Citation

Material Information

Title:
Object 3-2. Reference genomes used in building backbone phylogeny.
Series Title:
BATS IN A CHANGING WORLD: WHERE THEY GO, WHAT THEY BRING, AND HOW THEY IMPACT PEOPLE
Creator:
Shapiro, Julie
Language:
English
Physical Description:
Dissertation

Notes

Acquisition:
Collected for University of Florida's Institutional Repository by the UFIR Self-Submittal tool. Submitted by Julie Shapiro.

Record Information

Source Institution:
University of Florida Institutional Repository
Holding Location:
University of Florida
Rights Management:
Copyright Creator/Rights holder. Permission granted to University of Florida to digitize and display this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.

Downloads

This item is only available as the following downloads:


Full Text
>gi|49169782|ref|NC_005831.2| Human Coronavirus NL63, complete genome
CTTAAAGAATTTTTCTATCTATAGATAGAGAATTTTCTTATTTAGACTTTGTGTCTACTCTTCTCAACTA
AACGAAATTTTTCTAGTGCTGTCATTTGTTATGGCAGTCCTAGTGTAATTGAAATTTCGTCAAGTTTGTA
AACTGGTTAGGCAAGTGTTGTATTTTCTGTGTCTAAGCACTGGTGATTCTGTTCACTAGTGCATACATTG
ATATTTAAGTGGTGTTCCGTCACTGCTTATTGTGGAAGCAACGTTCTGTCGTTGTGGAAACCAATAACTG
CTAACCATGTTTTACAATCAAGTGACACTTGCTGTTGCAAGTGATTCGGAAATTTCAGGTTTTGGTTTTG
CCATTCCTTCTGTAGCCGTTCGCACCTATAGCGAAGCCGCTGCACAAGGTTTTCAGGCATGCCGTTTTGT
TGCTTTTGGCTTACAGGATTGTGTAACCGGTATTAATGATGATGATTATGTCATTGCATTGACTGGTACT
AATCAGCTCTGTGCCAAAATTTTACCTTTTTCTGATAGACCCCTTAATTTGCGAGGTTGGCTCATTTTTT
CTAACAGCAATTATGTTCTTCAGGACTTTGATGTTGTTTTTGGCCATGGTGCAGGAAGTGTGGTTTTTGT
GGATAAGTACATGTGTGGTTTTGATGGTAAACCTGTGTTACCTAAAAACATGTGGGAATTTAGGGATTAC
TTTAATAATAATACTGATAGTATTGTTATTGGTGGTGTCACTTATCAACTAGCATGGGATGTTATACGTA
AAGACCTTTCTTATGAACAGCAAAATGTTTTAGCCATTGAGAGCATTCATTACCTTGGTACTACAGGTCA
TACTTTGAAGTCTGGTTGCAAACTTACTAATGCTAAGCCGCCTAAATATTCTTCTAAGGTTGTTTTGAGT
GGTGAATGGAATGCTGTGTATAGGGCGTTTGGTTCACCATTTATTACAAATGGTATGTCATTGCTAGATA
TAATTGTTAAACCAGTTTTCTTTAATGCTTTTGTTAAATGCAATTGTGGTTCTGAGAGTTGGAGTGTTGG
TGCATGGGATGGTTACTTATCTTCTTGTTGTGGCACACCTGCTAAGAAACTTTGTGTTGTTCCTGGTAAT
GTCGTTCCTGGTGATGTGATCATCACCTCAACTAGTGCTGGTTGTGGTGTTAAATACTATGCTGGCTTAG
TTGTTAAACATATTACTAACATTACTGGTGTGTCTTTATGGCGTGTTACAGCTGTTCATTCTGATGGAAT
GTTTGTGGCATCATCTTCTTATGATGCACTCTTGCATAGAAATTCATTAGACCCTTTTTGCTTTGATGTT
AACACTTTACTTTCTAATCAATTACGTCTAGCTTTTCTTGGTGCTTCTGTTACAGAAGATGTTAAATTTG
CTGCTAGCACTGGTGTTATTGACATTAGTGCTGGTATGTTTGGTCTTTACGATGACATATTGACAAACAA
TAAACCTTGGTTTGTACGCAAAGCTTCTGGGCTTTTTGATGCAATCTGGGATGCTTTTGTTGCCGCTATT
AAGCTTGTACCAACTACTACTGGTGTTTTGGTTAGGTTTGTTAAGTCTATTGCTTCAACTGTTTTAACTG
TCTCTAATGGTGTTATTATTATGTGTGCAGATGTTCCAGATGCTTTTCAATCAGTTTATCGCACATTTAC
ACAAGCTATTTGTGCTGCATTTGATTTTTCTTTAGATGTATTTAAAATTGGTGATGTTAAATTTAAACGA
CTTGGTGATTATGTTCTTACTGAAAACGCTCTTGTTCGTTTGACTACTGAAGTTGTTCGTGGTGTTCGTG
ATGCTCGCATAAAGAAAGCCATGTTTACTAAAGTAGTTGTAGGTCCTACAACTGAAGTTAAGTTTTCTGT
TATTGAACTTGCCACTGTTAATTTGCGTCTTGTTGATTGTGCACCTGTAGTTTGCCCTAAAGGTAAGATT
GTTGTTATTGCTGGACAAGCTTTTTTCTATAGTGGTGGTTTTTATCGTTTTATGGTTGATCCTACAACTG
TATTAAATGATCCTGTTTTTACTGGTGATTTATTCTACACTATTAAGTTTAGTGGTTTTAAGCTTGATGG
TTTTAACCATCAGTTTGTTACTGCTAGTTCTGCTACAGATGCCATTATTGCTGTTGAGCTGTTGTTATTG
GATTTTAAAACTGCAGTTTTTGTGTACACATGTGTGGTTGATGGCTGTAGTGTCATTGTTAGACGTGATG
CTACATTCGCTACACATGTGTGTTTTAAGGACTGTTATAATGTTTGGGAGCAATTCTGCATTGATAATTG
TGGTGAGCCATGGTTTTTGACTGATTATAATGCTATCTTGCAGAGTAATAACCCTCAATGTGCTATTGTT
CAAGCATCAGAGTCTAAAGTTTTGCTTGAGAGGTTTTTACCTAAGTGTCCTGAAATACTGTTGAGTATTG
ATGATGGCCATTTATGGAATCTTTTTGTTGAAAAGTTTAATTTTGTTACAGATTGGTTAAAAACTCTTAA
GCTTACACTTACTTCTAATGGTCTTTTAGGTAATTGTGCCAAACGTTTTAGACGTGTTTTGGTAAAATTG
CTTGATGTCTATAATGGTTTTCTTGAAACTGTCTGTAGTGTCGCATACACTGCTGGTGTTTGCATCAAAT
ATTATGCTGTTAATGTTCCATATGTAGTTATTAGTGGTTTTGTAAGTCGTGTAATTCGTAGAGAAAGGTG
TGACATGACTTTTCCTTGTGTTAGTTGTGTCACCTTTTTCTATGAATTTTTAGACACTTGTTTTGGTGTT
AGTAAACCTAATGCCATTGATGTTGAACATTTAGAGCTTAAAGAAACTGTTTTTGTTGAACCTAAGGATG
GTGGTCAATTTTTTGTTTCTGGTGATTATCTTTGGTATGTTGTAGATGACATTTATTATCCAGCTTCATG
TAATGGTGTATTGCCTGTTGCTTTTACAAAATTAGCTGGTGGTAAAATATCTTTTTCTGATGATGTTATA
GTTCATGATGTTGAACCTACCCATAAAGTCAAGCTCATATTTGAGTTTGAAGATGATGTTGTTACCAGTC
TTTGTAAGAAGAGTTTTGGTAAGTCCATTATTTATACAGGTGATTGGGAAGGTCTACATGAAGTTCTTAC
ATCTGCAATGAATGTCATTGGGCAACATATTAAGTTGCCACAATTTTATATTTATGATGAAGAGGGTGGT
TATGATGTTTCTAAACCAGTTATGATTTCACAATGGCCTATTAGTAATGATAGTAATGGTTGTGTTGTTG
AAGCGAGCACTGATTTTCATCAATTAGAATGTATTGTTGATGACTCTGTTAGAGAAGAGGTTGATATAAT
TGAACAACCTTTTGAAGAAGTTGAACATGTGCTCTCAATTAAGCAACCTTTTTCTTTTTCTTTTAGAGAT
GAATTGGGTGTTCGTGTTTTAGATCAATCTGATAATAATTGTTGGATTAGTACCACACTTGTACAGTTGC
AACTTACAAAGCTTTTGGATGATTCTATTGAGATGCAATTGTTTAAAGTTGGTAAAGTTGATTCAATTGT
CCAAAAGTGTTATGAGTTGTCTCATTTAATTAGTGGTTCACTTGGTGATAGTGGTAAACTTCTTAGTGAA
CTTCTTAAAGAAAAATATACATGTTCTATAACTTTTGAGATGTCTTGTGATTGTGGTAAAAAGTTTGATG
ATCAGGTTGGTTGTTTGTTTTGGATTATGCCTTACACAAAACTTTTTCAAAAAGGTGAGTGTTGTATTTG
TCATAAAATGCAGACTTATAAGCTTGTTAGTATGAAAGGTACTGGTGTGTTTGTACAGGATCCAGCACCT
ATTGACATTGATGCTTTCCCTGTGAAACCTATATGTTCATCTGTATATTTAGGTGTTAAGGGTTCTGGTC
ATTATCAAACAAATTTATACAGTTTTAACAAAGCTATTGATGGTTTTGGTGTCTTTGACATTAAAAATAG
TAGTGTTAATACTGTTTGTTTTGTTGATGTTGATTTTCATAGTGTAGAAATAGAAGCTGGTGAAGTTAAA
CCTTTTGCTGTATATAAAAATGTTAAATTTTATTTAGGTGATATTTCACACCTTGTAAACTGTGTTTCTT
TTGACTTTGTTGTCAATGCTGCTAATGAAAATCTCTTGCATGGAGGCGGTGTTGCACGTGCTATTGATAT
TTTGACTGAAGGTCAACTTCAGTCATTATCTAAAGATTACATTAGTAGTAATGGTCCACTTAAGGTTGGA
GCAGGTGTTATGTTGGAGTGTGAAAAATTCAACGTATTTAATGTTGTTGGTCCGCGAACTGGTAAACATG
AGCATTCATTACTTGTTGAAGCTTATAATTCTATTTTATTTGAAAATGGTATTCCACTTATGCCTCTTCT
TAGTTGTGGTATTTTTGGTGTAAGGATTGAAAATTCTCTTAAAGCTTTGTTTAGTTGTGACATTAATAAA
CCATTGCAAGTTTTTGTTTATTCTTCAAATGAAGAACAAGCTGTTCTTAAGTTTTTAGATGGTTTAGATT
TAACACCAGTCATTGATGATGTTGATGTTGTTAAACCTTTTAGAGTTGAAGGTAATTTTTCATTCTTTGA
TTGTGGTGTCAATGCCTTGGATGGTGATATTTACTTATTATTTACTAACTCTATTTTAATGTTGGATAAA
CAAGGACAATTATTGGACACAAAACTTAATGGTATTTTGCAACAGGCAGCTCTTGATTATCTTGCTACAG
TTAAAACTGTACCAGCTGGTAATTTGGTTAAACTTTTTGTTGAGAGTTGTACCATTTATATGTGTGTTGT
ACCATCGATAAATGATCTTTCTTTTGATAAAAATCTTGGTCGTTGTGTGCGTAAACTTAATAGATTGAAA
ACTTGTGTTATTGCCAATGTTCCTGCTATTGATGTTTTGAAAAAGCTTCTTTCAAGTTTGACTTTAACTG
TTAAATTTGTTGTAGAGAGTAATGTTATGGATGTTAACGACTGTTTTAAGAATGATAATGTAGTTTTGAA
AATTACTGAAGATGGTATTAATGTTAAAGATGTTGTTGTTGAGTCTTCTAAGTCACTTGGTAAACAATTG
GGTGTTGTGAGTGATGGTGTTGACTCTTTTGAAGGTGTTTTACCTATTAATACTGATACTGTCTTATCTG
TAGCTCCAGAAGTTGACTGGGTTGCTTTTTACGGTTTTGAAAAGGCAGCACTTTTTGCTTCTTTGGATGT
AAAGCCATATGGTTACCCTAATGATTTTGTTGGTGGTTTTAGAGTTCTTGGGACCACCGACAATAATTGT
TGGGTTAATGCAACTTGTATAATTTTACAGTATCTTAAGCCTACTTTTAAATCTAAGGGTTTAAATGTTC
TTTGGAACAAATTTGTTACAGGTGATGTTGGACCTTTTGTTAGTTTTATTTATTTTATAACTATGTCTTC
AAAGGGTCAAAAGGGTGATGCTGAAGAGGCATTATCTAAATTGTCAGAGTATTTGATTAGTGATTCTATT
GTTACTCTTGAACAATATTCAACTTGTGACATTTGTAAAAGTACTGTAGTTGAAGTTAAAAGTGCTATTG
TCTGTGCTAGTGTGCTTAAAGATGGTTGTGATGTTGGTTTTTGTCCACACAGACATAAATTGCGTTCACG
TGTTAAGTTTGTTAATGGACGTGTTGTTATTACCAATGTTGGTGAACCTATAATTTCACAACCTTCTAAG
TTGCTTAATGGTATTGCTTATACAACATTTTCAGGTTCTTTTGATAACGGTCACTATGTAGTTTATGATG
CTGCTAATAATGCTGTCTATGATGGTGCTCGTTTATTTTCTTCAGATTTGTCTACTTTAGCTGTTACAGC
TATTGTTGTAGTAGGTGGTTGTGTAACATCTAATGTTCCAACAATTGTTAGTGAGAAAATTTCTGTTATG
GATAAACTTGATACTGGTGCACAAAAATTTTTCCAATTTGGTGATTTTGTTATGAATAACATTGTTCTGT
TTTTAACTTGGTTGCTTAGTATGTTTAGTCTTTTACGTACTTCTATTATGAAGCATGATATTAAAGTTAT
TGCCAAGGCTCCTAAACGTACAGGTGTTATTTTGACACGTAGTTTTAAGTATAACATTAGATCTGCTTTG
TTTGTTATAAAGCAGAAGTGGTGTGTTATTGTTACTTTGTTTAAGTTCTTATTATTATTATATGCTATTT
ATGCACTTGTTTTTATGATTGTGCAATTTAGTCCTTTTAATAGTCTTTTATGTGGTGACATTGTAAGTGG
TTATGAAAAATCCACTTTTAATAAGGATATTTATTGTGGTAATTCTATGGTTTGTAAGATGTGTTTGTTC
AGTTATCAAGAGTTTAATGATTTGGATCATACTAGTCTTGTTTGGAAGCACATTCGTGATCCTATATTAA
TCAGTTTACAACCATTTGTTATACTTGTTATTTTGTTAATTTTTGGTAATATGTATTTGCGTTTTGGACT
TTTATATTTTGTTGCACAATTTATTAGTACTTTTGGTTCTTTCTTAGGCTTTCATCAGAAACAGTGGTTT
TTACATTTTGTGCCGTTTGATGTTTTATGTAATGAGTTTTTAGCTACATTTATTGTCTGCAAAATCGTTT
TATTTGTTAGACATATTATTGTTGGCTGTAATAATGCTGACTGTGTAGCTTGTTCTAAAAGTGCTAGACT
TAAACGTGTACCACTTCAAACTATTATTAATGGTATGCATAAATCATTCTATGTTAATGCTAATGGTGGT
ACTTGTTTCTGTAATAAACATAACTTCTTTTGTGTTAATTGTGATTCTTTTGGGCCTGGTAATACTTTTA
TTAATGGTGATATTGCAAGAGAGCTTGGTAATGTTGTTAAAACAGCTGTTCAACCCACAGCTCCTGCATA
TGTTATTATTGATAAGGTAGATTTTGTTAATGGATTTTATCGTCTTTATAGTGGTGACACTTTTTGGCGG
TATGACTTTGACATTACTGAATCTAAGTATAGTTGTAAAGAGGTTCTGAAGAATTGTAATGTTTTAGAAA
ATTTTATTGTTTACAATAATAGTGGTAGTAACATTACACAGATTAAAAATGCTTGTGTTTATTTTTCTCA
ATTGTTGTGTGAACCTATAAAGTTGGTAAATTCAGAGTTGTTGTCAACTTTATCTGTTGATTTTAATGGT
GTTTTGCATAAGGCATATGTTGATGTTTTGTGTAATAGTTTTTTTAAGGAGTTAACTGCTAACATGTCCA
TGGCTGAATGTAAAGCTACACTTGGTTTGACTGTTTCTGATGATGATTTTGTTTCAGCTGTTGCCAATGC
ACATAGGTATGACGTTTTGCTTTCAGATTTGTCATTTAATAATTTTTTTATTTCTTATGCTAAACCTGAA
GATAAGTTGTCCGTTTATGACATTGCTTGTTGTATGCGTGCCGGTTCTAAGGTTGTTAACCATAATGTTT
TAATTAAAGAGTCAATACCTATTGTTTGGGGTGTCAAGGACTTTAATACTCTTTCTCAAGAAGGTAAGAA
GTACCTTGTTAAAACAACTAAAGCAAAGGGTTTGACTTTTTTATTAACTTTTAATGATAACCAAGCAATT
ACACAAGTTCCTGCTACTAGTATAGTTGCAAAACAGGGTGCTGGTTTTAAACGTACTTATAATTTTCTGT
GGTATGTATGTTTATTTGTTGTTGCATTGTTTATTGGTGTCTCATTTATTGATTATACAACCACTGTAAC
TAGCTTTCATGGTTATGATTTTAAGTACATTGAGAATGGTCAGTTGAAGGTGTTTGAAGCACCTTTACAC
TGTGTTCGTAATGTTTTTGATAATTTTAATCAATGGCATGAGGCTAAGTTTGGTGTTGTTACTACTAATA
GTGATAAATGTCCTATAGTTGTTGGTGTTTCAGAGCGTATTAATGTTGTTCCTGGTGTTCCAACAAATGT
ATATTTGGTAGGAAAGACTCTTGTTTTTACATTACAGGCTGCTTTTGGAAACACAGGTGTTTGTTATGAC
TTTGATGGTGTTACCACTAGTGATAAGTGTATTTTTAATTCTGCTTGTACTAGGTTGGAAGGTTTGGGTG
GTGACAATGTTTATTGTTACAACACTGATCTTATTGAAGGTTCTAAACCTTATAGTACTTTACAGCCCAA
TGCGTATTATAAGTATGATGCTAAAAATTATGTACGTTTTCCAGAAATTTTAGCTAGAGGTTTTGGCTTA
CGTACTATTAGAACTTTGGCTACACGTTATTGTAGAGTTGGTGAATGCCGTGACTCACATAAAGGTGTTT
GTTTTGGTTTTGATAAATGGTATGTTAATGATGGACGTGTTGATGACGGTTACATTTGTGGTGATGGTCT
TATAGACCTTCTTGTTAATGTACTCTCAATCTTTAGTTCATCTTTTAGCGTTGTGGCTATGTCTGGACAT
ATGTTGTTTAATTTTCTTTTTGCAGCATTTATTACATTTTTGTGCTTTTTAGTTACTAAATTTAAACGTG
TTTTTGGTGATCTTTCTTATGGTGTTTTTACTGTTGTTTGTGCAACTTTGATTAATAACATTTCTTATGT
TGTTACTCAAAATTTATTTTTTATGTTGCTTTATGCTATTTTGTATTTTGTTTTTACTAGGACAGTGCGT
TATGCTTGGATTTGGCATATTGCATACATTGTTGCATACTTCTTGTTAATACCATGGTGGCTTCTCACAT
GGTTTAGTTTTGCTGCATTTTTAGAGCTTTTACCTAATGTTTTTAAGTTAAAAATCTCTACTCAATTGTT
TGAAGGTGATAAGTTTATAGGTACTTTTGAGAGTGCTGCTGCAGGTACATTTGTTCTTGACATGCGTTCT
TATGAAAGGCTGATAAATACTATTTCACCTGAGAAACTTAAGAATTATGCTGCAAGTTATAATAAATATA
AATATTATAGTGGTAGTGCTAGTGAGGCTGATTATCGTTGTGCTTGTTATGCTCATTTAGCCAAGGCTAT
GTTAGATTATGCAAAAGATCATAATGACATGTTATATTCTCCACCTACTATTAGCTACAATTCCACCTTA
CAATCTGGTCTTAAGAAGATGGCACAACCATCTGGTTGTGTTGAGAGATGTGTGGTTCGCGTCTGTTATG
GTAGTACTGTGCTTAATGGAGTTTGGTTAGGTGACACTGTTACTTGTCCTAGACATGTCATAGCACCATC
AACCACTGTTCTTATTGATTATGATCATGCATATAGTACTATGCGTTTGCATAATTTTTCAGTGTCTCAT
AATGGTGTCTTCTTGGGAGTTGTCGGTGTTACAATGCATGGTTCTGTGTTGCGTATTAAGGTTTCACAAT
CTAATGTACATACACCTAAACATGTTTTTAAAACGTTGAAACCTGGTGATTCTTTTAATATTTTAGCATG
TTATGAAGGTATTGCATCTGGTGTTTTTGGTGTTAATTTACGTACAAACTTTACTATTAAAGGTTCTTTT
ATAAATGGAGCTTGTGGTTCTCCTGGTTATAATGTTAGAAATGATGGTACTGTTGAGTTTTGTTATTTAC
ACCAAATTGAGTTAGGTAGTGGTGCTCATGTTGGTTCTGATTTTACTGGTAGTGTTTATGGTAATTTTGA
TGACCAACCTAGTTTGCAAGTTGAGAGTGCCAACCTTATGCTATCAGATAATGTTGTTGCCTTTTTGTAT
GCTGCTTTGTTGAATGGTTGTAGGTGGTGGTTGTGTTCAACTAGAGTTAATGTTGATGGTTTTAATGAAT
GGGCTATGGCTAATGGTTATACAAGTGTTTCTAGTGTTGAGTGCTATTCTATTTTGGCAGCAAAAACTGG
TGTTAGTGTTGAACAATTGTTAGCTTCCATTCAACATCTTCATGAAGGTTTTGGTGGTAAAAACATACTT
GGTTATTCTAGTTTATGTGATGAGTTCACACTAGCTGAAGTTGTGAAGCAGATGTATGGTGTTAACTTGC
AAAGTGGTAAGGTTATTTTTGGTTTAAAAACAATGTTTTTATTTAGCGTTTTCTTCACAATGTTTTGGGC
AGAACTCTTTATTTATACAAACACTATATGGATAAACCCTGTGATACTTACACCTATATTTTGTCTACTT
TTGTTTTTGTCATTAGTTTTAACTATGTTTCTTAAACATAAGTTTTTGTTTTTGCAAGTATTTTTATTAC
CTACTGTTATTGCAACTGCTTTATATAATTGTGTTTTGGATTATTACATAGTAAAATTTTTGGCTGACCA
TTTTAACTATAATGTTTCAGTATTACAAATGGATGTTCAGGGTTTAGTTAATGTTTTGGTCTGTTTATTT
GTTGTATTTTTACACACATGGCGCTTTTCTAAAGAACGTTTTACACATTGGTTTACATATGTGTGTTCTC
TTATAGCAGTTGCTTACACTTATTTTTATAGTGGTGACTTTTTGAGTTTGCTTGTTATGTTTTTATGTGC
TATATCTAGTGATTGGTACATTGGTGCCATTGTTTTTAGGTTGTCACGTTTGATTGTATTTTTTTCACCT
GAAAGTGTATTTAGTGTTTTTGGTGATGTGAAACTTACTTTAGTTGTTTATTTAATTTGTGGTTATTTAG
TTTGTACTTATTGGGGCATTTTGTATTGGTTCAATAGGTTTTTTAAATGTACTATGGGTGTTTATGATTT
TAAGGTGAGTGCTGCTGAATTTAAATACATGGTTGCTAATGGACTTCATGCACCACATGGACCTTTTGAT
GCACTTTGGTTATCATTCAAACTACTTGGTATTGGTGGTGACCGTTGTATAAAAATTTCAACTGTCCAAT
CCAAACTGACTGATTTGAAGTGTACTAATGTTGTGTTATTGGGTTGTTTGTCTAGTATGAACATTGCAGC
TAATTCTAGTGAATGGGCTTATTGTGTTGATTTACACAATAAGATTAATCTTTGTGATGACCCTGAAAAA
GCTCAAAGTATGTTGTTAGCACTCCTTGCGTTCTTTCTAAGTAAACATAGTGATTTTGGTCTTGATGGCC
TTATTGATTCTTATTTTGATAATAGTAGCACCCTTCAGAGTGTTGCTTCATCATTTGTTAGTATGCCATC
ATATATTGCTTATGAAAATGCTAGACAAGCTTATGAGGATGCTATTGCTAATGGATCTTCTTCTCAACTT
ATTAAACAATTGAAGCGTGCCATGAATATCGCAAAGTCTGAATTTGATCATGAGATATCTGTTCAGAAGA
AAATTAATAGAATGGCTGAACAAGCTGCTACTCAGATGTATAAAGAAGCACGCTCTGTTAATAGAAAATC
TAAAGTTATTAGTGCTATGCACTCTTTACTTTTTGGAATGTTAAGACGTTTGGATATGTCTAGTGTTGAA
ACTGTTTTGAATTTAGCACGTGATGGTGTTGTGCCATTGTCAGTTATACCTGCAACTTCAGCTTCTAAAC
TAACTATTGTTAGTCCAGATCTTGAATCTTATTCTAAGATTGTTTGTGATGGTTCTGTTCATTATGCTGG
AGTTGTTTGGACACTTAATGATGTTAAAGACAATGATGGTAGACCTGTTCATGTTAAAGAGATTACAAAG
GAAAATGTTGAAACTTTGACATGGCCTCTTATCCTTAATTGTGAACGTGTTGTTAAACTTCAAAATAATG
AAATTATGCCTGGTAAACTTAAGCAAAAACCTATGAAAGCTGAGGGTGATGGTGGTGTTTTAGGTGATGG
TAATGCCTTGTATAATACTGAGGGTGGTAAAACTTTTATGTACGCTTATATTTCTAATAAAGCTGACCTT
AAATTTGTTAAGTGGGAGTATGAGGGTGGTTGCAACACAATCGAGTTAGACTCTCCTTGTCGATTTATGG
TCGAAACACCTAATGGTCCTCAAGTGAAGTATTTGTATTTTGTTAAAAATTTAAATACCTTACGTAGAGG
TGCCGTTCTTGGTTTTATAGGTGCCACAATTCGTCTACAAGCTGGTAAACAAACTGAATTGGCTGTTAAT
TCTGGACTTTTAACTGCTTGTGCTTTTTCTGTTGATCCAGCAACTACTTACTTGGAAGCTGTTAAACATG
GTGCAAAACCTGTAAGTAATTGTATTAAGATGTTATCTAATGGTGCTGGTAATGGTCAAGCTATAACAAC
TAGTGTAGATGCTAACACCAATCAAGATTCTTATGGTGGAGCGTCTATTTGTTTGTATTGTCGGGCCCAC
GTTCCTCACCCTAGTATGGATGGTTACTGTAAGTTTAAGGGTAAATGTGTTCAGGTTCCTATTGGTTGTT
TGGATCCTATTAGGTTTTGTTTAGAAAATAATGTGTGTAATGTTTGTGGTTGTTGGTTGGGACACGGGTG
TGCTTGTGACCGTACAACTATTCAAAGTGTTGACATTTCTTATTTAAACGAGCAAGGGGTTCTAGTGCAG
CTCGACTAGAACCCTGCAATGGCACGGACATCGATAAGTGTGTTCGTGCTTTTGACATTTATAATAAAAA
TGTTTCATTCTTGGGTAAGTGTTTGAAGATGAACTGTGTTCGTTTTAAAAATGCTGATCTTAAGGATGGT
TATTTTGTTATAAAGAGGTGTACTAAGTCGGTTATGGAACACGAGCAATCCATGTATAACCTACTTAACT
TTTCTGGTGCTTTGGCTGAGCATGATTTCTTTACTTGGAAAGATGGCAGAGTCATTTATGGTAATGTTAG
TAGACATAATCTTACTAAATATACTATGATGGACTTGGTCTATGCTATGCGTAACTTTGATGAACAAAAT
TGTGATGTTCTAAAAGAAGTATTAGTTTTAACTGGTTGTTGTGACAATTCTTATTTTGATAGTAAGGGTT
GGTATGACCCAGTTGAAAATGAAGATATACATAGAGTTTATGCATCTCTTGGCAAAATTGTAGCTAGAGC
TATGCTTAAATGCGTTGCTCTATGCGATGCGATGGTTGCTAAAGGTGTTGTTGGTGTTTTAACATTAGAT
AACCAAGATCTTAATGGTAACTTTTATGATTTTGGTGATTTTGTTGTTAGCTTACCTAATATGGGTGTTC
CCTGTTGTACATCATATTATTCTTATATGATGCCTATTATGGGTTTAACTAATTGTTTAGCTAGTGAGTG
TTTTGTCAAGAGTGATATTTTTGGTAGTGATTTTAAAACTTTTGATTTGCTTAAGTATGATTTCACTGAA
CATAAAGAAAATTTATTCAATAAGTACTTTAAGCATTGGAGTTTTGATTATCATCCTAATTGTAGTGACT
GTTATGATGATATGTGTGTTATACATTGTGCTAATTTTAATACACTATTTGCCACAACTATACCAGGTAC
TGCTTTTGGTCCACTATGTCGTAAAGTTTTTATAGATGGTGTTCCACTTGTTACAACTGCTGGTTATCAT
TTTAAGCAATTAGGTTTGGTTTGGAATAAAGATGTTAACACACACTCAGTTAGGTTGACAATTACTGAAC
TTTTGCAATTTGTCACCGACCCTTCCTTGATAATAGCTTCTTCCCCAGCACTCGTTGATCAACGCACTAT
TTGTTTTTCTGTTGCAGCATTGAGTACTGGTTTGACAAATCAAGTTGTTAAGCCAGGTCATTTTAATGAA
GAGTTTTATAACTTTCTTCGTTTAAGAGGTTTCTTTGATGAAGGTTCTGAACTTACATTAAAACATTTCT
TCTTCGCACAGAATGGTGATGCTGCTGTTAAAGATTTTGACTTTTACCGTTATAATAAGCCTACCATTTT
AGATATTTGTCAAGCTAGAGTTACATATAAGATAGTCTCTCGTTATTTTGACATTTATGAAGGTGGCTGT
ATTAAGGCATGTGAAGTTGTTGTAACAAATCTTAATAAGAGTGCTGGTTGGCCATTAAATAAGTTTGGTA
AAGCTAGTTTGTATTATGAATCTATATCTTATGAAGAACAGGATGCTTTGTTTGCTTTGACAAAGCGTAA
TGTCCTCCCTACTATGACACAGCTGAATCTTAAGTATGCTATTAGTGGTAAAGAACGTGCTAGAACTGTT
GGTGGTGTTTCTCTGTTGTCTACAATGACCACAAGACAATACCATCAAAAACATCTTAAATCCATTGTTA
ATACACGCAATGCCACTGTTGTTATTGGTACTACCAAATTTTATGGTGGTTGGAATAATATGTTGCGTAC
TTTAATTGATGGTGTTGAAAACCCTATGCTTATGGGTTGGGATTATCCCAAATGTGATAGAGCTTTGCCT
AACATGATACGTATGATTTCAGCCATGGTGTTGGGCTCTAAGCATGTTAATTGTTGTACTGCAACAGATA
GGTTTTATAGGCTTGGTAATGAGTTGGCACAAGTTTTAACAGAAGTTGTTTATTCTAATGGTGGTTTTTA
TTTTAAGCCAGGTGGTACGACTTCTGGTGACGCTAGTACAGCTTATGCTAATTCTATTTTTAACATTTTT
CAAGCCGTGAGTTCTAACATTAACAGGTTGCTTAGTGTCCCATCAGATTCATGTAATAATGTTAATGTTA
GGGATCTACAACGACGTCTGTATGATAATTGTTATAGGTTAACTAGTGTTGAAGAGTCATTCATTGATGA
TTATTATGGTTATCTTAGGAAACATTTTTCAATGATGATTCTCTCTGATGACGGTGTTGTCTGTTATAAC
AAGGATTATGCTGAGTTAGGTTATATAGCAGACATTAGTGCTTTTAAAGCCACTTTGTATTACCAGAATA
ATGTCTTTATGAGTACTTCTAAATGTTGGGTTGAAGAAGATTTAACTAAGGGACCACATGAGTTTTGTTC
CCAGCATACTATGCAAATAGTTGACAAAGATGGTACCTATTATTTGCCTTACCCAGATCCTAGTAGGATC
TTGTCAGCTGGTGTTTTTGTTGATGATGTTGTTAAGACAGATGCTGTTGTTTTGTTAGAACGTTATGTGT
CTTTAGCTATTGATGCATACCCTCTTTCAAAACACCCTAATTCCGAATATCGTAAGGTTTTTTACGTATT
ACTTGATTGGGTTAAGCATCTTAACAAAAATTTGAATGAGGGTGTTCTTGAATCTTTTTCTGTTACACTT
CTTGATAATCAAGAAGATAAGTTTTGGTGTGAAGATTTTTATGCTAGTATGTATGAAAATTCTACAATAT
TGCAAGCTGCTGGTTTATGTGTTGTTTGTGGTTCACAAACTGTACTTCGTTGTGGTGATTGTCTGCGTAA
GCCTATGTTGTGCACTAAATGCGCATATGATCATGTATTTGGTACCGACCACAAGTTTATTTTGGCTATA
ACACCGTATGTATGTAATGCATCAGGTTGTGGTGTTAGTGATGTCAAAAAATTGTATCTTGGTGGTTTGA
ATTACTATTGTACAAATCATAAACCACAGTTGTCTTTTCCATTATGTTCAGCTGGTAATATATTTGGTTT
ATATAAAAATTCAGCAACTGGTTCCTTAGATGTTGAAGTTTTTAATAGGCTTGCAACGTCTGATTGGACT
GATGTTAGGGACTATAAACTTGCTAATGATGTTAAAGATACACTTAGACTCTTTGCGGCTGAAACTATTA
AAGCTAAAGAAGAGAGTGTTAAGTCTTCTTATGCTTTTGCAACTCTTAAAGAGGTTGTTGGACCTAAAGA
ATTGCTTCTTAGTTGGGAAAGTGGTAAAGTTAAACCACCTTTGAATCGTAATTCTGTTTTCACTTGTTTT
CAAATAAGTAAGGACTCAAAATTCCAAATAGGTGAGTTCATCTTTGAGAAGGTTGAATATGGTTCTGATA
CTGTTACGTATAAGTCTACTGTAACTACTAAGTTAGTTCCTGGTATGATTTTTGTCTTAACATCTCACAA
TGTCCAACCTTTACGTGCACCAACTATTGCAAACCAAGAGAAGTATTCTAGCATTTATAAATTGCACCCT
GCTTTTAATGTCAGTGATGCATATGCTAATTTGGTTCCATATTACCAACTTATTGGTAAACAAAAGATAA
CTACAATACAGGGTCCTCCTGGTAGTGGTAAGTCACATTGTTCCATTGGACTTGGATTGTACTACCCAGG
TGCGCGTATTGTTTTTGTTGCTTGTGCCCATGCTGCTGTTGATTCCTTATGTGCAAAAGCTATGACTGTT
TATAGCATTGATAAGTGTACTAGGATTATACCTGCAAGAGCTCGGGTTGAGTGTTATAGTGGCTTTAAAC
CAAATAACACTAGTGCACAATACATATTTAGCACTGTTAACGCATTACCTGAGTGTAATGCTGATATCGT
TGTTGTAGATGAAGTTTCAATGTGTACAAATTATGACCTTTCTGTTATTAACCAGCGTTTATCATATAAA
CATATTGTTTATGTTGGTGATCCACAACAACTTCCTGCACCTAGAGTAATGATTACTAAAGGTGTTATGG
AGCCTGTTGATTATAACGTTGTTACTCAACGTATGTGTGCTATAGGCCCTGATGTTTTTCTTCATAAATG
TTATAGATGTCCTGCTGAAATAGTTAATACAGTTTCTGAACTTGTTTATGAGAACAAGTTTGTCCCTGTT
AAACCTGCTAGTAAACAGTGTTTTAAAGTCTTTTTTAAGGGTAATGTACAGGTTGACAATGGTTCTAGTA
TTAACAGAAAGCAGCTTGAAATAGTTAAGCTGTTTTTAGTTAAAAATCCAAGTTGGAGTAAGGCTGTGTT
TATTTCTCCTTATAATAGTCAGAATTATGTTGCTAGTAGATTTTTAGGACTTCAAATTCAAACTGTTGAT
TCTTCTCAAGGTAGTGAGTATGATTATGTAATCTATGCACAAACTTCTGACACTGCACATGCTTGCAATG
TAAACCGTTTTAATGTTGCTATAACACGTGCTAAGAAGGGTATATTTTGTGTAATGTGTGATAAAACTTT
GTTTGATTCACTTAAGTTTTTTGAGATTAAACATGCAGATTTACACTCTAGCCAGGTTTGTGGCTTGTTT
AAAAATTGTACACGCACTCCTCTTAATTTACCACCAACTCATGCACACACTTTCTTGTCGTTGTCAGATC
AGTTTAAGACTACAGGTGATTTAGCTGTTCAAATAGGTTCAAATAACGTTTGTACTTATGAACATGTTAT
ATCATTTATGGGTTTTAGGTTTGATATTAGTATTCCTGGTAGTCATAGTTTGTTTTGTACACGTGACTTT
GCTATTCGTAATGTGCGTGGTTGGTTGGGTATGGATGTTGAAAGTGCTCATGTTTGTGGCGATAACATAG
GTACTAATGTTCCTTTACAGGTTGGTTTTTCAAATGGTGTTAATTTTGTTGTGCAAACTGAAGGTTGTGT
GTCTACCAATTTTGGTGATGTTATTAAACCTGTTTGTGCAAAATCTCCACCAGGTGAACAATTTAGACAC
CTTATTCCTCTTTTACGTAAAGGACAACCTTGGTTAATTGTTCGTAGACGCATTGTGCAAATGATATCTG
ATTATTTGTCCAATTTGTCTGACATTCTTGTCTTTGTTTTGTGGGCAGGTAGTTTGGAATTAACTACAAT
GCGTTACTTTGTAAAAATAGGGCCAATTAAATATTGTTATTGTGGTAATTCTGCCACTTGTTATAATTCA
GTTAGTAATGAATATTGTTGTTTTAAACATGCATTGGGTTGTGATTATGTTTACAATCCGTATGCTTTTG
ATATACAACAGTGGGGTTATGTTGGTTCCTTGAGCCAAAACCACCACACATTCTGTAACATTCATAGAAA
CGAGCATGATGCCTCTGGTGATGCTGTTATGACACGTTGTTTGGCAGTACATGATTGTTTTGTCAAAAAT
GTTGATTGGACTGTAACGTACCCCTTTATTGCAAATGAGAAATTTATCAATGGCTGTGGGCGTAATGTCC
AGGGACATGTTGTTCGTGCAGCCTTGAAATTGTATAAACCTAGTGTTATTCATGACATTGGTAATCCTAA
AGGTGTACGTTGTGCTGTTACTGATGCCAAATGGTACTGTTATGACAAGCAACCTGTTAATAGTAATGTC
AAGTTGTTGGATTATGATTATGCAACCCATGGTCAACTTGATGGTCTTTGTTTATTCTGGAATTGTAATG
TTGATATGTATCCAGAATTTTCAATTGTGTGTCGTTTTGACACACGTACTCGTTCTGTTTTTAATTTAGA
AGGTGTTAATGGTGGTTCTCTTTATGTTAACAAACATGCGTTTCATACACCAGCATATGATAAACGTGCT
TTTGTTAAATTAAAACCTATGCCCTTTTTTTACTTTGATGACAGTGATTGTGATGTTGTGCAAGAACAAG
TTAATTATGTACCCCTTCGCGCTAGTAGTTGTGTTACTCGTTGTAATATAGGTGGTGCTGTTTGTTCAAA
ACATGCAAATTTGTATCAAAAATATGTTGAGGCATATAATACATTTACACAGGCAGGTTTTAACATTTGG
GTACCACATAGTTTTGATGTTTATAATTTGTGGCAAATTTTTATTGAAACTAATTTACAAAGTCTTGAAA
ATATAGCATTTAATGTTGTAAAAAAAGGGTGTTTTACTGGTGTTGATGGTGAGTTACCTGTTGCAGTTGT
TAACGACAAAGTTTTTGTTCGCTATGGCGATGTTGACAACTTGGTTTTTACAAATAAAACAACATTGCCT
ACTAATGTTGCTTTTGAATTGTTTGCAAAACGAAAAATGGGTTTAACACCACCATTGTCTATTCTCAAAA
ATCTCGGTGTTGTTGCTACATATAAATTTGTTTTATGGGATTATGAAGCTGAAAGACCTTTTACCTCATA
TACTAAGAGTGTATGTAAATACACTGATTTTAATGAGGATGTTTGTGTTTGTTTTGACAATAGTATTCAG
GGTTCGTATGAGCGTTTTACGCTTACTACGAACGCTGTTTTATTTTCTACTGTTGTCATTAAAAATTTAA
CACCTATAAAGTTGAATTTTGGTATGTTGAATGGTATGCCAGTTTCTTCTATTAAGGGTGATAAAGGTGT
TGAAAAATTAGTTAATTGGTACATATATGTTCGTAAAAATGGTCAATTTCAAGATCACTATGATGGTTTT
TACACTCAAGGTAGGAATTTATCAGACTTTACACCAAGAAGTGATATGGAGTATGATTTTCTTAACATGG
ATATGGGTGTTTTTATTAATAAATATGGTCTTGAGGATTTTAATTTTGAACATGTTGTATATGGTGATGT
TTCAAAAACTACATTAGGAGGTCTTCATTTGTTGATATCACAGTTTAGGCTTAGTAAAATGGGTGTTTTG
AAAGCTGATGATTTTGTCACTGCTTCTGACACAACTTTGAGGTGCTGTACTGTTACTTATCTTAATGAAC
TTAGTTCAAAAGTTGTTTGTACTTATATGGATTTGTTGTTGGACGACTTTGTTACTATACTAAAGAGTTT
AGATCTTGGTGTAATATCTAAAGTTCATGAAGTTATTATAGATAATAAACCTTATAGGTGGATGTTGTGG
TGTAAAGATAACCACTTGTCCACTTTTTATCCACAGTTGCAGTCTGCTGAATGGAAGTGTGGTTATGCTA
TGCCACAAATTTATAAGCTTCAACGTATGTGTTTGGAACCTTGTAATTTATATAATTATGGTGCTGGTAT
TAAGTTGCCTAGTGGTATAATGTTAAATGTTGTTAAATACACTCAGCTTTGTCAATACCTAAATAGCACT
ACAATGTGCGTACCTCATAATATGCGTGTTTTGCACTATGGTGCTGGTTCTGACAAAGGTGTGGCACCTG
GTACAACTGTTTTAAAACGTTGGCTACCACCCGATGCAATAATCATTGATAATGATATCAATGATTATGT
TAGTGATGCAGATTTTAGCATTACAGGTGATTGTGCTACTGTTTATCTTGAAGATAAGTTTGACTTACTT
ATTTCTGATATGTATGATGGTAGAATTAAATTTTGTGATGGTGAAAATGTCTCTAAAGATGGGTTTTTTA
CTTATCTTAATGGTGTTATTAGAGAAAAATTAGCTATTGGTGGTAGTGTTGCCATTAAGATTACAGAATA
TAGTTGGAATAAGTATCTTTATGAATTAATACAAAGATTTGCTTTTTGGACTTTGTTTTGCACGTCTGTT
AATACATCCTCTTCAGAAGCTTTTCTTATTGGTATTAATTATTTAGGTGACTTTATTCAAGGTCCTTTTA
TAGCTGGTAACACTGTTCATGCTAATTATATATTTTGGCGTAATTCTACTATTATGTCTTTGTCATACAA
TTCAGTTTTAGATTTAAGTAAGTTTGAATGTAAACATAAAGCCACTGTTGTTGTTACACTTAAAGATAGT
GATGTAAATGATATGGTTTTGAGTTTGATTAAGAGTGGTAGGTTGTTGTTACGCAATAATGGTCGTTTTG
GTGGTTTTAGTAATCATTTAGTCTCAACTAAATGAAACTTTTCTTGATTTTGCTTGTTTTGCCCCTGGCC
TCTTGCTTTTTCACATGTAATAGTAATGCTAATCTCTCTATGTTACAATTAGGTGTTCCTGACAATTCTT
CAACTATTGTTACGGGTTTATTGCCAACTCATTGGTTTTGTGCTAATCAGAGTACATCTGTTTACTCAGC
CAATGGTTTCTTTTATATTGATGTTGGTAATCACCGTAGTGCTTTTGCGCTCCATACTGGTTATTATGAT
GCTAATCAGTATTATATTTATGTTACTAATGAAATAGGCTTAAATGCTTCTGTTACTCTTAAGATTTGTA
AGTTTAGTAGAAACACTACTTTTGATTTTTTAAGTAATGCTTCTAGTTCTTTTGACTGTATAGTTAATTT
GTTATTTACAGAACAGTTAGGTGCGCCTTTGGGCATAACTATATCTGGTGAAACTGTGCGTCTGCATTTA
TATAATGTAACTCGTACTTTTTATGTGCCAGCAGCTTATAAACTTACTAAACTTAGTGTTAAATGTTACT
TTAACTATTCCTGTGTTTTTAGTGTTGTCAACGCCACCGTTACTGTGAATGTCACCACACATAATGGCCG
TGTAGTTAACTACACTGTTTGTGATGATTGTAATGGTTATACTGATAACATATTTTCTGTTCAACAGGAT
GGCCGCATTCCTAATGGTTTCCCTTTTAATAATTGGTTTTTGTTAACTAATGGTTCCACACTAGTGGACG
GGGTCTCTAGACTTTATCAACCACTCCGTTTAACTTGTTTATGGCCTGTACCTGGTCTTAAATCTTCAAC
TGGTTTTGTTTATTTTAATGCCACTGGTTCTGATGTTAATTGTAACGGCTATCAACATAATTCTGTTGTT
GATGTTATGCGTTACAATCTTAACTTCAGTGCTAATTCTTTGGACAATCTCAAGAGTGGTGTTATAGTTT
TTAAAACTTTACAGTACGATGTTTTGTTTTATTGTAGTAATTCTTCCTCAGGTGTTCTTGACACCACAAT
ACCTTTTGGCCCGTCCTCTCAACCTTATTACTGTTTTATAAACAGCACTATCAACACTACTCATGTTAGC
ACTTTTGTGGGTATTTTACCACCCACTGTGCGTGAAATTGTTGTTGCTAGAACTGGCCAGTTTTATATTA
ATGGTTTTAAGTATTTCGATTTGGGTTTCATAGAAGCTGTCAATTTTAATGTCACGACTGCTAGCGCCAC
AGATTTTTGGACGGTTGCATTTGCTACTTTTGTTGATGTTTTGGTTAATGTTAGTGCAACTAACATTCAA
AACTTACTTTATTGCGATTCTCCATTTGAAAAGTTGCAGTGTGAGCACTTGCAGTTTGGATTGCAGGATG
GTTTTTATTCTGCAAATTTTCTTGATGATAATGTTTTGCCTGAGACTTATGTTGCACTCCCCATTTATTA
TCAACACACGGACATAAATTTTACTGCAACTGCATCTTTTGGTGGTTCTTGTTATGTTTGTAAACCACAC
CAGGTTAATATATCTCTTAATGGTAACACTTCAGTGTGTGTTAGAACATCTCATTTTTCAATTAGGTATA
TTTATAACCGCGTTAAGAGTGGTTCACCAGGTGACTCTTCATGGCACATTTATTTAAAGAGTGGCACTTG
TCCATTTTCTTTTTCTAAGTTAAATAATTTTCAAAAGTTCAAGACTATTTGTTTCTCAACCGTCGAAGTG
CCTGGTAGTTGTAATTTTCCGCTTGAAGCCACCTGGCATTACACTTCTTATACTATTGTTGGTGCTTTGT
ATGTTACTTGGTCTGAAGGTAATTCTATTACTGGTGTACCTTATCCTGTCTCTGGTATTCGTGAGTTTAG
TAATTTAGTTTTAAATAATTGTACCAAATATAATATTTATGATTATGTTGGTACTGGAATTATACGTTCT
TCAAACCAGTCACTTGCTGGTGGTATTACATATGTTTCTAACTCTGGTAATTTACTTGGTTTTAAAAATG
TTTCCACTGGTAACATTTTTATTGTGACACCATGTAACCAACCAGACCAAGTAGCTGTTTATCAACAAAG
CATTATTGGTGCCATGACCGCTGTTAATGAGTCTAGATATGGCTTGCAAAACTTACTACAGTTACCTAAC
TTTTATTATGTTAGTAATGGTGGTAACAATTGCACTACGGCCGTTATGACTTATTCTAATTTTGGTATTT
GTGCTGATGGTTCTTTGATTCCTGTTCGTCCGCGTAATTCTAGTGATAATGGTATTTCAGCCATAATCAC
TGCTAATTTATCCATTCCTTCTAACTGGACTACTTCAGTTCAAGTTGAGTACCTCCAAATTACTAGTACT
CCAATAGTTGTTGATTGTGCTACTTATGTGTGTAATGGTAACCCTCGCTGTAAGAATCTACTTAAGCAGT
ATACTTCTGCTTGTAAAACTATTGAAGATGCCTTACGACTTAGTGCTCATTTGGAAACTAATGATGTTAG
TAGTATGCTAACTTTCGATAGCAATGCTTTTAGTTTGGCTAATGTTACTAGTTTTGGAGATTATAACCTT
TCTAGTGTTTTACCTCAGAGAAACATTCGTTCAAGCCGTATAGCAGGACGTAGTGCTTTGGAAGATTTGT
TGTTTAGCAAAGTTGTTACATCTGGTTTGGGTACTGTTGATGTTGACTATAAGTCTTGTACTAAAGGTCT
TTCTATTGCTGACCTTGCTTGTGCTCAGTACTACAATGGCATAATGGTTTTGCCAGGTGTTGCTGATGCT
GAACGTATGGCCATGTACACAGGTTCTCTTATAGGTGGCATGGTGCTCGGAGGTCTTACATCAGCAGCCG
CCATACCTTTTTCTTTGGCACTGCAAGCACGACTTAACTATGTTGCTTTACAAACTGATGTGCTTCAAGA
AAATCAGAAAATTTTGGCTGCATCATTTAATAAGGCTATTAATAATATTGTTGCTTCTTTTAGTAGCGTT
AATGATGCTATTACACAAACTGCAGAGGCTATACATACTGTTACTATTGCACTTAATAAGATTCAGGATG
TTGTTAATCAACAGGGTAGTGCTCTTAACCATCTCACTTCACAATTGAGACATAATTTTCAGGCCATTTC
TAATTCAATTCAGGCTATTTATGACCGGCTTGATTCAATTCAAGCCGATCAACAAGTTGACAGATTAATT
ACTGGACGGCTTGCAGCTTTGAATGCATTTGTTTCCCAAGTTTTGAATAAATATACTGAAGTTCGTGGTT
CAAGACGCTTAGCACAGCAGAAGATTAATGAATGTGTCAAGTCACAATCTAATAGATATGGTTTTTGTGG
CAATGGCACTCACATCTTTTCAATCGTCAACTCAGCTCCAGATGGTTTGCTTTTTCTTCATACTGTTTTG
CTGCCAACTGATTACAAGAATGTAAAGGCGTGGTCTGGTATCTGTGTTGATGGCATTTATGGCTATGTTC
TGCGTCAACCTAACTTGGTTCTTTATTCTGATAATGGTGTCTTTCGTGTAACTTCCAGGGTCATGTTTCA
ACCTCGCTTACCTGTTTTGTCTGATTTTGTGCAAATATATAATTGTAATGTTACTTTTGTTAACATATCT
CGTGTTGAGTTACATACTGTCATACCTGACTACGTTGATGTTAATAAAACATTACAAGAGTTTGCACAAA
ACTTACCAAAGTATGTTAAGCCTAATTTTGACTTGACTCCTTTTAATTTAACATATCTTAATTTGAGTTC
TGAGTTGAAGCAACTCGAAGCTAAAACTGCTAGTCTTTTTCAAACTACTGTTGAATTACAAGGTCTTATT
GATCAGATTAACAGTACATATGTTGATTTGAAGTTGCTTAATAGGTTTGAAAATTATATCAAATGGCCTT
GGTGGGTTTGGCTCATTATTTCTGTTGTTTTTGTTGTATTGTTGAGTCTTCTTGTGTTTTGTTGTCTTTC
TACAGGTTGTTGTGGTTGTTGCAATTGTTTAACTTCATCAATGCGAGGCTGTTGTGATTGTGGTTCAACT
AAACTTCCTTATTACGAATTTGAAAAGGTCCACGTTCAATAATGCCTTTTGGTGGCCTATTTCAACTTAC
TCTTGAAAGTACTATTAATAAGAGTGTGGCTAATCTCAAATTACCACCTCATGATGTTACTGTCTTGCGT
GACAATCTTAAACCTGTTACTACACTTAGTACTATTACTGCTTATTTGTTAGTTAGTTTGTTTGTCACTT
ACTTTGCTTTATTCAAACCTCTTACTGCTAGAGGTCGTGTTGCTTGTTTTGTTTTAAAACTATTGACACT
ATTTGTCTATGTGCCTTTATTGGTTCTTTTTGGTATGTATCTTGACAGTTTTATAATTTTTTCTACGCTG
TTGTTTCGATTCATACATGTTGGCTATTATGCCTATCTCTATAAAAATTTTTCATTTGTTTTGTTCAATG
TTACTAAACTATGCTTCGTTTCAGGCAAGTGTTGGTATCTTGAACAATCATTTTATGAAAATCGTTTTGC
TGCTATTTATGGTGGTGACCACTATGTCGTTTTAGGTGGTGAAACTATTACTTTTGTTTCTTTTGATGAC
CTTTATGTTGCTATTAGAGGTTCTTGTGAAAAGAACCTACAACTTATGCGTAAGGTTGACTTGTATAATG
GTGCTGTCATTTACATTTTTGCCGAAGAGCCTGTTGTTGGTATAGTCTACTCTTCTCAACTATACGAAGA
TGTTCCTTCGATTAATTGATGACAATGGTATTGTCCTCAATTCCATTTTATGGCTCCTTGTTATGATATT
TTTCTTTGTGTTGGCAATGACCTTTATTAAACTGATTCAATTGTGTTTTACTTGTCATTATTTTTTTAGT
AGGACATTATATCAACCAGTTTATAAAATTTTTCTTGCTTACCAAGATTATATGCAAATAGCACCTGTTC
CAGCTGAAGTACTAAATGTCTAAACTAAACGATGTCTAATAGTAGTGTGCCTCTTTTAGAGGTTTATGTC
CATTTACGTAACTGGAACTTTAGTTGGAATTTAATTCTAACGCTTTTTATAGTTGTGTTGCAGTATGGGC
ATTATAAGTATAGCAGACTTCTTTATGGTTTAAAGATGTCTGTTTTATGGTGTTTATGGCCACTTGTTCT
AGCTTTGTCTATTTTTGACTGTTTTGTCAATTTTAATGTGGACTGGGTCTTTTTTGGTTTTAGTATTCTT
ATGTCTATTATTACACTTTGTTTATGGGTTATGTATTTTGTTAATAGTTTCAGACTTTGGCGCCGTGTTA
AAACTTTTTGGGCTTTTAATCCTGAAACTAATGCAATCATCTCTCTCCAGGTTTACGGACATAATTATTA
CTTACCGGTGATGGCTGCACCTACAGGTGTTACATTAACACTTCTTAGTGGTGTACTTCTTGTTGATGGC
CATAAGATTGCTACTCGTGTTCAAGTGGGTCAGTTGCCTAAATATGTAATAGTTGCTACGCCTAGTACCA
CAATTGTTTGTGACCGTGTTGGTCGCTCTGTTAATGAAACAAGCCAGACTGGTTGGGCATTCTACGTCCG
TGCTAAACATGGTGATTTTTCTGGTGTTGCCTCTCAGGAGGGTGTTTTGTCAGAAAGAGAGAAGTTGCTT
CATTTAATCTAAACTAAACAAAATGGCTAGTGTAAATTGGGCCGATGACAGAGCTGCTAGGAAGAAATTT
CCTCCTCCTTCATTTTACATGCCTCTTTTGGTTAGTTCTGATAAGGCACCATATAGGGTCATTCCCAGGA
ATCTTGTCCCTATTGGTAAGGGTAATAAAGATGAGCAGATTGGTTATTGGAATGTTCAAGAGCGTTGGCG
TATGCGCAGGGGGCAACGTGTTGATTTGCCTCCTAAAGTTCATTTTTATTACCTAGGTACTGGACCTCAT
AAGGACCTTAAATTCAGACAACGTTCTGATGGTGTTGTTTGGGTTGCTAAGGAAGGTGCTAAAACTGTTA
ATACCAGTCTTGGTAATCGCAAACGTAATCAGAAACCTTTGGAACCAAAGTTCTCTATTGCTTTGCCTCC
AGAGCTCTCTGTTGTTGAGTTTGAGGATCGCTCTAATAACTCATCTCGTGCTAGCAGTCGTTCTTCAACT
CGTAACAACTCACGAGACTCTTCTCGTAGCACTTCAAGACAACAGTCTCGCACTCGTTCTGATTCTAACC
AGTCTTCTTCAGATCTTGTTGCTGCTGTTACTTTGGCTTTAAAGAACTTAGGTTTTGATAACCAGTCGAA
GTCACCTAGTTCTTCTGGTACTTCCACTCCTAAGAAACCTAATAAGCCTCTTTCTCAACCCAGGGCTGAT
AAGCCTTCTCAGTTGAAGAAACCTCGTTGGAAGCGTGTTCCTACCAGAGAGGAAAATGTTATTCAGTGCT
TTGGTCCTCGTGATTTTAATCACAATATGGGGGATTCAGATCTTGTTCAGAATGGTGTTGATGCCAAAGG
TTTTCCACAGCTTGCTGAATTGATTCCTAATCAGGCTGCGTTATTCTTTGATAGTGAGGTTAGCACTGAT
GAAGTGGGTGATAATGTTCAGATTACCTACACCTACAAAATGCTTGTAGCTAAGGATAATAAGAACCTTC
CTAAGTTCATTGAGCAGATTAGTGCTTTTACTAAACCCAGTTCTATCAAAGAAATGCAGTCACAATCATC
TCATGTTGCTCAGAACACAGTACTTAATGCTTCTATTCCAGAATCTAAACCATTGGCTGATGATGATTCA
GCCATTATAGAAATTGTCAACGAGGTTTTGCATTAAATTGTTTTGTAATTCCAGTTGAATGTTTATTATT
ATTAGTTGCAACCCCATGCGTTTAGCGCATGATAAGGGTTTAGTCTTACACACAATGGTAGGCCAGTGAT
AGTAAAGTGTAAGTAATTTGCTATCATATTAACATGTCTAGAGGAAAGTCAGAACTTTTTCTGTTTGTGT
TGTTGGAGTACTTAAAGATCGCATAGGCGCGCCAACAATGGAAGAGCCAACAACATATCTAAAAATGTTT
TGTCTGGTACTTGTTAATGATATTGTTTTTGATATGGATACAC

>gi|9629812|ref|NC_001846.1| Mouse hepatitis virus strain MHV-A59 C12 mutant, complete genome
TATAAGAGTGATTGGCGTCCGTACGTACCCTCTCAACTCTAAAACTCTTGTAGTTTAAATCTAATCTAAA
CTTTATAAACGGCACTTCCTGCGTGTCCATGCCCGCGGGCCTGGTCTTGTCATAGTGCTGACATTTGTAG
TTCCTTGACTTTCGTTCTCTGCCAGTGACGTGTCCATTCGGCGCCAGCAGCCCACCCATAGGTTGCATAA
TGGCAAAGATGGGCAAATACGGTCTCGGCTTCAAATGGGCCCCAGAATTTCCATGGATGCTTCCGAACGC
ATCGGAGAAGTTGGGTAACCCTGAGAGGTCAGAGGAGGATGGGTTTTGCCCCTCTGCTGCGCAAGAACCG
AAAGTTAAAGGAAAAACTTTGGTTAATCACGTGAGGGTGAATTGTAGCCGGCTTCCAGCTTTGGAATGCT
GTGTTCAGTCTGCCATAATCCGTGATATTTTTGTAGATGAGGATCCCCAGAAGGTGGAGGCCTCAACTAT
GATGGCATTGCAGTTCGGTAGTGCCGTCTTGGTTAAGCCATCCAAGCGCTTGTCTATTCAGGCATGGACT
AATTTGGGTGTGCTTCCCAAAACAGCTGCCATGGGGTTGTTCAAGCGCGTCTGCCTGTGTAACACCAGGG
AGTGCTCTTGTGACGCCCACGTGGCCTTTCACCTTTTTACGGTCCAACCCGATGGTGTATGCCTGGGTAA
TGGCCGTTTTATAGGCTGGTTCGTTCCAGTCACAGCCATACCGGAGTATGCGAAGCAGTGGTTGCAACCC
TGGTCCATCCTTCTTCGTAAGGGTGGTAACAAAGGGTCTGTGACATCCGGCCACTTCCGCCGCGCTGTTA
CCATGCCTGTGTATGACTTTAATGTAGAGGATGCTTGTGAGGAGGTTCATCTTAACCCGAAGGGTAAGTA
CTCCTGCAAGGCGTATGCTCTTCTTAAGGGCTATCGCGGTGTTAAGCCCATCCTGTTTGTGGACCAGTAT
GGTTGCGACTATACTGGATGTCTCGCCAAGGGTCTTGAGGACTATGGCGATCTCACCTTGAGTGAGATGA
AGGAGTTGTTCCCTGTGTGGCGTGACTCCTTGGATAGTGAAGTCCTTGTGGCTTGGCACGTTGATCGAGA
TCCTCGGGCTGCTATGCGTCTGCAGACTCTTGCTACTGTACGTTGCATTGATTATGTGGGCCAACCGACC
GAGGATGTGGTGGATGGAGATGTGGTAGTGCGTGAGCCTGCTCATCTTCTCGCAGCCAATGCCATTGTTA
AAAGACTCCCCCGTTTGGTGGAGACTATGCTGTATACGGATTCGTCCGTTACAGAATTCTGTTATAAAAC
CAAGCTGTGTGAATGCGGTTTTATCACGCAGTTTGGCTATGTGGATTGTTGTGGTGACACCTGCGATTTT
CGTGGGTGGGTTGCCGGCAATATGATGGATGGCTTTCCATGTCCAGGGTGTACCAAAAATTATATGCCCT
GGGAATTGGAGGCCCAGTCATCAGGTGTTATACCAGAAGGAGGTGTTCTATTCACTCAGAGCACTGATAC
AGTGAATCGTGAGTCCTTTAAGCTCTACGGTCATGCTGTTGTGCCTTTTGGTTCTGCTGTGTATTGGAGC
CCTTGCCCAGGTATGTGGCTTCCAGTAATTTGGTCTTCTGTTAAGTCATACTCTGGTTTGACTTATACAG
GAGTAGTTGGTTGTAAGGCAATTGTTCAAGAGACAGACGCTATATGTCGTTCTCTGTATATGGATTATGT
CCAGCACAAGTGTGGCAATCTCGAGCAGAGAGCTATCCTTGGATTGGACGATGTCTATCATAGACAGTTG
CTTGTGAATAGGGGTGACTATAGTCTCCTCCTTGAGAATGTGGATTTGTTTGTTAAGCGGCGCGCTGAAT
TTGCTTGCAAATTCGCCACCTGTGGAGATGGTCTTGTACCCCTCCTACTAGATGGTTTAGTGCCCCGCAG
TTATTATTTGATTAAGAGTGGTCAAGCTTTCACCTCTATGATGGTTAATTTTAGCCATGAGGTGACTGAC
ATGTGTATGGACATGGCTTTATTGTTCATGCATGATGTTAAAGTGGCCACTAAGTATGTTAAGAAGGTTA
CTGGCAAACTGGCCGTGCGCTTTAAAGCGTTGGGTGTAGCCGTTGTCAGAAAAATTACTGAATGGTTTGA
TTTAGCCGTGGACATTGCTGCTAGTGCCGCTGGATGGCTTTGCTACCAGCTGGTAAATGGCTTATTTGCA
GTGGCCAATGGTGTTATAACCTTTGTACAGGAGGTGCCTGAGCTTGTCAAGAATTTTGTTGACAAGTTCA
AGGCATTTTTCAAGGTTTTGATCGACTCTATGTCGGTTTCTATCTTGTCTGGACTTACTGTTGTCAAGAC
TGCCTCAAATAGGGTGTGTCTTGCTGGCAGTAAGGTTTATGAAGTTGTGCAGAAATCTTTGTCTGCATAT
GTTATGCCTGTGGGTTGCAGTGAAGCCACTTGTTTGGTGGGTGAGATTGAACCTGCAGTTTTTGAAGATG
ATGTTGTTGATGTGGTTAAAGCCCCATTAACATATCAAGGCTGTTGTAAGCCACCCACTTCTTTCGAGAA
GATTTGTATTGTGGATAAATTGTATATGGCCAAGTGTGGTGATCAATTTTACCCTGTGGTTGTTGATAAC
GACACTGTTGGCGTGTTAGATCAGTGCTGGAGGTTTCCCTGTGCGGGCAAGAAAGTCGAGTTTAACGACA
AGCCCAAAGTCAGGAAGATACCCTCCACCCGTAAGATTAAGATCACCTTCGCACTGGATGCGACCTTTGA
TAGTGTTCTTTCGAAGGCGTGTTCAGAGTTTGAAGTTGATAAAGATGTTACATTGGATGAGCTGCTTGAT
GTTGTGCTTGACGCAGTTGAGAGTACGCTCAGCCCTTGTAAGGAGCATGATGTGATAGGCACAAAAGTTT
GTGCTTTACTTGATAGGTTGGCAGGAGATTATGTCTATCTTTTTGATGAGGGAGGCGATGAAGTGATCGC
CCCGAGGATGTATTGTTCCTTTTCTGCTCCTGATGATGAAGACTGCGTTGCAGCGGATGTTGTAGATGCA
GATGAAAACCAAGATGATGATGCTGAAGACTCAGCAGTCCTTGTCGCTGATACCCAAGAAGAGGACGGCG
TTGCCAAGGGGCAGGTTGAGGCGGATTCGGAAATTTGCGTTGCGCATACTGGTAGTCAAGAAGAATTGGC
TGAGCCTGATGCTGTCGGATCTCAAACTCCCATCGCCTCTGCTGAGGAAACCGAAGTCGGAGAGGCAAGC
GACAGGGAAGGGATTGCTGAGGCGAAGGCAACTGTGTGTGCTGATGCTGTAGATGCCTGCCCCGATCAAG
TGGAGGCATTTGAAATTGAAAAGGTTGAAGACTCTATCTTGGATGAGCTTCAAACTGAACTTAATGCGCC
AGCGGACAAGACCTATGAGGATGTCTTGGCATTCGATGCCGTATGCTCAGAGGCGTTGTCTGCATTCTAT
GCTGTGCCGAGTGATGAGACGCACTTTAAAGTGTGTGGATTCTATTCGCCTGCTATAGAGCGCACTAATT
GTTGGCTGCGTTCTACTTTGATAGTAATGCAGAGTCTACCTTTGGAATTTAAAGACTTGGAGATGCAAAA
GCTCTGGTTGTCTTACAAGGCCGGCTATGACCAATGCTTTGTGGACAAACTAGTTAAGAGCGTGCCCAAG
TCTATTATCCTTCCACAAGGTGGTTATGTGGCAGATTTTGCCTATTTCTTTCTAAGCCAGTGTAGCTTTA
AAGCTTATGCTAACTGGCGTTGTTTAGAGTGTGACATGGAGTTAAAGCTTCAAGGCTTGGACGCCATGTT
TTTCTATGGGGACGTTGTGTCTCATATGTGCAAGTGTGGTAATAGCATGACCTTGTTGTCTGCAGATATA
CCCTACACTTTGCATTTTGGAGTGCGAGATGATAAGTTTTGCGCTTTTTACACGCCAAGAAAGGTCTTTA
GGGCTGCTTGTGCGGTAGATGTTAATGATTGTCACTCTATGGCTGTAGTAGAGGGCAAGCAAATTGATGG
TAAAGTGGTTACCAAATTTATTGGTGACAAATTTGATTTTATGGTGGGTTACGGGATGACATTTAGTATG
TCTCCTTTTGAACTCGCCCAGTTATATGGTTCATGTATAACACCAAATGTTTGTTTTGTTAAAGGAGATG
TTATAAAGGTTGTTCGCTTAGTTAATGCTGAAGTCATTGTTAACCCTGCTAATGGGCGTATGGCTCATGG
TGCAGGTGTTGCAGGTGCTATAGCTGAAAAGGCGGGCAGTGCTTTTATTAAAGAAACCTCCGATATGGTG
AAGGCTCAGGGCGTTTGCCAGGTTGGTGAATGCTATGAATCTGCCGGTGGTAAGTTATGTAAAAAGGTGC
TTAACATTGTAGGGCCAGATGCGCGAGGGCATGGCAAGCAATGCTATTCACTTTTAGAGCGTGCTTATCA
GCATATTAATAAGTGTGACAATGTTGTCACTACTTTAATTTCGGCTGGTATATTTAGTGTGCCTACTGAT
GTCTCCCTAACTTACTTACTTGGTGTAGTGACAAAGAATGTCATTCTTGTCAGTAACAACCAGGATGATT
TTGATGTGATAGAGAAGTGTCAGGTGACCTCCGTTGCTGGTACCAAAGCGCTATCACTTCAATTGGCCAA
AAATTTGTGCCGTGATGTAAAGTTTGTGACGAATGCATGTAGTTCGCTTTTTAGTGAATCTTGCTTTGTC
TCAAGCTATGATGTGTTGCAGGAAGTTGAAGCGCTGCGACATGATATACAATTGGATGATGATGCTCGTG
TCTTTGTGCAGGCTAATATGGACTGTCTGCCCACAGACTGGCGTCTCGTTAACAAATTTGATAGTGTTGA
TGGTGTTAGAACCATTAAGTATTTTGAATGCCCGGGCGGGATTTTTGTATCCAGCCAGGGCAAAAAGTTT
GGTTATGTTCAGAATGGTTCATTTAAGGAGGCGAGTGTTAGCCAAATAAGGGCTTTACTCGCTAATAAGG
TTGATGTCTTGTGTACTGTTGATGGTGTTAACTTCCGCTCCTGCTGCGTAGCAGAGGGTGAAGTTTTTGG
CAAGACATTAGGTTCAGTCTTTTGTGATGGCATAAATGTCACCAAAGTTAGGTGTAGTGCCATTTACAAG
GGTAAGGTTTTCTTTCAGTACAGTGATTTGTCCGAGGCAGATCTTGTGGCTGTTAAAGATGCCTTTGGTT
TTGATGAACCACAACTGCTGAAGTACTACACTATGCTTGGCATGTGTAAGTGGTCAGTAGTTGTTTGTGG
CAATTATTTTGCTTTCAAGCAGTCAAATAATAATTGCTATATAAATGTGGCATGTTTAATGCTGCAACAC
TTGAGTTTAAAGTTTCCTAAGTGGCAATGGCAAGAGGCTTGGAACGAGTTCCGCTCTGGTAAACCACTAA
GGTTTGTGTCCTTGGTATTAGCAAAGGGCAGCTTTAAATTTAATGAACCTTCTGATTCTATCGATTTTAT
GCGTGTGGTGCTACGTGAAGCAGATTTGAGTGGTGCCACGTGCAATTTGGAATTTGTTTGTAAATGTGGT
GTGAAGCAAGAGCAGCGCAAAGGTGTTGACGCTGTTATGCATTTTGGTACGTTGGATAAAGGTGATCTTG
TCAGGGGTTATAATATCGCATGTACGTGCGGTAGTAAACTTGTGCATTGCACCCAATTTAACGTACCATT
TTTAATTTGCTCCAACACACCAGAGGGTAGGAAACTGCCCGACGATGTTGTTGCAGCTAATATTTTTACT
GGTGGTAGTGTGGGCCATTACACGCATGTGAAATGTAAACCCAAGTACCAGCTTTATGATGCTTGTAATG
TTAATAAGGTTTCGGAGGCTAAGGGTAATTTTACCGATTGCCTCTACCTTAAAAATTTAAAGCAAACTTT
TTCGTCTGTGCTGACGACTTTTTATTTAGATGATGTAAAGTGTGTGGAGTATAAGCCAGATTTATCGCAG
TATTACTGTGAGTCTGGTAAATATTATACAAAACCCATTATTAAGGCCCAATTTAGAACATTTGAGAAGG
TTGATGGTGTCTATACCAACTTTAAATTGGTGGGACATAGTATTGCTGAAAAACTCAATGCTAAGCTGGG
ATTTGATTGTAATTCTCCCTTTGTGGAGTATAAAATTACAGAGTGGCCAACAGCTACTGGAGATGTGGTG
TTGGCTAGTGATGATTTGTATGTAAGTCGGTACTCAAGCGGGTGCATTACTTTTGGTAAACCGGTTGTCT
GGCTTGGCCATGAGGAAGCATCGCTGAAATCTCTCACATATTTTAATAGACCTAGTGTCGTTTGTGAAAA
TAAATTTAATGTGTTGCCCGTTGATGTCAGTGAACCCACGGACAAGGGGCCTGTGCCTGCTGCAGTCCTT
GTTACCGGCGTCCCTGGAGCTGATGCGTCAGCTGGTGCCGGTATTGCCAAGGAGCAAAAAGCCTGTGCTT
CTGCTAGTGTGGAGGATCAGGTTGTTACGGAGGTTCGTCAAGAGCCATCTGTTTCAGCTGCTGATGTCAA
AGAGGTTAAATTGAATGGTGTTAAAAAGCCTGTTAAGGTGGAAGGTAGTGTGGTTGTTAATGATCCCACT
AGCGAAACCAAAGTTGTTAAAAGTTTGTCTATTGTTGATGTCTATGATATGTTCCTGACAGGGTGTAAGT
ATGTGGTTTGGACTGCTAATGAGTTGTCTCGACTAGTAAATTCACCGACTGTTAGGGAGTATGTGAAGTG
GGGTAAGGGAAAGATTGTAACACCCGCTAAGTTGTTGTTGTTAAGAGATGAGAAGCAAGAGTTCGTAGCG
CCAAAAGTAGTCAAGGCGAAAGCTATTGCCTGCTATTGTGCTGTGAAGTGGTTTCTCCTCTATTGTTTTA
GTTGGATAAAGTTTAATACTGATAATAAGGTTATATACACCACAGAAGTAGCTTCAAAGCTTACTTTCAA
GTTGTGCTGTTTGGCCTTTAAGAATGCCTTACAGACGTTTAATTGGAGCGTTGTGTCTAGGGGCTTTTTC
CTAGTTGCAACGGTCTTTTTATTATGGTTTAACTTTTTGTATGCTAATGTTATTTTGAGTGACTTCTATT
TGCCTAATATTGGGCCTCTCCCTACGTTTGTGGGACAGATAGTTGCGTGGTTTAAGACTACATTTGGTGT
GTCAACCATCTGTGATTTCTACCAGGTGACGGATTTGGGCTATAGAAGTTCGTTTTGTAATGGAAGTATG
GTATGTGAACTATGCTTCTCAGGTTTTGATATGCTGGACAACTATGATGCTATAAATGTTGTTCAACACG
TTGTAGATAGGCGTTTGTCCTTTGACTATATTAGCCTATTTAAATTAGTAGTTGAGCTTGTAATCGGCTA
CTCTCTTTATACTGTGTGCTTCTACCCACTGTTTGTCCTTATTGGAATGCAGTTGTTGACCACATGGTTG
CCTGAATTCTTTATGCTGGAGACTATGCATTGGAGTGCTCGTTTGTTTGTGTTTGTTGCCAATATGCTTC
CAGCTTTTACGTTACTGCGATTTTACATCGTGGTGACAGCTATGTATAAGGTCTATTGTCTTTGTAGACA
TGTTATGTATGGATGTAGTAAGCCTGGTTGCTTGTTTTGTTATAAGAGAAACCGTAGTGTCCGTGTTAAG
TGTAGCACCGTTGTTGGTGGTTCACTACGCTATTACGATGTAATGGCTAACGGCGGCACAGGTTTCTGTA
CAAAGCACCAGTGGAACTGTCTTAATTGCAATTCCTGGAAACCAGGCAATACATTCATAACTCATGAAGC
AGCGGCGGACCTCTCTAAGGAGTTGAAACGCCCTGTGAATCCAACAGATTCTGCTTATTACTCGGTCACA
GAGGTTAAGCAGGTTGGTTGTTCCATGCGTTTGTTCTACGAGAGAGATGGACAGCGTGTTTATGATGATG
TTAATGCTAGTTTGTTTGTGGACATGAATGGTCTGCTGCATTCTAAAGTTAAAGGTGTGCCTGAAACGCA
TGTTGTGGTTGTTGAGAATGAAGCTGATAAAGCTGGTTTTCTCGGCGCCGCAGTGTTTTATGCACAATCG
CTCTACAGACCTATGTTGATGGTGGAAAAGAAATTAATAACTACCGCCAACACTGGTTTGTCTGTTAGTC
GAACTATGTTTGACCTTTATGTAGATTCATTGCTGAACGTCCTCGACGTGGATCGCAAGAGTCTAACAAG
TTTTGTAAATGCTGCGCACAACTCTCTAAAGGAGGGTGTTCAGCTTGAACAAGTTATGGATACCTTTATT
GGCTGTGCCCGACGTAAGTGTGCTATAGATTCTGATGTTGAAACCAAGTCTATTACCAAGTCCGTCATGT
CGGCAGTAAATGCTGGCGTTGATTTTACGGATGAGAGTTGTAATAACTTGGTGCCTACCTATGTTAAAAG
TGACACTATCGTTGCAGCCGATTTGGGTGTTCTTATTCAGAATAATGCTAAGCATGTACAGGCTAATGTT
GCTAAAGCCGCTAATGTGGCTTGCATTTGGTCTGTGGATGCTTTTAACCAGCTATCTGCTGACTTACAGC
ATAGGCTGCGAAAAGCATGTTCAAAAACTGGCTTGAAGATTAAGCTTACTTATAATAAGCAGGAGGCAAA
TGTTCCTATTTTAACTACACCGTTCTCTCTTAAAGGGGGCGCTGTTTTTAGTAGAATGTTACAATGGTTG
TTTGTTGCTAATTTGATTTGTTTCATTGTGTTGTGGGCCCTTATGCCAACATATGCAGTGCACAAATCGG
ATATGCAGTTGCCTTTATATGCCAGTTTTAAAGTTATAGATAATGGTGTGCTAAGGGATGTGTCTGTTAC
TGACGCATGCTTCGCAAACAAATTTAATCAATTTGATCAATGGTATGAGTCTACTTTTGGTCTTGCTTAT
TACCGCAACTCTAAGGCTTGTCCTGTTGTGGTTGCTGTAATAGATCAAGACATTGGCCATACCTTATTTA
ATGTTCCTACCACAGTTTTAAGATATGGATTTCATGTGTTGCATTTTATAACCCATGCATTTGCTACTGA
TAGCGTGCAGTGTTACACGCCACATATGCAAATCCCCTATGATAATTTCTATGCTAGTGGTTGCGTGTTG
TCATCCCTCTGTACTATGCTTGCGCATGCAGATGGAACCCCGCATCCTTATTGTTATACAGGGGGTGTTA
TGCACAATGCCTCTCTGTATAGTTCTTTGGCTCCTCATGTCCGTTATAACCTGGCTAGTTCAAATGGTTA
TATACGTTTTCCCGAAGTGGTTAGTGAAGGCATTGTGCGTGTTGTGCGCACTCGCTCTATGACCTACTGC
AGGGTTGGTTTATGTGAGGAGGCCGAGGAGGGTATCTGCTTTAATTTTAATCGTTCATGGGTATTGAACA
ACCCGTATTATAGGGCCATGCCTGGAACTTTTTGTGGTAGGAATGCTTTTGATTTAATACATCAAGTTTT
AGGAGGATTAGTGCGGCCTATTGATTTCTTTGCCTTAACGGCGAGTTCAGTGGCTGGTGCTATCCTTGCA
ATTATTGTCGTTTTGGCTTTCTATTATTTAATAAAGCTTAAACGTGCCTTTGGTGACTACACTAGTGTTG
TGGTTATCAATGTAATTGTGTGGTGTATAAATTTTCTGATGCTTTTTGTGTTTCAGGTTTATCCCACATT
GTCTTGTTTATATGCTTGTTTTTATTTCTACACAACGCTTTATTTCCCTTCGGAGATAAGTGTTGTTATG
CATTTGCAATGGCTTGTCATGTATGGTGCTATTATGCCCTTGTGGTTTTGCATTATTTACGTGGCAGTCG
TTGTTTCAAACCATGCATTGTGGTTGTTCTCTTACTGCCGCAAAATTGGTACCGAGGTTCGTAGTGACGG
CACATTTGAGGAAATGGCCCTTACTACCTTTATGATTACTAAAGAATCTTATTGTAAGTTGAAAAATTCT
GTTTCTGATGTTGCTTTTAACAGGTACTTGAGTCTTTATAACAAGTATCGTTATTTTAGTGGCAAAATGG
ATACTGCCGCTTATAGAGAGGCTGCCTGTTCACAACTGGCAAAGGCAATGGAAACATTTAACCATAATAA
TGGTAATGATGTTCTCTATCAGCCTCCAACCGCCTCTGTTACTACATCATTTTTACAGTCTGGTATAGTG
AAGATGGTGTCGCCCACCTCTAAAGTGGAGCCTTGTATTGTTAGTGTTACTTATGGTAACATGACACTTA
ATGGGTTGTGGTTGGATGATAAAGTTTATTGCCCAAGACATGTTATCTGTTCTTCAGCTGACATGACAGA
CCCTGATTATCCTAATTTGCTTTGTAGAGTGACATCAAGTGATTTTTGTGTTATGTCTGGTCGTATGAGC
CTTACTGTAATGTCTTATCAAATGCAGGGCTGCCAACTTGTTTTGACTGTTACACTGCAAAATCCTAACA
CGCCTAAGTATTCCTTCGGTGTTGTTAAGCCTGGTGAGACATTTACTGTACTGGCTGCATACAATGGCAG
ACCTCAAGGAGCCTTCCATGTTACGCTTCGTAGTAGCCATACCATAAAGGGCTCCTTTCTATGTGGATCC
TGCGGTTCTGTAGGATATGTTTTAACTGGCGATAGTGTACGATTTGTTTATATGCATCAGCTAGAGTTGA
GTACTGGTTGTCATACCGGTACTGACTTTAGTGGGAACTTTTATGGTCCCTATAGAGATGCGCAAGTTGT
ACAATTGCCTGTTCAGGATTATACGCAGACTGTTAATGTTGTAGCTTGGCTTTATGCTGCTATTTTTAAC
AGATGCAACTGGTTTGTGCAAAGTGATAGTTGTTCCCTGGAGGAGTTTAATGTTTGGGCTATGACCAATG
GTTTTAGCTCAATCAAAGCCGATCTTGTCTTGGATGCGCTTGCTTCTATGACAGGCGTTACAGTTGAACA
GGTGTTGGCCGCTATTAAGAGGCTGCATTCTGGATTCCAGGGCAAACAAATTTTAGGTAGTTGTGTGCTT
GAAGATGAGCTGACACCAAGTGATGTTTATCAACAACTAGCTGGTGTCAAGCTACAGTCAAAGCGCACAA
GAGTTATAAAAGGTACATGTTGCTGGATATTGGCTTCAACGTTTTTGTTCTGTAGCATTATCTCAGCATT
TGTAAAATGGACTATGTTTATGTATGTTACTACCCATATGTTGGGAGTGACATTGTGTGCACTTTGTTTT
GTAAGCTTTGCTATGTTGTTGATCAAGCATAAGCATTTGTATTTAACTATGTATATTATGCCTGTGTTAT
GCACACTGTTTTACACCAACTATTTGGTTGTGTACAAACAGAGTTTTAGAGGTCTAGCTTATGCTTGGCT
TTCACACTTTGTCCCTGCTGTAGATTATACATATATGGATGAAGTTTTATATGGTGTTGTGTTGCTAGTA
GCTATGGTGTTTGTTACCATGCGTAGCATAAACCACGACGTCTTTTCTATTATGTTCTTGGTTGGTAGAC
TTGTCAGCCTGGTATCCATGTGGTATTTTGGAGCCAATTTAGAGGAAGAGGTACTATTGTTCCTCACATC
CCTATTTGGCACGTACACATGGACTACTATGTTGTCATTGGCTACCGCTAAGGTTATTGCTAAATGGTTG
GCTGTGAATGTCTTGTACTTCACAGACGTACCGCAAATTAAATTAGTTCTTTTGAGCTACTTGTGTATTG
GTTATGTGTGTTGTTGTTATTGGGGAATCTTGTCACTCCTTAATAGCATTTTTAGGATGCCATTGGGCGT
CTACAATTATAAAATCTCCGTTCAGGAGTTACGTTATATGAATGCTAATGGCTTGCGCCCACCTAGAAAT
AGTTTTGAGGCCCTGATGCTTAATTTTAAGCTGTTGGGAATTGGTGGTGTGCCAGTCATTGAAGTATCTC
AAATTCAATCAAGATTGACGGATGTTAAATGTGCTAATGTTGTGTTGCTTAATTGCCTCCAGCACTTGCA
TATTGCATCTAATTCTAAGTTGTGGCAGTATTGTAGTACTTTGCACAATGAAATACTGGCTACATCTGAT
TTGAGCGTGGCCTTCGATAAGTTGGCTCAGCTCTTAGTTGTTTTATTTGCTAATCCAGCAGCAGTGGATA
GCAAGTGCCTTGCAAGTATTGAAGAAGTGAGCGATGATTACGTTCGCGACAATACTGTCTTGCAAGCCTT
ACAGAGTGAATTTGTTAATATGGCTAGCTTCGTTGAGTATGAACTTGCTAAGAAGAATCTAGATGAGGCT
AAGGCTAGCGGCTCTGCCAATCAACAGCAGATTAAGCAGCTAGAGAAGGCGTGTAATATTGCTAAGTCAG
CATATGAGCGCGACAGAGCTGTTGCTCGTAAGCTGGAACGTATGGCTGATTTAGCTCTTACAAACATGTA
TAAAGAAGCTAGAATTAATGATAAGAAGAGTAAGGTAGTGTCTGCATTGCAAACCATGCTCTTTAGTATG
GTGCGTAAGCTAGATAACCAAGCTCTTAATTCTATTTTAGATAATGCAGTTAAGGGTTGTGTACCTTTGA
ATGCAATACCATCATTGACTTCGAACACTCTGACTATAATAGTGCCAGATAAGCAGGTTTTTGATCAGGT
TGTGGATAATGTGTATGTCACCTATGCTGGGAATGTATGGCATATACAGTTTATTCAAGATGCTGATGGT
GCTGTTAAACAATTGAATGAGATAGATGTTAATTCAACCTGGCCTCTAGTCATTGCTGCAAATAGGCATA
ATGAAGTGTCTACTGTTGTTTTGCAGAACAATGAGTTGATGCCTCAGAAGTTGAGAACTCAGGTTGTCAA
TAGTGGCTCAGATATGAATTGTAATACTCCTACCCAGTGTTACTATAATACTACTGGCACGGGTAAGATT
GTGTATGCTATACTTAGTGACTGTGATGGTCTCAAGTACACTAAGATAGTAAAAGAAGATGGAAATTGTG
TTGTTTTGGAATTGGATCCTCCCTGTAAGTTTTCTGTTCAGGATGTGAAGGGCCTTAAAATTAAGTACCT
TTACTTTGTGAAGGGGTGTAATACACTGGCTAGAGGCTGGGTTGTAGGCACCTTATCCTCGACAGTGAGA
TTGCAGGCGGGTACGGCAACTGAGTATGCCTCCAACTCTGCAATACTGTCGCTGTGTGCGTTTTCTGTAG
ATCCTAAGAAAACGTACTTGGATTATATAAAACAGGGTGGAGTTCCCGTTACTAATTGTGTTAAGATGTT
ATGTGACCATGCTGGCACTGGTATGGCCATTACTATTAAGCCGGAGGCAACCACTAATCAGGATTCTTAT
GGTGGTGCTTCCGTTTGTATATATTGCCGCTCGCGTGTTGAACATCCAGATGTTGATGGATTGTGCAAAT
TACGCGGCAAGTTTGTCCAAGTGCCCTTAGGCATAAAAGATCCTGTGTCATATGTGTTGACGCATGATGT
TTGTCAGGTTTGTGGCTTTTGGCGAGATGGTAGCTGTTCCTGTGTAGGCACAGGCTCCCAGTTTCAGTCA
AAAGACACGAACTTTTTAAACGGGTTCGGGGTACAAGTGTAAATGCCCGTCTTGTACCCTGTGCCAGTGG
CTTGGACACTGATGTTCAATTAAGGGCATTTGACATTTGTAATGCTAATCGAGCTGGCATTGGTTTGTAT
TATAAAGTGAATTGCTGCCGCTTCCAGCGTGTAGATGAGGACGGCAACAAGTTGGATAAGTTCTTTGTTG
TTAAAAGAACTAATTTAGAAGTGTATAATAAGGAGAAAGAATGCTATGAGTTGACAAAAGAATGCGGTGT
TGTGGCTGAACACGAGTTCTTCACATTTGATGTGGAGGGAAGTCGGGTACCACACATAGTCCGTAAAGAT
CTTTCAAAGTTTACTATGTTAGATCTTTGCTATGCATTGCGTCATTTTGACCGCAATGATTGTTCAACTC
TTAAGGAAATTCTCCTTACATATGCTGAGTGTGAAGAGTCCTACTTCCAAAAGAAGGACTGGTATGATTT
TGTTGAGAATCCTGATATAATTAATGTGTATAAAAAGCTTGGTCCTATATTTAATAGAGCCCTGCTTAAC
ACTGCCAAGTTTGCAGACGCATTAGTGGAGGCAGGCTTAGTAGGTGTTTTAACACTTGATAATCAAGATT
TATATGGTCAATGGTATGACTTTGGAGATTTTGTCAAGACAGTACCTGGTTGTGGTGTTGCCGTGGCAGA
CTCTTATTATTCATATATGATGCCAATGCTGACTATGTGTCATGCGTTGGATAGTGAGTTGTTTGTTAAT
GGTACTTATAGGGAGTTTGACCTTGTTCAGTATGATTTTACTGATTTCAAGCTAGAGCTCTTCACTAAGT
ATTTTAAGCATTGGAGTATGACCTACCACCCGAACACCTGTGAGTGCGAGGATGACAGGTGCATTATTCA
TTGCGCCAATTTTAATATACTTTTTAGTATGGTCTTACCTAAGACCTGTTTTGGGCCTCTTGTTAGGCAG
ATATTTGTGGATGGTGTTCCTTTCGTTGTGTCGATCGGTTACCATTATAAAGAATTAGGTGTTGTTATGA
ATATGGATGTGGATACACATCGTTATCGCTTGTCTCTTAAGGACTTGCTTTTGTATGCTGCAGACCCTGC
CCTTCATGTGGCGTCTGCTAGTGCACTGCTTGATTTGCGCACATGTTGTTTTAGCGTTGCAGCTATTACA
AGTGGCGTAAAATTTCAAACAGTTAAACCTGGAAATTTTAATCAGGATTTTTATGAGTTTATTTTGAGTA
AAGGCCTGCTTAAAGAGGGGAGCTCCGTTGATTTGAAGCACTTCTTCTTTACGCAGGATGGTAATGCTGC
TATTACTGATTATAATTATTACAAGTATAATCTACCCACCATGGTGGATATTAAGCAGTTGTTGTTTGTT
TTAGAAGTTGTTAATAAGTATTTTGAGATCTATGAGGGTGGGTGTATACCCGCAACACAGGTCATTGTTA
ATAATTATGATAAGAGTGCTGGCTATCCATTTAATAAATTTGGAAAGGCCAGGCTCTATTATGAGGCATT
ATCATTTGAGGAGCAGGATGAAATTTATGCGTATACCAAACGCAATGTCCTGCCGACCCTAACTCAAATG
AATCTTAAATATGCTATTAGTGCTAAGAATAGGGCCCGCACCGTTGCTGGTGTCTCTATTCTCAGTACTA
TGACTGGCAGAATGTTTCATCAAAAGTGTCTAAAGAGTATAGCAGCTACTCGCGGTGTTCCTGTAGTTAT
AGGCACCACGAAGTTCTATGGCGGTTGGGATGATATGTTACGCCGCCTTATTAAAGATGTTGATAGTCCT
GTACTCATGGGTTGGGACTATCCTAAATGTGATCGTGCTATGCCAAACATACTGCGTATTGTTAGTAGTT
TGGTGCTAGCCCGTAAACATGATTCGTGCTGTTCGCATACGGATAGATTCTATCGTCTTGCGAACGAGTG
CGCCCAAGTTTTGAGTGAAATTGTTATGTGTGGTGGTTGTTATTATGTTAAACCAGGTGGCACTAGTAGT
GGGGATGCAACCACTGCTTTTGCTAATTCTGTGTTTAACATTTGTCAAGCTGTTTCCGCCAATGTATGCT
CGCTTATGGCATGCAATGGACACAAAATTGAAGATTTGAGTATACGCGAGTTACAAAAGCGCCTATACTC
TAATGTCTATCGTGCGGACCATGTTGACCCCGCATTTGTTAGTGAGTATTATGAGTTTTTAAATAAGCAT
TTTAGTATGATGATTTTGAGTGATGATGGTGTTGTGTGTTATAATTCAGAGTTTGCGTCCAAGGGTTATA
TTGCTAATATAAGTGCCTTTCAACAGGTATTATATTATCAAAATAATGTGTTTATGTCTGAGGCCAAATG
TTGGGTAGAAACAGACATCGAAAAGGGACCGCATGAATTTTGTTCTCAACATACAATGCTAGTCAAGATG
GATGGTGATGAAGTCTACCTTCCATACCCTGATCCTTCGAGAATCTTAGGAGCAGGCTGTTTTGTTGATG
ATTTATTAAAGACTGATAGCGTTCTCTTGATAGAGCGTTTCGTAAGTCTTGCAATTGATGCTTATCCTTT
AGTATACCATGAGAACCCAGAGTATCAAAATGTGTTCCGGGTATATTTAGAATATATAAAGAAGCTGTAC
AATGATCTCGGTAATCAGATCCTGGACAGCTACAGTGTTATTTTAAGTACTTGTGATGGTCAAAAGTTTA
CTGATGAGACCTTTTACAAGAACATGTATTTAAGAAGTGCAGTGCTGCAAAGCGTTGGTGCCTGCGTTGT
CTGTAGTTCTCAAACATCATTACGTTGTGGCAGTTGCATACGCAAGCCTTTGCTGTGTTGCAAATGCGCC
TATGATCATGTTATGTCCACTGATCATAAATATGTCCTGAGTGTGTCACCATATGTGTGTAATTCACCGG
GATGTGATGTAAATGATGTTACCAAATTGTATTTAGGTGGTATGTCATATTATTGTGAGGACCATAAACC
ACAGTATTCATTCAAATTGGTGATGAATGGTATGGTTTTTGGTTTATATAAACAATCTTGTACTGGTTCG
CCCTACATAGAGGATTTTAATAAAATAGCTAGTTGCAAATGGACAGAAGTCGATGATTATGTGCTAGCTA
ATGAATGCACCGAACGCCTTAAATTGTTTGCCGCAGAAACGCAGAAGGCCACAGAAGAGGCCTTTAAGCA
ATGTTATGCGTCAGCAACGATCCGTGAGATCGTGAGCGATCGGGAGTTAATTTTATCTTGGGAAATTGGT
AAAGTGAGACCACCACTTAATAAAAATTATGTTTTTACTGGCTACCATTTTACTAATAATGGTAAGACAG
TTTTAGGTGAGTATGTTTTTGATAAGAGTGAGTTGACTAATGGTGTGTACTATCGCGCCACAACCACTTA
TAAGTTATCTGTAGGTGATGTGTTCATTTTAACATCACACGCAGTGTCTAGTTTAAGTGCTCCTACATTA
GTACCGCAGGAGAATTATACTAGCATTCGTTTTGCTAGTGTTTATAGTGTGCCTGAGACGTTTCAGAATA
ATGTGCCTAATTATCAGCACATTGGAATGAAGCGCTATTGTACTGTACAGGGACCGCCTGGTACTGGTAA
GTCCCATCTAGCCATTGGGCTAGCTGTTTATTATTGTACAGCGCGCGTGGTGTATACCGCTGCTAGCCAT
GCTGCAGTTGACGCGCTGTGTGAAAAGGCACATAAATTTTTAAATATTAATGACTGCACGCGTATTGTTC
CTGCAAAGGTGCGTGTAGATTGTTATGATAAATTTAAGGTCAATGACACCACTCGCAAGTATGTGTTTAC
TACAATAAATGCATTACCTGAGTTGGTGACTGACATTATTGTCGTTGATGAAGTTAGTATGCTTACCAAC
TATGAGCTGTCTGTTATTAACAGTCGTGTTAGTGCTAAGCATTATGTGTATATTGGAGACCCTGCGCAGT
TACCTGCACCACGTGTGCTACTGAATAAGGGAACTCTAGAACCTAGATATTTTAATTCCGTTACCAAGCT
AATGTGTTGTTTGGGTCCAGATATTTTCTTGGGCACCTGTTATAGATGCCCTAAGGAGATTGTGGATACG
GTGTCAGCCTTGGTTTATAATAATAAGCTGAAGGCTAAAAATGATAATAGCTCCATGTGCTTTAAGGTTT
ATTATAAGGGCCAGACTACACATGAGAGTTCTAGTGCTGTTAATATGCAGCAAATACATTTAATTAGTAA
GTTTTTAAAGGCAAACCCCAGTTGGAGTAACGCCGTATTTATTAGTCCTTATAATAGTCAGAACTATGTT
GCTAAGAGAGTCTTGGGATTACAAACCCAGACAGTAGACTCAGCGCAGGGTTCTGAATATGATTTTGTTA
TTTATTCACAGACTGCGGAAACAGCGCATTCTGTCAATGTAAATAGATTCAATGTTGCTATTACACGTGC
TAAGAAGGGTATTCTCTGTGTCATGAGTAGTATGCAATTATTTGAGTCTCTTAATTTTACTACACTGACG
TTGGATAAGATTAACAATCCACGATTACAGTGTACTACAAATTTGTTTAAGGATTGTAGCAGGAGCTATG
TAGGATATCACCCAGCCCATGCACCATCCTTTTTGGCAGTTGATGACAAATATAAGGTAGGCGGTGATTT
AGCCGTTTGCCTTAATGTTGCTGATTCTGCTGTCACTTATTCGCGGCTTATATCACTCATGGGATTCAAG
CTTGACTTGACCCTTGATGGTTATTGTAAGCTGTTTATAACTAGAGATGAAGCTATCAAACGTGTTAGAG
CCTGGGTTGGCTTCGATGCAGAAGGTGCCCATGCGATACGTGATAGCATTGGGACAAATTTCCCATTACA
ATTAGGCTTTTCGACTGGAATTGATTTTGTTGTCGAAGCCACTGGAATGTTTGCTGAGAGAGATGGTTAT
GTCTTTAAAAAGGCAGCCGCACGAGCTCCTCCTGGCGAACAATTTAAACACCTTATCCCACTTATGTCAA
GAGGGCAGAAATGGGATGTGGTTCGAATTAGAATAGTACAAATGTTGTCAGACCACCTAGCGGATTTGGC
AGACAGTGTTGTACTTGTGACGTGGGCTGCCAGCTTTGAGCTCACATGTTTGCGATATTTCGCTAAAGTT
GGAAGAGAAGTTGTGTGTAGTGTCTGCACCAAGCGTGCGACATGTTTTAATTCTAGAACTGGATACTATG
GATGCTGGCGACATAGTTATTCCTGTGATTACCTGTACAACCCACTAATAGTTGACATTCAACAGTGGGG
ATATACAGGATCTTTAACTAGCAATCATGATCCTATTTGCAGCGTGCATAAGGGTGCTCATGTTGCATCA
TCTGATGCTATCATGACCCGGTGTCTAGCTGTTCATGATTGCTTTTGTAAGTCTGTTAATTGGAATTTAG
AATACCCCATTATTTCAAATGAGGTCAGTGTTAATACCTCCTGCAGGTTATTGCAGCGCGTAATGTTTAG
GGCTGCGATGCTATGCAATAGGTATGATGTGTGTTATGACATTGGCAACCCTAAAGGTCTTGCCTGTGTC
AAAGGATATGATTTTAAGTTTTATGATGCCTCCCCTGTTGTTAAGTCTGTTAAACAGTTTGTTTATAAAT
ACGAGGCACATAAAGATCAATTTTTAGATGGTTTGTGTATGTTTTGGAACTGCAATGTGGATAAGTATCC
AGCGAATGCAGTTGTGTGTAGGTTTGACACGCGTGTGTTGAACAAATTAAATCTCCCTGGCTGTAATGGT
GGCAGTTTGTATGTTAACAAACATGCATTCCACACCAGTCCCTTTACCCGGGCTGCCTTCGAGAATTTGA
AGCCTATGCCTTTCTTTTATTATTCAGATACGCCCTGTGTGTATATGGAAGGCATGGAATCTAAGCAGGT
CGATTATGTCCCATTGAGAAGCGCTACATGCATCACAAGATGCAATTTAGGTGGCGCTGTTTGTTTAAAA
CATGCTGAGGAGTATCGTGAGTACCTTGAGTCTTACAATACGGCAACCACAGCGGGTTTTACTTTTTGGG
TCTATAAGACTTTTGATTTTTATAACCTTTGGAATACTTTTACTAGGCTCCAAAGTTTAGAAAATGTAGT
GTATAATTTGGTCAATGCTGGACACTTTGATGGCCGGGCGGGTGAACTGCCTTGTGCTGTTATAGGTGAG
AAAGTCATTGCCAAGATTCAAAATGAGGATGTCGTGGTCTTTAAAAATAACACGCCATTCCCCACTAATG
TGGCTGTCGAATTATTTGCTAAGCGCAGTATTCGGCCCCACCCCGAGCTTAAGCTCTTTAGAAATTTGAA
TATTGACGTGTGCTGGAGTCACGTCCTTTGGGATTATGCTAAGGATAGTGTGTTTTGCAGTTCGACGTAT
AAGGTCTGCAAATACACAGATTTACAGTGCATTGAAAGCTTGAATGTACTTTTTGATGGTCGTGATAATG
GTGCTCTTGAAGCTTTTAAGAAGTGCCGGAATGGCGTCTACATTAACACGACAAAAATTAAAAGTCTGTC
GATGATTAAAGGCCCACAACGTGCCGATTTGAATGGCGTAGTTGTGGAGAAAGTTGGAGATTCTGATGTG
GAATTTTGGTTTGCTGTGCGTAAAGACGGTGACGATGTTATCTTCAGCCGTACAGGGAGCCTTGAACCGA
GCCATTACCGGAGCCCACAAGGTAATCCGGGTGGTAATCGCGTGGGTGATCTCAGCGGTAATGAAGCTCT
AGCGCGTGGCACTATCTTTACTCAAAGCAGATTATTATCTTCTTTCACACCTCGATCAGAGATGGAGAAA
GATTTTATGGATTTAGATGATGATGTGTTCATTGCAAAATATAGTTTACAGGACTACGCGTTTGAACACG
TTGTTTATGGTAGTTTTAACCAGAAGATTATTGGAGGTTTGCATTTGCTTATTGGCTTAGCCCGTAGGCA
GCAAAAATCCAATCTGGTAATTCAAGAGTTCGTGACATACGACTCTAGCATTCATTCGTACTTTATCACT
GACGAGAACAGTGGTAGTAGTAAGAGTGTGTGCACTGTTATTGATTTATTGTTAGATGATTTTGTGGACA
TTGTAAAGTCCCTGAATCTAAAGTGTGTGAGTAAGGTTGTTAATGTTAATGTTGATTTTAAAGATTTCCA
GTTTATGTTGTGGTGCAATGAGGAGAAGGTCATGACTTTCTATCCTCGTTTGCAGGCTGCTGCTGACTGG
AAACCTGGTTATGTTATGCCTGTCTTATATAAGTATTTGGAATCGCCTCTGGAAAGAGTAAACCTCTGGA
ATTATGGCAAGCCGATTACTTTACCTACAGGATGTATGATGAATGTTGCTAAGTATACTCAATTATGTCA
ATATTTGAGCACTACAACATTAGCAGTTCCGGCTAATATGCGTGTCTTACACCTTGGTGCCGGTTCGGAT
AAGGGTGTTGCCCCTGGGTCTGCAGTTCTTAGGCAGTGGCTACCAGCGGGAAGTATTCTTGTAGATAATG
ATGTGAATCCATTTGTGAGTGACAGTGTCGCCTCATATTATGGAAATTGTATAACCTTACCCTTTGATTG
TCAGTGGGATCTGATAATTTCTGATATGTACGACCCTCTTACTAAGAACATTGGGGAGTACAACGTGAGT
AAAGATGGATTCTTTACTTACCTCTGTCATTTAATTCGTGACAAGTTGGCTCTGGGTGGCAGTGTTGCCA
TAAAAATAACAGAGTTTTCTTGGAACGCTGAGTTATATAGTTTAATGGGGAAGTTTGCGTTCTGGACAAT
CTTTTGCACCAACGTAAACGCCTCTTCAAGTGAAGGATTTTTGATTGGCATAAATTGGTTGAATAAGACC
CGTACCGAAATTGACGGTAAAACCATGCATGCCAATTATCTGTTTTGGAGAAATAGTACAATGTGGAATG
GAGGGGCTTACAGTCTCTTTGACATGAGTAAGTTCCCTTTGAAAGCGGCTGGTACGGCTGTTGTTAGCCT
TAAACCAGACCAAATAAATGACTTAGTCCTCTCCTTGATTGAGAAGGGCAAGTTATTAGTGCGTGATACA
CGCAAAGAAGTTTTTGTTGGCGATAGCCTAGTAAATGTCAAATAAATCTATACTTGTCGTGGCTGTGAAA
ATGGCCTTTGCTGACAAGCCTAATCATTTCATAAACTTTCCCCTGGCCCAATTTAGTGGCTTTATGGGTA
AGTATTTAAAGCTACAGTCTCAACTTGTGGAAATGGGTTTAGACTGTAAATTACAGAAGGCACCACATGT
TAGTATTACCCTGCTTGATATTAAAGCAGACCAATACAAACAGGTGGAATTTGCAATACAAGAAATAATA
GATGATCTGGCGGCATATGAGGGAGATATTGTCTTTGACAACCCTCACATGCTTGGCAGATGCCTTGTTC
TTGATGTTAGAGGATTTGAAGAGTTGCATGAAGATATTGTTGAAATTCTCCGCAGAAGGGGTTGCACGGC
AGATCAATCCAGACACTGGATTCCGCACTGCACTGTGGCCCAATTTGACGAAGAAAGAGAAACAAAAGGA
ATGCAATTCTATCATAAAGAACCCTTCTACCTCAAGCATAACAACCTATTAACGGATGCTGGGCTTGAGC
TCGTGAAGATAGGTTCTTCCAAAATAGATGGGTTTTATTGTAGTGAACTGAGTGTTTGGTGTGGTGAGAG
GCTTTGTTATAAGCCTCCAACACCCAAATTCAGTGATATATTTGGCTATTGCTGCATAGATAAAATACGT
GGTGATTTAGAAATAGGAGACCTACCGCAGGATGATGAGGAAGCGTGGGCCGAGCTAAGTTACCACTATC
AAAGAAACACCTACTTCTTCAGACATGTGCACGATAATAGCATCTATTTTCGTACCGTGTGTAGAATGAA
GGGTTGTATGTGTTGATTTGTTTTTACACTATTAGTGTAATAAGCTTATTATTTTGTTGAAAAGGGCAGG
ATGTGCATAGCTATGGCTCCTCGCACACTGCTTTTGCTGATTTGATGTCAGCTGGTGTTTGGGTTCAATG
AACCTCTTAACATCGTTTCACATTTAAATGATGACTGGTTTCTATTTGGTGACAGTCGTTCTGACTGTAC
CTATGTAGAAAATAACGGTCATCCTAAATTAGATTGGCTTGACCTCGACCCAAAGTTGTGTAATTCAGGA
AAGATTTCCGCAAAGAGTGGTAACTCTCTCTTTAGGAGTTTTCACTTCACTGATTTTTACAATTATACGG
GTGAGGGAGACCAAATTGTATTTTATGAAGGAGTTAATTTTAGTCCCAGCCATGGCTTTAAATGCCTGGC
TCATGGAGATAATAAAAGATGGATGGGCAATAAAGCTCGATTTTATGCCCGAGTGTATGAGAAGATGGCC
CAATATAGGAGCCTATCGTTTGTTAATGTGTCTTATGCCTATGGAGGTAATGCAAAGCCCGCCTCCATTT
GCAAAGACAATACTTTAACACTCAATAACCCCACCTTCATATCGAAGGAGTCTAATTATGTTGATTATTA
CTATGAGAGTGAGGCTAATTTCACACTAGAAGGTTGTGATGAATTTATAGTACCGCTCTGTGGTTTTAAT
GGCCATTCCAAGGGCAGCTCTTCGGATGCTGCCAATAAATATTATACTGACTCTCAGAGTTACTATAATA
TGGATATTGGTGTCTTATATGGGTTCAATTCGACCTTGGATGTTGGCAACACTGCTAAGGATCCGGGTCT
TGATCTCACTTGCAGGTATCTTGCATTGACTCCTGGTAATTATAAGGCTGTGTCCTTAGAATATTTGTTA
AGCTTACCCTCAAAGGCTATTTGCCTCCATAAGACAAAGCGCTTTATGCCTGTGCAGGTAGTTGACTCAA
GGTGGAGTAGCATCCGCCAGTCAGACAATATGACCGCTGCAGCCTGTCAGCTGCCATATTGTTTCTTTCG
CAACACATCTGCGAATTATAGTGGTGGCACACATGATGCGCACCATGGTGATTTTCATTTCAGGCAGTTA
TTGTCTGGTTTGTTATATAATGTTTCCTGTATTGCCCAGCAGGGTGCATTTCTTTATAATAATGTTAGTT
CCTCTTGGCCAGCCTATGGGTACGGTCATTGTCCAACGGCAGCTAACATTGGTTATATGGCACCTGTTTG
TATCTATGACCCTCTCCCGGTCATACTGCTAGGTGTGTTATTGGGTATAGCTGTGTTGATTATTGTGTTT
TTGATGTTTTATTTTATGACGGATAGCGGTGTTAGATTGCATGAGGCATAATCTAAACATGCTGTTCGTG
TTTATTCTATTTTTGCCCTCTTGTTTAGGGTATATTGGTGATTTTAGATGTATCCAGCTTGTGAATTCAA
ACGGTGCTAATGTTAGTGCTCCAAGCATTAGCACTGAGACCGTTGAAGTTTCACAAGGCCTGGGGACATA
TTATGTGTTAGATCGAGTTTATTTAAATGCCACATTATTGCTTACTGGTTACTACCCGGTCGATGGTTCT
AAGTTTAGAAACCTCGCTCTTACGGGAACTAACTCAGTTAGCTTGTCGTGGTTTCAACCACCCTATTTAA
GTCAGTTTAATGATGGCATATTTGCGAAGGTGCAGAACCTTAAGACAAGTACGCCATCAGGTGCAACTGC
ATATTTTCCTACTATAGTTATAGGTAGTTTGTTTGGCTATACTTCCTATACCGTTGTAATAGAGCCATAT
AATGGTGTTATAATGGCCTCAGTGTGCCAGTATACCATTTGTCTGTTACCTTACACTGATTGTAAGCCTA
ACACTAATGGTAATAAGCTTATAGGGTTTTGGCACACGGATGTAAAACCCCCAATTTGTGTGTTAAAGCG
AAATTTCACGCTTAATGTTAATGCTGATGCATTTTATTTTCATTTTTACCAACATGGTGGTACTTTTTAT
GCGTACTATGCGGATAAACCCTCCGCTACTACGTTTTTGTTTAGTGTATATATTGGCGATATTTTAACAC
AGTATTATGTGTTACCTTTCATCTGCAACCCAACAGCTGGTAGCACTTTTGCTCCGCGCTATTGGGTTAC
ACCTTTGGTTAAGCGCCAATATTTGTTTAATTTCAACCAGAAGGGTGTCATTACTAGTGCTGTTGATTGT
GCTAGTAGTTATACCAGTGAAATAAAATGTAAGACCCAGAGCATGTTACCTAGCACTGGTGTCTATGAGT
TATCCGGTTATACGGTCCAACCAGTTGGAGTTGTATACCGGCGTGTTGCTAACCTCCCAGCTTGTAATAT
AGAGGAGTGGCTTACTGCTAGGTCAGTCCCCTCCCCTCTCAACTGGGAGCGTAAGACTTTTCAGAATTGT
AATTTTAATTTAAGCAGCCTGTTACGTTATGTTCAGGCTGAGAGTTTGTTTTGTAATAATATCGATGCTT
CCAAAGTGTATGGCAGGTGCTTTGGTAGTATTTCAGTTGATAAGTTTGCTGTACCCCGAAGTAGGCAAGT
TGATTTACAGCTTGGTAACTCTGGATTTCTGCAGACTGCTAATTATAAGATTGATACAGCTGCCACTTCG
TGTCAGCTGCATTACACCTTGCCTAAGAATAATGTCACCATAAACAACCATAACCCCTCGTCTTGGAATA
GGAGGTATGGCTTTAATGATGCTGGCGTCTTTGGCAAAAACCAACATGACGTTGTTTACGCTCAGCAATG
TTTTACTGTAAGATCTAGTTATTGCCCGTGTGCTCAACCGGACATAGTTAGCCCTTGCACTACTCAGACT
AAGCCTAAGTCTGCTTTTGTTAATGTGGGTGACCATTGTGAAGGCTTAGGTGTTTTAGAAGATAATTGTG
GCAATGCTGATCCACATAAGGGTTGTATCTGTGCCAACAATTCATTTATTGGATGGTCACATGATACCTG
CCTTGTTAATGATCGCTGCCAAATTTTTGCTAATATATTGTTAAATGGCATTAATAGTGGTACCACATGT
TCCACAGATTTGCAGTTGCCTAATACTGAAGTGGTTACTGGCATTTGTGTCAAATATGACCTCTACGGTA
TTACTGGACAAGGTGTTTTTAAAGAGGTTAAGGCTGACTATTATAATAGCTGGCAAACCCTTCTGTATGA
TGTTAATGGTAATTTGAATGGTTTTCGTGATCTTACCACTAACAAGACTTATACGATAAGGAGCTGTTAT
AGTGGCCGTGTTTCTGCTGCATTTCATAAAGATGCACCCGAACCGGCTCTGCTCTATCGTAATATAAATT
GTAGCTATGTTTTTAGCAATAATATTTCCCGTGAGGAGAACCCACTTAATTACTTTGATAGTTATTTGGG
TTGTGTTGTTAATGCTGATAACCGCACGGATGAGGCGCTTCCTAATTGTGATCTCCGTATGGGTGCTGGC
TTATGCGTTGATTATTCAAAATCACGCAGGGCTGACCGATCAGTTTCTACTGGCTATCGGTTAACTACAT
TTGAGCCATACACTCCGATGTTAGTTAATGATAGTGTCCAATCCGTTGATGGATTATATGAGATGCAAAT
ACCAACCAATTTTACTATTGGGCACCATGAGGAGTTCATTCAAACTAGATCTCCAAAGGTGACTATAGAT
TGTGCTGCATTTGTCTGTGGTGATAACACTGCATGCAGGCAGCAGTTGGTTGAGTATGGCTCTTTCTGTG
TTAATGTTAATGCCATTCTTAATGAGGTTAATAACCTCTTGGATAATATGCAACTACAAGTTGCTAGTGC
ATTAATGCAGGGTGTTACTATAAGCTCGAGACTGCCAGACGGCATCTCAGGCCCTATAGATGACATTAAT
TTTAGTCCTCTACTTGGATGCATAGGTTCAACATGTGCTGAAGACGGCAATGGACCTAGTGCAATCCGAG
GGCGTTCTGCTATAGAGGATTTGTTATTTGACAAGGTCAAATTATCTGATGTTGGCTTTGTCGAGGCTTA
TAATAATTGCACCGGTGGTCAAGAAGTTCGTGACCTCCTTTGTGTACAATCTTTTAATGGCATCAAAGTA
TTACCTCCTGTGTTGTCAGAGAGTCAGATCTCTGGCTACACAACCGGTGCTACTGCGGCAGCTATGTTCC
CACCGTGGTCAGCAGCTGCCGGTGTGCCATTTAGTTTAAGTGTTCAATATAGAATTAATGGTTTAGGTGT
CACTATGAATGTGCTTAGTGAGAACCAAAAGATGATTGCTAGTGCTTTTAACAATGCGCTGGGTGCTATC
CAGGATGGGTTTGATGCAACCAATTCTGCTTTAGGTAAGATCCAGTCCGTTGTTAATGCAAATGCTGAAG
CACTCAATAACTTACTAAATCAACTTTCTAACAGGTTTGGTGCTATTAGTGCTTCTTTACAAGAAATTCT
AACTCGGCTTGAGGCTGTAGAAGCAAAAGCCCAGATAGATCGTCTTATTAATGGCAGGTTAACTGCACTT
AATGCGTATATATCCAAGCAACTTAGTGATAGTACGCTTATTAAAGTTAGTGCTGCTCAGGCCATAGAAA
AGGTCAATGAGTGCGTTAAGAGCCAAACCACGCGTATTAATTTCTGTGGCAATGGTAATCATATATTATC
TCTTGTCCAGAATGCGCCTTATGGCTTATATTTTATACACTTCAGCTATGTGCCAATATCCTTTACAACC
GCAAATGTGAGTCCTGGACTTTGCATTTCTGGTGATAGAGGATTAGCACCTAAAGCTGGATATTTTGTTC
AAGATGATGGAGAATGGAAGTTCACAGGCAGTTCATATTACTACCCTGAACCCATTACAGATAAAAACAG
TGTCATTATGAGTAGTTGCGCAGTAAACTACACAAAGGCACCTGAAGTTTTCTTGAACACTTCAATACCT
AATCCACCCGACTTTAAGGAGGAGTTAGATAAATGGTTTAAGAATCAGACGTCTATTGCGCCTGATTTAT
CTCTCGATTTCGAGAAGTTAAATGTTACTTTGCTGGACCTGACGTATGAGATGAACAGGATTCAGGATGC
AATTAAGAAGTTAAATGAGAGCTACATCAACCTCAAGGAAGTTGGCACATATGAAATGTATGTGAAATGG
CCTTGGTATGTTTGGTTGCTAATTGGATTAGCTGGTGTAGCTGTTTGTGTGTTGTTATTCTTTATATGTT
GCTGCACAGGTTGTGGCTCATGTTGTTTTAAGAAGTGTGGAAATTGTTGTGATGAGTATGGAGGACACCA
GGACAGTATTGTGATACATAATATTTCCTCTCATGAGGATTGACTATCACAGCCTCTCCTGGAAAGACAG
AAAATCTAAACAATTTATAGCATTCTCATTGCTACCTGGCCCCGTAAGAGGCAGTCATAGCTATGGCCGT
GTTGGTCCTAAGGCTACATTGGCTGCTGTCTTTATTGGTCCATTTATTGTAGCATGTATGCTAGGCATTG
GCCTAGTTTATTTATTGCAATTGCAAGTTCAAATTTTTCATGTTAAGGATACCATACGTGTGACTGGCAA
GCCAGCCACTGTGTCTTATACTACAAGTACACCAGTAACACCGAGCGCGACGACGCTCGATGGTACTACG
TATACTTTAATTAGACCCACTAGCTCTTATACAAGAGTTTATCTTGGTACTCCAAGAGGTTTTGATTATA
GTACATTTGGGCCTAAGACCCTAGATTATGTTACTAATCTAAACCTCATCTTAATTCTGGTCGTCCATAT
ACTTTTAAGGCATTGTCCAGGCATATGAGACCAACAGCCACATGGATTTGGCATGTGAGTGATGCATGGT
TACGCCGCACGCGGGACTTTGGTGTCATTCGCCTAGAAGATTTTTGTTTTCAATTTAATTATAGCCAACC
CCGAGTTGGTTATTGTAGAGTTCCTTTAAAGGCTTGGTGTAGCAACCAGGGTAAATTTGCAGCGCAGTTT
ACCCTAAAAAGTTGCGAAAAACCAGGTCACGAAAAATTTATTACTAGCTTCACGGCCTACGGCAGAACTG
TCCAACAGGCCGTTAGCAAGTTAGTAGAAGAAGCTGTTGATTTTATTCTTTTTAGGGCCACGCAGCTCGA
AAGAAATGTTTAATTTATTCCTTACAGACACAGTATGGTATGTGGGGCAGATTATTTTTATATTCGCAGT
GTGTTTGATGGTCACCATAATTGTGGTTGCCTTCCTTGCGTCTATCAAACTTTGTATTCAACTTTGCGGT
TTATGTAATACTTTGGTGCTGTCCCCTTCTATTTATTTGTATGATAGGAGTAAGCAGCTTTATAAGTATT
ATAATGAAGAAATGAGACTGCCCCTATTAGAGGTGGATGATATCTAATCTAAACATTATGAGTAGTACTA
CTCAGGCCCCAGAGCCCGTCTATCAATGGACGGCCGACGAGGCAGTTCAATTCCTTAAGGAATGGAACTT
CTCGTTGGGCATTATACTACTCTTTATTACTATCATACTACAGTTCGGTTACACGAGCCGTAGCATGTTT
ATTTATGTTGTGAAAATGATAATCTTGTGGTTAATGTGGCCACTGACTATTGTTTTGTGTATTTTCAATT
GCGTGTATGCGCTAAATAATGTGTATCTTGGATTTTCTATAGTGTTTACTATAGTGTCCATTGTAATCTG
GATTATGTATTTTGTTAATAGCATAAGGTTGTTTATCAGGACTGGTAGCTGGTGGAGCTTCAACCCCGAA
ACAAACAACCTTATGTGTATAGATATGAAAGGTACCGTGTATGTTAGACCCATTATTGAGGATTACCATA
CACTAACAGCCACTATTATTCGTGGCCACCTCTACATGCAAGGTGTTAAGCTAGGCACCGGTTTCTCTTT
GTCTGACTTGCCCGCTTATGTTACAGTTGCTAAGGTGTCACACCTTTGCACTTATAAGCGCGCATTCTTA
GACAAGGTAGACGGTGTTAGCGGTTTTGCTGTTTATGTGAAGTCCAAGGTCGGAAATTACCGACTGCCCT
CAAACAAACCGAGTGGCGCGGACACCGCATTGTTGAGAATCTAATCTAAACTTTAAGGATGTCTTTTGTT
CCTGGGCAAGAAAATGCCGGTGGCAGAAGCTCCTCTGTAAACCGCGCTGGTAATGGAATCCTCAAGAAGA
CCACTTGGGCTGACCAAACCGAGCGTGGACCAAATAATCAAAATAGAGGCAGAAGGAATCAGCCAAAGCA
GACTGCAACTACTCAACCCAACTCCGGGAGTGTGGTTCCCCATTACTCCTGGTTTTCTGGCATTACCCAG
TTCCAAAAGGGAAAGGAGTTTCAGTTTGCAGAAGGACAAGGAGTGCCTATTGCCAATGGAATCCCCGCTT
CAGAGCAAAAGGGATATTGGTATAGACACAACCGCCGTTCTTTTAAAACACCTGATGGGCAGCAGAAGCA
ATTACTGCCCAGATGGTATTTTTACTATCTTGGCACAGGGCCCCATGCTGGAGCCAGTTATGGAGACAGC
ATTGAAGGTGTCTTCTGGGTTGCAAACAGCCAAGCGGACACCAATACCCGCTCTGATATTGTCGAAAGGG
ACCCAAGCAGTCATGAGGCTATTCCTACTAGGTTTGCGCCCGGCACGGTATTGCCTCAGGGCTTTTATGT
TGAAGGCTCTGGAAGGTCTGCACCTGCTAGCCGATCTGGTTCGCGGTCACAATCCCGTGGGCCAAATAAT
CGCGCTAGAAGCAGTTCCAACCAGCGCCAGCCTGCCTCTACTGTAAAACCTGATATGGCCGAAGAAATTG
CTGCTCTTGTTTTGGCTAAGCTCGGTAAAGATGCCGGCCAGCCCAAGCAAGTAACGAAGCAAAGTGCCAA
AGAAGTCAGGCAGAAAATTTTAAACAAGCCTCGCCAAAAGAGGACTCCAAACAAGCAGTGCCCAGTGCAG
CAGTGTTTTGGAAAGAGAGGCCCCAATCAGAATTTTGGAGGCTCTGAAATGTTAAAACTTGGAACTAGTG
ATCCACAGTTCCCCATTCTTGCAGAGTTGGCTCCAACAGTTGGTGCCTTCTTCTTTGGATCTAAATTAGA
ATTGGTCAAAAAGAATTCTGGTGGTGCTGATGAACCCACCAAAGATGTGTATGAGCTGCAATATTCAGGT
GCAGTTAGATTTGATAGTACTCTACCTGGTTTTGAGACTATCATGAAAGTGTTGAATGAGAATTTGAATG
CCTACCAGAAGGATGGTGGTGCAGATGTGGTGAGCCCAAAGCCCCAAAGAAAAGGGCGTAGACAGGCTCA
GGAAAAGAAAGATGAAGTAGATAATGTAAGCGTTGCAAAGCCCAAAAGCTCTGTGCAGCGAAATGTAAGT
AGAGAATTAACCCCAGAGGATAGAAGTCTGTTGGCTCAGATCCTTGATGATGGCGTAGTGCCAGATGGGT
TAGAAGATGACTCTAATGTGTAAAGAGAATGAATCCTATGTCGGCGCTCGGTGGTAACCCCTCGCGAGAA
AGTCGGGATAGGACACTCTCTATCAGAATGGATGTCTTGCTGTCATAACAGATAGAGAAGGTTGTGGCAG
ACCCTGTATCAATTAGTTGAAAGAGATTGCAAAATAGAGAATGTGTGAGAGAAGTTAGCAAGGTCCTACG
TCTAACCATAAGAACGGCGATAGGCGCCCCCTGGGAAGAGCTCACATCAGGGTACTATTCCTGCAATGCC
CTAGTAAATGAATGAAGTTGATCATGGCCAATTGGAAGAATCACAAAAAAAAAAAAAAAAAAAAAAA

>gi|971745655|ref|NC_028814.1| BtRf-AlphaCoV/HuB2013, complete genome
GGCCCCCATGGCTAGCAACCGTATTTCGTTGGCTTTTGCCAATGATTCAGAGATTTCAGCTCTTGGCTTT
GGTTCCGTCGAGAGCCGTCTCATTCTATAGTGAGGCCGCTGTCGGTGGTTTTGCCAATTGCCGATTTGTC
TCTACGGGTCTTCAAGACATAATTGAAGGCGTCCTTGATGATGACTACGTGTTAGTTATTACAGGGGTGC
ATCAACTAGTCGCCCGTATAGGCCAATTCGGTGACCAACCTTCAAATCTTAGGGGTTGGTTGCTGTTCTC
TAATTCAAACTACTTTTTGGGAGAATTAGATCTTGTCTTTGGTGGACGTGGTGGAAACACAGTCTACGTA
GACAATTACATGTGTGGTTCTAATGGTGTTCCCGTACTTCCTGAAGATCAATGGGAGTTTGTGGACTATT
TTGGTGAACTCACTGAAGTGTCAATTGGTGACACTACCTACATTAAGGCCTGGAACGTTGACAGAGTCGA
GGGGCCTTACAAAAGTCAAACTTTGTTGTCCATCAATGCCATTTCTTACTGCGGTGAAGTAATTCATGCA
TTGGCTGATGGTTCAACCATGTCTTATGCAACAGCTGTGAAAAAGAACAGCAAAACTGTTGTTAATAAGA
CCTTTCAAAAACTTTACGATAACATCGGTGTGCCCTTTGTTACCAATGGTAAAGTTTTAACTGAAATTAT
ACCCAAACCTGTGTTCAATCATGGACTGGTGAAATGCCATTGTGGAAAAGTTTCCTGGACTGTTGGAGAT
TGGAGTTGTTATAAGTCCACTTGTTGTGGAATAGTTTGCAAACCAATCGCTATTGTCAATGGAGACGTTA
ATCCAGGAGATGTTGTGATCACTAGTAAACAGGTGGCGACGAATGGCGTTAAGTACTATAATGGTATGGT
ACTTAAGTATGTAGATACCATCGAGGATGTGCACCTGTGGAGAGTTGTAAAACTGCAGAGCGTGAAAGGC
TTTGTAGCTTCTCCAAACTATGATCCAGCTGAATATGTCTTCCTTGCTGATGACGCTTGCTCACCAACCA
GTCGGTTGGTTATTTCTGCAAGTTACAAACTTGGGTTATTAAATGGAAATTTCACGGACGATGTTCGTGT
TGCAGCCAGAGATGGTACAATTGTCGTTGGCAATAATGTGCTTAGTCTGATTGACGTTGTTCTAACTAAA
CCGTGGTTCGTTCGAAAACTCGAGGAACTTCTCGGAGAAGCGTGGGACACGTTTGTGGCTAGTCTGAAAA
ATCTTGTGTTTACAAGTACTCAGTTGGTCGAACTTACGAAAGCACTCTCAAAAGCCGTGTTAAATGTTAC
TAAAGAAGGTATTGAGTTCGCGGCTGAAGTACCATCATGTTTTGAAAGTTGTTTTTCAGTTTTTAAAGAA
TTTGTTACTGGAATCTTTGATTTTACAGTAAACAGTGTAAAAATTGCAGGCCGTAGCTTTAAAAGTGTTG
GTTCTTACGTTCTGTTTGATAATGCTATAATTAAATTTGTAGCAGTTAAGGTCAAAGGCCTTCATCAAGC
AGGAATCAAACAGACTGAATACGCTACGTCTATAATTGGCAAAACTACTAAAGTTAACTCCAAAAGAACA
GAAAGTGCAGATGTTAACCTTGTGTTAGTCAATGACAAACAACCACTATTGAAGGACGGTGTCACTAAGA
TAATTGGTGGTAAGTCGTTCTTTTATAGCGGAGGTGTCTACAGACTTATGAGTGATAACAATTTTGTACT
TGATGAACCTGTGTTTCAAGAAAAAATGAGTGTACAATTTGAGTGTGAAAAACCGAAAGGTTTTGTTGAA
CCAAATTGTGACAATCTCCCAAGTGCCATCAAAACTACTGTAGAACAACTTGTTAAATTTAACACACCTT
ATCGTAATTACGATGTTAGTGTGGTGAATAATAAGTGTGTTGTCAAGTGTACTTACACTTTCCGTGCACC
AGCTTACATTGCAGACACAGAGAATTTTGTGAAAGCATGTGAGGTGTGTGTTGACAAAGAAGGTTTTGAT
GAATTCTATGTTCAAACACATGCAGTTGACTCTCTTGTAGCTTTCAAACCAGCTTTTGCTGAATTTGAAC
AGTTTTTAGAGCCTGTCAGTTGCCCTGAACTATTTCTTGAAATAGATGGTGGTAACATTTGGAATAAGTT
TATTAAAACTGTCACAGATGCTGTTGAATTTGTAAAATCAATTAAAGTTTCTTTTGACCTCAATGGTGTT
GTTGTTAAAGCCACAAAACGTTTCAAGAGATTCGCAGCTACTCTAGTTAATCTTTACAGAGAGTTTGTTG
CTACTGTTACTAAGACTATCAAAATTGGAAGCCAGGCTTTTACATATTATGCATTTGAAGTACCAAAAGT
TTTACTTTCTGGTGCTTTGCATAGTGTGAGAACAGTCAAAGCTAAAGAGCTTAACTTGTCTGTACAAGAC
GTTGTTGTTGAGTTCAATGTTTTTGATGGTGCAACAGTAGAAGTCACACCTAAACGTGTTGAAAAAGAAG
AAGTCTCTCTTGAGGAAGTAGAGTTTATCCCACCTGTAAGCAATGGCTCTATTGCAGTAGTTGATGGTTA
TTCATTTTACTCTTGTGGTGATTTGTATTACCCGTCAAATGAAAATGCAGTTGTCCCACTTTGCTTTAAA
CGTAGTGGTGGTGGTAAATTGCAATTCTCTGATGTTGTTGAAGTCAAAGAAATTGATCCAGTTTACAAAG
TAAAATTAGATTATGAATTTGAAGATGAAAATATTGCTGCAGTCTGTAAGAAAGCCATAGGTTCTAAAAT
TAAGTACAATGGTTCAGACTGGGAAGGTTTCTGTGAACAAATTCACTCTGTTATGACTGTCGTTGGTGAA
CACATGGAACTGCCTAAATACTACATCTATGATGAAGAAGGTGGTAACGATCTGAATAAGGTCGTCATGA
TTTCACAATGGTCATGTGACGGAGAGTCTAATGAACAAAAAGAAGAAGAACAACAGATTCAAAACGGTTC
TACAGATGTTTCTGAAGTTGAAAGTGAGCCCGCACCACCTGAAGTGGAGGTGCCACAGAAACCTCAGTAT
CAACAAGAACAAAAACCTGCTGTAGATCAACAGGCTGAAGTTGAAGCTGCTTTGTCATATATGACTCCTA
CAGCCCCTAAACCTACAGAAAACCCGTTTGCATTTGAGTATTATGACCTTAATGGTATTAAGGTACTAAG
ACAATGTGATAACAATTGTTGGGTTGCATCAGCTTTAGTCCAATTGCAGCTTTTGAATGTTAATGAGGAT
TATACGTACTTCTTTAAAAGTGGTCGTTTGTCTCCATTGGTTAAACGCTGTTATGAACGTACAGGTAACA
TTAGAGGATCTGCTGGTGACACGTCTCATTGCTTAGAAGTAATGTTACGTGATTTACACACTATGCAACT
TAGATTCTCTGTTAAGTGTAAATGTGGTACTTTTACTGAAGAAATGAGTGGTTGTGTTTTTAGATTTATG
CCAACAGCAAAAGCATTCCCATATGGTGGTTGTGCTTCTTGTGGTAAAACCAAGATGTACACTATTACTA
CCATGAAAGGAACTGGTGTGTTTTGTCAAGAACCTAACCCACTTAACATCAGTGATCTTCTGGTTGAACC
ACTCTGTGCATCTGTGTTTAAAAGTGGCCATTATAAAACCAACATTTACAAATATAATGTTTGTGTTGAT
GGTAATGGCCGTGGTCAAATTAAATGGAATACAGTTAACACAGTGTGTTTTAAGGATGTTGAGTACAATA
AAGTAGAGGAAGTCCAGTCTTTTGCTACTTACCGAAACATTTCCTTTTATCAAGGTGACATTAAAGAGGT
AAAATCTGTAAATCATGATTTTATAGTTAATGCAGCTAATGAGGATTTGAATCATGGTGGTGGTATTGCT
GGTGCTTTAAATAAATATACAAAGGGTGTGCTACAGAAAGTATCGAATGCACACATCACTGCAAATGGTA
AGCTTAAAGTGGGAAGTGGTGTTATGCTTGAATGCGATGGAACTAATATCTTTAATGTTGTTGGTCCACG
TAAAGGTAAGCATGCACCTGAATTGCTCATAAAAGCTTACGATGCAATTTTTAGTAATCCTGGTGTCCCA
CTAACACCTCTCATTAGTGTCGGTATTTTTAAAGTGCCAATTGAAGATTCGCTGTCTGCTCTTTTTGCAT
CTGCGGGCGAACGAGTAGTAAAGTGTTTTTGCTACACTTCAGCCGAAAAAAGCGCGATCATTAAATACAT
AGATAGTGTTACTAATGTAGTGGTAGATGTTAAAGAACCAGGGCCTGCACCTCCAGAGGTTAAACAAATC
CTACCTTTTAGAAAGGAGGGTAAATTTGACTTCTACGAAATAGAGGCAGCAGACTTGGCACTTTTAAATC
CAGATAGGTTAGTTATTTTCACTGATACAGACTTTAAATTATGCGATTTTGCTATCGCCTTCAATAGTGT
TGTTGAGGGAGGTTTGACTTCGTGTATTGAGGCTTATCGTAAAGAAAATAATGTTGTGCCTGCTGGTAAC
ATTGTTACCTTTAAATGTGAGGGAATGGTGGCAGTCAGTTTTGCTGTACTTCCAATTGCTGGTGCTGCTT
CTTATGATAAGAACGTCACACGCACAATTAATAAAATTACTAAGTTGAAGGGTAATGTCTTCTCAACTGT
ACCACCTACAAGTGTCTTGAAAAATATGCTTAAATGTTGTAATTGTTCCTTTGTTGTTTCGCAAGATACA
AAAGCGTCAGTGACAGAGTGTTTTGACGTTCAAGAAGTGCGAATCAAGGTTTCTTACAATGATAGAGATG
TTCAAGACGTAGTGGTTAAAGGAGACAAAGTTATTGATCAACAAATTGGTCCTTGTAGTACAAATAACTT
TGACCTGACAGGTGTAAAACCAGACGATGCAATTAATAGTGTCGTCAATGTTGCACCTGAAGTTGATTGG
ATTTCTCATTATGGTTTTCCACGAGCAGATGTGTGGCATACTCTTGATCATTCTGCTTATGATTATGAAA
GTAAAGAGCAGGATGGTGTCAGAGTCTTGAAATTCTCAGACAATAATTGTTGGGTTAATGCAACGTGCAT
TCAACTGCAGATTGCTAAAATAACATTTAGAACCGAGGGTATTCAAGCTATGTGGGATGAATTCCTTGTT
GGAAAAGTAGCGAAGTTTGTGCACTGGTTGTACTGGTACCAGAATTCTTCTAAGGGAGATCCTGGTGACG
TTGAGTACACTTTGAATGCTATTTCTCGTTACATGGCTAACAAGAGTACTGTTGTCATTTCACGTGTTGC
TACTACAGAGTGTTGTAATGACACTAAAACTATTCATACTCCAGTAGTAAATGTAAGTTTGCTGCGTTCG
GGTGTAGAAGATGGTGTCTGTCAACATGGCAATAAGTACTATAGCAGACTTGTTTCTGTGAAAGGTACTG
TGATTGTCACTTCTACTGGAAAACCTAATGTTTACCCTAGAAATGCTTTAATCACAGGTGATTCTTACAC
ATTGTATTCTGGTGATGTCAAAGATGGACATTACACAGTGTTTAGTGTGAAAGGGGACAAAATATTTGAT
GGAGAAAATGTTAGCTCTAACAATGATTTGTCTCTTTATCCAGTTACATCTGTGGTTGTTAGTAATAAAG
TTATTGAATTTGAGAAGCCAGCTAAGCCTAAAATTGCAGAGGTTATGAATAAATTAGACAATGCATCAGA
GAAGTTTTTCTCATTTGGTGACGTTGTCTCACGTAACTTTGCAGCAGTTTTTGTATGGTTGTTCAGTATG
ATTGGCCTTGTTTTTAAGGCGTTTAAAACCAAAGATGTAAAAGTCTTTGCTTTAGCACCTGAACGTACTG
GAATCATACTTGGTAGAAGTATCAAGTATAATTTTAAAGCAACTAAGCAATTGCTGGTTTCCAAAATAAA
ATGGGTTAAACTCTTTGGTAAAATACTATTAGCTATGTTTGCAATTTACGCCACAAGCTTTATGTTAGTT
AGATTTGGACCGCTTAATGAAAGTCTATGTACAGACTATGTTAAGAATTATTCCGAATCTAATTTTAATA
AGGCTGCTTACTGTGACGGTATAACTTGTAAAACTTGTCTTTATGGTTACCAAGAGCTTTCAGATTTTCC
TCACACCTCCACTGTTTGGGAACACGTTAAAGATCCACTATTTAAGAAGGTAATGCCTATGTTTTACATG
GCGTTCCTCTTGATTTTTGGTGGAACTATTACACGTTCTTGTATGCTCTATTTCCTTGCTCAATACGTCA
ATAATATTGGTGTCTTTTTGGGTGTTCAGGATAATGTGTGGGCATTACAATTTGTTCCTTTTGACGTTTT
TGGTGATGAGATTGTAGTAATTTTTCTTGTTGTTAAAATTTTGCTTTTCGCAAAACACATTGTTTTTGGT
TGTGATAAACCTTCGTGTGTAGCCTGTACTAAGAGTGCACGATTGACTAGAGTACCTATGCAAACAATTG
TTAATGGCTCTAATAAGTCATTTTACGTTGCTGCAAATGGTGGTAAGAAGTTTTGTAAGAAACATAACTT
CTTCTGTGTTAATTGTGACTCTTATGGACCTGGCAATACATTTATAAACGATGTTGTTGCTGCAGAAATC
TCTAATGTTGTTAAAACTAGTGTTGCACCTACTGCACCTGCTACAATTGATGTTACCAAGGTTGAATTTC
AGAATGGTTTTTATTACCTATATGGTCCTGATAACGTATTCTGGAGATACAACTTTGACATTACTGAAAG
TAAGTATGGTTGTAAAGATGTTCTTAAAAGTTGTAACATTTTGTCAGACTTTATTGTGTACAATAATGCT
GGTAGTAATGTTGCACAAGTGCGAAATGCATGTGTGTACTTCTCCCAGCTGCTTTGTAAACCAATTAAGT
TGGTTGACTCAACTTTGCTTTCAACTTTGAATGTAGACTTTAATGGTGCTTTACACAGTGCTTTTGTTGA
TGTGCTTAACGAGAGTTTTAGTAAAGATCTGTCTAGTTGTACGACTATGTCAGATTGTAAAACAGCTTTG
GATATTGAAGCAGATGACGAAGACTTTGTTAACTGTGTCAGTAACGCACATAAATTTAATGTGTTGCTTA
CAGACCTGTCTTTTAACAATTTTGTTACTTCTTATGCTAAACCTGAAGAAAAGCTCTCTACGCATGATAT
CGCTGCGTGTATGCGTGGTGGTTCTAAAGTAGTAAATCATAATGTACTAGTTAAAGAAAATGTACCAATT
GTTTGGCTTGCAAAAGACTTCAACATGCTATCCGAAGAAGGAAGAAAGTATGTTGTCAAGACAGCAAAGA
TAAAGGGTATCAACTTTATGTTGACATTCAATGAAAACCGTATGCAGACTACAATTCCTACTGTTAGCAT
TGCTGGCAAGAAAGGTTCTGGTCTGAAACAGTGTTATAACTTTATCTGGTGGTCTTGTGCATTTATCTTG
TTTATGTTCTTTGCAATTGGCTTGCTTGACTTTTCAACTACTGTTACTAGTGCTAGTGAGTATGACTTTA
AGTATATCATTGGTGGCAAATTGCAATCATTTGAAAAACCTCTTGATTGTGTTCATAATGTCTTTGACAA
TTTTAACACATGGTTCCAAGCAAAATTTGGTTTTGTACCACGTAACAGTAGGAGTTGTCCTATTGTCGTT
GGTGTCAATGATGAAGCCCGTGTGATACCTGGTGTTGCATCTGGTGTTTCGTTGGTTGATAAAACCCTTG
TTTTTGCTACAAAATCAGTTTTTGCAAATTCTGCTACCTGTTATGATATTACTGGTCCAGCTCCTGCTGA
ACGGTGTGTTTTCAACTCAGCTTGTACCACTTTGAATGGTCTTGGCGGTTTGGCAACTTATTGTTATAAA
AACGGTCTTGTTGAAGGCGCTAAGCTTTACACGGATTTACAACCTAATAGTCATTATAGTATGGCAGATG
GTGGTTATGTGAAACTCCCTGACGTACTTGCTAGTGGGTTCGGTTTTAGAACTGTTAAGACACAAGAAAC
TACATATTGTCGTGTGGGTCAGTGTGTTAATTCTAAAGCTGGTGTGTGCTTTGGTGCCAACAGATTTTTG
GTGTACAATGAAGATTCTGGCACAGACTTTGTTTGTGGAACAGGTTTAATGTCTTTAATGTATAATCTTT
TAAGTGTTTTCTCATCATCTTTCTCTGTTATGGCTATGTCTGGTCAAATTGTGCTGAATTGTGCAGTGGC
ATTGTTTGCTATTTTTGCCTGTATGCTTGTGACCAAGTTTAAGAGAATGTTTGGTGATCTGTCATTGGGT
GTCTGTTCTGTGATTTGTGTTGCAATTGTAAACAATTTGTCTTACATTGTCACACAAAATGCTGTTACTA
TGGTTGCGTATGCAGTCCTATACTTCTTGTGTACTCGCACATTTAGATATAGTTGGATCTACCATACTGG
CTATTGTATTGCTTACTTCACTCTTGCACCCTGGTGGTTAATCTTTATGTATGCTTGTTCTGCTCTTATC
GGTGTTATCCCAAATCTCCTCAAACTTAAAGTTACTACTCAATTGTTTGATGGTGACAAGTTTGTCGGAA
ATTTTGAAAATGCTGCTTTCGGAACGTTTGTAATGGATATGCATTCATACCAACGTTTGGTAAATAGCAT
TGCACCTGAAAAGCTTAAACAGTATGCTGCTAGTTACAACAAGTATAAGTACTATAGTGGTAGTGCAAGT
GAAGCAGATTATCGTCTTGCTTGTTATGCTCACCTTGCTAAGGCTATGCTTGACTATAGTTCTAACCACA
ATGACATTCTTTACACCCCACCTACTATCAGTTATAATTCTACACTTCAATCTGGATTGCGTAAAATGGC
CCAACCTTCTGGTGTTGTAGAACGTTGTGTTGTTCGTGTTTGCTATGGTAACATGGTACTTAATGGTTTG
TGGTTGGGTGACACAGTTATATGTCCTAGACATATAATTGCTTCCTCTACCTCTTCAATCATTGATTACG
AACATCAATACAGCGTTATGCGTTTGCATAATTTCTCTGTTTCAGTAGGTAATGTTTTCTTAGGTGTTGT
GGGTGTCACAATGAAAGGCACTAACTTGCATATCAAAGTTAATCAGACTAATGTTCATACTCCTGAACAC
ACATTTAAAACTCTTAAGCAGGGTGATTCCTTTAATATTCTTGCTTGTTATGATGGTGTTCCTTCTGGTG
TTTATGGTGTAACATTACGCACAAATAACACAATTAGAGGTTCATTCATTAATGGTGCCTGTGGTTCACC
TGGTTATAACATAAACAATGGTAAAGTTGAGTTCTGTTACTTGCATCAATTGGAGCTTGGCAGTGGTTGC
CACGTCGGTTCTAATTTAGATGGTGTTATGTATGGTGGTTTTGAAGACCAGCCTACATTACAAGTAGAAG
GAGCTAACAACCTTGTTACAATTAATGTTATAGCCTTTCTTTATGGTGCTCTCCTTAATGGTATCACATG
GTTTCTGTCTAATGATCGTGTTACTGTTGAGTCCTTTAATGAATGGGCTTCTGTTAACGGTTACACTGAT
TGTGGTAGTATTGATTGCTTTGCTATGTTGGCAGCTAAGACTAATGTAGATGTTCAACGCATATTGGCGG
CTGTACAGCGTCTACATAAAGGTTTTGGTGGTAAAAACATACTTGGTTTTACTACACTCACAGATGAGTT
TACAGTTACCGAAGTTATTAAGCAGATGTATGGAGTCTCTCTTCAGAGTGGTAAGGTTTCTAGCATGTTC
TATAACGTTTGTGTTATTGGTGCATTCCTTACTATGTTTTGGTCTGAACTTTTGCATTACACAGCTTTCT
TTTGGATTAGTCCTGGTTTTATTACACCTATGTTTTTCATGCTGCTTATGGTTTCAGTGTTCTTTATGTG
CGCTTTGAAACATAAAATTATGTTCTTGTACACATTCCTTATCCCTGCTGTAATTGTTACTTCTTGTTAC
AATTTTGCATGGGATTGGTATATTACATCTGTTTTGGCTACTACCTTTGATTATCATGTCTCACTTTTGA
GCTTGGATATTCAAGGTGTTATCAATGTTTCAGCTTGTGTCTTTGTCACTCTGTTGCACACATTTAGGTT
TTGTAAGAGTAGTGTAAATTACTCTTCTGTCATTACCTATTGCTGTTCATTGTTGTTTGTGGCCTACGGG
TTTTATATGGGATCAGATGCTCTTAGTCTTGTGATGATGGTACTCTTTAATTTTACTTCCAACTGGTATG
TAGGCGCTATAGTTTACAAAATTGCTTTTTACACACGTGATATGACTGTGCTTCCCTTGCTTGTTGGCAA
TGTGAAAGCTGTAATGTTGTGTTACATTGTGTTGGGCTATTTTTGTTGTGTTTACTATGGAATCTTGTAC
TGGATTAACCGGTTCTTTAAACTCACACTTGGTGTTTATGACTTTAAAGTCAGTGCCAATGAGTTTAAGT
ATATGGTTGCTAATGGTCTTCACGCACCTCGTGGTGTCTTCGATGCAGTTGCATTGTCTGTGAAACTCAT
TGGTATTGGAGGTGAGAAAACTATTAAAGTGTCAACTGTTCAGTCTAAATTGACAGACATTAAGTGCACA
AATGTTGTACTTTTGGGTTGTCTTTCTAGTATGAACATTGCTTCTCACACTAAAGAGTGGTCCTATTGTG
TTGAATTGCATAATAAAATTAATCTGTGTGATGATCCAGAAAAAGCACAAGAGATGTTGCTTGCATTGCT
TGCATTCTTCCTTTCTAAGCAAAAAGATTTTGGTGTTGACGATTTACTTGAATCATATTTCTCTAGTGGT
TCCATACTTCAAAGTGTGGCTTCTACTTTTGTTAATATGCCTTCGTTTATCGCTTATGAAAACGCTAGAC
AAGCTTATGAAGATGCAATTAATTCTGGAGCTGCTCAACAGTTGGTTAAACAACTTAAGCGTGCTATGAA
CATTGCTAAGTCTGAATTTGACCACGAGGCTTCTGTACAGAAGAAAATCTCTCGTATGGCAGAACAGGCT
GCAGCACAAATGTATAAAGAAGCTAGAGCTGTGAATCGTAAATCTAAGGTTATCAGTGCTATGCATTCTC
TCTTGTTTGGTATGCTTAGACGGTTGGATATGTCAAGTGTTGACACAATACTTAATCTTGCTAAAGATGG
TGTTGTACCTTTGTCTATTATACCTGCTGCTAGTGCTACAAAACTTAACGTCGTCAGTGCTGATCTTGAG
TCTTATCTTAAGATTTGCAAAGAGGGCTGTGTTCATTATGCTGGTGTCATTTGGAATGTAATTGACATAA
GGGATAATGACGGTAAACTTGTACACATGAAAGAAGTTACACAAGAGAATGTTGAAAATCTTGCATGGCC
TCTGTTCCTTAACTGTGAAAGAATTGTCAAATTGCAGAATAATGAAATCATGCCTGGTAAGCTTAAACAG
AGAGCTGTTAAGGCTGAGGGTGATGGATTTTCTGCTGATGGCAAAGCACTTTATAACAATGAGTCTGGAA
AGACTTTTATGTATGCATTTGTTGCAGACAAACCAGACCTTAAGTACGTGAAATGGGAATTTGACGGTGG
TTGTAATACCATTGAACTTGAACCCCCTTGTAAGTTTGCAGTTGAATCTACTAATGGTACCGTGATTAAG
TACTTATACTTCGTTCGCAATTTGAATACATTGCGTAGAGGAGCTGTACTTGGTTTCATTGGTGCTACTG
TTAGACTTCAAGCCGGTAAGCAGACTGAGTTGGCTACCAATTCACCTCTTCTTACTATGTGTGCCTTTTC
TGTAGACCCTGCTAAAACGTACTTAGATGCTGTGAAGCGTGGTGTTAAACCAGTTGGCAATTGTATTAAG
ATGTTGTCTAACGGTGCAGGTACAGGTCAAGCTATAACTGTTGGTGTTGAATCAAATACAAATCAAGATA
GTTATGGTGGTGCATCTGTATGCTTGTACTGTCGTGCACATGTTGAACATCCATCTATGGATGGACGTTG
CCGCCTTAAAGGTAAATATGTGCAAGTTCCGCTTGGTACAATTGATCCTATACGGTTTTGTCTTGAAAAT
GACACCTGTAAAGTTTGTATGTGCTGGTTAAATAACGGTTGTACTTGTGACAGAGTGAGTTCTGTTCAAG
CTTTTGATGCTGGTTATTTAAACGAGCAAGGGGCTCTAGTGCAGCTCAACTAGAGCCCTGTAATGGTACT
GACACTGATCACTGTGTCCGAGCCTTCGACATTTATAACAAAGAAGTTGCATGCATGGGTAAATTTTTAA
AAGTGAACTGTGTTCGCTTTAAAAACCCTGAATATAACGATGCATTCTTTGTTATAAAGAAATGTCCTAA
GTCTGTCATGGAACATGAGCAGTCCATATATGACATACTTAAAGATAGTGGTGCTGTTGCATCACATGAT
TTCTTTACGTGGAAAGATGGTCGTGCTATCTATGGTAATATTAGTCGTCAAAATTTGACCAAATATACCA
TGATGGACCTTGTCTACGCTTTAAGAAATTTTGATGAAAAGAATTGTGAGACTCTTAAAGAGATACTTGT
ACTTACAGGTGCCTGTGAAGAGTCTTATTTTGAAAGTAAAGTCTGGTTTGATCCTGTTGAAAATGAAGAC
ATTCATAGGGTGTATGCTATTCTGGGAAAGATTGTTGCTAACTCTATGATTAAGTGTGTTCGTCTCTGTG
ATGCCATGGTTGAAAATGGTATTGTCGGTGTAATTACACTTGATAACCAAGACCTTAATGGCAATTTTTA
TGATTTTGGAGACTTTGCACGCACATTACCTGGTATGGGAGTACCCTTGTGCACATCGTATTATTCATAC
ATGATGCCAGTTATGGGTATGACCAACTGTCTTGCAGGAGAATGTTTTATGAAAAGTGACATTTTTGGTG
ATGACTTTAAGACCTATGACTTGCTGCATTATGATTTTAGTGAACATAAGCAAGCATTGTTTGAAAAATA
TTTCAAGCATTGGGGCCAGGATTATCATCCAAATTGTGTTGATTGTCATGACGAAATGTGTTTAATTCAC
TGTGCTAATTTCAATACGTTGTTCTCTACTACAATACCTGCTACTGCTTTTGGACCATTGTGTCGTAAAG
TATTTGTAGATGGTGTGCCACTTGTTGCTACAGCTGGTTACCATTTTAAACAGTTAGGTATTGTCTGGAA
CAAAGATCTTAACACGCATTCTTCACGTCTGTCAATTAATGAACTTTTGCAGTTTGTGACTGACCCATCA
TTGTTAGTTGCTTCTTCTCCTGCACTTGTTGATCAACGCACTATTTGTTTTTCAGTTGCTGCTCTTAGTA
CTGGTATGACTAAGCAAACAGTCGAACCTGGTCATTTTAACAAAGAATTCTATGACTTCTTAAGAGGGCA
AGGTTTCTTTGAAGAAGGTTCTGAACTTACGCTTAAACACTTCTTCTTTGCTCAGAAGGGTGATGCAGCT
ATCAAGGATTTTGACTATTATCGTTATAATAGGCCAACAGTACTTGATATCTGCCAGGCTAGAGTAACAT
ACAAATTAGTCAGCCGTTACTTCGAAATTTATGAAGGTGGTTGTATTACTGCTAAAGAGGTTGTTGTTAC
AAACCTCAATAAGAGTGCAGGATACCCTTTGAACAAATTCGGAAAAGCAGGCCTTTACTATGATTCACTT
TCTTATGAAGAACAAGATGCGTTGTATGCTGTCACTAAGCGTAATGTGTTACCAACAATGACACAGCTTA
ATCTTAAATATGCAATTAGTGGAAAAGAACGCGCCCGTACTGTTGGCGGTGTTTCTTTGTTGTCCACTAT
GACGACTAGGCAGTATCACCAAAAGCATTTGAAGTCTATTGTTAACACACGGAATGCGTCTGTTGTAATA
GGCACAACCAAGTTTTATGGTGGTTGGGATAACATGCTTAAGACACTTATTGAAGGAGTTGAACACCCGT
GTTTAATGGGATGGGACTACCCGAAGTGTGATCGCGCGTTACCCAATATGATCAGGATGATCTCAGCCAT
GATTTTAGGTTCAAAGCATACAACTTGCTGTAACACTGAAGAGCGTTATTATCGCTTATGTAATGAGCTT
GCGCAAGTGTTGACAGAAGTTGTTTATTCTAATGGTGGTTTTTATTTGAAACCAGGTGGTACTACGTCGG
GTGACGCTACTACAGCTTACGCTAACTCAGTGTTTAACATCTTCCAAGCAGTCAGTGCCAATATTAACCG
CTTACTTAGTATCGATAGTAATGTGTGTAATAATGTTGGCGTCAAAGCTCTACAGAGAGAGTTGTATGAT
AACTGTTACAGGTCATCGACTGTGGATGATTCATTTGTAGACAAGTATTACGGTTATCTCCGTAAGCATT
TCTCAATGATGATTCTATCGGACGATGGTGTAGTCTGTTATAATAAGGATTATGCAGATTTGGGCTATGT
AGCAGATATAGGTGCGTTTAAAGCAACGTTGTATTATCAGAACAATGTGTTTATGAGCACCTCCAAATGC
TGGGTAGAGAACGATATTTCTAAGGGTCCACATGAATTTTGCTCGCAACATACTATGCAGATCGTGGATG
AGGCTGGCAAATACTATTTGCCATATCCCGACCCATCTAGAATTTTATCAGCAGGAGTGTTTGTTGATGA
TGTGGTAAAAACAGATGCCGTTATATTGCTTGAGCGTTATGTTTCGTTGGCAATAGACGCTTACCCTCTT
ACAAAGCACTCCAACCCTGAGTATCGAAAAGTGTTTTATGCACTACTTGACTGGGTGAAACATTTACATA
ACACCCTTAATCAAGGTGTTCTAGAATCTTTTTCCGTCACATTGTTAGAGGATGCTTCTTCTAAGTTCTG
GGACGAAAGCTTCTATGCTAGTATGTATGAAAAATCAACCATTCTGCAGGCTGCAGGTTTATGTGTTGTG
TGTGGTTCTCAAACTGTGTTAAGATGCGGAGATTGTCTAAGACGTCCGATGTTATGTACCAAGTGCGCGT
ACGATCACGTCATCTCCACAGATCACAAGTTCATACTAGCGATAACACCTTACGTGTGTAGTGCTTCAGG
CTGTAATGTTAATGACGTTACCAAATTGTACCTTGGTGGTCTTAGTTATTACTGTATTGACCATAAGCCT
AGTCTTTCTTTTCCACTCTGTGCAGCTGGAAATGTTTTCGGATTGTATAAAAACTCAGCAACTGGTTCGC
CAGATGTAGAAGTCTTTAACACCCTTGCAACTTCAGACTGGACAGATGTTCGTGACTACAAACTGGCAAA
TGAGGCTAAAGATTCACTCAGACTTTTTGCAGCAGAGACTGTCAAAGCTAAAGAAGAGAGTGTAAAGTCC
TCATATGCTTGTGCAACTTTAAAAGAGGTAATTGGCCCTAAAGAATTGTTACTCAGCTGGGAGGTTGGTA
AGGTTAAACCACCTCTTAACCGTAATAGTGTTTTTACTTGTTTCCAAATTACCAAGGATTCAAAATTCCA
AATTGGTGAATTTGTGTTTGAAAAACTTGACTACGGTTCAGATGCTGTTTGTTACAAATCTACAGCCACA
AATAAATTGGTTCCTGGCATGATTTTTGTGCTTACATCTCATAATGTACAGCCGCTTCGTGCACCTACAA
TTGCTAACCAGGAACGTTACTCCTCAATTTATAAGTTGTACCCGTCCTTCAATATCAATGAAGCATATTC
TAGTCTGGTACCATACTACCAAATGATTGGTAAACAAAGAATTACAACTATTCAAGGCCCTCCTGGCAGT
GGAAAATCACATTGCGTTATTGGTCTTGGACTTTACTACCCTGGTGCCAGAATTATGTTTGCTGCTTGTT
CACATGCTGCTGTTGATTCATTATGTGTAAAAGCTGCTATAGCTTATAGCTTAGAGCGTTGCACTAGAAT
TATTCCAGCACGTGCAAGAGTAGAATGCTTCAATGGCTTTAAACCTAATAACACCAGTGCACAGTATCTT
TTCTCTACTATTAACGCACTACCAGAATGTAATGTTGATATAGTAGTGATTGATGAGGTGTCCATGTGTA
CAAACTATGATCTTTCTGTTGTTAACCAGCGTGTCTCATATAAACATATTGTTTATGTTGGTGACCCTCA
ACAACTTCCAGCTCCTAGAACCATGATTACTCGTGGTGTTCTAGAACCTAAAGATTATAATGTAGTTACA
CAGAGGATGTGTGCTGTTGGGCCTGATGTGTTTTTGCATAAGTGTTATAGATGCCCTGCTGAAATTGTTA
GGACCGTGTCAGAAATGGTCTATGACAACAAATTCTTGCCAGTTCATCCAGATAGTAAACAGTGTTTTAA
GCTTATGTGTAAAGGCAATGTTCAGGTCGACAACGGTTCTAGCATCAATAGAAAACAACTAGATGTAGTG
AAACTATTTCTTGCTAAGAACCCGTCTTGGTCTAAAGCCGTCTTTATTTCACCTTACAATAGTCAAAATT
ATGTTGCCAGCCGTGCGCTAGGTTTACAAATACAGACTGTGGATTCTTCTCAGGGCAGTGAGTACGATTA
TGTCATTTACACTCAAACATCAGATACTGCACATGCATGTAACGTTAATAGATTTAACGTTGCTATTACA
CGTGCAAAGAAAGGTATTCTGTGTGTTATGTGTGGTAAAGAACTCTTTGATGCCCTCAAATTCTTTGAAA
TTAAGTTGACAGACCTCCAAGTTGGTGAGGGATGTGGTCTTTTCAAAGATTGTTCTAGGAAACCCGATTT
ATTACCTCCATCACATGCGACCACGTTTATGTCTTTGGCTGATAATTTTAAGACTAGTGGGGATTTGGCA
GTCCAAATAGGTTCTAATGGTGTCTGCAAATATGAACACGTGATTTCTTTCATGGGTTTCAGATTTGACA
GTTCCATTCCAGGCTATCATAGCTTATTTTGTACTAGGGACTTTGCCATGAGGCATGTTAGAGGGTGGAT
TGGTATGGACGTTGAAGGTGCTCACGTGGTGGGTGACAACGTAGGTACTAATGTGCCCCTTCAAGTAGGC
TTCTCTAATGGTGTTGATTTTGTGGTCCAACCTGAAGGTTGCATTTCCAACGAAAACGGGAACATTATCG
CACCTGTTAGAGCACGTGCTCCTCCTGGTGAACAGTTCGCACATTTGATACCATTAATGCGTAAAGGTCA
ACCATGGTCGGTTGTTCGTAAACGCATAGTTCAGATGTGTTGTGACTATTTGTCAGGTCTCTCTGATGTC
TTGGTATTCGTACTTTGGGCAGGAGGATTGGAGTTGACAACCATGAGATATTTTGTTAAGGTAGGTCCAG
TTAAACATTGTCATTGCGGAAAAGAGGCAACTTGTTATAACAGCTCGGTTCATGCGTTCTGTTGTTTCAA
GCACGCTCTAGGTAGCGATTACTTGTATAATCCTTATGTCATTGACATTCAGCAGTGGGGTTATACAGGG
TCTCTTGGACATAATCATCATGAAGTTTGCAATGTACATCGTAATGAGCATGTAGCATCTGGTGACGCTA
TCATGACTCGGTGTCTTGCAATACATGATTGCTTTGTGAAGAATGTAGACTGGTCTATCACTTATCCATT
CATTAGTAACGAACGTGCCATTAATAGTGGGGGTCGCATGGTGCAACGTCACCTCATGCATGCGGTACTA
AAATTATATAAACCCGAAGCAATTCACGACATTGGCAATCCCAAGGGTATCCGCTGTGCAGTTTCTGATG
CAAAGTGGTTTTGCTACGATAAGCAGCCTTTGAATTCCAACGTCAAATTGTTTGAGTACGATTATATAAC
CCACGGTCAGTTGAATGGATTATGCCTATTTTGGAATTGTAACGTTGACATGTACCCTGAATTTTCAGTT
GTTTGCAGATTTGACACACGTTGTCGTTCTAATCTGAATCTTGAGGGCTGTAATGGCGGTTCTCTCTATG
TCAACAAACATGCTTTCCACACTCCAGCTTTCGACAAACGTGCCTTTGCAAAGCTCAAACCAGCACCGTT
CTTCTATTATGATGACGGTCCATGTGAGCGTGTTCAGGACGAAGTCAACTATGTGCCTTTGCGAGCCTCC
AATTGTATCACTAGGTGTAACATTGGAGGGGCAGTGTGTAGTGCACATGCAGCTAAGTACCATGATTATG
TAGGAGCGTACAATAGCTTTGTACAAGCTGGTTTTACTCTTTGGGTTCCTAATTCTTTTGATCTTTTCAA
TCTTTGGCAAACTTTTGCTGAAACTAACTTACAAGGCCTTGAAAACATTGCTTACAATGTTGTTAAGAAA
GGCTCATTTGTAGGTGAAGCTGGTGAATTACCTGTTGCTGTTGTCAATGACCGCGTACTTGTACGTGATG
GAACCGTAGACAACTTGGTTTTCACTAACAAAACTTCATTACCCACTAACGTAGCATTTGAGTTATACGC
AAAAAGAAAGGTTGGTTTAACACCACCTTTATGTGTACTCAAAAATCTTGGTGTTGTAAGCACAGATAGG
TTTGTTCTGTGGGATTATGAAGCTGAACGACCATTTACGTCTTTTACCAAAAATGTTTGTAGTTACACAG
ATTTTAATGAGGAAGTTAACACATGTTATGACAATGCCATTCCTGGTTCTTTTGAAAGATTCACAGTGGC
AAAGAACGGTGTGTTAATTTCTAATGTTGCTATTAAGAAACTCGTTGGTATGAAATTATCATACGGTTTC
CTTAATGGTGTACCTGTGTCTACATGTGAAAACAAACCTGTTGTTTGGTATATTTATGTACGTAAAGATG
GTCAATTTGTAGATCAATTTGATGGTTACTACACTCAAGGTCGCAATGTCAGTGAATTTTTACCCCGTAG
TGATATGGAAAAAGATTTTTTGGAAATGGACATGAGTGTGTTTATTAGCAAGTACGGACTTGAGGACTAT
GCCTTTGAGCATGTCGTTTATGGAGATGTCTCTAAAACCACATTAGGTGGGCTGCATCTGCTTATATCTC
AAGTTCGTTTACAAAAACTGGGTGTTCTTAAAATAGAAGATTTTACTTCTAGTGATGATGGAACACTTAA
GTGTTGTACAGTAACTTTTGCTAATGATCCTAGTAGCAAAATGGTCTGCACTTATATGGATTTACTATTA
GACGATTTCGTCTTAATACTAAAGAGCTTAGACTTAAGTGTTGTGTCTAAAGTTCAAGAGGTTATTGTTG
ACTGTAAAATGTGGAGATGGATGTTGTGGTGTAAGGACCACAAGGTACAGACATTTTACCCTCAGTTGCA
ATCAGCTGAGTGGAAGTGCGGTTACTCAATGCCTTCTCTTTACAAGATTCAACGAATGTGCCTAGAGCCA
TGTAACCTCTATAATTATGGCACTGGTTTGAAATTACCTGATGGCATTATGTTTAATGTCGTAAAATATA
CTCAATTATGTCAATATCTCAATAGCACATCTATGTGTGTACCACACAACATGAGGGTTTTGCACTTAGG
TGCAGGGTCGGATAAGGGAGTTGCTCCTGGTACCGCAGTCTTGAAGAGATGGCTGCCTAGTGATGCTATC
GTTGTTGACAATGATGTGAACGACTATGTAAGTGATGCTGATTATAGTGTTACTGGAGACTGTTCTACTG
TGTACTTAGAAGATAAGTTTGACCTAGTCATTTCGGATATGTATGACGGAAGGGTGAAACAGAATGATGG
TGAAAATGTTTCTAAAGAGGGTTTCTTTACTTACATCAATGGTGTAATTAATGAGAAAATAGCTCTGGGT
GCAACGGTAGCCATCAAAATCACTGAGTATTCTTGGAACAAAAGACTTTATGAATTAATCCAACGTTTTG
AGTTTTGGACATTGTTTTGTACTAGTGTTAACACCTCTTCTTCAGAAGCTTTTCTGATTGGTGTTAATTA
TCTAGGAAACTTTGCCAATAACCCAATTTTGGATGGTAACACAATGCATGCCAATTATATATTTTGGCGC
AATTCAACTATTATGTCTATGTCTTACAATAGTGTTTTGGATTTAGCGAAGTTTAATTGCAGGCATAAAG
CAACTGTAATTGTTTCGTTGAAGGACAAAGATATAAATGATGTTGTTTTGGGTCTTATCAGAAATGGTAA
GTTGCTAATTAGAAATAATGGCATATATATGGGTTTTTCAAATCATTTAGTGTCAACTAAATAAAATGTT
AAGTTTTGCCGTTTATTTGGCTGTTTTATTGTCCAGTTTAAAGTTTGTTGTCATTGCAGGTCACGCCAAT
GGTAAAGAATGTGGTGGTGATCCTGGCTTGTTGCCTAATTTGAACCTTGGTTTACCAGCTAATAGTTCAG
TTTTGGTTAGTGGTTATTTGCCTGAACCAGTTAGTAGTAATAATTGGATATGTCCTGTTAAACCTTTAAA
TCAATACGGTGTTGATCACTTTAGTAATCTTAAAGGTATTTGGTGGTCATACTACACTGGTAATGAAGGT
GTGGAACTTGGTATTTCAGCTTCTGATTATGAACAAAATCCAAATCAGTGGGCTTTGTATATGTACCAGA
ATAATAATGCCACCTTTAATGACTCAAAAGGTGTGCTTTACTTTCGTGTTTGTAAATACGCAGGTAAATA
TACACCTGTGGGCAATCCAGACAAGACAGTTAGCAAAGTTTGTTTGATTGACAAAAAGGTCAGTTTTAAA
TTTGCTGACATGAAAAATGAAGTTATAGGTGTTACATGGTCTGGTAACTATGTTACCTTCTATGGCATTT
ATAAGTCTTTTCGCATTTACTTACCTAACAAATGGAACTTTGTTGCTGTTAAGTGTCTTGTTAAAGAAAC
TTGTGCGTTCTTTGCTGCTCATAAAATGGTCACTTTGAACATTACTACTAATGGTCAAGGTTTGATAAAA
AATTATAGTGTTTGCAAAGATTGCAATGGCTTTCCACAACATGTTTTTCCTGTTTTGGATGGTGGAAAAA
TTCCTGGTGATTTTAGTTTTGACAATTGGTTTCTTCTCACTAATAGTTCTACTATAGTGAATGGAAAAAT
AGTTGACATACAACCACTTAAACTACTTTGTCTTTGGCCTGTACCAGCACTTGTTGCAAATGATAATAAA
ATTTATTTTAACATTACTGGTGCAAATTGTAATGGCTTTAAAGATGAAAATGCTTATGCAGATGTGCTGC
GTTTCTCACTAAACTTCACTAATAGCCAAGTTTTTAATGGTATCCATAGTGTTACTGTTAATGTAGTTGG
TGGTGATTTAAAGTTTAGTTGTTCTAATACGAGCACATATGCAGAATCAGATGAGGTTTTGCCTTTTGGA
CCTTTAAGCAGCGTTTATTACTGTTTTGTTAATGGTAAGTTAGGCAATGACACTTTCAGCAGATTTGTAG
GTATTTTGCCTCCTGTTGTTAAAGAAATTGTCATTAGCCGTTATGGTTCGTTTTACATGAACGGTGTTAA
GCTGTTTGAGGTACCTTATGTGGAGAGTGTTGTTTTCAATGTCACTAGTAGTGTCGGTTCAGACTTTTGG
ACAGTAGCTTATGCCCAAAACACAGAAGTTCTGTTGGAAGTAAATTCTACCGACATTAAAGACATATTGT
ATTGTGACACACCAGCTAACAAATTGAAATGTCAACAACTCAGCTTTAGCCTAGAGGATGGTTTCTATCC
AGCTGCACTTGTGACTGGTGTTGAAGTACCTCGCACATACGTAGCTTTACCATATCATGCTACTCATATG
TTTGTCAATTTGACTGTGCATTTGGGTAACAGTGTTGATGCTGATGCGTATGTGCAGATCAATGGTGTTA
ATGATACTGTTTGTGTTAATACTACACAGTTCAGTACACATTTTCAACAACTAGACACTTCTAATACTAT
TAGTGCTTTAATGCAAAATGGTGATTGTCCTTTCAACTTTGACAGTTTGAACAACTTCTTAAGTTTTGAT
AGTATTTGTTTCAATCTACAACCAGTTGGTTCTAGTTGTACAATTTCTATAATGAAAAACTGGATGGGTT
TTAAAGCACCCTGGAAGAGTGTTTATGTCACATTTAAGAGAGGCAATCGTATAACAGGCGTTAAAAATGC
TAGTACTGGCATTTTTGACCCTAGTGTCATGCAATTGAATGAGTGTACAGATTACACTATATATGGTGTC
TCTGGTAGAGGTATCATTCGTAAGGCTAATTCGTCTTATATTAGTGGATTGTACTATACTTCTATTGCTG
GACAAATTATTGGGTTCAAAAATGCTACTACAGGTGAAGTGTTTTCTGTCACACCTTGTCAGTTAACTAT
GCAGGCTGCTGTTGTTAATGACGATATTGTGGGTGTTGTCTCCTCGACGAATACGTCTGGTATTAATTTC
ACCCACACCATTACCACTAAAACTTTTTATTACCACACTAATGTGCAACAAAATTGTTCTGAACCTGTGT
TAACATATGCTAATATTGGTGTTTGTTCAGATGGTTCTATCACTGAAGTAACTGTGAGAAAAACAGAACC
TGAACCTGTGGCACCCATCACTACTGGTAATTTAAGTATACCCTCCAACTTTACAGTTTCTGTTCAAGTT
GAGTATTTACAAATGTACAATAAACCAGTTAGTGTAGATTGTCAGACATATGTTTGTAATGGTAATCCTC
GTTGTTTAAAACTACTGACACAGTATGCTACAGCTTGTCGTACTATTGAAGAAGCTTTGCAACTTAGTGC
TCGTTTAGAGTCTGTTGAAGTTGCTAACATGATAGCTGTTTCTGATGAGGCTGTACAATTAGCTAATGTC
AGTTATTTTGATACTTATAATGTTAGCGTGCTCTTGCCAAGAGGTCAGAGTCGCGGTAGTGTTATAGAAG
ACCTATTGTTTAATAAAGTTATTACTAGTGGTCTTGGTACTGTGGACGAGGATTATAAAGCTTGCACTGG
TGATGGTTTTGGTGCTGCGTTAGCAGACCTCTTTTGTGCTCAGTATTACAATGGTATTATGGTGTTACCT
GGTGTTGTTGATGAAACTAAAATGGGTCTCTACACTGCATCTTTGACTGGTGCTATGGTTATGGGTGGTT
TTACAGCAGCTGCAGCTATTCCGTTTTCACTTGCTGTACAATCCAGACTTAACTATGTCGCTTTACAAAC
AGATGTGTTACAAGAAAACCAGAAAATATTGGCTTCTGCCTTCAACAGTGCTATGAGTAACATCACATAT
GCTTTTACTGAGGTTAAGAATGCCATTAAAGACACATCAGTGGCTATTAGTACTGTGGCTCAAGCTCTTG
GAAAGATTCAAAATGTTGTGAATGACCAAGGTCAAGCGCTTTCTCAACTTACTAGACAATTGGCCTCAAA
CTTTCAAGCTATCTCTTCTTCCATACAAGATATCTATAATAGGTTGAATGATGTGGAAGCAGATGCTCAA
GTTGATAGGCTTATTACAGGTAGGTTGGCTGCATTGAATGCTTTTGTTACTCAGACTTTGACTAAGTACA
CAGAGGTACGTGCTTCACGACAATTGGCTCAAGAGAAAATTAATGAGTGTGTTAAATCACAGTCATACCG
TTATGGTTTTTGTGGTAATGGCACCCATTTATTCTCAATTTCTAATGCTGCGCCACAAGGAATCATCTTC
TTCCATACAGTTTTGCTTCCTACAGAGTACCAAACTGTCGAAGCTTGGTCTGGTGTTTGCGTCAATAATC
ATTATGGTCTTGTTTTAAGAAATGTTCATGATGCGCTATATAAGCGCAATGATAGTTATTTCATAACTAG
TCGTGATATGTATGAACCTAGAGTTCCACAAGAATCTGACTTTGTTAGAATAACTGGTTGCAGTGTAGTT
TACCTCAATATAACTCACACACAGATTGGTGACATTATACCAGAGTATATAGATGTTAATAAAACTCTTG
AGGAGTTTCTTAATAGCTATCCTAACTACACTGTGCCTGATTTGAACTTAGATCTTTACAACCAGACTGT
CTTGAACTTGACCGAAGACATTAGCAAGCTGTATGAAAAAGCTGAAAGTCTCCACAATAAAACCATTATT
TTACAACAGTTGATTGATAATCTCAACAACACTTATGTTGACTTAGAATGGTTGAATCGTGTGGAAACTT
ACATTAAGTGGCCATGGTATGTGTGGCTTCTAATCTTTCTTGCACTTGCAGCTTTTACATTTTTAATGTT
ATATTGCTGTATTGCAACTGGTTGCTGCGGCTGTTTGAGTTGTATTTGCAGCTCGTGTGCTGATTGTAGA
GGCAAAAGATTACAACGTTACGAAGTGGAAAAGATTCACATTCAATAATGTTTCTTGGGCTTTTTGAAAG
TTCAATGGAGGCAGCTATTGCTAATGGTTTCAATATACCACCTAACGAAGTTGAAGAAATACTGGATGTA
ATCAAACCAGCTAGACAAACAATTTCAATTGCTAGCTTTTTGCTCTCCAGTGTTTTTGTGACTTGGTTTG
CATTGTACAAAGCCTCTTGTTTCAGAACAAATTGTGCACTTTTTGCCTTGCGCGTTTGCACTTTGCTGTT
GTACACACCAATTTTGGTGTTTTTCAACTCTTACATTGACGCAGTTGTTGTAGCTTGTTCTCTAACTATA
CGTTTTGCTTATCTGGGCTATTACAGTTACAAGTACAAAAGCTTTTCTTTTCTGGTGTTAAACACCAGTA
AAGTGGCTTTTGTGAATGGGAAATTTTGGTATTATGATGAGTCACCTTATGTTGTGCTTTGTGGTGGTGA
TCACCATGTGCAATTGGGTGAGTACATGATACCTTTTGCTGATTCAAATGAGTTGTACGTTGCTTTGCGT
GGAACTACAGAAGATGATGTACCTTTGTCCCGTAAAGTTGAAATGATGAACGGTGCTTTCATCTACATAT
TTGCTCGTGAACCTTGTGTTGGCATTGTAAATATGTCATTTAAAGAAACTCAACTTGACGAGGACTTAAC
CTTTATTACACTTCACAATGTTGACATTAGTCAATGATCATGGAATGGTACTTAGTACCCTTTTATGGCT
AATTGTGATTTTATTCCTCTTGCTTATCTCTATTACCTTAATTAAGTTGATACAATTGTGCTTCACTTGT
CATCAATTGATGTCTCGCACAATTTATGTACCTGCTTACAATGCGTATAGAGTTTACAAGGATTTTATGC
AAATTCAACCTTTACCTGTTATCGAAGTCTAAACTAAAACGATGTCGAATAACAGTACTGTACCAGTCGA
AGTTGTTGTTGAACATCTTCGTAACTGGAATTTCAGTTGGAATGTTGTGTTGACTGTGTTTTTAGTTGTC
CTTCAATATGGACAATACAAATACAGCAAGCTGCTTTACGGACTGAAAATGCTGATACTGTGGCTTTTGT
GGCCATTGGTGCTAGCGTTGTCAATTTTTGACAGCTGGGCTAGTTTCGGCGTAAATTGGGTTTTCTTTGC
TTTTAGCATCCTTATGTCCTGCATAACACTAGTGCTGTGGATAATGTATTTTGTCAACAGCTTCAGATTG
TATCGCAGAACTCAGACATTCTGGGCTTTTAATCCAGAAACAGATGCCATTATTACACTCTCAGTCTTTG
GTCGACAAGTTTCGATCCCGACTATTGTTGTCCCAACAGGCATCACGTTGACAGTTTTAAGTGGTACACT
TCTTGTGGAGGGTATTAAGGTTGCTACTGGTGTGCAGGTAAGTCAATTACCTACGTACTTAACAGTCGCC
AAGCCCTTTACCACTATAATTTATCAACGTGCTGGTCGTTCTGTGAATGCTCGTTCAAACACAGGCTGGG
CTTTCTATGTCAGATCGAAAAACGGTGACTATTCTGCTGTTTCGAGTCATTCAGATTCGATGACAGAAGA
TGAGAGAGTGCTTCATTTAGTTTAAACTAAACAAAAATGGCTTCAGTCAGTTTTCAAGAGGAAAAAAGGG
GCCGAAGTGGTAAGGTACCTCTTTCTTATTACAACCCTGTTATAGTTTCCGGAGATAAACCATTTTGGAA
GGTTATGCCTAATAATGCTGTTCCAAAAGGTAAAGGAAACAAGGATCAACAAATTGGCTATTGGAATGAA
CAACCTCGTTATCGCATGGTCCGTGGTACTCGTAAAGACTTGCCTTCAAAGTGGCATTTCTATTACTTGG
GAACAGGACCACATGCAGAGTCTAAATTCCGTACTCGCACAGAAGGTGTGTATTGGGTTGCTGTTCAAGG
TTCTAAAACTGAGCCAACAGGACTTGGTACACGCAAACGTAATGCTGAATTAGTCAATCCAGAATTTGCC
ATTCAATTGCCAGCTGCTATTGAAATCCAGGAGAACACAGTTTCTAGAGGAAACTCTAGGAGCCAGAGTT
CTAACAGAGATCGCAGTCAGAGTGGAAATCGTTCTCAAAATGACCAAAAACAGGGCAATCAAAATCAAAA
ATCGCGGAGCAATTCGCAGTCCCGAAAGGGAAACCAAAATTCAAATGACTCTGCCGTAGACATTGTTGCA
GCTGTTAAACAGGCACTTAAAGAGCTTGGTGTAACAAATGAAAGCAACAAGAAAGGTAAGAACAGTGGTA
CTAACACTCCTAAAGAACAACGTTCTAAATCACCCGCCAGATCTCCAACAGTTCAAAAGAAACAGTTGGA
AAGACCGCCTTGGAAACGTGTGCCTAATAGCACAGAAGACGTGACCAAGTGTTTTGGTGTAAGAGACACT
CACAGAAACTTTGGTGATGCTGATCTAGTCAGAAATGGCATAGATGCTAAGCATTATCCACAGTTAGCTG
AACTTGTCCCAACACCTGCTGCAGTTCTATTTGGTGGTGAAGTTGTTACTACAGAAGTTGGCTCGGATGT
GGAAATTACCTACATCTATAAGATGAAGGTTCCAAAAACAGATAAGAATTTGCCTGCTTTTCTTAAGCAG
GTAAGTGCTTATTCTCAACCATCCCAAGCTGCAGAAGTACCATCTCAGTTGAATCCTACTGCTGTTGCTT
TCCAACCACTGGCAGAGGATGAACAGGTCGAGATTATCGATCAGGTTTATGGCTCATTTGATGCTTAAGT
TTGCAAATCCTCAACTAAACATGGACATATTTAATATGTCTGTCTTGCTTTTTATAGTACTATGTTACTT
TGAAGTGGTGTTGTTTGCTTTGCAAGCTGTGTTTCTAGGTGTAGAACTTACTTCTAGTGTGTTGTTCTCT
TCTTTTATACTTGGTTGTGTTGCTGCTTTGTTTGTTACGGAGCTTCCTATGCAATTTCTAGATATAATTG
ATTTTTACACCTCACGCCTAGTGCACACTCCAGTAATACGCACCCTAGCCGTCAGCTGAAAAGCGGGCTA
GCAAGTGTAGGTGCTACTCTTATACAGAATGGTAGGCTCGTATATAAGCTAGTATAAGTAGAGTTTATAT
ATATTGCTGCGCTTAGACCAACGCATAAGATTCATGACCTCCTAGAGTCAGGGTAAGTACAAAGATCGCT
TGACGAGCCCACTGTGGAAGAACTGTCATAGGAACTTGATATCTTATAGTTAGTAGTTGCTAGTAGTTGC
GGCTTTGATAGGGATACACAAAAAAAAA

>gi|169822558|ref|NC_010438.1| Bat coronavirus HKU8, complete genome
GACTTAAAGATATAATCCATCTAGCGACGGGTTATACTCTTTTTAGACTGTTGTCTAATCCCCTCAACTA
AACGAAATTTTTGCCATACTTGTATGGCGGATTGAAATTTCCCTAGGTTACCACCATCCCGGCCCCAGTG
TCGTGTCATTCAGTGGTCCCTCGCACTGTTCCGTCAGTGCTTAAACCACTGTCTGACCTGCACGTAGTTC
TGTCTGCGTGCAGTGTGGATAGTACGTTCCGTCGTGCTTGAAACCGATAACAGGTCGCTATGGGTTCTAA
CCATTTGACCCTGGCTTTTGCCAGTGATTCTGAAATTTCTGCTTCAGGCTGTTCCACCCGTGAAGAGGCC
GTCTCACGCTATAGTGAGGCCGCGATTTATGGGTTTGAGAACTGCCGCTTTGTTGCGTCCGGTCTTCAAG
AGATCGTTGACGGTGTCAGCGCAGATGATTATGTGCTGTGTTTCTCAGGTGTCACAACACTGAGGGCTTT
TGTTGGCAAGTATGGTGACCGTCCTCGCAATTTGCGTGGTTGGTTATTGTTCTCCAACTGTAATTATTTC
TTGGAAGAAATCGATGTCATCTTTGGCTTTGGCGGTGGTGATGCCAGTCCCGTATATGTGGATAACTACA
TGTGCGGTGCTAATGGCAAACCCGTTTTGCCTGCTGATGTTTGGGTTTACCAGGATTATTTTGGTGAGGA
GACTGAACTTATTGTTAATGGTGTTAAGCATGTCAAGGTTTGGCATGTTACACGCACTGACATTCCGTAT
CAATTTCAGTCTCTAGGTGCCATCGAGTCAATTGAGTGGCTCACTGACATTCCTCACACGCTGCGGAATG
GTAGTAGACTTTCCGCTGCGCGTGCTGTTAAGCATAGTAAGAATGTTGTTTTGTCTGAACCACTCAAGAC
TTTGTACCAGGCATGTGGTAGTCCATTTGTTACTAATGGCTCCACCTTGCGTGAAGCTGTGCCAAAACCT
GTCTTTGCACATGCATATGTTGCGTGTAAGTGTGGCAGGAAAGCTTGGTCTGTTGGTGACTGGTCCGGCT
ATAAATCCACATGTTGTGGTGTTTTTGGCAAGCCACAGTGTGTCGTTTTTGGTGAGGTCGTGCCAGGTGA
CGTCTTTATCACTACCAGCTCAGTTGGTAGTGGTACACGTTACTACAACGGCCTTACTGTGAAGCATGTT
GTCACTGTTGATGGACTTGCATGCTGGCGTGTGCTTAAAACTCAGAGTGTTGATGGCTTGACAGCCACTC
CATCTTTTGATGATTACTCTGATGCTGCTTTTGATTGCTGTGTTTACCACAACAACACCCAGCTTGCTGT
TGCATATAAAATGGGTCTGTTAAGTGGCAACTTTGATGAGACAGTCATCGATGGCGTACTTGCTGGTGCC
ATTGATGTTGGCTCTGCTGTTTTAGATGTCATTGACAGAATCTGTGATGCGCAACCTTGGTTCATCCAGA
AATTTGGCGCGCTGTTTGAATCTGCATGGGCTGCGTTTGTTGCTACTCTTAAAAAGATTCCAGCGCTGTC
TTCAGAGTTCGTGCAGCTTTGCAGTGCTTTACAGAAGGCCATCCTTACTGTGCGCGATGGTGTTATTGAC
TTTTATGTCGAGAATGTAGCACCGAAGTTTGTAGCTGCAGTTGAGGCTTTTAAGATGCTTGTTGTTGGCG
TGTTTGATTTTTCTGTTGACACCTATAAGGTTGTGGGTGAAACTTTTAAGCGCGTTGGTGATTACGTTCT
TCTTGGTAATGCAGTGGCTAAGTTGGTTACTACAAAAGTCAAGGGAGTTCGTCAGGCCGGCGCAAAGAAA
GTCACTTTTGCCACACCTGTTATTGGTGTTGCTAAAAGGGTTACATCCACACGTACAGAAATTGACAGCG
TTCAGCTTGTTGCTTGTGCTTCTACACCACTTGTTGAAAATGGGTGTACTGTCATAGTTGATGGCATTGC
ATTCTTTAAGAGTGGTGGTGTTTACAGGCTTATGGCTGACACAGATCTCGTTTACGAGACACCTGTTTAT
TGTCAACAAGCCACTTGCAAGCCAGTCTTTAAGTGTGCCAAACCTGATGGTTTTCCTGATGTAACTAGTG
TTAACCCCGACACTTTGGCCCATGAGGTCAAGAAGATTTTGGGAGGCATAGCGAGACCATATGACAAGTA
CACTTGTAGTGTCATTAATGGTGAGTGCCAGGTTGACCATAGTTATAATTTTAAGGCCCCTGCTTATATC
ACAGACAAGCAGCAGTTTGTTATGCTCTGCAAAGACTTTGTTGTCGATGCCAAGTTTGAAGAGTTTTATG
TTAAGGCTCTTGAAGCTAAGTCCCTTGATGGTTTTGAGCCTTATTATGAGGCCTTTACCATCTTTAAGGG
AGAGCTTAAATGTCCTGCTGAGTTGATTGAGCTTGATGATGGTGGCTTGTTTAACACCTTTATTAAAACT
GTTAACAGTGCTTATGATTTTGTTAAGAATCTTAAAGTTTCTGTTACTGTTAAGGGTGTCATTTGTACAG
CTGCCAAGCGTTTTAAGCGTTGGGCTAATGCGCTTGCAAAGATCTATACTGAGTTTATTACTGGTGCCTG
TAAGACTGTCGTTATTGGCGGTCTTGAGTTTGCATACTATTGTTTTGCAAAACCTGCTATTGCACTCGGT
GACATCTTTGTGCGCGTTTCTAAGAACGCTCTTAGTGCCTTTAATAGACCAACTGAGGCTGGTGCTGTTG
ATGCTCTCGTCTTTGAAGGCGGTGATATTGAAACTGTCTGTTCGCGCGTTCAGTTTGATACTGTTGCGCT
TGAACCTGTGCAGGAAGTACCAGTTCCTAGTGATGGCTATGTTGCTGTTGTTGATGGCTACACTTTCTTT
ACCGATGGCACTCATTACTTCCCAACTGGACTGTCACGGTGCTACACAACGTGTTTTAAACGTGGTGGTG
GTACTGTTGAGTTTTCAGAGGTTGTGGAAGTTAAAGAGATTGATCCAGTCTATAAGGTTCGCCTTGAGTA
CGAATTTGAGGACGAGAACATTGCCATTGTTTGTAAGAAGGCCATTGGCAAAATTATTACCTTTGAGGGT
ACTGATTGGTCTGAGTTTGAACAAACTCTTATTAACGCAGTTTCTGTGGTTGGTGAGTTTGTTGACCTTC
CTGATTTTTATGTTTATGATGAGGAAGGTGGTACAGATCTTTCTAAGGTTGTGATGGTGTCACAATGGCC
TTTGAAGTCGTCACCCGAACCACAAAATTTTGATCCTTCACCACTAGCAGCATTTGTTGTTAGTTGTGGT
TTGGAATGTGATTTTAGTGGTTGCGGTGATCCTGTTAGTTGTTTTCAGACTGTTGAAGGTGCAGCTTTGT
GCATTTCAATGGAGCGTTCCTGTAAGTGTGGTACTGATCAGGCTGTTTGTGAGGGTTTTTATGTGCCTGT
TAAACCTTGTGCTAGCACTGACACTTGTGATGAGTGCGGTTGTGATCGCATTTCCACGATCACTAGCATG
GTAGGTACAGGTTTTGTGGACCTTTGTGACAACCCTGTTGTGCCTTTTGATTGCGTTGAGTGTGGTTTTG
GTGGCTATAATGGTGTTTGCTTCGTCAATGTTGACGTTGCAATCCCACCTCCAGAAGACTTGCCACCACC
ACCTGAACCGGAACCTGAGCCTCCTGTTGATGCTATGCAGGAGGTTGCTGAGGCACTGTCGTTTATTGTT
GATGAACCATCTGCTTTTGTTGATCCTTTTAAGTTTGAGTATTACGACCACGCTGGTGTTCGTGTGCTTA
AGCAGGAGGTTAACAATTGTTGGGTCGCTTCCACCTTGGTACAGTTGCAGCTGTACGGCTTTGACAGTGA
TGCTATGTCACTTTTCAAAGCTGGTAGCGTTTCGCCTATGGTGCGTAGGTGCTATGAAGCTGTTGGAGCC
ATTCGTGGTAGTTTAGGCGATGTTTCACAGTGCCTTGAAAAACTTCTTTCTGACAGTCATACTATGTTTA
TGACTTTCGATGTGAAGTGTGATTGTGGTGCATCTGTGGCTGAAATGAGTGGTGCTGTGTTTCGTTTTAT
GCCTACTCGTGATTCTTTTAACTATGGTGCTTGTCCTACTTGTAGGAGTGTCATGGTTTATAAGATTAAG
AGTATGCAGGGTACTGGCTTCTTTTGTCAGGACCCTAAACCTTTTAATACAGCTCGTTCGCTTGTTCGCC
CTGTTAGTGCCAGTGTTTACAGTGGTCGTACTGATGGTGGTCATTACAAAACCAATATCTATGATGCACG
TGTTTGCGTTGATGGTTTTGGCGTTACTAGTATTACTACTGGTAATGTTAATGTGATCCTGCTTCACGAT
GTTAGTTACGGTCTTGTAGAGACTGTGCCTGCCGTCGTTAATGATGTTGTTACAACCACTGTGGAAAGCG
TTACCAGCGCTGCTACACCTAGTGTAGAACCATTTGCCACTTTTGGCAGTGTTGAGTTTTACCAGGGTGA
TGTTAAGGCGTTGTCTGCACTTCCTTGCGACTTTGTGGTTAATGCTGCTAATGAAAATTTGCAGCATGCC
GGTGGTGTCGCTAAAGCTATTAATGACCTTACTGGCGGTGTGTTACAGCGTCTTTCAGACGATTACACAC
GTGCCAATGGTAAGGTTAAAGTAGGTTGTGGTGTTATGCTTGAGTGCCCACTGCGTGTGTTTAATGTGGT
TGGGCCTCGTAAAGGCAAACACGCCAGGTCTTTGCTTGTTAAGTGCTATAAGAGTGTTCTTTCAAATCCA
GGTGTACCTTTAACACCGTTAGTTAGTGTTGGTATATTTGGTGTGCCTTTGTCTGACTCTTTTATCGCAC
TTACAAGTGTTGTTGGTGAGAGACGTGTTTTGTGTTTCTGTTATTCAGACACAGAGCGTAAGGCTATTCT
TAAGTTGATTGAGCAGCGCTCTAGCGTTGATCAGCCAACTGTGCCAATTGTGCCACCAACAGCAGATGTG
GAGGTTGCAACTGTTGTACAGTGTGTTTCAGAAACTGAAGCTGCAACTGTGGTAATGGATGTTGTTGCTG
AACCACAGCCTACAGAAGTCATTGCTACACAGCCGTGTGTGCCTGAGGCACTTGAGGTAGTAGGCTCTGT
GACTTACTATCCTGTTGATGTAGGTGTTGTAGGTGTTAGACCTGACAACATAATTCTACACACCACGCAA
GACCTTGGTCTTTGCGCGTTTGGTAAGTTGCTAGATGAGCAGGCTTGTGGTGCATTGTCAGCTTCTATTG
ATGCTTATAAGCAAAATACGGCTGTAGTACCACCTGGTAATATTGTTACCTTTAAGTGTGAGGGCCAGCC
TACTGTTGTTTTGGCTGTGTTTCCACCTGCAGATGATGCGGCCTATCTTAAGAATGTCAAGCGTGCTGTT
AGTAAGCTTGCAAAGCTCAAAGGTGTTAGTGTTAGTACATTTTCCACCATTGATGTACACAAGCGTCTTC
TTGCTTTTGTGAAGTTGTTTTGTGTTGCATCAATGGACGTTGTTGGTGATGTACATACTACGCCTTCTGT
TGTTAAAGTGACAGAAGATGGTCGCACTGTTAAGGATGTTGTTGTTAGTACAACGACTACTGCGGGTGAT
CAATTGGGCCCATGTGCTGTAGAAGGCGCCAGTTTGACAACATCGGTTGTTACCGATGTTGTTAATAGTG
TTGTTGCAGTGGCTCCTAATGTTGATTGGGATAGTCATTACGGCTTTAAAGACGCTGGCAACTTCCATGT
GTTAGACCATAGTGCGTATGCTTATGATAGCGACTTTGTCGATGGTAAGCGCGCACTGGCTGGCAGTGAT
AATAATTGCTGGGTTAATGCCACATGTTTACAGTTGCAGTTTGCAGGTGTTGAGTTTTTGTCTAAGGGTG
TTACAGCCATGTGGAACGAGTTTTTAACAGGTGATGTTGCCCGTTTCGTGCACTGGCTGTATTGGCTTAA
TGGTGCTAGCAAAGGAGATTTGGGTGATGTTGAAACCACCTTAAACCTCGTTGCTAAGCACGCCAAACCT
AAAGGCTGTGTGACTATTGAAAAGACCACAGTTGATGGTTGTTGCGTCTCAGAAAAGCGTGTTAACAGTC
TCGTTGTTAATGCAAGTGTACTTCGACAGGGTGTGGGTGATGGTTATTGCCAGCATGGTAATGAGTACAT
CATTCGCGTCTCACGCGTCGAGGGCACTGCCATTATAGTGAATGTTGGTGATCCTTCTGTTAAGGCGCCA
AATTTACTTATTAGTGGCACGGCTTATACCGCTTTTTCTGGTCCTATAGATGCTGGTCACTACCGCGTGT
ATTGTTCTGCAACATCAAAGGTTTTTGATGGTAAGAGCATTGTTGGTGGTGACCTTTGCAACTTGGCAGT
TACCTCTGTTGTGGTTGTTAATAAGTTCTTTAAGGCTGAGGTTTGCAATGCTAAGAGTTCTGAACCGACG
GCAGTGAAAATTATGAGTAAGCTTGATGATGCTTCCGATAAGTTTTTCACTGCTGGCGATGTTGTTTCGC
ACAACATAGCTAATTCTGTTGTTTGGTTCTTTACTATGCTTAGTATATTGTTTAAAGCCTTTAAGACTCG
AGATTTTAAGGTTTTTGCTTTGGCTCCTGAGCGTACTGGCATAATATTTACGCGTAGTTTGAAATATAAT
ATTAAAGCTGCGCGTGATATGCTAAAGCGTAAGCAGAAGTGGGTGTTTTGGTTTTTAAAATTCTGTCTAC
TTCTGTATACTGCTTATGCTGTGTTGTTTATGTTCATACGCTTTGGACCACCTAATGAAACCTTGTGTAA
AGACCATGTTGACGGCTATGCAAATTCAACCTTTGTTAAGGATGATTATTGTAATAGTGCGTTGTGTCGT
GTGTGTCTTTTTGGTTATCAGGAACTTGCTGATTTGCCTCATACCAATGTTGTGTGGCGTCATGTGGGTA
TGCCGCTTTTTGTGAACTGGATGCCATTGTTTTATTTGGCTTTCCTCTTCATTTTTGGTGGCTTTGTTAC
TAAAGGCTTTGTTTTGTATTTTGTGGCTCAATATGTTAATGCCTTTGGCGTTCATTTTGGCATGCAAGAT
CTATTCTGGCCTTTACATTTAATACCCTTTAGCACTTTTGGTGACGAGATGGTAGTTTTGTTTTTGGTTG
GCCGGTTCCTTATGTTCGTTAAACATGTTTGCTTTGGCTGTGATAAAGCATCATGTGTTGCTTGTAGTAA
GAGTGCACGCCTTACACGTGTTCCAATGCAAACTATTGTTTGTGGAGCTAACAAGTCGTTTTACGTCACT
GCCAATGGTGGTAAGAACTTTTGTTCTAGGCATAATTTCTTCTGTGTGAATTGTGATTCACATGGCCCTG
GCAATACGTTTATTAACGAGGTTGTGGCTCGGGAACTCTCTAATGTTGTTAAGTCTAGTGTTAAGCCAAC
TGATGTAGCCTATTTAGAGGTTGATAAAGTCGAGTTTAATGACGGCTTTTATTACCTTTATTCTGGTGAA
ACCTTTTGGCGGTATAACTTCGACATAACGGACAACAAGTACTCATGCAAAGAGGCTCTTAAGAGTTGTA
ATGTTTTGTCTGATTTCATAGTTTATAATGATGCAGGCTCTAACATTACTCAAGTTCGTAATGCATGTGT
GTACTTCTCGCAGTTGCTTTGTAAGCCTATTAAACTTGTTAATGCTTCCCTATTATCCACTCTTAATGTG
GATTTTAATGGTGCATTACACTCTGCTTTTGTTAATGTTCTTAGTGATAGTTTCTCTAGGGACCTTAGCA
ATTGTTCTACTATGAATGAGTGTAAGCAAGCTTTAGGCTTTGAAGTTTCTGATGATGAGTTCCTTAATGG
TGTTAGTGATGCTCACCGTTATAATGTGTTGCTTTCTGACACTTCTTGTAATAACCTGGTTACTTCTTAT
GCCAAGCCTGAAGAGAAACTCTCTGTGCATGACTTAGGTACTTGCATGAGGTTTGGTGCTAAAGTTGTTA
ACCATAATGTTTTAATTAAGGAGAATGTTCCTGTCGTGTGGCTTGCAAGTGAATTTCACCTTCTCTCCGA
AGAGGGTCGTAAATACATTGTAAAGACTACTAAGGCGAAGGGTGTTACATTCCTACTCACATTCAATTCT
AACCCAATGCAACTTAATATTCCATCCACCAGCATCGTTAATAAGCGAGCTGCTGGTGTGGGTAGTAAGT
TCTTTTGGTGGGTGTGTTTGGCTATTGTTGCATTCTTCTTACTCCTTAATGCTTCCGAGTTCGGTTATGT
TGCTACTAGTTTTGAGGACTTTGGCTTTAAGTACATTGAACATGGTGTGCTTAAAGATTTTGATGGTCCC
CTATCTTGTGTGCATAACGTTTTTGACAATTTTAATGCTTGGCATGAAGCCCGCTACGGTGTTGTACCAA
TTAACAGACGTATATGTCCTATTGTGGTTGGAACCATTGACAATATACGTTTTGTTCCTAACGTGCCTTC
TGGTATTGTTTTGATTGGTAAAACACTTGTGTTTGCTGTTAAGGCAGTTTTTACCGAGACTGGTAACTGC
TTTAATTTGAACGGTCTTACGACTTTGGGTTCATGTATTTTCAATTCTGCTTGTACCAATATGGATGGGC
TTGGTGGTCCTGCCACTTATTGTTACAAGGAAGGTTTGTTTGAAAATTCCAAGCTTTATTCTGATCTCGT
ACCACACTCACACTATAAGCTTGAAGATGGCAATTTTATTAAATTGCCGGAAACACTTGCTCGCGGCTTG
GGGTTTGTCACCATTAAAACAATGGAGACTACTTATTGTCGCGTTGGTGAGTGTCTTGATTCTAAAGCTG
GTGTGTGTTTTGGTCTAGACAGATTTTTTGTCTATAATACTGAGTTTGGTGGCGACTACATATGTGGTTC
TGGCTTTTTGTCATTTTTCAGAAATGTTCTTAGTATTTTTACTAGTTCATTTTCTGTTATGGCTTTGTCG
GGTCAGGTTATGTTTAATTGTATTGTTGCCGCCATTGCAGTTGTCGTGTGCTTTCTTGTTATTAAGTTTA
AGCGCATGTTTGGTGATTTGTCAATGGGTGTATGTACCGTTGTAGCTGTGGTGCTTATTAATAATGTTTC
TTACATTATTACACAAAACATGTTGTTTATGTTTTTGTATGCCATATTTTATTTCCTGGCTGTTAAAGGT
CTTAAGTACGCTTGGATATGGCATATCGGATACGTTGTGGCCTACTTTACCTTAGCACCGTGGTTTTTGG
TTGCTTGGTATTTGGGCGCTACAGCCGTTGATGTGCTGCCTGCCATTCTCAAGCTTAAGATCTCTACGCA
GCTCTTTGAAGGTGATAAATTTGTTGGCACCTTTGAGACTGCAGCCTATGGTACATTTGTCCTTGACATG
CGTTCCTATGAGAAGTTGGTTAATAGTATGCCTATGGATAAGATCAAGCAGTATGCCGCCACTTATAATA
AGTATAAGTATTATAGTGGTAGTGCGTCAGAGGCTGACTACCGTTGTGCATGCTTTGCCCATCTCGCTAA
AGCATTACTTGCTTATGCTGACAACCACCAAGACCTTCTTTACACACCACCATCTGTAAGTTACAATAGC
ACATTGCAGAGTGGTCTTAAGAAGATGGCTCAGCCTTCAGGTATAGTTGAGAAGTGCGTTGTGCGTGTCT
GTTATGGTAACATGACTCTTAATGGTTTGTGGTTGGGTGATATTGTCGTTTGTCCTAGACATGTGATGGC
ATCCTCTACTACTAATACCATAGATTATGAGTATGAGTATAGCATGATGCGTTTGCACAACTTTTCTGTT
TCTGTTGGTAATGTGTTTTTGGGTGTTAATGGTGTCACCATGGAAGGTGTTAACTTGCACATCAAGGTGA
ATCAGTCCAATCCACATACACCAAAGCATACTTTTAGAACTCTTAAACCCGGTGATTCATTTAACATTTT
GGCTTGTTACGATGGTACACCTGCTGGTGTTTATGGCATCACAATGCGCCCTAATTATACTATTAGAGGT
TCATTCATCAATGGTGCCTGTGGCTCGCCTGGTTATAATGTTGTTAACGGTAATGTTGAGTTCTGCTACC
TGCACCAACTTGAACTTGGCAGTGGTTGCCATGTGGGTTCTAATTTTGATGGTATTATGTACGGCAACTT
TCAGGATCAGCCCTCTCTTCAAATTGAAGGTGCGGATCAGTTGGTTACACCTAATGTTGTAGCATTTTTG
TATGGTGCTCTTCTTAACGGTGTTAATTGGTTTGTGTCACCTGAGCGCCTTAGTGTTGAGGCGTTCAATG
AGTGGGCGCACAACAATGGCTTTACAGATATGAGTGGTGCGGAATGTTTCACTATGTTGGCTGCTAAAAC
TGGCGTTGATGTGCAACGTGTCCTGGCTTCTATTCAGAAGATAGCCAAGAGTTTTGGTGGTAGGAACATT
CTAGGTTTTACTTCTCTTACTGATGAGTTCACTGCTGCAGAGGTTATCAAACAGATGTATGGTGTTAACT
TACAGTCTCGTAAGTTGCCCAGTGTGTTTAATAACATCATGCTTGTTGGTGTATTCTGGTTTATGTTTAT
TTCTGAAATGTTGTATTATACATCTAGCTATTGGATTAAACCAGACCTCATCACACCGATTTTTATAATC
CTTTTTGCCATTGCTGTGTTTTTGACTGCCTTTGTTAAGCATAAGGTTTTGTTCCTTTACACCTTTTTGG
TGCCTGGTATAGTTATCACTGCCACCTCCAATTTGGCGTGGGATTGCTATGTGCGTGACCTGCTGGCTAA
GTACCTTGATTATCATATGTCCATCTTTAATATGGACATACAGGGTGTGTTTAACATTGCAGCTTGTTTC
ATGGTTAATGCTCTTCATACATGGCGTTACATGCGTAGTGGTTACACTACTCGTGTTACCTATGTTGCGT
CACTTATTGTGTCGGTTTATAATTACTGGTATGTTGGTGATGCACTGTCTTTGGCCATGATGCTTTTGCT
TAATGTTAATAACAATTGGTACATTGGTGCCTGTGCGTACAGGTTTGTACTGATTGTTGCTAATTATATG
AATCCCGCTGTTATAGGCTTTTTGGGTTCATTTAAGGTCATTATGTTTTTGTATGTGGCAGTCGGTTATT
TGTGCTGTATTTATTACGGCATTTTGTACTGGCTTAATAAGTTCTTTAAGTGTACTCTCGGTGTTTACGA
CTTTAAGGTGTCAGCAGCCGAATTTAAATATATGGTTGCTAATGACCTTAGAGCCCCTTGTGGTGTGTTT
GATTCTCTGTTGCTTAGTTTTAGGCTTATGGGTATTGGTGGTGAGAAGACCATTAAGATCTCCACTGTCC
AGTCGAAATTAACTGAAATTAAGTGTACCAATGTTGTACTAATGGGTGTTCTCACTAGTATGAATATTGA
GGCCAATAGTAAAGATTGGGCTTTTTGTGTTGATTTGCATAATAAGATCAATCTTTCTACTGATGCAGAG
AAGGCTATGGAATATTTGTTGGCTTTGTTAACATTCTTCCTTAGCCGCCAGAAGGATTTTAATTGCACTG
AGTTGTTGGATTCCTATTTTGCAGATAGTAGTATTTTGCAAAGCGTTGCCTCTACGTTTGTCAACATGCC
TTCGTTTATTGCGTATGAGACTGCTCGTCAGAACTATGAGGATGCGACCAATAATGGTTCTTCTCCACAG
CTCGTCAAGCAGCTTAAACGTGCAATGAATATTGCGAAGGCCGAGTTTGATCATGAAGCAGCTGTGCAGC
GTAAAATTCAGCGCATGGCTGAACAGGCTGCATCACAGATGTACAAAGAGGCTCGTGCTGTTAATAGGAA
GTCTAAGGTTATAAGCTCTATGCATGCATTACTTTTTGGTATGTTGCGTAAGCTTGATATGTCTGCTATT
GATACCATTCTTAACCTTGCTCGTGGTGGTGTTGTACCCCTTAATATTATTCCCGCTGCGTGTGCAACTA
AATTAGTTGTTGTGGCTAGTGATCATGAGTCTTTTACACGTGTGTATCAGCAGGGTGCTGTGCATTATGC
TGGTGCTGTGTGGACTCTGTCTGAAGTTAAGGATAATGATGGTAAACCAGTCCATGTTAAGGAAATAACG
AAAGATAACACTGCGCTTACATGGCCTTTAGTCCTTAATTGTGAGCGTGTTGTTAAGCTCCAGAATAATG
AAATTATTCCTGGTAAACTTAAACAGCGCCCAGTTAAAGGTGAGGGTGATGGCGGTGTTGCTGCAGATGG
TAAAGCACTTTATAACACCGAAGGCGGTCGTACTTTCATGTATGCGTTTGTTGCTGACAAACCAGACCTG
AAGGTTGTCAAATGGGAGTTTGAAGGTGGCCGTAACACAATTGAGTTAGAGCCACCATGCCGCTTTGCTG
TGTCCAATAGTAATGGTACCACTAGTATTAAGTATTTATACTTTGTTAAGAATCTTAATACATTGCGTAG
AGGTGCCGTACTTGGTTACATAGGTGCTACAGTGCGCCTGCAGGCTGGTACGCAGACTGAATTAGTGGCT
AATTCATCGCTGCTGACTATGTGTTCTTTTGCTGTTGATCCTAGGAAGTGTTATTTGGATGCAGTTAAAA
ATGGTGTTAAACCTGTTACTAACTGTGTCAAAATGCTTTCTAATGGTTCTGGCACCGGACAAGCTGTTAC
AGTGGGTGTTGAAGCTAACACAAATCAGGATAGTTATGGTGGTGCTTCCGTTTGCTTGTATTGTCGTGCT
CATATTGATCATCCTAGTATGGATGGTTTCTGTCAATTTAAGGGCCGTTATGTGCAAGTACCAATTGGCA
CTGTTGATCCTATCCGTTATTGCCTTGAGAATGACATTTGTAAGGTTTGCCATTGCTGGTTGAATAATGG
TTGCACTTGTGATCGTACAACTGTTGTGCAGTCACTTGACAACAATTATTTAAACGAGTGCGGGGCTCTA
GTGCAGCTCGACTAGAGCCCTGTAATGGTACTGAACCAGAACACGTAATCCGTGCCTTTGACATTTACAA
CAAAGATGTAGCTTGTATCGGTAAGTTTGTTAAAGTTAACTGTGTTAGGTTTAAAAACGCCGACAAGCAT
GATGCATTCTATGTTGTTAAACGTTGTACTAAGAGTGTTATGGAACACGAGCAATCCATATATGACGCTC
TTAAGGACTGTGGCGCGGTTTCTCCCCATGATTTCTTTGTCTGGAAAGATGGTCGTTCTGTTTATGGCAA
TATTGCACGTCACGATTTGACTAAGTACACTATGATGGACCTTGTTCATGCACTTCGCAACTTCGATGAG
AAGAATTGCGAAACTCTTAAAGAGATTTTAGTAATCTCTGGTGCATGTGACAGTTCTTATTTTGATAATA
AGAATTGGTATGATCCTGTTGAAAACGAGGACATTCATCGTGTGTACGCCAAGTTGGGCTGTGTTGTGGC
TAATGCTATGCTCAAATGTGTTGCACTTTGTGATGCTATGGTTGCGAAGGGTGTTGTTGGTGTTCTCACA
CTTGATAACCAGGACCTCAATGGTAATTTCTACGATTTTGGAGATTTTACCATTGGCATTCCTGGTGTGG
GTGTACCTCTTGCAACATCCTATTATTCGTACCTTATGCCAGTCATGGGTATGACTAATTGCCTAGCTCG
CGAGTGCTTTGTTAAAAGTGAAATCTTTGGCTCCGATTTTAAGACTTATGATCTTTTGGAGTATGATTTT
ACTGAGCATAAGCTTGGCCTTTTTAATAAGTATTTCAAGCATTGGGATCTTGATTATCATCCTAATTGTT
CTGACTGTTATGATGAGATGTGTGTTATTCATTGTGCTAATTTTAACGCACTTTTTGCTACTACCATTCC
TGACACTTCTTTCGGTCCCTTGTGCCGTAAAGTTTTTATTGATGGTGTACCAGTTGTTACTACTGCTGGT
TACCATTTTAAACAGTTGGGTTTGGTGTGGAATAAAGACCTGAATACACATTCTACTCGTCTTACTATTA
ATGAACTGCTTAGGTTTGTTACGGACCCTGCATTGCTTGTAGCATCCTCACCTGCATTGTTTGACCAGCG
CACTGTTTGCTTCTCTGTTGCTGCATTGGGTACTGGTCTTACTAAGCAGACTGTTAAACCTGGTCATTTT
AATAAGGAGTTTTATGACTTCCTTTGTGCCCAGGGTTTCTTTGATGAGGGTTCTGAACTTACGCTCAAGC
ACTTTTTCTTTGCACAGAAGGGTGATGCTGCTATACGTGATTTTGATTTTTATAGGTATAATAGACCTAC
CGTTTTGGATATATGTCAAGCTCGTGTCGCTTATCATGTTGTTAAGCGTTACTTTGACATATATGAGGGT
GGTTGTATAGCTGCTCGTGATGTTGTTGTTACAAACCTCAACAAGAGCGCTGGTTATCCACTTAACAAAT
TTGGTAAGGCTAGCCTGTATTACGAATCATTGTCATATGAGGAACAGGATGCCTTGTATGCACTTACAAA
GCGTAATGTTCTTCCTACTATGACACAGCTTAACCTTAAGTATGCTATTAGTGGTAAAGAGCGTGCTAGG
ACTGTTGGTGGTGTCTCTTTGTTGTCTACCATGACCACGAGACAATTTCACCAGAAACATCTTAAATCCA
TTGTCAATACACGTAATGCCACCGTTGTCATAGGCACTACTAAGTTCTATGGCGGCTGGGACAATATGTT
GCGAAATCTTATGGATGGTGTGGATAATGCTTGTCTCATGGGTTGGGATTACCCTAAGTGTGATCGTGCA
TTGCCCAACATGATTCGTATGATTTCTGCTATGATTTTGGGTTCTAAGCATGTTAATTGTTGTACCAATT
CAGATCGTTATTATAGACTTTGTAATGAGCTTGCACAAGTTCTTACTGAAGTTGTCTATTCTAATGGTGG
TTTCTATATGAAACCTGGTGGTACTACATCTGGTGACGCCACTACAGCCTATGCTAATTCTGTCTTCAAC
ATATTCCAGGCCGTTAGTGCTAATATTAACAGGATTTTGGGTATTAATAGTAATACCTGTAATAATCTTG
CTGTTAAATCCTTACAGCGTATGCTCTATGACAATTGTTATAGAAGTTCTGCTGTTGACCCTGGTTTTGT
TGATACTTTTTACGGCTACTTGCGGAAGCACTTCTCTATGATGATTCTGTCTGATGACGGTGTTGTCTGT
TATAATAAAGAGTATGCTTCTTTGGGTTATGTAGCCGATATTAACGCATTTAAGGCCACGTTGTATTATC
AGAACAATGTTTTTATGAGCACCTCTAAGTGTTGGGTCGAAGAAGACCTTACTAAAGGTCCTCATGAGTT
TTGTTCTCAACACACTATGCAAATAGTTGATGGTGATGGTACGTATTATTTACCGTACCCAGATCCATCA
CGTATTTTGTCTGCTGGCGTGTTTGTAGATGATGTTATTAAGACTGACGCTGTCGTTCTTTTGGAACGTT
ACGTGTCTTTGGCCATTGATGCTTATCCACTTTCCAAGCATCCAAACCCTGAATATCGTAAAGTGTTTTA
TGTGTTACTCGATTGGGTTAAACATCTTAATAACACTTTGAACCAGGGTGTGCTTGAGTCTTTCTCAGTT
ACGTTGCTTGAAGACGCGTCCTCTAAGTTTTGGGATGAATCTTTCTATGCAAACTTGTATGAGAAGTCTG
CTGTGTTACAGGCAGCTGGTCTTTGTGTTGTTTGCAATTCTCAGACTGTTCTGAGGCGCGGTGATTGCCT
CCGTAGGCCTATGTTGTGCACTAAGTGCGCTTATGACCACGTTGTAGGCACAAATCACAAGTTTATTCTT
GCAATTACACCGTACGTTTGTAATGCTGCTGGCTGTGCTGTTAATGATGTTACAAAGCTGTATTTAGGCG
GTCTTAGTTATTATTGTGTTGATCGCAAACCACAATTGTCATTCCCACTCTGTTCGGGTGGTAATGTTTT
TGGTTTGTATAAGAACTCTGCCACTGGTTCTCCGGACGTAGAGGTCTTTAACACTCTTGCTACTTCAGAC
TGGACTGACGCTAAGGACTATCGTTTGGCTAATGAAGTCAAAGACTCCCTTAGACTCTTTGCCGCTGAAA
CCGTTAAGGCAAAGGAGGAATGTGTCACGTCGTCCTATGCAGCAGCCACACTTAAAGAGATTATCGGACC
CAAGGAGTTGCTACTTAGTTGGGAACCTGGAAAGATTAAGCCACCTCTTAATAGGAATTCTGTTTTCACC
TGCTTTCAGGTGACGAAGGATTCTAAGTTTCAAGTTGGTGAGTTTACTTTCGAGAAGCTTGATTATGGTT
CAGATACTGTGTGTTATAAGTCAACTGCCACTTGTAAATTGCAACCTGGCATGATTTTTGTTTTGACTTC
ACACAATATCCAGCCATTAAGAGCCCCTACTATTGCAAATCAGGAGCGTTATGCTGCTATTTGCAAACTT
AAGCCAACATTCAATATTAGTGATGCCTATTCTACTTTGGTACCATATTACCAGATGATTGGTAGGCAAA
AGATTACCACCATTCAGGGTCCTCCTGGTAGTGGTAAATCACACTGTGTTATTGGATTGGGACTTTATTA
CCCTGGTGCCCGTATAGTCTTTGCTGCATGTTCGCACGCTGCAGTTGATTCGCTTTGTGTGAAGGCTAGC
ACGACTTATGTCGTCGAGCATTGTACTCGTATAATTCCAGCACGTGCTCGAGTTGAATGCTTCAGTGGTT
TTAAGGCTAATAATAATAGTGCACAGTACATCTTTTCAACTGTCAATGCACTACCTGAGTGTACCGCAGA
CATTGTTGTCATAGATGAAGTTTCTATGTGTACTAATTATGATTTGTCCATTGTTAACCAGAGAGTGGCT
TACAAACACATTGTCTATGTTGGTGACCCGCAACAATTGCCAGCTCCTCGCACCATGATTACTCGTGGTG
TGTTGGAACCTAAGGATTATAATGTTGTTACCCAACGAATGTGTGCTGTAGGCCCTGATGTGTTCTTGCA
TAAATGTTACCGTTGCCCTGCAGAAATTGTAAAGACTGTTTCCGAGCTTGTTTATGAGAACAAGTTCGTA
CCTGTGCACTCTGAGAGTAAACAGTGTTTCAAGATCTTTTGCAAAGGTGCAGTTCAAGTTGATAACGGTT
CTAGTATTAACCGTAGACAACTTGAAGTTGTTAAGATGTTTTTGGCAAAGAACCCGTCATGGTCTAAGGC
TGTTTTTATTTCGCCTTATAACAGCCAGAATTACGTTGCTAGCCGGTCTTTGGGCCTTCAGATTCAGACT
GTGGATTCCTCACAAGGCAGTGAGTATGATTATGTTATCTTTGCGCAAACTTCTGATACAGCTCATGCGT
GCAACATAAATCGGTTTAATGTTGCCATCACACGTGCTAAGAAGGGTATCTTCTGTATTATGTGTGATAA
GTTGCTGTATGAAGCGCTTAAGTTCTTTGAAGTCAAACTCACTGATCTGCAGGCTGGAGATACTTGTGGT
CTCTTTAAAGATTGCAGTAAGTTCGATGATCCACCATTGCCACCATCTCATGCACCCACTTATGTTGCTC
TTTCAGATAGGTTTAAGACTGAAGGTGATCTTGCCGTTCAGATTGGTAGTAAGACACCATGTACCTATGA
GAGAGTTATTTCATTTATGGGTTTCAGATTTGACCTCAACATTCCTGGTTATCACACGTTGTTTTGTACG
CGTGATTTTGCTATGAGACATGTTAGAGGCTGGCTTGGTATGGACGTAGAAGGTGCTCACGTCTGTGGCT
CTAATGTTGGCACTAATGTTCCACTCCAGATTGGTTTTTCAAATGGTGTGGATTTTGTTGTCAACCCAGA
GGGCTGTGTTATGACTAATGTCAATGATGTTATTGCACCTGTTAAAGCACGTGCACCACCTGGTGAGCAG
TTCGCACATCTCATACCTCTTATGCGTCGAGGACAGCCTTGGACTGTCATTCGTAAGCGCATAGTACAGA
TGTGTTGTGATTATGTCAGTCCTTCATCTGACATTCTCATTTTTGTGCTCTGGGCTGGTGGTCTTGAATT
GACTACAATGCGCTATTTTGTTAAGGTTGGACCCCGCTGTGATTGTCACTGCGGTAAGGTTGCTACCTGT
TATAATAGTGCTGAACATGCCTTTTATTGTTTTAGGCATGCTCTTGGTTGTGATTATCTTTACAACCCAT
ACGTCATAGATATTCAGCAGTGGGGTTATACAGGTTCCTTGAGTTCCAATCACCATGAGCATTGTAACGT
TCATCGTAATGAACACGTTGCTTCTGGTGATGCTATAATGACCCGTTGTTTGGCTATTTATGATTGCTTT
GTTAAGAATGTTGATTGGTCTATTACTTACCCTTTTATTGGCAATGAAGCTGCCATTAATAGAAGTGGTC
GTATTGTCCAGTCACATGCTGTCAAAGCTGCACTTAAAGTGTATAATCCAAAGGCTATCCATGATATTGG
AAATCCTAAGGGTATACGTTGTGCTGTTACTGATGCTAGTTGGTACTGTTATGATAAGAATCCTATCAGC
TCTAATGTTAAGACATTGGAGTATGATTACCTTGTACATGGACAATTTGATGGATTGTGCCTGTTTTGGA
ATTGTAACGTTGATATGTACCCTGAATTTTCTGTTGTCTGTAGATTTGATACTCGCTGTAAATCTGCCTT
CAATTTGGAGGGTGTTAACGGTGGTTCACTCTACGTCAACAATCATGCGTTTCACACACCTGCATTTGAT
AAACGTGCATTTGCTAAGCTTAAGGCAATACCGTTTTTCTTTTATGACGATGGTGAATGTGATAGCTGTC
AGGGTTCTATCAATTATGTACCACTACATGCTTCCAATTGTGTTACTAGGTGTAATATTGGCGGTGCTGT
TTGTAGTAAGCATGCCAATATGTATTATGCGTATGTCAATGCGTATAACACTTTTACACAAGCTGGTTTC
ACTATTTGGGTACCCAACAGCTTTGACGTTTATAATTTGTGGCAGACGCTCGTCACACCTAAGTTGCAGA
GTCTTGAAAATGTTGCCTTTAATGTGGTTAAACATGGCTCTTTTATTGGTGTTGATGGTGAACTCCCTGT
TGCTATAGTCGCTGATAAAGTTTTTGTGCGTGAAGGCACTGTTGATAACGTTCTCTTTGTTAATAAGACC
ACTTTACCAACAAATGTGGCATTTGAACTTTACGCAAAACGTAAGACTGGTAACACCCCATCCCTCACTA
TTTTGAGGAATTTGGGTGTTACACGTACTTACAAATTTGTTTTGTGGGACTATGAGGCTGAACGACCTTT
TACTTCATACACTAAGGATGTCTGTGGTTATACAGATTTTGATGCTGATGTCTGTACTTGCTACGACAAT
AGTATTGCCGGTTCTTTTGAACGGTTTTCTATGTGTCGTGACGGTGTTTTGATCTCAACATCGGCTGTTA
AAAAGTTGTCCGCTATTAAGCTTAACTATGGTTATCTTAATGGTGAACCTGTCACTACCTCTGAGGATAA
ACCTATCACATGGTACTTTTATGTACGCAAAGACGGTCAGTTTTTGGATCAGTGTGATAGTATTTTTACT
CAGGGTCGTAGTGCTGAAAACTTTGTACCACGTACTCAGATGGAAACTGATTTCCTTGAGCTGGACATGG
GTCTGTTCATCAGCAAGTATGGTTTGGAAAACTTTGCTTTTGAACACATTGTGTATGGAGATGTCTCTAA
AACCACATTAGGTGGTTTACACTTACTTATTTCTCAGGTTAGGTTGAGTAAGATGGGCATTCTTAAGGTC
GAGGAGTTTGTGCATACTGGTGATAGTTCACTACGTTGCGCATCTGTCACTTACGTTGATAACCCTTCAT
CCAAGATGGTTTGTTCTTATATGGATATTTTGCTTGATGACTTTGTTACATTGCTCAAGACATTGGACTT
GAGTGTTGTTTCCAAGGTTCATGAAGTTATTGTTGACTGTAAAGTTTACCGCTGGATGTTGTGGTGTAAG
GATCATAAGGTTCAAACCTTTTATCCTCAATTGCAATCGGCTGAGTGGAAATGCGGTTATTCTATGCCTT
CGTTGTACAAGATTCAACGCATGTGCCTTGAACCATGTAACCTGTACAATTATGGTGCAAGCATCAAGCT
ACCCGACGGTATCATGTTTAATGTAGTCAAATATACACAACTTTGTCAATATTTGAACAGTACTACCATG
TGTGTACCACATAATATGCGAGTTCTGCACCTTGGTGCTGGATCCGATAAAGGTGTTGCCCCTGGTACTA
CTGTACTTCGTCGTTGGTTACCTGACGATGCAGTAATTGTTGACAACGATGTTAATGACTACGTTAGTGA
TGCTGATATGAGTGTTGTTGGTGATTGTACTACATTGTATCTGCAAGACAAGTTCGATCTTGTCATTTCA
GATATGTATGATGGCAGAATTAAGCATATTGATGGTGAAAACGTTTCTAAAGATGGTTTCTTTGTGTACC
TTAATGGTGTTATAACAGAGAAACTTGCACTTGGAGGCTCTGTCGCTATCAAGATCACTGAACATAGTTG
GAACAAGCGTACCTATGAGCTTATTCAGAAATTTGCTTACTGGACATTGTTCTGTACCAGTGTGAATACT
TCATCTTCTGAAGCTTTTCTCATTGGTGTTAACTATTTAGGTGATTTGAACACCACACCGATTGTTGATG
GCAATGTTATGCATGCCAATTATATCTTTTGGCGTAATTCCACTATTATGGCGATGTCCTACAACAGTGT
CTTAGATCTTTCTAAGTTTGAGTGTAGGCATAAAGCAACGGTGGTTATAGCTTTGAAAGATACTGATTTA
AGTGAAGTTATAGTTGGTCTTATCAGGAATGGTAAGTTGCTTATTAGAAAGAATGGCAGTGTTTGTGGTT
ATGGCAATCATTTGGTTTCAACTAAATGAAATCTTTACTTGTCTTAAGCCTTTTGGCCTTGTTGGCCACA
TTGTCTGTCAATGCGCAGGTTACTGGTGAAGGCGGTGTGGCAGAAGGTAATTATTGGGTTAATGCCTCTT
GTGCTGGTTGGAGCTATTTTTATGCTCTTAAGCTTGGCCTACCACCCAATGCCTCTGCCATAGTCACTGG
TTATTTACCCAAACCTAAGGGTTGGATATGTCCTAGATTTAATGGTGCCGGTATCTATACACGTAATAAT
GCCAATGCTGTTTTTGTTATGTATAGAACCAAAGCCCTTGCCTTTGAGATTGGTGTTAGTTCTTCTGCTG
GTGGTGAGCAGTATAGTGCTTACATGGCTCAGCAGAATGGCAAATACCTTGTGCTTCGTATATGCAAGTG
GCAGAATGGCACTTTGGCTGCCCCCACTTTGCAGTCCACTTCTGGGAAGGATTGTATTGTCAATGTTAAA
GTTGACAATCATATGTTCTATCATGCAGCTCATGATATAGTCGGCATGTCCTGGTCTGGTGACGCTGTAC
GTCTATATACCCAGACTGACACAAAAACTTATTACATCCCTAATTCTTGGGACAGAGTGTCTATTAGGTG
CCCTGATAAGTTCTCGTGTTCCTCACAAATTGTCACTAAGGCTATTACTGTCAATGTCACCACTTTTGCT
AATGGTACCATTGACAAGTATGCCATTTGTGACAATTGTAATGGATATCCGGCTCACATCTTTCCTGTAT
CTGAAGGTGGACTTATTCCAGCTGATTTTAATTTTTCTAACTGGTTCCTGCTTACTAATAGTTCTACTAT
TGTTGATGGCCGCATTGTTTCAGAACAGCCTGTGCTACTTATGTGTCTTTGGGCTGTACCTGGACTGATG
TCAACTAATAGCTTTGTCTATTTCAATGGTACAGCCCCTAATAAGCAATGCAATGGCTATGCTACGGATA
GTGCTTTTGAGGCATTACGGTTTTCCCTTAATTTTACCGATGAAAGAGTCTTTGCTGGCAGCGGCAGTGT
TGTACTACTTGTGTCTGGTTTGCAGTACAAGTTTAGTTGCACTAATAATTCTGAGGCTGTGATCGATTCC
GGAATTCCTTTTGGTAATGTTGTTGAGCCGTTTTATTGTTTTGTCTCTATTAATGGCACTTCTATTTTTG
TTGGCATGCTCCCTGCTGTTTTACGTGAAATTGTTATCACTCGTTATGGCAGTATTTATCTCAATGGTTT
CTCCATTTTTCAAGGCCCACCCATTCAGGGTGTTTTGTTCAATGTAACTAATAGAGGTGCAACTGATCTT
TGGACCGTTGCACTCTCTAACTTTACGGAAGTCCTTGCTGAAGTTCAAAGTACTGCCATTAAAGCTCTGC
TTTATTGTGATGACCCATTGTCTCAGCTTAAGTGTCAACAATTGCAATTTTCGCTGCCTGATGGGTTTTA
TGCAACTGCCTCACTTTTTCAACATGAGTTGCCACGTACTTTTGTCACTTTACCACGCCATTTTACGCAT
TCTTGGATTAACCTGCGTATTAAATGGAAGAATGGTGTTTGTTACAATTGTCCACCTGCTTCTTCTTGGA
TTGATTTTGTAACATTCAATTCTAATGGCACCGAGAATGTTCTTCCTGAACGCACTTTATGCGTTAACAC
CACTCAGTTTACTACCAATTTGACTCTTATTGAGGAGGCTTTTAGTTATTCCACTCCTGTTGTTGTTCGT
GCTGATGATTGTCCTTTTGACTTCCAGTCCTTGAACAATTACCTAACTTTTGGTTCCATTTGTTTTTCTT
TGAATGGCACCATTGGTAAGGGTTGCACACTTGGAATATATAAACGAGCCTCGTCTCAGTACATTCCTAT
TTGGAATGTTTGGGTGGCTTACACTAGTGGTGATAATATCCTCGGTGTCAGAGAGCCCAATGTTGGTGTT
AGAGATCAGAGTGTAGTGCACCAGAATGTTTGTACATCATATACAATTTTTGGGCATTCAGGTCGCGGTA
TTATCAGACCTGCTAATATTTCATATATAGCAGGTGTGTATTATACTGCTGCTTCTGGTCAACTATTGGG
CTTTAAGAATACCACCACTGGTGAAGTGTTTTCTGTTACACCATGTAACCCATCACAGCAGGCTGTTGTT
GTGAAGGATCGTCTTGTTGGTGTTATGTCATCTACTAGCACTGTTTCGATTCCGTTTAATAATACGATTC
CAACTCCTAGTTTTTACTATCATAGTAATGCCACTAGTAGTTGTGATGATCCATCTGTTGTTTATTCATC
TATTGGTATTTGTGATGATGGCGGTATTACTTTTGTTAATAGTACTAGGGTTCGTGGTGAACCAGATCCT
GCTATTTCAATGGGTAATATTTCTGTTCCATCAAATTTCACTGTTTCCATTCAGGTTGAGTACTTGCAGA
TGTCCATTAGGCCTGTTTCGATAGATTGTGCTATGTATGTCTGTAATGGCAATCCTCATTGTACTAGGTT
GTTGCAGCAATATATTTCTGCTTGCCGAACCATTGAGGAGGCCTTACAGCTTAGCGCGCGCCTAGAGAGT
TTTGAAGTTAATAGCATGCTGACTGTTTCTGAAACAGCGTTAGACCTAGTCAACATCAGCACATTTGGTG
GCGATTACAATCTCACTGCTTTGTTGCCGCAAGGTGGTGGTAAACGCAGTGTTATTGAAGATATCTTGTT
TGACAAGGTTGTCACCAGTGGGCTGGGCACTGTTGATGAGGATTACAAGCGTTGTACCAATGGTATTGGT
ATTGCTGATGTCCCATGTGCGCAGTATTATAATGGTATTATGGTACTGCCAGGTGTTGTTGATGAGGAGA
AGATGTCCATCTATACTGCTTCCCTTCTTGGTGGCATGACTATGGGTGGTTTTACACCTGTCGCTGCTTT
GCCTTTTGCTTTGTCGGTACAGTCCCGTCTTAATTATGTTGCACTCCAAACTGATGTTTTGCAGAAAAAT
CAACAGATTTTGGCAAATGCCTTTAATTCTGCAATTGGTAATATCACTGTTGCGTTTGATCAGGTAACAA
CTGCAGTGCAACAAACTTCTGATGCTATTAAAACTGTTGCCAGCGCTCTTAATAAGGTTCAGAGCGTTGT
TAACTCTCAAGGTCAGGCCTTGCATCAACTTACTAAACAGCTTGCTTCCAATTTTCAAGCTATTTCTGCT
TCTATTGAAGATATTTATAATAGGCTTGATGGGCTTGCTGCTGATGCTAATGTTGATCGCTTAATTACAG
GACGCCTTGCTGCTTTGAATGCTTTTGTTACTCAGACTCTTACTAAGTACACAGAAGTTCGTGCTAGCAG
GTTGTTGGCGCAGGAGAAGATTAATGAGTGTGTTAAGTCACAATCCACTCGTTATGGATTTTGTGGAAAT
GGCACTCATTTGTTCTCCATCCCTAATGCTGCACCTGAAGGTATTATGCTGTTTCATACAGTTCTTGTAC
CCACTGAATATGTCTCAGTTACTGCCTGGTCTGGCTATTGTCATAACGGTGTTGGTTATGCCGTGAAAGA
TGTAGGCAATTCGCTGTTTCAGTTTAATAATACATTTTACATCACACCTCGAAATATGTATCAGCCACGT
ACACCTACGTCCGCTGACTTTATTCGTATTTCAGGTTGTAATGTTGTCTATGTCAACATTACTGATGAAC
AGCTGCCACAAGTTCAGCCTGAGTTTATTGATGTCAACAAGACTCTTGAAGAGTTAATGTCCAGGTTGCC
AAACAATACAGGGCCGAACTTGCCTCTTGATATTTTTAACCAGACATATCTTAATATCAGTGCTGAGATT
GATGCTCTTGAAAATAAGTCATTGGAGCTTCAGGCTACTGCTGACAAATTACAGCTAACCATTGAGCAGC
TCAATGCCACTCTCGTTGATCTTGAATGGCTTAATCGCTTTGAACAGTATGTTAAGTGGCCCTGGTGGGT
ATGGCTCACCATGATTATTGCCTTGGTCTTGTTGACTGGGCTTATGTTATGGTGTTGCCTTGCTACTGGA
TGCTGTGGTTGCTGTAGTTGTATGGCTAGTACTCTTGATTTTAGAGGCAGTAGGTTACAACAATACGAAG
TTGAAAAAGTGCACATCCAGTAATGTTTGGTGGCCTTTTCACTTATTCTATTGAATCAGTTCGTACTGCA
GTAAAGGAACTTGATTTGCCACCTGCTAAAGAGCATGATCTCCTTGAACATGTTGTGCCTGTGGCTCATG
CAACTTCTTTTGCTGGTTACCTTCTTACTAGCCTCTTTGTATTGTATTTTGCCTTATTTAAGGCTGTTAC
AATTAGGGGCAATTATGCATGCTTTATTGCACGCATTTTGCTCATTTTGGTGTATTGTCCACTTATTGCT
TATTGTGGCGCTTATTTGGATTCATGCATTATTTTTACTGCATTGCTTGTTAGGTTCTTTTGGACTGGTT
ATTATGCCTGTCGATATAGAACTTTTCTATTTGTCATCTTGAATGACACTACCTTGGCCTTTGTTAATGG
AAAGGCTTGGTATTATTCATCTCAGCCCTATATGGTTTTGCCTGGTGGCGAACATTATGTTCAGCTTGGG
CCTCATTTTATACCATTTGTAGGTGCCAAAGAGCTTTATGTTGCTGTTAGGGGCATGAATGATGAAAATC
TTGAGCTTGTTCGCTGTGTCGAACTTATTAATGGCTCGTTTTTCTACATCTTCGCAAGAGAACCCGTTGT
CGGTGTCGTGAATATGAAATTCACTGAGATACAACTCTACGAAGATGTTAACATTGATTGATGACCACGG
GCTGGTTGTCAACATTTTACTTTGGTTAATAGTGTGTATATGCGTCATTATTATTTGCAGTTCTATTATT
CAGTTTGTGCAGCTGTTGTTTTCTTGTCACAGATTGTGCTCTAATACTGTTTATAGGCCTGTTTATGTTG
CATATCGCGCTTACCAAGATTACATGCGAATAGATCCTCTTCCAGTCATTGATGTCTAAACGAAAATGAT
TTTCCTTATTCTTTTAGGCATTATTTGTGCGTGTTCAGCCAATGGTGACAACACCACGACCGCACCTCCT
ACGGTTCCTCAATCGATCCCTGTTGAACAGGTTGTGGAACATCTCCGAAACTGGAATTTTAGCTGGAATG
TAATACTGACAGTGTTTTTAATTGTGCTGCAGTATGGCAACTTTAAGTATTCTAAGTTGCTTTATGGCCT
CAAAATGGTCATTCTCTGGCTATTATGGCCCCTTGTGCTTGCGCTGTCAATTTTTGACGCATGGGCTAGC
TTCGGGGTTAATTGGACCTTTTTCGCATTCAGCATCGTTATGGCCTGCACTACTTTGATGCTGTGGATAA
TGTATTTTGTCAACAGCTTCAGGCTTTACCGAAGATGTCAATCCTTCTGGGCTTTTAATCCAGAAACTGA
TGCTGTAATTACTCTTTCCGTTTTTGGTAAAATTGTGGCAATTCCTGTCATGACGCCACCAACGGGCATC
ACGTTGACAATTCTTAGTGGAAAACTCCTTGTGGAGGGCATACCGGTTGCTAATGGCGTTTCGGTAACTC
AGTTACCGAGCTACGTCACTGTCGCCAAGGCCACTACCACTATAATATATCAACGTGTTGGTAAATCACT
GAATGCTGCTAGCCAGACAGGCTGGGCTTTTTACGTGAGGGCTAAAAATGGCGACTATTCTGCTGTGTCG
AATCCAAGTGATTCGTATACTGATACAGATAGATTGCTGCATTTAGTATAAACTAAACAAGTGTTGTTGT
ACAACCTCTGTTGTTAACACACTGTAATTATGGCTTCTGTAAGTTTTTCTGATGAGCCCCGTGGCCGTTC
TGGTCGAGTGCCTCTTTCTCTTTTTGCGCCATTACGTACCACCGATGGATCACTATTCTTCCGCGCTATG
CCTCAGAATGGTGTGCCCAAAGGTTTTGGTAACAAAGACCAACAAGTCGGATACTGGAATGAGCAGGTCC
GCTGGCGCATGAAGAGGGGTCAGAGACAAAATCTGCCCTCTAATTGGCACTTTTACTATCACGGCACAGG
CCCACATGCTGATGCTAAATTCAGAGAGAAGATTCAGGGTGTGTTCTGGGTTGCTAAGCAAGGTTCTAAG
GTTGCTCCAACTGACTTGCCAACACGCAAGCGCAACCAGCCTACTATTGAACCCCAGTTTGACTTTGATC
TTCCAAAGAACATTGAAATTGTGACTGCCCCAAGTCAGCCTAATTCTCGCTCTAACTCACGCAGTCAGAG
CAGTGGTGGCAGCAAGTCTCGTGCTAACTCTCAAAGCAGGGATAATTCAGACCAGCAAAAGACGCCTAAA
GGCTCAACTAATAACTCAGGAAGTAATTCACAGGAACGTTCCCAGAAATCCAAGAAGGGCAAGGGCAGCA
CTGATCAAGATGACCTTGTTAATGCTGTACGTCAAGCTCTTATGGGCCTCGGTTTTCAACCGCAGGGAAA
TTCTGGAAAGAATGGTGGTAAGAAATCAGCTCCAAGCAGTGGAAAGTCAACTCCCAAGGACTCGCGCTCA
AAATCGCCAGCGAGACCTCAGTCGACCAAGAAACAGCTTGACAAACCTGAATGGAAACGTGTCCCCAACA
AGTCTGAAAGCGTCACTGCCTGTTTCGGCCCGCGTGATGTTTCCCGTAATTTCGGAACCAAAGGACTTGT
TGCCGAAGGAGTAGAATACTCCCACTTTCCTCAGATTGCTGAACTGCTTCCAACCCAAGCGGCACTTGCA
TTCGGCAGTCGTGTTGAAGTCAAAGACTTTAAGGACGAGGTCGAAATTAAGTTCCACTATAAGATGAATG
TTCCTAAGGAAAACAAGAACCTCCAAGTCTTCCTTGATCAGGTTGATGCTTATTTGGATCCTTCTCGTGA
GGAAAAACCAAAAGAGCAGCGTAAATCCAAGGAAAAGAAGAAGGAAGAAGCACCTGCTCAACTCAACCCT
GCAGCACCTGTGTTTACACCACCAGTTGTGCTGCCAGATGCTGTTGCCAATGTTGAGTTTGACATGGTGG
ATGAGGTTATTGATGCCGATCATGAGTCTTTTGCATGAATTATCAACTAACAAAATGTTTGTTCTTGCTT
TGTTTGCTGTTTTGGCTATTGTTAATTCTGCCCCCATAGTTAATCATAAAGTTCTTAACCCTTATGATAC
TCCTCACAGTGGATTTCGTGGTTCTTGTGAGCAACTTGCTCTCACTTGTAGGCTTAATGTGCAACCTGAT
GCATTTCATGCAGCTGCCACCACTGGGTCCCCTGTTCAGATTCCTCGTGCTTGTGTTTCTTTTCGCACTG
TTTGCAGTGCTTGGCCGAAGTATGACTTTGGTTACCTCATGAGTCCTGATGTTTATGTTGTCACAACGAC
TCCTGATGGTAGGTACAAGTACGAGCTTAATTCTCTTGCCTTTACGCCTGAGGGTGCTCAATTGTTTTAC
ACGCTTGTTGATGGCTATGCCCATGAGCGTCGTAAACTCATTAAGGAAGGACGCCGTGAGGAGCTTCCTA
ATCTTGATGCTGAATACATAATCCACCCTACTGAGTCTCAGTAGTTTGGTGGCAGTCTTATACACTATGG
TAAGCCTGTAATTAAATAGTATAAGCAATGTTTAATTATATTACTAGCCTTAGATGAAAATTAGTTGCCT
ACAGTGCTACCCCTTTCGGAGTAATTGAAAGATCGCTTTGACGAGCCTAATGTGGAAGAGCCGTTTGGAG
TGCCTGTAGTGTTATAATTAGTAATTGTAGATAGGTGTAGTTTTGATAGGGATTCACAAAAAAAAAAAAA
AAA

>gi|169822550|ref|NC_010437.1| Bat coronavirus 1A, complete genome
GACTTAAAGATATAATCCATCTACAGATAGAGTGTACTCTTCTAGACTTTTGTCTACTCCCCTCAACTAA
ACGAAATTTTTGCCATATGTTTATGGCTAATTGAAATTTCAGTCGGTTGTTAACATACTTGCACAAGTGT
CGTGCATGTCGCCAGTCCCTCCTTTCAGTTCCGTCTGTTAGGTATACTAGGTGGCTGCCTTTGGTTCAGT
TCCGTCTGGCCATTGTGTGGATAGTACGTTCCGTCGTGCTTGAAACCGATAACTAGCAGGTATGTCGTCC
AACCTTGTGACATTGGCCTTTGCCAGTGATTCGGAGATTTCTGCAGAGGGTTTCTGTGATGTTAGTTCTG
CCGTCTACGCTTTTAGCGTGTCCGCAGCTAACGGTTTCACAGATTGCCGTTTTGTAGCCCAAGGCTTAGA
ACATTGCCTTGTTGGTATTGAAGCTGATGACTACGTCCTGTGTGTAACAGGCGATGTTCAGCTTAAGGCA
TATATTGCCAAATTCTCGGACCGTCCTCTAAACCTTCGTGGTTGGATCGTCCGTTCTAATTCAAATTACT
TTCTTGAAACCATGGATCTGGTTTTTGGCTGTGGTGGTGGCACTTCAATTCCAGTAGATAACTACATGTG
TGGTGCCAACGGTAAGCCAGTTTTACCAGAAGATATGTGGTGCTTTTGCGACTATTTTGGTGATGATGGA
GATAACATCACTGTAAATGGTCAAGCCTATCATAAGGCATGGAATGTCACTCGTGGTGATGTCCCATACC
AGTTTCAGAATGCTAGCACTATTCTTAGCATTGAGTACCTTGCAGACGAAAAACATGTGCTGCCTGATGG
TGCTGTTGCTAAGTCTGCTAAACCACCTAAGTTCTCTAAGAACATTGTTCTTTCAGAGAAATACAAAGCA
CTTTATGATGCTTGTGGCAATCCATTTGTCACTAATGGCACCAATGTCCTTGAGGTTGTAACCAACCCCA
TTTTTGCGCATGGTTTTGTGCAGTGTAAATGTGGGTCTAAACATTGGACTACTGGTGACTGGGCTGGTTT
CAAATCAGTGTGCTGTGGCATACCAGGACGTGTCTTATGCACAGTCTTTGGTGGTGTTGCACCTGGTTCA
GTTCTTCTGACATCAACTCGTGTTGATGCCAGCCCTGGTGCTACACGCTACTATCATGGTCTTACACTCA
AACACATTTGCAATGTGGATGGTGTTGCATGCTGGCGTGTCACTAAAGTGCAGGGTGTCGAATGTTTTGT
AGCTAGTGGTTCTATTGAGGACTGTGTTGGCTCCACTTTCGATACTTGTACATATGACAATTACACTTCA
TTTGCGAAGGCCTTTAAGTGTGGCATGCTAACTGGCAGCTTTTCTGACAATGTTGTTGCCAGTGTCATTA
ATGGCACACTTGATGTTGGTCTTGCAGTGCTGGATGTAACTACAGCTGTTACCAAGCCATGGTTTGTGCT
GAAGTGTGGTTCACTTCTTGAATCTGCTTGGGATGCACTCATAATGGCCATTAAACAGTTACCTGTTATG
GCTAGTGATGTGCTGAAGTTCTTTAACAACCTCACTCAAGTGCTGATTGTTGTTAGAAATGGTGTCATTG
ACATCATTCATTCTGTGCCAGAGGCTTTTAAGAGCGCCTTTGAGATCTTTAAAGACCTTGTTACAGGTGT
GTTTGATCTTGTTGTTGATCACTTTAAGATCGCCAACAAAAAATTCAAGCGTGCTGGTGATTACATCCTT
TTTGAAAACGCACTCGCTTGTCTTGTCAGTGGTAAGATTAAGGGTGTTAAACAAGCAGGTCTTAAAAAGC
TTCTGTATGCTAAGGCTATTGTTGGTGCTACGGTTAAAGTTACTGTTAATCGTATTGAAAGTGCAACTGT
CAAACTCGTTGAGTGTAAGCCATCTAACTTTGTTAAGAAAGGCAGTGCTGTTGTTATTAACAACATTGCA
TTTTTCCACAGTGATGGTGTTTACAGACTGATGAGTGACAGTGATGAGGTCTATGAAGACATTGCTTTTA
CTGCTGAAAGTGTGTCCACAGTTAAGAAACCAGTCTTTGATTGTACCAAACCAGTTGACTTTCCTGACAT
CAGTAGTACTGATGTTGAAGTACTGGTTCGCGAGGTCAGAGCTACTCTTGGTAAATTCTCCAGAGTCTAC
GACAAGTATAACTGTGTTGTCAAAGATGGAAAATGTGTTGTCACACATAGGTATGTCTTCAATGCACCTA
GCTTTGTTGAAGACAAGGCTATATTTGTTGACCTCTGTAAGGATTATGTCGCAGATGTTGGCTTTGAGGC
ATTTTATGCTAATGCCATTGTTGCCAATAACTCTGATGAGTTTAATCCAGTTTACTCAGCTTTTGAGGTT
TTCAAAACCAAAGTTGAGTGCCCTGAAGAATTTATGAATATTGATGGCGGTTCTATTTTTGGAACTTTCA
TCAATACAGTTAATGATGCTGTGAACTTTGTCAAATCGTTGAAGATAACGGTAACAGCTACTGAAGTCAT
GATCAACACTGTTAAGCGTTTCAAACGCTTTGCCAGTGCCCTTGCTAAGCTATATAGTGAGTTCATGAAC
ACTGTCAAGAATATCATTTCTATCGGCAGTATCAAATGTTACCACTATGGCTTTGTGAAACCTGTTCTAG
TGATCAAAGATATCTTTTACCGCATCTATGATGCTGCTGTAGACACATTCAATGTCGCTGTTGAAGCAGG
TCTAAACACAGTTAAGACTTTCAGTGGTGGTGAAAATCCTATCACTTTCTCACGTGTTGAAGTTGCTAGT
GTCGAGCTTGAACATGCTGAATATGTCAAGCCCGAAGCTAATGGTCATGTCAGTGTTATCAATGGACACA
CATTCTATACATGTGGTGACTATTACTACCCTTGTGACCAGAATAATTGCTTCTCACAGTGCTTTAAGAA
GGTTGGTGGATCTGCTGTTACATTTTCTGAAAAAGTTGCTGTCAAACAAATTGACCCTGTTTACAAAGTA
AAGCTCGTCTTCGAGTTTGAAGATGACACTATCAGTAGTGTTTGTAAGCAGGCAATTGGTAAATACATCT
CTTTTGAAGGCAATGACTGGTCCAGCTTTGAGGAAACTATTCATAACGCTATGAATGTTGTTGGTGAATT
CGTAGACCTACCTGATTACTTCATCTATGATGAAGAAGGTGGTCATGACTTAACTAACACTGTTATGATT
TCTCAATGGCCAGTGTTTGATCCATCAGCACTACAACTTTTAGTTGCTGACTTGGGTGTCAACTGTGATT
TCAATGGTAAGTCTTCCATTGAAGAATGCTTGACTTCTGTCTCTGACACTGTTCTTTGCGTGTCATTGGA
AAAGTCATGTGACTGTGGCACCTTCAATGCTATAATGGAAGGGTTTGCACTTGATTTCAAACCATGCACT
GATAGTGATGTCTGTGATAACTGTGGTGGTTTTTGTACTACTACTGTTTTGAGCATGACTGGTACTGGTT
TTGTGCGTTCTTGTGATGAACCATTAATGCCTTTCAATGTTACATTTGAAGGTTATGGTGTTTACAAGAA
CGTTTGTTTTGTTAATGACACAGTGTTACCTCCTCCTTTTGATGAAGAGATCACACCTATTGAGGAAGAC
CTAGTAGTAGAAGATGTCATCACAGCTGATGAAGTTGTTGATGTTGAAACTACTGCACAAGTAGAAGAAG
TGACTGTTGTTTCAGCTATCGAAGAGGACATTATCAAACCTGAAGAGGTTATTGATGTCTCTTCTGACAT
TGAAGCTGTTAATCATGCACTTTCCTTCATGAAACCTACAGAAACGAAGTTTGTAGACCCATTCAAGTTT
GATTATTATGATCATGAGGGCATTCGTGTACTCAGACAGAATAATAACAATTGTTGGGTCGCTTCTACTT
TGGTACAATTGCAACTTTCATGCTTGTTGGATGATGATGACACTATGGCTCTTTTTAAGGCTGGTAGTGT
GTCACCATTAGTTCGCAAGTGCTATGATGCAGTTGGAGCTATTGTGGGTAGTCTAGGTGATGCATCTCAT
TGTTTAGAAGTTCTTTTAAAAGACCTGCATACCATGTTTATCACTTGTGATGCCACTTGTGGTTGTGGTA
GCAGTAATTATGAACTTACTGGTTCTGTTTTTAGATTTATGCCTACCAGAGATAGTTTTAGTTATGGTGC
TTGTGGTGTTTGTGGTAAAACACTCAAGCTTAAGATTAGAACTATGACTGGTACTGGCTTCTTTTGTCAG
GACCCAAAACCTTTTAATACTGCACGTGCTATTGTAAAGCCAGTTTGTGCTAGTATTTATCAGGGTTCTA
CTACTAGTGGACACTATAAAACCAATGTCTTTGGCAAAAGATTTTGCGTTGATGGTTCTGGTGTTAGCAG
CATTTCTAATGGCCATATTAACACGATTCTTTTGAAGGATTGTAACTATGGCATTTCTGCTATTGCTGAA
CCTAAGCAAGAAAAAGTTGAGCAATTTGTCACACCTGAAGATGTTGGACAAGTTGTCAAACAAAAACCTA
AGCCTTTCACTATTTATCGCAATATTGAATTCTACCAAGGCGATGTTTCTGAATTAGTTGGTCTTGACTT
TGACTTTATTGTCAATGCAGCCAATGAGAATCTTAAGCATGCTGGTGGAGTTGCAGCTGCGATCGACAAG
CTTACTGGCAATGAATTGCAGAGTTTGTCAAATAAGTATGTAAAGACAAATGGTAAAGTCAAAGTTGGTT
CTAGTGCCATGATACGTTGTAAGAAATACAGCGTACTTAATGTTGTAGGACCTAGAAAAGGTAAACATGC
ACCTGATCTTTTGGAAAAGTGTTATAGAACCATTCTTAAAGAGCAAGGTGTTCCTCTCACGCCTCTTATT
AGTGTTGGTATATTTGGTATACCTCTTGCAACATCTTTCAATGCTCTATTGAACACGTCCAGTGGTAGAA
CGGTTAGATGCTTTTGCTACACTGATAAAGAGTGTAATGAGATTAAAACACTTGTTGCTTCGCTTAATGA
AGAACAAGTTGCAGCTACTGTTGAAGAAACAGTTGTAGCTGAAGAAAAGCCTATTGCTGACTTAGAAACA
GCTGTTGAAAGACCTGCTGAAGAAAAGTCAGTTGAAGCTGAGAAAATAGCTACCGAGGAGGTTAAAGAAC
CTTTGGTAGCCGAGAAAGTCATTGTTGAGGTAAATGAACCTGTTTTAAAGGTTGCTGGTGTGTCTTATTA
TAATATTGAAGACAGTTTTGCTGTTGGTGCTGACAATATTGTCATTCTTACTAACAGTAAATTAGAATTA
GGCAAAATTGGTGAATGTATTGATAAGCATTCTGATGGTGCCTTGAAACTAGCTGTCTCTGAATATTTAA
GTCAGACACCTAATGTACCTCCTGGCAATGTAATCTCAATGCGTTGTAGTGGTTTAGCCACAGTTGTGTT
TGCAGTAGTTCCTAGCGATGGCGATGTCCAATATGTCAGAAATGTCAAGCGTACTATTTCCAAACTGTCA
AAACTTAAGGGTTCTTCAGTTTGTTCTTTTAGTACACTTGACATGCACAAGCGTTTGTTGAACTTGTTTA
ACAAATTCTGTGTAGACAATATTGATGACATCAAAGACATTCACGACACAAAGACTACTATTAAAGTTAG
TCTTGATGGTCGTAATGTTGTTGATGTTGATGTCGCAGCAGACCAGACTATTGGTGAACAACTCAATGCA
TGTACTACTGATAATGTTATTATTTCAGACAGTGTTGTAACTGATGTTATTGACACTATTGTTAATGTTG
CCCCAGAAGTTGATTGGGATTCTTTTTATGGTTTCCCACATGCAGCTGAATTTCATATGCTTGACCATAG
TGCTTTTGCATTTGACAATGATGTCGTTGATGGCAAACGTGCACTAGTTGGAACTGACAATAATTGCTGG
ATAAACGCTGTTTGTTTACAATTGCAATTTGCTGAAGTAGATTTTACTTCAGAAGGTCTTAAAGACATGT
GGAATGAATTCCTGGTTGGCAATGTCGCTAAATTCTGTCACTGGATATATTGGCTTGTCAGAGCTAATAA
AGGTGATGCAGGTGATGCTGAAAATGCTTTGAATATGCTTAATAAGTATGTCAAGGCACACGGCACTGTC
ACATTGACACGTGAAACTGCTGAAGGTTGTTGTGTTAATGAACATCGCATTAATAGCTTTGTTGTCAATG
CTAGTGTTTTAAGGAGTGGTTGTAATGACGGCTATTGTAAGCATGGTAATGCTTATATAGCACGAGTCTC
TAAGGTTGATGGTGTGTCAGTTATTGTTAATGTGGACAGACCTAGTGTCATGTCTGACAATTTACTTTTA
TCTGGCACTTCTTACACAGCCTTTTCAGGACCTATGGATTCTGGTCATTACCGCGTTTTTAATCCAGCTA
CATCTAAGATGTTTGATGGTGCTAATTGCATTGGTGGTGACCTTTGTAATCTTGCCGTTACAGCTGTTGT
AATTAAAAACAAAGTTTTTAAAATTCAAACAGCAGATAACAACACTCCTGTAAAAATCATTAAAAAGCTT
GATGATGCTTCAGAAAAGTTTTTCAGTTTTGGTGATATTGTCTCCAAGAATGTTTGCAACTCGATAATAT
GGTTTTTCACTATGTTAAGTATCATCTTTAGAGCTTTTAAAACCAGAGACTTTAAGGTATTTGCTCTTGC
ACCAGAACGCACAGGTGTCATACTTAGTAGAAGCTTAAAATATAACTTGAAGGCTGCTCAACATGTGTTG
CGTCGTAAACAGACGTATGTTGAGAGATTCTTTAAGTTTAGTGTAATAGCTTACACTTTATATGCACTAA
GTTTCATGTTTGTGCGCTTTAGTCCTGCTAATGATTACTTTTGTAAAGATCATGTCGAAGGTTACAGTAA
TTCCACTTTTGTGAAAGATGAGTACTGTGCTTCCACTATGTGTAAGGTATGCTTATTAGGGTTTCAGGAG
CTTGCTGACTTGCCACACACTAAAGTTGTTTGGAAATATGTTGGCTTTCCAATTTTTGTCAATTGGTTAC
CGTTCTTGTACCTTGCATTCCTATTCACATTTGGTGGCATCTTTGTTAAAGGTCTTGTATGTTACTTCTT
TGCTCAATATGTCAACACACTTGGTGTTTACTTTGGTATGCAAGAGAAGTTTTGGCCTTTACAGATCATT
CCTTTTGACATTTTTGGTGATGAGATTGTTGTCACATTTATTGTGTACAAAGCTCTTATGTTTATCAAGC
ACGTTTGTTTTGGTTGTGAAAAACCATCATGTGTAGCTTGTAGTAAGAGTGCTCGTCTCAACAGAGTTCC
TATGCAGACTATTGTTAATGGTGCTAATAAGTTATTTTATGTTGTTGCTAATGGTGGTTCTTCATATTGT
CATAAGCACAAGTTCTTTTGCTTGAACTGCGACTCTTATGGACCTGGCAACACTTTTATTAATGAGACTG
TGGCACGTGAGCTTTCCAATGTTGTTAAAACTAACGTACAACCTACAGGTGAATCTTTTATCGAAGTCGA
TAAAGTATCATTTGAAAATGGTTCCTACTATTTATATAGTGGTGAAACTTTTTGGCGCTATAACTTTGAT
GTTACAGAGGCTAAATACGGTTGTAAAGAAGTCCTCAAAAATTGTAATGTTTTGTCTGACTTCATTGTTT
ATAACAACACTGGTACAAACGTTTCTCAAATAAGAAATGCGTGTGTGTACTTTTCTCAGATGCTTTGCAA
ACCAATTAAGCTTGTTGATGCTACATTGCTTTCTACTTTGAATGTAGATTTTAATGGTGCCTTACATAGT
GCATTCGTTCAGGTTCTTAATGATAGTTTCTCTAAGGATCTTTCTAGCTGTGCTAGTATGACCGAATGTA
AACAAGCTTTAGGTTTTGATGTCTCGGATGAGGAATTTGTCGATGCTGTTAGTAATGCACATAGATTTAA
TGTGTTGCTTTCTGACAATTCTTTTAACAACCTGTTGACATCTTATGCAAAACCTGAAGAACAGTTGTCT
ACGCATGATGTGGCTACTTGTATGCGTTTTAATGCAAAAGTGGTCAATCATAATGTTCTTATTAAAGAAA
ACGTTCCTATTGTGTGGCTTGCGCGTGACTTTCAACAGCTTTCTGAAGAAGGACGTAAGTACCTTGTTAA
AACTACTAAGGCCAAGGGTGTTACATTCTTATTGACATTTAATACAAATGCTATGAATGTTAAACTACCT
GCTATTAGTATTGTTAACAAGAAGGGTGCTGGTGTTAGTAGTTCATTTCTATGGTGGTTATGTGCTGCTA
TCATTACTTTCTTTTTCTGTGTTGGCATTAGTGAAGGTCTAATTGCTACCAGTCTTGAAGGTTTTGGTTT
CAAGTATATTAAAGATGGTGTTATGCATGACTTTGACAAACCTTTGAGTTGTGTACATAATGTCTTTGAT
AATTTCAATAGTTGGCATGAGGCCCGTTTTGGTAGTATTCCATCTAACAGCCTTAAATGTCCTATTGTTG
TTGGCACCCTTGATGACGTACGTAATGTACCTGGTGTGCCTTCTGGTATATTGTTAGTTGGCAAGACACT
AGTTTTTGCTATCAAAGCAGTCTTTACTGATGCTGGCAATTGTTATGGTCTTAATGGACTAACTAATGCT
GGTGCTTGCCTTTTCAACTCAGCATGCACAAAACTCGAAGGCCTTGGTGGTACTCATGTTTATTGCTACA
AAGACGGTTTGTTTGAGGGTTCCAAACGTTATTCTGATTTGGTTCCTCATTCTAACTATAAAATGGAGGA
TGGTAATTTTGTTAAATTGCCTGAAACTCTTGTTAATGGCTTTGGTATAAACATCATTCGCACAATGGAA
ACTACCTATTGTCGCGTTGGTGAGTGCTTGAAATCTAAGGCTGGTGTATGCTTTGGTGCTAATAGGTTCT
TTGTTTACAATGATGACTTTGGTTCCGATTACATTTGTGGTAATGGACTGTTTTCTTTTGTTAAGAACCT
GTTTAACACTTTCACAATGTCAGTGTCTGTCATGGCACTTTCAGGACAGGTCATTTTTAATTGCGCTGTT
GCAGCTTTGGCAATATTTATTTGCTTTTTAGTTGTAAAATTTAAGCGCATGTTTGGTGACCTGTCTTATG
GTGTTTGTAGTGTCATTGCTGCTGTAACTATCAATAACTTGTCTTATGTGTTTACACAAAACATGTTATT
CATGTTTGTGTATGCAACATTCTACTTTTTGGCTGTCAGAAATCTTAATTATGCATGGATTTGGCATGCT
AGTTATGTCGTTGCTTATTTCAACTTGGCGCCATGGTTTATTATCGTATGGTATGTTGTTGCAATGCTTA
CTGGTCTTTTGCCATCTGTCTTAAAACTTAAAATTTCTACCAATTTGTTTGAAGGTGACAAGTTTGTTGG
TACATTTGAAAATGCAGCTTTTGGCACTTTTGTTATAGACATGCATTCGTATGAAAAACTTGTTAATAGT
ATTACACCTGATAAGCTTAAACAACACGCCGCTATGTTTAATAAGTATAAATATTATAGTGGTAGTGCTT
CTGAGGCTGATTATAGATGCGCTTGTTTTGCACATCTAGCTAAGGCTATGACAGATTATGCATCAAGTCA
TCAAGACATGTTGTATTCACCTCCTAGCATTAGTTATAATTCAACTCTTCAAGCTGGTCTGCGTAAATTT
GCGCAGCCTTCAGGTGTTATTGAACATTGCATTGTGCGCGTTAGCTATGGTAACATGGTTCTTAATGGTC
TTTGGCTTGGTGATGAGGTTATTTGTCCTAGACATGTGATAGCCTCGTCTATCAATTCTGCCATTGATTA
TGACCATGAATACACTATGATGCGTTTACATAATTTCTCCGTGTCATCTGGTAATCTTTTTATTGGCGTA
GTTAGTGCTAAAATGAGAGGTGCTTCTTTGGTTATTAAAGTTAACCAGAACAACCCTCATACGCCTAAAC
ACGTCTTTAAAACGTTAAGAGCTGGTGATGCCTTCAATATATTGGCTTGTTATGATGGAGTACCCTCTGG
TGTTTATGGTACCATCCTTAGACATAACAAAACTATTCGCGGTTCATTTATTAATGGCGCGTGTGGTTCA
CCTGGTTTTAACATTAATGGTGATACAGTTGAATTTGTTTACTTGCATCAGCTGGAACTTGGTAGTGGTT
GCCATGTAGGGTCTAATATGGAAGGTGTTATGTACGGTGGTTTTGATGATCAGCCATCTCTTCAGATTGA
AGGTGCTGATTGTTTGGTGACCGTCAATGTCATAGCATTTCTATATGGTGCCATACTTAATGGTTGCACA
TGGTTCCTTTCTAATGAACGTGTTAGTGCTGAAGTTTTTAATGGTTGGGCACATGATAATAATTTTACTG
ATGTTGGCAGTTTTGACTGTTTCAACATCTTGGCTGCTAAGACTGGTGTTGATGTTCAACGTATTCTTGC
TTCTATTCAAAAACTAGCTAAAGGCTTTGGTGGTCGTAACATCATTGGATATGCATCACTCACTGATGAA
TTTACTGTCAGTGAGGTTGTTAAACAAATGTACGGCGTAAGTCTCCAGAGCAAACGTGTGCCTAGCATCT
TTAATAATGTCACACTTGTTAGTGTGTTTTGGTCTATGTTTTTGTCAGAGCTTTTGTATTACACATCTAG
CTATTGGATAAAACCAGACCTAATCACTGCTGTGTTTGTCTTGTTGTTTGGAATTGCTGTCATGCTCACA
CTTACTATTAAGCATAAAGTGTTGTTCTTGTACACATTCCTTATTCCAAGTGTTGTGATATCTGCTTGCT
ACAATTTGGCTTGGGATCTTTACATTCGTGAGCTTCTTGCCAAGTATTTTGACTACCATATGTCTATTTT
TAGTATGGACATTCAAGGTTGTTTCAATATTGTTGCTTGTATTCTCGTTAATGCGATTCACACATGGAGA
TTTGTCAAGACAGGTACTGCTACAAGATTGACATATGTGTTGTCACTGGTTGTGTCAGTTTATAATTACT
GGTGTTGCGGTGACTTCTTGTCTCTTTCAATGATGGTCCTACTTAATATCAATAATAATTGGTATATTGG
TGCGATTGCTTACAGATTTTCTGTTGTTGTCGTTAACTATATGGATCCATCTGTTATAAGAATGCTTGGC
GGTGTGAAAGTCATACTTTTCATGTATGTTACTTGTGGTTATTTATGCTGTATGTATTATGGCATATGCT
ACTGGTTTAACCGCTTCTTTAAGTGCACAATGGGACTTTATGAATTTAAAGTTAGTCCCGCTGAATTTAA
GTACATGGTTGCTAATGATCTTCGTGCTCCTACAGGTGTTTTTGATTCAATGTCACTTAGTCTGAAGCTT
ATGGGTCTGGGCGGTGAGAGAACTATTAAGATCTCCACTGTACAGTCTAAATTGACCGATATTAAATGTA
CTAATGTTGTACTCATGGGCTGTCTCTCTAGTATGAACATTGAAGCTAATTCTAAAAAGTGGTCATATTG
TGTTGATCTTCATAATAAGATTAACCTGTGTGATGATGCTGAGAAAGCTATGGAATATTTGCTTGCACTT
GTGACATTTTTCATAAGTGAACATGCTGATTTTAATGTTTCAGAGCTTGTAGATTCATATTTTGGTGATA
ATAGCATACTTCAAAGTGTTGCTTCTACATTTGTTAATATGCCTTCGTTTATAGCTTACGAGAGTGCTCG
TCAAAGTTATGAAGAGGCTATTAATAATGGATCATCACCTCAGCTCGTCAAACAACTTAAGCGTGCTATG
AACATAGCCAAAGCTGAGCTTGATCACGAGTCATCTGTTCAACGTAAGCTTAATCGCATGGCCGAACAAG
CTGCTGCACAGATGTACAAGGAAGCTAGAGCTGTTAACAAGAAGTCAAAAGTCATAAGTTCACTGCACAC
ACTTCTGTTTGGAATGTTGCGTAAACTTGACATGTCTTCTGTAGATAACATACTAAGCCTTGCTCGTGAT
GGAGTTGTACCACTTTCTATTATACCTGCAGCATGTGCTACAAAACTTACCATAGTTGTGAGTGATTTTG
AGTCATTCAAGCGCATCTTTCAACTAGGTAATGTTCAGTATGCAGGTGTGGTTTGGAGTCTTACCGAAGT
TAAAGATAACGATGGAAAACCTGTTCACATAAAAGAAATTACTGCAAATAATACTGCTTTGACATGGCCT
TTAATCCTTAATTGTGAGAGGATTGTTAAGCTTCAGAATAATGAGGTTATTCCTGGTAAGCTTAAGGTAC
GTCCACTTAAGGGTGAAGGTGAAGGTGGTTTTACTGCTGATGGAAAAGCATTATTTAATAATGAAGGTGG
CAAAACTTTCATGTATGCTTTCATTGCAGATAAACCAGACCTTAAAGTAGTCAAGTGGGAATTCGATGGT
GGTTGTAATGTCATTGAACTTGAACCTCCTTGTCGATTTGCAGTTGTTGATGCAGGTGGTAATAATGTTG
TTAAATACCTGTACTTTGTTAAAAATCTCAATACCTTGCGGCGTGGTGCTGTGCTCGGTTTTATTGGAGC
TACAGTTCGCCTTCAGGCTGGCAAACAAACAGAGCTTGTTGTTAACTCTTCTTTGTTGACGTTATGCTCT
TTTGCTGTTGATCCTGCAAAATGTTATTTGGACGCTGTTAAAAGTGGTGTTAAACCTGTTAACAATTGTG
TTAAAATGCTTTCTAATGGTTCTGGTACTGGTCAAGCTGTTACCGTAGGTGTCGAAGCCAATACTAATCA
GGATAGTTATGGTGGTGCTTCTGTTTGTTTATATTGCAGAGCTCATGTTGACCATCCTAGTATTGATGGA
TTCTGTCAATTTAAAGGCAGATATGTCCAAATACCCGTAGGTACTGTTGACCCTATACGGTTTTGTCTTG
AAAATCAAGTTTGCAAAGTGTGTCATTGTTGGTTGAATAATGGCTGTTCTTGTGGTAGAACGTCAGTTAT
CCAATCTGTTGATCAGGCTTATTTAAACGAGCAAGGGGCTCTAGTGCAGCTCGACTAGAGCCCTGTAATG
GTACTGAACCGGAGCATGTTGTACGCGCCTTTGATATTTACAATAAAGAAGTTGCCAGCATAGGCAAGTT
TGTTAAGGTGAATTGTGTTCGCTTTAAAAATCTTGACAAGCATGATGCTTTCTTTATTGTAAAACGCTGC
ACTAAGAGTGTTATGGAACACGAGCAGTCCATATATGACATTCTTAAATATAGTGGCGCTTTAGCTATTC
ATGACTTCTTCCTTTGGAAAGATGGTCGTGCTATCTATGGTAATATTTGCAGACAAGATTTAACTAAGTA
CACTATGATGGATCTCGTTAATGCTCTTCGTAATTTCGATGAAAAGAATTGCGAGGTTCTTAAAGAGATC
CTTATTCTAACTGGTGCTTGTGATTCTAGTTATTTCGATAACAAATCATGGTATGATCCAGTTGAGAATG
AGGATATACATAGAGTGTATGCTAAGTTAGGTGACGTTATTGCTAATGCAATGCTTAAATGTGTAGCGCT
TTGTGACGCTATGACTGAAAAAGGCATTGTAGGAGTCATTACGTTGGACAACCAAGATCTTAATGGTAAC
TTCTATGATTTTGGTGATTTTGTCACTAGTATTCCTGGTGTTGGTGTTCCCGTTTGCACTTCATATTACT
CTTATATGATGCCTGCTATGGGTATGGCTAATTGTTTGGCTCGTGAGTGCTTTATCAAAAGTGATATATT
TGGTTCTGATTTCAAGACATTTGATCTCTTGGAATATGACTTTACAGAACACAAGTTGAAACTTTTTGAT
AAGTACTTTAAATATTGGGGTCAAGATTATCACCCAGATTGTGCAGACTGTTATGATGAGATGTGTATTG
TCCATTGTGCTAATTTTAACACTCTGTTTGCCACAACAATTCCAAACACTGCTTTTGGTCCATTGTGTAG
AAAAGTGTTTATTGACGGTGTTCCTGTTGTTACTACTGCTGGTTATCATTTTAAACAGCTTGGTCTTGTA
TGGAACAAGGACATTAATACACATTCTACGAAGTTAAGCATTAATGAGTTATTGAGGTTTGTTTCAGATC
CTGCTCTGCTTGTTGCTTCATCACCAGCTTTGGTTGACCAGCGTACTGTATGCTTTTCTGTAGCTGCGTT
AGGTACTGGTGTTACAAAGCAAACACTTAAGCCAGGCCACTTTAATAAAGAATTTTATGACTTTTTACGT
GAGCACGGCTTCTTTGATGAGGGTTCAGAACTTACACTTAAACACTTCTTCTTTGCACAAAAAGGTGATG
CAGCTATTAGAGACTTTGACTTTTATCGTTATAACAGACCTACTGTTTTAGATATTTGTCAGGCTCGAGT
TGCTTATCATGTTGTTAAAAAGTATTTTGAAATCTATGAAGGTGGTTGTATTGCTGCACGAGATGTAGTT
GTTACAAACCTTAATAAGAGTGCTGGTTACCCTCTTAACAAATTTGGCAAAGCTGGTTTATACTATGAGG
CACTTTCCTATGAGGAGCAAGACGCTTTATATGCAGTTACCAAGCGTAATATCCTTCCGACAATGACACA
ACTTAATCTTAAGTATGCCATTAGCGGTAAAGAACGTGCACGCACAGTTGGTGGTGTATCACTTTTGTCC
ACTATGACGACTCGTCAGTTTCACCAAAAACATTTAAAGTCCATTGTCAACACTCGTAATGCTACTGTTG
TCATTGGGACTACTAAGTTTTATGGTGGATGGGACAATATGCTTAGAAATCTAATTGATGGTGTTGACAA
TGCGTGTCTTATGGGCTGGGACTATCCTAAATGTGATAGAGCTTTGCCTAATATGATTCGTATGATATCC
GCCATGATTTTGGGTTCTAAACATGAAAATTGTTGTACTAACTCTGACCGTTATTATAGACTATGTAATG
AGTTGGCACAAGTGCTAACTGAGGTGGTCTATTCTAACGGCGGTTTTTATTTGAAACCAGGTGGTACGAC
ATCGGGTGATGCAACGACAGCTTATGCCAATTCTGTTTTTAACATCTTCCAAGCAGTCAGTGCTAACATT
AATCGCATTTTGGGCGTTAATAGCAATACTTGCAACAATTTGACAGTTAAAGAGTTGCAACGCTCATTGT
ATGACAATTGTTATCGCACTAGTACTGTTGACCCTGCCTTTGTAGACACGTTTTATGGTTACCTACGCAA
ACATTTCTCTATGATGATTCTATCAGACGATGGTGTTGTTTGCTATAACAAGGAGTATGCATCTCTTGGC
TATGTTGCAGATATTGGTGCATTCAAAGCTACACTTTATTATCAAAACAATGTATTCATGAGTACTGCTA
AGTGCTGGGTTGAAGAAGACTTAAGTAAAGGCCCTCATGAATTTTGTTCTCAACATACATTGCAGATTGT
TGATGGTGATGGCACTTACTATTTGCCTTACCCTGATCCTTCTAGGATTTTGTCTGCAGGTGTTTTTGTT
GATGATGTTGTTAAAACTGATGCTGTGATACTTCTTGAACGTTATGTTTCTTTGGCAATTGATGCTTATC
CATTGTCCAAGCATCCTAATCCTGAATATAGAAAAGTGTTCTATGTTCTTTTAGATTGGGTTAAACACTT
AAATAACACCTTGAATGAAGGTGTTTTAGAATCTTTCTCAGTTACTTTGCTTGAAGATTCCAGTTCAAAG
TTCTGGGATGAAGGATTCTATGCTAGTTTATATGAAAAGAGTTCTGTCTTGCAGGCTTCTGGGTTATGCG
TTGTTTGCGGTTCTCAAACCGTTTTGCGCTGTGGTGATTGCTTACGTAGGCCTATGTTATGCACTAAGTG
TGCATATGACCACGTTGTTTCAACACCACACAAGTTCATTTTGTCAATTACACCTTATATGTGTAATACA
TCTGGGTGTACTGTTAATGACGTCACTAAGTTATATTTGGGTGGCCTTAGCTACTATTGCATTGATCATA
AACCAACTTTAGCTTTTCCATTGTGTTCAAATGGCAACATTTTTGGCCTTTACAAAAATTCAGCCACTGG
TTCACCTGACGTTGAAGTTTTTAATACTTTGGCTACGTCTGAATGGAATGATGCTAAGGATTATAGGCTT
GCTAATGAGGTTAAAGACTCACTTAGGTTGTTTGCTGCTGAAACTGTTAAAGCTCGTGAAGAGAGTGTTA
AGTCTTCTTATGCAGCTGCTACTTTGAAAGAAGTTATTGGACCTCGTGAATCGCTTCTCAGTTGGGAAGT
TGGTAAAGTAAAGCCTCCTCTCAATAGAAACTCTGTTTTTACCTGTTACCAGATCACTAAAGACTCTAAG
TTTCAGGTGGGAGAGTACACCTTTGAGAAGTTGGATTATGACAATGATACTGTTAGTTATAGGTCATCTA
CAACTTACAAATTGGCTCCAGGGATGATTTTTGTGCTTACATCGCACAATGTTCCGCCATTAAGAGCGCC
TACCATTGCAAATCAGGAACGTTATGCATCCATTTATAAGTTGCGTCCTGTTTTTAATATTAGTGATGAT
TATGCCAACTTAATTCCATATTACCAAATGATTGGAAAGCAGATGATTACAACTATTCAGGGACCTCCTG
GTAGTGGTAAATCTCATTGTGTCATTGGTCTTGGATTGTATTATCCCAACGCACGTATTGTCTTTACAGC
TTGTTCTCATGCAGCTGTGGACTCTTTATGTGTGAAAGCTAGTAAAAATTATGTTGTGGATCATTGCTCC
CGTATAATACCAGCACGTGCTCGTGTTGAGTGTTATAGTGGTTTCAAAGCTAACAACAACAGTGCACAAT
ATATATTTTCTACTGTCAATGCATTGCCTGAGTGTAATGCTGACATAGTAGTGGTGGATGAAGTGTCCAT
GTGTACTAATTATGATTTGTCTGTTATAAACCAAAGGGTTTCATACAGACATATTGTATATGTTGGTGAT
CCACAGCAGCTGCCTGCTCCTAGAACTATGATAACACGAGGTGTACTTGAACCTAAGGATTACAATGTAG
TCACACAGCGTATGTGTGCAGTAGGTCCTGATGTGTTCTTGCATAAATGTTATCGTTGTCCTGCGGAAAT
CGTGAACACAGTCTCAGAGCTTGTTTATGAAAATAAGTTTAAGCCTGTTCATGATGATAGTAAGCAGTGT
TTCAAGATCTATTGTAAGGGTTCCGTTCAGATTGATAACGGGTCGAGCATTAACCGTCGTCAACTGGAGG
TGGTGAAGATGTTCTTAGCCAAGAATCCTCGTTGGTCTAAGGCTGTATTCATTACCCCTTATAATAGCCA
GAATTATGTTGCTAGCCGTGTTCTCGGTTTGCAAATTCAGACTGTTGATTCTTCACAAGGTAGTGAGTAT
GATTATGTCATTTATACACAAACTTCTGATACTGCTCATGCTTGCAACATTAATAGGTTTAATGTTGCTA
TTACTAGAGCTAAGAAGGGCATCTTTTGTGTCATGTGTGATAAAGCGCTTTATGACTCACTCAAATTCTT
TGAGATTCAGTTAACTGATTTGCAATCTGGTGATTTATGTGGCCTTTTTAAGGATTGTAGTCGTGTTGAA
GAACCACTACCACCAGCTTATGCTCCTACATATGTTTCATTGTCAGATCGTTTTAAAACATCTGGCGAAT
TAGCTGTCAATGTAGGTGCTAAAGGACCTTGTACTTATGAGCACGTTATTTCTTACATGGGTTTTAGATT
TGATCTAAATGTTCCTGGTTATCATACCTTGTTCTGCACTCGTGACTTTGCAATGCGCAATGTTAGAGGT
TGGTTAGGCATGGATGTAGAAGGTGCTCATGTCTGTGGTTCTAATGTTGGCACTAATGTTCCTCTTCAAG
TAGGATTTTCTAATGGTGTCGATTTTGTTGTACAACCTGAAGGTTGTGTTATGAATAATGTGAATGACAC
TATAACATCTGTCAAAGCTAAGGCTCCACCTGGTGAACAGTTCGCACATCTTATTCAACTAATGCGTAAA
GGACAACCATGGAGTGTTGTTCGAAAACGCATTGTACAGATGTGTTGTGATTACATCTCTACTTCTTCAG
ATGTAATCATCTTTGTACTTTGGGCAGGTGGTTTGGAACTTACTACTATGCGTTACTTTGTTAAAGTTGG
ACCTCGCATAGACTGTCATTGTTCTAAAGTTGCTACATGTTATAATAGTGTTGAACATCAATATTACTGT
TTCAAACATGCTATGGGTTGTGATTATATTTACAACCCTTATGTTATTGATATACAACAATGGGGCTACA
CTGGTTCTCTTAGCTCTAATCACCATCAGCATTGTAATGTTCATAGAAATGAGCATGTTGCTTCAGGTGA
TGCTATTATGACTAGGTGTCTTGCAATTTATGACTGTTTTGTCAAAAATGTTGATTGGTCTATTACCTAT
CCATTTATTGGTAATGAAGCTGCCATCAACAAAGGTGGACGTGTTGTTCAATCACATATTGTCAAAGCAG
CCATAAAGGTTTATAATCCTAAAGTCATACATGACATTGGAAATCCTAAGGGTATACGTTGTGCTGTTAC
CAATTCTACAGGGTACAGCTATGACAAACAACCTTTAAATTCTAATGTCAAGACTTTGGAATACGACTAT
TTAATTCATGGTCAAATGGATGGACTCTGTTTGTTCTGGAATTGCAATGTCGATATGTACCCTGAATTCT
CTGTTGTTTGTAGATTTGATACCCGTTGTAAATCCACATTTAACTTGGAAGGTGTTAATGGCGGTTCTTT
GTATGTAAACAATCACGCTTTTCATACACCAGCATTTGACAAACGTGCTTTTGCCAAACTCAAACAAGCA
CCATTCTTCTTTTATGATGATGGTGATTGTGACAGTGTACAAGGTAGTGTAAATTATGTGCCTCTCAGAG
CTTCTAATTGCATTACACGTTGTAACATTGGCGGTGCAGTTTGCAATAAGCATGCTAATATGTATTATTC
GTATGTTAATGCATACAATACATATGTCCAAGCTGGATTTACTATTTGGGTTCCTAATAGTTTTGACACG
TATAATTTGTGGCAAACATTAGTCACTCCTCAGTTACAGAGCCTTGAAAATGTCGCCTTTAATGTCGTTA
AACATGGTTCTTTTGTAGGTGTAAAAGGTGATTTACCTGTTGCCATTGTGTCTGACAAAGTTTTTGTTCG
TGATGGTGTGGTTGATAATGTTATATTTACTAACAAGACCACTCTACCGACAAATATAGCTTTTGAACTC
TATGCTAAGCGTAAGATTGGTAACTCTCCTTCACTTACTGTGCTTAGAAACTTGGGTGTTACTTGTACTT
ACAAATTTGTTCTCTGGGATTATGAAGCTGACCGTCCTTTTACTAATTACACTAAAGATGTGTGTGCTTT
TACTGACTTCGATGCTGATGTATGCACTTGCTATGACAATAGTGTAGAGGGTTCTTTTGAACGTTTTTCA
CTGTGTCGTAATGGAGTGCTTATATCTACAACAGCTGTTAAGAAGCTTTCTGCCATAAAATTGAATTATG
GTTATCTTAATGGTTTTCCTATTACTAGTCATGATAATAAGCCCGTTACATGGTACTACTATGTTCGTAA
AGATGGAGTTTTTGTTGACCAATGTGATGGTATTTTCACACAAGGTCGCAATGTTAGCATCTTTGAACCA
CGTAGTGAGATGGAGTCTGATTTCTTAAATCTAGACATGGGCTTATTCATCTCTAAGTATGGTCTTGAAG
ACTATGCATTTGAACACATTGTCTTTGGTGATGTGTCTAAAAATACTCTTGGTGGTCTTCATTTGCTCAT
ATCCCAAGTACGTTTAAGCAAAATGGGTGTTCTTAAAGTTGAAGACTTTGTCTCGTCTGCTGATAGTACA
CTTAAAAGCTGCTCTGTTACGTATGTTAATGATCCTTCATCCAAGATGGTCTGTACGTACATGGACATTC
TACTTGATGACTTTGTTAATGTCCTGAAATCTTTGGATCTTAGTGTGGTTTCTAAGGTACATGAAGTCAT
TGTAGATTGTAAAGTTTACCGCTGGATGTTATGGTGTAAGGATTACAAAGTTCAAACTTTTTATCCTCAA
TTGCAGTCTGCCGAATGGAAATGTGGTTATTCCATGCCATCTTTGTACAAAGTTCAACGCATGTGCCTTG
AGCCATGTAATTTGTACAATTATGGTGCTAGTATTAAATTACCAGATGGCATAATGTTCAATGTTGTCAA
ATATACTCAGTTATGTCAGTATTTAAATAGTACTACTATGTGTATACCTCATTCTATGAGAGTATTACAT
TTAGGTGCTGGTTCTGACAAAGGCGTAGCACCTGGTACTAGTGTACTAAGAAGATGGTTACCCACTGATG
CTGTTATAGTTGACAATGATGTGAATGATTATGTTAGTGACGCTGATATTAGTGTTACTGGTGATTGTAC
TACACTTTACTTACAAGACAAATTTGACCTTGTCATTTCAGATATGTATGACGGTCGTATTAAACAAATG
GATGGTGAAAATGTTTCTAAAGATGGTTTCTTTGTTTACATCAATGGTGTTATAACTGAGAAATTAGCTT
TGGGTGGTACTGTTGCTATTAAAATCACTGAGTATAGTTGGAATAAGAGGCTTTATGAATTAATTCAAAA
GTTCTCTTACTGGACTATGTTCTGTACTAGTGTTAACACTTCTTCATCAGAAGCATCTTTGATTGGTGTT
AATTACTTGGGTGATTTTGCAACAGATCCAATTATTGACGGTAACGTGTTACATGCTAATTACATATTTT
GGAGAAATTCTACAGTAATGGCAATGTCTTATAATAGTGTATTGGATTTAGCTAAATTCCAATGCAGACA
TAAGGCGACTGTTGTTATAGCTTTAAAAGATAATGACATTAGTGATGTAATACTTGGTCTTATTAAAAAT
GGCAAACTGTTTATTAGAAAGAATGGTGTTGTGTGTAGTTATGGTAATCATCTAGTTTCAACTAAATAAA
ATGCTTTTCATTTTATGCATTGCATTGTGTTTTAATTTTGTCAGTGCCAATATTGGTTGTGAGTCCAATG
GTAATTTGGACATGCAACGCTTGAAACTAGGTTTACCTAGTAATATCACAAATGCATATGTTTCTGGTTA
CTTACCTTCACCTGATTCTTGGAATTGTACACAAAACCCTGTTGGTGTTGCTAATATAACTTATAATGCT
AAAGCTGTTTTTATCAGCTATTATAAGTTTGGAAGAGAAGTTGCCGTTGGTGTGGGTAATTCTAAGTCTA
ACGACTCTATTGGAATTTACTTTAATCATCATAATGGTAATAAAAGCACCATTCTAAGAGTTTGTAGGTG
GCATAAGTATTACATGCCATCATACACACCTACCATCACTACAGGTGGTAAAGATTGTGTTATAAATACA
AACCTTAAGCTGAGTTTTGTTGATCAAGGTAACCACAGTGATATATTTGGTCTTAGTTGGTCAGGTGACA
GACTGACCATTTATTCACTTGATGGTGTGAAATCCTACTATATTCCTGGAATAGGTGAACTTGATGTTGT
ATCATTCAGGTGTGTTTATAAAGAAACTTGTGCTCACCAAGTTATAACTAAACCCATTACAGCTATTGTT
AACACCACTGCAGATGGTCTTATTTCTGGTTACTCTGTTTGTGATGATTGCGATGGCTTTCCTAAGTATG
TTTTTGCTGTAACTGAGGGTGGTGAAGTACCACCAAATTTTCGGTTGGACAATTGGTTTTATTTAACCAA
TAGTTCTACACCTATTTCTGGTATGTTCACTTCAGTTCAGCCTTTTAATTTATCATGTGTTTGGACAGTT
CCTGTGTTGACTAATAACTCACTACCTGTTTATTTTAACATGTCAATGAATGAAAATGTGACTTGCAACG
GCTACAGCAACTTTGATGTTGGTGTTGTTGATGCAATGCGCTTTTCTCTTAATTTCACTGACAATCAAAT
TATACGCAAGGGTGTTATTTCTGTGTTTACTAGCACTAATGTGTATAATTTTAGTTGTACTAATAACAGT
GTTCTTGATGGTGATGCTGTCATACCTTTTGGTGATGTTGCACAAACACATTACTGTTTTATCAAGTACT
TTACTAATATTACTTCAGGTGAAAGTGTTAGTCAATTTGTTGGTATTTTACCACCACAGGTTAAAGAGTT
TGTAATTATGCGTAATGGTGATTTTCACCTGAATGGCTACAGGATATTTTCTGTGGATCGCGTTGAAAGT
GCTATTTTCAACATTTCTACAAATGATGGTAGAGATTTTTGGACAGTTGCATTTGCCAACAATGCTGAGG
TGTTGACTGAGATAAATGCTACTAGTATCCAAAACTTGCTTTACTGTAATAACCCTGTGAACAGCATCAA
GTGTCAGCAATTGCGCTTTAATCTTGATGATGGCTTTTATTCACATACTTTTGACAGTGCTGATAATTTA
CCTCGAACTATAGTTCGTTTGCCTAAGTATGTGACTCATTCTTACATTAATGTCACGGTTGGCGTTAATT
TTGAGAATGGAACGCTTACTAACTATCTTGTTGACTTTGCACCTGATGGTACATCCATAGGCAAAGATAA
CATAACTACTGTTTGTGTTGACACTACGACGTTTACTACTCGTCTTAATGTATTAGCATTTTCTGCTTTC
AGTACTGCTGTTGACATACAAGCTGGAACTTGTCTTTTTAGTTACAACAATTTAAACAACTACCTAGGTT
TGGTTTCTTTGTGTTTTTCCACAAAACCAAATGGTGGCTGTATGATGAGTGTTGTTGCTAGGGGTTATTT
TGGCGAGTTTCAAAAAGTTGGCGTTCTGTACGTTTCATTTACTAAGGGTGATAACGTACTTGGTGTTCCT
CCAAACAATATTCCTACTATAGGTGTTAGTGATATGAGTGATGTCAAACTAAATGTTTGCACTACATTCA
CCATCTATGGTCATACTGGCAGAGGTATAATTAACAAATCTAATAACACTTTTGTTTCAGGTTTGTTTTA
CACATCCGTCACTGGTAATTTGCTTGGTTTTAAGAACTCTACTACTGGAGAGATTTTTAGTATTTCTCCG
TGCCAACTTACAACTCAAGTTGCTGCTGTTTCTGACAAGATTGTTGGTGTTGCTGCAGCAACGAAAGAAG
TTACATTGCCTTTTGACACTCATGTCAGTTTGGGCTCTTTTTATTATCATTATAAAAATTCTAATGCTGA
GCTTTGTAAGAATCCAAGTTTAATGTATGGTGGTCTTGGTGTCTGTGAAGATGGTAGGCTCGTCAACATT
TCAAGATCTGAAGACACTTTTGTACCTTCAGCTGTAATAAGTGGCAACATTACAATACCTGCTAATTTCA
GTTTTGTAGTTCAACCTGAATACATTCAGATTATGACAAAACCCGTTAGTGTGGATTGTAGTGTTTATGT
TTGTAATGGAAATCCTAGGTGTCTACAGTTACTGACTCAGTATGCCAGTGTCTGTAGAACTGTTGAAGAA
CCATTGCAGCTAAATGCACGTTTAGAAGCACTAGAGCTTACCAGTATGATTATTGTTCAAGACAAAACTT
TGAAACTTGGTGTGGCATCCAATTTTAATGATACATTTGATCTTACTTTGGCTTTACCTAGACAACATCA
GTCTAGGTCTGCTATTGAAGATCTGTTGTTCAGTAAAATTGTAACCAGTGGTCTCGGTACTGTAGATGAC
GATTACAAGGAATGTGCTGCTAAAATGGCTAATACTATTGCTGAGGCTGGTTGTGTCCAGTATTATAATG
GCATTATGGTGTTGCCTGGTGTAGTTGATCCTTCTTTGCTTTCTCAGTACACAGCTGCACTTACTGGTGC
TATGGTACTTGGTGGTGTCACCGCTGCTGCTGCAATACCTTTTTCACTTGCTGTTCAAGCTAGACTTAAT
TATCTGGCTTGCCAAACTGATGTGTTGCAGCGTAATCAGATGATATTAGCTCAGTCTTTTAATGCTGCAA
TGGGTAATATTACAGTTGCTTTTAGTGGTGTAAGTAATGCCATTCAACAAACAGCCCAGTCATTGAATAC
CATTTCCCAAGCCCTTAATAAGGTTGAGAATGTTGTCAATGAACAAGGAACTGCTTTGTCTCAGTTAACC
AAGCAACTTGCTTCTAATTTTCAAGCCATTTCTTCTTCTATAGAAGATCTGTATAATAGGCTTGATACTT
TGGAAGCAGATCAGCAGGTTGACAGATTGATTACAGGACGTCTTGCTGCACTTAATGCTTTTGTGACTCA
ACAGTTGTTGCGTTATTCAGAGGTTCGTGCTTCTAGACAATTGGCTCAAGAAAAGATTAATGAGTGTGTT
AAATCACAGTCTTCTAGATATGGGTTCTGTGGTAATGGAACACATGTCTTTTCTGTTGCTAATGCTGCTC
CTGATGGTATTATGTTTTTACATGCTAATCTTGTACCCACTGCATTTATTGAAGTCTCTGCCTTTGCTGG
AGTTTGTGTTGATGGTAGAGCATTGGTTCTTAGAGGTCGTGATGAGGTTTTATTTCAAAAGCCTGATACT
GATCAGTATCTAATCACACCAAGGCTTCTTTTTGAACCACGAGTTCCTGTCAGTGCTGATTTTGTTGAAG
TTAGCAGTTGTAATGTTACCTTTATTAATTTGACTATCAATGAGTTGCCAGAGCTTTTGCCTGACTACAT
TGACGTTAATAAAACTTTGAAGGAATTCGCTGCTACCATTCCAAATCGCACTGAAATGCAATTGACGTTG
AACACTTATAATGCTACTGTTCTTAATCTCACTGACGAAGTTAAATCACTTATGTCACAAGCTGACGATT
TGACAAAAATCGCTAGTGAGCTTAATCTTACCATTTCTAAGATTAATAATACTCTTGTTGAACTTGAGTG
GCTTAACAGAGTTGAAACTTACATTAAATGGCCTTGGTATGTGTGGTTGGCTATTGCTGTTACACTTATC
ATATTGGTCGGACCTATGCTATGGTGTTGTCTCGCAACTGGTTGTTGTGGTTGTTGCAGCTGTTTGGTCA
ACTCTTGCAGTGACTGTGGCGGTAGACGCTTACAACGTTACGAAATTGAGAAAGTCCACGTTCAGTGATG
TGGGGCGGTCTCTTCCAGTTGCAGTTTGAAAAAGCACTTAGCAGTATCAACTCTGATCTTAATTTGCCTA
AAGAGCATTTGAAAGTGGTTGAGTCTCATCTCGCACCCATTCATTATGCAACGTCTTCATTGGGCTACCT
TTTTACTAGTTTCTTTGTGGTGTATTTTGCATTATTTAAAGCAAACACCTATAGAAGCAATATTGTGTGT
CTTGCTTTTAGGCTTGCACTTATACTTTTGTATAGTCCTTTGCTGTTATACTATGGATCATTTATTGATG
GTACATTTATTGCAGCTGTCCTTATTGGTAGAATGTGTCAGACACTTTATTATTCATACCGTTATAAGAA
TCCTTCCTTTGTTATTCTTAATACCTGCACTTTGGCTATAATTGATGGCAAGTCATGGTATTACTACGGA
CAAATTTGGTTCGTTTTACATGGTGGTAGAAACCATGTGAAGTTCGGACCTCATAATATTACTTTTCTAT
CTAACAATCAACTTCATGTTGATGTTAGAGGCTATACTAATCTAAATTTAGAGTTGATTCGCGTTGCAGA
ATTACCTCATGAATCATTGTTTTACATCTTTGGTACTGAACCTGTTAATGATGTGAAAGTTGTTGACATG
TTGAGTTCAACTACACGAAGATGTTAACTTTGGTAGATGATCATGGATTAGTTATTAATGCAATTTTGTG
GCTTTTGTTTTGTGTATCTGTTATTATAATTTGCTGTGCGTTAATACAACTTGTACAGTTGTGTTTTATA
TGTCATAGACTTTGTTCTAACACTGTGTACAAACCTGTTTATAAAGCCTACAAAATTTATCAAGATTATA
TGCAAATTGAACCGCTTCCAGTTTTAAATGTCTAAACGAGAATGATTAACTTTATTGTTCTTTGTTGCGC
CTTTATAGGCGTTATTTATGCAGACAATGGTGATAACACCACTGCTGTTACTCCAACACTTCCACCTCAG
CAAATACCGCTGAAAGAGGTGATGGAACATTTAAGAAACTGGAACTTCAGCTGGAACATAGTGCTTACTG
TCTTTTTGATAGTAATGCAGTATGGCCATTTCAAATACTCGACCATTTTGTATGGTTTGAAAATGCTTGT
GCTTTGGCTTCTTTGGCCTCTTGTACTTGCACTCTCAATTTTCGATGCATGGTCGACATTTGGGCAGAAG
TGGGTTATGTTTGCTTTTAGCATCGTTATGGCCTGCACAACATTAGTGCTGTGGTTGATGTATTTCATCA
ACAGTTTCAGGCTTTATAGAAGAACACAGTCATTCTGGGCATTCAACCCAGAAACTGATGCCATAATTAC
AATCTCTGTTTTTGGAAAGACAGTCGCTATTCCAGTACTGGTACCTCCGACAGGCATTACGTTGACAGTT
CTTAGTGGAAAGCTCCTTGTGGAGGGCATACCGGTTGCTAACGGAATCACGGTGGGACAACTACCTGAAT
TCGTAACTGTTGCCAAAGCTACCACTACAATTATCTATCGACGTGCCGGAAGGTCACTGAATGCTAAAAC
CCAGACTGGATGGGCATTCTATGTACGTGCAAAGAATGGCGACTATTCTGCTATTATGACGATGGCAGAT
TCATTTTCCGAAAATGAAAGATTGTTACATTTAGTTTAAACTAAACAAGAAAACCTGATATGGCTTCTGT
TCAGTTTGAAGATACCAACTCTCGTGGTCGTTCTGGTAGAATACCACTATCCTATTATGCTCCTCTGCGT
GTTGCTGATGACAAGCTTTTCCTTAAGTCTATGCCTGGTAATGGTGTACCAAAGGGTATGGGCGGAAAGG
CCGAGCAAATCGGATATTGGACAGAACAACGACGCTGGCGCATGAATAAAGGTCAGAGAAAGGATCTGCC
TTCTAATTGGCATTTCTATTATCTCGGTACTGGACCTCATGCAGATTTGAAATTCCGCGAACGCCAAGTT
GGAGTTTTCTGGGTTGCCAAGCAAGGTTCTAAGACTGAGCCTACTAATCTTGGTACACGTAATCGCAATC
AGCAATTGCGTATTCCTGAATTTGACTTTACACTGCCTGACAGTCTTGAGGTTGTTAACTCTGACAGCAG
ACCTGCTTCACGCTCTGACTCTCGTAGTCAGAGCAAGAGTAATAATCAATCTCGGTCTAATTCAAAGGCA
CGTGATCAGTCTGGAACCAGAACTCCAAAGAATGCTTCTCAGAATCAAAAACCTAAGAAGAACCAGCAAG
AAGATCTTGTTGCTGCAGTTCGCGAAGCACTGAAAGGTCTTGGCATTCAACAAAGCAGATCTTCTAGTGG
CAAATCTACTCCAGCTCGTTCAAAATCTCCAGCTAGACCATCCAATAAGAAACAACTTGACAAGCCTGAA
TGGAAACGTGTTCCTAACAGAACTGAAAATGCAACCACTTGTTTTGGTCAGCGTTCTGTTGAGAGAAACT
GTGGATCAGCTTCTGTAGTTGCAATGGGTGTTGAAGCACCTAATTTTCCTCAGATTGCTGAATTGATTCC
TACTCAGGCTGCTTTGTTCTTTGGTTCGAGAGTCTCTACTAAAGAAGTTGGTGATACTGTTGAAATCAAG
TATCACTACAAAATGTCTGTACCTAAAACTAATCCTAACCTTCCTTACTTTCTTCAGCAGGTAAATGCTT
ATCTTGATCCAAACTCTGATCAGCCTATACCTAAAAAGCCTAAGGCTAAATCTGAAGAAGTTCCTCAACT
GAATCCTGCTGCCCCTGTGTTTACACCTCCTGCTCAGGAACCTGCTGTTGAGCTTGAAATGGTCGATGAA
GTCTTCGACATCGATCCTCTTGGTGACTCTGTTGCTTGAGTCAATCTGTTGCGCTATTCACCCCATATCT
GTACTTTTCAGAATGGACAAGGTGACCTACTTATACTAAAATGTAAGCCTGTATTTAAGCAGTATAAGCA
ATACTTAAATATATTACTGCCCTTAGATCAAAGCTATATGCATTAGTACCTCTATGTTCTGGAGTAATCA
AAGATCCGCTTAGACGAGCCTATATGGAAGAGCTAGAACATATGTGCTACATGCTATAGTTAGTAGTTGT
AGATGGGTGTGGTTTTGATAGGGATTCACAAAAAAAAAAAAAAAAA

>gi|126030122|ref|NC_009020.1| Bat coronavirus HKU5-1, complete genome
GATTTAAGAGAATAGCCTAGCTATCCCTCTCTCTCGTTCTCTTGCAGAACTTTGTTTTTAACGAACTTAA
ATAATAGCCCTGCTGGTTTGCGTGCTGCGATACCTTTCTGCTGCGTCATAGGCGCCGGACTGGAAAGCGC
ATGTACACCACTGGGTATAATTAAAACTGAATAATATTTTTCAGTTAGAGCATCGTGTCTCAAGTGCTTC
ACGGTCACAATATACCGTTTCGTCGGGTGCGTGGCAATTCGGTGCACATCATGTCTTTCGTGGCTGGTGT
GGCTCCTCAAGGTGCGAGGGGCAAGTATAGAGCAGAGCTCAACACTGAAAAAAGGACTGACCATGTGTCT
CTCAAAGCGTCACTCTGTGATGCAGGAGATCTGGTTCTCAAGATCTCACCATGGTTTATGGACGGCGAAA
GCGCCTATAAACATGTGAGTGAACAACTCTCTAAGGGAAGTAAGCTTCTCTTTGTCCCTCAAACATTGAA
GGGATTCATACGGCATCTCCCAGGCCCTCGTGTTTACCTGGTTGAGAGGCTGACAGGGGGTACCTATTCG
GACCCATTCATGGTTAACCAGCTTGCTTACCAAAATGCCGCAGGAGAAGGTGTCATTGGCACAACCCTGC
AGGGTAAGCGTGTTGGAATGTTCTTCCCATTTGATGCGGATCTTGTTACTGGAGAGTTTCAATTTCTGCT
TCGTAAGAAGGGCTTCGGTGGCAACCGCTTCCGTGATGCTCCTTGGGATTACAACTGGACTCCCTACTCT
GATCTTATGGACGCTCTTGAGGCTGACCCTTGTGGTAAGTACTCTCAGAGCCTTCTTAAGAAGCTCGTTG
GAGGTGATTTCACCCCAATCGATCAATACATGTGTGGCAAAAACGGCAAACCCATTGCTGAATTTGCTGC
TTTAATGGCTAGCGAAGGAATCACCAAGCTAGCTGATGTGGAGGCCGAAGTCAAGTCCCGTACTGACTCA
GACCGCTACATCGTCTTCAAGAACAAATTATACCGGATTGTGTGGAATGTGCAACGTAAGGACGTTGCGT
ATTCAAAGCAATCTGCCTTTACTATGAATAGTATAGTCCAATTGGACACCATGGAGGATGTCCCTAGACA
CTCATTCACAATCGGCTCTGAGATCCAAGTGATTGCACCCTCAACTGCGGTGCAAGCTAATGGACATCTC
AATCTCAAACAGAGACTCCTCTACGCATTCTATGGTAAGCAGGCTGTCTCTGAACCCAACTACATCTACC
ACTCAGCGTACGTCGATTGCACGAGCTGTGGTAAAGGTAGTTGGCTGACTGGCAATGCTGTGCAAGGTTT
TGCATGTGATTGCGGAGCACACTATTGTGCTAATGATGTAGACTTGCAGTCTTCGGGCCTTGTGCGGAAG
AATGCTGTCCTTCTTACTACCTGTCCCTGCAATAAGGACGGAGAATGCAAACACACCCTCCCTCAGCTTG
TTAGCATGATGACTGACAAGTGTGACGTTGAGGTTGTTGGAAAAACCTTCATTCTTACTTATGGAGGCGT
AATTTACGCTTACATGGGTTGCAGTGGTGGTACTATGCACTTTATTCCTCGTGCAAAGTCATGTGTTTCC
AAGATTGGCGATGCCATCTTCACTGGATGCACAGGCACCTGGAGTAAGGTATGCGAAACAGCAAACCTTT
TCCTCGAAAGGGCTCAGCATGCCATCAATTTTGTTAATGAGTTTGTGCTCACAGAGACTGTAGTGGCACT
ACTTTCTGGTACTACTTCTAGTATCGAAGAACTTCGTGACCTGTGTCGTAACGCAACGTTCGAAAAGGTC
CGAGACTATTTAACACCTCGTGGCTGGATTGTCACGATGGGTTCCTACATTGAGGGTGTCATTAACGTAG
GTGCAGCTGGTGTCTGCAACGCTGCGCTTAATGCCCCATTCATTGTTCTCTCCGGACTTGGAGAATCCTT
TAAGAAGGTCGCTGCAACTCCTTGGAAATTGTGCAGCTCCCTCAGAGAAACTCTAGACCATTATGCTGAT
AGCATAACCTACAGGGTTTTCCCATATGACATCCCTTGCGATGTTACTGATTATACGGCTCTCTTGTTGG
ATTGTGCAGTTCTGACTGGAGCTTCAGCCTACTTTGTAGCCCGCTATGTGGATGAAAAAGTAGAGCAACT
CACTAACCTTGTCTTCTCCTCATGCCAGAGCGCAGTTGCAGCCTTTGTACAGGCATGTATGTCTACTTAC
AAAGCTACTGCAAAATTCATCTCTGACATGTTCACTCTAATAAAAGTAGTCTCTGAACGGCTCTACGTCT
ACACGTCTGTGGGCTTTGTCGTTGTTGGAGATTACTCATCTCAGCTTCTGAAGCAATTCATGCATATCCT
CTCAAAGGCCATGCAACTGCTTCACACCACGGTTTCTTGGGCAGGTTCCAAGTTGCCATCGGTTGTGTAC
AATGGAAGAGATTCCCTTGTATTTCCAAGTGGCACATACTATTGTGTCTCCACTCAAGGCAGGTCTCTGC
AGGATCAATTCGATCTTGTAATTCCTGGTGACCTGAGCAAGAAGCAAATTGGCATTCTTGAACCTACACC
CAACTCTACCACCGTTGATAAGAAAATCAACACAAATGTGGTGGAAGTAGTTGTTGGTCAATTAGAACCT
ACTAAGGAGCATAGTCCCGAACTAGTCGTCGGTGATTATGTGATCATTAGTAATAAAATCTTTGTGCGCA
GTGTCGAAGACAGCGAAACAGTCTTCTACCCACTCTGCACAGATGGAAAGATCGTGCCTACTTTGTTCAG
ACTCAAAGGTGGTGCGCCTCCCAAAGGAGTTAAGTTTGGTGGCGAACAAACAAAAGAAATAACTGCAGTC
AGAAGCGTATCTGTGGACTACGATGTTCATCCTGTCCTAGATGCACTGTTAGCCGGTTCCGAACTGGCCA
CATTCACAGTTGAGAAGGATCTCCCAGTCAAGGATTTCGTGGATGTTGTGAAGGATGAAGTTATTGAGTT
GCTCTCTAAACTTCTCCGTGGTTACAACGTTGACGGATTTGATCTGGAGGATTTCGCTGATACACCTTGC
TATGTCTACAATGCTGAAGGAGACTTAGCTTGGAGCTCAACCATGACCTTCTCAGTCAACCCTGTTGAGG
AAGTTGAAGAGGAGTGTGATGATGATTACGTAGAGGATGAGTACCTCTCTGAAGAAATGCTTGTCGAGGA
AGATGAGAATTCCTGGGCTGCAGCTGTTGAAGCCGTCATTCCAATGGAAGACGTCCAATTAGATACCCTT
GTAGCTGAAATTGATGTTTCAGAGCCAGCTGATGATGTCGCTGAACAAGCCTCTACTGAAGAAGTGGAAG
TGCCTAGTGCTTGTGTGTTGGAAGCCTCTCAAGTAGCTAACGCGGCTGAGGTTGAATCATGTGAGGCAGA
AGTTTCGTCTTCGATCCCCCTCCATGAGGATGCTAATGCCGCCAAGGCCAACGATTGTGCCGAAGGTATG
CCTGCGCTCGATAGTACTGAAACTGTCAGTAAGCTCTCAGTTGATACGCCAGTTGGTGATGTCACACAGG
ATGATGCTACAAGCAGCAATGCTACTGTAATAAGTGAAGATGTTCACACAGCCACTCATTCTAAAGGACT
AGTTGCGGTTCCTGAAGTTGTTCCAGAAAAGGCTTTGGGCACTTCGGTTGAGCGGATGAGGTCGACGAGT
GAGTGGACTGTTGTTGAGACTAGCTTAAAACAGGAGACTGCTGTAATAGTCAAAAATGATAGCTCTGCCA
AACCACAAAGGGTTAAAAAGCCCAAGGCAGAGAATCCTCTTAAAAATTTCAAACACATTGTCTTGAACAA
TGATGTTACACTAGTCTTTGGTGACGCTATTGCTGTGGCAAGAGCGACTGAAGACTGCATTCTTGTCAAT
GCCGCTAATACCCATTTGAAACATGGTGGTGGCATTGCAGCTGCTATTGACAGAGCATCTGGTGGGCTTG
TACAAGCCGAATCAGATGACTATGTCAACTTTTATGGGCCACTCAATGTGGGTGACTCTACTCTCCTGAA
AGGGCACGGCCTTGCAACTGGCATCCTTCACGTTGTAGGCCCAGACGCGCGTGCCAATCAGGACATTCAA
CTTCTTAAACGCTGTTATAAGGCGTTTAATAAGTACCCCTTAGTTGTGTCGCCTTTAATCTCCGCAGGTA
TTTTCTGCGTAGAACCAAGGGTGTCACTTGAATACTTGCTCTCTGTTGTACACACTAAAACATATGTTGT
GGTCAACTCAGAGAAAGTTTATAATGACCTTGCTGCACCAAAACCTCCGACTGGATTAACTTATTCACAC
GAGGGTTGGCGTGGCATCATTCGTAATGCAAAATCCTTTGGATTCACGTGCTTTATCTGCACTGATCAAT
CCGCAAACGCAAAACTTCTCAAGGGAAGGGGTGTGGATCTTACTAAGAAAACTCAAACTGTCGATGGTGT
CAAGTACTATCTTTATAGTTCTAAAGACCCATTGACTGACATAATAACTGCTGCTAATGCCTGCAAAGGC
ATTTGTGCCATGCCTATAGGTTATGTAACTCATGGGCTTGACTTAGCACAGGCGGGGCAACAAGTTAAGA
AAATAACTGTGCCATACGTCTGTTTGCTGGCATCAAAGGACCAAGTTCCTATCTTAAATTCTGATGTTGC
AGTTCAAACACCAGAACAGTCTTTCATTAACACTGTCATTGCTAATGGGGGTTACCATTGTTGGCATCTT
GTCACTGGTGAACTCATAGTTAAGGGAGTGTCATATCGAAAACTGCTAAATTGGTCAGATCAAACCATTT
GCTATGCAGATAATAAGTTTTATGTGGTAAAAGGACAAATTGCCTTACCATTTGACTCACTTGAGAAGTG
TCGGACCTACCTGACTTCAAGGGCCGCACAACAGAAAAACGTCGATGTTCTTGTAACAATCGATGGGGTT
AACTTCAGGACTGTTGTTCTGAATAATACAACTACTTATAGGGTACAGTTAGGTTCTGTATTCTATAAGG
GTTCTGACATCTCAGACACCATTCCCACTGAAAAGATGAGTGGTGAAGCCGTTTACTTGGCTGACAATTT
GTCAGAAGCTGAAAAGGCTGTACTTAGTGAAGTCTATGGAACAGCTGATACTGCATTTCTGCACAGGTAT
TACTCCCTCTTGGCACTGGTTAAGAAATGGAAGTATACGGTGCATGATGGTGTTAAATCCCTCAAGCTTA
ATAGCAACAATTGTTACGTTAATGTGACAATGTTGATGTTGGATATGCTTAAGGAGATCAAATTTATTGT
ACCTGCCTTACAAGCTGCGTACCTCAAACATAAGGGTGGTGATTCCACTGAATTCATTGCCCTAATAATG
GCATATGGTGACTGTACCTATGGTGAACCTGATGATGCCTCCAGACTGCTGCATACCATCCTTTCCAAGG
CTGAGCTTACTACTCAAGCTAAAATGGTTTGGAGACAATGGTGCAATGTCTGTGGCGTCCAAGATACTAC
TACTACAGGCCTCAAGGCGTGCATCTATGTAGGAATGAACTCATTAGACGAGCTTCATGCTACACATGAG
GAATGCTGTCAGTGCGGTGATGTAAGAAAACGACAACTCGTTGAACACAACGCACCATGGCTGCTGTTAT
CAGGACTTAATGAAGCTAAGGTAATGACGCCCACGTCGCAGTCGGCCGGTCCTGACTATACAGCATTTAA
CGTCTTTCAAGGTGTAGAGACCTCTGTGGGTCACTACTTGCATGTACGCGTGAAGGACAATCTCTTATAT
AAGTATGACTCCGGTAGCTTGAGTAAGACTTCCGATATGAAGTGCAAGATGACCGATGTCTATTATCCTA
AGCAGAGATATAGTGCAGACTGCAATGTCGTAGTATACTCTCTGGATGGGAATACTTGGGCTGATGTAGA
TCCTGATCTGTCAGCTTTCTATATGAAGGATGGCAAGTACTTCACCAAGAAACCTGTCATTGAATATTCA
CCAGCTACAATTCTATCTGGTAGTGTGTATACTAATAGTTGCCTTGTCGGACATGACGGTACCATTGGCA
GTGATGCTATTAGTTCTTCTTTTAACAACCTATTAGGCTTTGATAATTCTAAGCCAGTGTCAAAGAAACT
CACGTATTCCTTCTTCCCGGATTTCGAGGGAGATGTGATTCTTACAGAGTATTCCACTTATGACCCCATA
TACAAGAATGGCGCAATGCTACATGGCAAGCCAATCTTATGGGTTAACAATTCTAAATTTGACAGTGCAC
TTAACAAGTTTAATAGGGCTACGCTTAGACAAGTCTATGACATAGCACCTGTTACTCTTGAGAATAAATA
CACTGTCCTTCAAGACAACCAAATACAGCAGGTTGAGGTTGAGGCACCAAAGGAGGATGCTAAACCACAA
TCTCCTGTTCAGGTTGCAGAAGATATAGATAATAAGCTACCCATTATCAAGTGCAAAGGGCTTAAAAAGC
CATTTGTAAAGGATGGGTATAGTTTTGTTAACGACCCGCAGGGTGTCAATGTGATAGACACACTTGGTAT
TGATGATCTACGTGCGTTATACGTGGACCGCAATCTGCGGTTAATTGTTCTCAAAGAGAATAATTGGTCT
GCACTATTTAATATACACACTGTAGAAAAGGGAGATCTCAGTGTAATTGCTGCATCAGGATCCATCACAA
GAAGAGTGAAAATTCTTCTAGGTGCATCTTCTCTTTTTGCACAATTTGCATCTGTTACGGTCAATGTCAC
CACTGCGATGGGGAAAGCTTTAGGTAGAATGACGCGTAATGTAATTACTAATACTGGCATTATTGGACAG
GGCTTTGCTCTGCTCAAAATGTTATTAATATTACCTTTCACATTCTGGAAGTCTAAAAACCAAAGCACCG
TTAAAGTTGAAGTAGGTGCTCTAAGAACTGCTGGCATTGTCACGACTAATGTTGTAAAACAGTGTGCCTC
GGCAGCCTATGATGTGTTAGTAGTCAAGTTTAAGCGTATTGACTGGAAATCCACTTTACGCCTGCTTTTC
CTTATATGTACAACTGGGCTATTGTTGTCTTCACTATATTACTTGTTCTTGTTTCATCAAGTTCTAACAA
GTGACGTCATGTTGGATGGTGCCGAAGGCATGTTGGCTACTTATAGGGAATTGCGTTCCTATTTGGGCAT
CCATTCTCTCTGCGACGGTATGGTCGAAGCGTATCGGAACGTCTCGTATGACGTAAACGATTTTTGCTCA
AACCGTTCAGCCTTATGTAACTGGTGTCTTATTGGACAAGACTCACTTACTAGGTATTCCGCGTTCCAGA
TGATCCAAACTCATGTTACCAGCTATGTCATAAACATAGACTGGGTGTGGTTTGTAATGGAATTCGCACT
TGCTTACGTCTTGTACACTTCAACCTTTAACGTGTTGTTATTGGTGGTGTCATCTCAGTACTTTTTCTCC
TACACTGGGGCATTTGTAAACTGGCGTTCATACAATTACCTGGTCTCTGGATATTTCTTTTGCGTTACTC
ACATCCCCTTGTTGGGCCTTGTGCGTATCTATAATTTCCTTGCATGCCTCTGGTTCCTTCGTCGCTTCTA
CAATCATGTTATCAATGGCTGTAAGGACACTGCATGCCTGCTCTGTTACAAAAGGAATCGTCTAACACGT
GTGGAAGCATCAACAGTCGTCTGTGGTTCTAAACGCACGTTTTATATCGTCGCAAATGGCGGTACTTCAT
TCTGTTGTAGGCATAACTGGAATTGTGTTGATTGTGACACCGCAGGTATCGGGAACACCTTTATCTGTGA
AGAAGTTGCAAATGACCTCACTACCAGCCTACGGAGATTAGTGAAACCGACTGACAAGTCCCATTACTAT
GTGGAGTCAGTTACGGTTAAAGATTCAGTTGTCCAACTGCATTACAGTAGAGAGGGTGCCTCATGCTATG
AGCGTTACCCTCTCTGCTACTTTACTAATCTAGATAAGTTGAAGTTCAAAGAGGTTTGCAAAACTCCCAC
GGGGATACCTGAGCACAACTTTCTAATCTATGACTCGAGTGATCGTGGCCAGGAAAATTTAGCCAGATCA
GCTTGCGTTTATTATTCCCAGGTTCTCTCCAAGCCGATGTTGCTTGTGGATTCAAACATGGTCACCACTG
TTGGCGACAGTCGAGAGATTGCCAGCAAAATGCTTGATTCCTATGTTAATAGCTTCATTTCTCTTTTTGG
CGTGAATCGTGACAAGTTGGATAAACTTGTTGCCACCGCCCGCGATTGCGTAAAGAGGGGTGATGACTTC
CAAACTGTTATTAAGACTTTCACGGATGCCGCTCGCGGTCCAGCTGGTGTGGAATCTGATGTAGAAACGT
CCTCCATTGTCGACGCTTTGCAGTATGCGTATAAGCACGACCTGCAGTTGACTACAGAGGGGTTTAATAA
TTATGTTCCTAGCTATATTAAGCCTGACAGCGTCGCGACAGCTGATCTGGGTTGTTTAATTGACCTTAAC
GCTGCTTCTGTTAACCAGACTAGCATCCGCAATGCAAATGGCGCATGCATCTGGAATAGCAGCGACTATA
TGAAACTGTCTGATAGCCTCAAGCGACAGATTAGAATCGCTTGTCGTAAGTGCAATATTCCATTTAGACT
TACTACGTCTAGATTACGTTCTGCGGACAACATTTTGTCTGTTAAATTTAGTGCTACCAAACTCTCGGGA
GGTGCACCCAAATGGCTTTTGAAGCTCCGTGACTTCACGTGGAAAAGTTATTGTGTAGTTACATTAGTAG
TCTTTGCTATGGCTGTGTTGTCTTACCTATGTTTACCGGCATTCAACATGAGTCAAGTCTCCTTCCATGA
AGACCGCATTCTCACCTATAAAGTGGTAGAGAATGGTATCATTAGGGATATCACTCCTAGTGATACGTGC
TTTGCTAATAAGTACCAGTCATTCTCTAAATGGTTTAATGAGCACTATGGCGGATTGTTCAACAACGACA
TAAGTTGTCCCGTTACCGTAGCTGTTATCGCTGGTGTTGCAGGTGCTCGTGTACCCAACCTTCCTGCTAA
TGTTGCATGGGTCGGTCGCCAAATAGTTTTGTTTGTCTCCCGAGTCTTTGCCTCTTCTAATAATGTCTGC
TACACCCCAACCGCTGAAATCCCTTATGAGAGATTCTCCGATAGTGGGTGCGTTCTAGCATCTGAATGCA
CATTGTTCAGGGATGCAGAAGGTAAGATTAACCCCTACTGCTATGACCCTACTGTTCTGCCTGGTGCTTC
TGCTTATGATCAAATGAAGCCCCATGTTAGGTATGACATGTATGATTCAGACATGTACATTAAGTTTCCA
GAAGTGGTCTTTGAGAGTACTCTGCGTATTACTAAAACCTTGGCTACTCGCTATTGTCGCTTTGGCAGTT
GCGAAGATGCTAATGAAGGTGTCTGTATTACTACTAATGGCTCTTGGGCTATCTACAATGATCACTACGC
AAATAAACCTGGCGTTTATTGTGGTGATAACTATTTTGATATTGTCAGAAGACTTGGTCTCTCTCTTTTC
CAGCCTGTCACCTATTTCCAACTTAGTACTTCGTTGGCTTTGGGTGTCATGCTTTGTATCTTCTTGACAA
TTGCCTTCTACTACGTCAACAAGGTCAAACGTGCCCTTGCTGATTATACACAGTGTGCAGTCGTAGCAGT
AGCTGCCGCTCTTCTTAATAGCTTATGTCTATGCTTTGTTGTGTCAAACCCACTACTTGTGTTGCCATAC
ACAGCTTTGTACTACTATGCCACCTTTTACCTTACTGGTGAGCCTGCATTCGTTATGCACGTCTCATGGT
TTGTCATGTTCGGAACAGTCGTCCCTATATGGATGGTGTTTGCCTACATTGTGGGAGTCTGTCTTCGTCA
TTTACTCTGGGTTATGGCTTACTTCAGTAAGAAACATGTTGAAGTCTTTACTGATGGTAAACTGAATTGT
AGTTTCCAGGATGCTGCCGCTAATATCTTTGTGATTAACAAGGATACATACGTGGCACTCCGGAATTCTA
TTACCCAAGATTCCTATAATAGATACTTGTCCATGTTTAATAAGTACAAGTATTATTCTGGTGCGATGGA
CACTGCCTCCTATAGAGAAGCTTCTGCCGCGCATTTGTGTAAAGCCCTCCAAGTCTACAGCGAAACTGGT
AGTGATGTCCTCTTCCAGCCACCCAATTGCAGTGTCACCTCAAGCGTGTTGCAGAGCGGTCTGGTTAAGA
TGGCTGCTCCCAGTGGAGTTGTAGAGAATTGTATGGTTCAGGTGACTTGCGGTTCAATGACACTTAATGG
CTTGTGGCTCGACAATTATGTCTGGTGTCCGCGCCATGTTATGTGTCCCGCTGATCAGTTGTCTGATCCA
AATTATGATGCTCTTCTTGTTTCAAAAACCAACCTTAGCTTCATCGTTCAGAAGAACGTTGGTGCACCAG
CTAACTTACGGGTTGTTGGACACACTATGGTTGGTACTCTTCTAAAGTTGACTGTGGAATCTGCTAACCC
GCAGACACCCGCATACACTTTTACCACTGTAAAACCAGGAGCGTCCTTTAGTGTCTTAGCCTGTTATAAT
GGCAGACCAACCGGAGTCTTCATGGTAAATATGCGCCAGAACAGCACCATAAAAGGATCTTTCTTATGTG
GCTCTTGTGGTAGTGTTGGTTACACTCAAGAAGGAAATGTAATCAACTTCTGCTATATGCATCAGATGGA
GTTATCAAATGGTACTCACACTGGTTGCGCTTTTGACGGTGTCATGTACGGAGCTTTTGAAGATCGTCAA
GTACACCAAGTCCAATTGTCAGACAAATACTGTACCATAAATATAGTAGCTTGGCTTTATGCGGCGATTC
TTAACGGTTGTAATTGGTTTGTGAAGCCAAATAAGACTGGAATCGCTACTTTTAATGAATGGGCTATGAG
TAACCAATTCACAGAGTTTATTGGTACACAGTCCGTAGATATGCTTGCTCATAAGACAGGTGTTTCTGTT
GAGCAACTCCTTTATGCTATCCAGACATTACATAAAGGTTTCCAGGGTAAGACAATCCTTGGCAACTCAA
TGCTGGAAGATGAATTCACCCCTGATGATGTTAACATGCAGGTCATGGGTGTTGTTATGCAAAGTGGTGT
GAAGCGTATTTCTTATGGTTTAGTGCATTGGTTGTTTACAACATTGCTACTTGCATATGTGGCTACGCTG
CAACTCACCAAGTTTACTATCTGGAATTACTTGTTTGAGGTGATACCCTTACAACTAACTCCACTAGTTT
TGTGTGTAATGGCATGTGTTATGTTGACGGTAAAGCATAAACATACATTCCTTACACTGTTTCTGTTGCC
CACGGCTATTTGCTTAACATATGCAAATATAGTCTATGAGCCTCAAACACCAGTTTCAAGTGCTCTCATT
GCTGTAGCAAACTGGCTTAATCCTGCTAGTGTGTATATGCGCACTACTCATACTGACTTAGGTGTTTACC
TTAGTCTTTGCTTTGCGTTAGCTGTTGTAGTCCGTAGACTCTACAGGCCTAATGCCTCAAACTTGGCTCT
TGCCTTAGGTAGTGCCATGGTTTGGTTCTACACTTATACTACGGGTGATTGCTCTAGTCCCCTTACCTAC
CTTATGTTTCTTACCACATTGACTAGTGATTACACCGTAACCGTGTTTCTTGCAGTCAATGTTGCTAAGT
TTTTCGCTCGGGTTGTGTTCCTTTATGCGCCGCATGCAGGATTCATCTTCCCAGAGGTTAAACTTGTCTT
ACTGATGTATCTTGCTGTAGGATACTTCTGCACTGTTTATTTTGGTGTCTTCTCTTTGTTGAACCTGAAA
CTTCGTGTGCCACTTGGTGTCTACGATTATACAGTTTCAACCCAAGAATTTCGCTATCTCACGGGTAATG
GGCTTCACGCGCCACGCAACTCTTGGGAGGCCCTTCGTCTTAACATGAAATTGATTGGCATTGGCGGTAC
ACCTTGTATCAAGATAGCCAGTGTCCAGTCAAAACTTACTGATCTTAAATGCACTTCTGTGGTTCTTCTT
TCTGTTCTTCAACAGTTACACCTCGAGGCTAACAGTAAAGCTTGGGCTCACTGTGTTAAGCTTCATAATG
ACATCTTGGCTGCGACTGACCCCACAGAGGCATTCGACAACTTTGTTTGTCTGTTTGCTACTCTTATGTC
ATTCTCAGCCAATGTGGATTTAGAGGCTTTAGCAAGTGACCTGCTTGATCACCCATCGGTGCTGCAGGCT
ACTTTATCTGAATTCTCACACTTAGCTAGTTATGCTGAGTTGGAGGCTGCTCAATCTTCCTACCAAAAGG
CTCTGAACTCTGGTGATGCCTCACCGCAGGTTCTTAAGGCTTTGCAGAAGGCTGTTAATATCGCTAAGAA
TGCCTATGAGAAAGATAAGGCTGTAGCAAGAAAATTAGAGCGCATGGCTGAACAGGCTATGACGTCAATG
TATAAGCAAGCACGTGCCGAGGACAAGAAGGCCAAGATTGTAAGTGCTATGCAAACTATGCTCTTTGGCA
TGATTAAGAAGTTGGATAACGACGTTCTTAATGGTGTCATCTCAAACGCTAGGAATGGCTGTGTGCCTCT
TAGTGTTGTGCCACTTTGTGCTTCTAATAAACTGAGAGTGGTGATACCTGATATTACCATTTGGAACAAG
GTTGTCACCTGGCCAAGCTTGTCTTATGCCGGTGCACTTTGGGACATTTCTCTCATAAACAATGTGGACG
GTGAAGTTGTTAAGTCTTCAGATGTCACAGAGACAAATGAATCCTTGACATGGCCACTTGTTTTGGAATG
CACACGCGCTGCAAGTTCTGCTGTAACGCTGCAAAATAATGAGATCAGGCCATCTGGTCTAAAAACTATG
GTTGTTAGTGCTGGTATTGATCATGCTAACTGTAATACTAGCTCACTGGCTTATTATGAACCTGTTGAGG
GTCGTAAAATGCTGATGGGTATTCTTTCTGAAAACGCACATCTTAAGTGGGCTAAAGTTGAAGGCCGCGA
TGGATTTGTGAATATTGAACTTCAACCGCCGTGTAAGTTCTTAATAGCTGGTCCCAAAGGCCCAGAAGTT
AGATACTTGTACTTTGTTAAAAACCTTAACAATTTACATCGTGGACAGCTGCTAGGCCATATTGCAGCAA
CAGTCCGTTTACAGGCAGGTTCTAATACAGAATTTGCTATTAATTCATCAGTGCTGTCGGCTGTTACCTT
CAGCGTTGATCCTGGTAAAGCATACTTAGACTTTGTGAACGCAGGTGGCGCTCCATTGACTAATTGTGTT
AAGATGTTAACTCCTAAGACTGGTACTGGAATTGCAGTGTCTGTCAAACCGGAGGCTAATGCAGATCAAG
ATACCTATGGTGGTGCATCAGTGTGTCTATATTGCAGAGCGCATATAGAACACCCAGATGTCACAGGTGT
TTGTAAATTTAAGGGTAAATTTGTACAGGTTCCACTTCACATTCGTGATCCTGTTGGATTCTGTTTACAA
AATACCCCGTGCAATGTTTGTCAATTTTGGATAGGACATGGTTGTAATTGTGATGCTCTTCGTGGTACTA
CAATTCCCCAGTCCAAAGATTCCAACTTTTTAAACGAGTCCGGGGTTCTATTGTAAATGCCCGAATAGAA
CCCTGTGCCAGTGGTCTTACCACTGATGTTGTCTTTAGGGCATTTGACATCTGCAACTATAAGGCAAAAG
TTGCTGGTATAGGCAAGTATTACAAGACTAATACTTGCAGGTTTGTAGAAGTCGATGACGAAGGTCATAG
ACTTGACTCCTTCTTTGTCGTAAAACGCCATACAATGGAAAATTATGAGCTGGAGAAGCGGTGTTACGAT
CTTGTTAAGGATTGTGATGCTGTGGCAGTTCATGACTTCTTCATTTTTGACGTTGACAAAGTCAAAACTC
CTCATATAGTGCGTCAACGTTTGACAGAGTACACTATGATGGATCTTGTATATGCTTTGAGGCACTTTGA
TCAGAATAACTGTGAAGTGCTTAAGAGCATACTTGTAAAATATGGTTGCTGTGATGCATCATATTTTGAT
AATAAATTGTGGTTTGACTTCGTGGAAAACCCCAATGTTATAAGTGTTTATCATAAGCTTGGCGAGAGAA
TTCGTCAAGCTGTGCTTAACACTGTTAAATTTTGCGACCAGATGGTAAAATCTGGTCTTGTTGGTGTCTT
AACCCTTGACAATCAGGATCTGAATGGCAAGTGGTATGATTTTGGTGATTTTGTCATCACTCAACCTGGT
GCTGGAGTAGCTATTGTTGATAGCTACTATTCTTATTTAATGCCTGTGCTTTCTATGACCAACTGTTTGG
CCGCTGAAACACACAGGGATTGTGATCTAACTAAGCCTCTCATTGAGTGGCCACTTCTAGAGTACGACTA
CACAGATTACAAGATTGGTCTGTTTGAAAAGTACTTTAAGYATTGGGATCAGCAGTATCACCCAAATTGT
GTGAACTGTACTGATGACCGTTGTGTGCTACATTGTGCAAATTTCAATGTGCTTTTCTCAATGACGCTAC
CGGGAACGTCTTTTGGTCCAATTGTCCGAAAGATTTTTGTCGATGGTGTACCATTTGTCATATCTTGTGG
TTATCACTACAAGGAGTTAGGATTAGTCATGAATATGGACGTGAGTCTTCATAGACATAGACTATCACTT
AAGGAGCTAATGATGTATGCAGCTGATCCAGCCATGCACATAGCTTCAGCCTCTGCCCTTTGGGATTTAA
GAACACCATGTTTTAGTGTTGCCGCACTTACGACAGGTCTAACCTTTCAGACTGTCCGTCCTGGCAACTT
TAATAAAGATTTCTATGATTTTGTTGTTTCTAAGGGCTTTTTCAAGGAAGGGTCCTCAGTTACATTAAGG
CATTTCTTCTTCGCGCAAGATGGACATGCTGCTATTACTGATTACAGCTATTATGCTTACAACCTGCCAA
CGATGTGTGACATAAAGCAGATGTTGTTTTGTATGGAAGTTGTTGATCGTTACTTCGAGATATATGATGG
CGGTTGCCTCAATGCATCGGAAGTAATTGTTAACAATTTGGATAAGAGTGCTGGCCATCCATTCAATAAG
TTTGGAAAAGCCAGAGTCTATTATGAGAGTCTGTCATATCAAGAACAGGATGAGCTTTTTGCCATGACAA
AGCGAAACGTTCTTCCGACGATAACGCAGATGAATTTGAAATATGCTATTAGTGCTAAGAATAGAGCCCG
GACTGTTGCCGGTGTGTCGATTCTTAGTACAATGACTAATCGTCAATACCACCAGAAAATGCTTAAGTCT
ATGGCTGCTACGCGGGGTTCCACGTGCGTCATAGGGACCACTAAGTTCTATGGTGGTTGGGACTTTATGT
TAAAAACCTTGTATAAGGATGTAGATAATCCTCACTTGATGGGTTGGGATTACCCCAAGTGTGATCGCGC
TATGCCTAATATGTGTAGAATCTTTGCATCTCTCATATTAGCCCGTAAACATAGTACTTGTTGTACTAAC
ACTGATAGATTTTACCGCTTAGCAAATGAGTGCGCTCAAGTGCTTAGTGAGTATGTCCTTTGTGGCGGTG
GTTATTACGTCAAACCTGGTGGGACCAGTAGCGGCGATGCAACCACAGCTTACGCCAATAGTGTTTTTAA
CATTCTGCAGGCGACTACCGCGAATGTTAGTGCACTTATGGGCGCTAATGGCAACACTATTGTTGACGAG
GAAGTTAAGGATATGCAGTTTGAGCTGTATGTAAATGTTTACAGAAAGAGCCAGCCTGATCCTAAATTTG
TGGACAGGTATTATGCCTTTCTGAATAAGCACTTTTCCATGATGATACTGTCTGACGATGGTGTCGTATG
CTATAATAGTGACTATGCCACTAAAGGTTATATCGCATCCATTCAAAACTTCAAGGAGACTCTGTATTAT
CAGAATAATGTCTTCATGTCAGAGGCTAAATGCTGGGTGGAAACCGATTTGAAGAAAGGTCCACATGAGT
TTTGCTCACAGCATACACTTTTCATAAAGGATGGTGACGATGGTTACTTCCTACCTTATCCAGACCCCTC
AAGAATACTGTCTGCCGGTTGCTTCGTCGATGATATCGTCAAGACTGACGGTACGCTCATGGTTGAGAGA
TTCGTGTCATTGGCAATAGACGCTTATCCTCTCACGAAGCATGATGATCCTGAATACCAAAATGTATTCT
GGGTGTATTTACAGTATATAGAAAAACTGTACAAAGACCTCACAGGACACATGCTTGACAGTTATTCTGT
CATGCTATGTGGTGATAATTCAGCTAAATTCTGGGAAGAGAGCTTTTATAGAGATCTCTATACTGCTCCA
ACCACACTTCAGGCTGTCGGATCTTGTGTCGTGTGCCACTCTCAGACGTCGCTTCGTTGTGGTACGTGTA
TACGAAGACCCTTCCTTTGCTGTAAGTGTTGTTATGACCATGTCATAGCTACACCTCATAAAATGGTTCT
GTCTGTGTCACCTTATGTCTGTAACGCTCCAGGTTGTGACGTTGCAGATGTTACTAAACTGTATTTAGGC
GGTATGAGCTACTTCTGTATCGACCACCGCCCTGTATGCAGTTTTCCGCTCTGTGCAAACGGCCTTGTGT
TTGGTTTGTACAAGAATATGTGCACTGGTAGCCCATCTGTTACGGAATTTAACAGATTAGCTACTTGTGA
CTGGACTGAAAGTGGTGACTACACGTTGGCTAATACCACTACAGAACCACTAAAATTATTTGCGGCTGAA
ACACTTAGAGCAACTGAAGAAGCCTCTAAACAGTCGTACGCTATTGCTACTATCAAAGAAATAGTAGGTG
AGCGTGAATTGTTGCTCGTGTGGGAAGCTGGAAAAGCCAAACCACCACTCAATCGCAACTATGTTTTCAC
TGGTTATCATATAACCAAGAATAGTAAAGTCCAGCTCGGTGAGTATGTCTTCGAGCGCATAGACTATAGT
GATGCTGTCTCCTACAAGTCTAGTACTACGTATAAGCTAGCAGTCGGAGACATCTTTGTTCTTACCTCTC
ACTCGGTGGCCACCCTGCAGGCGCCCACAATTGTGAATCAAGAGAGGTATGTAAAAATAACTGGATTGTA
TCCAACTCTTACTGTACCTGAGGAATTTGCCAATCATGTTGCGAATTTTCAGAAAGCAGGTTTTAGTAAA
TTTGTCACCGTTCAGGGGCCCCCTGGCACCGGCAAGAGTCATTTTGCTATTGGGTTAGCGATTTACTACC
CAACAGCAAGAGTTGTTTACACAGCTTGCTCACACGCAGCCGTAGATGCATTGTGTGAGAAAGCTTTTAA
GTACCTGAACATTGCAAAATGTTCACGCATTATACCTGCGAAAGCACGTGTTGAGTGCTATGACCAGTTT
AAAGTTAATGAAACAAATTCTCAGTATTTGTTCAGTACTATTAATGCCCTACCAGAAACGTCTGCTGATA
TACTGGTGGTGGATGAAGTTAGTATGTGCACTAATTATGATCTCTCAGTGATTAATGCACGTATTAAAGC
TAAACACATCGTGTATGTTGGTGATCCAGCCCAGCTGCCTGCACCACGCACCTTGCTTACTCGGGGCACA
TTGGAACCGGAAAATTTCAATAGTGTAACCCGTTTAATGTGTAACTTGGGACCAGATATCTTTCTGAGTG
TTTGCTATCGGTGTCCTGAAGAAATAGTTAACACTGTGAGTGCGCTCGTCTACAACAATAAGCTTGTAGC
AAAGAAGCCGGCCTCAGGACAGTGTTTCAAAATTCTGTATAAGGGCAGTGTTACACATGATGCTAGCTCC
GCCATTAACAGACCTCAGCTTAACTTTGTTAAGTCTTTTATTGCTGCTAACCCTAATTGGAGTAAGGCAG
TTTTTATCTCTCCTTACAATAGTCAAAATGCTGTCGCCCGCTCAGTGTTGGGTTTGACTACGCAGACTGT
TGATTCATCACAGGGTTCTGAATACCCATACGTCATCTTTTGCCAAACTGCTGACACTGCTCACGCAAAC
AACATTAACAGATTTAATGTTGCAGTTACGCGTGCGCAGAAGGGTATTCTTTGCGTCATGACTTCTCAAG
CACTCTTCGATTCGCTCGAGTTTGCTGAGGTTTCTCTTAATAACTACAAGCTTCAGTCACAGATAGTAAC
GGGCTTGTACAAAGATTGCTCCAGAGAGTCATCTGGACTTCATCCTGCTTATGCGCCAACCTATGTTAGT
GTTGATGATAAGTATAAGACTAGTGATGAGCTTTGCGTGAACCTGAATGTACCCGCAAATGTTCCTTATT
CAAGAGTCATTTCAAGAATGGGTTTCAAGCTAGATGCATCGATACCCAACTACCCAAAACTCTTCATTAC
ACGTGATGAGGCTATAAGGCAAGTCAGAAGCTGGATAGGCTTCGACGTTGAAGGTGCCCATGCATCGCGT
AATGCATGTGGTACTAACGTGCCTTTGCAACTTGGCTTTTCTACTGGTGTGAACTTTGTTGTTCAGCCCG
TGGGTGTAGTTGATACTGAGTGGGGGAGCATGTTGACGAGCATCGCTGCGCGCCCTCCTCCCGGTGAACA
ATTTAAGCATTTGGTGCCTCTTATGAATAAAGGAGCCGCCTGGCCAATTGTAAGAAGACGTATTGTTCAG
ATGCTTTCAGACACTTTGGATAAATTGTCTGACTACTGTACGTTTGTTTGTTGGGCTCATGGCTTTGAGT
TAACGTCTGCATCCTATTTTTGCAAGATAGGTAAGGAGCAACGGTGTTGTATGTGTAATCGTCGCGCTTC
GACGTACTCTTCACCGTTACACTCTTATGCCTGCTGGAGTCATTCTAGCGGATATGACTATGTCTATAAC
CCATTCTTTGTAGATGTACAACAATGGGGATATATAGGCAATTTAGCGACTAATCACGACCGCTACTGTA
GTGTTCATCAGGGAGCCCACGTTGCCTCTAATGATGCAGTAATGACTCGTTGTTTAGCCATTCATGATTG
TTTTATTGAACGTGTTGAGTGGGATATCACGTATCCTTATATCTCACATGAAAAACGTCTTAATTCCTGT
TGTAGGGCAGTTGAACGCAATGTCGTACGCGCAGCTCTCCTTGCTGGCAGATTCGAAAGAGTCTACGATA
TTGGCAACCCTAAAGGAATTCCTATTGTTGATGACCCTGTTGTTGATTGGCATTATTATGATGCACAGCC
ACTGAGTAAGAAAGTTCAGCAGTTGTTCTACACAGAAGACTGCGCTAAAAACTTCTCAGATGGACTCTGC
TTATTCTGGAACTGTAATGTTCCAAGATATCCTAATAATGCTATAGTATGTAGGTTTGACACACGTGTGC
ACTCAGAATTCAATTTGCCCGGTTGTGATGGTGGCAGCTTGTACGTTAACAAGCATGCCTTCCACACACC
TGCATATGATGCTAGTGCATTCCGTGATCTGAAACCTCTGCCCTTCTTCTACTATTCCACAACACCATGC
GAAGTGCATGGTAATGGTAATATGTTAGAGGACATTGATTACGTACCACTTAAGTCTGCAGTATGTATAA
CTGCATGTAACCTTGGTGGTGCTGTCTGCCGTAAACATGCTGCTGAATACAGGGATTACATGGAAGCATA
TAATCTCGTATCAGCATCTGGTTTTAGACTGTGGTGTTATAAGACCTTTGATGTCTATAACCTCTGGTCA
ACCTTCACTAAAATTCAAGGTCTCGAAAACATCGCCTACAATGTTATTAAACAAGGTCACTTTACTGGTG
TCGAAGGTGAGTTGCCCGTCGCTGTGGTTAACGACAAAATCTACACCAAAAGTGATGTTAATGATGTGTG
CATCTTCGAAAATAAGACCACACTTCCTACTAATATTGCATTTGAACTGTATGCTAAAAGAGCTGTTCGC
TCGCATCCAGATTTCAATTTGCTACGTAATTTAGAAGTAGATGTCTGCTATAAGTTTGTGCTCTGGGATT
ACGAGCGTAGCAACATCTATGGTAGTGCAACTATTGGTGTATGCAAGTACACTGATATTGATGTCAATTC
AGCACTGAATATATGTTTTGACATTCGTGATAATGGCTCATTGGAAAGATTCATGTCTTTACCAAATGGC
ATCCTTATATCCGATCGCAAGGTGAAGAATTATCCTTGCATCGTTAGTTCTAACTATGCTTACTTCAATG
GCACACTGATAAGAGACAACACTGGTAACTCTCAAAGTAGCGATGGTGAAGTAAAGCAACCTGTAACATT
CTACATTTACAAGAAAGTCAATAATGAGTTCGTACAGTTCACTGATACGTACTACACTCTTGGTAGAACA
GTTTCCGATTTCACACCTGTTAGTGAAATGGAAAAGGACTTTCTCGCTCTTGATAGCGATGTTTTTATCA
AGAAGTATAAGCTAGAAGCTTATGCTTTTGAGCATGTGGTTTACGGTGATTTTTCACGTACCACATTAGG
TGGCCTCCATCTTCTTATTGGCTTATATAAGAAGCATCAAGAAGGTCACATTATCATGGAGGAAATGCTT
AAAGAAAGAGCTACCGTCCATAACTATTTTGTTACTGAATCGAACACAGCATCGTTCAAAGCGGTCTGTT
CGGTTATTGATTTAAAGCTTGACGACTTCGTTGACATTATAAAGGCAATGGACCTTAGTGTCGTTTCAAA
AGTCGTCAAGATTCCTATTGACTTAACTATGATTGAGTTTATGCTATGGTGTAAGGATGGTCAGGTGCAA
ACCTTTTACCCGAGACTTCAGGCTATCAATGATTGGAAGCCAGGTCTTGCAATGCCTTCACTATTTAAAG
TTCAAAACTCAAACCTTGAACCATGTATGCTGCCTAATTACAAGCAGTCAATCCCGATGCCGCAAGGCGT
CCATATGAATATAGCAAAATATATGCAATTGTGCCAGTATCTGAATACATGCACAATTGCAGTACCTGCC
AATATGCGAGTCATGCATTTTGGTGCTGGATCTGACAAAGGCGTCGCTCCTGGCTCCTCAGTTCTACGAC
AATGGCTTCCGACGGATGCCATCTTAATTGATAATGACCTAAACGAGTATGTGTCCGACGCGGATATTAC
TCTTTTTGGCGACTGCGTTACTGTGCGTGTTGGACAACAAGTAGATTTACTAATTTCCGACATGTACGAT
CCATCCACTAAAGTAGTAGGTGAAACAAATGAAGCAAAGGCGCTTTTCTTTGTGTATCTCTGCAACTTTA
TTAAAAATAACCTAGCTCTTGGAGGGTCCGTTGCGATAAAAATAACGGAACACTCATGGAGCGCAGAATT
ATATGAATTAATGGGAAGATTTGCATGGTGGACTGTGTTTTGTACCAATGCAAATGCATCCTCATCTGAG
GGATTTCTCATCGGAATAAATTACTTAGGAGAGCTAAAAGAAGTTATAGATGGTAATGTGATGCACGCCA
ACTATATATTCTGGCGTAATACTACTTTAATGAACCTGAGTACTTACTCTCTCTTCGATCTCTCGCGCTT
TCCTCTTAAATTAAAAGGAACACCAGTTCTTCAATTAAAAGAGAGCCAAATTAACGAACTTGTGATCTCT
CTCTTGTCGCAGGGCAAGCTTATTATTCGCGACAATGATACGCTCAGTGTTAGTACTGATGTGCTCGTTA
ACTTTTATAGGAAACCTCACAAGAGGTCAAAGTGTTGATATGGGACACAATGGCACTGGTTCATGTTTAG
ATTCCCAGGTACAACCTGATTATTTTGAATCTGTGCATACTACTTGGCCCATGCCTATTGACACGAGTAA
GGCTGAAGGTGTCATTTATCCTAATGGCAAGTCCTACTCTAATATTACTCTAACTTATACGGGACTGTAC
CCCAAGGCTAATGACCTTGGTAAACAGTATTTATTCTCTGACGGACATAGTGCCCCAGGACGTCTTAATA
ACTTATTTGTCAGTAATTACTCCTCACAAGTGGAGTCCTTTGATGATGGCTTTGTGGTCCGTATTGGTGC
TGCTGCCAATAAAACTGGAACCACTGTCATATCTCAATCCACATTTAAACCCATTAAGAAAATCTATCCA
GCCTTTTTGCTTGGACATTCTGTGGGTAATTATACACCGTCCAATAGGACAGGTCGTTATCTCAACCACA
CGCTTGTCATCCTACCGGATGGCTGTGGTACTATTTTACATGCATTCTATTGTGTTCTTCACCCTCGCAC
ACAACAAAATTGTGCTGGTGAAACAAATTTCAAATCCCTCTCGCTTTGGGATACTCCTGCATCAGACTGT
GTCTCTGGTTCTTATAACCAAGAAGCCACATTAGGTGCTTTCAAAGTGTATTTTGACTTGATTAATTGCA
CGTTCAGATACAATTATACTATAACAGAGGATGAAAACGCTGAGTGGTTCGGCATTACCCAAGACACACA
AGGCGTTCACCTCTATTCATCTCGAAAAGAGAACGTGTTCAGAAATAACATGTTCCACTTTGCTACTTTA
CCTGTGTACCAGAAAATCCTCTATTACACAGTCATTCCTCGCAGCATCCGAAGTCCTTTCAATGACAGAA
AAGCCTGGGCTGCATTCTACATTTATAAACTACATCCACTCACATATTTGCTAAATTTTGATGTGGAGGG
CTATATAACTAAAGCTGTAGACTGTGGCTACGATGATCTAGCACAGCTACAATGTTCCTACGAATCCTTC
GAAGTCGAAACAGGCGTTTATTCCGTTTCATCGTTCGAAGCTTCTCCTAGAGGTGAGTTCATTGAACAGG
CAACAACTCAAGAGTGTGATTTCACACCTATGTTGACTGGTACACCTCCTCCTATATATAATTTCAAAAG
GTTGGTCTTCACCAATTGCAATTACAACTTAACAAAACTCCTTTCACTGTTTCAAGTGAGCGAGTTTTCT
TGTCATCAAGTTTCACCTAGTAGTCTTGCTACCGGTTGTTACTCTTCTCTTACAGTGGACTATTTCGCTT
ATTCCACTGATATGAGTTCTTACCTGCAACCTGGCTCCGCTGGAGCAATTGTGCAGTTTAATTACAAACA
AGACTTTAGCAATCCCACGTGTAGAGTGCTTGCTACTGTTCCACAAAATCTTACTACAATTACTAAACCT
AGTAATTATGCTTATCTTACAGAGTGTTATAAAACCAGTGCATATGGCAAGAATTACTTGTACAATGCGC
CTGGCGCTTACACTCCTTGCTTATCTTTAGCCTCTCGTGGGTTCTCTACTAAATACCAGTCACATAGTGA
TGGCGAGCTAACCACTACTGGTTACATTTATCCTGTCACTGGAAATCTTCAAATGGCTTTCATAATTTCT
GTTCAGTATGGAACTGACACTAACAGTGTCTGCCCCATGCAAGCATTAAGAAATGATACTAGCATTGAAG
ATAAGCTAGACGTTTGTGTTGAATACTCGCTCCATGGTATAACTGGAAGGGGGGTTTTCCACAATTGCAC
ATCTGTTGGACTGAGAAACCAGCGGTTTGTGTATGATACTTTCGACAATTTAGTTGGTTACCATTCTGAC
AATGGTAATTACTATTGTGTCAGACCTTGTGTCAGTGTGCCTGTCTCTGTGATTTACGACAAGGCATCTA
ATTCTCATGCTACATTATTCGGAAGCGTTGCATGTTCGCACGTTACCACAATGATGTCGCAATTTTCACG
CATGACCAAAACTAATTTGCTCGCGCGTACAACTCCAGGTCCATTGCAAACTACTGTTGGTTGTGCAATG
GGCTTTATCAATTCCTCAATGGTAGTTGACGAATGTCAACTTCCGCTTGGTCAATCACTTTGTGCTATTC
CACCAACTACTTCTTCACGCGTTCGACGTGCTACTTCTGGTGCATCTGATGTGTTTCAAATCGCCACTCT
TAACTTTACTAGTCCATTAACACTCGCACCAATAAATTCTACTGGATTTGTTGTTGCTGTGCCGACTAAT
TTCACATTTGGTGTCACTCAAGAATTCATTGAGACTACCATTCAAAAGATTACTGTCGATTGCAAGCAGT
ACGTTTGTAATGGTTTTAAGAAGTGCGAAGACTTGCTCAAAGAATATGGCCAGTTTTGCTCTAAAATTAA
CCAGGCTCTTCATGGTGCAAACCTACGTCAAGACGAGTCTATTGCTAATCTATTTTCAAGTATTAAAACC
CAGAATACCCAGCCTCTTCAGGCGGGATTGAATGGTGATTTTAACTTGACTATGCTTCAAATACCTCAAG
TTACTACAGGTGAACGTAAGTACAGGAGTACTATCGAAGACCTTCTTTTCAATAAGGTTACTATTGCTGA
TCCTGGCTATATGCAAGGCTATGATGAATGTATGCAGCAAGGTCCTCAGTCAGCTCGAGACTTGATCTGT
GCACAATATGTTGCTGGCTACAAAGTGCTGCCACCCTTATATGACCCCTATATGGAAGCTGCTTACACTT
CTTCCCTATTGGGCAGTATTGCTGGTGCTAGTTGGACAGCAGGTCTGTCGTCTTTCGCAGCAATACCATT
TGCACAAAGTATCTTTTATCGCTTGAATGGTGTTGGCATCACTCAGCAGGTTCTGTCTGAGAATCAGAAG
ATCATTGCCAACAAATTCAATCAAGCTCTTGGTGCCATGCAAACTGGCTTTACTACTACTAACCTTGCTT
TCAACAAGGTTCAGGATGCAGTAAATGCTAATGCAATGGCTCTTTCCAAACTAGCTGCGGAATTGTCTAA
CACTTTCGGTGCTATTTCATCATCAATCAGTGACATCCTTGCAAGGCTTGACACTGTTGAACAAGAGGCT
CAAATTGATCGGTTGATCAATGGACGTCTTACATCCCTTAACGCATTCGTTGCGCAACAACTCGTGCGTA
CTGAAGCTGCTGCTAGATCTGCCCAATTGGCTCAAGATAAGGTCAATGAGTGCGTGAAGTCGCAATCCAA
ACGGAATGGATTCTGCGGAACTGGCACACATATTGTTTCATTTGCCATTAATGCTCCTAATGGCCTCTAC
TTCTTCCATGTTGGTTACCAGCCAACATCCCATGTCAATGCAACTGCCGCTTATGGCCTTTGCAACACTG
AAAATCCACAAAAGTGCATTGCACCTATTGATGGATACTTCGTCTTAAACCAAACTACCAGCACTGTCGC
AGACAGTGACCAACAATGGTATTATACTGGTAGTTCCTTCTTCCATCCTGAACCCATCACAGAAGCAAAT
TCTAAGTATGTGTCCATGGATGTAAAATTCGAAAACCTCACTAATAGGCTTCCTCCACCGCTCCTTAGTA
ATTCAACAGATTTGGATTTCAAGGAAGAGCTGGAAGAATTCTTCAAAAACGTCTCCTCACAAGGACCAAA
CTTCCAGGAGATTTCTAAGATTAACACTACACTGCTTAACCTCAACACAGAGTTGATGGTGCTGAGTGAA
GTTGTTAAACAATTAAATGAATCCTATATCGACTTGAAAGAGTTGGGGAATTATACTTTTTACCAAAAAT
GGCCATGGTATATATGGCTTGGCTTTATTGCAGGGCTTGTTGCTCTTGCTCTTTGTGTGTTCTTCATCTT
ATGCTGTACTGGCTGTGGTACTAGCTGTTTGGGGAAACTAAAATGTAATCGTTGTTGTGACTCGTATGAT
GAGTATGAGGTCGAGAAGATCCATGTTCATTGAGCATTTTAACGAACTTATGATGCGTGTGCAAAGACCA
CCCACACTCTTGCTCATTTTATTAGTTGCTAATGCTTTCTCAAAGCCCATTGGCACTCCTATGCCTGAGC
ACTGTTCTACCCTTGTTGGTAGAGAGTTTCAATCTTGTATTCGACAAGCACAGTTTGATACGGCTGGCAT
GTACACTAATCGCGTCATCGTGCTCGATCGAGCACGTACTCATCGCTATCCTATTGATCGTGACACTACT
ACTGCTCACGACACCTCTTACGACACTTCTGACCCTCAGTTGCTGTCTGATATTGGTTACTCCTTTGATT
ATGGGAAGTAATTAACGAACTTCATGGATTACGTGTCGCTGCTCAACCAGGTTTGGCAGAAACAGGTTAA
TTCCTCTCAAGAAGGAACTTTGGCTCCTGTTCGCCCTACATACGCCTATCGGCCAGTGCAGGGAAATCTT
CAGTGTCCTATCAAGTGGCGTTGCATTTACACTTTTGCAGGCTACACAGGTACTGCAACTGAGCCAACTA
AAGTATTAGCAAAACAAGAAGCCGCTAGGAAGGTTTGCCTTAGGCTTCAAGAGTATGGACGACTCGATGG
ATTTGGACTTAGACTGCGTTATAGCACAGCCTTCGAGCACAATCGTTATGATGCCTCTAAGTCCTATTTC
TACACGCAAACGTCGTCGTCATCCCATGAATAAAAGACGCTACGCTAAGCGCCGTTTTACTCCTGTAGAG
CCAAACGATATTATAATGTGTGATAAACCCACACATTGTATTCGCTTGGTTTTTGATCAATCATTACGCT
GGGTGCATTTTGATGGTATCAAAAACATCCTCACTGATTATGATGTTATTTTTAACCCTGATTTACACGT
TACTGTTGCTTTAGTTTGTGCAGGTAATGGTGTTACATTCAGTGATCTCACACCACTAACATTCATTCTA
GCTGACATGCTGCTTGAATTTAATGGTATCTTTACTTTGGGACAGACTTTGGTCATTGGTGCTCGTGAGT
ACCATTGGCTACCACAAGAGCTTAAAACTAATGTGGGCAAAGCTATCCCTCAGGCTAAAGAATGGCTTGT
AGATCATGGCTACAACGTGTACCATACAGGCCTTCCTACTCATATGTCGCTTGCAAAGCTTCATTCACTT
GACTTCGTCCAACAATCATATGTTGGCAGTAAGTTCTTTATTAAGCATTCTCATACCACTGAATATGCTA
TGCCCGTTTGTTTACAGGTAATAGCTATTGATGGTGAGAAAGTTGATGGTCGATCGAAACCCCTGTTTCA
GTATCCCATCCATAATCATTACAGACACTATCGTGCCTGCTTTCCTGGCCGCTAAACGAACTTATGGCTT
TTTCGCCATCCCTGTTTCAGCCACTTGTCATCCAAAAGGAGACACACGGTGGTGAACCTAGCAGCCCTAA
TCATGTCATCGCATGCATACCTCTTACAGGCTATGTTGCCGCTCTTGTGGTTAATGCATGCTTTTACCCT
CTACTATTCTGCTTACCTTATAGCAGTTGTAGGGCTAGTGTATGTAAGACCTTGGTACTCTATGTGCTGA
TGCTTTACAATTTCATTTTGTCGTGTATCCTAGTTGAGGACACACAACAACCTGTTGGCATATGCCTTAT
GGTATATTGCATAATATTAATGGCGATCTGGACTATCGACAGAGTTCGATTTTGTCTGCTGATCAGATCA
TTACGTCCACTTATTGACATGAGGTCAAATTTCATCCGTGTCAATACTGTTGCAGGCGGGGTTGTTATAC
CTGTTAACTATAGCAAACCCTGGTTTGTCAAAAATTTTAACCAGCGTTGTCGCTGTACAAATTGTTTCTT
TGCGCACTCAGCAACCTATCTCGAGTGCACATTTATAAGCCGTTTCTCTAAAACCACTCTTGTTTCCATT
AGTGACTTTCAGCTTAACGGTTCTCATTCAACTGTTTTCGTGCCTTTCAATAGCCGCGATTCAGTACCTC
TTCACATAATCGCACCCAGCGTGCTTACAGTTTAAGCTCGCTTCGCGCTGCTATGGGTCCCATGTTGAGG
CTAATCCATTTAGTCTCACTTTGGACATTTGGAAAACGAACTATGTTACCTTTTGTCCAAGAACAAATAG
GTGCATTCATAGTAAATTTTTTCATATTATCCGTAGTTTGTGCTGTAACACTCGTTGTGTGTCTAGCAAT
CCTTACGGCTATTCGATTATGTGTGCAGTGTGTTTCTGGTTGTCATACATTAGTATTTCTACCAGCTGTT
CATATTTATAATACAGGGCGTGCAGCCTATGTAAAGTTCCAAGAGAGCCATCCACCCTATCCCCCTGAGG
ACTGGGTTTAACGAACTCTCTAAATATGGCGTCTAGCAATGTTACCCTCTCTAATGATGAGGTTCTCAGG
CTTGTTAAAGACTGGAATTTCACCTGGTCGGTGGTCTTCCTGCTCATTACAATCGTGCTCCAATATGGCT
ACCCATCTAGGAGCATGTTTGTCTACGTCATCAAGATGTTTGTATTATGGCTACTTTGGCCAGCATCAAT
GGCACTATCTATATTTTGTGCTGTCTATCCAATTGATCTAGCTTCCCAGATAATCTCTGGCATACTAGCT
GCAACAAGCTGCGCGATGTGGATCTCCTACTTCGTGCAAAGCATTCGGCTGTTTATGCGTACTGGCTCTT
GGTGGTCTTTCAACCCTGAGTCTAACTGTCTACTTAATGTTCCCATCGGAGGCACCACTGTTGTGCGACC
ACTTGTTGAAGACTCGACCAGTGTCACTGCTGTGGTCACTGATGGCTACCTTAAGATGGCAGGCATGCAT
TTTGGTGCTTGCGACTTTCAACGTCTACCCTCTGAGGTGACGGTCGCAAAACCAAATGTGCTGATAGCCC
TGAAAATGATTAAACGCCAAGCGTATGGTACAAATTCTGGTGTTGCTATTTATCATAGGTATAAGGCAGG
CAACTATAGGAGGCCGCCCATTATACAAGACCAAGAACTCGCACTGCTAAGGGCTTAATTGCTCTAGTAA
GAGACAGATTTTTAACGAATCTTATTATCTCATTGTTATGGCTACTCCTGCTCCTCCTCGTGCAGTAGTG
TTCGCTAATGACAATGAAACCCCTACCAACAGTCAGCGTTCAGGGCGTCCAAGAACTAAGCCCAGACCTG
CCCCTAATACCACTGTCTCATGGTTCACGGGCCTTACCCAGCACGGTAAGCAGCCTCTTGCCTTCCCTCC
TGGACAGGGCGTACCTCTTAATGCCAATTCAACCCCTGCACAGAATGCTGGGTATTGGCGGAGACAGGAC
AGGAAAATTAACACTGGAAATGGAACAAAACCTCTGGCACCCAGGTGGTATTTCTACTACACTGGAACAG
GACCTGAGGCAAATCTCCCTTTCAGATCAGTCAAGGATGGAATCATCTGGGTCCATGAAAACGGTGCCAC
AGATGCTCCTTCGGTTTTTGGGACACGCAACCCTGCAAACGATCCAGCTATCGTCACGCAGTTTGCTCCT
GGTACTACGCTACCTAAAAACTTCCACATCGAAGGCACTGGTGGCAATAGTCAGTCATCTTCGAGAGCCT
CCAGCAGAAGCTCATCTAGATCTAGTTCAAGAAACGGAAGAAGTAACAACAGTTCCCGCAATGCTTCCCC
AGCTCCACATGGAGTCGGAGATGTAGTGGGTGCTGGAACTCTTTCAGTTCTTTTAGACTTGCAGAAGAGG
CTTGCCGATTTGGAAGCTGGTAAGGGTAATAAGCAACCTAAAGTCATCACCAAAAAGGATGCACAGGCTG
CCAAACAAAAGATGCGCCACAAGCGCGTCGCCACCAAAGGATACAATGTAGTCCAGGCTTTCGGAATGAG
AGGTCCTGGTCCGCTGCAGAGTAACTTTGGTGACATGCAATACAACAAGCTTGGCACTGAAGACCCACGT
TGGCCTCAAATTGCTGAACTTGCTCCCTCAGCATCTGCTTTCATGAGTACCTCCCAATTTAAGGTTACTC
ATCAGAGCAATGATGAAAATGGTGAACCGGTGTACTTCCTAAGTTACTCGGGCGCCATAAAATTAGACCC
AAAGAATCCCAACTACAACAAGTGGATGGAGATTCTTGACGCAAATATTGATGCTTACAAATCCTTCCCC
AAAAAGGAGCGAAAGCAAAAACCAAGTGGTGATGATGCTGCAACAGCACCAGCCACATCTCAGATGGAAG
ATGTCCCTGAACTGCCTCCTAAGCAACAGCGCAAGAAACGCGTTGTCCAAGGCAGTATCCCCCAACGTTC
AGCAGGCGTGCCTAGCTTTGAGGACGTTGTGGATGCCATTTTCCCCGATTCAGAGGCATAAATTGCCAAT
TGAACGTAACAAGAGTCGAGGCGATCGCTAGTGTTCTGGAAACCCCATTACATGATGCAATTGTCCACTC
TTGCACAGAATGGAATCATGTTTTACTTACAGTGCAAGAAGGTAAGTGAACCCATTTAATTGATAGCTGT
CATTTTAGTAAAGTGTGTAGCTATAGAGAGAAGTTTAAAGACTGTCACCTCTGCGAGATTGCAAGTGAAC
AGTGCCCCCTGGGAAGAGCTCTATAGTGTGAAATGTAAATAAAAACAGCTATTATTCAATTAGATTAGGC
TTTTTAGATGATTTGCAAAAAAAAAAAAAAAA

>gi|126030112|ref|NC_009019.1| Bat coronavirus HKU4-1, complete genome
GATTTAAGTGAATAGCCTAGCTATCTCACCCCCTCTCGTTCTCTTGCAGAACTTTGATTTTAACGAACTT
AAATAATAGCCTTGCTGTGTGCGTGTTGTGTTGTGGTCTGCAGCGTTTAGGCGCCGGGCTTCAAGCTTCA
TGCTCAACACTGGGCATAATTAAATATACTAAATAATAATATTTTTCATTCTGAGCTATCGTGTCTCTTG
TACTTCTCGGTCACAATACCCTGTTCCGTCAGGTGCGTGGCAATCCGGGGCATACTATGCTTTCCAAGGC
TAGTGTGACCACGCAAGGTGCGCGTGGTAAGTATCGAGCAGAGCTCTATAATGAAAAAAGAAGTGACCAT
GTTGCTTGCACAGTACCACTTTGTGATACTGATGACATGGCTTGTAAGCTCACACCATGGTTTGAAGATG
GGGAAACTGCCTTCAACCAAGTGAGTTCTATTCTTAAAGAAAAAGGTAAAATCCTTTTTGTCCCAATGCA
TATGCAGAGGGCTATGAAGTTTCTCCCAGGCCCACGTGTTTACCTGGTAGAGAGACTTACTGGAGGTATG
CTTTCAAAGCATTTCCTTGTTAACCAATTGGCTTACAAAGATCAAGTTGGTGCCGCAATGATGCGCACCA
CATTGAATGCTAAGCCTCTCGGTATGTTCTTTCCATATGATTCAAGTTTGGAGACTGGTGAATACACTTT
TCTCCTACGTAAGAATGGTCTTGGAGGACAACTTTTCCGTGAACGACCATGGGATCGTAAGGAAACACCT
TACGTGGAAATTTTAGATGATCTTGAGGCTGACCCTACTGGTAAGTACTCACAGAATCTTCTTAAGAAGT
TGATTGGTGGTGATTGTATCCCAATCGACCAATATATGTGTGGCAAAAACGGTAAACCTATTGCTGATTA
TGCCAAAATAGTAGCTAAGGAAGGGTTGACCACCTTGGCTGACATTGAAGTTGATGTTAAATCTCGTATG
GATTCAGATCGCTTCATTGTATTAAACAAAAAATTGTACCGTGTTGTTTGGAATGTTACACGTCGTAATG
TGCCATATCCCAAACAAACGGCTTTTACTATTGTGAGTGTTGTTCAGTGTGATGACAAAGATTCTGTTCC
TGAACATACATTTACTATTGGTTCACAAATTCTTATGGTGTCACCTCTAAAGGCCACTAATAATAAGAAT
TTTAATCTTAAACAGCGTTTGCTCTATACTTTTTATGGAAAAGATGCTGTTCAACAACCAGGTTACATTT
ACCACTCTGCTTATGTTGATTGTAATGCATGTGGTAGGGGTACGTGGTGTACTGGGAATGCTATACAGGG
CTTTGCTTGTGATTGTGGTGCTAATTATAGTGCCAATGATGTTGATTTGCAATCTTCAGGTCTAGTACCT
AGGAATGCGTTGTTCTTGGCTAATTGTCCTTGTGCTAACAATGGTGCATGCAGCCATAGTGCAGCACAGG
TTTACAACATCTTAGATGGTAAAGCTTGTGTTGAAGTTGGTGGAAAGTCTTTCACTTTAACCTTTGGTGG
CGTTGTTTATGCTTACATGGGTTGTTGTGATGGTACTATGTACTTTGTTCCTCGTGCTAAATCTTGTGTC
TCACGCATAGGTGATGCAATCTTTACTGGTTGCACAGGCACTTGGGATAAAGTTGTTGAGACAGCAAATC
TGTTTCTCGAAAAAGCCCAGCGTTCTCTTAATTTCTGTCAGCAGTTTGCTCTTACAGAGGTTGTTTTAGC
AATACTGTCTGGTACGACATCTACTTTTGAAGAGTTGCGTGACTTGTGTCATAATGCGAGTTATGAAAAG
GTGCGTGACCATTTAGTAAACCATGGCTTTGTGGTCACAATTGGTGATTATATTAGAGATGCAATTAATA
TAGGTGCAAATGGTGTTTGCAATGCTACTATTAACGCTCCTTTTATCGCCTTCACTGGTCTTGGTGAGTC
ATTTAAAAAAGTTTCTGCAATACCATGGAAAATTTGCAGTAATCTTAAAAGTGCCTTAGACTACTATAGT
TCTAATATTATGTTTAGGGTTTTTCCTTATGACATACCTTGCGATGTCAGTAATTTTGTAGAGCTGCTGT
TAGATTGTGGTAAACTTACAGTGGCTACTAGTTACTTCGTACTCCGTTATTTGGATGAGAAGTTTGATAC
AGTTCTTGGCACTGTTAGTAGTGCATGTCAAACTGCCCTGAGTAGTTTTCTTAATGCCTGTGTAGCAGCG
TCGCGTGCTACTGCAGGCTTTATTAATGACATGTTCAAATTGTTTAAAGTGCTCATGCATAAGCTATATG
TCTACACTAGTTGTGGCTATGTAGCTGTTGCTGAACATTCTTCTAAAATTGTACAACAAGTGCTCGACAT
TATGTCTAAGGCAATGAAGTTGTTGCACACTAATGTTTCCTGGGCAGGTACTAAATTATCTGCCATTATT
TATGAAGGCCGTGAAGCCCTTTTGTTTAATAGTGGAACATATTTTTGTCTTTCCACTAAAGCCAAAACAT
TACAGGGTCAAATGAATCTTGTTTTGCCAGGCGATTATAACAAGAAGACTTTAGGTATTCTTGACCCTGT
TCCCAATGCAGACACTATTGACGTTAATGCCAATAGTACAGTTGTAGATGTTGTGCATGGTCAATTAGAA
CCAACTAATGAGCATGGTCCCAGCATGATTGTAGGGAACTATGTACTCGTTAGCGACAAATTGTTTGTTC
GCACTGAGGACGAAGAATTTTATCCTCTTTGCACTAATGGTAAAGTTGTGTCTACCTTGTTTAGACTTAA
GGGTGGCATGCCTTCTAAAAAAGTTACATTCGGTGATGTTAATACCGTTGAAGTAACTGCTTATCGTAGT
GTATCGATTACATATGATATTCATCCAGTTCTTGATGCATTACTTAGTAGCTCAAAGTTAGCTACTTTTA
CAGTTGAGAAAGATCTTCTAGTTGAAGATTTTGTTGATGTCATCAAGGATGAGGTATTAACATTGCTTAC
ACCTTTGCTCCGTGGTTATGATATCGATGGTTTTGATGTAGAAGATTTTATTGATGTACCATGCTATGTT
TATAACCAAGATGGTGACTGTGCATGGAGTTCTAATATGACCTTTTCTATTAACCCTGTTGAGGATGTAG
AGGAGGTTGAAGAATTTATAGAAGATGATTATCTTTCTGATGAGCTGCCTATTGCTGATGATGAAGAAGC
TTGGGCTCGCGCTGTAGAAGAAGTCATGCCTTTGGATGACATTCTAGTAGCTGAAATTGAGTTGGAAGAA
GACCCACCACTGGAAACCGCCTTGGAAAGTGTGGAAGCTGAAGTAGTTGAAACAGCCGAAGCACAAGAAC
CAAGTGTAGAGTCAATAGACTCTACCCCTAGCACTTCTACAGTAGTAGGTGAAAATGACTTGAGCGTTAA
GCCCATGTCACGTGTAGCTGAAACTGACGATGTGCTAGAATTGGAAACGGCCGTAGTAGGTGGACCTGTG
TCAGATGTCACGGCTATTGTGACAAATGACATAGTGTCTGTTGAACAGGCTCAACAATGTGGTGTTTCTT
CATTACCTATTCAAGATGAAGCTAGTGAAAATCAGGTGCATCAAGTGTCTGATTTACAAGGTAATGAATT
ACTTTGTTCAGAAACTAAGGTTGAAATAGTACAACCTAGACAAGATTTGAAGCCAAGACGCTCACGTAAG
TCTAAGGTTGATTTAAGTAAATATAAGCATACTGTTATTAATAATAGTGTGACTTTAGTATTAGGTGATG
CTATACAAATAGCCTCATTACTGCCTAAGTGTATTCTTGTAAATGCTGCTAACCGCCATCTTAAACATGG
TGGTGGTATAGCTGGCGTTATAAATAAGGCATCTGGTGGTGATGTTCAGGAAGAATCAGATGAATATATA
AGTAATAATGGACCACTTCATGTAGGTGATTCCGTATTACTTAAGGGCCATGGCTTAGCAGATGCAATTT
TGCATGTTGTTGGTCCTGATGCTCGTAATAATGAAGATGCTGCTTTACTTAAACGCTGTTATAAGGCGTT
TAATAAGCATACTATTGTAGTAACACCGTTAATATCAGCTGGTATTTTTAGTGTAGACCCTAAAGTGTCT
TTTGAGTATCTCCTGGCTAATGTTACTACAACTACTTATGTTGTTGTTAACAATGAAGATATTTATAATA
CACTTGCAACACCATCAAAACCAGATGGTCTTGTTTATTCATTTGAAGGATGGCGTGGTACTGTTCGTAC
TGCTAAGAACTATGGTTTTACATGCTTCATTTGTACTGAGTATTCAGCCAATGTTAAATTTTTACGTACC
AAAGGTGTGGATACTACTAAGAAAATTCAAACAGTTGATGGTGTTAGCTATTATTTATATAGTGCTAGAG
ATGCCTTGACTGATGTTATTGCAGCTGCTAATGGCTGCTCAGGTATTTGTGCCATGCCTTTTGGCTACGT
TACGCATGGACTTGATTTGGCTCAATCTGGCAACTATGTACGTCAAGTAAAAGTGCCGTATGTTTGTTTA
TTAGCTTCTAAAGAACAGATTCCTATAATGAACTCAGATGTTGCTATTCAAACACCTGAGACAGCATTTA
TAAACAATGTTACTTCCAATGGGGGTTATCACAGTTGGCATTTAGTTAGCGGTGACCTCATTGTTAAGGA
TGTGTGTTATAAAAAGTTATTGCATTGGTCAGGTCAAACCATTTGCTATGCAGATAATAAATTCTATGTG
GTAAAGAATGATGTAGCTTTACCCTTTAGTGATTTAGAAGCGTGTAGGGCTTATCTGACTTCTAGGGCCG
CACAGCAAGTTAATATCGAAGTGCTTGTTACAATCGATGGTGTTAATTTCAGAACTGTTATTCTGAATGA
TACTACCACTTTTAGAAAACAGCTTGGTGCTACTTTCTATAAAGGTGTAGATATCTCAGATGCTTTTCCT
ACTGTGAAAATGGGAGGTGAGTCTCTATTTGTGGCTGATAATTTATCAGAATCGGAGAAAGTTGTACTGA
AAGAATATTACGGTACATCTGATGTTACATTTTTGCAACGATATTATTCACTGCAGCCATTGGTTCAGCA
GTGGAAATTTGTTGTACATGATGGTGTTAAGTCTTTGAAGCTTAGCAATTATAATTGTTACATTAATGCA
ACAATTATGATGATAGATATGCTACATGACATAAAATTTGTAGTGCCTGCGTTGCAGAATGCCTACTTAA
GATATAAGGGCGGAGATCCTTATGATTTTCTTGCCCTAATTATGGCTTATGGTGATTGTACATTTGACAA
TCCTGATGACGAAGCCAAACTTTTACATACTCTCCTTGCTAAAGCAGAATTAACTGTTTCAGCTAAAATG
GTATGGAGAGAATGGTGCACTGTTTGTGGTATTCGCGATATTGAATATACAGGCATGCGTGCATGCGTTT
ATGCTGGTGTTAATTCGATGGAAGAATTACAATCAGTTTTTAATGAAACTTGTGTGTGTGGTAGTGTAAA
ACACCGTCAATTGGTGGAACACTCGGCACCATGGTTATTGGTATCTGGTTTAAATGAAGTGAAAGTGTCT
ACTTCCACTGATCCAATTTACCGTGCCTTTAATGTCTTTCAGGGTGTGGAAACAAGTGTTGGTCACTATG
TCCATATTCGAGTGAAGGATGGTTTGTTTTATAAGTATGACTCTGGTAGCTTAACTAAAACTTCTGATAT
GAAGTGTAAGATGACCAGTGTGTGGTATCCCACAGTTCGTTATACAGCAGACTGTAATGTCGTTGTATAT
GATCTTGATGGTGTTACTAAAGTTGAAGTCAATCCAGACTTATCTAACTATTATATGAAGGATGGTAAGT
ATTATACTAGTAAACCTACCATTAAATATTCACCTGCTACCATATTACCTGGTAGTGTTTATTCTAATAG
TTGCCTTGTAGGTGTAGATGGAACTCCTGGCAGTGATACTATTAGTAAATTCTTTAATGATCTGTTAGGT
TTTGATGAAACAAAGCCTATTTCTAAGAAACTCACTTATTCTCTGTTGCCTAATGAAGATGGCGATGTTT
TATTATCTGAGTTTAGTAATTATAACCCAGTTTATAAGAAAGGCGTTATGCTTAAAGGCAAGCCTATCTT
GTGGGTTAATAATGGGGTCTGTGACAGTGCGCTTAATAAGCCGAATAGAGCCAGCCTTCGTCAATTATAC
GATGTGGCACCTATTGTTCTTGATAATAAGTACACTGTCTTACAAGATAATACATCTCAACTAGTAGAAC
ATAATGTTCCGGTTGTTGATGATGTTCCAATTACTACTAGAAAGTTAATTGAAGTTAAATGTAAAGGTTT
AAATAAGCCTTTTGTAAAGGGTAACTTCAGTTTTGTTAATGATCCCAATGGTGTTACTGTTGTAGACACA
TTAGGTTTGACTGAACTACGTGCCTTGTACGTGGATATTAATACTAGATATATTGTCCTTAGGGATAATA
ATTGGTCTAGTTTATTTAAGTTACATACTGTTGAATCTGGAGACTTACAGATTGTAGCGGCTGGTGGATC
TGTTACAAGAAGAGCGCGTGTTCTTCTTGGTGCATCATCACTTTTTGCAAGTTTTGCAAAAATTACAGTT
ACTGCAACGACAGCAGCATGTAAGACTGCTGGTCGCGGTTTCTGTAAATTTGTTGTTAATTATGGTGTTT
TGCAGAATATGTTTGTATTTTTAAAAATGCTATTTTTCTTACCATTTAATTATTTATGGCCTAAGAAACA
ACCAACTGTTGACATCGGTGTTAGCGGTTTAAGAACTGCTGGCATTGTTACGACTAATATAGTAAAACAA
TGTGGTACAGCAGCCTATTATATGTTATTAGGAAAATTTAAGCGTGTAGACTGGAAAGCTACATTACGTT
TGTTTTTACTATTATGCACAACAATTTTGTTGTTGTCATCAATATATCATTTGGTATTATTTAATCAAGT
ATTATCGAGTGATGTTATGTTAGAAGATGCTACTGGCATTTTAGCCATTTATAAAGAGGTGCGATCTTAC
CTCGGCATCCGTACGTTGTGTGATGGTTTAGTTGTAGAATACCGCAATACATCGTTTGATGTAATGGAGT
TCTGTTCTAACCGCTCAGTTTTATGTCAATGGTGTCTTATTGGTCAAGACTCATTGACACGTTATTCAGC
TCTTCAAATGCTTCAAACCCATATAACCAGCTATGTTTTGAACATAGATTGGATTTGGTTTGCACTTGAG
TTCTTTTTAGCATATGTGTTGTATACGTCTAGCTTTAACGTATTATTGTTAGTTGTTACAGCACAATATT
TCTTTGCTTACACTAGTGCATTTGTAAATTGGCGTGCTTACAATTACATAGTGTCAGGTCTCTTTTTCTT
AGTAACACACATACCGTTACATGGTTTAGTGCGTGTTTATAATTTTCTTGCATGTTTGTGGTTTCTGAGG
AAATTTTATAGCCATGTTATTAATGGTTGTAAAGACACAGCATGTCTTTTATGTTATAAAAGGAATCGTC
TTACACGTGTTGAAGCTTCCACCATTGTCTGTGGTACTAAACGTACGTTTTATATCGCAGCTAATGGAGG
CACGTCTTACTGTTGTAAACATAATTGGAATTGTGTTGAATGCGACACTGCAGGTGTAGGGAATACCTTT
ATCTGTACAGAAGTCGCTAATGACCTCACTACCACTTTACGCAGACTTATTAAACCCACTGATCAGTCAC
ATTATTATGTAGATTCAGTTGTGGTTAAAGATGCAGTTGTTGAACTACATTACAATAGAGATGGTTCTTC
ATGTTATGAGCGTTACCCTCTCTGTTATTTTACTAATTTAGAAAAATTGAAGTTCAAAGAGGTTTGTAAA
ACTCCTACAGGTATACCTGAACACAATTTTCTAATTTATGACACTAATGATCGTGGCCAGGAAAATTTAG
CTAGGTCAGCTTGTGTTTATTATTCCCAAGTCTTATGCAAGCCTATGCTGCTTGTTGATGTTAATTTGGT
TACCACTGTTGGTGATAGTAGAGAAATCGCCATCAAAATGTTGGATTCCTTTATAAATAGTTTCATCTCT
CTCTTTAGTGTAAGTCGTGATAAGCTTGAGAAGCTTATTAACACTGCACGTGATTGTGTTAGAAGAGGAG
ATGATTTCCAAAATGTTTTAAAGACTTTTACTGATGCTGCCCGTGGACATGCTGGTGTGGAGTCTGATGT
TGAGACAACTATGGTTGTTGATGCATTACAGTATGCACATAAGAATGATATTCAGTTGACAACTGAATGT
TATAATAATTATGTGCCTGGTTATATTAAACCAGATAGCATAAATACATTAGATTTAGGTTGTTTGATTG
ACCTTAAAGCTGCTTCTGTTAACCAAACTAGTATGCGAAATGCAAATGGTGCATGTGTTTGGAATAGTGG
TGATTATATGAAGCTTTCTGATAGTTTCAAGCGTCAGATTAGAATTGCTTGCAGAAAGTGTAATATTCCG
TTTAGACTTACTACGTCTAAACTTCGTGCAGCTGACAATATTTTGTCTGTAAAATTTAGCGCCACTAAAA
TTGTTGGTGGCGCTCCTAGTTGGCTTTTAAGAGTGCGTGATTTAACTGTTAAAGGTTACTGCATTCTTAC
GCTTTTTGTGTTTACAGTAGCTGTGCTATCCTGGTTTTGTTTACCTAGTTATAGTATTGCGACTGTTAAT
TTTAATGATGACCGCATTCTTACATATAAAGTTATTGAGAATGGTATTGTTAGAGACATAGCACCTAACG
ATGTATGCTTTGCCAATAAATATGGTCATTTTTCGAAATGGTTTAATGAGAACCACGGAGGCGTTTATCG
TAACTCCATGGATTGTCCCATTACTATAGCTGTAATAGCTGGTGTAGCAGGTGCTCGTGTGGCAAATGTT
CCAGCAAATTTAGCTTGGGTTGGTAAACAAATAGTGTTGTTTGTCTCCCGTGTCTTTGCTAATACTAATG
TGTGTTTTACACCTATTAATGAAATTCCTTATGATACATTCTCTGATAGTGGCTGTGTGCTTTCTTCAGA
GTGTACGTTGTTTAGGGATGCAGAAGGTAATTTAAATCCATTTTGCTATGACCCTACTGTACTACCTGGT
GCTTCAAGCTATGCTGATATGAAACCTCATGTACGTTATGACATGTATGATTCTGACATGTATATTAAAT
TTCCTGAGGTTATAGTTGAAAGTACTCTCAGAATTACTAAAACTTTAGCAACTCAATACTGCCGTTTTGG
TAGTTGTGAAGAGTCAGCTGCTGGTGTATGCATTAGCACCAATGGATCTTGGGCCTTGTATAATCAAAAT
TATAGTACTCGTCCTGGAATCTATTGTGGTGATGATTATTTTGATATAGTACGACGGTTGGCCATATCTT
TATTTCAACCAGTTACGTATTTTCAACTTAGCACATCTTTAGCTATGGGTTTAGTACTTTGTGTGTTTCT
TACAGCCGCTTTTTACTATATTAATAAAGTTAAGCGTGCTCTTGCCGATTACACACAATGTGCTGTTGTA
GCTGTAGTTGCAGCGTTGTTAAACAGCTTATGTTTATGCTTTATAGTTGCCAACCCATTGTTGGTTGCTC
CCTATACAGCTATGTATTACTATGCCACATTTTATCTTACTGGTGAACCGGCATTTATCATGCATATTTC
CTGGTATGTAATGTTTGGTGCTGTAGTTCCTATTTGGATGTTAGCATCTTACACCGTTGGTGTAATGTTG
CGTCATCTGTTTTGGGTGTTAGCTTATTTTAGTAAGAAGCATGTTGATGTTTTTACTGATGGTAAGCTTA
ATTGTAGCTTTCAGGATGCTGCTAGTAACATCTTTGTTATAGGTAAGGATACATATGTCGCTTTACGTAA
TGCTATAACACAAGATTCCTTTGTTAGGTATTTGTCATTATTTAACAAGTACAAGTATTATTCAGGTGCT
ATGGACACGGCTTCTTATAGAGAGGCTTGTGCCGCACATTTGTGTAAAGCCTTACAGACATACAGTGAAA
CTGGTAGTGACATCTTGTACCAACCACCTAATTGTAGTGTCACGTCTAGTGTGCTGCAAAGTGGTTTGGT
TAAGATGTCAGCTCCTAGTGGTGCTGTAGAGAACTGTATTGTGCAAGTTACATGTGGGTCTATGACATTG
AATGGTCTTTGGCTTGATAACACTGTATGGTGTCCTCGCCATATTATGTGTCCTGCTGACCAGTTAACTG
ACCCAAATTATGATGCTTTGTTAATTTCAAAAACTAATCATAGTTTTATTGTGCAAAAACACATAGGAGC
TCAGGCTAATCTGCGTGTTGTTGCTCATTCTATGGTTGGTGTCTTACTTAAGTTAACTGTTGATGTTGCT
AATCCTAGTACACCAGCATATACTTTTAGTACTGTTAAACCTGGCGCCTCGTTTAGCGTTTTAGCTTGTT
ATAATGGCAAGCCTACAGGTGTCTTTACAGTTAATTTACGCCACAATTCTACCATTAAAGGCAGTTTCCT
TTGTGGTTCTTGTGGTAGTGTTGGTTACACTGAAAATGGAGGTGTAATCAACTTTGTTTATATGCATCAG
ATGGAATTATCAAATGGTACACATACTGGTAGTTCCTTTGATGGTGTTATGTATGGTGCTTTTGAAGATA
AACAAACACACCAGTTACAGTTAACAGACAAATACTGCACTATTAATGTAGTAGCTTGGCTCTATGCAGC
AGTTCTAAATGGTTGTAAGTGGTTTGTAAAACCCACCAGAGTTGGAATTGTAACTTATAATGAATGGGCT
TTGAGTAATCAGTTTACAGAATTTGTAGGCACACAGTCCATTGATATGCTTGCTCACCGAACTGGTGTTT
CTGTTGAACAAATGCTTGCTGCTATCCAGAGTCTGCATGCTGGTTTTCAGGGTAAAACTATTCTGGGCCA
GTCTACTTTGGAGGATGAGTTCACTCCTGATGATGTTAATATGCAAGTCATGGGTGTTGTAATGCAGAGT
GGTGTTAAACGTATATCATATGGCTTTATACACTGGTTGATTTCAACCTTTGTATTGGCATATGTTAGCG
TTATGCAACTCACTAAGTTTACTATGTGGACTTATTTGTTTGAGACTATTCCCACACAAATGACTCCTCT
CTTATTGGGTTTTATGGCATGCGTTATGTTTACTGTTAAACATAAACATACCTTCATGTCACTCTTCCTA
TTACCTGTGGCACTTTGTTTGACATATGCAAATATTGTATATGAACCACAGACTTTAATATCAAGCACAT
TGATTGCTGTAGCTAATTGGTTGACTCCTACTAGTGTGTATATGCGCACTACACATTTTGACTTTGGCTT
ATATATTAGCCTTAGTTTTGTATTAGCGATTATTGTTAGGCGGTTGTATCGTCCTTCAATGTCGAATTTA
GCTCTAGCTTTATGTAGTGGTGTGATGTGGTTTTACACTTATGTTATAGGGGACCACAGTAGTCCCATAA
CCTATCTTATGTTTATAACTACGTTGACTAGTGATTACACAATTACTGTTTTTGCTACCGTTAACTTAGC
TAAGTTTATTTCTGGCTTGGTGTTCTTTTATGCTCCGCATTTGGGATTCATATTGCCAGAAGTTAAACTT
GTGTTATTAATATACCTGGGTTTAGGGTATATGTGTACAATGTATTTTGGTGTCTTTTCATTATTGAACC
TGAAATTGCGTGTACCATTGGGTGTGTATGACTATTCAGTTTCAACTCAAGAATTTCGCTTCCTTACAGG
TAATGGCCTTCATGCGCCACGTAACTCATGGGAAGCTCTAATACTTAATTTTAAATTGCTTGGTATTGGC
GGTACACCTTGTATTAAGGTTGCAACAGTCCAATCCAAGCTTACAGATTTGAAATGCACATCTGTTGTTT
TACTTACGGTGTTGCAACAATTACACCTTGAGTCTAATAGTAAGGCGTGGTCATATTGTGTTAAGTTACA
CAATGAAATTTTGGCTGCGGTTGATCCTACAGAAGCTTTTGAAAGATTTGTTTGTCTTTTTGCAACGCTA
ATGTCTTTTTCTGCTAATGTTGATTTAGATGCTTTAGCCAATGATCTCTTTGAGAATTCATCAGTCTTAC
AAGCTACTCTTACTGAGTTCTCTCATTTAGCTACTTATGCTGAATTAGAGACAGCTCAGTCATCTTACCA
AAAAGCTTTGAACTCTGGTGATGCGTCACCACAGGTTCTTAAAGCGTTACAAAAAGCTGTTAACGTTGCT
AAGAATGCCTATGAAAAAGATAAGGCTGTAGCACGTAAGTTAGAGCGTATGGCTGAACAAGCTATGACAT
CTATGTATAAGCAAGCACGTGCCGAGGATAAGAAGGCAAAAATTGTAAGTGCTATGCAAACTATGTTATT
TGGCATGATTAAGAAGTTAGATAATGATGTTCTTAATGGTGTTATAGCAAATGCTAGAAATGGTTGTGTG
CCTCTTAGCATTGTTCCTCTTTGTGCATCTAATAAGTTGAGGGTCGTAATACCTGATATTTCTGTTTGGA
ATAAAGTTGTTAATTGGCCTAGTGTTTCCTATGCTGGGTCTTTGTGGGATATTACAGTTATAAACAATGT
GGATAATGAAGTTGTCAAACCTACAGATGTTGTAGAAACTAATGAAAGTTTGACATGGCCACTTGTTATT
GAATGTAGCCGATCTTCTAGTTCTGCTGTGAAGCTACAGAATAATGAGATCCATCCTAAGGGTTTGAAGA
CTATGGTCATAACAGCTGGTGTAGATCAAGTTAATTGTAATAGTAGTGCCGTAGCTTACTATGAGCCTGT
TCAAGGCCATAGGATGGTTATGGGTTTGTTATCAGAGAATGCTCACCTTAAATGGGCTAAAGTTGAGGGT
AAAGATGGTTTTATTAACATAGAGTTACAACCACCTTGCAAATTTTTAATTGCAGGTCCTAAGGGCCCTG
AAATTAGATATCTTTACTTTGTAAAGAATCTTAATAATTTACATAGAGGCCAACTCTTGGGGCATATAGC
TGCAACTGTACGTTTGCAAGCTGGTGCTAATACAGAGTTTGCTAGTAATTCAACTGTTCTTACTCTTGTG
GCATTTGCAGTTGATCCAGCTAAAGCATACTTGGACTATGTTGGTTCTGGTGGAACACCATTGTCCAATT
ATGTTAAGATGCTTGCACCTAAAACAGGTACTGGCGTGGCTATTTCAGTTAAGCCAGAAGCAACTGCAGA
CCAAGAAACATATGGTGGTGCGTCTGTGTGTCTCTATTGTAGAGCACATATAGAACATCCTGATGTTTCA
GGTGTCTGTAAATATAAAACGCGTTTTGTACAAATCCCAGCGCACGTACGTGATCCTGTGGGATTTTTAC
TTAAAAACGTTCCGTGTAATGTCTGTCAGTATTGGGTTGGGTATGGTTGTAATTGTGACGCATTACGTAA
CAATACAGTCCCCCAATCCAAAGATACTAATTTTTTAAACGAGTCCGGGGTTCTAGTGTAAATGCCCGAC
TAGAACCCTGTTCAAGTGGTCTAACCACTGATGTCGTTTATAGGGCATTCGACATCTGCAATTTTAAAGC
TAGAGTTGCAGGTATAGGAAAGTATTATAAAACTAATACTTGTAGATTTGTACAGGTTGATGATGAAGGT
CATAAACTTGATTCTTATTTTATCGTTAAACGTCATACTATGAGTAATTATGAGTTAGAGAAGCGCTGCT
ATGATCTTCTTAAAGATTGTGATGCAGTGGCTATTCATGATTTCTTCATATTTGACGTTGATAAAACTAA
AACTCCACACATAGTACGTCAGAGTTTGACTGAGTATACTATGATGGATTTAGTATATGCTTTGCGCCAC
TTTGACCAGAATAATTGTGAAGTGTTAAAGAGCATATTAGTTAAATATGGTTGCTGTGAACAGTCATATT
TTGATAATAAATTATGGTTTGATTTTGTGGAAAACCCTAGTGTAATAGGTGTTTATCATAAACTTGGTGA
AAGAATTCGCCAAGCTATGTTAAACACTGTAAAAATGTGTGACCACATGGTTAAAAGTGGCCTTGTGGGT
GTTTTAACACTTGATAACCAAGACCTTAATGGTAAGTGGTATGATTTTGGTGATTTTGTTATTACCCAAC
CAGGTGCTGGAGTAGCTATTGTTGATAGCTATTATTCTTACCTTATGCCTGTGCTCTCAATGACCAATTG
TTTGGCAGCAGAGACACATAAGGATTGTGATTTTAATAAGCCTCTTATAGAGTGGCCTTTATTGGAGTAT
GATTATACAGACTATAAAATTGGTCTGTTTAATAAATACTTTAAATATTGGGATCAAACATACCACCCTA
ATTGTGTTAATTGTAGTGATGATCGTTGTATTTTACATTGTGCTAATTTCAATGTACTCTTTTCAATGGT
ACTACCTAACACATCTTTCGGGCCTATCGTTCGTAAGATTTTTGTTGATGGCGTACCGTTTATAGTATCT
TGTGGTTATCACTACAAGGAGTTAGGGTTAGTCATGAATATGGATTTTAACATCCATAGGCATAGGCTTG
CACTTAAGGAATTGATGATGTATGCAGCAGATCCTGCTATGCATATAGCATCTGCATCAGCCCTTTGGGA
TTTGAGGACACCATGTTTTAGTGTTGCAGCTCTTACAACTGGTTTGACATTTCAAACCGTTAGACCTGGC
AATTTTAATAAAGATTTTTATGACTTTGTAGTATCTAGAGGCTTTTTCAAGGAAGGGTCTTCAGTTACAT
TAAAACATTTCTTCTTTGCACAAGATGGTCATGCTGCTATTACAGATTATAGCTATTATGCTTATAATCT
ACCTACTATGGTTGACATCAAGCAGATGTTGTTCTGCATGGAAGTTGTCGACAAATATTTTGATATCTAT
GACGGTGGGTGCCTTAACGCTTCTGAAGTTATAGTTAATAATTTAGATAAGAGTGCTGGCCATCCTTTTA
ATAAGTTTGGCAAAGCACGTGTTTATTATGAAAGTATGAGTTATCAAGAGCAAGATGAATTGTTTGCTGT
AACTAAGCGCAACGTTTTGCCTACTATAACTCAAATGAATTTGAAGTATGCTATTAGTGCTAAGAATAGA
GCACGTACTGTAGCAGGCGTGTCTATACTTAGCACAATGACTAATCGTCAATATCACCAGAAGATGTTGA
AGTCTATGGCTGCAACGCGTGGAGCCACGTGTGTCATAGGCACAACTAAATTTTATGGTGGTTGGGACTT
TATGTTAAAAACCTTATATAAGGATGTTGAGAGTCCACATTTAATGGGTTGGGATTACCCTAAGTGTGAT
CGTGCTATGCCTAATATGTGTCGCATTTTAGCGTCATTGATTTTGGCACGTAAGCATAGTACTTGTTGTA
CTAATTCTGATAGGTTCTACCGCTTAGCCAATGAGTGTGCTCAAGTGTTAAGTGAGTATGTCCTATGCGG
AGGAGGTTATTATGTTAAACCAGGTGGTACGAGTAGTGGTGATGCAACTACTGCTTATGCCAATAGTGTT
TTTAACATATTACAAGCCACCACCGCTAATGTTAGTGCACTTATGAGTGCTAATGGTAATACTATCATAG
ATCGTGAAATAAAGGATATGCAATTTGACTTGTATATCAATGTATATAGAAAAGTAGTGCCTGATCCTAA
ATTTGTTGACAAGTACTACGCATTTCTTAATAAACACTTTTCTATGATGATCTTATCGGATGATGGTGTT
GTGTGTTATAATAGCGACTATGCCGCTAAAGGTTATGTCGCCTCCATCCAAAATTTTAAAGAGACGCTTT
ATTATCAAAATAATGTCTTTATGTCAGAAGCTAAGTGCTGGGTGGAAACCAATTTGGAAAAGGGTCCACA
TGAATTTTGTTCACAGCATACGCTCTATATTAAAGATGGGGACGATGGCTACTTCTTACCTTATCCAGAC
CCTTCTAGGATTTTGTCTGCCGGTTGCTTTGTTGATGATATCGTTAAGACTGACGGTACTGTCATGATGG
AGCGGTATGTGTCATTGGCTATAGATGCGTATCCTCTAACAAAGCATGATGATACTGAATATCAAAATGT
ATTCTGGGTCTATTTACAGTATATTGAAAAGCTTTATAAGGACCTAACTGGACACATGCTTGACAGTTAT
TCTGTTATGTTATGTGGTGATGATTCAGCCAAATTTTGGGAAGAGGGGTTCTATAGAGATCTCTATAGTT
CGCCTACCACATTACAGGCTGTAGGTTCTTGTGTTGTGTGTCACTCACAAACATCTTTGAGGTGTGGTAC
ATGTATACGAAGACCTTTCTTATGTTGCAAGTGTTGTTATGATCATGTAATTGCAACACCTCATAAAATG
GTTCTGTCAGTTTCACCTTATGTCTGTAATGCACCTGGTTGTGATGTTTCAGATGTTACTAAATTATATC
TGGGAGGTATGAGTTATTATTGTAATGACCATCGCCCAGTATGTAGTTTTCCTCTTTGTGCCAATGGCTT
AGTCTTTGGTTTATATAAAAATATGTGCACCGGTAGTTCGTCTATTATGGAATTTAATAGACTTGCTACT
TGTGATTGGAGTGATAGCGGTGACTACACTCTTGCTAATACAACTACAGAACCTCTTAAATTATTTGCGG
CTGAGACACTTAGAGCTACAGAAGAAGCTTCTAAACAGTCGTATGCTATAGCCACTATCAAAGAAATAGT
CGGTGAACGTGAATTAATACTTGTGTGGGAGGTTGGTAAATCCAAACCACCACTCAACCGTAATTATGTT
TTTACTGGTTATCATTTAACCAAGAATAGTAAAGTACAGCTCGGTGAGTATGTCTTCGAGCGTATAGATT
ATAGTGATGCTGTCTCTTATAAATCTAGTACTACGTATAAGCTAGCAGTAGGAGACATCTTTGTGCTTAC
CTCTCATTCAGTGGCGACATTGTCAGCGCCAACAATAGTGAATCAAGAGAGGTATTTAAAAATAACTGGT
ATATATCCAACTATTACTGTGCCTGAGGAGTTTGCAAATCATGTAGTGAACTTTCAAAAAGCAGGCTTTA
GTAAGTATGTTACCGTGCAAGGTCCTCCTGGTACAGGTAAGAGTCATTTTGCTATAGGGTTGGCAATATA
CTACCCTACAGCACGCATTGTTTATACAGCATGCTCACATGCGGCAGTTGATGCATTGTGTGAGAAGGCT
TTTAAGTATTTGAACATTGCTAAATGTTCTCGTATTATTCCTGCTAAAGCGCGTGTAGAGTGTTATGACA
GGTTTAAAGTCAATGATACAAATTCTCAATATTTATTCAGTACTGTTAATGCATTACCAGAAATATCAGT
CGATATACTGGTAGTGGATGAAGTTAGCATGTGTACTAATTATGATTTGTCAATCATAAATTCACGTGTT
AAAGCTAAACATATAGTGTATGTAGGTGATCCTGCTCAGTTACCAGCACCACGCACTTTGTTGATACGAG
GCACTTTGGAGCCTGAAAATTTCAATAGTGTTACTCGTTTAATGTGTAACTTGGGACCTGACATATTTCT
TAGTGTATGTTACCGGTGTCCTAAGGAAATTGTGAGCACTGTAAGCGCATTAGTTTACAACAATAAATTG
TCAGCTAAGAAAGATGCTTCTGGCCAGTGCTTTAAGATACTATTTAAAGGCAGTGTGACGCATGATGCGA
GCTCTGCCATTAATAGACCTCAATTGAATTTTGTAAAAACTTTTATAGCTGCTAACCCAAATTGGAGTAA
AGCAGTATTTATTTCACCTTATAACAGTCAAAATGCTGTAGCTAGATCCATGTTAGGACTAACTACGCAG
ACTGTTGATTCTTCACAGGGCTCTGAATACCCGTATGTGATTTTCTGTCAAACAGCAGACACTGCACATG
CTAATAACTTAAATAGGTTTAATGTGGCAGTGACTAGAGCACAGAAGGGTATATTATGTGTTATGACATC
TCAAGTTTTATTCGATTCTCTCGAATTTGCTGAATTGTCTCTTAATAATTACAAATTGCAGTCTCAGATT
GTGACTGGTTTGTTTAAAGATTGTTCTAGAGAGGACACTGGTCTTCCTCCTGCTTATGCACCTACTTATT
TAAGTGTAGATGCTAAATATAAAACTACAGATGAGTTGTGTGTGAATTTGAATATAACACCTAACGTTAC
ATATTCTAGAGTTATATCACGTATGGGATTTAAGCTTGATGCGACAATCCCAGGTTATCCTAAGTTATTC
ATCACGCGTGATGAAGCTATAAGGCAAGTTCGAAGCTGGGTAGGTTTCGATGTTGAGGGTGCACATGCTT
CTCGTAATGCATGTGGCACCAATGTGCCTTTACAGTTAGGATTTTCTACAGGTGTGAACTTTGTTGTTCA
ACCCGTTGGAGTTGTAGACACTGAGTGGGGTAGTATGCTGACGACTATTTCAGCACGACCACCACCTGGT
GAACAATTTAAACACCTCGTGCCACTAATGAATAAGGGTGCGACTTGGCCTATTGTACGAAGACGTATAG
TTCAAATGTTATCTGATACTTTGGATAAGTTGTCAGATTACTGTACGTTTGTTTGTTGGGCTCATGGTTT
TGAGCTCACGTCTGCGTCTTACTTTTGTAAGATTGGTAAAGAACAGCGGTGTAGCATGTGTAGTAGACGT
GCATCTACTTTCTCCTCACCGTTGCAATCTTATGCCTGCTGGAGTCATTCCAGTGGATATGATTATGTTT
ACAACCCATTTTTTGTTGATGTTCAGCAGTGGGGGTATGTAGGCAATTTAGCTACCAACCACGACCGGTA
TTGTGGCATCCATGCTGGTGCTCATGTAGCATCCAGTGATGCCATAATGACTAGGTGTTTGGCAATTTAT
GATTGTTTTATAGAACGTGTTGATTGGGATGTTACGTATCCTTATATATCACATGAACAAAAACTTAATT
CTTGCTGTCGTACAGTAGAGCGTAACGTTGTTCGCTCCGCTGTGCTCTCAGGCAAGTTTGAAAAAATTTA
TGATATTGGTAATCCTAAGGGTATTGCCATTATTTCTGAACCTGTGGAGTGGCATTTCTATGATGCACAG
CCTCTTAGTAATAAAGTTAAGAAATTGTTTTACACAGATGATGTGTCTAAGCAATTTGAAGATGGGCTGT
GTTTGTTTTGGAACTGTAATGTTTCAAAATACCCTAGTAATGCTGTTGTTTGTCGGTTTGATACTAGAGT
GCATTCAGAGTTTAATTTGCCTGGTTGTAATGGTGGCAGTTTGTATGTTAACAAACATGCCTTTCATACA
CCTGCATATGACATTAATGCATTTAGAGATCTTAAACCGTTACCTTTCTTTTACTATTCTACTACTCCAT
GTGAAGTTCATGGTAGTGGTAATATGTTAGAAGATATAGACTATGTGCCACTTAAATCTGCTGTTTGTAT
AACAGCTTGTAATTTAGGTGGAGCTGTTTGTCGTAAGCATGCAGCAGAATACCGTGATTATATGGAAGCA
TATAACATTGTATCAGCTGCAGGTTTTCGTCTATGGGTATATAAGACCTTTGATATCTATAATCTTTGGT
CTACTTTTGTTAAAGTTCAAGGTTTAGAAAACATTGCTTTTAATGTTATTAAACAAGGCCATTTTACAGG
TGTTGATGGTGAGTTGCCTGTTGCTGTAGTCAACGACAAGATCTTCACTAAAAATGGTACTGATGATGTG
TGCATTTTTAAGAATGAAACTGCACTTCCTACAAATGTAGCATTTGAATTGTATGCTAAGAGAGCTGTTC
GCTCTCATCCTGATTTGAATTTGCTACGTAATTTAGAGGTGGATGTTTGTTACAACTTTGTTCTTTGGGA
CTATGATCGTAACAACATCTATGGTACAACTACAATCGGTGTGTGTAAATACACTGATATTGATGTCAAT
CCAAATTTGAATATGTGTTTTGACATACGTGACAAAGGGTCATTGGAAAGGTTTATGTCAATGCCCAATG
GTGTTTTGATATCAGATCGCAAGATAAAGAATTATCCTTGCATTTCTGGTCCTAAGCATGCTTACTTTAA
TGGTGCTATTCTACGCAACATTGATGCCAAACAACCTGTTATTTTTTATTTGTATAAGAAAGTCAATAAT
GAATTCGTTTCATTTTCTGACACGTTTTATACGTGTGGCAGGACTGTTGGCGACTTTACTGTTTTAACTC
CTATGGAGGAAGACTTTCTTGTGCTGGATAGCGATGTTTTTATTAAGAAGTATGGCTTGGAAGACTATGC
TTTTGAACACGTAGTTTATGGTGATTTTTCACATACTACGTTAGGTGGCTTACATCTTCTTATAGGTTTA
TATAAGAAGATGCGTGAGGGTCACATATTAATGGAAGAAATGCTCAAGGATAGAGCTACTGTCCATAATT
ATTTTATAACAGATTCTAATACAGCTTCTTATAAGGCTGTTTGTTCTGTTATTGATTTAAGACTTGATGA
CTTTGTCACCATCATTAAGGAAATGGACCTTGATGTTGTGTCAAAAGTTGTTAAAGTTCCTATTGATTTA
ACTATGATTGAATTTATGTTGTGGTGTAGAGATGGAAAGGTTCAAACCTTCTATCCTAGACTTCAGGCTA
CCAATGATTGGAAACCTGGTCTAACTATGCCATCTTTGTTTAAAGTTCAGCAAATGAACCTTGAACCATG
TTTATTAGCTAATTATAAGCAATCCATACCAATGCCAAACGGCGTTCATATGAATGTTGCTAAATATATG
CAATTGTGTCAGTATTTGAATACTTGCACTCTAGCTGTTCCCGCCAATATGAGAGTCATTCATTTTGGTG
CTGGTTGTGAAAAAGGTGTTGCCCCTGGTACATCTGTTTTACGGCAGTGGCTGCCTTTAGATGCAGTCCT
GATAGATAATGATCTTAATGAGTTTGTATCAGATGCTGATATAACCATTTTTGGTGATTGCGTAACAGTA
CATGTCGGTCAGCAAGTGGATTTACTTATTTCTGACATGTATGACCCTTGTACTAAAGCTGTAGGAGAAG
TTAATCAAACGAAGGCTTTGTTCTTCGTATACCTCTGCAACTTTATAAAGAATAATCTTGCATTAGGTGG
CTCCGTTGCGATTAAAATAACTGAGCATTCATGGAGTGCAGATTTGTATAAAATTATGGGAAGATTTGCA
TATTGGACAGTTTTCTGTACTAATGCAAATGCATCCTCTTCAGAAGGGTTTCTCATTGGTATAAATTTCT
TAGGCGAGTTAAAAGAAGAAATTGATGGCAATGTTATGCATGCCAATTATATATTTTGGAGAAATTCAAC
TCCAATGAATTTGAGTACATACTCACTTTTTGATTTATCTCGCTTTCCTCTTAAATTAAAAGGTACACCA
GTACTTCAATTAAAGGAGAGTCAAATTAACGAACTTGTAATTTCTCTCTTGTCACAAGGAAAGTTGCTTA
TACGCGACAATGACACTCTTAATGTGTCTACTGATGTCCTTGTTAATTTTCGTAAGAGGCTGTGATTCAC
AATTTGTTGACATGAGTCCAGCTAGTAATACTAGTGAGTGTTTGGAGTCACAAGTTGACGCAGCTGCATT
TTCTAAATTAATGTGGCCTTATCCTATTGATCCTTCCAAAGTTGATGGTATCATTTATCCACTTGGTAGG
ACATATTCTAATATTACATTAGCATATACTGGTCTTTTTCCCCTACAAGGAGATTTAGGTAGCCAGTATT
TATATTCTGTAAGTCATGCTGTAGGTCATGATGGTGATCCTACAAAAGCTTATATTTCTAATTATTCACT
ATTGGTGAATGATTTTGATAACGGTTTTGTTGTACGAATTGGTGCTGCAGCTAATTCAACTGGCACCATT
GTAATTTCACCGTCTGTTAATACTAAGATTAAAAAAGCTTATCCTGCTTTTATCTTAGGTTCGTCTCTTA
CTAATACATCGGCTGGTCAGCCATTGTATGCTAATTACAGTTTAACCATCATTCCTGATGGTTGTGGGAC
TGTGTTGCATGCTTTTTATTGCATATTAAAACCACGTACTGTGAATCGATGTCCTAGTGGTACTGGTTAT
GTGTCTTATTTTATTTATGAAACAGTTCATAATGATTGTCAGTCTACAATTAACAGGAACGCTTCTCTTA
ATTCTTTTAAGAGCTTTTTCGATCTTGTTAATTGTACTTTCTTTAATAGTTGGGATATCACTGCTGATGA
AACAAAAGAGTGGTTTGGTATTACCCAAGACACTCAAGGTGTTCATCTCTACTCTTCTAGGAAAGGTGAT
TTATATGGCGGAAATATGTTTCGCTTTGCTACATTACCTGTGTACGAGGGTATAAAATATTACACTGTTA
TACCCAGAAGTTTTCGGTCTAAAGCTAACAAAAGAGAGGCTTGGGCTGCATTTTATGTGTATAAATTACA
TCAGCTGACTTACTTGTTAGATTTTTCTGTTGATGGTTATATACGTAGAGCTATAGATTGTGGACATGAT
GATTTGTCACAGCTCCATTGTTCTTATACATCTTTTGAAGTTGACACTGGTGTCTATTCTGTTTCTTCAT
ATGAAGCTTCAGCTACTGGCACCTTTATTGAACAACCTAATGCTACTGAGTGTGATTTTTCACCTATGCT
TACAGGTGTAGCTCCTCAGGTTTATAATTTTAAAAGGTTGGTTTTTTCCAATTGTAATTATAATCTTACT
AAACTCCTCTCTTTGTTTGCAGTTGATGAGTTTTCTTGTAATGGAATTTCACCTGATTCTATTGCACGTG
GTTGTTATTCTACTTTAACAGTGGATTATTTTGCCTATCCACTTAGTATGAAGTCATATATCAGACCTGG
TTCTGCAGGCAATATACCACTTTACAATTATAAACAGTCTTTTGCCAATCCTACGTGTAGAGTTATGGCA
TCTGTTCTTGCTAATGTTACTATTACTAAGCCTCATGCTTATGGTTATATTTCCAAGTGTTCTCGTCTGA
CTGGTGCAAACCAAGATGTTGAAACACCATTATATATTAACCCTGGTGAGTACTCTATTTGTAGAGATTT
TTCTCCTGGGGGTTTTTCTGAAGATGGTCAGGTCTTCAAGCGTACTCTTACCCAATTCGAGGGTGGTGGC
TTGCTTATTGGAGTTGGCACTAGAGTACCTATGACTGATAACTTACAAATGAGTTTTATAATCTCTGTCC
AATATGGTACCGGCACCGATAGTGTTTGCCCCATGTTGGACTTAGGTGATTCTTTAACTATCACTAACCG
TTTAGGTAAGTGTGTAGATTATTCACTCTATGGTGTTACTGGTAGAGGTGTTTTTCAAAACTGTACTGCC
GTTGGTGTTAAACAGCAGCGTTTTGTTTATGATAGCTTTGACAATTTAGTTGGTTACTATTCTGATGATG
GTAACTACTATTGTGTCAGACCTTGTGTCAGTGTACCTGTGTCTGTTATATATGATAAAAGTACAAATTT
ACATGCGACTTTATTCGGTAGTGTTGCTTGTGAGCACGTTACTACAATGATGTCGCAATTTTCACGCCTT
ACTCAAAGTAATTTACGTAGGCGTGATTCTAATATACCTCTTCAAACAGCTGTTGGTTGTGTTATAGGTC
TTTCTAATAACTCACTAGTAGTTAGTGATTGTAAATTGCCATTAGGCCAGTCACTTTGTGCAGTCCCTCC
TGTGTCTACTTTTAGAAGTTATAGCGCTAGCCAATTTCAGCTTGCTGTGCTTAATTATACTTCTCCTATT
GTTGTTACTCCTATTAATTCCAGTGGTTTTACCGCTGCAATTCCAACTAATTTTTCTTTTTCAGTTACAC
AGGAGTACATTGAAACATCCATTCAGAAGGTTACTGTAGATTGTAAACAGTATGTCTGTAATGGTTTTAC
TAGGTGTGAAAAGCTATTGGTTGAATATGGGCAATTTTGTTCCAAAATTAATCAAGCTTTACATGGTGCT
AATCTTAGACAAGATGAGTCTGTTTATAGTCTTTATAGTAACATTAAAACCACCTCTACCCAAACTCTTG
AGTATGGTTTAAATGGTGATTTTAATCTTACATTATTACAAGTACCACAAATTGGAGGTTCTTCCTCTAG
TTATCGTAGTGCTATTGAAGACTTATTATTTGATAAGGTAACTATTGCAGATCCCGGTTATATGCAGGGC
TATGATGATTGCATGAAACAAGGACCCCAGTCTGCTAGAGATCTTATTTGTGCTCAATATGTGTCTGGTT
ACAAAGTTTTACCACCACTTTATGACCCTAATATGGAAGCTGCTTACACATCTTCACTATTAGGTAGTAT
AGCAGGTGCTGGATGGACAGCTGGTCTTTCATCCTTTGCCGCTATACCTTTTGCACAAAGTATGTTTTAT
AGGTTGAATGGCGTTGGTATTACTCAACAAGTTCTCTCTGAGAACCAAAAGTTGATTGCTAACAAGTTTA
ACCAAGCCTTAGGTGCTATGCAAACTGGCTTTACAACATCTAACCTAGCTTTTAGCAAGGTTCAAGATGC
TGTAAATGCCAATGCACAAGCACTTTCTAAGTTAGCATCAGAGTTGTCTAATACTTTTGGTGCTATTTCT
TCATCTATTAGTGACATCCTTGCTAGGCTTGACACTGTTGAACAGGATGCGCAAATTGATCGTTTGATCA
ATGGTCGCTTAATTTCTCTTAACGCATTTGTTTCACAACAACTTGTGCGTTCTGAAACTGCTGCTAGATC
TGCTCAGTTGGCTAGTGACAAAGTCAACGAGTGTGTAAAATCACAATCCAAGAGAAATGGGTTCTGTGGG
TCTGGCACTCATATAGTATCATTTGTTGTTAATGCTCCAAATGGTTTTTATTTCTTTCATGTTGGTTATG
TTCCAACAAATTATACTAATGTTACAGCTGCTTATGGTCTCTGTAACAATAACAACCCTCCTTTGTGCAT
TGCACCAATTGACGGGTATTTCATTACTAATCAGACTACCACTTATAGTGTTGATACCGAATGGTATTAC
ACTGGTAGTTCTTTTTATAAACCTGAACCTATAACTCAGGCTAATTCACGTTATGTTTCTAGTGATGTGA
AATTTGACAAACTTGAGAATAACTTACCACCTCCACTCCTTGAGAATTCTACTGATGTGGATTTTAAGGA
TGAATTGGAAGAATTTTTCAAGAATGTTACCTCGCATGGTCCTAACTTTGCAGAGATATCTAAGATTAAC
ACTACACTGCTTGACCTTTCAGATGAGATGGCAATGTTGCAGGAAGTTGTTAAACAATTAAATGATTCCT
ACATTGATCTTAAAGAATTGGGAAATTATACTTATTATAACAAGTGGCCTTGGTACGTATGGCTAGGTTT
TATTGCAGGCCTTGTTGCCTTATTATTGTGTGTCTTTTTCCTTCTATGCTGTACTGGTTGTGGTACTAGC
TGCTTGGGAAAAATGAAGTGTAAGAATTGTTGTGATTCTTATGAAGAATATGATGTCGAAAAGATTCATG
TTCATTAAGATTTTAACGAACTTTTATTAGCAGTATGGTTTCTTTTAATGCTACTGCTATTCTTCTTTTA
TTACTTGCTAATGCTTTTTCTAAACCTTTATATGTCCCTGAGCATTGTGGTGGCATGTCTGGCACTCTCT
TTCAGGCTTGTATTAGACAAACTATGGTTGATACAACCGGTATGTACACCAATTCAGCTATGTCACATGA
TGGTGTTACAATACCATTTGATAGAGATGGCATTGTACATGAAGATCATTACACTGAAACAAACCCTACA
CCACTTTTTGATGCTGGGTTTTCCGTATAATTGATTTTAACGAACTTATGGACTACGTCTCTTTGCTTAA
CCAATTTTGGCAGAAGCAAATTAAGTCTTATAAAGAGACTCCTAGTCAGTATCATTACCTGTATCCACCC
AGGTTTTTCTATAAACCTGTTTTGGGTAATTTACAGCACCCTACCAAGTGGTGTTGTACTATTAAATTTT
ATGAGTATAGTGCTCAGGCTACTGAGTGTACTAAAGCATCAGCAAAACAAGATGCAGCTAGACTTATCTG
TGAACAGTTACAAGCTGCTGGACTACTCAATGGAATGGAGCTCCGATTCCGTAGTTCTGCCTCCGACATC
TTCGGACAAAACCGTTATGATGCCAGCAAAAGCTACTTCTTCTCGAAAACGGCATAGAAAACCTAAATTG
CAATATGCCAAGAGAAGGTTTTCCCCTGTTAATCCAAATGACTTAGTGCTAGTTCAGCAAGAACCTACTC
ACTGTGTTCGTTTGGTTTTTCCTTTAAGTAAGCGCTGGATACATTTTGATGGACTCGTCTATTCTTTAGC
GCGTCTTAATGTGTCTATGACTGTTGATTATCATGTTACCCTAGCTCTCATCTATGCTCCTGAGGCTGGT
GAATGCTTTGGTAACTTTTTACATCTTTGTCCATTGCTTAAAGATTGCTTGTTGGAGTTTAAAAAGCTCT
GTGTTCTTGGCAAAACACTTACCATTTTGGCAAGTGAATGGCCATTTTTTACAGATGTTAAAAAGAATAA
AGACAATTTAACTGTTCCTAAAGCTGTAGAGTGGCTAAAGGAACACGGCTATGAGATATATAATTCTCAA
TTGCCTTTACATATGTCTTTAGCAAAATTACATGACTTACCACAAGCACAGTTTGCTGAAGCGGCTGGTT
TATGTCATTATTTTGATCCTCGAGAGTTTGCTTTACCTTGCGCTCTTGAAGTAGTTAAGATAGGTGGTGG
TAAAGTTAATGGTAGATCCATTCCACTTGCCCGCTTCCCAATTAATAATGAGTTTAAATTCATTCCTTAT
CTTTATCAATGTGTTTAGGCCATTAACGAACTTATGGCTTTTTCAGCTTCTTTATTTCGGACTAAAACAG
TCCATACTGAAGATGCATTTTGCCCTCGTTCGGCTATTCAGGCTGAACAGCCTCCTAATATCATAGACTG
CATACCAGTTGCAGGCTATGAAGCTGCATTAATCACTAATGCACTTTTCCTATTAGTATTATTTGTCTTT
AACCCACTTACCTGTAAGGGCAATTGGATTAAAGCTATTTTGTTTTACAGCTTATTGCTGTATAATATGA
TATTAGCCATATTTTTGGTTGTTGATACACAACATTTTGTTAGTGCTTTGTTGCTAGCTTATGTTGTTAC
TTTTCTAGTCTTGTGGACTGCTGACCGAATACGTCTCAGTTGTGCAGTAGGAAGTGTATTACCCTTTGTC
GATATGCGGTCTTCCTATATCCGTGTTGACAACGGTAATTCCAGTGTTGTAGTTCCAATGAACCACACAA
AGCACTGGTTTATAAGAAATTTTGAGCAATCTTGTCATTGTGAAAATTGTTTTTATATTCACTCTTCATC
TTATGTTGAGTGTACTTTTATTAGTCGCCTAAAGAAATCCATACTTGTTTCAGTTTGTGATTTTTCTTTA
GGTGGTAATGTTTCTACTGTTTTTGTCCCTTCTAGTGATAAAACAGTACCCCTTCACATAATCGCACCTA
GCAAGCTTTATGTCTAAGCTTGTTTAATGCTTCTATGGGTCCTATGTTTAGTCTCTGACTAACCTTGGAC
ATTTGGAAAACGAACTATGTTACCTTTTGTCCATGAACAAATAGGTACTATCATAGTAAATTTTTTCATT
TTAACCGTAGTATGCGCTATTACATTAGTGGTGTGTTTAGCAATCCTTACGGCTATTAGATTATGTGTGC
AATGTGCTTCGGGTGTTAACACTCTTTTGTTTGTACCCGCGTTCTACATCTATAATACTGGGCGCAACGC
CTATTTTAAGTTTCAAGAGAATCGTCCACCCTTTCCTCCTGAGGACTGGGTTTAACGAACTCTTTAAATA
TGTCGTCGAACGGTAGTCTTACCAAAGATGAGGTAGTAAATATTATTAAGGACTGGAATTTTTCATGGTC
CATAATATTCCTACTTATTACTATCGTACTCCAATATGGTTATCCATCTAGGAGTATGATGGTTTACGTC
TTTAAGATGTTCATATTATGGCTTTTATGGCCAGCTTCTATGGCACTGTCCATATTTAGTGCTATTTATC
CTATTAGTTTATCATCCCAGATTATATCTGGCATTCTAGCAGCAATCTGTGCTGTTATGTGGCTAGCGTA
CTTTGTTCAGAGTATAAGGCTATTTATGCGCACTGGTTCCTGGTGGTCTTTTAATCCAGAATCTAATTGT
CTGCTCAATGTCCCAATCGGTGGTACAACAGTTGTTAGGCCCTTGGTCGAAGATTCGACTAGTGTTACTG
CTGTTGTCAACGACGGTCATCTTAAGATGGCTGGTATGCACTTTGGTCGCTGTGACTACGATAGACTTCC
TATGGAAATCACCGTAGCCAAGCCCTCTGTGCTTATAGCACTTAAGATGGTTAAACGCCAATCATATGGT
ACAAATTCTGGTGTTGCCATATTCCATAGGTATAAAGCTGGTAATTATAGAAGACCTACTATTATACAAG
ATGAAGAACTTGCATTGCTTAGGGCATAGTAAGTGAGATTTTAACGAATCTTAATAACTCATTGTTATGG
CAACTCCTGCTGCACCTCGCACCATTAGTTTTGCTGATAATAATGACAACCAGCCTAATCAGCAGCAGCG
TGGACGCGGAAGAAACCCTAAGCCACGACCTGCTCCCAATAACACTGTCTCCTGGTACACAGGGCTCACC
CAACACGGTAAAAACCCGCTTGCCTTCCCTCCTGGACAGGGTGTACCTCTTAATGCCAATTCTACAACAG
CCCAGAATGCTGGATACTGGCGGAGACAAGACCGGAAAATCAACACCGGTAATGGTGTTAAACAATTGGC
TCCCAGATGGTTCTTCTACTACACTGGGACTGGACCAGAGGCTAATCTACCTTTTAGATCAGTCAAGGAT
GGCATCGTCTGGGTTTATGAAGAAGGTGCCACTGATGCTCCTTCAGTCTTTGGGACTCGCAACCCAGCAA
ATGATGCTGCTATCGTTTGCCAGTTTGCGCCAGGTACTCTCATTCCTAAAAACTTCCACATTGAAGGGAC
TGGGGGTAATAGTCAGTCATCTTCAAGAGCATCCTCCAACAGTAGGAACTCTTCTAGATCCAGTTCCAGA
GGAGGACGAAGCACTTCTAACTCCAGAGGGACTTCCCCAGTTTCACATGGAGTCGGAAGTGCAGAATCCT
TAGCTGCTCTGCCATTGCTTCTAGACTTGCAGAAGCGTTTGGCTGATCTTGAGTCTGGAAAGTCAAAGCA
GCCTAAAGTTGTCACCAAAAAGGACGCTGCCGCTGCAAAAAATAAAATGCGCCATAAGCGTGTTGCCACC
AAAGGTTTCAATGTAACTCAGGCTTTTGGTCTTCGTGGACCAGGCCCATTGCAGGGAAATTTTGGTGACA
TGAACTACAACAAGTTTGGTACTGAGGACCCTCGTTGGCCTCAGATGGCTGAACTTGCTCCTTCAGCTTC
AGCTTTCATGAGTATGTCTCAATTTAAGCTTACCCATCAAAGCAATGATGACAAAGGTGATCCTATTTAC
TTTTTGTCATATTCAGGAGCAATTAAACTAGACCCTAAGAATCCCAACTACAAAAAGTGGCTGGAGCTTC
TTGAGTCAAATATTGATGCTTACAAAACTTTCCCTAAGAAAGAGCGTAAGCCTAAAACTACAGAAGATGG
AGCTGTTGCTTCTTCTTCAGCTAGTCAAATGGAGGATGTTGATGCTAAACCTCAGCGAAAGCCTAAAAGC
CGAGTAGCAGGTAGCATTACCATGCGTTCTGGAAGCTTACCAGCTCTTCAGGACGTTACCTTCGATTCAG
AGGCTTGAATGCCAATGAAGAGTAACAAGAGTTGAGGCAACTGCTAGCGTTCAGGTAACCCCTTTACGTG
ATGCATTTGTCCACTCTTGCACAGAATGGAATCATGTTAAACTTACAGTGCAAGAAAGTAAGTTAACCCA
TTTAATTGATAGCTATGCTTAGTGTAATGTGTAACTATAGAGAGTAATTTAAAGACTGTCACCTCTGCGT
GATTGCAAGTGAACAGTGCCCCTGTGGAAGAGCTCTATAGTGTAAAGTGTAAATAAAAATAGCTATTATT
CAATTAGATTAGGCTTAATAGATGATTAACAAAAAAAAAAAAAAAA

>gi|30271926|ref|NC_004718.3| SARS coronavirus, complete genome
ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTGTAGATCTGTTCTCTAAACGA
ACTTTAAAATCTGTGTAGCTGTCGCTCGGCTGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAA
TTTTACTGTCGTTGACAAGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTTTCGTCCGTGT
TGCAGTCGATCATCAGCATACCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTTC
TTGGTGTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTCCTTCAGGTTAGAGACGTGCTAGTGCG
TGGCTTCGGGGACTCTGTGGAAGAGGCCCTATCGGAGGCACGTGAACACCTCAAAAATGGCACTTGTGGT
CTAGTAGAGCTGGAAAAAGGCGTACTGCCCCAGCTTGAACAGCCCTATGTGTTCATTAAACGTTCTGATG
CCTTAAGCACCAATCACGGCCACAAGGTCGTTGAGCTGGTTGCAGAAATGGACGGCATTCAGTACGGTCG
TAGCGGTATAACACTGGGAGTACTCGTGCCACATGTGGGCGAAACCCCAATTGCATACCGCAATGTTCTT
CTTCGTAAGAACGGTAATAAGGGAGCCGGTGGTCATAGCTATGGCATCGATCTAAAGTCTTATGACTTAG
GTGACGAGCTTGGCACTGATCCCATTGAAGATTATGAACAAAACTGGAACACTAAGCATGGCAGTGGTGC
ACTCCGTGAACTCACTCGTGAGCTCAATGGAGGTGCAGTCACTCGCTATGTCGACAACAATTTCTGTGGC
CCAGATGGGTACCCTCTTGATTGCATCAAAGATTTTCTCGCACGCGCGGGCAAGTCAATGTGCACTCTTT
CCGAACAACTTGATTACATCGAGTCGAAGAGAGGTGTCTACTGCTGCCGTGACCATGAGCATGAAATTGC
CTGGTTCACTGAGCGCTCTGATAAGAGCTACGAGCACCAGACACCCTTCGAAATTAAGAGTGCCAAGAAA
TTTGACACTTTCAAAGGGGAATGCCCAAAGTTTGTGTTTCCTCTTAACTCAAAAGTCAAAGTCATTCAAC
CACGTGTTGAAAAGAAAAAGACTGAGGGTTTCATGGGGCGTATACGCTCTGTGTACCCTGTTGCATCTCC
ACAGGAGTGTAACAATATGCACTTGTCTACCTTGATGAAATGTAATCATTGCGATGAAGTTTCATGGCAG
ACGTGCGACTTTCTGAAAGCCACTTGTGAACATTGTGGCACTGAAAATTTAGTTATTGAAGGACCTACTA
CATGTGGGTACCTACCTACTAATGCTGTAGTGAAAATGCCATGTCCTGCCTGTCAAGACCCAGAGATTGG
ACCTGAGCATAGTGTTGCAGATTATCACAACCACTCAAACATTGAAACTCGACTCCGCAAGGGAGGTAGG
ACTAGATGTTTTGGAGGCTGTGTGTTTGCCTATGTTGGCTGCTATAATAAGCGTGCCTACTGGGTTCCTC
GTGCTAGTGCTGATATTGGCTCAGGCCATACTGGCATTACTGGTGACAATGTGGAGACCTTGAATGAGGA
TCTCCTTGAGATACTGAGTCGTGAACGTGTTAACATTAACATTGTTGGCGATTTTCATTTGAATGAAGAG
GTTGCCATCATTTTGGCATCTTTCTCTGCTTCTACAAGTGCCTTTATTGACACTATAAAGAGTCTTGATT
ACAAGTCTTTCAAAACCATTGTTGAGTCCTGCGGTAACTATAAAGTTACCAAGGGAAAGCCCGTAAAAGG
TGCTTGGAACATTGGACAACAGAGATCAGTTTTAACACCACTGTGTGGTTTTCCCTCACAGGCTGCTGGT
GTTATCAGATCAATTTTTGCGCGCACACTTGATGCAGCAAACCACTCAATTCCTGATTTGCAAAGAGCAG
CTGTCACCATACTTGATGGTATTTCTGAACAGTCATTACGTCTTGTCGACGCCATGGTTTATACTTCAGA
CCTGCTCACCAACAGTGTCATTATTATGGCATATGTAACTGGTGGTCTTGTACAACAGACTTCTCAGTGG
TTGTCTAATCTTTTGGGCACTACTGTTGAAAAACTCAGGCCTATCTTTGAATGGATTGAGGCGAAACTTA
GTGCAGGAGTTGAATTTCTCAAGGATGCTTGGGAGATTCTCAAATTTCTCATTACAGGTGTTTTTGACAT
CGTCAAGGGTCAAATACAGGTTGCTTCAGATAACATCAAGGATTGTGTAAAATGCTTCATTGATGTTGTT
AACAAGGCACTCGAAATGTGCATTGATCAAGTCACTATCGCTGGCGCAAAGTTGCGATCACTCAACTTAG
GTGAAGTCTTCATCGCTCAAAGCAAGGGACTTTACCGTCAGTGTATACGTGGCAAGGAGCAGCTGCAACT
ACTCATGCCTCTTAAGGCACCAAAAGAAGTAACCTTTCTTGAAGGTGATTCACATGACACAGTACTTACC
TCTGAGGAGGTTGTTCTCAAGAACGGTGAACTCGAAGCACTCGAGACGCCCGTTGATAGCTTCACAAATG
GAGCTATCGTTGGCACACCAGTCTGTGTAAATGGCCTCATGCTCTTAGAGATTAAGGACAAAGAACAATA
CTGCGCATTGTCTCCTGGTTTACTGGCTACAAACAATGTCTTTCGCTTAAAAGGGGGTGCACCAATTAAA
GGTGTAACCTTTGGAGAAGATACTGTTTGGGAAGTTCAAGGTTACAAGAATGTGAGAATCACATTTGAGC
TTGATGAACGTGTTGACAAAGTGCTTAATGAAAAGTGCTCTGTCTACACTGTTGAATCCGGTACCGAAGT
TACTGAGTTTGCATGTGTTGTAGCAGAGGCTGTTGTGAAGACTTTACAACCAGTTTCTGATCTCCTTACC
AACATGGGTATTGATCTTGATGAGTGGAGTGTAGCTACATTCTACTTATTTGATGATGCTGGTGAAGAAA
ACTTTTCATCACGTATGTATTGTTCCTTTTACCCTCCAGATGAGGAAGAAGAGGACGATGCAGAGTGTGA
GGAAGAAGAAATTGATGAAACCTGTGAACATGAGTACGGTACAGAGGATGATTATCAAGGTCTCCCTCTG
GAATTTGGTGCCTCAGCTGAAACAGTTCGAGTTGAGGAAGAAGAAGAGGAAGACTGGCTGGATGATACTA
CTGAGCAATCAGAGATTGAGCCAGAACCAGAACCTACACCTGAAGAACCAGTTAATCAGTTTACTGGTTA
TTTAAAACTTACTGACAATGTTGCCATTAAATGTGTTGACATCGTTAAGGAGGCACAAAGTGCTAATCCT
ATGGTGATTGTAAATGCTGCTAACATACACCTGAAACATGGTGGTGGTGTAGCAGGTGCACTCAACAAGG
CAACCAATGGTGCCATGCAAAAGGAGAGTGATGATTACATTAAGCTAAATGGCCCTCTTACAGTAGGAGG
GTCTTGTTTGCTTTCTGGACATAATCTTGCTAAGAAGTGTCTGCATGTTGTTGGACCTAACCTAAATGCA
GGTGAGGACATCCAGCTTCTTAAGGCAGCATATGAAAATTTCAATTCACAGGACATCTTACTTGCACCAT
TGTTGTCAGCAGGCATATTTGGTGCTAAACCACTTCAGTCTTTACAAGTGTGCGTGCAGACGGTTCGTAC
ACAGGTTTATATTGCAGTCAATGACAAAGCTCTTTATGAGCAGGTTGTCATGGATTATCTTGATAACCTG
AAGCCTAGAGTGGAAGCACCTAAACAAGAGGAGCCACCAAACACAGAAGATTCCAAAACTGAGGAGAAAT
CTGTCGTACAGAAGCCTGTCGATGTGAAGCCAAAAATTAAGGCCTGCATTGATGAGGTTACCACAACACT
GGAAGAAACTAAGTTTCTTACCAATAAGTTACTCTTGTTTGCTGATATCAATGGTAAGCTTTACCATGAT
TCTCAGAACATGCTTAGAGGTGAAGATATGTCTTTCCTTGAGAAGGATGCACCTTACATGGTAGGTGATG
TTATCACTAGTGGTGATATCACTTGTGTTGTAATACCCTCCAAAAAGGCTGGTGGCACTACTGAGATGCT
CTCAAGAGCTTTGAAGAAAGTGCCAGTTGATGAGTATATAACCACGTACCCTGGACAAGGATGTGCTGGT
TATACACTTGAGGAAGCTAAGACTGCTCTTAAGAAATGCAAATCTGCATTTTATGTACTACCTTCAGAAG
CACCTAATGCTAAGGAAGAGATTCTAGGAACTGTATCCTGGAATTTGAGAGAAATGCTTGCTCATGCTGA
AGAGACAAGAAAATTAATGCCTATATGCATGGATGTTAGAGCCATAATGGCAACCATCCAACGTAAGTAT
AAAGGAATTAAAATTCAAGAGGGCATCGTTGACTATGGTGTCCGATTCTTCTTTTATACTAGTAAAGAGC
CTGTAGCTTCTATTATTACGAAGCTGAACTCTCTAAATGAGCCGCTTGTCACAATGCCAATTGGTTATGT
GACACATGGTTTTAATCTTGAAGAGGCTGCGCGCTGTATGCGTTCTCTTAAAGCTCCTGCCGTAGTGTCA
GTATCATCACCAGATGCTGTTACTACATATAATGGATACCTCACTTCGTCATCAAAGACATCTGAGGAGC
ACTTTGTAGAAACAGTTTCTTTGGCTGGCTCTTACAGAGATTGGTCCTATTCAGGACAGCGTACAGAGTT
AGGTGTTGAATTTCTTAAGCGTGGTGACAAAATTGTGTACCACACTCTGGAGAGCCCCGTCGAGTTTCAT
CTTGACGGTGAGGTTCTTTCACTTGACAAACTAAAGAGTCTCTTATCCCTGCGGGAGGTTAAGACTATAA
AAGTGTTCACAACTGTGGACAACACTAATCTCCACACACAGCTTGTGGATATGTCTATGACATATGGACA
GCAGTTTGGTCCAACATACTTGGATGGTGCTGATGTTACAAAAATTAAACCTCATGTAAATCATGAGGGT
AAGACTTTCTTTGTACTACCTAGTGATGACACACTACGTAGTGAAGCTTTCGAGTACTACCATACTCTTG
ATGAGAGTTTTCTTGGTAGGTACATGTCTGCTTTAAACCACACAAAGAAATGGAAATTTCCTCAAGTTGG
TGGTTTAACTTCAATTAAATGGGCTGATAACAATTGTTATTTGTCTAGTGTTTTATTAGCACTTCAACAG
CTTGAAGTCAAATTCAATGCACCAGCACTTCAAGAGGCTTATTATAGAGCCCGTGCTGGTGATGCTGCTA
ACTTTTGTGCACTCATACTCGCTTACAGTAATAAAACTGTTGGCGAGCTTGGTGATGTCAGAGAAACTAT
GACCCATCTTCTACAGCATGCTAATTTGGAATCTGCAAAGCGAGTTCTTAATGTGGTGTGTAAACATTGT
GGTCAGAAAACTACTACCTTAACGGGTGTAGAAGCTGTGATGTATATGGGTACTCTATCTTATGATAATC
TTAAGACAGGTGTTTCCATTCCATGTGTGTGTGGTCGTGATGCTACACAATATCTAGTACAACAAGAGTC
TTCTTTTGTTATGATGTCTGCACCACCTGCTGAGTATAAATTACAGCAAGGTACATTCTTATGTGCGAAT
GAGTACACTGGTAACTATCAGTGTGGTCATTACACTCATATAACTGCTAAGGAGACCCTCTATCGTATTG
ACGGAGCTCACCTTACAAAGATGTCAGAGTACAAAGGACCAGTGACTGATGTTTTCTACAAGGAAACATC
TTACACTACAACCATCAAGCCTGTGTCGTATAAACTCGATGGAGTTACTTACACAGAGATTGAACCAAAA
TTGGATGGGTATTATAAAAAGGATAATGCTTACTATACAGAGCAGCCTATAGACCTTGTACCAACTCAAC
CATTACCAAATGCGAGTTTTGATAATTTCAAACTCACATGTTCTAACACAAAATTTGCTGATGATTTAAA
TCAAATGACAGGCTTCACAAAGCCAGCTTCACGAGAGCTATCTGTCACATTCTTCCCAGACTTGAATGGC
GATGTAGTGGCTATTGACTATAGACACTATTCAGCGAGTTTCAAGAAAGGTGCTAAATTACTGCATAAGC
CAATTGTTTGGCACATTAACCAGGCTACAACCAAGACAACGTTCAAACCAAACACTTGGTGTTTACGTTG
TCTTTGGAGTACAAAGCCAGTAGATACTTCAAATTCATTTGAAGTTCTGGCAGTAGAAGACACACAAGGA
ATGGACAATCTTGCTTGTGAAAGTCAACAACCCACCTCTGAAGAAGTAGTGGAAAATCCTACCATACAGA
AGGAAGTCATAGAGTGTGACGTGAAAACTACCGAAGTTGTAGGCAATGTCATACTTAAACCATCAGATGA
AGGTGTTAAAGTAACACAAGAGTTAGGTCATGAGGATCTTATGGCTGCTTATGTGGAAAACACAAGCATT
ACCATTAAGAAACCTAATGAGCTTTCACTAGCCTTAGGTTTAAAAACAATTGCCACTCATGGTATTGCTG
CAATTAATAGTGTTCCTTGGAGTAAAATTTTGGCTTATGTCAAACCATTCTTAGGACAAGCAGCAATTAC
AACATCAAATTGCGCTAAGAGATTAGCACAACGTGTGTTTAACAATTATATGCCTTATGTGTTTACATTA
TTGTTCCAATTGTGTACTTTTACTAAAAGTACCAATTCTAGAATTAGAGCTTCACTACCTACAACTATTG
CTAAAAATAGTGTTAAGAGTGTTGCTAAATTATGTTTGGATGCCGGCATTAATTATGTGAAGTCACCCAA
ATTTTCTAAATTGTTCACAATCGCTATGTGGCTATTGTTGTTAAGTATTTGCTTAGGTTCTCTAATCTGT
GTAACTGCTGCTTTTGGTGTACTCTTATCTAATTTTGGTGCTCCTTCTTATTGTAATGGCGTTAGAGAAT
TGTATCTTAATTCGTCTAACGTTACTACTATGGATTTCTGTGAAGGTTCTTTTCCTTGCAGCATTTGTTT
AAGTGGATTAGACTCCCTTGATTCTTATCCAGCTCTTGAAACCATTCAGGTGACGATTTCATCGTACAAG
CTAGACTTGACAATTTTAGGTCTGGCCGCTGAGTGGGTTTTGGCATATATGTTGTTCACAAAATTCTTTT
ATTTATTAGGTCTTTCAGCTATAATGCAGGTGTTCTTTGGCTATTTTGCTAGTCATTTCATCAGCAATTC
TTGGCTCATGTGGTTTATCATTAGTATTGTACAAATGGCACCCGTTTCTGCAATGGTTAGGATGTACATC
TTCTTTGCTTCTTTCTACTACATATGGAAGAGCTATGTTCATATCATGGATGGTTGCACCTCTTCGACTT
GCATGATGTGCTATAAGCGCAATCGTGCCACACGCGTTGAGTGTACAACTATTGTTAATGGCATGAAGAG
ATCTTTCTATGTCTATGCAAATGGAGGCCGTGGCTTCTGCAAGACTCACAATTGGAATTGTCTCAATTGT
GACACATTTTGCACTGGTAGTACATTCATTAGTGATGAAGTTGCTCGTGATTTGTCACTCCAGTTTAAAA
GACCAATCAACCCTACTGACCAGTCATCGTATATTGTTGATAGTGTTGCTGTGAAAAATGGCGCGCTTCA
CCTCTACTTTGACAAGGCTGGTCAAAAGACCTATGAGAGACATCCGCTCTCCCATTTTGTCAATTTAGAC
AATTTGAGAGCTAACAACACTAAAGGTTCACTGCCTATTAATGTCATAGTTTTTGATGGCAAGTCCAAAT
GCGACGAGTCTGCTTCTAAGTCTGCTTCTGTGTACTACAGTCAGCTGATGTGCCAACCTATTCTGTTGCT
TGACCAAGCTCTTGTATCAGACGTTGGAGATAGTACTGAAGTTTCCGTTAAGATGTTTGATGCTTATGTC
GACACCTTTTCAGCAACTTTTAGTGTTCCTATGGAAAAACTTAAGGCACTTGTTGCTACAGCTCACAGCG
AGTTAGCAAAGGGTGTAGCTTTAGATGGTGTCCTTTCTACATTCGTGTCAGCTGCCCGACAAGGTGTTGT
TGATACCGATGTTGACACAAAGGATGTTATTGAATGTCTCAAACTTTCACATCACTCTGACTTAGAAGTG
ACAGGTGACAGTTGTAACAATTTCATGCTCACCTATAATAAGGTTGAAAACATGACGCCCAGAGATCTTG
GCGCATGTATTGACTGTAATGCAAGGCATATCAATGCCCAAGTAGCAAAAAGTCACAATGTTTCACTCAT
CTGGAATGTAAAAGACTACATGTCTTTATCTGAACAGCTGCGTAAACAAATTCGTAGTGCTGCCAAGAAG
AACAACATACCTTTTAGACTAACTTGTGCTACAACTAGACAGGTTGTCAATGTCATAACTACTAAAATCT
CACTCAAGGGTGGTAAGATTGTTAGTACTTGTTTTAAACTTATGCTTAAGGCCACATTATTGTGCGTTCT
TGCTGCATTGGTTTGTTATATCGTTATGCCAGTACATACATTGTCAATCCATGATGGTTACACAAATGAA
ATCATTGGTTACAAAGCCATTCAGGATGGTGTCACTCGTGACATCATTTCTACTGATGATTGTTTTGCAA
ATAAACATGCTGGTTTTGACGCATGGTTTAGCCAGCGTGGTGGTTCATACAAAAATGACAAAAGCTGCCC
TGTAGTAGCTGCTATCATTACAAGAGAGATTGGTTTCATAGTGCCTGGCTTACCGGGTACTGTGCTGAGA
GCAATCAATGGTGACTTCTTGCATTTTCTACCTCGTGTTTTTAGTGCTGTTGGCAACATTTGCTACACAC
CTTCCAAACTCATTGAGTATAGTGATTTTGCTACCTCTGCTTGCGTTCTTGCTGCTGAGTGTACAATTTT
TAAGGATGCTATGGGCAAACCTGTGCCATATTGTTATGACACTAATTTGCTAGAGGGTTCTATTTCTTAT
AGTGAGCTTCGTCCAGACACTCGTTATGTGCTTATGGATGGTTCCATCATACAGTTTCCTAACACTTACC
TGGAGGGTTCTGTTAGAGTAGTAACAACTTTTGATGCTGAGTACTGTAGACATGGTACATGCGAAAGGTC
AGAAGTAGGTATTTGCCTATCTACCAGTGGTAGATGGGTTCTTAATAATGAGCATTACAGAGCTCTATCA
GGAGTTTTCTGTGGTGTTGATGCGATGAATCTCATAGCTAACATCTTTACTCCTCTTGTGCAACCTGTGG
GTGCTTTAGATGTGTCTGCTTCAGTAGTGGCTGGTGGTATTATTGCCATATTGGTGACTTGTGCTGCCTA
CTACTTTATGAAATTCAGACGTGTTTTTGGTGAGTACAACCATGTTGTTGCTGCTAATGCACTTTTGTTT
TTGATGTCTTTCACTATACTCTGTCTGGTACCAGCTTACAGCTTTCTGCCGGGAGTCTACTCAGTCTTTT
ACTTGTACTTGACATTCTATTTCACCAATGATGTTTCATTCTTGGCTCACCTTCAATGGTTTGCCATGTT
TTCTCCTATTGTGCCTTTTTGGATAACAGCAATCTATGTATTCTGTATTTCTCTGAAGCACTGCCATTGG
TTCTTTAACAACTATCTTAGGAAAAGAGTCATGTTTAATGGAGTTACATTTAGTACCTTCGAGGAGGCTG
CTTTGTGTACCTTTTTGCTCAACAAGGAAATGTACCTAAAATTGCGTAGCGAGACACTGTTGCCACTTAC
ACAGTATAACAGGTATCTTGCTCTATATAACAAGTACAAGTATTTCAGTGGAGCCTTAGATACTACCAGC
TATCGTGAAGCAGCTTGCTGCCACTTAGCAAAGGCTCTAAATGACTTTAGCAACTCAGGTGCTGATGTTC
TCTACCAACCACCACAGACATCAATCACTTCTGCTGTTCTGCAGAGTGGTTTTAGGAAAATGGCATTCCC
GTCAGGCAAAGTTGAAGGGTGCATGGTACAAGTAACCTGTGGAACTACAACTCTTAATGGATTGTGGTTG
GATGACACAGTATACTGTCCAAGACATGTCATTTGCACAGCAGAAGACATGCTTAATCCTAACTATGAAG
ATCTGCTCATTCGCAAATCCAACCATAGCTTTCTTGTTCAGGCTGGCAATGTTCAACTTCGTGTTATTGG
CCATTCTATGCAAAATTGTCTGCTTAGGCTTAAAGTTGATACTTCTAACCCTAAGACACCCAAGTATAAA
TTTGTCCGTATCCAACCTGGTCAAACATTTTCAGTTCTAGCATGCTACAATGGTTCACCATCTGGTGTTT
ATCAGTGTGCCATGAGACCTAATCATACCATTAAAGGTTCTTTCCTTAATGGATCATGTGGTAGTGTTGG
TTTTAACATTGATTATGATTGCGTGTCTTTCTGCTATATGCATCATATGGAGCTTCCAACAGGAGTACAC
GCTGGTACTGACTTAGAAGGTAAATTCTATGGTCCATTTGTTGACAGACAAACTGCACAGGCTGCAGGTA
CAGACACAACCATAACATTAAATGTTTTGGCATGGCTGTATGCTGCTGTTATCAATGGTGATAGGTGGTT
TCTTAATAGATTCACCACTACTTTGAATGACTTTAACCTTGTGGCAATGAAGTACAACTATGAACCTTTG
ACACAAGATCATGTTGACATATTGGGACCTCTTTCTGCTCAAACAGGAATTGCCGTCTTAGATATGTGTG
CTGCTTTGAAAGAGCTGCTGCAGAATGGTATGAATGGTCGTACTATCCTTGGTAGCACTATTTTAGAAGA
TGAGTTTACACCATTTGATGTTGTTAGACAATGCTCTGGTGTTACCTTCCAAGGTAAGTTCAAGAAAATT
GTTAAGGGCACTCATCATTGGATGCTTTTAACTTTCTTGACATCACTATTGATTCTTGTTCAAAGTACAC
AGTGGTCACTGTTTTTCTTTGTTTACGAGAATGCTTTCTTGCCATTTACTCTTGGTATTATGGCAATTGC
TGCATGTGCTATGCTGCTTGTTAAGCATAAGCACGCATTCTTGTGCTTGTTTCTGTTACCTTCTCTTGCA
ACAGTTGCTTACTTTAATATGGTCTACATGCCTGCTAGCTGGGTGATGCGTATCATGACATGGCTTGAAT
TGGCTGACACTAGCTTGTCTGGTTATAGGCTTAAGGATTGTGTTATGTATGCTTCAGCTTTAGTTTTGCT
TATTCTCATGACAGCTCGCACTGTTTATGATGATGCTGCTAGACGTGTTTGGACACTGATGAATGTCATT
ACACTTGTTTACAAAGTCTACTATGGTAATGCTTTAGATCAAGCTATTTCCATGTGGGCCTTAGTTATTT
CTGTAACCTCTAACTATTCTGGTGTCGTTACGACTATCATGTTTTTAGCTAGAGCTATAGTGTTTGTGTG
TGTTGAGTATTACCCATTGTTATTTATTACTGGCAACACCTTACAGTGTATCATGCTTGTTTATTGTTTC
TTAGGCTATTGTTGCTGCTGCTACTTTGGCCTTTTCTGTTTACTCAACCGTTACTTCAGGCTTACTCTTG
GTGTTTATGACTACTTGGTCTCTACACAAGAATTTAGGTATATGAACTCCCAGGGGCTTTTGCCTCCTAA
GAGTAGTATTGATGCTTTCAAGCTTAACATTAAGTTGTTGGGTATTGGAGGTAAACCATGTATCAAGGTT
GCTACTGTACAGTCTAAAATGTCTGACGTAAAGTGCACATCTGTGGTACTGCTCTCGGTTCTTCAACAAC
TTAGAGTAGAGTCATCTTCTAAATTGTGGGCACAATGTGTACAACTCCACAATGATATTCTTCTTGCAAA
AGACACAACTGAAGCTTTCGAGAAGATGGTTTCTCTTTTGTCTGTTTTGCTATCCATGCAGGGTGCTGTA
GACATTAATAGGTTGTGCGAGGAAATGCTCGATAACCGTGCTACTCTTCAGGCTATTGCTTCAGAATTTA
GTTCTTTACCATCATATGCCGCTTATGCCACTGCCCAGGAGGCCTATGAGCAGGCTGTAGCTAATGGTGA
TTCTGAAGTCGTTCTCAAAAAGTTAAAGAAATCTTTGAATGTGGCTAAATCTGAGTTTGACCGTGATGCT
GCCATGCAACGCAAGTTGGAAAAGATGGCAGATCAGGCTATGACCCAAATGTACAAACAGGCAAGATCTG
AGGACAAGAGGGCAAAAGTAACTAGTGCTATGCAAACAATGCTCTTCACTATGCTTAGGAAGCTTGATAA
TGATGCACTTAACAACATTATCAACAATGCGCGTGATGGTTGTGTTCCACTCAACATCATACCATTGACT
ACAGCAGCCAAACTCATGGTTGTTGTCCCTGATTATGGTACCTACAAGAACACTTGTGATGGTAACACCT
TTACATATGCATCTGCACTCTGGGAAATCCAGCAAGTTGTTGATGCGGATAGCAAGATTGTTCAACTTAG
TGAAATTAACATGGACAATTCACCAAATTTGGCTTGGCCTCTTATTGTTACAGCTCTAAGAGCCAACTCA
GCTGTTAAACTACAGAATAATGAACTGAGTCCAGTAGCACTACGACAGATGTCCTGTGCGGCTGGTACCA
CACAAACAGCTTGTACTGATGACAATGCACTTGCCTACTATAACAATTCGAAGGGAGGTAGGTTTGTGCT
GGCATTACTATCAGACCACCAAGATCTCAAATGGGCTAGATTCCCTAAGAGTGATGGTACAGGTACAATT
TACACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCAAAAGGGCCTAAAGTGAAATACTTGT
ACTTCATCAAAGGCTTAAACAACCTAAATAGAGGTATGGTGCTGGGCAGTTTAGCTGCTACAGTACGTCT
TCAGGCTGGAAATGCTACAGAAGTACCTGCCAATTCAACTGTGCTTTCCTTCTGTGCTTTTGCAGTAGAC
CCTGCTAAAGCATATAAGGATTACCTAGCAAGTGGAGGACAACCAATCACCAACTGTGTGAAGATGTTGT
GTACACACACTGGTACAGGACAGGCAATTACTGTAACACCAGAAGCTAACATGGACCAAGAGTCCTTTGG
TGGTGCTTCATGTTGTCTGTATTGTAGATGCCACATTGACCATCCAAATCCTAAAGGATTCTGTGACTTG
AAAGGTAAGTACGTCCAAATACCTACCACTTGTGCTAATGACCCAGTGGGTTTTACACTTAGAAACACAG
TCTGTACCGTCTGCGGAATGTGGAAAGGTTATGGCTGTAGTTGTGACCAACTCCGCGAACCCTTGATGCA
GTCTGCGGATGCATCAACGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCA
CAGGCACTAGTACTGATGTCGTCTACAGGGCTTTTGATATTTACAACGAAAAAGTTGCTGGTTTTGCAAA
GTTCCTAAAAACTAATTGCTGTCGCTTCCAGGAGAAGGATGAGGAAGGCAATTTATTAGACTCTTACTTT
GTAGTTAAGAGGCATACTATGTCTAACTACCAACATGAAGAGACTATTTATAACTTGGTTAAAGATTGTC
CAGCGGTTGCTGTCCATGACTTTTTCAAGTTTAGAGTAGATGGTGACATGGTACCACATATATCACGTCA
GCGTCTAACTAAATACACAATGGCTGATTTAGTCTATGCTCTACGTCATTTTGATGAGGGTAATTGTGAT
ACATTAAAAGAAATACTCGTCACATACAATTGCTGTGATGATGATTATTTCAATAAGAAGGATTGGTATG
ACTTCGTAGAGAATCCTGACATCTTACGCGTATATGCTAACTTAGGTGAGCGTGTACGCCAATCATTATT
AAAGACTGTACAATTCTGCGATGCTATGCGTGATGCAGGCATTGTAGGCGTACTGACATTAGATAATCAG
GATCTTAATGGGAACTGGTACGATTTCGGTGATTTCGTACAAGTAGCACCAGGCTGCGGAGTTCCTATTG
TGGATTCATATTACTCATTGCTGATGCCCATCCTCACTTTGACTAGGGCATTGGCTGCTGAGTCCCATAT
GGATGCTGATCTCGCAAAACCACTTATTAAGTGGGATTTGCTGAAATATGATTTTACGGAAGAGAGACTT
TGTCTCTTCGACCGTTATTTTAAATATTGGGACCAGACATACCATCCCAATTGTATTAACTGTTTGGATG
ATAGGTGTATCCTTCATTGTGCAAACTTTAATGTGTTATTTTCTACTGTGTTTCCACCTACAAGTTTTGG
ACCACTAGTAAGAAAAATATTTGTAGATGGTGTTCCTTTTGTTGTTTCAACTGGATACCATTTTCGTGAG
TTAGGAGTCGTACATAATCAGGATGTAAACTTACATAGCTCGCGTCTCAGTTTCAAGGAACTTTTAGTGT
ATGCTGCTGATCCAGCTATGCATGCAGCTTCTGGCAATTTATTGCTAGATAAACGCACTACATGCTTTTC
AGTAGCTGCACTAACAAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAATAAAGACTTTTAT
GACTTTGCTGTGTCTAAAGGTTTCTTTAAGGAAGGAAGTTCTGTTGAACTAAAACACTTCTTCTTTGCTC
AGGATGGCAACGCTGCTATCAGTGATTATGACTATTATCGTTATAATCTGCCAACAATGTGTGATATCAG
ACAACTCCTATTCGTAGTTGAAGTTGTTGATAAATACTTTGATTGTTACGATGGTGGCTGTATTAATGCC
AACCAAGTAATCGTTAACAATCTGGATAAATCAGCTGGTTTCCCATTTAATAAATGGGGTAAGGCTAGAC
TTTATTATGACTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCGTATACTAAGCGTAATGTCATCCC
TACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTC
TCTATCTGTAGTACTATGACAAATAGACAGTTTCATCAGAAATTATTGAAGTCAATAGCCGCCACTAGAG
GAGCTACTGTGGTAATTGGAACAAGCAAGTTTTACGGTGGCTGGCATAATATGTTAAAAACTGTTTACAG
TGATGTAGAAACTCCACACCTTATGGGTTGGGATTATCCAAAATGTGACAGAGCCATGCCTAACATGCTT
AGGATAATGGCCTCTCTTGTTCTTGCTCGCAAACATAACACTTGCTGTAACTTATCACACCGTTTCTACA
GGTTAGCTAACGAGTGTGCGCAAGTATTAAGTGAGATGGTCATGTGTGGCGGCTCACTATATGTTAAACC
AGGTGGAACATCATCCGGTGATGCTACAACTGCTTATGCTAATAGTGTCTTTAACATTTGTCAAGCTGTT
ACAGCCAATGTAAATGCACTTCTTTCAACTGATGGTAATAAGATAGCTGACAAGTATGTCCGCAATCTAC
AACACAGGCTCTATGAGTGTCTCTATAGAAATAGGGATGTTGATCATGAATTCGTGGATGAGTTTTACGC
TTACCTGCGTAAACATTTCTCCATGATGATTCTTTCTGATGATGCCGTTGTGTGCTATAACAGTAACTAT
GCGGCTCAAGGTTTAGTAGCTAGCATTAAGAACTTTAAGGCAGTTCTTTATTATCAAAATAATGTGTTCA
TGTCTGAGGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCACGAATTTTGCTCACAGCATAC
AATGCTAGTTAAACAAGGAGATGATTACGTGTACCTGCCTTACCCAGATCCATCAAGAATATTAGGCGCA
GGCTGTTTTGTCGATGATATTGTCAAAACAGATGGTACACTTATGATTGAAAGGTTCGTGTCACTGGCTA
TTGATGCTTACCCACTTACAAAACATCCTAATCAGGAGTATGCTGATGTCTTTCACTTGTATTTACAATA
CATTAGAAAGTTACATGATGAGCTTACTGGCCACATGTTGGACATGTATTCCGTAATGCTAACTAATGAT
AACACCTCACGGTACTGGGAACCTGAGTTTTATGAGGCTATGTACACACCACATACAGTCTTGCAGGCTG
TAGGTGCTTGTGTATTGTGCAATTCACAGACTTCACTTCGTTGCGGTGCCTGTATTAGGAGACCATTCCT
ATGTTGCAAGTGCTGCTATGACCATGTCATTTCAACATCACACAAATTAGTGTTGTCTGTTAATCCCTAT
GTTTGCAATGCCCCAGGTTGTGATGTCACTGATGTGACACAACTGTATCTAGGAGGTATGAGCTATTATT
GCAAGTCACATAAGCCTCCCATTAGTTTTCCATTATGTGCTAATGGTCAGGTTTTTGGTTTATACAAAAA
CACATGTGTAGGCAGTGACAATGTCACTGACTTCAATGCGATAGCAACATGTGATTGGACTAATGCTGGC
GATTACATACTTGCCAACACTTGTACTGAGAGACTCAAGCTTTTCGCAGCAGAAACGCTCAAAGCCACTG
AGGAAACATTTAAGCTGTCATATGGTATTGCCACTGTACGCGAAGTACTCTCTGACAGAGAATTGCATCT
TTCATGGGAGGTTGGAAAACCTAGACCACCATTGAACAGAAACTATGTCTTTACTGGTTACCGTGTAACT
AAAAATAGTAAAGTACAGATTGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTGTACA
GAGGTACTACGACATACAAGTTGAATGTTGGTGATTACTTTGTGTTGACATCTCACACTGTAATGCCACT
TAGTGCACCTACTCTAGTGCCACAAGAGCACTATGTGAGAATTACTGGCTTGTACCCAACACTCAACATC
TCAGATGAGTTTTCTAGCAATGTTGCAAATTATCAAAAGGTCGGCATGCAAAAGTACTCTACACTCCAAG
GACCACCTGGTACTGGTAAGAGTCATTTTGCCATCGGACTTGCTCTCTATTACCCATCTGCTCGCATAGT
GTATACGGCATGCTCTCATGCAGCTGTTGATGCCCTATGTGAAAAGGCATTAAAATATTTGCCCATAGAT
AAATGTAGTAGAATCATACCTGCGCGTGCGCGCGTAGAGTGTTTTGATAAATTCAAAGTGAATTCAACAC
TAGAACAGTATGTTTTCTGCACTGTAAATGCATTGCCAGAAACAACTGCTGACATTGTAGTCTTTGATGA
AATCTCTATGGCTACTAATTATGACTTGAGTGTTGTCAATGCTAGACTTCGTGCAAAACACTACGTCTAT
ATTGGCGATCCTGCTCAATTACCAGCCCCCCGCACATTGCTGACTAAAGGCACACTAGAACCAGAATATT
TTAATTCAGTGTGCAGACTTATGAAAACAATAGGTCCAGACATGTTCCTTGGAACTTGTCGCCGTTGTCC
TGCTGAAATTGTTGACACTGTGAGTGCTTTAGTTTATGACAATAAGCTAAAAGCACACAAGGATAAGTCA
GCTCAATGCTTCAAAATGTTCTACAAAGGTGTTATTACACATGATGTTTCATCTGCAATCAACAGACCTC
AAATAGGCGTTGTAAGAGAATTTCTTACACGCAATCCTGCTTGGAGAAAAGCTGTTTTTATCTCACCTTA
TAATTCACAGAACGCTGTAGCTTCAAAAATCTTAGGATTGCCTACGCAGACTGTTGATTCATCACAGGGT
TCTGAATATGACTATGTCATATTCACACAAACTACTGAAACAGCACACTCTTGTAATGTCAACCGCTTCA
ATGTGGCTATCACAAGGGCAAAAATTGGCATTTTGTGCATAATGTCTGATAGAGATCTTTATGACAAACT
GCAATTTACAAGTCTAGAAATACCACGTCGCAATGTGGCTACATTACAAGCAGAAAATGTAACTGGACTT
TTTAAGGACTGTAGTAAGATCATTACTGGTCTTCATCCTACACAGGCACCTACACACCTCAGCGTTGATA
TAAAGTTCAAGACTGAAGGATTATGTGTTGACATACCAGGCATACCAAAGGACATGACCTACCGTAGACT
CATCTCTATGATGGGTTTCAAAATGAATTACCAAGTCAATGGTTACCCTAATATGTTTATCACCCGCGAA
GAAGCTATTCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGGGCTGTCATGCAACTAGAGATGCTG
TGGGTACTAACCTACCTCTCCAGCTAGGATTTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTA
TGTTGACACTGAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCCACCAGGTGACCAGTTTAAA
CATCTTATACCACTCATGTATAAAGGCTTGCCCTGGAATGTAGTGCGTATTAAGATAGTACAAATGCTCA
GTGATACACTGAAAGGATTGTCAGACAGAGTCGTGTTCGTCCTTTGGGCGCATGGCTTTGAGCTTACATC
AATGAAGTACTTTGTCAAGATTGGACCTGAAAGAACGTGTTGTCTGTGTGACAAACGTGCAACTTGCTTT
TCTACTTCATCAGATACTTATGCCTGCTGGAATCATTCTGTGGGTTTTGACTATGTCTATAACCCATTTA
TGATTGATGTTCAGCAGTGGGGCTTTACGGGTAACCTTCAGAGTAACCATGACCAACATTGCCAGGTACA
TGGAAATGCACATGTGGCTAGTTGTGATGCTATCATGACTAGATGTTTAGCAGTCCATGAGTGCTTTGTT
AAGCGCGTTGATTGGTCTGTTGAATACCCTATTATAGGAGATGAACTGAGGGTTAATTCTGCTTGCAGAA
AAGTACAACACATGGTTGTGAAGTCTGCATTGCTTGCTGATAAGTTTCCAGTTCTTCATGACATTGGAAA
TCCAAAGGCTATCAAGTGTGTGCCTCAGGCTGAAGTAGAATGGAAGTTCTACGATGCTCAGCCATGTAGT
GACAAAGCTTACAAAATAGAGGAACTCTTCTATTCTTATGCTACACATCACGATAAATTCACTGATGGTG
TTTGTTTGTTTTGGAATTGTAACGTTGATCGTTACCCAGCCAATGCAATTGTGTGTAGGTTTGACACAAG
AGTCTTGTCAAACTTGAACTTACCAGGCTGTGATGGTGGTAGTTTGTATGTGAATAAGCATGCATTCCAC
ACTCCAGCTTTCGATAAAAGTGCATTTACTAATTTAAAGCAATTGCCTTTCTTTTACTATTCTGATAGTC
CTTGTGAGTCTCATGGCAAACAAGTAGTGTCGGATATTGATTATGTTCCACTCAAATCTGCTACGTGTAT
TACACGATGCAATTTAGGTGGTGCTGTTTGCAGACACCATGCAAATGAGTACCGACAGTACTTGGATGCA
TATAATATGATGATTTCTGCTGGATTTAGCCTATGGATTTACAAACAATTTGATACTTATAACCTGTGGA
ATACATTTACCAGGTTACAGAGTTTAGAAAATGTGGCTTATAATGTTGTTAATAAAGGACACTTTGATGG
ACACGCCGGCGAAGCACCTGTTTCCATCATTAATAATGCTGTTTACACAAAGGTAGATGGTATTGATGTG
GAGATCTTTGAAAATAAGACAACACTTCCTGTTAATGTTGCATTTGAGCTTTGGGCTAAGCGTAACATTA
AACCAGTGCCAGAGATTAAGATACTCAATAATTTGGGTGTTGATATCGCTGCTAATACTGTAATCTGGGA
CTACAAAAGAGAAGCCCCAGCACATGTATCTACAATAGGTGTCTGCACAATGACTGACATTGCCAAGAAA
CCTACTGAGAGTGCTTGTTCTTCACTTACTGTCTTGTTTGATGGTAGAGTGGAAGGACAGGTAGACCTTT
TTAGAAACGCCCGTAATGGTGTTTTAATAACAGAAGGTTCAGTCAAAGGTCTAACACCTTCAAAGGGACC
AGCACAAGCTAGCGTCAATGGAGTCACATTAATTGGAGAATCAGTAAAAACACAGTTTAACTACTTTAAG
AAAGTAGACGGCATTATTCAACAGTTGCCTGAAACCTACTTTACTCAGAGCAGAGACTTAGAGGATTTTA
AGCCCAGATCACAAATGGAAACTGACTTTCTCGAGCTCGCTATGGATGAATTCATACAGCGATATAAGCT
CGAGGGCTATGCCTTCGAACACATCGTTTATGGAGATTTCAGTCATGGACAACTTGGCGGTCTTCATTTA
ATGATAGGCTTAGCCAAGCGCTCACAAGATTCACCACTTAAATTAGAGGATTTTATCCCTATGGACAGCA
CAGTGAAAAATTACTTCATAACAGATGCGCAAACAGGTTCATCAAAATGTGTGTGTTCTGTGATTGATCT
TTTACTTGATGACTTTGTCGAGATAATAAAGTCACAAGATTTGTCAGTGATTTCAAAAGTGGTCAAGGTT
ACAATTGACTATGCTGAAATTTCATTCATGCTTTGGTGTAAGGATGGACATGTTGAAACCTTCTACCCAA
AACTACAAGCAAGTCAAGCGTGGCAACCAGGTGTTGCGATGCCTAACTTGTACAAGATGCAAAGAATGCT
TCTTGAAAAGTGTGACCTTCAGAATTATGGTGAAAATGCTGTTATACCAAAAGGAATAATGATGAATGTC
GCAAAGTATACTCAACTGTGTCAATACTTAAATACACTTACTTTAGCTGTACCCTACAACATGAGAGTTA
TTCACTTTGGTGCTGGCTCTGATAAAGGAGTTGCACCAGGTACAGCTGTGCTCAGACAATGGTTGCCAAC
TGGCACACTACTTGTCGATTCAGATCTTAATGACTTCGTCTCCGACGCAGATTCTACTTTAATTGGAGAC
TGTGCAACAGTACATACGGCTAATAAATGGGACCTTATTATTAGCGATATGTATGACCCTAGGACCAAAC
ATGTGACAAAAGAGAATGACTCTAAAGAAGGGTTTTTCACTTATCTGTGTGGATTTATAAAGCAAAAACT
AGCCCTGGGTGGTTCTATAGCTGTAAAGATAACAGAGCATTCTTGGAATGCTGACCTTTACAAGCTTATG
GGCCATTTCTCATGGTGGACAGCTTTTGTTACAAATGTAAATGCATCATCATCGGAAGCATTTTTAATTG
GGGCTAACTATCTTGGCAAGCCGAAGGAACAAATTGATGGCTATACCATGCATGCTAACTACATTTTCTG
GAGGAACACAAATCCTATCCAGTTGTCTTCCTATTCACTCTTTGACATGAGCAAATTTCCTCTTAAATTA
AGAGGAACTGCTGTAATGTCTCTTAAGGAGAATCAAATCAATGATATGATTTATTCTCTTCTGGAAAAAG
GTAGGCTTATCATTAGAGAAAACAACAGAGTTGTGGTTTCAAGTGATATTCTTGTTAACAACTAAACGAA
CATGTTTATTTTCTTATTATTTCTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGAT
GATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTTTACTATCCTGATGAAATTT
TTAGATCAGACACTCTTTATTTAACTCAGGATTTATTTCTTCCATTTTATTCTAATGTTACAGGGTTTCA
TACTATTAATCATACGTTTGGCAACCCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAG
AAATCAAATGTTGTCCGTGGTTGGGTTTTTGGTTCTACCATGAACAACAAGTCACAGTCGGTGATTATTA
TTAACAATTCTACTAATGTTGTTATACGAGCATGTAACTTTGAATTGTGTGACAACCCTTTCTTTGCTGT
TTCTAAACCCATGGGTACACAGACACATACTATGATATTCGATAATGCATTTAATTGCACTTTCGAGTAC
ATATCTGATGCCTTTTCGCTTGATGTTTCAGAAAAGTCAGGTAATTTTAAACACTTACGAGAGTTTGTGT
TTAAAAATAAAGATGGGTTTCTCTATGTTTATAAGGGCTATCAACCTATAGATGTAGTTCGTGATCTACC
TTCTGGTTTTAACACTTTGAAACCTATTTTTAAGTTGCCTCTTGGTATTAACATTACAAATTTTAGAGCC
ATTCTTACAGCCTTTTCACCTGCTCAAGACATTTGGGGCACGTCAGCTGCAGCCTATTTTGTTGGCTATT
TAAAGCCAACTACATTTATGCTCAAGTATGATGAAAATGGTACAATCACAGATGCTGTTGATTGTTCTCA
AAATCCACTTGCTGAACTCAAATGCTCTGTTAAGAGCTTTGAGATTGACAAAGGAATTTACCAGACCTCT
AATTTCAGGGTTGTTCCCTCAGGAGATGTTGTGAGATTCCCTAATATTACAAACTTGTGTCCTTTTGGAG
AGGTTTTTAATGCTACTAAATTCCCTTCTGTCTATGCATGGGAGAGAAAAAAAATTTCTAATTGTGTTGC
TGATTACTCTGTGCTCTACAACTCAACATTTTTTTCAACCTTTAAGTGCTATGGCGTTTCTGCCACTAAG
TTGAATGATCTTTGCTTCTCCAATGTCTATGCAGATTCTTTTGTAGTCAAGGGAGATGATGTAAGACAAA
TAGCGCCAGGACAAACTGGTGTTATTGCTGATTATAATTATAAATTGCCAGATGATTTCATGGGTTGTGT
CCTTGCTTGGAATACTAGGAACATTGATGCTACTTCAACTGGTAATTATAATTATAAATATAGGTATCTT
AGACATGGCAAGCTTAGGCCCTTTGAGAGAGACATATCTAATGTGCCTTTCTCCCCTGATGGCAAACCTT
GCACCCCACCTGCTCTTAATTGTTATTGGCCATTAAATGATTATGGTTTTTACACCACTACTGGCATTGG
CTACCAACCTTACAGAGTTGTAGTACTTTCTTTTGAACTTTTAAATGCACCGGCCACGGTTTGTGGACCA
AAATTATCCACTGACCTTATTAAGAACCAGTGTGTCAATTTTAATTTTAATGGACTCACTGGTACTGGTG
TGTTAACTCCTTCTTCAAAGAGATTTCAACCATTTCAACAATTTGGCCGTGATGTTTCTGATTTCACTGA
TTCCGTTCGAGATCCTAAAACATCTGAAATATTAGACATTTCACCTTGCGCTTTTGGGGGTGTAAGTGTA
ATTACACCTGGAACAAATGCTTCATCTGAAGTTGCTGTTCTATATCAAGATGTTAACTGCACTGATGTTT
CTACAGCAATTCATGCAGATCAACTCACACCAGCTTGGCGCATATATTCTACTGGAAACAATGTATTCCA
GACTCAAGCAGGCTGTCTTATAGGAGCTGAGCATGTCGACACTTCTTATGAGTGCGACATTCCTATTGGA
GCTGGCATTTGTGCTAGTTACCATACAGTTTCTTTATTACGTAGTACTAGCCAAAAATCTATTGTGGCTT
ATACTATGTCTTTAGGTGCTGATAGTTCAATTGCTTACTCTAATAACACCATTGCTATACCTACTAACTT
TTCAATTAGCATTACTACAGAAGTAATGCCTGTTTCTATGGCTAAAACCTCCGTAGATTGTAATATGTAC
ATCTGCGGAGATTCTACTGAATGTGCTAATTTGCTTCTCCAATATGGTAGCTTTTGCACACAACTAAATC
GTGCACTCTCAGGTATTGCTGCTGAACAGGATCGCAACACACGTGAAGTGTTCGCTCAAGTCAAACAAAT
GTACAAAACCCCAACTTTGAAATATTTTGGTGGTTTTAATTTTTCACAAATATTACCTGACCCTCTAAAG
CCAACTAAGAGGTCTTTTATTGAGGACTTGCTCTTTAATAAGGTGACACTCGCTGATGCTGGCTTCATGA
AGCAATATGGCGAATGCCTAGGTGATATTAATGCTAGAGATCTCATTTGTGCGCAGAAGTTCAATGGACT
TACAGTGTTGCCACCTCTGCTCACTGATGATATGATTGCTGCCTACACTGCTGCTCTAGTTAGTGGTACT
GCCACTGCTGGATGGACATTTGGTGCTGGCGCTGCTCTTCAAATACCTTTTGCTATGCAAATGGCATATA
GGTTCAATGGCATTGGAGTTACCCAAAATGTTCTCTATGAGAACCAAAAACAAATCGCCAACCAATTTAA
CAAGGCGATTAGTCAAATTCAAGAATCACTTACAACAACATCAACTGCATTGGGCAAGCTGCAAGACGTT
GTTAACCAGAATGCTCAAGCATTAAACACACTTGTTAAACAACTTAGCTCTAATTTTGGTGCAATTTCAA
GTGTGCTAAATGATATCCTTTCGCGACTTGATAAAGTCGAGGCGGAGGTACAAATTGACAGGTTAATTAC
AGGCAGACTTCAAAGCCTTCAAACCTATGTAACACAACAACTAATCAGGGCTGCTGAAATCAGGGCTTCT
GCTAATCTTGCTGCTACTAAAATGTCTGAGTGTGTTCTTGGACAATCAAAAAGAGTTGACTTTTGTGGAA
AGGGCTACCACCTTATGTCCTTCCCACAAGCAGCCCCGCATGGTGTTGTCTTCCTACATGTCACGTATGT
GCCATCCCAGGAGAGGAACTTCACCACAGCGCCAGCAATTTGTCATGAAGGCAAAGCATACTTCCCTCGT
GAAGGTGTTTTTGTGTTTAATGGCACTTCTTGGTTTATTACACAGAGGAACTTCTTTTCTCCACAAATAA
TTACTACAGACAATACATTTGTCTCAGGAAATTGTGATGTCGTTATTGGCATCATTAACAACACAGTTTA
TGATCCTCTGCAACCTGAGCTTGACTCATTCAAAGAAGAGCTGGACAAGTACTTCAAAAATCATACATCA
CCAGATGTTGATCTTGGCGACATTTCAGGCATTAACGCTTCTGTCGTCAACATTCAAAAAGAAATTGACC
GCCTCAATGAGGTCGCTAAAAATTTAAATGAATCACTCATTGACCTTCAAGAATTGGGAAAATATGAGCA
ATATATTAAATGGCCTTGGTATGTTTGGCTCGGCTTCATTGCTGGACTAATTGCCATCGTCATGGTTACA
ATCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCA
AGTTTGATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAAACGAACTTATG
GATTTGTTTATGAGATTTTTTACTCTTAGATCAATTACTGCACAGCCAGTAAAAATTGACAATGCTTCTC
CTGCAAGTACTGTTCATGCTACAGCAACGATACCGCTACAAGCCTCACTCCCTTTCGGATGGCTTGTTAT
TGGCGTTGCATTTCTTGCTGTTTTTCAGAGCGCTACCAAAATAATTGCGCTCAATAAAAGATGGCAGCTA
GCCCTTTATAAGGGCTTCCAGTTCATTTGCAATTTACTGCTGCTATTTGTTACCATCTATTCACATCTTT
TGCTTGTCGCTGCAGGTATGGAGGCGCAATTTTTGTACCTCTATGCCTTGATATATTTTCTACAATGCAT
CAACGCATGTAGAATTATTATGAGATGTTGGCTTTGTTGGAAGTGCAAATCCAAGAACCCATTACTTTAT
GATGCCAACTACTTTGTTTGCTGGCACACACATAACTATGACTACTGTATACCATATAACAGTGTCACAG
ATACAATTGTCGTTACTGAAGGTGACGGCATTTCAACACCAAAACTCAAAGAAGACTACCAAATTGGTGG
TTATTCTGAGGATAGGCACTCAGGTGTTAAAGACTATGTCGTTGTACATGGCTATTTCACCGAAGTTTAC
TACCAGCTTGAGTCTACACAAATTACTACAGACACTGGTATTGAAAATGCTACATTCTTCATCTTTAACA
AGCTTGTTAAAGACCCACCGAATGTGCAAATACACACAATCGACGGCTCTTCAGGAGTTGCTAATCCAGC
AATGGATCCAATTTATGATGAGCCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGAAAGTGAGTAC
GAACTTATGTACTCATTCGTTTCGGAAGAAACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTG
CTTTCGTGGTATTCTTGCTAGTCACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAA
TATTGTTAACGTGAGTTTAGTAAAACCAACGGTTTACGTCTACTCGCGTGTTAAAAATCTGAACTCTTCT
GAAGGAGTTCCTGATCTTCTGGTCTAAACGAACTAACTATTATTATTATTCTGTTTGGAACTTTAACATT
GCTTATCATGGCAGACAACGGTACTATTACCGTTGAGGAGCTTAAACAACTCCTGGAACAATGGAACCTA
GTAATAGGTTTCCTATTCCTAGCCTGGATTATGTTACTACAATTTGCCTATTCTAATCGGAACAGGTTTT
TGTACATAATAAAGCTTGTTTTCCTCTGGCTCTTGTGGCCAGTAACACTTGCTTGTTTTGTGCTTGCTGC
TGTCTACAGAATTAATTGGGTGACTGGCGGGATTGCGATTGCAATGGCTTGTATTGTAGGCTTGATGTGG
CTTAGCTACTTCGTTGCTTCCTTCAGGCTGTTTGCTCGTACCCGCTCAATGTGGTCATTCAACCCAGAAA
CAAACATTCTTCTCAATGTGCCTCTCCGGGGGACAATTGTGACCAGACCGCTCATGGAAAGTGAACTTGT
CATTGGTGCTGTGATCATTCGTGGTCACTTGCGAATGGCCGGACACTCCCTAGGGCGCTGTGACATTAAG
GACCTGCCAAAAGAGATCACTGTGGCTACATCACGAACGCTTTCTTATTACAAATTAGGAGCGTCGCAGC
GTGTAGGCACTGATTCAGGTTTTGCTGCATACAACCGCTACCGTATTGGAAACTATAAATTAAATACAGA
CCACGCCGGTAGCAACGACAATATTGCTTTGCTAGTACAGTAAGTGACAACAGATGTTTCATCTTGTTGA
CTTCCAGGTTACAATAGCAGAGATATTGATTATCATTATGAGGACTTTCAGGATTGCTATTTGGAATCTT
GACGTTATAATAAGTTCAATAGTGAGACAATTATTTAAGCCTCTAACTAAGAAGAATTATTCGGAGTTAG
ATGATGAAGAACCTATGGAGTTAGATTATCCATAAAACGAACATGAAAATTATTCTCTTCCTGACATTGA
TTGTATTTACATCTTGCGAGCTATATCACTATCAGGAGTGTGTTAGAGGTACGACTGTACTACTAAAAGA
ACCTTGCCCATCAGGAACATACGAGGGCAATTCACCATTTCACCCTCTTGCTGACAATAAATTTGCACTA
ACTTGCACTAGCACACACTTTGCTTTTGCTTGTGCTGACGGTACTCGACATACCTATCAGCTGCGTGCAA
GATCAGTTTCACCAAAACTTTTCATCAGACAAGAGGAGGTTCAACAAGAGCTCTACTCGCCACTTTTTCT
CATTGTTGCTGCTCTAGTATTTTTAATACTTTGCTTCACCATTAAGAGAAAGACAGAATGAATGAGCTCA
CTTTAATTGACTTCTATTTGTGCTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATAATGCTTATTATATT
TTGGTTTTCACTCGAAATCCAGGATCTAGAAGAACCTTGTACCAAAGTCTAAACGAACATGAAACTTCTC
ATTGTTTTGACTTGTATTTCTCTATGCAGTTGCATATGCACTGTAGTACAGCGCTGTGCATCTAATAAAC
CTCATGTGCTTGAAGATCCTTGTAAGGTACAACACTAGGGGTAATACTTATAGCACTGCTTGGCTTTGTG
CTCTAGGAAAGGTTTTACCTTTTCATAGATGGCACACTATGGTTCAAACATGCACACCTAATGTTACTAT
CAACTGTCAAGATCCAGCTGGTGGTGCGCTTATAGCTAGGTGTTGGTACCTTCATGAAGGTCACCAAACT
GCTGCATTTAGAGACGTACTTGTTGTTTTAAATAAACGAACAAATTAAAATGTCTGATAATGGACCCCAA
TCAAACCAACGTAGTGCCCCCCGCATTACATTTGGTGGACCCACAGATTCAACTGACAATAACCAGAATG
GAGGACGCAATGGGGCAAGGCCAAAACAGCGCCGACCCCAAGGTTTACCCAATAATACTGCGTCTTGGTT
CACAGCTCTCACTCAGCATGGCAAGGAGGAACTTAGATTCCCTCGAGGCCAGGGCGTTCCAATCAACACC
AATAGTGGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCCGACGAGTTCGTGGTGGTGACGGCA
AAATGAAAGAGCTCAGCCCCAGATGGTACTTCTATTACCTAGGAACTGGCCCAGAAGCTTCACTTCCCTA
CGGCGCTAACAAAGAAGGCATCGTATGGGTTGCAACTGAGGGAGCCTTGAATACACCCAAAGACCACATT
GGCACCCGCAATCCTAATAACAATGCTGCCACCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAG
GCTTCTACGCAGAGGGAAGCAGAGGCGGCAGTCAAGCCTCTTCTCGCTCCTCATCACGTAGTCGCGGTAA
TTCAAGAAATTCAACTCCTGGCAGCAGTAGGGGAAATTCTCCTGCTCGAATGGCTAGCGGAGGTGGTGAA
ACTGCCCTCGCGCTATTGCTGCTAGACAGATTGAACCAGCTTGAGAGCAAAGTTTCTGGTAAAGGCCAAC
AACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCATCTAAAAAGCCTCGCCAAAAACGTAC
TGCCACAAAACAGTACAACGTCACTCAAGCATTTGGGAGACGTGGTCCAGAACAAACCCAAGGAAATTTC
GGGGACCAAGACCTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCTCCAA
GTGCCTCTGCATTCTTTGGAATGTCACGCATTGGCATGGAAGTCACACCTTCGGGAACATGGCTGACTTA
TCATGGAGCCATTAAATTGGATGACAAAGATCCACAATTCAAAGACAACGTCATACTGCTGAACAAGCAC
ATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAAAAGACTGATGAAGCTC
AGCCTTTGCCGCAGAGACAAAAGAAGCAGCCCACTGTGACTCTTCTTCCTGCGGCTGACATGGATGATTT
CTCCAGACAACTTCAAAATTCCATGAGTGGAGCTTCTGCTGATTCAACTCAGGCATAAACACTCATGATG
ACCACACAAGGCAGATGGGCTATGTAAACGTTTTCGCAATTCCGTTTACGATACATAGTCTACTCTTGTG
CAGAATGAATTCTCGTAACTAAACAGCACAAGTAGGTTTAGTTAACTTTAATCTCACATAGCAATCTTTA
ATCAATGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCATCGAGGCCACGCGGAGTACGAT
CGAGGGTACAGTGAATAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTT
AGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAA
A

>gi|971747905|ref|NC_028833.1| BtNv-AlphaCoV/SC2013, complete genome
TTTTCACGTCGTGTGTGTGTTATTGCACACACATGATTGTGTTTGTGAAATTTCCCTAGGTTGCTGATTA
AGTTGTTAAGTGTAGTGGGTTCATACACCTCTTCTGGTTAGTTCCGTCTACCAGTAAGTGTGTGATACTC
CCCTCTTCTGTTCTGTCAGTCGAGGTGTGTGGATACCAGGTTCCGTCTTGGTTGAAACCTATAACTGCAA
CTCATGGCTCGCAACCCTATTACTGTGGCTAAAGCCGCTGTTTGTGAAATTTCTGCTATTGGTTTTGGTG
ACATCGGTGAGGCCGTGTTGCATTACAGCAATGCCGCTGCTGATGGTTTCATCAAATGCCGCTTTGTACC
CCTTTCTATGGCTGACTGTGTTGAGGGTTTGCTTAGTGACGAATTTGTCGTTCTTGTAAACAACGACACA
AGTTGCCTGACTGTGGGTACTTTTGGCGAGAGACCACCCGATCTTAAGGGTTGGCTCTTGTTTTCTAATT
GTGACGTTGATGGCACTGCTATTGTATCATTTGATGGTCTGGCAGGTGCTGAGGTTTACGTCGACAATTA
TATGTGTGATCAGACTGGGAAACCCGTTTTGGCCGCCGACGTTTGGACTTTCAAAGATTATTTCGGTGAA
AGTGATACCATTGTTATTGATGGTGTTGTTTACCGTAAGGCTTGGGAGGTTGTGCGTCTGGATGTTCCAT
ATAAGGCTCAGTCTGTTTCTGCTATAAGCTCTATTGAATGGTTGTGTGGTGTTCAGCATGTGTTGCCTAG
TGGCACTGTGTTGGATGTCGCAAAGTCTGTCTCCAAGAGCAAGGTTGTGCTTTTGTCTGATCCTTATGCT
GACATTTATGACCAGGTTGGAAGCCCTTTTATGACTAATGGAAAGAACCTGTTGGAAATTGTCGTTAAAC
CATGCTTCTTGCACGGTTATGTCAAATGTAACTGTGGTAACACGCACTGGGCAGTTGGTGATTGGCGAGC
TGGTTATAAATCAGTTTGTTGTGGTCTTAACTGTAATCCTATATGTGTTGCTGCTGGTTATGTTGAACCT
GGTGATGTACTTTTCACTTCTAAAGGGGCTGGTACGGGTCTGAAGTACTATAAGGGTCTTACTCTTAAGT
TTGTGGGTGAAGTTGAGAATGTTGCTGTTTGGCGCATTCAGAAAGTTCACCATGTGGATGGTTTTGTTGC
TTGCAACCGTTTTAAGGATGATTTTTGCTCAACCATGGAGTCTTGTGGTGTAGAGAATGTTAGTGCCACC
GCTAATGCTTTGAAATTTAGCCTTATTAGTGGGTGTTGCCAGGAAGTCACTCTGCGTTCGATTGTCAGTG
GCCAGCTTAGTGTTGGGTTTGCTGTTTTTGATACGTTTGAAGACATTTTCTCTATGCCTAAATGGATGCA
AAGGCTCGGTGCACTTGGTTCCACACTTTGGTCACAATTTAAGAGCTTTGCACGTGAAACTTTTAAAACT
TCAACATCACTTGTTGAGTTTGTGAATTTTCTTCGTGATGTTAGTTGTGTGGTTATGAATGGCGCATTGG
AACTTGTTGCTAATGTGCCAAATCACTTTGCATCACTCTTTGATCACTTGCGTGTCCTTGTGGCATCTGT
TACGACTCTCTTTATTGAAGAGTTTAAGGTTGCAGGTGTTGCATTCAAGCGCTTGGGTGACTATGTTTTG
TTTGATAATGCACTGTGCCAACTTGCGAGTGTGAAACTTAAGGGCTTCAAGCAAGATGGTTTGAAAACTG
CTACTTATGTTAGCACAGTTTATGGACCTAGTAAGCGTGTTAAAGTTAAGCGCGTTGAGAAATGCGATGC
TAACTTAGTTTTGTGTGATTCTGCACCTCTTGTGGATGAAGGTTATGCTTGTGTCATTCAAGGCCAAGCA
TTTTACACAAATGGCACGTATTACTGGTTTATGACAGATCATACATCTGTTTTGGAATCACCTGTGTTTA
AGAAAGACACTATTGTGTGTCCTGATGTACTCTTGGCTGTGGATGGTGGTGACATTTTCCACAAGTTTTT
GAGCACGGTTACAGATGTTGTTGAGTTCTGTGCTTCAATTAAAGTGCATTTTGGTTTGGAAGGCTTTGTT
ATTACAGCCGCCAAGAAGTTTAAAGCTTTTGCTCGCACTCTTACGGAGTTGTATAATGAGTTTGCCATTG
CAGTTTCTGATGTTGTTAAAATTGCTTGTATGAATTTTACATACTATGCTTTTAACAAACCTATGGTTGC
TGTCAATGGCACATTATGTCCTGTAGAGTTAGTGGAGCCACCTTCAGATGTTTCTAAAGAAGCACTTGTT
ACAGACTTTATGGTCTTTAAGTCACCTGACACACATGTTAAACCCATTAGGATTGAAACAGAGTCATGTG
AGCTTCATGAAGTGGACTTTGTTACTCCCCGTGATGGTGGTGTGGTCAAGATAATAGATGGTTATGCTTT
TTATGAGTCCAATGGCAACTATTACCCTTCTTCTGTTGATGGTGTTAAAAATGTCACATACCGTAAGAAG
GGTGGTGGTGTTGTCACCTTCTCAGAGACTAACTCTGTGAAGGAGGTTGACCCTGTTCATAAGGTTTATC
TGACCTACGAGTTTGAGGACGAAGTAGTTGTGGAGGTTCTTAAACAGACTGTGGGTTATAAGATGACCTT
TGAAGGACAGGAGTGGGCAGATTTTGAAGCTACACTTCGTGGTGTCTTGTCTGTTGTCTCAACTAAACTC
CCTATACCTGAGTACTTTGTGTACGATGAGGAGGGAGGTTTTGATTACACTAAGCCTGTTATGGTTTCAC
AGTGGCCCATACAGGTATCTGATAGTGTTGACCATGAGACTGTTGATGACACTGTTGACACTACACCGCG
CAGTGACGAAGATGAAGTGCGTGAGGCATTGTCCTTTATTAAAGAGGTTGAGCCTCAACCACTTAATCCG
TTTGCGTTTGAGTTTACGGACTATTGTGGTCTTAAAGTCCTTAAACAGGTTAATAATAACTGTTGGGTTG
CTTCAGCGTGCTTGCATATGCAATTGTTGGACCTGTTGGATACACCTGCTATGGACTTGTACAAGTGTGG
CCGTGTTGGCCCCCTGGTTCAATCATGTTACGAATCTGTCAAACAACTTGTAGGTTCTATGGGTGATGTC
ACTGAGTGCCTTGAACACATGCTTAAGGATGTTAAGTCATGTGTTGTTGTTTGTGACGCTGTTTGTGACT
GTGGTACCAAAGACCTTACTATTGAAGGTTGTGTTTTCAGGTTCATGCCATGTTCTGAACCGTTGGAACG
CTGGTGTGCAGTGTGTAATAGTATGGCTGCTTGCACTATTAAAGGTATAAAAGGTACGGCCATATTTTGC
CAAAAACCAGGTCCTGCCAATGATCTATACGTTGAGCCATATTGTGCTGCATCGTTTATTGGCAGTGTTA
CTAGTGGGCATTATCGTACTAATGTCTATCACACTGGTAAGGCCGTAGATGGTTTTGGTGTTCATGATAT
TGACAACACTAACTTGCACACTTATGCAGTTAAGAATGTTGATTGGACTAGATCACACACCCCAGCCGAT
AATTCACCCGCTTTGGTTGAACCATTCTTGGTTTACAAGAACGTGCAATTCTTTCAGGGTGATTTTAAAG
ATCTTGTTGGTGGTGTTCAGCACGATTTTGTTGTGAACGCCGCTAATGAGCGACTCCAGCATGGTGGTGG
TGTTGCTAAGGCCATCAATGATTACACAAATAATGAGCTGCAGCATCTGTCTAGTGCTCATGTTAAGAAA
CATGGAAAGGTTTCAGTGGGCAGTGGTGTTATGTTGCAATGTTCTGGTGTGAAAGTTCTTAATGTTGTAG
GTCCACGTCATGGTGCAGGTGAGGTTGCCTTGCTCGAAAATGCTTATAATTGTATTTTCGATCAGGACGG
TGTCCCTCTAACCCCTCTTATTGGTGTGGGGATTTTTAAGGTTCCTATTACAACATCCTTGAAGGCTTTG
CTTGATGTTGTAGGCGATAGGCAATGTAGGTGTTTTTGCTATTCAGATAGTGAAGTTGCTGCAATTGTTG
CCTATGTCAACAACATGTCAGCTGTAGATGATGTTCAGCTGCCTGTGTGTCCACCTTTAACACCTTGTAG
GGTTGAAGGTGACGTCTCATTTTACATGGGTAGTGTGGATGTTTTGCTACAACAGTCCTTTGATAGGTTT
GTTTTCTTTGTTAGTGAGGATCTGCAACTTTGCGTCTTAGCTAGTGCATTAGACGTTTATTTGAATGGCT
GTGTCACAGAGGCTTTAAATAAGTCTGGTCCATTGCCAGCTGGTAACATAGTCTCTTACAAACATCCTAA
AGGTGATGGTTTTGTTGTCGTGACTTTTGCAGTTTTGCCTGCTGTTGGCTCAAAGGATTTTGACAAAAAT
GTTAAACGTGTTTTTAACAAGTTGTCTAAGCTTAAAGGCAATATTCTTTCTACTGTGTCTAGTGTTATGT
TTGCGCGTCTAACACGTGTCTGGAAGTCTTTTTGGCTTTGTGATTCTAGTGTTAGTGTTGTTGACGAACA
CTTTTCAGAGACTAGTGTTTTTGTTGTCGTTACCGAGAATGGTAGAGACTTTGAAACTGTGGCTCTTGAC
ACAGCCAAAACTTTTGTGGAGCAGGTTGGTGTTTGCACTATTGATAATGTAGATGTAACAAATGCTGTTG
TTACGCCTACTGATGAACCTGTTAGTGTTGCTACACCGTCTGTTGATTGGGATGCGTTCTACGGCTTTGA
GAATGCTAGTGTTTTTCACACTTTGGACCATAGTGGTTTTGAGTTTGAGAGTACAGTCGTAGAAGGTAAA
CGCACTCTTAAGAGTTCAGATAACAACTGCTGGGTTAATGCTGTTTGCTTGCAATTGCAGTACTTGGATG
CAAAGTTTGTTAGTGAGGGTCTTAACGCTATGTGGGACTCTTACGTGACTGGTAATGTTTCTAAGTTTGT
CCACTGGTTGTACTGGATTACAGATCACAGCAAGAATGACCGCAATGATGCAGAAAGTGTGTTGTTGCGT
TTGTCTGTTTACCTATGTAAGTCTTGTGTCTTCACCATAGAACGTGAAACTTCATCATTGTGCTGTTCTG
AATTGCGCACGTACAACGCTTGTGTTGTTAGTGCGAGTGTGTTAAGGAATGGTGTTAGTGATGGTGTTTG
TAAACATGGTGATGCCTACAAGAGTAGGGTTTCTGCTGTTGATGGAATTGGTATAGTAGTTAGTGTTTCT
ATACCTGATCCTGTGCCTAAGAGTGCCTTGTTGGATGGTGTTTCTTACACTACTTTTACAGGTGATGTTG
GTAGTGGCCATTATGCTGTTGTGGATCGGAAACTTTATAAGTCATTTGATGGGTTTGATGTTAAACCTGC
TTCGTTGTCATCTGTTAGTGTGACAGGTGTTGTCGTCAAGACTGCAAAGTTTACGCGCAAAGTCAAACAA
GTTGCCACACCTACTGTTAGTTCTGGAGATGCACCTTTGGATTTGTCAACAACTCTGAATACAGCTGCCA
GTAAGTTTTTCAGTGTTGGCGACGTTGTAGCTCGCAATGTTGGTATGTTTTGTGTCTGGCTTTTTAGTAT
GCTGACTCTGCTTTTTAAAACTTTTAAAAAGAGAGACTTTAGTGTGTTAGCTTTAGCACCTCAGCGTACA
GGAGTTATATTTAGGAGGAGTCTTAAGTATAATAGTAAAGCCGCCTATAAACATTTAAATTCGAAGTGGG
GCACTGTAAAGTTTGTCATGAAGTTGCTTGTCATGTTTTATACATTGTACATGTTGCTTTTCTTGACAGT
GCGTTTTAGTCCTTTGAACAGTGTGTTTTGTGATGACTATGTTGATGGCTATTACAATTCTACATTTGTG
AAGAGTGACTACTGTGATGGCTTGGTCTGTAAAGTGTGTCTTTATGGTTACCAGGAGTTATCTGACTTTC
CCCACTTGGACTTGACATGGGAGTTTATAACGCATCCACTTTTAGTGAGTTTTATGCCTCTTTTATATAT
GGCATTCTTACTATGTTTTGGTAACAAATGGGTGCGGTTTTTGATGTGCTATTTCATATTGCAATATGTC
AATGCTGCTGGTGTTGTTCTTGGTCTTCAAGACTCTATTTGGGCTTTACACTTGGTTCCTTTTGACATCT
TTTGTGATGAAATAGTTGTTTGTTGGCTTGTTTATGTTATTTTGGCTTTTCTTAAGCATGTTTGTTTTGG
TTGTGAAAAACCTAGTTGTGTTGCATGCTCTAAAAGTGCACGCCTCACTCGTATTCCCATTCAAACTGTT
GTTAATGGTTCTACTAAAGTGGTTTATGTTGCTGCTAATGGTGGTAACAGACCCTTTTGTAAGAAGCATA
ACTTCTTTTGTGTGAATTGTGATTCTTATGGTGTTGGCTGCACGTTTATTAATGAGCACGTTGCGCGTGA
ACTTGCAAACGTTACTAAGACTAATGTTCAACCCACTGGTGATGCTTATATTGTTATAGACAAGGTTGAG
TTTCAGAATGGCTTTTACTATCTATATAGTGGTGAGACATTCTGGCGCTACAATTTTGATATAACTAGTT
CTAAGTACAGTTGTAAAGAGGTTTTAAAGTCTTGTAACATACTTAGTGACTTCATTGTTTTTGATAACAA
TGGCACTAATGTTTCGCAAGTGCACAACGCTAGTGTTTATTTGTCTCAACTTTTATGCAAGCCAATTAAG
TTAGTTGACAGTGCTTTGCTTTCCACTCTGGATGTTGATTTTAATGGTGCTTTACATAGTGCTTTCCTTG
AAGTGCTTAATAATAGTTTTAATAAGGACTTTAGTGGTTGTGCTACTATGTCTGAGTGCAAGAGCCTTTT
AGGTTTTGAAGTCTCAGATGAAGACTTTTACAATGCCGTTAGTGATGCTCATAGGTTTAATATTTTGTTG
ACAGACATTTCTTTCAACAATTTTATTACTACCTATGCAAAACCAGAGGAGAAGTTTGCAACTCATGATG
CTGCTGTTTGCATGCGGTCTGGTTCTAAAATTGTGAATCATAATGTTCTTATTAAGGAGAATGCTGCTGT
TGTTTGGTACCAGCGTGACTTTCATGCACTTTCCGAGGATTGTCGTAAATACATTGTTAAAACGTCAAAA
CAGAAAGGTGTTAACATTATGATTACTTTTAATGATACTAGAATGAATGTGGCTATACCCGCTGTTAACT
TCGTTTGTAAGAAGGGCGGTGCTATTAAACCTTTTGGTTGGTTGTGTATAGTCTTTGCATTCATTTTTGC
ACTTTATATGAGTGTTGGTCTTTTTGATTTTACTGAGTCTGTACCGTCTTACATGGGTTTTGACTTTAAG
TATATTAAAGAGGGCCGCTTGCATGATTTTACAGAGCGTCTTGACTGTGTTTATAGTGTTTTTGACAACT
TTGATGTTTGGCATGAAAGCAAATTTGGCACAGTTCCTACTAAGAGTATTAAGTGTCCTATAGTAGTTGG
TGTCTCTGATAGTGTCCGCACATTGCCTGGTGTTCCAGCTGGCGTTATGCTTGTTGGTAAGACTCTGGTT
TTTGCTGTTAAGACTGTTTTTGGCGAAACGGGCAATTGTTATGACACGCAGGGTGTTACTTCTACTAGTA
GTTGCTTATTTACTTCAGCTTGCACTGTGCTGTCTGGTATTGGTGGTACTATTACGTACTGTTATAAGGA
TGGCATAGTTGAAGGTGCTCGTACCTACAGTGAATTGGTACCTAACACTTATTACAAAATGGAAGACGGT
CGCCATGTCATATTTCCTGAAGTTTTGGCACGTGGTTTTGGTTTTAGAGCCGTACGTACGTTAGCCACTA
CATATTGTAGGGCTGGTCAGTGTGTCGATTCTAAAGCTGGAGTCTGTTTTGGTCTGGATAGGTTTCTAGT
CTATAGTGCAGACTCAGGCTCTGACTTTGTTTGCGGTAATGGGCTCTTATCATTGCTGTATAACGTGTTA
GCCATATTTTCTAGTTCATTCAGTGTTGCAGCTTTGTCAGGTCAAATAATCTTTAATTTGGTTGTTGCTG
CCATTGCTGTTTTTGTCTGTTTTACTGTTGTCAAGTTTAAACGTATGTTTGGTGACATGTCACGTGGTGT
GTGTACTGTTGGTGCCGCTGTTTTGGTTAACAACTTGTCTTATGTTGTTACGCAGAACACAGTTGGTATG
ATAGTTTATGCTGTCTTGTACTTTTTAGCTACACGTGGTGTTACATATTCATGGATATGGTATGTTAGCT
ATGTTGTGGCATATAGTACTCTTGCACCTTGGTGGCTTCTGAGTTGGTATTTGATTGCTGGTCTCAGTGG
TGTTATACCATCTTTTATCAAGTTGCGTGTCTCATCACAGCTTTTTGACGGTGACAAGTTTGTCGGTAGT
TTTGAAGCTGCTGCAATGGGTACATTTGTTCTTGATATGCATTCTTATGAGAAACTAGTTAATAGTTTGC
CTGCTGATAAGTTGAAGCAGTATGCTAGTGCTTTTAATCGCTATAAATATTATAGTGGTAGTGCTAGTGA
GGCAGACTACAGGCTTGCTTGCTTTTCTCATTTGGCTAAAGCCATGATGGATTATGGCACAACACACCAA
GATTGCCTGTACACACCACCTACTATTAGTTATAACTCCACCTTGCAGGCTGGCCTTCGTAAAATGGCTC
AGCCGTCTGGTATGGTGGAAAAGTGTATAGTTCGTGTTGCCTACGGTAATATGGTTTTGAATGGTGTGTG
GTTGGGAGATGAAGTCTACTGTCCGCGCCATGTTATAGCTGAAAACACAACGACTTTGATTGATTATGAT
AAAGCCTTTTCATTAATTAGGCTTCATAATTTTTCCGTGTCTGTTGGTAATGTCTTTTTGGGTGTTGTTA
GTTGTCGTATGCGCGGTGCCTTGCTTTGTATCAAGGTTAACCAAGCGAATGTTAACACACCTAATTATAC
ATTTAAGACATTGAAACCTGGTGACTCTTTTAATATTTTGGCATGTTATGAAGGTGTAGCCTCTGGTGTT
TATGGTGTTACGTTACGTAACAACAGCACGGTTCGAGGTTCGTTCATAAACGGTGCTTGTGGTTCACCAG
GCTATAATTTAGTAGGCAACACAGTTGAATTTTGTTATTTTCATCAGCTGGAATTAGGTAGTGGTTGCCA
TGTGGGTAGTGATGCTAATGGCGTTATGTACGGGAACTTTGACGACCAACCCACTTTACAGATTGAGGGT
GCGTCGCGACTGTACACGGCTAATGTTGTGTCATTCTTGTATGGCGCCTTGCTTAATGGTTGTAATTGGT
GGCTAACTAGTGATCGGCTTACTTTGGAGGCATTTAATGACTGGGCCACTTCTAATGATTTTACAACCCT
TAGTTCTGTTGATATGTATACCATATTGTCCGCTAAAACTGGTGTTGATGTAGCACGTGTTTTGGCAGCT
ATCCAAAAACTTGCAAAGGGTTTTGGCGGTAACAAGATTCTTGGTTATTCATCATTAACAGACGAGTTTA
CAGCTGGTGAGGTTATTAAACAGATGTATGGCGTGACGTTACAGAGTTCCAAGAAATCACGATTTTTGGG
TAACTTGTTGTCCATTGGTCTTTTTGTTTTTATGTTTTGGTCAGAGTTTTTGTCTTATTCTGCCCTATTC
TGGATTAATGCCAATGTTCTTACGCCTATCTTCTTGTGTTTATGTGGGTTTTCTGTTGTTTTGACAGTTG
GTCTTAAACATAAGCTGCTGTTCCTGTACACGTTTTTGATACCTACGGTTGTTTTACTTGCTGCCATTAA
TTTATCCTGGGACTTTTACTTACGTGCCTTGCTTTCTAGCACTGTTGGCTACCACACGTCTCTTATGTCT
TTTGACTTGCAGGGTGTGTTGAATATTGCTATTTGTGCTTTTGTTAGTGGGCTCCATTTATATCGTTTTA
GTCCCAATGTTGGCTCGTGTGCGACTCTGCTTATGTCGCTTGGTGTCACGGTTTACAATTATTGGTTTGA
CACTGATTACTTTTCAATCATTATGACACTCTTACTTAACATGTCTAGTACATGGTATATAGGTGCAATT
GCTTATAAAATTGCTAGTGTCATGATTGTGTTTGTACCAGCACCTCTAATTGCAGCATTTGGTCCTATCA
AGACTGTGCTTATGGTGTACGTCTGTATAGGTTATGTGTTCTGCATGTATTGGGGTTTTTGTTATTGGTT
GAACCGTGTTAGTAAGTTGACACTTGGTGTTTATGACTTTAAAGTTAGTTCTGCTGAGTTTAAGTACATG
GTAGCTAATGGTCTTAGTGCACCTCGTAGTGTCCTGGACACACTTTATCTTTCATTTAGGTTATTGGGTG
TTGGTGGTGAGCGTACTATTAAGGTCGCCACTGTCCAGTCCAAATTGACTGATCTTAAGTGTGCCAATGT
TGTTTTGCTTGGTTGCCTTTCTGCCATGAATGTGTCTGCGAACAGCAAAGAGTGGGCTTATTGTGTTGAT
TTACACAATAAAATCAATCTATGTGATGATCCTGAAAAGGCACAAGAAATGTTGCTTGCACTCCTTGCGT
TTTTCATAAGTAAGCAAAAAGACTTTGGTGTTGATGACCTGTTGGACTCTTATTTTTCCAATAGTGCATT
ATTACAGAGTGTTGCTGCTACTTTTGTTAATATGCCGTCTTATATAGCTTATGAGACTGCTAGACAGGAG
TATGAAAATGCGGTTAATACCGATGCTAGTCAATCTGTTGTCAAACAGCTACGCAAAGCTATGAATGTTG
CAAAAGCAGAGTTTGATAAGGAAGCATCTGTGCAGCGTAAAATAAACCGTATGGCAGAGGCAGCCGCTAC
TCAAATGTACAAAGAGGCACGAGCCGTTAACAAGAAGTCTAAGGTGATTAGTTCCTTGCATGCTATGCTT
TTTAGCATGTTGCGTCGCTTGGATATGTCTTCTATTGACAATATTCTTAGTTTGGCACGTGATGGCACTG
TACCGCTTTCTATAATTCCTACAGCATGTGCTACTAAGCTTACAGTTGTTTGTAGTGACATAGAGTCTTT
TTCTAAAGTTGTTTTTGACAATTGTGTGCAGTATGCTGGTGTGGTTTGGAATATTATTGACATCCGTGAC
GGTGATGGTAAGATTGTTCACCTTAAAGAAGTCAATAAAGATAATGTGGATGTGTTGTCTTGGCCTCTCT
TTGTTAACTGTGAGCGAATGGTCAAGTTGCAAAATAATGAGATCATGCCTGGCAAACTTAAACAAAAAGC
TGTGCGTGCTGAAGGTGAAGGTGTTCATTGTGATGGTAAGGCTTTGTATAACAATGAGGGTGGTAAAACC
TTCATGTATGCATTCCTTGCTGATAAACCTGACCTTAAGTACGTAAAGTGGGATTTTGATGGTGGCTGCA
ATGTTATAGAACTGGAACCACCATGTAAGTTTGCTGTAGAAACATCCACTGGTGTGCAAGTCCGCTATCT
GTATTTTGTTAAAAACTTGAACACATTACGGCGTGGTGCAGTGTTGGGCTACATTGGTGCAACGGTGCGT
TTACAAGCGGGTAAGCAGACTGAGTTGGCTACAAACTCATCACTTCTTACGCTTTGTGCCTTTGCTGTAG
ACCCTCCTAAAATGTACATTGATTCTGTTAAGGCAGGCATTAAACCAGTAGGTAATTGTGTTAAGATGTT
GTCTAATGGCGCTGGTAATGGTCAAGCTATTACTACAAGTGTCGAGGCAAACACGAACCAAGATAGTTAT
GGTGGTGCTTCTGTCTGTCTGTATTGTCGTGCCCATGTTGAACATCCTGGTATGGATGGTCGTTGTCAGT
TTAAGGGACGTTATGTACAAGTGCCACTTGGCACTGCAGATCCTATTAGGTTTTGTTTGGAGAACAAAGT
TTGCAGTGTTTGTGGTTGTTGGTTTGGTCATGGTTGCACATGCGATCGTACTTGCTTGCAAGCTGTTGAT
ACGGCTTATTTAAACGAGTACGGGGCTCTAGTGCAGCTCGACTAGAGCCCTGTAATGGTTCCGAAACGGA
CCATGTTGTGCGTGCTTTTGACATTTACAATAAAGATGTTGCTTGTATTGGTAAGTTTCTCAAAGTGAAT
TGTGTTCGCATGAGAAACGTTGATGCCAAAGATGCCTTCTTTGTTGTGAAGCGTTGTGTTAAGGGTGTTA
TGGAACACGAGCAGTCCATGTATGACACCCTAAAGCACAGTGGTGTTTTAGCCCCTCATGACTTTTACCT
TTGGAAGAATGGTCGTAGTGTTTATGGCAACGTTTCACGTCAGAACTTGACCAAGTACACTATGATGGAC
TTAGTTTTTGCACTGCGCAATTTTGATGAACGTAATTGCGACGTGTTAAAAGAAATCTTGGTACTTGTGG
GTGCCTGTGATGAGTCCTACTTTGAAAACAAGTGTTGGTATGACCCAGTGGAAAATGAAGACATTCATCG
CGTTTATGCGGCGCTGGGTCGTATTGTTAATACTGCCATGTTAAACTGTGTTAAGCTTTGTGACGCCATG
GTCGAAAAAGGTATTATTGGTGTACTTACACTTGATAACCAAGACCTCAATGGTCTCTTTTACGACTTTG
GTGATTTTTCTTTCACAATGCCTGGTATGGGTGTACCTTGTTGCACATCATACTACTCTTATATGATGCC
AGTTATGGGTATGACAAACTGTCTTGCCTGTGAGTGTTTTGTTAAGAGTGACATATTTGGCAGTGATTTT
AAGACTTTTGACTTATTGGAGTATGACTTTACAGAACATAAGTCTTTGCTCTTTGAGAAGTATTTCAAAT
ATTGGGGTCAGGATTACCATCCTAATTGTGTTGATTGTCACGATGACATGTGTGTTGTTCATTGTGCCAA
TTTCAACACGTTGTTTTCTACAACTATACCTATTACAGCATTTGGTCCTCTGTGTCGCAAGGTCTTTGTG
GACGGAGTCCCTCTGGTTACAACTGCTGGTTATCATTTTAAGCAGTTGGGTATAGTTTGGAACAAGGACA
TTAACACTCATAGCACTCGCTTGAGTATTAATGAATTGTTGCAATTCGTTGCAGACCCTGCCTTGCTTGT
GGCCTCCTCTCCAGCTCTTGTGGATCAGCGTACCTGCTGCTTTTCTGTTGCAGCACTTGGTACTGGTATG
ACTTCACAAACTGTAAAACCTGGTCATTTTAATCGTGAGTTTTATGACTTTTTGAGGGGCCAAGGATTCT
TTGAGGAGGGTTCTGACCTTACCCTTAAACACTTTTTCTTTGCACAGAAGGGCGACGCAGCTATTAAAGA
CTTTGACTTTTATCGCTATAATAGACCCACCATGTTAGATATCTGTCAAGCACGCGTAACGTATCAAATC
GTTAAGCGTTATTTTGACATTTACGATGGTGGTTGTATTACAGCTCGTGAAGTGGTTGTTGTTAATCTTA
ATAAGAGTGCTGGTTACCCCTTTAATAAGCTTGGCAAGGCTGGTCTTTATTACGAAGCCCTTTCTTATGA
GGAGCAAGACCAGTTGTATGCTGTGACTAAGCGTAATGTCATGCCTACCATGACGCAGCTTAATCTCAAG
TATGCCATTAGTGGTAAGGAGCGTGCACGGACTGTTGGTGGCGTCTCCCTCCTTTCTACTATGACTACAC
GCCAATACCACCAGAAACACCTTAAGTCTATTGTTAACACAAGAAACGCGTCTGTTGTTATCGGTACCAC
TAAATTTTATGGTGGTTGGGATAACATGTTGCGTACTTTAATTGATGGTGTTGACAACCCTTGTCTTATG
GGTTGGGACTACCCTAAGTGTGATAGAGCTTTGCCTAACATGATTCGCATGATCTCAGCTATGATTTTGG
GCTCTAAGCACGTTAATTGTTGTACTGCTTCTGATAGGTACTATAGGCTTTGTAATGAGCTTGCACAAGT
GCTTACTGAAGTTGTTTACTCCAATGGTGGTTTTTATTTTAAACCTGGTGGTACCACTTCTGGTGACGCT
ACTACAGCCTATGCAAATTCTGTGTTTAATATCTTTCAGGCTGTTAGTGCTAACATTAATAGGTTGCTTG
GTGTTGATTCCAACGCTTGCAACAATAATACTGTTAAGCACTTACAGCGTAGACTTTATGACAATTGCTA
CCGTCTTTCAAATGTCGATGATGAGTTTGTTAATGACTATTATGGTTATTTGCAAAAGCATTTTTCGATG
ATGATCTTGTCTGATGACGGTGTTGTTTGTTACAATAAAGATTATGCAGACCTTGGTTATGTGGCAGATA
TTGGTGCTTTTAAGGCTACATTGTATTATCAGAACAATGTGTTTATGAGCACTGCTAAGTGTTGGGTTGA
ACCGGATGTTAATAAGGGTCCTCATGAGTTTTGTTCTCAGCACACAATGCAAGTTGTTGATGAGAACGGT
AAGTACTTTTTGCCCTATCCCGACCCTTCACGTATCTTATCTGCTGGTGTTTTTGTCGATGATGTGGTTA
AAACTGACCCTGTTATTTTGCTAGAGCGTTATGTGTCTTTGGCTATAGATGCATACCCTCTATCTAAGCA
TGAGAACTTGGAGTACCGTAAGGTGTTCTATGCACTTCTTGACTGGGTCAAACACCTTCACAACACTCTA
AACCAAGGCATTTTAGAGTCATTTTCTGTCACACTTCTCGAAGACCAGTCTGCTAAGTTCTGGTCGGAAG
ACTTTTATGCTAATATGTATGAAAAGTCTACAGCATTGCAATCTGCTGGCATGTGTGTTGTTTGTGGCTC
TCAAACAGTTTTGAGATGTGGTGATTGTATCCGGCGTCCATTGTTGTGTACAAAGTGTGCATATGACCAT
GTTGTCGGTACACCACACAAGTTTATTTTGTCCATAAGCCCCTATGTCTGCAACCATTCAGGTTGCACTG
TAAATGATGTTACAAGGTTGTACCTTGGTGGGTTGTCATATTATTGTGTAGACCACAAGCCACAATTGGC
ATTTCCATTGTGTTCTGCAGGTAATGTGTTTGGTTTATACAAAAACTCTGCTACGGGCTCTGTGGATGTT
GATGTCTTTAACACCCTTTCAACAAGTGATTGGTCAGATGTGCGTGATTATAGGTTGGCTAATGAGTGCA
AGGACTCTCTTAGGCTTTTTGCGGCTGAAACCGTTAAGGCCAAAGAGGAATGCATTAAGTCTTCTTACGC
TTGTGCCACGTTGCGTGAAATTATAGGCCCTAAGGAGCTATTGCTCAGTTGGGAACCTGGTAAACCGCGG
CCGCCTTTAAATCGCAACTCTGTTTTCACTGGTTTTCAGATTACTAAGGATTCTAAGATGCAGTTGGGTG
AGTTTACATTTGAGAAACTTGACTATGATAGTGATGCTGTCGTTTACAAGTCTACTACGACTTGCAAACT
TAGTCCAGGTGTTCTCTTTGTTCTTACTTCCCACAATGTAGCACCATTACGTGCACCCACTATGGCTAAT
CAGGAGAAGTACTCCACTATTGTTAAGCTCAGACCTGTTTTTAACATTAGTGACGCATACGCTAGCCTTA
TACCGTATTATCAGTTGATAGGCAAACAACGTATTACTACTATCCAGGGACCACCTGGTAGTGGTAAGTC
ACATTGTGTTATAGGTTTGGGTTTGTATTATCCTGGTGCACGTATTCTGTACACTGCTTGTTCTCACGCT
GCAGTGGACTCTTTGTGTGCTAAAGCTGCTACTGCTTTCAACACAGACTCTTGTAGCCGTATTATACCTG
CGCGTGCTCGCGTAGAGTGTTTTTCTGGCTTTAAGGTCAATAACACTTCAGCACAGTACATCTTTGCTAC
AGTCAACACAATCCCTGAGATTAATGTTGACATTGTTGTGTTGGATGAAGTTTCTATGTGCACGAATTAT
GAGTTGTCACTTCTGAATCAACGTGTTAGTTATCGTCACGTCGTCTATGTTGGTGACCCACAGCAATTGC
CTGCACCCAGAACCATGATTTCAAAGGGTGTTTTGGAACCCAGGGACTACAATGTCGTCACACAGCGTAT
GTGCGCTGTAGGACCCGATGTGTTTTTACACAAGTGTTATCGTTGTCCTGCTGAAATTGTTAAGACTGTT
TCAGAGCTTGTTTATGAAAACAAGTTTAAGCCTGTGCATCCTGATAGTAAGGAATGTTTCAAGCTTTATT
GTAAAGGCTCTGTTCACGTAGATAATGGTTCTAGCGTTAACAAGCGCCAACTTGATGTTGTACGCATGTT
TTTGGGCAAGAATCCACGCTGGGCCAAAGCAGTCTTTATTTCACCTTATAATAGCCAGAATTATGTTGCT
AGTAGAGTTTTAGGTTTGCAAACGCAAACTGTGGATTCTTCTCAGGGCAGCGAGTATGACTATGTCATTT
ATACGCAAACATCAGACACCCTACACGCTTGTAACATTAATCGTTTTAATGTTGCTATAACGCGTGCTAA
GAAGGGTATTTTGTGTGTTATGTGTGACAGGTCGCTTTTTGATGCGCTCAAATTTTATGAGCTTAAAATG
ACTGATTTGCAATCTAGTGATGGCTGTGGGCTTTTTAAGGATTGTCATCGTGGCTCTGACAATTTGCCAC
CTTCTCACGCACCTACTTACATGTCACTGTCTGATGCTTTTAAGACCGATAAGGATCTTGCTGTGCAGAT
TGGTGTTAGTGGTACCATTAAGTATGAACATGTTATTTCATTTATGGGTTTTAGATTCGATGTCAATGTC
CCAGGTTATCATAACTTGTTCTGTACCCGTGATTTCGCTATGCGTAATGTTAGAGGGTGGATTGGTATGG
ATGTTGAAGGTGCGCATGTTTGTGGTGACAACCTTGGTACGAATGTACCACTCCAGATAGGCTTTTCTAA
CGGTGTTGATTTTGTTGTGCAACCAGAGGGTTGTGTTATCACTGAGTGTGGCAACAAGGTTACGTCCGTT
AGAGCTCGTGCTCCACCAGGTGAACAATTCACACATTTAATACCCCTTATGCGCAAGGGCCAACCTTGGT
CAGTTGTGCGTAAGCGTATAGTACAAATGTGTTGTGATTGTATGTCTGGTATGTCCGACATCATAATCTT
TGTGTTATGGGCGGGTGGACTAGAGTTGACTACCATGAGGTATTTTGTGAAAACAGGTCCAGTTACACAT
TGTCATTGTGGCAAAGAGGCTACCTGTTACAATAGTGGTTCTCATGCCTTCTATTGTTTCAGACACGCAC
TCGGTTGCGATTATCTGTACAACCCTTTTGTCATAGACATTCAACAATGGGGTTATACAGGGTCTCTTAG
CTTCAATCATCATCAGTATTGTAACATACATCGTAATGAGCATGTGGCATCTGGTGATGCTATTATGACA
CGATGTCTTGCTGTTTATGATTGTTTTGTAAAGAATGTGGACTGGTCTATCACTTACCCTTTCATTAGTA
ATGAACTTGCCATCAATAAAGGTGGTCGCGTTGTTCAATCTCACATTGTAAGAGCAGCGCTGAAGTTGTA
TAATCCTAAAGCTATCCATGACATTGGAAACCCTAAGGGTATACGTTGTGCTAGTACCAATATTTCTTGG
TACTGTTATGACAAACAACCACTGAATTCTAATGTCAGAATGCTTGAGTATGATTATATAACTCATGGTC
AAATGGAAGGGTTGTGCCTATTCTGGAACTGTAATGTTGATATGTATCCTGAGTTTTCTATTGTCTGCAG
GTTTGACACCCGTACACGCTCTGTCTTGAATTTAGAAGGTGTTAATGGTGGCTCACTATATGTGAACAAC
CATGCATTTCACACACCAGCTTATGACAGGCGGGCATTTGCTAAGTTGCAACCTGCACCATTTTTCTTTT
ACGATGATGGTGATTGTGATATTGTGCAGGGTGAGACAAATTATGTGCCATTACGCTCCTCTAGTTGCAT
CACGAGATGTAATGTCGGAGGCGCTGTTTGTTCTAAGCACTCTAATATGTACCATGCTTATGTCAATGCT
TACAATGTCTTTACTCAGGCAGGTTTTACAATCTGGGTTCCAAAGAGTTTCGAACTTTTTAACTTGTGGC
AGACGTTTTTGGACACTAATTTGCAAGGTCTTGAAAACATAGCTTACAATGTTGTGAAAAAGGGCTCTTT
TGTCGGTGCATCTGGTGAATTGCCAGTTGCAGTTGTTAATGACAGAGTTCTTGTTCGTGAGGACCTATCG
GATAATGTTGTTTTTGTTAACAAAACTTCGTTACCCACTAATGTTGCATTTGAGCTTTATGCTAAACGTG
CCACAGGTTTGACACCGCCGCTGACAATTTTGCGGAATTTGGGTGTTGTTAGTACATACAAATTTTGCTT
GTGGGATTATGAGGCTGAAAGGCCTTTTACTTCCTTTACCAAGAGTGTTTGTAGTTACACTGATTTTGAT
GAAGATGTTTGCACTTGTTATGATGCGAGTATCCCAGGTTCTCTGGAGAGGTTTACTCTTGCTAACAATG
CTGTACTCTTTTCAAGACAGCCTATCAAAAAGCTTACAGGTTTTAAAATTAATTATGGCTTCCTTAATGG
TGTTCCAGTTAGCACCACGGAAGGTAAACCTGTTGTTTGGTACTTTTATGTGCGCTCTAATGGTGTTAAC
GTCGACTATGTTGATGGTTATTACACACAGGGTCGTACAATAAGTACGTTTTTGCCACGTAGCCAGATGG
AAGAAGACTTTCTCAATATGGATGAGGGTTTCTTCATTTCTAAGTATGGTCTTGAGGACTTTGCTTTTGA
GCACGTGGTTTATGGTGATGTGTCTAAGACCACTTTGGGTGGTTTACACCTGCTAATTTCACAAGTGCGC
CTAGGTAAAATGGGCGTTCTTAATGTGGAGGATTTTGTTTCTTCAAATGACAGTACACTAAAGAGTTGTA
CTGTTACGTATGCAAATGATCCCAGTAGTAAAATGGTTTGTACTTATGTTGATTTGCTTCTGGACGATTT
TGTTTGTCTCCTTAAAAGTTTAGACCTTAGTGTTGTGTCTAAAGTTCATGAAGTTGTATTAGATTGTAAG
ATTTGGCGTTGGATGCTGTGGTGTAAGGACAATAAAGTCCAAACATTTTACCCACAGTTACAGTCTGCAG
AATGGAAGTGTGGTTATTCAATGCCAACACTTTACAAGATTCAAAGAATGTGTCTAGAACCATGCAATCT
CTATAATTATGGAGAGGGTGTGCGTTTACCTGAAGGCATTATGTTCAACGTTGTCAAATATACGCAACTT
TGCCAATACCTCAATAGCACTACTATGTGTGTGCCGCATAATATGCGTGTACTACACTTGGGTGCTGGTT
CTGACAAAGGTGTGGCACCTGGCACTGCTGTCCTTCGACGTTGGTTGCCTAGTGATGCAGTTATACTTGA
CAATGATGTGAACACTTATGTCAGTGATGCAGACTTTAGCCATACTGGTGATTGTTCCACGCTTTATCTT
ACAGATAAGTTTGATCTTGTTATTTCAGATATGTATGATGGTCGTATTAAGGCCATTGATGGTGCTAATG
TCTCAAAAGACGGCTTTTTCACGTATATTAACGGTGTAATTTGTGAGAAGCTTGCTCTTGGAGGCACTGC
TGCCATCAAAATCACAGAGTACAGTTGGAATAGGAAGCTTTATGAGCTGATGCAAAAATTTGCTTATTGG
ACTTTGTTCTGTACTAGCGTTAACACTTCTTCGTCGGAAGCTTTTCTGATTGGTGTTAACTACCTTGGTG
ACTTCAGCGAAACACCTGTTATAGATGGAGCCACATGTCATGCGAATTATATTTTCTGGCGTAATTCCAC
GCTGATGGCCATGTCTTACAATAGTGTTTTGGATCTGACGCGGTTTGAGTGCAAACACAAAGCTACTGTG
GTTGTTAATCTCAAGGAGTCTGATGTCAATGAAGTTGTTTTAGGACTTGTGAAGAGTGGTAAGTTACTAA
TCAGAAATACAGGGGTTGTTTGTGGTTACGCACAACCACCCCACTTAAGCCATGTATAAAACATTCCTTT
TGGTTGTTTTTACAGTGACTGTTGTTCACTGTCAAAATGCTTGCAACCAAGTTTTGCCGGGTATGAAAAT
TAACTTAGGCTTACCTCCCAGTACGTCATCCTTTGTGTCTGGTTACCTACCTACTCCTGGTAATTGGACT
TGTAGAAACGGGGGCACCACAAAGCTGCAAGGGCATGCAAGGGCTGTTTTTATGCGTTATTATGCATATG
CTAGAGCCTGGTCATTCGGTGTTGGTCCTTCTACCACCATCGATGGTCACTACGGTTTGTATGTCTGGCA
TTCTAATAGTGCTGGTCATATGACCGTTCGCATATGCCGTTGGTACCAAGACAGAGACCCTATTGCGCAG
AATTCCCCACATGATACAACCTCTAGTGACTGTATTTTGAACGTGCGTCAGCCATATGTGTTTACACATG
CTGGCTTTCAGGTCATAGGTGTGTCATGGACTGGAGAAGCTGTTACTGTTTATGGCAAGAGTAAACTGTA
CCGCTTATACGTCCCAGGTGCAAGTTTGTGGAACTCTGTTGCTTTTACTTGTTCCAAGGACGATTCCTGT
GGTCACCAAATAATTACTAAGCCTATCACAGTGAATGCTACTACTGATGACAAAGGTGTCATTACATCGT
ACACAGTTTGTGACCGTTGCGATGGTTTCCCGCACCATGTTTTTGCTGTGCAAGAAGGAGGTAAGATACC
TGGTAGTTTTGATTTTACAAATTGGTTTTACTTGACTAACACATCGTCACCTTTTGACGGTCGTTTTGTC
TCAAACCAACCGTTGCAGATTCAGTGCTTATGGCCGATTCCTGCTTTGACATCAACTACAGGTATCATCT
ACTTTAATTCCTCACGCTTTACAGACCCGCACCAGCGCTGTAATGGCTACAATGAAGTTGGAGGCTTAGC
CGACCACTTGAGGTTTGCTATCAATGTCACCGACCGAGGTGCTTTCCAGCTAGGTGTTATCTCGTTGCTG
GCTGTTCATAATGCGTACAATTTCTCTTGTAGTAATATTTCTAACTTTGTTGACGCTACTACTATTGGTG
TGCCGTTTGGTAAGACTTACCAACCATACTATTGTTTTGTCACAGAAGGTTACAATATTTCTGCTAATCG
CACATTTGTTGGTGTTATGCCTTCTGATGTGAGAGAAATTGTGGTTTCGCGTTATGGGTCTGTTTACATT
AATGGTTACAAGATTTTTAATGTAGGCGAGCTTTATGGTGTTGTCTTGAACTTTTCCAGCCTCACTGGCT
CAGACTTTTGGACTGTCGCCTACGCCAATGAGGTCAATGTGCTTGTTGATATTGAGGAGACTTATATCAC
TGGCATTTTGTATTGTGACACACCTTTGAACCGCCTTAAGTGTCAACAGCAGAGGTTCTTTATGGATGAT
GGCTTTTACTCAGCTATAGATCTTGCACCCCCAGTTGTGCAGACTATAGTGTTGCTGCCTGAATACACTG
GTTTGACTAACATCACACTAGATGTGAATGTTACTTTCAACCCTCCATCATGCATCCAATGTGCACCTAC
TGTTAATAGCATTTTGCTGAATGGTGAGTCTGGTGGTAGTGTTTGTGTCTCCACTAATAGATTTAGTGTT
GATTTCAAACTCACCGTGAACTCGCAGGCTTACGACATCGGTGTTAGAACTGGAAGTTGTCCTTTTTCCT
ATGGCTCACTTAACAATTTTGTTAAGTTTGGGAGTATTTGTTTTTCATTAGTGGACAATGGTGGCTGTCC
TATGCCTATCAACGCCATTAATTACATTAAAATTGAATACCCTATTGGGGTCCTCTATGTAACTCACTCT
CCTGGTGAGGCTATCACAGGGGTTCCTAAGGGTTTCATTAAAAGACTGGGCTTCTTAGATGCTAGTATTT
TGCATCTTAATGTTTGCACAGAGTACAACATTTATGGCATTGTGGGCAAAGGCATTATTAATAAGGCTAA
CAGTACATTGCATACTGGCATAGTTTATACTGATACTGCTGGTGTGCTTGTTAGCTTTAAGAATGTGACT
ACGGGTGACATCTACAGTGTCATACCATGCCAGACCTCAATGCAGTATGCGGTGATTGCTGATAACATTG
TTGGTGTTATCTCAGCAGACACTGCAACTGGCATCACATTCAATCATACAATTGCCACACCGATGTTCTA
TTATTCAACAAACACTGACCGTAATTGCACAGAGCCAGTACTTACATATGCTACTATGGGCATTTGTGCT
GACGGTGCTATAGGTTATGTGCAACCGAGAGTTGTATCTACAACGCCTGCAACACCCATTACCACCGGCA
ACCTCACAATACCTGTTAACTTTACTGTCTCTATACAGGCAGAATATGTCCAGGTGTCGCTGCGTGCAGT
GGTTGTGGATTGTGCCACGTATGTGTGTAATGGTAATGTGCGTTGTTTGCAGTTGTTGCGTCAGTATGTT
ACAGCATGTACTTCTGTCGAGAATGCATTGGCATTGAATGCACGTCTGGAGAGTCAAGAGGTTGCTGACA
TGCTGGCAGTTGATTATGCAGCTTATCGGTCTAGTTTGGAGCTAAACACACCTCAGTTTGAGAATGGCTT
TAACATTTCAGCTGTGCTTCCTGCGGGTGAAGGTAAGGGTAGTTTTATTGAGGATTTGCTCTTTGACAAG
GTCATTACTAATGGCCTTGGCACTGTCGATGCGGACTACAAACGCTGCATTGAAGAGAAAGGTGCTATTG
CTGACGTGGTTTGCAGACAGTACTACAAGGGCATTTCTGTTCTACCTGCACTTACTGACCCTGCTCGTAT
GGGTTTATACTCAGCATCACTTATGGGTGCCCTTACCTTGGGGGCTTTTGGTGGTGGTGCTGTTGCTGCA
CCTTTTTCCATAGCCGTCTTTTCTAAGCTTAATTATATTGCTTTGCAGACGGACTTAATTCAAGAAAACC
AGAAGCTTATTTCAGCCGCGTTTAACAATGCCATGGGTAACATCACTAAGGCATTTACTGATGTAAACAC
AGCATTGCAGCATGTCTCAGACGCTGTGAAAACAGTTGCCACTGCACTTAACAAAGTGCAGGATGCAGTC
AACACACAGGGAGAAGCATTACAGAAGCTAACTTCTCAGTTGGCGCAAAACTTTGATGCTATCTCATCGT
CAATTGACGACATCTATAATAAGTTGGATGTTCTGGCAGCTGATGCTCAGGTTGACCGGCTTATTAATGG
CAGACTTTCTGCTCTTTCTACCTTTGTTTCTGCTCAATTAGTCAAGTACTCAGAGGTTAAGGCTTCCAGA
AACTTGGCGATGCAGAAGGTGAATGAGTGTGTTAAGTCACAATCTTCGCGACTCGGCTTCTGTGGTAATG
GCACACATTTGTTCTCCATGGTAACAGGTGCACCGGATGGTTTGATGTTTTTGCATACTGTCTTGCTACC
CACTGAATACAAAGAAGTTGCAGCTTGGGCTGGTCTTTGTGTAGGTGGTAAGGCCTTTGTTTTACGTGAT
GTGCAGTTGTTGCTCTTTATAAGAATAATCCAGTACCTTGTCACATCACGCAATATGTACCAACCGCGTG
TGCCTCAAATGTCTGATTTTGTGCAGATACAGTCTTGTGCAATTACATATGTCAACCTTACTTCGGAAGA
GTTTAACAGTGTTGTGCCTGACTATATCGATGTTAACAAAACCTTGGAGGACTTTGCTGCCACTTTACCT
AATCGTACTTACCCAGATTTTTCCTTGGACCAGTTTAACCACACTTACCTGAATATTTCTGGACAAATTA
GTGTACTCGAGAACAAATCTGCTGAGTTGCTCTTGATTACTGAACGTCTCCAGCAACACATCCAAAATAT
CAATAATTCTTTGATAGATTTGGAGTGGCTTGATAGACTTGAAACTTATGTCAAGTGGCCTTGGTGGGTG
TGGCTGTGCTTTGCAGTTGTTTTTGTCATATTGCTAGGACTGATGCTTTGGTGTTGCATAGCCACAGGTT
GTTGTGGGTGTTGTAGCTGTATCACTGCATCGTGTGCCGGCTGTTGTGACTGCAGAGGTAAGAGGCTTCA
ACGTTACGAAGTGGAGAAGATCCACATTCAGTAATGTTTGGTTTGTTTCAACTCAATATACAAAATGCCG
CAAGTGTGGTTCGAACGTCCATCGTTCCTAAACAACTACTACCTCATGTTGTCCCTATTGCGCATTTTAA
TCTGGGTATTGATTATTTATTTAGCAGTGTGTTTGTATACTATTTTGCTACTTATCGTGGCAATAGTATT
AAGACTAACTGCGCCTTATTTGTTTGTCGGCTACTTGTCCTTTTTGTATACGCACCTTTACTACTTTACA
CAGGTGCATACATTGATGGTAGCCTCACTGCAATTATCCTGCTATGCAGGTTTTTCTATGTTGCGTACTT
TGCTGTGCGTTTTCATAGCTTTTACTTTGTCTTACTTAATAGCCCAACATTAGCTTGGGTGTTTGGAAAG
GCGTGGTATTATCATTTTGATGACTACACGTGTTTACGTGGGGGTGACTCTTATGTTCGTTTTGGGCCTC
ATTTTGTCCCCTTTGTTAGCGATAGAAACTTATTTCTCGCTTTGAGGGGTCGTGTGCAAAAAGACGTCTG
TTTGGTTAGGCGTGTTGAGCTTATTAATGGCGACTTTTTGTACATCTTTGCTAGCGAGCCTGCTATAAGT
GTCACATTCATCAATGATGTAAAGTAGATCTATTCTTCTCAACTAAACACTATGTTGTTTACATTGATTA
ATGATAATGGCTTTGTTCTTAACGCCATTTTGTGGGTATTTCTACTTATCTTTATTATTCTACTCTGTAT
AGCATTTATTAAGCTTGTGCAAGTGTGCTTTGCTTGTCACCAGTTGATGACAAGCGCTGTCTACAAGCCA
GTGCACAATGCTTATGCTATTTACAGGGATTTCATGAGAATAGACCCCCATCCAGTTTTAGATGTCTAAA
CGAAAATGAGTTCATCTAATCAGACAATTCCTGTCACTGAGGTGGTTGAACACCTCCGTAACTGGAATTT
CGCTTGGAACGTTATTTTGACTGTTTTACTCGTTGTCCTTCAGTATGGCAACTTCAAGTACAGCAAGGTC
TTGTATGGCCTTAAAATGCTTGTGCTTTGGGTGCTGTGGCCTACTGTGTTGGCATTGTCCATTTTCAATG
CCTGGGCTGAGTTTAACGTCAATTGGGTCATGTTCTCCTTTAGCATAATTATGGCCTGCGTAACTTTTGT
GCTGTGGATAATGTATTTTGTCAACAGCTTCAAGTTGTACCGCAGAACTCAGACTTTCTGGGCTTTCAAC
CCTGAAACTGATGCCATCATCACGCTCAATGTTTTCGGCCGGACCGTAGCTATTCCCGTAATTACGGCGC
CAACTGGGATCACATTGACTGTGCTCAACGGACAACTTCTTGTCGAGGGCTATAAGGTTGCTAATGGTGT
ACAGGTAGGACAACTACCATCGTACGTCACAGTCGCCAAACCGAGCACCACGATAATTTACCAACGTGTG
AGCAGGTCAATCAATGTGCGGTCCAACACTGGTTGGGCTTTCTTTGTTAGATCCAAGAATGGCGACTTTT
CGGCATTAGCTACAGATAACGAGACAATGACCGAAAGAGAGCGGCTTTTGCATTTAGTCTAAACCGAAAC
ATGTCCTCCTCAAAAGGAAATGTCGGTTTTGACAATGCTGCACGAGGCCGTTCTGGACGTGTCCCGTTCT
CATTTTACATGCCAGTTATTAATAACTCATCTCAGCCATTTTATAAGGTCATGCCACAAAATGCTGTCCC
GAAAGGTCAGGGCAACAAGGACCAGCAAATTGGCTACTGGAACGAGCAAGTCCGCTGGCGTATGGTTAAG
GGCACGCGTAAGGACCTTCCATCCAAGTGGCATTTTTACTACTTGGGAACTGGGCCTCACGCTGATCTCA
AGTTCCGCCAGCGCCAGCAAGGTGTCTTCTGGGTTGCTAAGGAAGGCGCTAAAGCTGAACCTACTGGACT
TGGTACTCGTGGCAGAAATGCAGAGCTTACCACTCCTATCTTTAATCCAGGGCTCCCTGACTCCATTGAA
ATTGTTGACCAATACTCACGCCCCAACTCACGTGCCTCTTCGCGTGCTAGGAGCCAGAGTAATGATCAAG
GAAATCGCTCTAGATCGCAGTCCAACAACAGGGCTCAATCTAACAACAGATCTCAGAGCAGAGGACGTCA
GAATCAGAACCAAAATAATCAGCCCACAGGAGATGGTGGATCAAATGGTCAACGTAACCAGCCTCGCAAT
AGATCTAACTCACGGAACCGTAGTGGTAACCAAGGCCGCAATGGCGGAAGCCAACAAGACTTGGTTGCTG
CCGTCCGTGAGGCTCTTGCTGGAATGGGATTCAAGCCAAATACCTCAGGTAGTGGAAGAAACACCCCTGT
GAAGGTGCCTAAGGGTGACAAACCCTTAAATAAACCTACCAAAGCACCAGCTTCGCAGGTTGAGAAACCT
GTGTGGAAGAGAACTCCGCACTCCCAGGAGAATGTGGAAGTGTGCTTCGGTCCACGCGACACCTACCAAA
ATTTTGGTGATAGTCAGCTGGTCCGTCTTGGTGTTGATTATCCTCACTACCCGCAGATTGGCGAGCTGAT
CCCCAGTCAAGCTGCACTTCTTTTTGGCAGTGAAATTACTGCTCATGAGCGAGGCGATAACATCCAACTT
ACCTACATCTACAAGATGGAGGTGCCTAAGGATCATAAGTCACTTGCGGCCTTTTTGCCACACATTGGTG
CTTATGCTGATTCCACCGAGGATGTTACACTACCACCAGCTCTGCCCCCAAAACAGCAACGCCTCCGCCG
TAGTGCTAGTACTGAAGTACTTGCTGACACCACTTCTGTTGTAGACGAAGAAGAGGTGGAGGAGGTTGTT
GATGATGTTACTGGTCAGGATGAAACATTTGCGTAATCAACTAAATTATGAAATTGCTCCTGTTAGTGTG
TCTTGCAGCCATTGTGGCTAATTACACCATGGACTCAAAACCACTCCCTAAACCGGTTAATACCACCCCT
GAGCATTGTGACAGTTTCACCTTTGGTGATACTGAAAAATTAAGGCGCAGGTGCATTCAAAATGTAAAGG
CTGACACCCTGGGCATGTACCTTAATTTGGTGCAGACTGTCCAGACGCCTGATGGTCCTATTACCTTTGC
CATTGACAGACCCAATAAACATGGGCCTATCTATGACATGTCAAAGGTTGACAAGGACCACACTGTCACA
ATCTCAACCCCGCAGGGATCCATCAGTGTTAATGTCGGCGAGAGTTTTCTCTCAGAAGCCCCATATGCTG
AGGATGCTGCAACTAGTGATTAAGTAAGAAGAAAAATCTGAACAGACACTGGCCGCTTAAGTGCTGCAAG
ATTCGCTAGAACTACGCTAGCGTCTCGGTCTTGTGCACAACGGTAAGCCAGTGGTCATGTCAGCACAATG
AAGGATATGACCATGTTGCTTTGACGAGTCGAACGCAATACATGCTATTTAAGTGTAACCCAGAATGAGT
ACAAAGATCCGCTATGACGAGCCTAACATGCTAGTTAGTGCAATGAGCGATGTTACAGAAGTACGCCATA
AGAAACCTTGGGTACAATCTGTTTCTATTGCCATTGCAAAACCTAGCAGGGAATAGCTGGTATCACACTT
AGTATTGTATTTGTTAGTAGGCATTGACATCACGGCATCGACATGGATACACAAAAAAAAAAA

>gi|971746735|ref|NC_028824.1| BtRf-AlphaCoV/YN2012, complete genome
AAGTGTCGTGCTCCTAGGGGTTGCACTTGACGTGTTCCGTCACGTACTTGTGTCCTTAGTGGCCCCACGC
TGTTCTGTCAGTGTGGTGTGTGGATATAGTGTTCCGTCACTATTGAAACCGATAACTGTGCACAATGTCT
ATCAACCAATTGACACTTGCAGTTGCAAGTGATCAGGAAATTTCAGCTCATGGCTATTCTACTATGTCTG
ATGCCGTTGAACATTTTAGTTCTTCCGCATCACATGGTTTTAAGGATTGCCGTTTTGTAGCCTTTGGGCT
GCAGGACATTGTTATTGGAGTTGAACCCAGTGACTTTGTTGTGGCTTTGGAGGGTGATGAAATTCTCACC
GCCTATATAGCCACTTTTGGAGCTAGACCTCGCTGTTTGCGCGGCTGGCTCATACCCTCTAATTCTAATT
ATGTTTTGGAGGATTTCCAGGTAATTTTCGGCAAGCGCGGCGGTAACGTCGTGTTTGTTGACAATTATAT
GTGCGGTGCTGATGGTAAGCCTGCAGTTCCTAGAGAACAATGGTCTTTTGAGGAACACTTTGATGATGAT
ACTGAAGATATCATTATTAATGGTGTGACTTACCGCCATGCTTGGAATACCATCCGTGCTGACGACCCTT
ATGAAAAACAGGGTTTACTTTCTATTAAGTCTATAGAGTATGTCTCTACTATTCCTCACAAGTTGCCTAA
TGGTTCTGTTCTTAGTGTTGCTGGACCACCTAAGAAACGTAAAGCTGTTGTACTTGATGAAAAGTATAAC
AAGATTTACAATGCTTGTGGTGTGCCCTTTGTCACTAATGGCAAATCTATTTCTGAAGTTGTCACTAAAC
CACTCTTCTTGCATGCGCTTGTTAAGTGTAAATGTGGTAATGAGTCTTGGACTGTTGGTGACTGGACCGG
TTTTAAAACTACTTGTTGTGGTGCTACTGGTAAGGTCACAACTTTTGCAGTTGGAGATGTTACTCCTGGT
GACATTGTTTTTACTACAACTGGTGCAGGTACAGGAACTAAATTTTTCTGTGGTCTTGTTTTGACTCATG
TTGATACACTTGAGGGTGTTTCTGCATGGCGTGTTGTCAAGGCATACACTGTTGACACCTTTGTTGCATC
ATCTAATTTTGATGAGTTTAACCACGTTATGAGCTTGGACCAATGTTCCTTTGACAATTTCAGCTCTATT
AGCGTAGCACTGAAGTTTTCACTTTTGCGTGGTAGTTGCTGTGATGATGTTAAGGTTGCCGTTGCAACTG
GTGTGATTGACATTGGTCTTGGTGTTTTTGATGTTAATGACACTGTTTTTGAGAATGTACCATGGTTTGT
TCAGAAATTTGAGTTTTTGAAACCAGCATGGGATGCTCTAAAGCAGGCAATTATTAATCTTGGTGTAACA
TCTAAGGCTGTTCTGTCTTTTATTAAATCACTGTGCAGTGCTGCATTTAGTGTTGTTGACGGTGTTCCAG
TTATTGTCTGCACTGTTGCTGAGAGATTTTCTAAGGCTTTTACTGATTTTTTGAGTTACACCCGTGAATG
CTTTACTGCCCTTTGTGATGACATCGTTGTGTTCGGTGTCAATTGCAAAGCTGTCGGTGATTACATTATT
TTTAATAATAGTGTGGTCAAGACTATTAAAGCTAAAGTTAAGGGTGTTAAAGAGGCAGGTCTTAAGAATG
TAACTTATACACAGTGTCTTCTTGGACCTACTAAATCTGTTAAGGTTAAGCGCGTTGAAAGTAGTGTTGC
TCAGCTTAAAGTTGTTGACACTGCCGTACCACTAAAACAGGAAGGTGAATGTCTTGTTGTCGGTGGCCGT
GCTATGTTTAGGTCTGATGGCTATTATAGGTTTATGGCTGATGCTGATGTTGTACTTGAGTCACCTGTTT
TTACAGCTGGTTCTCAGTACAATGTTGTGTTTGAAACTGACGCCTTATTTATAGCCCCAGAAATTGGCAC
TGTGTTTGAAGGTGATAACATTGACACTGTGGTTCAGATTGTTGCCAATAAAGTTCAAGCATTTAACAAT
AGATTTGTTGTTTATAACACACATATTGTTGATGGTGCTATTACTGTCTTTTGTGACTATAACTTTTCAT
GCCCAGCGTTCTTGGATGGTTTTCCAGAATGGTTTTCATTTTGTAAGAATCATTTTAAGGATGCTGGATT
TGTTGAGTTTTATGACAGCATTATTAATAGTGACAGCAATTTTCAAACCACATTTCAGCCTTATCTTGAC
CTTAAATCATCTATTGATGCTTACTTAGGTCCTGAAATTGTTAGAGCTGTTGATGGTGGTCGTTTGTGGC
GTACAGTTATTAATGGCATTAGTGATGCTGTTAATTTTTGTAAGAATCTTAGGTTACACTTTGAGTTTGG
TGAGCTTAAGGGTACTGTGGTCAAGCGTTTTAAGGGTATACTTAGAACTCTTCTTACAGTTTACAATGAG
TTTATTCAAACCACTGTTTCTGTTCTTACTATCTGTGGCATTAGTGCCAAGTACTATGCTTTTGATAAGC
CTATGCTTTGTATGCATGGTATAACAGAGCGTGTTACTAGTTTTGACATTACTAATCTTGGAAAGCCCAT
TTTAGATGGTCTTTCTAAGTGTAATGTCTTTGCATGTGGTTCTAATGCAGTTGTAGTTAATTCTGTTGAT
CATGAATTGCTTGATCTTGAAGAGTGTGAGTTTGTTGAACCTGCTAGTCATGGTGTGCTTGTCATATCAG
ATGATTATGGTTTTTATTCTTGTGAAACTGGCATTTATCCATATGCCAGCGATGGTAAGGTTTTGCCATT
GCGGTTTAGAAAGAAAGCTGGTGGTAAGAATGTTGCCTTTGATGATAATGTTATTGTTACTGAGATAGAT
CCTGTCTTTAAAGTTAAGCTCAATTTTGAGTTCGATGATGATAAGTTGGTCACAATATGTGAGAAAGTTA
TTGGTAATAAAATTAAATGTAGTTCCTGGTCTCAATTAGTTGAAATTATTGAAACTGCATTGACTACCAT
TAAGTCTTACTATAGTGTGCCTATTTATTACATCTATGATGAGGAAGGCGGTGAAGATCTCAGTGTGCCT
ATTATGATTTCAGAATGGCCTTTGGATAGCACTGGTACTGAAATTGTCGTGGATGTTGAGGACGTTGATG
AGCCTGTGTCACAAATTGAAGAAGTTAACAATGCTTTTGCTATTGAACCTTCTCCTAAACGTGATGTCAG
TCCATTTGGATTTGATAGCCACGACCTTAATGGTATACGTGTTTTAGTACAGAGCCAGAATAATTGTTGG
GTTAATGCAACCTGCTATCAATTGCAAATGCTAGGTTATGATGATACAGCAATGGAACTTTTTAGACATG
GTGGTGTTCATAACTTAGTTAAACGATGTTATGAAGTCACTGGTGCGTTTTTAGGTTCTCTAGGTGACGT
ATCTTTTTGTCTTGAAGAACTTTTGCGGGACGTTAAAATGGCTAAAGTAACTGTTGAAGTTACATGTAAT
TGTAGTTCTTATATGGATGAATTGCATGGTACATTTTTCCGTTTTATGCCAAGTAAGCAAAAGTTTGAAT
ATGGCGGTTGTGGTGAATGTCATGGTACTAGGTATTACAGAGTCTGCGGTATTGTAGGTTCTGCAATATT
TGCTCAACCACTAAAACATCTTAACCTAGATGATTTGGTCTGTGATGTTGCTAGTGCTAGTGTTTTTCTT
GGTAATGACTGTGGTCATTATATGATTAATGACTATGTTCATAAGATTTGTGTTGATGGTATGGGTGTTT
ACAAAATTAAGCACAATACTATTGATACTATTGTTGCTAAAAACGCTAACATTAAGCCCAACATTATTGC
ACCTTTTACAGAGTACTGTAATATTAAATTTTACCAAGGTGATTTTAAGGACCTTGCTGGTCTTTCTCAT
GACTTTGTTGTTAACGCAGCAAATTGTAATTTGGCTCATGGTGGTGGTGTAGCAAAGGCTATAAATGACT
ACACTGATGGCAAGTTACAGAAACTCTCCAACTCTTTTGTTAAGAAAAATGGTAAAGTTGATGTTGGTGA
GTGTGTCATGCTGGACACAGGCAAGATTAAAGTTCTTAATGCTGTTGGTCCCCGTAAAGGTAAAGATGCT
GAGTCTTTGTTGAATACCGTTTATACTAATATCTTTTCTCGTAAGGGTGTTCCTCTTATGCCTCTTATTA
GTTGCGGTATTTTTGGATTTGATCTTAAAGACTCACTTAGAGCATTTTTGGATGCATGTGGTAATAGACA
TGTTAAGTGCTTTGTATATTCTGACCTCGAAAGAGAGGCAGTTATGAAGTTTTTAACAACGCCTTGCGAT
GATACTGTTGTATCTGTTGAGACAGTAGGAACACCTTTAATTGAGGAGACAACAGTTAATGTTGTTCCTC
CATTTCGCACTATTGGTACTCATAATTTTTATGATTTCAGTGGTGTTGAGCCTATTTTAGGTTTAGGTGT
TAAAAACATTGTCCTTTTTACAGATCAGGTATTGTCTGTTAAAGATTTTGGTGTTGTTGTGGATAGGCAT
CTTAATGGCCTACTATCTGATATGTCTAGTAAGTATGTTAATGATCACAAAGCTGTTCCATTTGGTAATA
TTTTGTCACTTGATTGTGGCGCTTTTACTGTGGTGGATGCTGTAACACCATTTGAAGGTGCCAGCTTTGA
AAAGCAAAGTGGTCGTACTATACGTAAATTGACTAGGTTAGATGGTAGCACATTATGTGTTCTGCCTAAT
AATAGTGCATTATTTGATAAGCTATTTGCTTTGGGTGACAACTTTTCATTTTTGGTTTTAGATAATGTTA
AACCTTTGTTTGAGGATTATCTTAAACCCAAGGATGTTAGAGTTAAAGTCACAGCTGATGGCCGTAATGT
TAATGATGTTATAGTTACAACTACAGAGACTTTTGATGCACAATTAGGACCTGTTTCTAATGGTTCTGAA
TCACTTGTGGGTGTTACACCTACCGTTGCTGATAATGGTAAAGTTGTTAACACTGTACCAGATGTTAATT
GGAGTAAGCACTTTGGTTTTTCTGATGCTGCTGCTTTTGCAGTTCTTGACCATAGTAAGTTTGCTTTTGA
TTCTGAGATAGTGGATGGTAAACGTACACTTGTTGATTCAGATAATAACTGTTGGATTAATGCCACTTGT
TTAGCATTGCAGTTTCTTAAACCTACGTTTAAATACGTGGGTTGGGAAGATTTGTGGAACAAGTTTGTCA
CAGGTGATGTTTCTGGTTTTGTGCATCTTCTTTACTATATAGAAGGTGTGGACAAAGGTGCCAAGGGTGA
CGTTGAGAGTACATTGAGTAAACTTGATAAATACATTGTGTCTAGTGGTTCTGTTACTATTAAACGTTCT
ACGTTATGTGAACATTGTGATAGTACAGTTAAAACTATGACCGGTGCTATAGTTGAAGCTTCTGTTATTC
TTAACGGTCATATAGATGGCCATTGTCAACATAATTTTGATTGGCGTGTGCAAGTTGTTGGCGTTAAGGG
TGACATTATACTACTACATAGTGGTAGAATATTAGAGGGCCCTTATTTACATGGTGACGCTTATGTGGCT
TTTAGTGGTGACACTGATAATGGTCATTATACAGTCTTTGACAATAAATTATCTAAGATGTATGATGGTA
CTAAATGTGTTAAAACTACATTGGACACACTTACTGCCTCGTCTGTTGTTATTCGTAACGGTAGTTATGC
TGTTAAAAGTGAGCATGTACCGTTAATTAAAAAGTTGGATGATTCAGCTGAGAAATTCTTTAATGTTGGC
GACATTATTGCGCACAATATTGCATATTTCTTTGTGTGGCTGGTTACTACACTTAGTACTTTATATAGGT
GCTGGCGTGGTGGTAATTTTAAATTATTATCCAGCATACCTGAGCGTAGTGGTGTAGTATTAAGTAGGAG
TCTTAAGTACAATTTTAGAGCTTTACGTTCTAATGTTGTTAGTAAGCAAAAATATTGTTTTATGTTTGCT
AAATTATTACTTTTACTGTATACTATATATGCTATGTTATTTATTTTAGTTCGGTTTAGCTTTTTTAATG
ATTACATTTGTGGTACTACTGTTAAAGGTTATACTAATTCTGACTTTGACAAGGGTAAGTTTTGTAACGG
TTCTTTGGTTTGTAAGACTTGTCTTTTTGGTTATCAAGAACTTAGTGACCTGCAGCATGTTGGTGTTGTC
TGGAGTTATGTGCGTGAACCTCTCTTTTCTAGTATTTTACCACTATGTTATTTTGCTGTTATTGCAATTT
TTGGTGGTGTAATTGAAAGGTTTGCATTATGTTACTTTGCCGCACAATTTATAAATAATACTCTTATTTT
CTTTAAATTACAGGACCCTTTTTGGCCTGTTCAGCTTGTTCCTTTTGATATTTTTGGTGATGAGATACTT
GTTATATTTTTATCATATAAGGCCATCTGTTTCTTTAAGCATGTAGTTTTTGGTTGTGATAAACCTAATT
GTATTGCATGCTGTAAGAGTGCTAAACTTAAGAGAATTGCTATGGATACTATTGTTAATGGTTCCAGGCG
ATCTTTTTATGTTAATGCTAATGGTGGTGCTAAATTATGTAAGAAACATAACTTTTTCTGTGTTGCCTGT
GACTCTTATGGTAGTGGTCATACCTATATTAATGACCATATTGCCACTGAGTTACATAATATTACTAAGT
TACATGTTAAGCCTACTGGTCCTGCCTCTATTAATATTGATAGAGTGGAGTTTAGTGATGGATTTTATCG
CATATTTGCTGGTGATAAATTTTGGAAATACAACTTTGACATTACAGATAAAAAGTTCTCTTGTAGAGAG
GTACTTAAAAACTGTAATATCTTAGATGACTTTATTGTCTTTGACAATAATGGTTCAAACTTATCACAGG
TACAGAATGCATGCGTTTATCTATCACAACTTTTATGTAAACCTATTAAGATTATTGATTCTACACTATT
GTCCTCACTTAATGTTGACTTTAATGGCGCTTTACATAAGGCATTCTTGGATGTCTTACATAATAGTTTT
GGTAAGGACTTTAGTTCTTGTAAAACTATGCATGACTGTAAGGAGCTACTTGAGTTAGATATTAGTGATG
AAGATTTTGTTAAGGTGGTATCCGATGCACACCGTTTTGATGTGCTTATTACTGATACATCATTTAACAA
TTTCTGTACATCTTATGCCAAACCATCAGAGAAACTTTCGTCTTTTGATTTGGCACATTGTATGCGTAGT
GGTGCTAAAGTTGTTAATCATAATGTCCTTATTAAGGAGAAAATGCCTATTGTGTGGAACTGTGTTGATT
TTGCCAAGCTTTCAATTGATGCACGTAAGTATATTGTTAAAACTGCTAAGGTCAAAGGTGTAACTTTTCT
CCTTACTATTAATAATAATGTAATGGAAACCACTTTACCATGTGTTAGTGTTTTACAGAAACAGGGTGCT
GGTAAATTGTCCTCTATTTGGAAGCATTTTTGGTATGCATGTGGTGCTATTTTGGCACTGTTTTTGCTAC
TAAATTGTTTAAGTTTTACAGAGTATGCTATTAGCTTACCTGGTTATGACTTTAAGTATATTGAGGATGG
CCAGCTTAAACCATTTATTAGTGGTTTATACTGCGTACGTAATAACTTTGACACGTTTATGGAATGGCAT
GCTCAGAAGTTTGGATTTAGACCATCAAATAGTGACAAGTGTCCTATCGTTGTTGGTGCTAGCGATTCTG
GTCGTGTTATACCTGGTGTTGCATCTGATGTTTATTTGCTTGGTAAAACACTAGTTTTTACACTTAAAAC
TGTCTTTGGTAGTGCTGGTCATTGTTATGATGTTAATGGTATAGCCGATGGCGACAAATGTTTATTTAAT
TCTGCTTGTACTAATCTAGAAGGACTTGGTGGCACGCGTACTTATTGCTATAAGCCCGGTCTTATAGATG
GTGCTATGACGTATGGTGATTTAGAACATGATTCTTACTACCGTTTGAGTGGTGATAATTATGTTCGTTT
ACCATATGTTGTTGTTCAGGGTCTTGGTTTTAGAGCTGTGCGTACCCAGGCTACTACATATTGCCGTGTT
GGTGAATGTGTAGATTCAAAAGCTGGTATGTGTTTTGGTGCAGACAGGTGGATGGTATATTCTAATGACA
TAGGTTCTGACTTTATTTGTGGTTCTAGTTTGATGGACTTGTTACGTAATGTACTTAGCGTGTTCAATTA
CAACTTTTCCACTATGATTATGTCAGGCCAGGTTATTTTTAATTGTGTTCTTGCATGTGTTGTTGTTTTT
GGCTGCTACTTTGTGATGAAATTTAGACGTGTCTTTGGTGACATGTCTCTTGCTGTTTTCACAGTTTGTG
CTGCTGTTGTTGTTAACAACCTTTCCTACTTTATTTCATTGAATTATGTGGGTATGGTTGTTTACTCTTT
TCTATACTTTATTAGTACTAGAGGACTTAAGTATTGCTTTATATGGGATATCAGTTATGTTGTTGCCTAT
TGTCTGTTAGCTCCATGGTGGTTGCTTACATGGTATGTTTGTGCAGCGCTAATTGGCCTGATTCCCAATT
TGTTTAAACTTAAGGTTTCTACTACTTTGTTTGAAGGTACTAAATTTGTTGGCACGTTTGATGCTGCATC
AGTTGGTACTTTCGTTATTGATGCACGTTCTTATGAGCGTCTTATCAATAGCACTAGTATAGAGAAGATT
AAACAGTACGCTAGTACTTTTAATAAGTACAAATATTATAGTGGTAGTGCTAATGAGGCTGATTATAGAT
GTGCTTGTTATGCCCATCTTGCTAAAGCCCTTATTGATTTCTCAACAACTAGACAGGACACATTATACAC
CCCACCAACTGTTAGTATTAACTCTACTTTGCAGGCTGGTCTTAAGAAAATGGCCCAACCATCTGGTCTT
GTTGAACCATGTGTAGTTCGTGTCTCATATGGTAATACAGTACTTAATGGTGTTTGGCTTGATGACAAGG
TCTATTGCCCTAGGCATGTTTTGGCTAGTGACACCACAGTTACTATAGATTATGATGCAGCTTATCATTC
GATGAGATTGCATAATTTTTCTATTTCTAAGGGTAATGTTTTTCTTGGTGTTGTTGGTGCTGTTATGCAA
GGTGCTAACCTTGTTATTACTGTGTCACAGGCTAATGTTAATACTCCATCATATAGTTTTAGAACTTTGA
AAGCAGGTGAGTGTTTTAACATTTTAGCTTGTTATGATGGTACACCTGCTGGTGTCTATGGTGTTAATTT
GAGGAGCACACATACAATTAAGGGTTCATTTGTTAATGGTGCTTGTGGTTCACCAGGTTTTGTCATGAAT
GGTCATAAAGTAGAGTTTGTCTACATGCACCAGATAGAGCTTGGTAATGCATCACATGTCGGCTCAGATA
TGTTTGGTAACATTTATGGTGGGTTTGACGACCAACCTAGTATTCAGCTTGAGGGTGTTGCCACTCTTAT
TACTGAAAATGTTATCGCATTTCTATATGCTGCTTTGATTAATGGTGAACGTTGGTGGTGTTCCAATGAA
CGTTGCACTATTGATAGTTTTAATGAATGGGCTCTTGGTAATGGTTTTACTAATTTAGTGACTGGTGACG
GGTTTTCTATGTTGGCTGCTAAGACTGGCATCGATGTGTGTCAAATTCTTTCAGCTATACAGAGACTTGC
AACGGGTCTTGGTGGTAAGACAATTTTAGGTTATGCTTCTCTTACAGATGAATATACACTTAGTGAGGTT
GTTAGGCAAATGTATGGTGTTAACATACAGAGTACTAAGACTAGTAGTGCTTTGAAGAATCTACTTCTTA
TGGGTTTCTTTTTCCTACTATTTTGGTCTGAATTCTTTATGTATTCAACTATACTTTGGATTAACCCAGG
CTTAATCACAACCTTTTTGGGTCTCTTTGTAATGCTATCTATGCTGCTTGCTAGCTGTATTAAGCATAAA
ATGCTCTTTCTTCAGTTGTTCTTGCTCCCGTCTATTATTATAGCTGCGTGCTATAATTTTGCTTGGGATA
TGGAAGTAACTAGAATGTTGGCTAATCAGTTTGACTACCATGTTTCATTTCTTAATATGGATATACAGGG
TGCTATTAATATTATTGTGTGTTTTATCGGTATTTCTTTACATACTTATAGGTTTTTAGACACACAATTA
CGTTCTTATAGCACTTATGTATTATCTATGTGCACAGTCCTTTACACATTTTATTATGGCTATGACTCTT
TGAGCCTTGCTATAATGTTATTGGGTTTTGGTTGTAGAGAATGGTATGTTGGCACTGCTGCTTTTAGACT
TGCTCAATTTTTAGTGCCATATTGTCCTGGACTTATTACCTTTGTTGGTGATATTAAGGCTGTTTTGGTA
CTTTATCTTGTCTTTGGTTTTATTGCAACTGTTTATTTTGGCTTACTTTATTGGCTCAATAGAGTGCTTA
AATTGACTCTTGGCTGTTATGATTTTAAAGTATCAGCTGCTGAATTTAAATATATGGTTGCAAATGGTTA
CACTGCACCGAGGGGTCCTTTCGACTCTGTTTTACTTAGTCTAAGACTTCTTGGTGTTGGTGGGCATAAA
ACCATTAAGGTTTCTACAGTGCAGTCTAAACTTACAGATCTTAAGTGTGCTAATGTTGTGCTTCTAGGTT
GTCTTACTAATATGAATATTGCTGCTAATAGTAGAGAATGGTCTTATTGTGTTAATTTACATAATGAGAT
TAATCTTACTAGTGACCCAGAAGAAGCTCTTGAAAAACTTCTGGCTTTAGTAGCGTTTTTCCTTTCAAAA
CAACAAAACTTTGGCGTTGATGATTTAATAGATTCATTCTTTGAAAACAGAAATGTTCTTCAAAGTGTTG
CATCTGCTTTTGCTAATATGCCTAGCTTTATTGCTTATGAAAAGGCTCGTATGAATTACGAAGACGCTAT
TGCTAATGATGCTTCTCCTGCTGTTATTAAACAGTTAAAGAAGGCCATGAATACTGCTAAGGGTGAGTTT
GACCACGAATCTTCAGTGCAAAAGAAAATTCAGCGTATGGCTGATGCGGCTGCAGCACAGATGTATAAAG
ATGCACGTGCTGTTGATCGTAAATCTAAAGTTGTTAGTGCTATGCATTCACTATTGTTTGGTATGCTCCG
TAAGCTTGATATGTCTTCTATTAACCAGCTTATGGAACTTGCTAAAGATGGTTGTATACCTATGGCAATT
ATACCAGCTGCTGCAGCTACAAAACTTACAGTTATTACTCCTGATTTAGAATCTTTTAGTAAAATACGTG
TTGATAACAACATCTATTATGCTGGAGCTGCATGGAGTATTACTGATGTTAAGGATGCTGATGGTAGGGT
TGTTATTTTGAAAGAAGTTAATGTTGATAACAAGGATGCGTTAGTTTGGCCATTACATGTTAACTGTGAA
CGCGTTGTTAAGTTACAGAATAATGAAATTATTCCAGGTAAGCTTAAACAGCGTGCTGTTAAAGCTGAGG
GTGATGGTTTTTCTACTGACGCTAAAGCTCTTTATAATACTGAAGGTGGTCATCATTTTGTTTATGCACT
TATAGCTGATAAGCCTGATCTGAAAGTTGTTAAGTGGGAATTTGATGGTGGTTGTAAGACTATAGAGCTT
GAACCTCCATTAAAATTTGCTGTTGAAGCTCCTACTGGCGTTCAGATTAAGTATCTCTATTATGTTAAAA
ATCTTAATAACTTACGTAGAGGTGCCACATTGGGTTATATAGGTGCTACTGTTAGGTTACAGGCCGGTAA
ACAGACTGAAATGGCGTGTAACTCCTCTTTGCTCACTATTTGTGCTTTTGCTGTGGACCCTGCTAAGGCT
TATGTTAATGCTGTTAAACAGGGTGCTAAGCCTGTTGGTAATTGTATAAAGATGCTTGCTAATGGTTCTG
GTAGTGGACAGGCTATTACTAATGGTGTTGAAGCTAGTATGAACCAAGATTCTTATGGTGGTGCTTCAGT
TTGTATTTACTGTAGAGCGCATGTTGACCACCCAGCTATGGATGGTGCATGTCGCTTTAAGGGTAAGTAT
GTGCAAATACCTATAGGCGTCAATGACCCTATTGGGTTTTGTATAGAGAATGAAGTCTGTAAGGTCTGTG
GCTGCTGGCTTAACAATGGTTGCTCTTGCGATAGGTCTAGTGTTCAGAGTACTGATCAGGCTTATTTAAA
CGGGCAAGGGGCTCTAGTGCAGCTCGACTAGAGCCCTGTAATGGTACTGAACCAGAACATTGTGTTCGTG
CTTTTGACGTTTACAACAAGGACGTGGCATGTATTGGTAAATTTTTGAAGGTTAACTGTGTTAGGCTCAA
AAATTTAGATAAGCATGATGCCTTCTTTGTTATTAAGCGTTGCACTAAGTCTGTCATGGAACACGAGCAG
TCCATGTATAACAAACTTAGTGGTTCTAATGCATTAGCTGTGCATGACTTCTTTACCTGGAAAGATGGTC
GCTCTATTTACGGTAATGTTTGCAGGCAGGATCTTAGTAAGTATACTATGATGGACCTTTGCTATGCACT
ACGTAATTTTGATGAGCGCAATTGCGAGACTCTTAAAGAAATTTTGGTTCTTACGGGCTGTTGTGATCAA
TCTTATTTTGATAATAAGGTCTGGTATGATCCTGTTGAAAATGAAGATCTTCATCGCGTGTATGCACTAT
TGGGACAGCGCGTTGCTAACGCTATGTTGAAGTGCGTTAAATTGTGCGATGAGATGGTTACTAAAGGTGT
TGTTGGCGTTTTAACATTGGACAACCAGGACCTTAATGGTAATTTTTACGATTTTGGTGATTTTGTCGAT
GTTATGCCAGGTATGGGTATTCCCTGTTGTACTTCATATTACTCTTACATGATGCCAATTATGACTATGA
CTAATTGTTTGGCATGTGAGTGTTTTATGAAAAGTGATATTTTTGGCTCAGATTTTAAAACTTATGATTT
GCTTGAGTATGACTTTACTGATCATAAAGTCAAGCTCTTTGATAAGTACTTTAAATACTGGGGACAAGAT
TACCATCCTAATTGTAGTGATTGTTATGATGACATGTGTTTGTTACACTGTTCAAATTTTAACACACTAT
TCTCTACTACTATACCTAACACTGCTTTTGGTCCTCTCTGCAGAAAAGTTTTTGTAGATGGTGTGCCACT
TATTGCTACCGCTGGTTACCATTTTAAGCAGTTAGGTTTAGTTTGGAACAAGGATATTAATACCCATAAT
TCCCGCCTTAGTATGACTGATTTGTTACAGTTTGTTACAGATCCTGGCTTACTTATAGCTTCATCGCCTG
CCTTAGTTGATCAGCGTACAGTTTGTTTTTCTATCGCTGCACTTAGCACTGGTATAACACATCAAACTGT
AAAACCTGGTCATTTCAACAAGGAATTCTATGACTATTTGTTGTCTCAAGGGTTCTTTGATGAAGGTTCT
GAGTTAACACTTAAGCATTTTTTCTTTGCTCAGAAGGGTGATGCTGCTGTAGCTGATTTTGACTATTATA
GGTACAACAAGCCTACTATGTTAGACATATGTATGGCACGTTTTACGTATAAAGTAGTACAGCGTTATTT
TGAGTGTTATGATGGTGGTTGTATCACTGCTAGAGAAGTTGTTGTCACTAATTTGGATAAGAGTGCTGGT
TATCCTCTTAATAGGTTTGGTAAAGCTCGTTTGTTTTACGAGACCTTTAGTTATGAGGAACAAGATGCAC
TTTACGCTATGACAAAACGTAATATCTTACCAACTATGACACAGCTTAATCTTAAGTATTCTATTAGTGG
CAAAGCACGTGCCCGAACTGTGGGAGGTGTTTCACTTTTAGCAACCATGACTACCAGGCAGTTTCATCAG
AAGCATTTGAAGTCAATTGTTAATACTCGTAACGCTCCTGTTGTTATTGGTACAACAAAGTTTTACGGTG
GTTGGGACAATATGCTTAAGAATTTGATGAATGATGTTGACAATGGTGCACTTATGGGCTGGGATTATCC
TAAATGTGACAGAGCTATGCCTAGTATGATCCGCATGCTTGCTGCTATGGTTCTTGGATCAAAGCATGTT
ACATGTTGTACAGACAGTGATAGGTTTTACAGACTTTCTAATGAACTTGCACAAGTTCTTAATGAGGTTG
TACATTCCAATGGAGGTTTCTATGTAAAACCCGGTGGCACTACATCAGGTGATGCTACAACTGCTTATGC
AAACTCTGTCTTTAATATTTTCCAGGCAGTTAGCTCTAATATTAATAGGCTTCTTTCTGTTGATAGTAAT
GTGTGTAACAATTTATATGTTAAAAAGCTTCAGCGCTCTATCTATGACAATTGTTATAGATCTAGTGCTG
TTGATGACAATGTTGTTACAGAATTTTATAACTATCTTAAGAAGCATTTTTCTATGATGATTTTGTCTGA
TGATGGCGTTGTTTGCTACAATAAGGAGTATGCAGCTTTGGGTTATGTTGGTGACATCTCTGCTTTTAAG
GCAACTTTGTACTATCAGAACAATGTGTTTATGAGTACAGCTAAGTGTTGGGTTGAAGAAGATTTATCTG
TTGGACCTCATGAGTTTTGCTCACAACACACTATGCAAATAGTTGATTCTGATGGTGAATATTATTTGCC
TTACCCAGACCCTAGCCGTATTCTTAGTGCTGGTGTCTTTGTAGATGATATTGTGAAAACTGACCCCGTA
ATTTTACTTGAACGTTATGTGTCTCTTGCTATTGATGCATACCCATTATCTAAGCATCCCAATCGTGAAT
ATAGGAAAGTTTTCTATGTTCTTTTAGACTGGGTTAAACACTTACATAATACACTTAACCAGGGTATCCT
TGAAACTTTTTCTGTGACATTATTGGATGATGTTCAGAGTAAGTTCTGGGATGAGGCTTTTTATGCTGGT
ATGTATGAAAAGTCTACTGTGCTTCAAGCAGCTGGTATGTGTATTGTTTGTGGTTCACAAACTGTTCTTA
GATGTGGTGATTGTTTACGTCGTCCCTTATTATGTACAAAATGTGCTTATGATCATGTTGTAGGTACCAC
TCATAGGTTTATTTTATCCATTACGCCCTATGTATGTAATACATCTGGTTGTAATGTTAATGATGTTACC
AAGTTGTTTTTGGGTGGTCTTAACTATTATTGTCATGACCATAAGCCTCAGCTCTCATTTCCACTTTGTG
CTAACGGTAATATTTTTGGCCTCTATAAAAATTCTGCGGTTGGATCCTTAGATGTTGAAGTTTTTAATAA
ACTTGCTATGTCTGACTGGTCTGATGTCAGTGATTATAAATTGGCCAATGATGTCAAAGAATCATTGCGA
CTCTTTGCAGCTGAAACTATTAAAGCTAGGGAGGAGAGTGTTAAGTCTTCTTATGCGTGTGCTACTCTCA
AGGAGATTATAGGTCCTAAAGAACTACTGTTGCAATGGGAAGTTGGGAAGGCTCGACCTCCTCTTAACAG
GAATTCTGTTTTTACTTGTTTTCAGATTAGTAAAGACTCTAAGTGGCAAGTTGGCGAGTTTACATTTGAG
AAGCTCGACTATGGCTCTGACACTGTGTGTTATAAGTCTAATGTTACTGCCAAGCTTGTTCCTGGCATGA
TTTTTGTACTTACATCTCATAATGTCCTTTCGCTTAAAGCACCTACTATTGCCAATCAAGAGCGGTATTC
AACTATTTATAAGTTGTACCCATCTTTGAATGTTGATGATGCGTATTCATCTTTGGTTCCGTATTACCAA
CTTATTGGCAAGCAAAAGATTACTACAATACAAGGACCTCCTGGTAGTGGCAAATCGCATTGTGTTATTG
GTTTAGGGTTGTATTATCCTAGTGCACGTATTGTGTTTGCTGCTTGTTCACACGCTGCCGTTGACTCTTT
ATGTCATAAAGCTGCTAAAGCCTATAGTGTAGACAGATGCTCACGTATTATTCCTGCACGAGCTCGTGTT
GAGTGCTATAGTGGTTTTAAACCGAATAACACTTCAGCCCAGTACATCTTTTCAACTGTTAATGCTTTGC
CAGAGGTTAATGCCGACATTGTTGTCATTGATGAAGTGTCTATGTGCACTAACTATGATTTGTCTATTGT
TAATGCTCGTGTAGCATATAAACATATTGTCTATGTTGGCGATCCCCAGCAGCTACCTGCACCTAGGACT
ATGATAACGCGTGGTGTGTTACAACCTGAAGATTACAACGTTGTCACCCAGCGTATGTGTGGTGTAGGAC
CTGATGTTTTCTTGCATAAGTGTTATCGGTGCCCTGCTGAGGTTGTTAACACTGTATCTGAACTTGTTTA
TGAAAACAAGTTTAAACCAGTTAAAGACCACAGCAAACAGTGTTTTAAGATGTTTGTTAAGGGTAATGTT
CAGATTGATAACGGCTCTAGTGTTAATAAGAAGCAACTTGAGGTCGTTAAAGCCTTTATTGCTAAAAATC
CTAAATGGAGTCGTGCTGTGTTTATTTCTCCATACAATAGTCAAAACTACGTTGCAGGCCGCATGTTGGG
TTTACAGACACAAACTGTAGATTCTGCACAAGGTAGCGAGTATGATTATGTTATTTATACACAGACTTCT
GATACATCTCATGCTCTTAATGTTAACAGGTTTAATGTTGCCATTACACGCACCAAGATTGGTATTTTGT
GTATTATGTGTGACAAGGCACTGTATGACACATTGAAATTCTTTGAGATCAGTCAATCAGACCTTCAATC
TACTATAGGTGGGTGTGGTCTTTTTAAAGACTGTTACAAATTTGATCAAGATTTGCCACCTGCACATGCA
ACAACTTATATGGCCCTTTCTGACAAGTTTAAGACAGATAAAGAACTTGCTGTTAATATTGGCCATTCCG
ATGTTCGTTATGAACACGTTGTTTCCTTTATGGGCTTCCGTTTTGATATGAACATACCTAACTTTCACTC
TCTGTTTTGCACACGTGATTTTGCGATGCGTAATGTCAGGGGCTGGATCGGTATGGATGTAGAGGGAGCG
CATGTTTGTGGTGATAATATCGGTACAAATGTTCCATTACAAGTAGGTTTCTCTAATGGTGTTGACTTTG
TCGTACAACCTGAAGGTTGTGTTGTAACCAATGATGGTAACATTGTCAAACCAGTTAAAGCTAGAGCTCC
ACCGGGTGAACAATTCACACACCTAGTACCTTTGATGCGTAAAGGGCAGCCATGGTATGTTGTACGACGT
AGAATCGTGCAAATGGTCTGTGATTGTTTAAATGGGCTTTCAGACGTAGTAATTTTTGTACTATGGGCTG
GAGGTTTGGAGCTCACCACCATGAAGTATTTTGTTAAAATAGGACCATCTCAGCATTGTGATTGTGGTAA
AGAGGCTCGTTGCTACAATAGTGCGACTCATGCGTACTATTGTTTAGCACACGCACTTGGTTGCGATTAT
TTGTACAACCCCTTTGTTATAGATATACAGCAATGGGGCTATACAGGGTCTCTTAGCAGTAACCATCATG
AAGTTTGTAATGTGCACCGTAATGAGCATGTTGCTTCAGGTGACGCTATTATGACTAGATGTCTTGCAAT
TCATGATTGTTTTGTAAAAAATGTTGACTGGTCTATCACATACCCGTTTATTGCCAATGAGAATGCCATT
AATAAGAGTGGACGGATAGTTCAGTCTCATATTATGAAGGCTGCCTTGAAGGTGTATAATCCTAAAGCTG
TTCATGACATTGGAAATCCTAAAGGCATACGTTGTGCTGTAACTAATGTACCTTGGTACTGTTACGACAA
ACAGCCTATTAATTCTAATGTTAAGATGCTTGAGTATGATTATATGACTCATGGACAATTGGACGGTATG
TGCCTATTTTGGAACTGTAATGTAGATATGTATCCTGAGTTTTCTATTGTCTGCAGGTTTGACACACGCT
GTAGATCACATTTGTCACTGGAAGGCGTTAATGGTGGTGCACTTTATGTAAACAACCATGCCTTCCACAC
ACCTGCATATGACAAGCGTGCCTTTGCTAAGCTTAAGCCCATGCCATTTTTCTTTTATGATGATGGTGAA
TGTGATGTTTCACAGGGACAGATTAATTATGTGCCACTTCGTGCCACTGTGTGTATTACTAAGTGTAATA
TTGGTGGTGCTGTTTGTAAGCGACACGCTAGTCTTTATAGGGCTTATGTTGAGGCTTATAATACTTTTAC
TCAGAATGGTTTTAACATTTGGTGTCCCAACAGTTTTGATGTTTATAATTTATGGCAAACTCTAGTTGAC
ACTAATTTACAGGGCCTTGAGAACATTGCATTCAATGTCGTCAAGAAGGGCTCTTTTGTTGGTGAACCAG
GTGAGTTGCCTGTGGCAGTTGTAAACGATAGAGTGTCTGTTAGGGATGGTGTTAGTGATAATGTTATCTT
TGTTAATAAGACTTCATTACCAACCAATGTTGCATTTGAGCTGTATGCTAAGCGCAAAATTGGTCTTACA
CCGCCACTTACCATTCTGAAAAATATGGGTGTTGTTGCTACACATGGTTTCGTGTTATGGGACTATGATG
CTGACAGACCCTTTTCTAATTTTACTAAATCAGTTTGCAAGTATACAGACTTTGATGAGGATGTGTGTAC
TTGCTTTGATAACAGCATACAAGGTGCATTTGAGAGGTTTACTTTGTGTAAGAACGGTGTGTTAATTTCT
AATGTTGCTATCAAGAAATTACGTGGTATACGTTTGAATTTTGGTTACTTGAATGGCGTTGCAGTTAGTA
ATGTCACTGAAGGTGAGACTACTAAGCCTGTTGATTGGTATATCTATCAACGTAAAGATGGTTCATTTGT
TGAGCCCGTTGATGGTTACTACTCACAGGGTCGTAATGCTAGTACATTTTTACCACGTTCTCAGATGGAA
AAAGACTTTTTAGAACTTGACACCGGTTTGTTTATAAGTAAGTATGGACTTGAAGATTTTAATTTTGAGC
ACATCGTCTATGGCGACGTCTCAAAAACTACTCTCGGTGGTCTACATTTGCTCATATCACAGGTTCGTTT
AGCGCGTATTGGTGTTCTTAAGGTTGAGGACTTTGTTGACTCAGCTGATGATACACTACACAGTTGTTCT
GTTACGTATGCTAATGATCCTAGTAGTAAATCTGTTTGTACCTATATGGATATACTTTTAGATGATTTTG
TCGTGATTCTTAAGAATCTCGATCTTTCTGTGACATCTAAAGTGCATGATGTCATTGTTGATTGTAAGGC
TTGGCGCTGGATGCTTTGGTGTAAAGACTCCAAAGTAGCTACTTTCTACCCGCAGTTGCAGTCTGCTGAG
TGGAAATGTGGTTACAGTATGCCTAGCCTTTACAAAATACAGAATATGTGTATGGATGCATGTAATTTGT
ATAATTATGGTGCTAGTATTAAGTTGCCAGATGGTATTATGTTTAACGTTGTTAAATATACCCAACTGTG
TCAGTTTCTTAATACTACCACTATGTGTGTTCCTCATAATATGCGTGTTTTACACCTTGGTGCTGGCTCT
GATAAGGGTGTAGCACCAGGCACAGCTGTTTTACGTAGATGGCTTCCTGACGATGCAATAATTGTTGATA
ATGATGTTAATGATTATGTCAGTGATGCTGATTTTAGTATAACAGGTGATTGTACGCATGTTTATGTTGA
AGACAAATTTGACCTACTTATATCAGATATGTATGATGGAAAAATTAAGAGCATTGATGGTGACAATGTG
TCTAAAGATGGATTTTTCACTTATATCAATGGATTTATACGTGAAAAACTTGCGCTTGGTGGTGCTATGG
CTGTTAAGATTACAGAGTATAGTTGGAACAAACAACTTTATGAGATCGCACAGAAGTTTGAATACTGGAC
GCTGTTTTGTACTAGTGTCAATACGTCATCTTCTGAGGCATTTCTTATTGGTATTAACTATCTAGGTGAT
TTTTCTAGTACTAATGTTATAGATGGTAATGTTATGCATGCCAACTATATATTTTGGCGCAATTCTACTA
TTATGACAATGTCATATAATTCAGTTCTTGATTTGTCAAAATTTAGGTGTAAGCATAAAGCGACTGTTAT
TATTACACTTAAAGATAAAGACATTACTGATATGGTTTTAGGTCTTATTAAAAATGGTAAGTTGCTAATT
CGCAACTCACAGAAATTATTAAATTTTAGCAACCATCTTGTTACAACTAAATGAAATTGCTTACTGTATT
AACGTTGCTAGCCTGTATTAGGTTAGTTTGTGGTTGTACAGATGTTAATTTTGATTTGTTTAAAACTATA
CTTTCCACTAATCGTGGTAGTATAAATGGTACTGCAGTTATTTCTGGTGCATACCCTTCAACTAATATTA
GTGAATGGTTTTGTTCTGGCACTGTAGGTAGACCTAGTGGTATTGCTAAAGGTATTGGCATTTTTGCACA
GACTGCTAATGTTGATTATGGTAGTGGTGGTGGTGGTTACACTTTTAGTGTCTCACCCTCTCACTCTACT
AACTTGACATGGGAACTTTGGGTCCATCGTGCTTGGGGTGCTAATAAGCCAGTTACCATTAGGTTATGCA
AGTGGTTCCAGGCTCTACCCTTCAACCAAACCAGTCATCAACAAGATGCTGGCCCTACTAATGCTATTGA
GTGTTTAGTTAATGGCAGTTTTCCATCCCATAGTGCATTAAACTATATGTTTGGTGTAACATGGTATGAG
GGACTTGTTAGGGTCATATTTCCGCCTACTGTGTTTGAGATGCAGTTGGATGGATTACAGTGGGAGATTG
TGCGTTTTACTGGTCCCATTAGTGGTGGTAAGATGACACGTTTTAATGTTATAAAAGACATTTCCAGTAT
ACTTGTTTCTACTGATGCTCATGGTGCTGTTGACAATTTTGTTTATTGTGACTCTGGCTTTGTATCTGCA
TTGCAATGCAAGTTGCGTCGGTTTTCTTTACCACCTGGTGTTTATTCTAACACTGAAGTTGAGTATCCTA
GTGCTTTATACACAGTTGTTAGTAATATGACGTCGTGTCCAGAGCGTCCTAGTACATCTTGTACATCTAG
TTACTGTCCTCTTAAACGTGCTGTCTTTTCCAATTGTATTGTTAATTATACTAGTTGGGTTTATGACTCT
AGCGTTAAATCAAACTTTCAACATTTAATTTTGCCTAACGGTTTATTTAACCCTTTTATTGAATGTAATG
GTTTGAATAAGATAGTAACTAATTCGTGTGTGCCAGGTTTTGTATTACGTGTTGGTCGTGGTAAGGCCTT
AAATAAGACCGTTACAGTGCCTTATCTTAAAACATCTGAATGTTTTGGATGGGCTTGGAATGACCCACAG
GATTCAATTTTTGACTGGTGGATAGCAGACTTTGTCTCCAGTGGCGCATATGTTTGCACTTCCAACCCTG
TAGCCCCTAGAACTGGTGTGTGTATGACATATACTGTTGAGAAAACCACGTTTCAGGGTGTTTTATATGA
GAGTAATTTTACATTCTCACAGTATTACAACTTACTTTATGCTGGTTCACAGCTTAAGTATGTTAGAATA
CTTGGAATTGTTTATGAAGTTGCTGCTTGTTTTGAAGCCTCTTATGATGTCCTTTTTGCTTCTAATTCTA
GTTATGGCTTGTTATACCGTAGCTTCGATTGTAATCAAATACACATCAATGCAGAGCGTTTTAGGAGTAG
ATTATTACCTCAACATAATGGTACAGCTACTGCATTAGGTTGTTTGTTTAATGCTACATATGCACCTAAT
GACACCTTTGTTAACTGCTCAAATCCATTAGGTGATGGTTTTTGTGCGGATTTGAAAGGTACAGTTGCCG
TTCGTAGAATGGGTTTTGAGGCTCATGATACAACATATGTAGCTAATGTTATTAGTGAACGCTATATTTC
ATTAGCTATTGACCAACAACTTGTTTTAACTGAGCAATTTTTACAGACTACTATGCCCAAGTTTAGTGTT
AACTGTGAAACATACATTTGTGATGTCAGTAAGGCTTGTAAAAATCTTCTTTTTAGATATGGAGGTTTTT
GCCAAAAGATTGAGGCTGACATTAGGGGTGCAGGTGTTTTACTAGATAGCGATATTAGTGAGTTATACTC
CACTATAGTCGCTAAAAGTAGCTCGCTTGTACCTCAGACTGATAGATTCAATGTCTCACAGTTTTTCTTA
CCTAAGAACACTGCACCATCTCCACCTAGTCCTTACTCATCTAGATCTGCTATTGAAGATATTCTTTTTA
GCAAGATAGAGACAACCGGACCTGGTTTTTATGGTGACTACTACAACTGCAAGAAAAATGCCATACAGGA
CCTTACATGTGCACAGTATCATAATGGTATACTTGTTATACCACCTATTATGGATGCTGAGACTATGGGT
ATGTATGGTGGTATTGCAGCTGGTGCCGTGTCACTTGGCATTTTTGGTGGTCAGGCAGCTATTGCTACAT
GGAATACTGCGATTGCTGGGCGTTTGAATGCGTTAGGTGTTGTGCAAAATGCTCTTGTTGATGACGTTAA
TAAGTTGGCTAATGGTTTTAACCAACTTACGTCGCAGGTGGGCAAATTAGCGCTATCCACATCATCAGCG
TTGCAGGCCATACAAGCTGTTGTTAATCAAAATGCTGCACAAGTTGAATCTCTCGTTAGTGGTATAACTG
AGAATTTTGGTGCAATTAGTACCAATTTTAAGGTCATATCACAGCGTCTTGACAAACTTGAAGCAGACGT
TCAGATGGACAGACTCATTAATGGTCGTATGAATGTTCTTCAACTGTTTGTTACTAATTATAAGCTTAAA
ATCGCTGAACTACGTAACACACATAGGTATGTACAATCACTTATTAATGAGTGTGTGTATGCCCAGAGTT
TGAGGAACGGGTTTTGTGGCCAGGGTCTACATGTCCTATCACTTATGCAAAATGCACCTAGTGGTATTAT
GTTTTTCCATTACTCCTTAATACCCAACAACACTATCACAGTTAAAACCACACCAGGTCTTTGTGAAAGT
GATGAGATTGGTGCAAAATGCATTGTAGCGAAAAATGGAATTTTTGTTTCTGCTAATTTGAGTTATTGGC
AATGGTCGCCACGTAACATTTACAAGCCAGAAAATTTGACTTTTACTAATGTAATTGCAGTTTCGCGTGG
TGCTAATTACACCACCCTCAACAGAACTTTTGACATACCTGAACTTAACCAGAGTTTTCCAATTGATGAA
GAATTTCGTGAGTATTTTCAGAATATGTCAAGTGAGTTGCAGGCATTAAAGAATTTGACTGCTGATATGA
GTAAGCTCAACATTAGTGAGGAGATTAAGCTCATTAATGAGATCGCTCATAATGTCTCTATGATGCATGT
TGAGGTTGAAAAATTTCAGAAATATGTTAACTATGTCAAGTGGGCTTGGTGGCAGTGGTTACTTATTTTC
ATTGCTTTAACTTTACTTGCAGGCTTGATGGTTTGGTGCTGTTTAGCTACTGGTTGTTGTGGTATGTGTG
GTTGTTTAGCTGCCACATGTGCTTCTTGTTGTGATTGTAAAGGAACTAAACTTCAATCTTACGAGATTGA
AAAGATCCACATTCAGTAATGTTTGGTGGGCTGTTTCAGTTGACACTTGAAGGTGTCGTTAATTCTACAA
TCAGAGCTGCTAACTTGAATCCTAATGATGAAGCTATCATTAGGGAGCAAGTCCAACCTGCTATTAATGG
CGCTAACATGCTTGGTTACATGCTTACTAGCATGTTTGTTTGGTACTTTGCTCTTTACAAGCCTTCTACG
AAACGTGGCAGGATTGCTATGTTTGTTTCTAAATTGCTTGTCATCTTTGCTTATGTACCCATTATTATAT
ATTGTGGTGGCATTGTTGATGGCTGCATTATTCTTACAGCAGTAGTTAGTCGGTTACTATATACCAGTTA
CTATGCTTTCTGTTATAGGAGCTTTGCTTTTGTCTTATTCAATGCCACTACATTATGTTATGTCAATGGT
GTGGTTTGTCTTTATACGAGGATTACTAAAGTTGCCGACTATATAGCTTTATATGGTGGTCATCATTATG
TTACTCTCGAGACTACACCAGTTGAATTTGCGCACAAAGATTCTCTCTATGTTGCTGTTAGAGGTAAAAA
AGAACTTAATCTTTACCTCTCTAAGGCTATGGAGTTATCTGACGGCGCATATATTTATTTATTTACCAAT
ACACCTTTTGTTGGTATCTATAACGCTAATTTTCAGCTACAAGAAACTCAACTAAACTATGTTTCTGAAG
ATTGTTGATGATAATGGTTTATTTATCAACACAGTCTTGTGGCTTTTAGTGTTGATACTTGTTCTCTTGG
TCGCTATCACTGTTATTAAGCTCATTCAGCTATGTTTTTCTTGTCATAGACTTATGAGTAATACTGTTTA
TATACCAGTGTATAATGCTTACCTTGTTTACAAGTCTTATATGGAAGTTGAACCATGCCCCATTATTAAT
GTCTAAACTAAACGATGACTGATTCTAATGAAACGGTCCCTGTGACCGAAGTCTTAGAACATCTTAGGAA
TTGGAACTTTAGTTGGAATATTATTCTAACTATTTTTATTGCTGTTCTACAGTATGGCAATATGAAATAC
AGTTTCTTCCTTTATGGTACTAAGATGTTGATCATGTGGCTTCTATGGCCCCTGGTCATAGCTTTGAGCA
TTTTTAATGCTTATGCTGACTTTGGTGTCAACTGGTGGTTCTTCTCCTTCAGCATTCTGATGCTTGTCAT
AACGCTAGTTCTCTGGCTTATGTACATAATAAATAGTTTTAAGCTTTATCGCAGAACGCGTACTTTCTGG
GCTTTTAACCCTGAAACGGACGCTATTGCTGTCATTTCTGTCTTTGGTAGATCCTACTCGATACCTATGC
CAGTGGCACCTACAGGCATTACTCTGACGATTTTAAGTGGAACACTCTTTTTCGATGGCATCAGAATTGC
TACTGGTGTGCAACCTGCACACTTACCGCAATTTGTTACCGTTGCTAAACCTAGCACGACTATTATTTAT
ACTCGTGCGGGACGTTCCCTTAATGCTAGCACCAACACTGGTTGGGCTTTTTATGTCAGAAGTAAGCACG
GTGACTATTCTGCTTTATCAAATAGTAGTGATAATTTGACAGAAAATGACAGATTGCTGCATTTAGTCTA
AACTAAACGAATATGGCCACAGTTAATTGGGGTGACGCCGTTGAGGCTGAATCTCGTGGTCGTAAACCTA
GAATACCCCTTTCACTCTTTGCGCCTTTGCGTGTTACGAGTGATAAAAACTTCTGGAATGTTATGCCTAG
GAATGGAGTTCCAACAGGCAAAGGCAATTCAGAGCAACAGATTGGTTATTGGGTTGAACAGAAACGCTGG
CGCATGCAAAAGGGCCAACGTAAGGATCAGCCTTCTAACTGGCATTTTTACTACCTTGGTACTGGTCCTC
ATGCAGAAGCTCCTTTTAGAAAGCGCATTCAGGGCGTCCATTGGGTTGCTATTGATGGTGCTAAAACTAA
CCCCACAGGTCTTGGTGTGCGGAATCGTAATAGGGAACCTATTACACCGCAGTTTGGCTTTCAGTTACCT
TCAGACCTGATGATTGTTGAATCAACTTCTAGAAGTGCTTCACGTTCTCAGTCTAGATCTCGTAACCAAA
GTCAGAGCCGCAGTGGTCAGCAAACACCTAGATTCCAACAACAGTCTCAATCTGTTGACATTGTTGCTGC
AGTTAAACAGGCTTTAGCTGACTTAGGTATTTCAGGCACCCAGAATAAACCCCAGAGTGGTCGTAATACA
CCAAAACAAAAGAGCAGAGCTGTTTCACCTGCACCGAGCCCTAAACAGACTCGTAAGCAGATGGACAAAC
CTGAGTGGAAGCGTGTTCCAAATTCTGATGAAGATGTTAAGAAATGCTTTGGACCACGTTCTGTCGCTAG
GAATTTTGGTGACAGTGATTTGATCCAGAATGGCGTTGAGGCTAAGCATTTTCCAACAATTGCTGAGCTA
CTTCCAACTCAGGCTGCTATAGCTTTTGGTAGCGAAATTACCACCAAAGAGGCGGGTGATTTTGTTGAGA
TCACATATCATTATGTGATGAAGGTTCCTAAAACTGACAAGAACCTTCCGAGGTTCCTTGAGCAAGTTTC
GGCTTACTCTAAACCAAGTCAGATTAGAAGGTCTCAGTCCCAACAGGATCTAAATGTTGATGCCCTAGTC
TTTACCCCAGCACCTCCTACTACTCCAACTGTGCAGAGCCCTTCTTTCCTAGAGGAAGAAGTGGAAATGG
TTGATGAGATTATCAATTAGTTCAACTAAACATGAACCAGCTTATCCTTTTTCTTTGTATGATGTGCTGT
TATGCTATTCTTTTTGAGTGGCTTTTTAATCTTTTCTTCTATGCATGTCAGGTTAATACCTGGCATGATT
TTGCTTATTCTTGTAATTGGAGTTGGTCTTTATTCTTTGAGGATTTCAGTACTTGGTTTAAATGCTTTTC
TGTTATTCTTATTAGTACTATAGCTGCTGCTAGTCTTATGTTTATGGATTTTGCTATTGAGGTCTTTGAT
CTTTTTGAGCAGTTCTATATCTGTATTAGTGGTTTCTGTAGATTTGTTTGACATACAATCCCTAGCCTTG
CTTGTGGATTCAGTCTCATACACAATGGTAAGCACGTAATTATGCTAGTATGAGTAGAGTATAATTATAT
TGAGTCCTATAGACCAAAGCAGTCAACTACATGTCTGGTGTGGCGGAGTAACCAAAGATCCGCTTGACGA
GCCTATATGGAAGAGCCGTCACACCTCGTATGTATGTTGCTGTTAGTAGTTGTTAGTTAGTTGATTCTTT
GACAGTGATACACAAAAAAAAAAAA

>gi|971745446|ref|NC_028811.1| BtMr-AlphaCoV/SAX2011, complete genome
GACTTAAAAGTATATTCTATCTACGGATAGTTCATACTCTTTCTAGACCTTGCGTCTACTCAACTCAACT
AAACGAAATTTTCATCTTTTGGCGTTTGGGTTTTCCTAAATGCCAAAGGGTGCTTGCCAATATTTCGGTT
AGGCTGCCCCATTTTGCTTAAAAGTAGTGTGCCTCGTACACTCCCTGCCGTAGTGTTCCGTCACTACAGA
TCACAGTGTGCCTGGACCCTCTACTGTTCCGTCAGTGGAGGTGTGTGGATACAGTGTTCCGTCGCTGTTG
AAACCACTAACATAAGCAATGGCTTGCAGTCAGTACACACTTGCAGTGGCAAGTGATGTGGAAATAAATG
GTTATGGCTACCAGTCTATTGGAGATGCCGTCACAGCTTATAGCGTGGCCGCAGCTGATGGGTTTTCTGG
TTGTCGTTTTGTTCCATTTGGTCTTCAGGATTGTGTTGTTGGTGTGAACGATGACGATTATGTTATGGTT
CTCACTGGTGATCACACTCTTTATGCCTTTTTGGACCTGTTTTCAGCTACTCCTAGTAACATCCGTGGTT
GGCTGATTTTCTCTAACTGTAACTACGTGCTTGAGTCATTCGACGTTGTTCTCGGTCGTAGAGGTGGTGC
TCCGCCAATCTACGTCGATAACTACCTTTGTGGCGCTGATGGCACACCAGTAGTACAGGAGAGTATGTGG
TCTTACACTGATCACTTCGGTGAGGATTGTGATGAGATCACTCTTTGTGGCATTACTTATGTTCATGCTT
GGAACGTTCAGCGTGCTGATGTTCCATATGAGCAGCAGAATGTCACTTCTATCTTTTCAATCGAGTATCT
GCTCGATGTTGATCATGCACTTCAGAATGGCGCCGTTTTAAACGTCGCTTCTGGTGTTAAATACAAGAAG
AGTGTAGTGCTTTCCGAGGGCTTTAAAAAGCTCTACGATGCATGTGGTGTTCCAGCAGTTCAGAATGGTA
ATACTCTTGTTGACATTCTGACTAAACCAGCATTTTTCCATGCCATTGTGTCTTGCAGCTGTGGTCTCAG
CTCTTACACTGTCGGTGACTGGAAAATTGGTTTTCGCTCTCTGTGCTGTGGTAAGCGACTTGAACCCATA
ACTGTAGTTGTTGGAGATGTCAAGCCAGGTGACATCGTTGTCACTAGCGCTAATGCTGGTGATGGTGTGC
GTTATTTTAATGGTCTGACTTTGCAATATGTTGGTGACTGGGAAGGTGTTAGCTGCTGGCGTGCTGTTGG
TGTTCAAGCCTTTAATGGTTTTGTGGCATCACCTACGTTTGATGAACAGCTTCACACCTATAGTCTTGAT
GCATGTGCTTACACATCCAATACCCGGCTTTTTAAAGCTCTTAAACTGTCTGTCCTCAGTGGTTTTACCA
ATGACGATGTGACTAATGCTGTCATTGCTGGTGTTGTTGATGTCAACAGCTGTGTTTATAATTTTGTGGA
TGCTGTGCTTGAACAGAAGCCTTGGTTTGTTAGAAAACTGGGAAAACTCTGTGAGACTGCATGGTCTTTG
CTGTGCGATGCTCTTAAGGAGAGTTCTCTTTTGTCATCAGACCTTGTGGCTTTTGTTAAGAGTTTGACAA
CAGCAGTTCTTACAGTTGTTGATGGTAAGCTTAAACTTATTGCAGACATTCCATCAGTTTTTGAGAGCGT
TTTTGACGTTTTCAAGTCTGCTTTGGAAGGAATCTTTGATGCCTGTGCTAACACTGTCACTATTGCAGGT
AAGGCTGTTAGGGCTGCTTTTGATTACTTGCTGTTTGACAATGCCATTGTTAAGCTGCAGAGTGTAAAGG
TGAGTGGTCTTAAACAAGCTGGTGTTAAGAACGCATTATATGCAAGTGTAGTGATTGGTCCTACACAAAA
TGTCAAGACGACACGTGTTGAGGTTGTTAATGTAAAACTTACGCCTATTACTGACAAAGTGCCATTTAAC
CGTGAAGGTTATGTTGCACTTGTTGATGGTGTGGCGTTCTTCGTTAATGACGGTTACTATAGGCTTATGG
CTGACAGTGATTGTGTCTTAGAAGAACCTGTTTTTAAAGCTGCCTCTGGTGAAACTCTTGCTGGTGCTGT
TGAGTGTCCTTCATTGTTTGTGCAGGTTGATGGCGGTGCAATTTGGCGTAAAGTTGTGTCCGTCTTCGAT
GGTGTTACAGACTTTCTGAAGAACCTCAAGATTCAGTTTGGACTTAATGGTTTTGTTGGCACATGTGCAA
AACGCTACAGGAAAATTTTAAACACTCTTCTGACAATGTACAATGACTTTGCTGCTAGTGTTAGGCAAGT
TGTAGTGTTAGCTGGTGTTAAGCTGTCTTACTATGCCTTTGAAACACCGGCAGTTGCATTGAATGGTGTT
TTGCATGCTGTTAAGCGTTGCAGTGCAAAATCTTTAGATGTTCCATGTGAAGAGGGTGCAGCTGAGTTTA
ATGTTTTTGAGGGTGGTGTCCATCTTCTAAAGCCCACAGCGGTTGAACTTGCTAGTGATATGGAACTTCT
AGAAACAGACTATGTGGAACCTTGTGCTGGTGGTGTCTTGCGTATTTGCGATGACTATGCATGGTACATG
GATGGTGACAGATTTTATCCGTATGGTGACAATGGTGTCATACCACTTTGTTATAAGCTTGGTGGTGGTG
ACAGAGTAACCTTTGGTGAGGATGAAATCAAAGAAATTCCAGCACGCAATAACGTCAAACTTATTTTTGA
GTTTGAGAATGATGTTATTGCTGAGGCCTGCAAACAAGCTATTGGTAAGCGCATTAGCTTTGAGGGCGAC
TGGAGTGATCTGTGTGAAATGATAGACATTGCTATGAAAGCACTCTCTGATCATATTGAGGTACCAGAGT
ACTATATTTATGATGAAGAGGGTGGTAATGATTTGGACCTGCCAGTTATGATTTCACAATGGCCCTGCAA
CGCAGAAGATGCAGTCGCCAGTGTTTGTGAAGCTGTGGATGTCTGTTTTGGTGATGATTGTACTATGGAT
ATGCAATTTTGTGAGACTACAGATATTAGTATTACAACATGTAATGCTGTTGATACTGGTGTTGCAGTTC
ACAAGGCGCTTTCTCGTACAGTTGTTGTTCAGACAGCTAGTGATCCACAGAAGGAAGTTGAAGAAGCACT
GGCATATATGAAACCTGAGGTTGTTAAGCCAGTTGTTGAAAAGTCTATGTTTGACTACCCATCTACAGTC
TTTAATGGAATTCGTGTGCTAAAACAGGTTGCTAATAACTGTTGGTTGACATGTGCTACATATCAATTAC
AACTTGCTGATTGCTATGAAGCAGACGACTACTCGCTTTTTAAAGTGGGTAGTGTTAAGCACTTTGTCAA
ACGTTGTTATGAATCTGTGGGAGCTGTTAAGGGCAGTTTGGGTGATACAACACAGCTTTTGGAACGTTTG
TGTAAGGATGTCAAAACACTTAAGGTGACATGTAATGTTGCATGTGATTGTGGCACCTCTGTTAAAGTTC
TTGAAGGTTGTGTGTTTCATTTTATGCCTGTGGCTGACGCATTTCCCTATGGTGTTTGTAGCAACTGTAA
GCAAGTTGCTATGCACACTATAATGGGCATCAATGGTACTGGTTTCTTTTGTCAAGAACCAGCACATTTT
GATGTTAAGAAGGCGTTGTGTTCTATTGCAGCCACTGCTACATATGTAGGCAAACAGAATGGCGGCCATT
ATAGAACCAATGACTTTGTTCATGGTAAGGCTGTTGATGGTTCTGGTATAACACCTTTGAATTATAAAGC
ACCTGTTACCAACTGTCTTGTAGTTAATGCTAATTATGTAGCCCCCACACCGCCAGTTAAAGTGGAACTC
AACCCCTTTAGAGTGCATGGCAGTGTATCATTTTACAGAGCAGAGTTTTCTGAACTCGTTAATCTGGATT
ATGATTTTGTTGTCAATGCGGCAAATGAGAACTTGAGTCATGGTGGTGGTGTTGCAAAAGCAATTGATGA
TTACACAAAAGGACAGTTGCAACTTTTGTCTAAGGCATATGTCAAAAGTCATGGTCGTGTTCGTACAGGC
AATGGTGCTATGATCAAGTGTGACTCTTTTGATGTGCTTAATGTGGTTGGTCCTAAAAAGGGTGGTAAGA
GCTGGCAAAAGCTACTTCGCTTTGCTTATGAGACTATTTATAAGCAAGGTGGCACACCTTTGACACCATT
ATTGAGTTGTGGCATTTTCGGTGTTCCTTTAGAGGAGTCGCTAAAGATGTTGCTAGATACTTGTAATGAT
GTTAGGACTTGCTGTTTTGTTTACACTCCTGATGAAGAAGCCAAGGTTGTGGCTTATTTAGATAGTTTAA
AGGTTCAAGATGAAGTGCCTGCTAAAATTGAAGTGCAGCCATATAGAGTTGAAGGTAAATTCAATTTTTA
TGACTGTTCTGTTGCAGACATTCTTGCCACTGATGTTAGTTCAGTTGTTGTATTTACCGATGGTAAGTTG
TCTTTGACAGACGTCGGTGTTGAAATAGATGAACATCTGAGTGGTAAACTTTTAACATCTATTAAGGAGT
GTTTGGCCGAAAATATAGCTATACCTTCTGGTAATGCTATGAAGTTTGATTGCAACCCGACCATATATAT
GGCTGTGGTTCCTGCAATTAACACACCTGGTTTTGAGAAGAACGTTACGAGGACCTTACGCAAAGTTTCG
AAGTTGGAGGGTAGGGTCATTTGTACAACACCTATTAAACAGGTCTTGCAAATGGCATTAAAAACCTTTC
CTTCAAATTACGCATTTTTGGTTCATGATAGTGCTAAAAGCACTGTTGATGATTGTTTTTCTCTAGCGCA
GTATAAGGTTCAAACCACAGAGGATGGTGTTAATGTTAACACTGTCATTGTTTCAAATGCTAAGACTTAT
GGTGAGCAGTTGGGTTCAGTTACTGTAGCAGACAGTGACATCTCAGCTACGAAGCCCGCAGTCTTAGATG
AAACTAAGATGTTGGTTGTTGCACCTGCTGTTGATTGGGTTTCACATTATGGTTTTTCTGATGCTGCTGC
TTTTGCTACTTTTGACCATACACCTTTTGCTTTCGATAGCGATATGGTGATGGGCAAGAGAGCATTGGCA
CAGACAGATAACAATTGTTGGATCAATGCTGCTTGTCTAGCACTACAGCAATTGAAACCCAAGTTTAAAT
TTCCAGGTTTGGAGGCCGCATGGAATAAGTATGTTACAGGTGATTGTGGTGAGTTTGTTCACTTTCTTTA
CCATATTACGCGTTCGCGTAAGGGTGATTTAGGTGATACTGAAAACTTGCTTAATTTGTTGGATAAATAT
ATAGTCGCTAGTGGAACTGTTGTTCTAGAGCGACATGTAGACTGTCCCACATGCAATAGCACGGAACGCA
CCATAAATGCGAGTGTCGTTTCTGCTAGTTTGAGTAGAGACGGTTCTGATGATGGCGTTTGTTGTGCACA
TGGTGTAGACTATGTGTTGCGTGTTAAGCATGTTAAAGGTGATGTCATTATTACTACTTGTGAGCAGCCA
AAATGCTACAAAAGTTCTGAAATCCTTATGGGTGAGGCTTATGTTGCATTTACAGGGCCCATTAGTGGTG
GACATTATCTTGTATACGACAGAGCTACTGGTCAAGTTTTTGATGGTAATAAGTGTTTGCCATATGACTT
TGACACGTTGACAATTTCAGCAGTAGTTGTAAAAGGGGGCTACGTTTGTTCTATGCCTAAAAAGATCAAG
CTTGATCGTGTTATGACAGACTTGGACAACGGTGCTAAGAAGTTCTTTGATTTTGGCGATTTTATATTGC
GTAATCTCGCCAGTTTCTTTTCGATTTTCTTTAGCTTGTTGTTTGTCGGTTATAAGGCCTTGAAAAAGCG
CGATGTTAAAGTATTGGCACAAGCACCGCAACGTACAGGTATTATACTGACTCGTAGTCTAAAGTATAAT
TGTAAAGCTGCATTTAAGTTTTGGCAGACTCGCAGCTGGTGCATTATAATGTTGTTTAAAATTCTACTGC
TGCTTTTTGCGTTATTTGCGGCATGTTTCATGTTGATACGCTTTAGTTTCCTTAACAAGTATTTCTGTGA
TGGTTATGTTGCTGGTTATGCTAATTCCACTTTTGTTAAGAAAGATTTCTGTAACGGCGGTCTTGTTTGT
GACGCTTGTCTTCACGGATTTGATCAACTGTCAGATTTCAGTCATCTTAATGTTAAATGGGATTACATAA
CTGTGCCATTTGCGCTTAAGGTTTACCCTTCGGTTGTAGCATTTTTGTTGTTTTTGTTTGGCGGTGTCTA
TGTTAAATTCATGATGCTTTATGTCTTGGCACAATATGTCAACACATTTGGCGTTTATTTTGGATTTCAA
GACTATTTTTGGGTTGTTCACATTATCCCTTTTGATGTGTTCTGTGATGAAATCCTGGCAATCTTTTGTG
CCGTAAAGGGTCTTCTGTTTTTGAAACATGTCATAATGGGTTGTGACAGTCCAAGTTGCATCGCCTGTTC
CAAGAGTGCTCGTCTTAGGCGTGTTCCCATGACAACTGTTGTTAATGGTGCTAACAAGTCATTTTATGTT
ACAGCTAATGGTGGTACTAAGTTCTGCACTAAGCATAACTTCTTTTGTGTTGATTGTGGGTCATATGGTA
ATAACTCTACTTTTATCAATGATCACGTTGCTAGAGAGCTTAGTAATGTAGTTAAGACGTCAGTGCGTCC
TACAGGTCCAGCTTATATTGAAATAGACCGTGTTGATTTTTCAAACGGGTTTTATAGGTTGTACAGTGGT
GACACATTTTGGCGCTATAACTATGACATTACTGAGAGTAAATTTAGCTGTAAGGAAGTGCTTAAAAACT
GTAACACCGTTGACGATTTTATTGTCTACAATAATACTGGTACTAATGTTACACAGGTTCGTAATGCTTG
TGTATACCTTAGTCAACTTATGTGTAGACCTATTAAACTCGTTGACGCACAATTGCTATCTTCTCTAAAT
GTTGATTTTAATGGCGCTTTGCACAAGGCTTTTGTGGAGGTATTGCAAAATAGCTTTAGTGTTGATCTTG
CTGACTGTAATACTATGTCAGAATGCAAGGAGCGCATAGGTTTGGATGTTAGTGATGATGAGTTTTTGGC
AGCCGTTACCAACGCACACCGTTATGATGTGCTGTTGAGTGAGGTTTCCTTTAATAATTTTATCACTAGT
TATGCTAAGCCTGAAGAAAAATTGTCAGCATTTGACTGCGCCCAGTGTGTGCGTGCAGGTGCTAAGATAG
TTAATCATAATGTTATAGTCAAAGAAAAGCTTTCTATTGTGTGGCTTGCTAAAGATTTTCAGGCGTTGTC
AGCAGAGGGTCGTAAGTACATTGTTAAAACGTCCAAGGTAAAAGGGCTTAACTTTATACTTACACTTAAT
GATAATGCCGCACAGTGTAGTGTCCCTGTTGTTAGTATGATGAGCAAGAAGGGTGCTGGTCCCAAGAAAT
CTTTGTGGTTCCTTTGGGGTCTTTGCGCTTTCATTCTGGCATTATACTATGCTACTAGCTATATTACATT
TGGTACTATGGTTGGTAGTTTTCCAGGATATGATTTTAAGTACATAGAGCATGGCCAGCTCCAAGAGTTT
AGTCATGGTCTTACATGTGTGCACAATGTCTTTGACAATTTTATGGAATGGCATTTCCAAAAGTTTGGTA
ACACTCCTTCAACTGGTAAGGCTTGTCCAGTAATTGTAGGTGTTGGTGATAACGGTCGTACACTGCCTGG
TGTTCCAGCAGATGTTCACCTTGTAGGCCAAACTTTAGTTTTTACTGTTAAATCCGTCTTTGGCAACACA
AACCTTTGCTATGACACTAGCGGTGTTGTAAGTGCGGCTAGCTGCATTTTTATTTCTGCTTGTACAGTGT
TAGAGGGTCTTGGTGGTATTTCTACTTATTGCTACAAAGACGGTATTGTAGAGGGTGCTAAATTGTACAG
TGATTTGCAACCTAATGCACATTACAAATTTGACAATGACAATTTTGTGAAATTGCCAGAGGTTCTCGCT
AGGGGCTTTGGCATGCGAACTGTACGTACGCTAGACACCACTTACTGCCGTGTTGGTGAGTGCACAGAAT
CTAAGGCTGGCATTTGTATAGGAGCTGATAGGTGGCTTGTGTACAATGCAGAATCTGGCTCTGATTTTGT
TTGTGGTGCTAGTTTGTTACAGCTTCTGTACAATGTCTTTAGAGTCTTTAATACAGACTTTAGTACAGCA
GCGTTGTCAGGTCAAATGATGTTTAATGTTATTGTTGCAGGTCTTGCAATTATGGCATGTTTTATTATCA
CCAAATTCAAACGTGTCTTTGGTGATATGTCTTTTGGTGTTTTCACCGTTATTATTACAGCTTTGGTCTG
TAATTTGTCTTATTTTGTTACACAGAATTATTTGGGTTTGTACACATTTTCTTTGCTTTATTATCTTACC
ACTCGTAGTTTCCGTTATGAGTGGATTTGGCATATTGGCTATGTTGTGTCTTATTACTTTTTGGCACCTT
GGTGGCTTATGCTCATGTATGTGGGAGCCTTGGTTCTTGAACTTGTTCCCAATTTGCTAAAACTTAAAGT
TTCAACTCAATTGTTTGAGGATGGTAACTTTATTGGCAACTTTGAGAGTGCTGCCGCTGGTACGTTTGTG
CTCGATATGCGTACATACGAGAAACTTGTTAATAGCATTCCAGCAGAAAGACTTCGTCAGTATGCTGCTA
GCTATATGAAATACAAGTATTACAGCGGTTCACCAGGTGAAGTTGATTACAGACTTGCGTGTTATGCACA
CTTAGCCCATGCTATGATGTCATTTGGCAAAGATCAAAGAGATGTACTTTATACCCCACCCACAGTTAGT
TTTAACTCTACTCTACAATCAGGTCTCAAGAAGATGGCACAACCGTCAGGTATTGTTGAACCTTGTGTAG
TCAGAGTTTCTTACAATAGTACCGTCCTGAACGGTTTGTGGTTAGGAGACACTGTGTACTGTCCTCGTCA
TATAATAGCGTCTAACACAAATGCTGTTATTGACTATGACCATGCTTACACTGTTATGCGTTTGCATAAC
TTTAGCATTTCAGCTGGTAACATCTATTTGGGTGTTGTTAGTGCTACAATGCATGGTGCTAATTTACATA
TTAAGGTTAACCAGAGTAATGTGCATACACCAGTACATAGTTTTAGAACTGTGAAACCTGGTGAGATGTT
TAATATTCTGGCCTGTTATGATGGCACTCCAGCTGGTGTTTACAGTGTAAACCTCAGAACTAATCATACA
ATTAAAGGCTCTTTCATTAATGGTGCTTGTGGCTCACCTGGCTACAATATCGTTAATGGAACAGTTGAGT
TTGTTTATATGCACCAAATAGAGTTAGGTAGTGGTTGCCATGTGGGCTCATCTTTCGATGGCAAGATCTA
TGGTAACTACGAAGACCAACCTACACTTCAAATTGAAGGGTCTGCGAATTTAGTAACAGACAATGTGGTT
GCTTTTCTTTATGGTGCTTTACTCAATGGTATTACTTGGTGGTTAAGTCCATCACGTATTACCGTGGAAG
CTTTTAATGAATGGGCATCTGTTTCAGGTTATACACCATTACAGAGTGCTGATGGTTACTCAATTCTTGC
TGCTAAGACTGGTGTTGAGGTAGAGCGCATTTTAAGTTCTATTCAAAAACACGCTAATGGTTTTGGTGGT
CGTAATGTTTTGGGTTATTCTGCACTTACGGACGACTTCACTTTGAGTGAGGTTGTTAAACAAATGTTTG
GTGTTAACTTGCAGAGCAGTAAGAAGGTTTCATGCTGCAAGTCATTGTTGCTTGTAGGTGGATTCTTTGC
TATGTTCTGGGGTGAATTTTTGATGTATTCTTCTGTTATGTGGGTGCATCCAGCAGTAGTGACGCCTATA
CTGCTTTGTTTAGGTCTTGTATCTTTGATGCTGTCTGGTCTGATTAAGCACAAAATGATGTTTTTGCAAA
CATTTTTGTTGCCTTCTATTGTTGTGATTGCTGCAAATAATTTCTTTTGGGATTATTTTGTTACGCAGTT
ACTTGTCCAATATTTTGATTACACAGCATCTTTATTTAGTTTGGACATTCAGGGCCTTCTTAATATTGCC
ATGTGTCTTTTTGTTATGTTCTTACACACGTATAGGTTTGTGAGTACTGGTAATAATGCTATTGCTTACT
TATCTTCTCTTGTTGTAAGCGCTTACACTTACTTACTTGGTGGTGACCCTATGTATTGTGCTATTATGGT
TCTGTGTTCGCTTTCTAGCGAGTGGTACGTTGGCGCTGTTTGTTATAAACTAGCCATTCGTATTGCACCT
TACACTAGTCCTATAATTGCAACAGTTTTTGGCACACCAAAAGTTATAGTGTTTGTGTATTTGGCACTTG
GCTACTTTACTTGTGTGTACTGGGGCTTCTTGTATTGGTTTAACAGGTTCTTTAAATTTACTCTTGGTGA
GTATGATTTTAAAGTGAGTCCTGCTGAATTTAAATACATGGTTGCTAATAATCTTAGTGCACCGCGTGGC
CCATTCGACTCATTGGCTCTCTCTCTGCGGTTAGTGGGTGTTGGTGGTCAGCGTACTATTAGAATTTCTA
CCGTGCAGTCTAAATTGACAGATCTTAAATGTGCTAATGTTGTGCTTCTTGGTTGTTTGTCTAGTATGAA
TATTGCTAGCAATTCCAAAGATTGGGAGTATTGTGTAACATTACATAATAAAATCAATCTTTGTGATGAC
CCTGAGAAGGCACATGAAATGCTGTTAGCATTGTTGGCATTCTTTTTAAGCAAACAACAGGCATTTGGCA
TTGATGGACTTGTTGATTCATACTTTGACAGTAATAGTATGCTGCAGAGTGTGGCTAATACATACGTCAA
CTTGCCATCATTTGTTGCCTACGAGAGTGCACGTCAGAATTATGAGGAGGCTGTTAATAATGGCTCTTCT
CCTCAGATTATCAAACAAATGCGTCGTGCTATGCATCTTGCAAAGGCAGAGTATGACCGCGAAGTGTCTG
TTCAACGCAAAATTGAACGCATGGCGGAAAATGCTGCAGCGCAGATGTACAAGGAGGCACGCGCTGAAAA
TCGCAAGTCTAAGATCATCAGCTCAATGCATGCGTTGCTGTTTGGTATGTTGCGCAAGCTGGACATGTCT
AGTGTTGACACCATACTAAATTTGGCTAAGAATGGAGTTGTACCACTTTCTATTATCCCTGCCACTTCTG
CTACTAGATTGTGTGTTGTGTGTCCAGACCACGAGGCATATGCAAAGATTATTTTTGGTCAGTGTTTGCA
TTATGCTGGTGTTGTTTGGAACATAGTTGAAGTCAAAGATAATGATGGTAAGACTGTCCATCAGAAGGAA
ATTGTCAAAGCTAATGAGGAAACTCTTAGTTGGCCACTCTCTATTAATTGTGAACGTGTCGTAAAACTGC
AGAATAATGAAATCATTCCCAGTGGTAAGCTTAAACAGCAAGCTGTTAAGGCTGATGGTGATGGTTTTAG
TTCTGAAGGTATTGCACTTTACAATAATGAGGGTGGTAAGACATTTATGTATGCATTTTTGGCTGACAAA
CCAGATTTAAAGGTCGTTCGTTGGGAATTCGACGGTGGCTGTAATGTTATTGAACTTGAAGAGCCTCGTA
GGTTTGCCGTTGAGACTGGTAGTGGTACACAAATTAAGTACTTGTACTTCGTTAAAAACCTTAACACGTT
AAGGCGAGGTGCTGTTCTTGGTTTTATTGGTGCCACTGTCAGACTTCAAGCTGGCAAACAAACAGAGCAG
GCTGCTAATAGTTCTCTTTTGACTATGTGTGCTTTTGCCGTCGACCCTGCAAAGTGTTACTTGGATGCTG
TTAAGGGCGGTGTTAAACCTGTCGGTAATTGTATTAAGATGCTATCCAATGGTTCTGGTAATGGCCAGGC
TATAACCAATGGTGTGGAATCTAATACAAGTCAGGATACTTATGGTGGTGCTTCTGTATGTCTCTATTGT
AGAGCTCATGTTGACCATCCTAGTATGGACGGGTTTTGTCGTCTGAAAGGTAAATATGTCCAAGTACCAT
TAGGCACTTTAGATCCTATTAGATATTGCCTTGAGAACACTGTTTGTAAAGTCTGTGCTTGCTGGTTGAA
TAATGGTTGTCAATGCGAGCGTACTAGTATGCAGAGCTTTGACAATGGTTATTTAAACGAGTGCGGGGCT
CTAGTGATGCTCGACTAGAGCCCCTAAATGGCACTGACATCGATAGATGTGTTCGTGCTTTTGATGTTTA
CAACAAAGACGTTGCATGTATTGGCAAATTTCTTAAGGTGAACTGTGTTCGCTTTAGGAATGCTGATAAG
CATGATGCATTCTTTGTTGTAAAGCGTTGTACTAAGTCCGTCATGGAACATGAGCAGTCCATATATGACG
AACTTAAGCATTGTAATGCACTGGCACCTCATGACTTTTTCACATGGAAAGAAGGACGTGCTGTGTATGG
CAATATTAGTAGGCAAAATCTTACAAAGTATACTATGATGGATCTGTGTTATGCCCTACGTAACTTTGAT
GAACGTAACTGTGATACCTTAAAGGAAATACTCGTTCTCACAGGTTGTTGTTCTGAGGCTTATTTTGATA
ATAAGTGTTGGTATGACCCTGTTGAAAATGAGCACATACATAAGGTCTATGCACAGTTAGGTGTCATTGT
GGCAAACGCTATGCTCAAATGTGTTCGCCTATGTGATGCCATGGTTGAAAAGGGTATCGTGGGCATTTTG
ACACTTGATAACCAAGATTTGAATGGTGATTTTTATGATTTTGGCGACTTTTGTAAAACAGCACCAGGAA
TGGGTGTACCCTGTTGTACGTCATATTATTCATATATGATGCCTGTCATGGGTGTGACAAATTGTCTGGC
CTCAGAGTGTTTCATGAAGAGTTCTATCTTCGGTGAAGATTTTAAAACTTATGATCTGTTAGAGTATGAC
TTTACAGAGCATAAGGAAAGACTTTTCAAGAAATATTTCAAGTATTGGGACCAGGACTATCACCCTAACT
GCTGTGACTGTTATGATGATATGTGTGTTGTCCATTGTGCTAATTTTAACACTTTATTTGCTACTACTAT
ACCAGGTACTGCTTTTGGTCCATTGTGTCGCAAGGTTTACATTGATGGTGTACCCCTTGTGGCAACAGCT
GGCTACCATTTTAAGCAACTTGGTATAGTTTGGAACAAGGACGTTAACACACATTCTTCTAGGTTGAATA
TTAACGACCTACTGATGTTTGTTACAGATCCATCACTTATAGTCGCTTCATCTCCAGCATTGGTTGATCA
GAGAACTGTTTGTTTCTCTGTTGCTGCTTTAAGTACTGGTATGACACAACAAGTTGTGAAACCAGGTCAT
TTTAATAAGGACTTTTATGACTTTCTCTTAAAGCAGGGTTTCTTTAGTGAGGGCTCGGAGTTGACACTTA
AGCATTTCTTCTTTGCTCAGAAGGATGATGCAGCTGTCAAAGACTTCGATTTTTATCGTTATAACAGACC
AACTATGCTGGATATATGCCAAGCACGTGTCACATACAAAATTGTCTCACGCTATTTTGATTGCTATGAG
GGTGGCTGCATTACTGCTAAAGAAGTGGTAGTTACCAATCTTAATAAGAGCGCTGGGTGGCCTCTTAACA
AGTTTGGTAAAGCAGGTTTGTACTACGACTCTTTGTCATATGAAGAACAAGACCAACTCTATGCTGTCAC
CAAGCGCAATATCCTGCCCACTATGACACAGCTTAATCTTAAGTATGCCATTAGTGGTAAGGAACGCGCA
CGTACAGTAGGAGGTGTGTCACTATTATCTACTATGACTACAAGACAGTACCACCAAAAGCACTTGAAAT
CCATTGTTAACACACGCAATGCTGCTGTTGTTATTGGTACTACAAAGTTTTATGGCGGTTGGGACAATAT
GTTGAACAACCTTATATCTGGTGTTGAAAATCCACACCTTATGGGTTGGGACTATCCTAAGTGTGACCGT
GCTCTACCAAATATGATTAGAATGATTTCTGCAATGATTCTGGGTTCTAAGCACACCACATGCTGTAGCT
CTACAGATCGTTATTACAGATTATGCAATGAGTTGGCTCAAGTGCTCACAGAGGTTGTTTACTCCAATGG
TGGTTTCTATATGAAGCCTGGTGGTACAACTTCTGGTGATGCTACTACAGCCTATGCAAATTCTGTTTTT
AACATCTTTCAGGCTACTAGCGCAAACATTAACAGACTTCTTAGTGTTGACAGTAATAACTGTAACAATC
TTGGTGTGAAGGCCCTGCAGCGTCGTTTGTACGACTGTTGTTATAGGTCTTCTCATGTCGATGATGATTT
TGTTACGGAGTATTACAATTATCTTAGAAAGCACTTTTCTTTGATGATATTGTCAGACGATGGTGTTGTC
TGTTATAATAGTGAGTATGCTGCACTTGGCTATGTTGCCGATATTAGTGCCTTTAAAGCCACTTTGTATT
ACCAGAACAATGTCTTCATGAGTACGTCCAAATGCTGGGTTGAACCAGACATTAATAAGGGACCTCATGA
GTTTTGTTCACAGCATACAATGCAAATAGTGGATGAGAATGGTAAGTATTATCTACCATACCCAGATCCA
TCTAGGATTTTGTCCGCTGGTGTTTTTGTCGATGATATTGTCAAGACAGACCCCGTCATTTTGATGGAGC
GTTATGTGTCATTGGCTATTGATGCATACCCCTTGTCCAAGCATGAGAATCCAGAATACCGTAAGGTTTT
CTACGCTCTCTTAGATTGGGTAAAGCATCTTAATAAGACGTTACACGCAGGCATCCTGGATGCATTTTCC
ATAACGATGTTGGAAGACTCTGCTGCCAAATTTTGGGATGAGTCTTTTTATGCCGGTTTATATGAGAAGT
CAACAATTTTACAGGCTGCAGGTTTGTGTGTTGTTTGTGGCTCTCAAACTGTGCTTCGTTGTGGTGATTG
CATACGTCGTCCTATGTTGTGTACTAAGTGTGCATATGATCATGTTGTTGGCACTACACATAAGTTCATC
TTGTCTGTGACACCTTATGTCTGTAACAACTCCGGTTGTACGGTCAATGATGTTACAAAGTTATGGCTTG
GTGGACTTAGTTACTGGTGTACTGAACACAGACCACAACTTGCATTCCCCCTCTGTTCGGGTGGTAATGT
TTTTGGTTTGTATAAAAGCGCTGCAACTGGTTCGCCAGATGTAGAGGTTTTTAATCAGTTAGCCATGTCT
GATTGGACTGATGTTAAGGATTACAAGCTTGCAAATTCTGCAAAGGACAGCCTTAGGTTGTTTGCTGCTG
AAACTGTAAAAGCTCGTGAGGAGAGTGTAAAATCCCAGTATGCTAGTGCAACTCTTAAGGAGATTATTGG
TCCTAAAGAATTGCTACTTAGCTGGGAACCTGGTAAGGTTAAACCACCTCTCAACAGGAACTCTGTTTTC
ACGTGTTTTCAGATTTCAAAAGATTCTAAGTATCAGGTCGGCGAGTTTACTTTTGAAAAGGCAGACTACG
ATTCCGACACTGTTATTTATAAATCTACATCCACTAGCAAATTATGTCCAGGCATGCTTTTTGTCCTAAC
ATCACATAATGTAGCACCATTGAGAGCACCAACTATTGCCAATCAAGAGCGATACTCATCTATATTTAAG
TTGCATCCTGCATTTAATATAGCTGAAGCTTATGCGCAATTGGTGCCATATTATCAACTCATAGGCAAAC
AGCGTATTACCACTATACAGGGTCCTCCTGGTAGTGGTAAGTCTCATTGCGTTATAGGCTTAGGGTTGTA
CTTTCCTGGTGCGCGCATAGCATTTACTGCTTGTTCACATGCAGCTGTTGACTCCCTTTGTGTTAAAGCA
TTTACTGCATATGCACGTGATAGGTGTAGTCGCATAATTCCTGCTAGAGCGCGTGTGGATTGTTTCAATG
GTTTTAAAGCCAACAATAATAGTGCACAGTACATCTTTTCTACTGTTAATGCATTGCCAGAGTGTAACGT
TGACATAGTTGTTGTTGACGAAGTCTCTATGTGCACCAATTATGACCTCTCCATTATCAACAGTCGTATC
TCCTATAGACATATTGTCTATGTCGGAGATCCTCAGCAATTACCGGCACCTCGTACTATGATTACTAAGG
GTGTACTTGAACCTGCTGACTACAATGTTGTTACACAACGTATGTGTAGCGTGGGTCCTGACATCTTTTT
GCATAGATGCTTTAGATGTCCTGCTGAGATTGTTAACACTGTTTCAGAGCTTGTTTATGAAAATAAGTTC
AAGCCTGTTAATGCTGAGAGCAAACAGTGTTTTAAGCTTTTTGAACGTGGTAACGTCCATGTTGATAATG
GCTCTAGTATTAATAGGAGACAGCTTGATGTCGTTAAGATGTTTCTTGCTAAGAATCCTACTTGGTCCAA
TGCAGTTTTTATTTCACCTTATAATAGTCAGAATTATGTAGCAGCCAGAGTGTTAGGTTTGCAGATACAA
ACCGTGGACTCGTCTCAAGGCAGCGAATATGACTATGTTATTTACACACAGACATCAGACACACTGCATG
CATGCAATGTTAATAGATTTAACGTTGCTATAACGCGTGCTAAGAAAGGTATTTTCTGTGTCATGTGTGA
TAGAACTCTGTATGACTCACTCAAATTCTTTGAGGTTAAGTTGTCAGATTTACAAGCTGATAATGGTTGT
GGACTTTTTAAGAACTGCATACGCAATGAGGTCATTCTTAGTCCCGCATACGCACCTACTTATATGGCAC
TTTCTGACAGTTTTAAGACTAGTCAGGAATTGGCAGTTGCTATTGGTGCACCTCGTGATTGTGTTCGTTA
TGAGCACGTTATTTCTTTTATGGGCTTCCGCTTTGACGTGAACGTTCCTAATTACCACACACTCTTCTGT
ACTCGTGACTTTGCCATGAGACATGTTAGAGGTTGGATAGGGATGGATGTCGAAGGAGCTCATGTTTGCG
GTGACAATGTCGGCACCAATGTTCCACTACAAGTTGGTTTCTCTAACGGTATTGACTTTGTCGTACAGCC
AGAGGGGTGTGTCTCTACTGAAGTTGGCGACTTTATTAAACCTGTTAGAGCCCGTGCACCACCAGGTGAG
CAATTTACACATTTGGTTCCTCTTATTCGCAAGGGTCAACCATGGAATGTTGTTCGCCGCCGCATAGTAC
AAATGGTTTGCGATAGTCTGAAGGGTTTATCAGACGTCGTGGTCTTTGTTTTATGGGCAGGTGGTTTGGA
GTTAACAACTATGAGGTACTTTGTCAAGATAGGTATAGCTCAACATTGCTATTGTGGTAAGGATGCTCGT
TGTTACAATAGTGCGACACACTCGTTCTATTGTTTCAACCATGCAACAGGCTGTGATTACCTGTATAACC
CCTTTGCTATAGACATACAGCAGTGGGGCTACACAGGATCACTTAGTCTGAACCACCATGAGCATTGTAA
TGTGCATCGCAACGAGCATGTAGCGTCCGGTGATGCTATTATGACACGGTGCCTTGCAGTTTACGATTGC
TTTGTAAAGAATGTTGATTGGTCTATTACCTATCCATTTATTTGCAATGAGAGTGTAGTTAACAAGAGCG
GTCGTGTTGTTCAATCACACATTATGAGAGCTGCTCTTGTCGTATATGATCCAGTTGCAATTCATGATGT
TGGCAATCCTAAAGGTATACGCTGTGCTGTTACCAGTAAACCGTGGTATTGCTACGATAAGCAACCTCTT
AATTCCAATGTCAGATGTCTGGAGTACGACTACATAACTCATGGTCAAATGAATGGTTTGTGCCTATTCT
GGAACTGTAACGTTGATATGTACCCTGAGTTTAGCATTGTTTGCCGGTTTGACACACGCTGTAAGTCAGC
TCTCAACTTAGAGGGTTGTAATGGTGGTTCTTTGTATGTTAACAATCATGCATTCCACACACCAGCGTTT
GACAAGCGTGCATTTGCAAAGCTCAAGGTTATGCCCTTCTTTTATTATGACACTAGTGATTGTGATAAAG
TCCAGGAACATGTAAATTATGTTCCACTGCGTGCTAACAATTGTATCACACGATGTAATATCGGTGGTGC
TGTTTGTAGTAAACACGCTGATATGTACAAGAAGTACGTGGAGGCTTATAACACTTTCACACAGGCTGGT
TTTACCATCTGGTGTCCTACGTCTTTTGACGTTTACAACTTATGGCAATCTTTTACGACTTCTAATTTAC
AGGGGTTGGAGAACATAGCCTTTAATGTTGTTAAGAAGGGAGGTTTTGTTGGTGCTGATGGTGAACTACC
CGTCGCTGTTGTTAATGACCGTGTCATGGTACGCGACGGTATGACTGACACTCTGGTTTTTACAAATAAA
ACCGCACTTCCAACTAATGTTGCATTTGAACTTTACGCTAAGAGAAAACTCGGCCTTACCCCACCACTTA
CGATTTTACGTAATTTGGGTGTTGTAGCAACATATAAACATGTGCTATGGGATTATGAGGCTGAGCGTCC
ACTTACACCCTACACCAAGTCTGTATGTTCATACACTGACTTTGACCAGGATGTATGTGTGTGTTATGAT
AATTCTATTCCAGGTTCATTCGAGCGTTTCACAATGGCTAAAGATGCAGTGTTGTATTCCACTACATGTA
TTAAGAAGTTGACTTGTATTAAGGTTAACTTTGGTTACTTGAATGGAAATGCTGTTAGCACTACAAAGGA
AGTGGTTGGTGGTGAAACACGTGAAAAGAATGTAACTTGGTACATATACACACGCAAGGATGGTGCTTTT
GTAGACCGCTATGACGGCTACTATACTCAAGGGCGTAATGCAAATGATTTTGTGGCTCGTAGTCAGATGG
AAAAAGACTTTCTTGCTATGGACACTGGTTTGTTCATTTCCAAGTATGGTCTTGAAGACTACAATTTTGA
ACATATTGTTTATGGTGACGTTTCCAAAACAACTCTTGGTGGCCTACATTTACTAATTTCTCAAGTACGT
CTATCACAAATAGGCATACTTAAGGTCAATGATTTCGGTGGTGCAGATGACAGCACACTTAAGTGTTGCA
CTGTCACATACATAAATGACCCTAGTAGTAAAGTTGTGTGCACCTATATGGACTTGTTGTTGGATGATTT
TGTCACAATACTTAAGAGTTTGGACCTTTCAGTTGTTTCAAAGGTTCATGAAGTTTTAGTTGACTGCAAA
ATTTGGCGTTGGATGTTGTGGTGCAAGGATGCACACGTTGAAACATTTTACCCACAGTTGCAGTCTTCAG
AGTGGAAGTGCGGATATTCAATGCCCTCACTTTATAAAATACAGCGCATGTGTTTGGACACTTGTAACCT
TTACAATTATGGTGCAGGCTTGAAATTGCCTGATGGCATAATGTTCAACACACTTAAATACACCCAACTG
TGTCAGTACCTTAATAGCACTACTATGTGTGTACCACACAATATGCGTGTGTTACACCTTGGTGCAGGTT
CTGACAAGGGTGTTGCACCTGGTACTTGTGTCTTAAAGCGCTGGTTGCCACTTGACGCCATTGTGGTTGA
TAATGATATTAATGATTATGTTAGTGATGCAGATTTCAGTTATACAGGAGATTGCAACACTTTGTTCCTT
GAGGACAAATTTGATCTTGTGATCTCAGACATGTATGACGGTCGCACTAAGTTGTGTGATGGTGAAAATG
TGTCAAAAGAAGGTTTCTTCCCATACATTAATGGCGTCATTTTAAATAAATTATCTCTTGGTGGCACTGT
TGCCATTAAGATTACAGAGTATAGTTGGAATAAGCGCCTTTATGAGATTATTCAGAAATTTGAGTTTTGG
ACGTTGTTTTGTACGAGCGTTAACACGTCTTCCTCTGAGGCATTTTTAATTGGTGTTAATTATCTTGGTG
ACTTTTGTGAACGACCGGTTACCGATGGTAATACCATGCATGCCAATTACATATTTTGGCGCAATTCAAC
TATTATGACCATGTCATATAACTCTGTTTTGGACCTTTCAAAGTTTGCCTGCAAGCATAAAGCGACCGTG
GTTGTGTCACTAAAAGATGGTGATATTAACAGCATGGTAATAGGACTTGTAAAGAGTGGTAAACTTTTGG
TCCGTAATAATAACAAACTTTGTGGTTTTTCAAATCATTTAGTTTCAACTAAATAAAATGTGGCACGTCA
TTGTAGCCTTGGTTTTTATTCCATTTTTGAGTGCTGCTAATACTGGTACGTGTTCTAACACTATAAACCG
TTTTATGTACTTAAAATTGGGTTTACCAGTTCCTACAAATGATGCTTATGTTACTGGTTACTTGCCAATA
CCGTCGAACTGGACTTGCAGTGACGGTTATTGGCAGTACAAAAATGCTCATGGACTGTTTGTCTCTTATC
ATAGTACAGCGCTAGATTTTGCCATAGGCGTGTCGTCGTCGACAAGTTACGCCGAGAAATGGGGCCTTTA
TTTTTGGCAGAAAAATAATGAAGGCCGTGCTGTATTTAGAATCTGTAAGTGGGATGCAAGTGCACAAACC
AACTTTGCTCCCGATAGACATACAGCTCGTGACTGCTTTGTTAATAAGCAAATTCCCATGGTTTTTAAGC
ACCAAGGCAATGAAATAGTCGGCGTTTCATGGTCAGGTTCACGCGTGACATTACACACGTTAGATCGTGT
GTTTAGTTTCATTGTAGAAGGTGCAGAGAGTTGGGATTATGCTACTCTTCGTTGTGCCAATGGTTATGCA
TGCGCACACCAAGTTGTGTACAATCCTGTGACTGTTATTGTTACTACAGTCGCTGCAGGTATTCAAAAGT
ACACGCTTTGTGATAATTGCACTGGTTTCCCGCAGCATGTTTTTGCTACTATGGAGAATGGTGAAATACC
ACCTAGCTTTAATTTTGCTAATTGGTTTTATCTAACAAATTCTTCTTCACCTGTCTCTAGTAGAGTGGTT
GGTCTGCAACCACTTTTGTTAACATGTTTGTGGCCTATACCAGCTTTACTTGGCACTGCTACAGATATAA
CCTTTGACAGAAATGGTACCAGTGATGTTAGATGTAACGGCTTTGCCTCTAACGAGACGGCCGATGCTAT
GAGATTTTCACTTAATTTTACGGATAGTGCCGTATTTGCTAAAGAGGGTGTTATAACACTTAAAACGTTG
TCTAATACCTTCAAATTCTCTTGTAGCAACTCATCGACATACCAGGCACCATATGTCATACCTTTTGGTC
ACATTGACCAACCATATTATTGCTTTACCACATTTTACATCAATGAAACAGCTGGTACTACTACCACTTC
TTTTGTGGGTATGCTACCACCTGTTGTCAGAGAGTTTGTCATTACCAAGACTGGTAATGTGTACTTAAAT
GGCTACAGAATTTTCACTGTTGATGATGTGGTGAGCGTAAATTTTAACATTAGTTCTACAGACCATCGTG
ATTTTTGGACAGTTGCCTTTGTTAAAAACACAGAGGTGATGCTTGACATTGAAGACACTTATATAAAGCA
GTTGCTTTATTGTAACACACCTCTCAATGTTGTAAAGTGCCAGCAACTAAAATTTGTCTTAGACGATGGT
TTTTACTCTTATAGTTCACCAGTTGATGAAGTTTTGCCACGCACTATTGTGCGGTTGCCCAGACTTATGA
CACACAATTTTCTCAATTTTACAATCTTTGTGTCATTCTATTTTGATGATGATAAACAGGCCAGACCTGA
TGGCGGGTTTTATGAGTGCGCTACATGTGCTCCCAAGTATTACAAACTTGCCTTTGTAGACGATTGGACT
TCAGCTGTTAGCTCAAATGTTACAAGCATTTGCGTTAACTATGCCAGTTTCACTACCAGGTTATTCACTT
TTTATGCAGGTACCACTGCAGGTGTACATCTGGGTTTAGAGACTGGTACTTGCCCATTCAGTTTTGACAC
ACTTAATAACTATTTGACTTTTGGTTCACTGTGTTTTTCATTAGTAGCCAATGGTGGCTGTACTATGAAT
ATAGTCACACAAGGTCCTTATGGTTTGCCGCATACCATTGCGGTTTTGTATGTCTCATATACTGAAGGCG
ACAACATTATTGGAGTCCCTCTGTCTAACATACCACCTCTTGGTGTTTCAGACATGAGTCAGGTTTACCT
TGACACATGTACTACGTACACCATTTATGGTATGACAGGTCGTGGTGTTATCACCCGTAGTAACAACACG
TTTATTACTGGCCTATATTACACTTCAAATGCAGGCAATTTGTTGGCATATAAAAATTCAACTACTGGTG
TAGTTTATAATGTTTACCCATGTCAACTTTCTTCACAGGTTGCTGTTATAAGCGATGCCATTGTAGGTAT
GGCTTCATCTACTCCTAATGTGTCTATTGATTTTAATGTTACTGTCGTTGCTGACAACTTTTACTACCTA
AGTAATAGTGCACAGCCATGTGACCAACCAGTGCTTACTTATGCTGGTATAGGTATATGTAGTGATGGTA
GCATAACCAATAGTACGGCTAGGAGAGCTGCAGCAGACCCTGTTAGTCCTGTTATATCTGGTAATATTTC
TGTACCTACCAACTTCACTTTTTCTGTGCAAGTTGAGTATATACAGTTGATGCTTAAACCTGTAACAGTC
GACTGCAGTGTTTACGTTTGCAATGGAAACCCGCGTTGTCTTCAGCTACTGGCACAATATGCTAGTGCTT
GTAGAACTATAGAACAAGCCTTGCAACTTAGTGCAAGACTTGAGTCTGTTGAAGTCAATAGTATGATTTC
CATTTCGCAAGAGGCACTTGCGCTCGGTGTTATAGACAACTTTAAGCATGACTTTAATCTCACTAATGTA
CTTCCTGCCAGTGTAGGTGCTAAGTCTGCAGTGGAGGATTTGCTTTTTGATAAAGTCGTTACTTCAGGTT
TGGGAACTGTTGATGCAGATTATAAAGAGTGTGCTTCTCGCACGGCTAATACCGTAGCGGAAGTAGGTTG
CGTGCAATACTATAATGGAATTATGGTACTGCCTGGTGTTGTAGACCAATCTTTGCTGGCTCAGTATTCC
GCTGCTCTTACAGGTGCTATGGTATTTGGCGGTGTCACAGCAGGTGCTGCCGTACCATTTTCCATAGCAG
TTCAGTCCAGACTGAATTATTTAGCTTTGCAAACTGATGTTCTACAGCGTAACCAGCAGCAGCTTGCGAA
CTCCTTTAATGCTGCTATGGGTAACATTACTGAAGCTTTTGGTCGTGTTAACGACGCCATAGAGCAAACA
TCACATGCCATTTCAACTGTGGCACAGGCATTAGATAAGGTGCAGACCGTGGTCAATGATCAAGGTTTGG
CTCTCTCTCAACTTACAAAGCAGTTGGCTTCTAACTTTCAGGCTATTTCATCTTCTATAGAAGATCTTTA
TAACCGCCTTGACAGAGTCGAGGCTGACTTGCAGGTTGACAGACTTATCACAGGCCGTTTAGCTGCGCTG
AATGCTTTTGTGGCCCAACAGTTGACTAAGTACACGGATGTCAGAGCTTCTAGGCAGTTAGCACAGGATA
AAATTAATGAATGCGTTAAATCTCAGTCATTCCGTTACGGTTTTTGCGGCAACGGTACACATGTGTTTTC
CGTTGTTAATGCCGCTCCTGATGGAATGATGTTTTTCCATTCAGTTTTACTCCCTACTGCTTATATGGAA
GTGGCAGCATTTTCAGGGCTTTGTGTTGAAGGTAATGGCTATGTCCTCAGAGACACAGGTAATGTACTCT
TTGAGAAGAATGGTCAGTACCTCATTACTGCTAGGAAGATGTTTGAACCACGTGTTCCACAGACATCTGA
CTTTGTGCAAATTACAGGCTGTGATGTTGTATATTTGAATGTGACTCGTGATGAACTGCCTACTGTGATA
CCAGATTATATTGATGTTAATAGCACTGTCGAGGACATACTTAGTAAACTCCCTAACAGGACTACACCTG
AGTTTGACCTCGACATTTTCAATGCTACATACCTCAACTTGACTGGTGAGATAGCAGATTTAACGGCTAG
GTCCGAGTCACTTAAGAATACTACTTTAGAGTTAAAGGAGCTTATTGCTAATATTAATGCTACACTTGTT
GACCTTGAATGGCTTAACAGAGTTGAAACGTATATCAAGTGGCCTTGGTGGGTTTGGCTCATCATTGTGC
TAGTTTTGATACTTTTCACCTGTTTGATGCTGTTCTGTTGTTGTTCAACTGGATGTTGTGGCATTTTTAG
CTGTATGGCCAGTTCTTGCGGCGCCTGCTGTGATATACGTGGAACTAAACTTCAGCGGTACGAAGCTATA
GAAAAAGTCCACGTGCAATGATGGACCCGCTAGGTTTTCTGTGGTATTGGGATTTTGCTCCTAAGACAGT
GACACCTAAAGTTGCTGTACCACAAAGTTTACAACCTATTATTGTCCATTCTAATAACAGCGTTATAGGC
TTTTTGTTGATTAGCGTTTTCATATATTTCTTTGCTGTGTATAGAGCACACACATACAGGACGCAATTAG
TTTGCCTTTTGTGCAAATTTGTGCTTCTTGTTGTTTATGTGCCTCTATTAGTGTACTGCCAAGCATATGT
TGACGCTAGTATTATAGCACTAGTGCTTGTCATTAGACTGTGCTATCTGCTCTATTATTCTCTGAAGTAT
AAGACAGTAGATTTTCTACTATTTAATGATTCCGTGCTTTGTTTTTCCTTCGGCAAAGCATGTTTTGTAA
ATAATAAGCTTAGGCACTTTATGGTATTTACAGGAGGACACCATTACATGGATCTTGGCTACAATTTCGT
ACCTTTTGTTGACACGAGCACACTTGATGTGTGTATTCGTGGTAGCTTAGAGTATGATTTATTGTTTTCA
CGCCAGATTGAATTATGTGATGGTTCTTATTTATATCTTTTTACGAGCCAACCCGTTGTTAGTGTTTGCA
ACATTGTTACTACAACTCAACTTGACGAAACAGTCATTGAGCTGTAACATGTTGCTAAAACTTATTGAGG
ACAATGGTGTCATTGTTAATGGCATCATTTGGCTCTTGATACTTATATTTGTACTATTAATTTGTATCAC
TATATTAAAGTTGATTCAGCTGTGCATAGCTTGTCACCAGTTTGCTAATCGCACAGTATATTCACCTATT
TATAGTGCTTACCAATGGTACAAAGATTACATGCAAATTGCGCCCTTACCTCCTATCTATCATGTTTAAA
CTAAAACGATGAGCGACAATAGTACTGTCCCCGTCGCGGACGTTATTGAACATCTTAGAAATTGGAGTTT
TGCCTGGAACATCCTATTAACTCTGTTGATAGCGCTGCTCCAGTATGGCAATTTTAAGTACAGCAAGCTC
CTTTACGGGCTTAAGATGGCAATGTTGTGGCTGCTATGGCCTTGTGTTATAGCATTGTCCATAACTAATG
CTTGGGCTGACTTTAATGTTAACTGGGCGTATTTTGGCATCAGCATTTTTATGCTTGTTGTCACATTAGT
ACTCTGGATTATGTATTTTGTGAACAGTTTCCGCCTTTACAGGCGTACCAGGAGCTTCTGGGCCTTTAAC
CCGGAAACTGATTCAATTATCGTTTTCTCTGTCTATGGAACAACCTATTCCATTCCAGTGATCCAAGCCC
CGCAGGGCATTACATTCACAGTCCTGAGTGGTACACTTTTGGTCGACGGCATAAAAGTTGCAACAGGTGT
GCGCATTGAAGCGCTACCGCAATATGTCACTGTAGCTAAAGCTACAACTACCATTGTGTTCCACAGAGTA
GGCAAAGCCGTGAATGAAAGGACCCAGACGGGATGGCTGTTCTTTGTACGGTCGGGCTATGGTGACTACG
CTGCTCATTCAACCGGTACAGGACAAATGACAGAAAGCGAAAAATTACTTCATATAGCTTAAACTAAACA
ATGAGCTCTGTCAAATTTGAGGCCTCTGGTCGCACTGGCAGAACTCCACTCTCTTTCTTTGCACCACTTA
CGGTGTCCTCTGATAAGAAATTTTGGAATGTCCTCCCCAAAAATGCAGTTCCAACAGGAAAAGGCAATGC
CAAACAACAAGTTGGATACTGGAATGAACAGCCCAGATGGAGGATGCAGCGAGGTGAGAGGGTTGAGAAA
CCTTCTTACTGGCACTTCTACTTTCTTGGTACCGGCCCTCACGCTGATGCCAAGTTTAGAGAGCGCATCC
CAGGTGTGGTGTGGGTTAGCAAGGCGAATGCTGACCTTAACCCGACTAACCTTGGAACCAGATCTAAGGC
TAGAAGTGTCATCACTCCAAAATTTGACTCGGAGCTGCCTTCTGACATTGAAATCGTTGACAAGTCCTCT
GCACCAAACTCGCGGGGAAACTCGCGTAGCCAGAGCAGAGGTCCAGGCAATGGTGCGAACAGTCGGAACA
ACTCAAAGGGGAGAAACAACACGAACTCTCGTGACAATTCCAACAACAGAGGAAAATCTCAGTCTCGTAA
TAGCTCACGCAACCGCGGACAGCAGCGTAATAATAACCAACAACGCCAGGGAACTGGTGCTGCAGGTAAT
GGCACTGCTGACCTCGCTGCCGCTATTGTCTTGGCCCTTGAAAAAGCTGGCCTTACAAGAGAAACTGAGA
AGGCACCTAAGAAGGAGAGTGCTAATAATAATAAAAAATCAGAATCCAGAGCAAGTTCTCCTGCTCCAGC
TCAGTCCAAAAAGGACCAACTAGGTAAGGTGATGTGGAAACGCAACCCCGATCCTAGCTTCAATGTTACA
CAGTGCTTCGGACCACGTTCTGTTTACCAGAATTTTGGTGATGAAGATGCCATCAAGAACGGCGTCAAAG
CTAAGCACTTCCCCTCTTGGGCTGAGCTAACACCAACACCTGCTGCACTGCTTTTTGGCAGCGAGGTGAT
TACAGTTGAGGATGGTGATGATATCGTCATCCAGTACAACTACCAAATGAGAGTGCCCAAAACCATGGCA
GCACTCCAGACATTCCTGCCTCAGGTTGGTGCGTACGCCAATGGCGACAACGAATCTGAATCAGGCGACC
AGCCAGGTGCTTCTGCTGCTGCTGCTGCTGCACCAGAACCTCCTGCTCTACCTCCTAAATTGAACCCTAA
AGCAGATGCCTTCGTGCCTCCAAAGATTAATCCCAATTACTTTGACGGCATGAAGGTGGAGATAATGAAC
AAAACCATTTCAGATGATAGTACGGCTTAAACTTGACGAAATCTTTTGATTTCGAGCTATTTCAGCTGAA
GTTTGTAGTAATTGCTAATTGCTATCACTAAAATGTTTCCAGAAATCAATTTTGATCTGTGGATCACACA
AATTTGGTTGCTGTGCACTGCATGCTATATCTTCCTATATCAATGGTGGTACGTGTGGGTAACCACAGGT
ATTTTGCCAGCTGATACATGGTTTGTGCTGCTATTGTTCTTTGCATTCTGCTTCCCAGCCTTTTGTGACA
TGGCTAGTCCCGGGTTCCTTGAATGGTGGTATGATCAGGCTAGGTTTATTCATGATAACATCTTGCACTG
GCTACTTAGTGATATGCGGCCCCTAGGCTTCCTCCTTTGGATCCTAGTTATTTTGGGCCTGGTCTTATAC
ACAACGGTAGTCCAGTGGTAATTTCAGTATAAGAAGGAAATCACCATATTGCAGATCCGAGGTGAACGCT
ATGTTTTAACTATCTAACACGGAGTTGGAGTGATTTAAAGATCGCTTTGACGAGCCAACAATGGAAGAGC
CAACACGTGATTTAGCTACGCATAGTTACTAACTTAAGACAGTTCTGCTTTGCTATGGATACACAAAAAA
AAAAA

>gi|971745027|ref|NC_028806.1| Swine enteric coronavirus strain Italy/213306/2009, complete genome
AGTAAAGTGAGTGTAGCGTGGCTATATCTCTTCTTTTACTTTAACTAGCTTTGTGCTAGATTTTGTCTTC
GGACACTAACTCGAACTAAACGAAATATTTGTCTTTCTATGAAATCATAGAGGACAAGCGTTGATTATTT
CCATTCAGTTTGGCAATCACTCCTTGGAACGGGGTTGAGCGAACGGTGCAGTAGGGTTCCGCCCCTATTT
CGTAAGTCGCCTAGTAGTAGCGAGTGCGGTTCCGCCCGTACAACGTTGGGTAGACCGGGTTCCGTCCTGT
GATCTCCCTCGCCGGCCGCCAGGAGAATGAGTTCCAAACAATTCAAGATCCTCGTCAATGAGGACTACCA
AGTCAACGTGCCTAGTCTTCCTATTCGTGACGTGTTACAGGAAATCAAGTACTGTTACCGTAATGGATTT
GAGGGCTATGTTTTCGTACCAGAATACTGTCGTGACCTAGTTGATTGCGATCGTAAGGATCACTACGTCA
TCGGTGTTCTTGGTAACGGAGTAAGTGATCTTAAACCCGTTCTTCTTACCGAACCCTCCGTCATGTTGCA
AGGCTTTATTGTTAGAGCTAACTGCAATGGCGTTCTTGAGGACTTTGACCTTAAAATTGCTCGCACTGGC
CGAGGTATCATATATGTTGATCAATATATGTGTGGTGCTGATGGAAAACCAGTCATTGAGGGCGATTTTA
AGGATTATTTCGGTGATGAAGACATCATTGAATTTGAAGGAGAGGAATACCATTGCGCTTGGACAACTGT
GCGCGATGAGAAACCGCTGAATCAGCAAACTCTCTTTACTATTCAGGAAATCCAATACAACATGGACATT
CCTCATAAGTTGTCAAACTGTGCTATTAGACATGTAGCACCGCCAGTCAAAAAGAACTCTAAAATAGTTC
TGTCTGAAGATTACAAGAAGCTTTATGAAATCTTCGGATCACCCTTTATGGGAAATGGTGACTGTCTTAG
CAAATGCTTTAACACTCTCCATTTTATCGTTGCTACTCTTAGATGCCCTTGTGGTTCTGAAAGTAGCGGC
GTGGGAGATTGGACAGGTTTTAAGACTGCTTGTTGTGGTCTTTCTGGCAAAGTTAAGGGTGTCACTTTGG
GTGATATTAAGCCAGGTGATGCTGTCGTCACTAGTATGAGCGCAGGTAAGGGAGTTAAGTTCTTTGCCAA
TTGTGTTCTTCAATATGCTGGTGACGTTGAAGGTGTCTCTATATGGAAAGTTATTAAAACTTTTACAGTT
GATGATACTGTGTGCACCCCTGGCTTTGAAGGCGAATTGAACGACTTCATCAAACCTGAGAGCAAATCAC
TACTTGCATGCAGCGTTAAAAGAGCATTCATTACTGGTGAGATTGATGATGCTGTACATGATTGTATCAT
TACAGGAAAATTGGATCTTAGTACAAACCTTTTTGGTAACGTTGGTCTATTATTTAAGAAGACTCCATGG
TTTGTACAAAAGTGTGGTGCACTTTTTGTGGATGCTTGGAAATTAGTAGAAGAACTTTGTGGTTCACTCA
CACTTACATACAAGCAAATTTATGAAGTTGTAGCATCACTTTGCAATTCTGTTTTTACGATTGTAAACTA
CAAGCCAACATTTGTGGTTCCAGACAATCGTGTTAAAGACCTTGTAGACAAGTGTGTGCAAGTTTTTGTA
AAAGCATTTGATGCTTTTACGCAGGTTATTACAATAGCTGGTATTGAGGCCAAATGTTTTGTTCTTGGTG
CTAAATACCTGTTGTTCAATAATGCACTTGTCAAACTTGTCAGTGTTAAAATCCTTGGCAAGAAGCAAAA
GGGTCTTGAATGTGCATTCTTTGCTACTAGCTTAGTTGGTGCAACTGTTAATGTGACACCTAAAAGAACA
GAGACTGCCACTATCAGCTTGAACAAAGTTGATGATGTTGTAGCACCAGGAGAAGGTTATATCGTCATTG
TTGGTGATATGGCTTTCTACAAGAGTGGTGAATATTATTTCATGATGTCTAGTCCTAACTCTGTTCTTAC
TAGCAATGTTTTTAAAGCAGTTAAAGTTCCATCTTACGACATCGTGTACGATGTTGATAATGATACTAAA
AGCAAAATGATTGCAAAACTTGGTTCATCATTTGAATATGATGGTGATATTGATGCTGCTATTGTAAAAG
TCAATGAATTACTCACTGAATTTAGGCAGCAAAGTTTGTGCTTCAGAGCTCTTAAGGACGAAAAAAGCAT
TTTTGTTGAAGCCTACTTTAAAAAGTATAAAATGCCAGCATGCCTTGCAAAACATATTGGTTTGTGGAAC
ATCATAAAGAAGGATTCATGTAAGAGGGGTTTTCTTAATCTCTTCAATCATTTGAATGAATTGGAGGATA
TTAAAGAGACTAATATCCAGGCTATTAAAAACATTCTTTGTCCTGATCCTCTTCTTGATCTGGATTATGG
TGCCATTTGGTATAACTGCATGCCAAGTTGCTCTGATCCTTCAGTTTTGGGGAGCGTTCAACTTTTGATT
GGTAATGGTGTGAAAGTGGTTTGTGATGGATGCAAAGGTTTTGCTAATCAACTTTCAAAAGGTTACAACA
AGCTCTGTAATGCGGCTCGTAACGATATTGAGATTGGTGGTATACCATTTTCCACTTTTAAAACACCTAC
AAGTACTTTTATTGAAATGACAGATGCTATCTATTCAGTTGTTGAACAGGGTGAGGCATTATCCTTTAGA
GATGCTGATGTACCAGTTGTAGATGATGGTACCACTGCTACTGTTGATTGGTCTGAACCCATTTTGCTTG
AACCTGCTGAATATGTAAAACCAAAGAACAATGGTAATGTCATTGTTATTGCAGGTTATACATTTTATAA
AGATGAGGATGAACATTTTTATCCCTATGGTTTTGGTAAAATTTTGCAGAGAATGTATAATAAAATGGGT
GGTGGTGACAAAACTGTCTCATTTTCAGATGAAGTAGATGTTCAAGAAATTGCACCCGTTACAAGTGTTA
AACTTGAATTTGAATTTGACAATGAAATTGTAACTGGTGTTCTTGAACGAGCTATTGGTACTAGATACAA
ATTTACTGGTACGACTTGGGAAGAATTTGAAGAGTCTATTTCTGAAGAACTTGATGCGATTTTTGATACT
TTAGCAAACCAAGGTGTCAAACTTGAAGGTTACTTCATTTATGATACTTGTGGTGGCTTTGATATAAAAA
ATCCAGATGGTATTATGGTCTCTCAGTATGATATTGATATTACTGTTGATGAAAAATCAGAAGTTAGTGT
ATCAATTGAAAAAGAAGAAGTTGACTCTGTTGAAGAAAATCCCAGCGATGAAATCGAAGCATTTGAAGGT
GCTGAAGGGATTTCTTCTCAAGAAGATGCTGAAACAGTAGACTTTGCAGATCTTACTTCCACAGAAGAAG
ATGTTGACATTGTTGAAGTAACTGCTAAAGATGACCCTTGGGCTGCAGCTGTTGATGTACAAGAAGCTGA
ACAATTTAAGCATTCTCCACCACCTTTCAGGACAACGAATCTCAACGGAAAAATTATCCTTAAGCAAGAG
GATAATAATTGTTGGATAAATGCTTGTTGCTACCAGCTTCAGGCTTTTGATTTTTTCAACAATGAAGCTT
GGGAGAAATTTAAGAAGGGTGATGTCATGGAATTCGTAAACCTTTGCTATGCAGCGACAACACTAGCAAG
AGGTCACTCTGGTGATGCAGATTATCTTCTTGAACTTATGCTCAATGATTATAGCACAGCCAAGATAGTA
CTTGCAGCTAATTGTGGTTGTGGTGAAAAAGAAATTGTTTTGGAAAGAACTGTTTTTAAACTCACCCCAC
TTAAGGAGAGCTTTAGCTATGGTGTTTGTGGTGATTGCATGCAAGTTAACAACTGTAGGTTTTTAAGTGT
TGAAGGCTCGGGTGTTTTTGTTCATGACATATTAAGCAAGCAGACGCCAGAGTCTATGTTTGTTGTCAAA
CCTGTTATGCATGCAGTTTACACTGGCACAACTCAAAATGGCCATTACATGGTTGATGATATTGAACACG
GTTACTGTGTGGATGGTATGGGTATTAAGCCACTTAAGAAACGGTTTTATACATCCACATTGTTCATTAA
TGCCAATGTAATGACTAGAGCTGAAAAACCAAAACAAGAGTTTAAAGTTGAAAAAGTGGAACAGCAACCT
ATAGTGGAGGATGATAAATCCTCTATTGAAAAAGAGGAAATTCAAAGTCCTAAAAATGATGACCTTATAC
TGCCATTTTATAAAGTTGGTAAACTTTCCTTTTATCAGGGTGCTTTGGATGTTTTGATTAATTTTTTGGA
ACCTGATGTTATTGTTAATGCTGCTAATGGTGATCTTAAACACATGGGTGGTGTCGCAAGAGCCATCGAT
GTTTTCACTGGTGGTAAATTAACAGAACGTTCTAAGGATTATCTCAAAAAGAACAAATCTATTGCTCCTG
GTAATGCAGTTTTCTTTGAAAATGTCATTGAGCATCTTAGTGTTTTGAACGCAGTTGGACCACGTAATGG
TGACAGCCGAGTTGAAGCCAAACTTTGTAATGTTTACAAAGCAATTGCAAAGTGTGAAGGAAAAATATTA
ACACCACTTATTAGTGTTGGTATCTTTAATGTTAGACTTGAAACATCATTGCAGTGCTTACTTAAGACTG
TGAATGACAAGGGATTGAATGTCTTCGTATATACCGATCAAGAAAGGCACACTATTGAGAATTTCTTTGC
TTGTTCTATCCCTATTAATGTTACTGAGGACAATGTTAATCATGAACGTGTGTCTGTTTCTTTTGATAAA
ACATATGGTGAACAGCTTAATGGCACCGTTGTCATTAAAGATAAAGATGTTACAAACCAGTTGCCTAGTG
CTTTTGATGTTGGTCAAAAAGTTGTCAAGGCTATTGATATAGATTGGCAAGCTTATTATGGTTTCCGTGA
TGCTGCTGCTTTTAGTGCTAGTAGTCATGATGCTTATAAATTTGAAGTTGTTACACATAGCAATTTCATT
GTGCATAAGCAGACTGACAACAACTGCTGGATTAATGCAATTTGTCTTGCATTACAGAGACTCAAGCCAC
AGTGGAAATTTCCTGGTGTTAGAGGTCTCTGGAATGAATTTCTTGAGCGTAAAACACAAGGTTTTGTACA
TATGTTGTATCACATTTCTGGAGTAAAGAAAGGTGAGCCAGGTGATGCTGAATTAATGCTTCATAAACTT
GGTGACTTGATGGACAATGAGTGTGAAATCATTGTCACACATACTACAGCATGTGACAAGTGCGCAAAAG
TAGAAAAGTTTGTTGGACCAGTGGTAGCAGCACCTCTTGCAATTCATGGCATTGACGAAACATGTGTGCA
TGGTGTTAGTGTCAATGTCAAAGTTACCCAAGTTAGTGGCACTGTTGCCATTACCTCTTTGATTGGTCCT
ATTATTGGAGAAGTACTAGAAGCAACTGGTTATATTTGTTATAGCGGTTCTAATATGAGTGGTCATTATA
CCTATTACGACAACCGTAATGGATTAGTGGTTGATGCAGAAAAGGCTTACCATTTTAATAGAGACTTATT
ACAGGTCACAACAGTTATTGCAAGTAATTTTGTTGTCAAGAAACCACAAGCAGGGGAGAGACCTAAGAAT
TGTGCTTTTAAAGCTGCAGCATCTCCTAAGATTGTACAGGAACAAAAATTGTTGGCTATTGAAAGTGGCG
CTAACTATGCTCTTACTGAATTTGGAAAATATGCTGATATGTTCTTTATGGCTGGAGATAAAATTCTTAG
GTTTCTGCTTGAAATCTTTAAATATTTGCTGGTTCTATTTATGTGTCTTAGAAGTACTAAGATGCCTAAA
GTTAAAGTCAAACCGCCTTTTGCATTTAAAGATTTTGGTGCTAAGGTCAGAACTCTCAACTACATGAGAC
AATTGAACAAACCATCTGTTTGGCGTTATGCAAAACTAGTTTTATTGTTGATAGCAATATATAATTTCTT
TTATTTGTTTGTTAGTATACCAGTGGTGCATAAATTAACATGTAATGGTGCTGTACAGGCATATAAAAAT
TCTAGCTTTATAAAGTCAGCAGTCTGTGGCAATTCTATTTTATGCAAAGCCTGTTTGGCTTCTTATGATG
AGTTGGCCGATTTTCAACATCTCCAAGTTACTTGGGATTTTAAATCTGACCCATTATGGAACAGACTGGT
ACAATTGTCTTACTTTGCATTCTTGGCTGTTTTTGGTAGTAACTATGTTAGGTGTTTTCTTATGTATTTT
GTATCTCAGTACCTTAACCTTTGGCTTTCTTATTTTGGTTATGTAGAGTACAGTTGGTTTTTGCATGTTG
TTAACTTTGAATCTATTTCAGCTGAGTTTGTGATTGTAGTTATAGTGGTTAAGGCAGTTCTCGCTCTTAA
ACATATTGTCTTTTCATGCTCAAACCCTTCTTGCAAAACGTGCTCTAGAACTGCAAGGCAGACACGTATT
CCTATTCAAGTTGTTGTTAATGGTTCAATGAAAACTGTTTATGTTCATGCTAATGGTACTGGTAAATTTT
GCAAGAAACACAATTTTTATTGTAAGAACTGTGAGTCTTATGGCTTTGAAAATACATTCATTTGTGACGA
AATTGTACGTGATCTCAGTAATAGTGTTAAACAAACTGTTTACGCCACTGATAGATCGCATCAAGAAGTC
ACAAAAGTTGAATGTTCAGATGGCTTTTACAGATTTTATGTTGGTGATGAATTCACTTCATATGATTACG
ATGTAAAACACAAGAAATATAGTAGTCAAGAGGTTCTCAAGAACATGCTCTTGCTTGACGATTTTATTGT
GTACAGTCCATCTGGCTCTGCTCTTGCAAATGTTAGAAATGCCTGTGTTTACTTTTCACAACTTATTGGT
AAGCCTATTAAGATTGTTAACAGTGATTTGCTTGAAGATCTCTCTGTAGATTTTAAAGGGGCACTTTTTA
ATGCTAAAAAGAATGTAATTAAGAATTCTTTCAATGTTGATGTCTCAGAATGCAAAAATCTTGACGAATG
TTACAGGGTTTGCAATCTTAATGTGTCGTTTTCCACATTTGAAATGGCTGTCAACAATGCTCATAGATTT
GGTATTCTGATTACTGACCGTTCTTTTAACAATTTCTGGCCATCAAAAGTTAAGCCTGGTTCATCTGGTG
TGTCGGCCATGGACATTGGTAAGTGTATGACTTCTGATGCTAAGATTGTTAATGCTAAAGTTTTAACTCA
ACGTGGTAAAAGTGTTGTTTGGCTTAGCCAGGATTTTGCTGCACTTAGCTCAACTGCTCAGAAAGTTTTG
GTTAAAACTTTTGTAGAAGAGGGTGTCAACTTTTCACTCACATTTAATGCTGTAGGTTCAGACGATGATC
TTCCTTATGAAAGATTCACTGAATCTGTGTCTCCAAAAAGTGGTTCAGGCTTTTTCGATGTAATTACACA
GCTTAAACAAATTGTGATTTTGGTGTTTGTTTTTATTTTTATTTGTGGTTTGTGCTCTGTTTACAGTTTT
GCTACACAGTCCTATATTGAATCTGCTGAAGGCTATGATTACATGGTTATTAAGAATGGAATTGTTCAAC
CTTTTGACGATACCATTTCATGTGTTCATAACACTTATAAAGGATTTAGTGACTGGTTTAAAGCTAAGTA
TGGTTTTGGCCCTACTTTTGGTAAATCATGTCCAATTGTTGTAGGAACTGTTTTTGATCTTGAAAATATG
AGACCAATCCCTGACGTGCCTGCATATGTTTCTATTGTGGATAGATCTCTTGTTTTTGCTATTAATGCTG
CCTTTGGTGTTACTAATATGTGCTATGATCATACTGGCAATGCAGTTAGTAAGGACTCTTACTTTGACAC
TTGTGTGTTTAATACTGCATGCACCACTCTTACAGGTCTTGGTGGTACAATTGTATATTGTGCAAAGCAA
GGTTTAGTTGAGGGTGCTAAGCTCTATAGTGATCTTATGCCAGACTATTATTATGAGCATGCTAGTGGTA
ACATGGTTAAACTGCCAGCAATTATTAGAGGACTTGGTCTACGTTTTGTGAAAACACAGGCTACAACTTA
TTGTAGAGTGGGAGAGTGCATTGATAGTAAAGCTGGTTTTTGCTTTGGTGGTGATAACTGGTTTGTCTAC
GATAAAGAGTTTGGTAATGGATACATCTGTGGTAATTCTGTGTTAGGATTCTTTAAGAATGTTTTCAAAC
TCTTTAACTCTAACATGTCTGTGGTAGCTACATCTGGTGCGATGCTTGTTAATATCATTATTGCATGCTT
AGCTATTGCAACGTGTTACGGTATTCTTAAGTTTAAGAAGATTTTTGGTGATTGTACTTTCCTCATTGTT
ATGATTATTGTCACTCTTATTGTGAATAATGTGTCTTATTTTGTCACTCAAAATACGTTCTTTATGATCA
TTTATGCCATTGTTTACTATCTTACAACAAGAAAAATTGCATACCCAGGCATTTTTGATGCTGGGTTTAT
TATTGCTTATATTAATATGGCTCCATGGTACGTGATTACCGCATATGTCATAGTTTTCCTCTATGATTCA
CTCCCTTCACTGTTTAAACTTAAAGTTTCAACAAATCTCTTTGAAGGTGACAAATTTGTGGGTAACTTTG
AATCTGCTGCTATGGGTACTTTTGTTATTGACATGCGTTCATATGAGACTATTGTTAATTCTACTCCTAT
TGATAGAATTAAATCATATGCTAACAGCTTCAATAAATATAAGTACTACACAGGTTCAATGGGAGAAGCT
GACTACAGAATGGCTTGTTATGCTCATCTTGGTAAAGCTCTTATGGACTATTCTGTTAATAGAACCGACA
TGCTTTACACACCTCCTACTGTTAGTGTTAATTCCACACTTCAGTCAGGTTTACGGAAAATGGCGCAGCC
TAGTGGTCTTGTAGAGCCTTGCATTGTAAGAGTCTCCTATGGTAACAATGTGCTTAATGGTTTATGGTTA
GGAGATGAAGTCATTTGCCCTAGACATGTTATTGCTAGTGATACCACACGTGTTATCAACTATGAAAATG
AAATGTCTAGTGTGAGACTTCACAACTTTTCAGTTTCTAAGCATAATGTGTTTTTGGGTGTTGTGTCTGC
CAGATGTAAGGGTGTGAATCTTGTACTTAAAGTCAACCAGGTTAATCCTAATACACCAGAACATAAATTT
AAGTCTGTTAAAGCTGGTGAAAGTTTTAACATTCTAGCTTGTTATGAAGGATGTCCTGGCAGTGTTTATG
GTGTCAACATGAGAAGTCAAGGTACCATTAAAGGGTCTTTTATAGCTGGTACTTGTGGATCAGTAGGTTA
TGTGTTAGAAAATGGAATTCTCTATTTTGTATACATGCATCATTTAGAACTCGGAAATGGCTCGCATGTT
GGTGCCAATTTTGAAGGAGAAATGTATGGTGGTTATGAAGATCAACCTAGCATGCAATTGGAAGGTACTA
ATGTCATGTCATCAGATAATGTGGTTGCATTTTTATATGCCGCACTTATCAATGGTGAAAGGTGGTTTAT
TACAAACACATCGATGTCATTAGAATCGTACAATACATGGGCTAAAACTAACAGTTTCACAGAACTTTCT
TCAACTGATGCTTTTAGCATGTTGGCTGCAAAAACTGGTCAAAGTGTTGAGAAATTACTAGATAGTATCG
TAAGACTCAACAAGGGTTTTGGAGGTCGTACTATACTGTCTTATGGCTCATTGTGTGACGAGTTCACTCC
AACTGAAGTCATAAGGCAGATGTATGGTGTAAATCTTCAGGTTGGTAAAGTAAAATCTTTCTTTTACCCT
ATTATGACTGCAATGACAATTCTTTTTGCCTTTTGGCTTGAATTCTTTATGTACACACCCTTCACTTGGA
TTAATCCAACTTTCGTTAGTATTGTGTTGGTTGTTACAACTTTAATCTCGACGGTTCTTGTCTCTGGTAT
TAAGCATAAAATGTTATTCTTTATGTCTTTTGTTCTTCCTAGTGTTATCCTTGTGACAGCAAACAATTTG
TGCTGGGACTTGTCTTACTATGAAGGTCTTCAGTCAATTGTTGAGAATACTAATATTATGTTCTTGCCTG
TAGACATGCAAGGTGTCATGCTCACAGTGTTCTGCTTTATTGTTTTTGTTACATATAGTGTTAGATTCTT
TACATGTAAACAATCATGGTTCTCACTTGCTGTGACAACTATTTTTGTGATCTTTAACATGGTTAAAGTA
TTTGGAACATCTGATGAACCGTGGAATGAAAACCAAATTTCTTTCTGCTTTGTGAACATGCTTACTATGA
TTGTTAGTCTTACTACAAAGGATTGGATGGTTGTCGTTGCATCATACAGAGTTGCATATTATATTGTTGT
ATGTGTAATGCCACCTGCTTTTGTATCTGACTTCGGGTTTATGAAGTGTATTAGCATTGTTTACATGGCG
TGCGGTTACTTGTTTTGTTGCTATTATGGCATTCTTTATTGGATTAATAGATTTACATGCATGACTTGTG
GTGTTTATCAATTCACTGTGTCTGCAGCTGAACTTAAATACATGACAGCTAACAATCTTTCTGCACCTAA
GAACGCATATGATGCTATGATTCTTAGTGCTAAATTGATTGGTGTTGGAGGTAAGAGAAACATTAAAATT
TCAACTGTACAGTCAAAACTTACAGAGATGAAATGTACCAATGTTGTCTTGCTTGGTCTTCTGTCTAAAA
TGCATGTTGAATCTAATTCAAAAGAGTGGAACTATTGTGTTGGACTACATAATGAGATAAATCTTTGTGA
AGATCCTGAAATCGTTCTTGAGAAATTGTTAGCTCTCATTGCATTTTTCTTGTCCAAACATAACACTTGT
GACCTTAGCGAACTTATTGACTCATACTTTGAGAACACCACCATACTTCAAAGTGTGGCCTCAGCTTATG
CTGCATTGCCTAGTTGGATTGCACTTGAAAAAGCTCGCGCTGATCTTGAAGAGGCTAAGAAAAATGATGT
TAGCCCTCAAATTTTGAAGCAGCTTACTAAAGCATTTAACATTGCCAAGAGTGATTTTGAGCGCGAAGCA
TCAGTGCAAAAGAAGCTTGACAAAATGGCGGAGCAGGCTGCAGCTAGTATGTATAAGGAGGCACGAGCTG
TTGACAGAAAGTCAAAGATTGTTTCTGCTATGCATAGTCTACTTTTTGGTATGCTTAAGAAACTTGATAT
GTCCAGTGTCAACACTATTATTGAACAGGCTCGTAACGGTGTCCTACCTTTAAGTATTATTCCAGCTGCG
TCAGCTACAAGACTTGTTGTTATTACACCTAGCCTTGAAGTGTTTTCCAAGATTAGGCAAGAAAACAATG
TTCATTATGCTGGTGCCATTTGGACTATTGTTGAAGTTAAAGATGCTAATGGTTCACATGTACATCTTAA
GGAAGTTACCGCTGCTAATGAATTAAACCTTACTTGGCCATTGAGCATCACTTGTGAGAGAACCACAAAG
CTTCAGAACAATGAAATTATGCCAGGCAAACTTAAAGAGAGAGCTGTCAGAGCGTCAGCTACTCTTGATG
GCGAAGCTTTTGGTAGTGGAAAGGCTCTTATGGCCGCTGAAAGTGGAAAAAGTTTTATGTATGCATTTAT
AGCATCAGACAACAATCTTAAGTATGTTAAGTGGGAGAGCAATAATGATATTATACCTATTGAACTTGAA
GCTCCATTGCGTTTCTATGTCGATGGCGCTAATGGTCCTGAAGTTAAGTATTTGTATTTTGTTAAGAATT
TAAACACTCTTAGACGTGGTGCCGTTCTTGGTTATATCGGTGCGACAGTTCGTCTGCAAGCTGGTAAACC
TACTGAACATCCGTCTAACAGTAGTTTATTGACGTTGTGTGCTTTTGCACCTGATCCTGCTAAAGCATAT
GTTGACGCTGTTAAGAGAGGTATGCAACCAGTTAATAACTGTGTAAAAATGCTCTCAAATGGTGCTGGTA
ATGGTATGGCTGTTACAAATGGTGTCGAAGCTAACACGCAACAGGACTCTTATGGTGGTGCTTCAGTTTG
CATTTATTGCAGATGCCATGTTGAACATCCCGCTATTGATGGATTGTGCCGCTATAAAGGTAAGTTCGTG
CAAGTACCAACTGGCACACAAGATCCAATTCGGTTCTGTATTGAAAATGAGGTTTGTGTTGTCTGTGGTT
GTTGGCTTAACAATGGTTGTATGTGCGATCGTACTTCTATGCAGAGTTCTACTGTTGATCAGAGTTATTT
AAACGAGTGCGGGGTTCTAGTGCAGCTCGACTAGAACCCTGCAATGGTACTGATCCAGACCATGTTAGTA
GAGCTTTTGACATCTATAACAAAGACGTTGCGTGTATTGGTAAATTCCTTAAGACGAATTGTTCAAGATT
TAGGAATTTGGACCAACATGATGCCTACTACATTGTCAAACGTTGTACAAAGACCGTTATGGACCATGAG
CAAGTCTGTTATAACGATCTTAAAGATTCTGGTGCTGTTGCTGAACATGACTTCTTTACATACAAAGAGG
GTAGATGTGAATTCGGTAATGTTGCACGTAGGAATCTTACAAAGTACACAATGATGGATCTTTGTTACGC
CATTAGAAATTTTGATGAAAAGAACTGCGAAGTTCTTAAAGAAATACTTGTGACAGTAGGTGCCTGCACT
GAAGAATTCTTTGAAAATAAAGATTGGTTTGATCCAGTTGAAAATGAGGCCATACATGAAGTTTATGCAA
AACTTGGACCCATTGTAGCCAATGCAATGCTTAAATGTGTTGCCTTTTGCGATGCGATAGTGGAAAAAGG
CTATATAGGTGTTATAACACTTGACAACCAAGATCTTAATGGCAATTTCTACGATTTCGGAGATTTCGTG
AAGACTGCTCCAGGTTTTGGTTGTGCTTGTGTTACATCATATTATTCTTATATGATGCCTTTAATGGGGA
TGACTTCATGTTTAGAGTCCGAAAACTTTGTGAAAAGTGAAATCTATGGTTCTGATTATAAGCAGTATGA
TTTACTAGCTTATGATTTCACTGAACATAAGGAGTATCTTTTCCAAAAATACTTTAAGTACTGGGATCGC
ACATATCACCCAAATTGTTCTGATTGTACTAGTGACGAGTGCATTATTCATTGTGCCAATTTTAACACAT
TGTTTTCTATGACAATACCAATGACGGCCTTTGGACCACTTGTTCGTAAAGTTCATATTGATGGTGTACC
AGTGGTTGTTACTGCAGGTTACCACTTCAAACAACTTGGTATAGTATGGAATCTTGATGTAAAATTAGAC
ACGGTGAAGTTGAGTATGACTGATCTTCTTAGATTTGTCACAGACCCAACACTTCTTGTAGCATCAAGCC
CTGCACTATTAGACCAGCGTACTGTTTGTTTCTCCATTGCAGCTTTGAGTACTGGTGTTACATATCAGAC
AGTAAAACCAGGTCACTTTAACAAAGATTTCTACGATTTTATAACAGAGCGCGGATTCTTTGAAGAGGGA
TCTGAGTTAACATTAAAACATTTTTTCTTTGCACAGGGTGGTGAGGCTGCTATGACAGACTTCAATTATT
ATCGCTACAATAGAGTCACAGTACTTGATATTTGCCAAGCTCAATTTGTTTACAAAATAGTTGGCAAATA
TTTTGAATGTTATGACGGTGGGTGCATTAGTGCTCGCGAAGTTGTTGTTACAAACTATGATAAGAGTGCT
GGCTACCCTTTGAACAAATTTGGTAAAGCTAGACTTTACTATGAAACTCTTTCATATGAAGAGCAGGATG
CACTTTTTGCTTTAACAAAGAGAAATGTTTTACCCACAATGACTCAACTGAATTTGAAATACGCTATTTC
TGGTAAGGCAAGAGCTCGTACAGTAGGAGGAGTTTCACTTCTTTCTACCATGACTACGAGACAATATCAT
CAGAAGCATTTGAAGTCAATTGCTGCAACACGCAATGCTACTGTGGTTATTGGTTCAACCAAGTTTTATG
GTGGTTGGGACAATATGCTTAAAAATTTAATGCGTGATGTTGATAATGGTTGTTTGATGGGATGGGACTA
TCCTAAGTGTGACCGTGCTTTACCTAATATGATTAGAATGGCTTCTGCCATGATATTAGGTTCTAAGCAT
GTTGGTTGTTGTACACATAATGATAGGTTCTACCGCCTTTCCAATGAGTTAGCGCAAGTACTCACAGAAG
TTGTGCATTGCACAGGTGGTTTTTATTTTAAACCTGGTGGTACAACTAGCGGTGATGGTACTACGGCATA
TGCTAACTCTGTTTTTAACATTTTTCAGGCTGTTTCTGCTAATGTTAACAAGCTTTTGGGAGTTGATTCA
AACGCTTGTAATAACGTTACAGTAAAATCCATACAACGTAAAGTTTACGATAATTGTTATCGTAGTAGCA
GCATTGATGAAGAATTTGTTGTTGAGTACTTTAGTTATTTGAGAAAACACTTTTCTATGATGATTTTATC
TGATGATGGAGTTGTATGCTACAACAAAGATTATGCGGATTTAGGTTATGTAGCTGATATTAATGCTTTT
AAAGCAACACTCTATTACCAGAATAACGTCTTTATGTCCACCTCCAAGTGTTGGGTAGAACCAGATCTTA
GTGTTGGACCACATGAATTTTGTTCACAGCACACATTGCAGATTGTTGGACCTGATGGAGACTACTATCT
TCCCTATCCAGACCCCTCCAGAATTTTGTCAGCTGGTGTGTTTGTTGATGACATAGTTAAAACAGACAAT
GTTATTATGTTAGAACGTTACGTGTCATTGGCTATTGATGCATACCCACTTACAAAACACCCTAAGCCTG
CTTATCAAAAAGTGTTTTATACTTTACTAGATTGGGTTAAACATTTACAGAAAAATTTGAATGCAGGTAT
TCTTGATTCTTTCTCAGTGACAATGTTAGAGGAAGGTCAAGATAAGTTCTGGAGTGAAGAGTTTTACGCT
AGCCTCTATGAAAAATCCACTGTCTTGCAAGCTGCAGGCATGTGTGTAGTATGTGGTTCGCAAACTGTAC
TTCGTTGTGGAGACTGTCTTAGGAGACCACTTTTATGCACGAAATGTGCTTATGACCATGTTATGGGAAC
AAAGCACAAATTCATTATGTCTATCACACCATATGTGTGTAGTTTTAATGGTTGTAATGTCAATGATGTT
ACAAAGTTGTTTTTAGGTGGTCTTAGTTATTATTGTATGAACCACAAACCACAGTTGTCATTCCCACTCT
GTGCTAATGGTAACGTTTTTGGTTTATATAAAAGTAGTGCGGTCGGTTCAGAGGCTGTTGAAGATTTCAA
CAAACTTGCAGTCTCTGACTGGACTAATGTAGAAGACTACAAACTTGCTAACAATGTCAAGGAATCTCTG
AAAATTTTTGCTGCTGAAACTGTGAAAGCTAAAGAGGAGTCTGTTAAATCTGAATATGCTTATGCTATAT
TAAAGGAGGTTGTCGGCCCTAAGGAAATTGTACTCCAATGGGAAGCTTCTAAGACTAAGCCTCCACTTAA
TAGAAATTCAGTTTTCACGTGTTTTCAGATAAGTAAGGATACTAAAATTCAATTAGGTGAATTTGTGTTT
GAGCAATCCGAGTACGGTAGTGATTCTGTTTATTATAAGAGCACAAGTACTTATAAATTGATACCAGGTA
TGATTTTTGTGTTGACTTCTCATAATGTGAGTCCTCTTAAAGCCCCAATTTTGGTCAACCAAGAAAAGTA
CAATACCATATCTAAGCTATATCCTGTCTTTAATATAGCGGAAGCCTATAACACACTGGTTCCTTACTAC
CAAATTATAGGTAGGCAAAAATTTACAACTATCCAAGGCCCTCCTGGTAGCGGTAAATCTCATTGTGTTA
TAGGTTTGGGTCTGTATTATCCTCAGGCGCGAATAGTTTACACCGCATGTTCTCATGCTGCTGTAGACGC
TTTATGTGAAAAAGCGGCCAAAAACTTCAATGTTGATAGATGTTCAAGGATAATACCTCAAAGAATCAGA
GTTGATTGTTACACTGGCTTTAAGCCTAATAACACCAATGCGCAGTACTTGTTTTGTACTGTCAATGCTT
TACCAGAAGTAAGCTGTGACATTGTTGTAGTTGATGAGGTCTCTATGTGTACTAATTATGATCTTAGTGT
CATAAATAGCCGACTTAGTTACAAACACATTGTTTATGTTGGAGACCCACAGCAGCTACCAGCTCCTAGA
ACTTTGATTAATAAGGGTGTACTTCAACCTCAGGATTACAATGTTGTAACCAAAAGAATGTGCACACTAG
GACCTGATGTCTTTTTGCATAAATGTTACAGGTGTCCAGCCGAGATTGTTAAGACAGTCTCTGCACTTGT
TTATGAAAATAAGTTTGTACCTGTCAACCCAGAATCAAAGCAGTGCTTTAAAATGTTTGTAAAAGGTCAG
GTTCAGATTGAGTCTAACTCTTCTATAAACAATAAGCAATTAGAGGTTGTCAAGGCCTTTTTAACACATA
ATTCAAAATGGCGTAAAGCTGTTTTCATCTCACCCTATAATAGTCAAAATTATGTTGCTCGGCGTCTTCT
TGGTTTGCAAACGCAAACCGTGGATTCCGCCCAGGGTAGTGAGTATGATTACGTCATCTACACACAAACC
TCTGATACACAGCATGCTACTAATGTTAACAGATTTAATGTTGCCATTACGAGAGCAAAGGTTGGTATAC
TTTGTGTCATGTGTGATAGAACCATGTATGAGAATCTTGATTTCTATGAGCTCAAAGATTCAAAGGTTGG
TTTACAAGGGAAACCTGAAACTTGTGGTTTATTTAAAGATTGTTCGAAGAGCGAACAATACATACCACCT
GCTTATGCAACGACATATATGAGCTTATCTGATAGTTTTAAAACAAGTGATGGTTTAGCTGTTAACATTG
GCACAAAAGATGTTAAATATGCTAATGTCATCTCATATATGGGATTCCGGTTTGAAGCCAACATACCAGG
CTATCACACTCTATTTTGCACGCGGGACTTTGCTATGCGTAATGTTAGAGCATGGCTCGGGTTTGATGTT
GAAGGTGCACATGTCTGTGGTGATAATGTTGGCACTAATGTGCCATTACAGCTTGGTTTTTCAAACGGTG
TTGATTTTGTAGTGCAAACTGAAGGATGTGTTATTACTGAAAAAGGTAATAGCATAGAGGTTGTAAAAGC
AAGAGCACCACCAGGCGAACAATTTGCACACTTGATTCCGCTTATGAGAAAGGGTCAGCCTTGGCACATT
GTTAGACGCCGTATAGTGCAGATGGTCTGTGACTATTTTGATGGCTTATCAGATATTCTGATCTTTGTGC
TTTGGGCTGGTGGTCTCGAACTTACAACTATGAGGTACTTTGTTAAAATTGGAAGACCACAAAAATGTGA
ATGCGGTAAAAGTGCAACTTGTTATAGTAGCTCGCAATCTGTTTATGCTTGCTTCAAGCATGCACTAGGA
TGTGATTATTTATATAACCCTTACTGCATTGACATACAGCAATGGGGCTACACAGGATCTTTGAGTATGA
ATCATCATGAGGTTTGCAACATTCATAGAAATGAGCATGTAGCTAGTGGTGATGCTATCATGACTAGATG
TCTCGCTATACATGACTGTTTCGTCAAACGTGTTGATTGGTCAATTGTGTACCCTTTTATTGACAATGAA
GAGAAGATCAATAAAGCTGGTCGCATAGTGCAGTCACATGTCATGAAAGCTGCTCTGAAGATTTTTAATC
CTGTTGCAATTCACGATGTTGGTAATCCAAAAGGTATTCGTTGTGCTACAACACCGATACCATGGTTTTG
TTATGATCGTGATCCTATTAATAACAATGTTAGATGTTTGGACTATGACTATATGGTACATGGTCAAATG
AATGGTCTGATGTTGTTTTGGAACTGTAATGTAGACATGTACCCAGAGTTCTCAATTGTTTGTAGATTTG
ACACTCGCACTCGCTCTAAATTGTCTTTAGAAGGTTGTAATGGTGGTGCGTTGTACGTCAATAATCATGC
TTTCCATACACCAGCTTATGATAGAAGGGCTTTTGCTAAGCTTAAACCTATGCCATTCTTTTACTATGAT
GATAGTAATTGTGAGCTTGTTGATGGCCAACCTAATTATGTGCCACTTAAGTCTAATGTTTGCATAACAA
AATGCAACATTGGTGGTGCTGTCTGCAAGAAACACGCTGCTCTTTACAGAGCGTATGTTGAGGATTACAA
CATTTTTATGCAGGCTGGTTTTACAATATGGTGTCCTCAAAATTTTGACACCTATATGCTCTGGCATGGT
TTTGTTAATAGCAAAGCACTTCAGAGTCTAGAGAATGTGGCTTTTAACGTCGTTAAGAAAGGTGCCTTCA
CTGGTTTAAATGGTGACTTACCAACTGCTGTTATTGCTGACAAAATAATGGTAAGAGATGGACCTACTGA
CAGATGTATTTTTACAAATAAGACTAGTTTACCTACCAATGTAGCTTTTGAGTTATATGCAAAACGCAAA
CTTGGACTCACACCTCCATTAACAATACTTAGAAATTTAGGTGTTGTCGCAACATATAAGTTTGTGTTGT
GGGATTATGAAGCTGAACGTCCTTTCTCAAATTTCACTAAGCAAGTCTGCTCCTATACTGATCTTGACAG
TGAAGTTGTAACATGTTTTGACAATAGTATAGCTGGTTCTTTTGAGCGTTTTACTACTACAAGAGATGCA
GTGCTTATTTCTAATAACGCTGTGAAAGGGCTTAGTGCCATCAAGTTGCAATATGGCTTTTTGAATGATT
TACCTGTAAGTACTGTTGGAAATAAACCTGTCACATGGTATATCTATGTGCGCAAGAACGGTGAGTACGT
CGAACAAATCGATAGTTATTATACACAGGGACGTACCTTTGAAACCTTCAAACCTCGTAGTACAATGGAA
GAAGATTTTCTTAGTATGGATACTACACTCTTCATCCAAAAGTATGGTCTCGAGGATTATGGTTTTGAAC
ACGTTGTATTTGGAGATGTCTCTAAAACTACCATTGGTGGTATGCATCTTCTTATATCGCAAGTGCGCCT
TGCAAAAATGGGTTTGTTTTCTGTACAAGAATTTATTAATAATTCTGACAGTACACTGAAAAGTTGTTGT
ATTACATATGCTGATGATCCATCTTCTAAGAATGTGTGCACTTATATGGACATACTCTTGGACGATTTTG
TGACTATCATTAAGAGCTTAGATCTTAATGTTGTGTCCAAAGTTGTGGACGTTATTGTAGATTGTAAGGC
ATGGAGATGGATGTTGTGGTGTGAGAATGCACATATTAAAACCTTCTATCCACAACTCCAATCTGCCGAA
TGGAACCCCGGTTATAGCATGCCTACACTGTACAAAATCCAGCGTATGTGTCTCGAACGGTGTAATCTCT
ACAATTATGGTGCACAAGTGAAATTACCTGATGGCATTACTACTAATGTCGTTAAGTATACTCAGTTGTG
TCAATACCTTAACACTACTACACTGTGTGTACCACACAAAATGCGTGTACTGCATTTAGGAGCTGCTGGT
GCAGCTGGTGTTGCTCCTGGTAGTACTGTATTAAGAAGATGGTTACCCGATGATGCCATATTGGTTGATA
ATGATTTGAGAGATTACGTTTCCGACGCAGACTTCAGTGTTACAGGTGATTGTACTAGTCTTTACATTGA
AGATAAATTTGATTTGCTTATTTCTGATTTATATGATGGCTCCACAAAATCAATTGACGGTGAAAACACG
TCGAAAGATGGTTTCTTTACTTATATTAATGGTTTCATTAAAGAGAAACTGTCACTTGGTGGATCTGTTG
CCATTAAAATCACGGAATTTAGTTGGAATAAAGATTTATATGAATTGATTCAAAGATTTGAGTATTGGAC
TGTGTTTTGTACAAGTGTTAATACATCATCATCAGAAGGGTTTCTGATTGGTATTAACTACTTAGGACCA
TACTGTGACAAAGCAATAGTAGATGGGAATATAATGCATGCCAATTATATATTTTGGAGAAACTCTACAA
TTATGGCTCTATCACATAACTCAGTCCTAGACACTCCTAAATTCAAGTGTCGTTGTAACAACGCACTTAT
TGTTAATTTAAAAGAAAAAGAATTGAATGAAATGGTCATTGGATTACTAAGGAAGGGTAAGTTGCTCATT
AGAAATAATGGTAAGTTACTAAACTTTGGTAATCACTTCGTTAACACACCATAAATGAAGTTTTTAATCC
ACTGCTGGTTGTTCCTACCGCTATTGTCAGCCCTCAGCCTAACACAAGATGTCACTAGGTGTGGGGTAAA
CACTAATTTTAGACGGTTCTTTTCAAAATTCAATGTCCAGGCACCTGCCACCGTCATATTGGGTGGTTAT
CTACCTAGTATGAACTCTTCTAGCTGGTACTGTGGCCAAGGCATTGAAACTGCTAGTGGCGTCCACGGTA
TCTTTCTTAGCTACATTGATTCTGGCCAGGGCTTTGAAATTGGCATTGCGCAAGAGCCGTTTGACCCTAG
TGGTTACCAGCTTTATCTATATAAGGATAATGGTAACACTGGTGCTACTGCACGACTGCGTATTTGCCAG
TTTCCCCACAATAAAACATTGGGCCCCAGTGTTGGTGACGTTACAACAGGTCGTAACTGCCTAGTCAACA
AAGCCATTCCAGCTCACCTGCAGGATAACAAAAACATTGTTGTCGGCTTAACATGGGATAATGATCGTGT
CACTGTTTTTGCTGACAAGATCTATCATTTTTATCTTAAAAATGAATGGTCTCGTGTTGCGACAAGATGT
TATAATAAGCGAAGTTGTGCTATGCAATATGTTTACACACCCATTTACTACATGCTTAATGTTACTAGTT
CAGGTGAGGATGGTATTTACTACGAACCCTGCATATCCAATTGCATTGGTTACGCTGCTAATGTATTTGC
CACTGAGTCCAATGGTCATATACCAGATAGTTTTAGTTTTAACAACTGGTTTCTTTTGTCCAATGACTCC
ACTTTGTTGCATGGTAAAGTGGTTTCTAATCAACCTTTGTTGGTCAATTGCCTCTGGGCCATTCCTAAGA
TTTATGGATTAGGCCAATTTTTCTCATTCAATCAAACGCTGGGTGGCTCTTGTAATGGAGCTGCTGCTGA
GCGTGCCCCAGAGGCTTTGAGGTTTAACATTAATGACACCTCTGTCATTCTTGCTGACGGTTCAATTGTA
CTTCATACTGCTTTAGGAACAAATTTTTCTTTTGTTTGCAGTAATTCCTCAAACCCACATACAGCCACTT
TCACTTTACCTTTGGGTGCTACTAAAGTACCCTACTATTGCTTTCTTAAAGTGGACACTTACAACTCCAC
TGTCTATAAATTCTTGGCTGTTTTACCTCCTACTGTCAGGGAAATTGTCATCACCAAGTACGGTGATGTT
TATGTTAATGGGTTTGGCTATTTGCATATAGGTTTGCTGGATGCTGTCACAATTAATTTCACTGGCCATG
GCACTGACGGCGACGTCTCAGGTTTCTGGACCATAGCATCGACTAATTTTGTTGATGCACTCGTCGAGGT
TCAAGGAGCTGCCATTCAGCGTATTCTTTATTGTGATGATCCTGTTAGCCAACTCAAGTGTTCTCAGGTT
TCTTTTGATCTTGATAATGGTTTTTACCCTATCTCTTCTAGAAACCTTCTGAGTCATGAACAGCCAATTT
CTTTTGTTACTTTGCCCTCATTTAATGATCATTCTTTTGTTAATATTACTGTCTCTGCAGCTTTTGGTGG
TCATAGTGGTGCCAATCTTGTTGCATCTGACACTACTATCAATGGGTTTAGTTCTTTCTGTGTTGAAACT
AGACAATTTACCATCACACTGTTTTATAATGTTACAAACAGCTATGGTTACGTGTCTAAATCACAGACTA
GCAATTGCCCTTTCACCTTGCAATCTGTTAATGATTACCTGTCTTTTAACAAATTTTGTATTTCAACCAG
CCTTTTGGCTGGTGCTTGTACCATAGATATTTTTGGTTACCCTGATTTTGGTAGTGGTGTTAAGTTGACG
TCCCTTTATTTTCAATTCACAAAAGGTGAGTTGATTACCGGCACGCCTAAACCACTTGTAGGTGTCACGG
ACGTTTCTTTTATGACTCTGGATGTTTGTACCAAGTATACTATCTATGGCTTCAAAGGTGAGGGTATTAT
TACCCTTACAAATTCTAGCTTTTTAGCAGGTGTTTATTATACATCTGATTCTGGACAGTTATTAGCTTTT
AAGAATGTTACCAGTGGTGCTGTTTATTCTGTCACACCATGCTCTTTTTCAGAGCAGGCTGCATATGTTA
ATGATGATATAGTGGGTGTTATTTCTAGTTTGTCTAACTCCACTTTTAATAATACTAGGGAGTTGCCTGG
TTTCTTCTACCATTCTAATGATGGCTCTAATTGTACAGAGCCTGTGTTGGTGTACAGTAACATAGGTGTT
TGTACATCTGGCAGTATTGGCTATGTTCCATATCAGCATGGCCAAGTCAAGATTGCACCTACCGTTACTG
GGAATATTAGTATTCCCACCAACTTTAGTATGAGTATTAGAACAGAGTACTTACAGCTTTACAACACACC
TGTTAGTGTTGATTGTGCTACATATGTTTGCAATGGTAACTCCCGTTGTAAACAACTACTTTCCCAGTAC
ACCGCAGCGTGTAAGACCATAGAATCAGCATTACAACTCAGCGCCAGGCTTGAGTCTGTTGAAGTCAACT
CTATGCTTACTATCTCTGAAGAGGCTCTACAGTTAGCTGACATCAGTTCGTTTAATGGCGATGGATATAA
TTTTACCAGTGTGCTGGGTGTTTCTGTGTATGATCCAACAAGTGGCAGGGTGGTACAAAAAAGGTCTCTT
ATTGAAGACCTGCTCTTTAATAAAGTGGTTACTAATGGCCTTGGTACTGTTGATGAAGACTATAAGCGCT
GTACTAATGGTCGCTCTGTGGCTGATTTAGTCTGTGCGCAGTATTACTCTGGTGTAATGGTACTACCTGG
CGTTGTTGACGCTGAGAAGCTTCACATGTACAGTGCGTCTCTCATTGGTGGTATGGCGCTAGGCGGTTTA
ACTGCTGCGGTGGCATTGCCTTTTAGCTATGCTGTTCAAGCAAGACTTAATTATCTTGCCTTACAGACGG
ATGTTCTACAGCGCAACCAGCAATTGCTTGCTGAGTCTTTTAACGCTGCTATTGGTAATATAACTTCAGC
CTTCGATAGTGTTAAAGAGGCTATTAGTCAGACTTCCCAGGGTTTGAACACTGTGGCTCATGCGCTTAAT
AAGGTTCAAGAGGTTGTTAATTCGCAGGGTGCAGCCTTGTCTCAACTTACTTTACAGCTTCAACACAACT
TTCAAGCCATTTCTAGTTCTATTGATGATATTTATTCTCGACTGGACAGTCTTTCAGCTGATGTTCAGGT
TGACCGTCTCATCACCGGCAGGTTATCAGCACTTAATTCTTTTGTTTCTCAAACCCTCGCTAAGTATACT
GAGGTTCAGGCTAGCAGAAAGTTAGCACAGCAAAAGGTTAATGAGTGCGTCAAATCGCAATCTCAGCGTT
ATGGTTTTTGTGGTGGTGATGGTGAACATATTTTCTCTCTGGTACAGGCCGCACCGCAGGGCCTGCTGTT
TTTACACACAGTACTTGTACCGGGCGATTTTGTAAATGTTATTGCCATCGCTGGCTTATGCGTTAATGAT
GAAATTGCCTTGACTCTACGTGAGCCTGGATTAGTCTTGTTTACGCATGAACTTCAAACCTACAATGCGA
CGGAATATTTTGTTTCTTCGCGACGTATGTTTGAACCTAGAAAACCTACTGTTAGTGATTTTGTTCAAAT
TGAGAGTTGTGTGGTCACCTATGTCAATTTGACTAGCGACCAACTACCAGATGTAATCCCAGATTACATT
GATGTTAACAAAACATTTGATGAGATTGTAGCTTCTCTGCCCAATAGAACTGGTCCAAGTCTTCCTATAG
ATGTTTTTAATGCCACCTATCTTAATCTCACTGTTGAAATTGCAGATTTAGAGCAGCGCTCAGAGTCTCT
TCATAATATTACAGAAGAGCTCCGAAGTCTCATATACAATATCAACAACACACTTGTTGACCTTGAGTGG
CTCAATCGGGTTGAGACATATATCAAGTGGCCATGGTGGGTTTGGTTGATCATTTTCATTGTTCTCATCT
TTGTTGTGTCATTACTAGTGCTCTGTTGCATTTCCACGGGTTGTTGTGGATGCTGCGGTTGCTGCGGTGC
TTGTTTTTCAGGTTGTTGCAGAGGTCCTAGACTCCAACCTTACGAAGCTATTGAAAAGGTTCATGTGCAG
TGACGTTTTCCAGCACACAATTGACACAGTTGTCAAAGATGTCTCTAAGTCTGTTAACTTGTCTTTGGAT
GTTTTGAAGAATTAAACACACAAAATCCAAAGTATTAAGTTTTACAAAACAATTAAAGAGAGATTGTAGC
ACCAACTCGAACTAAACTTGTGAAAATGATTGGTGGACTTTTTCTTAATACTCTGAGTTTCTTAATTGTT
AGTAACCACTCTATTGTTAATAATACAGCAAATGTGCATCACACACAGCACGAACGTATTATAGTACAAC
AGCATCATGTTGTTAGTGCTAGAACACAAAATTATTACCCAGAGTTCAGCATCGCTGTACTTTTTGTATC
TTTTCTAGCTTTGTACCGTAGTACAAACTTTAAGACCTGTGTCGGTATCTTAATGTTTAAGATTTTATCA
ATGACGCTTTTAGGACCTATGCTTATAGCATATGGTTACTATATTGATGGCGTTGTTACAACAACTGTCT
TATCTTTAAGATTTGCCTACTTAGCATACTTTTGGTATGTTAATAGTAGGTTTGAATTTATTTTATACAA
TACAACGACACTCATGTTTGTACATGGCAGAGCTGCACCGTTTAAGAGAAGTTCTCACAACTCTATTTAT
GTCACATTGTATGGTGGCATAAATTACATGTTTGTGAATGACCTCACGTTGCATTTTGTAGACCCTATGC
TTGTAAGCATAGCAATACGTGGCTTAGCTCATGCTGATCTAACTGTAGTTAGAGCAGTTGAACTTCTCAA
TGGTGATTTTATTTACGTATTTTCACAGGAGCCCGTAGTCGGTGTTTACAATGCAGCCTTTTCTCAGGTC
GTTCTAAACGAAATTGACTTAAAAGAAGAAGAGGGTGACCACACCTATGACGTTTCCTAGGGCATTGACT
GTCATAGATGATAATGGTGTGGTCATTAGCATCATTTTCTGGTTCCTGTTGATAATTATATTGATATTAC
TTTCAATAGCATTGCTAAATATAATTAAGCTATGCATGGTGTGTTGCAATTTAGGAAGGACAGTTATTAT
TGTCCCAGTGCAACATGCTTATGATGCCTATAAGAATTTTATGCGGATTAAAGCATACAAACACGATGGA
GCACTCCTTGTTTGAACTAAACAAAATGAAGATTTTGTTGATATTAGCGTGTGCGATTGTATGCACATAT
GGCGAACGCTATTGTGCTATGAAGGACGATAAAGGTCTCTCATGTCGCAATAGCACAGCGTCTGATTGTG
ATGCGTGCTTCAACAAAGGCGATCTTATTTGGCATCTCGCAAACTGGAACTTCAGCTGGTCTATAATATT
GATCATTTTTATTACTGTGCTACAATATGGAAGACCTCAATTCAGCTGGTTCGTGTATGGCATTAAAATG
TTTATAATGTGGCTATTATGGCCCCTTGTTTTGGCTCTTACGATTTTTAATGCATACTCGGAATACCAAG
TGTCCAGGTATGTAATGTTCGGCTTTAGTATTGCAGGTGCAATTGTTACAGTTGTACTTTGGATTATGTA
TTTCGTAAGATCCATTCAGTTGTACAGAAGGACTAAGTCTTGGTGGTCCTTTAACCCTGAGACTAACGCA
ATTCTTTGCGTTAGTGCACTAGGAAGAAGCTATGTGCTTCCTCTCGAAGGTGTGCCAACTGGTGTCACTT
TAACTTTGCTTTCAGGGAATTTGTACGCTGAAGGGTTCAAAATTGCAGGTGGTATGAACATCGACAATTT
GCCAAAATACGTAATGGTTGCATCACCCAGCAGGACTATTGTCTACACACTTGTTGGCAAAAAGTTGAAA
GCAAGTAGTGCGACTGGATGGGCTTACTATGTAAAATCTAAAGCTGGTGATTACTCAACAGAGGCAAGAA
CTGATAATTTGAGTGAGCAAGAGAAATTATTACATATGGTATAACTAAACTTCTAAATGGCCAACCAGGG
ACAACGTGTTAATTGGGGGGACGAGTCCACCAAAACACGTGGTCGCTCCAATTCCCGTGGTCGGAAGAGT
AATAATATACCTCCCTCATTTTTCAACCCCATAACCCTCCAGCAAGGTGCAAAATTTTGGAACTTATGTC
CCAGAGATTTTGTACCTAAAGGAATAGGTAATAGGGATCAACAGATTGGTTATTGGAATAGACAAACTCG
CTATCGCATGGTAAAGGGCCAACGTAAAGAGCTTCCTGAAAGGTGGTTCTTTTACTATTTAGGCACTGGA
CCTCATGCAGATGCCAAATTTAAAGACAAATTAGATGGAGTTGTCTGGGTTGCCAAGGATGGTGCCATGA
ACAAACCTACTACGCTTGGTAGTCGTGGTGCTAATAATGAATCCAAAGCTTTGAAATTCGATGGTAAAGT
GCCAGGCGAATTTCAACTTGAAGTTAACCAGTCTAGGGATAACTCAAGGTCACGCTCTCAATCTAGATCT
TGGTCTAGAAACAGGTCTCAATCCAGAGGCAGGCAACAATCCAATAACAAGAAGGATGACAGTGTAGAAC
AAGCTGTTCTTGCCGCACTTAAAAAGTTAGGTGTTGACACAGAAAAACAACAGCAACGCTCTCGTTCTAA
ATCTAAGGATCGTAGTAACTCTAAAACAAGAGATACTACGCCTAAGAATGAAAACAAACACACCTGGAAG
AGAACTGCAGGTAGAGGTGATGTGACAAGGTTTTATGGAACTAGAAGCATCTCAGCCAATTTTGGTGACA
GTGACCTCGTTGCCAATGGGAGCAGTGCCAAGCATTACCCACAATTGGCTGAATGTGTTCCATCTGTGTC
CAGCATTCTGTTTGGAAGCTATTGGACTTCAAAGGAAGATGGCGACCAGATAGAAGTTACGTTCACACAC
AAGTACCACTTGCCAAAGGATGACCCTAAAACTGAACAATTCCTTCAGCAGATTAATGCCTATACTCGTC
CATCAGAAGTGGCAAAAGAACAGAGAAAAAGAAAATCTCGTTCTAAATCTGCAGAAAGGTCAGAGCAAGA
GGTAGTACCTGATGCATTAATAGAAAATTATACAGATGTGTTTGATGACACACAGGTTGAGATGATTGAT
GAGGTAACGAACTAAACGAGATGCTCGTCCTCCTCCATGCTGTATTTATTACAGTTTTAACCTTACTACT
AATTGGTAGACTCCAATTATTAGAAGGATTATTACTTAATCATTCTTTCAATCTTAAAACTGTTGATGAT
TTTAATATTTTATATAGGAGTTTAGCAGAAACCAGATTACTAAAAGTGGTTCTTTGCTTAATCTTTTTAG
TTTTAGTAGGATTTTGCTGCTATAGATTGTTAGTTATATTAATGTAAGGCAACCCGATGTTTAAAACTGG
TTTTTCTGAGGAACTACTGGTCATCGCGCTGTCTACTCTTGTACAGAATGGTAAGCACGTGTAATAGGAG
GTACAAGCAACCCTATTGCATATTAGGAGGTTTAGATTTGATTTGGCAATGCTAGATTTAGTAATTTAGA
GAAGTTTAAAGATCCGCTATGACGAGCCAACAATGGAAGAGCTAACGTCTGGATCTAGTGATTGTTTAAA
ATGTAAAATTGTTTGAAAATTTTCCTTTTGATAGTGATACA

>gi|971483139|ref|NC_028752.1| Camel alphacoronavirus isolate camel/Riyadh/Ry141/2015, complete genome
ACTTAAGTGTCTTATCTATCTATAGATAGAAAAGTCGCTTTTTAGACTTTGTGTCTACTCTTCTCAACTA
AACGAAATTTTTGCTACGGCCGGCATCTCTGATGCTGGAGTCGTGGCGTAATTGAAATTTCATTTGGGTT
GCAACAGTTTGGAAATAAGTGCTGTGCGTCCTAGTCTAAGGGTTCTGTGTTCTGTCACGGGATTCCATTC
TACAAACGCCTTACTCGAGGTTCTGTCTCGTGTTTGTGTGGAAGCAAAGTTCTGTCTTTGTGGAAACCAG
TAACTGTTCCTAATGGCCTGCAACCGTGTGACACTTGCCGTAGCAAGTGATACTGAAATTTCTGCAACTG
GTTGCTCTACTATTGCGCTAGCCGTCCGCCGCTATAGCGAGGCCGCTAGCAATGGATTTAGAGCATGCCG
ATTTGTTTCATTTGGCTTGCATGATTGCGTTGTTGGCATTGCAAACGACGATTATGTCATGGGTTTGCAT
GGTAACCAAACGTTGTCCTGCAATATAATGAAATTTTCTGACCGTCCCTTTATGCTTCGTGGTTGGTTGG
TTTTTTCCAATTCAAATTACCTCTTGGAGGAGTTTGATGTTGTCTTCGGTAAGAGAGGTGGTGGTAATGT
GACATACACTGACCAGTATCTCTGTGGCGCCGATGGCAAACCTGTCATAAGTGATGATTTATGGCAGTTT
GTTGACCATTTTGGTGAAAACGAAGAAATTATCATCAATGGTCATACTTACGTTTGTGCTTGGCTTACTA
AGCGCAAGCCTTTAGATTACAAACGTCAGAACAACCTTGCCATTGAAGAGATTGAATATGTGCGTGGCGA
TGCTTTGCATACACTACGCAATGGTTCTGTTCTTGAAATGGCTAAGGAAGTGAAGACATCTAGTAAGGTT
GTGTTAAGCGATGCTCTTGACAAACTTTACAAAGTTTTTGGTTCTCCTGTTATGACAAATGGTTCTAACA
TCTTAGATGCCTTTATTAAACCTGTGTTCATTAGTGCATTTGTTCAATGTACTTGTGGCAACAAGTCTTG
GTCTGTCGGTGATTGGACTGGTTTTAAATCCACCTGCTGTAATGTGCTCAGTAACAAACTGTGTGTTGTT
CCCGGTAATGTTAAACCTGGTGACGCTGTGGTTACTACTCAGCAAGCTGGTGTTGGTGTTAAGTACTTTT
GTGGCATGACTCTTAAGTTTGTTGCAAACATTGAAGGTGTCTCTGTTTGGCGAGTAATCGCTGTTCAGAG
TGTGGATGGATTTGTTGCTTCTGCTACTTTTGTAGAGGAGGAACATGCTAACAGAATGGATACATTCTGC
TTCAATGTACGCAATAGCACTACTGATGAGTGTCGTTTGGCCATGTTGGGTGCTGAAATGACCAGTAATG
TCAGAAGACAAGTTGCTGCAGGTGTCATAGACATTAGTACCGGTTGGTTCGATGTTTATGATGACATCTT
TGCTGAAAATAAACCATGGTTTGTTCGCAAGGCTGAAGACATTTTTGGCCCGTGTTGGTCTGCTCTTGTT
TCTGTGCTTAAACAGCTTAAAGTCACTACAGGTGAACTTATGAGGTTTGTTAAGTCTATTTGCAGTTCAG
CTGTTGCTGTTGTGAGTGGTACTATACAAATTGTTGCTAGTGTGCCTGATATGTTTTTGCCTGCTTTTGA
CGTGTTTGTCAAAGCTGTGCAAACTGTTTTTGACTGTGCTGTTGAGACCAGTACTATTGCAGGTAAATCA
TTTGACAAGGTTTTTGACTATGTTTTGCTTGACAATGCACTTGTAAAACTTGTCACCATAAAGCTTAAGG
GCGTTCGCGCAAGTGGCCTTAAAACAGTTAAGTATGCAACAGCTGTTGTTGGTTCCACTGAAGAAGTTAA
ATCTTCACGTGTTGAACGTAGCACTGCTGTACTTACAATCGCCAATAACTACCCCAAACTTTCAGATGAG
GGGTATACTGCCGTAATTGGCGATGTGGCGTACTTTGTTAGTGATGGCTACTTCCGTCTTATGGCCAGTC
CAAATAGTGTGTTGACTACTGCAGTCTATAAACCATTGTTTGCTTTTAACGTGAATGTTATGGGTACTAG
ACCTGAAAAATTTCCAACCATTGTGACTTGTGAAAATTTAGAGTCTGCCGTTTTATTTGTTAATGACAAA
ATCACTGAATTTCAATTGGATTGCAGTGTTGATGTTATTGACAATGAAATAATTGTCAAACCTAACATCA
GCCTGTGTGTTCCACTTTATGTGAGAGACTATGTTGACAAATGGGATGATTTTTGCAGACAATATAGTAA
CGAGTCTTGGTTTGAAGATGATTATAGGGCTTTTATTAGCGTTTTGGATGTTGCTGACGCTGATGTTAAA
GCTGCAGAGTCTAAGGCTTTTATTGATACCATTATTCCATCTTGTCCTTCTATTTTGAAAATAATAGACG
GTGGCAAGATATGGAGTGGAATCATTAAGGCTGTTAGCTCTGTTGCAGACTGGCTTAAATCTTTGAAATT
AACTCTTACACCAGAGGGTCTGTTTGGTACTTGTGCTAAGCGTTTTAAACGGTTTTTAACCGTTCTTTTA
GACGCTTACAATGCATTTTTAGACACTGTGGCTTCTATTGTTAAGATTGGTGGTAAAGCTTTTAAAAAGT
ATGCATTTGACAAACCTTATATTGTGGTATGTGATATCGTGTGTAAGGTTGAGCATAAAACAGATGCTGA
CTGGGTTGAGCTTATGCCACGTAATGACAGAATTAAGTCTTTTAGTACTTTTGAAAATGCATACTTACCT
ATTGCTGACCCAACACATTTTGATATTGAAGAAGTTGAACTTCTTGATACGGAATTTGTTGAACCAGGTT
GTGGTGGTATTTTGGCATTGATAGATGATCATGTCTTTTATAAAAAGGATGACATTTATTACCCATCAAA
TGGTACTAAAATATTACCCGTTGCATTTACTAAAGCCGCCGGTGGTAAAGTTTCTTTCTCTGACGCAGTA
GAAGTTAAAGATATTCCACCTGTCTATAGAGTTAAACTTTGCTTTGAGTTTGAGGATGAAAAACTTGTGG
ATGTGTGTGAAAAGGCAATTGGCGAGAAAATTAAACATGAGGGTGACTGGGATAGTTTTTGTAAAACTAT
TCAATCAGCACTTTCTGTTGTTTCAAGTTATGTAAACCTACCTACATATTACATCTACGATGAGCAAGGC
GGCACTGATTTGAGTTTGCCTGTTATGATTTCTGAATGGCCTCTTTCCGAATCTGACAAGGAAGAGGAGG
TTCAACAAGAGCAACAAGAAGACACTGTGGTGCCTGAAGTTGAAGTCGTTGTTGACCAAGTTGAAGAAGT
TAATAGTAGTTTTGCTATTGAGGCAGTGGATGTTAAATATGAGGTGAGTCCTTTTGAAATGCCATTTGAA
GAGTTAAATGGTTTAAAAATACTCAAACAAATGGATAATAACTGCTGGGTTAACTCAGTTATGTTACAGC
TACAATTAACAGGCATACTCGATGATGACTATGCTATGCAGTTCTTTAAAATTGGCAGAGTTTCCAAGAT
GGTTGAACGCTGTTACAATGCTGAGCAATGCATACGCGGTGCCATGGGTGATGTAGGCCTTTGTTTGTAT
AGACTGCTTAAAGATTTGCACACTGGTTTTATGGTTATGGACTACAAATGTAGTTGTACCAGTGGTAGAC
TTGAAGAATCGGGTTCCGTCTTGTTTTGTACACCTACTAAGAAGGCGTTTCCCTATGGTACTTGTCTAAA
TTGTAATGCACCTCGTATGTGTACAATTAGGCAGTTGCAAGGTACTATAATATTTGTGCAACAAAACCCA
GAACCTGTTAATCCTTGTGCTTTTGTCGTTAAACCAGTTTGTGCATCAGTTTTCCGTGGTGCTGTGTCTA
GTGGCCATTACCAAATAAACATCTACCCACAAAAGTTATGTGTGGATGGTTTTGGTGTTAACAAGATCCA
GCCATGGCCAAATGATGCACTTAACACTATTTGTATTAGAGATGCAAATTATAGCGCAAAAGTTGAAAAA
CCTGTAACACCAGGTAAACCACCAGCTGAACTAGCACCTATAGATGAGACTGTTGTCAAGGTTAAGTTGA
ACTCTTTCCTTACTTGCAACAATGTTTCTTTTTATCAAGGTGACATTGATGCTGTTGTTAATGGTGTTGA
CTTTGACTTCATCGTGAATGCTGCCAATGAAAACCTTGCTCATGGTGGAGGACTTGCTAAAGCTTTAGAT
GTGTACACTAAAGGTAAACTTCAACGTTTATCTAAAGAACACATTGGATTAGCAGGTAAAGTAAAGGTTG
GCGCAGGTGTTATGGTTGAGTGTGATGGCCTGAGAATTTTTAATGTTGTTGGTCCACGCAAGGGTAAACA
TGAACGTGATTTACTCATAAAAGCTTACAACACTATTAACAATGAACAAGGCATACCTTTAACACCAATC
CTGAGCTGTGGTATTTTTGGTGTCAAACTTGAAACTTCATTAGAAGTTTTGCTTGCTGTTTGTAATACAA
AGGAAGTCAAAGTTTTTGTTTACACAGACACAGAGGTTTGTAAGGTTAAGGATTTTGTGTCTGGTTTAGT
GAAAGTTCAAAAAGTTGAGCAACCTAAAATAGAACCAAAATCAGTGTCCGTAACTAAAGTCGCACCCAAG
CCTTATAAGGTAGATGGTAAATTTAGTTACTTTACAGACGACTTGTTGTGTGTCGCTGTTGGCAAACCTA
TTGTTCTGTTTACTGATTCTATGCTCACTTTGGATGACCGTGGTTTAGCTTTAGACAATGCACTTAATGG
TGTGCTTAGTGCTGCTATTAAGGATTGTATAGACACAAATAAAGCTATACCTTCTGGTAATCTTATTAAG
TTTGACATAGAGTCTGTTGTTGTCTATATGTGCGTTGTGCCATCGGACCAGGACAAACACTTGGATAAGA
ATGTTCAACGGTGTACACGTAAGCTGAATAGACTTATGTGTGATATAGTTTGTACTATACCAGCTGAGCA
TGTCTTGCCATTATTGTTGTCTAGTTTGACTTGTAATGTTTCTTTTGTAGGTGAACTTAAAGCTGTTGAA
TCTAAAGTTATAACTATAAAGGTGACAGAGGATGGTGTTAATGTTCATGATGTGACTGTGACAACAGACA
AGTCATTTGAACAACAAGTTGGTGTTATTGCTGTTAAAGACAAAGATCTTTCTGGTGCAGTACCAAGCGA
TCTTAATACATCTGAGTTGCTTACTAAGGCAATAGATGTTGATTGGGTTGAATTTTATGGTTTCGGAGAC
GCTGTTACTTTTGCAACAGTTGATCATAGTGATTTTGCATATGATAGTGCTGTTGTTAATGGTTTCAGAG
TTTTGAAAACCAGTGATAATAATTGTTGGGTGAATGCTGTGTGTATTTCACTACAGTATTTGAAACCCCA
CTTTATTTCACAAGGTCTTGATGCTGCATGGAACAAATTTGTTTTAGGCGATGTTGAAACTTTTGTCGCA
TTTATTTACTATGTAGCAGGGTTAGTGAAAGGTGCTAAGGGTGATGCTGAAGATATTTTGAATAAGTTAT
CTAAGTATCTTGCTAATGAAGCCCAAGTTCAATTAGAACATTATAGTTCTTGTGTTGAATGTGAGGCTAC
ATTTAAAAACCCTGTTGCATCTGTTAATTCTGCTATAGTTTGTGCTAGTGTCAAACGTGATGGTGTGCAA
GTTGGTTATTGTGCCCATGGTATTAAGTACTATTCACGTGTTAGAAGTGTTAGCGGTAGAGCTATTATAT
TCAGTGTCGAACAGCTTGAACCATGTTCTCAGTCTAGACTTTTGAGTGGTGTTGCTTACACTGCTTTTTC
TGGACCTGCTGACAATGGTCATTATACTGTTTATGATACTGCAAAGAAATCAATGTATGATGGTGATCGT
TTTGTCAAACATGATCTTTCTCTGTTGTCTGTCACATCAGTTGTTATGGTTGGTGGTTATGTTGCACCTG
TTAAAACAGTGAAACCTAAACCAGTCATTAATCAACTTGATGAGAAGGCACAGAAGTTCTTTGATTTTGG
TGATTTTTTGGTTCATAATTTTGTTACTTTTTTCACATGGTTGTTGAGTATGTTTACTTTGTGTAAAACT
GCAGTAACTACATGTGATGTTAAAATAATGGCCAAAGCACCACAAAGGACGGGTGTTGTTTTAAAACGTA
GTCTTAAATATAACTTAAAAGCGTCAACAGCTGTTCTTAAATCTAAGTGGTGGCTGCTTGCTAAGTTTAT
GAAACTACTGTTACTCATTTACACGTTGTATTCAGTAGTTTTGCTTGGTGTACTTTTTGGACCGTTTAAT
CTTTGTAGTGAGACTGTTAATGGTTATGCTAAGTCAAACTTTGTCAAGGATGATTATTGTGATGGTTCAT
TGGGCTGCAAGATGTGTCTTTTTGGTTACCAGGAGTTAAGTCAATTTAGCCATTTAGATGTTGTGTGGAA
GCATATAACAGACCCTTTGTTTAGTAATATGCAACCTTTCATTGTAATGGTTTTGTTGCTTATATTTGGT
GACAATTATCTGAGATGCTTCTTGCTGTATTTTGTTGCTCAGATGATAAGCACAGTTGGTGTTTTTCTAG
GCTACAAGGAAACAAATTGGTTTTTGCACTTTGTTCCATTTGATGTTATTTGTGATGAACTACTTGTCAC
TGTTATTGTTATTAAGGTTATTTCTTTTGTCAGACATGTGCTTTTTGGTTGTGAAAACCCAGATTGCATT
GCGTGCTCTAAGAGTGCTAGACTTAAGAGATTCCCTGTTAACACAATTGTTAATGGTGTGCAACGTTCAT
TTTATGTTAATGCAAATGGTGGTAGTAAGTTTTGTAAGAAACATAGATTTTTCTGTGTTGACTGTGACTC
TTATGGTTATGGCAACACGTTTATAACACCTGAAGTTTCTAGAGAACTTGGTAATATTACCAAAACAAAT
GTGCAACCAACAGGCCCAGCTTATGTCATGGTTGACAAAGTGGAGTTTGAAAATGGTTTCTATAGATTGT
ATTCCGGTGAAACATTTTGGCGTTACAATTTTGATATAACTGAAAGCAAGTATTCTTGCAAAGAGGTTCT
TAAAAATTGTAATGTTTTGGATGATTTCATCGTGTTTAACAATAATGGAACCAATGTAACACAGGTTAAA
AATGCTAGTGTTTATTTTTCACAGTTGTTGTGCAGGCCTATTAAATTAGTTGACAGTGAACTTTTGTCTA
CTTTGTCAGTTGATTTTAATGGTGTCTTACATAAGGCATACATTGATGTGCTACGTAATAGTTTTGGTAA
AGATCTTAATGCTAATATGTCTTTAGCCGAGTGTAAGAGTGCTTTAGGCTTGTCTATTAGTGATCATGAA
TTTACTAGTGCTATTTCCAACGCACATCGTTGTGACGTTTTGTTGTCTGATTTGTCATTTAACAACTTTG
TCAGTTCGTATGCTAAACCTGATGAAAAATTATCAGCTTATGACTTGGCTTGTTGTATGCGTGCAGGTGC
TAAGGTTGTTAATGCCAACGTTTTGACAAAGGATCAAACTCCTATTGTTTGGCATGCAAAGGATTTTAAC
AGTCTTTCTGCTGAAGGTCGTAAGTATATTGTTAAAACTAGTAAAGCTAAGGGCTTGACTTTCTTGTTGA
CAATTAATGAAAACCAAGCTGTTACACAAATACCTGCAACTAGCATTGTTGCTAAGCAAGGTGCTGGTGA
TGCTGGCCATTCATCAACATGGTTGTGGCTACTTTGTGGTCTTGTGTGTTTGATTCAATTCTATTTGTGT
TTTTTCATGCCCTACTTTGATACCGTTCGTAGTTTTGAGGGTTATGATTTTAAATATATAGAAAATGGTC
AGTTGAAGAATTTTGAAGCTCCACTTAAATGTGTCAGAAATGTTTTTGAAAATTTTGAGGATTGGCATTA
TGCTAAGTTTGGCTTTATACCTTTAAACAAGCAAAGCTGTCCTATTGTAGTTGGAGTTTCTGAAATTGTT
AACACTGTTGCTGGTATTCCATCTAATGTGTATCTTGTTGGTAAAACTTTAATTTTTACACTACAAGCTG
CTTTTGGTAATGCTGGTGTTTGTTATGACATTTTTGGCGTCACAACACCTGAAAAGTGCATTTTTACTTC
TGCTTGTACTAGATTGGAAGGTTTGGGTGGTAACAATGTTTATTGTTATAACACAGATCTTATGGAAGGT
TCATTGCCTTACAGTTCAATACAAGCTAACGCATATTATAAATATGACAATGGTAATTTTATTAAGTTGC
CAGAAGTTATTGCACAAGGCTTTGGGTTTAGAACAGTGCGTACTATTGCTACCAAATATTGCCGTGTAGG
TGAGTGTGTTGACTCCAATGCAGGTGTGTGTTTTGGCTTTGACAAGTGGTTTGTTAATGATGGACGTGTT
GACAATGGTTATGTTTGTGGTACTGGTTTGTGGAACCTTGTATTTAACATACTTTCCATGTTTTCATCTT
CATTTTCTGTTGCTGCAATGTCAGGCCAAATTTTACTTAATTGTGCATTAGGTGCTTTCGCAATCTTTTG
TTGTTTTCTCGTGACAAAATTTAGACGTATGTTTGGTGATCTTTCTGTGGGTGTTTGCACTGTTGTTATG
GCTGTTCTGCTTAACAATGTTTCATACATTGTAACTCAGAACTTAGTAACAATGATTGCATATGCTGTGT
TGTACTTCTTTGCTACTAGAAGTTTGCGCTACGCATGGATTTGGTGTGCTGCATATTTAATTGCATACAT
ATCTTTTGCCCCATGGTGGCTGTGTGCTTGGTACTTTCTTGCTATGTTAACAGGTCTTTTACCTAGTTTG
TTGAAGCTTAAAGTCTCGACAAACCTTTTTGAGGGTGACAAATTTGTAGGTACATTTGAAAGTGCTGCTG
CAGGAACATTTGTTATTGACATGCGTTCTTATGAAAAACTTGCTAATAGCATCTCTCCAGAAAAGTTGAA
AAGTTATGCTGCTAGCTATAATAGATACAAGTATTATAGTGGTAATGCAAATGAAGCAGATTACCGTTGT
GCTTGTTATGCCTATTTAGCGAAAGCAATGTTGGACTTTTCGCGTGATCACAATGACATTTTGTACACAC
CTCCAACTGTCAGTTATGGTTCTACATTACAGGCAGGTTTGCGTAAAATGGCACAGCCATCTGGCATTGT
GGAAAAATGCGTTGTTCGCGTCTGTTATGGCAACACTGTGTTAAATGGTTTATGGCTWGGTGACATTGTT
TATTGTCCACGTCATGTTATTGCATCTAACACAACTGCTGCTATAGACTATGATCATGAGTATAGTATTA
TGCGTTTGCATAATTTTTCTATAAATTCTGGTACAGCATTTCTTGGTGTTGTAGGTGCTACTATGCATGG
AGCAACTCTTAAAATTAAAGTTTCACAGACTAACATGCACACACCTAGACATTCTTTTAAGACACTAAAA
TCTGGCGAAGGTTTTAACATCTTAGCTTGTTATGATGGTTGTGCCCAAGGTGTTTTCGGTGTGAACATGA
GGACCAATTGGACTATCCGAGGTTCATTTATTAATGGTGCATGTGGTTCTCCTGGCTATAATCTTAAAAA
TGGCGAAGTGGAATTTGTTTACATGCATCAGATTGAACTCGGAAGTGGTAGCCATGTAGGTTCTAGCTTT
GATGGTGTTATGTATGGTGGTTTTGAAGACCAACCTAACCTTCAAGTTGAATCTGCCAACCAGATGCTAA
CAGTTAATGTGGTCGCATTTCTTTATGCTGCTATATTGAATGGTTGCATATGGTGGCTCAAAGGTGATAA
ATTGTCTGTAGAACATTATAATGAGTGGGCACAGGCTAATGGTTTTACAGCCATGAATGGTGAAGATGCC
TTTTCCATTCTTGCTGCTAAAACTGGTGTCTGTGTTGAAAGATTACTCCATGCTATTCAAGTTTTGAATA
ATGGCTTTGGTGGTAAAAACATTTTGGGTTATTCTAGTCTTAATGATGAGTTCAATATTAATGAAGTTGT
CAAACAAATGTTTGGTGTTAACTTACAAAGTGGCAAGACCACTAGTATGTTTAAATCACTAAGTTTGTTT
GCTGGTTTCTTTATTATGTTCTGGGCTGAGTTGTTTGTTTATACCACCACTGTTTGGGTTAACCCTGGTT
TTCTCACTCCGTTTATGATTTTGCTTGTTGCTTTGTCACTCTGTCTTACATCTTTTGTTAAACATAAGGT
GTTGTTCCTTCAAGTGTTTTTGTTGCCATCAATTATTGTGGCTGCAATTCAGAACTGTGCTTGGGACTAC
CATGTAACAAAGGTATTGGCAGAGAAGTTTGACTACAATGTTTCTGTTATGCAAATGGACATCCAGGGTT
TTGTTAATATTTTTATTTGTTTGTTTGTTGCACTTTTGCATACTTGGCGCTTTGCTAAAGAGCGTTGTAC
GCATTGGTGCACTTACTTGTTCTCACTCCTTGCTGTTTTATACACTGCACTGTATAGTTATGATTATGTT
AGCTTGCTAGTTATGCTACTTTGCGCAATTTCTAATGAATGGTACATAGGTGCTATTATTTTTAGAATTT
GTCGTTTTGGTGTTGCATGTTTGCCAGTGGCATACGTGGCATACTTTGGTAGTGTTAAAACTGTGTTGTT
GTTTTATATGTTGTTAGGCTTTGTTAGCTGTATGTACTATGGTTTGTTGTACTGGATTAACAGATTCTGT
AAATGCACATTAGGTGTTTATGACTTTTGTGTTAGTCCAGCTGAATTTAAGTACATGGTTGCTAATGGCT
TGAATGCACCAGATGGCCCTTTTGATGCGCTATTTCTGTCGTTTAAACTAATGGGTATTGGCGGTCCTAG
AACTATTAAAGTTTCTACTGTACAATCTAAATTGACAGATCTTAAGTGCACAAACGTCGTTCTAATGGGC
ATTTTGTCTAATATGAACATAGCTTCTAACTCAAAGGAGTGGGCATATTGTGTTGAAACGCACAATAAAA
TAAACTTGTGTGATAACCCCGAAACTGCTCAGGAGCTGTTGCTGGCGTTGTTGGCATTTTTCTTGTCTAA
GCATAGTGATTTTGGTCTTGGCGATCTTGTCGATTCTTATTTTGAGAATGACTCCATTTTGCAAAGTGTT
GCATCGTCTTTTGTTGGTATGCCATCTTTTGTTGCATATGAAACAGCAAGACAAGAGTATGAAAATGCTG
TTGCAAATGGTTCTTCACCACAAATAATCAAACAATTGAAAAAGGCTATGAATGTTGCAAAAGCTGAGTT
TGACAGGGAATCATCTGTTCAAAGGAAAATTAATAGAATGGCTGAACAAGCTGCTGCAGCTATGTATAAA
GAAGCACGTGCAGTCAATAGAAAATCAAAGGTTGTTAGTGCCATGCATAGTTTACTCTTTGGCATGCTCC
GACGATTGGACATGTCTAGTGTTGATACTATTCTTAATATGGCACGTAATGGTGTTGTTCCTCTTTCTGT
TATCCCTGCCACTTCGGCATCCAAGCTCGTCGTCGTGGTGCCAGATCATGATTCATTTGCGAGAATGATG
GTAGATGGTTTTGTGCACTACGCTGGCGTTGTTTGGACATTACAAGAAGTTAAGGATAATGATGGTAAGA
ATGTGCATCTTAAAGATGTTACAAAGGAAAACCAGGAAACACTTGTTTGGCCTCTGATTTTGACTTGTGA
ACGCGTCGTTAAATTGCAGAACAATGAAATAATGCCGGGCAAGATGAAGGTTAAAGCCACCAAAGCTGAA
GGTGATGGAGGCATTACTAGTGAAGGTAATGCTCTATACAACAATGAAGGTGGACGTGCATTTATGTATG
CATATGTGACTACGAAGCCTGACATGAAGTATGTTAAATGGGAGCATGACTCTGGTGTGGTTACAGTTGA
ATTGGAACCACCTTGCAGATTTGTTGTAGAYACACCTACTGGACCTCAAATTAAGTATCTTTACTTTGTT
AAGAATCTTAACACTTTAAGGAGGGGTGCTGTTTTGGGTTACATAGGCGCTACTGTGAGATTGCAAGCTG
GTAAACAGACTGAGTTTGTTTCAAATTCCCATTTATTAACGCATTGTTCATTCGCTGTTGACCCAGCTGC
AGCTTATCTTGATGCTGTTAAACAAGGCGCAAAACCTGTTGGCAACTGTGTAAAGATGTTGACTAATGGT
TCTGGTAGTGGTCAGGCTATTACTAGTACTATTGACTCTAATACTACACAGGATACATATGGTGGCGCTT
CTGTTTGTATTTATTGCAGAGCACATGTTGCACATCCAACCATGGATGGTTTTTGTCAGTATAAAGGCAA
GTGGGTACAAGTGCCTATAGGTACAAATGACCCTATAAGATTTTGTCTTGAAAATACTGTTTGTAAAGTT
TGTGGTTGTTGGCTTAATCATGGCTGTACATGTGACCGGACTGCTATTCAAAGTTTTGATAACAGTTATT
TAAACGAGTCAGGGGCTCTAGTGCCGCTCGACTAGAGCCCTGCAATGGTACAGACATAGATTATTGTGTC
CGTGCATTTGACGTTTACAATAAAGATGCTTCTTTTATCGGCAAAAACTTGAAGTCCAATTGTGTGCGCT
TCAAGAACGCAGATAAGGATGATGCGTTTTATATTGTTAAACGTTGCATTAAGTCAGTTATGGACCACGA
GCAGTCCATGTATAACTTACTTAAAGGCTGTAATGCTGTTGCTAAGCATGATTTTTTCACTTGGCATGAA
GGCAGAACCATCTATGGTAACGTTAGTAGACAGGATCTTACTAAATACACCATGATGGACTTGTGCTTTG
CTCTGCGTAACTTTGATGAAAAAGACTGTGAAGTTCTTAAGGAGATACTGGTTCTTACTGGTTGTTGTGG
TACTGATTACTTCGAAATGAAGAATTGGTTTGACCCAGTAGAAAATGAGGACATACACCGTGTGTATGCT
GCTTTGGGTACAGTAGTCGCAAATGCAATGCTTAAGTGTGTTGCTCTTTGCGACGAAATGGTGCTTAGAG
GAGTTGTTGGTGTTTTGACCTTAGACAACCAAGATCTTAATGGGAATTTCTACGATTTTGGGGACTTTGT
TTTGTGTCCTCCTGGTATGGGAATACCCTATTGCACATCATATTATTCTTATATGATGCCTGTTATGGGT
ATGACCAATTGTCTAGCTAGTGAGTGTTTTATGAAAAGTGACATTTTTGGTCAAGACTTCAAAACTTATG
ATTTGTTGAAATATGATTTCACAGAGCATAAGGAGGTTTTGTTCAACAAGTATTTTAAGTATTGGGGACA
GGGTTACCATCCTGATTGTGTAGATTGTTATGATGAGATGTGTATTTTGCATTGTTCAAATTTTAACACA
CTCTTCGCAACCACAATTCCAAATACAGCTTTTGGACCCCTATGCAGAAAAGTGTTTATTGATGGTGTAC
CTGTTGTTGCTACTGCTGGTTACCATTTTAAACAACTAGGACTTGTGTGGAATAAAGATGTTAACACTCA
CTCTACTAGACTTACTATTACTGAACTTTTACAGTTCGTGACAGATCCTGCGCTTATAGTTGCGTCATCG
CCAGCTTTAGTGGATAAACGCACTGTATGCTTTTCTGTCGCAGCTCTGAGTACAGGGTTGACATCTCAAA
CAGTAAAACCTGGCCATTTTAATAAGGAGTTTTATGACTTCTTACGCTCTCAAGGGTTTTTCGATGAAGG
TTCAGAATTGACATTGAAGCACTTCTTTTTTACACAAAAGGGTGATGCTGCAATTAAAGATTTTGACTAT
TATCGGTATAACAGACCCACCATGCTAGATATTGGACAAGCACGTGTGGCATATCAAGTAGCATCTCGTT
ACTTTGACTGCTATGAAGGTGGTTGTATTACATCTAGAGAGGTGGTTGTTACTAACCTTAATAAGAGTGC
TGGTTGGCCACTTAATAAGTTTGGTAAAGCTGGTTTATATTATGAGTCTATTAGTTATGAAGAACAAGAC
GCTATGTTTGCGTTAACAAAGCGTAATATTCTCCCTACTATGACTCAGTTAAATCTCAAATACGCCATAT
CTGGTAAGGAGCGAGCACGTACAGTTGGTGGTGTCTCTTTGTTAGCTACTATGACTACTAGACAGTTTCA
TCAGAAATGTTTGAAATCTATAGTTGCTACTAGAAATGCCACCGTTGTTATCGGCACTACCAAATTCTAT
GGCGGTTGGGACAATATGCTAAAGAACTTGATTGCTGACGTTGACGATCCTAAGTTGATGGGCTGGGACT
ATCCTAAGTGTGATAGAGCTATGCCTTCAATGATTCGTATGCTGTCGGCCATGATTTTAGGTTCTAAACA
TGTTACATGTTGTACGGCTAGTGACAAATTCTATAGACTTAGTAATGAGCTTGCTCAAGTTTTAACCGAA
GTTGTTTACTCAAATGGTGGGTTTTATTTTAAACCTGGTGGTACAACTTCTGGTGATGCAACTACTGCTT
ATGCCAACTCTGTTTTTAATATATTTCAGGCTGTAAGTTCTAACATTAATCGCATTTTGAGCGTTAACTC
GTCAAATTGCAACAATCTTAATGTTAAGAAATTACAGAAACAACTTTATGACAATTGCTATAGAAATAGT
AATGTCGATGAGTCTTTTGTGGATGACTTCTACGGTTATTTACAAAAGCACTTTTCTATGATGATTCTTT
CTGATGATGGTGTTGTGTGCTATAATAAAATTTATGCTGAACTTGGTTACATTGCTGATATTAGTGCTTT
TAAAGCCACTTTATATTATCAGAATGGTGTATTCATGAGCACAGCTAAATGTTGGACTGAGGAAGACCTT
TCTGTAGGACCTCATGAATTTTGCTCACAGCACACTATGCAGATTGTAGATGAAAATGGTAAGTATTATC
TACCATACCCAGATCCTAGCCGTATTATTTCTGCTGGTGTTTTTGTGGATGACATTACCAAGACTGATGC
TGTCATTCTTTTAGAACGCTATGTTTCTCTGGCTATAGATGCATACCCATTGTCTAAACATCCTAAACCC
GAGTATAGGAAAGTGTTTTATGCACTGTTAGACTGGGTTAAATATCTCAATAAAACTCTTAATGAAGGTG
TTTTGGAGTCATTCTCTGTCACACTTTTAGATGAACAAGAGTCCAAGTTTTGGGATGAAAGCTTTTATGC
TAGCATGTATGAGAAGTCTACAGTACTACAAGCTGCTGGTCTTTGTGTAGTATGTGGCTCTCAAACAGTT
CTAAGATGCGGTGATTGTTTACGCAAACCGATGTTGTGCACTAAGTGTGCTTATGATCATGTGTTTGGCA
CTGATCATAAGTTCATTTTGGCTATTACACCTTATGTTTGTAACACATCTGGTTGCAATGTAAACGACGT
TACAAAACTGTATCTTGGAGGTTTGAATTATTACTGTGTAGATCACAAACCACATTTGTCATTCCCACTG
TGTTCAGCTGGTAATGTCTTTGGTTTGTACAAAAGTTCTGCTTTGGGTTCCATAGACGTTGATGTTTTTA
ATAAGCTTTCTACTTCTGATTGGTCTGACATTCGTGACTATAAGTTAGCTAATGAAGCTAAAGAGTCACT
AAGGCTATTTGCAGCTGAAACTGTCAAAGCTAAGGAGGAAAGTGTTAAGTCATCATATGCTTATGCCACC
CTAAAGGAGATTGTAGGTCCTAAGGAACTTTTGCTYTCATGGGAAAGTGGAAAAGCCAAACCACCGTTAA
ACCGTAATTCTGTATTTACTTGCTTCCAAATTACAAAGGACTCCAAGTTTCAAGTTGGTGAATTTGTGTT
TGAGAAAGTAGATTATGGTTCTGATACGGTGACGTACAAATCCACTGCCACTACTAAGTTAGTACCAGGT
ATGTTATTTATTTTGACTTCTCATAATGTTGCTCCACTTAGAGCACCAACTATGGCTAATCAGGAAAAAT
ATTCCACCATTTACAAGTTGCACCCATCATTTAATGTTAGTGATGCTTATGCAAACCTTGTACCTTACTA
CCAACTCATTGGTAAACAACGCATTACTACAATACAGGGTCCCCCTGGTAGTGGTAAGTCTCATTGTTCT
ATCGGTATTGGTGTGTATTATCCTGGAGCAAGAATTGTGTTCACAGCTTGTTCACATGCTGCTGTTGATT
CGTTGTGTGCAAAAGCTGCCACAGCTTACAGCGTTGACAAGTGTACACGTATTATTCCTGCACGTGCTAG
AGTTGAGTGTTATAGTGGTTTTAAACCTAATAATAATAGTGCACAATATGTGTTTAGTACTGTTAATGCG
CTACCTGAAGTTAACGCAGACATTGTTGTCGTAGATGAAGTGTCTATGTGCACTAACTATGATTTGTCTG
TGATTAACCAGCGTATATCATACAAACACATTGTGTATGTTGGTGATCCTCAACAGCTGCCAGCTCCTAG
AGTTCTTATCTCTAAAGGTGTTATGGAACCAATCGATTATAATGTTGTGACACAGCGTATGTGTGCTATA
GGACCTGATGTCTTTTTACACAAGTGTTACAGATGTCCTGCTGAAATAGTTAACACTGTTTCAGAGCTTG
TTTACGAAAACAAGTTTGTACCTGTCAAAGAAGCTAGTAAGCAGTGCTTCAAAATCTTTGAACGTGGTAG
TGTGCAGGTAGATAATGGTTCCAGTATAAATAGACGCCAACTTGATGTTGTTAAGCGATTTATACATAAA
AACCCTACATGGAGTAAAGCTGTATTTATTTCACCTTATAATAGTCAGAACTATGTAGCTGCTAGGCTTT
TAGGTTTACAAACTCAGACGGTGGATTCTGCTCAAGGCAGTGAATATGATTATGTAATATTYGCACAGAC
ATCAGATACTGCTCATGCTTGTAATGCCAATCGTTTTAACGTTGCCATTACTAGAGCAAAGAAAGGCATC
TTTTGTATTATGTCTGACAGAACTCTGTTTGATGCACTTAAATTCTTTGAAATCACTATGACAGATTTAC
AGTCTGAAAATAGTTGTGGTTTGTTTAAAGATTGTGCACGTAACCCCATTGATTTACCACCAAGTCATGC
TACTACTTATCTATCATTGTCTGATAGATTTAAGACTAGTGGTGATTTAGCTGTTCAGATAGGTAGCAAC
AATGTTTGCACTTATGAACATGTGATCTCATATATGGGTTTCAGGTTTGATGTTAGTATGCCTGGCAGTC
ATAGTTTGTTCTGTACTAGAGATTTTGCCATGCGTCATGTTAGAGGTTGGTTAGGAATGGATGTAGAAGG
TGCACATGTCACAGGTGATAATGTTGGCACTAATGTACCTCTACAAGTAGGGTTTTCCAATGGTGTGGAT
TTTGTAGCGCAACCTGAGGGTTGTGTTGTAACAAACACTGGTAGTGTTGTAAAACCTGTTCGTGCACGTG
CACCACCTGGTGAACAATTTACCCACCTTGTACCTCTGTTACGCAAGGGACAACCTTGGAGTGTTTTGAG
AAAACGTATTGTTCAAATGATAGCAGACTACCTTGCTGGTTCATCTGACGTACTGGTGTTTGTACTGTGG
GCTGGCGGTTTAGAGTTGACCACTATGCGTTATTTTGTCAAGATTGGAGCTGTTAAACATTGCCAATGTG
GTACTGTTGCAACATGCTACAACTCTGTTAGTAATGATTATTGTTGTTTTAAACATGCATTGGGCTGTGA
CTATGTTTACAATCCATATGTCATAGACATTCAACAATGGGGTTATGTTGGTTCACTCTCTATTAATCAC
CATGCCATTTGTAATGTTCATAGAAATGAGCATGTGGCTTCTGGTGACGCTATTATGACTAGATGTTTGG
CTGTGTATGACTGCTTTGTTAAGAATGTGGACTGGTCAATTACCTATCCTATGATAGCTAATGAAAAAGC
CATAAACAGGGGTGGTCGCACTGTGCAAAGTCATATCATGCGTGCTGCTATTAAATTGTACAACCCTAAA
GCAATTCATGATATTGGTAATCCTAAGGGTATTCGTTGTGCTGTAACTGATGCAAAGTGGTATTGTTACG
ACAAGGACCCTATTAATTCTAATGTGAAAACATTAGAGTACGATTACATGACACATGGCCAAATGGATGG
CTTGTGTTTGTTCTGGAATTGCAATGTGGATATGTACCCTGAATTCTCAATTGTTTGCAGGTTTGATACA
CGTACGCGCTCTACATTGAACCTTGAAGGCGTAAATGGGGGTTCGTTATACGTCAACAACCATGCATTCC
ACACTCCAGCTTATGATAAACGTGCTATGGCCAAGTTAAAACCAGCACCGTTTTTCTATTATGATGACGG
TCCATGTGAAGTTGTTCATGATCAAGTCAACTATGTTCCTTTGAGAGCCACTAATTGTATTACTAAGTGT
AATATTGGTGGTGCTGTATGTTCTAAGCATGCTAATCTTTATAGAGCATATGTGGAGTCATATAACACTT
TCACCCAAGCTGGCTTTAACATTTGGGTTCCTACCACGTTTGATTGTTATAATTTGTGGCAGACCTTTAC
AGAGGTTAACCTGCAAGGTTTGGAGAATATTGCTTTTAATGTTTTAAAAAAAGGTTCATTTGTCTGTGCT
GATGGTGAACTACCAGTAGCCATTAGTGGTGATAAAGTGTTCGTACGTGATGGTAACATTGACAATTTAG
TCTTTGTTAATAAGACATCACTGCCCACAAACATAGCATTTGAACTTTTCGCAAAGAGGAAGGTTGGTTT
AACACCACCCCTCAGTATTCTCAAAAACCTCGGTGTTGTTGCTACATATAAGTTTGTCTTGTGGGATTAT
GAAGCTGAGCGTCCCTTTACAAGTTTTACTAAGTCTGTTTGTGGTTATACAGACTTTACAGAGGATGTTT
GTACCTGCTACGATAATAGTATACAAGGTTCGTACGAACGTTTTACTCTGTCAAATAATGCTGTGTTATT
CTCTGCTACTGCTGTGAAAGCAGGTGGTAAAAGTTTGCCGGCTATTAAATTGAATTTTGGAATGCTTAAT
GGTAATGCCATTGCTACTGTCAAATCAGAAGATGGTAACATTAAAAATGTTAACTGGTTTGTTTATGTAC
GCAAAGATGGTAAGCCTGTTGATCATTATGACGGTTTTTACACTCAAGGTCGTAATTTACAAGACTTTTT
GCCTCGCAGCACAATGGAAGAAGACTTTTTGAATATGGATATAGGTGTATTTATTCAAAAGTATGGTCTC
GAAGATTTTAACTTTGAGCACGTTGTGTATGGTGATGTGTCAAAAACTACCCTAGGCGGTTTGCACTTGT
TGATCTCACAGGTACGTCTGAGTAAAATGGGCATCTTGAAGGCAGAAGAGTTTGTGTCAGCATCTGACAT
AACACTCAAATGTTGTACTGTGACCTATCTTAATGATCCTAGTTATAAGACTGTTTGCACTTACATGGAT
TTGTTGTTAGATGATTTTGTTGCTATATTGAAGTCTTTGGATTTGACCGTTGTATCTAAGGTTCATGAGG
TCATAATTGACAACAAACCGTGGAGATGGATGCTATGGTGTAAAGATAATGCCGTTGCTACATTCTATCC
TCAGTTACAGAGTGCAGAATGGAAATGCGGATATTCTATGCCTGGTATTTATAAGACACAACGTATGTGC
TTAGAACCATGTAATTTGTATAATTACGGTGCGGGTTTGAAGTTACCTAGTGGCATTATGTTCAATGTTG
TTAAATATACTCAATTGTGTCAATATCTCAACAGTACTACTTTATGCGTTCCTCATAATATGAGAGTGTT
ACACTTAGGTGCTGGTTCAGATTATGGTGTTGCACCAGGAACTGCCGTTCTTAAAAGATGGTTGCCACAT
GATGCAATTGTTGTTGATAATGATGTTGTTGACTATGTGAGTGATGCCGATTTCAGTGTTACTGGTGATT
GTGCAACCGTTTATTTGGAAGACAAGTTCGACTTGTTAATTTCTGATATGTACGATGGCAGGACAAAGGC
AATTGATGGTGAAAATGTTTCGAAAGAAGGATTTTTCACTTATATCAATGGTGTCATTTGTGAGAAACTT
GCCATCGGAGGATCGGTTGCCATTAAAGTAACAGAGTATAGCTGGAACAAGAAATTGTATGAACTTGTAC
AAAAATTTTCTTTTTGGACTATGTTCTGCACTTCTGTTAATACGTCATCATCAGAAGCCTTTGTTGTCGG
AATTAACTATCTTGGTGATTTCGCAAAAGGACCCTTTATAGATGGCAACATAATACATGCAAATTATGTG
TTCTGGCGTAACTCAACTGTTATGACTTTGTCCTACAATTCTGTTTTAGACTTGAGTAAGTTTAATTGCA
AACATAAAGCGACCGTTGTTGTGCAATTAAAGGATGGTGACATTAATGAAATGGTGCTTAGTCTTGTTAG
GAATGGTAAGTTGCTTGTAAGGGGTAATGGCAAGTGTTTGAGTTTTAGTAATCATTTAGTCTCAACTAAA
TAAAATGTTTGTACTTGTTGCATATGCCTTGTTGCATATTGCTGGTTGTCAAACTATAAATGTTCTGAAC
ACTAGTCACTCTGTTTGTAACGGCTGTGTTGGTTATTCAGAAAATGTATTTGCTGTTGAGAGTGGTGGTT
ATATACCCTCCGACTTTGCATTTAATAATTGGTTTCTCTTAACTAATACCTCATCTGTTGTAGACGGTGT
TGTGAGGAGTTTTCAGCCTTTGTTGCTTAATTGCTTATGGTCTGTTTCTGGYTCGCGGTTTACTACTGGT
TTTGTCTATTTTAATGGTACTGGGAGAGGTGATTGTAAAGGTTTTTCTTCAAATGTTTTGTCTGATGTCA
TACGTTACAACATCAATTTTGAAGAAAACCTTAGACGTGGAACCATTTTGTTTAAAACATCTTTTGGTGT
TGTTGTGTTTTATTGTACCAACAACACTTTAGTTTCAGGTGATGCTTACATACCATTTGGTACAGTTTTG
GGCAATTTTTATTGCTTTGTAAATACTACTATTGGCAATGAAACTACTTCTTCTTTTGTGGGTGCACTAC
CTAAGACAGTTCGTGAGTTTGTTATTTCACGCACAGGACATTTTTATATTAATGGCTATCGCTATTTTAC
TTTAGGTAATTTAGAAGCCGTTAATTTCAATGTCACTAATGCAGAAACCACTTTTTGTACTGTTGCGTTA
GCTTCTTATGCTGACGTTTTGGTTAATGTGTCACAAACCGCTATTGCTAATATAATTTATTGCAACTCTG
TTATTAACAGACTGAGATGTGACCAGTTGTCCTTTGATGTACCAGATGGTTTTTATTCCACAAGTCCTAT
TCAATCCGTTGAGCTACCTGTGTCTATTGTGTCGCTACCTGTTTATCACAAACATACGTTTATTGTGTTG
TATGTTGATTTTAAACCTCAGAGTGGCGCCGGCACGTGTTATAACTGTCGTCCTTCTGTTGTTAATATTA
CACTGGCCAATTTTAATGAAACTAAAGGGCCTTTGTGTGTTGAAACATCACACTTCACTACCAAATACGT
TGCTTCCAATGTTGGTAGGTGGAGTGCTAGTATTAACACGGGAAATTGCCCTTTTTCTTTTGGCAAAGTT
AATAACTTTGTTAAATTTGGCAGTGTATGTTTTTCACTAAAGGATATACCCGGTGGTTGCGCAATGCCTA
TAGTGGCTAATTTTGCTTATATTAATTCTTATACTATAGGCTCATTGTATGTTTCTTGGAGTGATGGTGA
TGGAATTACTGGCGTCCCAAAACCTGTTGAGGGTGTTAGTTCCTTTATGAATGTTACATTGAATAAATGT
ACTAAATATAATATTTATGATGTATCTGGTGTGGGTGTTATTCGCATTAGCAATGACACCTTTCTTAATG
GAATTACGTACACATCAACTTCAGGTAACCTTTTGGGTTTCAAAGATGTTACTAATGGTATCATCTACTC
TATCACTCCTTGTAACCCACCAGATCAGCTTGTTGTTTATCAGCAAGCTGTTGTTGGTGCTATGTTGTCT
GAAAATTCAAGTAGTTACGGCTTCTCTAATGTTGTGGAATTGCCTAACTTTTTCTACGCTTCTAATGGCA
CTTACAATTGCACAGATGCTGTTTTAACTTATTCTAGCTTTGGTGTTTGTGCAGATGGTTCTATAATTGC
TGTTCAACCACGCAATGTTTCTTATGATGGTGTCTCAGCGATTGTCACAGCTAATTTGTCTATACCTTCC
AATTGGACTACTTCAGTCCAGGTTGAGTATTTACAAATTACAAGCACACCTATTTTAGTGGATTGCTCCA
CTTATGTTTGCAATGGTAATGTGCGCTGTGTTGAATTGCTTAAGCAGTATACTTCTGCTTGTAAAACTAT
TGAAGATGCCTTAAGAATTAGTGCTATGCTGGAGTCTGCAGATGTTGGTGAGATGCTCACTTTTGACGAG
AAAGCGTTTACACTTGCTAATGTTAGTAGTTTTGGTGACTACAACCTTAGCAGTGTTATACCTAGCTTGC
CTACAAGTGGTAGTAGAGTAGCCGGTCGCAGTGCCATAGAAGACATACTTTTTAGTAAAGTTGTTACTTC
TGGACTTGGCACTGTGGACGCAGACTACAAAAAGTGCACTAAGGGTCTTTCCATTGCTGATTTGGCTTGT
GCTCAATATTATAATGGCATTATGGTTTTGCCTGGCGTTGCTGATGCTGAACGAATGGCCATGTACACAG
GTTCCTTAATTGGTGGCATTGCCTTAGGAGGTCTTACATCAGCCGCTGCAATACCATTTTCTTTAGCTCT
TCAGGCACGTTTGAACTATGTGGCATTGCAGACTGATGTTTTGCAAGAAAATCAGAAAATTCTTGCTGCA
TCTTTTAATAAAGCAATGACTAACATTGTCGATGCCTTTACAGGAGTTAATGATGCTATTACTCAAACTT
CACAAGCTATACAAACAGTTGCCACTGCACTTAATAAGATTCAGGATGTTGTGAATCAACAAGGCAATGC
ATTGAACCATCTAACTTCTCAGTTGAGGCAAAATTTTCAAGCTATTTCCAGTTCTATTCAGGCTATCTAT
GACAGACTTGACACTATTCAGGCTGATCAACAAGTAGATAGGCTTATTACTGGTAGACTGGCTGCTTTGA
ACGCATTTGTTGCTCAGACACTTACTAAGTATACTGAGGTGCGTGCTTCTAGACAGCTTGCACAACAAAA
AGTGAATGAATGTGTCAAATCCCAGTCTAACCGTTATGGTTTCTGTGGAAATGGCACACACATTTTCTCA
ATTGTGAATTCTGCTCCTGAAGGCCTTGTTTTTCTTCACACTGTCTTGTTGCCCACGCAATATAAGGATG
TTGAGGCGTGGTCCGGGCTTTGCGTTGATAATACAAACGGTTATGTGCTGCGACAACCTAATCTTGCTCT
TTACAAAGAAGGCAATTATTATAGAATCACATCACGTTTTATGTTTGAACCACGCATTCCTACTATGGCA
GATTTTGTCCAGATTGAAAATTGCAATGTCACATTTGTTAACATTTCTCGCTCTGAGTTGCAAACTATTG
TGCCAGAGTATATTGATGTTAACAAGACGCTGCAAGAATTAATTGACAAATTGCCAAATTATACTGTCCC
AGACCTAGGCATCGACCAGTACAACCAGACTATTTTGAATTTGACCAGTGAAATTAGCACCCTTGAAAAT
AAATCTGCGGAGCTTAATTACACTGTTCAAAGACTGCAAACTCTTATTGACAACATAAATAGCACTTTAG
TCGACTTAAAGTGGCTCAACCGGGTTGAGACTTATCTCAAGTGGCCGTGGTGGGTGTGGTTGTGCATTTC
AGTCGTGCTCATCTTTGTGGTGAGTGTTTTGCTATTATGTTGTTGCTCTACTGGTTGCTGTGGCTTCTTT
AGTTGTCTTGCATCTTCTACTAGAGGTTGTTGTGAGTCAACTAAACTTCCTTATTACGACGTTGAAAAGA
TTCACATACAGTAATGGCTCTAGGTTTGTTTACTCTGCAAATCGAGTCTGCTGTTAATCAATCGCTAAGC
AAGTCGAAAGTTAGTGCCGTAGTTTCGCGCCAGGTTATCCAGGATGTTAGAGCTGCCGCTGTCACTTTCA
ACTTGCTAGCTTATACACTAATGAGCCTCTTTGTTGTTTACTTTGCTTTTTTCAAAGCAAGATCTAATCG
AGGAAGAGTAGCTCTTATAGTGTTTAAAATTCTAATCCTCTTCGTTTATGTACCATTGCTGTATTGGTCT
CAAGCTTACATTGATGCGACGTTGATCGCTGTAATTTTGCTTGGAAGGTTTTTCCATACAGCTTGGTACT
GTTGGCTGTACAAAACATGGGATTTCATAGTCTTCAATGTAACCACACTTTGCTATGTGCAAGGCAAATG
TTGGTTTCTTGAAAATAAGGCTTTGAAACCATTTGTGTGCTTCTACGGAGGGGACCAATTTCTTTACATA
GGTGACAGAGTTGTTTCCTATGTCTCAACTAACGATTTATACGTTGCTCTTAGAGGACGTATTGACAGAG
ATCTTAGCCTTTCTAGAAAGGTTGATCTTTATAACGGTGAATGTGTATACTTTTTTTGTGAACACCCAGC
TGTCGGAATAGTTAATACAGATTTTAAATTGGAATTTGAAGATGTTTCTGAAGCTAGTGGATGATCATGC
TTTAGTTGTAAATGTAATACTGTGGTGCGTAGTACTTATAGTACTTTTGCTAGTTTGTATTACAATTATT
AAACTAATTAAATTATGTTTTACATGCCATATGTTTTGTAATAAAACGATTTATGGTCCCATTAAAAATG
TGTATCACATTTACCAATCATACATGCACATAGACCCTTTCCCYAGACAAATTATTGATGTCTAAACTAA
ACGACAATGACTGAAGCTAATATTACTCAGGAGGAGTTGGTAACTCACCTGAAAAATTGGAATTTTAGTT
GGAATATTATTCTAACTATTTTCATTGTCATTCTTCAGTTTGGCCATTATAAATACTCAAGAATCTTTTA
TGGTCTGAAGATGCTAGTTTTGTGGCTTTTGTGGCCACTTGTACTTGCACTTTCAATCTTTGACACTTGG
GCAAACTGGGGATCCAACTGGGCCTTTGTCGCATTCAGCCTTTTTATGGCCGTATCAACACTCATTATGT
GGGTGATGTATTTCGTAAATAGTTTCAGACTTTTCCGACGTGCTCGAACTTTTTGGGCATGGAATCCGGA
AGTGAATGCAATCACAGTCACAACCGTGCTGGGACAGACGTACTACCAACCCATTCAACAAGCTCCAACA
GGCATTACGGTGACCTTGTTGAGCGGCGTGCTTTACGTGGACGGACATAGATTGGCTTCAGGTGTTCAGG
TTCATAACCTACCTGAACACATGACAGTTGCCGTGCCGAGCACTACTATAATTTATAGTAGAGTCGGAAG
GTCCGTAAATTCACGAAACAGCACAGGCTGGGTTTTCTACGTACGAGTAAAACACGGTGACTTTTCTGCA
GTGAGCTCTCCTACGAGCAATATGACAGAAAACGAAAGATTGCTTCATTTGATCTAAACTGAACGAAAAG
ATGGCTACAGTCAACTGGGCTGATTCCTCTGAACCACAACGTGGTCGTCAGGGCAGAATACCTTATTCCC
TTTATAGCCCTTTGCTTGTTGATAGTGAACAACCTTGGAAGGTGATACCTCGTAATTTGGTACCCACCAA
CAAGAAAGATAAAAGCAAGCTTATAGGCTATTGGAATATTCAAAAACGTTTCAGAACTAGAAAGGGCAAA
CGGGTTGACTTGTCACCTAAGTTGCATTTCTATTATCTTGGCACAGGACCCCACAAAGATGCTAAATTCA
GAGAGCGCATTGAAGGTGTTGTCTGGGTTGCTGTTGATGGTGCTAAAACCGAACCTACTGGTTATGGTGT
TAGGCGCAAGAATTCAGATCCAGAAGAACCACTCTTCAGTCAAAGTCTTCCAAATGGTGTTACTGTTGTT
GAAGAACCTGACTCTCGTGCTCCTTCGCGTTCTCAGTCAAAGTCACAGAGCCGAGGTCGTGGTGAATTTA
AACCTCAGTCGCGCAATTCTTCAAGTGCAAGTCAGGACGACATTATTAAGGCAGTAGCTGCTGCTCTTAA
ATCTTTAGGTTTTGAAAAAGAGAAAGAGGCAGCGAAAAAGGGTACTCCTAAGCCTTCTAGAAATCAGAGT
CCTGCTTCTTTTCAGACTCGTGCCAAGAGCCCTGCTCGTCCTCAGAATTCTGAAACAAAAGAACAAAAGC
ATGAAATGCAAAAACCACGGTGGAAAAGACAGCCTAATGATGATTTGACATCTAATGTTACACAGTGTTT
TGGCCCCAGAGATCCTTACCACAACTTTGGAAGTGCAGGTGTTGTAGCTAATGGTGTCAAAGCCAAAGGC
TACCCACAATTTGCTGAACTTGTGCCTTCTACAGCTGCCATGCTGTTTGACAGTCACATTGACTCTAAGG
AGTCTGGCAATAATGTTGTTCTTACTTACACAACTAGGGTTACAGTGCCCAAGGACCACCCGCATTTGGG
CAAGTTCTTAGAGGAGTTAAATGCATTCACTAAGCCTCTACAAGGAGACATGCAACAACACCCTCTTCTT
AACCCTAGTGCACAAGAATTACAAACTTCACCTGGAACTGCTGAACCAGTCTACGATGCAGTTTCTATTG
AAACTGACATAATTGATGAAGTCAACTAAACATGCATCCAGAAGATGAACATGCCCCCCTATGGCAAGTT
TTGTTTGGAATGGTTTTAGTTGAGGGTTCTATTATTTGGCTAATGGCCACTGTGTTGTTTGAAATCATTC
AATTGTTAGTTGCTGCTAATTCAGATGGTTTGTATGTGTTTTTTAGTTGGAATTTTGCTTTTGTTCTTGC
TTTTATTATTTTTCTGCTGCCTGTTTCCAGAGAGATTTGGCGCCCTGGTGCCGTAGATGAGTATATTGCT
TTTCTCCGGTCTATGCATGATGGCATGATCAGAGCTGCTTTTAACTAACATGATCCCTTGCTTCGGCTTG
ATAAGGATCTAGTCTTATACACAATGGTAAGCCAGTAGTAGTAGAGGTATAAGAAATTTGCTACTATGTT
ACTGAACCTAGGTGAACACTAGTATAACTCATTACAAATGTGCTGGAGTAATTAAAGATCGCTTTGACGA
GCCAACAATGGAAGAGCCAGTCATTTGTATTGAGACCTATCTAGTTAGTAACTGCTAATGGAACGGTTTC
GATATGGATACACAAAAAAAAAAAA

>gi|531967705|ref|NC_022103.1| Bat coronavirus CDPHE15/USA/2006, complete genome
GTGGATCCCTCACTAGTTCCGTCTGGTGAGGTGCGTGGATAGTGTGTTCTGTCACACTTGAAGCCGACAA
CTGCTCAGTATGGCAAGCAATCATCTAACACTGGCTTTTGCCAGTGATATGGAAGTTTCAGCTATAGGCT
TTGGGTCCATTAATGAAGCCGTATCATTTTACAGTGATGCCGCCATTGATGGTTTTACCCAATGCCGTTT
TGTTGCTGCAGGTCTCGCTAACACTGTCGAGGGTGTTGAACCCTCTGACTTTGTTATGGTTGTGACAGGT
GTCACCCAATTGCGAGCCTACATTGACACTTTTGGTAGCCGGCCTGCTAATTTACGCGGCTGGTTGCTGT
TTTCTAATTCCAATTATTTCCTTAGTGAGATGGAGCTTATTTTTGGTCGCCGGGGTGGTAATACTATCTA
TGTTGACCAGTACCTTTGTGGTGCGGATGGTAAGCCTGTCGTCCCTGAGGAATTTTGGGACTTTAAGGAC
TATTTTGTTGATGATGATCAGGTTGTGGTTAATGGCACCACTTACATTAAGGCTTGGGTGGTTGAACGCG
CAAATGTTGCTTATGAAGCTCAGAATGTGACTGCTATCAATGGCATTACATATTGCGCTAAAATCCCTCA
TACTTTGCCTGACGGGAGTGTTGTCCGTGTGGCCCGTAAACCTAAGATCAAAAAGTCAATAGTTCTCTCA
GATGTTTACAAGCCTTTGTTAGAGGGCTTGGGTGCACCATTTGTTAAGAATGGTGATACACTTGCATCTA
TTCTTACTGAACCTGTGTTTTTGCATGCGCTTGTTAAGTGTACTTGTGGCAAAACCATGTGGACCGTTGG
TGACTGGAGTTGCTACAAGTCATTGTGTTGCGGTGTAGTTTGCAAACCACTTTGTAACGTTGCTGGCATT
GTTAATCCTGGTTCCGCTGTTGTCACCCGTACTGGATTAGGTTCTGGTATTAAGTACTACTGTGGCATGT
TCTTGCGTCACATTCTTGACGTCGATGGCGTTTCTGTGTGGCGTGTGATCAGATTACAGAGTGCAGGTGA
GACTGTGACTTCGACCAACTTTGAGGAGTTTGGTGATGTGTGCCCTATGGACACATGTCACTATTCTCTA
GATTCAAGGCTGGCTGTCATGTTCAAACTTAACCTGCTTTCAGGTGACTTTTGTGCTGAGGTGCGTCATG
CTATTGCTAGCGGTGTTTTCAGCGTTGGTAATTTCATTTGTGACGTTACTGACGATGTGCTTGGAAAACC
ATGGTTCTTGAAGAAACTTGGTGTTCTAGCAGATGCTGCCTGGACCGCTTTTGTTGCCAGTCTTCGTAAA
ATTAAAGTTATGAGTTCGCAGCTTGTGGATCTTGCTAAAGCATTAGCGTGTGCTAGTGTTTCTGTTATTA
ACAGGTGCTTGGTTCTTGCTGCTGATGTGCCTCCTATTTTCAAGGAGTGTTTTGCTAAGTTTGTCAGTGC
TATTGCAGCTCTGTTTAAGTCTACTTGTGACACTGTCAAGGTTGCACGTCATTCATATCCAAGGCTTTTT
GACTATGTTTTGCTTGATAATCATTTGGTGAAAATGGTTACTCAACGCATTACTGGTAAAAAGCAGGCTG
GATTGACTGAGGCTACATTTGCTGATGTAATTCTGGGTGCCACTACTAATGTGACATCAGACCGTACTGA
GGCTTGTAATGTTGGCCTTGTGCTTTGTGACTATGACGTGCCCGTTCTGAATACTGGATATACTGCCATT
ATTGGTGGTAAGGCCTTTTTCTGTAGTGAGGGTTACTATAGGTTTATGGCTACCCCCAATGTTGTGCTTG
ATGAACCTGTGTTTCGTGCAGCGGCAGAATTGAATCCAGTTTTTGAGTGCGAAAAGCCTGATGGTTTTCC
AGTTCTCGTTGCATCCGATGTGGCTGAACTCTGTGTTAAAGTTGATCAGCTCCTGCCCAACTATAGTACC
TCATACAAACGTTATGAGAGTGTTATACGTGGTGAGCAGTGCTTTATACGCTGTATTTACGATTTTAGAG
CACCATCATTTATTAGGAAAGGTGATGATGCTGAGAAATTTGTGAAACAGTGTGAAGTGCTTGTTAGCAA
CCCCTTGTTCTTTGAGTTTTATACTCAGGCGCATGAGGCTGTTGACCTTGATCAGTATGTTAATACAGCT
TGTACCTTAGAAGGTTTTTCGCATATGGCTCCTGCTGTACCCAAGCCACATCCTTTGTTTTTGCAAATTG
ATGGCGGTGCCATATGGCGAAGTGTTGTTCGCCGTGTGAGCGCCGTAGCAGATTTTGTCAGAAACCTTAA
GGTTAGTTTTGGTTTGGAGGGCATTATTGTCTCAGCAGCTAGGAAATTCAAACAATGGGCTAAACTTTTG
GCTCAGATGTATAATGAATTTCTTAACTCTGTTTCAGCTGCCATTCATATTGCAGGGGTTAAGTTTATAC
ATTATGCCACCACTGTGCCACAGCTTGCCTATAATGGTTGCCTCTATGCTCTTAAAAAGACATATGCTGC
AACTGTAGGACTTCAAACCGAAGAGGGTGTTGACGGCTTTTATGCTTTTGACCATTGTCAATTACCAGTA
ACTCCTAGGTTGCTGCAGGTTGAAGATGTCAATTTAGAAGAAGCTGATTTTAAACCCCCAGTAGGTGGTG
GTTGTGTGGCAGTGATTAATGGTTACTCATTTTATGTGGAAGGTGATTCTTATTACCCCACTGATTGTAG
TGCTATTCATTCACTGCGCTTTAGAAAGCTTGGTGGTGCTGGTGTTGCTTTTTCAGAAGATGTGGCAGTT
AAAACTATTGATCCTGTCTACAAGGTTCGACTCGATTTTGAATTCGAAGATGATTCAGTTGTTGCACTTT
GCAAGAAGACTATTGGCAAGTCCATTAAGTTTAATGGTACAGAATGGGACAAATTTGTCGCCATTTTGGA
AACTGCACTAGGTGTTCTTGCAAAGCATGTTACGTTGCCACCATACTTCATTTATGACGACCATGGTGGC
AAGAACTTATCACGCACTGTAGTGGTTTCACAATGGCCACCAGCTGATGTTGATGAGTCTTGTGATGACA
GTGACGATGATGATGACTCCGACCATGAAGCAGATGAAGAATCCTCTGCTGAGCATGATGATGATCCTGA
AAGTGCATCAACAGATGAACAGTTGATGGGCCAGGATACTGCACCTGATAGTGCATCGACAGATGAAAGT
CATGAGACCGAACCTAATGGTGTGTCTTTAGATGAAGATCTGTCTGCAAAACAGGAAGAGGCTCTAAATG
CTTTGGACAACGCCATTGGTAGTGCATCAGCTGCCACAGAAGAAGAAGAAGTTAATGATGCACTGTCCTT
TATGACCGAGTCATCACCAAAACCTTGTGAGCCTACTAGCGACACATTTGCATATCCTTTTAAGGATTAT
AATGGTGTCAAGGTGCTAGACCAACAAAGTAACAATTGCTGGGTTAACTCAACTTTACTCCAGTTGCAGT
TGCTTGGTGTCATCGGTGATGACTCCGCAATGGCATTGTTTAAAGTTGGTAGAGTTGGACCTATGGTTAA
GCGTTGCTACGAAGCTGTTGGCGCAATTAAAGGCTCTTTAGGCGACGTGTCTCAGTGTATGGAAGTTTTG
TTACGTGATGTCAAAACTCTTACTGTACACTGTGATACTGTTTGTGACTGTGGGTCTGGCGCTAAGACCT
TTGTTGGCTGTGCTTTTAGGTTTGAGCCTACGACGGAACCGTTTCCATATGGTTGTTGTCAGAATTGCAA
ACAGGTTTTATTGCATACCATTACTTCTATTAGTGGTACTGGTGTGTTTTGTCGTGAACCTACTCCTTTT
GACATCAGTGTTATGCCAATTCGACCATTGTGTGCTGCAAATTATGTTGGCGCTGTTGATGGTGGTCATT
ATATGACTAACATATATACCAACAATGTTGCGGTGGACGGTCATGGTGTACACGTGATTGCAAACACAGG
TCTTAACACTATTTGTGTTAAGGATGTGGATTGGTCTAGAGCTATTAAATATGAACCCGTTCGTGTTGAA
AAGCCTAAAAAGGATGTCAATCCAGAACCACCAGTTAAACCTTTGAATGCTAAAGTTGATGGTTTGAAAC
CATTTGTTAGTTACAAAGGTGTTGAGTTCTATCAGGGTGCTTTTAAGGACCTCCTTGATTTGCCATTTGA
CTTTGTTGTAAACGCAGCAAATGAGCAATTGTCCCATGGTGGTGGTGTTGCACGTGCTATAGATGAACAT
ACTGGTGGTGAACTGCAAAGTTTGTCTGACAGATATGTTAAAGCCGTAGGTCCTCTAAAGGTTGGCACAG
GTGCTTACATTAAATGCAAAGCATTTGATGTTTTTAATGTTGTAGGTCCACGCAAGGGTAAACATGCTAA
GGATTTGCTTGTCAAGTCTTATGACAGTGTCTTTAGTGTGCCTGGCGTGCCACTTATGCCATTATTGAGC
ATTGGTATATTTAGGGTACCCATTGAAGATTCTTTGAGTGCTCTATTTGCCTGTGTTGGAGATCGCGTTT
GCAAGTGTTTTTGTTATTTGGACGCTGAGCGTGACGCTATTCTGCAATATGTTGCTGGGCTTTCGGTTGT
CAACGAGGAGGAAGTTAAGCAGGAAACTGCTTTTACTCCTAGGCGTATGGAGGGCTCATGTAACTTTTAT
GACTGCAACCCTAAAGCATTGGTTGACAATGGTGTGACAAGGTTTGTTGTTTTTACCAAACCAAGTCTTG
ATTTTTGTGACACCACCAAAGTGCTAGACACCTACTTTAAAAGTTTGCTAACTAACCTTGTAAAGGATTA
TGTTAGCACTCTTAAGGGTAAGGTTGTGCCAGCTGGTAACTGTGTTACACTGCGTTGCACTGATAGTGTT
AGTGTTACATTTGTTGTTTTGCCTACAGATGATGACCCTAATTTTGAAACTAATGCAAAGCGTGCTTTTC
AAAAATGTCTTAAACTTAAAGGTACATGTGTTTATGCGACCACTGATGCCGATGTTTTGAGACGTATTGT
CAAGCACTCATGCTTTGGTTTTATCGCTAATGACAATGTTATTAGTGCAGTTTTCACGGATGGTCAATTT
AGGGTTGAAGTTACACAAGACCAGCGTACTTACAGTGTTAAATCCTTAGATGCTAGTAAAACAATGGGCG
AACAGTTGGGTACATGTAGTGTTGATAACACTAATGTCTCTGATCAGCGTCCAACTAGTGATATTTCTAA
GGTTACTGTTGCTCCTGCTGTTGATTGGGACGTGCATTATGGTTTTGTTGGCGCAGCTAGTTTTCATATT
TTGAATCATGAAGCATTCGAATATCCTAGCAGCGTGCAAAATGGTAAGCGTGTTCTTAAAACTAGTGACA
ACAATTGTTGGGTTAATGCTGTATGTTTACAACTACAGTTTGCTAATGCCAAATTTGTTGGAACTGGTCT
TCAAACATTGTGGGATGAGTACCTGGTTGGTAATGTTGCTGGCTTTGTACACTGGTTGTATTGGCTAGCA
GGCGTTCAGAAGGGGGATCCTGGTGATGCTGAGGACACTTTGAATTTAATTTCTAAGTTTCTTCAGTCTC
AGGGACACGTGGTTGTGGACCGCACTACAGTTGATTCTTGCTGTAGTTCCCAGCGCACACTTGTTACACC
AGTGGTTAATGGTAGTATTTTGCGCATGGGTGTTGATGATGGTGCGTGTAAACATGGTTCTACTTTTATA
AATAAGGTTGTCAGTATTAATGGTACTGTAATCTTAGTTAATGTTGGGCCACCAATCTCTAGTGCACCTA
CTTCTTTTATACAGGGTCTGTCTTATACATCATTCAACAACACAGTTGGAGGTGTTGGACATTACACTGT
ATATGATAGTACACAGCATGGCTTTTATGACGGTGATGTCTTTGTACGTGGTGAATTGGCTATGCAACCT
GTGACTGCTTTAGTTGCTAGACATAGTCATTATGTTGTTAAAGACCCTGTAAAGTCTTTTGAACAACGTG
CTTCTGCAGTTGTTGACAGTCTCAATTTTGCATCTGAGAAGTTTTTCACCTTTGGTGATTTTGTGTCACG
TAACGTCATAACAATGTTAGTGTGGTTCTTTAGTTTGCTTTCTTTGCTGCTGAAGTCTGTGCGTCGCAGA
GACTTTAGGGTTTTAGCAGGTGCACCAGAGCGTTCTGGTGTTATAATTAGTCGTAGCATTAAATATAATG
TTAGAGCATTACGCTACTTTATGAGGCTGAAAGCCAAGTGGGTTTGTATGTTTTTGAAGGCCTGTTTCAT
ATTGTATACATGTTATGCTACATGTTTTATGATTATTAGGTTTTCGTTTGTAAGTGACATCTTTTGTAGT
GGCTACGTTGATGGTTATGCTAATTCCTCATTTGACAAAAATGCATACTGTGATGGACAGTTGTGCAAGG
TATGTTTGTTTGGTTACGATGAACTAGCAGATTTTCCGCATACCACTGTTGTTTGGGAGCACTTAAAAGA
CCCATTTGTCATAAATGTCATACCCCTATTTTATCTTGGCTTCTTGGCAATATTTGGTGGAACTGTTACT
CGTATAATGGTTTTGTACTTTGTTAGCCAGTATGTTAACATGCTTGGTGCTTACCTTGGTGTACAAGATA
GTGTTTGGTTTTTGCAATTCTTTCCATTTGATGTTTTTGGAGATGAGATCGTCGTGCTATTTTTAGTAGT
ACGCGTGCTTATGTTTCTCAAACACGTGTTGTTTGGTTGCGATAAACCCTCGTGTCTGGCTTGCTCTAAG
AGCGCAAGGCTGAAGCGTGTTCCAGTTTCCACTATTGTTTCTGGTGCTAATAAGTCCTTCTATGTCAATG
CTAATGGTGGTACGTCCTTCTGTAAGAAGCATAATTTTTATTGTGTTAATTGTGACTCTTATGGTTTGGG
TTGTACTTTCATTAATGACGTTGTTGCAGCTGAAGTTGGAAATGTTACTAAGTTAAACGTCCAGGCAACA
GGTCCTGCCTTTGTTGAGGTTGACAAAGTCGAATTTAACAATGGCTTTTACTACTTGTATAGTGGTAATA
CCTTTTGGAAATACAATTATGACATTACTGATAGTCGTTATAGTTGTAAAGAAGCCCTGAAAACGTGTAA
CGTAGCTGCTGACTTCATAATTTGTAATAACACAGGCTCTAATATGGCGCAAGTAAAGAATGCTTGTGTT
TATTTTAGCCAATTGTTGTGTAAACCTATTAAGATTGTAGATTCTACACTTGTGTCAACTTTGGGTGTTG
ATTTTAGCACATCTATTCATAGTGCTTTTGTTGAAATCCTAACCGATAGTTTCGGCAAAGATCTTTCAAA
TTGCACTACTATGTCACAGTGTAGGGCTACACTTGGGTTTGATGACATTTCTGATGAGGACTTTACAGGT
GCCGTTGCTAATGCCCATAGATATGGCTTGCTTTTAACAGACATTTCATTTAATAACTTTATTACCTCCT
ATGCTAAGCCAGAGGAGAAGATGTCTGTACATGATTTGGCCATTTGTATGCGTAGCGGTGCTCGTGTTGC
TAATCACAACGTGCTTGTCAAGGAAAATGTTCCTGTTGTGTGGTCTGCTGAAGCATTTAACGCATTATCT
GAAGAGTCTCGCAAGTATGTTGTTAAGACTTCTAAGGTCAAGGGTTTGACTTTTATGTTGTCTTTTAACA
ATGTTCGGATGCACACAACTATACCATCTGTTGCCATTTCAGGTAAAAAGGGTGGTAGTACAGTTTCTGC
ATTTTTTAAAAACTTGCGTAAGATATTGTGGTGTTCATGTACCATTATTTTGTGCTTGTTCTTTGTTACG
TCGTTGTGGAACTTTGCAGAAAGTTACCACAGTGGTAGTGAGTTTGGTTATAAGTACATTGAGAATGGTG
CACTCAAAGACTTTTCAGGACCACTTGATTGTGTGCACAATATTTTTGATGACTTTATGGCCTGGCATCA
TGCTAAGTATGGTGTTCAACCTATTAATAGCAGGCGTTGTCCTATTGTTGTTGGCGTTGACGAAAACGTC
CGCACAATACCTGGTGTCTCTGCTGGTGTTATGCTTGTTGGTAAAACATTGGTTTTTGCCGTCAAGTCTG
TTTATAGTTCTGCAGGTCTATGTTATGATGAGTTTGGAGCGGCCGCACCTGAACAGTGTTTGTTCAATTC
CGCTTGTACGACGCTGAAAGGTCTAGGTGGTACTTCTACTTATTGTTACCGTAGTGGTCTGGTCAGTGAT
AGTGGTCTCTATAGAGATTTGCTGCATGACAGTCATTACTTTTTGCCTGATGGTAACTATGTTAAATTTC
CAGAGGTTATATCACGTGGTTTTGGTTTCAGGACAGTACGTACTGCTGCTACAACATACTGCCGTGTTGG
TCAATGTGTTGACTCTAAACAAGGTGTATGTTTTGGACTTGATAGGTTCTTGGTTTACAGTGCAGAGTCT
GGTTCTGACTTTGTTTGTGGTACAGGTCTTATGTCATTGTTGTACAACGTTTTTGGTATATTTACACGTT
CTATACCAGTTGTTGTACTTTCAGGTCAAATTATGTTCAACTGTGTTGTTGCATTTCTTGCTGTCTCTTG
CTGCTTTTTGTTTACTAAGTTTAAGAGGCTTTTTGGTGACATGTCTTTTGGTGTGTTCACTGTTTGCTGC
TGTGTCTTGGTAAACAACCTTTCCTATATAATAACTCAGAATTATATGGGTCTTGTTTTCTACACTGTTT
TGTATTTCTTCTCCACAAAGACCGTGCGTTATGCTTGGATTTGGCACATAGGTTACTTTGTTGCCTACTT
CCTTGTAGCACCATGGTGGCTTTTGGGTATGTTTCTTGCTTCTGCTTTGACAGAGTTTTTGCCGTCAATG
TTTAAACTTAAAGTTTCTACCCAACTGTTTGATGGAGAGAAATTTGTTGGTAGTTTTGAGACAGCTGCTA
TGGGTACTTTTGTTTTAGACATGCGTACCTATGAAAAACTTGTTAATTCAACTCCTGGTGATAAAATACG
TCAGTATGCAGCCACCTATAATAAATATAAATATTATAGTGGTGGCGCCAATGAGGCTGATTATAGATTG
GCATGTTTTGCACATCTAGCCAAAGCCATGATGGACTTTGGTTCAAACCACCAGGACATGTTGTACTCAC
CTCCTACTGTCAGTTATAATTCAACACTGCAAGCTGGGCTTAAAAAGATGGCACAACCTTCAGGTGTTGT
TGAGCGCTGTATAGTCCGTGTTAGTTACGGTAACATGGTGCTCAATGGCCTTTGGTTAGGTGACACAGTT
TACTGCCCAAGACATGTGTTGGCTGCATCCACTACTACTCATATTGACTATGAACATGCGCTTGCTATTA
TGAGGTTACATAATTTTTCTATATCTTATGGTAACACATTTTTAGGCGTTGTTGGTTGTTCTACGAAGGG
TGCACTTTTGCTTATTAAGGTTGGTCAAAATAATGTTCACACACCTGGTAGTTATACTTTTAGAACACTT
AAGCCTGGCGATTCATTTAACATCTTAGCATGTTATGATGGTACAGCTACTGGCGTTTATGGTGTTAATT
TGAGAACCAATCATACCATTAGAGGCTCTTTTATTAATGGAGCTTGTGGTTCACCAGGTTTTAACATACA
TGGTAGCACTGTAGAATTTTGTTATTTACATCAACTAGAGCTTGGCTCTGGTTGTCATGTGGGTAGCGAC
ATGAATGGTGCTATGTATGGTGGATATGAAGACCAACCCTCTTTCCAGATAGAAGGTGTTAGTAACCTTG
TATCTGAGAATGTTGTAGCATTTCTTTATGGTGCATTGCTTAATGGATGTAATTGGTGGTTAGACCAGTG
TGGTGTTACTGTTGAGGCCTATAATGATTGGGCTCATAGTAATGGCTGTACTAGTTTATCAAGTACAGAT
TGTTTCACAATATTGGCAGCTAAGACTGGTGTCGAGGTGTCAAGAGTGTTGGCAGCTATACAGCGTCTTA
ATGTCAATTTTGGTGGCAAAGCTATACTTGGTTACACATCTTTAACTGACGAGTTTACTGTTGGTGAGAT
AATTAAGCAGATGTTTGGTGTTAACCTGCAAAGTGGTATTATAAGCCGTTCGGTGCGTAATGTGCTTTTA
GTCGGCTTATTTGTTTTACTGTTTTGGTCAGAGTTAGTTATTTATACACCATTTTTCTGGGTTTCTCCAG
CTTATATTACACCATTGTTTTTGATTGTCAGTGGTGTTTCTATCTTGTGCATGAGTCTTTTGAAGCATAA
AACATTGTTTTTGCAAATGTTTTTGATTCCAGCTGTTATTGCAGTGTCTGCTTACAATCTGGCATATGAT
TTGGAGATACGCACGTGGATGGCTACTAAGCTGGATTATCATGCCTCTATTCTTAGCTTTAACATTCAGG
GTATATTTAACATTATGGTGTGTTGTGTTGTTGTTTGTCTCCATGCATACCGTTGTGTTACTAGATCATC
ATCTGTTTTCACTATGGTTGTGGCGTGCGTAACGTCGTGCTATAGTTATGTTATATGTGGTGATGCCCTA
AGTGCTGCAATGGCTATTATGCTCAACATCACTGGTAATTGGTTTGTTGGTGCAGGTGCTTATAGGTTGG
CAACATATATTGTCTTACTAAACCCTGCACTACCTGCTCTTGTCGGTGATGTTAAGGCTATAGTCTTTGT
GTACGTTGCTGTTGGCTATGTTTGTTGTGTGTTTTATGGTATTTTGTACTGGGTTAACAGGTTTTGTAAA
CTTTCACTTGGTGTTTACGATTTTATGGTTAGCCCAGCTGAATTTAAGTACATGGTCGCTAATGGCTTAA
GAGCTCCTACTGGTGCATTTGATTCACTATTTTTGTCTGCACGTTTGCTTGGTATTGGTGGTCAGCGTAC
CATTAAGATATCAACAGTGCAGTCCAAACTTACTGATGTTAAGTGTACCAATGTGGTTCTAATGGGCTGT
TTGTCTAGCATGAACATTCAGGCTAACTCTGCTGAGTGGAATTATTGTGTTGATTTGCACAATAAAATAA
ACTTGTGTAATGATTTAGAACGTGCACAAGAGTATCTTTTGGCATTGTTGGCATTTTTCTTGTCAAAGAA
TAGTGCCTTTGGCTTAGATGATCTTTTGGACTCTTATTTTGACAATAACACTGTGCTTCAGGCTGTTGCT
ACTACATATGCTAACATGCCATCATACATTATGTATGAGAATGCAAGACAGGCATATGAGGAAGCAATTT
CAAACCGTTCCTCACCCCAGTTAATTAAGCAACTTAAGCATGCTATGAACAGGGCTAAGGGGGAGTTTGA
CCATGAGGCTGCAACTCAGCGTAAGATTGATCGTATGGCTGAACAAGCAGCTGCGCAGATGTTTAAGGAA
GCTAGAGCTGTGAATAAAAAGTCAAAGGTCACTAGTGCTATGCATGCCATGTTATTCAGTATGTTGCGTC
GTTTGGATATGTCTAGTGTTGACATTATCCTCAACCTCGCTAGAAATGGCACCGTTCCATTATCCATAAT
ACCTGCTTTGTGTGCTACTAGGTTGTCAATTATTGTCAGTGACTTTGAGTCATATGCCAAACTGTTTAGA
GAAGGTTGTATACATTATGCCGGTACTATATGGTCTGTTGCTGACATTAAGAACAACGATGGTAAACCAG
TACATCAGAAGGAAGTGACGTCTTCTAATGCTGAGAACTTGAGTTGGCCATTGTGTATTAATGCAGAACG
TATAGTTAAGTTACAGAATAACGAAGTTATGCCTGGTAAGCTTAAACAGCGTTCTGTTAAAGCAGAAGGT
GACGGTGTCATGGCTGAGGGCAAGGCGCTTTACAATACTGAGAATGGACGTACTTTTATGTACGCATTTC
TTGCAGACAAACCTGATCTTAAGGTCGTAAAATGGGAGTCTGATGACGGTGTTAAGGTCATAGAATTGGA
ACCACCTTGTAAGTTTTTGGTGGACACACCCAACGGACCACATGTAAAATTTTTGTACTTTGTGCGGAAT
CTTAACACACTTCGACGTGGTGCTGTTCTCGGTTTCGTTGGTGCAACAGTAAGATTACAGGCAGGTAAGC
AAACTGAGCAAGTTATGAATTCTTCTCTATTGACTATGTGTGCCTTTTCTACTGATCCAGCTAAGACATA
TCTTGATGCAGTTAAGAGTGGTGTTAAGCCAATTGGTAACTGTGTTAAAATGTTGGCTAATGGTGCTGGT
AACGGACAGGCTATCACTAATGGTGTTGAGGCTAATACTAGTCAAGACTCATATGGTGGTGCGTCTGTTT
GTCTGTGGTGTAGAGCTTATGTTGAACATCCAGCTATGGATGGCTTTTGTAAGTATAGAGGCAAGTATGT
CCAGGTACCTATTGGAACTGTCGATCCTATTAGGTATTGTCTTGAGAATGAGGTTTGTAAAGTTTGTGGA
TGCTGGTTGAATAACGGTTGTTCTTGTGATAGGACATCTATTGTCCAAAGCTTTGACAGCAGTTATTTAA
ACGAGCAAGGGGCTCTAGTGCAGCTCGACTAGAGCCCTGTAATGGCACTGATACTGATCATGTGTATCGT
GCTTTTGATATTTATAACAAGGATGTCGCATGTATAGGTCAGTTTCTTAAGGTGAACTGCGTTCGTTTTA
GGAATACTGACATGCATGACGCATTTTATGTTATAAAGCGCTGTACTAAGTCTGTCATGGATCACGAGCA
GTCCATATATGACAAACTTGCAAAATGTGATGCAGTTGCAAAACATGATTTCTTCACCTGGAAGGAAGGT
AGGTCAATCTATGGTAATGTTTGTAGGTGTAATCTTACAAAATATACCATGATGGATCTCTGTTTTGCAT
TGCGTAATTTTGATGAGCGTAACTGTCAAACCCTTAAAGAGATTTTAGTCTTGACTGGTGCCTGTGATGA
ATCTTATTTTGAAAATAAACTCTGGTTCGACCCTGTTGAGAATGAGGACATACACCGTGTTTATGCCAAG
TTAGGCGTCGTAGTGGCACGTGCTATGCTTAATTGTGTGAAGCTTTGTGATGCTATGGTCAAAGCTGGCA
TAGTGGGTGTTTTGACGCTTGACAATCAAGACCTTAATGGTAAGTTCTATGATTTTGGTGACTTTGTCCC
TAGTCTTGAGGGTATGGGTGTGCCATTATGTACCTCTTATTACTCTTATATGATGCCTATAATGGGTATG
ACTAATTGTTTGGCATCAGAGTGTTTTATGAAAAGTGACATTTTTGGTGAGGATTTTAAATCCTATGATT
TGTTGGAATATGATTTTACTGCCCATAAACAGTCTCTGTTTGAGAAGTATTTTAAATACTGGGGCCAAGA
GTATCATCCCAACTGTGTGGATTGTCATGATGATTTATGTGTGGTACACTGTGCAAATTTTAATACATTG
TTTTCTACAACAATACCTAACACTGCCTTTGGACCACTTTGTAGAAAGTGTTGGATTGATGGTGTTCCAC
TTGTTACCACAGCTGGTTATCATTTTAAACAGCTTGGTATAGTGTGGAACAAAGATTTCAACACACACTC
TACTAGATTGACAATAAATGACTTACTGCGGTTTGTTACTGACCCAGCACTTCTTGTTGCATCCTCACCT
GCACTTGTTGACCAACGTACCGTTTGCTTTTCTGTTGCGGCACTTAGTACTGGTCTAGTCAATCAAACTG
TTAAACCAGGCCATTTTAATGAGGAGTTTTATAACTTCCTTAGAGGCCATGGTTTCTTTGAAGAGGGGTC
TGAGTTGACACTTAAGCATTTCTTCTTTGCTCAGAAAGGTGATGCGGCTGTTAAAGACTTCGATTTTTAC
CGCTATAATAAGACCACCATGCTAGACATTTGTCAAGCACGCGTTGTTTATAAGCTAGTTTCTAGATACT
TTGAGATCTATGAAGGTGGCTGTATAACTGCGAAGGAGGTGGTTGTTACCAATTTGAATAAGAGTGCTGG
TTGGCCTCTTAACAAAATTGGTAAAGCAGGTACTTATTATGAGTCTTTGTCATATGAGGAACAGGATGAG
TTGTATGCGCTCACAAAGCGTAATATACTCCCTACTATGACTCAGCTCAACTTAAAGTACGCCATCAGCG
GTAAAGAAAGAGCACGTACTGTCGGAGGTGTCGCATTGTTATCAACTATGACCACTAGGCAGTTCCATCA
GAAGCATCTTAAATCCATCGTTAATACTAGGGGTGCCAGTGTTGTCATTGGCACAACTAAGTTTTATGGT
GGTTGGGATGCCATGCTTAAGACTCTTATACATGGTGTTGAAAATCCTCATCTAATGGGGTGGGACTATC
CGAAGTGTGATAGAGCTCTACCCAATATGGTACGGATGATTTCTGCTATGATATTGGGTTCTAAGCATGT
TACATGTTGTACTGCTAGTGATAGGTTTTTCAGATTGGCTAATGAGCTAGCACAGGTTTTGACTGAGGTT
GTCTACTCTAATGGTGGTTTTTATCTCAAACCTGGTGGCACAACTTCTGGTGATGCTACTACAGCATATG
CCAATTCTGTTTTTAACATCTTTCAGGCTGTCAGTGCTAATGTGAATCGGTTACTAAGAGTTGATAGTAA
TCTGTGCAATAATCTCGACGTAAGAGACCTACAACGTAGACTCTATGAGTGTTGTTATAGGTCTTCTACT
GTAGATGATAATTTTGTTAATGATTACTATGGTTTTCTTAGGAAGCATTTTTCTATGATGATATTATCAG
ACGATGGTGTTGTTTGCCATAACAGCGAGTATGCTCAGCTTGGTTATGTAGCAGATCTTAATGCCTTCAA
GTCTGTGCTATATTATCAGAATAATGTGTTTATGAGTGAGTCTAAATGTTGGGTTGAACCCGATGTTAAT
AAAGGACCTCATGAGTTTTGCTCACAGCACACTATGCAGATAACTGATAAGGATGGTTCTTACTTTCTGC
CTTATCCAGATCCCTCTAGAATTTTGTCAGCAGGCGTTTTTGTGGACGATGTTGTTAAGACAGACCCTGT
CATTCTTTTAGAGCGTTATGTTTCATTGGCTATAGATGCCTACCCTTTGTCCAAACATGAAAACCCTGAG
TATCAGCGTGTCTTCTATGTATTATTGGACTGGGTTAAACATCTTAATAAAACTTTAAACCAAGGCGTAT
TAGATGCGTTCTCTATCGAAATGCTAGAGGACTCAACTTGTAAGTTTTGGGATGAAAAGTTTTATTCTAA
CATGTATGAACGCTCTGCAGTTTTGCAGTCGGCAGGTCTGTGTGTTGTTTGTTCGTCTCAAACTGTATTA
CGGTGTGGTGACTGTCTACGTAGGCCTATGCTTTGTACTAAATGTGCATATGATCATGTGGTTTCTACCA
GTCATAAGTTTATATTGGCTATAACACCGTATGTTTGTTGTGCTACTGGCTGTGGTGTTAATGACGTTAC
CAAGCTCTACCTTGGTGGTTTGAGTTATTGGTGTATAGACCACAAACCTAGGTTAGCCTTTCCATTATGT
TCTGCTGGCAATGTTTTTGGTTTGTACAAAAATTCTGCAGTTGGTTCACCTGATGTGGACCAATTTAACC
AACTAGCTACTTCTGACTGGACTGATGTTCGTGATTACAAATTAGCCAATGATGTCAAGGACTCATTGCG
TTTGTTTGCAGCAGAAACTATTAAGGCTAGTGAGGAAAATATTAAGTCTTCTTATGCCTGTGCTACAATC
AGGGAAGTTATTGGTCCTAAAGAGCTTATTTTAAGTTGGGAGGCTGGTAAGACAAAGCCTGCTCTTAATC
GTAACTCAGTCTTTACTGGTTTTCATATTACTAAGAATATGAAGTCTCAGATAGGCGAGTTTACGTTTGA
GAAGTCTGACTATGATAGTGATGCTGTCATATACAAGTCTACCACCACGGTTAAATTACAACCTGGTATG
GTCTTTGTGTTGACATCTCACAATGTTCAGTCTTTACGTGCCCCAACTATTGCCAATCAGGAACGTTATG
CTAACCTTGTTAAGTTGAGGCCTGCTTTTAACGTACCTCCTGATTACGCTAATCTTGTGGCCTATTATCA
AATGATAGGTCACCAGAAGATTACCACAATCCAAGGTCCTCCTGGTAGTGGTAAATCTCATTGCGTTATT
GGCTTAGGATTGTACTACCCTGGTGCTAGAATCGTTTATACTGCATGTTCTCATGCTGCAGTTGATTCTT
TGTGTTGCAAGGCAGCCACTGCTTTTAGTGCCGATAGGTGTTCCAGAATTATACCTCAACGTGCTCGTGT
GGAGTGTTATTCGGGTTTTAAACCTAATAACACTACTGCACAGTACATATTTTCTACTGTTAATGCATTG
CCTGAGTGTGCCACTGATATCGTCGTTGTTGATGAAGTTTCAATGTGCACTAATTATGAGCTTTCTATAA
TTAACCAACGTGTTAGTTATAAGCACATAGTGTATGTTGGTGACCCACAACAATTGCCAGCACCACGCAT
AATGATAACGCGTGGTGTGCTGGAACCTAGCGATTATAATGTTGTCACCCAGCGCATGTGTGCTATTAAG
CCTGACATTTTCTTGCATAAGTGTTATCGCTGTCCTGCTGAGATTGTTGACACTGTTTCTGAGATGGTTT
ATGAAAACCAGTTCAAACCTGTTAACAAAGCAAGCAAACAGTGCTTCAAAATCATGTGTAAGGGTAATGT
CATGGTAGATAATGGTTCAAGTATTAACAGGAGGCAGCTGGAGGTTGTTAAAATGTTTTTGGCAAAGAAT
CCTAGTTGGCGTAATGCTGTTTTTATTTCACCCTACAATAGTCAGAATTATGTGGCTAGTCGTTCCCTTG
GTCTCCAGATACAGACTGTTGATTCATCACAGGGTAGTGAGTATGATTATGTCATATTTACCCAGACTTC
TGATACAGCACATGCTAGTAACGTTAACAGGTTTAATGTTGCTATCACTAGAGCTAAGAAGGGTATTTTG
TGTGTTATGTGTGACAAAAATCTTTATGATTTGCTTAAGTTTTATGAGCTTAAGTTGTCTGATTTACAAG
CACAAACTGATGGTTGCGGTCTGTTTAAGGATTGTAGTAGGCGCGACGACATGTTACCACCTTCACATGC
TTCTACTTATATGGCACTTTCTGACAATTTTAAGACAGACAAAGAATTGGCTGTCCAAATTGGTGTGAAT
GGTCCAATTAAGTATGAGCATGTTGTTTCATTCATGGGCTTCAGATTCGATGTTAACATACCTAACAATC
ATACACTGTTTTGTACACGTGACTTTGCAATAAGGCACGTGCGTGGTTGGCTTGGTTTTGATGTCGAAGG
AGCACATGTAGTTGGTGAAAATGTCGGTACAAATGTGCCACTACAACTTGGGTTTTCTAATGGTATTGAC
TTTGTTGTCAGACCAGAAGGGTGTGTTGTTACTGATACTGGTAGTGCTATTGTTCCTGTTAAAGCTCGTG
CACCACCTGGTGAACAATTTGCGCACTTGGTGCCATTGCTTAGGAAGGGTCAGCCATGGAGTGTTGTCAG
GAAACGCATCGTTCAGATGTGTTGTGACCATTTCATTAATTTGTCTGACATTGTAGTGTTTGTTTTATGG
TCTGGAGGCCTTGAATTGACAACAATGCGCTACTTTGTTAAGGTTGGTCCCATTAAGCACTGCGAGTGTG
GCAAGTTAGCGACTTGCTATAACAGTGTGTCACACTCTTTCTATTGTTTTACTCATGCATTTGGTTGTGA
TTACCTGTATAACCCTTACTGTATTGATATACAGCAGTGGGGTTACACTGGTTCACTTAGTAGTAACCAC
CATCAGCATTGCAATCTGCATCGTAATGAACATGTGGCATCTGGTGATGCTATCATGACGCGCTGTTTGG
CCATTTATGACTGCTTTGTTAAAAACGTTGATTGGTCTGTGACATATCCTTTCATAGCCAATGAAAACTT
AATTAACAAAAGTGGTCGTATGGTACAGTCCCATGTGATGCGGGCTGCACTAGCGTTGTATAAACCTAAG
GCCATCCATGATATTGGTAATCCTAAGGGTATACGCTGTGCAGTTACTGATGTCAGCTGGTATTGTTATG
ACAAACAACCTCTTAACAATAATGTTAAGACTCTAGAATATGACTACATTACACATGGTCAGTTTGATGG
TTTGTGTCTGTTTTGGAATTGTAATGTGGATATGTATCCAGAGTTTTCAATTGTTTGTCGCTTTGATACT
AGACAACGTTCCCTGTTAAATTTAGAAGGCTGTAATGGTGGTTCTCTTTATGTTAACAACCATGCTTTTC
ATACGCCAGCTTTTGATAAGCGAGCATTTGCTAAGCTTAAAGCCATGCCTTTCTTTTACTATGACACTTC
TGACTGCGATAAGTTGCATGACTCTATTAATTATGTACCACTTAAAGCATCTAATTGCATTACTAGGTGC
AATGTTGGTGGTGCTGTGTGTAGTAGGCATGCTGATCAGTATCATAGTTACGTTGCAGCGTACAATAATT
TTACACAGGCTGGTTTCACCATTTGGGTACCTCAAAATTTTGACCTCTACAACTTGTGGCAAACACTTGC
TAAGCCTAATTTACAAGGTTTGGAAAATATTGCCTTTAATGTTGTTAAGAAGGGTTCTTTTGTAGGTGCT
GAAGGTGAATTACCTGTTGCTATTGTTGGTGATAAAGTTCTTGTTCGTGAGAACGATGTTGATAACCTCG
TGTTCACAAATAAGACATCTCTACCTACCAATGTGGCATTTGAATTGTATGCAAAGCGAAAGGTTGGTTT
GACTCCACCTCTTACCATATTACGCAACTTGGGTGTGGTTCGCACTTATAAGTTTGTGTTGTGGGATTAT
GAGGCAGAGAGACCATTTACGTCTTATACTAAGGACGTTTGCAAGTATACAGATTTTGATGCTGGCGTTT
GCACATGTTATGATAATAGTGTGCAAGGTTCATTTGAACGTTTTACATTGGACCCTGATGCGGTACTCAT
TTCACTCACTGCTGTTAAAAAGTTGACACCCATTAAAATTAGTTATGGCTATCTTAATGGTGTCGCTGTT
TCACAGCATGAGAAGAAACCTCTTACTTGGTACATATATACCAGGAAAGGTGGCAAGTTTGATGATTACC
CAGAGGGTTTTTACACTCAGGGCCGTACTTCTGCTGATTTTAAGCCTCGTAGTACCATGGAGGAAGATTT
CCTTAATATGGACACTGGACTCTTTATATCTAAATATGGCCTTGAGGATTATGCTTTTGAGCATGTGGTC
TATGGTGACATCTCCAAAACAACCCTTGGTGGGTTACATTTGTTGATATCACAAGTTAGACTGTCTAAAT
TAGGCATCCTAAAAATTGATGAGTTCATAGCGGCTGGTGACAGTACATTGAAATCTTGTACTGTTACATT
TGCGGACAATCCTAGTAGTAAATCTGTTTGCACTTATATGGATTTATTATTGGATGACTTTGTTACAATT
ATGAAGAGTCTTGACCTTAGCGTTGTGTCTAAAGTCCATGAGGTTATGGTTGACTGTAAGATGTGGAGAT
GGATGTTATGGTGTAAAGACCACAAAGTCCAAACCTTCTATCCTCAGTTACAATCTGCCGAATGGAAGTG
TGGGTATAGTATGCCAGCACTTTATAAGATACAACGTATGTGTCTAGAACCTTGTAATTTGTATAATTAT
GGTGCTGGCATTAAGTTACCTGACGGCATTATGTTTAATGTTGTCAAGTATACACAGTTGTGCCAATACC
TGAATAGTACCACTATGTGTGTGCCTCATCATATGCGCTGTTTACACCTTGGTGCTGGCTCTGATAAGGG
CGTTGCACCAGGTACTGCAGTACTCAAGCGCTGGCTGCCTATTGATGCCGTCATTGTTGACAATGACGTT
AATGATTATGTCAGTGATGCTGACTTTAGTTACACAGGCGATTGTACAACTTTGTATTTGGCTGACAAGT
TTGATTTGGTCATCTCTGATATGTATGATGGTAAGATTAAGCTGTGTGATGGTGACAATGTTTCCAAGGA
AGGCTTTTTCACATACATCAATGGTGTTATATGTGAAAAACTTGCCATAGGTGGAACTGTAGCCATTAAG
ATTACAGAGCATAGCTGGAACAAGCGTCTGTATGAGTTAATACAGCGTTTTGAGTACTGGACTATGTTTT
GTACCAGCGTTAATACATCATCGTCAGAGTCATTTCTTATAGGCGTACATTACCTTGGTGATTACGCAAC
AACACCTGTCATTGATGGCAATACTATGCATGCAAACTACATCTTTTGGCGTAATTCTACTATGATGACT
ATGTCATACAATAGTGTTTTAGACCTTAGTAAGTTTGCATGCAAGCACAAGGCAACGGTTGTTGTTAATT
TGAAAGAAAATGCCATTTCAGATTTAGTTGTTAGCCTTGTTAGGAGTGGAAAGTTGCTTGTTAGAGGTTC
AGGCCCATTAGTTAATTTGTCAAATCATTTAGTTAATACTAAATGAAATTGATTATTTTGTTGTGCATAG
GCTTTGCTTATGCCAATCAACGTAATGTTGGTTGCAGCGAAGGCGGGTATCTTGATCCACCTAAGCGTTT
ACAGCTAGGATTGGATAATGTAACTGCCTTAGTACCTGGTGCCTTGCCACTCCCAGGTCTTTGGAATTGC
ACTGTTACTAGTAACTTTATATATGGACCAACGCCTCGTCCTATTGGCCTATTTATAATGTACTATGCCA
GTGCCCAAGTGGCCCAGTTTGGGATTTCTTCCACTCTTAGACGTTCTTTGTCACCATATTCGTTGTACTT
TTTAAACTATGGTAATGGCAGACGTCACATAATTCGCATTTGCAAGTGGGACACTGACAAAATGCTTCAG
GATTCTGATGCCACTACTGGTTACGATTGCATTGCTAATGTTCGCATCAATGATGTTGTGCTTGAGCATG
GTGGTCGCCAGATCTATGGCTTGTCTTGGTCTGGTAATGTAGTTACTCTCCATATGCTTAAAGGTATTAG
GCACATCACAGTGCCGGGGGCGCAATATTGGGACATTATTAGGTTTTCCTGTGGACACAAAGACTCCTGT
GGCCACCAGGTAGTTTACTCAACTAATGTTTTCAATGTCACAGTGCTCAACGGCTTTATTACTAACTACC
AAGTTTTGCCTGATAGTGGTGAATTTTCAGACAATTTGTTTACCGTTGGCGATGATGGTTCTATACCACC
ATCCTTTGGCTTTAACAATTGGTTTGTGCTTTCTAATTCCTCTTCCATTATTTCCGGCACGGTTGTTAGT
AACCAGCCGTTGCGTCTCACTTGTTTGTGGCCTATTCCATCCAGTACTGGTGCTCTGGCCACTATATATT
TTAATGGTACTAACGGTGCACAGTGCAATGGGTTTGACAGTAATGCACCCTTTGATGCCATTAGGTTTAA
TCTTAATGGCACTTTGAGTGGACATAACTTCGTTAGTGGTTTTGTCCTCCATGCTGCAAATGGTGCAACT
TTGGGTTTTTCATGTACCAACTCAACTGATGCCCCCTATTTACGTCAAATACCTTTTGGCATTGGTGACA
CGCCATATTATTGCTATCTTAATGTCACTACTGACATTAATAGTACAATGTCCTTTGTTGGGGCTTTGCC
TCTTAATTTGCGGGAGATTGTTATAGCTTCTAATGGTGATGTTTATATGAATGGGTATCGCTACTTTGCT
GCTGGTGATCTTAGTAGTGTTGATGTTGAGCTTCCTTCACAACAAGTTTTTGGTTCAACTTTTTGGACCA
TAGCTTTTACTGTTTTTGAGACAGTGTTGTTGGAAGTTGATGGTACTTCTATTAATCGCATGTTGTACTG
TGATAATCCGCTTAACCGTGTTAAGTGTAGTCACACACAATTTGATCTGGTTGATGGTTTTTATCCATTA
ACCGATGTTGATCTTGCTGTCAAACCATTTACTTTTGTCACGTTGCCTACTTTTGCTGACCATAGCTTTG
TTTATTTTAATTTTTCATTAATGTTTGATGACCTTAATGAAGATTTCAGATTGCAGAGCTTTAATCTTAC
TATTAATGGCCAATTGTCGTATTGTGTCCAGAGCAGGCAATTTACTACTAGTGGTAGTGTTCGAACTAAT
ACCAATCATCAGTTTGGCTTTTACACACAGCGTGCGGCTTCTAATGGTTGCCCTTTTACCATAGACACTT
TGAACAACTATCTTACATTTGGTAGGATTTGTTTCTCGTTTGGTGAAAGTGGTGCAGGCTGTGGTGTTGA
TGTCATGGTGGAGTCTCAGTACAACATGTTTAAGGTCACTACTATTTTTGTGTCTTATAGTGAAGGTGAT
ATAATTGCTGGTATGCCCAAACCTTCTGAAGGTATTCGTGATGTTTCAAAAATCCACTTGGACGTCTGTA
GTACCTACAGTATATATGGTCATACTGGTGATGGCATTATCCGTCTTACTAATGACACATTGTTAGGTGG
CCTCTATTACACTTCGCCTGGTGGTGCGCTTTTAGGTTTTAAAAATGTTACCACTGGTGAAATTTACTCC
GTCACACCATGTTCTCTGACTCAGCAGGTTGCTGTTGTTTCAGATGAAATTGTTGGTGTGGTGTCATCTA
GTGCTAATGTTAGTGATCAATTCAGCTTTACTTATACCACTGTCACTGAGCAGTTTTACTATATGACTGA
TGGTAATAGTAGTTGTTCTGAACCTGTACTAACATATAGTTCGCTAGGTGTTTGCAAAGACGGAGCATTG
CGTATTCTGCAACCACGTGAGGATACTACCCAACCCACACCTATTGTTTCTGGTGTTATTTCTATTGCAA
CCAACTTTACTCTTAGTGTTGTCACAGAATACATTCAATTGGCAAACACACCTATCAGTGTTGACTGTGC
CATGTATGTTTGTAATGGCAACCCTAGGTGTAATATGCTGCTCGCACAGTATTCTTCTGCTTGTCAGACT
ATCGAAAATGCGCTGCAGCTTAGTGCTAAACTTGAGTCTATTGAAGTTACTAACATGCTTACAGTTTCTG
AAGACAATTTGCAAATTGCTAACATTTCCACTTTTAATGGTGGTGGTTACAATTTCACTAATTTGATGGG
TACAACGTACTCAACCAAATCTGTTGTCGAGGACATTTTGTTTGACAAAGTCGTCACAAGTGGACTCGGA
ACTGTTGATGCAGATTATAAGGCATGTTCTAATGGCCTTTCCATTGCTGATCTTGTTTGTGCTCAGTATT
ATCAGGGTGTTATGGTTTTGCCAGGCGTTGTTGATGCTGCTAAGTTGCATATGTACTCTGCATCTTTGAT
GGGCGGTATGGCCTTAGGAGGCGTTACTGCAGCCGCTGCGTTGCCTTTTAGTTACGCCGTTCAAGCCCGC
CTTAATTATGTTGCATTGCAGACCGATGTTCTACAACGTAATCAACAAATTCTTGCTGAGTCATTCAACA
ATGCCATTGGTAACATAACTAATGCATTTGCTAGTGTTAACGATGCCATATCACAGACTGCTGAAGGTCT
TAGTACTGTTGCTGAGGCCCTTTCTAAAGTCCAAGATGTTGTTAACAACCAGGGTATGGCACTAAATCAT
CTAACTCTGCAATTGCAAAACAATTTCCAGGCTATTAGTTCTTCTATCGCCGACATTTATCGCAGGTTAG
ATCAACTTACTGCGGATGCTCAGGTAGATAGGTTAATTAATGGCAGATTGGCTGCTCTTAATGCCTTTGT
TTCACAAACTTTGACAAAGTATTCTCAAGTGCAGGCTTCTCGTAGTTTGGCCAAGCAGAAGATTAATGAG
TGCGTTTTGTCTCAGTCACCTAGATATGGGTTCTGTGGTGACGGTGGCAGGCATGTTTTCACTGTTACAC
AGGCTGCACCACAAGGGATTCTCTTTTTACACACCGTACTCAGACCTACTGGCAGTGTTAATGTTACTGC
TGCTGCTGGTATTTGTGTTGATGGTGCGGGGTATGCTTTGAACCAACCTGGTTTAGTTCTTATTTACCAA
GATGGTACATACCTTATTACACCCAGAGTTATGTTTGAACCACGCCAGCCTCAGATTAGTGACTTTGTGC
GTATTGAAGGCTGTGACGTAGAGTATTTTAATGTCACTGGTGAGTCTTTACCTGACATTTTCCCAGACTT
TATTGATGTTAATAAAACTCTGGAAGATATTCTTTCACAGCTGCAAAACAACACTGGACCTAAGTTTGAT
ATTGACATTTTTAATGCCACATATCTCAACTTATCCAGTGAAATTGCAGACCTCGAAATGAGGTCTGAAT
CTTTGCACAATACTACAGAGGAACTTAAGCGACTTATTGATAATATAAATTCAACACTTGTGGACCTTGA
ATGGCTCAATAGGGTTGAAACTTATATTAAGTGGCCATGGTGGGTGTGGTTGCTTATTGCCATTGCGCTC
ATTTTTACTGTTTCTTTGTTGTTGTTCTGTTGTATTGCAACAGGGTGTTGTGGCTGTTGTGGCTGTTGTG
CTTCTTGTTTAACTGGTTGTTGTAAAGGTCCTAGATTACAACCATACGAAGCTATTGAAAAGGTCCACGT
GCAGTAATGTTTCTTGGACTTTTCCAGTATACAATTAACTCTGCCATCAAAGATAGTATCGCTAAGAGCA
ATTTGTCTCTCAGCGATGCTGTTGTTGTTGACCAGCAGCTAGAGCCAGTTAGGCAATTTTCTATTGCTTC
TGGCTTTTTCTTTACCAGTGTGTTTGTGATTTACTTCACACTGTTTAAGGCGTCTACTTTTAGACGTAAC
CTACTACTACTACTTGCACGCTTTCTTGTAGTCGTGGTTTATTGTCCATTGTTATTTTACTTTGGATGTC
ATTTAGATGGTTCATTTATTTTGTTGACCATCTTTGCCAGACTTTTATATGTCTGTTACTATGCCTGGCG
TTACAAGTCCATTCAATTTGTTGTGCTCAACACAACTACACTAGCTTTTGTCAACGGTAAGTGCACTTAT
TATGCTAATGAGCCATTCTTCACTTTTGAGGGTGGTGATCATTACATTAAATTGGGTGAGTATTATGTCC
CATTTGTGGACAGGAACTCCCTTTATGTTGCACTTCGAGGAAAGTTTGAGGAGGATGTCTATCTGTCTCG
TAGTATCGAGCTGTTTAATGGACACTTTCTCTATGTCTTTACTCGGCAGCAAGTTGTCGGCATTGTAAAT
TCTAATTTTACAGATGTTCAACTCGACGAACTTGAATATGCTTCAGCTAGTTGATGATCATGGACTTCTT
GTCAATGGCATTTTATGGCTTATTTTACTCTTCTTTGTCCTAATAGTTTCTATAACTTTTATACAGCTTA
TAAACCTCTGCTTCACTTGTCACAGGTTTTGTAGCAGAGCTGTTTATACTCCTGTAGGTAGGATGTATGG
AGTCTATAAGTCTTATATGCAAATAGAACCCCTTCCTATTATTGATGTCTAAACGAAAATGGCTAATGGT
AGTGTCTCCGAGGAGGAGATTATCCATCATCTCAGAAATTGGAATTTTGGCTGGAACATTATACTCACTA
TCTTTATAGTGGTATTGCAATATGGCCAGTACAAATATTCTGCTTTTCTGTATGGCTTGAAAATGCTGGT
GCTGTGGCTCTTGTGGCCACTTGTGCTTGCACTCTCAATCTTTGATGCTTATGCCAGCTTTAATGTGAAC
TGGGTTTTCTTTGCGTTTAGCATCCTTATGGCTTGCGTCACGGGTGTGCTGTGGGTAATGTATTTTGTCA
ACAGCATTCGCCTTTGGAGACGTACCAAATCTTTCTGGGCTTGGAGTCCTGAAACTGACACCATTTTGGC
AACAACTGTGCTTGGTCGCACTGTTTACCTTCCACTGCCAGCCGCGCCGACAGGTGTCACTCTAACTCTG
CTTAACGGTACGCTGCTTGTCGAGGGCTTTAAGGTTGCTGTAGGAGTCACGGTAGAACTTCTACCTGACT
ATGTGGTAGTTGCTAAGCCGCATACGACAATCATATACCAGCGAGTTGGACGTTCTGTCAATGTGAGATC
TAACACAGGTTGGTCTTTTTACGTGAAGGCTAAATATGGCGACTATGCTACTACTGGACATTCAAATGAT
AAAGTTCCAGATAGTGAAGTTGTGTTACATTTAGTATAAACTAAACAAAATGGCCTCTGTTAAGTTCGCC
AAGAACAACCGCAGAGGAAGGATGGAATACTCCTATTTTGCCCCACTTATTATTAATTCTGACCAACCCA
TTTGGAAAGTTCTTCCTAACAATGCTGTGCCAGTTGGCAAGGGCGGTAAGGATGAGCAGATTGGGTATTG
GAATGAACAACCACGTTGGCGCATGCGCAAGGGACAGCGTGTTGACGTTGCATCTAAGTGGCACTTCTAT
TACCTTGGTACTGGACCTCATTCTGAGGAGCAGTATCGTAAGCGTATTGATGGTGTCTACTGGGTTGCTG
TCAACGGTGCTAAAACATCTCCAACAGGGCTTGGCACTCGTAGTGCTAAGACCAAGCCGCTGGAACTGAA
GTTTAACACGAAAATCCCTAAGGAGGTTGAGTTCGTTGAACCTACCTCTCCAGGGTCTTCTCGTGCAAAC
TCGCGCAGCCAAAGCCGTGGTGGTTCTAAATCCAGAAATAATTCTCCCAGAAGGGGTAATCAAAGCAAAT
CAAGGAACAGTTCTAAGAACAGAGGTGGTGACAACCGCTCCCGTAGTTCCTCAGGTACAAGAGACCAGGA
CGCAATTGTTGCTGCCGTAAAGGCTGCGCTTTTGGGACTTGGACTTGGTACTGACAGTAACTCCGGTGCT
TCAGGTAAGGCTTCTAAGGCTAACAGTGGAACTTCGACCCCAAAACCGAAGCCAGCTGCGACGCCAAAAT
CGCCTTCAACACCTAAGAGTCAGCTTGAAAGACCTGAATGGAAGCGAGTGCCAGATTCTGATTGCTCTGT
TGAGCAGTGCTTTGGACCACGTGGTGGTTTCAAGAATTTTGGCAGCGCAGATTTCGTACAGTATGGTGTC
GCTGCTAAGGGTTACCCTCAAGCAGCTGCACTAACACCAACATCAGCTGCATTGCTGTTTGGTGGTAACG
TACAGGTTCAGGAACTTTCAGATGACATTGAAATCACCTACACCTACAAGATGACTGTTCCCAAGTCAGA
CAAAAACCTTGAGGTCTTCCTCTCTAATGTTAATGCTTATAAAGAGGCAAAACCTCAGAGGGAACCCAAG
AAGAAGAAGGACAGAAGTTCACGTCCACCAACACCAGCTCCTAGTGCGCCGGTTGCCAGTGGAAATGCTG
AGCCTATATATGCAGATGTGCAACCCCAGGGACAAACTGAGCCTGTTTACGAAAATCCAGACCAGTACCT
TGGTGGTGTTGACATTGTCAACGAGGTTTACGGTAACCTACCTGACAATTCTCAGAGCACAGCTTAAATG
AGCCTGTAGTAATGATCAACTAAACATGATCTTGTATTACATTGCTGTTGTTGGCCCTCTTTTGCATTGG
TTTGCTGAAGGTTGTCGAGCCATTTACAAACTTTGGCTCGAGTGTCGTGATGTTCCTAATTATAGCATCA
ATGGTGCTCCTTTAGGAACTCGTGACATTTGTTACTACACCTCTTATGAGTTCATATACCTATGCTTTAT
CTTCTGCTTTGTTTCTGTCCCTATTTTCTGTTGGGCTTTTATCCATGAAAATGCTTTTGACTACTACGTG
CATAGGCTGCGCTGTATTCATCATGCATTCATTAGATTCTTGCTCAATGCTTCTGCTAAGGTTTGCTTTG
TTCTATCAATAGTGCTAATTGTGCTGACTTGCTTCCATGGCTATCAGGACCTTATGGACCTGTGACTTGG
AAGCTAGTCTTGCACACAATGGTAAGCCAGTAGTAATGACAGTGCAAGTAGGTTATTACTATATTACGGC
ATATAGGTAAACAGCAGTTCTCATTCATCTAAGTA

>gi|304633675|ref|NC_014470.1| Bat coronavirus BM48-31/BGR/2008, complete genome
TTTAAAATCTGTGTAGCTGTCACTTGGCTGCATGCCCAGTGCACTTACGCAGTATATCTTATAAACTTTT
ACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCA
GCCGATCATCAGCATACCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGG
TTTCAACGAGAAAACACACGTCCAACTCAGTTTACCTGTTTTGCAGGTTCGTGACGTGCTCGTACGTGGA
TTCGGTGACACCGTAGAAGAGGCTGTCGCTGAAGCACGCCAACATTTAATTGAAGGAACATGTGGCATTG
TTGATCTCCAGAAGGGTGTTTTACCCCAACTGGAACAACCTTACATTTTCCTTAAACGCTGTGATGCCCG
TACTGCTCCCCACGGCCATGTTATGGTCGAATTGGTGGCAGAGCTTGATGGCGTCCAGTATGGTAGGAGC
GGAGAATCTCTTGGTGTGTTAGTCCCGCATGTGGGTGAAACACCAATTGGTTACCGCAAGGTTCTTGTCC
GTAAGAACGGTAATAAGGGAGCCGGTGGTCACTTGTACGGCGCCGATCTAAGGTTTTACGATCTAGGTGA
CGAACTTGGCACTGACCCCCTTGATGACTTCCAACAAGATTGGAATACTAAGCATGGCAGTGGGCTTCGC
CGCGATCTCTTTAGGGAGCTCAATGGTGGTGTCTACACACGCTATGTTGATAACAACTTCTGCGGACCAG
ATGGTTATCCTCTGGAATGCATAAAAGACTTGCTTGCGCGAGCTGGCAAGTCAAGCGCACCTCTTGCTGA
ACAGCTTGACTTTTTGGAGTCTAAGAGAGGTGTGTACTGTTGCCGTGAACATGAGCATGAGATTGCTTGG
TACACGGAGCGCTCTGATAAGAGCTATGAGCTTCAGACACCTTTTGACATTACTAATGCCAAAAAGTTTG
ATTCTTTCAAAGGCGAATGTCCTAAATTCGTCTTCCCACTTAATTCCACAGTTAAAGTCTTGCAACCACG
TGTTGAAAAGAAGAAGACTGAGGGATTTTTAGGCCGTATTCGTACGGTTTACCAAGTTGCATCACCTGGT
GAGTGTAACTCTATGCACCTGTCTACCTACATGAATTGTAACCATTGTGGTGAAAAGTCATGGCAGACAT
GTGATTTCTTAACAGCCACTTGTGAAATGTGTGGCAACCAGAATACTGTTGAAGAGGGACCTACCACATG
TGGGTATGTACCTAGTAATGCTGTAGTAAAGATGGTTTGCCCTGCCTGTCAGAACCCAGAGATTGGGCCC
GACCATAGTGTGGCAGATTACCACAACAACTCAAAGATTGAAACTCGACTCCGCAAGGGAGGTAGGATTA
AATCTTTTGGTGGCTGTGTTTTCTCTTATGTTGGCTGCTACAACAAGCGTGCCTTCTGGGTGCCGCGTGC
CGCAGCCAATATTGGTTCCAACCATACTGGCGTTGTCGGTGAAGGAGTTGAAACCATGAATGAGGACTTG
CTTCAGATCTTAAGTCGTGAACGTGTTGTTATCAACATTGTTGGCGAGTTTTGTCTGAACGAGGAGATTG
CTATCTTACTTGCTTCTCTTTCAGCGTCTACTAGTGCTTTTGTAGAGACAGTTAAAAATCTTGATTTTAA
AACTTTCAAGAAAATCATTGAGTCTTGTGGTAATTATAAAGTGACCAAGGGCAAGTTTAAACCTGGTGTC
TGGAATATTGGCACTAGTAAATCATTGCTTACACCTCTGCATTGCTTTTCATCGCAGGCTGCAGGTGTAG
TTCGCTCAATCTTCTCTCGCACACTTGCTACAGCTAATCATTCAATTGTAGACCTGCACAGAGCTGCTAT
GATTATTTTCTCTGATATATCAGATCAAGCCAATCGTGTGCTGGATGCCATGGTCAACACATCTGACTTA
GTCACTGAAAGTGTTGTTGTCATGGCTTATCTCACAGGTGGATTGGTGCAACAGGTTAGTACCTGGTTGA
GCCAATTACTTAATACTTCTGTAGACAAGTTTAGCGCAGTTTTGCGCTGGCTTGAGCAAAAGCTCCAAGG
TGGCATTGATTTTCTTCGTCAAGCTTGGGGCATTCTTAAACTTCTAGTCACTGGCGCTTATGTGGTTATA
AGAGGTAAAATTCAAGTTGTTAACACTAGTCTCATAGAGTGCGTTACATCATTTGTTGACGTCGTTAACA
AGGTTTTTGAGCTCTGTACTGATTACATTACTGTTGCTGGTGCTAGAGTGCGTGCTATAAATTTTGGTGA
GGTTTTGATTGCGCAAAGTCGAGGCCTCTACCGTCAGTGTGTACGTGCCAGAGATCAGCTTCAGTTGTTG
ATGCCTTTAAAATCGCCAAAGGACGTTGTTTTCCTTGACGGTGATGCTTATGACACACTTTTAACCTCTG
AGGAGGTAACAGTTAAAAATGGAACTCTTGAAGCACTTGATCTTGAACTCAGTGACGTAGTTACTGGTGT
TGCGGAGGGAGTCCCTGTTTGTGTTAATGGTCTAATGCTCTTAGAATTGAAGGAAAAGGAGCAATACTGT
GCATTGTCTCCTTCTCTACTTGCAACTAATAACGTCTTTACATTAAAAGGAGGTGCCCCTACAAAGGGAG
TCACATTTGGTGAAGACACAGTTGTGGAAATCCAGGGTTATAAAAGTGTTAAAATCACTTTTGAGTTGGA
TGAACGTGTTGATAAAGTTCTTAATGAGAAGTGTGCATCCTATACAGTAGAGACCGGCACTACAGCTGAA
GAACTTGCTTGTGTTGTGGCTGAGTCTGTTGTAAAGACTTTACAACCAATCTCTGAATTACTAACACCCA
TGGGTATCGACCTTGATGAATGGAGTGTAGCTAAATTTTACCTGTTTGATGAGTCTGGTGAAGCAGTTCT
TTCATCACACATGTATTGTTCCTTCTATCCTCCTGACGAAGAGGAAGAAGAAGATTTGGAAGAGTCTGAA
GATGTCGAATACGGTACTGAAGACGATTACACAGGCGCCCCGCTCGAATTCGGTGCTAGTAGCACTGTTG
AGCAGGACGAGGTCCATGATGAAGAGGAAGACTGGCTTGCACCACAGGAAGAGTCCGAAGTGTTATATGA
CCAGTTTACCGATTATCACAAACTCACAGACAATGTCTTCATAAAGTGTGCTGATATTGTTGAAGAGTCT
CTGAAAGTCAACCCAACAGTTGTAGTGAATGCTGCTAACATACACTTGAAACATGGTGGTGGTGTTGCAC
GAGCACTAGATAAAGCAACTGGCGGTAGTATGCAAAAAGAATCTAATGATTACATTTCTACTAATGGTCC
TCTTAGAGTAGGAGGTTCCTGTCTTCTCTCAGGCCATAACTTAGCTAAACATTGTTTGCATGTTGTTGGC
CCAAATAAAAATGCAGGAGAGGATATTAAACTCCTTGATGCAGCCTATGAGAACTTCAATGCATATGAAG
TAGTTTTATCACCACTACTGTCAGCAGGTATCTTTGGTGTAAGTCCTATTCAATCACTAGAGACTTGCAA
GCGCGTGGTGCGTAACACAGTCTACATTGTTGTAAACGACAGTGTGGTATTTGATCAGCTTTTAGCCAAA
ACCCCTGGAAAGACTAACGAGAGGCCTGTTGTTGAATCTTCAGAAATTTGTGAGGAGGTCAACCAGAAGC
CTGTTGTTGAGTTTTCAGAAACTAAGGAGTTGCATGAAGAGACCAATCAGAAGCTTAAGTCTTCGGAAGA
GCCTGTTAAAACCCGCATTGAGGAGTTGAACACAACTGTTGATGAGGCTAAATTTCTAACCACTAAGTTG
CTATTATATGCAGATGTCAATGGTAATCTTAGTGAAGATTCAAAGGTGTTAATTGGCAATGATGGCGCGT
CCTTTAAAAAGGGTGCTCCTTACATTGTTGGTGACATCATTAGCGAAGGTGAATTGACCTGTGTTGTTTT
ACCAACTAAAGCTGTGGGTGGTACAACTCATATGCTTACTAGGGCTCTGAAGAATGTACCTTCAGACACC
TATCTTACAACCTATCCTGGTCAGGGTGTTTCAGGCTACACTTTGGATGAAGCTAAAGCAGCTCTTAAAA
AGTCCAGATCAGTCTTTTACATATTACCTTCAGCAAATGTTAATGCTAAGGAAGAGGTTTTAGGCACTGT
TGCCTGGAACTTGCGTGAAATGTTAGCTCACGCTGAGGAAACTAGGAAAGTTATGCCAGTCTGTATGGAT
GTTAGGGCGATTATTTCCACAATTCAGCGTAAGTATAAAGGAATTGGAATACAGGAAGGTCTTGTAGATT
ATAAAGTAAGATTTTACTTTTACTCTAGCAAAACACCTATTGCTAGGGTAATCTCAAACCTTAATTCTCT
TGGAGAGCCCCTGATTACTATGCCTTTGGGCTATGTCACACATGGACTCAATTTAGAAGAATCAGCGCGC
TACATGCGTTCTGTTAAGGTTCCTGTTGTAGTTTCTGTGTCTTCACCTGATGCAGTCACTTCTTACAACG
GTTATGTTACATCTGCTTCTAAGAGTGCTGAAGAACACTTTATTGAAACAGTTTCCTTAGCGGGTTCATA
CAAGGATTGGTCATATTCTGGCCAACGTACTGAACTTGGTGTTGAATTCCTCAAGAGAGGTGACAAAATT
GTCTACCATACAGTAGGAAATGTTATAGAATTTCACATGGAAGGTGAAGTTCTTCCTCTTGAGAAGTTAA
AAACTCTCTTAGCTTTAAGAGAGGTTAAAACTATTAAGGTGTTCACAACTGTAGATAACATCAACTTACA
CACACAAGTCATTGATATGTCTATGACTTATGGACAACAGCTAGGACCCACCTATATGGACGGTGCTGAT
CTTACTAAAGTCAAACCTCATGCTAGTCATGAGAACAAGACTTTCTTTGTCCTACCTAGTGATGATACGC
TACGTATTGAAGCTTTTGAGTACTATCATACCGTAGACGAGAGTTTTTTTGGTAGATACATGTCAGCATT
AAACCATACTAAAAGATGGAAGTATCCTCAAGTTGGTGGTTTAACATCTATAAAATGGGCAGATAACAAT
TGTTACTTGTCTAGTGTTCTTTTGTCACTACAACAAATTGACATTAAGTTTAATGCACCAGCACTTCAGG
ATGCTTATTATAGAGCGCGTGCTGGTGATGCTGCTAACTTCTGTGCACTTGTGCTCGCATACAGCAAGAA
GACTGTAGGTGAGCTGGGTGATGTACGTGAAACAATGGCCCATTTATTACAGCATGCAAACTTAGAGTCC
GCTAAACGGGTTCTTAATGTTGTGTGCAAACACTGTGGACAGAAAAGCACTACACTTAGTGGTGTTGAAG
CTGTCATGTACATGGGAACCCTCTCTTATGATCATCTTAAGAGAGGTGTTAAGATACCTTGTGTATGTGG
TCGTGAAGCTACACAATACTTAGTGAAACAAGAGTCAACTTTTGTTATGATGTCAGCTCCACCTGCAGAG
TACACTCTTCAAACCGGTGAGTTTTTGTGTGCTAATGAGTACACTGGTAATTACCAGTGTGGTCATTATA
CACATATTACAAATAGAGAAACTATCTATAAAATTGATGGTGCTCTCTTGACTAAAATTACTGAATATAA
GGGTCCTGTTGCTGATGTTTTCTATAAGGAAACATCCTACAGTACAGATATAAAACCTGTGTCATACAAA
CTCGATGGAGTGACTTACACAGAGATAAATCCAGATCTAAATGGGTATTACAAAAAGGACAATGCTTACT
ATACAGAACAGCCTATTGACCTTGTACCAACTCAACCTTTGCCTAATGCAAGTTTTGACAATTTCAGATT
TGTTTGTGCTAACACCAAATTTGCTGATGACTTGAACCAGATGACTGGCTTTAAAAAGCCTCCATCTAGG
GATTTAACAATTACGTTCTTCCCTGATTTGAATGGTGATGTGGTTGCTATTGATTATAGACACTACACAC
CTACTTTCAAAAAGGGTGCTAAACTTGTCCATAAGCCAATACTGTGGCATGTTAATCAGACTACTACTAA
GTCAACGTTTAAACCCAATATGTGGTGTCTGCGTTGTCTTTATAGTACAAAGCCTGTTCCCACTTCAAAT
TCGTTTGAGGTGTTAAGTTCAGATGACGCACAAGGAATGGACAATCTTGCTTGTGAAAGTCAACAAACTG
TCGCTGAAGAAGTAGTGGATAATCCTACCATACAGAAAGACATCATAGAGTGTGACGTGAAAACTACCGA
AGTTGTAGGCAATGTCATACTAAAACCATCAGCAGATGGCATTAAAGTTACATCAGAGTTGGAACATGAG
GATCTTATGGCTGCTTATGTGAATGAAACTAGCATTACCATTAAGAAGCCCAATGAGCTTTCTATCATGT
TGGGTTTAAAAACAATTGCTACACATGGTGCTGCTGCTATTAATAGTGTACCCTGGATTAAGATTTGTGC
TTATGTCAAGCCCTTTCTTGGTTACGTTGCAGAGCAATCTAAGAATTGTATTAAGCGCTGTTTTAGGCGT
GTTTTTAATGATTATATGCCATTCTTGTTGACGCTTTTATTGCAATTATGCACTTTTACTAAGAGTACAA
ATTTTAGAATAAAAGCTGCTATGCCCATTGTTATAGCTAGAAATAGTGTAATAGGTGGTGTTAGATTTTG
TCTAGATGCTTTGACTATGTATGTTAAATCACCTAAGTTTTCTGGAATACTCACTGTTGTTATGTGGTTA
TTATTATTAAGTGTCTGCTTAGGATGTTTAGTCTATGCAGTAGCTTCTTTTGGTGCCATCTTATCTGGTT
TTGGTCTGATGTCTTATTGTGATGGCGTTAGGGCGGGTTATGTTAACTCGTCTAATGTCACTATTCCTGA
CTACTGCGCAGGCAGTTTACCTTGTGGTGTTTGTTTGGGTGGTTTGGATTCTTTAGATGCATACCCAGCT
TTAGAGACGATTCAGGTTACCATTTCTTCCTACAAGTTAGACTTGACTTTTGTGGGAATGATGGCTGAAT
GGTTTTTGGCATATATGTTGTTTACTAAATTTTTTTATTTATTAGGTCTCTTTGCCTTAATGCAGTTGTT
TTTCGGTCTTTTTGCTACACACTTTGTGAATAATTCCTGGTTAATGTGGCTTATTATAAATGTAGTGCAA
ATGGCTCCCATTTCTGCTATGGTTAGAATGTATGTGTTCTTTGCCTCTTTCTACTATGTGTGGAAAGCTT
ATATACACGTTATTAATGGCTGTACATCATCCACTTGTATCATGTGTTACAAGCGTAATCGTGCAACACG
TGTTGAATGCACCACCATTGTCAACGGCATGAAGAAGTCCTTCTATGTTTATGCTAATGGTGGTCAAGGT
TTTTGCAAACTTCACAACTGGAATTGTTTGAATTGTGACACTTTCTGTTCTGGAAGTACATTTATCAGTG
ATGAGGTAGCACGTGACCTATCATTACAGTTTAAGAGACCTATTAATCCAACAGACCAGTCTTCTTACAA
TGTTGATAGTGTTACAGTAAAAGATGGTACACTCTACTTGTATTTTCAGAAGGCTGGTAAACTCACCTAT
GAGAGACATCCACTTTCTTACTTTGTTAATTTGGACAACCTGAGAGCTAATAACGTTAAAGGCACTTTGC
CTATTAATGTTATAGTTTTTGATGGTAAGTCTAAATGTGAAGAAGCTGCTGCTAAATCTGCATCTGTTTA
CTATAGTCAGTTGATGTGTCAACCTATATTACTATTAGACCAAGCTCTTATTTCTGATGTTGGCGATAGT
ACTGAAGTGGCTGTTAAAATGTTTGATGCGTATGTTAATGCATTCTCATCAACATTTAACGCTCCTATGG
AAAAACTAAAGACATTCATTGCGACAGCCCATGCTGAAATAGCTAAAGGTGTTTCTTTGGATAGTGTTTT
GTCTACATTTTTGTCTGCAGCCAGACAAGGATTTGTGGATTCTGATGTAGACACTAAGGATGTCATGGAG
TGTCTTAAACTGTCACACCATTCTGATTTGGAGATTACGAGTGACAGTTGTAACAATTTTATGCTTACTT
ACAACAAGGTTGAAAACATGACACCTAGAGATCTAGGTGCCTGCATTGATTGTAGTGCGCGTCATATTAA
TGCACAAGTGGCAAAGAGTCACAATGTTTCCCTTGTTTGGAATGTAAAGGACTATATGTCTTTGTCAGAA
CAGCTACGTAAACAAATACGTAGTGCTGCCAAAAAGAACAATATACCATTTAAACTCACTTGTGCTACTA
CTAGACAAGTTGTGAATGTTATAACAACAAAAATATCACTAAAAGGTGGTAAGTTTGTTAGCAATAATTG
GTTTAGGTTCCTACTCAAAATGACAGTTTTGATGGTATTGGTTGCCTTTATCTTCTATTTTATTACACCC
ACCCATACTTTAATGGGTCATGATGTGTTTTCTTCTGAAATTATCGGTTATAAAGCAATACATAATGGTG
TTACCAGAGATGTGTTGACCACCGATGATTGTTTTGCTAACAAGCACACTGGCTTTGACCATTGGTTCAG
TCAGCGTGGTGGTTCATATAGAAATGACAAGACCTGCCCTGTTATAGCGGCTGTTATTACGCGTGAGGTA
GGCTTTATAGTACCTGGTCTTCCTGGTACTGTAAGGCGTGCTTCCAATGGTGACTTTTTGCATTTCTTAC
CTAGAGTTTTTAGCGCTGTTGGTAACATTTGTTACACGCCAGCGAAATTAATAGAGTATACTGACTTTGC
AACTTCAGCCTGCGTGCTTGCTGCTGAATGTACTATCTTTAAGGATGCTCAAGGTAAACCTGTACCTTAT
TGCTATGATACTAATTTGCTTGAGGGTTCTATTTCTTATAGTGAGTTACGCCCCGACACTAGATATGTGT
TAATGGATGGCTCAATTATACAATTCCCTAGCACTTACCTTGAAGGTTCTGTGAGAGTGGTAACAACTTT
TGATTCTGAATACTGCAGACATGGTACTTGCGAACGATCAGACGCGGGTGTGTGTTTGTCTACTAATGGT
AGATGGGTTCTTAATAATGATTATTATCGATCCATTCCAGGTGTCTTTTGTGGTGCTGATGCTTCAGACT
TACTCTTTAACATCTTCACACCTCTTGTTAGACCAGTAGGCACACTTGACATTTCAGCTTCTGTTGTAGC
AGGTGGCCTTATAGCCATCCTTGTTACATGTGTTGCTTACTACTTTATGAAGTTTAGGCGTGCGTTTGGA
GAGTACAACCATGTTGTCTTTGCTAATGCACTTTTGTTTTTACTGTCTTTTACTATACTCTGTTTGACAC
CTGCGTACACATTTTTACCAGGTATCTATTCATTGCTTTACTTGTACTTGACCTTCTATTTTACTAATGA
CGTGTCTTTCTTGGCTCACCTGCAATGGCTAGCTATGTTCTCACCAATAGTGCCTTTCTGGATAACAGTC
ACTTATGTTGTCTGTATTTCTATTAAGCATTGCCATTGGTTCTTTAGTAATTACCTCAAGAAGAGAGTTG
TTTTTAATGGAGTTACATTTAGCACTTTTGAGGAGGCTGCTCTGTGTACCTTTCTTTTGAATAAGGAAAT
GTATCTTAAATTGCGTAGTGAGACACTTTTGCCACTTACACAATATAATAGATACCTTGCTCTTTATAAT
AAGTACAAGTATTTTAGTGGAGCTTTAGACACAACTAGCTATAGGGAAGCTGCATGCTGTCACTTAGCGA
AAGCTCTAAATGACTTCAGTAACTCTGGTGCTGATGTTCTATACCAACCACCACAGACTTCTATTACCTC
AGCTGTTTTACAGAGCGGTTTTAGAAAGATGGCATTCCCCTCAGGCAAAGTTGAGGGATGTATGGTACAG
GTCACATGTGGAACAACAACCCTGAACGGTTTGTGGTTAGACGATGTGGTCTATTGCCCTAGACATGTTA
TCTGCACACTAGAAGATATGCTTAACCCAAATTATGATGACTTACTTATTAGAAAGTCTAACCATAATTT
CCTTGTGCAGGCTAGTAATGTGCAATTGCGTGTTATTGGCCATACTATGCAGAACTGCTTGCTCAAACTT
AAGGTTGACATAGCTAATCCTAAAACACCTAAGTATAAGTTTGTACGTATTCAACCTGGACAGACTTTTT
CAGTGTTAGCTTGCTACAATGGTGCACCCTCGGGTGTTTACCAGTGTGCAATGAGGTCCAACCACACTAT
TAAGGGTTCATTCCTTAATGGTTCTTGTGGTAGTGTTGGTTTTAACATTGACTATGACTGCGTGTCCTTC
TGTTACATGCACCATATGGAGCTTCCTACAGGAGTTCATGCTGGTACAGACTTGGAAGGTAACTTCTATG
GACCATTTGTTGATAGACAAACAGCACAAGCAGCAGGAACTGATACAACCATTACACTTAATGTGTTGGC
TTGGCTCTATGCTGCTGTTATTAATGGGGAAAGATGGTTCCTTAATAGGTTTACAACTACCCTAAATGAT
TTTAATCTTGTTGCTATGAAGTACAACTATGAACCTCTAACACAAGATCAAGTTGACATCCTTGGACCGC
TTTCTGCCCAAACTGGAGTGGCTGTCATGGATATGTGTGCAGCACTGAAAGAATTGTTGCAAAATGGCTT
AAATGGTCGTACCATACTCGGTAGTACCATTTTAGAAGATGAGTTTACACCTTTTGACGTTGTTAGACAA
TGCTCAGGTGTAACCTTTCAAGGTAAATTCAAGAAAGTCGTCAAAGGTACCCATCATTGGTTGCTGTTGA
CACTCTTGACTTCTTTGTTAATACTTGTCCAAAGTACACAGTGGTCACTGTTTTTCTTTGTGTATGAACA
TGCCTTTTTGCCGTTTACAATGGGTGTTGTGTGTTTTGCTGCATGCGCTATGGTTCTTGTTAAGCATAAG
CATGCATTTTTGTGTTTGTTTTTGTTACCTTCCTTAATAACTGTTGCTTATTTTAATATGATCTACATGC
CTGCTAGTTGGGTTATGCGTGTCATGACATGGTTAGATTTAGTCGACACCAGCTTGTCTGGTTATAGACT
TAAGGACTGTGTTATGTATGCGTTAGCTGCTTTCTTACTCATCCTTATGACAGCTCGTACTGTTTATGAT
GATGCTGCTAGACGTGTTTGGACAGTTATGAATGTTATAACACTTGTCTACAAGGTCTACTATGGTAATT
CGCTTGATCAAGCACTTGCTATGTGGGCTCTTGTTATTTCTGTAACCTCTAACTATTCTGGTGTCGTTAC
GACTATCATGTTTTTAGCTAGAGCTATAGTGTTTTTGTGTGTTGAGTATTATCCTATTTTGTTTATTACT
GGCAACACCTTACAGTGTATAATGCTTGTTTATTGTTTCTTGGGCTATTGTTGCTGTTGTTACTTTGGTC
TTTTCTGTTTACTCAACCGCTATTTCAGATTAACTCTTGGTGTGTATGACTATTTTGTCTCCACACAAGA
GTTTAGGTATATGAATTCACAGGGACTTTTACCTCCTAAGACTAGTTTGGATGCCTTTAAACTCAATGTT
AAATTATTGGGTATTGGAGGTAAGCCTTGTATTAAAGTGGCCACTGTTCAGTCTAAAATGTCTGATATAA
AGTGCACTTCTGTTGTATTGCTTTCAGTTCTACAACAACTTAGAATTGAATCCTCATCCAAATTGTGGGC
ACAGTGCGTGCAATTGCACAATGACATCTTACTTGCTAAGGATACAACTGAGGCATTTGAAAAGATGGTC
TCATTGTTATCTGTTCTGCTTTCTATGCAAGGCGCTGTAGATATTAATAAGTTGTGTGATGAAATGCTCA
ACAATCGTGCTACTTTACAAGCCATTGCTTCAGAGTTTAGTTCTCTACCATCTTATGCAGCTTATGCTAC
AGCCCAGGAGGCTTATGAGCAGGCTGTTGCTAATGGAGACTCTGAAGTTGTTCTTAAGAAATTGAAAAAG
TCTTTAAATGTGGCTAAATCTGAATTTGACAGGGATGCCGCCATGCAACGTAAGTTGGAAAAGATGGCGG
ACCAGGCCATGACCCAAATGTACAAGCAGGCTAGATCTGAAGACAAGAGGGCAAAAGTTACTAGTGCCAT
GCAGACAATGCTATTCACTATGCTTAGAAAGCTTGATAATGATGCTTTGAACAATATTATTAACAATGCA
CGTGATGGTTGTGTACCACTCAACATCATACCATTGACAACTGCAGCCAAACTCATGGTTGTTGTCCCCG
ATTATAACACCTACAAGAATACTTGTGATGGCAACACATTTACGTATGCTTCCGCTCTCTGGGAAATCCA
GCAGGTTGTGGATGCAGATAGTAAAGTTGTTCAGTTGAGTGAAATTAACATGGACAATTCTCAAAACCTT
GCTTGGCCTCTTATTGTTACAGCATTGAGGTCCAATTCTGCAGTCAAATTACAGAATAATGAACTGAGTC
CTGTTGCACTGCGCCAGATGTCGTGTGCCGCAGGTACTACACAAACAGCTTGCACTGATGACAATGCACT
TGCCTATTACAACACTTCTAAGGGAGGTAGGTTTGTGCTTGCATTATTATCAGACCACCAAGATCTCAAA
TGGGCACGTTTCCCAAAGAGTGATGGTACAGGTACTATATACACAGAACTGGAACCACCATGTAGGTTTG
TTACAGACACACCAAAAGGCCCTAAAGTGAAGTACTTGTACTTTATCAAGGGCCTTAACAACCTAAATAG
AGGTATGGTACTGGGTAGTTTAGCTGCTACAGTACGTTTACAAGCTGGCAATGCTACGGAAGTTCCTGCC
AATTCTACTGTGCTTTCTTTTTGTGCGTTTGCTGTGGATCCAGCTAAGGCATATAAAGATTACCTAGCTA
GTGGTGGACAACCAATTACCAATTGCGTAAAGATGCTGTGCACACACACAGGTACAGGACAGGCTATAAC
TGTAATACCAGAAGCCAATATGGACCAAGAGTCCTTTGGTGGTGCTTCATGTTGCTTGTATTGTAGATGC
CACATTGATCATCCAAATCCTAAGGGATTTTGTGACTTGAAGGGTAAGTATGTCCAAATACCTACCACAT
GCACTAATGACCCCGTGGGTTTTATTCTTAGAAACACAGTCTGTACTGTCTGCGGTATGTGGAAAGGTTA
TGGCTGTAGTTGTGATCAACTCCGCGAGCCCGTGATGCAGGCAGCTGATGCCCCAGCGTTTTTAAACGGG
TTTGCGGTGTAAGTGCGGCCCGTCTTACACCGTGCGGCACAGGCACAAGCACTGATGTCGTTTACAGGGC
TTTTGATATTTATAATGAGAAAGTTGCTGGTTTTGCAAAGTTCCTAAAAACAAATTGTTGCCGTTTCCAG
GAAGTTGATGAAGAGGGCAACTTATTAGACTCCTATTTTGTTGTTAAGAGACATACTATGTCTAATTATC
AACATGAGGAGACTATGTATAATTTAGTTAAAGAGTGTCCAGCTGTTGCTGTGCACGACTTCTTTAAATT
TAGAGTAGATGGTGACATGGTACCACACATATCACGCCAGCGTCTTACTAAATACACAATGGCAGACTTA
GTCTATGCACTTCGTCATTTTGATGAAGGTAATTGTGACACCTTAAAAGAAATATTAGTCACATACAATT
GTTGTGATGACGCATATTTCAATAAAAAGGATTGGTACGACTTTGTGGAAAATCCTGATATACTACGCGT
ATACGCATGCCTAGGTGAGCGTGTGCGCCAAGCTTTGTTAAAGACTGTACAGTTCTGCGATGCCATGCGC
GATGCGGGCATTGTTGGTGTACTCACCTTGGATAATCAAGATCTGAATGGGAATTGGTACGATTTCGGTG
ACTTCGTACAAGTGGCACCAGGTGCAGGTATTCCTATTGTAGATTCTTATTATTCATTGCTGATGCCCAT
TCTTACGTTAACGAAGGCATTGGCAGCCGAGTCCCATATGGACTGTGATACTACAAAGCCTCTCATTAAG
TGGGACTTGTTGAAGTATGATTTCACGGAAGAAAGATTATGTCTTTTTAACCGTTATTTCAAGTATTGGG
ATCAAACATACCACCCTAATTGTATTAACTGTTTGGATGATAGGTGTATCCTACACTGTGCAAACTTTAA
TGTTTTATTTTCCACGGTGTTTCCGCCAACAAGTTTTGGCCCACTTGTGAGAAAAATTTTTGTGGATGGT
GTTCCTTTTGTTGTATCAACAGGCTACCATTTCCGTGAGTTGGGAGTTGTACATAATCAGGATGTAAACT
TACACAGCTCACGTCTCAGTTTTAAGGAACTTTTAGTGTACGCTGCTGATCCTGCTATGCATGCTGCATC
AGGCAACCTGTTGCTTGATAAACGCACTACATGCTTTTCAGTGGCTGCACTGACAAATAGTGTTGCTTTT
CAAACTGTCAAACCTGGTAATTTTAATAAAGACTTTTATGACTTTGCTGTGTCTAAAGGTTTCTTCAAGG
AAGGAAGTTCTGTTGAATTGAAACACTTCTTCTTTGCACAGGATGGCAATGCCGCTATTAGTGATTATGA
TTACTATCGTTATAATCTTCCTACAATGTGTGACATCAGACAACTGCTTTTTGTGGTTGAGGTGGTCGAC
AAATACTTTGATTGTTACGATGGCGGTTGCATAAATGCTAACCAAGTCATTGTTAACAATTTGGATAAAT
CAGCTGGATTCCCCTTTAATAAATGGGGAAAGGCTAGACTTTATTATGATTCTATGAGTTATGAAGATCA
GGATGCGTTGTTCGCTTATACTAAGCGCAATGTGATCCCTACCATTACTCAGATGAATCTTAAATATGCC
ATTAGTGCTAAGAATAGAGCGCGCACCGTAGCTGGTGTTTCTATCTGTAGCACTATGACCAATAGACAGT
TCCATCAGAAATTATTAAAGTCTATAGCCGCTACAAGAGGTGCCACAGTTGTAATAGGCACTAGTAAATT
CTATGGTGGCTGGCATAACATGTTAAAAACTGTTTACAGTGATGTTGAAACTCCTAACCTTATGGGTTGG
GATTACCCAAAATGTGATAGAGCCATGCCTAACATGCTTAGGATAATGGCATCACTTGTTCTTGCTCGCA
AACATAGTACTTGTTGTAACCTTTCACACCGTTTCTACGGGTTAGCTAATGAGTGTGCTCAGGTACTTAG
TGAAATGGTTATGTGTGGCGGTTCACTCTATGTGAAACCAGGCGGTACATCTTCAGGAGATGCCACCACT
GCTTATGCTAATAGTGTCTTTAACATTTGTCAAGCTGTTACAGCTAATGTTAATGCACTTTTGTCTACTG
ATGGTAATAAAATTGCTGACAAGTATGTCCGCAATTTACAACATAGACTTTATGAATGTCTCTATAGAAA
TAGAGACGTTGATCATGAATTTGTAGAAGAATTTTACGCTTATTTGCGTAAACACTTTTCTATGATGATT
CTCTCTGATGATGCTGTTGTTTGCTATAATAGCAACTATGCAGCTCAAGGTTTAGTAGCTAGCATTAAGA
ACTTTAAAGCAGTTCTTTATTATCAAAACAATGTTTTTATGTCTGAGGCAAAATGCTGGACTGAGACCGA
CCTTACTAAAGGACCTCATGAATTTTGCTCTCAGCATACAATGCTAGTTAAACAAGGAGATGATTACGTG
TACCTGCCTTACCCAGACCCATCTAGAATTTTAGGCGCTGGTTGTTTTGTTGATGATATCGTCAAAACCG
ATGGTACACTTATGATAGAACGGTTTGTGTCCCTAGCGATAGACGCCTACCCACTTACAAAGCACCCTAA
CCAGGAGTACGCTGATGTCTTCCATTTGTATTTGCAATACATTAGGAAGTTGCATGATGAGCTTACTGGA
CACATGTTAGACATGTATTCAGTCATGCTAACAAATGATAACACTTCTAGGTATTGGGAACCTGAGTTTT
ATGAGGCTATGTACACACCACATACAGTCTTGCAGGCTGTAGGCGCGTGTGTGTTATGCAATTCACAGAC
TTCACTTCGTTGCGGCTCATGCATCAGACGACCATTCCTGTGTTGCAAGTGCTGCTATGACCATGTCATT
TCGACTTCGCATAAATTAGTGCTGTCCGTTAATCCCTATGTTTGCAATGCCCCCGGTTGTGATGTCACAG
ACGTGACGCAACTTTATTTAGGAGGTATGAGCTACTACTGCAAGTCGCACAAGCCACCTATTAGCTTTCC
TTTGTGTGCTAATGGTCAGGTTTTTGGTCTTTATAAGAACACTTGTGTTGGCAGCGATAACGTAACTGAT
TTCAATGCCATAGCCACATGTGACTGGACTAATGCCGGTGATTACATACTTGCTAACACCTGCACTGAGA
GATTGAAACTCTTTGCTGCTGAAACTTTAAAAGCTAATGAAGAGACATTTAAACTATCCTATGGCATCGC
CACTGTGCGTGAAGTGCTGTCTGATAGAGAATTACATCTATCTTGGGAGATTGGGAAGCCTCGACCTCCC
TTGAATAGAAATTATGTCTTTACTGGCTATAGAGTTACTAAGAACAGTAAAGTGCAGATAGGAGAGTACA
CCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTGTATAGAGGTACTACAACTTATAAGTTAAATGTGGG
CGATTACTTTGTGTTAACATCACACACTGTAATGCCCTTGACTGCACCTACTTTAGTGCCACAAGAGCAC
TATGTGAGAATAACTGGCTTATACCCTACACTTAACATCTCTGATGAGTTTTCTAGCAATGTTGCTAACT
ATCAAAAAGTAGGTATGCAGAAGTATTCTACTTTGCAAGGACCACCAGGTACAGGTAAGAGCCACTTTGC
CATTGGGTTGGCATTGTACTATCCATCTGCACGCATAGTCTACACGGCATGCTCACACGCGGCTGTGGAT
GCTCTATGCGAGAAGGCGCTAAAATACTTGCCAATAGACAAGTGTAGCAGAATAATACCTGCGCGAGCTC
GCGTGGAGTGCTTCGACAAATTCAAGGTTAATTCAACACTTGAACAGTATGTTTTCTGTACAGTCAATGC
GCTGCCTGAAACTACTGCTGATATTGTAGTCTTTGACGAGGTTTCAATGGCCACAAATTATGACTTGAGC
GTCGTTAATGCTAGATTACGTGCTAAGCATTATGTCTACATTGGTGATCCTGCTCAATTACCTGCACCAC
GCACATTGCTTACAAAGGGCACACTAGAACCTGAATATTTTAACTCTGTGTGTCGTCTAATGAAAACAAT
AGGTCCCGACATGTTCCTTGGTACGTGTCGCCGATGTCCTGCTGAAATAGTCGACACTGTCAGTGCTTTA
GTTTATGATAATAAACTTAGGGCACATAAAGGCAAGTCATCACAATGTTTTAAAATGTTTTATAAAGGAG
TGATTACACATGACGTGTCATCTGCAATCAACAGACCACAGATTGGCGTGGTTAGAGAATTTCTGACACG
CAACCCTGCTTGGAGAAAAGCTGTTTTTATTTCACCTTATAACTCACAGAATGCTGTGGCTTCAAAAATA
CTTGGACTGCCTACGCAAACTGTAGATTCTTCACAAGGTTCTGAATATGACTACGTCATATTTGCTCAGA
CCACAGAAACAGCTCATTCATGCAATGTTAATAGATTTAATGTTGCTATTACAAGAGCCAAAGTAGGTAT
TTTGTGCATAATGTCCGATAAGGACCTCTATGATAAATTACAATTTACTAGTCTGGAAGTCCCACGTAGA
AGTGTGGCTGTATTGCAATCAGAGAATGTAACTGGACTTTTTAAGGACTGTAGTAAGCTAATAACTGGCT
TACATCCTACACAAGCACCTACATACCTTAGTGTTGATACTAAATTCAAAACTGAAGGTTTGTGTGTCGA
CATACCAGGAATACCAAAGGACATGACCTATCGTAGGCTCATCTCTATGATGGGTTTTAAAATGAACTAC
CAAGTTAATGGTTACCCTAACATGTTTATTACCCGTGATGAAGCAATCAAGCATGTTCGTGCTTGGATTG
GCTTTGATGTAGAGGGTTGTCATGCAACTAGGGATGCCGTAGGTACAAACCTACCACTCCAGTTAGGGTT
TTCAACTGGTGTTAACTTAGTAGCTGTTCCTACAGGCTATGTTGACACAAGTGCAGCCACAGAGTTCTCT
AGAGTAAATGCAAAACCACCACCTGGGGACCAGTTTAAACATCTAATACCGCTTATGTACAAGGGTTTAC
CTTGGAACATAGTGCGTGTTAAGATTGTACAAATGCTTAGTGATACACTAAAAGACCTTTCAGATAGAGT
CGTGTTCGTCCTTTGGGCACATGGCTTTGAACTTACTTCAATGAAGTATTTTGTCAAGATTGGACCAGAA
CGGACGTGTTGTCTGTGTGACAAGCGCGCAACTTGCTTTTCAACTTCATCAGATACATACGCTTGCTGGC
ACCACTCTGTGGGTTTTGACTATGTCTATAATCCATTTATGATTGATGTCCAGCAGTGGGGATTTACTGG
CAATTTGCAGAGTAACCATGACCAACATTGCCAAGTTCATGGCAATGCACATGTTGCTAGTTGTGATGCC
ATCATGACTCGTTGTCTTGCCATTCACGAGTGCTTTGTGAAGCGCGTGGATTGGTCTGTAGAATACCCTA
TTATAGGTGACGAGCTGAGAATTAATGTAGCATGCAGAAAAGTACAACATATGGTTGTAAAGTCTGCTTT
GCTTGCGGATAAGTTTCCAGTTCTTCACGATATTGGTAATCCAAAGGCTATAAAGTGTGTCCCTCAGGCT
GATGTAGAATGGAAGTTCTACGATGTGCAACCTTGTAGTGACAAAGCTTACAAAATAGAAGAGTTGTTCT
ATTCTTATGCAACCCATCATGATAAATTTACAGATGGCGTGTGTTTGTTTTGGAACTGTAACGTGGATCG
TTACCCTTCTAATGCAATTGTTTGCCGGTTTGATACTAGAGTGTTATCTAACTTGAATCTGCCTGGCTGT
GATGGTGGTAGTTTGTATGTAAATAAACATGCATTCCACACACCTGCCTTTGATAAAGGTGCTTTTGCTA
ACTTGAAGCAATTACCATTTTTCTATTATTCTGACAGTCCTTGCGAGTCACATGGTAAGCAAGTCGTGTC
AGACATTGATTATGTGCCTCTTAAATCTGCTACGTGTATTACACGATGCAACTTAGGCGGTGCCGTTTGT
CGTCATCATGCATCTGAGTACAGACAGTATTTAGATGCTTATAACATGATGATTTCGGCCGGCTTTAGCC
TTTGGATTTACAAGCAGTTTGACACTTATAATCTCTGGAATACCTTTACTAGGTTACAGAGTTTAGAGAA
TGTGGCTTACAATGTTGTTAATAAAGGACATTTTGATGGTCAAGCTGGTGAAAAACCAGTTTCCATCATT
AATAATACCGTCTACACAAAGGTGGATGGTGTTGATGTAGAAATCTTTGAAAATAAAACGACTTTGCCTG
TTAATGTTGCATTTGAGCTTTGGGCTAAACGTAACATTAAACCTGTTCCAGAAATAAAGATACTCAATAA
TTTGGGTGTTGATATTGCTGCTAATACTGTTATTTGGGATTATAAAAGAGAATCACCAGCCTATATTTCA
ACAATAGGTGTCTGTACAATGACTGACATTGCTAAGAAACCTACTGAAAACGCTTGTTCCTCACTCACCG
TCTTTTTTGATGGTAGAGTTGATGGACAGGTTGATTCTTTTAGAAATGCACGTAATGGTGTTTTAATTAC
AGAAGGCTCAGTGAAAGGGTTAAACCCTTCTAAGGGGCCACCACAGGCTAGTCTTAATGGAGTCACATTG
ATTGGAGAATCTGTAAAAACACAGTTTAATTACTTTAAAAAAGTAGATGGCGTTGTTCAACAACTGCCAG
AAACCTACTTTACTCAGAGCAGAAGTTTAGATGATTTCAAACCCAGGTCACAAATGGAGGTTGATTTCCT
ACAACTTGCAATGGATGAATTCATAGAGCGGTATAAGCTCGAGGGTTACGCCTTTGAGCATATCGTCTAT
GGAGATTTTAGTCATGGACAATTAGGTGGGCTACATCTTATGATTGGTCTCGCCAAAAGGTCTTTAGAAT
CACTACTGAAACTTGAGGATTTTATCCCGATTGACAGTACTGTGAAAAATTATTTTGTAACGGATGCACA
AACAGGTTCATCTAAATGTGTGTGCTCTGTCATTGATCTTTTACTTGACGATTTTGTTGAAATAATAAAA
TCTCAGGATTTGTCTGTCGTTTCAAAAGTGGTCACGGTCACCATTGACTATGCTGAAATTTCATTTATGC
TTTGGTGTAAAGATGGACATGTTGAGACATTTTACCCAAAACTGCAAGCAAATCAAACATGGCAACCTGG
TGTCGCCATGCCCAATTTGTATAAGATGCAAAGAATGCTTCTTGATAAGTGCGACCTTCACAATTATGGT
GAAAATGCTGTGATACCAAAAGGAATAATGATGAATGTCGCTAAATATACTCAACTGTGTCAATATTTAA
ATACACTTACTATAGCAGTGCCTTATAACATGCGAGTTATACATTTTGGTGCGGGATCTGATAAAGGTGT
CGCACCAGGCTCTGCTGTACTCAAACAATGGTTGCCAGTTGGCACGTTGTTGGTTGATTCAGACATAAAT
GATTTTGTGTCTGATGCTGATTCTACATTAATAGGAGACTGCTCTACTGTTTATACAGCTAATAAATGGG
ATCTTATTATTAGTGATATGTACGATCCGAAGACAAAGCACATATTAAAAGAAAACGACTCCAAGGAAGG
ATTTTTCACTTACTTATGTGGTTTTATTAAACAAAAGCTTGCCTTGGGAGGTTCCGTGGCTATAAAGATA
ACAGAACATTCTTGGAATGCCGATCTTTATAAGCTCATGGGATATTTCTCATGGTGGACTGCTTTTGTCA
CTAATGTAAACGCTTCTTCTTCAGAGGCTTTCTTAATAGGTGTTAACTACCTTGGTAAACAGAAAGAATC
CATTGACGGATATACCATGCATGCTAACTACATATTTTGGAGGAACACAAACCCTATACAATTGTCTTCC
TACTCTCTTTTCGACATGAGTAAATTCCCACTAAAGCTTAGGGGAACTGCTGTCATGTCCTTAAAAGATA
ATCAGATCAACGATATGATCTGTTCTCTTTTAGAAAAGGGTAGACTTATCATTAGAGAGAATAATAAAGT
TGTTTTCTCTAGTGATGTCCTAGTAAATAATTAAACGAACATGAAATTTTTGGCTTTTCTCTGTCTTCTT
GGCTTTGCTAACGCTCAAGATGGCAAGTGTGGTACACTATCTAATAAAAGTCCATCTAAGCTTACTCAGA
CTCCTTCTTCTAGGAGGGGTTTTTATTATTTTGATGACATTTTTAGGTCTTCAATTCGTGTGCTTACCAC
TGGCCATTTTCTTCCTTTTAATACTAACCTTACTTGGTATTTGACTTTAAAGTCTAATGGTAAGCAGAGG
ATTTATTATGATAATCCCAACATTAACTTTGGTGATGGTGTTTATTTTGGTCTAACCGAGAAATCTAATG
TTTTTCGAGGTTGGATTTTTGGTTCGACATTAGACAACACAACTCAGTCTGCTGTTCTCTTTAATAATGG
TACACACATTGTTATAGATGTGTGTAACTTTAATTTTTGTGCTGATCCAATGTTTGCTGTCAATAGTGGA
CAGCCTTATAAAACCTGGATTTATACTAGTGCGGCTAATTGCACTTACCACAGAGCACATGCATTTAATA
TTAGCACTAATATGAATCCAGGTAAGTTTAAACATTTTAGGGAGCACCTGTTTAAGAATGTAGACGGCTT
CCTATATGTCTATCATAACTATGAACCCATTGATCTTAACAGTGGTTTTCCTTCTGGCTTTTCTGTTTTA
AAACCAATACTTAAGCTGCCTTTTGGTCTCAACATTACATATGTTAAGGCCATAATGACATTGTTTTCTT
CCACTCAAAGTAATTTTGATGCTGACGCTTCTGCTTACTTTGTGGGCCATCTAAAACCTCTCACCATGCT
TGTTGACTTTGACGAGAATGGCACCATTATTGATGCTATAGATTGCTCTCAAGATCCACTCTCAGAGCTT
AAGTGTACCACTAAGAGTTTTACAGTTGAAAAAGGAATTTATCAAACCTCTAACTTCCGTGTTACACCAA
CCACTGAAGTTGTTAGGTTTCCTAACATTACACAGCTTTGTCCTTTTAACGAAGTTTTCAATATAACCTC
TTTCCCATCCGTTTACGCGTGGGAGAGAATGCGCATTACTAATTGTGTTGCGGACTACTCAGTGCTTTAC
AATTCTTCTGCCTCCTTCTCAACATTTCAGTGTTATGGCGTTTCACCTACAAAGCTCAACGATTTATGCT
TTAGCAGTGTTTACGCAGACTACTTTGTTGTGAAGGGTGATGATGTACGCCAAATTGCACCTGCTCAGAC
AGGTGTGATTGCTGATTACAATTACAAATTGCCTGATGATTTTACAGGTTGTGTAATAGCCTGGAATACA
AATTCTTTGGACAGTTCCAACGAATTCTTTTACAGGAGATTCAGACATGGAAAGATTAAACCTTATGGGC
GTGACCTTTCCAATGTTCTTTTTAACCCTTCAGGTGGTACATGTTCAGCTGAAGGTCTTAATTGTTACAA
ACCACTTGCCTCCTATGGATTTACACAGTCCTCTGGAATTGGCTTTCAACCATACAGAGTGGTTGTGCTT
TCTTTTGAGTTGTTAAACGCACCTGCTACAGTTTGTGGGCCTAAACAGTCTACTGAGCTAGTTAAGAACA
AGTGTGTTAACTTCAATTTCAACGGACTTACAGGCACTGGTGTGCTTACTAATTCTACTAAAAAGTTCCA
ACCTTTTCAACAGTTTGGGCGTGACGTTTCAGATTTTACGGACTCCGTCAGAGACCCTAAAACCCTTGAG
ATTCTTGACATTGCACCTTGTTCATACGGCGGTGTCAGTGTTATAACTCCTGGTACAAATGCTTCTAGTT
CAGTGGCTGTTTTGTATCAGGATGTTAATTGTACAGATGTGCCTACTATGTTACATGCTGATCAAATTTC
TCATGATTGGCGTGTGTATGCCTTCCGTAATGATGGCAACATATTCCAAACACAGGCTGGTTGTTTGATT
GGTGCTGCTTATGACAACTCATCTTATGAGTGTGATATTCCTATAGGAGCTGGCATTTGTGCTAAGTATA
CGAATGTTTCTAGCACACTTGTGCGCTCCGGTGGACACTCCATACTAGCTTACACCATGTCTCTTGGTGA
CAATCAAGACATTGTTTATTCTAACAACACCATTGCTATTCCAATGAATTTTAGTATTAGTGTCACTACT
GAGGTCTTGCCTGTTTCAATGACTAAGACTTCAGTAGATTGTAACATGTATATTTGCGGTGACTCCACTG
AATGCAGTAATTTGCTGCTACAGTATGGTAGTTTCTGCACGCAGTTAAACAGAGCTCTTGCCGGTATAGC
TGTGGAACAAGACAGAAATACTCGAGATGTCTTTGCACAAACTAAGGCCATGTACAAGACTCCTTCTTTG
AAGGATTTTGGTGGTTTTAATTTTTCACAGATTTTGCCAGACCCCGCTAAACCGTCTAGTAGATCTTTTA
TTGAGGACTTGCTTTACAACAAAGTCACACTTGCTGACCCAGGTTTTATGAAGCAGTATGGTGATTGTTT
AGGTGGTGTTAATGCTCGTGACCTCATTTGTGCACAAAAGTTCAATGGGCTCACAGTACTCCCACCCCTA
CTCACTGATGAAATGATTGCGGCATACACGGCAGCACTAATAAGTGGAACGGCTACGGCAGGTTTTACTT
TTGGTGCAGGTGCTGCGCTTCAGATACCTTTTGCGATGCAAATGGCTTACAGATTTAATGGCATTGGTGT
CACTCAAAATGTTTTGTATGAGAACCAGAAACAAATTGCTAATCAGTTCAATAAGGCTATCTCACAAATT
CAGGATTCCTTAAGTACTACTACTACAGCACTTGGCAAATTACAGGATGTGATTAACCAAAATGCCATAG
CCCTTAACACACTAGTTAAACAGCTTAGCTCCAATTTTGGTGCTATTTCTAGTGTACTGAATGATATTCT
GTCTCGACTTGACAAAGTAGAGGCCGAAGTTCAAATTGACAGGCTTATAACAGGACGTTTACAGAGCTTG
CAGACTTATGTTACACAGCAACTTATCAGAGCCGCAGAAATTAGAGCCTCTGCTAATCTTGCTGCTACAA
AAATGTCCGAGTGTGTACTTGGCCAGTCTAAGAGAGTAGACTTTTGTGGAAAAGGATATCATTTGATGTC
CTTCCCTCAGGCTGCTCCTCATGGTGTAGTTTTCTTACATGTTACTTATGTACCATCGCAGGAACAAAAC
TTCACTACTGCACCTGCTATTTGTCATGAAGGTAAAGCACACTTTCCTCGTGAAGGCGTCTTCGTCACAA
ATGGCACACACTGGTTTATCACTCAGCGAAATTTTTATTCGCCTCAGCCTATTACTACAGACAATACATT
TGTGTCAGGCAATTGTGATGTTGTCATTGGCATTGTTAATAACACTGTCTACGACCCACTACAGCCTGAA
CTAGACTCATTTAAAGAAGAACTTGACAAGTATTTTAAAAACCATACTTCACAGAATGTTAGTCTTGATG
GTCTTAACAACATAAATGCTTCAGTTGTGGACATTAAAAAGGAAATTGAACATCTCAATGAGATTGCCAA
AAGCCTAAATGAATCACTCATCGACCTACAAGAACTAGGCAAGTATGAGCAGTACATTAAATGGCCGTGG
TATGTGTGGCTTGGCTTTATTGCCGGTCTCATTGCCATCGTCATGGCTACAATTATGTTGTGTTGCATGA
CCAGCTGTTGTAGTTGTCTTAAAGGTGTTTGCTCATGTGCTTCATGTTGCAAATTCGATGAAGACCACTC
CGAACCAGTGCTTACTGGAGTGAAGTTACATTACACATAAACGAACTTATGGATTTGTTTTTGAACATCT
TCACTTTAGGATCTATTACTAGACAACCTGGTAAAGTTGAAAATGTTTCTCCTGCAAGTTCTTTTCATTC
TACAGCGTCCATCCCTTTACAGGCCACTCTACCTTTCGGATGGCTTGTTGTTGGCGTTGCATTTCTTGCT
GTTTTTCAAAGCGCTGCGAAATTAATACCTTTTAACAGTCTTTGGCAGCGTTGCTTATACCAGAGCTTTC
AATTGCTTTGCAATGTGCTTCTTATTGCTTTGACAGTTTACTCGCACTTACTGCTTGTTGCTGCAGGGCT
TGAAGCACCTTTCCTTTATCTACTTGCTTTGATTTACTTCTTACAGTGCGTTGTATTTGGCAGGCTTCTT
GTCAGATGCTGGCTGTGCTGGAAATGCAAATCAAAGAATCCATTAATTTATGACTCAAACTATTTTGTTT
GCTGGCATACTCACACTCATGACTATTGTATTCCTTACAATAGCATTACAAACACTATCGTCCTCACTGC
AGGTGATGGTGTCACTATTCCCATTCGGACACAAGACTACCAAATTGGTGGTTACTTCGAAAAATGGGAA
TCTGGTGTTAAGGACTATCTTACACTTATTGGTCCTTTCACTGAAGTTTATTACCAGCTTGAATCTACCC
AGATTTCCACAGACACTGGTATTAATAATGCGACATTCTTCCTCTTCTCAAAGAATGATGAAAGAGAACA
GGAAAGTGTCCAAGTTCACACAATCGACGGCTCATCAGGAGTTGTAAACCCAATTTACGATGAGCCGACG
CCGACTACTAGCGTGCCTCTTTAAGCACATTGATTGAGTACGAACTTATGTACTCATTCGTTTCAGAAGA
AACCGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTAGCTTTTGTGGTATTCTTGCTAGTCACCCTA
GCCATCCTTACTGCGCTTCGATTGTGTGCATACTGCTGCAATATTGTTAACGTGAGTTTAGTAAAACCGA
CTTTTTACGTTTACTCACGTGTAAAAAGCTTGAATTCCTCTCAGGAGGTTCCTGAATTTCTGGTCTAAAC
GAACTAATTATTATTTTTATTCTTTTAGGAACTTTAATATTGCTCTCTATGACTAACAGTAGTGCTTCTC
CTCCTACGGAGACCATTACCGTAGAGCAGTTAAAACACCTACTTGAGCAATGGAACCTAGTTATAGGTTT
TCTGTTTTTCGCTTGGATTCTGCTACTACAGTTTGCTTACTCCAACAGGAACAGGTTTCTTTACATAATA
AAGCTTGTGTTTCTCTGGCTTCTTTGGCCAATTACACTAGCCTGCTTTGTGCTTGCTGCCGTCTACAGAA
TTAACTGGGTTACAGGAGGCATAGCTATAGCGATGGCCTGCATTGTGGGTCTCATGTGGCTTAGCTACTT
TGTGGCTTCATTCAGGCTTTTCGCACGGACCAGGTCTTGGTGGTCTTTTAACCCAGAAACCAACATTTTG
CTTAACGTGCCACTACGTGGTACCATTCTGACCAGACCGCTTCTTGAGAGTGAACTTGTCATTGGTGCTG
TGATCATTCGTGGTCACCTCCGTATGGCTGGACACTCCCTTGGACGCTGTGACATTAAGGACCTCCCTAA
AGAAATCACTGTTGCTACATCACGAACTCTATCTTATTACAGATTAGGAGCCTCCCAGCGTGTAGCATCT
GATTCAGGTTTTGCTGTTTACCACCGCTATCGTATCGGTAATTACAAGCTAAATACCGACCACATAGGCA
GTGACGACAATATTGCTTTGCTAGTACAGTAAGAGACAACAGATGTTTAGTCTAGTTGCTTTCCAAGTTA
CCGTAGCAGAGTTGTTAATTTTAATTATGAAATCTTTTGGATTGGCACTTACTCATATCCAAATTGGTAT
AGTTTCATTATTAAAAATCCTAACAAACCGTCTAGATAGAAGGTATTCTAAACTAGACGAAGAAGAACCT
ATGGAAATTGATCATCCTTAAACGAACATGAAATTTCTTTTACTCGTGGCAATTGTAAGTATAGCATCAG
CAGAACTTTACCATTACCAAGAGTGTGCTAGAGGTACAACCGTACTCTTAAAGGAGCCTTGCCAACCTAA
TACTTACGAAGGCAACTCACCTTATCACCCTTTGGCTGACAACAAGTTTGCTATCACTTGTACAAACACC
AAATTTAGTTTTGTTTGTCAGGACGAGACAAGACACGTATTTCAATTACGTGCCCGGTCTATTTCACCCA
GACTTTTTGCCAGTCCAAAACATCATAGTGACGATTTCACCCCGGTGATCCTTATTATTGTCACATTGCT
CTTTGTAATCTACTGTTGCATGAAGAGACAATGATTCATTTAACTTTGTTTGATTTCTACCTTTGTGTCC
TATCTTTGCTACTTTTCTTGGTCATTATAATGCTAATCATCTTTTGTTTTGTGTTAGAATTACAAGATCT
AAACGAACAATAAAATGACTGATAATGGACAATCAAACTCGCGTAATGCGCCTCGCATTACGTTTGGTGT
CTCAGATACCTCAGACAATAATCAGAATGCAGAACGTGCTGGAGCGCGGCCAAAGCAAAGAAGACCGCAA
GGCCCTCCTAACAACACAGCATCCTGGTTCACAGCTCTCACTCAGCATGGTAAAGAAGGTCTCTCCTTTC
CGCGAGGACAGGGAGTGCCCGTTAATACCAATAGTACCAGGGACGACCAAATTGGCTACTATCGCAGAGC
TACCCGACGAGTTCGTGGTGGTGATGGTAAGATGAAAGAACTCAGCCCGCGCTGGTACTTCTACTATCTA
GGAACTGGACCAGAGGCCGCATTACCTTATGGTGCTAACAAAGATGGCATAGTTTGGGTCGCTACAGAAG
GAGCCCTAAACACGCCTAAAGATCACATTGGCACGCGCAATCCCAACAACAATGCTGCCATTGTCATACA
GTTACCACAAGGTACTACCTTGCCAAAAGGCTTCTACGCTGAAGGAAGTCGTGGTGGCAGTCAAGCCTCC
TCGCGTTCTAACTCACGTAGCCGTGGTAATTCCAGAAATTCAACACCTAGCAGCAGCAGAGGTTCATCAC
CTGCACGCATGGCTGCCGGAGGAGATACGGCACTTGCATTATTGCTGTTAGACAGGCTGAACCAGCTTGA
GAGCAAAGTTTCAGGTAAGACACCACAACAATCACAGGTTGTCACAAAGAAAACAGCTGCTGAGGCTTCT
AAAAAGCCCAGACAGAAAAGAACAGCTACCAAAGCCTATAATGTTACTCAGGCTTTTGGTAGGCGAGGTC
CCGAACCTACACAGGGAAATTTCGGTGACCAGGAATTAATCAGATTAGGTACTGATTACAAAAATTGGCC
ACAGATTGCACAGTTTGCACCCAGTGCTTCTGCATTCTTTGGCATGTCCCGTATAGGAATGGAAGTCACA
CCTACAGGGACTTGGTTAACCTATAATGGTGCCATAAAATTGGATGATAAAGACCCAAATTTCAAAGACC
AAGTTATTCTGCTTAATAAGCACATTGATGCTTATAAGACATTTCCACCTACAGAACCTAAAAAGGACAA
GAAGAAAAAGGCTGATGAAGTACAGTCACTGCCGCAGCGTCAGAAGAAACAGGCAACTGTGACTCTGTTA
CCTGCAGCAGATTTGGATGATTTTTCCAAACAACTTCAGAATTCCATGAATGCTTCACCTGATTCTACTC
AGGCCTAAATTCATGTTGACCACACAAGGCAGATGGGCTATGTAAACGTTTTCGCTATTCCGTTTACGAT
ACATAGTCTACTCTTGTGCAGAATGAATTCTCGTAGCTAAACAGCACAAGTAGGTTTAGTTAACTTTAAT
CTCACATAGCAATCTTTAATCAATGTGTAACATTAGGGAGGACTGGAAAGAGCCACCACATAGTCACCGA
GGCCACGCGGAGTACGATCGAGGGTACAGTGACTAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTA
ATGTGTAAAATTATTTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAA
AAAAAAAAAAAAAAAA

>gi|807743898|ref|NC_026812.1| Chinook salmon bafinivirus isolate NIDO, complete genome
ATTGAATTACCAATAAACTACCACCCGCTATTATAGCACTAGACACTAGCGAACTGCTAGCTCCTCCAAG
CTGCACAACGCAAACTGTCTTTTTAACTCTCCTAACCTCGAACGCAGCGCAGGTACCCTCACCCGGACCA
CGCGTGTGCCCTTGACTGGAAACCCTACCTTCGATCAGGCCTTCGAACGCAGCAAAGGTACCCTCACCCG
GACCACTTGTGTGCCCCTACGCCTGCTCTTACGTAGCCCCATCCTACCCACCCGCCAACTCTTAACCTAT
CAGCTTTGCCCACCGTGACGACTAGACGTGATCTAACTGCTACTACCAATCCTACTACAACCAACTTGCC
CACCAAGACGACTAGAGAGTGACGTAACTGCTACTGCCTAAGGCACTACCAGCGAAATCATAATCTGCTC
CTCTTGACCCAAGACGGTTTGGAACGGTGCTACTAGTGAACTCACTTCTGCTCCTTACGACCCAAAGACG
GTTATTATTTGGAAAACCTCCTACAGACTAGAGTCTTCAATCTCCACTGCTACTGTCGAAGTCGGTGTGC
TGCCTTTATAAAGCCGGTGAACTGCTACTGTTCTCAGAACATTATCACGAATCCTGCTGAATTTTGCCAG
CTATCCCTCCAAGCGCTACTAGTGGCCTCTTGCCTCTACTCTGCCCCTTTACCTACTCAATATAACTTAA
ATCTCTTCTAGAATCGCGCTAGCGCAAACCTTCACCGGTAACCGCCACAACGTCCTACAAGCTCTCAACC
AACGGCACTTTGTTGCTAAACCCTACGTGCAAGCATCTTTTTGCTATAACATCCACGTTCGAAAATCAAC
AAAAATGCCCAACATGCGAATCCGCAAGATTGCTCCTAAAGCCGCTGTTAAACCAACCCATAGCGGCCCA
AGAGTGGTCTCCAATCCCGCAAGCTGCCACATTTATATCGGACCCCAACTGCGTGCTCACAATTACCCGA
GCGTGCTAAAGGGCTCCTTTAAGGCTGCCAGCGAGGAAACCATAACAGCTATCAACCTAATTGCCACCGT
CCGCAAGGATGCTGGTATTTCAGGTCAATATGCTGGGAAGATGGGTTATGACCCCGAGATGGGACTTTTT
GYCTCCGTTGAAGGTGTTCGTGCCCTCCAAGCTTCCAAACTCCAAACTGCCCTTGAGGCAACTAAAAAGG
GTACTAGACCCTTTGGCCTTTTCAGGCCTAAACAGAGAGTGACTAACACCCACGCTCAAAATTTGCTAGC
CCTCCACCGTGCTAGCTCCACCGGCCCTTGGACCAAACACTTACCATCCCAAGGTCCCATAGGTAATTGC
CTCGCAGAATTCATGCAGGAGTACACTACCACAATTCCACCATTTGATAGTGTTCTCACTGAAAACGGTT
GGCAATACGCTGTCACGATTGACGGTGTGACTAAATCTCGCCTCCCATACACCGAAATTCGCCGCGGTGG
TTATGAATTTACAACAACTAATTACCACATCGGTGCAATCCAGGTTACTGCCAATCATATTGGCAAAGTA
AACCCTGGAGATACTGAATTGGACTGTCAATATTTCATGTTGACACGCAATCAAAAGCCCCAAAATTTCA
CTGCTGAGCAACTCGAAGGAAACATCCACAACATCATCTTCGACCTCAGTCACGAAACTGGCAAACCCAA
ACTTTACGGAATGGAAGAAGCCACCAAATTTAGAGTGACCACCACCGCACTCAAACCAACTCAATTTAAT
CCGGCCCCACCACTAGATAAACGCCCACTTAATATCCGCGTTCCTATGGCCCGTGTCTCAGTTCAGATGT
CCCACTCAGCTCTTCAAGCTGCAGTCCAACGTCAAAAAGCTGATACTACACCTAATAGTTGTGTTCGACG
CCTTAACACCGCAGTCGCTCAAGCTCTCCACGGTTCAGATACCACTTGTGTTACACCACACAACAACCAT
CTTGGTATCATGAATACTTACACCCCCATCCATGGAACTGAATACAACGATATTCATAATTACATATGGG
CAGAAGTGATTTACGCAGGTAAATATCAAACCCGTAATCTCTCCTTCTTCGCCTCATACTACAATCATCA
CGTTGACATCCACACTTGTCTGCGTGGTGTGTATGATTATGAAGAACTTCTCGATGTATCCGGTCTACCA
TACGGTGCAAAATTCTACCATCTCATCTACGACTTTAACAAAATCGGCTTGAAAACTCGCACAATTGGCG
AAACACGACAATGGGCTGGAACAACACCAAAAACACCCAAGAAAAAGCTTAGACTTGTAGCTATGACATC
AACCCCCAGCGCTACTCCATCAACCGCACACCTAGCACCCCCAACCACCACACGCACACCACTCAGAACA
CACATCTCAATTGGCCCGCACAACTGCACCATCATTGATATCAACAAAGCTCAATTTGCTTTCGACAACT
ACACCTCCCAACTCCCTAACTCTTGTGTTCACCGTGCCAACAAAGCTGTCTGCGCCGGTTTGAATGCTGA
TCTTCTTTCTACCCACTTTAACCACCTCTCTAAAGTAGAAACATCTAAAGGAACTTACCAATGGGTACAT
TTTAACCCCAAAACTACGGCTCCTGCTATCCAATTCTACGTCTTGCAATTTCAGAACCACGTCTACCTAC
GTCTTCTCCCCATGCCTATGAACCTTTCTTTCCGCACCATCTGTGACATTGAAACCGCCCACGGTCAACC
ACACCCAACTTACACAAGCCCAGACTGGCGCGTGTATTACCTCGCAAAGTACGATCCCACCAAAGTACTC
AGAGTTCAAGTTGTTGATTGGGCAGGTTCAGATACCATCACTGAAGATCATGTCACCCTCTTCCCACGCC
GACACATTATGACTAAAGTTTTGAAAAACGACCAAACTAAAGTTAACTACATCGACCCAACTAAAGATGC
AGCAACAACACCCTTCACAATTGAAACAGTTGAAGGAGGCAAAGTTGAAGTACTCTCCGCCAACGTCATC
CGCCAAATTAACATTGAAACTGGTCGCGGCAAGAAACGTAAAACAGCTAAATTAGATGTAAAAATTTCAA
TTAGAGTTAAAGCTACTAAAACCCGCACAACAATTCACGTCTTCATAACCCAAGCAAAAGATGAAAGCAA
AATCGTCACTCCAACCTCAGAAATGCAGGGAGTAGTCGACGTTTTAATTTCCAGAGCATGTGTCCTCTCA
CAACACGCAGGACCTGACATGACTTATGAACTGCACACACCTGACGGTTCTTGCACTAACCCCCTCGTTC
AATTCTTTGAAGAAGAAGGCGAGGTTCCTGAAGATGTTTACGATCTCTTCCCACCTGTAGAACGTAACGC
TGAAGGCTTAGTTATGTGCATGCCAGAAGGTTTTGCCCTCATCTCTGGTTGCATTCCTCATCCACTTGCT
TACTATGCTGACAAGTACGGTCAAACACTCGTACCTGAATTCAAAGTGACAAGAACTCACGTTGAACGCG
GCCCCATTCCACCATCACGGTCCATTTACTACACATTCATCCCAATTAATGTAGACTCCATCCCACCCTT
CGGACACACCTACAAATCCCTCGCCAAACTTAACACATTTAACCTGGGCTGGGAAGATCAAGACATGTTA
GATAACGCTGACACCCTCCTTCCATGTCTCTTAGAAAATGAAAACATGAAACTTTACCTAACATGGAAAA
TCATCGCCCGTGACTTCTCAGATAACACCACTGAAACAGCCCTTACCACCTACACTGATTTTACAACTAG
TGATTTCACCCCAGCTAACCAAACAGGATCCAGCTCTCAATCCCTTAGCTCTCCACCTCTTTCCCAACTC
TCTTCCCACAAATCTCTTGCTAACCTCTCAGAAATTGGCTCAATAGATAACATCCCGGAAAACACCCCTG
AAACAATCCAAGAAGAAGAAGATATCGAAGAGGAAGTAACATCTCCTGTTCAACTCACACCCAACACACT
CCAAGAACAAGCTACTCTCAACGAATCCATTCAATCACTCGTTGAATCAGTTGATTCTGATGTCCCCTAC
ACCTGGGAACAACGTGTTGAAGAAAGTGAGGTTGCAACTATTGATTTACAAGCTGTAGAATTAGATCAAA
CACCTGCTCCTACAACAATTCAAGGTCACAATTTCTCCCTCTTACTCACCGGTAACACAATTGGCTGCCA
CAATAGTATCATCAAACTCCTCGGTGAAACTACTCAAACGCTTACAGAAACATCAGATCAAATAAGCCAC
TTCACCCTTGCTTTCTGCCCTATCGTTTCTCGCGCCGGAACTGACATCCAAGCTGCCCAAGATAAAATTG
ATACTCTTTCCAAAATTAAACCTGCAATCATCATCGTACTCCACCACACTTTCGATGTAAACATGGTTAC
TCCTGAATCTTCCACAGCAATCACACGCTCTAACACACACGCTGTTGACATGCTGTTCCATGAAGATCAA
GGATTACTTCAATGCCAGAAGAATTATAACGCTCTGGCTAAAGTTGCAGATTTAATCCACCTTGAAACTC
CACCCAAAACATCATGGCTCGGATATTTCCAATCACTAATTACATGGCCAACCAAGGTCAAAACACCCAC
TACTCCCACTCCCACCACTCTCTCAATAGAAGCAGTGCAAGAATGGGTCAACGCAACATCACCTGACCTT
GCTACAGTAGACTGGAACAGTGCAATAACTGAACAGGAAACCACAGTAACTTCACTAATAGAAGAAATCT
CCCTACGCCCCAACACCAACAACACCGGCTATAACTTGTTTAAACCTAACCAACGTAACAACAACAGCCC
ATCAGACTACCTATCACGAACAACATCAGCAACCAAACACTGCTTAATCAACGGTCTTACTTCAGGTTCC
ACCATCCTTGAAGTCGGATGCGGATATGGTAAAGAATTTCACAAATACAAGAACTCTAACATCAAAGTTG
TTGCTTTGGAACCTCACCATGAACGCTACACCGAAGCCGCGAAGAAACTACCACCAAATTCTACCATTTA
CAACAAGACCCTAGAAGAATACAACCAAATTGTCATTAAAGAACAAATTGACGCCCTAGTTTCCTTTAAC
GCCATTCATTACAGTACAGTTACTGAAGCTCTTAAAGCATGTAACCTTGCCAAAGATCAAGTTGTCATTT
TAACACCAAATCATGATAAACTTAAAGCTCTTCACGATAGTAACACAACCATCACAAATTACAAAATTGA
ACTTGCTAATAATAAATTTACATTTACAATCGGCCAAAACACCTACAGCGAAAACTACTTCTCACTTCAG
GATTTCATGATTGGAATGCATGCCAGCAACTTCATGCTTTCTTCCCGCTCTTGTACTCTGCTTGAACATG
TTAACACCTTCAATGCCCACCTCTTAATTGACGCCACAACAGAAACAACTACCCTGCTAGACGCCTATGA
AGTACTCGTCTTCATAAAATTTAGACCACTGCTCCTCACCTACTCCAACACCGCTCTTGCAACTAACAAC
TCAAGAACAATCCGCAGTGCACTCTCACGTCTTATTAACTTCCGTGTCGCACCATCTAAAACAACATCAC
AGGTACATGTTCACATCCTCACCCGCAACGACCACGTAACCACAGAACAAGAACATCTAGACTTAGCAAA
TATTGAAATTGCCCACATGAACCCAAAACCAGCAATTATCTTTGTAACTTCCTCCCGATCCAGACATAAT
TACACCACCCCAACTGTCTTCTTCGACTTTGCTACACTATCAGCCCCCACCCTCCCAGAACAGCTTAAAC
CACTCACTGATCTAGCCCTCGCAATCCAACACACTGCTACCAAAACTCCAACAACAGTACTTACAACTGC
CCCAGAGGACCCAAAAACCCTCCCAACAGCACCCACCTCCTTTACAAAACCTTCCCGTAAACGCTACCAC
TGCTTCCACGATTTAACCACCCTACCAGTTAACAAAAATTTCATCTTAGTTAACGCAGGTAACCCCCACT
TAAAATCAGGTGGTGGAATAACTGGAGCCGTCTATAATCGCTACGGCCAAGGATTCATGCAAACTAACAA
CAGCATGCATGCTACACAATTACCTCTTGAAGTTGGTGACGTCTTGGAATACCCCTCTGACCGTAACAAC
CTGATTAACGTGACAGCCCCCTGCATCAACATCAAACACGCAGATTACAAAGGCCCACAACCAGCCCACG
CACTACTAGCAACATACAACGCAATTATTAACTACGTTGAACGTAAGTACGATAATGGTGACGAGAAACA
CGTCTTCATTCCTCTACTTGGTGCTGGATACTACGGTTGGTCACAGACTCAAAGCCTTCAAGCTTTTCTA
TCCGCGACTGATAATAGTTTCCGCAACACATATGTTCTACTCCTACACCCATCATCTGTAGATGTTGAAA
CAGCTGAAGTATTTGCCAAAATGCTCGCCACTACTAACCCACACTACTACCATGTTGAGGGCATAGCTAA
AGTTAATGCCAACTCTTGCGTTCTGCGTGCCCACATTGACCTTGCCCGAAAAACATCTTACCCTCAACCT
AGCTTAGGATTAATCGGCGCTTACTGGATGTACACCTGCCCCACCCTGGCCGCCCCATTGATACAAGCTG
GCATGCACGGTCCCAACACCTGGACTCCTGGCAGCTTTATTGATACTAGTATTGCTGAAATGACTGCTCG
CGCTTACAAAATAAATCTTGTTTGCGACGGTTGCTTCACTGATATCATCAATTTCAATCCCGACCAAGGT
TTAATCTGCAATACCTGCAAGACACCTGTCACTCTCCGAACAAACTATTATCGCCCACGCCTCCCACACA
TGATTAAAAATAGTCACGGACAACCCATCCCTAACATTACTCTAGATGGAGTTTACCACATGGCTACGCA
CCAATTGTTCCTAAATTCGGTACTCTTTAAAGATTCACATGCTTTCACAATTAACAACTTAAGTGAATGT
GATCTCCCAACAACCACAGCAGTAGCAACCTACTTCTACAAACCTTCAGATGCCTTAAACTTCTTCCTGA
ACTTTAACTCTGCTCTTTCTGCTAAAGTAACCTACACACCAGAACAGATAACACAAGCCCAAACCGCCCC
TCAACTGACGACTGACGATGACTACTCAGACTTGGACATTGACACAATCAAACCTACACCTACCACTCTA
CCACGCGCCCCAACACCGCTTTCAATTAGTGATAGTAGCGAAGATATCTCACTCTCCGATGACACCCGCA
CCGTAGCATCCCATCACGCTTCACAAATGTCCATATCAGCCGACACAACTAGTGATAGATATAGCTCTAC
AAACTCTCTAGCTATCTCAGAAGATATAACATTTCAAACAGGTGACGGTGAAACAACAACTTCACTTCTC
ACTGATTCGGTCCTATACTACTCTGTCGTTACAGTCTTACAACTACGTAAAGCAGAGGATTGTGTAGAAC
CTGATGTAGAAACTATTAACCTAAGACCCAACTCATCGCTCCACACCCTGACACATGACACAAACGCCAT
CGACCAACTTTACATCCAAGTGGCTTCTGATGCTTCAAATCACACTGTAATTAATAACACCACACTTGAA
TCTATTTCGAAAACAATGTGTGTGAAAAACTCCTTGTACACCCTTCTTACCAACTCAAAGTGTATAAGTC
ACCACATCATAGTTACAGGATATGACCAACATGCTAATGAAACACATACTATCAAAAGTGTCACGCGCCA
AGCCATGCTCGCCATCCAACCCCTTTCACAACTTACGTCCACACACGTTTACAGCACACTTGAAGAAGAT
ATTTCCACCATCTTCCAAACTGTCGTCCTAGAACATGTCAACCACACCAAGCTTTTCACTTACAACACCA
AGCTTCACTACGCAACCACAGTACCAACAAACCTACTCATCGATGGAACAATCGAAGATGTTCAAGGTAA
GCTGCGCGAAGTTGATCTTGGCATTGTTGTTCCTTATCATTGTGAAGTTGACGAGCAAATTGAATACACA
AATGCAATTGGCGACGTTCTCTACCAAAACACAAATCACCACTCACCACTAGTGACCTTTGTTTCTATCG
ACAAATCTTTTACTAAACGTATTTTTAATTCTTTAAAGTTTCAAACTCTACAGAACCTATGGCTCTACCT
TATTACCCTACAAGTATTTTTCACAGTTAAAGGAATTGGCTTCGGCTTCAGCTCAACGGAACCAAACACA
CAACTCATGAACGGTCTCTGGATACAATACGGCATCTTCTACTTCCAAGTACACCTCCAAACCCTCATCA
CCCACCCAGTGAAAAATGGCTACAGACTACTTTCATTACCAATCATGCTATACAACAAAGGCAAAAGATT
CACCGAACGTTCAGTCCAAACAATGACGGGAGAAATCGTTAACACACGAAAACCCTCGTTATCAAACGCT
GTACAAAAATACGGCATTAACACTCGACTTGAATACGTTGATATCTTCGATCTCCTCCACTATACACCTG
GATACATCGCATTTAACATCGCCTTGTTCTATCTCTTTGCTGGTAATGGCTATATAACATTCTTAGCCTA
CATCATCCAATTCTTCACCGCTCGCGATATCTACAGACTCTCTAAACACCTCTACACAGTCTCAAAACTC
ACCACCTTCCTCGCGAAATTTAAAACAGCAACCACCCGTCACGTCTTGTACGCTACCAACCAAGTAAACA
ACCGTTCCCTTCATCTCACCCTCGGATCCACAACAATTGACTTACTCAGCTTTACAAGCAAAGCAGCTTT
CCTTGCCCTGTGCTCCTCCTTCATCTCATGGCATTTCGGATTAGCTCTCGCCGGTGGTCACTCTGGTGAA
GACTACTCTCAACCACCCTACCACGCAGTATTTCAACATGCACTCCGCACTTTCGGACTTATTCCTCCTA
AAGAACATTACTACAGCTACCCATCCCTAGCTTCAGCCTGCGCAGACTCATCAGCCCCTCTCTGCTTCCT
CGGAACACCATTTAACTTCCACTTCCCATCATCCTACACACAAGCAGCATCCATGACTACAGAACACGTA
GTACCATTCTGGATCCAACTAATCATCCTAGCCCCACCATCGCTTTTCTTAGTTGTCATTCCGTGGCTGA
TCACAATGTTCATCTCACCAGTATTAACATTTAACCAACTTTTGCTCCCTGCACTCGCCGTACATTTCTT
AGCTATCTATGTAATCTACCTTTACTATTTCAAAAAATCATGCTGCCATTCTCACACATGCCTTAAACAC
GCTAAATTAGACCGCCCCATCCAAATTAAAGGCCTTTTCGATTTATCCATGTACTTCAATCACAATAAAC
TTTGCCCCCGCCACAACTTCTACTGTAATAATGCTGACGAACCTGGCCACACACTTGGACCCGTCCTAGC
AGCTCACATCACTGAATTTTACCATCTTAAACCTGGCACTATTAAGCCCGATGTCGCCCTAGTACACACA
GAACACCACGCTTCTCTGAGTCGCAAAGAATTGAAGAAACACGACGACCCAACCGATTGTGTCTGGACTG
CCCCACAAGGCGCTGCTGATACTCTCGTTTACGAAGCCTACTCCCATTTGAAAGGAGTCCAAATTCGCAT
TGATGCCAACACCGATACAACAACTCGTAGCATGCCTATTCCCATGGGCGCCAAAACAACATCTTCTCCA
GCTACAGGTGTCATCAACACAAAAGTTCTCGGCCATCTTAAAAGACATTGTAAGAAACCAGCTCTCCAAT
CTTACCTCTCAGGATACGTCGGTGCCCCCAACGCTAAAACTACTATCATGCCCATTACGTTCTTTAAACA
CCTGCCTGAAGGACTCAAGAAATACGCCATCAAAAACATCACCTTCTCAACTAACATGCTAACTGACAAC
TCTAACTCAGGTTTCATTCCAGAAGGCATCCACAACCCAAACAACCTCCCAACCAAGACTTTCCTGGTCA
AATCTATCGATCAAACAATTTTCGACCAACTCCACCCAGAAACACAAGCTATGCTAAAAGACGAATACCA
CATTAAACTTCATGATATAACATCTCAATTTCATGAAGTTATTGCTTCAGTGATGTCCTACGAAAGTTTC
ATCTTCGCACTCATCATTGTCTTATCCGTCTTCCTTGGTTTTATCTCCTACAGCTCTACTATAACCTCCA
CCACATCCCTACATGCCGGCTTGAACCCTACCATGCGCGGATCCACCACAGGTAAACCATTCATCCACCC
AGTTACTTACCCCAACTCCATCCTAATCCCTCTGACATCTTCCCAATACAATGTATTCAGATTGCAAAAT
GGAACTCTCTACTTTACTTCCCAAATAACTGCCCCAACCTGTACCGTTAAACTACCAAACCCCTACATTG
GCTTAACCACAGAAAAATTTTATGAATGCTCATCTGCCCTCCTCCACATGCCCTTCATGGTTCATCTTGG
CGGTGTGAAAATCGCTTACCTTAGAGCTGGTGTTGCCTATAACATGCCAACATACTCAGAAACACCACAA
ACTAGTAAACTCTGTGTTCTCACTGCMCTCTCAAAGACTAAATGCTTTAACATCCTACCAGGTGGTTTCC
ACACTCCAGTACTAGCCATCCTCGTCTCAACCTGTGCACTTCTGGCAACGGTCCTCTTCTACCTCTACCT
ACTCCAGATCTTCAAATTCTACACTAACTCAGTCTTGATGGTGGTTGCCATTCAAATTGCAACTATCTTC
CTCTTCATGCTATCCCCAGCTCTTGCTCTAACACTTCAACTGGTCTGTCTCATGTACCTTTACCATAACT
GGATGGTCGCCATGATTAACATCGCAAACCTCGCTGTTCTAGCCCACACAACATTTGGCATGGTACTCAT
CTTCATCTACGCGCTCTACAGACTTTACAAAGTCTACCAAGTTACATCAACCGCTGCAGTTACAATTAAC
GCAACTGGTGAAATGCGCTTCCACGGAACTCTTGATGAAGTTGCTCTCTGCACCTTTCCAATTAGCTCTG
CAAGTGTTTACCAAATCATGTCTGACCTCAGCTTAGATTACATTAAACTGGCCAGCTACAAAACATCTTA
TAACCGTGCTACTCGCAACCTGGTTAACATGATGCAAAGATACATTCTCGATACCTCCATCCCAGCTATA
CTTTATGACGGCTCAGTAACAACTGGCATCATGCAACAATCCCTAGTTAGACTTAAATCCCTAGTTACAA
CAGTTTACAAGGATAACTACTCCAACATCTGCAAAATTTCATCAACAACCCACTCACGATCAACATTCTG
CGTCGGAACTTTCCTTAACCCAACCACTGTTATCACTTGCTCCCACGGAATCTTAGCAAACTCTACTATT
ACCGTCTCCCACAAGTCAACTATTTATGAAGCAACAATTGAATCACAACGCAATGATATCACAATTCTTA
AACTCACAACACCAAACTCCGCAATCACTCACACCATCGAGTGCCATTCACCAAATGACGCTGATCTCGA
AAATATGCAAATTAACTACACCCAATTTGTTACTTTCGCTGATAAAGATCACTCAGATGCCATAGCCATG
AACAACACAACCTATTTACCATCTGGTCACTTCTTTGCTATCGGAACTGAATCTGGCGAATCTGGCAGTC
CCTACTTCTTTAACAACAAACTTGTAGGAATTCACTACGGAGTTAACACCTGTGATCAATTTATGCTCGC
CTCTAAACCTGATGGCAGTTACTACATCCCAGAGATCCAACACAACATCTCCACACAACCATCTTTTAGC
CTTAGTTGCATAGCCCATGGTCGAAAATCGGTAACCGCCAAAAACACCCCCACACTTCACGATGCTATCA
ACAAAGCCCTTGCTCAAACAACACGCTCAGCTTACACTAACGATTTAACAACAGAACACACACCTGAACA
ACTCCAGGCTGTCCTTGATTTTCTGACAGACCCTCTGAATAAATCTGGCCCTAAGACACTCCATAACTAC
ATGGCAACATCTATCCAAGTTCAATCCTCCACCACAGCCCAATCCGCCCACATTGACGTCCACAAACCAA
TTAGACAAGCAGCAACTCTCTACTACCTAATGGTTATCATCTTTGACATCATCGCATTCTTCTTAACCCC
CGATTCTGATTTCTCTAATCAACTTGTATCCATGACTGCCTACCTAGCTGCCTGGTTCCTTAATAAAACA
TGCTTCTACAACACCCATGTCCTTTACACAGTAACCACATGCTTCCAACTCTGCAAATACTTCAACATCG
TCTATCTCTTCACAATCATTCAATCCTATAAACCAATTGAAATGTCAATGATGGATAAACAATATGATTT
CCTTTGCGCCATCATTGTAGCCCTCTTACTCTCTCCAATCCTGGTCCTCATCTGGAAACGCCTCTGCAAC
TTCACCTGGCATTATCTTGTCGCTCATCTAGTTGTTGGCTGTGTGCTTTGCATCCACGTCTTCTTCAGCT
ACAGATCCTTTACATCTTCAACAGGCGGTCTATTAACATTCTCAGAATTCGCCTTTAACTCACCATTAAC
AGCAGTCATAACAGCTACAGTTGATGAAAGTCCTGTTTCTGTTATTGTCTACCCACTCTTGCAGCATGTC
ATCAGCGCAACCCTGATCTTAGCAATCGTGCCATCTCCCCTCCTCGCAGCAACAGTCTACTCTTTCTATC
TCATTGACCAAGATGTCCTCTGCCTCCTAATCTTTCTCCTGCTTACATCCAAACTGACACCACTCTTCCT
CCGCCCACTCACAACATTCGTTTCCTACGATGTTGTCATCCTCTCACCCTCTGCTTACGCTCAATGGCTC
ATGGCAAAATCTGAAGGTAAAGAATACGGTCTCTTTTTCGCTGTCATTCAATCAGTCTTTGATTTTACAT
CTCAACACGAAGTTGAATTGACACTTGAAGCACAAGAGATTACACAGCAAGTCCGTGTTGAAGTTCATAA
CACCGAACCTAAAGATACCAAGGATGACACCTGCTACATCACACCCACTACTATTATTAACCCAACTTTA
ATTAGAACTGACAATTACTTCTACACCAACACCAAGAAAGTAATCTGCGAAGCTCCCATTGAACTATCAG
ATAAGGCTAAAGAAATCGTCGCTAAACAACTCGACGCTATTCCACACCCTGATGCAGAAACAACTGATCT
AGAAGTTGCCACACTTATTGACTGCACAACTACAACCAAGCAATCAGAAGTTAAAGAAATTGAAGTAGAC
GATTTAACACATGCCTACCTACTCGCTCTTATCAAAGCAACTTGCATAGAATCTGGCCTCCCCATTCCAG
TGATGAACTACATCTCATCCCAGACCCAAATTGACTCAGTGATGATCCATTACTTTGTCAAAGCTGCCAA
CAAACTACTGCTTAAAGATCAGGAACTGCCTCTTATCACAGCCCAATCTGACACCTCCACCATTCAAGAA
ACCTTGGAAGCTCTAAAATTAAAGGACACCACCCTAATGAACCCCCAAGAACTTAAAGCTCACCGCAAAC
AGATTAACATTCTGAAAGCTGAACAAGAACGACAGCTATCCATGGAACGGAAACTCAACGCTTTCCTAGA
TACAATGCACCAACGTGCTGTGGCTGAAAAGAATAGATCAGAAGTTCACAGCAAAGTGTCAGCTGCTTTA
CGCATGCACCTTTCTAAGGTTGCAAACGCTGCACATTGCGACATGGAAACAACAGACGGTGTTATCACAC
TATGCTCCGCTTTCTCTATCCGCTCAGTTTGCATCACTCAAAACACTGCAGACGTCTCTATTTACTACTC
ACAATCCACAGATACATACTCGATCATAACTACCACCACAGTTTTCACAGCTTATAATCCTATGAATGCC
AACGGACAACCCATCATTCCAACCACTGATCCTTACAACCCTATCATTTCATTCCCGGTTATCTTCTCAC
TAAAACACCGTGAGGAAAAATCGGAGATAGAACAACAAGCAAACGTGGGATACTCCGAACGTGCCATAAA
AATAACAACAACTGAACACGCCACTGGAACAGTTCTCATGATTGACAACATTACATCTGTCATCCCCGCC
ACTAAAACCGATGCTCGCTTCACCGTAAACGGTAAAGGCTACAAGATCGTCGACAATGCCGTTGCCCACA
AAGCTCGTGCTAACATGTCTACAATTCTTGCTGTCTTGCGCAAATCCACCATCAGCGCACAAGCAGCAGT
AGTTAGAATTGGCGGTGCTAGATACCAAACATCTCACCAAGCTATCTCTTTCACCCCCTTTCAAACACCA
GGCTATGTTACCTACGCAGGAATATGCGTCTGCCAACGCTGCACACTCAGAGAACAACACGAGTGCCACT
ACGCAGGTAACTTTGTCCAGATACCCACTAACATCTCGACACAAGGACTTAATAAAATTTATGAATTAAC
ATCTATCGGCCCATGTAAACACAACCAATTTGAATGTACCACATGTCAACCAGATCTAATTACAAAGGCC
CCTGGACAAGTACTGGTTTACTTCACAGCCCACGCCCAAACCCACTATAAACAAATAGTTACTCAAATCT
GCAAATTTTACCAAGTTAAACAATGCAACTCCCAAAAGCATGCAGATTTCACTATCCATATAATTCCACA
TGGCCACTCAACTGATACAACTCATCCTAACACCACCGTTCTAGTTGTACGAAAACACCTAGTCGATCCA
GATCCTCACCCTCCACACATCGGTATAAGTTCCACCTTAACTGGCGAAGAACTTATTACTCTTGACAGAT
TACTACAACCTGCTGTCGAGCCTCAAACTAAGTCGTTTTTAAACTTCTGGAGCGGGTGGTAGGTGTATCG
TTACCATCCGCTAGCGACCCTTATACATCAGGGAGCTATAAACCGATACCTCGTATCTTTTACATTAACG
TTGCAACACGCAATGACACAAAATTAGATAAAGTCTCCAAACTCAACACCTGGAGCATGGAAACACCAAG
CGGAATTATCATGGTAAAAAATCGTGACGCCTCTAAAGAATTTGATATAGCTACCAACCTACCAAAGTCA
CTACCAATTTTAACACATAAACTCATGACTTACAACCGCGACAACCTCCTAATCAGATACTACACAACAC
CTTACTCACTAGGAGACCTTGTCTACGCTTACCAACTCGGCGATTTTGAACACCTTCTACTCGCAGCCGG
ACTTTCACCAAATCCTGCCCAATTGCTCGACCCTGGTAATTACACCCAATATCAACAAACAAAAGAACAT
CTCAGACAAATTATCTACAGATCTAATGAAAACCTCCATAAAATCATTCATTACTTCACCACCACTGATA
AATATCTGCCTCTAACCCTGGACAACATTGATCAGAACGGTTATTTGTACGATTTCGGTGACTACCCAGC
TAAAAGTCCCGTCAATAATCACCACGTACTAGAATCATGGACACAATTCTGTGTATTCTGCGAAGTTAAC
CTTGCTGAACTACCAGGTTTTAACCTCTACACTCAAACCCACTCAACTCCACAAATTATAAAGAGCCGAC
AAGACCTAGTCTCTGGCTCCTACATAGATAAACTACTAGCTCTTAACCACCTAATAGCAGCAAACCCAGA
AGCCCCTTCCACCGCTTCCACTCCCTTCTTTAACGCCTCTGCAGCCACAACTGACATGGTTGGCCTACAC
TCACCACTCTTTGGCTACCATGAAGTCAACAATGATTTGATCCGCTCTAAACTCTCACCAACAGAAGTTG
ACTTCATCAGATCTCAAGATTCTGCAAACTATGCTAAACCCAACGTCATCTCCATCGGCAACACAATTAG
CTATTACGGCAAAAGAATAACAACTAAAGCTGCCCAAAGAAAACCTCAATACGATCTCGACATGCTCAAA
AGATTAGAATCAATTGGCATCAGCACACTCGCTACAACATCTTACCACTACCAAGTAGCTGACGATGAAC
AATGTGTGCAAGATTTTAAATACTACGATTACAACTCGCCCAAAACCTATGACCCTAACTTCCTCAAGGC
CATCTACCACTACATGCAAGACATCTTTTCCATTTACAAAACTGATGTTTCCCTTAACCATGAAACAGGA
CAACCACGCCCCTCTTCCATGGGTCTTGGAATCACAGGTTTTACTCAAAAAGCTGTTTGGCAGTCTCTAC
CACCTGACTTTGGCCCACGCATGCTTGAAGTTGCAAAAGAAACCCTACTACCATTTACAACAAAGGTAAT
TGCAAAATACGCTCGCACAAAGAAAGCCCGTGCACGTACAGTAGGTGCTTCCAGTTTCGTCGCATCAACA
GTTTTCAGATTTCTTCACAAACCTGTAACCATGCGCATGGTCGACCAAGCCCAAAACAACATTGGCCCAC
TCCTAATTGGCGTCTCTAAATTTAACGGCGGTTTTGATAAATACATCCGTACTCAACATCCAAACGGTAT
AGAACATTACAACGTCATGGGTGCAGATTACACAAAATGTGATCGTAGCTTCCCATTGATCAACCGCGCC
TTCGCCGCAGCCCTTTTCTATGATTTAGGAGGTTTACCATCTGACAACATGTGGTTTATCAACGAAATAT
CCGCCTTCATGACTGACTTCTGCAACATCTCAGGTCACACATTTAATAAACCAGGCGGCACAACATCAGG
CGACTCAACAACTGCCTTTTCCAACTCCATCTACAACTACTTCGTACACCTCACTGTGCAATTCCTCACC
TTCCTCTCAGCCGACGTTCCAGAAACATATAAACATCTTCAAGGTGCTGCTCATCGCGCTTATTCAACTG
GAACTCTCGAAGATTACAACACCTACTTCGAACTCGTCCATGACTTAAACTGCACTGAATACTTCTTCCA
CTTTCTCAGTGACGACTCTTTTATCTTCTCAACCCAAGAAGCTTTCCCCATCTTCACAACATTAAACTTT
TCAACCAAACTTCAATCTATCCTTGGCTGCACTGTTGACGTAACTAAAGCCTGGGCTGCATCTGGGCACA
TCGAAGAATTCTGCAGTTCTCACATTGAAGAAATCGACGGTGTCTATCAATACATTCCTGATCCTAACAA
CATGATCGCAGGCTTGTACATGTCCGGTGAACCAGTACCAGTAGATAAGACCATCTGGAAATTAGTTGCT
ACACTCAGTGAATTGGCCATTTTTCAACACAAGGATCCATCACTTTTTAACGCCCTTTACCAACTCCTTC
AAAACATGCACAGTGAATATGTCACTCAACATAACCACGCTCTCCTTCCTCTCCAATTGCTTAATAAGAA
ATTCTATACTGATCTACTTCAACCAGGATTTGATACTGAAACAACTTTCCTCACTGACTTGCTAACATCT
GTCGGTGTGAAACTCCAAGCATCTAATGATTCACAATGCTACTTCTGTGACAACCCTACAATTTCAACAT
GTGCTGATTGCGTAGTGCCATATCCTATGTGTGCACTCTGCGCCTACACTCACTGGGTTCAAACAGACCA
TGCCCCATCACAAGTACCACCATGTGTGTCCTGTGGCTGTGTCAATCCTGGAAAGCTTTACCACTGTTTC
ACTGGCAGCGTTAAAATCTGCTGTCAAGATCACGTCTCTGGCCTCTCCCTACCTTTAGTAGACCACGCCA
AGAAAGTAATTAGAATACCCCTCTTCCAAAACTGCGAACGTCAACGATCCCTAGTCCATGCAATAACACA
CACGGCCTTATTTGATGACAATGATGAACCACTTAACACCGCAACATTCTCTAAATATGATCCAGAACAA
ACTAAAGAAGAAAACTTCGTACGCATCTTAAACGATTGCTATATGCTTGAAGCCCACCAAGCTCATCAAA
ACCCAGCATACACCTATGAAGTTACTGAACCTGGCACAATAGTCGTATCACAACCTCCATCAACAGCATA
TGGTAACTGTGTCTACGCTGAAATTCTCGATGACAAAAATCGTGTCGTCTTGAAAGTCACTCTTGATACA
AAGTCAGTACTAACACCTACTGTCTACCATGTAACATCTTGTCGTGGTACACTTTACACTCGCTATAATA
AAATCCGCAGAGTTCAGCACAAACCTTCAATAGTCCCTAGATCAACCCTAGCCTACTTCAACAACGCACA
ATTCATAATTGGACCACCAGGAACAGGAAAAACTACTTTCGTCATCAAGAACTACATTGACAGAGCAGAA
CCAACTAACAAAATAGCCTACATTGCCCCAACACACGCACTCGTACAAGCTATGGATCAAGCCATCTTCG
AAGCTCACGGATATGCAGCTAGTGTCAACATCGTTAAATCAGAACTTAACAACAAGACCTACAACTACAA
AGCAAACATGCCTGGATGCGATATCATGCTCGGGACACCCGGAGCTGTATCAGCGCACACTGGTTGTACC
ATGATCTTCGATGAGATGTCACTTGTACAGTTGAATACTGCTATGACTGCAATTGCTCGAGTAAAACCAT
CTAAACTCATCCTTCTCGGTGACCCATTTCAATTAGGCCCAGTAGTTCACTTCAGAAACTTTCAATACAA
CTACGAAGACTTCCCCTATCTTCACTTCGCCCCAACAATAACATCTCTCCGCGTATGCTTCCGATGCCCA
ACCCAAATCTTTAACGTATGGAGTCACTACTACACCAAACATGACATCCCACTCAATGCCTTTAAAGACG
GCGGCTCATTTGAAATCATTAAACACCACTCATGCGCCAGAGTTTCAGAAACAGCCCACCCTCTGGTCAC
AAGACTCTCAGAAGAAAATCCAGACTCCATGGTCCTTTGTAACTACAAAGCTCCAGTCTCCTGCCTCGAA
AACGCTCTAACAATTGACTCAAGTCAAGGCAGAACCTACCGTGACGTCATAGTCGTGTTGCTCGGAAACA
CAAATTTCACCCGTGTACCCAACCGATTTATTGTCGCTGCTTCAAGAGCTACACATTCTCTCAAAGTTTA
CCTTTCTGAAGAGATGTACGACCACTACTCCACACTATTCAATTGGCCACAATTAGAAACACCACAAATC
CAGCCACAAAACGCCTTCACAACACCTAACAACTTAGAAGAAACAAATCTCACAATGGCCGCTAATAACA
TCAGCTCTCTCGTCATCTGTGATATAGAATTTTTCCATCAAGTTCGCAGCCTTGAACCCAAAGTTTGCAC
ACTTGAAGTCGGTGACATTACCATCCACACATCAACAAGCGCCAAACAGATCATCGTTCCACGCGTTTCA
TCAACATCTAGTGAAATTTTTCCAAAATACTTTGCTCACAACATGCCAACCCTTACCCTCCCTAAACCAA
CACCAAAAGGAGATTGGGATTACATGAAACCTCACCGTGGAATTTCTCGCCGCATCAACATCGACAGAAC
TCACAAACTCTTTTCCCACATGGCTTGCACAACTACCGGAACTCCCATCTACGTTCTCTACGGTGCCCGC
AACGATATCCTAGCTCTTTCCAAATTAAATATCGTTGGTGACTACAAATGTTTCTGCAATCTACCAGCTA
ACTACTTCACCCTAGATGCCCAAGATAACATCAAATACTACTGCACCCAACACGCCAAACCAGCAGCACC
TCTCGCTGGAACCATTAATGCTAAATACATTGACATCCAAACAGAAAAGATCACTCTTGCCAAACGCCAT
GCTGAAATTTGTGATCACCACCATGGTGCAGCACACACATCTGATGTCGACACCATCATGACCGGATGCA
TCTTAGGCAATGAATTGACACTAGCAACTCAACATCTCAGCCAACTTCTCTTCACGGAACCCTTCAGCCA
CTACTCAAGTGTAATTTCTCCAGATATGCACCTTACCGTTTCAACCCGCCCTTGCAGGACACTCGGACAA
CTTATCATAACTAACATCAATGGTAAGAACTACAGATTCTCAATCCAACCACACCTGGATCTTAAAACAC
ACTTTTTTAACATCGTTGCTAAACAAGGCCACTCCTCTGTTTTAGTCAACGTTCCAGAAACAGTTCCGAC
CTGTACTAAAATTCGCGGTGAAACCTGCGCTACATGCTACAACACCTGGCTTATCCTCCAAGAACTTCAC
GCTGAACTAGCTAACACAGGTCTCGCCCTGGTCAATCCACTCCAACGCCAATACACTCAACGAGAAACAC
AAATTTTAACCAAGGTAATGTCTGTCACTCCAACATCTACAGGCAAAATCATGGTCCATCTCGACAACAC
ACTCTCCTTCCCCTTCCTAATCGATTTACCAACAAGTATCCAAACATACTGCAACAAAATTGATAAACCA
ATCCCTAACCCTGCAATTTTCACTTCCCTCAAAATTACACACACTTACGGATTCGGAACACCATTTGTCC
CTATGACAAACAACCCACTCATTCCATCTATCCTCAGTAACCAAAAACTTGCTGACAACCCAGACTACTA
CTACATCACACATCAACCATCAAACAGTGAACTCCCTTTCATGACTTCTTCACCAACTGCTGGCTTTTAC
TGCTACGATACCCCTCTGATTAACTTCTCGGAACGTACCATCAATAAACCACCCTATTACATCACACGAA
TTGTCCGTGGCCAACTACAAAAACCTGACATTGGCCTCTTCTCCACCAATAGACTCTTCACCAACCAATA
CGTACCTTTACCTAACGAACAACAAGCGTACGAAGATTTTGGTAAACATGTCTCCCTTGGTGAAACAACA
GCAACATCCTGGACAATCGGTGGCATGCATCTACTCCCAGCCTTCCAAACCACAACTAATTGGCAGATCA
CATCAGAACATACACCAATTCTCTCAATTACCATAGCTCGTGATCGCGGGGTCAAACTAGGAACAACAGC
CTTAGACGTACCTGCTGACCAACTACTTGAATTAATCGACTATAAAAACATCATAGTCTCAAAAGTAATA
GCTATTAAGATCGACGGCCAAAAAGTAAACATGATGGTTTTCACTCAAAACGGTAAAATCCAAACAGCCT
ACCCAGTACAACAAGCAAAGATGCACGATGTGACAAAACACCACGTCACTCCTGACTACATAATCTGGCC
TAAAATTTTCAGCGACTCACCTGTCGACAAATGGGATATTCCTAACTACAACCAACCACCTAAAGGTCTC
ACATCCAACGTCAACATCCACAAATACGACCAAATGTGTGCATTCTTTGACAAACACCTAACCATCCCAA
CAAATGGCCACGTCCACCATCTTGGTCATGCCGGACAAGTTTACAGCCCTGGTGATATAGTTCTAAAAGG
CTACTTCACAAAAGCTCGTTTAACATCATACGACTTGCGTGATTGTATATCAACCAGTGAAACAGCTCAC
CCTGACGACAACTGGCGTGCACACTTCATCCTTTCCGATGCATACTGTCCCAACACCGACTTTACATCTC
TCTGCAAAGACTACATGACTAAACACCTACGTCTTGGCGGAAGCATGCTCTGGAAGATGACAGAAACCTG
CAACATCGACGCTGAATCCATTCTACCATACTTTGGATCTTTTACTTTCGTCACCTTCGCTGTCAACTAC
TCATCATCCGAAACTTACGCTTTCCTTAAGGGATACATGGGTGAACCTAACTACAACACCACACTTCCAG
CTAACATCATGGGTCAACTCGGCGCGTACAGACAAAACCTATTGTACGTCCCCTATGCTAGTGAGTATAC
CGGTACCAGAGTTTATAAAGATTCTGGTGCTGTGAAAGTCATTCCGGCCATGTATGCAGATCGTCTGAAT
ACTTCCCACTATGCTCTCGGCTGCATCTACAGCACTTAGACATGGCAAACTTGCTATGGCTAACTCTTCT
CATCACTCTCGGTCTCGTGTCCGCTCAAATTAACACGACACTCCCAGACTGCCCGATCCCAACTTGCACC
TACACACCGCCAACAACCACCCCATTTGACCACACATCACTACACTCTTTTTTCACACACGACACAAACT
ATGCTTTCCTTCTTTCTCTTAAGTATAATGGTACTTTCATTCCTGCCACTATGGCTATGCCTGCTAACAA
CCTTTCGCAAACATACACACTCAACTATAAAAATGTCTTTGTCAACGTACCTGATTCTCAACTCCCCCCT
CCTCAAAGAAGTAATACTCAGTTGGCTGTTGTTGCAACTACAGCTTCCTGTCTTACTGCAACGTATACTG
CGATTCCTGGTACTATTCCTGCCCTTGCAGCTACGGACATGTATTGTGTGAAATTTACTCAGTCGTCCAA
CTTTGTGTACTTGTACGACACCACTGTCAACACCCCTGTTGGCGTACTTTTAAAAAACCCAACTGCCCCA
GTAGTTACAACTATCCTATCCACTATCATGGTTAACCGCCCGACAACAGTTTCAACCTCACAGCTGCTAT
CTAATATCTACTCCCTTATGAGAACGAGAAGCAACGTGATTCAACAACAATTCACTTGCACATCTTGCCT
CTTTGCCATCGACGCATCTACAGGAAGAGCAGCTACCTCACCAACTACTCACCTCCTAAACAACTGGTCC
CCATCCTTCTTTGAAACTAAAACAGCTATGCTGGACCACGTCTCTATGAACACCATCTACCAAACAGCAC
GTGGTGTGACTCGTGAAACCTTCACTAGTTACATCCTTAACGCAGCTAAAACCGCTGCCTACGCTCGTGG
TTCTCCCGCCTATTACATCTTTTCATTCGCAGCCATTGCACGTTACCATCAAGCAATGGTTACTCCTTAT
AACTATAACATCGGAAAACTTTGTGAAGCAACAGCTGCTTGCTGCTTATCAAATGGCATTGAACATTTTG
ACATCTATACCTGGCTATTTCACTACTACGGCTTTATGAAATCCAAAGTCTACAGTGAAACTTTTACAAC
AAACCCAGTACTAACATCAGTTATTAACTTAGCCACATCAATTAAAGGTAAACATTCCTCGTACTGTGAC
CTAACACCTTACAGTTCATTTACTGCCTATAATTTGATCATGCTTCAAGACGTTGTCGAACAATACCAAG
GGACACGTACAACATCCACATACGCTAACAATTTTCTCAACCTCACTGATATTAACGGATACCTACCCTA
TTCCACACATACCCCCCTCCCACAAAACTACCAAAACTACATGCCTTTTGCAACCTACCTACTTGCAACA
TTTTACTCTTCTTTCACTTTACAACAGAAATTTGACTTCCACAGATTCCTCCAATCTGTCTGTTATTATG
ACTCTGGTTTCATTTCTCGTAACCAAGCCTACCATTCTATCTGTCACATAATCACTCTGAAAACATCATC
TTCAGTACCTTACCCCGCAGAACTCCAATGGCCCTTTACTGCTCTCCCTTCCTCTGGTTATGACTCTTAT
CCAGTTTCTACAGGTTTAGGCACAGTAGCTGTTGGCAACACAAATCCACTTGATTACCCTGGAATTTGTT
ACCAATCAGTTTGCTTGACTCATCCTACTATTAACTTCAGACTTTTGTTATCAGAATTACCAATTAAATG
GGAAGTCCGACCTGAAGGTATCTATGTAACATCTAGAAACGATCCTACATGCCTGAATTTCAAAACATCA
CAGTTGGGAACAGTTTTCATTACCCTCTACGATTCTAACGCTAMATGCACACTCCAACAGACTACTTACT
CTCGCTCTGCTGTCCTGCGCCAAGTCAACACGTTTACACCAAATGCTACTGATTTAGTCGTGCCCTACGG
CAAAACACCAATATACAATGGAGCCTATAATATTAATTCCACTGCATCTGGTGCTGTCTCTYTCTCTACC
AACACACACTACATTCCACGTCTCCTCACTTCAGTTTTAACACCGCAAAGTGACTACAAGATTACACCTA
CAACCACTAATCTTGAACCATTCGTGGAAATTAATGGCACAACCTTTTACTACGATGCTAATCAAGCCTA
CGTCAATACATCCGACGTTTATCAAGCTAACGTTGATTTTGGACTCCCCCAAACATTTTCTCTTGATACC
AGCTTTCTTAATTGCACAGCTTTCCTCTGCGCTTCTGACTACAAATGTATCGCCGACTTTTCACCAATCT
GCTCAGCTACACAACCACTAATCGACGCCCTACTCCAAACCTACACACTGTACAATCAACAACTTACACT
GTACAATTCTTCCCTGCTCACAATTCAAGCCGCTGCAAACTACCTCTACGACACAAGAACACGTACTAGA
CGATCACTCCTATCTACTGTCAACCTTGGCTACGGTGACGTTTTTCAACAACCAGCCTGGGTCTACGAAA
TAGGTGCAACAGCTGCAATTCCTATGATCGGCCCTGCAGTCTCAGTCGGTTTGTTAGCCAGTAGAGTAGC
ATCTATTGAATCAACCCTCTATCAAATTACCCAAGGAGTCAAGGAGTCTATTATGGCTATGAACACCAAG
CTTGATAAGATTGCCAACATTTTACACTCAGACATTGAAAGATTAGGATTAACAGTTAACACATTAGCCT
CTTCATTCAACACATTCACTAAACAAGTAACAGATAAATTTGCCTCTGTTGATGTTGCATTTAACGACTT
ATCAACATCACTGAACACACTCACCACAACAACAACTGTTGGTGCCTCTTATGCAGCTCAAATTAACTTC
GCAACAACCACGCTAACCAATTTAGAAGTTCAAATCTCTCAAACAACAGATCACGCTCTATCTTGCATCG
CTGCGCTTAATGAACATGTTCTTTCTCCACACTGCATTTCCGTTTCACAACTTAGCGCTTACACACCTAA
TGCTCTCTCTAACATCGGTGAAAAACTAGTACTAACTCACTACATCAACGGATCACTCATCACATTCTAC
CATCTCATTGCTAGCAAGGGAGTTTACAGACCCCTGCCCAAAATGTATAACTCTACACACCATTTAGTTG
CAACAACTGGCTTTTATAACGGCCATTGTATCTTCTGTGGCGAACATTATTGTGATATCAGTGTTTCTGT
ACCATGTGATTATGCGTACGAACCACTTAAATCCACTGTACTAGCAGCTTACCCACTAACAACTGGTGTA
GCCCTTCTTACTCTTGACTCTACAGCTACTAACTTCATTATTAACTATAATAACGCTCCTCTCATTTCAT
CAAGCGTTCCACAACCACCTATCATCAATAACACCGATGGTACAGTTATTACGCTCCAACAACAAATAAT
CCAGCTTCAAACTCAATTCGACCACTTTAACATCTCGTCGAATTTTCACGTTTCAGAAATCCAACCAATT
ATAGACTACTACAATGCACAAATCAACTCATCTCTAAACCAGATAGTTGATTTTGGAAATGGCTCAACAT
CTAATGTAGGAACAATCATCCTCATTGTACTTGTAGTTGCCCTTGCACTTGCAGCAGCTATCGCCATTAT
TTGCGGATTAAAGCACTAAAGACCAACAAGTTGCAATGGCTTCTACCGGTACAAACATCACCGCAGAAGA
TCCCAACATTGGGTTTCACTTACAACTTAATGATGTCCTTAACACCCTGGACATCTCCGGCTTCAGCATC
TCAAATTCCCATTTGATGAGTGCGATGCTGACCCTTAACCTTCTCTGGAGCGCTATCTTTCTAGTCTCCT
TCTATCTAATCTTGGACATGGTTATGTACTACATCCCCCTGCTCAATAAGATTCCACTGCTGCCAACAAT
TAAAAACCTTTGTTGGTTTATCTCGACTCTGCTTGTTGCTGTTTCCATTTACGCTTCAGGAACTCTGCTG
ATCATTAAAATCTTCGGAGGCGTAGTCTTGCTCCTTGCTTTYCTCGGCCTGGTGAAGACTTTCTATATGT
TTATTGCAATGGCGCTGTCCTAYTACCGACACCGTAACATCGCAGTGGCATTGAACGGCCCTAATGTCGT
TATGGTTAACGGCACAGCAGTCCACTCTGATTTCATCCCCACGTCTGTGACACTGGTGAAGAAAGATGGT
GAACTCTATTTTCAAGGAACAAAGGTCCCCGGAAACAACTTGGTTGATGCGACCGTGAAGATCTTCACTT
TTAACGAATCGTTTGAATGCCTCCCCATCGCACTCTCACGTTACACTAAAGGTTCCTACGCTAGATTTGA
GCTCAAGTCGACCAACACCCACTATGAACTCCAAACTTTCTATCCTTCGCAAACAGAAACTAAATCTGTT
TAAAACACTAGCGAAAACAAATTACAATGGCATTCTACGGACCACCAATGATGCCTATGTCTATGCCCGC
TTCCTTTCCTCCTCGTCGCCGTGCCCCTAAAAAGCGCCCGCAACAGAAGAAACAGCCCAAACCACAGCCC
AAACCCCTCAATGACCAACAGAAAACAGCTGTTGCGAAAGAGGCTATTGCCAAAGCCACTACAGTGCCAA
TGCCACCCATGGCACCTGTAGTGAAGACTAGTCTGCGCACGCAGGTTATAAAAGGCAAACGCGGTGAACT
CCAAGATGCTCGAGGGCGTCTAACACAATCGGAGATCAACCAGCTGTACTTCCAGATCGCCACTGCCCTC
AACAGCGGCCTCGGTGAAATTGGAATACACAATGCTGCCACACAGGAGGGCGTCCGTCTCATCGTTCGTC
TCAACCTGGCCCCACCAAATTCTATTGCTGAGAAACTCTACAAATCTCACGCGGCGGCACATCTCAACTC
AGAGGCTCTCGAATCTAAATTCAAAGAACGAGAATCAGACCCTTTGTTTCATTTTTCAACAACCCCTGAG
TAAACTGACTTCACCTCAAAACTGGAGAAAGTATATATAACCACATCTCACACTATCCTTTATAAACTAT
ATATTGGGGTGGCATTAGGCCATTCCAAAGAATTCTTTAAGATCACACTCCTCGACACCTGACTAGTCAT
CACGTTTCCTGGGGTCTGCTCTTTAACATTCTACTATCCTATAAGATCTAAAAA

>gi|744692653|ref|NC_026011.1| Betacoronavirus HKU24 strain HKU24-R05005I, complete genome
GATAAAGTGTGAATCGCTTCCGTAGCATCGCACCCTCGATCTCTTGTTAGATCTAATCTAATCTAAACTT
TATAAAAACACTAGGTCCCTGCTAGCCTATGCCTGAGGGTTTAGGCGTTGCATACTAGTGTCTTAGGAAT
TTGACTGATAACACTTCCCTGCTAACGGCGTGTTGCACTCTCAGTCTAAGCCTCCCACCCATAGGAGGTA
TCATGGCTAAGCGAGTCAACAAATACGGCCTCACGCTAAAATGGGCCCCAGAATTTCCGTGGATGTTTGA
GGACACAGAGGAGAAGTTGGGTAACCCTGATAGCGGAGATGGGGATGGGTTTTGCTCCCCAGTTAAGCAG
GAAGAGGGATCGGTCAAAGATCATTTTGATAATCACGTTAAGATGGATTGTAGCATCCTATCTACTTATG
ATATGGTTGCGCAGTCTGTTTTGATACGTGATATAGTATCTAAGACAGGACCGGAAGATACCGAGTCTGT
GTTAAAGCAAGCCTTGTTGTCCCGCGAGGCAGTTTTTGTGCGACCACCCCAGCACATGACTCTTGAGTCA
TGTTATGCAGGAGGGTGTGTTCCTAAGGGATGGGTCATGGGTCAGTTCCGCCGCTGTACAACCTGTAGTA
CAGGAAATTGCGGTGTGGACAAACATGTATCCTACGAGCTCTACCTAATCAGCCCTCAAGGTGTTGGTTA
TGGTGCAGGTCGATTTATGGGTTGGGTAGTACCAAAGAGTGTGCTGCCACCCAAAGCTCTTGCGCGCTTG
GAACCTTATGTTCTTAAGGTGCGCAAGACAGGAGTTAAAGGTGCTTACAGTCGTGGGCACTATGAACAGC
AGGGTGCTGGTTCGAGCTTTGTCCTGGATAACGCCTGTGATGAAGTCATGAGTGCGCCAAAGGGCAAATT
CTCTGCCAAAGCCTATGCTCTTTTAAGACAGTATAGAGGCTTGAAACCTCTTGTCTTTGTGGACCAGTAT
GGTTGTGACTATACTGGCAGCCTCGCACAGGGCCTTTCCGCCTATGGGGAATGCAGTGTGAAGGAGATGA
GAGCTGGTATGTGGAAGACCAGTGATCAATTTGAGTATGTGGTGGCATGGCATACAGTTCGTGATGAAAG
GTTTGTGATGAGTTTGCAAACGTGTGCTACTATACGTAGTATTGCATACGTAGCGGACCCTATGGATGAT
TTGGAAGGTGACCAGGTTGTTGTGAAGGAGCCTGTTCATGTTCTAAGTGCCGATGCCACTGTAAAGAAGT
TTGTTAAAATAGCAGACTTAATGCAGGTCACTGATGCTGTGTCTGTTATAGAAACTGTTTATAAAGTCCC
TATAAAAGATTGTGGCTTTGTGATGCAGTTCGGCCATGTTCAGTGTGAACATGACGAGTGTGAGTTTGTT
GGGTGGATACCAGGTAACATGATAGATGGTTTTAAGTGCCCCGCTGGCAAGCTGTATGCAGCTAGCGAGG
TTCAAGCTCAATCTTCTGGAGTCATACCACCTAATGCTGTGTTGTTTACTGAAAGTACTGCCTTGACCTC
GCAGGATTCTTTTAAGATGTATGGTATGTCAGTTGTTCCTTTTGGTGGCTGTGTTTACTGGTCACCAGGA
TCTGGCATCTGGTTGCCTATCATCATGTCAGCTGTGAAGGCATATGATGGTATGACCTTTACAGGTTCTA
TTGGTTTTAAAACCATTGTTCAAGAGACTGCTGCTATTTGTCATGCTTTGTATCTGGACTATGTTCAATA
TAAGTGTGCAGATATAAAACAACATGCCATCTTGGGTGTTGATGATCTTTGGCACAAGCAGCTGCTTTTT
AACAGAGGTGATTATTCTCTCTTGTTAGAGAATGTGGATTATTTTATTATGCGCCGCGCTAAGTTTTCTG
TGGATAACAGCTTGGTCTGTTCTGAGGGTTTTGCACCTTTCCTGTTGGATGGTGTGGCCGCGCGCGCATA
TTATATAAATTGTTGTTTGAGTGCACCTGGCTTGCCAGAGAGTTTGTGCAAGCTAGGTATTGAAGTGGGG
AGCTGGTGTCAGAGCACATTGTGTTTGTGTATTGGCACAGTTCAGGGTGCCACTTCATTTGTGGTGAAGA
ATTTGAAAGTGTTTTTGTCCAAGTTTCAGATCTTTGGCAAAAAGTTCGTTAAAAATGTTAAAAAGCTCGT
AGAAGAGTGGATTAAAAAGTCTGTTTGTGCTCTTGCTTGGGTTGTCCTTCATGTCATAAACGGTGCTTAT
CTAATTTTAGAAGATGGTTTCCATTTTGTTGGAAGTGTGCCTGATTATGCTCGCAATTTTGTGAGGATAC
TTAGGGAGATGGTTAATATGATGTTAGATTGTATGAAACATACCATAATTAAGGGTCTACCTTGTTTTAA
GGTGGCTGCTGAGTACATTGTCTTCTCTGGAAGCTTTGTATATAAATTGGGCCTGGCTATGATAGATAAT
CTAGTCCTGCCTAGTGACATGATACAGAGTGAACTCCTTGCTTTGCATGGTGATGTTATTCCTGTGACAT
TAGAAAGTGAGGTTGTGGAAGTTGTAAAACAACCACTAAAACCACTAGGTTATCGAAAGCCTCCAATGAA
AGCAGCTCGTCTGTGTGTTGTAGACAATTTGTATATGGCTCAAAACGGTGACTGTCTATATCCTGTGATA
TTTGATGGTCAGCGTATTGGGTTGTTGGATCAGGCTTGGCGCTTTCCTTGTGCAGGTAAGAGTGTGTCCT
TTGCTGCAGCAGATGACGTTAAAATCATTGCTGCAAAGAAGAAGGTCACGGTCGAGTATGATCTTGATGT
CGAATTTAACACCATCTTAAATACTGCTTGTAACAGTTTTGAGGTGGATGGTAGTGTTGATGCAGATGAG
CTTGCTGCTGTGATTGTTGATACAATTCAGGACAAGTTAGAATCTTGCAAAACACTTGAAGGTGTGGGCG
CTAAGGTTTGTGCATTTTTGAGTAGGTTGGATGAAGAACCTATTTATTTGTTTGATGAGTGTGGTGATGA
GAAAGTTTCTTCTCATATGTTTTGCACATTCTGCCCACCGGAAGATGATGATGTTGTAATGTTTGAGTGT
GAAGCTGAAGGTTGTGATCTCAGTGAAGTGGAAACACCTGAAGCAGTGGAAGCAGAACCAGCCAGCCAGT
CAGACAGCCAATATGGTAATGTCGATGGTAATGGTGTAGGCGACGTGAAAGCTGTGGATGCTGTGGAAAC
TGAAGCTGTGGTTAACTCTGAATCTGAACAAAGTCAAGCATTAAGTGCAAATAAAGAGCTGCTTTGTGCA
GTATTTGAGGAAGATGTAGAAGCCACAGAACCGGTCATTGTCACTGATTGCATTAGCAGCAGTGTTGCCA
GTGAGGTTGAACAAGTGGAAGAAGTCTTTGATATAGCGACATGCGATGATCCTATTTTGCAGGAATTAGA
GCAGGTCGTAAATGTTGAGTATCAGCTTCATGGTAATGTCTGCGACTATGTTGCAGCTTATGAGGAAGCT
GTTAGTGATTTTTGGACAGTACAGCAAGACGAGTTTATTCACGTCTGTGGTGTATTTGTCCCTAAGACTA
CCAGGACTAATTGCTGGTTGCGTTCTGTCCTGGCAGTAATGCAGAAAATACCTTGTGTATTTAAGGATAA
GAAATTACAGAATTTGTGGTGTGTGTACAAGAATCAGTATTCTTCTGATTTTGTAGATGCACTGTTGAAA
AAGATTCCGGATAATATAATTGTACCGGAAGGAGGCTATGTTGCTGATTTTGCGTATTGGTTTTTAACAC
AGTGCAAATGGGATGCTAACTCTTATTGGCGCTGCTTGAAGTGTGGGATTGATAGTGAGTACAAAGGCCT
TGATGCCATGTTCTTCTATGGGGATGTAATCTCACAACCATGTAAGAAGTGTGGTCAGAGCATGGTGGCA
CTTAAGTTAGATGCACCATGCACCCTACACTTTTCTTTGATCGACACCACATTTAGTGCATTCTTTTCAT
TGAAAAGAGTGTACTTAGCAGCGTGTGTTGTCGATGTGCATAATCGGCACTCATTGGCAGTGATTGATTA
TAATGGTTTAAAGCAAGTTGATGGAACGCTTGTTACAGATGTTAGTAGTAACAAGTTTGATTTTATAGTT
GGGCATCCTATTAAGTTTGCTATGTCTACTTTTGAGATTGCCCAACTTTATGGAACTTGTATAACACCAG
ATGTTTGTTTTGTAAAAGGTGATATTATAGACGTTTCTAAGAAGGTTTTTGCTGATGTTGTTGTGAACCC
CGCCAACAGCCATATGGCGCATGGTGGTGGTGTAGCAAAAGCAATAGCAAGGGCAGCTGGCGACGCCTTT
AATAAAGAGACCTCCGACATGGTAAAGTTGCGAGGTCCTTGTCCTGTGGGTGAGTGTTACAAATCCACAG
GCGGTAAGTTGTGTAAGTTGGTGCTTAATGTTGTGGGTCCTGATGCGCGAGCACAGGGTAAACAATCTTA
TGCGCTACTTGAACGCGTCTACAAAGCGTTTAATAAATATGAATGTTGCGTCACTACGTTAGTGTCTGCT
GGTATATTTAGTGTGCCATCTGATGTTTCGTTGACGTATTTGTTGGGAGCCACCACTAAAAAGGTAGTGT
TGGTCAGTAATAATAAAGAAGATTTTAAGCTCATCGAGGGTTGCCAAACAACAGCCGTCGATGGTACTAA
ACAGTTGGCTGCTAGACTAACTCAACAGTTGGGCCGCCAAATTAAGTATGAAATCGATACTATAGCTCTT
CTTGATAAGGAGACAACTCTAGTATCGACTTATGATAAGCTGCAGGACATCTATTGTATGCAGCATGATA
TAAAGTTGGATGATGATGCTCGGGCTTATGTTCAGAGCATGTATCAATCCCTGCCAGAAGATTGGCGATC
AGTCTTCAAATTTGATGTTTGTGCTGGTGTTAGAGTTGTTAAATATTTTGAGTGCCCCGGCGGTATATCT
ATATGCAGTCAGGGTTCGGATTTTGGATATGTACAAGAAGGTACCTTTGTAAAGGCGACTGTCAAAGAGG
TGCAGCAGCTTTTTAAGAATGTAGTTGAAGTCCTGCTTACTGTTGATGGTTTCAACTTCAAGACCAAGTC
AGTCGTCTGTGGTGAAGCCTTTAGTAAGCAGGTTGGCAATGTGTTTTGTGAAAATGTTGATGTTACCAAG
CACATTGTTTCTAAAGAGTATGCAGGCAAAGTACTCTATCAGTTTGAGAACTTGTCTGAAGCTGAATTAG
AATCTGTTAAACAATCATTTGGGTTTGACCAGAAACAGCTTCTTGCTTATTACAGCTATCGCAGTTGTTG
TAGGTGGGAGGTCGTGGTCCATCGCAAATGGTTTTGTTTTAAGCAGGCAGACAATAATTGTTATTGTAAT
GCTGCATGCTTAATGTTGCAAAATCTTAATTTGACTTTTAAATTGCAGCAATGGCAAGAGGCGTGGCTCG
AATTCAGAGCGGGACGACCTCTGCGTTTTGTTGCACTTGTGCTTGCAAAAGGTGCCTTTGTTTATGGACA
ACCAGCTGATGCGCGTGACTTTATGCGAGTTGCCTTGAGCCAAGCAGATTTGTCAAGTGCTAGCTGTGAG
TATGAGTTTATTTGTAAATGTGGTGTAAAGGTTGAAAAGCGTGACGGCATTGATGCAGTCATGTTTTACG
GTACTTGTGATAAGCAGGCATTAGAAAAGGGTACTACTACAGATTGTAGTTGTGGACCTAAAACTGTTCA
CGTGCTTAGCATGAATGTGCCATTCTTTATTGGTAGTCAGGCTCCAGCTGTTGGAGCTTTGCCTAATGGT
TGTGCTGCTGCTAATTTGTATAAAGGAGGTGCTGTTGGCCATTACACGCATGTTAAGAATGGCAAACAGC
TCACATGTTTTGATGCACATAATGTTAAGAAGTGCACAACTCTTGTAGATGGTGTTACAGATTGTCTGTA
CACTAATGTGCCTAAGCAAACATTTGAGTCGTGTCTTACGACCTATTATTTAGATGATGTGAAACATGTT
GAGTACAAGCCTGATCTCTCGCAGTATTACTGTGAGGGTGGTCGGTATTACACTCAACGTATAGTTAAAG
CACAGTTTAAGACATTTGAGGCTGTCGATGGTGTGTACACAAACTTTGAGCTTGTGGGTCATGCCTTATG
TGATACTCTCAATGTTAAATTGGGCTTTGATTCTACTAAAGATTCAGTTCAATATAAGGTCACCGTCTGG
CCTGATGCAACGGGTGATGTTGTGTTAGCAGATGATGACTTGTATGTCAAGCGCTATAAAAAGGGTTGTA
TAACATTTGGTAAACCAGTTATCTGGCAGAGTCATATGGAAGCTTCCCTTGCATCCTTGACGTACTTTAA
CAGACCGAGTCTGATTGATAAAAATAAATTTGATGTGTTAACAGTGGAGGAGTCGGCTCTGGAGGAGAAA
GATGATTCTCAACAAGTCGGCCCCTTCATTATAAAGAAGCTCAAAAATGTTAAAAAGCCTATTAGTGTGG
ACGGTGTCATTATAGAGAATGATGATAAAGCCGAGGCCACTTTAGTTAAAAGTTTGACCTTAGATGATGT
AATTGCTATGTGGGTCACGGGTGGTAGGTATGTTGTATGGGTAGCCAATTGGCTTAGTAAGCTCGTATGC
ACTCCTACAGTACGTGAATATGTTAAGCGAGGTCTACAAAAGGTTAAAATACCGGTGGAACTCTTTTCAA
GGCGTGATGACAAGTGTGATGTAGTGCAGAAGAGCATAAAACGTGTTGTTTTGGCTCCGATGAATGCGTT
GCGCTTGTTCTATGTGCTAATGTGCTCTTGGTTGAAGAAGCCAAGTGACAATAAAGTTGTATACACCACA
GAAATAGTTTCTAAGTTTAGTTCTAAGTTGTTCGTTAAAGCATGTGGTATAGCTTTACGCAACTTTAAAT
GGGGAATGTTGTTACGCGGCTTCTTTATAGTTGCCACAATATTCCTTCTTTGGTTTAGTGTAATTTTTGC
AAATGTAATTTTTAGTGATTTATATTTGCCCAATATACGTTTCATGCCGACCTTAGTAGGCCATGTTATT
GCTAGGCTAAAATTCATTTTTGGGTTTTGGACCTTGTGTGATAGCATAGACGTGTCCAGTATTGGGTTTA
CATTTGACAATTGCACATCAGTTGCATGTCAATTTTGCTTATCGGGTTTTGACATGATTGATACGTACAA
GGCTATAGACTTTGTGCAGTATCATGTTGCGGGCTTTTCTGGTTTTGACTATAAGAGCTTTGCAGTCCTG
GTGTTGGAACTTGTTATAAGTTATGTTTTGTATACAGTGTGGTTCTATCCTTTGTTTGGTTTAGTCTGTT
TGCAAATTTTCACAACATGGTTTCCTGATATGTTTATGATCACTGAATTACATTGGTTTGTACGTTTGTT
TCTTTATATGGCCAATTTGTTGCCATTTCATGTGTTTTTGCGTTTGTATATAATTGTTGTTTTTATTTTT
AAAATGTTTAAGTTGTTTAGACATGTGGTTCATGGTTGTAATAAGCCTGGTTGTTTGTTTTGCTATAAGA
GGAACAAGAGTGTTCGTGTTAAGTGCAGCACTGTTGTGGGTGGCATGTTACGCTATTACGATGTGATGGC
TAATGGTGGCATAAACTTTTGTAACAAACATCAGTGGAATTGCATTGGGTGCGATTCCTATAAACCAGGC
AATACTTTTATAACCGTAGAGGCTGCAGCTGAATTGTCTAAAGAATTCAAACGCACTATAAATCCAACTG
ATGTTACGCACTATGTTGTAGAGTGTGTGCAGCAAGTAGGTTGTAAAATGCGCTTGTTCTACGAAAAGGA
TGGGCAGCGTGTTTATGATGATGTAAATGCTAGCATGTTTGTAGACTTTAATGGTCTGCTGCATTCTAAA
GTTAATGGTGTGCCTAAGACTAATGTAGTCATTGTGGATGGTGATGCTGATAAGGCTAACTTTCTCAATG
CTGTTGTCTTCTACGCACAATCATTGTTCCGTCCTGTGCTTATGATAGATAAGAGTTTGCTCACAACTGC
CAGCACAGGTACTAATGTTTCTAAGACTATGTTCGATGTCTACGTGGATACCCTTTTGGGCATGTTTGAG
GTCGAGCGAAAGTCACTTAATAATTTTATCCAGGTAGCACACAAGTCTCTTGCGGAAGGTGTGCAACTTG
AAAAGGTTTTAAACACATTTATTGGCTGTGCACGAAAAACTTGCTCTATAGATTCTGATGTTGACACTAG
ATGTCTTGCAGACACTGTTATGTCTACAGTTGCCGCTGGGCTTGACATGACAGATGAATCCTGCAACAAT
CTTGTGCCAACGTATATAAAGAGCGATAATATAGTGGCAGCTGATTTAGGTGTTCTTATACAAAATAATT
GTAAACATGTGCAGGGTAACGTGGCTAAAATGGCTGGTGTTTCTTGTATATGGCATGTAGATGTATATAA
TCAGCTTAGTTCTGATTTTCAGCATAAATTAAAGAAAGCATGTGTGAAAACTGGTCTTAAGCTTAAGCTT
ACTTATAATAAACAAGCCGCTAACGTGTCTATTTTGACAATGCCCTTCTCCCTTAAGGGAGGTGCGCTCG
TTAGCAATGTGCTGTTTAAGTGTTTTATCGCAAGTTTGATAGTCTTTTGTACATTGTGGCTTTTTATGCC
TAGCTACAGTGTACATAAGTCTGCTTATGAGCTACCAGCTTATGCCAGTTTTAAGGTTATAGATAATGGT
GTTGTGCGTGATGTTGATGTTAAAGATGTATGCTTTGCTAACAAATACGCACAATTTGATCAGTGGTATG
AGTCTACCTTTGGTCTGTCATATTATAGCAACCATCACAGCTGTCCTGTGGTCGTTGCTGTAATAGACAA
AGACATTGGCTCTACAGTGTTTAATGTTCCTACTAAAGTTTTGAGGTTTGGTTACCATGTGTTGCATTTT
ATAACATATGCATTCTCAGCTGATGGTGTGCAATGTTATACCCCGCATGAACAGATTTCTTATTCAGATT
TCTATAGTAGCGGTTGCGTCTTGTCTTCAGCATGCACAATGTTTGCTTCTGACAATGGTGCATCACAGGC
TTATTGTTATACGGAAGGGCTTGTTCAAAACGCCAGTCTGTATTCCTCATTGAGGCCACATGTTCGGTAT
AGTTTGGCTAACACCCATGGCTATATACGATTCCCAGAGGTACTGCGAGAAGGTCTTGTTAGGGTCATTC
GCACCAAAGCAATGACTTATTGCAGGGTAGGGTTGTGTGAGTCTGCTGAGGAGGGTATTTGTTTTACCTT
TAATGGTTCCTGGGCTCTTAATAATGAATATTATAGAAAAATGCCAGGTACTTTTTGTGGTAGGGACTTT
GTGGATATTTTTAATCAATTTGTAGTAGGATTGGCCCAACCAATAGATTTCTTTTCGTTGACTATGAGTT
CTGTTGTTGGTGCTGTTCTTGCTATAATAATTGTTTTGATCTTTTATTATCTCATCAAGCTCAAGCGTGC
GTTTGGTGATTATACAGCCGTAGTAGTGGTTAATGTAATTGTGTGGTTTATAAATTTTGTGATGCTTTTT
GTTTTCCAGGTTTATCCCACTTTCGCTGTTATATATGCTTTGTGTTATTTCTATGTGACACTGTATTTCC
CTTCGGAGATTAGTGTCATAATGCATCTACAGTGGCTTGTGATGTATGGTACAATTATGCCAATATGGTT
TTGTATACTTTATGTTGCAGCTGTTGTTTCAAACCATGCTTTCTGGGTATTTAGTTACTTCAGGAAGTTG
CATACTGGTATACGTAGTGATGGTACTTTTGAGGAAATGTCCCTCACTACTTTTATGATCAATAAGGATA
CTTATTGTAAGTTGAAGAATTCTCTGTCGGAGGTTGCATTTAATAAATATTTGAGTTTGTATAATAAGTA
TAGGTACTACAGTGGTAAAATGGATACTGCTGCGTACCGTGAAGCTGCCTGTTCTCAGTTGGCAAAAGCA
CTTGATACATTTAACCATAATAATGGCAATGATGTGCTTTACCAACCACCGACTGCATCAGTTTCTACAT
CTTTCTTGCAATCAGGTATTGCTAAGATTGTTTGTCCTACATCTAAAGTTGAGCCTTGTATCGTTAGTGT
TACTTATGGCAATATGACTCTCAATGGGCTTTGGCTTGACAATAAAGTATATTGTCCTCGCCATGTCATC
TGTGCAGCCAATGATATGGTTGATCCTGATTATGAGGCTTTACTTTGTAGGGTTACCTCGACAGATTTTG
TGGTTATGTTTGATCGTATGAGTCTTACTGTTATGTCTTACCAAATGCAGGGCGCTATGTTGATCCTGAC
TGTCACATTGCAGAATACTAAAACACCAAAGTATACCTTTGGCAATGTGAAACCTGGAGAGACATTTACA
GTTTTGGCTGCATACAACGGCAAACCCCAGGGAGCCTTTCATGTGACAATGCGCAGCAGTTTTACTATTA
AGGGCTCTTTTCTTTGTGGATCTTGTGGATCCGTTGGTTATGTCTTAATGGGCGATTGTGTTAAATTTGT
TTATATGCATCAATTGGAGCTTAGTACAGGTTGTCATACTGGTACTGACTTCAATGGGAACTTTTATGGT
CCCTATCGTGATGCTCAAGTTGTACAACTCCCTATACAGGATTATGTGCAGTCTGTTAATTTTGTAGCTT
GGTTGTATGCCGCAATTCTTAACAACTGCAATTGGTTTATACAAAGTGATATTTGTTCTGTTGAAGATTA
TAATGTTTGGGCTATGGCAAATGGTTTTAGTCAATTTACCATGGATCTTGTTATAGATGCTTTGGCTTCT
ATGACTGGAGTTCCTGTTGAGAAGTGTCTTGCCGCCATTAAAAGATTGAATAATGGTTTTCAGGGCAGGC
AAATTCTGGGCAGTTGCGTGTTTGAGGATGAACTTACACCAAGCGATGTCTATCAACAGCTCGCTGGTGT
TAAGTTGCAATCAAAACGCACTAGAGTCTTTAAGGGTACATTGTGCTGGGTGTTGACATCAACCTTTTTG
TTTGCATGTATTCTCTCAGCATTTGTAAAATGGACCATGTTTATGTATGTGACTCTTAATGTTCTTAGTG
TCACAATAGGAACACTTTGCTTTGTGGCCTGTGCTATGTTGTTTATTAAACACAAGCACTTGTATTTGAC
CATGTTTATACTTCCTGTATTTTTGACACTGTTGTATACTAACTATTTGGTGGTTTACAAACAGTCATTT
AGGGGGTATGCCTATGCATGGCTATCATATGTGGTGCCTTCTGTTGACTATACTTATACCTATGAGGTTT
TGTATGGTTGTTGTGCCGTTTTGTTCATGATTTTTACTACCATGCGTAGCATTAATCATGATTTGTTCTC
TATTATAATATTTATAACTAGAGTTTCTTCTGTAGTGTCTATGTGGTATATGGGTTCTAATTTGGAGATA
GAAATACTTTTGTTAGTTGTTTCTATCTTTGGAACCTATACCTGGACTACTATTATATCGCTGACTGTAG
CTAAGGCTATGGCTTGGTGGTTGCATGCCAATATCTTTTATTTGACTGATATTCCGCATGTGAAAATTCT
TTTGATGTGTTACCTTCTTGTAGGGTATATTGTGTGTTGTTACTGGGGAGTCTTCTCACTGTGTAACAAA
TTGTTTAGAGTTCCTTTGGGAGTTTATAATTATAAAATTTCTGTACAGGAACTTCGTTATATGAATGCCA
ATGGGTTGCGTCCACCACGTAATAGTTTTGAAGCCTTGATTCTTAATTTTAAGTTGATTGGTATTGGTGG
TGTGCCCATTATTGAAGTGTCTCAAATTCAATCTAAATTGACAGATGTTAAGTGTGCTAATGTTGTACTC
CTTAATTGTTTACAGCATCTACACGTAGCATCTAATTCTAAGTTGTGGCAATATTGTAGCACTTTGCACA
ATGAAATACTTGCCACTTCAGATCTTGGTGTTGCATTTGATAAACTGGCTCAGCTTTTGATTGTGCTTTT
TGCAAATCCAGCTGCTGTTGATACCAAATGCTTAACTAGTATAGAGGATGTGTGTGACGATTACGTCCGT
GACAATACAGTCCTACAGGCATTACAGAGTGAGTTTGTTAATATGGCTAGCTTCGTTGAATATGAAATTG
CCAAGAAAAATTTGGATGAGGCTAAGGCTAGCGGTTCTGCTAATCAACAGCAGATTAAACAGCTAGAGAA
AGCCTGTAATATTGCTAAGTCTGCATACGAGCGGGATAGAGCTGTTGCTCGTAAGCTTGAACGTATGGCT
GATTTGGCTCTTACTAATATGTATAAAGAAGCTAGAATAAATGATAAGAAGAGCAAGGTTGTCTCGGCGC
TGCAAACAATGTTGTTTAGCATGGTGCGCAAGCTTGACAACCAGGCACTCAATTCTATACTGGATAATGC
TGTTAAAGGGTGTGTACCTCTTAGCGCAATACCATCGCTTACTGCTAACTCACTTACAATTATAGTGCCA
GATAAAACAGTTTATGATCAAGTTGTGGATAATGTGTATATTGCATATGCTGGTAATGTGTGGCATATAC
AGAGTATACAAGATGCTGACGGCACTGTTAAACAGTTGAATGAGATTAATGAAAGTGTTAACTGGCCCAT
TGTTGTTACTGCTACACGGTATAATGAGGTATCAACTACCGTGATGCAGAACAACGAACTTATGCCTGCA
AAATTAAAAACACAGGTTGTTAGTAGTGGACCAGACATGAATTGTAATGTGCCTACCCAGTGTTATTATA
ATAATAGTAACAATGGGCGGATAATTTATGCTATACTTAGTGATACGGATGGTTTGAAGTACACTAAGAT
AGTAAAGGAAGATCAATCTGTTGTAGTGTTAGAATTGGATCCCCCATGTAAATTTACTGTTCAAGATGCA
AAGGGACTTAAAGTTAAGTACTTGTATTTTGTTAAAGGTTGTAACACACTAGCCCGTGGCTGGGTTGTTG
GAACTATTTCTTCTACAGTTCGTTTGCAGGCAGGACATGCAACTGAGTATGCTGCCAATTCTGCAATACT
GTCTTTGTGTGCGTTCTCTGTAGATCCTAAGAAGACGTATTTAGATTATATACAACAAGGGGGTATTCCT
ATAGCAAATTGTGTGAAGATGCTTTGTGATCATGCGGGTACCGGTATGGCCATTACAGTTAAACCTGATG
CTACTACTAATCAGGATTCTTATGGTGGTGCATCTGTTTGTATATACTGCCGCGCGCGTATTGAACATCC
AGATGTAGATGGATTGTGCAAGTTGCGCGGTAAATTTGTGCAAGTGCCCATAGGTATAAAAGATCCTGTG
TCTTATGTCTTGACGCATGATGTTTGCCAGGTGTGTGGATTTTGGCGTGATGGGTCTTGTTCCTGTGTAG
GTTCAAGTGCTACATTGCAGTCAAAGGATACGAACTTTTTAAACGGGTTCGGGGTGCGAGTGTAGATGCC
CGTCTCGTACCCTGTGCCAGTGGTTTATCTACTGATGTTCAAAAAAGGGCATTTGATATCTGTAATGCTA
ATGTTGCTGGCATTGGTTTACATTATAAGGTTAATTGCTGTCGATTTCAGTGCGCTGAAGAAGACGGTAC
TTTATTAGACCAGTACTTTGTTGTGAAAAGAACAGGCCTTGATATATATGATAAAGAAAAGGCATGTTAT
GAGCGGTTAAAAGATTGTAGTGTTGTGGCCGTACATGACTTCTTCACGTTTGATGTTGAAGGTAGCCGTG
TTCCTCACATCGTACGCAAATATCTAACAAAATATACTATGTTGGATCTTTGCTATGCATTGCGGCATTT
TGACCGCAATGACTGCTCATTACTATGTGATATTCTTTGCTTGTATGCTGAGTGTGAACAGTCCTATTTT
ACCAAAAAGGACTGGTATGATTTTGTTGAAAATCCTGATATTATTAATGTGTATAAAAAGCTTGGTCCCA
TTTTTAATAGGGCTTTGCTTAACACTGCTAAGTTTGCTGATGCTATGGTAGAAGCAGGCTTGGTAGGTGT
TTTAACACTTGATAATCAAGATTTGAATGGTATATGGTATGATTTTGGTGACTTTGTTCTTGCAGCACCC
GGTTGTGGTGTTGCAATAGCAGATTCTTATTATTCTTATATGATGCCAATGCTGACTATGTGTCATGCGT
TGGACAGTGAGTTATATGTTAATGGAGCTTATAGACAATTCGATCTTGTGCAGTATGATTTTACTGATTA
CAAGCTAGAGTTGTTTAATAAGTACTTTAAGTATTGGACTATGCCTTACCATCCAAACACATGTGATTGC
GAGGATGATAGGTGCATAATACATTGTGCCAATTTTAATATACTATTTAGTATGGTATTGCCTAATACCT
GTTTTGGGCCTCTTGTTAGGCAAATCTTTGTAGATGGTGTGCCTTTTGTCGTCTCAATAGGCTACCATTA
TAAAGAATTAGGTGTTGTTATGAATATGGATGTGGATACTCATAGGTACAGATTGTCCCTAAAAGATCTA
CTTTTGTATGCTGCTGATCCAGCCTTACATGTGGCGTCAGCAAATGCATTATATGATTTACGCACATGTT
GCTTTAGCGTTGCAGCTATAGCGAGTGGCGTAAAGTTTCAAACCGTTAAACCCGGTAATTTTAACCAGGA
TTTTTATGATTTTATATTAAGTAAAGGCTTGCTTAAGGAAGGTAGTTCTGTCGATTTGAGGCACTTCTTC
TTTACGCAAGATGGTAATGCTGCTATCACTGATTATAATTATTATAAATATAACCTACCTACTATGGTGG
ATATAAAGCAGTTGTTGTTTTGTTTAGAAGTTGTTTTTAAGTATTTTGAGGTCTATGATGGTGGGTGTAT
CCCAGCATCACAGGTTATTGTTAATAATTATGATAAGAGTGCTGGATACCCATTTAATAAGTTTGGTAAG
GCCCGACTCTACTATGAAGCACTTTCATTTGAAGAGCAGGATGATATTTATGCATATACCAAGCGAAATG
TTCTCCCCACTCTTACCCAAATGAATCTTAAATATGCCATTAGTGCTAAAAATAGGGCTCGCACTGTTGC
TGGAGTCTCTATCTTGAGTACTATGACTGGCAGAATGTTTCACCAGAAGTGTTTGAAAAGTATAGCAGCT
ACTCGTGGTGTATCAGTTGTTATTGGCACCACGAAATTTTATGGCGGCTGGGACGATATGTTGTGCCGCC
TTATTAAAGGAGTTGATAATCCTGTCTTAATGGGTTGGGATTATCCTAAGTGCGATCGTGCCATGCCAAA
TATTCTCAGAATTCTGAGTAGTTTGGTTCTTGCACGTAAGCATGATGCATGTTGTTCACAAACTGATAGG
TTCTATCGTTTGGCGAATGAGTGTGCACAAGTTTTGAGTGAAATTGTTATGTGTGGTGGCTGTTTTTATG
TTAAGCCAGGTGGCACTAGTAGTGGGGATGCAACCACTGCCTTTGCTAATTCTGTGTTTAACATATGTCA
AGCTGTCTCTGCCAATGTATGTGCCTTGATGTCATGCAATGGCAATAAGATTGAAGATTTGAGTATTCGC
AGCCTACAGCGGCGCTTATACTCTCATGTGTACCGCAGCGATTATGTTGATCCTGCTTTTGTTAATGAGT
TTTATGAGTTTTTAAATAAGCATTTTAGTATGATGATTTTGAGTGATGATGGTGTCGTATGTTATAATTC
TGAGTATGCGTCCAAAGGTTATATTGCTAATATTAGTGCCTTTCAACAGGTGCTGTATTATCAAAATAAC
GTGTTTATGTCAGAATCCAAATGTTGGGTTGAAAATGACATAAAGAATGGACCTCATGAATTCTGTTCTC
AACATACAATGCTAGTAAAAATGGATGGCGATGATGTTTATCTGCCATATCCTGACCCTAGTCGCATTCT
GGGAGCGGGCTGTTTTGTGGACGATCTATTAAAGACCGACAGTGTCTTATTAATAGAGCGGTTTGTTAGT
TTGGCTATAGATGCTTATCCATTGGTATATCATGAGAATGAAGAATACCAAAAGGTTTTTAGAGTGTATT
TGGAGTATATAAAGAAGTTGTACAATGATTTGGGTAACCAGATATTGGACAGCTATAGTGTGATTTTAAG
TACTTGTGACGGACAAAAATTTACTGACGAGTCCTTCTACAAGAACATGTATTTAAGAAGTGCAGTTATG
CAAAGCGTTGGTGCCTGCGTAGTCTGCTCATCTCAAACATCTTTACGCTGTGGCAGTTGCATACGCAAGC
CTTTATTGTGTTGTAAGTGCTGTTATGACCATGTAATGTCTACTGATCATAAATATGTCCTAAGTGTAGC
ACCATATGTGTGTAACGCTCCAGGATGTGATGTGAATGATGTTACCAAATTGTATTTAGGTGGTATGTCA
TATTATTGTGAAGACCATAAGCCACAATATTCGTTTAAATTAGTAATGAATGGTATGGTTTTTGGTCTAT
ATAAGCAATCTTGTACAGGTTCTCCCTTTATAGATGATTTTAATCGCATTGCTAGTTGTAAATGGACTGA
TGTGGACGATTACATACTAGCTAATGAATGTACCGAACGCTTAAAACTATTTGCTGCAGAGACTCAGAAG
GCAACTGAAGAGGCTTTCAAGCAAAGCTATGCTTCTGCTACTATACAGGAGATAGTAAGCGATCGTGAAT
TAATTCTCTCTTGGGAGGTTGGCAAAGTGCGGCCACCACTTAATAAAAATTATGTTTTCACCGGCTACCA
TTTTACTAAGAATGGTAAGACCGTGTTAGGTGAGTATGTTTTTGATAAGAGTGAGTTGACTAATGGTGTC
TATTATAGAGCCACAACCACTTATAAGCTATCAGTGGGTGATGTGTTTGTTTTAACATCACACTCTGTAG
CAAATTTAAGTGCTCCTACGCTTGTCCCACAGGAGCATTATACAAGTATAAAATTTCCTAGTGTTTATAG
TGTGCCTGAAACTTTTCAAGGCAATGTGGTGAATTATCAGCACATTGGTATGAAAAGATATTGTACTGTA
CAGGGACCACCTGGTACAGGAAAATCTCATTTAGCTATCGGGCTGGCAGTTTATTACTGCACGGCTCGAG
TTGTTTACACAGCGGCGAGCCACGCGGCCGTTGATGCTTTGTGTGAGAAGGCATACAAATTTTTGAATTT
AAATGACTGCACGCGAATAATTCCTGCAAAGGTGCGTGTGGAGTGCTATGATAAGTTTAAGATAAACGAC
ACATCTCGTAAGTATGTATTTACTACCATAAATGCATTGGCTGAGATTGTCACTGATATTGTTGTTGTAG
ATGAAGTAAGTATGCTTACCAACTATGAGCTGTCTGTTATAAATGCTCGTGTGCGTGCTAAGCATTATGT
GTATATTGGAGATCCTGCTCAATTACCTGCACCACGTGTGCTATTGAGTAAAGGAACTCTCGAGCCTAAA
TATTTTAATACTGTAACTAAGCTAATGTGTTGCTTAGGTCCTGATATCTTCCTTGGCACGTGTTATCGTT
GTCCTAAGGAGATTGTGGATACAGTGTCAGCCTTAGTTTATGATAATAAGCTTAAGGCTAAAAATGATAA
GAGCTCATTGTGTTTTAAGGTCTATTTCAAGGGGCAGACCACACATGAGAGTTCAAGTGCTGTCAATATG
CAGCAGATATATCTGATTAGCAAGTTTTTGAAAGCTAATCCACTCTGGCAAAAGGCTGTGTTTATCAGTC
CTTATAATAGTCAGAACTTTGCAGCTAAGAGGATATTAGGTTTGCAAACTCAAACCGTAGACTCTGCACA
AGGTTCTGAATATGATTATGTTATTTATTCCCAGACTGCGGAAACAGCGCATTCTGTTAATGTGAACCGC
TTCAATGTGGCAATTACCAGAGCAAAGAAAGGAATTTTCTGCGTTATGAGTAATATGCAGTTATTTGAAG
CATTGGATTTTATGCCACTCACCTTGGATAAAATACCTTCCAAGTTGCAGTGTGTTACTAATTTATTTAA
AGATTGTAGCAAGAGCTATGTTGGTTATCATCCAGCTCATGCTCCTTCATTTGTTGCGGTGGATGAAAAG
TACAAGGTAAGTGGTGATTTGGCCGTTTGCCTTGATATTGCGGATTCTACTATTAGTTATTCAAGGCTTA
TATCCCTCATGGGTTTCAAATTAGATATAACCCTTGACGGATATTGCAAATTGTTTATAACAAAAGAAGA
GGCTGTCAAACGTGTGAGGGCTTGGGTAGGCTTTGATTCTGAAGGTGCCCATGCCACACGTGACAACATA
GGGACTAACCTCCCATTACAGTTAGGCTTTTCAACAGGAATTGATTTTGTTGTTGAGGCTGTTGGTTTGT
TATCTGAGAGAGACAGCTACAAATTTTCTAAAGTTGTGGCGCGTGCTCCACCAGGTGAACAATTTAAACA
TCTTATACCACTTATGACGCGCGGTCAAAAGTGGGAAGTTGTTCGTTTACGCATTGTTCAAATGCTTTCA
GACCATCTTGTTGATTTAGCTGATTCTGTTGTTTTTGTTACATGGGCTGCCAACTTTGAATTGACATGTC
TCCGCTATTTTGCAAAAATAGGAAAGGAGACAACTTGTAATGTGTGTACTAACCGTGCAACTGTGTATAA
TTCACGCACTGGTTATTATGGATGTTGGCGGCACAGTTTGTCTTGTGATTATGTGTATAACCCACTTATT
GTAGATATACAGCAGTGGGGCTATACAGGTTCTTTATCTAGCAATCATGATATGTATTGTAGCGTTCATA
AGGGAGCTCATGTTGCCTCTTCAGACGCTATAATGACTCGGTGTTTAGCCGTGTATGATTGTTTTTGTAA
TAATGTCAACTGGAACCTTGAGTATCCAATTATTAGTAATGAGTTAGTTATAAATTCTTCTTGTAGGGCA
TTGCAGAGAGTTATGCTTAAGGCGGCGATGCTCTGTAATAGATATAGTTTGTGTTATGACATCGGCAACC
CAAAAGCGATTGCCTGTGTCAAAGATTTTGATTTTAAGTTCTATGATGCTAAGCCTCTTGTTAAGGCGGT
GAAGACCTTGGTCTACACATATGATGCTCATAAGGACAGTTTTAAAGATGGTTTGTGTATGTTTTGGAAC
TGCAATGTGGATAAGTATCCCTCCAATGCAGTGGTATGTCGGTTTGACACAAGGGTGTTAAGCAAGTTAA
ATCTCCCCGGTTGTAATGGTGGTAGTCTGTATGTTAATAAACATGCATTCCACACACCTCCCTTTATTCG
GGCAGCCTTCGAGTATTTGAAACCAATGCCTTTCTTCTATTATTCAGATACGCCTTGTGTGTATATGGAG
GGCATTGATGTTAAACAGGTGGATTATGTACCTCTTAAATCCGCCACTTGCATCACAAGATGCAATTTGG
GTGGCGCTGTATGTTTAAAACATGCTGAGGAGTATCGTGAGTATCTTGAATGCTACAATACAGCAACTAC
AGCAGGTTTTACTTTTTGGGTCTATAAGACCTTCGAATTTTATAATTTGTGGAATACATTCACCCAACTG
CAGAGTTTGGAGAATGTAGTTTATAATTTAGTCAAGACTGGAGCCTTTACTGGTGAGGCCGGCGAAATGC
CTTGTGCTATCCGTAATGACAAAGTCTTTGCTAAGATTGAACAGGAGGATGTCTTAGTGTTTAAAAATAA
CACGACATTCCCTACTAATGTGGCCGTCGAACTATTTGCTAAGCGAAGTGTTAGGCACCACCCAGAGCTT
AAGCTCTTAAGAAATTTGAATGTTGATGTTTGCTGGAAGCACATCATCTGGGATTATGTTAGAGAGAGTA
TATTTTGCACTAGCACCTTTGGTGTTTGCAAGTATACTGACATTAAAAATATTAGCCAATTGAATGTATT
ATATGATGGTCGTGACAATGGTGCTCTTGAAGCATTTAGAAATGCACAAAATGGTGTGTTCATTAGCACG
ACAAAAATAAAAAGTCTATCGATGATTAAAGGTCCACCACGTGCAGAATTAAATGGACTGTTGGTGGATA
AAGTTGGAAAAGAAGATGTTTCTTTTTATTTTGCAGTTCGTAAAGAGGGTCAGGATGTTATCTTCAGCCA
GTTAACCAGCCTGGGAGTCAGCTCTAACTGGAGCCCACAAGGTAATCCAGGGGGTTATGCCAAACCCGGT
AATGGCGCTGGTAATGATGCTCTAGCGCTTGGGAATCTCTTTACGCAAAGCAGACAGCTTGAGACATTTG
AACCTCGTTCAGAGATGGAGAGGGATTTTGTCCAGCTGGAAGATGAAGTGTTCATCCAGAAGTATGGTTT
GGAGGACTATGCTTTTGAACATATTGTTTATGGAAGTTTTAACCAGAAGATAATTGGTGGGTTGCATTTG
CTTATAGGCTTGTACCGAAGGCAGCAAACCTCCAAGCTGGAAATTCAAGAGTTCATTGAGTATGACTCTA
GCATACATTCGTACTTCATCACAGACCAGAAGAGTGGTAGTAGTAAGAGTGTGTGCACTGTGCTTGATTT
GTTGTTAGATGATTTTGTGGCTCTTGTTAAGTCACTTGATCTAAATTGTGTTAGTAAGGTAGTTAATGTA
AATGTTGATTTTAAGGACTTTCAGTTTATGTTGTGGTGTAACTCGGATAAAGTGATGACTTTTTATCCCA
GATTGCAAGCAGCATCTGATTGGAAACCTGGTTATACTATGCCTGTGCTATATAAATATCTCAATTCATC
TATGGAAAGAGTTGATTTATGGAATTATGGCAAGGTAATCCCACTTCCTACGGGATGTATGATGAATGTT
GCTAAGTACACCCAGCTATGTCAGTATTTGAATACTACAACGCTGGCTGTGCCTGCAAATATGAGAGTCT
TGCACTTAGGAGCGGGCTCAGATAAAGGTGTTGCACCTGGTTCTGCAGTTCTTAGGCAGTGGTTACCCGC
AGGTACAATACTTATAGATAATGATTTGAATCCCTTTGTTAGTGATAGCGTTGCTACTTACTTTGGGGAT
TGTGTTACGCTACCTTTTGATTGTCAGTGGGATCTGATAATTTCTGATATGTATGACCCTATAACTAAGA
ATATAGGAGAGTATAATGTTAGTAAAGATGGTTTCTTTACGTATATTTGTCATTTAATCCGTTCCAAGTT
GGCTCTAGGAGGCTCAGTTGCCATAAAAATAACAGAGTTTTCGTGGAACGCAGAATTATATAGTTTAATG
GGGAAGTTTGCTTTTTGGACGGTCTTCTGTGCAAATGCAAACGCCTCTTCAAGTGAAGGATTTTTAGTTG
GCATTAATTATTTGGGTAAGTCCAAGGTTGAAATTGATGGAAATGTTATGCATGCCAACTATTTGTTTTG
GAGAAATAGTCAGATGTGGAATGGAGGGTCTTATAGTCTTTTTGACATGACTAAATTTCCACTTAAATTG
GCTGGTACTGCGGTGGTGAATTTAAAAGCAGACCAGATCAATGATATGGTTTACTCTCTCATAGAGAAGG
GTAAGCTACTTGTTCGTGATACAAATAAAGAGTGTTTTACAGGTGATAGCCTAGTAAATGTTAGTAATCT
AAACTAAAATGGCTGTGGCATATGCTGACAAGCCAACTCATTTTATTAATTTTCCGCTTTCTCATTTTAA
CGAGTTTGTCGTGAAATTTAATAAGCTTCAGGCTACAATACTTGAAAGAGGTGTAGAATGCAAGCTACAA
AATTGTCCGCACATTAGTGTCACTATGCTTGATATTAAGCCTAGTGATATTAATTCGGTTGATATTGCCA
TTCAGGAAGTTATAGATGACTTTTGCTTCGATGATGCGGCTCTTACATTTTGTAACCCGCACATTCTAGG
CAGATGCATTGTCCTGGATGTTAAAGGTTGTGCAGAATTGCATGAAGATGTTGTTGACTATATTAGAGAA
AAAGGATGTGTTGCAGACCAGTCTAGAAAATGGATTGCACACTGCACCATCGCACAATTCACTAACATAA
CACCAAAACATCTTCCTGATGGTATAAAAGACCTACAATTCAATTGTACAATACCCATCAATCAATCTGC
CCCTGCATACCTCGAATTGGTAGAGCTAGGTGCTGATAAAAAGGATGGGTTTTATAAATCACTAGTTAGT
CATTGGATGGGAATCAGAAGTGTTGGTAAACCGCCCACTGACCATCTTAGTGCTATAATGGGCTATTGTT
GTTTGGATATGATACGAGAAGAGCTACCTGAAGGAAGTTTTCCCGAGCAAGATGATGATGCTTGGAATAA
GCTCGCGTATCATTATGATAACAACTTGTGGTTTTATCGATTTGTCTTCAAGAATAGTAAATATTTTCGA
AAGACAATTCGTCACAAATGTTGTAATTGTGCAGGTGAGTTTTCATACACGTCAAGTGATGAAGACTGAA
CTCGTTTTTAGATATGGCCACCGCAGTCCTAACCATAGGCCTGCTTTGCCTCCTCGTCGGTGTTACAGGT
TTTGAAAATCCTCCCACCAACGTGGTTTCTCACATTAATGACGATTGGTTTTTGTTTGGCGACAGTCGTA
GTGACTGTAACCATATCAATAATATCAATCCTAAAAACTATTCTTATATGGACCTCGATCCCTCGTTGTG
CAATTCAGGAAAAATATCTTCTAAGGCTGGCAATTCCATCTTTAGGAGCTTTCATTTCACTGACTTCTAC
AACTATCAGGGTGAAGGGAACCAAATAATATTCTATGAAGGCGTTAATTTTTCACCGAGTCATGCGTTTA
AATGTACCTCGTCCGGTGATAATGGTATTTGGATAAATAATAAAGGTAAGTTTTATGAGCAAGTGTATAA
GAAGATGTCCGTTTATCGAGGCCTCTCCATAATAACTGTTCCCTATGTGTACACTGGAGCGGCAGCTGCA
ACCTCAATTTGTAAGAGGGGCAGTCTGACCTTAAATAATCCAGCGTCTATACAGAGGGAAACTGGTGTTA
ATACTTATTTTTACACCGCTGAGGCTAATTTTACTCTCACGGGTTGTGATGAGTACATAGTCCCATTGTG
TATTTATACTGGTATGTTCCTGGCTTCAGGTACTTACTACAATGACAGCCAGTATTATTATAGTTATAGT
ACTGGAGAATTCTATGGCCGTAACAACACAGTTGATAAAGCTACTGTAGTTGATTACGAGTGCCAATATC
TTACCTTGCCTTCAGGAATTTATAAATCTGTTTCTAATGAGTTGCTTCTCACAGTTCCGACGAAGGCTAT
CTGTCTGACAAAGCCGAAGAGCTTTACGCCAGTACAGGTTGTCGATTCTCGTTGGAACCATGCCAGGACC
TCTGATAATAAAACAGCAGAGGCATGTCAATTGCCTTATTGCTATTTTCGTAATTCTACCACAGATTATG
TTGGTAGCTATGATATTAACCATGGCGATGTTGGATTTTCTAACATCCTCAAGGGTTTAATTTATAATGC
CCCTTGCTTTGCTAAGCAAGGTGTGTTTATGTATAATAATGTTAGTAGTGTTTGGCCCGTCTATGCCTAT
GGCGAGTGCCCCACTGCTGCCAATATAAATATAAATGGAATTCCCATTTGTAATTATGATCCGCTACCTG
TCATTTTGCTTGGCATTCTTCTTGGAATAGCGGTTATAACCATTGTGGTTTTGCTTTTATATTTCCTTGT
AGATAATGGTACTAGGCTTCATGATGCGTAGGCCATTAATCTAAACATGGTTATAATTTTTCTGCTCTTA
TTCGCCGAGCCTGTTTTTGGTATTATTGGCGATTTTAAGTGCACTCAAAGTTGGATTAATAGTGCCGCCT
CACCACAGCCGCCAATTTCCACTGAAGTTGTTGATGTGTCTAATGGTGTTGGCACGTACTATGTTCTAAA
TCGTGTTTATTTGAATACTAGTTTGTTGCTCACTGGTTATTATCCTGTATCGGGTTCCATCTATCGTAAC
CTGCTACTTAAGGGAACTCAGTGGTTAAGCACTAACTGGTTTCTTCCACCATTTTTGTCAGAATTTAATT
CTGGTATATTTGTTAAAGCTAGAAATAGCAAACCTGTGTTAAATGGCATCACTCATTCTGAGTTCGGAAC
TATAGTTTTTGGTACCTCTTTTGTGAATACCACTTACACTATAGTTATAGAGCCATCTACACAGATTGTT
AATGGTAAGTTAATTGGCACCTTGAGTGCGTCTGTATGCCAATACACTATGTGTGAATACCCTAATACGG
CTTGCAATCCTGTCTTGGGTAATGGACGACCTAGTCTATGGCATGCATCTATAGGCATTGTTCCTTGCCT
ATATCAGCGCAATTTTACATATAATGTGGCTGCTGATAATATTTATTTTCATTTCTATCAAGATGGTGGA
ACTTTTTATGCGTATGTAGGTGATAAAAGTCCTATTACAACGCTTTTGTTTCAAGTATATTTAGGCACTG
TCGTCACACACTACTATGTGTTGCCACTTGTGTGTAACGCCAGGCAAACTTATGAGTATTGGGTCACACC
TCTTATCAAGAGGGAATACCTTCTAGTCTTCGATGGCAACGGTGTAATTACCAATGCCGTCGATTGTGCT
AGTGATCACATGAGTGAAATTCAGTGTATGACTCAAAATATAAAACCTGTTACAGGAGTATACGAGCTCA
CTGGATACACTGTTCAACCAATAGCAGATGTGTACAGGCGTATACCCAATCTCCCTGATTGTGAGATCGA
ACAGTGGTTAAATGATCCACAAGTACCCTCTCCAATCTCATGGGAGCGCAAAACATTTAGTAATTGTAAT
TTTAATATGAGTAGTCTCCTCAGCAAGGTGAGGGCTACTTCTTTCTCTTGTAATAATATTGATGCTTCCA
AGATATATGATATGTGTTTTGGTAGCATAACTATAGATAAATTTGCCATTCCAAATAGTAGAAAGGTTGA
TCTACAGTTTGGAAGTTCAGGGTACATTCAGAATTACAATTATAGGTTGGACCAGTCCGCTACTTCTTGT
CAATTGTATTATGGCATCCCTGCTAATAATGTAACAGTTACCAAGAAGAATCCTAGCGGTTGGAATAATC
GCTATGGCTTTGTTGAATTTAAGCCTCTTAATATTGGTCAGAACTATAATAAATATAGTGCGATTTATTC
CACTATGTGTTTTAATGTACCCAATGATTATTGTCCTTGCAAACTTGGTTGCCCCACTGGTACTGTTGAA
AGACCTCAAATTGGTACATCAACTAGTGGACAACCTATATATGATTGTCCTGGTTATCCTTGGTTGACCA
GCTCAGCATGTAAACAAACACCAGCCACTGTGGGTGTTGGACAATATTGCCCTGGTGTGGGCGTTATGGC
TGACCAATGTGCGCCATCCATGCCGGGCAATTCCATCCTCACATGTTCGTGTTCTAATACTCAGTATAGT
GCAGGCAATAGTCAACCTTATTACTATGCCTGGACTTCTTTTGGAGCTGACACTTGTTTGTCGGGCGGTA
ATTGTCAAGTCTTTGCAAATGTTCTGCTTAATAATGTAAATAGCGGTACCACATGTGCCACCGATTTACA
GAAGGCAAACACTGAAATTATAGTAGGTGTTTGCGTTAAATATGACCTTTATGGCATATCAGGCCAGGGC
ATTTTTACTGAAGTTAATGCCACCTATTATAATAGTTGGCAAAACCTCCTCTATGATTCTAATGGTGGTC
TTTATGGTTTTAAAGACTTTCTCACCAATAGAACTTATATGATACGTAGTTGCTATAGTGGACGTGTTAG
CGCCGCTTATCATTCTGACACTGATGAGCCTGCCCTTCTGTACAGAAATCTCAAATGCAGCTACGTGTTT
AATAATAATATTTCTATCTCACGCTCAGTCATCAGGTACTTTGATAGTTACCTTGGCTGTGTGGTTAATG
CTGATGACGATATCGCTGAAGCTGTTGGTTCTTGCAATCTCACTGTTGGCAGTGGTTATTGCGTGGACTA
TTCATCTACATGGCGAGCCAAGAGAGATTTAAATACTGGTTATCGGCTTACTAATTTTGAACCTTTCGTT
CCTACTCTTGTGAACGATAGTGTTGAATCTGTTGGTGGTCTCTATGAGATCCAAATTCCGACAGAATTTA
CTATAGGTAACCTAGAGGAATTTGTACAAACAACTTCCCCCAAGGTAACCATTGATTGTGCTGCGTTTGT
CTGTGGTGACTATGCGGCTTGTAGAGAACAATTAGTAGAGTATGGTAGTTTCTGTGATAACATTAACACC
ATACTAAATGAAGTTAATAGCATGATTGATACATCCCAGTATCAATTAGCTAGTACATTAATGAATGGTG
TCACACTAAGCAGCAGGCTTAAGGATGGCATCAGTTTCAATCAGGACGACATCAACTTTTCTTCTGTGAT
GGGCTGTGTTGGTAGCAATTGCATATCACACCGCTCCGCAATAGAAGATATACTTTTTAACAAAGTAAAA
TTGTCTGATGTTGGTTTTGTGGACGCTTATAACAATTGCACTCAAGGTTCTGAAATTAGAGATCTTGTTT
GTGTGCAGAGTTTTAACGGTATTAAGGTACTACCACCTGTTCTATCAGAGTCTCAGATGTCTGGTTACGC
TACAGGTGTAGGACTATCCATGCTGTTTCCGCCATTTTCAGCGGCAGCAGGGGTCCCATTCACTATGAGT
GTTCAATACAGGATTAATGGTCTTGGTGTCACTATGGATGTTTTGAACCAGAACCAGAAAATGATTGCTA
ATGCCTTCAACAACGCTCTGACAGCTATTCAGAATGGGTTCGATGCAACCAATTCTGCGCTAGCTAAGAT
TCAGTCTGTTGTGAATGCAAATGCAGAAGCTTTAAATAACTTGTTGCAGCAGCTCTCTAATAGATTTGGT
GCAATTAGTTCATCTTTACAGGAAATTCTATCTAGGCTGGATGCCCTTGAGGCACAAGTCCAAATAGATA
GATTAATTAATGGCAGGCTTACTGCCCTCAATGCCTATGTGTCGCAACAACTTAGCGACATAACGCTTGT
TAAGTTCAGTGCTTCTCAGGCCATTGAGAAGGTTAATGAATGTGTTAAAAGTCAGTCAACGCGCGTAAAT
TTCTGTGGCAACGGAAATCATATATTGTCTCTTGTCCAGAACGCGCCATATGGATTATATTTTATTCACT
TCAGCTACCAACCAACTAAATACACCACTGCTTACGTGAGCCCTGGCTTATGTTTGGCTGGTGATGTTGG
AGTAGCACCTAAAAGTGGGTACTTTATCAAAGTTAATGATAAATGGATGTTCACTGGTAGTGCTTACTAC
CATCCTGAACCCATTACTAATGATAATGTTATAATGATGAATAATTGCGCTGTGAATTTTACAAAAGCGC
CTGATGTAGTCTTGAACACATCAATACCTAATCTCCCCGACTTCAAGGAGGAGTTGGATAAATGGTTTAA
AAATCAAAGTTCAGTGGCACCTGACTTGTCGCTGGATCTTGAAAGAATTAATGTTACCTTCCTGGATCTC
CAAGAAGAGATGGATAGGATTCAGGATGCAATTAAAAAGTTAAATGACAGTTACATCAACCTAAAGGAGA
TTGGTACGTACGAGATGTATGTAAAATGGCCTTGGTATGTATGGCTCTTAATTGGCCTTGCAGGTGTAGC
TGTCTTAGTACTCCTATTCTTTGTATGCTGTTGTACAGGATGTGGATCTAGTTGTTTTAAGAAGTGTGGA
AGTTGCTGTGATGATTATGGTGGTCATCAAGATATTGTGGTTAAAACCAGTCATGATGATTAACCCCGAT
ATCAGACCCCATAAATCACAGCAAGATAGGAAAGTGTTATTAAGTGTTAAAACCCATAAGCAGAGCCCGT
AATCTAACATTCACAATGAGTGATAGTGTTAAGATTATTGCTATTTTGGTTTTAACACCTTTGCTAATAG
CACTAGTAGTTGGAGTATGTCTCCTTCATTTATCCTTTGTGATATCAGGGCTAGATATAAGAAATACCAC
AAACCCATCCGCAAGGATTGGTACTGTGTGTTATACAATTAGAACCCCGCCTACGTCAGTGGTTACATCT
GGTGATGACGGTCGCGTTACATTAATTAAACCTACTGACACTTATACGAGTGTCTATTTGGGTAAATTTA
GAGGATTTGATACTGGTACAACAGGATTTAAAACCCCTGATTATAGTACCAGTACCAAGCCTATTCTTAC
AACGGGTAAACCTTATAATTTTCGGCACCTGCCGAAATTTAGGAGGCTAACCCCTACATGGATCCCTGGG
CTGTAGACAACATTGTGTACACTCGTGCATTTGATGTTTACAACCTAGAGAGTTATTGTTCCATTTTTGG
ATATAAGAGACCCGCAGTGGGTTACTCTTTCGTACATAATAATTCGTGGTGCCGTAATCAAGGTAAAGTT
CTTGCAACTCTGACCTTGTACGGAAAAACGGATAAAAATTTTGGAATTATTTCTGGCTTTAAGAGCTTCG
GTAATTCACCTTCCGAGGCTGTTAATAAGCTAGTATCTGAGACCATTGAGTTCATACTCTGGCGAGCAGA
GCATTTGAATAGATATGGTTGAACTTTCTCTTACAGACACAGTGTGGTATGTGGGGCAGATAATTTTAAT
TGTTGCTATATGCCTGCTCGTTATTCTTATAGTGGTAGCAGCCTTGGCAACATTTAAACTATGTATTCAA
CTTTGCGGTATGTGTAATACTTTAGTAGTGTCCCCTTCTATTTATGTGTATAATAGAGGAAGACAATTTT
ATAAGTTTTACAGTGATGCAAAACCCCCTGTTTTAGATTTGGATGATGTCTAGTTCATCTAAACATTATG
AGTGGTCAAGCAACAACCCCAGAGCCAATCTATAGCTGGACTGCGGATGAGGCAATTAGATTCCTAAAAG
AATGGAATTTCTCTTTGGGTATCATACTACTTGTAATCACAATCATACTACAGTTCGGTTATACGAGCCG
TAGCATGTTTGTCTATGTCATCAAGATGATAATTCTCTGGCTCATGTGGCCTCTGACTATCATTTTGGTT
ATTTTTAATTGCGTTTACGCATTGAATAATGTGTATCTTGGATTTTCTATAGTGTTTGCTATAGTGTCCA
TTATTATGTGGATTGTGTATTTTGTGAATAGTATTAGGTTGTTTATTAGAACGGGAAGTTGGTGGAGTTT
CAACCCCGAAACAAACAACCTGATGTGTATAGATATGAAAGGGAGAATGTTTGTTAGGCCCATAATTGAG
GACTATCATACCCTTACGGTCACAATAATACGTGGCCACCTTTACATTCAGGGTATAAAGCTTGGTACCG
GCTATACTCTATCTGACCTTCCCGCTTATGTGACTGTAGCAAAAGTTACACACATTTGCACGTATAAGCG
GGCATTTTTGGATAAGATAGGCGATATCAGTGGTTTTGCAGTATATGTGAAGTCCAAAGTCGGCAATTAC
CGGCTGCCATCCTCTCAAAAAGGGAATGGCATGGATACCGCATTGTTGAGAAATAATGTCTAAACTTAAA
GGATGTCTCATACGCCAGGCAAAGCTGGTAGCAGATCATCCTCTGGTAACCGTAATGGCGGCATTCTTAA
GTGGGCCGACCAGACGGAACCTAATAATGTTAATAGCAGAGGTAGAAGAGCCCAACCTAAGCAAACAGCT
AATACCCAGGCTTCAGGAGGAAATGTTGTACCATTTTACTCCTGGTTCTCTGGAATTACTCAGTTTCAAA
AAGGGCAAGAATTTGGATTTGAACAAGGACAAGGTGTGCCCCTTACCAATGGAGTCCCTCCCTCAGAAGA
AAAGGGATACTGGTATAGGCACAACAGAAAGTCCTATAGAACTGCAGATGGACAACAACGGCAGCTGCTA
CCCAGATGGTATTTTTACTATCTCGGAACAGGGCCGTATGCGAACAAACAATACGGGTCGGACATCGACG
GTGTTGTTTGGGTTGCTAGTCCAAATGTTGATGTACGTTCCCCAGCGGACGTTCCAGATAGGGATCCTAC
TAGCCACCAAGCTGAGCCGACTAGGTTTGCGCCTGGCACGGTTCTGCCTAAAGGCTATTATGTTGAAGGC
TCAGGAAGGTCTGCTCCTAGCTCGCGATCTAGCTCTCGTGCATCCAGCAGAGCATCTAGTGTCGGCGGAA
GCAGAAGCAGAAACAACTCAGCTTCTAGAAATAATACCTCTGAAGTGACACCTGATATGGCTGATCAAAT
TGCTTCCCTTGTGCTGGCCAAGCTGAACAAAGAGTCCGGCAAACCAGTGCAAGTTACAAAGCAGACAGCC
AAGGAAATAAAGCAGAAAATTCTCAACAAACCCCGCCAAAAGAGGACGCCCAACAAGCAGTGCACTGTTC
AACAGTGTTTCGGCAAAAGGGGCCCCAGCCAGAATTTTGGTGGTGGTAGTATGCTCAAATTGGGAACTAG
TGACCCACAGTTCCCCATCCTTGCTGAATTGGCCCCCACAGCGGGAGCCTTTTTCTTTGGATCCAAGCTG
GAATTGGCCAAAGTCAACAACATGTCTGGGGCTGCTGATGAGCCGCAGAAGGATGTTTATGAGCTGCGCT
ATTCTGGTGCAATAAGATTTGATAGCACCCTACCCGGGTTTGAGACTATCATGAAAGTTATGAATGAAAA
TCTGGATGCGTACCAACATACAGAAGAGGGTGCGCAATTGTTGAGCCCAAAATTTCAGCGCAAGCAGAAG
AAAGGGCAAGTTGAAAAGGATAATGTGAGTGCTGCAACGCCCAAGAGTCGTGTGCAGCAAAATGTAAGAA
GAGAGCTAACGCCCCAGGACCTCAGCATTCTCGCGCAGATTGATGATGATACCCAGGGAAGCTCAGAAAT
ATAAGAGAATGAACCCTATGTCGGCACTAGGTGGATAAAACCTCGCTAGCCAGTCGGGATAGGGCACTCT
CTATCAGAATGGATGTCTTGTCACTACAATAGATAGAGAAGGTTGTAGTGGACTATAGATTGCTTAGTTG
AAAATTATTGTTGATCATGTATAGTGTTGGAGCAGGTGAAAGATGTGCGTACATAAGTGACGACACGTGC
CCATGTGGAAGAGCCAGCATGTTAAGTGATCAGTAATAGATTAGTAAATGGATGAAGGTAATCATGGCCA
ATTGGAAGAATAACAAAAAAAAAAAAAAA

>gi|212681388|ref|NC_011550.1| Munia coronavirus HKU13-3514, complete genome
GACAAAAGATAAAAATTATACACGTATAATTTTTGTCTCTCTAGCTTCGCTAGTTCGCTACCGACACCAA
TCCAGGTGCGCCGCCATTACTTGCTCCCGTTTTGGCAGCCTTTGGCTGACCTACTTGGTCACTGCCGCAC
AAAAGCAGCAGAGTTCGCCGAGGACGGTTTTCAGCTCTTTGGCTGTGTGGGTTGAACTGGACCACTTAGT
CACCGGTGCCATAAAGGCCTGGAGTTCGCTAAGCTCCCGTTTAGCCTACAGTGCAGATAGTGGCTTTTTG
CACTATTTACCTTTATTTGTGGTTCCTCTGACCGTTCACCAACTCTATAGACAGCGCAGATTACTGTAGG
GTTAAGTTGCACCGGTATTCGCACCGCCCGTCAGCGGACGCATTATCCAGCATAGCACTCCTTGCATCGA
GCCTAGGTAGGATAAAACCCCCTACCGGGTCACTTTTAAGGCGTTTCCTCCACGGGATAGCCACTAGTGA
CTAGGTGTAAGTGATCTGATCTGGACGTATTGCGTTGCGCAAGTGCAACACCCATAGGAGCGTGGAATCC
TATTCTGCAGCTCTGTGCCTGATATAGTTTTGGAATGGCCAAGAACAAGGAGAAGCGCAGTCCCATTGTA
CTGCCTGAATTAGTGCCTCCTCCACTGCAGCTTTTTATATCTGTTGCTGCTTGCGAGGAAGGACATCCCA
ACAATACTACCTACTTGGCTAACTATAACTTGTACACCACCAAGGCTCCGCCAGGTGTGCAGGTTATTAA
GCCTGGTATATCACTTACTGACTTTGAGGCTATTTTTGGATCGCAACCCACTTTGCGTGCCATACGCAAT
TTGGTTTGTGAGCGCAACGCTAGTTGGGCTAATTCCAAGGATGATTTTTACCTCAAGGCCAAAACTTTGA
CCTTTTCTGATCCTGTGTTGCGGGCCATAATTCGCTATGCTCCGCCTAGGATTTCATCACTTGCAGCATT
GGCTCTGTTTGACCGGCTGGTTAAAATAGAGTATGATGAACTTAAGAAGATTGCCCTAGATGCAGCTGTT
GTACTTGCATACGAAGGCAAGATTACCACAACCCTTGCAGATGCAAAGAGTGTTGTGCTTACTCATAAGG
ACTCCTACTTAACGTTATCCAATGATGTTGTAGGAGCCAAATTTACTTCTGTCCTGCTTGCGCAGGCCAG
TCCAGCTAATGCGGCTATGCGGTTCTTAAACTTTTACCTTTATCCTTCGGCAACGGCTGTTGAGAAGGAC
GGTAAAATGCAACCCGTAGCCTGCAAGCCTATCCCTGCAAATGCTAAAGGAAAACCAATTCAAGAGGACT
GCCACCTGATTCCAGACTACCAGCAACTTGTTGTTAGTCAGGTTGAAGGTGTTGATTCCATTGTTGATGG
GGTTCTCTACCTTAAGACTAGCTCAGTACCACCCATTTACTATCCTCGTGTAAAGGGCGGTGCCTTGCTT
ATACCACTTAAACCACAGGGCACTTCATCAAAGAAGCTTAACGTGGTTTTTCATACTGAACCATCTGATG
TTTTGATGGCTTTTGTACAAATGCAACAATTTCTCAGTCGCACTGAGCAATCCTGGATTGAAGTGACTGA
TGCCCAGACCTATGATGTTTCTCCTACCGTAACTGTACGTGTGGGGGTGTCTAAACCTGGAGATGTTGTT
GTGTCAACTGAAGAGGAATACCTCAATTGTTTTAATGACCCTGACGTGAAAGAGCTTTATAAGCTTTTTC
GCACTGAGTCATGGGCCAAACTTGAACGGAAATTTGCGGGTCTGAGGGTTCGCATTTCGTCCGCTTTATC
CAACTTTATAAGCTTTTTGCATGCAATTGCAGATCGCTTTAAACCATTGTATGATGTCATTCATGCAGTT
ATCTATAAGCTTCAGTGCTTATCTTTGGATGCTGCTGCGCGCATAGCGAGTGTTAAGCTTGTCTATCGCG
CTGGCAAACTTATAGTTGACGCTGCATCCTTTGTGGCATCAGCTATACAACCATTATGTGACTTCTTCTT
ACCCTTTCTGAAGAAAGTCGCTGATTATGCAACTTATGCAGCTGGTAATTACATGTTGATGTTTACTAGC
GCAGGTACTTTTGTGTTAAAGAAAGCCCCAGCAAAGATAATTAATAAGGTTAAGTACATCTTTGATGTTA
ACCCTGATTATCCTGTTGAGGCAACAACCAACAAAGTAGTAACACATGATTCGCTCGCAATAACAGATGC
CACTCCTACTAGGGCTCTAGAGGCTGTTGACGTTGTTGTAGGCTCTACAGTGTTACAAATGGCAACAGAT
GGCACTTCTTACTTTCCTTCGGATGGTAACAGTGCTTCTTTACCTGGATTTCGAGCAGGCGCAGATCACC
TTACTGTGAGTTTTGTCTGTGACCTTTTTGATGATCCAACAAATCAGGCTATTAATGAGCTTTTAGCTGG
TTATGAGCTTAACAATTTAGTGGCACCAAGCGACTCAACTCCAAGGGACATTGCTCGCCTTGTTGTTGAT
GCTCTTGTTGACGCTCTAACAGACCACTTCCCAGAGAGGGTCATGGACTTACCGGAAGACTACCAAGTCT
TCTCTAGTCATGATGACCTACCTCTGGCAACACACCATATTCCCGACCATCTCACTCTCTATGTTCAAGC
TATGGAGAGTGAGGATGACTGTGAAGATGAACTTTATGTGGAGGATGATGACTACTGTGATCAGCCTGCC
ACAAACTTCGATGATGAAGAAGGACCTATTCCTCAGCAATGGGACCTTCCGGATGTAGACCACTTCTTAG
CAAAGTTGCGCAAGGAGCCGGCTGGCGACCAAGCACCTGCTAACACTAGTGATCAACAACAAGATCAAAT
TACTAGTAACCAGACTCAACCTACCGACGAAGAGCCATCAGCTTATGAGCCGGATGAGGTTAACTCTGAT
GATGAAATTATTATTCCTATAGTGCCTGACCAACCTGCGGACTTTAAAGCCGCAGTAAGCACTATAGCAG
AATATAAGACAAAGGATAAACTTCCACCCATTCAGGAAGAAACATCCAGTCAGGAGAGCAGTCGTTCCAC
AACTCCTAATCAGGAGGGCATCGACGCTACTTCAGACGTAAATAGTGTAGACTCAGCAGATGAAAGTGCT
GAATCGAGCTCAGAAACAGATAGCACCTTTGAAGATGCTACAGAAGATGTTCAACCTCAGCAGGATAGTT
CCTCGGCAGTCCGGTCTGTCGGATTAGATGACCAGAATTCCATTGCTAACGCGGCACACGATCGTGGCAA
TTGTGATAGTAAGGTTATCTTTGAAGATGTCGAGTCGGCCCAGGCTACTACTGCAGAGGCAGTCAACACT
GTCCAATCGAGTAACCAGAACTCCATCGCTAACGCGGCATACGATCGTGGCGATTGTGATAGTACGGCTA
TTTGTGACGATGGTGAGACAATCATTACTGATAGTAGTGAGGGTGACATCACTGATGAACCCCTGGCTAC
TATAGTAAACACACCTACAACTGTAGATAACAATTTGCCAGCAGTTGCTGTTAAACAACCTAGCCCTACG
AAAGTAGAGCTCGTTGTGGGACAGCTGACTAGTATAAAATATGACAATTCCGTGTTAGTAAATCCAGCCA
ATGAAGCACTTTCCAATGGGGGTGGTGCTGCTAAGGCTATAGCTGACATGGCAGGTCCTAAATATCAGGC
TTACTGTGATAGCATAGCGCCTATTACAGGTAATGTTACTACAGAACCTTTTGATGCCGCTAAGTATGGT
GTCTCATGTATTTTACATGTGGTGCCACCACGCGGTTCAGATCCTAATGTGCAGGAACTTTTGTACCAGG
CGTATAAGAGTATTCTTACTGAACCTGCGCACTACGTTATACCTATCTTAGGTGCTGGCATCTTTGGTTG
CAATCCTGTGCATTCGCTTGATGCCTTTAAGAAAGCCTGCCCAAGTGACATCGGGCGTGTAACCCTTGTC
ACTTTGGACAGCAATCATTTGCAAATTTGGGATGCGATTAACAGAACTGTTGTTCGCACCACAAAGGACT
TTGACCAGGTCACCACTAAGGCATTAACACCTCAAGGCATACTTGATGCTAACCTTTTTGATGGCCAAGA
ATTTGTCCAGGACCCAAAGCCTGGTCAAGTTTATTTGGAGGTTACTGATGAAATACAGCAGCAGGCAAAA
GAGCTTGATCTCACCCTGCAGCAGTATGTAACCTACCTTAAACTCTGTCATGCTAACTGGCCCATTAGTC
GTACTAATGGCGTTATGCATTTGAAACAACATAGAAATAATTGTTTTGTAAGCGCGGCCTTGAATTTGTT
TCAAAACACGCGCTTTCAACTGAGGCCTGCCATTGATCAACTCTACAAAGAGTTTCTTAATGGCAATCCT
AGTAGACTTGTAGCTTGGGTCTATGCGGCAACTAACCACACTATTGGTGAGTTTGGATGCCCCCAGGAAG
TAATAGCATTGTTCGTTAACAACGCAAACTCTGCATTTTCAGCCACTACAGTTTGTTGTGGCACCTATTT
CAACCACACGGGGGTCATATCTGTTTCAAAAGATTATGACCCACTGGTACCGAAGGTCTACTGTATGAAG
TGTGACACGTGGACTCCGTTTAACCCTGTTAGTGGTGTAGGAGCAATTGCAGTCGGCACTTCAGATGAGG
AACCTACACTTCCTGCCATTAAATATGCGCAAGACCATTGCTGGTATACTAATGGCAAGAAAACTATTAA
CGGCTATAACGCCAAAGCTAAAGTAGTGGCCACCTATCATAACTTTGATGTGGCACCTGCTCCACGTACA
GAGACAGTGTCAATGCCGCTGTCTACTAATAAATACTCTGTACTTCCTACGGAAGACATACCACAGAGTA
GTCCACTTTTGTTAGAACCTCCACCCAGGGAACTTCCACAAGATGAAGACAAACCTAAGGCTGAGGTTTT
GGACAATCCCACGCACTTAGACCTAATGGACTTGTGGATTCGCAAGCCCAAGTTCATCTTGGTTAAGTCA
TGGTCTATTTTGGGAAAGGCACTATGTAAAACAGGAACAGTTGTTTTTCTTAGTGCTAAACTCTTACTTA
AGTTTTATAACCACCTAGTAGAAATAGGGGCTATAGACAAAACTGTTAAATTGTCTGTTGGTTTGGCCTG
TAAGGTGGCACGCCACTTTATGCCATCGGCAGCAACTTTACGGAAAACATGCCTGGGATTGTTTTATTCA
ACAAAGACAATCTTCATGGCATTAGCTCCATTTTTGATGTTACCGGCTGTAGCGAGTATATTTTCTACTG
GTTACAAGCTGGGTGTACACTTATATGCACGTACTGGCATACCATGCGTGTATAATACAACTATGCATTA
TGATTATAATGCTTTCTGTGCTGGTGATTTAACATGTCTAACATGTTTTAATGGCCAGGACTCATTACAT
TTGTACCAGCACCTGCGCGTTAATCAACAACCCGTAATGGAAGTTGACTACACGCTTTATGCGCTGGCTT
TCATTTTATTACTTGCAAATGCCACTTTAGTTTTAGCGGCCCTTGCATTTGTGTTTATTGTCAATATGTA
CGGCTTCACAATACCGTATATTGGCACCTTGTATATAGACTATCAGACATTTTTAGTTATGTCTTTTATA
GTCTATTATGTATACAGAGTGTGTGCATTTTTAAGACACTTGGCTAAAGGCTGCAAGCAGCCAACATGCA
CATTGTGTTCAAAGATGCGCACTTCACCAACTATAACAGTGGAGACAATAGTCCAAGGTAGAAAATACCC
CTCTGTTGTAGAAACTAATGGCGGCTTTTCTATTTGTAAGGAGCACAATTTTTATTGTAAAAATTGCACT
GCTGAAAAGCCTGGCACTTTTATACCCACTGAAGCAGTTGAATCCTTGTCTAGGACCACAAAGCTTAGTG
TAAAACCCACGGCACCAGCATTTTTATTAGCTCGTGACGTAGAATGTCAAACTGATGTTGTTGTTGCGCG
TGCTATGCACAACCAGACAGCTCATGTTTGTATTTCTAAATACTCAGACATTCGTACCGTTGACCAACTA
CTTAAGCCTACTCCACTATTTTCATACACACCTGACGTTATGATAGCGGCAGACTTTGATAATAGTGGTA
GCTTGAAAACAGCTCGTGAATTAGCTGTAGTTTTGTCAATGGATCTTAAACGCACCATTATTATTATTGA
TCAGGCTTATTCTAGGCCTCTCAATACTTATGATGAGGTTGCTGCTCGTATGGAGAAGTATTTCACACTA
CAAAAGATAACACCATCTGGTGATATCTTTAATGACTTAAAACAAGCCACCGCAGGCCAGGCCACTGATT
CTGCTATTAATGCAGCTATTTTGGCAGTGCAACGCGGTCTTGACTTTACTATTGATAATCCCAATAACAT
CTTGCCTCACTATGCCTTTGATTTTACAACCCTTACTGCAGACGACCAGGCTACTATTATAGAGACTGGT
TGCGCTAAGGGCAATCTTAAAGGTACTGGTGTTGGTGTTATTTTATCTGCTAACCTTGTTACGAGACTGA
GTCAGTCAGCCCTTCGTATCATTGCTAATGCAGCCTCCCGTAATGGTGTTACATGTGCAGTTACACCATC
AACATTAGTTATGCGCGGCAATATAGCCACCCAGCCTTTAACACGCTTAAAGGCTGGTGCTGTACCATCG
CGGCGTGTAGTTTACACTATATTGGCAATCTGTGCAGTGTATGCCTTTGCTTTTGCGCTTTCCTGTGCAG
CTGCTCGACTTACATTACACACTGTGCCATCCATTAAGACTGACATGCGCGTCGATAATTTTTATGTAAT
TAGAGATGGTGTGTTAGACACTATTAGAGCAACTGACAACTGCTTTGCTAATAAGTTTTTGTCATTTGAC
TCCTTTCATCAGGCAACGTACACTAACTCCCCGGCCTGTCCAGTGGTGGTAGGTGTTGCCGATGTTAAAA
CACATTCTGTGCCTGGCATTCCAGCAGGTATTATATTGAGAGACAACTTAGTATTGCACATATACGAATT
GTCTATCTATGAGAGAGAACAGCGTGCTTCCATGGTTAGAGATGCGCTTAAACTCCATACGGGTAGCATC
TTTAATTTGGATAACCGCGTTGTTGTTGGCTACACACAGCATGAAGTTGTTGTTGGTAGCTCATACTTAC
GGTCACCTGCATTGTTTAATGCTAAATGCACCTACTTACAGCGTGATGGCAATAGAACTTTGTATTGCTA
TGACGCCGTAGATGTACCTCACAAGCTGTATTCGGATGTGTTGCCACACGTCGAATATCAGGCTGTCGAC
TTTAATGGGGAAGTTGTTCCACTAAAAATTCCAGAACAGATTCTCTACTACCCTCACATTGTTAGATACG
TCAGTAACACCTACTGTCGTATGGGACAATGTTTCAACACTAATCCTGGTGTATGTGTATCATTTACTGA
TGAGTTTCCTTATTCAGGAAATGAGATGCCAGGTGTTTATTGTGCCGATACCTCTTTTCAGTTAGCCTCT
AAGCTAGTTATGGGGACAGTATCTGGCATACATGTATTTACTTCAACAGCAGCACTTATAGCCTCCACAG
TGGTTATTATTGTGTGTGTTGTTTTAGTATTGGCTTTGCAGCGCCTATTTAGAGAGTACACAACTTTTGT
TATGTACACTTGTGGGTTGGCTGTTATTAACTTAATTGGCATCGCACTTATGTATAAGTGCCTTGCACTT
GCAGTACCATTCTATGTTATTTACCTCTACTTTGTCTGCACATTTTCCTCTGTTAAGAGGAGTGTAGCAC
TGTTTTACTTTTCAGTAGTTATGCTGCCACATGTTAGCAATATGCAATTGCTAGCAGTTGTTGTTTGTAG
CATTTTCTACTGTTTATACAATTATGTTTATGCAGTTACCAAGACGGGAGGCAAGTTTTCCTCATTCTTG
GATGCATCAAAATCTACATTTGTAATTGACAATGATAAATATGTCTTGTTGCGTGATCTAGCAGGCAGCG
ACTTCGATGCCTACCTAGCATCATACAACAAGTATAAGTACTTTTCTGGTACCGCCTCGGATAAGGACTA
TGATAGAGTTTGTATGGCATTTTTGGCCAAGGCTTTGTCATCTTTCCGTGAAGGAGGTGGTTCCCAGTTA
TACACACCGCCCAAACTGGCAGTAGTTCAGGGCGTTGTTTCAAAACTACAAGCTGGCGTTAAGCTCCTCC
TACATCCTTCAGGCGTTGTAGAGAGATGCATGGTGTCAGTTGTATATAATGGCGTTGCTCTGAACGGCAT
TTGGCTGAAAAATGTTGTTTATTGCCCGCGCCATGTTATTGGGAAGTATCGTGGAACCCAATGGGCCCAG
ATGGTTTCCATAGTAGACTGTCACGATTTCTGTGTAAAATGTCCAACACAGGGCGTGCAGCTTAATGTAC
AGTCTGTTAAGATGGTTGGTGCACTCCTCCAGCTTACAGTACATACCTCAAACACACTCACACCTGACTA
TAGGTTTGAGAGAATTACACCTGGTTCATCGATGACAATTGCGTGCACCTATGATGGTGTTGTGCGTCAC
GTGTACCATGTTGTACTTCAGCTTAACAACTTAATTTATGCAAGCTTCCTAAATGGAGCTTGTGGCAGTG
TTGGTTTTACACTTAAAGGTAAAACCCTCTGCTTACACTATATGCACCACATTGAGTTTAATAACAAGAC
TCATAGTGGTACAGATCTTGAGGGCACATTTTATGGACCTTATGTCGATGAAGAAATAGCCCAGAATCAA
ACAGCATTCCAGTATTATACTGATAATGTTGTTGCTCAGATGTATGCACACTTATTGACAGTTGATGCTA
ATCCTCGTTGGTTGGCACAGGCAGCTATAAGTGTTGATGACTTTAATGCATGGGCATCAAGCAATGCCTT
TGCACACTTTCCCTGTGAACAAACAAACAAGGCCTACATTTTAGGTCTTGCTCAGGTAACCCGTGTACCT
TTAGAGCGTATACTTAATACCATCATACAGTTAACACTGAACCGTGATGGTGTAATGATTATGGGCGCTC
CTGATTTTGACTGCGACTGGACACCAGAAATGGTCTACAATCAGGCTCCTATTGCATTACAATCTGGTGT
AGTTAAGAAGACTTGTATGTGGTTGTTCCACTGCTTGTTTATGGCTATTGCCATTATGTTAGCTGCACTA
CATGTATTACCTGTTACACTATACCCGCTAGCCCTGCCTTTTGCAGCTGCTATCGCGGTATTTTTAGTTC
TTACAATAAAACACACAGTTGTGTTTACCACCACGTTTTTGCTACCATCGCTGATTATGATGGTTGTGAG
TGCAAATACTTTTTGGATTCCAAACACATATCTTCGTACACTGTACCAGTATGTGTTTGGCTCCTCAATT
TCACAGCAGTTATACTGTTATAGTGTTGCACTTTACATAGGTGTGTATGTGGTCTTAGCAGTTAATTACA
CTTTGCGTTCGCTGCGTTACCGCGCCACATCTATTTCCACATTTTCTATACAGTGTTTCCAATTTGGTTA
CCTGTTGGCAATACTGTATCGCTTGTTCACTACCAAGTGGAGTGAGAACTTAGTTTTTACGGCAGCCTCG
ACCTTCACATCACACCCAGTTTTGGCTGGTGTGTGTTGGTGGGTTGCCCGTAGAATACCACTACCACTTT
TTGTACCTGATGTAGCTGTGCATGTGTTTACTTACACAGTTATAGGCTATGTTATTTGTATGCGATTTGG
TCTCATGTGGATCATAAACCGCTTTACTGCTATACCAATGGGCACATACTCTTATATGGTGTCTATTGAG
CAACTTAAGTATATGATGGCTGTTAAGATGTCCCCACCGCGTAATGCGTTTGAGGTGTTGATGGCCAATT
TAAGATTGCTTGGTATTGGCGGTGTTCGTAACATTGCCATATCCACAGTTCAAAACAAAATTTTAGATGC
AAAGGCAACTGCTGTAGTAGTAGCAAACCTGCTTGAGAAGGCAGGCGTTACGAATAAGCACGCTATTTGC
AAAAAGATTGTTAAGCTTCACAATGAGACTCTTAAGGCTACAACCTACCAGGACGCCGAGACATCTCTTG
TGAAGTTATTAGCACATATTGTTGAGTTTCTTCCCACTGACCAGGTAGATGCTTACCTAGCAGATGAAGA
GGAAGCTCAGCACGTTAACAATTATTTGGACAACCTGCTTGAGAACACTACAGTTGTGCAAGCAGTTGCT
GATGCTAACATTAATCTGGACTCTTATAGAATATATAAGGAGGCAGATGCTATATATAGACGCTCTGTAG
AGATGAATGAATCACCTCAGGAGCAAAAGAAAAAGCTTAAAGCTGTTAACATAGCTAAGGCAGAGTGGGA
GCGCGATGCTGCTTCCCAGCGTAAATTGGAGAAGCTTGCAGACGCTGCCATGAAGTCTATGTATTTGGCT
GAGAGAGCGGAGGATCGGCGTGTAAAGCTTACCTCTGGTCTTACAGCTATGCTTTATCACATGCTTAGAA
GATTGGACTCAGACAGAGTGAAAGCCCTTTTTGAGTGTGCTAAGCAACAAATATTACCTATACATGCTAT
TGTAGGTATTTCAAATGATAACTTTAAGGTCATCTTTAATGACAAAGATAGCTATTTGCAGTATGTAGAG
GGGAACACTCTTATTTATAAGGGTGTGCGCTACACTATTGTGAAGAAGCTATCTCTAGATAATGCACCTA
TTGAAGGCGTACCCGAAGAATATCCCGTAGTCGTAGAGACTGTGAAGGAGGGTGTGCCTCAGTTACAAAA
TAATGAGTTGTGTTTGCGTAATGTTTTTACAGCGCAGAATACAGCTATTGATATTAATGGTACTGAATCC
ACTGAAAAGTCTTTTTACATAACCAAGACGGGTAAGAAGATTTTAGTGGCAGTAACTTCTACTAAAGACA
ACTTGAAAACTGTTACCTGTGCCACCGATACTGGTAAGGCTGTCTTGAATTTAGACCCACCTATGCGATT
TGCGCATACTGTTGGAGGTAAGCAGTCAGTTGTTTATTTGTATTTTATTCAAAATTGTAGTTCTCTTAAC
AGAGGTATGGTTATTGGCCATATCTCTGGAACTACCATATTACAGGCTAATGGTACACACATTGAGTACC
AGGAGAATGCCTCATTGTTGACCTATTTAGCATTCGCTGTCGACCCTAAGGCTGCCTATCTGAAGCACTT
AGCTGACGGTGGTAAGCCTATACAGGGCTGTGTGCAGATGGTTGCTGCAATGGGTCCAGGATTTGCGGTT
ACTATAAAACCACAACCTAGTGAGCACCAGAATTCCTATGGAGGTGCATCAATTTGCTTATATTGCCGCG
CTCATATACCGCACCCTGGTGTAGATGGACGCTGTCCTTACAAGGGGCGCTTTGTCCAGATTGACAAAGA
TAAGGAACCAGTTTCTTTTGCCCTAACTCATGAGCCTTGCAGTTCTTGCCAGAGGTGGGTCGCTTATGAC
TGCACTTGTGGTACAAGCTTGCAAAACTCTGCTTATTTAAACGAGTAGTGGGTTCCAGTGAAGCCCGACT
GGAACCCCAACAGCCAGGTACAATCCCTGATGCTGTTAAACGGGCTTTTCATGTGCATAATAATACCACC
TCTGGTATATTTTTGAGCACCAAGACTAACTGCGCTAGATTTAAAACTCAGCGCTGTAATTTACCTATAC
CTTATAAAGGTTTAGTTGACCTATATTTTGTCAGTAAGCAATGCTCCTTATCCGTTTTTGAAACGGAGGA
GGCTTGCTACAATGCTTTTGACAAGGCTCTTATTACTACTGAAGACACATTTGGTGTTTTAGCCAAAACT
GAATTTTTCAAGTTTGACAAAATACCTAATGTAAATCGTCAGTATTTAACAAAGTACACTTTGCTGGACT
TGGCATATGCAATTCGGCATTTGTCAACTTCCAGAGATGTTATAAAGGAAATCCTAATCACCATCTGCGG
TACTCCCGAAGATTGGTTTGGAGAGCTATGGTATGACCCCATAGAGAATCCAACCTTTTATAGAGAGTTT
CACAAGCTAGGTGGTGTTTTGAATCGTTGTGTGTTAAATGCTAATAAGTTTGCTGAAGCCTGTCAACAGG
CTGGCCTTGTTGGTATATTAACACCAGATAATCAGGATCTTCTAGGTCAGATTTATGACTTTGGAGATTT
CATTAGTACACAGCCTGGTAATGGCTGTTGTGATATGTCATCCTATTATTCATACCTAATGCCTATCATG
TCCATGACACACATGCTAAAGTGTGAGTGTTATGGGCCCGATGGCAACGCAATAGAATATGACGGTTTCC
AATATGACTTTACTGACCTCAAGCTCGAGTGGTTTGAGAAGTATTTTAAGTTTTGGGACCGCCCATATCA
TCCAAATACTGTTGATTGTCCAGATGATCGTTGTGTGTTACACTGTGCGAATTTTAATATTTTATTCGCA
ATGTGTATACCCAATACAGCATTTGGCAATTTATGTTCTCATGCAACTGTTGATGGGCATTCAGTTGTCC
AAACAGTTGGCGTTCATTTAAAGGAGCTTGGTATAGTCCTTAATCAGGACGTCACCACGCATATGTCAAA
TATAAATTTAAACACGTTGCTACGCCTAGTTGGTGATCCGACTACAATAGCAGCTGTCTCTGACAAGTGT
TTAGATTTACGCACACCGTGTCAGACTTTGGCAACTATGTCTAGTGGGCTCACTAAACAGTCTGTCAAAC
CGGGACACTTTAATCAACATTTCTACAAGCACTTGCTTGATAGTGATCTTTTAGACCAACTTGGTATTGA
CATACGCCACTTCTACTATATGCAAGATGGTGAAGCGGCTATAACAGACTACAGCTATTATAGGTATAAT
ACACCCACCATGGTGGATATAAAGATGTTTTTATTCTGCCTTGAAGTTGCAGATAAATATCTTTCACCAT
ATGAAGGTGGCTGTATTAATGCACAGTCAGTTGTGGTCTCTAATTTAGACAAATCTGCGGGCTACCCATT
TAACAAGTTGGGTAAGGCTCGTAATTACTACGACATGACTTATGTCGAGCAAAATCAGCTGTTTGAGTAT
ACAAAACGCAATGTTTTGCCTACACTCACTCAGATGAATCTAAAATATGCGATTTCAGCAAAAGATCGTG
CTCGCACTGTTGCAGGTGTTTCTATTATAAGCACCATGACTAACAGGCAGTACCATCAGAAGATTCTGAA
ATCGATTTCACTTGCACGCAATCAGACTATAGTAATAGGCACTACCAAGTTTTATGGTGGTTGGGATAAT
ATGTTACGTAGGCTGATGCACAATATCAACAATCCCATATTAGTGGGCTGGGATTACCCCAAGTGTGATA
GGTCGATGCCTAACATATTGAGGATAGCATCTTCATGTTTGTTGGCACGAAAACACACCTGCTGTAATCA
AAGCCAGCGGTTTTACCGCTTAGCTAATGAATGTTGCCAGGTATTGTCCGAAGTGGTAGTGTCTGGTAAT
AATTTATATGTAAAACCCGGTGGTACTAGCAGTGGTGATGCAACCACAGCATATGCCAACTCGGTTTTCA
ATATTTTACAGGTTGTATCTGCAAATGTTGCAGCCTTCTTATCCACATCTACCACCTCTCACTCTAATAA
TGATATTGCATGTTTGCATCGTGCTCTTTATGAGGATATATATAGAGGTGATTCTTCAGACACAGCCGTT
ATCAATAGCTTTTATCATCATCTCCAAACCTATTTTGGGTTGATGATACTATCTGATGATGGTGTTGCAT
GTATAGACTCTGATGCTGCTAAGCAAGGGTCTGTTGCTGATTTAGATGGTTTTAGAGACGTTTTGTTCTA
CCAGAACAATGTTTATATGGCAGATTCAAAATGTTGGACTGAAACCGATATGAGTGTTGGACCTCATGAA
TTCTGCTCACAGCACACTGTGCTAGCAGAGCATGAGGGCAAACCCTACTACTTACCATACCCAGATGTCT
CGCGCATCTTGGGTGCTTGTATATTTGTAGATGACGTTAACAAGGCTGACCCTGTTCAGAACTTGGAACG
TTACATCTCCTTAGCTATTGATGCCTATCCGCTTACAAAAGTTGATCCTATTAAAGGTAAAGTATTTTAC
CTGTTGTTAGATTACATACGAGTTTTGGCTCAGGAGTTGCAGGATGGAATCCTAGATTCCTTCCAAACAC
TCACTGACATGTCGTATGTTAACAACTTTTTGCAAGAGGCTTTTTATGCTCAAATGTATGAGCAGAGCCC
AACACTGCAGGCTAGTGGTGTGTGTGTAGTTTGTTCTTCACCCACTATACTACGCTGTGGTGACTGCATT
CGCAGACCTTTATTGTGCTGTGTTTGTGCCTACCAGCATGTAACGCGCACAAGTCATAAACGTGTCATTG
CTATCAACAACTACATCTGTAGTGTTGATAATTGCAATGAAGACAATGTTGAAAAACTTTACATTTCAGG
CACAGCGATTTATTGTGAAAACCACAAACCTACGCTGTGTATACCTATTGTTGCTAATGGCTCTGTATTT
GGTATTTATCGTCACACTGCTCGCGGTAGTGATGATATAGACCTATTTAATGAGCTTGCAACATCCACCT
ATGACACTATTGCACCTTATCAAAAGGCCAATCGTGCACCATTATCATTAATGCTTTTTGCTGCTGAAAC
AATAAAAGCACTTGAAGAGTCAATTAAGAAGTCATATGCAACAGCCACTGTGCGTGATGTGTATGATCAA
AGATTTATTAAATTAGTTTGGGAACAGGGTAAGAAACCTCCGCCCATAACTAAGAACCACATATTTACTG
GCTATCATTTTAACAAGAATGGAAAAACCCAAGTTGGTGATTACATTCTAGCTAAAACTGATGGCACTGA
AACTTACACCTATCGTGGAACATCCACCTATAAGTTACAAACAGGTGATGTTCTCGTACTTATGGCACAT
GTAGTCACGCCTTTATCAGCACCACCGGTATTGGCACAAACTACATACGTTCGTAAATCACTTTTACCCG
ACACTGTAGGAGCTTCTTTTTATGTGCAACATTTTAAGTCATATAATGAGATAGCTATGCAGCGGGTTAC
AACTGTCCTTGGACCACCTGGCACTGGTAAATCAACCTTTGCTATAGGTTTGGCTAAGTACTATCCCAAT
GCGCGTATTTGCTACACGGCGTCATCCCATGCAGCGATCGATGCATTATGTGAAAAAGCTTTCAAGACAC
TACCTGTAGGCCAGTGCAGTCGTATCGTCCCCACGCGTACAACTGTAGAGTGCTTTCAGGAGTTTGTCGT
TAACAATACAACTGCTCAATACATTTTTTCTACAATCAATGCATTGCCAGACATTAAGTGTGACATCGTT
GTTGTAGATGAAGTTTCTATGCTAACCAATTATGAGCTTTCCTCTGTGAACGCTCGGTTAGTCTACACAC
ACATTGTGTATGTTGGTGACCCTTATCAGTTACCATCACCAAGAACTATGCTAACCTCAGGTCAACTGTC
ACCAGCTGACTATAATGTGGTTACTGATATAATGGTGCATGCTGGCGCTGATGTAATGCTAGACATGTGC
TACCGCTGCCCACGTGAAATCGTAGATACAGTGTCTAAGCTGGTTTACGATAATAAGCTAAAAGCGGCGA
AACCGAACTCAAGACAGTGTTACAAGACCATTGTTAATTTTGGTCCTGGAGACATTGCTCATGAGGGACA
ATCTGCCTACAACGAGGCCCAGTTACGTTTCGCACTCGCCTTTAGACAACAAAAGCGGTGGGACAACGTG
ACTTTTATTTCACCATATAATGCCATGAATGTTAAAGCAGCCATGGCAGGCTTTTCGACTCAGACTGTTG
ACTCATCTCAAGGCTCTGAGTATGATTATGTTATCTTTTGCGTGACTACTGATTCAGCCCACGCTTTAAA
CATGGCTCGTTTGAATGTTGCTTTAACACGTGCGAAAGTAGGAATACTTGTCGTGTTTAGGCAAGCAAAC
GAACTATATAACAGCTTGCAGTTTGAGCCTATTGACTCACAGCTTCAGGCGGGAGAACCCCTGACGTCGC
TTTTTAAGCGCTGCAGCTTTGAGTATAGTGGTCAACATCCTGCTCATGCCTTGACGTGGCATGACTGCGG
CGCAGAGTATCGCTGTGATGAACCACTTGCAAAATTAGTTGGCGTTACCGATGGTACGCTGATATCATAT
AAAACCCTGGTCTCAGCACTTGGGTTTTTGCCATCTCTAAAGATTGATACATATCATAATATGTTTTTAA
CACGTGATGTATGTCGCGCCTATGTTCAGAGCTGGATCGGCATAGACGTAGAAGCAGCACATGCCACGAA
ACCTAATGTTGGTACTAACATGCCGTTGCAGGTTGGTTTTAGTACTGGCAAGAATTTTTCTGTCACCCCA
GAAGGTATTTGGGTAAACGAGCACGGATCTTGCACTGAGCCCGTCCCTGCCAAAATACCTCCTGGCGACG
AATTCAAACACCTGAAGAAGGATATGCGCCAAGCGCGTCCTTGGAAGGTTGTGCGTTATGAGATTGTTGC
ACATCTTGCTGATGTTGCACCACATACTGATTATTTATGCTTTGTTACTTGGGCTCACCAGCTTGAGCTC
GCAACAATGCGTTATTTTGTTAAAATTGGCGTTGAAGAGCAGTGTTATTGTGGTAGACGTGCTTGCTTCA
CTAATGGAGTACAGTTCGCCTGCAAAGCACATTATGCTTTAACAACGCCACCATGTGATTATGTTTACAA
TCCATTTTTAGTCGACGTGGCAACGTGGGGATTCTCGGGACGTCTCTCCACTAACCATGACGCGGTTTGT
ACATACCATTCTAATGCTCATGTTGCATCTGCTGATGCAGCTATGACTATTTGTTTAGCCATACACGAAC
TGTTCAGTAGTGTAGACTGGAGCTTAGAATTTCCAGTCACCCCTGAGCAATCACAACTTAACAAAGCTTG
TCGATTAGTACAAGCCAATTATCTTAACATTCTGTTAACCACAACTAAAGCCACTGTTGTTCACGATATT
GGTAATCCTAAAGGCATACCTATCGTGAGACGACCTGGTGTTAAATATCACTATTATGATCAGGCACCTA
TTGTCAAACATGTCCAGAAGCTACGGTATAAGCCAGAGATGGAGGCCCGTTTCGTTGATGGCTTGACCAT
GTTTTGGAATTGTAATGTTGACACATACCCTGCTAATGCCTTGGTTTGTCGTTATGACACCCACAGGCAA
AAACATTTAATTGGCCCTAATGGTGCCGCATTATATGTTAATAAGCATGCATTTCTCACACCAGAGATGC
ATACTTATGCTACACATAAGCTAACATTGGCTCCTCTTGTCTACTATTCCACTACGGATTGTAGCAGTGA
GCAGCCAATAGTTGTAACCTATCGTGACTGTGTTACTCGCTGTAACACTGGCACTACTATCTGTCCTACT
CATGCCCTTGAGTATCAGGAATTCATCTCAGCATACAACCTTATGGCACGCCATGGGTTTAATGTTTATA
TACCACGTAACGTCAACGTCTACAACTGTTGGCTTACATTTACCAATTTACAAAACCTTGAAAACTTGGC
TTACAACTGTTACTATAAGAACTGCAATGCACATGTTGATGGTGCGCTTGATGTAGTTATTAATAGTAAT
GCTGTATATGCTAAGGTTGATAATAATCTTGTCAAGTTATTTGACAATAGAACAAATTTACCGGTCTCTG
TAGCCTTTGAGCATTACACGAACCGTCACACAAAGACATTGCCAACCACACAGTTGTTGTCTGGTCTAGG
TGTAACCGCCACCAGAAACTTCACTGTCTGGGTTGATGATGACACAGCTTTCACAAACACCCTTAATGTT
TCTACTTATACTGATGTTGATCCAACCAACCATGTCGTACTTTGTGATGACAGGTATGGTACGGATTGGA
GTCAGTTTAACCAATTACCTAATGCTGTCCTTTTAACAACCATTAAGGTTAAAAAGGCAGAACCATTTTG
TTTTGCACTGCTCTTACACTCAATGGCTCTAGCTATTGATGGACAAGAGCTCTACATTTATAAGCGACTT
AACGGTCAGCTTGTTTCAATTGATACTATCTGCACTCAAGGCAGATCAGTTGATAAATTTATACCTAAGA
CACCTATGGAGAGAGACTTTCTTGAAAAGTCCTCTGAAGAGTTTATTAATCTCTACCAGCTCCATGATTT
AGGTGTTGAACATATAATTTATGGTGATGACTCCAAACCTATTATTGGAGGAACTCACACACTCATTTCA
CTTGTCCGAAACAAATTTGACTTTCAACTTGTTAATCATATTTACAACCCAGTTCAGAACTGTGTTGTAA
CCTCCACTAAAGCAAGCTCTAAAAATGTTTGCACCATTCTTGATGTTCTATTAGATGACTATATAGACAT
CATTCGTCAAGCACATGCCAATTACACCACTAAGTCCAAGACGTTTAGTGTTGTGATTGACAATCAACCT
ATTCGTTTTATGCTTTGGCATGATGCCAAAGTAAACACTTGTTACCCAATATTGCAATCATTGACCAATG
GATACCAGATGCCATCTGTGTATAAAACATTGATCACTGATATGCAACCAGCAGATATTCCTAACTACCA
TTCCTATACACCAAAAGTGCCGGGAGTGGTTAAAAATGTAATTAAATATCGCCAACTTTTTAACTATATA
GTTAAAAAGGATAGATTGGCGGTACCACATAATATGACTGTCCTACACTTAGGTGCTGCGTCTGCTTTAG
GCACTGCACCAGGCAGCTCAGTTATAAAACAAATGTTACCAGATGGAACCGTCCTTATCGATTTAGACAT
AAGAGACTTCACATCTGATGCCAACCAAATAATAGTATCAGACTACAGAACATATATGCCACCACACCAT
ATAGATGCGATCTTTTCGGATCTATATTGTGGTGATGATATTCACTTTTTCGACAACTTAATAAGAATAG
TAAAGGAGAGGTTAGCTCTCGGTGGTTCTATTTTTGTTAAGATTACTGAACATTCATTTTCGCCAGAACT
CTACAGCTTAGCTGGATGGTTCGACGAATACCAATTATATTGCACAGCAGTAAATGCAACTTCTTCAGAA
GCATTTCTCTGTTGCTTTAACTACTTAGGACATGCAAAAGAGAACGTTGATGGTTACAATTTGCATGCCT
CATACATTCGTTGGCGTAATGAAATAGTACTAACACCAACTTATTCTTCGCTTGCAGACAACCCAGCTAC
TGCCTGTAAGCTCAAAGCAACTCCTATAATTTCCGTTAAGGAATTAGAAAAGAAACCAATACTTAAGTAC
CTCGTGTCTTCCGGTCGCCTGCTTGTCAGACCACCAGAATGCAGAGCACTTTACTAATGCTTATGTCTGC
AACTTTAGCGCATGCTAAGATTGCGGACACAATTTTTGATGCGCTCACATTTCCTAACGCGCATCGTTTT
CTCTACCGTCAGAACCGCTATCGCACACAGCGTGACTCTGGTATTTCTGTTGGCTCTTTACCTGGCTATC
CTACCCAGCATTTAGAGCTTATATCACCACTTACTAACTCTACGCTGCCTATTAATGGATTGCATAGGAG
TTACCAACCATTATATTTTGCATGTTTCACCGACATTGTCAACAACACGCTAAACATGCACCTCACACAG
AATGAACAAGCCACCTATAATTGTATGGGTGATGCTATAAGGAACATGTCTCATGATGCTCTCAGATTGT
TCCTAAATCTAACATCTGCAAACCGGGCCTCCATTCGAGTTATCGGCGCGGATAATACTACCTATATGTT
CGTCTGCTCTGAACACCTAAACATTTCAACAGCCATGGCGAACTCCACTTTCTATTCTGCTAATAAGCAG
CTTTATTGTTTTACAAATGAGACCTACTTGGGACCATTGCCAGCAAACCTGTCGGATATCACCATATATC
GGACGGGTCAATTTTATGTTAATGGTTACTTGTTAGGTACGCTACCCATTAGTGTCAAAACAGTTCGCAT
TGAAACTGGTGGTTTACCAGCTCATAGCACCTATTTTGCCCTTGCGAATCTCACGGACACTCTCATCACA
CTTGCAAATACAACTATTACACAAGTTACTTATTGTGAATCATCCACCATTGACAATATAGCTTGTCAAC
GCTCCACACATACTCTTGCTGATGGCTTTTATTCTGCACAGCAAGATTTATTTCAATCTAATGTTAGAAC
TGTCATAACCCTGCCTAAGTTACAAGAGGTTGAGGTTATACAGGTTAACATTACAGCAACATTTAACTTT
GGTGAACCCAAAGTAACTGCCATTACTATTAATGGTAATGACAGCTACTGTGTGACCAAGCCTTATTTTA
CCATACAGTCAAACTTTGTTTGTACTGGATGCACCCTTCAGGTTCGCAGCAGTACATGCAACTTTGACCT
GTTTGCTATTAATAATGGCATGTCCTTTTCGCAGTTTTGCATTAGCGCAACTGCAGGCTCATGCTCCAGT
AAAATAGTTGCAACCTATGTCTGGAATTATGACACAGGTAGAAACCTTTATTTTACATTTACAGAGGGCC
AAATGTTTACGGGCACCTCTACAACAACTCCTAATGCTATTGACACATCTTCTATTATTGAAGGTGTGTG
CACTGATTATACCATTTATGGTATTTCAGGCACAGGCATTATTAAATCCTCTGACTTACAACTTCATAAT
GGCATAGCATTTACATCACCCACTGGTGGTCTCTATGCCTTTAAAAATGTTACGACAGGCCAGGCTTATC
AGGTCTTACCCTGTGTAAGAACTACCCAGGCTGTTGTAATAAACAACACAATAGTTGGTGTCATCACATC
AACTAACACAACTTTGTATGGGTTTCAGCGGGTAATACCCACTCCTACCTTTTACTACACCACTAATGCT
ACCAACAATTGCACTCAACCAATTTTGTCATATGGACCTTTAGCCGTTTGTAGTGACGGGTCCATATCTG
CAACCACTACATTGCAGGACACTCGCCCATCAATAGTTTCTCTTTATAATGGCGAGATTGATGTACCATC
TGCATTTGCTTTGACTGTTCAATCTGAGTATCTTCAGATACAGTCTGAGCAGGTTGTTATAGATTGTGCC
CAGTATGTATGCAATGGCAATCCCCGTTGCTTACGGTTGCTTTCCCAGTACACGTCAGCATGTTCAAACA
TTGAGTCGGCGCTTCATGCCTCGGCTCAGTTGGACAGCAGGGACATTACAGACATGTTTCAAACCTCCAC
CCAGTCGCTGGAGCTTGCAAACATTACAAATTTTCAAGGTGATTATAATTTCACCAACATTCTTAGCAAT
AAGATAGGAGAGAAGTCCGTTATAGAGGATCTCCTCTTCAATAAAGTTGTTACCAATGGCCTAGGCACTG
TAGACCAGGACTACAAAGCCTGTTCTAAGGACATGGCCATTGCTGATTTAGTTTGTTCTCAGTATTACAA
TGGCATTATGGTTCTACCAGGTGTTGTTGATGCTGAGAAGATGGCAATGTATACTGGCTCTCTCACTGGA
GCCATGGTATTTGGTGGCCTCACAGCTGCAGCTGCTATTCCTTTTTCAACTGGAGTTCAGGCACGTCTTA
ATTATGTTGCTCTGCAGACTAATGTCCTGCAAGAGAACCAGAAAATTCTTGCTGACTCCTTCAATCAAGC
AGTTGGCAATATTTCATTAGCACTTTCCTCTGTTAACGATGCTATTCAGCAGACCTCAGAGGCTTTAAAT
ACAGTGGCCAATGCCATAAACAAAATACAAACAGTTGTGAACCAACAAGGTGAAGCCCTTTCCCACCTAA
CGGCACAATTGTCTAACAATTTTCAGGCCATATCAACATCTATTCAGGACATTTATAATCGTCTTGAAGA
GGTAGAGGCTAACCAGCAAGTTGATAGGCTCATAACAGGTCGCCTATCTGCTCTTAATGCATATGTTACG
CAGCTTCTCAACCAGATGTCACAGATTCGGCAGTATAGGTTGCTGGCTCAACAGAAAATCAATGAATGTG
TCAAGTCACAATCCACTCGCTATGGATTTTGTGGCAATGGCACGCACCTTTTTTCGTTAACACAAGCTGC
GCCTAATGGCATTTTGTTTATGCATGCAGTTCTTGTGCCCACTAAATTCGCGCGTGTCACAGCTTCAGCT
GGCATTTGCGTGGACAGCACTAAAGGTTACTCCCTCCAGCCTCAGCTTGTGCTCTTTAATATTAATGGCA
CCTGGAGGGTTACACCTAGGAACATGTACGAACCCCGCATACCTAGGTCTGCGGATTTCGTACCTCTTAC
TGAATGCAGTGTTACCTATTACAACACCACTGCATCACAATTGCCTACCATAGTCCCGGACTTTGTTGAT
GTCAATCAAACTGTCAGTGACATTATAGGCTCCCTACCTAACCCTACACCACCTAGCCTGGTTGTAGATT
TTTATAACCATACTATACTCAACCTTAGTGCTGAGATATTAGACTTACAGCAACGCGCTGATAATCTATC
ACAGATTTCAGAGCAGCTGCAACACTATATTGACAACCTTAATAACACTCTTGTAGATTTAGAGTGGCTT
AATAAGGTTGAAACATACATTAAATGGCCCTGGTGGGTGTGGCTGCTTATTGTTTTAGCCATAGCTGCTT
TCGCCTGTATATTAGTCACAATCTTCCTATGCACTGGATGCTGTGGAGGATGCTTTGGTTGTTGTGGTGG
TTGCTTTGGTCTCTTCTCTCACAAAAAGAGGGACACGGAACCGACACCCATCACATCTTTCAAGCTTAAA
GAATGGTAGCCGAAGACTGGGCTATAACCATTCCTGGTCAATATGTCGTCGCGACACTTGCTGTTTTAAG
TGTCTGCGTCTGTCTTTTATTTATTAACACCTGCTTAGCATGTGCTAAGCTCAGCTATAAATGTTTTCTA
GGTGCCAAATACCTAGTAAATCCAATTATTGTGTACTATTCAAAACCCCAAACAGTCTCTGACTCGGAGT
TTGTAAAGTTACACCAATTTCCAAGAAACAACTATGTCTGACGCCAATGAATGGCAGATTATTGTTTTTA
TCATCCTTATATGGGCCCTAGGGGTAATACTCCAAGGAGGATATGCCACTAGGAACCGTATAATTTACAT
TATCAAACTTATACTACTCTGGCTTCTCCAGCCATTCACATTAGTTGTCACCATTTGGACAGCAGTGGAA
AATGGATCAAAACCCGGAGGAGCTGTTTTCATTATTGCCATAGTCTTTGCCATCCTAACTCTGTTATCAT
GGCTACGCTATGTCTACGATTCAATACGTCTTGTTCTCAAGACACACTCAGCCTGGAGTTTCTCGCCTGA
AAGCAGACTACTCGCAGGTATAATGGACTCCATGGGCAATTGGCGCTGCATACCAATTGATCACATGGCA
CCTATATTGACTCCAGTACTAAAGCATGGCCGCCTTAAACTACATGGCCAGCAATTAGCAACTGGACTTT
CTGTCACATCACCTCCGAAGTCTATGGTGGTTGTTACTCCGTCGGATACCTTCCACTACACTCTTCGGAA
AACAATTGAATCCACTGATGATCGTGACTTGGCTGTGTTAATTTACCAGGGCGACAGGTCCTCTAATGCA
GCTTTACACACAATCACAACTTCTAATTCCGGCAACGCCAGAATTTACAACTACCTATAATGTGCAACTG
CATCTATCAGCTGCAGGCGCTTTATTCATATTGCAAAACTCATGTCATACAACCGGATGACATCTTTGAG
CTTTGCGACACTCTTGTTAAGCCTCGTTGCTTTGCTTATTCGACTGTGGTATTTATTAATGCTAATCCAA
TTGCATTTAGTATACTACCTCGGCAACTTCTTATCAACGACGAGCCACTCTTTATTGAGTATGGCTCAGT
CCGTGGATCAGATTTCATCATTAGACCTTCCCTTCAAGTTGTTCTTGAGGAGGAAATTTCAAGCATTCAA
ACAGTTCTAGCATCTGCAGGTGCGCGGCACTGCTAGGCTGTGTTTAGTCACCCCTACCTGTCTAATTAGC
GCTAAAGAGTGCGTTAGACTTAAGGGTAGGTGTGCTAACATTTAAGCTGTAGTGTGTGTTTTAAAACCAC
AAACAGAGAATTAAAGTTTGACACCAAAACCAATAATGGCAACTCCAGCGGTACCCACCACTGATGCCTC
ATGGTTCCAGGTTCTCAAAGCTCAGAACAAGAAAGCAATCCATCCCCAATTTAAAGGGAATGGTGTACCA
GTTAATTCTGCCATCAAACCTGCTGAAAATCATGGCTACTGGCTAAGATTTGCCAGACAGAAACCAGGTG
GCGCTCAAATTCCCCCTTCTTATGCCTTTTATTACACAGGCACAGGACCTAGGGGCAATCTTAAATATGG
TGAGTACCCTCCTAATGACTCCAAGGAAACTTCTCGTATCACTTGGGTTAAAGGTCCAGGAGCTGATACT
ACTATTAAGCCACATGTTGCCAAGCGCAACCCAAATAACCCTAAACACCAGCTGCTGCCGCTTAGATTTC
CACCTGGAGATGGACCGGCTGCAGGTTTTCGAGTTGACCCATTCAACTCTCGTGGAAGAACCATGGAGAG
AGGTAATGGACCTAGATCTCAGTCTGCAAATGACAGACCTGTGCAAAATCAGCCTAAGCGCCGTGATAGA
TCTGCTCCCGCAGCTGTTAGGCGTAAGACCCAGCATCAAGCCCCTAAGAGAACTTTACTTAAGGGCAAGA
CCATTTCTCAGGTGTTTGGCACTCGCTCCAAAGCTGGTGCTAACGTTGGCTCTGCTGACAGTGAGAAAGC
TGGCATGGCTGATTCTCGCATTATGACACTTGCACGCTTTGTGCCAGGTGTTCAGGAGTTATTGTTTGCT
GGCCACCTTGACAGCAACTTCCAGCAGGATGGAGCACTAACACTCACCTTTACCTATTCTATCACTGTCA
AGCAGGACTCGCCTGACTATGATAGACTCAAAGATGCTCTTAACACAGTAGTCAACCAGACATATGAGGC
GCCAACCAAGCCTCAGAAAGTTAAGAAGCCAGAATCTGAGCAATCCTCCAAGCCCAAACAGCCGAGGAAA
CCTAAAACCAAGAAAGCTGCTGAGGCAGACAAAGCTCCTGAAAAGGACAACTCAGCTGACCCGGATCAGT
TAGAGTGGGACAACGCATTTGAGTTCAAAAACTCTGAAGCGTAGACACCAACTACAAATACAACTTTACC
GACAGCATGTCGCGTAAATTTTCAAAACTAACCTACCCGCTAGGAGGTTCCCATGAAACTTTTGTGCCAC
ATAACTGTGCCAATCATATGGAGCCATGTGACATACCCACCATGACACCTTATCAGCCTTACATCGCTGA
ATCCTTTAAACTAATTCTTGAGGAGATTGCTGAGACTGGACAATCCTGTTCACCACATGCAGTCCTCCAC
TACCATGAACAAGGTTTAAAGGTTTGGAAAGTGCACTGGCAGCGCGGTGGTGACTGTGGTCCAGGCCACT
GCATTACCGTGTTCCAGAAGCAGGGTATTAACTCCATTGATTGGGACTCTGTTGATTTTACTACGCATGG
TGTTTACACCATACCACTACCAAATTAGTTTACATGGGTACTAGCCAGTCTACTACCAATGTAAACAACC
AAATCACAAATATACACGCATCTCATGATTCAGCAGTAAACACTAACAACTCAAATCAATCTGATTTGCA
GGCATTGTTGCAACAAGGTTTACCTTGGCTTGTGATCATACTTGCATTGATTTGTTTATTGTTAGCTGCT
GTGTGTATACATTTACTTAGAAGAATTAAACGTTACAAGACAACAATTTCAAAAGTAACGGCCACCAAAT
TAATACCATGATTAGCATTGGATACTATTTCATTACCACTATAACCATGCTGATCTTTGGCACTTGCGAC
CCTGTTGTCGCTGAGCATTTGGGACCCCTTATTGACCTAGAGATATTTGGGTTCCTAGCATTCATTTATT
ACTTCTGGAATTTTAGACCCAGAAAGATACAACTATACAAGCCAGAGAGCCAGTCAGAGGGCGCTACCAT
GCAAACTAGGGCTGGCTACTCTTGCACAGAATCACATCTCGATAATTGTCAGTGCAAGAAGGACAATTAT
ACCATTTAATGTGTCGAGGCCACGCGGAGTACGATCGAGGGTACAGCACAATCTCAACTTTTGTTGAAAC
TTAACTACATCCTATATGGAGAAGGAACAAAGGACTGTACTACTTTGTAGGTGCAGCAGTCGCCCAGTGG
GAGAGCGCCATATAGTATGTTGTTGAGCGGGGAACAAATTAGGGGAAATTAAATTGGCTTATAAGGGGGA
TGGAGCAAAAAAAAAAAAAAAA

>gi|212681378|ref|NC_011549.1| Thrush coronavirus HKU12-600, complete genome
GTCATTGCGTAAAATATATTATATATATATTTTGCTGCAACCTAGCTTCGCTAGTCCGATTCCGACACCA
ATCCAGGTGCGTTGCGTTGGCCTGTGTGCGCCCGGTGAGTGGTGCAAGAGTTTGATCACGCCTAACCGTA
ACATAAAGTTGCGGAGTTTTGGTTTGTTGATTGCTCTAGCGCTGCGACGGGACTTGTTGTGTTCATACAA
TACTACCTGTGCAACCCACTCATTTAGAGTGGGAGTTTCCACAGGCTATTGTTTTGGGCACCGTGCACAG
CCAAACTTTGCACAACTTCTTTAATTTTGATTCCTCTGACCATATACCTGTTTGTTGAGCATCAGTGCAC
CACTGTAGGGTTAATTGCTACCGGTCTGCACCGCCCGTCAGCGGAGGTGTTAGTGGGCATAGCACTCCTT
GCACCGCGCCAAGTGCTTTGCACGGGTGGCTTCTAAACCGTTTCTTCCACGAGATAGGTATTAGCCATTA
GGTGTAAGTGACCTGATCCCACCGTATCACCTTGCGCAAGTAGCAAACCCATAGGAGCGTGGAATCCTAT
TCTGCAGCTGCCTGATTGTTAACACTCAGATATGGCCATGAATATAGCAAAGCGCAGCCCAATTGTGCTG
CCACAAATACAACCACCCCCTCTGCAGCTTTTTATATCTGTTGCTGCAGCTGAAGAGGGTCATCCTAAAG
ATTTGACACACTTGGGTGATTATAACCTGATAACCACGAAAGCAATTCCTGGTGTTCCGGTTTTAAACCC
CAAGACATCACTTACTGAGTTTGAACAACTGTTTGGAGCTCAACCTGTGTTGCGTGCTCTGCGTAACTTG
GTTAGTGAAAGTCGTTCGGCTGAATGGCATAATTCCAAACAAGCTTTTGTTGTGAAAGCTCAACAATTGG
TCTTTTCTGATCATGTACTTAGAGCTATGATTCGTCATTGCCCCGCACGTGTATCTGCACTTGCATCTTT
AGCACTATTTAACAGGATTGTTAAAATAGATGCTGAAGATCTTCGCAATATTGCACTTGATGTTGCCGCT
GAAGTCACTTATGGTGGCTCAGCTGGTGTTGCTCTTGTTGATTGTAAGACCATTACTCTGACTCACAAGG
ATGCCTACATAACACTTACAAATGAGTGTTTTGGTGTTCCTTTTACTTCAACCTTGCTTGCACAGGCAAA
AGTTACTAATGGTGCTATGGCTTATGCTGATTACCTGTTTTACCCTGGTGCAACTTTGCGCATGGTTAAT
GGTAAAGCACTGCCTATAGCTTCTAAACCACTTGTTGCCATCATTCAAAAAGTTCCACTTTTGAGTGAAG
ATGTCAATCTTTTACCTGATTACACCCAAGCTCCTAATATTCAAGTTGAAGGGGCTGAAGTGAGTGTTAA
CGGTATTAATTACTTAAAGACAACTGATACACCACCTTTATACTATCCACGTGTTAAGGGTGGTGTGTTG
AATGTAGCCCTTAAACAGCAGGGCACCGCGGACAAAAAGTTGTCTGTGGTTTTTCATGCAAAACCAGATG
ATGTTTTGTTGGCTTTTATACAGTTACAAGACTTTTTAAATCGTTCGTCTGGTGGTTTTATTGATGTTAA
CACTGAAGTTTATGAAGTAGCACCAAATGTTAATGTCTCTATTGGTGTTTCAAAACCTGGAGATGTTGTT
GTTGCTACTGCAGAAGACTACTTGAAATGCTTTGATGATCCTGATGTTTCAGGTTTATACAAAGTTTTCC
AAACTGAGTCTTGGGCAAAAGTTCAGCAGACATTTCGCAAATTGCGGGTTAAGACTTCTGCTGTTGTTCA
AGAATTCTTAAAACTTCTAAGCCTTATTGCTGAGAAGTTTAAATCACTTTCAACAATTGTTGATGCAATT
GTTAGTCAATTACAAAATTTGACTTTGGATGTTGTGGCACGTGTGCAAACATTGCAAATTAGTTACAAGG
CAGGTCGTCTTGTTGTTGATGCAGTTGGTGTCATATCCAAAATTGTACAACCTTTTTGTGACTTTGTCAC
ACCATTCCTGCATAAAGTGGCAGGGTTTGCTACTTATGCTTTTGGAACTAATATGCTTTTGTGTACGTCA
CGAGGTGTGTTTGTTCTTCAGCAAAGCGCAGCTAAAATTGTTAATAAGCTGCGTTATGTTTTTACCGTTT
CACCAGAATATGCTGTTGAAACTACTACAAATAAAGTCATTTATGAAGACAGTTTGCACCCTGTTGATGA
TAAACCTTCTAGGGCTCTAGAAGTTGTTGATGTTGTTGTGGGTGATACTGTTTTACAAATGGCTACTGAT
GGTAATGCATATTTTCCAACTGATGGGAACTATGCATCATTACCTGCATTTAAAGCTGGTTCAGATGAAC
TTAATATAAGTTTCATCTGTGACATCTTTGATGATGATACTAATGCAATGATTAATGAAACACTCGCTGG
TTATGAGTTGAATCAGTTAGTGGCACCGCGTACATTGACACCGAGAGATATTGCAAATCTCGTTGTTAAT
ACGTTGGTTGATGCTATTACTGATCATTATCCAGAGAAATGTATTGATTTACCAGAAGACTATCAAGTCT
TTTCATCTTATGATGATTTGCCTCTTACAAACCATCATATACCTAAACATCTCTCACTCTATGTCCAGGC
TATGGAGTCTGACGATGGTGATGAGGATGTTATTATTGAAGATGATGATTATCAATGTGATACAGGCGAT
GATGATGGTGGTGTTATACCACAGTGTTGGGATATTCCTAACATTGATACATTGCTTGTTAAATTGCAAA
AGAATAAACCAGTTAGTGTTGAAGTTGTGCCTAATGACACTAGGGACACTACTGTTACAATGAATATTAG
CACACCTGATGATGTTGCTATTGTTGAACAAATAACTGAGTCAGCTGCCATACAAGCGGAGAGTGTTCAG
TCAGAACCAGGTGACCAGGTTGATCAACAACCTGTAGAAGAAATAAATGTAGAACAAATGGTCCAGGAGG
AATCTGAAGTTTCTACAAGTAATGATGATGAGTCAACTCAACCTAGAGTTATTGACACTCTAGGTGAAGA
TGAACTCTTGTTTATTCCACAATGTGATTTTCCAGAACATCGTCCGCTTAAGGCATATATTTATGACCGT
AAGCTGAAAAATGATGTTATAGAACAATCACCCATTACTTCAGATGCAGACTCAGAATTAAAGTCTGTAG
ATTCTGATGTAATTTATGAAGAAGCTGTATGTGATGATGACACCATCATTACAGATAGCACTGAGAATGG
AGAGGAAGAACAGCTTCCTGCAACCATTGTCAATCAACCACTTACAATAGACAATAATATTCCCACAGTA
GCTTTGAAGCAACCCAGTCCTACTAGAGTAGAATTGGTTGTGGGTGATTTGTCTACTATAAAGTTTGACA
ATTCTGTTTTAGTAAATCCAGCAAATCCACAATTAACAAATGGTGGAGGTGCTGCTAGAGCTATAGCAGA
GTTGGCTGGTCCAGAATATCAAGCTCACTGTAACAAAATTGCACCAATTAATGGTGTTGTTACTACTGAA
GCTTACAATGCTAAAACTTTAGGTGTTGCCTGCATTTTACATGTAGTACCACCTAAGGGTACTGACCATG
ATGTCCAGGAACAACTTTACAATGCTTACCGTAGCATTTTAACTGAACCCGCCCACTATGTAATACCATT
ACTAGGTGCAGGTATTTATGGTTGTAACCCTGTTCATTCTTTGGATGCTTTTAAAAAGGCATGTCCTCCT
GATATAGGACGTGTTACTTTGGTTACAAAGGATGTTAACCATTTACAACTATGGGATGCGTTGAATCGCG
TAGTTGTAAGAACAACAAAGGATTTTGACCAAATTACCACTCAGGCTCTGACACCTCAGGGTGTTTTAGA
TGCCAATCTTTTTGATGGTGATAAATTTGTTCAAGAACCACAACCAGATTGTGTTTATCTGGCTGTTGAT
GATGTAGTACAGACAAAAGCTAAAGACCTTGGTCTTTCTTTGAGTCAGTACTGTAGTTACCTTAAGATGT
GCCACCATAAGTGGGCCACTGTGCGCACTAATGGTATATTACATCTTAAACAGAAGGATAATAACTGCTT
TATTAGTGCAGCTATTAACCTATTTCAGGTTACACATTATAAATTACGTCCTGTTATAGATGAACTGTAT
CAGGAGTATGTTAATGGTAACCCTAACAGATTAGTTGCATGGATCTATGCATCTATTAATCAAAATATTG
GAGAGATGGGTTGTCCTCAACAAGTGACTTCTCTTTTGGTCTCCAATGCTAATTCAAAATTTTTTGGCAC
TGTTCATTGTTGTAAGACTTATTTTACACACGATGGTGTTATTGCTAATGTGAAAGATTTTGATCTTTTG
CAACCTAAAGTTTATTGCATGCGTTGTGAAAGTTGGACAACATTTACACCTGAACAAGTTGAGGGTGTTG
TTGTTTTAGGGAATACTATTGGTCCAGCACCAACTCATGCTATTTGTTTTGGTAATGCCCACTGTTGGTA
TACAAATGGGCGTAAGGCTATAAATGGCTATGACATTAATGCAAATGTTGTCGTAGTTTATCACAAATTT
CAGATGATGAAAACACAAGTTGTGGTTTCAGCACCATTGTCTACTAGTAATAATTTTGATGTTTTGAAGG
TTCAAGACATCCCTGAAGATTCACCACTTAATAGTGACCCTCCAGCTGTTGAAGCAGCAGTTAAGAGTGT
CACTAAATGTGAAGTCCATGATAATCCTACATATTTGGATTTGCTGGATGTTTGGGTTCGCAAACCAAAA
CACATCCTAGTTAAATCTTGGAGTGTTATTGGTAAACCTTTATTTAAAACTGGTAAAGTCATTTTACTTA
GTGGTAAATACTTGTTAAAGATCTATAACTACTTGTGTAGTATAGGTGTTATAGATACTACTGCAAAGTT
GTCTATAGGTTTGGCTTGTAAGTGTGTAAAACGAGTTCTTCCTTCAACTTTGACTATAACACGCACTGTA
AAAGGATTGTTCTATTCATTTAGGACAATTATATTTGCATGTGCGCCATTCTTATTATTACCAGCGGTTG
CTAGTATTTTGTCATCTAGCTACCAGCTTGGTGTTTATTTATATGCTAAAACGGGTACACCCTGTGCTGC
ATATATGAATGAGGATCATACTGATTATCAATCATTTTGTGCAGGTGATTTGACCTGTCTTGTTTGTTTT
AATGGTATGGATTCTCTGCATTTGTATAAGCATTTGCATGTTAGTCAAAAAGTTTATGAGACTTTTGACT
ATACACCTTATGCTTTGGCTTTAGTTTTACTTTTAGCGAACACCACACTTGTTATATGTACAATGCTGTG
TGTGTTTTTATTTAACATTTATAAGTTTACAGTGCCTTATTATGGTGTTGTAACTCTTGATTATCAAAAT
ACATTGACATTTGTCTTTGTAGTTTATTATATGTGGTGTGTGATAAGATTCTTTAGGCATTTGGCGCGTG
GGTGTAAAACACCTACGTGTTCTATATGTTCTAAATTGAGAATTTCACCCACTATAATTGTAGATACTAT
AGTTCAGGGACGTAAGTACCCATCTATAGTACATACTAATGCGGGTTTTAAAATTTGTCCAGAACACAAT
TTTTATTGTAAAAATTGTACTGGTGAAAACCCAGACACATTCATTCCCACTGAAGCAATAGAATCACTTT
CTCGTGTTACTAAGCTCAGTGTCAAACCTACAGCACCAGCTTATCTACTTGCTAGAGATGTTGAGTGCCA
GACTGATGCCATAGTAGCTCGCGCTACACATGGCGGCCAATCCATGGTGTGCATTTCAAAGTATTCTGAT
GTTAGAACTGTTGATGCACTCTTAAAACCAACACCTTTATTTTCTTACACTCCAGATGTTATCATTGCTG
CTGACTTTGATAATGCTGGTAGTTTGAAAACTGCTAAGGAATTGGCTGTTGTTTTGTCAATGGACCTTAA
GAGAACCATTTTTATTATTGATCAGTCATATTCAATGCCTGTAGATAATTATACAGAAGTGGTTTCTCGT
ATGGAGAAATATTATACTTTCCAAAAGATAACACCAACTGGTGATATTTTTATGGATGTTAAGACAGCCA
CTCATGGCCAAGCTACTGATTCTGCTATAAATGCAGCAATCCTAGCTGTTCAGAAAGGTTTGGACTTTAC
TATTGATGATCCAAACCATATACTACCTCATTATGCTTTTGAGTTTTCAAATTTGGCTGTTGAAGACCAA
TCTATTTTAATAGAAACTGGTTGTGCTAAAGGTAAACTTAAAGGTACTAATGTGGGTGTTATATTAGCTG
CTAACTTGGTTGAGCGTCTTAGCCAATCGGCTATACGTGTTATATCAAATGCAGCTTCTAGAAATGGTGT
TACTTGTTCTGTAACACCATCAACTATGGTTTTGCGTGGCAACATAGCTACACAACCTTTACAGAGAATT
AAAGCTGGTAGTGCTGCTAAACACAGTATTACTACTTTTGTTGTTTGTTTAATTGCTTTGTATGCATTGG
CCTATGGTATGGCAACCTTGGCTGTATATGTTTACCAACCAATTTATCCTACAGTAATGTCTGATATACC
TACTTCTGGCTTTTATGTCATTAGGGATGGTGTGTTAGACAATATACGCTCAACAGATACATGCTTTTCA
AATAAGTTTGTTTCTTTTGATGCTTATTTGCAGGCAGATTATGTTAATAGTCATAATTGTCCTGTTGTTG
TAGGTGTTGCTGATGTAGCAACTAAATCCATACCTGGTATTCCTGCTGGTGTTATTCACCGTGATTCAGG
AATTTTACATATTTATGAACAGTCTTTGTATGATCGCTTACAGCGACAATCCATGGTTCAAGAGGCATTG
GGTTTGAAGACTCGTGCTCTTTTTAATATTGGATATAGGACTGTTGTAGGTTACACACGTAGTGATGTTG
TTGTTGGTGCATCTTATATGCACTCACCATCATTATTTAATGCTAAATGTACTTATCTTGAATACCAAGA
TAAGAGACATTTATATTGTTTTGATAAAGTGGATAGAGAACATAAGCTTTATGCTGATGTTATACCACAT
GTTGAATATAAGGCAGTGGATTTTAATGGTGAGTTAGTGCCATTTAAAATTCCTGAACAACTGCTTTTAT
ACCCTCACATTGTTCGATACACTAGTAATTATTACTGTCGTATGGGACACTGTTTTAAAACTAACCCTGG
TGTTTGTGTTTCTTTCACTGATGAATTTCCTTACAGTGAAAATGTGCAACCAGGTGTTTATTGTGCAGAT
AGTGGATTCCAATTGCTTACTAATTTTATAATTGGTACTGTAACTGGTGTCCATATCTTTACATCAACTG
CAGCACTTTTAGGATCAACTTGTTTTATTCTATTATGTGTTTTTGCTATTTTAGCATTTCAACGCCTGTT
CAAAGAGTATACAACTTTTGTGTTACATACTCTTATTATAGCGGGTGTTAATATAATAGGCATTGCACTT
GTTTATAAGTTCACTGCTCTTGCAATTGTGTATTATGCAATCTATTTGTATTGCATTTTAACTTTTGTTC
CTATTAAGAGAAATATTGCTCTCTTTTATTTTGCTGTAGTGTTAGTACCACACATTAGTAATATGCAATT
ATTGGCTATTGCTGTTGTGTTTGTTTGTTACTTATGTTACAGCTATGTACGTGTAGTTTCTAAGACAGCT
GGAAAATTTTCATCTTTCTTAGGCGCTTCAAAAGCAACTTTTGTTATTGATAATGATAAGTATGTTATGC
TGAGAGACTTAGCTGGGAGTGAGTATGACTCTTATCTTGCCTCTTATAATAAGTATAAGTACTTTTCAGG
CACTGCTTCTGATAAGGATTATGACAAAGTTTGTATGGCCTTCTTGGCTAAAGCTTTGTCATCCTTTAGA
GATGGCGGTGGTTCCCAATTGTACACTCCACCACAGTTAGCTGTAGTGCAGAGTATAAAAACTAAATTAC
AAGCTGGTATAAAAATTTTGTTACACCCTTCGGGTGTTGTAGAGCGTTGTATGGTATCTGTTACCTACAA
TGGTTCTGCATTAAATGGTATTTGGCTTAATAATGTTGTCTATTGTCCACGCCATGTTTTTGGTAAGTTT
AAAGGTGAGCAATGGCAGCATATAGCATCTATAGCTGACTGTCGTGATTTCTGTGTTGTTTGTCCAACAC
AAGGAATACAATTGACAGTGCAGTCTGTAAAGATGGTGGGTGCTATTTTGCAACTCACAGTTCACACTAA
TAATACTGCAACTCCTGATTATGAGTTTGTTAGGTTAACACCAGGGTCATCTATGACCATTGCGTGCGCC
TATGATGGCGTTGTACGTAATGTTTATCATGTTGTACTCCAGACTAATAATCTCATTTATGCAAGTTTTC
TTAATGGAGCTTGTGGTAGTGTTGGTTATACACTTAAGGGTAAAACACTCTGTTTACATTATATGCACCA
CCTTGAGTTTAATAATCAAACCCATGGTGGTACAGATTTACATGGTGTTTTCTATGGTCCTTATGTGGAT
GAAGAAATCGCACAACAACAAACAACATTTCAGTACTATACTGATAATGTAGTTGCTCAATTATATGCTC
ATTTACTCACTGTTGATGCTTCCCCAAGATGGTTAGCACAAGCTGAAGTATCTGAGACCGATTTTAATGC
ATGGGCTTCTAACAATTCATTTGCTAACTTCCCATGTGAACCAGCTAACATGTCTTATATTTTGGGTTTA
GCCCAGACATCGCGTGTGTCTATAGGACGTGTTTTGAATACTATTATACAGCTTACTCTTAATAGGAATG
GTTCTCTTATAATGGGTAAGCCCGATTTTGAGTGTGATTGGACACCTGAAATGGTGTATAATCAAGCTCC
CATTACGTTACAGTCAGGTATAGTTCAGAGAACTTCTATGTGGCTGTTACATTTCTTATTTAATACCTTA
TTGGCTGTTTTAGCCATGTTACATGTATTACCTACTGAATTGTACCCACTAGGCTTGCCAGTGGTTACAG
TTTTTTCATCTATTATTACTGTTACTGTTAAGCATTCAGTAGTTTTCACAACTACATTTCTTTTGCCAGC
ATTTTTAATGTTTGTGGCAAAAGCACCCACTCTTTGGATTCCAAATACCTATTTAAGAAGTTTGTATGAA
TGGGTTTTTGGTCTCACTATGTCGGAACGCCTTACTTGTTATACAGTAGGTGTTTATATAGTAGTTTATT
GTCTTATAGCACTTAATTATACATTGAGGTGTGTAAGATATAGAGCTACTTCTTATGTTAGTATCTTTAT
GCAATGTGTACAATATGCTTATGTTGTGCACATAGTGTATAGATTACTTACTCAGGCATGGACTGATAAG
CTTTTGTTTACAGCATTCTCACTATTAACCTCACATCCTTTGTTGGCTGTGTGTGGTTGGTGGCTTGCTG
GGAAGTTTCCAGTACCATTTTTATTACCAGATTTGGCCATACAAATTGTGGCTTATATTGTTATAGGATA
CATTTTGTGTGTTCGATTTGGTTTATTATGGATTTTAAATAAATTTACTACCTTACCTATTGGCACATAT
AATTATATGGTGTCTATAGAACAACTAAAATATATGATGGCTATTAAAATGGGTCCTCCACGTAATGTGT
TTGAGGTTTTAGTAGCTAATTTAAGACTATTAGGTTTAGGTGGTAATAGAAATATTGCCATTTCAACTGT
TCAAAATAAAATCTTGGATGCAAAGGCTGCTGCTGTTGTAGTTGCCAACCTTCTTGATAAGGCTGGTGTC
ACAAACAAGCATTCAGTTTGCAAAAAGATTGTTAAATTGCATAATGACACTCTTAAAGCTACCACTTATG
AGGAAGCAGAGTTGTCACTTGTTAAATTATTAACACATATTATTGAGTTTTTGCCAACTGACCAGGTTGA
CGCTTATTTAGCTGATACAGTCAAAGTGCAAGCACTCAACCAATATTTAGACCACCTCTTAGAAAACAAA
CTTGTTTTACAAGCTGTTGTGGATGCTAATATAAATCTTGACTCCTATCGCATTTACAAGGAGGCTGATG
CTATTTATAAGAAATCTGTAGATATGGATGAACCATTGCAGATTCAAAAGAAGAAACTTAAAGCTGTTAA
TATAGCTAAAGCAGAATGGGAGCGTGAAGCTGCTTCTCAACGTAAGTTAGAGAAGTTGGCTGATGCTGCT
ATGAAATCAATGTATTTAGCTGAACGTGCTGAAGATCGACGTATCAAGTTGACTTCTGGGCTTACAGCTA
TGTTATATCATATGTTGCGTAGGTTGGATTCAGACAGAGTAAAAGCTTTGTTTGAATGTGCTAAGCAACA
GATTTTACCAATACACGCTATTGTGGGTGTTTCCAATGACAATTTAAAAGTTATCTTTAATGATAAAGAT
AGCTATATTCAGTATGTTGATGGTAACACACTCTTTTATAAAGGCCAGCGGTACACTATTGTTAAAAAGT
TGTCCCTGGATAATGCACCTATTGAAGGTACCCCTGAAGAGTATCCTATTGTTGTGGAGACTGTTCGTGA
GGGTATTCCTCAAATTCAAAATAATGAGCTTTGCTTGAGAAATGTTTTTACAGCACAAGCTCCAGTTTTT
GATTCTAACGGTAAAGAAAGCACTGCTAAATCCTTCTATGTGTCTAGAGCAGGTAGAAAGATTTTAGTGG
CCGTTACATCAACTAAAGATGATTTACGTACTGTTACCTGTCATACCGATAACGGTAAGACAATCCTAAA
TTTGGATCCTCCCATGAGGTTTGCTCATGTGATTGGCGGTAAACAGCATGTAGTCTATTTATATTTTATT
CAAAATATGTCATCATTGAACAGAGGTACGATTATTGGTCATATCTCTGGTACTACAATATTGCAAGCTA
ATGGTACTCAAATTGAGTATCAGGAGAATGCATCATTGTTAACCTATTTAGCATTTGCTGTAAACCCGAA
GGAAGCCTACTTAAAGCATTTGGCTGATGGTGGTAATCCTATTCGTGGTTGTATACAGATGATTGCTAGT
TTAGGCCCTGGTTTTGCTGTAACAACAAAACCTCAACCTAATGAGCATCAGTATTCTTATGGTGGTGCTT
CAATTTGTTTGTATTGTCGTGCTCATATACCACACCCTGGTGCGGATGGGCGCTGTTTATATAAAGGAAG
GTTTGTCCAAATTGATAAGGACAAAGAACCTATATCCTTTGCACTAACACATGAGCCTTGTAATGCCTGC
CAACATTGGGTCAATTATGATTGTACCTGTGGTAGTGCTTTGCAAAGTTCACCGTATTTAAACGAGTAAC
GGGGTCTAGTGGTGCCCGCCTAGAACCCCTACAACATGGTGTTACACCAGATGTTGTACAAAGGGCTTTT
CATGTACACAATAATGTCAATTCTGGCATATTTTTGAGTACAAAAACCAATTGTTCTCGTTTTAAAACAA
TTCGAGACCATTTACCTTTACCAACTGATAAAGCAGTTGAATTGTATTTTGTCAGTAAACAATGTTCACA
GCAATCTTTCGAGATTGAAGAAAAGTGTTATAATTTGCTTGCTGATAATATTAAATCGACTCCTGAAACA
TTTGGTGTTCTTGCTAGAACTGAATTTTTCAAGTTCGACAAAATACCCAATGTAAACAGGCAGAATTTAA
CAAAATATACATTATTAGACCTGGCTTATGCCTTGAGGCATTTATCCACGTCTAAAGATGTAATAAAAGA
AGTTCTTATGACCATGTGTGGAACCCCTGAAGAATGGTTTGATGAGCAGTGGTATGATCCCATTGAGAAT
CAAACATTTTATAGGGAGTTTCATAAGTTAGGGTCAATATTAAATCGTTGTGTTATTAATGCCAATACTT
TTGCAAAAGCTTGTGCTGATGCAGGTTTAGTTGGTATACTAACACCTGACAACCAAGACCTTTTAGGTCA
AATTTATGATTTTGGTGATTTTATAATCACACAGCAAGGTAATGGATGTGTTGATTTGGCATCCTATTAC
TCTTATTTAATGCCCATCATGTCAATGACTCATATGTTGAAGTGTGAGTGTTATGATAGTGATGGTAATG
ATTTAGTTTATGACGGTTTTCAATATGATTTTACTGAGTTCAAACTTAGTTTGTTCTCAAAGTATTTTAC
ATATTGGGACCGTCCTTATCACCCTAATACAGTTGATTGTCCAGATGATAGGTGTGTTTTGCACTGCGCA
AACTTTAATGTTTTGTTTGCTATGTGCATACCTAACACAGCCTTTGGTAATCTCTGTTCACAAGCAACAG
TCGATGGTCATAAGATCATTCAGACTGTTGGTGTACATTTGAAAGAGTTAGGTATAGTCTTGAATCAGGA
CGTTACCACTCATATGTCAAATATTAATTTAAACACTCTGTTGCGACTTGTAGGTGATCCTACCACTATT
GCAAGTGTTTCAGATAAGTGTTTAGATTTAAGAACACCTTGTCAAACTTTGGCAACTATGTCTAGTGGAA
TTACTAAACAGTCTGTCAAACCAGGACATTTTAATCAACACTTCTATAAGCATTTGCTTAATAGTGATAT
TTTAAACCAACTTGGTATTGATTTACGGCACTTTTACTATATGCAAGATGGTGAAGCAGCCATAACAGAC
TACAGCTATTATAGGTATAATACACCCACCATGGTTGATATAAAGATGTTTTTGTTTTGCCTTGAAGTGG
CGGACAAATATCTGCAACCATATGAAGGTGGGTGTCTTAATGCCCAGTCAGTTGTAGTTAATAATTTGGA
TAAATCTGCGGGATACCCTTTTAATAAATTGGGTAAGGCCCGTAATTATTATGACATGACTTATGTTGAA
CAAAATCAATTATTTGAGTATACAAAACGTAATGTTTTGCCAACACTTACTCAAATGAATCTTAAATATG
CTATTTCAGCTAAAGATCGTGCTCGTACTGTTGCTGGTGTTTCAATAATAAGCACTATGACTAACAGACA
GTACCATCAGAAAATGCTGAAATCAATTTCTTTAGCCAGAAATCAGACGATCGTAATTGGAACAACCAAA
TTTTATGGTGGTTGGGACAATATGTTGCGACGTTTGATGGATGGTATTAACAATCCTATTTTGGTGGGTT
GGGATTACCCTAAGTGTGATCGTTCTATGCCTAACATGTTAAGAATTGCTGCTTCTTGCTTGTTAGCACG
AAAACACACTTGTTGTACTCAAAGTCAGCGATTTTATCGTCTGGCTAATGAGTGTTGCCAGGTACTGTCA
GAAGTTGTGGTGTCTGGTAATAATCTATATGTTAAACCAGGTGGCACTAGCAGTGGTGATGCAACCACAG
CTTATGCTAATTCCGTGTTTAACATTCTACAGGTTGTATCTGCAAATGTTGCAACCTTTTTGTCTACTTC
TACCTCTAATCATAATTCTCGTGAAATTGCTAGTTTGCATAGGAATTTGTACGAGGATATATATAGGGGT
GACTCAAATAATACATCTGTCATTGAAGACTTTTATCAACACCTGAGAAAATATTTTGGGTTGATGATAT
TGTCTGATGACGGTGTAGCTTGTATTGACTCAGAGGCGGCTGCTTCTGGTGTAGTTTCCAACTTAGATGG
TTTTAGAGACATTTTGTTCTACCAAAACAATGTTTATATGGCAGATTCGAAATGTTGGACTGAAACCGAT
ATGAATGTTGGCCCTCATGAATTCTGTTCTCAACACACTGTGTTGGCTGAACATGAGGGCAAACCATATT
ACTTGCCGTATCCTGATGTTTCTCGCATTTTGGGTGCGTGTATATTTGTGGATGACGTTAACAAGGCTGA
TCCAGTTCAGAACCTTGAACGTTATATTTCTCTTGCCATAGATGCGTATCCGCTTACTAAAGTAGATCCA
GTTAAGGGTAAAGTGTTTTACTTACTCTTAGATTATATACGTGTGTTAGCTCAGGAATTGCAGGATGGTA
TCTTGGATACCTTCCAATCAATGACTGATATGTCATACGTTAATAATTTTGTGCAAGAGGCCTTTTATGC
TCAAATGTATGAGCAAAGTCCTACACTGCAGGCATCTGGTGTGTGTGTTGTTTGTGCTTCACCCACTATT
TTGCGTTGTGGTGATTGTATAAGAAGACCATTGTTGTGTTGTGTTTGTGCTTACCAACATGTAACACAAA
CTACACACAAACGTATAATTGCTATCAATAACTACATTTGTAGTGTTGATAACTGTAATGAAGATAATGT
TGAAAAATTATTTATTTCTGGTACAGCGATTTATTGTGAAAATCACAAACCTACGCTGTGCATACCTATT
GTAGCTAATGGAACAGTTTTTGGTATCTATCGTCATACAGCCAGAGGCAGTGATGACATAGAGCTGTTTA
ATGAATTAGCTACATCGAATTTTGACACAATTGAGCCTTATCGAAAGGCTAATCGTGCACCCTTATCATT
AATGCTCTTTGCTGCTGAAACTATTAAGGCACTCGAAGAGTCTATTAAGAAGTCATACGCAACTGCAACT
GTGAAAGATGTGTATGATCAAAGGTTTATTAAATTAGTTTGGGAGCAGGGTAAAAAGCCGCCTCCTATAA
CTAAAAATCACATATTTACCGGCTATCATTTTAATAAGAATGGGAAAACTCAAGTTGGGGATTACATTCT
TACTAAAACAGACGGTAATGATTCTTATACCTATCGTGGAACATCCACATATAGGTTACAAACTGGTGAT
GTATTAGTACTTATGGCACATGTTGTTACACCTTTGTCTGCACCTCCAGTGCTGGCACAAAGTACATATG
TCAGAAAGTCACTTATACCTGATACTGTTGGAGCTTCATTTTATGTACAGCATTTTAAGTCATATAATGA
GATTGCTCTGCAGAAAGTTACAACTGTACTTGGTCCACCAGGCACTGGTAAGTCCACCTTTGCTATTGGT
TTGGCTAAATACTACCCTAATGCTCGCATCTGTTATACTGCGTCATCGCATGCTGCTATAGATGCGTTGT
GTGAAAAAGCTTTTAAAACATTACCTGTAGGCCAATGCAGTCGTATAGTACCCACACGTACGACTGTAGA
GTGCTTCCAGGGTTTTGTTGTTAATAATACTACTGCACAATATATCTTCTCAACAATTAATGCACTTCCT
GATATAAAGTGTGATATAGTTGTTGTAGATGAGGTATCTATGTTAACCAATTATGAGCTTTCTTCAGTGA
ATGCTCGTTTGGTTTATAATTATATAGTTTATGTTGGTGACCCTTATCAGTTACCATCACCTAGAACAAT
GTTAACAACAGGTCAGTTGTCACCAGCTGATTATAATGTTGTGACTGATATTATGGTACATACTGGTGCT
GATGTGATGCTAGATATGTGCTATCGTTGTCCAAAAGAAATCGTAGAGACGGTGTCTAAACTTGTCTACG
ATAATAAGTTAAAAGCGGCGAAACCGAACTCACGTCAGTGTTATAAGACCATTGTTAATTTTGGTACTTC
TGACATTGCACATGAGGGACAATCTGCCTATAATGAAGCCCAGTTACGTTTTGCACTTGCTTTTAGACGT
TATAAGCGGTGGGAGAACGTGACATTTATTTCACCTTATAATGCCATGAATGTAAAAGCAGCCATGGCAG
GTTTTTCTACTCAAACTGTTGATTCATCTCAAGGTTCTGAGTATGATTATGTTATTTTTTGTGTGACTAC
TGATTCAGCTCACGCTTTAAATATGTCTCGTTTGAATGTTGCTTTAACACGTGCTAAGATTGGAATCTTA
GTAGTGTTTAGGCAAGCAAACGAACTCTATAATAGTCTGCAATTTGAATCGATTGATCCTAGCCTCGTAG
GTCAAGAGGGAGTACTCCTGATGACGGACCGACGCAGTACTGCCTTGGCGAAAAGTGGGAGTACTCCCAT
GAAGGTTCAGTCCAGTGAGGATACAACTCAGGAAGTACTTCCTGAGGGCTCGTCGAGTACTCGCTTGCTG
TGTCCTCTTTTCAAACGTTGCAGTTATGAGTATAGTGGTTTACATCCTGCTCATGCCTTAACATGGCATG
ACTGTGGCGCTGAGTATCGCTGTGATGAACCACTTGCTAAACTTGTGGGTGTCTCTGATGGCACCCTGGT
ATCATATAAAACCTTAGTGTCAGCACTCGGGTTTTTACCTTCTCTTAAAATTGAAACATATCACAATATG
TTTCTAACAAAGGAGGCATGTCGCACCTATGTACAAAGTTGGATTGGCATAGATGTTGAAGCTGCACATG
CTGTTAAACCTAATGTTGGTACTAATTTACCACTTCAAATTGGTTTTAGTACTGGCAAAAACTTCTCTGT
TACACCTGAGGGTATTTGGGTGAACGAGTTTGGATCTTGCACCGAACCAGTTCCTGCCAAAATACCCCCT
GGTGAACAATTTAGACACCTTAAACGAGATATGCGACAGGCGCGTCCGTGGAAGGTTGTACGTAATGAGA
TTGCTACACATTTAGCTGAGGTAGCGCCTTATACTGATCATATATGCTTTGTGACTTGGGCTCATCAATT
GGAGTTAGCCACAATGCGTTATTTTGTTAAAATTGGTACTGAAGAATCATGTTTTTGTGGCAGGAGAGCT
TGTTTCACAAATGAAACTGAGTTTACCTGCAAAGCACATCGTGCATTATCAGTACCCTCTTGTGATTATG
TGTATAACCCTTTTTTGATCGACGTGGCTACGTGGGGTTTCTCGGGACGTCTCTCCACAAACCATGACGA
GGTTTGCACATACCATTCAAATGCTCATGTTGCATCAGCTGATGCTACAATGACAGTTTGTCTTGCTATT
CACGAATTGTTCAGAAGTGTTGACTGGGATTTGGAATTTCCAGTAACTCCTGAGCAGTCACAATTGAATA
AAGCTTGTCGTTTGGTACAAGCCAACTATCTCAACATTTTGTTGACTACAACTAAAGCAACGGTGGTTCA
TGATATTGGTAATCCCAAAGGGATCCCAACAGTGCGCCGTGCTGGTGTTAAATATCATTTTTATGATCAA
GCACCTATTGTTAAACATGTCCAGAAACTAAAGTACAAACCCGAAATGGAGGCCCGTTTCATGGAAGGTT
TGACTATGTTTTGGAATTGTAATGTTGACACTTATCCAGCTAATGCTTTGGTGTGTCGTTATGATACGCA
CAGACAAAAGCACCTTATTGGACCTAATGGTTCAGCTTTATATATTAATAAGCATGCTTTTCTGACCCCA
GAAATGCATACTTATGCAACACATAAATTAACATTGGCACCCTTAATTTACTACTCAACAACTGATTGTA
GTAGTGAACAGCCAATTGTAGTTTCTTATCGTGATTGTGTTACGCGGTGTAATACTGGTACCACAATTTG
TCCTACACATGCTCTTGAATATCAAGAGTTTATTAATGCATATAACCTTATGGCTCGCCATGGGTTTAAT
GTTTATATACCACGTAATGTCAACGTTTATAATTGTTGGCTTTCATTTACTAATTTGCAAAACCTTGAAA
ATTTGGCTTACAATTGTTATTATAAGAACTGCAATGCTCATGTTGATGGGCAATTAGATGTAGTTATTAA
TAATAACGCTGTATATGCCAAAGTTGAAAATAATCTTGTCAAGTTGTTTGACAACCGAACCAATTTACCT
GTGTCTACTGCCTTTGAGCATTATACTAACAGGCATACTAAAGCATTACCCACTACGCAATTACTCGCAG
GTTTGGGAGTAACTGCTACCAGAAATTTTACAATTTGGGTGGATGATGACACAGTATTTCAACATACTGT
AAATGTTTCAACATATACTGACTGTGATCCTAACCTACATGTTGTTCTTTGTGATGATAGGTATGGAACA
GATTGGAGTCAGTTTAATCAAATGCCTAATGCTGTCTTCCTTACTAAAACAAAAGTGAAGAAGACAGTCC
CATTTATATGTACTGCTCTAACTCTTAATGGCGTAGCCATTGATGGCGATGAGTTGTATATTTACTATCG
TAAAGATAATCAATTAATAAATTTTACTACTATTCTAACACAGGGTAGGGTAGTAGATAAATTTATACCT
AAAACACCAATGGAAAAAGATTTCTTAGAAATGAATTCTGAAGACTTTATTAACTCTTATGAGTTACAAG
GTCTTGGTGTTGAGCACATTATTTATGGTGAGGATAATACACCTGTTATAGGTGGTACTCACGCTTTAAT
ATCACTAGTCAGGAATAAATTTTCCTTTGAACTAGTTAACCACATATACAACCCAGTACAAAACTGTGTT
GTTACATCTCAAAATGCAAGCTCTAAGGAAGTTTGCACATTATTAGATATTACACTTGATGATTATATTA
ATATAATAAAATCAGCTCATGCCAATTTTGAAACTAAATCAAAAGTGTTTAGTGTCAATATTGACTGTCA
AAATGTTAAATTCATGCTTTGGCATGATGAGCAAGTGCAAACTTGCTACCCCATTGTACAATCACTTACT
AATGGCTACCAAATGCCTAGTGTTTATAAAACACTAGTATGTGATTTAGAACCATGTGATATTCCAAATT
ATCATGCCTATGTACCTAGAGTACCGGGTGTTGTTAAAAATGTACTTAAATATAGACAATTATTTAACTA
TATTATTAAGAAGGACAGGTTAGCTGTTCCTCATAATATGACTGTTTTACATCTTGGAGCTGCCTCAATT
GAAGGTACAGCTCCTGGTACAGATGTTATAAAACACATGTTACCAGAAGGTACAGTTATTATTGATTTGG
ATATAAGGGAGTTTACTTCTGATGCAAACCAAATCATAATTTCTGACTATAGAACTTATATGCCACCCCA
CCATATAGATGCGATATTTTCGGATATGTATTGTGGTGATGACATTCATTTCTTTGATAATTTAATAAGA
ATAGTTAAAGAGAGGTTAGCTCTCGGTGGTTCACTTTTTGTGAAAATCACAGAACATTCTTATTCACCTG
AACTTTATGCTCTTGCTGGGCATTTTGATGATTATCAATTATTTTGTACAGCTGTTAATGCTTCTTCTTC
AGAATCATTTTTATGCTGTTTCAATTATTTAGGTAGTGTGAAAGAAAATGTGAATGGGCACATGCTTCAT
GCTGCTTATATAAGATGGCGCAATGAAATTGCGTTAACACCAACCTATTCACCTCTAGCTGATAACGCGG
CTGTGGTTTGTAAATTAAAGGCCACTCCCATAATTTCAGCTAAGGAGCTTGAAAAGAAACCAATTCTTAA
GTATCTTGTTGCTTCAGGTCGTCTACTTGTTAGGCCGCCAGAATGCAGAGAGTTATATTAATTTGCTTCA
TAACCCTAGCATCAGCTGCCAGGCTGGTTGATAGAGTTTTTGATGCATTAACTTTTCCAAATGCTCATCA
ATATCTTCGAGACACAAGGCAAATTCAACCTCGTTGGTTGCCTAGTGCTGAAGAACCTAAATCAGATGGC
AAGGGACATTTTACCCAAAATGTCCATAGATTTGCTTTTCTTACTAATGGTTCATCACCTGTTGACCAAA
TTATTCGTACAACGCAACCTCTGCTTTTGCGTTGTCCTCAATGGTTTGGTTATAATGGTAGTGGTAATTG
GGTGCTAAAATTTAATTTTAGTGAATCTAATTACTGTAATGATGGTTACAATTATAATGGTAACAAAGTA
GTCTCACACATAAGACTTATTGGTGCATTTTTAGCTTCACCATCTGTTGATTATGTGTTTACATTGCAAA
CTACCTCTGGTAGCACCTACTACTTAAACTGCAGCACATCACAACGTCCAGTTGGATTTGATGCAGAAAT
GCAACGTAATTACTGTTATGTTAAGACTGCTAATTACACGCAATTTATAGGCATTCTTCCTGAAAGAGTA
GCTGATGTTACTTTTTCCAGAGAGGGCACCTTTTATGTCAATGGCTTTGGCATGGGTTCCTTTGGTCAGC
TGGCCCGTATCACAGTTGATAAAGGGGCTCTAGCCACTTTTAACCATTCATGGGCATATTTCGTTGATGA
AGCAGATGTGCTTCTTAACATAACTGACAGCCAGATTCAGGGTATTGTCTATTGTGACAAGGACCTGTAT
GATCATCTTCGCTGCCAGCAGTCATCATTTAGTTTAACTGATGGATTTTATTCAACAGCTAAATATACTA
CAAATCAGCAGAGGAAAACAATTTTTGTTACTCTGCCTAAACACACATATACAGAGACTATCTCAATCTT
GCCTAACATTTCAAACCCAGCTTACCCTGATGGTAGTACCAATGGTCCTGCATTGGGTTGGTGGGTTGGT
ACAATGAATGTTTTATTTAATAATTCACAAACACTTTGTGTTAATTCATCATTTTTTATGGTTAACATTA
CTTTTAAATGTTGGTTGAAACCTCACCCTACCAAACCTTCTGACGAATATAAGTGCATAGGTGGTTTACC
CACAGCTCAGGTTAAACTACCTGACTGGCCTTTTGCACCTTATTATTCTTTTAGCCAACTTTGTTTGTCT
AGTACATACCAGGTTGGTTATTCCACTTTCTATTTCCAGTATTGGAACCAAGGTACTAATAAAAGATGGG
AATCAAAACCCCTCTTTTATTACACTTATCAAACAGGTACTCAATACACTTATGTAACAAAGCCAGTTAT
ATCATTTACTGATGTTTCTGAATTGTCACTTTATGAGTGTGTTGACTACAACATTTATGGTGTTATTGGT
TCTGGTATCATCCAACCTTCTAACATCTCTTATTTGAATGGCCTCTACTATACTTCTAGTGCTGGCCAAC
TATTAGCATTTAAAAACTCCACAACTTTCCAGATTTACACAGTTCAACCTTGTGATTCACCTGGACAAGT
TATAGTTTACAACAATTCTTTTATTGGAGCCATTACTGCCTCCAATCAAACTATTTTGAATTTTAAGAGT
CGCATTGCAACTCCTACATTCTACTATCATACAAATGCCACTAGTGTTCAAGGAAATTGTAATACTGCAC
CATTGCAGTTTTCCTCAATTGGCATTTGTCCTGATGGTTCTATTATGCAGGTCAACACTACTGTTGACAC
ACTACCTGCAACAACAATTATTACCAGTGGTAATATTACAATACCACTGAATTTTACAATTTCAATTCAG
GCTGAATACTTGCAAATACAAGCACAGCATACTGTTGTGGACTGTCAAACATATGTCTGCAATGGTAATG
CAAAATGCTTGCAATTACTTCAGCAATATTCTACTGCCTGTTCAAACATTGAACAATCACTTACTATGTC
TGCTCGACTTGACAATGCTGAAACGCTTGCCATGGTGCAGACTTCTACGCAAGGTTATCATCTGTCAAAG
ATTGAACAGCATGATAATCAATATAATTTAACTGCTATACTACCTAATAAACAAGGTGGTAGATCAGCAA
TTGAAGATCTACTTTTTGACAAAGTAGTTACAAATGGACTTGGCACTGTTGACCAGGATTACAAGGAATG
CACCAAAGGTGTTTCACTTGCAGACCTGGCATGTGCTCAATATTATTCAGGTATTATGGTTCTTCCAGGC
GTTGTTGACGCTGAAAAGATGGCCATGTACACTGCTTCACTTACAGGTGGTATGTTCTTTGGAGGACTTA
CCGCTGCTTCTTCCATACCTTTTTCCGTAGCTGTTCAAGCACGTCTTAATTATGTTGCACTTCAGACTGA
TGTGCTGCAGAAAAACCAACAAATACTTGCCAATAGCTTTAATCAGGCCATGGGCAATATAACACTTGCA
TTTTCTTCTGTTAATGATGCTCTTCAGCAAACCTCTGAAGTAATCCAAACAGTTGCAAATGCACTCAATA
AAATTCAGGATGTTGTGAACAAGCAAGGCTCTGCTTTGAACCACCTCACCCTGCAGTTACAAAACAATTT
TGATGCTATTTCACATTCAATAGCAGACATTTACGCTAGACTTGATGAAGTAGAAGCAAATCAGCAAGTC
GATCGCCTCATTACAGGCAGGCTTGCTGCATTAAATGCATACGTCACTCAAGTTCTAACACAAATTTCCC
AGCTTAAAGCCCAAAGGCAATTAGCTCAGGAGAAAATAAACGAGTGTGTGAAATCACAATCTGACAGATT
TGGATTCTGCGGAAATGGTTCACACTTATTTTCTATTACACAGGCTGCACCCAATGGCATCCTGTTTTTG
CACACTGTTCTAACACCAACTGACAGAGTCCAGGTTAATGCTATTGCTGGCATTTGTGTCTCTGATTCAG
CTTTTGTGTTACGTGAACCTAACCTTGCTTTCTTTCAACATGATGGCAAGTGGTTAATTTCACCCCGCAG
ATTGTTTCAACCAAGACCGGCCACTGTTGCTGACTTTGTGCAAATACAGTCCTGTGAGGTTACTTTCTAC
AATACAACCTATGATGAGCTTCCACAATTAATCCCTGATTATGTGGATGTTAACCAGACGGTTTCTGACA
TATTAGCCAACAAAACAGATCCATCTTTGGACCTTAAGTTGGACATTTACAATCAAACTGTTTTAAACCT
CTCTGCTGAAGTTGATGAACTTTTCCAGAGGGCTCAAAATCTTACTCTAATTTTCAAACAATTGGAGCAG
TATATCAACAACATCAACAACACTCTAGTAGATTTAGAGTGGCTTAATAGAGTTGAAACCTACATTAAAT
GGCCTTGGTGGGTTTGGCTACTCATTGTGTTAGCCATAGCAGCCTTTGCCTGTATAGTTATTACCATCTT
CCTTTGCACTGGTTGCTGTGGGGGATGTTTTGGTTGTTGTGGAGGCTGTTTTGGATTGTTCTCAAAGAGA
AAATTTGACAGCGACCCGACACCAGTTTCTTTTAAATTAAAGGAATGGTAGTGGAGGATTGGTCCATCAC
CATACCTGGACAATATGTTATAGCGGCACTAGTCATTCTTATTGTCTGTGTCACTTTGCTATTTATAAAC
ACATGTCTTGCTTGTGTTAAACTCTCATACAAATGTTTTCTAGGTGCTAGATACCTAGTTAACCCAATTA
TAGTGTACTACAGCAAGCCCAATCCTACTCCAGAGGAAGAGTTTGTTAAAATACACCAATTTCCAAGAAA
TAACTATGTCTGACGCCCAAGAGTGGCAGGTTATTGTTTTTATTATTATTATTTGGGCTCTTGGAGTTAT
TCTCCAAGGTGGCTATGCTACTAGAGCCCGCTTAATTTACATTATCAAATTAATATTACTTTGGCTACTC
CAGCCTTTTACCCTTGTTGTGACCATTTGGTCAGCTGTAGACAATGGTAATAACAAAACTGGAGCAGTTT
TTATCATCTCTATCATATTTGCAGTGCTTACTTTCCTGTCATGGTTGAGGTACTGGTATGATTCAATAAG
ACTAGTCATCAAGACACATTCTGCCTGGAGCTTTTCACCAGAAAGCAGACTCCTTGCAGGCATTAATGAC
CCTATGGGTAATTGGCGGTGCATTCCAATTGACCATATGGCCCCGATATTAGCTCCAGTCGTTAAACATG
GCAAGCTCAAGCTACATGGGCAAGAGCTGGCTTCTGGGGTCACAGTTTCATCTGTACCTAAGAGTATGAT
AGTTGTGTCACCTTCCGACACATTCCATTATACTCTTAAAAAGACCATTGATACTGACGAGCGAGACTTC
GCAGTCCTTATCTACCAGGGTGACCGTGTATCAAACGCTGGACTACACTCTATAACCACTTCAGATTCAG
GAAACGCACGCCTGTATAAGTATTTATAATGTGCAACTGCCTTTACCAGGTTAAAGCACTTGTTGAATAT
AGCAAAACACATGGAAAAACAGATGTTTTGGAGCTTCTTGACCCACTTGTCAAGACTCGGTGTTTTGCTT
ATACACTCGTGGTATGTATTAATGCTAATCCAGTTGCATTTAGTATATTACCTCGGAAATTACTTATCAA
TGGTGAGCCTCTCCTTATTGAATATGGCAATGTTTATGGAAAGGATTTTATCATTAGACCATCTTTGCAA
GTTATTCTTGAAGAAGAATGTTAATTTGACACCAAACCAATATGAGTGCTCCGGTTGTTCCCACAACTGA
CGCATCGTGGTTTCAGGTTCTCAAAGCTCAAAATAAAAAGGCTATTCATCCTCAATTTCGCGGTGATGGA
GTTCCGCTTAACTCTGCCATCAAACCTCAAGAAAACCATGGCTATTGGCTACGTTACAACAGACAAAAGC
CAGGTGGTGCTGCAATTCCTCCATCCTATGCCTTCTATTATACAGGCACAGGTCCGAGAGGAAACCTTAA
ATTTGGTGAGTACCCTCCTAATGATTCCAAGGATACGTCCCGTATTACTTGGGTCAAAGCAAAGGGAGCT
GACACTTCTATTAAACCTCATGTTGCCAAACGCAACCCCAACAACCCTAAACATGCACTGCTCCCTCTCC
GATTTCCATCAGGAGATGGTCCAGCTGCAGGTTTCAGAGTTGATCCCTTTAACACCAGAGGGCGCCAACT
CGAGCGTGCACCAGGTCCCAGATCTATGTCCATGGACACAAGACCAGCTGCTAACCAACCAAGAAAGCGC
GACCAGTCTGCACCAGCAGCCGTTCGACGCAAAACACAACACCAGGCTCCTAAGAGAACTTTGCAGAAAG
GTAAAACCATTTCTCAAGTCTTTGGACATCGTTCTCGCACCGGTGCCAATGTTGGTTCAGCTGATACTGA
GAAATCAGGAATGGCAGACCCCAGAATTATGGCTCTTGCACGTTATGTGCCAGGTGTCCAGGAAATGTTG
TTTGCAGGTCATGTTGATAGTCAATTCCAAGTGAATGACATCACCTTGACCTTCACTTATTCAATTACCG
TTAAGGAGAATTCTCCTGACTATATCAGAATTAAAGATGCTCTTAGTACTGTTGTCAATCAGACCTATGA
GCCTCCAACAAAACCTAAAAAGGAGAAAAAGCCAGTTGAGCAAGCTTCTAAGAATAACCAGCAGAAAAAG
AAACCAGCAAAGCAGGAAACTGCCAAACCTGATAACTCTGCTGACTTAGAGTGGGATGATGCTTTTGAAA
TAAAGCAAGATTCTTCTGCATAGACACCCAAACCTTTAAAATTTCCAGGCCGTTATGGCAGAGAAACGAA
CTAAATTGACTTACCCTCTTGGAGGGTCTCATGAAACCTATGTGCCTAGTTCGTGTTGTAACAGTATTGA
ACCCTGTTACATATCAACTATGCATCCATACCAACCCTATATTTCTGAGTCTTTTAAACTTATTCTTGAG
GAGATTGCTGAATGTGGTAACACTCAGTCACCACATGCATTTCTCTATTACCAAGAACCTGGTTTGAAAA
TTTGGAAAATTCATTGGCAAAGAGGTACTGACTGTGGTCCTGGCCACTGCATTACTGTCTTTCAGAATAA
AGAAAAGGGTTCTGTTAATTGGGAGGAGCAAGATTTTACTTCTCATTCTGTTTTCACAATTCCTCTTCCT
GAATAAATTTCATGGGCACCAGTCAATCTAGTGTTAGTGTAAATAATCAAATTACTAATATACATGCTTC
TGAGCATTCAAGTGTTCAGACATCAAATTCCAATACCTCAGAGATACAAGCTCTACTTCAGCAGGGTTTA
CCCTATTTGGTGATTTTGCTTAGTATTTTGTTGTTATTGCAATCAGCATTTATTATTCATTTATTACGGC
GTGTCAGAAGGCTAAAATCTAGACTTTTTGCTGCTGCACCCCTACTAACTTAAGAACATGATTAGTATTG
GTTATTATGTTATAACTGGTCTAACTATGTTCTTTTGGAATGTTCGAGACCCTTTATTATGCAGAACTTC
TTGGTCCACTTATTGACATTGAAGTTCTTGGTTTTGTAACATTTATACACTATTTCTGGCACTACCGTCC
ACGTAGATGCCAGCATGTTATACCGCAAGAGAGCCAGTCAGAGGGCGCTATCATGCAAACTAGGGCTGGC
TACTCTTGCACAGAATCACATCTCGATAAGTGTCAGTGCAAGAAGGACACTTATACCATTTAATATGCCG
AGGCCACGCGGAGTACGATCGAGGGTACAGCATAATCTCAACTTTTGTTGAAACTCATTTATAATACTAT
ATGGAGAAAGTTAAAGGACTGTACTACTTTGTAGGTGTAGCAGTCGCCCAGTGGGAAAGCGCCATATAGA
TTACAAATGAGTGGGGAACAAATTAGGGGAAATTAAATTGGCTTATAAGGGGGATGGAGCAAAAAAAAAA
AAAAAA

>gi|85667876|ref|NC_006577.2| Human coronavirus HKU1, complete genome
GAGTTTGAGCGATTGACGTTCGTACCGTCTATCAGCTTACGATCTCTTGTCAGATCTCATTAAATCTAAA
CTTTTTAAACAAGATTCCCTGTTATCCATGCTTGTGAGTGTGGTTTAATCATAATCTTGTATTTTACTTT
CCACACTTTTCATCTCTCTGCCAGTGACGTGTTGGTTGTCCTCAGCGTCCCTCCCATAGGTCGCAATGAT
TAAAACCAGCAAATACGGTCTCGGCTTCAAGTGGGCGCCAGAATTTCGTTGGCTGCTTCCGGATGCAGCG
GAGGAGTTGGCTAGTCCTATGAAGTCAGATGAGGGTGGGTTATGCCCCTCTACTGGTCAAGCGATGGAAA
GTGTTGGATTCGTTTATGATAATCATGTGAAGATAGATTGTCGCTGCATTCTTGGACAAGAATGGCATGT
GCAGTCAAATCTTATCCGTGATATTTTTGTTCATGAAGATCTACATGTTGTAGAAGTTCTAACTAAAACA
GCCGTAAAGTCCGGTACGGCAATTTTAATTAAATCACCTTTGCATAGCTTGGGTGGTTTTCCTAAAGGGT
ATGTTATGGGCTTGTTCCGTTCATACAAGACTAAACGTTATGTTGTACATCATCTTTCTATGACTACATC
TACTACTAATTTTGGTGAAGATTTTTTGGGTTGGATTGTACCTTTTGGTTTTATGCCATCTTATGTTCAC
AAATGGTTTCAATTCTGTAGGTTGTATATTGAAGAGAGTGATTTAATAATTTCAAATTTTAAATTTGATG
ATTATGATTTTAGTGTAGAAGATGCTTATGCTGAGGTTCATGCTGAGCCTAAAGGTAAATATTCACAAAA
AGCTTATGCTTTACTTAGACAATATCGTGGTATTAAACCCGTACTTTTTGTAGACCAGTATGGTTGTGAC
TATTCTGGTAAATTAGCAGATTGTCTTCAAGCTTATGGTCATTATTCTTTGCAAGATATGAGACAAAAGC
AGTCTGTATGGCTTGCCAATTGTGACTTTGATATTGTAGTGGCTTGGCATGTAGTTCGTGATTCACGATT
TGTTATGCGCCTGCAGACTATAGCTACTATTTGTGGTATTAAATATGTTGCACAACCTACAGAAGATGTA
GTAGATGGAGATGTAGTTATACGTGAACCTGTACATTTATTATCTGCTGATGCAATAGTTTTAAAGCTTC
CTAGTTTGATGAAAGTTATGACTCATATGGATGATTTTTCTATTAAATCTATATATAATGTTGATTTGTG
TGATTGTGGTTTTGTTATGCAGTATGGTTATGTAGATTGTTTTAATGATAATTGTGATTTTTATGGTTGG
GTTTCAGGTAATATGATGGATGGTTTTTCTTGTCCATTGTGTTGTACAGTTTATGACTCTAGCGAAGTTA
AAGCCCAATCATCTGGTGTTATTCCTGAAAATCCTGTGTTATTTACTAATAGTACTGATACTGTTAACCA
TGATTCTTTTAATTTGTATGGTTATTCTGTCACACCATTTGGTTCTTGTATATATTGGTCGCCGCGTCCT
GGATTGTGGATTCCTATAATTAAATCTTCAGTCAAGTCTTATGATGATTTGGTTTATTCAGGTGTAGTAG
GTTGTAAATCTATTGTTAAAGAAACTGCTCTTATTACTCATGCACTTTACTTAGATTATGTTCAATGTAA
GTGTGGTAATCTTGAACAAAATCATATTCTTGGCGTTAATAATTCTTGGTGTAGGCAACTGTTGCTTAAT
AGAGGTGATTATAATATGCTTCTAAAAAATATTGACTTGTTTGTTAAGCGTCGTGCTGATTTTGCTTGCA
AGTTTGCAGTTTGTGGAGATGGTTTTGTACCTTTTTTACTAGATGGTTTAATTCCCCGTAGTTATTATCT
AATTCAGAGTGGTATTTTCTTTACATCTTTGATGTCTCAATTTTCACAAGAAGTTTCTGATATGTGTTTA
AAAATGTGTATTTTGTTTATGGACAGAGTTTCAGTTGCTACATTTTATATAGAGCATTATGTTAATAGGT
TGGTTACTCAATTTAAGTTATTGGGTACTACACTTGTTAATAAAATGGTTAATTGGTTTAATACCATGTT
AGATGCTAGTGCACCTGCTACAGGCTGGCTTCTTTACCAATTATTGAATGGTCTTTTTGTAGTATCTCAA
GCCAACTTTAATTTTGTTGCTTTAATACCTGATTATGCTAAAATTTTAGTTAATAAATTTTACACTTTTT
TTAAGTTATTATTAGAGTGTGTTACAGTTGATGTTTTAAAAGATATGCCTGTTCTTAAAACTATTAATGG
TTTAGTTTGTATTGTAGGCAATAAGTTTTATAACGTTAGTACAGGGTTAATTCCTGGTTTTGTTTTACCA
TGTAATGCACAGGAACAACAAATTTATTTTTTTGAAGGCGTTGCAGAATCTGTTATAGTAGAAGATGATG
TTATTGAGAATGTCAAATCTTCTTTATCATCTTATGAGTATTGTCAACCACCTAAATCTGTAGAAAAAAT
TTGTATTATAGATAATATGTACATGGGTAAGTGTGGTGATAAATTTTTCCCTATTGTCATGAATGATAAA
AATATTTGTCTTTTAGATCAGGCTTGGCGTTTTCCATGTGCAGGTAGAAAAGTTAATTTTAACGAGAAAC
CTGTTGTTATGGAGATTCCGTCTTTGATGACAGTTAAGGTTATGTTTGATTTAGATTCTACTTTTGATGA
TATTTTAGGTAAAGTTTGTTCAGAATTTGAAGTAGAAAAGGGTGTTACTGTAGATGATTTTGTTGCTGTT
GTTTGTGATGCTATAGAGAATGCTTTAAACTCTTGTAAAGAGCATCCAGTGGTTGGTTATCAAGTTCGTG
CATTTTTAAATAAACTTAATGAGAATGTTGTTTATTTATTTGATGAGGCTGGTGATGAAGCAATGGCCTC
TCGTATGTATTGTACTTTTGCTATTGAGGATGTTGAAGACGTTATCAGTAGTGAAGCTGTCGAAGATACT
ATTGATGGTGTCGTTGAAGACACTATTAATGACGATGAAGATGTTGTTACTGGTGACAATGACGATGAAG
ATGTTGTTACTGGTGACAATGACGATGAAGATGTTGTTACTGGTGACAATGACGATGAAGATGTTGTTAC
TGGTGACAATGACGATGAAGATGTTGTTACTGGTGACAATGACGATGAAGATGTTGTTACTGGTGACAAT
GACGATGAAGATGTTGTTACTGGTGACAATGACGATGAAGATGTTGTTACTGGTGACAATGACGATGAAG
ATGTTGTTACTGGTGACAATGACGATGAAGATGTTGTTACTGGTGACAATGACGATGAAGATGTTGTTAC
TGGTGACAATGACGATGAAGATGTTGTTACTGGTGACAATGACGATGAAGATGTTGTTACTGGTGACAAT
GACGATGAAGATGTTGTTACTGGTGACAATAACGATGAAGAGATTGTTACTGGTGACAATGATGACCAAA
TTGTTGTTACTGGTGATGATGTAGATGATATTGAAAGTATTTATGACTTTGATACTTATAAAGCTCTTTT
AGTTTTTAATGATGTCTATAATGATGCTTTGTTTGTTAGTTATGGTTCTAGTGTTGAAACAGAAACATAT
TTTAAAGTTAATGGTTTATGGTCACCTACTATTACACATACTAATTGTTGGTTGCGTTCTGTGTTACTTG
TAATGCAGAAATTACCTTTTAAGTTTAAGGATTTAGCTATTGAAAATATGTGGTTATCTTATAAGGTGGG
TTATAATCAAAGTTTTGTTGATTATTTACTGACCACTATTCCTAAAGCTATTGTTTTGCCTCAAGGTGGT
TTTGTAGCTGATTTTGCTTATTGGTTTTTAAACCAGTTTGATATTAATGCGTATGCTAATTGGTGTTGTT
TAAAATGTGGTTTTTCTTTTGATTTAAATGGTTTGGATGCTTTGTTTTTTTATGGAGATATTGTGTCTCA
TGTTTGTAAGTGTGGACATAATATGACTCTAATAGCAGCGGACTTACCTTGTACATTACATTTTTCATTA
TTTGATGACAATTTTTGTGCTTTTTGCACCCCTAAAAAAATTTTTATTGCTGCATGTGCTGTGGATGTAA
ACGTTTGTCATTCTGTAGCTGTTATAGGTGATGAACAAATAGATGGTAAGTTTGTTACTAAATTTAGTGG
TGATAAATTTGATTTTATAGTAGGTTATGGAATGTCATTTAGTATGTCTTCTTTTGAGTTACCTCAATTG
TATGGTTTGTGTATAACACCTAATGTATGTTTTGTTAAAGGTGATATTATAAATGTTGCTAGACTTGTTA
AAGCTGATGTTATTGTTAATCCTGCTAATGGGCATATGCTCCATGGTGGTGGAGTTGCAAAAGCTATAGC
TGTAGCTGCAGGTAAAAAATTTTCTAAAGAAACTGCTGCTATGGTTAAATCTAAAGGTGTTTGCCAAGTA
GGAGATTGTTATGTTTCTACCGGTGGTAAATTATGTAAAACAATTCTTAATATTGTAGGCCCTGATGCTA
GACAAGATGGAAGACAATCTTATGTTTTGTTAGCACGTGCTTATAAGCATCTTAATAATTATGATTGTTG
TTTGTCTACTCTCATATCGGCTGGTATATTTAGTGTTCCTGCTGATGTGTCATTAACTTACCTTCTAGGT
GTTGTTGATAAACAAGTTATCCTTGTTAGTAATAATAAAGAAGATTTTGATATTATTCAAAAATGTCAAA
TTACTTCAGTTGTTGGTACTAAAGCATTGGCTGTTAGATTAACTGCTAATGTAGGCCGTGTTATTAAATT
TGAGACAGATGCATACAAACTTTTTTTGAGTGGTGATGATTGTTTTGTTTCAAATTCTTCTGTTATACAA
GAAGTTTTATTGCTTCGTCATGATATACAATTGAATAATGACGTTCGTGATTATTTGTTGTCTAAGATGA
CTAGTCTTCCTAAAGATTGGCGTCTTATCAATAAATTTGATGTTATTAACGGTGTTAAAACTGTTAAGTA
TTTTGAGTGTCCTAATTCTATTTATATATGTAGTCAGGGTAAAGACTTTGGTTATGTATGTGATGGTTCT
TTTTATAAAGCAACTGTTAATCAAGTTTGTGTTTTATTAGCTAAGAAGATAGATGTTTTGCTTACTGTAG
ATGGTGTTAATTTTAAATCTATTTCTCTTACTGTAGGTGAAGTTTTTGGTAAAATACTTGGTAATGTTTT
CTGTGATGGCATTGATGTTACTAAGTTAAAGTGTAGTGATTTTTATGCCGATAAAATTTTATATCAGTAT
GAAAATTTGTCTTTAGCTGATATTTCTGCTGTACAAAGTTCATTTGGGTTTGATCAGCAACAATTGCTTG
CTTATTATAATTTTTTAACAGTATGTAAATGGTCTGTAGTTGTTAACGGTCCATTTTTTTCTTTTGAACA
GTCTCATAATAATTGTTATGTGAATGTAGCTTGTCTTATGTTGCAGCATATTAATCTTAAATTTAATAAA
TGGCAGTGGCAGGAAGCATGGTATGAATTTCGTGCTGGCAGACCACATAGGTTAGTTGCTCTTGTTTTAG
CTAAAGGTCATTTTAAATTTGATGAACCATCAGATGCTACTGATTTTATTCGTGTTGTTTTGAAACAAGC
TGATTTATCAGGTGCAATTTGTGAATTAGAACTTATTTGTGATTGTGGTATTAAACAAGAAAGTCGTGTT
GGTGTTGATGCTGTTATGCATTTTGGTACATTAGCAAAGACTGATCTTTTTAATGGTTATAAGATTGGCT
GTAATTGTGCAGGTAGAATTGTCCATTGTACTAAATTGAATGTACCATTTTTGATTTGTTCTAATACTCC
TCTGAGTAAGGATTTACCTGATGATGTTGTTGCAGCTAACATGTTTATGGGTGTAGGTGTAGGCCATTAT
ACACATTTGAAATGTGGTTCACCTTACCAACATTATGATGCTTGTAGTGTTAAAAAATATACAGGTGTTA
GTGGTTGTTTAACTGACTGCTTGTATCTTAAAAATTTAACCCAGACTTTTACATCTATGTTGACTAATTA
TTTTTTGGATGATGTTGAAATGGTTGCTTATAACCCTGATCTTTCACAATATTATTGTGATAATGGTAAG
TATTATACAAAACCTATTATAAAGGCTCAGTTTAAACCATTTGCTAAAGTTGACGGTGTTTATACTAACT
TTAAGTTAGTTGGACATGATATTTGTGCTCAATTGAATGATAAGTTAGGTTTTAATGTAGATTTGCCGTT
TGTTGAGTACAAAGTAACAGTCTGGCCTGTAGCTACTGGTGATGTTGTTTTGGCATCTGATGATTTATAT
GTGAAACGTTATTTTAAAGGATGTGAAACTTTTGGTAAGCCTGTTATTTGGTTTTGTCATGATGAAGCAT
CATTGAATTCTCTTACTTATTTTAATAAACCTAGTTTTAAATCTGAAAATAGATATAGTGTTTTGTCTGT
TGATTCTGTATCTGAGGAGTCACAAGGTAATGTGGTTACTTCTGTTATGGAATCGCAGATTAGTACTAAA
GAGGTTAAGTTAAAGGGTGTTAGAAAGACTGTTAAAATAGAAGATGCTATTATTGTTAATGATGAAAATA
GTTCTATTAAGGTTGTTAAAAGTTTATCTTTAGTTGATGTTTGGGATATGTATTTGACAGGTTGTGATTA
TGTTGTTTGGGTTGCTAATGAATTGTCACGCCTAGTTAAATCACCAACAGTTAGGGAATATATACGATAT
GGTATTAAACCTATTACTATACCTATAGATTTGTTATGTTTAAGAGATGATAATCAAACTCTTTTAGTTC
CTAAAATTTTTAAAGCAAGAGCTATAGAATTTTATGGTTTTTTGAAGTGGTTGTTTATTTATGTTTTTAG
TTTATTACATTTTACAAATGATAAAACCATTTTTTATACTACAGAAATAGCTTCTAAGTTTACTTTTAAT
TTGTTTTGTTTGGCTCTTAAAAATGCTTTTCAGACATTTAGATGGAGTATATTTATAAAAGGTTTTCTTG
TTGTAGCCACTGTGTTTTTGTTTTGGTTTAATTTTTTGTATATAAATGTTATTTTTAGTGACTTTTATCT
TCCTAATATTAGTGTTTTTCCTATTTTTGTGGGAAGAATTGTTATGTGGATAAAGGCTACTTTTGGTTTG
GTTACAATTTGTGATTTTTATTCTAAGTTAGGTGTAGGTTTTACAAGTCATTTTTGTAATGGTAGTTTTA
TATGTGAATTGTGTCATTCTGGTTTTGATATGTTGGATACATATGCAGCTATAGATTTTGTTCAGTATGA
AGTAGATAGACGTGTTTTATTTGATTATGTTAGTTTAGTCAAATTAATTGTTGAACTCGTTATTGGTTAT
TCATTATACACAGTATGGTTTTATCCATTATTTTGTCTTATTGGTTTACAATTATTTACTACATGGTTGC
CTGATTTGTTTATGTTAGAAACTATGCATTGGTTGATTAGATTTATTGTATTTGTAGCTAATATGTTACC
TGCTTTTGTCTTGTTGCGGTTTTATATAGTTGTTACTGCTATGTATAAAGTAGTTGGTTTTATTAGGCAT
ATTGTCTATGGTTGTAATAAAGCTGGTTGTTTATTTTGTTATAAACGAAATTGTAGTGTTCGTGTTAAGT
GTAGTACTATTGTTGGTGGTGTAATTCGTTATTATGATATTACTGCTAATGGTGGTACTGGTTTTTGTGT
TAAACATCAATGGAATTGTTTTAATTGCCATTCTTTTAAACCAGGTAACACTTTTATAACTGTAGAAGCT
GCTATAGAACTTTCTAAAGAGCTTAAACGACCTGTAAATCCAACTGATGCTTCACATTATGTAGTTACTG
ATATTAAGCAAGTTGGTTGTATGATGCGTTTGTTCTATGATAGAGATGGACAGCGTGTTTACGATGATGT
TGATGCTAGTTTATTTGTAGATATTAATAATCTGTTACATTCTAAAGTTAAAGTTGTTCCTAATTTGTAT
GTAGTTGTAGTAGAGAGTGATGCTGATAGAGCTAATTTTCTGAATGCTGTTGTGTTTTATGCACAATCAT
TGTATAGGCCTATATTACTTGTAGACAAAAAGTTAATTACTACAGCTTGTAATGGTATCTCTGTAACCCA
GACTATGTTTGATGTTTATGTTGATACTTTTATGTCTCATTTTGATGTTGATAGAAAGAGTTTTAATAAT
TTTGTTAACATTGCTCATGCTTCTCTTAGAGAGGGTGTGCAATTAGAAAAGGTTTTAGATACTTTTGTGG
GATGTGTACGTAAATGTTGTTCCATTGATTCAGATGTTGAAACAAGATTTATTACTAAATCTATGATATC
TGCAGTAGCTGCTGGTTTGGAATTTACTGATGAAAATTATAACAATTTGGTACCTACATATTTAAAGAGT
GATAATATTGTAGCTGCTGATTTAGGTGTTCTTATACAGAATGGTGCTAAGCATGTACAGGGTAATGTTG
CTAAGGCAGCTAATATTTCTTGTATATGGTTTATTGATGCTTTTAATCAACTTACTGCTGATTTACAGCA
TAAATTAAAAAAAGCATGTGTTAAAACTGGCTTGAAGTTAAAATTGACTTTTAATAAGCAAGAGGCAAGT
GTCCCTATTCTTACAACACCCTTTTCACTTAAAGGAGGTGTTGTATTGAGTAATTTGTTATATATATTAT
TTTTTGTTAGTTTAATCTGTTTTATATTATTGTGGGCTTTATTGCCTACATATAGTGTTTATAAGTCTGA
TATTCATTTGCCTGCTTATGCTAGTTTTAAAGTTATTGATAATGGTGTTGTTAGAGATATTTCAGTTAAT
GATTTATGTTTTGCTAATAAATTTTTCCAATTTGATCAATGGTATGAGTCCACTTTTGGGTCTGTTTACT
ATCATAATTCTATGGATTGCCCTATTGTAGTGGCAGTTATGGATGAAGATATCGGTTCTACTATGTTTAA
TGTTCCTACTAAAGTTTTGAGACATGGCTTTCATGTTTTACATTTTTTAACTTATGCATTTGCTAGTGAT
AGTGTTCAGTGCTATACACCACATATTCAGATTTCTTATAATGATTTTTATGCTAGTGGTTGTGTTTTAT
CATCTTTGTGTACTATGTTTAAAAGAGGTGATGGTACACCACATCCTTATTGTTATTCAGATGGTGTTAT
GAAGAATGCTTCTTTGTATACATCTTTGGTTCCACATACACGTTATAGCCTTGCTAATTCTAATGGTTTT
ATAAGATTTCCTGATGTTATTAGTGAAGGTATTGTACGTATTGTAAGAACGCGCTCTATGACTTATTGTA
GAGTGGGTGCATGTGAATACGCCGAAGAGGGTATATGTTTTAATTTTAATAGTTCCTGGGTTTTGAATAA
TGATTATTATAGAAGTATGCCTGGAACTTTTTGTGGTAGAGATCTTTTTGATTTGTTTTATCAATTTTTT
AGTAGTTTAATTCGTCCTATAGATTTCTTTTCTCTTACTGCTAGTTCTATTTTTGGAGCTATATTGGCTA
TAGTTGTTGTCTTGGTTTTTTATTATTTAATAAAACTTAAGCGTGCTTTTGGAGATTATACTAGTGTTGT
AGTTATAAATGTTGTTGTTTGGTGTATTAATTTTCTTATGCTTTTTGTTTTTCAAGTTTATCCTATTTGT
GCATGTGTTTATGCTTGTTTTTATTTTTATGTAACATTGTATTTTCCTTCTGAAATTAGTGTAATTATGC
ATTTGCAATGGATTGTTATGTATGGTGCTATAATGCCTTTTTGGTTTTGTGTCACATATGTAGCTATGGT
TATTGCAAACCATGTTTTATGGTTATTTTCATATTGTAGGAAAATTGGTGTTAATGTATGTAGTGATAGT
ACATTTGAAGAAACATCTCTTACTACTTTTATGATTACTAAAGATTCTTATTGTAGATTAAAGAATTCTG
TTTCTGATGTTGCCTACAATAGATATTTGAGTTTGTATAATAAGTATCGTTACTATAGTGGTAAAATGGA
TACTGCTGCCTATAGAGAAGCGGCGTGTTCTCAGTTAGCTAAAGCTATGGAAACATTTAATCACAATAAT
GGTAATGATGTCTTATACCAACCTCCTACAGCATCTGTTTCTACATCTTTTTTGCAATCAGGTATTGTAA
AGATGGTATCTCCTACGTCAAAAATTGAACCTTGTATTGTTAGTGTTACTTATGGTAGTATGACTTTGAA
TGGTTTATGGTTAGATGACAAAGTTTATTGTCCTCGTCATGTTATATGTTCATCCTCTAATATGAACGAA
CCTGATTATTCTGCCTTATTGTGTAGAGTTACTCTAGGTGATTTTACTATAATGTCTGGTCGGATGAGTT
TAACAGTTGTGTCTTACCAGATGCAGGGCTGTCAACTTGTTTTGACAGTCTCTTTACAAAATCCTTACAC
TCCAAAATATACTTTTGGTAATGTTAAACCTGGTGAAACTTTTACTGTTTTAGCTGCGTATAATGGCCGA
CCACAAGGGGCATTTCATGTTACTATGCGTAGTAGTTATACTATTAAAGGTTCTTTTTTGTGTGGGTCAT
GTGGATCTGTTGGTTATGTATTAACAGGTGATAGTGTTAAGTTTGTATATATGCATCAATTAGAGCTCAG
TACTGGTTGTCACACTGGCACTGATTTTACTGGTAATTTTTATGGTCCATATAGAGATGCTCAAGTTGTA
CAGTTGCCAGTTAAGGACTACGTCCAGACTGTTAATGTTATTGCTTGGCTCTATGCAGCTATACTTAATA
ATTGTGCTTGGTTTGTACAAAATGATGTTTGTTCTACTGAAGATTTTAATGTTTGGGCTATGGCAAATGG
TTTTAGCCAAGTAAAAGCAGATCTTGTCTTAGATGCTTTGGCTTCAATGACAGGTGTTTCTATTGAAACT
TTATTGGCTGCTATTAAGCGTCTATATATGGGATTTCAAGGTCGTCAAATACTAGGAAGTTGTACTTTTG
AAGATGAATTGGCACCTTCTGACGTTTATCAACAATTGGCTGGTGTTAAATTGCAATCTAAAACAAAAAG
ATTTATTAAAGAAACAATTTATTGGATTTTGATATCTACATTTTTGTTTAGTTGTATAATTTCTGCATTT
GTTAAATGGACTATATTTATGTATATTAATACACATATGATTGGTGTTACATTATGTGTACTTTGTTTTG
TTAGTTTTATGATGTTACTAGTTAAACATAAGCATTTTTATTTGACTATGTATATAATTCCTGTACTCTG
TACCTTGTTTTATGTAAATTATTTAGTTGTTTATAAGGAAGGTTTTAGAGGTTTTACTTATGTCTGGCTC
TCATATTTTGTTCCTGCTGTGAATTTTACTTATGTTTATGAAGTATTTTATGGTTGTATTTTATGTGTTT
TTGCTATTTTTATAACTATGCATAGTATTAATCATGACATTTTTTCTTTGATGTTTTTGGTTGGTAGAAT
AGTTACTTTAATTTCTATGTGGTATTTTGGGTCGAATTTAGAAGAGGATGTTTTGTTATTTATTACAGCC
TTTTTAGGTACTTATACATGGACCACTATTTTGTCATTAGCTATAGCAAAAATTGTTGCTAATTGGTTGT
CTGTTAATATATTTTATTTTACAGATGTACCTTATATTAAATTGATTCTCTTGAGTTACTTATTTATAGG
GTATATTTTATCTTGTTATTGGGGATTTTTCTCTCTTTTAAACAGTGTTTTTAGAATGCCTATGGGTGTT
TATAATTATAAAATTTCTGTTCAAGAATTGCGTTATATGAATGCTAATGGCTTACGTCCACCTCGTAATA
GTTTTGAGGCTATTTTGTTAAATTTAAAACTGCTTGGAATAGGTGGCGTGCCAGTTATTGAAGTCTCCCA
AATTCAATCAAAATTGACTGATGTGAAATGTGCTAATGTTGTTTTGTTAAATTGTTTACAGCATTTGCAT
GTTGCTTCTAATTCTAAGTTGTGGCAGTATTGTAGTGTTTTACATAATGAAATACTATCTACTTCAGATT
TGAGTGTAGCTTTTGATAAGCTTGCTCAATTATTGATTGTTTTATTCGCCAATCCTGCTGCAGTTGATAC
TAAGTGTCTTGCAAGTATAGATGAAGTTAGCGATGATTATGTTCAAGATAGTACCGTTTTGCAGGCTTTG
CAAAGTGAGTTTGTAAATATGGCTAGTTTTGTTGAATATGAAGTCGCAAAGAAAAATTTGGCTGATGCTA
AAAATAGTGGTTCTGTTAATCAACAACAGATAAAACAGTTAGAAAAAGCATGTAATATAGCTAAGTCTGT
GTATGAACGTGATAAAGCTGTAGCTCGCAAACTTGAACGTATGGCAGACCTAGCACTTACTAACATGTAT
AAAGAGGCTCGGATTAATGATAAGAAGAGTAAAGTTGTTTCCGCTTTGCAGACAATGCTTTTTAGCATGG
TTCGTAAATTGGATAATCAGGCTTTAAATTCTATTCTGGATAATGCTGTTAAAGGTTGTGTACCTTTGAG
TGCTATTCCAGCATTGGCTGCTAATACTTTAACTATAGTAATACCAGATAAACAAGTTTTTGATAAAGTT
GTTGATAATGTTTATGTTACATATGCTGGTAGTGTATGGCATATACAGACTGTTCAAGATGCTGATGGTA
TTAATAAACAGTTAACTGATATTAGTGTTGATTCTAATTGGCCTCTTGTTATCATTGCGAACAGGTATAA
TGAAGTTGCTAATGCTGTTATGCAGAATAATGAGTTGATGCCTCATAAATTAAAAATACAAGTTGTTAAT
AGTGGTTCTGATATGAATTGTAATATTCCTACTCAATGTTATTATAATAATGGTAGTAGTGGTAGAATAG
TTTATGCTGTTCTTAGTGATGTTGATGGTCTTAAGTATACTAAGATAATGAAAGATGATGGAAATTGTGT
TGTTTTAGAGCTTGATCCTCCTTGTAAATTTTCTATACAAGATGTTAAGGGACTTAAAATTAAGTATCTT
TATTTTATTAAAGGATGTAACACTTTAGCTAGAGGGTGGGTTGTTGGTACTTTATCTTCAACAATTAGAT
TGCAGGCTGGTGTTGCTACTGAGTATGCAGCTAATTCTTCTATACTTTCATTATGTGCATTTTCTGTAGA
TCCTAAGAAAACTTATTTAGATTATATACAACAAGGTGGTGTACCTATAATTAATTGTGTTAAAATGCTC
TGTGATCATGCTGGTACTGGTATGGCCATTACTATTAAACCTGAGGCTACTATTAACCAAGATTCTTATG
GTGGTGCCTCAGTTTGTATTTATTGCCGTGCACGTGTAGAGCATCCAGATGTAGATGGTATATGTAAATT
ACGTGGTAAATTTGTACAAGTCCCTTTGGGTATAAAAGATCCTATTCTTTATGTGTTAACACATGATGTT
TGTCAAGTCTGTGGTTTTTGGAGAGATGGCAGTTGTTCCTGTGTAGGTTCAAGTGTCGCTGTTCAATCTA
AAGATTTAAATTTTTTAAACGGGTTCGGGGTACTAGTGTGAATGCCCGGCTAGTACCCTGTGCTAGTGGT
TTATCTACTGATGTTCAATTAAGGGCATTTGACATTTGTAATACCAATAGAGCTGGTATAGGTTTATATT
ATAAAGTGAATTGTTGCCGTTTTCAGCGTATAGATGACGACGGTAATAAATTGGATAAGTTCTTTGTTGT
CAAAAGAACTAATTTAGAAGTTTATAATAAAGAGAAAACTTATTATGAGTTGACTAAAAGTTGTGGTGTT
GTGGCTGAACATGATTTCTTTACATTTGATATTGATGGTAGTCGCGTGCCACATATAGTTCGTAGGAATC
TTTCAAAGTATACTATGTTAGATCTTTGCTATGCATTGCGTCATTTTGATCGTAATGATTGTTCAATATT
GTGTGAAATTCTTTGTGAGTATGCTGATTGTAAAGAATCCTACTTTTCTAAGAAAGATTGGTATGATTTT
GTTGAAAATCCTGATATTATTAATATATATAAAAAATTAGGCCCTATTTTTAATAGAGCTTTACTTAATA
CTGTCATTTTTGCAGACACCTTAGTTGAAGTAGGTTTAGTTGGTGTTTTAACTTTAGATAACCAAGATTT
GTATGGTCAATGGTATGATTTTGGTGATTTTATACAAACAGCCCCAGGGTTTGGTGTGGCAGTTGCAGAT
TCTTACTATTCTTATATGATGCCTATGTTGACTATGTGTCATGTATTAGATTGTGAATTATTTGTTAATG
ATAGTTATAGACAATTCGATCTTGTACAGTATGATTTTACTGATTACAAGTTAGAGTTGTTTAATAAGTA
TTTTAAGTATTGGGGTATGAAGTATCATCCTAATACTGTGGATTGTGATAATGATAGGTGTATTATTCAT
TGTGCTAATTTTAATATACTATTTAGTATGGTTTTACCTAATACTTGTTTTGGTCCCCTTGTTAGACAAA
TTTTTGTAGATGGTGTACCGTTTGTTGTTTCTATTGGTTACCATTACAAAGAGTTAGGTGTAGTTATGAA
CTTAGATGTTGACACACACCGTTATCGTTTGTCTCTTAAAGATTTACTTCTTTATGCAGCAGATCCTGCT
ATGCACGTTGCATCTGCTAGTGCTCTGCTTGATTTACGAACTTGTTGTTTTAGTGTAGCTGCCATTACAA
GTGGTATAAAATTTCAAACTGTAAAACCAGGTAACTTTAACCAAGACTTTTACGAGTTTGTTAAAAGTAA
AGGCTTGTTTAAAGAGGGTAGTACAGTTGATTTGAAACATTTTTTCTTTACTCAAGATGGTAATGCTGCA
ATTACTGATTATAATTATTATAAGTATAATTTACCTACTATGGTTGATATTAAGCAGTTATTGTTTGTAT
TAGAAGTTGTTTATAAATATTTTGAAATTTATGATGGTGGTTGTATACCAGCATCACAAGTTATTGTTAA
TAATTATGATAAAAGTGCTGGTTATCCATTTAATAAATTTGGTAAAGCCAGACTTTATTATGAGGCATTA
TCATTTGAGGAACAGAATGAAATTTATGCATATACTAAACGTAATGTTCTGCCCACCTTAACTCAAATGA
ATTTAAAATATGCTATCAGTGCTAAGAATAGAGCTCGCACTGTAGCAGGTGTTTCTATTCTTAGTACTAT
GACAGGCCGAATGTTCCATCAAAAATGTTTGAAGAGTATAGCAGCTACCCGAGGTGTTCCTGTTGTTATA
GGAACCACTAAATTTTATGGTGGTTGGGACGATATGTTACGTCATCTTATAAAGGATGTTGACAACCCTG
TTCTTATGGGTTGGGATTATCCTAAATGTGATCGTGCTATGCCAAATATTTTGCGTATTGTTAGTAGTTT
AGTTTTGGCCCGCAAACATGAATTTTGTTGTTCACATGGTGATAGATTTTATCGCCTTGCGAATGAATGT
GCTCAAGTTTTGAGTGAAATAGTTATGTGTGGCGGTTGCTATTATGTTAAGCCTGGTGGTACTAGCAGTG
GTGATGCAACTACTGCTTTTGCTAATTCTGTTTTTAATATATGTCAGGCTGTTACTGCTAATGTTTGTTC
TCTTATGGCCTGTAATGGCCATAAGATTGAAGATTTAAGTATACGCAATTTACAAAAACGCTTATACTCT
AATGTTTATCGTACAGATTATGTTGATTATACATTTGTTAATGAGTATTATGAATTTTTATGTAAGCATT
TTAGTATGATGATTTTGAGTGATGATGGTGTTGTCTGTTATAACTCTGATTATGCTAGTAAGGGTTATAT
AGCTAATATAAGTGTTTTTCAACAAGTTTTGTACTATCAGAATAATGTCTTTATGTCTGAATCTAAATGT
TGGGTTGAAAATGATATTACTAATGGTCCTCATGAATTTTGTTCCCAACATACTATGTTAGTTAAGATAG
ATGGTGATTATGTTTATTTACCATATCCAGATCCTTCTAGAATTTTAGGAGCTGGTTGTTTTGTTGATGA
TTTATTGAAGACTGACAGTGTTCTTTTGATAGAGCGCTTTGTAAGTCTAGCTATAGATGCTTACCCTTTA
GTACATCATGAAAATGAAGAATACCAAAAAGTCTTTCGTGTATATTTAGAATATATAAAAAAACTGTATA
ATGATCTTGGTACTCAGATCTTAGATAGTTATAGTGTTATTTTAAGTACTTGTGATGGTTTAAAGTTTAC
TGAAGAATCATTTTACAAGAATATGTATTTAAAAAGTGCCGTGATGCAGAGTGTAGGTGCATGCGTTGTT
TGTTCATCACAAACTTCTTTGCGTTGTGGCAGTTGTATACGTAAGCCTTTGTTATGTTGTAAATGTTGTT
ATGACCATGTTATGGCAACTAATCATAAATATGTTTTGAGTGTCTCACCTTACGTTTGTAATGCACCTAA
CTGTGATGTGAGTGATGTCACCAAATTATATTTGGGCGGTATGTCTTACTATTGTGAAAACCATAAACCC
CATTATTCATTTAAGTTAGTTATGAATGGTATGGTCTTTGGTTTGTATAAACAATCTTGCACGGGTTCAC
CTTATATAGATGATTTTAATAAGATAGCTAGTTGTAAATGGACAGAAGTTGATGATTATGTTCTGGCAAA
TGAGTGTATTGAACGTTTAAAGTTATTTGCTGCAGAAACTCAAAAGGCAACTGAAGAGGCTTTTAAACAA
AGCTATGCTTCTGCTACCATTCAAGAGATTGTTAGTGATAGAGAAGTTATTTTGTGTTGGGAGACAGGTA
AAGTTAAACCACCACTTAATAAAAATTATGTTTTCACAGGCTACCATTTTACTAGTACTGGTAAGACAGT
TTTAGGTGAGTATGTTTTTGATAAAAGTGAATTAACTAACGGTGTGTATTACCGCGCTACAACTACTTAT
AAACTTTCTATAGGTGATGTTTTTGTTTTAACATCACATTCTGTAGCTAGTTTAAGTGCACCTACACTTG
TCCCACAAGAGAACTATGCTAGTATAAGATTTTCTAGTGTTTATAGTGTTCCATTGGTGTTTCAAAATAA
TGTTGCTAATTATCAGCACATTGGAATGAAACGTTATTGCACTGTTCAAGGTCCCCCTGGTACGGGAAAG
TCTCATCTTGCTATAGGTCTAGCTGTTTATTACTACACAGCACGTGTAGTTTATACTGCTGCTAGTCATG
CTGCTGTAGATGCATTGTGTGAAAAAGCTTATAAGTTTTTAAATATTAACGATTGTACACGTATTATTCC
TGCTAAAGTTCGTGTAGATTGTTATGATAAGTTTAAAATTAATGATACCACTTGTAAGTATGTTTTTACC
ACAATAAATGCATTACCAGAGTTGGTTACAGATATTGTTGTTGTTGATGAAGTTAGTATGCTTACTAATT
ATGAATTGTCTGTTATAAATGCTCGTATTAAAGCTAAACATTATGTATATATTGGAGATCCTGCTCAATT
ACCTGCACCACGTGTGCTGTTGAGCAAGGGTTCTTTAGAACCTAGGCACTTCAATTCTATTACTAAAATA
ATGTGTTGTTTAGGTCCTGATATCTTTTTGGGAAATTGTTATAGGTGTCCTAAAGAAATTGTAGAAACTG
TTTCAGCATTGGTTTATGATAATAAACTCAAGGCTAAAAATGATAATAGTTCATTATGTTTTAAAGTATA
TTTTAAGGGACAGACAACACATGAGAGTTCAAGTGCTGTAAATATTCAACAGATATATCTAATTAGTAAA
TTTTTAAAAGCTAATCCAGTTTGGAATAGTGCTGTTTTTATTAGTCCTTATAATAGTCAGAATTATGTTG
CTAAGCGTGTTTTAGGTGTTCAAACACAAACTGTAGATTCTGCTCAAGGTTCGGAATATGATTATGTTAT
ATATTCACAAACAGCAGAAACAGCCCATTCTGTTAATGTTAATCGATTTAATGTTGCCATAACTAGAGCC
AAGAAGGGCATTTTTTGTGTTATGAGTAATATGCAATTATTTGAATCTCTTAATTTTATTACTCTACCTT
TAGATAAAATTCAAAATCAAACTTTACCTCGTTTGCATTGCACAACTAATCTTTTTAAAGATTGTAGTAA
AAGTTGCTTAGGTTATCATCCAGCGCATGCCCCCTCATTTTTAGCAGTTGATGATAAATATAAGGTTAAT
GAAAATTTGGCTGTAAATTTAAATATTTGTGAACCTGTTTTAACATATTCTCGTTTAATATCTCTTATGG
GTTTTAAATTAGATTTGACTCTTGATGGTTATTCTAAATTGTTTATTACTAAAGATGAAGCCATTAAACG
TGTTAGAGGTTGGGTTGGTTTTGATGTTGAGGGCGCTCATGCTACTCGCGAAAACATTGGAACAAACTTT
CCACTGCAAATAGGTTTTTCAACTGGTGTGGATTTTGTAGTTGAAGCTACTGGCTTATTTGCTGAGAGAG
ATTGTTATACTTTTAAAAAAACTGTAGCTAAAGCTCCTCCTGGTGAAAAATTTAAACATTTAATACCCCT
TATGTCAAAAGGTCAAAAGTGGGATATTGTTAGAATTAGAATTGTTCAAATGTTATCTGATTATCTTTTA
GACCTTTCTGATAGTGTAGTATTTATTACTTGGTCTGCCAGTTTTGAACTTACTTGTTTAAGGTATTTTG
CTAAATTAGGCAGAGAGCTTAATTGTAATGTGTGTTCTAATCGTGCTACATGCTACAATTCTAGAACTGG
TTATTATGGTTGTTGGCGCCATAGTTATACTTGTGATTATGTGTATAATCCACTTATTGTAGATATACAA
CAGTGGGGTTATACAGGTTCTTTAACTAGTAATCACGATATAATTTGTAATGTACATAAAGGTGCACATG
TTGCGTCAGCTGATGCAATTATGACTCGTTGTTTAGCAATCTATGATTGTTTTTGTAAATCTGTTAATTG
GAATTTAGAGTATCCAATAATTTCTAATGAGGTCAGTATAAATACATCTTGTAGGTTATTGCAGCGTGTC
ATGCTTAAAGCTGCCATGCTATGTAATAGATACAACTTATGTTATGACATAGGCAATCCTAAAGGTTTAG
CTTGTGTCAAAGATTATGAATTTAAATTTTATGATGCTTTTCCTGTAGCCAAGTCTGTTAAACAGTTATT
TTATGTCTATGATGTGCATAAAGATAATTTTAAAGATGGTTTATGTATGTTTTGGAATTGTAATGTTGAT
AAATATCCATCTAATTCAATTGTTTGTAGATTTGACACTCGAGTGTTAAATAAATTAAACCTTCCTGGAT
GTAATGGTGGTAGTTTGTATGTTAATAAACATGCATTCCATACTAATCCTTTTACTAGAACTGTTTTTGA
AAATCTTAAGCCTATGCCTTTTTTCTATTATTCAGATACGCCTTGTGTGTACGTAGATGGTTTAGAATCT
AAACAAGTTGATTACGTTCCTTTAAGAAGCGCCACTTGTATCACACGGTGTAATCTAGGTGGAGCTGTTT
GTTCAAAGCATGCTGAAGAATATTGTAACTACCTTGAGTCTTATAATATAGTTACTACAGCAGGCTTTAC
TTTTTGGGTTTATAAGAATTTTGATTTTTATAATTTATGGAACACTTTTACTACGTTACAGAGTTTAGAA
AACGTAATATATAACTTGGTTAATGTTGGTCATTATGATGGACGTACAGGTGAATTACCTTGTGCTATTA
TGAATGACAAAGTTGTTGTTAAGATTAATAATGTAGATACTGTTATTTTTAAAAATAATACATCATTTCC
TACTAATATAGCTGTTGAATTGTTTACAAAACGTAGTATCCGGCACCACCCTGAACTTAAGATTCTTAGA
AATTTGAACATTGATATTTGTTGGAAGCATGTCCTGTGGGATTATGTTAAAGATAGTTTGTTTTGTAGTT
CCACTTATGGTGTTTGTAAATACACAGATTTGAAGTTCATCGAAAATTTGAATATACTTTTTGATGGTCG
TGACACTGGCGCTTTAGAAGCTTTTAGAAAAGCAAGAAATGGTGTTTTTATTAGTACTGAAAAATTAAGT
AGGTTATCAATGATTAAAGGTCCGCAACGAGCTGATTTAAATGGTGTGATTGTGGATAAAGTTGGAGAAC
TCAAAGTTGAGTTTTGGTTCGCTATGAGAAAAGATGGTGACGATGTTATCTTCAGCCGAACAGACAGCCT
ATGCTCAAGCCATTACTGGAGCCCACAAGGTAATCTAGGTGGTAATTGCGCGGGTAATGTCATTGGTAAT
GATGCTCTAACACGTTTTACTATCTTTACTCAGAGTCGTGTATTGTCAAGTTTTGAACCTCGCTCAGATT
TAGAACGGGATTTTATTGATATGGATGATAATCTGTTTATTGCTAAATATGGTTTAGAAGACTATGCATT
TGATCATATAGTTTATGGTAGTTTTAACCATAAAGTTATAGGAGGTTTGCATTTGCTTATAGGCTTATTT
CGTAGGAAAAAAAAATCTAATTTGTTAATTCAAGAGTTTTTACAGTATGATTCTAGTATTCATTCATATT
TTATTACTGATCAGGAGTGTGGTAGTAGTAAGAGTGTTTGTACAGTTATTGATTTATTATTAGATGATTT
TGTTTCTATTGTTAAGTCATTAAATTTGAGTTGTGTTAGTAAAGTTGTTAATATTAATGTTGATTTTAAG
GATTTTCAATTTATGTTGTGGTGTAATGATAATAAAATTATGACTTTTTATCCTAAAATGCAAGCCACTA
ATGATTGGAAACCTGGCTATTCTATGCCTGTTTTGTATAAGTATTTGAATGTTCCATTAGAGAGAGTCTC
TTTATGGAATTATGGTAAACCTATTAATTTGCCTACAGGCTGTATGATGAATGTTGCTAAGTACACTCAA
TTATGTCAGTATTTGAATACTACAACATTAGCTGTTCCTGTTAATATGCGTGTTTTACATTTAGGTGCAG
GGTCTGATAAAGAAGTAGCTCCAGGTTCTGCTGTTTTAAGACAGTGGTTACCATCTGGTAGTATTCTTGT
AGATAATGATTTAAACCCATTTGTTAGCGATAGTTTAGTTACTTATTTTGGAGATTGTATGACTTTACCA
TTTGATTGTCATTGGGATTTGATAATATCTGATATGTATGATCCTCTTACTAAAAATATTGGTGATTATA
ATGTGAGTAAGGATGGGTTTTTTACTTACATTTGTCATTTAATTCGTGATAAATTATCTTTGGGTGGTAG
TGTAGCTATAAAAATTACAGAGTTTTCTTGGAATGCTGATTTATATAAATTAATGAGTTGTTTTGCATTT
TGGACAGTTTTTTGTACTAATGTAAATGCTTCTTCTAGTGAAGGGTTTTTAATAGGTATAAATTACCTGG
GTAAATCTTCTTTTGAAATAGATGGCAATGTTATGCATGCTAACTATTTGTTTTGGAGAAATAGTACAAC
ATGGAATGGCGGTGCTTATAGTTTATTTGATATGACTAAATTTTCTTTGAAATTGGCTGGCACTGCTGTT
GTTAATTTAAGACCAGATCAATTAAATGATTTAGTTTATTCTCTTATTGAAAGAGGTAAATTATTAGTTC
GCGATACGCGTAAAGAGATTTTTGTTGGTGATAGTCTTGTAAATACTTGTTAGATCTCATTAAATCTAAA
CTATGTTAATTATTTTTTTATTTTTTTATTTCTGTTATGGTTTTAATGAACCTCTTAATGTTGTGTCTCA
TTTAAACCATGACTGGTTTTTATTTGGTGATAGTCGTTCTGATTGTAACCATATTAATAATTTAAAAATT
AAAAATTTTGATTATTTGGATATTCACCCTAGTTTGTGCAACAATGGTAAGATTTCATCTAGTGCCGGTG
ATTCTATTTTTAAGAGTTTTCATTTCACTCGATTTTATAATTACACTGGCGAAGGTGATCAAATTATTTT
TTATGAGGGTGTTAATTTTAATCCTTATCATAGATTTAAGTGTTTTCCTAATGGTAGTAATGATGTATGG
CTTCTTAACAAGGTAAGATTTTATCGTGCCTTATATTCTAATATGGCCTTTTTTCGTTATCTTACTTTTG
TTGATATTCCTTATAATGTTTCTCTTTCTAAGTTTAATTCTTGTAAAAGTGATATTTTATCACTTAACAA
TCCTATTTTTATTAATTATTCTAAGGAAGTTTATTTTACTTTATTAGGTTGTTCTCTTTATTTAGTACCG
CTTTGCCTTTTTAAATCTAACTTTAGTCAGTACTATTATAACATAGATACTGGCTCTGTTTATGGTTTTT
CTAATGTTGTTTATCCTGATTTAGACTGTATTTATATTTCTCTTAAACCAGGTTCTTATAAAGTTTCCAC
CACTGCACCTTTTTTATCCTTACCTACTAAAGCTCTCTGTTTTGATAAATCTAAACAATTTGTACCTGTA
CAGGTTGTTGATTCTAGATGGAACAACGAGCGTGCCTCAGATATTTCTTTATCTGTTGCATGTCAATTGC
CATATTGTTATTTTCGCAATTCTTCTGCTAATTATGTTGGCAAGTATGATATTAACCACGGTGATAGTGG
TTTTATTTCTATTTTATCTGGTCTTTTATATAATGTTTCTTGTATTTCATATTATGGTGTATTTTTATAT
GATAATTTTACATCCATTTGGCCCTATTATTCTTTTGGTAGGTGTCCTACATCTTCTATTATTAAACATC
CAATTTGTGTTTATGATTTTTTGCCTATTATTTTACAAGGTATTTTATTATGTTTAGCTTTACTTTTTGT
TGTTTTTCTATTATTTTTGTTATATAACGATAAATCTCATTAAATCTAAACATGTTATTAATTATTTTTA
TTTTGCCTACAACATTAGCTGTTATAGGTGATTTTAATTGTACTAATTTTGCTATTAATGATTTAAACAC
CACAGTTCCTCGCATAAGTGAGTATGTTGTGGATGTTTCTTATGGTTTGGGTACATATTATATACTTGAT
CGTGTTTATTTAAATACTACTATATTATTTACTGGTTATTTCCCTAAATCTGGTGCCAATTTTAGGGATC
TATCTTTAAAAGGTACTACATATTTGAGTACTCTTTGGTATCAGAAACCCTTTTTATCTGATTTTAATAA
TGGTATTTTTTCTAGAGTTAAGAATACTAAGTTGTATGTTAATAAAACTTTGTATAGTGAGTTTAGTACT
ATAGTTATAGGTAGTGTTTTTATTAACAACTCTTATACTATTGTTGTTCAACCTCATAATGGTGTTTTGG
AGATTACAGCTTGTCAATACACTATGTGTGAGTATCCTCATACTATTTGTAAATCTAAAGGTAGTTCTCG
TAATGAATCTTGGCATTTTGATAAATCTGAACCTTTGTGTCTGTTCAAGAAAAATTTTACTTATAATGTT
TCTACAGATTGGTTGTATTTTCATTTTTATCAAGAACGTGGCACTTTTTATGCTTATTATGCTGATTCTG
GCATGCCTACTACTTTTTTATTTAGTTTGTATCTTGGTACTCTTTTATCTCATTATTATGTTTTGCCTTT
GACTTGTAATGCTATATCTTCTAATACTGATAATGAGACTTTACAATATTGGGTCACACCTTTGTCTAAA
CGCCAATATCTTCTTAAATTTGACAACCGTGGTGTTATTACTAATGCTGTTGATTGTTCTAGTAGTTTCT
TTAGCGAGATTCAATGTAAAACTAAATCTTTATTACCTAATACTGGTGTTTATGACTTATCTGGTTTTAC
TGTTAAGCCTGTTGCAACTGTACATCGTCGTATTCCTGATTTACCTGATTGTGACATTGATAAATGGCTT
AACAATTTTAATGTACCCTCACCTCTTAATTGGGAACGTAAAATTTTTTCTAATTGCAACTTTAATTTGA
GTACTTTGCTTCGTTTAGTTCATACTGATTCTTTTTCTTGTAATAATTTTGATGAATCTAAGATATATGG
TAGTTGTTTTAAGAGTATTGTTTTAGATAAATTTGCCATACCCAACTCCAGACGATCTGATTTGCAGTTG
GGCAGTTCTGGTTTTCTGCAATCTTCTAATTATAAAATTGACACTACTTCTAGTTCTTGTCAATTGTATT
ATAGTTTGCCTGCAATTAATGTTACTATTAATAATTATAATCCTTCTTCTTGGAATAGAAGGTATGGTTT
TAATAATTTTAATTTGAGCTCTCATAGTGTTGTTTACTCACGTTATTGTTTTTCTGTTAATAATACTTTT
TGTCCTTGTGCTAAACCTTCTTTTGCTTCAAGTTGCAAGAGTCATAAACCACCTTCTGCTTCCTGTCCTA
TTGGTACTAATTATCGTTCTTGTGAGAGTACTACTGTACTCGACCACACTGACTGGTGTAGGTGTTCTTG
TTTACCTGATCCTATAACTGCTTATGACCCTAGGTCTTGTTCTCAAAAAAAGTCTCTGGTTGGTGTTGGT
GAACATTGTGCAGGGTTCGGTGTTGATGAAGAAAAGTGTGGTGTATTGGATGGATCATATAATGTTTCTT
GTCTTTGTAGTACTGATGCCTTTCTAGGTTGGTCTTATGACACTTGCGTCAGTAACAACCGTTGTAATAT
TTTTTCTAATTTTATTTTAAATGGTATCAATAGTGGTACCACTTGTTCTAATGATTTATTGCAGCCTAAT
ACTGAAGTTTTTACTGATGTTTGTGTTGATTACGACCTTTATGGTATTACAGGACAAGGTATTTTTAAAG
AAGTTTCTGCTGTTTATTATAATAGTTGGCAAAATCTTTTGTATGATTCTAATGGCAACATTATTGGTTT
TAAAGATTTTGTTACTAATAAAACATATAATATTTTCCCTTGTTATGCAGGAAGAGTTTCTGCTGCTTTT
CATCAAAATGCTTCCTCTTTGGCTTTACTTTATCGTAATTTAAAATGTAGCTATGTTTTGAATAATATTT
CTTTAACTACTCAGCCATATTTTGATAGTTATCTTGGTTGCGTTTTTAATGCTGATAATTTAACTGATTA
TTCTGTTTCTTCTTGTGCTCTTCGCATGGGTAGTGGTTTTTGTGTTGATTATAACTCACCTTCTTCTTCC
TCTTCGCGTCGTAAACGTAGAAGTATTTCTGCTTCTTATCGTTTTGTTACTTTTGAACCCTTTAATGTCA
GTTTTGTTAATGACAGTATTGAGTCTGTGGGTGGTCTTTATGAGATCAAAATTCCCACTAACTTTACTAT
AGTTGGTCAAGAGGAATTTATTCAAACTAATTCTCCTAAAGTTACTATTGATTGTTCTTTATTTGTCTGT
TCTAATTATGCAGCTTGCCATGACTTATTGTCAGAGTATGGCACTTTTTGTGATAATATTAATAGTATTT
TAGATGAAGTTAATGGTTTACTTGATACTACTCAATTGCATGTAGCTGATACTCTTATGCAAGGTGTCAC
ACTTAGCTCCAATCTTAATACTAATTTGCATTTTGATGTTGATAATATTAATTTTAAATCCCTAGTTGGA
TGTTTAGGTCCACACTGCGGTTCTTCTTCTCGTTCTTTTTTTGAAGATTTATTGTTTGACAAAGTTAAAC
TTTCAGATGTTGGTTTTGTTGAAGCTTATAACAATTGTACTGGTGGTAGTGAAATTAGAGATCTTCTTTG
TGTACAATCCTTTAATGGTATTAAAGTTTTGCCTCCTATTTTGTCTGAATCTCAAATTTCTGGTTACACC
ACAGCCGCTACTGTTGCTGCTATGTTTCCACCATGGTCAGCAGCAGCTGGCATACCATTTTCTCTTAATG
TACAATATAGAATTAATGGTTTGGGTGTTACTATGGATGTTCTTAATAAAAATCAAAAGTTGATAGCTAC
TGCTTTTAATAATGCTCTTCTTTCTATTCAGAATGGTTTTAGTGCTACCAACTCTGCACTTGCTAAAATA
CAAAGTGTTGTTAATTCTAATGCTCAAGCACTTAATAGTTTGTTACAGCAATTATTTAATAAATTTGGTG
CAATTAGTTCTTCTTTACAAGAAATTTTATCTCGTCTCGATGCTTTAGAGGCTCAGGTTCAGATTGATAG
GCTTATTAATGGTCGTTTAACTGCTTTAAATGCTTATGTCTCTCAACAGCTTAGTGATATTTCTCTTGTA
AAATTTGGTGCTGCTTTAGCTATGGAGAAGGTTAATGAGTGTGTTAAAAGTCAATCTCCTCGTATTAATT
TTTGTGGTAATGGTAATCATATTTTGTCATTAGTTCAAAATGCTCCTTATGGTTTGTTGTTTATGCATTT
TAGTTATAAACCTATTTCTTTTAAAACTGTTTTAGTAAGTCCTGGTTTGTGTATATCAGGTGATGTAGGT
ATTGCACCTAAACAAGGGTATTTTATTAAACATAATGATCATTGGATGTTCACTGGTAGTTCTTACTATT
ATCCTGAACCAATTTCAGATAAAAATGTTGTTTTTATGAATACTTGTTCTGTTAATTTTACTAAAGCGCC
TCTTGTTTATTTGAATCATTCTGTACCAAAATTGTCTGATTTTGAATCTGAGTTATCTCATTGGTTTAAA
AATCAAACATCCATTGCGCCTAATTTGACTTTAAATCTTCATACTATTAATGCTACTTTTTTAGATTTGT
ATTATGAGATGAATCTTATTCAAGAGTCTATTAAGTCTTTGAATAATAGTTATATCAATCTTAAAGATAT
AGGTACATATGAAATGTATGTAAAATGGCCTTGGTATGTTTGGCTACTAATTTCTTTTTCATTTATAATA
TTCCTTGTATTGCTCTTTTTTATATGTTGTTGTACTGGTTGTGGTTCTGCATGTTTTAGTAAATGTCATA
ATTGTTGTGATGAGTATGGTGGTCATCATGATTTTGTTATCAAAACATCTCATGATGATTAGAATCTCTT
GTCAGATCTCATTAAATCTAAACTTTATTTATGGACGTTTGGAGACCTAGCTACACACATTCTCTTGTTA
TTAGAGAATTTGGTGTTACAAACCTTGAAGATTTGTGTCTAAAGTATAATTACTGTCAACCTATTGTTGG
TTACTGTATTGTACCTTTAAATGTTTGGTGTCGCAAGTTTGGCAAATTTGCTTCTCACTTTACATTACGT
AGTCACGATATTTCCCATAGTAATAATTTTGGTGTTGTAACTAGTTTTACTACTTATGGTAATACTGTTT
CTGAGGCTGTGTCTAGATTAGTTGAATCAGCTTCTGAATTTATTGTTTGGCGTGCAGAGGCACTTAATAA
GTATGGTTGATTTATTTTTCAATGATACTGCTTGGTACATAGGACAGATTTTAGTTTTAGTTTTATTTTG
TCTTATTTCTTTAATCTTTGTTGTTGCTTTTTTAGCAACTATTAAGCTTTGTATGCAACTTTGTGGTTTT
TGTAATTTCTTTATTATTTCACCTTCGGCTTACGTTTATAAAAGAGGTATGCAGTTGTATAAGTCTTATA
GTGAACAAGTTATACCACCCACTTCAGATTATTTAATCTAAATCTAAACATTATGAATAAATCTTTTCTT
CCTCAATTTACTTCTGATCAAGCTGTTACATTCTTAAAAGAATGGAATTTCTCTTTGGGTGTAATACTAC
TTTTTATTACTATCATATTGCAGTTCGGTTATACGAGCCGTAGTATGTTTGTTTATCTTATCAAGATGAT
TATTCTTTGGCTTATGTGGCCATTGACTATCACCTTGACTATATTTAATTGTTTTTATGCTTTGAATAAT
GCTTTTCTTGCATTTTCTATAGTGTTTACTATTATTTCTATTGTTATATGGATTCTTTATTTTGTTAATA
GTATTCGGCTTTTTATTAGAACTGGCAGTTGGTGGAGTTTTAATCCAGAGACCAATAATCTTATGTGTAT
TGATATGAAAGGCAAGATGTTTGTTAGGCCAGTTATTGAGGACTATCACACATTAACTGCTACTGTTATT
CGTGGTCATCTTTATATACAGGGTGTCAAACTTGGCACTGGTTATACTCTTTCAGATTTGCCCGTATATG
TTACTGTAGCTAAGGTGCAAGTACTTTGTACCTATAAACGTGCCTTTTTAGATAAGTTAGATGTTAATAG
TGGTTTTGCTGTTTTTGTTAAGTCTAAAGTTGGTAACTATCGTTTACCGTCTAGTAAACCTAGTGGTATG
GATACTGCCTTGTTAAGAGCTTAAATCTAAACTATTAGGATGTCTTATACTCCCGGTCATTATGCTGGAA
GTAGAAGCTCCTCTGGAAATCGTTCAGGAATCCTCAAGAAAACTTCTTGGGCTGACCAATCTGAGCGAAA
TTACCAAACCTTTAATAGAGGCAGAAAAACCCAACCTAAATTCACTGTGTCTACTCAACCACAAGGAAAT
ACTATCCCACATTATTCCTGGTTCTCCGGGATCACTCAATTTCAAAAAGGTAGAGACTTTAAATTTTCAG
ATGGTCAAGGAGTTCCCATTGCTTTCGGAGTACCCCCTTCTGAAGCAAAAGGATATTGGTATAGACACAG
CCGGCGTTCTTTTAAAACAGCTGATGGTCAACAAAAGCAGTTGTTACCGAGATGGTATTTCTACTATCTC
GGTACCGGCCCATATGCCAATGCATCCTATGGTGAATCCCTCGAAGGGGTCTTCTGGGTTGCTAATCACC
AAGCTGACACTTCTACTCCCTCCGATGTTTCGTCAAGGGATCCTACTACTCAAGAAGCTATCCCTACTAG
GTTTCCGCCTGGTACGATTTTGCCTCAAGGCTATTATGTTGAAGGCTCAGGAAGGTCTGCTTCTAATAGT
CGACCAGGTTCACGTTCTCAATCACGTGGACCCAATAATCGTTCATTAAGTAGAAGTAATTCTAATTTTA
GACATTCAGATTCTATAGTAAAACCTGATATGGCTGATGAGATCGCTAATCTTGTTTTAGCCAAGCTTGG
TAAAGATTCTAAACCTCAGCAAGTCACTAAGCAAAATGCCAAGGAAATCAGGCATAAAATTTTAACAAAA
CCTCGCCAAAAGCGAACTCCTAATAAACATTGTAATGTTCAACAGTGTTTTGGTAAAAGAGGACCTTCTC
AAAATTTTGGTAATGCTGAAATGTTAAAGCTTGGTACTAATGATCCTCAGTTTCCTATTCTTGCAGAATT
AGCTCCTACACCAGGTGCTTTTTTCTTTGGTTCTAAATTAGACTTGGTTAAAAGAGATTCCGAGGCTGAC
TCACCTGTTAAAGATGTTTTTGAACTTCATTATTCTGGTTCTATTAGGTTTGATAGTACTTTACCAGGCT
TTGAGACAATTATGAAAGTTCTTGAAGAGAATTTAAATGCTTACGTTAATTCTAATCAGAACACTGATTC
TGATTCGTTGAGTTCTAAACCTCAGCGTAAAAGAGGTGTTAAACAATTACCAGAACAGTTTGACTCTCTT
AATTTAAGTGCTGGTACTCAGCACATTTCAAATGATTTTACTCCTGAGGATCATAGTTTACTTGCTACTC
TTGATGATCCTTATGTAGAAGACTCTGTTGCTTAATGAGAATGAATCCTAATTCGACACTAGGTGGTAAC
CCCTCGCTATTATTCGGAATAGGACACTCTCTATCAGAATGAATTCTTGCTGTAATAACAGATAGAGTAG
GTTGTTACAGACTATATATTAATTAGTAGAAATTTTATATTTAGACATTTGATTGTTAGAGTAGTTATAA
GGTTTAGCTGTAGTATAAACGCCTCCGGGAAGAGCTATCAATTGTAGTGTTTAATATATATATTAGTATA
TGATTGAAATTAATTATAGCCTTTTGGAGGAATTAC

>gi|19387576|ref|NC_003436.1| Porcine epidemic diarrhea virus, complete genome
ACTTAAAAAGATTTTCTATCTACGGATAGTTAGCTCTTTTTCTAGACCTTGTCTACTCAATTCAACTAAA
CAGAAATTTTGTCCTTCCTTCCGGCCGCATGTTCATGCTGCTGGAAGCTGGCGTGGAATTTCATTAGGTT
TGCTTAAGTAGCCATCGCAAGTGCTGTGCTGTCCTCTAGTTCCTGGTTGGCGTTCCGTCGCCTTCTACAT
ACTAGACAAACAGCCTTCCTCCGGTTCCGTCTGGGGGTTGTGTGGATAACTAGTTCCGTCTAGTTTGAAA
CCAGTAACTGCCGGCTATGGCTAGCAACCATGTCACATTGGCGTTTGCCAATGATGCAGAAATTTCGGCT
TTTGGCTTTTGCACTGCTAGTGAAGCCGTCTCATACTATTCTGAGGCCGCCGCTAGTGGATTTATGCAAT
GCCGTTTTGTGTCCCTCGATCTCGCTGACACTGTTGAGGGATTGCTTCCTGAAGACTATGTCATGGTGGT
GATCGGCACTACCAAGCTTAGTGCGTATGTGGACACTTTTGGTAGCCGCCCCAGAAACATTTGTGGTTGG
CTGTTATTTTCTAACTGTAATTACTTCCTCGAAGAGTTAGAGCTCACTTTTGGTCGTCGTGGTGGTAACA
TCGTGCCAGTTGACCAATACATGTGTGGCGCTGACGGGAAACCTGTTCTTCAGGAATCCGAGTGGGAGTA
TACAGATTTCTTCGCTGACTCCGAAGACGGTCAACTCAACATTGCTGGGATCACTTATGTGAAGGCCTGG
ATTGTAGAGCGATCGGACGTCTCTTATGCGAGTCAGAATTTAACATCTATTAAGTCTATTACTTACTGTT
CAACCTATGAGCATACTTTTCTTGATGGTACTGCCATGAAGGTTGCACGTACTCCAAAGATCAAGAAGAA
TGTTGTTTTGTCTGAGCCACTTGCTACTATCTACAGGGAAATTGGTTCCCCTTTTGTGGATAATGGGAGC
GATGCTCGTTCTATCATTAGGAGACCAGTGTTCCTCCACGCTTTTGTTAAGTGTAAGTGTGGTAGTTATC
ATTGGACTGTTGGTGATTGGACTTCCTATGTCTCCACTTGCTGTGGCTTTAAGTGCAAGCCAGTCCTTGT
GGCCTCATGCTCTGCTATGCCTGGTTCTGTTGTGGTCACACGCGCTGGTGCTGGCACTGGTGTTAAGTAC
TACAACAACATGTTCCTGCGCCATGTGGCTGACATTGATGGATTGGCATTCTGGCGAATTCTTAAGGTGC
AGTCCAAAGACGACCTCGCTTGCTCTGGTAAGTTCCTTGAACACCATGAGGAAGGTTTCACAGACCCTTG
CTACTTTTTGAATGATTCGAGCCTTGCTACTAAGCTTAAGTTCGACATCCTTAGTGGCAAGTTTTCTGAT
GAAGTCAAACAAGCTATCATTGCTGGTCATGTTGTTGTTGGCAGTGCACTCGTTGACATTGTTGACGATG
CACTGGGACAACCTTGGTTCATACGTAAGCTTGGTGACCTTGCAAGTGCACCTTGGGAGCAGCTTAAGGC
TGTCGTTAGAGGCCTTGGCCTCTTGTCTGATGAGGTTGTGCTCTTTGGCAAAAGACTTAGCTGTGCCACT
CTTAGTATCGTTAACGGCGTTTTTGAGTTTCTCGCCGATGTGCCAGAGAAGTTGGCTGCGGCTGTTACAG
TTTTTGTCAACTTCTTGAATGAGTTCTTTGAGTCTGCCTGTGACTGCTTAAAGGTCGGAGGTAAGACATT
CAACAAGGTTGGTTCCTATGTTCTTTTTGACAATGCATTGGTTAAGCTTGTCAAGGCAAAAGCTCGCGGC
CCACGACAGGCAGGTATTTGTGAAGTTCGCTACACAAGCCTGGTTGTTGGGAGTACTACCAAGGTGGTTT
CCAAGCGCGTTGAAAATGCCAATGTGAATCTCGTCGTCGTTGACGAGGATGTAACCCTCAACACCACTGG
TCGTACAGTTGTCGTTGATGGACTTGCATTCTTCGAGAGTGACGGGTTTTACAGACATCTTGCTGATGCT
GACGTTGTCATCGAACATCCTGTTTATAAGTCTGCTTGTGAGCTCAAGCCAGTTTTTGAGTGTGACCCAA
TACCTGATTTTCCTTTGCCTGTGGCCGCTAGTGTTGCAGAGCTCTGTGTGCAAACCGATCTGTTGCTTAA
AAATTACAACACTCCTTATAAAACTTACAGCTGCGTAGTGAGAGGTGATAAGTGTTGCATCACTTGCACC
TTACAGTTCAAAGCACCAAGTTATGTGGAGGATGCTGTTAATTTTGTAGACCTATGTACCAAGAACATTG
GTACTGCTGGTTTTCATGAGTTTTACATAACGGCCCATGAACAACAGGATCTGCAAGGGTTTTTAACCAC
TTGTTGCACGATGTCAGGTTTTGAGTGTTTTATGCCTACAATCCCACAGTGTCCAGCAGTGCTTGAAGAG
ATTGATGGTGGTAGCATATGGCGGTCTTTTATCACTGGTCTTAATACAATGTGGGATTTTTGCAAGCGTC
TTAAAGTCAGCTTTGGACTGGATGGCATTGTTGTCACTGTAGCACGCAAATTTAAACGACTTGGTGCTCT
TTTGGCAGAAATGTATAACACTTATCTTTCAACTGTGGTGGAAAACTTGGTACTGGCCGGTGTTAGCTTC
AAGTATTATGCCACCAGTGTCCCAAAAATTGTTTTGGGCGGTTGTTTTCACAGTGTTAAAAGTGTTTTTG
CAAGTGTCTTCCAGATTCCTGTCCAGGCAGGCATTGAGAAGTTTAAAGTTTTCCTTAACTGTGTTCACCC
TGTTGTACCACGTGTCATTGAAACTTCTTTTGTGGAATTAGAAGAGACGACATTTAAACCACCAGCACTC
AATGGTGGTATTGCTATTGTTGATGGCTTCGCTTTCTATTATGATGGAACACTATACTATCCCACCGATG
GTAATAGTGTTGTGCCTATCTGTTTTAAGAAGAAAGGTGGTGGTGATGTTAAATTCTCTGATGAAGTCTC
TGTTAAAACCATTGATCCAGTTTATAAGGTCTCCCTTGAATTTGAGTTCGAGTCTGAGACTATTATGGCT
GTGCTTAATAAGGCTGTTGGTAATCGTATCAAGGTTACAGGTGGTTGGGATGATGTCGTTGAGTATATTA
ACGTTGCCATTGAGGTTCTTAAAGATCACGTTGAAGTGCCTAAGTACTACATCTATGATGAGGAAGGTGG
CACTGATCCTAATCTGCCCGTAATGGTTTCTCAGTGGCCGTTGAATGATGACACGATCTCACAGGACCTG
CTTGATGTGGAAGTTGTTACGGATGCACCAATTGATTCCGAGGGTGATGAAGTAGACTCCTCTGCACCTG
AGAAGGTGGCAGATGTGGCTAACTCTGAACCTGGGGATGATGGTCTTCCTGTGGCACCTGAAACAAATGT
AGAGTCTGAAGTTGAGGAAGTTGCCGCAACCTTGTCCTTTATTAAAGATACACCTTCCACAGTTACTAAG
GACCCTTTTGCTTTTGACTTTGTAAGCTACGGAGGACTTAAAGTTTTAAGACAATCTCATAACAATTGTT
GGGTTACTTCTACCTTGGTGCAGCTACAATTGCTTGGCATCGTTGATGACCCTGCAATGGAACTTTTTAG
TGCTGGTAGAGTTGGTCCAATGGTTCGCAAATGTTATGAGTCACAAAAGGCTATTTTGGGATCTTTGGGT
GATGTGTCGGCTTGCCTAGAGTCTCTGACTAAGGACCTACACACACTTAAGATTACCTGTTCTGTAGTCT
GCGGTTGTGGTACTGGTGAACGTATCTATGAGGGTTGTGCTTTTCGTATGACGCCAACTTTGGAACCGTT
TCCATATGGTGCTTGTGCTCAGTGTGCTCAAGTTTTGATGCACACTTTTAAAAGTATTGTTGGCACCGGC
ATCTTTTGCCGAGATACTACTGCTCTCTCCTTGGATTCTTTGGTTGTAAAACCTCTTTGTGCGGCTGCTT
TTATAGGCAAGGATAGTGGTCATTATGTCACCAATTTTTATGATGCTGCTATGGCTATTGATGGTTATGG
TCGTCATCAGATAAAGTATGACACACTGAACACCATTTGTGTTAAAGACGTGAATTGGACAGCACCTCTT
GTCCCTGCCGTTGATTCTGTAGTGGAGCCTGTTGTCAAACCATTCTATTCTTATAAGAATGTTGATTTTT
ACCAAGGAGATTTTAGTGACCTTGTTAAACTTCCATGTGACTTTGTTGTTAATGCTGCAAATGAGAAGTT
GTCTCATGGTGGCGGCATAGCAAAGGCCATTGATGTTTATACCAAGGGCATGTTGCAGAAGTGTTCAAAT
GATTACATTAAAGCACACGGTCCCATTAAAGTTGGACGTGGTGTCATGTTGGAGGCATTAGGTCTTAAGG
TCTTTAATGTTGTTGGTCCACGTAAGGGTAAGCATGCACCTGAGCTTCTTGTTAAGGCTTATAAGTCCGT
TTTTGCTAACTCAGGTGTTGCTCTTACACCTTTGATTAGTGTTGGAATTTTTAGTGTTCCTTTGGAAGAA
TCTTTATCTGCTTTTCTTGCATGTGTTGGTGATCGCCACTGTAAGTGCTTTTGTTATGGTGACAAAGAGC
GCGAGGCGATCATTAAGTACATGGATGGCTTGGTAGATGCTATTTTCAAAGAGGCGCTTGTTGACACTAC
TCCTGTCCAGGAAGATGTTCAACAAGTTTCACAAAAACCAGTTTTGCCTAATTTTGAACCTTTCAGGATT
GAAGGTGCTCATGCTTTCTATGAGTGCAACCCTGAAGGTTTGATGTCCTTAGGTGCTGACAAGCTGGTGT
TGTTTACAAATTCCAATTTGGATTTTTGTAGTGTTGGTAAGTGTCTTAACGATGTGACCAGCGGTGCATT
GCTTGAAGCCATAAATGTATTTAAAAAGAGTAACAAAACAGTGCCTGCTGGCAACTGTGTTACTTTAGAT
TGTGCAAATATGATTTCTATTACTATGGTAGTATTGCCATTTGATGGTGATGCTAATTATGACAAAAATT
ATGCACGCGCCGTTGTCAAGGTATCTAAGCTTAAAGGCAAGTTAGTGCTTGCTGTTGATGATGCCACGTT
GTATTCCAAGTTGTCCCACCTCAGCGTGTTAGGTTTCGTGTCCACACCTGACGATGTGGAGCGTTTCTAC
GCAAATAAGAGTGTGGTTATTAAAGTCACTGAGGATACACGTAGTGTCAAGGCTGTTAAAGTAGAATCCA
CTGCTACTTATGGACAACAAATTGGACCTTGTCTTGTTAATGACACCGTTGTCACAGACAACAAACCTGT
TGTCGCTGACGTTGTAGCTAAGGTTGTACCAAATGCTAATTGGGATTCACATTATGGTTTTGATAAGGCT
GGTGAGTTCCACATGCTAGACCATACTGGGTTTACCTTTCCTAGCGAAGTTGTTAACGGTAGGCGTGTGA
TTAAAACCACAGATAATAATTGTTGGGTTAATGTCACATGTTTACAATTACAGTTTGCTAGATTTAGGTT
CAAGTCAGCAGGTCTACAGGCTATGTGGGAGTCCTATTGTACTGGTGATGTTGCTATGTTTGTGCATTGG
TTGTACTGGCTTACTGGTGTTGACAAAGGTCAGCCTAGTGATTCAGAAAATGCACTTAACATGTTGTCCA
AGTACATTGTTCCTGCTGGTTCTGTCACTATTGAACGTGTCACGCATGACGGCTGTTGTTGTAGTAAGCG
TGTTGTTACTGCACCAGTTGTGAATGCTAGTGTGTTGAAGCTTGGCGTCGAGGATGGCCTTTGTCCACAT
GGTCTTAACTACATTGGCAAAGTTGTTGTAGTTAAAGGTACTACAATTGTTGTCAATGTAGGAAAACCTG
TAGTGGCACCATCACACCTCTTTCTTAAGGGTGTATCCTACACAACATTCCTAGATAATGGTAACGGTGT
TGTCGGCCATTATACTGTTTTTGATCATGGCACTGGTATGGTGCATGATGGCGATGCTTTTGTACCGGGT
GATCTTAATGTATCTCCTGTTACAAATGTTGTTGTCTCAGAGCAGACGGCTGTTGTGATTAAAGACCCTG
TGAAGAAAGCAGAGTTAGACGCTACTAAGCTGCTCGACACTATGAATTATGCATCGGAAAGATTTTTTTC
CTTTGGTGATTTCATGTCACGTAATTTAATTACAGTGTTTTTGTACATCCTTAGCATTTTGGGTCTCTGT
TTTAGAGCCTTTCGTAAGAGAGATGTTAAAGTTCTAGCTGGTGTACCCCAACGTACTGGTATTATATTGC
GTAAAAGTATGCGCTATAATGCAAAGGCGTTGGGTGTCTTTTTCAAGCTAAAGCTTTATTGGTTCAAAGT
TCTTGGTAAGTTTAGTCTGGGTATTTATGCATTGTATGCATTACTATTCATGACAATACGCTTTACACCT
ATAGGTAGCCCCGTCTGTGATGATGTTGTTGCTGGTTATGCTAATTCTAGTTTTGACAAGAATGAGTACT
GCAACAGTGTTATTTGTAAGGTCTGTCTCTATGGGTACCAGGAACTCTCGGACTTCTCCCACACACAGGT
TGTATGGCAACACCTTAGAGACCCATTAATTGGTAATGTGATGCCTTTCTTTTATTTGGCATTTTTGGCA
ATTTTTGGGGGTGTCTATGTAAAGGCTATTACTCTCTATTTTATTTTCCAGTACCTTAATAGTCTTGGTG
TGTTTTTGGGCCTACAGCAGTCCATTTGGTTTTTGCAGCTCGTGCCTTTTGATGTCTTTGGTGATGAGAT
CGTCGTCTTTTTCATCGTTACACGCGTATTGATGTTCATTAAGCATGTTTGCCTTGGCTGCGATAAGGCA
TCTTGTGTGGCTTGCTCTAAGAGTGCTCGCCTTAAGCGCGTTCCTGTCCAGACTATCTTTCAGGGTACTA
GTAAATCCTTCTACGTACATGCCAATGGTGGTTCTAAGTTCTGTAAGAAGCACAATTTCTTTTGTTTAAA
TTGTGATTCTTATGGTCCAGGCTGCACTTTTATTAACGACGTCATTGCAACTGAAGTTGGTAATGTTGTC
AAACTTAATGTGCAACCGACAGGTCCTGCCACTATTCTTATTGACAAGGTTGAATTCAGTAATGGTTTCT
ACTATCTTTATAGTGGTGACACATTTTGGAAGTACAACTTTGACATAACAGATAGCAAATACACTTGCAA
AGAGGCACTTAAAAATTGTAGCATAATCACAGACTTTATTGTTTTTAACAATAATGGTTCCAATGTAAAT
CAGGTTAAGAATGCATGTGTGTATTTTTCACAGATGCTTTGTAAACCTGTTAAGTTAGTGGACTCAGCGT
TGTTGGCCAGTTTGTCTGTTGATTTTGGTGCAAGCTTACATAGTGCTTTTGTTAGTGTGTTGTCGAATAG
TTTCGGCAAAGACCTGTCAAGTTGTAATGACATGCAGGATTGCAAGAGCACATTGGGTTTTGATGATGTA
CCATTGGATACCTTTAATGCTGCTGTTGCTGAGGCTCATCGCTATGATGTCCTCTTGACTGACATGTCAT
TCAACAATTTTACCACCAGTTATGCAAAACCAGAGGAAAAATTTCCCGTCCATGACATTGCCACGTGTAT
GCGTGTAGGTGCCAAGATTGTTAATCATAACGTTCTTGTCAAGGATAGTATACCTGTGGTGTGGCTTGTA
CGTGATTTCATTGCCCTTTCGGAAGAAACTAGGAAGTACATTATTCGTACGACTAAAGTTAAGGGTATAA
CATTTATGTTGACCTTTAATGATTGTCGTATGCATACTACCATACCTACTGTTTGCATTGCAAATAAGAA
GGGTGCAGGTCTTCCTAGTTTTTCAAAGGTTAAGAAATTCTTTTGGTTTTTGTGTCTGTTCATAGTTGCT
GCTTTCTTTGCACTAAGCTTTCTTGATTTTAGTACTCAGGTTAGCAGTGATAGCGATTATGATTTCAAGT
ATATTGAGAGTGGCCAGTTGAAGACTTTTGACAATCCACTTAGTTGTGTGCATAATGTCTTTATTAACTT
CGACCAGTGGCATGATGCCAAGTTTGGTTTCACCCCCGTCAACAATCCTAGTTGTCCTATAGTTGTTGGT
GTATCAGACGAAGCTCGCACTGTTCCAGGTATCCCAGCAGGTGTTTATTTAGCTGGTAAAACACTTGTGT
TTGCTATTAACACCATTTTTGGTACATCTGGTTTGTGCTTCGATGCTAGTGGCGTTGCTGATAAGGGCGC
TTGCATTTTTAATTCAGCTTGCACCACATTATCTGGTTTGGGTGGAACTGCTGTCTACTGTTACAAGAAT
GGGCTAGTTGAAGGTGCCAAACTTTATAGTGAGTTGGCACCTCATAGCTACTATAAAATGGTAGATGGTA
ATGCTGTGTCTTTACCTGAAATTATTTCACGCGGCTTTGGCATCCGTACTATCCGTACAAAGGCTATGAC
TTATTGCCGTGTTGGCCAGTGTGTGCAGTCTGCAGAAGGCGTTTGTTTTGGCGCCGATAGATTCTTTGTC
TATAATGCAGAATCTGGTTCTGACTTTGTTTGTGGCACAGGGCTCTTCACATTGTTGATGAACGTTATTA
GTGTTTTTTCCAAGACAGTACCAGTAACTGTGTTGTCTGGTCAAATACTTTTTAATTGCATTATTGCTTT
TGTTGCTGTTGCGGTGTGTTTCTTATTTACAAAGTTTAAGCGCATGTTCGGTGATATGTCTGTTGGCGTT
TTCACTGTCGGTGCTTGTACTTTGTTGAACAATGTTTCTTACATTGTAACACAGAACACACTTGGCATGT
TGGGCTATGCAACTTTGTATTTCTTGTGCACTAAGGGTGTTAGATATATGTGGATTTGGCACTTGGGATT
TTTGATCTCATATATTCTTATTGCACCATGGTGGGTTTTGATGGTTTATGCCTTTTCAGCCATTTTTGAG
TTTATGCCTAACCTTTTTAAGCTTAAGGTTTCAACACAACTTTTTGAGGGCGACAAGTTCGTAGGCTCTT
TTGAAAATGCTGCAGCAGGTACATTTGTGCTTGATATGCATGCCTATGAGAGACTTGCCAACTCTATCTC
AACTGAAAAACTGCGTCAGTATGCTAGTACTTACAATAAGTACAAGTATTATTCAGGCAGTGCTTCAGAG
GCTGATTACAGGCTTGCTTGTTTTGCCCATTTGGCCAAGGCTATGATGGATTATGCTTCTAATCATAACG
ATACGTTATACACACCACCCACTGTGAGTTACAATTCAACTCTACAGGCTGGCTTGCGTAAGATGGCACA
ACCTTCTGGTGTTGTTGAGAAGTGCATAGTCCGTGTTTGCTATGGTAATATGGCTCTTAATGGCCTATGG
CTTGGCGATATTGTTATGTGCCCACGCCATGTTATAGCGTCTAGTACTACTAGCACTATAGATTATGATT
ATGCCCTTTCTGTTTTACGCCTCCACAACTTCTCCATTTCATCTGGGAATGTTTTCCTAGGTGTTGTGAG
TGCAACTATGCGAGGTGCTTTGTTGCAGATAAAGGTTAATCAAAACAATGTCCACACGCCTAAGTACACC
TATCGCACAGTTAGACCGGGTGAATCTTTTAATATTTTGGCGTGCTATGATGGTGCTGCAGCTGGTGTTT
ACGGCGTTAACATGCGCTCTAATTACACTATTAGAGGCTCGTTCATTAATGGCGCTTGTGGTTCACCTGG
TTATAATATTAACAATGGTACCGTTGAGTTTTGCTATTTACACCAGCTTGAACTTGGTTCAGGCTGTCAT
GTTGGTAGCGACTTAGATGGTGTTATGTATGGTGGTTATGAGGACCAACCTACTTTGCAAGTTGAAGGCG
CTAGTAGTCTGTTTACAGAGAATGTGTTGGCATTTCTTTATGCAGCACTCATTAATGGTTCTACCTGGTG
GCTTAGTTCTTCTAGGATCGCTGTAGACAGGTTTAATGAGTGGGCTGTTCATAATGGTATGACAACAGTG
GGCAATACTGATTGCTTTTCTATTCTTGCTGCTAAGACTGGAGTTGATGTACAACGTTTGTTGGCCTCAA
TCCAGTCTCTGCATAAGAATTTTGGTGGAAAGCAAATTCTTGGCCATACCTCGTTGACAGATGAGTTTAC
TACAGGTGAAGTTGTACGTCAAATGTATGGCGTTAATCTTCAGGGTGGCTATGTGTCACGCGCCTGCAGA
AATGTCTTGCTGGTTGGTTCTTTTCTGACTTTCTTTTGGTCAGAATTAGTTTCCTACACTAAGTTCTTCT
GGGTAAATCCTGGTTATGTTACACCTATGTTTGCGTGCTTGTCATTGCTATCCTCACTTTTGATGTTCAC
ACTCAAGCATAAGACATTGTTTTTCCAGGTCTTCTTAATACCTGCTCTGATTGTTACATCTTGCATTAAT
TTGGCATTTGATGTTGAAGTCTACAACTATTTGGCAGAGCATTTTGATTACCATGTTTCTCTTATGGGTT
TTAATGCACAAGGTCTTGTTAACATCTTTGTCTGCTTTGTTGTTACCATTTTACACGGCACATACACATG
GCGCTTCTTTAATACACCTGCGAGTTCTGTCACTTATGTGGTAGCTTTGCTGACTGCGGCCTATAACTAT
TTTTACGCTAGTGACATTCTTAGTTGTGCTATGACACTATTTGCTAGTGTGACTGGCAACTGGTTCGTTG
GTGCTGTTTGTTATAAAGTTGCTGTGTATATGGCCTTGAGATTTCCTACGTTCGTGGCTATTTTTGGTGA
TATTAAGAGTGTTATGTTCTGTTACCTTGTGTTGGGTTATTTTACCTGTTGCTTCTACGGTATTCTCTAC
TGGTTCAACAGGTTCTTTAAGGTTAGTGTAGGTGTCTATGACTATACTGTTAGTGCTGCTGAGTTTAAGT
ATATGGTTGCTAATGGCCTACGTGCACCAACTGGAACACTTGATTCACTACTGTTGTCCGCCAAATTGAT
TGGTATTGGTGGTGAGCGGAATATTAAGATTTCTTCCGTTCAGTCTAAACTGACTGATATTAAGTGTAGT
AACGTTGTGCTTTTAGGCTGTCTTTCTAGCATGAATGTTTCAGCAAATTCAACAGAATGGGCTTATTGTG
TTGACTTGCATAACAAGATCAACTTGTGTAATGACCCAGAAAAAGCGCAGGAAATGCTACTTGCTTTGTT
GGCATTTTTCCTTAGTAAGAATAGTGCCTTTGGTTTAGACGACTTATTGGAATCTTATTTTAATGACAAT
AGTATGTTGCAGAGTGTTGCATCTACTTATGTAGGTTTGCCTTCCTATGTCATTTATGAAAATGCACGCC
AACAGTATGAAGATGCTGTTAATAATGGTTCTCCACCTCAGTTGGTTAAGCAATTGCGCCATGCTATGAA
TGTAGCAAAGAGCGAATTTGACCGTGAGGCTTCTACTCAGCGTAAGCTTGATAGAATGGCGGAACAGGCT
GCAGCACAGATGTATAAAGAGGCAAGGGCAGTTAATAGGAAGTCCAAAGTTGTAAGTGCTATGCATTCAC
TGCTTTTTGGTATGTTGAGACGTTTGGATATGTCTTCTGTAGACACCATTCTCAACTTGGCAAAGGATGG
GGTGGTACCTCTGTCTGTCATACCGGCAGTCAGTGCTACTAAGCTTAACATTGTTACCTCTGATATCGAT
TCTTATAATCGTATCCAGCGTGAGGGATGTGTCCACTACGCTGGTACCATTTGGAATATAATTGATATCA
AGGACAATGATGGCAAGGTGGTACACGTTAAGGAGGTAACCGCACAGAATGCTGAGTCCCTGTCATGGCC
CCTGGTCCTTGGGTGTGAGCGTATTGTTAAGCTCCAGAATAATGAGATTATTCCTGGTAAGCTGAAGCAG
CGCTCCATTAAGGCAGAAGGAGATGGCATAGTTGGAGAAGGTAAGGCACTTTACAATAATGAGGGTGGAC
GTACTTTTATGTATGCTTTCATTTCAGATAAACCGGACCTGCGTGTAGTTAAGTGGGAGTTCGATGGTGG
TTGTAACACTATTGAGCTAGAACCACCACGTAAGTTCTTGGTGGATTCTCCTAATGGTGCACAGATCAAG
TATCTCTACTTTGTTCGTAACCTTAACACGTTGCGTAGGGGTGCTGTTCTTGGCTACATAGGTGCCACTG
TACGCTTGCAGGCTGGTAAACAAACAGAACAGGCTATTAACTCTTCATTGTTGACACTTTGCGCTTTCGC
TGTGGATCCTGCTAAGACCTACATCGATGCTGTTAAAAGTGGTCACAAACCAGTAGGTAACTGTGTTAAG
ATGTTGGCCAATGGTTCTGGTAATGGACAAGCTGTTACTAATGGTGTGGAGGCTAGTACTAACCAGGATT
CATATGGTGGTGCTTCCGTGTGTCTATATTGTAGAGCACATGTTGAGCATCCATCTATGGATGGTTTTTG
CAGACTGAAAGGCAAGTATGTACAGGTGCCACTAGGTACAGTGGATCCTATACGTTTTGTACTTGAGAAT
GACGTTTGCAAGGTTTGTGGTTGTTGGCTGTCTAATGGCTGCACTTGTGACAGATCCATTATGCAAAGCA
CTGATATGGCTTATTTAAACGAGTACGGGGCTCTAGTGCAGCTCGACTAGAGCCCTGTAATGGTACTGAT
ACACAACATGTGTATCGTGCTTTTGACATCTACAACAAGGATGTTGCTTGTCTAGGTAAATTCCTCAAGG
TGAACTGTGTTCGCCTGAAGAATTTGGATAAGCATGATGCATTCTATGTTGTCAAAAGATGTACCAAGTC
TGCGATGGAACACGAGCAATCCATCTATAGCAGACTTGAAAAGTGTGGGGCCATAGCCGAACACGATTTC
TTCACTTGGAAGGATGGTCGTGCAATCTATGGTAACGTTTGTAGAAAGGATCTTACCGAGTATACTATGA
TGGATCTGTGTTACGCTTTACGTAACTTTGATGAAAACAATTGCGATGTTCTTAAGAGCATTTTGATTAA
GGTAGGTGCTTGTGAGGAGTCCTACTTTAATAATAAAGTCTGGTTTGACCCTGTTGAAAATGAAGACATT
CATCGTGTCTATGCATTGTTAGGTACCATTGTTGCACGTGCTATGCTTAAATGCGTTAAGTTCTGTGATG
CAATGGTTGAACAAGGTATAGTTGGTGTTGTCACATTAGATAATCAGGATCTTAATGGTGATTTTTATGA
TTTTGGTGATTTTACTTGTAGTATCAAGGGAATGGGTGTACCCATTTGCACATCATATTACTCTTATATG
ATGCCTGTTATGGGTATGACTAATTGCCTTGCTAGTGAGTGTTTTGTTAAGAGTGATATATTTGGTGAGG
ATTTTAAGTCATATGACCTGCTGGAATATGATTTCACGGAGCATAAGACAGCACTCTTCAACAAGTATTT
CAAGTATTGGGGACTGCAATACCACCCTAACTGTGTGGACTGCAGTGATGAGCAGTGCATAGTTCACTGT
GCCAACTTCAATACGTTGTTTTCCACTACCATACCTATTACGGCATTTGGACCTTTGTGTCGCAAGTGCT
GGATTGATGGTGTTCCACTGGTAACTACAGCTGGTTATCATTTTAAACAGTTAGGTATAGTTTGGAATAA
TGACCTCAACTTACACTCTAGCAGGCTCTCTATTAATGAATTACTCCAGTTTTGTAGTGATCCTGCACTG
CTTATAGCATCATCACCAGCCCTTGTTGACCAGCGTACTGTTTGCTTTTCAGTTGCAGCGCTAGGTACAG
GTATGACTAACCAGACTGTGAAACCTGGCCATTTCAATAAGGAGTTTTATGACTTCTTACTTGAGCAAGG
TTTCTTCTCTGAGGGCTCTGAGCTTACTTTAAAGCACTTCTTCTTTGCACAGAAGGTTGATGCAGCTGTT
AAGGATTTTGACTACTATAGGTATAATAGACCCACTGTTCTGGACATCTGCCAAGCTCGCGTCGTGTATC
AAATAGTGCAACGCTATTTTGATATTTACGAGGGTGGTTGTATCACTGCTAAAGAAGTGGTTGTTACAAA
CCTTAACAAGAGCGCAGGCTATCCTTTGAACAAGTTTGGTAAAGCTGGTCTTTACTATGAGTCTTTATCC
TATGAGGAACAGGATGAACTTTATGCTTATACTAAGCGTAACATCCTGCCCACTATGACACAGCTCAACC
TTAAATACGCTATTAGTGGCAAAGAACGTGCACGCACAGTGGGTGGTGTCTCGCTTTTGTCAACCATGAC
CACTCGGCAGTATCATCAGAAACACCTTAAATCCATAGTTAATACTAGGGGCGCTTCGGTTGTTATTGGT
ACTACTAAGTTTTATGGTGGTTGGGACAATATGCTTAAGAACCTTATTGATGGTGTTGAAAATCCGTGTC
TTATGGGTTGGGATTACCCAAAGTGCGATAGAGCACTGCCCAATATGATACGCATGATTTCAGCCATGAT
CTTAGGCTCTAAGCACACCACATGCTGCAGTTCTACTGACCGCTTTTTCAGGTTGTGCAATGAATTGGCT
CAAGTCCTTACTGAGGTTGTTTATTCTAATGGAGGGTTTTATTTGAAGCCAGGTGGTACTACCTCTGGTG
ATGCAACCACCGCATATGCAAACTCAGTTTTCAATATCTTCCAAGCAGTAAGTGCCAATGTTAACAAACT
TCTTAGTGTTGACAGCAATGTCTGTCATAACTTAGAAGTTAAGCAATTACAACGTAAGCTCTATGAGTGC
TGTTATAGATCGACTATCGTCGATGACCAGTTCGTCGTTGAGTATTATGGTTACTTGCGTAAACATTTTT
CAATGATGATTCTTTCTGATGATGGCGTTGTTTGTTATAACAATGACTATGCATCACTTGGTTATGTCGC
GGATCTTAACGCATTCAAGGCTGTTTTGTATTACCAGAACAACGTCTTCATGAGCGCCTCTAAATGTTGG
ATCGAGCCTGACATTAATAAAGGTCCTCATGAATTTTGTTCGCAGCATACTATGCAGATTGTCGATAAGG
AGGGTACTTATTACCTTCCTTACCCTGATCCTTCAAGAATCCTCTCTGCAGGTGTGTTTGTTGATGACGT
TGTTAAAACTGATGCAGTTGTATTGCTTGAACGTTATGTGTCATTGGCTATAGATGCCTACCCGTTATCT
AAGCATGAAAACCCTGAATATAAGAAGGTGTTTTATGTGCTTTTGGATTGGGTTAAGCATCTGTATAAAA
CTTTGAATGCTGGTGTGTTAGAGTCTTTTTCTGTCACACTTTTGGAAGATTCTACTGCTAAATTCTGGGA
TGAGAGCTTTTATGCCAACATGTATGAGAAATCTGCAGTTTTACAATCTGCAGGGCTTTGTGTTGTTTGT
GGCTCTCAAACTGTTTTACGTTGTGGTGATTGTCTACGGCGTCCTATGCTTTGTACTAAGTGTGCTTATG
ATCATGTCATTGGAACAACTCACAAGTTCATTTTGGCCATCACTCCATATGTGTGTTGTGCTTCAGATTG
TGGTGTCAATGATGTAACCAAGCTCTACTTAGGTGGTCTTAGTTACTGGTGTCATGAACACAAGCCACGT
CTTGCATTCCCGTTGTGCTCTGCTGGTAATGTTTTTGGCTTATACAAAAATTCTGCTACCGGTTCACCCG
ATGTTGAAGACTTTAATCGCATTGCTACATCCGATTGGACTGATGTTTCTGACTACAGGTTGGCAAATGA
TGTCAAGGACTCATTGCGTCTATTTGCAGCGGAAACTATCAAGGCCAAGGAGGAGAGCGTTAAGTCATCC
TATGCTTGTGCAACACTACATGAGGTTGTAGGACCTAAAGAGTTGTTGCTCAAATGGGAAGTCGGCAGAC
CCAAACCACCTCTTAATAGAAATTCGGTTTTCACTTGTTATCATATAACGAAGAACACCAAATTTCAAAT
CGGTGAGTTTGTGTTTGAGAAGGCAGAATATGATAATGACGCTGTAACATATAAAACTACCGCCACAACA
AAACTTGTTCCTGGCATGGTTTTTGTGCTTACCTCACATAATGTTCAGCCATTGCGTGCACCAACCATTG
CTAATCAAGAACGTTATTCCACTATACATAAGTTGCATCCTGCTTTTAACATACCTGAAGCTTATTCTAG
CTTAGTGCCCTATTACCAATTGATTGGTAAGCAGAAGATTACAACTATCCAGGGACCCCCCGGTAGTGGT
AAATCTCACTGTGTTATAGGGCTAGGTTTGTACTATCCAGGTGCACGTATTGTGTTTACAGCTTGTTCTC
ATGCAGCGGTCGATTCACTCTGTGTGAAGGCCTCCACTGCTTATAGCAATGACAAATGTTCACGCATCAT
ACCACAGCGTGCTCGTGTTGAGTGTTATGATGGTTTCAAGTCTAATAATACTAGTGCTCAGTACCTTTTC
TCCACTGTCAATGCTTTGCCAGAGTGTAATGCGGACATTGTTGTGGTGGATGAAGTTTCTATGTGCACTA
ATTATGACTTGTCTGTCATAAATCAGCGCATCAGCTATAGGCATGTAGTCTATGTTGGTGACCCTCAACA
GCTGCCTGCACCACGTGTTATGATTTCACGTGGTACTTTGGAACCAAAGGACTACAATGTTGTCACTCAA
CGTATGTGTGCCCTTAAGCCTGATGTCTTCTTGCACAAGTGTTATCGCTGTCCTGCAGAGATAGTGCGCA
CTGTGTCTGAGATGGTCTATGAAAACCAATTCATTCCTGTGCACCCTGACAGCAAGCAGTGTTTTAAGAT
CTTTTGCAAGGGTAATGTGCAGGTTGATAACGGTTCAAGTATTAACCGCAGGCAATTGGATGTTGTGCGT
ATGTTTTTGGCTAAAAATCCTAGGTGGTCAAAGGCTGTTTTCATTTCCCCTTATAACAGCCAGAATTATG
TTGCCAGCCGTTTGCTAGGTTTACAAATTCAGACAGTTGATTCATCCCAGGGTAGTGAGTATGACTATGT
CATTTACGCACAAACCTCAGATACTGCCCATGCCAGTAATGTTAACAGGTTTAATGTTGCCATCACAAGG
GCTAAGAAAGGCATATTATGTATAATGTGCGATAGGTCCCTTTTTGATCTGCTTAAATTTTTTGAGCTTA
AATTGTCTGATTTGCAGGCTAATGAGGGTTGTGGTCTTTTTAAAGACTGTAGCAGAGGTGATGATTTGTT
GCCACCGTCTCATGCTAATACCTTCATGTCTTTAGCGGACAATTTTAAGACTGATCAATATCTTGCTGTT
CAAATAGGTGTTAATGGACCCATTAAATATGAGCATGTTATCTCGTTTATGGGTTTCCGTTTTGATATTA
ACATACCCAACCACCACACTCTCTTTTGCACACGCGACTTTGCCATGCGCAATGTTAGAGGTTGGTTGGG
TTTTGACGTTGAAGGAGCACATGTTGTTGGCTCTAACGTCGGTACAAATGTCCCATTGCAATTAGGGTTT
TCTAACGGTGTTGATTTTGTTGTCAGACCTGAAGGTTGCGTTGTAACTGAGTCTGGTGACTACATTAAAC
CCGTCAGAGCTCGTGCTCCACCAGGGGAACAATTCGCACACCTTTTGCCTTTACTTAAACGCGGCCAACC
ATGGGATGTGGTTCGCAAGCGTATAGTTCAAATGTGTAGTGACTACCTGGCTAACCTATCAGACATACTA
ATTTTTGTGTTGTGGGCTGGTGGTTTGGAGTTGACAACTATGCGTTACTTTGTCAAGATTGGACCAAGCA
AGAGTTGTGATTGTGGTAAGGTTGCTACTTGTTACAATAGTGCGCTGCATACGTACTGTTGTTTCAAACA
TGCCCTTGGTTGTGATTATCTGTATAACCCATACTGTATTGATATACAGCAGTGGGGATACAAGGGATCA
CTTAGCCTTAACCACCATGAGCATTGTAATGTACATAGAAACGAGCATGTGGCTTCTGGTGATGCCATAA
TGACTCGCTGTCTGGCCATACATGATTGCTTTGTCAAGAACGTTGACTGGTCCATCACATACCCATTTAT
TGGTAATGAGGCTGTTATTAATAAGAGCGGCCGCATTGTGCAATCACACACTATGCGTTCAGTTCTTAAG
TTATACAATCCAAAAGCCATATATGATATTGGCAATCCTAAGGGCATTAGATGCGCCGTAACGGATGCTA
AGTGGTTCTGCTTTGACAAGAATCCTACTAATTCTAATGTCAAGACATTGGAGTATGACTATATAACACA
CGGCCAATTTGATGGGTTGTGCTTGTTTTGGAATTGCAATGTGGACATGTATCCAGAATTTTCTGTGGTC
TGTCGTTTTGATACTCGCTGTAGGTCACCACTCAACTTGGAGGGTTGTAATGGTGGTTCACTGTATGTTA
ACAATCATGCATTCCACACACCGGCTTTTGACAAGCGTGCTTTTGCTAAGTTGAAGCCAATGCCATTTTT
CTTCTATGATGATACTGAGTGTGACAAGTTACAGGACTCCATAAACTATGTTCCTCTTAGGGCTAGTAAC
TGCATTACTAAATGTAATGTTGGTGGAGCTGTTTGTAGTAAGCATTGTGCTATGTATCATAGCTATGTCA
ATGCTTACAACACCTTTACGTCAGCGGGCTTTACGATTTGGGTGCCCACTTCGTTTGACACCTATAATCT
GTGGCAGACATTTAGTAACAATTTGCAAGGTCTTGAGAACATTGCTTTCAATGTTTTAAAGAAAGGATCT
TTTGTTGGTGATGAAGGTGAGCTTCCTGTAGCTGTGGTCAATGACAAAGTGCTCGTTAGAGATGGTACTG
TTGATACTCTTGTTTTTACAAACAAGACATCACTACCCACTAACGTAGCTTTTGAGTTGTATGCCAAGCG
TAAGGTAGGACTCACCCCTCCCATTACGATCCTACGTAACTTGGGTGTTGTTTGTACATCTAAGTGTGTC
ATTTGGGACTATGAAGCCGAACGTCCACTTACTACTTTTACAAAGGATGTCTGTAAATATACCGACTTTG
AGGGTGACGTTTGTACACTCTTTGATAACAGCATTGTTGGTTCATTAGAGCGATTCTCTATGACCCAGAA
TGCTGTGCTTATGTCACTTACAGCTGTTAAAAAGCTTACTGGCATAAAGTTAACTTATGGCTATCTTAAT
GGTGTCCCAGTTAACACACATGAAGATAAACCTTTTACTTGGTATATTTACACTAGGAAGAACGGCAAGT
TCGAGGACTATCCTGATGGCTATTTTACCCAAGGTAGAACAACCGCTGATTTTAGCCCTCGTAGCGACAT
GGAAAAGGACTTCCTAAGTATGGATATGGGTTTGTTTATTAACAAGTACGGACTTGAAGATTACGGCTTT
GAGCACGTTGTGTATGGTGATGTTTCAAAAACCACCCTTGGTGGTTTACATCTACTAATTTCGCAGGTGC
GTCTGGCCTGTATGGGTGTGCTTAAAATAGACGAGTTTGTGTCTAGTAATGATAGCACGTTAAAGTCATG
TACTGTTACATATGCTGACAACCCTAGTAGTAAGATGGTTTGCACGTATATGGATCTCCTGCTTGACGAT
TTTGTTAGCATTCTTAAATCTTTGGATTTGAGCGTTGTATCTAAGGTTCATGAAGTTATGGTTGATTGTA
AAATGTGGAGGTGGATGTTGTGGTGTAAGGATCATAAACTCCAGACATTTTATCCACAACTTCAAGCCAG
TGAATGGAAGTGTGGTTATTCCATGCCTTCTATTTACAAGATACAACGTATGTGCTTAGAACCTTGCAAT
CTCTATAACTATGGTGCTGGTGTTAAGTTACCTGATGGCATTATGTTTAACGTAGTTAAATACACACAGC
TTTGTCAATATCTCAATAGCACCACAATGTGTGTACCCCATCACATGCGTGTGCTACATCTTGGTGCTGG
CTCCGATAAGGGTGTTGCACCTGGCACGGCTGTCTTACGACGTTGGTTGCCACTGGATGCCATTATAGTT
GACAATGATAGTGTGGATTACGTTAGCGATGCTGATTATAGTGTTACAGGAGATTGCTCTACCTTATACC
TGTCAGATAAGTTTGACTTAGTTATATCTGATATGTATGATGGTAAGATTAAAAGTTGTGATGGGGAGAA
CGTGTCTAAAGAAGGCTTCTTTCCCTATATTAATGGTGTTATCACTGAAAAGTTGGCACTTGGTGGTACT
GTAGCTATTAAGGTGACGGAGTTTAGTTGGAATAAGAAGTTGTATGAACTCATTCAGAAGTTTGAGTATT
GGACAATGTTCTGTACCAGTGTTAACACGTCATCGTCAGAGGCATTTTTAATTGGTGTTCACTATTTAGG
TGATTTTGCAAGTGGCGCTGTGATTGACGGCAACACCATGCATGCCAATTATATCTTCTGGCGTAATTCC
ACAATTATGACTATGTCTTACAACAGTGTGCTTGATTTAAGCAAGTTCAATTGTAAGCATAAGGCTACAG
TTGTTGTTAATTTAAAAGACTCATCCATTAGTGATGTTGTGTTAGGCTTGTTGAAGAATGGTAAGTTGCT
AGTGCGTAATAATGACGCCATTTGTGGCTTTTCTAATCATTTGGTCAACGTAAACAAATGAGGTCTTTAA
TTTACTTCTGGTTGCTCTTACCAGTACTTCCAACACTCAGCCTACCACAAGATGTCACTAGGTGCCAGTC
TACTACTAACTTTAGGCGGTTCTTTTCAAAATTTAATGTTCAGGCACCTGCCGTCGTCGTTTTGGGTGGT
TACCTACCTAGTATGAACTCTTCTAGCTGGTACTGTGGCACAGGCATTGAAACTGCTAGTGGCGTTCATG
GTATTTTTCTCAGCTACATCGATTCTGGTCAGGGCTTTGAGATTGGCATTTCGCAAGAGCCGTTTGATCC
TAGTGGTTACCAGCTTTATTTACATAAGGCCACTAATGGTAACACTAATGCTATTGCACGACTGCGCATT
TGCCAGTTTCCCGATAATAAAACATTGGGCCCTACTGTTAATGATGTTACAACAGGTCGTAACTGCCTAT
TCAACAAAGCCATTCCAGCTTATATGCGTGATGGAAAAGATATTGTTGTCGGCATAACATGGGATAATGA
TCGTGTCACTGTTTTTGCTGACAAGATCTATCATTTTTATCTTAAAAATGATTGGTCCCGCGTTGCGACA
AGATGTTACAATCGCAGAAGTTGTGCTATGCAATATGTTTATACACCTACCTACTACATGCTTAATGTTA
CTAGTGCAGGTGAGGATGGCATTTATTATGAACCCTGTACAGCTAATTGCACTGGTTACGCTGCCAATGT
ATTTGCCACTGATTCCAATGGCCATATACCAGAAGGTTTTAGTTTTAATAATTGGTTTCTTTTATCCAAT
GACTCCACTTTGTTGCATGGTAAAGTGGTTTCCAACCAACCCTTGTTGGTCAATTGTCTTTTGGCCATTC
CTAAGATTTATGGACTAGGCCAATTTTTCTCATTCAATCACACGATGGATGGCGTTTGTAATGGAGCTGC
TGTGGATCGTGCCCCAGAGGCTCTGAGGTTTAATATTAATGACACCTCCGTCATTCTTGCTGAAGGCTCA
ATTGTACTTCATACTGCTTTAGGAACAAATCTTTCTTTTGTTTGCAGTAATTCCTCAGATCCTCATTTAG
CCATCTTTGCCATACCTCTGGGTGCTACTGAAGTACCCTACTATTGCTTTCTTAAAGTGGATACTTACAA
CTCCACTGTTTATAAATTCTTGGCTGTTTTACCTCCTACTGTCAGGGAAATTGTCATCACCAAGTATGGT
GATGTTTATGTCAATGGGTTTGGCTATTTGCATCTCGGTTTGTTGGATGCTGTCACAATTAATTTCACTG
GTCATGGCACTGACGATGACGTTTCAGGTTTCTGGACCATAGCATCGACTAATTTTGTTGATGCACTCAT
CGAGGTTCAAGGAACTTCCATTCAGCGTATTCTTTATTGTGATGATCCTGTTAGCCAACTCAAGTGTTCT
CAGGTTGCTTTTGACCTTGACGATGGTTTTTACCCCATCTCTTCTAGAAACCTTCTGAGTCACGAACAGC
CAATTTCTTTTGTTACTTTGCCATCATTTAATGATCATTCTTTTGTTAATATTACTGTCTCTGCGGCTTT
TGGTGGTCTTAGTAGTGCCAATCTCGTTGCATCTGACACTACTATCAATGGGTTTAGTTCTTTCTGTGTT
GACACTAGACAATTTACCATTACACTGTTTTATAATGTTACAAACAGTTATGGTTATGTGTCTAAATCAC
AGGATAGTAATTGTCCTTTCACCTTGCAATCTGTTAATGATTACCTGTCTTTTAGCAAATTTTGTGTTTC
AACCAGCCTTTTGGCTGGTGCTTGTACCATAGATCTTTTTGGTTACCCTGCGTTCGGTAGTGGTGTTAAG
TTGACGTCCCTTTATTTTCAATTCACAAAAGGTGAGTTGATTACTGGCACGCCTAAACCACTTGAAGGTA
TCACAGACGTTTCTTTTATGACTCTGGATGTGTGTACCAAGTATACTATCTATGGCTTTAAAGGTGAGGG
TATTATTACCCTTACAAATTCTAGCATTTTGGCAGGTGTTTATTATACATCTGATTCTGGACAGTTGTTA
GCCTTTAAGAATGTCACTAGTGGTGCTGTTTATTCTGTCACGCCATGTTCTTTTTCAGAGCAGGCTGCAT
ATGTTAATGATGATATAGTGGGTGTTATTTCTAGTTTGTCTAACTCCACTTTTAACAATACTAGGGAGTT
GCCTGGTTTCTTCTACCATTCTAATGACGGCTCCAATTGTACAGAGCCTGTGTTGGTGTATAGTAACATA
GGTGTTTGTAAATCTGGCAGTATTGGCTATGTTCCATCTCAGTATGGCCAAGTCAAGATTGCACCCACGG
TTACTGGGAATATTAGTATTCCCACCAACTTTAGTATGAGTATTAGAACAGAATATTTACAGCTTTACAA
CACGCCTGTTAGTGTTGATTGTGCTACATATGTTTGTAATGGTAACTCTCGTTGTAAACAATTACTCACC
CAGTACACTGCAGCATGTAAGACCATAGAGTCAGCATTACAACTCAGCGCTAGGCTTGAGTCTGTTGAAG
TTAACTCTATGCTTACCATTTCTGAAGAGGCTTTACAGTTAGCTACCATCAGTTCGTTTAATGGTGATGG
ATATAACTTTACTAATGTGCTGGGTGCTTCCGTGTACGATCCTGCAAGTGGCAGGGTGGTACAAAAAAGG
TCTGTTATTGAAGACTTGCTTTTTAATAAAGTGGTTACTAATGGCCTTGGTACTGTTGATGAAGACTATA
AGCGCTGTTCTAATGGTCGCTCTGTGGCTGATCTAGTCTGTGCGCAGTATTACTCTGGTGTCATGGTACT
ACCTGGCGTTGTTGACGCTGAGAAGCTTCACATGTACAGTGCGTCTCTCATAGGTGGTATGGCGCTAGGA
GGTATAACTGCTGCAGCGGCATTGCCTTTTAGCTATGCTGTTCAAGCGAGACTCAATTATCTTGCTTTAC
AGACGGATGTTCTACAGCGGAACCAGCAATTGCTTGCTGAGTCTTTTAACTCTGCTATTGGTAATATAAC
TTCAGCCTTTGAGAGTGTTAAAGAGGCTATTAGTCAAACTTCCAAGGGTTTGAACACTGTGGCTCATGCG
CTTACTAAGGTTCAAGAGGTTGTTAATTCGCAGGGTTCAGCTTTGAACCAACTTACCGTACAGCTGCAAC
ACAACTTCCAAGCCATTTCTAGTTCTATTGATGACATTTATTCCCGACTGGACATTCTTTCAGCCGATGT
TCAGGTTGATCGTCTCATCACCGGCAGATTATCAGCACTTAATGCTTTTGTTGCCCAAACCCTCACTAAG
TATACTGAGGTTCAGGCTAGCAGGAAGCTAGCACAGCAAAAGGTTAATGAGTGCGTCAAATCGCAATCTC
AGCGTTACGGTTTTTGTGGTGGTGATGGCGAGCACATTTTCTCTCTGGTACAGGCCGCACCTCAGGGCCT
GCTGTTCTTACATACAGTACTTGTACCGGGTGATTTTGTAAATGTTCTTGCCATCGCTGGCTTATGCGTT
AATGGTGAAATTGCCTTGACTCTACGTGAGCCTGGCTTAGTCTTGTTTACGCATGAACTTCAAACTTATA
CTGCGACGGAATATTTTGTTTCATCGCGACGTATGTTTGAACCTAGAAAACCTACCGTTAGTGATTTTGT
TCAAATTGAGAGTTGTGTGGTCACCTATGTCAATCTGACTAGCGACCAGCTACCAGATGTAATCCCAGAT
TACATCGATGTTAACAAAACACTTGATGAGATTTTAGCTTCTCTGCCCAATAGAACTGGTCCAAGTCTTC
CCCTAGATGTTTTTAATGCCACTTATCTTAATCTTACTGGTGAAATTGCAGATCTAGAGCAGCGTTCAGA
GTCTCTCCGTAATACTACAGAAGAGCTCCGAAGTCTCATTAACAACATCAACAACACACTTGTTGACCTT
GAGTGGCTCAACCGAGTTGAGACATACATCAAGTGGCCGTGGTGGGTTTGGTTGATCATTGTTATTGTTC
TCATCTTTGTTGTGTCATTACTAGTGTTCTGCTGCATTTCCACGGGTTGTTGTGGATGCTGCGGTTGCTG
CGGTGCTTGTTTTTCAGGTTGTTGTAGGGGTCCTAGACTTCAACCTTACGAAGCTTTTGAAAAGGTCCAC
GTGCAGTGATGTTTCTTGGACTTTTTCAATACACGATTGACACAGTTGTCAAAGATGTCTCGAAGTCTGT
CAACTTGTCTTTGGATGCTGTCCAAGAGTTGGAGCTCAATGTAGTTCCAATTAGACAAGCTTCAAATGTG
ACGGGTTTTCTTTTCACCAGTGTTTTTGTTTACTTCTTTGCACTGTTTAAAGCGTCTTCTTTGAGGCGCA
ATTATATTATGTTGGCAGCGCGTTTTGCTGTCGTCTTTCTCTATTGCCCACTTTTATATTACTGTGGTGC
ACTTTTAGATGCAACTATTATTTGTTGCGCACTTATTGGCAGGCTTTGTTTAGTCTGCTTTTACTCCTGG
CGCTATAAAAATGCGCTTTTTATTATCTTTAATACTACGACACTTTCTTTTCTCAATGGTAAAGCAGCTT
ATTATGACGGCAAATCCATTGTGATTCTAGAAGGTGGCGACCATTACATCACTTTTGGCAACTCTTTTGT
TGCTTTCGTTAGTAACATTGACTTGTATCTAGCTATACGTGGGCGGCAAGAAGCTGACCTACATCTGTTG
CGAACTGTTGAGCTTCTTGATGGCAAGAAGCTTTATGTCTTTTCGCAACATCAAATTGTTGGCATTACTA
ATGCTGCATTTGACTCAATTCAACTAGACGAGTATGCTACAATTAGTGAATGATAATGGTCTAGTAGTTA
ATGTTATACTTTGGCTTTTCGTACTCTTTTTCCTGCTTATTATAAGCATTACCTTCGTCCAATTGGTTAA
TCTGTGCTTCACTTGTCACCGGTTGTGTAATAGCGCAGTTTATACACCTATAGGGCGCCTGTATAGAGTT
TATAAGTCTTACATGCGAATTGACCCCCTCCCCAGTACTGTTATTGACGTATAAACGAAATATGTCTAAC
GGTTCTATTCCCGTTGATGAGGTGATTGAACACCTTAGAAACTGGAATTTCACATGGAATATCATACTGA
CGATACTACTTGTAGTGCTTCAGTATGGCCATTACAAGTACTCTGTGTTCTTGTATGGTGTCAAGATGGC
TATTCTATGGATACTTTGGCCTCTTGTGTTGGCACTGTCACTTTTTGACGCATGGGCTAGCTTCCAGGTC
AACTGGGTCTTTTTCGCTTTCAGCATCCTTATGGCTTGCATCACTCTTATGCTGTGGATAATGTATTTTG
TCAATAGCATTCGGTTGTGGCGCAGGACACATTCTTGGTGGTCTTTCAATCCTGAAACTGACGCGCTTCT
CACTACTTCTGTGATGGGCCGACAGGTCTGCATTCCAGTGCTTGGAGCACCAACTGGTGTAACGCTAACA
CTCCTTAGTGGTACATTGCTTGTAGAGGGCTATAAGGTTGCTACTGGCGTACAGGTAAGTCAATTACCTA
ATTTCGTCACAGTCGCCAAGGCCACTACAACAATTGTCTACGGACGTGTTGGTCGTTCAGTCAATGCTTC
ATCTGGCACTGGTTGGGCTTTCTATGTCCGGTCAAAACACGGCGACTATTCAGCTGTGAGTAATCCGAGT
GCGGTTCTCACAGATAGTGAGAAAGTGCTTCATTTAGTCTAAACAGAAACTTTATGGCTTCTGTCAGCTT
TCAGGATCGTGGCCGCAAACGGGTGCCATTATCTCTCTATGCCCCTCTTAGGGTTACTAATGACAAGCCC
CTTTCTAAGGTACTTGCAAACAACGCTGTACCCACTAACAAGGGGAATAAGGACCAGCAAATTGGGTACT
GGAATGAGCAAATTCGCTGGCGCATGCGCCGTGGTGAGCGAATTGAACAACCTTCCAATTGGCATTTCTA
CTACCTCGGAACAGGACCTCACGGCGACCTCCGTTATAGGACTCGTACTGAGGGTGTTTTCTGGGTTGCT
AAAGAAGGCGCAAAGACTGAACCCACTAATTTGGGTGTCAGAAAGGCGTCTGAAAAGCCAATCATTCCAA
AATTCTCTCAACAGCTCCCCAGTGTAGTTGAGATTGTTGAACCTAACACACCTCCTGCTTCACGTGCAAA
TTCGCGTAGCAGGAGTCGTGGCAATGGCAACAATAGGTCTAGATCTCCAAGTAACAACAGAGGCAATAAC
CAGTCCCGTGGTAATTCACAGAATCGTGGAAATAACCAGGGTCGTGGAGCTTCTCAGAACAGAGGAGGCA
ATAATAATAACAATAACAAGTCTCGTAACCAGTCCAATAACAGGAACCAGTCAAATGACCGTGGTGGTGT
AACATCACGCGATGATCTGGTGGCTGCTGTCAAGGATGCACTTAAATCTTTGGGTATTGGAGAAAATCCT
GACAGGCATAAGCAACAGCAGAAGCCTAAGCAGGAAAAGTCTGACAACAGCGGCAAAAATACACCTAAGA
AGAACAAATCCAGGGCCACTTCGAAGGAACGTGACCTCAAAGACATCCCAGAGTGGAGGAGAATTCCCAA
GGGCGAAAATAGCGTAGCAGCTTGCTTCGGACCCAGAGGGGGCTTCAAAAACTTTGGAGATGCGGAATTT
GTCGAAAAAGGTGTTGATGCGTCAGGCTATGCTCAGATCGCCAGTTTAGCACCAAATGTTGCAGCATTGC
TCTTTGGTGGTAATGTGGCTGTTCGTGAGCTAGCGGACTCTTACGAGATTACATACAACTATAAAATGAC
TGTGCCAAAGTCAGATCCAAATGTTGAGCTTCTTGTTTCACAGGTGGATGCATTTAAAACTGGGAATGCA
AAACTCCAGAGAAAGAAGGAAAAGAAGAACAAGCGTGAAACCACGCTGCAGCAGCATGAAGAGGCCATCT
ACGATGATGTGGGTGCGCCATCTGATGTGACCCATGCCAATCTGGAATGGGACACAGCTGTTGATGGTGG
TGATACGGCCGTTGAAATTATCAACGAGATCTTCGATACAGGAAATTAAACAATGTTAGACCGGCTTATC
CTGGCTATGTTCCAGGGTAGTGCCATTACACTGTTATTACTGAGTGTTTTTCTAGCGACTTGGCTGCTGG
GCTATGGCTTTGCCCTCTAACCAGCGGTCTTGGTCTTGCACACAACGGTAAGCCAGTGGTAATGTCAGTG
CAAGAAGGATATTACCATAGCACTGTCACGAGGGGAACGCAGTACCTTTTCATCTAAACCTTTGCACGAG
TAATTAAAGATCCGCTTGACGAGCCTATATGGAAGAGCGTGCCAGGTATTTGACTTAAGGACTGTTAGTA
ACTGAAGACCTGACGGTGTTGATATGGATACAC

>gi|15081544|ref|NC_003045.1| Bovine coronavirus, complete genome
GATTGCGAGCGATTTGCGTGCGTGCATCCCGCTTCACTGATCTCTTGTTAGATCTTTTCATAATCTAAAC
TTTATAAAAACATCCACTCCCTGTAGTCTATGCCTGTGGGCGTAGATTTTTCATAGTGGTGTCTATATTC
ATTTCTGCTGTTAACAGCTTTCAGCCAGGGACGTGTTGTATCCTAGGCAGTGGCCCACCCATAGGTCACA
ATGTCGAAGATCAACAAATACGGTCTCGAACTACACTGGGCTCCAGAATTTCCATGGATGTTTGAGGACG
CAGAGGAGAAGTTGGACAACCCTAGTAGTTCAGAGGTGGATATAGTATGCTCCACCACTGCGCAAAAGCT
GGAAACAGGCGGAATTTGTCCTGAAAATCATGTGATGGTGGATTGTCGCCGACTTCTTAAACAAGAATGT
TGTGTGCAGTCTAGCCTAATACGTGAAATTGTTATGAATACACGTCCATATGATTTGGAGGTGCTACTTC
AAGATGCTTTGCAGTCCCGCGAAGCAGTTTTGGTTACACCCCCTCTAGGTATGTCTCTGGAGGCATGCTA
TGTGAGAGGTTGTAATCCTAATGGATGGACCATGGGTTTGTTTCGGCGTAGAAGTGTGTGTAACACTGGT
CGCTGCGCTGTTAACAAGCATGTGGCCTATCAGCTATATATGATTGACCCTGCGGGTGTCTGTTTTGGTG
CAGGTCAATTTGTGGGTTGGGTTATACCCTTAGCCTTTATGCCTGTGCAATCCCGGAAATTTATTGTTCC
TTGGGTTATGTACTTGCGTAAGTGTGGCGAAAAGGGTGCCTACAACAAAGATCATAAACGTGGCGGTTTT
GAACACGTTTATAATTTTAAAGTTGAGGATGCTTACGACTTGGTTCATGATGAGCCTAAGGGTAAGTTTT
CTAAGAAGGCTTATGCTTTAATTAGAGGATACCGTGGTGTTAAACCGCTTCTTTATGTAGACCAGTATGG
TTGTGATTATACTGGTGGTCTTGCAGATGGCTTAGAGGCTTATGCTGATAAGACATTGCAAGAAATGAAG
GCATTATTTCCTATTTGGAGCCAGGAACTCCCTTTTGATGTAACTGTGGCATGGCACGTTGTGCGTGATC
CACGTTATGTTATGAGACTGCAAAGTGCTTCTACTATACGTAGTGTTGCATATGTTGCTAACCCTACTGA
AGACTTGTGTGATGGTTCTGTTGTTATAAAGGAACCTGTGCATGTTTATGCGGATGACTCTATTATTTTA
CGTCAACATAATTTAGTTGACATTATGAGTTGTTTTTATATGGAGGCAGATGCAGTTGTAAATGCTTTTT
ATGGTGTTGATTTGAAAGATTGTGGTTTTGTTATGCAGTTTGGTTATATTGACTGCGAACAAGACTTGTG
TGATTTTAAAGGTTGGGTTCCTGGTAATATGATAGATGGTTTTGCTTGCACTACTTGTGGTCATGTCTAT
GAGACAGGTGATTTGCTAGCACAATCTTCAGGTGTTCTGCCTGTTAATCCTGTATTGCATACTAAGAGTG
CAGCAGGTTATGGTGGTTTTGGTTGTAAGGATTCTTTTACCCTGTATGGCCAAACTGTAGTTTATTTTGG
AGGTTGTGTGTATTGGAGTCCAGCACGTAATATATGGATTCCTATATTAAAATCTTCTGTTAAGTCTTAT
GACGGTTTGGTTTATACTGGAGTTGTAGGTTGCAAGGCTATTGTAAAGGAAACAAATCTCATTTGCAAAG
CGTTGTACCTTGATTATGTTCAACACAAGTGTGGCAATTTACACCAGCGGGAGTTGCTAGGTGTGTCAGA
TGTGTGGCATAAACAATTGTTATTAAATAGAGGTGTGTACAAACCTCTTTTAGAGAATATTGATTATTTT
AATATGCGGCGCGCTAAATTTAGTTTAGAAACTTTTACTGTTTGTGCAGATGGTTTTATGCCTTTTCTTT
TAGATGATTTGGTTCCGCGCGCATATTATTTGGCAGTAAGTGGTCAAGCATTTTGTGACTACGCAGATAA
AATCTGCCATGCTGTTGTGTCTAAGAGTAAAGAGTTACTTGATGTGTCTCTGGATTCTTTAAGTGCAGCT
ATACATTATTTGAATTCTAAAATTGTTGATTTGGCTCAACATTTTAGTGATTTTGGAACAAGTTTTGTTT
CTAAAATTGTTCATTTCTTTAAGACTTTTACTACTAGCACTGCTCTTGCATTTGCATGGGTTTTATTTCA
TGTTTTGCATGGTGCTTATATAGTAGTAGAGAGTGATATATATTTTGTTAAAAACATTCCTCGTTATGCT
AGTGCTGTTGCACAAGCATTTCGGAGTGTTGCTAAAGTTGTACTGGACTCTTTAAGAGTTACTTTTATTG
ATGGCCTTTCTTGTTTTAAGATTGGACGTAGAAGAATTTGTCTCTCAGGCAGTAAAATTTATGAAGTTGA
GCGTGGCTTGTTACATTCATCTCAATTGCCATTAGATGTTTATGATTTAACCATGCCTAGTCAAGTTCAG
AAAGCCAAGCAAAAACCTATTTATTTAAAAGGTTCTGGTTCTGATTTTTCATTAGCAGATAGTGTGGTTG
AAGTTGTTACAACTTCACTTACACCATGTGGTTATTCTGAACCACCTAAAGTTGCAGATAAAATTTGCAT
TGTGGATAATGTTTATATGGCCAAGGCTGGTGACAAATATTACCCTGTTGTGGTTGATGGTCATGTAGGA
CTCTTGGATCAAGCATGGAGGGTTCCTTGTGCTGGAAGGCGTGTTACATTTAAGGAACAGCCTACAGTAA
ATGAGATTGCAAGCACACCTAAGACTATTAAAGTTTTTTATGAGCTTGACAAAGATTTTAATACTATTTT
AAACACTGCATGTGGAGTGTTTGAAGTAGATGATACCGTGGATATGGAGGAATTTTATGCTGTGGTGATT
GATGCCATAGAAGAGAAACTTTCTCCATGTAAGGAGCTTGAAGGTGTAGGTGCTAAAGTTAGTGCCTTTT
TACAGAAATTAGAGGATAATTCCCTATTTTTATTTGATGAGGCTGGCGAGGAAGTTCTTGCTTCTAAATT
GTATTGTGCTTTTACAGCTCCTGAAGATGATGACTTTCTTGAAGAAAGTGGTGTTGAAGAAGATGATGTA
GAAGGTGAGGAAACTGATTTAACTGTCACAAGTGCTGGAGAGCCTTGTGTTGCCAGTGAACAGGAGGAGT
CTTCTGAAATCTTAGAGGACACTTTGGATGATGGTCCATGTGTGGAGACATCTGATTCACAAGTTGAAGA
AGATGTAGAAATGTCGGATTTTGCTGATCTTGAATCTGTGATTCAGGATTATGAAAATGTTTGTTTTGAG
TTTTATACTACAGAGCCAGAATTTGTTAAAGTTTTGGATCTGTATGTGCCTAAAGCAACTCGCAACAATT
GCTGGTTGCGATCAGTTTTGGCAGTGATGCAGAAACTGCCCTGTCAATTTAAAGATAAAAATTTGCAGGA
TCTTTGGGTGTTATATAAGCAACAGTATAGTCAGTTGTTTGTTGATACCTTGGTTAATAAGATACCTGCT
AATATTGTAGTTCCACAAGGTGGTTATGTTGCCGATTTTGCATATTGGTTCTTAACCTTATGTGATTGGC
AGTGTGTTGCATACTGGAAATGCATTAAATGTGATTTAGCTCTTAAGCTTAAAGGCTTGGATGCTATGTT
CTTTTATGGTGATGTTGTCTCACATGTGTGCAAGTGTGGTGAGTCTATGGTACTTATTGATGTTGATGTG
CCATTTACAGCCCACTTTGCTCTTAAAGATAAGTTGTTTTGTGCATTTATTACTAAGCGTAGTGTGTATA
AAGCAGCTTGTGTTGTGGATGTTAATGATAGTCATTCTATGGCTGTTGTTGATGGTAAACAAATTGATGA
TCATCGTGTCACTAGTATTACTAGTGATAAGTTTGATTTTATTATTGGGCATGGTATGTCATTTTCAATG
ACTACTTTCGAAATTGCCCAATTGTATGGTTCTTGTATAACACCTAATGTATGTTTTGTTAAAGGTGATA
TAATTAAAGTTTCTAAGCGTGTTAAAGCAGAAGTCGTTGTAAATCCTGCTAATGGCCATATGGCACATGG
TGGTGGTGTTGCAAAGGCTATTGCAGTAGCAGCTGGACAGCAGTTTGTTAAAGAGACTACCGATATGGTT
AAGTCTAAAGGAGTTTGTGCTACTGGAGACTGTTATGTCTCTACAGGGGGTAAATTATGTAAAACTGTGC
TTAATGTTGTTGGACCTGATGCGAGAACACAGGGTAAACAAAGTTATGCATTGTTAGAGCGTGTTTATAA
ACATCTTAACAAATATGATTGTGTTGTTACAACTTTGATATCAGCTGGTATATTTAGTGTGCCGTCTGAT
GTGTCTTTAACATATCTACTTGGTACTGCCGAGAAACAAGTTGTTCTTGTTAGCAATAATCAAGAGGATT
TTGATCTTATTTCTAAGTGTCAGATAACTGCCGTTGAGGGCACTAAGAAATTGGCAGAGCGTCTTTCTTT
TAATGTAGGGCGTTCTATCGTTTACGAAACAGATGCTAATAAGTTGATTTTAAGCAATGACGTTGCATTT
GTTTCGACATTTAATGTCTTACAGGATGTTTTATCCTTAAGACATGATATAGCACTTGATGATGATGCAC
GAACCTTTGTTCAGAGCAATGTTGATGTTGTACCTGAGGGTTGGCGTGTTGTCAATAAGTTTTATCAAAT
TAATGGTGTTAGAACCGTTAAGTATTTTGAGTGTCCCGGTGGCATAGATATATGCAGCCAGGATAAAGTT
TTTGGTTATGTACAGCAGGGTAGTTTTAATAAGGCTACTGTTGCTCAAATTAAAGCCTTGTTTTTGGATA
AAGTGGACATCTTGCTAACTGTTGATGGTGTCAATTTCACTAACAGGTTTGTGCCTGTAGGTGAAAGTTT
TGGTAAGAGTCTAGGAAATGTGTTCTGTGATGGAGTTAATGTCACGAAACATAAGTGTGATATAAATTAT
AAAGGTAAAGTCTTTTTCCAGTTTGATAATCTTTCTAGTGAAGATTTAAAGGCTGTAAGAAGTTCTTTTA
ATTTTGATCAGAAGGAATTGCTTGCCTACTACAACATGCTTGTTAATTGTTCTAAATGGCAGGTTGTTTT
TAATGGTAAGTATTTCACTTTTAAGCAAGCTAATAACAATTGTTTTGTTAATGTTTCTTGCTTAATGCTC
CAGAGTTTGAATCTGAAATTTAAAATTGTTCAATGGCAGGAGGCGTGGCTTGAATTTCGTTCTGGCCGCC
CTGCTAGATTTGTATCTTTGGTTTTAGCCAAAGGTGGGTTTAAATTTGGTGATCCTGCTGACTCTAGAGA
TTTCTTGCGTGTTGTGTTTAGTCAAGTTGATTTGACAGGGGCAATATGTGATTTTGAAATTGCATGTAAA
TGTGGTGTAAAGCAGGAACAGCGTACTGGTGTGGACGCTGTTATGCATTTTGGTACATTGAGTCGTGAAG
ATCTTGAGATTGGTTACACCGTGGATTGTTCTTGCGGTAAAAAGCTAATCCATTGTGTACGATTTGATGT
ACCATTTTTAATTTGTAGTAATACACCTGCTAGTGTAAAATTACCTAAGGGTGTAGGAAGTGCAAATATT
TTTAAAGGTGATAAGGTTGGTCATTATGTTCATGTTAAGTGTGAACAGTCTTATCAGCTTTATGATGCTT
CTAATGTTAAGAAGGTTACAGACGTTACTGGCAATTTGTCAGATTGTTTGTATCTTAAAAATTTGAAACA
AACTTTTAAATCGGTGTTAACCACCTATTATTTGGATGATGTTAAGAAAATTGAGTATAACCCTGACTTG
TCACAATATTATTGTGACGGAGGTAAGTATTATACTCAGCGTATTATTAAAGCCCAATTTAAAACATTTG
AGAAAGTAGATGGTGTGTATACTAATTTTAAATTGATAGGACACACCATCTGTGATATTCTTAATGCTAA
GTTGGGTTTTGATAGCTCTAAAGAGTTTGTTGAATATAAAGTTACTGAGTGGCCAACAGCTACAGGTGAT
GTGGTGTTGGCTACTGATGATTTGTATGTTAAGAGATACGAAAGGGGTTGTATTACTTTTGGTAAACCTG
TTATATGGTTAAGCCATGAGCAAGCTTCCCTCAATTCTTTAACATATTTTAATAGACCTTTATTGGTTGA
TGAGAATAAATTTGATGTTTTAAAAGTGGATGATGTTGACGATGGTGGTGATATCTCAGAGAGTGATGCC
AAAGAATCCAAAGAAATCAACATTATTAAGTTAAGTGGTGTTAAAAAACCATTTAAGGTTGAAGATAGTG
TCATAGTTAATGATGATACTAGTGAAATCAAATATGTTAAGAGTTTGTCTATAGTTGATGTGTATGATAT
GTGGCTTACAGGTTGTAGGTATGTTGTTAGAACTGCTAATGCTTTGAGCATGGCAGTTAACGTACCTACA
ATACGTAAGTTTATAAAATTTGGTATGACTCTTGTTAGTATACCAATTGATTTGTTAAATTTAAGAGAGA
TTAAGCCTGTTTTTAATGTGGTTAAAGCTGTGCGAAATAAAATTTCTGCATGCTTTAATTTTATTAAATG
GCTTTTTGTCTTATTATTTGGCTGGATTAAAATATCCGCTGATAATAAAGTAATTTACACCACAGAAGTT
GCATCAAAGCTTACATGTAAGCTTGTAGCTTTAGCTTTTAAAAATGCGTTTTTGACATTTAAGTGGAGTG
TGGTTGCTAGAGGTGCTTGCATTATAGCGACTATATTTCTATTGTGGTTTAATTTTATATATGCCAATGT
AATTTTTAGTGATTTTTATTTGCCTAAAATTGGTTTCTTGCCGACTTTTGTTGGTAAGATCGCACAGTGG
ATTAAGAGCACTTTTAGTCTTGTAACTATTTGTGATCTATATTCCATTCAGGATGTGGGTTTTAAGAATC
AGTATTGTAATGGAAGTATCGCATGTCAATTCTGCTTGGCAGGATTTGATATGTTAGATAATTATAAAGC
CATTGATGTAGTACAGTATGAAGCTGATAGGAGAGCATTTGTTGATTATACAGGTGTGTTAAAGATTGTC
ATTGAATTGATAGTTAGTTACGCCCTGTATACGGCATGGTTCTACCCATTGTTTGCTCTTATTAGTATTC
AGATCTTGACCACTTGGCTGCCTGAGCTTTTTATGCTTAGTACATTACATTGGAGTGTTAGGTTGCTGGT
GTCTTTAGCTAATATGTTACCAGCACATGTGTTTATGAGGTTTTATATTATTATTGCCTCTTTTATTAAG
CTGTTTATCTTGTTTAGGCATGTTGCCTATGGTTGTAGTAAACCTGGTTGTTTGTTTTGTTACAAGAGGA
ATCGTAGTCTACGTGTTAAATGTAGTACTATTGTTGGTGGCATGATACGCTATTACGATGTTATGGCTAA
TGGTGGCACTGGCTTTTGTTCAAAACATCAATGGAATTGCATTGATTGTGATTCTTATAAACCAGGTAAT
ACTTTTATTACTGTTGAGGCCGCTCTTGATTTATCTAAGGAATTGAAACGGCCTATTCAGCCTACAGATG
TTGCTTATCATACGGTTACGGATGTTAAGCAAGTTGGTTGTTATATGCGCTTGTTCTATGAGCGTGATGG
ACAGCGCACATATGATGATGTTAATGCTAGTTTGTTTGTGGATTATAGTAATTTGCTACATTCTAAGGTT
AAGGGTGTGCCTAATATGCATGTTGTGGTAGTGGAAAATGATGCCGATAAAGCTAATTTTCTTAATGCTG
CTGTATTTTATGCACAGTCTTTGTTTAGACCTATTTTAATGGTTGATAAAAATCTGATAACTACTGCTAA
TACTGGTACGTCTGTTACAGAAACTATGTTTGATGTTTATGTGGACACATTTTTGTCTATGTTTGATGTG
GATAAAAAGAGTCTTAATGCTTTAATAGCAACTGCGCATTCTTCTATAAAACAGGGTACGCAGATTTGTA
AAGTTTTGGATACCTTTTTAAGCTGTGCTCGTAAAAGTTGTTCTATTGATTCAGATGTTGATACTAAGTG
TTTAGCTGATTCTGTCATGTCTGCTGTATCGGCAGGCCTTGAATTGACGGATGAAAGTTGTAATAACTTG
GTGCCAACATATTTGAAGGGTGATAACATTGTGGCAGCTGATTTAGGTGTTCTGATTCAAAATTCTGCTA
AGCATGTGCAGGGTAATGTTGCTAAAATAGCCGGTGTTTCCTGTATATGGTCTGTGGATGCTTTTAATCA
GCTAAGTTCTGATTTCCAGCATAAATTGAAGAAAGCATGTTGTAAAACTGGTTTGAAATTGAAGCTTACT
TATAATAAGCAGATGGCTAATGTCTCTGTTTTAACTACACCCTTTAGTCTTAAAGGGGGTGCAGTTTTTA
GTTATTTTGTTTATGTATGTTTTCTGTTGAGTTTGGTTTGTTTTATTGGATTGTGGTGCTTAATGCCCAC
TTACACAGTACACAAATCAGATTTTCAGCTTCCCGTTTATGCCAGTTATAAAGTTTTAGATAATGGTGTT
ATTAGAGATGTTAGCGTTGAAGATGTTTGTTTCGCTAACAAATTTGAACAATTTGATCAATGGTATGAGT
CTACATTTGGTCTAAGTTATTATAGTAACAGTATGGCTTGTCCCATTGTTGTTGCTGTAGTAGACCAGGA
TCTTGGCTCTACTGTGTTTAATGTCCCTACCAAAGTGTTACGATATGGTTACCATGTGTTGCACTTTATT
ACACATGCACTTTCTGCTGATGGAGTGCAGTGTTATACGCCACATAGTCAAATATCGTATTCTAATTTTT
ATGCTAGTGGCTGTGTGCTTTCCTCCGCTTGTACTATGTTTGCAATGGCCGATGGTAGTCCACAACCTTA
TTGTTATACAGAGGGGCTTATGCAGAATGCTTCTCTGTATAGTTCATTGGTACCTCACGTGCGGTATAAT
CTTGCTAATGCTAAAGGTTTTATCCGTTTTCCAGAAGTGTTGCGAGAAGGACTTGTGCGTATTGTGCGTA
CTCGTTCTATGTCGTATTGCAGAGTTGGATTATGTGAGGAAGCTGATGAGGGTATATGCTTTAACTTTAA
TGGTTCTTGGGTGCTTAATAATGATTATTATAGATCATTGCCTGGGACCTTTTGTGGTAGAGATGTTTTT
GACTTAATTTATCAGCTTTTTAAAGGTTTAGCACAGCCTGTGGATTTCTTGGCATTGACTGCTAGTTCTA
TTGCTGGTGCTATACTTGCTGTAATTGTTGTTTTGGTGTTTTATTACTTAATAAAGCTTAAACGTGCTTT
TGGTGATTACACCAGTATTGTTTTTGTCAATGTGATTGTGTGGTGTGTAAATTTTATGATGCTTTTTGTG
TTTCAAGTTTACCCTACACTTTCTTGTGTATATGCTATTTGTTATTTTTATGCCACGCTTTATTTCCCTT
CGGAGATAAGTGTGATAATGCATTTACAATGGCTAGTTATGTATGGCACTATTATGCCTTTATGGTTTTG
TTTGCTATATATATCTGTTGTTGTTTCAAATCATGCTTTTTGGGTATTCGCTTACTGCAGACGGCTTGGT
ACTTCTGTTCGTAGTGATGGTACATTTGAAGAAATGGCTCTTACTACTTTTATGATTACAAAAGATTCTT
ATTGTAAGCTTAAGAATTCTTTGTCTGATGTTGCTTTTAATAGATATTTGAGTTTGTATAATAAATATAG
GTATTACAGCGGTAAAATGGATACTGCTGCATATAGGGAGGCTGCTTGTTCGCAGTTGGCTAAAGCAATG
GATACATTTACCAATAATAATGGTAGTGATGTGCTTTACCAACCACCTACTGCTTCCGTTTCAACTTCAT
TCTTGCAATCTGGTATTGTGAAAATGGTTAATCCTACTTCTAAGGTAGAACCATGTATTGTCAGTGTTAC
CTATGGTAATATGACATTGAATGGTTTATGGTTGGATGATAAGGTCTACTGTCCCAGACATGTGATATGT
TCTGCTTCAGATATGACTAATCCAGATTATACAAATTTGTTGTGTAGAGTAACATCAAGTGATTTTACTG
TATTGTTTGATCGTTTAAGCCTTACAGTGATGTCTTATCAAATGCAGGGTTGTATGCTTGTTCTTACAGT
GACCCTGCAAAATTCTCGTACGCCAAAATATACATTTGGTGTGGTTAAACCTGGTGAGACTTTTACTGTT
TTAGCTGCTTATAACGGCAAACCACAAGGAGCCTTTCATGTGACTATGCGTAGTAGTTATACCATTAAGG
GTTCCTTTTTATGCGGATCTTGTGGGTCTGTTGGTTATGTGCTAATGGGTGATTGTGTTAAATTTGTGTA
TATGCATCAATTGGAGCTTAGTACTGGTTGTCATACTGGTACTGATTTCAATGGGGATTTTTATGGTCCT
TATAAGGATGCTCAGGTTGTCCAATTGCCCGTTCAGGATTATATACAATCTGTTAATTTTGTAGCATGGC
TTTATGCTGCTATACTTAATAATTGTAATTGGTTTGTACAAAGTGATAAGTGTTCTGTTGAAGATTTTAA
TGTGTGGGCTTTGTCTAATGGGTTTAGCCAAGTTAAATCTGATCTTGTTATAGATGCTTTAGCTTCTATG
ACTGGTGTGTCTTTGGAAACATTATTGGCTGCTATTAAGCGTCTCAAGAATGGTTTTCAAGGACGTCAGA
TTATGGGTAGTTGCTCCTTTGAGGATGAATTGACACCTAGCGATGTTTATCAACAACTCGCTGGTATCAA
GTTACAATCAAAGCGTACTAGATTGGTTAAAGGCATTGTTTGTTGGATTATGGCTTCTACATTTTTGTTT
AGTTGTATAATTACAGCATTTGTGAAATGGACTATGTTTATGTATGTAACTACTAATATGCTTAGTATTA
CGTTTTGTGCACTTTGTGTTATAAGTTTGGCCATGTTGTTGGTTAAACATAAGCATCTTTATTTGACTAT
GTATATAATTCCTGTGCTTTTTACACTGCTGTATAACAACTATTTGGTTGTGTACAAGCAGACATTTAGA
GGCTATGTTTATGCATGGCTATCATATTATGTTCCATCAGTTGAGTATACTTATACTGATGAAGTTATTT
ACGGCATGTTATTGCTTATAGGAATGGTCTTTGTTACATTACGTAGCATTAACCATGATTTGTTTTCTTT
TATAATGTTTGTTGGTCGTGTGATTTCTGTTGTCTCTTTGTGGTACATGGGTTCTAACTTAGAGGAAGAA
ATTCTTCTTATGTTGGCTTCTCTTTTTGGTACTTACACATGGACAACAGCTTTATCTATGGCTGCAGCAA
AGGTTATTGCTAAGTGGGTTGCTGTGAATGTTTTGTATTTCACAGATATACCTCAAATTAAGATAGTTCT
TGTATGCTATTTGTTTATAGGTTATATTATTAGCTGTTATTGGGGTTTGTTTTCCTTGATGAACAGTTTG
TTTAGAATGCCTTTGGGTGTTTATAATTATAAAATTTCAGTACAGGAATTAAGATATATGAATGCTAATG
GATTGCGCCCTCCTAAGAATAGTTTTGAAGCCCTTATGCTTAATTTTAAGCTTTTGGGTATTGGAGGTGT
GCCAATTATTGAAGTATCTCAATTTCAATCAAAATTGACTGATGTTAAATGTGCTAATGTTGTCTTGCTT
AATTGCTTGCAACATTTGCATGTTGCTTCTAATTCTAAGTTGTGGCAGTATTGTAGCACTTTGCACAATG
AAATACTTGCCACTTCTGATCTGGGTGTTGCTTTTGAAAAGCTTGCTCAGTTGTTAATTGTTTTGTTTGC
TAATCCAGCTGCTGTGGATAGCAAGTGCCTGACTAGTATTGAAGAAGTTTGCGATGATTACGCAAAGGAC
AATACTGTTTTGCAGGCTTTACAGAGTGAATTTGTTAATATGGCTAGCTTCGTTGAATATGAAGTTGCTA
AGAAAAATCTTGATGAGGCGCGTTCTAGTGGTTCTGCTAATCAACAGCAGTTAAAACAGCTAGAGAAAGC
CTGTAATATTGCTAAATCTGCTTATGAACGCGACCGTGCTGTAGCAAGAAAGTTGGAGCGTATGGCAGAT
TTGGCTCTCACTAATATGTATAAAGAAGCTAGAATTAATGATAAGAAGAGTAAGGTTGTTTCTGCCTTGC
AAACTATGCTTTTTAGTATGGTGCGTAAGTTAGATAATCAAGCTCTGAATTCAATATTAGATAATGCTGT
GAAGGGTTGTGTACCATTGAATGCAATCCCTTCATTGGCTGCAAATACTCTGACTATAATTGTACCAGAT
AAAAGTGTTTACGATCAGGTAGTTGACAATGTCTATGTTACCTATGCGGGTAATGTATGGCAGATTCAAA
CTATCCAAGATTCAGATGGTACAAATAAGCAGTTGAATGAGATATCTGATGATTGTAACTGGCCACTAGT
TATTATTGCAAATCGGCATAATGAGGTATCTGCAACCGTTTTGCAAAATAATGAATTAATGCCTGCTAAG
TTGAAAACTCAGGTCGTTAATAGTGGTCCAGATCAGACTTGTAACACACCTACTCAATGTTACTATAATA
ATAGTAACAATGGGAAGATTGTTTATGCTATACTTAGTGATGTTGATGGTCTTAAGTATACAAAGATTCT
TAAAGATGATGGCAATTTTGTTGTTTTGGAGTTAGATCCTCCTTGTAAATTTACTGTTCAAGATGTTAAA
GGTCTTAAAATTAAGTACCTTTATTTTGTAAAAGGTTGTAACACACTAGCAAGAGGCTGGGTTGTTGGTA
CAATTTCTTCTACAGTTAGATTGCAAGCTGGAACTGCTACTGAGTATGCTTCCAACTCATCTATATTATC
TTTATGTGCGTTTTCTGTAGATCCTAAGAAAACGTATTTAGATTTTATACAGCAGGGAGGAACACCTATT
GCCAATTGTGTTAAAATGTTGTGTGACCATGCTGGTACCGGTATGGCCATTACTGTTAAACCCGATGCTA
CCACTAATCAGGATTCATATGGTGGTGCGTCTGTTTGTATATATTGCCGCGCACGAGTTGAACACCCAGA
TGTTGATGGGTTGTGCAAATTACGCGGCAAGTTTGTACAAGTGCCTGTAGGTATAAAAGATCCTGTGTCT
TATGTTTTGACACATGATGTTTGTCAAGTTTGTGGATTTTGGCGGGATGGAAGTTGTTCATGTGTTAGCA
CTGACACTACTGTTCAGTCAAAAGATACTAATTTTTTAAACGGGTTCGGGGTACGAGTGTAGATGCCCGT
CTCGTACCCTGTGCCAGTGGTTTATCTACTGATGTACAATTAAGGGCATTTGATATTTGCAATGCTAGTG
TTGCTGGCATTGGTTTACATTTAAAAGTTAATTGCTGCCGTTTTCAGCGTGTTGATGAGAACGGTGATAA
ATTAGATCAGTTCTTTGTTGTTAAGAGGACAGATCTGACTATATATAATAGAGAGATGGAATGCTATGAG
CGTGTAAAAGATTGTAAGTTTGTGGCTGAACACGATTTCTTTACATTTGATGTAGAAGGTAGTCGTGTGC
CACATATTGTACGCAAGGATTTAACAAAGTATACTATGTTGGATCTTTGCTATGCGTTGCGACATTTTGA
TCGCAATGATTGCATGCTGCTTTGTGACATTCTCTCTATATATGCTGGTTGTGAACAATCCTACTTTACT
AAGAAGGATTGGTATGATTTTGTTGAAAATCCTGATATTATTAATGTTTATAAAAAGCTAGGACCTATTT
TTAATAGAGCCCTAGTTAGCGCTACTGAGTTTGCAGACAAATTGGTGGAGGTAGGCTTAGTAGGCATTTT
AACACTTGATAACCAAGATTTAAATGGTAAATGGTATGATTTTGGTGACTATGTTATTGCAGCCCCAGGT
TGTGGTGTTGCTATAGCAGACTCTTATTATTCTTATATGATGCCTATGCTGACCATGTGTCATGCATTGG
ATTGTGAATTGTATGTGAATAATGCTTATAGACTATTTGATCTTGTACAGTATGATTTTACTGATTACAA
GCTCGAATTGTTTAATAAGTATTTTAAGCACTGGAGTATGCCATACCATCCTAACACGGTTGATTGTCAG
GATGATCGGTGTATCATACATTGTGCTAATTTTAACATACTTTTTAGTATGGTTTTACCTAATACATGTT
TTGGGCCTCTTGTTAGGCAAATTTTTGTGGATGGTGTTCCTTTTGTTGTTTCAATTGGATACCATTATAA
AGAACTTGGTATTGTGATGAATATGGATGTGGATACACATCGTTATCGCTTGTCTTTAAAAGACTTGCTT
TTATATGCTGCTGATCCAGCTTTGCATGTAGCTTCTGCTAGTGCATTGTATGATTTACGCACTTGCTGTT
TTAGTGTTGCGGCTATAACAAGCGGTGTAAAATTTCAAACAGTTAAACCTGGTAATTTTAATCAGGATTT
TTATGATTTTATTTTAAGTAAGGGCCTGCTTAAAGAGGGTAGTTCAGTTGATCTGAAGCACTTTTTCTTT
ACGCAGGATGGTAATGCTGCTATCACTGATTATAATTATTATAAGTACAATTTGCCCACCATGGTGGACA
TTAAGCAGTTGTTGTTTGTTTTGGAAGTTGTTTATAAGTATTTTGAGATTTATGATGGTGGGTGTATACC
GGCATCACAAGTCATTGTTAATAATTATGATAAGAGTGCTGGCTATCCATTTAATAAATTTGGAAAAGCC
AGGCTCTATTATGAAGCATTATCATTTGAGGAGCAGGATGAAATTTACGCCTATACTAAGCGCAATGTCC
TGCCAACACTTACTCAAATGAATTTGAAATATGCTATTAGTGCTAAGAATAGAGCCCGCACTGTCGCTGG
TGTTTCCATACTTAGTACTATGACTGGCAGAATGTTTCATCAAAAGTGTTTGAAAAGTATAGCAGCTACA
CGTGGTGTTCCTGTTGTTATAGGCACCACTAAATTTTATGGCGGCTGGGATGATATGTTACGTCGCCTTA
TTAAAGATGTTGATAATCCTGTACTTATGGGTTGGGATTATCCTAAGTGTGATCGTGCTATGCCAAACAT
ACTACGTATTGTTAGTAGTCTGGTTTTGGCTCGAAAACATGAGGCATGTTGTTCGCAAAGCGATAGGTTT
TATCGACTTGCGAATGAATGCGCACAAGTTCTGAGTGAAATTGTTATGTGTGGTGGCTGTTATTATGTTA
AGCCTGGTGGCACTAGTAGTGGTGATGCAACTACTGCTTTTGCTAATTCAGTTTTTAACATATGTCAAGC
TGTTTCAGCCAATGTATGTGCTTTAATGTCATGCAATGGTAATAAGATTGAAGATTTGAGTATACGTGCT
CTTCAGAAGCGCTTATACTCACATGTGTATAGAAGTGATATGGTTGATTCAACCTTTGTCACAGAATATT
ATGAATTTTTAAATAAGCATTTTAGTATGATGATTTTGAGTGATGATGGCGTTGTGTGTTATAATTCTGA
CTATGCGTCCAAAGGGTATATTGCTAATATAAGTGCCTTTCAACAGGTATTGTATTATCAAAATAACGTT
TTTATGTCAGAATCCAAATGTTGGGTTGAAAATGACATAAATAATGGACCTCATGAATTCTGTTCACAAC
ACACAATGCTTGTAAAGATGGATGGGGACGATGTCTATCTTCCATATCCTGATCCTAGTCGTATATTAGG
AGCTGGATGTTTTGTAGATGATTTGTTAAAGACTGATAGTGTTCTTTTAATAGAACGATTTGTAAGTCTT
GCAATAGATGCTTATCCACTTGTGTACCACGAAAATGAAGAATACCAAAAGGTTTTTCGTGTTTATTTGG
AGTATATAAAGAAGTTGTACAATGACCTGGGTAATCAGATCTTGGATAGCTACAGTGTTATTTTAAGTAC
TTGTGATGGACAAAAGTTTACTGATGAGTCCTTTTACAAGAACATGTATTTAAGAAGTGCAGTTATGCAG
AGTGTTGGAGCTTGCGTGGTCTGCTCTTCTCAAACATCATTACGTTGTGGCAGTTGCATCAGAAAGCCTC
TTCTTTGCTGCAAGTGTTGTTACGATCATGTTATGGCAACTGATCATAAATATGTTTTGAGTGTTTCACC
ATATGTGTGTAATGCACCAGGATGTGATGTAAATGATGTTACCAAATTGTATCTAGGTGGTATGTCATAT
TATTGTGAAGATCATAAGCCACAATATTCGTTTAAGTTGGTAATGAATGGTATGGTTTTTGGTCTATATA
AACAATCTTGTACAGGATCTCCGTACATAGATGATTTTAATCGTATAGCTAGTTGTAAATGGACTGATGT
TGATGATTACATACTGGCTAATGAATGTACAGAGCGCTTGAAATTGTTTGCTGCAGAAACGCAAAAGGCG
ACTGAGGAAGCCTTTAAGCAGAGTTATGCATCAGCAACAATACAAGAGATTGTTAGCGAGCGCGAATTGA
TCCTCTCTTGGGAGATTGGAAAAGTGAAGCCACCACTTAATAAAAATTATGTTTTTACTGGCTACCATTT
TACTAAAAATGGCAAGACAGTTTTAGGTGAGTATGTTTTTGATAAGAGTGAGTTGACTAATGGTGTGTAT
TATCGCGCCACAACCACTTATAAGCTATCTGTTGGAGATGTTTTTGTTTTAACCTCTCATTCAGTAGCTA
ATTTAAGTGCTCCTACGCTGGTGCCGCAGGAGAATTATAGTAGTATTAGATTCGCTAGTGTTTATAGTGT
GCTTGAGACGTTTCAGAACAATGTCGTTAATTATCAACACATTGGTATGAAACGTTATTGCACCGTGCAA
GGACCTCCTGGTACAGGAAAGTCACATCTTGCTATTGGTCTTGCTGTTTATTATTGTACAGCACGTGTAG
TATACACTGCGGCCAGCCATGCAGCTGTTGACGCATTGTGTGAAAAAGCATACAAATTTTTGAATATAAA
TGACTGCACTCGTATTGTTCCTGCCAAGGTCAGGGTGGAGTGCTATGATAAGTTTAAAATTAATGACACC
ACTCGTAAGTATGTGTTTACTACTATAAATGCATTACCTGAGATGGTGACTGATATTGTTGTTGTAGATG
AAGTTAGTATGCTTACCAATTATGAGCTTTCTGTTATTAATGCTCGTATTCGTGCTAAGCATTATGTTTA
CATTGGTGATCCTGCTCAATTGCCAGCACCACGTGTGTTATTGAGCAAGGGTACACTTGAACCTAAATAT
TTTAACACTGTTACTAAGCTTATGTGTTGCTTAGGGCCAGACATTTTTCTTGGTACATGTTATAGATGTC
CTAAGGAAATTGTTGATACAGTGTCTGCCTTGGTTTATGAAAATAAGCTTAAGGCTAAGAATGAAAGTAG
TTCATTGTGTTTTAAGGTCTATTATAAAGGCGTTACAACACATGAAAGTTCTAGTGCTGTAAATATGCAG
CAGATTTATTTGATTAATAAGTTTTTGAAGGCTAACCCTTTGTGGCATAAAGCCGTTTTTATTAGCCCAT
ATAATAGCCAGAACTTTGCAGCTAAGCGTGTTTTGGGTTTGCAAACCCAGACCGTGGATTCTGCTCAAGG
TTCTGAATATGATTATGTTATATATTCACAGACTGCAGAAACAGCGCATTCTGTAAATGTTAATCGCTTC
AATGTTGCTATTACTCGAGCCAAGAAAGGTATTCTTTGTGTTATGAGTAATATGCAGTTGTTTGAAGCAT
TACAGTTTACTACATTGACCTTAGATAAAGTGCCACAGGCCGTTGAAACGAGAGTTCAATGTAGTACCAA
TTTATTTAAAGATTGTAGCAAGAGTTATAGTGGTTACCACCCAGCTCACGCTCCTTCATTTTTGGCAGTA
GATGACAAATATAAGGCAACTGGCGATTTAGCCGTGTGTCTTGGTATTGGAGATTCTGCTGTTACATATT
CAAGATTAATATCACTCATGGGTTTTAAACTTGATGTCACCCTTGATGGGTATTGTAAGCTTTTTATAAC
TAAAGAAGAAGCTGTTAAACGCGTGCGTGCTTGGGTTGGCTTTGATGCTGAAGGCGCTCATGCCACGCGT
GATAGCATTGGGACAAATTTCCCACTTCAATTAGGGTTTTCTACAGGAATTGATTTTGTTGTGGAAGCCA
CTGGTTTGTTTGCTGATAGAGATGGTTACAGCTTTAAAAAGGCTGTGGCTAAAGCTCCTCCTGGTGAACA
ATTTAAGCATCTCATCCCTTTGATGACGAGAGGTCAGCGCTGGGATGTTGTTAGACCTAGAATAGTACAA
ATGTTTGCAGATCATTTAATTGATCTGTCTGATTGTGTTGTGCTAGTTACATGGGCAGCCAACTTTGAGC
TCACTTGTCTCCGATACTTTGCAAAAGTAGGTCGTGAGATCTCTTGTAATGTGTGCACTAAACGTGCCAC
AGCTTACAATTCTAGAACTGGTTACTATGGTTGTTGGCGCCATAGTGTTACATGTGATTACTTGTATAAT
CCACTTATTGTTGATATTCAACAGTGGGGATATATTGGATCTTTATCAAGTAATCATGATTTATATTGTA
GTGTCCACAAAGGAGCACATGTTGCTTCATCTGATGCTATAATGACACGGTGTTTGGCCGTTTATGATTG
TTTTTGCAATAATATTAATTGGAATGTGGAGTATCCCATTATTTCAAATGAGTTAAGTATTAATACCTCT
TGTAGGGTCTTGCAGCGTGTTATGCTTAAAGCTGCAATGCTCTGCAACAGATATACTTTGTGTTATGATA
TTGGCAACCCAAAAGCGATTGCCTGTGTCAAAGATTTTGATTTTAAGTTCTATGATGCCCAACCAATTGT
TAAGTCTGTCAAGACTCTTTTGTATTCTTTTGAGGCACATAAGGACTCTTTTAAAGATGGTTTGTGTATG
TTTTGGAACTGTAATGTGGATAAGTATCCACCGAATGCAGTTGTATGTAGATTTGACACGAGAGTGTTGA
ATAATTTAAATCTTCCTGGCTGTAATGGAGGTAGTTTGTATGTTAATAAACATGCATTCCACACTAAACC
CTTTTCTAGGGCAGCCTTTGAGCATTTGAAGCCTATGCCATTTTTCTATTATTCAGATACGCCTTGTGTG
TATATGGATGGCATGGATGCTAAGCAGGTTGATTATGTACCTTTGAAATCCGCCACTTGCATCACAAGAT
GCAATTTAGGTGGTGCAGTTTGTTTAAAACATGCTGAAGAGTATCGTGAGTACCTAGAGTCTTACAATAC
AGCTACTACAGCAGGTTTTACTTTTTGGGTCTATAAGACATTTGATTTTTATAATTTGTGGAATACGTTC
ACCAAGCTACAAAGCTTGGAGAACGTTGTATATAATTTAGTCAAAACTGGTCATTATACAGGACAGGCTG
GTGAAATGCCTTGTGCCATTATAAATGATAAAGTCGTGGCTAAGATCGATAAGGAGGATGTTGTCATTTT
TATTAATAATACAACATACCCTACTAATGTTGCTGTTGAATTATTTGCCAAGCGCAGTATTCGACACCAT
CCAGAGCTTAAGCTCTTTAGAAATTTGAATATAGACGTGTGTTGGAAGCACGTCATTTGGGATTATGCTA
GAGAAAGTATATTTTGCAGTAATACCTATGGTGTCTGCATGTATACAGATTTAAAGTTCATTGATAAATT
GAATGTCCTTTTTGATGGTCGTGATAATGGTGCTCTTGAAGCTTTTAAACGCTCTAATAATGGCGTTTAC
ATTTCCACGACAAAAGTTAAGAGTCTTTCGATGATAAAAGGTCCACCGCGTGCTGAATTAAATGGCGTAG
TGGTGGACAAGGTTGGAGACACTGATTGTGTGTTTTATTTTGCTGTGCGTAAAGAGGGTCAGGATGTCAT
CTTCAGCCAATTCGACAGCCTGAGAGTCAGCTCTAACCAGAGCCCACAAGGTAATCTGGGGAGTAATGAA
CCCGGTAATGTCGGTGGTAATGATGCTCTGGCAACCTCCACTATCTTTACACAAAGCCGTGTTATTAGCT
CTTTTACATGTCGTACTGATATGGAAAAAGATTTTATAGCTTTAGATCAAGACTTGTTTATTCAGAAGTA
TGGTTTGGAGGACTATGCCTTTGAACACATTGTTTATGGTAATTTCAACCAGAAGATTATTGGTGGTTTG
CATTTGTTAATAGGCTTGTACCGAAGACAGCAAACTTCCAATCTGGTTATTCAGGAGTTTGTTTCATACG
ACTCCAGCATACACTCTTATTTTATCACTGATGAGAAGAGTGGTGGTAGTAAGAGTGTTTGCACTGTTAT
AGATATTTTGTTGGATGATTTTGTGGCTCTTGTTAAGTCACTTAATCTCAACTGTGTGAGTAAGGTTGTT
AACGTTAATGTTGATTTTAAAGATTTTCAGTTCATGCTTTGGTGTAACGATGAGAAAGTTATGACTTTCT
ATCCTCGTTTGCAAGCTGCATCTGACTGGAAGCCTGGTTATTCTATGCCTGTATTATACAAGTATTTGAA
TTCCCCAATGGAAAGAGTTAGTCTCTGGAATTATGGGAAGCCGGTTACTTTGCCTACAGGCTGTATGATG
AATGTTGCTAAGTATACTCAGTTATGTCAATATCTGAATACTACAACATTAGCTGTACCTGTTAATATGC
GAGTTTTGCATTTAGGTGCAGGTTCAGAAAAAGGAGTAGCACCGGGTTCTGCAGTTCTTAGGCAGTGGTT
GCCTGCTGGTACTATTCTTGTAGATAATGATTTATACCCATTTGTGAGTGACAGTGTCGCTACATATTTT
GGGGATTGTATAACCTTACCCTTTGATTGTCAATGGGATTTGATAATTTCTGATATGTATGACCCTATTA
CTAAGAACATAGGGGAGTACAATGTAAGTAAAGATGGTTTCTTTACATACATTTGTCATATGATTCGCGA
CAAGTTAGCTCTGGGTGGCAGTGTTGCTATAAAAATAACAGAGTTTTCTTGGAATGCAGAATTATATAAG
TTAATGGGGTATTTTGCATTTTGGACGGTTTTCTGCACAAATGCAAACGCTTCTTCTAGTGAAGGGTTTT
TAATTGGCATAAATTATTTGGGTAAGCCCAAGGTTGAGATAGATGGAAATGTTATGCATGCCAATTATTT
GTTTTGGAGAAATTCCACAGTTTGGAACGGGGGTGCTTATAGCCTGTTTGACATGGCTAAATTCCCGCTT
AAGTTGGCTGGTACTGCCGTAATAAATTTAAGAGCAGACCAGATTAATGATATGGTTTATTCCCTTCTTG
AAAAGGGTAAACTACTTGTTAGAGATACAAATAAAGAAGTTTTTGTTGGTGACAGTTTGGTTAATGTAAT
CTAAACTTTAAGAATGGCAGTCGCTTATGCAGACAAGCCTAATCACTTTATCAATTTTCCACTTACCCAG
TTTCAGGGCTTTGTGTTAAATTATAAAGGTTTACAATTTCAACTTCTCGATGAAGGAGTGGATTGTAAAA
TACAAACAGCGCCTCACATTAGTCTTGCTATGCTGGATATTCAGCCTGAAGACTACAGAAGTGTTGATGT
TGCTATTCAAGAAGTTATTGATGATATGCATTGGGGTGAGGGCTTTCAGATTAAATTTGAAAACCCCCAT
ATCCTAGGAAGATGCATAGTTTTAGATGTTAAAGGTGTAGAAGAATTGCATGATGATTTAGTTAATTACA
TTCGTGATAAAGGTTGTGTTGCTGACCAATCCAGGAAGTGGATTGGACATTGCACCATAGCCCAACTCAC
TGATGCTGCACTTTCCATTAAGGAAAATGTTGATTTTATAAACAACATGCAATTCAACTATAAAATCACT
ATCAATCCCTCATCACCGGCTAGACTTGAAATAGTTAAGCTTGGTGCTGAAAGGAAAGATGGTTTTTATG
AAACCATAGCTAGCCACTGGATGGGAATTCGTTTTGAATATAATCCACCCACTGATAAGCTAGCTATGAT
TATGGGTTATTGTTGTTTAGAAGTGGTGCGTAAAGAGCTAGAAGAAGGTGACCTTCCCGAGAATGATGAT
GATGCTTGGTTTAAGCTATCGTACCATTATGAAAACAATTCTTGGTTCTTTCGACATGTCTACAGGAAAA
GTTCTTATTTCCGTAAGTCTTGTCAAAATTTAGATTGTAATTGTTTGGGGTTTTATGAATCTTCAGTTGA
AGAAGACTAAACTCAGTGAAAATGTTTTTGCTTCCTAGATTTGTTCTAGTTAGCTGCATAATTGGTAGCC
TAGGTTTTGACAACCCTCCTACCAATGTTGTTTCGCATTTAAATGGAGATTGGTTTTTATTTGGTGACAG
TCGTTCAGATTGTAATCATGTTGTTACTACCAACCCCCGTAATTATTCTTATATGGACCTTAATCCTGCC
TTGTGTGGTTCTGGTAAAATATCATCTAAAGCTGGCAACTCCATTTTTAGGAGTTTTCACTTTACCGATT
TTTATAATTACACAGGCGAAGGTCAACAAATTATTTTCTATGAGGGTGTTAATTTTACGCCTTATCATGC
CTTTAAATGCACCACTTCTGGTAGTAATGATATTTGGATGCAGAATAAAGGCTTGTTTTACACTCAGGTT
TATAAGAATATGGCTGTGTATCGCAGCCTTACTTTTGTTAATGTACCATATGTTTATAATGGCTCTGCAC
AATCTACAGCCCTTTGTAAATCTGGTAGTTTAGTTCTTAATAACCCTGCATATATAGCTCGTGAAGCTAA
TTTTGGGGATTATTATTATAAGGTTGAAGCTGATTTTTATTTGTCAGGTTGTGACGAGTATATCGTACCA
CTTTGTATTTTCAACGGCAAGTTTTTGTCGAATACAAAGTATTATGATGATAGTCAATATTATTTTAATA
AAGACACTGGTGTTATTTATGGTCTCAATTCTACTGAAACCATTACCACTGGTTTTGACTTTAATTGTCA
TTATTTAGTTCTACCCTCTGGTAATTATTTAGCCATTTCAAATGAGCTATTGTTAACTGTTCCTACTAAA
GCAATCTGTCTTAATAAGCGTAAGGATTTTACGCCTGTACAGGTTGTTGATTCGCGGTGGAACAATGCCA
GGCAGTCTGATAACATGACGGCAGTTGCTTGTCAACCCCCGTACTGTTATTTTCGTAATTCTACTACCAA
TTATGTTGGTGTTTATGATATCAATCATGGGGATGCTGGTTTTACTAGCATACTCAGTGGTTTGTTATAT
GACTCACCTTGTTTTTCGCAGCAAGGTGTTTTTAGGTATGATAATGTTAGCAGTGTCTGGCCTCTCTACC
CCTATGGCAGATGCCCTACTGCTGCTGATATTAATACCCCTGATGTACCTATTTGTGTGTATGATCCGCT
ACCAATTATTTTGCTTGGCATTCTTTTGGGTGTTGCGGTCATAATTATTGTAGTTTTGTTGTTATATTTT
ATGGTGGATAATGGTACTAGGCTGCATGATGCTTAGACCATAATCTAAACATGTTTTTGATACTTTTAAT
TTCCTTACCAACGGCTTTTGCTGTTATAGGAGATTTAAAGTGTACTACAGTTTCCATTAATGATGTTGAC
ACTGGTGTTCCTTCTATTAGCACTGATACTGTCGATGTTACTAATGGTTTAGGTACTTATTATGTTTTAG
ATCGTGTGTATTTAAATACTACGTTGTTGCTTAATGGTTACTACCCTACTTCAGGTTCTACATATCGTAA
TATGGCACTGAAGGGAACTTTACTATTGAGCACACTGTGGTTTAAACCACCTTTTCTTTCTGATTTTACT
AATGGTATTTTTGCTAAGGTCAAAAATACCAAGGTTATTAAAGATGGTGTAATGTATAGTGAGTTTCCTG
CTATAACTATAGGTAGTACTTTTGTAAATACATCTTATAGTGTGGTAGTACAACCACATACTACCATTTT
GGGTAATAAATTACAAGGTTTCTTAGAGATCTCTGTTTGCCAGTATACTATGTGCGAGTACCCAAATACG
ATTTGTAATCCTAATCTGGGTAATCAACGCGTAGAACTATGGCATTGGGATACAGGTGTTGTTTCCTGTT
TATATAAGCGTAATTTCACATACGATGTGAATGCTGATTATTTGTATTTCCATTTTTATCAAGAAGGTGG
TACTTTTTATGCATATTTTACAGACACTGGTGTTGTTACTAAGTTTCTGTTTAATGTTTATTTAGGCACG
GTGCTCTCACATTATTATGTCATGCCTTTGACTTGTAATAGTGCTCTGACTTTAGAATATTGGGTTACAC
CCCTCACTTCTAAACAATATCTACTAGCTTTCAATCAAGATGGTGTTATTTTTAATGCTGTTGATTGTAA
GAGTGATTTTATGAGTGAGATTAAGTGTAAAACACTATCTATAGCACCATCTACTGGTGTTTATGAATTA
AACGGTTACACTGTTCAGCCAATTGCAGATGTTTACCGACGTATACCTAATCTTCCCGATTGCAATATTG
AGGCTTGGCTTAATGATAAGTCGGTGCCCTCTCCATTAAATTGGGAACGTAAGACCTTTTCAAATTGTAA
TTTTAATATGAGCAGCCTGATGTCTTTTATTCAGGCATACTCATTTACTTGTAATAATATTGATGCTGCT
AAGATATATGGTATGTGTTTTTCCAGCATAACTATAGATAAGTTTGCAATACCCAATGGTAGGAAGGTTG
ACCTACAATTGGGTAATTTGGGCTATTTGCAGTCTTTTAATTATAGAATTGATACTACTGCTACAAGTTG
TCAGTTGTATTATAATTTACCTGCTGCTAATGTTTCTGTTAGCAGGTTTAATCCTTCTACTTGGAATAGG
AGATTTGGTTTTACAGAACAATCTGTTTTTAAGCCTCAACCTGCAGGTGTTTTTACTGATCATGATGTTG
TTTATGCACAACATTGTTTTAAAGCTTCCACAAATTTCTGTCCGTGTAAATTGGATGGGTCTTTGTGTGT
AGGTAATGGTCCTGGTATAGATGCTGGTTATAAAACTAGTGGCATAGGCACTTGTCCTGCAGGTACTAAT
TATTTAACTTGCCATAATGCTGCCCAATGTGATTGTTTGTGCACCCCAGACCCCATTACATCTAAAGCTA
CAGGGCCTTACAAGTGCCCCCAAACTAAATATTTAGTTGGCATAGGTGAGCACTGTTCGGGTCTTGCTAT
TAAAAGTGATCATTGTGGAGGTAATCCTTGTACTTGCCAACCACAAGCATTTTTGGGTTGGTCTGTTGAC
TCTTGTTTACAAGGGGATAGGTGTAATATTTTTGCTAATTTTATTTTGCATGATGTTAATAGTGGTACTA
CTTGTTCTACTGATTTACAAAAATCAAACACAGACATAATTCTTGGTGTTTGTGTTAATTATGATCTTTA
TGGTATTACTGGCCAAGGTATTTTTGTTGAGGTTAATGCGACTTATTATAATAGTTGGCAGAACCTTTTA
TATGATTCTAATGGTAATCTCTATGGTTTTAGAGACTACTTAACAAATAGAACTTTTATGATTCGTAGTT
GCTATAGTGGTCGTGTTTCAGCGGCCTTTCATGCTAACTCTTCCGAACCAGCATTGCTATTTCGGAATAT
CAAATGCAATTACGTTTTTAATAACACTCTTTCACGACAGCTGCAACCTATTAACTATTTTGATAGCTAT
CTTGGTTGTGTTGTCAATGCTGATAATAGTACTTCTAGTGTTGTTCAAACATGTGATCTCACAGTAGGTA
GTGGTTACTGTGTGGATTACTCTACAAAAAGACGAAGTCGTAGATCGATTACCACTGGTTATCGGTTTAC
TAATTTTGAGCCATTTACTGTTAATTCAGTAAATGATAGTTTAGAACCTGTAGGTGGTTTGTATGAAATT
CAAATACCTTCAGAGTTTACTATAGGTAATATGGAGGAGTTTATTCAAACAAGCTCTCCTAAAGTTACTA
TTGATTGTTCTGCTTTTGTCTGTGGTGATTATGCAGCATGTAAATCACAGTTGGTTGAATATGGTAGCTT
CTGTGACAATATTAATGCTATACTCACAGAAGTAAATGAACTACTTGACACTACACAGTTGCAAGTAGCT
AATAGTTTAATGAATGGTGTCACTCTTAGCACTAAGCTTAAAGATGGCGTTAATTTCAATGTAGACGACA
TCAATTTTTCCCCTGTATTAGGTTGTTTAGGAAGCGATTGCAATAAAGTTTCCAGTAGATCTGCTATAGA
GGACTTACTTTTTTCTAAAGTAAAGTTATCTGATGTCGGTTTCGTTGAGGCTTATAATAATTGTACTGGA
GGTGCCGAAATTAGGGACCTCATTTGTGTGCAAAGTTATAATGGTATCAAGGTGTTGCCTCCACTGCTCT
CGGAAAATCAGATCAGTGGATACACTTTGGCTGCCACTTCTGCTAGCCTGTTTCCTCCATGGTCAGCAGC
AGCAGGTGTACCATTCTATTTAAACGTTCAGTATCGTATTAATGGTATTGGTGTTACCATGGATGTGTTA
AGTCAAAATCAAAAGCTTATTGCTAATGCATTTAACAATGCTCTTGGTGCTATTCAGGAAGGGTTTGATG
CTACCAATTCTGCTTTAGTTAAAATTCAAGCTGTTGTTAATGCAAATGCTGAAGCTCTTAATAACTTATT
GCAACAACTCTCTAATAGATTTGGTGCTATAAGTTCTTCTTTACAAGAAATTCTATCTAGACTGGATGCT
CTTGAAGCGCAAGCTCAGATAGACAGACTTATTAATGGGCGTCTTACCGCTCTTAATGCTTATGTTTCTC
AACAGCTTAGTGACTCTACACTAGTAAAGTTTAGTGCAGCACAAGCTATGGAGAAGGTTAATGAATGTGT
CAAAAGCCAATCATCTAGGATAAATTTTTGTGGTAATGGTAATCATATTATATCATTAGTGCAGAATGCT
CCATATGGTTTGTATTTTATCCACTTTAGCTATGTCCCTACTAAGTATGTCACTGCGAAGGTTAGTCCCG
GCCTGTGCATTGCTGGTGATAGAGGTATAGCCCCTAAGAGTGGTTATTTTGTTAATGTAAATAATACTTG
GATGTTCACTGGTAGTGGTTATTACTACCCTGAACCTATAACTGGAAATAATGTTGTTGTTATGAGTACC
TGTGCTGTTAATTATACTAAAGCGCCGGATGTAATGCTGAACATTTCAACACCCAACCTCCCTTATTTTA
AGGAAGAGTTGGATCAATGGTTTAAAAACCAAACATCAGTGGCACCAGATTTGTCACTTGATTATATAAA
TGTTACATTCTTGGACCTACAAGATGAAATGAATAGGTTACAGGAGGCAATAAAAGTTTTAAATCAGAGC
TACATCAATCTCAAGGACATTGGTACATATGAGTATTATGTAAAATGGCCTTGGTATGTATGGCTTTTAA
TTGGCTTTGCTGGTGTAGCTATGCTTGTTTTACTATTCTTCATATGCTGTTGTACAGGATGTGGGACTAG
TTGTTTTAAGAAATGTGGTGGTTGTTGTGATGATTATACTGGACACCAGGAGTTAGTAATTAAAACATCA
CATGAAGACTAAGTTCGTCTTTGATTTATTGACTCCTGACGATATATTACATCCCTCCAATCATGTGAAT
CTAATTATAAGACCCATTTAGGTCGAGCATATTATAATAGCTACCACAATGCCTGCTGTTTAGTGGGTAC
TGTGTCTTATATAACTAGTAAACCTGCAATGCCAATGGCTACAACCATTGAAGGTGCAGATTATACTAAC
ATTATGCCTATTACTGTTCTTACAACAGTTTATTTAGGCGTTTCTATAGGTATTGACACTAGCACCACTG
GTTTTACCTGTTTTTCATGGTACTAGTTCCAAACCATATTATAATTTAGGTAGACCTTATAACTTTAAGC
ATTATTGCCAAAGTTTTTAAGGCCACGCCCTAGTAATGGACATCTGGAAACCTGAGATTAAATATCTCCG
TTATACTAACGGTTTTAATGTCTCAGAATTAGAAGATGCTTGTTTTAAATTTAACTATAAATTTCCTAAA
GTAGGATATTGTAGAGTTCCTAGTCATGCTTGGTGCCGTAATCAAGGTAGCTTTTGTGCTACACTCACTC
TTTATGGCAAATCCAAACATTATGATAAATATTTTGGAGTAATAACTGGTTTTACAGCATTCGCTAATAC
TGTAGAGGAGGCTGTCAACAAACTGGTTTTCTTAGCTGTTGACTTTATTACCTGGCGTAGACAGGAGTTA
AATGTTTATGGCTGATGCTTATTTTGCAGACACTGTGTGGTATGTGGGGCAAATAATTTTTATAGTTGCC
ATTTGTTTATTGGTTATAATAGTTGTAGTGGCATTTTTGGCAACTTTTAAATTGTGTATTCAACTTTGCG
GTATGTGTAATACCTTAGTACTGTCCCCTTCTATTTATGTGTTTAATAGAGGTAGGCAGTTTTATGAGTT
TTACAATGATGTAAAACCACCAGTTCTTGATGTGGATGACGTTTAGTTAATCCAAACATTATGAGTAGTG
TAACTACACCAGCACCAGTTTACACCTGGACTGCTGATGAAGCTATTAAATTCCTAAAGGAATGGAACTT
TTCTTTGGGTATTATACTACTTTTTATTACAGTCATATTGCAATTTGGATATACAAGTCGCAGTATGTTT
GTTTATGTTATTAAGATGGTCATTTTGTGGCTTATGTGGCCCCTTACTATCATCTTAACTATTTTCAATT
GCGTGTATGCGTTGAATAATGTGTATCTTGGCTTCTCTATAGTTTTTACTATAGTGGCCATTATTATGTG
GATTGTGTATTTTGTGAATAGTATCAGGTTGTTTATTAGAACTGGAAGTTGGTGGAGTTTCAACCCAGAA
ACAAACAACTTGATGTGTATAGATATGAAGGGAAGGATGTATGTTAGGCCGATAATTGAGGACTACCATA
CCCTTACGGTCACAATAATACGTGGTCATCTTTACATGCAAGGTATAAAACTAGGTACTGGCTATTCTTT
GTCAGATTTGCCAGCTTATGTGACTGTTGCTAAGGTCTCGCACCTGCTCACGTATAAGCGTGGTTTTCTT
GACAAGATAGGCGATACTAGTGGTTTTGCTGTTTATGTTAAGTCCAAAGTCGGTAATTACCGACTGCCAT
CAACCCAAAAGGGTTCTGGCTTGGACACCGCATTGTTGAGAAATAATATCTAAACTTTAAGGATGTCTTT
TACTCCTGGTAAGCAATCCAGTAGTAGAGCGTCCTCTGGAAATCGTTCTGGTAATGGCATCCTTAAGTGG
GCCGATCAGTCCGACCAATCTAGAAATGTTCAAACCAGGGGTAGAAGAGCTCAACCCAAGCAAACTGCTA
CTTCTCAGCAACCATCAGGAGGGAATGTTGTACCCTACTATTCTTGGTTCTCTGGAATTACTCAGTTTCA
AAAGGGAAAGGAGTTTGAATTTGCAGAGGGACAAGGTGTGCCTATTGCACCAGGAGTCCCAGCTACTGAA
GCTAAGGGGTACTGGTACAGACACAACCGACGTTCCTTTAAAACAGCCGATGGCAACCAGCGTCAATTGC
TACCACGATGGTATTTTTACTATCTTGGAACAGGACCGCATGCCAAAGACCAGTATGGCACCGACATTGA
CGGAGTCTACTGGGTCGCTAGTAACCAGGCTGATGTCAATACCCCGGCTGACATTCTCGATCGGGACCCA
AGTAGCGATGAGGCTATTCCGACTAGGTTTCCGCCTGGCACGGTACTCCCTCAGGGTTACTATATTGAAG
GCTCAGGAAGGTCTGCTCCTAATTCCAGATCTACTTCACGCGCATCCAGTAGAGCCTCTAGTGCAGGATC
GCGCAGTAGAGCCAATTCTGGCAATAGAACCCCTACCTCTGGTGTAACACCTGATATGGCTGATCAAATT
GCTAGTCTTGTTCTGGCTAAACTTGGCAAGGATGCCGCTAAGCCACAGCAAGTAACTAAGCAGACTGCCA
AAGAAATCAGACAGAAAATTTTGAATAAACCCCGCCAGAAGAGGAGCCCCAATAAACAATGCACTGTTCA
GCAGTGTTTTGGGAAGAGAGGCCCCAATCAGAATTTTGGTGGTGGAGAAATGTTAAAACTTGGAACTAGT
GATCCACAGTTCCCCATTCTTGCAGAACTCGCACCCACAGCTGGTGCGTTTTTCTTTGGATCAAGATTAG
AGTTGGCCAAAGTGCAGAATTTGTCTGGGAATCTTGACGAGCCCCAGAAGGATGTTTATGAATTGCGCTA
TAATGGCGCAATTAGATTTGATAGTACACTTTCAGGTTTTGAGACCATAATGAAGGTGTTGAATGAGAAT
TTGAATGCATACCAACAACAGGATGGTACGATGAATATGAGTCCAAAACCACAGCGTCAGCGTGGTCAGA
AGAACGGACAAGGAGAAAATGATAATATAAGTGTTGCAGCGCCCAAAAGCCGTGTGCAGCAAAATAAGAT
TAGAGAGTTGACTGCAGAGGACATCAGCCTTCTTAAGAAGATGGATGAGCCCTTTACTGAAGACACCTCA
GAAATATAAGAGAATGAACCTTATGTCGGCACCTGGTGGTAACCCCTCGCAGGAAAGTCGGGATAAGGCA
CTCTCTATCAGAATGGATGTCTTGCTGCTATAATAGATAGAGAAGGTTATAGCAGACTATAGATTAATTA
GTTGAAAGTTTTGTGTGGTAATGTATAGTGTTGGAGAAAGTGAAAGACTTGCGGAAGTAATTGCCGACAA
GTGCCCAAGGGGAAGAGCCAGCATGTTAAGTTACCATCCAGTAATTAGTAAATGAATGAAGTTAATTATG
GCCAATTGGAAGAATCAC

>gi|9626535|ref|NC_001451.1| Avian infectious bronchitis virus, complete genome
ACTTAAGATAGATATTAATATATATCTATTACACTAGCCTTGCGCTAGATTTTTAACTTAACAAAACGGA
CTTAAATACCTACAGCTGGTCCTCATAGGTGTTCCATTGCAGTGCACTTTAGTGCCCTGGATGGCACCTG
GCCACCTGTCAGGTTTTTGTTATTAAAATCTTATTGTTGCTGGTATCACTGCTTGTTTTGCCGTGTCTCA
CTTTATACATCTGTTGCTTGGGCTACCTAGTGTCCAGCGTCCTACGGGCGTCGTGGCTGGTTCGAGTGCG
AGGAACCTCTGGTTCATCTAGCGGTAGGCGGGTGTGTGGAAGTAGCACTTCAGACGTACCGGTTCTGTTG
TGTGAAATACGGGGTCACCTCCCCCCACATACCTCTAAGGGCTTTTGAGCCTAGCGTTGGGCTACGTTCT
CGCATAAGGTCGGCTATACGACGTTTGTAGGGGGTAGTGCCAAACAACCCCTGAGGTGACAGGTTCTGGT
GGTGTTTAGTGAGCAGACATACAATAGACAGTGACAACATGGCTTCAAGCCTAAAACAGGGAGTATCTCC
CAAACCACGGGATGTCATTCTTGTGTCCAAAGACATCCCTGAACAACTTTGTGACGCTTTGTTTTTCTAT
ACGTCACATAACCCTAAGGATTACGCTGATGCTTTTGCAGTTAGGCAGAAGTTTGACCGTAGTCTCCAGA
CTGGGAAACAGTTCAAATTTGAAACTGTGTGTGGTCTCTTCCTCTTGAAGGGAGTTGACAAAATAACACC
TGGCGTCCCAGCAAAAGTTTTAAAAGCCACTTCTAAGTTGGCAGATTTAGAAGACATCTTTGGTGTCTCT
CCTTTAGCGCGGAAGTACCGTGAATTGTTGAAAACAGCGTGTCAGTGGTCTCTTACTGTAGAAGCACTGG
ATGTTCGTGCACAAACTCTCGATGAAATTTTTGACCCCACTGAAATACTTTGGCTTCAGGTGGCTGCAAA
AATTCATGTTTCATCTATGGCAATGCGCAGGCTTGTTGGAGAAGTAACTGCAAAAGTCATGGATGCTCTG
GGCTCAAACTTGAGTGCTCTTTTTCAAATTGTTAAACAACAAATAGCCAGAATCTTTCAAAAGGCACTGG
CTATTTTTGAGAATGTGAATGAATTACCACAGCGTATTGCAGCACTTAAGATGGCTTTTGCCAAGTGTGC
TAGGTCAATTACTGTTGTGGTTGTTGAAAGAACTCTAGTTGTTAAAGAGTTCGCAGGAACTTGTCTTGCA
AGCATTAATGGTGCTGTCGCAAAATTCTTTGAAGAGTTGCCAAACGGCTTCATGGGTTCTAAGATTTTCA
CAACACTTGCCTTCTTTAAAGAGGCAGCTGTGAGAGTTGTGGAGAACATACCAAATGCACCGAGAGGTAC
TAAGGGATTTGAAGTTGTTGGCAATGCCAAAGGCACACAGGTAGTTGTGCGCGGCATGCGAAATGACTTA
ACATTGCTTGACCAAAAAGCTGATATTCCTGTTGAACCAGAAGGTTGGTCTGCAATTTTGGATGGACATC
TTTGCTATGTCTTTAGGAGTGGTGATCGCTTTTATGCTGCACCTCTTTCAGGAAATTTTGCTTTGAGTGA
TGTTCATTGCTGTGAGCGTGTAGTCTGTCTATCTGATGGTGTAACACCGGAGATAAATGATGGACTCATT
CTAGCTGCAATCTACTCTTCTTTTAGTGTCTCTGAGCTTGTAACAGCTCTTAAAAAGGGTGAACCATTCA
AGTTCTTGGGCCATAAATTCGTGTATGCGAAGGATGCAGCAGTGTCTTTTACTTTAGCGAAGGCTGCCAC
TATTGCAGATGTCTTGAGGCTGTTTCAATCAGCTCGTGTGATAGCAGAAGATGTTTGGTCTTCATTTACT
GAAAAGTCTTTTGAATTCTGGAAGCTTGCATATGGAAAAGTGCGCAACCTTGAAGAATTTGTGAAGACCT
ATGTTTGTAAGGCTCAAATGTCGATTGTGATTCTAGCAGCAGTGCTTGGAGAGGACATTTGGCATCTTGT
CTCACAAGTCATCTATAAATTAGGTGTTCTTTTTACTAAAGTCGTTGACTTTTGTGACAAACACTGGAAA
GGTTTTTGTGTACAGTTGAAAAGAGCTAAGCTCATTGTCACCGAAACCTTCTGTGTTTTAAAAGGAGTTG
CACAGCATTGTTTTCAACTGCTGCTAGATGCAATACACTCTTTGTACAAGAGTTTTAAGAAGTGTGCACT
TGGTAGAATCCATGGAGATTTGCTCTTCTGGAAAGGAGGTGTGCATAAAATTGTTCAAGATGGCGATGAA
ATATGGTTTGACGCCATTGATAGTGTTGATGTTGAAGATCTGGGTGTTGTTCAGGAAAAATCGATTGATT
TTGAGGTTTGCGATGACGTGACACTTCCAGAAAACCAACCTGGTCATATGGTTCAAATAGAGGATGATGG
TAAGAACTACATGTTCTTCCGTTTTAAAAAGGATGAGAACATTTATTATACACCAATGTCTCAACTTGGT
GCTATTAATGTGGTTTGCAAAGCAGGCGGTAAGACTGTCACCTTTGGAGAAACTACAGTACAAGAGATAC
CACCACCTGATGTCGTGCCTATTAAGGTTAGCATAGAATGTTGTGGTGAACCATGGAATACGATCTTCAA
GAAGGCTTATAAAGAGCCTATAGAAGTAGATACAGACCTCACAGTAGAACAATTGCTCTCTGTGATCTAT
GAGAAAATGTGTGACGACCTTAAATTGTTTCCAGAGGCACCAGAGCCTCCACCATTTGAGAATGTCGCAC
TTGTTGATAAGAACGGTAAAGATTTGGATTGTATAAAATCTTGCCATTTGATCTATCGTGACTATGAGAG
CGATGATGACATCGAGGAGGAAGATGCTGAGGAGTGTGACACAGACTCAGGTGAAGCTGAGGAGTGTGAC
ACTAATTCAGAATGTGAAGAAGAGGATGAGGATACTAAAGTGTTGGCTCTTATACAAGACCCGGCAAGTA
TTAAATACCCTCTGCCTCTTGATGAAGATTATAGCGTCTATAATGGATGTATTGTACACAAGGACGCTCT
TGATGTTGTGAATTTACCATCTGGTGAAGAAACTTTTGTTGTCAATAACTGTTTTGAGGGAGCTGTTAAA
CCACTTCCACAGAAGGTAGTTGATGTTCTTGGTGACTGGGGAGAGGCTGTTGATGCGCAAGAACAACTGT
GTCAACAAGAGCCTCTGCAACATACCTTTGAAGAACCAGTCGAAAATTCTACTGGTAGTTCTAAGACAAT
GACTGAACAAGTCGTTGTAGAAGATCAAGAACTACCTGTTGTTGAACAAGATCAGGATGTAGTTGTTTAT
ACACCTACAGATCTTGAAGTTGCAAAAGAAACAGCAGAAGAGGTTGATGAGTTTATTCTCATTTTTGCTG
TTCCTAAAGAAGAAGTTGTGTCCCAGAAAGATGGGGCACAGATTAAACAAGAGCCTATTCAAGTTGTTAA
ACCACAACGTGAGAAGAAGGCTAAAAAGTTCAAAGTTAAACCAGCCACATGTGAGAAACCTAAATTTTTG
GAGTATAAAACATGTGTGGGTGATTTGACTGTTGTAATTGCCAAAGCATTGGATGAGTTTAAAGAGTTCT
GCATTGTAAATGCTGCAAATGAGCATATGACTCATGGTAGTGGCGTTGCAAAGGCAATTGCAGACTTTTG
TGGACTGGATTTTGTTGAATATTGTGAGGACTATGTTAAGAAACATGGGCCACAACAGAGACTTGTTACA
CCTTCGTTTGTCAAAGGCATTCAATGTGTGAATAATGTTGTAGGACCCCGCCATGGAGACAACAACTTGC
ATGAGAAGCTTGTTGCTGCCTACAAGAATGTGCTTGTAGATGGCGTAGTCAATTATGTTGTGCCAGTTCT
TTCATTAGGAATTTTTGGTGTAGATTTTAAAATGTCAATAGACGCAATGCGTGAAGCTTTTGAAGGTTGC
ACCATACGCGTTCTTTTGTTTTCTCTGAGCCAAGAACACATCGATTATTTCGATGTAACTTGCAAACAGA
AGACAATTTATCTTACGGAGGATGGTGTTAAATACCGCTCCATTGTTCTAAAACCTGGTGACTCATTGGG
TCAATTTGGACAGGTTTATGCTAAAAACAAGATAGTTTTTACAGCCGATGATGTTGAGGACAAAGAAATT
CTCTACGTCCCCACGACTGATAAAAGCATTCTTGAATACTATGGTTTAGATGCGCAAAAGTATGTAATAT
ATTTGCAAACGCTTGCGCAGAAATGGAATGTCCAATATAGGGACAATTTTCTTATACTAGAGTGGCGCGA
TGGAAATTGTTGGATTAGTTCAGCAATAGTTCTCCTTCAAGCTGCTAAAATTAGGTTTAAAGGTTTTCTA
ACAGAAGCGTGGGCTAAACTGTTAGGTGGAGATCCTACAGACTTTGTTGCCTGGTGTTATGCAAGTTGTA
CTGCTAAAGTAGGTGATTTCTCAGATGCTAATTGGCTTTTAGCGAATTTAGCAGAACATTTTGACGCAGA
TTACACAAATGCGTTTCTTAAGAAGCGCGTTTCGTGTAACTGTGGTATTAAGAGCTATGAGCTTAGAGGC
CTTGAAGCTTGTATTCAGCCAGTTCGGGCAACTAATCTGCTACATTTTAAGACGCAATATTCAAATTGCC
CAACCTGTGGCGCAAATAATACGGATGAAGTAATAGAAGCTTCGTTACCGTACTTATTGCTTTTTGCTAC
TGATGGTCCTGCTACAGTTGATTGTGATGAAGATGCTGTGGGGACTGTCGTGTTTGTTGGTTCTACTAAT
AGTGGCCATTGTTATACACAAGCTGCAGGGCAAGCTTTTGATAATCTTGCTAAAGATAGAAAATTTGGAA
AGAAGTCGCCTTACATTACTGCAATGTATACGCGATTCGCTTTTAAGAATGAAACCTCTTTGCCTGTTGC
TAAACAGAGCAAGGGTAAGTCTAAGTCGGTAAAGGAAGATGTTTCTAACCTTGCTACTAGTTCTAAGGCC
AGTTTTGATAATCTTACTGACTTCGAACAGTGGTATGATAGTAACATCTATGAAAGTCTTAAAGTGCAGG
AATCACCTGATAACTTTGATAAATATGTGTCATTCACAACAAAGGAAGATTCTAAGTTGCCATTGACACT
TAAGGTTAGAGGTATTAAATCAGTTGTTGACTTTAGATCGAAGGATGGTTTTATTTATAAGTTAACACCT
GATACTGATGAAAATTCAAAAGCACCAGTCTACTACCCAGTCTTGGACGCTATTAGTCTTAAGGCAATAT
GGGTGGAAGGTAATGCTAACTTTGTTGTTGGTCATCCAAATTATTATAGTAAGTCTCTTCATATTCCTAC
TTTTTGGGAAAATGCTGAGAATTTTGTTAAAATGGGTGATAAAATTGGTGGTGTAACTATGGGACTTTGG
CGTGCAGAACACCTTAATAAACCTAATTTGGAGAGAATTTTCAACATTGCTAAGAAAGCCATTGTTGGAT
CTAGTGTTGTTACTACACAATGCGGTAAATTAATAGGTAAAGCAGCTACATTCATTGCTGATAAAGTAGG
TGGTGGTGTAGTTCGCAATATTACAGATAGCATTAAGGGTCTTTGTGGAATTACACGAGGGCATTTTGAA
AGAAAAATGTCTCCACAATTCCTAAAGACGCTTATGTTCTTTTTATTCTATTTCTTGAAGGCTAGTGTTA
AGAGTGTTGTCGCTAGCTATAAGACCGTGTTATGTAAGGTGGTACTTGCTACTTTACTTATAGTTTGGTT
TGTCTACACAAGTAACCCAGTAATGTTTACAGGAATACGTGTGTTAGATTTTCTATTCGAGGGTTCTTTG
TGTGGTCCTTATAAAGACTATGGTAAAGATTCTTTTGATGTGTTACGATATTGTGCAGATGATTTTATTT
GTCGTGTGTGTTTACATGACAAAGATTCACTTCATTTGTACAAACACGCTTATAGTGTAGAGCAGGTCTA
TAAAGATGCAGCTTCTGGTTTTATTTTTAATTGGAATTGGCTTTATTTGGTCTTTCTAATATTATTTGTT
AAACCAGTGGCAGGTTTTGTTATTATTTGCTATTGTGTTAAGTATTTGGTATTGAATTCAACTGTGCTGC
AAACTGGTGTTTGTTTTTTAGATTGGTTTGTACAAACAGTTTTTAGTCACTTTAATTTTATGGGAGCAGG
GTTTTATTTCTGGCTCTTTTACAAGATATATATACAGGTGCATCATATACTGTATTGTAAGGATGTAACA
TGTGAAGTGTGCAAAAGGGTTGCACGCAGCAACAGGCAAGAGGTTAGCGTGGTTGTTGGTGGACGCAAGC
AGATAGTGCATGTTTACACTAACTCTGGCTATAACTTTTGTAAGAGACATAATTGGTATTGTAGAAATTG
TGATGATTATGGTCACCAAAATACATTTATGTCTCCTGAAGTTGCTGGCGAGCTCTCTGAAAAGCTTAAG
CGCCATGTTAAACCTACAGCATACGCTTACCACGTTGTGGATGAGGCATGCTTAGTTGATGATTTTGTCA
ATTTAAAATATAAAGCTGCAACTCCTGGTAAGGATAGTGCATCTTCAGCTGTTAAGTGTTTCAGTGTTAC
AGATTTCTTGAAGAAAGCTGTTTTTCTTAAGGAAGCACTGAAATGTGAACAAATATCTAATGATGGTTTT
ATAGTGTGTAATACACAGAGTGCTCATGCATTAGAGGAAGCAAAGAATGCAGCCATCTATTATGCGCAAT
ATCTGTGTAAGCCAATACTTATACTTGACCAGGCACTTTATGAGCAATTAGTAGTAGAGCCTGTGTCTAA
GAGTGTTATAGATAAAGTGTGTAGCATTTTGTCTAGTATAATATCTGTAGATACTGCAGCTTTAAATTAT
AAGGCAGGCACACTTCGTGATGCTCTGCTTTCTATTACTAAAGACGAAGAGGCCGTAGATATGGCTATAT
TCTGTCATAATCATGATGTGGATTACACTGGTGATGGTTTTACTAATGTGATACCGTCATATGGTATAGA
CACTGGCAAGTTAACACCTCGTGATAGAGGGTTTTTGATAAATGCAGATGCTTCTATTGCTAACTTAAGA
GTTAAAAATGCTCCGCCGGTAGTATGGAAGTTTTCTGAGCTTATTAAGTTGTCTGACAGTTGTCTTAAAT
ATTTAATTTCGGCTACTGTTAAGTCAGGTGTTCGTTTCTTTATAACAAAGTCTGGTGCTAAACAAGTTAT
TGCTTGTCATACACAGAAGTTGTTAGTAGAGAAAAAGGCAGGTGGTATTGTTAGCGGCACCTTTAAGTGT
TTTAAGAGTTATTTTAAATGGCTCTTGATCTTTTACATACTTTTTACAGCATGTTGTTCGGGTTATTACT
ATATGGAGGTGAGTAAAAGTTTTGTTCACCCCATGTATGATGTAAACTCCACACTGCATGTTGAAGGTTT
TAAAGTTATAGATAAAGGTGTTCTTAGGGAAATTGTACCAGAAGATACATGTTTCTCTAATAAATTTGTT
AATTTTGATGCTTTTTGGGGCAGACCATATGATAATAGTAGAAACTGTCCAATTGTCACAGCTGTTATAG
ATGGTGATGGGACAGTAGCTACAGGTGTTCCTGGTTTTGTGTCCTGGGTTATGGATGGTGTTATGTTTAT
ACATATGACACAGACTGAGAGAAAACCGTGGTACATTCCTACTTGGTTTAATAGAGAAATTGTCGGTTAC
ACTCAGGATTCAATTATTACTGAGGGTAGTTTTTATACATCTATAGCGTTATTTTCCGCTAGGTGTTTAT
ATTTAACAGCCAGCAATACACCTCAATTGTATTGCTTTAATGGTGATAATGATGCACCTGGGGCTTTGCC
ATTTGGTAGTATTATTCCTCATAGAGTTTATTTCCAACCCAATGGTGTTAGGCTTATAGTTCCACAACAA
ATACTGCACACACCCTACGTAGTAAAGTTTGTATCAGACAGCTATTGTAGGGGTAGTGTGTGTGAGTACA
CTAGACCAGGTTACTGTGTGTCATTAAACCCACAATGGGTTTTGTTTAATGACGAATACACAAGTAAACC
CGGTGTTTTCTGTGGTTCTACTGTTAGAGAACTTATGTTTAGTATGGTTAGTACATTCTTTACTGGTGTT
AACCCCAATATCTATATGCAATTAGCAACTATGTTTTTAATACTAGTTGTTGTTGTATTAATCTTTGCAA
TGGTTATAAAGTTTCAAGGTGTTTTTAAAGCTTATGCAACCACTGTTTTTATAACAATGTTAGTTTGGGT
AATTAACGCATTTATTTTGTGTGTACATAGTTACAACAGTGTTTTAGCTGTTATATTACTAGTACTCTAT
TGCTATGCGTCATTGGTTACAAGTCGCAATACTGTTATAATAATGCATTGTTGGCTTGTTTTTACCTTTG
GTTTAATAGTACCCACATGGTTGGCTTGTTGCTACCTGGGATTTATTATTTATATGTATACACCGTTGTT
TTTATGGTGTTATGGTACTACAAAAAACACTCGTAAGCTGTATGATGGCAATGAGTTTGTTGGTAATTAT
GATCTTGCTGCGAAGAGCACTTTTGTTATTCGCGGCTCTGAATTTGTTAAGCTTACTAATGAGATAGGTG
ATAAATTTGAGGCCTACCTTTCAGCGTATGCTAGATTAAAGTACTATTCAGGCACTGGCAGTGAACAAGA
TTATTTGCAAGCTTGTCGTGCATGGTTAGCTTATGCTTTGGACCAATATAGAAATAGTGGTGTGGAAATT
GTTTATACTCCGCCACGTTACTCTATTGGTGTTAGTAGATTACAATCTGGTTTTAAGAAACTGGTTTCTC
CTAGTAGTGCTGTTGAAAAGTGCATTGTTAGTGTCTCTTATAGAGGTAATAATCTTAATGGACTGTGGCT
AGGTGACACTATCTACTGTCCTCGTCATGTATTGGGTAAGTTTTCAGGTGACCAATGGAATGATGTACTT
AATCTTGCTAATAATCATGAGTTTGAAGTTACAACTCAACATGGTGTTACTTTGAATGTTGTCAGTAGGC
GTTTAAAAGGTGCAGTTTTAATTTTACAAACTGCTGTTGCTAATGCTGAAACTCCAAAGTATAAGTTTAT
TAAAGCTAATTGTGGTGATAGTTTCACTATAGCTTGTGCTTATGGTGGTACAGTTGTAGGACTCTACCCT
GTTACTATGCGTTCTAATGGTACTATTAGAGCATCTTTTCTTGCGGGAGCCTGTGGTTCAGTTGGTTTTA
ATATAGAAAAGGGTGTAGTTAATTTCTTTTATATGCACCATCTTGAGTTACCTAATGCATTACACACTGG
AACTGACCTAATGGGTGAATTCTATGGTGGTTATGTTGATGAAGAGGTTGCACAAAGAGTGCCACCAGAT
AATTTAGTTACTAACAATATTGTAGCATGGCTCTATGCGGCAATTATTAGTGTTAAGGAGAGTAGTTTCT
CGCTGCCTAAATGGTTGGAGAGTACTACTGTTAGTGTTGATGATTATAATAAGTGGGCTGGTGACAATGG
TTTTACACCATTTTCTACTAGTACCGCTATTACTAAATTAAGTGCTATAACTGGAGTTGATGTTTGTAAG
CTCCTTCGCACTATTATGGTAAAAAATAGCCAGTGGGGTGGTGACCCCATTTTAGGGCAATATAATTTTG
AAGATGAATTGACACCGGAGTCTGTATTTAATCAGATTGGTGGTGTTAGATTACAATCTTCTTTTGTAAG
AAAAGCTACATCTTGGTTTTGGAGTAGATGTGTGTTAGCTTGCTTCTTATTTGTGTTGTGTGCTATTGTC
TTGTTTACGGCAGTGCCACTTAAATTTTATGTATATGCAGCTGTTATTTTGTTAATGGCTGTACTTTTTA
TTTCTTTTACTGTTAAACATGTTATGGCATATATGGATACTTTTCTATTGCCAACATTGATTACAGTTAT
TATTGGAGTTTGTGCTGAAGTGCCTTTCATCTACAATACTCTAATTAGTCAAGTTGTTATTTTCTTAAGT
CAATGGTATGACCCAGTAGTCTTTGATACTATGGTACCATGGATGTTCTTGCCACTAGTGTTGTATACTG
CTTTTAAGTGTGTACAAGGTTGCTATATGAATTCTTTCAATACTTCTTTGTTAATGCTGTATCAGTTTGT
GAAGTTAGGTTTTGTTATTTACACCTCTTCTAATACTCTTACTGCATACACAGAAGGTAATTGGGAGTTA
TTCTTCGAGTTGGTGCACACTACTGTGTTGGCTAATGTTAGTAGTAATTCTTTAATTGGTTTATTTGTTT
TTAAGTGTGCTAAATGGATGTTGTATTATTGTAATGCAACATACTTAAACAATTATGTACTAATGGCAGT
TATGGTTAACTGCATTGGCTGGCTCTGCACTTGTTACTTTGGGTTGTATTGGTGGGTTAATAAGGTTTTT
GGTTTAACCTTAGGTAAATACAATTTTAAAGTTTCAGTAGATCAATATAGGTATATGTGTTTGCACAAGA
TAAACCCACCTAAAACTGTGTGGGAAGTCTTTTCGACAAATATACTTATACAAGGAATTGGTGGTGACCG
TGTGTTGCCTATTGCTACAGTTCAAGCTAAATTGAGTGATGTAAAGTGTACAACTGTTGTTTTAATGCAG
CTTTTGACTAAGCTTAATGTTGAAGCAAATTCAAAAATGCATGTTTATCTTGTTGAGTTACACAATAAAA
TTCTTGCTTCTGATGATGTTGGAGAGTGCATGGATAATTTGTTGGGTATGCTTATAACACTATTTTGTAT
AGATTCTACTATTGATTTGAGTGAGTATTGTGATGACATACTTAAGAGGTCAACTGTATTACAATCGGTT
ACTCAAGAATTCTCACATATACCCTCTTATGCTGAATATGAAAGGGCTAAGAATCTTTATGAAAAGGTTT
TAGTTGATTCTAAAAATGGTGGTGTTACACAGCAAGAGCTTGCTGCATATCGTAAAGCTGCCAATATTGC
AAAGTCAGTTTTTGATAGAGACTTGGCTGTCCAAAAGAAGTTAGATAGCATGGCAGAGCGTGCTATGACA
ACAATGTATAAAGAGGCGCGTGTAACAGATAGACGAGCAAAATTAGTCTCATCACTACATGCGTTACTTT
TCTCAATGCTTAAGAAAATAGATTCTGAAAAGCTTAATGTCTTGTTTGACCAGGCTAGTAGTGGTGTTGT
GCCCCTAGCGACTGTTCCAATTGTTTGTAGTAATAAGCTTACACTTGTAATACCAGACCCAGAAACGTGG
GTCAAGTGTGTGGAAGGTGTGCATGTTACATATTCAACAGTTGTTTGGAATATAGACACTGTTATTGATG
CCGATGGCACAGAGTTACACCCAACTTCTACAGGTAGTGGATTGACATACTGTATAAGTGGTGCTAATAT
AGCATGGCCTTTAAAGGTTAACTTGACTAGGAATGGGCATAATAAGGTTGATGTTGTTTTGCAAAATAAT
GAGCTTATGCCACATGGTGTTAAAACAAAGGCTTGCGTAGCAGGTGTAGATCAAGCACATTGTAGCGTAG
AGTCTAAATGTTATTATACAAATATTAGTGGCAATTCAGTTGTAGCTGCTATTACTTCTTCAAATCCAAA
TCTGAAAGTAGCTTCGTTTTTGAATGAGGCAGGCAATCAGATTTATGTAGACTTAGACCCACCATGTAAA
TTTGGCATGAAAGTGGGTGTCAAGGTTGAGGTTGTTTACTTGTATTTTATAAAGAATACAAGGTCGATTG
TTAGGGGTATGGTACTTGGTGCTATATCTAATGTTGTTGTCTTACAGTCTAAAGGGCATGAAACAGAGGA
AGTGGATGCTGTTGGCATTCTTTCACTATGTTCATTTGCAGTAGATCCCGCGGACACATATTGTAAATAT
GTGGCAGCAGGTAATCAACCTTTAGGTAACTGTGTTAAAATGTTGACAGTGCATAATGGTAGTGGTTTTG
CTATAACTTCAAAGCCAAGTCCTACTCCTGACCAGGATTCTTATGGAGGAGCTTCTGTGTGTCTCTATTG
TAGAGCACACATAGCACATCCAGGAAGTGTAGGAAATTTAGATGGACGTTGTCAATTTAAAGGTTCTTTT
GTGCAAATACCTACTACGGAGAAAGACCCCGTTGGATTCTGTCTACGTAATAAGGTTTGCACTGTTTGCC
AGTGTTGGATTGGTTATGGATGTCAGTGTGATTCACTTAGACAACCAAAATCTTCTGTTCAATCAGTTGC
TGGAGCATCTGATTTTGATAAGAATTATTTAAACGGGTACGGGGTAGCAGTGAGGCTCGGCTGATACCCC
TTGCTAGTGGATGTGATCCTGATGTTGTAAAGCGAGCCTTTGATGTTTGTAATAAGGAATCAGCTGGTAT
GTTTCAAAATTTGAAGCGTAACTGCGCTAGATTCCAGGAACTACGCGATACTGAAGATGGAAATCTTGAG
TATCTTGATTCTTACTTTGTAGTTAAACAAACCACTCCTAGTAATTATGAACATGAAAAATCTTGTTACG
AAGACTTAAAGTCAGAAGTAACAGCTGACCATGACTTCTTTGTGTTCAATAAGAACATTTACAATATTAG
TAGGCAACGGCTTACTAAATATACTATGATGGACTTCTGCTATGCTTTGAGACATTTCGACCCAAAGGAT
TGTGAAGTTCTTAAAGAAATACTTGTCACTTATGGTTGTATAGAAGACTATCACCCTAAGTGGTTTGAGG
AGAATAAGGATTGGTACGACCCAATAGAAAACTCAAAATATTATGTCATGTTGGCTAAAATGGGACCTAT
TGTACGACGTGCTTTATTGAATGCTATTGAGTTCGGAAACCTTATGGTTGAAAAAGGTTATGTTGGTGTT
ATTACACTCGATAACCAAGACCTTAATGGCAAATTTTATGATTTTGGTGATTTTCAGAAGACGGCACCTG
GTGCTGGTGTTCCTGTTTTTGATACGTATTATTCTTACATGATGCCCATCATAGCCATGACGGATGCTTT
AGCACCTGAGAGGTACTTTGAATATGATGTGCACAAGGGTTATAAATCTTATGATCTCCTCAAGTATGAT
TATACTGAGGAGAAACAAGAATTGTTTCAGAAGTACTTTAAGTACTGGGATCAAGAGTATCATCCTAACT
GCCGTGACTGTAGTGATGACAGGTGTTTGATACATTGTGCAAACTTCAATATCTTGTTTTCTACACTTAT
ACCGCAGACTTCTTTCGGTAATTTGTGTAGAAAAGTTTTTGTTGATGGTGTACCATTTATAGCTACTTGT
GGCTATCATTCTAAGGAACTTGGTGTTATTATGAATCAAGATAACACCATGTCTTTTTCAAAAATGGGTT
TAAGTCAACTCATGCAGTTTGTTGGAGATCCTGCTTTGTTAGTGGGAACATCCAATAATTTAGTTGATCT
TAGAACGTCTTGTTTTAGTGTTTGTGCGTTAACATCTGGTATTACTCATCAAACGGTAAAGCCAGGTCAC
TTTAACAAGGATTTCTATGATTTTGCAGAGAAGGCTGGTATGTTTAAGGAGGGTTCGTCTATACCACTTA
AACATTTTTTCTATCCTCAAACTGGTAATGCTGCTATAAACGATTATGATTATTATCGTTATAACAGGCC
TACCATGTTTGACATATGTCAACTTCTATTTTGTTTAGAAGTGACTTCTAAATACTTTGAGTGTTATGAA
GGCGGCTGTATACCAGCTAGCCAAGTTGTAGTTAACAACTTAGATAAGAGTGCAGGCTATCCATTTAATA
AGTTTGGAAAAGCCCGCCTCTATTATGAAATGAGTCTAGAGGAACAGGACCAACTCTTCGAGATTACGAA
GAAGAATGTCCTACCCACTATAACTCAAATGAATTTAAAATATGCCATATCCGCGAAAAATAGAGCGCGT
ACAGTGGCAGGTGTGTCTATCCTTTCTACTATGACTAATAGGCAGTTTCATCAGAAGATTCTTAAGTCTA
TAGTCAACACTAGAAATGCTTCTGTAGTTATTGGAACAACCAAGTTTTATGGCGGTTGGGACAACATGTT
GAGAAACCTGATTCAGGGTGTTGAAGACCCAATTCTTATGGGTTGGGATTATCCTAAGTGTGATAGAGCA
ATGCCTAATTTGTTGCGTATAGCAGCATCCTTAGTACTTGCTCGCAAACACACTAACTGTTGTAGTTGGT
CTGAACGCATTTATAGGTTGTATAATGAATGCGCCCAGGTCTTATCTGAAACTGTACTTGCTACAGGTGG
TATTTATGTTAAACCTGGTGGCACTAGCAGTGGTGATGCTACTACTGCTTATGCAAACAGTGTTTTTAAC
ATAATACAAGCCACATCTGCTAATGTTGCGCGTCTTTTGAGTGTTATAACGCGTGATATTGTCTATGATA
ATATTAAGAGCTTGCAGTATGAATTGTATCAGCAGGTCTACAGGCGAGTTAATTTTGACCCAGCCTTTGT
TGAAAAGTTTTATTCTTACTTATGTAAGAATTTTTCGTTGATGATCTTGTCTGACGACGGTGTTGTTTGT
TACAACAACACATTAGCCAAACAAGGTCTTGTAGCAGATATTTCTGGTTTTAGAGAGGTTCTCTACTATC
AGAATAATGTTTTTATGGCTGATTCTAAATGTTGGGTTGAACCAGATTTAGAAAAAGGCCCACATGAGTT
TTGTTCACAACACACAATGCTAGTGGAGGTTGATGGTGAGCCTAAGTATTTGCCATACCCAGACCCTTCA
CGCATTTTGGGTGCATGTGTTTTTGTAGATGACGTGGATAAGACAGAACCTGTGGCTGTTATGGAGCGTT
ATATAGCTCTTGCCATAGATGCTTATCCACTAGTACATCATGAAAATGAAGAGTACAAGAAGGTATTCTT
TGTTCTCCTTGCATATATCAGAAAACTCTATCAAGAGCTTTCTCAGAATATGCTTATGGACTACTCTTTT
GTAATGGATATAGACAAGGGTAGTAAATTTTGGGAACAGGAGTTCTATGAGAATATGTATAGAGCTCCTA
CGACTTTACAATCTTGTGGCGTTTGTGTAGTTTGTAATAGTCAAACTATACTACGCTGCGGTAATTGTAT
TCGTAAACCGTTTTTGTGTTGTAAGTGTTGCTATGACCACGTCATGCATACGGACCACAAAAATGTTTTA
TCTATAAATCCTTATATTTGCTCACAGCTAGGTTGCGGTGAAGCAGATGTTACTAAATTGTACCTCGGGG
GTATGTCGTACTTCTGTGGTAATCATAAACCGAAATTGTCAATACCGTTAGTATCTAATGGTACTGTTTT
TGGAATTTACAGGGCTAATTGTGCTGGTAGTGAAAATGTTGATGATTTTAATCAACTAGCTACTACTAAT
TGGTCCATTGTCGAACCTTATATTTTAGCAAATCGCTGTAGTGATTCATTGAGACGTTTTGCTGCAGAGA
CAGTAAAAGCCACAGAAGAATTACATAAGCAACAATTTGCTAGTGCAGAAGTGCGAGAAGTATTCTCAGA
TCGTGAATTGATTCTATCATGGGAACCAGGAAAAACCAGGCCGCCATTGAATAGAAATTATGTTTTCACA
GGTTATCACTTTACAAGAACTAGTAAGGTGCAGCTTGGTGATTTTACATTTGAAAAAGGTGAAGGTAAGG
ATGTTGTCTATTATAAAGCAACGTCTACTGCTAAATTGTCTGTAGGAGACATTTTTGTTTTAACCTCACA
CAATGTTGTTTCTCTCGTAGCGCCAACATTGTGTCCACAACAAACCTTTTCTAGGTTTGTAAATTTAAGA
CCTAATGTAATGGTACCTGAATGTTTTGTAAATAACATTCCACTTTACCATTTAGTAGGTAAACAGAAGC
GTACTACAGTACAAGGTCCTCCTGGCAGTGGTAAATCCCACTTTGCTATAGGCCTTGCAGTATACTTTAG
TAGCGCTCGTGTTGTTTTTACTGCATGTTCTCATGCAGCTGTTGATGCTTTATGTGAAAAAGCTTTTAAG
TTTCTTAAAGTTGATGATTGCACTCGTATAGTACCCCAAAGGACTACTGTCGATTGCTTCTCAAAATTTA
AAGCTAATGACACAGGCAAAAAGTACATTTTTAGTACTATTAATGCCTTGCCGGAAGTTAGTTGTGATAT
TCTTTTGGTTGACGAGGTTAGTATGTTGACCAATTACGAATTGTCCTTTATTAATGGTAAGATAAATTAC
CAATATGTTGTGTATGTAGGTGATCCGGCTCAATTACCGGCACCCCGCACTTTACTTAATGGTTCACTTT
CTCCAAAGGATTATAATGTTGTCACAAACCTTATGGTTTGTGTTAAACCTGATATTTTCCTTGCAAAGTG
TTATCGTTGTCCTAAGGAAATTGTAGACACTGTGTCTACTCTTGTTTATGATGGAAAGTTTATTGCAAAT
AACCCAGAATCACGTGAGTGTTTCAAGGTTATAGTTAATAATGGCAATTCTGATGTAGGACATGAAAGTG
GTTCAGCCTACAACACAACACAATTGGAATTTGTGAAAGACTTTGTTTGTCGCAATAAACAATGGCGGGA
AGCAATATTTATTTCACCTTACAATGCTATGAACCAGAGAGCTTACCGTATGCTTGGACTTAATGTTCAA
ACAGTAGATTCTTCTCAAGGTTCAGAGTATGATTATGTCATCTTCTGTGTTACTGCAGATTCGCAGCATG
CACTGAATATTAATAGATTTAATGTGGCGCTTACAAGAGCTAAGCGTGGTATACTAGTTGTCATGCGCCA
GCGTGATGAATTGTATTCTGCTCTTAAGTTTACAGAGCTAGATAGTGAAACAAGTCTGCAAGGTACAGGT
TTGTTTAAAATTTGCAACAAAGAATTTAGTGGTGTCCATCCTGCTTATGCAGTCACAACTAAGGCTCTTG
CTGCAACCTATAAAGTTAATGATGAACTTGCTGCACTTGTTAATGTGGAAGCTGGTTCAGAAATAACATA
TAAACATCTTATTTCTCTGTTAGGATTCAAGATGAGTGTTAATGTTGAAGGCTGCCACAACATGTTTATA
ACACGTGATGAGGCAATCCGCAATGTAAGAGGTTGGGTAGGTTTTGATGTAGAAGCAACACATGCTTGTG
GCACTAACATTGGTACTAACCTGCCTTTTCAAGTAGGTTTCTCTACTGGTGCAGACTTTGTAGTCACGCC
TGAGGGACTTGTAGATACTTCAATAGGCAATAATTTTGAGCCTGTGAATTCTAAAGCACCTCCAGGTGAA
CAATTTAACCACTTGAGAGTGTTATTTAAAAGTGCTAAACCTTGGCATGTTATAAGACCAAGGATAGTGC
AGATGTTAGCAGACAATCTATGCAACGTTTCAGATTGTGTAGTGTTTGTCACATGGTGTCATGGCCTAGA
ACTAACTACTTTGCGCTATTTTGTTAAAATAGGCAAGGAACAAGTTTGTTCTTGTGGTTCTAGAGCTACA
ACTTTTAATTCTCATACTCAAGCTTATGCTTGTTGGAAGCATTGTTTGGGTTTTGATTTTGTTTATAACC
CACTTCTAGTGGATATTCAACAGTGGGGTTACTCGGGTAACCTACAGTTTAATCATGATTTGCACTGTAA
TGTGCATGGCCACGCTCATGTAGCTTCTGTTGACGCTATAATGACTCGTTGTCTTGCAATTAACAATGCA
TTTTGTCAAGATGTCAACTGGGATTTGACATACCCTCACATTGCAAATGAGGATGAAGTCAATTCTAGTT
GTAGATATCTACAACGCATGTATCTTAATGCGTGTGTTGATGCTCTTAAAGTTAATGTTGTCTATGATAT
AGGCAACCCTAAAGGTATTAAATGTGTTAGGCGTGGGGATGTTAATTTTAGATTCTATGATAAGAATCCA
ATAGTACGCAACGTCAAGCAGTTTGAGTATGACTATAATCAGCACAAAGATAAGTTTGCTGATGGTCTTT
GTATGTTTTGGAATTGTAATGTGGATTGTTATCCTGATAATTCCTTGGTTTGTAGGTATGACACACGAAA
TTTGAGTGTGTTTAACCTACCAGGCTGTAATGGTGGTAGTCTGTACGTTAACAAACATGCATTCTACACA
CCTAAATTTGACCGCATTAGCTTCCGCAATTTGAAAGCTATGCCATTCTTTTTTTATGACTCATCGCCTT
GTGAAACCATTCAAGTGGATGGAGTTGCGCAAGACCTTGTGTCTCTAGCTACGAAAGACTGTATCACAAA
GTGCAACATTGGTGGCGCTGTTTGTAAGAAACATGCCCAGATGTATGCAGAATTTGTGACTTCTTACAAT
GCAGCTGTCACAGCTGGCTTTACTTTCTGGGTAACTAATAAACTTAACCCTTATAACTTATGGAAAAGTT
TTTCAGCTCTCCAGTCTATCGACAATATTGCTTATAATATGTATAAGGGTGGTCATTATGATGCTATTGC
TGGAGAAATGCCCACTGTCATAACTGGAGACAAAGTTTTTGTTATTGATCAAGGTGTAGAAAAGGCAGTT
TTTGTTAATCAAACAACTCTACCTACATCTGTGGCGTTTGAGCTATATGCAAAGAGAAATATTCGCACAC
TGCCAAACAACCGTATTTTGAAAGGTTTAGGTGTAGACGTAACCAATGGATTTGTAATTTGGGATTATGC
TAACCAAACACCATTGTATCGTAATACCGTCAAGGTATGTGCATATACAGATATTGAGCCAAATGGCCTA
GTAGTTCTGTATGATGATAGATATGGTGATTACCAGTCTTTTCTTGCTGCTGATAATGCTGTTCTAGTTT
CTACACAGTGTTATAAGCGATATTCATACGTAGAAATACCATCTAATTTGCTCGTTCAGAATGGTATGCC
ATTAAAAGATGGAGCGAACCTGTATGTTTATAAGCGTGTTAATGGTGCGTTTGTTACACTACCTAACACA
ATAAACACCCAGGGTCGAAGTTATGAAACTTTTGAACCTCGTAGTGACATTGAGCGTGATTTTCTCGCTA
TGTCAGAGGAGAGTTTTGTAGAAAGGTATGGTAAAGACTTAGGCCTACAACACATACTGTATGGTGAAGT
TGATAAGCCCCAATTAGGTGGTTTACACACTGTTATAGGTATGTACAGACTCTTACGTGCGAATAAGTTG
AACGCAAAGTCTGTAACTAATTCGGATTCTGATGTCATGCAAAATTACTTTGTATTGTCGGACAATGGTT
CTTACAAGCAAGTGTGTACTGTTGTGGATTTACTGCTTGATGATTTCTTAGAACTTCTTAGAAACATACT
TAAGGAGTATGGTACTAATAAGTCAAAAGTTGTAACAGTGTCAATTGATTACCATAGCATAAATTTTATG
ACTTGGTTTGAAGATGGCAGTATTAAAACATGTTATCCACAGCTTCAATCAGCATGGACGTGTGGTTATA
ATATGCCTGAACTTTATAAAGTTCAGAATTGTGTTATGGAACCTTGCAACATTCCTAATTATGGTGTTGG
AATAACGTTGCCTAGCGGTATTCTTATGAATGTGGCAAAGTATACACAACTTTGTCAATACCTTTCGAAA
ACAACAATTTGTGTACCGCATAACATGCGAGTAATGCATTTCGGAGCAGGAAGCGACAAAGGAGTGGCGC
CAGGTAGTACTGTTCTTAAACAATGGCTCCCAGAAGGGACACTCCTTGTCGATAATGATATTGTAGACTA
TGTGTCTGATGCACATGTTTCTGTGCTTTCAGATTGCAATAAATATAATACAGAGCACAAGTTTGATCTT
GTGATATCTGATATGTATACAGATAATGATTCAAAAAGAAAGCATGAAGGCGTGATAGCCAATAATGGCA
ATGATGACGTTTTCATATATCTCTCAAGTTTTCTTCGTAACAATTTGGCTCTAGGTGGTAGTTTTGCTGT
AAAAGTGACAGAGACAAGTTGGCACGAAGTTTTATATGACATTGCACAGGATTGTGCATGGTGGACAATG
TTTTGTACAGCAGTGAATGCCTCTTCTTCAGAAGCATTCTTGATTGGTGTTAATTATTTGGGTGCAAGTG
AAAAGGTTAAGGTTAGTGGAAAAACGCTGCACGCAAATTATATATTTTGGAGGAATTGTAATTATTTACA
AACCTCTGCTTATAGTATATTTGACGTTGCTAAGTTTGATTTGAGATTGAAAGCAACGCCAGTTGTTAAT
TTGAAAACTGAACAAAAGACAGACTTAGTCTTTAATTTAATTAAGTGTGGTAAGTTACTGGTAAGAGATG
TTGGTAACACCTCTTTTACTAGTGACTCTTTTGTGTGCACTATGTAGTGCTGTTTTGTATGACAGTAGTT
CTTACGTTTACTACTACCAAAGTGCCTTCAGACCACCTAGTGGTTGGCATTTACAAGGGGGTGCTTATGC
GGTAGTTAACATTTCTAGCGAATTTAATAATGCAGGCTCTTCATCAGGGTGTACTGTTGGTATTATTCAT
GGTGGTCGTGTTGTTAATGCTTCTTCTATAGCTATGACGGCACCGTCATCAGGTATGGCTTGGTCTAGCA
GTCAGTTTTGTACTGCACACTGTAATTTTTCAGATACTACAGTGTTTGTTACACATTGTTATAAACATGG
TGGGTGTCCTTTAACTGGCATGCTTCAACAGAATCTTATACGTGTTTCTGCTATGAAAAATGGCCAGCTT
TTCTATAATTTAACAGTTAGTGTAGCTAAGTACCCTACTTTTAGATCATTTCAGTGTGTTAATAATTTAA
CATCCGTATATTTAAATGGTGATCTTGTTTACACCTCTAATGAGACCATAGATGTTACATCTGCAGGTGT
TTATTTTAAAGCTGGTGGACCTATAACTTATAAAGTTATGAGAGAAGTTAAAGCCCTGGCTTATTTTGTT
AATGGTACTGCACAAGATGTTATTTTGTGTGATGGATCACCTAGAGGCTTGTTAGCATGCCAGTATAATA
CTGGCAATTTTTCAGATGGCTTTTATCCTTTTACTAATAGTAGTTTAGTTAAGCAGAAGTTTATTGTCTA
TCGTGAAAATAGTGTTAATACTACTTGTACGTTACACAATTTCATTTTTCATAATGAGACTGGCGCCAAC
CCTAATCCTAGTGGTGTTCAGAATATTCAAACTTACCAAACAAAAACAGCTCAGAGTGGTTATTATAATT
TTAATTTTTCCTTTCTGAGTAGTTTTGTTTATAAGGAGTCTAATTTTATGTATGGATCTTATCACCCAAG
TTGTAAATTTAGACTAGAAACTATTAATAATGGCTTGTGGTTTAATTCACTTTCAGTTTCAATTGCTTAC
GGTCCTCTTCAAGGTGGTTGCAAGCAATCTGTCTTTAAAGGTAGAGCAACTTGTTGTTATGCTTATTCAT
ATGGAGGTCCTTCGCTGTGTAAAGGTGTTTATTCAGGTGAGTTAGATCATAATTTTGAATGTGGACTGTT
AGTTTATGTTACTAAGAGCGGTGGCTCTCGTATACAAACAGCCACTGAACCGCCAGTTATAACTCAAAAC
AATTATAATAATATTACTTTAAATACTTGTGTTGATTATAATATATATGGCAGAACTGGCCAAGGTTTTA
TTACTAATGTGACCGACTCAGCTGTTAGTTATAATTATCTAGCAGACGCAGGTTTGGCTATTTTAGATAC
ATCTGGTTCCATAGACATCTTTGTTGTACAAGGTGAATATGGTCTTAATTATTATAAGGTTAACCCTTGC
GAAGATGTCAACCAGCAGTTTGTAGTTTCTGGTGGTAAATTAGTAGGTATTCTTACTTCACGTAATGAGA
CTGGTTCTCAGCTTCTTGAGAACCAGTTTTACATCAAAATCACTAATGGAACACGTCGTTTTAGACGTTC
TATTACTGAAAATGTTGCAAATTGCCCTTATGTTAGTTATGGTAAGTTTTGTATAAAACCTGATGGCTCA
ATTGCCACAATAGTACCAAAACAATTGGAACAGTTTGTGGCACCTTTATTTAATGTTACTGAAAATGTGC
TCATACCTAACAGTTTCAACTTAACTGTTACAGATGAGTACATACAAACGCGTATGGATAAGGTCCAAAT
TAATTGCCTGCAGTATGTTTGTGGCAGTTCTCTGGATTGTAGAAAGTTGTTTCAACAATATGGGCCTGTT
TGCGACAACATATTGTCTGTAGTAAATAGTGTTGGTCAAAAAGAAGATATGGAACTTTTGAATTTCTATT
CTTCTACTAAACCGGCTGGTTTTAATACACCAGTTCTTAGTAATGTTAGCACTGGTGAGTTTAATATTTC
TCTTCTGTTAACAAATCCTAGTAGTCGTAGAAAGCGTTCTCTTATTGAAGACCTTCTATTTACAAGCGTT
GAATCTGTTGGACTACCAACAAATGACGCATATAAAAATTGCACTGCAGGACCTTTAGGCTTTTTTAAGG
ACCTTGCGTGTGCTCGTGAATATAATGGTTTGCTTGTGTTGCCTCCTATCATAACAGCAGAAATGCAAGC
TTTGTATACTAGTTCTCTAGTAGCTTCTATGGCTTTTGGTGGTATTACTGCAGCTGGTGCTATACCTTTT
GCCACACAACTGCAGGCTAGAATTAATCACTTGGGTATTACCCAGTCACTTTTGTTGAAGAATCAAGAAA
AAATTGCTGCTTCCTTTAATAAGGCCATTGGTCATATGCAGGAAGGTTTTAGAAGTACATCTCTAGCATT
ACAACAAATTCAAGATGTTGTTAGTAAACAGAGTGCTATTCTTACTGAGACTATGGCATCACTTAATAAA
AATTTTGGTGCTATTTCTTCTGTGATTCAAGAAATCTACCAGCAATTTGACGCCATACAAGCAAATGCTC
AAGTGGATCGTCTTATAACTGGTAGATTGTCATCACTTTCTGTTTTAGCATCTGCTAAGCAGGCGGAGTA
TATTAGAGTGTCACAACAGCGTGAGTTAGCTACTCAGAAAATTAATGAGTGTGTTAAGTCACAGTCTATT
AGGTACTCCTTTTGTGGTAATGGACGACATGTTCTAACCATACCGCAAAATGCACCTAATGGTATAGTGT
TTATACACTTTTCTTATACTCCAGATAGTTTTGTTAATGTTACTGCAATAGTGGGTTTTTGTGTAAAGCC
AGCTAATGCTAGTCAGTATGCAATAGTGCCCGCTAATGGTAGGGGTATTTTTATACAAGTTAATGGTAGT
TACTACATCACTGCACGAGATATGTATATGCCAAGAGCTATTACTGCAGGAGATGTAGTTACGCTTACTT
CTTGTCAAGCAAATTATGTAAGTGTAAATAAGACCGTCATTACTACATTCGTAGACAATGATGATTTTGA
TTTTAATGACGAATTGTCAAAATGGTGGAATGATACTAAGCATGAGCTACCAGACTTTGACAAATTCAAT
TACACAGTACCTATACTTGACATTGATAGTGAAATTGATCGTATTCAAGGCGTTATACAGGGTCTTAATG
ACTCTCTAATAGACCTTGAAAAACTTTCAATACTCAAAACTTATATTAAGTGGCCTTGGTATGTGTGGTT
AGCCATAGCTTTTGCCACTATTATCTTCATCTTAATACTAGGATGGGTTTTCTTCATGACTGGTTGTTGT
GGTTGTTGTTGTGGATGCTTTGGCATTATGCCTCTAATGAGTAAGTGTGGTAAGAAATCTTCTTATTACA
CGACTTTTGATAACGATGTGGTAACTGAACAATACAGACCTAAAAAGTCTGTTTGATGATCCAAAGTCCC
ACGTCCTTCCTAATAGTATTAATTCTTCTTTGGTGTAAACTTGTACTAAGTTGTTTTAGAGAGTTTATTA
TAGCGCTCCAACAACTAATACAAGTTTTACTCCAAATTATCAATAGTAACTTACAGTCTAGACTGACCCT
TTGGCACAGTCTAGACTAATGTTAAACTTAGAAGTAATTATTGAAACTGGTGAGCAAGTGATTCAAAAAA
TCAGTTTCAATTTACAGCATATTTCAAGTGTATTAAACACAGAAGTATTTGATCCCTTTGACTATTGTTA
TTACAGAGGAGGTAATTTTTGGGAAATAGAGTCAGCTGAAGATTGTTCAGGTGATGATGAATTTATTGAA
TAAGTCGCTAGAGGAGAATGGAAGTTTTCTAACAGCGCTTTACATAATTGTAGGATTTTTAGCACTTTAT
CTTCTAGGTAGAGCACTTCAAGCATTTGTACAGGCTGCTGATGCTTGTTGTTTATTTTGGTATACATGGG
TAGTAATTCCAGGAGCTAAGGGTACAGCCTTTGTATACAAGTATACATATGGTAGAAAACTTAACAATCC
GGAATTAGAAGCAGTTATTGTTAACGAGTTTCCTAAGAACGGTTGGAATAATAAAAATCCAGCAAATTTT
CAAGATGCCCAACGAGACAAATTGTACTCTTGACTTTGAACAGTCAGTTCAGCTTTTTAAAGAGTATAAT
TTATTTATAACTGCATTCTTGTTGTTCTTAACCATAATACTTCAGTATGGCTATGCAACAAGAAGTAAGG
TTATTTATACACTGAAAATGATAGTGTTATGGTGCTTTTGGCCCCTTAACATTGCAGTAGGTGTAATTTC
ATGTACATACCCACCAAACACAGGAGGTCTTGTCGCAGCGATAATACTTACAGTGTTTGCGTGTCTGTCT
TTTGTAGGTTATTGGATCCAGAGTATTAGACTCTTTAAGCGGTGTAGGTCATGGTGGTCATTTAATCCAG
AATCTAATGCCGTAGGTTCAATACTCCTAACTAATGGTCAACAATGTAATTTTGCTATAGAGAGTGTGCC
AATGGTGCTTTCTCCAATTATAAAGAATGGTGTTCTTTATTGTGAGGGTCAGTGGCTTGCTAAGTGTGAA
CCAGACCACTTGCCTAAAGATATATTTGTTTGTACACCGGATAGACGTAATATCTACCGTATGGTGCAGA
AATATACTGGTGACCAAAGCGGAAATAAGAAAAGGTTTGCTACGTTTGTCTATGCAAAGCAGTCAGTAGA
TACTGGCGAGCTAGAAAGTGTAGCAACAGGAGGAAGTAGTCTTTACACATAAATGTGTGTGTGTAGAGAG
TATTTAAAATTATTCTTTAATAGCGCCTCTGTTTTAAGAGCGCATAAGAGTATTTATTTTGAGGATACTA
ATATAAATCCTCTTTGTTTTATACTCTCCTTTCAAGAGCTATTAACGGTGTTACCTTTCAAGTAGATAAT
GGAAAAGTCTACTACGAAGGAACACCAGTTTTCCAAAAAGGTTGTTGTAGGATGTGGTCCAATTATAAGA
AAGAATAATTGAACCACCTACTACACTTATTTTTATAAGAGGTGTTTTACTTAACAAAAACTTAACAAAT
ACGGACGATGAAATGGCTGACTAGTTTTGGAAGAGCAGTTATTTCTTGTTATAAATCCCTACTATTAACT
CAACTTAGAGTGTTAGATAGGTTAATTTTAGATCACGGACTACTACGCGTTTTAACGTGTAGTAGGCGCG
TGCTTTTAGTTCAATTAGATTTAGTTTATAGGTTGGCGTATACGCCCACCCAATCGCTGGCATGAATAAT
AGTAAAGATAATCCTTTTCGCGGAGCAATAGCAAGAAAAGCTCGAATTTATCTGAGAGAAGGATTAGATT
GTGTTTACTTTCTTAACAAAGCAGGACAAGCAGAGCCTTGTCCCGCGTGTACCTCTCTAGTATTCCAAGG
GAAAACTTGTGAGGAACACATACATAATAATAATCTTTTGTCATGGCAAGCGGTAAAGCAGCTGGAAAAA
CAGACGCCCCAGCGCCAGTCATTAAACTAGGAGGACCAAAACCACCTAAAGTCGGTTCTTCTGGAAATGC
ATCTTGGTTTCAAGCAATAAAAGCCAAGAAGTTAAATACACCTCCGCCCAAGTTTGAAGGTAGCGGTGTT
CCTGATAACGAAAACATTAAGCCAAGCCAGCAACATGGATACTGGAGACGCCAAGCCAGGTTTAAGCCAG
GCAAAGGTGGAAGAAAACCAGTCCCAGATGCTTGGTACTTTTACTATACTGGAACAGGACCTGCCGCTGA
CCTGAACTGGGGTGATACTCAAGATGGTATAGTGTGGGTTGCTGCTAAGGGTGCTGATACTAAATCTAGA
TCCAATCAGGGTACAAGAGATCCTGATAAGTTTGACCAATACCCACTACGATTCTCGGATGGCGGACCTG
ATGGTAATTTCCGTTGGGACTTCATTCCCCTGAACCGTGGTAGGAGTGGAAGATCAACAGCAGCTTCATC
AGCAGCAGCTAGTAGAGCACCATCACGTGAAGGTTCGCGTGGTCGTAGAAGTGATTCTGGAGATGACCTT
ATTGCTCGTGCAGCAAAGATAATCCAGGATCAGCAGAAAAAGGGCTCTCGCATTACCAAGGCAAAGGCAG
ATGAAATGGCTCATCGCCGGTATTGCAAGCGCACTATCCCACCTAATTATAGGGTTGATCAAGTGTTTGG
TCCCCGTACTAAAGGTAAGGAGGGGAATTTTGGTGATGACAAGATGAATGAGGAAGGTATTAAGGATGGG
CGTGTTACAGCAATGCTCAACCTAGTCCCTAGCAGCCATGCTTGTCTTTTTGGAAGTAGAGTGACACCCA
AACTTCAACTAGATGGGCTTCACTTGAGATTTGAATTTACTACTGTGGTCCCATGTGATGACCCGCAGTT
TGATAATTATGTGAAAATTTGTGATCAGTGTGTCGATGGTGTAGGAACGCGTCCAAAAGATGACGAACCA
AAACCAAAGTCACGCTCAAGTTCAAGACCTGCTACAAGAGGAAATTCTCCAGCGCCAAGACAACAGCGCC
CAAAGAAGGAGAAAAAGCTAAAGAAGCAGGATGATGAAGCAGATAAAGCATTGACCTCAGATGAGGAGAG
GAACAATGCACAGCTGGAATTTTATGATGAGCCCAAGGTAATTAACTGGGGGGATGCAGCTCTAGGAGAG
AATGAACTTTGAGTAACATAATGGACCTGTTGTTTCCTGGTACATTTTGTTAAACACTATTTCTGTGCTT
TCCTATCAATTATTACAGGCATTGATTGTGATTATGTTCAATACTTAAGCTTCTTTTGGTTGCTTTTTGC
TTATTGTATTGTTGCTGTGCTTTTTATTGTTGTGATTCTCATTAGTTTGCTTTATCGTAGAAATTCAATA
GTAAGAGTTAAGGAAGATAGGCATGTAGCTTGATTACCTACATGTCTATCGCCAGGGAAATGTCTAATCT
GTCTACTTAGTAGCCTGGAAACGAACGGTAGACCCTTAGATTTTAATTTAGTTTAATTTTTAGTTTAGTT
TAAGTTAGTTTAGAGTAGGTATAAAGATGCCAGTGCCGGGGCCACGCGGAGTACGATCGAGGGTACAGCA
CTAGGACGCCCATTAGGGGAAGAGCTAAATTTTAGTTTAAGTTAAGTTTAATTGGCTAAGTATAGTTAAA
ATTTATAGGCTAGTATAGAGTTAGAGCA

>gi|693764258|ref|NC_025217.1| Bat Hp-betacoronavirus/Zhejiang2013, complete genome
TTAAGCTTCGGCTTGTTGCATAGGACCGGAAAGGTACTATCTACCCTAACTCTTGTAGTTAGACTCTCTA
AACGAACTTTAAAACTGGTTGTGTCCTTCAGTAGTCTGTATGGCCATTGGAGGCACACCGGTAATTATCA
AATACTAAGAAGATTCATAGTACATCCTTGTCTAGCTTTTGGTTGGCAGTGAGCCTACGGTTTCGTCCGT
GTCGCTCACAATTATCCACACAGTAGGTTTCGTCCGCTGTGGTTGAGTTGCTAGTCCGTTGCTGTTTCGT
CAGCCATCTACAACTCGACACCATGTGTAGCAAGGGGTATGAACTGAATCAGAAAACTCACTTTTCTGTG
GAACTGCCATGGATCCAAATTGGTGAGAATCCTATCAAACCTTGGTCGGTTACACCGGCTGAGGCCTTGA
ACACTGTATATGCTGCCATTGCTGAAGGCAAGGCTGCATTTATCCCACCATTCAAGGGGATGCATAAGTA
TCTCCCTGAATTGTGTGTCTTTCTAGTGAGAAACCATGGGAACCCAACACGCCCTTTTGACCTGCAAGAA
CTTGCTGTCCGCGAAGGTGACGTGAACTATGGTCGCTCAGGTGAAACAGTAGGCGCAATTGTACCGCTTG
ATGGACAGGAGCCCTACGGAACTATAACAATCCAACTCCGCAGACGCGGGAAAAATGCGGGTGGAGTCTA
TGCCTGGACTAACACCCGTGATACGGTTACAGATGATTTGGTTCATGAACCAATCGATCTGTATACTGAA
GATCCTAAAGGGAAACATGCCCAGGGAAACCTGCGCAAATTCCTTACTGGCGGTAACGATTTCCATCGTT
ACGTCGATAACTACTATTGCACTGGAGACGGGAAACCGCTGCCATGCATAGTGACTTTGCTCGAGAAGGC
TGGCCATGCCAATAAGCCTCTCGACGACGCTATGGACTATCTCCGAGGCTTGAACCGTATGGGACAACCT
TGTAGAGACCATGACCATGAGCGTGTTTGGGAAGTGGAGCGCGATAATGCTCCTTATCCTGAACAATCTC
TCTTCTCAATCAGTGCTATCAAGACCTTGGGTGAAATACCCCACTGTGTCTTTGCACCTGATTGTGCCGT
CAAAGTAATGAAACCTCGCAAGGTCAAACGCGGGGCTGACGGCTTTATGACGAAACTCAGAAGAGTGTAC
AATATCAATGGCTTTGATGAAGTCAAGCCAATGGCGCTCTGTGCACTCCATTACTGTGAGGATTGTGGCA
TGGAAATGTGGTGTCACTCAAATTTTGAGGAAGCCTACTGTCCATGTGGTAAAATTTACACCAACACACC
TTGCACACTAACTTCAGCTGGTTATGTTGTTGAAGGTTCAGTTGTTGCTATGCCGTGCGATGCATGTAAG
AGCGATAGCGACCATTCTAATGGGACCTTCTATGACAGCTGTAAGTATCTTGCTGAAGACAAAGCAGAAC
CTGGTAATAGGGAAAACTTTGTCTATTTTGGAGGATGTTGCTTTGCCTATGTTGGCTGCCGCAATGGTAA
TGCCATCTGGGTACCCAGAGCACATTCAGATATTGGTAACAATCACTCAGGCATTGTTGGAGCTGATGTT
GCTTTGCTTAATGATGACCTCAAGGCCATTGTTGCTCAAGAGGTTATACCTGTTGTGATCCCTGAAGACT
TTAAGGTCAATGAGACTGTGGTTGCTCTTGTAGCAGCAGTTTCAGGTTCAGTGGACCAGTTCATTAAGAA
CTGTAAAGGACTGACAGCTGAAACCTTCAAGTGTTTGCTTGAAGCTTCTGGCAAATTCAGAGTCACTGTT
GATCATGTTATTGACGGTTGTATTTGTGTTGCTACAGATAGCGCCGTTACGGCCCTTGAACCAGCATTGG
CTTTTTGTACTGCTGCCAATATCATGTACCGCACCCTTGTGGCTACATCTGTTGTCATCAGTGCTCATAC
TTTAGATGCTTTGGCTCAACGTGTGCGTGATGCTTGTAAACACGTGCACCCTCAGGCTATGCGTCTTCTT
AATACTCTTAATGAGTATGTGGATTACAGCACTAACTCCACACTTGTACTGTGCCATGACGTCATTAATT
TGCCAATTGTGCTTGGTGATATCCTGGACAGACTTTTCTGTGGATGCAAAAAGATTGTCGAGTCTGTCAC
AACATGGCTCTACAACTTTAGCATCTCTACTATTGACACAATATTTGACCTTAAGGCTTTTATTAGTCTT
ATTGTACGTAATAAGTACAAGTTTGTCAAGGGTAAGTTTGTGTTACTTGCTAAAAATGTCAGTTCTGTAG
TGCAATCTGTTGTTGCCTACCTAAACAATGTTATCTCAGCTTTTTACCAACAAGTGCAGTTTGCTGGCAC
CTACGTAGGAGCCTTTGAAATTCATCAAACGTTACTTGAGCTGGGTGGTGCTATCTACACGCGTGTGCAG
GTTGCAGCAAACAGTATTCAAGACCTTGTTTTGCCTTCTACAGTGTCCAAAAAGGAATTAACCTTTGTGG
ATGGACATGCTATTGACACAGAATTGACTTCTGAAGAAGTTACTGTGTTGGAAGGTATAGTTGAACAACT
TGACACTGATACCAATAAGATTGCTGGTGACAGTATCAAGGGTGATTTAGTCACGGTGAATAATTGTGTT
TTCGTACGCTTTGGCGATGGAAACCTTTCACCGGCTACTACTGACTGTCAAGCCACAAAAGGAGTTTTTA
AACTCAAAGGTGGCAACCCTGACAAGGTTAAAACCGTGACCTTCGGTGAAAACGAGGTCAAGGAAATCAC
TCCATATATTACAGTGAATGTGAAGTACACCGTTCATGACCTTCTTGATAAGATTCTCAATGTGCGGCTT
CCATCATTTACTGTTGAAAAGGGCTTAACGCTCCAAGAACTTACTGCAGTTGTTGAAGACGCAGTTGTCA
CACAATTGGAAGCTATGCGTGCTATCCTACTTGAAGCGGGTGTCGACATTGATATTGACGATCTTATTGA
CTCGCCATATTATATGTTTGACAACGCAGGTGACTCTGTTATTGGACCTGTGATGTACTTTTCCAACCAA
CAGCCCGTTGACTCAGATGAGTTGACAACGGCATCAGAGACTGAAGAAGTAGTCGAAGATGCTAAACATG
CTGCAACTAAACGTTCAAGTCAAGATTGGCTTGACGATAGTTGTTCTGAAGACGATTGTGAAGAGGAAGA
CGCAGTCACTGAAGCTGAAAGCGCTGCTGATAGTGCACCAGCGTTGGTTGTGGTTATAGAGGAACCTAAG
TCTACTGTTTCGTCAGTTAGCGAGGAACCAAAGTTTCCCTTACCTGAACAGTGTTCTGTTGAAACCCACA
TAGTCGTGGATGACACAAATAGCAAACGCCTCTTATGGTCGGACATGGTTGAAGCAACTTGTGGGTCTGC
CACTGATGGAAACGAAGGAACTGTGGGTGAGGTTGACACGTGTGCGGTAGCTGTAAATCGTGACAACACT
CCATCAACGCAGTCCATCGTAACCGTTTCTCCACAGAGAGAAGTGCATCACTATGTCGTAACTGAAGAGA
AGTGGGACGAACACGTGTGCGGTAGCTGTAAACCGTGTGAAATCCCCTTGAGCGTAAAAGCTAAGCGTGT
GAACCAAAATTCTGTAAATTGTGGTGAAAAGGCTGTCGTTACAGTTAACTCCACTACAGTTTTCAACACG
CCTGTTCCACGTGAAGTGGAAGCCAAAACGGCGAATGAACAACCTAAGGTTGATAGTACTACTGTAGCTA
AAGTCACTCGTACAAAGAGTGGGCACAGTCAGGAATTCAAACCCAAAGGTTACACCAAGCTTACCGACAA
TGTGTACATTAAGTGTGCCGACATTGTTGAGGAAGCTCGCAATACAAAACCACCTATTCTTGTAAATGCA
GCGAATTGCAAACTCAAGCATGGTGGTGGTGTGGCAGGTGCGATAAGGAAGGCCGTAGGAAACTCCATTC
AGGAGGATTCTGACCTTTACATTAAAGAAAATGGTGCTATACCCGTTGGAGGGGCAGCATTACTACCAGG
TTATAACTTGGCTACTAATATCCTACATGTAGTAGGACCTAATATTACAATGAATGAGGATTCCTCACTC
ATCGTTAATGCTTACTCAAACTTGAATAGTTTTAGTACTGTTGTAACACCACTGTTATCAGCTGGTATAT
TTGGTATGAAGCCTATTGATAGTCTTACTGCCTTACTTTCTACATGTAAGAAGACAGTCTATGTTGTTGT
CAACGACAAGACTATTTTCGATGCATGTTGTAGCCACATTAATAACAAGGATGTCAAAACACCATCTAAG
CCTGTTTACATGATGGGCGAAGTAGAAGTGTTTTGTAGTACTAAAGTTGCATATTGCAACCAGGATAAAG
AATTTTGTCCTGGTACATCTACCTTATTTAAACCTGAGCAGCTTGATGAGATTAGACTTAAGTTGCCAGA
AGACTTTCTGATTGGAGATTGCCACAAAGTGGATGATGTCTACGTTTTGTGCATACCTGACCGTAGAAAG
GGACAAGACCTTACAGGTTTTAAGGGTCTTAAACAATTAAAGAAAGTCACTGCCGCTTCATGTCTACCAG
GACAGGGAAAATTTGGCTTTACTATACAGGATGTGACGCCACTTATGACGGCATGTCCTGATATTTACCT
TGTCAAAACTAGTGTTGACAATGATGTTCAATTGTTGTGTCCGACAGTGACATACAATGTTAAACAAATG
TTGGCACGCGCTAAGCAAGAAAAATTGCTTATGTGTGTCAATATTGACAACAAGTCTTTTACCAGGAACG
TTGTTCATTTGGCAAAAAATTTTCAACACAAACCAGGCTGTCAAACTGTGGACGGCTATGAGTTTTACTG
TTACACTGAGAAACAACCATTGAGTTCTATCATTGATGAACTTAATGCGTTGGGCAAGGACATCATAACA
ACGCCATTAGGTTGTATTACACACCAATTATCCTTACCAGAGTCAGCAGCAAAAATGCGTGCTCTGAAGT
GCAAATTTCTCGCAGTGTGTACTTCGCCAGGTGCTGAAAAGCAATTCTGTGCTGCATTCACAGCTGCCTC
TAGCTCTACAGAAGAAGAGTTATTTATGGCAGATTGTGTTTCTAACGGTTCCTACATGGATTGGATCGTT
ATAAACAAAGCCGATGGTGACACAATTCATTTCCTTCAGAGGGATGAAGACATCATCGATTATCACACAA
GCACTAACAAGTTCAGTATGAGTGGTGTTAGTGGGCTTGTGTTTAAAGATGTGAAGATACTCAAGCGGTA
TCTCGAAAAAACTAAGCCTATGCTGAAAGAGGTTACCGTCTATACAACTGTAGACGGTACTAATGTTAAC
ACCAAGATTTTGATTTGTTCTAAATCTTTTGGCAGCCAGCTAGGCACATGTTACATTGATGGAGAGGACG
TTACAAGTGTCTTCCCTACAAAACAACATGAAGGTAAGATTGTCAACATAACTCAAGTTGACGATGTTAC
TAGTAGTCAGGTTAAAGAATACTATGGTGTTGAAGACACTAGTTTCCTGACTCGTTATAACTCAGCCTTG
ATGCATGTCAATCGCTGGTCGTTTGCAGAAGTACCTAGTACAGGTATTTTCTGCATTAAATGGGTGGCTA
ACAATTGCTATCTTAATGCTGCGATACTCATGCTACAGCAGCTCAATGTCGAATACGAGACACCTGCTGT
GCGTGAAGCGGCTTTTGAAATGCGTGCTGGCAAACCTCAACGGTTTGTGGCACTCATGATTGCTTACTTA
AAGGCTACCATTGGTCACACTGGTGATGCTAGAGAAGCAGTTAGAACTATGCTTTCACATGCCAAAGTGC
AAGGTGAAAGGCATTTTGTTATGATGTGCAAAAAGTGTGGGATTAGACGTAGTCAGTTTCACGGTCTTGA
TGCAGTCATGTGTTTCACAACCAACACACAACTAAGTGATTTCCTTAGTGGTGACGAAGCTGGTTGCACT
TGTGGTGATATTGTGCCTGTGTATCAGACACATATCAGAGTACCCTTTTTGATTCTTTCAACCACAGAGC
CCAAAATGCAAATGCTTAACTGTGAAGACACTAAGTTTCTTTGCGCTAATAATTACATGGGCACCTTAAG
TAGTGGACACTACACCCATGTTTTCAACAAGACACTCTTGTACAGTGTAAACGGTACACGAGTAACAAAA
ATGTCAGAAACAACAACAGCTGTTGCTGACGCTGTGTATAAAGACATAAAATATGACACTGAAGACCAAT
TCGTCACATACAGACTGGATGGTGTTTGGTGTCATGAAAAGAATCCAGACTTGAGCGTGTATTACAAATC
AGGTTCTGATTATTACACATCAGCACCTATAGACTTGACTCCTACAGAGCCATTGTCTGGTGCTGAATAC
GACAATTTCCATCTTAAACTTGTTGGGACACTTGATGACAACAAAGTTAAGTTTGTGCAAGAGTTTAATC
ACATGGTCAAATATGACAAAACCAAGCCTACGAGACCTGTTACTATATCTTTCTATCCTGAGATGGAAGG
TGATGTTGTAGCACTATCTGCGGATAAGTTGCAACAACATTTTAAGAAGGGGGCAAAATTTGGTTCCAAA
TTTATAGTTTGGCACACAGGTTACAAAATCACTAGAGATCTTGTCAAGCCAAACATGGCAGCTATGCGCT
GTATAACCACCTCTAAACCTGTGACTACACAAAACTCGTTTCAAGCTCTTTCTGTTGAACCTCTTCCAGA
GACAAAACATAGCGAGCATGAATTAGCCACAGAACAAAAACCAATCCTGAAACTCAGGACAGAGAAACCA
GTTGTTACGGCTGCAGTGACAATAATTCCTGCTCCCAAAAACGCTGATGCTCCTGTTTTAATTGAATCCT
TGACTACTGATGATGCGCTAGCTATGTATGTCAAGGGTACTCGAGATTTTGTTGTTAATAAGGCTAACAG
CCTGTCTAAGCTGTTTGGTATTAACACAATTGAACAGAATGGTGTCGATGCGCTAAATATGTGCTACGAC
AGGCTAGCTGTCTTTGACTATGTCAAACCATTTTTAACAGTTACTAAAACTGCTAGTGATGTGACAATCA
AAGCAGGAAAAGTAGCATGCTCACTATTGCAAAGAACAGTACCACTGTTATATGCTTTAGTAGTGTCTTA
TTTAGTACCCTTGTTCACAAGAACAAAACAACGTGTGTCAGTTAAAGTCCCTATGGTCTTAACTAAAAAC
ACATGCAGAAGTGTCTTTGGTTTATTGATGAATGGAGTTGCTAATTACTTCACGTCACCCAAATTCAAGT
CTTGTGTAAGAGTCTTTGCATTGGCAACATGCATAGCAGCGATTCTATATATGGCTATGTTTGTATATTT
GTTCTTTGACATATGGCTATCAAAAGCTAACGTGTGGACAGATGTGCAAACACTGAAAGATAATTTTGGT
CTTGGAACGGTTTGTGATAAATTCCAGACAGCTTATAATAACTCTGGTATTTATGATGCCACCGAGTATT
GTACTGGTAAGAGTTTTATGTGTAGTCTGTGTCTGCGTGGCATGGATAGTCTCAACTTTTACACAGAATT
GTCTACATCCCAAAAGACGGTCTCATGGTCTTCTTTTGATTTTAGTAACATTAACACTGCGGCTGAATGG
TGTTTGGCGTATTTGCTTTACACTAAGATGTTTGTGGTTTTGTTGGCGACTGCAATCTTCCAATGGTTTG
CTGTCTATTTTGGCCTCTACCTCACACAATCTAGTTGGTTGATGTGGACTATGGTTAGAGTCATCAGTCT
TGTTCCTACGAGCATTCTTGTTCGTATGTATATTTATTGTGCATCCTTTTACTTTGTCTACAGAGCTTAT
GTTCACGTCGTTAGTGGCTGTCAAGATACACGTTGTCTGATGTGCTACAAGCGTAACTTAGCTCGCAGAG
TGGAATGTCATACAGTTGTCCAGGGTTCTCGCAAATCATTTTATGTGCACGCTAATGGCGGTACTGGATT
TTGTGAAAAACATGCCTGGAATTGTATCAACTGTGATTCTTATGGACCTGGTAACACTTTCATCTGTGAC
GAAGTTGCTGTTGATTTGTCTACCACTTTTAAGCGACCTGTTAAGCCTACCGACAAGTCTCATTATTTTG
TGGATTCTGTAGAGGTTAAAGACACCTTTGTACACCTTTACTACTCAAAAAATGACACACGTGTTTACGA
CAGATATCCATTGTCTGTGTTCTCTAGTGTGGATTTCCTTAAACTTGCTAACATCAAAACTATGCCATCT
ACCAATGTGCTTGTTTTTGATGCTAGTAATAAAACTGAAGAAAACACTACTGTCGCAGCTAGTGTATACT
ACTCTCAACTATGTTGCCAACCTATGCTGTTGATCGAACAGAAACTATTGTCCAACATAGGTGATGCTAC
AGAAGTGTCGAAGAAGATGCTTGATGCTTATATTGAAAAATTCATGAGCACGTTCGGTGTCACCATGGAA
AAACTTAAAACATTTGTCAGCGCAGCTAAAAATAGTCTGAATGACGGTGTGCCTCTTGAAAAAGTACTTA
AAGAGTTTGTTGCAGCAGCTAAACAAAATTGTGCTGAGACTGATGTCGAAGCTGACTCTATTGTTAATGC
ACTGCAACTCACTTTTAAGGATGATGTTGACATCACAAAAGATTCTTACAATGACTTTGTACTTACTTAT
AACAAAGTTGATTCTATGACTCCATACGACTTAGGTGTGTGTATTGAGGTTGGTGCTAGACATGTCAATG
CAAATGTAGCAAAAGCAAATGCGGCTGCACTCATTTGGAACATTGACCACTACTTACTGCTTTCCGAGTC
TTTTAGACGCCAGATTCGTTCTTCGGCGCGTAAAAATGGTTTGCAGTTTAAACTGACGTGTAGCAAGAAT
AGACAAGTTACACCTTTTCTTACTACAAAAATTATGTTTAGCGGTGGTGCAACGTATACAACATGGCTAA
AAAGGTTATTAAAGGTTGCAATGGTTATGCTGCTTGTTTGCTGCATACTCTATTGTTTGCTTCCATCATT
TAAGTCTCAACCACTGAATATGTATAGTGACGAGATTATCGACTTCAAAGTTATTGAAGATGGGTCTTTG
CGTGACATAACTGCAGATGACACTTGTTTTTCAAACAAGCATAGTAGTTTTGTGTCATGGCTGTCTCGTA
ATGGTTTCAAAATGACAACCACTTCAAGACATTGTCCCATTACTGTAGCTGTAGTGGCTAAGAAAGTTGG
TGATGTTATACCGAGCCTACCAGGCGTGGTTACACGTGTTCTAGTTCGTGGCCAAATTATGCACTTCCTA
GCACGTGTCTTTAGTGCAGCAGCTAACATCTGTTACACACCTGGTACCTTGATTGAATACGAAGACTTTC
TCACAAGCGCATGTGTGCTCCCTGCAGAATGTACTATCTTTAAGGATTCTAATGGCATTGCAGTGCCTTA
CTGTTACGATGTTAATGCACTGCAAGGATCACTACCATATTCTAGCTTGAAGCATGATGTGCTTTACCAG
CTGGTGGATAATTCTTTCATCAAGTTCCCTAAAGTTCTCGTTGAAGGTGCGTTTCGTATTGTGCGTACAA
TGACAACACAATATTGTAGACATGGAGTTTGCGAAGACTCTATGGCTGGACTATGCCTGTCTCTTCGTGG
CTCATGGGTTTTGAACAACCCATATTACACATCGCAAAGCGGAGTCTATTGCGGTAATGATGTTGTGGAT
CTTCTGATGAACATCCTAGCGCCTATGTTTAGACCGGCTGGTGGTATGGATATAACCTCATCCATAGTAG
CAGGTGGTATACTATCTCTTGTTATTACAGTCGTGGCCTACTACATACTCAAGTTGCGTAGAGCTTTTGG
AGATTACCAACAGGTGGTTGTAGTCAATACACTAGCTTTTCTGTGTTCCTTCCTCGTGCTCTGCGTATCC
ACACAGTATCCTGTATTGCCAACTGTTTATTCTATCTTGTACTTCTACATGTCTCTTTACATGGCTAATG
AAGTTTCTTTCATTATGCACTGCTCGTGGTGTGTGATGTTTGTACCAATAGTACCCTTTTGGTGTACAGC
TGTGTATATAACAATGACATGCTCTAAGCATGTGTACTGGTTTTTCCAGACATTTTGCAAGAAAAATGTT
GTTGTACATGATGCTACATTTAGCAGTTTTGCTGAGGCCGCATTATCCACATTCATGATCACAAGAGATG
TGTATGTGAAATTACGTGCTGAAGCTTTTCTCTCTGCTGCACAATACAATAGGTATTTGTCCATGTTCAA
CAGATATAAGTACTTCAGTGGTTCTATGGATACTGAATCTTATAGAGAAGCTGCTTGTTGTCATCTCGCT
AAGGCCATGAAAGACTTCAGTGAGCAAGGGTCTGATATTCTTTATCAACCACCCAGTTGTTCACTGGCAT
CTGCTGTTTTACAGTCCGGTATTAGAAAGATGTCTTGTCCTACAGGCAAAGTAGAACGTTGCATGGTGCG
CGTAACTTGTGGTACTATGACACTTAATGGCTTGTGGCTGGACAATACTGTCTACTGCCCTCGCCATGTC
ATGTGTACACCAGAAGAACTACTTGCCCCTGATTATGACAGTATCCTTTTGCGTAAGGCTACTCATAGTT
TTACTGTTCAATATGGAACAGCATATCTTAAAGTAGTGTCCTACAAAATGACAGGATCAGTACTTCAGTT
GGGTGTTGACCAAATTAACCCTGAAACCCCAAAATATAAGTTTGTAAGGGCTAAGCCTGGCGCTACATTC
TCCGTTTTGGCTTGTTACAATGGTATGCCTGCTGGTGTATATCAAGTTGCAATGAGGCCAAACCATACTA
TCAAAGGTAGCTTTTTGAACGGCTCATGTGGTAGTGTTGGTTATACTCTAGGTTATGATAGAGTAGAATT
TTGCTATATGCATCACATGGAACTACCTACAGGTGTACACACTGGTACAGACCTGGAAGGTACTTTCTAT
GGTGATTTTGTTGACCGGCAAACGTCGCAGTCAGCTGGTTCAGATAATACACTTACGCTCAATGTGTTGG
CTTGGCTCTATGCAGCTGTCATCAACGGAGAACGTTGGTTTATTGTTCCACAAACTTGTGCTTTAACAGA
CTTCAATACAGCCGTCTTGAAGTACGGGTATCAAAGTCTTACTGAAGACGGTGTTGCAGCATTAGACCCA
CTGGTGGCCCAGACAGGAATCTCAGTTCAGACTATGTGTGCATCACTTAAAGATTTGCTTGTTCATGGTA
TGAGAGGCAGATGTATACTGAGCTCGCCCACACTCGAGGATGAGTTCACACCCTTTGACATTGTACGCCA
ATGTTCTGGTGTTACTTTGCAAAGTACTGTTAGAAGTGTTTCTTCTAAATTCTTTCAGTGGATGCTAATG
ACAGCACTTACTTTTACTATACTATTTTTACAACTGTGGGAAATGTCCATTTTTAGTTGGTTTGCTATGC
ATGCTACTATTCCAGTTGTAATCCTACTTATGGGTGTGTCTGCTTTTGTGACTATGTTAGTCAAACACAA
GCATGCCTTTACAACACTGTTCCTGATGCCAACATTGGCTGTTGTCTTTTATTATAATTGTATTTATGTA
CCTGAGCATTGGCTCATTGAAATGGTCAGCAAGTATGTTGACTTGACTGATACAATTCAGCTGTTCTACG
GCTATTCTATAAGAGAACTTATCGCTCTTTTTGCTGTGGTCATAGCTATGAGTGTCCTGTCTCTGCGTAT
TGTCTATGACGACAATACTAGACGAGTATGGCTTGCTACTAATGTGCTCACATGGTTGTACAGGTTGTAC
GCTGGCACAACAGTAGAGAAGGCTATGGCTTACTGGGCACTCCTTATGAGTCTCACCACAAATTATAGTG
GTTGTGTTACAGTTATAATGTTTGCTGCTAAAGGTGTCACAACATTAATTTACTACCAATTTCCTTTTCT
AGGATTGCTTATTGCAGAATTCAAATTCCTTATGTTAGTGTATACTTGCATTGGATATTTGTGCTGCGTT
TATTATGGCATCTTTTGTATGTTGAACAAATACTTACGTTGCACTTTTGGTGTGTATCCATACCTGGTCT
CCACACAGGAGTTCAGATATATGAATTCACAAGGCTTAACTCCCCCTACCAACAGCTGGGATGCTCTGAA
AATGAACATCAAATTGTCAGGTGTTGGTGGTGTGCCATGCATTAAGGTTTCTAATGTGCAATCTAAGATG
TCTGACATCAAATGCACGTCTGTGGTGTTGTTATCAGTTTTGCAACAACTCCGGATTGAAGCCAATTCAA
GAATCTGGTCACTGTGTGTCACACTTCACAATGACATTTTGCTGGCTAAAGATGCTACAGAGGCTTTTGA
AAAGCTTACAACGTTGTTGTCTGTATTGCTATCTATGCCAGGTGCTGTTGACCTTACTAAGTTGTGTGAT
GATGTCTTTGAGAACCCAGCAATTTTGCAGGCGGTTTCAAATGAATTTAATAATCTGCCCACGTTTGTTG
AATACGAGTGTGCACAGAAAGCTTATGATGAGGCTTTAGCAAATGGTGAAGGACCTATTGTCCTGAAGCA
GTTGAAAAAGGCAGTTAATTGTGCCAAATCTGCATTTGAAAGAGATGCAGCTGTGGCAAGAAAGTTAGAG
CGTATGGCAGACCTTGCCATGACACAAATGTACAAAGAAGCGCGTGCTGAAGATAAACGTGCTCGCGTCA
CATCTGCTATGCAATCTATGTTATTCAGCATGCTTCGTCGTCTTGACAATGATGCTTTGAATAATATAAT
CACTAATGCTAGAGATGGCTGTGTACCATTGAATGTGATACCCATGTTAGCCTCTAGCAAACTGCTTATT
GTCGTACCTGACATTAGTGTTTATAACAACACAGTGGAAGGAACACTCTTAACTTATGCTGGCGCCGTGT
GGGACGTAGTCCAAGTTACCGACGCTGACAACAAACCTATTGCCATGGGTGATATCACGATAGATACAGC
ACCTACATTGGCTTGGCCTTTAGTACTTTCAGCTGTAAGACGTGTTTCAGCAACAAAGTTACAAAATAAT
GAGTTGGCACCTCAGCTTTTGAATCAAAAAGCTGTTACTGGAGGTTCTGAACAAAACATATGCGACCAAC
CAGCGTTAGCATATTATAACACAGTCCAAGGCAAACATGTCATTTTGGCAGTTGTCAGTGATCATGACGG
ATTACGTTGGACTCGTGTTGATAAATCTGATGGTAATGGTATTGTTATGATTGAACTTGACCCTCCATGC
AGATTTATAACGCAAACATCAAGTGGTCCCAAAGTGAAGTACTTGTACTTCATCAAAGGACTAAACAACT
TATGTCGTGGCATGGTACTAGGTACTGTAGCTGCGACTGTTAGATTGCAAGCTGGCAAACCAACTGAAGT
GGCTGCCAACTCTAAATGCTTGACATTTTGTGCCTTTGCTGTAGATCCTGAAAAGGCATACTTTGACTTC
GTGAACAGCGGAGGCCAACCGCTTAATAATTGTGTGCGTGTTTTATGCACTCACACTGGTACAGGTCGTG
CTATAACTGCAGATCCAGAGGCTACAGCAGATCAAGAATCATATGGTGGTTCTTCTTGTTGCCTCTACTG
TAGATGTCACATTTCCCACCCAAGTCATAACGGGTTGTGTAAGTATAAAGGCAAATATGTGCAAATACCA
AATGTATGCACTAATGATCCAGTAGGGTTTTTGCTTAAAAACACTGTTTGCAATGTATGCGCTTGTTGGA
TAGGGTATGGTTGCAATTGTGACACACTCCGCCAGCCAGTGCTTCATGCTGCAGATGACAGTTTTTTAAA
CGGGTGCGCGGTGTAAGTGCAGCCCGTCTTACACCGTGTGGCAGTGGTCTTTCCACTGACGTCGTCGTAA
GGGCTTTCGACCTGTACAATAGTAAAATAGGAGGCTTTGGTCTTCGTTATAAGGGCAATTGCTGCCGATT
TCAAGAAATCGACGAAGACGGCAAAGCCTTAGACTCTTTTTTCATTGTCAAGAGACATACTGAAGACAAC
TTTAAGCTAGAACAGGAAATGTATGATTTGCTGAAGGACAGTGGTGTTGTGGCAGTCCACGACTTCTTTC
ACTTTAGAGTGGAGGGACGAATGGAGCCTCACATCACGCGTCAGCGACTTACAAAGTACACTATGGCTGA
TCTTGTTTACGCTTTTAGACACTTCGATGAAAATAGTTGTGAAGTGCTAAAAGAAATTCTTGTTACATAT
AATTGTTGTGGCTCGGATTATTTCGAGAAGAAAGATTGGTATGACTATGTAGAGAATCCTGATATACTTA
ATGTGTATGCCCGTCTTGGTGAGCGCATTAGGTGTAATTTACTTAAGACTGTAAAGTTCTGTGATGCCAT
GAAAAGACATGGTATTGTGGGAGTTTTGACGCTAGACAACCAAGACCTTAATGGTAATTGGTGTGATTTT
GGTGACTTTGTACGCGGCTTTCCTGGGAATGGAGTACCTGTCGTGGACTCATACTACTCATTGCTTATGC
CTTTAATGACAATGACTAAAATGCTTGAGGCAGAGACACATGTAGATTGTGACCTGACTAAGGATCATGT
GAAGTGGGACTTGCTCCAGTATGATTATACAGAGCATAGACTCAACTTGCACCAAAAGTACTTTAAGTAC
TGGGATATGCCATACCATCCCAATTGTCAGAGTTGTCCTGATGACCGTTGTATTTTGCATTGTGCAAATT
TCAATGTGTTATACAGTACAACTATACCACAAACATCATTTGGACCAATCGTCAAACGCATTTATGTGGA
TGGCGTTCCATTTGTTGTCTCTGCTGGTTACCATTATAAAGAGCTTGGCGTTGTCATGAATCAAGATATT
CATGTACACAACGCTAGGCTATCTCTTAGAGAATTGCTAGTCTATGCAGCTGACCCTGCCATGCATGCCG
CATCTGGTACTCTGTTGCTAGACAAAAGAACCACATGTTTTAGTGTGGCATCTCTTACCAACACAGTTAG
CTTCCAAACAGTGAAGCCAGGCAATTTTAATAAGGACTTCTACGACTTTGCTGTGTCTAAAGGTTTCTTT
AAGGAAGGTAGTTCCGTGGACCTTAAACACTTCTTCTTTGCACAGGATGGTAATGCTGCTATAACTGATT
ACAGTTATTACAGGTACAACCTTCCTACTATGTGCGATATAAAACAGCTTCTGTTCACTATGGAAGTGGT
AGATAAATATTTCGACTGCTATGATGGTGGTTGCTTAAACGCCAATCAAGTTGTTGTAAATTCATTAGAT
AAGTCAGCCGGTTTCCCATTTAACAAATGGGGTAAGGCTAGACTTTACTATGAATCTCTGAGTTATGAAG
ATCAGGATGCACTCTTTGCGTATACAAAGAGGAATGTGCTTCCAACAATAACTCAAATGAATTTGAAATA
TGCTATTAGCGCTAAGAATAGAGCCCGCACTGTAGCTGGGGTGTCTATATGTAGCACTATGACTAATCGT
CAATTCCATCAGAAGATGCTTAAGTCTATAGCTGCTACACGTAATGTGTCCGTTGTCATTGGAACTACAA
AGTTCTATGGTGGATGGAATAACATGCTCAAAACACTTTATGCAGATGTGGATAATGCACAACTAATGGG
TTGGGATTATCCTAAGTGTGACAGAGCTATGCCTAATATGTTGCGTATTTTCGCTTCATTGATTTTAGCC
AGAAAGCACAACACGTGTTGTAATGTAAGTGAAAGATACTACAGACTGGCTAATGAGTGCGCTCAAGTAT
TGAGTGAGATGGTTCTATGTGGTGGTGCTTTGTATGTGAAACCAGGTGGTACTTCCTCCGGTGACGCAAC
CACTGCATATGCAAATTCTGTTTTCAATATCTGTCAAGCAGTAACGGCCAACATTAGTGCCTTGCTAGCA
GCTAATGGAAACAAGATAGTCGATGTTTACATTCGAGACTTACAGCGTAAACTGTATGCGAATGTTTATC
GTAGTGTCCATGTTGATTATAAGTTCGTAGATGAGTACTACGCCTTTTTGCGTAAACACTTTTCTATGAT
GATACTGTCTGACGATGGTGTCGTATGTTACAATAGTGACTACGTAGCTAGAGGCTATATTGCTGGAATA
AAAGACTTCAAGCAAGTTCTTTATTACCAGAATAATGTTTTTATGTCGGAAGCCAAGTGTTGGGTGGAAC
CAGACCTGACTAAAGGCCCACATGAATTTTGTTCACAACACACTATGCTAGTTGAGCATAATGGTGAACA
AGTGTATCTACCTTACCCCGACCCCTCAAGAATTTTAGGGGCTTGTTGTTTTGTAGATGATGTTGTCAAA
ACTGACGGGACTATCATGATTGAGCGTTTCGTCGCCTTGGCTATTGATGCTTATCCTCTTACCAAACATG
AGAACCCTGAGTATAAGCAGGTCTTTTACTTGTTGTTACAATACATCAAGAAACTTCATGAAGAGTTAAC
GGGCCATTTGTTGGACATGTACTCTGTTATGATTTCGGGTGACAATGCTCAGAGATACTGGGAAGAAGAT
TTCTATGAAGCAATGTACACTCAATCAGTCACTTTACAGGCTGTCGGCGCGTGTGTGTTGTGTAATTCAC
AAACATCTTTGCGTTGCGGTGACTGTATTAGACGTCCATTTTTGTGTTGCAAATGTTGTTATGATCACGT
CCTTTCAACGCCACACAAACTGGTCTTGTCTGTATCACCTTACGTCTGTAATGCACCGGGTTGCGAAGTT
ACAGATGTTACACAACTCTACCTCGGAGGTATGAGTTATTTTTGCAAGTCCCATAAACCACCTATTAGTT
TCCCATTGTGTGCTAATGGTCAGGTGTTCGGACTTTATAAAAATACATGTGTCGGTAGCATTAATGTCGC
AGACTTTAACGCTATTGCCACATGTGATTGGAGTAGTAGTGGTGATTATGTTTTAGCTAACACCACAACT
GAGCGTCTGAAACTGTTTGCTGCAGAGACGCTTAAAGCTGTCGAAGAGACTGCTAAACAATCATATGGTG
TTGCTGTTGTACGAGAAGTCGTCAGCGACAAAGAAGTTATTTTACGGTGGGAAGCTGACAAACCGCGTCC
GCCTCTAAACCGAAATTACGTGTTTACTGGTTATAGGATAACTAAAAACAGTAAAACACAAATTGGCGAA
TACACCTTTGAGAAGTCAGATTATGGCGACTCAGTGTTGTATAAAGCCTCTACTACTTATAAGTTACAGG
TGGGAGACTACTTTGTGTTGACCTCTCACTCTGTCCTGCCTCTTTCTGCACCTACATTGTTGCCGCAAGA
GACATATACACGAATTGTAGGGCTCTATCCTACGTTCAACATTCCTGACGATTATGCTGGTAATGTTGTA
AATTACCAGAAAATCGGAATGGCTAAGTACACCACGGTTCAAGGTCCACCTGGCACAGGTAAAAGTCACC
TCGCCATTGGTGTAGCAGTTTATTATCCTACAGCACGCATAGTCTACACTGCTTGTAGTCATGCTGCTGT
TGATGCCTTATGTGAAAAGGCATTCAGAACATTGCCTATTTCTAAATGCTCACGCATAGTGCCCGCAAAG
GCCCGCGTAGAGTGTTTTGATAAATTCAAAGTCAATGATGGTACAGCACAATATGTGTTTAGCACCATCA
ATGCCTTACCAGAAACCTCAACTGATGTACTCGTTGTGGATGAAGTCAGCATGTGTACTAATTATGATCT
TAGCATAATTAATGCGCGTGTTCGAGCAAAGCATATTGTGTATGTGGGAGATCCAGCTCAATTGCCAGCG
CCACGTACATTACTTACAAGAGGCTCACTAGAACCAGAAAATTTCAATTCTGTGTGCCGTCTTATGAAAA
CATTAGGTCCTGACATATTCTTAGGAGTATGTCGTCGTTGTCCTAAGGAAATTGTAGACACTGTTTCAGA
GCTAGTTTATGAAAACAAGCTTAAGGCACATAAGCCAGAATCTGGACAGTGTTTCAAAATGTTTTACAAG
GGTACTGTTACCCATGATGTATCAAGCGCCATTAATAGACCACAAGTCGGCGTCGTGAGAGAGTTTCTAA
GCCGCAATCCCCAGTGGAAGAAGGCTGTGTTTATTTCACCATATAATAGCCAAAATGCAGTGGCTAGTAA
GATTCTGGGTTTACAGACCCAAACTGTGGACTCATCACAAGGTTCAGAGTATGATTATGTGATTTTCGCC
CAGACTACAGATACTGCACACTCTTGCAATGTTAATAGGTTTAATGTTGCTATCACAAGAGCTAAGAAGG
GTATACTCTGCATCATGTCGGATCCTGACATGTTCGAACGGTTAAAGTTCGTAGAGCTGGCTGTCCCTTC
TCGTAGTCAGATAAGGCTTCAGGCAACTGAAATTACTGGCTTGTTTAAGGATTGCAGCAAACTCATTACG
GGTTTGAGTCCTGCAATGGCACCAACATATATGGCCGTAGATGATAAATTCAAGACTAATGGTGGTCTTT
GCGTGCATCTACCCGGCATAGAAAAAGAAGTTAGCTATAGACGCTTGATTTCCATGATGGGGTTCAAGCT
TGACTATAGCGTTCAAGACTACCCGCGCTTGTTTATCACCCGGGATGAGGCGATTAAACAAGTTAGAGCG
TGGGTAGGTTTCGATGTTGAAGGTGCTCATGCTACAAAAGATGCAGTTGGTACTAATGTACCACTTCAGT
TAGGTTTCTCAACCGGCATCAATTTTGTAGCAACACCTACCGGTTTTGTTGATACTGAGACTGGCACAGA
ATGTTGCCGTATCTTCGCGAAACCGCCACCAGGAGAGCAATTCAAGCATTTAATACCACTAATGCACCGT
GGGATGCCATGGAATATAGTGCGTGCTAGAATTGTACAGATGATGAGTGACACTCTTAAAGGTGTTACTG
ATAGAGTAGTACTGGTAACTTGGGCTCACGGCTTTGAGCTTACAAGTATGCAGTACTTCTGTAAATTAGG
TCGCGAGCGCACATGTTGTATGTGTGCTGAGCGTGCAACTTGTTACTCCTCAGTGCATGACAATTTTGGA
TGTTGGCATCACTGTACAGGTTTTGATTATTTGTACAACCCCTTTATTGTAGATGTACAGCAATGGGGTT
ATTCAGGAAATTTGCAGAGCAATCATGACAATCATTGTTCTGTCCATTCAGGAGCACATGTGGCTAGTAG
CGATGCTATTATGACCAGATGTCTCGCCATTTATGATTGCTTCGTAAAAGAAGTACACTGGGACATTGAG
TATCCTTTCATTGCCGATGAAGAATTCATCAACAAGTCATGTAGAAAAGTCCAAAATATGGTCGCAAGAG
CTGCATTGCTAGGTGACAAATTTGGTACCATACATGATATCGGCAATCCAAAAGCACTCAAGTGTGTCCT
TGATGCAGAGGTGAATTGGAAATTTTATGATGCTAAACCCGTTGCTGGAAGAGCACATAAGGTTGAAACT
CTCTACTACCAGTATGAGGTCCATAAAGACCAGTTTCAGGATGGTGTTTGCATGTTCTGGAACTGTAATG
TGGACCATTATCCTAAAAACTCCATCGTTTGTCGCTTTGACACTAGGAGTCTTTCAAAATTAAATTTACC
AGGTTGTGATGGAGGTAGTTTATACGTAAATAAACATGCTTTCCACACGCCTGCATTTCAAAAGTCTGCA
TTTACTGATCTTCAGCAATTGCCATTCTTTTTCTACTCGGATACTGAGTGTGATAGTACAGGACAACAAG
TTGTTGCTGATATTAATTATGTTCCACTTAAATCCAATGTGTGCATTACTAGGTGCAACCTCGGTGGTGC
GGTGTGTAAGAAACATGCCAATGAATACCGAGAGTACTTGACTTGTTATAATGCTGTCATTGAAGCAGGT
TTTAGTCTTTGGATATACAAGTGGTTCAACATTTACAACTTGTGGAGTACTTTCACAAAGTTGCAAGGTT
TGGAAAATGTAGCATACAATGTTGTCAATAAAGGTCATTTTGATGGCACACAGGGTGAAATCCCTACTGC
CGTGATTGGCGACAAAGTATTTGTAAAACGTGAAGGCGTGGATGTTTGTGTGTTTACTAACAACACCACA
TTGCCTACTAACGTTGCATTTGAGCTTTACGCGAAGCGTAATGTAAATCCAGTTCCTGAAGTGAAATTAC
TCCGTAACATAGGTGTTGACATATGTAACGGATTCACACTTTGGGACTATGAGCAACAAGCTCCAGTGTT
TAACAGCACTATAGGAGTCTGTAAATATACAGACATCGCTGCTAAGTTCTCAGAAAAGAATTGTAAACCA
CTTACAATACTATTCGATGCGAGGCTTAGTGGTCATATTGATCAATTCTGCAATGCAGATAATGCTGTCT
TGTACAGCGATTACCCTATTAAGCGTTTACAAGGTTCTAAGGGACCTGAGCACTGTTCTATTAATGGTGT
CATTGTAAACTCTACACCAGATGGCGGGGAAAAACCTGCCATAAATTGTACATTCTACTTTTACAAGCGT
GAAAATGGTCAGCTTGTGAATGTAGGAAATAGTTATTTTACACAAAGCCGTGTTAAGAGCTCTTTTGAAC
CCCGTACCACTATGGAGCGTGACTTCTTAGAGCTCGACATGCATGGATTTATTCAACGCTACAATCTTGA
AAAATATGCTTTTGAGCACATTGTTTATGGTGACTTTAGTCACAAACAGATCGGTGGTTTACATCTTCTT
ATCGGCTTGATAAAACGCTGCAATGAGAGTACCATTGATATTGAAGAGTTCCTCACTATGGACTCTACTA
TTCACAATTACTTTGTAACAGACCAAAATACCGGTTCAAGCAAAGCTGTATGTTCTGTAATTGACTTGCT
CCTTGACGATTTCGTTGAAATAATCAAGAGCCAAGACTTAACTGTAGTCTCTAAAGTAGTCAAAGTTTTC
ATTGACTTCAGAGATTTCGATTTCATGCTGTGGTGCAAAGATGGAGTTGTGCAAACATTCTATCCTAGAT
TGCAGTCTTCATCAGAATGGCAGCCTGGCCAATCTATGCCTAGGCTCTACAAAATCCAAACCATGTGTAT
GGAAAAGTGTGAGCTTCTTAACTATGGTCAACCTCCTAAATTGCCTAATGGCATACTTATGAATGTTGCC
AAGTACACTCAATTGTGCCAGTACTTGAACAAAACCACCATAGCAGTTCCAGCTAAAATGCGTGTCATCC
ATTTTGGTGCAGGAAGTGAAAAAGGTATTGCGCCTGGTTCCACTGTGCTTAAGCAATGGTTACCTAAAGA
CGCTATTCTAGTTGACAATGATTTGAATGACTTCGCATCAGATGCAGATGTCACCATCATTGGCAACTGT
GTTACATTCCACACAGAGACTAAGTGGGATCTTTTGGTAAGTGACATGTATGATTGTGACTTTAAAAGTA
CAACTATGGGCGAAAACTATTCAAAGGATAGTTTCTTCCCATATTTGTGTGGTTTCATAAAAAACAAGTT
ATCTATAGGCGGTTCGGTTGCCATTAAGATAACAGAACACTCTTGGAGTGCAGATCTTTATAACCTTATG
GGACATTTTGCATGGTGGACAGCTTTCTGCACCAATGTAAATGCCTCATCATCGGAAGCATACCTAATCG
GCGTAAACTACGTCGGTAAAGAGGTTGAAAAGATTGATGGCAACATAATGCATGCCAATTATATTTTCTG
GAGGAATTACTCTCCATTTAATGTATCCAATTATTCTCTCTTTGACATGAGCAAGTTTGCACTAAAAGCC
AAAGGGACTCCTGTAATGTCTCTAAAAAAAGAGCAGATAAATGAAATGGTTTTGGGTCTCGTTGAAAAAG
GAAGACTCCTTATACGCGACACAAATTCATTTGTTCTCACCAATGATATGATGGTGAATTGTTAATCTAA
ACGAACCATGTTTGTGTTAGTTTTGTTATTTTCTATTGCAAGTGCTAAACTTGTAAAACCTAATGGTCAG
CATCCTACAACAGATGATACGGCTGCCTATTCTAATTGTCTAAGGTTATCACCACAATGGCACATTGGTT
TGTCCAATTTGACTGTTAACCATGACACATTTCTTATTCCGCAACCAACTTTCAATGCCACAACTCTTAG
TGCGGGATACTATCCTAAAATAGGAGATACAGTTGTTACATGGGAAGCCATTGTTACAGGTGACTCAGCC
GAAAATCAAAAGTTTAAGGTGGATTATGATAATTACATACCCCATGAATTTGGCCAAGGTATTGTCTTAA
AAGTCTTTAATAGAGACAAGGCTAGTGCTTCAACACCACCCGCATTTCTCTTTGGTTCGACTTTTGACAA
TACCACACACACTATGTTGATAGCAGTCAACACAACACACCGAACAGTCGCAGTTTGCCGATTTGAGTTC
TGTAGTACTCCTGTTGTTGCATCAATGATTAATAATGGTAATTTCCAACAATATAACCACTCTTCACTAT
TTACTAGTGCAGAGGATTGCATTTATGTGAATTACCAGAACTTTACAATGAATAACACCATGGGTGACCT
GTCTCGAACAGGAACTGTATATTACAGTTTTCAATACCTTAATGGTTATTTTTCTATTTATTACGCCTAT
AGGGCTTTGCACAATTTGACAGAACCTAAGTTTCTGTCACCATTTATGCATTTCCCTCTAAGCATTGCAG
TTACTAATTTTCTTGTTCCTCCAGTCTGGAACCGTAACTATCAAAATCAGAATGCCCAAACTCAAGCACG
TGGACAATTTGTCATTGAGTACGCTATGCTCCGACTGCAATCCATGTACTTTGATTATCAAAATGGCACT
CTCATTAATTACACTAGTTGTGACGACCTTTCATGCCTCACACAAACACCGTGCTCAACGCAAGCGCCGT
GTCCAACTACATCATGTCCGACACAAAAGTCAACTACTAGTGTTACAACAACTACTCCTACTACTATTAG
TACTACTATAAAGCCAACAACTATTAGTAGTACAACTTCAACTACAACTCAAACAACTAGCAGAACCACA
ACCGCAGAAACAACAACTACAACTGTTGCTTCTACAGTTTCACAAGGTACTACAAATGAAACTTATAGTA
CCTTACCTCCTTGTAACAACTATACGACCATAACGCAATCACCTTGTAATGATGTTGCGTATTTTTGGAC
TATGGTTTTTACAATTATAATATCCATTTCCTTCATATTGGGTGTGCTTCTCTGCAGCTCAATTGACTCA
TATGAAGAGGAAGTTAAACTTCATCAAATCTAAACGAACTTTATGAACTATTTCAACAAAATTGTCTCGC
ATAGCAGACAATTTAATTTTCAAAGACCACGCATAATCGTAGCCCGCAAAGAAGGGCTTTACGAGTGTGT
GATATTTTATCGGACTTACGCCGTTAAAGGTTACGGAACAACATGGTCGCACGCTATAGACTCTGCATCT
TGCAACTTATTCTATCAGCATGTCACCTATCCATAACCCGGGATGTACAGCCTTACGTTCATGAAGCCAA
TTGTACTAAACAGGTGGCAACAGAAGGCCCTTTTATGGCCGCTTACCCGTTAGGCAAATACGGTTTTATT
AACACTTACTATCCTGACAGGATATTTAGGTCAAACACTACTGCATTATTCACAGATTTGTTTCCAGTAA
TAGGAACTACTGTTACACCGTGGAAGGCTTTTAATGCTCTCACAACAAATGAGAGAAAAGACAAGCGCAA
CTTTGAGCGACACCCTTTCGGAGAAGGCGTTTTTGTCACAATAAAACACACTCAAGTCTCTGGGCCTTCT
ACACCCCCTATGTATTTGTTTGGCACTTATTTTAATTCATCTTCTTACACCTTAGCCATTAGCTTAGATG
GTCTTTATAGGCGTATAGAAGTGTGTAATTTTCAGGTGTGTCAAAACCCTGTTATGTATTATGCAAAGGT
TTCTAACCCAGCACAGGGCAACCCTTTGATTTATTCGCAACGTGCGTATACTGATTACAACTCATGTGTA
AGTCAAACTTCACAAAGTTTTAATATCACTTCACAAGGTGACAAAAATGGTGCCTTCTCTAAAGACACTA
TTACTACCTATGTTTTTAAATATCAAAATGGCATATTTTCTGTTTTCCATGGTTTCCACAATGGAACAGA
CCATGTGCCTTATCCAAAACCAGCTTTTGAGTTTCCTCTAGATATTCCCATAACACACTTTATCATTCCA
CCCACAGTGGAAGAACCTGCGCAAGGTCAGGGTTACACTAGGGGAAACTATGTTGTTTATTATGCCCAAC
TTAAGAAAAGCACATTCATGTTCGGTTTTGACTCCAATGGACTCATAACTAGATACATTGACTGTGCTGC
TGGACCTAAAGATGAACTAATGTGTTCACAAGGTAGTTTTAACATCACACCTGGTGTTTACACTACTACA
AATTACAGAGCCACACCTAAACAGCATGTTGTAATAACATCTGCTGATGTGAGCGCTGAATGTCCTTTTC
AATCACTTATTAATGTGACTGAAGCAACCATTCCCTCACCTGCTTTCTGGAGAAGGCATTATGTGAGAAA
TTGTAACTATGACATCTCTGTTTTCACTGACAATGCTGACGTCTATAGTTTACAATGCTATGGTGTAGCG
CCCTCAAGTCTTGCAGATATGTGTTGGGAAGAAGCTCACATAGATTACATGAAAATATCTGAGAAGGACA
TCTTCTCGTTTAAACCAAGTGGAGCTGGTGATTTTGCTAAGTATAACTATAAATTACCCTCTGATTTTAT
GGGTTGCACTGTTGTTTTCACAAATCAAGAATTAACGTGCAACGCAACTAGTGGGCAACTCTGTCATGTC
TACACTAACAATTTGACAAATTATCCCGCAGAGGCTACTGCATGGGATAAGAGTCATTATGAATCTATCG
AACGCTACCAAATGTGGAGTTCAGAAAACGTCTACAACTGTGAACTCCAAGAAGTTGGACCACAGCAATT
CAACCGTATGCCTAGGAATTGTTATGTTCGTAGTAACAACTCCAATGACTATTGGCAACCTATGAGTTTT
AGAGGCGTGAATAGTTTAATGGTTGCAATGGCCATAACTCTCAAACCCACTAGAACATCTGCTACTGTGT
GTGGTTATAAACAAAAGACCACACCGCTAGTTTTAAATGAATGTATTACTTATCACATTTATGGTTATAA
GGGAACTGGTGTAATTGTCAGTGCTAATTACACCTTCCAAAGTTTTCAAACTGTGCAATTAACCTCAACC
GGCTCTCTGCACTCTTTTAAATATAACAATACTATTTATGGTATTTTGCCATGTGCGCAGGCACAAGTTA
GTATTGTAACAGCGGGCTCAAACCATGACAATGTTGCTGTCGTTTACAATGGTCTAGGCTGTAATGCATT
TCAAAGTAAAATGCAAGGTGTGGATAATACTGAATGGTCTGTCTACACTAATTTCTCATCACCAATTGAC
ACACCTGTAGGTTGTCTAACTGGTGCTATTCAAGCTCAGGAAAATTCTACTGAGTGTCAATTTGCTCTCG
GCCTTGATTCTTGTGTCAACTATACAGCTGACACAAGATTGAGAACAGCTCGTGCTGCCGATAGAGCCCT
AACATTTAATTACATGTATTTTGCACAAGAACTCCCGTCTCAGTCTGAACAGTCTGTGGCATTTGATAAC
TCAACACTACAGATACCTATTAACTTTACTATTGGCATTGAGTATGAAACCATACCCGTGACCATGCCTA
AAGTTACTGTTGACTGTGCACAATATGTTTGTGGAGACAATTCAGAATGCAGAACCTTACTAGTACAGTA
TGGCACATTTTGTGAAACTATTAATGATGCTTTGCGCGGTGTTGCACTGCAGCAAGACGTGAACCAAAAA
GATGTCTTTTCGTCGGTTCGTAGGCTTGCTAAAGTATCAAGTCCAATGAATTTGGGCAACCTTAATGGTT
TCAACTTTTCTAGCATCCTAAATCAGGAAGCTATTAATGGCAACAACTTTCAGGCACGTTCTGCTATCGA
AGACTTGTTCTTTGATAAAATTGAGACTGCCGATGTTGGTTTCCAAAAGAAGTACGATGAGTGCACTGGA
GGTTCTGTTGTCAAGGACCTTGGTTGTGCTCAAAGTTTTAACGGTTTAATGGTGTTACCACCACAAATGA
CTGATGCACATGTAGCTGCTTACACTACATCTGCAGCCCTTGGGAGTTTCTTCTCAATTCCTAATACAAT
GCAAATGGCATACCGCTTCAATGGTATCGCAGTCACCCAAAAGGTGCTTGTCGATAACCAGAAGCAAATT
GCCAACAAATTTAACCAGGCTATGATGTCAGTACAAACAGGTTTTAAAGCTACCAGCAGTGCCCTTGAAA
AACTTCAAAAGGTTGTCAATGACAATGCACAGGCACTTAACAACCTCGTAGCCCAACTTACTAACAACTT
TGGAGCTATTTCATCAGCTATCAATGACATTACTCAGCGGCTCGATAAACTTGAGGCTGACGCCCAAATC
GACCGACTTATCAATGGCAGACTGCAAGTGCTTCAAACATTTGTAACTCAGCAACTCATTCGTGCTTCTG
AAATACGTGCATCAGCTAAATTAGCAGCACAGAAGATGTCAGAGTGTGTGCAAGGACAGTCGCAGAGACT
TGATTTCTGTGGCAGAGGTATGCACCTCATGTCCTTTCCACAAGCAGCTCCATATGGCATGGTGTTTTTA
CACGTGCTATATAAGCCCACAGATTACATCAATGTCACTACAGTGCCGGCAATTTGCAGTAATGATGTGG
CATACTTCCCTGTAGATGGTGTCTTTGTGTATTATAACAACTCACTAATGTTTACCAAGCGTAACTACTT
TGAGCCAGAAATAATCACCATTGACAACATACGGTCTGCAGGATCTTGTAATGTTGACGTCACTTACGTC
AATCACACTATTTACAATCCAGAAATGCCTGAGCTTGAAGATTTCAAACAGGAGCTGGAAGAAATTCGTA
AAAACTTTTCCACAGGACTGCCTAATAGACCTAATTTTACTCTTCCTGGATTGGAAGGTATAAATGCATC
TATGGTAGACCTAAGTGAGGAAGTTAAAATCTTAAATGACGTAGTCAAAGAGCTTAACGCATCATTGATC
AACCTCCAAGAGCTTGGAGTTAACTCTCAATATATCAAATGGCCATGGTACATATGGCTCGGATTTATTG
CTGGTTTAATAGCAATTGTCATGGCTACAATCATGCTTTGTTGCATGACTAGCTGTTGCAGTTGCTTTAA
AGGTCTATGTGCTTGTAAGCGCTGTTGCGACTCTTTTGACGAGCCAGACGAACCTATTAAATATCACTAT
CCTTAGGTTGCAATGGATTTCTTTTCATTGTACACGTTTGGTAGTTTTCATATGCATGCAGCTAAACTAG
CTAGCTTGCTGTCTAACAGTACTGAACATGTCGAACAGGCAGTTCAGCATCTGAACACTAAACTCACAGC
TGACATTATGCTGTGTATTTTCCTTGTAATATACTTGATTTGCTATTTCCTACGCACTGATTCTTTCATT
GCGGTAGTCTTCAAGTATTTAGCTGGCCTTCTAACTGGAGGCTTTCTTTGTCTGGGATTATTCCTAGACA
CACCTACGTTGCTGCTTAAAGCAACTATTGGTGTGGTTCTGTTTATGTTTTCGCTTGGATTCATTTGCAG
AATCACACTTGCAATTCGATGCAAATCACTAGTACCATTGTGTGCTGATGATGATTGCTTCGTAAATTAT
AATGCAGGAGGCAAAACTTATTGTATGCCTTTTGACCCAAATGAACCATATCTCACACTTGTAGTACACC
AAAATGGTATTACATGTGGATCATATAAATTATATGGTGATGTTTCTATTGCTGACCGCATTTACCTAGT
AACACTCACCAAATCTGTACCCTATTCACTTCAAAATATTTTTGATGCTGAATTGTGTACCATAGCTTTC
TATATAGCTGATTGTGCTGTTATAGAAGACCACACAACCGCAGGGAAAACTCCTAGACTGGAACTGAAAT
CAGATCCTATTTATGAGGTCCCTTGCGCTACTATTGATGTGCCTCTCTAAGGTCACTTGAAAGGAGTCTA
AACGAACTTACGTTTGGCTTTTGTCACACGTTAAATGTACTCCTTCGTCTCACAAGAGACAGGCACAGTA
ATAGTTAACGCTGTGTTTATTCTTGTGGGTTTTGTGGCATTATTAATAGTTGCCTTAGCAATCCTTACTT
GTTTGCGGCTGTGTGCATACTGCTGCAATATTCTTGATCAAGGCGTAGTTAGGCCTACTCGCTACGTCTA
TCTACAAGCTCAAACTTTCTACAATAAACTACAACCTGTGGAATCTGAGCTCCTAGTAGTGTAATCTAAA
CGAACGTTTAGTTATTGCACTTTTATTCGTCCCGATAGCTCTTGTAGCCATGTCGGGCGATAGCAACAAC
ACCATTACCCAGGAGGAACTTTTTAAAGTTGTCAAGGAATGGAATTTCGCTTTAGGCATTATGCTTTTTA
TATTCATCACACTTCTGCAGTATGCTTACGCTACTCGCAGTCTGGGACTGTATATACTAAAGCTTGTGCT
TCTTTGGCTCATGTGGCCACTCACTTTTGCATGCTTTGTGCTTGCTGCCATTTACCACGTGAACGTTGTG
TTCATGGGATTTGCCATCACATTTGCTATTATTGTTGGGTGCATGTGGCTTGGTTACTGGATTGCCTCAA
TCCGTCTGTTCAGAAGAACTGGTTCTGTTTGGTCTTTCAATCCAGAAACCAACAGACTGCTGAACGTAGC
GATTCGTGGAACCATGTACACCAGACCACTGCAGGAAGACACTGCTGTGATTGTAGCTACAGTTGCTCGT
GGAGTAGCTGTATTTGCAGGACACAAACTTGGAAGAGCTGACCTTGAGTCATTGCCTAACGAAATTACTG
TAGCCACCTCCAGAACGCTTTCCTATTTTAAGATGAGTAGGAAAGTAAATATTGGTGTTGGCTCGGGTGT
TGCGACCTATTTGCGTTACAAAGTGGGAAACCACCGAGTGCCAAATGCTCGCGCATCTGAAGATCAAGAA
GATCTGCTAGTTGTATCGTAAGAGATCACGAACAGAATGAATTTTAAGAGTATATATGAAGTAATCACTT
TGCTCTTTACATATATAGTCTTTGTGACTGTTGTTATCACCAACAATTCACAGAAATTACTTGAATGCTG
TTTGAGATTAATTAGAAAAATCCAATCTGTAAAACATGAGAAACAAAATACCAGATGTCTTAACACCTGG
CATTTAGTGTCATCAGAACATGGAATAGAGGATTTACCTGTATAACGTGCAAAACAACGAACTATGAGAT
ATCTTTTCCTCATAGTAGCTATCTGTACTGGTTTAACAGCGAAACCTGTTACCTTCACCCACAACCACGG
ACGACATAGAGTTGTAGTGGTTGATTGGACAGATAGCACAACACTTATTCTTAATCACGTTGATGAACCA
ATAACATCATCAACGGCTAATCGGCATTGCTGCAATTACAAAGTAGGATTTTGTACACACATTGTTGTGG
AAGCTTACTCTACTATTTCAGTACGTCGTATACCATTAGACCCAAAGAATTTTTGTGCTTGGCATTACGC
ACCTTGTACACACAACCCTCATATTGTTTGTGTTTAATCAGATTAATTTTACTAAATCTAAAATTAAAAT
AAACGAACTATTCTCTCACATCCTAAATGGCTGCTGAGGGGCAAAGAGTCACTTTTTTGACTCAAGGTTC
AAACCAAAATAACAACAACCAGGAAAACCAAGATGGACGTGGCGCTAGACCCAAAACTAGAAAGCCTCGT
CCAGCTCCACAAAATAACGTATCTTGGTTTACGCCTCTTACCCAACATGGAAAACAAGCGCTTACTTTTA
ACCCAGGACAAGGAGTGCCGCTCAACGCAAATGACGATCCTGACAGCCGCATCGGCTACTGGCGTCGCAA
CATTCGCACAGTTACAAAGAACGGCAAACCACAGAAATTGGACCCGCGCTGGTACTTTTACTATCTTGGC
ACAGGCCCTGAGCAAAACCTCAAGTACCTCCAGCAAAAGGACGGAATTGTCTGGGTTGCAGCTCACGGTG
CCCTTAATGTTCCAGTTAAAACAGTTGGGACCAGAAATCCAGCAAACGATCAAGCTATCGTTGCTGCATT
TGCGCCAGGTACCGAACTGCCCAAGGGTTTCTATGTTGAAGGTAGCAGATCTACATCATCCGCTTCTTCA
GCAGCGTCTTCAAGATCAAATTCGCGCAGCAGAAACTCTAGCCTCTCTCGCAGCTCTTCTCCCGGACGAG
GATTGCCACCAGCAACCGACCCTAACGGAGTTCTAGCTGCCTTGCTCCTGACTAAATTGGAAGCGCTTGA
TGCAAAAGTAAATGGCCCAAAACAACCCCCAGTTGTCACAAAGAAAACAGCAGCTGAAATTGCTGCCAAA
CCTAGGCAGAAACGCGTAGCCCATAAAGGTTACAATGTAAATGCTGCCTATGGACGCCGAGGCCCAGGAC
CATACCAGGGTAATTTCGGCACACAAGAATTCAACAAATTGGGAACAGACTATCCAAAATGGCCCCAAAT
TGCTCAACTTGCCCCTACACCGTCAGCATTCTTCGGAATGAGTCGATTCGCAGTTCAGAAGAACGACGAT
GGCACTTGGCTGACATACCATGGGCATATTAAAATGGATGAAAGTGATCCTAACTTCCAAGTATGGATGA
CTGAACTCCAGCAAAATATTGATGCTTACAAGAACTTCCCCCAGAAAGAGGAAAAGAAAAGCCGTAAGCC
AAAAACCAAGAATGTCGACATGGCACCCCAAGATGTAATGGGAGCTGCAGCTGTCGACCTTGAATGGGAC
TCGTCTATTGACCAGACGGGACCTAATACAATTGTTGTAAAACCTAAGAAGCAGCGCAAACCTGCTGCCG
ACAACAACATCTCTGAAATCTGAAAAATTCGCAAGTAGTAAGGCGTAGTATACCCTACCAGTAGGACTGG
GTTGCTATTCCTACACTTGTGCTGAATGGATTCTATGTATAGTGTAGCACAAGAAGACACTATACACGTT
TACTATCACTGTCTTTGACATTTAGTGTATAGTTGATTGGAGTAATTACAAAGAATACACACCGAGGCCA
CGCCGAGTAGGAACGAGGGTACAGTGTGAAAAGCCGATGTCAATGACCGGAAGAGCCAATCAATGTAAAA
TTAATAATCAAAGAACCCCCAGTGATTTTAATAGCTTTTTAGTAGAATTGCAAAAAAAAAA

>gi|667489388|ref|NC_019843.3| Middle East respiratory syndrome coronavirus, complete genome
GATTTAAGTGAATAGCTTGGCTATCTCACTTCCCCTCGTTCTCTTGCAGAACTTTGATTTTAACGAACTT
AAATAAAAGCCCTGTTGTTTAGCGTATCGTTGCACTTGTCTGGTGGGATTGTGGCATTAATTTGCCTGCT
CATCTAGGCAGTGGACATATGCTCAACACTGGGTATAATTCTAATTGAATACTATTTTTCAGTTAGAGCG
TCGTGTCTCTTGTACGTCTCGGTCACAATACACGGTTTCGTCCGGTGCGTGGCAATTCGGGGCACATCAT
GTCTTTCGTGGCTGGTGTGACCGCGCAAGGTGCGCGCGGTACGTATCGAGCAGCGCTCAACTCTGAAAAA
CATCAAGACCATGTGTCTCTAACTGTGCCACTCTGTGGTTCAGGAAACCTGGTTGAAAAACTTTCACCAT
GGTTCATGGATGGCGAAAATGCCTATGAAGTGGTGAAGGCCATGTTACTTAAAAAGGAGCCACTTCTCTA
TGTGCCCATCCGGCTGGCTGGACACACTAGACACCTCCCAGGTCCTCGTGTGTACCTGGTTGAGAGGCTC
ATTGCTTGTGAAAATCCATTCATGGTTAACCAATTGGCTTATAGCTCTAGTGCAAATGGCAGCCTGGTTG
GCACAACTTTGCAGGGCAAGCCTATTGGTATGTTCTTCCCTTATGACATCGAACTTGTCACAGGAAAGCA
AAATATTCTCCTGCGCAAGTATGGCCGTGGTGGTTATCACTACACCCCATTCCACTATGAGCGAGACAAC
ACCTCTTGCCCTGAGTGGATGGACGATTTTGAGGCGGATCCTAAAGGCAAATATGCCCAGAATCTGCTTA
AGAAGTTGATTGGCGGTGATGTCACTCCAGTTGACCAATACATGTGTGGCGTTGATGGAAAACCCATTAG
TGCCTACGCATTTTTAATGGCCAAGGATGGAATAACCAAACTGGCTGATGTTGAAGCGGACGTCGCAGCA
CGTGCTGATGACGAAGGCTTCATCACATTAAAGAACAATCTATATAGATTGGTTTGGCATGTTGAGCGTA
AAGACGTTCCATATCCTAAGCAATCTATTTTTACTATTAATAGTGTGGTCCAAAAGGATGGTGTTGAAAA
CACTCCTCCTCACTATTTTACTCTTGGATGCAAAATTTTAACGCTCACCCCACGCAACAAGTGGAGTGGC
GTTTCTGACTTGTCCCTCAAACAAAAACTCCTTTACACCTTCTATGGTAAGGAGTCACTTGAGAACCCAA
CCTACATTTACCACTCCGCATTCATTGAGTGTGGAAGTTGTGGTAATGATTCCTGGCTTACAGGGAATGC
TATCCAAGGGTTTGCCTGTGGATGTGGGGCATCATATACAGCTAATGATGTCGAAGTCCAATCATCTGGC
ATGATTAAGCCAAATGCTCTTCTTTGTGCTACTTGCCCCTTTGCTAAGGGTGATAGCTGTTCTTCTAATT
GCAAACATTCAGTTGCTCAGTTGGTTAGTTACCTTTCTGAACGCTGTAATGTTATTGCTGATTCTAAGTC
CTTCACACTTATCTTTGGTGGCGTAGCTTACGCCTACTTTGGATGTGAGGAAGGTACTATGTACTTTGTG
CCTAGAGCTAAGTCTGTTGTCTCAAGGATTGGAGACTCCATCTTTACAGGCTGTACTGGCTCTTGGAACA
AGGTCACTCAAATTGCTAACATGTTCTTGGAACAGACTCAGCATTCCCTTAACTTTGTGGGAGAGTTCGT
TGTCAACGATGTTGTCCTCGCAATTCTCTCTGGAACCACAACTAATGTTGACAAAATACGCCAGCTTCTC
AAAGGTGTCACCCTTGACAAGTTGCGTGATTATTTAGCTGACTATGACGTAGCAGTCACTGCCGGCCCAT
TCATGGATAATGCTATTAATGTTGGTGGTACAGGATTACAGTATGCCGCCATTACTGCACCTTATGTAGT
TCTCACTGGCTTAGGTGAGTCCTTTAAGAAAGTTGCAACCATACCGTATAAGGTTTGCAACTCTGTTAAG
GATACTCTGGCTTATTATGCTCACAGCGTGTTGTACAGAGTTTTTCCTTATGACATGGATTCTGGTGTGT
CATCCTTTAGTGAACTACTTTTTGATTGCGTTGATCTTTCAGTAGCTTCTACCTATTTTTTAGTCCGCAT
CTTGCAAGATAAGACTGGCGACTTTATGTCTACAATTATTACTTCCTGCCAAACTGCTGTTAGTAAGCTT
CTAGATACATGTTTTGAAGCTACAGAAGCAACATTTAACTTCTTGTTAGATTTGGCAGGATTGTTCAGAA
TCTTTCTCCGCAATGCCTATGTGTACACTTCACAAGGGTTTGTGGTGGTCAATGGCAAAGTTTCTACACT
TGTCAAACAAGTGTTAGACTTGCTTAATAAGGGTATGCAACTTTTGCATACAAAGGTCTCCTGGGCTGGT
TCTAAAATCATTGCTGTTATCTACAGCGGCAGGGAGTCTCTAATATTCCCATCGGGAACCTATTACTGTG
TCACCACTAAGGCTAAGTCCGTTCAACAAGATCTTGACGTTATTTTGCCTGGTGAGTTTTCCAAGAAGCA
GTTAGGACTGCTCCAACCTACTGACAATTCTACAACTGTTAGTGTTACTGTATCCAGTAACATGGTTGAA
ACTGTTGTGGGTCAACTTGAGCAAACTAATATGCATAGTCCTGATGTTATAGTAGGTGACTATGTCATTA
TTAGTGAAAAATTGTTTGTGCGTAGTAAGGAAGAAGACGGATTTGCCTTCTACCCTGCTTGCACTAATGG
TCATGCTGTACCGACTCTCTTTAGACTTAAGGGAGGTGCACCTGTAAAAAAAGTAGCCTTTGGCGGTGAT
CAAGTACATGAGGTTGCTGCTGTAAGAAGTGTTACTGTCGAGTACAACATTCATGCTGTATTAGACACAC
TACTTGCTTCTTCTAGTCTTAGAACCTTTGTTGTAGATAAGTCTTTGTCAATTGAGGAGTTTGCTGACGT
AGTAAAGGAACAAGTCTCAGACTTGCTTGTTAAATTACTGCGTGGAATGCCGATTCCAGATTTTGATTTA
GACGATTTTATTGACGCACCATGCTATTGCTTTAACGCTGAGGGTGATGCATCCTGGTCTTCTACTATGA
TCTTCTCTCTTCACCCCGTCGAGTGTGACGAGGAGTGTTCTGAAGTAGAGGCTTCAGATTTAGAAGAAGG
TGAATCAGAGTGCATTTCTGAGACTTCAACTGAACAAGTTGACGTTTCTCATGAGACTTCTGACGACGAG
TGGGCTGCTGCAGTTGATGAAGCGTTCCCTCTCGATGAAGCAGAAGATGTTACTGAATCTGTGCAAGAAG
AAGCACAACCAGTAGAAGTACCTGTTGAAGATATTGCGCAGGTTGTCATAGCTGACACCTTACAGGAAAC
TCCTGTTGTGCCTGATACTGTTGAAGTCCCACCGCAAGTGGTGAAACTTCCGTCTGCACCTCAGACTATC
CAGCCCGAGGTAAAAGAAGTTGCACCTGTCTATGAGGCTGATACCGAACAGACACAGAATGTTACTGTTA
AACCTAAGAGGTTACGCAAAAAGCGTAATGTTGACCCTTTGTCCAATTTTGAACATAAGGTTATTACAGA
GTGCGTTACCATAGTTTTAGGTGACGCAATTCAAGTAGCCAAGTGCTATGGGGAGTCTGTGTTAGTTAAT
GCTGCTAACACACATCTTAAGCATGGCGGTGGTATCGCTGGTGCTATTAATGCGGCTTCAAAAGGGGCTG
TCCAAAAAGAGTCAGATGAGTATATTCTGGCTAAAGGGCCGTTACAAGTAGGAGATTCAGTTCTCTTGCA
AGGCCATTCTCTAGCTAAGAATATCCTGCATGTCGTAGGCCCAGATGCCCGCGCTAAACAGGATGTTTCT
CTCCTTAGTAAGTGCTATAAGGCTATGAATGCATATCCTCTTGTAGTCACTCCTCTTGTTTCAGCAGGCA
TATTTGGTGTAAAACCAGCTGTGTCTTTTGATTATCTTATTAGGGAGGCTAAGACTAGAGTTTTAGTCGT
CGTTAATTCCCAAGATGTCTATAAGAGTCTTACCATAGTTGACATTCCACAGAGTTTGACTTTTTCATAT
GATGGGTTACGTGGCGCAATACGTAAAGCTAAAGATTATGGTTTTACTGTTTTTGTGTGCACAGACAACT
CTGCTAACACTAAAGTTCTTAGGAACAAGGGTGTTGATTATACTAAGAAGTTTCTTACAGTTGACGGTGT
GCAATATTATTGCTACACGTCTAAGGACACTTTAGATGATATCTTACAACAGGCTAATAAGTCTGTTGGT
ATTATATCTATGCCTTTGGGATATGTGTCTCATGGTTTAGACTTAATGCAAGCAGGGAGTGTCGTGCGTA
GAGTTAACGTGCCCTACGTGTGTCTCCTAGCTAATAAAGAGCAAGAAGCTATTTTGATGTCTGAAGACGT
TAAGTTAAACCCTTCAGAAGATTTTATAAAGCACGTCCGCACTAATGGTGGTTACAATTCTTGGCATTTA
GTCGAGGGTGAACTATTGGTGCAAGACTTACGCTTAAATAAGCTCCTGCATTGGTCTGATCAAACCATAT
GCTACAAGGATAGTGTGTTTTATGTTGTAAAGAATAGTACAGCTTTTCCATTTGAAACACTTTCAGCATG
TCGTGCGTATTTGGATTCACGCACGACACAGCAGTTAACAATCGAAGTCTTAGTGACTGTCGATGGTGTA
AATTTTAGAACAGTCGTTCTAAATAATAAGAACACTTATAGATCACAGCTTGGATGCGTTTTCTTTAATG
GTGCTGATATTTCTGACACCATTCCTGATGAGAAACAGAATGGTCACAGTTTATATCTAGCAGACAATTT
GACTGCTGATGAAACAAAGGCGCTTAAAGAGTTATATGGCCCCGTTGATCCTACTTTCTTACACAGATTC
TATTCACTTAAGGCTGCAGTCCATGGGTGGAAGATGGTTGTGTGTGATAAGGTACGTTCTCTCAAATTGA
GTGATAATAATTGTTATCTTAATGCAGTTATTATGACACTTGATTTATTGAAGGACATTAAATTTGTTAT
ACCTGCTCTACAGCATGCATTTATGAAACATAAGGGCGGTGATTCAACTGACTTCATAGCCCTCATTATG
GCTTATGGCAATTGCACATTTGGTGCTCCAGATGATGCCTCTCGGTTACTTCATACCGTGCTTGCAAAGG
CTGAGTTATGCTGTTCTGCACGCATGGTTTGGAGAGAGTGGTGCAATGTCTGTGGCATAAAAGATGTTGT
TCTACAAGGCTTAAAAGCTTGTTGTTACGTGGGTGTGCAAACTGTTGAAGATCTGCGTGCTCGCATGACA
TATGTATGCCAGTGTGGTGGTGAACGTCATCGGCAATTAGTCGAACACACCACCCCCTGGTTGCTGCTCT
CAGGCACACCAAATGAAAAATTGGTGACAACCTCCACGGCGCCTGATTTTGTAGCATTTAATGTCTTTCA
GGGCATTGAAACGGCTGTTGGCCATTATGTTCATGCTCGCCTGAAGGGTGGTCTTATTTTAAAGTTTGAC
TCTGGCACCGTTAGCAAGACTTCAGACTGGAAGTGCAAGGTGACAGATGTACTTTTCCCCGGCCAAAAAT
ACAGTAGCGATTGTAATGTCGTACGGTATTCTTTGGACGGTAATTTCAGAACAGAGGTTGATCCCGACCT
ATCTGCTTTCTATGTTAAGGATGGTAAATACTTTACAAGTGAACCACCCGTAACATATTCACCAGCTACA
ATTTTAGCTGGTAGTGTCTACACTAATAGCTGCCTTGTATCGTCTGATGGACAACCTGGCGGTGATGCTA
TTAGTTTGAGTTTTAATAACCTTTTAGGGTTTGATTCTAGTAAACCAGTCACTAAGAAATACACTTACTC
CTTCTTGCCTAAAGAAGACGGCGATGTGTTGTTGGCTGAGTTTGACACTTATGACCCTATTTATAAGAAT
GGTGCCATGTATAAAGGCAAACCAATTCTTTGGGTCAATAAAGCATCTTATGATACTAATCTTAATAAGT
TCAATAGAGCTAGTTTGCGTCAAATTTTTGACGTAGCCCCCATTGAACTCGAAAATAAATTCACACCTTT
GAGTGTGGAGTCTACACCAGTTGAACCTCCAACTGTAGATGTGGTAGCACTTCAACAGGAAATGACAATT
GTCAAATGTAAGGGTTTAAATAAACCTTTCGTGAAGGACAATGTCAGTTTCGTTGCTGATGATTCAGGTA
CTCCCGTTGTTGAGTATCTGTCTAAAGAAGACCTACATACATTGTATGTAGACCCTAAGTATCAAGTCAT
TGTCTTAAAAGACAATGTACTTTCTTCTATGCTTAGATTGCACACCGTTGAGTCAGGTGATATTAACGTT
GTTGCAGCTTCCGGATCTTTGACACGTAAAGTGAAGTTACTATTTAGGGCTTCATTTTATTTCAAAGAAT
TTGCTACCCGCACTTTCACTGCTACCACTGCTGTAGGTAGTTGTATAAAGAGTGTAGTGCGGCATCTAGG
TGTTACTAAAGGCATATTGACAGGCTGTTTTAGTTTTGCCAAGATGTTATTTATGCTTCCACTAGCTTAC
TTTAGTGATTCAAAACTCGGCACCACAGAGGTTAAAGTGAGTGCTTTGAAAACAGCCGGCGTTGTGACAG
GTAATGTTGTAAAACAGTGTTGCACTGCTGCTGTTGATTTAAGTATGGATAAGTTGCGCCGTGTGGATTG
GAAATCAACCCTACGGTTGTTACTTATGTTATGCACAACTATGGTATTGTTGTCTTCTGTGTATCACTTG
TATGTCTTCAATCAGGTCTTATCAAGTGATGTTATGTTTGAAGATGCCCAAGGTTTGAAAAAGTTCTACA
AAGAAGTTAGAGCTTACCTAGGAATCTCTTCTGCTTGTGACGGTCTTGCTTCAGCTTATAGGGCGAATTC
CTTTGATGTACCTACATTCTGCGCAAACCGTTCTGCAATGTGTAATTGGTGCTTGATTAGCCAAGATTCC
ATAACTCACTACCCAGCTCTTAAGATGGTTCAAACACATCTTAGCCACTATGTTCTTAACATAGATTGGT
TGTGGTTTGCATTTGAGACTGGTTTGGCATACATGCTCTATACCTCGGCCTTCAACTGGTTGTTGTTGGC
AGGTACATTGCATTATTTCTTTGCACAGACTTCCATATTTGTAGACTGGCGGTCATACAATTATGCTGTG
TCTAGTGCCTTCTGGTTATTCACCCACATTCCAATGGCGGGTTTGGTACGAATGTATAATTTGTTAGCAT
GCCTTTGGCTTTTACGCAAGTTTTATCAGCATGTAATCAATGGTTGCAAAGATACGGCATGCTTGCTCTG
CTATAAGAGGAACCGACTTACTAGAGTTGAAGCTTCTACCGTTGTCTGTGGTGGAAAACGTACGTTTTAT
ATCACAGCAAATGGCGGTATTTCATTCTGTCGTAGGCATAATTGGAATTGTGTGGATTGTGACACTGCAG
GTGTGGGGAATACCTTCATCTGTGAAGAAGTCGCAAATGACCTCACTACCGCCCTACGCAGGCCTATTAA
CGCTACGGATAGATCACATTATTATGTGGATTCCGTTACAGTTAAAGAGACTGTTGTTCAGTTTAATTAT
CGTAGAGACGGTCAACCATTCTACGAGCGGTTTCCCCTCTGCGCTTTTACAAATCTAGATAAGTTGAAGT
TCAAAGAGGTCTGTAAAACTACTACTGGTATACCTGAATACAACTTTATCATCTACGACTCATCAGATCG
TGGCCAGGAAAGTTTAGCTAGGTCTGCATGTGTTTATTATTCTCAAGTCTTGTGTAAATCAATTCTTTTG
GTTGACTCAAGTTTGGTTACTTCTGTTGGTGATTCTAGTGAAATCGCCACTAAAATGTTTGATTCCTTTG
TTAATAGTTTCGTCTCGCTGTATAATGTCACACGCGATAAGTTGGAAAAACTTATCTCTACTGCTCGTGA
TGGCGTAAGGCGAGGCGATAACTTCCATAGTGTCTTAACAACATTCATTGACGCAGCACGAGGCCCCGCA
GGTGTGGAGTCTGATGTTGAGACCAATGAAATTGTTGACTCTGTGCAGTATGCTCATAAACATGACATAC
AAATTACTAATGAGAGCTACAATAATTATGTACCCTCATATGTTAAACCTGATAGTGTGTCTACCAGCGA
TTTAGGTAGTCTCATTGATTGTAATGCGGCTTCAGTTAACCAAATTGTCTTGCGTAATTCTAATGGTGCT
TGCATTTGGAACGCTGCTGCATATATGAAACTCTCGGATGCACTTAAACGACAGATTCGCATTGCATGCC
GTAAGTGTAATTTAGCTTTCCGGTTAACCACCTCAAAGCTACGCGCTAATGATAATATCTTATCAGTTAG
ATTCACTGCTAACAAAATTGTTGGTGGTGCTCCTACATGGTTTAATGCGTTGCGTGACTTTACGTTAAAG
GGTTATGTTCTTGCTACCATTATTGTGTTTCTGTGTGCTGTACTGATGTATTTGTGTTTACCTACATTTT
CTATGGCACCTGTTGAATTTTATGAAGACCGCATCTTGGACTTTAAAGTTCTTGATAATGGTATCATTAG
GGATGTAAATCCTGATGATAAGTGCTTTGCTAATAAGCACCGGTCCTTCACACAATGGTATCATGAGCAT
GTTGGTGGTGTCTATGACAACTCTATCACATGCCCATTGACAGTTGCAGTAATTGCTGGAGTTGCTGGTG
CTCGCATTCCAGACGTACCTACTACATTGGCTTGGGTGAACAATCAGATAATTTTCTTTGTTTCTCGAGT
CTTTGCTAATACAGGCAGTGTTTGCTACACTCCTATAGATGAGATACCCTATAAGAGTTTCTCTGATAGT
GGTTGCATTCTTCCATCTGAGTGCACTATGTTTAGGGATGCAGAGGGCCGTATGACACCATACTGCCATG
ATCCTACTGTTTTGCCTGGGGCTTTTGCGTACAGTCAGATGAGGCCTCATGTTCGTTACGACTTGTATGA
TGGTAACATGTTTATTAAATTTCCTGAAGTAGTATTTGAAAGTACACTTAGGATTACTAGAACTCTGTCA
ACTCAGTACTGCCGGTTCGGTAGTTGTGAGTATGCACAAGAGGGTGTTTGTATTACCACAAATGGCTCGT
GGGCCATTTTTAATGACCACCATCTTAATAGACCTGGTGTCTATTGTGGCTCTGATTTTATTGACATTGT
CAGGCGGTTAGCAGTATCACTGTTCCAGCCTATTACTTATTTCCAATTGACTACCTCATTGGTCTTGGGT
ATAGGTTTGTGTGCGTTCCTGACTTTGCTCTTCTATTATATTAATAAAGTAAAACGTGCTTTTGCAGATT
ACACCCAGTGTGCTGTAATTGCTGTTGTTGCTGCTGTTCTTAATAGCTTGTGCATCTGCTTTGTTACCTC
TATACCATTGTGTATAGTACCTTACACTGCATTGTACTATTATGCTACATTCTATTTTACTAATGAGCCT
GCATTTATTATGCATGTTTCTTGGTACATTATGTTCGGGCCTATCGTTCCCATATGGATGACCTGCGTCT
ATACAGTTGCAATGTGCTTTAGACACTTCTTCTGGGTTTTAGCTTATTTTAGTAAGAAACATGTAGAAGT
TTTTACTGATGGTAAGCTTAATTGTAGTTTCCAGGACGCTGCCTCTAATATCTTTGTTATTAACAAGGAC
ACTTATGCAGCTCTTAGAAACTCTTTAACTAATGATGCCTATTCACGATTTTTGGGGTTGTTTAACAAGT
ATAAGTACTTCTCTGGTGCTATGGAAACAGCCGCTTATCGTGAAGCTGCAGCATGTCATCTTGCTAAAGC
CTTACAAACATACAGCGAGACTGGTAGTGATCTTCTTTACCAACCACCCAACTGTAGCATAACCTCTGGC
GTGTTGCAAAGCGGTTTGGTGAAAATGTCACATCCCAGTGGAGATGTTGAGGCTTGTATGGTTCAGGTTA
CCTGCGGTAGCATGACTCTTAATGGTCTTTGGCTTGACAACACAGTCTGGTGCCCACGACACGTAATGTG
CCCGGCTGACCAGTTGTCTGATCCTAATTATGATGCCTTGTTGATTTCTATGACTAATCATAGTTTCAGT
GTGCAAAAACACATTGGCGCTCCAGCAAACTTGCGTGTTGTTGGTCATGCCATGCAAGGCACTCTTTTGA
AGTTGACTGTCGATGTTGCTAACCCTAGCACTCCAGCCTACACTTTTACAACAGTGAAACCTGGCGCAGC
ATTTAGTGTGTTAGCATGCTATAATGGTCGTCCGACTGGTACATTCACTGTTGTAATGCGCCCTAACTAC
ACAATTAAGGGTTCCTTTCTGTGTGGTTCTTGTGGTAGTGTTGGTTACACCAAGGAGGGTAGTGTGATCA
ATTTCTGTTACATGCATCAAATGGAACTTGCTAATGGTACACATACCGGTTCAGCATTTGATGGTACTAT
GTATGGTGCCTTTATGGATAAACAAGTGCACCAAGTTCAGTTAACAGACAAATACTGCAGTGTTAATGTA
GTAGCTTGGCTTTACGCAGCAATACTTAATGGTTGCGCTTGGTTTGTAAAACCTAATCGCACTAGTGTTG
TTTCTTTTAATGAATGGGCTCTTGCCAACCAATTCACTGAATTTGTTGGCACTCAATCCGTTGACATGTT
AGCTGTCAAAACAGGCGTTGCTATTGAACAGCTGCTTTATGCGATCCAACAACTGTATACTGGGTTCCAG
GGAAAGCAAATCCTTGGCAGTACCATGTTGGAAGATGAATTCACACCTGAGGATGTTAATATGCAGATTA
TGGGTGTGGTTATGCAGAGTGGTGTGAGAAAAGTTACATATGGTACTGCGCATTGGTTGTTTGCGACCCT
TGTCTCAACCTATGTGATAATCTTACAAGCCACTAAATTTACTTTGTGGAACTACTTGTTTGAGACTATT
CCCACACAGTTGTTCCCACTCTTATTTGTGACTATGGCCTTCGTTATGTTGTTGGTTAAACACAAACACA
CCTTTTTGACACTTTTCTTGTTGCCTGTGGCTATTTGTTTGACTTATGCAAACATAGTCTACGAGCCCAC
TACTCCCATTTCGTCAGCGCTGATTGCAGTTGCAAATTGGCTTGCCCCCACTAATGCTTATATGCGCACT
ACACATACTGATATTGGTGTCTACATTAGTATGTCACTTGTATTAGTCATTGTAGTGAAGAGATTGTACA
ACCCATCACTTTCTAACTTTGCGTTAGCATTGTGCAGTGGTGTAATGTGGTTGTACACTTATAGCATTGG
AGAAGCCTCAAGCCCCATTGCCTATCTGGTTTTTGTCACTACACTCACTAGTGATTATACGATTACAGTC
TTTGTTACTGTCAACCTTGCAAAAGTTTGCACTTATGCCATCTTTGCTTACTCACCACAGCTTACACTTG
TGTTTCCGGAAGTGAAGATGATACTTTTATTATACACATGTTTAGGTTTCATGTGTACTTGCTATTTTGG
TGTCTTCTCTCTTTTGAACCTTAAGCTTAGAGCACCTATGGGTGTCTATGACTTTAAGGTCTCAACACAA
GAGTTCAGATTCATGACTGCTAACAATCTAACTGCACCTAGAAATTCTTGGGAGGCTATGGCTCTGAACT
TTAAGTTAATAGGTATTGGCGGTACACCTTGTATAAAGGTTGCTGCTATGCAGTCTAAACTTACAGATCT
TAAATGCACATCTGTGGTTCTCCTCTCTGTGCTCCAACAGTTACACTTAGAGGCTAATAGTAGGGCCTGG
GCTTTCTGTGTTAAATGCCATAATGATATATTGGCAGCAACAGACCCCAGTGAGGCTTTCGAGAAATTCG
TAAGTCTCTTTGCTACTTTAATGACTTTTTCTGGTAATGTAGATCTTGATGCGTTAGCTAGTGATATTTT
TGACACTCCTAGCGTACTTCAAGCTACTCTTTCTGAGTTTTCACACTTAGCTACCTTTGCTGAGTTGGAA
GCTGCGCAGAAAGCCTATCAGGAAGCTATGGACTCTGGTGACACCTCACCACAAGTTCTTAAGGCTTTGC
AGAAGGCTGTTAATATAGCTAAAAACGCCTATGAGAAGGATAAGGCAGTGGCCCGTAAGTTAGAACGTAT
GGCTGATCAGGCTATGACTTCTATGTATAAGCAAGCACGTGCTGAAGACAAGAAAGCAAAAATTGTCAGT
GCTATGCAAACTATGTTGTTTGGTATGATTAAGAAGCTCGACAACGATGTTCTTAATGGTATCATTTCTA
ACGCTAGGAATGGTTGTATACCTCTTAGTGTCATCCCACTGTGTGCTTCAAATAAACTTCGCGTTGTAAT
TCCTGACTTCACCGTCTGGAATCAGGTAGTCACATATCCCTCGCTTAACTACGCTGGGGCTTTGTGGGAC
ATTACAGTTATAAACAATGTGGACAATGAAATTGTTAAGTCTTCAGATGTTGTAGACAGCAATGAAAATT
TAACATGGCCACTTGTTTTAGAATGCACTAGGGCATCCACTTCTGCCGTTAAGTTGCAAAATAATGAGAT
CAAACCTTCAGGTCTAAAAACCATGGTTGTGTCTGCGGGTCAAGAGCAAACTAACTGTAATACTAGTTCC
TTAGCTTATTACGAACCTGTGCAGGGTCGTAAAATGCTGATGGCTCTTCTTTCTGATAATGCCTATCTCA
AATGGGCGCGTGTTGAAGGTAAGGACGGATTTGTCAGTGTAGAGCTACAACCTCCTTGCAAATTCTTGAT
TGCGGGACCAAAAGGACCTGAAATCCGATATCTCTATTTTGTTAAAAATCTTAACAACCTTCATCGCGGG
CAAGTGTTAGGGCACATTGCTGCGACTGTTAGATTGCAAGCTGGTTCTAACACCGAGTTTGCCTCTAATT
CCTCGGTGTTGTCACTTGTTAACTTCACCGTTGATCCTCAAAAAGCTTATCTCGATTTCGTCAATGCGGG
AGGTGCCCCATTGACAAATTGTGTTAAGATGCTTACTCCTAAAACTGGTACAGGTATAGCTATATCTGTT
AAACCAGAGAGTACAGCTGATCAAGAGACTTATGGTGGAGCTTCAGTGTGTCTCTATTGCCGTGCGCATA
TAGAACATCCTGATGTCTCTGGTGTTTGTAAATATAAGGGTAAGTTTGTCCAAATCCCTGCTCAGTGTGT
CCGTGACCCTGTGGGATTTTGTTTGTCAAATACCCCCTGTAATGTCTGTCAATATTGGATTGGATATGGG
TGCAATTGTGACTCGCTTAGGCAAGCAGCACTGCCCCAATCTAAAGATTCCAATTTTTTAAACGAGTCCG
GGGTTCTATTGTAAATGCCCGAATAGAACCCTGTTCAAGTGGTTTGTCCACTGATGTCGTCTTTAGGGCA
TTTGACATCTGCAACTATAAGGCTAAGGTTGCTGGTATTGGAAAATACTACAAGACTAATACTTGTAGGT
TTGTAGAATTAGATGACCAAGGGCATCATTTAGACTCCTATTTTGTCGTTAAGAGGCATACTATGGAGAA
TTATGAACTAGAGAAGCACTGTTACGACTTGTTACGTGACTGTGATGCTGTAGCTCCCCATGATTTCTTC
ATCTTTGATGTAGACAAAGTTAAAACACCTCATATTGTACGTCAGCGTTTAACTGAGTACACTATGATGG
ATCTTGTATATGCCCTGAGGCACTTTGATCAAAATAGCGAAGTGCTTAAGGCTATCTTAGTGAAGTATGG
TTGCTGTGATGTTACCTACTTTGAAAATAAACTCTGGTTTGATTTTGTTGAAAATCCCAGTGTTATTGGT
GTTTATCATAAACTTGGAGAACGTGTACGCCAAGCTATCTTAAACACTGTTAAATTTTGTGACCACATGG
TCAAGGCTGGTTTAGTCGGTGTGCTCACACTAGACAACCAGGACCTTAATGGCAAGTGGTATGATTTTGG
TGACTTCGTAATCACTCAACCTGGTTCAGGAGTAGCTATAGTTGATAGCTACTATTCTTATTTGATGCCT
GTGCTCTCAATGACCGATTGTCTGGCCGCTGAGACACATAGGGATTGTGATTTTAATAAACCACTCATTG
AGTGGCCACTTACTGAGTATGATTTTACTGATTATAAGGTACAACTCTTTGAGAAGTACTTTAAATATTG
GGATCAGACGTATCACGCAAATTGCGTTAATTGTACTGATGACCGTTGTGTGTTACATTGTGCTAATTTC
AATGTATTGTTTGCTATGACCATGCCTAAGACTTGTTTCGGACCCATAGTCCGAAAGATCTTTGTTGATG
GCGTGCCATTTGTAGTATCTTGTGGTTATCACTACAAAGAATTAGGTTTAGTCATGAATATGGATGTTAG
TCTCCATAGACATAGGCTCTCTCTTAAGGAGTTGATGATGTATGCCGCTGATCCAGCCATGCACATTGCC
TCCTCTAACGCTTTTCTTGATTTGAGGACATCATGTTTTAGTGTCGCTGCACTTACAACTGGTTTGACTT
TTCAAACTGTGCGGCCTGGCAATTTTAACCAAGACTTCTATGATTTCGTGGTATCTAAAGGTTTCTTTAA
GGAGGGCTCTTCAGTGACGCTCAAACATTTTTTCTTTGCTCAAGATGGTAATGCTGCTATTACAGATTAT
AATTACTATTCTTATAATCTGCCTACTATGTGTGACATCAAACAAATGTTGTTCTGCATGGAAGTTGTAA
ACAAGTACTTCGAAATCTATGACGGTGGTTGTCTTAATGCTTCTGAAGTGGTTGTTAATAATTTAGACAA
GAGTGCTGGCCATCCTTTTAATAAGTTTGGCAAAGCTCGTGTCTATTATGAGAGCATGTCTTACCAGGAG
CAAGATGAACTTTTTGCCATGACAAAGCGTAACGTCATTCCTACCATGACTCAAATGAATCTAAAATATG
CTATTAGTGCTAAGAATAGAGCTCGCACTGTTGCAGGCGTGTCCATACTTAGCACAATGACTAATCGCCA
GTACCATCAGAAAATGCTTAAGTCCATGGCTGCAACTCGTGGAGCGACTTGCGTCATTGGTACTACAAAG
TTCTACGGTGGCTGGGATTTCATGCTTAAAACATTGTACAAAGATGTTGATAATCCGCATCTTATGGGTT
GGGATTACCCTAAGTGTGATAGAGCTATGCCTAATATGTGTAGAATCTTCGCTTCACTCATATTAGCTCG
TAAACATGGCACTTGTTGTACTACAAGGGACAGATTTTATCGCTTGGCAAATGAGTGTGCTCAGGTGCTA
AGCGAATATGTTCTATGTGGTGGTGGTTACTACGTCAAACCTGGAGGTACCAGTAGCGGAGATGCCACCA
CTGCATATGCCAATAGTGTCTTTAACATTTTGCAGGCGACAACTGCTAATGTCAGTGCACTTATGGGTGC
TAATGGCAACAAGATTGTTGACAAAGAAGTTAAAGACATGCAGTTTGATTTGTATGTCAATGTTTACAGG
AGCACTAGCCCAGACCCCAAATTTGTTGATAAATACTATGCTTTTCTTAATAAGCACTTTTCTATGATGA
TACTGTCTGATGACGGTGTCGTTTGCTATAATAGTGATTATGCAGCTAAGGGTTACATTGCTGGAATACA
GAATTTTAAGGAAACGCTGTATTATCAGAACAATGTCTTTATGTCTGAAGCTAAATGCTGGGTGGAAACC
GATCTGAAGAAAGGGCCACATGAATTCTGTTCACAGCATACGCTTTATATTAAGGATGGCGACGATGGTT
ACTTCCTTCCTTATCCAGACCCTTCAAGAATTTTGTCTGCCGGTTGCTTTGTAGATGATATCGTTAAGAC
TGACGGTACACTCATGGTAGAGCGGTTTGTGTCTTTGGCTATAGATGCTTACCCTCTCACAAAGCATGAA
GATATAGAATACCAGAATGTATTCTGGGTCTACTTACAGTATATAGAAAAACTGTATAAAGACCTTACAG
GACACATGCTTGACAGTTATTCTGTCATGCTATGTGGTGATAATTCTGCTAAGTTTTGGGAAGAGGCATT
CTATAGAGATCTCTATAGTTCGCCTACCACTTTGCAGGCTGTCGGTTCATGCGTTGTATGCCATTCACAG
ACTTCCCTACGCTGTGGGACATGCATCCGTAGACCATTTCTCTGCTGTAAATGCTGCTATGATCATGTTA
TAGCAACTCCACATAAGATGGTTTTGTCTGTTTCTCCTTACGTTTGTAATGCCCCTGGTTGTGGCGTTTC
AGACGTTACTAAGCTATATTTAGGTGGTATGAGCTACTTTTGTGTAGATCATAGACCTGTGTGTAGTTTT
CCACTTTGCGCTAATGGTCTTGTATTCGGCTTATACAAGAATATGTGCACAGGTAGTCCTTCTATAGTTG
AATTTAATAGGTTGGCTACCTGTGACTGGACTGAAAGTGGTGATTACACCCTTGCCAATACTACAACAGA
ACCACTCAAACTTTTTGCTGCTGAGACTTTACGTGCCACTGAAGAGGCGTCTAAGCAGTCTTATGCTATT
GCCACCATCAAAGAAATTGTTGGTGAGCGCCAACTATTACTTGTGTGGGAGGCTGGCAAGTCCAAACCAC
CACTCAATCGTAATTATGTTTTTACTGGTTATCATATAACCAAAAATAGTAAAGTGCAGCTCGGTGAGTA
CATTTTCGAGCGCATTGATTATAGTGATGCTGTATCCTACAAGTCTAGTACAACGTATAAACTGACTGTA
GGTGACATCTTCGTACTTACCTCTCACTCTGTGGCTACCTTGACGGCGCCCACAATTGTGAATCAAGAGA
GGTATGTTAAAATTACTGGGTTGTACCCAACCATTACGGTACCTGAAGAGTTCGCAAGTCATGTTGCCAA
CTTCCAAAAATCAGGTTATAGTAAATATGTCACTGTTCAGGGACCACCTGGCACTGGCAAAAGTCATTTT
GCTATAGGGTTAGCGATTTACTACCCTACAGCACGTGTTGTTTATACAGCATGTTCACACGCAGCTGTTG
ATGCTTTGTGTGAAAAAGCTTTTAAATATTTGAACATTGCTAAATGTTCCCGTATCATTCCTGCAAAGGC
ACGTGTTGAGTGCTATGACAGGTTTAAAGTTAATGAGACAAATTCTCAATATTTGTTTAGTACTATTAAT
GCTCTACCAGAAACTTCTGCCGATATTCTGGTGGTTGATGAGGTTAGTATGTGCACTAATTATGATCTTT
CAATTATTAATGCACGTATTAAAGCTAAGCACATTGTCTATGTAGGAGATCCAGCACAGTTGCCAGCTCC
TAGGACTTTGTTGACTAGAGGCACATTGGAACCAGAAAATTTCAATAGTGTCACTAGATTGATGTGTAAC
TTAGGTCCTGACATATTTTTAAGTATGTGCTACAGGTGTCCTAAGGAAATAGTAAGCACTGTGAGCGCTC
TTGTCTACAATAATAAATTGTTAGCCAAGAAGGAGCTTTCAGGCCAGTGCTTTAAAATACTCTATAAGGG
CAATGTGACGCATGATGCTAGCTCTGCCATTAATAGACCACAACTCACATTTGTGAAGAATTTTATTACT
GCCAATCCGGCATGGAGTAAGGCAGTCTTTATTTCGCCTTACAATTCACAGAATGCTGTGTCTCGTTCAA
TGCTGGGTCTTACCACTCAGACTGTTGATTCCTCACAGGGTTCAGAATACCAGTACGTTATCTTCTGTCA
AACAGCAGATACGGCACATGCTAACAACATTAACAGATTTAATGTTGCAATCACTCGTGCCCAAAAAGGT
ATTCTTTGTGTTATGACATCTCAGGCACTCTTTGAGTCCTTAGAGTTTACTGAATTGTCTTTTACTAATT
ACAAGCTCCAGTCTCAGATTGTAACTGGCCTTTTTAAAGATTGCTCTAGAGAAACTTCTGGCCTCTCACC
TGCTTATGCACCAACATATGTTAGTGTTGATGACAAGTATAAGACGAGTGATGAGCTTTGCGTGAATCTT
AATTTACCCGCAAATGTCCCATACTCTCGTGTTATTTCCAGGATGGGCTTTAAACTCGATGCAACAGTTC
CTGGATATCCTAAGCTTTTCATTACTCGTGAAGAGGCTGTAAGGCAAGTTCGAAGCTGGATAGGCTTCGA
TGTTGAGGGTGCTCATGCTTCCCGTAATGCATGTGGCACCAATGTGCCTCTACAATTAGGATTTTCAACT
GGTGTGAACTTTGTTGTTCAGCCAGTTGGTGTTGTAGACACTGAGTGGGGTAACATGTTAACGGGCATTG
CTGCACGTCCTCCACCAGGTGAACAGTTTAAGCACCTCGTGCCTCTTATGCATAAGGGGGCTGCGTGGCC
TATTGTTAGACGACGTATAGTGCAAATGTTGTCAGACACTTTAGACAAATTGTCTGATTACTGTACGTTT
GTTTGTTGGGCTCATGGCTTTGAATTAACGTCTGCATCATACTTTTGCAAGATAGGTAAGGAACAGAAGT
GTTGCATGTGCAATAGACGCGCTGCAGCGTACTCTTCACCTCTGCAATCTTATGCCTGCTGGACTCATTC
CTGCGGTTATGATTATGTCTACAACCCTTTCTTTGTCGATGTTCAACAGTGGGGTTATGTAGGCAATCTT
GCTACTAATCACGATCGTTATTGCTCTGTCCATCAAGGAGCTCATGTGGCTTCTAATGATGCAATAATGA
CTCGTTGTTTAGCTATTCATTCTTGTTTTATAGAACGTGTGGATTGGGATATAGAGTATCCTTATATCTC
ACATGAAAAGAAATTGAATTCCTGTTGTAGAATCGTTGAGCGCAACGTCGTACGTGCTGCTCTTCTTGCC
GGTTCATTTGACAAAGTCTATGATATTGGCAATCCTAAAGGAATTCCTATTGTTGATGACCCTGTGGTTG
ATTGGCATTATTTTGATGCACAGCCCTTGACCAGGAAGGTACAACAGCTTTTCTATACAGAGGACATGGC
CTCAAGATTTGCTGATGGGCTCTGCTTATTTTGGAACTGTAATGTACCAAAATATCCTAATAATGCAATT
GTATGCAGGTTTGACACACGTGTGCATTCTGAGTTCAATTTGCCAGGTTGTGATGGCGGTAGTTTGTATG
TTAACAAGCACGCTTTTCATACACCAGCATATGATGTGAGTGCATTCCGTGATCTGAAACCTTTACCATT
CTTTTATTATTCTACTACACCATGTGAAGTGCATGGTAATGGTAGTATGATAGAGGATATTGATTATGTA
CCCCTAAAATCTGCAGTCTGTATTACAGCTTGTAATTTAGGGGGCGCTGTTTGTAGGAAGCATGCTACAG
AGTACAGAGAGTATATGGAAGCATATAATCTTGTCTCTGCATCAGGTTTCCGCCTTTGGTGTTATAAGAC
CTTTGATATTTATAATCTCTGGTCTACTTTTACAAAAGTTCAAGGTTTGGAAAACATTGCTTTTAATGTT
GTTAAACAAGGCCATTTTATTGGTGTTGAGGGTGAACTACCTGTAGCTGTAGTCAATGATAAGATCTTCA
CCAAGAGTGGCGTTAATGACATTTGTATGTTTGAGAATAAAACCACTTTGCCTACTAATATAGCTTTTGA
ACTCTATGCTAAGCGTGCTGTACGCTCGCATCCCGATTTCAAATTGCTACACAATTTACAAGCAGACATT
TGCTACAAGTTCGTCCTTTGGGATTATGAACGTAGCAATATTTATGGTACTGCTACTATTGGTGTATGTA
AGTACACTGATATTGATGTTAATTCAGCTTTGAATATATGTTTTGACATACGCGATAATTGTTCATTGGA
GAAGTTCATGTCTACTCCCAATGCCATCTTTATTTCTGATAGAAAAATCAAGAAATACCCTTGTATGGTA
GGTCCTGATTATGCTTACTTCAATGGTGCTATCATCCGTGATAGTGATGTTGTTAAACAACCAGTGAAGT
TCTACTTGTATAAGAAAGTCAATAATGAGTTTATTGATCCTACTGAGTGTATTTACACTCAGAGTCGCTC
TTGTAGTGACTTCCTACCCCTTTCTGACATGGAGAAAGACTTTCTATCTTTTGATAGTGATGTTTTCATT
AAGAAGTATGGCTTGGAAAACTATGCTTTTGAGCACGTAGTCTATGGAGACTTCTCTCATACTACGTTAG
GCGGTCTTCACTTGCTTATTGGTTTATACAAGAAGCAACAGGAAGGTCATATTATTATGGAAGAAATGCT
AAAAGGTAGCTCAACTATTCATAACTATTTTATTACTGAGACTAACACAGCGGCTTTTAAGGCGGTGTGT
TCTGTTATAGATTTAAAGCTTGACGACTTTGTTATGATTTTAAAGAGTCAAGACCTTGGCGTAGTATCCA
AGGTTGTCAAGGTTCCTATTGACTTAACAATGATTGAGTTTATGTTATGGTGTAAGGATGGACAGGTTCA
AACCTTCTACCCTCGACTCCAGGCTTCTGCAGATTGGAAACCTGGTCATGCAATGCCATCCCTCTTTAAA
GTTCAAAATGTAAACCTTGAACGTTGTGAGCTTGCTAATTACAAGCAATCTATTCCTATGCCTCGCGGTG
TGCACATGAACATCGCTAAATATATGCAATTGTGCCAGTATTTAAATACTTGCACATTAGCCGTGCCTGC
CAATATGCGTGTTATACATTTTGGCGCTGGTTCTGATAAAGGTATCGCTCCTGGTACCTCAGTTTTACGA
CAGTGGCTTCCTACAGATGCCATTATTATAGATAATGATTTAAATGAGTTCGTGTCAGATGCTGACATAA
CTTTATTTGGAGATTGTGTAACTGTACGTGTCGGCCAACAAGTGGATCTTGTTATTTCCGACATGTATGA
TCCTACTACTAAGAATGTAACAGGTAGTAATGAGTCAAAGGCTTTATTCTTTACTTACCTGTGTAACCTC
ATTAATAATAATCTTGCTCTTGGTGGGTCTGTTGCTATTAAAATAACAGAACACTCTTGGAGCGTTGAAC
TTTATGAACTTATGGGAAAATTTGCTTGGTGGACTGTTTTCTGCACCAATGCAAATGCATCCTCATCTGA
AGGATTCCTCTTAGGTATTAATTACTTGGGTACTATTAAAGAAAATATAGATGGTGGTGCTATGCACGCC
AACTATATATTTTGGAGAAATTCCACTCCTATGAATCTGAGTACTTACTCACTTTTTGATTTATCCAAGT
TTCAATTAAAATTAAAAGGAACACCAGTTCTTCAATTAAAGGAGAGTCAAATTAACGAACTCGTAATATC
TCTCCTGTCGCAGGGTAAGTTACTTATCCGTGACAATGATACACTCAGTGTTTCTACTGATGTTCTTGTT
AACACCTACAGAAAGTTACGTTGATGTAGGGCCAGATTCTGTTAAGTCTGCTTGTATTGAGGTTGATATA
CAACAGACTTTCTTTGATAAAACTTGGCCTAGGCCAATTGATGTTTCTAAGGCTGACGGTATTATATACC
CTCAAGGCCGTACATATTCTAACATAACTATCACTTATCAAGGTCTTTTTCCCTATCAGGGAGACCATGG
TGATATGTATGTTTACTCTGCAGGACATGCTACAGGCACAACTCCACAAAAGTTGTTTGTAGCTAACTAT
TCTCAGGACGTCAAACAGTTTGCTAATGGGTTTGTCGTCCGTATAGGAGCAGCTGCCAATTCCACTGGCA
CTGTTATTATTAGCCCATCTACCAGCGCTACTATACGAAAAATTTACCCTGCTTTTATGCTGGGTTCTTC
AGTTGGTAATTTCTCAGATGGTAAAATGGGCCGCTTCTTCAATCATACTCTAGTTCTTTTGCCCGATGGA
TGTGGCACTTTACTTAGAGCTTTTTATTGTATTCTAGAGCCTCGCTCTGGAAATCATTGTCCTGCTGGCA
ATTCCTATACTTCTTTTGCCACTTATCACACTCCTGCAACAGATTGTTCTGATGGCAATTACAATCGTAA
TGCCAGTCTGAACTCTTTTAAGGAGTATTTTAATTTACGTAACTGCACCTTTATGTACACTTATAACATT
ACCGAAGATGAGATTTTAGAGTGGTTTGGCATTACACAAACTGCTCAAGGTGTTCACCTCTTCTCATCTC
GGTATGTTGATTTGTACGGCGGCAATATGTTTCAATTTGCCACCTTGCCTGTTTATGATACTATTAAGTA
TTATTCTATCATTCCTCACAGTATTCGTTCTATCCAAAGTGATAGAAAAGCTTGGGCTGCCTTCTACGTA
TATAAACTTCAACCGTTAACTTTCCTGTTGGATTTTTCTGTTGATGGTTATATACGCAGAGCTATAGACT
GTGGTTTTAATGATTTGTCACAACTCCACTGCTCATATGAATCCTTCGATGTTGAATCTGGAGTTTATTC
AGTTTCGTCTTTCGAAGCAAAACCTTCTGGCTCAGTTGTGGAACAGGCTGAAGGTGTTGAATGTGATTTT
TCACCTCTTCTGTCTGGCACACCTCCTCAGGTTTATAATTTCAAGCGTTTGGTTTTTACCAATTGCAATT
ATAATCTTACCAAATTGCTTTCACTTTTTTCTGTGAATGATTTTACTTGTAGTCAAATATCTCCAGCAGC
AATTGCTAGCAACTGTTATTCTTCACTGATTTTGGATTACTTTTCATACCCACTTAGTATGAAATCCGAT
CTCAGTGTTAGTTCTGCTGGTCCAATATCCCAGTTTAATTATAAACAGTCCTTTTCTAATCCCACATGTT
TGATTTTAGCGACTGTTCCTCATAACCTTACTACTATTACTAAGCCTCTTAAGTACAGCTATATTAACAA
GTGCTCTCGTCTTCTTTCTGATGATCGTACTGAAGTACCTCAGTTAGTGAACGCTAATCAATACTCACCC
TGTGTATCCATTGTCCCATCCACTGTGTGGGAAGACGGTGATTATTATAGGAAACAACTATCTCCACTTG
AAGGTGGTGGCTGGCTTGTTGCTAGTGGCTCAACTGTTGCCATGACTGAGCAATTACAGATGGGCTTTGG
TATTACAGTTCAATATGGTACAGACACCAATAGTGTTTGCCCCAAGCTTGAATTTGCTAATGACACAAAA
ATTGCCTCTCAATTAGGCAATTGCGTGGAATATTCCCTCTATGGTGTTTCGGGCCGTGGTGTTTTTCAGA
ATTGCACAGCTGTAGGTGTTCGACAGCAGCGCTTTGTTTATGATGCGTACCAGAATTTAGTTGGCTATTA
TTCTGATGATGGCAACTACTACTGTTTGCGTGCTTGTGTTAGTGTTCCTGTTTCTGTCATCTATGATAAA
GAAACTAAAACCCACGCTACTCTATTTGGTAGTGTTGCATGTGAACACATTTCTTCTACCATGTCTCAAT
ACTCCCGTTCTACGCGATCAATGCTTAAACGGCGAGATTCTACATATGGCCCCCTTCAGACACCTGTTGG
TTGTGTCCTAGGACTTGTTAATTCCTCTTTGTTCGTAGAGGACTGCAAGTTGCCTCTTGGTCAATCTCTC
TGTGCTCTTCCTGACACACCTAGTACTCTCACACCTCGCAGTGTGCGCTCTGTTCCAGGTGAAATGCGCT
TGGCATCCATTGCTTTTAATCATCCTATTCAGGTTGATCAACTTAATAGTAGTTATTTTAAATTAAGTAT
ACCCACTAATTTTTCCTTTGGTGTGACTCAGGAGTACATTCAGACAACCATTCAGAAAGTTACTGTTGAT
TGTAAACAGTACGTTTGCAATGGTTTCCAGAAGTGTGAGCAATTACTGCGCGAGTATGGCCAGTTTTGTT
CCAAAATAAACCAGGCTCTCCATGGTGCCAATTTACGCCAGGATGATTCTGTACGTAATTTGTTTGCGAG
CGTGAAAAGCTCTCAATCATCTCCTATCATACCAGGTTTTGGAGGTGACTTTAATTTGACACTTCTAGAA
CCTGTTTCTATATCTACTGGCAGTCGTAGTGCACGTAGTGCTATTGAGGATTTGCTATTTGACAAAGTCA
CTATAGCTGATCCTGGTTATATGCAAGGTTACGATGATTGCATGCAGCAAGGTCCAGCATCAGCTCGTGA
TCTTATTTGTGCTCAATATGTGGCTGGTTACAAAGTATTACCTCCTCTTATGGATGTTAATATGGAAGCC
GCGTATACTTCATCTTTGCTTGGCAGCATAGCAGGTGTTGGCTGGACTGCTGGCTTATCCTCCTTTGCTG
CTATTCCATTTGCACAGAGTATCTTTTATAGGTTAAACGGTGTTGGCATTACTCAACAGGTTCTTTCAGA
GAACCAAAAGCTTATTGCCAATAAGTTTAATCAGGCTCTGGGAGCTATGCAAACAGGCTTCACTACAACT
AATGAAGCTTTTCAGAAGGTTCAGGATGCTGTGAACAACAATGCACAGGCTCTATCCAAATTAGCTAGCG
AGCTATCTAATACTTTTGGTGCTATTTCCGCCTCTATTGGAGACATCATACAACGTCTTGATGTTCTCGA
ACAGGACGCCCAAATAGACAGACTTATTAATGGCCGTTTGACAACACTAAATGCTTTTGTTGCACAGCAG
CTTGTTCGTTCCGAATCAGCTGCTCTTTCCGCTCAATTGGCTAAAGATAAAGTCAATGAGTGTGTCAAGG
CACAATCCAAGCGTTCTGGATTTTGCGGTCAAGGCACACATATAGTGTCCTTTGTTGTAAATGCCCCTAA
TGGCCTTTACTTCATGCATGTTGGTTATTACCCTAGCAACCACATTGAGGTTGTTTCTGCTTATGGTCTT
TGCGATGCAGCTAACCCTACTAATTGTATAGCCCCTGTTAATGGCTACTTTATTAAAACTAATAACACTA
GGATTGTTGATGAGTGGTCATATACTGGCTCGTCCTTCTATGCACCTGAGCCCATTACCTCCCTTAATAC
TAAGTATGTTGCACCACAGGTGACATACCAAAACATTTCTACTAACCTCCCTCCTCCTCTTCTCGGCAAT
TCCACCGGGATTGACTTCCAAGATGAGTTGGATGAGTTTTTCAAAAATGTTAGCACCAGTATACCTAATT
TTGGTTCCCTAACACAGATTAATACTACATTACTCGATCTTACCTACGAGATGTTGTCTCTTCAACAAGT
TGTTAAAGCCCTTAATGAGTCTTACATAGACCTTAAAGAGCTTGGCAATTATACTTATTACAACAAATGG
CCGTGGTACATTTGGCTTGGTTTCATTGCTGGGCTTGTTGCCTTAGCTCTATGCGTCTTCTTCATACTGT
GCTGCACTGGTTGTGGCACAAACTGTATGGGAAAACTTAAGTGTAATCGTTGTTGTGATAGATACGAGGA
ATACGACCTCGAGCCGCATAAGGTTCATGTTCACTAATTAACGAACTATTAATGAGAGTTCAAAGACCAC
CCACTCTCTTGTTAGTGTTTTCACTCTCTCTTTTGGTCACTGCATCCTCAAAACCTCTCTATGTACCTGA
GCATTGTCAGAATTATTCTGGTTGCATGCTTAGGGCTTGTATTAAAACTGCCCAAGCTGATACAGCTGGT
CTTTATACAAATTTTCGAATTGACGTCCCATCTGCAGAATCAACTGGTACTCAATCAGTTTCTGTCGATC
TTGAGTCAACTTCAACTCATGATGGTCCTACCGAACATGTTACTAGTGTGAATCTTTTTGACGTTGGTTA
CTCAGTTAATTAACGAACTCTATGGATTACGTGTCTCTGCTTAATCAAATTTGGCAGAAGTACCTTAACT
CACCGTATACTACTTGTTTGTACATCCCTAAACCCACAGCTAAGTATACACCTTTAGTTGGCACTTCATT
GCACCCTGTGCTGTGGAACTGTCAGCTATCCTTTGCTGGTTATACTGAATCTGCTGTTAATTCTACAAAA
GCTTTGGCCAAACAGGACGCAGCTCAGCGAATCGCTTGGTTGCTACATAAGGATGGAGGAATCCCTGATG
GATGTTCCCTCTACCTCCGGCACTCAAGTTTATTCGCGCAAAGCGAGGAAGAGGAGCCATTCTCCAACTA
AGAAACTGCGCTACGTTAAGCGTAGATTTTCTCTTCTGCGCCATGAAGACCTTAGTGTTATTGTCCAACC
AACACACTATGTCAGGGTTACATTTTCAGACCCCAACATGTGGTATCTACGTTCGGGTCATCATTTACAC
TCAGTTCACAATTGGCTTAAACCTTATGGCGGCCAACCTGTTTCTGAGTACCATATTACTCTAGCTTTGC
TAAATCTCACTGATGAAGATTTAGCTAGAGATTTTTCACCCATTGCGCTCTTTTTGCGCAATGTCAGATT
TGAGCTACATGAGTTCGCCTTGCTGCGCAAAACTCTTGTTCTTAATGCATCAGAGATCTACTGTGCTAAC
ATACATAGATTTAAGCCTGTGTATAGAGTTAACACGGCAATCCCTACTATTAAGGATTGGCTTCTCGTTC
AGGGATTTTCCCTTTACCATAGTGGCCTCCCTTTACATATGTCAATCTCTAAATTGCATGCACTGGATGA
TGTTACTCGCAATTACATCATTACAATGCCATGCTTTAGAACTTACCCTCAACAAATGTTTGTTACTCCT
TTGGCCGTAGATGTTGTCTCCATACGGTCTTCCAATCAGGGTAATAAACAAATTGTTCATTCTTATCCCA
TTTTACATCATCCAGGATTTTAACGAACTATGGCTTTCTCGGCGTCTTTATTTAAACCCGTCCAGCTAGT
CCCAGTTTCTCCTGCATTTCATCGCATTGAGTCTACTGACTCTATTGTTTTCACATACATTCCTGCTAGC
GGCTATGTAGCTGCTTTAGCTGTCAATGTGTGTCTCATTCCCCTATTATTACTGCTACGTCAAGATACTT
GTCGTCGCAGCATTATCAGAACTATGGTTCTCTATTTCCTTGTTCTGTATAACTTTTTATTAGCCATTGT
ACTAGTCAATGGTGTACATTATCCAACTGGAAGTTGCCTGATAGCCTTCTTAGTTATCCTCATAATACTT
TGGTTTGTAGATAGAATTCGTTTCTGTCTCATGCTGAATTCCTACATTCCACTGTTTGACATGCGTTCCC
ACTTTATTCGTGTTAGTACAGTTTCTTCTCATGGTATGGTCCCTGTAATACACACCAAACCATTATTTAT
TAGAAACTTCGATCAGCGTTGCAGCTGTTCTCGTTGTTTTTATTTGCACTCTTCCACTTATATAGAGTGC
ACTTATATTAGCCGTTTTAGTAAGATTAGCCTAGTTTCTGTAACTGACTTCTCCTTAAACGGCAATGTTT
CCACTGTTTTCGTGCCTGCAACGCGCGATTCAGTTCCTCTTCACATAATCGCCCCGAGCTCGCTTATCGT
TTAAGCAGCTCTGCGCTACTATGGGTCCCGTGTAGAGGCTAATCCATTAGTCTCTCTTTGGACATATGGA
AAACGAACTATGTTACCCTTTGTCCAAGAACGAATAGGGTTGTTCATAGTAAACTTTTTCATTTTTACCG
TAGTATGTGCTATAACACTCTTGGTGTGTATGGCTTTCCTTACGGCTACTAGATTATGTGTGCAATGTAT
GACAGGCTTCAATACCCTGTTAGTTCAGCCCGCATTATACTTGTATAATACTGGACGTTCAGTCTATGTA
AAATTCCAGGATAGTAAACCCCCTCTACCACCTGACGAGTGGGTTTAACGAACTCCTTCATAATGTCTAA
TATGACGCAACTCACTGAGGCGCAGATTATTGCCATTATTAAAGACTGGAACTTTGCATGGTCCCTGATC
TTTCTCTTAATTACTATCGTACTACAGTATGGATACCCATCCCGTAGTATGACTGTCTATGTCTTTAAAA
TGTTTGTTTTATGGCTCCTATGGCCATCTTCCATGGCGCTATCAATATTTAGCGCCGTTTATCCAATTGA
TCTAGCTTCCCAGATAATCTCTGGCATTGTAGCAGCTGTTTCAGCTATGATGTGGATTTCCTACTTTGTG
CAGAGTATCCGGCTGTTTATGAGAACTGGATCATGGTGGTCATTCAATCCTGAGACTAATTGCCTTTTGA
ACGTTCCATTTGGTGGTACAACTGTCGTACGTCCACTCGTAGAGGACTCTACCAGTGTAACTGCTGTTGT
AACCAATGGCCACCTCAAAATGGCTGGCATGCATTTCGGTGCTTGTGACTACGACAGACTTCCTAATGAA
GTCACCGTGGCCAAACCCAATGTGCTGATTGCTTTAAAAATGGTGAAGCGGCAAAGCTACGGAACTAATT
CCGGCGTTGCCATTTACCATAGATATAAGGCAGGTAATTACAGGAGTCCGCCTATTACGGCGGATATTGA
ACTTGCATTGCTTCGAGCTTAGGCTCTTTAGTAAGAGTATCTTAATTGATTTTAACGAATCTCAATTTCA
TTGTTATGGCATCCCCTGCTGCACCTCGTGCTGTTTCCTTTGCCGATAACAATGATATAACAAATACAAA
CCTATCTCGAGGTAGAGGACGTAATCCAAAACCACGAGCTGCACCAAATAACACTGTCTCTTGGTACACT
GGGCTTACCCAACACGGGAAAGTCCCTCTTACCTTTCCACCTGGGCAGGGTGTACCTCTTAATGCCAATT
CTACCCCTGCGCAAAATGCTGGGTATTGGCGGAGACAGGACAGAAAAATTAATACCGGGAATGGAATTAA
GCAACTGGCTCCCAGGTGGTACTTCTACTACACTGGAACTGGACCCGAAGCAGCACTCCCATTCCGGGCT
GTTAAGGATGGCATCGTTTGGGTCCATGAAGATGGCGCCACTGATGCTCCTTCAACTTTTGGGACGCGGA
ACCCTAACAATGATTCAGCTATTGTTACACAATTCGCGCCCGGTACTAAGCTTCCTAAAAACTTCCACAT
TGAGGGGACTGGAGGCAATAGTCAATCATCTTCAAGAGCCTCTAGCTTAAGCAGAAACTCTTCCAGATCT
AGTTCACAAGGTTCAAGATCAGGAAACTCTACCCGCGGCACTTCTCCAGGTCCATCTGGAATCGGAGCAG
TAGGAGGTGATCTACTTTACCTTGATCTTCTGAACAGACTACAAGCCCTTGAGTCTGGCAAAGTAAAGCA
ATCGCAGCCAAAAGTAATCACTAAGAAAGATGCTGCTGCTGCTAAAAATAAGATGCGCCACAAGCGCACT
TCCACCAAAAGTTTCAACATGGTGCAAGCTTTTGGTCTTCGCGGACCAGGAGACCTCCAGGGAAACTTTG
GTGATCTTCAATTGAATAAACTCGGCACTGAGGACCCACGTTGGCCCCAAATTGCTGAGCTTGCTCCTAC
AGCCAGTGCTTTTATGGGTATGTCGCAATTTAAACTTACCCATCAGAACAATGATGATCATGGCAACCCT
GTGTACTTCCTTCGGTACAGTGGAGCCATTAAACTTGACCCAAAGAATCCCAACTACAATAAGTGGTTGG
AGCTTCTTGAGCAAAATATTGATGCCTACAAAACCTTCCCTAAGAAGGAAAAGAAACAAAAGGCACCAAA
AGAAGAATCAACAGACCAAATGTCTGAACCTCCAAAGGAGCAGCGTGTGCAAGGTAGCATCACTCAGCGC
ACTCGCACCCGTCCAAGTGTTCAGCCTGGTCCAATGATTGATGTTAACACTGATTAGTGTCACTCAAAGT
AACAAGATCGCGGCAATCGTTTGTGTTTGGCAACCCCATCTCACCATCGCTTGTCCACTCTTGCACAGAA
TGGAATCATGTTGTAATTACAGTGCAATAAGGTAATTATAACCCATTTAATTGATAGCTATGCTTTATTA
AAGTGTGTAGCTGTAGAGAGAATGTTAAAGACTGTCACCTCTGCTTGATTGCAAGTGAACAGTGCCCCCC
GGGAAGAGCTCTACAGTGTGAAATGTAAATAAAAAATAGCTATTATTCAATTAGATTAGGCTAATTAGAT
GATTTGCAAAAAAAAAAAA

>gi|556333860|ref|NC_022643.1| Betacoronavirus Erinaceus/VMC/DEU/2012 isolate ErinaceusCoV/2012-216/GER/2012, complete genome
GATTAAAGAGAATAGCATAGCTATCCCTCTCTCTCCGTTCTCTTGTAGAACTCTTGTTTTAACGAACTTA
ATTAAAAGCCCTTATACTTTGTCTAGGTAGTGGCATTAGTGCCAGACCTATGCATTGTAGTGGGTTTAGT
AAAAACTAAATTCATATTTTTCATTTAGAGCTGCGTGTCTCAAGTGCGTCTCGGTCACAATATACTGTTC
CGTCAGGTGCGTGACAATCCGGGGCTCATCATGTCTTCCGCGACTGGTGAGGGTTCTCAAGGTGCGAGGG
CCACGTATAGAGCAGCGCTCAACAATGAAAAACGTCATGACCATGTTGCCCTAACTGTGCCATGTTGTGG
TACAGGGGCTAAGGTTACAGCTCTTTCACCTTGGTTCATGGATGGCGTAGTAGCCTATGAAACCGTGAAG
GAAATGCTATTAAAAGGAGAAAATCTCCTGTTCGCTCCAATTAATTTGAGCGGTTTTATCAAGTTTCTCC
CAGGCCCACGTGTTTACCTGGTTGAGAGGCTTACTGGAGGTACTTACTCCGAACCATTTATTGTTAACCA
ATTGGCTTTTTCCGATGAGCAGGATGGTCCTATGATGGGTACTACTCTGCAGGGCAAACCTATTGGATTT
TTCTTTCCTTTTGATGAAGAGCTTGTTACAGGTACTTATACCTTCAAGCTACGTAAGAATGGACTTGGTG
GACAATTGTTCCGCGAAGTTCCTCGGTTTGAGAACCATGATTTTCATGGTATTGAAGGTTTTTCTCAGAT
TGTTGAAGACTTACAGGAGGATCCTAAAGGAAAGTTTTCTAACAAGCTGTATAAGAAGTTGTGTGGTGGT
GATGTCACACCTGTGGATCAATACATGTGTGGTTTTGATGGGTCGCCTATCAAACCATATCTGGATCTAG
CCAATAAAGAAGGTTTAATAAAGTTGGCAGACGTTGAAGCTGATGTTCGTTCACGTGTGGATAAACATGG
TTTTCTCATTTTTAAAGGAACAACATATAGAGTTGTTTGGTTTACTGAGCGCAAGAACGTTGATTATAGT
AAACAAACGCTCTTTACAGTGAACTGTGTGGTGCAACGTAATGGTGTTCAAGATGTACCAGCACACCCTT
TCACTCTAGGAGGACGAGTGGATCAACTTAAACCGCATGTCGCTAAAGGCAACCTAGTGGGCCTTACATT
GAAAGCAAAAATTTTGTATACAATGTATGGTGAAGATGCTGTTGAAGAACCTTCTTATATTTACCACTCT
GCCTTTGTGGATTGTGGTAACTGTAATGAAGGTAAGTGGTGTACAGGTAATGCTGTGGCTGGATTTGCAT
GTGAATGTGGAGCATCTTACACTGCTAGAGATGTGCTCTTACAATCTTCAGGATTAGTAAAACCTAATGC
CTTGTTTTGCGCAACATGTCCCTTTGCAGAAGGAGATCGTTGTTCTTCAGAGTGCAAACACACTACACCT
CAAATCGTTAGCCATTTGAGCGAAAAGTGTGTTGTTTTTCCATCAGGCAAGAGCTTTGTGCTAGCATTTG
GCGGCGCTTTGTTCACATATATGGGTTGTGCAGAGGGTACTATGTATTTTGTACCTAGAGCAAAATCAGT
TGTTTCAAGAATTGGCACAGCTTGTTTTACAGGATGTGTTGGTGCTTGGGATAAAGTGCAACAAGTGGCA
AATCTCTTTACACAGAAAGCACAGCAGCAGTTGAACTTCGTTAATGAATTTGTTGTCAGTGATGTGGTGT
TAGCTATTTTAACTGGCACCACATCTACATTGGATGAGTTACGCAGTCTTTTGCAGGGCATTACCTTTGA
AAAGATGCGTGATTATTGTGTCAAACATGGTATTAAGGTTACCATGGGAGATTATGTGGATAGTGCTATT
AATGTAGGAGGCGCTAGTGTGAGGTCTGCTGCTATTAATGCACCTTTTGTAGTCTTATCAGCACTTGGTG
AGTCCTTTAAGAAAATTGCCGCCGTACCGTTTAAAGTTGGCAGTTCATTTTTAAAGACATGGGAGTATTT
GTCAGACTGTATTGTCTATAGAGTACTCCCTTATGAGTTGGAAGATGTGTCTGACTTTGTACAGTTGCTG
TTTAATTGTGTTGAAATTTCAGCCGCATCAATGTATTTTGCATCGGTTGTTATTAGAGAAAAAGTTAACA
CGATGTTTAATGCATTACCCTTGTCTGTTCAAACAGCTGCAGATAACATTATTGATGTTTGTTTGCGTGC
TACATTATGCACTGTAAAATTTTTAAATGATCTGTTGAGCCTTGTTAAACTGGTGGTTTGTAAGGCTTTT
GTGTACACCAATGCGGGATTCATGTCAACGCTGGAGAAAACTTCACCAGCAGCGCAAAAGTTGCTGGATG
TTTTGTCTAAGGCATTTAAATTGCTGCATAAGAAAGTTTCATGGGCTGGTTCAAAAGTCCATGCCGTTAT
TTATGAAGGTAAAGATGCCTTAGTGTTTTCTTCTGGAACATATCATTGTGTAACAGCACCTGGAAGTGTT
GTAGGCGCACATCTTGATGCCACAATACCAGGTGAAGTTGTTAAGAAGCAGCTTTCCATGTTGACTGCTA
CAAATTATTCAACTACTGTTGATGTTAGGCCTAGGACTAGAAGTGTAGAATTGGTTTATGGCCAATTGGA
AACAACTAATATGCATAGTCCAGACGTTGTTGTTGGGGATTATGTTATTATTAGTGATAAGGTTTTTGTA
CGTAGTGAGGAAGATGGACAATTAGCATTCTATCCTATGTGCACAAATGGCAAGGCAGTACCATGTATGT
TTACACTTAAGGGTGGTGCACCTATTAAGAAAGTCTCTTTTGGTAATGATGAAGTTCATGAAATTGACTC
TGTTAGAACAGTTACAGTTGAGTATAACATACATCCTGTTTTGGATACTCTTCTTAGTAACACAGAACTT
AAGACTTTTGTTGTAGATAAAGATCTTACAGTATCAGAATTTGCATTTGTCGTACAAGAGGCTGTTGCTG
ATCTGTTAGCTAAGCTTCTTCGCGGCATAGCGTTAGATGATTTTGATTTGGAAGATTTTGTAGATACCAA
AGTTTATGTTTTTAATTTAGATGGTGATGAAGTTTGGAAATCTACTATGATTTTCTCTGTTCATCCAGTT
GATTGTGATGATGAGGAAATAGATGATGCTCTGGAAGAGGACGATTCTTTCAATGAGGAAGAGGAATCAG
ATTCTTGGGCTGAAATGGTTGATGCTATATTCCCCTTGAGTGATGAAGCAGAGGGTGATGTAGCTGTAGA
AGAACAATCTCTAGTTGATGATGCAGGTGTAGTCTCACCGTCTGCGGCGGCGGAAAAAATAGTGCCAATG
CATGATGTAAGTGATGACTCTGCTTCAAACAATGAAGAGAGTGTGTGTGCAGATGTTGAGCCGAAAGGAG
TTGCACCGCCAGTAGAGGATGTAATTGTAGAGACTAAAGTACCTACAACGCCAATATTGGAAGAAAGTGA
CAACCCGGTGCTTGCTGAAGCAGACAGTTCACAGCAGTCAGATTGTGTAGAACATTCTGTGGTAGTAGAA
ACTACAAACACACCAGAGGTTTGTGTTGATGTAGAACATTGTGGGGTTGATCAAATTAGTGAAGAAGTGC
CGAAAGGAGCTGCACCGCCTGCCATGGAAGAGGAAAAGCCAAGTCAGGAAGTAAGTGTGAGCCCAGAGCC
ATCACTTAAAGAGGATAAACCGCACGAGGATTGCCAGCAACAGTTGGCTGATAAAAAACAACTTGTAGAA
GTTGTTAGTGATGATCAAATAGATCCTCTTAAAAATTATAAACATAAAGTTTTGAGTGGCAATGTCACTA
TTGTATTAGCAGATGCTATTAAATTGGCGAAGTGTTTTTCTACTAGTGTGTTGGTGAATGCTGCTAACAG
TCATTTAAAACATGCAGGTGGTATAGCACATGCAATTGATAGTGCATCTAAAGGTGCTGTTCAAAGAGAG
TCTGATGACTATATTAAGAATAATGGCGCATTACAAGTTGGTGACGCTGTTTTACTTAAAGGGCATGGCT
TAGCGAAGCATATTTTGCATGTAGTGGGCCCTGATGCAAGGCAAGGACAGGATGTAACATTGCTTTCTAA
ATGCTATAAGGCTATGAATGCGCATCCTTTAGTTGTTACACCATTAGTGTCAGCAGGCATTTTTGGTGTT
GACCCTAAAGTCTCTTTGCAAATGTTACAGCAGGTTGCAAAGACTAGGTTTCTGGTCTGTGTAAACTCTG
CTAATACATATGAAGAGTTAACAAAGGTGGTAATACCACAAGGTCTAACTTTTTCATTTGAGGGCATGAA
GAGTGCTGTTAGTAAGGCCAAAGAATACGGATTCACCATGTTCATTTGTGTTGATAATAAACAGAATCTT
AAGCTGTTAAAAACATTAGGTGTTAAAGTTGATAAGAAACAGTCCACTGTGAACGGTGTTAGGTATTATT
GCTATACTTCTGAAGACACCGTACCTAATTTAGTGGCTGTAGCTAATAAACAAAAAGGTATTGTAGCTTT
ACCTTTGGGTTATGTTACTCATGGGTTTGATTTAATGCAAGCAGCTGCGATAGTTAAAATGGTAACAGTG
CCATATGTGTGTCTGCTTGCTAATAAAGAGCAATTGGCTATACTTCAAGGTCATGTGTTGAAGAGTACGC
CATTTGAAGAATTTGTCAGTGGCATCAAGGATAATGGTTATGCACACTGGCAATTAGTGCAAGGTGAAAT
AATAGTTAATGGTGTTTCATACAGTAAGTTGTTACAATGGTCTGATCAAACTGTTGTGTACAGTTGTAGT
AAATTGTTTGTTTTAAAGAATGGCATTTTATTGCCCTTCAAAAGTGTGGAACAGTGTCGTTCATATTTGA
ATTCTAGAACGACGCAACAGTTAGACATCGAGGTGCTTGTCACTGTTGATGGTGTTAATTTTAGAACTGT
TATTCTAAATAATAAGAACACCTTTAGAAGCCAACTGGGTACAGTGTTTCTAGACGGTGTAGATGTGTCT
GATACCATACCAAGTGTGGATAAGAATGGTGCCAGTATGTATATTGCAGATAATTTTTCTAAGGAAGAAT
TAGCTGCAGTTAAAGAAACGTATGGCGTTGAAGATCCAGCGTTTTTATATAAGTATTATTCCATTCGTGC
CAAGGTAATAAAATGGAAAATGGCTATGTGTGAGGGTTCACCTTCTCTCTGTCTTAACAGTAATAATTGC
TATTTGAATGCGGCGGTTATGATGTTGGATTGCTTGAGAGATGTTAGATTTAATATACCAGCTTTGCAGT
CTGCGTATATGAAATTTAAAGGTGGTGATTTTGGAGATTTTATATCTCTTTTAATGGCATATGGTAATTG
TACATATGGACAACCAGATGATGCATCTATGCTTCTTCACACCGCGCTATCTAAAGCAGAACTTTTAGTA
TCTGCACGTATGGTGTGGCGTGAGTGGTGTGATCATTGTGGTGTTAAGGATGTTGTAATAACTGGTATTA
AGGCCTGTGTCTATGTAGGAGTGCAGACTCTAAACGAGTTAAGAGAGTGCAATCATTATATTTGCCAGTG
TGGTGGTGTCCGATTCAGACAATTAGTAGAATGTGTAACACCCTGGCTTTTATTATCTGGGCCTCCAAAT
GAGGAATTGGTTGCGAATCCAGATTTTGTGGCTTTTAACGTCTTTATAGGGCATGCGACAGGTGTAGGAC
ATTTTGTGCATGCTCGTGTAAAAAAAGGATTGTTATATAAGTATGATTCTGGTACCTTAACTAAGGCCTC
AGATTGGAGGTGTAAAGTTACCGATAAGTTATATCCAGGCCAGAAGTATACAGCAGAATGCGAAATCGTT
GTATATTCTTTGGATGGTAATCAGAAAGCTGAAAAACAACCAGACCTTTCAGCTTATTATGTTAAAGATG
GCAAGTATTATACTAATAAACCATCTTTGGAGTTTACACCAGCAACATTTGCTAGTGGTGTTGTTTATAC
CAATAGTTGTTTCATCGTTAAAGATGATGATAATATTGGTCATGCTTTTAATAAACTTTTAGGGTTCGAT
AAAAATAAACCTGCATCTAAACAATTAACATATTCATTGCTTCCTAATGAGGAGGGCGATGTTTTATTAG
CAGAGTTTAAGTCTTATGATCCCATGTATAAAAATGGTGCTGCATATAAGGGCAAGCCCATTTTGTGGGT
TAATAATGGTTTATATGATAGCAAGCTTAATAAGTATAACAGAGCTTCGTTACGTCAAATATTTGACATA
CAGCCTGTTGAAACTAAGAATAGGTTTGCGTCACTCAAAGTAGAAGAGGTTGATGAAAGACCTACTTCCC
TTGTTCAAGAAGAGACCGTAGTGTCTGAGAAAAGTGAGCTAAAGATTGTTAAGTGCAAAGGTCTTTCTAA
ACCATTTGTTAAAAACGGCTTTAGCTTTATTTCAGATGATAAAGGTATTCTAACAGTTGAATATCTTACA
AAGGAAGATATGCATACTTTGTATGTGAATCCTAAGAGCCAAATAATAGTTTTAAAAGACAACTGGTTGT
CTGGCTTATTCCAGATGCATACTGTACAGAGTGGTGATCTAAATGTTATAGCATCTTCAGGTTCTTTAAC
AAAGAAAGTTAAGCTGTTATTTAAAACTTCCTCTATGTGTAAAGAATTTTTAAGTCGTACTTTTGTAGCC
ACTAAGTGTGTCAATAGTGTTGTATCTTCAACAGTACGAAAAATTTGTTGTAATAAAGATATCTTTTTGA
AAGCATTTAGTTTCATTAAGATTTTATGCTTCGTACCGCTTAGGCATTTTAATAAACAAAAAGAGTGTAT
CAATGTAGATGTTAACGCTCTTTCTATAGCTGGTGTTGTAACAGGCAATGTAATCAAACAGTGTTGTAGC
ACCGGCTTTTATTTGTTTAAACAAAAGTTACGTCGCATAGATTGGAAAGCATCTTTGCGTTGGTTACTTT
TTATGTTAACAACTGTGGTCATGTTGTTTTCTGTGTATCATTTGTATGTATTCAATGCAGTGCTTACAAG
TGATGTTATTAAAGAGGTAAACACAGGTATTAAAGGTGTCTATTATAGAATAAGCTCCTACCTAGGTGTT
ACTTCTGTTTGTGATGGATTTTCAAATAATTATCGGAATGTTAGTTTTAATAGAGATGATTATTGTGAAA
AGTTTGGGTATGTGTGTCATTGGTGTCTAATGGGACAAGACTCGCTCACTCATTATAGCGCAATTCAAAT
AGTTCAAACCAATTTAAGCCACTATGTTTTAAGCATAGATTGGATGTGGTTTTGGATAGAATTGAGCGTT
GCTTATTTGATGTACACGCCAGCATTCAATTGGGTTTTGCTTGTCTGTACATTACAATACTTCTTTAGCC
AAACTAACCATATTATAAATTGGAGGTCTTATAATTTTGTTATGTCTGGCGTTTATTTATTAACCACATA
CATTCCCTTGTGTGGTCTTCTTAGAGTCTATAATGTGCTAGCCACCCTTTGGTATTTGCGTAGGTTTTAT
AACCATGTAATTAATGGGTGTAAAGATACTGCTTGCATGTTATGTTATAAGAGGAATCGTTTAACACGTG
TTGAAGCTTCTACCGTCGTTTGTGGTGTGAAACGTACGTTTTATATTACAGCTAATGGCGGTATATCTTT
CTGCAGTAGACATAATTGGAATTGTGTGGATTGCGACACCACAGGTTTAGGGCACACCTTCATCTGTGAA
GAAGTCGCTAATGATCTTACAACATCTCTACGCAGACTTGTTAAACCCACTGATAGGTCACATTATTATG
TGGAATCAGTTGAGGTTAAAAATTCTGTAGTACAGCTTAATTATACTAGAGATGGTCAACTATGCTATGA
GCGAGTCCCACTCTGTAACTTTAGTAATATAGACAAATTTAAGTTCAAAGAGGTTTGTAAATCAACTACG
GGTATACCTGAATTTAATTTTGTTATATATGATTCTACCGATCGTGGCCAAGAAAATTTAGCTAGGTCGG
CATGTGTTTATTATTCACAAGTTTTGTGTAAGTCTATTCTTTTAGTAGACTCAAACCTTATGAATACTGT
TGGTGACTCTAGTGCGATTGCCATCAGATTGTTGGATTCCTTTATTAATAGCTTTGCTAGTCTTTATAAT
GTTTCTAGAGATAAGTTGGAGAAATTGATTTCTACAGCTAAGGATTGTGTTAAAAGAGGTGAAGACTTGC
AGAGTGTCCTTAAAACATTCATACAAGCTGCACGTGTGCATGCTAATGTTGAGTCTGATGTTGAGACTGC
TAGTATAGTTGATGGTATACAATATGCTCATAAAAATGATATTGAGCTGGTTACTGATTCATTTAATAAT
TATATACCATCCTATGTTAAACCTGATAGTATAGCAACTGTAGATTTAGGTTGTCTTATAGATTTGAAAG
CTGCATCAGTTAATCCCGCTAGCATGAGAAATGCTAATGGCGCGTGCGTGTGGAATATTGATGCATATTT
AAAACTGTCCGATTCTCTAAAAAGACAAATTAGAGTGGCATGTCGGAAGTGTAGTCTTAACTTCAAGTTA
ACAACTTCGAAGCTTAGAGCACAAGACAATATATTGTCTGTTAAATTTAGTGTAACCAAATTTGTTGGTG
GTTCTTTAAATAGTAAATTGGGTTCATTTTTGTTTAAAATGTATGCTGGTTTTACTATTTGCTTAGTAAT
CCTTGCGATATTGATGTATTGCATTTTGCCTACATTTAATATGGCTAAAGTAGATTTTAATAATGATCGC
ATCCTTGGCTATAAAGTTTTGGATAATGGTATAGTAAGGGATATAGGTATAGATGACAAATGCTTTGTTA
ACAAGTATAACACATTTGATGCATGGTATCAGCAGGAATTTGGTAATAGTTATGATAATGATTACAATTG
TCCTGTTGTAGTTGCTGTAATAGCTGGCATTTCAGGCGAGAGAGTGCCAGGCGTGCCAACAAGTTTAATA
TGGGCTGGGAACCAAATATTGTTTTTTGTTTCTAGAGTCTTTGCAACTAATAGTAACATTTGTTATACAC
CTAGTATGGAAATTGCTTATGAAAAGTTTTCAGATAGTGGTTGTGTATTAGCAGCAGAATGCACCCTTTT
TAAAGATGCAGTAGGTAGTATGATACCCTATTGTTATGATGCTAATGTCTTACCTGGAGCTGTACCATAT
GACACTATGTTACCACATGTGAGATATGATCTTTATGATTCAAACATGTTTATTAAGTTTCCTGAAGTGA
TTGTTGAAGGCACACTCAGGGTAGTTAAGACCCTTAAGACCCAATACTGTAGACTTGGCAGTTGTGAATG
GTCTGAAGCAGGAATTTGTGTTAGCACAAATGGTTCATGGATGCTTAATAATGAGCATTATGCCAGTAAA
CCAGGTGTTTATTGTGGCAGTGATTATTTAGATATGGTAAGGCGTAGTCTTATGTTTTTGTTCCAGCCTA
TAACATATTTTCAATTAACCACATCTTTATTTATGGGTTTGTGTTTGTGTTTAGGAATTGTGGTAATTTT
CTATTATGTTAATAAATTTAAGAGGGCATTTGCAGATTATACACAGTGTGTTTTAATCGCTGTTATGGCC
ACAGGACTTAATGGATTATGCCTGTGTTTTGTCGCATCAAATCCATTTTTAATAGTACCTTATAGTGCAT
TTTATTATTATAGCACTTTTTATGTGACTAATGAACCAGCTGTTGTTATGCATGCATCTTGGCTTATAAT
GTTTCTGCCAGTAGCATCTGTATGGGTGGTTTGTTCATATCTAGCGGCTATTTGCTTTAGACACTGTTTT
TGGGTTTTGGCATATTTTAGCCGTAAGAAGGTAGATGTGTTTACAGATGGTAAACTCAATTGTACATTTC
AAGAAGCTGCAGCTAATATCTTTGTAGTTAACAGAGATACATATGTAGCCTTGCGAAATGCAATTAGTCA
GGATGCCTATAATAAGTATCTGGGTATGTTTAATAAGTATAAATATTTCTCAGGTGTTATGGATACTGCT
GCTTATAGAGAGGCTTCTGCTGCACATTTAGCTAAGGCTCTTCAAGTTTTTAGTGAGAATGGTAGTGACC
TCTTGTATCAGCCACCTAATTGTAGCTTAGCATCTAGTGTGTTACAAAGTGGTTTGGTTAAGATGGCACA
TCCTAGTGGTGCTGTTGAACAATGTATAGTTCAAGTTACTTGTGGCAGCATGACTCTTAATGGTTTGTGG
TTAGATAATATAGTTTATTGTCCACGCCATGTGATGTGCCCACAAGATCAATTAGTTGACCCTAACTATG
ATGCTTTGTTGAATTCTATGACTAATCATAGTTTCACTATACAGCGTCATGGTAGGTCAACAGCTAATTT
AAGATGTACAGGCCATGCTATGCATGGAACATTGTTAAAGTTGACTGTGGATTCTGCTAACCCAGAAACA
CCAGCTTATACTTTCACTACCATAAAGCAGGGTAGTTCTTTTAGTGTGTTAGCGTGCTATAATGGGCGTC
CATCAGGCACATATACAGTTGTAATGAGACCCAATAGCACAATTAAAGGTTCTTTTCTTTGTGGTTCTTG
TGGTAGTGTTGGTTATGTTAAGGAAGGTAATGTAATCAACTTTTGTTATATGCACCAAATGGAGTTGGCT
AATGGTACACATACTGGGTCTTCATTTGATGGTAAGATGTATGGTAATTTTCAGGATAGGCAAATTTACC
AGGCACAATTATCAGACAAACACTGCACTATAAATGTGGTGGCTTGGCTCTATGCAGCTGTATTAAATGG
TTGTAATTGGTTTGTTAAGCCAAATAAGACTGGTGTTGCAGCTTTTAATGAATGGGCTTTGTCTAATCAA
TTTACTGAATTTGTAAGTACACAGGCTCTAGAATTATTGGCTGTAAAAACTGGTGTTCAGATTGAACAGC
TATTGTATTCTATACAACAATTGAATAATGGCTTCCAAGGTAATGTTATACTTGGTAGTACAATGCTGGA
AGATGAGTATACACCTGAAGATGTTAATATGCAAATGATGGGTGTAGTAATGCAGAGTAGTGTTAGAAAA
ATTACTTATGGGTTTACACATTGGCTTCTAGCAACTTGTGTATTAACCTATGTTGTAATTTTACAACTTA
CTAAGTTTACAATTTGGAACTATTTGTTTAATGTTATACCATTACAATTGACTCCAATTATGTTTGTTGT
GTTGGCACTTGCTATGTTATGCGTTAAGCATAAACATGCATTTTTGACAACATTTCTATTACCTGGTGCA
CTATGTTTGACATATGCCAACTTAGTGTATGAGCCTAATACACCGGTTTCATCATTTTTGATCACGTTTG
TTAATTGGTTAAATCCTGATGGCACATATATGCGTACTACTCATATGGATTTGGGAGTTTACGTTAGTCT
TTGCCTAGCGCTATTAGTTGCAGTTAGGAGATTGTATAAACCATCAGTAACTAATTGTGCATTTGCTTTG
ACAAGCTTAGTTATGTGGTTTTATAGCTATAGTATAGGTGATGCATCGTCACCTATTGTTTATTTGCAGT
TTGTCACAGCAGCTACTAGTGACTATATGGTCACAGTGTTTCTAGCTGTGAATGTCGCTAAGTGCTTTGC
ATATCTTACCTCCATGTATTTTACAACTTTAAGTGTGGTTGTACCTGAAGTTAAGATAGTTTTATTAATG
TATATTTGTATAGGTTTTATCTGTACTATGTATTTTGGTGTCTTCTCATTTTTAAATCTTAAAATGCGCG
CACCTATGGGTGTTTATTCCTATGAAGTTTCTACGCAAGAGTTCAGGTATATGAATGCTAATGGACTTCG
AGCACCTAGAAACTCATGGGATGCTATGGTTTTGAATTTTAAATTGTTAGGTGTGGGTGGCGTACCTTGT
ATTAAAATTGCTAGTGTTCAATCTAAACTTACTGATTTAAAGTGTACATCAGTGGTATTGCTTTCAGTGT
TACAGCAGTTACATCTGGAAGCTAATAGTAAAGCTTGGAGTCATTGTGTCAAGCTACATAATGATATATT
ATCTGCAACAGACCCAAGTGAGGCTTTTGATAAATTTGTAGCTTTATTAGCAACATTAATGTCTTTTTCA
GGTAGTGTAGATTTAGATGCTTTAGCAAGTGAATTGTTAGACAATCCTAGTGTTTTGCAATCCACTTTAA
CAGAATTTTCACATCTGGCGAGTTATGCAGAGTTGGAAACTGCTCAAAAGTCTTACCAAGAAGCCATAGC
AGCAGGTGATGCATCACCGCAAATGCTGAAAGCTTTGCAGAAGGCTGTTAATGTGGCAAAAAATACTTAT
GAAAAAGATAAGGCTATTGCTAGAAAGTTAGAGCGCATGGCTGAACAAGCTATGACATCTATGTATAAGC
AAGCGCGTGCTGAAGACAAAAAGTCTAAAATAGTTAGTGCTATGCAGACTATGTTGTTTGGTATGATTAA
GAAGTTAGATAATGATGTTCTTAATGGTATCATTTCAAATGCTAGAAATGGGTGTGTACCACTTAGCATT
ATACCACTCTGCGCTTCTAATAAACTTAGAGTTGTAATTCCGGATATGCAAATCTGGAAACAGGTTGTAA
CGTACCCTGTATTATCGTATGCAGGTGCGCTTTGGGACATTACACTTATAAATAATGTTGATGGTGAAGT
GGTTAGGCCTTCTGATGTGGTAGATACCAATGAGAGTCTAACTTGGCCATTATTATTAGAATGCACTAGA
GCTGTAGCGTCTGCAGTCAAGTTGCAAAATAATGAGATTAAGCCTACAGGACTTAAAACTATGGTTGTAT
CAGCTGGTCAAGAACAAAATAGCTGTACTGTAAAGTCTGTAGCATACTACGAACCTGTACAAGGCCGTAA
GATGCTTATGGGTATATTGTCTGAAGATGCTCATTTAAAATGGGCAAGAGTTGAAGGTCAAGATGGTTTT
ATAACTATTGAGTTACAGCCACCTTGTAAATTTTTGATAGCAGGCAGTAAAGGTCCTGAAGTTAGGTATT
TGTATTTTGTTAAAAATTTGAATAATTTGCATAGAGGTCAGCTACTGGGACATATAGCTGCCACTGTTAG
ATTACAAGCTGGTTCTAATACAGAATATGCTTCAAATTCATCAGTATTGTCATTAGTGAACTTTGCTGTG
GATCCTGCTAGAGCTTATACAGATTATGTTAACGCTGGTGGTACACCGTTAACAAATTGTGTAAAGATGT
TAACTCCTAAAACAGGTACTGGCATAGCCATATCTGTTAAACCAGAGAGTAATTTAGATCAAGAAACTTA
TGGCGGAGCTTCAGTTTGTTTATATTGTCGTGCACATATAGAACACCCTGATGTATCTGGCGTTTGTAAG
TTCAAAGGCAAGTTTGTGCAAATACCTGCACAGTGTACACGTGACCCTGTAGGTTTTTGTTTGGCAAATG
TGCAGTGTAATGTCTGTCAATATTGGGTTGGTTATGGTTGCAATTGTGATTCTCTTAGAGAAAACACTAT
GCTCCATTCCAAAGACACTAATTTTTTAAACGAGTCAGGGGTTCTATTGTAGATGCCCGAATAGAACCCT
GTGCAAGTGGTCTTGCCACTGATGTCGTTTATAGGGCATTTGACATCTGCAACTATAAGGCAAGAGTTGC
TGGTATAGGAAAGCACTACAAGACGAATACTTGTAGGTTTGTTGAACTAGATGACCAAGGTCATAAGTTA
GACTCATATTTCGTAGTCAAAAGACATACGCTGGAGAATTATGAGTTGGAAAGGCATTGCTACGATTTGC
TAAAAGCTTGTGATTCAGTAGCAGCGCATGACTTTTTCGTGTTTGATGTAGATAAAACTAAAACACCACA
TATAGTCCGTCAACGTTTAACGGAGTATACCATGATGGATCTTGTTTATGCGCTTCGTCATTTTGATCAG
AACAATTGTGAAGTGCTTAAAACCATATTAGTGAGGTATGGTTGTTGTGAAGAATCATACTTTGATAATA
AGCTCTGGTTTGATTTTGTTGAAAACCCAGATGTAATACGTGTTTACCATAAGCTCGGTGAGTTAGTCAG
AAGAGCTATGCTAAGCACTGTTAAATTTTGCGACCACATGGTTAAGAGTGGTCTAGTGGGTGTTTTAACA
CTTGATAACCAAGATCTAAATGGAAAGTGGTATGATTTTGGTGATTTTGTAGTAACGCAGCCAGGTGCTG
GAGTAGCTGTAGTAGATAGTTATTATTCTTATTTAATGCCTGTGTTGTCTATGACTGACGCTTTAGCAGC
TGAGACACACAAGGATTGTGAACTTAGTAAACCACTCATAGAATGGTCTCTTTTAGATTATGATTTTACC
GATTATAAATTGTGTCTGTTTGAAAAATATTTCAAGCATTGGGATCAACCATATCATCCAAATTGTGTGA
ATTGTGTTGATGACCGTTGTATATTACATTGTGCTAATTTCAATGTATTGTTTTCAATGACACTACCTAA
AACCTGTTTTGGACCTTTGGTCAGAAAAGTTTATGTAGATGGAGTGCCATTTGTTGTATCTTGTGGTTAT
CACTATAAGGAATTAGGATTAGTTATGAATATGGATGTTAACATGCATAGTCATAGACTATCACTTAAGG
AATTGATGATGTATGCAGCTGATCCAGCCATGCATGTCGCTTCTTCCAATGCTTTATTAGATTTGAGGAC
ATCATGTTTTAGTGTCGCTGCTTTAGCTACAGGTTTAACATTTCAAACCGTACGGCCAGGCAATTTTAAC
CAGGACTTCTATGATTTCGTGGTCTCTAAAGGATTTTTTAAAGAAGGTTCATCTGTGACCTTAAAGCATT
TCTTCTACGCTCAAGATGGACATGCTGCTATTACAGATTATAATTATTATTCTTATAATCTGCCTACCAT
GTGTGATATTAAACAACTCTTGTTTTGTTTAGAGGTTGTTAATAAGTATTTTGATATCTATGATGGTGGA
TGCTTAAATGCCTCAGAAGTCATAGTTAATAATTTAGATAAAAGTGCTGGCTATCCTTTTAATAAGTTTG
GCAAAGCACGTGTTTATTATGAGAGTATGAGTTATCAGGAACAAGATGAGTTGTTTGCATTAACAAAGCG
AAATGTTGTTCCAACTATTACTCAAATGAATTTAAAGTATGCTATAAGTGCTAAGAATAGAGCTCGCACT
GTTGCTGGAGTGTCTATTCTTAGTACTATGACTAATCGCCAATACCATCAAAAGATGCTCAAGTCTATGG
CTGCCACTAGGGGAGCTACTTGTGTCATAGGAACTACTAAGTTCTATGGTGGTTGGGATTTTATGTTAAA
AACATTGTATAAAGATGTTGATAATCCAGAACTTATGGGCTGGGATTACCCTAAGTGTGATAGAGCTATG
CCTAATATGTGTAGAATTTTTGCATCATTGGTATTAGCTCGTAAACATAGCACATGTTGTACAAACAGTG
ATAGATTTTACCGCTTAGCTAATGAGTGCGCTCAAGTGCTAAGTGAATATGTACTTTGTGGTGGTGGTTA
TTATGTTAAACCTGGAGGCACTAGCAGTGGTGATGCTACCACAGCTTATGCAAATAGTGTTTTTAACATA
TTGCAAGCTGTCACTTCAAATGTTGGTGCTCTTATGGGTGCTAATGGTAATAAAATCATTGATAAGGAAG
TTAAAGATATGCAATTTGAATTGTATGTCAATATTTATAGAAATTCCAAACCGGATTTCAAGTTTGTAGA
TAAATATTATGCCTTTTTAAATAGGCACTTTTCAATGATGATACTTTCTGATGATGGTGTCGTCTGCTAT
AACAAGGATTATGCAGCGCGTGGTTACATAGCTGGCATACAGAATTTTAAAGAAACATTGTACTATCAGA
ACAATGTGTTTTTGTCAGAGGCTAAGTGTTGGGTGGAACCAGATATAGATAAAGGTCCACATGAGTTTTG
CTCTCAACACACACTATTAATAAAGGAAGGTGAAGACCACTATTTCTTACCTTATCCAGATCCCTCTAGG
ATTTTGTCTGCAGGTTGCTTTGTGGATGATATCATTAAGACTGATGGTACTCTCATGGTAGAGCGGTTTG
TGTCTTTGGCTATAGATGCTTACCCTCTAACAAAGCATGATAATATAGAATACCAAAATGTATTCTGGGT
CTATTTACAATATATAGAGAAATTGTATAAAGATCTTACAGGACATATGCTTGACACTTATTCTGTTATG
CTATGTGGTGATAATTCCTCAAAGTTTTGGGAAGAGCAGTTTTACAAAGATTTGTATAGTGCTCCAACAA
CTTTACAGGCTGTGGGCTCGTGTGTCGTGTGCCATTCACAAACATCTTTGAGGTGTGGTACATGCATACG
TAGACCGTTTTTATGCTGCAAATGTTGTTATGATCACGTTATAGCAACCCCTCATAAAATGGTTCTGTCA
GTTTCACCCTATGTTTGTAACGCACCAGGTTGTGATGTTTCAGACGTAACCAAATTATATTTGGGGGGTA
TGAGTTATTTTTGTGTGAACCATAAACCTATATGTTCATTCCCACTATGTGCCAATGGCTTGGTTTTTGG
TTTGTATAAGAACATGTGTACAGGTAGTGCATCCATTGCTGAATTCAATAGGTTGGCTACTTGTGATTGG
AGTGAAAGCGGTGATTATACACTTGCTAATACTACTACAGAACCTTTAAAATTATTTGCTGCTGAAACAT
TACGTGCTACTGAAGAAGCATCTAAGCAGTCTTATGCAATAGCCACCATCAAGGAAATTGTAGGTGAGCG
TGAATTAATTCTTGTGTGGGAGGCTGGTAAATCCAAACCACCACTCAACCGTAATTATGTTTTTACTGGT
TATCATATAACCAAAAATAGTAAGGTACAACTCGGAGAATATGTCTTTGAGCGTGTAGACTATAGTGAAA
CTGTCACTTATAAGTCAAGCACTACTTATAAGCTTTCTATAGGTGACATTTTTGTACTTACATCTCACTC
AGTGGCTACATTGACCGCGCCAACTGTAGTAAATCAAGAGAAGTATGTAAAAATAGTTGGATTGTATCCA
ACACTTACAGTACCAACAGAATTTTCTACTCATGTAGTTAATTTTCAAAAGGTCGGTTATAATAAATTTG
TCACTGTACAGGGACCACCTGGCACTGGCAAAAGTCATTTTGCTGTGGGTTTAGCTATATATTATCCTAC
AGCGCGTATTATTTTTACAGCATGCTCACATGCGGCAGTGGATGCATTATGTGAGAAAGCTTTTAAATAC
TTGAATATTGCCAAATGTTCACGTATCATTCCTGCCAAAGCACGAGTTGAGTGTTATGACAGGTTTAAAG
TAAATGAAACTACTTCACAGTACGTTTTTTCTACAATTAATGCATTACCAGAAACTACTGCTGACATTCT
GGTTGTTGATGAAGTTAGCATGTGTACTAATTATGATTTATCCATAATCAACGCACGTGTTAAAGCTAAG
CACATTGTCTACGTAGGTGATCCAGCGCAGCTGCCTGCACCTCGGACATTGTTAACTAGAGGCACATTAG
AACCTGAAAATTTTAATAGTGTCACTAGGTTTATGTGTAATTTAGGACCAGACATCTTTTTAAGTACATG
TTATCGTTGTCCTAAAGAAATTGTAACCACTGTTAGTGCTCTAGTTTACAACAATAAGTTGTTGTCTAAG
AAGGAGCAGTCAGGGCAGTGTTTTAAATTGCTCTATAAAGGTTGTGTGACGCATGATGCTAGTTCAGCCA
TTAATAGACCACAATTAGTTTTTGTTAAGAATTTTATAGCTGCCAATCCCGCATGGAGTAAAGCAGTCTT
TATTTCACCTTACAACTCTCAAAATGCTGTTGCAAGGTCTATGTTGGGTTTAAATACCCAAACTGTAGAT
TCTTCACAGGGTTCAGAATACCCCTATGTGATATTTTGTCAGACGGCTGACACAGCACATGCCAATAATA
TTAATAGGTTCAATGTTGCTGTAACACGTGCACAGAAGGGTATATTGTGTGTTATGACATCTCAGGCGTT
GTTTGATTCTTTACAATTTTCTGAGTTGTCTGTTAATAACTATAAGTTACAATCGCAAATTGTGACTGGT
TTATATAAAGATTGCTCACGTGAAATGAGCGGACTTTCACCAGCATATGCACCAACGTATATGAGTGTAG
ATGAAAAATTTAAGACTAATGATGAGCTTTGTGTGAATTTGAATATACCCGCAAATGTTTCATATTCAAG
AGTCATATCTAGAATGGGTTTTAAGCTCGATGCATCAATACCCAATTATCCTAAGCTTTTTATAACCAAA
GAAGAAGCTATAAGACAAGTTAGAAGCTGGATAGGTTTTGATGTTGAAGGTGCACATGCTTCGCGAAATG
CGTGTGGTACTAATGTGCCTCTCCAGTTAGGATTTTCAACAGGCGTGAATTTTGTTGTTCAACCTGTTGG
CGTTGTGGACACCGATTGGGGTAATATGTTGACAAATATATCAGCAAAACCCCCACCAGGTGAACAATTT
AAGCATTTAGTCCCACTAATGCATAAAGGTGCGGCTTGGCCTGTTGTACGGCGACGTATAGTTCAGATGG
TTTCAGACACTTTAGATAAATTGTCTGACCATTGTACGTTTGTTTGTTGGGCTCATGGCTTTGAATTAAC
ATCTGCATCTTATTTTTGCAAGATTGGTAAAGAGCAGAAGTGTTGTATGTGTAATAGACGCGCTGGTGCG
TACTCATCACCTCTGCATTCCTATGCATGCTGGGCACATTCCAGTGGTTATGATTATGTTTACAACCCAT
TCTTTGTAGATGTACAACAGTGGGGTTATGTAGGCAATCTTGCTACCAATCACGACCGTTATTGCACATT
GCATCAGGGTGCACATGTAGCATCCAATGATGCAATAATGACTCGTTGTTTGGCTGTTCATTCATGTTTT
ATAGAGCGTGTGGATTGGGATATAGAGTATCCTTATATATCACACGAGAAGCAGTTAAATTCCTTTTGTA
GAATTGTTGAGCGTAATGTAGTTCGTGCCGCATTGCTAGCCGGTGGTTTTAATCATGTCTATGATATTGG
TAATCCAAAAGGAATTCCTATAGTTGAAGACCCTGTAGTTGATTGGCATTATTATGATGCACAACCATTA
CGTAAAAATGTTAAACAGTTGTTTTATACAGAAGCCATGGCTTCTGATTTTAGTGATGGTTTGTGTTTAT
TTTGGAATTGTAATGTTCCATTATATCCAAATAATGCTATAGTATGTAGGTTTGACACACGTGTGCATTC
AGAGTTTAATCTACCTGGTTGTAATGGCGGCAGTTTGTATGTTAATAAACATGCTTTCCATACACCAGCG
TATGATGTCAGTGCATTTCGTAATTTGAAACCTATGCCTTTCTTCTACTATTCTACAACACCTTGCGAAG
TGCATGGCACTGGTAGTATGCTAGAAGATATTGATTATGTGCCACTTAAGTCTGCTGTTTGCGTTACAGC
ATGTAATTTAGGTGGTGCTGTTTGTAGAAAACATGCTATAGAGTATAGAGAGTATGTTGAGGCATATAAT
CTAGTATCTGCAGCAGGTTTCCGTTTATGGTGTTATAAGACCTTTGACATATATAATCTTTGGTCAACTT
TTAGTAGAGTTCAAGGTCTTGAGAATATTGCTTTTAATGTTGTAAAACATGGCCACTTTAAAGGTGTTGA
AGGAGAACTACCAGTAGCTGTAGTCAATGATAAAATCTTCACCAAGAGTGGTGTAAATGATGTGTGTGTC
TTTGAGAATAAGACCAACCTTCCTACTAATGTAGCATTCGAGTTGTATGCAAAAAGAGCTGTGCGCTCAC
ATCCCGATTTCAAATTGCTAAAGAATTTGCAAGCTGATGTTTGCTACAAACATGTCCTTTGGGATTATGA
CCGTAGTAACATCTATGGAACTGCTACTATAGGTGTATGTAAATACACAGATATTGATATCAATGCATCT
TTGAATATATGCTTTGACATTCGTGATCAAGGTTCCTTAGAAAAGTTCTTAACACTTCAAAATGGAATTT
TAATTTCTGATAGAAAAATCAAGAACTACCCTTGTGTTGTAGGTCCTGATTATGCTTATTTTAATGGTGC
CATTATTCGTGATAGTGAAACCATTAAACAACCTGTTAAATTTTATATTTATAAAAAACTCAATGGTGAG
TTTTTGCAATTTAGTGACTCCATTTATACACAAGGGCGCTCTTGTAGCGATTTTGAACCGTGTACTCAAA
TGGAGAAGGATTTCTTGTCTATGGAGAGCAATGTTTTCATTAAGAAATATAATCTAGAAGATTATGCTTT
TGAACATGTTGTTTATGGTGATTTTTCGCATACAACATTGGGTGGCTTACACCTTCTTATAGGTTTGTAT
AAGAAGAGTTTGGAAGGTCATATTATTATGGAAGAGATGCTAAAGGAGAGTGCTACTATCCATAATTATT
TTATTACAGAAACCAACACAGCATCTTTTAAGGCGGTGTGTTCGGTTATAGATTTAACTCTTGATGACTT
TGTACAGATTCTAAAAAGTTTAGACCTTGGCGTAGTATCCAAGGTAGTCAAGATTTCTATTGATTTAACA
TTTGTTGAATTTATGTTATGGTGCAGAGAAGGCCAAGTTAAAACTTTTTATCCTAGACTTCAGGCCTCTA
ATGATTGGAAGCCTGGTTTAGCCATGCCTTCTTTGTTCAAAGTACAGAATGTAAACCTTGAACCTTGCCA
ATTGGTTAATTATGGACAGTCCATATCTATGCCAAGAGGTGTTCATATGAATATAGCAAAATATATGCAA
TTGGCACAATATTTAAATACATGTACAATTGCAGTGCCTGCTAATATGCGTGTTATGCATTTTGGAGCAG
GTTCTGATAAGGGTGTTTCACCTGGAACATCAGTATTACGGCAGTGGTTACCATCTGATGCTGTTCTGAT
AGATAATGATATTAATAATTTTGTATCAGATGCTGATATAACATTATTTGGTGATTGTGCTACCGTTCGT
ATTGGACAACAAGTAGACCTTGTTATATCCGATATGTATGATCCTAGTACTAAAAATGTTAGAGAGAGTA
ATGAATCGAAAGCTTTATTCTTTACATATCTCTGCAATTTTATTAATAGAAATCTGGCTCTTGGTGGATC
TGTTGCTATTAAAATAACAGAACATTCATGGAGCGCAGAATTGTATGAATTAATGGGAAAATTTGCATGG
TGGACTGTATTCTGTACTAATGCAAATGCTTCCTCCTCTGAAGGATTTTTAATTGGTGTTAATTATTTAG
GTACCTTTAAAGAAGTTATAGATGGTAGTGCTATGCATGCCAACTATATATTTTGGAGAAATTCCACACC
TATGAATTTGAGTACATACTCACTTTTTGATTTGTCTAAATTTTGTTTAAAATTAAAAGGTACTCCTATT
TTACAATTAAAAGAGAGTCAGATTAACGAACTCGTTGTCTCTCTATTGTCACAGGGTAAGTTGCTCATAC
GTGACAATGATACGCTCAGCGTGTCTACTGATGTGCTTGTTAATGTTTATAAAAGCAACCCCAAGCGAGG
GAACATGTATATCTGTTGACATGCAGCCCTCATATTTTATCAAAAATTGGTCTATGCCAATTAATATGAG
TAAAGCAGATGGTGTTTTATACCCTGTTGGGCGTACTTATTCTAATATCACAATAACGCTTGAAGGGTTA
TTTCCACACCAAGCAGATCGTGGTGATATGTATGTTTACTCACAATCTCATAAAGGCAGGCCTTTCATTT
CTAATTATTCTCTCGTTACTAATGATTTTGGTAATGGCATAGTAATTAGAATAGGTTCTGCTGCTAATAA
AACTGGTAGTCCTATTATTTCTAATATTGCTAGTAACTTTCAGATTATGAAGAAACTTTATCCAGCTTTG
CTCTTTGGTAGTGCTGTTGGTAAATTTCCTGCTAATAATAAAACAGGTGCTTATTTTAATCATAGCCTCG
TTATTTTGCCCGAAAAATGTGGCACTGTTATTACAGCACTTTATTGTGTTTTAGAGCCCAAGAATGATAC
CAATTGTACTGGTAGTTCTGGTTATGTTAGTTATGTGCTGTTTGAAAATTTTAGTTGTGATGCAACTACT
GATGGTAACTTAAAAAATAGTTTACAGCAGTGGTTTAATATTAAGGATTGTCTTTTTGAGAAAAATTACA
ATGTTACTGATGATGAGAGGGAAGAGTGGTTTGGAATTATCCAAGATCAGCAAGGTGTCCACCTCTATAC
ATCTCGGAAGAATGGATATTCAAACAATATGTTTTTGTTTGCTACTTTACCAATTTATGATCAGATACTA
TATTATACTGTTATGCCGCGCAGTATTAATGCTAGTAATTATGCATCATATCATGCTTTTTCTGCATTTT
ATATTTACAAGTTACACAAAATCAACTATATGGTTGACTTTGATGTAAATGGTTATATCACAAGGGCTGT
CGATTGTGGTTATAATGATTATACACAATTGCAATGCTCTTATGGTCAATTTGATATGGATTCTGGTGTT
TATTCAGCTTCGTATTTTAATGCCCGCTCTAGAGGTTATTACTATGAAGCTGCAGAACTCACAGAATGTG
ACTTAGATGTATTGTTTAAAAACGATGCTCCTATAATAGCTAATTACAGTAGGCGAGTTTTTACTAATTG
TAATTATAATTTAACAAAACTCCTTTCTCTTGTGCAAGTAGATGAGTTTGTTTGTCATAAAACAACACCA
GAAGCGCTTGCTACTGGCTGTTATTCCTCTCTAACGGTAGACTGGTTTGCGCTGCCTTTTAGTATGAAGT
CAACATTAGCTATAGGATCAGCAGAAGCTATATCTATGTTTAATTATAATCAGGATTATTCCAATCCTAC
GTGTAGAATTCATGCAGCTGTAACAGCTAATGTTTCAACAGCGTTGAATTTTACTGCTAATGCTAATTAT
GCTTATATTTCCAGGTGCCAAGGTGTTGATGGTAAACCAATTCTATTACAACCAGGACAAATGACTAATA
TTGCTTGTCGTTCTGGTGTTTTGGCACGGCCATCAGATGCAGATTATTTTGGCTATTCATTTCAAGGACG
CAACTATTATTTAGGGCGTAAATCTTATAAACCTAAAACCGATGAGGGCGACGTTCAAATGGTTTATGTA
ATAACGCCTAAATATGATAAAGGCCCTGATACTGTATGCCCTCTTAAAGATATGGGTGCTGCCTCTTCTA
GTTTAGATGGCTTGTTAGGGCAGTGCATAGATTATGACATTCATGGAGTAGTAGGCCGTGGTGTTTTTCA
AGTTTGCAATACCACAGGAATTGCTAGTCAAATTTTTGTCTATGACGGATTTGGTAATATCATAGGCTTT
CATTCTAAAAATGGTACATACTATTGTATGGCACCATGCGTATCAGTACCTGTTTCTGTAATTTATGATA
AAAGCAGTGATGTTCATGCTACGCTTTATAGTAGCGTTGAGTGCAATCATATAAAATCAGTTGCAACAGT
TTTTAGTCGTCAAACTGAGTCTAAGCTTAGATCGAGTGATAACGGCCTTTTACAAACAGCTGTAGGCTGT
GTTATTGGATTCCGTAACACAAGTGACACTGTTGAAGATTGTACCTTACCTTTAGGCCAATCTCTCTGTG
CAAAACCACCTTCTTTTTCCAGTCGTAGTACCAATGTTAATAACACATTTGCTTTAGTGCATATGTTGTT
CCAAAATCCATTAAAAGTTAGTGTTCTCAATTCAACTGAGTTTCAGGTTTCAATACCTCAGAATTTTAGT
TTTGGTATTACTGAAGAATTTATAGAAACATCCATACAAAAGGTTACTGTTGATTGTAAGCAGTATGTTT
GTAATGGATTTGAGCGTTGTGAACAATTGTTGGTGCAGTATGGCCAATTTTGTTCAAAAATTAATCAAGC
ATTACATGGTGTTAATTTGCGCCAAGATGATGCTACTAAGAGTCTTTTTGAGGACATTAAAGTACCCCAA
TCAGTACCCTTAATGACAAGCCTCACTGGTGATTATAATTTATCATTATTCGAGGCACCTAATATTGGCA
GTGGTAATAATAACTACCGCAGTGCTTTAGAAGATCTGCTTTTTGATAAGGTTACATTATCAGATCCAGG
TTATATGAAAGGATATGACGAGTGCATGAAAAAAGGACCACCTAGTGCTAGGGACCTAATTTGTGCACAA
TATGTATCTGGTTATAAAGTTTTACCGCCTTTGTATGATGCTAATATGGAGGCTATGTATACTGCTTCTT
TAACTGGTAGTATAGCAGGTTCTTTTTGGACAGGAGGACTATCGTCTGCTGCTGCACTACCATTTGCACA
GTCAATGTTTTATCGTATGAATGGTATTGGCATCACTCAAAATGTTCTTATGAAGAACCAGAGGGAGATA
GCCAATAAGTTCAACCAGGCATTAGGTGCTATGCAAACAGGATTCACAGCTACCAATCAAGCTTTTCAGA
AGGTTCAAGATGTTGTGAATGCCAATGCACAAGCATTATCTAAATTAGCTAGTGAATTAGCTAACACATT
CGGTGCTATTTCCGCTTCTATAGGTGACATCTTAAAACGTTTGGATGTTTTAGAACAGGAAGTGCAAATA
GACCGCCTTATTAACGGACGTCTTACATCGTTGAATGCGTTTGTAAGTCAGCAACTGGTGAGGAGTGAAG
CTGCAGCTCGCTCATCTCAGTTGGCTAAAGAAAAAATTAATGAATGTGTCAAAGCTCAATCTACACGCAG
TGGGTTTTGCGGACAAGGCACTCATATAGTGTCATTTGTTATTAATGCCCCTAATGGATTTTATTTTATA
CATGTGGGTTATCACCCACAGGATTATGTAAATCAAACAGCTGCTTATGGCCTGTGTGATTCTTCTTCTA
AGAAATGTATTGCAGCCAAGAATGGCTATTTTGTTAAAAATGATTCTGATAGTGGTAGTTGGTCTTATAC
AGGCAGCAGTTTTTATCAGCCTGAACCTATCACCACTTTTAACTCAAGGTTTGTTGAACCTGAGGTAACT
TTTCAAAATTTAAGCAACAACCTTCCACCTCCACTCTTAAGTAATAACACTGATATTACTTTTGAGGATG
AGCTGGAAGAGTTTTATAAAAATATTACGTCTGAGATACCTAATTTTGGTTCTCTCAGTCAGATTAATAC
CACTATGCTTAACTTGTCTCAAGAAATGAGCACTTTACAGCAAGTGGTCAAAGATTTAAACAACTCTTAT
ATAGAGCTTAAAGAATTAGGCAATCACACATACTACCAAAAATGGCCGTGGTATGTGTGGTTGGGTTTCA
TTGCTGGTCTTTTGGCACTAGCATTATGTTTATTTTTCATACTGTGTTGCACAGGGTGTGGCACTAGTTG
TCTAGGAAAAATAAGTTGTACTCGTTGTTGTGATAAGTATGATGATTTTGAAATGCCGGACAAAGTTCAC
ATACACTAAAATAACGAATCTTAAATATGCAGTCTAAAAGAGGAATTTTAACTCTTATTGTCTGCAACAT
TTTAGCAATGAGCTTAGCTAAATCTTTTATACCTGAACATTGCGTCGATTATGAAGGTGCCATGTTCGAG
GCATGTGTTCAAAATGCTATTAGCGCAGCATCTGGCACATACACTAACACTAAATTGTCATACCCTGTGT
TTGATAATGATGGTGTTACTTATTATGATGCCACACAAGACCGCGATGCCACACCTAGTTATGAGCATAG
TGGTTTTTACGAACTTGATGAATCCAGTTTCTCTGCTAAACCAGTTTTGGCAAAGTTATAATAGTGTCAT
CAACACAGCTGAGAATTGGGTAGGACCCCCTCAGTATTCTTTTTATCCTGTGCTTAACACAGCGTCTAAC
ATCCAGTGGTTTTGTACTGCAACCTTTTTAGGATACACAGTGCAAACCCTAGATAATACTAAAGCTCTAG
CTAAACAAAAAGCTGCACAACAACTCCTTCAAAAGCTTAATGATGGATTGTAGTGCACTAACACAGTCTA
ATGAAATTAGGAACCGGCGCTATCACAAGCGCCGCTTCTCTCCTGTTAGAGCAAGTGATTTGCAGGTTGC
TAAACAACCTACACATTACCTGCGTATAACTTTTCCTCCCACACGACAATGGACTGTTAGAAGAGGACTT
ACAATGGAAGATGTTGAGACCTGGTTGTATAATTATGACGCTAAACCAGTCACTCAATATCACATTACTT
TAGCACTCCTTGTCTTGGATAAAGATGAGAGCATTCCTGATATCACTAACTTTGCCAACATGTTTAGGCG
TGTTAGGTTTGAGTTAAAAGACTTTAATGTGCTTGGCAGAACTCTTGTTCTTAATGCTACCGAGCTGGTT
TGTGAAAATCCTTACCAGTATGATCTTAGCAATTTGCAAGAAAAGGTGGTACCTTGCATTAAACAACTGT
TGTCATTACAACGTTATAAGTTGCATGATAGCGGTTTACCTTTACATTTATCAGTTAGCAAATTGCATGA
TTTAGAGCCTGAATACAGGTCTCATATCAGCAATGTTGTTTCCTATCGTCCGACATGTTTTGTAGCAAAG
CCCACATCTGTAGAGCTTGTAACAACACGTGCATTTAACGGCGACACACCCAAGGTGGTCATGTCAGTGC
CTATATATTAAGGACGAACTATGGCTTACACACTTTCTCTTTTTAAACCAGTGCAAGCTTCTCTAGCTTC
TCCGGAGCTAATAAGCAATAATCAGGAAAGTGTAGCATATGTAGACCGTTCACTAACTATGTTAACATGC
ATCCCAATTCAAGCTTATACTGCACTTTTAGCAGTTAATGCATGTATTTTTCCACTACTTCTGTCACTTA
AATGTGACACATGTAGGAGTAGTATGATCAAAACATTTGCAGTTTATCTGTTGATGTTCTATAATTTTAT
AATAGCTACTGTGTTAACCAGTAGCAATAATACTACGTTAGGAACACCTATATTGGTGTTCATTGTTGTA
GTGTCTATAATTTGGCTAGTGGATCGTATCCGCTTTTGCCTAATGTTAAAAACATTACTACCACTTGTTG
ATATGAGGTCTCATTTCATTCGTGTTAGTACATGTACATCACATACAGTCGTGGGAGTTTCACACTCACG
GCCTTATTTTATTAAAAACTTCGAGCAAACTTGCATTTGCCCTAAGTGTTGTTTTATACACTCTATTAAT
TTTTTAGAGTGCACATTTTATAGTCGTTTCACTAAAATTAGCCTTGTTTCAGTGGCTGAATTTAGTGTTG
CAGATAATATCTCAACCGTATATGCACCTCAAACTCGTGGTGCAGTACCTTTACACATAATCGCACCAAG
CGTGCTTACTCATTTTTTCTAAGTACGCGTTGCGCTTCTATGGGTCCCACTTGAGACTTTTCCGAGTCTC
TTTTTGGACATTTGGAAAACGAACTATGTTACCTTTTGTCCATCAACAATTAGGGTCATTCATAGTTAAC
TTTTTCATCTTTACCGTAGCTTGCGCTGTAATACTTTTAGTATCTATGGCAATCCTTACGGCCTGTCGAT
TATGTGTGCAGTGCTTAACAGGTGTTAATACCTTGTTAGTTCAACCAGCCATATATGTTTATAACATGGG
ACATTCTGTCTATGTAAAGTATCAGAATAGTAAACCAGAACTGCCGCCAGCAGATTGGTTTTAACGAACT
ATATAATCATGTCTAACGACACCCTATCTCAGGAAGAAGTTATTGCTGTTATTAAAGACTGGAACTTTGC
ATGGTCCATAGTCTTTCTTATTATTACTGCTGTACTACAGTATGGTTATCCATCTCGTAGTATGACAGCC
TATGTGGTTAAAATGTTTATGCTTTGGCTTTTATGGCCTTGTTCTATAGCACTGGCTGTCTTTAGTGCAG
TCTATCCCATTAATTTAGTTTCGCAGATTATATCTGGTTTACTAGCTGCTGTCTCTGTATTTATGTGGCT
TGGCTACTTTCTACAGAGTTTCAGACTTTTTAGAAGGACTGGGTCTTGGTGGTCTTTTAATCCAGAAACT
AACTGTCTTCTCAATGTACCAATAGGTGGTACAACAGTTGTTAGACCTCTAGTAGAAGATTCTACTAGTG
TCACAGCTGTTGTTACTAATGGTTATTTGAAAGTGGCAGGTATGCATTTTGGTCAGTGCGATTATTCGCG
ACTACCTACAGAAATAACAGTGGCTAAACCCAATGTTTTAATAGCCTTGAAAATGGTTAAACGGCAGGAT
TATGGTGTTAATTCTGGCGTTGCAATATACCATAGATACAAGGCTGGTAATTACAGGCGTCCACCAGTAG
TGGTGGACGAAGAACTTGCACTGCTTAGAGCTTAAGCTCATTAGTAAGAGTATGATATTATATCATTTAA
CGAATTTAATCTCATTGTAATGGCAACACCACAGCAACCTCGCGCTGTAACTTTTGCCGATAACAATGGA
AATCAACAAAATGGAAATAATCGAGGTAGACCAAGACAACCTAAACCTCGACCAGCCCCAAACAACTCTG
TCTCGTGGTACACAGGCATTACACAGCATGGTAAGCAGCCTCTTGCCTTTCCGGCTGGACAGGGTGTACC
TCTTAATGCCAATTCTACACCCAAGCAAAATGCAGGGTATTGGCGCAGACAAGACAGAAAGCTTAATACA
GGCAATGGCGTTAAACAGTTGGCCCCCAGGTGGTATTTCTACTACACTGGAACAGGACCTGAAGCTAACC
TGCCATTCAGAACAGTCAAAGATGGCATCTACTGGGTTTGGGAAGAAGGTGCTAGTGAAGCCCCTTCAGA
CTTTGGTACCAGGAATCCTGCTAATGACACAGCTATTGTCACGCAGTTCGCGCCTGGCACTCAATTACCT
AAAAACTGCCACATTGAGGGCACTGGAGGTAATAGTCAGTCATCTTCTAGAGCGTCCAGCACTAGCAGAA
ACTCCAGTAGATCTAATTCCAGAGGCTCCCAACCTGGTAGTAGAAGTCACTCACCAGGAAGTGTTGGACC
CTCAGATGCATCAGCACTGCTCTATCTTGAACTAGCTAAGAGACTAGAAGCTTTAGAAGCAGGTAAATCA
AAATCAGCACCTAAGGTTATCACTAAAAAAGATGCCGCAGATGCTAAGAAAAAGATGCGCCATAAGCGTG
TCGCCACCAAGGCATATAATCCCACTCAAGCCTTCGGTCTCAGGGGACCAGGTGACTTGCAGGGTAACTT
TGGTGACTTAAAGTATTGCAAAGAAGGTGTTGACGACCCACGCTGGCCTCAAATGGCTGAGCTGGCACCT
TCAGCATCTGCATTCTTAAGCATGTCACAGTTGAAACTAGTGCATCATTCTAATGACACAGACAACAAGC
CAGTTTATATGCTGCGCTATTCTGGTGCCATTAAATTAGATCCCAAGAATCCCAACTATTCTAAATGGCT
GGAGATTCTTGAAGCAAATATAGATGCTTACAAAAACTTCCCTAAGAAGGAAAAGAAGCAGAAACAATCT
CAGACTAAACAGGAACTAGAAGACCCTGAGTGGGATTCCACAGATCTGTTTTCTCAACCTTTACAAGACC
CAGACAACCAGCCGAAGGCACAGCGTGTTCCAAAAGGTAGTATTACCCAGAGGTCACGCCCTCCTAAGCC
TACAGTTGGTCCAATGGTCGATGTAGAACCTTAAAAAGGTACAGTAAAAGTAACAAGAGTAAGGCAATCG
CTAGTGAATGGAAACCCCATGTCATGACGCAATTGTCTACTCTTGCACAGAATGGAATCATGTTGTAACT
ACAGTGCAAGAAGGTAGGTGCAATCCATTTAATTGATAGCTATGTTTTAGTAAAGTGTGTAGCTATAGAG
AGTAAGTTAAAGGTTAACACCGCTGCATAATTGGCCCTTGCATGTGATTAACGCCCCCTGGGAAGAGCTC
TATAGTGTGTAATGTAAATAAGAATAGCTATAATTCAATTAATTCGGCTTATTAGATGATTTGCAAAAAA
AAAAA

>gi|557745614|ref|NC_022787.1| Porcine torovirus strain SH1, complete genome
TGACGTATCTTTAGTTGATTTTGAAGGCTTGAAATAAAGCTTTTAAAACCCCTTTACGGTTTGTCCACCA
TACGGACATTGTTCAGACCGCAGTGTCTTGTCAAGGAGGTTCAGCCTTGACTTTACTTCTCTGTGAGGAA
TCTACTCAGAAATACTGCTTGCGTACTAGTAGTTACAAGAGTCGCCACCTAGTACTTACAAGCGGGTCAA
ACCGCCCTCCGGAACGGTGGAGACTCCCTCCCGAACGTGTGCTTGACGTGACCAACTTTGGTCTAGCTTT
CTGAGAAATACTCCAGGGCTGTATCTAACCACTTTTGTTGTCAATTGTGGTTATTTATCAACCAAACATC
GTGTGACTCACCTCCAGCTTTGCTGCAGGCCTTCGGGACTAAACGAGTTCATACGCTTTGTGGTTAGTTT
TAGGACTTACCATCTCTCTATATCGCCAACCTGATTCTTTTTATTCTTAAGTTTTGCGTCTATACGCTAT
TTTCTTACGGTTGGCAGTTTGTTTGGTTGTTTGCACAGTTTCTTTTAATACCAATTTTTACTGTGCTTTT
AGTTTTTACAGCTAAGGCTGTTTTTTATTTACTTAAGTTGCTCGAAGCAGCTTTTACAACATTAGTTCTA
ATTTCAATTGAAAAGCTAAGGGGTGTCAGGAAACAACATAGACGCCCTTCTTGTGGTGTCTAGTTGATAT
TAATCTGGCAAACAAATACCAGGTTATTGACTCTTTGTGGAGTGAGACTTACGAGTATCAATTTGCCTAT
TTTGGACACCCATACAAAAATGTCCAAGATCTCAAAAAAGCCCACCAGCGAAACCGAGCCGCTTTTGTGC
TCAAGTATCTTGGACCTAACTTCCAGGTCCCAGTTTTTGGACCAGTGTTTAGGTACACCACAAAACCTGG
TATCACTTTCAAAGATGGATCCATCTATCTCGGTGTCACCGACTTTGGGACTCAAGTCCACATCAACCCC
CTACAGCTCTTTACAAAGTTTGCAATTACTTGTCCTGAACACCTCATCCACCCAGTTCAAATGGACTACC
GGGTCTATCTCGAAACTGAAGGCTCAGTTGGAGAGAGAATTGTGCAGGGGGTTAGTGCCTTTGAACGATA
TTACCCCAGGAAGCAATTATGTGGAACTATCGTTAATGATCCCTTCACTTTTGACTGGGCAGGAAATATC
CACAACTACTACTTCACCAGAAATGTACTCAGATACGGTACAAAATTGTATCAAGTTAATGGAAACAAAC
TTATTGAAAGGTGTTCAGGCATTGAGAGATCAGACATCTTGCCAAGAATACTTTCTGAATGCCAATTACC
AATCCTTGATACCACCCCAACTCCTGCTGAACGCGATGAGGATGTCATCTGTTGCGACTTTGAGTCCCTT
GACATTAGAGAGTACCCGGCTCTTGCTGAAACTAAGCCATTTCCATGGCGGCACTTCAGTCAGTTACACC
TCAATGATTAAGGGGTTTGCAGATTGTTCTAGACGTGATGAAAAGTGTCTTAAGCGTCGCTTAACAAAGG
AACAAAAGAGTCAGGAGGAAGGTAGCTTTGATGCTGGTAGGGTTATCACATTAGGGGGAAGGATGTACCG
TTATGAGGTTATAGTCTTGAAATGCAGTGATGAGAATGATGATTTCACTGGTTATGATGACCCAATAGAA
CAGTTAGAATACGACCTTGAGACTGTGCCACATTGCTGGAAAGAACTTGTTGAAGGTAAGTGTCTTACCC
GTGCTAAGGCAACTTGGGATCTTACAGAAGATCTTGATGTTGAGTTAGACCGTATACATATTGAGGAAGT
CAAAAGTCTTCAGCGTTCAGGTGCTAGTTGGGATTTATCTAGTGTTGGTGTTGATAGTCAAGATTTAGAG
GAAAGAGTCTTTTCACGTGTTTGGTTAAAACAATCTTCCAAGTACTTTGGTACAAAATTACAACAAGTGT
CAGAGCTTTTTAAGAGTGAGGGTTTGGCAGAACTTGTATCAACAATGAATGGTATAAATTCAGTTAGGGT
TGGTGATAAGTGGTTAAATTTTAGAGATCAAGGCAAATCATGTGTGTTTTTTGTTTATACCAATGATAAC
GTCTATTTGGCCACAACACGTCAAAGAGTTAGTTGTGATTACATTATTACCAAATTTAAGAGTGTTAAGT
GGATTGGTAATAAACCTGATAAGTGTAAAATTACCAAAGTGTTAGCATGGTTGATTTCTGTTAATAGAGT
TAAGAATAGCACCAGAGTAATTACACCAATGTTGTGTAAACAGGGTAAAATTAGTCATAAGGAGGTTGAT
TATTTAGATATGAGTGTTTTAGATAAATATGCAAGTTGTGCTTTTGGACCTACATGTGTACAGAAAGTTA
AAAAGTTTTTATTAAGTTATTATAAGTGTGATAGTGATTTTGATTTATTAGATAATTTTTTGACACCTGT
TAAATGTGGTAAAAAGAAAATGGTTTTTGAGAAGTGTTCTTGTAAAAATCACCAGTTTTATGTGGCACAG
TTTGACAACCATGTTGTTTTGGGTTTGGGACGACCTAATGGCATTTTGTATCCTGAAGAAGTACCAGCTT
ATGCAAGAGTTTATGCCGTTGGGTTTGCCAATGATAAGCATGGTGTGGAGATTCACTACTATTCTGAGAT
GGATAACAACCAACTACCACAAGAATACTGCTTTGTTGCCCATGACCAACACCATCAACAGGGGGGTGAA
GGTGACTATGTAAACTTTCACCCTGATGATTTTGAGGACGGTCCATTTCCTAACCTTGATTTTGATATTG
ATTATGATGACTTAATTTGGCCTGATGCACCAATTCCTGTACCTTCACCATATGGTTACCATCAGGGGCA
ACGTTTGAGAGATCTTTGTGTGGCAGATGGTGGTTTTGGTTGTGACTGCCCACGTTGTGATGGTAGTTAT
ATTTACCACCCAGTTAGACCTCGTCATTATGAATCTTTTGAAGAAGTGGGTCCATTTTTTAAAATGTGTG
AATTTAGGTTTACTTTTTCAGGCCAAATTTATAACCAGTTTTATGGGTTGGGGCCAAAAGTTCGTTTACA
GGATCTGGTAAAAGCAGGTAACAAGTTGTTACAGCTGTTAATAAGGGGTCAGTTAGAAGAATTAGATTTA
CCATCTGAAATTTTGAATTGTTTAACATATTTGAAATTGGGTTTGAATATTCATCCATTTGTTTGGCCAG
CCCCATTTTTTACTAGTAGTGGTGAGTGGGTTGATATTTTTGATGGTAATGATTTTGCGTTTGGTATAGA
TTTTAATAAGACAATTGGTATGATAGAGAGTGTGCAGTTTTTATGTGAAAACTTTCTTTCATTAAGTTGC
CCATTGGAGAAGTTGTACCAGGATTTACATACTGATGAGGAAGTTAAACAAATGTTTTGGTCAACAACCC
ACATGAAATATATATATTTGGCATTAATACATAGTGAAAGGTCTTTTAAGGCTATTTTGAATAATACACA
ATTAAATAATTCTCAATTGGCAAAATTAATTACAATTGGAACTTTAGATGCCCCAATAGTTTCACCTTGT
GCGTGTGAGGGTAATTGTGACCATGCTAAACCATATAATTGGACTGGTATATTAAATAAGGTATCTAAAT
ATGCCACATTAAAGCAGTTGATTGGTTTGTCCTACCATGATAAAAGGTTATTGGTTTTAAAAATGACACA
ACGTTATTTTCAAATAGAAGAAGGATTATTTCAACCAGTTCAATTGTTAATGGCTCCATTTTATAGTTTT
AATGACAATGTTGAACCAGATGAACAACCACTAACTGGGATGTTCCATCAAAACGTAATGCAAATGTTTG
ACACTTGTGTGATGCCTGATGTTATTACTAAACTGAAAAGAACTAGGGCTTCAGCTAATGACCTTTTTTG
TATTTTGGCTGATTACTTTAGACGATCATTTGCTTACCGTTATTACCGTGTTGCCGAATTTTCAGATCTT
GAAAAGACTCAAGTTTTTACAGATTTAACATCAGCATTGTCTGGTGGAACAAGTAAAATTGGTGCCTATG
CTGTGTGTAGAATGGTGGAACCTAGAAGTGTAGCTACAACTTGTGAAAAGTCCATGTTCCCACCTGAAGT
TGTACGAGCCATACGGGGTTATTTACCAGTTAGTTTTAATACAGGTGTTATGAATTATATAGATGAAAAT
TGTGATTTTGATTATTGTAATTTAGAGTTTTGTATTAGTGGTAAAGGTTTAACTAAGTTGAGTCAGAGTG
GTTTAATAGAGTGTAAGACTAATTTATTTGTTGTTAGATTTAATACTGTACCTTTATTGTATGTAACCAG
TAAACCTATATGCTTGAGTGAGTTTAGTTTAGAAGCTTCAGTGTCCTTGTTAGGTGATTTTAATGTGAAT
GTAGATATTGTTCCAGGTGCTACACTTTTTGGCTTATACTTTACTAATGGAAAGGCATGTCAAGATGTTT
GGGAGACATTACCACGATTTGGACTTGGTTGTTTGTCAACTCCAAAGTTACATCCTAAATTTAAGCCATT
TGATAATTTAGCTGAAGTTTGTTTTTTCAAACAAAAGGTTAAACTTGTTTCACTTGTTAATAATTTTACA
CCAGTTGAAATAGTTAAGCCAGAAGTTCCAAAAACTGTTATAGTGGATTTACTACCATATTATGGCTCAG
TTGGGTTCCAAGGTTTTGTTGCACCTAAGTGTGTTCTACCTGGAACTTTAGCAACTCATTATTGTAAGTT
GAATAATCAATTGGATAAGTGTGTTCAGGTTACAAAGTTGGCTGTTGCTCATGCATTTTATTTTAAACCC
TCAAACATGGGTTCATTATTTCATTTAGATCCAATGTATGGTAAAAGCTATGGTAAACCAGCTGTAGTTC
AATTTGAGCCTGTGGGACTTATAAAGGAGGTAAATGTACTTGTTTACCAATTTCGTGAACATGTTGCAAT
ACATTACTTTCCTGAATGCCCCACCTATGTAGCTGATGGTCATTACCCAAGTAAGTTTGTTGGAATATGG
CTGGGCTACTTACCATCTGTAGAGGAGTGTAAAATTGCACAACATAATCGGTCAGTTTATGTGCCTGCCT
GCTTCAGACTTTCACGGACTGGTGGTTACCACATTCAGCAGAATGAAGATTTTGAAAGGAGTAGTATAAC
TGTGACTTACCGTTATGCTAAGAATTTTGAGACGAAATCTTTGACACCTATGTTTCAAATGTTTAGTAAA
ATTTTTGGTAAGTCAAAACAAGAAATAATGTGTGCATTAAATTCTCTAACACCTGAAGCAAGTAAAGTTT
TAACTCTTTTTTGCAACGAATTTGACCCAGCATACACAGTACAAACTTTGTCTGATGAGGTTGCATTTGA
AACATCTGCCAGTCCCGAGTTAGTGGCATGTGCTTTAGCTTATATTATTGGTTATGAACTTTGTTTAACC
GTAAAAACTGGTGGAAGTTGTGAAAGTTTAGACATTGGTTCAAGTTTGGAACAAGTTTATATTGATTATG
ATACATGTGAAAATAGTTGGAAGTTATCAACAGATTTGCAGGATGATGATTCTGAGGATTTGGACCTACC
ATTTGATCAATACCATGAATTTAAGCTTGGTAAAGCATCAGTTGTTTTAGTTAAAGATGATTTTAAGAGT
GTTTATGATTTTTTAAAGAATGAACAAGGTATAGATTATGTTGTAAACCCAGCTAATAGCCAGCTTAAAC
ATGGAGGAGGCATTGCTAAAATTATATCCTGTATGTGTGGTCCTAAATTAACAAATTGGTCAAATGGTTA
TATAAAACAGCATAAAAAATTAGATGTTACTTGTGCTGTTAGATCACCTGGTTTTCAGCTAGGGAAAAAT
GTTCAGGTTATACATGTTGTAGGTCCTAAAAATGGTGATGTAGATGTTCAAGGAAAACTTAATAGTTCTT
GGAGAAGTGTGTTTCAAAATATTAAAGCTGATTCTACTGTTCTTACATCTATGTTGTCTACAGGTATTTT
TGGTTGTTCTGTTGTAAGTTCAGTTAGTACTTTATTAGACAATTTGCTATTTTTAGAAAAGGATGTAGTA
GTTTTTGTAGTTACAAATGATTTAAATCAGTATAAAGAAGCATTGAGTGTTATAGAGGGATATCAAGATT
TTCATGGAATTCCCAATTTTGGAAACACCTGTTGGTTTAATGCCATTTACCAGCTTTTAAAGAGTTTTGC
CACAAAGGAACAGCTTGTACAGGATTTAGTTAATTGTTTTGATGACTTCTATGACTGCCCAACTAAGCAA
TGTGTTGAGTGGGTATGTGAACAACTGGGTGTTAAGTTTGGAGAACAACATGATGCTGTAGAGATGTTAT
GTAAGATTTTTGATGTGTTTAAATGTGATGTAAGAGTTGGTTACGATTGTTTATCACGCTTACAGCATGT
TCAACTGGGCACCTGTAAGAACATCCCAGCTGAAGCTGTCCTTATGTTTAGTGGCCAAGATAAAAGTGGA
CATTGGACTGCTGCACGAAAATTAAATGGTGAGTGGTTTGTTTTTGATGATAAGTTAGTTATTAAAAAAG
ATCCAGATTGGTCTAAGGTTGTATTGGTTTTGAGAGACCGTGGCCTTTACAGAGCAAGTGACTTTGAAAC
ACCTCGGCCAAGACGTCGCCGTGTTGCACATCGAGTTCCTCGTGACACTTTATCTCAGGATGCTATAGTC
TTTACTGAGGAAAAACGGTTTGCTTCCGGTACAGTCTTGGTAGACACTTGTCTTGAGAGTGTTGAGAGTT
TTGATTTAGAGGGTAGTCATGTTAGTTTTGTAGAAAGTGTTGACGATTGTTTTTCAGATTGTGACCAGGT
TAGTTCTGTTAAGAGTGTGCAAGATGACTTAGAACAAAGTTGTGATGATAAGACTGATATTGAAGATGAA
AAGATAGTTGTGGTAGAGGATGTTAGTGAAGATGTTACAGAAGAATCACCACTACAACAACCTACACAGC
AGCAAAATGTTGTTAATGATGTAGATTTTGAACAGGTGCAGCAGCAAAATGAACTTGAGGTTTTACCGTC
CATTTTTATATCTGATTTTAAGCTTTCATTTGAAAAGAGGTTAGAACCAATAGTAAAACAAGATAATTTT
GAAGATATAGAGCTTCAGGATATGGCTAATATTGAACAATCCATGCCGTGCAAAGCGATGAATTGGAAAG
ATGTATTTTTTCAACAATACATAGGTTTTAAATCTGATTTTGTGAGTTTAGCAAATGTTAGTAAATTTCA
AGTTGTATTATATGCATTAAGTTTGTGGTTATTTTTGGTTTATTGTTTTGCTGATTTTTCATTATTAGGT
AAGTTTTGTTTGTATGTTGTGTTGCTATGGTTTAGTCATGTGTTAGTAACTGCTAGAAAAGTTGATTTAA
GTGTGATAAGTTTAGGTAGTGAGAGTTATGTACTTAGAGTTTTGAGTAGTGTTAAAGTACCAAATTTTAT
TGTAGTTAATTGTGATGGTATTCAATGGTTAATTTTAAAGTTGTTGTATTATAGTTTTTATTTTTATGAT
TTTGTAGTAAAGGTTGTTGTTATAATATTTCAAATGCCCCAATTACGGTGTTTTACGTGGCCCTTGCTTA
GGTTGGGTTTTGTAGATACGTTCCTTAGTCATCACATCCTTGCATTTTCTAACAAACAGGTTAGTCAATC
ATGCCTACCTGTTTATGGTGATGACCGTAGATATATTTATGTCCCCAGCTGGTGTAAGGAGTCCTTTAAC
ACTCTTTTACAACGTGCCAAACAGTTAACAGCAATGGGTTATTCCAAGACTTTAGACAACTGGTACTATC
AGTGCTGTTCTAAAACCACCAAACCAAGTTCATGTTTTAATGTTAGAGATTTTGTGTTTGATGATGATTG
TAGTAGTCATAAACAATATGGCTTCCTGTCCTCTTTGTTTGTTTATATAGTATTTTATACTGGTTTTGTT
ACTTTTTGGCTACCTCTTTTGTTTTTTTATTGTGCCTTGTTTATGTGTACTTTTAAAAATTTACCTGTTG
ATACAACAAAACCTATTAAATGGACAGTTTTGCAACAGGTGGTGGATGATTTGGTTTCTATTATAACTAA
ACCACTTTTTGGGAGACCTGCTTGTCCACCACTTAGTGCTTATTTGACAGCCACAACTGCAGAAGAAGCT
GTACGTTCATCAAGGTCACTTTTTGGTAGATTTTGCACACCTGTCGGATTTCAGCAACCGATTATGAATG
TAGTAAATGGTGTTTCTGTCTCTAGTTTGGGTTTTATTAACCCACTTATGTGGCCTTTGTTTGTTGTAGT
TTTGCTTGATAATAGATTTGTTTGGTTTTTTAATGTTTTGAGTTATATTATGTTACCCATTTTTGTTGTT
GTACTTTTTTATTTTTATTTGAGAAAAATTTGTGGTTGTGTGAATATAAAGGGTGTAACAAAGAATTGTA
CTAAGCACTTTCAAAATTTTTCAAAACCTTTGGTAGCAGCAGGTGTGCATGGTAATAGAACAAATTTTAC
ATACCAACCTATGCAGGAACATTGGTGTGACCGCCATTCTTGGTATTGTCCTAAGGAAGAACATTATATG
ACACCAGAGATGGCGATGTATATTAAGAATTATTACAACTTAGCAACAGCACCTACAGCAGATACTACAT
GGTGTGATTATGTTAAAACTACACCTACTATGACTTGGGCAAATTTTAAATTTTCATTGTTTAAACCTAA
TGAAACAGTTATGTGTGGTCCATCATCACATGCAGATGCTATGCTGTTGTCTTGGTATGCATTCCTACAT
GGTGTTAGATTTACACTGAATCCATCGGTCATTGATATACCAACACCTGTTCAGCCCATTTATGTTTCTT
CAGATAGTGATGATTCATTAGATAGAGTTTGTGATGTTAATTTAAGACCAACTAAGAGTAAGGGTAAATT
TAAGAAGCAGTCTATCGCTTACTTTTCATCTGGACCAGTTGACCTGTGGTATTATGTTACACTCGTTATA
TCTTTGGGTGCAATTTTTGTATTTATGTACAGCTGTCTTATGGTTGGGCAGTATGTTGTTATGCCTAAGG
ATAAATTTTTTGGTGTCAATCCCACAGGTTATTCTTATGTTAATGCACAACCTTATTTACATGCAAACCC
ACCTGTTTTGCGGAATAGTGATGGTATGGTATTGGCAACACCGTTGAAAGTTCCATCCATTTCTTATTCT
GTTTATAGGTTGTTGAGTGGTCATCTTTATTTTACAAAGCTTATTGTTGATGAAAATGAGTGTACACCAC
CTTTTGGCGCTGCTAGATTGTCACATGAATTTACCTGTAATGATTTTACATATGTTTTGCCAGCACATTT
ACGTGTTTTAAATCGTTATATTATGCTGATACATCCAGACCAACTTCACATGCTTCCTTTTGAGGTTGAA
CATTCAACACATACAAGACTTTGCTATGTGACAGGAACTAATGTTGTGGAGTGTTTGCCAACATTTGAGA
TTGTTTCACCATATGTTTTTGTGGTTATAGTGGCTATTTTTACTATATTGTTTTTATTCTTACTTAGAAT
GTATATAGTGATGTATAGTTATTTTAAAGTTTTTACATATGTTGTATTTAAGTTGTTGTTTGTTAATACA
ATTATGGTGTTGTTTGTTGTTTGTTTACCTCCTTTAGTTCCTGGTGTAATATTTGTTTTGGCACTTTGGT
TATGTGATAGTGTTGTGTTTTTATTGTATTTGGCAATTTTGAGTTTGTTTATTTTACCCTGGTTTTATGT
AATGGTTTTTATTTTAATGGTTGGTGGTTTTTCCTTTTGGTGGATGATGAAGTCTTCTGATGTAGTACAT
TTGACACCTGATGGATTAGCATTTAATGGTACTTTTGAACAAATTTCTAAGTGTGTTTTTCCCTTAAATC
CTTTAATTGTAAACCGGTTGCTTTTAGATTGCCAAATGTCCCATGCAGATCTTGTTGAGAAATCTAAACT
TAAAACAACTGAAGGTAAATTGGCAACTGAGATGATGAAAGTTTTTATGACAGGTGATACTGCTTATTAT
CAGCCATCGAATTTTAGTTTTCAGAGTGTTTTTTCAAAGGTTACATCACCATTTACTATTCATGCAAAGC
CACCAATGCCAATGTTTAGATTGTATGTACACTTTAATGGACAGTGTGTTGGGACTACTTGTACAGGTAC
AGGTTTTGCAATAGATGATGTTACAATTGTCACGGCAAGGCATCTTTTTGAGCGTGACGATTTGAAACCA
ACACATTTGTCTGTTGAACTTGCAGGTAAGTCATTTTGGTGTACATGGAAAGAGCCACGTGTTGAATCTT
GGAAGTTTGAGGGTGAGAATGCTTATATTTTAGTGGAAAATTTGAGAGATTTTTATGGTCAGGACTTTAA
GTATTTACCTTTTAGCAAAATAGAGGATGATTTTTATAAACGCATGGAACCTGCAACCATCTATTCCATC
AAGTATGGTAGTGAATTTGCCACACAGGCATGGCAAGCAGTTAATGGTCATTTTGTTTGTTCAAATACTG
AGGGTGGCGATTCTGGTGCTCCTTTGGTTTGGCATGATACTATTATTGGTGTACATCAAGGTATTTGTGA
TAGTTTTAAGACTACCTTAGTATCAGATAATTCTGGTAAAATGATGACAGAAGTTAAGGGCCACCATGTT
GATCCACCCATTTATTATAAGCCTGTTATAATATCAGCTGCTTATAACAAGTTTGTAGCTGATAGTGATG
TTAATGTTGGTGAGTGTACAAACTACCATAATTTTGGAGATGATGACTTTTTACCTATGCATGATGAATT
GGAAAAAGTTTCATTTGGTGATAAAATGCGTAGGTATTGTCAAGGTTTACCAAAATATTTAGAACCCCTT
CATTATTTTCATGTACCATCCTTTTGGCAGCCATTTAAAAAGCAATCTATTTCTACTAATGTTTCATGGG
TTGTAGAGAATTTGCATTTTATTTTTAGTTTGTATTTTCTTGTTTGTGATTTTGTAGCTTATTGGTGGCT
TGATGATCCATTTAGTGTAGTTTTGCCTTTATTTTTTATCGTGCAGCTTTTGAGTACTGTGGTTTTGAAG
AATGTTTTGTTTTGGAATACTAGTTATTTAGTTACATTAGCTGTTACATTTTATGTTCATTCAGAAGTAG
CTGAGTCTATGTATCTTTTGGGTTTTTTTTCAGATCAAATTGTTAATCGCATTGGTCTTATTTTAGTTGT
TTCTGTTATGTGCTTGTTTGTTGTAGTACGTGTGGTTGTAAATGTTAAACGTGCAATTTTTGTTGTTATT
GTTAGCATTTTATTAATTTGTGTTAATGTAATGGTAGGAGTTGTACAATTTAGCAGTTTTGTAACATTAG
TTATGTTTGATCTTTATGCTGTTTTTACTGCTTTGTTAACACCTCAGCCTGTTGTAGCTATTATGATGCT
TATTTTGTTTGATACTAAATGTTTAATGTCCTTTGCGTTTGTTGTTATTGTTTTGAGTTTTAGGTTTTTT
AGAGATTATAGGTTTGTTAAAGTTTTGCATAATTTTTGTAATTTTGATTTTGTCTTGACACAGTTGTCCC
TATTTCGTTATCGCCATCACAATCAAGGCAATAACCCTTCTCATTATGAGGCACTGTGGCTGTTTTTGAA
GGAAATTTATTATGGTGTGCAGGATGTTAAATATGAGGTTTTTTCACCACAGGCAGGAACCTATAATGTT
AAATTTTTGACAGATATGACTGAGCAGGACCAATTAGAAGCTGTTGAACAAGTTCAACGACGTCTTCAGC
GTTTTAGCATTGTTCAAGATAAACATTCACAAAGGTTGGTACTTTATTCAAAAAATGTTGAGTTTCTTAG
AGCACAAATACAGCAACAACGTGCATTGGGAGCTAACCCTTTTATAATAACCACTTTAACAGCAAAAGAT
ATTGCAATTGATAATGTTGAAGTTCACAATCCATCTCAATTTAAACCTGAAGATATGCAAGCTCATATGT
GGTTTTATTCAAAGTCTCCAGTTTTTTTTGGACAAGTTCCAATGCCCACGAATGTGCAGACAGCCGCTGT
GTTGGATACCACATACAATTGTCAAGATTTAACAGCTGATGAGAAAAATAATGTTGCTGCAACTTTACAA
ATACAAAATGCAGCTTTGACTTTGTCACTTTTTGATGAGTGTAGACAATTCCTTGAAAATGAAATAGGTG
ATGTTCCAGCAATTATGTGGCAGTCCGATGATGTGGCTGATGTTAAGCAGCTTGAGGCTCAGATTGAGAA
GTTGCGTGTTGTTTTAGATGGTATGCGGTTAGGTACAAGTGAATACAAGGCAACGCGCAAACAGATTAAT
ATATTACAGAGCCAGTTGGATAAAGCCCTTGCATTTGAGAGAAAATTAGCTAGATTTTTAGAGAAGGTTG
ATCAACAACAGGCAATAACAAATGAGACCCAAAAACAATTATCTGCATTTAAGAATTTGGTTAAACAGGT
TTATGAAAGTTATATGGCATCTTTGAAGGTTAAAATTGTTGAGTCTAATGATGCCTCTTGTTTGCTTACA
TCTACAGAATTACCTAGAAAGTTAGTTTTAATGAGACCTGTTACTGGTATAGATGATATTAAAATAGTTG
AAAAAGCAAATGGGTGTGAAATTACAGCTTTTGGTACAACATATACAACAGGACCAGGTAGTAATTTGGC
AGGTCTTGCCTATTCTTCAACACAACCATTGTCAGCTTATCCTTTTATATTTAATTTAGAAGGTGTGTTT
AAACAACAAGCAAATATAGGTTATAAAACAGTTGAGTGTAATATGTCATCAACCAATGGTACTGTATTAT
ATAAGGGTAAAATTGTGGCTGTACCTTCAGATGATGAGCCTGATTTTATTGTTTGTGGTAAGGGCTATAA
GCTTGATTGTGGTGTTAACGTCCTTTTAATACCATCTATAGTCCGCTATATTACCATAAATTTGACAGAC
CAATTACAAAAACAGTCTCTTAAGCCAAGGCGCCGGTTGCGTTATCAAGGCGTCAGGTTGGGTGGTGTAA
ATCTCGGAGAGCATCAGGCTTTTTCCAATGAATTAGTATCAACAGTAGGTTTTACAACATGGGTTTCGTC
TACCATTTGTAGTGATAAATCCCATAAACACCCCTGGTTTGTGCAAGTTCCTATTAATGAGAAAGACCCT
GAATGGTTTATCCATAATACATTACTAAAAGATAACCAGTGGGTTTTAGATGTTAAGCCTACACATTGGA
TGGTTAATGCAGACACAGATGAACAACTTTTTGCCCTATCATTGAGTGATGATGATTATATTAAGGCAGA
GTCCATATTGTCTAAATGGTCACCTATAACACAAGACGTTGAGTGTTGGTTTAAGGATTTGAAAGGTTAT
TATATAGTTAGTGGCTTGCAACCCTTATGGCCTGTTTGTCCTAAGAAAATTTGTAATTTGAAGATTGTGC
CAATTTACCAACCACAGTCTGTTAGGTATGCAGATCAACCAACCCATTTTTTTTCTATGCCAGTTGTACA
TAAAAATTTTTTAAATGCATTTTATGAGTTACAAGAAGGTTTTCCTGGTAAAAAACAGGTGGCTCCACAT
GTGAGTTTGACAATGCTTAGTTTGACTGATGAAGAAGTTATTAAAGTTGAAAATATCTTGGATGAATTAG
AGTTACCAACAACTTATATTACAATTACGAATCCACACATGATGGGTAGACATTATGTGTGTGAGGTGGA
AGGTCTACAGAGTTTGCATGACGAGGTAGTTTCAGTTTTGAGACAACACGGTATTGCTTGTGATCAGTCA
AGATTGTGGAAGCCTCATTTAACAATAGGTGAAGTTGTAGATGGTAGTAATTTTAGTGATTTTGGAGATT
TTGCTATGACGTGTAAAGTTGAGGATTTAGATTTTGTAAAGTTAGGTGCCCCAAAAGCAAATGCTAGATA
TGAATTTATTGCAACACTTCCTGTTGGTGATTTAAACTGTTAAGAGATGTCTGGAGCGCCTGCAGACATC
TCTGTTTTCAAAATGGCGCGTATCAGTCTTCCCGTTCTAAACATTATATAGATTTGGCAACAGAATATAA
TGCAGGTATTGTAAAGGTTAATAAGTCAAATACACATTCAGTTGAATTTGTTGGTAAAAGATATATGATA
AAACGTGTTAAAGACCAACATGAATTTGCATTGTCAAGAACATCCTTTTTACCTTCCATTATACCACACC
ATATGGTTAGTTATAATAATGAGTGGTTTTTAGTACGTGGACCAACAACTCAATGGAGTTTGGGTGACTT
GGTCTATGCCATTTGGTTGGGTGACCAGGATTATCTTGCTGAGTGTGGTTTTGTTTTTAATCCATCTAGA
GATGAGTTTTTTGAAGATGCAAAACAAAGATCTCATTTGGCATTTTTGCTAGAACCTGCAATTTTGAGTT
TTTGTGATATTTTTAGTTATATTAAGAAATTTGGCTTACCCTATAAGTTGACTTTAGATAATATGGATTT
GTGTGGAAATTTATATGATTTTGGAGATTACCCTTGTCCAAATGTTGTAGATAATCAGTCTGCCTTGTTT
GTTTTAGCTGAAGTTTGGTCTATGACACGTAAGCCTTTTCCACCTAAGTTTGCTCAAGTGTTGGCTTGCG
AGATGCAAGTTCCAGATGATTTTCAACTTCATTTTCAGAATACATTACTCTCGGGTAAGTATTTTGACAA
GGCTATGTGTCTTAATAATGTTAGACCATTTTTACAAGATCCTGCAAATTTAACGACAACACCATTTTTT
TCACAACATAGTGGTGTTTGGTCACATTTTTATAATCCTATTTATGGTTTAGTTGAAGTTGATTTGGATG
AATTTTCAAATTTACCTGAAGTTTTACAACAACTTATAACAGTTCAGGATCCTATTGCAAATAATATGCT
GCCTGCTATATCAATTGGTGATGGTGTTTTTTCTGCAAATGTTCCACCAGTTTTACCAGCCAAACAAAAG
GTTCCTTTGTATGATGTTGGTTTGTGTCAGGATTTAACTGATGCAGGTATTGATTGTGGAGAGGCATTTA
ATTATTTTTATTATTTGTCTAATCCTGCAGGAGCTTTGGCTGATGTTTGTTATTATGATTATCAGGGCAC
TGGGTTTTATTCACCTAAATTGCTTGCTGGTGTTTATGATTTTATGAAGAGAGTAACGGAGTGTTATCAA
ACAAATGAAAGGTTTACCTATGAGCAAGCAAAGCCCAGAAAATCATCTATGGGTGTTAACATTAGTGGTT
ATCAACAAGATGCAGTATACAGAGCACTTGGTCCTGAAAATATAATGAAGTTGTTTGAGTATGCACAGAA
AGCACCATTACCTTTTTGTACTAAAATTATTACAAAGTTTGCCTTATCAGCAAAAGCTAGAGCCAGAACG
GTTTCATCTTGTTCATTTATTGCATCTACAATTTTTAGATTTGCCCATAAGCCTGTAACATCAAAAATGG
TTGAAGCAGCTCAAAATTCACAAGGTTTTTGTCTTATAGGAGTTTCTAAATATGGTTTGAAGTTTTCTAA
ATTTCTTAAAGATAAATATGGCTCAATTGAACAATTTGATGTTTTTGGGAGTGATTATACAAAGTGTGAT
AGAACGTTTCCCCTCTCTTTTAGAGCCTTGACCGCCGCCCTACTCTATGAACTTGGAGGTTGGGAGGAGG
AGTCTTGGTTATATTTGAATGAGGTTAATTCCTATATGCTAGATACCATGATTTGTGATGGTATGTTATT
AAATAAACCAGGAGGTACATCATCTGGTGATGCAACTACCGCCCATTCAAATACGTTTTATAATTATATG
GTGCACTATGTTGTGGCATTTAAAACAATTTTGTCAGATCTTACAGAAAGCAATCGTGTTATGAGAGTAA
CAGCACATAATGCCTATACAACCGGCAATTATGATGTTTTTAATACCTTATTAGAGGAACAGTTTCAGAC
AAATTATTTTTTGAATTTTTTGTCTGACGATTCATTTATTTTTTCAGAACCTGGTGCACTTAAAATTTTT
ACATGTGAGAATTTTTCAAACAAACTTCAGACCATTTTACATACTAAAGTTGACCAAACAAAATCTTGGT
CAGCTAGTGGCCACATTGAAGAATTTTGTTCTGCACATATAATTAAAACAGATGGGGAGTATCATTTTTT
ACCATCACGTGGCCGCTTGCTGGCATCCCTTCTTATTTTAGATAAGCTGTCTGATGTAGATATTTACTAT
ATGAGGTTTGTTGCTATTCTTTGTGAGGCAGCTGTTTATTCTAGATATCAACCAGAATTTTTTAATGGTT
TATTTCAGGTGTTTTTAGATAAAGTTCAGCAGTTTAGAAGGGACTACTGTTGTGATCCATGTCCACCCCA
ACTTTTGGATAGATCTTTTTATGAAAATTTGGTTTTTACATCTAATACTGAAGTTGGTGTGGTTGATTGC
TATTTGGAAAATTTTAAATTACAGTGTGAATTTGAACAACAGTCTAGTTTAGATAAAGTTTGTTTTTGCT
GCCCCAACCCTGCAGTTTCTGTGTGTTGTGAGTGTTATGTACCTTTACCATTGTGTGCTTATTGTTATTA
TGTACATGTAATTATTAGTGGTCATAGTAAAATAGAGGATAAGTTTAGATGTCCATGTGGAAATGATGAT
ATAAGGGATTTATTTATAGTTTTGAATGATAGTATTTGTATATACCAGTGTAAAAATTGTGTTGGTAGTG
ATAGATTAAGACTTAGTTTGTTAAGTGATAGTGATCAAATTGTTAGATTGCCAGGTTTTAGAGCTAATTC
AGCATCCATAGCAAAAAATGGTGTTGCACAGCTTTTGACATCAGTTGATAATGTGGATATTTCTTTAGAT
TGGAACCATCAAGAAACTGTGTTACAAAATGTTGCTAGAATTGTTTATCATTCTGCAAACATGACACAGA
TGTCAATTGAGGTTGTTTATGTTAACTTCAACCTCATACGTAATGATGGTTCATCTGCTGTGCTTGATAT
TCCAAATTTTAAGTGTCCTGATACATCTTATTGTTTATTTTATAAGCCTGGCAAAACAGGAAGTTTAAAA
TTTACAGGCAAAGGAACATTAACATCATGTTATGATAATAAGAATTTAACTTGGTTCAAGGCTACATGTC
CAGATTTTTCACAACCATGGCGACAAGCTACATGTTTTGTGATTCAACAACATGATGCAGTTTATCCACC
ATTGAAGTCTACACAGTATGATAATGTAACATTTGTTATGGGACCACCTGGTACAGGCAAGACAACATTT
GTTTATAACAACTATCTTTCTAAGGCATCACCCTCCAATAGGTTTGTTTATTGTGCCCCAACACACCGTC
TTGTAGGTGATATGGATGAGAAGGTTGATGGTGCTGTTGTTGTTTCGGCATATAATGATCGCACATATCG
CAATCCTATTTGGAAGAAAGATGATTCATATGATATTTTGCTGTGTACACATAACACCTTGCCGTTTATA
AAAAGTGCTGTTTTGATAGTTGATGAAGTTTCACTTATACCACCACATGTTATGGTAAAAATTTTATCAA
TGGGCTTTAAAAAAGTTGTTTTGTTAGGTGACCCCTTTCAGTTGAGTCCCGTTTATAAAAATCATAAAGT
GCATTTTAAGTATGATACTTTTTATTTGTTACAATTAGCAACTCAAAAACGTTATCTTACTGCATGTTAT
CGCTGTCCACCCCAAATTTTAAGTGCATTTTCAAAGCCATATTGTGATGTTGGTGTTGATTTGGTTTCAT
TTAATAGTAAGCCTGGTAAATTTGATATTATTGTTAGCAAACAACTTGCAAATTTACAAGACTTTAGTGT
TTTGTCTGTTTTGGCAAAAGACTATCCAGGCTATACAATTCTTGTAAATTATAGGGCAGCTGTTGATTAT
GCTATGCAAAATGGTTTAGGTGATGTTACTACTATAGATTCTTCCCAAGGAACAACAGCAGCAAATCATT
TGCTTGTGTTGTTTGGTGCATCTAATTTTTCTAAGACTATAAACCGTGTTATTGTTGGTTGTTCCAGGTC
AACGACCCATTTAGTTGTTGTTTGTTGTCCAGAGCTTTATAAACATTTTCAACCCATTTTTAATTGGCCA
GAACCTGTATATAGGTATTTTGGTATGGAGAAGCAGTCAGATTTTAATATAATACCTGAAGTGTCATCAC
TAGTATTTTGTGATATAGAGTTTTGGCATTATAAAGCAGATCCTAATTTAAAAACACGTACAGTTTACCC
TGGACAAATTGCAGTTGTAACATCTCAAACTTTACAACTTTATTTGGGTGTGTTTGATGACACTGGTTAC
AAATCAGCATTACGCGGTTTGCCTAAGGATGTTTTTGTCCCACCAAATTGGGTTTGGATGCGCAAACATT
ATCCATCATATGAACAACATGCATATAATATGCAGCGCTTATTTAAGTTTATAATTGATACAACATGTGG
TCAGCCTTGTTTTATTTTGTATAGTTGTAGTAATGATTTGAAGAGTTTAAAGTTTTATGTAGAGTTTGAT
ACTAATTATTTTTGTGATTGTGGTGATTTAGCCATTTGCCTTATGCGCGATGGTTTATATAAGTGTAGAA
ATTGTTTTGATAATATGCTAGTTAGTAAGTTAGTAAATTGTAAATATTTAGATGTTCAGAAAGAGAGAGT
TAAATTACAAGATGCACATGATGCTATTTGCCAACAGTTTCATGGTGATTCACATGAGGCATTATGTGAT
GCAGTTATGACAAAATGTTTATATCTTACAAGCTATCAGGCTGCATTTAAAGATACATTACATGTTAAGT
ATAAAGATCTTTGCCTCGAGATACAATATAAGATAACTAGTCCATATGTGCGATATGATGGCGTTAACAA
ACGCTATTTGTATCGTGATCATGGGGCTATGTATTATTTTAGAACACCTCGATCACCAATGCAGAATGTG
TATAAATATGAAGTTGGTGCTCATGCTGAATATTGTATAAATATTTGTAATAGCTATGAAGGTTGTCAGT
CTTTTGGTAAAACATGTACAAAGTGTATACATATTCATTGTGTAGTTGAACAATTTTTAGCAGATGATAG
GTTTAAAGATTTTATTTTAGTTTCTGTTGTAAAGTCAGATTATATAGAGCAGTCATTATCACCTGCAGCC
AGGGCACTGATGTTAACTGTTACTAGGGTAGAAGGAAAAAATTTTTATACTTTAAATGGTCAGCGCTATG
ACTTGTATGACTACGATCTTAGCCAGTCTGTTATGCGCGTTGTTGGTGCTAGTGTTAAACCTCTTCCCTT
GTATTCAGTTGTTGTTGGTCTTGGCATAAATTGTACTGTGGGCTGTGTTTTACCAAATGTTCCTATGAAG
TTGAAGGACGATTTACTTGTTACGGATGTACCACTTTCTACTGTTAAATTAGATTTACCAACTTGGTACT
ATATAACATGGCCTACCTTGAGCAACAAAACATCGCGCTGGAAGTTTGCTGGTGCTCAAGTTTATGATTG
TTCTGTACATATTTATGTTGAGGCAACAGGTGAACAGCCCCTTTATTATTTACAGCTTGGCAACGGCGAT
AATCTTCGTGAGTTGCCTGATACATTATTTTCAACTGGAAGATTGTATAATTTGGAACATGACCCATCTT
TAAATTTTAATGTTCATCAGTTACCAGTTGAGACTATACCAAAAAATAAACATGTGTTTGCAGGTGATTT
TACTGAAGTTGGCACTGATATTGGTGGTGTACATCATGTTGTTGCATTGAATGGTTACAAGGGTACTATA
ATTCCCAATTATGTTAAACCAATAGGGACTGGCCTTATTAACGTTGGTAAGGCAGTTAAAAGAACGACCC
TTGTGGATGTTTGTGCCAACCAGTTGTATGAGAAAGTTAAACAGCAATTAGTAGATGTTAAAGTTAGTAA
GGTAATTTTTGTAAATATAGATTTTCAGGAAGTACAATTTATGGTTTTTGCTAAAAGTGATGATGATATA
CAAACATTTTATCCCCAAAAGGATTTTATAAGGTCGTATTATGAGTGGCCTCAGATATTACCAGCTTTGG
AGTCACATTACGACCTCAAGAATTATGGTCAAGATCCACTGTTTATGCCTCAACCAGTGAACTTTTCAAA
GTACACCCAAATATGCACATTTATTCAAGATCATGTAAAGGTTGCACGCAACTCTTTAATTTGGCATTTG
GGTGCTGCTGGTGTTGATGGTTGTTCTCCAGGGGATATTGTTTTGTCATCTTTTTTTAAAGATTGTTTAG
TTTATAGTTGGGATATTAAAGATTATGATACTTTGTTAGAAAAGCATAGTTATGATTGTAAGTTTAGGCC
AAATTTAATAGTTAGTGATATTTATAATGTTAGTAGTAATGTAACAGAAGTTTTAGAAGATTGTGTTAAT
AGGTTAGCATTGGGTGGCACTATTGTTTTTAAGACAACAGAAAGTTCAAGACCAGATATACAGCTTAGTG
AAATATCTAAATATTTTGCAGGAATTCAATTTTTTTCAACAGGAGTTAATACCTCTTCTTCAGAGGTTTT
TGTTGTCTTGAAATATAAGCTCTTTTCCGAACCACTTGGAGAGGAGTTGTGTTCACCCAATATTTTAAGA
CGAATTGCTGCATATAGAAATAAGTTATGTATAGTTCCTAATTTTAAAATTTTTAGTACTAGTTTAAGTT
ATAAGTTTAGTGGTGTTAAGTTTGTTCAAAAATGTTTTTATTGTTCTGTGCCACGTCAATTTTGTGCTTC
TGGATTAGTTCAGGAGGTACCTATGTTGTGTCAAATGAATCATTAATTGTAAGTGAGCCAGTATCTTATC
CCTTTTCTTTAGCTGTTCTTCGTTCTTTTACACAGCATGTTACAGGCAGGTTTAGGAGAGATGTTGTTGA
ACAGGTTTGGGATTTTGCTTACCAAATATCTACCAACCGGATAAGTGTTAATGGATGGGATGTTGTTTTT
AAGTCACCTTTTACTCTTAGTTATTCCAATGGTATGTTAAACACATCTGTTTTGTTATATGATGCGTATA
TGAAGTCATCAATTTCAAAATTTAGTTATACAGTTACAGCTTACACAGGACAACGCCCATATCTTAACAC
TCAGGTAAACGATTTAGCTAATGGCGGTTATACTGGTTGGTCTGATAGTGTTAGAGTTGATAACTGTGGT
AATTATGCATGTCATCCTGGAGGTAAGCCTGGGTGTTCTATTGGTCAACCTAGAATGTTACAAGGTGTTT
GTACAAGAATTTTGCCTACCACCCAGTCACCTGGTGTACAATTTTTAGGTATTAATTATCAACTAACCCC
TTATACTGATTATGTTTTATCTATGCCATTAACACAATCTGGTTACTGCCATAATAGTCCAGTTTATGTT
CAGTGTGGTGCTTGGACACCATATCGTTTGCACTCTTTTGGGTGTGATAGGGTTGGTTGTAATTATAATT
TAACAACGGATTGGGTTGTTGGCTTTAAGTCAAAAATATCACCTGTTACTTTGCCTCAAGAACTTCGGTT
GCCAATAGCTCAGAAAGTTTCTAGGAGGTTGGGTGTTAATGTACCTGATTATTTTTGGTTGGTTAAGCAA
TCTTATTATTATTTAGCACATTCCATTAAGTCTCCTAATTATTCTTTGTTTGCTGCACTGCTTAATTCTA
TTTTTCAACAGTCTCGTTTTTTGACTGATTTGTGTTATTCACAACCTTTTTTTCAAGTTCAGCAGTGCTA
TGATAATGCTTTATATTTACCTGATGCTGTTTTTACAACTTTATTTTCAACACTTTTTCAATGGGACTAT
CAGGTTAAGTTTCCAGATAGTAGTGGTTTACAGGTTAATGAAACTTTTTTACAAGTACCATCATATGAAT
ATGTTGGACAAACTGTTTCACAGGGCCAGATTTTAAATTTGTTTAAAGATGCAATGGTATTTTTGGATTT
TTTTGATACAAAATTTTATAGAGTTAATGATGGCCCTGGTGGTGATGTTTTTGTTGTTGTTGTTAAGCAA
ATGGAAGAGATAAAGTATAGTGATTTTAAGGTTAAGTTAGTTAATGGGTTTTTACAGGTTAGCTGCAAAG
ATGTTGTTAATGCAACACTTAAGCCACATGATTCACAGGTTATATTGCTAGCTAGGCATATGTCAATGTG
GTCTGTTGCAGCAGCCAATTCAACAACAATTTATTGTCCAATTTATACACTTACTCGTTTTGGAAAACTT
GACATTTCATCTTCTTGGTTTTTTCATACTTTAGCTAGACCATCTGGTCCTCTTAAAGAGATTTCTATGC
CCATTTTATCAACAGCAGCTGCAGGTGTTTATATGTATGCTATGCCTGAACATTGGCTTCCTTTTTTACA
ACAGTTGCAACAAGTATATCAACCAAGTCTTTTTAGTTTGGGTATTAATATGACACCTGCCAATTCAACA
CAACTTCAGGCATATGTTCAAACTTATACAGCTTGGTACTTGTCCATTATATATACTAAGCTTCCTGAGG
TTAGGAGGTTGAGTTTTGGCGCGCAGTTGGTACCTTATATTCAGGCTTTGCTTTCTTTTAGACAGTCAGA
TATTGATGCAACTGATGTTGATACTGTTGCTCGCTATAATACTTTGTGTCTTATGTGGGGTAGAAAGTAT
GCTGTTGTTTCTTATAGTCAGTTACCTGAATGGTCATTACCTCTTTTTAGGGGTGAAGTGGGTAGTTCAA
TGTGGTTTAGAAAAAGTATTACATGTGAAAATACACCTGCACATTTTTATCCCATAGTTGGCTATTTAGA
TTTTTTGGATTATAAATATATACCTAAGTATAATTCTGTTCGGTGTCCTAATACAAATGTACAACCAACA
TTGTTGCAAGTTTATGAAGTGCCTAATTTATTTGTTATTATAGTTCAGTGTGTTTTTGGTTCATATTCTT
GGTTTTCTGGCTTAACAGATAGTGGTGCCTATACCTTTTATAGGTCATATAAAATTGGCACTATTTGTAT
TTTGTTACCTTATACTACCCCTTCCAGCAGTATGACAACTATAGGTTTTTATGCACAGGAGTCATTACCT
ATACCTGTTATTACAACTACTGAAGATTTACTATCTAATTGTACTGGTATTTTTCAGGATGGTGTTTTTA
CACCTTGCCATCCTTCTGGGTGCCCTGTGCGTAGTTCCTATGATAATTATATTGTTTGTAAGGGTGACAA
TGAATCTAACTATACTTTAAGGAATTACCATCGAGTTTCTCCACCTGTTTATAATGTTCCCCTACCTGAG
GTTTCTTTAAATTTAACTGTGCCAACTGTTAATTTAACATCTTATAATCTTAGTCCATCAAATTCTGTTT
TACTACAAGATATTGATGGAGGAATTGTTGTAGATCATAATACTGGCTCAATTTGGTATCCTGATGGTCA
AGCATATGATGTTTCATTTTATATTTCTGTTATAATACGTTATGCACCTCCTAAGCTAGAATTGCCATCA
TCACTAGCTAATTTTACATCATGTTTAGATTATGTTTGTTTTGGAAACCAACAGTGTAGAGGTGAAGCAC
AAACTTTTTGTGCATCTATGGATTATTTTGAACAGGTGTTTAATAAAAGTTTGACATCATTAGTAACAGC
GTTAACAGATTTACATCATGTTTTAAAGTTAATATTACCTGAAACCACACTTGAACTTACTGAACCAGCA
CGTAGACAACGTCGTGCTGTTGATGAGTTTGCTGATAGTATTTCATTATTGTCTGAGTCATTTGAGAGGT
ATATGTCACCTGCTTCACAGGCTTATATGGCCAATATGATGTGGTGGGATGAAGCCTTTGATGGTGTAAG
TTTACCGCAAAGATCAGGTTCCATTTTGTCACGGTCTCCATCGATTTCGTCAACATCTTCCTGGCGATCT
TACTCATCCCGGACACCACTAATTTCAAATGTAAGAACACCTAAAACTACATTTAATGTGAAGCTATCCA
TGCCCAAATTACCTAAGGCATCTACACTCTCAACTATTGGTTCTGTACTATCATCTGGACTTTCTATTGC
ATCTCTTGGTTTATCTATTTTTTCAATTATCCAAGATAGACAAGTTACAGAACTTACTCAGCAACAGATT
ATGGCACTTGAGAATCAAGTAACAATTTTAACAGATTATACTGAAAAGAATTTTAAGGAAATACAATCTT
CCTTGAATACTTTGGGTCAGCAAGTTCAGGATTTTTCACAACAAGTAACTTTATCTTTGCAACAACTTTC
TAATGGTTTAGAGCAAATTACACAACAGCTTGATAAGAGTCTTTATTATGTTACTGCCACCCAACAGTAT
TCTATTTATATGTCATCTTTGATAAATCAGTTAAATGAGTTGTCACAAGCTGTTTATAAAACACAGGATA
TGTATATAACATGCATACATTCTTTGCAGTCTGGTGTTCTTTCACCCACTTGTATAACACCATCCCAGAT
ATTGCAGCTTTACCAAGTAGCTAAAAATTTGAGTGGTAATTGTCAACCTATATTTTCTGAACGGGAGATT
TCTCGTTTTTATTCATTGCCCCTTGTGACAGATGCTATGGTGCATAATGATACCTATTGGTTTTCTTGGT
CAATCCCAATTACTTGCTCAAATATATTAGGTTCTGTTTTTAAGGTACAACCTGGTTATATAGTCAATCC
ATTCCATCAAACAAGCTTACAATATGATTTACCAACACATGTTGTTACATCAAATGCTGGTGCATTGGTA
TTTAATAACCATTATTGTGACAGATATAACCAAGTTTATTTGTGTACCAAGTCAGCTTTTGATCTTGCTG
AATCTAACTACCTTACCATGATTTATTCAAATGTTACTGGTAATGGCAGTCTTACTTTTCATCCAGAACC
AAAACCTGATCCATGTGTGTACTTGTCAGCATCAACACTTTATTGTTTTTATTCAGATGTTTGTCATCAA
TGTGTTGTCACTGTTGGCAATTGCACAAATCGCACTGTTACCTATGAGAATTATACCTACTTTATTATGG
ATCAGCAGTGTAGGGGATTTGACCAGATTACTATTTCATCACCAGTGGATATTAGGTATGATTTTACAGC
AATACCATCTAAACCCCCTTTACCATTGCATTTGTCATATATTAATGTTACTTTTAATGTAACTTTACCC
AATGGTGTGAATTGGACGGATTTGGTGTTAGATTATAGTTTTAAAGATAAAGTTTATGAGATATCAAAAA
ATATAACACAGCTACATGAACAAATTTTGCAAGTATCTAGTTGGGCTTCAGGATGGTTTCAGCGATTAAG
AGATTTTCTTTATGGTTTACTCCCTGCTTGGATTACTTGGCTTACTTTGGGATTTAGCTTATTTAGTATT
GTTATAAGTGGTGTAAATATTATATTGTTTTTTGAAATTAATGGTAAGGCTAAGAGAAGTTAGTCACTAT
CTTTAGTTGAAGATTGCCAAGATGTTTGATACAAATTTTTGGCCTTTTCCAGACCAGGCACCAGACCCCT
TTAAAGCTCAAGTTGAGCAGTTATCACCTACTGAAAATGTTTACATTTTTCTTACAACACTTTTTGGTAT
ACTCCAGTTGGTTTATGTTATTTTTAAGTTACTATGTACAATGTTTCCAACATTACATTTTTCACCGATT
TGGAGGGGTTTGGAAAATTTTTGGCTTTTTCTCAGCCTTACATCTTTGGCAATTGCTTATTGGTGGCTTC
CTAGTATGACCTTTACTGGCTACTGGGCACTTACTGTAATTGCCACCATTTTAGTTTTAGTTATGTTAAT
TATGATGTTTGTTAAGTTTATTAATTTTGTTAAGTTGTTTTATAGAACTGGTAGCTTTGCAATTGCTATT
CGTGGTCCAATTGTTTTAGTAGCCCTTGATGTTACTATTAAGCTACATTGCACACCTTTTGCAATATTAG
TTAAAGAAGTTGGCAGTATTTTTTATCTTTCAGAGTATTGTAACAAACCATTGAATGCAGCTCAAATTGC
TGCACTTAAGATTTGTGTTAATGGACAATGGTTTGCTTATACTAGGTCATCAACCACAAGTGCAGCTAAA
GTGGCAGCTGCAAATAGTACTGCTAAATACCATCTTTTTATTTTGCAGGGTGTTGCTGATTATACGCAGT
TGTCAAGTGTTAAGTTTGAGTAGCCACTTATCTTTAGATGATGTTGAGGATGAGCCGTGTGCGTGGTCCT
CAATGTATTTTAATTTTTATTTTTTCTGTGGCATTTGCTGCCAAACCTATTACACCTCATTATGGTCCAG
GCCACATAACATCTGATTGGTGTGGTTTTGGTGATAGTCGATCCGATTGTACCAACCCTTCTACACCAAA
GAGTTTGGATATTTCTGAGCAGCTTTGCCCCAAATTTTCATCTAAAACAGGTTCATCAATGTTTATATCT
TTACATTGGAATAATAGTGATACTTTTACTGTTTTTAATTATTCAAATTGTGGTGTTGAGAAAGTGTTTT
ATGAGGGCGTGAATTTTTCACCACACCGGAATTATACATGTTATCATGAAGGCTCCAGTGGTTGGGTTAA
TAATAAGGCCAGTTTTTATACTAAACTTTACCAAATGTCAACAACATCACGTTGCATTAAGTTGATAACA
TTAAAACCACCTGAGAATATTCCACAACATTCACCTGGTATGTGTAATCCACAAACTAATAAGATTCCTG
ATAATCCACGCCTTATAACTTTAACCAATAATGGTTCTTTGTCCATACAATTTAGTTTACCAGTACAGTT
TGATGGCACTAATTGCACAAAACATCTTGTGCCTTTTTGTTATATAGATGGTGGTTGTTTTCAAACATCT
GGTTATTGTCACCCTTTTGGGTATTCATATTCTTCATCAGCATTTTATTATGGTTTTTATACTGAAGGTA
TACCTGTTGGTAAACATAATTATATTTGTGATTATTTAGAGATGCAACCAGGTTTATATAATGCAACTAC
TTTTGGTAAATTTTTACTTTATCCAACTAAGACTTATTGTATGGATACTATGAATATTACAGTACCAGTT
CAAGCTGTTCAGAGCATTTGGTCACAAAGCCGTCAATCTGATGATGCTATTGGCATGGCGTGTAAGTCAC
CTTATTGCATATTTTATAATAAGACTAAGCCTTATTTGGCACCCAATGGAGCTGATGTAAATCATGGTGA
TGAAGAAGTACGTGAGATGATGCAAGGTTTGTTGTTAAATTCCTCATGTATTTCACCACAGGGCTCAACA
CCTTTAGCCTTGTATTCTAGTGAAATGATATATACACCTAATTATGGTTCATGCCCTCAATATTATAAGT
TGTTTGAAACATCTAGTGATGAGAATGTTGATGTAACCTCCTCTGCATATTTTGTGGCTACTTGGGTGTT
GCTAGTTTTAGTTATTATTTTGATTTTTATTTTAATTAGTTTTTGTTTAAGTAGTTATTAGATTAAGTAA
GTGTGAGACACTATCTTTAGTGAGTGAGCCAAGATGAATTCTATGCTTAATCCAAATGCTATGCCATTCC
AGCCACAGCCACAAGTAGTGGCTATGCCCATTCAGTATCCTATGGGCTTTCAACCACGGTTTCAAAGGAG
GCGTAACCCTGGTTTTAGACCTATGTTCCAGAGGCGTAATAATTCTAATCAGAACCGCAGCCGTCAGAAT
AGATCACGTATTCTAAATCAACGACGTGGTCTTACATCTTCACGAAATCAACAGCGTTCCAATAGACGCC
AAAATAATCAACAACCGTTGTCAATGCCATTTGACCAACAGTTACTTATGATGGCAAATGAGACAGCACT
TTCTGCAACATTTCCACCTGAGTTGCAGAGTTTGGCGCCTACAAAGCTTGTGAAGATTGCTAAGAGGGGT
GCTATGCAGATAGTTTCTGGTCATGCTACTGTTGAAGTGTCCAGTGGTGAGCAAGATACGCCTCATAAAA
TTGCAACTTTTACAATAAAAGTGGCTCTTAATTAAAACCTTTTCAGCAACCATATGGTTGGTCTGTAATT
TAATTGTTTAGTGTTATCAACATGGCATAACTTGCCTCTGGCTCCACTGTGTAAACCATCCAGATTTTAA
TGGTTTTGCTGGATTTTATGGTTGAGTGTCTCCATGTAAGATGTTATGTTAGTTAATATTAGACCTACCC
CAGAAGTAGTAAAAAGCAGCC

>gi|594135072|ref|NC_023760.1| Mink coronavirus strain WD1127, complete genome
ACTTTTAAAGATAAGTGCGTGTAGCGTAGCTGCCCACCTTTCTTTAACTTGACTCTTGTCAATTCTACTC
AACTAAACGAAATTTTGTTACCACACATTTTATGTGGGTAACATTTTGGTAATTTCGTTTTTATCTAGCT
TGTTAACCATTCTGAGGTAGGGGTTTGGCTGGCTGAGCGTGTTCCGTCACGCTTAGTAGGTGCTTCAGCT
AGTTCCGTCTAGCTGTTGCGTGGATCCTAGTTCCGTCTAGGTGAAACCTTACTCCCCTCATTATGGGATC
CAAGCACTTTAAAATCCTTGTTGTTGAGGATTCAGAAATTACCGCACATGGCTACAAATCCTACAACGAT
TGTAGCAATGCTTTAAAGCTTTGCTGGCATGTAGGATTTGATGGCTATGTTTTTGTACCTGAATACTCTA
GAGACCTGCTTACTGGTTGTCGTGAACAGGAGTACGTTTTTGGTGTGTTCGGTGCTAATGATAATGTCAT
CAAACCCTGTTTCTTGGACGTGCAAACTGCCAATTTACAGGGTTTTATTGTACGTAGTAGTGCTATTGGT
GTTGAAGAAGATTTCTATCTTCGTATCAACAATATCGGTGGCACTGTTGTTTACGTAGATCAATTCCTCT
GTGGCGCTGATGGTAAGCCTGTCCGCCAAGGCGAGATGAAAGACTACTTCGGTGATCTAGAGGATATTGT
TATTGATGACATTACTTACAAGCATGCCTGGGAAGTCGCACGTGATATGGACGTTCCCCATGCTAAACAG
ACTGCTCTTAATGTTCAGTCTATAATATATCTTATGGATGTAGACCATAAGATTGTTAATGGCGCCACTC
GTCAACGTGCTGCGCCTGTGAAGATTAGTTCCAAGGTTTGTTTGACTGAGCCATACAACAGCCTGTATAA
ACAGTTTGGTTCGCCATACATGCAGAATGGTGGCAACTTGAATGAGTGCTTTTCCAAGCTTAACTTCATA
GTTGCTAACGTTAAATGTAAGTGTGGTGGTGAGTCTAGCGGTGTTGGTGATTGGACTGGTTTTAAATCAG
CCTGTTGTGGCACACCTGGTAAAGTTATTGGTGTGTCTATAGGCGACGCCAGTGTTGGTGAAGCTGTCAT
TACATCAAAAGGCTGTGGTACTGGGACTAAGTTTTATGCTGGTGCTGTTCTCAAGTATGTCGGTGATGCT
GAAGGTGTTTCTGTGTGGCGTGTCATGGCTACGTATGCCAATGACGTTGTTGCTACAACAACCTTCGACA
AGTGTAAATTAGCACTGCTTGATCATGATAGTAACAGTCTTGTTGCTAATAGTGTCAAGAAGTGTTATCT
CACTGGTGAACCCGATGCCACTGTGGTTGATGCCATTGTTGCTGGCCATGTTAACTTGTCCAGTAACATT
TTTGGTGCAATTCCTGTTCTTTTTGAAAAGACACCTTGGTTTGTTAAGAAATGTGGTGCCTTGTTTGAGA
CGGCCTGGCAGTCTATTTGTAAGTTTTTAAGTGCTGGTGGTTTTACTTATGTTGCTATAAGGGATGCCAT
CAACGCAATTTGCTCAATTTGTTTTACTATTAAAGATTCAAAACCTTTGTTCATAGTTTCTAGTGCTGCA
TCTAGTCTTGTTAGGACGTGTGTGCAGTTTCTTGAATCAGCTTTTGACATCTTTACCCAGACAGTTGAGG
TTGTTGGGGTCACTTGCAAATGTGTTGTTCTTGGTTGCAAGTATTTACTTTTTGACAATGCTCTTGTCAT
GCTTAAGGATTTAAAGCTTAAAGGTAAACGCGAAGCTGGTTTAAACACTGCCACGTTCGCGTCTGCTATT
ATTGGTGGCACTGCGGAAGTTAATCCTACTCGATTTGAAAATTCAACTGCAAACCTGACACTTGTGAATG
ATGTTGTTCAACCTGGACCAGGCTATGCCGTTGTTATAGGCGGTATGGCCTTTTATTGCACTGGTGATTA
CTATTTTATGATGTCATCACCTACCAGTGTTATCACAACATCTGTTTTTAAGGCTTCTACATTCAATGCA
TTTTGTTTGCGCTATGATGTAGAGGACCCTTACAAAACTAAGCTTGTTGCAAGATTTGGTAATGTGTACT
CTGCTAATGGTTGCATTGATGATGCAGTTGAATCTCTTAATGTGGCTCTGAAGGAATTTTACAGTAATGG
TGTGTGCTTTAAAGCATATGCAGACAAAGACATCATCGTTATAGAACCATTTTGTCGTAAATATAAAATG
CCAAAGTGTCTTAGAGATCACACTGGTCTTTGGGACATCATTCGGTCTAATGCAGGTGAGCCTGGCTTTT
TCAATAAGTATAAAAAGCTAGAAGCACTTGAGGATGTTTATGACAGTGATGATTATAAAAATCTGTTGTG
TCCTAAAGTTTTGTTTAGGCTAGACAATGGTATTATATGGTATAGACATATCAGGAGTGTTAAAAACTGT
AAAATAACACATGTAACGTGTACTTTTACAGGTGGAATCCTTAAGTTGTTATTGGATGGCTATGACGCTC
TTGCTGGTATGATAACTCGTGGTTACCAACAACTTTGCAAGGCGAAGCCATTCAAGCTTGATATTGCTGG
CGTGACGCTTAATGGTTTTACAACACCAATTGGTCGTGACTTCCTAGATTTTGGTGAGGATGTCGTCGAA
ATCTTTTGTGGTGGTAAAACACGCTGTTTTTCAGGTGCTAGCATTCCTGTTAGTGTTGAAAAGATTGTTG
AAGATGATGTCTGGTCTACAACTATTTTGGAAGAGACTGAGTATCAGCCACCAAAGAATGGAGGTGTTGT
GGTAGTTATAGATGGTTACACGTTTTACACTTGTAATCATGAACAATTCTACCCTTTTGGTGACAGTAAA
GTTGTCCAGAAATTGTACAACAAATCTGGTGGCGATGTTAAAAATGTGACCTTTAACGACACTGTGGATG
TTAGAGAAGTTGATCCTGTTTTCCAGGTGAAAATTACATATGAGTTTGATGATGACACTATTACTAATGT
TTTGAAAACAGTTATTGGTACCAGTGTTACAATAGAAGGTAACAACTGGGAGCTATTAGATGATACTCTG
ACAGAAAAGGTCGATGCTGTGTTTTCACAATTGCAACAAGCTGGCATTGAACTACCATCATATTACATAT
ATGATTGTGCAGGAGGTTTTGATGTTGGTTGCAACGATGGTATAATGATCTCACAGTATGATATTTGTGT
TGATGCACCCCTAGAAAATGTTGAAGAAGTTAGTGATGTTGAAGTTGTCGATGACCCATCTACTAATGAC
ACTGTGTCAGAAGTCGTAGAGGAGCATGTTGTAGTTTCTGAAGATGTTGAAGGAGTTGTTGATGAGATTG
TTTCTGATGTAGATGATGAACCTATCACAGATGTTATGTCACCATTCGCATTTCCGAATAGCATGATTAA
TGGCAAAGTGGTGCTTAAACAACACCAGAACAATTGTTGGCTTAATGCTGCAGGTTACCAGTTACAGTGT
TTGAAGGCTTTAGAAGATGAATCTTTCAAACAATACTGTGCTGGTGATGTTGCACCATTTGTGCAATTGA
TGTACGCTGTGACTAACAGGAACATTGGTGACCTTGGTGAGGCGGAGTATGTTTTAGAGCAACTTCTTAG
TAGTGCTCAAACTGCCAAAGTGAAGTTGTCAGCTTTATGTAGCTGTGGCACTATGGAAGAATTGATTTCT
GGCTGTGTTTTTAGAATGCGCTGTACTAGTGCTACCTTTGACTATGGTGTCTGTGGTGTTTGTAAAACTG
TTAAGAAGACAACTATAGTTGGAATTGAAGGCACTGGCGTTTTTGTGCATGATCCTGCTAATTACAAACC
ACTTGTTAAACCTGTTTGCAAAGCAATTTTTAAAGGTTCAACAACGGGAGGTCATTATATGGTGCATGAT
GTTCTGGCAAAAGTGTTAGTTGATGGTTTTGGTTTGCATCCGGTTCAGAATTTGCCTTTTACATCTGTAT
GCTTTGTTAATGCCAAATATGTTAAGGAAATTTCTAAATGTGCACCTAAGGCTAGTGAAGACCCCTGGGC
TAAAGCTGTTGACGTACAAGAGAAACAAACTTCTGTTGTTACATCGTTTAGCCAACAAGCATGTGAGGAC
AAACCTATAACTGTTGAGCAAGGTACAGTACAAACCTCAATTGAGTGCGTAGCAGAACAATCGATTGTTG
TTGCAACACGCAATCAGGAGATCACAGAGGACAAATCTATAACTGTTGACCAAGGTACTGTAAAACCCTT
AATTACTGCAAAACCAGCAGTTGAACCATTTTTTGTCACAGGTAATATTAAATTTTACAGGGGTGATGTT
AAGTCTCTTGTTGAAAACCTTAAACCTAAAGTATTGGTTAATGCAGCTAATTCCCACCTACAACATAAAG
GTGGTGTTGCTAAAGCCATAGACGCCTACACAAATGGCGCTCTTACTAGGGAGTCTGTTGAATACTTTAA
ACAGTACAAACCTATTCCCCCTGGTAACATTGTGGTCTTTAATGATGTTTGGAAAGGTCTTAACATCGCT
AATGCTGTGGGACCACGTGTTTCAGAAGAGCGTTGTGCACAAAAATTGGACTCTGTTTATCGCAAAATGA
CTAAAATTGAAGGTCCCATTTTGACACCACTTATTAGCTGTGGTGTTTTTGGTGTGCCATTGGAACAATC
ATTACGCTCACTTCTTGCTGCGTTTAAACAAAAACCTATTTGTGTTTTTGTGTACACAGAAGCTGAAGAA
CGTAAGGTTTTGGATTATTTCAAAACACCTGTGACTGTTGTAGTAAAAGATTGTAACAAAGTCACAAAGA
ATACTGTTGATGCATCAGCTACTATTGGTGTTCAATTAGGTTCCAGTGTTGTTTTGAACGATCAGGATTA
TTCCAAATGTGTACCAGATCTGTCAATGGCGCAAGCTACAATTACAAAGGTAGTTGACGTTGATTGGTGT
GGTCATTATGGCTTTGAAAATGCTGCCGTTTTTAGTGCGTCTGATCACTCAGATTATAAGTTTGAGAGTG
CCATTGTTAATGATAAAATTGTGTTTAAGCAAAGTGATAACAATTGTTGGGTTAACTCCCTATGTTTGTT
GTTGCAGGATTATAAACCCACTTGGCGATTTCCTGGCATGGAAGATCTTTGGTCTAAATTTGTTAGTGGT
ACAACAGAACCATTTGTGCACTTCTTGTATTTTATCACGGGCACTACGAAAGGTCAACCTAATGATGTGG
AGCTTGCACTTCATAAATTAGAACCTTTACTGTGTGCTAGTGGGTCAGTCACTTTGGATGAATTTAGTGG
TTGTGATTGTTGTTATAATCGTAGTACTATAAGTGGTCCCATAGTTGCAGTACCACTACAAACTCTTGGT
GATAAGGCGGTTTGTAGACATGGAGTGAGAGTTACAACGCGAGTGCATAAAATTCAGGGTTCTGTTATTC
TAACATCGATTAATGGTTCTGTCACAGATTGTTTGAAAGGTGATGGTTATGTTTGTTTTACAGGTAGTAA
GGATAGAGGACATTACACTTACTACTCTGGCGTTATGTATGACGCTGACAAAACATACCCTTTCAAAGTT
TCTGACCTTAGTGTAACATCAGTTCTAATTTCAAATGGTTACACTGTGCCAGTGGTACAATCACCGAGAA
TTACTAGAGACCTGCAAGTTGTTGACAATGATCTTGATGCTATACAAAAATTGGACAAGTATGCAAATAA
GTTTTTTAAGTTTGGTGACACTGTGGCTAAGACAATTTTAGCGGTGTTTAAATACTTACTTTGCTGTTAT
TTTTTCTTACTAGAAAATTGTACGAAATCTAAAAAGTTGAAGGTGAAGGTTAAGCCTCCGTTTGTCGTAA
AGCCATTAGACGTCAAATTACGAGCTCTTAACTCTATAACACTTTTAACAAATACCAAATTTTGGTTTTA
TATTAAATTTTTGTTAGGTTTATTATTGTTGTACAACTTACTTTATGTTGTTGTTAGTGTACCATTGTTT
CATAAGGTAGCATGCTCAAGGTACAGTTCTATGTATGCGAACTCTAGTTTTGTTAAGTCAGATGTTTGTT
CGAGTTCTGTGCTGTGCAAAGCTTGCTTATCCTCTTATGAAGAACTGTCGGACTTTGACCATCTTAGAGT
TGTCTGGGATTACAAGTCTGACCCACTTTGGTATAAATTGGTGCAACTATTTTATTTTGGCACTCTCATG
ATTTTTGGTAACAATATTGTAAGATTTTGTATGTTGTATTTTGTTGCACAGTTGTTTAATAATTGGCTGT
CTTACTATGGTTTGGTCAATTATAGTTGGTTTTTAAACGTAGTTTACTTTGAAACTGTGGCTGCAGAGTT
GGTGGTTATTATGGCGGTTATTAAAGTGTTTTTCTTTTTAAAGCACTATTGGTATGGTTGTGACAAAGCT
GATTGTAAATCTTGCTCTAAAATTGCAAAGCAAAATCGTATACCTGTTAACGTAGTTGTTAATGGTAGTA
TTAAATCAGTCTATGTCCATACTAATGGTGGTTCTAAATTCTGTAAGCGTCATAATTTTTACTGTAAAAA
TTGTGACTCTTATGGTAGTGACAACACTTTTATATGCCATGAAATAGTTAAAGATTTGTCTAGTGCTGTC
AAACACCCAGTTTATGCCACAGATGTCTCATTTAAAGAAGTTGATAAAGTTGAATGCTCTGATGGCTTTT
ACCGTTTTTACACCGGTGATGAGTACACTCGTTACAATTTTGATGTTACAGATAAAAAGTATAGTTGTAA
AGAAGTCTTAAAGTCCTTACAGTTGCTTGATGATTTTGTCATTTATGATCCTAATGGTACAACACCCGCT
AATTTACATAATGCTTGTGTGTATTGGTCCCAATTACTAGGTAAACCTATAAAACTAGTAAACAGAGATC
TCATACAATCATTGACGGTTGATTTTAATGGTGTTCTGTTAGAAGCGCATAAGCGTGTTGTGGGTAACTC
CTTCAATGTTGATGTTTCTAACTGTAAAACTTTACGTGAGTGCTATGAAGCCTGTAAAACAGATGTGCCT
TATCATACTTTTGAGGATGTCGTTGTACATGCACATAAGTATGATGTCTTAATGACAGACCTCAGTTTTA
ATAATTTTTGGTTGACATATGCCAAGCCTGAGGACAATTTAACGTCCTTTGATATAGCAAATTGTATTAG
GGCTAATGCTAAGGCTGTTAATCATAGTGTCTTAAGTAAAGAGAATGTACCTATTGTGTGGTCTGCAACA
GACTTCGTAAAGCTTAGTGGTGAAGCTAAACATTTGTTAATAAAGACAGCGAAAGCTAAAGGTGTCACAA
TTATGATTACACTTAACACAAATGTTATGAGCCACAACCTTCCTGCTGTTGCAATTGGGCGCAAGAGTGG
CTCTGGATTTTTTGACATTTACAATGAGTGTAAACAGGTTTTGCGGCTATTGCTTGCTATTGTGTTAGTG
TGGGGTTTGTTTAGCTGTTATAATGGTTACACACCCACATATGTAACATCTGCTGTCGGTTATGATTTTA
TGCTTATTAAGAATGGTAAGATACAGAGCTTTGATGACACCATTGATTGTGTACATAATGTCTACAAAGA
TTTCCCATTATGGTACAAAGGCAAATATGGCAGACAAATCACATACTCTCGTGCTTGTCCCATAGTTGTA
GGTACTGTGTTTGACCTTGTAGACAATATGAGACCTGTACCAGATGTGCCGGCTTATGTAACACTTGTTG
GACGCTCTCTGATTTTTGCCATAAACGCCGTCTTTGGTAATACTGACTTGTGTTATGACCACCAGGGTGT
AGCAAAATCTAGGAATTCTATTTTTGACAATTGTGTTTATAATGCCGCTTGTACACAGCTTACAGGTATG
GGTGGCACAGCCATTTACTGTTTTAAAGAGGGTGTTATGAATGGTAACATTTTACAACACAAAACTTATG
CTGACATCGCACCAGAAACCTTTTATGAGTTGAAAGATGGTAACATGATAAAGTTGCCTACAATCATAAG
GGGTTTGGGTCTGCGTGTTGTACAGACGTTATCTACTACATATTGCAGGGTTGGTGAGTGTACTCAATCC
AAGGAAGGGTTTTGTGTGGGTCTAGACAACTGGTTTGTGTATGACAGAAGCTTTGGTGATGGTTATATTT
GTGGTGATAGTGTTTTTGGTTTTGCAACTAATGTGTTTAGGTTGTTTAACCAAAATTTATCAGTTGTTGC
AACATCAGGCTATATGATTACTAACTTGATCATAGCCTTGTGTGCCATAGCCGTGTGTTACTTCTTTTTG
AAGTTTAAACGTATTTTTGGCGATTGTTCCATGTTAGTTACTATTATTGTTATTACACTACTGTGTAATA
ATATTTCTTATTTCTTTACTAGAAATTTGGTACTCATGATTGTTTATGCTACTGGTTATTATTTTCTGTC
TAGACGTTTACCCTATCCAGGTGTTATGGATTTAGGTTTTATAATTGCTTACTTTAATATGGCACCTTGG
TGGATCCTTATTAGTTATTTGTTAATGTTCTTTTATGACTCTTTACCATCTTTCTTTAAACTAAAAGTCT
CTACACAGTTGTTTGAGGGTGATAAATTTGTTGGTAATTTTGAGTCAGCTGCATCTGGTACTTTCGTTAT
TGACATGCGCTCCTATGAAACTATTGTTAATTCTATACCTATGGAGCGCTTGAAAGGTTATGCAGCAACT
TTTAATAAGTACAAATATTATACTGGCAGTATGGGTGAGTCTGATTATCGCATGGCATGTTATGCTCATT
TAGCACGTGCTTTATTAGATTATAGTGCTAATCGTAATGATATTTTGTACACACCACCAACTGTCAGTGT
TAACTCGACTTTACAATCTGGTCTCAGAAAAATTGCACAGCCGTCTGGTATTGTAGAACCTTGTGTTGTC
AGAGTTGCATACGGCAACACAGTTCTAAATGGTTTGTGGTTAGGTGATGAAGTCATTTGTCCTCGTCACG
TTATAGCAAGTGATACTACAAAGACTATCAATTACGAGTCAGACCTTTTAGGCGTACGATTACATAACTT
TTCAGTGTCTAAAGGTAATGACTTTTTAGGCGTTATTGGTTGTTCATATAGGGGTGTTAATCTTGTTATT
AAGGTTAGCCAAGTGAATACACAAACGCCCAAACATAAGTTCAGGACTGTTAAAGCTGGTGATAGTTTTA
ACATCTTAGCTTGCTATGATGGTAAACCTAATGGTGTTTATGGTGTTAACATGCGTACTCAGGGTACTAT
TAGAGGTTCTTTTATAAATGGTACCTGTGGCTCCCCCGGATACGTCCTTGAAGGTGACACAGTACATTTT
GTGTACATGCATCATTTAGAACTTGGAAATGGTTCTCATGTAGGTTCAGATTTTAATGGTGTTATGTATG
GTGGTTATGAAGACCAGCCTAGTTTGCAGTTGGAAGGTGCTAATGTGATGTCTACGGATAATGTAGTTGC
ATTTTTGTATGCAGCTATTATTAATGGTGAACGTTGGTTCATTAATAGTGGTTACACATCATTAGAAACT
TTTAACAACTGGGCCCGCTCTAATGGTTACACTGAATTAGCGTCTATTGACGTTTTTAGTATGTTAGCTG
CTAAAACTAGCATTAATGTGGAACGCCTATTAGATGCTATTATGCGCTTGTCAACAGGGCTTGGAGGTCG
TACGATCTTAGGATATGGTTCTTTGAGTGATGAGTTTACGCCAACAGAAGTTGTGAGACAGATGTTTGGC
GTAAATTTACAAAGTACAAAAGTTAAATCCTATTGCTACCCTGTTTTAATGATTTGTGCATTTTTGTTTG
CTTTTTGGTCAGAATTTTTCTTATACACACCTTTTACATGGTTTAGTCCTACAATGATAAGTTGCATTTT
GTTTGTAACAGTTGTTATTTCAGCTATTTTTACTACATTTGTGAAGCATAAAATGTTGTATTGCAGCTCA
TTTTTGTTACCTAGCATTATTCTTATGACTTGTAGCAATTTAGTGTGGGACTATTTTTATTTTGAGGCTG
TGCAGGCAAAACTTGTTGAAATCAACCTTTCTTTGGTTTCTATTGATATGCAAAGTGTGGCTTTGATTAT
TCTTTGTGTTCTGATTGCTTGTGTTCATTGTTACAGGTTTGTCACACAAAAACAATCTATTCCTGTTTGT
TTAATAACTTTGTGTTTTGTATGTTACAACTTGGTTGTTCAATGGTATTACTTGCTAAGAAGTTCTGATG
TTGGTGTTAACCTACAGTTCGGTTATATTAATTTAGGCATGATGGTTGTTTGCTTAATAACTAAAGATTG
GGTTGTTGTTGCTGTGGCCTATCGTTTGGCTTACTACACAGTGTTTTATTTAATACCAGAACAAGTTGTT
TTTGATTTTGGTGTTATTAAATGTTTGTGTGTAATTTACATGTTGTTTGGATATGTTAGCTGTTGTTATT
ATGGTGTTTTATATTGGATCAATCGTTTCACGCATATGACTTGTGGTGTGTATCAATTTTGTGTTTCAGC
TGCAGAACTTAAATATATGACAGCTAACAACTTGACTGCACCTACAAATGCCTATGAGGCTATGGTTTTA
AGTGCAAAATTGGTTGGTATTGGTGGTAACAAGAACATTAAAATAGCCTCTGTACAGTCTAAATTGACTG
ATATGAAATGTACCAATGTGGTGCTACTAGGCTTGCTTTCAAAAATGCATGTAGAAGCTAACTCTAAAGA
ATGGAATTATTGTGTTACACTTCATAACGAGATTAATCTCAGTGATGATCCTGATGTTGTGCTTAATAAG
CTCTTGGCATTGTTGGCATTTTTCTTGTCTAAACACAACAACTGTGACTTGTCTGAGCTTATAGACTCTT
ATTTTGATAATGCGTCCATTCTTCAGAGTGTGGCTTCTGCTTACGCATCGTTGCCATCATGGGTTGCTTA
TGAACAAGCACGTGATGCATATATGGAAGGTAAGAAGAATGATGTTGCACCGCAAATCCTCAAACAATTA
CAAAAGGCTATGAATATTGCTAAGGCTGAGTTTGATCGTGAAGCTAGTGTGCAAAAGAAGTTGGACCGTA
TGGCAGAACAAGCAGCTTCTAATATGTTTAAAGAAGCACGTGCTGTTGATCGTAAATCTAAGATTATAGG
TGCTATGCACAGTCTACTTTTTAGTATGCTTAAGCGACTGGACATGTCATCTGTTAACACGTTGATCGAC
CAAGCACGTAATGGTTGTTTACCACTTAGTATAATTCCAGCTGCATCTGCAACACGGTTAGTTGTTGTGA
CGCCTAACATAGATGTTTTCTCTAAAGTTAGACTAGAAAACAATGTTCACTACGCAGGCGCGGTTTGGTC
TATAATTGAAGTACGAGATTCTAATAGTTCCATTGTGCACCTTAAAGAAGTGACACAGGCAAATGAACAG
AATTTGTGTTGGCCTTTGACTGTTACGTGTGAACGTGTTTCCAAATTACAGAATAATGAAATTATGCCGG
GTAAAATGAAGGAGCGTGCTGTTAAGGCATCGTCTAGTGCAGATGGTGATGCTTGTAGTAATGGTAAAGC
TCTATTTGCCGCTGAAGGTGGTAAACATTTTATGTATGCGTTAATTTCCAATGATGGTAATTTGAAATAT
GTTAAGTGGGAAGGTAATAATGATGTTATTACCATCGAACTCGAACAGCCACTTAAGTTTTATGTGGAGG
GTGCTAATGGACCTGAAATTAAACATTTGTACTTTGTTAAGAATTTGAACACTTTGAGGCGTGGTGCTGT
TTTAGGTTACATTGGAGCTACCATACGTCTACAGGCTGGTAAGCAAACAGAACATCCTTCTAATAGTAGT
TTACTTACACTGTGTGCGTTTGCACCTGAACCTGCAAAAGCATATGTTGAACTCGTAAAGAAGGGTATGC
AGCCTGTGAATAACTGTGTTAAGATGTTGTCTAATGGCTCTGGTAATGGTATGGCTATTACCAATGGTGT
AGAAGCAACACCTAACCAGGACTCGTATGGTGGTGCATCAGTTTGCATTTATTGTAGGTCACACACTGCA
CATCCATCTATTGATGGTATGTGTAGATTTAAAGGCAAGTTTGTACAAGTTCCTGCAGGTACTGCAGATC
CTATACGGTTTTGTATAGAGAACGACATTTGTGCTGTTTGTGCGTGTTGGCTTAACAATGGTTGTGTTTG
TGATAGAACATCGATGCAAGCTGCTGTCGTAGATCAGAGTTATTTAAACGAGTACGGGGTTCTAGTGGAG
CTCGACTAGAACCCTGCAATGGTACAAGCCCTGATTGTGTTACAAGGGCTTTTGATGTTTACAATGCTGA
TGTGGCATGCATTGGCAAGTTTCTTAAAACCAATTGTAGTCGTTTTAAAAACTTAGATGCACATGATGCC
TATTACATTGTAAAACGTTGTCGTAAAAGCGTTATGGACCATGAGCAAGTCTGTTATAACGCTTTAAAAC
ATTCCAATGCCTTAGCTTCACATGATTTTTTTGAGTATAGTGAAGGTAGACATGTCTTTGGTAATGTTTG
TAGACGCAATTTGACTAAGTATACAATGATGGATCTTTGTTATGCACTGCGCAATTTTGATGAGAAAAAT
TGTGATGTTCTTAAAGAAATCCTGGTTCTTACCAATTGTTGTGATAGTACCTTCTTTGATAATCCTGACT
GGTATGACCCTGTGGAGAATGAAGCTATTCATGTTGTATATGCCAAGTTAGGACACATTGTTGCAAATGC
TATGCTTAAGTGTGTGGCTCTTTGTGATGCTATGGTTGAAAAAGGTTATGTTGGTATTATCACTTTGGAT
AATCAAGACCTTAATGGTAACTTTTATGATTTTGGTGACTTTGTTTCTACAATTGGTGGTTGCGGTTGTG
CTTGTGTCACATCTTACTATTCTTACATGATGCCAATTATGGGTATGACATCATGTTTAGAGTCTGAAAA
TTTTGTTAAAAGTGACATTTATGGTTCTGACTACAAACAGTATGATTTGCTGTCTTATGACTTTACAGAG
CATAAAGAGAAATTGTTTAATAAGTACTTTAAATATTGGGACCGACCATACCACCCCAATTGTTCAGATT
GTGTGGATGATGCTTGTATTTTGCATTGTGCAAACTTTAACACCTTATTTGCTACTACGATTCCCATTAC
AGCCTTTGGACCTTTAGTTAGGAAAGTTTTTATTGATGGTGTTCCTATTGTGGTCACAGCTGGTTATCAC
TTTAAACAGCTTGGTTTGGTGTGGAATAAAGATGTTAATGTTAACAATCAGAAGTTGTCTATGACTGACC
TTCTTAAATTTGTAACGGACCCCTCTTTGTTAGTTGCATCAAGTCCAGCTTTGTTAGATCAGAGAACAGT
TTGTTTCTCAATAGCTGCTTTAGGCACAGGTGTAACGTATCAGACTGTCAAACCTGGTCATTTCAACAAA
GAGTTTTATGACTTTATTGTTGAAAGAGGTTACTTTGCAGAAGGTTCTGACTTGACATTAAAACATTACT
TCTTTGCACAGAGTGGTGAAGCTGCTATAACAGACTTTAATTACTATCGTTATAATAGAACCACTGTTTT
AGACATTTGTCAAGCTGAGTTAGTGTTTCAGATAGTGGCGAAATACTTTGACTGTTATGATGGTGGTTGT
ATTACAGCTCGTGAAGTTGTAGTCACCAATTATGATAAGAGTGCAGGTTATCCACTTAACAAGTTTGGTA
AAGCTAGACTTTATTATGAAACTCTGTCATATGAGGAACAAGACGAGCTTTTTGCAACTACTAAGCGTAA
TGTGCTACCCACTATGACACAAATGAATCTAAAGTACGCGATTTCTGGTAAGGCTAGAGCACGTACTGTG
GGTGGTGTTTCGCTATTATCCACTATGACAACACGGCAGTATCATCAGAAGCATTTGAAATCTATTGCTG
CCACACGTAATGCTACAGTTGTGATTGGCACTACTAAGTTTTATGGTGGCTGGGACGATATGTTGAAAAA
CCTAATGCGAGATGTTGACAATGGCTGTCTTATGGGTTGGGATTATCCGAAATGTGATCGTGCATTGCCT
AATATGATTAGAATGGCGTCCGCCATGATATTAGGTTCAAAACACGTCGGATGCTGCACCCATAGTGACA
GATTTTATCGTCTGTCTAATGAGTTGGCACAAGTTCTTACAGAAGTTGTACACTGTACGGGTGGCTTTTA
TATAAAACCTGGTGGTACAACTTCTGGTGATGGTACTACAGCTTATGCTAACTCTGCATTCAACATATTT
CAGGCTGTCTCTGCAAATGTCAATAGACTTTTAAGTGTAGATTCTAACACCTGTAACAATTACAATGTTA
AAGCATTGCAGCGTAAGATATACGATAATTGTTACAGAAGTAGTGTTGTAGATCCCTTGGTCATAGACGA
GTATTATGCTTATTTGCGTAAACACTTCTCTATGATGATATTATCTGATGATGGCGTTGTTTGTTATAAT
AAAGAGTATGCAGATTTAGGTTATGTTGCTGACATAAGTGCTTTTAAATCTGTACTTTACTACCAAAACA
ACGTCTTTATGTCTTCTGCCAAGTGTTGGGTTGAACCAGACTTAAGTGTGGGACCACATGAATTTTGTTC
GCAGCATACTATGCAAATTGTAACTCCAGATGGTGATTATTATTTACCATACCCAGACCCTTCTAGAATC
CTTAGTGCTGGTGTGTTTGTTGACGATATTGTCAAAACTGATAACGTTATCATGCTTGAGCGTTATGTTA
GTTTGGCAATTGATGCTTACCCTTTGACAAAACACCCTAAGCCATCATACCAGAAAGTGTTTTACACATT
GTTAGAATGGGTTAAACATTTACAGAAAACTTTGAATGCTGGTATATTGGATTCATTTTCTGTGACAATG
TTGGAAGATGGCCAGGATAAATTTTGGAGTGAAGAGTTTTATGCTAATCTGTACGAAAAGTCTACTGTTT
TACAAGCTGCGGGTATGTGTGTTGTTTGTAGCTCACAAACAGTACTAAGGTGTGGTGACTGTTTGAGACG
TCCTTTACTTTGTACTAAGTGTGCATACGATCACGTCATGGGAACAAAACACCATTTCATCATGTCTCTT
ACACCATATGTATGTAGTTACAATGGTTGTAATATTAATGATGTTACCAAATTATACTTGGGAGGTCTTA
ACTACTACTGTATGGATCATAAGCCACAATTGTCATTCCCGCTTTGCGCGAACGGCAACATCTTTGGTTT
ATACAAGAGTTCTGCTGTTGGTTCACCAGACGTGGAAGATTTTAACCGTTTAGCTACATCAGATTGGTCA
AATGTTGAAGATTACAAGCTAGCTAATGTTGTTAAAGAATCTTTGAAGTTGTTTGCAGCTGAAACTATTA
AAGCTACTGAGGAATCAGTTAAGTCCCAGTATGCTTGTGCTGTGCTTAAAGAAGTTGTAGGTCCTAAGGA
AGTTGTTTTACAATGGGAAGCTTCTAAGACAAAGCCACCACTTAATAGGAATTCAGTTTTTACATGTTAC
CAAATTCTTAAAGATTCAAAAGTACAATTGGGTGAATTTGTTTTTGAGCAAACAGAGTATGGTGGCGATG
CTGTTTATTACAAGAGCACTTCTACTACTAAGTTGGTGCCTGGTATGATATTTGTTTTGACGTCTCACAA
CGTTGGAGCTTTGAAAGCACCAGTTTTGGTTAACCAAGAAAAATACAGCACCATTTCGAAGTTGTATCCA
ACTTTCAATATAGCAGAGGATTATGCCAACTTGGTACCATACTATCAGATGGTAGGTAAACAGAAGTTTA
CAACCATACAAGGTCCTCCTGGTTCTGGCAAGTCACATTGTGTTATTGGCTTGGGGCTGTATTATCCTGG
TGCACGTATAGTTTATACTGCTTGTTCACATGCAGCTGTTGATTCACTTTGTGAAAAGGCTGCTAAAAAT
TTTAATGTTGATAAATGTTCGCGTATAATTCCTATGCGCGCTCGTGTAGAATGTTACTCAGGGTTTAAAC
CTAATAACAACAATGCCCAGTACATTTTTAGTACTGTAAATGCATTACCAGAATGTAATTGTGACATTGT
TGTTGTTGATGAAGTTTCTATGTGTACCAATTATGAGCTTAGCGTTATTAACAGTCGTGTAAGCTATAAA
CACATAGTTTATGTAGGAGACCCACAACAGTTACCCGCACCACGTACATTGATAAACAAGGGAGTTCTAA
AACCGCAGGATTATAATGTTATAACACAACGTATGTGTACATTAGGTCCAGACGTGTTTTTACACAAATG
TTTTAGGTGTCCGGCTGAAATTGTTAACACAGTCTCTGCTTTGGTTTACGAGAATAAATTCAAACCTGTA
AAGCCAGAATCAAAACAGTGTTTCAAGATGTACGTAAGAGGTAACGTTCAAATTGATAATGGTTCTTCTG
TTAACCGTAAACAATTGGAAGTTGTTAAGCTGTTTTTAGCAAAGAATCCAAAGTGGAAAAATGCCACCTT
CATCTCGCCATACAACAGTCAAAATTATGTGGCTCGCAGACTCCTGGGTTTACAAACACAAACCGTGGAT
TCTGCACAAGGTAGTGAATATGACTTCGTCGTGTACACGCAGACATCGGATACAGCACACGCTGTTAACA
TTAATAGGTTTAATGTTGCAATAACGCGTGCTAAAATTGGTATACTGTGTGTAATGTGTGACAAAGCCAT
GTATGATGGTCTTAATTTCTATGAAATTAAAGATGTCAACCTACAAGTGAAAAGTGAAGGTTGCGGTTTG
TTTAAAGATTGTGCTAAAGTGGAACACTACATACCACCAGCATATGCCACCACATACATCAGTTTGTCTG
ACTCTTTCAAAACTAACAATGGTTTTGCCGTGGATGTTGGTAACAAACCTGTTACGTACGCGTCTGTAAT
CTCATACATGGGTTTTAGGTTTGATGCCAACATACCTGGTTATCATACCTTGTTCTGTACACGTGATTTT
GCCATTCGCAATGTTAGAGCATGGCTGGGCTTTGATGTTGAAAGTGCGCATGTTTGTGGTGACAATATTG
GTACAAATGTGCCATTACAGTTAGGGTTCTCTAATGGTGTAGATTTTGTTGTACAACCTGAAGGTTGTGT
TGTTACAGATAAAGGAAGTTCCATATGTCCTGTTAAGTCTAGAGCACCACCCGGTGAACAATTTGCTCAT
CTTATACCGCTAATGCGACGTGGTCAAGCATGGAGTATTGTTAGGCGTCGCATTGTTCAGATGGTTTGTG
ACTACTTTGATGGTTTGTCTGACGTTGTTATTTTTGTGTTATGGGCAGGTGGTTTGGAACTCACAACTAT
GAGGTACTTTGTTAAAATAGGCGTACCATGCAAGTGTGATTGTGGTGTTGTAGCTACATGTTATAATAGT
GCACAGGGTACTTACCACTGTATGAAACATGCATTAGGTTGTGATTACTTGTACAATCCCTATTGTATTG
ATATTCAGCAGTGGGGTTACACAGGTTCTCTTAGTATGAATCATCACGAGGTGTGTAATGTACATAGGAA
TGAACATGTTGCAAGTGGTGACGCCACTATGACACGGTGCCTTGCAGTACATGATTGTTTTGTTAAGCGC
GTAGATTGGTCTATAACCTACCCTTTTATTGATAACGAAGCTACAATAAATAAGGCTGGTAGAGTTGTTC
AATCACACGTGGTCCGTGCCGCTATCAAAGTTCTTAATCCTAGTGCCATACATGATGTTGGCAACCCCAA
AGGCATACGTTGTGTTACAACACCATTACCATGGTTTTGTTATGACAAAGACCCTATTAATAGTAATGTT
AGGTGTTTGGATTATGATTTTATCACGCATGGTCAAATGCCTGGTTTAATGTTGTTTTGGAATTGCAATG
TTGACATGTACCCAGAGTGTAGTGTAGTTTGTCGTTTTGACACTCGTACACGTTCCAAGCTGTCATTAGA
AGGTTGCAATGGTGGTGCGTTGTATGTTAACAATCACGCATTCCATACTGAAGCTTACGATCGGAGGGCT
TTTGCTAAGTTGAAACCACTACCGTTCTTCTTCTTTGATGATTCAACTTGTGAGCTTGTTGATGGTCAAC
CTAATTATGTGCCTTTGAAGTCGAATGTTTGTATTACACGTTGTAATATTGGTGGTGCTGTATGTAAGAA
ACATGCTGCTCTGTACCGTAAGTATGTAGAGGATTACAATACATTTGTACAGGCTGGTTTTACCATATGG
GGTCCTTCAAACTTTGACACCTACACATTATGGCAAGGCTTTGTCAACTCAAAAGCATTGCAGAGTTTGG
AAAATGTTGCATATAATGTTGTGAAAAAAGGCGTTTATACAGGTTTGACTGGTGATCTGCCTACAGCTAT
TGTAGCTGATAAAGTTTTGGTTAGAGATGGTTCTACAGATCGTGTTTTATTTACAAATAAGACAATGTTG
CCGACTAATGTGGCATTTGAATTGTATGCCAAACGTAAAGTTGGCTTAACACCACCTCTTACAATATTAA
GAAATTTGGATGTTGTTGCCACTTACAAATTTGTACTGTGGGACTATGAGGCTGAATGTCCTTTTAGTAA
TTTTACAAAAGAAGTTTGTGGTTACACAGATCTTAAAGATGATGTTGTTGTATGCTATGATAATAGCATA
GTTGGTTCTTATGAACGTTTTACAACCAGTAAAGATGGTGTTCTGATTTCTAACAGTGCTATTAAGGGTT
TGGTCCCTATAGCACTTAATTTTGGTTATTTGAACAATTTACCTGTTAGTACTGTTGGTAATAAGCCTGT
TAAGTGGTACATCTATGTGCGTAAGAATGGTGTTTATGTCGAACACATAGATGGTTTCTACTCACAAGGT
CGCACTTTTGACACCTTCAAAGCACGTAGTAAAATGGAGGAAGATTTCTTGTCTATGGATACCACATTGT
TTATTCAAAAGTATGGTCTTGAGGATTATGGTTTTGAACATGTAGTTTTTGGCGATGTGTCTAAAACTAC
TTTAGGTGGTATGCATTTGTTAATCTCACAAGTGCGTTTGTCCAAGATGGGCTTGTTTTCTGTGCAAGAA
TTTATGACTAACAGTGACAGCACTTTAAAGAGCTGTTGTATAACGTACGCTGATGATCCTAGTTCTAAGA
GTTTGTGTACATACATGGACATACTGTTAGATGACTTTGTGACAATAGTCAAGGGTTTGGATTTGAGTGT
TGTTTCCAAAGTTGTTGATGTGGTGGTCGATTGTAAAGTGTGGCGTTGGATGCTTTGGTGTGAGAATGCC
ACCATTAAGACATTCTACCCCCAGCTACAATCCGCTGAGTGGAAACCTGGTTATTCGATGCCTAATCTTT
ACAAAATTCAGCGTATGTGCTTGGAACGTTGTAATCTTTATAATTATGGTGCTAGTCTGCAGTTACCAGA
TGGTATAACGACAAATGTTATTAAATACACACAGTTGTGTCAATATCTTAATACAACCAGCATTTGTGTA
CCACATAAGATGCGTGTGCTACATCTTGGTGCTAGTAGCCACGATGGTGTGGCACCTGGTACTAGTGTGT
TGAGACGCTGGTTACCTGATGATGCAATTTTAGTTGATAATGATGTTAGAGATTACATATCAGATGCAGA
TTTTAGTATTACAGGAGATTGTACTAGTATGTATTTAGAAGACAAGTTTGATCTTCTAATATCTGACATG
TATGATAGTACAAATAAAAGCATTGATGGCAACAACGTGTCTAAGGAAGGATTTTTCCCTTATATTAATG
GGTTTATTAGAGAGAAACTTTCCTTGGGTGGTAGTGTTGCCATTAAACTTACAGAATATAGTTGGAACAA
GGAGCTGTATGAGTTAATACAGCGTTTTGAGTATTGGACAATGTTTTGCACTAGTGTTAACACATCGTCT
TCTGAGGCATTTCTTATTGGTGTTAACTATATGGGTGATTACAGCGAAAAATGTATTATTGATGGAAATG
TAATGCATGCTAATTACATATTTTGGAGAAATTCGACTGTTATGGCTTTGTCCTATTATTCTGTCTTTGA
TCTAACAAAATTTAAATGTAAGTTTAACAATGCATTAGTTGTTAATTTGAAAGATAGTGATATAAATGTT
ATGGTTAAAGGTTTAATTAAAGGTGGTAAATTACTCGTTAGAAATAACGGCAAGTTACTAAACTTTGGTA
ACCATTTGGTGAATGTTTAAGATGTTTACTAAATTGTTGCTGCTAGCAGTTGTAAGTGTAGCAGTTAAGT
GCGATGACATTCGTAATTTAACAGCACGCTGTGCCACTCTACAAAATGTAAGTATTGGGTCACATTGGTA
CCTTATTGACAATTTTGTTAAGAATTATAGTAGCCGCCTGCCTTCAAATTCTGACGTTGTTTTAGGCGAT
TATTTTCCAACTGTTAAACCGTGGTACAATTGTGTCTTCAGATATTGGGGTGCACACAATGCATTACTTT
TAGAAAATCTTAAAGCACTATATTGGGACACAGTTCAAGGTGTGACAGGTGTTAATAATAAATATTTACT
TGTTAGTATACATGGTTCACCGTATAGTGCTACAGTGTACCATAAAAATGGTGAGATGGCACGCTATGAT
AGCGGTAGATTTTGTTTGTGTAAAGGTGCCATTAATACAACTGTTGCTACAGGCTCTGGTAATTGTTGGG
GCTATGATTGTAAAATTAATAGTACATTTTGGAATTGTAATAATACGGGTTGTGGTGACTTATTGTATGG
TTTGCAATGGTCCAATTCAGAATTGATGGCGTACTTGTCTGGTGACATTTACCGTATTAAACTTTATAAT
ACTTGGTTTAATAATGCGACCATTTCCAATACTTTTGCAAGTAATGGTACCACATCTAATAGCTGGTGGT
TTAATCCAGTCTACAACCTTACGTATTATAGAGTTAATAAAACTGATAACACTGTTGTAGTGCAAAATTG
TACCAATAATTGTGCTGACTATGTAAACAACATATTTAGTACAGAATCTGGTGGTATTATACCAGAAGGT
TTCAGTTTTAACAACTGGTTTGTGTTAACTAATGATTCTACTATAACAGATGGACGCTTTTTAACACGTC
AGCCATTGCTAGTTAATTGTTTATGGCCGGTTCCAAGCTTTAGTGAAACATCGCAAAACTTTTGTTTTAA
TACTGAAGACTTTGCGCAGTGTAATGGTTACAGACTTAATAGCACAGCTGATGTTATTAGGTTTAACCTT
AATTTTACACATGAAACAGTAGCTGCCAGTGGTACAACATTTTTCGAGTTGAATACAACTGGAGGTGTTG
TGCTTCATATATCATGTTACAATCAATCTAGAACAGAAGCTGTAACAAGTGAAGGTTTTTTACCATTTGG
CTACCATGAGAACTCTCTTTATTGTTACGTTTCTTATAATGAAACGTTACAGAAGTTTTTGGGTGTTTTG
CCACCTAGTGTTAAAGAGATTGCTATTAGTAAAGATGGTGGTTTCTATATTAATGGTTACAATTATTTCC
AAACATTTCCTATTGATTGTATATCATTTAATCTAACAACTGGCAACACTGGTGCTTTCTGGACTATTGC
TTATACATCATACACTGATGTTATGGTTGATGTTGAAAATACAGCCATAAAAAGAGTAGTTTATTGTAAT
AGTCACATTGATGATATTAGGTGTAATCAGCTTACACCCAACTTACCAGATGGATTTTACCCAGTTTCAC
CTAAAGCAATTGGATTTGTAAACAAGACATTTGTTACACTACCTGCTAATTTTGATCATGTGTATGTCAA
TATTACTGGTAATGTCAGACTTAAAATTCAGCGTGGTCGACCTTATAATAATGGTGGTAATGCAACTTTA
AGTTTTCAAGGTTGTATTGACGTTTCTCAATTTACAGTCAATGTAAACCACACTTGCACACTAATTGATG
CAAACGGTCAGTGTACTGGTGCTTATGAAGCCAGGGTTTATGTAACTAGTGGTAGTTGTCCATTTGCTTT
CGACCGTCTTAACAACCATATGTCTTTTTCTAAAATATGTTTTTCACCTGTGCCATTGGGTGATGATTGC
CGCTTAGACTTGACTGTTCAAACCCGTTATTTCACTGGTGTGTTTGCTCACGTGTATGTCAGTTATAAAT
TTGGTTTAGACATAGTTGGTCTTCCAAGAGCTGATGCTGGTTTGAAAGATCTCTCTGTATTGCATTTAAA
TGTCTGTACTGAGTACAATGTCTATGGGTTTGCTGGAACTGGTATCATACGTGAAACTAATCAAACTGTC
ATGGGTGGTCTATATTACACATCGCTGTCAGGTGATCTCCTAGGTTTTAAAAATGTCACAACTGGCACTG
TGTACTCTATAACACCTTGTGAACTCAGTGCTCAAGCTGCAGTTATTGATGGCTCAATTGTTGGTGCTAT
TACGTCCGTTAATAGTGAGTTGCTAGGTTTGAAAAATCACATTGTAACACCGTATTTTTATTATTATTCA
GTTTACAATTATACTGCAGATAACAACTCTAGATCCATGCAAAAGTATGATGTTAACTGCACACCTGTTA
TATCATATTCTAATATGGGTGTATGTGCTAATGGTGCACTTGTTTTTATTAATGTCACTCACACAAATGG
TGATGTACAACCTATTAGCACTGGCAATGTCACAATCCCTAGTAATTTCACAATATCAGTTCAAATGGAG
TACGTTCAAGTTTCAACTGAGCTTGTGTCTATAGATTGTGCGCGTTATGTTTGTAACGGTAATGCTAGGT
GTGGTAGATTATTATCTCAGTATGTTAGTGCATGCCAGACTATTGAACAAGCACTTGCCATGGGTTCACG
CTTGGAATCGATGGAACTTGAGTCTATGATATCCATTTCCGAAAATGCTTTGAAGTTGGCATCTGTTGAA
GAATTTAATAGTTCTGCCATGTTAAACCCTATCTACAATGAAAGTGGTAACACTATTGGTGGTATATACT
TAGATGGTTTGAAGGATATACTGCCTCGTAAGAACAAACATGGTTCTTCGCGTTCCACTATTGAAGATTT
GCTATTCAACAAGGTTGTCACCACAGGGCTTGGTACTGTGGATGAAGATTACAAGCGTTGCACTAAGGGT
TCTGATATTGCTGATTTAGCATGTGCACAGTATTATAATGGTATCATGGTCTTGCCGGGTGTTGCTAATG
ATGGTAAAATGAGCATGTATACAGCCTCTTTGTCAGGTGGCATTTCGCTTGGTGCTTTAGGTGGTGGTGC
TGTCGCAATACCGTTTTCATTAGCTGTTCAGGCACGCTTAAATTATGTTGCTTTGCAGACAGATGTTTTG
CAACGTAACCAGGAGATTTTAGCTGCATCATTTAATCAAGCTATTGGTAATATTACCATAGCTTTGGGTA
AAGTGAATAATGCCATTTACCAAACTTCGCAGAGTTTGTCAACTGTGGCACAAGCTTTAACTAAAGTTCA
AGATGTTGTTAATTCTCAAGGTAAGGCACTTAACCATCTAACACTACAATTACAAAATAATTTCCAGGCA
ATCAGTAGTTCTATACAAGACATCTATTATAAGTTAGATGATATTAACGCTGATGCACAAGTTGATCGTC
TTATTACTGGTAGGCTGGCGGCACTTAACGCTTTTGTGACACAAACTCTCACTAGACAAGCTGAGGTTAG
AGCCAGCAGACAACTTGCTAAACAGAAAGTTAATGAGTGTGTGCGTTCACAGTCCTCAAGATTTGGATTT
TGTGGCAACGGTACACACTTGTTCTCTCTTGCAAATGCTGCACCTAATGGTATGGTGTTTTTCCATACAG
TGTTGGTGCCCACAGCTTATCAGACAGTGACTGCTTGGTCTGGTATATGTGCTTCTGATGGTGATAGAAC
CTTTGGTTTGATTGTTAAGGATGTGTCTTTAACATTATTCCGTAACTATAACAACAGTTTCTATTTAACA
CCACGCACCATGTACCAACCACGAATCGCCACTAGTGCAGATTTTGTACAGATAGCAGATTGTGATGTCT
TGTTTGTTAATGCTACTATATTAGAGCTGCCTAGTATAATACCTGATTACATTGATATTAATAAGACGGT
ACAGGATTTGCTAGACAGTTATAAACCTAACTGGACTGTACCAGAGTTATCATTAGACATATTCAATCAA
ACCTATCTTAATATTACTAATGAGATTAATGATCTGGAAAATCGATCTGTTGTTTTGTATAACACTACYA
AGGAATTGGAGTTGCTAATTCAGAGTATCAACAACACACTAGTTGATCTTGAATGGCTTAACAAGATTGA
AACTTATGTAAAGTGGCCTTGGTATGTGTGGGTTCTTATTGCTTTAATATTTCTTTTTGTATTACCTATG
TTGTTGTTCTGTTGTTTGTCAACAGGTTGTTGTGGCTGCTGTGGATGTTTATCTAGTTGCGCAGCTGGTT
GTTGTAAATATAGTTGTAGTAGAGACCTCTCGCGTTATGAACCTATTGAGAAAGTGCATGTCAATTAATT
CTACTCAACTAAACAATGATAGGTAGTCTCATTACCGGTTTGTTTATAACATCTATTTCGTTTTTAAAGG
AAGATGTTACCATTAAAACTACAGATGTCCAAGCAGACACTAATTGTAGTACTATTGTGCAGCGCTCTGT
CGCCGCACCTAAAAGTTACACAGATGATGTTTCTGTGTTTATTATTTCTTTATTGTTTTCTATATTTTTG
GCTATGTACCGTAGTACAAGCTTTAAATCAAATGTAGCTCTGTCTCTGTTTAAGATTGCTACTATTTGTT
TCATATCACCATTCCTTATAGGTTTAGGTCTATATGTTGATGGTATTGTTACGTTAGTGGTACTCTTAAG
TCGCTACTTTTATTTGAGTTACTTTTGGTTTAAGTTTGAACGTTTTGAATTTTTATTCTACAATGTTTCA
ACTTTAATGTTTGTACATGGTAAAGCTGCACCGTATTTGAGAAGTTCTAATCACGCTCATTATGTGACAC
TTTATGGTAGTCTTAATCATATGAGAGTGGATGACTTTACGTTGTACTTTGTAGACCCAATGCTAGTTAA
AATAGCAATTAGAGGCTTTGTTCAATTAGATCTTAATGTTGTAAGGTCTATAGAACTTCTTAACGGTGAT
TTTATTTACATATTTTCACCAGAGCCTGTTGTTGGTGTTTATAATGCAGCGTTTTCTCAAGACATTGTAA
ACGAAATTAAATTAGACGATCATAGTTATGAGATTCCCGAACGTCTTGACTGTGATTGATGACAATGGAA
TTGTAATCAACTCCATATTTTGGCTACTGTTGATAATTGTAATTATATTATTTTCTATAGCACTACTTAA
CGTTGTTAAGTTGTGCATGGTTTGTTGTAGATTAAGCAATGTTGTTATCATTGCGCCTGCTCGACAAGCC
TATAATGCCTATAAAGATTTCATGAACATACCAAAAGCACCAGACAGTGTTTGTATTGTTGTTTAACTCA
ACTAAACAAATAATGGAGGTTTTATTGGTAGCAGCAACTGCAGTGCTGTCTGTTATACCAACTAGCCATG
CAACAAATTTGTATTGTCTTATGAATACAACTTCTGTTGCAAATAATACTTGTCAAAATACAAATGGCAT
TTGTGATACTTGTATTAATGAAGGAAATCTTATATGGCATTTGATGAACTGGAATTTCAGTTGGTCTGTC
CTTCTCATCTTGTTTATAACAATATTACAATATGGAAGGCCACAGGTCAGCTGGTTCATTTATGGCATTA
AAATGCTTATTATGTGGCTTTTGTGGCCACTGGTCTTAGCACTCACGATTTTTAATGCCTATTCTGAATA
TACAAATTCCAGGTATGTAATGTTTGGCTTTAGCGTAGCTGGTTCTGTACTCACATTTGTTTTGTGGGTT
ATGTACTTTGTTAGATCCATCCAACTGTGGCGTCGTACTCGTACATGGTGGTCATTTAATCCTGAGACAA
ATGCTATCCTGTGTCTTAATGCTGTGGGAAATCGATTTGTCCTACCTTTGAATGGTGCACCAACTGGTAT
TACACTAACCTTACTCTCCGGCAACTTGTATGCGGAAGGGTTCAAAGTTGGAAGTGGTGTTAATGTGGAA
AATTTGCCTAAGTATGTAATGGTGGCCACACCTGGTAATACCATTGTCTACCACCAAGTGGGAAAATCAC
TTAAGGCTGCAAATTCTACAGGATGGTCATATTATGTTCGTGCTAAAGCAGGCGATTACTCAACAGAAGC
AAGAAATGACAATTTGAGTGAGCATGAAAAATTATTACATATGGTATAAACTAAACTTCTATTATGGCTG
GAAACGGCAACCGCGTGAACTGGGGAGATGAGCCTTCACCTTCTCAAAATCGTGGTAGATCTCGTTCCCG
TAGTCGTAAAAATGAAAATATACCTCTGTCGTTTTTCAACCCTATAACTCATACAGGTAACAAGAAGTTT
TGGAATGTTGCACCAAAAGACTTAGTACCTAAAGGTAAGGGTAACAGAGATCAGCAAGTTGGCTATTGGA
ATCGTCAGGAACGTTGGCGCATGCAGAAAGGTCAGAAAATCCAGTTACCATCGAGATGGTTCTTTTACTA
TCTAGGAACTGGACCTCATCAGAATGCCAAATTCCAAGAACGCATTGACGGCGTTTATTGGGTTGGCAAG
AATGGTTCTAAAACTGTACCTACAGGACTAGGTACGAGAGGTTCTAACCAAGAATCTCTTGACCTACAAT
TTGATTGCGCAGTTCCTTCTGAATTTAAATTAGAACAAAATGTTAACTCTAGAAGCAACTCTAGGTCTAG
GTCTAGAGGACGGTCTAGGTCTAACACAAGGTCTAATGACAACCAATCTTCAAGTCAAGATATAGCCACT
GCTGTTGCTGCTGCTCTAGCTCAAATGGGTTTTGCTCCAAAAGAAACACAGAAGAATAAGTCTCGCTCTA
AATCTAGAGATAGGGCTAAGTCTAGTGAAAGACCTGTTCCTAAGAATGAAAACAAGCACTCATGGAAGAA
AACGCCTGGCAAAGGAGATGTTGAAACCATGTTTGGAAAACGCAGTGCCAACTCAAACTTTGGTGATGCA
GAATTAGTGAAGGACGGTAGTTCGCATAAAAACTACCCTCAGTTGGCTGAAATGGTTCCTTCCACAGGTG
CACTAGTGTTTGGTGGAAAGTGGGAAGCTACTGAGTCTGGTGATGATGTTATTGTTACTGTTAACTACAG
TTACAAACTACCAAAGAATGACCCCAAAACTACCGCTTTTGTCGGTCAAATCGGTGCATATACCAAACCT
TCACAAGTGGCTAAAGAACAAAGATCTCGTTCTAAATCTCGTGAGAGAGCAGCCACACCTGTGCCAACAC
CTGTGAGTGCTACAGCTGAGAATTACACTGATGTTTTTGATGAGAATGTTGAAATTATTGATGAACTAAA
CTAATTACATGCTAGTATGTCTGCATGTTGTCCTGGTTCTAGTATTAATATGCTTGATTTTGAAGCGTAT
TAAATTACTAGAGCAGTTAGTTCTTAATGCCATTCTCAATTTAACTACACTAACTAACGTGCTTGATATA
GCCGATAGTGGTGTGAAAGTTAAATATTTTCAATTGTTAAAACCTGACTGTCTAGATCTTTATAGTTTGC
AGCGTGCCATTGTTGAAGTGCGCCTTCTTAGACTGTTTATTAGGGTTTTATTCTTTATTGTGCTATTCTA
TCTCATTGTATGCGTTTTAATCTGATCACATACATCCCAGGACGTGTGTGGTTTAAACTACCTAGATCTT
TCAAAGACTGGGTTGTTGCTAAGGTGAAACGCAGAGTTCACACTTGTAGATCTACTAAAACTGACTACAG
GCGTAGGGCTATTTACAATTTGAGAATTAAAAATGCAAGCACAAGTAGTTGTAATTCTTTCTCTTCTAGC
TCTTGCTTTAGGAACAAATGACCATGTTCACCCTACATATGATTGGAAAACCTTAGAAATGTTTTATGGT
AGGACTCTTTTTATTGCTGAAAGTACAACATTGTCTCTACCATTAGATGCTCATTTGCACTGTGGTGTTA
TTTCTGGTAAACGTTGTGTCTTTCCTGGTTACATCTATCAGGCTAAGGACCATGTGGATTACAGGTTTGA
TATCCAATCACCGTTCTACATGTTTGTTAATGAGTTTACCATAACTAGAGATAATAGTGGTGATGTTGTA
TATGTTAAACTCTTAACAACTGTCTCTAAGGTAAAAATGCTTAATGTGGGTTGTAATAGGCTAGCTCCTA
TGTTAAATTTGCCTTTTGGTACTAAAATCTACCATGATAAGGATAGACAATTAGAAGTTGAAGGTAGGGC
TGTCCCTTGTACTAATAGAAAATATTTCATTGAGTTCTGTCCTTCTGGTCCTAATGATTTTTGTTTTTAT
GATGTTCTTAGAATCTTTGATTTAGACACTTTTAAAGGTAGAAAAGGTAGAGCTAATGTTCTTCTGTCCC
TTAAAGATGAATTATAACAAGATCTTCAGGCGTGTACTGCGAGATCTACTCTTACACAGAATGGTAAGCA
CGTATCTATGCAGGGTGTAAGTAACTCATAGATATATTAGGAAGTTTAGATTGAATTAATCAATACTAGA
TTGAAAATTTGAGAGTAATTTAAAGATCCGCTTAGACGAGCCAACAATGGAAGGGCTCAACTTTTGGATC
TAGTTAATTGCTAATTTTAAATTGATGATAATTTTCCTTTTGATAGTGATACACAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

>gi|409188582|ref|NC_018871.1| Rousettus bat coronavirus HKU10, complete genome
ACATGGGGACTTATTGTGATTTTCTATCTGCGGATAGTAAGTGTCACTACTTAGACCTTGTGTCTCCTCA
TCTCAACTAAACGAAATTTTATCCATCGCACACATGTTCGCATGTGTTTGCGTATGGTGCAATTGAAATT
TCATTAGGTTGCCTAATTTGGGTAACAAGTGCAGTGCGTCCTAGTGGCTCTGAGTGAGGGTTCCGTCCCC
TCTCATCCATTACAAACGCCCTTTGCCAGTTCCGTCTGGTGAAGTGTGTGGAAGTCAAGTTCCGTCTTGT
CTGAAACCTGTAACTGTGCCCAATGGCTAGCAACCAATTGACATTGGCTTTTGCCAATGACTCCGAGATT
TCAGCTTATGGCTTTGACACCGTCGAGCATGCCGTGGCACAATATAGTGCTGCCGCAGCTAACGGTTTTG
CTCAATGCCGATTTGTCATTACTGGCCTGCAAGACTTGGTTGTGGGTGTTAACGATGAAGAGTTTGTTCT
TGTCGTGACTGGCTTGCACCAACTCACAGCCCGTATTGGCAAATTCGGTGACCAACCCCAAAACTTACGT
GGTTGGTTGCTGTTCTCCAACTCCAACTACTTCTTAGGTGAGTTGGATCTTATTTTTGGCAATCGCGGTG
GTACCACTGTTTTTGTCGATAACTTTTTGTGTGGTGCTAATGGTCTTCCAGCTTGTTCTGAACAAGAATG
GGAGTTTAAAGACTATTTTGGTGAACTTGATGAAGTCATCATTAATGGCACCACTTTTGTTAAAGCATGG
AATGTGGACCGTACACCAGGACCTTATTCAACCCAAAACTTGCTTTCCATTAACTCTATTTCTTGGTGTG
GTGAAATCCCACACTCACTTGCTGACGGTTCTATTCGTAGGGTTGCTAAAGTGGTGAAAAAGAGTAAGAG
TGTTTTGCTTGGCAAACAGTTTCAACAATTGTATGACAGTGTTGGTTCTCCTTTTGTTACTAATGGTAAA
AACCTTACTGATGTGCTTGTGAAGCCAATTTATTGTCATGCTCTTGTTAAATGCCAATGTGGCAAAACAT
CATGGACTGTTGGTGATTGGAGTTGTTATAAGTCTATGTGTTGTGGTTTTAACTGTAAACCCCTTGCCAT
TGTCAACGGAGAAGTCGTCCCTGGTGATGTTCTCGTTACCAGCGACAAGGTATCTGCCTCCGGAACTAAG
TACTATAATGGTATGGTGCTTAAGTTTGTGGACAAAATTGACAATGCTTGCTTGTGGAGAATTACACAAG
TTCAGAGTTGCATGGATGTTGTTGCGTCCGGCAATTACAAGGGAGATGAATTCATCTATCACACTGATGA
TATTTGCAGTCCGACTAATATGTCTAAAATATCTCATGCTTTTAAATTATGTTACTTCACAGGTTCTTAC
ACAGATGAAGTAAAATCTGCTCTACTCCATGGTGAGTTCGATGTTTGCACAAACATCTGTGATGTTTCAG
ACCATTCAATTCACAAGCCTTGGTTTGTGCGTGAGATGGAGGAACTTCTTGGAGGAGCATGGGACAACTT
TGTTAAGGCTGTTAAGTCCTTATCTGTCTTGAACAGTCAACTGTTCGACCTTATGAGTGGTCTTGCTAAG
GCTACTATTAGGGTTGTAAATGGCTGCATTGAGTTTTGTGCCAATATTCCTACATGCTTTAACGATGCTT
TTGAGTGTCTTAAGAGCTTTGTGGAAACACTTTTTGACCTTACAGTTAATACTGTAACATTTGCTGGTCA
GTCTTTTAAGGCTGTCGGTGATTATGTTCTTCTTAACAATGCCATTGTTAAGTTTGTATCTGTAAAGGTT
AAAGGTTTACACCAGGATGGCATTAAGAGTACTATGTATGCCACTACAGTTGTTGGTAAAACAGCTAAAG
TTAAGTCCCGTAGAATTGAAACGTGCAATGCTAATCTGAGTGTTGTACCTGACCAAGCACTTGTTAAAGA
CGGTGTTACCAAGATTATTGGTGGACGTTCGTTCTTTTGTAGTGGAGGTTGTTATCGCTTGATGAGTGAT
GTGGATACTGTTATTATGTCACCTGTTTACCAAGCTGTTGCACCCACTGAAGTTGTGTTCAACTGTGTTA
AACCTGCTGGTTTTGTGGATCCTGTGTGTAGCACTCTTCCTGAACTTGTCAGTGATGTGACTAAACAATT
ATTGCCCTTGAACAAACCTTACCGTTTCTACGACGTTAAGGTTAAAGATGGCATGTGTATTGTTACACAA
GAGACCACATTTAGAGCACCATCTTATATTGCAAACAGTGCGCTGTTTGTGCAGCTTTGTGAAGAGTGCG
TGGATGTTCAAGGTTTTGATGATTTCTACGTAAAGGCACATGAAGCTACCAGTTTGAGCCAATTCGAACC
TATGTTTCCTGCTTTTCAACAGTTTGTAAAAAGTGTTGATTGCCCCCAAATATTGAAGGATATTGATGGT
GGTGGCATTTGGAAGACATTTATTCAGACTGTTTCTGATGCTGTTGAGTTCGTAAAATCTATTAAGGTAG
ATTTTGGACTAGACGGTATTATTATTACAGCTACAAAGAGGTTCAAGAAATTTGCAGGCATTCTCCTTAA
TTTGTACAGAGAGTTTATTGCTTCTGTTACAAGTGTGGTTAAGATTGGTGGTAAGAGTTTTACTTACTAC
TTGTTTGAGAAGCCTAAAATGGCCATTTCTGGTATTTTGCATAATGTGCGTGTTCTTAAGGCTAAAGATT
GCACTATTGCTGCTGAAGATATCCTTGTTGAAATGACTGTTTTTGACAGCTTTGAAATACCTATTCAACC
ATCTCGTGTTGAAGTTCAGCAAGTCGAATTTGAAGAGGCAGAATTTGTGCAACCACAGGCTGGTGGTGTT
CTTGCTGTTGTTAACAAACATGTGTTTTACAATAAGGGCGACTACTATTACCCTGCCAATGAAACACATG
CTGTGCCTGTATGCTACAAAAGAGGTAGTGGTACTAATGGCACTGTTGTAAAATTCTCTGAAGCAGTTCA
GGTTAAAGAGATAGAACCTGTCCATCGTGTTAAACTTGAATATGAGTTTGAAGATGAAACTATTGTAGAA
ATATGCAAGAAAGTCATTGGAAAACGTTACAAGTTTACAGGTACAGAGTGGGAAGAACTTTGTAGTTACA
TTCATAGTGTAATGAAAACAGTATCAGACCACATTGAAGTACCTGAGTACTTTGTCTATGATGAAGAAGG
TGGAAATGATTTTACAAAAGTTGTTATGGTTTCTCAGTATTCAATTGCTGATGAACAGCCTGAAAATGTG
GGGCAAACGGATGTTCTTAAAGAAGAGCAGACAGTTGAAGCCACATCCAAATCACAGGTTGTACAACCAT
TGAAACAACAAGAACCCGTAAAACCACAAAAGTCTCAAATTGAAGAAGTTAATGAAGCTCTTAGTTTTAT
GCTTGAACCAGTACAACAGAAACCTAAAGTTAATCCTTTTAATTTTGAATTCTATGACTATAAGGGCATT
AGAGTTCTTAAACAGAAGGATAACAATTGTTGGGTTTCGTCTACATTGGTTCAATTGCAATTATTGGATT
GCTACTCTGATCCTGCATTTGACTTGTTCAAGGCAGGTAGTGTTGCACCGATAGTACAAAAGTGCTATGA
GCTCACACGAAACATTGTAGGTTCTGCTGGCGATGTTTCTTTTGCTTTAGAACAACTTCTTAAAGACTTG
CACACAATGTTTATAACATTTGATGTTGTGTGTGGTTGTAACAACGGTGAAAGGCGCCAATCAGAGCTTA
GTGGTTGTGTGTTTAGGTTTTTACCTACATCTGAACCATTTGCCTATGGTGGCTGTCCATCTTGTGATAA
ACCTCTTATGCACACTATAACATCTATGCAAGGTACTGGTGTGTTTTGCCAAGATCCTAAAGCTGTGGAT
GTTACTACGTTGTTGGTTCAACCTATGTGTGCTTCTGCTTTCATTGGCAATTGGTTTAATAACTCGCTTG
GTCATTACAAAACAAATGTTTATGACAAGGGGTTTTGTGTTGACGGTAATGGATCATGGCCTATCACTTT
GAACACCTTGAACACTATTTGTTACAAGGATGTCAATTATGTTAGACCACTTCCTGTTGTGTCTGATCAA
CCAATTGTTGAAGAGAAAACTAAACAAGATGAATTAAAACCTTTTGCAACTTATAGAAATGTTGAATTCT
ACAAGGGTGAGATATCGGACCTTGTGCAACTTAAACATGACTTTGTGGTCAATGCTGCTAATGAGAATTT
GAGTCATGGTGGTGGTGTTGCTGCAGCGATAAACAATCTTACTAAAGGTTTGTTACAAACGTTGTCAGAC
CATTATGTGAAGAAAAATGGCAAAATAAAAGTTGGACAGGGTGTTATGTTACATTGTGGTAAGGAAAACG
TCTTGAATGTTGTTGGACCACGTAAAGGTAAGCATTCACCTCAATTGCTTGAGAAAGCCTACAAGTTTGT
TTTAAAACAAAAAGGCACACCACTTACACCACTTCTTAGTGTAGGTATCTTTAAAGTACCTATTTTGGAG
TCTGTTACAGCTTTAAAAAATGTTGTTGGCGACCGTCATGTTAAATGTTTTTGTTACTCAGTTGCAGAAG
TCTCTGAGATACAGAAATGTCTTGACAATGATGTGGTTGAACCTAAAATGGAAGTCCCACAGATTGAATC
TGAGACGGTTATATCTGTGTCACAAAACACAGAACAACAAGCATTTTCACATGTGGATAGAAGGGAACTT
AAACCTTGCAGAGTTGAGGGTAAGTTTTCATTTTATGATTGTCCTATTGCTGACATTGCTATCACAGAAC
CTGAGAGAGTTGTCTTCTTTACAGATGTTAAACTTAGTTTTTGTGAGGCAGCAAAAGCATTAGACAAACA
TTATGAAGGTGCTTTGACTAGCTGTGTACAGGCCTATTTAGCTGAGACACCATTGATTCCTGCTGGTAAT
TTGTTAACTTTGAAGTGTGAAGGTGCCATTCCTGTTAGTTTTGCTGTTCTGCCAGATACAGATGCAGCAA
ATTATAACAAGGATGTTAAACGCACATTGACAAAAGTGTCAAAGTTAAAAGGCAAAATATTTTGCACGAT
ACCAACAGTAGATGTTATGAAACAAATGCTTAAGTGCTGCAACACAAGTTTTATTGTAACTGATGCTACC
AAAACTCGATTGTCAGAGTGTTTTGAGTCTGCAGTAGTAGAAGTTAAAGTTACACATGACGGTCGTGATG
TGCACACCGTCAAGGTTAAGACTGATGTTGTACTTGACGAGCAAGTTGGTGTTTGCAGTTTGAATAATTG
TGACCTTACTGGTGTTAAACCTGACGATGCTATTGTAGATGTTGTTAGTGTAGCTCCAGAAGTTGATTGG
ATTTCATATTATGGCTTTCCTCGTGCTGACCTTTATCATACGTTAGATCATAAACAATATGCGTATGAAA
ATAGTGATGTTGAAGGTAAGCGTGTTTTGAAATTTTCTGACAATAATTGCTGGGTTAACACTATTTGTCT
ACAGTTACAATTTGCTAAAGCCATTTTCAAGACTGAGGGTCTTCAAGCTATGTGGGATGAGTTTCTCACA
GGTAGAGTTGAAAGGTTTGTGCACTGGTTGTACTGGTATCAAAATATTGAAAAAGGTCAACCTGGTGATG
TTGAGTATTTGCTTGGTAAAATAAGTCGCTATCTAGTGAATAGTGGTACAGTCACCATTTCAAAAGATTC
GGTTTGTTGTAACAGCAAACGTACTCTTACTACACCTGTGGTAGAAGCTAGTATCCTTAAGAGTGGTTTT
GATGATGGTGTTTGTAAACATGGTAATGCTTGTGTGTCGCGTATTAGTGCTGTTAGAGGTACTGTTATTG
TGATTCAAACAGGCAAACCTAAAGTTTACCCACGTGCTGCTCTAATTGATGGTGACACCTACACTACGTA
TTCTGGTAGCGTAGAAGACGGTCATTACACCGTTTTTGAAACTAAGAATAGCAGAGTGTATGATGGTGAC
ACCGTTTCTACTGGTAATGACCTTTCTACACATGCTGTGTCTTCTGTTGTTGTTGCTAATAAGTTGTTCG
ATGACCCCATAGAGGTTGTTGAAAGAGAGGCTTCTAGTATTGTTAACACATTAGACACTTCTGCTGAGAA
GTTCTTTTCTTTTGGTGACATTGTTTCTCGCAATTGTGTTACATTTCTTGTGTGGTTATTTAGCATGTTT
AGTTTAGCTTTTAAGGCTTTTAGGACTAGAGATGTTAAAGTTATAGCTCAAGTACCGCAAAGAACAGGGT
TAATATTAAGCCGCAGTTTAAAGTATAATGTTAAAGCTACTAACAAGTTTTTACAGTCAAGAACTAAATG
GGTTGTTTTGTTTAGTAAAATGCTATTAGTGCTTTCTACATTGTATGCATTGTGGTTTCTTTTATTACGA
TTTGGTCCTTTGCACGACACAGTTTGTACAAGTTATGTTGAAGGTTATTCTAAGTCTAATTTTGACAAAA
ATGCTTTCTGTGAAAACTTAGCTTGTAAAACGTGTTTGTATGGTTATGAAGAGCTTTCAGATTTTCCGCA
CACTGTTACAACATGGACTCATTTGGGTGATCCGCTTTTTAAAACTTTGTTGCCACTTATTTATATAGCA
TTTTTGCTTATATTTGGTGGTGTTGTTGTTCGTGGGTTCATGCTTTATTTTGTTGCGCAATATGTCAACC
AATTTGGTGTGGTTTTGGGTTTCCAAGATAGTGTCTGGGCCCTTCAGCTTGTCCCATTTTCAATTTTTGG
TGACGAAATTGTTGTGTTGTTTTTAGTTATAAAGTTTATGTTGTTTTTAAAACATGTTTTCTTTGGTTGT
GAAAAACCTTCTTGTGTTGCTTGTTCAAAAAGTGCACGTCTAACACGTATTCCTATGCAAACTATTGTTA
ATGGCTCTAATAGGTCATTTTACGTAGTTGCTAATGGTGGTAAAAAATTTTGTGAGAAGCATAAATTTTT
CTGTGTTAATTGTGATTCTTATGGACAAGGCAACACGTTTATTAATGATGTAGTTGCTGCAGAAGTTTCT
AATGTGGTTAAAACCAATGTTATTGCTACAGGTCCTGCTGTTATCGACATTACAAAGGTAGAATTCCACA
ACGGGTTTTACTATTTGTATGGTGATGATGGCAAGACATTTTGGCGCTACAACTTTGATATTACAGAAGG
TAAATACAGCTGTAAAGAAGTGCTTAAGAATAGTAATGTTTTGGCAGATTTTATTGTTTACAACAATGTG
GGTTCAAATTTGGCGCAGGTTAAGAATGCTTGTGTTTATTTCTCACAGTTACTTTGTAAACCAATCAAGC
TTGTTGATGCAACTTTGTTGGCAACACTGAATGTTGATTTTAATGGTGCGTTGCACGCGGCTTTTGTTGA
AGTTCTTAACGAAAGTTTCGGTAAGGACCTTAAGAGTTGTTCCACGATGGCAGACTGTAAAACAGCGTTG
GATATTGATGCTGATGATGAAGAGTTTGTCAATGGTGTTAGCAATGCACATCGTTACAATACATTGTTGT
CTGATTTGTCATACAACAACTTTGTTACATCTTACGCCAAACCAGAAGAAAAACTTTCAACCCATGATCT
TGCTGCTTGCATGCGTGGTGGCGCTAAGGTTGTTAACCATAATATTTTAGTAAAGGAGAATGTACCCATT
GTTTGGTATGCTAAAGATTTCAACATGTTGTCTGAAGAAGGACGTAGATATGTTGTTAAAACTGCCAAAC
TTAAAGGTGTAAACTTTCTACTTACATTTAATGACAACCGTATGCAAACTCAAATACCTGTGGTTAGTGT
CACAACAAAGTGCGGGTCTGGCATTAGACGATGTTATAATTACATCTGGTGGATCTGTGCTTTTATTTTG
TGTGTGTTTTTAGCTACAGGATTTGTTGATTACACCTCTATGGTTGTAAGCGCTAGTGACTATGATTTTA
GGTACATTGAAGGTGGTAAGCTGAAAGTTTTTGAAACACCTTTGAAATGTGTACATAACACATTTGCTAA
TTTTGACAATTGGTACAACTCAAAGTTTGGTTTTACTCCTAGTAAAGACAAACGTTGTCCGATTGTTGTT
GGTGTTTCTAACGAGGCTAGAACGATCCCTGGTGTGCCGTCGGGTGTTTTTCTTTTTGGTAAGACACTTG
TCTTTGCGCTTCAAATAGTTTTTGGAGGTTCACACACATGCTATGACATGACTGGACCAGCTCCTTTGGA
CCGCTGTATATTCGACTCTGCCTGTACCACACTTAATGGTTTGGGCGGTGAGCGTGTATATTGTTACAAA
AACGGTCTTGTTGAAGGTTCTCTTCTTTATACAGACTTGCAACCTAATAGTTATTATAGTCTCCCAGTTG
GTGGTTATGTTAGACTACCAGAGGTTATAACTAGTGGTTTAGGTTTTAGGACTGTACGTACACAACAAAC
CACTTATTGCAGAATGGGAGAATGTGTTGATTCGAAGGCTGGTATTTGTTTTGGCGCTAATAGGTTTCTT
GTTTATAGTGCTGAATCAGGTACAGACTTCGTTTGTGGTACAGGTCTCTTGTCTTTGTTGCTTAATGTGT
TTAATATGTTTTCTTCTTCATTTTCTGTTTTGGCTATGTCCGGTCAAATTGTTTTTAATTGTGTGCTTAC
ATGTGTTATAATTATGGCTTGTTTGCTTGTCACAAAACTTAAACGTATGTTCGGTGATCTCTCATTGGGA
GTGTGCACTGTTGTTTGTGTGGCTATTGTGAACAATTTGTCATATATTATTACCCAGAATGCTGTAATGA
TGGTAGTGTATGCCATTTTGTACTTTTTGTCAACTAGGACTTTCAAGTATGGATGGATATGGCATGTGGG
CTACTGTATTGCTTACCTTTCTATGGCACCATGGTGGTTGTTGTTCTGGTATATGTGTTCAGCTTTAATC
GGCTTAGTACCTAGTTTGCTTAAGTTAAAAGTTACTTCTCAACTTTTTGATGGTGACAAATTTGTTGGCA
ATTTTGAAACGGCTGCTACTGGCACATTTGTGTTGGATATGCATTCGTATCAAAGAATTGTTAATAGTAT
TGCACCCGAAAAGATTAAGCAACATGCTGCTAGTTATAACAAGTATAAGTACTATAGTGGTGCTGCTTCT
GAAGCTGATTATAGACTTGCTTGTTATGCACATTTGGCTAAAGCTGTTTTAGACTATGGAACCAATCACC
AAGATACGTTGTACACACCACCAACCATTAGTTACAATTCAACATTGCAATCCGGTTTGCGTAAGATGGC
GCAACCTTCTGGTGTGGTGGAGAAGTGTGTTGTACGTGTTTGTTATGGTAATATGGCACTTAATGGTTTG
TGGCTAGGTGATGTTGTTATTTGTCCTAGACATGTGATAGCATCAAACACTAACGCACTTATTGATTATG
AACATGAGATTAGTGTTATGCGTTTGCATAATTTCTCAGTTTCGGTTGGTAATGTGTTTTTGGGTGTCGT
TAGTGCTACAATGAAGGGTGCTAACTTGCATATTAAGGTTAACCAGACCAATGTTAATACTCCTGAACAT
AGTTTCAAAACCATAAAACAGGGTGAGTCTTTTAACATCCTTGCATGTTATGATGGTATGCCTTCTGGTG
TTTATGGTGTCACTATGCGTAACAACTATACTATTAGAGGTTCTTTTATTACTGGTGCTTGTGGTTCGCC
TGGTTACAATGTAACTAATGGCAAAGTTGAATTTTGCTACTTGCACCAATTAGAACTTGGTAGTGGTTGT
CATGTAGGTTCAAACTTAGAAGGTGTTATGTATGGTTGTTATGAAGATCAACCTACATTGCAGATAGAGG
GTGTTAACCATCTTGTGACTCCTAATGTTATTGCATTTCTTTATGGTGCATTACTTAATGGTATTACATG
GTGGTTGAACTCTGATAAAGTTTCTGTGGAATCCTTCAATGAGTGGGCTCTTAACAACGGTTTTACTACA
TGTGGTAACCTAGACTGTTTTAATATGCTTTCTGCTAAGACTGGTGTAGACGTGCAACGTTTATTGGCGG
CTGTACAACGCTTACACAATAGTTTTGGTGGTAAAAATATCCTCGGTTATACTACTCTTACAGATGAGTT
TACTGTTGGCGAGGTTATTAAGCAGATGTATGGTGTTACTTTACAGAGTAATAAAGTTGTTGGTGCGTTT
TGCAACTTAGCCATTGTGGGCCTCTTTGTTACAATGTTTTGGTCTGAACTTTTACAATACACAGCATTCT
TTTGGGTTAGTCCTGGTTTTGTGACTCCTGTGTTCTTTGCACTGTTGTTAGTGTCCTTTATACTTATGTG
TTTTCTTAAACACAAAGTGTTGTTTTTATACACTTTTCTTATACCATCAGTCATAATTATGGCAAGTTAT
AATTTTATGTGGGACTGGTCTGTGGCAGCTGAATTGGCCCGCATCTTCGATTACCATGTTTCCATTGTTA
GTTTTGACATTCAAGGTTTGTTGAATGTTGCCGTATGTTTGTTTGTCACTCTGTTACATACAATGCGGTT
TTTCAAAACAAACACATCAATTTCAACTTATGTATTGTCATTGGCATTTACTGTTTATGGCTTTGTTGTT
GGTTCTGATGTGTTGAGTATTGTTATGACTTTGCTTTTTAATTTGACATCTTCGTGGTATGTTGGTGCTA
TTGTTTACAAATTGGCATATTACCTTCAATATTATACATCATTTGCACAAATTTTGGGTTCTATAAAAGC
TATTATGCTTTGTTATATGGGCCTTGGTTATTTGTGCTGTGTCTATTATGGCTTTTTGTACTGGATTAAC
CGTTTTTGTAAACTATCTCTTGGTGTTTACGATTTTAAGGTTAGTGCCAATGAGTTTAAATTTATGGTTG
CTAATGGTTTGCAAGCACCGCGTGGTGTTTTTGATAGTCTGGCATTGTCAATTAAGCTCATGGGTATTGG
TGGTGAAAAGACTATTAAAGTCTCATCTGTCCAGTCCAAATTGACCGATATTAAGTGTACAAATGTTGTG
CTTCTTGGTTGTTTGTCTAGTATGAACATTGCTGCTAACACCAAAGAATGGTCTTATTGTGTTGATTTGC
ATAATAAGATTAATCTTTGTAATGACCCTGAAGCTGCACAAGAAATGTTATTGGCTCTACTTGCTTTTTT
CCTTAGTAAGCATAAAGATTTTGGCTTTGATGATTTGCTGGATTCTTACTTTGCAGACAATTCTATTCTG
CAAAGTGTGGCATCCACATTTGTTAATATGCCGTCTTTTATTGCTTATGAAAATGCGCGTCAAGCTTATG
AAGATGCTATTGCCAATGATTCTGCTCCTCAGTTGGTTAAACAATTGAAGACAGCTATGAACATAGCAAA
ATCTGAGTTTGATAGGGAAGTTTCTGTGCAAAAGAAAATTTCGCGTATGGCTGAACAAGCTGCAGCGCAG
ATGTACAAAGAGGCTAGAGCTGTTAACAGAAAGTCTAAGGTTATTGGTGCTATGCATTCATTGCTTATGG
GCATGCTTCGTAAGTTGGACATGTCTAATGTTGACACCATACTTAATTTAGCAAAAGATGGTGTTGTACC
TCTCTCTATTATACCAGCAGCTTGTTCCACAAAGTTGAACGTTGTTAGTGCTGATTTAGATTCTTATTAT
AAGATTTGCAGGGATGGTTGTGTGCACTATGCCGGCGTTATCTGGAATGTTATAGACATTCGTGATAATG
ATGGTAAAATTGTACATGCTAAAGAAATTGCACCTGAAAACGTTGAAAACATTGCTTGGCCCATTTTTCT
TAACTGCGAACGCATTGTTAAGTTGCAGAATAATGAAATAATGCCCGGTAAGCTTAAGCAGCGTCCTGTT
AAAGCTGAGGGTGATGGTATTTCTGCTGATGGTATGGCTTTGTTCAACAACGAGTCTGGTAAAACGTTTA
TGTATGCGTTTATTGCAGACAAACCTGATCTTAAATTTGTTAAATGGGAATTTGACAATGGATGTAGTGT
TATAGAACTTGAACCACCGTGTCGTTTTGCAGTGCAAACACCTACTGGTACCACTATTAAGTATTTGTAT
TTTGTGCGCAATTTGAATACATTGCGTCGTGGTGCTGTTTTAGGTTTTATTGGTGCAACTGTTCGACTTC
AAGCTGGTAAACAAACTGAACTTGCCGTTAATTCCCCATTGCTTACTATGTGTGCTTTTGCAGTTGACCC
TGCTAAGACTTACTTGGATGCTGTCAAAAGAGGTGCTAAACCTGTTGGTAATTGTATTAAAATGCTTGCC
AATGGTTCTGGTACTGGACAGGCCGTAACTACGGGTGTTGAGGCTAACACTAACCAAGATAGTTATGGTG
GTGCGTCTGTGTGTTTGTATTGTAGAGCACATGTTGAACACCCTAGTATGGATGGTTATTGTAAACTGAA
AGGTCGTTATGTACAGGTGCCTATGGGAACAATAGATCCTATAAGATTTGTACTAGAAAATGAGGCCTGT
AAAGTTTGCCAGTGTTGGTTAAATAATGGTTGTGCTTGTGATAGAGTTTCTACATCTATGCAAGCTTTTG
ACAATGGTTATTTAAACGAGCAAGGGGCTCTAGTGCAGCTCAACTAGAGCCCTGCAATGGCACTGACACT
GATCATTGTGTCAGAGCATTTGACATTTATAACAAAGATGTTGCATGTCTTGGTAAGTTTTTGAAAACGA
ACTGTGTTCGTTTCAGAAACAAATTACATAAGGATGCATACTTTGTTATAAAGAGATGTCCTAAGTCTGT
CATGGAACATGAGCAATCCATATATGACATACTTAAAGATTCTGGAGCCATTGCAACACATGACTTCTTC
GTATGGAAGGATGGTCGCATGATTTATGGTAATATTAGTAGACAAGATCTTACTAAGTATACTATGATGG
ACCTTGTGTATGCATTGCGCAACTTTGATGAGAAAAATTGTGAAACTCTTAAGGAGATACTTGTTATTAC
AGGCGCGTGTGACCAGTCTTATTTTGATAATAAGTTCTGGTTTGATCCTGTAGAAAATGAAGATCTCCAT
AGAGTTTATGCCATTTTGGGTAAAATAGTAGCAAATGCCATGTTAAAATGTGTTCGTTTAGGTGATGCCA
TGGTTAAACATGGTATCGTTGGTGTTATCACTCTTGATAACCAAGACCTTAACGGCAACTTTTATGATTT
TGGCGATTTTGCTAAAACATTACCTGGTATGGGTGTTCCTTTGTGTACTTCTTATTACTCTTACATGATG
CCTGTTATGGGTATGACCAATTGTCTTGCTGGTGAATGCTTTATTAAAAGTGATATTTTTGGTAGTGATT
TTAAGTCTTTCGATCTTTTGCATTATGACTTTACTGATCATAAACAAGCATTGTTCGAAAAGTACTTTAA
GCATTGGGACCAAGAGTATCATCCTAATTGTGTGGATTGCCATGATGAACTTTGTATAGTTCATTGTGCC
AATTTTAACACATTGTTTTCCACCACTATTCCCATTACGGCTTATGGCCCGCTGTGTCGCAAAGTTTTTG
TTGATGGTGTGCCATTAGTCGCTACAGCAGGTTATCATTTTAAACAACTTGGTATTGTGTGGAATAAAGA
TTTGAACACACATTCTACCAGGCTTACTATTAATGAGCTATTACAATTTGTGACTGACCCATCGTTGCTT
GTTGCTTCTTCACCAGCCCTGGTTGATCAGCGTACTGTGTGCTTCTCAGTCGCTGCACTAGGTACAGGTA
TGACTAAGCAAACTATGCAACCTGGTCATTTTAACAAGGAATTCTATGACTTTTTGCGTAAACAAGGTTT
CTTTGAAGAAGGTTCTGAATTAACACTCAAACACTTCTTCTTTGCGCAAAAAGGTGATGCTGCCATTAAG
GATTTTGATTATTATAGGTATAACAAACCTACAATGTTAGATGTCTGTCAGGCACGTGTTGCATACAAAC
TTGTTAGTCGCTATTTCGACATTTATGATGGTGGTTGTATAACTGCTAAAGATGTTGTGGTTACAAACCT
CAACAAAAGTGCTGGTTACCCACTTAATAAATTTGGAAAGGCTGGTTTGTATTATGAATCCTTGACTTAC
GAAGAGCAAGATGCTCTTTATGCTGTCACAAAGCGTAATGTGTTGCCTACTATGACACAGCTCAACTTAA
AGTATGCTATTAGTGGTAAGGAACGTGCACGCACTGTTGGTGGTGTTTCTCTTTTATCCACTATGACTAC
TAGACAGTACCATCAAAAACACCTTAAATCTATTGTGAATACACGCAATGCTTCTGTTGTCATTGGTACC
ACTAAATTTTATGGTGGTTGGGACAACATGTTAAACACGCTTATTAATGGTGTTGAAAACCCTTGTCTTA
TGGGTTGGGACTACCCTAAGTGTGACAGAGCATTGCCTAACATGATACGCATGATCTCTGCTATGATACT
TGGTTCCAAACACACAACATGTTGTACTACTGATGAAAGATATTATCGTTTGTGCAATGAGTTGGCCCAA
GTGTTAACAGAGGTTGTGTATTCTAATGGTGGTTTTTATTTTAAACCTGGTGGTACTACCTCAGGTGATG
CTTCTACAGCCTATGCTAACTCAGTCTTTAACATTTTCCAGGCAGTCAGTTCTAACATTAACAGATTGTT
GACTATCGACAGCAATGTTTGTAATAATGTTAGTGTCAAAACTCTGCAAAGAGAGTTGTATGACAACTGC
TACAGGTCATCAAGTGTTGACGAACAATTCATAGATAAATATTATTGCTATTTACGCAAACATTTTTCTA
TGATGATTTTGTCTGATGATGGTGTAGTCTGTTACAACAAAGATTACGCAGACCTTGGTTATGTAGCAGA
TATTAGTGCATTCAAAGCTACATTGTACTATCAGAACAATGTCTTTATGAGCACTTCCAAGTGTTGGGTT
GAACCTGACATTACTAAGGGTCCACATGAGTTTTGTTCACAACACACTATGCAGATTGTTGATGAAAATG
GTAAATATTATTTACCCTATCCTGATCCATCTAGGATATTGTCTGCAGGTGTTTTTGTTGATGATGTTGT
TAAAACTGACGCTGTCATTTTGCTTGAACGCTATGTTTCATTGGCTATTGACGCTTACCCTTTGTCTAAA
CACCCAAATCCTGAGTATCGTAAAGTATTTTATGTACTTTTAGACTGGGTTAAACATTTGCATAACACAC
TTAATCAAGGTGTTTTAGAATCTTTCTCTGTCACATTACTAGAAGACACGTCTTCTAAGTTCTGGGACGA
GAGTTTCTATGCCAATATGTATGAAAAGTCAGCCATACTACAGTCGGCTGGTTTATGTGTAGTGTGTGGT
TCTCAAACTGTACTTCGTTGTGGTGACTGTTTACGACGTCCCATGTTGTGTACAAAGTGTGCTTATGACC
ACGTGATTGCCACACCTCATAAATTCATATTGGCTATAACGCCCTATGTGTGTTCATATTCTGGCTGTAA
TGTTAATGATGTCACTCAACTTTATCTTGGTGGTCTTAGTTACTATTGTGCTGAACACAAACCCAGACTT
TCATTCCCTCTTTGTTCTGCTGGCAATGTTTTTGGTCTTTACAAAGCTTCAGCCACTGGTTCTCCAGATG
TTGAAATTTTCAACACACTGGCAACTTCTGATTGGACAGATGTTAGAGATTATAAAATTGCCAATGAAGC
TAAGGATTCTCTTAGACTATTTGCAGCAGAAACTATTAAAGCAAAGGAGGAAAGTGTTAAGTCTTCTTAT
GCTTGTGCAACACTTAAAGAAGTTATAGGACCTAAAGAATTACTGCTAAGTTGGGAGTGTGGTAAAGTTA
AACCACCCCTCAACAGAAACAGTGTTTTTACATGTTTTCATATTACAAAAGACTCCAAATTTCAAGTAGG
TGAATTTGTTTTTGAAAAAGTTGATTATGGTTCTGATGCTGTTAGTTATAAGTCCACTTCTACGAGTAAG
TTGTCTCCTGGTATGGTGTTTGTGTTAACATCTCATAATGTACAGCCGCTTCGAGCACCTACCATAGCAA
ACCAGGAACGCTACTCATCAATTCACAAATTGTACCCGTCCTTCAACATTGCCGACGCTTACTCTACGCT
GGTACCTTATTATCAAATGATAGGTAAACAGCGTATAACTACAATACAGGGACCTCCTGGTAGTGGTAAG
TCACATTGTGTTATAGGTCTGGGTTTGTACTACCCTGGTGCACGCATAGTTTTCACAGCATGCTCTCATG
CAGCTGTTGACTCTTTGTGTGTTAAGGCATCAACTGCTTATGTAAATGACCGCTGTTCTAGGATTATTCC
TGCTCGTGCTAGAGTGGATTGTTTCAGTGGTTTTAAGTCTAATAACAATAGTGCTCAGTACCTCTTTTCC
ACTGTCAATGCACTACCTGAATGTAATGCTGACATAGTTGTGGTGGATGAGGTTTCGATGTGCACGAACT
ATGATTTGTCTGTGATTAACCAGCGTTTGTCTTACAAACATATTGTTTACGTTGGTGACCCTCAACAATT
GCCTGCGCCTAGAACCATGATCTTGCGTGGTGTTTTAGAACCTAAGGATTATAATGTTGTCACACAAAGA
ATGTGTGCTGTTGGTCCTGATGTCTTTTTACACAAGTGTTATCGTTGTCCAGCCGAGATTGTGAAAACAG
TTTCTGAGATGGTTTATGATAACAAGTTTGTGCCTGTACATCCAGAGAGTAAACAGTGTTTTAAGCTCTT
CTGTAAAGGCAATGTGCATGTTGACAATGGTTCTAGCATTAACCGTAAGCAATTAGATGTTGTCAAATTA
TTTTTGGCTAAAAATCCATCTTGGTCTAAGGCAGTGTTTATTTCACCATACAACAGTCAAAATTATGTGG
CTAGTAGAGCTCTCGGTCTTCAGATACAAACTGTCGATTCATCGCAAGGCAGTGAATATGATTATGTCAT
TTTTACACAAACATCTGACACACAGCATGCTTGTAACGTTAATCGCTTTAACGTTGCCATTACACGTGCT
AAGAAAGGTATTTTGTGTATAATGTGTGACAAAGAGCTCTTTGACGCTCTAAAATTTTTTGAAATTAAAC
TTACTGATTTACAGGCTGGTGAAGGTTGTGGTCTTTTTAAAGATTGTTCTAGGAAACCCGATTTATTACC
CCCATCGCATGCCACCACGTTTATGTCTTTATCTGATAATTTTAAGACGAGTGGTGATCTCGCAGTGCAA
GTTGGTGTGAATGGTGTTTGTAAGTATGAACACGTAATTTCCTTTATGGGATTTAGGTTTGATACTAACA
TACCTGGTTACCACAGTTTGTTTTGCACCAGAGACTTTGCTATGAGACATGTTAGAGGTTGGTTGGGTAT
GGATGTTGAAGGCGCTCATGTTGTAGGCGACAACATCGGTACTAACGTACCTTTGCAGGTGGGTTTTTCT
AACGGTGTGGATTTTGTTGTCCAACCAGAAGGTTGTGTGGTCAACGAGTTTGGCACAAACATTCAACCCG
TTAGAGCTCGTGCTCCGCCAGGTGAACAGTTCGCACATCTCATACCACTTATGCGTCGTGGTCAACCATG
GGTTGTCGTGCGTAAACGCATAGTGCAGATGTGTTGTGACTATTTGTCTGGCTTATCAGATGTGCTCGTA
TTTGTTTTATGGGCCGGTGGTTTGGAGTTGACTACCATGAGATACTTTGTTAAAGTAGGACAAGTCAAGC
ATTGTCACTGCTCTAAAGAGTCTACTTGTTACAATAGTACAACTCATGAGTATTATTGTTTCAAGCATGC
ACTTGGTTGTGATTATCTGTATAATCCTTTTGTTATTGATATACAACAGTGGGGTTATACAGGCTCTTTG
AGTTTGAACCATCATGAGGTTTGTAATGTGCATCGTAATGAACATGTTGCGTCTGGTGATGCTATCATGA
CACGGTGTCTTGCAATTCATGATTGCTTTGTGAAAAGTCTTGACTGGTCTATTACATATCCATTCATTGC
TAACGAGCGTGAAATTAATAGTGGTGGTCGTGTTGTTCAGCGTATGCTAATGAAGACAGCCATTAAGTTG
TACAATCCTAAAGCAATCCATGACATTGGTAATCCAAAGGGCATCCGCTGTGCTGTAACAGATGCTAAGT
GGTTTTGCTACGATAGGCAACCTTTGAACTCCAATGTTAAATTGTTTGAGTATGATTATATAACACACGG
TCAACTGGATGGTTTATGTTTGTTTTGGAACTGTAATGTTGACATGTATCCTGAGTTTTCCATTGTTTGC
CGGTTTGATACTAGATGCAGATCCAGCCTCAATCTAGAAGGCACCAATGGTGGTTCCTTATATGTCAACA
AACATGCTTTCCACACACCAGCTTTTGATAAACGTGCTTTTGCTAAGCTTAAACCTGCACCCTTCTTCTT
TTATGATGACGGTCCTTGTGACCGCATACAGGAAGAGATTAACTATGTTCCATTGCGTGCTGCTAATTGC
ATAACACGTTGTAACATTGGTGGTGCTGTTTGTAGTACACATGCTAAGCAGTACTATGATTATGTTAATG
CTTACAATAGCTACACTCAAGCTGGTTTTACATTATGGGTTCCTAATACATTTGATCTTTTTAATTTGTG
GCAAACTTTTGCTGACACAAAATTACAGAGTCTCGAAAATATCGCATATAATGTGATTAAAAAGGGCTCT
TTTGTTGGTGAGTCTGGTGAGTTACCAGTCGCCATTGTAAATGACAAAGTTTTTGTGCGAGAAGGCACTG
TTGACAACCTTGTCTTTGTAAATAAAACTTCATTACCTGCTAATGTGGCATTTGAACTTTTCGCTAAAAG
AAAAGTTGGTTTAACACCACCCCTTAGTGTACTCAGAAACCTTGGTGTTGTGAGTACATATAAGTTTGTT
TTGTGGGATTATGAGGCAGAAAGACCTTTTACTTCATTTACAAAGAGTACGTGTAGCTACACAGACTTTG
ATGAGGATGTCACAACATGTTTCGATAATGCTATTGCTGGTTCTTTTGAACGCTTTACATTGACTAGAAA
TGCTGTTTTGATATCTAATGTAGCTATTAAGAAACTAGTAGGCATGAAAATTGCTTATGGTTTGCTTAAT
GGTGTTCCTGTTTCTGTGTGTGAAAATAAACCTGTCACTTGGTACATATATGTTCGTAAGGATGGACAGT
TTGTGGATCAGTATGACGGTTACTACACACAAGGTCGTAACATAGCAGAGTTTTTGCCGCGTAGTGATAT
GGAAAAAGACTTCTTAGAAATGGACATGGGCATGTTTATAAATAAGTATGGTCTTGAAGACTATGCTTTT
GAACATGTTGTCTATGGTGATGTCTCAAAAACTACACTTGGTGGCTTACACCTGCTTATTTCTCAAGTGC
GTCTACAGAAAATGGGTGTTCTTAAAATTGATGAGTTCACATCTAGTAATGATGGTACGCTCAAAAGCTG
CACTGTCACTTATGCAAACAATCCAAGTAGCAAAATGGTTTGCACATATATGGATTTGTTGTTAGATGAC
TTTGTAACAATACTTAAAAATTTGGACTTAGATGTTGTGTCCAAAGTTCAGGAGGTTATTATAGATTGCA
AAGTTTGGCGGTGGATGCTGTGGTGTAAGGGTCATAAAGTTCAAACTTTTTACCCTCAATTACAGTCTGC
TGAATGGAAATGTGGTTATTCCATGCCATCAATCTACAAAATACAAAGGATGTGCCTTGAGCCTTGTAAC
CTCTACAATTATGGTGCCAGTATCAAATTACCTGATGGCATCATGTTCAATGTCGTGAAATACACTCAAT
TATGTCAATATTTAAATAGCACTACTATGTGTGTACCATACAACATGAGGGTTTTGCACCTTGGTGCAGG
GTCGGATAAGGGAGTTGCACCTGGTACCGCAGTCTTACGAAGATGGCTGCCAAGTGATGCTATTATTGTT
GACAATGATGTTGAAGACTATGTTAGTGATGCTGACTACAGCATTACAGGTGATTGTTCTACAGTTTACT
TAGAAGATAAGTTTGACCTAGTCATATCTGATATGTACGATGGTAAAACAAAACACTGTGATGGTGAGAA
TGTTTCAAAGGAAGGATTTTTCGTTTACTTCAACGGTGTTATAAACGAGAAACTTGCACTTGGAGCATCC
GTTGCTATAAAGGTAACTGAATATTCGTGGAACAAGAAACTTTATGAGTTAGTTCAACGATTTGAGTTTT
GGACATTGTTTTGTACCAGTGTTAATACGTCTTCATCCGAAGCGTTTTTAGTTGGTATTAATTATCTTGG
GACCTTTAGCGATAAGCCAGTTATAGATGGTAATGTAGTTCACGCCAATTACATATTCTGGCGAAATTCA
ACAATTATGTCGATGTCCTATAATAGTGTGCTTGACCTCGCCAAGTTTAATTGTAAACATAGAGCAACGG
CAGTCATACAACTTAAAGACAGTGACATTAATGATATGGTCCTTGGTCTTATAAAAAGAGGCAAAATACT
TGTTAGAATGAATGGGACTTATATGGGTTTTTCTAACCATTTAGTCTCAACTAAACAAAGATGATTTCTC
TTGCTGTTTTTATAGCAGAGATACTTGTTATTATTACGAGATTTTCGTGTCTTGCTGATCAATGTCAAGG
TACACCTTGGTTAGCTAAGAACTTGAATCTTGGTTTGTCACCTAATTTGACTAATGTTTATGTACCAGGT
TTGTTGCCTACAAAGGACACCACAAAGTGGTATTGTCGCACAGAATCATACTTTTTTACAGGTTATAAAG
GTGTGTTTCTATCGTACCACAGTTTTGGTATGCCTTGGTCTATTGGTGTTTCCAATTCTGATCTCTCTGT
TGCACGTGAAACATGGTCATTGTATGTTTCTCATGGCAATAATAGAGGTGTTATGACCTTTAGAATTTGT
AAATGGCCACGTGTGCCTGGACTAGCACAAGAACCTACTCCTAACACTGGTGGTGTTAATTGTGTAGTAG
ATAAGCAATTTCCTTTCACTTTTCAACACGAGGCTAATGAAATGGTGGGTATTACTTGGAGTTCTGATTA
CGTTCGTATTTATGGGCTTCAAAGTACCTATCGTTTTTATTTTCCTAATAAGTGGAATAAAGTTAATGTT
AATTGTGCACATAAGAGTTCTTGTCAGGTCTACCCTGTTAAAGACAGTGTTACATGGGTTGTTAATACCA
CAGCTGATGGACGTGTTAAAGATTACACTATTTGTGGTTCTTGTAATGGTTTTCCGCAACACGTCTTCCC
TGTTTCACCTGGTGGTTTAATACCTCCTGATTTTAGTTTTGACGGTTGGTATGTTTTAACCAACTCTTCC
ACTATGGTGCAAGGTAAGTTTGTTGCATCTCAACCTTTAAAATTGTTGTGCCTTTGGCCTGTACCTGCTT
TGGATTCTAGTGCTAGTGTTGTTTATTTTAATTTATCACGTAGTAGTGCGCAATGCAATGGTGCTACTGA
AAATGGTTTAGCCGATGCATTACGTTTTTCTATGAATTTCTCTAGAAATGGTTTCAGTGGTGCTCACAGT
TTGACTTTAAAAGGTGCCATTGATTATGTTTTTAGGTGCACTAATAACACTAACGTAACAAGTTTTTATT
CTATACCATTTGGTTATATTAAAACAGTTTACAGGTGTTTTGTATCCTATAATAGCACTAATGGCACAGT
GTCAGAGTTTGTGGGTGTTTTGCCACCTCTTGTTAAAGAAATTGTTGTCTCACGTTATGGCACCATTTAT
TTGAATGGTGTACGTATCTTTAAGTTACCGCCTTTAGAAGGTGTTGTGTTCAATGTAACTAGTGATGTTG
GTTCAGACTTCTGGACTGTTGCATTTGCGCAAAACGCTGAAGTTTTGTTGGAAGTTAATGCAACTAACAT
TGTTAATTTGCACTATTGTGATAATACGCTGAACAAGGTTAAGTGTCAACAACTTTCTTTTCAATTACCT
GATGGTTTTTATCCTACAACGAACCTGGTGGATAGTGTTGTTCCTAAAACATATGTTGCTTTACCCTATC
ATGCAACACACACGTACATTGAATTAAATATAACTGTTAATTATGTACGTGATGAGATAGCATTAACTGG
AGGTGGTGAGTTGACTTGTGTTAATACAACACAATTCACCACACTCTTCTCAACTAATGCTGCTACTGAT
GGGAACACTTATGAAGGTGTAGTTATTAATGTCAATTGTCCTTTTGACTTTGACAACCTTAATAATTACC
TGTCTTTTGACTCCATTTGTTTCTCTTTGAAACCAATCGCTGGTGGTTGCACTATGCGACTTGTTAAACA
AATTCTTGTGTCATATTTTGACATAGGTGTTTTGTATGTTTCCTATACACCTGGTTCAAAAATTACTGGT
GTTTTACAACCTACAGGTGGTGTTTATGACCCTAGTATTGTTCATATGGGTGTTTGTACAGACTACGTTG
TTTATGGTCTTACTGGTAGAGGTGTTATATCTGTCAGTAACACCACTTACATTGCTGGTTTGTACTATAC
ATCATTTGCAGGACAGTTGTTAGGTTTTAAAAATTCTACTACAGGTGTTCTTTATGCTGTTGAACCATGT
GACACTTCTAGTCAAGTTGCCGTCTACGGTGATGCTATTATAGGTGCTATGACATCTTCTGCTAATGTCA
CTTTTGGTTTTGTTAACACCACAGTGCTACCATCTTTTTACTACCACACTAATGGTTTTGGTGGTTGTCA
GACACCCGTGTTAGAGTATGGTTCCATGGGTTTGTGTGCTGACGGTAGTGTTGTAGATGTTACATTACGC
CAATACCAACCAGCGCCAGTTTCACCAATTGCAACAACAAACATTAGCATACCATTAAACTTCACAATCT
CCATTCAAACAGAGTACATACAGATGTACTCACAACAAGTTTCAGTTGATTGTAGTATGTATGTTTGTAA
TGGTAATGTTAGGTGTTTGCGTTTACTCACGCAGTATGCAACTGCTTGTAGGAATATTGAAAGTGCTTTA
CAACTTAGTGCTCGTTTAGAGTCGTTAGAAGTCAGCTCAGTTGTTTCTGTTTCTGAAAATGCCTTAAAGT
TGGCAAATATCACACATTTTGATAGTTACAATTTATCAGTTTTGCTGCCTAAAAGTGATGGTAAAAGTGT
TGTTGAAGACATACTTTTTGATAAAGTTGTTACTAGTGGTCTTGGTACCGTTGACCAGGATTACAAAAAT
TGTGTGGGTAAACTTGGCGTTGCACAGGACATAGCTGACGTTGGTTGTGCACAGTATTATAACGGCATCA
TGGTGTTACCTGGTGTTGTGAATGAAGCAAAAATGGGTTTGTATACTGCATCTTTAACAGGTGCCATGGT
GATGGGAGGTTTTACAGCTGCAGCTGCTATACCATTTTCTTTGGCTGTACAATCTCGTCTTAATTATGTG
GCCTTGCAAACTGATGTTCTGCAACAAAATCAAAAGTTGTTGGCAGACTCTTTTAATAATGCACTTTCTA
ATATAACATTGGCCTTCTCCAATGTTAATGATGCTTTGCAAGATGCTTCTGAAGCCATTAACACGGTTGC
GGTGGCATTAGGCAAGGTTCAAGGTGTTGTCAATGAGCAAGGACAAGCCATAGCGCACCTTACACAACAA
TTAACGCAAAATTTTCAGGCTATTTCGCATTCTATAGCTGATATTTATAATAGACTTGATGAACTTGCTG
CTGACGCACAAACAGACCGTTTGATAACGGGTCGTCTTAGTGCGTTGAATGCTTTTGTTACTCAAACTCT
AACTAAGTCAGCTGAAGTTAAACAGAGCAGGCTTTTGGCTCAACAAAAGGTGAATGAGTGTGTTAAATCA
CAATCAAATCGGTTTGGTTTTTGTGGCAATGGTACACATTTGTTTTCCATTGTTAACAATGCACCTAATG
GTTTGATGTTTTTCCATACCGTTTTAGTTCCTACTGTTTACGTCACAGTTTCTGCATGGGCTGGTGTTTG
TTTTAATAACCGTGCGTACATTCTTAGAGATGTTGAGAGTGTGCTTTTTAATAATAACGGTTATTATGTC
ACTAACAGGAAGATGTATGAACCACGTGTTCCTCAGTTCTCCGACTTTGTGCAAGTTGAGAATTGTGTTG
TGTCTTATTTGAATCTTTCTGATGTTGATGTTAACACTGTAATACCTGATTACATAGATGTTAACAAAAC
TCTAGAGGATTTGTTACAACAGTTACCAAATCACACACTTCCTGACCTTGGCCTAGATCAGTATAATAAT
ACAATTTTAAACTTGACAGCTGAAATAGACATTTTACAGAACAAGTCTGACTTGTTGTTGGCATCTACTG
AAAGGTTGCAACAACTTATTGATAACCTCAATAAGACGTATGTGGACTTAGAGTGGCTTAATAGATTTGA
ACAGTACATTAAGTGGCCTTGGTATGTGTGGTTGGCAATTTTGCTTGCCATCATACTATTCTCATTTTTG
ATGTTATATTGTTGTTGTGCCACTGGTTGTTGTGGTTGTCTTAGCTGTTTGACCAATTCTTGTGATTGTC
GCGGCAAAAATTTACAACGTTACGAAGTAGAAAAAGTGCACATTCAATAATGACTGGCCTATTTCAAACC
TCTTTTGGTGACTCAGTTCAGGCTGGTGTGCAGCATTTAGTTGAAAAATTACCATTACCTGATGTACATT
TTCAACATGCATTGCCATTAGCCAATTTTCTCATGACTAGTGTGTTTGTAATTTACTTTGCTATGTACAA
AGCCAGCTCAGTTAGAAATAACTGTATTATGTTTGGCTTTAGGCTTTTTGCAATGTTTGTATACGCACCA
TTGTTATGTTATTTTGAGCTGTATGTTGATGCCGCTATTATTTTCGGTGCTCTTTACACTAGGCTTATGT
ATGTTACGTATTATGCCTGTAGGTACAGATCACCTGCATTTGTTGTGCTTAACACTGACAAACTTGCTTT
TGTTCAAGGCTATTATTGGTACTATCAGGACAACTCATACCTGACTTTGTTAGGTGGTGAAAACTTTGTC
ACCTTTGGTCCTAATTTTGTGCCAATTGCTGCCACTAATGACCTTTACATTGCTCTCAGAGGTAAGAAAG
ATGATGATGTACCACTGGTGAGGCGCGTAGAACTCATCAATGGACAATTCTTTTACATCTTTGCACAAGA
GCCTGTTGTAGGTGTGGTGAACATGTGCTTTTCTGAACTTAGACTCTGTGAAGAAGTTGAAGTTCAATCT
GATTAACAAACTAAACTAAATTTAACCTAACACCATGATGTTTACATTAGTGAATGATAATGGTATGATT
GTAAGTGCAATCCTTTGGTTAGTTGTGTTGTTGTTTGTTCTACTAATTGCTGTTACTGTAATTAAATTAA
TTCAATTATGCTTTACATGTCACAAGCTTATGAGCAACACAATTTATGTGCCTGTTTATAGTGCTTATGT
TATGTATAAAAATTTTATGCAAATAGATCCTTGCCCAGTTATAGATGTCTAAACGAAATGTCAAACGGTG
ACAATTCAACGATACCCACAGATGTGGTTATCCAACATCTAAGAAATTGGAATTTCAGTTGGAATGTAAT
TCTTACAATATTTCTAGTTGTCCTTCAATATGGACACTACAAATATAGTGCTGTGCTTTACATCCTGAAA
ATGACAATTCTGTGGCTGCTGTGGCCTCTTGTACTTGCCCTGTCAATTTTTGACAGTTGGTCAAGTTTTG
GCAACAACTGGACCATGTTTGCTTTTAGCATCTTAATGGCTTGCATTACGCTTGTGCTGTGGATAATGTA
CTTTGTCAACAGTTTCAGGCTGTACCGCAGAACCAACACTTTCTGGGCCTTTAACCCGGAAACTGATGCC
ATTATCACACTGTCCGTCTTTGGTCGCCAAGTTTCAATTCCAGCCCTTGTGGCTCCAACTGGCATTACGC
TCACTGTGTTAAGTGGTACACTCCTAGTGGAAGGCATTAAGGTTGCTACTGGTGTGCAGGTAAACCAATT
ACCTACGTACATCACTGTTGCCAAGCCTAGCACCACAATTGTGTATCAACGTGCTGGACGTTCGCTCAAC
ACGCGCTCAAACACAGGTTGGGCGTTTTATGTCAGATCGAAAAATGGCGACTACTCTGCTGTAACGAGTT
CTGCTGATTCGCTTACAGAAGACGAGAAACTTTTACATTTAGTCTAAACTAAACAAAATGGCCTCAGGTG
GCAACAATGTTAGCTTTGCTAACAAACCCAGAGGTCGGAGTGGCAAAGTCCCTCTATCTTATTATTCTCC
TGTCATGATTGACGGAGATCAACCCTTTTGGAAGGTGATGCCCACTAATGCCGTACCAACTGGCATGGGT
GACAAAAATCAACAAATTGGCTATTGGAATGAACAACCCCGTTGGAGAATGGTCAAAGGCCAGCGTAAGG
AGTTGCCGTCTAAGTGGCACTTTTATTACCTTGGTACTGGACCACAAGAAGATGCACGCTATCGTCAAAG
AATTGAAGGTGTGTTTTGGGTTGCTGTACAGGGTTCAAAGACTGATCCTACCGGCTTGGGAACTCGCAGG
AAGGGTCAGGATCTGATCTCACCTAAATTTGCTGTTAAAATTCCTTCCAATGTGATGATTGTAGAGGAAA
CCTCTCGCCCTCCTTCTAGATCACAAAGTAACAGCAGGCCTCAGAGCAGAAACAACTCTAGGCCTCAATC
TAAAAATAACTCTCAGAACAACTCTCGTGACAACTCGAGAGCACCAAGCAGACCTCGTTCACGCGCAAAT
TCAACTAGCTCTACCACTAATGATGCTGTTGATATTGTTGCTGCCGTGAAACAAGCGCTTAAAGAGCTTG
GTGTAACACCTGAGAAGAAAAATCAAGAAAAACAAAAGAAAAGCAAGAAAAGCAATTCTGGTAGCAACAC
CCCAAAAGAGGCTGCCACTCCAAAACAAAAATCTAGCCCTTCAACACCAAGGAAGCAGCTAGAAAGACCA
GAGTGGAAACGTGTGCCAAACAAGGAGGAAAATGTTACTGCTTGTTTTGGACCACGAGACACTCTTCACA
ACTTCGGTGATCAAAAGCTTATTGCTGAAGGTGTGCAAGCTTCTCATTATCCCCAACTCGCTGAACTCGT
ACCTACACCAGCTGCATTGCTGTTTGGTGGCGAAGTTTCAACGAGAGAACGTGGTGATGAAGTTGAAATT
ATGTATGTTTACAAAATGAAGGTTCACAAATCAAACAAGGACCTTCCTGCTTTCTTGCAACAAGTCAGTG
CTTATGCTCAAGCTCCTGATGCTACAACTACAGAAAAAGCTACTGTGCAACCACTGCTGAATCCAACTGC
TCCAGACTTCCAACCAGCTACATCGGAAGAAGTCATTGAAATGATTAACACTGTGTATGATTCTTTTGAT
GCGTAATCAACTAAACAGGTAATGCATGTGCTCATAATTATCATCTGCTTCTATTTGCAGTGCTTTTTGT
GGGCATTACAACCTTTGTTTGAGGCTTGCGCTTATCATTGGCCTGTTTGTGTTTACGTACCTAGTACCAT
TTCATACTGTTATAGTGTCCTTGGATTTAGTCTTATTGTAATTGGCTGCTTATTTTCTGCTTTGGTTCTT
GACGTTCTTGGACTTATTGCACTTAAGTGTCTGTTAGTTTGTAGGTTTCTTAATTAATCAATCACAATGA
AATTGTTACTGCTTCTTAGTATTCTTAGCTTTTCTTCTGCAGCCCCAACTACCTATCGGGCATCTCAAGC
TGCTAAAGTACTAATTTATACCACTGAAAAAGTCACTCTAAATAACCAGAGAACACACTCATACACAAAA
TGGGGTGTGTGCTCCACAGGATGGAACACATACACGAACACAATGGTTGTGGTTAATGGTAGGTGGGTTG
AAACAACCAAACCGCCAAGACCCACAGCCATTGCTATTCCAACATTCCCATACGAGCCTAGAAGTGAAAA
ACCAGGTTTTGGTTCTCACTTTGACTATGGCCGTATTGAGTATGAGAGTATCTTGTGTGCTGCATTTGAG
CATGTCAGTAATGACATTGCAAAAATTGCTGCTCAATTGGCTCAGACACAGCGACGACATCAGACTTTCG
CTGTGACTACTTTTAGGTGGTCTACTCCTTCAAATTAATACGCACCCTTTCTTCGGATTGACAAGGTGCT
ACTCTTATACAGAATGGTAAGCCTGTTTATAAGCTAGTATAAGTAGAGTTTATAGATATTGCTGTGCCTA
GACCAACGTACATATTACAAGACACTCCAGAGTCAGAGTAATTTAAAGATCCGCATAGACGAGCCAACAA
TGGAAGAGCTGTCATGGAATCTTGTATATATGTATCAGTAGTTGTTAGTGGACACGGCTTTGATAGGGAT
ACGC

>gi|315192962|ref|NC_002306.3| Feline infectious peritonitis virus, complete genome
ACTTTTAAAGTAAAGTGAGTGTAGCGTGGCTATAACTCTTCTTTTACTTTAACTAGCCTTGTGCTAGATT
TGTCTTCGGACACCAACTCGAACTAAACGAAATATTTGTCTCTCTATGAAACCATAGAAGACAAGCGTTG
ATTATTTCACCAGTTTGGCAATCACTCCTAGGAACGGGGTTGAGAGAACGGCGCACCAGGGTTCCGTCCC
TGTTTGGTAAGTCGTCTAGTATTAGCTGCGGCGGTTCCGCCCGTCGTAGTTGGGTAGACCGGGTTCCGTC
CTGTGATCTCCCTCGCCGGCCGCCAGGAGAATGAGTTCCAAACAATTTAAGATCCTCGTTAATGAGGACT
ACCAAGTCAACGTTCCTAGCCTTCCTTTCCGTGACGCACTGCAGGAAATTAAGTACTGCTACCGTAACGG
TTTTGATGGCTATGTCTTCGTGCCTGAATACCGTCGTGACCTAGTTGATTGCAATCGTAAGGATCACTAC
GTCATTGGTGTTTTGGGTAACGGAATAAGTGATCTTAAACCTGTTCTCCTTACCGAACCTTCCGTCATGT
TGCAGGGTTTCATTGTTAGAGCCAACTGCAATGGCGTTCTTGAGGACTTTGACCTTAAATTCGCCCGTAC
TGGAAACGGCGCCATATATGTGGACCAATACATGTGTGGTGCTGATGGAAAGCCAGTTATTGAAGGTGAG
TTTAAGGATTATTTCGGTGATGAGGACGTTATCATCTATGAAGGAGAGGAGTACCATTGTGCCTGGCTAA
CAGTGCGCGATGAAAAACCTTTATGGCAACAAACTCTCCTTACAATTAGGGAAATCCAATACAACCTGGA
TATCCCACATAAGTTGCCAAATTGTGCTATCAGAGAGGTAGCACCACCAGTCAAGAAGAATTCTAAGGTT
GTTCTTTCTGAAGAGTATAGAAAACTCTATGACATCTTCGGCTCGCCATTTATGGGCAATGGAGACAGTC
TTAACACGTGTTTTGACAGCCTTCACTTCATTGCTGCCACCCTTAAGTGTCCTTGTGGCGCTGAAAGTAG
TGGTGTTGGTGATTGGACTGGCTTTAAGACTGCTTGTTGTGGTCTCCATGGCAAAGTTAAAGGTGTCACA
TTAGGTGCTGTTAAGCCAGGTGATGCCATTGTCACTAGCATGAGTGCTGGCAAGGGTGTAAAATTCTTTG
CTAATAGTGTACTCCAATATGCTGGTGATGTGGAAAATGTCTCTGTTTGGAAAGTGATTAAAACTTTCAC
TGTTAATGAGACTGTCTGCACCACTGATTTTGAAGGCGAATTGAACGACTTCATTAGACCAGAGAGTACT
TCGCCTGTTTCATGCTCCATTAAGAGAGCTTTCATCACAGGTGAAGTTGATGATGCAGTCCATGATTGTA
TTATCGCAGGAAAGTTGGATCTTAGTACTAATCTTTTTGGTAGTGCTAACCTGCTTTTTAAGAAAATGCC
CTGGTTTGTGCAAAAGTGTGGTGCGATTTTTGCTGATGCTTGGAAAGTTGTTGAAGAACTGCTTTGTTCT
CTTAAACTTACATACAAGCAAATTTATGATGTAGTAGCATCACTCTGCACTTCTGCTTTTACTATTATGG
ACTACAAACCTGTATTTGTAGTTTCATCTAATAGTGTTAAGGACCTCGTTGATAAGTGTGTTAAAATTCT
TGTGAAAGCCTTCGATGTCTTCACACAGACAATTACCATTGCAGGTGTAGAGGCTAAGTGCTTTGTGCTT
GGTTCTAAATACTTGCTTTTTAACAATGCACTTGTTAAGCTTGTCAGTGTTAAAATACTTGGTAAGAGAC
AAAAAGGTCTTGATAGTGCATTCTTTGCCACTAACTTAATTGGTGCTACTGTTAATGTGACACCACAACG
GACTGAGTCAGCCTACATTAGCCTGAATAAAGTAGATGACGTTGTTACGCCTGGTGGAGGTCATATTGTC
ATTATTGGTGATATGGCTTTTTACAAGAGTGAAGAATACTATTTTATGATGGCAAGCCCTGATTCAGTCC
TTGTTAATAATGTTTTTAAAGCCGCGCGAGTGCCATCTTATAACATTGTTTATGATGTGAATGATGACAC
CAAGAGTAAGATGGTGGTTAAAATAGGAACATCATTCGACTTTGATGGTGACCTCGATGCTGCTATTGCT
AAGGTTAATGACTTACTTATTGAGTTTAGACAAGAAAAGTTGTGTTTCAGAGCGCTTAAGGATGGTGAAA
ACATCCTAGTTGAGGCATATCTTAAGAAGTACAAGATGCCAGTTTGTCTTAAAAACCATGTTGGTTTATG
GGACATCATACGACAAGATTCCGGTAAGAAGGGTTTTCTTGACACTTTCAATCATCTTAATGAATTGGAG
GACGTCAAGGATATAAAAATTCAGACCATTAAAAACATTATTTGTCCTGACCTCCTACTGGAATTGGATT
TTGGTGCCATCTGGTACAGATGCATGCCAGCATGCTCTGACAAGTCCATTTTAGGTAATGTTAAAATCAT
GCTAGGCAATGGTGTTAAAGTAGTTTGTGATGGTTGTCACAGTTTTGCTAATCGTTTAACGATTAATTAC
AATAAACTCTGTGACACAGCTCGCAAAGACATTGAAATTGGTGGCATACCGTTTTCCACCTTTAAAACAC
CATCTAGCAGTTTTATTGATATGAAAGATGCTATCTATTCCGTAGTTGAATATGGTGAAGCACTCTCTTT
TAAGACTGCAAGTGTGCCTGTAACTAATAGTGGCATCATTACAACTGATGACTGGTCAGATCCCATTTTG
TTAGAACCTGCAGATTATGTTGAACCTAAAGACAATGGCGATGTAATTGTCATTGCTGGATACACCTTTT
ACAAGGATGAAGATGATCATTTTTATCCATATGGTTCTGGCATGGTTGTGCAGAAAATGTACAACAAGAT
GGGTGGTGGTGACAAGTCAGTTTCGTTTTCAGACAATGTTAATGTTAGAGAGATAGAACCTGTTACACGT
GTCAGGCTAGAATTTGAGTTTGACAATGAGGTGGTAACACAGGTGCTTGAAAAAGTCATTGGTACCAAAT
ATAAATTTATAGGTACCACTTGGGAAGAGTTTGAAGATTCTATCTCCGAGAAACTTGACAAAATTTTTGA
CACGCTTGCTGAGCAGGGTGTAGAACTTGAAGGCTATTTCATTTACGACACATGTGGTGGATTTGACATT
AATAACCCAGATGGTGTTATGATTTCACAGTACGATCTTAACACAGCTGCTGATGACAAAAGCGATTCTG
ATGCAAGTGTGGAAGACATCTCTTTGATTTCTGACAACGAAGATGTTGAACAAATTGAAGAAGATAATAC
TTCAACTGATGATGCTGAAGATGTTTCATCTGTAGAAGGAGAAACTGTATCAGTTGTCGATGTTGAAGAC
TTTGTTGAACAAGTTTCGCTCGTAGAAGAAAATAATGTTTTAACTCCTGCTGTAAACCCTGATGAGCAAC
TTTCCTCAGTAGAAAAAAAAGATGAAGTCTCTGCTAAAAATGATCCGTGGGCTGCTGCTGTTGATGAACA
GGAAGCTGAACAACCTAAACCTTCCTTGACCCCATTCAAGACAACAAATCTTAATGGTAAAATCATACTT
AAACAACAAGATAATAATTGTTGGATAAACGCTTGCTGTTATCAATTGCAAGCCTTTGATTTCTTCAACC
ATGATTTGTGGGATGGTTTTAAGAAAGATGATGTTATGCCTTTTGTAGACTTTTGTTATGCAGCTCTAAC
TTTGAAGCAGGGTGATTCAGGGGATGCAGAATACCTTTTGGAGACGATGCTCAATGATTATAGTACAGCT
AAAGTCACACTTAGTGCTAAGTGCGGCTGTGGTGTTAAAGAGATAGTTTTAGAACGAACTGTGTTTAAGC
TCACACCTCTTAGGAATGAGTTTAAATATGGTGTCTGTGGTGACTGTAAGCAAATTAACATGTGTAAGTT
TGCTAGCGTGGAAGGTTCTGGTGTTTTTGTTCATGATAGAATTGAAAAACAGACACCTGTGTCACAATTT
ATTGTGACACCTACTATGCATGCAGTTTACACAGGTACAACACAGAGTGGTCATTATATGATTGAAGATT
GCATTCATGATTACTGTGTGGATGGTATGGGAATTAAACCTCGTAAACATAAGTTTTACACATCCACTTT
GTTTCTTAATGCAAATGTAATGACAGCTAAATCTAAAACTATGGTTGAACCACCTGTGCCCGTAGAGGAT
AAGTGTGTAGAAGACTGTCAAAGTCCTAAAGATCTTATACTACCCTTTTATAAAGCGGGAAAAGTCTCAT
TTTACCAAGGAGATTTAGATGTTTTGATTAACTTTCTTGAGCCTGACGTCCTTGTTAACGCTGCTAATGG
TGATCTTAGACACGTGGGTGGCGTTGCTAGAGCTATTGATGTATTCACAGGTGGTAAGTTAACAAAACGC
TCTAAGGAGTACCTTAAATCCAGCAAAGCAATAGCTCCTGGTAATGCTGTGCTTTTTGAAAACGTACTTG
AGCATCTTAGTGTGTTGAATGCTGTAGGACCACGTAATGGTGACAGTAGAGTTGAAGGTAAACTCTGTAA
TGTCTACAAAGCAATCGCTAAGTGTGATGGTAAGATACTAACACCACTTATTAGTGTTGGTATCTTCAAA
GTCAAACTGGAAGTTTCGTTGCAGTGTCTACTTAAAACTGTCACAGATAGAGATTTAAATGTCTTTGTTT
ACACTGACCAAGAGAGAGTTACCATAGAAAATTTTTTCAATGGTACTATTCCTATCAAGGTAACGGAAGA
TACTGTGAATCAAAAGCGTGTGTCTGTAGCACTTGATAAAACTTATGGTGAGCAACTCAAAGGAACTGTT
GTTATTAAAGACAAAGATGTTACTAACCAGTTGCCAAGTGTGTCAGATGTCGGTGAAAAAGTCGTTAAGG
CATTGGATGTTGATTGGAATGCTTACTATGGCTTTCCAAATGCAGCAGCTTTTAGCGCCAGTTCCCATGA
TGCTTATGAATTTGATGTTGTAACACATAACAACTTCATTGTTCATAAGCAAACTGATAATAATTGTTGG
GTTAATGCAATTTGTTTAGCATTACAGAGACTTAAACCAACATGGAAGTTTCCTGGTGTTAAAAGTTTGT
GGGATGCATTTCTCACGCGTAAAACTGCTGGATTTGTACATATGCTATATCACATTTCGGGCTTAACGAA
AGGACAACCTGGCGATGCCGAGTTGACTTTACATAAGCTTGTTGATTTGATGTCAAGTGATAGTGCAGTT
ACTGTCACACACACAACTGCATGTGATAAGTGCGCTAAAGTTGAAACTTTCACAGGTCCTGTGGTAGCGG
CACCTCTTTTGGTTTGTGGCACTGATGAAATTTGTGTCCATGGTGTACATGTCAATGTTAAAGTGACAAG
CATTAGAGGTACTGTGGCTATCACTTCTTTAATAGGTCCTGTAGTGGGTGACGTTATTGATGCAACTGGT
TACATTTGCTACACTGGTTTGAATTCGCGTGGCCATTATACCTACTACGATAATCGTAATGGTTTAATGG
TTGATGCCGATAAGGCCTACCATTTCGAGAAAAACCTTTTACAGGTCACAACAGCCATTGCTAGTAATTT
TGTTGCTAACACGCCTAAGAAGGAGATTATGCCTAAGACTCAAGCTAAAGAATCAAAAGCTAAAGAATCA
AATACGGCTCGTGTTTTTAGTGAGGTTGAAGAAAATCCTAAAAATATAGTTCGTAAAGAAAAATTGTTAG
CTATTGAGAGTGGTGTAGATTATACAATCACAACACTCGGTAAATATGCTGACGTATTCTTTATGGCTGG
TGATAAAATTCTTAGGTTTCTCCTTGAAGTCTTTAAATATTTATTGGTTGTTTTTATGTGTCTTAGAAAA
TCTAAGATGCCTAAAGTTAAAGTAAAACCACCACACGTATTTAGAAACTTGGGTGCTAAAGTTAGAACAT
TGAATTATGTAAGACAATTGAACAAACCAGCCCTGTGGCGTTACATAAAACTAGTACTACTTTTAATAGC
ATTATATCATTTTTTCTATTTGTTTGTCAGCATACCAGTAGTGCACAAATTGGCATGTAGTGGTAGTGTT
CAAGCATATAGTAATTCTAGTTTTGTAAAGTCGGAAGTTTGTGGTAATTCTATTTTGTGCAAGGCGTGTC
TGGCATCTTATGATGAATTGGCAGATTTTGATCATCTCCAGGTGTCATGGGATTACAAGTCAGACCCACT
ATGGAATAGAGTTATACAATTGTCGTATTTTATATTCTTGGCTGTTTTTGGTAACAATTATGTTAGATGT
CTTCTTATGTATTTTGTCTCCCAGTACCTTAACCTGTGGTTATCTTATTTTGGTTATGTTAAGTATAGCT
GGTTTTTGCATGTTGTCAACTTTGAATCAATTTCTGTTGAATTTGTAATCATAGTTGTGGTTTTTAAGGC
AGTTCTCGCACTTAAACACATTTTCCTACCATGCAACAACCCGTCATGTAAGACATGTTCTAAAATTGCT
AGGCAGACGCGCATTCCTATACAGGTTGTGGTTAACGGTTCAATGAAGACTGTGTATGTCCATGCTAATG
GTACTGGTAAACTCTGCAAAAAGCATAACTTTTATTGTAAGAATTGTGACTCTTATGGGTTTGATCACAC
ATTTATTTGTGATGAGATTGTGCGTGATCTAAGTAACAGCATTAAGCAAACTGTTTATGCTACTGATAGG
TCATACCAGGAAGTCACAAAAGTTGAATGTACCGACGGGTTTTATAGGTTCTATGTTGGTGAAGAATTCA
CGGCATATGACTATGATGTAAAACATAAGAAGTATAGTAGTCAGGAGGTGCTTAAGACAATGTTCCTGCT
TGATGACTTCATTGTTTACAACCCATCAGGGTCTTCTCTTGCTAGTGTTAGAAACGTCTGTGTTTACTTC
TCACAATTAATTGGTAGGCCTATTAAGATCGTTAATAGTGAGTTGCTTGAGGATTTATCTGTAGACTTTA
AGGGAGCACTCTTTAATGCCAAAAAGAATGTTATTAAAAACTCTTTTAATGTGGATGTTTCAGAATGTAA
GAATCTTGAAGAGTGTTACAAGTTGTGTAACCTCGACGTGACATTCTCCACTTTTGAAATGGCAATTAAT
AATGCTCACAGATTTGGTATATTAATTACAGACCGATCTTTTAACAATTTTTGGCCATCGAAGATTAAGC
CTGGTTCTTCTGGTGTTTCTGCTATGGATATCGGTAAGTGCATGACTTTTGATGCTAAGATTGTTAATGC
AAAGGTTTTAACACAACGTGGTAAAAGTGTTGTATGGCTCAGTCAGGATTTCTCCACTCTTAGTTCTACA
GCACAAAAGGTTTTAGTTAAAACGTTTGTGGAGGAGGGTGTAAATTTTTCACTCACATTTAATGCTGTTG
GTTCAGATGAAGATCTGCCGTATGAGCGGTTCACTGAATCTGTTTCGGCAAAGAGCGGTTCAGGTTTCTT
TGATGTACTTAAACAGCTTAAACAACTCTTCTGGTGTCTTGTTTTGTTCATTACCCTTTATGGTTTATGC
TCAGTCTACAGTGTTGCAACTCAGTCTTATATTGATTCTGCTGAGGGTTATGATTACATGGTTATTAAGA
ACGGTGTTGTTCAATCATTTGATGATTCTATTAACTGTGTACATAATACATACAAAGGCTTTGCAGTGTG
GTTTAAAGCTAAACATGGTTTTGTACCTACATTTGACAAGTCCTGCCCTATTGTTTTAGGAACTGTTTTT
GATTTAGGTAATATGAGACCAATCCCTGATGTGCCTGCGTATGTAGCACTTGTTGGTAGATCCTTAGTGT
TCGCAATCAATGCTGCATTTGGCGTTACTAATGTGTGCTATGATCATACTGGTGCCGCTGTAAGTAAGAA
TTCTTACTTTGACACTTGTGTCTTCAATTCTGCGTGCACTACTCTAACTGGCATTGGTGGTACAGTCGTT
TATTGTGCTAAGCAAGGACTTGTTGAGGGTGCTAAGCTTTACAGTGAATTGCTGCCTGATTATTATTATG
AGCATGCTAGTGGTAACATGGTAAAAATACCAGCCATTATTAGGAGTTTTGGTCTACGGTTTGTAAAAAC
ACAGGCTACAACTTATTGCAGAGTGGGAGAGTGTACTGAAAGTCAAGCTGGTTTTTGCTTCGGTGGCGAC
AACTGGTTTGTCTATGATAAAGAGTTTGGAGATGGTTACATTTGTGGAAGTTCCACATTGGGATTCTTCA
AAAATGTGTTCGCACTCTTTAATTCTAATATGTCTGTAGTAGCTACATCTGGTGCAATGTTGGCTAACAT
TGTTATTGCATGCTTAGCTATTGCAGTCTGTTATGGTGTTCTTAAGTTTAAAAAGATCTTTGGTGATTGC
ACTCTCTTAGTAGTTATGATTATTGTTACATTGGTTGTTAATAATGTTTCATACTTTGTAACCCAAAACA
CATTCTTTATGATTGTTTATGCTATCATCTATTATTTCACAACAAGAAAACTTGCATACCCAGGTGTTTT
AGATGCGGGGTTCATTATCGCATACTTGAATATGGCCCCATGGTATGTTCTTGTTTTGTATATAATGGTG
TTCCTTTATGATTCCCTACCATCACTATTCAAACTTAAAGTAACAACAAACCTCTTTGAAGGTGATAAAT
TTGTAGGTAGTTTCGAATCAGCAGCTATGGGTACTTTTGTTATAGATATGCGTTCATATGAAACACTTGT
TAATTCTACATCTCTAGATAGAATTAAGTCATATGCTAACAGCTTTAACAAGTATAAGTACTATACTGGT
TCGATGGGAGAGGCTGATTACCGCATGGCTTGCTACGCTCATTTGGGTAAGGCGTTAATGGATTATTCTG
TTTCAAGAAATGATATGCTTTATACGCCACCAACGGTCAGTGTCAATTCAACACTGCAGTCCGGATTGAG
AAAAATGGCACAGCCTAGTGGTGTTGTGGAACCCTGTATTGTAAGGGTGGCTTATGGCAATAATGTTCTT
AATGGTTTGTGGCTTGGAGATGAAGTCATCTGCCCTAGACACGTCATTGCTAGTGATACATCGCGAGTGA
TCAATTATGAGAATGAGTTGTCTAGTGTGCGTTTACATAACTTTTCTATAGCCAAAAATAATGCGTTTTT
GGGTGTTGTGTCTGCCAAATATAAGGGTGTAAATCTTGTGCTTAAAGTGAATCAGGTAAACCCTAACACA
CCAGAACATAAATTTAAATCCGTGAGGCCAGGTGAGAGTTTTAACATTCTTGCTTGTTATGAAGGCTGTC
CCGGTAGTGTCTACGGTGTTAACATGAGAAGTCAGGGTACTATCAAAGGTTCATTTATTGCTGGTACCTG
TGGGTCAGTAGGTTATGTATTAGAAAATGGAACGCTCTATTTCGTGTACATGCACCACTTGGAATTAGGT
AATGGTTCTCATGTTGGTTCAAATCTTGAAGGGGAAATGTATGGCGGTTATGAAGATCAGCCTAGCATGC
AATTGGAGGGTACTAATGTCATGTCATCAGATAATGTAGTTGCATTTTTGTATGCTGCTCTTATTAATGG
TGAGAGATGGTTTGTTACAAACACATCAATGACGTTAGAATCTTACAATGCATGGGCCAAAACCAATAGT
TTTACGGAAATTGTGTCAACTGATGCTTTTAATATGTTGGCTGCAAAAACTGGTTATAGTGTTGAAAAGT
TGCTTGAGTGTATTGTTAGACTCAATAAAGGTTTTGGAGGACGTACTATACTGTCTTATGGCTCTCTGTG
TGACGAATTCACGCCTACTGAAGTCATAAGGCAAATGTATGGTGTTAATCTTCAGAGTGGTAAAGTGAAA
TCGATATTTTACCCTATGATGACTGCCATTGCCATTCTTTTTGCATTCTGGTTAGAATTCTTCATGTATA
CACCCTTCACATGGATTAACCCGACATTTGTTAGTGTTGTTCTAGCTATTACAACACTTGTATCTGTGTT
GTTAGTTGCTGGAATTAAACACAAAATGTTGTTCTTTATGTCTTTTGTGATGCCTAGTGTTATTTTAGCT
ACTGCACATAATGTGGTCTGGGATATGACCTATTATGAAAGTTTACAGGTGCTTGTGGAAAACGTTAATA
CCACTTTCTTACCAGTCGATATGCAGGGTGTCATGCTTGCACTGTTCTGTGTTGTTGTGTTTGTTATATG
CACTATAAGATTTTTTACATGCAAGCAGTCGTGGTTTTCACTGTTTGCAACAACTATTTTTGTGATGTTT
AACATTGTCAAGTTACTAGGTATGATAGGTGAGCCATGGACTGATGACCACTTTTTGTTGTGTCTTGTAA
ACATGCTTACTATGTTGATAAGTCTTACTACAAAGGATTGGTTTGTTGTCTTTGCATCATACAAAGTTGC
TTATTACATAGTTGTGTATGTAATGCAGCCAGCTTTTGTTCAAGATTTTGGCTTTGTTAAGTGCGTAAGC
ATAATTTACATGGCTTGCGGTTATCTATTCTGTTGTTATTACGGTATCCTTTACTGGGTTAACAGGTTTA
CATGCATGACGTGTGGTGTTTACCAATTTACGGTTTCACCGGCCGAGCTCAAATACATGACTGCTAATAA
TTTGTCTGCACCTAAGACTGCATATGATGCTATGATTCTTAGTTTTAAGTTGATGGGCATTGGTGGAGGA
CGTAATATCAAAATATCCACTGTGCAGTCTAAACTTACAGAGATGAAGTGTACAAATGTTGTCTTGCTCG
GTCTTTTGTCTAAAATGCATGTTGAATCTAATTCAAAAGAGTGGAATTATTGTGTTGGTTTGCATAATGA
AATCAATTTGTGTGACGACCCTGACGCCGTCCTCGAAAAATTACTTGCGCTCATTGCATTCTTTTTGTCC
AAGCATAACACATGTGATCTTAGTGATCTTATTGAGTCCTATTTTGAGAACACCACTATTTTACAGAGTG
TAGCATCTGCTTATGCTGCTTTGCCTAGCTGGATTGCCTATGAAAAAGCTCGTGCCGATCTAGAAGAGGC
TAAGAAGAATGATGTTAGCCCTCAACTTTTGAAACAGCTTACAAAGGCTTGTAATATCGCTAAGAGCGAA
TTTGAGCGAGAAGCTTCCGTGCAAAAGAAGCTTGACAAAATGGCAGAGCAGGCTGCAGCTAGCATGTACA
AAGAGGCACGCGCCGTGGACAGGAAGTCAAAAATAGTTTCAGCTATGCATAGTTTACTCTTTGGTATGCT
CAAGAAACTCGACATGTCCAGTGTTAATACCATTATTGAACAGGCTCGTAATGGCGTGTTACCATTGAGC
ATTATACCAGCTGCCTCAGCTACAAGACTTATTGTTGTAACACCTAATCTTGAAGTGCTTTCCAAGGTTA
GGCAAGAAAACAATGTACACTATGCAGGTGCCATTTGGTCAATTGTTGAGGTTAAGGATGCTAATGGCGC
TCAAGTCCACTTGAAAGAAGTTACAGCTGCCAATGAATTAAACATAACCTGGCCCTTGAGTATAACTTGT
GAGAGAACCACAAAGTTGCAGAATAATGAAATCTTGCCAGGTAAACTTAAAGAGAAAGCTGTTAAAGCAT
CTGCTACAATTGATGGCGATGCTTATGGTAGCGGTAAAGCGCTTATGGCTTCTGAAGGTGGTAAGAGCTT
TATATATGCATTTATAGCATCAGACAGCAACCTTAAGTATGTTAAATGGGAGAGCAACAATGATGTAATA
CCTATTGAACTTGAGGCTCCATTGCGCTTTTATGTAGATGGTGTTAATGGTCCTGAGGTTAAATATTTGT
ATTTTGTGAAAAGCTTGAACACTCTTAGACGTGGTGCTGTTCTTGGTTATATCGGTGCAACGGTTCGTCT
GCAAGCTGGTAAACCTACTGAACACCCATCTAATAGTGGTTTGCTGACATTGTGTGCTTTTGCACCTGAC
CCTGCTAAAGCATATGTTGACGCTGTTAAACGAGGTATGCAGCCAGTTACCAACTGTGTAAAAATGCTCT
CAAATGGTGCCGGTAATGGTATGGCTATCACAAATGGCGTCGAATCTAACACACAACAGGACTCTTATGG
TGGCGCATCTGTATGTATTTATTGTAGATGTCATGTAGAACATCCTGCAATTGATGGATTGTGCCGCTTT
AAAGGTAAATTCGTCCAAGTACCAACCGGGACTCAGGATCCTATTAGATTCTGTATTGAAAATGAAGTTT
GCGTCGTTTGCGGTTGCTGGCTTACTAATGGTTGTATGTGTGATCGTACTTCTATACAAGGCACCACTAT
TGATCAGAGTTATTTAAACGAGTGCGGGGTTCTAGTGCAGCTCGACTAGAACCCTGTAATGGTACTGATC
CAGACCATGTTAGTAGAGCTTTTGACATCTACAATAAAGATGTTGCATGTATTGGTAAATTCCTTAAGAC
CAATTGTTCCCGTTTTAGGAATTTAGACAAACATGATGCCTACTACGTAGTCAAGCGTTGTACTAAGAGC
GTTATGGACCATGAGCAAGTCTGTTATAACGATCTTAAAGATTCAGGTGTAGTTGCTGAACATGACTTCT
TTTTGTATAAGGAAGGTCGATGTGAATTCGGTAATGTTGCACGTAAGGATCTTACAAAGTACACAATGAT
GGATCTGTGTTATGCTATTAGGAACTTTGATGAAAAGAACTGTGAAGTTCTTAAAGAAATACTTGTGACA
TTAGGTGCCTGCAATGAATCTTTCTTTGAAAATAAGGATTGGTTTGACCCAGTAGAAAATGAAGCTATAC
ATGAAGTATACGCAAGACTTGGACCTATAGTAGCCAACGCTATGCTTAAATGTGTAGCGTTTTGTGATGC
TATTGTGGAAAAAGGTTACATAGGTATTATAACTCTTGATAACCAAGATCTTAATGGCAATTTTTACGAT
TTCGGTGATTTTGTAAAAACAACGCCAGGTTTTGGATGTGCTTGCGTTACATCATATTATTCTTATATGA
TGCCCTTAATGGGAATGACTTCATGTTTAGAGTCTGAAAATTTTGTGAAAAGTGATATCTATGGTGCTGA
TTATAAGCAGTACGATTTACTAGCTTATGATTTCACGGACCACAAGGAAAAACTTTTCCATAAATATTTT
AAGCACTGGGATCGAACATACCACCCTAATTGCTCTGATTGTACAAGTGATGAGTGCATTATTCATTGTG
CTAATTTTAACACGTTATTTTCAATGACCATACCTAGTACCGCTTTCGGACCACTTGTCCGTAAAGTTCA
CATTGATGGTGTACCAGTAGTTGTTACTGCAGGTTACCATTTCAAACAACTTGGTATAGTATGGAATCTT
GATGTAAAATTAGACACAATGAAGTTGAGCATGACTGATCTTCTTAGATTTGTCACAGATCCAACACTTC
TTGTAGCATCAAGCCCTGCACTTTTAGATCAGCGTACTGTCTGTTTCTCCATTGCAGCTTTGAGTACTGG
TGTTACATATCAGACAGTAAAACCAGGTCACTTTAACAAAGATTTCTACGATTTCATAACAGAGCGTGGA
TTCTTTGAAGAGGGATCTGAGTTAACATTAAAACATTTCTTCTTTGCACAGGGCGGTGAGGCTGCTATGA
CAGACTTCAATTATTACCGCTACAACAGAGTCACAGTACTTGATATTTGCCAAGCTCAATTTGTTTACAA
AATAGTTGGCAAATATTTTGAATGTTACGACGGTGGGTGCATTAATGCTCGTGAAGTTGTTGTTACAAAC
TATGACAAGAGTGCTGGTTATCCTTTGAACAAATTTGGTAAAGCTAGACTTTACTACGAAACTCTTTCAT
ATGAAGAGCAGGATGCACTTTTTGCTTTAACAAAGAGAAATGTTCTACCCACAATGACTCAAATGAATTT
GAAATATGCTATTTCTGGTAAGGCAAGAGCTCGTACAGTAGGAGGAGTTTCACTTCTTTCTACCATGACT
ACGAGACAATACCATCAGAAGCATTTGAAGTCAATTGCTGCAACACGCAATGCCACTGTTGTCATTGGTT
CAACCAAGTTTTATGGTGGTTGGGACAACATGCTTAAAAATTTGATGCGTGATGTTGATAACGGTTGTTT
GATGGGGTGGGACTATCCTAAGTGTGACCGTGCTTTACCTAATATGATTAGAATGGCTTCTGCCATGATA
TTGGGTTCTAAGCATGTTGGTTGTTGTACACATAGTGATAGATTCTACCGCCTCTCCAACGAGTTAGCTC
AAGTACTCACAGAAGTTGTGCATTGCACAGGCGGTTTTTACTTTAAACCTGGTGGTACAACTAGTGGTGA
TGGTACTACAGCTTACGCTAACTCTGCTTTTAACATCTTTCAAGCTGTTTCTGCTAATGTTAATAAGCTT
TTGGGCGTTGATTCAAACGCTTGTAACAATGTTACAGTAAAGTCCATACAACGTAAAATCTACGATAATT
GTTATCGTAGTAGCAGCATTGATGAAGAATTTGTTGTTGAGTACTTTAGTTATTTGAGAAAACACTTTTC
TATGATGATTTTATCTGATGATGGAGTTGTGTGCTACAACAAAGATTATGCAGATCTAGGTTATGTAGCT
GACATTAATGCTTTTAAAGCAACGCTCTATTATCAGAATAATGTCTTCATGTCCACTTCTAAGTGTTGGG
TAGAACCAGATCTTAGCGTTGGACCACATGAATTTTGTTCACAACACACATTGCAGATTGTAGGACCTGA
TGGAGACTACTATCTTCCCTACCCAGACCCGTCTAGAATTTTGTCAGCTGGTGTGTTTGTTGATGACATA
GTTAAAACAGACAATGTTATTATGTTAGAACGTTACGTATCATTGGCTATTGATGCATATCCGCTCACAA
AACACCCTAAGCCTGCTTATCAAAAAGTATTTTACACTCTGCTAGATTGGGTTAAACATCTACAGAAAAA
TTTGAATGCAGGCGTTCTTGATTCGTTTTCAGTGACAATGCTAGAAGAAGGTCAAGATAAGTTCTGGAGT
GAAGAGTTTTATGCTAGCCTCTATGAAAAATCCACTGTTTTGCAAGCTGCAGGTATGTGTGTTGTGTGTG
GTTCACAAACTGTACTTCGTTGTGGAGACTGTCTTAGGAGACCACTTTTATGTACGAAATGTGCTTATGA
CCATGTTATGGGAACAAAGCACAAGTTCATTATGTCTATCACACCATATGTGTGTAGTTTTAATGGTTGT
AATGTCAATGATGTTACAAAGTTGTTTTTAGGTGGTCTTAGTTATTATTGTATGGACCACAAACCACAGT
TGTCATTCCCACTCTGTGCTAATGGCAACGTTTTTGGTTTGTACAAAAGTAGTGCAGTCGGTTCAGAGGA
TGTTGAAGACTTCAACAAACTTGCAGTTTCTGACTGGACTAATGTAGAAGACTACAAACTTGCTAACAAT
GTCAAAGAATCTCTGAAAATTTTCGCTGCTGAAACTGTGAAAGCTAAGGAGGAGTCTGTTAAATCTGAAT
ATGCTTATGCCATATTAAAGGAGGTTATCGGCCCTAAGGAAATTGTACTCCAATGGGAAGCTTCTAAGAC
TAAGCCTCCACTTAACAGAAATTCAGTTTTCACTTGTTTTCAGATAAGTAAGGATACTAAAATTCAATTA
GGTGAATTTGTGTTTGAGCAATCTGAGTACGGTAGTGACTCCGTTTATTACAAGAGCACGAGTACTTACA
AACTTACACCAGGTATGATTTTTGTGTTGACTTCTCATAATGTGAGTCCTCTTAAAGCCACAATTCTAGT
CAACCAAGAAAAGTACAATACCATATCTAAGCTCTATCCTGTTTTTAACATAGCGGAAGCCTATAATACA
CTGGTGCCTTACTATCAAATGATAGGTAAGCAAAAATTTACAACTATCCAAGGTCCTCCTGGTAGCGGTA
AGTCTCATTGTGTTATAGGTTTGGGTTTGTATTATCCTCAGGCAAGAATAGTCTACACTGCATGTTCTCA
CGCGGCTGTAGACGCTCTATGTGAAAAAGCAGCCAAGAACTTCAATGTTGATAGATGTTCAAGGATAATA
CCTCAAAGAATCAGAGTTGATTGTTACACAGGTTTTAAGCCTAATAACACTAATGCGCAGTACTTGTTTT
GTACTGTCAATGCTCTACCAGAAGCAAGTTGTGACATTGTTGTAGTCGATGAGGTCTCTATGTGTACTAA
TTATGATCTTAGTGTCATAAATAGCAGACTGAGTTATAAACATATTGTTTATGTTGGCGACCCACAACAA
TTACCTGCTCCTAGAACTCTGATTAACAAAGGTGTACTTCAACCACAGGATTACAATGTTGTAACCCAAA
GAGTGTGCACACTAGGACCTGATGTCTTCTTGCATAAATGTTACAGATGCCCAGCTGAAATTGTTAAGAC
AGTCTCTGCACTTGTTTATGAAAACAAATTTGTACCTGTCAACCCAGAATCAAAGCAGTGCTTCAAAATG
TTTGTAAAAGGTCAGGTTCAGATTGAGTCCAACTCTTCTATAAACAACAAGCAACTAGAGGTTGTCAAGG
CGTTTTTAGCACACAATCCAAAATGGCGTAAAGCTGTTTTCATCTCACCCTATAATAGCCAAAATTATGT
TGCTCGGCGTCTTCTTGGTTTGCAAACGCAGACTGTGGACTCCGCGCAGGGTAGTGAGTATGATTATGTT
ATCTACACACAGACTTCCGATACACAGCATGCTACTAATGTTAACAGATTCAATGTTGCCATTACGAGAG
CAAAGGTTGGTATACTTTGTATCATGTGTGATAGAACTATGTATGAGAATCTTGATTTCTATGAACTCAA
AGACTCAAAGATTGGTTTACAGGCAAAACCTGAAACTTGTGGTTTGTTTAAAGATTGTTCAAAGAGCGAA
CAATACATACCACCTGCTTATGCAACAACATATATGAGTTTGTCCGATAATTTTAAGACAAGTGATGGTT
TAGCTGTTAACATCGGTACAAAGGATGTTAAATATGCTAATGTCATCTCATATATGGGATTCAGGTTTGA
AGCCAACATACCAGGCTACCACACATTGTTTTGCACTCGAGACTTTGCTATGCGTAATGTTAGAGCATGG
CTTGGTTTTGACGTTGAAGGTGCACATGTCTGTGGTGATAATGTTGGAACTAATGTACCTTTACAGCTGG
GTTTCTCAAATGGTGTGGATTTTGTAGTACAAACTGAAGGATGCGTTGTTACTGAAAAAGGTAATAGCAT
TGAAGTTGTAAAAGCACGAGCACCACCAGGTGAGCAATTTGCACACTTGATTCCACTTATGAGAAAGGGT
CAACCTTGGCACATTGTCAGACGCCGTATAGTGCAGATGGTCTGTGACTATTTTGACGGCTTGTCAGATA
TTCTGATTTTTGTGCTTTGGGCTGGTGGTCTTGAACTTACAACTATGAGATACTTTGTTAAAATTGGAAG
ACCACAAAAATGTGAATGCGGTAAAAGTGCAACTTGTTATAGTAGCTCTCAATGTGTCTATGCTTGTTTC
AAGCATGCATTAGGATGTGATTATTTATATAACCCTTACTGTATTGACATACAGCAATGGGGCTACACGG
GATCTTTGAGCATGAATCATCATGAAGTTTGTAACATTCATAGAAATGAGCATGTAGCTAGTGGTGATGC
TATCATGACTAGATGTCTTGCTATACATGATTGTTTTGTCAAACGTGTTGACTGGTCAATTGTGTACCCT
TTTATTGACAACGAAGAAAAGATCAATAAAGCTGGTCGCATAGTTCAGTCACATGTCATGAAAGCTGCTT
TGAAGATTTTTAATCCTGCTGCAATTCATGATGTGGGTAATCCCAAAGGCATCCGTTGTGCTACAACACC
AATACCATGGTTTTGTTATGATCGTGATCCTATTAATAACAATGTTAGATGTCTGGAGTATGACTATATG
GTACATGGTCAAATGAATGGTCTTATGTTATTTTGGAACTGCAATGTAGACATGTACCCAGAGTTTTCAA
TTGTTTGTAGATTTGATACTCGCACTCGCTCTAAACTGTCTTTAGAAGGTTGTAATGGTGGTGCATTGTA
TGTAAATAACCATGCTTTCCACACACCAGCTTATGATAGAAGAGCTTTTGCTAAGCTTAAACCTATGCCA
TTCTTTTACTATGATGATAGTAATTGTGAACTTGTTGATGGACAACCTAATTATGTACCACTTAAATCAA
ATGTTTGCATAACAAAGTGCAACATTGGTGGTGCTGTCTGCAAGAAGCATGCTGCTCTTTACAGAGCGTA
TGTTGAGGATTATAACATGTTTATGCAGGCTGGCTTTACGATATGGTGTCCTCAAAATTTTGACACTTAC
ATGCTTTGGCACGGTTTTGTTAATAGCAAAGCACTCCAGAGTCTAGAAAATGTGGCTTTTAACGTTGTTA
AGAAAGGTGCCTTCACTGGTTTAAAAGGTGACTTACCAACTGCTGTTATTGCTGACAAAATAATGGTAAG
AGATGGACCTACTGACAAATGTATCTTTACAAATAAGACTAGTTTACCTACAAATGTAGCTTTCGAGCTA
TATGCAAAACGCAAACTTGGACTCACACCTCCATTAACAATACTTAGAAATCTAGGTGTTGTCGCAACAT
ACAAATTTGTGTTGTGGGACTATGAAGCTGAATGCCCCTTCTCAAATTTCACTAAGCAAGTGTGTTCTTA
CACTGATCTTGATAGTGAAGTTGTAACATGTTTTGATAATAGTATTGCTGGTTCTTTTGAACGCTTTACT
ACTACAAAAGATGCAGTGCTTATTTCTAATAACGCTGTGAAAGGGCTTAGTGCCATTAAATTACAATATG
GCTTTTTGAATGATCTACCTGTAAGTACTGTTGGAAACAAACCTGTCACATGGTATATCTATGTGCGCAA
GAACGGTGAGTACGTCGAACAAATTGATAGTTACTACACACATGGACGTACTTTTGAAACCTTTAAACCT
CGTAGTACAATGGAAGAAGATTTTCTTAGTATGGATACTACACTCTTCATCCAAAAGTATGGCCTTGAGG
ATTATGGTTTTGAACACGTTGTATTTGGAGATGTCTCCAAAACTACCATTGGTGGTATGCATCTTCTTAT
ATCGCAAGTGCGCCTTGCAAAAATGGGTTTGTTTTCTGTTCAAGAATTTATGACTAATTCTGACAGTACA
CTGAAAAGTTGTTGTATTACATATGCTGATGATCCATCTTCTAAGAATGTGTGCACTTATATGGACATAC
TCTTGGACGATTTTGTGACTATCATTAAGAGCTTAGATCTTAATGTTGTGTCCAAAGTTGTGGATGTTAT
TGTAGATTGTAAGGCATGGAGATGGATGCTGTGGTGTGAGAATTCACAGATTAAAACCTTCTATCCACAA
CTCCAATCTGCTGAATGGAACCCTGGCTATAGCATGCCTACATTGTACAAAATCCAGCGTATGTGTCTCG
AACGGTGTAATCTCTACAATTATGGTGCACAAGTGAGATTACCTGATGGCATTACTACTAATGTTGTTAA
GTATACTCAATTGTGTCAATACCTTAACACTACTACTGTGTGTGTACCACACAAAATGCGAGTTCTGCAT
TTAGGAGCTGCTGGTGCATCTGGTGTTGCTCCTGGTAGTACTGTGTTACGAAGGTGGTTACCAGACGATG
CCATATTGGTTGATAACGATTTGAGAGATTACGTTTCCGACGCAGACTTCAGTGTTACAGGTGATTGTAC
TAGTCTTTACATTGAAGACAAATTTGATTTGCTTATCTCTGATTTATATGATGGTTCCACAAAATCAATT
GACGGTGAAAACACGTCGAAAGATGGTTTCTTTACTTATATTAATGGTTTCATTAAAGAGAAACTATCAC
TTGGTGGATCTGCTGCCATCAAAATCACAGAATTTAGTTGGAATAAAGATTTATATGAATTGATTCAAAG
ATTTGAGTATTGGACTGTGTTTTGTACAAGTGTTAATACGTCATCATCAGAAGGTTTTCTGATTGGTATT
AACTACTTAGGACCATACTGTGACAAAGCAATAGTAGATGGAAATATAATGCATGCCAATTATATATTTT
GGAGAAACTCTACAATTATGGCTCTATCACATAACTCAGTCCTAGACACTCCAAAATTTAAGTGCCGTTG
TAACAATGCACTTATTGTTAATTTAAAAGAAAAAGAATTGAATGAAATGGTCGTTGGATTACTAAGGAAG
GGTAAGTTACTCATTAGAAATAATGGCAAGCTACTAAACTTTGGTAATCATTTAGTTAATGTGCCATGAT
TGTGCTCGTAACTTGCCTCTTGTTGTTATGTTCATACCACACAGTTTTGAGTACAACAAATAATGAATGC
ATACAAGTTAACGTAACACAATTGGCTGGCAATGAAAACCTTATCAGAGATTTTCTGTTTAGTAACTTTA
AAGAAGAAGGAAGTGTAGTTGTTGGTGGTTATTACCCTACAGAGGTGTGGTACAACTGCTCTAGAACAGC
TCGAACTACTGCCTTTCAGTATTTTAATAATATACATGCCTTTTATTTTGTTATGGAAGCCATGGAAAAT
AGCACTGGTAATGCACGTGGTAAACCATTATTATTTCATGTGCATGGTGAGCCTGTTAGTGTTATTATAT
CGGCTTATAGGGATGATGTGCAACAAAGGCCCCTTTTAAAACATGGGTTAGTGTGCATAACTAAAAATCG
CCATATTAACTATGAACAATTCACCTCCAACCAGTGGAATTCCACATGTACGGGTGCTGACAGAAAAATT
CCTTTCTCTGTCATACCCACGGACAATGGAACAAAAATCTATGGTCTTGAGTGGAATGATGACTTTGTTA
CAGCTTATATTAGTGGTCGTTCTTATCACTTGAACATCAATACTAATTGGTTTAACAATGTCACACTTTT
GTATTCACGCTCAAGCACTGCTACCTGGGAATACAGTGCTGCATATGCTTACCAAGGTGTTTCTAACTTC
ACTTATTACAAGTTAAATAACACCAATGGTCTAAAAACCTATGAATTATGTGAAGATTATGAACATTGCA
CTGGCTATGCTACCAATGTATTTGCTCCGACATCAGGTGGTTACATACCTGATGGATTTAGTTTTAACAA
TTGGTTCTTGCTTACAAATAGTTCCACTTTTGTTAGTGGCAGGTTTGTAACAAATCAACCATTATTGATT
AATTGCTTGTGGCCAGTGCCCAGTTTTGGTGTAGCAGCACAAGAATTTTGTTTTGAAGGTGCACAGTTTA
GCCAATGTAATGGTGTGTCTTTAAATAACACAGTGGATGTTATTAGATTCAACCTTAATTTCACTGCAGA
TGTACAATCTGGTATGGGTGCTACAGTATTTTCACTGAATACAACAGGTGGTGTCATTCTTGAAATTTCA
TGTTATAGTGACACAGTGAGTGAGTCTAGTTCTTACAGTTATGGTGAAATCCCGTTCGGCATAACTGACG
GACCACGATACTGTTATGTACTTTACAATGGCACAGCTCTTAAATATTTAGGAACATTACCACCCAGTGT
AAAGGAAATTGCTATTAGTAAGTGGGGCCATTTTTATATTAATGGTTACAATTTCTTTAGCACATTTCCT
ATTGGTTGTATATCTTTTAATTTAACCACTGGTGTTAGTGGAGCTTTTTGGACAATTGCTTACACATCGT
ATACTGAAGCATTAGTACAAGTTGAAAACACAGCTATTAAAAATGTGACGTATTGTAACAGTCACATTAA
TAACATTAAATGTTCTCAACTTACTGCTAATTTGAATAATGGATTTTATCCTGTTGCTTCAAGTGAAGTA
GGTTTCGTTAATAAGAGTGTTGTGTTATTACCTAGCTTTTTCACATACACCGCTGTCAATATAACCATTG
ATCTTGGTATGAAGCTTAGTGGTTATGGTCAACCCATAGCCTCGACACTAAGTAACATCACACTACCAAT
GCAGGATAACAATACTGATGTGTACTGTATTCGTTCTAACCAATTCTCAGTTTATGTTCATTCCACTTGC
AAAAGTTCTTTATGGGACAATATTTTTAATCAAGACTGCACGGATGTTTTAGAGGCTACAGCTGTTATAA
AAACTGGTACTTGTCCTTTCTCATTTGATAAATTGAACAATTACTTGACTTTTAACAAGTTCTGTTTGTC
GTTGAGTCCTGTTGGTGCTAATTGCAAGTTTGATGTTGCTGCACGTACAAGAACCAATGAGCAGGTTGTT
AGAAGTCTATATGTAATATATGAAGAAGGAGACAACATAGTGGGTGTACCGTCTGATAATAGCGGTCTGC
ACGATTTGTCTGTGCTACACCTAGACTCCTGTACAGATTACAATATATATGGTAGAACTGGTGTTGGTAT
TATTAGACGAACTAACAGTACGCTACTTAGTGGCTTATATTACACATCACTATCAGGTGATTTGTTAGGC
TTTAAAAATGTTAGTGATGGTGTCATTTATTCTGTGACGCCATGTGATGTAAGCGCACAAGCGGCTGTTA
TTGATGGTGCCATAGTTGGAGCTATGACTTCCATTAACAGTGAACTGTTAGGTCTAACACATTGGACAAC
GACACCTAATTTTTATTACTACTCTATATATAATTACACAAGTGAGAGGACTCGTGGCACTGCAATTGAC
AGTAACGATGTTGATTGTGAACCTGTCATAACCTATTCTAATATAGGTGTTTGTAAAAATGGTGCTTTGG
TTTTTATTAACGTCACACATTCTGACGGAGACGTGCAACCAATTAGCACTGGTAATGTCACGATACCTAC
AAATTTTACTATATCTGTGCAAGTTGAATACATGCAGGTTTACACTACACCAGTATCAATAGATTGTGCA
AGATACGTTTGTAATGGTAACCCTAGATGTAACAAATTGTTAACACAATATGTGTCTGCATGTCAAACTA
TTGAACAAGCACTTGCAATGGGTGCCAGACTTGAAAACATGGAGGTTGATTCCATGTTGTTTGTCTCGGA
AAATGCCCTTAAATTGGCATCTGTTGAGGCGTTCAATAGTACAGAAAATTTAGATCCTATTTACAAAGAA
TGGCCTAGCATAGGTGGTTCTTGGCTAGGAGGTCTAAAAGATATACTACCGTCCCATAATAGCAAACGTA
AGTATGGTTCTGCTATAGAAGATTTGCTTTTTGATAAAGTTGTAACATCTGGTTTAGGTACAGTTGATGA
AGATTATAAACGTTGTACTGGTGGTTACGACATAGCAGACTTGGTGTGTGCTCAATATTACAATGGCATC
ATGGTTCTACCAGGTGTAGCTAATGCTGACAAGATGACTATGTACACAGCATCACTTGCAGGTGGTATAA
CATTAGGTGCACTTGGTGGTGGCGCCGTGGCTATACCTTTTGCAGTAGCAGTACAGGCTAGACTTAATTA
TGTTGCTCTACAAACTGATGTATTGAATAAAAACCAACAGATCCTGGCTAATGCTTTCAATCAAGCTATT
GGTAACATTACACAGGCTTTTGGTAAGGTTAATGATGCTATACATCAAACATCACAAGGTCTTGCCACTG
TTGCTAAAGCGTTGGCAAAAGTGCAAGATGTTGTCAACACACAAGGGCAAGCTTTAAGTCACCTTACAGT
ACAATTGCAAAATAATTTTCAAGCCATTAGTAGTTCTATTAGTGATATTTATAACAGGCTTGACGAACTG
AGTGCTGATGCACAAGTTGATAGGCTGATTACAGGTAGACTTACAGCACTTAATGCATTTGTGTCTCAGA
CTCTAACCAGACAAGCAGAGGTTAGGGCTAGTAGACAACTTGCCAAAGACAAGGTTAATGAATGTGTTAG
GTCTCAGTCTCAGAGATTCGGATTCTGTGGTAATGGTACACATTTGTTTTCACTAGCAAATGCAGCACCA
AATGGCATGATTTTCTTTCATACAGTACTATTACCAACAGCTTATGAAACTGTAACAGCTTGGTCAGGTA
TTTGTGCTTCAGATGGCGATCGCACTTTCGGACTTGTCGTTAAAGATGTGCAGTTGACGTTGTTTCGTAA
TCTAGATGACAAGTTCTATTTGACCCCCAGAACTATGTATCAGCCTAGAGTTGCAACTAGTTCTGATTTT
GTTCAAATTGAAGGGTGTGATGTGTTGTTTGTCAACGCGACTGTAATTGATTTGCCTAGTATTATACCTG
ACTATATTGACATTAATCAAACTGTTCAAGACATATTAGAAAATTACAGACCAAACTGGACTGTACCTGA
ATTTACACTTGATATTTTCAACGCAACCTATTTAAATCTGACTGGTGAAATTGATGACTTAGAGTTTAGG
TCAGAAAAGCTACATAACACTACAGTAGAACTTGCCATTCTCATTGATAACATTAATAATACATTAGTCA
ATCTTGAATGGCTCAATAGAATTGAAACTTATGTAAAATGGCCTTGGTATGTGTGGCTACTGATAGGTTT
AGTAGTAGTATTTTGCATACCATTACTGCTATTTTGCTGTTTTAGCACAGGTTGTTGTGGATGCATAGGT
TGTTTAGGAAGTTGTTGTCACTCTATATGTAGTAGAAGACAATTTGAAAATTATGAACCAATTGAAAAAG
TGCATGTCCACTAAATTTAAAGTTAAGGATGTTGAATAAATTCCTTAAGAACTAAACTTATTAGTCATTA
CAGGTCTTGTATGGACATTGTCAAATCTATTGACATATTCGTAGACGCTGTACTTGACGAACTTGACCGT
GCATACTTTGCTGTAACTCTTAAAGTAGAATTTAAGACTGGTAAACTACTTGTGTGTATAGGTTTTGGTG
ACACACTTCTTGAGGCTAAGGACAAAGCGTATGCTAAGCTTGGTCTCTCCTTTATTGAAGAAGTCAATAG
TCATACAGTTGTTTAGTATTACTGTTTACAAGTTTAAAGCCAAATTTTGGTATAAACTACCTTTTGAAAC
TAGACTTTGTATCATTAAACACACAAGACCCAAAGCATTAAGTGTTACAAAACAAGTAAAGAGAGATTAT
AGAAAAATTGCCATTCTAAATTCCATGCGAAAATGATTGGTGGACTTTTTCTTAACACTCTTAGTTTTGT
AATTGTTAGTAACCATGTTATTGTTAATAACACAGCAAATGTGCATACTACACAACATGAAAATGTTATA
GTACAACAGCATTAGGTTGTTAGTGCTAGAACACAAAATTATTACCCAGAGTTCAGCATCGCTGTACTCT
TTGTATCATTTTTGGCTTTGTACCGTAGTACAAACTTTAAGACGTGTGTCGGCATCTTAATGTTTAAGAT
TGTATCAATGACACTTGTAGGGCCTATGCTTATAGCATATGGTTACTACATTGATGGCATTGTTACAATA
ACTGTCTTAGCTTTAAGATTTTTCTACTTAGCATACTTTTGGTATGTTAATAGTAGGTCCGAATTTATTT
TATACAATACAACGACACTCATGTTTGTACATGGCAGAGCTGCACCGTTTATGAGAAGTTCTCACAGCTC
TATTTATGTCACATTGTATGGTGGCATAAATTATATGTTTGTGAATGACCTCACGTTGCATTTTGTAGAC
CCTATGCTTGTAAGAATAGCAATACGTGGCTTAGCTCATGCTGATCTAACTGTTTTTAGAGCAGTTGAAC
TTCTCAATGGTGATTTTATATATGTATTTTCACAGGAGCCCGTAGCCGGTGTTTACAATGCAGCCTCTTC
TCAGGCGGTTCTAAACGAAATTGACTTAAAAGAAGAAGAAGAAGACCATAACTATGACGTTCCCTAGGGC
ATTTACTATCATAGATGACCATGGCATGGTTGTTAGCGTCTTCTTCTGGCTCCTGTTGATAATTATATTG
ATATTGTTTTCAATAGCATTGCTAAATGTTATTAAATTGTGCATGGTATGTTGCAATTTGGGTAAGACTA
TTATAGTACTACCTGCACGCCATGCATATGATGCCTATAAGACCTTTATGCAAACCAAGGCATATAATCC
CGACGAAGCATTTTTGGTTTGAACTAAACAAAATGAAGTACATTTTGCTAATACTCGCGTGCATAATTGC
ATGCGTTTATGGTGAACGCTACTGTGCCATGCAAGACAGTGGCTTGCAGTGTATTAATGGCACAAATTCA
AGATGTCAAACCTGCTTTGAACGTGGTGATCTTATTTGGCATCTTGCTAACTGGAACTTCAGCTGGTCTG
TAATATTGATTGTTTTTATAACAGTGTTACAATATGGCAGACCACAATTTAGCTGGCTCGTTTATGGCAT
TAAAATGCTGATCATGTGGCTATTATGGCCTATTGTTCTAGCGCTTACGATTTTTAATGCATACTCTGAG
TACCAAGTTTCCAGATATGTAATGTTCGGCTTTAGTGTTGCAGGTGCAGTTGTAACGTTTGCACTTTGGA
TGATGTATTTTGTGAGATCTGTTCAGCTATATAGAAGAACCAAATCATGGTGGTCTTTTAATCCTGAGAC
TAATGCAATTCTTTGTGTTAATGCATTGGGTAGAAGTTATGTGCTTCCCTTAGATGGTACTCCTACAGGT
GTTACCCTTACTCTACTTTCAGGAAATCTATATGCTGAAGGTTTCAAAATGGCTGGTGGTTTAACCATCG
AGCATTTGCCTAAATACGTCATGATTGCTACACCTAGTAGAACCATCGTTTATACATTAGTTGGAAAACA
ATTAAAAGCAACTACTGCCACAGGATGGGCTTACTACGTAAAATCTAAAGCTGGTGATTACTCAACAGAA
GCACGTACTGACAATTTGAGTGAACATGAAAAATTATTACATATGGTGTAACTAAACTTTCAAATGGCCA
CACAGGGACAACGCGTCAACTGGGGAGATGAACCTTCCAAAAGACGTGGTCGTTCTAACTCTCGTGGTCG
GAAGAATAATGATATACCTTTGTCATTCTACAACCCCATTACCCTCGAACAAGGATCTAAATTTTGGAAT
TTATGTCCGAGAGACCTTGTTCCCAAAGGAATAGGTAATAAGGATCAACAAATTGGTTATTGGAATAGAC
AGATTCGTTATCGTATTGTAAAAGGCCAGCGTAAGGAACTCGCTGAGAGGTGGTTCTTTTACTTCTTAGG
TACAGGACCTCATGCTGATGCTAAATTCAAAGACAAGATTGATGGAGTCTTCTGGGTTGCAAGGGATGGT
GCCATGAACAAGCCCACAACGCTTGGCACTCGTGGAACCAATAACGAATCCAAACCACTGAGATTTGATG
GTAAGATACCGCCACAGTTTCAGCTTGAAGTGAACCGTTCTAGGAACAATTCAAGGTCTGGTTCTCAGTC
TAGATCTGTTTCAAGAAACAGATCTCAATCTAGAGGAAGACACCATTCCAATAACCAGAATAATAATGTT
GAGGATACAATTGTAGCCGTGCTTGAAAAATTAGGTGTTACTGACAAACAAAGGTCACGTTCTAAACCTA
GAGAACGTAGTGATTCCAAACCTAGGGACACAACACCTAAGAATGCCAACAAACACACCTGGAAGAAAAC
TGCAGGCAAGGGAGATGTGACAACTTTCTATGGTGCTAGAAGTAGTTCAGCTAACTTTGGTGATAGTGAT
CTCGTTGCCAATGGTAACGCTGCCAAATGCTACCCTCAGATAGCTGAATGTGTTCCATCAGTGTCTAGCA
TAATCTTTGGCAGTCAATGGTCTGCTGAAGAAGCTGGTGATCAAGTGAAAGTCACGCTCACTCACACCTA
CTACCTGCCAAAGGATGATGCCAAAACTAGTCAATTCCTAGAACAGATTGACGCTTACAAGCGACCTTCT
GAAGTGGCTAAGGATCAGAGGCAAAGAAGATCCCGTTCTAAGTCTGCTGATAAGAAGCCTGAGGAGTTGT
CTGTAACTCTTGTGGAGGCATACACAGATGTGTTTGATGACACACAGGTTGAGATGATTGATGAGGTTAC
GAACTAAACGCATGCTCGTTTTCGTCCATGCTGTACTTGTAACAGCTTTAATCTTACTACTAATTGGTAG
AATCCAATTACTAGAAAGGTTGTTACTCAGTCATCTGCTTAATCTTACAACAGTCAGTAATGTTTTAGGT
GTGCCTGACAGTAGTCTGCGTGTAAATTGTTTGCAGCTTTTGAAACCAGACTGCCTTGATTTTAATATCT
TACATAAAGTTTTAGCAGAAACCAGGTTACTAGTAGTAGTACTGCGAGTGATCTTTCTAGTTCTTCTAGG
GTTTTCCTGCTATACATTGTTGGGTGCATTATTTTAACATCATGATTGTTGTAATCCTTGTGTGTATCTT
TTTGGCTAATGGAATTAAAGCTACTGCTGTGCAAAATGACCTTCATGAACATCCCGTTCTTACCTGGGAT
TTATTACAGCATTTCATAGGACATACCCTCTACATTACAACACACCAGGTCTTAGCACTACCGCTTGGAT
CTCGTGTTGAGTGTGAGGGTATCGAAGGTTTCAATTGCACATGGCCTGGCTTTCAAGATCCTGCACATGA
TCATATTGATTTCTACTTTGATCTTTCTAATCCTTTCTATTCATTTGTAGATAATTTTTATATTGTAAGT
GAGGGAAATCAAAGAATCAATCTCAGATTGGTTGGTGCTGTGCCAAAACAAAAGAGATTAAATGTTGGTT
GTCATACATCATTTGCTGTTGATCTTCCATTTGGGATTCAGATATACCATGACAGGGATTTTCAACACCC
TGTTGATGGCAGACATCTAGATTGTACTCACAGAGTGTACTTTGTGAAGTACTGTCCACATAACCTGCAT
GGTTATTGCTTTAATGAGAGGCTGAAAGTTTATGACTTGAAGCAATTCAGAAGCAAGAAGGTCTTCGACA
AAATCAACCAACATCATAAAACTGAGTTATAAGGCAACCCGATGTCTAAAACTGGTCTTTCCGAGGAATT
ACGGGTCATCGCGCTGCCTACTCTTGTACAGAATGGTAAGCACGTGTAATAGGAGGTACAAGCAACCCTA
TTGCATATTAGGAAGTTTAGATTTGATTTGGCAATGCTAGATTTAGTAATTTAGAGAAGTTTAAAGATCC
GCTATGACGAGCCAACAATGGAAGAGCTAACGTCTGGATCTAGTGATTGTTTAAAATGTAAAATTGTTTG
AAAATTTTCCTTTTGATAGTGATAC

>gi|189313868|ref|NC_010800.1| Turkey coronavirus, complete genome
ACTTAAGATAGATATTAATATATATCTATCATACTAGCCTTGTGCTAGATTTCCAACTTAACAAAACGGA
CTTAAATACCTACAGCTGGTCCTCATAGGTGTTCCATTGCAGTGCACTTTAGTGCCCTGGATGGCACCTG
GCCACCTGTCAGGTTTTTGTTAGTAAAATAACATTGTTGCTGGTATCACTGCTTGTTTTGCCGTGTCTCA
TTTTATACATCCGTTGCTTGGGCTACCTAGTATCCAGCGTCCTACGGGCGTTGTGGTCGGTTCGAGTGCG
AAGGACCTCTGGTTCATCTAGCGGTAGGCGGGTGTGTGGAAGTAGCGCTTCAGACGTACCGGTTCTGTTG
CGTGAAATACGGGGTCACCTCCCCCCACATACCTCTAAGGGCTTTTGAGCCTAGCGTTGGGCTACGTTCT
CGCATAAGGTCGGCTATACGGCGTTTGTAGGGGGTAGTGCCAAACAACCCCTGAGGTGACAGGTTCTGGT
GGTGTTTAGTGAGCAGACATACAATAGACAGTGACAACATGGCTTCAAGCCTAAAACAGGGAGTATCTCC
CAAACCAAGGGATGTCATTCTTGTTTCCAAAGACATTCCCGACCAACTCTGTGACGCTTTATTCTTTTAT
ACGTCACACAACCCTAAGGATTACGCTGATGCTTTTGCAGTTAGGCATAAGTTTGACCGTAATCTTCAGA
CTGGGAAGCAGTTTAAATTTGAAACTGTGTGTGGTCTCTTCCTTTTGAAGGGAGTTGACAAAATAACACC
TGGCGTCCCAGCAAAAGTTTTAAAAGCCACTTCTAAGTTGGCAGATCTAGAAGACATCTTTGGTGTCTCT
CCCTTTGCACGGAAGTACCGTGAATTGTTGAAGACAGCATGCCAGTGGTCTCTCACTGTAGACACACTGG
ATGCTCGTGCACAAACTCTTGATGAAATTTTTGACCCCACTGAAATATTTTGGCTTCAGGTGGCCGCAAA
AGTTCAAGTTTCAGCTATGGCAATGCGCAGGCTTGTTGGAGAAGTAACTGCAAAAGTCATGGAAGCTCTT
GGCTCAAATTTGAGTGTTCTCTTTCAAATTGTTAAACAACAAATAGCCAGAATCTTTCAAAAGGCACTGG
CTATTTTCGAGAATGTGAGTGACTTACCGCAGCGTGTTGCAGCACTTAAGATGGCCTTTGCCAAGTGTGC
CAAGTCAATTACTGTTGTGGTTGTGGAAAGAACTCTAGTTGTTAGAGAGTTCGCAGGGACTTGCCTTGCA
AGCATCAATGGTGCTGTTGCAAAATTCTTTGAGGAACTTCCAAATGGCTTTATGGGTTCTAAAGTCTTCA
CAACATTGGCCTTTTTTAAGGAAGCAGCTGTGAAAATTGTGGAAAATATACCAAATGCACCAAGGGGCAC
TAAAGGGTTTGAAGTCATTGGCAATGCCAAGGGTACACAAGTTGTTGTGCGTGGCATGCGAAATGATCTA
ACGTTGCTTGACCAAAAAGCTGACGTCCCTGTGGAGTCAGAAGGTTGGTCTGCAATCCTAGAAGGACATC
TTTGCTATGTCTTTAAGAGTGGCGATCGTTTCTATGCGGCACCTCTTTCAGGAAATTTTGCATTGCATGA
TGTACATTGCTGCGAGCGTGTTGTCTGTCTTTCTGATGGTGTAACACCAGAGATAAATGATGGACTCGTT
CTAGCCGCAATCTATTCATCTTTTGGTGTCTCAGAACTTGTGGCAGCCCTTAAAAAAGGTGAACCATTTA
AGTTTTTAGGCCATAAGTTTGTGTACGTAAAGGATGAAGCAGTTTCGTTTACTTTAGCGAAGGCTGCCAC
TATTGCAGATGTTCTGAAGCTGTTTCAGTCAGCTCGTGTGCAGGTAGACGATGTTTGGTCTTCATTTACT
GAAAAGTCTTTTGAATTCTGGAGGCGCGCGTATGGAAAAGTGCGCCATCTTGAAGAACTTGTGAAGACTC
ACTTTTGTAAAGCTCAAATGTCAATTGTGGTTCTAGCAGCAGTGCTTGGAGAAGGCATTTGGCATCTTGC
CTCACAAGTCATCTACAAATTAGGTGGTCTTTTTACTAAAGTTGTTGATTTTTGTGAGAAACACTGGCAG
GGGTTTTGCGTTCAGTTGAAGAGGGCTAAGCTCGTTGTCACTGAAAATTTTTGTGTTCTAAAAGGAGTTG
CACAGCACTGTTTTCAACTATTGCTGGGTGCAATACATTCTCTGTATAAGAGTTTTAAGAAGTGTGTACT
TGGTAGAATTCATGGAGACTTGCTCTTCTGGAAAGGTGGTGTACACAAAATTGTTCAAGATGGCGATGAA
ATTTGGTTTGACGCCATTGATAGTGTTGATGTTGAAGATCTGGGTGTTGTTAAAGACAAACCTATAGATT
TTGAGGTTTGTGAAGACGTAACACTTCCAGAAAACCAACCTGGTCACATGGTTCAAATCGAAGAAGATGG
AAAGAACTATATGTTTTTCCGATTCAAAAGGGATGAGAACATCTATTATACACCAATGTCTCAACTTGGT
GCAATTAATGTAGTTTGCAAAGCAGGCGGTAAAACCGTTACCTTTGGAGGCACTACTGTGAAAGAAATAC
CGCCACCTGATGTTGTGCCTATTAAGGTTAGCATCGAGTGCTGTGGTGAACCATGGAATACAATCTTCAA
GAAAGCTTATAAAGAGCCCATTGAAGTTGAGACAGACCTCACAGTTGAACAATTGCTCTCTGTGATCTAT
GAGAAAATGTGTGATGACCTCAAATTGTTTCCAGAGGCTCCAGAGCCTCCACCATTTGAGAACGTCGCTC
TTGTTGATAAGAACGGTAAAGACTTGGATTGTATAAAATCATGCCATCTTATCTACCGTGATTATGAGAG
TGGTGATGATATCGAGGAGGATGATGCTGAGGAGTTTGATACTGACTCAGCTGATGCTGAAGAATGTGAC
ACAGCCTCAGAATGTGAAGAAGAGGACGAGGATACTAAAGTGTTGGCTCTTATACAAGACCCGGCAAGTA
ACAAGTACCCTCTTCCACTAGATGATGATTATAGCGTCTACAATGGTGCAATTGTTCATAAAGACGCTCT
TGATGTTGTGAATTTACCATCTGGTGAAGAAACTTTTGTTGTTAGTAATTGTTTTGAGGGAGCTGTTAAA
CCACTCCCACAGAAAGTTATTGATGTTCTAGGTGACTGGGGTGAGGCTGTTGATGCACAAGAACAATTGT
GTCAACAGGAATCTACTCGAGTCGTATTTGAGAAACCGGTTGAGGATTCTACTGGTAGTTGCGAGGCAAT
GGTTGAACGAACTGTTGTTGAAGAACATGCTGTAGTTCCTGTGGTTGAGAATAAGTCGGATGTAGTTGTT
TATACACCTGCCGATCTAGAAGTTGTTAAAGAAACAGCAGAAGAGGTGGACGAGTTCATTCTCATTTCTG
ATGTTTCTAAAGAAGAAGTTGTGTCTCAAGAGAAAGAAGAGCCACAAGTTGAGCAACATCCTACTCAAGT
TGTTAAACCACAACGCGAGAAGAAGGCTAAAAAGTTTAAAGTTAAACCAGCCACATGTGAAAAACCCAAG
TTTTTGGAGTATAAAACTTGTGTGGGTGATTTGACTGTTGTGATTGCCAAAGCATTGGATGAATTTAAAG
AGTTCTGCATTGTAAATGCTGCAAATGAGCATATGTCTCATGGTGGAGGCGTTGCGAAGGCAATTGCAGA
CTTTTGTGGACCTGACTTTGTGGAATATTGTGAAGACTATGTTAAGAAACATGGACCACAACAAAGACTT
GTTACACCTTCATTTGTCAAGGGCATTCAATGTGTGAATAATGTAGTAGGACCTCGCCATGGAGACAGCA
ACTTGCGTGAGAAGCTTGTGGCTGCTTACAAGAAGGTTCTTGTAGATGGCGTCTTCAATTATGTTGTACC
AGTTCTCTCGTCAGGAATCTTTGGTGTGGATTTTAAAATGTCAATAGACGCAATGCGTGAAGCCTTTGAT
GGTTGCGACATACGTGTCCTCTTGTTCTCTCTGAGTCCAGAACACATCGATTATTTCAATGCAACTTGTA
AGCAGAAGACACTTTATCTTACGGAGGATGGTGTTAAATACCGCTCCATTGTTGTAAAACCTGGTGACTC
ATTGATTCAATTTAGACAGGTTTTTGCTAAAAATAAGGCAGTCTTTACAGCTGATGATGTTGAGGATAAA
GAAATCCTCTTCGTTCCTACTACTGATAAGACTGTTCTTGAGTATTATCATTTAGATGCGCAAAAGTATG
TGATATATTTACAAACTCTTGCGCAGAAATGGAATGTCCAATATAGGGACAATTTTATTATACTAGAGTG
GCGTGATGGAAACTGCTGGGTTAGTTCAGTAGCAGTACTCCTTCAAGCTGCCAAAATTAGGTTTAGAGGT
TTTCTTGCAGAAGCATGGGCTAAATTCCTAGGTGGTGATCCTACGGAGTTTGTAGCTTGGTGTTATGCGA
GTTGCAATGCTAAAGTTGGTGATTTTTCAGATACCAATTGGCTTTTGGCTAATTTGGCAGAACATTTTGA
TGCAGACTACACGAACGCACTTCTTAAGAAGCGTGTGTCTTGTAACTGTGGTGTAAAGAGTTATGAACTT
AGGGGCCTTGAAGCTTGTATACAACCAGTAAAGGCACCTAACCTGCTACATTTTAAGACGCAATATTCAA
ATTGCTCAATCTGTGGTGCAAATAGTACGGATGAAGTAATAGAAGCTTCACTACCATACTTGTTGCTCTT
TGCTACTGATGGCCCTGCTGCAGTTGATTGTGATGAAAATGCTGTAGGGACTGTTGTTTTCATTGGATCT
ACTAATAGTGGCCATTGTTATACACAAGCCATAGATAAGGCTTTTGATAATCTTGCTAAGGACAGAAAAT
TTGGAAAGAAGTCGCCTTACATTACAGCAATGTATATGCGCTTTTCTCTTAAGAGTGAAAATCCTTTACC
TGTTGTTAAACAGAGTAAGGGTAAAACTAAGGTAGTAAAAGAAGATGTTTCTAACCTCGCTACTAGTTCT
AAGGTTAGTTTTGATGATCTTACTGACTTTGAACATTGGTATGATAGCAACATCTATGAAAGTCTTAAAG
TGCAGGAAACACCTGACACTTTTGATGGGTATGTGTCATTTACAACAAAGGAAGATTCTAAGTTGCCACT
GACACTTAAAGTTAGAGGTATTAAATCAGCTGTTGACTTTAGGTCGAAGGATGGTTTCACGTACAAGTTA
ACACCTGATACTGATGAAAATTCAAAAGCACCAGTCTACTATCCAGTCTTGGACGCTATTAGTCTTAAGG
CGATATGGGTGGAAGGTAATGCTAATTTTGTTGTTGGACATCCAAATTGTTATAGTAAGTCTCTTCGCAT
TCCTACTTTTTGGGAAAGTGCTGAGAGCTTTTTTAAAATAGGTGATAAAATTGATGGTGTAACTATGGGC
CTGTGGCGTGCAGAACACCTTAATAAACCTAATCTTGAGAGAATTTTCAACATTGCTAAGAAGGCTATTG
TTGGGTCTAGTGTTGTTACTACACAATGTGGTAAATTAATTAGTAAAGCAGCTACATTCATTGCTGATAA
AGTAGGTGGTGGTGTAGTTCGCAATATTACAGATAGTATTAAGGGTTTTTTTGGGTTTACACGTGGGCAT
TTTGAATTGTCTCCACAATTCATAAAAACACTTATATTCTTCTTCTTTTACTTTATAAAGGCTAGCGCCA
AGAGTCTAGTTTCTAGCTATAAGAGAGTGTTATGTAAGGTGGTATTTGCCACTTTACTTATAGTGTGGTT
TATTTACACAAGTAATCCAGTAATTTTTACTGGAATACGTGTGTTAGACTTTCTAGTTGAAGGTTCTTTA
TGTGGTCCTTATAATGACTACGGTAAAGATTCTTTTGATGTGTTACGCTATTGTGCAGATGACTTTACTT
GTCGTGTGTGTCTACATGACAGAGATTCTCTTCATTTGTATAAACATGCATATAGCGTAGAACAGATTTA
TAAAGCTGCAAGTTCTGGCATTGTTTTTAATTGGAATTGGCTTTATTTGGTCTTTTTAATTTTATTTGTT
AAGCCAGTAGCAGGTTTTGTTATTATTTGCTATTGTGTTAAGTATTTGGTATTGAATTCAACTGTTCTGT
TAACTGGTGTAGGTTTTCTGGACTGGTTTGTTCAAACAGTTTTTAATCACTTTAACTTTATGGGTGCAGG
ATTTTATTTCTGGCTCTTTTATAAGATATACATACAGGTGTATCATATACTGTATTGTAAAGACGTAACA
TGTGAAGTGTGTAAGAGAGTTGCACGCAGTAATAGGCAAGAGGTTAGTGTTGTTGTTGGTGGACGCAAGC
AAATAGTGCATGTTTATACCAACTCTGGCTACAAATTTTGTAAGAAACATAACTGGTATTGTAGAAATTG
TGATGATTATGGTCACCAAAATACATTTATGTCTCCAGAAGTTGCTGGTGAGCTTTCTGAAAAGCTTAAA
CGCCATGTTAAACCTACAGCATATGCTTACCATGTTGTGGATGAAGCATGCTTAGTTGATGATTTTGTCA
ATTTAAAATATAAAGCTGCAATTCCTGGTAAGGATAGTGCACCTCTTGCAGTTAAATGTTTCAGTATTAC
AGATTTCTTGAAGAAAGCTGTTTTTCTTAAAGATGCACTGAAATGTGAACAAATATCTAATGATGGTTTT
ATAGTGTGTAATACACAGAGTGCGCATGCATTAGAGGATGCAAAGAATGCTGCCATATATTATGCGCAAT
ATCTGTGTAAACCAATACTTTTACTTGACCAGGTGCTCTATGAGCAATTAGTAGTTGAGCCTGTGTCTAA
GAGTGTTGTAGATAAGGTGTGTAGCATCCTGTCTAATATAATATCTGTAGATACTGCAGCTCTAAATTAC
AAGGCAGGTACACTTCGTGATGCCCTGCTTTCTATTACTAAAGATGAAGAAGCCGTAGATATGGCTATCT
TCTGTCATAATCATGATGTGGAATACACTAGTGATGGTTTTACTAATGTGATACCATCATATGGTATAGA
CACTGATAAATTAACACCTCGTGATAGAGGGTTTTTGATAAATGCAGATGCTTCTATTGCTAACCTAAGA
GTTAAAAATGCTCCACCGGTGGTATGGAAGTTTTCTGATCTTATTAAGTTGTCTGACAGTTGTCTTAAAT
ATTTAATTTCAGCTACTGTCAAGTCAGGAGTTCGTTTCTTTATAACAAAGTCTGGTGCTAAGCAGGTTAT
TTCTTGTCACACACAGAAATTGTTGGTAGAGAAAAAGGCTGGTGGTATCATAGGTGGTACTTTTAATTGG
TTCAAGAGTTGTTGTAAATGGCTCTTGATATTTTATGTACTTTTTACATTGTGTTGTTTGGGTTATTATC
ATATGGAGATGAATAAAATTTTTGTTCATCCCATGTATGATGTTAACTCTACAATGCATGTTGAAGGTTT
TAAGGTTATAGATAAAGGTGTTATTAGAGACATTGTACCAGAGGATGCTTGCTTCTCTAATAAGTTTGCT
AATTTTGATGCTTTTTGGGGCAAATCATATGAAAATAGTAGAGACTGTCCAATAGTAACGGCCATTATAG
ACGGTGCTGGAACAGTAGCTGCTGGTGTTCCTGGGTTCGTAGATTGGGTCATGAATGGTGTAATGTTTGT
ACACATGGCACAAACTGATCGAAGACCTTGGTATGTCCCTGCTTGGTTTAATAGGGAAATTGTTGGTTAC
ACTCAGGATTCAATTGTTACTGAAGGTAGTTTTTATACATCTATAGCTTTGTTTTCAGCAAGATGTTTAT
ATTTAATAGCCAGCAATACACCACAGTTGTATTGTTTTAATGGTGATAGTGATGCACCTGGAGCCTTACC
ATTTAGTAGTATAATTCCTCATAGGGTTTATTTCCAACCTAATGGTGTTAGGCTTATAGTTCCTCAGCAA
ATAATGCATACACCCTATATAGTAAAGTTGTTGTCAGACAGCTATTGTAGAGGTAGTGTATGTGAGTACA
CTAAACCAGGTTACTGTATGTCGTTGAACTCCCAATGGGTGTTGTTTAATGATGAATACATAGGTCGACC
TGGTGTCTTTTGTGGTTCTACTGTTAGAGAACTTGTGTTTAATATGGTTAGTACATTCTTTACTGGTGTT
AACCCTAATATTTATATGCAGCTAGCAACTATGTTTTTAATATTAGTTATTGTTGTGTTAATTTTTGCAA
TGGTTATAAAGTTTCAAGGTGTTTTTAAAGCTTATGCAACCATTGTGTTTACAATAATGTTAGTTTGGGC
TGTTAATGCATTTGTGCTATGTGTACATAGTTATAATAGTGTTGTAGCTGCTATACTACTTGTACTCTAC
TGCTATGCATCACTTGTTACAAGTCGCAATACTTCTATAATAATGCATTGCTGGCTTGTTTTTACTTTTG
GTTTGATAGTACCTATATGGCTAGCTTGTTGCTACTTAGCATTTGTACTTTATGTTTATACACCTTTATT
TTTCTGGTGTTACGGTACTACTAAAAATACTCGTAAGCTATATGATGGTAACGAGTTTGTTGGTAACTAT
GATCTCGCTGCGAAGAGTACTTTTGTTATTCGCGGTTCTGAGTTTGTTAAGCTTACGAACGAGATAGGTG
ATAAATTTGAAGCCTATCTCTCAGCGTATGCTAGACTTAAATATTACTCAGGCACAGGCAGTGAACAAGA
TTATTTGCAAGCTTGTCGTGCGTGGTTAGCTTATGCACTTGACCAATATAGAAATAGTGGTGTTGAAATT
GTGTATACTCCACCGCGTTATTCTATTGGTGTTAGTAGATTACAAGCTGGTTTTAAGAAACTAGTTTGTC
CTAGTAGTGCTGTTGAAAATTGCATTGTTAGTGTCTCTTACAGAGGTAATAATCTTAATGGACTGTGGCT
AGGTGATGCTATCTACTGTCCGCGACATGTTCTAGGCAAGTTTTCAGGTGATCAATGGAGTGATGTACTT
AATCTTGCTAATAATCATGAGTTTGAGGTTGTAACTCAAAATGGTGTTACTTTGAATGTTGTTAGTAGGC
GGTTGAGAGGCGCAGTTTTAATTTTACAAACTGCTGTCGCCAATGCTGACACTCCTAATTATAAGTTTGT
TAAAGCTAATTGTGGTGATAGTTTCACTATAGCTTGTTCTTATGGTGGTACAGTTGTGGGACTCTACCCT
GTTACTATGCGTCCTAATGGTACTATTAGAGCTTCTTTCCTTGCAGGAGCTTGTGGCTCAGTTGGTTTTA
ATATAGAAAAGGGTGTAGTTACTTTCGTTTATATGCACCATCTTGAGTTACCTAATGCATTACACACTGG
AACTGACCTATTTGGTGATTTCTATGGTGATTATGTGGACGAAGAGGTTGCACAAAGGGTGCCACCAGAT
AATTTAGTTACTAATAATATTGTAGCATGGCTTTATGCCGCAATTATTAGTGTTAAGGAGAGTAGCTTCT
CACTGCCTAAATGGTTGGAGAGTACTACTGTCAGTGTTGAAGACTACAATAAATGGGCTGGTGATAATGG
TTTTACACCATTTTCTACTAGTACTGCTATTACTAAATTAAGTGCTATAACGGGAGTAGATGTTTGTAAA
CTCCTTCGCACTATTATGGTAAAAAGTAGTCAATGGGGTAGTGATCCCATTTTAGGACAATATAATTTTG
AAGATGAATTGACACCAGAGTCTGTTTTCAACCAGGTAGGTGGTGTTAGGTTACAGTCATCTATTGTAAG
AAGAGCCACATCTTGGTTTTGGAGTAGATGTGTTTTAGCTTGCTTCTTATTTGTGTTGTGTGCTATTGTC
TTGTTTACGGCATTACCACTTAAATACTATGTACATGCAGCTGTTATTTTGTTAACAGCTGTACTTTTTA
TTTCTTTTACTGTTAAACATGTTATGGCTTACATGGACACTTTCCTACTGCCTACATTGATTACAGTTAT
TATTGGAGCTTGTGCTGAAGTCCCTTTCATATACAACACTCTAATTAGTCAAGTTGTTATTTTCTTAAGT
CAATGGTATGATCCTGTAGTCTTTGATACTATGGTGCCATGGATGTTATTGCCATTAGTATTGTACACTG
CTTTTAAGTGTGTACAAGGTTGCTATATGGATTCTTTCAATACTTCTTTGTTAATGCTGTATCAGTCTAT
GAAGTTAGGTTTTGTTACTTACACCTCTACAAACACTCTTACTGCATATACAGAAGGTAATTGGGAGTTG
TTTTTTGAGTTGGTTCACACTACTGTGTTGGCTAATGTTAGTAGTAATTCTTTAATTGGCTTATTTGTGT
TTAAGTGTGCTAAATGGATGTTGTATTACTGCAATGCAACATACTTTAACAATTATGTGTTAATGGCAGT
CATGGTTAATGGCTTGGGCTGGCTTTGCACTTGTTATTTTGGATTATATTGGTGGGTTAATAAGGTTTTT
GGTTTAACCTTAGGTAAATATAACTTTAAAGTTTCAGTAGATCAATATAGGTATATGTGCTTGCACAAAA
TACCAGCACCTAAGAGTGTCTGGGATGTTGTTAAGACAAATATACTTATACAAGGAATTGGTGGTGATCG
TGTGTTGCCTATTGCTACAGTTCAATCTAAATTGAGTGATGTAAAGTGTACAACTGTTGTTTTAATGCAG
CTTTTGACTAAGCTTAATGTTGAAGCAAATTCAAAAATGCATGCTTATCTTGTTGAGTTACACAATAAAA
TCCTTGCATCTGATGATGTTGGAGAGTGCATGGATAATTTGTTGGGTATGCTTGTTACACTATTTTGTAT
AGATTCTACTATTGATTTGAGTGAGTATTGTGATGATATACTTAAGAGGTCAACTGTCTTACAGTCGGTT
ACTCAGGAGTTCTCATACATACCCTCTTATGCTGAATATGAAAGAGCTAAGAATCTTTATGAAAAGGTTT
TAGCTGATTCTAAAAATGGTGGTGTAACACAGCAAGAGCTTGCTGCATATCGTAAAGCTGCCAATATTGC
AAAGTCAGTTTTTGATAGAGACTTGGCTGTTCAAAAGAAGTTAGACAGCATGGCAGAACGTGCTATGACA
ACAATGTATAAAGAGGCGCGTGTCACTGATAGACGAGCAAAATTAGTTTCATCACTACATGCGTTACTTT
TTTCAATGCTTAAGAAAATAGATTCTGAAAAGCTTAATGTCTTATTTGATCAGGCTAGTAGTGGTGTTGT
ACCTCTAGCTACCGTTCCAATTGTTTGTAGTAATAAGCTTACCCTTGTAATACCAGATCCAGAAACTTGG
GTCAAGTGTGTAGAAGGTATGCATGTTACATACTCAACAGTTGTTTGGAATATAGACACTGTTATTGATG
CTGATGGTACAGAGTTACATCCAACTTCTGTGGGTAGTGGATTGACATACTGTATAAGTAGTGATAATAT
AGCATGGCCTTTAAAGGTCAACTTGACTAGAAATGGGCATAATAAGGTTGATGCTGCTCTGCAGAATAAT
GAGCTTATGCCTCATGGTGTAAAAACAAAGGCTTGCGTTGCAGGTGTAGATCAAGCACATTGTAGCGTAG
AGTCTAAATGTTATTATACTAATATTAGTGGTAATTCAGTTGTTGCTGCTATTACTTCTTCTAATCCAAA
TTTGAAGGTAGCTTCATTTTTGAACGAGGCAGGCAATCAGATTTATGTAGACCTAGACCCACCATGTAAA
TTTGGCATGAAGGTGGGTGACAAGGTTGAGGTTGTTTACTTGTATTTTATAAAGAATACAAGGTCAATTG
TTAGGGGTATGGTACTTGGTGCTATATCTAATGTTGTTGTCTTACAGTCTAAAGGGCATGAAACAGAGGA
AGTGGATGCCGTTGGCATTCTTTCACTTTGTTCATTTGCAGTAGACCCTGCTGATACATATTGTAAATAT
GTGGCAGCAGGTAATCAACCTTTAGGTAACTGTGTTAAAATGTTGACAGTACATAATGGTAGTGGCTTTG
CTATAACATCAAAGCCAAGTCCAACTCCTGATCAGGATTCTTATGGAGGGGCTTCTGTGTGTCTCTATTG
TAGAGCACATATAGCACACCCAGGAGGTGCAGGAAATTTAGATGGACGTTGTCAATTTAAAGGTTCTTTT
GTGCAAATACCTACTACGGAGAAAGACCCCGTCGGATTCTGTCTACGTAATAAGGTCTGCACTGTTTGTC
AGTGTTGGATAGGTCATGGGTGTCAGTGTGATGCAATTAGACAACAAAAACCTTCTGTTCAGTCAGTTGC
TGGTGCATCTGATTTTGGTAAGAATTATTTAAACGGGTACGGGGTAGCAGTGAGGCTCGGCTGATACCCC
TTGCTAGTGGGTGTGACCCTGATGTTGTAAAGCGAGCCTTTGATGTTTGTAATAAGGAATCAGCTGGTAT
GTTTATAAATTTTAAGCGTAACTGTGCGAGATTCCAAGAAGTACGTGATACTGAAGATGGAAATCTTGAG
TATCTTAATTCTTATTTTGTGGTTAAACAAACCACTCCTAGTAATTATGAACATGAAAAGTCTTGTTATG
AAGACTTAAAGTCAGAAGTAACGGCTGACCATGACTTCTTTGTGTTCAATAAGAACATTTACAATATTAG
TAGGCAGAGGCTTACTAAATATACTATGATGGACTTTTGCTATGCTTTGAGGCATTTTGACCCAAAGGAC
TGCGAAGTTCTTAAAGAAATACTTGTCACTTATGGTTGTATAGAAGATTATCACCCTAAGTGGTTTGAAG
AGAATAAGGATTGGTACGACCCAATAGAAAACCCAAAATATTATGCCATGTTGGCTAAAGTGGGGCCTAT
TGTACGACGTGCTTTATTGAATGCTATTGAGTTCGGAAACCTTATGGTTGAAAAAGGTTATGTTGGTGTT
GTCACGCTTGATAACCAAGATCTTAATGGCAAATTTTATGACTTTGGTGATTTTCAAAAGACAGCGCTTG
GTGCTGGTATTCCTGTCTTTGATACGTATTATTCCTACATGATGCCCATCATAGCCATGACGGATGCTTT
AGCACCTGAAAGGTATTTTGAATATGATGTGCATAAGGGTTATAAATCTTATGATCTTCTCAAGTATGAT
TATACTGAGGAGAAACAAGAAATGTTTCAAAAGTACTTTAAGTACTGGGATCAGGAGTATCACCCTAACT
GTCGTGACTGTAGTGATGACAGGTGTTTGATACATTGTGCAAACTTCAACATCTTATTTTCTACACTAAT
ACCGCAGACTTCTTTCGGTAATCTGTGTAGAAAAGTTTTTGTTGATGGTGTACCATTCATAGCTACTTGT
GGCTATCATTCTAAAGAACTTGGTGTTATTATGAATCAAGATAACACCATGTCGTTTTCAAAATTGGGTT
TAAGTCAACTCATGCAGTTTGTTGGAGACCCTGCCCTTTTGGTGGGAACATCCAATAATTTAGTTGATCT
TAGAACGTCTTGTTTTAGTGTTTGTGCTTTAGCGTCTGGTATTACGCATCAAACTGTAAAACCAGGTCAC
TTTAACAAGGATTTCTATGACTTTGCAGAGAAGGCTGGTATGTTTAAGGAAGGTTCTTCTATACCACTTA
AACATTTCTTCTACCCACAGACTGGTAGTGCTGCTATAAACGATTATGATTATTATCGTTATAACAGGCC
TACTATGTTTGACATACGTCAACTTCTATTTTGTTTAGAAGTGACTTCTAAATATTTTGACTGCTATGAA
GGCGGCTGTATACCAGCAAGCCAAGTTGTAGTTAATAATCTAGACAAGAGCGCAGGCTATCCATTTAATA
AGTTTGGAAAAGCCCGTCTCTATTATGAAATGAGTCTAGAGGAACAGGACCAACTCTTTGAGAGTACAAA
GAAGAATGTCCTGCCCACTATAACTCAAATGAATTTAAAATATGCTATATCTGCGAAGAATAGAGCTCGT
ACAGTGGCAGGTGTTTCTATCCTTTCTACTATGACTAATAGGCAATTTCATCAGAAGATTCTTAAGTCTA
TAGTTAATACTAGGAATGCTCCTGTAGTTATTGGAACAACCAAGTTTTATGGCGGTTGGGACAACATGTT
GAGAAACCTTATTCAGGGTGTTGAAGACCCGATTCTTATGGGTTGGGATTATCCAAAGTGTGATAGAGCA
ATGCCAAATTTGCTACGTATAGCAGCATCTTTGGTACTTGCTCGGAAACACACTAACTGTTGTACTTGGT
CTGAGCGTATTTATAGGTTGTATAATGAATGCGCTCAGGTTTTATCAGAAACTGTCTTAGCTACAGGTGG
TATTTATGTGAAACCTGGTGGCACTAGCAGTGGCGATGCTACTACTGCTTATGCAAACAGCGTTTTTAAC
ATAATACAAGCCACATCTGCAAATGTTGCGCGTCTTTTGAGTGTTATAACGCGCGATATTGTTTATGACG
ACATTAAGAGCTTGCAGTACGAATTGTATCAGCAGGTTTACAGGCGAGTTAATTTTGACCCAGCCTTTGT
TGAAAAGTTTTATTCTTACTTATGTAAGAATTTTTCCTTGATGATCTTGTCTGACGACGGTGTTGTTTGT
TATAACAATACACTAGCCAAGCAAGGTCTTGTAGCAGATATTTCTGGTTTTAGAGAAATTCTCTACTACC
AAAATAATGTTTATATGGCTGATTCTAAGTGTTGGGTGGAACCAGATTTAGAAAAAGGCCCTCATGAATT
TTGTTCACAGCATACAATGCTAGTGGAGGTGGATGGTGAGCCTAAATACTTGCCATACCCAGATCCTTCA
CGCATTTTGGGTGCATGTGTATTTGTAGATGACGTAGATAAGACAGAACCTGTGGCTGTTATGGAGCGCT
ATATAGCTCTAGCCATAGACGCTTATCCGCTAGTGCATCATGAGAATGAGGAGTACAAGAAGGTTTTCTT
TGTGCTGCTTTCATATATCAGAAAACTCTATCAAGAGCTTTCTCAGAATATGCTTATGGACTACTCTTTT
GTAATGGATATAGACAAGGGTAGTAAATTTTGGGAACAGGAGTTCTATGAGAATATGTATAGAGCCCCTA
CAACTTTACAATCTTGTGGTGTCTGTGTAGTGTGCAATAGTCAAACTATACTGCGCTGTGGTAATTGTAT
TCGCAAACCATTTTTGTGTTGTAAATGTTGCTATGACCATGTCATGCATACAGACCACAAAAATGTTTTG
TCTATAAACCCATACATTTGCTCACAACCCGGTTGTGGCGAGGCAGATGTTACTAAATTGTATCTCGGAG
GTATGTCATACTTCTGTGGTAATCATAAACCAAAATTGTCAATACCATTGGTATCTAATGGTACTGTTTT
TGGAATTTACAGGGCTAATTGTGCAGGTAGCGAAAATGTTGATGATTTTAACCAACTAGCTACTACTAAT
TGGTCTACTGTAGAACCTTATATTTTAGCAAATCGTTGTAGTGACTCGTTGAGGCGCTTTGCTGCAGAGA
CAGTAAAAGCCACAGAAGAGTTACATAAGCAACAATTTGCTAATGCAGAAGTGAGAGAAGTCCTCTCAGA
TCGTGAATTGATTCTATCATGGGAGCCAGGTAAAACCAGCCCTCCATCGAATAGAAATTATGTTTTCACA
GGCTATCACTTTACAAGAACTAGTAAGGTGCAGCTTGGTGATTTTATATTTGAAAAAGGTGAAGGTAAAG
ATGTTGTCTATTATAGGGCAACGTCCACTGCTAAATTGTCTGTTGGAGACATTTTTGTTTTAACCTCACA
CAACGTTGTTTCTCTTGTAGCACCAACATTGTGTCCACAACAAACCTTTTCTAGGTTTGTAAATTTAAGA
CCTAATGTAATGGTACCAGAATGCTTTGTAAATAACATTCCACTGTACCACTTATTAGGTAAACAGAAGC
GTACTACAGTACAAGGCCCTCCTGGCAGTGGTAAGTCACACTTTGCTATAGGCCTTGCAGCGTACTTTAG
TAATGCTCGTGTTGTTTTTACTGCATGCTCTCATGCAGCTGTTGATGCTTTATGTGAAAAAGCTTTTAAG
TTTCTTAAAGTTGATGATTGCACTCGTATAGTACCTCAAAGAACTACTATCGATTGCTTTTCAAAGTTTA
AAGCTAATGATACAGGCAAAAAGTACATTTTTAGTACTATAAATGCCTTGCCAGAAGTTAGTTGTGACAT
TCTCTTGGTTGACGAGGTTAGTATGTTGACCAATTATGAATTGTCATTTATTAATGGTAAGATAAACTAC
CAATATGTTGTGTATGTAGGTGATCCCGCTCAATTACCGGCACCTCGTACCTTACTTAATGGTTCACTTT
CACCAAAGGATTATAATGTTGTAACAAACCTTATGGTTTGCGTTAAACCTGATATCTTCCTTGCGAAGTG
TTACCGTTGTCCTAAGGAAATTGTAGACACTGTGTCTACTCTTGTTTATGATGGAAAGTTTATTGCAAAC
AACCCAGAATCACGCCAGTGTTTTAAAGTTATAGTTAATAATGGTAATTCTGATGTAGGACATGAAAGTG
GTTCAGCCTACAACACAACTCAGTTAGAATTTGTGAAAGATTTTGTTTGTCGCAATAAAGAGTGGCGAGA
AGCAACATTCATTTCACCTTATAATGCTATGAACCAGAGAGCCTATCGTATGCTTGGACTTAATGTTCAG
ACAGTAGACTCGTCTCAAGGTTCAGAGTATGACTATGTTATCTTCTGTGTTACTGCAGATTCGCAACATG
CACTGAATATTACCAGATTTAATGTGGCGCTTACAAGAGCTAAGCGTGGTATATTGGTTGTCATGCGTCA
GCGCGATGAATTGTATTCTGCTCTCAAGTTTACAGAGCTTGATAGTGAAACAAGTCTGCAAGGAACAGGT
TTGTTTAAAATTTGCAACAAAGAATTTAGTGGTGTTCATCCTGCTTATGCAGTAACAACTAAGGCTCTTG
CTGCAACCTACAAAGTTAATGATGAACTCGCTGCACTTGTTAATGTAGAAGCTGGTTCAGAAATAACATA
TAAACATCTTATTTCTTTGTTAGGATTTAAGATGAGTGTTAACGTTGAAGGTTGCCATAACATGTTTATT
ACACGTGATGAGGCAATCCGCAATGTAAGAGGTTGGGTAGGATTTGATGTAGAGGCCACACATGCTTGTG
GTACTAACATTGGTACTAACCTGCCTTTTCAAGTAGGTTTCTCTACTGGTGCGGACTTTGTGGTCACGCC
TGAGGGACTTGTAGACACTTCAATAGGCAATAATTTTGAGCCTGTGAATTCTAAAGCACCTCCGGGTGAA
CAATCACTTGAGAGCGTTATAAGTGCTAAACCTTGGCATGTTATAAGACCAAGGATTGTACAAATGTTAG
CAGACAACCTATGCAATGTTTCAGATTGTGTGGTTTTTGTAACTTGGTGTCATGGTCTAGAACTAACTAC
TTTGCGCTATTTTGTTAAAATAGGCAAAGAACAAGTGTGTTCTTGTGGTTCTAGAGCTACAACATTTAAT
TCTCATACTCAAGCCTATGCTTGTTGGAAGCATTGTTTGGGCTTTGATTTTATTTATAATCCACTTTTAG
TGGATGTTCAACAGTGGGGTTACTCTGGTAACCTACAATTTAATCATGATTTGCATTGTAATGTGCATGG
CCATGCGCATGTAGCCTCTGCGGATGCTATTATGACGCGTTGTCTTGCAATTAACAATGCATTTTGTCAA
GATGTCAACTGGGATCTGACATACCCTCATATTGCAAATGAGGATGAAGTCAATTCTAGTTGTAGATATT
TACAACGCATGTATCTTAATGCATGTGTTGATGCTCTTAAAATTAACGTTGTCTATGATATAGGCAACCC
TAAAGGTATTAAATGCGTTAGACGTGGAGACTTGAGTTTTAGATTCTATGATAAGAATCCAATAGTACCC
AACGTTATGCAGTTTGAGTATGACTATAATCAGCATAAAGATAAGTTTGCTGATGGTCTTTGTATGTTTT
GGAATTGTAATGTGGATTGTTATCCTGATAATTCCTTGGTTTGTAGGTATGACACACGAAATTTGAGTGT
GTTTAACTTACCAGGTTGTAATGGTGGTAGCCTGTATGTCAATAAACATGCATTCCACACACCTAAATTT
GATCGCATTAGCTTTCGTAATTTGAAAGCTATGCCATTCTTTTTCTATGACTCATCTCCTTGCGAAACCA
TTCAAGTGGATGGAGTTGCACAGGATCTTGTGTCACTAGCTACTAAAGATTGTATCACAAAATGCAACAT
AGGCGGTGCTGTTTGTAAGAAACATGCGCAGATGTATGCAGAGTTTGTGACTTCTTATAATGCAGCGGTA
ACAGCTGGTTTTACATTTTGGGTTACTAATAATTTTAACCCGTATAATTTGTGGAAAAGTTTTTCAGCTC
TTCAGTCTATCGATAATATTGCTTATAATATGTATAAGGGTGGTCATTACGACGCTATTGCAGGAGAAAT
GCCCACCATCGTGACTGGAGATAAAGTTTTTGTTATTGATCAAGGTGTAGAAAGGGCGGTTTTTGTTAAT
CAGACAACACTGCCTACTTCTGTGGCATTTGAACTGTATGCGAAGAGAAACATTCGCACACTGCCAAACA
ACCGTATTTTGAAGGGTCTTGGTGTAGATGTAACCAATGGTTTTGTAATTTGGGATTATGCGAACCAAAC
ACCATTATATCGTAATACTGTTAAGGTGTGTGCATACACAGACATTGAGCCAAATGGTCTAATAGTTCTG
TATGATGATAGATATGGTGATTACCAATCTTTTCTTGCCGCTGATAATGCTATCCTAGTTTCTACACAGT
GTTATAAGCGATATTCATATGTAGAAATACCGTCAAACATGCTTGTTCAGAATGGTATGCCATTAAAAGA
TGGAGCGAATCTGTATGTTTATAAGCGTGTTAATGGAGCGTTTGTTACGCTACCTAGCACACTAAACACA
CAGGGCCGCAGTTATGAAACTTTTGAACCTCGTAGTGACGTTGAGCGTGATTTTCTCGCCATGTCAGAAG
AGGATTTTGTAGTAAAGTATGGTAAAGGCTTAGGTCTACAACACATACTGTATGGTGAAGTTGATAAACC
ACAATTGGGCGGTTTACACACTGTTATAGGTATGTACAGACTTTTACGTGCGAATAAGTTGAATGCAAAG
TCTGTTACTAATTCAGATTCTGATGTCATGCAAAATTATTTTGTGTTGGCAGATAACGGTTCTTACAAGC
AAGTGTGCACTGTTGTGGATCTACTGCTTGATGACTTCTTAGAACTTCTTAGGGGCATACTGAATGAGTA
TGGTACTAATAAGTCAAAAGTTGTAACAGTGTCAATTGATTACCATAGCATAAATTTTATGACTTGGTTT
GAAGATGGCAGTATTAAAACATGTTATCCACAGCTTCAATCAGCATGGACGTGTGGTTATAATATGCCTG
AACTTTATAAAGTCCAGAATTGTGTTATGGAACCTTGCAACATTCCTAACTACGGTGTTGGAATAACGTT
GCCGAGTGGTATTATGATGAATGTGGCAAAGTATACACAACTTTGTCAATATCTTTCGAAAACAACAATG
TGTGTACCGCATAATATGCGAGTAATGCATTTTGGAGCAGGAAGTGATAAAGGAGTGGCTCCAGGTAGCA
CTGTTCTTAAGCAGTGGCTCCCTGAAGGTACACTCCTTGTTGATAACGATATTGTAGATTATGTGTCTGA
TGCACATGTTTCTGTGCTTTCAGATTGCAATAAATATAAAACAGAGCACAAGTTTGACCTTGTGATATCT
GATATGTATACAGATAATGATTCAAAAAGAAAGCATGAAGGCGTGATAGCCAATAATGGCAATGATGACG
TTTTCATATATCTCTCAGATTTTCTTCGTAACAATTTGGCTCTTGGTGGCAGTTTTGCTGTAAAGGTGAC
AGAGACAAGTTGGCATGAGAATTTATATGACATTGCACAAGATTGTGCATGGTGGACAATGTTTTGTACT
GCAGTGAATGCTTCTTCGTCAGAGGCATTTATGATTGGTGTTAATTATTTAGGTGCAAGCGAAAAGGTTA
AAGTTAGTGGAAAGACGCTGCACGCAAATTATATATTTTGGAGGAATTGTAATTATTTACAAACCTCTGC
TTATAGTATATTTGACGTTGCCAAGTTTGATTTGAAGTTAAAAGCGACGCCAGTAGTTAGTCTGAAAACT
GAACAAAAAGACAGACTTAGTTTTTGGTTTAGTTAAGAGTGGCAAGTTATTAGTTAGAGATGTTGGTGCA
GTTGTGTTGCCTGACGATAATCTTGTCACTTGTATGTAATGTGAGTTCTATTCCCACAATTTGTCTCAAT
GCTACTGTAGGTAGTGGTGTGTGTCTACCTTGCACAAACATACCAGAGTATGCAGATGGTAAAAATGGGG
GTGAAGCCCTAGATTTTTATAGTCCAGATGTTATGAGACCGCCAGATGGCGCATATATACAATCCGGTTA
TTATGAACCACTTTTCACAGGTTGCTTTAATCAAACTAATCAAACTGATAGCACCTGTAGAAATGGGCTT
TATAAAGGGTCGCCAGGTAATTTTACTATACAAGGTGATTTTCTTAAAAATTATGATGCTGTTGGCATAA
TGTTTTGGTGGGGTTTAGCTACTAATGTGGGTAAAGTAACACCACCCAATGATCCTACTTTTAATTTAAC
ATGGGGCAACTTTTTTCTTAATTCTAAGAATTTTACAGGTTTCCATAAAGTTAAAAGTGTCATATTTATT
GCCACTGGAGATATCTTCGTAAATGGCGTTTTAATGGGTTTTTATAATCTAAATTTTACACAAACCTTAA
CAATTTGGTTAGCACAGTGTGTTGGCACAATGAAGGTTGTTATTTTACGTAATAGTAATGCTCTAGTTCA
TTTTTCGGCTGGCAACGTAGTTGCTTTCGAACCCTGCACAGGAGACACTACTATTAATAAGTTACGTTGC
GCTTATCAGCAATTTAATTTTTCTACAGGATTTTATGACATAGATACTTTTGTACCTGTGACATCTAATA
TTACATATTTACCTTACCCAGATTTAAAAGACAATACTGGTCAAGAGGTATGTGACTTTTATGTAGCTCT
TAAAGGAGATCATGTTATTTACAACCAAAGTTGTGTAGACTCTAAGTACCCATTCTTTAAATTAAAGTGT
AATAATACTTATTCATGGGATAATGATAAGTTGTGTATTTTAGGGTCTGAAATATATGTGCCGGGGTATA
ATGTTTACACTAATACGCAACATTCATATGCTGGCACTATACCGAATTATCCAACTTGTTCTTCCAAAGG
TCTTAGTTTGGAAAATATTTATAATAATATAGGTTTCAATAGATTTTGTGTAACTAAATTGTTGACGACT
CGTGATATATCATCTATAACCCAATACACTTGTGTTTATGTCGTTAGTGTAGAAGGTTTTGATAGTTATA
ATCAAGGTATTGTATACAGTTATGTTGGTGTAAACTTTGATTTTGGTACAGCTATGTATAGTGTGAAAAC
TGCACCTATGCAGTTCATCTATACAGAGCAATGTCATAAGTATAATATTTACAACATAAGAGGTGTTGGT
CAAATATTAAATGTCACTGGTAAAGATAATACTACACTTGTAGACGGTGGTCTAGTAATAACTAGTGGCA
GTGGCTTATTGGCTTTTCGTAATAATGGAAGTCTTTTTAGTGTACAACCTTGCCGGACAGTTTCAACTCA
AGCTGTAATTGTTAATGGGAGTTTTGTAGGCTTGTTTGTTCCTGCATCTTGTTGGTTAGCCGATCAATTT
AATCTAGGTAACCACACAGAATATGTAGATGGTGGTTGTCTTATTAGTAATAAGACTATTAGTAGAAAGC
GTAGGTCTACTAACGCTGTTTATACTGGTGAATGCACAGGTTTATTTGCAGCTATGGGTACATCTTGTAT
TTATAGTAATGGCACAGTTCTTAATAGAACATTACCACAACCATCTGTTCAAACTAGTGTGCAACCATTA
CTAGGTGTTGTAGCAAATGTGTCTATTCCAAAAGAATTGACACTTGCTGTAACCACAGAATACTTACAAA
CTCGTTATCAGAAAGTTACTATTGATTGTGCTAAATATGTCTGTGGTGATTCTACAAGGTGCCGCACGTT
GCTGCAGCAGTATGGTTCTTTTTGCCAGAGTGTTAATGCTATATTAAGTGGTGTTAATGAGAATGAAGAT
AATGGTTTACTGCAATATGCGGAAGCTATTAATACAGGTTACACACTTAATTTTACTGGTTATAATGTAT
CCAATTTGGGTGGGTTTGATTTGTCCCTTGTTCTACCCAAAAATCTTACTTTGGCACAAAATCAAGGTAG
GTCTACTATTGAAGACTTACTTTTTGACAAAGTTGTTACTCTAGGTGTTAGTGAAGTTGATCAGAATTAT
GATAAATGTATAGCATCTAGAGGTGGTTCTTTTACTAATTTAGCAGATTTAACTTGTGCTCAGTTTTACA
ATGGTGTCATGGTGCTCCCTGGTGTTGTTGACCCTGGTCTAATGGCAGTGTACACCGGCTCTTTAATAGG
TGGTATGGCGCTCGGAGGCATTACAGCAGCGGCATCCATACCATTTGCTACTCAAATACAAGCACGTGTC
AATTATTTAGCGTTGACACAATCAGTGCTTTTAGATAACCAAAATTTGATAGCAAATTCCTTTAATAAGG
CCCTTAAAGGTATACAGTCAGCATTAGACACTGTTTCCCAGGGGTTTGTTGAAGTAGCTAGAGGTTTTGA
GAGCGTAACTGTAGCACTTAATAAAGTTCAGGATGTGGTTAACACACATTCCGACATATTAAATAAACTT
ATGGCTCAGCTTAGTGTTAATTTTGGGGCTGTTTCATCTTCTCTTAATGAGATATACCTAAAATTAGACC
AGATTAATGCAGATGCTCAGGTTGATAGGTTAATTACTGGTAGGTTGACTGCATTATCAACTTACGTAGC
ATCTCTTCAATTAGCAGCTTATAAGGCTGACCAGTCAAGACGCTTGGCTCTACAGAAAGTAGAGGAGTGT
GTTAAGTCGCAATCCATGCGATATGGTTTCTGTGGTAATGGTAGCCATGTTCTAACAATACCACAGAGTG
CTCCTAATGGAATATTCTTTATCCACTACACGTACCAACCCACTTCTTATGTTACAATTGAAGCAGTGCC
TGGTCTATGTGTAACAACACCTTCTGGAAAGTATGGTGTAATGCCCAAGACTGGAAGTGGCATCATATTT
AGACAGAATGATACTTTCTTTGTCACTTCCACACAGTTATATGAGCCTAAGCTTTTATCATATTCAGAAG
TGGTCAATTTAACATCTTGTGAAGCTAATTATTACAATGTTAGTGAAAGTGAAACACCCTTTCAACCAGC
ATTGCCTAATTTCGATGACGAGTTTAATGACATTTTTACTGAGTTAAATACCTCAAAAGATGCCATTAAA
AATATCAGTTCCAATTTTAACTACACAATTCCCATCCTAAATCTTGAGGATGAGATTTGTAGATTGAATC
ACTCCATTAACACACTATATAATTATAGTGATGTTATTGATAAAATTAACCAGGGTCTTAATGACACCTT
TATTAATCTTGAACAACTTAATAAAATTACACGTTACATTAAGTGGCCTTGGTATGTTTGGTTAGCAATT
GGTTTTGCTTGTTTAATATTCATCTTAATATTAGGATGGGTGTTTTTCATGACTGGTTGTTGTGGTTGTT
GTTGCGGATGCTTTGGCATTATTCCGCTAATGAGTAAGTGTGGTAAGAAATCCTCTTACTACACGACTTT
TGATAATGATGTGGTGTATAACAAAACAGACCTAAAAAGTCTGTTTAATGATTCAAACTCCAACATCTTT
TCTAATAGTGTTAATTCTTCTTTGGTTTAAACTTGTGTTAAGTTGTTTTAAAGAGTGTGTTTTAGCGCTT
CTTCAATTAATACAAGTTTTACTCCAAATTATTAATAGTAACTTACAGGCTAGACTTCTGCTTTGGCACA
GTCTAGACTAATGTTAGATTTTGAAGCAATTATTGAAACTGGTCAGCAAATAATTCAGCAAATCAGTTTC
GATTTACAGCACATTTCAAGTGTGCTAAGCACTGAATTATTTGACCCCTTTGAAGTCTGTGTTTACAGAG
GAGGTAATTATTGGGAGTTAGAGTCAGCTGACGAGTTTTCAGGTGATGACGAATTTATTGAGTAAATCGC
TAGAGGAGAACGGAAGTTTCCTAACAGCAGTTTACATATTTGTTGCATTTGTAGCACTTTACCTATTAGG
TAGGGTACTTCAAGCATTTGTACAGACTGCTGATGCTTGTTGTTTGTTTTGGTATACATGGATAGTAGTT
CCTGGAGCTAAGGGTGCAGCCTTTGTATACAATTATACATATGGTAAAAAACTTAACAAACCGGAGTTAG
AAGCGGTTATTGTTAACGAGTTCCCCAAGAACGGTTGGAATAACAAAAGTCCAGCAAATTTCTAATATGA
CGGAAAATTGTACACTTGATTCAGAGCAGGCAGTTCTGCTTTTTAAGGAATATAATTTATTTATAACCGC
ATTCCTATTGTTTCTTACCATACTACTTCAGTATGGTTACGCAACTAGGAGTCGGTTTATCTATATACTG
AAAATGATAGTGTTATGGTGCTTTTGGCCCCTTAACATTGCAGTAGGTGTAATTTCATGTATATACCCAC
CAAACACAGGAGGTCTTGTCGCAGCGATAATACTTACAGTGTTTGCGTGTATGTCTTTTGTAGGTTATTG
GATTCAGAGTTTTAGACTCTTTAAGCGGTGTAGGTCATGGTGGTCATTCAACCCCGAGTCTAGTGCCGTA
GGTTCAATACTCCTCACAAATGGTCAACAATGTAATTTTGCTATAGAGAGTGTGCCTATGGTGCTTGCTC
CAATTATAAAGAACGGTGTCCTTTATTGTGAGGGTCAGTGGCTTGCTAARTGTGAACCAGACCACTTGCC
TAAAGACATATTTGTATGCACACCGGATAGACGTAATATCTATCGTATGGTGCAGAAATACACTGGTGAC
CAAAGCGGAAATAAGAAAAGGTTTGCTACATTTGTCTATGCAAAGCAGTCAGTAGACACTGGGGAGCTAG
AAAGTGTAGCAACAGGTGGAAGTAGCCTTTACACATAAATGTGTGTGTGTAGAGAGTATTTAAAATTATT
CTTCAATAGTGCCTCTATTTTAAGAGCGTGGAAGAGTATTTGGTTTGAGGACATTAATATAAATCCTCTT
TGTTTTGTACTCTCTTTACAAGAGTTATTATTTAAGCAACAGTTTTTCCTTTCCTTTGTTTGGAAGAAAG
TTGTTGTTAATGGTGTAGAATTCCAAGTAGAAAATGGAAAAGTCCACTACGAAGGAAACCCCATTTTTCA
AAAAGGTTGTTGTAGATTGTGGTCCCATTATAAGAGGGATTAAATGGATTAAACCACCTACTACTACTTA
CTTGTAATAAGGGCGTTTGGACTTACAAACGCGTAACAAGTACGGACGATGAAATGGCTGACTAGTTTTG
GAAGAGCAGTTGTTTCGTGTTATAAGGCCCTACTATTAACTCAATTAAGAGTGTTAGATAGGTTAATTTT
AGATTACGGACCAAAGCGCACTTTAACGTGTGCTAGGCGAGTGCTTTTAGTTCAATTAGATTTAGTTTAT
AGGTTGGCATATACGCCCACCCAATCGCTGGTATGAATAATAGTAAAGATAATCCTTTTCGCGGAGCAAT
AGCAAGAAAAGCGCGAATTTATCTGAGAGAAGGATTAGATTGTGTTTACTTTCTTAACAAAGCAGGACAA
GCAGAGCCTTGTTCCGCGTGTACCTCTTTAGTATTCCAAGGGAAAACTTGTGAGGAACACATAAATAATA
ACGATCTTTTGTCATGGCAAGCGGTAAGGCAACTGGCAAGACAGATGCCCCAGCGCCGGTCATCAAACTA
GGAGGACCAAAGCCACCTAAAGTTGGTTCTTCTGGAAATGCATCTTGGTTTCAATCAATAAAAGCCAAGA
AGCTAAATACACCTCAACCTAAGTTTGAAGGTAGCGGTGTTCCTGATAATGAAAATATTAAAACAAGCCA
GCAGCATGGATACTGGAGACGCCAAGCCAGGTTTAAGCCAGGTAAAGGCGGAAGAAAACCAGTCCCAGAT
GCTTGGTACTTCTATTATACTGGAACAGGACCAGCCGCTGACCTGAATTGGGGTGATACCCAAGATGGTA
TAGTGTGGGTTGCTGCAAAGGGTGCTGATGTTAAATCTAGATCTAACCAGGGTACAAGGGACCCTGACAA
GTTTGACCAATATCCACTACGATTCTCGGACGGAGGACCTGATAGTAATTTCCGTTGGGACTTTATTCCT
CTGCATCGTGGTAGGAGTGGAAGATCAACAGCAGCTTCATCAGCAGCATCTAGTAGAGCACCGTCGCGTG
ACGGCTCGCGTGGTCGTAGAAGTGGTTCTGAAGATGATCTTATTGCTCGTGCAGCAAAGATAATCCAGGA
TCAGCAGAAGAAGGGTTCTCGCATTACTAAGGCTAAGGCTGATGAAATGGCTCACCGCCGGTATTGCAAG
CGCACTGTTCCACCTGGTTATAAGGTTGATCAAGTATTTGGTCCCCGTACTAAAGGTAGGGAGGGAAATT
TTGGTGATGACAAAATGAATGAGGAAGGTATTAAGGATGGGCGTGTTACGGCAATGCTCAACCTAGTCCC
TAGCAGCCATGCTTGTCTTTTTGGAAGCAAAGTGACGCCCAAACTTCAACCAGATGGGCTTCACTTGCGA
TTTGAATTTACTACTGTGGTCCCGCGTGATGATCCGCAGTTTGCTAATTATGTGCAAATTTGTGATCAGT
GTGTCGATGGTATAGGAACACGTCCAAAAGACAATGAACCCAGACCAAAGTCACGCCCAAGTTCTAGACC
TGCTACAAGAGGAAATTCTCCAGCGCCAAGACAACAGCGCCCAAAGAAGGAGAAAAAGCCAAAGAAGCAG
GATGATGAAGTAGATAAAGCGTTGACCTCGGATGAGGAGAGGAACAATGCACAGCTGGAATTTGATGATG
AACCCAAGGTAATTAATTGGGGGGATTCAGCCCTAGGAGAGAATGAGTTGTAGAGCCTTTCTACTGTTCT
CTCTCCTTTATCCTAGAAGATCATTAGTTAGAGTTAAGGAAGATAGGCATGTAGCTTAGCACCTACATGT
CTATCGCCAGGGAAATGTCTAATCTGTCTACTTAGTAGCCTGGAAACGAACGGTAGACCCTTAGATTTTA
ATTTAGTTTAATTTTTAGTTTAGTTTAAGTTAGTTTAGAGTAGGTGTAAAGATGCCAGTGCCGGGGCCAC
GCGGAGTACGATCGAGGGTACAGCACAAGGACGCCCATTAGGGGAAGAGCTAAATTTTAGTTTAAGTTAA
GTTTAATTGGCTAAGTATAGTTAAAATTTATAGGCTAGTATAGAGTTAGAGCAAAAAAAAAAAAAAAAAA
AAAAAAA

>gi|77118348|ref|NC_007447.1| Breda virus, complete genome
TGACGTATCTTTAGTTGATTTTGAAGCCTTGAAATAAAGCTTTTAAAAACCCCTTTTGGTTTGCCCACCA
TACGGGCAGTTTTCAGACCGCAGTGTCTTGTCAGGGAGGTCCAGCCTTGACTTTACTTCTCCGTGAGGAA
TCTACTCAGAAAAACTGCTTGCGTACTAGTAGTTACAAGGGTTATCACCTAGTACTTACAAGCGGGTCAA
ACCGCCCTCCGGAACGGTCATAACCCCCTCCCGAACGTGCGCTTGACGTGACTGGTCTTTCAGTCTAGCT
TTCTGAGAAATACTCCGGGGTTGTAACCCACCATTTTGACCTTTGGTCAGTTTGGTAACACTCCAACCAA
ACAGCATCTGACCCACCTCCAGCTTGCTGCAGGCCATTTGGACTAAACGGGTTCAGATATCTTGTGGCTA
AACCTCTGACCCACCTCCAGTTTACTGCAGGCCTTTTGGACTAAACGGGTTCAGACTCTTTGTGGTTAGT
TTTTAACTACCCACTGTTTAGCCGCCAACCTGATTTTTATTGTTACAAAATTTTGTGTTTACACATTATT
TTCTTACGGTTGGCAGTTTGTTTGGTTGTTTGCACAGTTTTTGCTGATACCAATTTTTACTGTGCTTTTG
GTGTTTTCGGCTAAGGCTGTTTTTCACATACTTAGTTTGCTTGAAGTAACCTTCACAACATCTGTTTTGT
TTTTGGTTTCTAAGGTAAAGAGTTTCAGGAAAAAACATAGGCGCCCATCTTGTGGTGTCTAGTTTTAATT
AATCTGGCAAACAAGTATCAAGTCATCGACTCCCTTTGGAGTGAGACTTACGAGTACCAATTCGCCTATT
TTGGCCATCCATATAAAAATGTCCAAGACCTCAAGAGAGCTCACCAACGAAACCGAGCTGCATTTGTGCT
CAAGTACCTTGGACCTAATTTCCAAGTCCCAGCTTTTGGCCCAGTGTTTAGGTACACCACAAAATCTGGT
ATCTCTTTCAAAGATGGTTCCATCTATCTTGGAGTCACCGACTTTGGAACCCAGATACACATCAACCCAC
TCCAGCTCTTTACAAAGTTTGCAATTACTTGCCCTGAACACCTCATCCACCCTGTACAAATGGACTACAG
GGTCTATCTCGAAACTGAGGGGTCATTTGGAGAGAGAATTGTGCAGGGGGTTAGTTCCTTTGAACGATTT
TATCCCAAAAGGCAACTATGTGGAGTTATCATTGATGATCCCTTCAGTTTTGACTGGGCAGGGAACATCC
ACAACTACTACTTTACAAGAAATGTGCTCAGATATGGTACAAAGTTGTATCAAGTCAATGGAAACAGACT
TATTGAAAGGAGTTCTGGCATTGAAAGATCAGACGTCTTGCCAAGAATACTTTCTGAGTGCCAACTACCA
ATCCTTGATACCACCCCAACCCCTAGTGAATGCGATGAGGATGTCATCTGTTGTGGATTTGAGTCCCTTG
ATATTAGAGAATACCCGGCTCTTGCTGAAACTCAGCCCTTTCCATGGCGGCACTTCAGTCAGTTACACCT
CAATGATTAGGGAGTTTGTGGATTGTTCTAGACGGGATGAAAAATGTCTTAAGCGCCGTCTAACAAAGAA
GCAAAAGAGGCAGGAAGAAGGTAGTTTTGATGCTAACAAGGTTATAACACTTGGTGGTAAAATGTATCGT
TACCGGGTGGTTATATTGAAATGTAGTGATGAGGTTGATGATTTAATTGGCTTTGATGGTAAAGTTGGAG
AATTTGATTATAATTTTGAGAATGTACCACATTGTTGGAGGGACCTTGTTAAAAGAAGGTGTCTTATTCG
GGCAAAGGCCACTTGGAATCTTGCTGGGGGTGTTGATGAGAATTTGGACCATGTCTACATAGATGAAAGC
CAGCRGGATTTTCGGTGTGCTGATGGAAGCTCGGATTCACCTAGTGCATGTGTTGAGGACCCTCATTTGG
AAGAAAGAATTTTTTCTCGTGTGTGGTTAAAACAGACATCTAGGTTTTTTGGTACAAAGATACAACAGGT
GTCCGAGTTGTTCAAGAGCATTGGGTTGCCTGAACTTGAAACTACATATTGTGGTGTTAATCCAGTAAAA
GTAGGTAATAAGTGGCTTAGTTTTAGAGATCAAGGTAGATCAAGAGTATTTTTTGTTTATACTGATAGTA
ATGTATATTTAGCCACAACACGTCAAAAAGTTTGTTGTGACTACATTTTAACTAAATTTAAGAGTGTTAA
ATGGATTGGCAATAAGCCTGATCAGTGTAGAGTTGTAAAAGTGTTAGCATGGTTGATTTCTGTAAATAAG
GTTAAAAATTGTACAAGAGTTATTACACCAATGTTGACTGTTCAGGGTAAGATTAGTCATAGAAGAGTTG
ATTATTTGGATATAAGTGTTTTAGATAGTTATGTAAGTGATACCGCTGGTTTAAATTGTGTACAGAAGGT
TAAAAAGTTTTTATCAATGTATTATAATTGTGGTGCTGATTTGGGTTTGCTAGATAAYTTTTTAACACCT
ATAGAGTGTGGCACTAAGCAGCTGGTTTTTGAAAGATGTAATTGTCCAAACCATCAGTTCTATGTAGCTC
AATTTGACAATCATGTGGTTTTAGGTTTGGGTAGGCCTACAGGAGTTGTATATCCGGAAGAAATACCAAG
TTGTGCAAACATTTATGCTGTGGGTTTTGCAACTCAGAAAAGGGTTGTTGAAGTTCATTATTATTCTGAA
ATGGATCGTCATCAGCTGCCTCAGGACTACTACTATTTTGCTTATGATCAAGAATTTCAGCATGTTGGTG
GTGATGATTATGTTAATCACCACCTAGATGATGTTGAAGATCAACCATTCCCACCTGTATTGTTTGATGA
TGTCTATGATAGTGGTGACTCTTTAGATGATGGTGGAAGTGATTTAGATTGTTTTGATGTTGGTTATGAT
TTTTTYTGGCCTGAGGCACCCATACCTGTACCATCACCTTATGGTTATTATCAGGGTCAACGATTGAGGG
ATTTGTGTGTTGCAGGAGGTGATTTTGGCTGTGATTGCCCTCGTTGTGATGGCACATTTATTTATCATCC
ATTCAGACCACGACACTACCATTCCTTTGATGAGGTTGGTCCATTTATTCAGATGTGTGAATTTACACTA
ACATATTCAGGACAAAATTACAACTTATTTTATGGTTTAGAACCCAAAGTTTGTCTTCAAGATTTGGTGG
AAGCAAGTGATAAACTCTTACAGTTATTGGTGAGGGGACAGTTGGAAAATATATCACTGCCAAATGATAT
TTTAGCATGTTTATCAAGTTTGAAGTTGGGGGCTAATATCCACCCCTTCTTGTGGCCAGCACCGTTTTTT
AATGCTAATGGTGAGTGGGTTGACATTTTTGGTGGTGGTGACTTTACAGTGTTTGGTGAGGATTTCTGCT
TAAAGGCCAAGTCTATGGTTGAAAGTGTGTATTTTTTAGTTGAAAATTTCTTTTCTGTGGATTGTCCTAT
TGGGAATTTATATTGTAATTTGCATCTTGATGGTGATGTTAAGAAGATGCTTTGGTCAACAATTCATATG
AAGTATATTTATTTAGCTTTAATACATAGTGAAAAAGTTTTTAATATTATCTTAAATAGTAGACAATTAA
GCCATCAAGAGTTAGTTAAGCTGGTTATAATAGGTACCTTTGATGTTTCTATAGTTGCACCCTGTGCTTG
TAGTGGTGATTGTAATCATGGTAAGGTATATAATTGGACAAATCTTCTTAGTAGTGTTTATAGATTTGTA
ACATTAGACCAGTTGGTGGGGCTGTCATATTGTGAGAAAAGGTCACTAGTCCTTAGAAAGGTTCAGCAGT
ACCTTGAGGTTGAAGAGGGGTACCAACGGCCAGTACAGCTGTTGATGGCACCATTTTATGGTTTTAATGA
TAATGCCGAACCTGATGAACAGCCCTTGACTGGTGTTTTTCACCAACAGGTAATGCAAATGTTTGATACA
TGTGTGATGTTAGATGTTATTTGTGGCCTAAAGCGGCCAAGAGCATCAGTGTATAACCTCTTTGGTGTGT
TGGCAGATTATTTTAGGAGACCATTTACCTTCCGGTATTATCAAGTGGCTGAGTTTTCGGGCTCAGAATC
CACTCAGGTTTTTACAGATGTAACTTCTGCATTGACATCTAAAGACCCCTGCTCTAATCGCCCCTACATT
TATCACGATTACGCAGTTTGTAGGGTTGTGGAGCCTAGGACAGCCGCTGTAACAACTAGGGGGGCCATAT
ACCCACCAGAGGTCATAGAGATGATCCGTAGTTATTTACCAATTGAGTTTGATGTAGGTGTTATGAATTA
TGTTGATGGTAATTGTGATTTTAAATATTGCAATTTAGAGTTTTGCCTTAGTGGTAGAGGTTTGGTTAAG
TTGGATACTGGTGAGTTGTTAGATTATAAGACTAATTTGTTTGTTGTTAGGTACAAAACATTACCCTTGC
TATATGTTACTAGTAATCCTATTTATTTGAGTGATTTTAGTTTAGATAATGCTGTTTGTCTTACAGGTGA
TTTTAAGTTAAGTTTTGATGTTGAGCCTGGTAGTACACTCTTTGGCCTCTATTTTACTAATGGTAGGTGT
TATAGAGATGTTTGGGAAACTTTACCACGCTTTGGACTTGGTACCCTATCCCCTCCTAAGTGTCATTCTA
AGTGTGAACCTTTTGAGAATTTGGCAGAGGTGTTTTTTTTCAAGCGTAGGGTCCAGCTTGTTCCATTGGT
AAATAATTATACTCCAGTTTTTAGGCATAGGCCAGACATCCCTAAAGTTTTGACAGTTGAATTGATGCCC
TACTACTCATCTATAGGGTACCAAGGCTTTGTAGCCCCCAAATGTGTTTTGCCTGGATGTGTGGCCACTC
AGTATTGTAAGTTGAGACATCAATTGGATAGATGTGTTCAGGTTACCAAGTTAGCAGTTGCATATGCATT
TTATTTTAAACCACTTAACATAGGCTCACTTTACCATTTAGATCCTATGAGAGGTACTAGTTATGGTAAG
CCAGCTGTGGTACAGTTTGAACCCGTTGGGTTGATAAAGGAAGTTAATATACTTGTCTATCAGTTTGGTA
AACATGTTGCCATACATTATTTCCCAGAATGTCCCACATATGTAGCCTATGGACACTACCCAAGTCATTC
TGTGGGTGTGTGGTTGGGTTACCTACCCTCGGTTGAAGAGTGTGTTATTGCACAACGCAATTATAGGGTA
TATGTTCCCACATGCTTTAGGCTCTCACGTACTGGTTGCTATCATATTCAACAGGATGAAGATTTTGAAA
GAACACATATTACAGTGAGTTACCATTATGCTAGAGATTTTGACACAAAGTCTTTAACACCTATGTTTCA
GATGTTTAGTAAAATTTTTGGTAAGTCAAAACAAGATCTTATTTGTGCATTAAATTCTTTAAGTGAAGAG
TCACAGAGTGTTTTAACATTATTTTGTGAGGAGTTTGATTCAGCCTACACCTTGCAAACAATATCTGATG
AGGTTTCATTTGAAACATCCACTAGTCCAGAATTGGTAGCGTGTGTGTTGGCTTATGCAATTGGTTATGA
GCTTTGCTTAACTGTTAAGACTGATGGTGAGTGTGAAAGTTTAGATGTTGGTTCAAGTTTGGAACAGGTT
TATGTTGATTATGATGTAAGCAAAAATGTTTGGGACCTGTCAACTCACCTGCAAGATGATAGTTCTGATG
ATTTGGAGTTACCATTTAATCAATATTATGAGTTTAAGGTAGGTAGGGCTTCAGTTGTTTTAGTTCAAGA
TGATTTTAAGAGTGTTTATGATTTTTTGAAGAGTGAGCAAGGTGTTGATTATGTTGTTAACCCTGCCAAT
AATCAATTAAAGCATGGTGGAGGTATTGCTAAGGTTATCTCATGTATGTGTGGCCCGAAGTTGACAAGTT
GGTCAAATAATTATATAAAACAATATAAAAAGTTGGGTGTAACTTGTGCTATTAGGTCTCCAGGTTTTCA
GTTGGGGAAGGGTGTCCAAATTATACATGTTGTAGGTCCCAAGAGTGCAGATTCTGATGTTGTAAATAAA
CTTGAAGCATCTTGGCGTAGTGTTTTTCAAAATGTTAAGCCTGACACCACTGTCCTTACTTCAATGTTGT
CTACTGGTATATTTGGTTGTTCTGTTACAGACTCAGCTACTACATTGCTTAGTAATTTGGTAGATTTAGA
TAAAGATGTTGTAGTTTTTGTGGTTACTAATGTTTCTGATCAGTACATTGAGGCTTTGGGTGTTGTGGAG
AGTTTTCAAAGTGCACATGGTTTACCAAACTTTGGTAATACTTGTTGGTTTAATGCCTTGTATCAGCTTT
TAAAGAGTTTTGCTGTAAAAGAGCAGATTGTACAGGATTTGGTTAATTGTTTTGATGATTTTTATGAGTG
TCCAACTAGGCAATGTGTTGAGTGGGTGTGTGATCAATTGGGTGTAGTGTTTGGTGAACAGTATGATGCA
GTTGAGATGTTAGTTAAAATTTTTGATGTTTTTAAGTGTAATGTTAGAGTGGGCTATGATTGCTTAGCAC
GTCTACAACAGGTTGCTTTGGGGTCTTGTAGGGAGGTTCCAGCTGATGCTGTTCTTATGTTTTTTGGTCA
GGATAAGAGTGGACACTGGGTGGCAGCGCGTAAGGTATGTGGTGTTTGGTACACTTTTGATGATAAAGTG
GTTGTTAAGAAGGATCCTGACTGGTCTAAGGTTGTTTTGGTTTTGAGAGAGCGTGGTCTTTTCAAAGCAA
CTGATTTTGAAACACCCAGACCAAGGCGCCGTCGTGTTGCATATAGGGTGCCGCGGGATACTATTTCACA
GGATGCAATCATGTTTCTTGAGGAGAGGCAATTTTCGTCTGGTACGATGCTTGCCCATAGTTGTGTTGAG
AGTGTTGAAAGTTTTCATGTTGAGGGTGTTCAGCCCAGCCCACTTCAGAGTGTTGATGGTTTAGATGATG
TTGCTGACCTGAGTTGTGATAATCATGTTTGTGACAATAGTGATTTGCAAGAACCTCAGGTTGTAGTTAG
CCAGCCCAGTGAGGTGTTGACCACGAGCATGTCTATAGAGTGTCCAGTTTTAGAAAATTCTGAGTGTAGT
GTAGAGACTGATTTAAATCCTGTGTGTGAGGAGAATGAACAGGTTGGTGAGAGTGGCATTAAGGAACAAG
ATGGTGTAACCACATCTGACTCTCAACAGGTTTTTTCAAAAAGTTTAGACCCAATTATTAAACAACATGA
GGTAGAGAGTGTGGAGCCTCAGGATTTGCCAGTGTTTAGTCAACAGCCACAAGTTATGTTGTCTATGACA
TGGAGAGATGTACTCTTCCAACAGTATTTGGGTTTTAAATCTGATTTATTGAGTTTAACTCATGTAAATA
AATTTAAGATTGTAGTTTACCTTATGGTATTATGGTTTGTTTTGTTATATTGTTTTTCAGATTTTTCATT
GTTGAGTAGGTTTTGCTTATATGTCTTTTTGTTATGGTTAAGTCATGTTGTTTTAGTGGTCAAAAAGTTA
GATTTAGGTTTAGTTAATTCAGGTGGTGAGAGTTATGTACTTAGGATTTTAAGTAGTGTTAAGGTGCCCA
ATTGTATTGCTTTTAATTGTGATGGTGTTCATTGGTTAATTTTGAAGTTGTTATTTTATAGTTTTCATTT
CTATGACTTTTTTGTTAAGACTCTGGTTGTTGTTTTTCAAATGCCACAGTTAAGGTGCTTTACGTGGCCT
CTACTTAAGCTTGGCTTTGCCGATACATTTTTGAGTCACCATATCCTTGCATTTCCAACAAAGCAAGTTA
GTCAATCCTGTTTGCCTGTTTTTGGTGATGAGCGTAAGTACATTTACGTTCCATACTGGTGTAAGGAGTC
ATTTAGAACACTTGTTGCGCGGGCAAAACAGTTGACAGCAACAGGACGCACCAAAACTCTTGATAACTGG
CATTATCAGTGTTGCTCTAAAACTGTTAAACCAAGTTCATGCTTTAATGTTCGAGATTTTGTTTTTGATG
ATGCTTGTAATAACCATAAACATTATGGTTTCTTTTCTGCCCTTTGGTTTTATGTTGTTTTTTATAGTGG
TTTTGTTAGTTTTTGGTTACCTTTAATGTTTTGTTATTGTGCTTTGTTTATGTGTACTTTTAAAAATTTG
CCTGTAAATATCACAAGACCAATAAGGTGGACTGTGTTACAACAAGTTGTAGATGATTTATTGTCTATAA
TTACTAAACCACTTTTTGGGCGTCCTGCATGTCCCCCTCTTAGTGCCTATCTGACAGCAACGACAGCTGA
TGAGGCTGTGCGTGCATCAAGGTCCTTGCTAGGACGGTTTTGTACACCTGTGGGTTTTCAACAACCAATT
ATGAATGTTGAGAATGGTGTAGCTGTCTCAAGTTTAGGGTTTATTAACCCTCTTATGTGGCCCCTGTTTA
TTGTTGTTTTGCTTGATAATAGGTTTGTTTGGTTTTTTAATGTGTTAAGTTATATCATGTTACCAGTTTT
TGTGATTATACTTTTTTATTTTTATTTGAGGAAGATATGTGGTTGTGTTAATGTAAAGGGTGTTGTTAAG
AATTGTACAAGACATTTCCAGAATTTTTCTAAACCATTAGTCGCAGCGGGTGTGCATGGTAATAGGACAA
ACTTTACCTACCAGCCTATGCAGGAGAATTGGTGTGACCGTCACTCTTGGTATTGCCCTAAAGAGGAGCA
TTACATGACACCAGAGATGGCAATGTTTATTAAGAACTATTACAATTTGGCAACTTCACCAATGGCTGAC
ACAATTTGGTGTGATTATGTTAAATCTGTACCCAACATGACGTGGGCTAATTTTAAATTCTCATTGTTTA
AATCTAATGAGACAGTTATGTGTGGTCCGTCATCACATGCAGATTCAATGTTGTTGTCATGGTATGCTTT
CTTACATGGTATACGGTTTGCTGTGAATCCATCTGTTATAGATATACCATCCCAAACACAGCCTATATAT
GTGTCATCGGATAGTGATGATTCATTGGATAAAGGTTGTGATGTTAGTTTGAGGCCAACAAAGAACAAGG
GTAAGTTTAAGAAGCAGTCTGTTGCATACTTTTCAGCTGGACCTGTGGACTTGTGGTACTATGTTATGCT
CATTATAGCGTTGGGAGCAATTTTTGTGTTTATGTATAGTTGTTTTATGGTAGGACAGTATGTTGTTATG
CCAAGAGATAAGTTTTTTGGTGTTAATCCTACTGGATACTCATATGTTAATGCACAGCCATATTTACATG
CTAGTCCACCTGTTTTGAGAAATAGTGATGGAATGGTTTTGGCAACACCATTGAAAGTTCCATCTATTTC
TTATTCTGTTTATCGTCTACTGAGTGGTCACCTTTATTTTACTAAACTTATCGTAGCTGAAAATGAGTGC
ACACCACCTTTTGGTGCAGMTAGACTGTCACATGAGTTTACTTGTAATGATTTTACCTACATCTTACCAG
CCCACTTAAGAATTTTTGGTCGTTATATTATGTTAATACACCCAGACCAGCTACATATGTTGCCCTTTGA
GGTTGAGCATTCAACGCATACACGACTCTGTTATGTTACTGGGACTAATATTGTTGAGTGCTTACCAACA
TTTGAAATAATTTCACCATATGTTTTTGTAGTTTTAGTTGCTATATTTACTATAGTGTTTTTATTTTTAC
TTAGAATGTATATAGTGATGTATAGTTACTTTAAAGTTTTTACATATGTAGTTTTTAAGTTGTTATTTGT
GAATACTGTTATGGTCCTGTTTGTTGTTTGTTTACCACCCCTAGTTCCTGGTGTTGTTTTTGTTTTGGCG
CTTTGGTTGTGTGATAGTGTAGTGTTTTTGCTGTATTTGGCAGTTTTGAGTTTGTTTATTTTACCTTGGT
TCTATGTGATGCTTTTTGTGTTGATAGTTGGTGGATTTGTTTTTTGGTGGATGATGAAGTCCTCTGATGT
AGTGCATTTGACACCGGATGGGTTGACTTTTAATGGTACCTTTGAACAAGTTTCTAAGTGTGTATTTCCT
TTAAACCCTTTGATTGTTAATCGTCTCTTGCTAGATTGTCGGATGTCACATTCAGACTTGGTAGAAAAGT
CCAAGCTTAAAACAACTGAAGGAAAGCTTGCTACTGAGATGATGAAAGTTTTTATGACAGGTGAAACAGC
ATACTACCAGCCTTCAAACTTCAGTTTTCAGAGTGTTTTCTCAAAGGTTGTGTCACCCTTTACCCTACAT
GCTAGACCACCTATGCCCATGTTCAGATTGTATGTCTATTTTAATGGGCAGTGTGTTGGAACAACGTGCA
CAGGTACTGGCTTTGCTATAGATGATAGCACGATTGTAACTGCTAAACATCTTTTTGAGTGTGATGACCT
TAAACCAACACATTTGTCTGTTGAGTTATCATGTAGATCTTATTGGTGCACGTGGAAGGAACCTAATGTT
TTATCATGGAAGTTTGAGGGTGAGAATGCCTATATTTCTGTTGAAAATTTGAGAGATTTCTATGGTATAG
ATTTTAAGTATTTACCATTTCAGCAAATTGAATGTGAATTTTACAAACGTATGGAGGCAGTGACTATATA
TTCAATTAAGTATGGTAGTGAGTTTGCAACTCAAGCTTGGCAAACTGTTAATGGTCATTTTGTTTGTTGT
AATACAGAAGGTGGTGATTCCGGTGCTCCCTTGGTTTGGCGCGATTCTGTAATTGGTGTGCATCAGGGTC
TTTGTGATAGTTTTAAAACCACCTTGGCATCTGATAGTAAGGGTGTTATGATGACAGAGGTAAAGGGTTA
CCATGTTGACCCACCCGTCTATTATAAGCCTATTATTATGTCGGCGGCTTATAATAAGTTTGTTGCTGAT
AGTGATGTTAGTGTGGGTGAGTGTACTAATTATCATAATTTTGTTAATGAGGATTTTTTTTCGATGCATG
ATGAGTTAGAAAAGGTTTCATTTGGTGATAAGATGTTTAGGTATTGTCAAAGTTTACCCAGATATTTAGA
ACCCCTTCATTACTTTCATGTACCCTCATTTTGGCAGCCGTTTAAGAAGCAGTCTGTTTCGTCTAATGTT
TCCTGGGTGGTGGAGAATTTACATTTTATTTTTAGTGTTTATTTTCTTGTTTGTGATTTTGTGGCATATT
GGTGGCTTGATGATCCCTTTAGTGTTGTATTGCCTTTATTTTTTGTTGTACAGCTTTTGAGTACGGTTGT
TTTGAAGAATGTTTTGTTTTGGAATACAAGTTATTTGGTTACTTTGGCAGTGACATTTTATGTGCATTCT
GAGGTGGCTGAATCCATGTATCTTCTTGGTTTGTTTTCTGATCAAATAGTTAATCGTGTTGGTTTAATTT
TGGTAGTATCTGTTATGTGTCTTTTTGTTGTTGTTCGTGTGGTTGTTAATGTCAAGCGTGCAATTTTTGT
TGTGGTTGTTAGTGTTTTGTTGATTGTGGTAAATGTTGTGCTGGGTGTTGTGCAGTTTAATAGTCTTGTG
GCAGTTTGTATGTTTGATATTTATGCTGTCTTTGCAGCATTGTTAACACCTCAGCCTGTGGTAGCAATAA
TGATGCTTATTTTGTTTGATACAAAGTGTTTAATGTCATTTGCCTTTGTTGTTATTGTATTGAGTTTTAG
GGTTTTTAAGAATTATAAGTTTGTTAGGGTTTTGCATAATCTTTGTAATTTTGATTTTGTTTTGACTCAG
CTTTCATTGTTTCGTTACCGCCACCATAACCAAGGTAATAACCCATCACATTATGAAGCATTGTGGTTGT
TTTTGAAGGAATTGTATTATGGTGTACAGGATGTAAAGTATGAAGTCTTTTCACCACAGGCTGGTACATA
TAATGTTAGATTTTTGACTGACATGACTGAACAGGACCAATTGGAAGCTGTTGAGCAAGTGCAGCGCCGT
TTACAGCGCTTTAGTATTGTACAGGATAAAAATTCCCAGAGGCTTGTGCTTTATTCTAAGAATGTTGATT
TTCTTAGATCACAAATACAACACCAGCGTGTATTGGGTGCTAATCCATTTATTATAACAACTTTGACACC
TAAAGATATTGCAATAGATAATGTTGAGGTCCATAACCCATCACAATTTAAACCTGAAGATTTGCAGGCT
CATATGTGGTTTTATTCAAAGTCTCCTATATTTGTTGGCCAAGTTCCCATACCTACTAATGTGCAGACTG
CAGCTGTGTTAGATACAACATATAATTGTCAAGACCTAACTGCGGATGAAAAGAATAATGTTGCTGCTAA
TTTACAAATACAGAATGCAGCATTGACTTTGTCACTATTTGAAGAGTGTAACAGGTTTCTTGAGAGTGAG
TTGGGTGATGTTCCTACTCTAATGTGGCAGTCTGAGGATGTTGTTGATGTTAAACAACTTGAGGTGCAGA
TAGAAAAGCTTCGTGTTGTCTTGGATGGCATGCAGTTGGGTACTAGTGAGTACAAAGCAACGCGTAAACA
AATTAATATATTACAGAGTCAGTTGGATAAAGCTCTTGCATTTGAGAGGAAGCTTGCTAAATTTTTAGAA
AAAGTTGATCAGCAACAGGCTATTACAAATGAAACAGCAAAACAACTATCTGCATTTAAAAACTTAGTTA
AACAAGTTTATGAAAGTTATATGTCATCTCTGAAGGTAAGAGTTGTTGAGTCAAATGATGCATCATGCCT
ATTGACATCCACTGATTTACCACGGAAACTTGTACTTATGAGACCTATAACAGGATTGGATAATATTAAG
ATTGTTGAGAAAGCAAATGGTTGTGAAATTACAGCTTTTGGTGACACGTTTACTACTGGATTAGGTAGTA
ACCTTGCCGGTTTGGCGTATTCATCAACTCAACCATTATCAGCTTACCCTTTTATATTTAATCTTGAGGG
CATATTTAAACAGCAAGCTAATATTGGCTATAAGACCGTTGAGTGTAATATGTCATCTGACAACGGTAGT
GTGCTCTATAAGGGTAAGATTGTTGCTGTACCATCAGAAGATAATCCTGATTTTGTTGTGTGTGGTAAGG
GTTATAAGCTTGATTGTGGTATTAATGTACTTATGATACCATCAATAGTTCGTTATATAACCTTAAATTT
GACTGACCATTTACAGAGACAGAGTTTGAAACCAAGACGACGGTTGCAGTATAAACAACAAGGAGTTAGA
CTTGGTGGTGTTAATCTTGGAGAACATCAAGCATTTTCAAATGAGTTAATTTCATCTGTCGGTTATACAA
CATGGGTTTCATCTACTGTTTGTACCGACAAATCCCACAAGCATCCCTGGTTTGTGCAGATACCAAGTAG
TGAAAAAGATCCAGAGTGGTTTATGCATAATACTCAAGTTAAGAATAATCAGTGGGTAGTTGATGCTAAA
CCTACACATTGGCTTGTTGATGCAGATACAAATGAACAGCTATTTGCTTTGGCACTCACAGATGAGGAAT
ATTTGAAAGCTGAATCTATTCTTGCTAAGTGGTCACCAATAACCCAGGATGTTGAGTGTTGGTTTAAGGA
TTTGAGGGGGTATTATACTGTGAGTGGCCTTCAACCATTATGGCCTGTTTGTCCAAAAAAAATTTGTAGT
TTAAAGATTGTGCCAATTTTTCAGTCTCAGTCAGTGGCTTATGCTGATGAACCTACACATTTTCTTTCTT
TACCTGTTGTAAATAAAAATTTTCTTGAGGCTTTTTATGAGTTACAAGAGGGCTTTCCTGGGGAGAAACA
GGTGGCCCCCCATATTAGTTTGACCATGCTTAAATTGACTGAAGAGGATGTGGCGAAGGTTGAAGATATT
CTTGATGAGATGGTATTGCCCAACACTTACGCCACTATTACCAACCCACATATGATGGGACAATATTATG
TGTTTGAAGTAGAAGGTCTTCAGGCTCTTCATGATGAAGTAGTTTCTGTTTTGAGACAGCATGGCATAGC
CTGTGATCAGACAAGAATGTGGAAGCCTCATTTAACTATAGGTGAAATTAAAGATGGTAGTGTGTTTAAT
AAATTTAAAGATTTTGGAATTACTTGTAAGTTAGAAGATTGTGATTTTGTTAAGTTAGGGGCACCAAAAG
CAAATGCTCGTTATGAGTTCATTGCTACACTTCCTGTTGGTGATTTAAACTGCTGAGAGATGTCTGGTGC
GCCTGCAGACATCTCTGTTTTCAAAATGGCGCGTATCAGTCGTCACGATCTAAGCATTATATTGATTTGG
CGACTGAGTACAACGCAGGCATTGTTAAGGTTAATAAATCTAATACTCACTCTGTAGAATACAAGGGCCA
AAGGTTTATGATTAAACGTGTTAAAGATCAACATGAATTTGCCCTTGCAAGGACTGCGTTTTTACCATCA
ATAATACCTCACCATATGGTACATCAAAATGGTGAGTGGTTTTTGGTGCGCGGTCCTACAACACAATGGA
GTCTGGGTGACCTTGTCTATGCCATTTGGCTTGGTGACCAGGCGTATCTTGATGAATGTGGTTTTGTTTT
TAATCCATCCAGAGATGAGTTTCTTGACGATGCCAATCAGAGATCTTATTTGGCAAATTTGCTTGAGCCT
GCTATTTTGAGTTTTTGTGAGATTTTTCATTGTGTGAAAGGTTGTCAAGTGCCATATAAAATAACATTGG
ATAATTTGGATTTAAAAGGACAACTTTATGATTTTGGAGATTATCCGTGTCCTAATAAGGTAGATAATCA
GTCTGCCTTGTTTGTTTTGGCTGAAGTTTGGTCTATGACACGTAAACCTTTTCCAACCAAGTTTGCACAA
GTACTTGCAAAAGAGATGAATGTTCCTGCTGACTTTCAAATGTATTTCCAGCACACACTTTTGTCAGGCA
AGTATTTTGATAAGGCAATGTGTTTAAATAATGTTAGACCACTCTTGAGGGATCCAGCCAATTTAACAAC
AACACCTTTTTTTTCACAACATAGTGGTGTATGGACACATTTTTATAATCCAATATATGGCCTTGTTGAA
TGTGATTTGGAGGAGTTTTCTAATCTGCCCGAAGTTTTACAGCAGCTTATTACTGTGCAGGGACCTATAA
CCAGTGCCATGACACCTGCCATTTCCATTGGTGAGGGTGTGTATGCAGCTAATGTGCCACCTGTTGCTGC
AGCAAAACAAAAGATACCCCTCTATGATGTTGGCTTGTGCCAAGAACTTACTGATGCGGGTGTGGACTGT
GGGGAGGCATTTAAGTATTTTTACTATTTGTCAAATCCTGCAGGGGCACTTGCTGATGTTTGTTTTTATG
ATTATCAGGGCACTGGATTTTATTCACCTAAATTGCTTGCTGGAGTTTATGATTTTATGAAAAGGGTAAC
AACTTGTTATAAAACTGATGAGAGGTTTACTTATGAGCAAGCAAAACCAAGAAAGTCATCTATGGGCATT
AATATTACAGGTTATCAACAAGATGCAGTTTATCGTGCCTTAGGTCCTGAAAATATTACTAAATTGTTTG
AGTATGCACAGAAAGCTCCATTGCCATTTTGTACTAAGATTATAACAAAGTTTGCATTGTCAGCAAAAGC
AAGAGCTAGAACAGTGTCATCATGCTCCTTTATAGCATCAACCATTTTTAGATTTGCACATAAACCAGTA
ACATCCAAAATGGTAGAAGTTGCACAAAATTCACAAGGATTTTGTCTTATAGGTGTTTCCAAGTATGGTT
TGAAATTTTCCAAGTTTCTTAAGGACAAGTATGGTGCTATTGAACAATTTGATGTTTTTGGGAGTGATTA
TACCAAGTGTGATCGAACATTTCCCTTGTCCTTTAGAGCATTGACAGCTGCCTTACTTTATGAACTTGGA
GGTTGGGAGGAAGATTCTTGGTTGTACCTAAATGAGGTGAATTCCTATATGTTGGATACAATGCTTTGTG
ATGGCATGCTGTTGAATAAACCCGGAGGGACATCCTCAGGTGATGCCACAACTGCACACTCTAATACATT
TTATAATTATATGGTGCATTATGTAGTAGCTTTTAAGACAATTTTATCAGATTTGTCTGACTGCAACAAG
GTTATGAGAATAGCTGCTCATAACGCCTATACTACGGGTGATTATGGCGTTTTTAACACCTTGCTTGAAG
AACAGTTTCAGACGAATTATTTTTTAAATTTTTTGTCTGATGATTCGTTTATATTCTCAAAGCCTGGTGC
ATTGAAAATATTTACTTGTGAAAATTTTTCAAATAAGTTGCAGACCATTCTGCATACTAAAGTCGACCTA
ACAAAATCATGGGCGACAACTGGTCATATTGAAGAGTTTTGTTCTGCACATATAATTAAAACTGATGGAG
AATACCACTTTTTACCATCTCGTGGTAGGTTGTTAGCATCTCTGCTGATATTGGACAAACTTTCAGATGT
AGATATTTACTACATGAGATTTGTTGCAATTCTTTGTGAGTCGGCAGTCTATTCTAGATATCAACCAGAG
TTCTTTAATGGCTTGTTTCAAGTGTTCTTAGATAAAGTGCAGCAATTTAGGAAGGACTACTGTTGTGATC
CGTGTCCTACTCAACTTCTTGATCGCCAGTTCTATGAGAACTTGGTATTTACATCGAATACAGAAGTTGG
ATTGGTTGATTGCTATTTAGAAAATTTTAAGTTGCAATGTGAGTTTAAACAACAGGCAGGGTTTGATAGA
GTGTGTTTTTGTTGTCCGAATCCAGCAGTTTCTGTTTGTGAGGAGTGTTACGTGCCCCTGCCCCTTTGTG
CTTATTGTTATTATGTACATGTTGTAATTAGCAGTCATTGTAAAATAGAAGATAAGTTTAAGTGTCCTTG
TGGGCAAGATGATATAAGAGAATTATTTATAGTGTTAAATAATAGTATTTGTATATATCAGTGTAGAAGT
TGTGTTGAAAGTGATAGATTAAGGATTAGTTTGTTAAGTGATGTTGATCAAGTTGTGAGATTGCCCGGCT
TTAAAGCAAACTCAGCCTCCATTGCAAAGAATGGAGTTGCTCAACTTTTAACACCTGTTGATAATGTTGA
TGTGTCTTTGGATTGGAACCATCAAGAAACTGTTCAACAGAATGTTGCAAGGATTGTCTACCATTCTGCA
AATATGACACAAATGTCAATTGAGGTTGTTTATGTAAATTTTAGTCTTGTGCGGAATGATGGGTCATCAG
CAATTTTAGACATTCCTAATTTTAAATGTCCCGACACATCTTATTGTCTTTTTTACAAGCCGGGCAAGAC
AGGTGTCCTGAAGTTTACAGGGAAGGGGACTTTAACGTCGTGTTATGATAGCAATAATTTAACCTGGTTT
AAGGTCACTTGCCCAGATTTTAATCAACCATGGAGACTTGCAACATGTTTTGTTATTCAGCAGCATGATG
CAGTTTACCCACCAATAAAGTCAACACAGTATGAGAATGTTACCTTTGTTATGGGACCACCTGGAACAGG
AAAGACTACATTTGTTTATAATACTTATTTGTCAAAGGCATCTCCATCCAACCGCTTCGTCTATTGTGCA
CCAACTCATAGACTTGTAGGTGATATGGATGAGAAAGTTGATGGTGCCGTTGTTGTGTCAGCTTATAATG
ATAGGACATACCGTAATCCAGTTTGGAAGAAAGACGATTCTTATGATGTCCTACTCTGCACACATAATAC
ATTGCCTTTTATTAAGAGTGCTGTTCTGATTGTTGATGAAGTTTCCCTTATACCACCACATGTGATGATT
AAAATTTTGTCCATGGGTTTTAAAAAAGTTGTTCTTTTGGGAGATCCATTTCAGCTAAGTCCAGTTTATA
AAAATCATAAAGTGCATTTTAAGTATGATACTTTTTATTTATTACAGCTTGCTACTCAAAAGCGGTATTT
GACAGCATGTTACCGCTGCCCACCACAGATTTTGAGTGCATTTTCGAAACCATATTGTGATGTTGGTGTT
GATTTGGTTTCATTTAATAATAAGCCTGGAAAGTTTGATATTATAGTTAGCAAACAATTAGCCAACATGC
AGGACTTTAGTGTGTTATCTGTCCTGTCAAAGGAGTATCCAGGTTATGTAATTCTTGTGAATTACAGAGC
AGCTGTTGATTATGCAATGCAGAATGGACTTGGTGATGTAACTACAATTGATTCCTCCCAGGGGACTACT
GCTGCTAACCATCTCTTAGTGTTGTTTGGGGCATCTAATTTTTCTAAGACTATTAACCGTGTTATTGTCG
GTTGCTCACGATCAACAACCCATTTAGTAGTGGTTTGTTGCCCAGAATTGTATAAACACTTCCAGCCAAT
ACTTAACTGGCCAGAACCAGTTTATAGGTATTTTGGCATGGAGAAACAGTCTGATTTTAATATAATACCA
GAAGTAGCATCCCTGGTCTTTTGTGATATTGAGTTTTGGCATTATAAAGCAGACCCAAACTCAAAAACCC
GCACTGTTTACCCTGGGCAGATTGCTGTAGTAACATCACAGACTTTACAACTATATCTTGGTGTCTTCGA
TGATGCTGGTTATAAATCGGCTCTTCGAGGGTTGCCTAAGGATGTGTTTGTACCACCTAATTGGGTTTGG
ATGAGAAAGCATTATCCATCATTTGAACAACATGCTTATAATATGCAGCGGTTATTTAAGTTTATAATTG
ATACAACTTGTGGACAGCCTTGGTTTATTTTGTATAGTTGTAGTAATGATTTGAAAAGTTTAAAATTTTA
TGTAGAGTTTGGCACTAATTATTTTTGTAGTTGTGGTGAGTTAGCCATTTGCCTAATGCGCGATGGCTTG
TATAAATGTAGAAATTGTTATGGTAATATGTCAATAAGTAAGTTAGTTAATTGTAAATATTTAGATGTAC
AAAAGGAAAGGATTAAGTTACAAGATGCCCACGATGCTATTTGTCAACAATTTCATGGTGACTCCCATGA
GGCATTGTGTGATGCAGTTATGACAAAATGTCTGTATTTGGCAAGCTATGACGCTGCATTTAAGGACACA
ATACATGTTAAGTATAAAGATCTTTGTTTGGAAATACAGTATAAAATAACAAGTCCTTATGTCAGATATG
ATGGCGTAAATAAACGCTATTTGTATCGTGACCATGGAGCCATGCACTATTTTAAAACACCTAAGTCTCC
TATGCAGAATGTGTATAGGTATGAGGTTGGTGCTCACACAGAGTATAGCATCAACATTTGTAATAGTTAT
GAGGGGTGTCAGTCCTTTGGAAAGACTTGTACTAAATGTATTCACATTCATTGCATTGTTGAGCAGTTTA
TGGCTGATGATAGGTATAGGGACTTTATTCTTGTGTCCGTTGTAAAATCTGATTTTGTTGAACAGGCATT
GTCACCTGCAGCAAAAGCTTTGATGTTAACGGTTACTAGGGTTGAGGGTAAGAGTTTTTACACCTCTAAT
GGACAGCGCTATGACTTATATGACTATGACTTGAGTAAGTCGGTTATGCGAGTTGTAGGTGCAAGTGTGA
AACCCCTCCCTTTGTATTCCGTTGTTGTGGGCTTAGGTATTAACTGTACTGTTGGTTGTGTATTACCAAA
TGTGCCAATGAAGTTAAAGGATGAGTTGTTAAGTACCGATGTACCACTTTCCACTTTAAGGCTTGACTTG
CCTACATGGTACTATGTTACCTGGCCCACATTAAGTAATAGAACCTCCCGCTGGAAGTTAGCTGGTGCTC
AAGTTTATGATTGTTCTGTGCATATTTATGTTGAGGCTACAGGAGAACAGCCGTTGTATTATTTACAGCT
TGGCAATGGTGAAAGCCTCCGAGAGCTACCTGAAACTTTGTTTTCTACTGGCAGACTCTACAACTTGGAA
CATGATCCGTCTAAGAATTTTAATGTGCAACAGTTAGCCATTGAGACAATACCTAAGAACCACCATGTCT
TTGCAGGAGATTTTACAGATGTTGGAACAGACATAGGTGGAGTGCATCATGTTGTTGCACTAAATGGCTA
TAAAGGTAGTATAATACCCAATTATGTAAAGCCAATTGCAACAGGCTTGATAAATGTTGGGAGATCTGTT
AAGAGAACTACTTTAGTTGATGTTTGTGCCAACCAGCTGTATGAGAAGGTGAAACAGCAAATAGCGGGTG
TAAAAGTGAGTAAAGTTATTTTTGTAAATATTGATTTTCAAGAGGTTCAGTTTATGGTATTTGCCAAGGG
CGAGGACGATATACAGACCTTTTATCCTCAAAAAGAGTTTATAAGGTCGTATTATGAATGGCCAACCATT
TTACCAGAACTGGAATCCCATTATGACCTTAAGAATTATGGTCAAGACCCCCAGTTTATGCCTCAACCTG
TGAATTTTGCAAAATATACACAGATTTGCACCTTTATTCAAGAACATGTTAAGGTTGCAAGAAATTCTTT
AATATGGCATGTTGGTGCGGCAGGGATTGATGGCTGTTCGCCTGGTGATATTGTGCTGTCCTCTTTTTTT
AAAGAATGTTTGGTTTATAGTTGGGATGTTAAGGATTATGATACATTGTTGGAAAAGCATAATTATGATT
GTAATTTTAGACCCAATTTAATAGTTAGTGATGTTTATAATGTAAGTAGTAATGTGAGTGAAGTGTTAGA
AGATTGTGTGCATAGGCTTGCATTGGGTGGGACTATAATATTTAAGACAACCGAGAGTTCAAGACCAGAT
ATACAGTTAAGTAAAGTTACAAAATATTTTGCTGCCGTGCATTTTTTTACAGCAGGAGTAAATACCTCTT
CATCGGAGGTTTTTGTTGTCTTGAAATATAAGCTACACTCCGAACCAATTGGTGAGGAGTTGTGTTCCCC
CAATATTTTGCGACGAATTGCCGCATATAGAAATAAGTTATGTATAGTGCCTAATTTTAAGGTTTTTAGT
ACTAGTTTAAGCTATAGATTTAGTAGTGTTAAGTTTGTGCAAAAATGTTTTTATGTTTCTGTACCGCGGC
AATTTTGTGCCTCTGGATTAATTCAGGAGGTGCCGTTGTTGTGTCAAATGAAACATTAGTGGTTTGTGAG
CCAGTATCCTACCCTTATTCCCTACAAGTCCTTCGTTCTTTTTCACAGCGTGTTAATTTAAGAACAAAGA
GAGCTGTTATTGATGATGCCTGGTCTTTTGCCTACCAAATTTCAACTAATTCTTTGAATGTTAATGGTTG
GTATGTTAATTTTACATCTCCTTTAGGTTGGAGTTATCCAAATGGTAAATTGTTTGGAATTGTCCTGGGT
TCTGATGCCATGATGAGAGCATCCCAGTCTTTTTTTACATATGATGTTATTTCATATGTGGGGCAAAGAC
CAAACCTTGACTGTCAAATAAATGATTTAGTAAATGGTGGTTTGGATAGTTGGTACAGCACTGTTAGAGT
GGATAATTGTGGTAACTACCCATGCTACGGTGGGGGTAAACCTGGTTGTTCTATTGGACGGCCCTATATG
GCCAATGGTGTGTGTACCCGTGTTTTGTCGACCACCCAGTCTCCAGGCATTCAGTATGAGATATATTCTG
GCCAAGATTACGCTGTGTACCAAATTACACCTTATACACAGTATACCCTTACCATGCCATCTGGAACCCC
CGGTTATTGTCAACAGACACCGCTCTATGTAGAGTGTGGTTCCTGGACACCATATAGAGTTCATGCATAT
GGTTGTGATAAGGCAACTCAGGGCTGCAAGTATACCATTTCATCAGATTGGGTTGTCGCTTTTAAGAGTA
AGATTACAGCGGTAACCCTTCCACCAGATTTGAAGGTTCCAGTTGTACAAAAGGTTACTAAACGGCTTGG
TGTTACATCTCCAGATTATTTTTGGCTAATAAAGCAGGCCTATCAATATCTTTCACAGGCAGCAATTTCA
CCAAACTATGCACTGTTTTCGGCACTTTCAAATTCACTTTATCAACAGTCTCTTGTTTTGACAGATTTGT
GCTACGGTTCTCCATTCTTCGTGGCTCAGGAGTGCTACAACAATGCATTGTATTTGCCTGACGCTGTTTT
TACTACTTTGTTTTCAATTTTGTTTAATTGGGATTATCAGGTGAATTATCCGGTGAAAAATGTTTTACAA
ACAAATGAGACCTTTTTACAATTACCAACAACTGGATATTTGGGCCAGACAGTTTCCCAAGGACGCATGC
TGAACCTTTTTAAGGATGCCATAGTGTTTCTTGATTTCTATGATACCAAGTTTTACCGCACGAATGATGG
ACCTGGTGGTGACATTTTTGCTGTTGTTGTGAAGCAAGTGCCAGTCATTGCATATAGTGCATTTAGAATT
GAACAACAGACTGGTGACTATCTCGCTGTTAAGTGTAAAGATGTTACACAGGCAACACTAGCACCACATC
CATCTCGTGTTGTTTTGCTTGCTAGACACATGTCTATGTGGTCTATTGCTGCAGCTAACTCCACCACTAT
TTATTGTCCAATTTACACCTTGACACAGTTTGGTTCGCTTGATATTTCTACATCTTGGTATTTTCATACC
TTGGCACAGCCGTCTGGCCCAATACATCAGGTTTCCATGCCTCTTCTTTCTACTGCCGCCGCTGGTGTTT
ATATGCATCCTATGGTTGAACATTGGGTTACTCTTTTGACACAAACTCAAGATGTTTATCAGCCTAGTAT
GTTTAATATGGGTGTTAATAAGTCTGTCACTTTAACAACACAGTTGCAGGCTTATGCTCAGGTTTATACT
GCTTGGTTTTTGTCCATTCTATATACCCGGCTCCCCGAGTCTAGAAGATTGACATTGGGGGCACAGTTGA
CACCCTTTGTACAAGCACTTTTATCATTTAAGCAGGCTGATATTGATGCTACTGATGTTGATACAGTAGC
CCGTTATAATGTGTTATCTTTGATGTGGGGTAGAAAGTATGCTGCTGTTTCTTATAACCAATTACCTGAG
TGGTCATATCCCCTGTTTAAGGGTGGAGTTGGTGATTCTATGTGGTTTAGAAAAGAAATTTCTTGTTCTA
GCCAAAATCCATCAACACCATCACATTTCCCTTTTATAGCGGGTTACCTGGATTTTTTAGATTATAAGTA
TATTCCCAAGTATAAAGGTGTTGCATGTCCTACCACAATGGTAGCACCTACATTGTTGCAAGTTTATGAA
ACACCACAGCTGTTTGTTATAATTGTTCAATGTGTTTCCACTACATACTCATGGTATCCAGGACTTCAAA
CCCCACACACAATTTATCGCTCATACAAACTTGGCACGATCTGTGTTTTGGTGCCATATTCAAGTCCGAC
CAGTGTTTATTCATCATTTGGGTTTTTTTCTCAATCTGCACTCACAATACCTACAGTGCAAACGACTGAT
GATATTTTACCTGGTTGTGTGGGTTTTGTACAAGATGGTGTTTTTACGCCATGTCATCCATCTGGTTGTC
CTGTTCGTAATTCTTATGATAATTATATTATTTGTCCTGGTTCTAGTGCGTCTAACTACACCTTACGCAA
CTATCACAGGACAACTATTCCAGTTATGAATGTACCAATTGACGAAGTGCCCTTACAGCTTGAAATACCA
ACAGTAAGTTTAACATCATATGAACTTAAACAATCTGAGTCTGTTTTGTTACAGGACATTGAGGGGGGCA
TTGTTGTTGACCACAATACTGGTTCAATCTGGTACCCTGGTGGTCAAGCCTATGATGTCTCTTTCTATGT
TTCTGTAATTATACGCTATGCTCCACCTAAGCTTGAGTTGCCATCTACACTTGCTAATTTTACATCGTGT
CTTGATTACATTTGTTTTGGTAATCAACAGTGTAGAGGTGAGGCACAGACTTTTTGCACTTCAATGGATT
ATTTTGAACAAGTTTTTAATAAGAGTTTAACATCTTTGATAATAGCTTTGCAAGACTTGCATTATGTTTT
AAAACTTGTGTTACCAGAAACAACCCTTGAACTTACTGAGGATACACGTCGTAGGCGACGTGCTGTAGAT
GAGTTTTCAGACACAATATCACTTTTGTCAGAGTCATTTGAGAGGTTTATGTCACCAGCTTCACAGGCCT
ATATGGCAAACATGATGTGGTGGGATGAAGCATTTGATGGTATAAGTTTGCCACAGAGAACTGGCTCTAT
ACTATCGAGGACACCTTCGTTGTCATCCACTTCTTCCTGGCGTTCATATTCATCACGAACACCACTTATT
TCAAATGTTAAAACACCAAAGACTACTTTTAATGTGAAGTTATCTATGCCAAAATTACCCAAGGCATCTA
CCCTCTCAACTATTGGGTCTGTACTATCATCTGGTCTCTCTATTGCTTCTTTGGGTTTGTCTATATTTTC
AATTATAGAGGACAGAAGAGTTACAGAGCTTACACAACAGCAAATTATGGCGCTTGAGAATCAGATTACT
ATTCTTACTGATTATACAGAAAAGAATTTTAAGGAAATACAATCCTCCTTGAATACTTTGGGACAGCAAG
TTCAGGATTTTTCACAACAAGTGACATTGTCACTACAGCAGCTGTCTAATGGCTTAGAGCAAATTACCCA
GCAGTTGGATAAGAGTATCTATTATGTTATGGCAGTACAGCAGTATGCCACCTACATGTCATCTCTTGTA
AATCAGCTTAATGAGCTGTCCCAAGCTGTGTATAAGACACAAGATATGTACATAACATGTATACATTCTT
TACAATCTGGTGTTCTTTCACCCAACTGTATAACCCCTTCACAAATGTTTCATTTGTATCAAGTAGCAAA
AAATTTGAGCGGAGAATGTCAACCAATTTTTTCAGAGCGTGAGATTTCACGCTTTTACTCCCTTCCACTT
GTGACTGATGCTATGGTGCATAATGATACTTATTGGTTTTCATGGTCAATTCCTATCACATGTTCCAACA
TCTTGGGCTCAGTTTATAAGGTTCAACCGGGTTATATAGTGAACCCCCACCACCCCACCAGCCTACAATA
TGATGTTCCTACTCATGTTGTTACTTCAAATGCTGGTGCGTTGATATTTGATGAGCATTATTGCGATAGG
TATAACCAGGTCTACCTATGCACAAAGTCTGCATTTGATCTTGCAGAATCTAGCTATCTTACAATGCTCT
ATTCTAATCAAACAGATAATAGTAGCCTGACATTTCATCCAGCACCAAGACCTGACCCTTGTGTTTATTT
GTCAGCATCAGCCCTTTACTGCTATTATTCAGATGAATGTCATCAATGTGTTATAGCAGTTGGTAATTGT
ACTAATCGTACTGTTACCTATGAAAACTACACTTACCCAATTATGGACCCACAGTGTAGAGGTTTTGATC
AGATAACCATATCATCACCAATTGCCATTGGTGCTGATTTTACAGCTTTACCATCTCGGCCACCTTTGCC
TTTGCATTTGTCATATGTGAATGTTACATTTAATGTTACTTTACCCAATGGAGTTAATTGGACTGATTTG
GTTTTAGATTATAGTTTTAAAGATAAAGTTTATGAAATTTCAAAGAATATAACCCAGCTACATGAGCAGA
TACTTCAAGTTTCCAATTGGGCTTCTGGATGGTTTCAGCGTTTAAGAGATTTTCTTTATGGTTTAATTCC
TGCTTGGATTACCTGGCTTACTTTAGGTTTTAGTTTGTTTAGTATATTAATAAGTGGTGTAAATATTATA
TTGTTTTTTGAGATGAATGGCAAGGTTAAGAAAAGCTAGTCACTATCTTTAGTTGAAGGTTGCCAAAATG
TTTGAGACCAATTATTGGCCCTTCCCTGATCAGGCTCCAAACCCATTTAATGCTCAAGTTGAGCAGTTAT
CAGCAACTGAAAATGTTTATATTTTTCTTACTACACTTTTTGGAATACTCCAACTAGTGTATGTTATTTT
TAAGTTGTTATGTACTATGTTTCCAGCTCTGCATTGGTCGCCTATATGGCGCGGTTTGGAGAATTTTTGG
CTTTTCTTGAGTTTAGCATCCCTTGCAATTGCCTATTGGTGGCTTCCCAGTATGACCTTTACTGGCTATT
GGGCATTGACCATTATTGCCACCATTTTGGTTTTGATTATGTTGATAATGATGTTTGTTAAGTTTGTTAG
TTTTGTTAGATTGTTTTATAGGACTGGAAGTTTTGCAATTGCTATACGGGGACCAATTGTGCTTGTTGCA
CTTGATGTTACCATTAAGCTTCATTGCACACCTTTTGCAATTCTTGTTAAGGAGGTTGGCAATATCTTTT
ATTTGTCAGAGTATTGCAATAAACCATTAACAGCTGCTCAGGTTGCTGCGTTGCGGATTTGTGTTGGCGG
ACAATGGTTTGCTTACACGCGGTCCACTACTACCAGCGCCGCTAAAGTAGCTGCAGCTAACAGCACTGCA
AAATACCATCTTTTTGTGCTGCAAGGTGTTGCAGATTATACGCAATTGTCTAGTGTTAAGTTTGAGTAGC
CACTTATCTTTAGAAGATGCTGAGTTTAATACTTTTTTTCCCATCTTTTGCCTTTGCGGCAACACCAGTA
ACACCATATTATGGTCCAGGACATATTACCTCTGATTGGTGTGGATTTGGTGATAGCAGGTCTGATTGCA
CCAACCCTCAGTCACCTATGAGTCTTGATATCCCTCAACAGTTGTGTCCTAAGTTTTCATCAAAGTCATC
TTCGTCCATGTTTTTGTCATTACATTGGAATAATCATTCCAGTTTTGTTTCCTATGATTATTTTAATTGT
GGTGTGGAGAAGGTTTTTTATGAGGGTGTGAATTTTTCACCACGTAAGCAGTATAGTTGTTGGGATGAGG
GTGTTGGTGGTTGGATTGAACTTAAGACCAGGTTTTATACTAAGCTTTATCAAATGGCAACAATTTCACG
TTGCATCAAGCTTATCCAACTACAAGCCCCATCTAGTTTGCCAACACTAAAAGCTGGTGAGTGTCGTACC
AAAAAGCAGTTGCCTGACAACCCTCGTTTGGCTTTGCTTAGTGACACTGTACCAACTTCTGTCCAGTTTG
TTTTGCCTGGTTCAAGTGGTACCACAATTTGCACTAAACATCTTGTGCCGTTTTGCTATCTTAACCATGG
TTGTTTTACAACGGGTGGTTCTTGTCGGCCTTTTGGTGTTTCTTATGTTTCAGATTCATTTTATTATGGG
TACTATGATGCAACATCACAGATAGGTTTAACTGAGTCCCATGATTATGTTTGTGATTATCTTTTTATGG
AACCAGGCACTTATAATGCATCTACTGTTGGTAAATTCCTTGTTTATCCCACAAAGTCATATTGTATGGA
CACAATGAATATAACAGTTCCAGTTCAAGCTGTACAGAGCATTTGGTCAGAACAGTACGCCTCTGATGAT
GCAATAGGTCAGGCGTGTAAAGCACCATACTGTATATTTTATAATAAGACCACTCCATATACAGTAACCA
ATGGATCTGATGCAAATCATGGTGATGATGAGGTAAGAATGATGATGCAGGGTCTTTTGAGGAATTCATC
CTGCATTTCACCTCAAGGTTCCACCCCACTTGCTCTTTATTCAACTGAGATGATTTATGAACCAAATTAT
GGTTCTTGTCCACAGTTTTATAAACTGTTTGATACATCTGGCAATGAGAATATAGATGTTATTTCATCTT
CTTATTTTGTGGCTACCTGGGTTTTGTTGGTGGTGGTTGTTATTTTAATTTTTGTAATTATAAGTTTTTT
TGTTAGTAGTGTTTAAGTTGAGTTGGAGACACTATCTTTAGAGAGAGAGCCAAGATGAATTCTATGCTTA
ATCCAAATGCTGTGCCATTTCAGCCGTCCCCTCAGGTTGTCGCCATACCTATGCAGTACCCATCAGGTTT
TCCTCCTGGATTCCGTAGACAACGTAACCCAGGTTTTCGGCCCATGTTCAATAGGCGGCGGAATAATAAT
GGCAACCAAAACCGTGGCCGTCAAAATCGGCAACGTGTTCAAAATAATAATCGTGGCAACATTGGAAATC
GTCAAAATAACGGGCAACGCGGTAGTAGGCGCCAATATAATCAGGCGTCCCCAAATGTGCCTTTTGAACA
GCAATTGCTGATGATGGCAAATGAAACCGCATATGCTGCAACCTATCCACCAGAGATGCAGAATGTTGCC
CCCACCAAATTGGTGAAAATTGCCAAAAGAGCTGCAATGCAGATTGTCTCCGGTCATGCCACCGTTGAGA
TTTCCAATGGTACTGAAGACTCTAATAAGCGAGTCGCTACCTTTACGATTAAGGTGGTAATGAATTAAAA
CCTTTTCAGCAACCTTGTGGTTGGTCTGTAACTGAAATGCTTAGTGTTATCAACATGGCATAACTTGCCT
CTGGCTCCACTGTGTGTAACCATCTAGATTTTAATGGTTTTGCTAGATAGTATGGTTGAGTGTCTCCATG
TAAGATGTTATGTTAGTTAGTATTAGGCCTACCCCAGAAGTAGTAAAAAGCAGCC

>gi|253750530|ref|NC_012936.1| Rat coronavirus Parker, complete genome
CCCTCTCAACTCTAAAACTCTTGTAGTTTAAATCTAATCTAAACTTTACAAACGGCACTTCCTGCGTGTC
CATGCCCGTGGGCTTGGTCTTGTCATAGTGCTGACATTTGTGGTTCCTTGACTTTCGTTCTCTGCCAGTG
ACGTGTCCATTCGGCGCCAGCAACCCACCCATAGGTTGCATAATGGCAAAGATGGGCAAATACGGTCTCG
GCTTCAAATGGGCCCCAGAATTTCCATGGATGCTTCCGAACGCATCGGAGAAGTTGGGTAACCCTGAGAG
GTCAGAGGAGGATGGGTTTTGCCCCTCTGCTGCGCAAGAACCGAAAGTTAAAGGAAGAACTTTGGTTAAT
CACGTGAGGGTGGATTGTAGCCGGCTTCCAGCTTTGGAGTGCTGTGTTCAGTCTGCCATAATCCGTGATA
TCTTTGTAGATAAGGATCCCCAGAAGGTGGAGGCCTCAACTATGATGGCATTGCAGTTCGGTAGTGCTGT
CTTGATTATGCCATCCAAGCGCTTGTCTATTCAGGCATGGGCTAATTTGGGTGTGCTGCCTAGAACACCA
GCCATGGGGTTGTTCAAGCGCGTCTGCCTGTGTAATACCAGGGGGTGTTCTTGTGACGTCCACGTGGCTT
TTCAACTCTTTACCGTTCAACCCGATGGCGTATGCCTAGGTAATGGACGTTTTATAGGCTGGTTTGTTCC
AGTCACAGCCATACCGGAGTATGCGAAGCAGTGGTTGCAGCCCTGGTCCATCCTTCTTCGTAAGGGTGGT
AACAAGGGGTCTGTGACATCCGGCCACCGCCGTGCTGTTACCATGCCTGTGTATGACTTTAATGTGGAGG
ATGCTTGCGAGGAGGTTCATCTTAACCCGAAGGGTAAGTACTCTCGCAAGGCGTATACTCTTCTTAAGGG
CTATCGCGGTGTTAAACCCATCCTTTTTGTGGACCAGTATGGTTGTGACTATACTGGATGTCTCGCCAAG
GGTCTTGAGGACTATGGTGACCTTACTTTGAGTGAGATGAAGGAGTTATTCCCTGTGTGGCGTGAATCCT
TAGATAATGAAGTAGTTGTGGCCTGGCATGTTGATCGTGACCCGCGGGCTGTTATGCGTCTGCAGACTCT
TGCTACTCTACGTAGCATTGATTATGTGGGCCAACCGACAGAGGATGTGGTGGATGGAGATGTGGTAGTG
CGTGAGCCTGCTCATCTTCTAGCAGCTGATGCCCTTGTTAAAAGACTCCCCCGTTTGGTGGAGACTATGC
TGTATACGGATTCGTCCGTTACAGAATTTTGTTATAAAACCAAGCTGTGTGATTGTGGTTTTATCACGCA
GTTTGGCTATGTGGATTGCTGTGGTGACACCTGCGATTTTCGCGGATGGGTACCGGGCAATATGCTGGAT
GGTTTTCCTTGCCCAGGGTGTAGCAAAAGTTACATGCCATGGGAACTGGAAGCTCAATCATCAGGTGTAA
TCCCAGAAGGAGGTGTTCTGTTTACTCAGAGCACTGATACGGTGAATCGTGAGGCTTTTAAGCTCTACGG
TCATGCTGTTGTGCCTTTTGGTTCTGCTGTGTATTGGAGCCCTTACCCAGGTATGTGGCTTCCAGTAGTT
TGGTCTTCTGTTAAGTCATACTCTGGTTTGACTTATACAGGAGTTGTTGGTTGTAAGGCAATTGTTCAGG
AGACAGATGCTATATGCCGGTCTCTATATATGGACTACGTTCAGCACAAGTGTGGCAATCTCGATCAGAG
AGCTACTCTTGGATTGGACGATGTCTATCATAGACAATTGCTTGTAAATAGAGGTGACTATAGTCTCCTA
CTTGAAAATGTAGATTTGTTTGTTAAGCGGCGCGCTGAATTTGCTTGCAAATTTGCCACCTGCGGAGATG
GTTTTGTACCTCTTCTGCTAGATGGTTTAGTGCCCCGCAGTTATTATTTAATTAAGAGTGGCCAGGCCTA
CACCTCGATGATGGTTAATTTTAGCCATGAGGTGATTGACATGTGTATGGACATGGCATTATTGTTCATG
CATGATGTTAAAGTGGCCACTAAGTATGTTAAGAAGTTTACTGGCAAACTAGCCGTGCGCTTTAAGGCGT
TAGGTGTAGCCGTTGTCAGGAAAATTACTGAATGGTTTGATCTTGCCGTGGACATTGCTGCTAGTGCCGC
TGGATGGCTTTGCTACCAGCTGGTAAATGGCTTATTCGCAGTGGCCAATGGTGTCATAACATTTGTTCAG
GAGGCTCCTGAGCTAGTCAAGAATTTTGTTGCCAAGTTCAGGGCATTTTTCAAGGTTTTGATCGACTCTA
TGTCGGTTTCTATCTTGTCTGGACTTACTGTTGTCAAGACTGCCTCAAACAGGGTATGTCTGGCTGGCAG
TAAGGTTTATGAGGTTGTGCAGAAGTCTTTGTCTGCATATGTTTTGCCTGTTGGTTGCAGTGAGGCCACT
TGTTTAGTGGGCGAAAGTGAACCTGCAGTTTTTGAAGATGATGTTGTTGGTGTGGTTAAGACCCCATTAA
CATATCAAGGCTGTTGTAAGCCACCCACTTCTTTCGAGAAGATTTGTATTGTAGATAAATTATATATGGC
CAAGTGTGGTGATCAATTCTACCCCGTGGTTGTTGATAACGACACTGTCGGCGTGTTAGATCAGTGCTGG
AGATTCCCCTGTGCGGGCAAGAAAGTCGTGTTTAACGACAAGCCTAAAGTCAAGGAGGTACCCTCCACGC
GAAAGATTAAGATTATCTTCGCTCTGGATGCGACCTTTGATAGTGTTCTCTCGAAGGCGTGTTCAGAGTT
TGAAGTTGATAAAGATGTTACATTGGATGAGCTGCTTGATGTTGTGCTTGACGCAGTTGAGAGTACGCTT
AGTCCTTGTAAGGAGCATGATGTGATAGGCACAAAAGTTTGTGCTTTACTTGATAGGTTGGCAGAAGATT
ATGTCTATCTTTTTGATGAAGGAGGCGATGAAGTGATTGCCCCGAGGATGTATTGTTCCTTTTCTGCTCC
TGATGATGAAGACTGCGTCGCAGCAGATGTTGTAGATGCAGATGAAAACCAAGATGATGATGCTGACGAC
TCTGTAGTCCTTGTCGCCGATGCACAAGAGGACGGCGTTGCCAAGGAGCAGGTTGAGGTGGATTCTGAAA
TTTGCGTTGCGCATACTGGTGGTCAAGATGAATTGACTGAGCCAGATGCTGTCGGATCTCAAACTCCCAT
CGCCTCTGCTGAGAAAACCGAAGTCGGAGAGGCAAGCGACAGGGAAGGGATTGCTGAGGCGAAGGCAACT
GTGTGTGCTGATGATTTAGATGCCTGCCCCGATCAAGTGGAGGCATTTGAAATCGAAGAGGTTGAAGACT
CTATCTTGGATGAGCTTCAAACTGAACTTAATGCGCCAGCAGACAGGACCTATGAGGATGTTTTGGCATT
TGATGCCATATACTCAAAGGCTTTGTCTGCAGTCTATGCTGTGCCGAGTGATGAGACGCACTTTAAAGTG
TGTGGATTCTATTCGCCTGCTATAGAGCGCACTAATTGTTGGCTGCGTTCCACTTTGATAGTAATGCAGA
GTTTACCTTTGGAATTTAAAGACTTGGAGATGCAAAAGCTCTGGTTGTCTTACAAGGCTGGCTATGATCA
ATGCTTTGTGGATAAACTAGTTAAGAGCGTGCCCAGGTCGATTATTCTTCCACAAGGTGGTTATGTGGCA
GATTTTGCCTATTACTTTTTAAGTCAGTGTAGCTTTAAAGCTCATGCTAACTGGCGTTGTTTAAAGTGTG
ACATGGCGTCAAAGCTGCAAGGTTTGGATGCCATGTTCTTTTATGGAGACGTTGTGTCTCATATGTGTAA
GTGTGGTAGTGGCATGACCTTGTTGTCTGCGGATATACCGTACACTTTGCATTTTGGAGTGCGAGATGAT
AAGTTTTGCGCTTTTTACACGCCGAGAAAGGTTTTTAGGGCTGCTTGTGCGGTAGATGTTAATGATTGTC
ATTCCATGGCTGTTGTGGATGGCAAGCTAATTGATGGTAAGAACGTTACCAAATTTACTGGTGACAAATT
TGATTTTATGGTGGGTCATGGGATGACATTTAGTATGTCACCCTTTGAGACCGCCCAGTTATACGGTTCA
TGTATAACGCCAAATGTTTGTTTTGTTAAAGGAGATGTTATAAAGGTTGCTCGCTTGGTTGAGGCCGAAG
TCATTGTTAACCCTGCTAATGGGCGGATGGCTCATGGTGCAGGTGTTGCAGGTGCTATAGCTAAGGCGGC
GGGCAAGTTTTTTATTAAAGAAACTGCCGATATGGTGAAGAATCAAGGTGTTTGTCTAGTTGGCGAATGC
TATGAATCTGCTGGTGGTAAATTATGTAAAAAGGTGCTTAACATTGTGGGACCAGATGCTCGAGGGCAAG
GTAGGCAATGTTACTCACTCCTAGAGCGTGCATATCAGCATATTAATAAGTGTGATAATGTTGTTACCAC
TCTAATATCGGCTGGCATATTTAGTGTGCCTACTGATGTTTCCTTGACTTATTTACTTGGTGTTGTGACT
AAGAATGTTATTCTTGTTAGCAACAACAAAGATGATTTTGATGTGATAGAGAAGTGCCAAGTTACTTCTG
TGGCTGGTACTAAAGCACTGTCACTTCAATTGGCCAAAAATTTGTGTCGTGATGTAAAGTTTGAGACGAA
TGCATGTGATACGCTTTTTGGCGCGTCCTGCTTCGTGGCAAGCTATGATGTGTTGCAGGAAGTTGAATTG
CTGCGACATGATATACAGTTGGATGATGACGCACGTGTTTTTGTGCAGGCTAATATGGATTGCCTGCCCA
CAGACTGGCGTCTTGTTAATAAACTTGATGTTGTGGATGGTGTTAGAACCATTAAGTATTTTGAGTGTCC
GGGAGAGATTTTTGTATCTAGCCAGGGCAAAAAGTTTGGTTATGTTCAGAATGGTTTATTTAAAGTGGCG
AGTGTTAGTCAAATACGGGCTCTACTTGCTAATAAGGTTGATGTCTTGTGCACTGTTGATGGTGTTAACT
TCCGCTCCTGCTGTGTAACAGAGGGTGAAGTTTTTGGCAAGACATTAGGTTCAGTCTTTTGTGATGGCAT
AAATGTCACCAAAGTTAGGTGTAGTGCCATTCACAAGGGTAAGGTTTTCTTTCAGTACAGTGGTCTGTCT
GAGGCCGATCTTGTGGCTGTTAAAGATGCTTTTGGTTTTGATGAACCACAACTGCTGAAGTACTATAATA
TGCTTGGCATGTGTAAGTGGCCAGTAGTTGTTTGTGGCAATTATTTTGCTTTCAAGCAGTCAAATAATAA
TTGCTATATAAATGTGGCATGTTTAATGCTGCAGCATTTGAATTTAAAGTTTCCCAAGTGGCAATGGCAG
GAGGCCTGGAACGAGTTCCGCTCCGGTAAGCCACTAAGGTTCGTGTCCTTGGTGTTAGCAAAGGGCAGCT
TTAAATTTAATGAACCTTCTGATTCCACTGATTTTATACGTGTGGTGCTGCGCGAAGCAGATTTGAGTGG
TGCCACATGTGATTTGGAATTTATTTGTAAATGTGGTGTGAAGCAAGATCAGCGCAAAGGTGTTGACGCT
GTTATGCATTTTGGTACATTGGATAAAAGTGATCTTGTCAAGGGTTATAATATCGCATGTACATGCGGTA
GTAAACTTGTGCATTGCACCCAATTTAATGTACCATTCTTAATTTGCTCCTACACTCCAGAGGGCAGGAA
ACTGCCTGACGATGTTGTTGCAGC