||RAPiDGENOMICS_rs1205_02120
TTGTCCCATATGAGATACCTTGATCTCTCTGAAGCTGGCTTTGTCGGTGAAATTCCATATCATGAGCTTGGAAACCTTACTCACTTGCAGTATCTCGATCTCTCCTCTAGTGACTTCACT
>augustus_masked-Fvb3-4-processed-gene-7.7:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-7.7:480-600||RAPiDGENOMICS_rs1205_02121
CATGAGCTTGGAAACCTTACTCACTTGCAGTATCTCGATCTCTCCTCTAGTGACTTCACTAATTCCATAGAATTCTTCAGTTGGCTCCCTCATCTTTCCTCTTTAAAATACTTGGACCTC
>augustus_masked-Fvb3-4-processed-gene-7.7:540:660:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-7.7:540-660|2x||RAPiDGENOMICS_rs1205_02122
AATTCCATAGAATTCTTCAGTTGGCTCCCTCATCTTTCCTCTTTAAAATACTTGGACCTCAGTTTTGTCAATCTTAGTAATGTTTTTGATTGGCCGGAAACAGTAAACAAGCTCCATAAT
>augustus_masked-Fvb3-4-processed-gene-7.7:60:180:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-7.7:60-180|2x||RAPiDGENOMICS_rs1205_02123
CTGCATATCAGTTGTGGTGCTTGTGCTAATGTGACGAGGTGTGTAGAGAGGGAAAGGGAAGCGCTGCTTGCTATCAAACAAGACCTGGTGATTAACTCCACTCGACTCTCTTCGTGGGGA
>augustus_masked-Fvb3-4-processed-gene-7.7:600:720:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-7.7:600-720||RAPiDGENOMICS_rs1205_02124
AGTTTTGTCAATCTTAGTAATGTTTTTGATTGGCCGGAAACAGTAAACAAGCTCCATAATCTACGAAACTTGACTTTATATGGATGCCAACTTCCGCCTCCAATTATTTCCAGTACTACT
>augustus_masked-Fvb3-4-processed-gene-7.7:720:840:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-7.7:720-840||RAPiDGENOMICS_rs1205_02125
CTTTCTGACAAGAATACTTCTCAAACTCTTGCTTTTGTTGATCTTTCTAAAAACAGTCTCACTTCATCATTATTCAAATGGTTGTGTAACATCAATGCCACCCTTGCTCTTCTTAACCTC
>augustus_masked-Fvb3-4-processed-gene-7.7:780:900:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-7.7:780-900|2x||RAPiDGENOMICS_rs1205_02126
ACTTCATCATTATTCAAATGGTTGTGTAACATCAATGCCACCCTTGCTCTTCTTAACCTCTCTCACAACAAATTAAGTGGTTCACTTCCCGATTGTATCGGAAACATGAGCTCTCTTACA
>augustus_masked-Fvb3-4-processed-gene-7.7:840:960:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-7.7:840-960||RAPiDGENOMICS_rs1205_02127
TCTCACAACAAATTAAGTGGTTCACTTCCCGATTGTATCGGAAACATGAGCTCTCTTACACATCTCAACCTTTCCGGTAACCAACTTGAAGGAAGGATTCCCGATTCTTTTGCAAAGTTA
>augustus_masked-Fvb3-4-processed-gene-7.7:900:1020:Parent=augustus_masked-Fvb3-4-processed-gene-7.7-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-7.7:900-1020|2x||RAPiDGENOMICS_rs1205_02128
CATCTCAACCTTTCCGGTAACCAACTTGAAGGAAGGATTCCCGATTCTTTTGCAAAGTTATGTAGTTTGCAAGAATTGGTTATTTCATCCTGTAATCTCAGCGGACACATTTCTAATTTT
>augustus_masked-Fvb3-4-processed-gene-8.14:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-8.14:0-120||RAPiDGENOMICS_rs1205_02129
ATGGCTAATGCATTCCTTTTCTTCTCTCTTTTGATATTTTGTTCCAATATCATACTTGAAAACACTATTGCTTGCAACCAAAGTGAGCGCAGCTCTCTGCTGTCATTTGCTCTCACTCTG
>augustus_masked-Fvb3-4-processed-gene-8.14:1075:1195:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-8.14:1075-1195||RAPiDGENOMICS_rs1205_02130
TGTTACCATCTTCTCTACCATACAGTCATATTCAGATGGTCGATTTTTCCAGCAATCGCTTACATGGTGTGATTCCATCTTCTTTTTTCCAACAGGCTTGGAAGTTGACTGGTTTCAATG
>augustus_masked-Fvb3-4-processed-gene-8.14:1195:1315:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-8.14:1195-1315||RAPiDGENOMICS_rs1205_02131
TCAGTAACAACACCTTTTCAGGTCCTATCCCATCCTCTATTTGTCTTCCTTCTTCCTCGTTACGACACCTTGATTTTTCCTTCAATGATTTAAATGGTAGTATTCCTCGTGTACTTGGGA
>augustus_masked-Fvb3-4-processed-gene-8.14:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-8.14:120-240||RAPiDGENOMICS_rs1205_02132
TCATCTCCTCAGTTGAATTGGACTTCCTTCGATTGTTGCAATTGGGAGGGGATCACATGCAATCAGAATGGATGGATCACTCATTTGCAGTTACCTTCCAAAGCACTTAAACTCGAAGAA
>augustus_masked-Fvb3-4-processed-gene-8.14:1315:1435:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-8.14:1315-1435||RAPiDGENOMICS_rs1205_02133
AGTGTTCCAAACTGCAGGTTTTTCGTGCTGGTCACAATTACCTGTCAGGATCACTTCCAGAAGATATCTATAATGCTACCACAGTTGAAGAGATCTCACTACCTCTAAATTCACTGAATG
>augustus_masked-Fvb3-4-processed-gene-8.14:1435:1555:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-8.14:1435-1555||RAPiDGENOMICS_rs1205_02134
GAGCAATCAGTGATGGCATTGCCAAGCTCATCAACCTCACAACACTTGATCTCTCCTATAACCAATTGAGTGGTGTGCTCCCTCTCCATCTTGGGAAGCTCTCAAAGTTGAAACACATAC
>augustus_masked-Fvb3-4-processed-gene-8.14:1555:1675:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_7::augustus_masked-Fvb3-4-processed-gene-8.14:1555-1675||RAPiDGENOMICS_rs1205_02135
TCCTTGATTTCAACTATCTGGAAGGTTCATTGCCTCTATCCCTGATGAATTGCACAAAACTAGTTGAACTACGTATGGGAGCCAACGACTTGGGAGGTAATATCTCCATGTTCAATTTCT
>augustus_masked-Fvb3-4-processed-gene-8.14:1675:1795:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_8::augustus_masked-Fvb3-4-processed-gene-8.14:1675-1795||RAPiDGENOMICS_rs1205_02136
CCAAGCTCAGCCGACTTAGTAAACTTGACTTGCGGATGAATAACTTCTTTGGTGTCTTACCGAGAAGCCTCTACTCGTGCAAGTTCTTGAAAGCAATTCGAGTGAGCTATAATAATCTAG
>augustus_masked-Fvb3-4-processed-gene-8.14:1795:1915:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_9::augustus_masked-Fvb3-4-processed-gene-8.14:1795-1915||RAPiDGENOMICS_rs1205_02137
AGGTTCAAATACAGCCTGAAATTGCTTCATTGAAATCCCTGTCCTTCCTCTCACTGGGAGTAAACAAACGTTTGACGAATGTCAAAGAGGCAATGAAGATACTGATGGGTTGCAAAAGCC
>augustus_masked-Fvb3-4-processed-gene-8.14:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-8.14:180-300|2x||RAPiDGENOMICS_rs1205_02138
AATCAGAATGGATGGATCACTCATTTGCAGTTACCTTCCAAAGCACTTAAACTCGAAGAAGGTATTTTTCTATCATCCTCACTTGGAAATCTCATACATCTCACCCACTTGAATCTCTCC
>augustus_masked-Fvb3-4-processed-gene-8.14:2035:2155:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-8.14:2035-2155||RAPiDGENOMICS_rs1205_02139
CTGGTCAACTCCCTTTATGGCTATCAAAGCTCAGAAAGTTAGAGTCCTTGAGTCTGAGTCATAATAGAATCACAGGCTCAATCCCAAGTTGGATAGGGAGTCTTCCTAGGCTCTATTCTA
>augustus_masked-Fvb3-4-processed-gene-8.14:2155:2275:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_12::augustus_masked-Fvb3-4-processed-gene-8.14:2155-2275||RAPiDGENOMICS_rs1205_02140
TAATCATGGACTTCAACCTACTTTCAGGTAAAATTCCGAAGGAACTGTGGATGCTCCCTATGTTGGTATCTGAACAAGCTGCAGCTACTGCAGATACTGCTCTTGATCTGCCTTGCTTCT
>augustus_masked-Fvb3-4-processed-gene-8.14:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-8.14:240-360||RAPiDGENOMICS_rs1205_02141
GGTATTTTTCTATCATCCTCACTTGGAAATCTCATACATCTCACCCACTTGAATCTCTCCCACAATTCACTTTCTGGTTCTCTAAGTACTGGATTCTTCTTGTCTTTAAATCATTTGGAG
>augustus_masked-Fvb3-4-processed-gene-8.14:2515:2635:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-8.14:2515-2635||RAPiDGENOMICS_rs1205_02142
CCACGTCTTTCACAAGTCTTCATTTCTTATCAAAACTCAACGTCTCCTTCAATAATCTTGAAGGGCCAATACCATCAAGCACTCAGCTCCAAAGTTTTGATGCTTCTGCGTTTGAGGGGA
>augustus_masked-Fvb3-4-processed-gene-8.14:2635:2755:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_16::augustus_masked-Fvb3-4-processed-gene-8.14:2635-2755||RAPiDGENOMICS_rs1205_02143
ATCTGAATCTTTGTGGTGATCCACTTCCAAATAAGTGTAAGAGAACTAAGGGCACTGATGAACCTGATATGAACAACACAGATGCAGACATTGAGTTTCCATGGTTTTATATTTCTGCTG
>augustus_masked-Fvb3-4-processed-gene-8.14:2755:2875:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_17::augustus_masked-Fvb3-4-processed-gene-8.14:2755-2875||RAPiDGENOMICS_rs1205_02144
CACTTGGGTTCATTATAGGATTTTGGGGAGTCTTTGGTCCTTTAGTATTACTGAAGAAATGGAGGTATGCATATTACCAGTTCCTAGACAATGTATATGACAGGTTCATGGTGATGATAT
>augustus_masked-Fvb3-4-processed-gene-8.14:300:420:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-8.14:300-420|2x||RAPiDGENOMICS_rs1205_02145
CACAATTCACTTTCTGGTTCTCTAAGTACTGGATTCTTCTTGTCTTTAAATCATTTGGAGATTCTTGATTTGAGCTATAACCTTCTTTCCGGGGAGCTACCATCTTCGTTATTCCAACAT
>augustus_masked-Fvb3-4-processed-gene-8.14:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-8.14:360-480||RAPiDGENOMICS_rs1205_02146
ATTCTTGATTTGAGCTATAACCTTCTTTCCGGGGAGCTACCATCTTCGTTATTCCAACATGCTTGGAATTTGACTAGTTTCAATGTGAGGAACAACAACTTCTCAGGTTCTATTCCATCC
>augustus_masked-Fvb3-4-processed-gene-8.14:60:180:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-8.14:60-180|2x||RAPiDGENOMICS_rs1205_02147
AACACTATTGCTTGCAACCAAAGTGAGCGCAGCTCTCTGCTGTCATTTGCTCTCACTCTGTCATCTCCTCAGTTGAATTGGACTTCCTTCGATTGTTGCAATTGGGAGGGGATCACATGC
>augustus_masked-Fvb3-4-processed-gene-8.14:600:720:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-8.14:600-720||RAPiDGENOMICS_rs1205_02148
GGTTACAATAACCTCTCAGGATTAGTTCCAGTAGAGATGTATAATGCTACCACACTTAAAGAAATTTCATTACCTGCTAATTCTCTTTCTGGAGTCCTTGGTGAAAAAATGCTTCAACTT
>augustus_masked-Fvb3-4-processed-gene-8.14:660:780:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_6::augustus_masked-Fvb3-4-processed-gene-8.14:660-780|2x||RAPiDGENOMICS_rs1205_02149
GAAATTTCATTACCTGCTAATTCTCTTTCTGGAGTCCTTGGTGAAAAAATGCTTCAACTTGTGAACCTCACAATCCTTGATCTCTCCTATAACCAATTGAGTGGTATGCTCCCTCACCAT
>augustus_masked-Fvb3-4-processed-gene-8.14:955:1075:Parent=augustus_masked-Fvb3-4-processed-gene-8.14-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-8.14:955-1075||RAPiDGENOMICS_rs1205_02150
ACCTCACCCACTTGAATCTCTCCCACAATTCACTTTATGGCTCTCTAGATCAAACTCAACTCTTCTTGTCCTTGAACTATCTCCAAGTTATAGATTTGAGCTATAACCTTCTCTTTGGAG
>augustus_masked-Fvb3-4-processed-gene-8.15:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-8.15-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-8.15:0-120||RAPiDGENOMICS_rs1205_02151
ATGCTAGTGCAGCCTGCAATTCACGCAATGGTTCGAGGCTTAAGCTTTCTTCTCATTTTGATGTCATTGTTTACTCATAATGTTCATGCATGCATCCAAACACAACGTACTTCTCTCTTG
>augustus_masked-Fvb3-4-processed-gene-8.15:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-8.15-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-8.15:120-240||RAPiDGENOMICS_rs1205_02152
TCCTTTGCCCTCGATCTATCTTCTCCTTCCTTAAACTGGACTTCTGGTAATTGTTGCTATTGGGAAGGCATTACTTGTAGTCGAGATGGTTGGGTCACCCATTTGCAGTTACCCTCCAAA
>augustus_masked-Fvb3-4-processed-gene-8.15:1200:1320:Parent=augustus_masked-Fvb3-4-processed-gene-8.15-mRNA-1_11::augustus_masked-Fvb3-4-processed-gene-8.15:1200-1320||RAPiDGENOMICS_rs1205_02153
AACAAACGTTTGACGAATGTCAAAGAGGCAATGAAGATACTGATGGGTTGCAAAAGCCTTGTAGTTTTATCATTAGCATCCAGTTTTGTAGGTGAGGAATTTCCTACTGATCTTGGGAAA
>augustus_masked-Fvb3-4-processed-gene-8.15:1560:1680:Parent=augustus_masked-Fvb3-4-processed-gene-8.15-mRNA-1_14::augustus_masked-Fvb3-4-processed-gene-8.15:1560-1680||RAPiDGENOMICS_rs1205_02154
TTGGTATCTGAACAAGCTGCAGCTACTGCAGATACTGCTCTTGATCTGCCTTGCTTCTACCCCAGTGTTGATTATGCAAAACCTATACAGTACAATTACTTGTATTACGAAGCAATGATA
>augustus_masked-Fvb3-4-processed-gene-8.15:1680:1800:Parent=augustus_masked-Fvb3-4-processed-gene-8.15-mRNA-1_15::augustus_masked-Fvb3-4-processed-gene-8.15:1680-1800||RAPiDGENOMICS_rs1205_02155
TCCCTAAAAAGCAATAACCTACATGGGAACATACCTTCTGAGATTGGCCAATCGAAGCTTCTGAAAACTTTGTATCTTAGCAACAACAACTTGTCCGGCAATATTCCAGAACAGATAGCT
>augustus_masked-Fvb3-4-processed-gene-8.15:300:420:Parent=augustus_masked-Fvb3-4-processed-gene-8.15-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-8.15:300-420|2x||RAPiDGENOMICS_rs1205_02156
ACTCACTTGAATCTCTCACACAATTCCCTTTCTGGTTCTCTATATCAAAGTGAAACCTTCTTGTCTTTAAATTATCTCGAAATCCTAGATTTGAGCTTTAACCTTCTCTTTGGAATGTTA
>augustus_masked-Fvb3-4-processed-gene-8.15:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-8.15-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-8.15:360-480||RAPiDGENOMICS_rs1205_02157
TTGTCTTTAAATTATCTCGAAATCCTAGATTTGAGCTTTAACCTTCTCTTTGGAATGTTACCATCTTTTCTACCATCCACCAGTCATATTCAGTTGGTGGATTTTTCCAGCAATCGCTTA
>augustus_masked-Fvb3-4-processed-gene-84.1:0:120:Parent=augustus_masked-Fvb3-4-processed-gene-84.1-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-84.1:0-120||RAPiDGENOMICS_rs1205_02158
ATGGATAGCTTCTGTGGAAACCTATTCAAGCCTACCATGAAAAATGCTGCTCATTACTTGCTCTTTCTTTTCCTGGCATCTTCACACCTGCACAATACTCAACTATGTTTCGGTGATGGA
>augustus_masked-Fvb3-4-processed-gene-84.1:120:240:Parent=augustus_masked-Fvb3-4-processed-gene-84.1-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-84.1:120-240||RAPiDGENOMICS_rs1205_02159
CTTCCGAGTGGAGTGATGAGCTCATCATCATGCTTTGATGAAGAGAGAGAGGTGCTTCTCAGCTTTAAAAGAGATGTTACTGATAGTTCTGGCAGACTTTCATCTTGGGTGGGTTTGGAT
>augustus_masked-Fvb3-4-processed-gene-84.1:180:300:Parent=augustus_masked-Fvb3-4-processed-gene-84.1-mRNA-1_2::augustus_masked-Fvb3-4-processed-gene-84.1:180-300|2x||RAPiDGENOMICS_rs1205_02160
AGCTTTAAAAGAGATGTTACTGATAGTTCTGGCAGACTTTCATCTTGGGTGGGTTTGGATTGCTGCCGATGGAAAGGGATTTCATGCAACAACCGTACAGGTCACGTTGCAAAGATGGAC
>augustus_masked-Fvb3-4-processed-gene-84.1:240:360:Parent=augustus_masked-Fvb3-4-processed-gene-84.1-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-84.1:240-360||RAPiDGENOMICS_rs1205_02161
TGCTGCCGATGGAAAGGGATTTCATGCAACAACCGTACAGGTCACGTTGCAAAGATGGACCTCCGGAACCCGAATTACGATCAAGGCTACCGTGGGGAGACTTTTTTGGGGGGTAAGATC
>augustus_masked-Fvb3-4-processed-gene-84.1:300:420:Parent=augustus_masked-Fvb3-4-processed-gene-84.1-mRNA-1_3::augustus_masked-Fvb3-4-processed-gene-84.1:300-420|2x||RAPiDGENOMICS_rs1205_02162
CTCCGGAACCCGAATTACGATCAAGGCTACCGTGGGGAGACTTTTTTGGGGGGTAAGATCAATCCTTCTTTGCTTAGCTTGAAAAACTTATATCACCTTGACCTAAGCGGAAATGATTTT
>augustus_masked-Fvb3-4-processed-gene-84.1:360:480:Parent=augustus_masked-Fvb3-4-processed-gene-84.1-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-84.1:360-480||RAPiDGENOMICS_rs1205_02163
AATCCTTCTTTGCTTAGCTTGAAAAACTTATATCACCTTGACCTAAGCGGAAATGATTTTCAAGGACTTCGAATTCCTAGTTTCTTTGGGAAGCTTACAAGTTTGAGGTATCTTAATCTC
>augustus_masked-Fvb3-4-processed-gene-84.1:420:540:Parent=augustus_masked-Fvb3-4-processed-gene-84.1-mRNA-1_4::augustus_masked-Fvb3-4-processed-gene-84.1:420-540|2x||RAPiDGENOMICS_rs1205_02164
CAAGGACTTCGAATTCCTAGTTTCTTTGGGAAGCTTACAAGTTTGAGGTATCTTAATCTCTCCCATGCTTCATTCGTCGGAGAGATTCCCCCAGCTCTTGGTAACCTCTCAAACTTGATT
>augustus_masked-Fvb3-4-processed-gene-84.1:480:600:Parent=augustus_masked-Fvb3-4-processed-gene-84.1-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-84.1:480-600||RAPiDGENOMICS_rs1205_02165
TCCCATGCTTCATTCGTCGGAGAGATTCCCCCAGCTCTTGGTAACCTCTCAAACTTGATTTATCTTGACCTTGGTTCTGAAAATGATTACTTTTCTGATCCGTATTTTTCCAACAACTTA
>augustus_masked-Fvb3-4-processed-gene-84.1:540:660:Parent=augustus_masked-Fvb3-4-processed-gene-84.1-mRNA-1_5::augustus_masked-Fvb3-4-processed-gene-84.1:540-660|2x||RAPiDGENOMICS_rs1205_02166
TATCTTGACCTTGGTTCTGAAAATGATTACTTTTCTGATCCGTATTTTTCCAACAACTTAAATTGGCTTTCTCATATCTCTTCCCTAAAGTACCTCAATCTTGGAGGTATGAACCTTAGC
>augustus_masked-Fvb3-4-processed-gene-84.1:60:180:Parent=augustus_masked-Fvb3-4-processed-gene-84.1-mRNA-1_1::augustus_masked-Fvb3-4-processed-gene-84.1:60-180|2x||RAPiDGENOMICS_rs1205_02167
CTCTTTCTTTTCCTGGCATCTTCACACCTGCACAATACTCAACTATGTTTCGGTGATGGACTTCCGAGTGGAGTGATGAGCTCATCATCATGCTTTGATGAAGAGAGAGAGGTGCTTCTC
>augustus_masked-Fvb4-1-processed-gene-0.4:1680:1800:Parent=augustus_masked-Fvb4-1-processed-gene-0.4-mRNA-1_15::augustus_masked-Fvb4-1-processed-gene-0.4:1680-1800||RAPiDGENOMICS_rs1205_02168
AGTTCACCGCCACCTCCTCCGCCACATCACTCTTCCTATGTCCCATCTCCACCAAACTATCATCATAGTCCGGTTTACACTTCACCACCTCCACCTCCGCCCTCGGGCAATGAACATTAT
>augustus_masked-Fvb4-1-processed-gene-0.4:180:300:Parent=augustus_masked-Fvb4-1-processed-gene-0.4-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-0.4:180-300|2x||RAPiDGENOMICS_rs1205_02169
TCCAACTGGAACGGGTCGGACGTCTGCTCCTACATGGGAGTCTTCTGCGCTGCTCTCCCCTCAGTCGGGCGTGTGGTCGCCGGCATTGACCTCAACCACGCTGACATTGCTGGCTACCTG
>augustus_masked-Fvb4-1-processed-gene-0.4:1800:1920:Parent=augustus_masked-Fvb4-1-processed-gene-0.4-mRNA-1_16::augustus_masked-Fvb4-1-processed-gene-0.4:1800-1920||RAPiDGENOMICS_rs1205_02170
TCAAAAGCACCACCACCTTGGCACACTCCCGAGAATAACTCACCACCCGAAACACATGCTAGTCCACCTCCCTCGCCGGGGGATATACATTATACCAAAGCACCACCACCGTGGCACACG
>augustus_masked-Fvb4-1-processed-gene-0.4:360:480:Parent=augustus_masked-Fvb4-1-processed-gene-0.4-mRNA-1_4::augustus_masked-Fvb4-1-processed-gene-0.4:360-480||RAPiDGENOMICS_rs1205_02171
TGCGGCGTCGTCCCCACCAGCTTTCGGCGACTGAAACTGCTCCACGAGCTGGATCTCAGCAACAACCGCTTTGTGGGCAACTTCCCCAAAGTGGTGCTCTCCTTGCCTTCCCTCAAGTAC
>augustus_masked-Fvb4-1-processed-gene-0.4:420:540:Parent=augustus_masked-Fvb4-1-processed-gene-0.4-mRNA-1_4::augustus_masked-Fvb4-1-processed-gene-0.4:420-540|2x||RAPiDGENOMICS_rs1205_02172
AACAACCGCTTTGTGGGCAACTTCCCCAAAGTGGTGCTCTCCTTGCCTTCCCTCAAGTACTTGGATCTCCGTTTTAACGAGTTCGAAGGCTCCGTTCCTTCCCAGCTCTTCGACAAGGAT
>augustus_masked-Fvb4-1-processed-gene-0.4:480:600:Parent=augustus_masked-Fvb4-1-processed-gene-0.4-mRNA-1_5::augustus_masked-Fvb4-1-processed-gene-0.4:480-600||RAPiDGENOMICS_rs1205_02173
TTGGATCTCCGTTTTAACGAGTTCGAAGGCTCCGTTCCTTCCCAGCTCTTCGACAAGGATCTCGATGCCATTTTCCTCAACGACAACAGGTTCCGGATGGGCATCCCCCACAATCTCGGC
>augustus_masked-Fvb4-1-processed-gene-0.4:600:720:Parent=augustus_masked-Fvb4-1-processed-gene-0.4-mRNA-1_6::augustus_masked-Fvb4-1-processed-gene-0.4:600-720||RAPiDGENOMICS_rs1205_02174
AACTCGCCCGTTTCGGTGCTTGTGTTGGCCAACAATAATCTTGGGGGTTGCATTCCTGGTAGCATCGGCAACATGTGGAAGACTCTCAACGAGATTATTCTGTTGAATGACAATCTCACC
>augustus_masked-Fvb4-1-processed-gene-123.0:0:120:Parent=augustus_masked-Fvb4-1-processed-gene-123.0-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-123.0:0-120||RAPiDGENOMICS_rs1205_02175
ATGGTTGAAGCAGTTCCATTTGGTACTGCCGTAGACATACTCATCAAGCTGGGGTCTTCCGCTTTCCAGAAACTCGGGCTCATCTACGGCGTCAACAAGGAAATGAAGAAGCTCGAGAAC
>augustus_masked-Fvb4-1-processed-gene-123.0:1106:1226:Parent=augustus_masked-Fvb4-1-processed-gene-123.0-mRNA-1_3::augustus_masked-Fvb4-1-processed-gene-123.0:1106-1226||RAPiDGENOMICS_rs1205_02176
TATGCATGACCTCATACACGATCTTTCTCGGGCAGTTGCAGGATCTGAATTCTCAGTTTGCAGTGTGGATGTTGGAGATATATCTGAAAGAGTTCATCATCTTTCATTTAGTTGTCATCT
>augustus_masked-Fvb4-1-processed-gene-123.0:1226:1346:Parent=augustus_masked-Fvb4-1-processed-gene-123.0-mRNA-1_4::augustus_masked-Fvb4-1-processed-gene-123.0:1226-1346||RAPiDGENOMICS_rs1205_02177
GCCTTCTTCATGGGAAGTTCCGATAGCATTGCTCAAAGCAAAGAAGACTAGAACATTTATGCTACCACTTCAGGAACAAGCATATAAAATTTCCAGTCACAATTCAATCATTTCAAACTT
>augustus_masked-Fvb4-1-processed-gene-123.0:1466:1586:Parent=augustus_masked-Fvb4-1-processed-gene-123.0-mRNA-1_6::augustus_masked-Fvb4-1-processed-gene-123.0:1466-1586||RAPiDGENOMICS_rs1205_02178
CCCTGCTTCTATAAGCAATCTGCAGAATCTGAAGACGCTTAAACTCAACAGGTGCTACAGACTTGAACAACTACCTAGAGATATTGGAAAGATGTCCAGCCTTAGAAATCTTGAGATCAC
>augustus_masked-Fvb4-1-processed-gene-123.0:1689:1809:Parent=augustus_masked-Fvb4-1-processed-gene-123.0-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-123.0:1689-1809||RAPiDGENOMICS_rs1205_02179
GCGTTACTTGACAATCTTACCACAATTGAGGGCTGTCTCAGATGCCAGCATCTTCTACCACTTGATCAACTGCCTTCTCTCAAGTTTCTCAAACTGTATTCTCTAAGTTCCCTGGAGCAC
>augustus_masked-Fvb4-1-processed-gene-123.0:1809:1929:Parent=augustus_masked-Fvb4-1-processed-gene-123.0-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-123.0:1809-1929||RAPiDGENOMICS_rs1205_02180
ATCAACAACAGTTACTCATCTTCCTCTTCTAGTTTGGCTGGTGAAGGAAGAGAGCCTTTGTTTTTTCCATCATTGAAAGAGCTCATACTTTATGACTTGCCACTCTTGAAGCTGTGGCAA
>augustus_masked-Fvb4-1-processed-gene-123.0:1929:2049:Parent=augustus_masked-Fvb4-1-processed-gene-123.0-mRNA-1_3::augustus_masked-Fvb4-1-processed-gene-123.0:1929-2049||RAPiDGENOMICS_rs1205_02181
ACATGCAGTGATGAAGATGTGACAACAACAATGCCAAATCGACAGCTTTCATTTCCTTCCCTCACCAAATTGACAATCGTGGACGCCCCTAACTTAACATCCATGCCAATGCTTCCACTA
>augustus_masked-Fvb4-1-processed-gene-123.0:2049:2169:Parent=augustus_masked-Fvb4-1-processed-gene-123.0-mRNA-1_4::augustus_masked-Fvb4-1-processed-gene-123.0:2049-2169||RAPiDGENOMICS_rs1205_02182
GTTGAAGAATTGCTTATGGACACCATCTCGATAAAGCTGTTGCAGTCAATGTTGATGGCAGCAGCCTCAGAAAGACATACAAGCTCTTCCTCCCTAGCTAGATTGAAATTTTATCAAATC
>augustus_masked-Fvb4-1-processed-gene-123.0:462:582:Parent=augustus_masked-Fvb4-1-processed-gene-123.0-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-123.0:462-582|2x||RAPiDGENOMICS_rs1205_02183
GTGTGGGGGTATGGAGACTTTGATTTATATTCAATTGCTGAGAAAATCTTGAGATCTAGTGCTACGAATGAACTAGAGGATTCGGAGTTTTATCACCAGCATATTTTGATGCAGAAGAAA
>augustus_masked-Fvb4-1-processed-gene-123.0:710:830:Parent=augustus_masked-Fvb4-1-processed-gene-123.0-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-123.0:710-830||RAPiDGENOMICS_rs1205_02184
TCTATCGGAGGAAGAGAGTTGGACATTGTTCAAGCAACTGGCTTTTAAAGGTGGAAGGGAGGAGGAGCATCCGGAGTTGGTGCCAATAGGAAGAAGAATTGTGAAGAAATGCAGAGGTGT
>augustus_masked-Fvb4-1-processed-gene-123.0:866:986:Parent=augustus_masked-Fvb4-1-processed-gene-123.0-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-123.0:866-986||RAPiDGENOMICS_rs1205_02185
CTATGATCACATGCCAATTTATTTGAAACAATGCTTCTCCTACTGTGCATTGTTCCCTAAGGGATTTGCAATTGAGAAGAAAATGTTTGTGGAACTTTGGATAGCTCAGGGTTACATTCA
>augustus_masked-Fvb4-1-processed-gene-123.0:986:1106:Parent=augustus_masked-Fvb4-1-processed-gene-123.0-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-123.0:986-1106||RAPiDGENOMICS_rs1205_02186
CCTTCCTGGTAAAGAGAAGAACTTAGAAGAAATTGGTGACATGTATTTCAAAGAATTGATAGAGAGATCATTATTTCAAGAGATCAAGAAAGATGCCAATGGAATTTTAATTAGTTGTCA
>augustus_masked-Fvb4-1-processed-gene-145.13:0:120:Parent=augustus_masked-Fvb4-1-processed-gene-145.13-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-145.13:0-120||RAPiDGENOMICS_rs1205_02187
ATGGGCAGAAGAGAAACGAAGGAGCCTAAAGTGCTTGAAGTTGGTAAAGAAATTGTAAGGAAGTGTCGGGGTTTGCCTCTTGCTGCCAAGACTTTGGGTAGTCTCATGCATAGTAAGCAA
>augustus_masked-Fvb4-1-processed-gene-145.13:120:240:Parent=augustus_masked-Fvb4-1-processed-gene-145.13-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-145.13:120-240||RAPiDGENOMICS_rs1205_02188
ACATTGAAAGAGTGGGATGATGTTCTGCACAGCAGTATATGGAAATTGAAAGAGTTCGAGGAAAGTGTATTTCAACCTCTATTGTTGAGTTATTATGATCTCGCTCCGACCATTAGAAAA
>augustus_masked-Fvb4-1-processed-gene-145.13:180:300:Parent=augustus_masked-Fvb4-1-processed-gene-145.13-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-145.13:180-300|2x||RAPiDGENOMICS_rs1205_02189
GAAAGTGTATTTCAACCTCTATTGTTGAGTTATTATGATCTCGCTCCGACCATTAGAAAATGTTTTTTGTATTGTGCTATATTTCCTAAAGATTATCTAATTGATAAGTTTGAGTTGATT
>augustus_masked-Fvb4-1-processed-gene-145.13:319:439:Parent=augustus_masked-Fvb4-1-processed-gene-145.13-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-145.13:319-439||RAPiDGENOMICS_rs1205_02190
ATTTTGAGAGAGATGATAAAGGAAACATAACAGGTTGCAAAATGCACGATAGTGTTCGTGAATTTGTGCAATATCTGTCCAAAAGTGAATTCCTTGTCATGGATGTTAGAAGATCTAAAT
>augustus_masked-Fvb4-1-processed-gene-145.13:439:559:Parent=augustus_masked-Fvb4-1-processed-gene-145.13-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-145.13:439-559||RAPiDGENOMICS_rs1205_02191
TCAAGCCTCCAAATGAGAAGGTTCGTCACATGTTCTTAACATTTGACAGTGTGACATGTACGAGTGTGTATTTTCCTTTAGCAAATTTGCGCACGGTGATAATGGATGGGGAGTGGGCAT
>augustus_masked-Fvb4-1-processed-gene-145.13:559:679:Parent=augustus_masked-Fvb4-1-processed-gene-145.13-mRNA-1_3::augustus_masked-Fvb4-1-processed-gene-145.13:559-679||RAPiDGENOMICS_rs1205_02192
TTGGGGTAAAAGATCTTTTCAAATTGAACAGTCTTAGGGCTCTGGATTTGAGCAAGTATTGGGGAGTTATTCCAAATGATATCGGAGGATTGATACACCTGAGATACCTCAAGTTAAGTC
>augustus_masked-Fvb4-1-processed-gene-145.13:679:799:Parent=augustus_masked-Fvb4-1-processed-gene-145.13-mRNA-1_4::augustus_masked-Fvb4-1-processed-gene-145.13:679-799||RAPiDGENOMICS_rs1205_02193
ACAATCCTTCGAAGGAATTGCCTGAAACTCTGTGTGATTTGTATTATCTGCAGACCTTGATACTTGACTCCTGCCATTTACTCATAAAATTACCACACGGGATGGAGAAGCTGATAAACT
>augustus_masked-Fvb4-1-processed-gene-166.2:0:120:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-166.2:0-120||RAPiDGENOMICS_rs1205_02194
ATGGAATCCACAATTCCCGTCGAAAACCCTAAAACCTCCGGATATCCAGAACCCTCCGATTCCGCATTGCAAGTCGTCAACGCCGGCAGCGAAGTCGCCGGAGCCGACTCGATTCTCGAC
>augustus_masked-Fvb4-1-processed-gene-166.2:1080:1200:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_10::augustus_masked-Fvb4-1-processed-gene-166.2:1080-1200||RAPiDGENOMICS_rs1205_02195
AGTTGCTCATTTCTTAACTCTACTGCAGTAGATGAAGGTGATGAAAAAGATTGTGATGATGAAGTATCCTCAAATAGTCGAGAGGTTGCAGGTGAGCAAGATGAAGCATTATGTTCAGAA
>augustus_masked-Fvb4-1-processed-gene-166.2:120:240:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-166.2:120-240||RAPiDGENOMICS_rs1205_02196
GTCTCCGGCCAGAGCCTAGACTTTCCGATCGGTGAGAACGCCGGCGACGACGTCGGCGATCTATACCTCTACAAAAATGTGTACAATCTACTGCCGAAATCCATCGCCGGTATAAAAGGC
>augustus_masked-Fvb4-1-processed-gene-166.2:1200:1320:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_11::augustus_masked-Fvb4-1-processed-gene-166.2:1200-1320||RAPiDGENOMICS_rs1205_02197
ATGTTAAAAGCCACTTCTGGATCCAAGAGGAAGAAGCATATCGGGGATCTGAAGAAGCCGAATTGCAAGAATTTAAAGTCAGCTGGAATTAGTGGTGAATCTAGTCATGCTGTTTCATTA
>augustus_masked-Fvb4-1-processed-gene-166.2:1680:1800:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_15::augustus_masked-Fvb4-1-processed-gene-166.2:1680-1800||RAPiDGENOMICS_rs1205_02198
CTTCAAGATGGCTTTTATGATGCTGGACGTGATAGGCCATTTCTGCCACTAGAGAGTTATGATGGAAATTTCCCTCTTGACTCGCGTGAAGTTATTTTCTTGGACAGCGAAAAGGATGAT
>augustus_masked-Fvb4-1-processed-gene-166.2:1800:1920:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_16::augustus_masked-Fvb4-1-processed-gene-166.2:1800-1920||RAPiDGENOMICS_rs1205_02199
GAGTTGGATGGAATTTTTCAGTCTGCCAGAGATGTGGTTCGCCATTTGAATGAGTTAAATGACAATTGCACTGATGAGCGACAGATTGCAATGTTTCTTGCTCTATTTGTATCAGATCAT
>augustus_masked-Fvb4-1-processed-gene-166.2:1920:2040:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_17::augustus_masked-Fvb4-1-processed-gene-166.2:1920-2040||RAPiDGENOMICS_rs1205_02200
TTTGGAGGGAGTGATAGGGTTGCTGGTATTGAAAGGAGGCGAAAAGGTAGTCCTGATGCAAATGTCAGGAAGCCTTTTGTATGCACCTGTTCAACTAGAAACGGTGAAGCTTGTAATTTA
>augustus_masked-Fvb4-1-processed-gene-166.2:2280:2400:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_20::augustus_masked-Fvb4-1-processed-gene-166.2:2280-2400||RAPiDGENOMICS_rs1205_02201
ATACCAGTCAAGAGAGTGGACTCAACTGAGACTCGTTGGATAGTTGATGCATGTCGTCCAAATGACATCAGAATGGAAACAGATCCTGAATATTATTGTAGGTATATGCCTATGAGTCGG
>augustus_masked-Fvb4-1-processed-gene-166.2:240:360:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_3::augustus_masked-Fvb4-1-processed-gene-166.2:240-360||RAPiDGENOMICS_rs1205_02202
TTGAAGACGCTCAAGTTCTTCGGCAACGAGATCAATCTGTTCTCGTCGCCGGAGATCGGCGACTTGGTGAGGCTAGAATGCCTGAGGATCTCGTCGCCGGAGTTCGACGGCTTGCCGCTG
>augustus_masked-Fvb4-1-processed-gene-166.2:2520:2640:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_22::augustus_masked-Fvb4-1-processed-gene-166.2:2520-2640||RAPiDGENOMICS_rs1205_02203
GAGTTGGCAGCTAAAATTCGTACTTTGGAGGTAGATGGGACTTCAGGGGATGATGTTAGGAAGTTTGAGTACAACTGCTTAGGGGAAGTAAGAATGTTAAGTGCTTTGCAACACCCCTGC
>augustus_masked-Fvb4-1-processed-gene-166.2:2640:2760:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_23::augustus_masked-Fvb4-1-processed-gene-166.2:2640-2760||RAPiDGENOMICS_rs1205_02204
ATAGTAGAGATGTATGGACATCAGATATCATCCAAGTGGGCTCCTTCAGTGAATGGTACTCCTGGCTCCCGTACTCTGCAATCAGCAATTTTCATGGAGTACATAAATGGGGGTTCCATA
>augustus_masked-Fvb4-1-processed-gene-166.2:3240:3360:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_28::augustus_masked-Fvb4-1-processed-gene-166.2:3240-3360||RAPiDGENOMICS_rs1205_02205
GAAGAGTTGGAAGCGCTTCTGCTATTTATGGATGAGCCAGCAGCTCGATCAGCTGCAGAGCTTGGGGGAACAGAGGCCGACTTAGACACACAAGCATTTCTTGCTGACTTGTTCTGCAAA
>augustus_masked-Fvb4-1-processed-gene-166.2:840:960:Parent=augustus_masked-Fvb4-1-processed-gene-166.2-mRNA-1_8::augustus_masked-Fvb4-1-processed-gene-166.2:840-960||RAPiDGENOMICS_rs1205_02206
AATGAGTCTGGCAGTTCTTCAGTTGAGTTGGATTGCTCGTCGAATGTGAGTAGTGTGTCTAATAAATCGAAAAGTAGGTTTCTTGCAAGTTGGAGATCGGATGGGAGGAAGTGTTATATT
>augustus_masked-Fvb4-1-processed-gene-167.11:1157:1277:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-167.11:1157-1277||RAPiDGENOMICS_rs1205_02207
GTACTGGTTGTATGCGGCTGTTAGTTGTAAGAGTTTACTGGTGACAAATGATGAAATGCGAGATCACTTGTTCCAACTTCTTGGCACTAACTTTTTCCCAAGATGGAAGGAAAAACATCA
>augustus_masked-Fvb4-1-processed-gene-167.11:120:240:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-167.11:120-240||RAPiDGENOMICS_rs1205_02208
CTGAAGCACAAGCTGGACATGTGTTCCCGCCACGGCCAAGTCGTCGAGGCTCTGAGAATTTACGACGAGGCTATGACTGATGGGGTTCCGTTGAGCCTGCACCATTACAATGTGCTGTTG
>augustus_masked-Fvb4-1-processed-gene-167.11:1418:1538:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-167.11:1418-1538||RAPiDGENOMICS_rs1205_02209
ACCTCAGTCTTCTTCTTCCTCGTCTCCACAACCTCAGCTCAGAACACAACAAGGGGTTCTGTCTTTCTTGGAAGCCCAAAACATGAAATGGAGTGTCCCGACCAAGACCCTGTTTCTCCT
>augustus_masked-Fvb4-1-processed-gene-167.11:1478:1598:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-167.11:1478-1598|2x||RAPiDGENOMICS_rs1205_02210
GTCTTTCTTGGAAGCCCAAAACATGAAATGGAGTGTCCCGACCAAGACCCTGTTTCTCCTCAAAGTTGTCTGCTTTCTGTGCTTCTCAGTTTCCGGCGACAACCGCTGGCCGGAGAAGTC
>augustus_masked-Fvb4-1-processed-gene-167.11:1538:1658:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-167.11:1538-1658||RAPiDGENOMICS_rs1205_02211
CAAAGTTGTCTGCTTTCTGTGCTTCTCAGTTTCCGGCGACAACCGCTGGCCGGAGAAGTCGGTTCTGCTCGAGCTGAAAGCCTCAGTGTCGGACCCAGATGGGGTTCTGTCTACCTGGGC
>augustus_masked-Fvb4-1-processed-gene-167.11:1598:1718:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-167.11:1598-1718|2x||RAPiDGENOMICS_rs1205_02212
GGTTCTGCTCGAGCTGAAAGCCTCAGTGTCGGACCCAGATGGGGTTCTGTCTACCTGGGCCGACAGCAGCTCTGCTCACCACTGTTCCTGGTTCGGGGTCTCCTGCGACTCAAAGTCCAA
>augustus_masked-Fvb4-1-processed-gene-167.11:1778:1898:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_4::augustus_masked-Fvb4-1-processed-gene-167.11:1778-1898||RAPiDGENOMICS_rs1205_02213
TACTTGCTCTGAGACTGTGAAATTTCAATTTCAGTTTGGTGGGTTTGGGGCTTGGAGAAGGAGTGAGGTTAGTGATGGGAGATTAGGTGGAAAGCTTTCACCTTTGATTGGGAAACTGAG
>augustus_masked-Fvb4-1-processed-gene-167.11:1958:2078:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_5::augustus_masked-Fvb4-1-processed-gene-167.11:1958-2078|2x||RAPiDGENOMICS_rs1205_02214
TTGGGGGTTAGAGAAGCTTGAAGTGCTTGATCTTGAGGGGAATTTGCTGGAGGGGGAATTGCCGAAGAGGTTTGAGGGTTTGAGGAAGTTGAGGGTTTTGAATGTTGGGTTTAATCGGAT
>augustus_masked-Fvb4-1-processed-gene-167.11:2018:2138:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_6::augustus_masked-Fvb4-1-processed-gene-167.11:2018-2138||RAPiDGENOMICS_rs1205_02215
GCCGAAGAGGTTTGAGGGTTTGAGGAAGTTGAGGGTTTTGAATGTTGGGTTTAATCGGATTGGTGGGGAGGTTCCGGTTTCGCTTTCGAAATGTAAGGATTTGGAGGTTGTGAGTTTGGC
>augustus_masked-Fvb4-1-processed-gene-167.11:2198:2318:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_7::augustus_masked-Fvb4-1-processed-gene-167.11:2198-2318|2x||RAPiDGENOMICS_rs1205_02216
GGTGTATTTGGGTGGGAATAGGTTGAATGGATCGATTCGGGGAAATTTTGGAAGATCTTGCCAGAATCTTGAGCATTTTGATGTGTCAGGGAATTCCCTTGTTGGGAAGATTCCACGTAG
>augustus_masked-Fvb4-1-processed-gene-167.11:2258:2378:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_8::augustus_masked-Fvb4-1-processed-gene-167.11:2258-2378||RAPiDGENOMICS_rs1205_02217
CCAGAATCTTGAGCATTTTGATGTGTCAGGGAATTCCCTTGTTGGGAAGATTCCACGTAGTTTGGGGAATTGTCTGCGGTTAAGGACTGTTTTGTTGTTTTCGAATATGCTGGATGGTGT
>augustus_masked-Fvb4-1-processed-gene-167.11:2318:2438:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_8::augustus_masked-Fvb4-1-processed-gene-167.11:2318-2438|2x||RAPiDGENOMICS_rs1205_02218
TTTGGGGAATTGTCTGCGGTTAAGGACTGTTTTGTTGTTTTCGAATATGCTGGATGGTGTGATTCCTGGTGAACTTGGTAAGATTCGGGGGCTTGAAGTTCTGGATGTGTCTAGGAATAG
>augustus_masked-Fvb4-1-processed-gene-167.11:2378:2498:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_9::augustus_masked-Fvb4-1-processed-gene-167.11:2378-2498||RAPiDGENOMICS_rs1205_02219
GATTCCTGGTGAACTTGGTAAGATTCGGGGGCTTGAAGTTCTGGATGTGTCTAGGAATAGCCTTAGTGGTCCTATCCCTACTGAGCTTGGACAATGCGCCAATTTGTCGGTTCTTGTCCT
>augustus_masked-Fvb4-1-processed-gene-167.11:240:360:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_3::augustus_masked-Fvb4-1-processed-gene-167.11:240-360||RAPiDGENOMICS_rs1205_02220
TATTTGTGCTCTTGTGACGGTGAAGATGCTGACGTGGGGCTGGGGAGAGGGTTCGAGATTTTCCGGCAGATGGTGGAGGATAAGGTTGTGCCGAATGAGGCCACGTTTACCAATGCTGCA
>augustus_masked-Fvb4-1-processed-gene-167.11:2498:2618:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_10::augustus_masked-Fvb4-1-processed-gene-167.11:2498-2618||RAPiDGENOMICS_rs1205_02221
GTCGAATCTTTTTGATCCATTGCCAATCGATCAGAATACAAGTGGAGATTCGTCGGTTGAGTTATACAAAGGAGTGGTTGATGATTACAATTTTTATGAAGGCTCCATTCCTGAGGAGAT
>augustus_masked-Fvb4-1-processed-gene-167.11:2738:2858:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_12::augustus_masked-Fvb4-1-processed-gene-167.11:2738-2858||RAPiDGENOMICS_rs1205_02222
CACTGGAGAGGTCATTGGAGTGTTTGATAGATGCAAGAAGCTGCAGTATCTAAATTTGAGCTCAAATAAGCTGAGTGGGAAGCTTGATGGAAAACTACCAGTTCCTTGTATGACCATTTT
>augustus_masked-Fvb4-1-processed-gene-167.11:2978:3098:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_14::augustus_masked-Fvb4-1-processed-gene-167.11:2978-3098||RAPiDGENOMICS_rs1205_02223
TCTCTTTATTTGCAGAACTTATATTGACACCCATTTACCACTTTTTGGTGCTAGTTTCACATTGATTCACGATTTCAGTGGTAACAACTTCACTGGTCCAATCCAACACCTTCCTCTTGC
>augustus_masked-Fvb4-1-processed-gene-167.11:3278:3398:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_16::augustus_masked-Fvb4-1-processed-gene-167.11:3278-3398|2x||RAPiDGENOMICS_rs1205_02224
ACTGAGACTCTTGGATGCCTCTGGAAATCTCTTATTTGGGTCAATACCACCAGATCTTGGGGATGTGAAGTCTCTCGTCTTTCTCGACTTGAGCAGGAACCAGTTGCAGGGTGAAATTCC
>augustus_masked-Fvb4-1-processed-gene-167.11:3338:3458:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_17::augustus_masked-Fvb4-1-processed-gene-167.11:3338-3458||RAPiDGENOMICS_rs1205_02225
GGATGTGAAGTCTCTCGTCTTTCTCGACTTGAGCAGGAACCAGTTGCAGGGTGAAATTCCTACAGAACTCAGTAATTTGAGGTATCTCAAGTATCTGTCCTTGGCTGATAACAACTTTAC
>augustus_masked-Fvb4-1-processed-gene-167.11:360:480:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_4::augustus_masked-Fvb4-1-processed-gene-167.11:360-480||RAPiDGENOMICS_rs1205_02226
AGGCTGGCGGCGGCGTCGGCGGACCCGGAAATGGCGTTTGGTTTGGTGAAGCAGATGAAGGTGTTTGGGATTGAACCGAAGTTGAGGTCTTATGGGCCGGCATTGTTTGGGTTTTGTAAG
>augustus_masked-Fvb4-1-processed-gene-167.11:480:600:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_5::augustus_masked-Fvb4-1-processed-gene-167.11:480-600||RAPiDGENOMICS_rs1205_02227
AAGGGGGAGGCTGAGAGGGCGTATGAGGTTGATGCACACATGGTGGAGTGTGGGGTGGTGGCTGAGGAGGCGGAGATTGCAGCATTGTTGAAGATTAGTTCGGAGATGGGGAAGGGGGAG
>augustus_masked-Fvb4-1-processed-gene-167.11:600:720:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_6::augustus_masked-Fvb4-1-processed-gene-167.11:600-720||RAPiDGENOMICS_rs1205_02228
AAGGTTTATGAGATGATGCAGAGGTTGAGGAGTGGGGTGAGGCAGGTCGGGGAGAGTACTGCTGAGGTGGTTGAGGAGTGGTTTAAGTCGGAGGAGGCGGGGAGAGTTGGGGTGGAGAGG
>augustus_masked-Fvb4-1-processed-gene-167.11:975:1095:Parent=augustus_masked-Fvb4-1-processed-gene-167.11-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-167.11:975-1095||RAPiDGENOMICS_rs1205_02229
CTGAATACTGTTGTGAATCGATTACAAAAAATGAGTCCAGCAAACAGATTGCCACTTGTTTTATTACACAAAAGTCGTACGATTGGTGGCCCTGCTCAGAATCCTAAGAACAAGGCATTG
>augustus_masked-Fvb4-1-processed-gene-180.2:0:120:Parent=augustus_masked-Fvb4-1-processed-gene-180.2-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-180.2:0-120||RAPiDGENOMICS_rs1205_02230
ATGGGGGCATGCTTAGGCAGTGAGTTAGATTCTTCTTTGCTTAGTTTAACTTACTTGAATTACTTGGACCTCAGTTACAACAATTTTCAAGGAATTGCTATTCCAAGTTTCCTAGGTCCA
>augustus_masked-Fvb4-1-processed-gene-180.2:120:240:Parent=augustus_masked-Fvb4-1-processed-gene-180.2-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-180.2:120-240||RAPiDGENOMICS_rs1205_02231
CTCAAGAAATTGAGGTATCTTGACCTCTCCCAATCATCATTTGGAGGAATGGTTCCTCCTCAACTAGGGAATCTGTCAAACTTGTTTTACCTTGATCTGACCACATACTCAAATCCACAA
>augustus_masked-Fvb4-1-processed-gene-180.2:180:300:Parent=augustus_masked-Fvb4-1-processed-gene-180.2-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-180.2:180-300|2x||RAPiDGENOMICS_rs1205_02232
CAACTAGGGAATCTGTCAAACTTGTTTTACCTTGATCTGACCACATACTCAAATCCACAAAATCTTGATCTGACCACATACTCATATCCACAACATCCATGGGTTTCAGATTTTTATTGG
>augustus_masked-Fvb4-1-processed-gene-180.2:240:360:Parent=augustus_masked-Fvb4-1-processed-gene-180.2-mRNA-1_3::augustus_masked-Fvb4-1-processed-gene-180.2:240-360||RAPiDGENOMICS_rs1205_02233
AATCTTGATCTGACCACATACTCATATCCACAACATCCATGGGTTTCAGATTTTTATTGGCTCTCTAGTCTCTCTTCCTTGCAGTACCTGGCAACAACCAATTGGTTACCTGCTGTTAAT
>augustus_masked-Fvb4-1-processed-gene-180.2:453:573:Parent=augustus_masked-Fvb4-1-processed-gene-180.2-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-180.2:453-573||RAPiDGENOMICS_rs1205_02234
CTGCATACACTTGATCTTGGAGGGAACAAGTTCTCAGAGACCATACCAACATGGATCAGAGAAGACCTACATCTATTTTCATATTTACTTCTTGGAGCCAACATGTTCACTGGAAATATT
>augustus_masked-Fvb4-1-processed-gene-180.2:513:633:Parent=augustus_masked-Fvb4-1-processed-gene-180.2-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-180.2:513-633|2x||RAPiDGENOMICS_rs1205_02235
GAAGACCTACATCTATTTTCATATTTACTTCTTGGAGCCAACATGTTCACTGGAAATATTCCTCAGCAAATATGTGGCCTCCCAGATGTTCAAGTTTTAAACCTTTCTCAAAATATATTA
>augustus_masked-Fvb4-1-processed-gene-180.2:60:180:Parent=augustus_masked-Fvb4-1-processed-gene-180.2-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-180.2:60-180|2x||RAPiDGENOMICS_rs1205_02236
TACTTGGACCTCAGTTACAACAATTTTCAAGGAATTGCTATTCCAAGTTTCCTAGGTCCACTCAAGAAATTGAGGTATCTTGACCTCTCCCAATCATCATTTGGAGGAATGGTTCCTCCT
>augustus_masked-Fvb4-1-processed-gene-180.2:658:778:Parent=augustus_masked-Fvb4-1-processed-gene-180.2-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-180.2:658-778||RAPiDGENOMICS_rs1205_02237
GAAAGATACCACAAGGCTTTGGAAGCTTAGACAAGTTAGAAACTCTTGACCTATCGGTTAATCATCTTCGGGGCCCAATTCCCATAAGCATGACTTCTATGACTGCACTGAACAACTTGA
>augustus_masked-Fvb4-1-processed-gene-180.2:898:1018:Parent=augustus_masked-Fvb4-1-processed-gene-180.2-mRNA-1_3::augustus_masked-Fvb4-1-processed-gene-180.2:898-1018||RAPiDGENOMICS_rs1205_02238
GCTCAACATCCAATAATGAGGATCCACAACCTAAAGAAGATGCAGTTGAAGATGAAGATGAGTCTGGAAAGATATGGTTCTACGTAAGCACTGCGTTGGGATTCATAGTGGGATTTTGGG
>augustus_masked-Fvb4-1-processed-gene-199.15:1020:1140:Parent=augustus_masked-Fvb4-1-processed-gene-199.15-mRNA-1_9::augustus_masked-Fvb4-1-processed-gene-199.15:1020-1140|2x||RAPiDGENOMICS_rs1205_02239
AATCTTCCCACTTGCCGGCATTTGAATAATATAAATCTTGCCAGGAACAACTTGAGTGGCCAAATTCCTGACAGCTTCAAGGACTTTCATACTCTCAGTTACCTCTCACTTTCAAATGCC
>augustus_masked-Fvb4-1-processed-gene-199.15:1200:1320:Parent=augustus_masked-Fvb4-1-processed-gene-199.15-mRNA-1_11::augustus_masked-Fvb4-1-processed-gene-199.15:1200-1320||RAPiDGENOMICS_rs1205_02240
TTGGTTCTCACCATGAACTTCTATGGTGAAGATTTGCCAGCTGATCCAAACCTTCATTTTCCAAGGTTGAAGGTATTTATTCTTGCAAATTCTCGGCTCACGGGTTCAATACCCCAATGG
>augustus_masked-Fvb4-1-processed-gene-199.15:1440:1560:Parent=augustus_masked-Fvb4-1-processed-gene-199.15-mRNA-1_13::augustus_masked-Fvb4-1-processed-gene-199.15:1440-1560||RAPiDGENOMICS_rs1205_02241
TTTACTGGGGAGATCCCGAGAAGCTTAACTGGACTACAGAGCCTCATTGATGGGAATTTTTCCTCATTTCCGGAACCTTCCCCTGATTTTCCTCTTTTCCAGAAGAAGAATGTAAGTGCA
>augustus_masked-Fvb4-1-processed-gene-199.15:1500:1620:Parent=augustus_masked-Fvb4-1-processed-gene-199.15-mRNA-1_13::augustus_masked-Fvb4-1-processed-gene-199.15:1500-1620|2x||RAPiDGENOMICS_rs1205_02242
TCCTCATTTCCGGAACCTTCCCCTGATTTTCCTCTTTTCCAGAAGAAGAATGTAAGTGCAAGGGGATTGCAGTACAATCAAGTTTGGAGCTTTCCACCAACGCTGGAACTTAGCAACAAT
>augustus_masked-Fvb4-1-processed-gene-199.15:1620:1740:Parent=augustus_masked-Fvb4-1-processed-gene-199.15-mRNA-1_14::augustus_masked-Fvb4-1-processed-gene-199.15:1620-1740|2x||RAPiDGENOMICS_rs1205_02243
AATTTCAGTGGACAGATCTGGCCAGAATTTGGGAACCTGAAATCCCTTCATGTATTGGATCTGAAGTGCAACAATTTATCTGGACCAATTCCAAGTTCTCTTTCTAATATGGTCAGCTTA
>augustus_masked-Fvb4-1-processed-gene-199.15:1680:1800:Parent=augustus_masked-Fvb4-1-processed-gene-199.15-mRNA-1_15::augustus_masked-Fvb4-1-processed-gene-199.15:1680-1800||RAPiDGENOMICS_rs1205_02244
CTGAAGTGCAACAATTTATCTGGACCAATTCCAAGTTCTCTTTCTAATATGGTCAGCTTAGAGACTTTGGATTTGTCTCATAACAAGCTTTCAGGGATAATACCCAGTTCATTGATTCGC
>augustus_masked-Fvb4-1-processed-gene-199.15:180:300:Parent=augustus_masked-Fvb4-1-processed-gene-199.15-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-199.15:180-300|2x||RAPiDGENOMICS_rs1205_02245
AAATGGGCAGGTATTACTTGCAACTCTTCCTTCTATCTTGGATTGGATGATTCTGTTGATAGTTATAGAGTGGTTGAGTTGGATCTTTCGAGTAGGAGACTATATGGGAACCTTTCTGAA
>augustus_masked-Fvb4-1-processed-gene-199.15:240:360:Parent=augustus_masked-Fvb4-1-processed-gene-199.15-mRNA-1_3::augustus_masked-Fvb4-1-processed-gene-199.15:240-360||RAPiDGENOMICS_rs1205_02246
AGTTATAGAGTGGTTGAGTTGGATCTTTCGAGTAGGAGACTATATGGGAACCTTTCTGAATCTTTGGGGAATTTGGAACAACTTAGAGCCCTCAATCTTTCTCACAATTTCCTTAAAAAA
>augustus_masked-Fvb4-1-processed-gene-199.15:60:180:Parent=augustus_masked-Fvb4-1-processed-gene-199.15-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-199.15:60-180|2x||RAPiDGENOMICS_rs1205_02247
GTTTTGAGCTCTCAGAACCTGACCTGCAATCTCAATGATTTGAATGCATTGGAAGGTTTCATGGGTGGTCTGCAGAGTACCCTTGGTAATTGGGGCAGGAATTTCTCTGATGATTGCTGT
>augustus_masked-Fvb4-1-processed-gene-199.15:720:840:Parent=augustus_masked-Fvb4-1-processed-gene-199.15-mRNA-1_7::augustus_masked-Fvb4-1-processed-gene-199.15:720-840||RAPiDGENOMICS_rs1205_02248
CCGCTGAGCAAAGAAGTTGGTAACCTGATCAACCTTACTCGGTTGGATATATCAACTAATTGGTTTTCAGGGACCATTCCGGACGTCTTCCACAGCCTCCGGAGGTTACAGTGTTTTGTT
>augustus_masked-Fvb4-1-processed-gene-199.15:960:1080:Parent=augustus_masked-Fvb4-1-processed-gene-199.15-mRNA-1_9::augustus_masked-Fvb4-1-processed-gene-199.15:960-1080||RAPiDGENOMICS_rs1205_02249
ATGACAAGTTTGGTCTCTCTTGATCTAGGTTCAAATCAGTTTGTTGGGGTTATTCCATCTAATCTTCCCACTTGCCGGCATTTGAATAATATAAATCTTGCCAGGAACAACTTGAGTGGC
>augustus_masked-Fvb4-1-processed-gene-31.4:0:120:Parent=augustus_masked-Fvb4-1-processed-gene-31.4-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-31.4:0-120||RAPiDGENOMICS_rs1205_02250
ATGTCCACATTACACTACTTGAATTTGAGCAACAACTACTTCAAAGACAAAATCCCATTTCAGTTAGGAAATTTGGTCCACCTGTCCCAGCTAGACTTGAGTCATAATTTACTCGAGGGT
>augustus_masked-Fvb4-1-processed-gene-31.4:240:360:Parent=augustus_masked-Fvb4-1-processed-gene-31.4-mRNA-1_3::augustus_masked-Fvb4-1-processed-gene-31.4:240-360||RAPiDGENOMICS_rs1205_02251
ATATCCTACAATCAGTTGCAGGGTCCGGTTCCCAACAACAAAGCATTTCAAGATGCTGTCTTTGAAGGAAATGAAGGATTGTGTGGTAACGTTACTAGACTTCGACCCTGCAATAATCCC
>augustus_masked-Fvb4-1-processed-gene-31.4:360:480:Parent=augustus_masked-Fvb4-1-processed-gene-31.4-mRNA-1_4::augustus_masked-Fvb4-1-processed-gene-31.4:360-480||RAPiDGENOMICS_rs1205_02252
TCCATGGAAATTGAGCATGCCTCAAAAACAGATCAAAGTCTCGTGTTTTTGATTGCTTTCCCTGTTTTGGGAACAGTTTTACTTTTGCTTGCCTTCGGTGGAATGGCCTTGGTTAGAAAA
>augustus_masked-Fvb4-1-processed-gene-31.4:480:600:Parent=augustus_masked-Fvb4-1-processed-gene-31.4-mRNA-1_5::augustus_masked-Fvb4-1-processed-gene-31.4:480-600||RAPiDGENOMICS_rs1205_02253
ACCAGACAAAAAGAGCAGGACACAGAGCAGAGCAATGTGCAGCATGTAGTTGTTTTTTCCATATCTAAATTTGATGGAAGAAGAATGTATGATGAAATCATCAAGGCAACTAATGACTTT
>augustus_masked-Fvb4-1-processed-gene-31.4:706:826:Parent=augustus_masked-Fvb4-1-processed-gene-31.4-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-31.4:706-826||RAPiDGENOMICS_rs1205_02254
AGAATGGTAGCTTGGCTTCAATCTTGAGCAAAGAATATGAAGCTAAGAAATTGGAGTGGAGCACAAGGGTGAGGATTGTGAAAGGTGTAGCTCATGCCTTATCTTATATGCATCATGATT
>augustus_masked-Fvb4-1-processed-gene-31.4:826:946:Parent=augustus_masked-Fvb4-1-processed-gene-31.4-mRNA-1_2::augustus_masked-Fvb4-1-processed-gene-31.4:826-946||RAPiDGENOMICS_rs1205_02255
ACTCTCCACCTATTGTGCATCGAGACATATCAAGCAACAAGATTTTGCTCGACTACGAATATGAGCCTTGTGTTTCAGACTTTGGCACAGCAAAGTTTTTAAACCCAGACTCATCGAATT
>augustus_masked-Fvb4-1-processed-gene-72.5:354:474:Parent=augustus_masked-Fvb4-1-processed-gene-72.5-mRNA-1_1::augustus_masked-Fvb4-1-processed-gene-72.5:354-474||RAPiDGENOMICS_rs1205_02256
CAGCAGCCACCCAGAACTGATATTCTCACCGGACAGTCCAACTGGAAACTCCGAGTCATTCAGAACCTCTACCCTGCCCTCAGCCGTGACGTCACTCTTCCTCCTGCGGATGAGACCCCT
>augustus_masked-Fvb4-2-processed-gene-1.3:0:120:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-1.3:0-120||RAPiDGENOMICS_rs1205_02257
ATGCCACTTGTTCTGAGTCTCACTTCCCTGAGATGGCTACTTCTGCTTCTTCTGCTCATATCTTCCTCGTCCTCATCTCTGCCGCGGCGGAGAGAAGAAGAAGCGGCAGCAGGTGTGTGC
>augustus_masked-Fvb4-2-processed-gene-1.3:1140:1260:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_10::augustus_masked-Fvb4-2-processed-gene-1.3:1140-1260|2x||RAPiDGENOMICS_rs1205_02258
CTAGATTTGTCCCATAATCAATTTACTGATGGGATTTCAAAGCTCAACCTCATCAGCATGTCAAGCTTGCAGAGCCTTAAGCTCTCAAACAACCAACTCAAGTTTGACATTTCAGAAATC
>augustus_masked-Fvb4-2-processed-gene-1.3:1200:1320:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_11::augustus_masked-Fvb4-2-processed-gene-1.3:1200-1320||RAPiDGENOMICS_rs1205_02259
TCAAGCTTGCAGAGCCTTAAGCTCTCAAACAACCAACTCAAGTTTGACATTTCAGAAATCAAATTGCCAGACACCATATCTTTGGTTGATTTACACTCAAATCACCTTGTTGGATCTATC
>augustus_masked-Fvb4-2-processed-gene-1.3:1320:1440:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_12::augustus_masked-Fvb4-2-processed-gene-1.3:1320-1440||RAPiDGENOMICS_rs1205_02260
TCGAGGATGTTGAATAACAGGGAGAGCAGCTTTCACTTTTTGGAGGTTTTAGATGTGTCAAACAATCAAATTTCAGGTGGTATTCCAGAGTTCAGACAAGGCATGAGGCTCAAAGCAGTC
>augustus_masked-Fvb4-2-processed-gene-1.3:1440:1560:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_13::augustus_masked-Fvb4-2-processed-gene-1.3:1440-1560||RAPiDGENOMICS_rs1205_02261
AACATAGGAAGCAATAAAATTGCTGGTCACATCCCCATTTCAGTTTCAAACCTGATTCAACTCGAAAGGTTTGATATCTCGAGGAACCAGATAACAGGCACTATTCCCACAAGTTTGGGT
>augustus_masked-Fvb4-2-processed-gene-1.3:1500:1620:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_13::augustus_masked-Fvb4-2-processed-gene-1.3:1500-1620|2x||RAPiDGENOMICS_rs1205_02262
CTCGAAAGGTTTGATATCTCGAGGAACCAGATAACAGGCACTATTCCCACAAGTTTGGGTTTGTTGGGGAAACTTCAATGGCTTGACCTGTCCATAAATGGACTCACCGGAAAAATCCCA
>augustus_masked-Fvb4-2-processed-gene-1.3:1560:1680:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_14::augustus_masked-Fvb4-2-processed-gene-1.3:1560-1680||RAPiDGENOMICS_rs1205_02263
TTGTTGGGGAAACTTCAATGGCTTGACCTGTCCATAAATGGACTCACCGGAAAAATCCCAACGAGTTTATTGGGTGTTGAAGGTCTAAGACATGCAAGCTTCAGGGCAAATAAGTTGTGT
>augustus_masked-Fvb4-2-processed-gene-1.3:240:360:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-1.3:240-360||RAPiDGENOMICS_rs1205_02264
TGTGACCCAGCTGGGAGGGTTACTGTCTTGCAGTTGCAGAGGCCTGGGTACATGAAGGGTACTCTCTCCCCTTCTCTCGGCAATTTGAATTTCTTGCAGGTATTGGTCATCAGTGGCATG
>augustus_masked-Fvb4-2-processed-gene-1.3:300:420:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-1.3:300-420|2x||RAPiDGENOMICS_rs1205_02265
ACTCTCTCCCCTTCTCTCGGCAATTTGAATTTCTTGCAGGTATTGGTCATCAGTGGCATGAAACAAATCACAGGTCCAATTCCCGACACCTTCTCCAATCTTGCTCACCTCACCCAGTTG
>augustus_masked-Fvb4-2-processed-gene-1.3:360:480:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_4::augustus_masked-Fvb4-2-processed-gene-1.3:360-480||RAPiDGENOMICS_rs1205_02266
AAACAAATCACAGGTCCAATTCCCGACACCTTCTCCAATCTTGCTCACCTCACCCAGTTGGCCCTCGAGGACAATTCCCTCCAAGGATACATTCCTTCAGGTTTAGGCCGTTTGTCCTTC
>augustus_masked-Fvb4-2-processed-gene-1.3:420:540:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_4::augustus_masked-Fvb4-2-processed-gene-1.3:420-540|2x||RAPiDGENOMICS_rs1205_02267
GCCCTCGAGGACAATTCCCTCCAAGGATACATTCCTTCAGGTTTAGGCCGTTTGTCCTTCCTCCAGAGCCTCACACTCGCTGGCAACCGATTCAAGGGCCACATTCCCCCAAGCCTAGCG
>augustus_masked-Fvb4-2-processed-gene-1.3:480:600:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_5::augustus_masked-Fvb4-2-processed-gene-1.3:480-600||RAPiDGENOMICS_rs1205_02268
CTCCAGAGCCTCACACTCGCTGGCAACCGATTCAAGGGCCACATTCCCCCAAGCCTAGCGACTCTAACCAATCTTGTCCAACTCAACTTAGCAAGAAATTTGCTCACAGGTCCAATTCCA
>augustus_masked-Fvb4-2-processed-gene-1.3:540:660:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_5::augustus_masked-Fvb4-2-processed-gene-1.3:540-660|2x||RAPiDGENOMICS_rs1205_02269
ACTCTAACCAATCTTGTCCAACTCAACTTAGCAAGAAATTTGCTCACAGGTCCAATTCCACCCACTTTCCAAAACTTTCATGCCCTGCAGTATCTTGATCTCAGCTTCAATTTGTTATCT
>augustus_masked-Fvb4-2-processed-gene-1.3:600:720:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_6::augustus_masked-Fvb4-2-processed-gene-1.3:600-720||RAPiDGENOMICS_rs1205_02270
CCCACTTTCCAAAACTTTCATGCCCTGCAGTATCTTGATCTCAGCTTCAATTTGTTATCTGGGCTCATTCCAAGCTTTGTAGGGCAGCATCTGCACAACCTTACCTTCATTGACATCTCC
>augustus_masked-Fvb4-2-processed-gene-1.3:720:840:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_7::augustus_masked-Fvb4-2-processed-gene-1.3:720-840||RAPiDGENOMICS_rs1205_02271
AATAACCAATTTTCTGGTCGAATGCCTGTTTCCCTCTTCAGTTTGCCCAACCTTTTGGACTTGTCCTTGGGCCATAACCAACTGACAGGGAACATTCCTGTCCAGGTTGGCGGCCTCAAA
>augustus_masked-Fvb4-2-processed-gene-1.3:780:900:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_7::augustus_masked-Fvb4-2-processed-gene-1.3:780-900|2x||RAPiDGENOMICS_rs1205_02272
TTGTCCTTGGGCCATAACCAACTGACAGGGAACATTCCTGTCCAGGTTGGCGGCCTCAAATCCCTTACTAGTCTTTCCTTGAGCAATAACCGACTTAACGGTCATATTCCAGCATCCATT
>augustus_masked-Fvb4-2-processed-gene-1.3:900:1020:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_8::augustus_masked-Fvb4-2-processed-gene-1.3:900-1020|2x||RAPiDGENOMICS_rs1205_02273
TCAAATTTGCAGAACATTTGGTACCTCAACTTATCCAGAAATGGGTTTACAAGTCCTTTGCCAGAGACTTCTGCTAGGGGATTCCCTTCTCTGTTGTCAATAGACCTTTCTTACAACAAT
>augustus_masked-Fvb4-2-processed-gene-1.3:960:1080:Parent=augustus_masked-Fvb4-2-processed-gene-1.3-mRNA-1_9::augustus_masked-Fvb4-2-processed-gene-1.3:960-1080||RAPiDGENOMICS_rs1205_02274
CCAGAGACTTCTGCTAGGGGATTCCCTTCTCTGTTGTCAATAGACCTTTCTTACAACAATCTCAGTCTAGGCACTGTTCCGGATTGGATCAGAAGCCGGCAACTTAGAGATGTTCATCTT
>augustus_masked-Fvb4-2-processed-gene-101.1:1080:1200:Parent=augustus_masked-Fvb4-2-processed-gene-101.1-mRNA-1_10::augustus_masked-Fvb4-2-processed-gene-101.1:1080-1200||RAPiDGENOMICS_rs1205_02275
AAAGTCCCTCATGATCTGCTGCCCAAGTTAAGACGTTTACGAGTGCTATCTTTCGGTGCATGTCGTATTACAGAATTGCCTGAACTTGGCAATTTAAAGCATCTTCGCTATTTGGACCTT
>augustus_masked-Fvb4-2-processed-gene-101.1:240:360:Parent=augustus_masked-Fvb4-2-processed-gene-101.1-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-101.1:240-360||RAPiDGENOMICS_rs1205_02276
GTTTGGAGCGAAATAAATCATGATTGGGATCTCTTGTGGATGCCTTTGGAAGTAGGGAAAAGTGGAAGTAAGATAATAGTCACGACACGGAATAGTGATGTTGCCTCGAGCATGGGGACT
>augustus_masked-Fvb4-2-processed-gene-101.1:60:180:Parent=augustus_masked-Fvb4-2-processed-gene-101.1-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-101.1:60-180|2x||RAPiDGENOMICS_rs1205_02277
AGGCGCTTTGATTTGAAAGTTTGGATATTTGTATCTAGTCACTTTGATCCAATGAGGGTCACAAAAACAATGCTTTGGTCAGTCCATTCGGAAAAAGTTTATATTGATGACTTGAATTTG
>augustus_masked-Fvb4-2-processed-gene-101.1:600:720:Parent=augustus_masked-Fvb4-2-processed-gene-101.1-mRNA-1_6::augustus_masked-Fvb4-2-processed-gene-101.1:600-720||RAPiDGENOMICS_rs1205_02278
GAAAGTAACATACTTCAAACTTTAAGCCTAAGTTATCATCACCTTCCTGCTCATTTGAAGCCTTGTTTTGCATACTTTTCCATTTTCCCAAGAGAATTTGAGCTGGACAAGGATTCACTT
>augustus_masked-Fvb4-2-processed-gene-101.1:660:780:Parent=augustus_masked-Fvb4-2-processed-gene-101.1-mRNA-1_6::augustus_masked-Fvb4-2-processed-gene-101.1:660-780|2x||RAPiDGENOMICS_rs1205_02279
CCTTGTTTTGCATACTTTTCCATTTTCCCAAGAGAATTTGAGCTGGACAAGGATTCACTTGTTTTATTATGGATGGCAGAAGGTTTCCTTCAACCTAGAGGAAATAAAAAGTTGGAAGCT
>augustus_masked-Fvb4-2-processed-gene-101.1:840:960:Parent=augustus_masked-Fvb4-2-processed-gene-101.1-mRNA-1_8::augustus_masked-Fvb4-2-processed-gene-101.1:840-960||RAPiDGENOMICS_rs1205_02280
AACAGATCACGATATATAATGCACAGCCTCATGCAAGAGCTAGCTCACTTTGTTTCTGGAGAATTCTGTGTTGAGGATGGTAATGAACACAAAGCTTTTGAGAAGGCTCGTCATTCTTCC
>augustus_masked-Fvb4-2-processed-gene-101.1:960:1080:Parent=augustus_masked-Fvb4-2-processed-gene-101.1-mRNA-1_9::augustus_masked-Fvb4-2-processed-gene-101.1:960-1080||RAPiDGENOMICS_rs1205_02281
TATATTCGTCGTCAACGTGAGGTAACAAAAAGGTTTGAGTTCTTCAGCAGACTTGAGCGCTTACGTACCTTCCTTCCATTGGATTCAACAGATGGAATTGGTGTAAGCTATTTGGCTAAG
>augustus_masked-Fvb4-2-processed-gene-107.10:1080:1200:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_10::augustus_masked-Fvb4-2-processed-gene-107.10:1080-1200||RAPiDGENOMICS_rs1205_02282
GCGCCAATAGGAAGAAGAATTGTGAAGAAATGCGGAGGTGTTCCGCTTGCTATAAGGACTCTAGGAAGCATGATGAGATATAAAGCTAATGAAATCGAGTGGATTGCGATTCAAAATACA
>augustus_masked-Fvb4-2-processed-gene-107.10:120:240:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-107.10:120-240||RAPiDGENOMICS_rs1205_02283
ACCCTCTCCACCATCAAAGCTGTGCTCTTGGATGCAGAGGAGAAGCAAGAGAAGAGCCATCTGGTGCAGGACTGGATCAGGAAGCTCAACGAGGTTGTGTATGAGGCAGATGACTTGTTG
>augustus_masked-Fvb4-2-processed-gene-107.10:1440:1560:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_13::augustus_masked-Fvb4-2-processed-gene-107.10:1440-1560||RAPiDGENOMICS_rs1205_02284
AGATCATTATTTCAAGAGATCAAGAAAGATGCCAATGGAATTTTAATTAGTTGTCATATGCATGACCTCATACACGATCTTTCTCGGGCAGTTGCAGGATCTGAATTCTCAGTTTGCAGT
>augustus_masked-Fvb4-2-processed-gene-107.10:1560:1680:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_14::augustus_masked-Fvb4-2-processed-gene-107.10:1560-1680||RAPiDGENOMICS_rs1205_02285
GTGGATGTTGGAGATATATCTGAAAGAGTTCATCATCTTTCATTTAGTTGTTATTTGCCTTCTTCATGGGAAGTTCCGATAGCATTGCTCAAAGCAAAGAAGACTAGAACATTTATGCTA
>augustus_masked-Fvb4-2-processed-gene-107.10:1680:1800:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_15::augustus_masked-Fvb4-2-processed-gene-107.10:1680-1800||RAPiDGENOMICS_rs1205_02286
CCACTTCAGGATCAAGCATATAAAATTTCCAGTCACAATTCAATCATTTCAAACTTGAGGTGCTTACGTGTGTTAGATCTACATAACCTAAGAATCAATGAGCTTTCAAATTCCGTAGGC
>augustus_masked-Fvb4-2-processed-gene-107.10:1800:1920:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_16::augustus_masked-Fvb4-2-processed-gene-107.10:1800-1920||RAPiDGENOMICS_rs1205_02287
AAGTTGACCCATCTTAGGTACCTTGACCTCTCTGGTAATGTTAGTATGACAGCACTCCCTGCTTCTATAAGCAATCTGCAGAATCTGCAGACGCTTAAACTCAACAGGTGCTACAGACTT
>augustus_masked-Fvb4-2-processed-gene-107.10:1920:2040:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_17::augustus_masked-Fvb4-2-processed-gene-107.10:1920-2040||RAPiDGENOMICS_rs1205_02288
GAACAACTACCTAGAGATATTGGAAAGATGACCAGCCTTAGACATCTTGAGATCACTGGGTGCCGCAAATTGAATCACATGCCACTTGGGATGGGAAACTTGGTATCTCTTCAAACATTA
>augustus_masked-Fvb4-2-processed-gene-107.10:2160:2280:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_19::augustus_masked-Fvb4-2-processed-gene-107.10:2160-2280||RAPiDGENOMICS_rs1205_02289
AATGGTACAGTAGGTTCAAAGAGTTCAAATTTGAGCAGCAAGCAGTACCTAGAATCCTTAAAACTAATTTGGTCCAGAGACGACAACAGTGGAAATAATGAAGATGACATGGTGTTGGAA
>augustus_masked-Fvb4-2-processed-gene-107.10:2520:2640:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_22::augustus_masked-Fvb4-2-processed-gene-107.10:2520-2640||RAPiDGENOMICS_rs1205_02290
TCTTCTAGTTTGGCTGGTGAAGGAAGAGAGCCTTTGTTTTTTCCATCATTGAAAGAGCTCACACTTTATGACTTGCCACTCTTGAAGCTGTGGCAAACATGCAATGATGAAGATGTGACA
>augustus_masked-Fvb4-2-processed-gene-107.10:2640:2760:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_23::augustus_masked-Fvb4-2-processed-gene-107.10:2640-2760||RAPiDGENOMICS_rs1205_02291
ACGACAATGCCAAATCGACAACTTTCATTTCCTTCCCTCACCAAATTGACAATCGTGGATGCCCCTAACTTAACATCCATGCCAATGCTTCCACTAGTTGAAGAATTGCTTATGGACACC
>augustus_masked-Fvb4-2-processed-gene-107.10:2760:2880:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_24::augustus_masked-Fvb4-2-processed-gene-107.10:2760-2880||RAPiDGENOMICS_rs1205_02292
ATCTCGACAAAGCTGTTGCACTCAATGTTGATGGCAGCAGCCTCAGAAAGACATACAAGCTCTTCCTCCCTGGCTAGATTGAAATTTTTGATCATCAAATCTTGCGATGATCTTGTGTCT
>augustus_masked-Fvb4-2-processed-gene-107.10:360:480:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_4::augustus_masked-Fvb4-2-processed-gene-107.10:360-480||RAPiDGENOMICS_rs1205_02293
GATGAGATTGCAGGGGATATTTCAAAGTTTAACTTCAGGGATAGGTCATTGATAATATCAGATATTGGGGTCGAGATCAATAATAGGAGAGAAGAGACGCATTCATTTGTGGTGGAATCA
>augustus_masked-Fvb4-2-processed-gene-107.10:420:540:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_4::augustus_masked-Fvb4-2-processed-gene-107.10:420-540|2x||RAPiDGENOMICS_rs1205_02294
GATATTGGGGTCGAGATCAATAATAGGAGAGAAGAGACGCATTCATTTGTGGTGGAATCAGCTGTGGTTGGAAGAAAGAGAGAGAAGGAGGAAATGGTGGAGTTCTTGACATGCCCGCCA
>augustus_masked-Fvb4-2-processed-gene-107.10:780:900:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_7::augustus_masked-Fvb4-2-processed-gene-107.10:780-900|2x||RAPiDGENOMICS_rs1205_02295
AAACTGTTGATGGAGGAGTTGCAGATTCTTCTTCGGAAGAAATTGGATGGGAAGCGCTACCTTCTTGTTCTGGATGATGTGTGGAATGTGAACCGAGAAAGCTGGCTTCAGCTGAATGAT
>augustus_masked-Fvb4-2-processed-gene-107.10:840:960:Parent=augustus_masked-Fvb4-2-processed-gene-107.10-mRNA-1_8::augustus_masked-Fvb4-2-processed-gene-107.10:840-960||RAPiDGENOMICS_rs1205_02296
CTTCTTGTTCTGGATGATGTGTGGAATGTGAACCGAGAAAGCTGGCTTCAGCTGAATGATTTGTTGAAAGGTGGTGCCAATGGGACTAAGGTTGTTGTGACAACTCGTAGCACGAAAGTT
>augustus_masked-Fvb4-2-processed-gene-112.1:0:120:Parent=augustus_masked-Fvb4-2-processed-gene-112.1-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-112.1:0-120||RAPiDGENOMICS_rs1205_02297
ATGAGGTTGGAGCGGAGGGGGTGCCAGCGGGAGGGGAAGGATCGGACGGTGAGGGAGGTGCGGAGGAGGAGGGAAAGGTTATGGGGTGTGTCTGACACGAGGGTGGAGAAAAGTGAAGCG
>augustus_masked-Fvb4-2-processed-gene-112.1:545:665:Parent=augustus_masked-Fvb4-2-processed-gene-112.1-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-112.1:545-665||RAPiDGENOMICS_rs1205_02298
GCGAAAAATTGCAAAGAAGTGTCAGAAACTTAATGAAATGATCAAAGCCATACCAGTGAGGAATCAAAGATATGGTGTTGGCCATCTAGGAGGAGCAGCTACATCTGAAGATATTCATAA
>augustus_masked-Fvb4-2-processed-gene-112.1:665:785:Parent=augustus_masked-Fvb4-2-processed-gene-112.1-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-112.1:665-785||RAPiDGENOMICS_rs1205_02299
ATTGGTGCAGAACCAAGCAGAGTCCTCTATATTCATTATGGAAGACGAACTGGTTGGGATTGAAGGCAAGAAGCAAATACTAATGGGATGGCGGCTCATGGATAAAGAGCAACACCAAAC
>augustus_masked-Fvb4-2-processed-gene-158.1:1080:1200:Parent=augustus_masked-Fvb4-2-processed-gene-158.1-mRNA-1_10::augustus_masked-Fvb4-2-processed-gene-158.1:1080-1200||RAPiDGENOMICS_rs1205_02300
GCGCAATTTGCTCAAGCAGCGCAGAGAATCCGGGGCAGTCTTTCATTCAACTGCCTGCGGTGTCCGGACAATGTTCCATTGTGCGAAGGCGGCCAAAGGAAAGTAGAAGAGTGTATTGGA
>augustus_masked-Fvb4-2-processed-gene-158.1:300:420:Parent=augustus_masked-Fvb4-2-processed-gene-158.1-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-158.1:300-420|2x||RAPiDGENOMICS_rs1205_02301
TCAGTAGTTGGTAACCTAACCGAGCTCACCTTCATCAACCTCAGAAAAAACAACTTTCGAGGACCAATACCCAGGTCCATTTCCAATCTAAAGAAGCTCACTAGACTTTCACTGGCCAAC
>augustus_masked-Fvb4-2-processed-gene-158.1:420:540:Parent=augustus_masked-Fvb4-2-processed-gene-158.1-mRNA-1_4::augustus_masked-Fvb4-2-processed-gene-158.1:420-540|2x||RAPiDGENOMICS_rs1205_02302
AATTTCTTCACCGGCACCATTCCCTTGGGATTCAACACACTCAAGAAGCTAGAGTCTCTAGACATTTCGTTCAATGAGCTCTCTGGAACAATTCATCCCAGCATAGGTGGACTCCGAGGC
>augustus_masked-Fvb4-2-processed-gene-158.1:540:660:Parent=augustus_masked-Fvb4-2-processed-gene-158.1-mRNA-1_5::augustus_masked-Fvb4-2-processed-gene-158.1:540-660|2x||RAPiDGENOMICS_rs1205_02303
TTGACATTCTTAAGCTTGTCCAACAATGGCTTCACTGGCAGAGTCCCAGACCTTTCGGGGTTATGGCAGCTCAAGACCTTAGATCTCAGCGGAAACCAGCTCCATGGAAATCTCCCAAAT
>augustus_masked-Fvb4-2-processed-gene-158.1:60:180:Parent=augustus_masked-Fvb4-2-processed-gene-158.1-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-158.1:60-180|2x||RAPiDGENOMICS_rs1205_02304
TTTACTAGTTCGCTAACCCTGGAATCCGATATTCAAGTTCTTCGTGTGGTGAAGCGTAGCATAGATCCCAACGCCATCCCCCCAAATTCCTATCTCAGTAGCTGGGACTTCAAACTCGAT
>augustus_masked-Fvb4-2-processed-gene-158.1:600:720:Parent=augustus_masked-Fvb4-2-processed-gene-158.1-mRNA-1_6::augustus_masked-Fvb4-2-processed-gene-158.1:600-720||RAPiDGENOMICS_rs1205_02305
TTATGGCAGCTCAAGACCTTAGATCTCAGCGGAAACCAGCTCCATGGAAATCTCCCAAATTTTCCAGTAAGCTTGAGAACACTGATTCTGAGCCAAAATCTGTTTTTAGGCCATCTTACA
>augustus_masked-Fvb4-2-processed-gene-223.0:0:120:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-223.0:0-120||RAPiDGENOMICS_rs1205_02306
ATGTACTTCCCTGATCTTGAATACATCGACCTCAGCTTGAATGAATTCTTTGATGTCATCCCGCCTCATATTAGGTTCCTCTCCAAACTGACCTATCTTGATCTATCTTTGGATCAGTTC
>augustus_masked-Fvb4-2-processed-gene-223.0:1052:1172:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-223.0:1052-1172||RAPiDGENOMICS_rs1205_02307
GAATCTTTCCCACAATAATCTTTCCGGTCGCATTCCGACAACTTTTGAACAAATGTTTAGCTTGATTCAAGTCTACATATCCTACAATCAGTTGCAGGGTCCGGTTCCCAACAACAAAGC
>augustus_masked-Fvb4-2-processed-gene-223.0:120:240:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-223.0:120-240||RAPiDGENOMICS_rs1205_02308
TCTGGGAAAATCCCACCAGAAATAGGTCTTCTAACAAATCTTGAGGTCCTGCACCTAAATGAAAACCAGTTAAATGGCTCAATTCCTCAAGAGATTAGTCGGCTCAAGTTTGTTTACGAG
>augustus_masked-Fvb4-2-processed-gene-223.0:1262:1382:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-223.0:1262-1382||RAPiDGENOMICS_rs1205_02309
TTTTACTCTTGCCTTCGGTGGAATAATGGCCTTGGTTAGAAAAACCAGACAAAAAGAGCAGGACACAGAGCAGAGCAATGTGCAACATGAAGTTGTTTTTTCCATATCTAAATTTGATGG
>augustus_masked-Fvb4-2-processed-gene-223.0:1382:1502:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-223.0:1382-1502||RAPiDGENOMICS_rs1205_02310
AAGAGGAATGTATGATGAAATCATCAAGGCAACTAATGACTTTGATGCTGTATGTTGCATCGGAAAGGGAGGATCCGGAAGTGTCTACAAGGCTAAGCTTCCATCAGGCGACATAGTGGC
>augustus_masked-Fvb4-2-processed-gene-223.0:1502:1622:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-223.0:1502-1622||RAPiDGENOMICS_rs1205_02311
GGTGAAGAAACTCCATCCAGTACTTGAAGGTGAGGGGACGTCTCGGATGGACTTCCATAACGAAATAAGGGCACTAGTAGAGATACGACACCGGAACATTGTGAAGCTTCGTGGTTTCTG
>augustus_masked-Fvb4-2-processed-gene-223.0:1622:1742:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_4::augustus_masked-Fvb4-2-processed-gene-223.0:1622-1742||RAPiDGENOMICS_rs1205_02312
CTCTCATGCCCGTCACTCATTTTTGGTTTATGACTACCTAGACAATGGTAGCTTGGCTTCAATCTTGAGCAAAGAATATGAAGCTAAGAAATTGGAGTGGAGCACAAGGGTGAGGATTGT
>augustus_masked-Fvb4-2-processed-gene-223.0:1742:1862:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_5::augustus_masked-Fvb4-2-processed-gene-223.0:1742-1862||RAPiDGENOMICS_rs1205_02313
GAAAGGTGTAGCTCATGCCTTATCTTATATGCATCATGATTGCTCTCCACCTATTGTGCATCGAGACATATCAAGCAACAACATTTTGCTCGACTACGAATATGAGCCTTGTGTTTCAGA
>augustus_masked-Fvb4-2-processed-gene-223.0:180:300:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-223.0:180-300|2x||RAPiDGENOMICS_rs1205_02314
GAAAACCAGTTAAATGGCTCAATTCCTCAAGAGATTAGTCGGCTCAAGTTTGTTTACGAGCTTGCTTTACATAACAACAGTCTAGAAGGCATGCTTCCAGCTTTTCTAGGTGATTTGAAC
>augustus_masked-Fvb4-2-processed-gene-223.0:1942:2062:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-223.0:1942-2062||RAPiDGENOMICS_rs1205_02315
AACTAGCATACACAATGAAGGTGACAGAGAAGTGTGATGTCTATAGCATTGGGATGCTGGTACTGGAAGTGATAATGGGAAAGCAGCTGGGTGATTTCATCTCTTCTTCCTCGTTTCCAT
>augustus_masked-Fvb4-2-processed-gene-223.0:2062:2182:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-223.0:2062-2182||RAPiDGENOMICS_rs1205_02316
CCACAGACGAAAACATATCGCTCACGGATATGCTCGACAAGCGCCTTCCCCCTCCTACACCTAATGTTGAGAAGGAATTGATGATAATTGCAAGGCTAGCAATAGAATGCAGACATTCTC
>augustus_masked-Fvb4-2-processed-gene-223.0:240:360:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-223.0:240-360||RAPiDGENOMICS_rs1205_02317
CTTGCTTTACATAACAACAGTCTAGAAGGCATGCTTCCAGCTTTTCTAGGTGATTTGAACAACCTGACTTCATTGTATCTCTATTCAAATCGACTTTCTGGTTCTATTCCTGCCTCTCTA
>augustus_masked-Fvb4-2-processed-gene-223.0:412:532:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-223.0:412-532||RAPiDGENOMICS_rs1205_02318
GAACCATTCCTAAAGAGATTGGGAACTTGAAATCACTAGGGGATTTAGAGTTGGGTGAGAATCAACTCATTGGTTCTATTCCCACTTCAATTGGTGGATTGAGTAACTTAGAGTTTTTAT
>augustus_masked-Fvb4-2-processed-gene-223.0:628:748:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-223.0:628-748||RAPiDGENOMICS_rs1205_02319
GAAATTTATACGAAGAATTTGGTGCCTATCCAAATCTTCTGTACATGGACCTAAGCCACAACAACTTCTACGGTGAAATCTCACCTGTCTGGGGACAATGTCCGCGGTTAGAAACTCTTC
>augustus_masked-Fvb4-2-processed-gene-223.0:748:868:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-223.0:748-868||RAPiDGENOMICS_rs1205_02320
TTCTGGCAAGAAACAACCTTTCTGGCAGCATCGCACCTGAGATTGGCAATGCAACACAAATACATGTACTCGATCTGTCGTCGAATCGTTTAGTTGGGGAGGTTCCAAATGAGATTGGGA
>augustus_masked-Fvb4-2-processed-gene-223.0:932:1052:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-223.0:932-1052||RAPiDGENOMICS_rs1205_02321
AGACAAAATCCCATTTCAGTTAGGAAATTTGGTCCACCTGTCCCAGCTAGACTTGAGTCATAATTTACTCGAGGGTAAGATACCATCAGAAATGAGCAAAATGCAAAGATTGGAGTATCT
>augustus_masked-Fvb4-2-processed-gene-223.0:992:1112:Parent=augustus_masked-Fvb4-2-processed-gene-223.0-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-223.0:992-1112|2x||RAPiDGENOMICS_rs1205_02322
TAATTTACTCGAGGGTAAGATACCATCAGAAATGAGCAAAATGCAAAGATTGGAGTATCTGAATCTTTCCCACAATAATCTTTCCGGTCGCATTCCGACAACTTTTGAACAAATGTTTAG
>augustus_masked-Fvb4-2-processed-gene-225.8:0:120:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-225.8:0-120||RAPiDGENOMICS_rs1205_02323
ATGGAGGTCCTGCTGAGCCTCAAGGCATTTATGCAACAACATAACAGGGTAAATCAAGGTCAATACTCAAAATGGAACCAGAGCAACAACCCATGTGAGTGGCCTAGAATATCATGTAAT
>augustus_masked-Fvb4-2-processed-gene-225.8:1117:1237:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-225.8:1117-1237||RAPiDGENOMICS_rs1205_02324
ATATTGAGACAAATGTTGGTCCAACATTTGAATCAAACAATCAGGACAAGGATCGAATTGTAGCTGGATCCGGGGTGTGCTTAGAAATACAGAGATGGATTCCAGCAGACTACCCTCCAT
>augustus_masked-Fvb4-2-processed-gene-225.8:120:240:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-225.8:120-240||RAPiDGENOMICS_rs1205_02325
GATGAACAGATAGTCAGTGCAGTTGATCTCTCTGATAGCGAAATCTCCGGTGAGGTTTTCAGAAACTTCTCTGCCCTGACAGCGTTGTCATACCTTGACCTATCCATGAACACTTTGCAT
>augustus_masked-Fvb4-2-processed-gene-225.8:1237:1357:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_4::augustus_masked-Fvb4-2-processed-gene-225.8:1237-1357||RAPiDGENOMICS_rs1205_02326
TCAGCTTTTTGTATAAAATCCTCACAAGGAAGAGTTGTCAAAATATGCAGGATCAGCTCTTCAAGGGAAATGGTCTGTTTCCCGTATGTGTTGCTGGTTCTACAATGAGGACATTACAAA
>augustus_masked-Fvb4-2-processed-gene-225.8:1357:1477:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_5::augustus_masked-Fvb4-2-processed-gene-225.8:1357-1477||RAPiDGENOMICS_rs1205_02327
TCTCCGGTTACATTCAACTGAGTGGGAATCAACTTTCAGGTCAAGTCCCTCCAGAAATTGGTGAGATGCAAAATATTAGTATGTTGAATTTAGCTTTCAATAAATTTTATGGAGAACTCC
>augustus_masked-Fvb4-2-processed-gene-225.8:1477:1597:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_6::augustus_masked-Fvb4-2-processed-gene-225.8:1477-1597||RAPiDGENOMICS_rs1205_02328
CTGCAGAGATTGGACAAATGACACTAGTAGTGTTGAACCTCACTAAGAACAGTTTTTCCGGCCAAATACCAATGGAAATTGGAAACATGAAGTGCATGCAGCATCAGGATTTGTCTTATA
>augustus_masked-Fvb4-2-processed-gene-225.8:1609:1729:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-225.8:1609-1729||RAPiDGENOMICS_rs1205_02329
TGGGCAACTGGCAACATTTGACATACAGTCCTACCTTGGTGACCCAAAACATGAAGTGCATGCAGCATCAGGATTTGTCTTATAACAACTTTTCCGGTACCTTCCCTCCTTACTTAAACA
>augustus_masked-Fvb4-2-processed-gene-225.8:1729:1849:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-225.8:1729-1849||RAPiDGENOMICS_rs1205_02330
GCTTGACTGAGCTAAGCAAGTTTAACATCTCATACAATCCACTCATCTCTGGTGTAATTCCTTCCAGTGGGCAACTGGCAACATTTGACATACAGTCCTACCTTGGTGACCCCCTCCTCA
>augustus_masked-Fvb4-2-processed-gene-225.8:180:300:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-225.8:180-300|2x||RAPiDGENOMICS_rs1205_02331
AGAAACTTCTCTGCCCTGACAGCGTTGTCATACCTTGACCTATCCATGAACACTTTGCATGGAGTTATCCCAGAGGACCTGAGTCATTGCCAGAGCCTCAAATACCTCAACCTGTCACAT
>augustus_masked-Fvb4-2-processed-gene-225.8:1849:1969:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-225.8:1849-1969||RAPiDGENOMICS_rs1205_02332
TCCTTCCAAAATTCATCAACTCCAAAGATAATGGGGATACCCTTCCTAAGTTTATCGACAACTCCACAGATCATGAGGATGAGGTTATAAGAAATGGATTCTACAATAGCATGGGAGTTG
>augustus_masked-Fvb4-2-processed-gene-225.8:240:360:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-225.8:240-360||RAPiDGENOMICS_rs1205_02333
GGAGTTATCCCAGAGGACCTGAGTCATTGCCAGAGCCTCAAATACCTCAACCTGTCACATAACATTCTTGATGGTGAGCTGAAATTGCAAGGGTTAAATCAATTAGAGGTTCTTGATTTG
>augustus_masked-Fvb4-2-processed-gene-225.8:300:420:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-225.8:300-420|2x||RAPiDGENOMICS_rs1205_02334
AACATTCTTGATGGTGAGCTGAAATTGCAAGGGTTAAATCAATTAGAGGTTCTTGATTTGGCTGTAAACAGGTTTTATGGGGACATGAATATTAGCTTCCCTGGAATGTGCAAAAACTTG
>augustus_masked-Fvb4-2-processed-gene-225.8:360:480:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_4::augustus_masked-Fvb4-2-processed-gene-225.8:360-480||RAPiDGENOMICS_rs1205_02335
GCTGTAAACAGGTTTTATGGGGACATGAATATTAGCTTCCCTGGAATGTGCAAAAACTTGATAGTTGCAAATGTTTCATCTAATAACTTAACTGGTAGGATTGATCAGCACTTTGATGAA
>augustus_masked-Fvb4-2-processed-gene-225.8:542:662:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-225.8:542-662||RAPiDGENOMICS_rs1205_02336
TTGTAGCTTGGTGAATTTGGACCTGTCAGAAAATGAATTTTCTGGTGAAGTTGCAAAAGGGATATCAAATTGCCGGAATCTGGTTACATTGAATCTCGGGGGAAACAAATTTACAGGGCC
>augustus_masked-Fvb4-2-processed-gene-225.8:60:180:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-225.8:60-180|2x||RAPiDGENOMICS_rs1205_02337
CAATACTCAAAATGGAACCAGAGCAACAACCCATGTGAGTGGCCTAGAATATCATGTAATGATGAACAGATAGTCAGTGCAGTTGATCTCTCTGATAGCGAAATCTCCGGTGAGGTTTTC
>augustus_masked-Fvb4-2-processed-gene-225.8:602:722:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-225.8:602-722|2x||RAPiDGENOMICS_rs1205_02338
GATATCAAATTGCCGGAATCTGGTTACATTGAATCTCGGGGGAAACAAATTTACAGGGCCAATTCCATCTGAGATTGGAAGCATTTCGAGTCTGACATATTTGTTCTTGGAAAATAATAG
>augustus_masked-Fvb4-2-processed-gene-225.8:662:782:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-225.8:662-782||RAPiDGENOMICS_rs1205_02339
AATTCCATCTGAGATTGGAAGCATTTCGAGTCTGACATATTTGTTCTTGGAAAATAATAGTTTTTCTAGAGTGATCCCGGAATCCCTTTTGAATTTGAGCAGCTTGGTGTCTTTGGATTT
>augustus_masked-Fvb4-2-processed-gene-225.8:877:997:Parent=augustus_masked-Fvb4-2-processed-gene-225.8-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-225.8:877-997||RAPiDGENOMICS_rs1205_02340
TGGAACAATACCACGAGTATGGAAATTTGTCACACCTCCAAGCACTAGATCTTTCCTCCAACAGCCTATCTGGGCCAATACCTCCCACCATAGGAAACTTGAAATCTCTCATGTTTCTTA
>augustus_masked-Fvb4-2-processed-gene-258.8:0:120:Parent=augustus_masked-Fvb4-2-processed-gene-258.8-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-258.8:0-120||RAPiDGENOMICS_rs1205_02341
ATGTCTCGTCTCCTTCGTTGTCTCTCTTTCTTGCTCCTCTTCCTCTACATCTGCTACGCTGCTACTGCAGCTGGTGATGATGATCAAGACTCGCTCAAGTTTGAGAACCCAAGGATTGCC
>augustus_masked-Fvb4-2-processed-gene-258.8:1320:1440:Parent=augustus_masked-Fvb4-2-processed-gene-258.8-mRNA-1_12::augustus_masked-Fvb4-2-processed-gene-258.8:1320-1440||RAPiDGENOMICS_rs1205_02342
CCTCCACCACCTACTGAAAAAGTATCACCCCGGACTCATCTTCCTGTTCCACCACCCCCACCTACCCAAAAGGTATCACCAAGTACCCATCTAGCTCCACCTCCCCCTAGTTCGACCCAT
>augustus_masked-Fvb4-2-processed-gene-258.8:2040:2160:Parent=augustus_masked-Fvb4-2-processed-gene-258.8-mRNA-1_18::augustus_masked-Fvb4-2-processed-gene-258.8:2040-2160||RAPiDGENOMICS_rs1205_02343
GCTCCAATTTCGCCACCTCCCCCAAGCTATCACCACTCACCTCCTCAACATTGGCATCATCCACCACCACCATCATGGTCGCATCAACAATCTCCTCCACATGCTGAGCCCCCCAAGTTT
>augustus_masked-Fvb4-2-processed-gene-258.8:240:360:Parent=augustus_masked-Fvb4-2-processed-gene-258.8-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-258.8:240-360||RAPiDGENOMICS_rs1205_02344
CCCTCAGTCGGGCATGTGGTCGCCGGCATTGACCTCAACCACGCTGACATTGCTGGCTACCTGCCTCCTGAGCTAGGCCTCCTCTCCGACCTCGCTCTCTTCCACATCAACTCCAACCGC
>augustus_masked-Fvb4-2-processed-gene-258.8:300:420:Parent=augustus_masked-Fvb4-2-processed-gene-258.8-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-258.8:300-420|2x||RAPiDGENOMICS_rs1205_02345
CTGCCTCCTGAGCTAGGCCTCCTCTCCGACCTCGCTCTCTTCCACATCAACTCCAACCGCTTCTGCGGCGTAGTCCCCACCAGCTTTCGGCGACTGAAACTGCTCCACGAGCTGGATCTC
>augustus_masked-Fvb4-2-processed-gene-258.8:60:180:Parent=augustus_masked-Fvb4-2-processed-gene-258.8-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-258.8:60-180|2x||RAPiDGENOMICS_rs1205_02346
GCTACTGCAGCTGGTGATGATGATCAAGACTCGCTCAAGTTTGAGAACCCAAGGATTGCCAAGGCTTACACCACCCTCCAAGCATGGAAGTCGGCCATCTTCTCGGACCCTTTCAACTTC
>augustus_masked-Fvb4-2-processed-gene-258.8:780:900:Parent=augustus_masked-Fvb4-2-processed-gene-258.8-mRNA-1_7::augustus_masked-Fvb4-2-processed-gene-258.8:780-900|2x||RAPiDGENOMICS_rs1205_02347
TTCAACCATCTTCAAGGGCCTCTGCCCTCCGCCTCCATAGCCAAAATGAAGAGCTTGGAGGAGCTCGACGTCGCCCGTAACAGATTCACCGGTGTAATACCGGCCAGCATTTGTCAACTG
>augustus_masked-Fvb4-2-processed-gene-258.8:960:1080:Parent=augustus_masked-Fvb4-2-processed-gene-258.8-mRNA-1_9::augustus_masked-Fvb4-2-processed-gene-258.8:960-1080||RAPiDGENOMICS_rs1205_02348
ACCGCTACTCCTGTCTCTAATAATGGTACCAAGAACTGCATTCCTGGCAAATTGGATCAAAGATCTACGAGGGAATGTGCCTCCCCGGCTGCCCGTCCCGTGGACTGCAGCAAGCTCAAA
>augustus_masked-Fvb4-2-processed-gene-36.4:0:120:Parent=augustus_masked-Fvb4-2-processed-gene-36.4-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-36.4:0-120||RAPiDGENOMICS_rs1205_02349
ATGGAATCCCCAATTCCCGTCGAAATCCCTAAAACCTCCGGAGATCCAGAACCCTCCGATTCCGCATTGCAAGTCGTCGACGCCGGCAGCGACGTCGCCGGAGCTGACTCGATCCTCGAC
>augustus_masked-Fvb4-2-processed-gene-36.4:1200:1320:Parent=augustus_masked-Fvb4-2-processed-gene-36.4-mRNA-1_11::augustus_masked-Fvb4-2-processed-gene-36.4:1200-1320||RAPiDGENOMICS_rs1205_02350
TCAGAAATGTTAAAAGCCACTTCTGGATCCAAGAGGAAGGAGCATGTCGGGGATCTGAAGAAGCCGAATTGCAAGAATTTAAAGTCAGCTGGAATTAGTGGTGGTCATGCTGTTTCATTA
>augustus_masked-Fvb4-2-processed-gene-36.4:1320:1440:Parent=augustus_masked-Fvb4-2-processed-gene-36.4-mRNA-1_12::augustus_masked-Fvb4-2-processed-gene-36.4:1320-1440||RAPiDGENOMICS_rs1205_02351
GAGCAAGGTGATAAAAACAAATACGAGAATGAAGTACCCTCAGCTAGTCAAGAGGTTGTTGGAGAGAAAGATGAAGAAGCATCCCCTTTAGAAAAATCAGATCCTACTTCAGGATCCAAG
>augustus_masked-Fvb4-2-processed-gene-36.4:1440:1560:Parent=augustus_masked-Fvb4-2-processed-gene-36.4-mRNA-1_13::augustus_masked-Fvb4-2-processed-gene-36.4:1440-1560||RAPiDGENOMICS_rs1205_02352
AGGAAGAATTCAAATGGTGGTGAGGATGTTAAGCAGCCAGATTGCGAGAATGGTGATGGCAATGTTAAGCAGCCAGATGGCGAGAATGGCGATGGGGATGTTAAGCAGCCAGATTGCAAG
>augustus_masked-Fvb4-2-processed-gene-36.4:1560:1680:Parent=augustus_masked-Fvb4-2-processed-gene-36.4-mRNA-1_14::augustus_masked-Fvb4-2-processed-gene-36.4:1560-1680||RAPiDGENOMICS_rs1205_02353
GATGGTGTTGGGGAGAATAAGCAGCGCAAGAGATTACGTCTTGATCAAGTACATAGTCATGATTGTTCAAACATATCTAAAAAATTTAGTGATATGTCTTTTTGCAGTATTGAGGACAGT
>augustus_masked-Fvb4-2-processed-gene-36.4:2160:2280:Parent=augustus_masked-Fvb4-2-processed-gene-36.4-mRNA-1_19::augustus_masked-Fvb4-2-processed-gene-36.4:2160-2280||RAPiDGENOMICS_rs1205_02354
TATGGTGTTTGTAGACATAGAGCATTACTATTGAAGTATCTTTGTGATCGGATGGAGCCTCGAGTACCTTGTGAGCTTGTGAGGGGATACCTGGATTTCATGCCCCATGCTTGGAATGTG
>augustus_masked-Fvb4-2-processed-gene-36.4:3240:3360:Parent=augustus_masked-Fvb4-2-processed-gene-36.4-mRNA-1_28::augustus_masked-Fvb4-2-processed-gene-36.4:3240-3360||RAPiDGENOMICS_rs1205_02355
GAAGAGTTGGAGGCGCTTCTGCTAATTATGGACAAGCCAGCAGCTCGATCAGCTGCAGAGCTTGGGGGAACAGAGGCTGACTTAGACACACTAGCATTTCTTGCTGTCTTGTTCTGCAAA
>augustus_masked-Fvb4-2-processed-gene-36.4:360:480:Parent=augustus_masked-Fvb4-2-processed-gene-36.4-mRNA-1_4::augustus_masked-Fvb4-2-processed-gene-36.4:360-480||RAPiDGENOMICS_rs1205_02356
CACAAATTCAAGGGGCTGAAGGAGCTGGAGCTCTCCAAAGTCACGTCTCGGTGCTCGGCGGTTCCGATTCTGAGCCAGGTCGCCGGGCTGAAGCTTCTGACGAAGCTATCGGTATGTTAT
>augustus_masked-Fvb4-2-processed-gene-36.4:480:600:Parent=augustus_masked-Fvb4-2-processed-gene-36.4-mRNA-1_5::augustus_masked-Fvb4-2-processed-gene-36.4:480-600||RAPiDGENOMICS_rs1205_02357
TTCTCCATAACTTTTCTACCGCCGGAGATTTGCTGCTTGACGAGCTTGGAGTATCTGGACCTTTCGTTCAACAAGATGAAGACTTTGCCTGCAGAAATTGGGAATTTGAATGCTCTGGTT
>augustus_masked-Fvb4-2-processed-gene-36.4:600:720:Parent=augustus_masked-Fvb4-2-processed-gene-36.4-mRNA-1_6::augustus_masked-Fvb4-2-processed-gene-36.4:600-720||RAPiDGENOMICS_rs1205_02358
TCGTTGAGAGTTTCGAATAATAAACTGGAGGCATTGCCTGAGGAGTTGTCCAGATTGGCTGTGCTGGAGAGCCTGGACTTGTCGCATAATAGGCTGACGTCACTTGGGGATGTTGATTTC
>augustus_masked-Fvb4-2-processed-gene-36.4:660:780:Parent=augustus_masked-Fvb4-2-processed-gene-36.4-mRNA-1_6::augustus_masked-Fvb4-2-processed-gene-36.4:660-780|2x||RAPiDGENOMICS_rs1205_02359
GTGCTGGAGAGCCTGGACTTGTCGCATAATAGGCTGACGTCACTTGGGGATGTTGATTTCGGGTTGATGATTAGTCTCAAGAGTTTGAATCTCAAGTACAATAGGCTGAAGAGTGAGTGT
>augustus_masked-Fvb4-2-processed-gene-36.4:960:1080:Parent=augustus_masked-Fvb4-2-processed-gene-36.4-mRNA-1_9::augustus_masked-Fvb4-2-processed-gene-36.4:960-1080||RAPiDGENOMICS_rs1205_02360
CGGCGGAGAGGTCCAATGCTGATGCGTGTGAAGGAAGTTGGAGAAAGCAAAGCAGGAAATGTAGATGTTACTGATTCTGTAGTAGATGAGGATGAGGATGAGGCCGAAGGATGTCGAGAA
>augustus_masked-Fvb4-2-processed-gene-77.8:1008:1128:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-77.8:1008-1128||RAPiDGENOMICS_rs1205_02361
GGAGACTTCATCATCCAAGAAGGGGAGTTCTTGTATGGAGTCAGCGATCAAGTTGAGCTTGCACAAACTGAGCTACAGTTGATGCAGGGTTTCCTCAAAGATGCTGATGCAAGACAAGGA
>augustus_masked-Fvb4-2-processed-gene-77.8:1128:1248:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-77.8:1128-1248||RAPiDGENOMICS_rs1205_02362
GATGATGAAACTGTTCGTGTCTGGGTTGCGAAAATTAGAGATGCTGCTTATGATTTGGAAGATGTGGTTGAAATCTATGTGCTGAAAGTGGTGTCCAAGAGGGAAGGTGGTTTTAAGAGT
>augustus_masked-Fvb4-2-processed-gene-77.8:1248:1368:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_4::augustus_masked-Fvb4-2-processed-gene-77.8:1248-1368||RAPiDGENOMICS_rs1205_02363
ATAATTAAAAGGTTTGGTCGCATGTTCAAGGAAGGAGTTGATCTTCACAAAATTGGGTCGGAAATTCAGAACATTACAATCAATATTTCTACTTTGAGGTCTCGTTTGGAAGCTTACAAC
>augustus_masked-Fvb4-2-processed-gene-77.8:1428:1548:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_5::augustus_masked-Fvb4-2-processed-gene-77.8:1428-1548|2x||RAPiDGENOMICS_rs1205_02364
AGGCGGACATACTCTCATATCGTTGAACGTGATGTTGTTGGCCTGGAGCATAGCGTGAAAGAATTGGCCATGCATTTGGTCAGAAGTGGAGACAGCCATCGAGTTGTTTCTATTTGGGGA
>augustus_masked-Fvb4-2-processed-gene-77.8:1488:1608:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_6::augustus_masked-Fvb4-2-processed-gene-77.8:1488-1608||RAPiDGENOMICS_rs1205_02365
GAATTGGCCATGCATTTGGTCAGAAGTGGAGACAGCCATCGAGTTGTTTCTATTTGGGGAATGGGCGGTTTGGGGAAAACAACTCTTGCAAAACAGGTTTATCATGATAATGAAGTCAGA
>augustus_masked-Fvb4-2-processed-gene-77.8:1548:1668:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_6::augustus_masked-Fvb4-2-processed-gene-77.8:1548-1668|2x||RAPiDGENOMICS_rs1205_02366
ATGGGCGGTTTGGGGAAAACAACTCTTGCAAAACAGGTTTATCATGATAATGAAGTCAGACAACACTTTGATTGTTTTGCTTGGGTTTGTATATCTCAACGATGTCAAGTACGAGATGTT
>augustus_masked-Fvb4-2-processed-gene-77.8:1608:1728:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_7::augustus_masked-Fvb4-2-processed-gene-77.8:1608-1728||RAPiDGENOMICS_rs1205_02367
CAACACTTTGATTGTTTTGCTTGGGTTTGTATATCTCAACGATGTCAAGTACGAGATGTTTGGGAAGAAATCCTTGTCAAAGTTTCTGCTATGCATAGAACAGAGATTTCTCAAATGAAT
>augustus_masked-Fvb4-2-processed-gene-77.8:1668:1788:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_7::augustus_masked-Fvb4-2-processed-gene-77.8:1668-1788|2x||RAPiDGENOMICS_rs1205_02368
TGGGAAGAAATCCTTGTCAAAGTTTCTGCTATGCATAGAACAGAGATTTCTCAAATGAATAACGGAGAAATAGCCAAGAAGCTTCATCTTGTACAGCGAGAGAGTAGATGTTTTGTAGTA
>augustus_masked-Fvb4-2-processed-gene-77.8:1728:1848:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_8::augustus_masked-Fvb4-2-processed-gene-77.8:1728-1848||RAPiDGENOMICS_rs1205_02369
AACGGAGAAATAGCCAAGAAGCTTCATCTTGTACAGCGAGAGAGTAGATGTTTTGTAGTACTTGATGACATATGGAGTGTTGAGACCTGGGAGTCTCTGAAAGCTGCATTTCCACTGTGT
>augustus_masked-Fvb4-2-processed-gene-77.8:1848:1968:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_9::augustus_masked-Fvb4-2-processed-gene-77.8:1848-1968||RAPiDGENOMICS_rs1205_02370
GAGAAAACTAAAAGCAGAATATTACTCACCACGCGGAATGAAGAGGTAGCTCTGCATTCAGACAGGAACGGTTTCCTCTTCCAACCTCGACCACTGAATGACCATGAAAGTTGGCAACTG
>augustus_masked-Fvb4-2-processed-gene-77.8:2065:2185:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_1::augustus_masked-Fvb4-2-processed-gene-77.8:2065-2185|2x||RAPiDGENOMICS_rs1205_02371
GTCTCCCATTAGCCATTACTGTGCTCGCAGGACTTCTGGCAAGAAAGGAGACAGTTGATGAATGGGATACGGTGCATACAAATGTTGATGTATACATTAGAAGAGGCAAAGGCTCGGAAC
>augustus_masked-Fvb4-2-processed-gene-77.8:2125:2245:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-77.8:2125-2245||RAPiDGENOMICS_rs1205_02372
AATGGGATACGGTGCATACAAATGTTGATGTATACATTAGAAGAGGCAAAGGCTCGGAACAAGAATACAGAGGAGCATTGTGGGTGCTGGCATTAAGTTATGATGATTTACCATATCACT
>augustus_masked-Fvb4-2-processed-gene-77.8:2185:2305:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_2::augustus_masked-Fvb4-2-processed-gene-77.8:2185-2305|2x||RAPiDGENOMICS_rs1205_02373
AAGAATACAGAGGAGCATTGTGGGTGCTGGCATTAAGTTATGATGATTTACCATATCACTTAAAACCCTGTTTTCTGTATTTAGGCCATTTTCCTGAAGATTTTGAGATACCGGTGAAAA
>augustus_masked-Fvb4-2-processed-gene-77.8:2245:2365:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-77.8:2245-2365||RAPiDGENOMICS_rs1205_02374
TAAAACCCTGTTTTCTGTATTTAGGCCATTTTCCTGAAGATTTTGAGATACCGGTGAAAAGATTGACTCAATTATGGATTGCAGAAGGTTTTATATATGCATCACAAGAAAGAATAACAA
>augustus_masked-Fvb4-2-processed-gene-77.8:2305:2425:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-77.8:2305-2425|2x||RAPiDGENOMICS_rs1205_02375
GATTGACTCAATTATGGATTGCAGAAGGTTTTATATATGCATCACAAGAAAGAATAACAATGGAGGATGTAGCTTATGGCTATTTAAATGAGTTGGTAGAAAGATGTGTGGTACAAATTT
>augustus_masked-Fvb4-2-processed-gene-77.8:240:360:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_3::augustus_masked-Fvb4-2-processed-gene-77.8:240-360||RAPiDGENOMICS_rs1205_02376
GCCGCCACCGTCTCAATCGACTCGCACATGCGGCGGGCCAGGTACCCCTGGAAGCTTCCGAAGGACTCAAGTAAATCCGTCAAGGCCAGGTCGATCACGAACCTGGTCAACGGCCACGAC
>augustus_masked-Fvb4-2-processed-gene-77.8:2485:2605:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_5::augustus_masked-Fvb4-2-processed-gene-77.8:2485-2605||RAPiDGENOMICS_rs1205_02377
TGTGCTTAGAAAAGGCGAAACAGGAGAACTTTCTCCAGAACGTCAATTTTTCACATCAAAACATGACTCCTATTTCTTCTTCCATGGTAGCCAATGCTGCAGCAACAGTTAAAGTTCGAA
>augustus_masked-Fvb4-2-processed-gene-77.8:2605:2725:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_6::augustus_masked-Fvb4-2-processed-gene-77.8:2605-2725||RAPiDGENOMICS_rs1205_02378
GACTTGCAATCTACGTGGATGAGAATGCCGATGAATTGGTTCCATTGAGAAACCACAAAGACAGCCACCTTCGGTCACTACTGTACTTTTACCCAGGATATAATTGGATTCTCAGAAATG
>augustus_masked-Fvb4-2-processed-gene-77.8:2725:2845:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_7::augustus_masked-Fvb4-2-processed-gene-77.8:2725-2845||RAPiDGENOMICS_rs1205_02379
AGAAGTTAGTAGGATTGCTGTTTAAGAAGTTCAAATTGCTTCGAGTTTTGAAGCTTGAAGGGCTAGGGTTGAGAACCCAGGTAGAATTGCCGAATGAGATTGGCAACATGGTCCACTTGA
>augustus_masked-Fvb4-2-processed-gene-77.8:2845:2965:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_8::augustus_masked-Fvb4-2-processed-gene-77.8:2845-2965||RAPiDGENOMICS_rs1205_02380
GATTTATGAGTCTGCGTCATAGTTGTATAACAAGGTTTCCATCCTCCTTGGGTAAATTGATATGTTTGCAAACTCTTGATTTGCAATGTAACGCCAATGTAATTCCAGATGTGATTTGGA
>augustus_masked-Fvb4-2-processed-gene-77.8:2965:3085:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_9::augustus_masked-Fvb4-2-processed-gene-77.8:2965-3085||RAPiDGENOMICS_rs1205_02381
AGATGACACAACTCAGGCATTTATATTTACCCCTCTATTGGACGGCAGAACCTAAGCTGCGACTGTCTACTCTTCACAACTTACAGACCTTAGATCATGTTTCTAGTCTCTGTTCCGACC
>augustus_masked-Fvb4-2-processed-gene-77.8:3085:3205:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_10::augustus_masked-Fvb4-2-processed-gene-77.8:3085-3205||RAPiDGENOMICS_rs1205_02382
TGAATGATCTCACTGAATTGAGAAACCTGAGGAAACTGGGAATAAGAGTGACTAGCAGGTGGGAAAATTTGGAGGAAACCTTGAAATGTATAAGCAGCACACTTGACCGCGTTCGATCAC
>augustus_masked-Fvb4-2-processed-gene-77.8:3205:3325:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_11::augustus_masked-Fvb4-2-processed-gene-77.8:3205-3325||RAPiDGENOMICS_rs1205_02383
TCTTTGTGCACAACTTACTTGAAAATGATAGTGGTACGGAGGTTACAGATATACTGTCAAGTTGTCGTAATATATACAAGTTGAATTTGAATGGACGAACTGTAGAGTTGCCAAAATTTC
>augustus_masked-Fvb4-2-processed-gene-77.8:3325:3445:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_12::augustus_masked-Fvb4-2-processed-gene-77.8:3325-3445||RAPiDGENOMICS_rs1205_02384
TTCATGACTATGCAAACCTCACGAAGATAACATTGTGTCGTTGTGAACTGAAAGACAACCAAATGACAGAGCTAGAGAAGCTGCCAAACCTCAAAACTCTTTGCGTGATGGAAATGACTT
>augustus_masked-Fvb4-2-processed-gene-77.8:3445:3565:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_13::augustus_masked-Fvb4-2-processed-gene-77.8:3445-3565||RAPiDGENOMICS_rs1205_02385
TTGTGTACAAGAATACAAAGACACTTGTCTTCTCCAAAGGTGGCTTTCCTCATATTGAATGTCTTAAACTTATTTGCATACGAGAAGGAGAAGCAGAGGACTTGAAGGTGGAAGAAGGGG
>augustus_masked-Fvb4-2-processed-gene-77.8:3565:3685:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_14::augustus_masked-Fvb4-2-processed-gene-77.8:3565-3685||RAPiDGENOMICS_rs1205_02386
CCCTGCCTAGTCTCTGCCGTTTGTACATAGAACATTGCAGGGGATTGAAGACAATTCCAGATGGGCTGAGATATGTTACTACCCTCAAGAAACTAACCGTAGAAATGCCTAGCTCATTTG
>augustus_masked-Fvb4-2-processed-gene-77.8:360:480:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_4::augustus_masked-Fvb4-2-processed-gene-77.8:360-480||RAPiDGENOMICS_rs1205_02387
GCGGCGGAGAACGGATTCGAGTTCGGGAACCGGAAGATCAAATCGAAGCGGGCGGCGACGACGAAGAGAGTCCGGTCGAATTGGATAGCGAACTCGAAGATCGACGAGGGAGGGGATAGC
>augustus_masked-Fvb4-2-processed-gene-77.8:480:600:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_5::augustus_masked-Fvb4-2-processed-gene-77.8:480-600||RAPiDGENOMICS_rs1205_02388
CGGGAGGAAGGGGAGGGGTGGATGAGCGTGGATCCGAGTCCGGTGAGGGACGAGAGTCCTGTGCAGTCGGCGGAGGAGAACGATAATTGGGAAGCGGAGGAGCAGAGGAGGGTTTGGGGG
>augustus_masked-Fvb4-2-processed-gene-77.8:600:720:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_6::augustus_masked-Fvb4-2-processed-gene-77.8:600-720||RAPiDGENOMICS_rs1205_02389
AGGGGATCGGAGAGCAGGGAAAACGACGCCGTTGAGATGCCGGAGTCGAATTGGAGCGGGGTGAGGACGTGGCTAATTGAATTGGGGTTGAGTCGGTATACGCCGGTGTTTGAGATACAT
>augustus_masked-Fvb4-2-processed-gene-77.8:720:840:Parent=augustus_masked-Fvb4-2-processed-gene-77.8-mRNA-1_7::augustus_masked-Fvb4-2-processed-gene-77.8:720-840||RAPiDGENOMICS_rs1205_02390
GAGGTGGATGACGAGGTGTTGCCGATGCTGACGTTGGAGGATCTTAAAGATATGGGGATCAACGCCGTCGGATCACGGCGGAAAATGTACAGAGCGATCCAGAAGCTTCGCAAAGGGTTC
>augustus_masked-Fvb4-3-processed-gene-10.0:180:300:Parent=augustus_masked-Fvb4-3-processed-gene-10.0-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-10.0:180-300|2x||RAPiDGENOMICS_rs1205_02391
TCTGACAACAAACTTACTGGAAGTATACCAACTTGGATCGGAAACTTTTCTCAGCTCAACATATTAAACCTCTCCAGAAATTCACTTGTTTCAAAGATCCCCGACTCGATTACTGACTTG
>augustus_masked-Fvb4-3-processed-gene-10.0:360:480:Parent=augustus_masked-Fvb4-3-processed-gene-10.0-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-10.0:360-480||RAPiDGENOMICS_rs1205_02392
TTCCAGATAAGGCAGTCATTCCCGTATGATTCACTGAAGCATGTTGATCTATCTGATAACAATTTCTCAAGTGGAATTGAGCAAATTGGTGAAAGACCGCAGCAAGACATGCAGTTCCTC
>augustus_masked-Fvb4-3-processed-gene-10.0:480:600:Parent=augustus_masked-Fvb4-3-processed-gene-10.0-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-10.0:480-600||RAPiDGENOMICS_rs1205_02393
AATTTATCAAGCAACATATTGCGAGGTAAAATACCAAAATCCGTAGAGAGATTGAAGGCACTTCAAAGTTTGGATTTGAGTTCCAACAAGTTAAGTTTCAACTTGCCAGAGAGCTTAGGA
>augustus_masked-Fvb4-3-processed-gene-10.0:540:660:Parent=augustus_masked-Fvb4-3-processed-gene-10.0-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-10.0:540-660|2x||RAPiDGENOMICS_rs1205_02394
CTTCAAAGTTTGGATTTGAGTTCCAACAAGTTAAGTTTCAACTTGCCAGAGAGCTTAGGAAATCTGAGCAAGTTAGAGACGCTCAAGTTGCAGAAAAACCAATTCAACGACAGAATTCCA
>augustus_masked-Fvb4-3-processed-gene-10.0:600:720:Parent=augustus_masked-Fvb4-3-processed-gene-10.0-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-10.0:600-720||RAPiDGENOMICS_rs1205_02395
AATCTGAGCAAGTTAGAGACGCTCAAGTTGCAGAAAAACCAATTCAACGACAGAATTCCAAATGGGTTTTTGAAGTTGAGAAAACTGAAGAAGTTGGATTTGTCAGACAATCTTCTGGCG
>augustus_masked-Fvb4-3-processed-gene-10.0:660:780:Parent=augustus_masked-Fvb4-3-processed-gene-10.0-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-10.0:660-780|2x||RAPiDGENOMICS_rs1205_02396
AATGGGTTTTTGAAGTTGAGAAAACTGAAGAAGTTGGATTTGTCAGACAATCTTCTGGCGGGAAAAATCCCAGAGGGCAAACCCCTGAGCGACTTTTCAAAGAGCTCTTACTCTGGAAAC
>augustus_masked-Fvb4-3-processed-gene-12.6:0:120:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-12.6:0-120||RAPiDGENOMICS_rs1205_02397
ATGGCAGATATTGTTATTACAGTTGTTGGAAAGTTAGCAGAGTACACAGTGGAACCTGTTCTGCGACAATTTGGTTATCTGAGTAACTACAAGAGCAATGTTGAAGATATCACCATGAAG
>augustus_masked-Fvb4-3-processed-gene-12.6:1080:1200:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_10::augustus_masked-Fvb4-3-processed-gene-12.6:1080-1200||RAPiDGENOMICS_rs1205_02398
GTCATCAGAGATGTAATGGATGCACTGACAGATGATGAATCCAATCCCATTGTAATATGTGGGATGGGGGGTATCGGCAAAACAACTTTGGTGATGGAGATTGGTGCAAAAGCAGGTGAA
>augustus_masked-Fvb4-3-processed-gene-12.6:120:240:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-12.6:120-240||RAPiDGENOMICS_rs1205_02399
GTTACAACTCTGACTGCTACAAGAGACGGGGTACAGTTACGTGTGGATGGAGCAAAGAGGAACTTGGAGGATATTCTTCCCGAAGTTCAGAACTGGTTGGAACGAGTACTGCAGACCATA
>augustus_masked-Fvb4-3-processed-gene-12.6:1200:1320:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_11::augustus_masked-Fvb4-3-processed-gene-12.6:1200-1320||RAPiDGENOMICS_rs1205_02400
GTACAACTATTTGATGAAATTGCAATTGCAGAGTTCACCCAAGAACCTGATCTCATCAAAATTCAAGGTCAAATTGCCAAAGCTCTCCGCTTGGAACTTACAGGAGAAGACGACAGAGCA
>augustus_masked-Fvb4-3-processed-gene-12.6:1320:1440:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_12::augustus_masked-Fvb4-3-processed-gene-12.6:1320-1440||RAPiDGENOMICS_rs1205_02401
GCTAAGTTACGTGAAAGATTATCACGGGGTACTAACAATGTCCTTTTAATATTGGACAATGTTTGGACACAATTAAATTTGTGGGAAATAGGGATTCCAATTTCCCGTGATCAAAAATGT
>augustus_masked-Fvb4-3-processed-gene-12.6:1380:1500:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_12::augustus_masked-Fvb4-3-processed-gene-12.6:1380-1500|2x||RAPiDGENOMICS_rs1205_02402
GTTTGGACACAATTAAATTTGTGGGAAATAGGGATTCCAATTTCCCGTGATCAAAAATGTTGTAAACTTCTGGTAACATCACGGAACCAAGATATTTTCAAAGAGATGAAAACCAGAAAA
>augustus_masked-Fvb4-3-processed-gene-12.6:1440:1560:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_13::augustus_masked-Fvb4-3-processed-gene-12.6:1440-1560||RAPiDGENOMICS_rs1205_02403
TGTAAACTTCTGGTAACATCACGGAACCAAGATATTTTCAAAGAGATGAAAACCAGAAAACATTTCCCCATTGGTGGTTTGCCAAAACATGATGCCTGGAGTTTGTTTAAGAAGGTGGCA
>augustus_masked-Fvb4-3-processed-gene-12.6:1560:1680:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_14::augustus_masked-Fvb4-3-processed-gene-12.6:1560-1680||RAPiDGENOMICS_rs1205_02404
GGAGGTTCCATTGAATCTGATCTCGAGCTGCGTCCAATAGCAGAACAAGTTCTTGATGAATGTGATGGTTTACCAGTTGCAATTTCTACAGTTGGAGGGGCACTACAAGGTAAAAGCATT
>augustus_masked-Fvb4-3-processed-gene-12.6:1620:1740:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_14::augustus_masked-Fvb4-3-processed-gene-12.6:1620-1740|2x||RAPiDGENOMICS_rs1205_02405
TGTGATGGTTTACCAGTTGCAATTTCTACAGTTGGAGGGGCACTACAAGGTAAAAGCATTTCAAGATGGAGAAATGCACTTAGAGAACTAAGAAATGCTTGTCCCAAAAACGTGCCAGGA
>augustus_masked-Fvb4-3-processed-gene-12.6:1680:1800:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_15::augustus_masked-Fvb4-3-processed-gene-12.6:1680-1800||RAPiDGENOMICS_rs1205_02406
TCAAGATGGAGAAATGCACTTAGAGAACTAAGAAATGCTTGTCCCAAAAACGTGCCAGGAGTGATAAAGCATGTGTATGGAAAAATAGTGTTCAGCTACGAATGTCTACCAAGCGAGCAA
>augustus_masked-Fvb4-3-processed-gene-12.6:1740:1860:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_15::augustus_masked-Fvb4-3-processed-gene-12.6:1740-1860|2x||RAPiDGENOMICS_rs1205_02407
GTGATAAAGCATGTGTATGGAAAAATAGTGTTCAGCTACGAATGTCTACCAAGCGAGCAAGCCAAATCATGTTTTTTACTATGTTGTCTATTTCCGGAAAGTGAAGATTTTGATATTGAA
>augustus_masked-Fvb4-3-processed-gene-12.6:1800:1920:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_16::augustus_masked-Fvb4-3-processed-gene-12.6:1800-1920||RAPiDGENOMICS_rs1205_02408
GCCAAATCATGTTTTTTACTATGTTGTCTATTTCCGGAAAGTGAAGATTTTGATATTGAAATGTTGGTTAGAATTGCGATTGGGCTCGGGCTTTTGAAAGGCATTGATTCAATATCTGAA
>augustus_masked-Fvb4-3-processed-gene-12.6:1860:1980:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_16::augustus_masked-Fvb4-3-processed-gene-12.6:1860-1980|2x||RAPiDGENOMICS_rs1205_02409
ATGTTGGTTAGAATTGCGATTGGGCTCGGGCTTTTGAAAGGCATTGATTCAATATCTGAAGGAAGGGATTGCGTAGAAACATTGGTTGACACACTCAAAGATCACTCTTTATTGTTAGAC
>augustus_masked-Fvb4-3-processed-gene-12.6:1920:2040:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_17::augustus_masked-Fvb4-3-processed-gene-12.6:1920-2040||RAPiDGENOMICS_rs1205_02410
GGAAGGGATTGCGTAGAAACATTGGTTGACACACTCAAAGATCACTCTTTATTGTTAGACGGTGATGAGAAAGAGTCTGTTAGAATGCATGATGTGGTGCGTGATGTAGCCGTGTATATA
>augustus_masked-Fvb4-3-processed-gene-12.6:2040:2160:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_18::augustus_masked-Fvb4-3-processed-gene-12.6:2040-2160||RAPiDGENOMICS_rs1205_02411
GCCTCCCAAGAGTTTAATCAAGACAAGAATGATGAGTCTGAAAAGAGAATCGTGTTAAGACATGGACCGGAAGTGAACTATTGGCGCAGCTATAATGCTGTCGATGAATCTGGATCTGAG
>augustus_masked-Fvb4-3-processed-gene-12.6:2160:2280:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_19::augustus_masked-Fvb4-3-processed-gene-12.6:2160-2280||RAPiDGENOMICS_rs1205_02412
GAATCTGCATATTGTCGTTCACTGACAACCTGTACAAGTTCTACTGAACTTTTACTAATGGGGGTCAAAGATTGGTTGAAGCTGAAGCTGAAGCTGCTGGACACAATTTTCGATGGAATG
>augustus_masked-Fvb4-3-processed-gene-12.6:480:600:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-12.6:480-600||RAPiDGENOMICS_rs1205_02413
CCGGTGAAGCCCTATGAAGAGGCTAGCTCCTCCTCAGGAACATCCAATCCTGCTAAAGCACATGTACCCATGGATCTCTCTGACCGTCTGGAATATAGGCTGCCTTATACAAAGGATCTC
>augustus_masked-Fvb4-3-processed-gene-12.6:540:660:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-12.6:540-660|2x||RAPiDGENOMICS_rs1205_02414
CATGTACCCATGGATCTCTCTGACCGTCTGGAATATAGGCTGCCTTATACAAAGGATCTCTTGACGGCTCTGCAAGATGACAAGATCAATATCATTGGCATTTCTGGGACATTCAGAGAG
>augustus_masked-Fvb4-3-processed-gene-12.6:600:720:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-12.6:600-720||RAPiDGENOMICS_rs1205_02415
TTGACGGCTCTGCAAGATGACAAGATCAATATCATTGGCATTTCTGGGACATTCAGAGAGTTGGATACAGTAACAACTAAAGAATTCATCAAAAGAATGAAACACAGAAATCTCTTTGAA
>augustus_masked-Fvb4-3-processed-gene-12.6:660:780:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-12.6:660-780|2x||RAPiDGENOMICS_rs1205_02416
TTGGATACAGTAACAACTAAAGAATTCATCAAAAGAATGAAACACAGAAATCTCTTTGAAGAGGTTGTGATGGCACTTGTGTCTCAGGATCCAGATTTGAAACGAATACAAGATGAGATT
>augustus_masked-Fvb4-3-processed-gene-12.6:720:840:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_7::augustus_masked-Fvb4-3-processed-gene-12.6:720-840||RAPiDGENOMICS_rs1205_02417
GAGGTTGTGATGGCACTTGTGTCTCAGGATCCAGATTTGAAACGAATACAAGATGAGATTGCAGAAATGCTGGACCTCAAATTGGAGAAGGGGAGTTTGGTGGAACGGGCAGAGAGGCTA
>augustus_masked-Fvb4-3-processed-gene-12.6:780:900:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_7::augustus_masked-Fvb4-3-processed-gene-12.6:780-900|2x||RAPiDGENOMICS_rs1205_02418
GCAGAAATGCTGGACCTCAAATTGGAGAAGGGGAGTTTGGTGGAACGGGCAGAGAGGCTACGTACTGTGTTATTGGCTTCTGATTCTAAGAGGTTTCTTGTGATACTGACTGATGTCTGG
>augustus_masked-Fvb4-3-processed-gene-12.6:840:960:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_8::augustus_masked-Fvb4-3-processed-gene-12.6:840-960||RAPiDGENOMICS_rs1205_02419
CGTACTGTGTTATTGGCTTCTGATTCTAAGAGGTTTCTTGTGATACTGACTGATGTCTGGAAAATTCTTGATTTGGAAGCAATTGGAATTTATCATGTTGATATCAAGAAAAGCTGCAAG
>augustus_masked-Fvb4-3-processed-gene-12.6:900:1020:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_8::augustus_masked-Fvb4-3-processed-gene-12.6:900-1020|2x||RAPiDGENOMICS_rs1205_02420
AAAATTCTTGATTTGGAAGCAATTGGAATTTATCATGTTGATATCAAGAAAAGCTGCAAGATAATGTTGATTTCACAACTACCAGATGTGTTTGGTGAGATGGGGACACGGAGCAATTTC
>augustus_masked-Fvb4-3-processed-gene-12.6:960:1080:Parent=augustus_masked-Fvb4-3-processed-gene-12.6-mRNA-1_9::augustus_masked-Fvb4-3-processed-gene-12.6:960-1080||RAPiDGENOMICS_rs1205_02421
ATAATGTTGATTTCACAACTACCAGATGTGTTTGGTGAGATGGGGACACGGAGCAATTTCAGATTGCTATTACATTCCACACCCATAGCAAGACCCGTTGAGTTTGAATCAAGGAATTCG
>augustus_masked-Fvb4-3-processed-gene-151.6:1080:1200:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_10::augustus_masked-Fvb4-3-processed-gene-151.6:1080-1200||RAPiDGENOMICS_rs1205_02422
AAGGTGGTCATTACAGTGAACTTTGAGAACCAGCATTTCAATGGGACTATTTCGCCTGCCTTTGCCAACCTCACATCGCTGCAAAATCTGATGCTGAAAAACAACAACTTGACGGGTCCA
>augustus_masked-Fvb4-3-processed-gene-151.6:1320:1440:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_12::augustus_masked-Fvb4-3-processed-gene-151.6:1320-1440||RAPiDGENOMICS_rs1205_02423
AAAATTGGGACTACACCGAGCTCTGGTGATCCAGGGAGTTCACCTTCTGGCAACAACTCAACTGCTCCAGGCGGGAGTCCTTCTCCATCATCAAACAATTCTTCAGTTTCGCCTGGTATG
>augustus_masked-Fvb4-3-processed-gene-151.6:1440:1560:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_13::augustus_masked-Fvb4-3-processed-gene-151.6:1440-1560||RAPiDGENOMICS_rs1205_02424
ATTGCTGGTATAGTTATTGCTGTTGCTATCTTCATTGGAGTGTTGTTGTTTGTATTCATCAAATGTTATTGGAGCAAAAAGCATAGGAAGTTTGGAAGAGTGGATAATACGCTGACTGGA
>augustus_masked-Fvb4-3-processed-gene-151.6:1800:1920:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_16::augustus_masked-Fvb4-3-processed-gene-151.6:1800-1920||RAPiDGENOMICS_rs1205_02425
AGGATGGAATCTGTGGCAGTGGGTACTAAGGGATTGAACGAGTTTCAAGCAGAAATTGCAGTCCTCACTAAGGTCAGGCATAGGCATTTGGTTGCACTGTTAGGATATTGCATTAATGGT
>augustus_masked-Fvb4-3-processed-gene-151.6:1920:2040:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_17::augustus_masked-Fvb4-3-processed-gene-151.6:1920-2040||RAPiDGENOMICS_rs1205_02426
AATGAGAGACTTCTAGTGTACGAGTACATGCCACAAGGAACGTTGACACAACACTTGTTTGATTTGCGGGAGACTGGGGTAACTCCTCTTACTTGGAAGCAGAGAGTGACAATAGCTTTG
>augustus_masked-Fvb4-3-processed-gene-151.6:2368:2488:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-151.6:2368-2488||RAPiDGENOMICS_rs1205_02427
CATGGTTTCGCAGAGTCCTTGTCAACAAAGAAAACATTCCCAAGTCTATTGACCAAACTCTTGACCCTGATGAGGAGACAATGGAGAGCATATACAAAGTTGCTGAGCTTGCGGGTCATT
>augustus_masked-Fvb4-3-processed-gene-151.6:2488:2608:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_3::augustus_masked-Fvb4-3-processed-gene-151.6:2488-2608||RAPiDGENOMICS_rs1205_02428
GCACAGCTCGTGAGCCATATCAGAGACCAGACATGGGCCATGCGGTCAACATCTTGGGTCCTCTTGTTGAGCACTGGAAACCTACAACCCACGAAGAAGAAGATGAAAACAGTGGCATTA
>augustus_masked-Fvb4-3-processed-gene-151.6:300:420:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_3::augustus_masked-Fvb4-3-processed-gene-151.6:300-420|2x||RAPiDGENOMICS_rs1205_02429
CCCTTCCCCTCCCTCGCCAACCTCTCCAACCTCCGTGAAGTCTACCTCGACACCAACAACTTCTCCTCCATCCCCGCCGGCTGCTTCGGAGGCCTCACCGGCTTGCAGACTCTTTCCATG
>augustus_masked-Fvb4-3-processed-gene-151.6:360:480:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-151.6:360-480||RAPiDGENOMICS_rs1205_02430
TTCTCCTCCATCCCCGCCGGCTGCTTCGGAGGCCTCACCGGCTTGCAGACTCTTTCCATGAGCAACAACGAGATTCTCGCGCCGTGGGTGTTCCCATCTGAGCTCACCGGGTCGACCAGC
>augustus_masked-Fvb4-3-processed-gene-151.6:420:540:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-151.6:420-540|2x||RAPiDGENOMICS_rs1205_02431
AGCAACAACGAGATTCTCGCGCCGTGGGTGTTCCCATCTGAGCTCACCGGGTCGACCAGCTTGGTCACCTTCCAAGCAGGTAACACCAACTTGTATGGTAATATTCCCGACATTTTTGGA
>augustus_masked-Fvb4-3-processed-gene-151.6:480:600:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-151.6:480-600||RAPiDGENOMICS_rs1205_02432
TTGGTCACCTTCCAAGCAGGTAACACCAACTTGTATGGTAATATTCCCGACATTTTTGGATCGTTTGCCAACTTGCAAAATGTGAGATTGTCCTACAACAATCTCACCGGGCCGCTGCCC
>augustus_masked-Fvb4-3-processed-gene-151.6:600:720:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-151.6:600-720||RAPiDGENOMICS_rs1205_02433
AAGTCGTTTTCTGGATCTGGGATTCAGAATCTCTGGATTAACAATCAGGATTCCGGGTTATCTGATACCGTTGAGGTTCTTTCCAACATGACTTCGTTGACTCAGGTGTGGCTGCACAAG
>augustus_masked-Fvb4-3-processed-gene-151.6:720:840:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_7::augustus_masked-Fvb4-3-processed-gene-151.6:720-840||RAPiDGENOMICS_rs1205_02434
AATCAGTTCCGTGGGGGGATCCCGGACCTGACGCAATGTAGTGCTCTCACTGATCTTCAGCTTCGTGACAATGTGTTTACTGGGATGGTGCCGGCGACGTTGACTGGGTTGTCTTCTTTG
>augustus_masked-Fvb4-3-processed-gene-151.6:900:1020:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_8::augustus_masked-Fvb4-3-processed-gene-151.6:900-1020|2x||RAPiDGENOMICS_rs1205_02435
GTGAAGGCCACTTATGAGGGTAATAGCTTTTGTAAGACCACCGCTGGGCCTTGTGATCCACAGGTCACTACGCTGCTTCAGGTTGCAGGGGCTTTGGGGTACCCGGAATCATTGGCTGAG
>augustus_masked-Fvb4-3-processed-gene-151.6:960:1080:Parent=augustus_masked-Fvb4-3-processed-gene-151.6-mRNA-1_9::augustus_masked-Fvb4-3-processed-gene-151.6:960-1080||RAPiDGENOMICS_rs1205_02436
CAGGTCACTACGCTGCTTCAGGTTGCAGGGGCTTTGGGGTACCCGGAATCATTGGCTGAGGCTTGGACAGGAGACAATGCGTGTGAATCCTGGAGCTTCATTAGTTGTGATTCTGCTCGA
>augustus_masked-Fvb4-3-processed-gene-156.9:0:120:Parent=augustus_masked-Fvb4-3-processed-gene-156.9-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-156.9:0-120||RAPiDGENOMICS_rs1205_02437
ATGGTTAAACAAGATGATTCCCCAACAAAGCTCAATCACCTTCAATTTCAAGACGATGTCGATACGAGGATCTATTACCAAGATACAATTATAGTTACCAACAAAGGTATAAAGATGGAG
>augustus_masked-Fvb4-3-processed-gene-156.9:120:240:Parent=augustus_masked-Fvb4-3-processed-gene-156.9-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-156.9:120-240||RAPiDGENOMICS_rs1205_02438
CTAGTAAAGATTCTAACTGTCTTCACCTCGATTGACTTCTCAAACAATAAGTTTGAGGGATCGATACCAAAGGAAATTGGAGCATTCAAATCGTTGTATGCCCTCAACTTGTCAACTAAT
>augustus_masked-Fvb4-3-processed-gene-156.9:180:300:Parent=augustus_masked-Fvb4-3-processed-gene-156.9-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-156.9:180-300|2x||RAPiDGENOMICS_rs1205_02439
TCGATACCAAAGGAAATTGGAGCATTCAAATCGTTGTATGCCCTCAACTTGTCAACTAATGCTTTCACAGGAGCAATCCCAGAATCATTTAGCAGCTTGAGTCAACTAGAGTCGCTAGAC
>augustus_masked-Fvb4-3-processed-gene-156.9:240:360:Parent=augustus_masked-Fvb4-3-processed-gene-156.9-mRNA-1_3::augustus_masked-Fvb4-3-processed-gene-156.9:240-360||RAPiDGENOMICS_rs1205_02440
GCTTTCACAGGAGCAATCCCAGAATCATTTAGCAGCTTGAGTCAACTAGAGTCGCTAGACATCTCAAAGAACAACCTGAGCGGGCAAATTCCACCACAACTTACACAACTCACTTTCCTT
>augustus_masked-Fvb4-3-processed-gene-156.9:300:420:Parent=augustus_masked-Fvb4-3-processed-gene-156.9-mRNA-1_3::augustus_masked-Fvb4-3-processed-gene-156.9:300-420|2x||RAPiDGENOMICS_rs1205_02441
ATCTCAAAGAACAACCTGAGCGGGCAAATTCCACCACAACTTACACAACTCACTTTCCTTTCGTTTTTGAATCTCTCATATAATCATCTTGTGGGAAGGATTCCAAGCGGTAACCAATTT
>augustus_masked-Fvb4-3-processed-gene-156.9:360:480:Parent=augustus_masked-Fvb4-3-processed-gene-156.9-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-156.9:360-480||RAPiDGENOMICS_rs1205_02442
TCGTTTTTGAATCTCTCATATAATCATCTTGTGGGAAGGATTCCAAGCGGTAACCAATTTTCAACATTTTCAAGAGATTCATTTGAAGGCAATAATGATTTATCCGGACCTCCCTTGACT
>augustus_masked-Fvb4-3-processed-gene-170.2:1080:1200:Parent=augustus_masked-Fvb4-3-processed-gene-170.2-mRNA-1_10::augustus_masked-Fvb4-3-processed-gene-170.2:1080-1200||RAPiDGENOMICS_rs1205_02443
ATGGAGCTGATGGGACGTGTGAATATCGGGAACTACATTCCATGGCTTGCTTGGTGGAGCAGCGTCAATGGTTTGAACGCTAAACTAGAAAAGGGGGGTCGATCGGGTCAGGGGGTAGCT
>augustus_masked-Fvb4-3-processed-gene-170.2:360:480:Parent=augustus_masked-Fvb4-3-processed-gene-170.2-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-170.2:360-480||RAPiDGENOMICS_rs1205_02444
CACCAAAGGGACAGCTTTGCTGAAGCGTTTGATGAACATGAAGAGAAGTTTGGAGAAGATAGTAAGCAAGTGGAACCTTTCAGTTCCTTAACCCTAATGCATGTGCTTCTACTTCTCATT
>augustus_masked-Fvb4-3-processed-gene-170.2:420:540:Parent=augustus_masked-Fvb4-3-processed-gene-170.2-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-170.2:420-540|2x||RAPiDGENOMICS_rs1205_02445
AGTAAGCAAGTGGAACCTTTCAGTTCCTTAACCCTAATGCATGTGCTTCTACTTCTCATTTTCCTTATTCTCCTATACAAATCATTCATCACCAGCCCTACTACGAAAAACTCACCACCT
>augustus_masked-Fvb4-3-processed-gene-170.2:600:720:Parent=augustus_masked-Fvb4-3-processed-gene-170.2-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-170.2:600-720||RAPiDGENOMICS_rs1205_02446
TCACTCGAAGCCCTAGCTAAGCGCTTCGGCCCTGATTTCATGCTCCTCCGTTTCGGAAGCGTGTCGGTCCTTGTGGTCTCGTCTGCTGAGACAGCCGACGAGGTCCTAAAGACCAATGGC
>augustus_masked-Fvb4-3-processed-gene-170.2:840:960:Parent=augustus_masked-Fvb4-3-processed-gene-170.2-mRNA-1_8::augustus_masked-Fvb4-3-processed-gene-170.2:840-960||RAPiDGENOMICS_rs1205_02447
CATCTTTTGAGCAACAAAAGGGTTCAGTCTTTTCATGGTGTTGGAGAAGAAGAGACCAAACTGATGCTCAGGAAGATAGAACAGCAGTCCACATCTTCGTCACCGGACCATTCAATTGCT
>augustus_masked-Fvb4-3-processed-gene-170.2:960:1080:Parent=augustus_masked-Fvb4-3-processed-gene-170.2-mRNA-1_9::augustus_masked-Fvb4-3-processed-gene-170.2:960-1080||RAPiDGENOMICS_rs1205_02448
CCAAATCTGAGCGAAATGCTTTCGACTCTGACAAATGATGTGAGCTGCAGAGTGGCTCTTGGGAGGAAGTACTGCGTTGGAGAAGATGGTAAGATGTTTCAGGAGCTTCTGAAGGAGTTT
>augustus_masked-Fvb4-3-processed-gene-180.7:1200:1320:Parent=augustus_masked-Fvb4-3-processed-gene-180.7-mRNA-1_11::augustus_masked-Fvb4-3-processed-gene-180.7:1200-1320||RAPiDGENOMICS_rs1205_02449
GAGATTTGGGAGTTATCAAAAGAGGAGAATGATGTTCTGAAGATACTCAAGTTAAGCTATGATCACATGCCAATTTATTTGAAACAATGCTTCTCCTACTGTGCATTGTTCCCTAAGGGA
>augustus_masked-Fvb4-3-processed-gene-180.7:1320:1440:Parent=augustus_masked-Fvb4-3-processed-gene-180.7-mRNA-1_12::augustus_masked-Fvb4-3-processed-gene-180.7:1320-1440||RAPiDGENOMICS_rs1205_02450
TATGCAATTGAGAAGAAAATGTTAGTGGAACTTTGGATAGCTCAGGGTTACATTCACCTTCCTGGTAAAGAGAGGAACTTAGAAGAAATTGGTGACATGTATTTCAAGGAATTGATAGAG
>augustus_masked-Fvb4-3-processed-gene-180.7:2040:2160:Parent=augustus_masked-Fvb4-3-processed-gene-180.7-mRNA-1_18::augustus_masked-Fvb4-3-processed-gene-180.7:2040-2160||RAPiDGENOMICS_rs1205_02451
CCGTTATTCATCTTGGGGAAGAAAGATCTCTTTTCCGGGGTTAGTGGTGGACTAGATGAGTTGAGTGGCCTGAACTGTCTTAAAGGGGTACTTCATGTTGTCCATCTTGAACATGTCGAC
>augustus_masked-Fvb4-3-processed-gene-180.7:2280:2400:Parent=augustus_masked-Fvb4-3-processed-gene-180.7-mRNA-1_20::augustus_masked-Fvb4-3-processed-gene-180.7:2280-2400||RAPiDGENOMICS_rs1205_02452
GGCCTCCAACCCCATCAAAATTTGAAAGTGCTCCATATAGCTGGGTATTGCGGCGTTCACTTCCCCAACTGGCTGATGAACAATGCTGCTTCCTCTCTTCCAAGTTTAGTGGAGCTCACA
>augustus_masked-Fvb4-3-processed-gene-180.7:2400:2520:Parent=augustus_masked-Fvb4-3-processed-gene-180.7-mRNA-1_21::augustus_masked-Fvb4-3-processed-gene-180.7:2400-2520||RAPiDGENOMICS_rs1205_02453
ATTGAGGGCTGTCTCAGATGCCAGCATCTTCCACCACTTGATCAACTCCCTTCTCTCAAGTTTCTCAAACTGTATTCTCTAAGTTCCCTGGAGCACATCAACAACAGTTACTCATCTTCC
>augustus_masked-Fvb4-3-processed-gene-180.7:2880:3000:Parent=augustus_masked-Fvb4-3-processed-gene-180.7-mRNA-1_25::augustus_masked-Fvb4-3-processed-gene-180.7:2880-3000||RAPiDGENOMICS_rs1205_02454
TTCCCTGAAGATAGGATAGCCAGCCTCACTTCCCTTAAGCTTCTAAAGATTATAGATTGTGGAAACTTGACATCTCTACCACAGAACCTGCACTGTGAATACGTACTCAGTAATTCCTGG
>augustus_masked-Fvb4-3-processed-gene-180.7:420:540:Parent=augustus_masked-Fvb4-3-processed-gene-180.7-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-180.7:420-540|2x||RAPiDGENOMICS_rs1205_02455
GATATTGGGGTTGAGATCAATAATAGGAGAGAAGAGACGCATTCTTTTATGGTGGAATCAGCTGTGGTTGGAAGAAAGAGAGAGAAGGAGGAAATGGTGGAGTTCTTGACGAACCCACCA
>augustus_masked-Fvb4-3-processed-gene-180.7:480:600:Parent=augustus_masked-Fvb4-3-processed-gene-180.7-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-180.7:480-600||RAPiDGENOMICS_rs1205_02456
GCTGTGGTTGGAAGAAAGAGAGAGAAGGAGGAAATGGTGGAGTTCTTGACGAACCCACCAAGTGAAGGAGAAAATGTTTATGTTACTGCCATTGTTGGTATTGGGGGACTTGGGAAGACG
>augustus_masked-Fvb4-3-processed-gene-180.7:540:660:Parent=augustus_masked-Fvb4-3-processed-gene-180.7-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-180.7:540-660|2x||RAPiDGENOMICS_rs1205_02457
AGTGAAGGAGAAAATGTTTATGTTACTGCCATTGTTGGTATTGGGGGACTTGGGAAGACGACCCTGGCTAAAATGTTGTATAATGATGATAGGGTAGCCAACTATTTTGAATTTAAGATG
>augustus_masked-Fvb4-3-processed-gene-180.7:600:720:Parent=augustus_masked-Fvb4-3-processed-gene-180.7-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-180.7:600-720||RAPiDGENOMICS_rs1205_02458
ACCCTGGCTAAAATGTTGTATAATGATGATAGGGTAGCCAACTATTTTGAATTTAAGATGTGGGTGTGGGGTTATGGAGACTTTAATTTATATTCAATTGCTGAGAAAATCTTGAGATCT
>augustus_masked-Fvb4-3-processed-gene-221.14:0:120:Parent=augustus_masked-Fvb4-3-processed-gene-221.14-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-221.14:0-120||RAPiDGENOMICS_rs1205_02459
ATGGGCAAGTTAATGTCTCTGTTTTGTCTGGTGTATTTCACATTATGTTCCACTCCATTGTTTACTAGTTCGCTAACACTGGAATCCGATATTCAAGTTCTTCGTGTGGTGAAGCGTAGC
>augustus_masked-Fvb4-3-processed-gene-221.14:120:240:Parent=augustus_masked-Fvb4-3-processed-gene-221.14-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-221.14:120-240||RAPiDGENOMICS_rs1205_02460
ATAGATCCCAACGCCATCCCCCCAAATTCCTATCTCAGTAGCTGGGACTTCAAACTCGATCCATGCGAAACTACAGGCGGGCAGTTCCTCGGAATCTTATGCAGTTTCCCTCTAGACAAA
>augustus_masked-Fvb4-3-processed-gene-221.14:180:300:Parent=augustus_masked-Fvb4-3-processed-gene-221.14-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-221.14:180-300|2x||RAPiDGENOMICS_rs1205_02461
CCATGCGAAACTACAGGCGGGCAGTTCCTCGGAATCTTATGCAGTTTCCCTCTAGACAAATCCCCAAGCAGAATAACTGCCATTGATCTTGATGGTGCAGGCTATCAGGGTTTCCTAACA
>augustus_masked-Fvb4-3-processed-gene-221.14:240:360:Parent=augustus_masked-Fvb4-3-processed-gene-221.14-mRNA-1_3::augustus_masked-Fvb4-3-processed-gene-221.14:240-360||RAPiDGENOMICS_rs1205_02462
TCCCCAAGCAGAATAACTGCCATTGATCTTGATGGTGCAGGCTATCAGGGTTTCCTAACATCAGCAGTTGGTAACCTAACCGAGCTCACCTTCATCAACCTCAGAAAAAACAACTTTCGA
>augustus_masked-Fvb4-3-processed-gene-221.14:480:600:Parent=augustus_masked-Fvb4-3-processed-gene-221.14-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-221.14:480-600||RAPiDGENOMICS_rs1205_02463
GACATTTCGTTCAATGAGCTCTCTGGAACAATTCATCCCAGCATAGGTGGACTCCGAGGCTTGACATTCTTAAGCTTGTCCAACAATGGCTTCACTGGCAGAGTCCCAGACCTCTCGGGG
>augustus_masked-Fvb4-3-processed-gene-221.14:660:780:Parent=augustus_masked-Fvb4-3-processed-gene-221.14-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-221.14:660-780|2x||RAPiDGENOMICS_rs1205_02464
TTTCCAGTAAGCTTGAGAACACTGATTCTGAGCCAAAATCTGTTTTTAGGCCATCTTACAACTCTAAACAAACTCAGTAACCTCAGAGTGCTCGATGTGAGCGGCAACAGACTTTCAGGT
>augustus_masked-Fvb4-3-processed-gene-221.14:720:840:Parent=augustus_masked-Fvb4-3-processed-gene-221.14-mRNA-1_7::augustus_masked-Fvb4-3-processed-gene-221.14:720-840||RAPiDGENOMICS_rs1205_02465
ACTCTAAACAAACTCAGTAACCTCAGAGTGCTCGATGTGAGCGGCAACAGACTTTCAGGTGCCATCACTAGAGAATTTTTTACTTTACCCAAGGTCACTCAACTCAATCTCTCATATAAC
>augustus_masked-Fvb4-3-processed-gene-221.14:840:960:Parent=augustus_masked-Fvb4-3-processed-gene-221.14-mRNA-1_8::augustus_masked-Fvb4-3-processed-gene-221.14:840-960||RAPiDGENOMICS_rs1205_02466
CACTTCACAAGATTGGAGGTAGTGAGATCTTTTGGACAAGAGGAGCTTCAGGTGCTCGATGCAAAAGGAAATCAACTGCGAGGCCATTTGCCTGTGAATTTGGTAACTCTGCAGAATCTA
>augustus_masked-Fvb4-3-processed-gene-221.14:960:1080:Parent=augustus_masked-Fvb4-3-processed-gene-221.14-mRNA-1_9::augustus_masked-Fvb4-3-processed-gene-221.14:960-1080||RAPiDGENOMICS_rs1205_02467
ACAACAATCAACCTTTCCTACAACCAGTTTTTTGGTAAAATACCCGACGCATACGCATCAAGAGTTGGAGACTGGAGTGAACTATACTTGGATCACAACTTTTTGCTAGGAAAGCTTCCA
>augustus_masked-Fvb4-3-processed-gene-25.14:0:120:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-25.14:0-120||RAPiDGENOMICS_rs1205_02468
ATGGCTAGCAGAAAGTCCTCCTTTAAACTTCTTTTGCCTGTCTTCCTTCTTTTGTTAACCGCATACTCTACCTTCCTTGAAGCCAAGTTGGCCAACTCTGGTGTTAAGGGTTTTAGGGTG
>augustus_masked-Fvb4-3-processed-gene-25.14:1017:1137:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_3::augustus_masked-Fvb4-3-processed-gene-25.14:1017-1137||RAPiDGENOMICS_rs1205_02469
GGACAACTTGCACAACTAAATTCCTTAGATCTCTGGGGTAGTTCATGGGAAGGCATCATATCTGAAATTCATTTTAGCAATCTCTCTCTCTTGGCTTATCTTTCATTGTCGTCTACAAAT
>augustus_masked-Fvb4-3-processed-gene-25.14:1137:1257:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-25.14:1137-1257||RAPiDGENOMICS_rs1205_02470
AACTCTTTGGTGTTCCACTTCAGTCATGAGTGGATTCCCCCTTTCACTCTTTATACTCTCTCTATCAGTGATTGCAAACTGATGAATCCTAGATTTCCCACTTGGCTCAGAAATCAGAGT
>augustus_masked-Fvb4-3-processed-gene-25.14:120:240:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-25.14:120-240||RAPiDGENOMICS_rs1205_02471
GCTTGTAATGAGGAGGAAAGAGCAGCCCTCCTTAAATTCAGGCAAGGCCTTAAAGATCCTTATGGTCAGCTTTCGTCTTGGGTTGGGGAGGACTGCTGCAATTGGACAGGCATAGGGTGC
>augustus_masked-Fvb4-3-processed-gene-25.14:1257:1377:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-25.14:1257-1377||RAPiDGENOMICS_rs1205_02472
TTCCTCTATAAAATAACTCTCTCAACTGTGGGAATTTCAGATACAATACCTGATTGGTTTTGGGGAAAGTCACCATATCCTTATTGGTGGGGGAATGTGGATCTCTCCAATAACCAACTA
>augustus_masked-Fvb4-3-processed-gene-25.14:1377:1497:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-25.14:1377-1497||RAPiDGENOMICS_rs1205_02473
AGAGGACAGCTTCCTAAACTGGTAAATTTTGCTGAAGGGGCATCTGTCAATTTGAATAGCAACTCCTTGGAGGGTTCCCTTCCATTTTGGCCAAACGTGACTGAACTCGCTTTGGCAAGC
>augustus_masked-Fvb4-3-processed-gene-25.14:1497:1617:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_7::augustus_masked-Fvb4-3-processed-gene-25.14:1497-1617||RAPiDGENOMICS_rs1205_02474
AATCGATTTTCTGGACCAATTCCCTTAAACATTGGCCAGGAGATGCCAAATATGAATATCCTAGATCTTTCAAGGAATAATCTAAATGGTAGCATTCCTTCTTCCATAAGTAAGATGAAG
>augustus_masked-Fvb4-3-processed-gene-25.14:1557:1677:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_7::augustus_masked-Fvb4-3-processed-gene-25.14:1557-1677|2x||RAPiDGENOMICS_rs1205_02475
CTAGATCTTTCAAGGAATAATCTAAATGGTAGCATTCCTTCTTCCATAAGTAAGATGAAGAGTTTGACTTCTCTTGATCTCTGGAGGAATTATTTATCCGGAAATATCCCTAGTGATTGG
>augustus_masked-Fvb4-3-processed-gene-25.14:1617:1737:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_8::augustus_masked-Fvb4-3-processed-gene-25.14:1617-1737||RAPiDGENOMICS_rs1205_02476
AGTTTGACTTCTCTTGATCTCTGGAGGAATTATTTATCCGGAAATATCCCTAGTGATTGGAAGGGATTACAGAGCTTGACGACCATAGATTTTTCCAATAACAATCTTTCTGGTCAAATT
>augustus_masked-Fvb4-3-processed-gene-25.14:1677:1797:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_8::augustus_masked-Fvb4-3-processed-gene-25.14:1677-1797|2x||RAPiDGENOMICS_rs1205_02477
AAGGGATTACAGAGCTTGACGACCATAGATTTTTCCAATAACAATCTTTCTGGTCAAATTCCAAGCTCCATGTGCTCACAACTACCTTCACTTTTCTGGTTGAGGTTAAGCAATAACAAT
>augustus_masked-Fvb4-3-processed-gene-25.14:180:300:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-25.14:180-300|2x||RAPiDGENOMICS_rs1205_02478
TATGGTCAGCTTTCGTCTTGGGTTGGGGAGGACTGCTGCAATTGGACAGGCATAGGGTGCAGCAACCAAACAGGCAATGTCCTCAAGCTTGATCTTAGCCAGCCATTTTCCTGTGTCGAA
>augustus_masked-Fvb4-3-processed-gene-25.14:240:360:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_3::augustus_masked-Fvb4-3-processed-gene-25.14:240-360||RAPiDGENOMICS_rs1205_02479
AGCAACCAAACAGGCAATGTCCTCAAGCTTGATCTTAGCCAGCCATTTTCCTGTGTCGAAAAACCTACAGTAGCAACTGGTGGTTATATCTGGGCATGCTTATTAGGTGGTGAGTTAGAT
>augustus_masked-Fvb4-3-processed-gene-25.14:300:420:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_3::augustus_masked-Fvb4-3-processed-gene-25.14:300-420|2x||RAPiDGENOMICS_rs1205_02480
AAACCTACAGTAGCAACTGGTGGTTATATCTGGGCATGCTTATTAGGTGGTGAGTTAGATCCTTCTTTGCTTAGTTTAACATACTTGAATTACTTGGACCTCAGTTACAACAATTTTCAA
>augustus_masked-Fvb4-3-processed-gene-25.14:360:480:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-25.14:360-480||RAPiDGENOMICS_rs1205_02481
CCTTCTTTGCTTAGTTTAACATACTTGAATTACTTGGACCTCAGTTACAACAATTTTCAAGGAATTGCTATTCCAAGTTTCCTAGGTTCACTCAAGAAATTGAGGTATCTTGACCTCTCC
>augustus_masked-Fvb4-3-processed-gene-25.14:420:540:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-25.14:420-540|2x||RAPiDGENOMICS_rs1205_02482
GGAATTGCTATTCCAAGTTTCCTAGGTTCACTCAAGAAATTGAGGTATCTTGACCTCTCCCAATCATCATTTGGAGGAATAGTTCCTCCTCAACTAGGGAATCTGTCAAACTTGTTTTAC
>augustus_masked-Fvb4-3-processed-gene-25.14:480:600:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-25.14:480-600||RAPiDGENOMICS_rs1205_02483
CAATCATCATTTGGAGGAATAGTTCCTCCTCAACTAGGGAATCTGTCAAACTTGTTTTACCTTGATCTGACCACATATTCATATCCACAAAATCTATGGATTTCAGATTTTTATTGGCTC
>augustus_masked-Fvb4-3-processed-gene-25.14:540:660:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-25.14:540-660|2x||RAPiDGENOMICS_rs1205_02484
CTTGATCTGACCACATATTCATATCCACAAAATCTATGGATTTCAGATTTTTATTGGCTCTCTAGTCTCTCTTCCTTGCAGTACCTGAGTTTGGGAAACTTAAACCTTAGCCTGGCAACA
>augustus_masked-Fvb4-3-processed-gene-25.14:60:180:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-25.14:60-180|2x||RAPiDGENOMICS_rs1205_02485
GCATACTCTACCTTCCTTGAAGCCAAGTTGGCCAACTCTGGTGTTAAGGGTTTTAGGGTGGCTTGTAATGAGGAGGAAAGAGCAGCCCTCCTTAAATTCAGGCAAGGCCTTAAAGATCCT
>augustus_masked-Fvb4-3-processed-gene-25.14:600:720:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-25.14:600-720||RAPiDGENOMICS_rs1205_02486
TCTAGTCTCTCTTCCTTGCAGTACCTGAGTTTGGGAAACTTAAACCTTAGCCTGGCAACAACCAATTGGCTACCTGCTGTTAATATGCTTCCTTCACTGTTAGAGTTGCATTTGCCTGAC
>augustus_masked-Fvb4-3-processed-gene-25.14:777:897:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-25.14:777-897||RAPiDGENOMICS_rs1205_02487
GAACTTATTGAAGGTTTGTCCAGATGCAGTAATAGTAGCTTAAAATTGTTAGATGTCAGTTTTAATAATGTCAGGGGGTTACTGCCTGATTCTTTGGGCTCCCTTCAATATTTGAAAACT
>augustus_masked-Fvb4-3-processed-gene-25.14:897:1017:Parent=augustus_masked-Fvb4-3-processed-gene-25.14-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-25.14:897-1017||RAPiDGENOMICS_rs1205_02488
CTCAGAATCAGTCAAAATGCACTCTTTGGTCCACTTCCAACAATAGTAGGAAACCTGTCACATTTGCATGTCCTCGACCTATCATTTAACATGATGAATGGAACAATTCCAGAAAGCATT
>augustus_masked-Fvb4-3-processed-gene-3.20:1560:1680:Parent=augustus_masked-Fvb4-3-processed-gene-3.20-mRNA-1_14::augustus_masked-Fvb4-3-processed-gene-3.20:1560-1680||RAPiDGENOMICS_rs1205_02489
AGGGGATTGCAGTACAATCAAGTTTGGAGTTTTCCACCGACGCTGGAACTTAGCAACAATAATTTCAGTGGACAGATCTGGCCAGAATTTGGGAACCTGAAATCCCTTCATGTATTGGAT
>augustus_masked-Fvb4-3-processed-gene-3.20:1740:1860:Parent=augustus_masked-Fvb4-3-processed-gene-3.20-mRNA-1_15::augustus_masked-Fvb4-3-processed-gene-3.20:1740-1860|2x||RAPiDGENOMICS_rs1205_02490
GAGACTTTGGATTTGTCTCATAACAAGCTTTCAGGGATAATACCCAGTTCATTGATTCGTCTCAGTTTTTTGTCCAAGTTCAGTGTTGCAGACAATCAATTAGAGGGGGAGATCCCTAAT
>augustus_masked-Fvb4-3-processed-gene-3.20:1920:2040:Parent=augustus_masked-Fvb4-3-processed-gene-3.20-mRNA-1_17::augustus_masked-Fvb4-3-processed-gene-3.20:1920-2040||RAPiDGENOMICS_rs1205_02491
CATGCTCCTCCATGTCCATCCAAGGTTCATACTTATCTCGATCAAACCAGAAAATCAAGAATGAATGTATTTGGAGTAGAATATAGAGGAGTTGTCATTGCAATAGCTGTGGGATTTGTA
>augustus_masked-Fvb4-3-processed-gene-3.20:300:420:Parent=augustus_masked-Fvb4-3-processed-gene-3.20-mRNA-1_3::augustus_masked-Fvb4-3-processed-gene-3.20:300-420|2x||RAPiDGENOMICS_rs1205_02492
TCTTTGGGGAATTTGGTACAACTTAGAGCCCTCAATCTTTCTCACAATTTCCTTAAAAACTCACTTCCTGCTTCACTTTTCCAATTGCCAAACTTAGAGTACTTAGACTTGAGTTCTAAT
>augustus_masked-Fvb4-3-processed-gene-3.20:360:480:Parent=augustus_masked-Fvb4-3-processed-gene-3.20-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-3.20:360-480||RAPiDGENOMICS_rs1205_02493
TCACTTCCTGCTTCACTTTTCCAATTGCCAAACTTAGAGTACTTAGACTTGAGTTCTAATGACTTTTCTGGTCCCATTCCAGTCGATTTCAATTTACCTTCGATCCTGTCACTTGACATC
>augustus_masked-Fvb4-3-processed-gene-3.20:480:600:Parent=augustus_masked-Fvb4-3-processed-gene-3.20-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-3.20:480-600||RAPiDGENOMICS_rs1205_02494
TCTCAAAATTTATTGAATGGTTCTATTCCACAAAGCATTTGTGTAAATTCTACTCGGCTTCAGGTTCTGAAGTTGGCTGTGAACTACTTGTCTGGTAGTCTTCCAGAAAGTCTTGCCAAT
>augustus_masked-Fvb4-3-processed-gene-3.20:840:960:Parent=augustus_masked-Fvb4-3-processed-gene-3.20-mRNA-1_8::augustus_masked-Fvb4-3-processed-gene-3.20:840-960||RAPiDGENOMICS_rs1205_02495
GCTCATTCCAATAATTTCAGCGGTCCGATACCCCATTCCTTGTCAAGTTCTCCAACCATCTCGTTTCTGAATGTGAGAAACAACTCATTGGATGGTCCAATCGATCTAAATTGTTCAGCA
>augustus_masked-Fvb4-3-processed-gene-318.3:0:120:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-318.3:0-120||RAPiDGENOMICS_rs1205_02496
ATGATGGAAGAGGAACAAGGAGGACAAGAGCGAATATTCGTAGGGGGATTGGGAGGGAGCGTGACGGAAGACGATCTGCATAGGCTCTTCACCGTAGTTGGAGGAAGCGTCCACGGAATC
>augustus_masked-Fvb4-3-processed-gene-318.3:1026:1146:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_3::augustus_masked-Fvb4-3-processed-gene-318.3:1026-1146||RAPiDGENOMICS_rs1205_02497
CAACTTGTCGGTCATAGGGACAACAGTGGGTTCAGTGTCTCACGTATACTGACAGGCAGATCTTCTACTGCCCATACTGAACCGAAAACTGGCACTTCTGATGTGCAGCAGTCTGACACC
>augustus_masked-Fvb4-3-processed-gene-318.3:1146:1266:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-318.3:1146-1266||RAPiDGENOMICS_rs1205_02498
AGAAACCAGGACCTGGCAAGTAATGGAAACTCGGAAGGCCAGCTGTCTGAGATGGAACCACATGAGGAAAGTGCAGAACATAAACCTACCAAATCAGTATCTGACTCATATACGTCAGGT
>augustus_masked-Fvb4-3-processed-gene-318.3:1417:1537:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-318.3:1417-1537|2x||RAPiDGENOMICS_rs1205_02499
CCGCCCTCCAAGCATGGAAGTCGGCCATCTTCTCGGACCCTACCAACTTCACTTCCAACTGGAACGGGTCGGACGTCTGCTCCTACATGGGAGTCTTCTGCACTGCTCTCCCCTCAGTCG
>augustus_masked-Fvb4-3-processed-gene-318.3:1837:1957:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-318.3:1837-1957||RAPiDGENOMICS_rs1205_02500
CCATTTTCCTCAACGACAACAGGTTCCGGATGGGCATCCCCCACAATCTCGGCAACTCGCCCGTTTCGGTGCTTGTGTTGGCCAACAATAATCTTGGGGGTTGCATTCCTGGTAGCATCG
>augustus_masked-Fvb4-3-processed-gene-318.3:1957:2077:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-318.3:1957-2077||RAPiDGENOMICS_rs1205_02501
GCAACATGTGGAAGACTCTCAACGAGATTATTCTGTTGAATGACAATCTCACCGGTTGCTTGCCTCCCCAGATCGGCCGCCTCCGGAATCTCACCGTCTTTGATGTGAGCTTCAACCATC
>augustus_masked-Fvb4-3-processed-gene-318.3:2017:2137:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-318.3:2017-2137|2x||RAPiDGENOMICS_rs1205_02502
TGCCTCCCCAGATCGGCCGCCTCCGGAATCTCACCGTCTTTGATGTGAGCTTCAACCATCTTCAAGGGCCTCTGCCCTCCGCCTCCATAGCCAAAATGAAGAGCTTGGAGGAGCTCGACG
>augustus_masked-Fvb4-3-processed-gene-318.3:207:327:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-318.3:207-327||RAPiDGENOMICS_rs1205_02503
TACAATGGGTGCGTGTGGAAGGGTGGGAAGCTCAAGGTCCACAAGGCTAAACAACACTATCTTGTTCGTATGAGACGTGAATGGGCTGAGCTAGAAGCTGCTCAACTCGCTGCTGCAGAA
>augustus_masked-Fvb4-3-processed-gene-318.3:2137:2257:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_7::augustus_masked-Fvb4-3-processed-gene-318.3:2137-2257|2x||RAPiDGENOMICS_rs1205_02504
TCGCCCATAACAGATTCACTGGTGTAATACCGGCCAGCATTTGTCAACTGCCAGCCTTGCGCAACTTCACCTATTCCTTCAACTACTTCACCGGAGAGGCTCCTGCTTGCACCGCTACTC
>augustus_masked-Fvb4-3-processed-gene-318.3:417:537:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-318.3:417-537||RAPiDGENOMICS_rs1205_02505
GTGAAAGCTTTGCCCTTCAGTGGAACCGGCAAGCACAAATATAGTTTCCAACGTCTTCAGGTTCCTTCTCTCCCCCTTCATTTCTGTGACTGTGAAGAGCATGCTGTGCCTGACCCTTCT
>augustus_masked-Fvb4-3-processed-gene-318.3:537:657:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-318.3:537-657||RAPiDGENOMICS_rs1205_02506
CCTCACCAACTAAACCAATTATCTGACCATGTTATCAATGCCAAGGAGCTTACTATTATGAATAAAGTAATGGGCAAGCTCTTACAAAAGGAAGTTGAACATGTTTCTGATGATGCTCAA
>augustus_masked-Fvb4-3-processed-gene-318.3:657:777:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_3::augustus_masked-Fvb4-3-processed-gene-318.3:657-777||RAPiDGENOMICS_rs1205_02507
CACAATACTACTGCCCTGCCTCTGTCTCTGCCTACTCAACAACATCATGAATCAGAAGCCGAGGAAGATGACCTCATCATTAATATTGTGTCAACTAAACAAGAAGAAAACGTACTGTCC
>augustus_masked-Fvb4-3-processed-gene-318.3:786:906:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-318.3:786-906||RAPiDGENOMICS_rs1205_02508
GAATTGAGATCCAGTGGAACACAGGTGCGCACAAAGATTAATGCACCTCCTAACAAAAAGAGGAAATCCCTTGTCAACAATAATTACTGTGAAATAGAATTGGAGCCTCATATCTCTGCC
>augustus_masked-Fvb4-3-processed-gene-318.3:906:1026:Parent=augustus_masked-Fvb4-3-processed-gene-318.3-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-318.3:906-1026||RAPiDGENOMICS_rs1205_02509
GGAAAGACAGATTCTAAATCTCGTTCAAATAAACTCTTCGAAGCTCAACCAGAACAACCAGAACTCAGTGTCCAACTATCAACTGCCCCTGTTTCATGGTCTCAGAAATGTTCATGGAAA
>augustus_masked-Fvb4-3-processed-gene-38.15:0:120:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-38.15:0-120||RAPiDGENOMICS_rs1205_02510
ATGGCTCTAGAAGTAGTGGGTGGAGCTCTTCTCTCTTCTGCTCTTGCTGTTCTGTTTGATAGGATCGCTTCCCGTCCCGTTGTTGACTTCATCCGAGGGAAGAAGACCACTGCTGGGCTG
>augustus_masked-Fvb4-3-processed-gene-38.15:1080:1200:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_10::augustus_masked-Fvb4-3-processed-gene-38.15:1080-1200||RAPiDGENOMICS_rs1205_02511
AAACAGATTGCTCAAAAGTGTAAAGGACTCCCTTTAGCTGCAAAATCACTTGGGTGTCTTTTACGTTCTGAATCAAATATTGAGAAATGGGAAGAAATATTGAACAATGACATATGGGAG
>augustus_masked-Fvb4-3-processed-gene-38.15:120:240:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-38.15:120-240||RAPiDGENOMICS_rs1205_02512
CTCGAGAAGTTGAATAACAAGTTGTTGTCAGTTAACAATTTGCTTGATGATGCAGAGGAGAGGCAAATCAGAGAACCTGAAGTGAGGAAATGGCTTGATGAGCTTAAAGATGTTCTGTAT
>augustus_masked-Fvb4-3-processed-gene-38.15:1200:1320:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_11::augustus_masked-Fvb4-3-processed-gene-38.15:1200-1320||RAPiDGENOMICS_rs1205_02513
TTGCAAGATAGAGAGAATGACATTTTGCCAGCTCTATGGTTGAGTTACTATTATCTACCTCCACATCTGAAGCGTTGTTTTGCTTACTGTTCCTTATTTCCTGAAGATTATGTGTTTGAC
>augustus_masked-Fvb4-3-processed-gene-38.15:1260:1380:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_11::augustus_masked-Fvb4-3-processed-gene-38.15:1260-1380|2x||RAPiDGENOMICS_rs1205_02514
CCACATCTGAAGCGTTGTTTTGCTTACTGTTCCTTATTTCCTGAAGATTATGTGTTTGACAAAAGGGAACTGGTTTTGTTGTGGATGGCTGAGGATCTCTTACCGTCGAAATCAAAGACT
>augustus_masked-Fvb4-3-processed-gene-38.15:1320:1440:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_12::augustus_masked-Fvb4-3-processed-gene-38.15:1320-1440||RAPiDGENOMICS_rs1205_02515
AAAAGGGAACTGGTTTTGTTGTGGATGGCTGAGGATCTCTTACCGTCGAAATCAAAGACTGCATTTGAACAAGTCGGAGAGAACTACTTTGATGATTTATTGTCAAGGTCATTTTTTCTA
>augustus_masked-Fvb4-3-processed-gene-38.15:1440:1560:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_13::augustus_masked-Fvb4-3-processed-gene-38.15:1440-1560||RAPiDGENOMICS_rs1205_02516
CGGGGACAACATCCTTCTTCTTTCACCATGCATGATCTTATCCATAACTTGGCAAACTTTGTCTCTGGAGAGTTTTGTGTTAGGTTGGAGAATAATGACTCTGTACTGGAAAATGTCGGC
>augustus_masked-Fvb4-3-processed-gene-38.15:1560:1680:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_14::augustus_masked-Fvb4-3-processed-gene-38.15:1560-1680||RAPiDGENOMICS_rs1205_02517
AAGGCTCGCCACTTCTCCTATATCAATTATGCACATGGAACCAGCACTTTTGATCAATGGGACAGCTTGTATAAAGCCAAGTATTTGAGGACCTTTCTACCAAAATCAGAATATACCCCC
>augustus_masked-Fvb4-3-processed-gene-38.15:1680:1800:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_15::augustus_masked-Fvb4-3-processed-gene-38.15:1680-1800||RAPiDGENOMICS_rs1205_02518
CTACCTAGAGTAAATTTTGGTATATTCCTGAAGCTTCAGTATTTAAGAGTGCTTAGATTACCAGGGTCCGATATTCATGAGCTGCCCAAGTCAGTTACCAAGTTGAAGCACCTGAGGCAC
>augustus_masked-Fvb4-3-processed-gene-38.15:1800:1920:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_16::augustus_masked-Fvb4-3-processed-gene-38.15:1800-1920||RAPiDGENOMICS_rs1205_02519
CTTGACTTGTCAGGCACATTAATTAGAAAGTTACCTGATGAGATATGTACTTTTATTAATTTAAAGACCTTATTGTTGACGTGGTGTGGACGTCTAGTTGAGTTGCCAACTGATTTCAGA
>augustus_masked-Fvb4-3-processed-gene-38.15:1920:2040:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_17::augustus_masked-Fvb4-3-processed-gene-38.15:1920-2040||RAPiDGENOMICS_rs1205_02520
AGATTAGTAAACTTACGTCATCTTGATATTAGAGGCACAGAGATAAAGAAGATGCCACCGGGGATGGGGAAAATGAAAGATCTGCAAACATTAAGAGGTGAGTTTGTCCTAGACAAAAAT
>augustus_masked-Fvb4-3-processed-gene-38.15:2040:2160:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_18::augustus_masked-Fvb4-3-processed-gene-38.15:2040-2160||RAPiDGENOMICS_rs1205_02521
ACTGGTGGTAACATTGCAGAGATTAAAGAGCTTGAGCAGTTGCGAGAAACACTAAGTATCTCTGGGCTTCGCAATATTGCGCATGCGACGGATGCCATGGAGGCCAATATCAGGAAGAAG
>augustus_masked-Fvb4-3-processed-gene-38.15:2160:2280:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_19::augustus_masked-Fvb4-3-processed-gene-38.15:2160-2280||RAPiDGENOMICS_rs1205_02522
TATTTGAATGAATTAGTCTTGGACTGGGGAGGAAAGTCTGCTGATACGAACGATACAGAGAAAGAGAGAGATGTGCTGGACAACCTCCAACCTCATACAAACGTGAAAGAACTCAGGATA
>augustus_masked-Fvb4-3-processed-gene-38.15:2280:2400:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_20::augustus_masked-Fvb4-3-processed-gene-38.15:2280-2400||RAPiDGENOMICS_rs1205_02523
AAATCATACGGGGGTACAAGATTTCCAGGTTGGTTGGAACATCATTGTAATTTGGTTCGTCTTCATCTTGTGGATTGTGGAAATTGTTTGTTCTTGCGGTCAGTTGAGCAGCTACCCTCC
>augustus_masked-Fvb4-3-processed-gene-38.15:240:360:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_3::augustus_masked-Fvb4-3-processed-gene-38.15:240-360||RAPiDGENOMICS_rs1205_02524
CACGCCGATGATCTATTGGATGAAATCAAGACTGCAGCTCTGCGTAGCAACATGGAACGAGAAGATTCTGGAAGCAGCTGCTGCAGCACATATCAGGTACTCAAGTTTTGTTCTAGTTCC
>augustus_masked-Fvb4-3-processed-gene-38.15:2400:2520:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_21::augustus_masked-Fvb4-3-processed-gene-38.15:2400-2520||RAPiDGENOMICS_rs1205_02525
CTCGAGGATCTTCGAATTGAAGAATTTAATGGAGAGGTGACTATGGTTTCTAAGCCTTGTCCTAATCTTCGTAGGCTGATTGTGAGGTCTTGTCCCCAGCTAACCGGGACATTCATGTTA
>augustus_masked-Fvb4-3-processed-gene-38.15:2520:2640:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_22::augustus_masked-Fvb4-3-processed-gene-38.15:2520-2640||RAPiDGENOMICS_rs1205_02526
TCCAACTTCCCAAAGCTTGAAAGCCTCGACTTGAGTGATGTCAATGTAGCATCTCTTCATTCCCCTTCACTCCTCGCCCTTGTCAGTCTTAAAATATATAATTGCCCAAATTTTGTTGGT
>augustus_masked-Fvb4-3-processed-gene-38.15:2640:2760:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_23::augustus_masked-Fvb4-3-processed-gene-38.15:2640-2760||RAPiDGENOMICS_rs1205_02527
TTTACCGATGGAGGGCTGGATGCGCCCAATTTGGAGACCATAGATCTCACAAGTTGTTGGAAACTGAGGTCATTGCCACAACACATGCACAACCTTCTCCCATCTCTCAGGATGTTGTCC
>augustus_masked-Fvb4-3-processed-gene-38.15:2760:2880:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_24::augustus_masked-Fvb4-3-processed-gene-38.15:2760-2880||RAPiDGENOMICS_rs1205_02528
CTACATGATTGTCCGGAATTGGAATCATTTCCCGAAGGAGGATTGCCGTCTAAGTTAGGAGACTTATACATCTGGCGTTGCAAGAAACTCAGTGGAAGCCGCATGCAGTGGGGTCTACCA
>augustus_masked-Fvb4-3-processed-gene-38.15:2880:3000:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_25::augustus_masked-Fvb4-3-processed-gene-38.15:2880-3000||RAPiDGENOMICS_rs1205_02529
ACACTCACCTCTCTCAGATTCTTGACCGTCGACTTCGAGGGATGTGAACAAGTAGATTCATTTCCAGACGAGGGGCGGCTGCCCACCACTCTCTCACAACTCCGCATCAAGGGAATTTCG
>augustus_masked-Fvb4-3-processed-gene-38.15:3000:3120:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_26::augustus_masked-Fvb4-3-processed-gene-38.15:3000-3120||RAPiDGENOMICS_rs1205_02530
AAGCTGGATGGCAAGGGGTTAGGACAACTCACCTCTCTTAAACAGTTGGATATTGGTTATTGCCCTCAACTCCAGTGCTTGCCAGATGAAGGGCTACCCACTTCCCTTTCTTATCTGGAA
>augustus_masked-Fvb4-3-processed-gene-38.15:360:480:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-38.15:360-480||RAPiDGENOMICS_rs1205_02531
GTTGGAAAAAGTGTGGAACCTAGGATACAAAAGATTCTTGACAGACTAGAGCTTATTGTCAACGAAAAAGATGGGCTTCATTTGAATGTGGGTGTTAAAGATAGACCACAAGCAACACGG
>augustus_masked-Fvb4-3-processed-gene-38.15:420:540:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-38.15:420-540|2x||RAPiDGENOMICS_rs1205_02532
AACGAAAAAGATGGGCTTCATTTGAATGTGGGTGTTAAAGATAGACCACAAGCAACACGGTGTACAACTTCTTTGGTAGAAGAGTCTAGTGTATATGGAAGGGGTGAAGAAAAGGAGGCC
>augustus_masked-Fvb4-3-processed-gene-38.15:480:600:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-38.15:480-600||RAPiDGENOMICS_rs1205_02533
TGTACAACTTCTTTGGTAGAAGAGTCTAGTGTATATGGAAGGGGTGAAGAAAAGGAGGCCATTGTCCAGTTATTGCTAGCAGATGGCAAGACTGAAATAAAGACAGATATGCTTCCACTT
>augustus_masked-Fvb4-3-processed-gene-38.15:540:660:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_5::augustus_masked-Fvb4-3-processed-gene-38.15:540-660|2x||RAPiDGENOMICS_rs1205_02534
ATTGTCCAGTTATTGCTAGCAGATGGCAAGACTGAAATAAAGACAGATATGCTTCCACTTGTGGGCATGGGTGGGATCGGCAAGACCACGCTTGCTCAACTTGTATACAACGATGACAGA
>augustus_masked-Fvb4-3-processed-gene-38.15:600:720:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-38.15:600-720||RAPiDGENOMICS_rs1205_02535
GTGGGCATGGGTGGGATCGGCAAGACCACGCTTGCTCAACTTGTATACAACGATGACAGAATCAAGCAACATTTTGTCCATCGATCTTGGTTTTGTGTTTCAGAAGGTTTTGATATTACC
>augustus_masked-Fvb4-3-processed-gene-38.15:660:780:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-38.15:660-780|2x||RAPiDGENOMICS_rs1205_02536
ATCAAGCAACATTTTGTCCATCGATCTTGGTTTTGTGTTTCAGAAGGTTTTGATATTACCAAAATAACAAAGTCTATTTACCGGTCGGTAACTTCAGAAGTTTGTGATATCGAAGACCTT
>augustus_masked-Fvb4-3-processed-gene-38.15:720:840:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_7::augustus_masked-Fvb4-3-processed-gene-38.15:720-840||RAPiDGENOMICS_rs1205_02537
AAAATAACAAAGTCTATTTACCGGTCGGTAACTTCAGAAGTTTGTGATATCGAAGACCTTGATCTGCTTCAAGTTAAACTGAAGACGTCATTGACAGGGAAGAAATTTCTCATTGTTTTT
>augustus_masked-Fvb4-3-processed-gene-38.15:780:900:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_7::augustus_masked-Fvb4-3-processed-gene-38.15:780-900|2x||RAPiDGENOMICS_rs1205_02538
GATCTGCTTCAAGTTAAACTGAAGACGTCATTGACAGGGAAGAAATTTCTCATTGTTTTTGACGATGTTTGGACAGTGAATAATAGAGATTGGGAACTCTTGAGCCGACCCTTTGAGAGT
>augustus_masked-Fvb4-3-processed-gene-38.15:840:960:Parent=augustus_masked-Fvb4-3-processed-gene-38.15-mRNA-1_8::augustus_masked-Fvb4-3-processed-gene-38.15:840-960||RAPiDGENOMICS_rs1205_02539
GACGATGTTTGGACAGTGAATAATAGAGATTGGGAACTCTTGAGCCGACCCTTTGAGAGTGGAGGTAATGGAAGTAAGATCATTGTCACAACACGTGATGAAGGAGTTGCACGCAGTATT
>augustus_masked-Fvb4-3-processed-gene-4.7:0:120:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-4.7:0-120||RAPiDGENOMICS_rs1205_02540
ATGAGGGATCAAGATTTCTGGTCTGTTATCTTTGTAATTGGGTTCTGCTTCCAGCCACTAGTTTTGAGCACTCAGAACCTGACCTGCAATCTCAATGATTTGAATGCATTGGAGGGTTTC
>augustus_masked-Fvb4-3-processed-gene-4.7:1080:1200:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_10::augustus_masked-Fvb4-3-processed-gene-4.7:1080-1200||RAPiDGENOMICS_rs1205_02541
CAAATTCCTGACAGCTTCAAGGACTTTCATACTCTCAGATACCTCTTACTTTCAAATGCCAGCTATTCTAATCTATCATCTGCCCTTCATATCTTACAGCAGTGTCAGAATCTAACGACT
>augustus_masked-Fvb4-3-processed-gene-4.7:120:240:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_2::augustus_masked-Fvb4-3-processed-gene-4.7:120-240||RAPiDGENOMICS_rs1205_02542
ATGGGTGGTCTGCAGAGTACCCTTGGTAATTGGGGCAGGAATTTATCTGGTGATTGCTGTAAATGGGCAGGTATTACTTGCAACTCTTCCTTCTCTCTTGGATTGGATGATTCTGTTGAT
>augustus_masked-Fvb4-3-processed-gene-4.7:1260:1380:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_11::augustus_masked-Fvb4-3-processed-gene-4.7:1260-1380|2x||RAPiDGENOMICS_rs1205_02543
CCAAGGTTGAAGGTATTTATTCTTGCAAATTCTCGGCTCACGGGTTCGATACCCCAATGGTTGAGTAAGAGCAGCAGATTGCAGTTACTGGATATATCATGGAACTGCTTGGAGGGTACA
>augustus_masked-Fvb4-3-processed-gene-4.7:1320:1440:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_12::augustus_masked-Fvb4-3-processed-gene-4.7:1320-1440||RAPiDGENOMICS_rs1205_02544
TTGAGTAAGAGCAGCAGATTGCAGTTACTGGATATATCATGGAACTGCTTGGAGGGTACAGTTCCAGCTTGGTTTGGCAATTTTACTAATCTCTTCTACTTGGACATATCAAACAATACT
>augustus_masked-Fvb4-3-processed-gene-4.7:1380:1500:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_12::augustus_masked-Fvb4-3-processed-gene-4.7:1380-1500|2x||RAPiDGENOMICS_rs1205_02545
GTTCCAGCTTGGTTTGGCAATTTTACTAATCTCTTCTACTTGGACATATCAAACAATACTTTTAATGGGGAGATCCCGAGAAGCTTAACTGGACTACAGAGCCTCATTGATGGGAATTTT
>augustus_masked-Fvb4-3-processed-gene-4.7:1440:1560:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_13::augustus_masked-Fvb4-3-processed-gene-4.7:1440-1560||RAPiDGENOMICS_rs1205_02546
TTTAATGGGGAGATCCCGAGAAGCTTAACTGGACTACAGAGCCTCATTGATGGGAATTTTTCCTCACTTCAGGAACCTTCCCCTGACTTCCCAGTTTTCTGGAAAAGGAATTTGAGTGCC
>augustus_masked-Fvb4-3-processed-gene-4.7:1500:1620:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_13::augustus_masked-Fvb4-3-processed-gene-4.7:1500-1620|2x||RAPiDGENOMICS_rs1205_02547
TCCTCACTTCAGGAACCTTCCCCTGACTTCCCAGTTTTCTGGAAAAGGAATTTGAGTGCCAGAGGATTGCAGTACAATAAATTTTGGAGATTTCCTCCAACACTGGATCTCAGCAACAAT
>augustus_masked-Fvb4-3-processed-gene-4.7:1560:1680:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_14::augustus_masked-Fvb4-3-processed-gene-4.7:1560-1680||RAPiDGENOMICS_rs1205_02548
AGAGGATTGCAGTACAATAAATTTTGGAGATTTCCTCCAACACTGGATCTCAGCAACAATAATTTCAGTGGACAGATCTGGCCAGAATTTGGGAACCTGAAATCCCTTCATGTATTGGAT
>augustus_masked-Fvb4-3-processed-gene-4.7:1620:1740:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_14::augustus_masked-Fvb4-3-processed-gene-4.7:1620-1740|2x||RAPiDGENOMICS_rs1205_02549
AATTTCAGTGGACAGATCTGGCCAGAATTTGGGAACCTGAAATCCCTTCATGTATTGGATCTAAAGTGCAACAATTTATCTGGACCAATTCCGAGTTATTTATCTGAAATGACCAACTTG
>augustus_masked-Fvb4-3-processed-gene-4.7:1680:1800:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_15::augustus_masked-Fvb4-3-processed-gene-4.7:1680-1800||RAPiDGENOMICS_rs1205_02550
CTAAAGTGCAACAATTTATCTGGACCAATTCCGAGTTATTTATCTGAAATGACCAACTTGGAGACTATGGATTTGTCTCATAACAAGCTTTCAGGGGAAATACCGCATTCATTAGTTCGT
>augustus_masked-Fvb4-3-processed-gene-4.7:1740:1860:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_15::augustus_masked-Fvb4-3-processed-gene-4.7:1740-1860|2x||RAPiDGENOMICS_rs1205_02551
GAGACTATGGATTTGTCTCATAACAAGCTTTCAGGGGAAATACCGCATTCATTAGTTCGTCTCAACTTTTTGTCCAAGTTTAGTGTTGCAGACAACCAGTTAGAGGGGGTGATCCCTGCA
>augustus_masked-Fvb4-3-processed-gene-4.7:1800:1920:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_16::augustus_masked-Fvb4-3-processed-gene-4.7:1800-1920||RAPiDGENOMICS_rs1205_02552
CTCAACTTTTTGTCCAAGTTTAGTGTTGCAGACAACCAGTTAGAGGGGGTGATCCCTGCAGGAGGTCAGTTTGGGACCTTCTCAAATTCAAGCTTTCAAGGGAATAATCTTTGCGGATAT
>augustus_masked-Fvb4-3-processed-gene-4.7:1920:2040:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_17::augustus_masked-Fvb4-3-processed-gene-4.7:1920-2040||RAPiDGENOMICS_rs1205_02553
TATGCTTCCTCTTGTCTATCTTACTCAAAACCACAGCCACAGCCACAGACACACAGCAGAATAAGAGTAGAATATAGAGGAGTTGTCATTGGAATAGCTGTGGGATTTGTATTTGGAGTA
>augustus_masked-Fvb4-3-processed-gene-4.7:360:480:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_4::augustus_masked-Fvb4-3-processed-gene-4.7:360-480||RAPiDGENOMICS_rs1205_02554
TCGCTTCCTGCTTCACTTTTCCAATTGCCAAACTTAAAGCACTTAGACTTGAGTTCTAATGACTTTTCTGGCCCCATTCCAGATAATTTCAATTTACCTTCGATTCTGTCACTTGACATC
>augustus_masked-Fvb4-3-processed-gene-4.7:720:840:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_7::augustus_masked-Fvb4-3-processed-gene-4.7:720-840||RAPiDGENOMICS_rs1205_02555
ACGCTGAGCAAAGAAGTTGGTAACCTGATTAACCTTGTTCGTTTGGATATCTCGAGTAATTGGTTTTCAGGAAGAATCCCAGATGTCTTCCACAGCCTTCGAAGATTACAGTATTTTGAT
>augustus_masked-Fvb4-3-processed-gene-4.7:840:960:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_8::augustus_masked-Fvb4-3-processed-gene-4.7:840-960||RAPiDGENOMICS_rs1205_02556
GCTCATTCCAATAACTTGAGTGGCAAGATACCCCCTTCCCTGTCAAGTTCTCCAACCATCTGGTTGCTGAATGTGAGAAACAACTCATTGGATGGTCCAATTGATCTAAATTGTTCAGCA
>augustus_masked-Fvb4-3-processed-gene-4.7:900:1020:Parent=augustus_masked-Fvb4-3-processed-gene-4.7-mRNA-1_8::augustus_masked-Fvb4-3-processed-gene-4.7:900-1020|2x||RAPiDGENOMICS_rs1205_02557
TGGTTGCTGAATGTGAGAAACAACTCATTGGATGGTCCAATTGATCTAAATTGTTCAGCAATGACAAGTTTGGTCTCTCTTGATCTAGGTTCAAATAAGTTTGATGGGGTTACTCCATCT
>augustus_masked-Fvb4-3-processed-gene-4.9:0:120:Parent=augustus_masked-Fvb4-3-processed-gene-4.9-mRNA-1_1::augustus_masked-Fvb4-3-processed-gene-4.9:0-120||RAPiDGENOMICS_rs1205_02558
ATGGGTGTTCAAGATTTGTGGGTGGTCATCTTTGTTATTGGGTTTTGCTTCCAAGCTCAGGTTTTGAGCTCTCAGAACCTGACCTGCAATCTCAATGATTTGAACGCATTGGAGGGTTTC
>augustus_masked-Fvb4-3-processed-gene-4.9:1140:1260:Parent=augustus_masked-Fvb4-3-processed-gene-4.9-mRNA-1_10::augustus_masked-Fvb4-3-processed-gene-4.9:1140-1260|2x||RAPiDGENOMICS_rs1205_02559
AGCTATTCTAATCTATCATCTGCCCTTCATATCTTACAGCAGTGTCAGAATCTAACCACTTTGGTTCTCACCATGAACTTCTATGATGAAGAATTGCCAGCTGATCCAAACCTTCATTTT
>augustus_masked-Fvb4-3-processed-gene-4.9:1920:2040:Parent=augustus_masked-Fvb4-3-processed-gene-4.9-mRNA-1_17::augustus_masked-Fvb4-3-processed-gene-4.9:1920-2040||RAPiDGENOMICS_rs1205_02560
GACCATGCTCCTCCATGTCCATCCAAGGTTCATACTGATCTCGATCAAACCAGAAAATCAAGAATGAATGTAGGATCTATTATTGGTATAGCTGTTGGAACTGTATTTGGAACAGCAATG
>augustus_masked-Fvb4-3-processed-gene-4.9:2160:2280:Parent=augustus_masked-Fvb4-3-processed-gene-4.9-mRNA-1_19::augustus_masked-Fvb4-3-processed-gene-4.9:2160-2280||RAPiDGENOMICS_rs1205_02561
CTTTTCCAAAACAAGGAGAACAATAAAGAACTCTCTCTTGACGACCTCCTGCACGCCACCAACAATTTTGATCAGGCAAATATCATTGGCTGTGGGGGTTTTGGTCTGGTTTACAAAGCC
>augustus_masked-Fvb4-3-processed-gene-4.9:2280:2400:Parent=augustus_masked-Fvb4-3-processed-gene-4.9-mRNA-1_20::augustus_masked-Fvb4-3-processed-gene-4.9:2280-2400||RAPiDGENOMICS_rs1205_02562
ACCCTCCCTGATGGTAAGAAGGTTGCAATCAAGCGCCTGTCTGGTGACTGTGGCCAGATGGATAGAGAATTCCGTGCTGAAGTTGAAGCACTGTCAAAAGCTCAACATCCAAATCTTGTC
>augustus_masked-Fvb4-3-processed-gene-4.9:2520:2640:Parent=augustus_masked-Fvb4-3-processed-gene-4.9-mRNA-1_22::augustus_masked-Fvb4-3-processed-gene-4.9:2520-2640||RAPiDGENOMICS_rs1205_02563
AATACAAGGCTTAAAATTGCTCAAGGGGCAGCAAGGGGGCTTGCTTATTTGCATCAATCATGCGAACCCCATATTGTTCATCGGGATATAAAGTCAAGTAATATTCTTTTAGATGAGAAT
>augustus_masked-Fvb4-3-processed-gene-4.9:2640:2760:Parent=augustus_masked-Fvb4-3-processed-gene-4.9-mRNA-1_23::augustus_masked-Fvb4-3-processed-gene-4.9:2640-2760||RAPiDGENOMICS_rs1205_02564
TTTAAAGCCCACTTAGCTGATTTTGGTCTTGCAAGGCTCCTGCTTCCCTATGATACTCATGTAACAACTGATCTTGTTGGGACATTGGGCTACATTCCTCCCGAGTATGGCCAAGCCTCT
>augustus_masked-Fvb4-3-processed-gene-4.9:2760:2880:Parent=augustus_masked-Fvb4-3-processed-gene-4.9-mRNA-1_24::augustus_masked-Fvb4-3-processed-gene-4.9:2760-2880||RAPiDGENOMICS_rs1205_02565
GTTGCTACTTACAAGGGCGATGTGTACAGTTTTGGGGTTGTTCTTTTGGAGCTTCTAACTGGGAAAAGGCCTATGGATATGTGCAAGCCAAAAGTAGCTCGGGATTTGATCTCTTGGGTG
>augustus_masked-Fvb4-3-processed-gene-4.9:2880:3000:Parent=augustus_masked-Fvb4-3-processed-gene-4.9-mRNA-1_25::augustus_masked-Fvb4-3-processed-gene-4.9:2880-3000||RAPiDGENOMICS_rs1205_02566
TTTCAGATGAAGAGGGAGAAGAGGGAAACTGAAGTGTTTGATCCAGTCATTTATGACAAGCAGAAAGATCAGGAGCTTTTGTGTGTTTTAGAGATTGCATTGCTTTGCTTAAGTGGATGC
>augustus_masked-Fvb4-3-processed-gene-4.9:600:720:Parent=augustus_masked-Fvb4-3-processed-gene-4.9-mRNA-1_6::augustus_masked-Fvb4-3-processed-gene-4.9:600-720||RAPiDGENOMICS_rs1205_02567
TGTAGTTCCTTGGAGGACCTTTGTCTCCTCACGAATAATCTCTCTGGTGGTGTACCTGAAGGTATATATCAGCTGCAGAATCTGACCAGATTGACCATTGAAGATAACAAGCTTACCGGG
>augustus_masked-Fvb4-3-processed-gene-40.0:2040:2160:Parent=augustus_masked-Fvb4-3-processed-gene-40.0-mRNA-1_18::augustus_masked-Fvb4-3-processed-gene-40.0:2040-2160||RAPiDGENOMICS_rs1205_02568
TCCACCAAACCATACTTGGAGACAGTTGAAGATATTTCTTTTGCTGATATCTCTGAGAAATCTCTCTGCTCTATTAAAGCAAGACGTAAATCTATCCTAGTTCCTATAGGAACTGTGCAG
>augustus_masked-Fvb4-3-processed-gene-40.0:2880:3000:Parent=augustus_masked-Fvb4-3-processed-gene-40.0-mRNA-1_25::augustus_masked-Fvb4-3-processed-gene-40.0:2880-3000||RAPiDGENOMICS_rs1205_02569
CATCGAGACATTAAAAGTGAGAACATATTGATTGATTTGGATAGCAAGACAGCCAATGGAGCACCTGTTGTGAAGCTCTGTGATTTTGATAGAGCGGTGCCTCTAAGGTCATACTTGCAT
>augustus_masked-Fvb4-3-processed-gene-40.0:720:840:Parent=augustus_masked-Fvb4-3-processed-gene-40.0-mRNA-1_7::augustus_masked-Fvb4-3-processed-gene-40.0:720-840||RAPiDGENOMICS_rs1205_02570
GGGTTGATGATTAGCCTCAAGAGTTTGAATCTCAAGTACAATAGGCTGAAGAGTGAGTGTGTAGTGGCGCCTTCGTCAATATGCTGTGATTTGGATGGGAATGGAAATGATGTGTGTGGC
>augustus_masked-Fvb4-3-processed-gene-40.0:960:1080:Parent=augustus_masked-Fvb4-3-processed-gene-40.0-mRNA-1_9::augustus_masked-Fvb4-3-processed-gene-40.0:960-1080||RAPiDGENOMICS_rs1205_02571
CGGTGGAGAGGTCCAATGCCGATGCGTGTGAAGGAAGTTGGAGAAAGCAAAGCAGGAAATGTAGATGTTACTGATTCTGTAGCAGATGAGGATGAGGCTGAAGGATGTCGAGAAGCTGAA
>augustus_masked-Fvb4-4-processed-gene-165.5:360:480:Parent=augustus_masked-Fvb4-4-processed-gene-165.5-mRNA-1_4::augustus_masked-Fvb4-4-processed-gene-165.5:360-480||RAPiDGENOMICS_rs1205_02572
GGACCAATACCCAGGTCCATTTCCAATCTAAAGAAGCTCACTAGGCTCTCACTGTCCAACAATTTCTTCACCGGCACCATTCCCCTGGGATTGAACACCCTCAAGAAGCTAGAGTCTCTA
>augustus_masked-Fvb4-4-processed-gene-165.5:780:900:Parent=augustus_masked-Fvb4-4-processed-gene-165.5-mRNA-1_7::augustus_masked-Fvb4-4-processed-gene-165.5:780-900|2x||RAPiDGENOMICS_rs1205_02573
GCCATCACTAAAGAATTTTTTACTTTACCCAAGGTCACTCAACTCAATCTCTCAAATAACCACTTCACAAGATTGGAGATAGTGAGATCTTTTGGACAAGAGGAGCTTCAGGTGCTCGAT
>augustus_masked-Fvb4-4-processed-gene-165.5:900:1020:Parent=augustus_masked-Fvb4-4-processed-gene-165.5-mRNA-1_8::augustus_masked-Fvb4-4-processed-gene-165.5:900-1020|2x||RAPiDGENOMICS_rs1205_02574
GCAAAAGGAAATCAACTGCGAGGCCATTTGCCTCTGAATTTGGTAACTCTGCAGAATCTAACAACAATCAACCTTTCCTACAACCAGTTTTTTGGTAAAATACCCGACGCATACGCGTCA
>augustus_masked-Fvb4-4-processed-gene-2.3:1020:1140:Parent=augustus_masked-Fvb4-4-processed-gene-2.3-mRNA-1_9::augustus_masked-Fvb4-4-processed-gene-2.3:1020-1140|2x||RAPiDGENOMICS_rs1205_02575
CTCAGTCTAGGCACTGTTCCGGATTGGATCAGAAGCCGGCAACTTAGAGATGTTCATCTTGCTGGTTGTCAATTGAGAGGTACCCTCCCAAGCATCACAAAGCCTGCGTCTTTGAACTCC
>augustus_masked-Fvb4-4-processed-gene-2.3:1080:1200:Parent=augustus_masked-Fvb4-4-processed-gene-2.3-mRNA-1_10::augustus_masked-Fvb4-4-processed-gene-2.3:1080-1200||RAPiDGENOMICS_rs1205_02576
GCTGGTTGTCAATTGAGAGGTACCCTCCCAAGCATCACAAAGCCTGCGTCTTTGAACTCCCTAGATTTGTCCTATAATCAATTTACGGATGGGATTTCAAAGCTCAACCTCATCAGCATG
>augustus_masked-Fvb4-4-processed-gene-2.3:120:240:Parent=augustus_masked-Fvb4-4-processed-gene-2.3-mRNA-1_2::augustus_masked-Fvb4-4-processed-gene-2.3:120-240||RAPiDGENOMICS_rs1205_02577
TCAGAAGCAGATAGAGCTTCCCTTCTGAGCTTCAAGGTCAGAATCGTCGAGGACACAACCGACATTCTGTCTTCATGGACAGGCACAGACTGCTGCGCAGGAGGATGGGAAGGTGTCGAG
>augustus_masked-Fvb4-4-processed-gene-2.3:1380:1500:Parent=augustus_masked-Fvb4-4-processed-gene-2.3-mRNA-1_12::augustus_masked-Fvb4-4-processed-gene-2.3:1380-1500|2x||RAPiDGENOMICS_rs1205_02578
AACAATCAAATTTCAGGTGGTATTCCAGAGTTCAGACAAGGCATGAGGCTCAAAGCAGTCAACATAGGAAGCAATAAAATTGCTGGTCACATCCCCAATTCAGTTTCAAACCTGATTCAA
>augustus_masked-Fvb4-4-processed-gene-2.3:1680:1800:Parent=augustus_masked-Fvb4-4-processed-gene-2.3-mRNA-1_15::augustus_masked-Fvb4-4-processed-gene-2.3:1680-1800||RAPiDGENOMICS_rs1205_02579
GGAGAGATCCCACAAGGGAGACCATTCAACATCTTTCCTGCAACTGCTTATCTCCACAATTTGTGCTTATGCGGCAAGCCTCTGCCACCTTGTAGAGGAAAGACTCAAAGCAACAAGCAG
>augustus_masked-Fvb4-4-processed-gene-2.3:180:300:Parent=augustus_masked-Fvb4-4-processed-gene-2.3-mRNA-1_2::augustus_masked-Fvb4-4-processed-gene-2.3:180-300|2x||RAPiDGENOMICS_rs1205_02580
GACATTCTGTCTTCATGGACAGGCACAGACTGCTGCGCAGGAGGATGGGAAGGTGTCGAGTGTGACCCAGCTGGGAGGGTTACTGTCTTGCAGTTGCAGAGGCCTGGGTACATGAAGGGT
>augustus_masked-Fvb4-4-processed-gene-2.3:60:180:Parent=augustus_masked-Fvb4-4-processed-gene-2.3-mRNA-1_1::augustus_masked-Fvb4-4-processed-gene-2.3:60-180|2x||RAPiDGENOMICS_rs1205_02581
TCTTCCTCGTCCTCATCTCTGCCGCGGCGGAGAGAAGAAGAAGCGGCAGCAGGTGTGTGCTCAGAAGCAGATAGAGCTTCCCTTCTGAGCTTCAAGGTCAGAATCGTCGAGGACACAACC
>augustus_masked-Fvb4-4-processed-gene-2.3:660:780:Parent=augustus_masked-Fvb4-4-processed-gene-2.3-mRNA-1_6::augustus_masked-Fvb4-4-processed-gene-2.3:660-780|2x||RAPiDGENOMICS_rs1205_02582
GGGCTCATTCCAAGCTTTGTAGGGCAGCATCTGCACAACCTTACCTTCATTGACCTCTCCAATAACCAATTTTCTGGTCGAATGCCTGTTTCCCTCTTCAGTTTGCCCAGCCTTTTGGAC
>augustus_masked-Fvb4-4-processed-gene-2.3:840:960:Parent=augustus_masked-Fvb4-4-processed-gene-2.3-mRNA-1_8::augustus_masked-Fvb4-4-processed-gene-2.3:840-960||RAPiDGENOMICS_rs1205_02583
TCCCTTACTAGTCTTTCCTTGAGCAATAACCGACTTAACGGTCATATTCCAGCATCCATTTCAAATTTGCAGAACCTTTGGTACCTCAACTTATCCAGAAATGGGTTTACAAGTCCTTTG
>augustus_masked-Fvb4-4-processed-gene-210.0:0:120:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_1::augustus_masked-Fvb4-4-processed-gene-210.0:0-120||RAPiDGENOMICS_rs1205_02584
ATGCACAATAATGCAGCCCTCACCATTTCCATTTCCATGGGAAACCCACAAATGCTCATCCCATTTGGATTAGTTGTGTTGCTTCATTACTCATGCTTTCTTCGCTCGGCCACCTCCTAC
>augustus_masked-Fvb4-4-processed-gene-210.0:120:240:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_2::augustus_masked-Fvb4-4-processed-gene-210.0:120-240||RAPiDGENOMICS_rs1205_02585
TCTTCCAACTTCACCGATCAATCTGCTCTCCTTGCCATTCAATCCAAACTCACATTTGAACCTACCAAAACTGTCTTGGGTGGTAATTGGCATACCAACACAAGCTTCTGTGATTGGATT
>augustus_masked-Fvb4-4-processed-gene-210.0:180:300:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_2::augustus_masked-Fvb4-4-processed-gene-210.0:180-300|2x||RAPiDGENOMICS_rs1205_02586
CCTACCAAAACTGTCTTGGGTGGTAATTGGCATACCAACACAAGCTTCTGTGATTGGATTGGGGTCTCATGCAGTAAACGGAGGCAGAGAGTTACCGCCTTGGTCTTGTCAGATATAGGT
>augustus_masked-Fvb4-4-processed-gene-210.0:240:360:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_3::augustus_masked-Fvb4-4-processed-gene-210.0:240-360||RAPiDGENOMICS_rs1205_02587
GGGGTCTCATGCAGTAAACGGAGGCAGAGAGTTACCGCCTTGGTCTTGTCAGATATAGGTCTTGAAGGCACCATTGCACCTCATGTTGGCAACCTCTCATTTCTAGTCGTATTGGTTCTC
>augustus_masked-Fvb4-4-processed-gene-210.0:300:420:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_3::augustus_masked-Fvb4-4-processed-gene-210.0:300-420|2x||RAPiDGENOMICS_rs1205_02588
CTTGAAGGCACCATTGCACCTCATGTTGGCAACCTCTCATTTCTAGTCGTATTGGTTCTCCAACAGAACAGCTTGTCCGGGATTGTGCCAAGTGAAATCAGCCATCTACACCGCTTGAGG
>augustus_masked-Fvb4-4-processed-gene-210.0:360:480:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_4::augustus_masked-Fvb4-4-processed-gene-210.0:360-480||RAPiDGENOMICS_rs1205_02589
CAACAGAACAGCTTGTCCGGGATTGTGCCAAGTGAAATCAGCCATCTACACCGCTTGAGGGTCCTTGTACTGGAAGGGAACCAGTTGGAAGGACAGATCCCTGCTTTTTTATATCATTGC
>augustus_masked-Fvb4-4-processed-gene-210.0:420:540:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_4::augustus_masked-Fvb4-4-processed-gene-210.0:420-540|2x||RAPiDGENOMICS_rs1205_02590
GTCCTTGTACTGGAAGGGAACCAGTTGGAAGGACAGATCCCTGCTTTTTTATATCATTGCGGAAAGCTCGAAATCATTGCCCTTACCGGTCATATTCCTGAAGAGTTGGGTTTCTTACCC
>augustus_masked-Fvb4-4-processed-gene-210.0:480:600:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_5::augustus_masked-Fvb4-4-processed-gene-210.0:480-600||RAPiDGENOMICS_rs1205_02591
GGAAAGCTCGAAATCATTGCCCTTACCGGTCATATTCCTGAAGAGTTGGGTTTCTTACCCAAACTTGAGATATTATATCTCGGTTTAAACAACCTGACTGCTGGTGAAATTCCATCTTCT
>augustus_masked-Fvb4-4-processed-gene-210.0:540:660:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_5::augustus_masked-Fvb4-4-processed-gene-210.0:540-660|2x||RAPiDGENOMICS_rs1205_02592
AAACTTGAGATATTATATCTCGGTTTAAACAACCTGACTGCTGGTGAAATTCCATCTTCTTTGGGGAATGTTTCAACATTACAAGAACTGAGTGTGCCAAAGAGTGACCTCACAGGTTCT
>augustus_masked-Fvb4-4-processed-gene-210.0:60:180:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_1::augustus_masked-Fvb4-4-processed-gene-210.0:60-180|2x||RAPiDGENOMICS_rs1205_02593
CCATTTGGATTAGTTGTGTTGCTTCATTACTCATGCTTTCTTCGCTCGGCCACCTCCTACTCTTCCAACTTCACCGATCAATCTGCTCTCCTTGCCATTCAATCCAAACTCACATTTGAA
>augustus_masked-Fvb4-4-processed-gene-210.0:600:720:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_6::augustus_masked-Fvb4-4-processed-gene-210.0:600-720||RAPiDGENOMICS_rs1205_02594
TTGGGGAATGTTTCAACATTACAAGAACTGAGTGTGCCAAAGAGTGACCTCACAGGTTCTCTCCCTTCCGCTCTACTAAATCTATCTTCTCTAGTTGTTATTTCACTATATAGAAATAAC
>augustus_masked-Fvb4-4-processed-gene-210.0:660:780:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_6::augustus_masked-Fvb4-4-processed-gene-210.0:660-780|2x||RAPiDGENOMICS_rs1205_02595
CTCCCTTCCGCTCTACTAAATCTATCTTCTCTAGTTGTTATTTCACTATATAGAAATAACATTTCAGGAGTTCTTCCTGAGCATCTTTGCCATTACTGGCCTAATATTCAACACATTGAT
>augustus_masked-Fvb4-4-processed-gene-210.0:720:840:Parent=augustus_masked-Fvb4-4-processed-gene-210.0-mRNA-1_7::augustus_masked-Fvb4-4-processed-gene-210.0:720-840||RAPiDGENOMICS_rs1205_02596
ATTTCAGGAGTTCTTCCTGAGCATCTTTGCCATTACTGGCCTAATATTCAACACATTGATTTATCTGGAAACAAACTTGGTGGGCAGCTCTCTTCGAGATTTGATCAATGCAGTGAATTG
>augustus_masked-Fvb4-4-processed-gene-37.14:0:120:Parent=augustus_masked-Fvb4-4-processed-gene-37.14-mRNA-1_1::augustus_masked-Fvb4-4-processed-gene-37.14:0-120||RAPiDGENOMICS_rs1205_02597
ATGGAATCCCCAATCCCCGTCGAAAACCCTGAAGCCTCCGGAGATCCAGAACCCTCCGATTCCGCATTGCAAGTAGTCGGCGCCGGCAGCGACGTCGCCGGAGCCGACTCGATCCTCGAC
>augustus_masked-Fvb4-4-processed-gene-37.14:2040:2160:Parent=augustus_masked-Fvb4-4-processed-gene-37.14-mRNA-1_18::augustus_masked-Fvb4-4-processed-gene-37.14:2040-2160||RAPiDGENOMICS_rs1205_02598
AAACCATACTTGGAGATGGTTGAAGATATTGCTTTTGCTGATATCTCTGAGAAATCTCTCCGCTCTATTAAAGCAAGACATAAATCTCTCCTAGTTCCTATAGGAACTGTGCAGTATGGT
>augustus_masked-Fvb4-4-processed-gene-37.14:2400:2520:Parent=augustus_masked-Fvb4-4-processed-gene-37.14-mRNA-1_21::augustus_masked-Fvb4-4-processed-gene-37.14:2400-2520||RAPiDGENOMICS_rs1205_02599
GTTCCTCTTTCTGGAAGCAACTTTGGTCATTCTTTGCTACATAATTTGCCCTTTATTGATGGAACTGTGAACAGATCTGGCAGTTCTCTCATTCAGTGCAAATATGGATCAGTTGAGTTG
>augustus_masked-Fvb4-4-processed-gene-37.14:2760:2880:Parent=augustus_masked-Fvb4-4-processed-gene-37.14-mRNA-1_24::augustus_masked-Fvb4-4-processed-gene-37.14:2760-2880||RAPiDGENOMICS_rs1205_02600
TACATAGAAAAGCTATCAAAAGCTGGTGAGAAGCATGTCCCTGTGCATATAGCTTTGTGCATTGCTAAAGATGTTGCTTCTGCATTGGTGGAGCTGCATTCAAAGAATATCATTCATCGA
>augustus_masked-Fvb4-4-processed-gene-37.14:3000:3120:Parent=augustus_masked-Fvb4-4-processed-gene-37.14-mRNA-1_26::augustus_masked-Fvb4-4-processed-gene-37.14:3000-3120||RAPiDGENOMICS_rs1205_02601
CTTGTCGCTCATGTAGGGATACCTCCTCCTAATGTTTGTGTTGGAACACCTCGCTGGATGGCTCCAGAGGTTCTAAGGACAATGCATGAGCAAAATTTTTATGGACTTGAAGTTGATATC
>augustus_masked-Fvb4-4-processed-gene-37.14:3120:3240:Parent=augustus_masked-Fvb4-4-processed-gene-37.14-mRNA-1_27::augustus_masked-Fvb4-4-processed-gene-37.14:3120-3240||RAPiDGENOMICS_rs1205_02602
TGGTCGTTTGGATGCCTTCTTTATGAATTATTGACTCTGCAACTTCCTTTTTCGGGAGTAGCTGATTTGGAGATACATGACCTTATTGTGATGGGACAACGACCAAAGTTAACAGAAGAG
>augustus_masked-Fvb4-4-processed-gene-37.14:3240:3360:Parent=augustus_masked-Fvb4-4-processed-gene-37.14-mRNA-1_28::augustus_masked-Fvb4-4-processed-gene-37.14:3240-3360||RAPiDGENOMICS_rs1205_02603
TTGGAGGCGCTTCTGCTATTTATGGACGAACCAACAGCTCAATCAGCTGCAGAGCTTGGGGGAACAGAGGCTGACTTAGGCACGCTAGCATTTCTTATTGACTTGTTCTGCAAATGTACA
>augustus_masked-Fvb4-4-processed-gene-37.14:3360:3480:Parent=augustus_masked-Fvb4-4-processed-gene-37.14-mRNA-1_29::augustus_masked-Fvb4-4-processed-gene-37.14:3360-3480||RAPiDGENOMICS_rs1205_02604
GAAGAGAATCCGCAGAGTCGTCCAACAGCTGACAACATCTACAAATTGTTGCTCGAACACAGCATGAAGCTCTCTAGTGAAACTAGGTTAAAATTTTGTAACCCTATTGATGGTTCATTG
>augustus_masked-Fvb4-4-processed-gene-37.14:420:540:Parent=augustus_masked-Fvb4-4-processed-gene-37.14-mRNA-1_4::augustus_masked-Fvb4-4-processed-gene-37.14:420-540|2x||RAPiDGENOMICS_rs1205_02605
GTTCCGATTCTGAGCCAGGTCGCCGGGCTGAAGCTCCTGACGAAGCTATCGGTATGTTATTTCTCTATAACTTTTCTACCGCCGGAGATTTTCTGCTTGAAGAGCTTGGAGTACCTGGAC
>augustus_masked-Fvb4-4-processed-gene-37.14:540:660:Parent=augustus_masked-Fvb4-4-processed-gene-37.14-mRNA-1_5::augustus_masked-Fvb4-4-processed-gene-37.14:540-660|2x||RAPiDGENOMICS_rs1205_02606
CTTTCGTTCAACAAGATGAAGGCTTTGCCTGCAGAAATTGGGAATTTGAATGCTCTGGTTTCGTTGAGAGTTGCGAATAATAAACTGGAGGCATTGCCTGAGGAGTTGTCCAGATTGGCT
>augustus_masked-Fvb4-4-processed-gene-54.7:0:120:Parent=augustus_masked-Fvb4-4-processed-gene-54.7-mRNA-1_1::augustus_masked-Fvb4-4-processed-gene-54.7:0-120||RAPiDGENOMICS_rs1205_02607
ATGGCTGAAGCACTTGTTGGCGTATTTGTAGAGCGCTTGGCTTTGATCACATTGAACAAGGTCGGCCAAGAGCTGAATCTGATCATAGGTGTTGGCAAAGAAATTGAAACCCTCACCCTC
>augustus_masked-Fvb4-4-processed-gene-54.7:120:240:Parent=augustus_masked-Fvb4-4-processed-gene-54.7-mRNA-1_2::augustus_masked-Fvb4-4-processed-gene-54.7:120-240||RAPiDGENOMICS_rs1205_02608
AATCTCCGAAAAATCGAAGCTCTGTTGGAGGATGCAGAGCAAAGACAAGTGCAGGATGGAAGTGTCAGAGTATGGCTGAGCAACTTGAAAGAAGTGTCCGACGCAATTGAAGAGGTGTTG
>augustus_masked-Fvb4-4-processed-gene-54.7:240:360:Parent=augustus_masked-Fvb4-4-processed-gene-54.7-mRNA-1_3::augustus_masked-Fvb4-4-processed-gene-54.7:240-360||RAPiDGENOMICS_rs1205_02609
GATGAGTGGCGCTATGAAATTCTTAAGCAGCAATTTTCTGAGAAACAGCGAGGAGAAGAAGGTAGTGATCATCAAAATGCTCCTGTACATGTTGCTAAGAAGCAGCAGGTATGTTTCCCT
>augustus_masked-Fvb4-4-processed-gene-54.7:600:720:Parent=augustus_masked-Fvb4-4-processed-gene-54.7-mRNA-1_6::augustus_masked-Fvb4-4-processed-gene-54.7:600-720||RAPiDGENOMICS_rs1205_02610
AGCAAGTTACTAAATGATGATGGTCATGAACAAAACAGAATTCCCCACATCCCTAATGAGAGTAGTGAAGAACAGGATAGTGTGGAAGAGAGTCTTTTCTCTATCAATCCTACTGTTCCT
>augustus_masked-Fvb4-4-processed-gene-54.7:660:780:Parent=augustus_masked-Fvb4-4-processed-gene-54.7-mRNA-1_6::augustus_masked-Fvb4-4-processed-gene-54.7:660-780|2x||RAPiDGENOMICS_rs1205_02611
AGTAGTGAAGAACAGGATAGTGTGGAAGAGAGTCTTTTCTCTATCAATCCTACTGTTCCTTCTATCATTCCGATTGTCGGAATGGGAGGGATCGGTAAGACCACTCTTTCTCAGCTAGTG
>augustus_masked-Fvb4-4-processed-gene-54.7:780:900:Parent=augustus_masked-Fvb4-4-processed-gene-54.7-mRNA-1_7::augustus_masked-Fvb4-4-processed-gene-54.7:780-900|2x||RAPiDGENOMICS_rs1205_02612
TATAATGATAGGAGAGTGAAAGCTCATTTTGATAGGAGAATATGGGTATGTGTCCCATTCCCTTTTGAAGAGATCCAAATTCTTGCAGCTATCGCTCAAGATCTTGGTATTCCATATCAC
>augustus_masked-Fvb4-4-processed-gene-6.9:1800:1920:Parent=augustus_masked-Fvb4-4-processed-gene-6.9-mRNA-1_16::augustus_masked-Fvb4-4-processed-gene-6.9:1800-1920||RAPiDGENOMICS_rs1205_02613
CTCAGTTTTTTGTCCAAGTTCAGTGTCGCAGACAATCAATTAGAGGGGGAGATCCCTAGTGGAGGTCAGTTTGGGACTTTCCCAAATTCAAGCTTTGAAGGGAACAATCTTTGTGGTGAC
>augustus_masked-Fvb4-4-processed-gene-6.9:2040:2160:Parent=augustus_masked-Fvb4-4-processed-gene-6.9-mRNA-1_18::augustus_masked-Fvb4-4-processed-gene-6.9:2040-2160||RAPiDGENOMICS_rs1205_02614
TTTGCTCTCATATTCATAATTGTGATTCGGGAACATAATCGAAGAGAGGTTGATCCTGAAAAAGAGCACGATATGGAAGAGAAGTATTTGGAAGAACTTGGTTCAAAATCAGTGGTTCTT
>augustus_masked-Fvb4-4-processed-gene-6.9:2400:2520:Parent=augustus_masked-Fvb4-4-processed-gene-6.9-mRNA-1_21::augustus_masked-Fvb4-4-processed-gene-6.9:2400-2520||RAPiDGENOMICS_rs1205_02615
CTTCAAGGGTATTGCACTTATAAAAGTGACAGGCTTTTGATATATTCTTACATGGAGAACAGTAGTCTCGACTATTGGTTGCATGAAAAGCTGGATGGGGCATCCTGTCTAGATTGGAAT
>augustus_masked-Fvb4-4-processed-gene-6.9:420:540:Parent=augustus_masked-Fvb4-4-processed-gene-6.9-mRNA-1_4::augustus_masked-Fvb4-4-processed-gene-6.9:420-540|2x||RAPiDGENOMICS_rs1205_02616
GACTTTTCTGGCCCCATTCCAGTTGATTTCAATTTACCTTCGATTCTGTCACTTGACATCTCTCAAAATTTCTTGAATGGTTCTATTCCACAAAGCATTTGTGTAAATTCTACTCGGCTT
>augustus_masked-Fvb4-4-processed-gene-6.9:480:600:Parent=augustus_masked-Fvb4-4-processed-gene-6.9-mRNA-1_5::augustus_masked-Fvb4-4-processed-gene-6.9:480-600||RAPiDGENOMICS_rs1205_02617
TCTCAAAATTTCTTGAATGGTTCTATTCCACAAAGCATTTGTGTAAATTCTACTCGGCTTTGGGCACTGAAGCTGGCTGTGAACTACTTGTCTGGTAGTCTTCCAGAAAGTCTTGGCAAT
>augustus_masked-Fvb4-4-processed-gene-76.1:0:120:Parent=augustus_masked-Fvb4-4-processed-gene-76.1-mRNA-1_1::augustus_masked-Fvb4-4-processed-gene-76.1:0-120||RAPiDGENOMICS_rs1205_02618
ATGGTGAGTTCGAAGCCGGCTACGGGGGAGAGCACTCCGTGCGATTTCTGCAGCGAGCAGCCGGCGGTGCTCTACTGCAAGGCCGACTCGGCCAAGCTGTGCTTGTTCTGCGACCAGCAC
>augustus_masked-Fvb4-4-processed-gene-76.1:1077:1197:Parent=augustus_masked-Fvb4-4-processed-gene-76.1-mRNA-1_1::augustus_masked-Fvb4-4-processed-gene-76.1:1077-1197||RAPiDGENOMICS_rs1205_02619
ATCAACTCAAATAACCCAGCAGTGAGTCAGGGGCCAGCAACATCTGAGAGCAACAACATCTCTATTGGCCGGCCATCATCAGGGTCAGCTTTTGGTGAAGACAAAGGCAACATTGCCACT
>augustus_masked-Fvb4-4-processed-gene-76.1:1197:1317:Parent=augustus_masked-Fvb4-4-processed-gene-76.1-mRNA-1_2::augustus_masked-Fvb4-4-processed-gene-76.1:1197-1317||RAPiDGENOMICS_rs1205_02620
ACGGAACAACCTTTCCTAATGAGAAGTGACAGTCTGCGGACGGTAGGAACAAAGGCTAGCACGGAGCTGCTTGCGCAAAACAGGGGCAATGCTATGCTGCGTTACAAAGAGAAGAAGAAA
>augustus_masked-Fvb4-4-processed-gene-76.1:1456:1576:Parent=augustus_masked-Fvb4-4-processed-gene-76.1-mRNA-1_1::augustus_masked-Fvb4-4-processed-gene-76.1:1456-1576||RAPiDGENOMICS_rs1205_02621
GGGATGCTCTTTATTTCTGGAAAACCCAATTGGTCGACCCTAACAATGTTCTTCAGAGCTGGGATCCGACTTTGGTCAATCCATGCCTCTGGTTTCACGTTACCTGCGACAGTCAAAACA
>augustus_masked-Fvb4-4-processed-gene-76.1:1661:1781:Parent=augustus_masked-Fvb4-4-processed-gene-76.1-mRNA-1_1::augustus_masked-Fvb4-4-processed-gene-76.1:1661-1781||RAPiDGENOMICS_rs1205_02622
GGAGTTGTATGAAAACAAATTCTTTGGACCTATTCCATCCGCAATTGGTCACTTGAGTAAACTAGTCAGATTGGACTTGTACAAGAATAAACTCTCCGGAACAATTCCACAAACTTTGGG
>augustus_masked-Fvb4-4-processed-gene-76.1:2096:2216:Parent=augustus_masked-Fvb4-4-processed-gene-76.1-mRNA-1_1::augustus_masked-Fvb4-4-processed-gene-76.1:2096-2216||RAPiDGENOMICS_rs1205_02623
GGAGTTATACCAGAACAAATTTTATGGATCTATTCCTTCGGAACTTGGTCACTTAAAAGAACTAATCAGCTTGGACTTGTACCGGAACCAACTCTCGGGACCAATTCCAGAGACCTTAGG
>augustus_masked-Fvb4-4-processed-gene-76.1:480:600:Parent=augustus_masked-Fvb4-4-processed-gene-76.1-mRNA-1_5::augustus_masked-Fvb4-4-processed-gene-76.1:480-600||RAPiDGENOMICS_rs1205_02624
GGGGAGGCGGCTCCGGCGAAGAGGCAGGGCTCTGGTGGGAGCTTGGGGAAGCACAAGCAGGGGATTCAGAAGCAGCTGGTGGAGCTGCTCAAGAGGGACTTCGATGGCGGCGGAGAGAAT
>augustus_masked-Fvb4-4-processed-gene-76.1:600:720:Parent=augustus_masked-Fvb4-4-processed-gene-76.1-mRNA-1_6::augustus_masked-Fvb4-4-processed-gene-76.1:600-720||RAPiDGENOMICS_rs1205_02625
TTGGAGGCGCCGGCGAGGAATAGTGATAATGGCTGGGAGGGAAATGGTGATGGGAATAATGTTGATGTGAATGTGAATGCGGAAGGGTTTGATGTGGAGAATGGAAGAGTTGATGGAGTG
>augustus_masked-Fvb4-4-processed-gene-76.1:720:840:Parent=augustus_masked-Fvb4-4-processed-gene-76.1-mRNA-1_7::augustus_masked-Fvb4-4-processed-gene-76.1:720-840||RAPiDGENOMICS_rs1205_02626
AACGTAGGTTCTGCTGCTGCTGCCATTCCGCAGCCGTTGCTGCAGCAACAAGCGGCGCCGTTTACGTCTCTGCTTATGATGGCTGAAGGCATTGTTGATCGAGATATGTTGTGGGATACC
>augustus_masked-Fvb4-4-processed-gene-76.1:876:996:Parent=augustus_masked-Fvb4-4-processed-gene-76.1-mRNA-1_1::augustus_masked-Fvb4-4-processed-gene-76.1:876-996||RAPiDGENOMICS_rs1205_02627
ATATGGGATTTTAATCTAGGAAAGTCGAGGGGTCATGACGAAACAGTTCCATTGGATGTCTCATATGGTTCAGATGGTTCGGGATTCATGATTAAGAATTTTAGTGATCTTCTGAAAGAA
>augustus_masked-Fvb5-1-processed-gene-130.16:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-130.16-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-130.16:0-120||RAPiDGENOMICS_rs1205_02628
ATGGCGGTTGATATTGTATTGGGAATGGGTGTAGAACTCGTATGGAAAGGAATAGAGAGAGAGTTTGGGAACAATCTTCTGCAGGTGAGAAGCATTGACATTTCAAGCAATTCTTTGGTA
>augustus_masked-Fvb5-1-processed-gene-130.16:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-130.16-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-130.16:120-240||RAPiDGENOMICS_rs1205_02629
GACGAAATTCCAGAAAGTATCACAAGTATGGAAAAGTTAACATCACTGAACCTTTCAGGAAACAATTTGATCGGAAAGGTTCCTGAAAACTTTGGAAACATGAAGATGTTGGAATCTCTT
>augustus_masked-Fvb5-1-processed-gene-130.16:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-130.16-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-130.16:240-360||RAPiDGENOMICS_rs1205_02630
GATTTGTCCAGAAACCAGATATCTGGTGGAATACCTGCAAGTTTTTCAAAACTAAACTTTCTTAGTGTCTTGGACTTATCACACAACAACTTGTCAGGAAGAATTCCACTTGGCACCCAA
>augustus_masked-Fvb5-1-processed-gene-130.16:300:420:Parent=augustus_masked-Fvb5-1-processed-gene-130.16-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-130.16:300-420|2x||RAPiDGENOMICS_rs1205_02631
CTTAGTGTCTTGGACTTATCACACAACAACTTGTCAGGAAGAATTCCACTTGGCACCCAACTTCAGAGTTTTAATGCTACTGTATATATGGGAAATTTTGGACTTTGCGGACCACCGTTG
>augustus_masked-Fvb5-1-processed-gene-130.16:60:180:Parent=augustus_masked-Fvb5-1-processed-gene-130.16-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-130.16:60-180|2x||RAPiDGENOMICS_rs1205_02632
GAGTTTGGGAACAATCTTCTGCAGGTGAGAAGCATTGACATTTCAAGCAATTCTTTGGTAGACGAAATTCCAGAAAGTATCACAAGTATGGAAAAGTTAACATCACTGAACCTTTCAGGA
>augustus_masked-Fvb5-1-processed-gene-130.17:1080:1200:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_10::augustus_masked-Fvb5-1-processed-gene-130.17:1080-1200||RAPiDGENOMICS_rs1205_02633
ATATCAGGATCATTACCTGATAAGTTTTGGGATCTATTTGTCCACTTATATTCGTTAGATCTCTCCATCAATCAAATCTGTGGGAAGCTGCCGAATCTGTCAACAACAATATTTTGGGTT
>augustus_masked-Fvb5-1-processed-gene-130.17:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-130.17:120-240||RAPiDGENOMICS_rs1205_02634
CTTGCTCTTTTACAGTTTAAACAAGGCCTTCTATCCGATAACAAATATAATGCTCTTGCCACTTGGGAAAGCACGAAAGATTGCTGCGACTGGAGAGGAATTGCGTGTAACAATCATACA
>augustus_masked-Fvb5-1-processed-gene-130.17:1200:1320:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-130.17:1200-1320||RAPiDGENOMICS_rs1205_02635
GTTGACTTGTCTTCTAATCTACTTTCCGGTGCAGTGCCATCATTTCCTCCGACGCTTAGGTTCTTGAATCTCTCGACCAACATGTTTTCTGACCTCTCGTCTTCCTTTTGTGCAACGCGG
>augustus_masked-Fvb5-1-processed-gene-130.17:300:420:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-130.17:300-420|2x||RAPiDGENOMICS_rs1205_02636
CTACTTGAATTGCGATATCTAGAGTACTTGGACCTTAGTTTTAATGATTTTGGAGGTATGATGATTCCCGTCTTCATTGGCTCTTTGAGTCAATTGAAAGAGCTCAAACTTGGAAGAGCT
>augustus_masked-Fvb5-1-processed-gene-130.17:480:600:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-130.17:480-600||RAPiDGENOMICS_rs1205_02637
CTTTCCAATAACGAAAATGTTAGTTCTGAAAATGTTGAGTGGTTGTCTCATCTCTCTTCCTTGAGATACCTGAACATGTCATGGGTGAATTTGTCTGAGGCTGTGAATTGGCCACAATCT
>augustus_masked-Fvb5-1-processed-gene-130.17:60:180:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-130.17:60-180|2x||RAPiDGENOMICS_rs1205_02638
TCCTTTTCTAGTAGTGTTGGAAGCTCCAACAATACTTTCTTGTGCTTGGAGAGTGAAAGGCTTGCTCTTTTACAGTTTAAACAAGGCCTTCTATCCGATAACAAATATAATGCTCTTGCC
>augustus_masked-Fvb5-1-processed-gene-130.17:600:720:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-130.17:600-720||RAPiDGENOMICS_rs1205_02639
TTGAGCAAGCTCACTTCATTAAGAGAGCTCAAGTTATCTCTGTGTAACCTTCCTGATGTCAATCTAAGCTCACTTTCTAAGAACGCACTGGAGACCTTGGACTTGCAGAATAACCAGTTC
>augustus_masked-Fvb5-1-processed-gene-130.17:660:780:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-130.17:660-780|2x||RAPiDGENOMICS_rs1205_02640
AATCTAAGCTCACTTTCTAAGAACGCACTGGAGACCTTGGACTTGCAGAATAACCAGTTCTGGGGTTCACTTCCAGAACTGACAGGTTTTTCCAAGTTGAGAGAGTTACTCCTCTCCTCT
>augustus_masked-Fvb5-1-processed-gene-130.17:720:840:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-130.17:720-840||RAPiDGENOMICS_rs1205_02641
TGGGGTTCACTTCCAGAACTGACAGGTTTTTCCAAGTTGAGAGAGTTACTCCTCTCCTCTAATAATATATCCGGGTCTCTACCCGAGAGTGTCGGGACACTCTCTAGCCTTGAAGAACTA
>augustus_masked-Fvb5-1-processed-gene-130.17:780:900:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-130.17:780-900|2x||RAPiDGENOMICS_rs1205_02642
AATAATATATCCGGGTCTCTACCCGAGAGTGTCGGGACACTCTCTAGCCTTGAAGAACTAGATGTCAGCATGAATTCTATGACGGGTGTCATCACAGAATCCCACCTTCGGGACCTCTCT
>augustus_masked-Fvb5-1-processed-gene-130.17:840:960:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-130.17:840-960||RAPiDGENOMICS_rs1205_02643
GATGTCAGCATGAATTCTATGACGGGTGTCATCACAGAATCCCACCTTCGGGACCTCTCTCGTTTACAGTCTTTGAAACTTTCTGGTAATGGTTTCTACATCAACCTCAGCTCTCATTGG
>augustus_masked-Fvb5-1-processed-gene-130.17:900:1020:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-130.17:900-1020|2x||RAPiDGENOMICS_rs1205_02644
CGTTTACAGTCTTTGAAACTTTCTGGTAATGGTTTCTACATCAACCTCAGCTCTCATTGGGATCCACCATTTCAACTTACTAGTTCGTTAGCCCTCTCCTCTTGCAAGCTGGGCCCAGCT
>augustus_masked-Fvb5-1-processed-gene-130.17:960:1080:Parent=augustus_masked-Fvb5-1-processed-gene-130.17-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-130.17:960-1080||RAPiDGENOMICS_rs1205_02645
GATCCACCATTTCAACTTACTAGTTCGTTAGCCCTCTCCTCTTGCAAGCTGGGCCCAGCTTTTCCGAAATGGATTCTGAAGCAGACAAATATTACTGAGCTTCATCTCTCTAATGCTGGA
>augustus_masked-Fvb5-1-processed-gene-146.1:1080:1200:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_10::augustus_masked-Fvb5-1-processed-gene-146.1:1080-1200||RAPiDGENOMICS_rs1205_02646
GAGGGGCTTCCCCTTGCTATTGTGGCTATTAGTGGAGTTTTAGCTGCCAAAGATAAGCGCAGAATTGATGAGTGGGATATGGTTGGCCACAGTCTTGGGTATGAAATTGAGGGCAACGAC
>augustus_masked-Fvb5-1-processed-gene-146.1:1140:1260:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_10::augustus_masked-Fvb5-1-processed-gene-146.1:1140-1260|2x||RAPiDGENOMICS_rs1205_02647
AGAATTGATGAGTGGGATATGGTTGGCCACAGTCTTGGGTATGAAATTGAGGGCAACGACAAACTGCAGGACTTGAAGAAAGTACTTTCACTCAGCTTTAATGATTTACCATACTATCTC
>augustus_masked-Fvb5-1-processed-gene-146.1:1260:1380:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-146.1:1260-1380|2x||RAPiDGENOMICS_rs1205_02648
AAATCTTGCTTCTTGTACCTGAGCATCTTTCCAGAGGATCATTTGATTAAGCATATGAGGCTTATTCGATTATGGATGGCAGAGGGCTTCATTGAAGAAAAACAAGGAAAAACATTGGAA
>augustus_masked-Fvb5-1-processed-gene-146.1:1440:1560:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_13::augustus_masked-Fvb5-1-processed-gene-146.1:1440-1560||RAPiDGENOMICS_rs1205_02649
ACAACAGCTGATGGAAGGGTTACAAAACTTCGTATCCATGATCTCTTCCGTGAAATAATCACCTCCAAAACAAGAGATCAGAACTTTGCCACAGTAGCCAAAGAGCATAATGTAACACTG
>augustus_masked-Fvb5-1-processed-gene-146.1:1680:1800:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_15::augustus_masked-Fvb5-1-processed-gene-146.1:1680-1800||RAPiDGENOMICS_rs1205_02650
AGACTCTTCCCGGCCGGCTTTGCGCTGCTTAATGTGTTGGATTTGCAAAGCACTCCTTTAAATGTTTTCCCAGTTGAAGTTGTGAACCTTTACTTTTTAAAGTATCTGAGTTTGAGAGAT
>augustus_masked-Fvb5-1-processed-gene-146.1:1800:1920:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_16::augustus_masked-Fvb5-1-processed-gene-146.1:1800-1920||RAPiDGENOMICS_rs1205_02651
ACCAGGGTAAAAGCCATCCCTAGATTTATAGGGAAGCTTCAGAACCTGGAAACTTTGGATATGAAGCATTCTCGTGTTACTGAACTTCCAGTTGAAATCCTGAAACTCCAACGTCTGCGC
>augustus_masked-Fvb5-1-processed-gene-146.1:1920:2040:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_17::augustus_masked-Fvb5-1-processed-gene-146.1:1920-2040||RAPiDGENOMICS_rs1205_02652
TATCTCCTGGTGTATCGTTATGAGTTTGTTCCTTACGAAGATTTTCACTCTACATATGGTTTTAAGGTCCTTGAAAAAATAGGGGCTTTGAAATCCCTTCAAAAGCTATGTTTCATTGAG
>augustus_masked-Fvb5-1-processed-gene-146.1:2040:2160:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_18::augustus_masked-Fvb5-1-processed-gene-146.1:2040-2160||RAPiDGENOMICS_rs1205_02653
GTCAACCAAGGTGGCAGTGCATTAATGAGAGAGCTGGGGAAACTAATTCAATTGAGAAGGTTAGGCATTGTTAAGATGAGGAAAGAAGATGGCAAGGCTCTTTCTTCATCCATTGAAAAG
>augustus_masked-Fvb5-1-processed-gene-146.1:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-146.1:240-360||RAPiDGENOMICS_rs1205_02654
CTTCTACAAGCACATGATCATGGGGTGGAGGGATTATATGGTTCAATCCATAAGCTTTCTTGCTGCATCAAGAACACAAAAGCTCGATACCGAATTGCTTCAGAGTTAAGAGCCATAAAC
>augustus_masked-Fvb5-1-processed-gene-146.1:2400:2520:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_21::augustus_masked-Fvb5-1-processed-gene-146.1:2400-2520||RAPiDGENOMICS_rs1205_02655
CTGTGTCAGGTTTTTGAAGGAGACACATTATGTTTTGGAGATGGCGGTTTTAAGAAGCTCAAGCATTTATGCCTCGATAAATCTGATGAACTTCGATGTATAGAGGTGGAGGTGGGAACA
>augustus_masked-Fvb5-1-processed-gene-146.1:2640:2760:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_23::augustus_masked-Fvb5-1-processed-gene-146.1:2640-2760||RAPiDGENOMICS_rs1205_02656
ATCAAGACTCTACTTCCACATGAAAAGGGCAATGATTATTGGAAAGTTTGTCATGTTCCAGAAGTTTATGTCACTTACTTGAGAGAGTTTGGGTGGGAGGTATTCTCACTAGAAGGCTTG
>augustus_masked-Fvb5-1-processed-gene-146.1:360:480:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-146.1:360-480||RAPiDGENOMICS_rs1205_02657
TCCAGGATCAGAAAAGTCTCTGAGGTTCATAAGCGACTCCACCACAAATTCAATATGGCTGAACAAGGCTCAAGTTCTAAGGACCATCGAGGTGACGCTTTACTTCTAGAGAAAACTGAT
>augustus_masked-Fvb5-1-processed-gene-146.1:480:600:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-146.1:480-600||RAPiDGENOMICS_rs1205_02658
ATAGTCGGCATAGACAAGCCTATTAAGCAGATGGTCGGGAGGCTGCTCAATGGTGATTGTGCACGTGAGGTAGTTTCTGTGGCAGGAATGGGAGGAATGGGGAAGACTACCCTGGCGAAG
>augustus_masked-Fvb5-1-processed-gene-146.1:600:720:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-146.1:600-720||RAPiDGENOMICS_rs1205_02659
CAAGTCTATGATGCAGCAGAAGTGAAGAAACATTTCAAATTACGCGCTTGGATCACTGTTACTCAGTCTTTCAAACTAGGGGAACTTCTTAAAGACATCGTTCAACAGCTCCACCAAGCA
>augustus_masked-Fvb5-1-processed-gene-146.1:780:900:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-146.1:780-900|2x||RAPiDGENOMICS_rs1205_02660
ATTAAAGACTTCCTACAGAAGAGGAGGTATCTCATTGTCTTGGATGATGTGTGGCACTTGTACGGATGGAATGCTATGAAGTATGCATTGCCTAATAATATGTATGGCAGCCGAGTAATT
>augustus_masked-Fvb5-1-processed-gene-146.1:840:960:Parent=augustus_masked-Fvb5-1-processed-gene-146.1-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-146.1:840-960||RAPiDGENOMICS_rs1205_02661
TACGGATGGAATGCTATGAAGTATGCATTGCCTAATAATATGTATGGCAGCCGAGTAATTCTCACTACTCGAAATGCAGATATAGCCTCGACAACAAGCATGGAGTCTGGAGGTGAAGTC
>augustus_masked-Fvb5-1-processed-gene-153.1:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-153.1:0-120||RAPiDGENOMICS_rs1205_02662
ATGGCAGAAAGTGTAGTCACCTATTTGGTTGACCGGCTCACGACGTTACTCGAAGAAGAAGTGAAACTCTTGTCAGGGATCCGAGAACAGGTCGAGGACCTGGTTGCTGAATTGCAGCGT
>augustus_masked-Fvb5-1-processed-gene-153.1:1320:1440:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-153.1:1320-1440||RAPiDGENOMICS_rs1205_02663
AAAATTGAGCATATGAAATTGATTCGGTTATGGTTAGCTGAAGGATTTGTTATTGGAAAAGAGGGAAGGACACCGGAAGAAGTTGCAGAGAGTTACCTCAGAGAGTTATTAAACAGAAGT
>augustus_masked-Fvb5-1-processed-gene-153.1:1380:1500:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-153.1:1380-1500|2x||RAPiDGENOMICS_rs1205_02664
GAGGGAAGGACACCGGAAGAAGTTGCAGAGAGTTACCTCAGAGAGTTATTAAACAGAAGTTTGATTCAAGCAGCAGAAACATCAACTGATGGGAGAGTAAAATCATATCGCATCCATGAT
>augustus_masked-Fvb5-1-processed-gene-153.1:1440:1560:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_13::augustus_masked-Fvb5-1-processed-gene-153.1:1440-1560||RAPiDGENOMICS_rs1205_02665
TTGATTCAAGCAGCAGAAACATCAACTGATGGGAGAGTAAAATCATATCGCATCCATGATCTTTTACTGGAGATTATCATTTTGATGTCTAGAGAGCAAAACTTTGCAGCAATAGAAAAA
>augustus_masked-Fvb5-1-processed-gene-153.1:1560:1680:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_14::augustus_masked-Fvb5-1-processed-gene-153.1:1560-1680||RAPiDGENOMICS_rs1205_02666
GGGCAAGGGCAAGGTACAATTTGTCCTGACAAAGTTCGAAGACTATCAATAGTTAACACGCTGCAGAATGTATGCCAAACAAGGACACCGTCTCGGCTTCGCTCATTGCTCGTTTTTGGG
>augustus_masked-Fvb5-1-processed-gene-153.1:1920:2040:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_17::augustus_masked-Fvb5-1-processed-gene-153.1:1920-2040||RAPiDGENOMICS_rs1205_02667
GCTGAGATTTTGAATCTGAAGCGACTTCGTCATCTCCTGGTTTATCGTTATGAGGTTGAGTCATATGCACGCTTTAATGCCAGAAAAGGAGTCAAGATTCCTGCAGGGATATGTGGCTTA
>augustus_masked-Fvb5-1-processed-gene-153.1:2040:2160:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_18::augustus_masked-Fvb5-1-processed-gene-153.1:2040-2160||RAPiDGENOMICS_rs1205_02668
CAATCACTCCAAAAGCTCTGCTTTATAGAGGCAAATCAATACAGTGGTGCTCTAATGGCAGAGCTTGGGAGAATGAACCAATTAAGGAGGTTAGGCATTTACAAGTTGAGAGCAGAACAT
>augustus_masked-Fvb5-1-processed-gene-153.1:2520:2640:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_22::augustus_masked-Fvb5-1-processed-gene-153.1:2520-2640||RAPiDGENOMICS_rs1205_02669
CTGCAATTGGTAACCATAGAGGAGGGAGCAATGCCTCAACTAGAAAAGCTAATTATCCAGCGGTGTGAATCACTGAAGAAGGTTCCACATGGTATTGAGCATTTAAACAGTTTAAAGTTG
>augustus_masked-Fvb5-1-processed-gene-153.1:2640:2760:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_23::augustus_masked-Fvb5-1-processed-gene-153.1:2640-2760||RAPiDGENOMICS_rs1205_02670
CTTGAATTTTTCGATATGCCAGATGAATTCATCACGGCACTAAATCCAGATGATGGGGGAGATCACTGGAAAGTCGCTCATGTTCCAGCAGTTTATTATTCCTATTGGAGAGGAGGGGGT
>augustus_masked-Fvb5-1-processed-gene-153.1:360:480:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-153.1:360-480||RAPiDGENOMICS_rs1205_02671
AAAGTCAAAAGCCTCTACGAGGGAAATGAGAGATACAAACTTGTAGCCCGAGCTGGCTCCAGCCCAGCGTCTCTAGTTCACCACCACAAGATTGGACAGGGAGAAGCCCTTTTACTCGAA
>augustus_masked-Fvb5-1-processed-gene-153.1:420:540:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-153.1:420-540|2x||RAPiDGENOMICS_rs1205_02672
AGCCCAGCGTCTCTAGTTCACCACCACAAGATTGGACAGGGAGAAGCCCTTTTACTCGAAGAGGCTGATCTTGTGGCAATTGGCGAGCACAAAAAGCAACTGATTGAGCTGCTTATGAAG
>augustus_masked-Fvb5-1-processed-gene-153.1:660:780:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-153.1:660-780|2x||RAPiDGENOMICS_rs1205_02673
ATCACTGTTTCTCGATCAGTCAAGATAAATCAGCTCCTAAGACACATGATCAATAAAATCTTCAGAGTTATCACAAAACCAGATCCTGAAGATGAAGAAGTTGAAACCATGGATGACAAC
>augustus_masked-Fvb5-1-processed-gene-153.1:720:840:Parent=augustus_masked-Fvb5-1-processed-gene-153.1-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-153.1:720-840||RAPiDGENOMICS_rs1205_02674
TTCAGAGTTATCACAAAACCAGATCCTGAAGATGAAGAAGTTGAAACCATGGATGACAACCAGCTAAGAGAGAGAATCAAAAAATTGCTGCAGAATAGTAGGTACCTGATTGTTCTTGAT
>augustus_masked-Fvb5-1-processed-gene-153.7:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-153.7:0-120||RAPiDGENOMICS_rs1205_02675
ATGGCAGAAAGTGTAGTGAAGTTTTTACTTGACAAGCTCAATTCGTTAATTGAAGGAGAGGTGGTGCTGTTCTCAGAAATTCAAGCACAGGTCAGGGACACGGTTGATGAATTAGAGCGT
>augustus_masked-Fvb5-1-processed-gene-153.7:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-153.7:120-240||RAPiDGENOMICS_rs1205_02676
ATTCAGGCGTTCTTAAGGGTTGCTGATGCAAAGGAAGATGGTGATCCTCAGCTCAAACTATGGGTCAGAAAAGTAAGAGAAGTGGCTCATGAGATGGAAGATGTCCTGGATAAATTCAGG
>augustus_masked-Fvb5-1-processed-gene-153.7:1200:1320:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-153.7:1200-1320||RAPiDGENOMICS_rs1205_02677
CAGCAAAATGATCAGCTTGAAAATATGAAGGAATTACTGTATCTCAGTTTCAGTGATTTACCATACCAGCTAAAATCATGTTTCTTGTATTTGAGCATCTTTCCTGATCTCTACAACATT
>augustus_masked-Fvb5-1-processed-gene-153.7:1320:1440:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-153.7:1320-1440||RAPiDGENOMICS_rs1205_02678
GAGCGTATGAGATTAATTCGGTTATGGTTAGCTGAAGGATTTCTGATCACAATGGAAGGAAAGACACCAGAAGAAGTTGCAGAGAGTTACCTTAAGGAGCTATTGGACAGATGTTTGATT
>augustus_masked-Fvb5-1-processed-gene-153.7:1920:2040:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_17::augustus_masked-Fvb5-1-processed-gene-153.7:1920-2040||RAPiDGENOMICS_rs1205_02679
TTAAAGCTTAAGCAACTTCGCCATCTCCTGGTGTATCGTTACGAAGTTGAGTCTTATGCACACTTTAATTCCAAGTATGGAGTAAAGGTTCCTGCAGGAATCTGTGGCTTGGAAAAGCTC
>augustus_masked-Fvb5-1-processed-gene-153.7:2040:2160:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_18::augustus_masked-Fvb5-1-processed-gene-153.7:2040-2160||RAPiDGENOMICS_rs1205_02680
CAAAAGCTGTGTAAAATAGAGGCAAATCAAGATAATTATGCTTTAATGGCGAACCTCGGAAGCTTGACTCAGCTGAGGAGGTTAGGCATTCTAAAATTGAGACAAGAAAATGGAACAGCC
>augustus_masked-Fvb5-1-processed-gene-153.7:2160:2280:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_19::augustus_masked-Fvb5-1-processed-gene-153.7:2160-2280||RAPiDGENOMICS_rs1205_02681
TTATGCTTATCCATCCAAAAGATGAAGAACCTTCGTGCATTGTCTGTATCTTCAGTGAAGAAGGAAGGGATAATTGATATGAGCCATCTTTCTTGTGCTCCTGAATTTCTTCAGCGACTG
>augustus_masked-Fvb5-1-processed-gene-153.7:2280:2400:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_20::augustus_masked-Fvb5-1-processed-gene-153.7:2280-2400||RAPiDGENOMICS_rs1205_02682
TACTTGACAGGTCGTTTAGAAAGCTTACCACACTGGATTTCTTCTCTTCAAAACCTGGCCAGACTATTCCTAAAATGGAGTCGATTGAAGGAGGATCCTCTTGTCCAACTTCAAGGTTTG
>augustus_masked-Fvb5-1-processed-gene-153.7:2520:2640:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_22::augustus_masked-Fvb5-1-processed-gene-153.7:2520-2640||RAPiDGENOMICS_rs1205_02683
GTAACTATAGATAAGAGAGCAATGCCTTGTCTAGAAAAGCTTATTATCCAGCGGTGTAAATTGTTGAAGAAGGTCCCATCTGGCATCGAGCTTTTAACCAGTCTAAAGTTGCTTGAATGT
>augustus_masked-Fvb5-1-processed-gene-153.7:2640:2760:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_23::augustus_masked-Fvb5-1-processed-gene-153.7:2640-2760||RAPiDGENOMICS_rs1205_02684
TTTGATATGCCAGATGAATTTATCATGGCACTACATCCAGATGGTGGAGAAGATCACCAGAAAGTCGCTCGTATCCCGGCGGTTTATTATTCCTATTGGAAAGGTGGCGGTTGGGATGTC
>augustus_masked-Fvb5-1-processed-gene-153.7:2870:2990:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-153.7:2870-2990||RAPiDGENOMICS_rs1205_02685
GAGAGGTGGTGCTGTTCTCAGAATTCAAGCACAGGTCAGGGACACGGTTGATGAATTAGAGCGTATTCAGGCGTTCTTAAGGGTTGCTGATGCAAAGGAAGATGGTGATCCTCAGCTCAA
>augustus_masked-Fvb5-1-processed-gene-153.7:2990:3110:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-153.7:2990-3110||RAPiDGENOMICS_rs1205_02686
ACTATGGGTCAGAAAAGTAAGAGAAGTGGCTCATGAGATGGAAGATGTCCTGGATAAATTCAGGCTGTTCTATTCCAATGATCCCCCGCCTGGATTTTGTACTTTACTTGACAAGCTTAT
>augustus_masked-Fvb5-1-processed-gene-153.7:3110:3230:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-153.7:3110-3230||RAPiDGENOMICS_rs1205_02687
TTGCTTCATCAAGATATGGAAAGCTTACCATCAAACTGCTGCTGATATTGAATGCCTAAACTCGAGAATCAGAAGCCTCAGAGATGGACATGACAGATACCAAATTGTTGACCAACCTGG
>augustus_masked-Fvb5-1-processed-gene-153.7:3230:3350:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-153.7:3230-3350||RAPiDGENOMICS_rs1205_02688
CTCCACTTCTTCCCGCCGAAGTGGGCACCGTCTGTTTGTTCAAGGGGATGACCTCTTACTGGAAGCAGCTGATCTTATGGCAATCAGGGAGCAGCCTAAAAATCAGCTGATCGAGCTGCT
>augustus_masked-Fvb5-1-processed-gene-153.7:3375:3495:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-153.7:3375-3495||RAPiDGENOMICS_rs1205_02689
TCAGTCAGTATGAACCAGCTCCTTAGATCCATGATTCATAACATCTTCCAAGTTATTCAGAAACCACCTGAGGAAGAGGTTGATAGCATGAACAACAACCAGCTCCGAGAAAGAATCCAA
>augustus_masked-Fvb5-1-processed-gene-153.7:360:480:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-153.7:360-480||RAPiDGENOMICS_rs1205_02690
AGAATCAGAAGCCTCAGAGATGGACATGACAGATACCAAATTGTTGACCAACCTGGCTCCACTTCTTCCCGCCGAAGTGGGCACCGTCTGTTTGTTCAAGGGGATGACCTCTTACTGGAA
>augustus_masked-Fvb5-1-processed-gene-153.7:4095:4215:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-153.7:4095-4215||RAPiDGENOMICS_rs1205_02691
GCAGAGAGTTACCTTAAGGAGCTATTGGACAGATGTTTGATTCAAGCAGCAGAAACAGCAACTGATGGGAGAGTTAAGTCATATCGTATCCACAATTTTCTACGAGAGATATTTATTTCC
>augustus_masked-Fvb5-1-processed-gene-153.7:4215:4335:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-153.7:4215-4335||RAPiDGENOMICS_rs1205_02692
AAGTCCAAGGAGCAAAATTTTGCAGCAGTAGTGAAAGAGGGAGATACAATGTGGCCTGAAAAAGTTCGAAGACTATCAATAGTTAACTCAGTGCAGAATGTACAAAAAAGAGGCCTCCAT
>augustus_masked-Fvb5-1-processed-gene-153.7:4556:4676:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-153.7:4556-4676||RAPiDGENOMICS_rs1205_02693
AAAATCAGAAACACAAATCACAGGCGAAGAAATGGCCGAAAGTGCTGTCATGTTTTTAGTTTGCAAGCTTAAGACGTTACTTGAAGAAGAGGTGAACCTATTGTCAGGGATCAAAGCACA
>augustus_masked-Fvb5-1-processed-gene-153.7:4676:4796:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-153.7:4676-4796||RAPiDGENOMICS_rs1205_02694
GGTCGAGGAAATGGTTGATGAATTAGAGCGCATCCAGGCGTTCTTAAAGGCTGCTGATGCAAAGGAAGACAGGGATCCTCAGAAAAAAGTGTGGGTTAATCAAGTCAGAAATGTGGCTCA
>augustus_masked-Fvb5-1-processed-gene-153.7:4796:4916:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-153.7:4796-4916||RAPiDGENOMICS_rs1205_02695
CGAGATGGAAGATACCCTTGATATATTCAGGCACTCGCATTCACATGATCACGGGCGTGGATTTCTTGCTTCTCTTCATAAGCTTTATTTCATCACCAAGAAATGGAAAGCTCGTCGACA
>augustus_masked-Fvb5-1-processed-gene-153.7:4916:5036:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-153.7:4916-5036||RAPiDGENOMICS_rs1205_02696
AGTTGCTGCTGATATTGAAGGCCTAAAGAATAGGATCAAGAGTCTCGAGAGAAACAAATTTGTTGATCCAACTGGCTCCACCTCTGCACATCAGGTTCCATATCAGTTCACTCCAGGGGA
>augustus_masked-Fvb5-1-processed-gene-153.7:4976:5096:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-153.7:4976-5096|2x||RAPiDGENOMICS_rs1205_02697
TGTTGATCCAACTGGCTCCACCTCTGCACATCAGGTTCCATATCAGTTCACTCCAGGGGATGCCACTTTACTAGAAGAGGCTGAGCTGGTGGCGATCGGTGAGCCGAAAAGGAAACTTTT
>augustus_masked-Fvb5-1-processed-gene-153.7:5096:5216:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-153.7:5096-5216|2x||RAPiDGENOMICS_rs1205_02698
TGAGTTGCTTATGAAGGAAGAATCAACACGCCAGGTGGTTCCTATAGTTGGTATGGGAGGACTGGGAAAAACTACCTTGGTAAAGCAATTGTACGAGGATGCCAAAGTTCAGAAGCATTT
>augustus_masked-Fvb5-1-processed-gene-153.7:5156:5276:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-153.7:5156-5276||RAPiDGENOMICS_rs1205_02699
ACTGGGAAAAACTACCTTGGTAAAGCAATTGTACGAGGATGCCAAAGTTCAGAAGCATTTTAAGATACATGCTTGGATCACTGTCTCTCGGTCATGCCATATGAATAAGCTCCTAAGACG
>augustus_masked-Fvb5-1-processed-gene-153.7:5276:5396:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-153.7:5276-5396||RAPiDGENOMICS_rs1205_02700
CATGATCCATGAGATATTCAATGTTATCAGAAAACCAGTTCCTCAAGATGAAGAAATTGAAAGCATGGACGACAACAAGCTTAGAGAGAGAATCAGAAAATTGCTACAGCATAGCAGGTA
>augustus_masked-Fvb5-1-processed-gene-153.7:540:660:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-153.7:540-660|2x||RAPiDGENOMICS_rs1205_02701
AAACATGAGCCAGGACTCCAGGTGGTATCGGTGGTTGGAATGGGCGGATTGGGCAAAACTACCTTGGTAAAGCAGGTGTATGAGGACCCCGAGGTTAGGAAACGCTTTAAGGTTCATGCT
>augustus_masked-Fvb5-1-processed-gene-153.7:5756:5876:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-153.7:5756-5876||RAPiDGENOMICS_rs1205_02702
TGGAAGTATTGGAGCTGAAATTCAGGAAAATGAACAGCTTGACAATATGACAAAGGTGCTGTATCTCAGTTTCAGTGATTTACCATACCATCTGAAGTCATGTTTCTTGTATCTGAGCAT
>augustus_masked-Fvb5-1-processed-gene-153.7:5816:5936:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-153.7:5816-5936|2x||RAPiDGENOMICS_rs1205_02703
GTATCTCAGTTTCAGTGATTTACCATACCATCTGAAGTCATGTTTCTTGTATCTGAGCATGTTTCCTGATATCTACAAAATTGATCATATGAAATTAATTCGATTGTGGTTAGCTGAAGG
>augustus_masked-Fvb5-1-processed-gene-153.7:5936:6056:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-153.7:5936-6056|2x||RAPiDGENOMICS_rs1205_02704
ATTTATTATTGAAACCGGAGGAAGGACACCGGAAGAAGTTGCACAGAGTTACATAAAGGAGCTATGGGACAGAAGTTTGATTCAAGCAACAGAAACAGCAACTGATGGGCGAGTTAAATC
>augustus_masked-Fvb5-1-processed-gene-153.7:5996:6116:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_13::augustus_masked-Fvb5-1-processed-gene-153.7:5996-6116||RAPiDGENOMICS_rs1205_02705
GCTATGGGACAGAAGTTTGATTCAAGCAACAGAAACAGCAACTGATGGGCGAGTTAAATCCTATCGCATCCATGATCTTTTACGGGAGATTATCATTTCAAAGTCTAGGGAGCAAAATTT
>augustus_masked-Fvb5-1-processed-gene-153.7:600:720:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-153.7:600-720||RAPiDGENOMICS_rs1205_02706
ACCTTGGTAAAGCAGGTGTATGAGGACCCCGAGGTTAGGAAACGCTTTAAGGTTCATGCTTGGATCACTGTTTCTCAGTCAGTCAGTATGAACCAGCTCCTTAGATCCATGATTCATAAC
>augustus_masked-Fvb5-1-processed-gene-153.7:6116:6236:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_14::augustus_masked-Fvb5-1-processed-gene-153.7:6116-6236||RAPiDGENOMICS_rs1205_02707
TGCAGCTGTAGAGAGAGAAGAAAGCACAACGTGGTCTGAAAAAGTTCGACGACTATCAATAGTTAATACATTGCAGAATGTCCAAAAGAAAAAGACTCCATCTAAACTTCGCTCTTTGCT
>augustus_masked-Fvb5-1-processed-gene-153.7:6236:6356:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_15::augustus_masked-Fvb5-1-processed-gene-153.7:6236-6356||RAPiDGENOMICS_rs1205_02708
CATCTTTGGGGTAGAAGATTCACTAAATGATTTTTCCATAACAAAATTGTTTCCAACAGGTCTTCAGCTGCTCACTGTATTAGACTTGGAAGGTGCACATCTACAGGAGTTTCCAAAAGA
>augustus_masked-Fvb5-1-processed-gene-153.7:6356:6476:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_16::augustus_masked-Fvb5-1-processed-gene-153.7:6356-6476||RAPiDGENOMICS_rs1205_02709
GGTTGTGAAGCTGGTCTTTCTCAAGTACCTTAGCTTGAGGAATAGCAAGGTGAAACAAATTCCAAGCTCCATCAAGAAGCTAAGATACCTAGAGACTCTCGACCTTAAACACTCCCATGT
>augustus_masked-Fvb5-1-processed-gene-153.7:6476:6596:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_17::augustus_masked-Fvb5-1-processed-gene-153.7:6476-6596||RAPiDGENOMICS_rs1205_02710
TGTTGAATTGCCTGTTGAAATTTTGTATTTGAAGCAACTTCGTCATCTCCTGGTGTATCGTTATGAAGTTGAATCCTATGCACAATTTAATGCCAAATATGGAGTTAAGCTTCCTGCAGG
>augustus_masked-Fvb5-1-processed-gene-153.7:6596:6716:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_18::augustus_masked-Fvb5-1-processed-gene-153.7:6596-6716||RAPiDGENOMICS_rs1205_02711
AATATGTAGCTTGCAATCTCTTCAAAAGCTTTGTTTTATAGAGGCAAATCAATGCAGTGGAGGTTTCATGGCAGAGCTAGGGGGAATGAATCAATTGAGGAGGTTAGGCATTTTGAAGTT
>augustus_masked-Fvb5-1-processed-gene-153.7:6716:6836:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_19::augustus_masked-Fvb5-1-processed-gene-153.7:6716-6836||RAPiDGENOMICS_rs1205_02712
GAGACAAGAAGATGGGGAAATCTTATGCTCATCCATCCAAAAGATGAAAAATCTTCGCTCATTGTCTGTATCATCTGGAGAGTTTGATGGGTTAATTGATTTGAGCTACATGCCTAGTGC
>augustus_masked-Fvb5-1-processed-gene-153.7:6836:6956:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_20::augustus_masked-Fvb5-1-processed-gene-153.7:6836-6956||RAPiDGENOMICS_rs1205_02713
TCCTAAGTTTCTTCGGCGATTATACTTGACAGGTCGTTTAGCTAACTTACCACACTGGCTACCTGCGCTTCAAAACCTGGTCAGACTGTTTCTAAAATGGAGTCGGCTGACGGAAGATCC
>augustus_masked-Fvb5-1-processed-gene-153.7:6956:7076:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_21::augustus_masked-Fvb5-1-processed-gene-153.7:6956-7076||RAPiDGENOMICS_rs1205_02714
TCTAGTGCATCTTCAGGGTTTACCAAATCTGGTACATCTTGAACTGCTACAAGTTTTTGATGGAGAAAGCTTGCACTTTAAGGCAGGAGGGTTTCCAAGGCTGAAGTTATTAGGCATTGA
>augustus_masked-Fvb5-1-processed-gene-153.7:7076:7196:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_22::augustus_masked-Fvb5-1-processed-gene-153.7:7076-7196||RAPiDGENOMICS_rs1205_02715
TAAGTTGGATGAACTTCAATCAATAACCATAGATGAGGGAGCAATGCCTTGTCTAGAAAAGCTTATTATCCAGCGGTGTGAATCACTGAAGAAGGTTCCACATGGTATTGAGCATTTAAA
>augustus_masked-Fvb5-1-processed-gene-153.7:7196:7316:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_23::augustus_masked-Fvb5-1-processed-gene-153.7:7196-7316||RAPiDGENOMICS_rs1205_02716
CAGTTTAAAGTTGCTCGAATTTTTCGATATGCCAGATAAATTCATCACGGCACTAAATCCAGATTGTGGAGAAGATCATTGGAGAGTCGCTCATGTCCCGGCAGTTTATTATTCCTATTG
>augustus_masked-Fvb5-1-processed-gene-153.7:960:1080:Parent=augustus_masked-Fvb5-1-processed-gene-153.7-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-153.7:960-1080||RAPiDGENOMICS_rs1205_02717
CAAGGTATGGTCTACATTTTGGAGCCCTTATCTGTAGAAGAGTCTCGAACTCTTTTATATAAGATGACATTTCAGGCAGACTCATGCCCACAAACCTTGAAGGGCATTTGTGACTGCATC
>augustus_masked-Fvb5-1-processed-gene-161.10:1020:1140:Parent=augustus_masked-Fvb5-1-processed-gene-161.10-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-161.10:1020-1140|2x||RAPiDGENOMICS_rs1205_02718
AATGACAATCAAATTTGGGGTCATATACCCACAGCATTTGGATCCTTAAATAATCTTGGATACCTTGACCTGTCCACCAACAAATTTAGCGAGTCAATTCCAAGCACTTTAGGTGACTTG
>augustus_masked-Fvb5-1-processed-gene-161.10:1080:1200:Parent=augustus_masked-Fvb5-1-processed-gene-161.10-mRNA-1_10::augustus_masked-Fvb5-1-processed-gene-161.10:1080-1200||RAPiDGENOMICS_rs1205_02719
TACCTTGACCTGTCCACCAACAAATTTAGCGAGTCAATTCCAAGCACTTTAGGTGACTTGTCCAAGTTAAACTACTTGAATTTGAGCAATAACAATTTGAGTCATGAGATTCCATTTCAG
>augustus_masked-Fvb5-1-processed-gene-161.10:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-161.10-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-161.10:120-240||RAPiDGENOMICS_rs1205_02720
GAAATAGGAAACCTTCATAATTTGGTTGAGCTCTTTATTGATGCCAACTACTTGACAGGTCCAATCCCTCCAAATTTTGGAAACTTCAAAGAGCTAATTGTGATGTCATTGTGCAACAAT
>augustus_masked-Fvb5-1-processed-gene-161.10:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-161.10-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-161.10:240-360||RAPiDGENOMICS_rs1205_02721
AATCTTTCTGGTTCTATCCCTTCAGAACTAGGAAATCTGAAGTCACTGGTCAAACTATACCTTCACCAGAACAATTTTTCTGGCTCAATCCCGGCAACTTTAGGTGACCTAACAAACCTT
>augustus_masked-Fvb5-1-processed-gene-161.10:300:420:Parent=augustus_masked-Fvb5-1-processed-gene-161.10-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-161.10:300-420|2x||RAPiDGENOMICS_rs1205_02722
CTTCACCAGAACAATTTTTCTGGCTCAATCCCGGCAACTTTAGGTGACCTAACAAACCTTACTTATCTCTATTTATTCCAAAATGAACTTTCTGGAGCCATTCCTCAAGAGCTGGGAAGG
>augustus_masked-Fvb5-1-processed-gene-161.10:360:480:Parent=augustus_masked-Fvb5-1-processed-gene-161.10-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-161.10:360-480||RAPiDGENOMICS_rs1205_02723
ACTTATCTCTATTTATTCCAAAATGAACTTTCTGGAGCCATTCCTCAAGAGCTGGGAAGGTTGAAATCTCTTGTAAATCTACAGTTCAACATGAATCAACTGAATGGTTCCATTCCCACT
>augustus_masked-Fvb5-1-processed-gene-161.10:600:720:Parent=augustus_masked-Fvb5-1-processed-gene-161.10-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-161.10:600-720||RAPiDGENOMICS_rs1205_02724
CAATTTGTTGGTTATTTGCCCCAAAATATTTGCCGAGGTGGAGCACTAGAATATTTTACAGCAAACAACAACTATTTGATAGGTCCAAACCCCAAGAGCTTGAAAACTTGTAGCAGCTTA
>augustus_masked-Fvb5-1-processed-gene-161.10:720:840:Parent=augustus_masked-Fvb5-1-processed-gene-161.10-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-161.10:720-840||RAPiDGENOMICS_rs1205_02725
GTCAGACTCCATCTCGGATGGAACCAACTCACAAGCAATATATCTGAAGACTTTGGTGTCTATCCTCAACTTCAGTTTATAGACCTAAGCCACAATAACTTCTATGGTGAAGTGTCACAC
>augustus_masked-Fvb5-1-processed-gene-161.10:840:960:Parent=augustus_masked-Fvb5-1-processed-gene-161.10-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-161.10:840-960||RAPiDGENOMICS_rs1205_02726
AGTTGGGGACAATGTCCAAAATTAGGAACTCTAAGAATTGCGAGAAACAGACTTACTGGTAGCATACCACCTCAGATCAGCGATGCATCCCAAATTCAGGAACTCGATCTTTCATCAAAT
>augustus_masked-Fvb5-1-processed-gene-161.10:900:1020:Parent=augustus_masked-Fvb5-1-processed-gene-161.10-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-161.10:900-1020|2x||RAPiDGENOMICS_rs1205_02727
AGCATACCACCTCAGATCAGCGATGCATCCCAAATTCAGGAACTCGATCTTTCATCAAATCGTTTAGTTGGGATGATCCCAGAGGAATTGGTGAGAATGACTTTGTTGAAGCTGGTGTTG
>augustus_masked-Fvb5-1-processed-gene-161.10:960:1080:Parent=augustus_masked-Fvb5-1-processed-gene-161.10-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-161.10:960-1080||RAPiDGENOMICS_rs1205_02728
CGTTTAGTTGGGATGATCCCAGAGGAATTGGTGAGAATGACTTTGTTGAAGCTGGTGTTGAATGACAATCAAATTTGGGGTCATATACCCACAGCATTTGGATCCTTAAATAATCTTGGA
>augustus_masked-Fvb5-1-processed-gene-188.8:1320:1440:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-188.8:1320-1440||RAPiDGENOMICS_rs1205_02729
AATCTCAAGGATCTCATTCTCAATAATAACCGCCTCATCGGAGAAATCCCCACTGAATTGTTCAGTTGCAGTAATCTTGAGTGGATATCATTGACAAGCAATAGAATCAGTGGCGAAATC
>augustus_masked-Fvb5-1-processed-gene-188.8:1440:1560:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_13::augustus_masked-Fvb5-1-processed-gene-188.8:1440-1560||RAPiDGENOMICS_rs1205_02730
CCAAGGGAGTTTGGTGTCTTGACAAGGCTGGCTGTCCTGCAACTTGGGAATAATAGCCTGAGTGGGCAGATACCAGGAGAGTTGGCAAATTGTAGCAGTTTGGTTTGGTTGGATTTGAAC
>augustus_masked-Fvb5-1-processed-gene-188.8:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-188.8:180-300|2x||RAPiDGENOMICS_rs1205_02731
TGCACCTGGTTTGGAATCACATGCACTGCAGGCAGAGCAACTCAGCTCAATCTCAACGGTGGTTCACTAGTTGGGACAATCTCTCTCGACCCTTTCTCTTCTCTTGATAGGCTCTCTGTC
>augustus_masked-Fvb5-1-processed-gene-188.8:1860:1980:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_16::augustus_masked-Fvb5-1-processed-gene-188.8:1860-1980|2x||RAPiDGENOMICS_rs1205_02732
CCAGAGGAATTCGGAGAAATGATTGCGCTGCAAGTTCTTGAGTTAGCTCACAACCAGTTATCAGGTGAGATTCCTGCATCGCTTGGCCAGCTTAAAAATTTAGGTGTGTTTGATGCATCA
>augustus_masked-Fvb5-1-processed-gene-188.8:1920:2040:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_17::augustus_masked-Fvb5-1-processed-gene-188.8:1920-2040||RAPiDGENOMICS_rs1205_02733
TCAGGTGAGATTCCTGCATCGCTTGGCCAGCTTAAAAATTTAGGTGTGTTTGATGCATCACATAACAGACTGCAGGGTCATATCCCAGATTCGTTCTCCAACTTATCATTTTTGGTTCAA
>augustus_masked-Fvb5-1-processed-gene-188.8:2040:2160:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_18::augustus_masked-Fvb5-1-processed-gene-188.8:2040-2160||RAPiDGENOMICS_rs1205_02734
ATTGATTTGTCCTACAATGAATTGACTGGGGAGATCCCCACAAGGGGACAGCTGAGTACACTTCCTGCTACCCAATATGCTAACAATCCAGGACTTTGTGGGGTACCATTGCCAGAGTGT
>augustus_masked-Fvb5-1-processed-gene-188.8:2280:2400:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_20::augustus_masked-Fvb5-1-processed-gene-188.8:2280-2400||RAPiDGENOMICS_rs1205_02735
GCTTCAGTGTGTGTTCTGATTGTGTGGGGCATTGCAATGCGTTCAAGGCGGAAGGAAGCGCAAGAGGTGAAGATGCTTAACCGCTTGCAGGCATCTCGTGCAGCAACCACATGGAAAATT
>augustus_masked-Fvb5-1-processed-gene-188.8:2400:2520:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_21::augustus_masked-Fvb5-1-processed-gene-188.8:2400-2520||RAPiDGENOMICS_rs1205_02736
GACAAAGAGAAAGAACCATTGAGCATCAACGTTGCTACTTTTCAGAGACAACTAAGGAAGCTCAAGTTCTCCCAACTCATTGAGGCAACCAATGGTTTCTCGGCAGATAGTCTTATAGGT
>augustus_masked-Fvb5-1-processed-gene-188.8:2880:3000:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_25::augustus_masked-Fvb5-1-processed-gene-188.8:2880-3000||RAPiDGENOMICS_rs1205_02737
GACATGAAGTCGAGCAATGTATTGTTGGACAATGAAATGGAAGCAAGAGTTTCGGATTTTGGAATGGCAAGGCTCATAAGTGCACTTGATACACACTTGAGTGTAAGCACATTAGCAGGC
>augustus_masked-Fvb5-1-processed-gene-188.8:3120:3240:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_27::augustus_masked-Fvb5-1-processed-gene-188.8:3120-3240||RAPiDGENOMICS_rs1205_02738
GAGGACTTTGGAGATACTAATCTAGTTGGATGGGCGAAAATGAAAGTGAGAGAAGGGAAACAGATGGAAGTGATAGACCAGGAATTAGTTTCGGCAGCCAAAGGAAGTGACCAAGCAGAA
>augustus_masked-Fvb5-1-processed-gene-188.8:3240:3360:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_28::augustus_masked-Fvb5-1-processed-gene-188.8:3240-3360||RAPiDGENOMICS_rs1205_02739
GCCGAAGAAGTGAAAGAGATGGTGAGGTATTTGGAAGTAACACTTCGGTGTGTTGATGATTTCCCTTCCAGAAGGCCAAACATGTTGCAGGTGGTGGCCTTGCTCCGCGAGCTGATGCCC
>augustus_masked-Fvb5-1-processed-gene-188.8:540:660:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-188.8:540-660|2x||RAPiDGENOMICS_rs1205_02740
AACCTAACCGGGTTCATGTCCGGTTTCAAAATCGACAAATATTCTTGTTCTTCATTAGCTCAGCTTGATTTCTCAGGAAACCGCATCAATGGTTCTCTTCCTATGTCCTTGTCGAACTGC
>augustus_masked-Fvb5-1-processed-gene-188.8:660:780:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-188.8:660-780|2x||RAPiDGENOMICS_rs1205_02741
ACTGCTCTCAAAACCATAAACTTAGCATATAATATGCTTTCTGGGGAAATCCCAAGATCTTTTGGGCAACTCAGCAGTCTACAAAGACTGGACCTTTCTCACAATCAAATCACAGGTTGG
>augustus_masked-Fvb5-1-processed-gene-188.8:840:960:Parent=augustus_masked-Fvb5-1-processed-gene-188.8-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-188.8:840-960||RAPiDGENOMICS_rs1205_02742
AACTTCACTGGCCCAATCCCATCAGTTTTCTCCTCTTGTTCTTGGCTCCAACTTCTTGATCTTTCCAACAACAACATATCAGGCCCCTTGCCAGATTCTCTCTTCCAGAATCTAACCTCC
>augustus_masked-Fvb5-1-processed-gene-22.7:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-22.7:0-120||RAPiDGENOMICS_rs1205_02743
ATGCATTTTGTAATGGGTGGCGTTGCAATGTCTCATTTCATACTGTTTCTTGCAATACTCCATTCCATTCTTGCTGTTGCTCCTGGTGATAATTCGAGAGACTCCAACCTTCTTCTGAGA
>augustus_masked-Fvb5-1-processed-gene-22.7:1200:1320:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-22.7:1200-1320||RAPiDGENOMICS_rs1205_02744
GGAACTCTACTTCCTGAAATCGGAAACTTGAGTTCCTTGGAAAACCTGTTTCTGTTTGACAACATGATCACAGGTGGAATTCCAGTGGAGATAGGAAAGCTGCAAAGGCTGAAAGCCATC
>augustus_masked-Fvb5-1-processed-gene-22.7:1320:1440:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-22.7:1320-1440||RAPiDGENOMICS_rs1205_02745
TACCTTTACGACAACCAGATGTCAGGACCGATACCAAGTGAGTTAACCAACTGCTCAAGCTTGACAGCAATTGATTTCTTTGGTAACCATTTCTCAGGCTCCATCCCAGCCACAATTGGA
>augustus_masked-Fvb5-1-processed-gene-22.7:1440:1560:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_13::augustus_masked-Fvb5-1-processed-gene-22.7:1440-1560||RAPiDGENOMICS_rs1205_02746
AAACTCAAGAATCTTGTTGTCCTCCAGCTGAGGCAGAATGACTTGTCAGGTCCTATACCACCAAGCTTAGGCTACTGCAGAAGCCTTCAGTTATTGGCCTTAGCTGATAACAAGCTCTCA
>augustus_masked-Fvb5-1-processed-gene-22.7:1560:1680:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_14::augustus_masked-Fvb5-1-processed-gene-22.7:1560-1680||RAPiDGENOMICS_rs1205_02747
GGAACATTGCCACCCACATTCAGATTCATTTCACAACTAAGCACCATTACTCTCTACAACAATTCCTTCCAAGGCCCTCTTCCTCAATCTCTTTTCCTTCTCAAAAACCTCAAGAAAATA
>augustus_masked-Fvb5-1-processed-gene-22.7:1620:1740:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_14::augustus_masked-Fvb5-1-processed-gene-22.7:1620-1740|2x||RAPiDGENOMICS_rs1205_02748
AATTCCTTCCAAGGCCCTCTTCCTCAATCTCTTTTCCTTCTCAAAAACCTCAAGAAAATAAATTTCTCTCACAATCGGTTTAGTGGAACCATCTTCCCTCTCTCTGGTTCAAGTTATCTG
>augustus_masked-Fvb5-1-processed-gene-22.7:1680:1800:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_15::augustus_masked-Fvb5-1-processed-gene-22.7:1680-1800||RAPiDGENOMICS_rs1205_02749
AATTTCTCTCACAATCGGTTTAGTGGAACCATCTTCCCTCTCTCTGGTTCAAGTTATCTGACTGCAATGGACTTGACCAACAATAGCTTTTCAGGTTCCATACCTTCTAGACTTTCCATG
>augustus_masked-Fvb5-1-processed-gene-22.7:1740:1860:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_15::augustus_masked-Fvb5-1-processed-gene-22.7:1740-1860|2x||RAPiDGENOMICS_rs1205_02750
ACTGCAATGGACTTGACCAACAATAGCTTTTCAGGTTCCATACCTTCTAGACTTTCCATGTGCAGAAACTTAACCCGTCTCCGCCTTGCACATAATCAACTCACTGGCACCCTGCCTTCT
>augustus_masked-Fvb5-1-processed-gene-22.7:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-22.7:180-300|2x||RAPiDGENOMICS_rs1205_02751
ATTTGCACTTGGAATGGCCTTGAATGTTCAAATGATCAGATGCATATTATTAGTCTGAACCTGTCTGGATCAGGACTATCAGGTCCCATCCCACATGAGCTTTGGAACCTCACTTCAATC
>augustus_masked-Fvb5-1-processed-gene-22.7:1800:1920:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_16::augustus_masked-Fvb5-1-processed-gene-22.7:1800-1920||RAPiDGENOMICS_rs1205_02752
TGCAGAAACTTAACCCGTCTCCGCCTTGCACATAATCAACTCACTGGCACCCTGCCTTCTGAATTTGGCCAACTCACACAGCTCAACTTTCTTGACTTGTCATTCAACAACTTCACAGAT
>augustus_masked-Fvb5-1-processed-gene-22.7:1860:1980:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_16::augustus_masked-Fvb5-1-processed-gene-22.7:1860-1980|2x||RAPiDGENOMICS_rs1205_02753
GAATTTGGCCAACTCACACAGCTCAACTTTCTTGACTTGTCATTCAACAACTTCACAGATGAAATCCCACCTCAATTGTCTTCTTGTAAGAAACTTGAGCATTTCTTGGTTAACAATAAC
>augustus_masked-Fvb5-1-processed-gene-22.7:2160:2280:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_19::augustus_masked-Fvb5-1-processed-gene-22.7:2160-2280||RAPiDGENOMICS_rs1205_02754
CTCTCTTCTCTGAATGTCCTAAATCTTCAGAAAAACAATTTTACGGGGTCAATTCCATCGACGATCCAGAACTGCAAGAAGCTATATGAACTGAGGCTCTCAGAAAACTTGTTGTCAGGC
>augustus_masked-Fvb5-1-processed-gene-22.7:2520:2640:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_22::augustus_masked-Fvb5-1-processed-gene-22.7:2520-2640||RAPiDGENOMICS_rs1205_02755
GGATTCCCACGGAGCTCCTTCTTAGGAAATGATCAGAAACTTTGCGGCCCACCGTTAGCACCGTGTGGGGAATCCGAGGTGCAGAGGGTAAAGCGCCTTTCGCGTACTGCAGCAACTGGT
>augustus_masked-Fvb5-1-processed-gene-22.7:360:480:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-22.7:360-480||RAPiDGENOMICS_rs1205_02756
CTTCAAAATCTTGAAGCACTTCTCCTATACTCCAATTTTCTGTCTGGTGAGATTCCTGAGGAAATAGGTGCTTTGAAGAACATGCGAGTTCTAAGAGTAGGAGATAACTTTATATCAGGT
>augustus_masked-Fvb5-1-processed-gene-22.7:480:600:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-22.7:480-600||RAPiDGENOMICS_rs1205_02757
GAGATCCCACCAAGCATTGGCAACTTGACTGAGTTGAGAGTGTTGGCTCTCGCCTATTGCCAATTAAATGGAAGCATTCCAGTTGAAATTGGTAAGTTGAAGCATCTACAATCTCTTGAC
>augustus_masked-Fvb5-1-processed-gene-22.7:60:180:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-22.7:60-180|2x||RAPiDGENOMICS_rs1205_02758
CATTCCATTCTTGCTGTTGCTCCTGGTGATAATTCGAGAGACTCCAACCTTCTTCTGAGAATCAAGTCAGAACTCGTTGATCCATCAGGAGTTCTGAACAACTGGTCTCCAACAGCTCAT
>augustus_masked-Fvb5-1-processed-gene-22.7:780:900:Parent=augustus_masked-Fvb5-1-processed-gene-22.7-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-22.7:780-900|2x||RAPiDGENOMICS_rs1205_02759
TTAAGTCAGCTACGCAATTTGAAGTACTTGAATCTGCTTGGAAACAGATTGAGTGGCGCCATTCCTTCGGAGCTTAACCAGTTGGTTCAACTTGAGATGCTTGACTTTTCAATGAACAAT
>augustus_masked-Fvb5-1-processed-gene-237.11:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-237.11:120-240||RAPiDGENOMICS_rs1205_02760
GACGTCCAGGATCCGATTGGCGCATTGAACGGCTGGGATGCCTCCACGCCTTCCGCCCCCTGCGACTGGCGCGGCGTCTTCTGCGACAATAGTTCTCGCGTCTCGGAGCTCCGTTTGCCT
>augustus_masked-Fvb5-1-processed-gene-237.11:1260:1380:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-237.11:1260-1380|2x||RAPiDGENOMICS_rs1205_02761
GAAAATCAGTTCTCGGGTTCCATTCCTCCGAGTATTGGTAATCTTTCCAGGCTGGAGACTTTGGGCTTGGGAGGGAATAACTTGACAGGAACTATGCCTGAGGAATTGTTAATAGGGTTG
>augustus_masked-Fvb5-1-processed-gene-237.11:1320:1440:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-237.11:1320-1440||RAPiDGENOMICS_rs1205_02762
TTGGGCTTGGGAGGGAATAACTTGACAGGAACTATGCCTGAGGAATTGTTAATAGGGTTGGGTAATTTGACCACACTGGACCTGAGTGGTAACAAGTTTTTTGGTGAAGTTGCCATCAGT
>augustus_masked-Fvb5-1-processed-gene-237.11:1380:1500:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-237.11:1380-1500|2x||RAPiDGENOMICS_rs1205_02763
GGTAATTTGACCACACTGGACCTGAGTGGTAACAAGTTTTTTGGTGAAGTTGCCATCAGTATTGGGAGTTTGAGTCAGTTAATGGTGTTGAATTTAAGTGGCAATGGCTTTTCTGGAAGG
>augustus_masked-Fvb5-1-processed-gene-237.11:1440:1560:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_13::augustus_masked-Fvb5-1-processed-gene-237.11:1440-1560||RAPiDGENOMICS_rs1205_02764
ATTGGGAGTTTGAGTCAGTTAATGGTGTTGAATTTAAGTGGCAATGGCTTTTCTGGAAGGGTTCCGACTAGCTTGGGTAGTCTTTTCAGGCTTACGACTATCGATCTGAGCAAACAAAAC
>augustus_masked-Fvb5-1-processed-gene-237.11:1500:1620:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_13::augustus_masked-Fvb5-1-processed-gene-237.11:1500-1620|2x||RAPiDGENOMICS_rs1205_02765
GTTCCGACTAGCTTGGGTAGTCTTTTCAGGCTTACGACTATCGATCTGAGCAAACAAAACTTTTCTGGTGAGGTGCCCTCTGAGCTTTTGGGGTTACCTAATTTACAAGTCATTGCATTG
>augustus_masked-Fvb5-1-processed-gene-237.11:1620:1740:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_14::augustus_masked-Fvb5-1-processed-gene-237.11:1620-1740|2x||RAPiDGENOMICS_rs1205_02766
CAAGAGAATAGGTTGTCTGGAGACATCCCTGAAGGTTTTAGCAGTTCAATGGGTCTGCATTATTTGAATCTCAGTTCAAATGCATTTTCTGGTCACATTCCAGAGAATTATGGTTTTCTT
>augustus_masked-Fvb5-1-processed-gene-237.11:1680:1800:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_15::augustus_masked-Fvb5-1-processed-gene-237.11:1680-1800||RAPiDGENOMICS_rs1205_02767
TATTTGAATCTCAGTTCAAATGCATTTTCTGGTCACATTCCAGAGAATTATGGTTTTCTTCGGTCATTGGTTGTTCTTTCATTGTCCAACAATCACATTTTAGGACCAATTCCACCGGAG
>augustus_masked-Fvb5-1-processed-gene-237.11:1740:1860:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_15::augustus_masked-Fvb5-1-processed-gene-237.11:1740-1860|2x||RAPiDGENOMICS_rs1205_02768
CGGTCATTGGTTGTTCTTTCATTGTCCAACAATCACATTTTAGGACCAATTCCACCGGAGCTTGGGAACTGCTCCGATATTCAAGTTCTGGAGCTGCAAATGAATTCTTTGACTGGCACC
>augustus_masked-Fvb5-1-processed-gene-237.11:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-237.11:180-300|2x||RAPiDGENOMICS_rs1205_02769
TGCGACTGGCGCGGCGTCTTCTGCGACAATAGTTCTCGCGTCTCGGAGCTCCGTTTGCCTCGGCTTCAACTCGGCGGCCGACTCAGCGACTCGCTTTCCAAGCTCAAGATTCTGGGGAAG
>augustus_masked-Fvb5-1-processed-gene-237.11:1860:1980:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_16::augustus_masked-Fvb5-1-processed-gene-237.11:1860-1980|2x||RAPiDGENOMICS_rs1205_02770
ATTCCAGCCGATCTCTCTCGCTTATCAGTTTTGAAGGAACTTGATTTGGGTAGCAACAACTTAACAGGTGGAATCCCAGAGGAAATCTCCAAATGCTCATCATTAACTGCTTTGTTGTTG
>augustus_masked-Fvb5-1-processed-gene-237.11:2160:2280:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_19::augustus_masked-Fvb5-1-processed-gene-237.11:2160-2280||RAPiDGENOMICS_rs1205_02771
CTTGGTTCTCGGTTCAACAATGCATCAGACTTTTCTGGGAATCAAAACTTATGTGGCCTGCCATTGGAAAAGAAGTGCAAGGATCTAGACAAGAAAGACAGAAATAAGAGGTTGATTCTG
>augustus_masked-Fvb5-1-processed-gene-237.11:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-237.11:240-360||RAPiDGENOMICS_rs1205_02772
CGGCTTCAACTCGGCGGCCGACTCAGCGACTCGCTTTCCAAGCTCAAGATTCTGGGGAAGCTCAGTCTCCGGTCGAACTCCTTCAACGGCACTATCCCTGACTCACTCTCTCAATGCACG
>augustus_masked-Fvb5-1-processed-gene-237.11:2640:2760:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_23::augustus_masked-Fvb5-1-processed-gene-237.11:2640-2760||RAPiDGENOMICS_rs1205_02773
ATATTCCGAAAAGAAGCAGAAGCACTAGGCAGAGTCAAGCACCGAAACTTAACAGTTCTTCGCGGCTACTATGCTGGTCCACCTGACCTCAGGCTTCTTATCTATGACTACATGCCCAAC
>augustus_masked-Fvb5-1-processed-gene-237.11:2880:3000:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_25::augustus_masked-Fvb5-1-processed-gene-237.11:2880-3000||RAPiDGENOMICS_rs1205_02774
ACACTTGTACACGGCGATGTGAAGCCACAAAGCGTGCTATTCGATGCAGATTTTGAAGCCCATTTGTCTGATTTCGGCCTAGACAAACTAACATCAGCAACAAGTGCTACCACTCAAACC
>augustus_masked-Fvb5-1-processed-gene-237.11:3120:3240:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_27::augustus_masked-Fvb5-1-processed-gene-237.11:3120-3240||RAPiDGENOMICS_rs1205_02775
CTAACAGGAAAGAAGCCAGTGATGTTCACAGAAGACGAAGACATAGTGAAGTGGGTGAAGAAGCAGCTTCAAAGAGGCCAAGTTGCCGAGCTACTAGAGCCAGGGTTGCTTGAGCTAGAT
>augustus_masked-Fvb5-1-processed-gene-237.11:3240:3360:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_28::augustus_masked-Fvb5-1-processed-gene-237.11:3240-3360||RAPiDGENOMICS_rs1205_02776
CCTGAGTCATCCGAGTGGGAGGAGTTCTTGCTTGGAGTGAAAGTCGGGCTGCTTTGTACAGCACCGGACCCGCTGGATCGGCCCACCATGTCCGACATTGTTTTCATGCTCGAAGGCTGC
>augustus_masked-Fvb5-1-processed-gene-237.11:420:540:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-237.11:420-540|2x||RAPiDGENOMICS_rs1205_02777
GGGAACCTCACTGCCTTGCAAATTCTCAATGTCGCAAGTAACCGCCTCTCCGGCGAAATCTCCGGCGAGCTACCTACGAGTCTTATTTACCTCGATCTCTCTTCCAACTCATTCTCCGGC
>augustus_masked-Fvb5-1-processed-gene-237.11:480:600:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-237.11:480-600||RAPiDGENOMICS_rs1205_02778
TCCGGCGAGCTACCTACGAGTCTTATTTACCTCGATCTCTCTTCCAACTCATTCTCCGGCGAGATTCCGAGGAGCATCGCGAACCTGACGCAGCTTCAGCTCATCAACCTGTCGTACAAC
>augustus_masked-Fvb5-1-processed-gene-237.11:540:660:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-237.11:540-660|2x||RAPiDGENOMICS_rs1205_02779
GAGATTCCGAGGAGCATCGCGAACCTGACGCAGCTTCAGCTCATCAACCTGTCGTACAACCAGTTTTCCGGTCAGGTTCCGGTGAGCTTCGGCCAGCTCCAGAAGCTGCAGTTCCTCTGG
>augustus_masked-Fvb5-1-processed-gene-237.11:660:780:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-237.11:660-780|2x||RAPiDGENOMICS_rs1205_02780
CTGGACCATAACCTCTTGGAAGGGACGCTGCCGTCGGCGATAGCCAATTGCGCGGCGCTGGTGCATTTGAGCGTCGAAGGGAATGCGCTCGGCGGCGTGATTCCGGCGGCTATCGGAGCT
>augustus_masked-Fvb5-1-processed-gene-237.11:840:960:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-237.11:840-960||RAPiDGENOMICS_rs1205_02781
TCGTTGTTTTGCAATGCCTCATTCAATACGGCGTCGCTTAAGATTGTCCAGCTAGGGTTTAATTCGTTCACGGATATTGTTAAGCTTGAGACGGCCACATGTTTTAGTGGTCTGGTGGTT
>augustus_masked-Fvb5-1-processed-gene-237.11:900:1020:Parent=augustus_masked-Fvb5-1-processed-gene-237.11-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-237.11:900-1020|2x||RAPiDGENOMICS_rs1205_02782
AATTCGTTCACGGATATTGTTAAGCTTGAGACGGCCACATGTTTTAGTGGTCTGGTGGTTTTGGATCTTCAGCACAATCGGATTGGCGGCGATTTTCCTTGGTGGTTGACACAGGTGCCC
>augustus_masked-Fvb5-1-processed-gene-238.7:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-238.7-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-238.7:0-120||RAPiDGENOMICS_rs1205_02783
ATGGCCAAAATACCAGTTCTCTCCTTGCACTTACTGCCACTCTTTACCACATTGTTCATTTCTTTGCTTTTCCCGCCATGTATGCCTTTAATGGTCGAAACTGAAGCCCTCCTTGAGTTG
>augustus_masked-Fvb5-1-processed-gene-238.7:1320:1440:Parent=augustus_masked-Fvb5-1-processed-gene-238.7-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-238.7:1320-1440||RAPiDGENOMICS_rs1205_02784
CAGAACAACAATTTCTCAGGTTATCTTCCGGTGGAAATTGGGAAGCTAACAAAGTTGGACAGACTCTATTTGAATCATAATAACTTCTCAGGTGAAATACCTTCAGAAATTGGTTTCCTG
>augustus_masked-Fvb5-1-processed-gene-238.7:1560:1680:Parent=augustus_masked-Fvb5-1-processed-gene-238.7-mRNA-1_14::augustus_masked-Fvb5-1-processed-gene-238.7:1560-1680||RAPiDGENOMICS_rs1205_02785
ATCCCACTTACGCTTTCACTGATGAGCTCTTTGAACTCTCTAAATCTCTCTGGGAATAAACTCTCTGGTGAAGTTCCAGAAAATTTAGAGAAACTGAAGCTAAGCTCCATAGACTTGTCC
>augustus_masked-Fvb5-1-processed-gene-238.7:1680:1800:Parent=augustus_masked-Fvb5-1-processed-gene-238.7-mRNA-1_15::augustus_masked-Fvb5-1-processed-gene-238.7:1680-1800||RAPiDGENOMICS_rs1205_02786
GAAAATCTGTTATCTGGAAGAGTACCATCTGATCTTCTGACCACAGGTGGAGACAAAGCCTTTCGTGGAAACAACAAACTCTGCATCGACCAATATTCAAAAGCACATTCAGATTCTAAT
>augustus_masked-Fvb5-1-processed-gene-238.7:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-238.7-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-238.7:180-300|2x||RAPiDGENOMICS_rs1205_02787
TCCCCCTGTGAGTTCTCCGGGATTACTTGCGATTCTGGGAAAGTCACTGAAATATCTCTTGGGTACAAGTCACTCTCCGGTCAGATTTCGCCCTCCATTGGCGTCCTTGAGAGCCTCACC
>augustus_masked-Fvb5-1-processed-gene-238.7:2280:2400:Parent=augustus_masked-Fvb5-1-processed-gene-238.7-mRNA-1_20::augustus_masked-Fvb5-1-processed-gene-238.7:2280-2400||RAPiDGENOMICS_rs1205_02788
AATTTGTTTCAAGCACTTCACAGACAGCTTAAAGGTGGGCAGCCGGAATTGGATTGGTACCAGAGGTATAGGATTGCTTTGGGAGCAGCTCGGGGGATTTCTTATCTACACCATGATTGT
>augustus_masked-Fvb5-1-processed-gene-238.7:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-238.7-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-238.7:240-360||RAPiDGENOMICS_rs1205_02789
GGGTACAAGTCACTCTCCGGTCAGATTTCGCCCTCCATTGGCGTCCTTGAGAGCCTCACCACGCTTTCACTGACTTCCAACCGCATAACAGGAGAGATTCCTGTACAATTGACTCATTGT
>augustus_masked-Fvb5-1-processed-gene-238.7:2563:2683:Parent=augustus_masked-Fvb5-1-processed-gene-238.7-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-238.7:2563-2683||RAPiDGENOMICS_rs1205_02790
AGCTGGCTTATACTGCTAAAGTCACTGAAAAGTGCGATGTCTATAGTTTTGGTGTAGTTCTACTTGAGCTAGTTACTGGTAAAAGACCAATTGAAGACGACTACGGGGAAGGAAAAGACA
>augustus_masked-Fvb5-1-processed-gene-238.7:2803:2923:Parent=augustus_masked-Fvb5-1-processed-gene-238.7-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-238.7:2803-2923||RAPiDGENOMICS_rs1205_02791
TTTGTACTACCAAGCTTCCATCCCTGCGCCCTACAATGCGAGAGGTGATCAAGATGCTTACTGATGCTGATCCTAGCACTTTCACGTCTCCAAGTAATAAATCAAGCAAAGATGGCAAGG
>augustus_masked-Fvb5-1-processed-gene-238.7:300:420:Parent=augustus_masked-Fvb5-1-processed-gene-238.7-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-238.7:300-420|2x||RAPiDGENOMICS_rs1205_02792
ACGCTTTCACTGACTTCCAACCGCATAACAGGAGAGATTCCTGTACAATTGACTCATTGTACCAATCTTAAATCATTGAATCTGTCTCAGAATCAATTGGTTGGAAAAATCCCTGATCTT
>augustus_masked-Fvb5-1-processed-gene-238.7:480:600:Parent=augustus_masked-Fvb5-1-processed-gene-238.7-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-238.7:480-600||RAPiDGENOMICS_rs1205_02793
CCTTCTTGGGTGGGAAATCTCACAGGTCTACAATATCTGGGCCTTGGGTACAATCCGTTTGATGAAAGTGAAGTTCCTGGGAATCTTGGAAACTTGAAGAACTTGACATGGCTGTATCTG
>augustus_masked-Fvb5-1-processed-gene-238.7:840:960:Parent=augustus_masked-Fvb5-1-processed-gene-238.7-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-238.7:840-960||RAPiDGENOMICS_rs1205_02794
TTGCCTCCCGAGTTTGGAAATCTCAAGAATTTAGTGGTTTTTCAGTTGTATAACAACAATTTTTCTGGGGAGTTCCCTTCTGGGTTTGGAGAGATGCAGCATCTTACTGCATTGTCAATA
>augustus_masked-Fvb5-1-processed-gene-244.4:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-244.4:0-120||RAPiDGENOMICS_rs1205_02795
ATGTTGTTGAGCAAGATGTTGAGAGAGAGTAACCCAGAAGGGGGGCGGTTCCTTGTCATCCCAATTGTAGGGATGGGAGGGATGGGGAAAACAACTCTTGCCCAATTAGTCTATAATGAT
>augustus_masked-Fvb5-1-processed-gene-244.4:1041:1161:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-244.4:1041-1161||RAPiDGENOMICS_rs1205_02796
TTGTTGCAACCACATGAAAATTTGGAACGTTTATTCATTTTCCACTGCCACGGCACAATCGAGTCTCTCTATCGAATAAAGTCTTTACAGAATTTGAGACATGTTAATCTTTATGATTGG
>augustus_masked-Fvb5-1-processed-gene-244.4:1161:1281:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-244.4:1161-1281||RAPiDGENOMICS_rs1205_02797
AGATTTTGTGAAGTTTTGCCTCTTGGAAAATTGCCATCGCTTGAAGTTTTAGAAATTCAGAAGATGGATATTGTGAAAAAGGTGGGAGATGAATTTTTTGGAATAGAAAAACAAGACTCT
>augustus_masked-Fvb5-1-processed-gene-244.4:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-244.4:120-240||RAPiDGENOMICS_rs1205_02798
GAAAATGTTACAACCCATTTTCATAAGAAAGCCTGGGTTTGTGTCTCAGATCCTTTTAATGAGGTTAAGATTGCTAAAGCGATCTTAGAATGTTTAGATGGAACCGAGAGCAGGTTAAAT
>augustus_masked-Fvb5-1-processed-gene-244.4:1281:1401:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-244.4:1281-1401||RAPiDGENOMICS_rs1205_02799
GAAACTCTCTCTGCAGGAATTCTGTTCCCTAAACTGAAACAACTCTCTTCTTGGGGCATGTTCAAATGGCAAGAGTGGGAAGGAATCACAAGGGATTTATCTGAAATCATAATAATGCCA
>augustus_masked-Fvb5-1-processed-gene-244.4:1401:1521:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-244.4:1401-1521||RAPiDGENOMICS_rs1205_02800
CGCCTTTCTTCCTTGGAATTTTGGGCGTGCTCACAGCTCAAAGCACTGCCAGACTTCCTCTACAACATAACAGCACTTCGTACCTTGACAATCGAGTTTTGTCGAATTCTCAGACGAGAA
>augustus_masked-Fvb5-1-processed-gene-244.4:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-244.4:180-300|2x||RAPiDGENOMICS_rs1205_02801
GAGGTTAAGATTGCTAAAGCGATCTTAGAATGTTTAGATGGAACCGAGAGCAGGTTAAATGAGTTGGAAACTCTGCTGTTGTGTATAAGAACACATGTTGAGAAAAAGAAATTTCTCCTT
>augustus_masked-Fvb5-1-processed-gene-244.4:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-244.4:240-360||RAPiDGENOMICS_rs1205_02802
GAGTTGGAAACTCTGCTGTTGTGTATAAGAACACATGTTGAGAAAAAGAAATTTCTCCTTGTCCTGGATGATGTGTGGACTGAAGAAGAAACCAAGTGGGAAAGTTTGAAATTATTTGTA
>augustus_masked-Fvb5-1-processed-gene-244.4:300:420:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-244.4:300-420|2x||RAPiDGENOMICS_rs1205_02803
GTCCTGGATGATGTGTGGACTGAAGAAGAAACCAAGTGGGAAAGTTTGAAATTATTTGTAATAATGCAGTGTTGTGCAGAAGGTAGTACAATACTAGTCACAACGCGAAAACAAGAGGTT
>augustus_masked-Fvb5-1-processed-gene-244.4:360:480:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-244.4:360-480||RAPiDGENOMICS_rs1205_02804
ATAATGCAGTGTTGTGCAGAAGGTAGTACAATACTAGTCACAACGCGAAAACAAGAGGTTGCTAAAATGATGAGAGCAACCTGTAATATGATCCATTTAGACAAGTTGAGTGATAGGTAT
>augustus_masked-Fvb5-1-processed-gene-244.4:420:540:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-244.4:420-540|2x||RAPiDGENOMICS_rs1205_02805
GCTAAAATGATGAGAGCAACCTGTAATATGATCCATTTAGACAAGTTGAGTGATAGGTATTGTCTAGCATTGTTCAACAGTATCGCATTTTTGGATAGGGAAGTAGATGAGTCTAGTGAG
>augustus_masked-Fvb5-1-processed-gene-244.4:480:600:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-244.4:480-600||RAPiDGENOMICS_rs1205_02806
TGTCTAGCATTGTTCAACAGTATCGCATTTTTGGATAGGGAAGTAGATGAGTCTAGTGAGTTTGGAGTCATTGGTGAGAAAATTGTGAATAAGTGTAAAGGTTTGCTTCTTGCCGTAAAG
>augustus_masked-Fvb5-1-processed-gene-244.4:540:660:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-244.4:540-660|2x||RAPiDGENOMICS_rs1205_02807
TTTGGAGTCATTGGTGAGAAAATTGTGAATAAGTGTAAAGGTTTGCTTCTTGCCGTAAAGACTCTAGGCAGTCTATTGTGGCATAAGAAAACAACAAGGGAATGGCAGGATGTTCTAGAT
>augustus_masked-Fvb5-1-processed-gene-244.4:60:180:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-244.4:60-180|2x||RAPiDGENOMICS_rs1205_02808
CCAATTGTAGGGATGGGAGGGATGGGGAAAACAACTCTTGCCCAATTAGTCTATAATGATGAAAATGTTACAACCCATTTTCATAAGAAAGCCTGGGTTTGTGTCTCAGATCCTTTTAAT
>augustus_masked-Fvb5-1-processed-gene-244.4:681:801:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-244.4:681-801||RAPiDGENOMICS_rs1205_02809
CTTGAGAAACTACCCAAGGCAATGGGAAAGTTGATTAATTTGAAGCATCTATATGTTTGGGGTTGTTTAAATCTGAGGTACTTGCCTAAAGGGATTAGGAGTTTGAAAAGTCTGCTAGTA
>augustus_masked-Fvb5-1-processed-gene-244.4:741:861:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-244.4:741-861|2x||RAPiDGENOMICS_rs1205_02810
GGTTGTTTAAATCTGAGGTACTTGCCTAAAGGGATTAGGAGTTTGAAAAGTCTGCTAGTACTAGACTGCTTTTATGTATGTGAGGGTGAGGATGAAGCATTAAAGTTCAGACATCTCGGA
>augustus_masked-Fvb5-1-processed-gene-244.4:801:921:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-244.4:801-921||RAPiDGENOMICS_rs1205_02811
CTAGACTGCTTTTATGTATGTGAGGGTGAGGATGAAGCATTAAAGTTCAGACATCTCGGAATCATGGAACAACTTCATGGGAGCCTTCGGATAGACAGGGTGGGGAGTAGTGCAAAAGAT
>augustus_masked-Fvb5-1-processed-gene-244.4:921:1041:Parent=augustus_masked-Fvb5-1-processed-gene-244.4-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-244.4:921-1041||RAPiDGENOMICS_rs1205_02812
GATGCTAGTGAGATTGAGAAAGCACAGTTGGGGAAGAAGAAGCACCTCCGTAGTTTGGGAGTAAGATTCCAGGAAGAAGATGGAGAGCAGAGAAAAGGTGATGACGAAACCGTGAAAGCA
>augustus_masked-Fvb5-1-processed-gene-248.11:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-248.11-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-248.11:0-120||RAPiDGENOMICS_rs1205_02813
ATGGAAGAAGGCAAGGACAACCATGAGGTCAAAGGTGAGACATCAGGTTCTCCTCCTCCTCCATCCTGTCCATTTCAGTTACGTTTCAAAGAGTTACCTGATCATCTTCAACAGTGTTTA
>augustus_masked-Fvb5-1-processed-gene-248.11:1080:1200:Parent=augustus_masked-Fvb5-1-processed-gene-248.11-mRNA-1_10::augustus_masked-Fvb5-1-processed-gene-248.11:1080-1200||RAPiDGENOMICS_rs1205_02814
GCTTGGTTTGGTTCCTTGGAAAGGCTCACAAGCTTAAGATTAGGTTTCTCCCATTTGTCTGAGAACCCATCATTGGTGCTTCAAGTCCTACTCAACTTGAAAAGCTTAACCCTTTGGGAG
>augustus_masked-Fvb5-1-processed-gene-248.11:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-248.11-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-248.11:120-240||RAPiDGENOMICS_rs1205_02815
ATGTACTGTTCCATCTTCCCTGAGAGCTACCTGCTTTCAAAAGCGGCACTTATCCGATTACTAGTGGCCCAAGGATTGATAGAAGAAAAGGCAGGGAGGATTCTGGAGGATGTCGCAGAA
>augustus_masked-Fvb5-1-processed-gene-248.11:1200:1320:Parent=augustus_masked-Fvb5-1-processed-gene-248.11-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-248.11:1200-1320||RAPiDGENOMICS_rs1205_02816
GCTTATGATGCAAAGCAAATAGGGAAAGAGTTCTGTAGTGCTGGTGGATTTTCCAAGCTCGAGATTCTCATCATTGCTTCTCCTGTTCTTGAGGAGTGGACAGAACTTGAAGAGGGAGCA
>augustus_masked-Fvb5-1-processed-gene-248.11:1320:1440:Parent=augustus_masked-Fvb5-1-processed-gene-248.11-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-248.11:1320-1440||RAPiDGENOMICS_rs1205_02817
CTACCTAGCTTGAGGTACCTCCACTTGCACAGTTGTGTGCGCCTGAAAATGTTACCTGAAGGTTTGCAGTCCCTCACCAAACTGGAGCAGTTGCATTTGCTGCCTCTGATGGATGATCAT
>augustus_masked-Fvb5-1-processed-gene-248.11:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-248.11-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-248.11:180-300|2x||RAPiDGENOMICS_rs1205_02818
CTAGTGGCCCAAGGATTGATAGAAGAAAAGGCAGGGAGGATTCTGGAGGATGTCGCAGAAGAATATATATGTGAATTGATCAACCAGCGACTGCTTCGAGTAAAGGATGAACTTGATCGG
>augustus_masked-Fvb5-1-processed-gene-248.11:360:480:Parent=augustus_masked-Fvb5-1-processed-gene-248.11-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-248.11:360-480||RAPiDGENOMICS_rs1205_02819
AAGGAAGGAAAGTATGCAGCCTTTAAGGTTTTCATTTGTTCAGACATCAGACAACTCATATCTCAAACCAACAATCTTCAACTAACTGCTTTGTTCCTGCTAGAAAAGGAAGATCTCTCT
>augustus_masked-Fvb5-1-processed-gene-248.11:480:600:Parent=augustus_masked-Fvb5-1-processed-gene-248.11-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-248.11:480-600||RAPiDGENOMICS_rs1205_02820
CAACATGATGGTAGTTGGCTACAATTTGATGGTGTGAACACTGTAAGAGTGCTTGAGCTGAAAGATACCAAAATCAAGAAGTTACCAGATGAAGTGGGAGACCTGAAACACCTCAGGTAT
>augustus_masked-Fvb5-1-processed-gene-248.11:600:720:Parent=augustus_masked-Fvb5-1-processed-gene-248.11-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-248.11:600-720||RAPiDGENOMICS_rs1205_02821
CTTGGCTTGAAAAGCACCGATATAGAAGAGCTTCCAGAGGGACTAGGCAGATTAGAAGCCTTGCAAACTTTGGATATTAGATGGTGTGGGGATTTAACAGGCTTGTCAGCTGAGATACTC
>augustus_masked-Fvb5-1-processed-gene-248.11:720:840:Parent=augustus_masked-Fvb5-1-processed-gene-248.11-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-248.11:720-840||RAPiDGENOMICS_rs1205_02822
AATCTTGTAAGGTTGAGGCACCTCAAAATGTACAAGACCAAAGGCGTTTGTGGGATGAAGCTACCAGTAGGAATAGGAAAACTCAGAGATCTTCAGACATTGACAGGTATATACGCTGGC
>augustus_masked-Fvb5-1-processed-gene-248.11:840:960:Parent=augustus_masked-Fvb5-1-processed-gene-248.11-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-248.11:840-960||RAPiDGENOMICS_rs1205_02823
GGTGGAACTGCAGCTGAAGTAGGTAACCTGATAGGGCTCAGAAGACTCGGAGTGATGGATGTGGATGAAGAGAATGTCACTGAGCTATTTGCCTCTATCGAGAAGATGCCGTGCCTTCTT
>augustus_masked-Fvb5-1-processed-gene-248.11:960:1080:Parent=augustus_masked-Fvb5-1-processed-gene-248.11-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-248.11:960-1080||RAPiDGENOMICS_rs1205_02824
TCCTTGTCTTTAGAAGCAAAGTACACGTATCCTCAGGAAAAACTTGTCCTCTTGGAGTCATTCTCACCTCCACCATTTCTTCGAAAGCTTCGCCTTGAGGGAATACTAGAAAAGCTACCT
>augustus_masked-Fvb5-1-processed-gene-249.2:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-249.2-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-249.2:0-120||RAPiDGENOMICS_rs1205_02825
ATGATCATGTTCAAGGTCCAAGTGAGAGATGTGAAACTGACGCTGGAATGTTTGAAGCCAGTGATCCAAGAGATATCAGAGTACAACAAGGTGTTGAAGAATCAGCCATTAGAGGAGGAG
>augustus_masked-Fvb5-1-processed-gene-249.2:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-249.2-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-249.2:120-240||RAPiDGENOMICS_rs1205_02826
CTAGAACTGCAGGACTTGAAATTGCAAATAGAAGAGGGTGCAAATCTCGTTCGAAAGTGTTCCAAGGTTGGTGCCTGGAGTTTGTGCAAGAAGTACAAGTACAGCAACCAACTCTCTCAA
>augustus_masked-Fvb5-1-processed-gene-249.2:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-249.2-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-249.2:180-300|2x||RAPiDGENOMICS_rs1205_02827
TCCAAGGTTGGTGCCTGGAGTTTGTGCAAGAAGTACAAGTACAGCAACCAACTCTCTCAACTGGATCAATCACTTCAGACACTGTTGCATTTGCTCGAAGTTCAGAAAACAAGGGATCTC
>augustus_masked-Fvb5-1-processed-gene-249.2:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-249.2-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-249.2:240-360||RAPiDGENOMICS_rs1205_02828
CTGGATCAATCACTTCAGACACTGTTGCATTTGCTCGAAGTTCAGAAAACAAGGGATCTCAGGGAGACCTTGGTTATTGTCAACAAGATAGAGACCGTCGTCCAGCGAATTGAAGGAAAT
>augustus_masked-Fvb5-1-processed-gene-249.2:60:180:Parent=augustus_masked-Fvb5-1-processed-gene-249.2-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-249.2:60-180|2x||RAPiDGENOMICS_rs1205_02829
GTGATCCAAGAGATATCAGAGTACAACAAGGTGTTGAAGAATCAGCCATTAGAGGAGGAGCTAGAACTGCAGGACTTGAAATTGCAAATAGAAGAGGGTGCAAATCTCGTTCGAAAGTGT
>augustus_masked-Fvb5-1-processed-gene-250.1:1058:1178:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-250.1:1058-1178|2x||RAPiDGENOMICS_rs1205_02830
AATATATTCGGCTACAGAAATGAATGAAGATGAAGCTCTTCAGCTCTTTACTTGGCATGCCTTCAGAAAGAGTAATCATGATGAAGGATTTTTTGAAGTATCAAGTAGTGTAGTTGCCTA
>augustus_masked-Fvb5-1-processed-gene-250.1:1118:1238:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-250.1:1118-1238||RAPiDGENOMICS_rs1205_02831
CTTCAGAAAGAGTAATCATGATGAAGGATTTTTTGAAGTATCAAGTAGTGTAGTTGCCTACTGCGGAGGTTTGCCGGTAGCTCTTGAAATTCTAGGATCTTTGTTGCTAGGAAGAAGCAT
>augustus_masked-Fvb5-1-processed-gene-250.1:1238:1358:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-250.1:1238-1358||RAPiDGENOMICS_rs1205_02832
GCCCGAGTGGAAAAGCGTGTTGGGGAAATTGAAAAGAGTTCCTCATGGCCAAATTCAGGAAAAGCTTAAGATAAGCTTTGATGGGCTAAGTGATGATAAACAGAAGGATATATTCCTTGA
>augustus_masked-Fvb5-1-processed-gene-250.1:1298:1418:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-250.1:1298-1418|2x||RAPiDGENOMICS_rs1205_02833
AAAGCTTAAGATAAGCTTTGATGGGCTAAGTGATGATAAACAGAAGGATATATTCCTTGACATATCCTGTTTCTTTATAGGAATGGACAAGAACTATGTCATACAAATATTGGATGGTTG
>augustus_masked-Fvb5-1-processed-gene-250.1:1358:1478:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-250.1:1358-1478||RAPiDGENOMICS_rs1205_02834
CATATCCTGTTTCTTTATAGGAATGGACAAGAACTATGTCATACAAATATTGGATGGTTGTAATCTCTTTGCCAAAATTGGAATCAGTGGTCTCCTAGAGCGACGCCTTGTGACTGTTTG
>augustus_masked-Fvb5-1-processed-gene-250.1:1418:1538:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-250.1:1418-1538|2x||RAPiDGENOMICS_rs1205_02835
TAATCTCTTTGCCAAAATTGGAATCAGTGGTCTCCTAGAGCGACGCCTTGTGACTGTTTGTGAAAGAAACAAGCTGGGGATGCATGATTTGCTTCGAGACATGGGCAGAGAAATTGTTCG
>augustus_masked-Fvb5-1-processed-gene-250.1:1478:1598:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-250.1:1478-1598||RAPiDGENOMICS_rs1205_02836
TGAAAGAAACAAGCTGGGGATGCATGATTTGCTTCGAGACATGGGCAGAGAAATTGTTCGAACAAATTCCCCTAATGACCCTGGAAAGTGTAGTAGATTGTGGAACCCTGAAGATGTAAT
>augustus_masked-Fvb5-1-processed-gene-250.1:1620:1740:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-250.1:1620-1740||RAPiDGENOMICS_rs1205_02837
GGAACTGAAGAAATTCAAGGACTCGCTCTAACTTTGTCGGGATCTGACAAGGCGTGTTTCAATACAAATGTATTTAAAAATATGAAGCGATTGAGATTGCTTCATCTCAAATACGTAGAG
>augustus_masked-Fvb5-1-processed-gene-250.1:1740:1860:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-250.1:1740-1860||RAPiDGENOMICS_rs1205_02838
CTCACTGGAGGCTATGGAGATCTTTCCAAAAAGTTAAGGTGGTTGTGCTGGCATGGATTTCCTCTAAAGTTCCTTCCGAATGAGTTTAATCTACCAAATGTTGTTGTTATTGATCTGCAG
>augustus_masked-Fvb5-1-processed-gene-250.1:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-250.1:180-300|2x||RAPiDGENOMICS_rs1205_02839
AGAAGAGGGGAAAAAATCTCATCCGACCTGCTTCGTGCAATCCAGGGGTCCAGAGTTTCTGTGATCGTCTTCTCCAGGAGGTATGGGGATTCGAGTTGGTGCCTTGAGGAACTGGTCAAG
>augustus_masked-Fvb5-1-processed-gene-250.1:1896:2016:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-250.1:1896-2016||RAPiDGENOMICS_rs1205_02840
ATGCTCAAAAAGCTGAAGATTCTAAATCTTAGTCATTCTCATCACCTAACAAGATCACCAGACTTCTCAAAACTTCCAAAGCTCGAGAAATTGATACTCAAAGGCTGTGAGAGGTTATCC
>augustus_masked-Fvb5-1-processed-gene-250.1:2016:2136:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-250.1:2016-2136||RAPiDGENOMICS_rs1205_02841
GAGGTTCACCAGTCCATTGGACATCTTGAAGGACTTGCTTTGGTAAATCTTAAAGACTGCAAAATGCTCAAGGAGCTCCCAATGTCTTTCTACCAGTTGAAAGCTATTGAAACTCTGATT
>augustus_masked-Fvb5-1-processed-gene-250.1:2136:2256:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-250.1:2136-2256||RAPiDGENOMICS_rs1205_02842
CTTTCTGGCTGTTCAAAATTTGATAACTTGATGAAGGATTTAGGTCAGATGGTATCCTTGAGAACTCTGCTAGCTGATAACACTGCCATAAGAGAAATACCATCATCCATAATACAGTTG
>augustus_masked-Fvb5-1-processed-gene-250.1:2256:2376:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-250.1:2256-2376||RAPiDGENOMICS_rs1205_02843
AGTAACCTTGAATATTTATCTTTATGTGGCCTGAAACAGCGGCCATCTAAATTGTTTCTGACTCGCTTCTGGTCTCACCTGTTGCCAAGAAGATGTGTAAAATATCCTACATCCTTATCA
>augustus_masked-Fvb5-1-processed-gene-250.1:2376:2496:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-250.1:2376-2496||RAPiDGENOMICS_rs1205_02844
GGTTTATATGCTTTGAAAGAACTGTATGTTAGAGACTGCAATTTAAATGACAGTTCACTTCCGAAGGATCTTGAGAGTCTATCTTGTTTGGAAGTATTGAATTTGGGAAGAAATTGTTTC
>augustus_masked-Fvb5-1-processed-gene-250.1:2496:2616:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-250.1:2496-2616||RAPiDGENOMICS_rs1205_02845
TTTAGCCTTCCATGCCTCAGTGGTCTTCTCCAGCTTCAAGATCTTACATTGGATAATTGCAATTTGACTGAAGAGGCCATTACAGCTACTAATCTTTGGACTCTACCTTCTTTAGATTTA
>augustus_masked-Fvb5-1-processed-gene-250.1:2616:2736:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-250.1:2616-2736||RAPiDGENOMICS_rs1205_02846
TTGGATCTAAGTGGCAATAGTTTTCGTAGCCTTCCAAGCCTCAGGGGACTTCCCAAGCTAGTCCATCTACTTCTGGATAATTGCACTAACCTTCATGCCATCCCAGAACTACCAACAAAT
>augustus_masked-Fvb5-1-processed-gene-250.1:2736:2856:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-250.1:2736-2856||RAPiDGENOMICS_rs1205_02847
CTAGCTGTGCTGAGAGCAGATGGCTGCACTGCATTGGAAAGAATGCCAAACTTTTCAGAAATGCTGAGCATCCGTCAGCTGAATCTTAGTGATTCCCCCAAACTAAGTGACATCCCGGGC
>augustus_masked-Fvb5-1-processed-gene-250.1:2940:3060:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-250.1:2940-3060||RAPiDGENOMICS_rs1205_02848
AGGGGGAGTTATGCAGGCAACTTTGGAGGCATCTTTCTCCCTGGAAATGACATTCCACCGAGGTTCATGTATGTCAATGAGGGTGGCATTCTCACTTTTCAAGTGCCTCCTAATATAGGC
>augustus_masked-Fvb5-1-processed-gene-250.1:300:420:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-250.1:300-420|2x||RAPiDGENOMICS_rs1205_02849
ATCATGGAGTGTAGAAGAACACTTGGTCAAATGGTTTTCCCAGTTTTCGTTGACGTTAATCCTTCCGATGTGAGAAGACAGACTGGTAGTTTTGCAGTGGCATTTCAGAAGCATGAAGGG
>augustus_masked-Fvb5-1-processed-gene-250.1:3060:3180:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-250.1:3060-3180||RAPiDGENOMICS_rs1205_02850
AGTAATCTGAAGGCATTGACTGTGTGCATTGTCTATTCTTGTTCTTCAAAGAAAAGAGAAAATCTGAGTAGTATTTTCATATATGTTATAAACCATACCAAGCACACTGTCTTTTTCGTC
>augustus_masked-Fvb5-1-processed-gene-250.1:3180:3300:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-250.1:3180-3300||RAPiDGENOMICS_rs1205_02851
CGACCATCATCACGTCCCAAGGAAATAATCTCCAGTGGGGTTATTTGGCAAGGACGCTTCTCAAACAGAAAGTTCAGTTTGGAAGGTGGAGACGACGTTGAGATTTGTGCAGCAATTGGT
>augustus_masked-Fvb5-1-processed-gene-250.1:3300:3420:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-250.1:3300-3420||RAPiDGENOMICS_rs1205_02852
TCTCGATTCCGGGTGAAGAAAATTGGGGTTGATCTTGTATTGGATGAATATACTTTCAGAGATGTGGATATGATCAAGTCTCTTCCATATGCTCGTTTTCGTCGTCAGAATGATGATGAT
>augustus_masked-Fvb5-1-processed-gene-250.1:3420:3540:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-250.1:3420-3540||RAPiDGENOMICS_rs1205_02853
GATGAGGGAGAAATCACATCAACTAGTAGAGGTGGTGTTGTTACGCATCAGCAAATCAACTTCAACAAATGTGTCTTGTGGTGTTTGATTGCCGCCATCGCATGTTCTTATATATTCATG
>augustus_masked-Fvb5-1-processed-gene-250.1:518:638:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-250.1:518-638||RAPiDGENOMICS_rs1205_02854
GCATGAAGGGAAGTTTATCAAGATAATTGTTGGGGAGGTTAGTAGACACTTGAACAACACTTACTTATTTGAAGCCGTGTACCCAGTTGGAATCGATTCTCGGGTAGAGGATATGAGCAA
>augustus_masked-Fvb5-1-processed-gene-250.1:758:878:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-250.1:758-878||RAPiDGENOMICS_rs1205_02855
AAGTTTTCTAGCAAATGTCAGGGAAGCAACAAAGCAGCCAAATGGTCTGGTTCGTTTGCAAGAACAACTTCTTTTTGATGTCTTGAGAACAACCAAGATAAAGGTTGGTAGTGTTGATGG
>augustus_masked-Fvb5-1-processed-gene-250.1:878:998:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-250.1:878-998||RAPiDGENOMICS_rs1205_02856
AGGGATCAATGTGATAAAAGAGAGACTTCGATGTAGAAGGGTACTTGTCATAATTGATGATATAGATCAACTAGATGATCTCTATGCATTAGCTGGAAACCATGACTGGTTTGGTTCGGG
>augustus_masked-Fvb5-1-processed-gene-250.1:938:1058:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-250.1:938-1058|2x||RAPiDGENOMICS_rs1205_02857
TATAGATCAACTAGATGATCTCTATGCATTAGCTGGAAACCATGACTGGTTTGGTTCGGGAAGTAGAATTGTTATCACCACAAGAGATGAACATTTGCTAAAACTACTGAAAGTAGATTC
>augustus_masked-Fvb5-1-processed-gene-250.1:998:1118:Parent=augustus_masked-Fvb5-1-processed-gene-250.1-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-250.1:998-1118||RAPiDGENOMICS_rs1205_02858
AAGTAGAATTGTTATCACCACAAGAGATGAACATTTGCTAAAACTACTGAAAGTAGATTCAATATATTCGGCTACAGAAATGAATGAAGATGAAGCTCTTCAGCTCTTTACTTGGCATGC
>augustus_masked-Fvb5-1-processed-gene-282.2:1080:1200:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_10::augustus_masked-Fvb5-1-processed-gene-282.2:1080-1200||RAPiDGENOMICS_rs1205_02859
AGTTTGAGGAACTGCACAACCTTATATAGAGTCCGACTCGATGGGAACCAATTCACTGGAAATATATCTGAAGATTTTGGTGTATATCCAAACTTGGATTACATAAAACTAAGTGACAAT
>augustus_masked-Fvb5-1-processed-gene-282.2:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-282.2:120-240||RAPiDGENOMICS_rs1205_02860
ATAAGCAGTCTTCAAGACCCTCAATCAAACCTAACTTCATGGTTTTCTCAGCACTTCCCAAATGAAACAAGTACATGCACTTGGTCTGCCATTTCTTGCAACAGTGCCAATAGTGTCACC
>augustus_masked-Fvb5-1-processed-gene-282.2:1200:1320:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-282.2:1200-1320||RAPiDGENOMICS_rs1205_02861
AATTTTTATGGTGAAATTTCGGAGAAATGGGGCAAGTCTCTGCAGCTAACAAATCTTGAGATTGCAGGTAACAATATAACAGGTTCCATACCACCTGAGATTGGTAATTTGTCTCAACTA
>augustus_masked-Fvb5-1-processed-gene-282.2:1320:1440:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-282.2:1320-1440||RAPiDGENOMICS_rs1205_02862
CATTTGCTCAATCTTTCTTCGAATCATTTAGTTGGAACAATCCCTGTAGGACTAGGAAAGTTGACCTCTTTGATTCAGCTCATACTGAATGATAATCAACTTTCTGGTGCCATACCACAA
>augustus_masked-Fvb5-1-processed-gene-282.2:1560:1680:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_14::augustus_masked-Fvb5-1-processed-gene-282.2:1560-1680||RAPiDGENOMICS_rs1205_02863
AAGTTGAGTCATGCAACCCCAAGTAAGTTGGGTCAGTTGAAGCAGCTGTCTGTACTAGATTTGAGTCATAATTCTCTTAGTCAAGAGATACCAACGGAGCTTAGTAATTTGGAAAGCTTG
>augustus_masked-Fvb5-1-processed-gene-282.2:1620:1740:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_14::augustus_masked-Fvb5-1-processed-gene-282.2:1620-1740|2x||RAPiDGENOMICS_rs1205_02864
TTGAGTCATAATTCTCTTAGTCAAGAGATACCAACGGAGCTTAGTAATTTGGAAAGCTTGTTGACAATGAATCTGTCCCATAATAACCTCTCTGGTGTTGTTCCCAAGACTTTTGATCAC
>augustus_masked-Fvb5-1-processed-gene-282.2:1680:1800:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_15::augustus_masked-Fvb5-1-processed-gene-282.2:1680-1800||RAPiDGENOMICS_rs1205_02865
TTGACAATGAATCTGTCCCATAATAACCTCTCTGGTGTTGTTCCCAAGACTTTTGATCACCTTCGTGGCTTGGAGTTCGTTGACATATCGTACAATCGATTATCGGGTTTAATTCCAGAA
>augustus_masked-Fvb5-1-processed-gene-282.2:1740:1860:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_15::augustus_masked-Fvb5-1-processed-gene-282.2:1740-1860|2x||RAPiDGENOMICS_rs1205_02866
CTTCGTGGCTTGGAGTTCGTTGACATATCGTACAATCGATTATCGGGTTTAATTCCAGAAAACAAAGCATTTCAAGAAGCTCCTATAGAAGCATTGCAAGGGAATCAAGGTCTGTGTGGC
>augustus_masked-Fvb5-1-processed-gene-282.2:1800:1920:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_16::augustus_masked-Fvb5-1-processed-gene-282.2:1800-1920||RAPiDGENOMICS_rs1205_02867
AACAAAGCATTTCAAGAAGCTCCTATAGAAGCATTGCAAGGGAATCAAGGTCTGTGTGGCAACGCTACAGCTTTACAGCCCTGCAGTAAGACACATGGCAAAATGAAGCTCGTGTACTTG
>augustus_masked-Fvb5-1-processed-gene-282.2:2040:2160:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_18::augustus_masked-Fvb5-1-processed-gene-282.2:2040-2160||RAPiDGENOMICS_rs1205_02868
CTTCGTTCAGTGTCAATTTTTGAAGGAAAATTGTTGTATGAAGAAATTGTAAAAGCAACTGAAGATTTTAATGATGCTTATTGCATTGGAAAGGGAGGCGTTGGAACTGTATACAAGGCA
>augustus_masked-Fvb5-1-processed-gene-282.2:2160:2280:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_19::augustus_masked-Fvb5-1-processed-gene-282.2:2160-2280||RAPiDGENOMICS_rs1205_02869
AAGCTTCCATCTGATGAGTTGGTAGCAGTAAAGAAACTCCACTGTGATGGTGTGAGGAGCTTTGAAAAAGAGTTCTTAAACGAGGTGATGGCATTGACTGAGATACGCCATCGGAATGTT
>augustus_masked-Fvb5-1-processed-gene-282.2:2280:2400:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_20::augustus_masked-Fvb5-1-processed-gene-282.2:2280-2400||RAPiDGENOMICS_rs1205_02870
GTGAAACTTTATGGCTTCTGTTCACATCCACGACACTCGTTTTTGGTCTATGAGTACCTTGGAAGGGGTAGCTTGTTCTCAATCTTGTGTAATGATGAAGCAGCCAAGGAATTGGATTGG
>augustus_masked-Fvb5-1-processed-gene-282.2:2400:2520:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_21::augustus_masked-Fvb5-1-processed-gene-282.2:2400-2520||RAPiDGENOMICS_rs1205_02871
AGCAAGAGGGTAAATATCATCAAAGGTGTGGCTGATGGCTTATCATACATGCACTCTGATGTATCACCACCAATTGTTCATCGAGACATAACCAGCAAGAACATTTTGCTAGATGCAGAA
>augustus_masked-Fvb5-1-processed-gene-282.2:2740:2860:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-282.2:2740-2860||RAPiDGENOMICS_rs1205_02872
CTGCAATCAGAAAAGGAAATTTGCCTGAAGATGTGTGGGACGGCCGCCTTGAACCTCCCATGGGTAAAACTCTAGAGGAACTTGTTACTGTCTTAATGCTATCTGTCGCATGCCTACATC
>augustus_masked-Fvb5-1-processed-gene-282.2:360:480:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-282.2:360-480||RAPiDGENOMICS_rs1205_02873
GAAATCAGTAAACTCTCCAAACTAGTGTATCTTGATTTGTCTACCAATAGGTTGAATGGTTCAGTTCCTGCTTCTTTTGGGAACCTTAGCAGTCTTGCTTACTTGAATCTAGGTAGGAAC
>augustus_masked-Fvb5-1-processed-gene-282.2:600:720:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-282.2:600-720||RAPiDGENOMICS_rs1205_02874
AAAGTGCTATACATGTTTGAGAACATATTTGTTGGCTCCATTCCCTTGGAGATAGGTAAGTTGGCTTTTCTCAGGAGTCTCAGCCTTCACAAAAACAATATTTCTGGTAGTATCCCGGAT
>augustus_masked-Fvb5-1-processed-gene-282.2:720:840:Parent=augustus_masked-Fvb5-1-processed-gene-282.2-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-282.2:720-840||RAPiDGENOMICS_rs1205_02875
TCCATATGTGACTTGAGACACCTTACTTCATTGGAGCTGTATCGGAACAATCTTTCCGGCCAAATTCCAGAAAATATTGGAAGCTTGAAGTCTCTTGTTGTTCTAAATGCCTGTGAGAAT
>augustus_masked-Fvb5-1-processed-gene-297.17:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-297.17:0-120||RAPiDGENOMICS_rs1205_02876
ATGTCGATTCCGGAGAAACAGTCGGATGTATCACCTCTTGAGATGTCACAATGCGCTGCTGAGGAAATGTTCGATAAAAGTGAGGCCATGGCCAGCATAAGGAGGAGTTATGAAGATCTT
>augustus_masked-Fvb5-1-processed-gene-297.17:1080:1200:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_10::augustus_masked-Fvb5-1-processed-gene-297.17:1080-1200||RAPiDGENOMICS_rs1205_02877
GCTGTAGTTCAACAAGGGGAGTATGGAAAGTTGAAAGATATGTTATCTCTACGCTGCCTGAAAATATCATGGGGAGTGGTTTCTGAAAATGAGTCCAATCGCTCCAATGAGCTCTTATTT
>augustus_masked-Fvb5-1-processed-gene-297.17:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-297.17:120-240||RAPiDGENOMICS_rs1205_02878
CAGGGGACGGATTTGAAGGTCTGCCTTCTTTCTTTCTCAATCTTCCCTGAGAATTCTGTGATTAGAAAGAGGCCTCTAATTTACTGGTGGATTGGCGAGGGCTTCATCACGGCTACCGAA
>augustus_masked-Fvb5-1-processed-gene-297.17:1200:1320:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-297.17:1200-1320||RAPiDGENOMICS_rs1205_02879
CCACCGAATTTAGAAAAACTGGATCTTCAAGGTTTTCCTCTATCAGCTGCACCAGAAGGGTTGAAGGCTAGCAAACTGAAGAATTTAAAGAAGCTCTATATAAGGGGTGGGAACCTTGTT
>augustus_masked-Fvb5-1-processed-gene-297.17:1320:1440:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-297.17:1320-1440||RAPiDGENOMICS_rs1205_02880
AGCTTGGATAATATGCTCGAGAATCATGTGGAGTGGAAAGTAGAAATCTTGCGTCTCAAGTACTTGAAGAAGTTAGAATCGGCAAACGTGGAGAAAGTTTTTCCTCAACGGAAGTACTGG
>augustus_masked-Fvb5-1-processed-gene-297.17:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-297.17:180-300|2x||RAPiDGENOMICS_rs1205_02881
ATTAGAAAGAGGCCTCTAATTTACTGGTGGATTGGCGAGGGCTTCATCACGGCTACCGAAGAGAAGACAGCAGAGGAGATAGGAGAAGACATCTATGCAAAGCTCTTGAGAAAGGACTTG
>augustus_masked-Fvb5-1-processed-gene-297.17:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-297.17:240-360||RAPiDGENOMICS_rs1205_02882
GAGAAGACAGCAGAGGAGATAGGAGAAGACATCTATGCAAAGCTCTTGAGAAAGGACTTGATTCAACCAGCACCAGGTGAGACCAACTGTTTATCACTTGTGAAGAATTGTGTAGTTCAC
>augustus_masked-Fvb5-1-processed-gene-297.17:360:480:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-297.17:360-480||RAPiDGENOMICS_rs1205_02883
CCTTGGATTCGTCTTATGTTGATCTCCTTGGCCAGAGCGGCTAAGCTGTTCGACTTCGACCCCGAATGGCCTATGATGCCATCTGATTCTAAATTAACTTGTAGGCGTTCAAGTTTAGTT
>augustus_masked-Fvb5-1-processed-gene-297.17:480:600:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-297.17:480-600||RAPiDGENOMICS_rs1205_02884
TATAATAAGCCAATAACTTCTCAGGGTGATGATCAATTTAATCCGATAAAGATGGATGATGATCAATTGAAAAAGCTATTGACTGTATTCAATGTAAATGTTCAATATCTTAATCTCAAA
>augustus_masked-Fvb5-1-processed-gene-297.17:60:180:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-297.17:60-180|2x||RAPiDGENOMICS_rs1205_02885
GAGGAAATGTTCGATAAAAGTGAGGCCATGGCCAGCATAAGGAGGAGTTATGAAGATCTTCAGGGGACGGATTTGAAGGTCTGCCTTCTTTCTTTCTCAATCTTCCCTGAGAATTCTGTG
>augustus_masked-Fvb5-1-processed-gene-297.17:600:720:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-297.17:600-720||RAPiDGENOMICS_rs1205_02886
CAAGAATGGCTCGACAAGTTGAAGAGGGTTGAAGTTCTTCACCTTGGACGGTGGCAGGGCTCCCCCAAGTATCACATTGAAGTGGTTCAGAAAACATTTGATGGTTCACAAGCTGTAGGG
>augustus_masked-Fvb5-1-processed-gene-297.17:720:840:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-297.17:720-840||RAPiDGENOMICS_rs1205_02887
TTCCTTAATGGTTTGGGAGCTCAGAAGCACTTGAAGTATCTTAGCCTCAGAGGAATATCAAGAATTAGCCAACTCCCTGCTTCTATTCATAGTCTTATCAGCCTCGAAATTCTCGATCTG
>augustus_masked-Fvb5-1-processed-gene-297.17:840:960:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-297.17:840-960||RAPiDGENOMICS_rs1205_02888
AGAGCATGCCATGACTTGGAACGGTTGCCTTCTGACATCTCATCATTGAAGAAGCTCACGCATTTGGATGTAGCAGAGTGTTACTTACTAGAAGGCATGCCCAAAGGGCTTCACAAACTT
>augustus_masked-Fvb5-1-processed-gene-297.17:960:1080:Parent=augustus_masked-Fvb5-1-processed-gene-297.17-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-297.17:960-1080||RAPiDGENOMICS_rs1205_02889
CCTTCCCTGCAAGTACTGAAAGGTTTTCTGATAGGGTCAGAGGAAAAGACTCCCTCCAAATTCAGTGATCTTGCCAAGCTGAAGAACCTAAGGCGGCTCAGCATACATATAGGGAATGAG
>augustus_masked-Fvb5-1-processed-gene-39.1:1080:1200:Parent=augustus_masked-Fvb5-1-processed-gene-39.1-mRNA-1_10::augustus_masked-Fvb5-1-processed-gene-39.1:1080-1200||RAPiDGENOMICS_rs1205_02890
AGCTGTTCCTCGCTCCAACAGCTCGATCTTTCAGAAAACCATTTTGTAGGGGAACTACCTACTTCCCTGGACAAACTAGGGAATCTCACTGATCTTGTGCTGAACAATAACAACTTCACA
>augustus_masked-Fvb5-1-processed-gene-39.1:1920:2040:Parent=augustus_masked-Fvb5-1-processed-gene-39.1-mRNA-1_17::augustus_masked-Fvb5-1-processed-gene-39.1:1920-2040||RAPiDGENOMICS_rs1205_02891
GAAATCCCACCTCAATTGTCTTCTTGTAAGAAACTTGAGCATTTCTTGGTTAACAATAACCAATTCACAGGAGCAGTACCTCCATGGTTAGGTAGCCTACAGGAACTAGGAGAACTAGAC
>augustus_masked-Fvb5-1-processed-gene-39.1:2040:2160:Parent=augustus_masked-Fvb5-1-processed-gene-39.1-mRNA-1_18::augustus_masked-Fvb5-1-processed-gene-39.1:2040-2160||RAPiDGENOMICS_rs1205_02892
TTCTCATGCAACAACTTCCAGGGAACAGTTCCTGCAAATCTCGGAAACTGTTCAAAACTACTCAAGCTTTCTCTGCATGACAACAGTCTCTCAAGTACTATCCCGGAGGAAATAGGGAAT
>augustus_masked-Fvb5-1-processed-gene-39.1:2588:2708:Parent=augustus_masked-Fvb5-1-processed-gene-39.1-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-39.1:2588-2708||RAPiDGENOMICS_rs1205_02893
TACAGTGGCCATTGTGTTGACATCCTCAGCAATATGCTTGATAATCATTTACATCATGCTGAGAATATGGTGCAAGTGGAGAAAAGTTTCTATTTCAAACTCAGATGGCTCTGGAGGAAA
>augustus_masked-Fvb5-1-processed-gene-4.7:1291:1411:Parent=augustus_masked-Fvb5-1-processed-gene-4.7-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-4.7:1291-1411||RAPiDGENOMICS_rs1205_02894
AAGGAGTTCTGAGAGATGGTTCTCTTGTAGCTGTTAAGAGCATTAATGTGACCAGTTGCAAGTCTGAGGAAGCTGAATTTGTGAAGGGACTGCACTTATTATTTTCGCTAAGTCATGAAA
>augustus_masked-Fvb5-1-processed-gene-4.7:1582:1702:Parent=augustus_masked-Fvb5-1-processed-gene-4.7-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-4.7:1582-1702||RAPiDGENOMICS_rs1205_02895
TATCGTTCAGTGTGTTTATTGGGGTACTGGTTCTCTTGCAAACAGGTATTGGATACTTGCACAGCAGGGTAGAAAACAAACCTGCCATGATTCACCAAAACATCTCTGTTGAAAAGGTTC
>augustus_masked-Fvb5-1-processed-gene-4.7:1702:1822:Parent=augustus_masked-Fvb5-1-processed-gene-4.7-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-4.7:1702-1822||RAPiDGENOMICS_rs1205_02896
TCATCGATCAGCAATTTAGGCCATTGATTTCGGACTCTGGCCTTCCTAAGCTGCTTGCTGATGACATTGTCTTCTCCACTCTGAAGACAAGTGCTGCAATGGGATACCTAGCTCCTGAAT
>augustus_masked-Fvb5-1-processed-gene-4.7:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-4.7-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-4.7:180-300|2x||RAPiDGENOMICS_rs1205_02897
GGTGTGGCGTGTAATGAGCATAGCAAAGTGGCTAATGTTTCTTTGCAGGGGAAGGGTCTTTCCGGTCAGGTTTCGCCGGCGGTGGCAGAGCTCCGGTGCTTGTCGGGTCTGTACTTGCAC
>augustus_masked-Fvb5-1-processed-gene-4.7:1822:1942:Parent=augustus_masked-Fvb5-1-processed-gene-4.7-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-4.7:1822-1942||RAPiDGENOMICS_rs1205_02898
ATATCACCACTGGTCGTTTCACCGAGAAAAGTGATGTATATGCATTTGGAGTCATTGTCCTCCAAGTTATATCAGGAAACCTACAACTCAACACTTCAATGAAACTGGCCGCGGAATCAA
>augustus_masked-Fvb5-1-processed-gene-4.7:1942:2062:Parent=augustus_masked-Fvb5-1-processed-gene-4.7-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-4.7:1942-2062||RAPiDGENOMICS_rs1205_02899
GCAGATATGAAGAATTCGTCGACACCAATCTAAAAGGGCAATTCTCAGAACCTGAGGCAGCTGCACTGGGAAAACTTGGACTGATATCCACGCACGAGCTTCCCGACCAAAGACCAACAA
>augustus_masked-Fvb5-1-processed-gene-4.7:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-4.7-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-4.7:240-360||RAPiDGENOMICS_rs1205_02900
TCCGGTCAGGTTTCGCCGGCGGTGGCAGAGCTCCGGTGCTTGTCGGGTCTGTACTTGCACTATAATAACTTGTCAGGGGAGATTCCAAAAGAGATTGGAGCTCTGACTGAGCTTACTGAT
>augustus_masked-Fvb5-1-processed-gene-4.7:550:670:Parent=augustus_masked-Fvb5-1-processed-gene-4.7-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-4.7:550-670||RAPiDGENOMICS_rs1205_02901
TGGGGAACTTAGGGATGCTCAAAAGGCTTGATCTGGGCTTCAATAAGTTCTTTGGTACAATTCCTGCAAAGCTAGCTAGTATACCATCTTTGGAAGTCTTGGATGTCCGAAACAATTCTC
>augustus_masked-Fvb5-1-processed-gene-40.8:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-40.8-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-40.8:0-120||RAPiDGENOMICS_rs1205_02902
ATGGAAGAAAGCAAGGACAGCCATGAAGATGAAAAAGGTGATACATCAACTTCTTCTTCACCTTGTCCATTACAGTTACGTTACATAGAGTTACCTTATCACCTTCAAAGTTGTGTAGTG
>augustus_masked-Fvb5-1-processed-gene-40.8:1080:1200:Parent=augustus_masked-Fvb5-1-processed-gene-40.8-mRNA-1_10::augustus_masked-Fvb5-1-processed-gene-40.8:1080-1200||RAPiDGENOMICS_rs1205_02903
TGGGTTGGTTGCTTGGAAAGGCTCACGAACTTAAGATTAGGTTTCTCCAATCTGTCTGAGAACCCATCATTGGTACTTCAAGTCCTGCCCAACTTGAAAAAGTTAACCCTTTGGCAGGCT
>augustus_masked-Fvb5-1-processed-gene-40.8:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-40.8-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-40.8:120-240||RAPiDGENOMICS_rs1205_02904
TACTGTTCCATCTTCCCTGAGAGCTACCGGCTTTCAAAAGGGAAACTTATCCGGTTACTAGTAGCTCAAGGACTGATACAAGAAAAAGCAGGGAAGATTATGGAGGATGTAGCAGAAGAA
>augustus_masked-Fvb5-1-processed-gene-40.8:1200:1320:Parent=augustus_masked-Fvb5-1-processed-gene-40.8-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-40.8:1200-1320||RAPiDGENOMICS_rs1205_02905
TACGATGCGAAGCAAATAGGGAAAGAGTTCTGTACTGCTGGTGGGTTTCCAAAGCTCGAGGTTCTCATCATTGCTTCTCGTGTTCTTGAGGAGTGGACAGAACTTGAAGAGGGAGCACTA
>augustus_masked-Fvb5-1-processed-gene-40.8:1440:1560:Parent=augustus_masked-Fvb5-1-processed-gene-40.8-mRNA-1_13::augustus_masked-Fvb5-1-processed-gene-40.8:1440-1560||RAPiDGENOMICS_rs1205_02906
GAACGGTTGAAACCTGATGGTGGAGAGGAGTATTACAAAATTAGGCACATTCCAGAGACATCATACACTACCAACTCTATGATACAAAGATATGTGCAAGCTGCGCAAAGAGGAACAACA
>augustus_masked-Fvb5-1-processed-gene-40.8:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-40.8-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-40.8:240-360||RAPiDGENOMICS_rs1205_02907
TATATATGTGAACTGATCAACCAGCAACTGCTTCAAGTACTGGAGGAACACCCTCGGAGAGATGGGACTCAATTGAGGGTCCCCTGTGGTCTTCAAAAGTTCTGTCTTGATCAACTGAAG
>augustus_masked-Fvb5-1-processed-gene-40.8:360:480:Parent=augustus_masked-Fvb5-1-processed-gene-40.8-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-40.8:360-480||RAPiDGENOMICS_rs1205_02908
GAAGGAAAATTTGCAACCTTTGGAGTTTTCATTTGTTCAGATATCACACAGCTGATATCCCAAATGAACAATCTTCAACTAACTGCTTTGTTCCTGCTAGCAAATCAGAATCTATCTCAA
>augustus_masked-Fvb5-1-processed-gene-40.8:480:600:Parent=augustus_masked-Fvb5-1-processed-gene-40.8-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-40.8:480-600||RAPiDGENOMICS_rs1205_02909
CATGATGGTAGTTGGCTAAAATTTAATGGTGTGAACACTTTAAAAGTGCTTGAGCTAAAAGATACCAAAATCAAGAAGTTACCAGATGAAGTGGGAGATCTAATACACCTCTCGTATCTT
>augustus_masked-Fvb5-1-processed-gene-40.8:60:180:Parent=augustus_masked-Fvb5-1-processed-gene-40.8-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-40.8:60-180|2x||RAPiDGENOMICS_rs1205_02910
CCTTGTCCATTACAGTTACGTTACATAGAGTTACCTTATCACCTTCAAAGTTGTGTAGTGTACTGTTCCATCTTCCCTGAGAGCTACCGGCTTTCAAAAGGGAAACTTATCCGGTTACTA
>augustus_masked-Fvb5-1-processed-gene-40.8:600:720:Parent=augustus_masked-Fvb5-1-processed-gene-40.8-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-40.8:600-720||RAPiDGENOMICS_rs1205_02911
GGCTTGAAAAGCACGGATATAAATGAGCTTCCGGAGGGGATAGGCAGATTAGAAGCCCTGCAATCTTTGGATATTAGATGGTGTGGGAATTTAACAGCATTGCCAGCTGAGATACTCAAC
>augustus_masked-Fvb5-1-processed-gene-40.8:840:960:Parent=augustus_masked-Fvb5-1-processed-gene-40.8-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-40.8:840-960||RAPiDGENOMICS_rs1205_02912
GGCACTGCAGCTGAAGTAGGTGACCTGATAGGGCTCAGAAGATTAGGAGTGATGGACGTGGACGAGGAGAATTTCACTGAGCTGTTTGCCTCTATTATGAAGATGCAGGGCCTTCTTTCC
>augustus_masked-Fvb5-1-processed-gene-40.8:960:1080:Parent=augustus_masked-Fvb5-1-processed-gene-40.8-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-40.8:960-1080||RAPiDGENOMICS_rs1205_02913
TTGTCTTTAGAAGCAAAATGCGCATTCCCTCAGGGAGAGCTTTTCCTCCTGGAGTCATTCTCACCTCCACCATTTCTTCAAAAGCTTCGCCTTGAGGGCATCCTAGGAAAGCTACCTGCT
>augustus_masked-Fvb5-1-processed-gene-43.15:1080:1200:Parent=augustus_masked-Fvb5-1-processed-gene-43.15-mRNA-1_10::augustus_masked-Fvb5-1-processed-gene-43.15:1080-1200||RAPiDGENOMICS_rs1205_02914
AGCAACGGGAAGATAATAGCTATTAAGAAGATCATTCAGCCTCCTAAGGACGCCAATGAGATGGCCGAAGAAGAGAGCAAGCAGATGCACAAGAAGATGCGTCAAATTCGGTCGGAGATC
>augustus_masked-Fvb5-1-processed-gene-43.15:1560:1680:Parent=augustus_masked-Fvb5-1-processed-gene-43.15-mRNA-1_14::augustus_masked-Fvb5-1-processed-gene-43.15:1560-1680||RAPiDGENOMICS_rs1205_02915
ACAGTGGGTTATATTGCACCGGAGTATCATCAGACAATCAAGTTCACAGAAAAGTGTGATATATACAGCTTTGGGGTGTTGCTTGGGGTATTGATTATAGGAAAGCTTCCCTCTGATGAT
>augustus_masked-Fvb5-1-processed-gene-43.15:600:720:Parent=augustus_masked-Fvb5-1-processed-gene-43.15-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-43.15:600-720||RAPiDGENOMICS_rs1205_02916
TACTTCAACTTCGCCGGAAATGAGTTCCTTGAAGGCTCGGCGCCTAAGTTGAAACGTGTGGAGGTTGAGGTTCCGAGACGTTTCATATTTGCTGAAACTTCAAACTCCACCACGGCAGCG
>augustus_masked-Fvb5-1-processed-gene-43.15:840:960:Parent=augustus_masked-Fvb5-1-processed-gene-43.15-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-43.15:840-960||RAPiDGENOMICS_rs1205_02917
CTGGGGTTCTTTGCAGGAGCGCTGGCTGGGAGTATATCCGGGTTCATCTTCTCTCTGCTGTTCAAGCTGCTCTTGGCTGTGGTGAGAGGTGGAGGCAGGGAATCTGGTCCATCCATTTTC
>augustus_masked-Fvb5-1-processed-gene-43.15:960:1080:Parent=augustus_masked-Fvb5-1-processed-gene-43.15-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-43.15:960-1080||RAPiDGENOMICS_rs1205_02918
AGTTCTCTGATCAAAAGGAAAGAGGACTTGGCTTTTCTGGAGAAAGAAGACGGGCTTGATTCGTTGGAGCTCATTGGAAGAGGAGGATGTGGAGAAGTTTACAGAGCTGAGATGCCAGGA
>augustus_masked-Fvb5-1-processed-gene-48.4:1168:1288:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-48.4:1168-1288||RAPiDGENOMICS_rs1205_02919
AGGAATGGTTGTTGAAGATATCATCCCAAGTCGAGTATTTACATTTCACCGACAATCAAATCCAAGGACCGCTTCCATTCCATTCCAAGTTTCCAAAATTGTACAGATTAGATTTGAGTC
>augustus_masked-Fvb5-1-processed-gene-48.4:1288:1408:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-48.4:1288-1408||RAPiDGENOMICS_rs1205_02920
GCAATCGATTTTCCAAGTCTATTCCCTTAAATTTTGGACAACTAATGCCAAATCTAAGACTGTTGTACTTGTCTGATAATTATTTAGTTGGTACCATTCCATCCTCAATTTGTGAAATTC
>augustus_masked-Fvb5-1-processed-gene-48.4:1408:1528:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-48.4:1408-1528||RAPiDGENOMICS_rs1205_02921
CGTTGTGGAGCATTTATCTAAGGAACAATCAGCTATCTGGAGAGTTCCCTCAAGCATGGAGTTTGTGGAGCGAAATCGATGTTGTGGATGTCTCAAGAAACAATCTCTCTGGTAATATTC
>augustus_masked-Fvb5-1-processed-gene-48.4:1528:1648:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-48.4:1528-1648||RAPiDGENOMICS_rs1205_02922
CGAGTTCCATGGGTATCCCAAGTAGTCTTGCTATATTGAAGATGAACAACATTAACTTTGGTGGCAAAATTCCTTCCTTCAGAAATTGCTCTGAGTTGAGTAGACTTGCACTCGGAGGCA
>augustus_masked-Fvb5-1-processed-gene-48.4:1648:1768:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-48.4:1648-1768||RAPiDGENOMICS_rs1205_02923
ACAAGTTTTCTGGTAATCTACCTTCATGGATAGGATCAATGGTGACACTGCGTATGCTACAATTGCGAACTAACTCTTTCAGTGGTCACATTCCCCATCACCTGTGCAATCTTATTGGTC
>augustus_masked-Fvb5-1-processed-gene-48.4:1768:1888:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-48.4:1768-1888||RAPiDGENOMICS_rs1205_02924
TCCATGTCCTGGACCTTGCTCAGAACAACTTTTCAGGTACCATTCCAAAGTGTTTGGATAATATCACTTCCATGGGTAGCGAGCCCGGTGGTTGGCCTGTGTACGATTATGCTGAGCAAA
>augustus_masked-Fvb5-1-processed-gene-48.4:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-48.4:180-300|2x||RAPiDGENOMICS_rs1205_02925
GACGATTGCTGTCAATGGAATGGTCTTTCCTGCGACAACCAGACTGGCCACATAGTAAAGATGGATCTCCGGAATCCATATCCATACAGAGTTTATAATGACGAGTGGGATTTCAAGGAC
>augustus_masked-Fvb5-1-processed-gene-48.4:1888:2008:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-48.4:1888-2008||RAPiDGENOMICS_rs1205_02926
CAACAATAATATCAAAAGGAAGAGAACTAGAATACGGTGTTTACAATGCAGGTTTGGTGAAAAGTATTGATCTTTCCTCAAATAACTTGGAAGGTGAAATTCCTGATGAAATAACCAGTC
>augustus_masked-Fvb5-1-processed-gene-48.4:2008:2128:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-48.4:2008-2128||RAPiDGENOMICS_rs1205_02927
TCATTGCACTGGGTACCTTGAACTTGTCGAGGAATCATTTACATGGAAATATTCCGTCAAACATTGGAAACTTGAGTTCGCTGGAAACACTTGACCTCTCACACAATCACCTTTTTGGAG
>augustus_masked-Fvb5-1-processed-gene-48.4:2128:2248:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-48.4:2128-2248||RAPiDGENOMICS_rs1205_02928
AAATTCCTCAAAGCTTGTCTTCTTTGAACTACTTGTCTCATTTGAACTTGTCTTATAACAACTTTTCTGGAAGAATTCCTTCGGGCAATCAGCTCCGAACACTGGTCGATCCATCCATTT
>augustus_masked-Fvb5-1-processed-gene-48.4:2188:2308:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-48.4:2188-2308|2x||RAPiDGENOMICS_rs1205_02929
ACTTTTCTGGAAGAATTCCTTCGGGCAATCAGCTCCGAACACTGGTCGATCCATCCATTTATGAGGGCAACCCATCATTGTGCGGCTTTCCTCTTTCAACCAAGTGCCCTGGAGATGACG
>augustus_masked-Fvb5-1-processed-gene-48.4:2248:2368:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_10::augustus_masked-Fvb5-1-processed-gene-48.4:2248-2368||RAPiDGENOMICS_rs1205_02930
ATGAGGGCAACCCATCATTGTGCGGCTTTCCTCTTTCAACCAAGTGCCCTGGAGATGACGAACCTACTAGCACTGGAAATCTTCCTGTCCAAAACAATGATGATGAAGATGGCAATGAAA
>augustus_masked-Fvb5-1-processed-gene-48.4:2368:2488:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-48.4:2368-2488||RAPiDGENOMICS_rs1205_02931
AGCTCGGTCTCTACATTAGCGTCGCGCTTGGCTTTATCATAGGCTTCTGGGGTGTTTGTGGCACATTAGTTGTGAAGAAATCGTTGAGGCATGCCTATTTTCAGTTCTTCGACAACATCA
>augustus_masked-Fvb5-1-processed-gene-48.4:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-48.4:240-360||RAPiDGENOMICS_rs1205_02932
ATGGATCTCCGGAATCCATATCCATACAGAGTTTATAATGACGAGTGGGATTTCAAGGACTACCAACAGTCTTGCTTGAGTGGTAAGATAAACCCTTCTTTGCTTAGCTTGAAGCATATA
>augustus_masked-Fvb5-1-processed-gene-48.4:360:480:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-48.4:360-480||RAPiDGENOMICS_rs1205_02933
TATTACTTAGACCTAAGCTGGAATGATTTTCATGGGATTCACATTCCCAACTTCTTGGGGAAGCTTACAAGCTTGAGGTATCTCAATCTCTCTTATGCTTCATTTCGAGGAGAGATTCCC
>augustus_masked-Fvb5-1-processed-gene-48.4:420:540:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-48.4:420-540|2x||RAPiDGENOMICS_rs1205_02934
AAGCTTACAAGCTTGAGGTATCTCAATCTCTCTTATGCTTCATTTCGAGGAGAGATTCCCCATTTTCTTGGTAACCTCTCAAACTTGAACTATCTTGACCTTGACAATAGCCGTCCCAGC
>augustus_masked-Fvb5-1-processed-gene-48.4:480:600:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-48.4:480-600||RAPiDGENOMICS_rs1205_02935
CATTTTCTTGGTAACCTCTCAAACTTGAACTATCTTGACCTTGACAATAGCCGTCCCAGCAACAGCCTTGACGAAAACCTTTCTTCCAAAAATTTGAATTGGCTTTCTCGTCTCTCTTCC
>augustus_masked-Fvb5-1-processed-gene-48.4:600:720:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-48.4:600-720||RAPiDGENOMICS_rs1205_02936
CTGAAGTACCTCAATCTCGGACGAGCTAACCTTGGTGGTGCAGGAGTGAGTTGGTTACATTATATCAACATGCTTCCCTCACTGTTGGAGTTGCATTTATCTGCATGCGGCATTGATTCA
>augustus_masked-Fvb5-1-processed-gene-48.4:720:840:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-48.4:720-840||RAPiDGENOMICS_rs1205_02937
AACCAGCTTCCACTCCTATTACCGACCGTTAACTTTACATCCCTTTCAGTCCTTGATATGTCTGATAACTCTTTCAATTCTTCGATTCCAAGCTGGATTTCTAATCTGACAAGTCTAAGC
>augustus_masked-Fvb5-1-processed-gene-48.4:840:960:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-48.4:840-960||RAPiDGENOMICS_rs1205_02938
ACACTTGATCTACACGGCAATTATTTTGCTAGTCCCATTCCAAATGAATTTGCAAACTTAAAAAATCTTGAGCACCTTGATTTATCATTCAATTACCTTGATGGTCAAATTCCTGAAGTT
>augustus_masked-Fvb5-1-processed-gene-48.4:900:1020:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-48.4:900-1020|2x||RAPiDGENOMICS_rs1205_02939
AAAAATCTTGAGCACCTTGATTTATCATTCAATTACCTTGATGGTCAAATTCCTGAAGTTTTGGGACAGCTTTCCCAGCTAGTTGTCTTAGACCTGTCTCAAAATTTTTGGGAAGGCACC
>augustus_masked-Fvb5-1-processed-gene-48.4:960:1080:Parent=augustus_masked-Fvb5-1-processed-gene-48.4-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-48.4:960-1080||RAPiDGENOMICS_rs1205_02940
TTGGGACAGCTTTCCCAGCTAGTTGTCTTAGACCTGTCTCAAAATTTTTGGGAAGGCACCTTAACAGAATCCCATTTCAAAAGTCTCACAAAATTAGACTCTTTTGCCGTTAGCACAGAC
>augustus_masked-Fvb5-1-processed-gene-5.2:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-5.2:0-120||RAPiDGENOMICS_rs1205_02941
ATGGCCGCAAACACAGCCTCCGTTCAACCGGGTCGGTTTCGGGTCCTGAAGCAAGGAACCAAACCCGTTGAACCGAACCTGGGTCCCGTGGTTTATTGGATGTTCAGAGACCAGAGGGTC
>augustus_masked-Fvb5-1-processed-gene-5.2:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-5.2:120-240||RAPiDGENOMICS_rs1205_02942
AAATACAACTGGGCTTTGATCCACGCCGTCGAAGAGGCCAACAAGGCCCATGTCCCCGTCGCCGTCGCCTTCAATTTGTTCGATCAATTTCTTGGCGCCAAAGCGCGCCATTTAGGGTTT
>augustus_masked-Fvb5-1-processed-gene-5.2:1224:1344:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-5.2:1224-1344||RAPiDGENOMICS_rs1205_02943
GGTTGGAAGGAACGACCAATTTTTGGGAAAATACGTTACATGAACTATGCAGGCTGCAAAAGGAAATTTGACGTGGATGGATACATTTCCTATGTGAAGAGGCTTGATGCAACAAAGAAG
>augustus_masked-Fvb5-1-processed-gene-5.2:1393:1513:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-5.2:1393-1513||RAPiDGENOMICS_rs1205_02944
ATATGGAGATTGCTACTGGAACTGCTACAGATCTTGTTGGAAAGATTTTGGGGTTTGCGGGTTCAACAGTTGGACGGCAAGTGGGTTATTTGATCCACTACAAACGTAACCTTGAAAATC
>augustus_masked-Fvb5-1-processed-gene-5.2:1633:1753:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-5.2:1633-1753||RAPiDGENOMICS_rs1205_02945
CTAGGATCACTAAGGAGGCAGAACAACTGTTGAAAGATGATGGCCAACCAAAGACGAAATGTGTCCATGGGTTTTGTCCAAATCCGGTGCTCCGTCGTCGTCGAAGCAAGAACTCGTTGG
>augustus_masked-Fvb5-1-processed-gene-5.2:1753:1873:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-5.2:1753-1873||RAPiDGENOMICS_rs1205_02946
CATTGGTTGTAGCTGTTACCGAGCTGATCAACGAAGCAAAAGAACTTTCTGACATTGCGTACGTCCCCCCTAAAGGCCCTAAAGATCTAGAGACTGAAGTGGACAAATTAAGAGTTGCTA
>augustus_masked-Fvb5-1-processed-gene-5.2:1873:1993:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-5.2:1873-1993||RAPiDGENOMICS_rs1205_02947
AAGATACGTTAGCTGAGAAGGTTGCTGCAGCTAAAGTGAAGGGTGAAACGATCCATGCAAATGTCCAAGACTGGCTGAAAAAAGTGGCTGAGATTACTGAAGTGGCAGAAGAATTGTTGA
>augustus_masked-Fvb5-1-processed-gene-5.2:1993:2113:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_6::augustus_masked-Fvb5-1-processed-gene-5.2:1993-2113||RAPiDGENOMICS_rs1205_02948
AAGACAAGCACCAATCAGTTGAGGAGGCAACCGAATTCTCAAAAGATGAAATCCAAGCAATTGAAAAGCCAAACGCCTCCTTAAGTCATGGAAGCAAGGAATTATTGGAGTTGCTGCAGG
>augustus_masked-Fvb5-1-processed-gene-5.2:2113:2233:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-5.2:2113-2233||RAPiDGENOMICS_rs1205_02949
GGGTTACTGAACTATATGAGAAAAGAGATTTTCCTGACATTTCATTCGAACCCCCTAAAGATCTACAGACTGAAGTGGATAAATTAAGTGTTGCTAAAGAGACGTTAGCTGAGGAGGTCG
>augustus_masked-Fvb5-1-processed-gene-5.2:2233:2353:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_8::augustus_masked-Fvb5-1-processed-gene-5.2:2233-2353||RAPiDGENOMICS_rs1205_02950
CTGCAGCTGAAGTGAAGGGTGAAAAAATCCATAAGAATGTCCTAGACTGGCTAAAAAGAGTGACTGAGATTGTTAAAAAAGCAGAACAATATTTGAAAGACAAGCACCGATCAACTGAAG
>augustus_masked-Fvb5-1-processed-gene-5.2:2353:2473:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_9::augustus_masked-Fvb5-1-processed-gene-5.2:2353-2473||RAPiDGENOMICS_rs1205_02951
ATGCAAGCGAATTTATGAAAGATGGCATCCAAGCAATTGAAAAGCCAAACGCCTCTTTAAGTCATGGAAGCAAGGAATTATTGGAGTTGCTGCAGGGGGTTACTGAATTATATGAGAAAA
>augustus_masked-Fvb5-1-processed-gene-5.2:2533:2653:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_10::augustus_masked-Fvb5-1-processed-gene-5.2:2533-2653|2x||RAPiDGENOMICS_rs1205_02952
AAGACTATGAGGAATTTGATTCAAGAAGTTCAGTAGTGGAGAAAATCTTGAAGGAATTGAGAAGTACCTCTAGTTCTGATATGATATTGGTGTATGGTGTTGGGGGTGTGGGAAAGACCA
>augustus_masked-Fvb5-1-processed-gene-5.2:2593:2713:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_11::augustus_masked-Fvb5-1-processed-gene-5.2:2593-2713||RAPiDGENOMICS_rs1205_02953
GAAGTACCTCTAGTTCTGATATGATATTGGTGTATGGTGTTGGGGGTGTGGGAAAGACCACGCTCGTTGAAGAAGTTCTAAGGAAAGCTCAAAAAGAGAAGCTCTTTCAGGATGCAGTAA
>augustus_masked-Fvb5-1-processed-gene-5.2:2713:2833:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-5.2:2713-2833||RAPiDGENOMICS_rs1205_02954
TGGTAAGGGATGTGAAAGTTCCAAACTTGGAAGCAATTCAAAAGCAAATTGCTGACAAGTTAGGTCTGAAGAATATTTTGGAAGCGCATACTCTACCTGGAAGGGCCGATAAAATAAATG
>augustus_masked-Fvb5-1-processed-gene-5.2:2773:2893:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_12::augustus_masked-Fvb5-1-processed-gene-5.2:2773-2893|2x||RAPiDGENOMICS_rs1205_02955
TAGGTCTGAAGAATATTTTGGAAGCGCATACTCTACCTGGAAGGGCCGATAAAATAAATGAAAGAATCAAGAACAACAACACTCTCGTCATTTTTGATGATGTTTGGGAAGAAGTTGATT
>augustus_masked-Fvb5-1-processed-gene-5.2:2833:2953:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_13::augustus_masked-Fvb5-1-processed-gene-5.2:2833-2953||RAPiDGENOMICS_rs1205_02956
AAAGAATCAAGAACAACAACACTCTCGTCATTTTTGATGATGTTTGGGAAGAAGTTGATTTGAAGGCTGTGGGACTTCCCCACAAATCCACTTGTAGAATATTGTTGACATCCAGGAGTC
>augustus_masked-Fvb5-1-processed-gene-5.2:2893:3013:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_13::augustus_masked-Fvb5-1-processed-gene-5.2:2893-3013|2x||RAPiDGENOMICS_rs1205_02957
TGAAGGCTGTGGGACTTCCCCACAAATCCACTTGTAGAATATTGTTGACATCCAGGAGTCAACAAGTATTTTCTCATAAGATTAAGCAAAAGGAGTTTCCGCTTGGGGTATTGGATGACA
>augustus_masked-Fvb5-1-processed-gene-5.2:2953:3073:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_14::augustus_masked-Fvb5-1-processed-gene-5.2:2953-3073||RAPiDGENOMICS_rs1205_02958
AACAAGTATTTTCTCATAAGATTAAGCAAAAGGAGTTTCCGCTTGGGGTATTGGATGACAAAGAAGCATGGGCTTTATTTGAAAAGAAAGCAGGTGATGTTGTTGCGGATCCTACTATTC
>augustus_masked-Fvb5-1-processed-gene-5.2:3013:3133:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_14::augustus_masked-Fvb5-1-processed-gene-5.2:3013-3133|2x||RAPiDGENOMICS_rs1205_02959
AAGAAGCATGGGCTTTATTTGAAAAGAAAGCAGGTGATGTTGTTGCGGATCCTACTATTCGACCTGTAGCAGCTCAAGTAGCCGAGAAATGTGGGGGGTTGCCTGTTTTGGTTATCACAG
>augustus_masked-Fvb5-1-processed-gene-5.2:3073:3193:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_15::augustus_masked-Fvb5-1-processed-gene-5.2:3073-3193||RAPiDGENOMICS_rs1205_02960
GACCTGTAGCAGCTCAAGTAGCCGAGAAATGTGGGGGGTTGCCTGTTTTGGTTATCACAGTTGCAAGAGCATTAGAAAACAAGAATCTACCCATCTGGAAAAATGCCTTGAAAAAGCTCG
>augustus_masked-Fvb5-1-processed-gene-5.2:312:432:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-5.2:312-432||RAPiDGENOMICS_rs1205_02961
GGAGAAGCGGAGGAGACGATACCGGATTTTGTGAGGGAATGCGGGGCTTCACTTTTGGTGACAGATTTTTCACCTCTAAGGGAGGTTCGGAAATGTAAGGAGGAGATATGCAAGAGGGTC
>augustus_masked-Fvb5-1-processed-gene-5.2:3193:3313:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_16::augustus_masked-Fvb5-1-processed-gene-5.2:3193-3313||RAPiDGENOMICS_rs1205_02962
AAAGGTTTGATGAGAAAGGAGACTTGACTCACAAGGCATACTCGGGTATCGAGTGGAGTTACACTCAATTGAGTGACGAGGAGCAACTTCAATCACTGTTCTTGTTGTGTGGTTCTGTCG
>augustus_masked-Fvb5-1-processed-gene-5.2:3253:3373:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_16::augustus_masked-Fvb5-1-processed-gene-5.2:3253-3373|2x||RAPiDGENOMICS_rs1205_02963
ACACTCAATTGAGTGACGAGGAGCAACTTCAATCACTGTTCTTGTTGTGTGGTTCTGTCGCTATGGGCAACAATATTTCATTGACAACCTTGTTGAAATATAGCATAGGTTTGGGTTTCT
>augustus_masked-Fvb5-1-processed-gene-5.2:3313:3433:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_17::augustus_masked-Fvb5-1-processed-gene-5.2:3313-3433||RAPiDGENOMICS_rs1205_02964
CTATGGGCAACAATATTTCATTGACAACCTTGTTGAAATATAGCATAGGTTTGGGTTTCTTTCAAGACTGTACCGTGGAAGAAGCACGAAATGCCTTGTATGAACAGGTTGACAAGCTCA
>augustus_masked-Fvb5-1-processed-gene-5.2:3373:3493:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_17::augustus_masked-Fvb5-1-processed-gene-5.2:3373-3493|2x||RAPiDGENOMICS_rs1205_02965
TTCAAGACTGTACCGTGGAAGAAGCACGAAATGCCTTGTATGAACAGGTTGACAAGCTCAAAAGTTGTTGTCTATTGTTAGACGGTGATGATGGTACATGTGTCAGAATGCATGATCTTG
>augustus_masked-Fvb5-1-processed-gene-5.2:3433:3553:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_18::augustus_masked-Fvb5-1-processed-gene-5.2:3433-3553||RAPiDGENOMICS_rs1205_02966
AAAGTTGTTGTCTATTGTTAGACGGTGATGATGGTACATGTGTCAGAATGCATGATCTTGTACGTGATGTTGCTAACAGGATTGCACGGAGAGTTCAACATGCCTTGGTTGAAGATGGAG
>augustus_masked-Fvb5-1-processed-gene-5.2:3553:3673:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_19::augustus_masked-Fvb5-1-processed-gene-5.2:3553-3673||RAPiDGENOMICS_rs1205_02967
GTCATAATAAGTTGGAAAAATGGCCAGATGAAGAGTTCTTTATTGAGTGTAGTAAGATTTGTTTGCCTTGTTGCAAGATCGCCACTCTTCCGCAAGTACCTTGGAAATGTCCACAACTGG
>augustus_masked-Fvb5-1-processed-gene-5.2:3793:3913:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_21::augustus_masked-Fvb5-1-processed-gene-5.2:3793-3913||RAPiDGENOMICS_rs1205_02968
CATCTTTTTCATCTTTAAAGAATCTCCAGACATTGTGTTTAGACGGATATTATTTCGAAGACACGAACCTAGCCCTAGTTGGAGAACTAAGAAACTTGGAAGTTCTTAGCATGGTACAGT
>augustus_masked-Fvb5-1-processed-gene-5.2:3913:4033:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_22::augustus_masked-Fvb5-1-processed-gene-5.2:3913-4033||RAPiDGENOMICS_rs1205_02969
CCAATGTTAGACAGTTACCCCAAGAATTTGGGCAGTTAACCCGTCTACGGTTGGTGGATTTGTCTGATTGCCTTTTTCTTAGTGTGATTCCATCTGGTGTCATTTCCAATTGGACAAAAC
>augustus_masked-Fvb5-1-processed-gene-5.2:4033:4153:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_23::augustus_masked-Fvb5-1-processed-gene-5.2:4033-4153||RAPiDGENOMICS_rs1205_02970
TCGAAGACTTGAGATTGAGAAACAGCTTTGACAAATGGGAGGGTACCGCCAAACAATATGAATCCGAAGAATTAGACAGTGAAACAAGTATTGCGAGCCTTTTGGAGCTGATGAACTTGC
>augustus_masked-Fvb5-1-processed-gene-5.2:4153:4273:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_24::augustus_masked-Fvb5-1-processed-gene-5.2:4153-4273||RAPiDGENOMICS_rs1205_02971
CCAACGTAACCACATTAGAAGTACACATTCCAGATATTGACATTCTTCCACCAAAGTTTTTCTCGGACAGGTTGGAAAAATACCAAATATTTCTTGGCGACGGGGACTTCGGTTCTATGG
>augustus_masked-Fvb5-1-processed-gene-5.2:4273:4393:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_25::augustus_masked-Fvb5-1-processed-gene-5.2:4273-4393||RAPiDGENOMICS_rs1205_02972
AAGAAACAACTCTCAATACCCTTAAACTACAGCCCCATCCCAGATTTGAATTGAACGAGAATGTAAAAATATTGCTCAAGAAGTGTGATATTTTTACCGTGAATGGAGGTGATTTTTCAT
>augustus_masked-Fvb5-1-processed-gene-5.2:4410:4530:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-5.2:4410-4530||RAPiDGENOMICS_rs1205_02973
ATTGTGATGTCCAACTTAACAACATTGGACGTGTCTTCCTGTGATGGCTTCAAATACTTGTTTACATCTTCTATGGTCAGAAGTCTTGTAAAACTCAAATATCTCGAGGTATGTAGCTGC
>augustus_masked-Fvb5-1-processed-gene-5.2:4530:4650:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-5.2:4530-4650||RAPiDGENOMICS_rs1205_02974
CGAGACATGGAAGAGATAGTTTCTACAATAGAGTCCCATGAAGAAGATGTGGATAACATATTTGCTAAGCTAGAAAGACTCACGTTGAATGAACTTCCAAACTTTGCTAGATTCTGTACA
>augustus_masked-Fvb5-1-processed-gene-5.2:4758:4878:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-5.2:4758-4878||RAPiDGENOMICS_rs1205_02975
GTAAGATTTCCAAGATTGGAGATATTGAAAATCATCAAATACGGAGAAGACACAGCCTTGAAGAAAATATGGCACAACCAACTAGCACCAGGCTCATTTTGCAGACTCAGAGAATTTCAC
>augustus_masked-Fvb5-1-processed-gene-5.2:4878:4998:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-5.2:4878-4998||RAPiDGENOMICS_rs1205_02976
CTGGAGAATTGCAGTGGTGTAAGTAGTATTTTTCCACCAAGTATGACAGGAAGATTGAGTGGTCTGGAAACCTTGGTTATATTTGGTTGCGCGTCAGCGAGAGTAGTATTTGATGAAAGC
>augustus_masked-Fvb5-1-processed-gene-5.2:4998:5118:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-5.2:4998-5118||RAPiDGENOMICS_rs1205_02977
GGAGAAAGTACTGGCACAACAACCACTCATTTGAAAGACGGTCAAAATCTGAAGTCGGTTACGATATACTTCTGTCACAATTTGAGATATGTTTTCCCCGCATCTATGGTAACCAAAGGA
>augustus_masked-Fvb5-1-processed-gene-5.2:5118:5238:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-5.2:5118-5238||RAPiDGENOMICS_rs1205_02978
CTTCAGCAGTTGCAGGAGCTGGAGTTGCGTTATTGTTTTGAAATGAGGAATGTTGTTGGCAAGGAAGAAGGTGCAGTAGAATCAACAACACATCCTAGGTTTATATTCCCAAAAGTCAAA
>augustus_masked-Fvb5-1-processed-gene-5.2:5238:5358:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-5.2:5238-5358||RAPiDGENOMICS_rs1205_02979
GCTATGATGTTTGACTCTATGGACACATTTACGAGCTTCTATCCCGCGACGCATACTTCTGAGTGGCCATCACTCCAACATTTCGTGTTTTCTCGTTGTTCTCTGGAGACTTTTGCTGCA
>augustus_masked-Fvb5-1-processed-gene-5.2:5427:5547:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-5.2:5427-5547||RAPiDGENOMICS_rs1205_02980
CCAACTCCTTGCCTGGCCCACATCCTCCGTACGCCGCCAACGCGAATCACCAACCGCATTCCTCTCCTCTTCTACTCCTCCATGGCCGCAAATACCGCCTCCGTCCAACCGGGTTGGTTT
>augustus_masked-Fvb5-1-processed-gene-5.2:5547:5667:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-5.2:5547-5667||RAPiDGENOMICS_rs1205_02981
CGGGTCCTGAAGCAAGGAGTCAAACCGGTCGACCCGAACCCGGGTCCCGTGATTTATTGGATGTTCAGAGACCAGAGGGCCAAAGACAACTGGGCTTCGATCCACGCCGTCGAAGAGGCC
>augustus_masked-Fvb5-1-processed-gene-5.2:5667:5787:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-5.2:5667-5787||RAPiDGENOMICS_rs1205_02982
AACAAGGCCCATGTCCCCGTCGCCGTCGCCTTCAATTTGTTCGATCAATTTCTTGGCGCCAAAGCGCGCCATTTTGGGTTTATGCTGAGGGGATTGAAGCAATTGCATTCCGATCTTGAA
>augustus_masked-Fvb5-1-processed-gene-5.2:6191:6311:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-5.2:6191-6311||RAPiDGENOMICS_rs1205_02983
GTTGAAGGGTTATTCATCAGACCGGAATAATCCCTTGAAACCAAGAGGGGTGTCTGGTCTTTCTCCATATTTGCATTTTGGGCAGATATCTGCACAGAGGTGTGCCTTGGAGGCACGTAG
>augustus_masked-Fvb5-1-processed-gene-5.2:853:973:Parent=augustus_masked-Fvb5-1-processed-gene-5.2-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-5.2:853-973||RAPiDGENOMICS_rs1205_02984
TGGATGCATTTTTGGAGGAGTTGATTGTGCGCAGAGAACTTGCTGACAACTACTGCTTCTACCAGCCTCATTATGATTCATTGCAAGGGGCATGGGAATGGGCACGTAAGACTTTAATGG
>augustus_masked-Fvb5-1-processed-gene-57.8:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-57.8-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-57.8:120-240||RAPiDGENOMICS_rs1205_02985
GCGCAACAAGCGAGTAACGGAGAAGGAGGAGCTGCTGCACCTGCTCCTGTTCTAGGAGTAGTATTTGGAATGTTGTATGATGCTGTGACACAAGTGAAGGTCAAGAATTTGATGTTTAAC
>augustus_masked-Fvb5-1-processed-gene-57.8:60:180:Parent=augustus_masked-Fvb5-1-processed-gene-57.8-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-57.8:60-180|2x||RAPiDGENOMICS_rs1205_02986
ATTCCAGGGCATATATCAAGAGCGCAGCAGGAGGTCATACAACGAATGCAAGTGAATGTTGCGCAACAAGCGAGTAACGGAGAAGGAGGAGCTGCTGCACCTGCTCCTGTTCTAGGAGTA
>augustus_masked-Fvb5-1-processed-gene-71.8:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-71.8-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-71.8:0-120||RAPiDGENOMICS_rs1205_02987
ATGCAGGGAGCCTCTTCCTCCTCTGGTTCTGTCACCCCTCCATATAGACATGAAGTGTTTCTGAGCTTCAGAGGTAAAGATACACGTTCTGGTTTTACGTACCATCTGTACAAGGCTTTA
>augustus_masked-Fvb5-1-processed-gene-71.8:120:240:Parent=augustus_masked-Fvb5-1-processed-gene-71.8-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-71.8:120-240||RAPiDGENOMICS_rs1205_02988
GAGAGGGAGAAAATCAAGACGTTTTTTGATGATCGTACGCTCAAGAGAGGAGAGAATATATCAACAGCACTTCTTCAGGCAATTGAAGTTTCAAGAATTTCCGTGGTGATATGCTCCGAA
>augustus_masked-Fvb5-1-processed-gene-71.8:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-71.8-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-71.8:180-300|2x||RAPiDGENOMICS_rs1205_02989
TCAACAGCACTTCTTCAGGCAATTGAAGTTTCAAGAATTTCCGTGGTGATATGCTCCGAAAACTACGGTTCGTCAGGTTGGTGTTTGGATGAACTTGTCAGGATCCTTGAATGTCAAAAA
>augustus_masked-Fvb5-1-processed-gene-71.8:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-71.8-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-71.8:240-360||RAPiDGENOMICS_rs1205_02990
AACTACGGTTCGTCAGGTTGGTGTTTGGATGAACTTGTCAGGATCCTTGAATGTCAAAAATCAAAGCAGCAGGTTGTTATTCCAGTTTTTTACAAGGTGGATCCAGCACATGTACGACAT
>augustus_masked-Fvb5-1-processed-gene-71.8:479:599:Parent=augustus_masked-Fvb5-1-processed-gene-71.8-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-71.8:479-599||RAPiDGENOMICS_rs1205_02991
GTATGAATCTGATTTTATTGAGAAGATTGTTAAAGAGATAAAAGAACTGGCTGGCCTCCACGACCAAAAGAAGAAAGAAGATGTTCTCGGCTTCAACCACCAAAGCAATAAGGACTCGAC
>augustus_masked-Fvb5-1-processed-gene-71.8:60:180:Parent=augustus_masked-Fvb5-1-processed-gene-71.8-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-71.8:60-180|2x||RAPiDGENOMICS_rs1205_02992
CTGAGCTTCAGAGGTAAAGATACACGTTCTGGTTTTACGTACCATCTGTACAAGGCTTTAGAGAGGGAGAAAATCAAGACGTTTTTTGATGATCGTACGCTCAAGAGAGGAGAGAATATA
>augustus_masked-Fvb5-1-processed-gene-73.7:240:360:Parent=augustus_masked-Fvb5-1-processed-gene-73.7-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-73.7:240-360||RAPiDGENOMICS_rs1205_02993
CTTGGCATTTGGAACTATCACTGCATGAAGCGAAGCTACTCCGACCAACTTGCCGAGTTGTTCAGGTCTCTTAGAAGAGTGTTGTACATTCTAAAGCTGCAGGAAGAGAGACATACAAAT
>augustus_masked-Fvb5-1-processed-gene-73.7:360:480:Parent=augustus_masked-Fvb5-1-processed-gene-73.7-mRNA-1_4::augustus_masked-Fvb5-1-processed-gene-73.7:360-480||RAPiDGENOMICS_rs1205_02994
GAGATCTTGCTTGTTGCAAGGAACATTCGCGACAGACAAAATGACCTGGAAAGAAGGTTATGTGGTTTACTAAAAGTGAAGCTGGAGGAGCAGAACGAAGGCAATGGTCAGGTGAAAAAT
>augustus_masked-Fvb5-1-processed-gene-73.7:780:900:Parent=augustus_masked-Fvb5-1-processed-gene-73.7-mRNA-1_7::augustus_masked-Fvb5-1-processed-gene-73.7:780-900|2x||RAPiDGENOMICS_rs1205_02995
GAAAGACTTCTGGAGTTGGATGATTATCTTCGAGGATTGTTATGTATGATGAGGGAGCAGGTAGCCAAGGATATGAAGGAGACTTTGCTTTCTGTATGCAACTTGGAAATGACGCTCACT
>augustus_masked-Fvb5-1-processed-gene-73.8:0:120:Parent=augustus_masked-Fvb5-1-processed-gene-73.8-mRNA-1_1::augustus_masked-Fvb5-1-processed-gene-73.8:0-120||RAPiDGENOMICS_rs1205_02996
ATGCAGGGAAAAAGGGGTGTGATCAAGGAAAGATGGGACTCGGAAGACGAGCAGGATGTCAAGCAAAGTAAAAGGGAAGGCGTCTTTGAATATCAGGTTGCTGGTGAATATGAACTTCCA
>augustus_masked-Fvb5-1-processed-gene-73.8:180:300:Parent=augustus_masked-Fvb5-1-processed-gene-73.8-mRNA-1_2::augustus_masked-Fvb5-1-processed-gene-73.8:180-300|2x||RAPiDGENOMICS_rs1205_02997
TCATTGAGAGAAGTACAGATTACTCATGGAACTGAATTGGATATGCATGTGAGCAACTTGAAGAGGAAGCTTTTGTATGATGGCCACTTGGCCCTTGTGCTGACAGGTCCTGAACGATGT
>augustus_masked-Fvb5-1-processed-gene-73.8:300:420:Parent=augustus_masked-Fvb5-1-processed-gene-73.8-mRNA-1_3::augustus_masked-Fvb5-1-processed-gene-73.8:300-420|2x||RAPiDGENOMICS_rs1205_02998
GGGAAAACTAGACTGGCAGAAAAGTTTTGTCAAGATGAGGAAGTGAAAGATAAGTTCAAGAACAACATCTTCTGCCTCCCTGTTTCACAGAATCCAAGTTTGGACCTTATTGTTCAACAA
>augustus_masked-Fvb5-1-processed-gene-73.8:540:660:Parent=augustus_masked-Fvb5-1-processed-gene-73.8-mRNA-1_5::augustus_masked-Fvb5-1-processed-gene-73.8:540-660|2x||RAPiDGENOMICS_rs1205_02999
GATGATGTCTGGCCTGGATCTGAATCCCTTCTTGATGAGTTTGATGAATTCAAAAGGTCAAATTTCAAGATTCTGGTGACATCAAGATTCGAATTTCCCAGATTTGGTTCCTCCTATTAT
>augustus_masked-Fvb5-2-processed-gene-136.2:120:240:Parent=augustus_masked-Fvb5-2-processed-gene-136.2-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-136.2:120-240||RAPiDGENOMICS_rs1205_03000
ATGACGGCTTTCCTGAGGGTTGCTGATGCGTATGAAGAAAGTGATGAGGAACTCAAAGTCTGGGTTAAACAACTAAGAGAAATTGCTTATGAAAGTGAAGATGTTCTTGATGAGTTTACC
>augustus_masked-Fvb5-2-processed-gene-136.2:1560:1680:Parent=augustus_masked-Fvb5-2-processed-gene-136.2-mRNA-1_14::augustus_masked-Fvb5-2-processed-gene-136.2:1560-1680||RAPiDGENOMICS_rs1205_03001
CCAGAAAAAATCCGCCGTCTGTCAATACATAACACACTGCAGTATGTACAGACAAACAGGTGTGCTTCTCAGCTACGTTCTCTTTTTATGTTTACAGTAGCTGAGAAACCATCACTACGA
>augustus_masked-Fvb5-2-processed-gene-136.2:2160:2280:Parent=augustus_masked-Fvb5-2-processed-gene-136.2-mRNA-1_19::augustus_masked-Fvb5-2-processed-gene-136.2:2160-2280||RAPiDGENOMICS_rs1205_03002
TTGTCCAAACTTTCTGCATTGTCCATAACTTCAGTGGAAGAGGACGAGATCATTGATTTGGAGCACCTATATTCTCCTCCTATGTTGCTTCAGCGTTTGTACTTGCGAGGGAGATTGGAA
>augustus_masked-Fvb5-2-processed-gene-136.2:2280:2400:Parent=augustus_masked-Fvb5-2-processed-gene-136.2-mRNA-1_20::augustus_masked-Fvb5-2-processed-gene-136.2:2280-2400||RAPiDGENOMICS_rs1205_03003
GCATTGCCTCATTGGATACCTTCTCTTCACAGCCTCGTCAAGTTGTATTTGAAATGGAGCAGGTTAAAGGATGATCCACTTGTATTTCTTCAACATTTGCCCAATCTAGTACATCTCGAG
>augustus_masked-Fvb5-2-processed-gene-136.2:2520:2640:Parent=augustus_masked-Fvb5-2-processed-gene-136.2-mRNA-1_22::augustus_masked-Fvb5-2-processed-gene-136.2:2520-2640||RAPiDGENOMICS_rs1205_03004
ATGCCTTGTCTTGAAAATCTAAGCATCCGGCGCTGTAAATCACTGGAGAAAGTACCATCAGGCATTGAACATCTCATCAAACTAAAGGTGCTTAAGTTTTTCGATATGCCAGAAAAACTA
>augustus_masked-Fvb5-2-processed-gene-136.2:420:540:Parent=augustus_masked-Fvb5-2-processed-gene-136.2-mRNA-1_4::augustus_masked-Fvb5-2-processed-gene-136.2:420-540|2x||RAPiDGENOMICS_rs1205_03005
GAACAAGGCTCAAGTTCTAAGGACCATCGAGGTGACGCTTTACTTCTAGAGAAAACTGATATAGTCGGCATAGACAAGCCTATTAAGCAGATGGTTGGGAGGCTGCTCAATGGTGATTGT
>augustus_masked-Fvb5-2-processed-gene-136.2:660:780:Parent=augustus_masked-Fvb5-2-processed-gene-136.2-mRNA-1_6::augustus_masked-Fvb5-2-processed-gene-136.2:660-780|2x||RAPiDGENOMICS_rs1205_03006
ACTCAGTCTTTCAAACTAGGGGAACTTCTTAAAGACATCGTTCAACAGCTCCACCAAGCAATCAGAAGTCCAGTTCCACAAGAAATCAACAGCATGAATACCAACCAGCTGAAAACAATC
>augustus_masked-Fvb5-2-processed-gene-136.2:720:840:Parent=augustus_masked-Fvb5-2-processed-gene-136.2-mRNA-1_7::augustus_masked-Fvb5-2-processed-gene-136.2:720-840||RAPiDGENOMICS_rs1205_03007
ATCAGAAGTCCAGTTCCACAAGAAATCAACAGCATGAATACCAACCAGCTGAAAACAATCATTAAAGACTTCCTACAGAAGAGGAGGTATCTCATTGTCTTGGATGATGTGTGGCACTTG
>augustus_masked-Fvb5-2-processed-gene-136.2:900:1020:Parent=augustus_masked-Fvb5-2-processed-gene-136.2-mRNA-1_8::augustus_masked-Fvb5-2-processed-gene-136.2:900-1020|2x||RAPiDGENOMICS_rs1205_03008
CTCACTACTCGAAATGCAGATATAGCCTCGACAACAAGCATGGAGTCTGGAGGTGAAGTCTACACTTTGGAGCCCTTGCCCCCAATGGAATCATGGGAGTTACTGTGTAAGAAGACATTC
>augustus_masked-Fvb5-2-processed-gene-144.2:1560:1680:Parent=augustus_masked-Fvb5-2-processed-gene-144.2-mRNA-1_14::augustus_masked-Fvb5-2-processed-gene-144.2:1560-1680||RAPiDGENOMICS_rs1205_03009
GATACAATGTGGCCTGAAAAAGTTCGAAGACTATCAATAGTTAACTCGGTGCAGAATGTACAAAAAAGGAGGCCTCCATCTACACTTCGCTCTTTGCTCATCTTTGGGGCAGAAGGTTCA
>augustus_masked-Fvb5-2-processed-gene-144.2:1680:1800:Parent=augustus_masked-Fvb5-2-processed-gene-144.2-mRNA-1_15::augustus_masked-Fvb5-2-processed-gene-144.2:1680-1800||RAPiDGENOMICS_rs1205_03010
CTTACTAACTTATCCATACCAAAATTCTTTCCTAAATGTCTCCAGTTGCTTACTGTTTTAGACTTGCAAGGAGCACATATAGAGGTCTTTCCAAAAGAGGTTTTCAAGCTGGTTCTTCTC
>augustus_masked-Fvb5-2-processed-gene-144.2:1800:1920:Parent=augustus_masked-Fvb5-2-processed-gene-144.2-mRNA-1_16::augustus_masked-Fvb5-2-processed-gene-144.2:1800-1920||RAPiDGENOMICS_rs1205_03011
AAGTTTCTTAGCCTGAGGGGTAGCAAGGTAAAACAAATTCCAACCTCCATCAAGAATTTGAGATACCTACAGACTCTGGACCTTAAACACTCCCATGTCGTTGAATTGCCATCTGAGATT
>augustus_masked-Fvb5-2-processed-gene-144.2:240:360:Parent=augustus_masked-Fvb5-2-processed-gene-144.2-mRNA-1_3::augustus_masked-Fvb5-2-processed-gene-144.2:240-360||RAPiDGENOMICS_rs1205_03012
CTGTTCTATTCCAATGATCCCCCGCCTGGATTTTGTACTTTACTTGACAAGCTTATTTGCTTCATCAAGATATGGAAAGCATACCATCAAATTGCTGCTGATATTGAAGGCCTAAACTCC
>augustus_masked-Fvb5-2-processed-gene-144.2:2400:2520:Parent=augustus_masked-Fvb5-2-processed-gene-144.2-mRNA-1_21::augustus_masked-Fvb5-2-processed-gene-144.2:2400-2520||RAPiDGENOMICS_rs1205_03013
CCAAATTTGGTACATCTTGAACTCCTACAAGTTTATGATGGGAATAGCTTGCATTTTGAGGCAAAAGGGTTCCCAAGTCTGAAGTTACTAGGTATTGATAAATTAGAAGAACTTCAATCA
>augustus_masked-Fvb5-2-processed-gene-144.2:720:840:Parent=augustus_masked-Fvb5-2-processed-gene-144.2-mRNA-1_7::augustus_masked-Fvb5-2-processed-gene-144.2:720-840||RAPiDGENOMICS_rs1205_03014
ATCTTCCAAGTTATTCAGAAACCACCTGAGGAAGAGGTTGACAGCATGAACAACAACCAGCTCCGAGAAAGAATCCAAAAGTTGCTGCAGCAAAGCAGGTACCTGATTGTTCTTGATGAT
>augustus_masked-Fvb5-2-processed-gene-144.2:840:960:Parent=augustus_masked-Fvb5-2-processed-gene-144.2-mRNA-1_8::augustus_masked-Fvb5-2-processed-gene-144.2:840-960||RAPiDGENOMICS_rs1205_03015
TTGTGGCAGACAGATGCCTGGGATGTCATCAATAAAGTAATCCCCAATAACAAACTAGGTAGTCGAGTAATGCTCACTACTCGTATTCATGCTGTAGCACATGCCTCTTGCTCGGGCACA
>augustus_masked-Fvb5-2-processed-gene-144.2:900:1020:Parent=augustus_masked-Fvb5-2-processed-gene-144.2-mRNA-1_8::augustus_masked-Fvb5-2-processed-gene-144.2:900-1020|2x||RAPiDGENOMICS_rs1205_03016
AGTCGAGTAATGCTCACTACTCGTATTCATGCTGTAGCACATGCCTCTTGCTCGGGCACACAAGGTATGGTCTACATTTTGGAGCCCTTATCTGTAGAAGAGTCTCAAACTCTTTTATTT
>augustus_masked-Fvb5-2-processed-gene-144.3:1053:1173:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_9::augustus_masked-Fvb5-2-processed-gene-144.3:1053-1173||RAPiDGENOMICS_rs1205_03017
GAAGTTGCACAGAGTTACATAAAGGAGCTATGGGACAGAAGTTTGATTCAAGCAACAGAAACAGCAACTGATGGGCGAGTTAAATCCTATCGCATCCATGATCTTTTACGGGAGATTATC
>augustus_masked-Fvb5-2-processed-gene-144.3:1173:1293:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_10::augustus_masked-Fvb5-2-processed-gene-144.3:1173-1293||RAPiDGENOMICS_rs1205_03018
ATTTCAAAGTCTAGGGAGCAAAATTTTGCAGCTGTAGAGAGAGAAGAAAGCACAACGTGGTCTGACAAAGTTCGACGACTATCAATAGTCAATACATTGCAGAATGTCCATAAGAAGAAG
>augustus_masked-Fvb5-2-processed-gene-144.3:1293:1413:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_11::augustus_masked-Fvb5-2-processed-gene-144.3:1293-1413||RAPiDGENOMICS_rs1205_03019
ACTCCATCTAAACTTCGCTCTTTGCTCATCTTTGGGGTAGAAGATTCACTAAATGATTTTACCATAACAAAATTGTTTCCAACAGGTCTTCAGCTGCTGACTGTATTAGACTTGGAAGGT
>augustus_masked-Fvb5-2-processed-gene-144.3:1413:1533:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_12::augustus_masked-Fvb5-2-processed-gene-144.3:1413-1533||RAPiDGENOMICS_rs1205_03020
GCACATGTACAGGAGTTTCCAAAAGAGGTTGTGAAGCTGGTCTTTCTCAAGTACCTTAGCTTCAGGAATAGCAAGGTGAAACAAATTCCAAGCTCCATCAAGAAGCTAAGATACCTAGAG
>augustus_masked-Fvb5-2-processed-gene-144.3:153:273:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-144.3:153-273|2x||RAPiDGENOMICS_rs1205_03021
ATCGGTGAGCCGAAAAGGAAACTTTTTGAGTTGCTTATGAAGGAAGAATCAACACGCCAGGTGGTTCCTATAGTTGGTATGGGAGGACTGGGAAAAACTACCTTGGTAAAGCAATTGTAC
>augustus_masked-Fvb5-2-processed-gene-144.3:1533:1653:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_13::augustus_masked-Fvb5-2-processed-gene-144.3:1533-1653||RAPiDGENOMICS_rs1205_03022
ACTCTCGACCTTAAACACTCCCATGTTGTTGAATTGCCTGTTGAAATGTTGTATTTGAAGCAACTTCGTCATCTCCTGGTGTATCGTTATGAAGTTGAATCCTATGCACAATTTAATGCC
>augustus_masked-Fvb5-2-processed-gene-144.3:2009:2129:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-144.3:2009-2129||RAPiDGENOMICS_rs1205_03023
AGGAGTGTTTCCAAGACTGAAGTTATTAGGCATTGATAAGTTAGATGAACTTCAATCAATAACCATAGATGAAGGAGCAATGCCTTGTCTAGAAAAGCTTATTATCCAGGGTTGTGAATC
>augustus_masked-Fvb5-2-processed-gene-144.3:213:333:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-144.3:213-333||RAPiDGENOMICS_rs1205_03024
GTGGTTCCTATAGTTGGTATGGGAGGACTGGGAAAAACTACCTTGGTAAAGCAATTGTACGAGGATGCCAAAGTTAAGAAGCATTTTAAGATACATGCTTGGATCACTGTCTCTCGGTCA
>augustus_masked-Fvb5-2-processed-gene-144.3:2249:2369:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_4::augustus_masked-Fvb5-2-processed-gene-144.3:2249-2369||RAPiDGENOMICS_rs1205_03025
AGTCGCTCATGTCCCTGCAGTTTATTATTCCTATTGGAAAGTTGGCGGTTGGGATGTGTTTTCATTAGTCAATGACAGGGAGGGATTTCATCAGGGTACTTCTGCAATGAGGAGGCTTGA
>augustus_masked-Fvb5-2-processed-gene-144.3:273:393:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-144.3:273-393|2x||RAPiDGENOMICS_rs1205_03026
GAGGATGCCAAAGTTAAGAAGCATTTTAAGATACATGCTTGGATCACTGTCTCTCGGTCATGCCATATGAATAAGCTCCTACGACGCATGATCCATGAGATATTCAATGTTATCAGAAAA
>augustus_masked-Fvb5-2-processed-gene-144.3:333:453:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_3::augustus_masked-Fvb5-2-processed-gene-144.3:333-453||RAPiDGENOMICS_rs1205_03027
TGCCATATGAATAAGCTCCTACGACGCATGATCCATGAGATATTCAATGTTATCAGAAAACCAGTTCCTCAAGATGAAGAAATTGAAAGCATGGACGACAACAAGCTTAGAGAGAGAATC
>augustus_masked-Fvb5-2-processed-gene-144.3:453:573:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_4::augustus_masked-Fvb5-2-processed-gene-144.3:453-573||RAPiDGENOMICS_rs1205_03028
AGAAAATTGCTACAGCATAGTAGGTACCTGATTGTTCTGGATGACCTATGGAATACAGCTGACTGGAATGCCATCAATCATGCAATGCCAAACAACGATCTTGGTAGTCGAGTAATGCTC
>augustus_masked-Fvb5-2-processed-gene-144.3:513:633:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_4::augustus_masked-Fvb5-2-processed-gene-144.3:513-633|2x||RAPiDGENOMICS_rs1205_03029
GACTGGAATGCCATCAATCATGCAATGCCAAACAACGATCTTGGTAGTCGAGTAATGCTCACTACTCGCAATGTCAAAGTAGCCTCTGTCTCTTGCTTGGGGAACCCTGCTGACATGATC
>augustus_masked-Fvb5-2-processed-gene-144.3:573:693:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_5::augustus_masked-Fvb5-2-processed-gene-144.3:573-693||RAPiDGENOMICS_rs1205_03030
ACTACTCGCAATGTCAAAGTAGCCTCTGTCTCTTGCTTGGGGAACCCTGCTGACATGATCTACCGTTTACAGCCCTTATCACTGGAAGATTCATGGACTCTTTTCTGCAGGAAGACATTT
>augustus_masked-Fvb5-2-processed-gene-144.3:693:813:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_6::augustus_masked-Fvb5-2-processed-gene-144.3:693-813||RAPiDGENOMICS_rs1205_03031
CGTGGAAGTCCATGCCCTCCAAATCTGAAAGAAATTTGTCCATCCATCCTAACGAAATGTGAGGGACTGCCCCTTGCTATTGTAGCACTGGGAGCTGTTCTAGCTTTAAAAGACCAGACA
>augustus_masked-Fvb5-2-processed-gene-144.3:753:873:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_6::augustus_masked-Fvb5-2-processed-gene-144.3:753-873|2x||RAPiDGENOMICS_rs1205_03032
GAGGGACTGCCCCTTGCTATTGTAGCACTGGGAGCTGTTCTAGCTTTAAAAGACCAGACAAATGTAGATGAATGGACTGATGTTTGTGGAAGTATTGGAGCTGAAATTCAGGAAAATGAA
>augustus_masked-Fvb5-2-processed-gene-144.3:813:933:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_7::augustus_masked-Fvb5-2-processed-gene-144.3:813-933||RAPiDGENOMICS_rs1205_03033
AATGTAGATGAATGGACTGATGTTTGTGGAAGTATTGGAGCTGAAATTCAGGAAAATGAACAGCTTGACAATATGACAAAGGTGCTGTATCTCAGTTTCAGTGATTTACCATACCATCTG
>augustus_masked-Fvb5-2-processed-gene-144.3:873:993:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_7::augustus_masked-Fvb5-2-processed-gene-144.3:873-993|2x||RAPiDGENOMICS_rs1205_03034
CAGCTTGACAATATGACAAAGGTGCTGTATCTCAGTTTCAGTGATTTACCATACCATCTGAAGTCATGTTTCTTGTATCTGAGCATGTTTCCTGATATCTACAAAATTGATCATATGAAA
>augustus_masked-Fvb5-2-processed-gene-144.3:93:213:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-144.3:93-213||RAPiDGENOMICS_rs1205_03035
GTTCCATATCAGTTCACTCCAAGGGATGCCACTTTACTAGAAGAGACTGAGCTGGTGGCAATCGGTGAGCCGAAAAGGAAACTTTTTGAGTTGCTTATGAAGGAAGAATCAACACGCCAG
>augustus_masked-Fvb5-2-processed-gene-144.3:933:1053:Parent=augustus_masked-Fvb5-2-processed-gene-144.3-mRNA-1_8::augustus_masked-Fvb5-2-processed-gene-144.3:933-1053||RAPiDGENOMICS_rs1205_03036
AAGTCATGTTTCTTGTATCTGAGCATGTTTCCTGATATCTACAAAATTGATCATATGAAATTAATTCGATTGTGGTTAGCTGAAGGATTTATTATTGAAACCGGAGGAAGGACACCGGAA
>augustus_masked-Fvb5-2-processed-gene-146.2:0:120:Parent=augustus_masked-Fvb5-2-processed-gene-146.2-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-146.2:0-120||RAPiDGENOMICS_rs1205_03037
ATGGCAGAAAGTATAGTCACCTTTTTAGTTGACAGGCTCACGATGTTACTTGACGAAGAGGTGAAACTCATGTCAGGGATCCGAGAACAGGTCGAGGACCTGGTTAATGAATTGGAGCGT
>augustus_masked-Fvb5-2-processed-gene-146.2:1020:1140:Parent=augustus_masked-Fvb5-2-processed-gene-146.2-mRNA-1_9::augustus_masked-Fvb5-2-processed-gene-146.2:1020-1140|2x||RAPiDGENOMICS_rs1205_03038
AAGAAGACATTTCATGGAGAGTCGTGCCCTCCAAATTTGGATGAATTTTGTCAATGCATCCTGATGAAATGCAGGGGACTGCCCCTTACAATTGTGGCCATCGGCGCTGTACTAGCTCTT
>augustus_masked-Fvb5-2-processed-gene-146.2:1140:1260:Parent=augustus_masked-Fvb5-2-processed-gene-146.2-mRNA-1_10::augustus_masked-Fvb5-2-processed-gene-146.2:1140-1260|2x||RAPiDGENOMICS_rs1205_03039
AAAGACAAGAGAATGGTGGATGAATGGGCTGCTGTGTGTGGCAGTATTGGAACTGAAATTGCGGGAAATGATCAACTTGACAGCATGAAAAAATTGTTGTATCTCAGTTACAGAGATTTA
>augustus_masked-Fvb5-2-processed-gene-146.2:1260:1380:Parent=augustus_masked-Fvb5-2-processed-gene-146.2-mRNA-1_11::augustus_masked-Fvb5-2-processed-gene-146.2:1260-1380|2x||RAPiDGENOMICS_rs1205_03040
CCATACCATCTGAAATCTTGTTTCTTATATCTGAGCATCTTTCCTGATTTTTACAAAATTGAGCATATGAAATTGATTCGGTTATGGTTAGCTGAAGGATTTGTTATTGGAAAAGAGGGA
>augustus_masked-Fvb5-2-processed-gene-146.2:1680:1800:Parent=augustus_masked-Fvb5-2-processed-gene-146.2-mRNA-1_15::augustus_masked-Fvb5-2-processed-gene-146.2:1680-1800||RAPiDGENOMICS_rs1205_03041
CTTGCTGATTTTCCCATACCAAAATTGCTTCCTGACCTTCAGTTGCTTACTGTATTAGACTTAGAAGGTGCACGTCTGGATATGTTTCCAAGTGAGGTTGTCAAGCTTCTTCTTCTCAGG
>augustus_masked-Fvb5-2-processed-gene-146.2:2236:2356:Parent=augustus_masked-Fvb5-2-processed-gene-146.2-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-146.2:2236-2356||RAPiDGENOMICS_rs1205_03042
GTATTGATAAGTTGGATGAACTGCAATTGGTAACCATAGAGGAGGGAGCAATGCCTCGGCTAGAAAAGCTAATTATCCAGCGCTGCAAATGTTTAAAGAATGTCCCATTTGGCATTGAGC
>augustus_masked-Fvb5-2-processed-gene-146.2:240:360:Parent=augustus_masked-Fvb5-2-processed-gene-146.2-mRNA-1_3::augustus_masked-Fvb5-2-processed-gene-146.2:240-360||RAPiDGENOMICS_rs1205_03043
CTTTTCCATTCACACTATCATGGCCACGGATTCCAAGCTTCCCTTCATAAACTTTCTTGCATCGTCAAGAAATGGAAAGTTAACCATCAAATTTCAGCTGATATTCGAAGAATAAACTCA
>augustus_masked-Fvb5-2-processed-gene-146.2:660:780:Parent=augustus_masked-Fvb5-2-processed-gene-146.2-mRNA-1_6::augustus_masked-Fvb5-2-processed-gene-146.2:660-780|2x||RAPiDGENOMICS_rs1205_03044
ATCACTGTTTCTCGATCAGTCAAGTTAAATCAGCTCCTAAGACACATGATCAATAAAATTTTCAGCGTTATCACAAAACCAGATCCTGAAGATGAAGTTGATACCATGGATGACAACCAG
>augustus_masked-Fvb5-2-processed-gene-146.2:720:840:Parent=augustus_masked-Fvb5-2-processed-gene-146.2-mRNA-1_7::augustus_masked-Fvb5-2-processed-gene-146.2:720-840||RAPiDGENOMICS_rs1205_03045
TTCAGCGTTATCACAAAACCAGATCCTGAAGATGAAGTTGATACCATGGATGACAACCAGCTGAGAAAGAGAATCAAAAAATTGCTGCAGAATAGTAGGTACCTGATTGTTCTTGATGAT
>augustus_masked-Fvb5-2-processed-gene-146.2:780:900:Parent=augustus_masked-Fvb5-2-processed-gene-146.2-mRNA-1_7::augustus_masked-Fvb5-2-processed-gene-146.2:780-900|2x||RAPiDGENOMICS_rs1205_03046
CTGAGAAAGAGAATCAAAAAATTGCTGCAGAATAGTAGGTACCTGATTGTTCTTGATGATATATGGCATATACAGGACTGGGAAGCCATCAATCATGTAATGCCGAACAACGATCGTGGT
>augustus_masked-Fvb5-2-processed-gene-146.2:840:960:Parent=augustus_masked-Fvb5-2-processed-gene-146.2-mRNA-1_8::augustus_masked-Fvb5-2-processed-gene-146.2:840-960||RAPiDGENOMICS_rs1205_03047
ATATGGCATATACAGGACTGGGAAGCCATCAATCATGTAATGCCGAACAACGATCGTGGTAGTCGAGTAATGCTCACTACTCGCAATGTTAATGTAGCCTCTGCATCTTGCTCGGGGAAC
>augustus_masked-Fvb5-2-processed-gene-146.5:0:120:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-146.5:0-120||RAPiDGENOMICS_rs1205_03048
ATGGCAATCAGGGAGCAGCCTAAAAAACAGCTGATCGAGCTGCTTATGAAACATGAGCCAGGACGCCAGGTGGTATCGGTGGTTGGGATGGGCGGATTGGGCAAAACTACCTTGGTAAAG
>augustus_masked-Fvb5-2-processed-gene-146.5:1072:1192:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_6::augustus_masked-Fvb5-2-processed-gene-146.5:1072-1192||RAPiDGENOMICS_rs1205_03049
CACTTCGCTCTTTGCTCATCTTTGGGGCAGAAGGTTCACTTACTAACTTATCCATACCAAAATTCTTTCCTAAAGTCTCAGTTGCTTACTGTTTAGACTTGCAAGGAGCACATATAGAGG
>augustus_masked-Fvb5-2-processed-gene-146.5:1254:1374:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-146.5:1254-1374||RAPiDGENOMICS_rs1205_03050
TTGAGTCTTATGCACGCTTTAATTCCAAGTATGGGTAAAGGTTCCTGCAGGAATTGTGGCTTGGAAAAGCTCCAAAAGCTGTGTAAAATAGAGGCAAATCAAGATAATTGTGCTTTAATG
>augustus_masked-Fvb5-2-processed-gene-146.5:1374:1494:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-146.5:1374-1494||RAPiDGENOMICS_rs1205_03051
GCGAACCTTGGAAGCTTGACTCAGCTAAGGAGGTTAGGCATTCTAAAATTGAGACAAGAAAATGGAACAGCCTTATGCTTATCCATCCAAAAGATGAAGAACCTTCGTGCATTGTCTGTA
>augustus_masked-Fvb5-2-processed-gene-146.5:1614:1734:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_4::augustus_masked-Fvb5-2-processed-gene-146.5:1614-1734||RAPiDGENOMICS_rs1205_03052
CAAAACCTGGCCAGACTATTCCTAAAATGGAGTCGATTGAAGGAGGATCCTCTTGTCGAACTTCAAGGTTTGCCAAATTTGGTACATCTTGAACTCCTACAAGTTTATGATGGGAATAGC
>augustus_masked-Fvb5-2-processed-gene-146.5:1997:2117:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-146.5:1997-2117||RAPiDGENOMICS_rs1205_03053
GATGGATCTGAGCGTCATCTTCGCCGTTCGCATCCAAGTGTCGTTAACGTTCATTATCGGCGTCTCACGTTGTCAACGTTTAGCCATCGTCGACGTCCAGCCGTCGCAGTTGTCTTCATC
>augustus_masked-Fvb5-2-processed-gene-146.5:2634:2754:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-146.5:2634-2754||RAPiDGENOMICS_rs1205_03054
CCCTTATCACTGGAAGATTCATGGACTCTTTTCTGCAGGAAGACATTTCGTGGAAGTCCATGCCCTCCAAATCTGAAAGAAATTTGTCCATCCATCCTAACGAAATGTGAGGGACTGCCC
>augustus_masked-Fvb5-2-processed-gene-146.5:3114:3234:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_5::augustus_masked-Fvb5-2-processed-gene-146.5:3114-3234||RAPiDGENOMICS_rs1205_03055
GGGCGAGTTAAATCCTATCGCATCCATGATCTTTTACGGGAGATTATCATTTCAAAGTCTAGGGAGCAAAATTTTGCAGCTGTAGAGAGAGAAGAAAGCACAACGTGGTCTGACAAAGTT
>augustus_masked-Fvb5-2-processed-gene-146.5:3234:3354:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_6::augustus_masked-Fvb5-2-processed-gene-146.5:3234-3354||RAPiDGENOMICS_rs1205_03056
CGACGACTATCAATAGTCAATACATTGCAGAATGTCCATAAGAAGAAGACTCCATCTAAACTTCGCTCTTTGCTCATCTTTGGGGTAGAAGATTCACTAAATGATTTTACCATAACAAAA
>augustus_masked-Fvb5-2-processed-gene-146.5:3354:3474:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_7::augustus_masked-Fvb5-2-processed-gene-146.5:3354-3474||RAPiDGENOMICS_rs1205_03057
TTGTTTCCAACAGGTCTTCAGCTGCTGACTGTATTAGACTTGGAAGGTGCACATGTACAGGAGTTTCCAAAAGAGGTTGTGAAGCTGGTCTTTCTCAAGTACCTTAGCTTCAGGAATAGC
>augustus_masked-Fvb5-2-processed-gene-146.5:3474:3594:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_8::augustus_masked-Fvb5-2-processed-gene-146.5:3474-3594||RAPiDGENOMICS_rs1205_03058
AAGGTGAAACAAATTCCAAGCTCCATCAAGAAGCTAAGATACCTAGAGACTCTCGACCTTAAACACTCCCATGTTGTTGAATTGCCTGTTGAAATGTTGTATTTGAAGCAACTTCGTCAT
>augustus_masked-Fvb5-2-processed-gene-146.5:3594:3714:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_9::augustus_masked-Fvb5-2-processed-gene-146.5:3594-3714||RAPiDGENOMICS_rs1205_03059
CTCCTGGTGTATCGTTATGAAGTTGAATCCTATGCACAATTTAATGCCAAATATGGAGTTAAGCTTCCTGCAGGAATATGTAGCTTGCAATCTCTTCAAAAGCTTTGTTTTATAGAGGCA
>augustus_masked-Fvb5-2-processed-gene-146.5:3714:3834:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_10::augustus_masked-Fvb5-2-processed-gene-146.5:3714-3834||RAPiDGENOMICS_rs1205_03060
AATCAATGCAGTGGTGGTTTCATGGCAGAGCTAGGGGGAATGAATCAACTGAGGAGGTTAGGCATTTTGAAGTTGAGACAAGAAGATGGGGAAACCTTATGCTCATCCATCCAAAAGATG
>augustus_masked-Fvb5-2-processed-gene-146.5:592:712:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-146.5:592-712||RAPiDGENOMICS_rs1205_03061
ATGAATGGACTGCTATCTGTGGAAGTATTAGTGCCGAGATTCAGCAAAATGATCAGCTTGAAAATATGAAGGAATTACTGTATCTCAGTTTCAGTGATTTACCATACCAGCTGAAATCAT
>augustus_masked-Fvb5-2-processed-gene-146.5:712:832:Parent=augustus_masked-Fvb5-2-processed-gene-146.5-mRNA-1_3::augustus_masked-Fvb5-2-processed-gene-146.5:712-832||RAPiDGENOMICS_rs1205_03062
GTTTCTTGTATTTGAGCATCTTTCCTGATCTCTACAACATTGAGCGTATGAGATTAATTCGGTTATGGTTAGCTGAAGGATTTCTGATCACAATGGAAGGAAAGACACCAGAAGAAGTTG
>augustus_masked-Fvb5-2-processed-gene-150.9:0:120:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-150.9:0-120||RAPiDGENOMICS_rs1205_03063
ATGTCTACCTCACTCTCTGATCCAATCAATTCAAGCCCACTTGCTGACAGACCACCGGTTGAAGCCGCCACATTGAGAGGACCCAGACTCACCAGATCTCGTCGATCCAACCACCGGTCT
>augustus_masked-Fvb5-2-processed-gene-150.9:1123:1243:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-150.9:1123-1243||RAPiDGENOMICS_rs1205_03064
TTCATGTGGTTCTAGTCATATTTGTTTACCTTGTATATACGGCAAGCAATGAGCTTGGTAGTCCCAGAGTTGTGTACAACTGTCTGATAGAGGTAGCAAGTAAATCAAGAATCTGTCAGG
>augustus_masked-Fvb5-2-processed-gene-150.9:1243:1363:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-150.9:1243-1363||RAPiDGENOMICS_rs1205_03065
AGCCAATTTCTCATCAGGGGCAGTCTTGTGGTCCTGTCAGTGGGAATTACAAAGGGTCGTACCTAACCATGATGAGTTCAGGCGGGCTAGTCTTTGGGATTATCAACATTGTTGGAAACT
>augustus_masked-Fvb5-2-processed-gene-150.9:1386:1506:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-150.9:1386-1506||RAPiDGENOMICS_rs1205_03066
GGATATTGGGTAAGTGCCATAGCTGCACGGCCGTCATCAACTCATAAAGGTTACTTGTTAGGTGGGCTTGTCTGGTTTGCAGTCCCATTCTCTTTGGCAACATCACTAGGTCTGGGAGCA
>augustus_masked-Fvb5-2-processed-gene-150.9:159:279:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-150.9:159-279||RAPiDGENOMICS_rs1205_03067
GCTTGGGGAAAAGAAGGCAAGAGCTCACATTGCTTGAAGGGTATCTTGGAGGGTCATAAGGATGTTTCGTTTAACTCGGTGGTGGTTTCAGAGGATGGGAGATGGGTCAATGGAGGCGGT
>augustus_masked-Fvb5-2-processed-gene-150.9:1625:1745:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-150.9:1625-1745||RAPiDGENOMICS_rs1205_03068
GGCAGTGACATCTGCTGGTTCCTCAGAGCTTATAGCAGTATCCTCATTATGTACTTATGATATCTATCGCACATACATAGATCCAGATGCAACTGGAAAGACAATCCTCAAGGTATCTAG
>augustus_masked-Fvb5-2-processed-gene-150.9:1745:1865:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-150.9:1745-1865||RAPiDGENOMICS_rs1205_03069
GGCTGTCATCCTTGGTTTCGGATGCTTTATGGGGTTGTTAGCAGTGATGTTAAACAAGGCAGGAGTGTCATTGGGTTGGATGTATCTGGCAATGGGAGTGTTCATCGGCTCAGCAGTGCT
>augustus_masked-Fvb5-2-processed-gene-150.9:1865:1985:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_3::augustus_masked-Fvb5-2-processed-gene-150.9:1865-1985||RAPiDGENOMICS_rs1205_03070
TCCCATTGCTTTCATGCTTCTATGGAGAAAGGCAAATGCCATTGGAGCAATTCTAGGAGCAACAATTGGTTGTCTTCTTGGGATCATCACATGGCTATCTGTTGCTAAAATTGAGTATGG
>augustus_masked-Fvb5-2-processed-gene-150.9:1985:2105:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_4::augustus_masked-Fvb5-2-processed-gene-150.9:1985-2105||RAPiDGENOMICS_rs1205_03071
CCGAGTGAATCTTGACACAACAGGTAGGAATGCACCAATGCTTGCTGGAAACCTTGTCTCTATACTTGCTGGTGGCGCTATACATGCTATATGTAGCTTCATGTCCCTGCAGAACTACGA
>augustus_masked-Fvb5-2-processed-gene-150.9:2105:2225:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_5::augustus_masked-Fvb5-2-processed-gene-150.9:2105-2225||RAPiDGENOMICS_rs1205_03072
TTGGGAAACCACAAGGCAGATCACAGTGGTTGAGAAGGAAAAGAGTGAGCTGCCAGCAGAAGAGTACAGGGAGGAAAAATTATTGAGAGCAAAAGCCTGGATAGTGAAATGGGGTGTTGG
>augustus_masked-Fvb5-2-processed-gene-150.9:2275:2395:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-150.9:2275-2395||RAPiDGENOMICS_rs1205_03073
GAGCTTTTAGTATAGGGTACTTCACATTCTGGGCAGTGATAGCAATAGCATGGGGTACAATTGGTTCCATTTTCATCATTACTTTACCGTTATATGTGAGCTGGGAAACAATCCAGAGTG
>augustus_masked-Fvb5-2-processed-gene-150.9:2395:2515:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-150.9:2395-2515||RAPiDGENOMICS_rs1205_03074
TCCTCCTGGGCATGTTTACAAATGACAGGCTCATGGAAAAGGTTGAAGAAATGAATTTGAGGCTGCGCACAGTCATGTTGGCTATACCAGAAGCAGAGAGAATTTACTTGCTTGAGAAGG
>augustus_masked-Fvb5-2-processed-gene-150.9:2741:2861:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-150.9:2741-2861||RAPiDGENOMICS_rs1205_03075
TTTCCCTAATCTTGAATATGTTGACCTCAGCTTGAATAAAATCTTCGATGTCATCCCACCTCAGATCAGCTCCCTCTCCAAACTTATTTATCTTGATCTATCTTTTAATCAGTTGTCTGG
>augustus_masked-Fvb5-2-processed-gene-150.9:279:399:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-150.9:279-399||RAPiDGENOMICS_rs1205_03076
TCCGATGGATTTTTGCTGGGGTGGGAAGGGTGTGTAAATGGTGATGATCAAATTGGGAGTTGGAAGTTGGTTTGTGAAACAAAAGCGCATCAAAATGCAGTGTTCTCGATGTGTTTGATG
>augustus_masked-Fvb5-2-processed-gene-150.9:2861:2981:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_3::augustus_masked-Fvb5-2-processed-gene-150.9:2861-2981||RAPiDGENOMICS_rs1205_03077
GAAAATCCCACCAGAAATTGGTCTTCTAACAAAACTTGAGGTCCTGCACCTCATGGGAAACCAGTTAAATGGCTCAATTCCTCAAGAAATAGGTGACCTTAAGCTTCTCTATGAGCTTGC
>augustus_masked-Fvb5-2-processed-gene-150.9:2981:3101:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_4::augustus_masked-Fvb5-2-processed-gene-150.9:2981-3101||RAPiDGENOMICS_rs1205_03078
GCTATACACCAACAATCTCGAAGGTTCAATTCCTATTTCTCTTGGTAATTTGAGCAACATGAGATTTCTGTATCTCTATGAAAACCAACTTTCTGGTCCCATCCCACTAGAAATAGGAAA
>augustus_masked-Fvb5-2-processed-gene-150.9:3041:3161:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_4::augustus_masked-Fvb5-2-processed-gene-150.9:3041-3161|2x||RAPiDGENOMICS_rs1205_03079
GAGATTTCTGTATCTCTATGAAAACCAACTTTCTGGTCCCATCCCACTAGAAATAGGAAACCTTCATAATTTGGTTGAGCTCTTTATTGATGCCAACTACTTGACAGGTCCAATCCCTCC
>augustus_masked-Fvb5-2-processed-gene-150.9:3161:3281:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_5::augustus_masked-Fvb5-2-processed-gene-150.9:3161-3281|2x||RAPiDGENOMICS_rs1205_03080
AAATTTTGGAAACTTCAAAGAGCTAATTGTGATGTCATTGTGCAACAATAATCTTTCTGGTTCTATCCCTTCAGAACTAGGAAATCTGAAGTCACTGGTCAAACTATACCTTCACCAGAA
>augustus_masked-Fvb5-2-processed-gene-150.9:3461:3581:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_8::augustus_masked-Fvb5-2-processed-gene-150.9:3461-3581||RAPiDGENOMICS_rs1205_03081
CTTGAGAAACATAGAAATGTTATACCTTCGTGACAACAAACTTTCTGGCTCCATCCCCAAAGAGTTGGAGAATCTCATGAAGTTGACTGTACCAGAGTTGGATACTAACCAATTTGTTGG
>augustus_masked-Fvb5-2-processed-gene-150.9:3607:3727:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-150.9:3607-3727||RAPiDGENOMICS_rs1205_03082
GCAATATATCTGAAGACTTTGGTGTCTATCCTCAACTTCAGTTTATAGACCTAAGCCACAATAACTTCTATGGTGAAGTGTCACACAGTTGGGGACAATGTCCAAAATTAGGAACTCGAA
>augustus_masked-Fvb5-2-processed-gene-150.9:3843:3963:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-150.9:3843-3963||RAPiDGENOMICS_rs1205_03083
GGTAAGATACCATCAGGGATGAGCAGTATGGAGAGCCTTGAGGAACTGCATCTTCAACACAATAAACTTTCCGGTCTCATTCCAACATATTTCGATAAAATGCTTGGCTTGTTGTACATT
>augustus_masked-Fvb5-2-processed-gene-150.9:3903:4023:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-150.9:3903-4023|2x||RAPiDGENOMICS_rs1205_03084
AATAAACTTTCCGGTCTCATTCCAACATATTTCGATAAAATGCTTGGCTTGTTGTACATTGGCATGTCCTACAATCAGTTGCAGGGTCCTATTCCAAACAACAAAGCATTTCAAGATGCT
>augustus_masked-Fvb5-2-processed-gene-150.9:4078:4198:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-150.9:4078-4198||RAPiDGENOMICS_rs1205_03085
CTCTTTCATTTGCTCTACTGGGAATTGTAATGATTGTTAGATCAATAAAGAAGAAAGAGCAGCAACCACAGCAGCATGATATGCAGGATGGAGAGATCTTTTCCGCACTCAACTTTGATG
>augustus_masked-Fvb5-2-processed-gene-150.9:4198:4318:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-150.9:4198-4318||RAPiDGENOMICS_rs1205_03086
GAAGAATGATGTATGAAGAAATCATAAAAGCAACCAATGGTTTTGACTCCATGCACTGCATTGGTAAGGGAGGATCAGGAAGCGTCTACAAGGCCAAGTTGTCCTCAGGCAGCATAGTTG
>augustus_masked-Fvb5-2-processed-gene-150.9:4318:4438:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_3::augustus_masked-Fvb5-2-processed-gene-150.9:4318-4438||RAPiDGENOMICS_rs1205_03087
TAGTGAAGAAACTCCATTCTATACTTGACAGCAATGGTGAGGAGACGTCAATGAAGGAGTTCCTCAATGAAATGAGAGCACTAGTAGAGATACAACACAGAAATATTGTGAAACTTTTTG
>augustus_masked-Fvb5-2-processed-gene-150.9:4438:4558:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_4::augustus_masked-Fvb5-2-processed-gene-150.9:4438-4558||RAPiDGENOMICS_rs1205_03088
GGTTTTGTTCAAATCCAAGTCACTTGTTTTTGGTCTATGACTACCTAGAAAATGGTAGTTTGGCTTCAATATTGAGCAAAGAATCTGAAGCTCCAAAAATGGAGTGGAGTTCAAGAGTAA
>augustus_masked-Fvb5-2-processed-gene-150.9:4558:4678:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_5::augustus_masked-Fvb5-2-processed-gene-150.9:4558-4678||RAPiDGENOMICS_rs1205_03089
GAGTTGTAAAAGGTGTGGCTCATGCATTGTCATATATGCATCATGATTGCAACCCACCGATTGTACATCGAGACATATCAAGCAACAATATTTTGCTCGATGACGAATATGAGCCTTGTG
>augustus_masked-Fvb5-2-processed-gene-150.9:482:602:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-150.9:482-602||RAPiDGENOMICS_rs1205_03090
CTCTGGTTCACAGTGTCCGCCTTTCGACTTTTCCGGCAAGTACTACGACGTCGTGTCTGGAGATGGCTGTGGGAGGCAAAGCAGCTTCTTTGAAGGGAAAGCAGTGCTCAATCAGAGCGT
>augustus_masked-Fvb5-2-processed-gene-150.9:902:1022:Parent=augustus_masked-Fvb5-2-processed-gene-150.9-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-150.9:902-1022||RAPiDGENOMICS_rs1205_03091
CTGGGGCACAGCTGCACACATAGTCTTCCTCAGTTTCTGCTTTTTGACAAATATTATTGTAACAGCAATGCTGCTGCTCGGTGGTTCTGCTGTTGTAAATGCACTTACCGGAGTGAACAT
>augustus_masked-Fvb5-2-processed-gene-176.7:1020:1140:Parent=augustus_masked-Fvb5-2-processed-gene-176.7-mRNA-1_9::augustus_masked-Fvb5-2-processed-gene-176.7:1020-1140|2x||RAPiDGENOMICS_rs1205_03092
GCTTGCAAAAGCCTGCAGGTTTTAGACTTGAGCTCTAACAAAATCTCTGGTGTGATCCCGGCTGATTTATGTCCTGGAGCTGCTTCACTTCAGGAGCTGAGGATGCCGGATAACCTTATC
>augustus_masked-Fvb5-2-processed-gene-176.7:1200:1320:Parent=augustus_masked-Fvb5-2-processed-gene-176.7-mRNA-1_11::augustus_masked-Fvb5-2-processed-gene-176.7:1200-1320||RAPiDGENOMICS_rs1205_03093
TTGAACTATCTCAACGGTTCGATTCCTGCTGAGCTTGGGAAGCTGGAGAACCTGCAGCAGCTGATAGCATGGTACAATGGCTTGGAGGGGAAAATCCCACCAGACTTGGGAAAGTGCAAG
>augustus_masked-Fvb5-2-processed-gene-176.7:600:720:Parent=augustus_masked-Fvb5-2-processed-gene-176.7-mRNA-1_6::augustus_masked-Fvb5-2-processed-gene-176.7:600-720||RAPiDGENOMICS_rs1205_03094
CAGCTTGATTTCTCAGGAAACCGCATCAATGGTTCTCTTCCTATGTCCTTGTCGAACTGCACTGCTCTCAAAACCATAAACTTTGCATATAATATGCTTTCTGGGGAAATCCCAAGATCT
>augustus_masked-Fvb5-2-processed-gene-18.27:120:240:Parent=augustus_masked-Fvb5-2-processed-gene-18.27-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-18.27:120-240||RAPiDGENOMICS_rs1205_03095
TCTACACTAGCCTCTATACAACCACTCGTCATCAAGCAAATAGGAGATTACAACGTGAAACTGGAGCTCCCAAATGATGAAGTAGAAAAGCTCCAGAAACAGATGAGGGAAGGCGAAGAG
>augustus_masked-Fvb5-2-processed-gene-18.27:180:300:Parent=augustus_masked-Fvb5-2-processed-gene-18.27-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-18.27:180-300|2x||RAPiDGENOMICS_rs1205_03096
CTGGAGCTCCCAAATGATGAAGTAGAAAAGCTCCAGAAACAGATGAGGGAAGGCGAAGAGCTCATATGCAGGTTGTCGAAACTGCGTTGGTGGAATCGTATCAAGTCTCGTTACATAGTT
>augustus_masked-Fvb5-2-processed-gene-18.27:480:600:Parent=augustus_masked-Fvb5-2-processed-gene-18.27-mRNA-1_5::augustus_masked-Fvb5-2-processed-gene-18.27:480-600||RAPiDGENOMICS_rs1205_03097
GGTTTGCAAGAGAAGTTTGTTTTGCAACTGCAAAACAACGGGGAACAGCTGCTTCAATTGCAACGGGTGATAGAGGACATGATGATGCAGCAAGAAGCAAGGGGAGTGACTGATAGCGAA
>augustus_masked-Fvb5-2-processed-gene-18.27:664:784:Parent=augustus_masked-Fvb5-2-processed-gene-18.27-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-18.27:664-784|2x||RAPiDGENOMICS_rs1205_03098
AGCACCTGTTCAAACAGAATGTCACATATAAACCCGTCCTCAGAAATATCAAATCGACACTAGACTCTTTAGGACCAGTGATCGAAGGGATAGAGGAGACCAATCGGTCCTTGAGCTATA
>augustus_masked-Fvb5-2-processed-gene-19.1:1046:1166:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_5::augustus_masked-Fvb5-2-processed-gene-19.1:1046-1166|2x||RAPiDGENOMICS_rs1205_03099
CAATCTTATATACAAGGCCTGGGAACTAGATCATGATGAAGGTTGTAAGCTCTTCAGTTCACATGCTTTCAAGACTAGGAGCGATCATCCAGACGACAATGAGGAGCTCTTAGTTGGTAC
>augustus_masked-Fvb5-2-processed-gene-19.1:1106:1226:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_6::augustus_masked-Fvb5-2-processed-gene-19.1:1106-1226||RAPiDGENOMICS_rs1205_03100
ACATGCTTTCAAGACTAGGAGCGATCATCCAGACGACAATGAGGAGCTCTTAGTTGGTACTGTTGTTAAATATGCGCAAGGCCTTCCATTAGTGCTGCAAGTTTTAGGTTCACATTTATA
>augustus_masked-Fvb5-2-processed-gene-19.1:1166:1286:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_6::augustus_masked-Fvb5-2-processed-gene-19.1:1166-1286|2x||RAPiDGENOMICS_rs1205_03101
TGTTGTTAAATATGCGCAAGGCCTTCCATTAGTGCTGCAAGTTTTAGGTTCACATTTATATAAAAGAGAGTTACATAAATGGCAAGCTATGATAGAAGGTTTTAAAAGAAATCATCCCGA
>augustus_masked-Fvb5-2-processed-gene-19.1:120:240:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-19.1:120-240||RAPiDGENOMICS_rs1205_03102
CATTTGTACAACAGTTTGGTTCAAAGGGGGATCAAGACTTTCATAGATAATGATCTTAGAAGAGGAGAGGAAATATCACAATCACTTCTCCGAGCCATTAAAGAATCAAAGCTCTCTCTC
>augustus_masked-Fvb5-2-processed-gene-19.1:1226:1346:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_7::augustus_masked-Fvb5-2-processed-gene-19.1:1226-1346||RAPiDGENOMICS_rs1205_03103
TAAAAGAGAGTTACATAAATGGCAAGCTATGATAGAAGGTTTTAAAAGAAATCATCCCGAAGGCGTTAAAGATATTCTCAAAGTCAGTTATGATGGATTGGAAAAAACAGAGAGAGAAGT
>augustus_masked-Fvb5-2-processed-gene-19.1:1406:1526:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_8::augustus_masked-Fvb5-2-processed-gene-19.1:1406-1526|2x||RAPiDGENOMICS_rs1205_03104
TGAAGGTTGTAGCCACATCAATCCTAAGCATACTATTGACATTCTTGAAGAAAAGGCACTCATAAATGCTGGTCAAATAACTGGTCGAATAAGGATGCATAATTTGCTAGAAGAGATGGG
>augustus_masked-Fvb5-2-processed-gene-19.1:1466:1586:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_9::augustus_masked-Fvb5-2-processed-gene-19.1:1466-1586||RAPiDGENOMICS_rs1205_03105
CATAAATGCTGGTCAAATAACTGGTCGAATAAGGATGCATAATTTGCTAGAAGAGATGGGAAAACAAATAGTTGATCAAGAGTCAAAGATGCCCGGACAGCGTAGCAGATTATGGTATCA
>augustus_masked-Fvb5-2-processed-gene-19.1:180:300:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-19.1:180-300|2x||RAPiDGENOMICS_rs1205_03106
AGAGGAGAGGAAATATCACAATCACTTCTCCGAGCCATTAAAGAATCAAAGCTCTCTCTCATTGTCTTCTCTGAAAATTACGCATCCTCAAAGTGGTGTTTGGAAGAACTGGTTCACATC
>augustus_masked-Fvb5-2-processed-gene-19.1:1896:2016:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-19.1:1896-2016||RAPiDGENOMICS_rs1205_03107
AGTATGCATAATCTGACATCCTTGAAATTGAGTCGATGCAAATTCCTAACACAAATCCCCGACATGTCTGGAAGCCCAAACTTGGAGTTGCTGGATCTAAGTTTCTGTAGAAGTTTAGAG
>augustus_masked-Fvb5-2-processed-gene-19.1:2016:2136:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_2::augustus_masked-Fvb5-2-processed-gene-19.1:2016-2136||RAPiDGENOMICS_rs1205_03108
GAGGTTCACCCTTCCGTTGGATACCTCGAAAAGCTGGTTAATCTGAATCTTTACGAATGCCATGACCTTGTGAAGCTGCCTCCAAAAGTCAACTGGAGATCCCTCAAAGGACTTCATCTT
>augustus_masked-Fvb5-2-processed-gene-19.1:2136:2256:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_3::augustus_masked-Fvb5-2-processed-gene-19.1:2136-2256||RAPiDGENOMICS_rs1205_03109
TATTGTTGCACTAAGCTGGAGAGTTTCCCTGAAATTGTGGGAGAGATGAAATGCTTGACATCTTTGACTCTATGGTCCACTAGCATCAAAACATTGCCGTCATCCATTCGGTATCTAATC
>augustus_masked-Fvb5-2-processed-gene-19.1:2256:2376:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_4::augustus_masked-Fvb5-2-processed-gene-19.1:2256-2376||RAPiDGENOMICS_rs1205_03110
AACCTTAAACGGTTGTTGTTAGGTCACTGTGGAAACCTCACAGATATACCTCGCAGCATTTATGAACTGCAAAAGTTGAAGGACTTGGAGTTTGTGTGCCCAAAACTCGTAACATTCCCA
>augustus_masked-Fvb5-2-processed-gene-19.1:2376:2496:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_5::augustus_masked-Fvb5-2-processed-gene-19.1:2376-2496||RAPiDGENOMICS_rs1205_03111
GACGACGGTGGTTATTTACGAGGATGCAATTCATCTAAAATTGATTTCCTGTGGCCCACTTTATTTCATCTTGATTTATCCGGATGCCCCTTTGTTACTCTTCCCGAATGCATCGTGGAA
>augustus_masked-Fvb5-2-processed-gene-19.1:2496:2616:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_6::augustus_masked-Fvb5-2-processed-gene-19.1:2496-2616||RAPiDGENOMICS_rs1205_03112
TTTGTCAACTTGTCAAGACTCACTTTGACAGACTGCACGAGGCTCGTTGAAATTCCGGAGCTTCCACCACGGATTACAGAGTTGGATGCGAGTAATTGCGTATCTTTGGAAAGAATTTCA
>augustus_masked-Fvb5-2-processed-gene-19.1:2616:2736:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_7::augustus_masked-Fvb5-2-processed-gene-19.1:2616-2736||RAPiDGENOMICS_rs1205_03113
AAGCTGTCAAACATTTTGGAGCGTAAAGAATCACAGATGATCCAGATTTTGAACTTGACTAATTGCCGGAGACTCTGTCAAAATGTATTGACTGAGATGGCGGCAAGCAAGGAAGATGAT
>augustus_masked-Fvb5-2-processed-gene-19.1:2736:2856:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_8::augustus_masked-Fvb5-2-processed-gene-19.1:2736-2856||RAPiDGENOMICS_rs1205_03114
GATCTCTTTTCTCGGCTCCTATTTTCTCAGCTATCCGAGTTCTCAATTGTATTTCCAGTTCCAAGAAGCAAGATTCCAAAATGGTTCAGCTGTCAAATGGATTTCATGGTGCATCGACGG
>augustus_masked-Fvb5-2-processed-gene-19.1:2856:2976:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_9::augustus_masked-Fvb5-2-processed-gene-19.1:2856-2976||RAPiDGENOMICS_rs1205_03115
TTTGAGTTTTGGATTGAAGCACTCCCAAATTTCAAATGGGACAACACAGGATTGGCTCTCTGTGTTGCTCTTGATGATCGACAACGTCCTTGTTCTTTTGATTTGTGGATACACATCGAT
>augustus_masked-Fvb5-2-processed-gene-19.1:2976:3096:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_10::augustus_masked-Fvb5-2-processed-gene-19.1:2976-3096||RAPiDGENOMICS_rs1205_03116
GAAGTTAGTCTTTCGTATTCACATCGTTGTCTTGGTTCAAGAGAGTCGGATCATGTATGGGTGCGCTACATTCCATTCGCCGAATTGTGGGCAAGTGGTTATATGCGTCCCCTGCCGCCA
>augustus_masked-Fvb5-2-processed-gene-19.1:300:420:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_3::augustus_masked-Fvb5-2-processed-gene-19.1:300-420|2x||RAPiDGENOMICS_rs1205_03117
CTTGAATGTAAAAGATCAAAGAACCAAATGGTTCACCCAATCTTTTACAAAGTGAATCCCTCTGACGTAAGACACCAAAGTGGTACATTTGGTAAGGCACTTGCACCTCTTGAACGCAGA
>augustus_masked-Fvb5-2-processed-gene-19.1:3096:3216:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_11::augustus_masked-Fvb5-2-processed-gene-19.1:3096-3216||RAPiDGENOMICS_rs1205_03118
TCCTTTACCTGTCGAGTCGTCATTCTTCTAAGCAAATTCTCGGGCCCCTTTAAAAGCTGTGGGGTCCACCTTATAATGCCTCCCAATGAAGACATTTGTATGAAGCTAATCCGTGCAGAG
>augustus_masked-Fvb5-2-processed-gene-19.1:360:480:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_4::augustus_masked-Fvb5-2-processed-gene-19.1:360-480||RAPiDGENOMICS_rs1205_03119
TCTGACGTAAGACACCAAAGTGGTACATTTGGTAAGGCACTTGCACCTCTTGAACGCAGATTCAAAGATGACATAGGCAAGGTGTCCAGATGGAGAGCAGCTCTTTTTGAAGCATCAAAT
>augustus_masked-Fvb5-2-processed-gene-19.1:566:686:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-19.1:566-686|2x||RAPiDGENOMICS_rs1205_03120
ACCTACCAAGTTGGGTATGCCAAAGTGGCCAGTTGGGCTAGACTCTCGGGTAGAAGATATGCTTGAAATGTTAGATGTGGGGGAAAGTGGTGTACGCATGGTAGGGATATGGGGAACTAG
>augustus_masked-Fvb5-2-processed-gene-19.1:746:866:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_3::augustus_masked-Fvb5-2-processed-gene-19.1:746-866||RAPiDGENOMICS_rs1205_03121
TGGTTGCTGCTTTTTGGAAAATGTTAGAGAGTGTTCAGAGCAACATAGAGGTTTAGCCAACCTACAGAGAATTATTCTCTCTGACATTATGAGATTGAAAGAATTGGAAATAAACAATGT
>augustus_masked-Fvb5-2-processed-gene-19.1:806:926:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_3::augustus_masked-Fvb5-2-processed-gene-19.1:806-926|2x||RAPiDGENOMICS_rs1205_03122
CCTACAGAGAATTATTCTCTCTGACATTATGAGATTGAAAGAATTGGAAATAAACAATGTTAATGAAGGAATCACTTTGTTGCCTGAAATGTTGAGACATAAAAGGATTCTCTTAGTTCT
>augustus_masked-Fvb5-2-processed-gene-19.1:866:986:Parent=augustus_masked-Fvb5-2-processed-gene-19.1-mRNA-1_4::augustus_masked-Fvb5-2-processed-gene-19.1:866-986||RAPiDGENOMICS_rs1205_03123
TAATGAAGGAATCACTTTGTTGCCTGAAATGTTGAGACATAAAAGGATTCTCTTAGTTCTTGATGATGTGAATAAATCAAACCAGCTAGACACATTAGCCGGAGCTTCAGACTGGTTCGG
>augustus_masked-Fvb5-2-processed-gene-204.3:0:120:Parent=augustus_masked-Fvb5-2-processed-gene-204.3-mRNA-1_1::augustus_masked-Fvb5-2-processed-gene-204.3:0-120||RAPiDGENOMICS_rs1205_03124
ATGGCCAAAATACCTGTTCTCTCCTTCCAATTACTACCACTCTTTACCACATTGTTCATTTCTTTGCTTTTCCCGCCATGTATGCCTCTATCGGTCCAAACTGAAGCCCTCCTTGAGTTG
>augustus_masked-Fvb5-2-processed-gene-204.3:1200:1320:Parent=augustus_masked-Fvb5-2-processed-gene-204.3-mRNA-1_11::augustus_masked-Fvb5-2-processed-gene-204.3:1200-1320||RAPiDGENOMICS_rs1205_03125
ATTCCAGCTGAGTTTTGGTCACTACCTAAAGCTGTAATCATTGATTTTAGTGATAATAACTTTCATGGAGCGATATCTCCCAGCATTGGGTTTTCTACCAGCTTGAATCAGTTGATGTTG
>augustus_masked-Fvb5-2-processed-gene-204.3:1260:1380:Parent=augustus_masked-Fvb5-2-processed-gene-204.3-mRNA-1_11::augustus_masked-Fvb5-2-processed-gene-204.3:1260-1380|2x||RAPiDGENOMICS_rs1205_03126
TTTCATGGAGCGATATCTCCCAGCATTGGGTTTTCTACCAGCTTGAATCAGTTGATGTTGCAGAACAACAATTTCTCAGGTTATCTTCCGGTGGAAATTGGGAAGCTAACAAAGTTGGAA
>augustus_masked-Fvb5-2-processed-gene-204.3:1380:1500:Parent=augustus_masked-Fvb5-2-processed-gene-204.3-mRNA-1_12::augustus_masked-Fvb5-2-processed-gene-204.3:1380-1500|2x||RAPiDGENOMICS_rs1205_03127
AGGCTCTATTTGAATCATAATAACTTCTCAGGTGAAATACCTTCAGAAATTGGTTTCCTGAAGCAGTTATCATCTTTGCATGTTGAAGAAAATTCTTTGTCAGGCTCAATACCTTCAGAA
>augustus_masked-Fvb5-2-processed-gene-204.3:1800:1920:Parent=augustus_masked-Fvb5-2-processed-gene-204.3-mRNA-1_16::augustus_masked-Fvb5-2-processed-gene-204.3:1800-1920||RAPiDGENOMICS_rs1205_03128
ATGAATACATGTTCTGTTAAGCATAGTCAGAAAAGGGTGGTTCAAAATAAATTGGTTTTGTTCTCTATCATAGCATCTGCCTTGGTTGTTGTTTTAGCTGGATTGGTGCTTGTTAGTTAT
>augustus_masked-Fvb5-2-processed-gene-204.3:1920:2040:Parent=augustus_masked-Fvb5-2-processed-gene-204.3-mRNA-1_17::augustus_masked-Fvb5-2-processed-gene-204.3:1920-2040||RAPiDGENOMICS_rs1205_03129
AAGAACTTCAAGCGTTCTGAGGTTGACCGAGAAAGTAGTTTGGAAGAGGGGAAGGAAACAGATCCGAAATGGAAACTTGCATCTTTTCACCAACTGGAAATAGATGCAGATGAAATCTGT
>augustus_masked-Fvb5-2-processed-gene-204.3:2040:2160:Parent=augustus_masked-Fvb5-2-processed-gene-204.3-mRNA-1_18::augustus_masked-Fvb5-2-processed-gene-204.3:2040-2160||RAPiDGENOMICS_rs1205_03130
GATTTGGAAGAAGAAAATTTGGTAGGCAGCGGCAGTACTGGGAAAGTTTACCGCCTTGATCTGAAGAGGAATGGCGGTACGGTAGCTGTAAAACAACTTTGGAAAGGCAATGGCTTGAAG
>augustus_masked-Fvb5-2-processed-gene-204.3:2400:2520:Parent=augustus_masked-Fvb5-2-processed-gene-204.3-mRNA-1_21::augustus_masked-Fvb5-2-processed-gene-204.3:2400-2520||RAPiDGENOMICS_rs1205_03131
TCCCCACCTATAATTCATAGAGATATAAAATCAACAAACATTCTGCTTGATGATGATTACGAGGCAAAAGTTGCTGATTTTGGGGTTGCAAAAATTGTACAAAACACTGACAAGGGTTCA
>augustus_masked-Fvb5-2-processed-gene-204.3:2683:2803:Parent=augustus_masked-Fvb5-2-processed-gene-204.3-mRNA-1_2::augustus_masked-Fvb5-2-p