Citation
U.S. Army Medical Department journal

Material Information

Title:
U.S. Army Medical Department journal
Alternate title:
United States Army Medical Department journal
Alternate Title:
AMEDD journal
Running title:
Army Medical Department journal
Abbreviated Title:
U.S. Army Med. Dep. j.
Creator:
United States -- Army Medical Department (1968- )
Place of Publication:
Fort Sam Houston, TX
Publisher:
U.S. Army Medical Department
Publication Date:
Frequency:
Quarterly[<Oct.-Dec. 2001->]
Bimonthly[ FORMER Sept.-Oct. 1994-]
quarterly
regular
Language:
English
Physical Description:
volumes : illustrations ; 28 cm

Subjects

Subjects / Keywords:
Medicine, Military -- Periodicals -- United States ( lcsh )
Military Medicine ( mesh )
Medicine ( mesh )
Medicine, Military ( fast )
United States ( mesh )
United States ( fast )
United States
Genre:
Electronic journals.
Periodicals.
Periodicals. ( fast )
Fulltext.
Government Publications, Federal.
Internet Resources.
serial ( sobekcm )
federal government publication ( marcgt )
periodical ( marcgt )
Electronic journals ( lcsh )
Periodicals ( mesh )
Periodicals ( fast )
Fulltext
Government Publications, Federal
Periodicals
Internet Resources

Notes

Dates or Sequential Designation:
Sept.-Oct. 1994-
General Note:
Title from cover.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
This item is a work of the U.S. federal government and not subject to copyright pursuant to 17 U.S.C. §105.
Resource Identifier:
32785416 ( OCLC )
98642403 ( LCCN )
1524-0436 ( ISSN )
ocm32785416
Classification:
RC970 .U53 ( lcc )
616.9/8023/05 ( ddc )
W1 JO96 ( nlm )

Related Items

Preceded by:
Journal of the US Army Medical Department.

UFDC Membership

Aggregations:
Digital Military Collection

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

JulySeptember 2017Outcomes of a Military Regional Multispecialty Synchronous Telehealth Platform and the Importance of the Dedicated Patient Presenter . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1COL Kirk H. Waibel; Stephanie J. Garner, RN; Brandon Carter, RN; Irfan Bojicic, RN; Robin Smith, RNA Retrospective Analysis: Do Bacterial Culture and Sensitivity Data Support Empiric Use of Piperacillin-Tazobactam and Antipseudomonal Fluoroquinolones in Hospitalized Patients? . . . . . . . .9CPT Pulkit Saxena; CPT Ryan V. Burkhart; MAJ Craig R. AinsworthLow Prevalence of Carbapenem-Resistant Enterobacteriaceae Among Wounded Military Personnel .. ... 12Katrin Mende, PhD; Miriam L. Beckius, MPH; Wendy C. Zera; Fatma Onmus-Leone, MS; et alEffects of Mandatory Screening Labs in Directing the Disposition of the Apparently Healthy Psychiatric Patient in the Emergency Department . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18MAJ Karyn E. Kagel; CPT Meghan Smith; CPT Ilya V. Latyshenko; et alResilience-Enhancing Relationships: What We Can Learn From Those With a History of Adverse Childhood Experiences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25COL Derrick Arincorayan; Larry Applewhite, PhD; MAJ Matthew Garrido; et alA Randomized Comparison Between Neurostimulation and Ultrasound-Guided Lateral Femoral Cutaneous Nerve Block . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33Gaurav Gupta, MD, FRCPC; Mohan Radhakrishna, MC, FRCPC; Isacc Tamblyn, PhD; et alOcclusion Training: Pilot Study for Postoperative Lower Extremity Rehabilitation Following Primary Total Knee Arthroplasty . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39Capt Christopher L. Gaunder, USAF, MC; CPT Michael P. Hawkinson; et al Rehabilitation and Tactical Athlete Fitness . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44Capt Gavin L. Mills, USAF, MC; COL Anthony E JohnsonMartial Arts-Based High Intensity Interval Training in the Rehabilitation of Combat Amputees . . . . ...... 53Capt Gavin L. Mills, USAF, MC; CPT David J. Tennent; LTC Joseph F. Aldrete; COL Anthony E. JohnsonCharacteristics of US Combat Veterans (2001-2011) Who Remain on Active Duty After Upper Extremity Amputations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57Sara H. Kift, DScOT; Capt Taylor J. Bates, USAF, MC; CPT Nathan A. Franklin; COL Anthony E. Johnson . ...... 62LTC Thomas M. Johnson; LCDR Esra Toussaint-Barrett, USPHS; LTC Jose M. PizarroResistance to Abrasion of Extrinsic Porcelain Esthetic Characterization Techniques . . . . . . . . . . . 71LTC Woo J. Chi; William Browning, DDS; Stephen Looney, PhD; et alEffect of Smokeless Tobacco on Surface Roughness of Dental Restorations . . . . . . . . . . . . . . . . 80Placement and Replacement Rates of Amalgam and Composite Restorations on Posterior Teeth in a Military Population . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 88MAJ Benjamin D. Owen; COL Peter H. Guevara; COL William GreenwoodImproved Coding Accuracy in an Academic Practice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95LTC Dana Nguyen; MAJ Heather OMara; CPT Roberty PowellWinging of the Scapula Diagnosed as Parsonage-Turner Syndrome: A Case Report . . . . . . . . . . . 99CPT Christine Carroll; Bill Bass MD J OURNAL THE UNITED STATES ARMY MEDICAL DEPARTMENT

PAGE 2

J OURNALA Professional Publication of the AMEDD CommunityTHE UNITED STATES ARMY MEDICAL DEPARTMENTOnline issues of the AMEDD Journal are available at http://www.cs.amedd.army.mil/amedd_journal.aspxJulySeptember 2017 US Army Medical Department Center & School P B 8-17-7/8/9 The Army Medical Department Journal [ISSN 1524-0436] is published quarterly 3630 Stanley RD STE B020478234-6100. The Army Medical Department Journal are listed and Journals CORRESPONDENCE: (210) 221-6301, DSN 471-6301DISCLAIMER: The AMEDD Journal in the AMEDD Journal AMEDD Journal CONTENT: AMEDD Journal .OFFICIAL DISTRIBUTION: By Order of the Secretary of the Army: GERALD B. OKEEFE Secretary of the Army Mark A. Milley 1719803LTG Nadja Y. West MG Brian C. Lein

PAGE 3

July September 2017 1Telehealth development and implementation within the military has continued to grow at a rapid pace. As part of the Army Campaign 2020, the US Army Medical Com with the initiation of the Telehealth Service Line (THSL) in 2010 to develop and implement enterprise-level tele health strategies.1 While the majority of telehealth en behavioral health or via an asynchronous or store-andforward modality, telehealth can also encompass mul tispecialty synchronous or real-time patient interaction, remote patient monitoring, and mobile health.2 For 20142016, the MEDCOM THSL directed efforts to expand a comprehensive patient-centered experience using a multispecialty synchronous platform; however, multiple barriers and challenges exist between regional medical centers and remote clinics where specialists and patients are located. One major challenge is creating a sustainand healthcare personnel at the originating site where the patient and presenter are located with the distant site where the specialist is located.3 Unfortunately, there are no current dedicated telehealth positions on the US Ar mys organizational Table of Distribution and Allowanc es with the exception of the THSL headquarters located under the MEDCOM G-3/5/7 Patient Care Integration. Thus, regional health commands and local Army health clinics (AHCs) are left to determine how they can sup port telehealth. Many articles have discussed the roles and responsibilities of the telehealth presenter but we in presenter capabilities and its effect on telehealth.4-11 Herein, we report the results of a multispecialty synchronous telehealth program after developing 3 differ ent categories of patient presenters. We also discuss spe presenters and their effect on regional telehealth efforts Outcomes of a Military Regional Multispecialty Synchronous Telehealth Platform and the Importance of the Dedicated Patient Presenter C OL Kirk H. Waibel, MC, USA I rfan Bojicic, RN S tephanie J. Garner, RN R obin Smith, RN B randon Carter, RN ABSTRa A CT Implementing a successful multispecialty synchronous telehealth program requires identifying and overcoming numerous barriers. One key aspect of synchronous telehealth involves the telehealth presenter; however, the im pact that a dedicated patient presenter has supporting routine multispecialty synchronous telehealth is unknown. Methods: We conducted a retrospective review of telehealth encounters conducted from a single regional medi cal center over a two-year period to 12 outlying health clinics which provided one of 3 levels of patient presenter support: category 1 locations had a dedicated telehealth registered nurse, category 2 locations had a nondedi cated registered nurse or licensed vocational nurse, and category 3 locations were supported by an Army medic (military occupational specialty 68W). Results: A total of 4,032 telehealth encounters occurred from January 2014 to December 2015 involving 26 distinct specialties located within a single regional medical center and 12 outlying health clinics which sup per month compared to either category 2 or category 3 locations ( P <.0001). Category 1 and category 2 locations Comment: and evaluated its effect on telehealth activity. Regional medical centers initiating a multispecialty synchronous telehealth program should strongly consider hiring, educating, and placing dedicated presenters at patient origi nating sites.

PAGE 4

2 http://www.cs.amedd.army.mil/amedd_journal.aspx METHODS The primary objective of this retrospec tive review was to assess the number of clinical encounters per month in indi vidual AHCs comparing 3 telehealth presenter categories. Secondary objectives assessed year-to-year telehealth activity and telehealth activity in locations prior to and after implementation of dedicated telehealth presenters. From (4,032/4,112) of synchronous telehealth encounters in Regional Health Com mand Europe (RHC-E) were conducted by healthcare providers located at the Landstuhl Regional Medical Center (K. H. W., unpublished data). Landstuhl Regional Medical Center (LRMC) is the regional strategic specialty medi cal platform supporting approximately in 12 distant AHCs located in Germany, Italy, and Belgium (Figure 1). Prior to 2015, telehealth efforts in RHC-E were focused on behavioral health and sur gical subspecialties. However, in part due to the reluctance of frontline staff to support telehealth as a routine com ponent of patient care, the European Advancement for Regional Telehealth project was launched in late 2014, hir senters who supported a comprehensive medical, surgical, and behavioral health telemedicine platform.3One clear barrier at the initiation of regional telehealth efforts in 2013 centered on consistent patient presenta ditional resources to support regional telehealth efforts, despite regional policies directing immediate priority to these efforts. Simply put, initial resistance to various pi lot projects mirrored known telehealth barriers.3 Second a GS-0610-10 position description was developed for a Registered Nurse (Clinical) Telehealth Nurse Care Coor dinator (TNCC). Further, 3 categories for a telehealth pa tient presenter were established to model potential assets within the AHC: category 1 represented the dedicated cialty telehealth platform within the AHC (ie, dedicated telehealth presenter); category 2 was a registered nurse or licensed vocational nurse (LVN) located within the clin ic but telehealth was not their full time duty; category 3 was a military occupational specialty (MOS) 68W medic education, and competency assessment regarding the telehealth processes for each patient encounter. Hired in late 2014, Category 1 TNCCs spent an initial week with the regional telehealth team, individually met with each operating procedures (SOPs) and presentations skills, engaged in weekly one-hour telehealth huddles with the regional telehealth nurse manager, and returned every 6 months for refresher training and new service develop ment. Category 2 and 3 locations were assisted with tel ephonic, video teleconference, and in-person site visits as requested. All telehealth visits regardless of location required writ ten patient or parental consent. Synchronous telehealth visits conducted between patients and providers were performed on a secure, Health Insurance Portability and Accountability Act (HIPAA)-compliant video link. Each OUTCOMES OF A MILITARY REGIONAL MULTISPECIALTY SYNCHRONOUS TELEHEALTH PLATFORM AND THE IMPORTANCE OF THE DEDICATED PATIENT PRESENTER Italy Germany Belgium Army health clinic with dedicated health presenterLandstuhl Regional Medical Center Army health clinic Figure 1. Locations of Army Regional Health CommandEurope Army health clinics.

PAGE 5

July September 2017 3 AHC supporting telehealth had one standardized Polycom HDX 9000 Practitioner Cart (Polycom, Inc, San Jose, CA) which included an AMD2500 General Exam Camera, AMD Fiberoptic Otoscope, and AMD Tel ephonic Stethoscope (AMD Global Telemedicine, Chelmsford, MA). All presenters, regardless of category, were trained on the use of all devices. Providers used a desktop computer installed with Polycom RealPres ence software and camera (Polycom, Inc, San Jose, CA). Per current telehealth guidance, all clinic encounters at the patient site are coded as a 99499 visit with an originating site fee: HCPCS (Healthcare Common Procedure Coding System) Q3014. visit follow standard clinic operating procedures (ie, a HIPAA compliant exam room, vital signs obtained, medications reconciled, and consented for telehealth). At the allotted appointment time, both the originating site where the patient is located and the distant site (ie, LRMC specialist) dial-in to a video conference bridge. At that time, good audio and video is established, a unique access code is provided by the bridge technician to both parties, and the bridge technician signs out which 2016 Ambulatory Care National Patient Safety Goal, is established by the specialist and the appointment begins. ses can be virtually shared or emailed to the patient and presenter, respectively. At the request of the specialist, the presenter can perform a physical exam using a highform any aspect of the ear, eye, nose, throat, heart, lung, and skin exam. Category 1 dedicated telehealth present aspects of the history and physical exam (Table 2). Study approval was obtained from the LRMC Human Research Protection Program. Descriptive statistics were used for demographic and AHC details. One-way ANOVA was used to assess differences for intraand inter-TNCC category encounters. Population-corrected telehealth activity between locations was calculated using the 2-tailed Mann-Whitney RRESULTS From January 2014 and December 2015, 4,032 synchronous telehealth encounters oc curred among 26 distinct specialties located within a single regional medical center and ulation varied at each AHC with a median (range) of 4,184 (411-10,214) with a total ben median (range) distance from outlying AHCs to LRMC was 366 (40-940) kilometers. Regarding the 12 AHCs: from January to October 2014 (10 months) which was prior to hiring 3 category 1 dedicated patient present Table 1. Telehealth presenter categories and Army health clinic (AHC) location.TNCC category (Nov 2014 -Dec 2015 )1 2 3Skill level Dedicated presenter (TNCC) AHC nurse, LVN, or 68W medic 68W medic only AHC location Stuttgart (PCH) Vilseck (VSK) Wiesbaden (WBD) Grafenwoehr (GFW) Katterbach (KTB) Shape (SHP) Vicenza (VCZ) Baumholder (BHR) Brussels (BSL) Hoenfels (HHF) Illesheim (ILS) Livorno (LVO) Median population (range) 8 236 ( 6 968 10 214 ) 6 157 ( 3 487 8 548 ) 1 884 ( 411 4 141 ) Total population 25 418 24 349 10 465TNCC indicates Telehealth Nurse Care Coordinator; LVN, licensed vocational nurse. Table 21 TNCCs.Specialty Unique capabilities Allergy/Immunology Asthma control test; Allergen immunotherapy and omalizumab consent forms; spirometry, peak flow measurement Anesthesia/Preoperative12-lead ECG, telestethoscope, Mallampati score Cardiology12-lead ECG, Holter event monitor Dermatology Vibrent Teledermatology Ear, Nose, and Throat Fiberoptic laryngoscopy, whisper test, Weber and Rinne test General surgery Postoperative wound assessment, suture removal, dressing changes, wound VAC changes Neurosurgery Socrates, complete neurological exam, follow up xray Occupational therapy Goniometry, dynamometer Orthopedics Specialized shoulder exam (eg, Neers, OBriens, Hawkins test), specialized knee exam, suture and splint removal, CAM boot, goniometry, follow up x-rays Pediatric development Head circumference Plastic surgery Body measurements for elective surgery Podiatry Suture/splint removal, CAM boot, goniometry for ankle range of motion Pulmonary Spirometry and peak flow measurement Sleep medicineEpworth sleepiness scale, Friedman score, Mallampati score, neck circumference Urology Postoperative examination, Bladder ultrasound*Depending on facility capabilities. TNCC indicates Telehealth Nurse Care Coordinator; CAM, controlled ankle motion.

PAGE 6

4 http://www.cs.amedd.army.mil/amedd_journal.aspx through December 2015, the 5 category 3 sites remained verted to category 1 sites with the hiring and placement of 3 dedicated telehealth registered nurses (Figure 2). The 3 category 1 telehealth nurses worked in their re being hired in a dedicated nurse presenter position, but were not engaged with patient presentation prior to be ing hired. Monthly telehealth encounters for November most telehealth encounters per month compared to either category 2 or category 3 locations ( P<. 0001) (Figure 3). ry 1 locations in 2015 ( P=. 08) which observed an average were observed within the 4 category 2 and 5 category 3 locations, respectively ( P <.05), but category 2 locations compared to category 3 locations ( P<. 0001) with an av P<. 05) 3). Category 1 sites activity as a percentage of all sites ber 2014 to December 2015 (Figure 4). Controlling for population size, 2 category 1 locations P=. 82). One category 1 AHC ( P=. 45) and one category 3 AHC ( P=. 16). The per centage of the population utilizing telehealth per month (Vilseck and Wiesbaden) (Figure 5). For 2015, the mean telehealth at category 1, 2, and 3 sites were 7.04 (4.65) P<. 05). When comparing one AHC to another AHC there were a number of locations that were statistically distinct from one another (Table 3).Estimated travel distance, travel expenses, and days missed if each patient visit was based on a single indi vidual travelling to LRMC for their visit from November OUTCOMES OF A MILITARY REGIONAL MULTISPECIALTY SYNCHRONOUS TELEHEALTH PLATFORM AND THE IMPORTANCE OF THE DEDICATED PATIENT PRESENTERFigure 2. Comparison of mean telehealth encounters per month at Army health clinics prior to and after hiring 3 Category 1 telehealth nurses. Notes: indicates P <.05; indicates P <.0001; NS 1. Army Health Clinic Location (see Notes below) Category of Telehealth Nurse Care Coordinator Service Category 1 Category 2 Category 340 10 0 50 20 60 30BHRWBD BSL SHP LVO VCZ GFW HHF ILS KTB VSK PCH NS NS NS Mean Encounters per Month

PAGE 7

July September 2017 5 2014 through December 2015 equaled 1.65 million ki lometers driven, $1.13 million in travel expenses, and 4,365 work days missed (Table 4). CCOmm MM ENT Telehealth can encompass a number of modalities, but multispecialty synchronous or real-time telehealth cur rently provides the best patient satisfaction.12 Further, synchronous telehealth fosters the patient-physician re lationship through direct communication.13 To be suc cessful, sustainable, and robust, synchronous telehealth encounters require the provider, patient, and patient presenter. Previous studies have demonstrated how the patient presenter can streamline patient presentations for specialists, but we are unaware of any studies which have compared different levels of patient presenters.14,15One of the main obstacles for telehealth is achieving the acceptance of patient originating sites.3 It is clear that close working relationships between the medical neighborhood containing specialists and the primary care home is paramount. Herein, we observed that as the dedication and presenter category increased, so did the number of telehealth visits even when control ling for population size. Dedicated telehealth presenters functioned as local and, in many instances, subregional telehealth champions providing feedback to local pro viders in morning huddles, interacting weekly with the cesses and examination skills with specialists (Table 2). The decision to hire a dedicated telehealth presenter is often the subject of concern with questions about return of investment (ROI). These are appropriate questions, but travel expenses, school days missed, work days, de creased deferral to the network, and increased medical and surgical recapture should be included in ROI assess ments, as well as work relative value units generated. As a retrospective review, we acknowledge that there are a number of limitations of this study. First, perhaps the same outcomes could be obtained with a dedicated LVN or dedicated MOS 68W medic instead of the registered nurses who were hired. The purpose of the registered exam under the training and guidance of the special ist. In fact, as part of the biannual training, category 1 be permitted with a lower skill level. Further, a regis tered nurse can conduct and document in the electronic health record any aspect of the physical exam required by the specialist.Figure 3. Mean and interquartile plot of monthly mean telehealth encounters within Army health clinics. Note: 1. Army Health Clinic Location (see Note below) BHR BSL SHP LVO VCZ GFW HHF ILS KTB VSK PCH WBD 40 90 10 0 50 20 70 60 30 80 P<.0001 P<.05 P<.05 Not Significant P<.0001 P<.0001 Mean Encounters per Month

PAGE 8

6 http://www.cs.amedd.army.mil/amedd_journal.aspxOUTCOMES OF A MILITARY REGIONAL MULTISPECIALTY SYNCHRONOUS TELEHEALTH PLATFORM AND THE IMPORTANCE OF THE DEDICATED PATIENT PRESENTER50 0 300 250 200 150 100 Jan Jan Feb Feb Mar Mar Apr Apr May May Jun Jun Jul Jul Aug Aug Sep Sep Oct Oct Nov Nov Dec Dec 2014 2015 Category of Telehealth Nurse Care Coordinator Service Category 1 Category 2 Category 3 Mean Encounters per Month Figure 4. Number of telehealth encounters supported by month based on telehealth nurse category. Figure 5. Percentage of population using telehealth monthly. Note: 1. Percentage of PopulationArmy Health Clinic Location (see note below) BHR BSL SHP LVO VCZ GFW HHF ILS KTB VSK PCH WBD0.6 1.2 0.2 0 0.4 0.8 1.0

PAGE 9

July September 2017 7 Second, the 3 AHCs with a cat egory 1 registered nurse were the initial starting locations for each specialty, thereby increas ing at least initial monthly activ ity. While overall telehealth activ ity increased in 5 category 2 and 3 locations, there were 2 locations which, when corrected for population size, were not statistically site: Shape and Brussels AHCs (Table 3). The Shape clinic spe identifying and placing a nurse in mid-2015 to be dedicated to the telehealth mission. Brussels AHC was the second smallest clinic site, resulting in a much population-based percentage calculations as noted by its wider variation of monthly encounters (Figure 5). Three category 1 presenters (authors I. B., R. S., and B. C.) were queried regarding their observations within their respective AHCs. One of the most important as pects is to ensure that there is an alternate presenter who, in case of personal illness or other reasons, is able to present patients. Regarding patients who are typically in a remote or small mili tary installation, the opportunity to travel to the regional medical center located within a larger urban shopping location is a frequently pressed the desire to visit the specialist in a typical brick and mortar location which is often the local host nation provider close to where the patient lives. Additional ancillary services such as pulmonary function testing, Woods lamp, ultrasound, and computed to mography may not be available in some AHCs, resulting in the requirement for some patients to visit the host nation university hospital or LRMC. In a recent publication, it was noted that none of the outlying AHCs in RHC-E had the capability to perform pulmonary function testing, a basic component of asthma man agement.16 cost incurred by the Soldiers unit or AHC for the patient to see a host nation provider, as the costs are covered by TRICARE. Thus, an un expected cost of increased telehealth activity is an increased likelihood of a recommenda tion that the patient travel to LRMC, thereby directly affecting the units budget. However, one published study from an LRMC specialty observed that telehealth resulted in less than one-quarter of new and follow up visits requiring an in-person visit, thereby saving costs and improving individual readiness.16 On translated medical records coupled with minimal time lost from work when using synchronous telehealth in an individuals local AHC is clearly nested in the Chief of the Armys priority of readiness.17 Table 4. Estimates of per month travel-related distances and per diem costs associated with documented encounter data.Category AHC LocationaNo. of Encounters Estimated Travel Costs Before TNCCbAfter TNCCcKilometers Traveled (roundtrip) Missed Work Days Per Diem Costs (USD)1WBD3.1 46.6 9,981.6 46.6 3,443.6VSK17.4 50.1 37,753.9 100.1 25,542.9PCH14.6 37.9 15,702.4 37.9 9,210.2Category 1 totals35.1 134.6 63,437.9 184.6 38,196.72SHP7.7 14.5 10,875.0 29.0 9,551.9VCZ6.4 14.1 22,514.3 42.2 18,292.9GFW3.19.2 7,279.3 18.4 4,814.9KTB4.6 10.4 5,613.6 20.7 4,008.1Category 2 totals21.8 48.2 46,282.2 110.3 36,667.83BHR3.31.3 102.90.6 35.5BSL0.72.5 1,750.05.0 1,603.8LVO1.81.1 2,250.05.4 1,847.7HHF2.33.1 2,309.73.1 1,564.7ILS2.72.8 1,526.62.8 1,083.8Category 3 totals10.8 10.8 7,939.2 16.9 6,135.5Categories 1, 2, 3 totals67.7 193.6 117,659.3 311.8 81,000.0Estimated cost totals, Nov 2014-Dec 2015 1,647,230.2 4,365.2 1,134,000.0AHC indicates Army health clinic; TNCC indicates telehealth nurse care coordinator. Notes: a. 1. 10 months of 2014. c. Per month for 14 months, (November 2014 through December 2015). Table 3. Population-corrected comparison between telehealth sites and monthly tele health encounters (January-December 2015). Note: Army health clinic locations and 1.VSK PCH SHP VCZ GFW KTB BHR BSL LVO HHFILS WSD 0.82VSKPCH 0.450.16SHP0.051VCZ 0.060.240.170.37 GFW0.090.890.37 KTB0.750.89BHR0.93 BSL 0.27LVO0.10 HHF 0.67 indicates P<.05; indicates P<.01; indicates P<.001

PAGE 10

8 http://www.cs.amedd.army.mil/amedd_journal.aspx Telehealth remains a top MEDCOM policy and has the ability to leverage technology to provide services and access to specialists that otherwise are limited or re quire extensive travel to reach. However, telehealth fac es numerous obstacles and challenges, both from pro viders and staff at both originating and distant sites. We observed the direct impact of the dedicated patient pre senter who, over 14 months, was the key to solving many challenges within the AHC, the regional telehealth of providers. The telehealth presenter should be considered a vital member of the synchronous telehealth encounter, and we recommend that other regional medical centers developing multispecialty synchronous telehealth plat dedicated patient presenters. RREFERENCES 1. US Army Medical Department. Army Telehealth [internet]. Available at: http://armymedicine.mil/ Pages/Virtualhealth.aspx. Accessed May 22, 2016. 2. C enter for Connected Health Policy. State Tele health Laws and Medicaid Program Policies., March 2016. Available at: http://www.cchpca. ccessed May 18, 2016. 3. T aylor J, Coates E, Brewster L, Mountain G, Wes sels B, Hawley MS. Examining the use of telehealth in community nursing: identifying the factors af fecting frontline staff acceptance and telehealth adoption. J Adv Nurs 2015;71(2):326-337. 4. cine. J Telemed Telecare 2005;11:60-70. 5. N icolini D. Stretching out and expanding work practices in time and space: the case of telemedi cine. Hum Relat 2007;60(6):889-920. 6. S ullivan DH. Technological advances in nursing care delivery. Nurs Clin North Am 2015;50:663-677. 7. Y esenofski L, Kromer S, Hitchings K. Nurses lead ing the transformation of patient care through tele health. J Nurs Adm 2015;45:650-656. 8. T aylor J, Coates L. Caring from a distance: the role of telehealth. Nurs Times 2015;111:18-20. 9. S hore JH, Mishkind MC, Bernard J, et al. A lexicon of assessment and outcome measures for telemen tal health. Telemed J E Health 2014;20:282-292. 10. Edirippulige S. Readiness of nurses for prac ticing telehealth. Stud Health Technol Inform 2010;161:49-56. 11. Tr ossman S Back to the future? Telehealth services, tele-nursing are on the rise. Am Nurse 2014;46;1-6. 12. W einstock MA, Nguyen FQ, Risica PM. Patient and referring provider satisfaction with telederma tology. J Am Acad Dermatol 2002;47:68-72. 13. H aney T, Kott K, Fowler C. Telehealth etiquette in home healthcare: the key to a successful visit. Home Healthc Now 2015;33(5):254-259. 14. B ergman DA, Sharek PJ, Ekegren K, Thyne S, Mayer M, Saunders M. The use of telemedicine access to schools to facilitate expert assessment of children with asthma. Int J Telemed Appl 2008. doi: 10.1155/2008/159276 159276. 15. B rown W, Odenthal D. The uses of telemedicine to improve asthma control. J Allergy Clin Immunol Pract 2015;3(2):300-301. 16. W aibel KH. Synchronous telehealth for outpatient allergy consultations: a 2-year regional experience. Ann Allergy Asthma Immunol 2016;116:571-575. 17. M illey MA. 39th Chief of Staff of the Army Initial Message to the Army [internet]. Avail able at https://www.army.mil/e2/rv5_down loads/leaders/csa/Initial_Message_39th_CSA.pdf. Accessed June 4, 2016. AUTHORS COL Waibel is Staff Allergist, Division of Medicine, LRMC, Landstuhl, Germany. He is also Medical Direc tor and Consultant, RHC-E Telehealth, and Allergy/Im eral of the Army. Ms Garner is the Regional Telehealth Nurse Direc tor, Landstuhl Regional Medical Center, Landstuhl, Germany. Mr Carter is the Category 1 Telehealth Nurse Care Co ordinator and Patient Presenter at the Patch Barracks Clinic, Stuttgart, Germany. Mr Bojicic is the Category 1 Telehealth Nurse Care Co ordinator and Patient Presenter at the Wiesbaden Army Health Clinic, Wiesbaden, Germany. Ms Smith is the Category 1 Telehealth Nurse Care Coor dinator and Patient Presenter at the Rose Barracks Clinic, Vilseck, Germany.OUTCOMES OF A MILITARY REGIONAL MULTISPECIALTY SYNCHRONOUS TELEHEALTH PLATFORM AND THE IMPORTANCE OF THE DEDICATED PATIENT PRESENTER

PAGE 11

July September 2017 9 with empiric initiation of antibiotics is well documented.1 Pseudomonas aeruginosa has been a particularly prob lematic bacterial infection whose antibiotic resistance is increasing at an alarming rate.2 Inappropriate empiric antibiotic coverage of Pseudomonal blood stream infec 3 This high mortality rate, in addition to prior studies showing an increased mortality rate with empiric monotherapy,4 -6 has led to empiric combination antimicrobial coverage becoming the clinical standard for suspected infection with gram-negative bacteria. Double coverage for Pseudomonas infection usually includes the addition of to an antipseudomonal beta-lactam. At our institution as well as other military and civilian medical centers, it is common to use the antipseudomonal beta lactam piperacillin-tazobactam in combinacoverage. Fluoroquinolones are commonly selected for double coverage due to the ease of dosing, decreased monitoring, and decreased toxicity (compared to aminoglycoside agents). Our institution provides an annual cumulative antimicrobial susceptibility report to estimate percentages of resistance of a particular organism to an antibiotic. Based on the William Beaumont Army Medical Center (WBAMC) 2015 antimicrobial susPseudomonas isolates were rent strategy of double coverage to be effective, (ide Pseudomonas isolates not susceptible to piperacillin-tazobactam would be susceptible to levoWe conducted a 6-month retrospective record review to determine whether there is bacterial culture data to support our initial empiric gram-negative double coverage with extended antipseudomonal beta-lactam (piperacilBased on our institutions antiobiogram, a previous Pseudomonas coverage tipseudomonal beta-lactam,7 along with our knowledge of mechanisms of resistance, led us to hypothesize that providing double coverage for empiric Pseudomonas lin-tazobactam would provide no additional coverage. M ETHODS We examined 6-months of culture and sensitivities data of Pseudomonas bacteria from urine, blood, sputum, population. Exclusion criteria for our study were cultures from patients under the age of 18; concomitant gram-positive organisms; and gram-negative organisms other than Pseudomonas, Proteus, Klebsiella and E coli Isolates from same anatomical site or person were included as separate data points, only if these isolates are phenotypically different. The terms susceptible and resistant are determined by standard Clinical and Laboratory Standards Institute (http://clsi.org/) guidelines, and criteria used by the WBAMC lab. Culture and sensitivities are reported as A Retrospective Analysis: Do Bacterial Culture and Sensitivity Data Support Empiric Use of Piperacillin-Tazobactam and Antipseudomonal Fluoroquinolones in Hospitalized Patients? C PT Pulkit Saxena, MC, USA C PT Ryan V. Burkhart, MC, USA M AJ Craig R. Ainsworth, MC, USA WBAMC Cumulative Antimicrobial Susceptibility Report: 1Jan2015-31Dec2015. Internal medical facility document not readily accesible by the general public.

PAGE 12

10 http://www.cs.amedd.army.mil/amedd_journal.aspxsusceptible, intermediate, or resistant. Susceptible 8 intermediate or resistant. Pseudomonas RESULTS $\003WRWDO\003RI\003\031\027\003LVRODWHV\003RI\003Pseudomonas Pseudomonas auerginosa Pseudomonas putida Pseudomonas COMMENT XU\003LQLWLDO\003K\)-30.3(SRWKHVLV\003TXHV\020 WLRQLQJ\003WKH\003HI\277FDF\\000RI\003HPSLULF\003 GRXEOH\003FRYHUDJH\003RI\003VXVSHFWHG\003 SVHXGRPRQDO\003LQIHFWLRQV\003ZDV\003 FRQ\277UPHG\003E\\000RXU\003\031\020PRQWK\003UHW\020 URVSHFWLYH\003UHYLHZ\021\003RQH\003RI\003WKH\003 \031\027\003LVRODWHV\003FXOWXUHG\003ZHUH\003UHVLV\020 WDQW\003WR\003SLSHUDFLOOLQ\020WD]REDFWDP\003 EXW\003VHQVLWLYH\003WR\003\300XRURTXLQR\020 ORQHV\021\003KLV\003VXJJHVWV\003WKHUH\003LV\003QR\003 DGGLWLRQDO\003FRYHUDJH\003RU\003EHQH\277W\003 FRQIHUUHG\003ZLWK\003HPSLULF\003 Pseu domonas and delirium. Pseu domonal Pseudomonas Pseudomonas tion,11 Pseudomonas resistant antibiotics, as well as on our institutions culture patient subset. DO BACTERIAL CULTURE AND SENSITIVITY DATA SUPPORT EMPIRIC USE OF PIPERACILLIN-TAZOBACTAM AND ANTIPSEUDOMONAL FLUOROQUINOLONES IN HOSPITALIZED PATIENTS? 2http://www.cs.amedd.army.mil/amedd_journal.aspx Pseudomonas RESULTS Pseudomonas Pseudomonas auerginosa Pseudomonas putida Pseudomonas COMMENT Pseudomonas Pseudomonal Pseudomonas Pseudomonas 11 Pseudomonas 12 DO BACTERIAL CULTURE AND SENSITIVITY DATA SUPPORT EMPIRIC USE OF PIPERACILLIN-TAZOBACTAM AND ANTIPSEUDOMONAL FLUOROQUINOLONES IN HOSPITALIZED PATIENTS? sensitivity.Note: Cipro is cipro o acin osyn is pipercilin ta obactam eva uin is levoo acin. % Sensitive Cipro osyn eva uin 67.2% 66.1% 90.6% 20 0 40 60 80 100

PAGE 13

July September 2017 11 REFEr R ENCES 1. Dellinger RP, Levy MM, Rhodes A, et al. Surviving sepsis campaign: international guidelines for management of severe sepsis and septic shock: 2012. Crit Care Med 2013;41(2):580-637. 2. Z ilberberg MD, Shorr AF. Prevalence of multidrugresistant Pseudomonas aeruginosa and carbapenem-resistant Enterobacteriaceae among specimens from hospitalized patients with pneumonia and bloodstream infections in the United States from 2000 to 2009. J Hosp Med 2013;8(10):559-563. 3. K ang C, Kim S, Park W, et al. Pseudomonas aeruginosa bacteremia: risk factors for mortality and bial therapy on clinical outcome. Clin Infect Dis 2003;37:745-751. 4. G arnacho-Montero J, Ortiz-Leyba C, Herrera-Me lero I, et al. Mortality and morbidity attributable to inadequate empirical antimicrobial therapy in patients admitted to the ICU with sepsis: a matched cohort study. J Antimicrob Chemother 2008;61(2):436-441. 5. K umar A, Ellis P, Arabi Y, et al. Initiation of inapreduction of survival in human septic shock. Chest 2009;136(5):1237-1248. 6. L ueangarun S, Leelarasamee A. Impact of inappropriate empiric antimicrobial therapy on mortality of septic patients with bacteremia: a retrospective study. Interdiscip Perspect Infect Dis 2012:756205. Available at: http://www.ncbi.nlm.nih.gov/pmc/ar ticles/PMC3419419/. Accessed September 15, 2016. 7. M izuta M, Linkin DR, Nachamkin I, et al. Idencal dual antimicrobial therapy of Pseudomonas ae-ruginosa infection: potential role of a combina tion antibiogram. Infect Control Hosp Epidemiol 2006;27:413-415. 8. Jorgensen JH, Ferraro MJ. Antimicrobial susceptibility testing: a review of general princi ples and contemporary practices. Clin Infect Dis 2009;49(11):1749-1755. Available at: http://cid.ox fordjournals.org/content/49/11/1749. Accessed September 15, 2016. 9. L ipsky BA, Baker CA. Fluoroquinolone toxicity Clin Infect Dis 1999;28(2):352-364. Available at: http:// cid.oxfordjournals.org/content/28/2/352. Accessed September 15, 2016. 10. B alasubramanian D, Schneper L, Merighi M, et al. 2012. The Regulatory Repertoire of Pseudomonas aeruginosa AmpC Beta-Lactamase Regulator AmpR Includes Virulence Genes. PLoS One 7(3):e34067. Available at: http://journals.plos.org/ plosone/article?id=10.1371/journal.pone.0034067. Accessed September 15, 2016. 11. C linical and Laboratory Standards Institute (CLSI). M39-A2: Analysis and Presentation of Cumulative Antimicrobial Susceptibility Test Data 2nd ed. Wayne, PA: CLSI; 2006. 12. H ildreth CJ, Burke AE, Glass RM. Inappropri ate Use of Antibiotics. JAMA. 2009;302(7):816. Available at: http://jama.jamanetwork.com/article. aspx?articleid=184426. Accessed September 15, 2016.A UTHOr R S CPT Saxena is an Internal Medicine Resident PostGraduate Year 3 at William Beaumont Army Medical Center, El Paso, Texas. CPT Burkhart is a First Year Cardiology Fellow at the San Antonio Military Medical Center, San Antonio, Texas. MAJ Ainsworth is the Medical Director, Burn Inten sive Care Unit, US Army Institute of Surgical Research, Joint Base San Antonio-Fort Sam Houston, Texas.

PAGE 14

12 http://www.cs.amedd.army.mil/amedd_journal.aspxColonization and infection with multidrug-resistant (ESBL)-producing Enterobacteriaceae, are a global health problem and frequently complicate the care of wounded military personnel.1-6 Examination of surveil lance cultures collected from wounded military person nel on admission to Landstuhl Regional Medical Cen ter (LRMC) in Germany and military hospitals in the United States recovered 2,065 colonizing isolates. The predominant organisms were Escherichia coli and Kleb siella pneumoniae 7Recently, the emergence of carbapenem-resistant En terobacteriaceae (CRE) has become an additional threat tality rates, and potential for wide transmission.8-17 In an analysis of healthcare-associated infections in the E coli Enterobac ter spp, and K pneumoniae associated with surgical site infections were resistant to carbapenems, respectively.8 The rising prevalence of CREs has further complicated patient care in the military health system. Surveillance of Department of Defense (DoD)-managed medical fa cilities within the United States and overseas reported a mean annual CRE incident rate of 0.49 per 100,000 patient-years. It was noted that the proportion of CRE a steady rise in the proportion of carbapenem-resistant Klebsiella spp between 2005 and 2010.9 Furthermore, E coli K pneumonia e isolates recovered from US military personnel and Af ghan nationals treated at a deployed US military hospi tal in Afghanistan were carbapenem-resistant.18As more combat casualties are surviving grievous injuries, the rate of trauma-related infections has increased.19 With complicated, polymicrobial wounds, the prevalence of multidrug-resistant organisms provides a challenge to clinicians treating wounded warriors. As carbapenems Low Prevalence of Carbapenem-Resistant Enterobacteriaceae Among Wounded Military Personnel K atrin Mende, PhD F atma Onmus-Leone, MS M iriam L. Beckius, MPH C OL Clinton K. Murray, MC, USA W endy C. Zera, BS D avid R. Tribble, MD, DrPH ABSTRa A CT Multidrug-resistant organisms (MDROs) are a global health problem that affect both civilian and military pop ulations. Among wounded warriors, MDROs further complicate the care of trauma-related infections, resulting in extended duration of hospitalization, as well as increased morbidity and mortality. During the wars in Iraq resented a serious challenge for clinicians. We examined carbapenem-resistant Enterobacteriaceae prevalence among wounded military personnel over a 6-year period (2009-2015). Among 4090 Enterobacteriaceae isolates Enterobacter aerogenes followed by Klebsiella pneumoniae Escherichia coli patients were carbapenemase-producers with one associated with an infection. All 5 carbapenemase-producing isolates were resistant to all tested carbapenems and each carried one carbapenemase gene (4 with blaKPC-3 and 1 with blaNDM-1). Overall, although a large number of Enterobacteriaceae isolates were collected, only a small proportion was carbapenem-resistant and data indicate a lack of a cluster. Due to these limited numbers, posure, and clinical outcomes. DDISCLa A Im M ER : University of the Health Sciences, Henry M. Jackson Foundation for the Advancement of Military Medicine, the National Institutes of Health or the Department of Health and Human Services, Walter Reed Army Institute of Research, Brooke Army Medical Center, the Navy or Air Force. Mention of trade names, commercial products, or organization does not imply endorsement by the US Government.

PAGE 15

July September 2017 13are often used to treat gram-negative infections resistant to broad-spectrum antibiotics, the emergence of CREs is a cause for concern. As a result, we determined the prevalence of CREs among wounded military personnel and evaluated carbapenem resistance mechanisms. METHODS As part of the US DoD-De partment of Veterans Affairs, Trauma Infectious Disease Outcomes Study (TIDOS),19 isolates were collected from military personnel injured dur ing deployment and medically evacuated to LRMC before be ing transferred to a participating military hospital in the United States (the Walter Reed Nation al Military Medical Center* or San Antonio Military Medical Center). All collected isolates were stored in a microbiologi cal repository. Our analysis was restricted to Enterobacteriaceae isolates collected between June 1, 2009, and April 31, 2015. Iso if they were recovered from in fection work-ups. Surveillance specimens were obtained from groin/axilla swabs performed within 2 days of hospital admis sion either at LRMC or the par ticipating military hospitals in the United States. Multi 4 antibiotic classes, ESBL production, or carbapenemase production.20 For the purpose of our study, carbapenem tested (ie, meropenem, imipenem, doripenem, and er tapenem). Information related to infections, treatment, and outcomes was retrieved from the TIDOS infectious disease module,19 which supplements the Department of Defense Trauma Registry.21Isolate identities and antimicrobial susceptibilities were determined utilizing the BD Phoenix automated micro biology system and NMIC/ID-304 panels (BD Biosci ences, Sparks, MD). As the BD Phoenix system does not report susceptibility results for certain bacteria/antibi otic combinations, E-test was also performed for all car bapenems.22 conducted for genotyping in accordance with standard practices. Three multiplex PCRs for the detection of car bapenemase genes were performed using previously de scribed primers (Table 1).23 The PCRs were carried out with the following conditions: 5 minutes at 94C, 30 cycles of 30 seconds at 94C, 40 seconds at 56C, and 50 seconds at 72C, followed by 5 minutes at 72C. The Neo-Rapid CARB Kit (Rosco Diagnostica, Taastrup, Denmark) was used to identify carbapenemase-producing isolates, which were sent to the Multidrug-Resistant Or ganism Repository and Sur veillance Network (MRSN) for whole genome sequencing using the Illumina MiSeq plat form. Paired-end sequencing of short (550 bp) and mate-paired sequencing of long (2-10 kilo base [kb]) genomic fragments ished bacterial genomes. The genes encoding carbapenem with other antibiotic resistance genes by BLASTN analysis using comprehensive web-based microbial annotation resources and pipelines developed internally by MRSN. RESULTS A total of 4090 Enterobacteriaceae isolates were collect ed from June 2009 through April 2015 (Table 2). Exami nation of antimicrobial susceptibility determined that 1391 isolates (34%) were multidrug-resistant and 1302 E coli was the most common (51%), followed by K pneumoniae (13%) and Enterobacter cloacae (12%). A total of 141 isolates (3.4% of 4090) were resistant to at least one carabapenem; however, only 16 isolates (0.4% of 4090) were resistant to all tested carbapenems (100% resistant to doripenem, ertapenem, imipenem, and meropenem) with 50% associated with infections (Table 2). Enterobacter aerogenes (44%) was predomi nant, followed by K pneumoniae (37%) and E coli (19%). All carbapenem-resistant isolates were ESBL-producers. Twelve isolates (75%) were susceptible to amikacin, 9 THE ARMY MEDICAL DEPARTMENT JOURNAL *Prior to their consolidation to become the Walter Reed National Medical Center in September 2011, both the Walter Reed Army Medical Center and the National Naval Medical Center received patients from LRMC. The Brooke Army Medical Center became part of the newly es tablished San Antonio Military Medical Center in September 2011. Table 1tion of Carbapenemase Genes.Gene Primer Sequence (5-3) Product Size (base pair)blaIMPF: GGAATAGAGTGGCTTAAYTCTC R: GGTTTAAYAAAACAACCACC 232blaSPMF: AAAATCTGGGTACGCAAACG R: ACATTATCCGCTGGAACAGG 271 blaAIM F: CTGAAGGTGTACGGAAACAC R: GTTCGGCCACCTCGAATTG 322 blaVIM F: GATGGTGTTTGGTCGCATA R: CGAATGCGCAGCACCAG 390 blaOXA F: GCGTGGTTAAGGATGAACAC R: CATCAAGTTCAACCCAACCG 438 blaGIM F: TCGACACACCTTGGTCTGAA R: AACTTCCAACTTTGCCATGC 477 blaBIC F: TATGCAGCTCCTTTAAGGGC R: TCATTGGCGGTGCCGTACAC 537 blaSIM F: TACAAGGGATTCGGCATCG R: TAATGGCCTGTTCCCATGTG 570blaNDMF: GGTTTGGCGATCTGGTTTTC R: CGGAATGGCTCATCACGATC 621blaDIMF: GCTTGTCTTCGCTTGCTAACG R: CGTTCGGCTGGATTGATTTG 699blaKPCF: CGTCTAGTTCTGCTGTCTTG R: CTTGTCATCCTTGTTAGGCG 798

PAGE 16

14 http://www.cs.amedd.army.mil/amedd_journal.aspx E aerogenes iso cin. The 16 isolates were recovered from 7 deployed military personnel, of which 6 were wounded in Afghanistan and one was injured in Naples, Italy. Except for one isolate obtained from LRMC, the carbapenem-resistant isolates were col lected from surveillance swabs or clini cal cultures obtained at military hospi portion of the 16 isolates varied annually, Examination of PFGE results showed that all patients carried different strains of the Enterobacteriaceae organisms, indicating a lack of a cluster. Furthermore, no patients carried two or more differ ent strains within the same genus. When serial isolates collected from patients were assessed, there were no genotypic changes. Five K pneumoniae isolates were car bapenemase-producers, of which 4 were from surveillance cultures (3 from groin and one rec tum) and one was associated with a pneumonia (col lected from bronchoalveolar lavage). In addition, 4 were serial isolates from one patient collected at 2 separate facilities, including the infecting isolate recovered at Walter Reed National Military Medical Center 3 days One patient sustained a gunshot wound in the Afghani stan combat theater and the other was injured in a fall while stationed in Naples, Italy. The 5 carbapenemaseproducing K pneumoniae isolates were sent to MRSN for further testing and carbapenemase genes were iden blaNDM gene, while the remaining 4 isolates from a single patient carried a blaKPC gene. Whole genome sequencing of the 5 carbapenemase-pro ducing K pneumoniae isolates revealed that the 4 serial isolates (from the same patient) were genetically identical and represented a single clone (collected in 2012). and carried the carbapenemase gene blaKPC-3 on an homology to the previously described plasmid pKpQILLS6.24 The single isolate from another patient belonged to MLST ST-11 (collected in 2014) and carried the car bapenemase gene blaNDM-1 on an approximately 73.5 plasmid pS-300cz (Genbank Accession # KJ958927). Two surveillance isolates amongst the serial carbapene mase-producing K pneumoniae isolates from one patient were collected prior to treatment with meropenem, sug gesting that the strain already carried the resistance gene and that meropenem exposure did not induce carbapenem resistance. For this patient, a carbapenem-susceptible K pneumoniae Staphylococcus aureus and Acinetobacter baumannii-calcoaceticus complex isolates were associ ated with the same pneumonia along with the carbapen emase-producing K pneumoniae Treating this patient with ampicillin-sulbactam, meropenem, and vancomy cin cleared the infection during inpatient hospitalization. CCOmm MM ENT Carbapenem-resistant Enterobacteriaceae are becoming more widespread in healthcare facilities in the United Table 2. Most Common Enterobacteriaceae Collected from Wounded Military Personnel (2009-2014) with a Focus on Carbapenem Resistance.OrganismsaSurveillance (%)Infecting (%)Total (%) Escherichia coli1608 (57.7) 495 (38.0) 2103 (51.4)Resistant to carbapenem12 (0.7) 9 (1.8)21 (1.0)Carbapenem-resistant E colib0 3 (0.6)3 (0.1)Klebsiella pneumoniae391 (14.0)150 (11.5) 541 (13.2)Resistant to carbapenem15 (3.8) 7 (4.7)22 (4.1)Carbapenem-resistant K pneumoniaeb5 (1.3) 1 (0.7) 6 (1.1)Enterobacter cloacae227 (8.1) 284 (21.8) 511 (12.5)Resistant to carbapenem6 (2.6) 6 (2.1) 12 (2.3)Carbapenem-resistant E cloacaeb0 0 0Enterobacter aerogenes232 (8.3) 125 (9.6) 357 (8.7)Resistant to carbapenem17 (7.3) 20 (16.0)37 (10.4)Carbapenem-resistant E aerogenesb3 (1.3) 4 (3.2) 7 (2.0)Serratia marcescens76 (2.7) 120 (9.2) 196 (4.8)Resistant to carbapenem3 (3.9) 14 (11.7) 17 (8.7)Carbapenem-resistant S marcescensb0 0 0Total Enterobacteriaceaec2788 1302 4090Total Enterobacteriaceae resistant to carbapenem70 (2.5) 71 (5.5) 141 (3.4)Total Carbapenem-Resistant Enterobacteriaceaeb8 (0.3)8 (0.6)16 (0.4)Notes: a. The percentage of carbapenem-resistant isolates for each organism is calculated using the totals for that specific organism. b. Carbapenem-resistant Enterobacteriaceae are defined as being resistant to all tested carbapenems (ie, meropenem, imipenem, doripenem, and ertapenem). c. Only the top 5 organisms are presented so the total for the overall Enterobacteriaceae is greater than the sum of the columns. LOW PREVALENCE OF CARBAPENEM-RESISTANT ENTEROBACTERIACEAE AMONG WOUNDED MILITARY PERSONNEL

PAGE 17

July September 2017 15 States and have been associated with high rates of mor tality.8-11,25,26 While the rate of carbapenem resistance is still low, the rising prevalence is concerning. As a result, we examined isolates for carbapenem resistance col lected from military personnel wounded during deploy ment in support of operations in Iraq and Afghanistan. Although a large number of Enterobacteriaceae isolates were collected from combat casualties over a study pe bapenem-resistant. The distribution of isolates across lack of a carbapenem-resistant Enterobacteriaceae clus ter with this wounded military population. Prior to 2000, recovery of CREs was rare in the United States; however, within the past decade, an increase in according to the National Healthcare Safety Network, the proportion of CREs in US acute care hospitals rose Klebsiella spp tively).25 Localized hospital outbreaks have also been reported in multiple states, including New York, Colo rado, Illinois, and West Virginia.26-31 It is notable that US hospitals, and may be the result of environmental factors or the approach to infection control. Nonetheless, the proportion of CREs in our analysis is higher than previous surveillance reports from DoDorganisms, the proportion of carbapenem-resistant E coli K pneumoniae and Enterobacter spp ( E aerogenes and E cloacae tively) is also higher compared to the prior surveillance 9Following recognition of increased carbapenem resis tance due to widespread transmission of the blaNDM-1 gene, a military health system surveillance program was implemented in 2010, resulting in the screening by MRSN of all carbapenem-resistant isolates for the gene. Approximately 13 hospitals, including 5 in combat Providencia stuartii isolates recovered from an Afghan national burn patient treated at a US/coalition combat support hospital in Bagram, Afghanistan.32,33 A low number of carbapenem-resistant K pneumoniae iso Iraq; however, none were found to carry the blaNDM-1 or blaKPC-3 genes.34 CRE isolates) carbapenemase-producing K pneumoniae mase-producing isolates were recovered from 2 patients and one isolate was associated with an infection (ie, pneumonia). All 5 isolates were resistant to all tested carbapenems and each isolate carried one carbapenemase gene, indicating that carbapenem resistance was 4 isolates carried blaKPC-3 while blaNDM-1 was only carrying blaKPC-3 sustained injuries in Naples, Italy, and was treated initially at a Naples hospital. As a carbapenem-resistant ST258 K pneumoniae strain car rying blaKPC-3 has been previously reported in Italy,24 there is the potential that the carbapenemase-producing K pneumoniae isolates were acquired through hospital transmission by the injured service member. To the best K pneumoni ae isolates carrying blaNDM-1 recovered from military personnel wounded in Afghanistan. Due to the low numbers of CREs in our study, it is dif resistance, antibiotic exposure, and clinical outcomes. transmission patterns of CREs in this patient popula tion. Nevertheless, as CREs are becoming widespread in both civilian and military health systems, surveil lance should continue. ACKNOWLEDGm M ENTS We are indebted to the Infectious Disease Clinical Re search Program Trauma Infectious Disease Outcomes Study team of clinical coordinators, microbiology tech nicians, data managers, clinical site managers, and ad ministrative support personnel for their tireless hours to ensure the success of this project. Support for this work (IDCRP-024) was provided by the Infectious Disease Clinical Research Program, a DoD program executed through the Uniformed Services Uni versity of the Health Sciences, Department of Preven tive Medicine and Biostatistics. This project has been funded by the Global Emerging Infections Surveillance and Response System, a Division of the Armed Forces Health Surveillance Center and the National Institute of Allergy and Infectious Diseases, National Institutes of Health, under Inter-Agency Agreement Y1-AI-5072, and the Department of the Navy under the Wounded, Ill, and Injured Program. The sponsor of this study had no role in the study de sign, data analysis and/or interpretation, or writing the manuscript. The corresponding author had full access to submit for publication.

PAGE 18

16 http://www.cs.amedd.army.mil/amedd_journal.aspx RREFERENCES 1. Hospenthal DR, Crouch HK, English JF, et al. Mul tidrug-resistant bacterial colonization of combatinjured personnel at admission to medical centers after evacuation from Afghanistan and Iraq. J Trauma 2011;71(suppl 1):S52-S57. 2. M ende K, Beckius ML, Zera WC, et al. Phenotypic and genotypic changes over time and across facili ties of serial colonizing and infecting Escherichia coli isolates recovered from injured service mem bers. J Clin Microbiol 2014;52:3869-3877. 3. M urray CK, Roop SA, Hospenthal DR, Dooley DP, Wenner K, Hammock J, Taufen N, Gourdine E. Bacteriology of war wounds at the time of injury. Mil Med 2006;171:826-829. 4. H ospenthal DR, Crouch HK, English JF, et al. Response to infection control challenges in the deployed setting: Operations Iraqi and Enduring Freedom. J Trauma 2010;69(suppl 1):S94-S101. 5. K een EF III, Murray CK, Robinson BJ, Hospen thal DR, Co EM, Aldous WK. Changes in the in cidences of multidrug-resistant and extensively drug-resistant organisms isolated in a military medical center. Infect Control Hosp Epidemiol 2010;31:728-732. 6. S cott P, Deye G, Srinivasan A, et al. An outbreak of multidrug-resistant Acinetobacter baumanniicalcoaceticus complex infection in the US military health care system associated with military opera tions in Iraq. Clin Infect Dis 2007;44:1577-1584. 7. W eintrob AC, Murray CK, Lloyd BA, et al. Active surveillance for asymptomatic colonization with multidrug-resistant gram negative bacilli among injured service members a three year evaluation. MSMR 2013;20:17-22. 8. S ievert DM, Ricks P, Edwards JR, et al. Antimicro bial-resistant pathogens associated with healthcareassociated infections: summary of data reported to the National Healthcare Safety Network at the Cen ters for Disease Control and Prevention, 2009-2010. Infect Control Hosp Epidemiol 2013;34:1-14. 9. L esho EP, Clifford RJ, Chukwuma U, et al. Car bapenem-resistant Enterobacteriaceae and the cor usage and resistance in the US military health sys tem. Diagn Microbiol Infect Dis 2015;81:119-125. 10. F alagas ME, Lourida P, Poulikakos P, Rafailidis PI, Tansarli GS. Antibiotic treatment of infections due to carbapenem-resistant Enterobacteriaceae: sys tematic evaluation of the available evidence. Anti microb Agents Chemother 2014;58:654-663. 11. F alagas ME, Tansarli GS, Karageorgopoulos DE, Vardakas KZ. Deaths attributable to carbapenemresistant Enterobacteriaceae infections. Emerg In fect Dis 2014;20:1170-1175. 12. D oi Y, Paterson DL. Carbapenemase-producing Enterobacteriaceae. Semin Respir Crit Care Med 2015;36:74-84. 13. L azarovitch T, Amity K, Coyle JR, et al. The com plex epidemiology of carbapenem-resistant Entero bacter infections: a multicenter descriptive analysis. Infect Control Hosp Epidemiol 2015;36:1283-1291. 14. K im SR, Rim CB, Kim Y, et al. Four cases of car bapenem-resistant Enterobacteriaceae infection from January to March in 2014. Korean J Fam Med 2015;36:191-194. 15. G uh AY, Bulens SN, Mu Y, et al. Epidemiol ogy of carbapenem-resistant Enterobacteria ceae in 7 US communities, 2012-2013. JAMA 2015;314:1479-1487. 16. M ayer CL, Haley VB, Giardina R, Hazamy PA, Tsivitis M, Knab R, Lutterloh E. Lessons learned from initial reporting of carbapenem-resistant En terobacteriaceae in New York State hospitals, 20132014. Am J Infect Control 2016;44:131-133. 17. D eutsch RF, Ross JW, Nailor MD. Carbapen em-resistant Enterobacteriaceae: a case series of infections at Hartford Hospital. Conn Med. 2015;79:269-275. 18. S utter DE, Bradshaw LU, Simkins LH, et al. High incidence of multidrug-resistant gram-negative bacteria recovered from Afghan patients at a de ployed US military hospital. Infect Control Hosp Epidemiol 2011;32:854-860. 19. T ribble DR, Conger NG, Fraser S, et al. Infection-as sociated clinical outcomes in hospitalized medical evacuees after traumatic injury: trauma infectious disease outcome study. J Trauma 2011;71:S33-S42. 20. C enters for Disease Control and Prevention. The National Healthcare Safety Network (NHSN) Manual Patient safety component. Protocol mul infection (MDRO/CDI) module. 2016. Available at: https://www.cdc.gov/nhsn/pdfs/pscmanual/pcs manual_current.pdf. 21. E astridge BJ, Jenkins D, Flaherty S, Schiller H, Holcomb JB. Trauma system development in a the ater of war: experiences from Operation Iraqi Free dom and Operation Enduring Freedom. J Trauma 2006;61:1366-1372. 22. C linical and Laboratory Standards Institute. Analy sis and Presentation of Cumulative Antimicrobial Susceptibility Test Data; Approved Guideline Third Edition 2009. CLSI document M39-A3. Wayne, PA. Available at: http://clsi.org/. 23. P oirel L, Walsh TR, Cuvillier V, Nordmann P. Mul tiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis 2011;70:119-123.LOW PREVALENCE OF CARBAPENEM-RESISTANT ENTEROBACTERIACEAE AMONG WOUNDED MILITARY PERSONNEL

PAGE 19

July September 2017 17 24. Villa L, Capone A, Fortini D, et al. Reversion to susceptibility of a carbapenem-resistant clinical isolate of Klebsiella pneumoniae producing KPC-3. J Antimicrob Chemother 2013;68:2482-2486 25. C enters for Disease Control and Prevention. Vital signs: carbapenem-resistant Enterobacteriaceae. MMWR Morb Mortal Wkly Rep 2013;62(9):165-170. 26. G upta N, Limbago BM, Patel JB, Kallen AJ. Car bapenem-resistant Enterobacteriaceae epidemiol ogy and prevention. Clin Infect Dis 2011;53:60-67. 27. F rias M, Tsai V, Moulton-Meissner H, Avillan J, Hunter J, Arwady MA, Epstein L. Notes from the Escherichia coli associated with endoscopic ret rograde cholangiopancreatography-Illinois, 2013. MMWR Morb Mortal Wkly Rep 2014;62:1051. 28. nem-resistant Klebsiella pneumoniae associated with a long-term--care facilitiy---West Virgin ia, 2009--2011. MMWR Morb Mortal Wkly Rep 2011;60:1418-1420. 29. P isney L, Barron M, Jackson S, et al. Notes from tant Klebsiella pneumoniae producing New Delhi metallo-beta-lactamase-Denver, Colorado, 2012. MMWR Morb Mortal Wkly Rep 2013;62:108. 30. E pstein L, Hunter JC, Arwady MA, et al. New Del hi metallo-beta-lactamase-producing carbapenemresistant Escherichia coli associated with exposre to duodenoscopes. JAMA 2014;312:1447-1455. 31. B ratu S, Landman D, Haag R, Recco R, Eramo A, Alam M, Quale J Rapid spread of carbapenem-re sistant Klebsiella pneumoniae in New York City: A new threat to our antibiotic armamentarium. Arch Intern Med. 2005;165:1430-1435. 32. S torey SA, McGann PT, Lesho EP, Waterman PE. bapenem resistance in a clinical isolate of Provi dencia stuartii in a US/coalition medical facility ---Afghanistan, 2011. MMWR Morb Mortal Wkly Rep 2011;60(22):756. 33. M cGann P, Hang J, Clifford RJ, et al. Complete sequence of a novel 178-kilobase plasmid carrying blaNDM-1 in a Providencia stuartii strain isolat ed in Afghanistan. Antimicrob Agents Chemother 2012;56:1673-1679. 34. A l Sehlawi ZS, Almohana AM, AlThabab AA. Oc currence and detection of carbapenemase-produc ing Klebsiella pneumoniae clinical isolates in Najaf hospitals. Al-Kufa J Biol 2013;5:e321. AUTHORS This report was prepared by the listed authors on behalf of the Infectious Disease Clinical Research Program Trauma Infectious Disease Outcomes Study Group: Dr Mende is the Director of the Molecular Biology Laboratory for the Infectious Disease Clinical Research Program, Department of Preventive Medicine and Bio statistics, Uniformed Services University of the Health Sciences (Bethesda, Maryland), at the San Antonio Military Medical Center, Joint Base San Antonio-Fort Sam Houston, Texas. Dr Mende is also employed by the Henry M. Jackson Foundation for the Advancement of Military Medicine, Inc, Bethesda, Maryland. Ms Beckius is with the Molecular Biology Laboratory at the San Antonio Military Medical Center, Joint Base San Antonio-Fort Sam Houston, Texas. Ms Zera is with Molecular Biology Laboratory for the In fectious Disease Clinical Research Program, Department of Preventive Medicine and Biostatistics, Uniformed Services University of the Health Sciences (Bethesda, Maryland), at the San Antonio Military Medical Center, Joint Base San Antonio-Fort Sam Houston, Texas. Ms Zera is also employed by the Henry M. Jackson Foun dation for the Advancement of Military Medicine, Inc, Bethesda, Maryland. Ms Onmus-Leone is a research microbiologist at the Multidrug-resistant Organism Repository and Surveil lance Network, Walter Reed Army Institute of Research, Silver Spring, Maryland. COL Murray is Deputy Chief of the US Army Medical Readiness Center of Excellence, Joint Base San AntonioFort Sam Houston, Texas. Dr Tribble is a Professor in the Department of Preven tive Medicine and Biostatistics, Uniformed Services University of the Health Sciences, and the Science Direc tor of the Infectious Disease Clinical Research Program, Uniformed Services University of the Health Sciences, Bethesda, Maryland.

PAGE 20

18 http://www.cs.amedd.army.mil/amedd_journal.aspxPsychiatric complaints are the fastest growing condition evaluated in emergency departments (ED) in the United 1 In 2012, the Carl R. Darnall Army Medical Center Emergency Department (Fort Hood, Texas) saw 3,686 patients with a mental health concern as a chief complaint, making year. When the American military entered combat operations in Afghanistan and Iraq over 14 years ago, military medical departments and the American government were woefully unprepared to handle the psychological strains that would be placed on some 2.2 million troops (and their families) who were deployed over the years. A 2008 report by the RAND Corporation estimated that bat operations with mental health issues.2 Along with the active duty service member, family members are seeking care for their own mental health issues in record numbers. In a 2002 study, Calhoun et al3 determined that partners of Veterans diagnosed with posttraumatic Effects of Mandatory Screening Labs in Directing the Disposition of the Apparently Healthy Psychiatric Patient in the Emergency Department M AJ Karyn E. Kagel, SP, USA C PT Meghan Smith, MC, USA C PT Ilya V. Latyshenko, MC, USA M AJ Christopher Mitchell, MC, USA L TC Andrew Kagel, MC, USA ABSTRa A CT Objective: To determine whether mandatory psychiatric admission laboratory tests yield results that change the disposition of a patient with primary psychiatric complaint from admission to a psychiatric service to admis sion to a medical service. Methods: This was a single center retrospective cohort chart review study approved by the facility Institutional Review Board in which we used a records database maintained by the emergency departments social workers to access the records of every patient that presented to our emergency department with a psychiatric chief com plaint between the dates of December 1, 2011, and December 1, 2013. We focused on those that were admitted to either a psychiatric service or a medical service after a thorough evaluation by the department of social work and an emergency provider. We applied our inclusion and exclusion criteria and reviewed the results of the mandatory psychiatric labora tory tests (complete blood count, comprehensive metabolic panel, thyroid stimulating hormone, acetaminophen, aspirin, blood alcohol level, urinalysis, urine pregnancy test, urine drug screen) required for admission. Our independent variables were the compulsory psychiatric admission laboratory tests and our dependent variable was the admission to a medical service. Results: Of 5,606 laboratory tests that were ordered and produced results for the 682 patients enrolled in our psychiatric service admission, by the 2 reviewing emergency physicians. Only one of 682 psychiatric patients without any medical complaints but a chief complaint of suicidal ideation, and was found to have diabetic ketoacidosis. Based on our data, the probability that an abnormal laboratory test will result in a change in dis Conclusion: Patients presenting to the emergency department with a psychiatric chief complaint and no physi abnormal laboratory study will change their disposition from a psychiatric admission to a medical admission.

PAGE 21

July September 2017 19 stress disorder (PTSD) experience more caregiver bur den and have poorer psychological adjustment than part ners of Veterans without PTSD. According to the Vet erans Administration, partners of Veterans with PTSD reported lower levels of happiness and less satisfaction in their lives with about half reporting having felt on the verge of a nervous breakdown.4 The psychological stress and ongoing struggle for adequate treatment for these service members and their families have led to a strain on the mental health care system at many of our military bases. Several recently published reports attest that service members interested in accessing mental health care often face long wait lists.5 Although these wait times can vary considerably from one behavioral health clinic to another; the Department of Defense Mental Health Task Force noted that delays of 30 days for an initial mental health appointment are not uncom mon. This gap in care leads many service members and their families to seek help for their mental health con cerns at local EDs. For adult psychiatric cases that present to the ED and are otherwise medically stable, mandatory screening labs add unnecessary costs, use limited resources, and ex tend emergency department stays without changing the are required for psychiatric admission are often based on expert opinion and medical screening performed by psychiatrists, who are not trained to evaluate emergency patients for medical conditions, rather than emergency providers.6 In a retrospective study of 212 patients, Korn et al7 concluded that patients with a psychiatric chief safely referred to psychiatric services without the use of ancillary testing in the ED. In a similar study, Amin and Wang found that patients presenting to the ED with psy chiatric chief complaints and benign histories and physi 1We conducted this study to determine if mandatory psychiatric admission laboratory tests yield results that change the disposition of a psychiatric patient from ad mission to a psychiatric service to admission to a medi cal service if that patient has presented with no medi following examination by a trained emergency provider. We believe that if these mandatory laboratory results do not change the patients admitting service, the use of laboratory testing for psychiatric patients should be performed only at the discretion of the evaluating emergency medicine provider, thus increasing patient throughput in the department, reducing risks to patients and staff, and decreasing costs in the healthcare system. METHODS Study DesignWe conducted a single center retrospective cohort chart review study.SettingThis study was conducted at a Level III trauma center supporting more than 42,000 military personnel and more than 145,000 family members, retirees, and civilian emergencies. In 2012, the ED evaluated 77,403 patients, with 3,686 (4.8%) of those patients being psychiatric pa tients. The department has a full time staff of 8 licensed social workers that evaluate all psychiatric complaints and assist the emergency clinicians with the assessment and placement of these patients. The medical center has a 15-bed inpatient psychiatric ward and a 5 bed ICU, as well as the ability to admit psychiatric patients to 3 offsite inpatient psychiatric treatment facilities.Selection of ParticipantsWe conducted this study using a database maintained by the medical center Department of Social Work of all emergent psychiatric patient evaluations and their dispo sitions. The database records a patients name, age, mili tary unit, chief complaint, and disposition. Using SPSS software (IBM Inc, Armonk, NY) and the general rule for multivariate analysis, we powered our study for 30 subjects enrolled per independent variable. With 9 inde pendent variables, we determined that we would have to enroll at least 270 patients to adequately power our study. We performed a post hoc analysis to ensure adequate power. We trained an emergency medicine second-year criteria to all patients in the database. In addition to her training, our research resident was blinded to our hy pothesis and was not involved in the development of our study to avoid data collection bias. We instructed her to pull paper medical records if electronic medical records were not complete and informed her that we would per form quality checks on her data collection and recording. She spent 3 months enrolling study participants that met criteria. She began by narrowing our search to all pa tients aged 18-65 years who presented with a psychiatric chief complaint at the ED and were admitted to a psychi atric or medical service from the ED during the period December 1, 2011 through December 1, 2013. From this patient group, she reviewed each medical chart for any physical complaints, vital sign abnormalities, or abnor nurse or emergency department provider. Patients who were not strictly psychiatric patients were eliminated. After eliminating all patients with concurrent medical complaints or physical exam or vital sign abnormali ties, 682 patients remained enrolled in the study. After

PAGE 22

20 http://www.cs.amedd.army.mil/amedd_journal.aspxdata was collected, the primary investigator randomly reviewed 3 patient charts from each month to ensure our data collector had enrolled appropriate patients and collected accurate data.Outcome MeasuresOur primary outcome measure was the percentage of dispositions that changed from psychiatric ad mission to medical admission as a result of clinically tory screening laboratory tests. To determine the percentage, we divided the total number of patients who underwent each mandatory laboratory test by the total number of patients whose disposition was changed to a medical admission based on an abnor mality in each laboratory test. We also tabulated the require treatment per our hospital protocols, prior to disposition, but did not change the disposition of the patient. Our hypothesis was that the mandatory psychiatric admission laboratory tests do not yield re sults that change the disposition of a psychiatric patient from admission to a psychiatric service to admission to a medical service.Method of Measurement and Data Collection exclusion criteria, the data research resident removed laboratory results for each patient into an Excel spread sheet. Normal laboratory results were recorded as nor mal, and abnormal laboratory results were recorded as the actual laboratory value. If the research resident en countered missing electronic medical records, the paper hardcopy was pulled for review. Using this method, we had no incomplete charts or missing data points. The results of the mandatory psychiatric screening labora tory tests for the 682 study participants (complete blood count (CBC), comprehensive metabolic panel (CMP), thyroid stimulating hormone (TSH), acetaminophen (APAP), aspirin (ASA), blood alcohol level (BAL), urinal ysis (UA), urine pregnancy test (UHCG), urine drug screen (UDS)) were reviewed separately by 2 independent board certi to require treatment in the department ac cording to the hospital psychiatric admis sion protocols. The reviewing physicians were blinded to any change in disposition that resulted from the laboratory tests and were not involved in the development or execution of this study in any way. This study was conducted under a protocol re viewed and approved by the Institutional Review Board and in accordance with the approved protocol. R ESES UL TSTS Six hundred eighty-two subjects met our criteria and were enrolled in the study. All of the patients presented with a chief psychiatric complaint (ie, life stress, sui cidal ideation, homicidal ideation, depression, anxiety), denied concurrent physical ailments, and had normal vi tal signs and nursing and provider assessments. Descrip tive statistics of the subjects are presented in Figures 1 and 2. Of 5,606 laboratory tests ordered and results received for these patients (682 UA, CMP, BAL, TSH, ASA, CBC, UDS, APAP, and 150 UHCG), as shown in Table cant abnormal results by our 2 reviewing emergency physicians. These were laboratory values that, accord ing to our hospital psychiatric admission criteria, would require treatment prior to psychiatric admission. Thirty patients had abnormal UAs and were started on treatment for asymptomatic uri nary tract infections prior to admission to psychiatry. Five patients had hypokalemia on their CMP and were treated with K-Dur and admitted to psychiatry. The other 2 ab normal CMPs showed elevated creatine for the repeat laboratory values returned to normal prior to psychiatric admission. The 7 patients with elevated BAL had repeat laboratory tests drawn until levels were under 100, meeting admission standards to psychiatry. Thyroxine free (free T4) levels were obtained on the 3 Figure 1. Number of subjects by age group. 18-25 26-33 34-41 42-49 50-57 58-65 Age Group (years) Number of Subjects0 150 100 50 250 200 350 300 400 9 6 34 87 204 350 22% 78%Figure 2. Percentages of subjects by gender. Male Female EFFECTS OF MANDATORY SCREENING LABS IN DIRECTING THE DISPOSITION OF THE APPARENTLY HEALTHY PSYCHIATRIC PATIENT IN THE EMERGENCY DEPARTMENT

PAGE 23

July September 2017 21 patients with abnormal TSH and results were normal, eliminating concern for acute thyroid abnormalities. These patients were cleared for psychiatric admis sion with recommendations for repeat laboratory work upon discharge. Finally, the patient with elevated ASA had serial ASA levels drawn in the emergency depart admission. disposition to a medical service based upon abnormal laboratory studies, a probability of 1/682=0.1% (95% CI: 0.0% to 0.9%). That patient was a 43-year-old male who presented without any medical complaints but a chief complaint of suicidal ideation. This patient had an abnormal CMP (elevated glucose) and UA (glucose and ketones present) and was found, through his labora tory work, to have diabetic ketoacidosis (DKA). Upon and insulin in the emergency de partment and was transferred to the intensive care unit. The prob ability that an abnormal labora tory test will result in a change in patient disposition is 1/682=0.1% (95% CI: 0.0% to 0.9%). Using Fishers Exact Test, we found that there was a statistically patient disposition between an abnormal and normal CMP ( P =.013) and an abnor mal and normal UA ( P =.047). Because many of our laboratory tests had no abnormal results (CBC, UDS, APAP, UHCG), we decided to investigate if the truly zero and, if not, what the estimated probability is for an abnormal result in one of those laboratory tests in the future. Us rule of three, among the tests for which there were no abnormal results, the esti mated probability of an abnormal labora for the CBC, UDS, and APAP, and 2.0% to 3.1% (high limit of the 95% CI) for UHCG. This means that even though our data had some laboratory tests with no abnormal re sults, there is still a small probability that there will be abnormal results in future pa tients. The analysis results are presented in Table 2. There were also laboratory tests for which there were abnormal results but no change in disposition (ASA, BAL, and TSH), and we estimated the probability of future abnormal results in those laboratory tests as well. the probability of a future abnormal result in the labora tory tests that already had abnormal results was up to 1.8% (high limit of the 95% CI), presented in Table 3. This means that there is continued probability of these laboratory tests resulting abnormally, but this does not change the probability that these abnormal results will alter disposition in the future. COmm MM ENT Due in part to the demand placed on emergency depart ments and the prevailing evidence that mandatory psy chiatric laboratory tests do not alter a patients disposition, Table 1 changed disposition.Laboratory Test UA CMP BAL TSH ASACBC UDS APAP UHCG Number of laboratory tests ordered682682682682682682682682150Number of normal laboratory tests651 674 675 680 681 682682682150Number of clinically significant abnormal laboratory tests31 87210000Number of dispositions changed due to laboratory results110000000UA indicates urinalysis; CMP, complete metabolic panel; BAL, blood alcohol level; TSH, thyroid stimulating hormone; ASA, aspirin; CBC, complete blood count; UDS, urine drug screen; APAP, acetaminophen; UHCG, urinary human chorionic gonadotropin. Table 2 with no abnormal results.N Abnormality Normal Probability of an in the Future95% CI Rule of Three CBC682 06820.0% 0.4% (-0.1% to 0.7%) 0.4%APAP682 06820.0% 0.4% (-0.1% to 0.7%) 0.4%UDS682 06820.0% 0.4% (-0.1% to 0.7%) 0.4%UHCG150 0 150 1.3% 1.8% (-0.5% to 3.1%) 2.0%CBC indicates complete blood count; UDS, urine drug screen; APAP, acetaminophen; UHCG, urinary human chorionic gonadotropin. Table 3 tests with abnormal results.N Abnormality Normal Probability of an in the Future95% CI BAL682 7 675 0.8% (0.3% to 1.8%)TSH682 2 680 0.6% (0.0% to 1.2%)ASA682 1 681 0.5% (-0.1% to 0.9%)BAL indicates blood alcohol level; TSH, thyroid stimulating hormone; ASA, aspirin.

PAGE 24

22 http://www.cs.amedd.army.mil/amedd_journal.aspxthe American College of Emergency Physicians (ACEP) created a clinical policy in 2005 that provided a Level B and two Level C recommendations (recommendations for patient management that may identify a particular the routine testing of clinically stable adults that present to the emergency department with psychiatric symp toms.8 Despite these recommendations and the results from prior studies, clinical practice has not changed in most emergency departments which is, in part, due to poor communication between the emergency medicine providers and the accepting psychiatrists. as Korn et al,7 Parmar et al,6 and Amin and Wang,1 in the military population. Our study demonstrates that these mandatory screening laboratory tests change the disposition in psychiatric patients with no physical com ception, none of the performed tests altered a patients ing laboratory tests for medically stable psychiatric pa tients are very unlikely to change the patients disposi tion. Medicine accepts a reasonable miss-rate order to avoid over-testing and unnecessary treatments. Many decision-making rules, such as pulmonary embolism rule-out criteria, accept the risk of missing a positive at sition, demonstrate that forgoing mandatory screening laboratory tests in these stable psychiatric patients is al lowing an acceptable level of risk. This risk is further mitigated due to these patients being admitted to a hos pital psychiatric ward where they will continue to be monitored and can be transferred or reevaluated quickly if their presentation changes. In analyzing the individual laboratory tests for clinically results are often returned as normal. However, we know that zero abnormal results does not mean zero risk, so we determined the future probability of an ab normal result in those laboratory tests with no abnormal results (CBC, APAP, UDS, UHCG) in our study and found that, with the exception of the UHCG, there was be comfortable with. This means that we can, essential ly, stop ordering these tests in stable psychiatric patients studies with abnormal results that did not alter a patient estimated probability of a future abnormal result. This is a miss rate that we can also be comfortable with, as none of these abnormalities ultimately change the pa tient disposition. This study suggests that these 6 labora tory tests can be safely eliminated from our battery of mandatory tests, as none of them altered the patient dis The urine pregnancy test was only ordered on female patients and a positive result did not alter the disposition at our hospital as all inpatient psychiatric facilities are capable of treating pregnant patients. This laboratory result may direct a treatment plan for the psychiatrist but does not alter the disposition of our medically stable psychiatric patient. We suggest that the UHCG can be ordered by the psychiatrist once the patient is admitted rather than in the emergency department where it does not alter the patient course. Again, focusing on the utility of individual laboratory tests, the only ones with abnormalities that required a change in disposition were the CMP and the UA. Both of these laboratory tests were positive for elevated glucose, and the results initiated the workup for DKA in the only patient with a disposition change. The reviewing physicians believe the CMP results were cause enough to alter the disposition, but the UA results did not, on their own, result in the disposition change. This patient was a new-onset diabetic with no previous workup or diagnosis of diabetes and he denied any physical symp toms throughout his ED course, even after he was told of his diagnosis and began emergency treatment. These 2 DKA workup due to the hyperglycemia found in each. These laboratory tests may be considered redundant or is much less expensive and faster to rule out DKA in the stable psychiatric patient. The nonlife-threatening diagnoses found by these 2 laboratory tests were mild hypokalemia and asymptomatic urinary tract infections that required treatment prior to psychiatric admission, but add to our concerns for overtreatment of laboratory results in asymptomatic patients. From our results, we believe that the CMP and UA can be replaced by the mia. With the elimination of these 2 laboratory tests, the probability of a disposition change will remain less than are all admitted to the hospital and monitored for symp tom changes. Our results, which would suggest that we only need a in stable psychiatric patients, differ from those of EFFECTS OF MANDATORY SCREENING LABS IN DIRECTING THE DISPOSITION OF THE APPARENTLY HEALTHY PSYCHIATRIC PATIENT IN THE EMERGENCY DEPARTMENT

PAGE 25

July September 2017 23 Parmar et al6 in which the laboratory results caught an acetaminophen overdose in a medically cleared patient. As a result, they recommended keeping the APAP level as a screen for suicidal patients. With these results, a dialogue should begin within the hospital system, between the emergency and psychiat ric departments, in the hopes of eliminating completely or reducing the number of mandatory tests required for a psychiatric admission. Because there is no standard ized medical clearance for a psychiatric patient, it is of the system they have in place. This study shows that extensive mandatory screening laboratory tests do not change the disposition of psychiatric patients present ing without medical complaint to a military hospital. In emphasis on decreasing emergency department wait times, the departments of emergency medicine and psy chiatry could use this study results, in conjunction with the 2005 guideline from ACEP and the results of prior studies on the matter, to streamline the process of psy chiatric admissions within the military and reduce the medical screening laboratory tests required for medical clearance. We hypothesized that a thorough history and physical psychiatric patient without any medical complaints and that mandatory laboratory tests would not change the disposition. Our results show that, with one excep tion, history and physical exam alone can appropriately provide the disposition of medically stable psychiatric patients. Emergency providers and psychiatrists should work together to create appropriate testing strategies and admission criteria for psychiatric patients. LIMITATIONS Our study site had characteristics distinctive to the mili tary in that our study population was a mean age of 28 years and over 75% male. The population consisted of a relatively healthy active duty population and their fam ily members. Our study site was also unique in that it had multiple inpatient psychiatric facilities that were able to readily accept our patients, including the inpa tient psychiatric ward of the study hospital. This made This population and psychiatric disposition resources to the military hospitals across the country, however the ability for an emergency provider to appropriately evaluate psychiatric patients for an underlying medi cal condition should be universal to emergency depart ments. We believe that our observations, with regard to mandatory testing of psychiatric patients with no physi applicable to multiple emergency department settings. We performed a retrospective cohort chart review study in which we used a second year emergency department resident to review all of the patient charts and record data over the course of 3 months. We believe that by having a single data collector performing this task over a short period of time, we decreased the possibility of multiple interpretations of the data collection process and data recording. Our data collector was blinded to our hypothesis to decrease data collection bias. She was also informed that we would perform random inspec tions of her data to ensure accuracy.9 We pulled paper records of all charts that were not complete in the elec tronic medical records to ensure complete data collec tion. We also reviewed records that spanned a 2-year time period, attempting to get a better long-term picture and increase our data points. Because this was a retrospective review and we only had written documentation of the patient encounter, we had to trust that documentation as fact. In reviewing provider and nursing notes, occasional documentation errors were found with regards to normal vital signs and recorded as normal and abnormal vital signs were re corded as normal. This brings to light the limitations of a retrospective study and, while our data collector did her best to fully evaluate patient documentation, we must acknowledge that due to human error, not all documentation made in patient charts may be accurate. We could see when abnormal results were recorded as normal but we could not see if abnormal physical exam sibility and a risk when trusting retrospective charts. Finally, in reviewing retrospective data, we could not see the order in which the patient evaluation process oc curred. In our department, these mandatory laboratory tests may be ordered in triage, prior to an emergency providers evaluation, or by the provider after the bedside evaluation. If these laboratory tests are ordered in triage and results obtained prior to the physical evalua tion, those results may guide some providers to a more focused and detailed history and physical examination with the possibility of discovering abnormalities, there by excluding that patient from our study. Ideally, to truly abnormality in a stable psychiatric patient, the patient would be evaluated without the providers knowledge of the laboratory results so as not to guide the history and exam.

PAGE 26

24 http://www.cs.amedd.army.mil/amedd_journal.aspx A prospective validation study, ideally with a more var ied patient population, is recommended to more broadly spective multicenter study at military hospitals is need ed to derive and validate a clinical decision-making rule that can be used across the Department of Defense and in similar populations for screening of psychiatric pa tients with no physical complaint. CCONCLUSIONONCLUSION Of 682 patients evaluated with a psychiatric chief com plaint and no medical complaint of abnormal physical from psychiatric admission to medical admission based ings of previous studies and indicates that these man datory screening laboratory tests rarely alter a patients disposition after evaluation by an emergency trained provider. By eliminating these laboratory tests we ac mitigated due to these patients all being admitted to the hospital. RREFERENCES 1. Amin M, Wang J. Routine laboratory testing to evaluate for medical illness in psychiatric patients in the emergency department is largely unreveal ing. West J Emerg Med 2009;10(2):97-100. 2. T anielian TL, Jaycox LH, eds. Invisible wounds of war: Psychological and Cognitive Injuries, Their Consequences, and Services to Assist Recovery Santa Monica, CA: Rand Corporation; 2008. 3. C alhoun PS, Beckham JC, Bosworth HB. Caregiv er burden and psychological distress in partners of veterans with chronic posttraumatic stress disorder. J Trauma Stress 2002;15(3):205-212. 4. Kulka RA, Schlenger WE, Fairbank JA, et al. Trauma and the Vietnam War Generation: Report of Findings from the National Vietnam Veterans Readjustment Study New York: Brunner/Mazel Inc; 1990. 5. J ohnson SJ, Sherman MD, Hoffman JS, et al. The Psychological Needs of U.S. Military Service Members and Their Families: A Preliminary Report Washington, DC: American Psychological Asso ciation Presidential Task Force on Military De ployment Services for Youth, Families, and Service Members; 2007. 6. Pa rmar P, Goolsby C, Udompanyanan K, et al. Val ue of mandatory screening studies in emergency department patients cleared for psychiatric admis sion. West J Emerg Med 2012;13(5):388-393. 7. K orn CS, Currier GW, Henderson SO. Medical clearance of psychiatric patients without medical complaints in the emergency department. J Emerg Med. 2000;18:173-176. 8. L ukens TW, Wolf SJ, Edlow JA, et al. Clinical Policy: Critical Issues in the Diagnosis and Management of the Adult Psychiatric Patient in the Emergency Department. Ann Emerg Med 2006;47(1):79-84. 9. W orster A, Haines T. Advanced statistics: un derstanding medical record review (MRR) studies. Acad Emerg Med 2004;11(2):187-192. AUTHORS MAJ Kagel, LTC Kagel, and CPT Smith are with the De partment of Emergency Medicine, Carl R. Darnall Army Medical Center, Fort Hood, Texas. CPT Latyshenko is with the Department of Emergency Medicine, Womack Army Medical Center, Fort Bragg, North Carolina. MAJ Mitchell is Regimental Surgeon, 3rd Cavalry Regi ment, Fort Hood, Texas.EFFECTS OF MANDATORY SCREENING LABS IN DIRECTING THE DISPOSITION OF THE APPARENTLY HEALTHY PSYCHIATRIC PATIENT IN THE EMERGENCY DEPARTMENT

PAGE 27

July September 2017 25Adverse childhood experiences (ACE) have long been recognized as antecedents to negative physical and men tal health outcomes. Felitti and his colleagues, in their landmark ACE study,1 discovered child maltreatment and household dysfunction to be associated with many of the leading causes of death in adults. Further reports from the ACE study linked childhood adversity to psy chosocial problems that included suicide attempts,2 alcohol abuse,3 intimate partner violence,4 depressive disorders,5 hallucinations,6 and generally poorer mental health functioning.7 Since the initial work of Felitti et al, others have contributed to the growing understand ing of the long-term consequences of childhood trauma. A study of young adults from economically disadvan taged, urban communities revealed that those with a high rate of ACEs were more likely to experience de pressive symptoms, use drugs and engage in antisocial behavior.8 Since the advent of the all-volunteer service, increased percentages of service members, particularly males, have described personal ACEs.9 in the high prevalence of ACEs seen in Soldiers who sought treatment for a wide array of behavioral health disorders while deployed to a combat zone, with many reporting having experienced 3 or more types of ad versity.10 Similarly, active duty Marines who reported a history of ACEs appeared to be at an increased risk for developing posttraumatic stress disorder after re turning from a combat deployment.11 Additional stud ies have correlated childhood adversity with a lifetime onset of posttraumatic stress disorder, conduct disorder, substance use disorders, suicidal ideation, and anxi ety.12-14 Furthermore, ACEs are believed to exacerbate the physical and psychological symptoms experienced by those with severe mental health disorders.15,16 Much of the research on ACEs has shown that the more ad versity a child experiences, the more likely they will develop physical or psychosocial problems as an adult. tion that not everyone who endures hardships early in life is destined to become psychosocially dysfunctional. This evidence suggests that some people become resil ient in the face of adversity and emerge from childhood trauma to lead psychologically healthy and highly suc cessful professional lives. Thus resilience, characterized by achieving positive outcomes despite severe threats to growth or adaptation,17 may mitigate the risk of develop ing the psychological distress and maladaptive behavior associated with ACEs. In fact, psychological resilience has been shown to protect against the risk of suicide re lated to childhood trauma and lessens the association between being emotionally neglected as a child and developing psychiatric symptoms as a young adult.18,19 Furthermore, homeless adolescents with a history of ACEs who perceived themselves as resilient were found less likely to engage in risky behavior, were less lonely and more hopeful.20 Becoming resilient can be achieved through various pathways.21 While innate factors and silience, the Kauai longitudinal study on the resilience and recovery of at-risk children discovered that relationships with supportive adults mitigate the vulnerabilities of adversity and facilitate positive outcomes as adults.22 RRESILIENCE aA ND R RELa A TIONSHIPS The power of human connections to shape individual growth and development has been espoused by many theoretical perspectives, but none more so than attach ment theory. According to John Bowlby, Attachment behavior is any form of behavior that results in a person attaining or maintaining proximity to some other clearly cope with the world.23 Accordingly, becoming secure ly attached has been shown to be positively associated with resilience.24man relationships can exert in promoting, and in some cases restoring, healthy development can be found in the literature on resiliency in vulnerable populations. Re search has established that older children who live under chronically adverse conditions tend to do better or recover more effectively when they have a relationship Resilience-Enhancing Relationships: What We Can Learn From Those With a History of Adverse Childhood Experiences C OL Derrick Arincorayan, MS, USA L arry Applewhite, PhD M AJ Matthew Garrido, MS, USA C PT Victoria Cashio, MS, USA C PT Meghan Bryant, MS, USA

PAGE 28

26 http://www.cs.amedd.army.mil/amedd_journal.aspxwith a competent adult.25 Relatedly, Brooks proposed that developing caring relationships in schools, based on respect, encouragement, and attentiveness, may help young students elude the negative outcomes related to environmental threats.26 This idea is congruent with relationships with adults that foster the formation of a self-identity grounded in resilience and competence.27 Furthermore, developing a sense of competence, a con tributor to resilience, requires caring, competent adults to be actively involved in a childs life.28 Importantly, resilience-enhancing relationships are not limited to pri mary caregivers. Extra-familial adults, such as teachers, coaches, clergy and mental health workers, have proven to be effective mentors that can serve as a protective factor for vulnerable children.29 This may partially ex plain how mothers who were abused as children were able to break the cycle of abuse after receiving emo tional support from foster parents and others when they were younger.30 Although much resilience research fo cuses on children, a meta-analysis of the effectiveness of resilience-building programs conducted in occupational settings found many of the protective factors pertinent to children may also apply to adults and that direct re 31 suggesting that relating to the coach or trainer can enrich the learning process. Additionally, caring relationships in the workplace boost resilience and can be transformative during times of organizational change.32 Interestingly, Laursen and Birmingham, in an ethnographic study of adolescents,33 caring relationship to include trust, attention, empathy, Restrepo (http://restrepothemovie.com/), has written about the role social bonds play in helping to sustain Soldiers through the stress of a combat deployment and, conversely, how the absence of postdeployment social support elevates the risk of developing posttraumatic stress disorder.34 One of the principal objectives of this study is to identify the characteristics of past and pres ent supportive relationships that have helped individuals overcome adversity and contributed to them becoming resilient Soldiers. METHODS The study protocol was approved by the Institutional Review Board at Tripler Army Medical Center. Inves tigators adhered to the policies for protection of human subjects as prescribed in 45 CFR 46 and entailed a 2-part protocol. First, we used a correlational design to explore the relationship between adverse childhood experiences and resilience in adulthood followed by semistructured interviews to identify characteristics of supportive relationships that contributed to individuals becoming resilient adults in spite of childhood adver sity. A convenience sample of 250 active duty service members, recruited at the Soldier Readiness Processing 3-part survey that included basic demographic informa tion, the ACE questionnaire, and the Connor-Davidson Resilience Scale (CD-RISC). The ACE questionnaire used in this study is an adaptation of the survey used in the seminal ACE Study.1 It contains 10 questions written to elicit dichotomous yes/no responses to cap ture the respondents exposure, prior to age 18, to child maltreatment, domestic violence, parental separation/ divorce, having a member of the household who was mentally ill, abused substances, or was incarcerated. In to determine a total ACE score. Although the ACE data are collected retrospectively, answers to the ACE ques tions have demonstrated good test-retest reliability indi cating that responses tend to be generally stable.35 The CD-RISC is a valid and reliable self-reported measure of resilience consisting of 25 items rated on a 5-point scale (0-4) with higher scores indicative of greater re silience.36 In our current study, we achieved a Cronbach further volunteered to be interviewed, participant re voluntarily provided their name and a point-of-contact. Inclusion criteria for the qualitative portion of the study consisted of reporting at least 3 adverse childhood ex periences, demonstrating high resilience as evidenced by scoring 80 or higher on the CD-RISC and, based on their response to question two of the CD-RISC, hav ing a close and secure relationship they could turn to in times of stress. From the 36 volunteers who met our criteria, we selected a purposive sample of 25 that re tics. The semistructured interviews consisted of a series of open-ended questions with probing follow-up queries designed to capture descriptions of the personal char acteristics and behavior exhibited by individuals with whom participants had a current or past supportive rela tionship. Interviews were recorded in process and spe mented. To control for interviewer bias, another member of the research team listened to the recorded interview and transcribed key descriptive quotes as well. Finally, a third researcher reviewed the 2 independent interview summaries for inter-rater reliability, only material documented on both summaries was considered reliable and RESILIENCE-ENHANCING RELATIONSHIPS: WHAT WE CAN LEARN FROM THOSE WITH A HISTORY OF ADVERSE CHILDHOOD EXPERIENCES

PAGE 29

July September 2017 27 tics or actions, and frequencies tabulated. The statistical application SPSS v.22 (IBM Corpora tion, Armonk, New York) was used to calculate the frequency distributions of demographic char acteristics, the prevalence of each adverse child hood event, and correlations between ACEs and Army Medical Center Institutional Review Board granted approval to conduct this study. RRESULTS DemographicsAs described in Table 1, the 250 participants were predominantly male with a moderate number of women. They were relatively young with an aver age age of 27 years. The sample was rather diverse with many self-identifying as Caucasian, followed lander and Native American. Most were married Only a few were divorced. They were fairly welleducated as a majority were high school graduates or had completed some college courses and a sig degree. Some had completed postgraduate educa The overwhelming majority were enlisted service members with almost half serving in the junior grades of E1-E4. A substantial number were junior few senior NCOs (E7-E9) represented. Commis percentage of the sample. Half worked in support the others served in the combat arms specialties. On average, they had almost 6 years of time-inservice with a wide range of 3 months to 28 years of military experience. Interestingly, most had not deployed to a combat zone. The subset of 25 that participated in interviews was similar across most demographic variables but were more likely to be married, more junior in rank, and less likely to have deployed to a combat zone.Adverse Childhood ExperiencesIn total, ACE scores ranged from 0 to 10 with a mean of 2.9 (SD=2.6). As detailed in Table 2, the vast majority of Soldiers reported experiencing at least one form of childhood adversity with half enduring 3 or more. Of the 7 individuals who reported 9 or more types of ad verse experiences, only one met the inclusion threshold for resiliency but that individual did not volunteer to be interviewed. Having parents that divorced or separated was the most commonly reported disruption to ones childhood. Experiencing child maltreatment, in its vari a relatively small percentage reporting being sexually abused. Many indicated growing-up in a household with someone who abused alcohol or other substances. A lit tle over a quarter lived with a mentally ill family mem ber. A considerable number had a member of the house Table 1. Demographic Characteristics of Study Population.Demographic Variables Survey Only (n=225) Interviewees (n=25) Total (n=250) Mean Age (years)27.12 27.5227.16Mean Time-In-Service (years)5.7 5.5 5.7Gender Female33(14.7%) 6(24%) 39(15.6%)Male192(85.3%)19(76%) 211(84.4%)Race African-American43(19.1%) 3(12.0%) 46(18.4%)Asian17(7.6%) 3(12.0%) 20(8.0%)Caucasian99(44.0%) 13(52%) 112(44.8%)Hispanic46(20.4%) 4(16.0%) 50(20.0%)Native American3(1.3%)1(4%)4(1.6%)Pacific Islander14(6.2%)1(4%) 15(6%)Other3(1.3%)0(0%)3(1.2%)Marital Status Single83(36.9%) 6(24.0%) 89(35.6%)Married132(58.7%) 19(76%)151(60.4%)Divorced9(4%)0(0%) 9(3.6%)Unknown1(0.4%)0(0%)1(0.4%)Education High School68(30.2%) 7(28.0%) 75(30.0%)Some College72(32.4%) 10(40.0%) 83(33.2%)Tech Certification8(3.6%) 0(0%)8(3.2%)Associates Degree31(13.8%) 5(20.0%) 36(14.4%)Bachelors Degree33(14.7%)2(8.0%)35(14.0%)Masters Degree7(3.1%)1(4.0%)8(3.2%)Doctorate2(0.9%)0(0%)2(0.8%)Unknown3(1.3%)0(0%)3(1.2%)Rank E1E4106(47.1%) 15(60.0%) 121(48.4%)E5E679(35.1%) 5(20.0%) 84(33.6%)E7E98(3.6%) 3(12.0%) 11(4.4%)Officer32(14.2%)2(8.0%)34(13.6%)MOS Combat Arms97(43.1%)12(48.0%)109(43.6%)Combat Support34(15.1%)2(8.0%) 36(14.4%)Combat Service Support63(28.0%) 3(12.0%) 66(26.4%)Medical18(8.0%) 5(20.0%) 23(9.2%)Unknown13(5.8%) 3(12.0%) 16(6.4%)Combat Deployment No127(56.4%) 17(68%) 144(57.6%)Yes98(43.6%)8(32%)106(42.4%)

PAGE 30

28 http://www.cs.amedd.army.mil/amedd_journal.aspxdomestic violence. Predictably, given our criteria to be included in the studys qualitative phase, the 25 individuals who were interviewed reported ex periencing childhood trauma in greater percent ages across all measures. We found no statistically demographic variable.ResilienceScores on the CD-RISC ranged from 34 to 100 with a mean of 78.28 (SD=13.74) and a median relationship was found between total number of ACEs and current resilience as measured by the CD-RISC ( r =-.138, P =.029). Further analysis us 2 test for independence with Yates Con tinuity Correction was conducted to examine the relationship between a high number of ACEs (3 or more) and high resilience scores (80 or higher on the CD-RISC) and also found a statistically signif 2=10.9, P =.001, higher) were analyzed in relation to each ACE, 2=11.8, P 2=6.3, P =.01, 2=6.0, P =.015, 2=5.5, P als who were physically or psychologically abused, or grew-up with a mentally ill family member tended to be less resilient as measured by the CDRISC. All other adverse childhood experiences cally, with current resilience.Relationship CharacteristicsAll 25 interviewees described having current and past supportive relationships that helped them be current sources of support followed by extra-fa milial relationships with peers or supervisors such gaining strength from their relationship with a spiritual or religious entity. Similarly, family members, mostly the mother but also fathers, grandparents, siblings and an uncle, were described as prominent adult relation outside of the family, such as a foster parent, teacher, neighbor and friends, were, and in some instances re of the sample. As seen in the Figure, 9 characteristics reliably emerged from the descriptions of those who the development of resilience. The characteristics with representative descriptions are:AvailableAlways there W ould be there Just being there W as always there for me Always going to be there (and in several instances) No matter what RESILIENCE-ENHANCING RELATIONSHIPS: WHAT WE CAN LEARN FROM THOSE WITH A HISTORY OF ADVERSE CHILDHOOD EXPERIENCES Table 2. Prevalence of Adverse Childhood Experiences.Adverse Childhood Experience Items Survey Only (n=225) Interviewees (n=25) Total (n=250) Psychological abuse: insulted, humiliated, demeaned, sworn at, feared physical abuse.92(40.9%) 20(80.0%) 112(44.8%)Physical abuse: pushed, grabbed, slapped, targeted with thrown objects, struck leaving marks or resulting in injury.77(34.2%) 18(72.0%) 95(38.0%)Sexual abuse: touched, fondled, and/or forced to touch others in a sexual way; oral, anal, or vaginal intercourse.25(11.1%)9(36.0%)34(13.6%)Emotional neglect: not loved, made to feel unimportant, not looked after, did not feel close or supported.46(20.4%) 11(44.0%) 57(22.8%)Physical neglect: not enough to eat, wore dirty clothes, not protected, parents too high or drunk to provide care or seek medical care for you if needed.28(12.4%)7(28.0%)35(14.0%)Parental divorce/separation: parents ever separated or divorced.118(52.4%)17(68.0%)135(54.0%)Domestic violence: directed towards mother or stepmother.43(19.1%)7(28.0%) 50(20.0%)Substance abuse: lived with a problem drinker, alcoholic, or drug abuser.75(33.3%) 20(80.0%) 95(38.0%)Mental illness: household member was depressed, had a mental illness, or attempted suicide.55(24.4%) 11(44.0%) 66(26.4%)Incarceration: household member went to prison.45(20.0%) 11(44.0%) 56(22.4%)Number of ACEs Reported per Individual0 56(24.9%) 0(0%) 56(22.4%) 1-2 70(31.1%)0(0%)70(28.0%) 3-4 44(19.5%)9(36.0%)53(21.2%) 5-6 36(16.0%)9(36.0%)45(18.0%) 7-8 12(5.3%)7(28.0%) 19(7.6%) 9-10 7(3.1%)0(0%)7(2.8%)

PAGE 31

July September 2017 29 CommunicatorListens Good listener W illing to listen Listened to me W ould listen before giving advice Talked to me like an adult Just talking things out Could sit down and talk T alks to me No yellingCaringShowed me she cares Cares about me W ould go out of his way to show he cared Very nurturing and loving Constantly checking up on me Willing to helpRole ModelA role model to me Led by example Inspiring Respected Looked up to Always positive Trustworthy Can tell her anything Earned my trust CoachTaught me a lot Pushed me to be greater E ncouraged me Pushed me to not give up Gave me tips on how to do things, Showed me the Army thinking process Taught me to be more responsibleGuardianProvided security T ried to protect me Made sure I had a place to stay Would stand up for us My mental shieldNonjudgmental Tried to understand Never judged me Put herself in my shoes Unbiased He understands what Ive been through Accepted meFirmDirect and stern T ough love Very forceful Kicks me in the ass T ells me when Im being a baby, to man up CCOmm MM ENT Our show that a substantial number of Sol diers may come from challenging backgrounds as this active duty sample reported experiencing childhood adversity at a rate comparable to that reported by a clin ical sample of deployed Soldiers10 and exceeding that found in the general population.37 Moreover, anyone mographic group was found to be more likely to have grown-up in adverse conditions. The large percentage of Soldiers that acknowledged having ACEs under is seen as an opportunity to escape family adversity.21 Therefore, the military may disproportionately attract chosocial problems associated with adverse childhood experiences. Consequently, it is in the best interests of the military services to understand the needs of these potentially vulnerable service members and to provide leadership and support services to help them achieve success in their pursuit of a better life. Although the strength of the relationship is admittedly or household dysfunction as a child can have a delete rious effect on how resilient one becomes as an adult. This may be particularly true for those individuals who were physically or psychologically abused, witnessed domestic violence, or lived with a mentally ill family ship with a supportive adult. Being considered supportive by others can be accom plished by manifesting certain personal qualities. First, and apparently foremost, is being available. Knowing that someone who is viewed as better able to cope with the world will be there when needed establishes Characteristics of people as described during participant inter the participants resilience. Percentage of Participants Describing Characteristic Nonjudgmental Available Communicator Caring Role Model Trustworthy Coach Guardian Firm20 40 60 80 0 100 24% 36% 32% 44% 60% 64% 80% 72% 84%

PAGE 32

30 http://www.cs.amedd.army.mil/amedd_journal.aspxa secure base from which to engage the external world without fear of being abandoned. In addition, maximizexercising good communication skills that begin with a willingness to listen. A great deal of support appears to derive from being allowed to express oneself before receiving unsolicited advice or, in a more negative vein, disapproval from others. Listening, however, is contin gent upon others being willing to open-up. While the ex perience of being cared for is subjective, demonstrat ing that one cares and can be trusted and nonjudgmental fosters a sense of safety that encourages a person to talk who may otherwise be reluctant to reveal their inner most thoughts due to their family history. Further, a rela tionship built on trust provides an opportunity to impart cultivate a sense of competency leading to enhanced re judiciously, enforcing socially acceptable conduct is nec essary to keep someone who may be at-risk for maladap tive behavior on the right track. Being a respected role and leads by example appears to facilitate the process. Our results, however, should be considered within the context of limitations inherent in our approach. Using a correlational design does not allow us to conclude that growing-up with ACEs causes one to be less resilient as an adult, only that the two situations are associated with one another. Also, relying on a convenience sample of volunteers creates the risk of a selection bias that re yond the sample. Furthermore, we only achieved face IImM PLICa A TIONS Our supportive relationships do make a positive difference in the lives of those who experienced childhood adversity by contributing to resilience in adulthood. Further, be ing experienced as supportive entails several prominent characteristics that include availability, communication that emphasizes listening, caring, trustworthiness, and being a respected role model who is willing to coach in socially acceptable ways without being judgmental. While these qualities seem fundamentally applicable to all human interactions, they may be most meaningful in our family relationships. A supportive family mem ber, either a spouse, mother, or other relative, was most to overcome adversity and contributing to resilience. Therefore, incorporating these evidence-based charac teristics into family advocacy prevention classes may be useful in strengthening marriages as well as provide a simple model for healthy parent/child relationships. Moreover, since a wide-array of extra-familial relation ships were also deemed supportive, these attributes can be developed into a skill set for military leaders to ap ply in mentoring vulnerable Soldiers and used to inform the training of junior leaders during their initial leader ship schools. Providing supportive leadership based on the characteristics found in this current research could augment the Armys efforts to enhance psychological resilience through the Comprehensive Soldier and Fam ily Fitness Program.38 Future research should continue to focus on those who developed grit despite childhood relationship and to determine if there is a critical de relationship can be optimized. CCONCLUSIONS Much research has clearly established that adverse child hood experiences can lead to an adulthood plagued by multiple physical and psychosocial maladies. Neverthe less, there is mounting evidence to show that supportive relationships can mitigate the negative effect of child hood trauma by helping to build resilience. More specif ically, relationships based on a constellation of seeming ly simple actions and basic human qualities contribute to the development of the resiliency necessary to over come current and future adversity. Given the number of Soldiers who may have experienced childhood adversity, military leaders, in addition to being technically and tors by integrating these qualities into their leadership style. Perhaps we should consider applying these sup portive attributes in all the relationships in which we hope to make a meaningful difference. RREFERENCES 1. Felitti VJ, Anda RF, Nordenberg D, et al. Relation ship of childhood abuse and household dysfunction to many of the leading causes of death in adults: the adverse childhood experiences (ACE) study. Am J Prev Med. 1998;14(4):245-258. 2. D ube SR, Anda RF, Felitti VJ, Chapman DP, Williamson DF, Giles WH. Childhood abuse, household dysfunction and the risk of attempt ed suicide throughout the life span. JAMA 2001;286(24):3089-3096. 3. D ube SR, Anda RF, Felitti VJ, Edwards VJ, Croft JB. Adverse childhood experiences and per sonal alcohol abuse as an adult. Addict Behav 2002;27:713-725.RESILIENCE-ENHANCING RELATIONSHIPS: WHAT WE CAN LEARN FROM THOSE WITH A HISTORY OF ADVERSE CHILDHOOD EXPERIENCES

PAGE 33

July September 2017 31 4. lent childhood experiences and the risk of intimate partner violence in adults. J Interpers Violence 2003;18(2):166-185. 5. Edwards VJ, Anda RF. Adverse childhood experi ences and the risk of depressive disorders in adult hood. J Affect Disord. 2004;82:217-225. 6. verse childhood experiences and hallucinations. Child Abuse Negl 2005;29:797-810. 7. E dwards VJ, Holden GW, Felitti VJ, Anda RF. Re lationship between multiple forms of childhood maltreatment and adult mental health in com munity respondents: Results from the adverse childhood experiences study. Am J Psychiatry 2003;160(8):1453-1460. 8. S chilling EA, Aseltine Jr. RH, Gore S. Adverse childhood experiences and mental health in young adults: A longitudinal survey. BMC Public Health 2007;7:Available at: http://www.biomedcentral. com/1471-2458/7/Accessed October 6, 2016. 9. B losnich JR, Dichter ME, Cerulli C, Batten SV, Bossarte RM. Disparities in adverse child hood experiences among individuals with a history of military service. JAMA Psychiatry 2014;71(9):1041-1048. 10. A pplewhite L, Arincorayan D, Adams B. Exploring the prevalence of adverse childhood experiences in soldiers seeking behavioral health care during a combat deployment. Mil Med. 2016;181:1275-1280. 11. L eardMann CA, Smith B, Ryan MAK. Do ad verse childhood experiences increase the risk of postdeployment posttraumatic stress disorder in US Marines? BMC Public Health 2010;10:4Avail able at: http://www.biomedcentral.com/14712458/10/4Accessed September 22,. 2016. 12. Stein MB, Sareen J. Population attributable frac tions of psychiatric disorders and suicide ideation and attempts associated with adverse childhood ex periences. Am J Public Health 2008;98(5):946-952. 13. tionship between child abuse, parental divorce, and lifetime mental disorders and suicidality in a na tionally representative adult sample. Child Abuse Negl 2009;33:139-147. 14. G rief Green J, McLaughlin KA, Berglund PA, et al. Childhood adversities and adult psychiatric disor ders in the national comorbidity survey replication I. Arch Gen Psychiatry 2010;67(2):113-123. 15. R osenberg SD, Lu W, Mueser KT, Jankowski MK, Cournos F. Correlates of adverse childhood events among adults with schizophrenia spectrum disor ders. Psychiatr Serv 2007;58(2):245-253. 16. L u W, Mueser KT, Rosenberg SD, Jankowski MK. Correlates of adverse childhood experiences among adults with severe mood disorders. Psychi atr Serv 2008;59(9):1018-26. 17. M asten AS. Ordinary magic: resilience processes in development. Am Psychol 2001;56(3):227-238. 18. R oy A, Carli V, Sarchiapone M. Resilience miti gates the suicide risk associated with childhood trauma. J Affective Dis 2011;133:591-594. 19. C ampbell-Sills L, Cohan SL, Stein MB. Relation ship of resilience to personality, coping, and psy chiatric symptoms in young adults. Behav Res Ther 2006;44(4):585-599. 20. R ew L, Taylor-Seehafer M, Thomas NY, Yockey RD. Correlates of resilience in homeless adoles cents. J Nurs Scholarsh 2001;33(1):33-40. 21. B onanno GA. Loss, trauma, and human resilience: have we underestimated the human capacity to thrive after extremely aversive events?. Am Psy chol 2004;59(1):20-28. 22. W erner EE. The children of Kauai: resiliency and recovery in adolescence and adulthood. J Adolesc Health 1992;13(4):262-268. 23. B owlby J. A Secure Base: Parent-child Attachment and Healthy Human Development New York, NY: Basic Books, Inc; 1988:26-27. 24. S imeon D, Yehuda R, Cunill R, Knutelska M, Put nam FW, Smith LM. Factors associated with resil ience in healthy adults. Psychoneuroendocrinology 2007;32:1149-1152. 25. M asten AS, Best KM, Garmezy N. Resilience and development: Contributions from the study of chil dren who overcome adversity. Dev Psychopathol 1990;2:425-444. 26. B rooks JE. Strengthening resilience in children and youths: maximizing opportunities through the schools. Child Sch 2006;18(2):69-76. 27. U ngar M. The importance of parents and other caregivers to the resilience of high-risk adolescents. Fam Process 2004;43(1):23-41. 28. M asten AS, Coatsworth JD. The development of competence in favorable and unfavorable environ ments: lessons from research on successful chil dren. Am Psychol 1998;53(2):205-220. 29. R ak CF, Patterson LE. Promoting resilience in atrisk children. J Couns Dev 1996;7:368-373. 30. E geland B, Carlson E, Sroufe LA. Resilience as process. Dev Psychopathol 1993;5(4):517-528. 31. V anhove AJ, Herian MN, Perez ALU, Harms PD, Lester PB. Can resilience be developed at work? A meta-analytic review of resilience-building pro gramme effectiveness. J Occup Organ Psychol 2016;89(2):278-307.

PAGE 34

32 http://www.cs.amedd.army.mil/amedd_journal.aspx32. Wilson SM, Ferch SR. Enhancing resilience in the workplace through the practice of caring relation ships. Organizational Dev J 2005;23(4):45-60. 33. L aursen EK, Birmingham SM. Caring relation ships as a protective factor for at-risk youth: an ethnographic study. Fam Soc 2003;84(2):240-246. 34. J unger S. Tribe: On Homecoming and Belonging New York, NY; Hachette Book Group: 2016. 35. D ube SR, Williamson DF, Thompson T, Felitti VJ, Anda RF. Assessing the reliability of retrospective reports of adverse childhood experiences among adult HMO members attending a primary care clinic. Child Abuse Negl 2004;28:729-737. 36. C onnor KM, Davidson JRT. Development of a new resilience scale: the Connor-Davidson Resilience Scale (CD-RISC). Depress Anxiety 2003;18:76-82. 37. C enters for Disease Control and Prevention. About behavioral risk factor surveillance system ACE data [internet]. 20Available at: https://www.cdc. gov/violenceprevention/acestudy/ace_brfss.html Accessed January 4,. 2017. 38. for psychological resilience in the US Army. Am Psychol 2011;66(1):1-3. AUTHORS COL Arincorayan is Deputy Chief, Department of Be Dr Applewhite is a Clinical Associate Professor, US Army/Fayetteville State University MSW Program, US Army Medical Department and School, JBSA Fort Sam Houston, Texas. MAJ Garrido is Director of Training, Social Work In ternship Program, Department of Behavioral Health, Division Sustainment Brigade, Fort Stewart, Georgia. lery Brigade, Camp Casey, Republic of Korea.RESILIENCE-ENHANCING RELATIONSHIPS: WHAT WE CAN LEARN FROM THOSE WITH A HISTORY OF ADVERSE CHILDHOOD EXPERIENCES

PAGE 35

July September 2017 33Meralgia paresthetica, a painful mononeuropathy of the lateral femoral cutaneous nerve (LFCN), can result from injury, compression or mechanical irritation of the lat ter.1 Lateral femoral cutaneous nerve block plays an in strumental role in the diagnosis and management of me ralgia paresthetica.1 Techniques for LFCN block include (US)-guidance.2-4 In a randomized crossover study, blind 2 The latter resulted in a P <.001) coupled with a shorter onset time ( P <.02).2 Although several recent reports3-4 have advocated US for LFCN block, to date, no RCT has compared NSand US-guided techniques. In this randomized, volunteer study, we set out to com pare NSand US-guided LFCN blocks. We hypothesized that US would provide shorter performance and onset times. Thus, the primary outcome was the total anesthe sia-related time (ie, the sum of performance and onset times). We also aimed to describe the triplanar sensory distribution of the LFCN after local anesthetic blocks. MaA TERIa A L aA ND METHODS e current trial was registered at Clinicaltrials.gov (Identier: NCT02577510) on October 14, 2015. Aer obtaining ethics committee approval (Defence Research and Development Canada Human Research Ethics Com mittee) and written informed consent, we enrolled 21 volunteers. Inclusion criteria were age between 18 and 60 years, American Society of Anesthesiologists (ASA) physical status I to II, and body mass index between 20 kg/m2 and 40 kg/m2. Exclusion criteria included A Randomized Comparison Between Neurostimulation and Ultrasound-Guided Lateral Femoral Cutaneous Nerve Block G aurav Gupta, MD, FRCPC At ikun Thonnagith, MD M ohan Radhakrishna, MD, FRCPC M aria Francisca Elgueta, MD I saac Tamblyn, PhD M Cpl Marie Eve Robitaille, AEC D e QH Tran, MD, FRCPC R oderick J Finlayson, MD, FRCPC L Col Markus Besemann, MD, FRCPC ABSTRa A CT Background : This prospective, randomized trial compared neurostimulation (NS) and ultrasound (US) guided lateral femoral cutaneous nerve (LFCN) block. We hypothesized that US would result in a shorter total anesthesia-related time (sum of performance and onset times). Methods : Twenty-one volunteers were enrolled. The right lower limb was randomized to an NSor US-guided LFCN block. The alternate technique was employed for the left lower limb. With NS, paresthesias were sought in the lateral thigh at a stimulatory threshold of 0.6 mA (pulse width=0.3 ms; frequency=2 Hz) or lower. With US, local anesthetic was deposited under the inguinal ligament, ventral to the iliopsoas muscle. In both groups, time and number of needle passes were recorded. Subsequently, a blinded observer assessed sensory block in midway between the anterior superior iliac spine and the lateral knee line. The blinded observer also assessed the areas of sensory block in the anterior, medial, lateral, and posterior aspects of the thigh and mapped this distribution onto a corresponding grid. Results seconds), onset times (300.0 to 307.5 seconds) and total anesthesia related-times (480.1 to 554.0 seconds). However US required fewer needle passes (3.22.9 vs 9.512.2; P =.009). There were no intergroup differences in terms of the distribution of the anesthetized cutaneous areas. However considerable variability was encountered be tween individuals and between the 2 sides of a same subject. The most common areas of sensory loss included the central lateral two-eighths anteriorly and the central antero-inferior three-eighths laterally. Conclusion : Ultrasound guidance and NS provide similar success rates and total anesthesia-related times for LFCN block. The territory of the LFCN displays wide interand intra-individual variability.

PAGE 36

34 http://www.cs.amedd.army.mil/amedd_journal.aspxA RANDOMIZED COMPARISON BETWEEN NEUROSTIMULATIONAND ULTRASOUND-GUIDED LATERAL FEMORAL CUTANEOUS NERVE BLOCK coagulopathy, pregnancy, breast feeding, hepatic or re nal failure, allergy to local anesthetic (LA), prior sur gery in the inguinal area, and neuropathy impacting sensation of the lateral thigh. All LFCN blocks were performed by 2 operators (au thors G. G. and R. J. F.) experienced with the NS and US techniques. They were carried out in a medical facil ity with access to resuscitative equipment and drugs. Volunteers were positioned supine. Using a computergenerated sequence of random numbers and a sealed envelope technique, the right lower limb was random ized to an NSor US -guided LFCN block. The alternate technique was employed for the left lower limb. tion of Shannon et al.2 After disinfection and draping, a 2 cm medial to the anterior superior iliac spine (ASIS) and 1 cm caudal to the inguinal ligament (Figure 1). A 22-gauge block needle (SonoPlex Stimcannula, Pajunk Mediztechnologie, Geisingen, Germany) attached to a nerve stimulator (MultiStimSwitch, Pajunk Mediztec hnologie, Geisingen, Germany) set at a current of 1.5 mA (pulse width=0.3 ms; frequency=2 Hz) was then inserted. Paresthesias were sought along the lateral as pect of the thigh. If sensory stimulation was not found with the initial insertion, the needle was advanced su anesthetize the LFCN. The US technique was performed according to the de scription of Hara et al.5 After skin disinfection and draping, a 6-13 MHz linear US probe (probe SL3323, MyLabTouch, Esoate, Genova, Italy) was applied in a sterile fashion medially to the ASIS and caudally to the inguinal ligament, in order to obtain a short axis view of the iliopsoas muscle. A skin wheal was raised with 0.5 22-gauge block needle was advanced until its tip was po sitioned just ventral to the iliopsoas muscle. Five mL of time interval between contact of the US probe with the patient and the acquisition of a satisfactory picture. For temporal interval between the start of the procedure (skin-probe contact for the US group and skin wheal for the NS group) and the end of LA injection through the block needle. Imaging and performance times were Figure 1. Needle in position for a block of the lateral femoral cutaneous nerve using the nerve stimulation technique. A line has been drawn (B) between the anterior superior iliac spine (ASIS) and the pubic tubercle. The skin puncture site is 2 cm medial along this line and 1 cm caudal to it. 2http://www.cs.amedd.army.mil/amedd_journal.aspxcoagulopathy, pregnancy, breast feeding, hepatic or renal failure, allergy to local anesthetic (LA), prior surgery in the inguinal area, and neuropathy impacting sensation of the lateral thigh. tioned supine. Using a computer-generated sequence of random numbers and a sealed envelope technique, the 2 After disinfection and draping, a and 1 cm caudal to the inguinal ligament (Figure 1). A Mediztechnologie, Geisingen, Germany) attached to a anesthetize the LFCN. description of Hara et al. After skin disinfection and sitioned just ventral to the iliopsoas muscle. Five mL of patient and the acquisition of a satisfactory picture. For A RANDOMIZED COMPARISON BETWEEN NEUROSTIMULATIONAND ULTRASOUND-GUIDED LATERAL FEMORAL CUTANEOUS NERVE BLOCKFigure 1. Needle in position for a block of the lateral femoral cutaneous nerve using the nerve stimulation technique. A line has been drawn (B) between the anterior superior iliac spine (ASIS) and the pubic tubercle. The skin puncture site is 2 cm medial along this line and 1 cm caudal to it. 2A 2B Figure 2. Ultrasound guided block of the lateral femoral cutaneous nerve.2A:an out-of-plane needle (N) has been placed through the inguinal ligament (IL), ventral to the iliopsoas muscle (IPM), one centimeter medial to the anterior superior iliac spine (ASIS).2B:5 mL of local anesthetic (LA) has been injected, spreading under the inguinal ligament (IL) and ventral to the iliopsoas muscle (IPM).

PAGE 37

July September 2017 35 recorded by the (nonblinded) investigator assisting the primary operator. The number of needle passes was also recorded by the nonblinded assistant. The initial needle dle advancement that was preceded by a retraction of at least 10 mm counted as an additional pass.6A fter LA injection through the block needle, LFCN block was tested over the lateral aspect of the thigh. Measurements were carried out every minute until 20 minutes by a blinded observer. Block success was de between the ASIS and the lateral knee line.2 Onset time success. Thus total anesthesia-related time equaled the sum of performance and onset times. In addition to recording anthropometric data, the blinded observer also assessed incidental femoral block (knee extension) at 20 minutes and procedural pain using a October December 20163THE ARMY MEDICAL DEPARTMENT JOURNAL recorded by the (nonblinded) investigator assisting the recorded by the nonblinded assistant. The initial needle least 10 mm counted as an additional pass.6After LA injection through the block needle, LFCN 2 success. Thus total anesthesia-related time equaled the sum of performance and onset times. In addition to recording anthropometric data, the blinded observer also assessed incidental femoral block (knee extension) at 20 minutes and procedural pain using a Area Percentage of Thigh Frozen Frequency 2 0 4 6 8 10 12 20 0 406080100 =21.01%13.72% Neurostimulation (NS) Guided Area Percentage of Thigh Frozen Frequency 2 0 4 6 8 10 12 20 0 406080100 =21.24%13.97% Ultrasound (US) Guided Anterior (right leg)Anterior (left leg)Lateral (left leg)Lateral (right leg)Posterior (left leg)Posterior (right leg) a b c e d g f 10 18 14 12 20 16 04 268Successful TreatmentsFigure 3A. Sensory area distribution maps observed for successful nerve blocks. Overlapping areas shared between patients are denoted by the area color. Legend: a. Anterior superior Illiac spine d. Patella (lateral view) g. Popliteal crease b.Patella (anterior view)e.Lateral joint line c.Greater trochanter f.Gluteal fold Figure 3B. Histogram of frozen areas (reported as a percentage of patient thigh surface area) experienced by patients for successful NS and US treatments. Av erage freeze area percentage for each treatment protocol are shown.

PAGE 38

36 http://www.cs.amedd.army.mil/amedd_journal.aspxA RANDOMIZED COMPARISON BETWEEN NEUROSTIMULATIONAND ULTRASOUND-GUIDED LATERAL FEMORAL CUTANEOUS NERVE BLOCK visual analog scale (0 cm indicates no pain; 10 cm indi cates worst imaginable pain). For those patients with successful LFCN blocks at 20 minutes, the blinded assessor proceeded to determine the extent of the sensory loss in all directions from the reference point. A mark was made where sensation was deemed to have normalized, and the distribution was transferred to the respective grid (Figure 3). Using wash able markers, the grids were premarked into quartiles (based on length) in all views, and then further subdi vided into eighths. Anteriorly, quartiles were calculated by dividing the distance from the ASIS to superior pa tella into equal fourths, and then further subdivided into eighths with a bisecting line drawn superiorly from the midpoint of the patella. Laterally, the distance from the superior edge of the greater trochanter to the lateral joint line of the knee was divided into quartiles, and then further subdivided into eighths with a bisect ing line drawn superiorly from the mid point of the lateral joint line. Posteriorly, the distance between the gluteal and popliteal folds was divided into fourths, and then fur ther subdivided into eighths with a bisecting line drawn superiorly from the midpoint of the popliteal fossa. SSTa A TISTICa A L ANa A LYSIS We expected similar success rates for both groups. Our research hypothesis was that performance and onset times would be different. Therefore, the main outcome was the total anesthesia-related time (sum of perfor mance and onset times). According to Shannon et al,2 the total anesthesia-related time with NS is 10.14.7 minutes. Using a paired t test to compare both tech effect size of 0.74 and required a total of 17 subjects un dergoing bilateral blocks in order to achieve a 2-tailed total anesthesia-related times can only be calculated success rate with NS, 20 subjects were needed to account for block failure. Because 21 volunteers in quired about study participation, we decided to enroll all 21 subjects. Statistical analysis was performed using SPSS Ver sion 21 statistical software (IBM, Armonk, New sessed with the Lilliefors test and then analyzed us ing a paired t test. Data that did not have a normal distribution, as well as ordinal data, was analyzed us ing Wilcoxons signed ranks or McNemars test. All P values presented were 2-sided and values inferior to .05 For territorial mapping of the LFCN, initial digitization was handled with a digital scanner. We used a combi nation of guided curve detection (as implemented in GraphClick (Arizona-Software.ch, Neuchatel, Switzer gorithm to segment images between FROZEN and UN FROZEN. All images were area-normalized, allowing for comparison between subjects of different physical sizes. Subsequently, images were aligned within one degree. Treatment heat-maps (Figure 3) were generated using Matplotlib (http://matplotlib.org). Statistics for the sensor distribution were computed using the open source python module SciPy (http://scipy.org). RRESULTS All LFCN blocks were performed over a period of 2 days (November 7-8, 2015). Demographic data are presented in Table 1. Both techniques provided simi (162.1-231.3 seconds), onset times (300.0-307.5 seconds), total anesthesia related-times (480.1-554.0 seconds) and procedural pain scores (4.0-4.6). However US required fewer needle passes (3.22.9 vs 9.512.2; P =.009) (Ta ble 2). At 20 minutes, one volunteer (US group) displayed incidental femoral nerve blockade. No statistical differences were detected when compar ing the distribution of sensory loss between US and NS-guided LFCN blocks. The overall average surface area coverage was similar, with normative distribution observed in the available sample size. However consid erable variability was encountered between individuals Table 1. Volunteer CharacteristicsAge (years)40.3 (10.0)Sex (male/female)17/4Body mass index26.7 (3.5)Continuous variables are presented as means (SD). Categorical variables are presented as count. Table 2. Block Performance Data.Ultrasound (N=21)Nerve Stimulation (N=21)P value Imaging time22.5 (19.6) NA NAPerformance time162.1 (125.8) 231.3 (210.9) .138Onset time307.5 (157.8) 300.0 (236.0) .920Total anesthesia-related time480.1 (251.9) 554.0 (366.9) .443Success rate (%)20.0 (95.2) 16.0 (76.2) .125Number of passes3.2 (2.9) 9.5 (12.2) .009Block-related pain (VAS score)4.6 (2.2)4.0 (2.2) .139Incidental femoral block1.0 (4.8) 0 (0) >.999All time variables are in seconds. Continuous variables are presented as means (SD). Categorical variables are presented as count (percentage). NA indicates not applicable; VAS, visual analog scale.

PAGE 39

July September 2017 37 and between the 2 sides of a same subject (Figure 3). The most common areas of sensory loss included the central lateral two-eighths anteriorly and the central antero-inferior three-eighths laterally. CCOmm MM ENT In this randomized trial, we compared NSand USguided LFCN blocks. Our results reveal that both mo dalities result in similar success rates and total anes thesia-related times. We speculate that the lack of inter for brachial plexus, femoral, and sciatic nerve blocks,7-8 For instance, Tran et al9 reported comparable success Fredrickson et al10 found no differences in success rate to a landmark-based deep peroneal nerve block on one side and a US technique on the other, Antonakakis et al11 observed similar sensory and motor block between 20 and 60 minutes. cal variations of the LFCN. Instead of being a singular structure, the latter can divide into multiple branches 12 For these subjects, NS would provide limited success as an end branch and not the parent trunk. Furthermore the LFCN can be found dorsal, ventral, or lateral to the ASIS.13-15 In the event that the nerve is ventral to the latter, subinguinal LA deposition (with US guidance) would result in failure. The technique employed in our US group requires dis cussion. In the literature, most descriptions pertaining prior to targeting it with LA. In contrast, Hara et al5 sim ply used US to inject LA under the inguinal ligament, ventral to the iliopsoas muscle. In 2011, these authors compared their subinguinal method to a nerve-targeting P =.0027).5 Thus, in the current trial, we opted for the subinguinal technique because it represents the best evidence-based option available. Similarly, for the control group, we pur 2The interindividual variability in the sensory distribution of the LFCN has been previously described. Corujo et al16 played a typical territory (lateral thigh without exten sion past the midline of the anterior thigh). However, in LFCN encompassed both lateral and anterior aspects of thigh.16 In 16 patients, Hopkins et al17 found that, after a successful LFCN block, the area of sensory loss was frequently pear-drop shaped with its apex lying over or distal to the greater trochanter and its body extend ing distally and anteriorly towards the knee. However, there existed no region of the thigh that was consistently anesthetized in all 16 subjects.17 ing previous reports by Corujo et al16 and Hopkins et al17 pertaining to interindividual variability, our results also the LFCN can vary within the same individual between right and left lower limbs. out potential differences between NS and US with larger LA volumes. However larger injectates may increase the risk of incidental femoral nerve block, thereby hinder ing the diagnostic value of LFCN block for meralgia (US group) suggests that even volumes as small as 5 mL can result in LA migration from the LFCN to the US subinguinal technique (decreased needle passes) apply solely to LFCN blocks with LA. Neuroablative procedures, such as pulsed radiofrequency, would still or US). Finally, there exists no standard method to de lineate neural sensory distribution. Any mapping tech nique inherently carries a certain amount of imprecision. Nonetheless, future studies could employ 3-dimensional scanning technology to determine the sensory topography for various nerves blocks. In conclusion, US and NS provide similar success rates and total anesthesia-related times for LFCN block. The territory of the LFCN displays wide interand intraindividual variability: the most common distributions in the thigh encompass the central lateral two-eighths anteriorly and the central antero-inferior three-eighths laterally. ACKNOWLEDGEm M ENTS We thank Sgt Ann Dostie, Captain Alex Duong, and administration of this study.

PAGE 40

38 http://www.cs.amedd.army.mil/amedd_journal.aspx RREFERENCES 1. Hui GKM, Peng PWH. Meralgia paresthetica. What an anesthesiologist should know. Reg Anesth Pain Med 2011;36:156-161. 2. S hannon J, Lang SA, Yip RW, Gerard M. Lateral femoral cutaneous nerve block revisited. A nerve stimulator technique. Reg Anesth 1995;20:100-104. 3. N g I, Vaghadia H, Choi PT, Helmy N. Ultrasound cutaneous nerve. Anesth Analg 2008;107:1070-1074. 4. H urdle MF, Weingarten TN, Crsostomo RA, Psimos C, Smith J. Ultrasound-guided blockade of the lateral femoral cutaneous nerve: technical description and review of 10 cases. Arch Phys Med Rehabil 2007;88:1362-1364. 5. H ara K, Sakura S, Shido A. Ultrasound-guided lateral femoral cutaneous nerve block: compari son of two techniques. Anaesth Intensive Care 2011;39:69-72. 6. Ko nrad C, Schupfer G, Wietlisbach M, Gerber H. Learning manual skills in Anesthesiology: is there a recommended number of cases for anesthetic pro cedures?. Anesth Analg 1998;86:635-639. 7. N eal JM, Gerancher JC, Hebl JR, Ilfeld BM, et al. Upper extremity regional anesthesia: essentials of our current understanding, 2008. Reg Anesth Pain Med. 2009;34:134-170. 8. T ran DQH, Clemente A, Finlayson RJ. A review of approaches and techniques for lower extremity nerve blocks. Can J Anesth 2007;54:922-934. 9. T ran DQH, Dugani S, Finlayson RJ. A randomized comparison between ultrasound-guided and land Reg Anesth Pain Med 2010;35:539-543. 10. F redrickson MJ, White R, Danesh-Clough TK. Low-volume ultrasound-guided nerve block pro vides inferior postoperative analgesia compared to a higher-volume landmark technique. Reg Anesth Pain Med 2011;36:393-398. 11. A ntonakakis JG, Scalzo DC, Jorgenson AS, et al. Ultrasound does not improve the success rate of a deep peroneal nerve block at the ankle. Reg Anesth Pain Med 2010;35:217-221. 12. G rothaus MC, Holt M, Mekhail AO, et al. Lateral femoral cutaneous nerve: an anatomic study. Clin Orthop Relat Res 2005;437:164-168. 13. A szmann OC, Dellon ES, Dellon AL. Anatomical course of the lateral femoral cutaneous nerve and its susceptibility to compression and injury. Plast Reconstr Surg 1997;100:600-604. 14. M urata Y, Takahashi Y, Yamagata M, et al. The anatomy of the lateral femoral cutaneous nerve, with special reference to the harvesting of iliac bone graft. J Bone Joint Surg Am 2000;82:746-747. 15. Kosiyatrakul A, Nuansalee N, Luenam S, Koon chornboon T, Prachaporn S. The anatomic varia tion of the lateral femoral cutaneous nerve in rela tion to the anterior superior iliac spine and the iliac crest. Musculoskelet Surg 2010;94:17-20. 16. C orujo A, Franco CD, Williams JM. The sen sory territory of the lateral cutaneous nerve of the thigh as determined by anatomic dissections and ultrasound-guided blocks. Reg Anesth Pain Med. 2012;37:561-564. 17. H opkins PM, Ellis FR, Halsall PJ. Evaluation of lo cal anaesthetic blockade of the lateral femoral cuta neous nerve. Anaesth 1991;46:95-96. AUTHORS Dr Gupta, a physiatrist, works with the Canadian Forces Health Services Centre-Ottawa and the Alan Edwards Pain Management Unit of the Department of Anesthesia, Montreal General Hospital. He is also an Adjunct Profes sor at McGill University in Montreal, Quebec. Dr Radhakrishna is with the Division of Physical Medi cine and Rehabilitation, Department of Medicine and the Alan Edwards Pain Management Unit of the Department of Anesthesia, Montreal General Hospital. He is also an Associate Professor at McGill University in Montreal, Quebec. search Council of Canada. He is also an Assistant Pro fessor of Physics at the University of Ontario Institute of Technology, Oshawa, Ontario. Dr Tran is with the Department of Anesthesia, Montreal General Hospital. He is also an Associate Professor at McGill University in Montreal, Quebec. LCol Besemann, a physiatrist, is head of the Canadian Forces physical rehabilitation program at the Canadian Forces Health Services Group Headquarters in Ottawa. He also works at the Canadian Forces Health Services Centre and is a lecturer at the University of Ottawa. Dr Thonnagith is a Fellow in the Department of Anesthe sia, Montreal General Hospital, and now staff within the Faculty of Medicine, Chulalongkorn University, Thailand. Dr Elgueta is a Fellow in the Department of Anesthesia, MCpl Robitaille is with the Canadian Forces Health Ser vices Centre-Ottawa, Ontario. Dr Finlayson is an anesthesiologist with the Alan Edwards Pain Management Unit of the Department of Anesthesia, Montreal General Hospital. He is also a Pro fessor at McGill University in Montreal, Quebec.A RANDOMIZED COMPARISON BETWEEN NEUROSTIMULATIONAND ULTRASOUND-GUIDED LATERAL FEMORAL CUTANEOUS NERVE BLOCK

PAGE 41

July September 2017 39Total knee arthroplasty (TKA) is a commonly performed procedure proven to provide functional improvement and pain relief for most patients with advanced knee arthritis.1 Although outcomes of total knee replacement are typically excellent, up to 20% of patients continue to have postoperative pain, functional limitations, and low treatment satisfaction.2-4 Postoperative health-relat ed quality of life and patient satisfaction is now a key goal of surgery and important measure of operative outcomes.5 Quadriceps activation has been shown to be negatively affected following TKA and its function has been directly correlated with outcomes.6-8 Postoperative quadriceps strength in order to improve postoperative pain and functional outcomes.6 (BFR) training is a form of exercise that uses brief peri load resistance training to improve muscular strength and endurance. These loads are typically 20% to 30% of a patients single repetition maximum.7-8 This tech nique has been used with promising results in a wide spectrum of patients, from high intensity athletes to the elderly.8-12 Occlusion training has recently gained in creased attention in the rehabilitation community where earlier, faster rehabilitation.9-10 We present 3 cases of ac tive patients with a primary diagnosis of osteoarthritis who underwent primary TKA and participated in BFR training as part of their postoperative rehabilitation. MATERIALS AND METHODS ing surgeon to participate in BFR training as an adjunct to their standard physical therapy. Patients were given the opportunity to participate in these therapy adjuncts at the suggestion of their operating surgeon following postoperative rehabilitation and restoration of adequate range of motion as determined by the operating surgeon. Patients participated in BFR training 3 times a week, during which each person was asked to perform leg ex tension, leg press, and reverse press during each session under occlusion conditions. The weight was determined based on that individuals one-repetition maxium (1RM). This was calculated by performing a warm-up at 50% of the predicted 1RM, followed by an attempt at an 80% load. If successful, after a one minute rest, the patient re peated the exercise at the same load for as many repeti of 80% was unsuccessful, the weight was decreased, and the process repeated. Each exercise was repeated after one minute of rest. Tourniquet pressure was set at 80% of the limb occlusion pressure. This was determined by was lost using an ultrasound probe. Tourniquet pressure averaged between 100 and 150 mmHg for the 3 patients. Each exercise was performed in 4 sets, with each set to failure, and a 30-second rest between sets. When the Occlusion Training: Pilot Study for Postoperative Lower Extremity Rehabilitation Following Primary Total Knee Arthroplasty C apt Christopher L. Gaunder, USAF, MC C PT Michael P. Hawkinson, MC, USA C PT David J. Tennent, MC, USA C OL Creighton C. Tubb, MC, USA AABSTRACT With continued emphasis on the value of healthcare, factors such as quality of life and patient reported out comes are critical in evaluating high-demand procedures such as knee replacement surgery. Equally important are generally considered excellent; however, many patients continue to have postoperative pain, functional nous tourniquet that stimulates local changes in muscle at low resistance. Herein we report on 3 patients who participated in BFR exercises as an adjunct to their normal physical therapy following total knee arthroplasty.

PAGE 42

40 http://www.cs.amedd.army.mil/amedd_journal.aspxpatient was able to perform any one set for more than 120 seconds before muscle failure, the weight for that At no time did the occlusion training proceed for greater than 30 minutes consecutively. Isokinetic muscle testing was performed at the baseline evaluation and at the conclusion of each patients physi cal therapy period using a Biodex System 3 isokinetic dynamometer (Biodex Medical Systems, Inc, Shirley, NY 11967). For each patient, peak torque was calculated as a measure of maximum strength attained throughout the range of motion. Total work, a measure of muscular endurance, was calculated as the amount of work per formed throughout the range of motion. These measure ments were taken at 90 degrees/second of both exten RRESULTS Case 1A 44-year-old male with left knee pain and radiographic osteoarthritic changes to his medial and patellofemoral compartments with neutral alignment underwent an un complicated primary cruciate retaining TKA. Following examination and radiographic work-up, he underwent a course of nonoperative treatment for his osteoarthritis that failed to provide satisfactory long-term relief. As such, he was indicated for a left total knee arthroplasty. Six weeks following his procedure, his pain was well controlled. He had appropriate wound healing and re gained his range of motion although he had persistent with his children, and continue to serve in his role as an active duty service member in the Army. After partici degrees/second as shown in Figure 1.Case 2 ity-limiting chronic right osteoarthritic knee pain that failed nonoperative treatment modalities. Radiographs degenerative changes of the patellofemoral articulation with a 7 degree varus deformity. The patient underwent primary cruciate retaining TKA followed by our routine postoperative physical therapy program. However, 4-months postoperatively he expressed apprehension in returning to his job as a patrolman due to his continued quadriceps weakness and resultant functional disability. He was subsequently enrolled in a BFR training regi men that included leg extensions, leg press, and stand ing reverse leg press to improve his quadriceps strength was able to return to his work related activities.Case 3A 60-year-old male presented with chronic right knee pain that limited his abilities to perform activities of daily living. Radiographs demonstrated tricompart mental osteoarthritis, most severe in medial joint space OCCLUSION TRAINING: PILOT STUDY FOR POSTOPERATIVE LOWER EXTREMITY REHABILITATION FOLLOWING PRIMARY TOTAL KNEE ARTHROPLASTYFigure 1. Case 1 change in peak torque achieved at 90 de grees/second following 8 training. Peak Torque in Flexion Peak Torque in Extension 10 20 0 30 40 50 60 80 70 90Foot-pounds Uninvolved Limb Involved Limb (initial) Involved Limb (final) Figure 2. Case 2 change in peak torque demonstrated at 90 degrees/second following 8 training. 20 0 40 60 80 100 140 120 160Foot-pounds Peak Torque in Flexion Peak Torque in Extension Uninvolved Limb Involved Limb (initial) Involved Limb (final)

PAGE 43

July September 2017 41 narrowing and a 7 degree varus deformity. He subse quently failed nonoperative treatment and was indicated for a primary cruciate retaining TKA. His course was complicated by limited range of motion postoperatively. He was indicated for manipulation under anesthesia 20 days after his index procedure. His range of motion was month after his manipulation, he was referred to physi cal therapy for BFR due to continued inability to regain his quadriceps strength. After participating in 8 weeks of BFR training, he experienced an increase in peak degrees/second as shown in Figure 3. COMMENT In this case series, we report data on 3 patients who un derwent total knee arthroplasty and had postoperative of quadriceps weakness. All 3 patients had persistent weakness despite being enrolled in our standard post operative physical therapy regimen which emphasizes range of motion and quadriceps strength. After partici pation in an 8-week program of BFR training, all 3 had objective improvements in their quadriceps strength and in all 3 cases exceeded the peak torque measurements of their uninvolved limb as measured prior to initiation of the use of BFR therapy following total knee arthroplasty. As mentioned previously, quadriceps weakness fol lowing total knee arthroplasty is well described in the literature. Mizner et al13 demonstrated a 62% decrease from 10 days preoperative to 27 days postoperatively, and other studies have shown decreased strength com pared to healthy controls at time points out to 2 years postoperatively.14,15 These studies suggest that the weak ness is pervasive throughout the full arc of motion of the knee and strength oftentimes never fully reassumes its preoperative level. To demonstrate the importance of this weakness, clinical studies have documented a positive correlation between quadriceps strength and scoring on multiple validated patient-reported outcome measures.15-17 Given this information, there is certainly a role for novel rehabilitation tactics that improve our ability to rehabilitate postoperative muscle weakness. tion has been shown to elicit substantial increases in muscle mass and strength. While the exact mechanism of action is not yet fully understood, studies suggest that following BFR training there are increased levels of anabolic growth hormones and increased activation muscle hypertrophy and proliferation of myogenic stem cells.7,18-20 Further research is required to determine the therapy results in physiologic changes when compared to standard resistance training. While there were no adverse events related to therapy in our series, the sample was too small to support any to 6 weeks postoperatively in any patient as the effect of BFR training on wound healing is unknown. The most catastrophic adverse events described in the literature related to BFR training are deep venous thrombosis (DVT), pulmonary embolism, rhabdomyolysis, and ex acerbation of ischemic heart disease, all of which occur at less than 1% in the literature.21 Another study looking ther demonstrated that there we no increases in hemato logic clotting factors after BFR training.22 Furthermore, although literature has demonstrated that intraoperative occlusive tourniquet use has been associated with de creased quadriceps function postoperatively, the pres cantly lower than those used in these studies.23A major limitation of this series is the lack of patientreported outcomes measurements recorded before and ing and lack of a comparison population. Further clini cal studies utilizing validated patient-reported question naires in addition to functional outcome measures would allow for a more accurate comparison assessing both the shortand long-term consequences of knee injury and restriction training in the postoperative period. Fur ther studies with larger cohorts should be undertaken Figure 3. Case 3 change in peak torque demonstrated at 90 degrees/second following 8 training. Peak Torque in Flexion Peak Torque in Extension 20 0 40 60 80 100 120Foot-pounds Uninvolved Limb Involved Limb (initial) Involved Limb (final)

PAGE 44

42 http://www.cs.amedd.army.mil/amedd_journal.aspx to better characterize these risks. Furthermore, as this tive treatment recommendations. Larger clinical studies occlusion training following primary TKA. Possible areas for future research would also include the use of BFR training preoperatively as preoperative quadriceps strength has also been associated with better postoperative outcomes.24 Lastly, as we recognize the potentially devastating complications associated with wound heal ing complications, this intervention should be used with caution in the acute postoperative period and only in those patients with uncomplicated postoperative courses. This series represents our early success using BFR train ing for postoperative TKA patients. While we recognize the limitations of this series, we believe that BFR training may provide patients the opportunity to regain their strength more quickly and completely, and potentially decrease their total duration of physical therapy. Further investigation into this therapeutic modality is clearly warranted. RREFERENCES 1. Dahm DL, Banes SA, Harrington JR, Sayeed SA, Berry DJ. Patient-reported activity level after total knee arthroplasty. J Arthroplasty 2008;23(3):401-407. 2. J ain NB, Higgins LD, Ozumba D, et al. Trends in epidemiology of knee arthroplasty in the United States, 1990-2000. Arthritis Rheum 2005;52(12):928-3933. 3. S han L, Shan B, Suzuki A, Nouh F, Saxena A. In termediate and long-term quality of life after total knee replacement, a systematic review and metaanalysis. J Bone Joint Surg Am 2015;97(2):156-168. 4. B rander VA, Stulberg SD, Adams AD, Harden RN, Bruehl S, Stanos SP, Houle T. Predicting total knee replacement pain: a prospective, observational study. Clin Orthop Relat Res 2003;416:27-36. 5. S hi HY, Mau LW, Chang JK, Wang JW, Chiu HC. Responsiveness of the Harris Hip Score and the SFQual Life Res 2009;18(8):1053-1060. 6. M eier W, Mizner RL, Marcus RL, Dibble LE, Pe ters C, Lastayo PC. Total knee arthroplasty: muscle impairments, functional limitations, and recom mended rehabilitation approaches. J Orthop Sports Phys Ther 2008;38(5):246-256. 7. C ook SB, Clark, BC, Ploutz-Snyder LL. Effects skeletal muscle function. Med Sci Sports Exerc 2007;39(10):1708-1713. 8. I ida H, Nakajima T, Kurano M, et al. Effects of compliance in elderly subjects. Clin Physiol Funct Imaging 2011;31(6):472-476. 9. A be T, Sakamaki M, Fujita S, et al. Effects of lowintensity walk training with restricted leg blood older adults. J Geriatr Phys Ther 2010;33(1): 34-40. 10. L oenneke JP, Kearney ML, Thrower AD, Collins S, Pujol TJ. The acute response of practical occlu sion in the knee extensors. J Strength Cond Res 2010;24(10):2831-2834. 11. P ope ZK, Willardson JM, Schoenfeld BJ. Exercise J Strength Cond Res 2013;27(10): 2914-2926. 12. S tevens JE, Mizner RK, Snyder-Mackler L. Quad riceps strength and volitional activation before and after total knee arthroplasty for osteoarthritis. J Orthop Res 2003;21:775-779. 13. M izner RL, Petterson SC, Stevens JE, Vanden borne K, Snyder-Mackler L. Early quadriceps strength loss after total knee arthroplasty: the contributions of muscle atrophy and failure of vol untary muscle activation. J Bone Joint Surg AM 2005;87(5):1047-1053. 14. M izner RL, Stevens JE, Snyder-Mackler L. Volun tary activation and decreased force production of the quadriceps femoris muscle after total knee ar throplasty. Phys Ther 2003;83(4):359-365. 15. S ilva M, Shepherd EF, Jackson WO, Pratt JA, McClung CD, Schmalzried TP. Knee strength after total knee arthroplasty. J Arthroplasty 2003;18(5):605-611. 16. Y oshida Y, Mizner RL, Ramsey DK, SnyderMackler L. Examining outcomes from total knee arthroplasty and the relationship between quad riceps strength and knee function over time. Clin Biomech 2008;23(3):320-328. 17. M izner RL, Petterson SC, Snyder-Mackler L. Quadriceps strength and the time course of func tional recovery after total knee arthroplasty. J Or thop Sports Phys Ther 2005;35(7):424-436. 18. N eilsen JL, Aagaard P, Bech RD, et al. Proliferation of myogenic stem cells in human skeletal muscle in response to low load resistance training with blood J Physiol 2012;590(17):4351-4361. 19. restriction during low-intensity resistance exercise increases S6K1 phosphorylation and muscle pro tein synthesis. J Appl Physiol 2007:103(3):903-910. 20. F ry CS, Glynn EL, Drummond MJ, et al. Blood naling and muscle protein synthesis in older men. J Appl Physiol 2010;108(5):1199-1209.OCCLUSION TRAINING: PILOT STUDY FOR POSTOPERATIVE LOWER EXTREMITY REHABILITATION FOLLOWING PRIMARY TOTAL KNEE ARTHROPLASTY

PAGE 45

July September 2017 43 21. Nakajima T, Kurano M, Iida H, et al. Use and safety of KAATSU Training: results of a national survey. Int J Kaatsu Training Res 2006;2:5-13. 22. M adarame H, Kurano M, Takano H, et al. Effects of low intensity resistance exercise with blood healthy subjects. Clin Physiol Funct Imaging 2010; 30(3):210-213. 23. S aunders KC, Louis DL, Weingarden SI, Waylo nis GW. Effect of tourniquet time on postopera tive quadriceps function. Clin Orthop Relat Res 1979;143:194-199. 24. M izner RL, Petterson SC, Stevens JE, Axe MJ, Snyder-Mackler L. Preoperative quadri ceps strength predicts functional ability one year after total knee arthroplasty. J Rheumatology 2005;32(8):1533-1539. AUTHORS Capt Gaunder is an Orthopaedic Surgery Resident at the Brooke Army Medical Center, San Antonio Military Medical Center, JBSA-Fort Sam Houston, Texas. CPT Hawkinson is an Orthopaedic Surgery Resident at the Brooke Army Medical Center, San Antonio Military Medical Center, JBSA-Fort Sam Houston, Texas. CPT Tennent is an Orthopaedic Surgery Resident at the Brooke Army Medical Center, San Antonio Military Medical Center, JBSA-Fort Sam Houston, Texas. COL Tubb is a staff Orthopaedic Adult Reconstruction Surgeon at the Brooke Army Medical Center, San Anto nio Military Medical Center, JBSA-Fort Sam Houston, Texas.

PAGE 46

44 http://www.cs.amedd.army.mil/amedd_journal.aspx challenges to training and equipping Soldiers for mili tary operations. Rarely are large numbers of Soldiers and their equipment marched over great distances rely ing upon the physical endurance of the troops to reach strategic objectives. Since the onset of hostilities follow ing the attacks of September 11, 2001, military engage ments have involved Soldiers transported to and from the area of combat operations by personnel carriers or aircraft with their success and survival far more depen dent on individual speed, strength, and tactical agil ity than upon their 2-mile run time. In addition to the changing physical demands of modern warfare, increas tempo have driven military leadership to question both the effectiveness and cost of current physical training methods. A number of studies have demonstrated high rates of overuse injuries associated with the long-dis tance marching within our initial entry trainees, further adding to the cost of basic training, delaying combat readiness, and causing the discharge of a number of recruits before they reach their operational unit. Inter national studies have demonstrated that decreased running mileage can have a profound effect on the number among trainees.1 Given the disproportionately high rate cation to current training methods is necessary to fully accomplish current advances in the integration of wom Soldiers in todays military engagements must be equipped with speed, strength, and agility, which are primarily anaerobic functions. Additionally, Soldiers must have middle-distance running and strength en duranceprimarily aerobic functions. Thus, a fully obic and aerobic. The reality of the changing physical demands placed on Soldiers and the legitimate short comings of traditional endurance training suggests further advances, applicable for austere environments, are needed in the current methods of physical training across the military. Recent data suggests these requirements can be met us ing martial arts-based high intensity internal training both extremity and core muscle strength with minimal resource needs in an environment that fosters esprit-dewithout impeding strength gains when combined with resistance strength training. Though there are a number of recognized safety concerns with martial arts, vari ous safety precautions can be taken to mitigate the risk of injury to apply this type of physical training broadly across the military. Integrating martial arts into HIIT way to train both basic trainees and operational military units to meet the high demands of present-day military operations. This article highlights the known risks and tensity interval training program for consideration to be HHIGH I INTENSITY I INTERVa A L T TRa A INING High intensity interval training has become a wellknown and well-studied method of improving cardio pulmonary and skeletal muscle function with several training, integrating it into a variety of different athletic activities. Additional research has broadened the use of HIIT by modifying workouts to achieve activity-specif ic outcomes all along the aerobic-anaerobic spectrum. The training consists of repeated short (less than 45 seconds) to long (2 to 4 minute) bouts of rather highintensity exercise interspersed with recovery periods.2 Optimal cardiovascular and peripheral tissue adaptions are believed to occur when the athlete is performing at or close to their VO2max over long periods of time. This can be achieved through a variety of different exercises, including short-distance sprints, stationary or road cy not limited to physiologic and metabolic function, as workouts are commonly much shorter in duration than Martial Arts-Based High Intensity Interval Training as a Component of Warfighter Rehabilitation and Tactical Athlete Fitness C apt Gavin L. Mills, USAF, MC C OL Anthony E. Johnson, MC, USA

PAGE 47

July September 2017 45traditional lower-intensity, high-volume workouts, sav ing both time and money for participants.2,3 MIXED MaA RTIa A L ARTS Mixed martial arts (MMA) is a sport derived from a mixture of modern and traditional combat sports that incorporates punches and kicks from western boxing, kick-boxing, and muay thai, stand-up grappling from judo, Greco-Roman and freestyle wrestling, and ground admixture of various combat sport traditions grew in popularity under a variety of different names, including and mixed martial arts. The physical requirements of MMA are characterized by high-intensity and explosive movements over short time intervals combined with the strength and power of the contenders to deliver high velocity blows and control or grapple their opponents to achieve dominant positioning and submission holds. minutes each. The winner is decided by knockout, tech nical knockout, or submission; or the judges decides the winner if time runs out.4,5 As the sport has grown in popularity, the use of MMA-based workouts has also sparring, integrated with HIIT that we hereafter refer to as martial arts-based high intensity interval training (MA-HIIT). DDRa A WBa A CKS TO I ImM PLEm M ENTING MaA RTIa A L ARTS-B BaA SED H HIGH I INTENSITY I INTERVa A L T TRa A INING P PROGRam AM S across the military would come with a number of rec ognized risks, some of which are presented in Table 1. Prominent members within the sports medicine community have long voiced concerns over the safety of martial arts overall and western boxing in particular.6,12 Some have argued that the sole intent of boxing is to is immoral violence.12 In truth, there is evidence to support the premise that professional boxers do suffer tests.8 ability of mixed martial arts, this opposition has since calls for reform in the American Medical Associations position on such sports.13Given the rise in popularity and involvement of a wide range of ages, physicians have taken a closer look at the risks associated with the sport. Studies of tournamenthave evidence of head and neck injury, as well as frac tures and one reported fatality.14 With the exception of cutaneous hematomas and bruising, musculoskeletal in juries are the most common type of injury seen in MMA 9 Given that there is a broad range of martials arts forms and styles, each with varying degrees of intensity and contact, coupled with the fact that many martial artists never compete in tournaments, Zetaruk et al10 compared the injuries in different types of popular martial arts during both periods of normal training and tournament competition. Their results demonstrate the obvious correlation between the degree of contact and injury severity among martial arts. Taekwondo, for example, portrayed a 3-fold increase in risk of injury than Shotokan karate (a low-impact form of karate) and Tai chi, which has no opponent present, confers a very minimal risk of injury even though many participants are about the age of 65. In the context of normal practice and interspersed tournament play, martial artists sus of students in tai chi.10 They also found that participants who had been practicing for 3 or more years and were aged 18 years or older had a higher risk of sustaining injury, indicating that more experienced and stronger fused with low contact martial arts would require mea sured risk analysis with reasonable preventive measures THE ARMY MEDICAL DEPARTMENT JOURNAL Table 1 published in the literature.Reference Summary Lundberg6Boxing is dangerous and immoral. Weisenthal et al7CrossFit participants showed 20% injury rate, most commonly of the shoulder, lower back and knee. Decreased injury rates seen when trainer present. Casson et al887% of boxers in study demonstrated signs of brain injury on at least 2 different neurophysi ological studies. James9Besides bruising and cutaneous hematomas, muscle and joint injury are the most common type of injury in MMA. Zetaruk et al10There is a threefold greater risk of injury in tae kwondo than in Shotokan karate. There is a decreased number of injuries in MA participants less than 18 years old and an increase risk of injury in participants with greater than 3 years of experience. Bergeron et al11CrossFit may be associated with increased risk of rhabdomyolysis, overuse injuries, muscle strain, ligamentous injury, and stress fractures.

PAGE 48

46 http://www.cs.amedd.army.mil/amedd_journal.aspxto address known injury risks and widespread concerns about the implications of martial arts and western boxing. variety of extreme conditioning programs (ECP) such as CrossFit, P90x and Insanity that are similar in intensity to MA-HIIT. A number of concerns have been voiced regarding such programs due to the relative intensity of the workouts. In 2011, the Consortium for Health and Military Performance and American College of Sports Medicine consensus paper on extreme ECPs among military personnel states that ECPs may be associated with increased risk of rhabdomyolysis, overuse injuries, muscle strain, ligamentous injury, and stress fractures.11 Another survey of CrossFit athletes showed that the most common injuries were to the shoulder, low back, 15 These data give reason to implement preventive measures to mitigate the risk of injury possible in MA-HIIT that are discussed later in this review. Martial arts have grown in popularity in the western petitive sports with appeal across a broad age-range for both sexes. As physicians are charged with oversight of our societys medical wellbeing, there are a number of reasons for medical professionals to have measured concern with the promotion of combat sports and high type of training as well as an expansive discussion of methods to mitigate known risks must also be consid analysis of such training. BBENEFITS OF aA H HIGH I INTENSITY I INTERVa A L T TRa A INING P PROGRam AM There are several well-studied advantages to both mar tial arts and HIIT, some of which are presented in Table 2. We suggest that integrating martial arts-based exer to create an optimized training program for the unique observed cardiovascular and metabolic improvements, injury prevention rates, increased team building within participants, and the low relative costs of these regimens. A number of studies have investigated the functional per formance outcomes of HIIT in variety of settings. HIIT has been shown to increase VO2max and O2 consump tion and improve exercise-induced cardiac output, trans lating to improved overall exercise performance.16,17,19 Much of the enthusiasm for HIIT in the physical training community stems from the possibility to decrease adap tive interference when improvement in both aerobic and anaerobic function is desired. Many experts hold that muscle hypertrophy, strength, and power from resistance training (ie, low-repetition, heavy-weight lifting) are in hibited with high-volume endurance training (ie, longdistance jogging or cycling).18,38 Thus, in the context of both power and endurance, this dynamic would create a tradeoff between these 2 metrics of performance. Es sentially, the Soldier can either be relatively weak with high long-distance endurance or strong with relatively low long-distance endurance. A study by Laird et al18 re cently challenged this theory. Twenty-eight recreation ally active women were enrolled in either a concurrent sprint interval and resistance training (CST) group or a control group of resistance training (RT) alone. The re in one repetition max back squat, maximal isometric force, average peak anaerobic power testing, and zero incline treadmill velocity. More importantly, the results showed no evidence of interference of strength adapta tions in the CST group and simultaneous improvements in both anaerobic and aerobic function when HIIT and resistance training are used concurrently.18 Smith et al17 further validated the aerobic improvements achieved by HIIT in a group of men and women subjects who under went a 10-week cycle of high intensity power training. Metabolic improvements in HIIT have been demonstrat ed in a number of studies investigating cellular adaptations explaining functional gains in both strength and en durance. Burgomaster et al20 observed an increase in the maximal activity of citrate synthase leading to increased muscle oxidative potential and twice the endurance ca pacity in cyclers who performed 6 sessions of 15-minute sprint cycling over a 2-week time period. These data demonstrate that workouts consisting of intense, short endurance capacity and muscle oxidative potential at or above that of long-distance aerobic training regimens over similar time periods. Additionally, Ni Cheilleachair et al21 observed similar results in a group of competitive in addition to baseline aerobic exercise, demonstrates improved endurance performance in rowers and is more effective than slow-paced, long-distance training at improving associated aerobic physiological variables including power output and lactate threshold. Investiga tion by Gibala and McGee22 showed that a short-term HIIT program produced marked increases in oxidative enzyme expression, oxidative capacity, improved endur ance capacity, and changes in carbohydrate metabolism that are comparable to traditional endurance training with a fraction of the training time. Research has also extended beyond exercise science demonstrating even MARTIAL ARTS-BASED HIGH INTENSITY INTERVAL TRAINING AS A COMPONENT OF WARFIGHTER REHABILITATION AND TACTICAL ATHLETE FITNESS

PAGE 49

July September 2017 47 broader effects of HIIT programs. Cho et al23 saw an im provement in whole-body insulin resistance associated with obesity in laboratory mice after exposing them to HIIT regimens. Richards et al24 saw similar results in a test group of healthy adults after 2 weeks of sprint inter val training. Drigny et al looked at the effect of HIIT on patients with metabolic syndrome. Improvements were seen in a number of physiologic metrics associated with metabolic syndrome including body mass index (BMI), waist circumference and a decrease in echocardiogram QT dispersion parameters which has been hypothesized to be associated with metabolic syndrome secondary to hyper-sympathetic nervous syndrome at baseline.25 BBENEFITS OF MaA RTIa A L ARTS The focus on posture, balance and mind-body control has demonstrated a variety of both emotional and physi al26 studied the effects of a regimented treatment pro gram of noncontact taekwondo movements on a group Table 2Reference Summary Coswig et al5MMA sparring matches achieve moderate to high intensity, yet promote only low to moderate muscle damage or inflammation based on serum levels of creatinine kindase, IgA, glucose, and cortisol. Hwang et al168-week HIIT program is associated with improvement in cardiac ejection fraction which was positively related to exercise-induced improvements in peak 02 consumptions. Smith et al17High intensity power training caused increased VO2max and aerobic fitness. Laird et al18HIIT does not interfere with strength adaptations while improving aerobic fitness. Astorino et al19HIIT regimens increase VO2max which is related to an increase in cardiac output. Burgomaster et al202 weeks of HIIT showed increased citrate synthase maximal activity and doubled endurance capacity during cy cling exercise at 80% VO2max. Ni Cheilleachair et al21HIIT performed twice weekly in addition to aerobic exercise demonstrates improved endurance performance in rowers and is more effective than long, slow-distance training at improving associated aerobic physiological variables including power output at lactate threshold. Gibala and McGee22Short-term high-intensity interval training shows marked increase in oxidative enzyme expression, improved oxi dative capacity, improved endurance capacity and changes in carbohydrate metabolism that are comparable to traditional endurance training with a fraction of the training time. Cho et al23HIIT regimen in mice alleviates whole body insulin resistance associated with obesity. Richards et al2416 minute sessions of very high-intensity, sprint interval exercise training distributed over 2 weeks increased insulin sensitivity. Drigny et al25HIIT regimens in patients with metabolic syndrome was associated with decreased BMI, reduced waist circumfer ence, and decreased QTd EKG parameters. Byun et al26Basic taekwondo movements are associated with statistically significant improvements in childrens posture. Bu et al27Tai Chi studies have demonstrated stress reduction, improved agility and balance, posture control, lower extrem ity strength improvement and decreased musculoskeletal decline seen in aging individuals. Yan et al2812-week Tai Chi regimen is associated with clinically significant improvements in pain, stiffness, and physical function in patients with knee osteoarthritis. Yang et al29Tai Chi shows beneficial effects by improving motor function, balance, and functional mobility in people with Par kinsons disease compared to other active therapies. Woodward30Martial arts are likely associated with decreased number of falls in elderly, improved relaxation, self-esteem, mind-body coordination, decreased depression and sleep disruption, increased self-esteem in cancer patients, and possibly an adjuvant therapy for symptom control in ADHD patients. Tong et al31Core muscle strength improvements are associated with improved endurance running performance. Jones et al32Amount of unit training in terms of running distance and amount of weight-bearing physical training was associ ated with increased risk of over-use injury. Santtila et al33HIIT would be an effective method of training recruits because of observed aerobic improvements and low injury rates compared to traditional methods. Hak et al34Injury rates similar in CrossFit as Olympic weight lifting, power lifting, and gymnastics. Shoulder and spine injuries are the most common. No incidences of rhabdomyolysis Poston et al35There is no increased risk of rhabdomyolysis in CrossFit/HIFT participants compared to long distance running. Dibble et al36HIIT consisting of resistance training produces increased muscle volume, muscle force, and functional status in Parkinsons disease patients when compared to standard exercise programs. Dibble et al37High intensity eccentric resistance training improves muscle force, bradykinesia, and quality of life in Parkinsons disease patients to a greater degree than standard exercise programs.

PAGE 50

48 http://www.cs.amedd.army.mil/amedd_journal.aspxdemonstrating the effect of martial arts training on core muscle strengthening. Tia chi, a no-contact, no-oppo nent style of martial arts often practiced by a wide range of ages including the elderly, has been associated with improved agility and balance, posture control, and lower extremity strength improvement and has been associ ated with decreased musculoskeletal decline in aging individuals.27 A meta-analysis of the effects of a 12-week regimen of tai chi in patients with symptomatic knee osteoarthritis showed improvement in pain, stiffness, and physical function.28 The effect of tai chi on neuro degenerative processes and balance in the elderly has tion, balance, and overall functional mobility in people with Parkinsons disease when compared to other active therapies.29 Woodward et al30 further studied the broad effects of martial arts on health status, suggesting that martial arts are likely associated with decreased num ber of falls in the elderly, relaxation, mind-body coor dination, decreased depression and sleep disruption, in creased self-esteem in cancer patients, and possibly an adjuvant therapy for symptom control in patients with seen in patients practicing martial arts, especially in tai chi studies, further investigation is needed to determine Even without such available data, the evidence presented by the studies cited above clearly supports the potenhealth improvements for a variety of patients. BBENEFITS OF aA MaA RTIa A L ARTS-B BaA SED H HIGH I INTENSITY I INTERVa A L T TRa A INING P PROGRam AM The integration of martial arts-based workouts into onstrated in the literature for both martial arts and HIIT. Tong et al31 studied the effect of core muscle strengthen ing in addition to HIIT on endurance running economy, showing that the addition of core strengthening exercises, such as MA-HIIT, can add to the aerobic improvements seen in HIIT. Coswig et al5 used time-motion responses and biological parameters of fatigue and physiological stress to characterize the effect of athletes participating They found that MMA sparring achieves moderate to high intensity yet only low to moderate muscle damage kinase, IgA, glucose, and cortisol. These data show further supports the hypothesis that martial arts-based drills and sparring are a practical method to achieve the level of intensity required for HIIT. When compared to traditional methodology of training military personnel, MA-HIIT provides an effective manner by which to prepare Soldiers for the demands of modern warfare, decreases overuse injuries, and substantially lowers the cost of preliminary military training. Several authors have detailed the physical 39-41 Mala et al39 described the anaero high-intensity combat activities such as moving under Operation Enduring Freedom, troops were often trans ported with personnel carriers or airborne insertion. This is in sharp contrast to traditional warfare where in fantry Soldiers had to travel on foot over long distances while carrying their personal equipment and weapons to wage assaults. Once inserted into in an objective, Soldiers today perform anaerobic bursts of sprinting, climbing, pulling, or crawling while carrying a large amount of heavy gear. Turner et al40 suggests that HIIT combined with strength and power training and decreas ing running volume would deliver the results needed realized in the way Soldiers are physically trained in preparation for deployments. The dynamics of modern warfare necessitate a training program that develops an aerobic total body power and explosiveness while main taining the cardiovascular capacity to support it.38,39In addition to the evolving demands of modern warfare, the recent advances taken to integrate women into com modate the exercise physiology unique to women. Wom en, on average, have lower body mass, lower bone mass, greater body fat, and less lean body mass then men. Due to the low levels of circulating testosterone, women have less muscle mass and smaller ratio of fast twitch to capacity of women is further limited by smaller hearts, less circulating intravascular volume, and lower hemo globin than men.42 Even in the context of such physi ologic challenges to optimizing the female tactical ath lete, several studies demonstrate that strategic strength the sex-based differences in physical performance.43-45 Kraemer et al44 demonstrate that periodical resistance MARTIAL ARTS-BASED HIGH INTENSITY INTERVAL TRAINING AS A COMPONENT OF WARFIGHTER REHABILITATION AND TACTICAL ATHLETE FITNESS

PAGE 51

July September 2017 49 ference in men and women. Additionally, they dem proved functional strength such as repetitive box lifts. and concurrent resistance training, MA-HIIT would facilitate both muscular hypertrophy and improve func tional strength to optimize the capability of women to 43,44One of the strongest factors catalyzing change in mili tary training across several nations is the rate of injuries seen in traditional training methods consisting of large volume endurance exercises (ie, long-distance running or marching) and the associated high cost of these injuries.46 In 1993, Jones et al32 studied the epidemiology which were overuse injuries (stress fractures, Achil les tendonitis, or patellofemoral syndrome). More im portantly, they found that the amount of unit training in terms of running distance was positively correlated with overuse injury. Later, in 2001, Knapik et al47 ex respectively and that women were twice as likely to sus tain training-related injuries as men. It was previously thought that encouraging pretraining in recruits would reduce the large number of overuse injuries seen in basic trainees. Swissa et al48 explored this theory and found that no correlation existed between pre-basic training ac tivity and the number of stress fractures reported. This further highlights the need for high-quality, evidencebased training programs in the military. Even among highly trained Naval Special Warfare Sea, Air, and Land (SEAL) operators that routinely engage in high-risk, tac cur during physical conditioning.49 In the face of these high injury-rates, HIIT has been recognized as an ade quate method to train basic trainees primarily due to the decreased rates of injury as well as the positive effect on 33 In summary, the high rates of overuse and musculoskeletal injuries in both basic trainees and special operations force units would be decreased while increasing physical performance by implementing MAHIIT into military physical training programs. The ability to actually address the well-known causes of ed, yet there have been several studies demonstrating effective techniques to do so if implemented appropri ately. Chalupa et al46 found that Soldiers participating in the Army physical readiness program (APRP) had reduced overuse and musculoskeletal injuries including tarsal bone and femoral neck stress fractures. The pri mary differences in the APRP from traditional training is a decreased amount of long-distance endurance run ning and integration of interval training. Additionally, researchers found that the Israeli military was able to reduce high rates of stress fractures in Soldiers by de creasing the total distance marched or ran and increas ing the number of hours slept per night by trainees.1 Given the clear association between overuse injuries in the military and total distances ran by trainees, MAHIIT would provide an effective way to improve aerobic mize overuse injuries. SSTRa A TEGIES TO MITIGa A TE P POTENTIa A L R RISKS OF MA-HIIT HIIT Given the relative intensity of MA-HIIT and the known risks associated with it, there are several measures that can be taken to mitigate such risks. We recommend against using exercises that incorporate live strikes to the head and groin or choke and submission holds which would largely decrease the known risks of head and neck injury in combat sports.10,50 We also recommend the use of protective gear such as gel gloves and proper punch ing pads or bags.30 Attention should be given to proper technique, as there is data to suggest that adherence to correct form and prescribed workout regimen with the use of a trained instructor or instructor-participant decreases injury.9,15,51 Additionally, in agreement with several other sources,11,34 we recommend periodization with a proper familiarization period, individualizing workouts to Soldiers abilities, frequent inspection of workout equipment and facilities, and monitoring pro units. We also recommend the strict adherence to known principles of exercise (ie, PROVERBS* and FITT) to encouraged successful, well-balanced and injury-free physical training. Though MA-HIIT is likely associated with several risks of injury, implementing rather simple methods to decrease such risks enables MA-HIIT to be both effective and safe for broad use across the military. RRISK/B BENEFIT ANa A LYSIS taining to the use of MA-HIIT, the recognized risks and program can be compared. The main risks for partici pants largely consist of musculoskeletal injury given the dynamic exercises used. Using appropriate oversight and *Progression, Regularity, Overload, Variety, Recovery, Balance, 1 principles/).Frequency, Intensity, Time, Type (http://stretchcoach.com/ar

PAGE 52

50 http://www.cs.amedd.army.mil/amedd_journal.aspx technical instruction with periods of familiarization for participants, these risks can be decreased. Though some believe there to be a risk of rhabdomyolysis secondary to the intensity of the training, several sources point out there is little to no evidence to support such claims, sug gesting the overall intensity of MA-HIIT confers minimal risk on participants.34,35 Many of the injuries associated with competitive martial arts are mitigated by not strik ing opponents and using safety equipment. The numer training and lower rates of overuse injury secondary to lower mileage make it an optimal model of physical training. A decrease in the number of overuse injuries alone could potentially save the military millions of dol lars annually. Additionally, MA-HIIT betters equips the with the cardiovascular reserve to sustain prolonged en HIIT, this program would provide substantial improve ment to existing training programs and should be used to train military personnel. Since 2010, the Center for the Intrepid and the Department of Orthopaedic Surgery at Brooke Army Medical Center have incorporated a mar tial arts-based high intensity interval training program in the rehabilitation of over 500 wounded warriors with extremity war injuries, both amputees and limb-salvage patients, with oversight by Orthopaedic Sports Medicine specialists trained in martial arts. CCONCLUSION Martial arts-based high intensity interval training, over principles of exercise and sports medicine provides an as rehabilitation/reintegration of the wounded warrior. Implementation of MA-HIIT across the military has the potential to provide a time and cost effective method of training that would improve existing levels of physical performance and likely decrease overuse injury rates in the military. Further well-formulated, prospective stud ies are necessary to provide more data for the implemen tation of MA-HIIT programs across both military and civilian organizations. RREFERENCES 1. Finestone A, Milgrom C. How stress fracture in cidence was lowered in the Israeli army: a 25-yr struggle. Med Sci Sports Exerc 2008;40(suppl 11):S623-S629. 2. B uchheit M, Laursen PB. High-intensity interval training, solutions to the programming puzzle. Part II: anaerobic energy, neuromuscular load and prac tical applications. Sports Med 2013;43(10):927-954. 3. B uchheit M, Laursen PB. High-intensity interval training, solutions to the programming puzzle. Sports Med 2013;43(5):313-338. 4. A mtmann JA. Self-reported training methods of event. J Strength Cond Res 2004;18(1):194-196. 5. C oswig VS, de Paula Ramos S, Del Vecchio FB. Time-motion and biological responses in simulated mixed martial arts sparring matches. J Strength Cond Res 2016;30(8):2156-2163. 6. L undberg GD. Boxing should be banned in civi lized countries. JAMA 1983;249(2):250. 7. W eisenthal BM, Beck CA, Maloney MD, DeHav en KE, Giordano BD. Injury Rate and Patterns Among CrossFit Athletes. Orth J Sports Med. 2014, 2(4):2325967114531177 8. C asson IR, Siegel O, Sham R, Campbell EA, Tar lau M, DiDomenico A. BRain damage in modern boxers. JAMA 1984;251(20):2663-2667. 9. J ames LP. Injury Prevention Strategies for Mixed Martial Arts. Strength Cond J 2014;36(5):88-95. 10. Z etaruk MN, Violn MA, Zurakowski D, Micheli styles. Br J Sports Med 2005;39(1):29-33. 11. B ergeron MF, Nindl BC, Deuster PA, et al. Con sortium for Health and Military Performance and American College of Sports Medicine consensus paper on extreme conditioning programs in mili tary personnel. Curr Sports Med Rep Nov-Dec 2011;10(6):383-389. 12. K riegel M. A step back. New York Times Septem ber 16, 2012. 13. L undberg GD. Blunt force violence in AmericaJAMA 1996;275(21):1684-1685. 14. O ler M, Tomson W, Pepe H, Yoon D, Branoff R, Branch J. Morbidity and mortality in the martial arts: a warning. J Trauma 1991;31(2):251-253. 15. W eisenthal BM, Beck CA, Maloney MD, De Haven KE, Giordano BD. Injury rate and patterns among CrossFit athletes. Orthop J Sports Med. 2014;2(4). Available at: https://doi. org/10.1177/2325967114531177. Accessed May 3, 2017. 16. H wang CL, Yoo JK, Kim HK, et al. Effect of high-intensity interval training versus moderateintensity continuous training on cardiac function in older adults: Paper presented at: 63rd Annual Meet ing of the American College of Sports Medicine; June 2, 2016; Boston MA. Abstract available at: http://www.acsmannualmeeting.org/wp-content/ uploads/2016/05/ACSM16_Abstracts_Session_C_ vFIN_web_gray.pdf. pS265, presentation 1315. Ac cessed May 4, 2017.MARTIAL ARTS-BASED HIGH INTENSITY INTERVAL TRAINING AS A COMPONENT OF WARFIGHTER REHABILITATION AND TACTICAL ATHLETE FITNESS

PAGE 53

July September 2017 51 17. Smith MM, Sommer AJ, Starkoff BE, Devor ST. sition. J Strength Cond Res 2013;27(11):3159-3172. 18. L aird RH 4th, Elmer DJ, Barberio MD, Salom LP, Lee KA, Pascoe DD. Evaluation of performance improvements following either resistance train ing or sprint interval-based concurrent training. J Strength Cond Res 2016;30(11):3057-3065. 19. A storino TA, Edmunds RM, Clark A, et al. Effect of Various regimes of high intensity interval train ing (HIIT) on changes in maximal oxygen uptake and hemodynamic function. Paper presented at: 63rd Annual Meeting of the American College of Sports Medicine; June 2, 2016; Boston MA. Ab stract available at: http://www.acsmannualmeet ing.org/wp-content/uploads/2016/05/ACSM16_Ab stracts_Session_D_vFIN_web_gray.pdf, pg S383, presentation 1817. Accessed May 4, 2017. 20. B urgomaster KA, Hughes SC, Heigenhauser GJ, Bradwell SN, Gibala MJ. Six sessions of sprint in terval training increases muscle oxidative potential and cycle endurance capacity in humans. J Appl Physiol 2005;98(6):1985-1990. 21. N i Cheilleachair NJ, Harrison AJ, Warrington GD. The effect of HIIT on blood lactate indices and performance in well-trained male rowers. Paper presentation 1818 at: 63rd Annual Meeting of the American College of Sports Medicine; June 2, 2016; Boston MA. Abstract available at: http://www.acs mannualmeeting.org/wp-content/uploads/2016/05/ ACSM16_Abstracts_Session_D_vFIN_web_gray. pdf, pg S383, presentation 1818. Accessed May 4, 2017. 22. G ibala MJ, McGee SL. Metabolic adaptations to short-term high-intensity interval training: a little pain for a lot of gain?. Exerc Sport Sci Rev 2008;36(2):58-63. 23. C ho J, Kim D, Lee I, Chang J, Kang H. high-in tensity interval training improves whole body in sulin resistance via the hepatic AdipoR1 mediatedsignaling pathway. Paper presented at: 63rd An nual Meeting of the American College of Sports Medicine; June 2, 2016; Boston MA. Abstract available at: http://www.acsmannualmeeting.org/ wp-content/uploads/2016/05/ACSM16_Abstracts_ Session_D_vFIN_web_gray.pdf, pg S405, presen tation 1902. Accessed May 4, 2017. 24. R ichards JC, Johnson TK, Kuzma JN, et al. Shortterm sprint interval training increases insulin sen sitivity in healthy adults but does not affect the thermogenic response to beta-adrenergic stimula tion. J Physiol 2010;588(Pt 15):2961-2972. 25. D rigny J, Gremeaux V, Guiraud T, Gayda M, Ju neau M, Nigam A. Long-term high-intensity in tions improves QT dispersion parameters in meta bolic syndrome patients. Ann Phys Rehabil Med 2013;56(5):356-370. 26. B yun S, An C, Kim M, Han D. The effects of an exercise program consisting of taekwondo basic movements on posture correction. J Phys Ther Sci 2014;26(10):1585-1588. 27. B u B, Haijun H, Yong L, Chaohui Z, Xiaoyuan Y, Singh MF. Effects of martial arts on health status: a systematic review. J Evid Based Med 2010;3(4):205-219. 28. Y an JH, Gu WJ, Sun J, Zhang WX, Li BW, Pan tion in patients with osteoarthritis: a meta-analysis. PloS One 2013;8(4):e61672. 29. Y ang Y, Li XY, Gong L, Zhu YL, Hao YL. Tai Chi for improvement of motor function, balance and gait in Parkinsons disease: a systematic review and meta-analysis. PloS One 2014;9(7):e102942. 30. W oodward TW. A review of the effects of martial arts practice on health. WMJ 2009;108(1):40-43. 31. T ong TK, McConnell AK, Lin H, Nie J, Zhang H, Wang J. Functional inspiratory and core muscle training enhances running performance and econ omy. J Strength Cond Res 2016;30(10);2942-2951. 32. J ones BH, Cowan DN, Tomlinson JP, Robinson JR, Polly DW, Frykman PN. Epidemiology of in juries associated with physical training among young men in the army. Med Sci Sports Exerc Feb 1993;25(2):197-203. 33. S anttila M, Pihlainen K, Viskari J, Kyrolainen H. Optimal physical training during military basic training period. J Strength Cond Res 2015;29(sup pl 11):S154-S157. 34. H ak PT, Hodzovic E, Hickey B. The nature and prevalence of injury during CrossFit training. J Strength Cond Res 2013;epub. Available at: http:// insights.ovid.com/crossref?an=00124278-9000 00000-97557. Accessed May 4, 2017. 35. P oston WS, Haddock CK, Heinrich KM, Jahnke SA, Jitnarin N, Batchelor DB. Is high-intensity Mil Med 2016;181(7):627-637. 36. D ibble LE, Hale TF, Marcus RL, Droge J, Gerber JP, LaStayo PC: High-intensity resistance training in persons with Parkinsons disease. Mov Disord 2006;21(9):1444-1452.

PAGE 54

52 http://www.cs.amedd.army.mil/amedd_journal.aspx37. Dibble LE, Hale TF, Marcus RL, Gerber JP, LaSt ayo PC: High intensity eccentric resistance train ing decreases bradykinesia and improves quality of life in persons with Parkinsons disease: a pre liminary study. Parkinsonism Relat Disord. 2009, 15(10):752-757. 38. F riedl KE, Knapik JJ, Hkkinen K, et al. Perspec physical readiness: report of an international mili tary physiology roundtable. J Strength Cond Res 2015;29:S10-S23. 39. M ala J, Szivak TK, Kraemer WJ. Improving per formance of heavy load carriage during highintensity combat-related tasks. Strength Cond J 2015;37(4):43-52. 40. T urner A. Strength and conditioning for British sol diers. Strength Cond J 2016;38(3):59-68. 41. S zivak TK, Mala J, Kraemer WJ. Physical per formance and integration strategies for women in combat arms. Strength Cond J 2015;37(4):20-29. 42. G reeves JP. Physiological implications, perfor mance assessment and risk mitigation strategies of women in combat-centric occupations. J Strength Cond Res 2015;29(suppl 11):S94-S100. 43. N indl BC. Physical training strategies for military womens performance optimization in combatcentric occupations. J Strength Cond Res Nov 2015;29(suppl 11):S101-S106. 44. K raemer WJ, Mazzetti SA, Nindl BC, et al. Effect of resistance training on womens strength/power and occupational performances. Med Sci Sports Exerc 2001;33(6):1011-1025. 45. Y anovich R, Evans R, Israeli E, et al. Differences in der-integrated army basic training. Med Sci Sports Exerc 2008;40(suppl 11):S654-S659. 46. Chalupa RL, Aberle C, Johnson AE. Observed rates of lower extremity stress fractures after im plementation of the Army physical readiness train ing program at JBSA Fort Sam Houston. US Army Med Dep J January-March 2016:6-9. 47. K napik JJ, Sharp MA, Canham-Chervak M, Hauret K, Patton JF, Jones BH. Risk factors for training-related injuries among men and women in basic combat training. Med Sci Sports Exerc 2001;33(6):946-954. 48. S wissa A, Milgrom C, Giladi M, et al. The effect of pretraining sports activity on the incidence of stress fractures among military recruits. A prospective study. Clin Orthop Relat Res 1989(245):256-260. 49. L ovalekar M, Abt JP, Sell TC, Wood DE, Lephart SM. Descriptive epidemiology of musculoskeletal injuries in Naval special warfare sea, air, and land operators. Mil Med 2016;181(1):64-69. 50. N ishime RS. Martial arts sports medicine: current issues and competition event coverage. Curr Sports Med Rep Jun 2007;6(3):162-169. 51. Se ll TC, Abt JP, Nagai T, et al. The Eagle Tactical Athlete Program reduces musculoskeletal injuries in the 101st Airborne Division (Air Assault). Mil Med. 2016;181(3):250-257. AUTHORS Capt Mills is with the Department of Orthopaedic Sur gery, San Antonio Military Medical Center, JBSA-Fort Sam Houston, Texas. COL Johnson is the Chairman, Department of Ortho paedic Surgery, San Antonio Military Medical Center, JBSA-Fort Sam Houston, Texas.MARTIAL ARTS-BASED HIGH INTENSITY INTERVAL TRAINING AS A COMPONENT OF WARFIGHTER REHABILITATION AND TACTICAL ATHLETE FITNESS Articles published in the Army Medical Department Journal are indexed in MEDLINE, the National Library of Medicines bibliographic database of life sciences and biomedical information. Inclusion in the MEDLINE database ensures that citations to AMEDD Journal researchers during searches for relevant information using any of several bibliographic search tools, including the National Library of Medicines PubMed service.

PAGE 55

July September 2017 53The US armed forces are currently engaged in the lon history. The advancements in tactical combat casualty care, rapid medical evacuation, and improvements in personal body armor and armored vehicles have result ed in unprecedented survival rates. The second-order effect of the improved survival of combat injuries is the increased clinical burden of extremity injuries, includ ing amputations.1 These unique features of casualty care within Operations Iraqi Freedom (OIF) and Enduring Freedom (OEF), coupled with the widespread use of a myriad of improvised explosive devices (IEDs)/roadside bombs have given rise to the almost 1,700 individuals with major limb amputations from 2001 to 2015.2-5The long-term nature of musculoskeletal combat injuries has a profound effect on service members potential for continued military service as well as their quality of life after separation from service. In a cohort from paedic/musculoskeletal. In the midst of OIF and OEF, many advances were made with regards to rehabilitation and reintegration of service members with severe ex tremity injury, regardless of limb-salvage or amputation. Unfortunately, the return to duty rate postamputation is 6,7 Furthermore, regardless of whether the medical disposition of the injured service member is return to duty, continuation on active duty in another military occupational specialty, or separation from military service, their emotional pressive symptoms.8,9 The toll that a traumatic amputa tion has on a Soldiers physical and mental wellbeing cannot be overstated. In a study of resource utilization in the care of combat injuries, extremity injuries re quire the longest average inpatient stay, were respon 10 It is clear that extremity injuries represent the largest clinical the most severe of which are combat amputations. Mili tary orthopaedic surgeons are now charged with provid ing the highest level of treatment and rehabilitation for posttraumatic combat amputees to ensure they regain the highest possible quality of life regardless of the overwhelming challenges they face, while also retain ing these critical lessons learned for the betterment of casualties from future wars. Treating the combat amputee requires careful consid eration of a number of characteristics unique to these patients when compared to amputees amongst the gen eral population. Of the amputations performed in the US causes, the majority of which being vascular and onco logic disease.11 These patients are typically older, have several comorbidities, are less active at baseline, and have decreased functional demands when compared to posttraumatic amputees, especially those of the mili tary.12 In fact, nearly half of the patients that receive an amputation secondary to vascular disease will die with in 5 years of the operation.13 Posttraumatic amputees, on the other hand, are often younger, in better physical and cardiovascular condition at the time of injury, desire more active lifestyles, and have a higher survival rate following amputation.14 Many combat amputees also sustain other injuries associated with their combat trauinjuries.15 Additionally, posttraumatic stress disorder is commonly associated with patients with orthopaedic combat injuries.6 Taking into consideration the charac teristics unique to the posttraumatic combat amputee is essential in providing comprehensive rehabilitative care with several nuances that differ from standard noncom bat amputee care. Since the onset of the hostilities following the attacks of September 11, 2001, several advances related to the Martial Arts-Based High Intensity Interval Training in the Rehabilitation of Combat Amputees C apt Gavin L. Mills, USAF, MC C PT David J. Tennent, MC, USA L TC Joseph F. Aldrete, MC, USA C OL Anthony E. Johnson, MC, USA

PAGE 56

54 http://www.cs.amedd.army.mil/amedd_journal.aspxMARTIAL ARTS-BASED HIGH INTENSITY INTERVAL TRAINING IN THE REHABILITATION OF COMBAT AMPUTEES rehabilitation of the combat amputee have been devel oped to achieve maximum function in these patients. Research shows a number of positive aspects of exer cise routines relevant to combat amputees including im proved health outcomes of quality of life, functional ca pacity and mood states, decreased metabolic cost of am bulation, and reduced anxiety.16-18 Previous studies have shown that participation in sports can help amputees cope with their perceived physical impairments by pro viding adaptive athletic opportunities that maximize en gagement in new activities while minimizing disability. Additionally, pursuing sports as an amputee allows pa tients to discover the options available to them regarding different types of activities and prostheses, as well as gain the motor control necessary to control the pros thetic limb for athletic participation.12 One study showed that rehabilitation programs with the use of the prosthe sis to achieve activity correlates with improved over all quality of life and satisfaction with the prosthesis.19 are higher in amputees who participate in sports as well and coping behavior.12 Amputee participation in athlet ics leads to improvements in the cardiopulmonary sys tem, muscle force generation, and lean body mass, as well as decreased rehabilitation time.12 Using sports to is a component of the culturally competent care process for veterans that is proving to be essential to their over all rehabilitation.12High intensity interval training (HIIT) has become a popular evidence-based approach to developing cardio The HIIT programs emphasize short, repetitive inter vals of less than 4 minutes of explosive exercises, allow ing the trainee to exercise at or close to VO2max over a 20 Several studies demonstrate that HIIT can lead to improvements in cardiopulmonary along the aerobic-anaerobic spectrum. A number of different exercises can be used within the HIIT mod el including sprints, seated rows, cycling, and martial arts. Recently, researchers have investigated the utility requirements of men and women in the armed forces into a program called martial arts-based high intensity interval training or MA-HIIT.21 observed cardiovascular and metabolic improvements, decreased injury rates, increased team building within participants, and the low relative costs of these regi mens.21 The numerous studies demonstrating the ben without impairing strength training and lower rates of military training overuse injury secondary to lower running mileage make MA-HIIT an optimal model of physical training in the military. Additionally, MA-HIIT to sustain prolonged combat engagements.21 being used to optimize the rehabilitation of combat am putees. Since 2010, the Center for the Intrepid and the Department of Orthopaedic Surgery at the San Antonio Military Medical Center have used a martial arts-based high intensity interval training program to rehabilitate over 500 combat veterans who sustained severe extremity injuries, both amputees and limb salvage patients, as demonstrated in the Figure. Patients receive coaching during MA-HIIT sessions by Orthopaedic Sports Medi cine specialists trained in martial arts. While several combat amputees have thrived in this program and were A combat amputee undergoing martial arts-based high inten sity interval training at the Center for the Intrepid at San Anto nio Military Medical Center.

PAGE 57

July September 2017 55 very positive in their assessments of its results, there from which to derive best practices on the use of MAHIIT for rehabilitating these combat injured patients. Though some authors advocate gradual orientation to exercise regimens and limiting amputees to moderate or low intensity exercises, little empiric evidence exists to support these reservations.22 In fact, one study showed similar injury rates among amputees and able bodied players competing in noncontact football.12 Patients that begin a rehabilitation program sooner after their amputation achieve better walking ability postoperatively.23 Though more studies are needed to explore the effec tiveness of MA-HIIT on this subset of traumatic amputees, the potential of providing a comprehensive and ef fective rehabilitation program remains promising given the current body of knowledge. The combat amputee has several barriers to successful rehabilitation to premorbid function that are unique to young, healthy, and motivated patients who underwent extremely traumatic injuries. MA-HIIT programs offer an excellent method to achieve and maintain maximal while providing the opportunity for patients to become sidual limb and/or prosthesis. Additionally, working together with other amputees overcoming similar chal lenges to their recovery embodies the warrior ethos and encourages comradery amongst wounded warriors and their care providers. Creating a rehabilitative program that adequately addresses the challenges unique to com bat amputees while providing the mental and physi cal training necessary can likely be achieved through implementing MA-HIIT. However, more well-designed is available to support creation of a formal, evidencebased program incorporating MA-HIIT into an overall rehabilitative treatment regimen for amputees. RREFERENCES 1. Cross JD, Ficke JR, Hsu JR, Masini BD, Wenke JC. of long-term disabilities. J Am Acad Orthop Surg 2011;19(suppl 1):S1-S7. 2. R abago CA, Clouser M, Dearth CL, et al. The Ex tremity Trauma and Amputation Center of Excel lence: Overview of the Research and Surveillance Division. Mil Med 2016;181(S4):3-12. 3. K elly JF, Ritenour AE, McLaughlin DF, et al. In jury severity and causes of death from Operation Iraqi Freedom and Operation Enduring Freedom: 2003-2004 versus 2006. J Trauma 2008;64(suppl 2):S21-S26, discussion S26-S27. 4. K rueger CA, Wenke JC, Ficke JR. Ten years at war: comprehensive analysis of amputation trends. J Trauma Acute Care Surg 2012;73(6 suppl 5):S438-S444. 5. S tansbury LG, Lalliss SJ, Branstetter JG, Bagg MR, Holcomb JB. Amputations in U.S. military and Iraq. J Orthop Trauma 2008;22(1):43-46. 6. B elisle JG, Wenke JC, Krueger CA. Return-to-duty rates among US military combat-related amputees in the global war on terror: job description matters. J Trauma Acute Care Surg 2013;75(2):279-286. 7. T ennent DJ, Wenke JC, Rivera JC, Krueger CA. Characterisation and outcomes of upper extremity amputations. Injury 2014;45(6):965-969. 8. K ashani JH, Frank RG, Kashani SR, Wonderlich SA, Reid JC. Depression among amputees. J Clin Psychiatry 1983;44(7):256-258. 9. D arnall BD, Ephraim P, Wegener ST, et al. De pressive symptoms and mental health service utilization among persons with limb loss: results of a national survey. Arch Phys Med Rehabil 2005;86(4):650-658. 10. M asini BD, Waterman SM, Wenke JC, Owens BD, Hsu JR, Ficke JR. Resource utilization and disabil ity outcome assessment of combat casualties from Operation Iraqi Freedom and Operation Enduring Freedom. J Orthop Trauma 2009;23(4):261-266. 11. H eikkinen M, Saarinen J, Suominen VP, Virk kunen J, Salenius J. Lower limb amputations: dif ferences between the genders and long-term sur vival. Prosthet Orthot Int 2007;31(3):277-286. 12. B ragaru M, Dekker R, Geertzen JH, Dijkstra PU. Amputees and sports: a systematic review. Sports Med. 2011;41(9):721-740. 13. R obbins JM, Strauss G, Aron D, Long J, Kuba J, Kaplan Y. Mortality rates and diabetic foot ulcers: is it time to communicate mortality risk to patients with diabetic foot ulceration?. J Am Podiatr Med Assoc Nov-Dec 2008;98(6):489-493. 14. L epantalo M, Matzke S. Outcome of unrecon structed chronic critical leg ischaemia. Eur J Vasc Endovasc Surg 1996;11(2):153-157. 15. P otter BK, Scoville CR. Amputation is not isolated: an overview of the US Army Amputee Patient Care Program and associated amputee injuries. J Am Acad Orthop Surg 2006;14(10 spec no.):S188-S190. 16. P enedo FJ, Dahn JR. Exercise and well-being: a re ated with physical activity. Curr Opin Psychiatry 2005;18(2):189-193. 17. W ard KH, Meyers MC. Exercise performance of lower-extremity amputees. Sports Med 1995;20(4):207-214.

PAGE 58

56 http://www.cs.amedd.army.mil/amedd_journal.aspx18. on trait anxiety and physical self-concept of fe male university students. Psychol Sport Exerc 2003;4(3):255-264. 19. A karsu S, Tekin L, Safaz I, Goktepe AS, Yazicio glu K. Quality of life and functionality after lower limb amputations: comparison between univs. bilateral amputee patients. Prosthet Orthot Int 2013;37(1):9-13. 20. B uchheit M, Laursen PB. High-intensity interval training, solutions to the programming puzzle. Part II: anaerobic energy, neuromuscular load and prac tical applications. Sports Med 2013;43(10):927-954. 21. M ills G, Johnson A. Martial arts-based high inten US Army Med Dep J July-September 2017:33-41. 22. M atthews D, Sukeik M, Haddad F. Return to sport following amputation. J Sports Med Phys Fitness 2014;54(4):481-486. 23. Sansam K, Neumann V, OConnor R, Bhakta B. Predicting walking ability following lower limb amputation: a systematic review of the literature. J Rehabil Med. 2009;41(8):593-603. AUTHORS Capt Mills is with the Department of Orthopaedic Sur gery, San Antonio Military Medical Center, JBSA-Fort Sam Houston, Texas. CPT Tennent is with the Department of Orthopaedic Surgery, San Antonio Military Medical Center, JBSAFort Sam Houston, Texas. LTC Aldrete is the Medical Director, Center for the In trepid, San Antonio Military Medical Center, JBSA-Fort Sam Houston, Texas. COL Johnson is the Chairman, Department of Ortho paedic Surgery, San Antonio Military Medical Center, JBSA-Fort Sam Houston, Texas.MARTIAL ARTS-BASED HIGH INTENSITY INTERVAL TRAINING IN THE REHABILITATION OF COMBAT AMPUTEES

PAGE 59

July September 2017 57Since 2001, overseas contingency operations (OCOs) in support of the Global War on Terrorism have led to a large population of combat-related amputees.1 In con combat-related injuries and combat-related amputations in Iraq and Afghanistan have been the result of explo 1-3 Gunshot wounds spectively, in the same time period.1-3 War.4,5 Decreased mortality rates for those wounded on in body armor, casualty evacuation, and tactical combat casualty care.4-7 Therefore, the percentage of service members with multiple limb amputations has increased proportionately as greater numbers of service members are able to survive these previously life-threatening in juries.8 Review of the data of the Military Orthopaedic Trauma Registry (MOTR) within the Department of De fense Joint Trauma System as of October 1, 2012, found a hand, arm, leg, or foot, had been treated at military treatment facilities, including 481 with multiple amputa tions and 272 with upper extremity amputations. A larger body of research has been conducted on amputa tions involving the lower extremity as such amputations Characteristics of US Combat Veterans ( 2001-2011) Who Remain on Active Duty After Upper Extremity Amputations S ara H. Kift, DScOT C apt Taylor J. Bates, USAF, MC C PT Nathan A. Franklin, MC, USA C OL Anthony E. Johnson, MC, USA ABSTRa A CT Objectives: Return to duty following traumatic amputations has been extensively studied in those with lower extremity amputation. As upper extremity amputations occur less frequently, the issue of return to duty for those with upper extremity amputations has received relatively little research. The purpose of this study was to determine the rate at which service members remain on active duty at least one year after having sustained traumatic upper extremity amputations during Operation Iraqi Freedom, Operation Enduring Freedom, and other overseas contingency operations of the Global War on Terrorism. Design: Retrospective. Setting: Military, Academic Level 1 trauma center. Patients: One hundred eighteen patients who sustained combat-related upper extremity amputations between October 2001 and December 2011. Intervention: Data was obtained from the medical record for these 118 patients. Main Outcome Measurements: Percentage of service member remaining on active duty one year following an upper extremity amputation, and evaluation of demographic and injury related factors associated with retention. Results: The overall rate for the upper extremity amputees studied at one year from injury who remained on ac and patients who sustained burns were also more likely to remain on active duty than patients with similar amputation types without concomitant burn injuries ( P =.039). Conclusions: The rate of service members with traumatic upper extremity amputations who were still on active ing retention on active duty. Further study on war casualties who sustain upper-extremity traumatic amputa tions with and without burns is required to optimize outcomes in this population.

PAGE 60

58 http://www.cs.amedd.army.mil/amedd_journal.aspxCHARACTERISTICS OF US COMBAT VETERANS ( 2001-2011) WHO REMAIN ON ACTIVE DUTY AFTER UPPER EXTREMITY AMPUTATIONS are far more common than those involving the upper ex 1 The ability to return to duty has been evaluated as an indicator of a service members functional outcome.6,9-11 This has led to great er amounts of resources devoted to research, prosthetic lower extremity amputees and increase return to duty rates.6,10-12 However, upper extremity amputees have higher disability rates compared with lower extremity amputees.12 Despite this, relatively little research has been focused on upper limb amputations. The purpose of our study was to determine the return to duty rate at one-year postinjury for service members who sustained upper extremity amputations and remain characteristics associated with higher retention rates. PPaA TIENTS aA ND METHODS Following receipt of institutional review board approval, we searched the Department of Defense Trauma Reg istry (DoDTR) and the MOTR using ICD-9 codes to identify all US military service members who sustained combat-related, upper extremity amputations from Oc tober 7, 2001, to December 18, 2011. Upper extremity tal to shoulder disarticulation. All US military service members who were treated for combat-related upper ex tremity amputation at the San Antonio Military Medi cal Center (SAMMC) were included. All nontraumatic, noncombat related amputations that occurred during this time period were excluded from the research. NonUS military personnel, including civilian contractors and foreign nationals, were also excluded from the study. Electronic medical records at SAMMC were then manually searched. The data extracted from the inpatient and outpatient medical records included rank at the time of injury, mil itary occupation specialty (MOS) or area of concentra tion, age, branch of service, mechanism of injury, injury type, Maximum Abbreviated Injury Severity score and Injury Severity Score (ISS), hand dominance, ICD-9 codes, single or multiple amputations, laterality of am type of prosthetic used, and a range of comorbidities. Army Regulation 40-50113 Medical Retention Determination Point (MRDP) as the point in treatment and rehabilitation (not to exceed 1 year from date of injury) at which the service memto determine that he/she is unlikely to carry out the tasks required by their military rank and specialty. Therefore, initiation of a medical evaluation board (MEB) within 365 days of injury. The Medical Evaluation Board Inter nal Tracking Tool was queried to determine the date of medical board initiation. IBM SPSS Statistics 20 was used to perform the sta 2 test was used to determine er exact test was used in instances where the expected count was less than 5 to compare categorical data. All continuous variables were tested for normality to deter mine the appropriate test. The variable ISS score was normally distributed and used a Students t test. All oth ers were calculated using the Mann-Whitney U test. Sta P RRESULTS Of the 118 service members who met the initial inclusion criteria (combat amputation, ICD-9 code, time pe riod) from the DoDTR/MOTR, 83 were included in the (1) amputations performed less than one year prior to the conclusion of data collection (August 1, 2012), and had tation, (3) lack of treatment at SAMMC, and (4) incom plete medical records (Table 1). Of the 83 subjects who one year postinjury, and 44 had initiated a MEB. This Of the demographic characteristics available for analy retention ( P =.021). At one year from injury, MEB pro among our patient population (Table 3), there was a demonstrated paradoxical relationship with burn injuries. Medical board proceedings were initiated for 8 of who sustained an amputation without any burns entered the MEB process, nearly twice the rate of those who were burned ( P =.039). Factors which did not demonstrate sta service, MOS (Table 2), injury type, lat erality of amputation, amputation level (Table 4), hand dominance, or prosthetic use (Table 5). Table 1. Reasons for exclusion of lation (N=35).Reason for Exclusion Number n(%N) No definitive amputation19 (54%)Limited documentation3 (9%)Other13 (37%)

PAGE 61

July September 2017 59 CCOmm MM ENT in whether a subject remained on active duty based on rank ( P =.021) and on comorbidity of burns ( P =.039). Increased retention rates with increasing rank is consis tent with previous studies.6,10,11 One possible explanation is that those who have achieved higher ranks in their amount of time in the military and may remain dedicated Table 2. Demographics of study population (N=83).   A ctive Duty n (%N) MEB n (%N) P Value Average Age (range in years).053 18-23 12 (14%) 24 (30%) 24-29 12 (14%) 12 (14%) 30+ 15 (18%) 8 (10%)Gender .95Male38 (46%) 44 (53%)Female1 (1%) 0 (0%)Branch of Service .28Army33 (40%) 36 (43%)Marine4 (5%) 7 (8%)Air Force2 (2%) 0 (0%)Navy0 (0%) 1 (1%)Rank .021Junior Enlisted: E1-E4 13 (16%) 26 (31%)Senior Enlisted: E5-E9 16 (19%) 13 (16%)Commisioned Officer: W01-06 6 (7%) 1 (1%)Rank Unknown 4 (5%) 4 (5%)MOS .44 11A Infantry Officer3 (4%) 0 (0%) 11B Infantry Enlisted7 (8%) 13 (16%) 12B Combat Engineer0 (0%) 1 (1%) 13B Field Artillery1 (1%) 2 (2%) 19K Armor Crewman1 (1%) 2 (2%) 21B Engineer (Combat) 2 (2%) 3 (4%) 31B Military Police2 (2%) 1 (1%)Other13 (16%) 11 (13%)Missing10 (12%) 11 (13%) Table 3. Comorbidities among study population (N=83).Active Duty n (%N) MEB n (%N) P Value Traumatic Brain Injury15 (18%) 11 (13%) .18Spinal Cord Injury2 (2%) 1 (1%) .9Burns15 (18%) 8 (10%) .039Fractures31 (37%) 34 (41%) .81Soft Tissue37 (45%) 42 (51%) .7Nerve6 (7%) 6 (7%) .82Polytrauma34 (41%) 42 (51%) .34Behavioral Health Diagnosis21 (25%) 27 (33%) .48 Table 4. Injury characteristics of study population (N=83).   A ctive Duty n (%N) MEB n (%N) P Value Mechanism of Injury.52Explosive Device36 (43%) 43 (52%)Gunshot Wound3 (4%) 1 (1%)Type of Injury .54Penetrating25 (30%) 31 (37%)Blunt11 (13%) 12 (14%)Burn3 (4%) 1 (1%)Amputee #1Single24 (29%) 27 (33%)Multiple15 (18%) 17 (20%)Laterality.48Unilateral Upper24 (29%) 27 (33%)1 Upper 2 Lower8 (10%) 9 (11%)1 Upper 1 Lower1 (1%) 4 (5%)Bilateral Upper6 (7%) 3 (4%)Quad0 (0%) 1 (1%)Amputation Level .48Digital22 (27%) 19 (23%)Ray Resection2 (2%) 1 (1%)Wrist Disarticulation2 (2%) 2 (2%)Transradial5 (6%) 8 (10%)Elbow Disarticulation1 (1%) 1 (1%)Transhumeral3 (4%) 11 (13%)Shoulder Disarticulation1 (1%) 0 (0%)Digital & Transradial1 (1%) 1 (1%)Digital & Elbow Disarticulation0 (0%) 1 (1%)Digital & Transhumeral1 (1%) 1 (1%)Elbow Disarticulation & Transhumeral1 (1%) 0 (0%) Table 5. Prosthetic type and use among study population (N=83).   A ctive Duty n (%N) MEB n (%N) P Value Hand Dominance. 46Right30 (36%)32 (39%)Left4 (5%)7 (8%)Unknown5 (6%)5 (6%)Prosthetic Use. 32Used17 (20%)24 (29%)Not Used20 (24%)18 (22%)Unknown 2 (2%)2 (2%)Type of Prosthetic. 55Body Powered5 (8%)5 (8%)Myoelectric8 (12%)18 (28%)Hybrid2 (3%)4 (6%)Other9 (14%) 14 (22%)

PAGE 62

60 http://www.cs.amedd.army.mil/amedd_journal.aspxCHARACTERISTICS OF US COMBAT VETERANS ( 2001-2011) WHO REMAIN ON ACTIVE DUTY AFTER UPPER EXTREMITY AMPUTATIONS tion, those who have achieved a higher rank are less like ly to be required to hold positions that require physical Amputees who had sustained burns were more likely to remain on active duty than those who were not burned cess to early rehabilitation through the integrated reha bilitation program at the US Army Institute for Surgical Research Burn Center. All amputees receive out-patient rehabilitation at the Center for the Intrepid, an integrat ed rehabilitation center. However, patients treated in the Burn Center began rehabilitation as inpatients. This is in contrast to amputees without burns who were treated without an integrated rehabilitation program. Therefore, the only difference is the time of exposure to integrated rehabilitation. The observation that burn victims were more likely to remain on active duty requires further study. was noted that most prosthetic users used more than one type of prosthetic. While none of the type of prosthet ics (body-powered, myoelectric, hybrid or other) yielded member remained on active duty, it should be noted that the more costly and technologically advanced myo electric prosthetics did not increase the retention rates within our study. Determining the cause for decreased retention rates in those using myoelectric prosthetics merits further study. The major limitation of our study is its retrospective nature, thus we are able to show associations only. Re spective studies are dependent upon the quality of the medical documentation reviewed. During the course of the research, multiple discrepancies in the medical re cords examined were noted. To minimize errors, two researchers were utilized to provide a second examina tion of the collected data and ensure congruency with the medical records. A second weakness in this study was the process used to determine retention status. The MEB initiation date is often accepted in military medicine literature as a pre liminary return to duty date, but it can by no means be are unable to determine if our subjects initiated MEB proceedings after the Medical Retention Decision Point. However, given the scope of our review included a 10year period, it is consistent that nearly half of upper-ex tremity amputees are able to perform well enough to be retained beyond the MRDP. Lastly, this study included only US service members treated at SAMMC after sustaining combat-related traumatic upper extremity amputations. Adhering to these criteria yielded a relatively small sample size of 118 pa tients. This decreases the external validity of our study. Some strengths of this study include the length of time utilized (10 years), which encompasses a greater por this area. As the study was conducted at one of the only three military amputee care centers, the small popula population. This study, therefore, may be thought of as an initial study examining the characteristics of upper extremity amputees who remain on active duty one year post injury. erations in support of the Global War on Terrorism (pri marily OIF and OEF) who were treated at San Antonio Military Medical Center remained on active duty one year after combat-related, traumatic upper extremity cantly with retention included rank and the presence of burns. Increased active duty rate among burn victims may, in part, be due to earlier exposure to integrated re habilitation. This potential relationship warrants future found. Other studies on upper extremity amputees have dem 12 Our study provides characteristics of those patients who remain on active duty at one year from their in jury. The gap between the status of these patients at one exploration: Š W hat changes between the medical decision mak Š W hen service members leave the rehabilitative en vironment, are they still able to access appropriate resources when they face setbacks? Š I s there a disconnect between the resources avail able and service members understanding of what they may access? Š C ould additional resources bridge the gap between one year retention and full return to duty? needs of amputee service members who wish to remain on active duty following an upper extremity amputation. Further qualitative research should also be conducted with this population to determine other factors that may

PAGE 63

July September 2017 61 affect a service members desire and his/her ability to remain on active military service following an upper ex tremity amputation. Treatment of combat casualties in a patient-centered, integrated performance unit model such as a musculoskeletal specialty home within the Patient Centered Medical Neighborhood is supported and warrants fur ther research. RREFERENCES 1. Krueger CA, Wenke JC, Ficke JR. Ten years at war: comprehensive analysis of amputation trends. J Trauma Acute Care Surg 2012;73:S438-S444. 2. E nad JG, Headrick JD. Orthopedic injuries in U.S. casualties treated on a hospital ship during Opera tion Iraqi Freedom. Mil Med 2008;173:1008-1013. 3. O wens BD, Kragh JF, Jr., Wenke JC, Macaitis J, Wade CE, Holcomb JB. Combat wounds in opera tion Iraqi Freedom and operation Enduring Free dom. J Trauma 2008;64:295-299. 4. A rredondo J, Foote N, Pruden JD, McFarland MJ, McFarland LV. Wounded warriors perspec tives: helping others to heal. J Rehabil Res Dev 2010;47(4):xxi-xxviii. 5. R obbins CB, Vreeman DJ, Sothmann MS, Wilson SL, Oldridge NB. A review of the long-term health outcomes associated with war-related amputation. Mil Med 2009;174(6):588-592. 6. S tinner DJ, Burns TC, Kirk KL, Ficke JR. Re turn to duty rate of amputee soldiers in the cur J Trauma 2010;68(6):1476-1479. 7. P otter BK, Scoville CR. Amputation is not isolat ed: An Overview of the US Army Amputee Patient Care Program and Associated Injuries. J Am Acad Orthop Surg 2006;14(spec no 10):S188-S190. 8. Dougherty PJ, McFarland LV, Smith DG, Es quenazi A, Blake DJ, Reiber GE. Multiple trau matic limb loss: a comparison of Vietnam veterans to OIF/OEF servicemembers. J Rehabil Res Dev 2010;47(4):333-348. 9. P asquina PF, Tsao JW, Collins DM, et al. Quality of medical care provided to service members with combat-related limb amputations: report of patient satisfaction. J Rehabil Res Dev 2008;45(7):953-960. 10. C ross JD, Stinner DJ, Burns TC, Wenke JC, Hsu JR. Return to duty after type III open tibia fracture. J Orthop Trauma 2012;26(1):43-47. 11. K ishbaugh D, Dillingham TR, Howard RS, Sinnott MW, Belandres PV. Amputee soldiers and their re turn to active duty. Mil Med 1995;160(2):82-84. 12. T ennent DJ, Wenke JC, Rivera JC, Krueger CA. Characterisation and outcomes of upper extremity amputations. Injury 2014;45(6):965-969. 13. A rmy Regulation 40-501: Standards of Medical Fitness Washington, DC: US Department of the Army; December 22, 2016:76. AUTHORS Dr Kift received her DScOT from Baylor University. She currently resides in Augusta, Georgia. Capt Bates is a PGY-1, Department of Orthopaedic Sur gery, San Antonio Military Medical Center, JBSA-Fort Sam Houston, Texas. CPT Franklin is a Research Fellow, US Army Institute of Surgical Research (Extremity Trauma and Regnerative Medicine Area), JBSA-Fort Sam Houston, Texas. COL Johnson is the Chairman, Department of Ortho p aedic Surgery, San Antonio Military Medical Center, JBSA-Fort Sam Houston, Texas.

PAGE 64

62 http://www.cs.amedd.army.mil/amedd_journal.aspx 3 4-7 13 14 Temporospatial Angiogenesis-Associated Gene Expression Profiles in Rat Ischemic Skin Flaps ABSTRa A CT Objectives: Study Design: Methods: P Results: Conclusions:

PAGE 65

July September 2017 63 MaA TERIa A LS aA ND METHODS $OO\003SURFHGXUHV\003ZHUH\003UHYLHZHG\003DQG\003DSSURYHG\003E\\000WKH\003 'ZLJKW\003'DYLG\003\(LVHQKRZHU\003$UP\\000)13.6(HGLFDO\003&HQWHU\003$QL Guide for the Care and Use of Laboratory Animals RNA Isolation RNA Amplification and Labeling Zone I Zone IIZone IIIZone IV 0 5 mm 10 mm 0 3 mm

PAGE 66

64 http://www.cs.amedd.army.mil/amedd_journal.aspx t P RRESULTS ,Q\003DQ\003HDUOLHU\003VWXG\)61.7(\017\025\024\003UHVHDUFKHUV\003LQ\003RXU\003ODE\003XVHG\003RUWKRJR P CCOmm MM ENT ,PPHGLDWHO\\000DIWHU\003\300DS\003HOHYDWLRQ\017\003SHGLFOH\003VNLQ\003\300DSV\003EH A While the P TEMPOROSPATIAL ANGIOGENESIS-ASSOCIATED GENE EXPRESSION PROFILES IN RAT ISCHEMIC SKIN FLAPS

PAGE 67

July September 2017 65 Table 11 of 3Genebank ID Gene Name Symbol Fold Change Zone 1Fold Change Zone 2Fold Change Zone 3Fold Change Zone 4EarlyLateEarlyLateEarlyLateEarlyLateNM_053546 Angiopoietin 1 Adra2b -2.45   -3.54*-1.46-2.88*-1.50   -1. 70   -1.06-1.09 NM_ 138505 Adrenergic receptor, alpha 2bAggf11.39   1.01   2.051.36-1.61   1.21   1.362.05 XM_ 226709 Angiogenic factor with G patch and FHA domains 1 Akt1-1.68   -1.65   1.19-1.95-2.33   1.34   1.161.48 NM_ 033230 Thymoma viral proto-oncogene 1 Angpt11.70   1.63   1.411.03-2.42   1.89   -1.401.36 XM_ 344544 Angiopoietin 2 Angpt22.23   1.11   2.682. 70-2.45   1.67   1.443.21 NM_ 199115 Angiopoietin-like 4 Angptl41.73   1.61   1.093.30-1.27   1.45   -1.54-1.21 NM_ 031012 Alanyl (membrane) aminopeptidaseAnpep -2.41   -2.46   -1. 70-1.64-2.07   1.25   -1.66*1.44 XM_ 220907 ADP-ribosylation factor-like 12 Arl12-1.68   -1.13   -1.351.341.03   -2.41   2.031.14 XM_ 343260 1 Bai11.75   1.59   1.453.24-2.67   -1. 70   -1.841.37 NM_ 019205 Chemokine (C-C motif) ligand 11 Ccl11-2.05*1.20   -1.211.201.43   1.46   1.08-2.86 NM_ 031530 Chemokine (C-C motif) ligand 2 Ccl21.62   1.20   2.09*2. 77-2.78   -1.55   1.302.31 XM_ 226213 Cadherin 5 Cdh5-4.52*-7.65*1.00-3.21*-1.09   -3.03*1.66-2.55 XM_ 241632 Procollagen, type XVIII, alpha 1 Col18a15.36   5.47   2.2611.451. 77   -1.21   1.36-1.80* XM_ 343607 Procollagen, type IV, alpha 3 Col4a31.35   1.18   1.552.44-1.88   1.64   -1. 71-1.33 NM_017104 Colony stimulating factor 3 (granulocyte) Csf3-1.20   -1.25   1.002.10-1.18   1.89   1.28-1.80 NM_ 022266 Connective tissue growth factorCtgf 2.22   -2.20   1.111.07-2.29   -1.57   -2.291.42 NM_ 030845 Chemokine (C-X-C motif) ligand 1 Cxcl1-1.27   1.05   -1.311.08-1.68   -1.04   1.111.46 NM_ 139089 Chemokine (C-X-C motif) ligand 10 Cxcl10-1.42   -1.81   -1.42-1.01-3.13   -1.56   -1.671.42 NM_ 182952 Chemokine (C-X-C motif) ligand 11 Cxcl11-2.54   -6. 70   1.32-1.382.47   1. 78   3.48-2.86 NM_ 053647 Chemokine (C-X-C motif) ligand 2 Cxcl2-1.68   -1.66   1. 741.11-2.86   -1.22   1.071.80 NM_ 001007729 Chemokine (C-X-C motif) ligand 4 Cxcl48.85   7 .19   1.3413.23-1.47   -1. 73   -1.191.11 NM_ 022214 Chemokine (C-X-C motif) ligand 5 Cxcl5-1.42   1.28   -1.54*-1.16-1.39   -1.10   2.181.10 NM_ 145672 Chemokine (C-X-C motif) ligand 9 Cxcl9 -6.80 -4.13 -1.29-2.24 -1.31-2.55*2.37-1.92 NM_001012122 Endothelial cell growth factor 1 (platelet-derived) Ecgf1 -9.52   -7 .19 -2.50*-5.74* -1.381.00   -1.59*1.26 NM_ 017301 Endothelial differentiation sphingolipid GPCR 1 Edg1 1.70 1.52 1.492.38 1.561.15   -1.351.21 NM_ 053599 Ephrin A1 Efna1 1.68   -1.19 1.421.82 -2. 74-2.64   -1.561.39 XM_ 234903 Ephrin A2 Efna2 2.56 1.83 1.183.91 -3.17-1.07   -1.841.16 XM_ 574979 Ephrin A3 Efna3 1.56   1.59 1.461.37 -2.122.10   -1.511. 75* NM_012842 Epidermal growth factor Egf -2.00   -1. 73 -4.11-4.76 -1.012.10*-2.061.23 NM_001010968 Endoglin Eng -1.59   -1.37 -1.49-1. 76 1.24-1.05   1. 71*1.05 NM_023090 Endothelial PAS domain protein 1 Epas1 -5.63 -3.00* -5.06*-5.61* -1.381.11   -1.85*1.05 NM_ 021689 Epiregulin Ereg -3.91 -3.75* -2.43*-3.19* -1.101.18   -1.49-1.87 NM_ 022924 Coagulation factor II F2 1.82   1.20 -1. 731.80 -1.32-1.24   -2.181.43 NM_ 012846 Fibroblast growth factor 1 Fgf1 1.41   1. 77 -1.121.63 -1.91-1.60   -1.891.16 NM_ 019305 Fibroblast growth factor 2 Fgf2 1.18   -1.02 1.042.28 -1.431.05   -1.241.42 NM_ 131908 Fibroblast growth factor 6 Fgf6 2.53 2.04 1.111.63 1.351.85*-1.391.14 NM_053429 Fibroblast growth factor receptor 3 Fgfr3 1.30   1.18 1.271.41 -2.66*1.23   -2.32-1.13 NM_ 031761 C-fos induced growth factor Figf 1.95   2.93 1.321.11 -2.201.50   -1.491.11 NM_ 019306 FMS-like tyrosine kinase 1 Flt1 8.41   7 .19 1.0320.09 -1.231.40   -1.331.06 NM_ 173838 Frizzled homolog 5 (Drosophila) Fzd5 1.43   1.41 -1.25-1.31 -1.322.43*-1.531.03 NM_ 001013119 Guanine nucleotide binding protein, alpha 13 Gna13-1.76   -2.19-1.962.001.06-1.29   -1.32-1.02 NM_ 022696 Heart and neural crest derivatives expressed transcript 2 Hand 2-1.34   1.05-1.181. 79-1.07-1.06   -1.331.20 NM_ 017017 Hepatocyte growth factor Hgf 1.54   1.211.352.35-1.81-2.46   -1. 771.69*Statistically significant ( P <.05)

PAGE 68

66 http://www.cs.amedd.army.mil/amedd_journal.aspx Table 1 2 of 3Genebank ID Gene Name Symbol Fold Change Zone 1Fold Change Zone 2Fold Change Zone 3Fold Change Zone 4EarlyLateEarlyLateEarlyLateEarlyLateNM_024359 Hypoxia inducible factor 1, alpha subunit Hif1a 1.74   1.281.061.911.13-1.15   1.151.37 NM_ 001014786 Interferon-alpha 1 Ifna1-2.34   -2.83*-2.18-1.601.091.22   -1.67-1.09 NM_ 138880 Interferon gamma Ifng 1.50   1.481.625.12-1.551.16   -1.611.03 NM_ 178866 Insulin-like growth factor 1 Igf11.98   2.18   -1.462.591.14   1. 77   -1.20-1.08 NM_ 012854 Interleukin 10 Il1020.62   15.31   1.0333.20-2.01   1.13   1.081.07 NM_ 053390 Interleukin 12a Il12a -3.08*-2.35*-1.38-2.87*1.01   -1.26   -1.33-1.10 NM_ 019165 Interleukin 18 Il181.43   -1.37   -1.95-1.531.30   1.29   -1.401.22 NM_ 031512 Interleukin 1 beta Il1b 10.84   5. 74   1.4117 .16-1.74   -1.42   -1.301.80 NM_ 012589 Interleukin 6 Il61.06   -1.11   1.021.58-1.02   -1.05   -1.361.33 XM_ 230950 Integrin alpha V Itgav -10.16*-12.68*-3.59-16.39*-1.83   -2.07   1.10-1.37 NM_ 153720 Integrin beta 3 Itgb3-1.71   -3. 73*-1.06-1.242.68*1.21   2.26-1. 79 NM_019147 Jagged 1 Jag1-1.68   -1.41   -1.36-1. 742.46*1.80   1.23-1.16 NM_ 013062 Kinase insert domain protein receptorKdr -1.55   1.43   1. 721.651.68   1.52*1.15-1.24 XM_ 215963 Laminin, alpha 5 Lama51.27   -1.12   1.051.392.05*1.06   1.331.01 NM_ 030854 Leukocyte cell derived chemotaxin 1 Lect115.72   13.15*2. 7442.73-2.41   -2.25   -1.16-1.50* NM_ 013076 Leptin Lep 5.51   4 .80   1.1311.05-1.00   1.08   -1.121.22 NM_ 031020 Mitogen activated protein kinase 14 Mapk14-1.35   -1.06   1.471.051.88*1.26   1.361.24 NM_ 030859 Midkine Mdk 2.66   2.38   1.415.29-1.53   1.08   -1.24-1.05 XM_ 222317 Matrix metalloproteinase 19 Mmp191.20   1.69*1.361.231.11   1.82*-1.06-1.12 NM_ 031054 Matrix metallopeptidase 2 Mmp21.93   2.43*2.22*2.56*1.15   2.08*1.02-1.19 NM_ 031055 Matrix metallopeptidase 9 Mmp91.16   1.29   -1.41-1.39-1.81*1. 73*-1.461.43 NM_001002827 Notch homolog 4 Notch42.10   3.62*1.97*3.11*1.18   1.46*-1.221.12 NM_ 031545 Natriuretic peptide precursor type BNppb 1.65   1.24   1.96*1. 70*-1.71   -1.31   -1.621.39 NM_ 012613 Natriuretic peptide receptor 1 Npr1-1.02   2.14   1.251.00-1.47   1.30   -1. 73-1.08 NM_145098 Neuropilin 1 Nrp1-2.51   1.10   1.07-2.07-1.09   -1.03   -1.50-1.57 NM_ 030869 Neuropilin 2 Nrp27.95   4 .05   2.10*9.90-1.16   -1.50   1.12-1.27 NM_ 181363 Nudix (nucleoside diphosphate linked moiety X)-type motif 6 Nudt6-3.20*-2.40*-1.49*-2.96*-1.13   1.25   -1.59*-1.69* NM_ 012801 Platelet derived growth factor, alphaPdgfa 1.27   1.52   1.462.061.85   1.06   2.09*-1.56 XM_ 343293 Platelet derived growth factor, B polypeptide Pdgfb 2.04   -1.47   1.301.41-1.98   -1.58   -1.871.64* NM_ 031591 Platelet/endothelial cell adhesion molecule Pecam 3.06*1.74   1.87*2.88*-1.96   -1.59   -1.821.36 NM_ 053595 Placental growth factor Pgf -1.22   -1.28   -1.34-1.031.01   -1.42   1.221.02 NM_ 013085 Plasminogen activator, urokinasePlau 1.23   -1.14   1.181.08-1.44*-1.40*-1.161.07 XM_ 574314 Plasminogen Plg -3.15*-3.12*1.90*-1.682.73*-1.53   2.29-2.17 NM_ 001002278 Protein O-fucosyltransferase 1 Pofut11.13   -1.00   1.19-2.00*-1.36   1.36   -1.14-1.06 NM_ 138852 Prokineticin 2 Prok22.65   1.63   1.061.07-1.19   1.69*-1.12-1.09 NM_ 031606 Phosphatase and tensin homologPten 2.74   1.34   1.391.54-2.26   -1.98   -2.10-1. 78 NM_017043 Prostaglandin-endoperoxide synthase 1 Ptgs12.77*2.94*1.593.82-1.20   -1. 71   -1.031.19 NM_ 017232 Prostaglandin-endoperoxide synthase 2 Ptgs2-2.05   -1.58   -1.30-2.081.61   1.15   1.171.25 NM_ 017066 Pleiotrophin Ptn 1.15   2.41   1.361.201.13   1.13   -1.18-1.05 XM_ 341781 SAPS domain family, member 1 Saps1-1.58   -1. 75*-1.20-2.64*1.31   1.13   1.03-1.03 NM_ 177927 Serine (or cysteine) peptidase inhibitor, clade F, member 1 Serpinf1-3.82*-7.67*-3.51*-5.27*1.83*-1.36   2.80-1.94 NM_ 207605 SH2 domain protein 2A Sh2d2a -2.21   -1.88*-1.13-2.881.06   -1.37   1.62*-1.23*Statistically significant ( P <.05) TEMPOROSPATIAL ANGIOGENESIS-ASSOCIATED GENE EXPRESSION PROFILES IN RAT ISCHEMIC SKIN FLAPS

PAGE 69

July September 2017 67 Table 1 3 of 3Genebank ID Gene Name Symbol Fold Change Zone IFold Change Zone IIFold Change Zone IIIFold Change Zone IVEarlyLateEarlyLateEarlyLateEarlyLateNM_021692MAD homolog 5 (Drosophila) Smad5 -1.82   -1. 78   -1.67-3.15*1.19   1.44   -1.09-1.07 NM_133386Sphingosine kinase 1 Sphk1 2.04   1.36   1.211.45-1.97   -1.18   -1.91*1.19 XM_214279Stabilin 1 Stab1 1.96*1.08   -1.291.331.35   -1.52*-1.02-1.12 XM_238531Stabilin 2 Stab2 -1.15   -1. 73*-1.05-1.67*-1.09   1.10   1.221.19 XM_341009T -box 1 Tbx1 1.24   -1.03   1.371.46-1.61*-1.50   -1.051.16 XM_22081 1T-box 4 Tbx4 1.69   1.42   1.22-2. 79*-1.92*-1.28   -1.161.14 XM_342863 kinase Te k 1.36   1.29   -1.12-1.62-1.19   1.25   -1.10-1.14 NM_012671 T ransforming growth factor alpha Tgfa 1.20   1.34   1.421.401.07   1.35   1.18-1.20 NM_021578 T ransforming growth factor, beta 1 Tgfb1 1.24   1.48   -1.47-1.91*-1.42   1.18   -1.20-1.22 NM_031 131 Transforming growth factor, beta 2 Tgfb2 1.49   -1.20   1.101.18-1.37   -1.38   -1.681.52 NM_013174 T ransforming growth factor, beta 3 Tgfb3 1.34   -1.19   1.061.69-1.40   -1.61   -1.271.35 NM_012775 T ransforming growth factor, beta receptor 1 Tgfbr1 -3.99* -6.20*-1.74-5.92*-1.82   -1.86   -1.04-1.12 XM_214778Thrombospondin 2 Thbs2 -2.11   -2.30*-1.04-1.621.69   -1.04   1.58-1.01 XM_233462 T yrosine kinase with Ig-like and EGFlike domains 1 Tie1 1.15   1.57   -1.06-1.061.36   1.20   1.111.01 NM_053819T issue inhibitor of metallopeptidase 1Timp1 1.73*1.02   1.30-1.67-1.83*-1.01   -1.011.07 NM_021989T issue inhibitor of metalloproteinase 2Timp2 -1.29   2.34   -1.161.131.54   2.08*-1.241.43 NM_012886T issue inhibitor of metalloproteinase 3Timp3 -1.24   -1.44   -1.08-1.601.87   4 .44   -1.271.88 XM_235768T ransmembrane serine protease 6 Tmprss6 1.57   1. 74*1.131.46-1.10   1.00   -1.431.37 NM_012675 T umor necrosis factor (TNF superfamily, member 2) Tnf -1.04   1.56   -1.11-1.22-1.61*-1.63   -1.301.63 NM_181086 T umor necrosis factor receptor superfamily, member 12a Tnfrsf12a -1.36   -1.12   -2.49*-2.42*-2. 70   2.46   -1.922.24 NM_001001513 T umor necrosis factor ligand superfamily member 12 Tnfsf12 -3.75* -3.57*-2.60-5.13*-2.19*1.00   -1.391.41 NM_145765 T umor necrosis factor (ligand) superfamily, member 15 Tnfsf15 1.11   1.10   1.10-1.88*1.14   1.17   -1.18-1.07 NM_134388T roponin T1, skeletal, slow Tnnt1 -2.14   -1.6   -1.93-2.27*-1.52   1.00   1.091.24 NM_031836V ascular endothelial growth factor AVegfa 1.62   1.33   1.411.18-1. 74   1.14   -1.021.14 NM_053549V ascular endothelial growth factor BVegfb 1.75*1.15   1.171.16-1.03   1. 78   -1.021.08 NM_053653V ascular endothelial growth factor CVegfc 1.39   1.43   1.233. 76*-2.02   -1.12   -1.572.38 NM_001013167W AS protein family, member 2Wasf2 2.02   1.63   1.282.40-2.05   -1.36   -2.031.84 Statistically significant ( P <.05)

PAGE 70

68 http://www.cs.amedd.army.mil/amedd_journal.aspx 33 34 Tgfbr1 mean normalized signal intensitysdDay 1Day 3Day 7Zone I 98.538.5 24.724.3 15.911.7 Zone II 81.036.3 46.633.3 13.716.3 Zone III 27.315.5 15.02.5 14.710.3 Zone IV 15.43.5 14.85.4 13.76.8 Epas mean normalized signal intensitysdDay 1Day 3Day 7Zone I 6.793.171.210.99 2.261.85 Zone II 10.47.2 2.060.94 1.861.75 Zone III 9.374.12 6.801.31 10.43.57 Zone IV 11.14.52 6.001.84 11.65.92 Nrp2 mean normalized signal intensitysdDay 1Day 3Day 7Zone I 0.690.195.534.712.812.58 Zone II 0.650.131.370.376.457.19 Zone III 1.440.541.240.670.960.19 Zone IV 1.070.291.200.550.850.14 Serpinf1 mean normalized signal intensitysdDay 1Day 3Day 7Zone I 25.55.386.6611.693.323.97 Zone II 15.68.584.432.752.953.69 Zone III 2.000.883.661.231.471.14 Zone IV 1.831.665.143.890.950.17 Vegfa mean normalized signal intensitysdDay 1Day 3Day 7Zone I 0.460.190.780.370.640.31 Zone II 0.570.110.810.430.670.36 Zone III 0.520.330.300.130.590.18 Zone IV 0.530.150.520.570.600.31 Vegfc mean normalized signal intensitysdDay 1Day 3Day 7Zone I 0.710.140.990.851.020.88 Zone II 0.750.300.920.402.821.87 Zone III 0.510.500.250.160.460.26 Zone IV 0.470.190.300.281.110.90 Fgf2 mean normalized signal intensitysdDay 1Day 3Day 7Zone I 0.670.070.790.340.650.59 Zone II 0.430.210.440.190.970.67 Zone III 0.370.150.250.060.380.06 Zone IV 0.380.260.300.150.530.24 Pdgfa mean normalized signal intensitysdDay 1Day 3Day 7Zone I 2.660.653.375.314.034.16 Zone II 1.801.652.631.653.714.54 Zone III 2.372.174.381.222.502.19 Zone IV 2.250.994.712.121.451.32Table 2 TEMPOROSPATIAL ANGIOGENESIS-ASSOCIATED GENE EXPRESSION PROFILES IN RAT ISCHEMIC SKIN FLAPS

PAGE 71

July September 2017 69 CCONCLUSION ,Q\003D\003SUHYLRXV\003VWXG\)61.7(\017\025\024\003UHVHDUFKHUV\003LQ\003RXU\003ODE\003GH\277QHG\003GLV ACKNOWLEDGEm M ENTS :H\003WKDQN\003'U\003-LOO\003/HZLV\017\003&ROOHJH\003RI\003'HQWDO\003)9.2(HGLFLQH\003 DQG\003*UDGXDWH\003&ROOHJH\003RI\003%LRPHGLFDO\003FLHQFHV\017\003:HVWHUQ\003 QLYHUVLW\\000RI\003WKH\003+HDOWK\003FLHQFHV\017\003RPRQD\017\003&DOLIRUQLD\036\003 'U\003OI\003)-23.9(\(\003:LNHVM|\017\003'HSDUWPHQW\003RI\003HULRGRQWLFV\017\003UDO\003 %LRORJ\)1(\003/DERUDWRU\)1(\003IRU\003$SSOLHG\003HULRGRQWDO\003\t\003&UDQLRID RREFERENCES \024\021 \003 X]\003)-7.5(\017\003\(URJOX\003\(\017\003'RJUX\003+\017\003'HOLEDV\003\017\003XQF\003%\017\003 \)16.5(JXU\003.\021\003KH\003HIIHFW\003RI\003UHSODFHPHQW\003\300XLGV\003DQG\003QRU Clin Otolaryngol Allied Sci J Surg Res Plast Reconstr Surg Plast Reconstr Surg Aesthetic Plast Surg Plast Reconstr Surg Plast Reconstr Surg Di Yi Jun Yi Da Xue Xue Bao Cy tokine Growth Factor Rev Med Mol Morphol J Vasc Surg

PAGE 72

70 http://www.cs.amedd.army.mil/amedd_journal.aspx Q J Nucl Med Development Jpn J Phar macol Pharmacol Rev Oncogene Bio chem Biophys Res Commun Biochem Biophys Res Commun Curr Diabetes Rev Arterioscler Thromb Vasc Biol Laryngoscope Plast Re constr Surg Nature Plast Reconstr Surg Nat Med Ann N Y Acad Sci Thromb Haemost Clin Exp Rheu matol Proc Natl Acad Sci U S A Mol Hum Reprod Arthritis Rheum J Cell Physiol Annu Rev Immunol Science Cell PLoS Med AUTHORS /&\003-RKQVRQ\003LV\003WKH\003$VVLVWDQW\003'LUHFWRU\017\003\003$UP\\000$G TEMPOROSPATIAL ANGIOGENESIS-ASSOCIATED GENE EXPRESSION PROFILES IN RAT ISCHEMIC SKIN FLAPS

PAGE 73

July September 2017 71Resistance to Abrasion of Extrinsic Porcelain Esthetic Characterization TechniquesLTC Woo J. Chi, DC, USA J Rodway Mackert, DMD William Browning, DDS R ichard J. Windhorn, DMD Stephen Looney, PhD F rederick Rueggeberg, DDS, MS January March 20171Although ceramic restorations are considered to be color-stable, a gradual change in shade may be noticed starting a few years after placement.1 While there could be any number of reasons for this change, removal of a thin layer of colorants by toothbrush abrasion may be a contributing factor. According to Aker et al, toothbrush abrasion was found to gradually remove the colorant layer applied to the surface of metal ceramic crowns.2 The colorant layer was completely removed after 10 to 12 years of simulated toothbrushing, while colorants having a glaze overcoat were removed after 30 years of simulated toothbrushing because the layer of clear glaze had to be worn away before the colorant layer could be affected.2,3 In another study, most of the colorant layer was removed after 11 years of simulated brushing resulting in a signi cantly rough surface and shade mismatch.4A novel dental ceramic characterization technique was introduced by a master dental laboratory technician during hands-on training at the US Army Prosthodontic Residency Program to fabricate longer lasting esthetic dental restorations with improved wear resistance properties Resistance to Abrasion of Extrinsic Porcelain Esthetic Characterization Techniques MAJ Woo J. Chi, DC, USA J. Rodway Mackert, DMD William Browning, DDS COL Richard Windhorn, DC, USA Stephen Looney, PhD Frederick Rueggeberg, DDS, MSABSTRACT A novel esthetic porcelain characterization technique involves mixing an appropriate amount of ceramic colorants with clear, low-fusing porcelain (LFP), applying the mixture on the external surfaces, and ring the combined components onto the surface of restorations in a porcelain oven. This method may provide better esthetic qualities and toothbrush abrasion resistance compared to the conventional techniques of applying color-corrective porcelain colorants alone, or applying a clear glaze layer over the colorants. However, there is no scienti c literature to support this claim. This research evaluated toothbrush abrasion resistance of a novel porcelain esthetic characterization technique by subjecting specimens to various durations of simulated toothbrush abrasion. The results were compared to those obtained using the conventional characterization techniques of colorant application only or colorant followed by placement of a clear over-glaze. Four experimental groups, all of which were a leucite reinforced ceramic of E TC1 (Vita A1) shade, were prepared and red in a porcelain oven according to the manufacturers instructions. Group S (stain only) was characterized by application of surface colorants to provide a de nitive shade of Vita A3.5. Group GS (glaze over stain) was characterized by application of a layer of glaze over the existing colorant layer as used for Group S. Group SL (stain+LFP) was characterized by application of a mixture of colorants and clear low-fusing add-on porcelain to provide a de nitive shade of Vita A3.5. Group C (Control) was used as a control without any surface characterization. The 4 groups were subjected to mechanical toothbrushing using a 1:1 water-to-toothpaste solution for a simulated duration of 32 years of clinical use. The amount of wear was measured at time intervals simulating every 4 years of toothbrushing. These parameters were evaluated longitudinally for all groups as well as compared at similar time points among groups. In this study, the novel external characterization technique (stain+LFP: Group SL) did not signi cantly enhance the wear resistance against toothbrush abrasion. Instead, the average wear of the applied extrinsic porcelain was 2 to 3 times more than Group S (stain only) and Group GS (glaze over stain). Application of a glaze layer over the colorants (Group GS) showed a signi cant improvement on wear resistance. Despite its superior physical properties, the leucite reinforced ceramic core (Group C) showed 2 to 4 times more wear when compared with other test groups. A conventional external esthetic characterization technique of applying a glaze layer over the colorants (Group GS) signi cantly enhanced the surface wear resistance to toothbrush abrasion when compared with other techniques involving application of colorants only (Group S) or mixture of colorant and LFP (Group SL). The underlying core ceramic had signi cantly less wear resistance compared with all externally characterized specimens. The novel esthetic characterization technique showed more wear and less color stability, and is thus not advocated as the best method for surface characterization. Application of a glaze layer provides a more wear resistant surface from toothbrush abrasion when adjusting or extrinsically characterizing leucite reinforced ceramic restorations. Without the glaze layer, the restoration is subjected to a 2 to 4 times faster rate and amount of wear leading to possible shade mismatch.

PAGE 74

72 http://www.cs.amedd.army.mil/amedd_journal.aspxRESISTANCE TO ABRASION OF EXTRINSIC PORCELAIN ESTHETIC CHARACTERIZATION TECHNIQUES 2http://www.cs.amedd.army.mil/amedd_journal.aspxand color stability. The method involves mixing an appropriate amount of ceramic colorants with incisal, or clear, low-fusing porcelain (LFP). The mixture is then applied to the external ceramic surfaces and red. Dental laboratory technicians can characterize dental restorations faster since this technique requires only one ring cycle, whereas conventional characterization technique involves 2 separate cycles of ring colorants and glaze layer. The master technician also claims that suspending colorants throughout the matrix of clear porcelain creates more esthetic and natural looking restorations by increasing the depth of perception. The wear resistant property and color stability using this novel technique have not been published in the dental literature, but may surpass those of placing and ring a separate colorant layer, then covering it with a low fusing glaze (Figure 1). The effects of toothbrush abrasion on dental restorations are studied in vitro using a reciprocating, mechanical device to hold toothbrushes against the restoration surface in a slurry mixture of water and dentifrice to simulate the in vivo state. This condition simulates a three body wear system that involves frictional contact among toothbrush bristles, dentifrice slurry, and the restorative material.5 Furthermore, there are additional factors that are related to toothbrush and dentifrice abrasion. The combination of the effects of dentifrice, toothbrush, brushing force, brushing habits, and pH of the slurry solution contribute to abrasion of tooth and restoration surfaces.4,6 The effect of brushing force on wear of dental ceramics has been studied using an in vitro 3-body wear test.7 Studies have shown a direct relationship between brushing force and the amount of wear.7 In addition, De Boer et al showed that abrasion is linearly correlated to the number of strokes.6Aker et al reported that 1 hour of brushing or 16,000 brush strokes in the toothbrushing machine was projected to be equal to brushing each tooth 22 strokes twice a day, 365 days a year.2 In addition, Bergvall et al estimated 14,000 strokes per year whereas Heath and Wilson estimated 20 000 strokes per year.8,9 Another study reported that, on average, one surface of a tooth receives 19 strokes each time of brushing resulting in approximately 14,000 strokes per year.10 More strokes were used to brush the mandibular than the maxillary teeth, more for the labial and buccal than for occlusal and lingual surfaces.10,11 These studies imply that the labial surface of anterior teeth or restorations will receive more brush strokes compared to other tooth surfaces in the mouth, hence enhancing the adverse effects of toothbrush abrasion in the esthetic zone. MATERIALS AND METHODSCeramic Specimen PreparationOne master specimen (14.5 mm by 11.5 mm by 3.0 mm) was cut from a 3 mm thick clear plastic vacuum matrix material (Biostar, Great Lakes Orthodontics). Four dimples, approximately 50 m deep, were carved on the corners of the master specimen. An impression of the master specimen was made in a disposable plastic box (Plastic Boxes Clear/Blue 1, #1011740LL, Zahn Dental) using polyvinyl siloxane impression material (Extrude, Light Body, #29177, Kerr Dental). Melted dental dipping wax (Bellewax, Kerr Dental) was owed into the impression and allowed to cool to room temperature and harden. A total of 16 wax-patterns of the master specimen were generated in this manner. The wax-patterns were sprued and invested in a phosphate-bonded investment (Microstar Dental, LLC) for 15 minutes, allowed to harden, and then transferred into a burn-out oven (In nity L30, Jelrus) preheated to 1600F. After 60 minutes in the oven, 2 ceramic ingots with Vita A1 shade (IPS Empress, E TC1 Esthetic Ingot, Ivoclar Vivadent) were pressed into the investment in a porcelain oven (EP 500; Ivoclar Vivadent) according to manufacturers instructions. Thus, a total of 16 leucite-reinforced ceramic blocks were fabricated from the wax-patterns. The shade of each processed specimen was measured with a calibrated intraoral dental spectrophotometer (VITA Easyshade, Vident). The spectrophotometer was secured on a stand with clamps and the specimens were raised on a at platform perpendicular to the probe. The initial surface characteristics as well as the thickness of the materials above the plane connecting 3 of the 4 dimple bottoms of each specimen were obtained by using a scanning pro lometer (Taylor Hobson Pneumo, Taylor Hobson Precision) before the application of the surface colorants. The dimple bottoms were not covered with surface colorants because they served as reference points for comparing within each specimen throughout clinically simulated toothbrushing (CST) (Figure 2). Surface colorants (IPS Empress Universal stain A2/A3/ A3.5, Ivoclar Vivadent) were applied to the specimens in Group S and Group SL to achieve the de nitive shade RESISTANCE TO ABRASION OF EXTRINSIC PORCELAIN ESTHETIC CHARACTERIZATION TECHNIQUESFigure 1. Different techniques of ceramic esthetic characterization by application of components to surface of existing ceramic restoration. Mixture of Colorant and LFP Application Colorant Application Glaze Application Colorant Application Veneering Porcelain Esthetic Characterization

PAGE 75

July September 2017 73 January March 20173THE ARMY MEDICAL DEPARTMENT JOURNAL of Vita A3.5. These specimens were then red in a porcelain oven at the manufacturer recommended temperature. A clear glaze layer (IPS Empress Universal Glaze, Ivoclar Vivadent) was applied only to the 4 specimens in Group GS and then red in the same porcelain oven. A mixture of clear, add-on low-fusing porcelain (IPS Empress Add-On, Ivoclar Vivadent) and color corrective porcelain colorants was made and applied to the 4 specimens in Group SL. The specimens were red in the same porcelain oven. The specimens in Group C were used as a control without any external esthetic characterization. The prepared specimens were scanned again using the surface pro lometer. The scanned, 3-dimensional images of each specimen were compared with the correlated images scanned before the characterization (Figure 3).Toothbrush Abrasion of the Ceramic GroupsSpecimen holders for the toothbrushing machine were made by placing 2 specimens on a 2 mm-thick clear plastic block and pressing down a heated 0.6 mm-thick vacuum matrix material (Biostar, Great Lakes Orthodontics) on the top of the specimens. The middle portion of the vacuum matrix material was cut out while protecting the dimples (Figure 4). A toothbrushing machine (V-8 Cross Brushing Apparatus, Sabri Enterprises) that holds up to 8 manual toothbrushes (47 Tufts Medium Toothbrush, Ranir Co.) simulated toothbrush abrasion on the groups under a slurry solution composed of 37.5 g of neutral toothpaste (Sparkling White Cinnamon Mint Toothpaste, Colgate Oral Pharmaceuticals) and 37.5 ml of distilled water. The force applied on each brush was adjusted to 200 gf (1.96 N). The toothbrushing machine was adjusted to provide 19,000 reciprocal strokes (de ned as 1 cycle of downward and upward motion) to the specimens to simulate one year of clinical use. The number of reciprocal strokes and force applied was determined based on 8 published abrasion studies (Table 1). Initial measurements of the surface pro le were recorded before subjecting the specimens to simulated toothbrush abrasion. The specimens were then placed in the toothbrushing machine and the abrasion process was started. After each 76,000 strokes, the specimens were removed and tested and rotated 180. In addition, the slurry solution and toothbrushes were replaced every 76,000 reciprocal strokes.Surface ProfilimetryThree dimensional images of the scanned specimens were produced using pro lometer software (Talymap Software, Taylor Hobson Precision). The 3-dimensional images were properly oriented and leveled using a reference plane formed by connecting the bottom of 3 specific dimples. Then, a surface pro le of the leveled images, diagonally connecting 2 speci c dimples, was produced for every 4 years of simulated toothbrushing up to 32 years of CST (Figure 5). The surface pro les were exported to Microsoft Excel (2003) and a superimposed image was produced for each group (Figure 6). The average height loss over time and percentage loss of colorant layer in each group over time were calculated using the digitized areas under these curves. First, unnecessary areas under the incline of the dimples as well as the shoulder areas between the top of the dimples to the beginning of the colorant layer were removed (Figures 7 and 8). In order to calculate the average height of colorant layer above the ceramic core, the average height of the core above the bottom of the dimples was subtracted from the Figure 2. Schematic diagram portraying each specimen group with composition in cross section. Group SL Colorant+LFP (A3.5) IPS Empress (A1)Group GS Clear Glaze Colorant (A3.5) IPS Empress (A1)Group S Colorant (A3.5) IPS Empress (A1)Group CThickness of material above plane of dimple bo om IPS Empress (A1) Dimples Figure 3. Group GS: glaze layer over colorant layer. Distance Across Specimen (mm)Height (mm) 12 0468 2 10 14 0.00 0.02 0.04 0.06 0.08 0.10 0.12 Prestain Poststain Colorant & Glaze Layers Ceramic Core

PAGE 76

74 http://www.cs.amedd.army.mil/amedd_journal.aspxRESISTANCE TO ABRASION OF EXTRINSIC PORCELAIN ESTHETIC CHARACTERIZATION TECHNIQUES 4http://www.cs.amedd.army.mil/amedd_journal.aspxaverage height of the colorant layer from the bottom of the dimples (Figure 8). This method was applied to calculate initial thickness of characterization layers in Groups S, GS, and SL. The average initial thickness of colorants in Group S was 16 m. The average initial thickness of colorants and glaze layer in Group GS was 34 m. The initial thickness of glaze layer above colorants was 18 m. The average initial thickness of mixture of colorants and LFP was 40 m. The average height of colorant layer was calculated every 4 years until 32 years of CST. The average height loss as well as percentage loss was calculated every 4 years of CST. The average height loss and percentage loss over time was plotted.Statistical AnalysisFor each data, repeated measures analysis of variance (ANOVA) were used to test the null hypothesis that there was no interaction between groups (stain only, Group S; glaze over stain, Group GS; stain+LFP, Group SL; Control, Group C) and time (0, 4, 8, 12, 16, 20, 24, 28, 32 years). If no signi cant interaction was found, pro les for each group were assumed to be parallel. In this case, the next step was to (1) test the main effect for group, which was the null hypothesis that the group pro les were coincident, and (2) test the main effect for time, which was the null hypothesis that the group pro les were level. Failure to reject the null hypothesis in (1) would have shown that there was no difference among groups, regardless of time. Failure to reject the null hypothesis in (2) would have shown that there was no difference with regard to time, regardless of group. All 3 of these tests were performed at the 0.05 signi cance level. In this study, the group-by-time interaction was statistically signi cant. Therefore, the 4 groups were compared separately at each of the time points, and the time points were compared separately within each of the 4 groups. Each of the tests of the group effect and each of the tests of the time effect were performed at a Bonferroni-adjusted signi cance level of 0.05/(number of tests performed), so that the family-wise error rate for the tests of the 2 factors (group and time) could be controlled at the 0.05 level. Regardless of whether there was signi cant interaction or not, the Tukey-Kramer method of multiple comparisons for repeated measures designs was used to perform all possible pair-wise comparisons among groups and among time points, using the same signi cance level as the test of the corresponding main effect. RESISTANCE TO ABRASION OF EXTRINSIC PORCELAIN ESTHETIC CHARACTERIZATION TECHNIQUESFigure 4. Design of specimen holder. Protective plastic lip Area subjected to toothbrush abrasion Create areas not subjected to wear to preserve the reference dimples from toothbrush abrasion. Create dimples so that specimens can be oriented for volumetric wear measurements. Create area to accomodate width of toothbrushing machine test brush setup. Figure 5. Cross-sectional image generated every 4 years of clinical simulation of toothbrushing for each specimen. 2 0468 2 0 4 6 8 9 7 3 5 1 10 11 12(mm) (mm) (m) 20 0 40 60 80 200 240 180 140 160 120 100 220 260Distance Across Specimen (mm)Height (mm) 12 0468 2 10 14 0.00 0.02 0.04 0.06 0.08 0.10 0.12 Prestain Poststain Ceramic Core Addition of Colorants Cross Section

PAGE 77

July September 2017 75 January March 20175THE ARMY MEDICAL DEPARTMENT JOURNAL RESULTSAverage Height Loss ( m)The novel external characterization technique (stain+LFP, Group SL) did not significantly enhance the wear resistance against toothbrush abrasion when compared with conventional techniques. Instead, the average height loss of the applied extrinsic porcelain was 2 to 3 times more than Group S (stain only) and Group GS (glaze over stain) after 32 years of CST. Application of a glaze layer over the colorants (Group GS) showed a signi cant improvement on wear resistance, starting as early as the 12-year mark, when compared with Group SL (stain+LFP) and Group S (stain only). After 32 years of CST, only 9 m (average height loss), or 27% (average percentage loss), of the initial applied glaze layer (Group GS) had been abraded away, whereas 15 m (81%) loss was observed in the colorant layer (Group S) and 24 m (52%) loss was observed when the colorants were mixed with LFP (Group SL). This result was consistent with the protective effect of a glaze layer against toothbrush abrasion.4Merely applying and ring colorants (Group S) showed a signi cant improvement in wear resistance as early as 12 years of CST when compared with the novel Table 1. Summary of previously published studies on toothbrush abrasion.StudyNumber of Reciprocal Strokes/Year Weight (g) Applied Dentifrice Water Ratio Slurry Replacement Cycle Substrate Aker27,9204501:1NonePorcelain Bativala414,1182501:1NonePorcelain Bergwall87,0004501:1NoneAcrylic Resin Cannon12N/A2501:1NonePorcelain Goldstein1310,0002831:1NoneComposite Heath910,000N/AN/AN/A N/A Kanter144,320N/AN/AN/AComposite Tanoue1510,0003501:120,000 strokes Composite Wictorin167,3804501:1NoneAcrylic Resin Wang1723,809200N/AN/AComposite Average10,5053351:1N/A N/A Figure 6. Superimposed cross-sectional views over time. Distance Across Specimen (mm)12 0 468 2 10 14Height of Specimen (mm)0.00 0.02 0.04 0.06 0.08 0.10 0.12 28Years Wear 32Years Wear Prestain Stained 4Years Wear 8Years Wear 12Years Wear 16Years Wear 20Years Wear 24Years Wear Ceramic Core Colorant & FLP Distance of the Colorant Layer

PAGE 78

76 http://www.cs.amedd.army.mil/amedd_journal.aspxRESISTANCE TO ABRASION OF EXTRINSIC PORCELAIN ESTHETIC CHARACTERIZATION TECHNIQUES 6http://www.cs.amedd.army.mil/amedd_journal.aspxtechnique (Group SL). Despite its superior physical properties, the leucite reinforced ceramic core (Group C) showed 2 to 4 times more wear over 32 years of CST when compared with other test groups. Statistically signi cant height loss of the ceramic core was observed, starting as early as the 8-year mark, when compared with other test groups. Although average height loss among the characterized specimens showed a positive relationship with increased duration of simulated toothbrushing, each group demonstrated different rates of wear. For example, the least average height loss (91.74 m) among the characterized specimens was observed in Group GS (glaze over stain) after 32 years of CST. The largest average height loss (352.74 m) was observed in Group C (Control). Group S (stain only) had a lower average height loss (132.47 m) when compared with Group SL (stain+LFP) (212.28 m) (Figure 9, Table 2).Average Percentage Stain LossAverage percentage loss among the characterized specimens also showed a positive relationship with increased duration of simulated toothbrushing. Each group demonstrated a different rate of percentage loss. For example, Group S (stain only) showed 80%12% of the original external colorants gradually removed after 32 years of CST. Group SL (stain+LFP) showed 52%7% of the external colorant layer gradually abraded away. Group GS (glaze over stain) showed only 27%6% of the external glaze and colorant layer abraded away over 32 years of CST (Figure 10, Table 3). Group GS (glaze over stain) demonstrated a signi cantly reduced percentage loss, starting as early as the 12-year point, when compared with other test groups. Overall, this group showed the least amount of percentage loss of the characterized surface over 32 years of CST (Figure 10). Group SL (stain+LFP) showed a signi cantly smaller percentage loss starting at the 16-year mark when compared with Group S (stain only). This nding was due to increased initial thickness of the characterization layer in Group SL that was 2 times thicker than the colorant layer in Group S. The average thickness of the colorants in Group S (stain only) was 16 m compared with that of 40 m in Group SL (stain+LFP). COMMENTIn this study, using the novel external characteristic technique of mixing LFP with colorants (Group SL) did not enhance the wear resistance against simulated toothbrush abrasion. Instead, the average height and percentage loss were 2 to 3 times greater when compared to Group S (stain only) and Group GS (glaze over stain). This substantial wear of the LFP and colorant mixture may have resulted from its less dense and more porous surface characteristics compared with a stained and glazed surface. Therefore, the novel esthetic characterization technique may lead to more adverse effects RESISTANCE TO ABRASION OF EXTRINSIC PORCELAIN ESTHETIC CHARACTERIZATION TECHNIQUESFigure 7. Area of interest de ned. Distance Across Specimen (mm)Height (mm) 12 0468 2 10 14 0.00 0.02 0.04 0.06 0.08 0.10 0.12 Area of Interest Shoulder Top of Dimple Bottom of Dimple Prestain Poststain Figure 8. Area of interest after removal of unnecessary areas. Distance Across Specimen (mm)12 0 468 2 10 14Height (mm)0.00 0.02 0.04 0.06 0.08 0.10 0.12 Prestain Poststain Average height of ceramic ingot from bottom of dimples=40 m Average height of colorants from bottom of dimples=75 m Average height of colorants35 m (75 m-40 m)

PAGE 79

July September 2017 77 January March 20177THE ARMY MEDICAL DEPARTMENT JOURNAL rather than improving the physical and esthetic qualities of a restoration. Application of a glaze layer over the colorants (Group GS) improved the wear resistance compared with other characterization techniques. After 32 years of CST, only 9 m (average height loss), or 27% (average percentage loss), of the initial applied glaze layer (Group GS) was abraded away, whereas 15 m (81%) loss was observed in the colorant layer (Group S) and 24 m (52%) loss was observed when the colorants were mixed with LFP (Group SL). These results were consistent with the protective effect of a glaze layer against toothbrush abrasion.2,4 Therefore, application of a clear glaze layer over the colorants is recommended to enhance the wear resistance against toothbrush abrasion. Despite its superior physical properties, the leucite-reinforced core ceramic (Group C) showed 2 to 4 times more wear over 32 years of CST compared with the extrinsic colorants and glaze. Lower wear resistance of the ceramic core may be due to higher crack growth pattern of the leucite-reinforced ceramics in an aqueous slurry solution with neutral pH when they are subjected to mechanical toothbrushing. The increase in solubility of leucite crystals may be another explanation of this undesired property of the ceramic core. Further research should be conducted to investigate the correlation between the solubility of leucite-reinforced ceramics and the potential of a higher wear rate compared with dental ceramics without leucite crystals. A pilot study was conducted for up to 32 years of CST using 2 specimens in each group in order to determine the number of specimens needed in each group for this experiment. Eight specimens per group were determined to be necessary based on the results from the pilot study. Although only 4 specimens per group were used in this experiment due to limited time and resources, statistically signi cant differences among groups were found. Experimental modi cations, such as rotating the specimens 180 every 4 years of CST, using at toothbrush bristles, and using more abrasive toothpastes, were made from the pilot study to facilitate even patterns of wear. A larger sample might have provided additional precision to detect differences among groups with shorter periods of follow-up corresponding to those that are more commonly found in clinical studies. Parameters including the force applied to the specimens, number of reciprocal strokes in 1 year of CST, and the area of the toothbrush bristles had be considered. In an attempt to correlate these factors, Equation 1 was formulated:Figure 9. Average accumulated height loss ( m) of external porcelain characterization layer over 32 years of clinically simulated toothbrushing.Note: n=4 specimens per group. SD values not included to enhance clarity (refer to Table 2). Accumulated Simulated Years of ToothbrushingAverage Height Loss ( m)25 0 10 15 5 20 30 40 35 0-28 0-4 0-120-160-20 0-8 0-24 0-32 Statistically not significant Statistically significant Glaze over Stain (Group GS) Stain Only (Group S) Stain plus LFP (Group SL) Control (Group C) Table 2. Average accumulated height loss over accumulated years of clinically simulated toothbrushing (CST).Accumulated Years of CST Accumulated Height loss ( m) Group SaGroup GSbGroup SLcGroup CdAvgSDCVAvgSDCVAvgSDCVAvgSDCV 0-40.80.5571.10.3271.20.3242.10.523 0-81.90.5252.30.6283.80.7185.30.25 0-124.10.5122.90.4167.21.11510.31.211 0-165.70.5103.40.259.41.11114.30.32 0-207.70.454.30.4912.31.51219.21.26 0-249.30.885.60.51015.01.51024.21.46 0-2810.71.4137.21.52117.91.71029.22.28 0-3212.92.5199.01.71920.72.31134.72.78a: stain only c: stain+LFP Note: CV indicates Coef cient of variation b: glaze over stain d: Control

PAGE 80

78 http://www.cs.amedd.army.mil/amedd_journal.aspxRESISTANCE TO ABRASION OF EXTRINSIC PORCELAIN ESTHETIC CHARACTERIZATION TECHNIQUES 8http://www.cs.amedd.army.mil/amedd_journal.aspxwhere: PD =pressure applied times distance traveled (work) F =weight applied to the toothbrush (N) Lb =length of bristles (mm) Wb =width of bristles (mm) S =number of reciprocal strokes for 1 year of CST This equation shows that the weight (grams-force) applied on the toothbrush and the total distance the toothbrush bristles traveled on a specimen in 1 year of CST has an inverse relationship with the area of the bristles that are in contact with the specimen. For example, the average parameters of 8 different abrasion studies from Table 1 are shown below: Average weight applied to toothbrush=335 gf (3.29 N) Average number of reciprocal strokes for 1 year of CST=10,505 strokes Length of bristles=25 mm Width of bristles=8 mm PD=(335 g10,505 reciprocal strokes25 mm)/ (8 mm5 mm)= (87,979,375 gf reciprocal strokes mm)/(200 mm2)= 439,897 gf strokes/mm A researcher can calculate the appropriate number of reciprocal strokes in 1 year of CST with different parameters using 439,897 gf strokes/mm as a constant value. In this study, the number of reciprocal strokes was calculated to be 19,000 per year since the maximum amount of force the toothbrushing machine could generate was 200 gf (1.96 N), which was 135 gf (1.32 N) less than the average force applied on the toothbrush. Therefore, the number of reciprocal strokes was increased to compensate for the decrease in force applied on the toothbrush using Equation 1. CONCLUSIONSA conventional external esthetic characterization technique of applying a glaze layer over the colorants (Group GS) signi cantly enhanced the surface wear resistance to toothbrush abrasion, and improved the surface color stability when compared with other techniques involving application of colorants only (Group S) or mixture of colorant and LFP (Group SL). The underlying core ceramic had signi cantly less wear resistance properties compared with all externally characterized specimens. The novel esthetic characterization technique showed more wear and is thus not advocated as the best method for surface characterization. REFERENCES1. Anil N, Bolay S. Effect of toothbrushing on the material loss, roughness, and color of intrinsically and extrinsically stained porcelain used in metalceramic restorations: an in vitro study. Int J Prosthodont 2002;15:483-487. 2. Aker DA, Aker JR, Sorensen SE. Toothbrush abrasion of color-corrective porcelain stains applied to porcelain-fused-to-metal restorations. J Prosthet Dent 1980;44:161-163. 3. Yilmaz C, Korkmaz T, Demirkoprulu H, Ergun G, Ozkan Y. Color stability of glazed and polished dental porcelains. J Prosthodont 2008;17:20-24. 4. Bativala F, Weiner S, Berendsen P, Vincent GR, Ianzano J, Harris WT Jr. The microscopic appearance and effect of toothbrushing on extrinsically stained metal-ceramic restorations. J Prosthet Dent 1987;57:47-52.RESISTANCE TO ABRASION OF EXTRINSIC PORCELAIN ESTHETIC CHARACTERIZATION TECHNIQUES Figure 10. Average accumulated percentage loss of external porcelain characterization layer over 32 years of clinically simulated toothbrushing.Note: n=4 specimens per group. SD values not included to enhance clarity (refer to Table 2). Average Percentage Loss ( m) Statistically not significant Statistically significantAccumulated Simulated Years of Toothbrushing50 0 20 30 10 40 60 80 90 70 0-28 0-4 0-120-160-20 0-8 0-24 0-32 Glaze over Stain (Group GS) Stain Only (Group S) Stain plus LFP (Group SL)

PAGE 81

July September 2017 79 January March 20179THE ARMY MEDICAL DEPARTMENT JOURNAL 5. al-Hiyasat AS, Saunders WP, Smith GM. Threebody wear associated with three ceramics and enamel. J Prosthet Dent 1999;82:476-481. 6. De Boer P, Duinkerke AS, Arends J. In uence of tooth paste particle size and tooth brush stiffness on dentine abrasion in vitro. Caries Res 1985;19:232-239. 7. Kon M, Kakuta K, Ogura H. Effects of occlusal and brushing forces on wear of composite resins. Dent Mater J 2006;25:183-194. 8. Bergwall O, Brannstrom M, Wictorin L. The effect of tooth brushing and removal of excess lling on the surface of composite restorative resins. Sven Tandlak Tidskr 1971;64:347-356. 9. Heath JR, Wilson HJ. The effect of water on the abrasion of restorative materials. J Oral Rehabil 1977;4:165-168. 10. Macgregor ID, Rugg-Gunn AJ. Toothbrushing duration in 60 uninstructed young adults. Community Dent Oral Epidemiol 1985;13:121-122. 11. Macgregor ID, Rugg-Gunn AJ. Survey of toothbrushing duration in 85 uninstructed English schoolchildren. Community Dent Oral Epidemiol 1979;7:297-298. 12. Cannon ML, Marshall GW Jr, Marshall SJ, Cooley RO. Surface resistance to abrasion of preformed laminate resin veneers. J Prosthet Dent 1984;52:323-330. 13. Goldstein GR, Lerner T. The effect of toothbrushing on a hybrid composite resin. J Prosthet Dent 1991;66:498-500. 14. Kanter J, Koski RE, Martin D. The relationship of weight loss to surface roughness of composite resins from simulated toothbrushing. J Prosthet Dent 1982;47:505-513. 15. Tanoue N, Matsumura H, Atsuta M. Wear and surface roughness of current prosthetic composites after toothbrush/dentifrice abrasion. J Prosthet Dent 2000;84:93-97. 16. Wictorin L. Effect of toothbrushing on acrylic resin veneering material. I. A study of abrasion in vitro. Sven Tandlak Tidskr 1971;64:247-254. 17. Wang L, Garcia FC, Amarante de Araujo P, Franco EB, Mondelli RF. Wear resistance of packable resin composites after simulated toothbrushing test. J Esthet Restor Dent 2004;16:303-314; discussion 14-15.AUTHORSMAJ Woo is a former resident, US Army Advanced Education Program in Prosthodontics, Tingay Dental Clinic, Fort Gordon, Georgia. Dr Browning is a Professor and IDA Endowed Chair in Restorative Dentistry, School of Dentistry, Indiana University, Indianapolis, Indiana. Dr Looney is a Professor, Department of Biostatistics, Georgia Regents University, Augusta, Georgia. Dr Mackert is a Professor, Department of Graduate Studies, Oral Rehabilitation and Oral Biology, College of Dental Medicine, Georgia Regents University, Augusta, Georgia. COL Windhorn is Commander, US Army Dental Clinic, Fort Richardson, Alaska. Dr Ruggeberg is a Professor, Department of Graduate Studies, Oral Rehabilitation and Oral Biology, College of Dental Medicine, Georgia Regents University, Augusta, Georgia. Table 3. Statistical analysis of average accumulated height loss between groups over timeHeight Loss(n=4 specimens per group)Time (years) IPS Empress vs Group GSaIPS Empress vs Group SLbIPS Empress vs Group ScGroup GSavs Group SLbGroup GSavs Group ScGroup SLbvs Group Sc41.0001.0000.9891.0001.0001.000 8 0.003d0.877 <0.001d0.8901.0000.557 12 <0.001d0.002d<0.001d<0.001d0.994 0.002d16 <0.001d<0.001d<0.001d<0.001d0.130 <0.001d20 <0.001d<0.001d<0.001d<0.001d<0.001d<0.001d24 <0.001d<0.001d<0.001d<0.001d<0.001d<0.001d28 <0.001d<0.001d<0.001d<0.001d<0.001d<0.001d32 <0.001d<0.001d<0.001d<0.001d<0.001d<0.001da: glaze over stain c: stain only b: stain+LFP d: indicates statistical signi cance with <.05 AUTHORS LTC Woo is a Prosthodontist with the 65th Medical Bri gade, US Army Garrison Yongsan, Seoul, Republic of Korea. Dr Browning is a Professor and IDA Endowed Chair in Restorative Dentistry, School of Dentistry, Indiana Uni versity, Indianapolis, Indiana. Dr Looney is a Professor, Department of Oral Health and Diagnostic Sciences, The Dental College of Georgia at Augusta University, Augusta, Georgia. Dr Mackert is a Professor, Department of Restorative Sciences, Restorative Services, The Dental College of Georgia at Augusta University, Augusta, Georgia. Dr Windhorn is Assistant Dean for Digital Dentistry, University of Kentucky College of Dentistry, Lexington, Kentucky. Dr Ruggeberg is a Professor, Department of Restorative Sciences, Restorative Services, Oral Biology, The Den tal College of Georgia at Augusta University, Augusta, Georgia.

PAGE 82

80 http://www.cs.amedd.army.mil/amedd_journal.aspxDespite notable progress in reducing the prevalence of cigarette smoking in the military, smokeless tobacco use continues to increase.1 Based on data from the Millennium Cohort Study, deployment and combat exposure in the US military are associated with an increased level of smokeless tobacco use and smoking.2 According to the Murtha Cancer Center, Department of Defense Cancer Center of Excellence, the prevalence of smokeless tobacco use in the military is almost 4 times greater compared to use in the US civilian population.3 Symptoms of posttraumatic stress disorder also increase the odds for use.2Dental caries is one of the most prevalent diseases causing the demineralization of tooth structure. Streptococcus species are the predominant oral bacterial acids produced.4 Defective restorations lead to additional loss of tooth structure due to restoration and caries removal. Factors contributing to restoration defects include: marginal leakage, polymerization shrinkage, or plaque build-up due to high surface roughness. Three restorative materials presently used for class V lesions include amalgam, resin composite, and resin-modified glass ionomer (RMGI). Amalgam contin ues to serve as an excellent and versatile material in dentistry for more than 150 years, with an estimated 100 million Americans having amalgam restorations.5 Amalgam is the material of choice for larger carious lesions in posterior teeth due to its strength, durability, ease of use, and low cost.6 Amalgams were commonly placed in class V preparations due to their hydrophilic quality, decreasing the need for moisture control. Amalgam limitations include poor esthetics and increased tooth structure removal for mechanical retention. Composite restorations increased in popularity as a result of their tooth-like appearance and ability to conserve tooth structure, and now represent the preferred restoration among patients in the United States. Improvements such as refinement of ler materials with wear properties comparable to human enamel have made resin materials more predictably reliable in clinical use.7 Composite resins are more technique sensitive, require bonding agents to maintain retention, and typically fail sooner than amalgams.Effect of Smokeless Tobacco on Surface Roughness of Dental Restorations M AJ Shani O. Thompson, DC, USA N icole Meyer L TC Manuel Pelaez, DC, USA ABSTRa A CT Clinical Relevance: Surface alterations of dental restorations can result in increased plaque biofilm. This leads to increased risk of premature restoration failure. Smokeless tobacco, in common use by some US military personnel, represents a potential source for surface alteration. If smokeless tobacco causes an untoward effect, selection of a more resistant restorative material could increase restoration longevity, thus minimizing lost work time and costs as sociated with replacement of failed restorations. Purpose: Comparatively assess the effect of smokeless tobacco/salivary substitute mixture on altering surface roughness of amalgam, composite resin, and resin modified glass ionomer (RMGI) restorations. Materials and Methods: Sixty cubic restorations (3 groups of 20) were fabricated using a 4 mm by 3 mm Teflon mold. One examiner assessed the restorations at time points representing zero days, one day, one week, 2 weeks, one month, and 3 months. The data obtained were collected using a surface profilometer, measured in micrometers. Data were statisti P < .05. Results: d face roughness ( P P <.0001. est surface roughness alteration. Conclusion: Smokeless tobacco mixed with a salivary substitute altered restoration surface roughness over time. Resinmodified glass isonomer restorations demonstrate the greatest alteration of surface roughness, with amalgam restorations showing the least. Amalgam remains the preferential restorative material in patients who use smokeless tobacco.

PAGE 83

July September 2017 81Resin-modified glass ionomers (RMGIs) have the same ion-releasing glass ler particles seen in conventional GIs, but smaller. They are synthesized by reacting methacrylate with polyacrylic acid.8 The setting reaction for RMGIs is dual cure and light activated, as well as an acid-base reaction after absorption of water. They are excellent for class V restorations due to their oride releasing properties in these nonesthetic regions. Their smart behavior, which can change their behavior in response to various stimuli such as stress, heat, moisture, electricity, and pH, helps to prevent dimensional changes in moist environments.9Compared to other restorative materials, one advantage of glass isonomers is that they may be placed in cavi ties without the need for bonding agents.10 Despite these positive biocompatible features, their weakness lies in the lack of sufficient strength and toughness.8 To improve some of these weak glass ionomer properties, the creation of RMGIs improved exural strength through the introduction of hydrophilic monomers and polymers like hydroxylethyl methacrylate.11Resin composites and RMGIs are the most common types of adhesive materials used to restore cervical lesions.12 Ideal esthetic properties of composite resins and the oride releasing properties of RMGIs make these 2 restorations a good t. The more comparable modulus of elasticity of both restorations compared to enamel also allows for ideal abfractive properties. Amalgams have a solid record of longevity far outlasting those of composite resins and RMGIs with less inclination to recurrent decay. Understanding these properties help dentists decide which restorative material to use when treating deploying Soldiers who use smokeless tobacco. Smokeless tobacco, which contains high sugar content and acidic properties, also contributes to caries onset, destruction of enamel and other tooth structures.13 As a result, smokeless tobacco use could result in a greater number of early failures of restorations, especially class V cervical restorations. Various studies investigated the influence of surface structure and composition of dental restorative materials on bacterial adhesion.14 The overall conclusion from these studies is that surface roughness is positively correlated with plaque accumulation.15 Findings also demonstrate that increased surface roughness would prompt nonuniform stress distribution, mainly due to the shape differences in the surface layer.16 Ultimately, this leads to craze lines, cracks, or even fractures in the restoration causing inflammation of the dental pulp if not properly treated. Mecholsky et al17 developed the theory that initiation of cracks starts at stress concentration points caused by surface roughness. Given the relatively high rate of smokeless tobacco use in the armed forces, it is critical to understand how different dental materials respond to smokeless tobacco THE ARMY MEDICAL DEPARTMENT JOURNAL Materials to test the effect of smokeless tobacco exposure on surface roughness.Material Type Contents Manufacturer Amalgam Valiant PhD (regular set)59% Ag, 13% Cu, 43% Hg, 28% Sn Kerr Charlotte, NC Composite resin Filtek Supreme Ultra Universal Bis-GMA, UDMA, TEGDMA, Bis-EMA (6) resins, silica filler, zirconia filler3M ESPE St. Paul, MN Resin modified glass ionomer Fuji II LC Silicate glass powder, polyalkenoic acid, HEMA, UDMA GC America Alsip, IL Copenhagen Tobacco long cut, straight Water, tobacco, sodium chloride binders, natural and artificial flavors, ammonium chloride, ethyl alcohol, ammonium sodium carbonate preservatives (10 mg) US Smokeless Tobacco Company Nashville, TN Surface profilometerSurface Roughness Tester, Surftest SJ-210 2.4 in color graphic LCD, calculation results assessed profiles, load and amplitude curves Mitutoyo Corporation Japan Dykstra EMS Embedding Mold Stepped Microtome Catalog # 70907Teflon Electron Microscopy Sciences Hatfield, PA Curing Light Mini LED #303677-019Power module, handpiece, eyeshield Acteon North America Mount Laurel, NJ Simulated salivary extract Hanks Balanced Salt Solution, 1X10 mL Corning Cellgro Manassas, VA Matrix Strips DuPont Mylar 10 cm by 0.95 cm MFG#20 95-8205Plastic strips measure 4 in by 3/8 in by 0.002 in Patterson Dental Supply Montreal, Quebec Laboratory incubator Heratherm Oven Model # 3700-87 97.2F temperature Thermo Scientific Anaheim, CA Reclosable container & lid0.55 liter clear plastic None Solo Cup Operating Corporation Highland Park, IL

PAGE 84

82 http://www.cs.amedd.army.mil/amedd_journal.aspxexposure. To answer this question, the present study evaluated the effect of smokeless tobacco/salivary ex tract on 3 commonly used dental materials with differ ing surface roughness (Ra, m). MaA TERIa A LS aA ND METHODS Sixty restorations, divided into equal groups of twenty (20 amalgam, 20 RMGI, and 20 composite resin), were used to evaluate effects of smokeless tobacco and salivary extract solution combined liquid extract (Copenhagen long cut straight and Hanks Balanced Salt Solution) on the surface roughness of different restorations. Materials used, compositions, and product manufacturers used are listed in the Table.Specimen PreparationThe restorative materials called for the preparation of 20 cubic specimens each, using a 4 mm x 3 mm Heliotest PA) (Figure 1). The prepared materials slightly overresin and RMGI occurred with proper isolation and light cure with the use of a Mylar strip (DuPont Mylar, Montreal, Quebec) to help remove voids and excess material. A LED light cure unit (Mini LED, Acteon North America, Mount Laurel, NJ) with a light intensity of 665 mW/ cm cured and polymerized the composite and RMGI according to the manufacturers instructions. Amalgams fully set over the 24-hour setting period. Figure 2 shows restoration placement in the embedding molds. Following specimen preparation, all restorations were polished, then soaked in normal saline at 37C for 24 hours. Preparations were blotted dry and initial meaSurftest SJ-210) to determine baseline surface roughness. Baseline measurements represent control values. The examiner stored specimens in a 97.2F Heratherm during the duration of the experiment to represent the average temperature of the human mouth. Ten mg of the Copenhagen smokeless tobacco (Figure 3) and 10 ml of the salivary substitute liquid mix fully covered each type of restorative material for 24 hours a day (Figure 4). The examiner measured the surface roughness after 6 hours (representing one day), 2 days (representing one week), 3.5 days (representing 2 weeks), 6 days (representing one month), and 15 days (representing 2 months). The need to evaluate the surface degradation at shorter time intervals occurred due to the limited time constraints. The surface profilometer (Figure 5), an instrument which measures a surfaces profile in order to quantify its roughness, helped evaluate and quantify the surface roughness of the restorations. The average surface roughness (Ra) is the average value of the height of the surface profile above and below the centerline throughout the determined sampling length.18In total, 60 prepared specimens divided into 3 groups were evaluated: Group 1, Valiant PhD (n=20); Group 2, Filtek Supreme Ultra Universal (n=20); and Group 3, Fuji II LC (n=20).Evaluation and Data CollectionOne independent examiner placed and evaluated all restorations and collected data. The examiner accurately measuring the precision roughness specimen supplied The examiner also adjusted the gain to ensure the measured value equaled the nominal Ra value of the precision roughness specimen. Figure 1. Top restoration materials: (A) RGMI; (B) Composite; (C) Amalgam. Bottom sample embedding mold.EFFECT OF SMOKELESS TOBACCO ON SURFACE ROUGHNESS OF DENTAL RESTORATIONS

PAGE 85

July September 2017 83 surface roughness (Ra, in micrometers) of the specimen. An initial roughness measurement represented the an initial roughness value. If this occurred, the examcould obtain a reading. If the surface was too rough to gain a second reading, a null value was annotated. SSTa A TISTICa A L METHODS A 2-way ANOVA test, using the same materials, analyzed intragroup comparisons between baseline and varying timelines. Evaluating row and column factors time, restoration, and the interaction between the 2 factors. The alpha value was set at 0.05. Data are represented as means (SEM) and experimental manipulations were performed in a parallel manner. Dunnetts multiple comparisons test indicated the data collected cant. Graph Pad Prism statistical software was used for all statistical analyses. RRESULTS No restorations were lost due to misplacement or extreme chemical wear. Fifty-two readings were discarded legible readings presented at hour 222 of data collection. rations presented a legible reading on the next available measurement period.TimeWhen evaluating the change percentage of surface roughness over time, all restorations showed a steady to large change in roughness. Amalgams showed an testing period. Figure 6 portrays a small increase in surface roughness from baseline to completion of the data collection. There was a steady movement with a slight change over time. The highest surface roughness recording appeared at the simulated one month and one day mark (186 hours) and the lowest surface roughness recording appeared at baseline. The RMGI showed the greatest overall percentage 2-month period. Figure 6 shows a large increase over time from baseline to completion. The highest surface roughness recording appeared at the modeled 2-month period (360 hours) and the lowest recording appeared at 2-month period as shown in Figure 6. The highest surface roughness recording emerged at the one-week mark (45 hours) and the lowest recording emerged just short of one month. All of the results followed suit with the hypothesis showing statistical signif icance for an increase in surface roughness over all. The total percentage Figure 2. Amalgam (left), composite resin (center), and glass ionomer (right) restoration materials in embedding molds. Figure 3. Copenhagen Long Cut Straight smokeless tobacco.

PAGE 86

84 http://www.cs.amedd.army.mil/amedd_journal.aspxof variation for all restorations combined showed a row factor of 0.7672, yielding P <.0001 suggesting the RestorationsExamination of the restorations from a clinical standcal roughness existed for all restorations. The RMGIs showed a distinct staining and change in surface texture (Figure 7). The percentage of total variation for the col umn factor was 67.73, yielding P <.0001, satisfying the Interaction of Time with Respect to RestorationData shows that the amalgam restoration did not change surface roughness much over time, compared to the gradual, then rapid rise in surface roughness detected in the glass ionomer material. With regard to the effect of time with respect to the restoration, data shows staances among them after smokeless tobacco exposure (F(60, 3425)=1.607; P interaction between time and restoration type (F(2, 3425) = 4255; P <.0001). The P value ( P comparisons of specimen mean scores. The ANOVA ration types with respect to time (F(120, 3425)=4.398; P <.0001). CCOmm MM ENT Studies have shown an increased use of smokeless to bacco, especially among deployed military personnel.2 Reasons for smokeless tobacco use include helping to stimulate moisture in the mouth, addiction to nicotine, and peer pressure. Ingredients found in smokeless to bacco include: polonium 210, N-nitrosamines, formaldehyde, nicotine, cadmium, cyanide, arsenic, benzene, vors, preservatives, and sugars are also added. Polynuclear aromatic hydrocarbons, polonium 210, and N-nitrosamines represent the chemical carcinogens.19 Another becomes extracted from one dip of snuff when kept in the mouth for 30 minutes.20The pH of smokeless tobacco ranges from 5.84 to 8.1 21 Although the average pH is more neutral to basic, the large amount of sugar, preservatives, and chemical carcinogens of smokeless tobacco have an association with gingival recession, tooth wear, and dental caries in users.22 Long-term clinical success of dental restorations depends on various factors, including the physical properties of the material, clinical proficiency of the treating dentist, and proper maintenance and patient care. Understanding whether there is a change in surface roughness is important because, according to Yalcin and Gurgan, irregularities in surface texture enhance bacterial adhesion, and roughened materials may suffer from increased staining.23 Increased bacterial adhesion increases the incidence of recurrent decay and defective restorations. The 3 restorative materials used in this study showed varying results most likely due to the differences in their material structure. Due to their organic matrix, resin materials are more prone to chemical alteration compared to metal or ceramic restorations.14 This could explain why the amalgam group showed the smallest change in surface roughness compared to the composite resin and RMGI groups. Studies comparing amalgam and resin-based composites as restorative materials suggest amalgam has greater Figure 4 material covered with the smokeless tobacco/salivary sub stitute mix. The other 2 embedding molds were covered in a similar manner. Figure 5. Surface roughness tester (Surftest SJ-210 meter.EFFECT OF SMOKELESS TOBACCO ON SURFACE ROUGHNESS OF DENTAL RESTORATIONS

PAGE 87

July September 2017 85 longevity than resin-based composites. One randomized clinical trial24 revealed the risk of experiencing secondary caries as 3.5 times greater with composites. Amalgam outperformed resin-basedcomposites, showing a survival rates of amalgams may be attributed to the less technique sensitive nature of placing them, expansion of amalgam upon setting which decreases onset of marginal leakage, and a greater ability to withstand occlusal forces. The RMGI showed the greatest change in surface roughincrease noted throughout the entire 360 hours of testing. This increase also showed clinical evidence with visible roughness and staining. The large sensitivity of RMGI to smokeless tobacco may be attributed to a weak organic matrix. While RMGIs per form well with retention and postsensitiv ity, it is not reliable in terms of marginal characteristics, surface properties, and color stability.25 For this reason, RMGI may not be the restoration of choice for a patient using smokeless tobacco. fect on the surface roughness of composite resin. The results for this material ctuat ed differently from the amalgam and RMGI. Values for the surface roughness remained steady for the rst half of the experiment until a sharp drop in roughness was measured around the halfway point. From that point on, the roughness continued to gradually increase. This is the only res toration which reacted contrary to initial clinical expectations clinically. Despite the clinical variability, statistics showed a sig Composite resins may have reacted with such clinical variability due to human error. Future studies may benefit from an extended time period of testing, which may help show a larger data set of the clinical exposure of the restoration composition change. In a previous study observing the effect of in-office bleaching agents carbamide peroxide and hydrogen peroxide,14 results showed a slight increase in the surface roughness of the composite resin tested, but the increase in this experiment did in this study, has a well-rounded appeal because of its equal mix of esthetics and strength. Its translucency is also appealing. Composite resins, in this experiment, did not show the high resistance to smokeless tobacco of amalgam, but it also did not show the large change Figure 6. Change in surface roughness over time for each tested material. Time (hours) Surface Roughness (m)0.5 0 1 1.5 4 3.5 3 2.5 20 144 84 48 6 360 Amalgam Ionomer Composite Figure 7. Amalgam (left), composite resin (center), and glass ionomer (right) restoration materials after 360 hours of testing.

PAGE 88

86 http://www.cs.amedd.army.mil/amedd_journal.aspx in roughness in comparison to RMGIs. Additional testing focusing on the relationship smokeless tobacco has on the composite resin may be helpful in gaining more understanding. When reviewing and evaluating overall experiment results, it is important to remember that this study only takes into account the effect a smokeless tobacco mix has on the surface roughness of dental restorations solely from a chemical perspective. Objectively, smokeless tobacco use has more than just a chemical effect. The largest effect is abrasive in nature. The natural state of the tobacco is a graininess, which contributes the abrasive effects. Additional studies accounting for both chemical and abrasive effects of smokeless tobacco will provide an even greater understanding of this topic. In retrospect, the gold standard for truly measuring the surface roughness of a specimen would be use of a scanning electron microscope (SEM). Nonetheless, the results of this study demonstrate distinct, measurable differences among common dental restoration materials when exposed to smokeless tobacco. These dings provide a framework for future studies such as SEM experiments. Additionally, the results presented here add to the literature to better inform dental clinicians, particularly those treating military personnel, when selecting restoration materials. CONc C LUSION Both quantitative and clinical observations show the distinct effect that smokeless tobacco/salivary substitute mix has on surface roughness of common dental restorations. Amalgam (Valiant PhD), which represents the oldest and strongest restoration, showed the smallest change over time. The RMGI (Fuji II) showed the greatest percentage of surface roughness change with a distinct clinical staining over a period equivalent to 2 months. AcC KNOWLEDGMENTS Sincerest thanks to COL (Ret) Linda L. Smith, a Com prehensive Dentist, and former Commander, US Army Dental Activity, US Military Academy, West Point, NY, as well as Assistant Director, Advanced Education in General Dentistry-1 Year Training Program, US Army Dental Activity, Baumholder, Germany. Thank you for your organizational guidance and editorial review of this manuscript. REFEr R ENc C ES 1. Bondurant S, Wedge R, eds. Combating Tobacco Use in Military and Veteran Populations Washington, DC: National Academies Press; 2009. 2. H ermes ED, Wells TS, Smith B, et al. Smokeless tobacco use related to military deployment, cigarettes and mental health symptoms in a large, prospective cohort study among US service members. Addiction 2012;107(5):983-994. 3. K angmin Z, Lee S. Smokeless tobacco use in the US military: accelerating progress against cancer through collaboration. Presentation at Walter Reed National Military Medical Center/John P. Murtha Cancer Center, Bethesda, MD; June 23, 2014. Available at: http://www.wrnmmc.capmed.mil/ CancerCenter/Shared%20Documents/16-Lee%20 -%20MCCCancer.pdf. Accessed September 9, 2016. 4. G omez J. Detection and diagnosis of the early caries lesion. BMC Oral Health 2015;15(suppl 1):S3. 5. R itter AV. Talking with patients: dental amalgam. J Esthet Restor Dent 2003;15(5):319. 6. B harti R, Wadhwani KK, Tikku AP, Chandra A. Dental amalgam: an update. J Conserv Dent 2010;13(4):204-208. 7. C hristensen GJ. Should resin-based composite dominate restorative dentistry today?. J Am Dent Assoc 2010:141:1490-1493. 8. K eshanif Khoroushi M. A review of glassionomer: From conventional glass-ionomer to bioactive glass-ionomer. Dent Res J (Isfahan) 2013;10(4):411-420. 9. M cCabe JF, Yan Z, Al Naimi OT, Mahmoud G, Rolland SL. Smart materials in dentistry--future prospects. Dent Mater J 2009 Jan; 28(1):37-43. 10. C hoi JY, Kim HW, Lee HH. Bioactive sol-gel glass added ionomer cement for the regeneration of tooth structure. J Mater Sci Mater Med 2008;19(10):3287-3294. 11. L assila LV, Nrhi T, Vallittu PK, Yli-Urpo H. Compressive strength and surface characterization of glass ionomer cements modified by particles of bioactive glass. Dent Mater J 2005;21(3):201-209. 12. H eintze SD, Roulet JF. Glass ionomer derivates have better retention rates in cervical restorations compared to self-etching adhesive systems. J Evid Based Dent Pract 2010;10(1):18-20. 13. T omar SL, Winn DM. Chewing tobacco use and dental caries among US men. J Am Dent Assoc 1999;130(12):1700. 14. M ourouzis P, Koulaouzidou E, Helvatjoglu-Antoniades M. Effect of in-office bleaching agents on physical properties of dental composite resins. Quintessence Int 2013;44(4):295-302. 15. R ashid H. The effect of surface roughness on ceramics used in dentistry: a review of literature. Eur J Dent 2014;8(4):571-579.EFFECT OF SMOKELESS TOBACCO ON SURFACE ROUGHNESS OF DENTAL RESTORATIONS

PAGE 89

July September 2017 87 16. Davidson CL, de Jager N, Feilzer AJ. The influence of surface roughness on porcelain strength. Dent Mater J 2000;16(6):381-388. 17. M echolsky J, Freiman S, Rice R. Effect of grinding on w geometry and fracture of glass. J Am Ceram Soc 1977;60:114-117. 18. F ilho H, Azevedo M, Nagem H, Marsola F. Surface roughness of composite resins after ishing and polishing. Braz Dent J 2003;14(1):37-41. 19. M ain JH, Lecavalier DR. Smokeless tobacco and oral disease. J Can Dent Assoc 1988;54:586-91. 20. P rokopczyk B, Wu M, Cox JE, Amin S, Desai D, Idris AM, Hoffmann D. Improved methodology N-nitrosamines in tobacco by super critical id extraction. J Agric Food Chem 1995;43:916-922. 21. B runnemann KD, Hoffmann D, Qi J. Chemical profile of two types of oral snuff tobacco. Food Chem Toxicol 2002;40:1699-1703. 22. W alsh P, Epstein J. The oral effects of smokeless tobacco. J Can Dent Assoc 2000;66:22-25. 23. Y alcin F, Gurgan S. Effect of two different bleaching regimens on the gloss of tooth colored restorative materials. Dent Mater J 2005;21:464-468. 24. Bernardo M, Luis H, Martin MD, et al. Survival and reasons for failure of amalgam versus composite posterior restorations placed in a randomized clinical trial. J Am Dent Assoc 2007;138(6):775-783. 25. S idhu SK. Clinical evaluations of resin-modi-glass-ionomer restorations. Dent Mater J 2010;26(1):7-12. AUTHORS MAJ Thompson is Commander, Fort Leavenworth Dental Clinic, Fort Leavenworth, Kansas. When this study was conducted, she was a 2nd Year Resident, Advanced Education in General Dentistry, US Army Dental Activity, Fort Bragg, North Carolina. Professor of Psychology and Biology at Hope College, Holland, Michigan. Ms Meyer, a clinical research assistant, is a junior at Hope College, Holland, Michigan. LTC Pelaez is a Periodontal Mentor, Advanced Educa tion in General Dentistry-2 Year Training Program, US Army Dental Activity, Fort Bragg, North Carolina.

PAGE 90

88 http://www.cs.amedd.army.mil/amedd_journal.aspxIn the past several decades, major changes have oc curred in both dental treatment philosophies (surgical vs medical model)1 and direct dental restorative materi als (amalgam and composite)2 which have the potential to change the longevity of directly placed dental restorations. The most frequently cited reason for replacing direct dental restorations is secondary caries.3-11 Therefore, it stands to reason that if one lowers the caries risk of the patient by using Andersons medical model1 or Feather stones CAMBRA approach (caries management by risk assessment),12,13 the placed dental restoration will fare better and last longer. Similarly, using the dental restorative materials with the greatest longevity potential and caries resistant placed direct dental restorations are resin composite and amalgam. Reasons for choosing either amalgam or composite for direct dental restorations may include cost, esthetics, ease of use, caries risk of the patient, and the material of preference (either for the patient or doc tor).14,15 There is an ongoing debate in the literature over which restorative dental material has better longevity in the oral cavity.2,4,8,11,14,16 It should be noted that, regardless of the current debate, amalgam has a longer history of success, but the longevity of properly placed resin composite, is greatly improving. The US Department of Health and Human Services estimates that 60 to 70 percent of restorative work is Placement and Replacement Rates of Amalgam and Composite Restorations on Posterior Teeth in a Military Population M AJ Benjamin D. Owen, DC, USA C OL Peter H. Guevara, DC, USA C OL William Greenwood, DC, USA ABSTRa A CT Objective: large proportion of a general dentists time. Variations in the rate of initial placement and replacement of direct den-tal restorations may be associated with material placed (amalgam or composite), age, caries risk of the patient, and other factors. The purpose of this research was to clarify where the majority of patient care time is spent as a restorative Army dentist regarding either the initial placement or replacement of failed restorations; and how the location, caries risk, and material used (amalgam or composite) affects replacement rates. Methods: This retrospective cross-sectional study gathered data from 600 randomly selected military patient dental records. All paper records were reviewed and cross checked with the digital record and digital x-ray databases. Record review was limited to all direct dental restorations placed in the posterior dentition within the past 2 years (March 2011 to March 2013). Statistical analysis was accomplished using chi-square tests and logistic regression analyses. Results: Of the 600 charts reviewed, 525 were male, 75 were female, with an average age of 26 years (SD=6), ranging from 17 to 54 years. A third of the patients were classied as high, moderate, and low caries risk, respectively. The total number of posterior direct dental restorations placed was 2,117. Initial restorations totaled dibular replacement of an existing restoration. Conclusions: torations. The majority of direct dental restorations placed and replaced were amalgam. No signicant difference was found between composite and amalgam restorations. Location was shown to be signicant with rst molars and second molar restorations failing with the highest frequency. There was no signicant difference found between male and female patients. As patients age increased, the number of replacement restorations also increased.

PAGE 91

July September 2017 89replacement of existing restorations.17 Composite res torations have become the material of choice, being placed as direct restorations more frequently by practitioners than at any time in the past.18 Are we compromis ing longevity and retention for esthetics? Or, have mate rials and methods changed so much that composites can now be used interchangeably with amalgam in most if not all clinical situations?2In a military population the idea of placing a function al, lasting, and retentive dental restoration is critical.19 Todays Soldiers experience a myriad of environments and their access to care is a constantly changing variable. readiness. This research seeks to improve upon existing treatment philosophies and aid in improving Soldier care. The purpose of this research is to show where the major ity of patient care time is spent by a restorative Army dentist on either the initial placement or replacement of failed restorations, and how the size, location, caries risk, and material used (amalgam or composite) affects by military dentists is replacing existing restorations; composite restorations fail more frequently; and perma existing restorations the most often. METHODS For this research project, 600 dental records were se lected (using an online random number generator) from the over 12,000 active dental records maintained at the were randomly chosen and that no record was looked at twice, 60 records at a time were selected from each of the 10 color jackets used to sort records in the clin ic. Once those 60 records were reviewed from each of the 10 sections a total of 600 patient charts had been reviewed. The paper records were assessed concurrently with our digital record (CDA) and digital x-rays (DEVAA) databases of dental restorations and restoration replacement rates. Record review was limited to all direct dental restorations placed in the posterior dentition within the previous 2 years (March 2011-March 2013). This data mining included look ing at restorative materials (amalgam vs composite) being placed, replaced, and treatment planned within the past 2 years; the age, gender, and caries risk of the patient; restoration location; and the size (number of surfaces) of the restorations. Exclusion criteria included any patient record that did not have direct dental restorations in the posterior of the mouth placed, replaced, or treatment planned in the past 2 years, and patients who did not have an annual exam with recent caries risk annotated in the past 2 years. SSTa A TISTICa A L ANa A LYSIS Chi-square tests and logistic regression analyses were used to assess whether replacements are associated with factors such as age, risk of caries (high, moderate, or low), and material used (amalgam vs composite). Analy ses were also done to evaluate whether type of restora tion differs by location of tooth (eg, upper vs lower, or molar vs premolar). RRESULTS A total of 600 charts were reviewed; 525 of male patients, 75 female patients, with an average age of 26 years (SD= 6), ranging from 17 to 54 years. Patients were evenly divided among high, moderate, and low caries risk. As associated with gender and caries risk. The total number of direct dental resto rations (composite and amalgam) placed in the posterior dentition from the 600 reviewed patient charts was 2,117. Ini replacement restorations placed totaled As shown in Figure 3, of the 1,429 initial direct restorations initially placed, 1,026 688 direct dental restorations replaced THE ARMY MEDICAL DEPARTMENT JOURNALFigure 1. Caries risk by gender. 36 37 31 32 323220 30 0 40 50 10 Male Female Low Moderate High Percentage of Patients Caries Risk 68% 32%Figure 2. Posterior direct dental restorations. Replacement Placement

PAGE 92

90 http://www.cs.amedd.army.mil/amedd_journal.aspxYounger patients were more likely than older patients to have an initial resto ration placed. As patients increased in age, there was markedly less initial placement of restorations and more replacement of restorations. As shown in Figure 4, this transition typically occurred among patients aged 30-40 years. As shown in Figure 5, restorations lo replaced most frequently, accounting for 23.1% (159 res lars were a close second, with a replacement rate of 22% (152 restorations). In order, from most often replaced to least often, the remaining locations were mandibular second molars, maxillary second molars, maxillary sec Five hundred twenty-ve of the 600 randomly chosen charts were male patients (88%) and 75 were female pa tients (13%). This aligns well with the overall distribu tion of gender in the Army. In 2013, Defense Manpower Research showed enlisted strength to be 86.8% male and 13.2% female, while officers were 84.5% male and 15.5% female.20 Therefore, the random sample used for this re search closely reflects an average sampling of the Army. Female patients were noted to be about 2 years older on average than male patients, 27.5 vs 25.6 years. As men tioned earlier, a comparison of the distribution of caries risk by gender reveals no significant differences (Figure 1). However, the data showed that men were more likely than women to have an initial resto ration placed, and that amalgam was more likely to be used for replacement restorations for males than for females (83% vs 71%, P =.007). Figure 6 pres ents those distributions. The age range of our random patient sample of 600 was 17-54 years of age. ence by age ( P =.055), which is partly because younger patients are more tients (eg, 37% of patients aged 17-25 years are high risk vs 26% of patients aged 26-54 years) (Figure 7). were more likely than older patients to have amalgam for initial restorations (79% of patients aged 17-21 years vs 49% of patients aged 36-55 years) (Figure 8). COMMENT Previous research has demonstrated that practicing gen eral dentists spend a majority of their time replacing restorations, with a replacement rate between 37% and 70%.2-10 However, the results from this research show that the majority of the military dentists time (over twothirds) is spent placing initial restorations. The hypoth esis that more than 50% of an Army dentists time is spent replacing restorations was shown not to be true. The authors believe that this is directly related to the unique subpopulation being treated by the Army dentist. Factors leading to this result could include the age of the patients (average age of 26 years), prevalent high caries risk of patients (almost one-third of all patients seen), poor oral hygiene of patients (often as sociated with stress), and the high intake of fermentable carbohydrates (snacks, sodas, energy drinks; all common for Soldiers to consume). The average civil ian practice sees patients that are, on average, older, lower caries risk, and of ten represent a highly motivated patient group with excellent oral hygiene. This research indicated that in the Army, the majority of direct dental restorations being replaced are amalgams (64%). It should be noted that the vast majority of restorations being initially placed in the Army are also amalgams. In fact, within initial direct restorations placed and re viewed, 1,026 were amalgams (71.8%) Figure 3. Distribution of restorative materials used in initial and replace ment restorations. Replacement Initial Placement 403 441 247 1,026 Composite Amalgam PLACEMENT AND REPLACEMENT RATES OF AMALGAM AND COMPOSITE RESTORATIONS ON POSTERIOR TEETH IN A MILITARY POPULATION

PAGE 93

July September 2017 91 ity of restorations placed in the Army are composites apparent that a larger percentage of composites are be ing replaced in comparison to composites that are being initially placed within the Armys large group practice. This may represent a higher failure rate of composite restorations, even though fewer overall are being placed and replaced than amalgam restorations. Older research shows that amalgam restorations routinely last longer than composite, exhibiting better wear, durability, and longevity.2,15,16 However, newer research concludes that there is now no evident difference be tween amalgam and com posite in longevity/failure rates.21 It is interesting to note that higher failure rates were associated with both older patients and an increase in the number of surfaces being restored.21 This newer research, which shows that amalgam and composite are becom ing more equivalent, more accurately reflects the newer materials and meth ods being used by todays dentists. A relational trend is pres ent in the analysis of pa tient age and replacement rates of dental restoration. As patients age, there is a shift from initial placement of restorations to replacement of restorations. In the military, the vast majority of the population seeking dental treatment is young, which is part of the reason why more initial restorations are being placed. The av erage civilian dentist will be placing many more re placement restorations across an older (on average) patient base. Therefore, the implication is that civilian dentists with older patient bases will spend more time replacing restorations. the restoration affected the replacement rate. Restora lars were replaced the most often, at 159 restorations or mandibular and maxillary second molars had very simi and came in at the 3rd and 4th most replaced locations, respectively. The posterior tooth that had replacement restorations completed the least often was the mandibureplaced. High caries risk patients should be treated medically because surgical replacement of missing tooth structure is insufcient treatment on its own. The disease pro cess (caries) should be addressed. If the treating dentist drills and lls without regard for treating the active in fectious disease, then those restorations will likely fail and require replacement in the future. Anderson et al1 Percentage of Teeth40 50 0 30 60 20 80 90 10 70 74 65 72 69 83 61 71 58Initial Restoration Initial Restoration, Amalgam Replaced Amalgam Replaced with AmalgamFigure 6. Distribution by gender of initial restorations and use of amalgam in restorations. Male Female Number of Replacement Restorations Mandibular 1st Molar Mandibular 2nd Molar Maxillary 2nd Premolar Maxillary 1st Premolar Maxillary 1st Molar Maxillary 2nd Molar Mandibular 1st Premolar Mandibular 2nd Premolar 6 42 41 115 60 113 152 159Figure 5. Distribution of replacement restorations by location. 0 20 40 60 80 100 120 140 160 180

PAGE 94

92 http://www.cs.amedd.army.mil/amedd_journal.aspxaddressed this concern in 1993 when they suggested dentists follow 7 steps for high caries patients: 1. C aries control and diet analysis 2. U se of sealants 3. U se of chlorhexidine and uoride varnish 4. Us e of xylitol gum 5. U se of uoride rinse 6. R ecall after the end of treatment, and bacterio logic testing 7. D efinitive restorations of temporaries The above protocol described by Andersons medical model is still applicable today. Featherstone et al12,13 de scribed a newer technique for high caries management in 2003: caries management by risk assessment (CAM BRA). According to this model, dental caries progres sion or reversal depends upon the balance between de mineralization and remineralization of tooth structure. The caries balance is determined by the relative weight of the sums of pathological factors and protective fac tors. If a patient is well advised of this and decreases the unfavorable factors (frequency and amount of ferment able carbohydrates, bacterial load, and poor saliva qual ity) while increasing the protective/favorable factors (sadiet), the balance will shift towards remineralization of tooth structure and overall caries risk will decrease. If the techniques mentioned here are employed correctly by dentists and patients, replacement rates of dental res torations would go down as caries is consistently found to be the primary reason for replacing restorations. This research revealed that military dentists place and replace direct dental restorations with amalgam more frequently than with composite. Why is amalgam the material of choice in the Army? Amalgam costs less, is is less technique sensitive, has an excellent record, and is proven to be durable. Composite, having improved greatly in the areas of durability, fracture resistance, and longevity, is still very technique sensi tive. In addition, compared to amal gam, composite requires up to 2.5 more time to properly place a composite restoration.14 A poorly placed, incompletely cured composite will not last as long as, or function as well as, an amalgam restoration. The belief held by many dentists that high risk caries patients should not receive com posite restorations is another reason that amalgam restorations are favored Figure 8. Distribution by age group of initial restorations and use of amalgam in restorations. Percentage of Teeth 60 60 68 80 44 49 68 85 68 76 62 77 79 60 85 79 20 10 40 30 60 80 90 50 70 0 36-54 26-35 22-25 17-25Age Range (years): Initial RestorationInitial Restoration, Amalgam Replaced Amalgam Replaced with Amalgam 10 0 50 40 30 20Figure 7. Caries risk by age group. 43 32 26 37 39 25 30 33 37 26 37 37Moderate High Low Percentage of Patients 36-54 26-35 22-25 17-25Age Range (years): Caries RiskPLACEMENT AND REPLACEMENT RATES OF AMALGAM AND COMPOSITE RESTORATIONS ON POSTERIOR TEETH IN A MILITARY POPULATION

PAGE 95

July September 2017 93 by Army dentists. In the less than ideal environments in which the military often nds itself, amalgam continues to have an advantage over composite. In summary, some advantages of amalgam: c ost, t ime, e ase of placement, BH A free, f orgiving nature of the material, lo ngevity; while some advantages of composite include: e sthetics, m ercury free, i mproving durability, and lo ngevity. CCONCLUSION As materials and methods for use of composite resin as a dental restorative material continue to improve, clini cal performance will continue to improve as well. The choice of restorative material may be considered less consequential in the future, and dental professionals will need to focus more on preventive treatment, such as CAMBRA, to decrease caries risk, decrease replace ment rates, and increase restoration longevity. existing direct dental restorations, and the majority of the direct dental restorations placed and replaced are composite and amalgam restorations. Location was lar restorations failing with the highest frequency. There female patients. As patients ages increased, the number of replacement restorations also increased. RREFERENCES 1. Anderson MH, Bales DJ, Omnell KA. Modern management of dental caries: the cutting edge is not the dental bur. J Am Dent Assoc 1993;124:36-44. 2. C hristensen GJ. Restoration longevity versus es thetics, a dilemma for dentists and patients. J Am Dent Assoc. 2011;142(10): 1194-1196. 3. Ch rysanthakopoulos NA. Reasons for place ment and replacement of composite dental restora tions in an adult population in Greece. J Dent Res Dent Clin Dent Prospect 2011;5(3):87-93. Avail able at: http://www.ncbi.nlm.nih.gov/pmc/articles/ PMC3442453/. Accessed September 6, 2016. 4. M jr IA. Amalgam and composite resin restora tions: longevity and reasons for replacement. Paper presented at: International Symposium on Criteria for Placement and Replacement of Dental Restora tions; October 19-21, 1989, Lake Buena Vista, FL. 5. B urke FJ, Cheung SW, Mjr IA, WilsonNH. Rea sons for the placement and replacement of resto rations in vocational training practices. Prim Dent Care 1999;6(1):17-20. 6. D eligeorgi V, Wilson NH, Fouzas D, Koulaki E, BurkeFJ, Mjr IA. Reasons for placement and replacement of restorations in student clinics in Manchester and Athens. Eur J Dent Educ 2000;4(4):153-159. 7. M jr IA, Moorhead JE, Dahl JE. Reasons for re placement of restorations in permanent teeth in gen eral dental practice Int Dent J 2000;50(6):361-366. 8. H ickel R, Manhart J. Longevity of restorations in posterior teeth and reasons for failure J Adhes Dent 2001;3(1):45-64. 9. A l Negrish AR. Reasons for placement and replace ment of amalgam restorations in Jordan. Int Dent J 2001;51(2):109-115. 10. F rost PM. An audit on the placement and replace ment of restorations in a general dental practice Prim Dent Care 2002;9(1):31-36. 11. P alotie U, Vehkalahti M. Reasons for replace ment and the age of failed restorations in posterior teeth of young Finnish adults. Acta Odontol Scand 2002;60:325-329. 12. F eatherstone JD, Adair SM, Anderson MH, et al. Caries management by risk assessment: consensus statement. J Calif Dent Assoc 2003;31(3):257-269. 13. Y oung DA, Featherstone JD, Roth JR. Curing the silent epidemic: caries management in the 21st century and beyond J Calif Dent Assoc 2007;25(10):681-685. 14. R oulet JF. Benefits and disadvantages of toothcoloured alternatives to amalgam. J Dent 1997;25(6):459-473. 15. C orrea MB, Peres MA, Peres KG, Horta BL, Bar ros AD, Demarco FF. Amalgam or composite resin? Factors inuencing the choice of restorative material. J Dent 2012;40(9):703-710. 16. L einfelder KF. Do restorations made of amalgam outlast those made of resin-based composite?. J Am Dent Assoc 2000;131(8):1186-1187. 17. H ealth.gov. IV Dental Amalgam Benefits Analysis [internet]. Office of Disease Prevention and Health Promotion. Available at: https://web.health.gov/ environment/amalgam1/appendixI-sectionIV. htm. Accessed September 6, 2016.

PAGE 96

94 http://www.cs.amedd.army.mil/amedd_journal.aspx18. Ottenga ME, Mjr IA. Amalgam and composite posterior restorations: curriculum versus practice in operative dentistry at a US dental school. Oper Dent 2007;32(5):524-528. 19. M acInnis WA, Ismail A, Brogan H. Placement and replacement of restorations in a military popula tion. J Can Dent Assoc 1991;57(3):227-231. 20. S tatistic Brain. Demographics of Active Duty U.S. Military [internet]. August 12, 2016. Available at: http://www.statisticbrain.com/demographics-of-ac tive-duty-u-s-military/. Accessed September 6, 2016. 21. M cCracken MS, Gordan VV, Litaker MS, et al. A 24-month evaluation of amalgam and resin-based composite restorations: ndings from the National Dental Practice-Based Research Network. J Am Dent Assoc. 2013;144(6):583-593. AUTHORS Clinic, US Army Dental Activity Bavaria, Germany. COL Guevara is Program Director, Advanced Education is also the General Dentistry Consultant to The Army Surgeon General and a Professor at the Uniformed Ser vices University of the Health Sciences. COL Greenwood is Commander, Fort Benning Dental Activity, Fort Benning, Georgia.PLACEMENT AND REPLACEMENT RATES OF AMALGAM AND COMPOSITE RESTORATIONS ON POSTERIOR TEETH IN A MILITARY POPULATION

PAGE 97

July September 2017 95Practice management has become an increasingly important component of graduate medical education. Les sons learned in training will carry forward to every practice environment; private, academic, and military. One of the most critical aspects of practice management is documentation and coding for physician services, as This importance is also emphasized by the Accredita tion Council for Graduate Medical Education mandate for training in coding and billing. Current (2015) pro gram requirements for training in family medicine ne cessitate 100 hours (or one month) of health system man agement instruction, including current billing practices and determining value in the marketplace.1The need for improved training in coding is recog nized by residents and faculty alike. A survey of 600 residents at the University of Louisville demonstrated care care costs did not improve with subsequent years of training.2 A survey of 60 surgical residents and 46 attending physicians from 5 training programs revealed felt they had not been adequately trained in documenting and coding for physician services. Ninety-two percent of residents in this survey thought expertise in documentation and coding would improve their practice, and 3 success of academic medical centers, where initial cod ing is performed by resident physicians. Under-coding Improving Coding Accuracy in an Academic Practice L TC Dana Nguyen, MC, USA M AJ Heather OMara, MC, USA C PT Robert Powell, MC, USA ABSTRa A CT Practice management has become an increasingly important component of graduate medical education. This ap plies to every practice environment; private, academic, and military. One of the most critical aspects of practice any practice. Our quality improvement project aimed to implement a new and innovative method for teaching bill ing and coding in a longitudinal fashion in a family medicine residency. We hypothesized that implementation of a new teaching strategy would increase coding accuracy rates among residents and faculty.MethodsDesign: single group, pretest-posttest. Setting: military family medicine residency clinic. Study populations: 7 faculty physicians and 18 resident physicians participated as learners in the project. Educational intervention: monthly structured coding learning sessions in the academic curriculum that involved learner-presented cases, small group case review, and large group discussion. Main outcome measures: overall coding accuracy (compliance) percentage and coding accuracy per year group for the subjects that were able to participate longitudinally. Statistical tests used: average coding accuracy for population; paired t test to assess improvement between 2 in tervention periods, both aggregate and by year group.ResultsOverall coding accuracy rates remained stable over the course of time regardless of the modality of the educa tional intervention. A paired t 24=-0.127, P =.90.ConclusionsDidactic teaching and small group discussion sessions did not improve overall coding accuracy in a residency practice. Future interventions could focus on educating providers at the individual level.

PAGE 98

96 http://www.cs.amedd.army.mil/amedd_journal.aspx ated with the Mayo Clinic conducted a study to develop an instrument for billing in resident clinics, compare bill ing practices among residents of different training levels, billing. The authors found higher rates of coding errors among junior residents compared to senior residents. ( P ing among PGY-1 residents compared with PGY-2 and tively ( P < 05). Based on the 100 chart sample, the authors estimated that in a residency class of 48 residents, approximately $450,368.64 annually was lost to inaccu1 level.4 In an effort to improve resident knowledge on incentive-based reimbursement, Carter et al designed an educational intervention with emergency medicine resi dents. Residents attended a one-hour lecture, were giv en a pocket card on documentation, received biweekly from their billing department. These interventions re sulted in an increase in total relative value units (RVUs) per hour, from 3.17 to 3.71 ( P =.0001). With an average of 70,000 patient encounters per year, the authors esti mated a projected billing increase of $1.5 million from this educational intervention.5Several educational experiences have been successfully directed toward residents at improving coding accuracy. Benke et al evaluated the effect of a single 90-minute training session covering basic coding procedures and common errors at an ENT program with 14 practitio ners with varying coding experience. Those inexperienced with coding (10 providers) showed an improved ly lower than that of more experienced coding practitio ners.6 In an effort to improve generalized practice man agement knowledge, a surgery program implemented a multifaceted approach. Surgery and medicine residents attended a series of 10 monthly lectures covering vari ous aspects of practice management. In addition, surgi cal residents met monthly for didactic sessions with the coding team and program director provided real time outpatient visit coding feedback. Surgical coding com over a 12-month period.7 OOBJECTIVE Our quality improvement project aimed to implement a new and innovative method for teaching billing and cod ing in longitudinal fashion in a family medicine residency. METHODS Design, Setting, Study PopulationThis study received institutional approval as a quality improvement project. It was conducted as a local qual ity improvement initiative within a family medicine residency clinic. Ten faculty physicians and 24 resident physicians participated in monthly educational sessions about coding rules and regulations for outpatient en counters. Seven faculty and 18 residents were present over both academic years spanned by this project.InterventionWe implemented 2 different educational interventions over a 12-month period. Initially, the educational ses sions were learner-presented cases followed by large group discussion. Every 4 weeks, 3 residents and one ers as common errors by the resident and faculty providers in the clinic. The selected residents and faculty were placed in coding time out and were instructed to sit with the coders to review their errors. The coders then provided one-on-one instruction regarding the appropriate way to code the encounter. During morning report once monthly, the selected providers then summarized the encounter, how the encounter was initially coded, and instructed the group on the appropriate coding or how improve documentation to justify their coding. The coders were present during this session to answer any questions generated by the large group discussion. The providers were subsequently released from time out and a new group of residents and faculty were chosen for the following cycle. Over the second 6-month period, we changed the format of the educational sessions. In lieu of learner-presented cases, we facilitated small group case reviews followed by large group discussion. Each month, the authors iden with the clinic coding staff. Three outpatient encounters were selected and distributed to 3 small groups during the monthly educational sessions. Each small group re ceived a different encounter with both patient and pro vider identifying information removed. Residents and faculty worked together in teams to discuss the appro priate diagnosis, current procedural terminology (CPT) code, and evaluation and management (E/M) code to assign to the encounter. Small groups then presented to the large group, while the authors facilitated discussion, highlighted teaching points, and emphasized proper coding practice. Again, coding staff attended to answer any questions or provide clarifying points from the large IMPROVING CODING ACCURACY IN AN ACADEMIC PRACTICE

PAGE 99

July September 2017 97 group discussion. Of note, on arrival at the residency program, providers are given a coding cheat sheet for coding requirements for common family medicine en counters and procedures.OutcomesCoding accuracy rates were assessed monthly for indi vidual providers. Prior to, and for the duration of this project, coders were collocated in the clinic. As standard tient clinical encounters for all providers and were readi ly available for any questions. A monthly provider/coder comparison chart was already generated at the hospital level with provider diagnosis, CPT, and E/M codes fol lowed by the correction after coder review. This report was obtained and reviewed every month by the authors. Encounters were considered accurate or compliant if the provider assigned E/M code matched the correct coder assigned E/M code. SPSS Statistics (IBM Corp, Armonk, NY) was used to conduct paired t test to assess for overall coding accuracy for the large group. Paired t test and ANOVA was used to assess subgroups as organized into faculty and residency class year. RRESULTS As this study crossed 2 academic years, only those who were present for the entire inter vention period were included in the data analysis, shown in Table 1. All listed par ticipants were present during both the prein tervention and postintervention time periods. To ensure a large enough sample, a 3-month period, vention, was used as the baseline. Table 2 shows the results of the total group coding accuracy rates before and after the educational intervention period. The average coding accuracy for the learners in this study for this SD=10.25) for 1,420 encounters. A 2-month period at the completion of the 2 interventions was evaluated for our comparison data. Average coding accuracy for the 899 encounters during t24=-0.127, P The average change in coding accuracy between educa year residents who progressed to second year residents (R1/2), second year residents who progressed to third year residents, and faculty. The data is shown in Table 3. A one-way between subjects ANOVA was conducted to compare the effects of the educational interventions within and between each of these subgroups. There (F2,22=1.50, P =.25). Among all levels of learners, no compared to each other. CCOmm MM ENT There was no improvement in coding accuracy (as re when the data was aggregated and when individual year groups were assessed. Ideally, we would be able to assess long-term individual performance data in an educa tional practice. However, academic environment restric tions prevented this assessment at the individual level. Interns work in clinic on average once weekly, with increasing weekly clinics per year group. Thus the number of encounters, particularly from the interns, during the assessment period was small. Although the upper level residents and faculty generated more clinical encounters, many individuals in these subgroups were not present in the residency program during the preintervention and postintervention period. As a consequence, only 8 upper level residents and 7 faculty formed the additional subgroups. Thus, participation in the educational interven tions is a potential confounder. The educational sessions occurred during morning report, which is mandatory but may not be attended based on current rotation, vacation, etc. Attendance at each session was not recorded to sub sequently note any potential trends in coding accuracy (ie, correlation between number of sessions attended and change in accuracy at an individual level). Table 1. Provider Role.Provider Number of Participants Intern/R28R2/R3 10Faculty7 Table 2. Coding Accuracy Rates Before and After Educational Intervention.Before Intervention After Intervention 95% CI for Mean Difference Outcome M SD M SD n t df 26.44% 10.25 26.79% 11.38 25 -6.11 to 5.40 -0.127 ( P =.90) 24 Table 3. Change by Year Group in Coding Accuracy After Edu cational Interventions.Learner N Mean Coding Accuracy Change After Educational Interventions SD SE 95% CI for Mean Lower Bound Upper Bound R1/R28 -3.86 13.61 4.81 -15.24 7.51R2/R310 6.13 15.02 4.75 -4.61 16.88Faculty7 -3.08 11.44 4.32 -13.65 7.50

PAGE 100

98 http://www.cs.amedd.army.mil/amedd_journal.aspxPrior studies demonstrated improvement after focused individual educational sessions and large group train ing.4-7 It is unclear why these same methods were not effective in this project. In addition to the limitations listed above, it may be due to the fact that this is a mili tary environment. Anecdotally, military providers have less incentive for accurate coding as they do not re ceive direct compensation for physician services. We tive, providers have less motivation to learn and practice coding and billing skills. There was also some resistance during this project based on perceptions of the role of the physician and frustration with the electronic medical record. During this quality improvement process the authors learned of implemen tation by the local coders of the Army Leveling Tool, resulting in down-coding of several conditions based on disease complexity, despite documentation provided. Although the coding staff understood and implemented the tool, experienced faculty providers had never been educated into its purpose or use. Therefore, it was con dents ways to improve documentation and coding skills in the absence of experience or corporate knowledge. Over the last decade, the AMEDD has brought more emphasis to quality of care and population health mea sures, as compared to the previously emphasized RVU/ sonnel, space allocation, and density of clinic schedules are still largely based on a productivity metric. However, military facilities largely provide inadequate coding and billing education support to primary care providers. edge or competency levels at the individual provider level. Leaders should consider that these low accuracy rates likely lead to inaccurate data management and as sessment at the upper echelons, and may increase the work-load burden on front-line providers. tervention to improve individual provider coding knowl edge and competency. We recommend that other aca demic and clinical programs within the AMEDD experi ment with other teaching and learning modalities. We suspect that more personal and individual educational inincreased administrative support resources and time, but Future interventions could also include a more detailed analysis of coding error to determine the types of cod ing errors on which to focus training. CCONCLUSION coding for physician services, is an important facet of resident education. While this study did not demon strate an improvement in coding accuracy using indi vidual and small group sessions and subsequently small group sessions with facilitated large group discussion, a Programs should tailor their approach based on practice structure and learning needs. RREFERENCES 1. Accreditation Council for Graduate Medical Edu cation. Program Requirements for Graduate Medi cal Education in Family Medicine September 29, 2013; revised June 14, 2015; effective July 1, 2015. Available at: http://www.acgme.org. 2. R oberts JL, Ostapchuk M, Hughes Miller K, Ziegler CH. What residents know about health care reform and what we should teach them. J Grad Med Educ 2011;3(2):155-161. 3. F akhry SM, Robinson L, Hendershot K, Reines HD. Surgical residents knowledge of documenta tion and coding for professional services: an op portunity for a focused educational offering. Am J Surg 2007;194(2):263-267. 4. K apa S, Beckman TJ, CHA SS. A reliable billing method for internal medicine resident clinics J Grad Med Educ 2010;2(2):181-187. 5. C arter KA, Dawson BC, Brewer K, Lawson L. RVU ready? Preparing emergency medicine resi dent physicians in documentation for an incen tive-based work environment. Acad Emerg Med 2009;16(5):423-428. 6. B enke JR, Lin SY, Ishman SL. Directed educa tional training improves coding and billing skills for residents Int J Pediatr Otorhinolaryngology 2013;77(3):399-401. 7. J ones K, Lebron RA, Mangram A, Dunn E. Prac tice management education during surgical resi dency. Am J Surg 2008;196(6):878-881. AUTHORS LTC Nguyen is an Associate Professor and Clerkship Di rector, Department of Family Medicine, Uniformed Ser vices University of the Health Sciences, Bethesda, MD. MAJ OMara is with the Department of Family Medi cine, Madigan Army Medical Center, Tacoma, WA. CPT Powell is with the Department of Family Medicine, General Leonard Wood Army Community Hospital, Fort Leonard Wood, MO.IMPROVING CODING ACCURACY IN AN ACADEMIC PRACTICE

PAGE 101

July September 2017 99Parsonage-Turner syndrome is a rare syndrome of un known etiology affecting the brachial plexus. It is con sidered a rare disorder with an incidence of 2 per 100,000. Patients affected range from 3 months to 75 years of age with highest incidence between 30-70 years old.1,2It is also known as brachial plexus neuritis, neuralgic amyotrophy, brachial plexitis, brachial plexus neuropathy, or shoulder girdle syndrome or neuritis.1,3 Parson age-Turner syndrome (PTS) is characterized by the inchest, shoulders and arms. Viral illness or autoimmune responses have been considered the most common risk factors for PTS, although it can also be idiopathic and hereditary.1,3,4It is a peripheral nervous system disorder that presents with acute upper extremity pain and multifocal paresis, and it may have a complicated recovery course in many of those affected.2,3 The syndrome may be associated with scapular winging. The variable location and the se verity of symptoms depend on which parts of the plexus are affected. The long thoracic, suprascapular, and the axillary nerves are most affected. Even if it mostly af fects the upper trunk, the lower trunk can be affected as well.3 Muscles most commonly affected include the deltoid, supraspinatus, infraspinatus, serratus anterior, biceps, and triceps.5Parsonage-Turner syndrome varies in presentation and nerve involvement. It is usually characterized by the sudden onset of severe shoulder and upper arm pain fol lowed by motor involvement several days later. The pain may extend to the trapezius, upper arm, forearm and hand.1,2 If paralysis is present, it may persist for months but recovery is usually complete.1 CCaA SE R REPORT A 24-year-old female Soldier presented to the emergen cy department (ED) as a return visit for right shoulder trying to catch herself with her right arm. She was seen in same ED 2 weeks after the injury and diagnosed with rotator cuff dysfunction after negative shoulder x-rays. On this subsequent return visit, she was complaining of worsening right shoulder pain with burning, stinging, and electrical shock-like pain with radiation from the posterior/lateral shoulder to the upper right back. She also complained of numbness over the deltoid and dorsal the right arm, but denied any neck pain or trauma. Neurological exam showed 4/5 strength in deltoid, bi bilaterally. She had decreased sensation over the dorsal right hand with lack of discrimination sharp/dull. The hand was also cooler to touch and had mild swelling. Clinical examination of the right shoulder revealed a normal but painful passive range of motion. Active mo bilization of the right shoulder showed scapular winging. Rotator cuff muscle weakness was absent, other than the one noted with supraspinatus. Middle deltoid atrophy was noted. Vascular examination was normal. Previous ED chart and follow up orthopedics and physi cal therapy visits were reviewed. Patient had a right shoulder arthrogram that was read as negative. She was Winging of the Scapula Diagnosed as Parsonage-Turner Syndrome: A Case Report C PT Christine Carroll, MC, USA B ill Bass, MD ABSTRa A CT A 24-year-old active duty female Soldier complained of right shoulder burning, stinging, electrical shock-like pain with radiation to the right hand after completing a ruck march. She also complained of swelling and feel right winging of the scapula. She also exhibited weakness to right arm, weak right hand grip, and decreased sensation over the dorsal right hand. The right hand was also noticed to be colder to touch than the left one. She had tenderness to palpation over right paracervical muscles from C3 to C7. A previous magnetic resonance patient was diagnosed with Parsonage-Turner syndrome.

PAGE 102

100 http://www.cs.amedd.army.mil/amedd_journal.aspxWINGING OF THE SCAPULA DIAGNOSED AS PARSONAGE-TURNER SYNDROME: A CASE REPORT referred to physical therapy and during treatment she noticed worsening pain and weakness. Concerned for spinal cord impingement, patient was sent to ED for further evaluation. The magnetic resonance imagery (MRI) of the cervical spine obtained on the repeat ED visit showed mild disc protrusion at C5-C6 without spinal cord impingement. Findings were discussed with the neurologist on call. Parsonage-Turner syndrome was suspected. Patient was released home with opioids and short term steroid course. Upon further review during subsequent visits, patient was referred to an out of network neurologist and her case was lost to follow up. CCOmm MM ENT Parsonage-Turner syndrome may involve several nerve trunks and vary in presentation, thus being often misdi agnosed as cervical disc disease or rotator cuff dysfunc tion/tear.4 Diagnosis is based on the history and physical 1,4 The characteristic presentation is an acute, severe neurogenic pain in the shoulder or arm lasting for several days or weeks, followed by muscle weak ness, atrophy, and sensory loss as the pain diminishes.4,5 Pain is the most common presenting symptom in almost shoulder, but not by neck movements.5The symptoms do not always correlate with a single nerve root distribution and are often described as patchy, with involvement of multiple muscles and dermatomal neurologic source.4In addition to motor nerve symptoms, sensory nerve in esthesia and hypoesthesia.4,5 Most frequently, the senso ry loss is incomplete and occurs over the lateral shoulder and upper arm or the radial surface of the forearm.5Autonomic dysfunction in the form of trophic skin and nail changes, edema, temperature dysregulation, and in creased sweating is less frequently seen.4,5 Electrodiagnostic studies and neuroimaging have high sensitivity for detecting which nerve trunks are involved and the degree of muscle denervation. However, they needed for precise localization and treatment planning, and they are usually performed more than 3 weeks from clinical onset.1The duration of pain lasts for 1 to 2 weeks or longer. Once initial pain subsides, weakness and muscle atro phy may develop.2,5Testing passive shoulder range of motion may be dif make an accurate diagnosis, it is critical to complete a thorough neurologic and musculoskeletal examination of both the symptomatic and the asymptomatic extremi ties, including testing manual muscle strength, range of shoulder for signs of impingement, adhesive capsulitis, rotator cuff injury, and scapular dyskinesis.5Magnetic resonance imagery remains the test of choice for diagnosis. Cervical MRI may reveal cervical disc disease or nerve root compression. Shoulder MRI may identify other causes of shoulder pain, including rota tor cuff tears, labral tears, shoulder impingement, nerve entrapment, or mass lesions. Abnormalities signifying denervation may be detected on MRI in cases of early PTS, such as diffuse high signal intensity, or atrophy Magnetic resonance imaging may not be sensitive changes in PTS. However, magnetic resonance neurog raphy may show not only early hyperintense thickening of the involved areas of the brachial plexus,5 but also to assessing response to therapy.1The best treatment for PTS remains unknown. There is some evidence stating that early use of oral corticoste roids shortens the time of intense pain and hastens mo tor nerve recovery. In addition, pain may be treated with and opioids.4 not help with diagnosis determination.5The prognosis of PTS for the majority of patients is good, with an estimated three quarters of all patients making a complete recovery within 2 years.2 However, some of the patients may still experience pain, and may develop adhesive capsulitis and shoulder subluxation years after the diagnosis was made.5 CCONCLUSION Parsonage-Turner syndrome is an under-recognized condition. It should be considered as a diagnosis in the setting of an abrupt onset of upper extremity pain

PAGE 103

July September 2017 101 weakness, atrophy and occasional sensory abnormali ties. Treatment with a multidisciplinary approach that includes both physical therapy and multiple medications is acceptable with a goal of maintaining range of mo tion and preventing loss of function. In addition, other therapies such as nerve stimulators and acupuncture should be considered, based on the patients response.5 If conservative treatment fails, early (within 6 months) surgical treatment such as neurolysis, nerve grafts, and nerve transfers may be considered.5 RREFERENCES 1. Zara G, Gasparotti R, Manara R. MR imag ing of peripheral nervous system involvement: Parsonage-Turner syndrome. J Neurol Sci 2012;315(1-2):170-171. 2. S inanovic O, Zukic E, Jusufovic M, Muminovic Umihanic M, Barucija M, Muftic M. Recurrent form of Parsonage-Turner syndrome: case report. J Neurol Sci 2015;357(suppl 1):e345. doi:10.1016/j. jns.2015.08.1225 3. Stutz C. Neuralgic amyotrophy: Parsonage-Turner syndrome. J Hand Surg Am 2010;35(12):2104-2106.4. Smith, CC, Bevelaqua, AC. Challenging pain syndromes. Phys Med Rehabil Clin N Am 2014;25(2):265-277.5. Van Tongel A. Schreurs M, Bruyninckx F, Debeer P. Bilateral Parsonage-Turner syndrome with unilateral brachialis muscle wast ing: a case report. J Shoulder Elbow Surg 2010;19(8):e14-e16. AUTHORS CPT Carroll is an Emergency Medicine Resident at the Darnall Army Medical Center, Fort Hood, Texas. Dr Bass is an Attending Physician, Emergency Medicine Residency Program, Darnall Army Medical Center, Fort Hood, Texas.

PAGE 104

102 http://www.cs.amedd.army.mil/amedd_journal.aspx The US Army Health Readiness Center of Excellence The Army Medical Department Center and School ENVISION, DeE SIGN, TRAIN, EdD UCAte TE, I INSPIRe E Joint Base San Antonio-Fort Sam Houston, Texas

PAGE 105

July September 2017 103

PAGE 106

104 http://www.cs.amedd.army.mil/amedd_journal.aspxThis page intentionally left blank.

PAGE 107

SUBMIssSSION OF MMANUsSCRIPTsS TO THE ARMY MMEDICaAL DDEPaARTMENT JOURNaAL The United States Army Medical Department Journal is published quarterly to expand knowledge of domestic and international military medical issues and technological advances; promote collaborative partnerships among the Services, components, Corps, and specialties; convey clinical and health service support information; and provide a professional, high quality, peer reviewed print medium to encourage dialogue concerning health care issues and initiatives. RREVIEW PPOLICY All manuscripts will be reviewed by the AMEDD Journal s Editorial Review Board and, if required, forwarded to the appropriate subject matter expert for further review and assessment. IIDENTIFICATION OF PPOTENTIAL CCONFLICTsS OF IINTEREsST 1. Related to individual authors commitments: tionships that might bias the work or information presented in the manuscript. To prevent ambiguity, authors must state explicitly on the title page, providing additional detail, if necessary, in a cover letter that accompanies the manuscript. 2. A ssistance: Authors should identify Individuals who provide writing or other assistance and disclose the funding source for this assistance, if any. 3. I nvestigators: in the manuscript. 4. R elated to project support: Authors should describe the role of the study sponsor, if any, in study design; collection, analysis, and interpretation of data; writing the report; and the decision to submit the report for publication. If the supporting source had no such involvement, the authors should so state. PPROTECTION OF HHUMAN SUBJECTsS AND AANIMALsS IN RREsSEARCH When reporting experiments on human subjects, authors must indicate whether the procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the Helsinki Declaration of 1975, as revised in 2000. If doubt exists whether the research was conducted in accordance with the Helsinki Declaration, the authors must explain the rationale for their approach and demonstrate that the institutional review body explicitly approved the doubtful aspects of the study. When reporting experiments on animals, authors should indicate whether the institutional and national guide for the care and use of laboratory animals was followed. IINFORMED CCONsSENT Identifying information, including names, initials, or hospital numbers, should not be published in written descriptions, photographs, as well as in print after publication. Patient consent should be written and archived, either with the Journal the authors, or both, as dictated by local regulations or laws. GUIDELINEsS FOR MMANUsSCRIPT SUBMIssSSIONsS 1. Manuscripts may be submitted either via email (preferred) or by regular mail. Mail submissions should be in digital format (prefer ably an MS Word document on CD/DVD) with one printed copy of the manuscript. Ideally, a manuscript should be no longer than 24 double-spaced pages. However, exceptions will always be considered on a case-by-case basis. 2. T he American Medical Association Manual of Style governs formatting in the preparation of text and references. All articles should conform to those guidelines as closely as possible. Abbreviations/acronyms should be limited as much as possible. Inclu sion of a list of article acronyms and abbreviations can be very helpful in the review process and is strongly encouraged. 3. A c omplete list of references cited in the article must be provided with the manuscript, with the following required data: R eference citations of published articles must include the authors surnames and initials, article title, publication title, year of publication, volume, and page numbers. R eference citations of books must include the authors surnames and initials, book title, volume and/or edition if appropriate, R eference citations for presentations, unpublished papers, conferences, symposia, etc, must include as much identifying information as possible (location, dates, presenters, sponsors, titles). 4. Either color or black and white imagery may be submitted with the manuscript. Color produces the best print reproduction quality, but please avoid excessive use of multiple colors and shading. Digital graphic formats (JPG, TIFF, GIF) are preferred. Editable versions with data sets of any Excel charts and graphs must be included. Charts/graphs embedded in MS Word cannot be used. Prints of photographs are acceptable. If at all possible, please do not send photos embedded in PowerPoint or MS Word. photographic print on the back. Tape captions to the back of photos or submit them on a separate sheet. Ensure captions and photos are indexed to each other. Clearly indicate the desired position of each photo within the manuscript. 5. information must be included on the title page of the manuscript. Submit manuscripts to: DSN 471-6301 Comm 210-221-6301 Email: usarmy.jbsa.medcom-ameddcs.list.amedd-journal@mail.mil EDITOR, AMEDDDD JOURNaALDOTDOT AA BORDeEN IINSTITUTeE3630 SSTa ANLeEY RDRD STSTE B0204 JBSSA FORT SSamAM HOUSTON, T TX 78234-7697

PAGE 108

PIN: 202119-000