|
i3
OPEN 0 ACCESS Freely available online
PLosone
DNA Aptamers as Molecular Probes for Colorectal Cancer
Study
1,3*
Kwame Sefah\ Ling IVIeng\ Dalia Lopez-Colon\ Elizabeth Jimenez\ Chen Liu^, Weihong Tan
1 Department of Chemistry, Department of Physiology and Functional Genomics, Shands Cancer Center, UF Genetics Institute and McKnight Brain Institute, University of
Florida, Gainesville, Florida, United States of America, 2 Department of Pathology, Immunology and Lab Medicine, University of Florida, Gainesville, Florida, United States
of America, 3 H. Lee Moffitt Cancer Center & Research Institute, Tampa, Florida, United States of America
Abstract
Background: Understanding the molecular features of specific tumors can increase our knowledge about the mechanism(s)
underlying disease development and progression. This is particularly significant for colorectal cancer, which is a
heterogeneous complex of diseases developed in a sequential manner through a multistep carcinogenic process. As such, it
is likely that tumors with similar characteristics might originate in the same manner and have a similar molecular behavior.
Therefore, specific mapping of the molecular features can be potentially useful for both tumor classification and the
development of appropriate therapeutic regimens. However, this can only be accomplished by developing high-affinity
molecular probes with the ability to recognize specific markers associated with different tumors. Aptamers can most easily
meet this challenge based on their target diversity, flexible manipulation and ease of development.
Methodology and Results: Using a method known as cell-based Systematic Evolution of Ligands by Exponential
enrichment (cell-SELEX) and colorectal cancer cultured cell lines DLD-1 and HCT 116, we selected a panel of target-specific
aptamers. Binding studies by flow cytometry and confocal microscopy showed that these aptamers have high affinity and
selectivity. Our data further show that these aptamers neither recognize normal colon cells (cultured and fresh), nor do they
recognize most other cancer cell lines tested.
Conclusion/Significance: The selected aptamers can identify specific biomarkers associated with colorectal cancers. We
believe that these probes could be further developed for early disease detection, as well as prognostic markers, of colorectal
cancers.
Citation: Sefah K, Meng L, Lopez-Colon D, Jimenez E, Liu C, et al. (2010) DNA Aptamers as Molecular Probes for Colorectal Cancer Study. PLoS ONE 5(12): el 4269.
doi:10.1371/journal.pone.OOI 4269
Editor: Dimitris Fatouros, Aristotle University of Thessaloniki, Greece
Received May 3, 2010; Accepted October 16, 2010; Published December 10, 2010
Copyright: 2010 Sefah et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: Work was funded by the following: NIH:R01 GM079359: Development of Molecular Probes for Biomedical Applications; NIH CAI22648, Enrichment and
Detection of Exfoliated Cancer Cells. The funding agency had no role in study design, data collection and analysis, decision to publish, or preparation of the
manuscript.
Competing interests: The authors have declared that no competing interests exist.
* E-mail: tan@chem.ufl.edu
Introduction
Colorectal cancer (CRC) is the third most common cancer (10-
15 % of all cancers) and one of the leading causes of cancer-related
deaths worldwide, with an estimated half a million deaths
worldwide and over fifty thousand deaths in the United States
alone.
CRC is a heterogeneous complex of diseases caused by
destructive genetic/epigenetic alterations that accumulate in a
sequential manner through a multistep carcinogenic process [1]. It
is therefore likely that tumors with similar characteristics might
originate in the same manner and have a similar molecular
behavior. Since the molecular features of a given tumor reflect the
mechanism(s) underlying disease development and progression,
the implication for tumor classification is significant. For instance,
molecular classification of leukemia and lymphomas has tremen-
dously enhanced our understanding of these diseases [2,3,4]. The
investigation of the molecular bases of two major syndromes,
familial adenomatous polyposis (FAP) and hereditary nonpolypsis
CRC (HNPCC), has led to the identification of two main
pathways by which these molecular events can lead to CRC [5].
About 85% of CRCs arise from events that result in chromosomal
instability (CIN), with aneuploidy and early inactivation of
adenomatosis polyposis coli (APC). A further 15% result from
processes that generate micro satellite instability (MSI), replication
error or loss in the caretaker mismatch repair (MMR) function
associated with HNPCC [6,7,8,9]. Although we have improved
our understanding of the molecular events underlying the
development of CRC, no significant impact on patient care has
resulted. Even though considerable progress that been made in the
treatment of patients with CRC using folic acid (FA)-modulated 5-
flurouracU (5-FU), about 50% of CRC patients eventually develop
metastatic CRC (mCRC). However, the use of new chemotherapy
agents, such as oxaliplatin and irinotecan, either alone or in
combination with approved biological agents, such bevacizumab
and cetuximab, promises to prolong survival [10,11].
Therefore, in order to maximize the available treatments, it is
critically important to gain even more insight into the molecular
mechanisms underlying disease development and progression, as
well as significantiy improve our efforts to elucidate new
I. PLoS ONE I www.plosone.org
1
December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
therapeutically relevant targets and molecular markers. Such
efforts will help expand and diversify disease management options.
Studies have also shown that shifting disease detection to an earlier
stage through mass screening and intervention at this stage can
reduce the risk of death from CRC [12,13]. These findings
strongly demonstrate the clinical need for biomarkers for the early
detection of CRC so that the disease can be effectively managed.
Genomic techniques, such as DNA microarray analysis, and
proteomic methods, such as two-dimensional (2-D) electrophoresis
and mass spectrometry, are now commonly used to elucidate the
expression profiles of genes and proteins in cells, tissues and bodily
fluids [14,15]. Indeed, the identification of genes and proteins that
are characteristically produced during the development of cancer
can potentially uncover useful biomarkers that will aid in the
management of CRC. Although proteomics have played a
dominant role in the field of biomarker development [16] and
will continue to do so, the current proteomic strategies have not
generated enough markers for CRC.
Interestingly, CRC is one of the first cancers for which tumor
markers were used to aid in disease management. For example,
carcinoembryonic antigen (CEA) has been used extensively to
determine prognosis and monitor both disease progression and
therapy after curative resection. A high level of CEA in the serum
is associated with cancer progression. However, even in the
absence of cancer, high levels of CEA have been reported in
conditions such as hepatitis, pancreatitis, inflammatory bowel
disease and obstructive pulmonary disease. In addition, other
cancers, such as pancreatic, gastric, lung and breast, have elevated
levels of CEA, indicating the lack of specificity of this marker.
Other markers, such as carbohydrate antigen 19-9 (CAI9.9),
CA242, metalloproteinases-1 (TIMP-1), Thymidylate synthase,
p53, and APC gene, all lack the necessary sensitivity and specificity.
To be clinically useful, a biomarker must be effective and have
high predictive value [7], yet no such single biomarker exists.
Although no consensus has been reached, it seems that the
development of multiple biomarkers for detection and risk
assessment of a single cancer is favored over single comprehensive
biomarkers that can successively predict risk for any type of cancer
[7]. This is even more important as multiplexing methods are
becoming more of a norm than the exception.
Biomarkers that are directiy associated with tumor cells as they
are transformed from normalcy into malignancy will be of
significant interest as these markers can be useful tools for
mapping the molecular features of the diseased cells. The ability of
probes to identify an important clinical specimen, such as
exfoliated malignant colonocytes, rather than normal colonocytes,
would be particularly important for CRC [16]. Specifically, once
exfoliated cells from colonic mucosa have been sloughed into the
stool, it has already been demonstrated that DNA from the stool
can be isolated and subjected to a multi-target DNA analysis. This
assay can currentiy assess 15 mutational hot spots, including k-ras,
p53, APC, BAT-26 and L-DNA. Although DNA fecal markers are
quite promising, they are not widely used in clinical settings and
therefore probes that can specifically detect the cells will be
important.
In the development of sensitive, selective molecular markers for
CRC, cell-based aptamer selection holds significant promise by its
potential to identify multiple useful markers in a relatively short
time. During the last two decades, appreciable efforts have been
made to develop markers for various types of cancers using a process
known as the Sytematic Evolution of Ligands by Exponential
enrichment (SELEX) [17,18]. Through this process, numerous
oligonucleotide probes (aptamers) have been generated that can
bind specifically to proteins associated with membranes of different
.'^p.- PLoS ONE I www.plosone.org
tumor cells [19,20,21,22,23,24,25,26]. Aptamers are short, single-
stranded oligonucleotides (DNA or RNA), typically <100 mer, that
have the ability to bind to other molecules with high affinity and
specificity. They have been generated against a variety of targets
from small molecules [27,28,29,30] and peptides/proteins [31,32,
33,34,35,36] to whole ceUs [19,20,21,22,23,24,25,26] as weU as
bacteria, viruses and virus associated proteins [37,38,39,40,
41,42,43]. The cell-based selection strategy generates aptamers
that bind to unknown targets in their native state. Nevertheless, the
target can still be identified through affinity extraction and mass
spectrometry [44,45]. To create more sensitive and selective probes
for CRC, we have developed a panel of DNA aptamers that
specifically recognize colorectal cancer cells. These probes were
generated by cell-SELEX using colorectal cancer cultured cell lines
DLD-1 and HCT 116. Initial binding studies by flow cytometry and
confocal microscopy using these cultured cell lines show that most of
our aptamers have high affinity and selectivity. Our data further
show that these aptamers neither recognize normal colon cells
(cultured), nor do they recognize a majority of the other cancer cell
lines tested. Our findings clearly show that the probes identify
specific membrane proteins associated with colorectal cancers. We
believe that these probes could be further developed for early
disease detection, as well as prognostic markers, of colorectal
cancers.
Results
Over the last decade, several aptamers have been developed for
different targets, including purified molecules, as well as complex
targets, such as the live cells of different cancers. We have used the
cell-based SELEX strategy to generate a panel of DNA aptamers
for colorectal cancers. A random ssDNA pool (approximately 10 )
was subjected to sequential binding and elution to select from the
pool DNA sequences having the ability to bind to surface markers
of the target cell. DLD-1 and HCT 116 were used as targets with
HCTl 116 and HT-29 as respective controls in separate selections.
The introduction of counter selection provided the opportunity to
eliminate, to the extent possible, common surface markers, while
at the same time enriching differential markers on the target cells.
The DNA pool collected after each round of selection was
amplified by PCR, and the product was used to prepare ssDNA
for the next round of selection. In this selection strategy, the
incubation of the DNA pool with the cells was performed in
culture dishes (cell monolayers). The enrichment of the selection
pool through successive selection was monitored by flow
cytometry. In order to use the cells for flow cytometry, cells were
cultured overnight and dissociated using short time (30 sec-1 min)
trypsin treatment and/or non-enzymatic cell dissociation solution
(MP Biomedicals). Short time treatment with trypsin did not have
any observable effect with respect to the ability of the selection
pool to recognize the cells, since no difference between the signal
intensities of the trypsin and the non-enzymatic treatment options
was observed (Text SI, figure SI). Peak shift (increase in the
fluorescence intensity as compared to the library) is an indication
of fluorescence intensity of the cell as a result of the labeled DNA
sequence binding to the cells (Figure 1). With the increasing
number of selection cycles, there was a steady increase in the
fluorescence intensity of the target cells, indicating that DNA
sequences with better binding to the target cells were being
enriched. However, there was no significant peak shift with the
control cells, especially in the early and mid rounds of selection. By
the 14' round of selection, there was a significant increase in
fluorescence signal of the target as compared to the control cells.
An additional two rounds (16' round) led to an increase in the
2 December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
B
10 10 10
FLl Fluorescence intensity
lo-'
i ^
150- \
100- M t L0P
50- mk
0- 1? !l^ ^n^ul^^a^^j
10" 10' 10^
FLl Fluorescence intensity
10
Figure 1. Enrichment of selected DNA pools of target DLD-1 (A) and control HCT 116 (B) during selection and monitored by Flow
cytometry. Direction of arrows shows increasing rounds of selection from the 5* -16* pool. As selection progressed there was higher
corresponding increase in fluorescence intensity of the target than the control. The sudden increase in fluorescence signal of the control from 14"^ to
16* round without corresponding increase in the target indicates higher enrichment.
doi:10.1371/journal.pone.0014269.g001
signal enhancement of the control, but no significant increase for
the target. This is possible at the terminal end when selection is
continued further even when there is no significant signal
difference between the successive pools to the target. The highly
enriched pools were cloned and the positive clones sequenced.
Sequence analysis provided potential DNA aptamer candidates
grouped into families based on their sequence homology. About 8
distinct homologous families and many randomized sequences
were identified for the DLD-1 selection. The number of sequences
in the distinct homologous families ranged from 6-110 (Table 1)
with few base mutations within a family. Representative sequences
from the different families were chosen to test their interactions
with the target.
The rolling cycle amplification (RCA) products from sequencing
were used for the initial screening. The products from the chosen
wells were diluted with 100 (xl H2O and used for PCR
amplification. The PCR products were used to prepare ssDNA
and then used for binding assays. Two sequences having at least
one base mutation were chosen from families with sequences
greater than 20 (Table 1). The use of the RCA product provided
Table 1. Representation of different homologous families
after cloning and sequencing and alignment of DLD-1
selection.
Family
Number of sequences Percentage of total sequences
1 110
2 46
3 22
4 30
5 23
6 26
7 6
8 9
9 26
Random <6
25.5
10.7
5.1
7.0
5.3
6.0
1.4
2.1
6.0
30.9
Members in each family differ in few numbers of bases.
doi:10.1371 /journal.pone.0014269.1001
US with a faster method of screening for potential aptamer
candidates. The sequences with binding signal greater than that of
the control (Text SI, figure S2) were chemically synthesized and
labeled with fluorescein isothiocynate (FITC) or bio tin at the 3'
end. All synthesized sequences were purified by HPLC and then
quantified. The binding assays were performed using flow
cytometry, as described, and the binding signal was directiy
detected in FLl for FITC probes, FL2 for streptavidin-conjugated
PE or FL3 for streptavidin-conjugated PE-Cy5.5. The initial
binding assays with the synthesized sequences named KDEDl to
KDED20 revealed many sequences binding to the cell target
(Figure 2). Some of the sequences belonging to the same family,
and therefore envisaged to be binding to the same target, showed
different binding signal strengths to the target. These include
KDED2/KDED15; KDED1/KDED5; KDED9/KDED10,
KDED3/KDED19 and KDED7/KDED18.
The co-current selections, using DLD-1 (without negative
selection) and HCT 116 as targets, also generated the following
aptamers: KC2D3, KC2D4, and KC2D8 for DLD-1: KCHAIO
and KCHBIO for HCT 116 (Figure 3).
All the developed aptamers were further tested with all the
colorectal cancer cell lines used in this study. The following
aptamers showed recognition only to the cell line used for the
selection: KDED2/KDED15, KDED7/KDED18, KDED9/
KDEDIO and KC2D3 (DLD-1) and KCHBIO (HCT 116).
Figure 4 shows the pictorial representation of the interaction
between the individual aptamers and the three different colorectal
cancer cell lines. The height of the cone represents the percentage
of cells that had fluorescence intensity above the control library
with the threshold set at 5% fluorescence signal intensity.
We then determined the apparent dissociation constants (Kd)
for the selected aptamers, which ranged between 0.68 nM and
302 nM (Table 2 and Figure 5). In order to enhance synthesis
efficiency and also increase the flexibility of chemical manipula-
tion, some of the aptamers were truncated, and the binding
strength and apparent Kds of the truncated sequences were also
assessed. Before each truncation, the possible structures of each
aptamer sequence were predicted using Integrated DNA Tech-
nologies oligoanalyzer under the selection conditions. The most
favorable hairpin structures were selected and the hang over bases
at the 3' and/or the 5' end removed, each at a time. Series of
truncations were made and each of these was finally tested with the
PLoS ONE I www.plosone.org
December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
A
B
C
10 10 10
FL3-Fluorescence Intensity
10 10 10 10
FL3-Fluorescence Intensity
10 10 10 10
FL3-Fluorescence intensity
D
10 10 10 10
FL3-Fluorescence Intensity
100
10" 10' 10' 10"
FL3-Fluorescence intensity
10 10 10 10
FL3-Fiuorescence Intensity
Figure 2. Flow cytometry histograms showing the binding of representative aptamer candidates screened against the target DLD-1
cells. Cells were dissociated with non-enzymatic dissociation solution. The cells were washed and incubated with different aptamer candidates (blue
histogram). The fluorescence signal was detected by streptavidin-PE-cy5.5. The unselected library was used as background fluorescence signal (black
histogram). All the aptamers A (KDED2), B (KDED5), C (KDED7), D (KDEDl5), E (KDEDl9), F (KDED20).
doi:10.1371/journal.pone.0014269.g002
B
10 10 10
FL3-Fluorescence intensity
10 10 10
FL3-Fluorescence intensity
10 10 10
FL3-Fluorescence Intensity
E
10 10 10
FL3-Fluorescence intensity
10 10 10 10
FL3-Fluorescence Intensity
Figure 3. Screening of selected aptamers candidates in the alternate selection against DLD-1 (Blue) and HCT 116 (red) using flow
cytometry. A (KC2D3), B (KC2D4), C (KC2D8). D (KCHAIO), E (KCHBIO).
doi:10.1371/journal.pone.0014269.g003
). PLoS ONE I www.plosone.org
December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
100
. 90
.^'80
I 70
C60
t 50
C 40
S 30
2i 20
ยง 10
E 0
'iJ
0^,0^ XV
4^^>fi*,ki
Aptamer
V ^- ^^'^\,C^
Figure 4. Pictorial representation of the recognition pattern of the different aptamers generated against DLD-1 and HCT 116.
Binding assays were performed with DLD-1, HCT 116 and HT-29. The background fluorescence intensity of the library was set below 5% and the
fluorescence signal of the individual aptamers was then determined and used in pictorial representation as shown.
doi:10.1371/journal.pone.0014269.g004
positive ceUs to assess the binding. The truncation of KCHAIO
(KCHAlOa) did not change the properties of the aptamer.
However, significant improvement of binding affinity was
observed with KDED7 truncation (KDED7a) and the various
forms of KDED2 (KDED2a, KDED2a-l and KDED2a-3), as
demonstrated in the improved affinities of the truncated versions
(Table 2). For instance, the Kd of KDED7 improved from
157.3 nM to 46.8 nM, about 3-fold improvement, while KDED2
improved from 191.9 nM to 29.9 nM, a 6-fold improvement. The
rest did not show observable binding to the target. In almost all the
Table 2. Different aptamer sequences and their corresponding apparent dissociation constants (Kd).
Aptamer
Sequence
Kd (nM)
KDEDl
KDED2
KDED2a
KDED2a-1
KDED2a-3
KDED3
KDED5
KDED7
KDED7a
KDED9
KDEDIO
KDEDl5
KDEDl8
KDEDl9
KDED20
KCHAIO
KCHAlOa
KCHBIO
KC2D3
KC2D4
KC2D8
AGAGACCCTGACTGCGAACTAAACAAAATACGAGCAGGGAGACTTCTATCCGATTGTTGGACACGGTGGCTTCTT
AGAGACCCTGACTGCGAAAACTGCTATTACGTGTGAGAGGAAAGATCACGCGGGTTCGTGGACACGGTGGCTT
AGAGACCCTGACTGCGAAGGGGTGGTTTTCAAAGAGTCTTGCCTGACTCCCCTGTGGTGGACACGGTGGCTTCTT
AGAGACCCTGACTGCGAAGCGGACGCACTTTTAGCAAGCAAGTCGACAATGGAGGTTTTGGACACGGTGGCTTCTT
AGAGACCCTGACTGCGAAGCAACTGATGCTAGAACTGTGTGGGGTTTGGGGTATAATTTGGACACGGTGGCTTCTT
AGAGACCCTGACTGCGAAGCGGACGCACTTTTAGCAAGCAAGTTGACAATGGAGGTTTTGGACACGGTGGCTTCTT
AGAGACCCTGACTGCGAAGGGGTGGTTTTCAAAGAGTCTTGCCTGACTCCTCTGTGGTGGACACGGTGGCTTCTT
AGAGACCCTGACTGCGAATAGGTTGGATAGGGATGGTAGAGCAGGCTAAGCACTTTTTTTTATTGGACACGGTGGCTTCTT
ATCCAGAGTGACGCAGCAGATCTGTGTAGGATCGCAGTGTAGTTGACATTTGATACGACTGGCTGGACACGGTGGCTTAGT
ATCGTCCGCCACCACTACTCGGGAAAGGAACAAACTGCTATTAGGTCGCAGGCCGGTGAGACTGCCTGCCGATGT
ATCGTCCGCCACCACTACTCCCACTGGTAGCCATTCCGCCCTTAACCGGGCCATCGTGAGACTGCCTGCCGATGT
ND
191.935.2
139.2 25.0
50.5 11.4
29.2 6.4
125.76.0
4.82.6
157.3 6.2
46.88.1
ND
ND
30225.0
ND
38.66.7
41.615.5
21.31.7
28.22.7
3.90.4
32.1 3.4
54.3 7.9
0.70.2
cloi:10.1371 /journal.pone.0014269.1002
). PLoS ONE I www.plosone.org
December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
120
100
S
5 10 15
Concentration (nM)
20
25
Figure 5. Binding curve of KC2D8 aptamer with DLD-1 cells. Cells were incubated with varying concentrations of Biotin-labeled aptamer in
duplicate. The florescence signal was detected with streptavidin-PE-cy5.5. The mean fluorescence intensity of the unselected library (background
binding) at each concentration was subtracted from the mean fluorescence intensity of the corresponding aptamer. The actual fluorescence intensity
was fitted into Sigmaplot to determine the apparent Kd.
doi:10.1371/journal.pone.0014269.g005
assays reported, we have used all the individual sequences
(truncated and full- length) of KDED2, since the difference in
binding affinity can influence the sensitivity of a particular assay.
We further examined the selectivity by testing the interaction
between aptamers and cultured normal cell lines, as well as cell
lines from other cancers, including leukemia, lung, ovarian, brain
and cervical cancer. As shown in Table 3, among the tested
aptamers, KDED19 and KC2D8 showed significant signal
intensity above the control library to some of the cell lines. For
instance, there was significant recognition (> -H~l-) of KDED19 to
CAOV3, TOV21G, CEM and H661, whereas Hela and U87MG
showed reduced signal (Table 3). KC2D8 showed a recognition
trend similar to that of KDED19 with the cell lines tested (Table 3).
There was no observable signal from the other aptamers with any
of the cell lines tested, including the normal colon cell lines
(CCDI8C0 and FHC) and fresh human colon cells (Text SI,
figure S3). This implies that most of the developed aptamers are
specific to colorectal cancers (Table 3). This observation is
significant as it provides many possible options for further
development of these aptamers for colorectal cancer studies.
Because of the similar binding pattern observed with KDED 19
and KC2D8, especially the signal with CEM, we decided to use
Sgc8 against these aptamers in the subsequent competition assays
to preliminary verify the target molecule.
In general, the cell-SELEX strategy produces different kinds of
aptamers for different targets and/or the same target present on
the extracellular surface of the cells. We therefore performed
competition assays to assess if any of these aptamers, especially
those from different families, could influence the binding of the
other. Obviously, it was reasonable to assume that sequences
synthesized from the same family will compete; also, sequences
that bind different cells will not compete among themselves. For
instance, it is possible for KDED2 to compete with KDED 15, but
it is unlikely that it will compete with KDED5 or KCHAIO. On
this basis, we performed competition of KDED2 (FITC) against
KDED7, KDEDIO, KDED18, and KC2D3 (unlabeled), and
KCHAIO (FITC) against KDED5, KDED20, KC2D4, KDED 19
and KC2D8 (unlabeled), ending with KC2D4, KC2D8 and
KDED 19 against CEM aptamer Sgc8 (unlabeled). Ten-fold excess
of the unlabeled competitor was first incubated with DLD-1 before
the introduction of the FITC-labeled aptamer. This ensured
competitive advantage and the potential to saturate and block the
binding of the second aptamer if they both bound the same target
or if the binding of one influenced the binding of the secondary
aptamer. Unlabeled KDED2 and KCHAIO were used in these
assays as positive control. KDED2 binding was not influenced by
any of the aptamers tested against it. Similarly, we did not observe
any competition between KCHAIO and any competing aptamers.
However, there was significant influence on the binding of
KDED19, KC2D4, and KC2D8 in the presence of 10-fold excess
of unlabeled Sgc8 (Text SI, figure S4). This result suggests that
these aptamers may be binding to the same target as Sgc8. This
further suggests that KDED 19, KC2D4 and KC2D8 will compete
among themselves, although we did not perform such competition
assay. These aptamers were developed using DLD-1, which did
not have the initial blocking using Sgc8. This supports the idea
that it is practicable to block a known marker in order to allow the
development of probes for targets of interest.
Immunohistological imaging and fluorescence microscopy have
been widely used in the study of solid tumors and, in particular,
colorectal cancers. Therefore, we also assessed if these aptamers
could be used for tumor imaging with the positive cell line. In this
preliminary study, we used cultured cell lines. Here we performed
binding assays in culture dishes similar to the selection protocol,
but with cell confluence of over 60%. After washing, the signal was
detected with PE-streptavidin conjugate or streptavidin-Alexa
Fluor 633. Figure 6 shows the confocal images of KDED2,
KDED3, KDED5 and KDED7 detected wifli PE-streptavidin.
There was significant signal strength of the tested aptamers
compared with the unselected library. The signal pattern shows
that the aptamers bound to the surface of the cells attached to the
culture dish.
PLoS ONE I www.plosone.org
December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
Table 3. Recognition of aptamers with different cancer cell lines.
KDED2
KDED5
KDED7
KDEDIO
KDED19
KDED20
KC2D3
KC2D8
KCHAIO
KCHBIO
DLD-1 + HCT 116 MM M M 1 +++
HT-29 +++
CCDI8C0 -
FHC -
HL60 -
NB4 -
K562 -
KG-1 -
CCRF-CEM -
Ramos -
Hela -
NCi-H23 -
H1975
CAOV3
TOV21G
HBE135
H661
Ludlu
U87MG
M M I
M M I
M M I
M M I
ND
ND
+
ND
ND
ND
ND
ND
ND
M M I
M M I
M M I
ND
ND
ND
ND
+ - + -
ND ND ND ND ND ND
ND +++ MM MM ND ND ND ND ND ND ND ND ND
Selectivity study to assess the recognition of selected aptamers to different cell lines including colorectal cancer (DLD-1, HCT 116, HT-29), normal colon (CCDI8C0, FHC),
leukemia (HL60, NB4, K562, KG-1, CCRF-CEM, Ramos), lung cancer (NCI-H23, H1975, H661, Ludlu), cervical cancer (Hela), ovarian cancer (CA0V3, T0V21G), brain tumor
(U87MG) and normal epithelial (HBE 135). A threshold of fluorescence intensity of PE-cy5.5 in the flow cytometry analysis was set such that the control library showed 5% of
cells above the threshold. After binding the aptamer signal was evaluated by the percentage of cells above the threshold such that all signals below 10% were considered
as background and designated '-'. The rest were assigned as follows; 11 -30%, +; 31-50%, ++; 51-70%, +++; 71 -85%, mm and >86, M M 1. The final concentration of each
aptamer was 250 nM.
doi:10.1371 /journal.pone.0014269.t003
Similarly, significant fluorescence signal was observed from
streptavidin-Alexa Fluor 633 conjugates when DLD-1 was used
against the other aptamers, including KCHAIO, KC2D8,
KDED18, KDED19, and KDED20 (Figure 7), as well as HCT
116 ceUs with KCHAIO and KC2D8. As expected, KDED2 did not
bind HCT 116. The intensity of the fluorophore signal followed the
same pattern as the flow cytometry. Interestingly, KC2D8 showed a
stronger signal with HCT 116 than with DLD-1.
It is usual to assume that aptamers selected against tumor cell
lines bind to surface proteins. This has been demonstrated in most
of the SELEX protocols involving tumor cell lines [44,45]. In
order not to wholly translate any one SELEX data to the other, we
performed assays to preliminarily determine the molecules on the
cell surface to which the selected aptamers would bind. In this
assay, the DLDL-1 cells were treated with trypsin and/or
proteinase K for 15 min at 37C. After the incubation period,
the protease activity was stopped with the addition of ice cold
culture medium containing FBS. The cells were quickly washed
twice by centrifugation and then incubated with the aptamers. The
untreated cells were used as positive control. Figure 8 shows the
response of the aptamer binding after the protease activity. Except
for KDED5 and KCHAIO, all the other aptamers lost recognition
in both trypsin- and proteinase K-treated cells. The fluorescence
signals reduced to the background, indicating that the treatment of
cells with the proteases caused digestion of the target protein. For
KDED5, there was significant reduction in signal intensity, but the
KCHAIO signal reduced only marginally, indicating that the
targets were not wholly affected by the treatment.
We envisaged two possible causes: 1) insufficient time of
protease treatment and/or 2) target molecules having significant
portions other than protein, such as carbohydrate or heavily
glycosylated protein not wholly exposed to protease digestion. In
response, we performed long time (30 min and 1 hour) protease
treatment with higher concentrations of proteinase K, as well as
glycosidase treatment. The increase in protease concentration, as
well as long incubation time, did not affect the binding of these two
aptamers. In addition, the incubation of the cells with O-linked
and N-linked glycosidases followed by protease treatment did not
significantiy influence the binding of these two aptamers. We
believe that the glycosidase assays cannot be conclusive since we
did not find literature to support the efficiency of this assay using
cultured cell lines instead of pure glycoprotein.
The development of aptamers that will bind to the target at
varying conditions, especially at physiological temperature and in
culture medium, is important. This will increase the flexibility with
which these aptamers can be adopted and implemented in many
assay platforms. We therefore assessed the binding of the aptamers
at 37C, in culture medium, and under both conditions
simultaneously. As shown in figure S5 (Text SI), KDED2,
KDED2a, KDED2a-l (same aptamer, but different sequence
lengths) and KCHAIO maintained significant binding to DLD-1
cells. The signal strengths were not significantiy different from the
assays at 4C. On the other hand, the other aptamers had reduced
signal intensity to DLD-1. The signal difference may be a result of
the differential affinity of individual aptamers. For instance,
KDED2 (better affinity) and KDED 15 belong to the same family.
PLoS ONE I www.plosone.org
December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
m. ^*^^H W ^ Jlfi
1 ^
D
Figure 6. Confocal images of aptamers staining with cultured DLD-1 cells. Cells were incubated with aptamer conjugated with biotin and
the binding event was observed with PE-conjugated streptavidin. A (unselected library showing the background binding); B (KDED2); C (KDED3); D
(KDED5) and E (KDED7).
doi:10.1371/journal.pone.0014269.g006
but KDED15 did not show significant binding at 37C. In the
RPMI-1640 experiments, KEDE2, KDED2a and KDED2a-l
showed equal binding strength, even when the incubation was
performed at 37C. KDED5 and KCHAIO showed reduced, but
significant binding, as opposed to the remaining aptamers (Text
SI, figure S6), some of which showed almost no binding. This
observation is important in the further development of aptamer-
based assays, such as targeted therapy, apoptotic and viability
assays at physiological conditions.
Discussion
Systematic evolution of nucleic acid probes for molecular
recognition has generated a large number of useful aptamers for
various applications in diverse fields, including biotechnology,
biomedicine, pharmacology, microbiology and chemistry. We
have used cell-SELEX to generate a panel of DNA aptamers that
have specific recognition to colorectal cancers. In this report, we
used DLD-1 and HCT 116 as the target cell lines, and the
selection was performed in the culture dish. We believe that this
system is an accurate representation of the native state of the
surface markers. In one of the selections with DLD-1, we
introduced negative selection with the HCT 116 cell line with
the aim of selecting a panel of aptamers with diverse recognition
patterns to colorectal cancers. Traditionally, in order to ensure the
efficiency of negative selection, the control cell line is often in 5- to
10-fold excess of the target cell line. However, in these schemes,
because the selection was done in the culture dish, the incubation
volumes restricted the size of culture dish we could use.
Consequentiy, only about 2-fold excess of control cell line was
used. We therefore envisaged that the ratio of the positive and the
negative cell lines was insufficient to potentially eliminate a
significant number of the sequences binding to the common
markers. However, we believe that it provided the opportunity for
us to enrich for aptamers that could have differential binding
patterns to colorectal cancer cell lines.
Sequential binding and elution of the DNA library pool with
positive and negative cells eventually produced DNA-enriched
pools that potentially bind to the target with high fluorescence
signal intensity, but with minimal recognition to the control. In all
flow cytometry binding assays for selected pools and aptamer
candidates, cells were removed from culture dishes with either
short time trypsin treatment (30 sec -1 min) at room temperature
or by using commercial non-enzymatic dissociation buffer. We
noticed that mild short time enzymatic treatment did not have any
observable effect on the binding of any of the aptamers and that
the fluorescence signal was similar to that of the cells in the non-
enzymatic buffer. Consequentiy, we preferred using the trypsin in
most of the assays since the non-enzymatic buffer was slightiy
harsh on cells, especially when left for a prolonged time. We
generated a panel of DNA aptamers with diverse binding patterns
to colorectal cancer cell lines. All four aptamer families (KDED2/
KDED15; KDED7/KDED18; KDED9/KDED10 and KC2D3)
showed specific binding to only DLD-1 cells, but not to the other
colorectal cancer cell lines or the other cancer cell lines tested. In
addition, one aptamer, KCHBIO, showed specific binding to only
HCT 116 cells. The other representative aptamer families,
KDED3/KDED19; KDED1/KDED5, KDED20; KCHAIO,
KC2D4 and KC2D8, however, showed recognition to other
colorectal cancer cell lines (HCT 116 and HT-29). CRC is a
heterogeneous complex of diseases [1]; therefore, it is useful to find
aptamers that have differential binding patterns. The importance
of developing such panel of disease probes is that a combination of
them can give high predictive value of disease management
procedures [7,46]. Such approach has been successfully imple-
mented by using proteomic profiling to detect the risk of ovarian
cancer [47]. A similar approach was demonstrated by detecting
DNA from CRC stool sample using a multi-target DNA analysis
panel. We believe that these sequences, when further developed,
will contribute to efforts in developing more effective and reliable
CRC disease management regimens.
PLoS ONE I www.plosone.org
December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
(V-r.
o
9
;?-,
H
Figure 7. Confocal images of aptamers staining with cultured DLD-1 (A-F) and HCT 116 (G-J). Cells were incubated with aptamer
conjugated with biotin and the binding event was observed with AlexaFluor 633 conjugated streptavidin. Unselected library shows the background
binding. Aptamers show significant binding over the background signal. For DLD-1 cells, A= unselected library; B = KCHAIO; C = KDEDl9; D =
KC2D8; E = KDEDl8; F = KDED20 and for HCT 116 cells, G = unselected library; H = KCHAIO; I = KC2D8 and J = KDED2a-3.
doi:10.1371/journal.pone.0014269.g007
Our flow cytometry data correlated with confocal microscopy
imaging. We observed that aptamers which had high signal
intensity by flow cytometry also produced brighter fluorescence
signal by confocal microscopy. This is very important because of
the fast turnaround time with flow cytometry coupled with its high
sensitivity compared with immunohistochemical staining of tissue
sections. This is supported by the study carried out by [48] which
showed sensitivity of tissue-dissociated cells by flow cytometry
compared to immunohistochemical staining. In their report, the
mean fluorescence intensity of anti-EP4, anti-HLA-ABC, anti-
HLA-DR and anti-CD80 was not affected by the enzymatic
dissociation solution. However, although the mean fluorescence of
anti-CD54 was reduced by 30% after 1 hour of enzymatic
treatment, the signal was still significantiy higher above the
control. Therefore, in the future, we envisage that clinical CRC
specimens can be dissociated and that the cell suspension can be
used in flow cytometry analysis for faster and easier disease
assessment or diagnosis.
The role of membrane and membrane-associated proteins in
invasive and metastasis potential of tumor cells can be a major
prognostic indicator in many cancers. Cell-SELEX can play a
major role in identifying such potential markers through the
development of aptamer probes. Preliminary determination of the
target surface molecules of these aptamers indicates that they bind
to membrane proteins. With the exception of KDED5 and
KCHAIO, which marginally reduced in signal strength, the rest of
the aptamers completely lost recognition after protease treatment,
meaning that the target was digested by the treatment. We
envision that KDED5 and KCHAIO might be associated with
glycoproteins which might be shielded by an extensive glycosyl-
ation, although the results from the glycosidase assay do not
support it. We believe that this assay was not effective enough
when adopted for whole live cells.
CRC is one of the first cancers to use tumor markers to aid
management. Generally, however, because of the lack of very
specific tumor markers, the needed advancements have not been
PLoS ONE I www.plosone.org
December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
A
B
C
10 10 10 10
FL3-Fluorescence Intensity
D
10 10 10
FL3-Fluorescence Intensity
10" 10' 10' 10'
FL3-Fluorescence Intensity
10 10 10
FL3-Fluorescence Intensity
10 10 10 10
FL3-Fluorescence Intensity
10 10 10
FL3-Fluorescence Intensity
H
10 10 10
FL3-Fluorescence Intensity
FL3-Fluorescence Intensity
10 10 10
FL3-Fluorescence Intensity
Figure 8. Preliminary determination of cell surface molecule that binds to aptamer. Cells were treated with trypsin and proteinase K for
15 min and then incubated with aptamer. The untreated cell incubated with aptamer was used as positive control. Black histogram, (unselected
library with untreated cells); red (aptamer with untreated cells); blue (unselected library with trypsin treated cells); purple (aptamer with trypsin
treated cells) and lime (aptamer with proteinase K treated). The following aptamers were assessed; A (KDED2); B (KDED5); C (KDEDl0); D (KDEDl8); E
(KDED20); F (KCHAIO); G (KC2D3); H (KC2D4), I (KC2D8). With the exception of KDED5 and KCHAIO which reduced only minimally, the signal of all
others reduced significantly.
doi:10.1371/journal.pone.0014269.g008
realized. While the leading marker, CEA, has been used
extensively to determine prognosis and to monitor disease progress
and therapy after curative resection, it is not sufficientiy specific
based on its elevated level in other conditions, such as hepatitis,
pancreatitis, inflammatory bowel disease and obstructive pulmo-
nary disease, as weU as pancreatic, gastric, lung and breast cancer.
Similarly other markers such as KRAS had been suggested as
prognostic markers, but KRAS mutations have been observed in
several cancers and its importance as prognostic marker is still
controversial. It is therefore important to observe that most of the
aptamers developed in this report show significant specificity to
CRC. Except for KDED19, KC2D4 and KC2D8, which bind to
most of the cell lines tested, the rest of the aptamers are very
specific to only CRC, with some recognizing a particular CRC cell
line, as demonstrated by the specificity assays, but none of them
bound to the normal fresh colon and normal colonic epithelial cell
line, demonstrating that the target markers of these aptamers are
disease-related. This initial characterization of the selected
aptamers is very important since it provides key information
regarding the potential use of these markers, though further studies
may be necessary to determine their diagnostic and prognostic
significance.
IVIaterials and IVIethods
Cell lines and cell culture
Colorectal cancer cell lines DLD-1 (Dukes' type C colorectal
adenocarcinoma), HCT 116 (colorectal carcinoma) and HT-29
(colorectal adenocarcinoma) were purchased from American Type
Cell Culture (ATCC) and used for initial selection assays. Other
PLoS ONE I www.plosone.org
10
December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
cell lines used in this study to assess selectivity and the recognition
pattern of the selected sequences include HL60 [26], K562 [26],
NB4 [23], KG-1 (ATCC), Ramos [23], CCRF-CEM [23]
(leukemia); Hela, cervical (ATCC); NCI-H23 [25], H1975
(ATCC) (lung) and FHC, CCD-I8C0 (ATCC) (normal colon).
Cells were maintained in culture with RPMI-1640 containing 10%
heat-inactivated FBS (Invitrogen) and 100 Units/mL penicillin-
streptomycin (Cellgro) for DLD-1, HL60, NB4, K562, Ramos,
CCRF-CEM, and Hela. Both HCT 116 and HT-29 cells were
maintained in McCoy's 5A culture medium containing 10% heat-
inactivated FBS and 100 Units/mL penicillin-streptomycin. FHC
was maintained in 45% Ham's F12 medium; 45% Dulbecco's
modified Eagle's medium, 25 mM HEPES; 10 ng/ml cholera
toxin; 0.005 mg/ml insulin; 0.005 mg/ml transferrin; 100 ng/ml
hydrocortisone; 10% FBS and 100 Units/mL penicillin-strepto-
mycin. KG-1 cells were maintained in IMDM with 20% FBS and
100 Units/mL penicillin-streptomycin. All cultures were incubat-
ed at 37C under a 5% CO2 atmosphere. Normal clinical colon
tissue was obtained from the Department of Pathology, Shands
Hospital, University of Florida.
Oligonucleotides
Random DNA primers and libraries were designed using the
Integrated DNA Technologies (IDT) software. The forward
primer was labeled at the 5' end with FITC, and the reverse
primer was labeled with biotin at the 5' end. Different primers and
library sets were used for different selections to avoid cross
contamination. All sequences, including aptamer sequences
obtained after sequencing, were synthesized by standard phos-
phoramidite chemistry using a 3400 DNA synthesizer (Applied
Biosystems) and purified by reverse phase HPLC (Varian Prostar).
Before the selection process, the PCR amplification conditions of
the primers and libraries were optimized. All PCR mixtures
contained 50 mM KCl, 10 mM TrisHCl (pH 8.3), 1.5 mM
MgClj, dNTPs (each at 2.5 mM), 0.5 (xM each primer, and Hot
start Taq DNA polymerase (5 units/(xl). Amplifications were
carried out in a Biorad 1 Cycler at 95C for 30 sec, 57.0C for
30 sec, and 72C for 30 sec, followed by the final extension for
3 min at 72C. The FITC-coupled sequences were used to
continue and monitor progress of selection by flow cytometry.
Experimental procedure of cell-SELEX
In the first selection, DLD-1 was used as the target with HCT
116 as the control. Both cell lines grow as adherent monolayer. For
the first round of selection, DLD-1 was cultured in a 100 mm
x20 mm culture dish to >95% confluence. Cells were washed in
the dish with washing buffer (4.5 g/liter glucose, mM MgCl2^
dissolved in Dulbecco's PBS with magnesium chloride and calcium
chloride). Fifteen nmol of library was dissolved in 1000 ul of
binding buffer (4.5 g/liter glucose, 5 mM MgCl2, 0.1 mg/ml
tRNA and 1 mg/ml BSA, all in Dulbecco's PBS with magnesium
chloride and calcium chloride). The DNA pool was denatured at
95C for 5 min and quickly cooled on ice for 10 min. The pool
was then incubated with the cells at 4C on rocker for 1 hour.
After incubation, the cells were washed three times with washing
buffer to remove unbound sequences. Five hundred microliters of
binding buffer was added and the cells scraped to recover cell/
DNA complexes. The cell-DNA complex was heated at 95C for
15 min and the mixture centrifuged at 14000 rpm to pellet the cell
debris. The supernatant containing the ssDNA was recovered and
amplified by PCR using FITC- and biotin-labeled primers to
increase the number of copies of individual sequences. A
preparative PCR was performed using the amplified pool as the
template. The selected sense ssDNA strands were separated from
.'^p.- PLoS ONE I www.plosone.org
the biotinylated antisense ssDNA by alkaline denaturation and
affinity purification with streptavidin-coated Sepharose beads (GE
Healthcare Bio-Sciences Corp., Piscataway, NJ, USA). The
ssDNA was dried and then resuspended in binding buffer to a
final concentration of 1 (xM. The pools were denatured at 95C,
snap cooled and used to perform the second round of selection
using the same procedure as described for first selection. After
washing, the binding sequences were eluted by heating, and the
recovered ssDNA was used to perform negative selection using
HCT 116. In the control selection, cells were cultured in a
100 mm x20 mm culture dish. Similarly, cells were washed and
incubated with the eluted DNA pool. After incubation, the non-
binding sequences in the incubation buffer were recovered. The
pool was amplified by PCR using FITC- and biotin-labeled
primers, and then PCR product was used to prepare ssDNA.
The entire selection process was repeated until significant
enrichment was obtained for the positive cell line (16 rounds) when
assayed by flow cytometry. During the selection, the size of the
positive cell dish was changed to 60 mm xl5 mm, but that of the
control cell line was maintained. Also, the stringency of selection
was increased by (i) increasing the volume of washing buffer (ii)
increasing washing time and (iii) increasing the amount of FBS
from 10% (from 4 round) to 20%. Three enriched pools were
amplified by PCR using unlabeled primers and the PCR products
cloned into Escherichia coli using TOPO TA cloning Kit for
sequencing (Invitrogen, Carlsbad, CA, USA). The positive clones
were sequenced.
In a parallel approach, different oligonucletide libraries were
used to perform another selection with DLD-1, but without
negative selection and HCT 116 positive using HT-29 as control.
With regards to the HCT 116 selection, our previous study
revealed that the cell line binds to Sgc8, a CCRF-CEM aptamer
[23], with high fluorescence signal, an indication of high
expression of the target PTK7. Therefore, prior to the selection,
we introduced 10-fold excess of unlabeled Sgc8 in order to block
Sgc8 binding sites on PTK7 and, consequentiy, avoid selecting for
the same target again. The enriched pools were also cloned and
sequenced. The rationale of this approach is to generate a panel of
aptamers that would have differential binding recognition to
colorectal cancers.
Binding assays
1. Enrichment of selected pool. Flow cytometry was used
in all the binding assays to monitor the process and enrichment of
the selection pools. Prior to monitoring, DLD-1, HT-29 or HCT
116 cells were cultured overnight. Cells were dissociated either by
non-enzymatic cell dissociation solution (MD Biomedicals) or by
mild short time (30-60 sec) trypsin treatment at room
temperature. Dissociated cells were washed and incubated with
250 nM final concentration of the FITC-labeled ssDNA selection
pools at 4C in 100 \x\ incubation volume. After washing, the
pellets were resuspended in 200 (xl washing buffer, and the
fluorescence intensity was determined by FACScan cytometer (BD
Immunocytometry Systems) by counting 15,000 events. The
unselected DNA library labeled with FITC was used as the
background signal.
2. Assessment of potential aptamer candidates. The
initial assessment of potential aptamer candidates was done with
RCA reaction products obtained from sequencing in different 96-
well plates. The choice of which wells (sequence) to test was based
on the homology of the sequence alignment using ClustalX18.3.
Products from representative wells were diluted with 100 (xl of H2O
before use. Aliquots were amplified by PCR using FITC- and
biotin-labeled primers. The PCR products were used to prepare
11 December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
ssDNA, and the sense strand containing the FITC was used for
binding assay by flow cytometry. Sequences that showed
recognition with positive cells were chemically synthesized and
labeled with biotin. Biotin was used to label the synthesized ssDNA
so that the binding signal could be detected with any streptavidin-
conjugated fluorophore applicable to flow cytometry and
microscopy.
3. Screening of potential aptamer candidates and binding
affinities. The screening of potential aptamers and the binding
affinity of the successful aptamer candidates were done by flow
cytometry using biotin-labeled aptamer, and the signal was
detected with streptavidin-R-PE conjugate (0.5 mg R-PE at
0.25 mg/mL SAV, Invitrogen) or streptavidin-PE-Cy5.5 (.2 mg/
mL). To determine the binding affinity of the aptamers, positive
cells were cultured overnight and the cells dissociated using non-
enzymatic dissociation buffer and/or short time (30 sec) trypsin
treatment. Cells were washed and incubated with varying
concentrations (0.10 nM -500 nM final concentration) of biotin-
labeled aptamer in a 200 (xl volume of binding buffer containing
10% FBS. After 10 min of incubation, cells were washed twice
with washing buffer and then incubated with 100 (xl PE-
streptavidin conjugate or streptavidin-PE-Cy5.5 at a final
dilution of 1:400 dilution (optimized). This was incubated for
10 min and then washed twice with 1200 (xl washing buffer. The
cell pellets were resuspended in 200 (xl washing buffer and
analyzed by flow cytometry. The biotin-labeled unselected
library was used as a negative control to determine the
background binding. All binding assays were done in duplicate.
The mean fluorescence intensity of the unselected library was
subtracted from that of the corresponding aptamer with the target
cells to determine the specific binding of the labeled aptamer. The
apparent equilibrium dissociation constant (Kd) of the aptamer-
cell interaction was then obtained by fitting the dependence of
intensity of specific binding on the concentration of the aptamers
to the equation Y = B max X/(kd -I- X), using Sigma Plot (Jandel,
San Rafael, CA).
Confocal microscopy
The binding of the selected aptamers with the cells was further
assessed by confocal microscopy. The binding assay was similar to
the selection procedure. Here, DLD-1 or HCT 116 cells were
seeded in a 35 mm petri dish, 10 mm microwell (MatTek
Corporation), and cultured overnight. The cells showing more
than 60% confluence were carefully washed and then incubated
with the aptamers or control library at a final concentration of
250 nM. After incubation, ceUs were carefully washed before
incubation with 1:200 dilution (optimized) of streptavidin-conju-
gated Alexa Fluor 633 (Invitrogen) or 1:400 dilution of PE-
streptavidin conjugate for 10 min. Excess probes were washed off
and the signal detected with confocal microscopy (FV5 00-1X81
confocal microscope, Olympus America Inc., Melville, NY), with
40 X oil immersion objective (NA = 1.40, Olympus, Melville, NY).
Excitation wavelength and emission filters were as follows: PE,
488 nm laser line excitation, emission BP520; and Alexa Fluor
633 nm laser line excitation, emission LP650 filter.
Selectivity
The recognition of all the selected aptamers was tested on the
three colorectal cancer cell lines (DLD-1, HCT 116 and HT-29),
normal colon cell lines (FHC, CC 18Co) as well as HBE135 E6/
E7 (normal epithelial cell line). Although these aptamers were
developed using colorectal cancer cell lines, the possibility of
selecting for targets that are also present on other cancers could
not be ruled out. Therefore, the selectivity was further extended to
.'^p.- PLoS ONE I www.plosone.org
other cell lines from different cancers, including K562 (CML),
NB4 (APL), HL60, KG-1 (AML), Ramos (Burkitt's lymphoma),
CCRF-CEM (ALL), Hela (cervical) and NCI-H23, H1979, H661
(small cell lung cancer), Ludlu (squamous cells), CAOV3, (ovarian
cancer cell line) and U87MG (brain tumor). These cell lines were
used in binding assays as described above. In all the assays, the
final concentration of the each aptamer was 250 nM.
Competition assays
These selections generated a number of aptamers with varying
binding patterns and florescence signal intensities to the target cell
DLD-1. Competition assays were done to assess if any of these
aptamers would bind to the same target. In general, cell-SELEX
can identify multiple aptamers for multiple targets as weU as
multiple aptamers for a single target in a single selection. These
competition assays were designed based on the aptamers'
selectivity results. One set was designed for the aptamers that
showed selective binding to only the target DLD-1 cells, whereas
the other one was designed for all the other aptamers. In each
case, the unlabeled aptamer competitor was incubated with DLD-
1 cells in 10-fold excess final concentration (2.5 (xM). After
incubation, the other FITC-labeled aptamer was added at a final
concentration of 250 nM. As positive control to assess the
effectiveness of the assay, the same aptamer, with both labeled
and unlabeled, was used. The cells were washed and fluorescence
intensity determined by flow cytometry, as described.
Effect of temperature and culture medium on the
binding of aptamers
The ability of aptamers to recognize target at physiological
temperature is important, especially where these aptamers were
generated at lower temperatures. We therefore performed binding
assays at 37C to verify the stability of the binding of the aptamer
to its target. Before the binding assays, all reagents and buffers
were maintained at room temperature. Again, all centrifugations
were done at room temperature, but the actual binding was done
at 37C. Briefly, DLD-1 cells cultured for 24 hours were
dissociated with short time trypsin treatment. Cells were washed
and incubated with biotin-labeled aptamer at the final concentra-
tion of 250 nM. After incubation, the cells were washed and
incubated with streptavidin-PE or streptavidin PE-Cy5.5 for
10 mins. The cells were washed and the fluorescence intensity
determined.
The initial selection, monitoring and all the reported assays
were done in phosphate buffer. We therefore further assessed if the
aptamers could maintain the binding structure in culture medium
to recognize the target. Here binding assays were performed in
culture medium, and incubation was done both at 4C and 37C.
Normal human colon specimen
We tested the recognition pattern of these aptamers on fresh
normal human colon specimen. The fresh tissue was chopped into
small pieces and washed with PBS. The pieces were then
incubated in dissociation solution for 10 min. After a substantial
number of cells were released into solution, the supernatant was
collected and the cells pelleted. This was used in the binding assay
and detected by flow cytometry as described.
Supporting Information
Figure SI Binding assays showing the interaction of DNA
selected pools with DLD-1 cells dissociated using non enzymatic
dissociation solution (A) and short time trypsin (B). Black
12 December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
histogram (unselected library background), red (13th selected pool)
and blue (14th selected pool).
Found at: doi:10.1371/journal.pone.0014269.s001 (1.27 MB TIF)
Figure S2 Flow cytometry dotplots showing the interaction of
the RCA products with DLD-1 cells. A threshold based on
fluorescence intensity of FITC in the flow cytometry was set so
that about 5% of cells incubated with the FITC-labeled DNA
library represent fluorescence intensity background (lower right
quadrant), and the binding event was assessed based on the
percentage of cells binding over the threshold.
Found at: doi:10.1371/journal.pone.0014269.s002 (1.41 MB TIF)
Figure S3 Flow cytometry dot plot showing the interaction of
aptamer with normal human colon cells.
Found at: doi:10.1371/journal.pone.0014269.s003 (1.83 MB TIF)
Figure S4 Assessment of the effect of binding KDED 19,
KC2D4, and KC2D8 to DLD-1 cells in the presence of excess
of unlabeled Sgc8. Red histogram (control background); green
(aptamer binding without excess of unlabeled Sgc8) and blue
(aptamer binding in the presence of excess unlabeled Sgc8).
Found at: doi:10.1371/journal.pone.0014269.s004 (1.35 MB TIF)
References
1. Ogino S, Goel A (2008) Molecular Classification and Correlates in Colorectal
Cancer. Journal of Molecular Diagnostics 10: 1327.
2. Bagg A, Kallakury BV (1999) Molecular pathology of leukemia and lymphoma.
Am J Clin Pathol 112: S76-S92.
3. Arber DA (2000) Molecular diagnostic approach to non-Hodgkin's lymphoma.
J Mol Diagn 2: 178-190.
4. Ventura RA, Martin-Subero JI, Jones M, McParland J, Gesk S, et al. (2006)
FISH analysis for the detection of lymphomaassociated chromosomal abnor-
malities in roudne paraffm-embedded tissue. J Mol Diagn 8: 141151.
5. Casado E, De Castro J, Belda-Iniesta C, Cejas P, Feliu J, et al. (2007) Molecular
markers in colorectal cancer: genedc bases for a customized treatment. Clin
Transl Oncol 9: 549-554.
6. Kinzler KW, Vogelstein B (1998) Landscaping the cancer terrain. Science 280:
1036-1037.
7. Umar A, Srivastava S (2004) The promise of biomarkers in colorectal cancer
detecdon. Disease Markers 20: 8796.
8. Lindblom A (2001) Different mechanisms in the tumorigenesis of proximal and
distal colon cancers. Curr Opin Oncol 13: 6369.
9. Liu B, Nicolaides NC, Markowitz S, Willson JK, Parsons RE, et al. (1995)
Mismatch repair gene defects in sporadic colorectal cancers with microsatellite
instability. Nat Genet 9: 48-55.
10. Andre T, Tournigand C, Mineur L, Fellague-Chebra R, Flesch M, et at (2007)
Phase II study of an optimized 5-fluorouraciloxaliplatin strategy {OPTIMOX2)
with celecoxib in metastatic colorectal cancer: a GERCOR study. Ann Oncol
18: 77-81.
11. Hurwitz H, Fehrenbacher L, Novotny W, Cartwright T, HainsworthJ, et al.
(2004) Bevacizumab plus irinotecan, fluorouracil, and leucovorin for metastatic
colorectal cancer. N Engl J Med 350: 2335-2342.
12. Hardcasde JD, Chamberlain JO, Robinson MH, Moss SM, Amar SS, et al.
(1996) Randomised controlled trial of faecal-occult-blood screening for
colorectal cancer. Lancet 348: 14721477.
13. Kronborg O, Fenger C, Olsen J, Jorgensen OD, Sondergaard O (1996)
Randomised study of screening for colorectal cancer with faecal-occult-blood
test. Lancet 348: 1467-1471.
14. Kim SY, Hahn WC (2007) Cancer genomics: integradng form and function.
Carcinogenesis 28: 1387-1392.
15. Faca V, Krasnoselsky A, Hanash S (2007) Innovative proteomic approaches for
cancer biomarker discovery. BioTechniques 43: 279283.
16. Kim HJ, Yu M-H, Kim H, Byun J, Lee C (2008) Noninvasive molecular
biomarkers for the detection of colorectal cancer. BMB reports, pp 685692.
17. Tuerk C, Gold L (1990) Systematic evoludon of ligands by exponential
enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249:
505-510.
18. Ellington AD, Szostak JW (1990) In uitm selection of RNA molecules that bind
specific ligands. Nature 346: 818-822.
19. Morris KN, Jensen KB, Julin CM, Weil M, Gold L (1998) High affinity ligands
from in vitro selection: Complex targets. ProcNad Acad Sci (U S A) 95:
2902-2907.
20. Hicke BJ, Marion C, Chang Y-F, Gould T, Lynott CK, et al. (2001) Tenascin-C
Aptamers Are Generated Using Tumor Cells and Purified Protein. J Biol Chem
276: 48644^8654.
21. Wang C, Zhang M, Yang G, Zhang D, Ding H, et al. (2003) Single-stranded
DNA aptamers that bind differentiated but not parental cells: subtractive
.'^p.- PLoS ONE I www.plosone.org
Figure S5 Assessment of the binding of selected aptamers at
37C. Red color represents cell background; green (unselected
library) and blue (aptamer signal).
Found at: doi:10.1371/journal.pone.0014269.s005 (1.39 MB TIF)
Figure S6 Selected aptamers were incubated with cells using
culture medium RPMI-1640 as the binding medium. Red
(unselected library background); Blue (aptamer signal using PBS
binding buffer) and Green (aptamer signal in RPMI-1640).
Found at: doi:10.1371/journal.pone.0014269.s006 (1.38 MB TIF)
Text SI
Found at: doi:10.1371/journal.pone.0014269.s007 (0.04 MB
DOC)
Author Contributions
Conceived and designed the experiments: KS WT. Performed the
experiments: KS LM DLC EJ. Analyzed the data: KS LM DLC EJ CL
WT. Contributed reagents/materials/analysis tools: KS LM CL. Wrote
the paper: KS WT.
systematic evolution of ligands by exponential enrichment. Journal of
Biotechnology 102: 15-22.
22. Cerchia L, Duconge F, Pestourie C, Boulay J, Aissouni Y, et al. (2005)
Neutralizing aptamers from whole-cell SELEX inhibit the RET receptor
tyrosine kinase. PLoS Biol 3: 0697-0704.
23. Shangguan D, Li Y, Tang Z, Cao ZC, Chen HW, et al. (2006) Aptamers evolved
from live cells as effective molecular probes for cancer study. Proc Nad Acad Sci
(USA) 103: 11838-11843.
24. Tang Z, Shangguan D, Wang K, Shi H, Sefah K, et al. (2007) Selection of
Aptamers for Molecular Recognition and Characterization of Cancer Cells.
Anal Chem 79: 4900-4907.
25. Chen HW, Medley CD, Sefah K, Shangguan D, Tang Z, et al. (2008) Molecular
Recognition of Small-Cell Lung Cancer Cells Using Aptamers. Chem Med Chem
3: 991-1001.
26. Sefah K, Tang ZW, Shangguan DH, Chen H, Lopez-Colon D, et al. (2009)
Molecular recognition of acute myeloid leukemia using aptamers. Leukemia 23:
235-244.
27. Hofmann HP, Limmer S, Hornung V, Sprinzl M (1997) Ni^^-binding RNA
motifs with an asymmetric purine-rich internal loop and a G-A base pair. RNA
3: 1289-1300.
28. Rajendran M, Ellington AD (2008) Selection of fluorescent aptamer beacons
that light up in the presence of zinc. Anal Bioanal Chem 390: 10671075.
29. Geiger A, Burgstaller P, von der Eltz H, Roeder A, Famulok M (1996) RNA
aptamers that bind L-arginine with sub-micromolar dissociation constants and
high enantioselectivity. Nucleic Acids Res 24: 10291036.
30. Wallace ST, Schroeder R (1998) In vitro selection and characterization of
streptomycin-binding RNAs: recognition discrimination between antibiotics
RNA 4: 112-123.
31. Williams KP, Liu X-H, Schumacher TNM, Lin HY, Ausiello DA, et al. (1997)
Bioactive and nuclease-resistant 1-DNA ligand of vasopressin. Proc Nad Acad
Sci(U S A) 94: 11285-11290.
32. Tuerk C, MacDougal S, Gold L (1992) RNA pseudoknots that inhibit human
immunodeficiency virus type 1 reverse transcriptase. Proc Nad Acad Sci (U S A)
89: 6988-6992.
33. Kubik MF, Stephens AW, Schneider D, Marlar RA, Tasset D (1994) High-
affmity RNA ligands to human a-thrombin. Nucl Acids Res 22: 2619-2626.
34. JeUinek D, Green LS, Bell C, Lynott CK, Gill N, et al. (1995) Potent 2'-Amino-
2'-deoxypyrimidine RNA Inhibitors of Basic Fibroblast Growth Factor.
Biochemistry 34: 11363-11372.
35. Davis KA, Lin Y, Abrams B,Jayasena SD (1998) Staining of cell surface human
CD4 with 2'-F-pyrimidine-containing RNA aptamers for flow cytometry.
Nucleic Acids Res 26: 3915-3924.
36. Mallikaratchy P, Stahelin RV, Cao Z, Chob W, Tan W (2006) Selection of DNA
ligands for protein kinase C-5. Chem Commun. pp 32293231.
37. Pan W, Craven RC, Qiu Q, Wilson CB, Wills JW, Golovine S, et al. (1995)
Isolation of virus-neutralizing RNAs from a large pool of random sequences.
Proc Nad Acad Sci (U S A) 92: 11509-11513.
38. Kumar PKR, Machida K, Urvil PT, Kakiuchi N, Vishnuvardhan D, et al.
(1997) Isolation of RNA aptamers specific to the NS3 protein of hepatitis C virus
from a pool of completely random RNA. Virology 237: 270282.
39. Misono TS, Kumar PKR (2005) Selection of RNA aptamers against human
influenza virus hemagglutinin using surface Plasmon resonance. Anal Biochem
342: 312-317.
13 December 2010 | Volume 5 | Issue 12 | e14269
Aptamers for Colorectal Cancer
40. Gopinath SG B, Misono TS, Kawasaki K, Mizuno T, Imai M, et al. (2006) An
RNA aptamer that distinguishes between closely related human influenza viruses
and inhibits haemagglutinin-mediated membrane fusion. Journal of General
Virology 87: 479^87.
41. Tang Z, Parekh P, Turner P, Moyer RW, Tan W (2009) Generating aptamers
for recognition of virus-infected cells. Glinical Ghemistry 55: 813822.
42. Bruno JG, KielJL (1999) In vitro selection of DNA aptamers to anthrax spores
with electrochemiluminescence detection. Biosens Bioelectron 14: 457464.
43. Hamula GLA, Zhang H, Guan LL, Li X-F, Le G (2008) Selection of Aptamers
against Live Bacterial Gells. Anal Ghem 80: 78I2-78I9.
44. Shangguan D, Gao Z, Meng L, Mallikaratchy P, Sefah K, et al. (2008) Gell-
Specific Aptamer Probes for Membrane Protein Elucidation in Gancer Gells.
J Proteome Res 7: 2I33-2I39.
45. Mallikaratchy P, Tang Z, Sefah K, Meng L, Shangguan D, et al. (2007) Aptamer
direcdy evolved from live cells recognizes membrane bound immunoglobin
heavy mu chain in Burkitt's lymphoma cells. Mol Gell Proteomics 6: 22302238.
46. Hector S, Prehn JHM (2009) Apoptosis signaling proteins as prognosdc
biomarkers in colorectal cancer: A review. Biochimica et Biophysica Acta 1795:
II7-I29.
47. Petricoin III EF, Ardekani AM, Hitt BA, Levine PJ, Fusaro VA, et al. (2002) Use
of proteomic patterns in serum to idendfy ovarian cancer. Lancet 359: 572577.
48. Diederichsen AG, Hansen TP, Nielsen O, Fenger G, JenseniusJG, et al. (1998)
A comparison of flow cytometry and immunohistochemistry in human colorectal
cancers. APMIS 106: 562-570.
[. PLoS ONE I www.plosone.org 14 December 2010 | Volume 5 | Issue 12 | e14269
|