Citation
A Comparative Genomics Approach To Understanding The Roles Of P53 Binding Sites

Material Information

Title:
A Comparative Genomics Approach To Understanding The Roles Of P53 Binding Sites
Series Title:
19th Annual Undergraduate Research Symposium
Creator:
Cheung, Jessica
Acuna Higaki , Adrian
Pelletier, Nicole
Language:
English
Physical Description:
Undetermined

Subjects

Subjects / Keywords:
Center for Undergraduate Research
Center for Undergraduate Research
Genre:
Conference papers and proceedings
Poster

Notes

Abstract:
Cancer is one of the leading causes of mortality worldwide, with over 8 million deaths per year. In more than 50% of cancers, the transcription factor P53 serves as a tumor suppressor which exerts anti-proliferative functions in response to oncogenic stressors. Through ChIP-Seq analysis, thousands of P53 binding sites in mammalian genomes have been identified, yet the functionality of these binding sites remains to be established. It is hypothesized that mutations or epigenetic silencing of non-coding regulatory sequences of P53 target genes play an extensively important role in cancers. By using Drosophila as a model organism, a comparative genomic approach to identify functional P53 binding sites is proposed. To do this, a library of significant P53 binding sites must first be established by looking at data obtained from RNA-seq and comparing them to our ChIP-Seq data. Next, CRISPR-Cas9 will be used to generate Drosophila models containing mutations in the P53 binding sites near the pro-apoptotic genes Hid and Rpr. Selected adult flies containing the CRISPR-Cas9 induced mutations will undergo irradiation induced DNA damage to assess their functional importance. By using this approach we will discover functional roles of non-coding regulatory regions in tumorigenesis and contribute to apoptosis inducing cancer therapies. ( en )
General Note:
Research authors: Adrian acuna higaki, Nicole Pelletier, Jessica Cheung, Varsha Sundaresan, Ying Li, Benedetto DiCaccio, Victor Lin, Lei Zhou - University of Florida
General Note:
Faculty Mentor: Cancer is one of the leading causes of mortality worldwide, with over 8 million deaths per year. In more than 50% of cancers, the transcription factor P53 serves as a tumor suppressor which exerts anti-proliferative functions in response to oncogenic stressors. Through ChIP-Seq analysis, thousands of P53 binding sites in mammalian genomes have been identified, yet the functionality of these binding sites remains to be established. It is hypothesized that mutations or epigenetic silencing of non-coding regulatory sequences of P53 target genes play an extensively important role in cancers. By using Drosophila as a model organism, a comparative genomic approach to identify functional P53 binding sites is proposed. To do this, a library of significant P53 binding sites must first be established by looking at data obtained from RNA-seq and comparing them to our ChIP-Seq data. Next, CRISPR-Cas9 will be used to generate Drosophila models containing mutations in the P53 binding sites near the pro-apoptotic genes Hid and Rpr. Selected adult flies containing the CRISPR-Cas9 induced mutations will undergo irradiation induced DNA damage to assess their functional importance. By using this approach we will discover functional roles of non-coding regulatory regions in tumorigenesis and contribute to apoptosis inducing cancer therapies. - Center for Undergraduate Research,

Record Information

Source Institution:
University of Florida
Rights Management:
Copyright Jessica Cheung. Permission granted to University of Florida to digitize and display this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

CRISPR Cas 9 genome editing tool will be used to generate Drosophila models containing mutations in the P 53 binding sites near the Drosophila pro apoptotic genes Hid and Rpr Further studies will be conducted to identify the functional importance of P 53 binding to repetitive sequences as well We further aim to see if the binding strength and functions carried out by P 53 differs between repetitive and non repetitive binding regions Out of the 32 Hid and 28 Rpr stocks generated, very few had significant mutations and none had the required mutations near the specific binding motifs For this reason, we are generating a larger select of stocks containing CRISPR Cas 9 in order to increase the chances of obtaining the required stock needed for functional analysis Selected adult flies containing the CRISPR Cas 9 induced mutations near the specific binding sites will undergo irradiation induced DNA damage to assess their functional importance We will perform comparison studies of damage induced P 53 binding in human, mouse, and Drosophila models to identify analogous patterns In addition, we found an unknown cause of lethality in some flies containing homozygous induced mutation when using the CRISPR Cas 9 genome editing system Throughout this process we will be tracking lethality percentage again and performing sequencing and complementation studies to ensure that the cause of lethality will not affect the conclusion of our experiments By using this approach, we will discover functional roles of non coding regulatory regions in tumorigenesis and contribute to apoptosis inducing cancer therapies A Comparative Genomics Approach to Understanding the Roles of Individual P53 Binding Sites Adrian Acuna Higaki a,b Nicole Pelletier a,b Jessica Cheung a,b Varsha Sundaresan a,b Ying Li a Benedetto Diciaccio a Victor T Lin a Lei Zhou a,b,c a Department of Molecular Genetics and Microbiology, University of Florida, Gainesville, FL 32610, USA b UF Health Cancer Center, University of Florida, Gainesville, FL 32610, USA c UF Genetics Institute, University of Florida, Gainesville, FL 32610, USA INTRODUCTION Figure 1. Genomic binding of DmP53 following DNA damage. A) Western blot verification of DmP53 Ab in wt and P53 / Drosophila embryos before and after XR, B) P53 ChIP qPCR showing P53 binding in front of pro apoptotic gene Rpr (IgG control), C) ChIP seq peak close to Rpr in Sensitive stage embryos after X ray, D) ChIP seq peak close to Hid in Sensitive stage embryos after X ray. A. B. C. D. hid METHODS Cancer is one of the leading causes of mortality worldwide, with over 8 million deaths per year In more than 50 % of cancers, the transcription factor P 53 comes into play, serving as a tumor suppressor that exerts distinct anti proliferative functions in response to a variety of oncogenic stressors Mutations in the tp 53 gene are thought to be one of the most common mechanisms by which cancer evades tumor suppression The importance of P 53 cannot be overlooked as potential therapies for cancer become available Through ChIP Seq analysis, thousands of P 53 binding sites in mammalian genomes have been previously identified, yet the functionality of these binding sites remains to be established In order to further study the P 53 binding profile, we established a library of significant P 53 binding sites by looking at upregulated and downregulated genes obtained from RNA seq and comparing them to our ChIP Seq data It was found that there is P 53 dependent induction of pro apoptotic genes in response to irradiation in early stem cell like stages but not in the differentiated stages It is hypothesized that mutations or epigenetic silencing of non coding regulatory sequences of P 53 target genes play just as an important role in cancers as do the extensively studied coding regions of p 53 By using Drosophila as a model organism, a comparative genomic approach to identify functional P 53 binding sites and determine their roles in tumorigenesis is proposed Zhaoyu Xue et al. G3 2014;4:2167 2173 ACKNOWLEDGEMENTS RESULTS FUTURE DIRECTIONS CONTACT INFORMATION Nicole Pelletier Adrian Acuna Higaki Email: nfp13@ufl.edu Email: aracuna@ufl.edu We would like to extend our gratitude to Dr Lei Zhou and Varsha Sundaresan for their mentorship, guidance, and support throughout our research experience We would also like to thank the rest of the members in Zhou lab Stock Genotype Sequence 1 R 12 bp deletion AGCGTGCATC GACGTGTTCG AAG GCCT -----------4 R 9 bp deletion AGCGTGCATC GACGTGTTCG A -------TGGG 9 R 3 bp substitution + 2 bp deletion AGCGTGCATC GACGTGTTCG AAG GC TCC TT -GG 15 R 3 bp deletion AGCGTGCATC GACGTGTTCG AAG GCC --TTGGG 17 R 2 bp substitution + 1 bp insertion AGCGTGCATC GACGTGTTCG AAG GC T T C C ATTTGGG 7 H 1 bp substitution TGAA CATACAT A AATATGTACATT ATGCAAGGATTT CCCAAGATGACGAAATTCAAGCA 19 H 1 bp substitution TGA -CATACAT A AATATGTACATT ATGCAAGGATTT CCCAAGATGACGAAATTCAAGCA 20 H 2 bp deletion TGA -CATACATGA -TATGTACATT ATGCAAGGATTT CCCAAGATGACGAAATTCAAGCA gRNA subsitution P 53 MOTIF insertion ------: deletion Figure 2. A) This diagram summarizes the findings regarding the irradiation responsive enhancer region (IRER), a 33kb intergenic sequence on the 3 rd chromosome that is located between two pro apoptotic genes reaper and sickle This region is subject to epigenetic regulation which undergoes an open to closed transition during embryonic stages 11 12, B) This schematic shows how we will be using the CRISPR/Cas9 mediated conditional mutagenesis system to create mutations in the germ cells of adult Drosophila A. B. Table 1 In Table 1 we selected a few stocks to showcase the preliminary results and analysis from the sequencing data. We will continue to screen for mutations that disrupt the P53 binding motif and perform functional analysis. Key: Jessica Cheung Email: jessica32b@ufl.edu