Molecular evidence for convergent evolution and allopolyploid speciation within the Physcomitrium- Physcomitrella specie...

MISSING IMAGE

Material Information

Title:
Molecular evidence for convergent evolution and allopolyploid speciation within the Physcomitrium- Physcomitrella species complex
Physical Description:
Mixed Material
Language:
English
Creator:
Beike, Anna K.
Stackelberg, Mark Von
Schallenberg-Rudinger, Mareike
Hanke, Sebastain T.
Follo, Marie
Publisher:
Bio-Med Central (BMC Evolutionary Biology)
Publication Date:

Notes

Abstract:
Background: The moss Physcomitrella patens (Hedw.) Bruch & Schimp. is an important experimental model system for evolutionary-developmental studies. In order to shed light on the evolutionary history of Physcomitrella and related species within the Funariaceae, we analyzed the natural genetic diversity of the Physcomitrium-Physcomitrella species complex. Results: Molecular analysis of the nuclear single copy gene BRK1 reveals that three Physcomitrium species feature larger genome sizes than Physcomitrella patens and encode two expressed BRK1 homeologs (polyploidization-derived paralogs), indicating that they may be allopolyploid hybrids. Phylogenetic analyses of BRK1 as well as microsatellite simple sequence repeat (SSR) data confirm a polyphyletic origin for three Physcomitrella lineages. Differences in the conservation of mitochondrial editing sites further support hybridization and cryptic speciation within the Physcomitrium-Physcomitrella species complex. Conclusions: We propose a revised classification of the previously described four subspecies of Physcomitrella patens into three distinct species, namely Physcomitrella patens, Physcomitrella readeri and Physcomitrella magdalenae. We argue that secondary reduction of sporophyte complexity in these species is due to the establishment of an ecological niche, namely spores resting in mud and possible spore dispersal by migratory birds. Besides the Physcomitrium-Physcomitrella species complex, the Funariaceae are host to their type species, Funaria hygrometrica, featuring a sporophyte morphology which is more complex. Their considerable developmental variation among closely related lineages and remarkable trait evolution render the Funariaceae an interesting group for evolutionary and genetic research. Keywords: Physcomitrella patens, Funariaceae, Hybridization, Polyploidization, Speciation
General Note:
Beike et al. BMC Evolutionary Biology 2014, 14:158 http://www.biomedcentral.com/1471-2148/14/158; Pages 1-19
General Note:
doi:10.1186/1471-2148-14-158 Cite this article as: Beike et al.: Molecular evidence for convergent evolution and allopolyploid speciation within the Physcomitrium- Physcomitrella species complex. BMC Evolutionary Biology 2014 14:158.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
© 2014 Beike et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
System ID:
AA00026948:00001

Full Text

PAGE 1

1 Figure S 2 Alignment of BRK1 amino acid sequences Multiple sequence alignment of BRK1 amino acid sequences from several land plants. The conserved blocks used for primer design are denoted by red boxes. The leading five letters of each sequence identifier denote the species in the common abbreviation (first three letters of the genus, followed by the first two letters of th e species, e.g. PHYscomitrella PAtens ).



PAGE 1

1 Figure S4 Habitus of gametoph ytes Physcomitrella gametoph ytes grown under standardized in vitro conditions on solid mineral medium. (A) Physcomitrella patens [ Physcomitrella patens ssp. patens ] from Gransden, Europe; (B) Physcomitrella patens [ patens ssp. patens ] from Lviv, Europe; (C) Physcomitrella patens [ patens ssp. patens ] from Illinois, USA; (D) Physcomitrella patens [ patens ssp. california ] from California, USA; (E) Physcomitrella readeri [ patens ssp. readeri ] from Australia; (F) Physcomitrella magdalenae [ patens ssp. magdalenae ] from Rwanda, Africa; (G) Physcomitrella readeri [ patens ssp. californica ] fro m Okayama, Japan; (H ) Physcomitrella readeri [ patens ssp. californica ] from Kumamoto Japan; (I) Physcomitrella readeri [ patens ssp. californica ] from Saitama, Japan.



PAGE 1

1 Figure S6 Leaf let details Leaflets of (A) Physcomitrella patens [ Physcomitrella patens ssp. patens ] from Gransden, Europe; (B) Physcomitrella patens [ patens ssp. californica ] from Del Valle Lake, California, USA; (C) Physcomitrella readeri [ patens ssp. californica] from Japan, Okayama; (D) Physcomitrella magdal enae [ patens ssp. magdalenae ] from Rwanda, Africa. Both accessions from Europe and North America reveal a costa in contrast to those from Okayama, Japan. Physcomitrella from Rwanda, Africa has orbiculate leaflets in comparison to the lanceolate leaflets of the other accessions.



PAGE 1

1 Figure S3 Phylogenetic tree using BRK1 Neighbor joining tree of using BRK1 (Pp1s35_157V6.1) from selected Funariaceae. The three distinct clades of Physcomitrella are highlighted in bold. The distinct loci of BRK1 for each Physcomitrium species are highlighted in boxes. Green boxes: distinct loci of P. pyriforme accessions from Europe. Blue boxes: distinct loci of one P. collenchymatum accession from North America from two different capsules. Red boxes: distinc t loci of BRK1 from three accessions of P. eurystomum from Europe. The numbers at the nodes are derived from 1,000 bootstrap samples.



PAGE 1

1 Figure S 1 Alignment of genomic BRK1 sequences Multiple sequence alignment of amplified and clonal genomic sequences of BRK1 from different Funariaceae. The exon region is shown in white letters, the intron region in black letters. The species names are sorted alphabetically. Accessions with only one locus of BRK1 are represented by one sequence of directly sequenced PCR product, whereas two representative clonal sequences are sh own for each accession with two loci of BRK1 ( P.

PAGE 2

2 collenchamytum P. eurystomum and P. pyriforme ). Polymorphisms in the exon regions are depicted in red ( P. collenchymatum ) and orange ( P. eurystomum ) boxes.



PAGE 1

Photo by Manuel Hi Molecularevidenceforconvergentevolutionand allopolyploidspeciationwithinthe Physcomitrium Physcomitrella speciescomplexBeike etal. Beike etal.BMCEvolutionaryBiology 2014, 14 :158 http://www.biomedcentral.com/1471-2148/14/158

PAGE 2

RESEARCHARTICLEOpenAccessMolecularevidenceforconvergentevolutionand allopolyploidspeciationwithinthe Physcomitrium Physcomitrella speciescomplexAnnaKBeike1,2,MarkvonStackelberg2,4,MareikeSchallenberg-Rdinger10,SebastianTHanke1,3,10,MarieFollo6, DietmarQuandt5,StuartFMcDaniel7,RalfReski2,3,8,9,BenitoCTan11andStefanARensing1,3,9,10*AbstractBackground: Themoss Physcomitrellapatens (Hedw.)Bruch&Schimp.isanimportantexperimentalmodelsystem forevolutionary-developmentalstudies.Inordertoshedlightontheevolutionaryhistoryof Physcomitrella and relatedspecieswithintheFunariaceae,weanalyzedthenaturalgeneticdiversityofthe Physcomitrium Physcomitrella speciescomplex. Results: Molecularanalysisofthenuclearsinglecopygene BRK1 revealsthatthree Physcomitrium speciesfeature largergenomesizesthan Physcomitrellapatens andencodetwoexpressed BRK1 homeologs(polyploidization-derived paralogs),indicatingthattheymaybeallopolyploidhybrids.Phylogeneticanalysesof BRK1 aswellasmicr osatellite simplesequencerepeat(SSR)datacon firmapolyphyleticoriginforthree Physcomitrella lineages.Differencesin theconservationofmitochondrialeditingsitesfurthers upporthybridizationandcrypticspeciationwithinthe Physcomitrium Physcomitrella speciescomplex. Conclusions: Weproposearevisedclassificationofthepreviouslydescribedfoursubspeciesof Physcomitrella patens intothreedistinctspecies,namely Physcomitrellapatens Physcomitrellareaderi and Physcomitrella magdalenae .Wearguethatsecondaryreductionofsporophytecomplexityinthesespeciesisduetothe establishmentofanecologicalniche,namelysporesr estinginmudandpossiblesporedispersalbymigratory birds.Besidesthe Physcomitrium Physcomitrella speciescomplex,theFunariaceaearehosttotheirtypespecies, Funariahygrometrica ,featuringasporophytemorphologywhi chismorecomplex.Theirconsiderable developmentalvariationamongclosely relatedlineagesandremarkabletrai tevolutionrendertheFunariaceaean interestinggroupforevolutionaryandgeneticresearch. Keywords: Physcomitrellapatens ,Funariaceae,Hybridization,Polyploidization,SpeciationBackgroundAmajorgoalinevolutionarybiologyistounderstand theprocessesthatgeneratenewspecies.Untilrecently, geneticanalysesofspeciesdifferenceshavereliedona smallnumberofmodelsystems.Hereweexaminepatternsofdivergenceamongrelativesofthemoss Physcomitrellapatens (Hedw.)Bruch&Schimp.,thefirstbryophyte withcompletelysequencedandwell-annotatednuclear, plastidandmitochondrialgenomes[1-4]. P.patens belongstotheFunariaceae,afamilyofsmall,terricolous mosseswithhighlydiversesporophytemorphology.In contrasttootherFunariaceae, Physcomitrella ischaracterizedbyashortsporophytelackingmanyoftheornamentationstypicalinmosses.Thehistoryofthegenus wasreviewedbyTan[5].TheIndexMuscorum[6] listedfourspeciesinthegenus Physcomitrella .Ofthe fourtaxa, Physcomitrella austro-patens Broth.and P. californica H.A.CrumandL.E.Andersonweretreated laterassynonymsof P.readeri (Mll.Hall.)I.G.Stone &G.A.M.Scott. Physcomitrellahampei Limpr.was interpretedasahybridspecies[5-7].However,basedon *Correspondence: stefan.rensing@biologie.uni-marburg.de10PlantCellBiology,FacultyofBiology,UniversityofMarburg, Karl-von-Frisch-Str.8,35043Marburg,Germany Fulllistofauthorinformationisavailableattheendofthearticle 2014Beikeetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycredited.TheCreativeCommonsPublicDomain Dedicationwaiver(http://creativecommons.org/publicdomain/zero/1.0/)appliestothedatamadeavailableinthisarticle, unlessotherwisestated.Beike etal.BMCEvolutionaryBiology 2014, 14 :158 http://www.biomedcentral.com/1471-2148/14/158

PAGE 3

variablebutoverlappingphenotypiccharacteristics,a revisedclassificationofthegenus Physcomitrella was subsequentlyproposedbyTan[5],whichdescribed Physcomitrella asonesinglepolymorphicspecieswith foursubspecies,namely P.patens ssp. patens fromEurope, P.patens ssp. readeri (Mll.Hal.)B.C.TanfromAustralia, P.patens ssp. californica (H.A.Crum&L.E.Anderson) B.C.TanfromCalifornia(NorthAmerica)andJapan, and P.patens ssp. magdalenae (deSloover)B.C.Tan fromRwanda(Africa).Currently,themajorityofbryologistsacceptthreeseparatespecies,namely Physcomitrella patens P.readeri and P.magdalenae DeSloover. P.patens hasawidedistributionintheNorthernHemisphere, P. readeri isfoundinCalifornia(NorthAmerica),Australia andJapan[8],while P.magdalenae hasbeenreported fromRwanda,Africa[9,10].Recentdatasuggestthatthe Physcomitrella phenotypearosethreetimeswithinthe Physcomitrium Physcomitrella speciescomplex,basedon phylogeneticanalysesofnuclear,chloroplast,andmitochondrialDNAsequencedata[11,12].Here,thespecies complexisdefinedasataxonomicgroupofintergraded phenotypesthathindersseparationbasedonmorphologicaltraits.Duetothefactthat Physcomitrella hasbeen classifiedasasinglespeciesbasedonsimilarmorphologicalcharactersofthesporophytes,ithasbeenargued thatsuchcharactersshouldnotbeusedforclassification [11].Inordertotestthepolyphyleticoriginofthegenus Physcomitrella andtoanalyzewhethermonophyletic groupscorrespondingtospeciescanberesolvedwithin Physcomitrella ,weperformedphylogeneticanalysesofa nuclearsinglecopygene( BRK1 )[13]andmicrosatellite simplesequencerepeat(SSR)dataamplifiedfromnumerousaccessionscoveringallfour Physcomitrella subspecies andfurtherFunariaceae. Regardingthesequenced P.patens strainfromGransden (Europe),thehaploidchromosomenumberofn=27for meioticandmitoticcells[14,15]providesevidencefora complexhistoryofpolyploidization,sincethebasenumberofchromosomesisreportedtoben=4 – 7among mosses[16-18].Genomeduplicationorpolyploidizationis animportantmechanismofeukaryoticevolution[19-22] andconsideredtobeofparticularrelevanceinthespeciationanddiversificationoflandplants.Moleculardata haveconfirmedthat P.patens isapaleopolyploidthat underwentatleastonewhole-genomeduplicationevent approximately45MYAduringtheEocene[23].However,someotherFunariaceaefromwithinthe Physcomitrium Physcomitrella speciescomplexhaveevenhigher chromosomenumbersranging,e.g.,fromn=9ton=72 for Physcomitriumpyriforme ,orn=9ton=54for Physcomitriumeurystomum [18].Takingthisintoaccount,along withthefactthatsomeFunariaceaeshowinterfertility[5,12,24,25],aconsiderablenumberofpolyploids,includingallopolyploidhybridspecies,canbeexpected.Natural hybridsamongtheFunariaceae,typicallycharacterizedby intermediatesporophyticcharacteristics[26,27],havealso beendescribedfromthefield[28-31].Theputativehybrid originof Physcomitriumcollenchymatum and P.eurystomum wasrecentlybeensuggestedbasedonmolecular dataandgenealogicalanalysesofsixdifferentloci,includingribosomal,plastid ic,andnuclearmarkergenes [12].However,scarceevidenceforpolyploidizationderivedparalogs(homeologs)ofsinglecopygenesinthe analyzed Physcomitrium specieshasbeenshowntodate. Inthisstudy,weanalyzedgenomesizesandhomeologsofthenuclearsinglecopygene BRK1 [13]acrossa broadrangeofFunariaceaeaccessionsinordertotest whetherspeciesbelongingtothegenus Physcomitrium areallopolyploidhybrids.Wechose BRK1 asaphylogenetic markergeneasitisasinglecopygeneinnearlyallofthe landplantgenomessequencedtodate(Additionalfile1: FigureS2).Inaddition,weassessedtherequirementof RNAeditingsitestobeedited,sinceoutof13 P.patens editingsites(cytidineswhic harepost-transcriptionally changedintouridines)[32,33]threearenotpresentin Funariahygrometrica [34],thusrenderingthepattern ofeditingsitegainandlossapotentiallyinformative evolutionaryfeaturewithintheFunariaceae.Basedon phylogeneticanalysisofthenovelmarkergene BRK1 microsatellite-derivedgeneticdistancesanddifferent editingpatterns,wehaverevisedthe Physcomitrella subspecies sensu Tan[5]andhypothesizeonspeciation andthemodeofsporedispersalin Physcomitrella .MethodsFunariaceae invitro collection,cultureandobservationNumerousFunariaceaeaccessions(determinedbythe collectors)werecontributedtotheauthors(Table1)and establishedinaxenic invitro cultureaspreviouslydescribed[12,35].Allplantsoriginatedfromrecentisolates exceptthe P.patens accessionfromGransden(Europe) whichderivesfromasinglesporeisolatedbyH.L.K. Whitehousein1962[14].Informationaboutlocality, habitat,collectors,yearofcollection,InternationalMoss StockCenter(IMSC)numbersandvouchers,aswellas molecular,morphologicalandflowcytometricdataare availableforselectedspeciesfromthatcollection (Additionalfile2:TableS1).Plantsfromtwocapsules collectedatthesamelocationweredenotedwitha “ K ” andthecapsulenumber.Atpresent,the invitro collectioncomprises38Funariaceaeaccessionsfromdifferent worldwidelocations(Additionalfile2:TableS1).These accessionswereassignedtotaxaaccordingtothespeciesclassificationofthecollectorsandencompass20 Physcomitrella ,14 Physcomitrium ,three Funaria and one Aphanorrhegma accession.The Physcomitrella accessionscompriseplantsfromregionswherethefourdifferentsubspecieswereoriginallyfound[5,10]. P.patens ssp.Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page2of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 4

Table1FunariaceaespeciescollectionSpecies(revised)LocalityRegionCollector Physcomitrella subspecies ( sensu Tan) Physcomitrellapatens GransdenWood,Huntigdonshire,UKEuropeWhitehouse patens NeneWashes,Cambridge,UKEuropePreston patens Cholsey,Berkshire,UKEuropePorley patens BadHonnef,Grafenwerth,Rheinland-Pfalz,GermanyEuropeFrahm patens Heimerbrhl,Rheinland-Pfalz,GermanyEuropeWolff patens Nennig,Saarland,GermanyEuropeCaspari patens Martinshof,Saarland,GermanyEuropeCaspari patens Villersexel,HauteSane,France(K3+K4)EuropeLth patens Lviv,UkraineEuropeLobachevska patens Wikcastle,Uppsala,SwedenEuropeNilsson,Thelander,Olsson, Ronne patens Trondheim,NorwayEuropeHassel patens Gemnd,Nordrhein-Westfalen,Germany(K5)EuropeFrahm patens Gemnd,Nordrhein-Westfalen,Germany(K1) (var.megapolitana) EuropeFrahm patens KaskaskiaIsland,Illinois,USANorth America Sargent&Vitt patens DelValleLake,California,USANorth America Mishler californica Physcomitrellareaderi Kumamoto,Shisui-cho,Kyushu,JapanJapanOno&Deguchi californica Saitama,Iwatsuki-shi,Honshu,JapanJapanHiguchi californica Okayama,Honshu,JapanJapanHasebe californica MeltonReservoir,Victoria,AustraliaAustraliaStajsic&Klazenga readeri Physcomitrella magdalenae Mt.Bisoke,Ruhengeri,RwandaAfricaSolga&Buchbender magdalenae Physcomitrium sphaericum Grosshartmannsdorf,Osterzgebirge,Sachsen,GermanyEuropeFrahm Imsbach-Aue,Saarland,GermanyEuropeWolff Vellescot,Territore-de-Belfort,FranceEuropeLth Physcomitrium eurystomum Neukirch,AllguWest,Wangen,Bodenseekreis,BadenWrttemberg,Germany EuropeSchfer-Verwimp Neustadt,Thringen,GermanyEuropeEckstein Schleiz,Thringen,GermanyEuropeEckstein Physcomitriumpyriforme Bischofswerda,Sachsen,GermanyEuropeEckstein Nordhausen,Liebenrode,Thringen,GermanyEuropeEckstein Waltershof,Gera,Thringen,GermanyEuropeEckstein Haardtrand,Ebekoben,Rheinland-Pfalz,GermanyEuropeLauer vergran,Biskops-Arn,Uppland,SwedenEuropeLnnell Madeira,PortugalEuropeEckstein Durham,OrangeCounty,NorthCarolina,USANorth America Goffinet Physcomitrium collenchymatum ShawNatureReserve,FranklinCounty,MO,USA(K1,K2A,K2B)North America Allen&Darigo Funariahygrometrica Durham,OrangeCounty,NorthCarolina,USANorth America Goffinet Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page3of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 5

patens isrepresentedby14accessionsfromdifferentregionsofEuropeandoneaccessionfromNorthAmerica. P.patens ssp. californica accessionsareavailablefrom NorthAmericaandJapan,onefromthesouthernisland KyushuandtwofromthecentralislandHonshu. P.patens ssp. magdalenae wascollectedinRwanda,Africa.One accessionof P.patens ssp. readeri isavailablefromthe MeltonReservoirinAustralia.Inadditiontothat, Aphanorrhegmaserratum andthree Funaria speciesfrom NorthAmericaarerepresentedinthecollection.Concerning Physcomitrium ,three P.sphaericum accessions, three P.eurystomum accessions,seven P.pyriforme accessionsfromEuropeandNorthAmericaandone P. collenchymatum accessionfromNorthAmericaarealso available(Table1,Additionalfile2:TableS1). PlantswerecultivatedonsolidmineralKnopmedium [36]aspreviouslydescribed[37].Forstandardizedobservationofgametophyticfeatures,plantsweregrown onPetridishes(9cmdiameter)wrappedwithlaboratory film.Environmentalconditionsweresetto22degrees Celsiusandalongday(16hlight,8hdark)lightcycle (whitelightat70 mol*s 1*m 2).Plantswereestablishedbytransferofindividualgametophores,andobservedunderastereobinocular(Zeiss,Germany)after severalweekstomonthsofgrowth.GenomicDNAextractionGenomicDNAwasextractedfrommosstissuefollowing thecetyltrimethylammoniumbromide(CTAB)method describedby[38].Upto100mgofmossmaterialwas disruptedwithaTissueLyser(Qiagen,Hilden,Germany) andincubatedfor30minin700 LCTABbuffer(2% CTAB,1.4MNaCl,20mMEDTA,0.5%PVP40, 100mMTris/HCl,pH8.0;0.2%2-mercaptoethanol[v/v] addedbeforeuse).Subsequently,600 Lchloroform: isoamylalcohol(24:1)wasadded.Phaseseparationwas reachedaftervigorousmixingbycentrifugation(16,100g) for5min.Theaqueousphasewastransferredtoafresh tubeand2/3[v:v]isopropanolwasaddedforprecipitation at 20Covernight.TheDNAwassedimentedbycentrifugation(20,817xg)for30 – 45minat4C.Thesupernatant wasremovedandthepelletwaswashedtwicewith200 L of70%ethanol.Aftercentrifugation(16,100xg),the supernatantwasremoved.DNAwasdissolvedin100 L TEbuffer(0.1MTrisHCl,0.01MEDTA,pH7.5with HCl).ForRNAsedigestion,10 gRNAseA(10mg/mL, ThermoScientific,St.Leon-Rot,Germany)wereaddedand theDNAwasincubatedfor1hat37C.RNAsedigestion wascontrolledandDNAconcentrationwasdeterminedby gelelectrophoresisin1%agarosegels.Amplificationof BRK1 fromgenomicDNAApartofthenucleargene BRK1 (Pp1s35_157V6.1)was amplifiedusingtheprimersBRICK1_for:GTCGGCATTG CTGTACAAandBRICK1_rev:CTCCAGCTGACGCT CCAG.ThePCRwasperformedin20 Lreactionvolumecontaining2 L10BufferE(Genaxxon,Biberach, Germany),0.4 Ldeoxyribonucleotidetriphosphates (dNTPs,10mM,ThermoScientific,St.Leon-Rot,Germany), 1.25UTaqpolymerase(Genaxxon,Biberach),0.5 lof eachprimer(10pmol/ L)and1 LgenomicDNA(50 – 100ng/ L).ThePCRcyclingconditionsconsistedofan initialdenaturationat94Cfor5min,followedbycycling conditionswhichconsistedofadenaturationstepof45s at94C,annealingat52Cfor1minandelongationat 72Cfor1minforatotalof30cycles.ThePCRproductswereelutedandpurifiedfroma1%agarosegel withtheQIAquickGelExtractionKit(Qiagen,Hilden, Germany)accordingtothemanufacturer ’ sinstructions.Cloningof BRK1 andplasmidDNAextractionThePCRsequencingproductsof P.eurystomum P.collenchymatum and P.pyriforme showedoverlappingsequencepeaks(polymorphisms)intheelectropherogram (Figure1A).Inordertoobtainclearsequencesforpotentiallymultiplelociof BRK1 forthesespecies,the PCRproductswereclonedintothebluntendvector pJET1.2/bluntaccordingtothemanufacturer ’ sprotocol (CloneJET ™ MolecularCloningKit,ThermoScientific, St.Leon-Rot,Germany).Thevectorwastransformed into E.coli cells,whichwereincubatedovernighton solidampicillin-containingLBmediumat37Cforselection.BacterialcolonieswerescreenedfortheinsertionofplasmidDNAviaPCRusingthepJET1.2/blunt primerspJet_T7_for:TAATACGACTCACTATAGGG andpJet_rev:GAAGAACATCGATTTTCCATGGCAGC. Table1Funariaceaespeciescollection (Continued)Funariaamericana Canada,AlbertaNorth America Goffinet Funariaflavicans Durham,OrangeCounty,NorthCarolina,USANorth America Goffinet Aphanorrhegmaserratum Arkansas,USANorth America BuckSeveralFunariaceaewerecontributedtotheauthorsandestablishedinaxenic invitro culture.Thenameofeachspecies,locality,regionandcollectorarelisted foreachaccession.For Physcomitrella ,therevisedtaxonnameaccordingtothenewclassificationproposedhereislistedontheleft,whiletheformernameof thesubspeciesasdescribedbythecollectorislistedontheright.Forfurtherinformation,e.g.yearofcollection,habitatandavailabledata( BRK1 ,SSRs,editing analysis,genomesize,IMSCnumber)seeAdditionalfile 2 :TableS1.Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page4of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 6

PlasmidDNAextractionwasperformedafteranovernight incubationinampicillin-containingliquidLBmediumat 37CusingtheGeneJET ™ PlasmidMiniprep-Kit(Thermo Scientific,St.Leon-Rot,Germany).Directsequencingof BRK1 PCRproductsandofplasmid clonesIntotal,10 – 50ng/ LofthepurifiedPCRproductwere sentforsequencingtoGATCBiotechAG(Konstanz, Germany)usingtheprimersBRICK1_forandBRICK1_rev. PlasmidDNAwassentinconcentrationsof30 – 100ng/ L andSangersequenced(GATCBiotechAG,Konstanz, Germany)withastandardsequencingprimerfortheblunt endvectorpJET1.2/blunt(ThermoScientific,St.LeonRot,Germany).Foraccessionswithpolymorphicdirect PCRsequencingproducts,upto10plasmidDNAsfrom independentclonesweresentforsequencing,respectively. Sequenceswhichwereobtainedatleasttwiceindependentlywereconsideredtrueandusedforphylogeneticanalyses.Exceptionstothiswerebothsequencesof BRK1 for one P.pyriforme accession(Nordhausen,Europe),andone sequencerepresentingonelocusof P.collenchymatum (ShawNatureReserve,FranklinCounty,MO,USA)which wereeachobtainedonlyonce.Thesesequenceswereincludedintofurtheranalysessincetheywerefoundtobe identicaltocorrespondingsequencesofotheraccessions fromthesamespecies.BRK1 sequenceanalysisThesequencechromatogramswereanalyzedwith theChromasProsoftware,version1.34(http://www. technelysium.com.au/ChromasPro.html).MultiplesequencealignmentswerecalculatedwithMUSCLE3.51 [39]andvisualizedwithJalview[40].Thegenestructure of BRK1 wasannotatedwithinthemultiplesequence alignmentaccordingtothegenestructurefoundin P. patens (Pp1s35_157V6.1,Additionalfile3:FigureS1). Neighbor-joininganalysiswasperformedwithQUICKTREE_SD[41,42]using1,000bootstrapreplicates.Bayesian inferencewascarriedoutwithMrBayes[43],usingthe GTRmodelwitheightgammadistributedrates,invariant sites,twohotandtwocoldchains,burn-in250andtwo milliongenerations,untilthestandarddeviationofsplitfrequenciesdroppedbelow0.01 .MaximumlikelihoodinferencewascarriedoutwithTREE-PUZZLE[44]usingthe GTRmodelwitheightgamma-distributedrates,quartet puzzling(10,000steps)andexactparameterestimation. WhiletheMaximumLikelihoodtreeisshown,support valuesfromallthreemethodsareplottedonthetree (seelegend).ThetreewasvisualizedwithFigTreev1.1.2 (http://tree.bio.ed.ac. uk/software/figtree/).RNAeditinganalysisDNAwaspreparedfromplantmaterialusingtheextractionmethoddescribedby[45].Primerpairsborderingregionsof nad 3, nad 4, nad 5(subunitsofcomplexI, ampliconlength343bp,392bpand459bp,respectively), cox 1(subunitofcomplexIV,252bp), rps 14(ribosomalproteinS14,246bp)and ccm FC(cytochrome biogenesisfactorsubunitC,210bp)harboringmitochondrialeditingsitesidentifiedinthe P.patens accessionfromGransden[34],wereusedforPCRassays. Amplificationassayswereperformedasdescribed[34]. PCRproductsweregel-purifiedusingtheHiYieldPCR Clean-up&Gel-Extractionkit(SdlaborbedarfGmbH, Gauting,Germany)orpurified usingExoSAP-IT(Affymetrix, SantaClara,USA)andSangersequenced(GATCBiotech AG,Konstanz,Germany).DNAsequenceswerealignedto thecorrespondingcodingsequencesof P.patens and Funariahygrometrica [34]usingMega5.0[46]andputativeeditingsiteswereidentifiedviaPREPACT2.0[47]. Figure1 Electropherogramsofthe BRK1 intronregionfrom Physcomitriumeurystomum. (A) Directsequencingproductof BRK1 amplified from P.eurystomum (Schleiz,Europe)genomicDNA.Sequencepolymorphismsareindicatedwithblackarrows. (B) Clonalsequencingproductsof the BRK1 showingtwodistincthomeologsof BRK1 in P.eurystomum .FiguregeneratedusingGentle(http://gentle.magnusmanske.de/). Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page5of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 7

AmplificationofEST-derivedmicrosatellitesGenomicDNAwasextractedaspreviouslydescribed[48]. Sixty-foursimplesequencerepeat(SSR)lociwithavailable polymorphisminformationcontent(Tablehttp://www. cosmoss.org/376_PCR_tested _SSRs.xlsonhttp://www. cosmoss.org/genmap.content)werechosenfromacollectionofEST-derivedmicrosatellites[48].Intotal,49loci werefoundtobesuitablebymeansofPCR,usingtherespectivefirstprimerpairlisted;theSSRnumberingin Additionalfile4:TableS2correspondstotheoneinthe abovementionedoriginaldata.SSRlociwereamplifiedin a20 LPCRmixcontaining2 lof10RED-Taq-PCR buffer,0.1mMdATP,dCTP,dGTPanddTTP,5pmol eachoftwoprimers,0.5URED-Taq-Polymerase(SigmaAldrich,Deisenhofen,Germany)and4nggenomicDNA. PCRwascarriedoutstartingwithaninitialDNAdenaturationat95Cfor2min.Thefirstcycleconsistedof30s denaturationat92C,withprimerannealingfor30sat 60Candelongationfor30sat72C.Ineachofthe10 subsequentcycles,theannealingtemperaturewasdecreasedby0.7C.Thefinal25cyclesconsistedof15s denaturationat92C,15sprimerannealingat52Cand 30selongationat72C.SSRPCRproductsweresize separatedin3%MetaPhor(CambrexCorporation,East Rutherford,USA)highresolutionagarosebygelelectrophoresisin0.5foldTBE(45mMTris-borate,1mM EDTA,pH8.0)andvisualizedbyethidiumbromide staining.SSRdataanalysisSSRlociwerescoredmanuallyforallincludedaccessions accordingtotheiramplifiedfragmentsize.Distinguishable sizeswerescoredasdifferentalleles;indistinguishable sizeswerescoredasthesameallele(Additionalfile4: TableS2).AbsenceofPCRproductswasscoredasahaploidnullallele.Thedatasetincludedall Physcomitrella accessionsaswellas Physcomitriumsphaericum (Additional file2:TableS1).Geneticdistanceswerecalculatedwith Nei ’ sDAdistancealgorithm[49].Thephylogenetictree wasconstructedwiththeNeighbor-Joiningalgorithm[50] using1,000bootstrapreplicates.Forgeneticdistanceand phylogenetictreecalculationsthesoftwarePOPULATION 1.2.28[51]wasusedandthetreewasvisualizedusing FigTree(http://tree.bio.ed. ac.uk/software/figtree/).In addition,thedifferentsizedallelesderivedfromthe49 SSRlociweretransformedinto170binarypresence/ absencecharacters(nullalleleswerescoredasgaps). Thebinaryencodingmightoverestimatevariation,but wasnecessarysinceSplitsTreedoesnotallowpresentationofthedatainacontinuousfashion.Basedon thismatrix(Additionalfile4:TableS2),SplitsTree4 [52]wasusedtocalculateGeneContentdistancesand abootstrapped(1,000repl icates)NeighborNet.FlowcytometryGametophores,pre-culturedforfourweeks,werechopped usingarazorbladeinbuffer(0.107gMgCl2*6H2O,0.5g NaCl,1.211gTris,0.1mLTritonX-100in100mLwater, pH7.0withHCl)containing1mg/L4.6Diamidino-2Phenylindol(DAPI).Thedebriswasfilteredthrougha 40 msievepriortomeasurement.Theflowcytometric measurementwasperformedwithaMoFloHighSpeed CellSorter(BeckmanCoulter,Krefeld,Germany).ThenucleiweresortedonthebasisoftheirforwardandsidescatterprofilesaswellasontheirDAPIsignals.Thescatter measurementswereperformedusingexcitationfroman argonionlaserat488nmat200mWpower,whilethe DAPIsignalcamefromexcitationwithanargonion lasersetupformultilineUVemission(351 – 356nm)at 80mW.DAPIemissionwasmeasuredfrom440to 460nm.Asareferencetocontrolfortherelativeintensitiesofthesamples,20 LofDAPIReferenceStandard Beads(BangsLaboratories,Inc.,Cat.906,Lot-No.7238) wereaddedtoeachsample.TheDAPIbeadscouldbe separatedfromthenucleionthebasisoftheirforward versussidescatterprofiles. Profileswereseparatedinto DAPI,1n(1c)and2n(2c)peaks.The2npeakrepresentscellsarrestedattheG2/Mtransition[53].Values presentedinTable2aretheaveragedmedianofthe1n peakdividedbythemedianofthepeakfortheDAPI beads,i.e.,haploidnuclearDNAcontentnormalizedto DAPIcontrolbeads.Theratiobetweenthe1nand2n peakwas1.99+/ 0.19inallsamples,supportingcorrect peakdefinition(Additionalfile5:TableS3). P.patens from Gransdenservedasanadditionalcontrolforeachexperiment[n=6];otheraccessionsweremeasureduptofour timesifindoubtofmeasurementquality. Table2GenomesizesofFunariaceaeSpecies(revised)Genomesize[1c] Physcomitrella subspecies ( sensu Tan) Physcomitrellapatens 0.960.15 patens,californica Physcomitrellareaderi 0.960.05 readeri,californica Physcomitrellamagdalenae 0.92 magdalenae Physcomitriumsphaericum 0.780.43 Physcomitriumeurystomum 1.270.32* Physcomitriumcollenchymatum 1.510.44 Physcomitriumpyriforme 1.330.42* Funariahygrometrica 0.440.03* Aphanorrhegmaserratum 0.9Genomesizeshownisthehaploid(1c)peaknormalizedbyDAPIbeads(see Methods );valuesareshown+/ standarddeviationwhereapplicable. Asterisksshowsignificantlydifferentgenomesizewithregardto P.patens (one-sided t -test,p<0.05).genomesizeforGransden=1.02+/ 0.14, Villersexel “ K3 ” =0.87,DelValleLake( californicasensu Tan)=0.75;forfurther detailsseeAdditionalfile 5 :TableS3.For Physcomitrella ,therevisedtaxon nameaccordingtothenewclassificationproposedhereislistedontheleft, whiletheformernameofthesubspeciesislistedontheright.Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page6of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 8

Sequencingof BRK1 transcriptsfromsixselected FunariaceaeTotalRNAwasextractedusingtheQiagenRNeasyPlant MiniKit(Qiagen,Hilden,Germany)accordingtothemanufacturer ’ sinstructions,followedbyon-columnDNAsedigestion.TheresultingRNAsamplesfrom P.patens from Gransden(Europe),threeaccessionsfrom P.eurystomum (Neukirch,NeustadtandSchleiz,Germany)andtwoaccessionsfrom P.collenchymatum (ShawNatureReserve, FranklinCounty,MO,USA)werereversetranscribed usingSuperscriptIII(Invitrogen ™ ,Karlsruhe,Germany). ThereverseprimerBRK1_rev(CACCGTTAGCTTCTC GTTCA)wasusedforprimingthefirststrandsynthesis. TheresultingcDNAwasthenfurtheramplifiedusingboth BRK1 primers,BRK1_for(GACAATCGCCATTTTTC GAG)andBRK1_rev,andsubsequentlySangersequenced (GATCBiotechAG,Konstanz,Germany).Theprimers usedwereselectedbasedonmultiplesequencealignment ofclonalsequences.QuantitativeReal-TimePCRandhigh-resolution-meltingTotalRNAwasextractedandcDNAwassynthesizedas describedabove.cDNAsynthesiswasverifiedbyPCR. PrimersforquantitativeReal-TimePCR(qPCR)were designedtospecificallyamplifya129bplongfragment oftheexoncontainingpolymorphismsin P.collenchymatum (BRK1_for:GACAATCGCCATTTTTCGAGand BRK1_revCACCGTTAGCTTCTCGTTCA).EachqPCR wascarriedoutusingtheSensiMixHRMkit(Bioline, Lickenwalde,Germany)onaLightCycler480(Roche, Mannheim,Germany)withthefollowingparameters: 95Cfor10min,followedby50cyclesof95C,60C and72C,for15seach.Highresolutionmeltinganalysis wassubsequentlycarriedoutfrom65Cto95Cwitha ramprateof0.02C/s.Meltingcurvedatawereanalyzed usingtheGeneScanningsoftware(Roche,Mannheim, Germany)andasensitivitysettingof0.4withautogrouping.Pre-meltandpost-melttemperatureswere chosenintherangeof77Cand84Crespectively.ResultsParalogsofthesinglecopygene BRK1 andenlarged genomesizesprovideevidenceforallopolyploidhybrid Physcomitrium speciesInordertogainevidenceforhomeologsofthesinglecopy gene BRK1 weamplifiedthisgenefromselectedFunariaceae,includingthegenera Aphanorrhegma Physcomitrella Physcomitrium and Funaria (Table1,Additional file2:TableS1).ThesequencelengthamplifiedfromgenomicDNA(includingthesingleintron)wasapproximately600nucleotides,butvariesbetweentheanalyzed species(Table3).InthePCRproducts,sequencepolymorphismsweredetectedwithinallaccessionsofthespecies P.pyriforme P.collenchymatum and P.eurystomum indicatingmultiple BRK1 lociwithinthesespecies.However,nosequencepolymorphismsweredetectedinthe Aphanorrhegma Funaria and Physcomitrella accessions (Table3).AftercloningtherespectivePCRproducts,two distinctsequenceswereclearlydistinguishableper Physcomitrium species,respectively(Figure1A).Theselociwere comparedtothepolymorphicdirectsequencingproduct inordertocomparethesequencepolymorphismswith bothclonalsequencesof BRK1 (Figure1B).Mostdifferencesbetweenthehomeologsoccurredinthesingle intron,whileinthecaseof P.collenchymatum and P. eurystomum polymorphismsalsooccurredintheexons (Additionalfile3:FigureS1,Table3).Phylogeneticanalysesrevealedtwodistinctcladesofthehomeologous BRK1 for P.pyriforme P.eurystomum and P.collenchymatum (Figure2).Sincethreeoftheseclades(oneper Physcomitrium lineage)clusterwiththe P.patens (ssp. magdalenae )accessionfromAfrica(labelled P.magdalenae inFigure2),andtwooftheotherthreewith P.patens fromEurope,theyprovideevidenceforallopolyploidizationratherthanautopolyploidization. Flowcytometricmeasurementswereperformedforall Funariaceaeforwhichthe BRK1 sequencewasavailable, includingmultipleaccessionsof Physcomitrella P.pyriforme P.eurystomum and P.collenchymatum (Additional file2:TableS1).Allaccessionsof Physcomitrella showa comparablegenomesizeas P.patens fromGransden (Europe),whereas P.pyriforme P.eurystomum and P. collenchymatumhavealargersize(Table2),albeit P. collenchymatum notsignificantly(p>0.05,one-sided t test).ThesehigheramountsofDNA,togetherwiththe BRK1 homeologs,indicatethat P.pyriforme P.collenchymatum and P.eurystomum arerecentallopolyploids. Table3Sequencepolymorphismsof BRK1Species(revised) BRK1 sequence length(nucleotides) Polymorphisms (exon/intron);gaps Physcomitrellapatens 5810 Physcomitrellareaderi 5800 Physcomitrellamagdalenae 5770 Physcomitriumeurystomum 61427(1/26);1 Physcomitrium collenchymatum 61426(2/24);1 Physcomitriumpyriforme 61519(0/19);5 Funariaflavicans 5800 Funariahygrometrica 5460 Funariaamericana 5800 Aphanorrhegmaserratum 5480OverviewofsequencepolymorphismsinthedirectPCRproductof BRK1 from differentFunariaceae.Foreachspeciesmultipleaccessionsareincluded.The numberofsequencepolymorphismsandgapsbetweentwohomeologsfrom the Physcomitrium accessionsisshownontheright.FordetailsseeAdditional file 3 :FigureS1.Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page7of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 9

Expressionpatternsof BRK1 homeologsin Physcomitrium speciesInordertodeterminewhetherbothlociof BRK1 are expressedin P.collenchymatum and P.eurystomum RT-PCRandquantitativeReal-TimePCR(qPCR)were performedusingprimersthatcoverpolymorphismsin theexon(Additionalfile3:FigureS1).Theexistenceof bothhomeologsatthetranscriptlevelwasconfirmed viaRT-PCRandsubsequentsequencingofthetranscripts (Figure3).Theexpressionpatternofthehomeologswas determinedwithqPCRandtheresultingampliconswere analyzedbyhighresolutionmelting(HRM)todistinguish thetranscripts. P.patens fromGransden(Europe)wasused asareference.Both P.collenchymatum accessionsshow twodistinctexpressedtranscriptsof BRK1 ,whereasall three P.eurystomum and Physcomitrella yieldedonlyone productinthisanalysis(Figure4).Duetothealmostidenticalmeltingpatterns,theaut o-groupingofthegenescanningsoftwarewasnotabletodistinguishbetweenthe P. eurystomum accessions(NeukirchandSchleiz,Germany) withtheirsinglepolymorphismattheexonlevel,whilethe twopolymorphismsintheexonof P.collenchymatum (Table3)couldberesolved.Insummary,theexonpolymorphismsof BRK1 wereconfirmedatthetranscriptlevel bysequencing(Figure3)andpartlybyHRM,demonstratingthatbothhomeologsareexpressed(Figure4). vergran Europe AGera Europe ASchleiz Europe B Aphanorrhegma serratum Neukirch Europe B Mt Bisoke Rwanda Africa Nordhausen Europe A Missouri North America 1BNeukirch Europe AMelton AustraliaMissouri North America 2ADel Valle Lake California North America Neustadt Europe B Missouri North America 2BHaartrand Europe A Schleiz Europe A Missouri North America 1ANordhausen Europe B Haartrand Europe Bvergran EuropeSaitama JapanNeustadt Europe A Bischofswerda Europe AOkayama Japan Bischofswerda Europe B Gransden Europe Gera Europe B Physcomitrella magdalenae Physcomitrella paten s Physcomitrella readeri Physcomitriumpyriforme Physcomitriumpyriforme Physcomitriumcollenchymatum Physcomitriumcollenchymatum Physcomitriumeurystomum Physcomitriumeurystomum BI NJ ML Aphanorrhegma serratum Figure2 Phylogenetictreeof BRK1. Phylogenetictreeofthenucleargene BRK1 (Pp1s35_157V6.1)fromselectedFunariaceae.Three Funaria species( F.hygrometrica F.flavicans ,and F.americana )wereusedastheoutgroup(notshown,seeAdditionalfile6:FigureS3,fordetails).The clusterrepresentingthe Physcomitrium Physcomitrella speciescomplexshownhereissupportedbyallmethods.Duetodifferingorunresolved branchingorder,dependingoninferencemethodused,thebackboneisshownasmultifurcating.Thethreedistinctcladesof Physcomitrella representing P.readeri (Japan,Australia), P.magdalenae (Africa)and P.patens (EuropeandNorthAmerica)areshowninbold.Thedistinct paralogouslociof BRK1 foreachhybridspeciesarehighlightedwithcoloredbrackets.Redbracketsrepresentdistinctlocioffive P.pyriforme accessionsfromEurope.Bluebracketsshowmultiplelocioftwocapsulesofa P.collenchymatum accessionfromNorthAmerica.Greenbrackets markdistinctlociof BRK1 withinthreeaccessionsof P.eurystomum fromEurope.Thesymbolsatthenodesrepresentsupportvalues>95for MaximumLikelihood(ML),BayesianInference(BI)andNeighborJoining(NJ),respectively.Theyarederivedfrom1,000NJbootstrapsamples, respectivelyshowposteriorprobabilitiesofBayesianinferenceormaximumlikelihoodquartetpuzzlingsupport. Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page8of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 10

BRK1 asaphylogeneticmarkerconfirmspolyphyletic originofthree Physcomitrella speciesBasedonthehighconservationofBRK1(Additional file1:FigureS2)andonthefactthattheencodinggene BRK1 harborsanintron,weexpectedthenucleicacid sequencetorepresentasuitablephylogeneticmarker toresolverelationshipswithintheFunariaceae.Differentmethodsoftreeinferencebasedonthenucleicacid sequences(exon/intron)allledtoessentiallythesame topology,separatingthe Funaria sequencesfromfour wellsupportedclades(Additionalfile6:FigureS3). Thethreecladesrepresenting Physcomitrella fromEurope andNorthAmerica(ssp. patens andssp. californica ), Physcomitrella fromAustraliaandJapan(ssp. readeri and ssp. californica )and P.patens ssp. magdalenae from Africaaredistinctinthe BRK1 -basedphylogeny(Figure2, Additionalfile6:FigureS3).Thisconfirmsapolyphyletic originofthesethreelineagesaspreviouslyproposed [11,12]andsupportsthataccessionsof P.patens ssp. californica (DelValleLake,CaliforniaandtwoaccessionsfromJapan)actuallybelongtotwodifferentclades. Moreover, A.serratum clustersinacladetogetherwith Figure3 Electropherogramsofapolymorphicregionwithinthe BRK1 transcriptfromsixselectedFunariaceae. Sequencingofan amplifiedregionwithinthe BRK1 transcriptfrom (A) P.patens (Gransden Europe) ,P.eurystomum (Schleiz (B) ,Neukirch (D) andNeustadt (F) Europe)and P.collenchymatum (ShawNatureReserve,FranklinCounty,MO,USA,K1 (C) andK2A (E) ,USA).Blackarrowsindicatesequence polymorphisms. Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page9of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 11

P.patens ssp. patens andmaythereforebeconsidered tobelongtothe Physcomitrium Physcomitrella complex aswell.Genicmicrosatellitessupporthighgeneticdistances withinthegenus PhyscomitrellaSixty-fourEST-derivedsimplesequencerepeat(SSR) loci[48]wereanalyzed,andall Physcomitrella accessions (Additionalfile2:TableS1)turnedouttobeofdifferent genotypesasmeasuredbySSRs.Intotal,238alleleswere detected(average3.7allelesperSSR).Thephylogenetic treebasedongeneticdistances(Figure5)displaysaseparationoffourmajorclades .Oneclearlyramifiedclade consistsofEuropeanandNorthAmericanaccessions ( P.patens ssp. patens and P.patens ssp. californica ) withsmallgeneticdistances,asecondcladeisformed bytheJapaneseandtheAustralianaccessions( P.patens ssp. readeri and P.patens ssp. californica ),whilethe African P.patens ssp. magdalenae isonaseparatebranch (Figure5).Thegeneticdistancesofthefour Physcomitrella subspeciesclusterstooneanotherareaslargeas,or evenlargerthan,thedistanceof P.sphaericum toeachof them.Largebandingsizeshiftsandnullallelesobtainedin theAfricanandtheJapanese-AustraliancladepointtowardssequencechangessurpassingtheenclosedSSRsand affectingtheflankingregions.Visualizationoftheallele presence/absencedataasanetwork(Figure6)suggestseithersexualrecombinationandthuslongrangegenetic flow,ortheparallel(convergent)evolutionofalleles. Thereareonlyminordifferencesbetweenthetopologies ofFigures5and6.Insummary,althoughsomeofthe nodesarenotwellsupported,thegeneticdistancedata supportthreeindependentlyevolved(polyphyletic) Physcomitrella lineagesinthesamewayasthe BRK1 data does.Thepatternofeditingsitessupportsindependent speciationof Physcomitrella andhybridizationof PhyscomitriumRequirementforRNAeditingateightpositionsinthe mitochondrialgenomeknowntobeeditedin P.patens fromGransden(Europe)wascheckedforabroadsetof accessionsacrossthe Physcomitrium Physcomitrella speciescomplex(Additionalfile2:TableS1,Additionalfile7: TableS4).Editingsitesin nad 5, cox 1and ccm FC,which wereconservedbetween F.hygrometrica and P.patens ,as Figure4 Highresolutionmeltinganalysisof BRK1 .(A) Normalizedandtemperatureshiftedhighresolutionmeltingcurveand (B) difference plotof BRK1 from P.patens (mauve),thetwo P.collenchymatum accessionsK1(green)andK2A(red)andthethree P.eurystomum accessions Neustadt(gray)andNeukirch/Schleiz(bothblue);seeAdditionalfile3:FigureS1foralignmentwithmarkedpolymorphisms. Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page10of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 12

wellasrps14eU137SL(fornomenclatureseeFigure7), absentfrom F.hygrometrica [34],werefoundtobeconservedinallinvestigatedspecies.Incontrast,therequirementofeditingatpositionsnad3-230andnad4-272 varied.Whileallisolatesof Physcomitrella fromEurope andNorthAmerica(ssp. patens andssp. californica ) showededitingatbothpositions,inaccessionsof Physcomitrella fromAustraliaandJapan(ssp. readeri and ssp. californica )and P.patens ssp. magdalenae from AfricaaTwasalreadyencodedattheappropriatepositions,makingeditingobsolet e.Thissupportstheindependentspeciationofatleasttwo Physcomitrella lineages,and theassignmentofaccessionsof P.patens ssp. californica intodifferent Physcomitrella lineages. Clusteringof A.serratum tothe P.patens clade,as showninthe BRK1 -basedphylogeny,wasconfirmed bythesameeditingrequirementsof A.serratum and P.patens ssp. patens incontrastto Funaria (Figure7). Physcomitrella readeri( ssp. californica & ssp. readeri)Physcomitrella patens( ssp. patens & ssp. californica)Physcomitrella magdalenae( ssp. magdalenae) Figure5 SSR-basedneighbor-joiningtree. Unrootedneighbor-joiningtreeconstructedusingNei ’ sDA-distanceondatasetsderivedfrom64 SSRsof21 Physcomitrella accessions.Accessionsarenamedwiththeirdesignationandcountry.Grayellipsesindicatethreecladesof Physcomitrella accessions,supportingarevisedclassificationintothethreedistinctspecies P.patens (EuropeandNorthAmerica), P.readeri (AustraliaandJapan) and P.magdalenae (Africa).Thenumbersatthenodesarederivedfrom1,000bootstrapsamples. Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page11of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 13

All P.pyriforme isolatesshowedaTatposition nad3eU230SLandaCatpositionnad4eU272SLat theDNAlevel(Figure7),congruentwith P.pyriforme beingahybridspeciesderivedfromdivergent parentallines.The P.collenchymatum and P.eurystomum, aswellasthe Physcomitriumsphaericum editingsites nad3eU230SLandnad4eU272SL,areakintothe P.patens ssp. patens clade(Figure7).Thescenarioof P.patens ssp. magdalenae developingfromthesameparentallineas P.pyriforme and P.eurystomum isfurthersupportedby asitetobeedited,ccmFCeU52RC,exclusivelyidentified inaccessionsofthesethreelineages.Anadditionalputativeeditingsitein nad 5,nad5eU446SL,isonlyshared by P.pyriforme and P.patens ssp. magdalenae.Invitro comparisonofgametophyticmorphological featuresSincesporophyticfeaturesarenotsuitablefordistinguishing Physcomitrella species,wecomparedgametophytes grownunderidentical invitro conditions.TheCalifornian accession(Additionalfile8:FigureS4D,Additionalfile9: FigureS5D,Additionalfile10:FigureS6B)deviatesfrom theEuropeanaccessions(Additionalfile8:FigureS4A-C, Additionalfile9:FigureS5A-C,Additionalfile10: FigureS6A)bydevelopingmuchsmallergametophores withsmallerleaflets(i.e.,non-vascularleavesorphyllids; cf. PlantOntologytermPO:0025075).However,consistentwiththeEuropeanaccessions,theleafletsofthe Californianaccessiondevelopacostainmostcases,albeitlesspronouncedandextendingtoonlythreequarters oftheleaflets(Additionalfile10:FigureS6A,S6B).Inthe JapaneseandtheAustralianaccessionsthegametophoresandleaflets(Additionalfile8:FiguresS4E, Additionalfile9:FigureS5G-I)aremuchsmaller,typicallylessthanhalfthesizeascomparedto P.patens fromGransden(Europe,Additionalfile8:FigureS4A, Additionalfile9:FigureS5A,Additionalfile10:Figure S6A),comparabletotheCalifornianaccession(Additional file10:FigureS6B,S6C).However,theleafletsdonotdevelopacostaexceptinveryrarecaseswhereacostamay bepresent,reachingatmosthalfthelengthoftheleaflets (Additionalfile10:FigureS6C).TheleafletsoftheAfrican accession(Additionalfile8:FigureS4F,Additional file9:FigureS5F)arethelargestamongallanalyzed accessions,withuptotwicethesurfaceoftheEuropean accessions(Additionalfile10:FigureS6D).Theyare Figure6 SSR-basedNeighborNet. Unrooted,equalangledSplitstreeNeighborNetbasedonpresence/absenceof170differentsizedSSRbands derivedfrom49loci.Numbersattheedgesrepresentbootstrapsupport,shownonlyforvalues>50.Accessionsarenamedwiththeirdesignation andcountry. Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page12of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 14

orbiculateandmuchbroaderthanthelanceloateleaflets oftheotheraccessions(Additionalfile10:FiguresS6D). Insummary,leafletshapeandthepresenceofacosta mightbeusefultodistinguishthe Physcomitrella accessions,whileleaflet/gametophoresizeseemedrathervariable.Ofcourse,thiscomparisonwasdoneonlyforsingle accessionsfrom invitro cultivatedFunariaceaeandone canthereforeexpectmoremorphologicalvarianceinthe fieldaswellasfromotheraccessionsgrownunder invitro conditions.DiscussionHybridizationandpolyploidizationamongthe FunariaceaeHerewepresentdatashowingthatconvergentevolution andallopolyploidizationare associatedwiththegenerationofnewspeciesintheFunariaceae.Interspecific hybridizationamongmossesisanunderestimatedevolutionaryphenomenon[26].Both,artificialcrossings [24,25,27,54]andnaturallyoccurringhybridshavepreviouslybeendescribedfortheFunariaceae[28-31]. Previously,[12]reportedthat Physcomitriumcollenchymatum and P.eurystomum arehybridspecies,putativelyproducedfromhybridizationsbetweenancestors ofmodern P.sphaericum and P.pyriforme .Thiswas basedontheobservationthatthesespeciescontained specificpolymorphisms(i.e., sphaericum and pyriforme likealleles)atfournuclearloci( adk apr ho1 and papr ). However,eachhaploidindividualgenerallycontained eitherthe sphaericum or pyriforme -likeallele,butnever both.Thisfindingwasconsistentwitheitherhomoploid hybridspeciation,orallopolyploidspeciation,followed byalossofonehomeologateachoftheseloci(fractionation).Theoneexceptiontothispatternwasthe ho1 locuswherefourEuropeanisolatesof P.pyriforme containedtwodivergentcopiesofthislocus. Herewefoundthat P.eurystomum P.collenchymatum ,andfiveEuropeanisolatesof P.pyriforme havegenomesizeslargerthanthoseoftheirputativeparent lineages,whiletheyalsocontaintwodivergentparalogs of BRK1 .Forthesedatatobeexplainedbyahomoploid hybridspeciationevent,wewouldhavetoassumeboth amassiveexpansionoftransposableelements[55]and parallelduplicationsofthe BRK1 locus.Alternatively, thesedatamightreflectanallopolyploidizationevent followedbythelossofoneparalogatthe adk apr ,( ho1 ) and papr loci,aprocesscalledfractionation.Ourcurrent datadonotallowtounambiguouslyruleouthomoploid CCCCCC CC CC TC TT TT TT 11*2 2 2 1*1*1 Physcomitriumcollenchymatum Physcomitriumeurystomum Aphanorrhegmaserratum Physcomitrellapatens( Physcomitrella patens ssp. patens / ssp.californica )PhyscomitriumsphaericumPhyscomitrellamagdalenae( Physcomitrella patens ssp. magdalenae )Funariahygrometrica Physcomitrellareaderi( Physcomitrella patens ssp. readeri / ssp.californica )Physcomitriumpyriforme Figure7 Overviewofmolecularfeaturessupportingtheproposedspeciationwithinthe Physcomitrium-Physcomitrella species complex. There-classifiedspecies(subspeciesfollowingtheformerclassificationofTan1979inbrackets)arearrangedassupportedbydata presentedinthisstudy,modifiedafter[12].Dashedlinesindicatehybridizationeventsresultinginthethreespeciesof Physcomitrium .Thedotted lineillustratestheclusteringof A.serratum togetherwith P.patens .Therequirementofeditingatparticularpositionsin nad 3and nad 4isshown. TheRNAeditingsitenomenclatureconsistsofaffectedgene,positioninthereadingframeandtheresultingaminoacidcodonchangeinduced byRNAediting[32].C(Cytidine)attheDNAlevelindicatesaneditingsite,whereasnoeditingisrequiredinthecaseofathymidine(T)atthe appropriateposition.Thenumberof BRK1 loci(homeologs)isdepictedforallanalyzedspecies,while*indicatesSSR-basedsupportforthethree Physcomitrella species. Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page13of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 15

hybridspeciation,butthefrequencyofhomeologloss followingpolyploidyinawiderangeoforganisms[56] suggeststhatfractionationmaybeamoreplausibleexplanation.Acomparativeanalysisofthegenome-wide patternsofparalog-lossorretentioncouldpotentially provideinsightsintothegeneticinteractionsamongloci ordosagesensitivity. Theevolutionarysuccessofhybridsisalsoknownfor seedplants,whereallopolyploidoffspringaresometimes moresuccessfulthantheparentallines[21,22].Contrary toseedplants,whichcontainallelesinthedominant sporophyticgeneration,mossescontainonlyasinglegene locusinthedominanthaploidgeneration.Therefore,the homeologsgeneratedthroughanauto-orallopolyploidizationeventmightrepresentanadditionalevolutionary advantagesincetheyrepresentredundantgenecopies (akintoalleles),encodedonhaploidsegregatedchromosomes.Inallopolyploidhybrids,gainsofgenesonly encodedbyoneofthetwoparentalgenomesmighteven bemorebeneficialiftheyrelayanimportantadvantage thatoneoftheparentsdidnotencode. Intheallopolyploidseedplantcottonthemajorityof expressionbiasesarethoughttobeduetosub-and neofunctionalizationsubsequenttothepolyploidization event[57].Indeed,60%ofthehomeologsarefoundto betranscriptionallybiased,e.g.,dueto cis -regulatory elementdivergenceoftheparentalgenomes[58,59]. Undertheconditionsappliedhere,both BRK1 homeologs areexpressedinthesametissuein P.collenchymatum and P.eurystomum, andinthecaseof P.collenchymatum their expressionlevelsseemnottobeheavilybiased.Allopolyploidcottonhasbeenestimatedtobe1.5MYold[60], whiletheseparationoftheparentallineageswithin the Physcomitrium Physcomitrella speciescomplexoccurred~11MYA[12].Thehybridsstudiedhereare likelyyoungerthanthat-butwemightalsoseedifferent patternsorspeedsofhomeologdivergencebetweenmosses andseedplantsinfuturestudies. Withregardtoeditingsiteevolution,weconsideraT atnad3_230andnad4_272tobetheancestralstate, sincethreelineages( Funariahygrometrica Physcomitrellareaderi and Physcomitrellamagdalenae )sharethis characteristic,whilethegainofaCinthesepositions canbeexplainedbyasinglemutationpereditingsitein thelineagegivingriseto Physcomitriumsphaericum and Physcomitrellapatens (Figure7).Underthisscenario, editingofnad3eU230SLandnad4eU272SLinthehybrid species P.eurystomum P.collenchymatum and P.pyriforme mighthavebecomefeasiblebygain(fromtheparental P.sphaericum lineage)ofthecorrespondingnuclear encodededitingfactorPPR_56(Pp1s208_104V6.1,[61]). Thegainoftheeditingrequirement(i.e.,aCinsteadof aTinthemitochondrialDNA)atoneorbothpositionsinthehybridspeciescanbeexplainedbyeither maternaltransmissionoftheorganelleandthustransferofthemutationfromthe P.sphaericum parental lineage,orbytheindependentgainofmutations(after lossofselectionpressurebygainofthenuclearediting factor). Basedonsynonymoussubstitutionplotsofgeneduplicationevents,awhole-genomeduplicationin P.patens hasbeenhypothesizedanddatedto~45MYA[23].As thisismuchlaterthantheFunariidaedivergence~172 MYA[62],andgenefamilytreesincluding F.hygrometrica and P.patens usuallyshowclearorthologpairs [34,63],itisreasonabletoassumethatthepreviously shownpaleopolyploidization[23]isacommonancestral traitofallFunariaceae.Inthislight,itissurprisingthat the F.hygrometrica haploidgenomesizemeasuredhere issignificantlylowerthanthatof P.patens .Anexplanationforthisfindingcouldbeamuchlowertransposonorrepetitiveelementcontentin F.hygrometrica orasignificantlydifferentA/Tcontent.Inanycase, fractionation(i.e.,homeologloss)apparentlyoccurredtoalargeextent,sincethepaleopolyploidizationevent wasnotdetectablebymeansofhomeologsof BRK1 in thoseFunariaceaethatarenothybrids. Insummary,(sympatric)speciationfollowingallopolyploidizationhasapparentlyoccurredseveraltimeswithin the Physcomitrium Physcomitrella speciescomplex.Revisedclassificationof PhyscomitrellaBycomparingthegeneticdiversityintheanalyzed Physcomitrella accessionswefoundconsistencyinthreemain distinctivegroupings.OnecladeincludesallEuropeanand thetwoNorthAmericanaccessions(aswellas Aphanorrhegma ),asecondcladeencompassestheJapaneseand theAustralianaccessionsandthethirdlineageisrepresentedbytheAfricanaccession.Hence,ourresultsconfirmrecentlypublishedmoleculardataconcerningthe Physcomitrium Physcomitrella speciescomplex,wherean independentoriginofthree Physcomitrella lineageswas assumed[11,12].Sincethegeneticdistancesbetweenthe three Physcomitrella cladesareaslargeas,orevenlarger than,thegeneticdistancesto Physcomitrium species,the three Physcomitrella lineagesshouldberegardedasdifferentspecies.Basedontheresultspresentedhere,we proposearevisedclassification,whichdivides Physcomitrella intothreespecies: 1. Physcomitrellapatens (Hedw.)BruchetSchimp. Bryol.Eur.1:13,1849. Basionym: Phascumpatens Hedw.Spec.Musc.20,1801. Synonyms: Physcomitriumpatens (Hedw.)Mitt., Ann.Mag.Nat.Hist.,ser.2,8:363,1851. Physcomitrellapatens ssp. californica (H.A. Crum&L.E.Anderson)B.C.Tan,J.HattoriBot. Lab.46:334,1979.Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page14of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 16

ThistaxonencompassestheEuropeanandNorth Americanaccessionsof P.patens ssp. patens and theNorthAmericanaccessionsof P.patens ssp. californica. 2. Physcomitrellareaderi (Mll.Hal.)I.G.Stone& G.A.M.Scott ,J.Bryol.7:604,1974. Basionym: Ephemerellareaderi Mll.Hal.,Hedwigia41: 120,1902. Synonyms: Physcomitriumreaderi Mll.Hal., Gen.Musc.Frond.112.1900, nom.inval ., lackingspeciesdescription. Physcomitridium readeri (Mll.Hal.)G.Roth,Auereurop. Laubm.250,1911. Physcomitrellapatens ssp. readeri (Mll.Hal.)B.C.Tan,J.HattoriBot.Lab. 46:334,1979. ThistaxonencompassestheAustralianaccessionsof P.patens ssp. readeri andtheJapaneseaccessionsof P.patens ssp. californica 3. Physcomitrellamagdalenae DeSloover, Bull.Jard. Nat.Belg.45:131,1975. Synonyms: Physcomitrellapatens ssp. magdalenae (DeSloover)B.C.Tan,J.Hattori Bot.Lab.46:334,1979. Aphanorrhegma magdalenae (DeSloover)Ochyra,ActaBot. Hung.29:178,1983. ThistaxonencompassestheAfricanaccessionsof P. patens ssp. magdalenae Followingthisclassification, P.patens ,disjunctinNorth AmericaandEurope,canbeclearlydistinguishedfrom P.readeri and P.magdalenae bydistinctgametophytic (butnotsporophytic)morphologicalaswellasmolecularcharacteristics. Accordingtothe BRK1 phylogenyandthepatternof editingsites,thestegocarpous A.serratum mayalsobe classifiedas Physcomitrella ,although Physcomitrella is cleistocarpous.Thus,theFunariaceaetypespecies, F. hygrometrica ,representsthemosthighlycomplexendof amorphologicalseries,with Physcomitrella / Aphanorrhegma representingtheotherend.Theoriginofacleistocarpoustaxonfromastegocarpoustaxonisfound severaltimeswithintheacrocarpousmosses.Specieswith cleistocarpousandstegocarpousmembersarefounde.g. inthegenus Pottia ,where P.bryoidesand P.recta are cleistocarpouswhiletheremainingspeciesarestegocarpous,havingeithernoperistome,orarudimentaryor evenwell-developedperistome.Inconclusion,aspreviouslysupposed,sporophyticcharacteristicscannotbeused toresolvethephylogenyoftheFunariaceae[11]. Consideringanindependentevolutionfor Physcomitrella from Physcomitrium ancestors[12]andtheobserved(phylo)geneticdistances,theanalyzedaccessions ofthe Physcomitrium-Physcomitrella speciescomplexmay inconsequencebeclassifiedasasinglegenus.Inthiscase, Physcomitrium wouldbethecorrectgenusnameasitis olderthan Physcomitrella ,datingbackto1829.Givenour presenttaxonsamplinganddataset, Physcomitrella Physcomitrium and Aphanorrhegma formaspeciescomplex thatmayormaynotincludeadditionalgenera,suchas Entosthodon and Bryobeckettia [11].Therefore,further phylogeneticstudiesincludingmoreaccessionsandmore generaarerequiredinordertoconfidentlyproposearevisionintaxonomicclassificationatthegenuslevel(i.e.,unitingthespeciesofthe Physcomitrium Physcomitrella species complexintoamonophyleticgenus Physcomitrium ).Disjunctoccurrenceandlongrangedispersalof PhyscomitrellaThehabitatsofthe Physcomitrella accessionsusedin thisworkshowclearsimilarities,astheygrowonmoist, oftendisturbedground,typ icallyincloseproximityto water. Physcomitrella showsacosmopolitan,probably originallyholarcticdistrib ution(excludingborealand tropicalregions).Whileonemightexpectgeneticdistancestocorrelatewithgeographicdistances,thetwo P. patens isolatesfromGemnd(Germany)clusterwith oneoftheFrenchVillersexelaccessions, “ K4 ” (Gemnd “ K5 ” ),andtheEnglishCholseyaccession(Gemnd “ K1 ” ) respectively;thelatterGemndaccessionwascharacterizedas var.megapolitana inthefield.Also,theaccessions fromVillersexel(France)clusterindifferentpartsofthe P.patens geneticdistancetree.Thesegeneticdistances provideevidenceforeitherhighintra-populationdiversityorlongrangedispersal. Mosssporesareabletosurviveinmudforprolonged periodsoftime,atraitconsideredimportantforephemeralspecies[64].Inparticular, Physcomitrella isknown toquicklyappearonthemuddybanksofreservoirsafter draining. P.patens sporesarelargerandfewerinnumber (30 mdiameter,8,000-16,000percapsule)thanthoseof F.hygrometrica (23 m,60,000-170,000)[65],making themabiggerenergyreservoirthatmightbeabletoboost growthassoonastheconditionsaresuitable.Spores smallerthan20 mareeasilydispersedbywind[64]and longrangedispersalviathismodeisevidentfor Funaria hygrometrica [66],alsoconsideringitscosmopolitandistribution.Giventhelargersporesizeof P.patens, alongwith thefactthattheplantsgrowonwetsoilandhaveacleistocarpouscapsule,sporedispersalbywindispossiblebut appearsunlikely.Althoughlongdistancesporedispersal bywindcannotbeexcludedfor Physcomitrella ,wesuggest thatsporedistributionbybirds[67]alongmigration routesmayalsocontributetotheobserveddisjunctdistributionpatterns.Thedisjunctdistributionof P.patens on bothsidesoftheNorthernAtlanticmaybeexplainedby useoftheEastAtlanticflyway,whiletheNorthAmerican continentiscoveredbyatotaloffourpartiallyoverlapping flyways[68],potentiallyallowingthesporestospreadBeike etal.BMCEvolutionaryBiology 2014, 14 :158 Page15of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 17

acrossthecontinent.Concerning P.readeri ,whichis foundinJapanandAustralia,butalsoinEurope[69], nearlyidenticalribosomalspacerdatabetweentheaccessionsfromEngland,AustraliaandJapansuggests longrangedispersal.ThedisjuncthabitatsinJapanand AustraliaarecoveredbytheWestPacificaswellasbythe EastAsian-Australasianflywayusedbymigratorybirds [68].SincetheEastAsian-AustralasianflywayisgeographicallyoverlappingwiththeEastAtlanticflyway,dispersal fromJapan/AustraliatoEurope[69]istheoreticallypossible,althoughlesslikelythan,e.g.,theexchangebetween JapanandAustralia.Wehypothesizethat Physcomitrella mightbedispersedviamigratory(water)birdsalongflywayssincetheobservedhabitatsfollowadistributionpatterncoincidingwithsuchflyways.WhentheSSRdataare visualizedasanetwork,potentialgeneticflowisalsosupported.Whilereticulatestructuresarepresentmainly within P.patens and P.readeri ,thereisalsoevidencefor allelesthatarepotentiallyexchangedbetweenbothspecies.Interestingly,basedontheSSRdatanoexchangeis evidentbetween P.magdalenae P.sphaericum andanyof theotheraccessions.IndependentsecondaryreductionofFunariaceae sporophytecomplexityConsideringthefactthatcharacteristicstructuralfeatures ofmosssporophytescanbecorrelatedwithspecialized habitats[70],themostlikelysecondaryreductionofthe Physcomitrella sporophytetoacleistocarpouscapsulewith reducedsetaandincreasedsporesizemaybeinterpreted asanadaptationtoanephemerallifestyle.Giventhe polyphyleticoriginofthet hreecryptic(withregardto sporophyticfeatures) Physcomitrella species,aconvergentevolutionaryprocessinwhichthesetaisreduced andthecapsuleisnolongerdehiscentcanbeassumed. P.patens inhabitsanephemeralhabitat,e.g.onbanksof riversandpondswhichdryupinsummerorautumn. Thespecieshasashortlifecycleofuptotwomonths fromsporegerminationtothedevelopmentofspores [65].Besidesareducedsporophyte,ashortenedlife cyclealsorepresentsatypicaladaptationtoahighlyunpredictableandephemeralhabitat[70].In Physcomitrella ,thegametophoreisreducedaswell,forminga smallrosettewithitsapparentmainfunctionbeingthe productionofgametangiaandsporecapsules.Asa semi-aquaticmoss,thesporesaremostlikelyreleased intowaterormud.Thismodeofsporedispersaldoes notrequirealidoraperistomeatthecapsule,butrather thedisintegrationofthecapsulewhenmaturesporeshave developed. TheFunariaceaefeaturehighlyvariablesporophyte architectures,andsporophyt esofinterspecieshybrids usuallydisplayintermediateormaternalphenotypes [27].Ithasbeenarguedthatevolutionarypressuremay forcechangestomosssporophytearchitecturerather thanconservingit[11,70].Insummary,wehypothesize thatprobablyparapatricspeciationviaestablishingan ecologicalniche,namelytherestingofsporesinthe mud,theirpotentialdispersalbybirdsratherthanby wind,andanephemerallifecycle,hasledtotheindependentevolutionofareducedsporophyteinthethree Physcomitrella lineages – makingthemcrypticspecies ifoneconsiderssporophytemorphologyalone.ConclusionsInthisstudywepresentmolecularinsightsintotheglobal geneticdiversityofthe Physcomitrium-Physcomitrella speciescomplex,providingevidenceforsympatricspeciation involvingallopolyploidization,aswellasforconvergent evolutionleadingtoareducedsporophyte,largespores, andacolonizationofahumid,ephemeral,moisthabitat, possiblyconcomitantwithpossibleparapatricspeciation. Primarily,thesequenced P.patens isolatefromGransden (Europe)hastodatebeenwidelyusedasanexperimental modelincomparativeplantsciences,followedbythe FrenchisolateVillersexel “ K3 ” thathasbeenusedforthe generationofageneticmap[71]andforcrossingexperimentswith “ Gransden ” andotherisolates[54].The presentcollectionofaxenic invitro culturesofFunariaceaeaccessions,togetherwiththemoleculardatapresentedhere,isexpectedtoboosttheresearchinto naturalvariationandtraitevolutionofthisemerging modelsystemrepresentinghaploid-dominantlandplants. ResequencingofFunariaceaeaccessionswillleadtoinsightsintogenomeevolutionanditscouplingtotrait evolution.AvailabilityofsupportingdataThedatasetssupportingtheresultsofthisarticleare includedwithinthearticle(anditsadditionalfiles). BRK1 sequencedatahavebeensubmittedtoGenbank andareavailableundertheaccessionnumbersKC337119KC337148.AdditionalfilesAdditionalfile1:FigureS2. AlignmentofBRK1aminoacidsequences. MultiplesequencealignmentofBRK1aminoacidsequencesfromseveral landplants.Theconservedblocksusedforprimerdesignaredenotedby redboxes.Theleadingfivelettersofeachsequenceidentifierdenotethe speciesinthecommonabbreviation(firstthreelettersofthegenus, followedbythefirsttwolettersofthespecies,e.g. PHYscomitrellaPAtens ). Additionalfile2:TableS1. Funariaceaecollection(detailed)anddata matrix. Additionalfile3:FigureS1. Alignmentofgenomic BRK1 sequences. Multiplesequencealignmentofamplifiedandclonalgenomicsequences of BRK1 fromdifferentFunariaceae.Theexonregionisshowninwhite letters,theintronregioninblackletters.Thespeciesnamesaresorted alphabetically.Accessionswithonlyonelocusof BRK1 arerepresentedby onesequenceofdirectlysequencedPCRproduct,whereastwoBeike etal.BMCEvolutionaryBiology 2014, 14 :158 Page16of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 18

representativeclonalsequencesareshownforeachaccessionwithtwo lociof BRK1 ( P.collenchamytum P.eurystomum ,and P.pyriforme ). Polymorphismsintheexonregionsaredepictedinred( P.collenchymatum ) andorange( P.eurystomum )boxes. Additionalfile4:TableS2. SSRdata. Additionalfile5:TableS3. Flowcytometricanalyses(detailed). Additionalfile6:FigureS3. Phylogenetictreeusing BRK1 Neighbor-joiningtreeofusing BRK1 (Pp1s35_157V6.1)fromselected Funariaceae.Thethreedistinctcladesof Physcomitrella arehighlightedinbold. Thedistinctlociof BRK1 foreach Physcomitrium speciesarehighlightedin boxes.Greenboxes:distinctlociof P.pyriforme accessionsfromEurope.Blue boxes:distinctlociofone P.collenchymatum accessionfromNorthAmerica fromtwodifferentcapsules.Redboxes:distinctlociof BRK1 fromthree accessionsof P.eurystomum fromEurope.Thenumbersatthenodesare derivedfrom1,000bootstrapsamples. Additionalfile7:TableS4. Editingsiteconservationalongthe Physcomitrium-Physcomitrella speciescomplex. Additionalfile8:FigureS4. Habitusofgametophytes. Physcomitrella gametophytesgrownunderstandardized invitro conditionsonsolid mineralmedium. (A) Physcomitrellapatens ,[ Physcomitrellapatens ssp. patens ]fromGransden,Europe; (B) Physcomitrellapatens [ patens ssp. patens ]fromLviv,Europe; (C) Physcomitrellapatens [ patens ssp. patens ] fromIllinois,USA; (D) Physcomitrellapatens [ patens ssp. california ]from California,USA; (E) Physcomitrellareaderi [ patens ssp. readeri ]from Australia; (F) Physcomitrellamagdalenae [ patensssp. magdalenae ]from Rwanda,Africa; (G) Physcomitrellareaderi [ patens ssp. californica ]from Okayama,Japan; (H) Physcomitrellareaderi [ patens ssp. californica ]from Kumamoto,Japan; (I) Physcomitrellareaderi [ patens ssp. californica ]from Saitama,Japan. Additionalfile9:FigureS5. Habitusofgametophoresandleaflets. Physcomitrella accessionsgrownunderstandardized invitro conditions onsolidmineralmedium.(A) Physcomitrellapatens [ Physcomitrellapatens ssp. patens ]fromGransden,Europe;(B) Physcomitrellapatens [ patens ssp. patens ]fromLviv,Europe;(C) Physcomitrellapatens [ patens ssp. patens ] fromIllinois,USA;(D) Physcomitrellapatens [ patens ssp. california ]from California,USA;(E) Physcomitrellareaderi [ patens ssp. readeri ]Australia;(F) Physcomitrellamagdalenae [ patens ssp. magdalenae ]fromRwanda,Africa; (G) Physcomitrellareaderi [ patens ssp. california ]Okayama,Japan;(H) Physcomitrellareaderi [ patens ssp. californica ]fromKumamoto,Japan;(I) Physcomitrellareaderi [ patens ssp. california ]fromSaitama,Japan. Additionalfile10:FigureS6. Leafletdetails.Leafletsof(A) Physcomitrellapatens [ Physcomitrellapatens ssp. patens ]fromGransden, Europe;(B)Physcomitrellapatens [ patens ssp. californica ]fromDelValle Lake,California,USA;(C) Physcomitrellareaderi [ patens ssp. californica ] fromJapan,Okayama;(D) Physcomitrellamagdalenae [ patens ssp. magdalenae ]fromRwanda,Africa.BothaccessionsfromEuropeand NorthAmericarevealacosta,incontrasttothosefromOkayama,Japan. Physcomitrella fromRwanda,Africahasorbiculateleafletsincomparison tothelanceolateleafletsoftheotheraccessions. Competinginterests Theauthorsdeclarethattheyhavenocompetinginterests. Authors ’ contributions SARconceivedofmostofthestudy.MvS,RRandSARconceivedoftheSSR andphenotypicpartofthestudy,MvSperformedit.AKBandSARdesigned mostoftheexperiments.MSRandSARdesignedtheeditinganalyses,MvS theSSRanalyses.AKBperformedtheBRK1experiments,MSRtheeditingsite analyses,STHtheqPCRs/meltingstudies,MFtheflowcytometry/melting studies,SARthestatistics.AKBandSARperformedthephylogeneticanalyses. AKB,SMD,BCTandSARhypothesizedonspeciesevolution.AKBandSAR draftedthemanuscript,withparticipationofallauthors.Allauthorsreadand approvedthefinalmanuscript. Acknowledgements ThisworkisdedicatedtoourfriendandcolleagueJan-PeterFrahmwho passedawayunexpectedlyinFebruary2014.Hecontributedmuchtothis projectbycollectingplantmaterial,providingtaxonomicalbackgroundand discussingspeciesevolutionamongmosses. Wearegratefultoallcontributors(Table1/Additionalfile2:TableS1)for theirhelponcollectinganddeterminingFunariaceaeandtoT.Tikofor technicalassistance.WewouldliketothankB.Goffinetforhelpfulcomments onthiswork. ThisworkwassupportedbytheUniversityofFreiburg,theMinistryof Science,ResearchandArtoftheFederalStateofBaden-Wrttemberg(RiSC granttoSAR)andbytheGermanFederalMinistryofEducationandResearch (FreiburgInitiativeforSystemsBiology,0313921toSAR). Authordetails1FacultyofBiology,UniversityofFreiburg,Schnzlestr.1,79104Freiburg, Germany.2PlantBiotechnology,FacultyofBiology,UniversityofFreiburg, Schnzlestr.1,79104Freiburg,Germany.3FRISYSFreiburgInitiativefor SystemsBiology,UniversityofFreiburg,79104Freiburg,Germany.4Present address:Kthe-Kollwitz-Schule,Reserveallee5,76646Bruchsal,Germany.5NeesInstituteforBiodiversityofPlants,UniversityofBonn,Meckenheimer Allee170,53115Bonn,Germany.6DepartmentofMedicineI,University MedicalCenterFreiburg,79106Freiburg,Germany.7UniversityofFlorida, Gainesville,FL32611,USA.8FRIASFreiburgInstituteforAdvancedStudies, UniversityofFreiburg,79104Freiburg,Germany.9BIOSSCentreforBiological SignallingStudies,UniversityofFreiburg,79104Freiburg,Germany.10Plant CellBiology,FacultyofBiology,UniversityofMarburg,Karl-von-Frisch-Str.8, 35043Marburg,Germany.11TheUniversityandJepsonHerbaria,Universityof California,Berkeley,CA94720,USA. Received:19December2013Accepted:4July2014 Published:11July2014 References1.RensingSA,LangD,ZimmerAD,TerryA,SalamovA,ShapiroH,Nishiyama T,PerroudPF,LindquistEA,KamisugiY,TanahashiT,SakakibaraK,FujitaT, OishiK,Shin-IT,KurokiY,ToyodaA,SuzukiY,HashimotoS,YamaguchiK, SuganoS,KoharaY,FujiyamaA,AnterolaA,AokiS,AshtonN,BarbazukWB, BarkerE,BennetzenJL,BlankenshipR, etal : The Physcomitrella genome revealsevolutionaryinsightsintotheconquestoflandbyplants. Science 2008, 319 (5859):64 – 69. 2.ZimmerAD,LangD,BuchtaK,RombautsS,NishiyamaT,HasebeM,Vande PeerY,RensingSA,ReskiR: Reannotationandextendedcommunity resourcesforthegenomeofthenon-seedplantPhyscomitrellapatens provideinsightsintotheevolutionofplantgenestructuresand functions. BMCGenomics 2013, 14: 498. 3.SugiuraC,KobayashiY,AokiS,SugitaC,SugitaM: Completechloroplast DNAsequenceofthemoss Physcomitrellapatens :evidencefortheloss andrelocationofrpoAfromthechloroplasttothenucleus. NucleicAcids Res 2003, 31 (18):5324 – 5331. 4.TerasawaK,OdaharaM,KabeyaY,KikugawaT,SekineY,FujiwaraM,SatoN: Themitochondrialgenomeofthemoss Physcomitrellapatens shedsnew lightonmitochondrialevolutioninlandplants. MolBiolEvol 2007, 24 (3):699 – 709. 5.TanBC: Anewclassificationforthegenus Physcomitrella B.S.G. JHattori BotLab 1979, 46: 327 – 336. 6.WijkR: IndexMuscorum. Utrecht,NL:RegnumVegetabile;1959:1959 – 1969. 7.TanBC: Physcomitrellapatens (Musci:Funariaceae)inNorthAmerica. The Bryologist 1978, 81 (4):561 – 567. 8.OchiH: ArevisionofthefamilyFunariaceae(Musci)inJapanandthe adjacentregions. JapJBot 1968, 20: 1 – 34. 9.MuellerF: NeueundbemerkenswerteMoosfundeausZaire. TropBryology 1995, 10: 81 – 90. 10.SlooverJL: NotedebryologieafricaineIII.Physcomitrellamagdalenae sp. nov. BulletinduJardinbotaniquenationaldeBelgique/Bulletinvande NationalPlantentuinvanBelgi 1975, 45 (1/2):131– 135. 11.LiuY,BudkeJM,GoffinetB: Phylogeneticinferencerejectssporophyte basedclassificationoftheFunariaceae(Bryophyta):rapidradiation suggestsrampanthomoplasyinsporophyteevolution. MolPhylogenet Evol 2012, 62 (1):130 – 145. 12.McDanielSF,vonStackelbergM,RichardtS,QuatranoRS,ReskiR,Rensing SA: ThespeciationhistoryofthePhyscomitrium-Physcomitrellaspecies complex. Evolution 2010, 64 (1):217 – 231.Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page17of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 19

13.PerroudPF,QuatranoRS: BRICK1isrequiredforapicalcellgrowthin filamentsofthemossPhyscomitrellapatensbutnotforgametophore morphology. PlantCell 2008, 20 (2):411 – 422. 14.EngelPP: Theinductionofbiochemicalandmorphologicalmutantsin themoss Physcomitrellapatens AmJBot 1968, 55 (4):438 – 446. 15.ReskiR,FaustM,WangXH,WeheM,AbelWO: Genomeanalysisofthe moss Physcomitrellapatens (Hedw.)B.S.G. MolGenGenet 1994, 244 (4):352 – 359. 16.BeikeAK,RensingSA: The Physcomitrellapatens genome – afirst steppingstonetowardsunderstandingbryophyteandlandplant evolution. TropBryology 2010, 31: 43 – 49. 17.FrahmJ-P: BiologiederMoose. Heidelberg,Berlin:SpektrumAkademischer Verlag;2001. 18.FritschR: IndexToBryophyteChromosomeCounts,vol.40. Berlin,Stuttgart:J. Cramer/GebruederBorntraeger;1991. 19.CrowKD,WagnerGP: ProceedingsoftheSMBETri-NationalYoung Investigators ’ Workshop2005.Whatistheroleofgenomeduplicationinthe evolutionofcomplexityanddiversity? MolBiolEvol 2006, 23 (5):887 – 892. 20.OhnoS: Evolutionbygeneduplication. NewYork:Springer;1970. 21.SoltisPS,SoltisDE: Theroleofhybridizationinplantspeciation. AnnuRev PlantBiol 2009, 60: 561 – 588. 22.VandePeerY,MaereS,MeyerA: Theevolutionarysignificanceofancient genomeduplications. NatRevGenet 2009, 10 (10):725 – 732. 23.RensingSA,IckJ,FawcettJA,LangD,ZimmerA,VandePeerY,ReskiR: An ancientgenomeduplicationcontributedtotheabundanceofmetabolic genesinthemoss Physcomitrellapatens BMCEvolBiol 2007, 7 (1):130. 24.WettsteinF: GattungskreuzungenbeiMoosen. ZInduktAbstammungsVererbungsl 1924,33: 253 – 257. 25.WettsteinF: Genetik. In ManualofBryology. EditedbyVerdoornF.Hague: TheNetherlands:(ed.F.Verdoorn).MartinusNiehoff;1932:233 – 272. 26.NatchevaR,CronbergN: Whatdoweknowabouthybridizationamong bryophytesinnature? CanJBot 2004, 82: 1687 – 1704. 27.RensingSA,BeikeAK,LangD,GreilhuberJ,WendelJF,LeitchIJ,Dole elJ: Evolutionaryimportanceofgenerativepolyploidyforgenomeevolution ofhaploid-dominantlandplants. In PlantGenomeDiversity. vol.inpress. Vienna,NewYork:Springer;2012. 28.AndrewsAL: AnewhybridinPhyscomitrium. Torreya 1918, 18: 52 – 54. 29.AndrewsAL: Taxonomicnotes.II.Anothernaturalhybridinthe Funariaceae. TheBryologist 1942, 45 (6):176 – 178. 30.BrittonEG: ContributionstoAmericanBryologyIX. BulletinoftheTorrey BotanicalClub 1895, 22 (2):62 – 68. 31.PettetA: HybridsporophytesinFunariaceae.I.Hybridsporophyteson Physcomitrellapatens (Hedw.)B.&S.,and Physcomitriumsphaericum (Schkuhr)Brid.inBritain. TransBrBryolSoc 1964, 4: 642 – 648. 32.RdingerM,FunkHT,RensingSA,MaierUG,KnoopV: RNAediting:only elevensitesarepresentinthe Physcomitrellapatens mitochondrial transcriptomeandauniversalnomenclatureproposal. MolGenet Genomics 2009, 24: 24. 33.MiyataY,SugiuraC,KobayashiY,HagiwaraM,SugitaM: Chloroplast ribosomalS14proteintranscriptiseditedtocreateatranslation initiationcodoninthemoss Physcomitrellapatens. BiochimBiophysActa 2002, 1576 (3):346 – 349. 34.RdingerM,SzovenyiP,RensingSA,KnoopV: AssigningDYW-typePPR proteinstoRNAeditingsitesinthefunariidmosses Physcomitrella patens and Funariahygrometrica. PlantJ 2011, 67 (2):370 –380. 35.BeikeAK,HorstNA,RensingSA: Axenicbryophyte invitro cultivation. EndocytCellRes 2010, 20: 102 – 108. 36.SteevesTA,SussexIMCRP: Invitro studiesinabnormalgrowthof prothalliofthebrachenfern. AmJBot 1955, 42: 232 – 245. 37.ReskiR,AbelWO: Inductionofbuddingonchloronemataand caulonemataofthemoss, Physcomitrellapatens ,usingisopentenyladenine. Planta 1985, 165 (3):354 – 358. 38.DoyleJJ,DoyleJL: IsolationofplantDNAfromfreshtissue. Focus 1990, 12: 13 – 15. 39.EdgarRC: MUSCLE:amultiplesequencealignmentmethodwithreduced timeandspacecomplexity. BMCBioinformatics 2004, 5: 113. 40.ClampM,CuffJ,SearleSM,BartonGJ: TheJalviewJavaalignmenteditor. Bioinformatics 2004, 20 (3):426 – 427. 41.FrickenhausS,BeszteriB: Quicktree-SD ;2008. 42.HoweK,BatemanA,DurbinR: QuickTree:buildinghugeNeighbourJoiningtreesofproteinsequences. Bioinformatics 2002, 18 (11):1546 – 1547. 43.RonquistF,HuelsenbeckJP: MrBayes3:Bayesianphylogeneticinference undermixedmodels. Bioinformatics 2003, 19 (12):1572 – 1574. 44.SchmidtHA,StrimmerK,VingronM,vonHaeselerA: TREE-PUZZLE: maximumlikelihoodphylogeneticanalysisusingquartetsandparallel computing. Bioinformatics 2002, 18 (3):502 – 504. 45.EdwardsK,JohnstoneC,ThompsonC: Asimpleandrapidmethodforthe preparationofplantgenomicDNAforPCRanalysis. NucleicAcidsRes 1991, 19 (6):1349. 46.TamuraK,PetersonD,PetersonN,StecherG,NeiM,KumarS: MEGA5: molecularevolutionarygeneticsanalysisusingmaximumlikelihood, evolutionarydistance,andmaximumparsimonymethods. MolBiolEvol 2011, 28 (10):2731– 2739. 47.LenzH,KnoopV: PREPACT2.0:PredictingC-to-UandU-to-CRNAEditing inOrganelleGenomeSequenceswithMultipleReferencesandCurated RNAEditingAnnotation. BioinformBiolInsights 2013, 7: 1 – 19. 48.vonStackelbergM,RensingSA,ReskiR: IdentificationofgenicmossSSR markersandacomparativeanalysisoftwenty-fouralgalandplantgene indicesrevealspecies-specificratherthangroup-specificcharacteristics ofmicrosatellites. BMCPlantBiol 2006, 6: 9. 49.NeiM,TajimaF,TatenoY: Accuracyofestimatedphylogenetictreesfrom moleculardata.II.Genefrequencydata. JMolEvol 1983, 19 (2):153 – 170. 50.SaitouN,NeiM: Theneighbor-joiningmethod:anewmethodfor reconstructingphylogenetictrees. MolBiolEvol 1987, 4 (4):406 – 425. 51.LangellaO: Populations1.2.28.PopulationGeneticSoftware(Individualsor PopulationsDistances,PhylogeneticTrees). availableathttp://www. bioinformatics.org/downloads/index.php?file_id=538.2002. 52.HusonDH,BryantD: Applicationofphylogeneticnetworksin evolutionarystudies. MolBiolEvol 2006, 23 (2):254 – 267. 53.SchweenG,GorrG,HoheA,ReskiR: Uniquetissue-specificcellcyclein Physcomitrella PlantBiol 2003, 5 (1):50 – 58. 54.PerroudPF,CoveDJ,QuatranoRS,McDanielSF: Anexperimentalmethod tofacilitatetheidentificationofhybridsporophytesinthemoss Physcomitrellapatens usingfluorescenttaggedlines. NewPhytol 2011, 2 (10):1469 – 8137. 55.UngererMC,StrakoshSC,ZhenY: Genomeexpansioninthreehybrid sunflowerspeciesisassociatedwithretrotransposonproliferation. Curr Biol 2006, 16 (20):R872 – R873. 56.LynchM,ConeryJS: Theevolutionaryfateandconsequencesofduplicate genes. Science 2000, 290: 1151 – 1155. 57.FlagelL,UdallJ,NettletonD,WendelJ: Duplicategeneexpressionin allopolyploid Gossypium revealstwotemporallydistinctphasesof expressionevolution. BMCBiol 2008,6: 16. 58.ChaudharyB,FlagelL,StuparRM,UdallJA,VermaN,SpringerNM,Wendel JF: Reciprocalsilencing,transcriptionalbiasandfunctionaldivergenceof homeologsinpolyploidcotton(gossypium). Genetics 2009, 182 (2):503 – 517. 59.FlagelLE,WendelJF: Evolutionaryratevariation,genomicdominance andduplicategeneexpressionevolutionduringallotetraploidcotton speciation. NewPhytol 2010, 186 (1):184 – 193. 60.SenchinaDS,AlvarezI,CronnRC,LiuB,RongJ,NoyesRD,PatersonAH, WingRA,WilkinsTA,WendelJF: Ratevariationamongnucleargenesand theageofpolyploidyinGossypium. MolBiolEvol 2003, 20 (4):633 – 643. 61.OhtaniS,IchinoseM,TasakiE,AokiY,KomuraY,SugitaM: Targetedgene disruptionidentifiesthreePPR-DYWproteinsinvolvedinRNAeditingfor fiveeditingsitesofthemossmitochondrialtranscripts. PlantCellPhysiol 2010, 51 (11):1942 – 1949. 62.NewtonAE,WikstrmN,BellN,ForrestLL,IgnatovMS: DatingThe DiversificationOfThePleurocarpousMosses. In Pleurocarpousmosses: SystematicsandEvolution ,vol.SpecialVolume71.EditedbyTangneyN. BocaRaton:SystematicsAssociation:CRCPress;2006. 63.ZobellO,FaiglW,SaedlerH,MunsterT: MIKC*MADS-boxproteins: conservedregulatorsofthegametophyticgenerationoflandplants. Mol BiolEvol 2010, 27 (5):1201 – 1211. 64.GlimeJM: BryophyteEcology. In Volume1PhysiologicalEcology. Editedby GlimeJM.2007.vol.1:EbooksponsoredbyMichiganTechnological UniversityandtheInternationalAssociationofBryologists. 65.NakosteenPC,HughesKW: Sexuallifecycleofthreespeciesof Funariaceaeinculture. Bryologist 1978, 81: 307 – 314. 66.McDanielSF,ShawAJ: Selectivesweepsandintercontinentalmigrationin thecosmopolitanmoss Ceratodonpurpureus (Hedw.)Brid. MolEcol 2005, 14: 1121 – 1132.Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page18of19 http://www.biomedcentral.com/1471-2148/14/158

PAGE 20

67.LewisLR,BehlingE,GousseH,QianE,ElphickCS,LamarreJF,BetyJ, LiebezeitJ,RozziR,GoffinetB: Firstevidenceofbryophytediasporesin theplumageoftransequatorialmigrantbirds. PeerJ 2014, 2: e424. 68.BoereGC,StroudDA: TheFlywayConcept:WhatItIsAndWhatItIsn ’ t. Edinburgh,UK:TheStationeryOffice;2006. 69.HooperEJ,DuckettJG,CumingAC,KuninWE,PresselS: Ephemerella readeri Mll.Hal.( Physcomitrellareaderi (Mll.Hal.)I.G.Stone&G.A.M. Scott,Funariidae,Bryophyta):agenusandspeciesnewtoEurope. JBryol 2010, 32: 256 – 264. 70.VittDH: AdaptiveModesoftheMossSporophyte. TheBryologist 1981, 84 (2):166 – 186. 71.KamisugiY,vonStackelbergM,LangD,CareM,ReskiR,RensingSA, CumingAC: Asequence-anchoredgeneticlinkagemapforthemoss, Physcomitrellapatens. PlantJ 2008, 56 (5):855 – 866.doi:10.1186/1471-2148-14-158 Citethisarticleas: Beike etal. : Molecularevidenceforconvergent evolutionandallopolyploidspeciationwithinthe Physcomitrium Physcomitrella speciescomplex. BMCEvolutionaryBiology 2014 14 :158. Submit your next manuscript to BioMed Central and take full advantage of: € Convenient online submission € Thorough peer review € No space constraints or color “gure charges € Immediate publication on acceptance € Inclusion in PubMed, CAS, Scopus and Google Scholar € Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Beike etal.BMCEvolutionaryBiology 2014, 14 :158 Page19of19 http://www.biomedcentral.com/1471-2148/14/158



PAGE 1

1 Figure S5 Habitus of gametophores and leaflets Physcomitrella accessions grown under standardized in vitro conditions on solid mineral medium. (A) Physcomitrella patens [ Physcomitrella patens ssp. patens ] from Gransden, Europe; (B) Physcomitrella patens [ patens ssp. patens ] from Lviv, Europe; (C) Physcomitrella patens [ patens ssp. pate ns ] from Illinois, USA; (D) Physcomitrella patens [ patens ssp. california ] from California, USA; (E) Physcomitrella readeri [ patens ssp. readeri ] Australia; (F) Physcomitrella magdalenae [ patens ssp. magdalenae ] from Rwanda, Africa; (G) Physcomitrella rea deri [ patens ssp. california ] Okayama, Japan; (H ) Physcomitrella readeri [ patens ssp. californica ] from Kumamoto Japan; (I) Physcomitrella readeri [ patens ssp. california ] from Saitama, Japan.