<%BANNER%>

UFIR



Selection of Aptamers specific for adipose tissue
http://www.plosone.org/home.action ( Publisher's URL )
CITATION PDF VIEWER
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/IR00001301/00001
 Material Information
Title: Selection of Aptamers specific for adipose tissue
Physical Description: Journal Article
Creator: Sefah, Kwame
Liu, Jun
Liu, Huixia
Liu, Bo
Pu, Ying
Van Simaeys, Dimitri
Tan, Weihong
Publisher: Public Library of Science
Publication Date: May 25, 2012
 Notes
Abstract: Background: Obesity has reached epidemic proportions, affecting more than one tenth of the world’s population. As such, adipose tissue is being increasingly recognized as an important therapeutic target for obesity and related metabolic disorders. While many potential targets of adipose tissue have been established and drugs developed, very few of those drugs specifically target adipose tissue without affecting other tissue. This results from a limited knowledge of both cell surface markers and physicochemical traits specific to adipocytes that might otherwise be exploited by circulating drugs. Methodology/Principal Findings: Here we report the use of cell-SELEX technology to select two aptamers that can specifically recognize mature adipocytes: adipo-1 and adipo-8. Adipo-8 shows high affinity for differentiated, mature 3T3-L1 adipocytes with a Kd value of 17.865.1 nM. The binding was sustained upon incubation at 37uC and insulin stimulation, butwas lost upon trypsin treatment. The binding ability was also verified on frozen tissue slides with low background fluorescence and isolated adipocytes. Conclusions/Significance: Aptamer adipo-8 selected from a random library appears to bind to mature differentiated adipocytes specifically. This aptamer holds great promise as a molecular recognition tool for adipocyte biomarker discovery or for targeted delivery of molecules to adipocytes.
Acquisition: Collected for University of Florida's Institutional Repository by the UFIR Self-Submittal tool. Submitted by Kwame Sefah.
Funding: This work was supported by the National Key Scientific Program of China (2011CB911001, 2011CB911003) and by the Natural Science Foundation of Hunan Province (07JJ5108), China. This work is also supported by grants awarded by the National Institutes of Health (GM066137, GM079359 and CA133086). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
 Record Information
Source Institution: University of Florida Institutional Repository
Holding Location: University of Florida
Rights Management:
This item is licensed with the Creative Commons Attribution License. This license lets others distribute, remix, tweak, and build upon this work, even commercially, as long as they credit the author for the original creation.
System ID: IR00001301:00001

Downloads

This item is only available as the following downloads:

Liu_et_al._PLoS_ONE ( PDF )


Full Text

PAGE 1

SelectionofAptamersSpecificforAdiposeTissueJunLiu1,2,HuixiaLiu1* ,KwameSefah2,BoLiu1,YingPu1,DimitriVanSimaeys2,WeihongTan2*1 DivisionofGeriatrics,XiangyaHospital,CentralSouthUniversity,Changsha,Hunan,China, 2 CenterforResearchatBio/NanoInterface,DepartmentofChemistryand DepartmentofPhysiologyandFunctionalGenomics,ShandsCancerCenter,UFGeneticsInstituteandMcKnightBrainInstitute,UniversityofFlorida ,Gainesville,Florida, UnitedStatesofAmericaAbstractBackground:Obesityhasreachedepidemicproportions,affectingmorethanonetenthoftheworld’spopulation.Assuch, adiposetissueisbeingincreasinglyrecognizedasanimportanttherapeutictargetforobesityandrelatedmetabolic disorders.Whilemanypotentialtargetsofadiposetissuehavebeenestablishedanddrugsdeveloped,veryfewofthose drugsspecificallytargetadiposetissuewithoutaffectingothertissue.Thisresultsfromalimitedknowledgeofbothcellsurfacemarkersandphysicochemicaltraitsspecifictoadipocytesthatmightotherwisebeexploitedbycirculatingdrugs.Methodology/PrincipalFindings:Herewereporttheuseofcell-SELEXtechnologytoselecttwoaptamersthatcan specificallyrecognizematureadipocytes:adipo-1andadipo-8.Adipo-8showshighaffinityfordifferentiated,mature3T3-L1 adipocyteswithaKdvalueof17.8 6 5.1nM.Thebindingwassustaineduponincubationat37 u Candinsulinstimulation,but waslostupontrypsintreatment.Thebindingabilitywasalsoverifiedonfrozentissueslideswithlowbackground fluorescenceandisolatedadipocytes.Conclusions/Significance:Aptameradipo-8selectedfromarandomlibraryappearstobindtomaturedifferentiated adipocytesspecifically.Thisaptamerholdsgreatpromiseasamolecularrecognitiontoolforadipocytebiomarkerdiscovery orfortargeteddeliveryofmoleculestoadipocytes.Citation: LiuJ,LiuH,SefahK,LiuB,PuY,etal.(2012)SelectionofAptamersSpecificforAdiposeTissue.PLoSONE7(5):e37789.doi:10.1371/ journal.pone.0037789 Editor: MariaGasset,ConsejoSuperiordeInvestigacionesCientificas,Spain Received December7,2011; Accepted April27,2012; Published May25,2012 Copyright: 2012Liuetal.Thisisanopen-accessarticledistributedunderthetermsoftheCreativeCommonsAttributionLicense,whichpermitsunrestricted use,distribution,andreproductioninanymedium,providedtheoriginalauthorandsourcearecredited. Funding: ThisworkwassupportedbytheNationalKeyScientificProgramofChina(2011CB911001,2011CB911003)andbytheNaturalScienceFoundationof HunanProvince(07JJ5108),China.ThisworkisalsosupportedbygrantsawardedbytheNationalInstitutesofHealth(GM066137,GM079359andCA13308 6).The fundershadnoroleinstudydesign,datacollectionandanalysis,decisiontopublish,orpreparationofthemanuscript. CompetingInterests: Theauthorshavedeclaredthatnocompetinginterestsexist. *E-mail:lhx900@yahoo.com.cn(HL);tan@chem.ufl.edu(WT)IntroductionObesityhasreachedepidemicproportionsinmostindustrializedcountries,leadingtoanincreasedprevalenceofmetabolic syndromecharacterizedbyvisceralobesity,hypertension,dyslipidemia,andinsulinresistance.Adiposetissuehaslongbeingviewed solelyasasiteforpurefatstorage.However,duringthelast20 years,adipokines,oradipocytokines,whicharecell-to-cell signalingproteinssecretedbyadiposetissue,havebeenstudied andcharacterized,leadingtoasurgeofscientificinterestin adipocytes.Adiposetissueisprimarilycomposedofadipocytes, whicharecellsthatstorefatasenergy,butadipocytesalsohavean endocrinefunctioninregulatingenergyhomeostasisandservingas anintegratorofvariousphysiologicalpathways[1,2,3]. Manystudieshavedemonstratedthatobesity,particularly visceralobesity,ismainlyinvolvedinincreasingtheclinicalriskof metabolicandcardiovasculardiseases[4,5].Visceraladiposetissue isnowthoughttoplayapivotalroleinmetabolicsyndromeandits clinicalconsequences[6,7].Targetingadiposetissueasawayto treatthesediseaseshasbeeninvestigatedandtested[8].For example,peptidemotifhomingtowhitefatvasculaturehasbeen developedusingthephagedisplaymethod.Conjugationwithproapoptoticpeptide[9]and11 b -hydroxysteroiddehydrogenasetype 1(11 b -HSD1)inhibitor[10]hasalsoshownsomepromising results. Targeteddeliveryofdrugsspecifictoadiposetissuehasalso beenenvisionedasaneffectivemethodtotreatmetabolicdisorders [8,11,12].However,whilemanypotentialtargetsofadiposetissue havebeenestablishedandcandidateanti-obesitydrugshavebeen developed,noneofthosedrugsspecificallytargetsadiposetissue, leadingtoundesirablesideeffectsandlowerefficacies.Thisresults fromalimitedknowledgeofbothcell-surfacemarkersand physicochemicaltraitsspecifictoadipocytesthatmayotherwise beexploitedbycirculatingdrugs. Cell-SELEXisanestablishedmethodusedtoselectshort strandsofnucelotides,calledaptamers,whichareableto recognizetargetcellswithhighbindingaffinityandspecificity. Currently,aptamershavebeengeneratedfromseveralcelllines usingthistechnique,includingleukemiacells[13],glioblastoma cells[14]andlungcancercells[15].Aptamersgeneratedfromthis methodalsoprovideanalternativetoolforthediscoveryofcellsurfacebiomarkersthatcandistinguishtargetcellsfromothercell lines[16,17,18].Moreover,aptamerscanbeeasilyengineeredto carrydrugpayloads,e.g.,siRNAs(14).GiventheabilityofsiRNAs toknockdownanygeneofinterest[19],turningoffgeneactivity viasiRNAscouldhavetherapeuticbenefits.Drugsdeliveredinthis waywillsignificantlyenhanceefficacyofdrugtherapy,while avoidingsideeffectsbyunwantedactiononothercelltypes. Byusing3T3-L1,asapositiveadipocytecellline,andbothits precursorpreadipocyteandHepG2asnegativecelllines,wehave PLoSONE|www.plosone.org1May2012|Volume7|Issue5|e37789

PAGE 2

selectedanadipocyte-specificaptamerusingcell-SELEXtechnology.Thisaptamer,denotedadipo-8,bindswithhighaffinityonly todifferentiatedadipocytes,butnottopreadipocytesorothercell linestested.Byitsabilitytospecificallyrecognizemature adipocytes,thisaptamermayalsoserveasatoolforadipocyte biomarkerdiscoveryoreventargeteddeliveryofdrugsforthe treatmentofadipocyte-relatedmetabolicdisease.ResultsandDiscussion EnrichmentofAptamerCandidateUsingCell-SELEXAsdescribedinMethods,cell-SELEXwasusedtoselect aptamercandidatesfromarandomlibraryagainstthemature adipocytecellline3T3-L1,aclassicalcelllineforthestudyof adipocytes invitro .Upondifferentiation,preadipocytestransform fromfibroblast-likecellsintomaturelipid-containingadipocytes thatsharemanycharacteristicsofadiposecells invivo .Toexclude aptamercandidateswhichbindtowidelyexpressedmembrane proteinsandtheirprecursorpreadipocytes,livercancercellline HepG2andundifferentiatedpreadipocyteswereusedforcounter selection. Theselectionprocesswasinitiatedbyincubating20pmolof libraryssDNA’swithmature3T3-L1cellsonacultureplate.After washing,cellswerecollected,andthosesequencesbindingto targetwereelutedbyheatingthecollectingsolutionto95 u C. Sequencesthatboundtogeneralcellsurfacetargetswereremoved byincubatingtheenrichedpoolwithundifferentiated3T3-L1cells (rounds2,4,6,8,10and12–19)andHepG2cells(rounds3,5,7,9 and12).Aftereachround,theelutedpoolwasPCR-amplified,and thessDNArecoveredfromthePCRproductwasusedforthenext roundofselectionorforflowcytometrytomonitorpool enrichment.Incontrasttoothercelllines,differentiated3T3-L1 adipocytesappearedasscattereddotsinSideScatter(SSC)and ForwardScatter(FSC)flowcytometry,resultingfromthespeedof adipogenesisamongindividualcells.Inthedotplot,SSCreflects thegranularityofthecell,whileFSCreflectsthecellsize.As reportedintheliterature,3T3-L1cellswillmoveupwardinSSC afterdifferentiationintomatureadipocytesduotoincreased cytoplasmicgranularitycausedbylipiddropletaccumulation [20,21].Therefore,wesetacutoffpointat 200sothatadotplot abovethisvaluewouldberegardedasreportingdifferentiated, matureadipocytes(FigureS1),whilebelowthisvalue,only undifferentiatedcellsorcelldebriswereexpected. Afterarepeatedpositive-negativeselectionprocess,weobserved acleardotplotshiftfromtheoriginalpoolinflowcytometryby incubatingthepoolenrichedfromthe13throundwithdetached adipocytes.InthedotplotFigure1A,onlyafewcellsappearedin theupperrightquadrant.Whenlibrarypoolwasaddedtothe cells,wenoticedaclearcellpopulationintheleftupperquadrant. However,fromthe6thtothe13throundpool,thecellpopulation shiftedtotheupperrightquadrant.Thistendencywasclearly illustratedinthehistogramaftergating;therewasaclearshift fromlefttorightandfromthe6thtothe16thpool.Ontheother hand,fromthe16thtothe19thpool,nofurthershiftwasnoticed (Figure1B).Theseresultsindicatedthatthepoolwassuccessfully enrichedforsequenceswhichbindtomembranetargetsexpressed bythematureadipocyte.Thesepoolswerethentestingforbinding tothenegativecelllines.Noneoftheenrichedpoolscouldbindto preadipocytes(Figure1C)orHepG2cells(FigureS2).Poolsignals werealsoreducedrelativetobackgroundinthepreadipocytes. Sincemostpoolsequencesappearedtobindonlysurfacemarkers expressedinmature3T3-L1adipocytes,thepoolsgeneratedfrom rounds13,17,and19weregel-purifiedandsequenced.SequencesSelectedforSynthesisandTestsforBinding AbilityAnalysisoftheenrichedpoolsfromrounds13,17,and19, indicatedthattheycouldallbecategorizedinto8familiesbased ontheirsequencehomology.Eightsequencesshowinghighest homologyamongthedifferentpoolswereregardedasaptamer candidatesandsynthesized.Tofurthertestthebindingabilityof individualsynthesizedaptamers,biotinwascoupledtothe5 9 end ofeachaptamercandidateandstreptavidin-PEwasaddedforflow cytometry.Amongeightfamiliestested,aptamersadipo-1and adipo-8hadthestrongestbinding(Figure2A,BandFigureS3). DetailedsequencesareshowninTable1.Aptamers(250nM) werealsotestedwithcontrolcells,andflowcytometryshowedno bindingforeitheraptamertopreadipocytesorHepG2cells. AsshowninFigure2C,thebindingKdwasalsodetermined. ThecalculatedKdsofadipo-1andadipo-8tomatureadipocytes were97.5 6 13.5nMand17.8 6 5.1nM,respectively.Thebinding ofthesetwoaptamerstoadipocyteswasalsoverifiedbyconfocal microscopy.AsshowninFigure3,almostnosignalwasobserved wheninitiallibrarywasincubatedwiththedifferentiated adipocytes.However,whenadipo-1wasincubatedwithcells,we observedaroundredsignallocatedintheperipheralareaofthe lipid-containingadipocytes.Thesignalbecamemuchstronger whenadipo-8wasincubatedwithmatureadipocytes,indicating thatadipo-8bindsmorestronglythanadipo-1tomature adipocytes.SpecificityofSelectedAptamersNext,thespecificbindingoftheaptamersselectedagainst3T3l1adipocyteswastestedagainstthefollowingcelllines:A549 (humanlungadenocarcinomaepithelialcellline),Hct116cells (colorectalcarcinomaHCT-116cells),humanBcells,Tcells, CK562(humanerythroidleukemia),Ramos(humanBurkitt’s lymphomacellline),PL45(pancreaticcancercells),MCF-7(breast cancercells)andA172(humanglioblastomacellline).Asshownin Table2,noneofthesecelllinesshowedbindingtoadipo-8,whilea slightshiftcouldbeobservedintheA549,PL45,andMCF-7cell lineswithadipo-1.After3T3-L1preadipocytesdifferentiateinto adipocytes,thefollowingknownproteinsareexpressedonthecell membrane:GLUT4[22],fattyacidtransportprotein(FATP1) [23],fattyacidtranslocase(FAT/CD36)[24],plasmamembrane fattyacidbindingprotein(FABPpm)[25],Insulin-responsive aminopeptidase(IRAP)[26],transferrinreceptor(TfR)[27],and Caveolaanditsproteins[28].Sincealloftheseproteinsarealso expressedoneitherhepatocytesormusclecells,wenexttestedthe bindingabilityofadipo-8tohepG2cells,WThepatocytes,and differentiatedC2C12cells(musclecells).Again,however,no bindingshiftcouldbeobserved,demonstratingthattheselected aptameradipo-8hadhighspecificitytomature3T3-L1adipocytes.CharacterizationofSelectedAptamersTwobroad-spectrumserineproteases,trypsinandproteinaseK, withdifferentmechanismsofaction,werealsousedinthebinding studiesofadipo-1andadipo-8.Aftertreatmentofmature adipocytewithtrypsinfor30min,therewasnosignificantshift backobservedwithadipo-1.However,thesametreatmentwith adipo-8didresultinasignificantflowcytometryshiftback (Figure4),indicatingthatthetargetmoleculebindingwithadipo-8 ismostlikelysomekindofprotein.Inaddition,sinceselection processesaregenerallyperformedat4 u C,wealsotestedwhether physiologicaltemperaturewouldaffectthebindingability. Aptamersadipo-1andadipo-8wereincubatedwithtargetcellsAptamersforAdipocyteCells PLoSONE|www.plosone.org2May2012|Volume7|Issue5|e37789

PAGE 3

Figure1.Flowcytometryresultsforselectedpools(500nM)withdifferentiated3T3-L1adipocyteandpreadipocytecells. (A)Dot plotofflowcytometrywithselectedpools.(B)Flowcytometryassaytomonitorthepoolenrichmentfordifferentiated3T3adipocytes.(C)Theslight shiftoftherespectivepoolstocontrol3T3-L1preadipocytewasrecoveredbycounterselection. doi:10.1371/journal.pone.0037789.g001 Figure2.Characterizationofselectedaptamers. FlowcytometryforthebindingofPE/cy5-labledadipo-1(A)andadipo-8(B)todifferentiated 3T3-L1adipocytesataconcentrationof250nM.(C)Kddeterminationforadipo8.AdipocyteswereincubatedwithvaryingconcentrationsofPE-Cy5labeledadipo8aptamer.Therelativefluorescenceintensityrepresentsaratioobtainedthroughthefollowingformula:relativefluorescensce intensity=[(fluorescensceofaptamer-fluorescensceoflibrary)/fluorescensceoflibrary].Errorbarsrepresentstandarddeviations.Eachdat apoint wasperformedintriplicate. doi:10.1371/journal.pone.0037789.g002 AptamersforAdipocyteCells PLoSONE|www.plosone.org3May2012|Volume7|Issue5|e37789

PAGE 4

at37 u Cand4 u C,butnodifferencesinbindingabilitywere observedateithertemperature(Figure5A,B). Mostcurrentlyknownproteinsexpressedontheadipocyte membranesurfaceafterdifferentiationareresponsivetoinsulin stimulation.Forexample,proteinslikeGLUT4,FATP1,IRAP haveten-foldincreasedexpressioninthecellmembraneupon insulinstimulation,whileotherproteinslikeFAT/CD36, FABPpm,TfRincreasetwo-tothree-fold[29,30,31,32].Consequently,wetestedwhetherinsulinstimulationwouldaffectthe bindingabilityofadipo-8.Serumstarvationwasperformedbefore theexperimenttoincreasecellularresponsetoinsulin[33].Cells werethentreatedwithinsulinataconcentrationof160nMbefore flowcytometry.However,nosignificantshiftchangeswere observedwithorwithoutinsulinstimulation(Figure5C),indicatingthatthisaptamermaybindtoaproteinthatisnotinvolvedin theinsulinsignalingpathwayand,further,thatitmaybeapossible adipocytebiomarkernotyetreported.BindingofSelectedAptamerAdipo-8toFrozenAdipose TissueSincetheselectedaptamersspecificallyboundtomature adipocytes,adipo-8wastestedtodetermineifitrecognized adiposetissueinarealclinicalsample.Tomaximallypreservethe antigensattheiroriginalstateontheadipocytecellmembrane, epididymaladiposetissuewasremovedimmediatelyaftersacrifice oftheratandusedforfrozenslide.Afterfixingwithcoldacetone for10min,thefrozenslidewasusedforstainingwithcy5-labled adipo-8andcy5-labeledlibrarycontrol.TheresultsoffluorescenceimagingandH&EstainingareillustratedinFigure6. Althoughaverystrongfluorescencewasnotedwithadiposetissue, verylimitedbackgroundfluorescencecouldbeobservedwhen cy5-labeledlibrarywasincubatedwiththeadiposetissueslide,a resultwhichiscontrarytoapreviousreportofhighbackground fluorescencewhenaptamerswereincubatedwithformalin-fixed, antigen-retrievedtissue[34,35].Wehavealsoextendedthe bindingtesttofrozenslidesfromliver,skeletalmuscle,pancreatic tissue,andnofluorescencewasobserved(FigureS4).Toexplain thisinconsistency,itisproposedthattheextensiveintra-and intermolecularcrosslinksoftissueproteinsinducedbyformalin mayincreasethechanceofnonspecificbinding.Furtherinvestigationisneededtoevaluatethisphenomenonbycomparingthe effectofvariousmodesoftreatingtissuesectionsforbinding ability.BindingofSelectedAptamerAdipo-8toIsolatedRat AdiposeCellsSincetheaptameradipo-8selectedfrom3T3-L1celllineshows bindingtoadiposetissuefromS-Drats,wetheninvestigated whetherthisaptamercanbindwithisolatedadipocytes.The adiposetissuecontainsdifferentcellsincludingadipocytes, preadipocytes,fibroblasts,aswellastissueresidentmacrophages, andvascularconstituents[36].Primaryadipocyteswerethen isolatedfromepididymalfatpadsusingmethodsdescribedby Sugihara[37].Theadipocytescanbeeasilyseparatedfromother celllinesduetotheirfloatingpropertiesaftercentrifugation.We thentestedthebindingofcy5labeledadipo-8andtheunselected ssDNAlibrarywithfloatingadipocytesandpelletedcellsfrom digestedadiposetissueseparately.Afterincubationwiththe floatingadipocytesfor45min,weobservedstrongfluorescence underfluorescencemicroscopy,comparedtotheweakbackgroundfluorescenceobservedafterincubationwiththecontrol cy5-labledssDNAlibrary(Figure7).Furthermore,noprominent fluorescencecouldbeseenwhenpelletedcellswereincubatedwith adipo-8,demonstratingthattheaptamerprobablydidnotbindto othercellswithinadiposetissue. Inconclusion,wehaveselectedtwoaptamers,adipo-1and adipo-8thatcanrecognizedifferentiatedlipid-rich3T3-L1 adipocytesbycell-SELEXwithcounterselectionagainstpreadipocytesandHepG2cells.Inparticular,adipo-8showedhigh specificityandaffinitytowardsmatureadipocyteswithaKdof 17.8 6 5.1nM.Furthermore,adipo-8showednobindingtoany othercelllinetested,indicatingthatthisprobecouldbeusedto furthercharacterizemembraneproteinexpressionafteradipocyte differentiation.Furthertissueslidestestrevealedthattheadipo-8 canrecognizeadiposetissue,whilenostainingcanbeobservedon tissueslidesfromratliver,skeletalmuscle,pancreas.Theseresults indicatethatthisaptamerhasthehighpossibilityofbindingtoa moleculartargetspecificallyexpressedinadiposetissue,especially adipocytes.Severalstrategieshavebeenproposedforthe treatmentofmetabolicdiseaseviaspecifictargeteddeliveryof therapeuticdrugstoadiposetissue.Supportedbyourfindings,this probemayalsobeexploitedfordirecttargeteddeliveryofantiobesitydrugstoadiposetissue.Anotherinterestingfindinginthis studyisthatlittleornobackgroundfluorescencewasobserved whenaptamerswereincubatedwithfrozenslidesfromuntargeted tissue.Thus,performingSELEXonfrozentissueslidescouldbe exploredasanewstrategyforthediscoveryofnewtissuespecific biomarkers.MaterialsandMethods MaterialsandReagentsThe3T3-L1(Mouse3T3-L1preadipocytes),HepG2(liverhepatocellularcells),A549(humanlungadenocarcinomaepithelialcell line),Hct116cells(colorectalcarcinomaHCT-116cells),CK562 (humanerythroidleukemia),Ramos(humanBurkitt’slymphoma cellline),PL45(pancreaticcancercells),MCF-7(breastcancer cells)andA172(humanglioblastomacellline)wereobtainedfrom ATCC(AmericanTypeCultureCollection,Manassas,VA,USA). HumanBcellsandTcellsweregiftsfromLung-JiChang(Dept.of MolecularGeneticsandMicrobiology,UniversityofFlorida). C2C12cellswerekindlyprovidedbySallyE.Johnson(Dept.of AnimalSciences,UniversityofFlorida).Dulbecco’smodified Eagle’smedium(DMEM),calfserum(CS),FBS,OilRedO, phosphate-bufferedsaline(PBS),paraformaldehyde,bovineserum albumin(BSA),3-isobutyl-1-methyxanthine(IBMX),insulinand dexamethasone(DEX)werepurchasedfromSigma(St.Louis, MO).Libraryandaptamersweresynthesizedona3400DNA/ Table1. Detailedsequencesofaptamersusedinthebindingassay(primersareblue-colored).NameSequence Adipo-1ATGAGAAGCGTCGGTGTGGTTACTCCGGGCACTTGATATATCGATATGGAGAATAATGCACCCTGAGCGGGCTGGCAAGGCGCATA Adipo-8ATGAGAAGCGTCGGTGTGGTTAAACACGGAACGAAGGTGCAGGAAGATTTGTCGATGCGGTGCCTGAGCGGGCTGGCAAGGCGCATA doi:10.1371/journal.pone.0037789.t001 AptamersforAdipocyteCells PLoSONE|www.plosone.org4May2012|Volume7|Issue5|e37789

PAGE 5

Figure3.Confocalimagesofaptamersstainedwithcultureddifferentiated3T3-L1adipocytes. Cellswereincubatedwithaptamers conjugatedwithbiotin,andbindingeventswereobservedwithPE-conjugatedstreptavidin.(A)unselectedPE-labeledlibrary;(B)adipo-1;(C)and adipo-8.Thefinalconcentrationoftheaptamersinthebindingbufferwas250nM. (Left )fluorescenceand( Right )opticalimagesofdifferentiated 3T3-L1adipocytes. doi:10.1371/journal.pone.0037789.g003 AptamersforAdipocyteCells PLoSONE|www.plosone.org5May2012|Volume7|Issue5|e37789

PAGE 6

RNAsynthesizer(AppliedBiosystems,FosterCity,CA).The sequenceswerethendeprotectedinAMA(ammoniumhydroxide/ 40%aqueousmethylamine1:1)andpurifiedbyreversed-phase HPLC(ProStar,Varian,WalnutCreek,CA,USA).Taqpolymerase,dNTPsandotherreagentswerepurchasedfrom Takara.PCRwasperformedonaBioradThermocycler.Trypsin andProteinaseKwerepurchasedfromFisherBiotech.CellCultureandStainingThe3T3-L1preadipocyteswereculturedinDMEMwith10% calfserumat37 u Cina10%CO2incubator.Thecellswere differentiatedasdescribedpreviously[38,39].Briefly,3T3-L1cells weregrowntoconfluencyin10%calfserum/DMEM.Twodays post-confluency(DAY0),celldifferentiationwasinitiatedby addingMDImedia(DMEMcontaining10%FBS,0.5mM3isobutyl-1-methylxanthine,1mMdexamethasone,and1.67mM insulin).After48h(DAY2),theincubationmediumwasreplaced withinsulinmedia(DMEMcontaining10%FBS,1.67mM insulin).Twodayslater(DAY4),themediumwaschangedto 10%FBS/DMEM.Cellswereincubatedwith10%FBS/DMEM everytwodaysthereafter.Fulldifferentiationwasusuallyachieved byDAY8.OnDAYS0,4,6,8and10,cellswerefixedwith4% formalininPBS(pH7.4)andstainedwithOilRedOtoevaluate thedifferentiationrate.Differentiated3T3-L1cellsatDAY10 wereusedforsubsequentexperiments.Allothercelllinesusedfor selectivityassayswereculturedaccordingtoATCCspecifications.Cell-SELEXProcedureThelibraryofsyntheticDNAs,composedofacentral randomizedsequenceof45nucleotidesflankedbytwo20-nt primerhybridizationsites(5 9 -ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCT CCTACA-3 9 ),wasamplifiedusingaFITC-labeled5 9 -primer(5 9 FITC-ATGAGAGCGTCGGTGTGGTA-3 9 )andabiotin-labeled3 9 -primer(5 9 -biotin-TACTTCCGCACCCTCCTACA-3 9 ). Cell-SELEXwasperformedaspreviouslydescribed[40].Briefly, thessDNApool(100pmol)in400mLbindingbufferwas denaturedbyheatingto95 u Cfor5minandthencoolingonice for5minforbetterfolding.ThessDNApoolwasthenincubated withdifferentiated3T3-L1adipocytesat4 u Cfor1hour.After washing,cellswerecollectedin300mLbindingbufferina1.5mL tube,andtheboundssDNAswereelutedbyheatingat95 u C.After centrifugation,thesupernatantwasincubatedwithundifferentiated3T3-L1preadipocytesorHepG2cellsforcounterselection. Aftercentrifugation,thesupernatantwasPCR-amplifiedwith FITC-andbiotin-labeledprimers.TheselectedsensessDNAwas separatedfromthebiotinylatedantisensessDNAstrandby streptavidin-coatedSepharosebeads(AmershamPharmaciaBiosciences)in0.2MNaOH.ThepurifiedssDNAswerethenused forthenextscreeninglibraryorforpoolenrichmentmonitoredby flowcytometry.FlowCytometricAnalysisMatureadipocytesandundifferentiatedprecursorswerefirst washedwithPBSanddetachedwithnonenzymaticdissociation bufferfor15min.Afterwashing,50 6 104cellswereincubated withFITC-labeledssDNApooldissolvedin200mLbindingbuffer atafinalconcentrationof250nMfor45min.Cellswerewashed twicewith1mLwashingbufferandresuspendedin200mL bindingbuffer.FluorescencewasdeterminedwithaFACScan cytometer(BDImmunocytometrySystems)bycounting30,000 events.TheFITC-labeledunselectedssDNAlibrarywasusedasa negativecontrol.Whenthelevelofenrichmentreachedaplateau Table2. Relativebindingofaptameradipo-1andadipo-8withdifferentcelllines.3T3-L1A549 HumanB cell HumanT cell Hct 116 CK 562RamousPL45MCF-7A172HepG2 WT hepatocytesC2C12 Adipo-1 +++ 22222 ++ 2222 Adipo-8 +++ 222222222222 doi:10.1371/journal.pone.0037789.t002 Figure4.Preliminarydeterminationofthenatureofthemoleculartargetstowhichaptamersbind. Effectoftrypsintreatmentonthe bindingabilityofadipo-1(A)andadipo-8(B)todifferentiated3T3-L1adipocytes.Theconcentrationofaptamersinthebindingbufferwas250nM. doi:10.1371/journal.pone.0037789.g004 AptamersforAdipocyteCells PLoSONE|www.plosone.org6May2012|Volume7|Issue5|e37789

PAGE 7

andnofurthershiftcouldbeobserved,poolsofinterestwere submittedforsequencing.AffinityTestsofAptamersThebindingaffinityofaptamerswasdeterminedbyincubating differentiated3T3-L1cells(5 6 105)onicefor30mininthedark withvaryingconcentrationsofbiotin-labeledaptamerina200mL volume.Cellswerewashedthreetimeswith1000mLWB, followedbyresuspensionin150mLBBcontainingstreptavidinPEforanother15min.Afterwashing,cellsresuspendedin200mL washingbufferwerethensubjectedtoflowcytometry,with5 9 biotin-labeledlibraryasnegativecontrol.Alloftheexperiments forbindingaffinitywererepeatedatleastthreetimes.Therelative fluorescenceintensityrepresentsaratioobtainedthroughthe Figure5.Flowcytometryassaystoassessifaptamers’bindingabilitytomatureadipocytescanbeinfluencedbytemperatureand insulinstimulation. Effectsoftemperature(A,B)andinsulinstimulation(C)onthebindingabilityofadipo-1andadipo-8(250nM)todifferentiated 3T3-L1adipocytes. doi:10.1371/journal.pone.0037789.g005 Figure6.(A)HEstainingoffrozenadiposetissuefromSDrats. (B)Adiposetissuefrozensectionsstainedwith200nMCy5-labeledlibrary (250nM)(C)Adiposetissuefrozensectionsstainedwith200nMCy5-labeledadipo-8(250nM). doi:10.1371/journal.pone.0037789.g006 AptamersforAdipocyteCells PLoSONE|www.plosone.org7May2012|Volume7|Issue5|e37789

PAGE 8

followingformula:relativefluorescensceintensity=[(fluorescensceofaptamer-fluorescensceoflibrary)/fluorescensceof library].ByusingSigmaPlot(Jandel,SanRafael,CA),the equilibriumdissociationconstants(Kd)oftheselectedaptamers tocellswerecalculatedbyfittingthedependenceoffluorescence intensityofspecificbindingontheconcentrationoftheaptamers totheequationY=BmaxX/(Kd+ X).ConfocalImagingofCellsBoundwithAptamerForconfocalimaging,thebiotin-labeledaptamersandunselectedcontrolssDNApoolswereincubatedwithcellsandwashed asdescribedforflowcytometry.AfterincubationwithBB containingstreptavidin-PE,cellswerewashedandsubjectedto confocalimagingwithanOlympusFV500-IX81confocal microscope.A5-mW,488-nmHe-Nelaserwastheexcitation sourceforthephycoerythrins(PE)throughouttheexperiments. Twenty-fivemicrolitersofcellsuspensionboundwithbiotinstreptavidin-PE-labeledssDNAweredroppedonathinglassslide placedabovea60xoil-immersionobjective(PLAPO60XO3PH ) withanumericalapertureof1.40(Olympus).SelectivityandSpecificityTodeterminethecellspecificityoftheselectedaptamers,cell lines,includingA549,Hct116cells,humanBcells,Tcells, CK562,Ramos,PL45,MCF-7,C2C12,andHepG2cells,were usedinbindingassaysbyflowcytometry,asdescribedabove. Figure7.Molecularrecognitionofadipo-8withisolatedadipocyte. Fluorescenceimageofisolatedmatureadipocytestainedbycy5-labled adipo-8(A),library(B).Fluorescenceimageofisolatedpelletedcellsoffromcollagenase-digestedadiposetissuestainedbycy5-labledadipo-8 (C). Thefinalconcentrationoftheaptamersinthebindingbufferwas250nM.Optical(Left)andfluorescence(Right)imageofadipocyteandpelleted cells. doi:10.1371/journal.pone.0037789.g007 AptamersforAdipocyteCells PLoSONE|www.plosone.org8May2012|Volume7|Issue5|e37789

PAGE 9

EffectofProteaseDigestionandTemperatureon AptamerBindingTargetcells(differentiatedadipocytes)weredetachedusinga nonenzymaticcelldissociationsolution.AfterresuspensioninWB, thecellswerewashedwith3mLofPBSandthenincubatedwith 1mLof0.05%trypsin/0.53mMEDTAinHBSSor0.1mg/mL proteinaseKinPBSat37 u Cfor15and30min,respectively.Pure FBSwasaddedtoquenchtheproteinases.Afterwashingwith 2mLofBB,thetreatedcellswereusedforbindingassays,as describedabove.Thebindingstabilityofselectedaptamerswas testedbyincubatingaptamerswithadipocytesat37 u C,while aptamersincubatedonicewereusedasthepositivecontrol, followedbyflowcytometry.EffectofInsulinonBindingAbilityofAdipo-8Afterserumstarvationfor20hours,matureadipocyteswere incubatedwithDMEMmediawith160nMinsulinfor10min. Afterwards,cellswerechilledoniceandincubatedwithbiotincoupledaptamerfor30min.Afterwashing,cellswereincubated withstreptavidin-PEdyefor15min.Afterwashing,cellswere detachedwithnonenzymaticdissociationbufferfor20minand usedforflowcytometry.StainingofRatAdiposeTissueFrozenSectionsUsing SelectedAptamersMaleSprague-Dawleyrats(n=4,200–250g)weresuppliedby theExperimentalAnimalCenterofCentralSouthUniversity.All proceduresperformedontheanimalswereincompliancewiththe ChineseCouncilofAnimalCareguidelines.Allexperimental animalswereapprovedbytheAnimalCareandUseCommittee ofXiangYaHospital,CentralSouthUniversity.Ratswere sacrificedbyvertebraldislocation.Afterfreshsegmentsof epididymaladipose,liver,skeletalmuscle,orpancreatictissue werefrozen,theywereembeddedinoptimalcuttingtemperature (OCT)compound,andtransversesections(10mm)weregenerated withacryostat,followedbymountingonchargedglassslides. Sectionswerefixedwithcoldacetonefor10minutesatroom temperatureandwashedeitherforH&Estainingorfor fluorescenceaptamerstaining.Forfluorescenceaptamerstaining, tissuesectionswereblockedwithbindingbuffercontaining10% BSAand1mMtRNAat4 u Cfor60minandthendroppedwith 300mLof250nMcy5-labeledaptamersinbindingbuffer.After incubationfor45minutes,thesetissuesectionswerewashedthree timeswithbindingbuffer.Finally,thestainedsectionswere imagedbyfluorescencemicroscopy(Nikon,Japan).Theexcitation wavelengthwas633nm,emissionfluorescencewasdetectedusing a670nmfilter,andtheexposuretimewas150ms.Preparationandincubationofadiposecellswithselected aptamersforfluorescencemicroscopy.MaleSpragueDawleyratswereusedtoobtainprimaryadiposecellsasdescribed previously[37].Briefly,theepididymalfatpadswereremovedand transferedto5.5mLprewarmedKRHbuffer(120mMNaCl, 5.2mMKCl,2.5mMCaCl2,1.2mMKH2PO4,1.2mM MgSO4,15mMNaHCO3,10mMHEPES,5.0mMD-glucose, 3%BSA,pH7.4).Thefatpadswerethenmincedwithasharp scissorsfor2min,and15mgcollagenasetypedissolvedin0.5mL KRHbufferwasthenaddedtothemixture.Afterincubatingina shakingwaterbathwithrapidshaking(120cycles/min)for60min at37 u C,thecellsweregentlypassedthroughstainlessmesh(pore size300mesh).Aftercentrifugationat400gatroomtemperature for1min,adipocyte(floatingcells)andpelletedcellswere resuspendedseparatelyin30mLfreshbuffer(37 u C).The centrifugationandwashingwererepeatedthreetimes.Thecells wereresuspendedin3mLbindingbuffer(approx2.5 6 106cells/ mL).Forfluorescencemicroscopy,thecy5-labeledaptamersand unselectedcontrolssDNApoolswereincubatedwithisolatedrat adiposecells.Theinfranatantwaswithdrawn,andthefloating cellswerewashedthreetimesandusedforfluorescence microscopy.Thepelletedcellswereincubatedandwashedas describedforflowcytometry.Twenty-fivemicrolitersofcell suspensionincubatedwithcy5-labeledaptamersorssDNAwere droppedonathinglassslideandsubjectedtofluorescence microscopyasdescribedabovewithanexposuretimeof150ms.SupportingInformationFigureS1Dotplotsofsidescatterversusforwardscatterof3t3L1cellsgeneratedfromflowcytometricanalysisoflevelsof granularityat0,10daysafterinduction.Theregionabovethebar wasgatedtoincludethedifferentiated3T3-L1cells. (TIF)FigureS2Flowcytometryassayofselectedpoolwithnegative HepG2cells. (TIF)FigureS3Thebindingcurveofadipocytesincubatedwith varyingconcentrationsofPE-Cy5-labeledadipo8aptamer(A),PECy5-labeledadipo1(B)andtheirunselectedlibrary.(Errorbars: SD,N=3). (TIF)FigureS4( Upper )H&Estainingoffrozenslidesofliver(A), skeletalmuscle,(B)andpancreatictissue(C)fromSDrat.( Lower ) 250nMadipo-8appliedtofrozenslidesofdifferenttissues.( Lower Imageswereobtainedat100 6 magnification. (TIF)AcknowledgmentsWethankSallyE.Johnson(Dept.ofAnimalSciences)forherhelpwith C2C12cellcultureanddifferent iation.Wealsoacknowledgethe InterdisciplinaryCenterforBiotechnologyResearch(ICBR)atthe UniversityofFlorida.AuthorContributionsConceivedanddesignedtheexperiments:JLKSHLDVSWT.Performed theexperiments:JLKSHLBLYP.Analyzedthedata:JLHLBLYP. Wrotethepaper:JLWT.References1.TrayhurnP,BeattieJH(2001)Physiologicalroleofadiposetissue:whiteadipose tissueasanendocrineandsecretoryorgan.ProcNutrSoc60:329–339. 2.KershawEE,FlierJS(2004)Adiposetissueasanendocrineorgan.JClin EndocrinolMetab89:2548–2556. 3.FruhbeckG,Gomez-AmbrosiJ,MuruzabalFJ,BurrellMA(2001)The adipocyte:amodelforintegrationofendocrineandmetabolicsignalingin energymetabolismregulation.AmJPhysiolEndocrinolMetab280:E827–847. 4.BoselloO,ZamboniM(2000)Visceralobesityandmetabolicsyndrome.Obesity Reviews1:47–56. 5.RitchieSA,ConnellJMC(2007)Thelinkbetweenabdominalobesity,metabolic syndromeandcardiovasculardisease.Nutrition,MetabolismandCardiovascularDiseases17:319–326. 6.BergmanRN,VanCittersGW,MittelmanSD,DeaMK,Hamilton-WesslerM, etal.(2001)Centralroleoftheadipocyteinthemetabolicsyndrome.JInvestig Med49:119–126. 7.GuilhermeA,VirbasiusJV,PuriV,CzechMP(2008)Adipocytedysfunctions linkingobesitytoinsulinresistanceandtype2diabetes.NatRevMolCellBiol9: 367–377.AptamersforAdipocyteCells PLoSONE|www.plosone.org9May2012|Volume7|Issue5|e37789

PAGE 10

8.NawrockiAR,SchererPE(2005)Keynotereview:Theadipocyteasadrug discoverytarget.DrugDiscoveryToday10:1219–1230. 9.KoloninMG,SahaPK,ChanL,PasqualiniR,ArapW(2004)Reversalof obesitybytargetedablationofadiposetissue.NatMed10:625–632. 10.LiuJ,WangL,ZhangA,DiW,ZhangX,etal.(2011)Adiposetissue-targeted 11beta-hydroxysteroiddehydrogenasetype1inhibitorprotectsagainstdietinducedobesity.EndocrJ58:199–209. 11.KleinJ,PerwitzN,KrausD,FasshauerM(2006)Adiposetissueassourceand targetfornoveltherapies.TrendsEndocrinolMetab17:26–32. 12.HossenMN,KajimotoK,AkitaH,HyodoM,IshitsukaT,etal.(2010)Ligandbasedtargeteddeliveryofapeptidemodifiednanocarriertoendothelialcellsin adiposetissue.JControlRelease147:261–268. 13.SefahK,TangZW,ShangguanDH,ChenH,Lopez-ColonD,etal.(2009) Molecularrecognitionofacutemyeloidleukemiausingaptamers.Leukemia23: 235–244. 14.DanielsDA,ChenH,HickeBJ,SwiderekKM,GoldL(2003)Atenascin-C aptameridentifiedbytumorcellSELEX:systematicevolutionofligandsby exponentialenrichment.ProcNatlAcadSciUSA100:15416–15421. 15.ChenHW,MedleyCD,SefahK,ShangguanD,TangZ,etal.(2008)Molecular recognitionofsmall-celllungcancercellsusingaptamers.ChemMedChem3: 991–1001. 16.BerezovskiMV,LechmannM,MusheevMU,MakTW,KrylovSN(2008) Aptamer-facilitatedbiomarkerdiscovery(AptaBiD).JAmChemSoc130: 9137–9143. 17.UlrichH,WrengerC(2009)Disease-specificbiomarkerdiscoverybyaptamers. CytometryA75:727–733. 18.KimY,LiuC,TanW(2009)AptamersgeneratedbyCellSELEXforbiomarker discovery.BiomarkMed3:193–202. 19.AlekseevOM,RichardsonRT,AlekseevO,O’RandMG(2009)Analysisof geneexpressionprofilesinHeLacellsinresponsetooverexpressionorsiRNAmediateddepletionofNASP.ReprodBiolEndocrinol7:45. 20.LeeYH,ChenSY,WiesnerRJ,HuangYF(2004)Simpleflowcytometric methodusedtoassesslipidaccumulationinfatcells.JLipidRes45:1162–1167. 21.LeTT,ChengJ-X(2009)Single-CellProfilingRevealstheOriginofPhenotypic VariabilityinAdipogenesis.PLoSONE4:e5189. 22.BoganJS,McKeeAE,LodishHF(2001)Insulin-ResponsiveCompartments ContainingGLUT4in3T3-L1andCHOCells:RegulationbyAminoAcid Concentrations.MolCellBiol21:4785–4806. 23.StahlA,EvansJG,PattelS,HirschD,LodishHF(2002)InsulinCausesFatty AcidTransportProteinTranslocationandEnhancedFattyAcidUptakein Adipocytes.DevelopmentalCell2:477–488. 24.PohlJ,RingA,KorkmazU,EhehaltR,StremmelW(2005)FAT/CD36mediatedlong-chainfattyaciduptakeinadipocytesrequiresplasmamembrane rafts.MolBiolCell16:24–31. 25.ZhouSL,StumpD,SorrentinoD,PotterBJ,BerkPD(1992)Adipocyte differentiationof3T3-L1cellsinvolvesaugmentedexpressionofa43-kDa plasmamembranefattyacid-bindingprotein.JournalofBiologicalChemistry 267:14456–14461. 26.RossSA,ScottHM,MorrisNJ,LeungW-Y,MaoF,etal.(1996) CharacterizationoftheInsulin-regulatedMembraneAminopeptidasein3T3L1Adipocytes.JournalofBiologicalChemistry271:3328–3332. 27.TannerLI,LienhardGE(1987)Insulinelicitsaredistributionoftransferrin receptorsin3T3-L1adipocytesthroughanincreaseintherateconstantfor receptorexternalization.JournalofBiologicalChemistry262:8975–8980. 28.SchererPE,LisantiMP,BaldiniG,SargiacomoM,MastickCC,etal.(1994) InductionofcaveolinduringadipogenesisandassociationofGLUT4with caveolin-richvesicles.TheJournalofCellBiology127:1233–1243. 29.HashiramotoM,JamesDE(2000)CharacterizationofInsulin-Responsive GLUT4StorageVesiclesIsolatedfrom3T3-L1Adipocytes.Molecularand CellularBiology20:416–427. 30.TannerLI,LienhardGE(1987)Insulinelicitsaredistributionoftransferrin receptorsin3T3-L1adipocytesthroughanincreaseintherateconstantfor receptorexternalization.JournalofBiologicalChemistry262:8975–8980. 31.TannerLI,LienhardGE(1989)Localizationoftransferrinreceptorsand insulin-likegrowthfactorIIreceptorsinvesiclesfrom3T3-L1adipocytesthat containintracellularglucosetransporters.TheJournalofCellBiology108: 1537–1545. 32.KandrorKV,PilchPF(1994)gp160,atissue-specificmarkerforinsulinactivatedglucosetransport.ProceedingsoftheNationalAcademyofSciences 91:8017–8021. 33.ChingJK,RajguruP,MarupudiN,BanerjeeS,FisherJS(2010)Arolefor AMPKinincreasedinsulinactionafterserumstarvation.AmericanJournalof Physiology-CellPhysiology299:C1171–C1179. 34.ZhaoZ,XuL,ShiX,TanW,FangX,etal.(2009)RecognitionofsubtypenonsmallcelllungcancerbyDNAaptamersselectedfromlivingcells.Analyst134: 1808–1814. 35.LiS,XuH,DingH,HuangY,CaoX,etal.(2009)Identificationofanaptamer targetinghnRNPA1bytissueslide-basedSELEX.JPathol218:327–336. 36.BergAH,SchererPE(2005)Adiposetissue,inflammation,andcardiovascular disease.CircRes96:939–949. 37.SugiharaH,YonemitsuN,MiyabaraS,YunK(1986)Primaryculturesof unilocularfatcells:characteristicsofgrowthinvitroandchangesin differentiationproperties.Differentiation31:42–49. 38.GreenH,KehindeO(1975)Anestablishedpreadiposecelllineandits differentiationinculture.II.Factorsaffectingtheadiposeconversion.Cell5: 19–27. 39.KratchmarovaI,KalumeDE,BlagoevB,SchererPE,PodtelejnikovAV,etal. (2002)Aproteomicapproachforidentificationofsecretedproteinsduringthe differentiationof3T3-L1preadipocytestoadipocytes.MolCellProteomics1: 213–222. 40.ShangguanD,LiY,TangZ,CaoZC,ChenHW,etal.(2006)Aptamers evolvedfromlivecellsaseffectivemolecularprobesforcancerstudy.ProcNatl AcadSciUSA103:11838–11843.AptamersforAdipocyteCells PLoSONE|www.plosone.org10May2012|Volume7|Issue5|e37789