Deletion Analysis of the miR-17-92 Promoter

MISSING IMAGE

Material Information

Title:
Deletion Analysis of the miR-17-92 Promoter
Physical Description:
Book
Creator:
Amrhein, Scott
Publication Date:

Subjects

Genre:
Spatial Coverage:

Notes

Abstract:
KSHV causes cancer within certain populations through the manipulation of the cell cycle by means such as the regulation of miR-17-92 cluster by viral proteins. This cluster encodes for micro-RNAs which recently have been shown to fulfill an important role in regulating gene activity. In the case of miR-17-92, its products have inhibitory effect upon the E2F transcription factors and in turn are positively regulated by this protein family. This experiment sought to determine the importance of this activator in the presence of the viral proteins vCyclin and vFLIP through the generation of plasmids containing shortened miR-17-92 promoters and luciferase genes. Cells were co-transfected by the reporter vectors and the viral gene expression plasmids and then assayed for luciferase activity. The activities of the deletion promoters while relatively equal were far higher than the full lengthpromoter. Thus there is a strong repressor site in the deleted region between full lengthand the deletion promoter which started 500 bp from gene origin. Furthermore, this experimentindicates that vFLIP and vCyclin are able to transactivate miR-17-92 expression from thirty base pair promoter which does not contain an E2F binding site.
Acquisition:
Collected for University of Florida's Institutional Repository by the UFIR Self-Submittal tool. Submitted by Holly Hofer.
General Note:
Undergraduate Honors Thesis

Record Information

Source Institution:
University of Florida Institutional Repository
Holding Location:
University of Florida
Rights Management:
Copyright Scott Amrhein. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
System ID:
IR00004040:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 Deletion Analysis of the miR-17-92 Promoter Scott Amrhein Spring 2014

PAGE 2

2 Abstract KSHV causes cancer within certain populations through the manipulation of the cell cycle by means such as the regulation of miR-17-92 cluste r by viral proteins. This cluster encodes for micro-RNAs which recently have been shown to fulfill an important role in regulating gene activity. In the case of miR-1792, its products have inhibitory effect upon the E2F transcription factors and in turn are positively regulated by this protein family. This experiment sought to determine the importance of this activator in th e presence of the viral proteins vCyclin and vFLIP through the generation of plasmids c ontaining shortened miR-17-92 promoters and luciferase genes. Cells were co-transfected by the reporter vectors and th e viral gene expression plasmids and then assayed for luciferase activity The activities of the deletion promoters while relatively equal were far higher than the full length promoter. Thus there is a strong repressor site in the deleted region between full length and the deletion promoter which started 500 bp from gene origin. Furthermore, this experiment indicates that vFLIP an d vCyclin are able to transactivate miR-17-92 expressi on from thirty base pair prom oter which does not contain an E2F binding site. Introduction Kaposi’s sarcoma is a relatively rare disease that primarily affects certain elderly populations and the immune-compromised. Unlike many of its brethren though, this cancer is instigated not by mutation but by a virus2. Once called human herpes virus 8, Kaposi’s sarcoma associated herpesvirus is a member of Herpes viridae and possesses the ability to induce tumor formation during its latent phase.1 To accomplish this task the virus utilizes several proteins which are homologous to those found in its human host. Within a normal eukaryotic cell these proteins such as cyclin-D and FLIP play an integr al role in regulating the cell cycle. With the addition of the viral orthologs th is delicate cycle is broken and an uncontrollable cell growth favorable to the virus can commence. A further mechanism of this viral manipulation has been revealed with the discovery of mi croRNAs over the past decades. Unlike messenger RNA, these short lengths of ribonucleic acid break the central dogma and are not translated into polyp eptides. Instead th ese sequences after tr anscription undergo a modification involving a cut by Dicer and incor poration into an RNAinduced silencing

PAGE 3

3 complex. This RISC then selectively binds to certain mRNAs, preventing their reading by the ribosomes and the production of the protein.1 A cluster of micro-RNAs within humans composes miR-17-92. As with all genes, the transcrip tion of microRNA-17-92 is controlled by a promoter. These sections of DNA which can run from a hundred to thousands of base pair s in length contain sites where specific proteins or complexes known as transcription factors can attach. This binding can either enable or prevent the functioning of RNA polymerase and therefore these sites control the rate of micro-R NA transcription. For example, th e E2F1 transcription factor and its associated family have been shown to ha ve a positive regulation upon the expression of miR17-92.6 Interestingly, these regulat ory proteins which control as pects of cell replication and apoptosis are inhibited by the products of miR-17-92, creating a feedback loop.5 In the case of KSHV infected cells, the vCyclin and vFLIP can also induce posit ive regulation of miR-17-92. By cutting away at the promoter and then test ing the productivity of each new length, sites of critical importance can be loca ted. Through analysis by Promo, it was determined that within 100 base pairs of gene start there were thre e binding sites for E2F1 with less than 15% discontinuity.3,4 Within 70bp there is only two sites and there are none within 30 bp of the start of the miR-17-92 cluster.3,4 The figure below represents th e four promoter fragments produced Figure 1 Transcription and Translation of micro RNAs1

PAGE 4

4 in this experiment which were 30 base pairs, 70 base pairs, 100 base pairs and 500 base pairs long. Figure 2 Schematic Diagram of Experimental Vectors Along with the full length promoter, these frag ments were placed into a pGL3 vector which contained the gene for Firefly luciferase whic h allowed for the eventual direct assay of transfected cells. The cells were also transfected with a plasmid containing a CMV promoter and a Renilla luciferase which operate d on a different substrate. This allowed for the normalization of the generated data. Methods and Materials The experiment required the creation and amplif ication of shortened miR-17-92 promoters which were then transfected alongside earlier produced vectors containing vC yclin or vFLIP into eukaryotic cells. This process is detailed in the following sections. PCR The first steps of the experiment required the creation of different length miR-17-92 promoters. The forward PCR primers were cr eated by combing an identical vector sequence

PAGE 5

5 with individual homologous segments that started at the desired lengths w ith the reverse primer simply being inverted and complementary to the end of the full length promoter. Table 1 Experimental Primers Forward Primers TACGCGT GCTAGCCC500 bp CCGCCAGCGGCTCCCGGCTCCCGC 100 bp -CGGGAGCAGGAGCCCGCGGCCGGC 70 bp GATGGTGGCGGCTACTCCTCCTGG 30 bp TCCGGCGACGGAGGGAAACCTGTT Reverse Primer GCAGATCTCGAGCCC CGCACACAACAGGTTTCCCTCCGTC The ordered primers were diluted to a concentr ation of 0.1nm/L. A working primer mix was created by adding 10 L of the desired forward pr imer with the same amount of diluted reverse primer in 80 L of deionized water. Five r eactions vessels were made for each promoter with each individual vessel containing: 1 L of the Primer Mix 1 L of the Full Primer at 5 ng/L as template 15 L of Cyclic Green Mast er Mix produced by Promega 13 L of H2O The reaction vessels were then placed into an Eppendorf Mastercycler Gradient with individual annealing temperatures of 50.0 C, 52.7 C, 55.4 C, 58.1 C and 60.0 C.The longer plasmids of 100 and 500 bp fragments were kept at this temper ature for 30 seconds whereas the 30 and 70 bp promoters only annealed for 10 seconds. All samples underwent thirty cycles with an initialization and denaturation temperature of 95C for 5 minutes and 30 seconds and an elongation temperature of 72C for 10 seconds. Afte r the completion of the PCR a portion of the

PAGE 6

6 all samples were run on a 1% agrose gel against either a 1 kb or 2log ladder. The samples with the highest evident concentration at the correct location were selected for the next stage of the experiment. Figure 3 Results of PCR of 30 and 70 bp Promoters compared against 2log ladder after 21 minutes at 125 V In the figure above the 30 bp fragments produced at 55.4 C and 58.1 C, fourth and fifth bands from the right were selected for the next round of the experiment alongside the 70 bp promoters created at 52.7 C and 55.4 C. GeneArt Cloning Using the GeneArt Cloning System created by Life Technologies the experimental vectors were created by joining the selected promoter and a linearized pGL3, a plasmid which contains an ampicillin resistance and luciferase gene. The initial linearization of pGL3 was accomplished by the SmaI which cut at the singl e CCCGGG site in the plasmid. The hour-long digestion took place in a 37 C solution composed of 10 L of 800ng/ L of DNA, 4 L of 10X Buffer 4 produced by New England Laboratories, 21 L of water, and 4 L of the enzyme. The cut plasmid was then purified through the use of QIAEX Gel Extraction pr otocol on a 1% agrose gel. With this linearized plasmid and the shorte ned promoter as reagents, the vector was created by following the manufacturer’s instructions fo r 10X enzyme mix. A portion of the product

PAGE 7

7 solution was run on 1% agrose gel against a 2log ladder to check for success before transformation as demonstrat ed in the figure below. Figure 4 Results of GeneArt Cloning for 30 and 70 bp Promoters against 2log ladder after 28 minutes at 135 V Transformation The resulting plasmids were then used to transform samples of One Shot Top10 Chemically Competent E. Coli culture to produ ce the initial experimental samples. Fifty microliters of these cells were exposed to 10 L of the reaction products on ice for thirty minutes followed by a heat shock of 42 C for 1 min. After another 2 minut es of incubation on ice, the samples were diluted by addition of 250 L of SOC media. The cells were then allowed to recover in a shaking incubator set to 230 rpm and 37 C. After this time, 85 L of solution was finally plated on pre-warmed Petri dishes containing ampicillin laced LB agar and incubated for 18 hours at 37 C. On the following day, five colonies at random were picked from each plate and inoculated into individual conical tu bes of 3mL of LB media containing 3 L of ampicillin that had a concentration of 50mg/mL. These tubes we re also allowed another 18 hours in the shaking

PAGE 8

8 incubator before the entire sample had its plasmid DNA extracted and purified by the QIAprep Spin Miniprep procedure using a vacuum manifold. The final solu tions of DNA were tested for concentration and then sent to the ICBR lab for sequencing. Following this sequencing, another culture of Top10 cells was transformed using the now known plasmids. However, in case after incubation 10 L of the liquid culture was placed in a flask containing 100mL of LB media and 100 uL of ampicillin. These samples were then purified using the QIAGEN Plasmid Midi Kit and the manufacturer instructions. A sample of this purified DNA was then removed, diluted to a con centration of 500 ng/ L and was used to transfect the eukaryotic cells. Transfection and Assay The transfection required the seeded and incu bation of a eukaryotic cell line. For this experiment SLK cells were grow n in on 10 cm plate in 10 mL of Dulbecco’s Modification of Eagle’s Medium by Sigma Life Sc iences which contained 4.5 g/ L of glucose and L-glutamine without sodium pyruvate. The incubation proceeded at 37C and under an atmosphere containing 5% CO2 until a high confluence had been reach ed. The media was then removed and the cells washed with 2 mL of Dulbecco’s Phos phate Buffered Saline solution. Cell removal took place five minutes after the ad dition of 2 mL of tryspin solution that was also produced by Sigma with addition of new DMEM. The so lution was spun down at 1100 rpm for 5 minutes before the supernatant was discarded and the cells were resuspended in 6 mL of new DMEM. A 100L sample of this new suspension was th en mixed with 100L of Trypan Blue. Ten microliters of these dyed cells were then placed in a hemocytometer for counting. From this act, the concentration was determined and the appropr iate amount of solution was placed into each well of a 24-well plate to ensure cells/well. Five hundred microliters of DMEM were

PAGE 9

9 added to each well and cells were allowed to in cubate for 24 hours under the previously stated conditions. The final stage of the experiment occurred when these samples of experimental plasmid were co-transfected with already produced expr ession vectors that either contained genes for vFLIP, or vCyclin into the SLK cells. This wa s accomplished through the use of the TransIT-293 reagent made by Mirus. Nine microliters of ro om temperature reagent were placed in a reaction vessel which contained 150 L of Opti-MEM I Reduced-Serum Medium, 3 L of expression vector, 3 L of experimental vector, and 6 L of CMV-pRL as an internal control. All the vectors had a concentration of 0.5 g/ L. After mixing, the solution was allowed to sit at room temperature for 20 minutes to allow for the form ation of DNA-filled micelles with 50 L from each reaction vessel being placed in three wells. After 48 hour incubation, the media was removed, 200 L of PBS was applied to clean the wells, and the cells were lysed using 100 L of 1x Passive Lysis Buffer. Rocked for twenty minutes at 3 rpm, the lysate was cleared from each well and placed in a centrifuge tube before be ing spun for five minutes at 14,000 rpm. Seventyfive microliters of the remaining supernatant was removed and placed in a new centrifuge tube before being centrifuged again for 10 minutes at 14,000 G. Twenty five microliters of the remaining lysate was removed from each centrifuge tube and positioned in one well of a 96 well plate. From here the remaining cellular products were tested for lucifera se and renilla activity through the use of Dual Luciferase Report kit by Promega using a FLUOstar Optima.

PAGE 10

10 Results The following figures show the luciferase activit y of the Full 1,000 base pair, 500 base pair, 100 base pair, 70 base pair, and 30 base pair promoter s in cells that contain either vFLIP or vCyclin. The enzyme activity in the full length promoter in vFLIP only reached RLU while the lowest experimental promoter, 500 bp, had a value RLU. This more than tenfold increase was repeated with the vCyclin data and was maintained even after normalization against the activity of Renilla in the transfected cells. The error bars are the 95% confidence interval using t=2.920 and tw o degrees of freedom. Figure 5 Normalized Activity of Promoters with vFLIP 0 20000 40000 60000 80000 100000 120000 140000 Full5001007030Luciferase Activity (RLU)Promoter Length (Base Pairs)Luciferase Activity of Promoters with vFLIP

PAGE 11

11 Figure 6 Normalized Activity of Promoters with vCyclin Figures Seven and Eight depict th e relative activity of the experi mental promoters compared to the full length of the miR-17-92 promoter when co -transfected with an expression plasmid that contained either vFLIP or vCyclin. The luciferase data was first normalized against the results of a Renilla assay, a gene with a promoter that does not respond to vFLIP or vCyclin. The error bars depict the 95% confidence interv al for the experimental data. 0 10000 20000 30000 40000 50000 60000 70000 Full 5001007030Luciferase Activity (RLU)Promoter Length (Base Pairs)Luciferase Activity of Promoters with vCyclin

PAGE 12

12 Figure 7 Relative Activity of Experimental Compared to Full Promoters with vFLIP Figure 8 Relative Activity of Experimental Compared to Full Promoters with vCyclin Conclusion The deletion analysis of the miR-17-92 reveal ed a relatively consistent activity among the partial promoters. These results indicate that th e viral proteins are able to induce a pathway which activates a site that exists within thirty base pairs of the start of th e coding region. In these 0 5 10 15 20 Full5001007030Fold ChangePromoter Length (Base Pairs)Relative Luciferase Activity of Experimental to Full Length Promoters with vFLIP 0 2 4 6 8 10 12 14 16 Full5001007030Fold ChangePromoter Length (Base Pairs)Relative Luciferase Activity of Experimental to Full Length Promoters with vCyclin

PAGE 13

13 deletion promoters the E2F family does not play a major role in its upre gulation. According to gene prediction as done by Promo the thirty base pair promoter possessed no E2F1 binding sites yet had similar functionality to the one hundred ba se pair promoter which contained three E2F1 sites.3,4 Furthermore, in the presence of vFLIP or vCyclin, these promoters had far greater activity than the full length promoter as well. Upon the expression of vFLIP, the 500 bp promoter, which had the lowest activ ity, caused an expression of luciferase that was greater than the full length promoter by a factor of From this it can a ssumed that upstream of five hundred base pair promoter, there is a major repressor site which was cut off during this experiment. Both the search for the repressor site upstream of 500 base pairs and the activator site downstream of 30 base pairs presents aven ues for further research. Promoter fragments could be created of lengths between five hundred base pairs and the full length of nearly one thousand base pairs in search of the repressor site. Concurrently promoter segments of less than 30 bp in length could be cr eated in the search for the activation site influenced by the viral proteins. Both these experiments would follow si milar methodology to that described within this report.

PAGE 14

14 References 1. Boss, I. W., Plaisance, K. B., & Renne, R. (2009). Role of virus-encoded microRNAs in herpesvirus biology. Trends in Microbiology, 17(12), 544-553. doi:http://dx.doi.org.lp.hsc l.ufl.edu/10.1016/j.tim.2009.09.002 2. Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M., & Moore, P. S. (1994). Identification of herpesvirus-like DNA sequences in AIDSassociated kaposi's sarcoma. Scie nce, 266(5192), 1865-1869. Retrieved from http://www.jstor.org/stable/2885040 3. Engelmann, D., & Putzer, B. M. (2012). The dark side of E2F1: In transit beyond apoptosis. Cancer Research, 72, 571-575. 4. Farr, Domnec; Roset, Rom; Huerta, Mario; Adsuara, Jos E.; Rosell, Lloren; Alb, M.Mar; Messeguer. Xavier. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res 31, 13, 3651-3653, 2003. 5. Messeguer, Xavier; Escudero, Ru th; Farr, Domnec; Nuez, Oscar; Martnez, Javier; Alb, M.Mar. PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics 18, 2, 333-334, 2002. 6. O'Donnell, K. A., Wentzel, E. A., Zeller, K. I., Dang, C. V., & Mendell, J. T. (2005). cmyc-regulated microRNAs modulate E2 F1 expression. Nature, 435(7043), 839-843. doi:10.1038/nature03677 7. Sylvestre, Y., De Guire, V., Querido, E., Mukhopadhyay, U. K., Bour deau, V., Major, F., Chartrand, P. (2007). An E2F/miR-20a au toregulatory feedback loop. Journal of Biological Chemistry, the, 282, 2135-2143. doi:10.1074/jbc.M608939200 Acknowledgements I would simply like to think Hong Seok Choi, Dr. Renne, and the other members of the Renne Lab for all their help during my research.