Evaluation of Phomopsis amaranthicola sp. nov. as a biological control agent for Amaranthus spp.

MISSING IMAGE

Material Information

Title:
Evaluation of Phomopsis amaranthicola sp. nov. as a biological control agent for Amaranthus spp.
Physical Description:
Book
Language:
English
Creator:
Rosskopf, Erin Nichole, 1967-
Publication Date:

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
aleph - 28638299
oclc - 38863575
System ID:
AA00026805:00001


This item is only available as the following downloads:


Full Text











EVALUATION OF PHOMOPSIS AMARANTHICOLA SP. NOV. AS A
BIOLOGICAL CONTROL AGENT FOR AMARANTHUS SPP.












By

ERIN NICHOLE ROSSKOPF


















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA

1997

























Copyright 1997
by
Erin N. Rosskopf


























To
Mom And Dad
















ACKNOWLEDGMENTS

I would like to thank Dr. Raghavan Charudattan for his support and interest in my progress, both as a scientist and as a human being. Without his continuity and belief, I could not have completed my program. I would like to thank Dr. Shoemaker and Dr. Morsink for their encouragement and belief in me. I would like to thank Dr. Dave Mitchell for his inspiration and high standards and for teaching me how to think in a holistic way about plant disease. I thank my committee members, Dr. James Kimbrough, Dr. Corby Kistler, and Dr. Tom Bewick, for their input, assistance and open access to their facilities. I would like to thank all of my committee members for being role models committed to teaching. Without their expertise, I would not have known where to begin or end. I would also like to thank Dr. Uma Verma and Mr. Jim DeValerio for their friendship and for "teaching me the ropes." Assistance from Dr. Gerry Benny and Ulla Benny was invaluable and allowed me to explore areas of research that I would not have been able to do otherwise. Help from Mr. Jerry Minsavage, Dr. Frank Martin, Ms. Patty Rayside, Dr. Earl Taliercio, Dr. Vicente Febres, and Dr. Bill Stall is much appreciated. I thank Dr. Agrios for his support. I also thank all of the staff for their help and for keeping everything going. I extend my thanks to Mr. Gene Crawford, Mr. Lucious Mitchell, Mr. Eldon Philman, Mrs. Nancy Philman, and Mr. Bill Crawford for their help, support, love, and friendship. Special thanks to Bill for hanging in there through the rough parts and a hope that he thinks it



iv









was worth it. I would like to thank Dr. Rose Koenig, Dr. Tim Widmer, Dr. Jim Gaffney, Dr. Margaret Smither-Kopperl, Dauri Tessman, Daniela Lopes, Bob Kemerait, and Kenny Seebold for their friendships and guidance. Many thanks to Mark Elliott for letting me whine whenever I needed to. I could not have completed the daily activities in my program without the assistance of Will Canova, Jay Gideon, Eric Azara, and StayC Graham. I appreciate the expertise provided by Jason Lampert, Carolyn Bartuska, Jay Harrison, and Greg Erdos and the Electron Microscopy staff. Special thanks go to the late Dr. Bud Uecker and Dr. Amy Rossman for their invaluable assistance and inspiration. I would like to thank Drs. Robinson Pitelli and Li-Chuan Liu for their friendships and the opportunities they afforded for working on an international scale. I would also like to thank Drs. Alicia Maun and Beree Darby for keeping me healthy and sane. My best wishes for success to all of the students in Dr. Charudattan's program. I could not have gotten through the rough parts without my constant companion, Elias, who never barked too loudly when I got home late. I would also like to thank Rita Rosskopf, George and Mabel Liebau, and the rest of my family for being patient and loving. Most thanks go to Cheri and Allen Rosskopf for being the greatest human beings alive, for being my best friends and for always loving me no matter what. It was their fascination with the natural world around them, their unique abilities to see the beauty in nature and the crucial gift of knowing how to share it that got me on this path. I couldn't have taken even the first step without them.








17
















TABLE OF CONTENTS

ACKNOWLEDGMENTS ............................................................. iv

ABSTRACT ........................................................................... viii

CHAPTERS

I. INTRODUCTION......................................................... 1

II CHARACTERIZATION OF PHOMOPSIS
AMARANTHICOLA, SP. NOV ........................................... 20
Introduction .......................... ............. ..................... 20
Materials and Methods ................................................. 29
Results ............................................................ 41
Discussion....................................................................... 61
III THE EFFECTS OF EPIDEMIOLOGICAL CONDITIONS ON THE
PATHOGENIC EFFICACY OF PHOMOPSIS AMARANTHICOLA 68
Introduction ........................................................ 68
Materials and Methods ......................................................... 71
Results ................................................................. 75
Discussion ....................................................... ...... 84
IV FIELD EVALUATION OF PHOMOPSIS AMARANTHICOLA ...... 91
Introduction ......................................................... 91
Materials and Methods .............................................. 93
Results .................................. ............................... 95
Discussion .......... ......... .......................................... 110
V COMPATIBILITY, FORMULATION, AND APPLICATION....... 116
Introduction .......................................................... 116
Materials and Methods ............................................ 129
R esults ...................... ......................................... 134
Discussion ............................................................ 140
VI SUMMARY AND CONCLUSIONS .................................. 150












vi









APPENDICES

A SEQUENCE ALIGNMENTS OF rDNA INTERNAL TRANSCRIBED
SPACER REGIONS .............................................................. 154

B WEATHER DATA DURING FIELD EVALUATION OF
PHOMOPSIS AMARANTHICOLA ............. .................... 161

C GERMINATION OF CONIDIA OF PHOMOPSIS
AMARANTHICOLA OVER TIME ...................................... 164

D CARBON DIOXIDE PRESSURIZATION AND pH ................. 166

E ISOLATION OF FUNGI FROM AMARANTHUS DUBIUS
IN PUERTO RICO .......................................................... 168

REFERENCE LIST ............................................................... 174

BIOGRAPHICAL SKETCH ........................................................ 191
































vii














Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EVALUATION OF PHOMOPSIS AMARANTHICOLA SP. NOV. AS A
BIOLOGICAL CONTROL AGENT FOR AMARANTHUS SPP.

By

Erin Nichole Rosskopf
December, 1997


Chairman: Dr. Raghavan Charudattan Major Department: Plant Pathology


A new species, belonging to the fungal genus Phomopsis (Sacc.) Bubik, was identified as the causal agent of a leaf and stem blight occurring on Amaranthus L. sp. in Florida. The fungus (isolate ATCC# 74226) was identified as a new species, P. amaranthicola Rosskopf, Charudattan and Shabana, based on the morphological characteristics, as well as through partial genetic characterization.

The potential for use of this organism as a biological control agent to manage pigweeds and amaranths was evaluated. Conidial suspensions of P. amaranthicola were most effective in causing high levels of plant mortality when tested in comparison with mycelial suspensions in both greenhouse and field trials. Fungal suspensions amended with a psyllium mucilloid were effective in causing plant mortality even in the absence of a dew period. A dew period lasting for 24 h resulted in the greatest plant mortality regardless of the type of inoculum suspension or the amendment, although 8 h of dew were adequate for severe infection. Conidial


Viii









suspensions ranging from 1.5 x 106 to 1.5 x 10' conidia/ml were most effective in causing high levels of mortality of pigweeds of the two- to four-leaf stage. Dew temperatures ranging from 25-350 C were most conducive for disease development and plant mortality.

The host range of P. amaranthicola was tested using a centrifugalphylogenetic scheme (Wapshere, 1974), with A. hybridus as the focal plant. Thirtythree biotypes belonging to 22 known and two unknown species of Amaranthus were tested for susceptibility to the fungus. All accessions were susceptible to the fungus, but susceptibility did not lead to mortality in all cases. Species in which there was a minimum of one biotype succumbing to 80-100% mortality included A. acutilobus L., A. lividus L., A. powellii S. Wats., A. retroflexus L., and A. viridus L. Plants within the family Amaranthaceae, but outside the genus Amaranthus, as well as crops in which pigweeds are a problem, were also tested for susceptibility to the fungus. A substantial number of plants that are reported to have an association with another member of the genus Phomopsis were also tested. No plants outside the genus Amaranthus showed any symptoms, nor was P. amaranthicola found to be present in their tissues as evidenced microscopically or through isolation techniques.

Phomopsis amaranthicola was field tested during the summers of 1993, 1994, and 1995. The species A. hybridus, A. lividus, A. spinosus L., A. retroflexus, and A. viridus were included. In addition, a triazine-resistant accession of A. hybridus was used. Field treatments consisted of single or double applications of mycelium and two concentrations of conidia. As in greenhouse trials, conidial suspensions were most effective in causing high levels of plant mortality, although A. lividus and A.



ix









viridus were effectively controlled with all treatments. The characteristics of this fungus indicate that it would be a useful component in an integrated weed management program for pigweeds and amaranths.













































X














CHAPTER I
INTRODUCTION

Weed control in the United States has followed trends similar to those of other

types of pest control. Historically, the dependence on cultural practices diminished in the mid 1960s as reliance on chemical herbicides increased. Although mechanical and cultural practices are still a necessary part of a successful weed management strategy, the limited number of individuals producing food in the United States has made the use of herbicides the most economically advantageous means.

Weeds are considered one of the most limiting factors in crop production. In Florida, for example, losses due to weeds in cotton were estimated at approximately $168.00 per hectare in 1994 (Colvin, 1995). In soybeans, as much as $197.68 per hectare was lost in 1994 to weeds through the cost of herbicides, loss in yield, quality, land value, and in additional costs for land preparation, cultivation, and harvesting. It has been estimated that more than 80% of all pesticides sold in the U.S. are herbicides and the area treated with herbicides has increased from 9 million hectares in 1949 to approximately 197 million hectares treated in 1990 (Anderson, 1983; Bellinder, 1994).

Although herbicides have proven to be extremely effective means of vegetation control, their use has come with a number of direct and indirect costs that are now being considered as outweighing the benefits in many cases. Public concern has increased over the contamination of water sources, as well as agronomic problems caused by the overuse and soil persistence of many herbicides. The latter has become increasingly important as



1









the emergence of resistant weed populations has risen with the development and widespread use of the imidazolinone and sulfonylurea families of herbicides and the continued application of triazine herbicides (Ahrens et al, 1981; Anderson, 1983; Manley et al., 1996; Sivakumaran et al., 1993; Stallings et al., 1994).

The development of resistance, at least the resistance that has been

documented at this time, can be attributed primarily to either prolonged use of a class of herbicides or the herbicide acting at a single dominant site of action (Holm and LeBaron, 1990; Vencill and Foy, 1988). Resistance to triazine herbicides, as an example, has been found to be conferred by a single recessive gene, which alters the triazine binding sites on the chloroplast membranes (Fuerst et al., 1986b)

The damage that can occur to crops as a result of soil persistence has been minimized with newer herbicides, but continues to be a problem. As the number of herbicides registered decreases and public pressure to diminish chemical use heightens, there comes an increased need for the development of efficacious alternatives to traditional, chemical herbicides. This general trend encourages the search for cultural practices and biological control agents that can be used in integrated weed management programs.

For some specific weed systems, due to the limited registration of effective

herbicides and the development of resistance to others, there are open avenues for the development of fungi to be used as mycoherbistats. There is extensive literature concerning the use of plant pathogenic fungi for the biological control of weeds in agricultural and ecological settings (Abbasher and Sauerborn, 1992; Adams, 1988; Anderson and Walker, 1985; Andres et al., 1976; Auld et al., 1988; Auld and Morin,






3


1995; Bewick et al., 1986; Charudattan,1990; Daigle and Connick, 1990; TeBeest and Templeton, 1985; Templeton et al., 1979). A number of fungi have been shown to be capable of controlling their target weeds. Some of these have been examined extensively, while others are still in the preliminary of evaluation. Two mycoherbicides, Collego (Encore Technologies, Minnetonka, MN), registered for control of northern jointvetch (Aeschynomene virginica [L.] B. S. P.) in rice and DeVine (Abbott Laboratories, Chicago, IL) for control of stranglervine (Morrenia odorata [Hook. and Amott] Lindl.) in Florida citrus, were introduced into commercial use in the 1980s. Dr. Biosedge, a commercial preparation of Puccinia canaliculata (Schwein.) Lagerh. for the control of nutsedge in agricultural settings is registered with the Environmental Protection Agency, but is unavailable because of a lack of commercial interest in production (Phatak, personal communication to R. Charudattan, 1995). BioMal, a commercial product consisting of formulated spores of Colletotrichum gloeosporioides f. sp. malvae, has been efficacious, but has suffered from limited commercial success (Cross and Polonenko, 1996). Two biological control agents, Camperico, Xanthomonas campestris pv. poae, and Biochon, Chondorstereum purpureum, are currently being marketed for use in turf and for hardwood weed control, respectively (Auld, 1997; Imaizumi et al., 1997).

The development of a mycoherbicide may be complicated by a number of factors. A good candidate system should include an organism that can be cultured easily, maintains stability in culture, has a host range that is suitably limited, and has a relatively high level of efficacy, being able to perform adequately in the field. This is often the most limiting factor in development. These conditions may be met with a simple,






4


aqueous formulation of the pathogen or may be effected with a formulation that enhances the performance of the agent.

The first step in the developmental process of a biological control agent for a weed or group of weeds is to isolate and screen potential pathogens for their ability to cause severe plant disease. Once a pathogen has been identified that shows potential, the biology of the pathogen must be studied to determine the optimum environmental conditions for its success. These conditions would include the most disease conducive temperature, dew duration, plant growth stage, and application method (Charudattan, 1990; Heiny and Templeton, 1991; Klein et al., 1995; McRae and Auld, 1988; Mintz et al., 1992; Morin et al, 1990a; Mortensen, 1986; TeBeest, 1985). Formulation of the pathogen may be varied, and a number of adjuvants may be evaluated that might enhance the development of disease in the field (Amsellam et al., 1990; Klein et al., 1995). The system must then be tested in a field situation to determine if the move to large scale use might be possible.

Weeds that have a number of characteristics that make them excellent targets for mycoherbicidal control, where a fungus is applied inundatively, are pigweeds and amaranths. Pigweeds and amaranths belong to the genus Amaranthus L. (Amaranthaceae) and are broadleaf plants that are predominantly herbaceous annuals, although there are a few woody species. These plants are characterized by the production of a well developed tap root that can extend many feet into the ground, which renders them relatively drought tolerant. Pigweeds produce compound inflorescence and seeds within utricles, which may be dehiscent or indehiscent. The species that have been used as grain crops are dehiscent. Species may be either monoecious or dioecious. There are approximately 60 species described in the genus Amaranthus. Speciation is based






5


primarily on morphological characteristics of the flowers, although this is complicated by outcrossing between species (Radford et al., 1968).

Amaranthus spp. utilize the C4 photosynthetic pathway, which makes them

favored in areas with high temperatures, intense sunlight, and dry conditions (Ahrens and Stoller, 1983; National Research Council, 1989; Nielson and Anderson, 1994; Patterson et al., 1985; Pearcy et al., 1981), although they are commonly found where the soil has been disturbed and is not excessively wet. Amaranthus viridus L., considered to be a more tropical species, can tolerate higher moisture than other species (Holm et al., 1997).

The majority of information concerning amaranths comes from the literature related to their uses as food sources. The three species most commonly used as grain crops include Amaranthus caudatus L. (=A. edulis Speg.), A. cruentus L., and A. hypochondriachus L. (National Research Council, 1984). These species are predominantly self-pollinated, although outcrossing can occur (Transue et al., 1994). Hybrids of A. hypochondriachus and A. caudatus are viable, while other crosses involving these three species are not. Species grown as leafy vegetables include A. cruentus, A. dubius Mart. ex Thell., A. tricolor L. (=A. gangeticus L.), A. lividus L. (syn.= A. blitum L.), and A. palmeri S. Wats. (Cole, 1979).

Due to the interest in Amaranthus spp. as crops, some work has been done to track the origin and modes of distribution of these plants. Direct evidence documenting initial domestication is scant and a number of hypotheses have been suggested. A comprehensive discussion has been provided by Sauer in a number of papers, but no decisive conclusions are drawn concerning each species due to lack of






6


direct evidence (Sauer, 1950; 1967). It is believed that A. hypochondriachus was derived from A. powellii S. Wats. and that A. cruentus L. was derived from the weed species, A. hybridus L. Amaranthus caudatus most probably originated from cultivated A. quitensis H. B. K. (Sauer, 1967). By 1492, there were two major areas of amaranth cultivation that included the highlands of Peru south into Bolivia, extending to Argentina as one area, and through the highlands of Guatemala through Mexico and into the southwestern United States as the second area. It has been proposed that A. hypochondriachus and A. cruentus were originally native to the Mexican area and that A. caudatus originated in the Andean area. Amaranthus and A. hypochondriachus were spread, evidently by the Spanish, into Europe as ornamentals, and by the 1700s were being cultivated as grain crops. By the 19th century, grain amaranths had been taken to Africa and Asia, where there now exist secondary centers of diversity (Sauer, 1967; National Research Council, 1984). Amaranthus cruentus may have been one of the most ancient crops domesticated in America. This species was introduced into Europe before 1600 (Cole, 1979). The origination of the species commonly cultivated as vegetables has not received a great deal of attention, although the origin of A. tricolor and A. lividus is considered to be in China (Tindall, 1983).

Amaranthus caudatus, also referred to as kiwicha, has been reported as playing a significant role in both the nutritional and spiritual lives of the Andean cultures. Tombs more than 4,000 years old have been found to contain apparently domesticated amaranth seeds (National Research Council, 1989). Conflicting reports concerning the common name of the species found there, also reported to be huauhtli,






7


make it difficult to determine if this refers to A. hypochondriachus or A. caudatus. It is hypothesized that the use of popped amaranth seeds or flour mixed with blood or honey to create small forms or idols, which were eaten during a variety of rituals and festivals, led to the loss of amaranth as a crop after the Spanish conquest. The Catholic church viewed these as pagan activities and prevented cultivation of the crop (Sauer, 1967).

Amaranthus caudatus has a variety of common names, including Inca wheat (trigo del inca), quihuicha, and kiwicha and is found throughout Central and South America, India, Iran, and China (Rehm and Espig, 1991). This species contains two true varieties that were developed in Peru. Noel Vietmeyer, a tall and somewhat disease resistant variety, produces slightly lower seed yields compared to the more disease susceptible Alan Garcia, which is short and yields as much as 5 tons of seed per hectare if the conditions are favorable (National Research Council, 1989). Amaranthus caudatus is one of the few species that grows well above 1500 meters.

Amaranthus hypochondriachus also has a number of vulgar names, including

princess feather, algeria, guautli, and huauthli, and is found throughout India and China, as well as in its proposed area of original cultivation. Amaranthus hypochondriachus is considered to be the best yielding grain amaranth (Cole, 1979). Amaranthus cruentus is commonly called purple amaranth and is distributed throughout Central America, India, and China. This species has been used for dye production. It was also used as a vegetable crop in West Africa. Since its move into Asia, use of this crop has become more popular there than in its area of origin. These three species grow well in the lowlands, as well as in mountainous regions (Rehm and Espig, 1991), although A. caudatus is apparently better adapted to higher elevations. Plants of this type grow best at 21-28" C. Most cannot tolerate frost, although a few cold-tolerant lines have been









found. Genotypes have been found that can tolerate high salinity, wide ranges of soil pH (optimum ranging from 5.5-7.5) and aluminum toxicity (National Research Council, 1989).

Some consider the grain amaranths to be an excellent source of protein, with a range of 13-18% of the total dry weight being composed of protein. Starch composes approximately 50-60% of the total dry weight (Paredes-Lopez, 1994). The grain is also high in lysine, calcium, zinc, phosphorous, iron, potassium, vitamin B-complex, and vitamin E (National Research Council, 1989; Paredes-Lopez, 1994). It has been suggested that the grain be used in a protein complementation with oats or wheat to balance the high lysine level with a deficiency in leucine, which is found in abundance in the more common grains. The lysine content can be reduced by as much as 17% as a result of popping the seeds. In addition to the excellent nutritional quality of the grain, it also contains tocotrienols, which have been associated with cholesterol reduction, anti-tumor activity, and anti-oxidative activity (Paredes-Lopez, 1994).

Amaranthus tricolor is the species most commonly used as a vegetable crop. This is often referred to as Chinese spinach, Chinese amaranth, aupa, and tampala. This species is found throughout the tropics and subtropics of the world (Rehm and Espig, 1991). Amaranthus dubius and A. lividus were once grown as leafy vegetables (National Research Council, 1984). Amaranthus lividus is the ingredient for dishes known as vleeta in Greece and norpa in India (Grubben, 1977). Amaranthus dubius has a broad distribution, with a single cultivar, claroen, grown in West Africa, Central and South America, and India (Paredes-Lopez, 1994).






9


In India these vegetables play an important role during the hot season

(Grubben, 1977). In 1984, it was estimated that the leaves of amaranth provided at least 25% of the dietary protein intake during the harvest season (National Research Council, 1984). The total dietary fiber ranges from 3% in Mexican samples to 12.9% in those collected from Indian plantings; between 27 and 33% percent of the total dry matter is composed of protein. These leafy vegetables are high in calcium, vitamin A, potassium, vitamin C, and niacin (Paredes-Lopez, 1994). Yields as high as 40 tons of vegetable matter per hectare have been reported, although yields, depending upon the species and location, more commonly fall between 4 and 14 tons/hectare (National Research Council, 1984). The foliage can be harvested within 3-6 weeks of transplanting seedlings and can either be harvested by removing the small plants or several cuttings may be taken from the same plants (Grubben, 1977). High levels of nitrate and oxalate are antinutritional factors associated with these leafy vegetables. Problems arise when a diet is deficient in calcium and high levels of oxalate are consumed. The excess oxalate binds calcium and causes deposition of insoluble calcium oxalate in the digestive, urinary, and blood tracts (Williams, 1993). Nitrates and oxalates are reduced significantly when the leafy vegetables are boiled.

Many species of amaranth produce seeds prolifically, with some researchers reporting up to 100,000 seeds per plant (Radford et al., 1968; Walters and Keil, 1977), while others have identified species, such as A. viridus and A. retroflexus L., that can produce from 230,000 to 500,000 seeds per plant (Stevens, 1932). The small seeds are commonly found within the first few millimeters of soil and are stimulated to germinate by common cultivation practices. The rate of seed germination is high






10


under cultivation, as the flash of light created by the tilling of the soil is enough to increase the germination significantly (Anderson, 1983). Holm et al. (1997) report that researchers have found that a strong exposure to light for 2 seconds is adequate to increase germination of A. retroflexus seeds from 50%, as obtained in the dark, to 100%. Seeds from these plants may be spread in manure, with crop seeds, and through irrigation systems.

The competitive ability of pigweeds and amaranths has been well documented in a number of cropping systems. In corn, for example, pigweeds have caused losses in yield as high as 40% (Holm et al., 1997). Cotton yields may also be affected dramatically by pigweed interference. It has been reported that there is a linear decline in cotton yield if pigweed density is increased from zero to 32 plants per 15 m of row (Buchanon et al., 1980a; Byrd and Coble, 1991; Street et al., 1981). In potatoes (Solanum tuberosum L.), a single redroot pigweed (A. retroflexus) plant per meter of row caused losses as high as 32% of marketable tubers (Murray et al., 1994; Vangessel and Renner, 1990). Due to these characteristics, pigweeds are considered to be among the world's worst weeds (Holm et al., 1977).

Three species in particular have been studied extensively due to their

extremely detrimental impacts and wide distributions. Amaranthus hybridus, smooth pigweed, is an agronomic pest in as many as 27 countries, including the United States, Brazil, Argentina, New Zealand, and Mexico. This weed is considered to be a principal problem in crops such as peas (Pisum sativum L.), sugar beets (Beta vulgaris [L.] Beav.), sugarcane (Saccharum officinarum L.), potatoes, wheat (Triticum aestivum L.), and soybeans (Glycine max [L.] Merr.).









Amaranthus spinosus L., spiny amaranth, is also widely distributed, with

populations being most troublesome in tropical and subtropical regions. This species has been reported as a major weed problem in more than 40 countries, including the United States, Brazil, Taiwan, and Thailand, and it affects a number of valuable crops, including tobacco (Nicotiana tabacum L.), cotton (Gossypium hirsutum L.), cassava (Manihot esculenta Crantz), upland rice (Oryza sativa L.), mangoes (Mangifera indica L.), sorghum (Sorghum bicolor [L.] Moench), sweet potatoes (Ipomoea batatas [L.] Lam.), and papaya (Carica papaya L.).

Amaranthus retroflexus, commonly known as redroot pigweed, is reported as a serious or problematic weed in 32 countries. Amaranthus lividus and A. viridus are also broadly distributed and affect crops in more than 30 countries. Amaranthus viridus and A. dubius are considered to be some of the worst weeds in Puerto Rico, where they affect the growth of many fruit crops, as well as beans and garlic (Liu, L-C., personal communication, 1997). In Florida, pigweeds are included in the 10 most commonly found weeds in tobacco, soybeans, cotton, and peanuts (Arachis hypogea L.) (Colvin, 1995).

In addition to the problems associated with pigweeds as competitors with

economically important crops, there is also documentation of their impact on livestock. Pigweeds can contain high nitrate levels, depending upon the soil fertility and growth stage, and have been implicated in the loss of livestock due to poisoning (Holm et al., 1977). Horses and cattle are most susceptible to this effect, but sheep are reported to be unaffected, although there are some older reports that do not concur with this finding (Holm et al., 1997). In areas where herbicide use is limited by choice, such as in organic production areas, pigweeds may render the land virtually unusable (Figure 1-1).






12


Traditionally, pigweeds have been controlled using triazine herbicides, which have been extremely effective, but their persistence in the soil, coupled with their extreme selection pressure and highly specific mode of action, have resulted in the emergence of many resistant weed populations (Ahrens et al., 1981; Ahrens and Stoller, 1983; Jachetta, 1979; Vencill and Foy, 1988). These resistant plants were also found to be cross-resistant to a number of other herbicides (Fuerst et al., 1986a; Fuerst et al., 1986b). Amaranthus retroflexus was one of the first species that was identified as exhibiting resistance to triazine-type herbicides (Holm et al., 1997). Currently, there are a number of herbicides that are effective for control of weeds belonging to the genus Amaranthus, although the majority of these are registered for use in cereal crops, turf, and major vegetable crops (Crop Protection Chemicals Reference, 1994; Durghesha, 1994; Fuerst et al., 1986b; Grichar, 1994; Jordan et al., 1994; Krausz et al., 1994; Mekki and Leroux, 1994; Moomaw and Martin, 1985; Wilson et al., 1980); however, they are used predominantly as preplant incorporated treatments. Minor crops, for which there are few herbicides registered for pigweeds, have few options for control of these weeds. Many of the currently registered herbicides for major crops are effective in controlling pigweeds; these include herbicides that have active ingredients such as glyphosate, bentazon, trisulfuron, metsulfuron methyl, trifluralin, or imazypyr. Many of these herbicides, however, have problematic issues, such as nontarget effects and toxicity problems.

Biirki et al. (1997), in reviewing strategies for control of amaranth, reported on results obtained by Senesav and Minotti, in which three management strategies were compared for distribution and emergence of pigweeds. The three treatments






13









































Figure 1-1. Severe infestation of Amaranthus hybridus L. in a cattle pasture in southeastern Pennsylvania. An infestation of this kind, coupled with a desire on the farmer's part to limit use of chemical herbicides, leaves few alternatives for control of this weed. These factors can render this land virtually unusable.






14


compared included using clover (Trifolium repens L.) as a living mulch, using a conventional tillage system, and using a no-tillage system. The living mulch reduced the growth of pigweed most significantly. Work by Ammon, reviewed in the same paper, showed that reductions in cultivation also reduced pigweed growth, but not significantly enough to consider cultivation reduction effective as a sole control practice. The conclusion drawn from studies such as these indicates that an integrated management approach is necessary for adequate control of pigweeds and amaranths. The use of biological control agents could contribute to an integrated approach.

Amaranth suffers from few limiting diseases, although a number of pests have been reported as occurring on various species. Literature citations on disease problems are scarce and many mentions are brief and vague. The relative scarcity of pathogens may be a result of the production of suspected allelopathic substances (Paredes-Lopez, 1994). Insect pests and a few fungal pathogens are considered to be the most common. Nematodes occur on amaranth, but are considered minor problems. In Peru, there have been reports implicating phytoplasmas in diseases in amaranth (National Research Council, 1984). Abiotic factors that can affect growth include aluminum and manganese toxicity in marginal soils (National Research Council, 1989). In the United States, it is suspected that air pollution has a significantly detrimental effect on amaranth growth.

Insect pests have had more of an impact on amaranth growth than have fungal, bacterial or viral pathogens. The most common insect pest found on amaranth in the United States is the tarnished plant bug, Lygus lineolaris (Hemiptera: Lygaeidae). Insect pressure from Psara bipunctalis (Lepidoptera) on Amaranthus cruentus has






15


been heavy enough to result in recommendations to apply chemical insecticides to amaranths grown as crops. In the course of underground tunneling, the African mole cricket (Gryllotalpa gryllotalpa [Orthoptera: Gryllotalpidae]) has a detrimental effect on amaranth growth by breaking through roots (Tindall, 1983). Perhaps the insect pests with the most significant affect are the stem borers. This group appears to have the most impact on amaranth production in Mexico (Sciara spp. [Diptera: Sciaridae]) and in Africa and India (Lixus trunculatus [Coleoptera: Cleoninae]), where some species of amaranths are still utilized as a food source (Grubben, 1977; Sauer, 1967; Tindall, 1983).

Fungal pathogens have great potential for limiting growth of amaranths.

Although the importance of particular pathogens is dependent upon the location, the pathogens causing damping-off are considered to be most severe. Species of Pythium Pringsh., Rhizoctonia DC., and Fusarium Link:Fr. are most commonly referred to as the causal agents of the observed damping-off (Grubben, 1977; National Research Council, 1984; Paredes-Lopez, 1994), although it appears that P. aphanidermatum (Edson.) Fitzp., P. debaryanum Auct. non R. Hesse and P. myriotylum Drechs. are the most important species involved (Farr et al., 1989; Sealy et al.,1988). Thanatephorus cucumeris (A. B. Frank) Donk. (anamorph=Rhizoctonia solani Kiihn) is considered to be more prevalent than Fusarium spp. (D. Brenner, North Central Regional Plant Introduction Station, personal communication, 1995). Damping-off is considered to be a major limitation at the seedling stage, but there are no specific estimates of seedling loss due to this disease. Accessions of A. tricolor were found to be the most resistant species to these diseases (Sealy, 1988).






16


Blight and wet rot caused by Choanephora cucurbitarum (Berk. and Ravenel) Thaxt. are considered to be limiting or potentially limiting to amaranth growth. Choanephora blight is reported on A. cruentus in East Africa as one of the first reported disease problems in the crop there. Symptoms develop rapidly on plants infected with C. cucurbitarum, resulting in a leaf and stem blight that is accompanied by wet rotting. Diseased stems turn dark and brittle and bend downward. This pathogen is also reported from Florida and was first described on amaranth from Sumatra (Teri and Mlasani, 1994). This pathogen can be responsible for mortality of up to 50% of plants in populations where it has been observed. Insect damage can predispose plants to infection by this pathogen.

Leaf-spotting fungal pathogens are considered to be of minor importance in amaranth, but have the potential to cause damage, particularly to the leafy-vegetable types. Cercospora brachiata Ellis and Everh., C. beticola Sacc., and other species of Cercospora Fresen. have been reported from the United States and most other amaranth-growing regions with high humidity and rainfall for dissemination of the pathogen (Alfieri et al., 1984; Farr et al., 1989; Tindall, 1983).

Several other fungal pathogens are reported as being potentially harmful to

amaranth growth. These include Macrophoma (Sacc.) Berl. and Voglino. sp., Albugo blitii (Biv.-Bern.) Kuntz, and Alternaria amaranthi (Peck.) Van Hook. Macrophoma sp. causes stem black spot and could cause toppling, although there is only one reference to this disease (Paredes-Lopez, 1994). Albugo blitii is the causal agent of white rust and has been recognized on a wide range of species throughout the United States as well as Mexico, although it does not appear to cause any significant damage






17


(Wellman, 1977; Farr et al., 1989; Alfieri et al., 1984). Alternaria amaranthi has been reported throughout the United States and also has been reported from A. cruentus in Tanzania (Teri and Mlasani, 1994).

Two species of Meloidogyne may be limiting factors to amaranth growth.

Meloidogynejavanica has been reported as a problem in cultivated A. viridus, and M. javanica and M. incognita have been reported on A. hybridus (Luc et al., 1990). Root-knot nematodes may cause symptoms that range from small galls on otherwise normal roots to causing the formation of only a few severely galled roots with few or no rootlets and a disorganized vascular system. The more severe symptoms include wilt (from a loss of turgor pressure), chlorosis, and reduced flowering. It is unclear what race of M incognita infects amaranth.

In addition to the reports of root knot nematodes, Cactodera amaranthi is reported to be a sporadic and minor pest of vegetable amaranths in Mexico. Radopholus similis has been reported from A. viridus in the Ivory Coast, although it is not an important concern. Pratylenchus zeae has been reported to infect A. spinosus (Luc et al., 1990).

A bacterial disease of A. viridus, caused by Xanthomonas campestris pv. amaranthicola (Patel, Wankar, and Kulkarni) Dye was reported from India in the early 1950s. Although it was indicated that the bacterium could be transmitted to other weed species and to A. caudatus, no further mention of the pathogen exists (Bradbury, 1986).

Although a number of viruses have been reported to be mechanically

transmissible to Amaranthus spp., there is only one that appears to have an effect on






18


the growth of the minor vegetable species. Amaranthus mosaic potyvirus has been reported to cause mild to severe mosaic symptoms on A. lividus and A. viridus in India. Both old and young leaves appear mottled. The natural mode of transmission is unknown (Brunt et al., 1990). Something referred to as mosaic mottle has been reported from Peru, while a virus streak disease of amaranth has been reported from Brazil (Wellman, 1977).

The number of pathogens and nematodes that infect amaranths contributes to the need for their control. In addition to limiting crop production by direct interference with crops through competition, there is the possibility of contributing to existing crop disease problems through harboring of plant pests. The host ranges of some of the pests reported as occurring on amaranth are so wide that the presence of pigweeds in most crops could prove to be a detriment. Thanatephorus cucumeris causes a limiting disease in many of the same crops, including cotton, soybeans, corn, lettuce, tomato, and peanuts, in which pigweeds are reported as a troublesome weed. Pigweeds, thus, may serve as between-season or over-wintering hosts that allow for continued disease pressure, even when crop rotation is used.

Although there are many pathogens that may be considered as potential

biological control agents, only one has been previously considered. A stem and leaf blighting pathogen, Microsphearopsis amaranthi (Ell. and Berth.) Heiny and Mintz was evaluated for its potential to control tumble pigweed (A. albus L.). The importance and distribution of this species is relatively limited and the pathogen was not found to be efficacious on other pigweed species (Heiny et al., 1992; Mintz et al., 1992). In a review by BUrki et. al. (1997), a number of insects with potential are






19


reported. Vogt and Cordo (see Biirki et. al. [1997)) have studied several species, including Disonycha glabrata Fabricius (Coleoptera: Chrysomelidae), the pigweed flea beetle, which has been released in several states in the United States (Biirki et. al.,1997). This species is being further considered as a biological control agent for Amaranthus retroflexus. Other species that have been released or are being considered for further development include Epicauta leopardina Haag (Coleoptera: Meloidae), Melanagromyza amaranthi Spenc. and Havr. (Diptera: Agromyzidae), and Hypolixus truncatulus Fabricius (Coleoptera: Curculionidae).

Research Rational

The importance of the species belonging to the genus Amaranthus spp. as competitive weeds in many agricultural and pasture situations, coupled with their worldwide distribution, has made pigweeds and amaranths serious targets in weed management programs across the globe. These weeds have excellent reproductive potential and present a major concern as more species and populations are discovered to be resistant to the most efficacious chemical herbicides. A potential alternative control method, that could be combined with existing methods, would be the use of a fungal plant pathogen in an integrated approach.














CHAPTER II
CHARACTERIZATION OF PHOMOPSIS AMARANTHICOLA sp. nov.

Introduction

In 1992, a pycnidial fungus isolated from diseased amaranth plants, was found to be the causal agent of the observed stem and leaf blight. Greenhouse inoculations revealed that the disease caused by this organism began as leaf lesions, which expanded, coalesced, and moved to the leaf petiole, causing premature leaf abscission. These symptoms were observed within 5 days of inoculation (Figure 2-la). Symptoms then appeared on stems, with lesions girdling the stem, causing stem constriction and toppling of plants (Figure 2-1b). The severity of the symptoms observed in the field and then reproduced in subsequent inoculations warranted further investigation of the fungus as a potential biological control agent for pigweeds and Amaranthus spp.

An examination of the literature revealed several pycnidial fungi that have been reported as infecting various species ofAmaranthus L. Phoma amaranthi Brun. was first reported from "Amaranthi albi"' (Saccardo, 1884). This fungus has since been reported from Amaranthus chlorostachys Willd. in New Jersey. Phoma amaranthicola Brun. was originally reported from "Amaranthi spinosi" and since has been reported from Amaranthus graecizans L. auctt., non L. from Oregon (unpublished USDA compilation of herbarium specimens provided by Dr. A. Rossman, Beltsville, MD). An unidentified species of Phoma Sacc. also has been reported as causing stem necrosis of an Amaranthus sp. in Florida (Alfieri et al., 1984).



20






21











































Figure 2-1a-b. Leaf lesions and stem lesions on Amaranthus hybridus L. resulting from inoculation with Phomopsis amaranthicola.






22


The description of the genus Phoma Sacc., as documented in Sutton (1980), is

as follows:

Mycelium immersed, branched, septate, hyaline or pale brown. Conidiomata
pycnidial, immersed, or semi-immersed, sometimes becoming erumpent,
unilocular, brown, globose, separate or aggregated, occasionally confluent,
thin-walled (in P. lingam becoming thick-walled and
pseudosclerenchymatous); walls of thin-walled, pale to medium brown textura angularis. Ostioles single or several to each pycnidium, central, not papillate.
Conidiophores only present in P. cava and P. tracheophila and then either filiform, septate, and branched, or short, irregularly branched, and ramified
respectively. Conidiogenous cells enteroblastic, phialidic, integrated or
discreet, ampulliform to doliform, hyaline, smooth, collarette and aperture
minute, periclinal wall markedly thickened. Conidia hyaline, aseptate or occasionally 1 septate, thin-walled, often guttulate, ellipsoid, cylindrical,
fusiform, pyriform or globose.

The description of Phoma amaranthi Brun., as documented in Saccardo's

Sylloge Fungorum (1895), reads as follows:

Phoma amaranthi Brun. Champ. Charente Infer. 1892, p. 34. Peritheciis
sparsis v. confertis, minutis, globuloso-depressis, nigris, erumpentibus,
basidiis nullis; sporulis oblongis, utrinque rotundatis, hyalinis, 2-guttulatis, 78 x 3. Hab. as truncos emortuos Amaranthi albi, Charente Inf., Galliae.

The description of Phoma amaranthicola Brun., as documented in Saccardo's

Sylloge Fungorum (1895), reads as follows:

Phoma amaranthicola Brun. Champ. Charente Infer. 1892, p. 34.
Peritheciis confertis, minutis, brunneo-nigris, globosis, parum depressis, perforatis, obtectis dein erumpentibus, sporulis oblongis, griseo-hyalinis,
minutis, 2-3 x 1.5-2. Hab. as truncos emortuos Amaranthi spinosi, Charente
Inf., Galliae.

In addition to the pycnidial fungi, a single report of a species of Diaporthi

infecting Amaranthus comes from Argentina. Diaporthe amaranti, described by

Spegazzini as a new species, was isolated from Amaranti chlorostachydis

(Spegazzini, 1909). There is no mention of an anamorphic stage in this report and

this organism does not appear again in the literature.






23


The description of Diaporthe amaranthi Speg., as a new species is as follows:

Diag. Euporthe, parva, matrice nigrificata hinc inde gregaria subseriata, vix ostiolato-producta, ascis sporisque minoribus. Hab. Ad caules putrescentes
Amaranthi chlorostachydis in arvis Villa Casilda, Jul. 1905. Obs. Matrix
hinc inde extus late sordideque infuscata, intus subdealbata linea nigra angusta
sinuosa percursa; perithecia in maculis gregaria relaxata v. conferta, matrici
infossa, globulosa (120-150pm), tenui membranacea olivacea, sursum
prominula atque ostiolo carbonaceo saepius breviusculo armata; asci fusoidei,
a strato proligero mox secedentes (45-50p x 8p), aparaphysati octospori;
sporae distichae ellipticae medio 1 -septato-constrictae, loculis subaequalibus
hyalinis grosse biguttulatis (10-12p x 4p).

A single species of Phomopsis (Sacc.) Bubik has been reported as infecting

amaranth. This species, P. amaranthi Ubriszy and Vir6s was reported from Hungary

from Amaranthus retroflexus L.

The description of Phomopsis amaranthi n. sp. by Ubriszy and V6r6s (1966),

follows:

Pycnidia sparsa vel seriata, depresso-ellipsoidea, immersa dein papilla nigra emergentia, contextu dilute brunneo circa porum obscuriore, 300-600 x 200300 micra. Conidia 1. ovali-fusoidea, hyalina, biguttulata, attenuata, 6.7-9 x
2.7-3.6 micr., 2. filiformes, curvata 18-27 x 0.5-1.5 micr. magna.
Conidiophora 18-20 x 0.5-0.8 micr.-Hab. in stipitibus emortuis Amaranthi
retroflexi.

Based on preliminary observations, the Florida isolate from Amaranthus sp.

was tentatively identified as a member of the genus Phomopsis. The description of

the genus Phomopsis, as documented in Sutton (1980) is as follows:

Mycelium immersed, branched, septate, hyaline to pale brown. Conidiomata
eustromatic, immersed, brown to dark brown, separate or aggregated and confluent, globose, ampulliform or applanate, unilocular, multilocular or
convoluted, thick-walled; walls of brown, thin- or thick-walled texturis
angularis, often somewhat darker in the upper region, lined by a layer of smaller-celled tissue. Ostiole single, or several in complex conidiomata,
circular, often papillate. Conidiophores branched and septate at the base and
above, occasionally short and only 1-2 septate, more frequently multiseptate
and filiform, hyaline, formed from the inner cells of the locular walls.
Conidiogenous cells enteroblastic, phialidic, determinate, integrated, rarely






24


discrete, hyaline, cylindrical, aperatures apical on long or short lateral and
main branches of the conidiophores, collarette, channel and periclinal
thickening minute. Conidia of two basic types, but in some species with
intermediates between the two: a condia hyaline, fusiform, straight, usually
biguttulate (one guttule at each end) but sometimes with more guttules,
aseptate; p conidia hyaline, filiform, straight or more often hamate, eguttulate,
aseptate.

The form-genus Phomopsis belongs in the form-family Sphaeropsidaceae,

which is included in the form-order Sphaeropsidales in the form-class Coelomycetes (Sutton, 1980). Uecker reports the name Phomopsis was used by Saccardo in 1881 as an infrageneric label of unspecified rank, using it as Phoma (Phomopsis) versoniana. In 1883, the name was used, again by Saccardo, to indicate a generic name, Phomopsis cucurbita (Uecker, 1988). Phomopsis was then proposed as the name of a subgroup of Phoma species that produced beta conidia and were known to have a Diaporthe teleomorphic stage (Saccardo, 1884). However, no species were included in this division, and therefore, it was not considered to be a valid name. According to Uecker, Hohnel in 1903, named the genus Myxolibertella, into which he placed three species. This became the first legitimate generic name for what is now called Phomopsis. Saccardo placed several other species into the genus Phomopsis and in 1905 transferred the three species listed by Hohnel as Myxolibertella into the genus Phomopsis (Uecker, 1988). It was not until 1981 that Reidl et al. proposed conservation of the name Phomopsis, which was accepted by the International Botanical Congress in 1987. Phomopsis lactucae (Sacc.) Bubak was designated the lectotype (Riedl and Wechtl, 1981), but there is still controversy concerning the acceptance of this species as the lectotype (Sutton, 1980).






25


A number of Phomopsis species and the associated Diaporthe Nitschke.

teleomorphs are known to cause a variety of diseases (Balducchi and McGee, 1987; Farr et al., 1989; Killebrew, 1993; Uecker, 1988; Uecker and Johnson, 1991; Uecker and Kuo, 1992; Yesodharan and Sharma; 1987). Species are also known to be saprophytic, endophytic, or weakly pathogenic. Those that are considered to be plant pathogens are thought to be host specific, and this has been used as a character for speciation. One example of an endophytic species is Phomopsis oblonga (Desmaz.) Traverso, which has been found as a natural inhabitant of healthy elm trees in England. It has been shown that this fungus serves to limit the breeding of the Ceratocystis ulmi-carrying bark beetle and may be responsible, in part, for slowing the spread of Dutch elm disease in some areas (Webber and Gibbs, 1981). Many species of Phomopsis have been important to forest pathology as well (Grove 1935, 1937; Hahn, 1930). Symptoms produced in diseases caused by Phomopsis spp. include canker, seed decay, stem-end rot, root rot, fruit rot, wilt, leaf spots, and bark necrosis (Uecker, 1988).

Approximately 65 species of Phomopsis are considered to be plant pathogenic, of which approximately 30 are found in the United States. The identification of species in this genus, based primarily on morphological characteristics is hindered by character plasticity. Difficulty with identification is also compounded due to teleomorphic associations with Diaporthe spp. being known for only about 20% of the named species. Evidence that host association is inadequate for speciation in this genus was provided by Brayford in 1990, who showed that Phomopsis occurring on twigs and bark of Ulmus L. in the United Kingdom and other






26


parts of Europe belonged to different morphological and genetic groups. Both groups were isolated from a variety of tree species, showing that more than one species could be found on a single host and more than one host could support a single species.

Toxin production by members of the genus Phomopsis has been a topic for several research projects, and at least two secondary metabolites have been partially characterized (Culvenor et al., 1989; Li et al., 1992; Luduena et al., 1990). Phomopsis leptostromiformis (Kuhn) Bubik var. leptostromiformis Shivas, Allen, and Williamson and Phomopsis leptostromiformis (Kuhn) Bubik var. occidentalis Shivas, Allen, and Williamson produce secondary metabolites that have been shown to be responsible for lupinosus in livestock (Peterson et al., 1987; Toesing et al., 1984). No other species of Phomopsis have been reported as causing diseases in mammals.

Species of Phomopsis characteristically produce two types of conidia, referred to as c conidia and 0 conidia. A few species of Phomopsis are reported to have a third type of conidium. Three species reported to have the third type of conidium, called the C conidium, are P. hordei Punith., P. oryzae Punith., and P. phyllanthi Punith.; these species were isolated from Hordeum vulgare L., Oryzea sativa L., and Phyllanthus L. spp., respectively (Punithalingam, 1975).

With the exceptions of Phomopsis sojae Lehman (Jensen, 1983; Luttrell, 1947), P. phaseoli (Desmaz.) Sacc. (Kulik, 1988), and P. helianthus Munt.-Cvet., Mihal., and Petrov. (Muntanola-Cvetkovic et al., 1985), little work has been done toward determining the role that the spore types play in disease development. Beta conidia have been considered to be nongerminating (Muntanola-Cvetkovic et al., 1985), but in some species they are the only spore type observed (Muntanola-






27


Cvetkovic et al., 1985; Uecker, 1988). As is the case with other Phomopsis spp., the P-conidia production is influenced by the nutritional components of the medium. Study of Phomopsis helianthus revealed that P conidia were capable of germination, but the germination resulted in mycelial strands that did not survive to produce colonies (Muntanola-Cvetkovic et al., 1985).

Several species of Phomopsis have been considered as potential biological control agents (McPartland, 1983; Morin et al., 1990a,b; Shivas, 1991). Phomopsis convolvulus Ormeno has been evaluated for the control of field bindweed (Convolvulus arvensis L.) (Morin et al., 1990a,b; Ormeno et al., 1988) and Phomopsis emicis Shivas has been evaluated for control of Emex australis Steinheil (Shivas, 1991).

Phomopsis subordinaria (Desmaz.) Traverso, which has been evaluated for the control of plantain (Plantago lanceolata L.) has been examined by using isozyme characterization and randomly amplified polymorphic deoxyribonucleic acids (RAPD) (deNooij and van Damne, 1988; Meijer et al., 1994). Rehner and Uecker (1994) attempted to relate fungal species with host association through the amplification and sequencing of the internal transcribed spacer (ITS) regions of the ribosomal DNA. Their work resulted in three groups based on the ITS phylogeny. Group A consisted of two sub-clades. High similarity of one sub-clade, referred to as Al, if viewed as a single species, could be indicative of a broad host range, including plants belonging to the genera Paulownia Siebold and Zucc., Epigaea L., Kalmia L., Cornus L., Tsuga Carriere, Lindera Thunb., Vaccinium L., and Picea Dietr., to name a few. Members of the second sub-clade, A2, were all associated with cultivated






28

Vaccinium spp. Group B, with the exception of a single isolate, originated from southern temperate to tropical regions and produced elongate paraphyses in the conidiomata. Isolates in Group C were obtained from a wide range of herbaceous cultivated plants. Results of this study suggest that there is a great deal of variation within the genus that could be attributed to geographical distribution.

Comparison of the ITS sequence data within species complexes in other fungal groups reveal differing levels of intraspecific and interspecific divergence. Anderson and Stavoski (1992) found that among northern hemisphere Armillaria (Fr.) Staude spp., ITS 1 sequences were nearly identical; the species tested, however, could be differentiated on the basis of infertility tests, morphological characters, and other molecular criteria. Carbone and Kohn (1993) found similar results with species of Sclerotium Tode:Fr. Vilgalys and Sun (1994), and O'Donnell (1992) reported divergent ITS types for Pluerotus (Fr.) Kummer spp. and Fusarium sambucinum Fckl., respectively. In a recent study by Berthier et al. (1996), the ITS polymorphic restriction patterns of the DNA of the biological control agent Puccinia carduorum Jacky were found to be distinct for P. carduorum from Carduus acanthoides L. and C. thoermeri Weinmann when compared to those of the same fungal species isolated from C. tenuiflorus Curtis and C. pycnocephalus L. Harrington and Potter (1997) found that the phylogeny of the ITS region corroborated species delimitation based on the morphological characteristics of members of the genus Sarcoscypha. Choice of the ITS regions for species differentiation can lead to missing species matches due to the occurrence of species that exhibit significant intraspecific variation within these regions. Some authors support the use of the intergenic spacer regions or the 28s rRNA for species differentiation (Egger, 1992; Hillis and Dixon, 1991).






29


Materials and Methods

Isolate Identification and Morphological Characterization

Initial isolation and tentative identification of the isolate were performed by Dr. Yasser Shabana. Dr. Shabana performed the preliminary fulfillment of Koch's postulates. Isolates were stored on potato dextrose agar (PDA) slants and in soil tubes (Dhingra and Sinclair, 1995).

Single-spore isolates were recovered from slants and soil tubes by plating onto PDA. The details of the original isolation did not indicate the spatial or temporal relationships among the isolates. Several of the available specimens were initially grown out. Those that grew were separated into two groups, consisting of A, B, C, D, and E, and 1, 2, 3, 4, and 5, depending upon whether they had been grown from isolates marked as originating from alpha or beta conidia, respectively. While originally viable, isolates derived from 3 conidia grew erratically. Isolates 3-5, derived from P conidia, as well as a single subculture of the a-derived culture B, and isolates D and E, were lost in culture. These materials were tested for the presence of double-stranded RNA (Seroussi et al., 1989), but due to the difficulty in culturing the isolates, the results from this study were not conclusive. Isolate B, having consistent growth in all other subcultures, was used for morphological character determination, although all remaining isolates were grown on PDA and V-8 agar (Dhingra and Sinclair, 1995), which was composed of 200 ml of V-8 juice, 3 g of calcium carbonate, and 14 g of agar. This was done to determine whether all isolates produced the same types of conidia. Plates were initiated using a 5-mm3 mycelial plug taken from 10-day-old PDA cultures. Plates were then incubated at 250C+/- 20C






30


with a 12-h light cycle. Spores were harvested from plates using 10 ml of sterile deionized water per plate and gentle scraping with a rubber policeman. Isolate B was used for the remaining work. A hemacytometer was used to make the counts of conidia. Data taken included proportions of each type of conidium and measurements of conidia. Conidial germination was evaluated by placing a thin coating of PDA onto a sterilized glass slide. A droplet of a conidial suspension, obtained from plates in the same manner as above, was placed onto the PDA and a sterilized cover slip was placed on top. The slides were allowed to incubate for 20-24 h on the bench top and the proportions of germinating conidia were pooled with the spore germination data obtained directly from the suspensions.

A conidial suspension containing all three types of conidia was also plated into

water agar (Fisher Scientific, Fairlawn, N J) to attempt to regenerate colonies from single conidium isolations.

The dimensions of pycnidia were measured at the first sign of sporulation.

Measurements were also made of conidia and pycnidia taken from inoculated A. hybridus L. tissue that was allowed to senesce and dry slightly to induce pycnidial formation, as had been observed in the field. Stem pieces with pycnidia were placed in moist chambers to induce sporulation. In an attempt to induce a perithecial state, infected tissue samples were allowed to dry and were stored in sand or soil, at both 41C and at 300C, in the absence of light. The available isolates were also paired on PDA and V-8 agar plates.

The physical dimensions of conidia were measured using cultures of the Florida amaranth isolate B grown on PDA and from diseased plant tissue. Samples were obtained from 1- to 2- week-old colonies from plates that were incubated at 250C +/-20C.






31


Four samples of conidial droplets from each of five replicate cultures were used. Droplets were mounted on glass slides in a drop of water and conidia were measured in two randomly chosen fields until measurements of 100 of each type of conidium were taken. C conidia were sparse and all of the C conidia that could be found in each field were measured.

Isolates were grown on artificial growth media, including PDA, V-8 agar, corn

meal agar (CMA), oatmeal agar (OMA), corn infusion agar (CIA), and amaranth-infusion agar (AIA) for comparison of growth characteristics. The PDA, CMA, and OMA were obtained from Difco Laboratories (Detroit, MI). Amaranth infusion agar and corn infusion agar were prepared by boiling approximately 50 g of amaranth leaves and stems or corn kernels in 500 ml of deionized water for 30 minutes. Two hundred milliliters of the strained extract were added to 800 ml of deionized water containing 14 g of Fisher Scientific agar. Media were sterilized by autoclaving. The following isolates, obtained from symptomatic tissues of accessions of Amaranthus spp. were compared for growth of mycelium and spore production: 75A, 72A, and 72B provided by Dr. Charles Block of the North Central Regional Plant Introduction Station, Ames, Iowa; BG from Belle Glade, Florida; FP1 and FP3 from Fort Pierce, Florida; AI from Immokalee, Florida; and BRZ from Jaboticabal, Sao Paulo, Brazil. Each isolate was transferred onto six petri plates of each growth medium. Plates were inoculated using a 5-mm3 mycelial plug from cultures grown on PDA. Days required for pycnidial formation and spore types produced were noted.

Specimens were prepared for microscopic examination by placing pycnidia on a glass slide to which either 3% KOH solution or a deionized water droplet was added. The specimens treated with KOH were allowed to remain in the solution for






32


approximately 3minutes and then the pycnidium was chrushed with the eraser end of a pencil. The KOH was then wicked off with a towelette and replaced with lactophenol.

Separation of spore types was performed using filtration through 10-micron

and 1-micron mesh filters. Suspensions of conidia were prepared by flooding 14-dayold V-8 agar plates that had been prepared as above. The surface of the plates were gently scraped to remove spores. The suspension was then filtered through the mesh. Spores were separated by glycerol gradient centrifugation with gradients of 50%, 30%, and 10%; and 40%, 30%, 20%, and 10%. Each glycerol solution was layered into a 15-ml centrifuge tube at a volume of 3 ml. Tubes were centrifuged at 5,000 g for 5 minutes and then punctured at each visible layer, starting from the top most layer. Three samples, of approximately 100 ld each, were removed from each layer using a Pasteur pipette.

Specimens were prepared for scanning electron microscopy by the method of Nation (1983 a, b), using hexamethyldisilazane as the drying agent. Specimens were examined with a Hitachi S4000 scanning electron microscope at the University of Florida Interdisciplinary Center for Biotechnology Research Electron Microscopy Laboratory.

Host Range Testing

Host range testing of Phomopsis amaranthicola was performed using the

centrifugal phylogenetic scheme (Wapshere, 1974) with Amaranthus hybridus as the focal plant. The first phase of testing included 33 biotypes belonging to 22 known species and two unknown species of Amaranthus obtained from the North Central






33


Table 2-1. Effect of Phomopsis amaranthicola on Amaranthus L. spp.

Species Origin Percent Incidence Percent Mortality
A. acutilobus Germany 100 100 A. albus Germany 100 50 A. australis USA-FL 31 0 A. australis USA-FL 39 0 A. blitoides Germany 100 0 A. caudatus Argentina 100 28 A. caudatus USA 94 28 A. crassipes Czechoslovakia 100 56 A. cruentus Mexico 84 0 A. cruentus USA-AR 100 50 A. cruentus USA-ME 100 5 A. cruentus Mexico 84 17 A. delflexus Germany 100 67 A. dubius Ghana 67 0 A. dubius Jamaica 100 6 A. floridanus USA-FL 23 0 A. graecizans USA-IA 100 50 A. hybridus Argentina 100 18 A. hybridus Ecuador 89 50 A. hybridus USA-PA 100 26 A. hybridus Zimbabwe 78 8 A. hybridus USA-IN 100 56 A. hybridus USA-AR 100 56 'Results were recorded five weeks after inoculation. Data are the average of three replicates combined from each of two trials.






34


Table 2-1 continued.
Species Origin Percent Incidence Percent Mortality
A. lividus Hong Kong 100 100 A. lividus India 100 86 A. palmeri USA-AR 100 0 A. palmeri USA-IA 100 39 A. palmeri Senegal 95 28 A. powelli Germany 100 84 A. powelli USSR 100 100 A. quintensis Ecuador 100 50 A. retroflexus India 100 56 A. retroflexus USA-CA 100 100 A. retroflexus USA-IA 100 42 A. retroflexus USA-IL 100 89 A. retroflexus USA-PA 100 67 A. retroflexus USA-WA 100 100 A. rudis USA-IA 84 50 A. spinosus Indonesia 100 44 A. spinosus Zimbabwe 100 0 A. tricolor India 78 50 A. tricolor USA 56 28 A. tricolor USA 100 67 A. viridus Indonesia 100 84 A. viridus Unknown 100 92 'Results were recorded five weeks after inoculation. Data are the average of three replicates combined from each of two trials.






35


Regional Plant Introduction Station in Ames, Iowa (Table 2-1). Plants were grown from seed and then were transplanted to clay pots with three plants per pot. Each accession was planted to six pots and three were used as controls and three pots of each accession were inoculated with conidia of P. amaranthicola. Conidial suspensions contained 1 million conidia per ml amended with psyllium mucilloid at 0.5% (m:v). Suspensions were spray-inoculated onto plants using a hand-held pump sprayer. Control plants were sprayed with a suspension containing psyllium mucilloid (Metamucil, Proctor and Gamble, Cincinnati, OH) alone.

Inoculated and control plants were then placed in a dark dew chamber for 24 h at 280C +/- 20C. After the dew period, plants were placed in the greenhouse and observed for symptom development and mortality for 5 weeks.

The second phase of testing involved the inoculation of additional weed, crop, and ornamental species chosen on the basis of a close relationship to the genus Amaranthus, the report of an association of the plant with another species of Phomopsis or Diaporthe, or a crop in which Amaranthus spp. are a problem and therefore may be a crop in which P. amaranthicola might be utilized. Plants in this phase of testing were treated in the same way as in the previous phase. In addition, tissue was taken from each of the treated plants and plated onto PDA to determine if there could be a quiescent infection. Tissues were surface sterilized using 10% sodium hypochlorite. A listing of the species tested and their reactions are listed in Table 2-2. Amaranthus hybridus plants were included in each phase of the testing to ensure the viability and infectivity of P. amaranthicola in suspensions used for inoculation.






36


Table 2-2. Plant reactions in the host range test of Phomopsis amaranthicolay.

Family
Genus species Reactionz Apiaceae
Daucus carrota (L.) subsp. sativus Hoffm. I Amaranthaceae
Alternanthera philoxeroides (L.) R. Brown I Celosia argentea L. I Celosia argentea L. var. cristata (L.) Kuntze I Iresine rhizomatosa Standley I Froelichia gracilis (Hooker) Moq. I Gomphrena globosa L. I
Apocynaceae
Vinca minor L. I Asteraceae
Helianthus giganteus L. I Lactuca sativa L. I Lactuca sativa L. var. longifolia Lam. I Achillea millefolium L. I Achillea ptarmica L. I Brassicaceae
Brassicajuncae (L.) Czern. I Cactaceae
Opuntia compressa (Salisbury) Macbride I Campanulaceae
Lobelia inflata L.
Caryophyllaceae
Stellaria media (L.) Cyrillo I Lychnis alba Miller I
Saponaria officinalis L.
Silene stellata (L.) Aiton F. I Dianthus armeria L. I Dianthus barbatus L. I Chenopodiaceae
Chenopodium album L. I Atriplexpatula L. I Beta vulgaris L. I Spinacia oleracea L. I Kochia scoparia Roth I
YReactions were recorded from three replicates of each inoculated plant species. Two trials were performed using a number of available varieties. zI represents an immune reaction.






37


Table 2-2 continued.
Family
Genus species Reaction Cucurbitaceae
Cucurbita pepo L. I Cucurbita maxima Duchesne I Cucurbita moschata (Duchesne) Duchesne ex. Por. I Cucumis melo L. var. cantalupensis Naudin I Cucumis sativus L. I Citrullus lanatus (Thunb.) Matsum. and Nakai I Fabaceae
Glycine max (L.) Merr. I Senna obtusifolia (L.) H. S. Irwin and Barneby I Pisum sativum L. I Pisum sativum L. var. macrocarpon Ser. I Phaseolus vulgaris L. I
Viciafaba L.
Lamiaceae
Salviafarinacea Benth. I Salvia officinalis L. I Salvia splendens Sellow ex Roem. and Schult. I Plectranthus L'Her. sp. I Liliaceae
Allium cepa L. I Malvaceae
Abelmoschus esculentus (L.) Moench I Poaceae
Pennisetum glaucum (L.) R. Brown I Triticum aestivum L. I Sorghum bicolor (L.) Moench I Zea mays L. I Solanaceae
Lycopersicon esculentum Mill. I Capsicum annum L. I Capsicum frutescens L. I Nicotiana tabacum L. I Solanum melongena L. I Verbenaceae
Verbena brasiliensis Vellozo I Verbena hastata L. I
YReactions were recorded from three replicates of each inoculated plant species. Two trials were performed using a number of available varieties. zI represents an immune reaction.






38


DNA Extraction. Amplification, and Sequence Analysis

The following isolates were grown in liquid potato-dextrose broth shake cultures: B (ATCC# 74226) from Gainesville, FL; FP1 and FP3 from Fort Pierce, Florida; 75A from Ames, Iowa; MA, Microsphaeropsis amaranthi (Ell. and Barth.) Heiny and Mintz provided by G. A. Weidemann, University of Arkansas, Fayetteville, AR; Pho, Phoma medicaginis Malbr. and Roum. (ATCC# 52798); and PO, Phomopsis oryzae (IMI# 158929). Specimens of P. hordei (IMI 128344 Ex Type) and P. phyllanthi (IMI 95131 Ex Type) were available only as preserved herbarium specimens and were not included in the molecular characterization. These isolates were to be amplified by the method described in Taylor and Swann (1995), but the specimens did not have adequate material for DNA extraction.

Two hundred fifty-milliliter flasks containing 50 ml of PDB were inoculated with three, 5-mm3 mycelial plugs from 10-day-old PDA cultures of each of the isolates derived from single-spore cultures stored at 90C. After 7-10 days of growth in shake culture, the contents of the flasks were filtered through sterile cheesecloth, squeezed dry, and rinsed three times with sterile deionized water. Mycelium was then placed into 13-ml plastic tubes, stored for 24 h in a -800C freezer, and lyophilized for 24-48 h. The dry mycelium was then mixed with liquid nitrogen, ground to a fine powder, and combined with DNA extraction buffer consisting of a 1:1:0.4 volume of Nuclei Lysis Buffer (0.3 M Sorbitol, 0.1 M Tris, and 20 mM EDTA, at pH 7.5), DNA isolation buffer (0.2 M Tris at pH 7.5, 50 mM EDTA, and 0.2 mM hexadecyltrimethylammonium bromide [CTAB]) and 0.5% Sarkosyl (Koenig, 1997).






39


Ten milliliters of the extraction buffer were combined with approximately 1 g of ground mycelium in 15-ml tubes, and the tubes were placed in a 650C water bath for 60 minutes. The contents of the tubes were then mixed by inversion, and 1 ml of solution was transferred to a sterile, 1.5-ml microcentrifuge tube. Five hundred microliters of chloroform:octanol (24:1) solution were added to each tube. The solution was mixed thoroughly by inversion. The solution was then centrifuged for 10 minutes at 12,000g in a microcentrifuge at room temperature. The supernatant was transferred to sterile 1.5-ml tubes and treated with 5 p1l of a suspension containing 20 mg RNAse (Sigma Chemical Company, St.Louis, MO) per ml for 30 minutes at 370C. Following the RNAse treatment, 5 p1 of a suspension of 20 mg Proteinase K (Sigma Chemical Company, St. Louis, MO) per ml were added and allowed to remain in solution for 20 minutes at 370C. One volume of ice-cold isopropanol was then added, and the tubes were shaken until the DNA was visible as a white precipitate. After 60 minutes in a -200C freezer for 60 minutes, the tubes were centrifuged at 10,000 g for 5 minutes and the DNA pellet was washed with 100 p1l of 70% ethanol three times. Due to the viscosity of the DNA pellet obtained, the crude pellet was dissolved in TE buffer containing 2M NaCI and reprecipitated in two volumes of ethanol. The DNA was then pelleted and the tubes were allowed to dry. The pellet was then resuspended in 100 pl of TE buffer (10 mM Tris, 1 mM EDTA). Samples were then placed at 40C until the DNA was dissolved. The methods described here are a modified version of the DNA extraction method used by Koenig (1997).

The concentration of DNA in the samples was estimated by running 3 pl1 of each sample on an agarose gel containing 1 ptl of ethidium bromide per ml of gel along with a






40


bacteriophage Lambda DNA concentration standard (Gibco-BRL, Gaithersburg, MD), and making visual comparisons based on the relative fluorescence of the samples compared to the standards using UV light.

Approximately 100 ng of template DNA per 100 1d reaction mixture were used in symmetric PCRs. The internal transcribed spacer regions (ITS) of the nuclear ribosomal repeat were analyzed using primers ITS4 and ITS5 (White et al., 1990; Bruns et al., 1991); the sequences are listed in Table 2-3. These primers take advantage of the conserved regions of the 18s and 28s nuclear rRNA genes to amplify the noncoding regions between them. The primers were synthesized at the University of Florida Interdisciplinary Center for Biotechnology Research Oligonucleotide Synthesis Laboratory (Gainesville, FL). Polymerase chain reactions were performed using final concentrations of the components in the reaction mixture as follows: 20 mM Tris-HCI (pH 8.4); 50 mM KCl; 1.5 mM MgCI2; 1 [tM of each primer; 200 jtM each of dATP, dCTP, dGTP, and dTTP; and 2.5 U of Taq polymerase (Gibco-BRL, Gaithersburg, MD) per 100 tl of reaction mixture. A GenAmp 6000 (Perkin-Elmer Applied Biosystems, Foster City, CA) was used for the amplification. The cycling conditions used included an initial denaturation step of 2 minutes at 94C, with 32 cycles of 940C for 45 seconds, 550C for 30 seconds, and 720C for 45 seconds each. The last cycle included a 10-minute incubation at 720C and then storage at 40C. Unincorporated nucleotides and primers were separated from double stranded PCR products using Wizard PCR Preps (Promega Inc., Madison, WI) according to the manufacturers instructions. Sequences, provided by the University of Florida Interdisciplinary Center for Biotechnology Research DNA Sequencing Laboratory, were aligned manually. Phylogenetic analyses were performed using PAUP version 3.1.1 (Swofford, 1993). The positions in the alignment were used as






41


uniformly weighted characters; single gaps were treated as missing characters; and regions that could not be aligned or regions with large, continuous gaps were excluded from the analysis (Appendix A). The analysis was based on informative characters only. Microsphaeropsis amaranthi was used as the outgroup. The first analysis included 24 sequences, 13 chosen from those deposited in GenBank by Rehner and Uecker (1994), and three deposited by Udin (1996), which were chosen based on a wide range of host associations. The first analysis was performed using 1000 replicate heuristic searches with random sequence addition. Support for groupings was determined by bootstrapping of 500 replicate data sets, unless noted, using random input of sequences and by the decay indices using Treerot (Sorenson, 1996).

Results

Isolate Identification and Morphological Characterization

Symptoms produced on Amaranthus hybridus that were spray-inoculated with

conidial suspensions of Phomopsis amaranthicola consisted of round to elliptical lesions with either tan or light brown centers with red-brown rings. Coalescing and large lesions developing on leaf petioles and stems caused a stem and leaf blight, which led to premature defoliation and girdling of stems, and plant mortality.

Growth on PDA and all other media was initiated with white mycelium growing in a circular pattern. Pycnidia were produced within 7 days after culture initiation, beginning closest to the point of inoculation and formed in concentric rings approximately 5 mm apart (Figure 2-2). Pycnidia produced on all types of media, as well as those produced on plant material, were ostiolate (Figures 2-3 and 2-4). Conidiophores lined the walls within the pycnidium and were closely packed (Figures 2-5 and 2-6). Alpha, 3, and C conidia were produced within the same pycnidium when all spore types






42

Table 2-3. Sequences for the internal transcribed spacer region primers.

ITS Primer" Sequencez

4 TCCTCCCGCTTATTGATATGC
5 GGAAGTAAAAGTCGTAACAAGG

xSequences are written 5'-3'.
'Primers were synthesized at the University of Florida Interdisciplinary Center for Biotechnology Research, Oligonucleotide Synthesis Laboratory, Univ. of Florida, Gainesville.
ZSequences based on White et al. (1990).






43









































Figure 2-2. Characteristic growth of Phomopsis amaranthicola on potato dextrose agar. Note white mycelium with dark pycnidia produced in concentric rings around the point of inoculation.






44








































Figure 2-3. Pycnidia of Phomopsis amaranthicola produced on a stem section of an inoculated Amaranthus hybridus L. plant. Stem sections were placed on wetted Whatman #3 filter paper and placed in a moist chamber until sporulation.






45























g~i%








Figure~ 2-4 Sporulatmg_~" pyrii' ofhmpi aaaliol sosre sqas mon a OX







46




















Api,



At


r *or
r,\ lii-PSI,
14,47




Su*






Fiue25.Eetonmcoraho pciim fPoopi mratioa
Photoraph courts ofS. Candraohan







47















































Figure 2-6. Electron micrograph of an a conidium of Phomopsis amaranthicola.






48








































Figure 2-7. (a). Germinating conidium of Phomopsis amaranthicola as observed by light microscopy (1000X). Note guttules within the conidium. (b). f conidium. (c). C conidia of Phomopsis amaranthicola.






49










































Figure 2-8. (a). Cross-section of a pycnidium ofPhomopsis amaranthicola showing lining of the cavity with conidiophores (10OX). (b). Conidiophores with a conidia (400X). (c). Conidiophore with at conidium (I000X).






50


were present (Figure 2-7). In pycnidia containing all three types of conidia, an average of 87% of all conidia produced were a conidia. Beta conidia contributed 10% and C conidia an average of 3% to the total conidial counts. Conidia were produced on hyaline, phialidic conidiophores, which were occasionally branched (Figure 2-8). The conidiogenous cells producing a conidia did so from multiple loci.

Attempts to separate the conidial types using glycerol gradient centrifugation and filtration were not successful in producing suspensions composed exclusively of a single conidial type. A suspension containing 86% P conidia was obtained through double filtration through a series of 1-ptm mesh filters. This suspension was used to inoculate three pots ofAmaranthus hybridus plants. Few leaf lesions appeared on these plants.

Suspensions containing mixtures of the conidial types were plated on water agar in order to obtain single conidial isolates and examine the germination of conidia. Germination of conidia on PDA-covered glass slides produced the following results. No C conidia were observed to germinate, although they did exhibit incipient morphological changes associated with germination, including irregular swellings. After more than 20 h, less than 30% of P conidia showed morphological changes and production of thread-like mycelium. This mycelial growth, like that observed for P. helianthe (Muntanola-Cvetkovic et al., 1985), disintegrated and did not produce colonies. Alpha conidia were found to germinate approximately 87% of the time using this method.

Measurements of conidia and conidiomata obtained for the Florida amaranth isolate from PDA are listed in Table 2-4 with the comparative measures reported for






51


Phomopsis amaranthi from amaranth in Hungary. Although the ranges are slightly overlapping, the average size of a conidia of the Florida isolate are larger than the range reported for P. amaranthi. In addition to the size differences in both a conidia and P conidia of both isolates, there is the marked absence of the third type of conidium from the description of the Hungarian isolate.

Greater numbers of both a conidia and P conidia were produced on V-8 agar than on PDA. The numbers of a conidia produced on V-8 and PDA were 3.5 x 108 conidia per ml and 1.6 x 108 conidia per ml respectively. The numbers of P conidia produced were 9.7 x 107 conidia per ml and 2.5 x 107 conidia per ml on V-8 agar and PDA, respectively. The numbers of C conidia produced were negligible and not taken into account. Sporulation occurred more quickly on V-8 agar, with plates beginning to yield conidia within 6 days versus between 9 and 10 days on PDA.

Pairing of isolates on PDA and V-8 juice agar did not result in the production of a sexual stage, nor did there appear to be any zonation. Instead, all of the paired isolates grew in an intermingled fashion. Infected stem pieces stored in soil and sand and exposed to temperatures of 40C and 300C did not produce perithecia. Removal of these tissues and subsequent plating resulted in regrowth of P. amaranthicola from all pieces.

The growth characteristics of the isolates obtained from amaranth grown on a variety of media as observed in cultures grown on V-8, pea agar (PA), potato dextrose agar, potato dextrose broth (PDB), corn meal agar (CMA), oatmeal agar (OA), and amaranth infusion agar (AIA) were observed for two isolates, A and B, from the Gainesville collection, one isolate obtained from amaranth in Belle Glade (BG), two







52







C



0 Z -Go
0
a E






rAi
o e :0
-




:0 0 :o - 4

. .I
00
>~ EE







0 Za
0I ICT~ p




Ocu 00 m. oU *~ ..5 0

.r.




0 0 00~- a 0 4-0 )

e 5





U .9 o oo a .0

~r- 00 0 0.' 0
0, c0 ce C \c- o EU C > 00 r o 0 o1o o


0U
)o)oo eo
0 >



0~0
C o



o 0) C o5 a .o .0





o zo



00
cir S








02)
aob at5 ,'








: Z3e >o0






53


isolates obtained from Fort Pierce (FP1 and FP3), three isolates from Ames, Iowa (75A, 72A, and 72B), and a single isolate from Brazil (BRZ), as well as an isolate of Phomopsis oryzae (IMI# 158929) (Figure 2-9). All isolates produced profuse mycelium, but the isolate of Phomopsis oryzae, as well as the isolates obtained from Ames were most abundant in aerial growth and extremely floccose.

The Gainesville isolate grew more slowly than any of the other isolates on all of the media tested. All of the isolates grew most slowly on OA (Figure 2-9). The isolate of P. oryzae and the Gainesville isolates A and B were the only isolates that produced a conidia, 0 conidia, and C conidia. Isolate BRZ produced a conidia and 3 conidia. Gainesville isolates A and B produced only a conidia on OA. The presence of all three types of conidia in pycnidia produced on plant tissue was erratic. The remaining isolates, BG, FP1, FP3, 72A, 72B, and 75A, produced only a conidia on all of the media tested. Only the Gainesville isolates produced pycnidia at regular intervals in concentric rings, rather than distributed throughout the plate (Figure 2-2). All isolates produced mycelium in potato dextrose broth, and produced pycnidia only at the liquid to air interface along the sides of the glass flasks. Host Range Testing

Results of the first phase of the host range study are listed in Table 2-1. All of the species of amaranth tested were susceptible to infection by P. amaranthicola. Incidence of infection ranged from 23-100%. Mortality of amaranth plants ranged from 0-100%. Species of Amaranthus in which no mortality occurred after inoculation with P. amaranthicola included A. acutilobus L., A. blitoides S. Wats, one Mexican accession ofA. cruentus L., A. dubius Mart. ex Thell., A. floridanus, one






55


accession of A. palmeri S. Wats. from Arkansas, and one accession of A. spinosus L. from Zimbabwe. Those species having a minimum of one accession with between 10 and 50% mortality included A. albus, A. caudatus L. (=A. edulis Speg. = A. mantegazzianus Pass.), A. cruentus, A. graecizans L., A. hybridus L., A. palmeri, A. quintensis H. B. K., A. retroflexus L., A. rudis Sauer, A. spinosus, and A. tricolor L. (=A. gangeticus L.). Species having a minimum of one accession suffering from 51100% mortality included A. crassipes Schlect, A. delflexus, A. hybridus, A. lividus L., A. powelli S. Wats., A. retroflexus, A. tricolor, and A. viridus L. The species with the greatest levels of mortality included accessions of A. acutilobus, A. lividus, A. powelli, A. retroflexus L., and A. viridus. Ten symptomatic plants were chosen for plating of diseased tissue to confirm the presence of P. amaranthicola. All tissue samples produced colonies of P. amaranthicola.

The second phase of testing included members of the families Apiaceae,

Amaranthaceae, Apocynaceae, Asteraceae, Brassicaceae, Cactaceae, Campanulaceae, Caryophyllaceae, Chenopodiaceae, Cucurbitaceae, Fabaceae, Lamiaceae, Liliaceae, Malvaceae, Poaceae, Solanaceae, and Verbanaceae. All plants were considered as immune to infection by P. amaranthicola (Table 2-2). No plants became symptomatic and tissue from each of three plants from each inoculated species plated on PDA produced no colonies of P. amaranthicola. DNA Amplification and Seauence Analysis

Primers ITS4 and ITS5 were used to provide the double-stranded

amplification product of the ITS region for sequencing. Comparisons were performed to determine the relationship of the Florida isolate B with other members of the genus






56

Phomopsis, as well as selected isolates of related genera. Length variations within the sequences of the ITS regions of the chosen isolates were observed. Sequences of isolates 452, 456, 468, 476, 484, 512, 522, 528, 537, 597, 624, 642, and 649, were obtained from GenBank (deposited by Rehner and Uecker). These isolates had ITS 1 sizes ranging from 165-184 bp, while those included in this study ranged from 140175 bp. Sequences of the ITS2 region of the isolates obtained from the GenBank ranged from 155-162 bp, while test isolates ranged from 144-157 bp in this region. The base compositions of the Phomopsis spp. that were included from the work by Rehner and Uecker (1994) ranged from 52-56% GC for ITS1 and 56-59% for ITS2. The sequences of the isolates sequenced for this study had base composition which ranged from 45-56% GC in ITS1 and 49-59% in ITS2. The isolates chosen from those deposited by Rehner and Uecker were chosen based on geographical distribution and a wide range of host associations (Table 2-5).

Initially, sequences from both ITS1 and ITS2 were aligned as a single data set. Alignment of these sequences resulted in a data matrix of 498 sites in 24 isolates. Alignment of both ITS 1 and ITS2 required the insertion of gaps to maximize sequence similarity. Because of ambiguities in alignment, short sequence segments were excluded from the analysis. Initial heuristic searches on 24 sequences found 53 equally parsimonious trees of length 251, with a consistency index (CI) of 0.946 and a retention index (RI) of 0.974 (Figure 2-10). Analysis was repeated by separating the two regions into character subsets. Heuristic searches based on the sequences of ITS 1 were performed with a character matrix of 298 sites in 24 isolates. This search






54













OMA












7B





Figure 2-9. Comparison of growth characteristics of a number of specimens collected from species of Amaranthus L. Isolates 72A, 72B, and 75A were collected at the North Central Regional Plant Introduction Station and were provided with a tentative identification as a Phomopsis (Sacc.) Bubik sp. by Charles Block. Isolate P202 was taken from diseased Amaranthus spinosus L. in Gainesville, and isolate 2B 11 represents a subculture of the Florida isolate B, which was deposited with ATCC. The isolates are shown here grown on Difco oatmeal agar.






57


Table 2-5. Isolate descriptions for cultures used for comparison of the internal transcribed spacer regions. All sequences for isolates with labels composed of a three digit number were obtained from GenBank and were deposited by S. Rehner and F. Uecker. Sequences for isolates gm2, GAP08, and GLB06 were also obtained from the GenBank. These isolates were deposited by W. Udin (1996).
Isolate Host Genus Geographical Conidial Types
Abbreviation Location
75' Amaranthus USA-Iowa Alpha BG Amaranthus USA-Florida Alpha FP1 Amaranthus USA-Florida Alpha FP3 Amaranthus USA-Florida Alpha
PHO" Glycine N/A MAv Amaranthus USA-Arkansas N/A
B Amaranthus USA-Florida Alpha, beta, and C conidia
POW Oryza Alpha, beta, and C conidia
624x Glycine USA-Florida Unknown
537x Kalmia USA-New Jersey Alpha and beta conidia 528x Magnifera Puerto Rico Alpha and beta conidia
522x Sassafras USA-New Jersey Unknown
512x Juniperus USA-New Jersey Alpha and beta conidia 476y Vaccinium USA-New Jersey Alpha and beta conidia 468Y Vaccinium USA-New Jersey Alpha and beta conidia
649x Convolvulus Canada Alpha 642x Glycine USA-Maryland Alpha
597x Solanum Dominican Republic Unknown
484y Capsicum USA-Maryland Alpha and beta conidia 456Y Stokesia USA-Mississippi Alpha and beta conidia 452Y Capsicum USA-Texas Alpha and beta conidia gm2z Prunus USA-Georgia Alpha and beta conidia GAP8z Prunus USA-Georgia Alpha and beta conidia GLB06z Prunus USA-Georgia Alpha and beta conidia
'Isolate provided by C. Block, North Central Regional Plant Introduction Station, Ames ,Iowa. "Phoma medicaginis, ATCC# 52798.
'Isolate ofMicrosphaeropsis amaranthi provided by G. Weidemann, University of Arkansas. Phomopsis oryzae, IMI# 158929.
x As reported in Uecker, 1988.
YAs obtained from the personal notebooks of F. Uecker, courtesy of R. Pardo-Schultheiss, U.S.D.A., Beltsville, MD.
zIsolate information from W. Udin, 1997.








58



75 BG 100 FPI dl FP3 PHO MA

B

PO

624 537 528 68 75 70 522 d23 dl dl 512

476

468 100 gm2 66
d6 GAP08 100 dl
GLBO6
d24
649 642 597

81 i484 dl 456 452





Figure 2-10. Phylogenetic relationships among strains of Phomopsis spp. from various hosts and isolates obtained from species of Amaranthus based on internal transcribed spacer region (ITS) sequences. Strict consensus of 53 equally parsimonious trees (tree length=251, consistency index=0.946, homoplasy index=0.054, retention index-0.974, rescaled retention index=0.921). Bootstrap replication frequencies greater than 50% are indicated above branches. Values below branches, preceded by a lowercase d represent decay indices values. Isolate information is listed in Table 2-5.







59



75
BG
75
FP1
dl
FP3

PHO

MA

B

PO
51 624 d2 537 60 528 100 dl 522

d16
68 512 dl 476
468
100 gm2 81 d5 GAP08 d3 GLBO6

649

642
60 77 484 dl 59 d2 456 dl 452 597




Figure 2-11. Phylogenetic relationships among strains of Phomopsis spp. from various hosts and isolates obtained from species of Amaranthus based on rDNA internal transcribed spacer region 1 (ITS 1) sequences. Strict consensus of 52 equally parsimonious trees (tree length=154, consistency index=0.799, homoplasy index=0.201, retention index-0.930, rescaled retention index=0.742). Bootstrap replication frequencies greater than 50% are indicated above branches. Values below branches, preceded by a lowercase d represent decay index values. Isolate information is listed in Table 2-5.







60



75
BG FP1 FP3 MA PHO
B
PO
649 642 624 597 537
80 528 100 522 dO
d5 512
476
484 468 456 452
92
d92 gm2 dl GAP08 GLBO6




Figure 2-12. Phylogenetic relationships among strains Phomopsis spp. from various hosts and isolates obtained from species of Amaranthus based on rDNA internal transcribed spacer region 2 (ITS2) sequences. Strict consensus of nine equally parsimonious trees (tree length=102, consistency index=0.709, homoplasy index=0.291, retention index-0.894, rescaled retention index=0.634). Bootstrap replication frequencies greater than 50% are indicated above branches. Values below branches, preceded by a lowercase d represent decay index values. Isolate number, source and some morphological characters are listed in Table 2-5.






61


found 52 equally parsimonious trees with a length of 154 steps, a CI of 0.799, and RI of 0.930 (Figure 2-11). Heuristic searches based on the sequences of the ITS2 region were performed using a data matrix of 245 sites in 24 isolates. This search resulted in nine equally parsimonious trees of 102 steps, CI of 0.709, and a RI of 0.894 (Figure 2-12).

A series of subsets were then analyzed to determine the effect of excluding certain groups of isolates from the analysis. The first subset included all of the isolates that were sequenced specifically for this study, as well as the three Phomopsis spp. from the GenBank that contained the 5.8s rDNA sequence information (isolates gm2, GAP08, and GLB06). The data matrix for this subset contained 709 sites in 11 taxa. Heuristic searches resulted in four most parsimonious trees of 124 steps, with a CI of 0.952 and a RI of 0.977 (Figure 2-13). The second subset included the isolate under study, Gainesville isolate B, and the Phomopsis isolates chosen from the data set of Rehner and Uecker, with Phoma medicaginis (ATCC# 52798) included as the outgroup. Heuristic searches resulted in nine most parsimonious trees, with 167 steps and a CI of

0.665, and a RI of 0.763. The strict consensus of these trees is presented in Figure 2-14. Branches without bootstrap values were not supported by the 50% majority-rule consensus tree.

Discussion

There have been more than 400 taxa described within the genus Phomopsis, and there has been no recent revision of the members of the genus. The general morphological characters of the Florida isolate indicate that it belongs in the genus Phomopsis. It shares the characteristic conidial types produced by other species of Phomopsis and produces these conidia in pycnidial conidiomata. The conidiophores were branched or straight and these are shared characteristics.







62





75


BG

59
FPI
dl

FP3


PHO


MA


B


100 PO
d31 92
d4 96 gm2 100 d4
d8 GAP08


GLBO6




Figure 2-13. Phylogenetic relationships among selected Phomopsis spp. from peach and rice and several isolates obtained from Amaranthus spp. based on rDNA internal transcribed spacer region sequences. Strict consensus of four most parsimonious trees (tree length=124, consistency index=0.952, homoplasy index=0.048, retention index=0.977, rescaled retention index=0.930). Bootstrap replication frequencies greater than 50% are indicated above branches. Values below branches, preceded by a lowercase d represent decay index values. Isolate information is listed in Table 2-5.






63


PHO
B

PO

71 624 dl 537 71
528
dl
53 522 85 d2 512 dl 90 476 dl 468

100 gm2 68 d6 GAP08 100
d2
d25 GLBO6 d25
649

642

91 484 dl 456 dl
452

597



Figure 2-14. Phylogenetic relationships among selected Phomopsis spp. from various hosts and several isolates obtained from Amaranthus spp. based on rDNA internal transcribed spacer region sequences. Strict consensus of four most parsimonious trees (tree length=124, consistency index=0.952, homoplasy index=0.048, retention index-0.977, rescaled retention index=0.930). Bootstrap replication frequencies greater than 50% are indicated above branches. Values below branches, preceded by a lowercase d represent decay index values. Isolate information is listed in Table 2-5.






64


Determination of speciation within the genus Phomopsis has been highly

dependent upon the host from which the isolate was described. More recent studies with several species have shown that the host ranges of many of the isolates that have been named as species are more broad than originally hypothesized, and it also has been found that a single host plant is capable of supporting more than one species. This somewhat complicates speciation in this genus. The lack of a true lectotype species for the genus Phomopsis (Sutton, 1980) further complicates speciation of fungi in the group.

Several characters of the Florida isolate, which I will name P. amaranthicola, are unique in comparison to many members of the genus. The presence of a third type of conidium is reported for only a few species. Multiple loci of conidiogenesis are reported for no other species in the genus.

Alpha conidia are apparently the infectious propagules of this isolate and were found to germinate efficiently and to be produced abundantly on several types of media. Alpha conidia and beta conidia are commonly produced for many species of Phomopsis and the alpha conidia have been found to be the most predominant type. The presence of the C conidium has been reported for only three other species (Punithalingam, 1975). The species Phomopsis amaranthi Ubriszy and V6r6s was not reported to have C conidia, nor was it reported that there were multiple loci of conidiogenesis for cc-conidium production.

While the host ranges of Phomopsis spp. have been found to be relatively

ambiguous characters for species definitions, P. amaranthicola was found to have a host range that is exclusively limited to the genus Amaranthus. No host range






65


information was published for P. amaranthi from Hungary. All of the Amaranthus spp. tested were susceptible to P. amaranthicola, although there was a great deal of variability in the incidence of infection, as well as in mortality. A high level of infection did not necessarily result in substantial mortality. There was also variability in relation to differences in susceptibility within species among biotypes or accessions.

Analysis of the sequence data from a variety of isolates from Amaranthus spp. and other species of Phomopsis showed considerable variation in both the ITS 1 and ITS2 regions. Alignment of all of the isolates was difficult and required the insertion of several gaps to achieve an optimal alignment (Appendix A). Consensus trees constructed for each grouping of isolates gave similar topologies. Nearly all nodes resolved in the strict consensus cladograms were present and received moderate to strong support by the bootstrap analyses. In all cases, the groupings resulted in Gainesville isolate B, P. amaranthicola, falling as the sister group to the major clade containing the Phomopsis spp. sequenced by Rehner and Uecker (1994). Isolates of Phomopsis spp. analyzed by Rehner and Uecker (1994) were grouped in this study similarly to their groupings in their original work. Two sequenced isolates, 624 and 528, were chosen from their subgrouping B. These isolates grouped with the isolates from their group A, isolates 537, 522, 512, 476, and 468. Isolates in their group C, 642, 484, 456, and 452, also grouped together in this study. The Florida isolate B, while grouping as the sister group to the other Phomopsis "species," relative to the Phoma-like isolates, was consistently outside of both of the major clades (Figures 210 and 2-11).






66


The cladogram based on the ITS2 sequence data was less resolved than all other trees (Figure 2-12). Cladograms that were based on sequence groups that excluded the Phomopsis "species" sequenced by Rehner and Uecker (1994), resulted in the grouping of the B isolate as the well-resolved sister taxon within a clade containing P. oryzae and the Phomopsis spp. isolates from Georgia peach (Figure 213). The Florida isolate B is clearly distinct from the two major clades containing the PHO isolate and the PO isolate (Figures 2-10, 2-11, 2-13, and 2-14).

A number of points complicate making conclusions concerning the

information resulting from the sequence analysis data. There was a high degree of variability in the sequences of the isolates. This made alignment of the sequences difficult and somewhat ambiguous in terms of identifying the optimal alignment. Alignments are often prohibitively difficult when the paired sequences differ by more than 30% (Hillis and Dixon, 1991). In addition, due to the complicated taxonomic situation regarding the genus Phomopsis, it is impossible to determine if the terminal clades represent species or groupings of isolates that have been referred to as species. Although the Florida isolate B consistently occurs as the sister group to the remaining isolates of Phomopsis spp., it is difficult to determine if it truly belongs in this group. The results of the sequence analysis, coupled with the unique morphological characteristics, certainly indicate that it is not a new isolate of any of the existing species that have been sequenced; therefore, it is necessary and justified to name it as a new species. Performing a sequence analysis based on a more conserved region, such as the 28S sequence information, as well as a revision of the genus Phomopsis as a whole, might lead to the determination that the Florida isolate B could be a






67


representative of a new genus. Analysis of any other region of DNA was not a

realistic option at this time, due to the limited availability of sequence information for

this genus.

The description of the fungus obtained from amaranth in Gainesville, Florida,

named here as the new species, Phomopsis amaranthicola sp. nov. Rosskopf,

Charudattan, and Shabana is as follows:

Coloniae in agaro "potato dextrose" albidae, floccosae, denique fumosus. Mycelio septalis, ramosa. Pycnidia abundanti, producens concentricus 0.5-cm separatus, solitaria. Pycnidia globosa, ostiolata et unilocularia, 371-287 pm, exudato sporali dilutus armeniacus. Paries pycnidialis brunneis vel piceus, cellulis multistratosis, eustromaticus. Conidiophores hyalinae, simplicia, recta vel ramosa. Cellulae conidiogenae hyalinae, procreans a conidia multilocus, phialidicae, exorientes stratis ex intimis cellularum cavitatis pycnidii. Alpha conidia hyalina, fusiforme-elliptica, 17 guttulata, unicellularia, 6.6-24.0 x 2.2-6.6 pm, average 14.1 x 5.7 pm (mode 13.2 x 6.6 jpm). Beta conidia hyalina, filiformia, hamatus vel recta, 24.2-28.6 x 1.1-2.2 pm, average 27.8 x 1.6 pm (mode 28.6 x 1.1 pm). C conidia sparsa, hyalina, variabilis guttulata, 18-22 pm. Pycnidia in caules emortuis immersa, erumpescentia, singularis, unilocularia.

Colonies produced on potato dextrose agar white, floccose, turning gray to brown. Mycelium septate and branched. Pycnidia abundant, produced in concentric rings 0.5-cm separating, solitary. Pycnidia globose, ostiolate and unilocular, measuring 371-287 pm, with conidia released in a peach-colored matrix. Pycnidial wall brown to black and multicelled. Conidiophores hyaline, occasionally branched. Conidiogenous cells hyaline, having multiple loci of alpha conidium production, phialidic, lining the inner-wall of the cavity. Alpha conidia hyaline, fusiform-elliptic, containing 1-7 guttules, aseptate, measuring 6.6-24.0 x 2.2-6.6 pm, average 14.1 x 5.7 pm (mode 13.2 x 6.6 pm). Beta conidia hyaline, filiform, hamate or straight, measuring 24.2-28.6 x 1.1-2.2 pm, average 27.8 x 1.6 pm (mode 28.6 x 1.1). C
conidia sparse, hyaline, guttulate, measuring 18-22 pm in length. Pycnidia on dead stems immersed and erumpent, single, and unilocular.

In the review of integrated control of Amaranthus retroflexus L., Bilrki et al.

(1997) referred to this species of Phomopsis as P. amaranthicola Brunaurd, stating

that the fungus had been collected in South America. This was a mistake on the part

of the authors (Biirki, personal communication to Rosskopf, 1997). I am presenting

here the first description of this species.














CHAPTER III
THE EFFECTS OF EPIDEMIOLOGICAL CONDITIONS ON THE PATHOGENIC
EFFICACY OF PHOMOPSIS AMARANTHICOLA.

Introduction

The most commonly cited explanation for the failure of fungal plant

pathogens used for biological control agents of weeds to cause severe disease, is the requirement of an extended dew period for adequate infection. Some pathogens, such as Sphacelotheca holci Jack (=S. cruenta [Kuhn.] Potter), under consideration for use as a biological control agent for johnsongrass (Sorghum halepense [L.] Pers.), do not have this as a major constraint. Researchers working with this pathogen have reported that, although initial greenhouse studies indicated a need for free moisture for infection, later studies resulted in 55% infection of plants regardless of the availability of free moisture. It is apparent that although this is a relatively low reported infection rate, the authors found it to be adequate to reduce the competitive ability of the weed (Massion and Lindow, 1986).

Daniel and coworkers (1973), studying the use of a strain of Colletotrichum gloeosporioides (Penz.) Sacc. for the control of northern jointvetch (Aeschynomene virginica [L.] B.S.P.) found that infection was not limited by the absence of a dew period, but that fastest onset of disease was achieved if the inoculated plants were exposed to 80% relative humidity "overnight." This organism was reported to be capable of causing infection at greenhouse temperatures ranging from 23-320C,




68






69


although the data presentation did not indicate the levels of severity achieved. The same organism was capable of infecting plants ranging from 5.0- to 30.5-cm tall, although the greatest percentage of mortality was achieved with the smallest-size class of plants. This organism was later registered as the bioherbicide Collego.

One species of Phomopsis (Sacc.) Bub.k, P. convolvulus Ormeno, was

evaluated for its potential for the control of field bindweed (Convolvulus arvensis L.). This fungus was found to cause the highest levels of plant mortality when the inoculated plants were exposed to a minimum of 18 h of dew combined with an inoculum concentration of 109 conidia/m'. This treatment resulted in 55% plant mortality (Morin et al., 1990b). Isolates of Bipolaris setariae (Saw.) Shoemaker examined for the control of goosegrass (Eleusine indica [L.] Gartner) required a 48hour dew period for 100% infectivity. The optimal temperature for disease development in this system was 240C. The isolate was able to control goosegrass plants of the 2- and 4-week growth stages (Figliola et al., 1988).

Similar results were obtained in studies involving the development of

anthracnose of spiny cockleburr (Xanthium spinosum L.), caused by Colletotrichum orbiculare (Berk. et Mont.) v. Arx. The optimal temperatures for disease development by this organism were between 200C and 250C, with a dew period of 48 h. As with several other potential biological control organisms, if this dew period was split into 12-hour exposures with 12 hours separating dew exposure, the disease severity was decreased. A significant level of mortality of cockleburr was not achieved with any of the treatments, with disease ratings approaching five, which did not constitute plant death (McRae and Auld, 1988).






70


Colletotrichum truncatum (Schw.) Andrus and Moore, used for the control of Florida beggarweed (Desmodium tortuosum [Sw.] DC.), had optimal disease development with 14 to 16 h of dew at temperatures between 240C and 290C. Conidial suspensions with concentration of 10' to 107 conidia/ml were most effective in controlling plants in the cotyledon stage of growth. The efficacy of the pathogen diminished as the maturity of the plants increased (Cardina, 1988). The percentage of control obtained at 180C was significantly lower.

Microsphaeropsis amaranthi (Ell. and Barth.) Heiny and Mintz

(=Aposphaeria amaranthi Ell. and Barth.), a pathogen of tumble pigweed (Amaranthus albus L.), was found to cause the most significant levels of pigweed mortality in a series of growth chamber experiments when applied to plants of the four-leaf stage and exposed to a minimum of 8 h of dew. There were no significant differences when comparing mortality of inoculated plants exposed to 8, 12, and 24 h of dew. This dew period requirement is substantially lower than those for many of the potential biological control agents that have been evaluated. There were also no significant differences in mortality when conidial suspensions ranging from 104 to 107 were used for inoculation. In this case, there was no detrimental effect produced by delaying the onset of dew and therefore the disease resulted in 100% plant mortality (Mintz, 1992).

Testing of the epidemiological parameters is essential for determining the

potential of biological control agents for weeds. Although many organisms that prove to have potential at this level of testing do not prove to be efficacious in the field, determination of the basic environmental conditions necessary for disease






71


development will provide some measure of the potential for field use. In order to test the effects of these parameters on the disease development caused by Phomopsis amaranthicola Rosskopf, Charudattan, and Shabana on pigweed (Amaranthus L. spp.), greenhouse studies examining the period of dew required for use of conidial and mycelial preparations were examined. In addition, the temperature during the dew period was also evaluated in terms of the development and severity of disease. The effect of a humectant on disease severity and plant mortality was also evaluated. The growth stage of the Amaranthus hybridus L. test plants was also examined as a potential factor in establishing the efficacy of the organism. Different concentrations of conidia in suspensions used for inoculation ofA. hybridus plants were also considered as a potential factor in disease development and severity. Amaranthus hybridus plants were found to be moderately susceptible to infection by P. amaranthicola. Therefore, it was chosen for evaluation of the pathogen. Although other species, including A. lividus and A. viridus, were more susceptible, they were so severely affected by the pathogen that differences in the experimental parameters would not be detected.

Materials and Methods

Dew Period, Inoculum Type, and Amendment

To study the dew period required for disease initiation by P. amaranthicola, inoculum suspensions were prepared that were composed of both conidia and mycelium. Conidial suspensions were prepared by harvesting conidia from V-8 agar plates by flooding plates with 10 ml of deionized water and dislodging spores using a sterilized rubber policeman. The suspension was then filtered through two layers of






72


sterile cheese cloth and standardized to 1 million conidia per milliliter using a hemacytometer. Cultures utilized in this way were from 12-24 days old. Cultures were maintained at 250C 20C and exposed to a diurnal light regime. Mycelial suspensions were prepared from mycelial mats harvested from 2- to 3-week-old cultures grown in potato dextrose broth (PDB) in Fernbach flasks. The PDB was amended with chloramphenicol (2.5 mg/L) and streptomycin (3.7 mg/L). These cultures were allowed to grow under ambient light.

When the mycelium was ready for harvest, the cultures were filtered through two layers of sterile cheese cloth and rinsed with sterile deionized water. The mycelium was then pressed dry and weighed to prepare suspensions containing 5 g/ml. For the dewperiod experiment, the suspensions were continuously stirred and split into two aliquots; one of each type of inoculum was amended with a hydrophilic psyllium mucilloid (Metamucil, Procter and Gamble, Cincinnati, OH) at the rate of 0.5 g/100 ml (m:v). Mycelial suspensions were applied using sterilized paint brushes. Three milliliters of suspension were applied to each plant for the mycelial treatments. Conidial suspensions were applied with hand-held pump sprayers using 3 ml per plant. Plants of A. hybridus L., smooth pigweed, were used for greenhouse experiments. Plants were grown from seed (Azlin Seed Service, Leland, MS) in the greenhouse and transplanted at the cotyledon stage to three plants per 9-cm clay pot containing Metromix 300 (Scott's-Sierra Horticultural Products Co., Marysville, OH). Plants were maintained in the greenhouse until they had from two to four true leaves. Plants were inoculated with the conidial or mycelial suspensions, either with or without the amendment. The plants were subsequently exposed to varying lengths of dew consisting of no dew, in which the plants were inoculated and then returned to the greenhouse, or 4, 8, 12, or 24 h of dew.






73


Controls consisted of plants sprayed with water or water amended with psyllium mucilloid, and the uninoculated plants were exposed to the same dew treatments as the inoculated plants. When removed from the dark dew chamber, plants were returned to the greenhouse and evaluated for disease development and plant mortality over 8 weeks. Three replicates were used for each treatment and the experiment was repeated twice. Data were taken as the proportion of dead plants. The proportions were transformed using the arc-sine square-root transformation. Analysis of variance (ANOVA) was used to determine if the trials could be combined and to determine the significance of the effects and any interactions. Means were separated using Tukey's Honestly Significant Difference (HSD) test and regression analysis was performed using the General Linear Models (GLM) analysis (SAS Institute, 1988).

Dew Period and Temperature

To examine the effect of temperature during the dew period, a conidial

suspension of P. amaranthicola was prepared as before and amended with psyllium mucilloid (0.5% m:v). Plants were spray-inoculated as before and then exposed to varying lengths of dew, 0, 4, 8, 12, and 24 h, with temperatures of 20, 25, 30, and 350C. Plants of the four- to six-leaf stage were used for this experiment. Controls consisted of uninoculated plants exposed to the same dew durations and temperatures as the inoculated plants. Each treatment consisted of three replicates, consisting of three plants per replicate, and the experiment was repeated thrice. Data were taken as the proportion of dead plants. The proportions were then transformed using the arcsine square-root transformation. Analysis of variance was used to determine if the






74


trials could be combined and to determine the significance of the effects and any interactions. Means were separated using Tukey's HSD test and regression analysis was performed using the GLM analysis.

Effect of Plant Growth Stage on Disease

The effect of plant growth stage on the development of disease and plant mortality was tested using plants of five growth stages: 1) <2-leaf stage = fully expanded cotyledon with the first true leaves just beginning to open (approximately 10 days after planting); 2) 2- to 4-leaf stage = two fully expanded leaves with the third and fourth leaves just beginning to expand (approximately 16 days after planting); 3) 4- to 6-leaf stage = four true leaves fully expanded and the fifth and six leaves beginning to expand (approximately 20 days after planting); 4) 6- to 8-leaf stage = six fully expanded leaves with the seventh and eighth leaves just beginning to expand (approximately 26 days after planting); 5) flowering = axillary buds present and producing flowers (approximately 30 days after planting).

Plants were grown from seed in the greenhouse in a staggered fashion to

accomplish the desired growth stages. Plants were sprayed with a hand-held pump sprayer to just before runoff with a conidial suspension of 1 x 106 conidia per ml. Approximately 3 ml of suspension were applied to each plant. Inoculated seedlings were transferred to a dark dew chamber for 24 h at 250C' 20C. Controls consisted of each plant growth stage sprayed with a 0.5% (m:v) psyllium mucilloid suspension and exposed to 24 h of dew. Data were taken as the proportion of dead plants. The proportions were then transformed using the arc-sine square-root transformation.






75


Results from two trials were combined. Analysis of variance was used to determine if the trials could be combined and the significance of the treatment effect. Means were separated using Tukey's HSD test.

Inoculum Concentration

The effect of inoculum concentration on plant mortality was evaluated using conidial suspensions of a conidia of P. amaranthicola prepared in the same manner as above. Suspensions were then diluted to contain approximately 1.5 x 10S, 6.0 x 105, 1.5 x 106, 6.0 x 106, and 1.5 x 107 conidia per ml, as determined with a hemacytometer. All suspensions were amended with psyllium mucilloid (0.5% m:v). Amaranthus hybridus plants of the four- to six-leaf stage were utilized for this study and were grown as in the above experiments. Plants were inoculated with a handheld pump sprayer as before, and were then exposed to 12 h of dew at 250C'20C in the dark. Inoculated and control plants were moved to the greenhouse and observed for disease development and mortality for 8 weeks. Data were taken as the proportion of dead plants. The proportions were then transformed using the arc-sine square-root transformation. Results from three trials were combined. Analysis of variance was used to determine if the trials could be combined and the significance of the treatment effects. Means were separated using Tukey's HSD test.

Results

Dew Period, Inoculum Type, and Amendment

Results of the first series of trials examining the effect of the dew period

duration, inoculum type, and amendment were analyzed as a five x five factorial. All of the factors, dew duration, inoculum type, and amendment, were found to be






76


significant (P=0.0001), and there were no significant interactions among the factors (P< 0.05). Trials had mean square errors of the same magnitude (Trial 1 MSE=0.489, Trial 2 MSE=0.543), and the effect of trial was found to be insignificant (P=0.714). Data for each factor were pooled over all other factors. Significantly higher percentages of mortality occurred when plants were exposed to a minimum of 8 h of dew than at lower exposures (Table 3-1 and Figure 3-1). There was no significant difference between no dew period (13% mortality) and a 4-h dew period (32% mortality). There was no statistically significant increase in mortality when comparing

8 h of dew (53% mortality), and 12 and 24 h of dew, (59% and 73%, respectively). Regression analysis of the effect of dew duration resulted in the equation y--0.003x2 + 0.114x + 0.181, although the r-square (R2=0.47) was relatively low and coefficient of variation high (CI=50.8) (Figure 3-1).

The type of inoculum used, whether a conidial preparation or mycelial suspension, was also a significant factor in determining the most efficacious preparation of P. amaranthicola. Application of conidial suspensions resulted in an average of 61% mortality of A. hybridus and were more effective than mycelial suspensions, which yielded only 31% mortality of the same weed species (Figure 3-2).

The addition of the psyllium mucilloid as an amendment to the fungal

preparations significantly influenced the mortality ofA. hybridus after inoculation with P. amaranthicola. Fifty-four percent of plants were killed by the amended suspensions, versus 38% mortality of plants treated with the nonamended fungal suspensions (Figure 3-3). These differences were all found to be significant at the a=0.05 level using the Tukey's HSD mean separation procedure. No control plants were affected by the treatments.






77


Table 3.1. Mortality ofAmaranthus hybridus L. after inoculation with Phomopsis amaranthicola obtained for each treatment combination of dew period, inoculum type, and amendment with psyllium mucilloid (Metamucil).

Inoculum Type Percent Mortality
Dew Duration
Conidia 0 4 8 12 24
Amended 28 50 71 92 95
Nonamended 17 39 56 72 87 Mycelium
Amended 6 28 61 50 61
Nonamended 0 11 22 22 50







78




80
b

70


b
60
b

50


o
40



30



20
a

10




0 4 8 12 24 Dew Period (Hours)


Figure 3-1. Effect of dew duration on the mortality of Amaranthus hybridus L. caused by inoculation with Phomopsis amaranthicola. Bars with different letters represent significantly different average mortality values based on the arc-sine squareroot transformed proportions with mean separation by Tukey's Honestly Significant Difference test (--0.05). Data are the result of two combined trials. Regression analysis of the effect of dew duration resulted in the equation y=-0.003x2 + 0.1 14x +
0.181, with a significance ofP=0.0001, although the r-square (R2=0.47) was relatively low and coefficient of variation high (CI=50.8).







79








70
a
60

50

S40


30

20 10

0
Conidia Mycelium Inoculum



Figure 3-2. Effect of inoculum type of Phomopsis amaranthicola on mortality of Amaranthus hybridus L. plants. Bars with different letters represent significantly different average mortality values based on the arc-sine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (c=0.05). Data are the result of two combined trials.







80




60

a


50




40




30




20




10




0
With Without Amendment Figure 3-3. Effect of amendment with a psyllium mucilloid on the efficacy of Phomopsis amaranthicola on Amaranthus hybridus L. plant mortality. Bars with different letters represent significantly different average mortality based on the arcsine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (cc=0.05). Data are the result of two combined trials.






81


Effect of Dew-Period Temperature

The effect of temperature during dew exposure periods was found to be a

significant factor in the efficacy ofP. amaranthicola as expressed by mortality of A. hybridus (Table 3-2.). Three trials were combined based on all trials having mean square errors of the same magnitude, 0.200, 0.241, and 0.244 for trials 1-3 respectively. Trial was also found to be an insignificant factor with P=0.35. In this experiment, the effect of dew duration was also found to be significant, as had been shown previously. There was no interaction between the effects of temperature and dew duration (P<0.05); therefore, the temperature data were pooled over the dewduration treatments. Temperatures of 250C, 300C, and 350C were found to be equally effective, with levels of mortality of 52%, 57%, and 67%, respectively. Treatment with a dew period temperature of 200C was found to cause a significant decrease in level of mortality, with this treatment producing only 23% mortality of inoculated A. hybridus plants (Figure 3-4). No control plants were affected by the treatments. Effect of Plant Growth Stage

Plant growth stage had a significant effect on the efficacy of P. amaranthicola (P=0.0322, R2=0.71, CV=46.5, MSE=0.67). The two trials were combined based on mean square errors of the same magnitude (0.058, and 0.041 for each of two trials) and insignificant effect of trial using ANOVA (P=0.08). Growth stage 1 (<2-leaf stage = fully expanded cotyledon with the first true leaves just beginning to open (approximately 10 days after planting)) and growth stage 2 (2- to 4-leaf stage = two fully expanded leaves with the third and fourth leaves just beginning to expand






82


Table 3-2. Mortality ofAmaranthus hybridus L., after inoculation with Phomopsis amaranthicola, obtained for each treatment combination of dew period duration and temperature.

Temperature Percent Mortality
Dew Duration
4 8 12 24 20 11 15 19 48 25 30 44 67 67 30 30 59 70 67 35 48 70 67 82







83




70



60 b

b

50



40



30

a

20



10





20 25 30 35 Temperature (Degrees Celsius) Figure 3-4. Effect of dew-period temperature on the efficacy of Phomopsis
amaranthicola on Amaranthus hybridus L. Bars with different letters represent significantly different average mortality values based on the arc-sine square-root
transformed proportions with mean separation by Tukey's Honestly Significant
Difference test (cL=-0.05). Data are the result of two combined trials.






84


(approximately 16 days after planting)) were most effectively controlled by the application ofP. amaranthicola (Figure 3-5). Although inoculated plants of growth stage number 5 (flowering = axillary buds present and producing flowers [approximately 30 days after planting]) appeared to be affected by application of the fungus, there was no difference between the mortality of inoculated or uninoculated plants of this growth stage. The high level of mortality in the fifth growth stage can be attributed to natural mortality related to the end of the plant's life cycle. Effect of Inoculum Concentration

The different concentrations of a conidia of P. amaranthicola applied to A. hybridus plants did not have any significant effect on the percentage of mortality resulting from those inoculations (a=0.05) (Figure 3-6). The only difference that was significant was between the control treatment, consisting of the application of psyllium mucilloid alone, and the treatments containing conidia. The three trials were combined based on mean square errors of the same magnitude (0.120, 0.165, and 0.153 for each of three trials) and insignificant effect of trial using ANOVA (P=0.2682).

Discussion

The infection ofAmaranthus hybridus by Phomopsis amaranthicola was most effective when preparations containing conidia were used. Although mycelial suspensions used for inoculation did cause disease, the levels achieved were inadequate for significant control of the weed. This is a minor limitation for the large-scale use of P. amaranthicola, as the production of mycelium in liquid culture is less expensive and requires less space or specialized equipment than does production of conidia on solid media. Unfortunately, P. amaranthicola does not undergo appreciable conidiation in






85


80
a
70 a

60 E Inoculated a ID Control
-50
o ab
S40

S30

20 bc



0c c c c c

1 2 3 4 5 Plant Growth Stage



Figure 3-5. Effect of plant growth stage on the efficacy ofPhomopsis amaranthicola. Bars with different letters represent significantly different average mortality of Amaranthus hybridus plants based on the arc-sine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (a=0.05). Data are the result of three combined trials. Plant growth stages are as follows: 1) <2-leaf stage = fully expanded cotyledon with the first true leaves just beginning to open (approximately 10 days after planting); 2) 2- to 4-leaf stage = two fully expanded leaves with the third and fourth leaves just beginning to expand (approximately 16 days after planting); 3) 4to 6-leaf stage = four true leaves fully expanded and the fifth and six leaves beginning to expand (approximately 20 days after planting); 4) 6- to 8-leaf stage = six fully expanded leaves with the seventh and eighth leaves just beginning to expand (approximately 26 days after planting); 5) flowering = axillary buds present and producing flowers (approximately 30 days after planting).







86



40

35
b
30
b b S25 20
2 20

S15



5

0 a

0 1.5 6 15 60 150 Concentration of alpha-conidia (x 106)


Figure 3-6. Effect of inoculum concentration on the efficacy of Phomopsis amaranthicola on the mortality ofAmaranthus hybridus. Bars with different letters represent significantly different average plant mortality based on the arc-sine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (a=0.05). Data are the result of three combined trials.






87


potato dextrose broth and will require further investigation to determine if a semi-solid mode of production will be successful for large-scale inoculum production.

Fortunately, relatively low concentrations of conidia were found to be adequate for causing mortality ofA. hybridus plants. Unlike other potential agents for biological control of weeds, such as P. convolvulus, which requires 10' conidia/ml to cause high levels of mortality in seedlings of field bindweed, there were no significant differences between applications of different concentrations of conidia. The conditions of the study here, including the suboptimal dew duration, as well as the application of the fungus to plants of moderate growth, rather than to plants in the seedling stage, further support the effectiveness of lower concentrations of conidia.

The addition of the psyllium mucilloid, in the form of Metamucile, did

substantially improve the efficacy of P. amaranthicola, particularly in the absence of an extensive dew period. The results from these studies indicate that dessication-reducing formulations of this pathogen could improve significantly its practical use. The necessity for prolonged exposure to dew, as was stated earlier, is one of the most limiting factors in the development of suitable, effective biological control agents for weeds. The use of humectants in the formulation of these pathogens may alleviate these extended periods. In the case of P. amaranthicola, a dew period of a minimum of 8 h is important for high levels of plant mortality. When compared to many potential biological control agents, this is a relatively low dew-duration requirement, although it is still a longer period than is available in field situations. Further work in the area of formulation may eliminate even this relatively minimal dew requirement.






88


The temperature of the dew period had a significant effect on the efficacy of P. amaranthicola. The optimal temperature range for infection and disease development with P. amaranthicola was similar to the optimal ranges reported for several other Phomopsis spp. (Eshenaur and Milholland, 1989; Rupe and Ferris, 1987; Tekrony et al., 1983). The most important implication of these results are that the optimal temperatures, from 250C-350C, for disease development and plant mortality fall within the temperature range that occurs during the growing season of the weed. The upper limit of the testing range should be increased above 350C to determine what the high temperature ceiling might be. One negative aspect of the apparent low temperature inhibition of the pathogen is that P. amaranthicola may not be suitable for control of pigweeds in northern crops, such as beets (Schweizer, 1981; Schweizer and Lauridson, 1985). It is unlikely that the use of this fungus in more southern temperate regions and subtropical settings will be limited by temperature.

The growth stage of the A. hybridus seedlings appeared to be one of the more significant factors affecting the efficacy of P. amaranthicola. The importance of early season control of species of Amaranthus has been documented for several crops, including beans (Lugo, 1996) and soybean (Monks and Oliver, 1988). The ability of P. amaranthicola to control pigweeds early in their growth is compatible with the need for early-season control of these weeds in many crops (Kropff et al., 1992; Weaver and Tan, 1983; Weaver et al., 1992). Although the most susceptible growth stages are the smaller stages, it may be possible to improve the efficacy ofP. amaranthicola on older or more mature plants with the addition of formulating agents.






89


The timing of application of P. amaranthicola as a biological control agent for pigweeds is decidedly one of the most important factors. Timing plays a crucial role, both in terms of the growth of the target weeds, as well as in optimization of the environmental conditions that are present during and after application. It appears that applications made early after weed emergence would be most conducive for effective control. The pathogen should also be applied to take advantage of the most humid periods or timed to coincide with the onset of the evening or early morning dew period. These factors are more important to consider than the temperature at the time of application.

In several cases, there was a great deal of variability in the efficacy of P.

amaranthicola. In addition to the factors that were looked at here, there are certainly other conditions that may have played a role in the variation between trials or between experiments. Suspensions of conidia that were allowed to remain on the laboratory bench for more than 1 h before spraying showed improved germination over those allowed to sit for up to 1 h or for more than 7 h (Table C-1). In studies involving the role of the conidial matrix of P. convolvulus, the matrix was found to act as an inhibitor of conidial germination (Sparace et al., 1991). It may be possible that this phenomenon occurs with Phomopsis amaranthicola, as the release of conidia does occur in a similar matrix. In cases where the suspensions were not held for a long enough period before use, the conidial matrix may not have been adequately dissolved.

In studies involving the use ofAlternaria helianthi (Hansf.) Tubaki and Nishihara, the temperature at which the fungus was propagated had an effect on the efficacy of the organism when used for control of Xanthium strumarium L. (cocklebur). Although the






90


fungus was found to produce conidia at all of the temperatures used, there were differences in the infectivity of the spores and the resulting disease (Abbas, et al., 1995a,b). Germination and growth of a conidia of P. amaranthicola is quite variable in itself and this, coupled with the other potential factors described here may contribute to varying levels of efficacy.




Full Text

PAGE 1

EVALUATION OF PHOMOPSIS AMARANTHICOLA SP. NOV. AS A BIOLOGICAL CONTROL AGENT FOR AMARANTHUS SPP. By ERIN NICHOLE ROSSKOPF A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1997

PAGE 2

Copyright 1997 by Erin N. Rosskopf

PAGE 3

To Mom And Dad

PAGE 4

ACKNOWLEDGMENTS I would like to thank Dr. Raghavan Charudattan for his support and interest in my progress, both as a scientist and as a human being. Without his continuity and belief, I could not have completed my program. I would like to thank Dr. Shoemaker and Dr. Morsink for their encouragement and belief in me. I would like to thank Dr. Dave Mitchell for his inspiration and high standards and for teaching me how to think in a hoUstic way about plant disease. I thank my committee members. Dr. James Kimbrough, Dr. Corby Kistler, and Dr. Tom Bewick, for their input, assistance and open access to their facilities. I would like to thank all of my committee members for being role models committed to teaching. Without their expertise, I would not have known where to begin or end. I would also like to thank Dr. Uma Verma and Mr. Jim DeValerio for their friendship and for "teaching me the ropes." Assistance from Dr. Gerry Benny and Ulla Benny was invaluable and allowed me to explore areas of research that I would not have been able to do otherwise. Help from Mr. Jerry Minsavage, Dr. Frank Martin, Ms. Patty Rayside, Dr. Earl Taliercio, Dr. Vicente Febres, and Dr. Bill Stall is much appreciated. I thank Dr. Agrios for his support. I also thank all of the staff for their help and for keeping everything going. I extend my thanks to Mr. Gene Crawford, Mr. Lucious Mitchell, Mr. Eldon Philman, Mrs. Nancy Philman, and Mr. Bill Crawford for their help, support, love, and friendship. Special thanks to Bill for hanging in there through the rough parts and a hope that he thinks it iv

PAGE 5

was worth it. I would like to thank Dr. Rose Koenig, Dr. Tim Widmer, Dr. Jim Gaffiiey, Dr. Margaret Smither-Kopperl, Dauri Tessman, Daniela Lopes, Bob Kemerait, and Kenny Seebold for their friendships and guidance. Many thanks to Mark EUiott for letting me whine whenever I needed to. I could not have completed the daily activities in my program without the assistance of Will Canova, Jay Gideon, Eric Azara, and StayC Graham. I appreciate the expertise provided by Jason Lampert, Carolyn Bartuska, Jay Harrison, and Greg Erdos and the Electron Microscopy staff. Special thanks go to the late Dr. Bud Uecker and Dr. Amy Rossman for their invaluable assistance and inspiration. I would like to thank Drs. Robinson Pitelli and Li-Chuan Liu for their friendships and the opportxmities they afforded for working on an international scale. I would also like to thank Drs. Alicia Maun and Beree Darby for keeping me healthy and sane. My best wishes for success to all of the students in Dr. Charudattan's program. I could not have gotten through the rough parts without my constant companion, Elias, who never barked too loudly when I got home late. I would also like to thank Rita Rosskopf, George and Mabel Liebau, and the rest of my family for being patient and loving. Most thanks go to Cheri and Allen Rosskopf for being the greatest human beings alive, for being my best friends and for always loving me no matter what. It was their fascination with the natural world around them, their unique abilities to see the beauty in nature and the crucial gift of knowing how to share it that got me on this path. I couldn't have taken even the first step without them.

PAGE 6

TABLE OF CONTENTS ACKNOWLEDGMENTS iv ABSTRACT viii CHAPTERS L INTRODUCTION 1 n CHARACTERIZATION OF PHOMOPSIS AMARANTHICOLA, SP. NOV 20 Introduction 20 Materials and Methods 29 Results 41 Discussion 61 III THE EFFECTS OF EPIDEMIOLOGICAL CONDITIONS ON THE PATHOGENIC EFFICACY OF PHOMOPSIS AMARANTHICOLA 68 Introduction 68 Materials and Methods 71 Results 75 Discussion 84 IV FIELD EVALUATION OF PHOMOPSIS AMARANTHICOLA 91 Introduction 91 Materials and Methods 93 Results 95 Discussion 110 V COMPATIBILITY, FORMULATION, AND APPLICATION 116 Introduction 116 Materials and Methods 129 Results 134 Discussion 140 VI SUMMARY AND CONCLUSIONS 150 vi

PAGE 7

APPENDICES A SEQUENCE ALIGNMENTS OF rDNA INTERNAL TRANSCRIBED SPACER REGIONS 154 B WEATHER DATA DURING FIELD EVALUATION OF PHOMOPSIS AMARANTHICOLA 161 C GERMINATION OF CONIDL\ OF PHOMOPSIS AMARANTHICOLA OVER TIME 164 D CARBON DIOXIDE PRESSURIZATION AND pH 1 66 E ISOLATION OF FUNGI FROM AMARANTHUS DUBIUS IN PUERTO RICO 168 REFERENCE LIST 174 BIOGRAPHICAL SKETCH 191 vii

PAGE 8

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EVALUATION OF PHOMOPSIS AMARANTHICOLA SP. NOV. AS A BIOLOGICAL CONTROL AGENT FOR AMARANTHUS SPP. By Erin Nichole Rosskopf December, 1997 Chairman: Dr. Raghavan Charudattan Major Department: Plant Pathology A new species, belonging to the fungal genus Phomopsis (Sacc.) Bubak, was identified as the causal agent of a leaf and stem blight occurring on Amaranthus L. sp. in Florida. The fungus (isolate ATCC# 74226) was identified as a new species, P. amaranthicola Rosskopf, Charudattan and Shabana, based on the morphological characteristics, as well as through partial genetic characterization. The potential for use of this organism as a biological control agent to manage pigweeds and amaranths was evaluated. Conidial suspensions of P. amaranthicola were most effective in causing high levels of plant mortality when tested in comparison with mycelial suspensions in both greenhouse and field trials. Fungal suspensions amended with a psyllium mucilloid were effective in causing plant mortality even in the absence of a dew period. A dew period lasting for 24 h resulted in the greatest plant mortality regardless of the type of inoculum suspension or the amendment, although 8 h of dew were adequate for severe infection. Conidial viii

PAGE 9

suspensions ranging from 1.5 x 10* to 1.5 x 10^ conidia/ml were most effective in causing high levels of mortality of pigweeds of the twoto four-leaf stage. Dew temperatures ranging from 25-35 C were most conducive for disease development and plant mortality. The host range of P. amaranthicola was tested using a centrifiigalphylogenetic scheme (Wapshere, 1974), with^. hybridus as the focal plant. Thirtythree biotypes belonging to 22 known and two unknown species of Amaranthus were tested for susceptibility to the fimgus. All accessions were susceptible to the fungus, but susceptibility did not lead to mortality in all cases. Species in which there was a minimum of one biotype succumbing to 80-100% mortality included A. acutilobus L., A. lividus L., A. powellii S. Wats., A. retroflexus L., and A. viridus L. Plants within the family Amaranthaceae, but outside the genus Amaranthus, as well as crops in which pigweeds are a problem, were also tested for susceptibility to the fimgus. A substantial number of plants that are reported to have an association with another member of the genus Phomopsis were also tested. No plants outside the genus Amaranthus showed any symptoms, nor was P. amaranthicola found to be present in their tissues as evidenced microscopically or through isolation techniques. Phomopsis amaranthicola was field tested during the summers of 1993, 1994, and 1995. The species A. hybridus, A. lividus, A. spinosus L., A. retroflexus, and A. viridus were included. In addition, a triazine-resistant accession of A. hybridus was used. Field treatments consisted of single or double applications of mycelium and two concentrations of conidia. As in greenhouse trials, conidial suspensions were I most effective in causing high levels of plant mortality, although A. lividus and A. ix I

PAGE 10

viridus were effectively controlled with all treatments. The characteristics of this fungus indicate that it would be a useful component in an integrated weed management program for pigweeds and amaranths. X

PAGE 11

CHAPTER I INTRODUCTION Weed control in the United States has followed trends similar to those of other types of pest control. Historically, the dependence on cultural practices diminished in the mid 1960s as reliance on chemical herbicides increased. Although mechanical and cultural practices are still a necessary part of a successful weed management strategy, the limited number of individuals producing food in the United States has made the use of herbicides the most economically advantageous means. Weeds are considered one of the most limiting factors in crop production. In Florida, for example, losses due to weeds in cotton were estimated at approximately $168.00 per hectare in 1994 (Colvin, 1995). In soybeans, as much as $197.68 per hectare was lost in 1994 to weeds through the cost of herbicides, loss in yield, quality, land value, and in additional costs for land preparation, cultivation, and harvesting. It has been estimated that more than 80% of all pesticides sold in the U.S. are herbicides and the area treated with herbicides has increased from 9 million hectares in 1949 to approximately 197 milHon hectares treated in 1990 (Anderson, 1983; Bellinder, 1994). Although herbicides have proven to be extremely effective means of vegetation control, their use has come with a nimiber of direct and indirect costs that are now being considered as outweighing the benefits in many cases. Public concern has increased over the contamination of water sources, as well as agronomic problems caused by the overuse and soil persistence of many herbicides. The latter has become increasingly important as 1

PAGE 12

2 the emergence of resistant weed populations has risen with the development and widespread use of the imidazolinone and sulfonylurea families of herbicides and the continued application of triazine herbicides (Ahrens et al, 1981; Anderson, 1983; Manley et al., 1996; Sivakumaran et al., 1993; Stallings et al., 1994). The development of resistance, at least the resistance that has been documented at this time, can be attributed primarily to either prolonged use of a class of herbicides or the herbicide acting at a single dominant site of action (Holm and LeBaron, 1990; Vencill and Foy, 1988). Resistance to triazine herbicides, as an example, has been found to be conferred by a single recessive gene, which alters the triazine binding sites on the chloroplast membranes (Fuerst et al., 1986b) The damage that can occur to crops as a result of soil persistence has been minimized with newer herbicides, but continues to be a problem. As the number of herbicides registered decreases and pubUc pressure to diminish chemical use heightens, there comes an increased need for the development of efficacious alternatives to traditional, chemical herbicides. This general trend encourages the search for cultural practices and biological control agents that can be used in integrated weed management programs. For some specific weed systems, due to the limited registration of effective herbicides and the development of resistance to others, there are open avenues for the development of fimgi to be used as mycoherbistats. There is extensive literature concerning the use of plant pathogenic fimgi for the biological control of weeds in agricultiu-al and ecological settings (Abbasher and Sauerbom, 1992; Adams, 1988; Anderson and Walker, 1985; Andres et al., 1976; Auld et al., 1988; Auld and Morin,

PAGE 13

3 1995; Bewick et al., 1986; Charudattan,1990; Daigle and Connick, 1990; TeBeest and Templeton, 1985; Templeton et al., 1979). A number of fungi have been shown to be capable of controlling their target weeds. Some of these have been examined extensively, while others are still in the preliminary of evaluation. Two mycoherbicides, CoUego (Encore Technologies, Miimetonka, MN), registered for control of northern jointvetch {Aeschynomene virginica [L.] B. S. P.) in rice and DeVine (Abbott Laboratories, Chicago, IL) for control of stranglervine {Morrenia odorata [Hook, and Amott] Lindl.) in Florida citrus, were introduced into commercial use in the 1980s. Dr. Biosedge, a commercial preparation of Puccinia canaliculata (Schwein.) Lagerh. for the control of nutsedge in agricultural settings is registered with the Environmental Protection Agency, but is imavailable because of a lack of commercial interest in production (Phatak, personal communication to R. Charudattan, 1995). BioMal, a commercial product consisting of formulated spores of Colletotrichum gloeosporioides f sp. malvae, has been efficacious, but has suffered fi-om limited commercial success (Cross and Polonenko, 1996). Two biological control agents, Cdxa^enco Xanthomonas campestris 'pv.poae, and Biochon, Chondorstereum purpureum, are currently being marketed for use in turf and for hardwood weed control, respectively (Auld, 1997; Imaizimii et al., 1997). The development of a mycoherbicide may be complicated by a number of factors. A good candidate system should include an organism that can be cultured easily, maintains stability in cultxu-e, has a host range that is suitably limited, and has a relatively high level of efficacy, being able to perform adequately in the field. This is often the most limiting factor in development. These conditions may be met with a simple.

PAGE 14

4 aqueous formulation of the pathogen or may be effected with a formulation that enhances the performance of the agent. The first step in the developmental process of a biological control agent for a weed or group of weeds is to isolate and screen potential pathogens for their ability to cause severe plant disease. Once a pathogen has been identified that shows potential, the biology of the pathogen must be studied to determine the optimum environmental conditions for its success. These conditions would include the most disease conducive temperature, dew duration, plant growth stage, and application method (Charudattan, 1990; Heiny and Templeton, 1991; Klein et al., 1995; McRae and Auld, 1988; Mintz et al., 1992; Morin et al, 1990a; Mortensen, 1986; TeBeest, 1985). Formulation of the pathogen may be varied, and a number of adjuvants may be evaluated that might enhance the development of disease in the field (Amsellam et al., 1990; Klein et al., 1995). The system must then be tested in a field situation to determine if the move to large scale use might be possible. Weeds that have a number of characteristics that make them excellent targets for mycoherbicidal control, where a fimgus is applied inundatively, are pigweeds and amaranths. Pigweeds and amaranths belong to the genus Amaranthus L. (Amaranthaceae) and are broadleaf plants that are predominantly herbaceous annuals, although there are a few woody species. These plants are characterized by the production of a well developed tap root that can extend many feet into the ground, which renders them relatively drought tolerant. Pigweeds produce compound inflorescence and seeds within utricles, which may be dehiscent or indehiscent. The species that have been used as grain crops are dehiscent. Species may be either monoecious or dioecious. There are approximately 60 species described in the genus Amaranthus. Speciation is based

PAGE 15

5 primarily on morphological characteristics of the flowers, although this is complicated by outcrossing between species (Radford et al., 1968). Amaranthus spp. utilize the C4 photosynthetic pathway, which makes them favored in areas with high temperatures, intense sunlight, and dry conditions (Ahrens and Stoller, 1983; National Research Council, 1989; Nielson and Anderson, 1994; Patterson et al., 1985; Pearcy et al., 1981), although they are commonly found where the soil has been disturbed and is not excessively wet. Amaranthus viridus L., considered to be a more tropical species, can tolerate higher moisture than other species (Holm et al., 1997). The majority of information concerning amaranths comes from the literature related to their uses as food sources. The three species most commonly used as grain crops include Amaranthus caudatus L. {=A. edulis Speg.), A. cruentus L., and A. hypochondriachus L. (National Research Council, 1984). These species are predominantly self-pollinated, although outcrossing can occur (Transue et al., 1994). Hybrids of A. hypochondriachus and A. caudatus are viable, while other crosses involving these three species are not. Species grown as leafy vegetables include A. cruentus, A. dubius Mart, ex Thell., A. tricolor L. {=A. gangeticus L.), A. lividus L. (syn.= ^. blitum L.), and^. palmeri S. Wats. (Cole, 1979). Due to the interest in Amaranthus spp. as crops, some work has been done to track the origin and modes of distribution of these plants. Direct evidence documenting initial domestication is scant and a number of hypotheses have been suggested. A comprehensive discussion has been provided by Sauer in a number of papers, but no decisive conclusions are drawn concerning each species due to lack of

PAGE 16

6 direct evidence (Sauer, 1950; 1967). It is believed that A. hypochondriachus was derived from A. powellii S. Wats, and that A. emeritus L. was derived from the weed species, A. hybridus L. Amaranthus caudatus most probably originated from cultivated^, quitensis H. B. K. (Sauer, 1967). By 1492, there were two major areas of amaranth cultivation that included the highlands of Peru south into Bolivia, extending to Argentina as one area, and through the highlands of Guatemala through Mexico and into the southwestern United States as the second area It has been proposed that A. hypoehondriaehus and A. emeritus were originally native to the Mexican area and that A. eaudatus originated in the Andean area Amaranthus and A. hypoehondriaehus were spread, evidently by the Spanish, into Europe as ornamentals, and by the 1700s were being cultivated as grain crops. By the 19th century, grain amaranths had been taken to Africa and Asia, where there now exist secondary centers of diversity (Sauer, 1967; National Research Council, 1984). Amaranthus cmentus may have been one of the most ancient crops domesticated in America This species was introduced into Europe before 1600 (Cole, 1979). The origination of the species commonly cultivated as vegetables has not received a great deal of attention, although the origin of A. trieolor and A. lividus is considered to be in China (Tindall, 1983). Amaranthus caudatus, also referred to as kiwicha, has been reported as playing a significant role in both the nutritional and spiritual lives of the Andean cultures. Tombs more than 4,000 years old have been found to contain apparently domesticated amaranth seeds (National Research Council, 1989). Conflicting reports concerning the common name of the species found there, also reported to be huauhth,

PAGE 17

7 make it difficult to determine if this refers to A. hypochondriachus ox A. caudatus. It is hypothesized that the use of popped amaranth seeds or flour mixed with blood or honey to create small forms or idols, which were eaten during a variety of rituals and festivals, led to the loss of amaranth as a crop after the Spanish conquest. The Catholic church viewed these as pagan activities and prevented cultivation of the crop (Sauer, 1967). Amaranthus caudatus has a variety of common names, including Inca wheat (trigo del inca), quihuicha, and kiwicha and is found throughout Central and South America, India, Iran, and China (Rehm and Espig, 1991). This species contains two true varieties that were developed in Peru. Noel Vietmeyer, a tall and somewhat disease resistant variety, produces slightly lower seed yields compared to the more disease susceptible Alan Garcia, which is short and yields as much as 5 tons of seed per hectare if the conditions are favorable (National Research Council, 1989). Amaranthus caudatus is one of the few species that grows well above 1500 meters. Amaranthus hypochondriachus also has a number of vulgar names, including princess feather, algeria, guautli, and huauthli, and is found throughout India and China, as well as in its proposed area of original cultivation. Amaranthus hypochondriachus is considered to be the best yielding grain amaranth (Cole, 1979). Amaranthus cruentus is commonly called purple amaranth and is distributed throughout Central America, India, and China This species has been used for dye production. It was also used as a vegetable crop in West Africa. Since its move into Asia, use of this crop has become more popular there than in its area of origin. These three species grow well in the lowlands, as well as in mountainous regions (Rehm and Espig, 1991), although y4. caudatus is apparently better adapted to higher elevations. Plants of this type grow best at 21-28 C. Most cannot tolerate frost, although a few cold-tolerant lines have been

PAGE 18

8 found. Genotypes have been found that can tolerate high sahnity, wide ranges of soil pH (optimum ranging from 5.5-7.5) and aluminum toxicity (National Research Council, 1989). Some consider the grain amaranths to be an excellent source of protein, with a range of 13-18% of the total dry weight being composed of protein. Starch composes approximately 50-60% of the total dry weight (Paredes-Lopez, 1994). The grain is also high in lysine, calciiun, zinc, phosphorous, iron, potassium, vitamin B-complex, and vitamin E (National Research Council, 1989; Paredes-Lopez, 1994). It has been suggested that the grain be used in a protein complementation with oats or wheat to balance the high lysine level with a deficiency in leucine, which is found in abundance in the more common grains. The lysine content can be reduced by as much as 17% as a result of popping the seeds. In addition to the excellent nutritional quality of the grain, it also contains tocotrienols, which have been associated with cholesterol reduction, anti-tumor activity, and anti-oxidative activity (Paredes-Lopez, 1994). Amaranthus tricolor is the species most commonly used as a vegetable crop. This is often referred to as Chinese spinach, Chinese amaranth, aupa, and tampala This species is found throughout the tropics and subtropics of the world (Rehm and Espig, 1991). Amaranthus dubius and A. lividus were once grown as leafy vegetables (National Research Council, 1984). Amaranthus lividus is the ingredient for dishes known as vleeta in Greece and norpa in India (Grubben, 1977). Amaranthus dubius has a broad distribution, with a single cultivar, claroen, grown in West Afiica, Central and South America, and India (Paredes-Lopez, 1994).

PAGE 19

9 In India these vegetables play an important role during the hot season (Grubben, 1977). In 1984, it was estimated that the leaves of amaranth provided at least 25% of the dietary protein intake during the harvest season (National Research Council, 1984). The total dietary fiber ranges fi-om 3% in Mexican samples to 12.9% in those collected fi^om Indian plantings; between 27 and 33% percent of the total dry matter is composed of protein. These leafy vegetables are high in calcium, vitamin A, potassium, vitamin C, and niacin (Paredes-Lopez, 1994). Yields as high as 40 tons of vegetable matter per hectare have been reported, although yields, depending upon the species and location, more commonly fall between 4 and 14 tons/hectare (National Research Council, 1984). The foUage can be harvested within 3-6 weeks of transplanting seedlings and can either be harvested by removing the small plants or several cuttings may be taken fi-om the same plants (Grubben, 1977). High levels of nitrate and oxalate are antinutritional factors associated with these leafy vegetables. Problems arise when a diet is deficient in calcium and high levels of oxalate are consumed. The excess oxalate binds calcium and causes deposition of insoluble calcium oxalate in the digestive, urinary, and blood tracts (Williams, 1993). Nitrates and oxalates are reduced significantly when the leafy vegetables are boiled. Many species of amaranth produce seeds prolifically, with some researchers reporting up to 100,000 seeds per plant (Radford et al., 1968; Walters and Keil, 1977), while others have identified species, such as A. viridus and A. retroflexus L., that can produce fi-om 230,000 to 500,000 seeds per plant (Stevens, 1932). The small seeds are commonly found within the first few millimeters of soil and are stimulated to germinate by common cultivation practices. The rate of seed germination is high

PAGE 20

10 under cultivation, as the flash of light created by the tilling of the soil is enough to increase the germination significantly (Anderson, 1983). Holm et al. (1997) report that researchers have found that a strong exposure to light for 2 seconds is adequate to increase germination of ^. retroflexus seeds from 50%, as obtained in the dark, to 100%. Seeds from these plants may be spread in manure, with crop seeds, and through irrigation systems. The competitive ability of pigweeds and amaranths has been well documented in a number of cropping systems. In com, for example, pigweeds have caused losses in yield as high as 40% (Hohn et al., 1997). Cotton yields may also be affected dramatically by pigweed interference. It has been reported that there is a linear decline in cotton yield if pigweed density is increased from zero to 32 plants per 15 m of row (Buchanon et al., 1980a; Byrd and Coble, 1991; Street et al., 1981). In potatoes (Solarium tuberosum L.), a single redroot pigweed (A. retroflexus) plant per meter of row caused losses as high as 32% of marketable tubers (Murray et al., 1994; Vangessel and Renner, 1990). Due to these characteristics, pigweeds are considered to be among the world's worst weeds (Hohn et al., 1977). Three species in particular have been studied extensively due to their extremely detrimental impacts and wide distributions. Amaranthus hybridus, smooth pigweed, is an agronomic pest in as many as 27 countries, including the United States, Brazil, Argentina, New Zealand, and Mexico. This weed is considered to be a principal problem in crops such as peas (Pisum sativum L.), sugar beets (Beta vulgaris [L.] Beav.), sugarcane (Saccharum officinarum L.), potatoes, wheat {Triticum aestivum L.), and soybeans {Glycine max [L.] Merr.).

PAGE 21

11 Amaranthus spinosus L., spiny amaranth, is also widely distributed, with populations being most troublesome in tropical and subtropical regions. This species has been reported as a major weed problem in more than 40 countries, including the United States, Brazil, Taiwan, and Thailand, and it affects a number of valuable crops, including tobacco (Nicotiana tabacum L.), cotton {Gossypium hirsutum L.), cassava (Manihot esculenta Crantz), upland rice (Oryza sativa L.), mangoes (Mangifera indica L.), sorghum {Sorghum bicolor [L.] Moench), sweet potatoes {Ipomoea batatas [L.] Lam.), and papaya (Carica papaya L.). Amaranthus retroflexus, commonly known as redroot pigweed, is reported as a serious or problematic weed in 32 coimtries. Amaranthus lividus and A. viridus are also broadly distributed and affect crops in more than 30 countries. Amaranthus viridus and A. dubius are considered to be some of the worst weeds in Puerto Rico, where they affect the growth of many fruit crops, as well as beans and garlic (Liu, L-C, personal communication, 1997). In Florida, pigweeds are included in the 10 most commonly found weeds in tobacco, soybeans, cotton, and peanuts (Arachis hypogea L.) (Colvin, 1995). In addition to the problems associated with pigweeds as competitors with economically important crops, there is also documentation of their impact on livestock. Pigweeds can contain high nitrate levels, depending upon the soil fertility and growth stage, and have been implicated in the loss of livestock due to poisoning (Holm et al., 1977). Horses and cattle are most susceptible to this effect, but sheep are reported to be unaffected, although there are some older reports that do not concur with this finding (Holm et al., 1997). In areas where herbicide use is limited by choice, such as in organic production areas, pigweeds may render the land virtually unusable (Figure 1-1).

PAGE 22

12 Traditionally, pigweeds have been controlled using triazine herbicides, which have been extremely effective, but their persistence in the soil, coupled with their extreme selection pressure and highly specific mode of action, have resulted in the emergence of many resistant weed populations (Ahrens et al., 1981; Ahrens and Stoller, 1983; Jachetta, 1979; Vencill and Foy, 1988). These resistant plants were also found to be cross-resistant to a number of other herbicides (Fuerst et al., 1986a; Fuerst et al., 1986b). Amaranthus retroflexus was one of the first species that was identified as exhibiting resistance to triazine-type herbicides (Holm et al., 1997). Currently, there are a nimiber of herbicides that are effective for control of weeds belonging to the genus Amaranthus, although the majority of these are registered for use in cereal crops, turf, and major vegetable crops (Crop Protection Chemicals Reference, 1994; Durghesha, 1994; Fuerst et al., 1986b; Grichar, 1994; Jordan et al., 1994; Krausz et al., 1994; Mekki and Leroux, 1994; Moomaw and Martin, 1985; Wilson et al., 1980); however, they are used predominantly as preplant incorporated treatments. Minor crops, for which there are few herbicides registered for pigweeds, have few options for control of these weeds. Many of the currently registered herbicides for major crops are effective in controlling pigweeds; these include herbicides that have active ingredients such as glyphosate, bentazon, trisulfiiron, metsulfiiron methyl, trifluralin, or imazypyr. Many of these herbicides, however, have problematic issues, such as nontarget effects and toxicity problems. Biirki et al. (1997), in reviewing strategies for control of amaranth, reported on results obtained by Senesav and Minotti, in which three management strategies were compared for distribution and emergence of pigweeds. The three treatments

PAGE 23

13 Figure 1-1. Severe infestation of Amaranthus hybridus L. in a cattle pasture in southeastern Pennsylvania. An infestation of this kind, coupled with a desire on the farmer's part to limit use of chemical herbicides, leaves few alternatives for control of this weed. These factors can render this land virtually unusable.

PAGE 24

14 compared included using clover (Trifolium repens L.) as a living mulch, using a conventional tillage system, and using a no-tillage system. The living mulch reduced the growth of pigweed most significantly. Work by Ammon, reviewed in the same paper, showed that reductions in cultivation also reduced pigweed growth, but not significantly enough to consider cultivation reduction effective as a sole control practice. The conclusion drawn fi-om studies such as these indicates that an integrated management approach is necessary for adequate control of pigweeds and amaranths. The use of biological control agents could contribute to an integrated approach. Amaranth suffers fi-om few limiting diseases, although a number of pests have been reported as occurring on various species. Literature citations on disease problems are scarce and many mentions are brief and vague. The relative scarcity of pathogens may be a result of the production of suspected allelopathic substances (Paredes-Lopez, 1994). Insect pests and a few fimgal pathogens are considered to be the most common. Nematodes occur on amaranth, but are considered minor problems. In Peru, there have been reports implicating phytoplasmas in diseases in amaranth (National Research Council, 1984). Abiotic factors that can affect growth include aluminum and manganese toxicity in marginal soils (National Research Council, 1989). In the United States, it is suspected that air pollution has a significantly detrimental effect on amaranth growth. Insect pests have had more of an impact on amaranth growth than have fiingal, bacterial or viral pathogens. The most common insect pest found on amaranth in the United States is the tarnished plant bug, Lygus lineolaris (Hemiptera: Lygaeidae). Insect pressure from Psara bipunctalis (Lepidoptera) on Amaranthns cruentus has

PAGE 25

15 been heavy enough to result in recommendations to apply chemical insecticides to amaranths grown as crops. In the course of underground txmneling, the African mole cricket {Gryllotalpa gryllotalpa [Orthoptera: Gryllotalpidae]) has a detrimental effect on amaranth growth by breaking through roots (Tindall, 1983). Perhaps the insect pests with the most significant affect are the stem borers. This group appears to have the most impact on amaranth production in Mexico (Sciara spp. [Diptera: Sciaridae]) and in Africa and India (Lixus trunculatus [Coleoptera: Cleoninae]), where some species of amaranths are still utilized as a food source (Grubben, 1977; Sauer, 1967; Tindall, 1983). Fungal pathogens have great potential for limiting growth of amaranths. Although the importance of particular pathogens is dependent upon the location, the pathogens causing damping-off are considered to be most severe. Species of Pythium Pringsh., Rhizoctonia DC, and Fusarium Link.Fr. are most commonly referred to as the causal agents of the observed damping-off (Grubben, 1977; National Research Council, 1984; Paredes-Lopez, 1994), although it appears that P. aphanidermatum (Edson.) Fitzp., P. debaryanum Auct. non R. Hesse and P. myriotylum Drechs. are the most important species involved (Farr et al., 1989; Sealy et al.,1988). Thanatephorus cucumeris (A. B. Frank) Donk. (anamorph=i?Azzoctonm solani Kiihn) is considered to be more prevalent than Fusarium spp. (D. Brenner, North Central Regional Plant Introduction Station, personal communication, 1995). Damping-off is considered to be a major limitation at the seedling stage, but there are no specific estimates of seedling loss due to this disease. Accessions of A. tricolor were found to be the most resistant species to these diseases (Sealy, 1988).

PAGE 26

16 Blight and wet rot caused by Choanephora cucurbitarum (Berk, and Ravenel) Thaxt. are considered to be limiting or potentially limiting to amaranth growth. Choanephora blight is reported on A. cruentus in East Africa as one of the first reported disease problems in the crop there. Symptoms develop rapidly on plants infected with C. cucurbitarum, resulting in a leaf and stem blight that is accompanied by wet rotting. Diseased stems turn dark and brittle and bend downward. This pathogen is also reported from Florida and was first described on amaranth from Sumatra (Teri and Mlasani, 1994). This pathogen can be responsible for mortality of up to 50% of plants in populations where it has been observed. Insect damage can predispose plants to infection by this pathogen. Leaf-spotting fimgal pathogens are considered to be of minor importance in amaranth, but have the potential to cause damage, particularly to the leafy-vegetable types. Cercospora brachiata Ellis and Everh., C. beticola Sacc, and other species of Cercospora Fresen. have been reported from the United States and most other amaranth-growing regions with high humidity and rainfall for dissemination of the pathogen (Alfieri et al, 1984; Farr et al., 1989; Tindall, 1983). Several other fimgal pathogens are reported as being potentially harmfiil to amaranth growth. These include Macrophoma (Sacc.) Berl. and Voglino. sp.. Albugo blitii (Biv.-Bem.) Kuntz, and Alternaria amaranthi (Peck.) Van Hook. Macrophoma sp. causes stem black spot and could cause toppling, although there is only one reference to this disease (Paredes-Lopez, 1994). Albugo blitii is the causal agent of white rust and has been recognized on a wide range of species throughout the United States as well as Mexico, although it does not appear to cause any significant damage

PAGE 27

17 (Wellman, 1977; Farretal., 1989; Alfierietal., 1984). Altemaria amaranthi has been reported throughout the United States and also has been reported from A. cruentus in Tanzania (Teri and Mlasani, 1994). Two species of Meloidogyne may be limiting factors to amaranth growth. Meloidogyne javanica has been reported as a problem in cultivated A. viridus, and M. javanica and M. incognita have been reported on A. hybridus (Luc et al., 1990). Root-knot nematodes may cause symptoms that range from small galls on otherwise normal roots to causing the formation of only a few severely galled roots with few or no rootlets and a disorganized vascular system. The more severe symptoms include wilt (from a loss of turgor pressure), chlorosis, and reduced flowering. It is imclear what race of M. incognita infects amaranth. In addition to the reports of root knot nematodes, Cactodera amaranthi is reported to be a sporadic and minor pest of vegetable amaranths in Mexico. Radopholus similis has been reported from A. viridus in the Ivory Coast, although it is not an important concern. Pratylenchus zeae has been reported to infect A. spinosus (Lucetal., 1990). A bacterial disease of ^4. viridus, caused by Xanthomonas campestris pv. amaranthicola (Patel, Wankar, and Kulkami) Dye was reported from India in the early 1950s. Although it was indicated that the bacterium could be fransmitted to other weed species and to A. caudatus, no fiuther mention of the pathogen exists (Bradbury, 1986). Although a number of viruses have been reported to be mechanically transmissible to Amaranthus spp., there is only one that appears to have an effect on

PAGE 28

18 the growth of the minor vegetable species. Amaranthus mosaic potyvirus has been reported to cause mild to severe mosaic symptoms on A. lividus and A. viridus in India Both old and young leaves appear mottled. The natural mode of transmission is unknown (Brunt et al., 1990). Something referred to as mosaic mottle has been reported from Peru, while a virus streak disease of amaranth has been reported from Brazil (Welhnan, 1977). The number of pathogens and nematodes that infect amaranths contributes to the need for their confrol. In addition to limiting crop production by direct interference with crops through competition, there is the possibility of contributing to existing crop disease problems through harboring of plant pests. The host ranges of some of the pests reported as occurring on amaranth are so wide that the presence of pigweeds in most crops could prove to be a detriment. Thanatephorus cucumeris causes a limiting disease in many of the same crops, including cotton, soybeans, com, lettuce, tomato, and peanuts, in which pigweeds are reported as a froublesome weed. Pigweeds, thus, may serve as between-season or over-wintering hosts that allow for continued disease pressure, even when crop rotation is used. Although there are many pathogens that may be considered as potential biological confrol agents, only one has been previously considered. A stem and leaf blighting pathogen, Microsphearopsis amaranthi (Ell. and Berth.) Heiny and Mintz was evaluated for its potential to confrol tumble pigweed {A. albus L.). The importance and distribution of this species is relatively limited and the pathogen was not found to be efficacious on other pigweed species (Heiny et al., 1992; Mintz et al., 1992). hi a review by Bifrki et. al. (1997), a number of insects with potential are

PAGE 29

19 reported. Vogt and Cordo (see Biirki et. al. [1997)) have studied several species, including Disonycha glabrata Fabricius (Coleoptera: Chrysomelidae), the pigweed flea beetle, which has been released in several states in the United States (Biirki et. al.,1997). This species is being further considered as a biological control agent for Amaranthus retroflexus. Other species that have been released or are being considered for further development include Epicauta leopardina Haag (Coleoptera: Meloidae), Melanagromyza amaranthi Spenc. and Havr. (Diptera: Agromyzidae), and Hypolixus truncatulus Fabricius (Coleoptera: Curculionidae). Research Rational The importance of the species belonging to the genus Amaranthus spp. as competitive weeds in many agricultural and pasture situations, coupled with their worldwide distribution, has made pigweeds and amaranths serious targets in weed management programs across the globe. These weeds have excellent reproductive potential and present a major concern as more species and populations are discovered to be resistant to the most efficacious chemical herbicides. A potential alternative control method, that could be combined with existing methods, would be the use of a fungal plant pathogen in an integrated approach.

PAGE 30

CHAPTER II CHARACTERIZATION OF PHOMOPSIS AMARANTHICOLA sp. nov. Introduction In 1992, a pycnidial fungus isolated from diseased amaranth plants, was found to be the causal agent of the observed stem and leaf blight. Greenhouse inoculations revealed that the disease caused by this organism began as leaf lesions, which expanded, coalesced, and moved to the leaf petiole, causing premature leaf abscission. These symptoms were observed within 5 days of inoculation (Figure 2la). Symptoms then appeared on stems, with lesions girdling the stem, causing stem constriction and toppling of plants (Figure 2-lb). The severity of the symptoms observed in the field and then reproduced in subsequent inoculations warranted further investigation of the fungus as a potential biological control agent for pigweeds and Amaranthus spp. An examination of the literature revealed several pycnidial fungi that have been reported as infecting various species of Amaranthus L. Phoma amaranthi Brun. was first reported from ''Amaranthi albi" (Saccardo, 1884). This fungus has since been reported from Amaranthus chlorostachys Willd. in New Jersey. Phoma amaranthicola Brun. was originally reported from ''Amaranthi spinosi" and since has been reported from Amaranthus graecizans L. auctt., non L. from Oregon (unpublished USD A compilation of herbarium specimens provided by Dr. A. Rossman, Beltsville, MD). An unidentified species of Phoma Sacc. also has been reported as causing stem necrosis of an Amaranthus sp. in Florida (Alfieri et al., 1984). 20

PAGE 31

Figure 2-la-b. Leaf lesions and stem lesions on Amaranthus hybridus L. resulting from inoculation with Phomopsis amaranthicola.

PAGE 32

22 The description of the genus Phoma Sacc, as documented in Sutton (1980), is as follows: Mycelium immersed, branched, septate, hyaline or pale brown. Conidiomata pycnidial, immersed, or semi-immersed, sometimes becoming erumpent, unilocular, brown, globose, separate or aggregated, occasionally confluent, thin-walled (in P. lingam becoming thick-walled and pseudosclerenchymatous); walls of thin-walled, pale to medium brown textura angularis. Ostioles single or several to each pycnidium, central, not papillate. Conidiophores only present in P. cava and P. tracheophila and then either filiform, septate, and branched, or short, irregularly branched, and ramified respectively. Conidiogenous cells enteroblastic, phialidic, integrated or discreet, ampuUiform to doliform, hyaline, smooth, collarette and aperture minute, periclinal wall markedly thickened. Conidia hyaline, aseptate or occasionally 1 septate, thin-walled, often guttulate, ellipsoid, cylindrical, fiisiform, pyriform or globose. The description Phoma amaranthi Brun., as documented in Saccardo's Sylloge Fungorum (1895), reads as follows: Phoma amaranthi Brun. Champ. Charente Infer. 1892, p. 34. Peritheciis sparsis v. confertis, minutis, globuloso-depressis, nigris, erumpentibus, basidiis nullis; sporulis oblongis, utrinque rotundatis, hyalinis, 2-guttulatis, 78x3. Hab. as truncos emortuos Amaranthi albi, Charente Inf., Galliae. The description Phoma amaranthicola Brun., as documented in Saccardo's Sylloge Fungorum (1895), reads as follows: Phoma amaranthicola Bmn. Champ. Charente Infer. 1892, p. 34. Peritheciis confertis, minutis, brunneo-nigris, globosis, parum depressis, perforatis, obtectis dein erumpentibus, sporulis oblongis, griseo-hyalinis, minutis, 2-3 x 1.5-2. Hab. as truncos emortuos Amaranthi spinosi, Charente Inf Galliae. In addition to the pycnidial fimgi, a single report of a species of Diaporthi infecting Amaranthus comes fi-om Argentina. Diaporthe amaranti, described by Spegazzini as a new species, was isolated from Amaranti chlorostachydis (Spegazzini, 1909). There is no mention of an anamorphic stage in this report and this organism does not appear again in the literature.

PAGE 33

23 The description of Diaporthe amaranthi Speg., as a new species is as follows: Diag. Euporthe, parva, matrice nigrificata hinc inde gregaria subseriata, vix ostiolato-producta, ascis sporisque minoribus. Hab. Ad caules putrescentes Amaranthi chlorostachydis in dxv\sW\\\2iCd&i\6iii,in\. 1905. Obs. Matrix hinc inde extus late sordideque infiiscata, intus subdealbata linea nigra angusta sinuosa percursa; perithecia in maculis gregaria relaxata v. conferta, matrici infossa, globulosa (120-150^m), tenui membranacea olivacea, sursiun prominula atque ostiolo carbonaceo saepius breviusculo armata; asci fusoidei, a strato proligero mox secedentes (45-50|a x 8fi), aparaphysati octospori; sporae distichae ellipticae medio 1-septato-constrictae, loculis subaequalibus hyalinis grosse biguttulatis (10-12fi x A\i). A single species of Phomopsis (Sacc.) Bubak has been reported as infecting amaranth. This species, P. amaranthi Ubriszy and Voros was reported from Himgary from Amaranthus retroflexus L. The &QScrvi>i\on Phomopsis amaranthi n. sp. by Ubriszy and Voros (1966), follows: Pycnidia sparsa vel seriata, depresso-ellipsoidea, immersa dein papilla nigra emergentia, contextu dilute brunneo circa porum obscuriore, 300-600 x 200300 micra. Conidia 1. ovali-fiisoidea, hyalina, biguttulata, attenuata, 6.7-9 x 2.7-3.6 micr., 2. fiUformes, curvata 18-27 x 0.5-1.5 micr. magna. Conidiophora 18-20 x 0.5-0.8 micr. -Hab. in stipitibus emortaxs Amaranthi retroflexi. Based on preliminary observations, the Florida isolate from Amaranthus sp. was tentatively identified as a member of the genus Phomopsis. The description of the genus Phomopsis, as docimiented in Sutton (1980) is as follows: Mycelium immersed, branched, septate, hyaline to pale brown. Conidiomata eusfromatic, immersed, brovra to dark brown, separate or aggregated and confluent, globose, ampuUiform or applanate, unilocular, muhilocular or convoluted, thick-walled; walls of brown, thinor thick-walled texturis angularis, often somewhat darker in the upper region, lined by a layer of smaller-celled tissue. Ostiole single, or several in complex conidiomata, circular, often papillate. Conidiophores branched and septate at the base and above, occasionally short and only 1-2 septate, more frequently multiseptate and filiform, hyaline, formed from the inner cells of the locular walls. Conidiogenous cells enteroblastic, phiahdic, determinate, integrated, rarely

PAGE 34

24 discrete, hyaline, cylindrical, aperaUires apical on long or short lateral and main branches of the conidiophores, collarette, channel and periclinal thickening minute. Conidia of two basic types, but in some species with intermediates between the two: a condia hyaline, fusiform, straight, usually biguttulate (one guttule at each end) but sometimes with more guttules, aseptate; P conidia hyaline, filiform, straight or more often hamate, eguttulate, aseptate. The form-genus Phomopsis belongs in the form-family Sphaeropsidaceae, which is included in the form-order Sphaeropsidales in the form-class Coelomycetes (Sutton, 1980). Uecker reports the name Phomopsis was used by Saccardo in 1881 as an infrageneric label of unspecified rank, using it as Phoma {Phomopsis) versoniana. In 1883, the name was used, again by Saccardo, to indicate a generic name, Phomopsis cucurbita (Uecker, 1988). Phomopsis was then proposed as the name of a subgroup of Phoma species that produced beta conidia and were known to have a Diaporthe teleomorphic stage (Saccardo, 1884). However, no species were included in this division, and therefore, it was not considered to be a valid name. According to Uecker, Hohnel in 1903, named the genus Myxolibertella, into which he placed three species. This became the first legitimate generic name for what is now called Phomopsis. Saccardo placed several other species into the genus Phomopsis and in 1905 transferred the three species listed by Hohnel as Myxolibertella into the genus Phomopsis (Uecker, 1988). It was not until 1981 that Reidl et al. proposed conservation of the name Phomopsis, which was accepted by the International Botanical Congress in 1987. Phomopsis lactucae (Sacc.) Bubak was designated the lectotype (Riedl and Wechtl, 1981), but there is still controversy concerning the acceptance of this species as the lectotype (Sutton, 1980).

PAGE 35

25 A number of Phomopsis species and the associated Diaporthe Nitschke. teleomorphs are known to cause a variety of diseases (Balducchi and McGee, 1987; Fan et al., 1989; Killebrew, 1993; Uecker, 1988; Uecker and Johnson, 1991; Uecker and Kuo, 1992; Yesodharan and Sharma; 1987). Species are also known to be saprophytic, endophytic, or weakly pathogenic. Those that are considered to be plant pathogens are thought to be host specific, and this has been used as a character for speciation. One example of an endophj^c species is Phomopsis oblonga (Desmaz.) Traverso, which has been found as a natural inhabitant of healthy elm trees in England. It has been shown that this fimgus serves to limit the breeding of the Ceratocystis ulmi-canying bark beetle and may be responsible, in part, for slowing the spread of Dutch ehn disease in some areas (Webber and Gibbs, 1981). Many species of Phomopsis have been important to forest pathology as well (Grove 1935, 1937; Hahn, 1930). Symptoms produced in diseases caused by Phomopsis spp. include canker, seed decay, stem-end rot, root rot, fruit rot, wilt, leaf spots, and bark necrosis (Uecker, 1988). Approximately 65 species of Phomopsis are considered to be plant pathogenic, of which approximately 30 are found in the United States. The identification of species in this genus, based primarily on morphological characteristics is hindered by character plasticity. Difficulty with identification is also compounded due to teleomorphic associations with Diaporthe spp. being known for only about 20% of the named species. Evidence that host association is inadequate for speciation in this genus was provided by Brayford in 1990, who showed that Phomopsis occurring on twigs and bark of Ulmus L. in the United Kingdom and other

PAGE 36

26 parts of Europe belonged to different morphological and genetic groups. Both groups were isolated from a variety of tree species, showing that more than one species could be found on a single host and more than one host could support a single species. Toxin production by members of the genus Phomopsis has been a topic for several research projects, and at least two secondary metabolites have been partially characterized (Culvenor et al., 1989; Li et al, 1992; Luduena et al., 1990). Phomopsis leptostromiformis (Kuhn) Bubak var. leptostromiformis Shivas, Allen, and Williamson and Phomopsis leptostromiformis (Kuhn) Bubak var. occidentalis Shivas, Allen, and Williamson produce secondary metabolites that have been shovm to be responsible for lupinosus in livestock (Peterson et al., 1987; Toesing et al., 1984). No other species of Phomopsis have been reported as causing diseases in mammals. Species of Phomopsis characteristically produce two types of conidia, referred to as a conidia and P conidia. A few species of Phomopsis are reported to have a third type of conidium. Three species reported to have the third type of conidium, called the C conidium, are P. hordei Punith., P. oryzae Punith., and P. phyllanthi Punith.; these species were isolated from Hordeum vulgare L., Oryzea sativa L., and Phyllanthus L. spp., respectively (Punithalingam, 1975). With the exceptions of Phomopsis sojae Lehman (Jensen, 1983; Luttrell, 1947), P. phaseoli (Desmaz.) Sacc. (Kulik, 1988), and P. helianthus Munt.-Cvet., Mihal., and Petrov. (Muntanola-Cvetkovic et al., 1985), little work has been done toward determining the role that the spore types play in disease development. Beta conidia have been considered to be nongerminating (Muntanola-Cvetkovic et al., 1985), but in some species they are the only spore type observed (Muntanola-

PAGE 37

27 Cvetkovic et al., 1985; Uecker, 1988). As is the case with other Phomopsis spp., the P-conidia production is influenced by the nutritional components of the medium. Study of Phomopsis helianthus revealed that P conidia were capable of germination, but the germination resulted in mycelial strands that did not survive to produce colonies (Muntanola-Cvetkovic et al., 1985). Several species oi Phomopsis have been considered as potential biological control agents (McPartland, 1983; Morin et al., 1990a,b; Shivas, 1991). Phomopsis convolvulus Ormeno has been evaluated for the control of field bindweed {Convolvulus arvensis L.) (Morin et al., 1990a,b; Ormeno et al., 1988) and Phomopsis emicis Shivas has been evaluated for control of Emex australis Steinheil (Shivas, 1991). Phomopsis subordinaria (Desmaz.) Traverso, which has been evaluated for the control of plantain (Plantago lanceolata L.) has been examined by using isozyme characterization and randomly amplified polymorphic deoxyribonucleic acids (RAPD) (deNooij and van Damne, 1988; Meijer et al., 1994). Rehner and Uecker (1994) attempted to relate fungal species with host association through the amplification and sequencing of the internal transcribed spacer (ITS) regions of the ribosomal DNA. Their work resulted in three groups based on the ITS phylogeny. Group A consisted of two sub-clades. High similarity of one sub-clade, referred to as Al, if viewed as a single species, could be indicative of a broad host range, including plants belonging to the genera Paulownia Siebold and Zucc, Epigaea L., Kalmia L., Comus L., Tsuga Carriere, Lindera Thunb., Vaccinium L., and Picea Dietr., to name a few. Members of the second sub-clade, A2, were all associated with cultivated

PAGE 38

28 Vaccinium spp. Group B, with the exception of a single isolate, originated from southern temperate to fropical regions and produced elongate paraphyses in the conidiomata. Isolates in Group C were obtained from a wide range of herbaceous cultivated plants. Results of this study suggest that there is a great deal of variation within the genus that could be attributed to geographical distribution. Comparison of the ITS sequence data within species complexes in other ftmgal groups reveal differing levels of mfraspecific and interspecific divergence. Anderson and Stavoski (1992) found that among northern hemisphere Armillaria (Fr.) Staude spp., ITSl sequences were nearly identical; the species tested, however, could be differentiated on the basis of infertility tests, morphological characters, and other molecular criteria. Carbone and Kohn (1993) found similar results with species of Sclerotium Tode:Fr. Vilgalys and Sun (1994), and O'Donnell (1992) reported divergent ITS types for Pluerotus (Fr.) Kummer spp. and Fusarium sambucinum Fckl., respectively. In a recent study by Berthier et al. (1996), the ITS polymorphic restriction patterns of the DNA of the biological control agent Puccinia carduorum Jacky were found to be distinct for P. carduorum from Carduus acanthoides L. and C. thoermeri Weinmann when compared to those of the same ftmgal species isolated from C. tenuiflorus Curtis and C. pycnocephalus L. Harrington and Potter (1997) found that the phylogeny of the ITS region corroborated species delimitation based on the morphological characteristics of members of the genus Sarcoscypha. Choice of the ITS regions for species differentiation can lead to missing species matches due to the occiurence of species that exhibit significant intraspecific variation within these regions. Some authors support the use of the intergenic spacer regions or the 28s rRNA for species differentiation (Egger, 1992; HiUis and Dixon, 1991).

PAGE 39

29 Materials and Methods Isolate Identification and Morphological Characterization Initial isolation and tentative identification of the isolate were performed by Dr. Yasser Shabana. Dr. Shabana performed the preliminary fulfillment of Koch's postulates. Isolates were stored on potato dextrose agar (PDA) slants and in soil tubes (Dhingra and Sinclair, 1995). Single-spore isolates were recovered firom slants and soil tubes by plating onto PDA. The details of the original isolation did not indicate the spatial or temporal relationships among the isolates. Several of the available specimens were initially grown out. Those that grew were separated into two groups, consisting of A, B, C, D, and E, and 1, 2, 3, 4, and 5, depending upon whether they had been grown fi-om isolates marked as originating firom alpha or beta conidia, respectively. While originally viable, isolates derived fi-om p conidia grew erratically. Isolates 3-5, derived from p conidia, as well as a single subculture of the a-derived culture B, and isolates D and E, were lost in culture. These materials were tested for the presence of double-sfranded RNA (Seroussi et al., 1989), but due to the difficulty in culturing the isolates, the results from this study were not conclusive. Isolate B, having consistent growth in all other subcultiures, was used for morphological character determination, although all remaining isolates were grown on PDA and V-8 agar (Dhingra and Sinclair, 1995), which was composed of 200 ml of V-8 juice, 3 g of calcium carbonate, and 14 g of agar. This was done to determine whether all isolates produced the same types of conidia. Plates were initiated using a 5-mm^ mycelial plug taken from 10-day-old PDA cultures. Plates were then incubated at 25C+/2C

PAGE 40

30 with a 12-h light cycle. Spores were harvested from plates using 10 ml of sterile deionized water per plate and gentle scraping with a rubber policeman. Isolate B was used for the remaining work. A hemacytometer was used to make the counts of conidia. Data taken included proportions of each type of conidium and measurements of conidia. Conidial germination was evaluated by placing a thin coating of PDA onto a sterilized glass slide. A droplet of a conidial suspension, obtained from plates in the same manner as above, was placed onto the PDA and a sterilized cover slip was placed on top. The slides were allowed to incubate for 20-24 h on the bench top and the proportions of germinating conidia were pooled with the spore germination data obtained directly from the suspensions. A conidial suspension containing all three types of conidia was also plated into water agar (Fisher Scientific, Fairlawn, N J) to attempt to regenerate colonies from single conidium isolations. The dimensions of pycnidia were measured at the first sign of sporulation. Measurements were also made of conidia and pycnidia taken from inoculated A. hybridus L. tissue that was allowed to senesce and dry slightly to induce pycnidial formation, as had been observed in the field. Stem pieces with pycnidia were placed in moist chambers to induce sporulation. In an attempt to induce a perithecial state, infected tissue samples were allowed to dry and were stored in sand or soil, at both 4C and at 30C, in the absence of hght. The available isolates were also paired on PDA and V-8 agar plates. The physical dimensions of conidia were measured using cultures of the Florida amaranth isolate B grown on PDA and from diseased plant tissue. Samples were obtained from 1to 2week-old colonies from plates that were incubated at 25C +/-2C.

PAGE 41

31 Four samples of conidial droplets from each of five replicate cultures were used. Droplets were moimted on glass slides in a drop of water and conidia were measured in two randomly chosen fields until measurements of 100 of each type of conidium were taken. C conidia were sparse and all of the C conidia that could be found in each field were measured. Isolates were grown on artificial growth media, including PDA, V-8 agar, com meal agar (CMA), oatmeal agar (OMA), com infusion agar (CIA), and amaranth-infusion agar (AIA) for comparison of growth characteristics. The PDA, CMA, and OMA were obtained from Difco Laboratories (Detroit, MI). Amaranth infusion agar and com infusion agar were prepared by boiling approximately 50 g of amaranth leaves and stems or com kemels in 500 ml of deionized water for 30 minutes. Two hundred milliUters of the strained exfract were added to 800 ml of deionized water containing 14 g of Fisher Scientific agar. Media were sterilized by autoclaving. The following isolates, obtained from symptomatic tissues of accessions of Amaranthus spp. were compared for growth of mycelium and spore production: 75A, 72A, and 72B provided by Dr. Charles Block of the North Centi-al Regional Plant Inti-oduction Station, Ames, Iowa; EG from Belle Glade, Florida; FPl and FP3 from Fort Pierce, Florida; AI from Immokalee, Florida; and BRZ from Jaboticabal, Sao Paulo, Brazil. Each isolate was ti-ansferred onto six petii plates of each growth medium. Plates were inoculated using a 5-mm^ mycelial plug from cultures grown on PDA. Days required for pycnidial formation and spore types produced were noted. Specimens were prepared for microscopic examination by placing pycnidia on a glass slide to which either 3% KOH solution or a deionized water droplet was added. The specimens treated with KOH were allowed to remain in the solution for

PAGE 42

32 approximately Sminutes and then the pycnidium was chrushed with the eraser end of a pencil. The KOH was then wicked off with a towelette and replaced with lactophenol. Separation of spore types was performed using filtration through 10-micron and 1 -micron mesh filters. Suspensions of conidia were prepared by flooding 14-dayold V-8 agar plates that had been prepared as above. The surface of the plates were gently scraped to remove spores. The suspension was then filtered through the mesh. Spores were separated by glycerol gradient centrifligation with gradients of 50%, 30%, and 10%; and 40%, 30%, 20%, and 10%. Each glycerol solution was layered into a 15-ml centrifuge tube at a volume of 3 ml. Tubes were centrifuged at 5,000 g for 5 minutes and then punctured at each visible layer, starting fi-om the top most layer. Three samples, of approximately 100 yil each, were removed fi-om each layer using a Pasteur pipette. Specimens were prepared for scanning electron microscopy by the method of Nation (1983 a, b), using hexamethyldisilazane as the drying agent. Specimens were examined with a Hitachi S4000 scanning electron microscope at the University of Florida Interdisciplinary Center for Biotechnology Research Electron Microscopy Laboratory. Host Range Testing Host range testing of Phomopsis amaranthicola was performed using the centrifugal phylogenetic scheme (Wapshere, 1974) wi\h Amaranthns hybridus as the focal plant. The first phase of testing included 33 biotypes belonging to 22 known species and two unknown species oi Amaranthus obtained fi-om the North Central

PAGE 43

33 Table 2-1. Effect ofPhomopsis amaranthicola on Amaranthus L. spp^ Origin Percent Incidence r erceni ivionaniv A. acutilobus Germany 100 100 A alhwi Germany 100 y4 (lu'ttrn.li'i USA-FL 31 n u A australis Alt Iftil^Li til X^t-lrLJ USA-FL 39 A U A hlitnidp'i Germany 100 A. caudatus Argentina 100 28 USA 94 28 Czechoslovakia 100 A. cruentus Mexico 84 n A. cruentus USA-AR 100 A. cruentus USA-ME 100 A. cruentus Mexico 84 17 A delflexus Germany 100 O / A duhius Ghana 67 n A duhius Jamaica 100 u A floridanus USA-FL 23 0 A. graecizans USA-IA 100 50 A. hybridus Argentina 100 18 A. hybridus Ecuador 89 50 A. hybridus USA-PA 100 26 A. hybridus Zimbabwe 78 8 A. hybridus USA-IN 100 56 A. hybridus USA-AR 100 56 "Results were recorded five weeks after inoculation. Data are the average of three replicates combined fi-om each of two trials.

PAGE 44

34 Table 2-1 continued. Ori (Tin rerceni Monaiirv PTnnQ IT r\ Tier 1 C\f\ iUU JJ.IiiJ.Ct mo oO /, jJciifTit^ri inn U TNA-TA inn jy A 'nn'\A}£>1ii vjciiiictiiy inn O/l UOOIv 100 iUU A /luiyit^yyi C7 c inn DU lliu.la. inn JO TISA-rA 100 1 nn A y^tf/lT/^^YUV jX / t^tf L/J I l4ij TTC A-TA 1 on 42 tt<;a tt 1 nn 89 /t, mirojiKixus TT
PAGE 45

35 Regional Plant Introduction Station in Ames, Iowa (Table 2-1). Plants were grown from seed and then were transplanted to clay pots with three plants per pot. Each accession was planted to six pots and three were used as controls and three pots of each accession were inoculated with conidia of P. amaranthicola. Conidial suspensions contained 1 million conidia per ml amended with psyllium mucilloid at 0.5% (m:v). Suspensions were spray-inoculated onto plants using a hand-held pump sprayer. Control plants were sprayed with a suspension containing psyllium mucilloid (Metamucil, Proctor and Gamble, Cincinnati, OH) alone. Inoculated and control plants were then placed in a dark dew chamber for 24 h at 28C +/2C. After the dew period, plants were placed in the greenhouse and observed for symptom development and mortality for 5 weeks. The second phase of testing involved the inoculation of additional weed, crop, and omamental species chosen on the basis of a close relationship to the genus Amaranthus, the report of an association of the plant with another species of Phomopsis or Diaporthe, or a crop in which Amaranthus spp. are a problem and therefore may be a crop in which P. amaranthicola might be utilized. Plants in this phase of testing were treated in the same way as in the previous phase. In addition, tissue was taken from each of the freated plants and plated onto PDA to determine if there could be a quiescent infection. Tissues were surface sterilized using 10% sodium hypochlorite. A listing of the species tested and their reactions are listed in Table 2-2. Amaranthus hybridus plants were included in each phase of the testing to ensure the viability and infectivity of P. amaranthicola in suspensions used for inoculation.

PAGE 46

36 Table 2-2. Plant reactions in the host range test of Phomopsis amaranthicola' Family Genus species Reac tion'' Apiaceae Daucus carrota (L.) subsp. sativus Hoffin. I Amaranthaceae Altemanthera philoxeroides (L.) R. Brown I Celosia argentea L. I Celosia argentea L. var. cristata (L.) Kuntze I Iresine rhizomatosa Standley I Froelichia gracilis (Hooker) Moq. I Gomphrena globosa L. I Apocynaceae Vinca minor L. I Asteraceae Helianthus giganteiis L. I Lactuca sativa L. I Lactuca sativa L. var. longifolia Lam. I Achillea millefolium L. I Achillea ptarmica L. I Brassicaceae Brassica juncae (L.) Czem. I Cactaceae Opuntia compressa (Salisbury) Macbride I Campanulaceae Lobelia inflata L. I Caryophyllaceae Stellaria media (L.) Cyrillo I Lychnis alba Miller I Saponaria officinalis L. I Silene stellata (L.) Alton F. I Dianthus armeria L. I Dianthus barbatus L. I Chenopodiaceae Chenopodium album L. I Atriplex patula L. I Beta vulgaris L. I Spinacia oleracea L. I Kochia scoparia Roth I Reactions were recorded from three replicates of each inoculated plant species. Two trials were performed using a number of available varieties, represents an immune reaction.

PAGE 47

37 Table 2-2 continued. Family Genus species Reaction Cucurbitaceae Cucurbita pepo L. I Cucurbita maxima Duchesne I Cucurbita moschata (Duchesne) Duchesne ex. Por. I Cucumis melo L. var. cantalupensis Naudin I Cucumis sativus L. I Citrullus lanatus (Thunb.) Matsum. and Nakai I Fabaceae Glycine max (L.) Merr. I Senna obtusifolia (L.) H. S. Irwin and Bameby I Pisum sativum L. I Pisum sativum L. var. macrocarpon Ser. I Phaseolus vulgaris L. I Vicia faba L. Lamiaceae Salvia farinacea Benth. I Salvia officinalis L. I Salvia splendens Sellow ex Roem. and Schult. I Plectranthus L'Her. sp. I Liliaceae Allium cepa L. I Malvaceae Abelmoschus esculentus (L.) Moench I Poaceae Pennisetum glaucum (L.) R. Brown I Triticum aestivum L. I Sorghum bicolor (L.) Moench I Zea mays L. I Solanaceae Lycopersicon esculentum Mill. I Capsicum annum L. I Capsicum frutescens L. I Nicotiana tabacum L. I Solanum melongena L. I Verbenaceae Verbena brasiliensis Vellozo I Verbena hastata L. I Reactions were recorded from three replicates of each inoculated plant species. Two trials were performed using a number of available varieties, represents an immune reaction.

PAGE 48

38 DNA Extraction. Amplification, and Sequence Analysis The following isolates were grown in liquid potato-dextrose broth shake cultures: B (ATCC# 74226) from Gainesville, FL; FPl and FP3 from Fort Pierce, Florida; 75 A from Ames, Iowa; MA, Microsphaeropsis amaranthi (Ell. and Barth.) Heiny and Mintz provided by G. A. Weidemann, University of Arkansas, Fayetteville, AR; Pho, Phoma medicaginis Malbr. and Roum. (ATCC# 52798); and PO, Phomopsis oryzae (IMI# 158929). Specimens of P. hordei (IMI 128344 Ex Type) and P. phyllanthi (IMI 95131 Ex Type) were available only as preserved herbarium specimens and were not included in the molecular characterization. These isolates were to be amplified by the method described in Taylor and Swann (1995), but the specimens did not have adequate material for DNA extraction. Two hundred fifty-milliliter flasks containing 50 ml of PDB were inoculated with three, 5-mm^ mycelial plugs from 10-day-old PDA cultures of each of the isolates derived from single-spore cultures stored at 9C. After 7-10 days of growth in shake culture, the contents of the flasks were filtered through sterile cheesecloth, squeezed dry, and rinsed three times with sterile deionized water. Mycelium was then placed into 13-ml plastic tubes, stored for 24 h in a -80C freezer, and lyophilized for 24-48 h. The dry mycelium was then mixed with liquid nitrogen, ground to a fine powder, and combined with DNA extraction buffer consisting of a 1 : 1 :0.4 volume of Nuclei Lysis Buffer (0.3 M Sorbitol, 0.1 M Tris, and 20 mM EDTA, at pH 7.5), DNA isolation buffer (0.2 M Tris at pH 7.5, 50 mM EDTA, and 0.2 mM hexadecyltrimethylammonium bromide [CTAB]) and 0.5% Sarkosyl (Koenig, 1997).

PAGE 49

39 Ten milliliters of the extraction buffer were combined with approximately 1 g of ground mycelium in 15-ml tubes, and the tubes were placed in a 65C water bath for 60 minutes. The contents of the tubes were then mixed by inversion, and 1 ml of solution was transferred to a sterile, 1.5-ml microcentrifuge tube. Five himdred microliters of chloroform:octanol (24:1) solution were added to each tube. The solution was mixed thoroughly by inversion. The solution was then centrifuged for 10 minutes at 12,000g in a microcentrifuge at room temperature. The supernatant was transferred to sterile 1.5-ml tubes and treated with 5 |a.l of a suspension containing 20 mg RNAse (Sigma Chemical Company, St.Louis, MO) per ml for 30 minutes at 37C. Following the RNAse treatment, 5 |il of a suspension of 20 mg Proteinase K (Sigma Chemical Company, St. Louis, MO) per ml were added and allowed to remain in solution for 20 minutes at 37C. One volume of ice-cold isopropanol was then added, and the tubes were shaken until the DNA was visible as a white precipitate. After 60 minutes in a -20C freezer for 60 minutes, the tubes were centrifuged at 10,000 g for 5 minutes and the DNA pellet was washed with 100 ^il of 70% ethanol three times. Due to the viscosity of the DNA pellet obtained, the crude pellet was dissolved in TE buffer containing 2M NaCl and reprecipitated in two volumes of ethanol. The DNA was then pelleted and the tubes were allowed to dry. The pellet was then resuspended in 100 \xl of TE buffer (10 mM Tris, 1 mM EDTA). Samples were then placed at 4C until the DNA was dissolved. The methods described here are a modified version of the DNA extraction method used by Koenig(1997). The concentration of DNA in the samples was estimated by running 3 |il of each sample on an agarose gel containing 1 )j,l of ethidium bromide per ml of gel along with a

PAGE 50

bacteriophage Lambda DNA concentration standard (Gibco-BRL, Gaithersburg, MD), and making visual comparisons based on the relative fluorescence of the samples compared to the standards using UV light. Approximately 100 ng of template DNA per 100 fil reaction mixture were used in symmetric PCRs. The internal transcribed spacer regions (ITS) of the nuclear ribosomal repeat were analyzed using primers ITS4 and ITS5 (White et al., 1990; Bruns et al., 1991); the sequences are hsted in Table 2-3. These primers take advantage of the conserved regions of the 18s and 28s nuclear rRNA genes to amplify the noncoding regions between them. The primers were synthesized at the University of Florida Interdisciplinary Center for Biotechnology Research Oligonucleotide Synthesis Laboratory (Gainesville, FL). Polymerase chain reactions were performed using final concentrations of the components in the reaction mixture as follows: 20 mM Tris-HCl (pH 8.4); 50 mM KCl; 1.5 mM MgC12; 1 \iM of each primer; 200 |iM each of dATP, dCTP, dGTP, and dTTP; and 2.5 U of Taq polymerase (Gibco-BRL, Gaithersburg, MD) per 100 \il of reaction mixture. A GenAmp 6000 (Perkin-Elmer Applied Biosystems, Foster City, CA) was used for the amplification. The cycling conditions used included an initial denaturation step of 2 minutes at 94C, with 32 cycles of 94C for 45 seconds, 55C for 30 seconds, and 72C for 45 seconds each. The last cycle included a 10-minute incubation at 72C and then storage at 4C. Unincorporated nucleotides and primers were separated from double stranded PGR products using Wizard PCR Preps (Promega Inc., Madison, WI) according to the manufacturers instructions. Sequences, provided by the University of Florida Interdisciplinary Center for Biotechnology Research DNA Sequencing Laboratory, were aligned manually. Phylogenetic analyses were performed using PAUP version 3.1.1 (Swofford, 1993). The positions in the alignment were used as

PAGE 51

41 uniformly weighted characters; single gaps were treated as missing characters; and regions that could not be aligned or regions with large, continuous gaps were excluded from the analysis (Appendix A). The analysis was based on informative characters only. Microsphaeropsis amaranthi was used as the outgroup. The first analysis included 24 sequences, 13 chosen from those deposited in GenBank by Rehner and Uecker (1994), and three deposited by Udin (1996), which were chosen based on a wide range of host associations. The first analysis was performed using 1000 repUcate heiuistic searches with random sequence addition. Support for groupings was determined by bootstrapping of 500 replicate data sets, unless noted, using random input of sequences and by the decay indices using Treerot (Sorenson, 1996). Results Isolate Identification and Morphological Characterization Symptoms produced on Amaranthns hybridus that were spray-inoculated with conidial suspensions of Phomopsis amaranthicola consisted of round to elliptical lesions with either tan or light brown centers with red-brown rings. Coalescing and large lesions developing on leaf petioles and stems caused a stem and leaf blight, which led to premature defoliation and girdling of stems, and plant mortality. Growth on PDA and all other media was initiated with white mycelium growing in a circular pattern. Pycnidia were produced within 7 days after culture initiation, beginning closest to the point of inoculation and formed in concentric rings approximately 5 mm apart (Figure 2-2). Pycnidia produced on all types of media, as well as those produced on plant material, were ostiolate (Figures 2-3 and 2-4). Conidiophores lined the walls within the pycnidium and were closely packed (Figures 2-5 and 2-6). Alpha, p, and C conidia were produced within the same pycnidium when all spore types

PAGE 52

42 Table 2-3. Sequences for the internal transcribed spacer region primers. ITS Primer^^ Sequence' 4 5 TCCTCCCGCTTATTGATATGC GGAAGTAAAAGTCGTAACAAGG "Sequences are written 5 '-3'. ^Primers were synthesized at the University of Florida Interdisciplinary Center for Biotechnology Research, OUgonucleotide Synthesis Laboratory, Univ. of Florida, Gainesville. ^Sequences based on White et al. (1990).

PAGE 53

43 Figure 2-2. Characteristic growth of Phomopsis amaranthicola on potato dextrose agar. Note white mycelium with dark pycnidia produced in concentric rings around the point of inoculation.

PAGE 54

44 Figure 2-3. Pycnidia of Phomopsis amaranthicola produced on a stem section of an inoculated Amaranthus hybridus L. plant. Stem sections were placed on wetted Whatman #3 filter paper and placed in a moist chamber until sporulation.

PAGE 55

45 1 Figure 2-4. Sporulating pycnidium of Phomopsis amaranthicola as observed in a squash mount at lOOX.

PAGE 56

Figure 2-5. Electron micrograph of a pycnidium of Phomopsis amaranthicola. Photograph courtesy of S. Chandramohan.

PAGE 57

1 47 Figure 2-6. Electron micrograph of an a conidium of Phomopsis amaranthicola.

PAGE 58

48 Figure 2-7. (a). Germinating conidium ofPhomopsis amaranthicola as observed by light microscopy (lOOOX). Note guttules within the conidium. (b). p conidium. (c). C conidia of Phomopsis amaranthicola.

PAGE 59

49 Figure 2-8. (a). Cross-section of a pycnidium of Phomopsis amaranthicola showing lining of the cavity with conidiophores (lOOX). (b). Conidiophores with a conidia (400X). (c). Conidiophorewithaconidium(lOOOX).

PAGE 60

were present (Figure 2-7). In pycnidia containing all three types of conidia, an average of 87% of all conidia produced were a conidia. Beta conidia contributed 10% and C conidia an average of 3% to the total conidial counts. Conidia were produced on hyaline, phialidic conidiophores, which were occasionally branched (Figure 2-8). The conidiogenous cells producing a conidia did so from multiple loci. Attempts to separate the conidial types using glycerol gradient centrifugation and filtration were not successful in producing suspensions composed exclusively of a single conidial type. A suspension containing 86% P conidia was obtained through double filtration through a series of 1-fj.m mesh filters. This suspension was used to inoculate three pots of Amaranthus hybridus plants. Few leaf lesions appeared on these plants. Suspensions containing mixtures of the conidial types were plated on water agar in order to obtain single conidial isolates and examine the germination of conidia. Germination of conidia on PDA-covered glass slides produced the following results. No C conidia were observed to germinate, although they did exhibit incipient morphological changes associated with germination, including irregular swellings. After more than 20 h, less than 30% of p conidia showed morphological changes and production of thread-like mycelium. This mycelial growth, like that observed for P. helianthe (Muntanola-Cvetkovic et al., 1985), disintegrated and did not produce colonies. Alpha conidia were found to germinate approximately 87% of the time using this method. Measurements of conidia and conidiomata obtained for the Florida amaranth isolate from PDA are listed in Table 2-4 with the comparative measures reported for

PAGE 61

51 Phomopsis amaranthi from amaranth in Hungary. Although the ranges are slightly overlapping, the average size of a conidia of the Florida isolate are larger than the range reported for P. amaranthi. In addition to the size differences in both a conidia and P conidia of both isolates, there is the marked absence of the third type of conidium from the description of the Hungarian isolate. Greater nimibers of both a conidia and p conidia were produced on V-8 agar than on PDA. The numbers of a conidia produced on V-8 and PDA were 3.5 x 10* conidia per ml and 1 .6 x 10* conidia per ml respectively. The numbers of P conidia produced were 9.7 X 10^ conidia per ml and2.5x lO'conidiapermlon V-8 agar and PDA, respectively. The numbers of C conidia produced were negligible and not taken into account. Spomlation occurred more quickly on V-8 agar, with plates beginning to yield conidia within 6 days versus between 9 and 10 days on PDA. Pairing of isolates on PDA and V-8 juice agar did not result in the production of a sexual stage, nor did there appear to be any zonation. Instead, all of the paired isolates grew in an intermingled fashion, hifected stem pieces stored in soil and sand and exposed to temperatures of 4C and 30C did not produce perithecia. Removal of these tissues and subsequent plating resulted in regrowth of P. amaranthicola from all pieces. The growth characteristics of the isolates obtained from amaranth grown on a variety of media as observed in culUires grown on V-8, pea agar (PA), potato dextrose agar, potato dextrose broth (PDB), com meal agar (CMA), oatmeal agar (OA), and amaranth infiasion agar (ALA) were observed for two isolates, A and B, from the Gainesville collection, one isolate obtained from amaranth in Belle Glade (BG), two

PAGE 62

52 1 e o •o hi :0 T3 N 2 CO "S o o U IS -) ^ CO 'c o o £ CO '•3 'S o o CO Oi S CO c o > CL, o to C/3 D t/3 c u Oi C -§1 o o 5 o 5 ^ 5 I ^ i > O < s

PAGE 63

53 isolates obtained from Fort Pierce (FPl and FP3), three isolates from Ames, Iowa (75 A, 72A, and 72B), and a single isolate from Brazil (BRZ), as well as an isolate of Phomopsis oryzae (IMI# 158929) (Figure 2-9). All isolates produced profuse mycelium, but the isolate of Phomopsis oryzae, as well as the isolates obtained from Ames were most abimdant in aerial growth and exfremely floccose. The Gainesville isolate grew more slowly than any of the other isolates on all of the media tested. All of the isolates grew most slowly on OA (Figure 2-9). The isolate of P. oryzae and the Gainesville isolates A and B were the only isolates that produced a conidia, P conidia, and C conidia. Isolate BRZ produced a conidia and P conidia. Gainesville isolates A and B produced only a conidia on OA. The presence of all three types of conidia in pycnidia produced on plant tissue was erratic. The remaining isolates, BG, FPl, FP3, 72A, 72B, and 75A, produced only a conidia on all of the media tested. Only the Gainesville isolates produced pycnidia at regular intervals in concentric rings, rather than distributed throughout the plate (Figure 2-2). All isolates produced mycelium in potato dexfrose broth, and produced pycnidia only at the liquid to air interface along the sides of the glass flasks. Host Range Testing Results of the first phase of the host range study are Hsted in Table 2-1. All of the species of amaranth tested were susceptible to infection by P. amaranthicola. Incidence of infection ranged from 23-100%. Mortality of amaranth plants ranged from 0-100%. Species of Amaranthus in which no mortality occurred after inoculation with P. amaranthicola included A. acutilobus L., A. blitoides S. Wats, one Mexican accession of^. cruentus L., A. dubius Mart, ex Thell., A. floridanus, one

PAGE 64

55 accession of^. palmeri S. Wats, from Arkansas, and one accession of A. spinosus L. from Zimbabwe. Those species having a minimum of one accession with between 10 and 50% mortaUty mcluded^. albus,A. caudatus L. {=A. edulis Speg. = A. mantegazzianus Pass.), A. cruentus, A. graecizans L., A. hybridus L., A. palmeri, A. quintensis H. B. K., A. retrqflexus L., A. rudis Sauer, A. spinosus, and A. tricolor L. {=A. gangeticus L.). Species having a minimum of one accession suffering from 51100% mortahty included^, crassipes Schlect, A. deljlexus, A. hybridus, A. lividus L., A. powelli S. Wats., A. retroflexus, A. tricolor, and A. viridus L. The species with the greatest levels of mortality mcluded accessions of A. acutilobus, A. lividus, A. powelli, A. retroflexus L., and A. viridus. Ten symptomatic plants were chosen for plating of diseased tissue to confirm the presence of P. amaranthicola. All tissue samples produced colonies of P. amaranthicola. The second phase of testing included members of the families Apiaceae, Amaranthaceae, Apocynaceae, Asteraceae, Brassicaceae, Cactaceae, Campanulaceae, Caryophyllaceae, Chenopodiaceae, Cucurbitaceae, Fabaceae, Lamiaceae, Liliaceae, Malvaceae, Poaceae, Solanaceae, and Verbanaceae. All plants were considered as immune to infection by P. amaranthicola (Table 2-2). No plants became symptomatic and tissue from each of three plants from each inoculated species plated on PDA produced no colonies of P. amaranthicola. DNA Amplification and Sequence Analvsis Primers ITS4 and ITS5 were used to provide the double-stranded amplification product of the ITS region for sequencing. Comparisons were performed to determine the relationship of the Florida isolate B with other members of the genus

PAGE 65

56 Phomopsis, as well as selected isolates of related genera. Length variations within the sequences of the ITS regions of the chosen isolates were observed. Sequences of isolates 452, 456, 468, 476, 484, 512, 522, 528, 537, 597, 624, 642, and 649, were obtained from GenBank (deposited by Rehner and Uecker). These isolates had ITSl sizes ranging from 165-184 bp, while those included in this study ranged from 140175 bp. Sequences of the ITS2 region of the isolates obtained from the GenBank ranged from 155-162 bp, while test isolates ranged from 144-157 bp in this region. The base compositions of the Phomopsis spp. that were included from the work by Rehner and Uecker (1994) ranged from 52-56% GC for ITSl and 56-59% for ITS2. The sequences of the isolates sequenced for this study had base composition which ranged from 45-56% GC in ITSl and 49-59% in ITS2. The isolates chosen from those deposited by Rehner and Uecker were chosen based on geographical distribution and a wide range of host associations (Table 2-5). Initially, sequences from both ITSl and ITS2 were aligned as a single data set. Alignment of these sequences resulted in a data matrix of 498 sites in 24 isolates. Alignment of both ITSl and ITS2 required the insertion of gaps to maximize sequence similarity. Because of ambiguities in alignment, short sequence segments were excluded from the analysis. Initial heuristic searches on 24 sequences found 53 equally parsimonious trees of length 251, with a consistency index (CI) of 0.946 and a retention index (RI) of 0.974 (Figure 2-10). Analysis was repeated by separating the two regions into character subsets. Heuristic searches based on the sequences of ITSl were performed with a character matrix of 298 sites in 24 isolates. This search

PAGE 66

Figure 2-9. Comparison of growth characteristics of a number of specimens collected from species of Amaranthus L. Isolates 72A, 72B, and 75A were collected at the North Central Regional Plant Introduction Station and were provided with a tentative identification as a Phomopsis (Sacc.) Bubak sp. by Charles Block. Isolate P202 was taken from diseased Amaranthus spinosus L. in Gainesville, and isolate 2B11 represents a subculture of the Florida isolate B, which was deposited with ATCC. The isolates are shown here grown on Difco oatmeal agar.

PAGE 67

57 Table 2-5. Isolate descriptions for cultures used for comparison of the internal transcribed spacer regions. All sequences for isolates with labels composed of a three digit number were obtained from GenBank and were deposited by S. Rehner and F. Uecker. Sequences for isolates gm2, GAP08, and GLB06 were also obtained from the GenBank. These isolates were deposited by W. Udin (1996). Isolate Host Genus Geographical Conidial Types Abbreviation Location 75' Amaranthus USA-Iowa Alpha BG Amaranthus USA-Florida Alpha FPl Amaranthus USA-Florida Alpha FP3 Amaranthus USA-Florida Alpha PHO" Glycine N/A MA" Amaranthus USA-Arkansas N/A B Amaranthus USA-Florida Aloha beta and C conidia pQ* Oryza Alpha, beta, and C conidia 624^ Glycine USA-Florida Unknown 537" Kalmia USA-New Jersey Alpha and beta conidia 528" Magnifera Puerto Rico Alpha and beta conidia 522" Sassafras USA-New Jersey Unknown 512" Juniperus USA-New Jersey Alpha and beta conidia 476^ Vaccinium USA-New Jersey Alpha and beta conidia 468^ Vaccinium USA-New Jersey Alpha and beta conidia 649" Convolvulus Canada Alpha 642" Glycine USA-Maryland Alpha 597" Solanum Dominican Republic Unknown 484'' Capsicum USA-Maryland Alpha and beta conidia 456^ Stokesia USA-Mississippi Alpha and beta conidia 452" Capsicum USA-Texas Alpha and beta conidia gm2^ Prunus USA-Georgia Alpha and beta conidia GAP8' Prunus USA-Georgia Alpha and beta conidia GLB06' Prunus USA-Georgia Alpha and beta conidia 'Isolate provided by C. Block, North Central Regional Plant Introduction Station, Ames ,Iowa. "Phoma medicaginis, ATCC# 52798. "Isolate of Microsphaeropsis amaranthi provided by G. Weidemann, University of Arkansas. ""Phomopsis oryzae, IMI# 158929. As reported in Uecker, 1988. As obtained from the personal notebooks of F. Uecker, courtesy of R. Pardo-Schultheiss, U.S.D.A., Beltsville, MD. ^Isolate information from W. Udin, 1997.

PAGE 68

58 100 dl 68 d23 75 100 d24 d 1 70 dl I 00 66 d 1 d6 81 75 BG FP I FP3 PHO M A B PO 624 537 528 522 5 12 476 468 gm2 GAP08 G LB06 649 642 597 484 456 452 Figure 2-10. Phylogenetic relationships among strains of Phomopsis spp. from various hosts and isolates obtained from species of Amaranthus based on internal transcribed spacer region (ITS) sequences. Strict consensus of 53 equally parsimonious trees (tree length=25 1 consistency index=0.946, homoplasy index=0.054, retention index=0.974, rescaled retention index=0.921). Bootsfrap replication frequencies greater than 50% are indicated above branches. Values below branches, preceded by a lowercase d represent decay indices values. Isolate information is listed in Table 2-5.

PAGE 69

59 100 dl6 75 dl 51 d2 60 dl 60 dl 68 dl 81 d3 59 dl 100 d5 77 d2 75 BG FPl FP3 PHO MA B PO 624 537 528 522 512 476 468 gm2 GAP08 GLB06 649 642 484 456 452 597 Figure 2-11. Phylogenetic relationships among strains of Phomopsis spp. from various hosts and isolates obtained from species of Amaranthus based on rDNA internal franscribed spacer region 1 (ITSl) sequences. Strict consensus of 52 equally parsimonious trees (free length=154, consistency index=0.799, homoplasy index=0.201, retention index=0.930, rescaled retention index=0.742). Bootsfrap replication frequencies greater than 50% are indicated above branches. Values below branches, preceded by a lowercase d represent decay index values. Isolate information is listed in Table 2-5.

PAGE 70

60 100 80 d5 do 1 1 dl 75 BG FPl FP3 MA PHO B PO 649 642 624 597 537 528 522 512 476 484 468 456 452 gm2 GAP08 GLB06 Figure 2-12. Phylogenetic relationships among strains Phomopsis spp. from various hosts and isolates obtained from species of Amaranthus based on rDNA internal franscribed spacer region 2 (ITS2) sequences. Strict consensus of nine equally parsimonious frees (free length=102, consistency index=0.709, homoplasy index=0.291, retention index=0.894, rescaled retention index=0.634). Bootstrap replication frequencies greater than 50% are indicated above branches. Values below branches, preceded by a lowercase d represent decay index values. Isolate number, source and some morphological characters are listed in Table 2-5.

PAGE 71

61 found 52 equally parsimonious trees with a length of 154 steps, a CI of 0.799, and RI of 0.930 (Figure 2-11). Heuristic searches based on the sequences of the ITS2 region were performed using a data matrix of 245 sites in 24 isolates. This search resulted in nine equally parsimonious trees of 102 steps, CI of 0.709, and a RI of 0.894 (Figiu-e 2-12). A series of subsets were then analyzed to determine the effect of excluding certain groups of isolates from the analysis. The first subset included all of the isolates that were sequenced specifically for this study, as well as the three Phomopsis spp. from the GenBank that contained the 5.8s rDNA sequence information (isolates gm2, GAP08, and GLB06). The data matrix for this subset contained 709 sites in 1 1 taxa. Heuristic searches resulted in four most parsimonious frees of 124 steps, with a CI of 0.952 and a RI of 0.977 (Figure 2-13). The second subset included the isolate under study, Gainesville isolate B, and the Phomopsis isolates chosen from the data set of Rehner and Uecker, with Phoma medicaginis (ATCC# 52798) included as the outgroup. Heuristic searches resulted in nine most parsimonious trees, with 167 steps and a CI of 0.665, and a RI of 0.763. The strict consensus of these frees is presented in Figure 2-14. Branches without bootsfrap values were not supported by the 50% majority-rule consensus free. Discussion There have been more than 400 taxa described within the genus Phomopsis, and there has been no recent revision of the members of the genus. The general morphological characters of the Florida isolate indicate that it belongs in the genus Phomopsis. It shares the characteristic conidial types produced by other species of Phomopsis and produces these conidia in pycnidial conidiomata. The conidiophores were branched or sfraight and these are shared characteristics.

PAGE 72

62 59 dl 100 d31 92 100 d8 d4 96 d4 75 BG FPl FP3 PHO MA B PO gm2 GAP08 GLB06 Figure 2-13. Phylogenetic relationships among selected Phomopsis spp. from peach and rice and several isolates obtained from Amaranthus spp. based on rDNA internal franscribed spacer region sequences. Strict consensus of four most parsimonious trees (tree length=124, consistency index=0.952, homoplasy index=0.048, retention index=0.977, rescaled retention index=0.930). Bootstrap replication frequencies greater than 50% are indicated above branches. Values below branches, preceded by a lowercase d represent decay index values. Isolate information is listed in Table 2-5.

PAGE 73

63 100 d25 85 dl 100 dl 71 dl 71 dl 68 d2 53 d2 90 dl 100 d6 91 dl PHO B PO 624 537 528 522 512 476 468 gni2 GAP08 GLB06 649 642 484 456 452 597 Figure 2-14. Phylogenetic relationships among selected Phomopsis spp. from various hosts and several isolates obtained from Amaranthus spp. based on rDNA internal franscribed spacer region sequences. Strict consensus of four most parsimonious trees (free length=124, consistency index=0.952, homoplasy index=0.048, retention index=0.977, rescaled retention index=0.930). Bootstrap replication frequencies greater than 50% are indicated above branches. Values below branches, preceded by a lowercase d represent decay index values. Isolate information is listed in Table 2-5.

PAGE 74

64 Determination of speciation within the genus Phomopsis has been highly dependent upon the host from which the isolate was described. More recent studies with several species have shown that the host ranges of many of the isolates that have been named as species are more broad than originally hypothesized, and it also has been found that a single host plant is capable of supporting more than one species. This somewhat complicates speciation in this genus. The lack of a true lectotype species for the genus Phomopsis (Sutton, 1980) further complicates speciation of fungi in the group. Several characters of the Florida isolate, which I will name P. amaranthicola, are unique in comparison to many members of the genus. The presence of a third type of conidium is reported for only a few species. Multiple loci of conidiogenesis are reported for no other species in the genus. Alpha conidia are apparently the infectious propagules of this isolate and were found to germinate efficiently and to be produced abundantly on several types of media. Alpha conidia and beta conidia are commonly produced for many species of Phomopsis and the alpha conidia have been found to be the most predominant type. The presence of the C conidiimi has been reported for only three other species (Pimithalingam, 1975). The species Phomopsis amaranthi Ubriszy and Voros was not reported to have C conidia, nor was it reported that there were multiple loci of conidiogenesis for a-conidium production. While the host ranges of Phomopsis spp. have been found to be relatively ambiguous characters for species definitions, P. amaranthicola was found to have a host range that is exclusively limited to the genus Amaranthus. No host range

PAGE 75

65 information was published for P. amaranthi from Hungary. All of the Amaranthus spp. tested were susceptible to P. amaranthicola, although there was a great deal of variability in the incidence of infection, as well as in mortality. A high level of infection did not necessarily result in substantial mortality. There was also variability in relation to differences in susceptibility within species among biotypes or accessions. Analysis of the sequence data from a variety of isolates from Amaranthus spp. and other species of Phomopsis showed considerable variation in both the ITSl and ITS2 regions. Alignment of all of the isolates was difficult and required the insertion of several gaps to achieve an optimal alignment (Appendix A). Consensus trees constructed for each grouping of isolates gave similar topologies. Nearly all nodes resolved in the strict consensus cladograms were present and received moderate to strong support by the bootstrap analyses, hi all cases, the groupings resulted in Gamesville isolate B, P. amaranthicola, falling as the sister group to the major clade containing the Phomopsis spp. sequenced by Rehner and Uecker (1994). Isolates of Phomopsis spp. analyzed by Rehner and Uecker (1994) were grouped in this study similarly to their groupings in their original work. Two sequenced isolates, 624 and 528, were chosen from their subgrouping B. These isolates grouped with the isolates from their group A, isolates 537, 522, 512, 476, and 468. Isolates in their group C, 642, 484, 456, and 452, also grouped together in this study. The Florida isolate B, while grouping as the sister group to the other Phomopsis "species," relative to the Phoma-Wkt isolates, was consistently outside of both of the major clades (Figures 210 and 2-11).

PAGE 76

66 The cladogram based on the ITS2 sequence data was less resolved than all other trees (Figure 2-12). Cladograms that were based on sequence groups that excluded the Phomopsis "species" sequenced by Rehner and Uecker (1994), resulted in the grouping of the B isolate as the well-resolved sister taxon within a clade containing P. oryzae and the Phomopsis spp. isolates from Georgia peach (Figure 213). The Florida isolate B is clearly distinct from the two major clades containing the PHO isolate and the PO isolate (Figures 2-10, 2-11, 2-13, and 2-14). A number of points complicate making conclusions concerning the information resulting from the sequence analysis data. There was a high degree of variability in the sequences of the isolates. This made alignment of the sequences difficult and somewhat ambiguous in terms of identifying the optimal alignment. Ahgnments are often prohibitively difficult when the paired sequences differ by more than 30% (Hillis and Dixon, 1991). In addition, due to the complicated taxonomic situation regarding the genus Phomopsis, it is impossible to determine if the terminal clades represent species or groupings of isolates that have been referred to as species. Although the Florida isolate B consistently occurs as the sister group to the remaining isolates of Phomopsis spp., it is difficult to determine if it truly belongs in this group. The results of the sequence analysis, coupled with the unique morphological characteristics, certainly indicate that it is not a new isolate of any of the existing species that have been sequenced; therefore, it is necessary and justified to name it as a new species. Performing a sequence analysis based on a more conserved region, such as the 28S sequence information, as well as a revision of the genus Phomopsis as a whole, might lead to the determination that the Florida isolate B could be a

PAGE 77

67 representative of a new genus. Analysis of any other region of DNA was not a realistic option at this time, due to the limited availability of sequence information for this genus. The description of the fungus obtained from amaranth in Gainesville, Florida, named here as the new species, Phomopsis amaranthicola sp. nov. Rosskopf, Charudattan, and Shabana is as follows: Coloniae in agaro "potato dextrose" albidae, floccosae, denique fumosus. Mycelio septalis, ramosa. Pycnidia abundanti, producens concentricus 0.5-cm separatus, soHtaria. Pycnidia globosa, ostiolata et unilocularia, 371-287 |im, exudato sporali dilutus armeniacus. Paries pycnidialis brunneis vel piceus, cellulis multistratosis, eustromaticus. Conidiophores hyalinae, simplicia, recta vel ramosa. Cellulae conidiogenae hyalinae, procreans a conidia multilocus, phialidicae, exorientes stratis ex intimis cellularum cavitatis pycnidii. Alpha conidia hyalina, flisiforme-elliptica, 17 guttulata, unicellularia, 6.6-24.0 x 2.2-6.6 |im, average 14.1 x 5.7 jam (mode 13.2 x 6.6 \xm). Beta conidia hyalina, fihformia, hamatus vel recta, 24.2-28.6 x 1.1-2.2 |im, average 27.8 x 1.6 |im (mode 28.6 x 1.1 |im). C conidia sparsa, hyalina, variabiHs guttulata, 18-22 |j,m. Pycnidia in caules emortuis immersa, erumpescentia, singularis, unilocularia. Colonies produced on potato dextrose agar white, floccose, turning gray to brown. Mycelium septate and branched. Pycnidia abundant, produced in concentric rings 0.5-cm separating, solitary. Pycnidia globose, ostiolate and unilocular, measuring 371-287 |im, with conidia released in a peach-colored matrix. Pycnidial wall brown to black and multicelled. Conidiophores hyaline, occasionally branched. Conidiogenous cells hyaline, having multiple loci of alpha conidiimi production, phialidic, lining the inner-wall of the cavity. Alpha conidia hyaline, fusiform-elliptic, containing 1-7 guttules, aseptate, measuring 6.6-24.0 x 2.2-6.6 |am, average 14.1 x 5.7 |am (mode 13.2 x 6.6 |am). Beta conidia hyaline, filiform, hamate or straight, measuring 24.2-28.6 x 1.1-2.2 ^m, average 27.8 x 1.6 ^m (mode 28.6 x 1.1). C conidia sparse, hyaline, guttulate, measuring 18-22 \im in length. Pycnidia on dead stems immersed and erumpent, single, and unilocular. In the review of integrated control of Amaranthus retrojlexus L, Burki et al. (1997) referred to this species of Phomopsis as P. amaranthicola Brunaurd, stating that the fungus had been collected in South America. This was a mistake on the part of the authors (Biirki, personal communication to Rosskopf, 1997). I am presenting here the first description of this species.

PAGE 78

CHAPTER III THE EFFECTS OF EPIDEMIOLOGICAL CONDITIONS ON THE PATHOGENIC EFFICACY OF PHOMOPSIS AMARANTHICOLA. Introduction The most commonly cited explanation for the failure of fungal plant pathogens used for biological control agents of weeds to cause severe disease, is the requirement of an extended dew period for adequate infection. Some pathogens, such as Sphacelotheca hold Jack (=5. cruenta [Kuhn.] Potter), under consideration for use as a biological control agent for johnsongrass {Sorghum halepense [L.] Pers.), do not have this as a major constraint. Researchers working with this pathogen have reported that, although initial greenhouse studies indicated a need for free moisture for infection, later studies resulted in 55% infection of plants regardless of the availability of free moisture. It is apparent that although this is a relatively low reported infection rate, the authors found it to be adequate to reduce the competitive ability of the weed (Massion and Lindow, 1986). Daniel and coworkers (1973), studying the use of a sfrain of Colletotrichum gloeosporioides (Penz.) Sacc. for the control of northern jointvetch {Aeschynomene virginica [L.] B.S.P.) found that infection was not limited by the absence of a dew period, but that fastest onset of disease was achieved if the inoculated plants were exposed to 80% relative humidity "overnight." This organism was reported to be capable of causing infection at greenhouse temperatures ranging from 23-32C, 68

PAGE 79

69 although the data presentation did not indicate the levels of severity achieved. The same organism was capable of infecting plants ranging from 5.0to 30.5-cm tall, although the greatest percentage of mortality was achieved with the smallest-size class of plants. This organism was later registered as the bioherbicide Collego. One species of Phomopsis (Sacc.) Bubak P. convolvulus Ormeno, was evaluated for its potential for the control of field bindweed (Convolvulus arvensis L.). This fungus was found to cause the highest levels of plant mortality when the inoculated plants were exposed to a minimum of 1 8 h of dew combined with an inoculum concentration of lO'conidia/m^ This treatment resulted in 55% plant mortality (Morin et al., 1990b). Isolates oiBipolaris setariae (Saw.) Shoemaker examined for the control of goosegrass (Eleusine indica [L.] Gartner) required a 48hour dew period for 100% infectivity. The optimal temperature for disease development in this system was 24C. The isolate was able to control goosegrass plants of the 2and 4-week growth stages (Figliola et al., 1988). Similar results were obtained in studies involving the development of anthracnose of spiny cockleburr (Xanthium spinosum L.), caused by Colletotrichum orbiculare (Berk, et Mont.) v. Arx. The optimal temperatures for disease development by this organism were between 20C and 25C, with a dew period of 48 h. As with several other potential biological control organisms, if this dew period was split into 12-hour exposures with 12 hours separating dew exposure, the disease severity was decreased. A significant level of mortality of cockleburr was not achieved with any of the treatments, with disease ratings approaching five, which did not constitute plant death (McRae and Auld, 1988).

PAGE 80

70 Colletotrichum truncatum (Schw.) Andrus and Moore, used for the control of Florida beggarweed (Desmodium tortuosum [Sw.] DC), had optunal disease development with 14 to 16 h of dew at temperatures between 24C and 29C. Conidial suspensions with concentration of 10^ to 10^ conidia/ml were most effective in controlhng plants in the cotyledon stage of growth. The efficacy of the pathogen diminished as the maturity of the plants increased (Cardina, 1988). The percentage of control obtained at 18C was significantly lower. Microsphaeropsis amaranthi (Ell. and Barth.) Heiny and Mintz (=Aposphaeria amaranthi Ell. and Barth.), a pathogen of tumble pigweed {Amaranthus albus L.), was found to cause the most significant levels of pigweed mortality in a series of growth chamber experiments when applied to plants of the four-leaf stage and exposed to a minimum of 8 h of dew. There were no significant differences when comparing mortality of inoculated plants exposed to 8, 12, and 24 h of dew. This dew period requirement is substantially lower than those for many of the potential biological control agents that have been evaluated. There were also no significant differences in mortality when conidial suspensions ranging fi-om 10"* to 10^ were used for inoculation. In this case, there was no detrimental effect produced by delaying the onset of dew and therefore the disease resulted in 100% plant mortality (Mintz, 1992). Testing of the epidemiological parameters is essential for determining the potential of biological control agents for weeds. Although many organisms that prove to have potential at this level of testing do not prove to be efficacious in the field, determination of the basic environmental conditions necessary for disease

PAGE 81

71 development will provide some measure of the potential for field use. In order to test the effects of these parameters on the disease development caused by Phomopsis amaranthicola Rosskopf, Charudattan, and Shabana on pigweed {Amaranthus L. spp.), greenhouse studies examining the period of dew required for use of conidial and myceUal preparations were examined. In addition, the temperature during the dew period was also evaluated in terms of the development and severity of disease. The effect of a humectant on disease severity and plant mortahty was also evaluated. The growth stage of the Amaranthus hybridus L. test plants was also examined as a potential factor in establishing the efficacy of the organism. Different concentrations of conidia in suspensions used for inoculation of ^. hybridus plants were also considered as a potential factor in disease development and severity. Amaranthus hybridus plants were found to be moderately susceptible to infection by P. amaranthicola. Therefore, it was chosen for evaluation of the pathogen. Although other species, including A. lividus and A. viridus, were more susceptible, they were so severely affected by the pathogen that differences in the experimental parameters would not be detected. Materials and Methods Dew Period. Inoculum Type, and Amendment To study the dew period required for disease initiation by P. amaranthicola, inoculum suspensions were prepared that were composed of both conidia and mycelium. Conidial suspensions were prepared by harvesting conidia fi-om V-8 agar plates by flooding plates with 10 ml of deionized water and dislodging spores using a sterilized rubber policeman. The suspension was then filtered through two layers of

PAGE 82

72 sterile cheese cloth and standardized to 1 miUion conidia per milliliter using a hemacytometer. Cultures utilized in this way were from 12-24 days old. Cultures were maintained at 25C 2C and exposed to a diurnal light regime. Mycelial suspensions were prepared from mycelial mats harvested from 2to 3-week-old cultures grown in potato dextrose broth (PDB) in Fembach flasks. The PDB was amended with chloramphenicol (2.5 mg/L) and sfreptomycin (3.7 mg/L). These cultures were allowed to grow under ambient light. When the mycelium was ready for harvest, the cultures were filtered through two layers of sterile cheese cloth and rinsed with sterile deionized water. The mycelium was then pressed dry and weighed to prepare suspensions containing 5 g/ml. For the dewperiod experiment, the suspensions were continuously stirred and split into two aliquots; one of each type of inoculimi was amended with a hydrophilic psyllium mucilloid (Metamucil, Procter and Gamble, Cincinnati, OH) at the rate of 0.5 g/100 ml (m:v). Mycelial suspensions were applied using sterilized paint brushes. Three milliliters of suspension were applied to each plant for the mycelial treatments. Conidial suspensions were applied with hand-held pump sprayers using 3 ml per plant. Plants of A. hybridus L., smooth pigweed, were used for greenhouse experiments. Plants were grown from seed (Azlin Seed Service, Leland, MS) in the greenhouse and transplanted at the cotyledon stage to three plants per 9-cm clay pot containing Metromix 300 (Scott's-Sierra Horticultural Products Co., Marysville, OH). Plants were maintained in the greenhouse until they had from two to four true leaves. Plants were inoculated with the conidial or mycelial suspensions, either with or without the amendment. The plants were subsequently exposed to varying lengths of dew consisting of no dew, in which the plants were inoculated and then returned to the greenhouse, or 4, 8, 12, or 24 h of dew.

PAGE 83

73 Controls consisted of plants sprayed with water or water amended with psyllium mucilloid, and the uninoculated plants were exposed to the same dew treatments as the inoculated plants. When removed from the dark dew chamber, plants were returned to the greenhouse and evaluated for disease development and plant mortality over 8 weeks. Three replicates were used for each treatment and the experiment was repeated twice. Data were taken as the proportion of dead plants. The proportions were transformed using the arc-sine square-root transformation. Analysis of variance (ANOVA) was used to determine if the trials could be combined and to determine the significance of the effects and any interactions. Means were separated using Tukey's Honestly Significant Difference (HSD) test and regression analysis was performed using the General Linear Models (GLM) analysis (S AS Institute, 1988). Dew Period and Temperature To examine the effect of temperature during the dew period, a conidial suspension of P. amaranthicola was prepared as before and amended with psyllium mucilloid (0.5% m:v). Plants were spray-inoculated as before and then exposed to varying lengths of dew, 0, 4, 8, 12, and 24 h, with temperatures of 20, 25, 30, and 35C. Plants of the fourto six-leaf stage were used for this experiment. Controls consisted of uninoculated plants exposed to the same dew durations and temperatures as the inoculated plants. Each treatment consisted of three replicates, consisting of three plants per replicate, and the experiment was repeated thrice. Data were taken as the proportion of dead plants. The proportions were then transformed using the arcsine square-root transformation. Analysis of variance was used to determine if the

PAGE 84

74 trials could be combined and to determine the significance of the effects and any interactions. Means were separated using Tukey's HSD test and regression analysis was performed using the GLM analysis. Effect of Plant Growth Stage on Disease The effect of plant growth stage on the development of disease and plant mortality was tested using plants of five growth stages: 1) <2-leaf stage = fiilly expanded cotyledon with the first true leaves just beginning to open (approximately 10 days after planting); 2) 2to 4-leaf stage = two fiilly expanded leaves with the third and fourth leaves just begiiming to expand (approximately 16 days after planting); 3) 4to 6-leaf stage = four true leaves fiilly expanded and the fifth and six leaves beginning to expand (approximately 20 days after planting); 4) 6to 8-Ieaf stage = six fiilly expanded leaves with the seventh and eighth leaves just beginning to expand (approximately 26 days after planting); 5) flowering = axillary buds present and producing flowers (approximately 30 days after planting). Plants were grown from seed in the greenhouse in a staggered fashion to accomplish the desired growth stages. Plants were sprayed with a hand-held pump sprayer to just before runoff with a conidial suspension of 1 x 10* conidia per ml. Approximately 3 ml of suspension were applied to each plant. Inoculated seedlings were transferred to a dark dew chamber for 24 h at 15C"' 2C. Controls consisted of each plant growth stage sprayed with a 0.5% (m:v) psyllium mucilloid suspension and exposed to 24 h of dew. Data were taken as the proportion of dead plants. The proportions were then transformed using the arc-sine square-root transformation.

PAGE 85

75 Results from two trials were combined. Analysis of variance was used to determine if the trials could be combined and the significance of the treatment effect. Means were separated using Tukey's HSD test. Inoculum Concentration The effect of inoculum concentration on plant mortaUty was evaluated using conidial suspensions of a conidia of P. amaranthicola prepared in the same manner as above. Suspensions were then diluted to contain approximately 1.5 x 10^ 6.0 x 10^ 1.5 X 10*, 6.0 X 10^ and 1.5 x 10^ conidia per ml, as determined with a hemacytometer. All suspensions were amended with psyllium mucilloid (0.5% m:v). Amaranthus hybridus plants of the fourto six-leaf stage were utilized for this study and were grown as in the above experiments. Plants were inoculated with a handheld pump sprayer as before, and were then exposed to 12 h of dew at 25C^'"2C in the dark. Inoculated and control plants were moved to the greenhouse and observed for disease development and mortality for 8 weeks. Data were taken as the proportion of dead plants. The proportions were then transformed using the arc-sine square-root transformation. Results from three trials were combined. Analysis of variance was used to determine if the trials could be combined and the significance of the treatment effects. Means were separated using Tukey's HSD test. Results Dew Period. Inoculum Type, and Amendment Results of the first series of trials examining the effect of the dew period duration, inoculum type, and amendment were analyzed as a five x five factorial. All of the factors, dew duration, inoculum type, and amendment, were foimd to be

PAGE 86

significant (P=0.0001), and there were no significant interactions among the factors (P< 0.05). Trials had mean square errors of the same magnitude (Trial 1 MSE=0.489, Trial 2 MSE=0.543), and the effect of trial was found to be insignificant (P=0.714). Data for each factor were pooled over all other factors. Significantly higher percentages of mortality occurred when plants were exposed to a minimum of 8 h of dew than at lower exposures (Table 3-1 and Figure 3-1). There was no significant difference between no dew period (13% mortality) and a 4-h dew period (32% mortahty). There was no statistically significant increase in mortality when comparing 8 h of dew (53% mortality), and 12 and 24 h of dew, (59% and 73%, respectively). Regression analysis of the effect of dew duration resulted in the equation y=-0.003x^ + 0.114x + 0.181, although the r-square (R^=0.47) was relatively low and coefficient of variation high (CI=50.8) (Figure 3-1). The type of inoculum used, whether a conidial preparation or mycelial suspension, was also a significant factor in determining the most efficacious preparation of P. amaranthicola. Application of conidial suspensions resulted in an average of 61% mortality of A. hybridus and were more effective than mycelial suspensions, which yielded only 31% mortality of the same weed species (Figure 3-2). The addition of the psylliimi mucilloid as an amendment to the fimgal preparations significantly influenced the mortality of A. hybridus after inoculation with P. amaranthicola. Fiftyfour percent of plants were killed by the amended suspensions, versus 38% mortality of plants treated with the nonamended ftingal suspensions (Figure 3-3). These differences were all found to be significant at the a=0.05 level using the Tukey's HSD mean separation procedure. No control plants were affected by the treatments.

PAGE 87

Table 3.1. Mortality of Amaranthus hybridus L. after inoculation with Phomopsis amaranthicola obtained for each treatment combination of dew period, inoculum type, and amendment with psyllium mucilloid (Metamucil). Inoculum Type Percent Mortality Dew Duration Conidia 0 4 8 12 24 Amended 28 50 71 92 95 Nonamended 17 39 56 72 87 Mycelium Amended 6 28 61 50 61 Nonamended 0 11 22 22 50

PAGE 88

78 Figure 3-1. Effect of dew duration on the mortality of Amaranthus hybridus L. caused by inoculation with Phomopsis amaranthicola. Bars with different letters represent significantly different average mortality values based on the arc-sine squareroot transformed proportions with mean separation by Tukey's Honestly Significant Difference test (a=0.05). Data are the result of two combined trials. Regression analysis of the effect of dew duration resulted in the equation y=-0.003x^ + 0. 1 14x -i0.181, with a significance of P=0.0001, although the r-square (R^=0.47) was relatively low and coefficient of variation high (CI=50.8).

PAGE 89

79 Figure 3-2. Effect of inoculum type of Phomopsis amaranthicola on mortality of Amaranthus hybridus L. plants. Bars with different letters represent significantly different average mortality values based on the arc-sine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (a-0.05). Data are the result of two combined trials.

PAGE 90

80 60 Figure 3-3. Effect of amendment with a psyllium mucilloid on the efficacy of Phomopsis amaranthicola on Amaranthns hybridus L. plant mortality. Bars with different letters represent significantly different average mortality based on the arcsine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (a=0.05). Data are the resuh of two combined trials.

PAGE 91

81 Effect of Dew-Period Temperature The effect of temperature during dew exposure periods was found to be a significant factor in the efficacy of P. amaranthicola as expressed by mortahty of A. hybridus (Table 3-2.)Three trials were combined based on all trials having mean square errors of the same magnitude, 0.200, 0.241, and 0.244 for trials 1-3 respectively. Trial was also found to be an insignificant factor with P=0.35. In this experiment, the effect of dew duration was also found to be significant, as had been shown previously. There was no interaction between the effects of temperature and dew duration (P<0.05); therefore, the temperature data were pooled over the dewduration treatments. Temperatures of 25C, 30C, and 35C were found to be equally effective, with levels of mortality of 52%, 57%, and 67%, respectively. Treatment with a dew period temperature of 20C was foimd to cause a significant decrease in level of mortality, with this treatment producing only 23% mortality of inoculated A. hybridus plants (Figure 3-4). No control plants were affected by the treatments. Effect of Plant Growth Stage Plant growth stage had a significant effect on the efficacy of P. amaranthicola (P=0.0322, R^=0.71, CV=46.5, MSE=0.67). The two trials were combined based on mean square errors of the same magnitude (0.058, and 0.041 for each of two trials) and insignificant effect of trial using ANOVA (P=0.08). Growth stage 1 (<2-leaf stage = fiiUy expanded cotyledon with the first true leaves just beginning to open (approximately 10 days after planting)) and growth stage 2 (2to 4-leaf stage = two ftilly expanded leaves with the third and fourth leaves just beginning to expand

PAGE 92

82 Table 3-2. Mortality ofAmaranthus hybridus L., after inoculation with Phomopsis amaranthicola, obtained for each treatment combination of dew period duration and temperature. Temperature Percent Mortality Dew Duration 4 8 12 24 20 11 15 19 48 25 30 44 67 67 30 30 59 70 67 35 48 70 67 82

PAGE 93

83 20 25 30 35 Temperature (Degrees Celsius) Figure 3-4. Effect of dew-period temperature on the efficacy of Phomopsis amaranthicola on Amaranthus hybridus L. Bars with different letters represent significantly different average mortality values based on the arc-sine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (a=0.05). Data are the result of two combined trials.

PAGE 94

84 (approximately 16 days after planting)) were most effectively controlled by the application of P. amaranthicola (Figiire 3-5). Although inoculated plants of growth stage number 5 (flowering = axillary buds present and producing flowers [approximately 30 days after planting]) appeared to be affected by application of the fiingus, there was no difference between the mortality of inoculated or uninoculated plants of this growth stage. The high level of mortality in the fifth growth stage can be attributed to natural mortality related to the end of the plant's life cycle. Effect of Inoculum Concentration The different concentrations of a conidia of P. amaranthicola applied to A. hybridus plants did not have any significant effect on the percentage of mortality resulting fi-om those inoculations (a=0.05) (Figure 3-6). The only difference that was significant was between the control treatment, consisting of the application of psyUium mucilloid alone, and the treatments containing conidia. The three trials were combined based on mean square errors of the same magnitude (0.120, 0.165, and 0.153 for each of three trials) and insignificant effect of trial using ANOVA (P=0.2682). Discussion The infection of Amaranthus hybridus by Phomopsis amaranthicola was most effective when preparations containing conidia were used. Although mycelial suspensions used for inoculation did cause disease, the levels achieved were inadequate for significant control of the weed. This is a minor limitation for the large-scale use of P. amaranthicola, as the production of mycelium in liquid culture is less expensive and requires less space or specialized equipment than does production of conidia on solid media. Unfortunately, P. amaranthicola does not undergo appreciable conidiation in

PAGE 95

85 Figure 3-5. Effect of plant growth stage on the efficacy oiPhomopsis amaranthicola. Bars with different letters represent significantly different average mortality of Amaranthus hybridus plants based on the arc-sine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (a=0.05). Data are the result of three combined trials. Plant growth stages are as follows: 1) <2-leaf stage = fully expanded cotyledon with the first true leaves just beginning to open (approximately 10 days after planting); 2) 2to 4leaf stage = two fiilly expanded leaves with the third and fourth leaves just beginning to expand (approximately 16 days after planting); 3) 4to 6-leaf stage = four true leaves fiilly expanded and the fifth and six leaves beginning to expand (approximately 20 days after planting); 4) 6to 8-leaf stage = six fiilly expanded leaves with the seventh and eighth leaves just beginning to expand (approximately 26 days after planting); 5) flowering = axillary buds present and producing flowers (approximately 30 days after planting).

PAGE 96

86 40 -1 0 1.5 6 15 60 150 Concentration of alpha-conidia (x 10*) Figure 3-6. Effect of inoculum concentration on the efficacy of Phomopsis amaranthicola on the mortahty of Amaranthus hybridus. Bars with different letters represent significantly different average plant mortality based on the arc-sine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (a=0.05). Data are the result of three combined trials.

PAGE 97

87 potato dextrose broth and will require further investigation to determine if a semi-solid mode of production will be successful for large-scale inoculum production. Fortunately, relatively low concentrations of conidia were found to be adequate for causing mortality of A. hybridus plants. Unlike other potential agents for biological control of weeds, such as P. convolvulus, which requires 10' conidia/ml to cause high levels of mortality in seedlings of field bindweed, there were no significant differences between applications of different concentrations of conidia. The conditions of the study here, including the suboptimal dew duration, as well as the application of the fungus to plants of moderate growth, rather than to plants in the seedling stage, further support the effectiveness of lower concentrations of conidia. The addition of the psyllium mucilloid, in the form of Metamucil, did substantially improve the efficacy of P. amaranthicola, particularly in the absence of an extensive dew period. The results from these studies indicate that dessication-reducing formulations of this pathogen could improve significantly its practical use. The necessity for prolonged exposure to dew, as was stated earlier, is one of the most limiting factors in the development of suitable, effective biological control agents for weeds. The use of himiectants in the formulation of these pathogens may alleviate these extended periods. In the case of P. amaranthicola, a dew period of a minimum of 8 h is important for high levels of plant mortality. When compared to many potential biological control agents, this is a relatively low dew-duration requirement, although it is still a longer period than is available in field situations. Further work in the area of formulation may eliminate even this relatively minimal dew requirement.

PAGE 98

88 The temperature of the dew period had a significant effect on the efficacy of P. amaranthicola. The optimal temperature range for infection and disease development with P. amaranthicola was similar to the optimal ranges reported for several other Phomopsis spp. (Eshenaur and Milholland, 1989; Rupe and Ferris, 1987; Tekrony et al., 1983). The most important imphcation of these results are that the optimal temperatures, fi-om 25C-35C, for disease development and plant mortality fall within the temperature range that occurs during the growing season of the weed. The upper limit of the testing range should be increased above 35C to determine what the high temperature ceiling might be. One negative aspect of the apparent low temperature inhibition of the pathogen is that P. amaranthicola may not be suitable for control of pigweeds in northern crops, such as beets (Schweizer, 1981; Schweizer and Lauridson, 1985). It is unlikely that the use of this fungus in more southern temperate regions and subtropical settings will be hmited by temperature. The growth stage of the A. hybridus seedlings appeared to be one of the more significant factors affecting the efficacy of P. amaranthicola. The importance of early season control of species of Amaranthus has been documented for several crops, including beans (Lugo, 1996) and soybean (Monks and Oliver, 1988). The ability of P. amaranthicola to control pigweeds early in their growth is compatible with the need for early-season control of these weeds in many crops (Kropff et al., 1992; Weaver and Tan, 1983; Weaver et al., 1992). Although the most susceptible growth stages are the smaller stages, it may be possible to improve the efficacy of P. amaranthicola on older or more mature plants with the addition of formulating agents.

PAGE 99

89 The timing of application of P. amaranthicola as a biological control agent for pigweeds is decidedly one of the most important factors. Timing plays a crucial role, both in terms of the growth of the target weeds, as well as in optimization of the environmental conditions that are present during and after application. It appears that applications made early after weed emergence would be most conducive for effective control. The pathogen should also be applied to take advantage of the most humid periods or timed to coincide with the onset of the evening or early morning dew period. These factors are more important to consider than the temperature at the time of appHcation. hi several cases, there was a great deal of variability in the efficacy of P. amaranthicola. hi addition to the factors that were looked at here, there are certainly other conditions that may have played a role in the variation between trials or between experiments. Suspensions of conidia that were allowed to remain on the laboratory bench for more than 1 h before spraying showed improved germination over those allowed to sit for up to 1 h or for more than 7 h (Table C-1). hi studies involving the role of the conidial matrix of P. convolvulus, the matrix was found to act as an inhibitor of conidial germination (Sparace et al., 1991). It may be possible that this phenomenon occurs with Phomopsis amaranthicola, as the release of conidia does occur in a similar matrix. In cases where the suspensions were not held for a long enough period before use, the conidial matrix may not have been adequately dissolved. In studies involving the use of Alternaria helianthi (Hansf.) Tubaki and Nishihara, the temperature at which the fungus was propagated had an effect on the efficacy of the organism when used for control of Xanthium strumarium L. (cocklebur). Although the

PAGE 100

90 fungus was found to produce conidia at all of the temperatures used, there were differences in the infectivity of the spores and the resulting disease (Abbas, et al., 1995a,b). Germination and growth of a conidia of P. amaranthicola is quite variable in itself and this, coupled with the other potential factors described here may contribute to varying levels of efficacy.

PAGE 101

CHAPTER IV FIELD EVALUATION OF PHOMOPSIS AMARANTHICOLA Introduction Field evaluation of biological control agents for weeds is one of the most important components of a complete evaluation of pathogens' efficacy. Although an organism may perform effectively in greenhouse or growth-chamber experiments, the use of the fungus in the field is often characterized by variable activity against the target weed. Several pathogens have been tested in the field for biological control of weeds. Puccinia carduorum Jacky was evaluated in the field for the control of musk thistle (Carduus theormeri Weinmann). Although this pathogen had performed effectively in the greenhouse, with significant reductions in plant matter accumulation after both single and multiple applications of the pathogen, field performance was limited to accelerated senescence and reductions in seed production (Baudoin et al., 1993). Colletotrichum orbiculare (Berk, and Mont.) von Arx has been tested in the field for the control of Xanthium spinosum L. This pathogen was tested in small scale plots with efficacious results and was fiirther tested at four sites with variable environmental conditions. Two sites were treated with artificial dew periods of 18 h, which resulted in 100% plant mortality. Sites that were not treated with an artificial dew period reached a maximum plant mortality of 50% (Auld et al., 1990). This system was later evaluated using oil suspension emulsions of the pathogen and the field results were dramatically increased (Klein et al., 1995b). 91

PAGE 102

92 Field trials testing the effect of Colletotrichum truncatum (Schw.) Andrus and Moore on the growth of hemp sesbania (Sesbania exaltata [Rydb.] ex. Hill) included the application of the pathogen to plots at two rates in either an aqueous suspension or in an invert emulsion. The maximum level of weed mortality in plots treated with the aqueous suspension was 42%, while in invert emulsion suspensions of the pathogen there was 97% mortality in the plots treated with the higher application rate. This was comparable to control with the herbicide acifluorfen. The effect of the invert emulsion applied without the fungus was statistically similar to the effect of the pathogen in the aqueous suspension (Boyette et al., 1993b) Altemaria crassa (Sacc.) Rands was evaluated for the control of jimsonweed {Datura stramonium L.). It was effective in one field trial location using a mycelial preparation, while at the second site plant mortality reached a maximiun of only 29% (Boyette et al., 1986). This system demonstrates a common phenomenon, that of the reduced efficacy of many pathogens in the field, as well as the variability that can be associated with differences in potential sites of use. The control of Amaranthus albus L. by the agent Microsphaeropsis amaranthi (Ell. and Earth.) Heiny and Mintz is an example of a successful transition fi"om greenhouse to field use. This pathogen, which was extremely efficacious on the target weed in controlled growth-chamber studies, also performed well in the field with 96-99% mortality after applications of 1 x 10* and 6x10* conidia/ml. This system was tested in only one season at one location (Mintz et al., 1992). The objective of the current study was to evaluate the potential of Phomopsis amaranthicola in the field.

PAGE 103

93 Materials and Methods 1993 Trial The 1993 field trial was performed at the Organic Farm, Department of Horticultural Sciences, on the grounds of the University of Florida. The pigweed species tested were chosen based upon their economic importance and the minimum of 50% mortality in greenhouse studies. The species chosen included Amaranthns hybridus L., A. viridus L., A. lividus L., A. retroflexus L., A. spinosus L., and a triazine-resistant accession of A. hybridus. Seeds were obtained from the North Central Regional Plant Introduction Station, USDA-ARS, Ames, Iowa and from Dr. T. Bewick, University of Florida. Plants were grown from seed in the greenhouse, transplanted to flats, allowed to grow for 10 days, and were transplanted to the field with 10-20 plants of each species per plot. These were allowed to grow for 1 week before inoculation. The field plot had a completely randomized design using five species and one accession, and eight freatments with five replicates per freatment. Plots were 1 m^ with 1.5-m alleys. Treatments 1-4 consisted of a single application of a psylliimi mucilloid control (0.5% m:v), mycelial suspension (50 g/1), low conidial concenfration (1 million conidia/ml), and a high concentration of conidia (6 x 10^ conidia/ml). All fiingal suspensions were amended with 0.5% psyllium mucilloid. Treatments 5-8 were of the same composition as freatments 1-4, but with a second spray application 10 days following the first. Each freatment was applied at a rate of approximately 90 ml per plot, which is equivalent to approximately 950 L/ha, using a carbon dioxide back-pack sprayer with 138 kPa of pressure. Fimgal suspensions were prepared as described for the greenhouse trials. Applications were performed at dusk.

PAGE 104

94 Pots containing each of the six species were placed within each treatment, at both the beginning and the end of the spray to determine inoculum viability and dispersal. The potted plants were then exposed to 24 h of dew and transferred to the greenhouse, where they were observed for disease development. Data were recorded as incidence of symptoms occurring within each plot on a weekly basis. This was then converted to the percentage of plants showing sjnnptoms in each plot. Mortality was recorded in the same manner. Symptomatic tissue was taken from three plants in each plot, including diseased control plants, surface sterilized and plated onto potato dextrose agar amended with chloramphenicol (2.5 mg/L) and streptomycin sulfate (3.7 mg/L). The cimiulative disease incidence data were plotted versus time using regression for lifetime data (Kahn and Sempos, 1989). Percentages were then transformed using the arc-sine square-root transformation and variance and interactions were analyzed using the General Linear Models (GLM) procedure with repeated-measures analysis, and least-squares mean was used for mean separation. Each species was analyzed separately. 1994-95 Trial Preparation for the 1994 and 1995 field trials was performed in the same manner as in 1993. Field studies were performed at the Millhopper Horticultural Sciences Unit of the Institute of Food and Agricultural Sciences. Plants were grown from seed in the greenhouse, as in 1993, and then transplanted to the field with 20 plants per plot. Species were not combined within plots. The design of the 1994 and 1995 field experiments had a completely randomized block design with the replicate plots as the blocking factor. Plots were 1 m^ with 1-m alleys. The same freatments were used as in 1993 and were applied in the same manner.

PAGE 105

95 Data for each species were collected as in 1993 and proportions of dead plants were transformed using the arc-sine square-root transformation and analyzed using the GLM procedure with repeated-measures analysis and least-squares means was used for mean separation. Results 1993 Symptoms first appeared in the field on Amaranthus lividus treated with the low concentration of conidia 4 days after treatment. The first instance of mortality also occurred in the same treatment. Plants of A. retroflexus did not survive transplantation to the field and were excluded fi-om the analysis. The cimiulative disease incidence data were plotted versus time using regression for lifetime data. The data for each species best fit the WeibuU model. Disease progress within inoculated plots progressed much more rapidly than in noninoculated plots (Figures 4-1 to 4-5). This was the case for all species tested. The variances and covariances generated by the regression procedure were then used to compare disease incidence between the treatments within each species. Estimates of the times required to reach 50% incidence within each treatment were calculated fi-om the Weibull models and used to compare the treatments. A 95% confidence interval was constructed for each treatment centered around the expected number of days to reach 50% incidence (Table 4-1). The number of days required to reach 50% incidence in control plots ranged fi-om 17-45 days, while treated plots reached this level of disease within 4-8 days after treatment. Amaranthus viridus plants that were treated with double applications of suspensions containing conidia reached 50% disease incidence more rapidly than in any other treatment. Disease incidence most

PAGE 106

96 rapidly reached 50% in plots of A. lividus treated with conidia. Data were also analyzed using the GLM with repeated-measures analysis and mean separation by least-squares means (Tables 4-2 A-C). The effects of treatment and week after inoculation were significant (P— 0.0001) for all species and there was a sigmficant interaction between the effects (P<0.05). Mortality of A. lividus treated with one application of the high concentration of conidia was 73% within 2 weeks of inoculation (Table 4-2 A). This level of mortality was not significantly different fi-om any of the other treatments containing P. amaranthicola, but was significantly higher than that in both controls. Control of A. hybridus at the 2-week mark in plots treated with a single or a double application of a high concentration of conidia was 34% and 37% plant mortality. This level of mortality was not significantly different fi-om the effects of the other treatments containing P. amaranthicola, but was different fi-om controls. Control of the other species at this time was insignificant. Excellent control of ^. lividus, A. viridus, A. spinosus, and A. hybridus was achieved by the fourth week after inoculation (Table 4-2 B). Mortality of A. lividus 4 weeks after inoculation ranged from 66-88% in plots treated with a suspension of P. amaranthicola. There were no differences between these treatments when compared to one another, but all were significantly different from controls. Control of ^. viridus reached 77% in the plots treated with double application of a low concenfration of conidia. This level of mortality was not significantly different from other fiingal treatments, but was different from one of the control freatments. Amaranthus spinosus suffered 70% mortaUty in plots freated with double applications of a low concenfration of conidia. While this level of mortality was significantly

PAGE 107

97 different from controls, it was not statistically different from other treatments containing the ftingus. Control of A. hybridus ranged from 69 to 100% mortality in plots treated with the ftingus, with no significant differences between those treatments. Mortality in plots treated with the fungus were significantly different from that in the controls. Control of the triazine-resistant accession was insignificant at 4 weeks after inoculation. Greater than 90% mortality was achieved for each species by 6 weeks after inoculation, except the triazine-resistant /I. hybridus, which reached only 36% mortality (Table 4-2 C). This was significantly different from control plots, but not different from other treatments containing conidia or a double application of mycelium. Conidial suspensions were generally the most effective inoculum type, although by the sixth week, there was substantial plant death in plots freated with mycelium. Considerable weed mortality occurred in the control plots by the end of the experiment period Mortality of the plants in pots treated with this the fungus and exposed to a 24-h dew period reached 100% within four weeks of inoculation. Symptomatic tissue taken from inoculated and control plants was plated on potato dextrose agar and P. amaranthicola was recovered from the representative samples from each plot. 1994 The effects of treatment and time were significant for the species A. lividus, A. viridus, and A. spinosus (P<0.05), and there was a treatment by time interaction (P<0.10) for all species tested, with the exception of A. hybridus. The treatment effect was not significant for either ^4. hybridus accession.

PAGE 108

98 Figure 4-1 WeibuU model of disease progress on Amaranthus viridus in 1993 as a result of inoculation with Phomopsis amaranthicola. Treatments consisted of a single (1-4) or double (5-8) application of psyllium mucilloid alone (1,5), mycelial suspension (2, 6), 1.0 x 10^ conidia/ml suspension (3, 7), and 6.0 x 10^ conidia/ml suspension (4, 8). M I M I I M I I I M 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 58 Days Figure 4-2. Weibull model of disease progress on Amaranthus lividus in 1993 as a result of inoculation with Phomopsis amaranthicola. Treatinents consisted of a single (1-4) or double (5-8) application of psyllium mucilloid alone (1, 5), mycelial suspension (2, 6), 1.0 x 10* conidia/ml suspension (3, 7), and 6.0 x 10^ conidia/ml suspension (4, 8).

PAGE 109

99 Figure 4-3. WeibuU model of disease progress on the triazine-resistant accession of Amaranthus hybridus in 1993 as a result of inoculation with Phomopsis amaranthicola. Treatments consisted of a single (1-4) or double (5-8) application of psyllium mucilloid alone (1, 5), mycelial suspension (2, 6), 1.0 x 10^ conidia/ml suspension (3, 7), and 6.0 x lO'' conidia/ml suspension (4, 8). Days Figure 4-4. Weibull model of disease progress on Amaranthus spinosus in 1993 as a result of inoculation with Phomopsis amaranthicola. Treatments consisted of a single (1-4) or double (5-8) application of psyllium mucilloid alone (1,5), mycelial suspension (2, 6), 1.0 x 10^ conidia/ml suspension (3, 7), and 6.0 x 10^ conidia/ml suspension (4, 8).

PAGE 110

100 1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 58 Days Figure 4-5. Weibull model of disease progress on Amaranthus hybridus in 1993 as a result of inoculation with Phomopsis amaranthicola. Treatments consisted of a single (1-4) or double (5-8) application of psyllium mucilloid alone (1,5), mycelial suspension (2, 6), 1.0 x 10* conidia/ml suspension (3, 7), and 6.0 x 10^ conidia/ml suspension (4, 8).

PAGE 111

o u 00 s <*.2 =: o .H a U3 ^ \o oo ^ ^ ^ o vd o o 00 o u u u On 0\ ca o o o ^ XI XI p <*i iri >/i iri n r^ ^ vd >o u-i 73 U U •2 X) o >. 0\ Ov — K-> > ^ vd 2 X) 13 ^ — — — s> u ^ u o cj P O 3 O O s "(3 "2 o 3 I u •5 T3 s u 00 u u 3 a 3 O"
PAGE 112

to CO u u a (72 £3 o c u o ll u I to t c .o o "S a o A ^ C3 O O r*^ cd cd ^ ^ — O O

PAGE 113

103 I CO u 'o a on o c u o u u 3 I 2 I CO C O cS O o ea ^ ^ ^ BJ X) XI J3 VO VO CT\ 0\ O X C8 X X o o c o c o o _o .3 o o o o X X 2 2 — • cn 4^ 2 § I ^ B B II ^3 w S CO CO OJ

PAGE 114

104 I £ 2 o\ u c § I 5 o c o 3 u o c u u C8 c o 6 U U U CN (2 I 03 '3 u 00 o c u o u Oh to 2 I c o a < o d 2: CD CO o oo CTn O VO OO O O O 00 m o 00 o ^ o o o o o o o o o o r— — 00 VO — 1^ >/-> J3 J3 cn — VO CTn 00 at Si Si „ CO C4 r~ r00 o in ^ 00 ro 00 Cv :> o o (1>

PAGE 115

105 The first symptoms occurred in plots of A. lividus treated with conidial suspensions of P. amaranthicola. These symptoms were visible within 4 days of inoculation. Plant mortality 2 weeks after inoculation was minimal with no significant levels of mortality for any of the test species (Table 4-3 A). Four weeks after inoculation, plant mortality in plots of A. lividus treated with a double application of a high concentration of conidia had reached 95% (Table 4-3 B). Mortality in these plots was significantly greater than that in the control plots, but not different fi-om mortality in plots treated with any of the applications containing conidia. Mortality in plots treated with double applications of a high concentration of conidia was significantly greater than mortality in plots treated with mycelium. Mortality in A. viridus plots treated with conidial suspensions of the fimgus was significantly greater than that in the control plots 4 weeks after inoculation, ranging between 41 and 58% in the treated plots. The mortality in plots treated with mycelia was not significantly different firom control plots. Mortality of A. spinosus 4 weeks after inoculation reached 39% in plots treated with a double application of a high concentration of conidia. This level of mortality was not significantly different fi-om a single application of the same concentration, which resulted in 31% mortality, but was significantly greater than mortality levels in all other ti-eatinents. Control of the two A. hybridus accessions was not significant at 4 weeks after inoculation. Pigweed mortality at 6 weeks after inoculation reached 100% in plots containing A. lividus treated with single applications of conidial suspensions. Control plots of this species increased in plant mortality from 12% in both controls at week 4, to 72 and 80% at week 6, but there were no significant differences between contirol and fimgus-treated plots (Table 4-3 C ). Up to 96% mortality occurred in plots o^A.

PAGE 116

106 viridus treated suspensions of conidia, but no differences occurred among any of the treatments at week 6. Amaranthus spinosiis plots treated with a single application of a low concentration of conidia reached 70% plant mortality. This was significantly higher than mortality in control plots, but not different fi-om mortality levels after other single applications or the double application of a high concentration of conidia. Control of A. hybridus was insignificant. 1995 Interpretation of the results of the 1995 study were complicated by the presence of a substantial amount of insect damage to plants in all plots. No insecticide was used, as the effect of this type of application was not previously determined for this fimgus. Treatment effects were significant for A. lividus (P=0.0050) and^. spinosus (P=0.0025). Time was a significant factor for^. lividus, A. spinosus, and A. viridus (P=0.0001), with no interaction between treatment and time(P<0.05). Time was also significant for both A. hybridus accessions (P=0.0001) with interactions between treatment and time. Mortality for A. lividus at 2 weeks was 26% in plots treated with the single application of a high concentration of conidia. This was not statistically significantly different fi-om the mortality levels in other treatments or the control. Mortality levels of 29% and 38%) were achieved by the second week after inoculation in plots of A. spinosus in applications of a high concentration of conidia, but these were not significantly different fi-om control plot mortality (Table 4-4 A). Low levels of mortality for other species after 2 weeks were not significantly different among treatments.

PAGE 117

107

PAGE 118

108 I I O u a 00 o C U t> u Ph a: OOOOO — u C 'o E E -3 -3 'c 'S o o P 3 o O U c o .2 II T3 ^ C O o c o u \o ^ o o O 8 X X 3 O O S IS vd ^ O X X .2 2;*o o ^ ^ — V£5 (0 u .s S .CO CO 'C Q H X > § XI U cn 10 !2 a ea CO I. CO JO s u & § CO I o u CO O .3 > CO O u CO u CO .3 v. o s s u o u a u > .2 =0 £ <0 ^ o ?^ Oh ,W to a ^ U CO Si O Cw ^ 2 S S 2 S 6 fS -a S S 00 CO • §, <= 00 2 .3 CO CO I3 U 1/1 C C JJ o u € S 2 S p •S 73 ^ 3 2 S I o S o ?5 .3 u o2

PAGE 119

I I -Cl U5 a o u tn C o '>- oj O "E < Cm O d 2 CD ea ^ ^ J3 X> c4 ^ cQ c4 cd OS fN O ro ^ o o o o cd A o o >o TjVO ro m VO cnt^VOfNOOOVOVO l~-OOOsCTvVOP^CvoO cd^cdcd^cdcQcd (N0\OOOO>oO 3 >>00 B •5 'S o u u > .3 t: o c u u > .2 to ^ •S c 2 H >

PAGE 120

110 Mortality in plots of Amaranthus lividus 4 weeks after inoculation was 73% in the double application of the high concentration of conidia. This was significantly higher than mortality in control plots (Table 4-4 B), but not significantly better control than was achieved in other plots treated with conidial suspensions. Seventy-eight percent plant mortality occurred in ^. spinosus plots treated with a double application of the high concentration of conidia, but this was not different from mortality in other treatments, except in a single appUcation of a low concentration of conidia. Mortality in plots of A. viridus and the A. hybridus accessions was insignificant. Six weeks after inoculation, all plots of A. lividus, including controls, had greater than 95% mortality (Table 4-4 C). No significant differences existed between the treatments in A. viridus plots, with plant mortality ranging between 25 to 64%). Control of^. spinosus approached 100% m treated plots, but no significant differences were detected in treatments and controls. Mortality in A. hybridus plots reached 74% in treated plots and 50% in controls, but there were few differences among treatments by 6 weeks after inoculation. The A. hybridus triazine-resistant accession reached 61% plant mortaUty after treatment with a double application of the high concentration of conidia. Mortality in control plots reached 37%, and there were no differences detected among any treatments. Discussion The application of Phomopsis amaranthicola to species of Amaranthus in the field had a significant impact on the survival of the plants. Control of Amaranthus lividus was excellent in all three years of testing, with plant mortality of 100%) from at least one treatment each year. Disease progressed more quickly in plots treated with the fimgus

PAGE 121

I 41 I o u C/3 CO t: o U o u Ph CO o a: I I a o Z OO'-^OOO — ^ 0>nf><=> o s s o X X S S ^ o u a CO u CQ U o o u > "id i c u u u o. u 00 u 2 & > o :s •S c ^ eg ex u Q H

PAGE 122

I I u a. o c u o I l>5 a a o — ^ ca C3 CQ CQ CQ X X3 X> at CD cj to 1-^ S S o "2 S "2 6 'o .2 o o o .S o o S o ssSSss I •a 'S o u o o X X o o ui _tj ding 1 o u a VI COI JS CJ u CO CO U u O d II C u 1 s CO u tre ffer J3 u •3 CO u >, of ant cn o C s o icati sign o u 1-1 a u 2 > CO (8 .3 tte ortality same • :he s u 3 u o. CO u 00 CO u< S > o "o o CO C u c CO -- c CO u cn ges res u Ul t o. U CO u l-l .3 ent CO CO Pen Q H >• N

PAGE 123

I o u a. 00 o c u u u PL, to :i en C CO u "a o. o Z m 00 Tf Tj•>J (N • x> R3 ^ cd ^ vo ^ o 00 rr o rn (N 00 r~ vo a\ o o o o o r~o o o O CT\ O O O — I — ^ — c _o •a 3 'H 'S o o cj a o o >o o S s g X X o o u u JS o U C3 U o u a o •c o "S IS .3 I o E c •5 a a .3 s S Q H >

PAGE 124

114 than in control plots, but significant differences in pigweed plant mortality among treatments and controls were difficult to detect. Applications of conidia were generally more effective in causing plant mortality, but this was variable from species-to-species and year-to-year. Overall plant mortality was greatest in the 1993 and 1995 studies. This may have been somewhat influenced by the maximum relative humidity during the period of the study. The spread to control plots was great enough to eliminate significant differences between control and inoculated plots. The maximum relative humidity in 1995 was the greatest of the 3 years studied (Figure B1) and had the greatest amount of rainfall, while rainfall in 1993 was the least of the 3 years (Figure B-3). The minimum and maximum temperatures during the periods of the studies did not appear to be highly variable from year to year (Figure B-2), although this factor has been reported as being less significant in terms of disease development by species of Phomopsis (Eshenauer and MilhoUand, 1989; Rupe and Ferris, 1987) All species of Amaranthus tested were confroUed in at least 1 year of study, except for the triazine-resistant accession of A. hybridus. This accession and the triazine-susceptible accession had faster growth rates in comparison with the other species. Plants of these two groups were approaching the 6-leaf stage by the time of application of the fungus. The effect of the plant growth stage has been previously established, with the efficacy of P. amaranthicola being hindered by application to the more mature plants. An experimental design that included buffer rows of an immune plant, as was used in field trials testing the efficacy of CoUego for the control of northern

PAGE 125

115 jointvetch (Aeschynomene virginica [L.] B. S. P.), could have provided a means to confine secondary spread of P. amaranthicola, thus allowing more valid comparisons between inoculated plots and controls. This comparison was further complicated in the 1995 trial with the additional effect of the insect population. Not only were plants affected by the insects themselves, but there was the possibility that inoculum was being spread by this means as well (Shivas and Scott, 1993). In evaluating the effect of environmental factors on the spread and severity of disease caused by Phomopsis sojae in soybean, Rupe and Ferris (1987) reported that rain, duration of surface wetness and relative humidity were the most important factors in disease development. Rain events were the primary means of dispersal of the pathogen. Tekrony and EgU (1983) also found that Phomopsis spp. in soybean disease intensity was dependent more upon moisture than on temperature. Conversely, Udin (1996), reports that the temperature had an effect on the growth of Phomopsis spp. found on peach in the field. The former case appears to be more representative of the results with P. amaranthicola for the control of pigweeds. Two additional aspects of the field results are important to consider. Although there are few statistically significant differences between treated and control plots, the effects seen in the control plots resulted fi-om the spread of the fungus, indicating that it is possible for P. amaranthicola to produce secondary inoculum in the field. This could aid in controlling escapes, as well as newly emerging pigweed plants. In addition, although the differences between control and inoculated plots were not significant, high levels of pigweed plant mortality were achieved.

PAGE 126

CHAPTER V COMPATffilLITY, FORMULATION, AND APPLICATION Introduction The use of formulations for biological control agents is a relatively new application of technology that is well known to the chemical herbicide industry. Formulations or formulating agents are considered to be the crucial difference between the product being able to reach the general public and remaining in the laboratory. Most chemical herbicides could not be distributed without being combined with some other material. Thus, the active constituent is combined with a solvent, carrier, or surfactant in order to make its delivery and dispersal convenient, which is the broad definition of formulating (Anderson, 1983). Although this allows the consumer to spread a very small amount of active ingredient over a wide area, this may not be the only advantage to a formulated chemical. Chemical herbicides may gain their activity or have enhanced phytotoxicity due to the agent with which they are mixed. The formulation may also allow the agent to have a prolonged shelf-life or to be transported easily and without ahering the effectiveness of the product. In some cases, the carrier may serve as the formulation. This is usually only the case with dry pellet or powder apphcations. In addition to the basic formulation, materials that act as surfactants may be added to the formulated product to further enhance the activity or usability of the product. 116

PAGE 127

117 The same basic principles underlie the use of formulations for the application of biological control agents. Formulations are used most frequently to enhance the activity of the organism. The need for high levels of inoculum in the field and the normal requirement of an extended dew period for efficacious activity are two aspects of the development of a biological control agent that may be alleviated by the addition of a formulating agent. The formulation of biologicals is complicated by the need for the organism to remain alive and virulent through the processing. The convenience of application, which is so important for chemical formulation is almost a secondary consideration when a biological control organism is the active ingredient. The more important focus in formulating the biological control agent is improving the longevity and efficacy. In addition, the formulation of a biological may address the need for using combinations of biologicals and chemical pesticides. The most commonly used addition to a suspension containing a biological control agent, which for convenience and likelihood will be assumed to a conidial suspension in water, is that of surfactants. Since water is the most common carrier of biological control agents during the preliminary stages of development, the addition of a water-compatible agent is the most convenient next step. Surfactants may be of various forms that result in a variety of effects, but focus on modifying the surface properties of a liquid (Anderson, 1983). This may facilitate the spreading, emulsifying, or sticking properties of an agent in a water solution. Surfactants may have phytotoxic effects alone or may predispose the plant to infection as well as providing increased coverage. In some cases, particularly with products such as Tween 80 or Tween 20, detrimental effects may be seen in the biological control agent (Prasad, 1993). These are important characteristics to evaluate

PAGE 128

118 during the experimental phase of surfactant use as they may enhance or inhibit the effect of the biocontrol agent. Surfactants can be classified into groups based on their ionization in water and this may give some clue as to how a new or untried surfactant will behave in a biological control setting. The commonly used surfactants, Tween 20, Tween 80, Triton X-100, and Tergitol are all nonionic surfactants. These have been the most commonly used surfactants for initial experimentation. Silwet L-77 is an example of a new generation of surfactants, which are organosilicates. These surfactants reduce the surface tension far more than other types of siu^actants and may prove to be an important advancement for biological control agent applications, as they may allow for penetration of the cuticular area (Stevens, 1994; Zidack and Backman, 1996). One drawback with this type of nonionic surfactant is that in helping to breach the epicuticle, it may cause the plant to induce toxins, which can retard the growth of the pathogen (Womack and Burge, 1993). Other surfactants that act as emulsifying agents, which are used with more complex formulations, such as those that involve oil-based spore suspensions, are now more commonly used. In addition to the use of surfactants in water carried systems, a niunber of other formulations are now being explored. Gelatins have been added to spore suspensions and serve to stick the spores to the leaf surface, as well as providing a hydrophilic matrix in which the spores may germinate more readily in the absence of an adequate dew period (Shabana et al., 1997). This type of formulation appears to have lost much of its attraction as the solution is viscous and difficult to apply, as well as being relatively costly. Other simple adjuvants could include the addition of a water-soluble nutrient base that can be mixed with the water suspension prior to application. This is the case with

PAGE 129

119 Collego (Encore Technologies, Minnetonka, MN), which consists of a dried spore preparation that is resuspended in water and a prepackaged amount of sugar as an osmoticum and nutrient source to allow for the gradual rehydration and germination of spores of Colletotrichum gloeosporoides f sp. aeschynomene (Penz.) Penz. and Sacc. Use of sugar also has been reported for control of spurred anoda (Anoda cristata [L.] Schledt.) with Alternaria macrospora Zinmi. Control of Desmodium tortuosum (Sw.) DC. (Florida beggarweed) was enhanced when sucrose was added to the Colletotrichum truncatum (Schw.) Andrus and Moore spore suspension prior to application. Surfactants may prove to increase the even distribution of fungal spores within an aqueous solution by overcoming their hydrophobic nature (Bannon et al., 1990). These are essentially cases where adjuvants or surfactants have been used to increase the germination or efficacy of a pathogen, either attributable to the increase in germination or to the more efficient application and adhesion of the biological control agent. There has, within the last 5 or 10 years, been substantial progress in developing true formulations for biological control agents (Boyette et al., 1996; Connick et al., 1991; Daigle and Connick, 1990; Daigle and Cotty, 1992; Smith, 1991). The first attempts were complicated by the inability of many fimgal propagules to endure a great deal of processing, but in order to increase the long-term viability and to facilitate long-distance transport, this aspect of the development of a biological control agent has had to be addressed. Two general approaches have been taken that are directly related to the way in which the biological control agent is envisioned to act, either in the biological control of weeds or diseases. If the target site is the foliar portion of the plant, formulation tactics have been directed to either a fluid formulation or a formulation that is readily suspended in an aqueous solution. For the organisms that act at the soil level or are incorporated

PAGE 130

120 into the soil, solid formulations have been developed. In some cases, the formulated product may be a solid, but the organism may multiply on this substrate and be disseminated into the foliage in this maimer. One type of formulation used for biological control consists of encapsulation of the propagule in starch granules. This allows the agent to be delivered in a conveniently applied form; however, adherence to the leaf surface requires that there be preapplication wetting, which is not realistic for large-scale commercial use (McGuire and Shasha, 1992). A second type of formulation that has been the focus of most workers in the field of biological control of weeds utilizes invert-emulsion. This method involves the use of a variety of mixtiires composed of combinations of paraffin wax, mineral oil, soybean oil, and lecithin. These combinations are mixed with a spore suspension and an emulsifying agent. The first application of this type of mixture was with spores of Altemaria cassiae Jurair and BChan. to control sicklepod {Senna obtusifolia [L.] Irwin and Bameby) (Daigle et al., 1990). The ability of the oils to significantly depress the rate of water evaporation facilitates germination of the applied spores when there is an inadequate dew period. Additional work with this pathogen and target weed included the various aspects that must be considered when seeking a formulation that optimizes performance of the agents. The amendment of the invert-emulsion with nutrients increased the germinability, as did establishing the optimal pH of the solution (Daigle and Cotty, 1991, 1992). Since this first application, numerous potential biological control agents have been applied using this type of formulation with different combinations of components. Additional work with Altemaria Nees spp., A. crassa (Sacc.) Rands and A. cassiae, indicated that the formulation of these mycoherbicides as invert-emulsions reduced the necessary inoculum threshold (Amsellam et al., 1990). The work with these two

PAGE 131

121 pathogens indicated that conidia were receiving additional benefits firom the formulation ingredients beyond that provided by the prolonged availability of water. During this period of research on the effects of invert-emulsion on the disease development, few experiments included adequate controls that utilized the emulsion alone to determine what, if any, effects these oil and wax mixtures would have on the plant. In this case, with Altemaria spp., the assumption was that the fungus was enhanced in some way, rather than the plant being predisposed. The potential for phytotoxicity has been assessed in other studies and this has affected the choices of the components for the formulations. A great deal of work has been done in this area with the Colletotrichum truncatum for the control of hemp sesbania (Sesbania exaltata [Raf ] Rydb. ex Hill); Colletotrichum gloeosporiodes f. sp. aeschynomene for the control of Senna obtusifolia; and Colletotrichum orbiculare for the control of Xanthium spinosum. Control of hemp sesbania was dramatically improved by the use of the invert-emulsion in the absence of dew, again supporting the hypothesis that greater control is achieved through providing a prolonged period of water availability (Boyette, 1995). The additional work with the Colletotrichum spp. indicate that there is a direct effect on the plant fi-om some types of oils (Auld, 1993; Klein et al., 1995). Reports of host-range expansion through the use of the invert emulsion formulation further support the idea of the effect of oils on the plant contributing to disease progress. Although the use of this type of formulation to increase the number of plants for which the biological control agent may be used is a positive prospect for enhancing organisms that have extremely limited host ranges, host ranges might also be altered to include crop plants in which the agent is applied.

PAGE 132

122 In the case of the expansion of the host range of Alternaria crassa, a biological control agent for jimsonweed {Datura stromium L.), a number of crops were affected, including tomato {Lycopersicon esculentum Mill.), eggplant {Solatium melonegro L.), potato (iS". tuberosum L.), and tobacco {Nicotiana tabacum L.) (Yang et al., 1993). Two additional formulations that have become increasingly popular for both biological control agents of weeds and for diseases are alginate pellets and one referred to as "Pesta." These solid formulations are easily adapted to a number of different fungi. Alginate pellets have been used to deliver a substantial number of biological control agents, including Alternaria macrospora, A. cassiae, Fusarium lateritium Nees:Fr, Colletotrichum malvarum (Braun. and Casp.) South., Fusarium solani (Mart.) Sacc. f sp. cucurbitae Snyd. and Hans., Talaromyces flavus (Klocker) Stolk and Samson, Gliocladium virens Mill., Gold., and Foster (DeLucca et al., 1990), Penicillium oxalicum Currie and Thorn., and Trichoderma viride Pers:Fr. (Daigle and Cotty, 1992). This formulation can be manipulated in a number of ways to optimize the development of the agent in the field, as well as increasing the ease of application. Organisms that have been formulated in this manner have an excellent shelf-life compared to the unformulated organisms, and the composition actually allows the formula to act as a production system. This type of system optimizes the potential of the agent by providing high concentrations of the fi-eshest inoculum possible, and it can be manipulated to provide the optimal conditions for sporulation. Rather than quantifying the inoculum at the time of application and introducing it into the environment, depending on that source to provide adequate infection, this system allows fi-esh spores to be produced fi-om the mycelium or spores that have been

PAGE 133

123 incorporated into the pellet. Nutritional amendments, such as sugars or com, soy, or rice meal as a carbon source, or amino acids, just as in a growing medium, may be incorporated into the formulation to provide a base for improved germination as well. This method of formulation appears to be relatively inexpensive, versatile and can produce inoculum to virtually any size or weight standard (Gemeiner et al., 1991) This also has the advantage that additional stickers may be added that allow the alginate to adhere to the surfaces of seeds to protect them against a pathogen with an encapsulated antagonist (Andrews, 1992). The "Pesta" formulation is also a means of producing inoculum within the formulated material. This material consists of a wheat-gluten mixed with the fungus to prepare sheets of material that are then dried and crumbled. This material, used with Fusarium oxysporum Schlecht.:Fr. to control sicklepod, was foimd to retain viability for 1 year, although viability was somewhat reduced (Boyette et al., 1993). This formulation allows for a convenient means of delivery and results in the production of secondary cycles of conidia in the field. When agricultural byproducts, such as com cobs or rice husks, are used to produce inoculimi, the pathogen may be stored on this ground material and the material then applied directly to the field (Batson and Trevethan, 1988). This is a case of the medium of spore production acting as a carrier, rather than a true formulation. This could also be said of the use of a liquid medium that is incorporated with vermiculite or perlite for field application. Although these methods may provide inexpensive means of producing inoculum in the field, prolonged storage of these types of materials does not seem feasible. The studies that have examined the viability of the encapsulated pathogen after prolonged

PAGE 134

storage have not addressed the potential for contamination of this material or the degradation of nutrients in the mixture. These factors could result in not only a loss of viability, but of infectivity. In evaluating the common formulations that have been utilized for the enhancement of biological control agents, a number of components would contribute to a system designed for the formulation of Phomopsis amaranthicola for the control of pigweeds. One interesting aspect that has been explored recently is the use of simscreens to protect spores that are not melanized (Prasad, 1993). Although no plant-effects were evaluated in this study, if the fungus could be formulated with an ultra-violet protectant, it was able to withstand a wider range of enviroiunental conditions. Formulations that prolong the availability of free water in contact with the conidia of the biological control agent would also be an interesting avenue for exploration related to the development of a formulation of P. amaranthicola. The knowledge gained from past experimentation in invert-emulsion formulation has led to the predominating use of vegetable oils, and this freatment appears to cause no alteration to the cuticular layer of the leaf surfaces of the plants that have been examined (Auld, 1993; Egley and Boyette, 1995). Although the effects that different types of oils have on P. amaranthicola would have to be examined in vitro to determine if there would be in vivo effects, the invert-emulsion formulation has the potential to overcome the dew-period requirement of the pathogen, while still providing a relatively homogeneous and easily applied material. Other interesting aspects that should be evaluated involve the potential use of other adjuvants that could act as stickers or spreaders to allow for a more uniform

PAGE 135

125 application of the fungus. The potential effects of these types of surfactants could be tested using a simplistic microscopic evaluation of the impact these additives have on germ-tube development or cell contents and integrity. It might also be feasible in this system to apply the fungus with the addition of a minor nutritional supplement to encourage conidial germination. The alginate or "Pesta" approaches have been utilized with a number of species of Colletotrichum, which produce their spores within a gelatinous matrix from an acervulus (Connick et al., 1991). The modes by which these spores, that are produced on the granular material applied to the soil, reach the plant to cause infection have not been reported thoroughly. It would seem that the fungus incorporated into the material would have to be in direct contact with the emerging plant or that a rather serendipitous rain event would have to occur immediately or soon after sporulation. The high levels of mortality that have been achieved, at least in the small-pot, greenhouse setting seem to indicate that there is effective contact (Connick et al., 1991). If these aspects can be clarified, it may be possible that this type of formulation could be utilized to provide inoculum of P. amaranthicola, due to the similar manner in which the spores are produced. If the pathogen could successfully infect the pigweed stems or be present in the field so that sporulation could coincide with leaf emergence, this system could be useful. One aspect of utilization of fungi and bacteria as biological control agents for weeds that may be more important than is reflected in the literature, is the application procedure used for field use. In reviewing the literature related to the development of plant pathogenic fungi, it becomes apparent that there is no shortage of agents showing promise at the greenhouse phase of testing (Charudattan, 1990). Many of

PAGE 136

126 these organisms then disappear from the Hterature. Although some fungi with promise are tested in the field and these results are reported, many pathogens, for which small-scale field application would have been the next step, either result in significant decreases in efficacy in the field or are not reported upon subsequently. The materials and methods of many field-testing procedures often lack information concerning the type of spray equipment or propellant used (James and Sutton, 1996; Kohl et al., 1995; Murray, 1988). Mintz et al, (1992), in evaluation of Aposphaeria amaranthi, later correctly identified as Microsphaeropsis amaranthi, report the use of COj as the propellant. In successfiil field trials of Colletotrichum truncatum for the control of hemp sesbania {Sesbania exaltata) Boyette et al. used an air-assist sprayer (1993). Studies by Egley et al. (1993) on the same organism utilized the same sprayer system. Klein et al. (1995) report the use of compressed nitrogen for application of Colletotrichum orbiculare for control of Xanthium spinosum. Morin et al. (1990) evaluated the effect of Phomopsis convolvulus on field bindweed; field studies were conducted using an air-pressurized sprayer. Field trials using Pseudocercospora nigricans (Cooke) Deighton as a biological control agent for sicklepod {Senna obtusifolia), performed by Hofineister and Charudattan (1987), utilized a carbon dioxide backpack sprayer. In this study the organism affected only the canopy height, while having greater efficacy in greenhouse trials. There are many other studies that may have utilized COj that have not reached the literature. Field trials conducted with P. amaranthicola applied to species of Amaranthus were performed using a COj backpack sprayer (Chapter IV). Although the season-long efficacy on some plant species was excellent, the Amaranthus spp.

PAGE 137

127 most commonly used for greenhouse tests with high levels of mortality were not controlled in the field (see Chapter IV). In a regional test of Altemaria cassiae as a mycoherbicide for sicklepod, there were site-to-site differences in efficacy. The type of spray applicator used by the various researchers was imexplained (Charudattan et al.,1986). Work by Braverman and Griffin (1995) established that the use of a COj backpack sprayer caused significant acidification of the spray solution. Their study was aimed at determining the influence of the drop in the hydrogen-ion concentration of the spray solution on the efficacy of chemical herbicides, stating that many herbicides may become less soluble at low pH levels; hydrogen-ion concentration may also affect herbicide absorption. These authors report that the addition of bicarbonate alleviated this effect. The decrease in pH units could have an effect on the growth and efficacy on potential biological control agents (Dillard,1988; Marin et al., 1995; Murray, 1988; Valovage and Kosaraju,1992). An important area of research that is beginning to receive more attention is the compatibility of biological control agents with multiple crop protection strategies in an integrated pest control program. This may include the use of multiple biological control agents (Chandramohan and Charudattan, 1996; TeBeest and Templeton, 1985), or the timing of applications of biologicals with cultural disease and weed management practices, such as tillage practices that minimize weed effects or the appUcation of low rates of herbicides to predispose weeds to infection. For an agent to be successfully incorporated into agricultural practices that are already established, such as the use of chemical fungicides or herbicides, it is important to determine what

PAGE 138

128 the effects of these components might be on the biological agent. It has been found that chemical pesticides may serve as a nutritional base for some microorganisms or otherwise enhance the disease effects that plants incur from fungal plant pathogens (Altman and Campbell, 1977; Altman and Rovira, 1989; Cerkauskas,1988; Johal and Rahe, 1990). The primary goal of testing the effect of chemicals on potential biological control agents is to determine the incompatible reactions that may limit the use of the organism. In the case of C. gloeosporiodes f sp. aeschynomene, or CoUego, it was found that the fungus was compatible with tank-mixed applications of herbicides, such as bentazon (3-(l-methylethyl)-(l//)-2,l,3-ben20thiadiazin-4(3//)-l,2,2-dioxide) or acifluorfen (5-(2-chloro-4-(trifluoromethyl)phenoxy)propanoic acid). This organism was also found to be compatible with a nimiber of insecticides and fungicides (Charudattan, 1993). The agent DeVine, on the other hand, was found to be detrimentally affected by the addition of any wetting agents, fertilizers, or chemical pesticides. Reviews of the materials that have been tested with several biological control agents are provided by Charudattan (1993) and Hoagland (1996). Although fungal plant pathogens that are developed as biological control agents appear to be most commonly compatible with insecticides, there are few other generalizations that can be drawn. Thus, it is imperative that each individual potential agent be tested before tank-mixed or other combined use is recommended. Accordingly, a series of experiments were performed to determine the effects of adjuvants, pesticides, and delivery system on the growth of Phomopsis amaranthicola and its efficacy in the control ofAmaranthus hybridus, as a representative species.

PAGE 139

129 Materials and Methods Effect of Amendments To determine the effect that a number of potential amendments might have on the growth and efficacy of P. amaranthicola for the control of Amaranthus hybridus, a conidial suspension of the fungus was prepared by removing conidia from 12to 14day-old V-8 cultures by addition of 10 ml of sterile deionized water to plates and then gently scraping the plates with a rubber policeman. The suspensions were then filtered through sterile cheesecloth and diluted to approximately 1x10* conidia/ml as determined by hemacytometer coimts. Suspensions were then amended with the following materials: Kelgin, a food grade algin (Nutrasweet Kelco Co., Monsanto, San Diego, CA); Kelzan, xanthan gum, now marketed as Keltrol (Nutrasweet Kelco Co., Monsanto, San Diego, CA); Natrasol, hydroxyethyl cellusose (Aqualon Co., Wilmington, DE); Silwet L-77, a siUcone polyethercopolymer (Loveland Industries, Inc., Greeley, CO); Tween 20, polysorbate 20 (Sigma Chemicals, St. Louis, MO); Triton X-100, octylphenoxypolyethoxyethanol, nonionic surfactant (Union Carbide, Houston, TX); Metamucil; and an invert emulsion (Yang et al., 1993) composed of 80 ml Sunspray 6 agricultural oil (Sun Co., Inc., Marcus Hook, PA), 20 ml of light mineral oil (Fisher Scientific), 2 ml of Myverol(a monoglyceride serving as an emulsifying agent; Eastman Chemical Co., Kingsport, TN) and 102 ml of the aqueous conidial suspension. These products were used at the following rates: 0.05% Kelgin, 0.05% Kelzan, 0.05% Natrasol, 0.25% Silwet L-77, 0.3% Tween 20, 0.05% Triton X-100, and 0.5% Metamucil.

PAGE 140

130 Plants of Amaranthus hybridus L., smooth pigweed, were used for greenhouse experiments. Seedlings were grown from seed (Azlin Seed Service, Leland, MA) in the greenhouse and transplanted at the cotyledon stage to three plants per clay pot containing Metromix 300 (Scott's-Sierra Horticultural Products Co., Marysville, OH). Plants were then maintained in the greenhouse until they had four true leaves. Conidial suspensions were applied using hand-held pump sprayers using 3 ml per plant. Control plants were treated with each of the amendments in water with no conidia. Plants were then exposed to a 12-h dew period at 25C^'"2C and kept in the greenhouse for 8 weeks. Data were taken as the proportion of dead plants. The experiment was performed three times. The proportions were transformed using the arc-sine square-root transformation. Analysis of variance was used to determine if the trials could be combined and to determine the significance of the treatments. Means were separated using Tukey's HSD test. The same solutions were also prepared for determining of the effect of each amendment on the germination of a conidia of P. amaranthicola. Conidial suspensions containing each amendment were sprayed onto water agar plates with 0.02% sucrose with a compressed-air sprayer (138 kPa). Plates were then allowed to incubate in ambient light for 24 h and the proportion of germinating conidia was determined by counting 50 conidia from each of three replicate plates of each amendment. This experiment was performed three times. Proportions were transformed using the arc-sine square-root transformation. Analysis of variance was used to determine if the trials could be combined and to determine the significance of the freatment. Means were separated using Tukey's HSD test.

PAGE 141

Effect of Pesticides The effect of a variety of pesticides on the germination of a conidia of P. amaranthicola was tested by preparing conidial suspensions as previously described. The suspensions were then mixed with several individual pesticides. The following herbicides were tested: Roimdup (Monsanto Co., St. Louis, MO), common name glyphosate (N-[phosphonomethyl] glycine in the form its isopropylamine salt), used at the rate of 21.1 ml/L; Surflan (Dow Elanco, IndianapoHs, IN), oryzalin (3,5dintro-N4, N4-dipropyl-sulfanilamide), used at the rate of 21.1 ml/L; DMA (Dow Elanco, Indianapolis, IN), dimethylamine salt of 2,4-D (2,4-Dichlorophenoxyacetic acid), used at the rate of 1.17 L/hectare; Pramitol (Ciba-Geigy, Greensboro, NC), prometon (2,4-bis[isopropylamino]-6-methoxy-s-triazine), used at the rate of 392 g a.i./hectare; and Lexone (DuPont Agricultural Products, Wilmington, DE), metribuzin (4-aniino-6-[ 1 1 -dimethylethyl]-3-[methylthio]1 ,2,4-triazine-5 [4H]-one), used at the rate of 280 g a.i./hectare. The fungicides that were tested included Benlate(DuPont Agricultural Products, Wilmington, DE), benomyl (methyl l-[butylcarbamoyl]-2benzimidazolecarbamate), used at the rate of 1 5 g/L; Kocide (Kocide Chemical Corp., Houston, TX), copper hydroxide, used at the rate of 2.2 Kg/hectare; Karathane(Rohm and Haas Co., Philadelphia, PA) (2,4-dinitro-6octyrphenylcrotanate), used at the rate of 1.27 g/L; and Bravo (ISK Biotech Corp., Mentor, OH), chlorothalonil (tetrachloroisophthalonitrile), used at the rate of 15 g/L. Each preparation containing the pesticide and conidia was sprayed onto water agar plates containing 0.02% sucrose using a compressed-air sprayer (138 kPa). Plates

PAGE 142

132 were then allowed to incubate in ambient light for 24 h, and the proportion of germinating conidia was determined by counting 50 conidia from each of three replicated plates of each amendment. This experiment was performed three times. Proportions were transformed using the arc-sine square-root transformation. Analysis of variance was used to determine if the trials could be combined and to determine the significance of the treatment. Means were separated using Tukey'sHSD test. Effect of Invert Emulsion In a brief study involving the effect of invert emulsion on the efficacy of P. amaranthicola on mature plants and on the host range of the organism, conidial suspensions were prepared as indicated above. An invert emulsion containing P. amaranthicola a conidia, as described earlier, was used to inoculate six pots each of A. hybridus plants of growth stages 4 and 5 (see Chapter EI). Inoculations were also done with conidia suspended in water and in a 0.05% (m:v) solution of psyllium mucilloid. Plants were exposed to 24 h of dew, in the dark, at 25C*''2C. The plants were then placed in the greenhouse and observed for symptom development and plant mortality over 6 weeks. Additionally, suspensions of conidia of P. amaranthicola in an invert emulsion preparation were used to inoculate eggplant, lettuce, and tomato, all of which had been tested previously for their susceptibility to the organisms formulated in the psyllium mucilloid. All plants were immune to infection by P. amaranthicola when conidia were amended with the humectant. All plants were grown from seed and thinned to one to four plants per pot, depending upon the species. Amaranthtis hybridus plants were also inoculated to ensure viability and infectivity of the conidial

PAGE 143

133 suspension. Data were taken as the proportion of dead plants. The proportions were transformed using the arc-sine square-root transformation. Analysis of variance was used to determine if the trials could be combined and to determine significance of main effects. Means were separated using Tukey's HSD test. Effect of Application System In order to determine if the type of propellant used in the application system had an affect on the growth and development of P. amaranthicola, experiments were performed using a compressed-air sprayer and a CO2 backpack sprayer for application. Suspensions of conidia of P. amaranthicola were prepared as before. The suspensions were not amended with any other materials. The suspensions were sprayed on water agar plates amended with 0.02% sucrose immediately after pressurization at 210 kPa, and then 10, 20,30, and 60 minutes after pressurization. Three plates were used for each time and system combination. Plates were then incubated for 24 h in ambient light at room temperature. The proportion of germinating a conidia was determined by counting 50 conidia fi"om each replicate plate. This experiment was performed twice. The proportions were transformed as before. Analysis of variance was used to determine if the trials could be combined and to determine significance of treatments. Means were separated using Tukey's HSD test. The second experiment was performed using conidial suspensions prepared as before, and the suspensions were pressurized and applied to plants of A. hybridus using the compressed-air and COj backpack sprayers. Plants were sprayed immediately after pressurization, and then 10, 20, 30, and 60 minutes after

PAGE 144

pressurization. The plants were then exposed to 12 h of dew in a dark dew chamber at 25C''''2C. Plants were moved to the greenhouse and observed for disease development for 6 weeks. A 12-point disease rating system based on the Horstfall Barret scale (Campbell and Madden, 1990) was used for assessment of disease with 0 being no visible symptoms and 12 being plant death. Each treatment combination was replicated three times using pots with three plants per pot. This experiment was performed twice. Analysis of variance was used to determine if the trials could be combined and to determine the significance of the main effects and any interactions. Means were separated using Tukey's HSD test. Results Effect of Amendments The three trials of this experiment were combined based on the mean square errors being of the same magnitude, 0.007, 0.005, and 0.005, although there was variation between trials 2 and 3 and trial 1 within the Kelgin and Triton X-100 treatments. The effect of surfactant was significant at the P=0.0001 level. Germination of the a conidia of P. amaranthicola was significantly inhibited when the conidial suspension was combined with Silwet-L-77 (Figure 5-1). None of the other materials appeared to have an inhibitory effect on the growth of P. amaranthicola, nor did they increase germination when compared to the germination in water. Results jfrom the inoculation of Amaranthus hybridus plants with conidia of P. amaranthicola amended with each of the materials above were quite variable (Table 5-1). The levels of mortality achieved were low compared to efficacy in other

PAGE 145

135 Figure 5-1. Effect of amendments on the germination of a conidia of Phomopsis amaranthicola. Data are the results of three combined trials. Bars with different letters represent significantly different germination based on the arc-sine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (a=0.05). Invert emulsion is composed of Sunspray 6 agricultural oil, light mineral oil, and Myverol.

PAGE 146

experiments. Trials were combined due to mean square errors of the same magnitude (0.037, 0.046, and 0.064) and insignificance of the effect of trial (P>0.05). After combining trials, the r-square was equal to 0.6244 and coefficient of variation equal to 118.24. Invert emulsion with P. amaranthicola was the most effective treatment, with mortality of 74%, although treatment of plants with invert emulsion without the fungus was 33%. Thus, the amendment itself has considerable phyto toxicity. None of the other materials had any effect on the growth of plants when applied alone (Table 5-1). Effect of Chemical Pesticides The three trials of this experiment were combined for analysis based on the mean square errors being of the same magnitude (0.009, 0.001, and 0.005) and the insignificance of trial as a factor (P>0.05). The effect of pesticide was found to be significant (P=0.0001) with an r-square of 0.905 and coefficient of variation of 22.43. There was no significant difference between germination rates in water (none), Benlate, Lexone, Pramitol, Surflan, and DMA; germination ranged from 71 to 86% (Figure 5-2). There was a significant decrease in germination of a conidia of P. amaranthicola when the fimgus was combined with Roundup, Bravo, Kocide, and the fimgicide Karathane. Spore germination ranged from 21% with chlorothalonil to 0 with Karathane. The only fungicide tested that did not affect P. amaranthicola was Benlate, with germination of 76%. The only herbicide that had a detrimental effect was Roimdup, with only 2% germination of a conidia.

PAGE 147

137 Table 5-1. Effect of amendments on the efficacy of Phomopsis amaranthicola on mortality of Amaranthus hybridus. Amendment' Percent Mortality Without Phomopsis amaranthicola With P. amaranthicola None Psyllium mucilloid Invert emulsion' Natrasol Silwet L-77 Tween 20 Kelzan Triton X-100 Kelgin "Data are the results of three combined trials. ''Values with different letters represent significantly different mortality based on the arc-sine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (a=0.05). 'Invert emulsion is composed of Sunspray 6 agricultural oil, light mineral oil, and Myverol. Oa" 15 ab Oa 33 b 33 b 74 c Oa 7a Oa 11 ab Oa 11 ab Oa 15 ab Oa 11 ab Oa 4a

PAGE 148

138 Effect of Invert Emulsion Three trials testing the effect of invert emulsion on the host range of P. amaranthicola were combined because of the mean square errors being of the same magnitude (0.171, 0.182, and 0.251) and trial effect being insignificant(P=0.5384). The surfactant was the only significant effect (P=0.0001), with plant effect P=0.7422 and fungus effect P=0.3698. There were no interactions between the main effects. Application of the fungus, P. amaranthicola, in an invert emulsion caused significant mortahty of lettuce, tomato, and eggplant (Figure 5-3). The same plant species were killed by the application of the invert emulsion alone. None of the plants was affected by application of the fungus in psyllium mucilloid, nor were they affected by application of the mucilloid alone. AppUcation of these treatments to A. hybridus plants resulted in typical symptom development and plant mortahty of 95% after application of the invert emulsion plus the fungus, and 33% mortality with invert emulsion alone. Fifty-five percent mortahty was recorded for plants treated with P. amaranthicola in mucilloid, and no mortality occurred in A. hybridus plants treated with mucilloid alone. The effect of amendment on the control of older plants was difficult to interpret. The trials had mean square errors of the same magnitude 0.0534, 0.0861, and 0.0855, and the effect of trial was not significant (P>0.05); therefore, the trials were combined for analysis. The analysis of the resulting data set indicated that the surfactant was significant (P=0.0014), the presence or absence of the fungus was significant (P=0.0001), the growth stage of the plant was not significant (P=0.3881), and there was a significant interaction between surfactant and fungus (P=0.0057). Mean separation using least

PAGE 149

squares mean was performed combining the data for amendment and fungal treatments across plant growth stage. In the presence of the fungus, the differences between the amendment treatments were insignificant (Table 5-3). There was, however, a significantly greater mortality of plants treated with the invert emulsion alone without the fungus than in those treated with water or psyllium mucilloid alone (a=0.10). Mortality of A. hybridus plants was greater in plants treated with suspensions containing P. amaranthicola with water and psyllium mucilloid that in treatments containing water or psylhum mucilloid alone. This, however, was not the case with the application of invert emulsion. There was no significant difference in plant mortality when A. hybridus plants treated with invert emulsion alone were compared to plants treated with the invert emulsion containing P. amaranthicola. Effect of Application Svstem The results of three trials to determine the effect of application system on germination of a conidia of P. amaranthicola were combined as there was no significant effect of trial (P=0.9800). Germination was reduced from approximately 85% in conidia sprayed with the compressed-air sprayer, and 65% of those that were sprayed with COj germinated. This was a significant decrease in germination (P=0.0001) (Figure 5-4). Time imder pressure did not have a significant effect (P=0.378). The data obtained for each system at each time is listed in Table 5-4. The lack of significance of time under pressure allowed the data to be combined for each system over time. The effect of application system on disease development of A. hybridus caused by P. amaranthicola was significant (P=0.0001); the disease severity was greater in the case

PAGE 150

of the compressed-air application system (Figures 5-5 and 5-6). Two trials were combined for analysis due to the effect of trial being insignificant (P=0.078) and mean square errors being of the same magnitude (0.05 1 and 0.083). Time under pressure did not have a significant effect (P=0.0976). The data for each system was pooled over time and means were separated using Tukey's HSD (a=0.05). Discussion There are a substantial number of factors that can lead to the success or failure of a potential biological control agent for weeds. One of the important aspects to examine is the potential for developing formulations of the organism that can help to promote its growth or efficacy. The studies of the effects of amendments on the growth and efficacy of Phomopsis amaranthicola for the control of Amaranthus spp. have led to the use of a psyllium mucilloid as an amendment to facilitate the germination of the a conidia. This decision is based upon the fact that the germination rate with this amendment is the greatest of all amendments tested, and, although there are amendments that have statistically equal germination rates, each has other factors that minimize their attractiveness as components for use with P. amaranthicola. Many of the gel formulations, including xanthan gvmi, hydroxymethylcellulose, and algin, are viscous and difficult to work with. In addition, their effects on disease development and mortality of Amaranthus hybridus is not impressive; in studies on the effect of amendment on plant mortality, none of the suspensions promoted substantial mortality. The extremely low levels of mortality achieved with the amendments can be attributed to the exposure of plants to only 12 h of dew. Plants of the four-leaf stage were used for this study and had substantial additional growth before the first symptoms

PAGE 151

141 Ia o. 3 T3 C 3 O o > ta C/5 U T3 U E o c o m o 2 S3 g U011BUIUU39 )U33i3({ 3 b b CO

PAGE 152

142 as o c
PAGE 153

143 Table 5-3. Effect of amendment on the control of mature Amaranthus hybridus plants with Phomopsis amaranthicola as expressed by percentage of plant mortality". Surfactant/Fungus Treatment" P. amaranthicola present P. amaranthicola absent Water 48a''A' Water 12bA Psylliimi mucilloid 56aA Psyllium mucilloid llbA Invert emulsion 48aA Invert emulsion 39aB Plants of growth stages 4 and 5 were used for this study. Growth stage 4) 6-8 leaf stage = six fiiUy expanded leaves with the seventh and eighth leaves just beginning to expand (approximately 26 days after planting). Growth stage 5) flowering = axillary buds present and producing flowers (approximately 30 days after planting). "There was no significant difference between growth stages (P=0.3881); therefore, the data expressed are the average mortahty for each surfactant and fimgus combination pooled across growth stage. The interaction between fimgus and surfactant was significant (P=0.0057). ^ Means with the same lowercase letters in the same row are not significantly different based on the least squares mean separation (a=0.10). ^ Means with the same capital letter in the same column are not significantly different based on the least squares mean separation (a=0.10). Table 5-4. Germination of a conidia of Phomopsis amaranthicola after pressurization with carbon dioxide or air. System^ Time 1 2 3 4 5 Carbon dioxide 56 75 65 59 62 Air 81 87 85 87 90 ^ There was no significance of the main effect of time, but the difference between germination rates for the two pressurization systems was significant (P=0.0001).

PAGE 154

144 Figiire 5-4. Effect of application system with carbon dioxide or air on the germination of a conidia of Phomopsis amaranthicola. Data are the results of three combined trials. Bars with different letters represent significantly different germination based on the arc-sine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (a=0.05).

PAGE 155

Carbon dioxide Air Application System Figure 5-5. Effect of application system on efficacy of Phomopsis amaranthicola on Amaranthus hybridus plants. Disease severity was visually assessed based on a scale of 0-12, with 0 being no visible symptoms and 12 being plant death. Data are the results of two combined trials. Bars with different letters represent significantly different germination based on the arc-sine square-root transformed proportions with mean separation by Tukey's Honestly Significant Difference test (a=0.05).

PAGE 156

146 Figure 5-6. Effect of application system on the efficacy of Phomopsis amaranthicola on Amaranthus hybridus plants. The plant on the left was treated with P. amaranthicola applied with a carbon dioxide backpack sprayer after 20 minutes of pressurization. The plant on the right was treated with the fiongus pressurized for the same amount of time with a compressed air sprayer.

PAGE 157

appeared. The more mature plants were more difficult to control, as was observed in previous experiments. The efficacy of P. amaranthicola when applied in an invert emulsion was significantly increased, but this formulation has a detrimental effect when applied to plants even without the fungus, indicating that there is potential for crop phytotoxicity as well. This is further exemplified by the study involving the use of the invert emulsion on plants that were originally tested for susceptibility to P. amaranthicola using the psyllium mucilloid. Plants in this study were predisposed to infection, but P. amaranthicola could not be isolated from the dead eggplant, lettuce, and tomato plants. Although many studies have elaborated on the positive effects of invert emulsion formulation, there could be problems with the host range of the agent applied in the field with the invert emulsion. The host range results obtained by using aqueous inoculum suspension or another amendment may be different fi-om those of invert emulsion. This would not pose a problem in situations where the biological control agent is applied to row middles, to the ground, tree crops, or during the fallow period. The use of the invert emulsion would not provide a significant advantage in the case of P. amaranthicola due to the characteristics of the target weeds and the efficacy of the organism in other formulations. Another consideration with this type of formulation is the requirement of the expected user. As an example, according to the Policy and Procedures Manual, Certification Standards Materials List of the Florida Certified Organic Growers and Consumers, Inc. (1997), the use of this type of formulated product would be prohibited for organic growers.

PAGE 158

148 There is the potential for P. amaranthicola to be used in an integrated approach to manage pigweeds and amaranths. The compatibility of the fimgus with several herbicides that are commonly used for the control of pigweeds makes it more convenient for use and, thus, adds to its potential for large-scale use. The study involving the effects of pesticides leads to the conclusion that fungicides that may be used in the crop setting, particularly for pathogens that are closely related to Phomopsis spp., would have to be applied separately, and the timing would be an important factor in the efficacy of the biological control agent. It is recommended that any potential biological control agent should be tested for compatibility with the components of any system in which it is to be used. Specific testing of each organism in each system is required, but a rational approach can be implemented that is based upon the putative or known activities of the chemicals. There are a few examples in the literature of field applications of fimgal plant pathogens for biological control of weeds that utilize a CO2 backpack sprayer (Mintz et al., 1992); however, the results for P. amaranthicola would suggest that this organism would benefit fi-om application with a compressed-air sprayer, rather than with a COjpropelled system. The effect on germination of conidia could potentially limit the inoculum that is available fi-om the initial application. Although this may not affect the long-term control of the weed, as the secondary inoculum produced in the field may be adequate to cause plant mortality, this is highly dependent upon the environmental conditions present. Carbon dioxide pressurization significantly depresses the pH of the pressurized solution (Braverman and Griffin, 1995, and Table D-1). Studies performed in

PAGE 159

149 conjunction with this work indicate that pressurization of tap water for as Uttle as 20 minutes caused a drop to pH of 4.5. It was found that the germination of a conidia of P. amaranthicola exposed to pH of 4.0 was substantially reduced (Table D-3). In addition, it was found that solutions containing many of the amendments tested for their effect on germination of a conidia of P. amaranthicola caused decreases in pH when added to tap water (Table D-2). These studies lead to the conclusions that P. amaranthicola, while adequately formulated for greenhouse studies with psyllium mucilloid, requires more development for large-scale field use. The variability in efficacy of the organism, which is evident fi-om study to study, indicates that a formulation that could provide inoculimi stability and increased efficacy would be advantageous. A system is required that allows for the inoculum to be produced and stored so that conidia of the same age are used in all studies or field uses. Other possible factors that could contribute to variability include fluctuations in temperature during inoculum production, as well as the periods of time that suspensions are allowed to stabilize.

PAGE 160

CHAPTER VI SUMMARY AND CONLCUSIONS Plants belonging to the genus Amaranthus are of considerable concern as weeds in agronomic, vegetable, and fruit crops, as well as in pastures. The ability of these weeds to compete with crops causes significant yield losses and contributes to the cost of crop production due to the necessity for chemical herbicide use and intensive cultural management practices. Occurrence of populations of weed species that are resistant to chemical herbicides is increasing, and the number of classes of herbicides to which they are resistant is also expanding. This phenomenon, coupled with increasing public concern over the intensive use of chemical pesticides calls for the development of alternative control measures. Organisms with potential for biological control of these weeds include insects as well as plant pathogenic fungi (Burki et al., 1997; Mintz et al., 1992). It is possible, with enough study, to develop an integrated weed management strategy that could incorporate several of these components for the control of these weeds. In 1992, a pycnidial fimgus was determined to be the causal agent of a stem and leaf blight of Amaranthus sp. observed in the field. The morphological characteristics of the fungus, as well as the partial genetic characterization using the sequence information of the internal transcribed spacer regions of the rDNA, have led to the description of this organism as a new species, Phomopsis amaranthicola Rosskopf, Charudattan, and Shabana. Further analysis of this fungus, including sequencing of 150

PAGE 161

151 additional genes, as well as a revision of the genus Phomopsis may lead to this organism being named as a member of a new genus. The development of P. amaranthicola as a biological control agent for weeds in the genus Amaranthus is favored by a number of characteristics of the fungus. Phomopsis amaranthicola produces abundant inoculum, in the form of a conidia, in artificial culture. Inoculum can be produced to satisfy the experimental requirements, although large-scale use of the organism will require further investigation into the possibility of less expensive and less space-consuming growing conditions. Phomopsis amaranthicola has a host range that is limited to the genus Amaranthus, which makes its application in crops a safe alternative to herbicides. The pathogen is capable of controlling several species of weeds in the genus, including some of the worst weeds, such as A. hybridus, A. spinosus, A. retroflexus, A. lividus, and A. viridus. While the formulation of the organism could still be improved, the use of a psyllium mucilloid himiectant minimized the need for an extended dew period for severe disease development. Suspensions of the fungus composed of conidia generally were most effective in controlling the weed species tested, which makes quantification of the inoculum required for control a relatively simple matter. Concentrations of conidia necessary for severe disease development is relatively low, with 25-30% mortality of A. hybridus plants resulting fi-om apphcation of suspensions containing 1x10* conidia/ml and a dew period of 12 h. Efficacy of Phomopsis amaranthicola in the field, although somewhat variable, as with most other biological control organisms, was sufficient for suppression of the weed. The rampant spread of the fungus to the control plots

PAGE 162

caused difficulty in analysis, but showed that the fungus had a detrimental impact on the weeds and that it is capable of significant spread, particularly when overhead irrigation is used. Additional tests could be performed to determine if the Amaranthus spp. that were not controlled 100% in the field could be suppressed below the economic threshold in a particular crop by successfully limiting the competitive ability of the weed (Jacobs et al., 1996; Kadir and Charudattan, 1996; Paul and Ayers, 1986). The temperature range in which P. amaranthicola performs effectively is within the range at which many Amaranthus spp. grow; thus, it does not appear that temperature will be a limiting factor in the use of P. amaranthicola, although use in the more northern areas of the United States may be limited. The growth stage of the target weed at the time of inoculation is one of the most important factors in the success of this fungus, as was evident in results obtained in both greenhouse and field trials. It is also reasonable to conclude that P. amaranthicola could be successfully combined with chemical pesticides or other organisms (Appendix E) to control additional weed species or for the control of other agricultural pests. It is important that the timing of such applications be conducive to disease development, such as prevention of contact of P. amaranthicola with fungicides to which it is sensitive. Although relatively high levels of weed mortality occurred in field trials in which the organism was applied using a carbon dioxide back-pack sprayer, later studies revealed that the fungus would be more efficacious if applied using compressed air.

PAGE 163

153 Although the invert emulsion formulation has increased in popularity, particularly m those systems where the pathogen has been developed to the point of moderate-scale field use, the phytotoxicity of many forms of this formulation is cause for concern. The expansion of the host range that has been reported, coupled with the damage done to crop plants tested here make further refinement of this formulation necessary to prevent any adverse occurrences in the field. While this formulation may be suitable for particular systems, it does not appear to be usefiil for application of P. amaranthicola. Additional work using different combinations of oils and emulsifiers may lead to formulations of this type that are less phytotoxic. Although few fimgi have been developed to the point that they are successfully marketed, the outlook for P. amaranthicola to be used commercially is good, hidustry interest in an efficacious organism for pigweed control is promising and two U. S. Patents (U. S. Patent Nos. 5,393,728 and 5,510,316) have been granted for the use of P. amaranthicola as a broad-spectrum bioherbicide for pigweeds and amaranths. Although P. amaranthicola is more sensitive to environmental conditions than are chemical control methods and does require more time for weed suppression, it can be considered a viable alternative to chemicals when they are not appropriate for use or as a component of an integrated approach to manage weeds in the genus Amaranthus.

PAGE 164

APPENDIX A SEQUENCE ALIGNMENT OF rDNA INTERNAL TRANSCRIBED SPACER REGIONS ^PHO — AGCGGGTATCCCTACCTGATCCGAGGTCAAGAGTGTAAAAA GTACTTTTGGACG MA TCAGCGGGTATCCCTACCTGATCCGAGGTCAAGAGTGTAAAAAT GTACTTTTGGACG PO GGGTATTCCTACCTGATCCGAGGTCAAATTTTCAAGAGTTGGGGGTTTAACGGCA B GCGGGTATCCCTACCTGATCCGAGGTCAACCTTGTGAAA GATTTAACGGCC ****** ******************** ** PHO TCG — TCGTTATGAG — TGCAAAGCGCGAGATGTACT GCGCTCCGAAATCAATACG MA TCG--TCGTTCTGAA--TGCAAAGCGCGAGATGTACT GCGCTCCGAAATCAATACG PO GGGCACCGCCAGGGCCTTCCAGAGCGAGGGTTTAACT-ACTGCGCTCGGGGTCCT GG B GCG-ACCGCCCGCGC--TCCGAAGCGATTAATGAAATCACAACGCTTAGAGAC GG ** **** **** PHO CCGGCT-GCCAATTG-TTTTGAGGCGAGTCTACACGCAAAGGCGAGACAAACACCCAACA MA CCGGCT-GCCAATTG-TTTTGAGGCGAGTCTACGCGCAGAGGCGAGACAAACACCCAACA PO CGAGCTCGCCACTAGATTTCAGGGCCTG-CTTCGTGAAAAGCAGTG C-CCCAACA B ACAGCTCAGCCGGAGACTTTGAGGCGCG-CG GAACACCGCGG CGCCCAATA *** ** *** * ***** PHO CCAAGCATAGCTTGAAGGTACAAATGACGCTCGAACAGGCATGCCCCATGGAATACCAAG MA CCAAGCAGAGCTTGAAGGTACAAATGACGCTCGAACAGGCATGCCCCATGGAATACCAAG PO CCAAGCAATGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCTCCGGAATACCAGA B CCAAGCGAGGCTTGAGTGGTGAAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAG ****** ****** ************************* ********* PHO GGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACACTACTTA MA GGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACACTACTTA PO GGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTA B GGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTA ***************************************************** ****** PHO TCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTAGTTGAAAGTTGT MA TCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTGT PO TCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTT B TCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTT *********************************************** ********** PHO AACTATTATGTTTTT-CAGACGCTGATT TCAATTACAAAGGGTTTAATTTTGTCCA MA AACTATTAAGTTTTTTCAGACGCTGATT GCAACTGCAAATGGTTTAAATT-GTCCA PO GATTCATTTGTGTTT — TTTCTCAGAGTTTCAGTGTAAAAACAGAGTTGATTT — GGCCB GTTTAATTTA — CTT — AAACTCCGAC GCAAAGATGCAGTGTTTGAA GGCC* ** ** *** ** 154

PAGE 165

155 PHO GTCGGCGGGCGA ACCCGCCGAGGAAACGT ACGTACT CAAAAGMA ATCGGCGGGCGA ACCCGCCGAGGAAACGA AGGTACT CAAAAGPO GCCGGCGTGCCTTTTCCTCACCGGAGTGAGGGGCCTACTAGAGACCAGCAGCGCCGAGGC B TCCGG-GGGC GCTCGCCGTCGAAACGGC AGGGTC — GC — CCCCGAAGC PHO -ACATG-GGT AAGAGGTAGCGGGCAAAGCCCA CAAACTCTAGGTAA MA -ACATG-GGT AAGAGATAGCAGGCAAAGCCTA CAA-CTCTAGGTAA PO AACAAAAGGTATAAGTTCACAAAGGGTTTCTGGGTGCGCCTGG-GGCGCGTTC-CAGCAA B AACAAGTTGT GTTCACAAAGGGTTGGAGGTCGAGCCCGAAGGCCCTCACTCAGTAA PHO TGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTAC— MA TGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTT PO TGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTTTTACTB TGATCCCTCCGCAGGTTCACCTACGGAGACCTTGTTACGACTTTTACT****** ***** ******** ***** ******************* ^ First alignment performed using isolates representing members of different genera. Isolate information is provided in Table 2-5.

PAGE 166

156 ^gm2 GAACCAGCGGAGGGATCATTGCTGGA GAP08 GAACCAGCGGAGGGATCATTGCTGGA 597 A 649 AGGGATCATTGCTGGA 642 AGGGATCATTGCTGGA 4 52 ATCATTGCTGGA 484 AGGGATCATTGATGGA 456 AGGGATCATTGCTGGA 624 AGGGATCATTGCTGGA 528 AGGGATCATTGCTGGA 522 GGA 512 AGGGATCATTGCTGGA 537 476 GGATCATTGCTGGA 4 68 TCATTGCTGGA GLB06 GAACCAGCGGAGGGATCATTGCTGGA PHO — AGCGGGTATCCCTACCTGATCCGAGGTCAAGAGTGTAAAAA GTACTTTTGGACG MA TCAGCGGGTATCCCTACCTGATCCGAGGTCAAGAGTGTAAAAAT GTACTTTTGGACG PO GGGTATTCCTACCTGATCCGAGGTCAAATTTTCAAGAGTTGGGGGTTTAACGGCA B GCGGGTATCCCTACCTGATCCGAGGTCAACCTTGTGAAA GATTTAACGGCC gm2 ACGCGCCCTAGGCGCACCCAGAAACCCTTTGTGAACTTATACCTTT — TGTTGCCTCGGC GAP08 ACGCGCCCTAGGCGCACCCAGAAACCCTTTGTGAACTTATACCTTT — TGTTGCCTCGGC 597 ACGCGCC-TCGGC-GACCCAGAAACCCTTTGTGAACTTATACCTAT — TGTTGCCTCGGC 64 9 ACGCGCC-TCGGC-GACCCAGAAACCCTTTGTGAACTTATACCTATACTGTTGCCTCGGC 642 ACGCGCT-TCGGC-GACCCAGAAACCCTTTGTGAACTTATACCTAC— TGTTGCCTCGGC 4 52 ACGCGCT-TCGGC-GACCCAGAAACCCTTTGTGAACTTATACCTAC — TGTTGCCTCGGC 4 84 ACGCGCT-TCGGC-GACCCAGAAACCCTTTGTGAACTTATACCTAT — TGTTGCCTCGGC 456 AGGCGCT-TCGGCCGACCCAGAAACCCTTTGTGAACTTATACCTAT — TGTTGCCTCGGC 624 ACGCGCC-CCAGGCGACCCAGAAACCCTTTGTGAACTCATACCTTA-CTGTTGCCTCGGC 528 ACGCGCC-CCAGCGAGCCCAGAAACCCTTTGTGAACTTATACCTTA-CTGTTGCCTCGGC 522 ACGCGCC-CCAGCA — CCCAGAAACCCTTTGTGAACTTATACCTTA-CTGTTGCCTCGGC 512 ACGCGCC-CCAGGCGACCCAGAAACCCTTTGTGAACTTATACCTTA-CTGTTGCCTCGGC 537 GCGCGCC-CCAGCGAGCCCAGAAACCCTTTGTGAACTTATACCTTA-CTGTTGCCTCGGC 476 ACGCGCC-CCAGCGAGCCCAGAAACCCTTTGTGAACTTATACCTTA-CTGTTGCCTCGGC 4 68 ACGCGCC-CCAGCGAGCCCAGAAACCCTTTGTGAACTTATACCTTA-CTGTTGCCTCGGC GLB06 ACGCGCC-TCGGCGCACCCAGAAACCCTTTGTGAACTTATACCTTA-CTGTTGCCTCGGC PHO TCG— TCGTTATGAG— TGCAAAGCGCGAGATGTACT GCGCT-CCGAAATCAATAC MA TCG— TCGTTCTGAA--TGCAAAGCGCGAGATGTACT GCGCT-CCGAAATCAATAC PO GGGCACCGCCAGGGCCTTCCAGAGCGAGGGTTTAACT-ACTGCGCT-CGGGGTCCT G B GCG-ACCGCCCGCGC — TCCGAAGCGATTAATGAAATCACAACGCT-TAGAGAC G

PAGE 167

157 gm2 GCTGCTGG — TCTTCACAGGCCC-TTTACTTC-ACAGTAAAGAGACGG — CACGCCGGCG GAP08 GCTGCTGG — TCTTCACAGGCCC-TTTACTTC-ACAGTAAAGAGACGG — CACGCCGGCG 597 GCAGGCCGG-CCTCTCCTGGCAGAGGCCCCCT-GGAGACAGGGAGCAG — CCCGCCGGCG 64 9 GCAGGCCGG-CCTCCCCA — CCGAGGCCCCCT-GGAGACAGGGAGCAG — CCCGCCGGCG 642 GCAGGCCGG-CCTTTTGTGACAAAGGCCCCCT-GGAGACAGGGAGCAG — CCCGCCGGCG 452 GCAGGCCGC-CTTTGTCA-AAGAAGGCCCCCT-GGAGACAGGGAGCAG — CCCGCCGGCG 484 GTAGGCCGG-CCTCTTCA — CTGAGGCCCCCT-GGAAACAGGGAGCAG — CCCGCCGGCG 456 GTAGGCGCG-CCTCTTCA — CTGAGGCCCCCT-GGAAACAGGGAGCAG — CCCGCCGGCG 624 GCAGGCCGG-CCCCCCCA GG-GGCCCTC — GGAGACGAGGAGCAGG-CCCGCCGGCG 528 GCTACGTGG-TCCTTCGGGGCCC-CTCACCCT-CGGGTGTTGAGACAG — CCCGCCGGCG 522 TCTACGTGG-TCCTTCGGGGCCC-CTCACCCT-CGGGTGTTGAGACAG — CCCGCCGGCG 512 GCTACGTGG-TCCTTCGGGGCCC-CTCACCCT-CGGGTGTTGAGACAG — CCCGCCGGCG 537 GCTACGTGG-TCCCTCGGGGCCC-CTCACCCT-CGGGTGTTGAGACAG — CCCGTCGGCG 47 6 GCTACGTGG-CCCCTCGGGGCCC--TCACCCT-CGGGTGTTGAGACGG — CCCGCCGGCG 4 68 GCTACGTG--CCCCT-GGGGCCC--TCACCCT-CGGGTGTTGAGACGG — CCCGCCGGCG GLB06 GCAGGCCGGCTCCCATCTGGGGGCCCCTCGTT-TCTGACGAGGAGCAGG-CTCGCCGGCG PHO GCCGGCT— GCCAATTGTTTTGAGGCGAGTCTACACGCAAAGGCGAGACAAACACCCAAC MA GCCGGCT — GCCAATTGTTTTGAGGCGAGTCTACGCGCAGAGGCGAGACAAACACCCAAC PO GCGAGCTC-GCCACTAGATTTCAGGGCCTGCTTCGTGAAAAGCAGTG C-CCCAAC B GACAGCTC-AGCCGGAGACTTTGAGGCGCGCG GAACACCGCGG CGCCCAAT gm2 GCCAAGTTAACTCTTGTTTTTACACTGAAACTCTGAGAAAAAAACACAAATGAATCAAAA GAP08 GCCAAGTTAACTCTTGTTTTTACACTGAAACTCTGAGAAAAAAACACAAATGAATCAAAA 597 GCCAGCTAAACTCTTGTTTCTACAGTGAATCTCTGAGTAAAAA-CATAAATGAATCAAAA 64 9 GCCAACCAAACTCTTGTTTCTACAGTGGATCTCTGAGTAAAAAACATAAATGAATCAAAA 642 GCCAACCAAACTCAAGTTTCTACAGTGAATCTCTGAGTACAAAACATAAATGAATCAAAA 452 GCCAACTAAACTCTTGTTTCTATAGTGAATCTCTGAGTAAAAA-CATAAATGAATCAAAA 484 GCCAACCAAACTCTTGTTTCTACAGTGAATCTCTGAGTAAAAAACATAAATGAATCAAAA 456 GCCAACCAAACTCTTGTTTCTACAGTGAATCTCTGAGTAAAAAACATAAATGAATCAAAA 624 GCCAAGCCAACTCTTGTTTTTACACCGAAACTCTGAGCAAAAAACACAAATGAATCAAAA 528 -CCAACCTAACTCTTGTTTTTACACTGAAACTCTGAGAATAAAAGATAAATCAATCAAAA 522 GCCAACCTAACTCTTGTTTTTACACTGAAACTCTGAGAATAAAACATAAATGAATCAAAA 512 GCCAACCCAACTCTTGTTTTTACACTGAAACTCTGAGAATAAAACATAAATGAATCAAAA 537 GCCAACCTAACTCTTGTTTTTACACTGAAACTCTGAGCACAAAACATAAATGAATCAAAA 476 GCCAACCCAACTCTTGTTTTTACACTGAAACTCTGAGAATAAAACATAAATGAATCAAAA 4 68 GCCAACCCAACTCTTGTTTTTACACTGAAACTCTGAGAATAAAACATAAATGAATCAAAA GLB06 GCCAAGTTAACTCTTGTTTTTAATTTGAAACTCTGAGAATAAAACATAAATGAATCAAAA PHO ACCAAGCATAGCTTGAAGGTACAAATGACGCTCGAACAGGCATGCCCCATGGAATACCAA MA ACCAAGCAGAGCTTGAAGGTACAAATGACGCTCGAACAGGCATGCCCCATGGAATACCAA PO ACCAAGCAATGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCTCCGGAATACCAG B ACCAAGCGAGGCTTGAGTGGTGAAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAA

PAGE 168

158 gm2 GAP 08 597 649 642 452 484 456 624 528 522 512 537 476 468 GLB06 PHO MA PO B gm2 CAPO 8 597 649 642 452 484 456 624 528 522 512 537 476 468 GLB06 PHO MA PO B CTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAG CTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAG CTTT CTTT CTTT CTTTCAA CTTT CTTTCAA CTTTCAA CTTT CTTT CTTTCAA CTTTCAA CTTT CTTTCAA CTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAG GGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACACTACTT GGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACACTACTT AGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTT GGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTT TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTG ATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTAGTTGAAAGTTG ATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTG ATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTT ATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTT

PAGE 169

159 gin2 GAP 08 597 649 642 452 484 456 624 528 522 512 537 476 468 GLB06 PHO MA PO B GTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCATTGCTTGGTGTT GTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCATTGCTTGGTGTT AGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT AGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT AGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT AGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT AGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT AGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT AGCGTCATTTCAACCCTCAAGCATTGCTTGGTGTT AGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT AGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT AGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT AGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT AGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT AGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT GTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGAT TAACTATTATGTTTTT CAGACGCTGATT TCAATTACAAAGGGTTTAATTT TAACTATTAAGTTTTTT CAGACGCTGATT GCAACTGCAAATGGTTTAAATT TGATTCATTTGTGTTT TTTCTCAGAGTTTCAGTGTAAAAACAGAGTTGATTTTGTTTAATTTA— CTT AAACTCCGAC GCAAAGATGCAGTGTTTGAA — gm2 GAP 08 597 649 642 452 484 456 624 528 522 512 537 476 468 GLB06 PHO MA PO B GGGGCACTGCCTGTAAAAGG— GGGGCACTGCCTGTAAAAGG— GGGGCACTGC-C-TGAGAAA— GGGGCACTGC-C-TGTAAGACGGGGCACTGCTC-TCTGACGGGGGGCACTGCTC-TCTCGCGG— GCAGGCCCTGAAAT-CTAGTGGCGAGCT-CGC ---GCAGGCCCTGAAAT-CTAGTGGCGAGCT-CGC -GGGCAGGCCTTGAAAT-CTAGTGGCGAGCT-CGC -GGGCAGGCCCTGAAAT-CTAGTGGCGAGCT-CGC -GAGCAGGCCCTGAAAT-CTAGTGGCGAGCT-CGC -GAGCAGGCCCTGAAAT-CTAGTGGCGAGCT-CGC GGGGCACTGCTT-TCGTCCAGA AAGCAGGCCCTGAAAT-CTAGTGGCGAGCT-CGC GGGGCACTGCTT-TCGTCCAGA AAGCAGGCCCTGAAAT-CTAGTGGCGAGCT-CGC GGGGCACTGCTT-TCTACCCGA GAGCAGGCCCTGAAAT-CTAGTGGCGAGCT-CGC GGGGCACTGCTT-TTACCCAAG A-GCAGGCCCTGAAAT-TCAGTGGCGAGCT-CGC GGGGCACTGCTT-TTACCCAAG A-GCAGGCCCTGAAAT-TCAGTGGCGAGCT-CGC GGGGCACTGCTT-TTACCCAAG A-GCAGGCCCTGAAAT-TCAGTGGCGAGCT-CGC GGGGCACTGCTTCTTACCCAAG AAGCAGGCCCTGAAAT-TCAGTGGCGAGCT-CGC GGGGCACTGCCT-TTACCCAA AGGCAGGCCCTGAAAT-TCAGTGGCGAGCT-CGC GGGGCACTGCCT-TTACCCAA AGGCAGGCCCTGAAAT-TCAGTGGCGAGCT-CGC GGGGCACTGCCTTTGTGTAAAAGCGAAGGCAGGCCCTGAAAT-TCAGTGGCGAGCT-CGC TGTCCAGTCGGCGGGCGA ACCCGCCGAGGAAACGT ACGTACT C -GTCCAATCGGCGGGCGA ACCCGCCGAGGAAACGA AGGTACT C -GGCC-GCCGGCGTGCCTTTTCCTCACCGGAGTGAGGGGCCTACTAGAGACCAGCAGCGC -GGCC-TCCGG-GGGC GCTCGCCGTCGAAACGGC AGGGTC--GC— CCC

PAGE 170

160 gm2 TAGGACCCCGAG-CGTAGTAGTT AAACCCTCGCTTTGGAAGGCCC-TGGCGG-TGCC GAP08 TAGGACCCCGAG-CGTAGTAGTT AAACCCTCGCTTTGGAAGGCCC-TGGCGG-TGCC 597 CAGGTCCCCGAG-CGTAGTAGTA TTATC-TCGCCCTGGAAGGCCC-TGGCGG-TGCC 64 9 CAGGACCCCGAG-CGTAGTAGTT ATATC-TCGCTCCGGAAGGCCC-TGGCGG-TGCC 642 TAGGACCCCGAG-CGTAGTAGTT ATATC-TCGTTCTGGAAGGCCC-TGGCGG-TGCC 4 52 CAGGACCCCGAG-CGTAGTAGTT ACATC-TCGCTCTGGAAGGCCC-TGGCGG-TGCC 4 84 CAGGACCCCGAG-CGTAGTAGTT ATATC-TCGCTCTGGAAGGCCC-TGGCGG-TGCC 4 56 CAGGACCCCGAG-CGTAGTAGTT ATATC-TCGCTCTGGAAGGCCC-TGGCGG-TGCC 624 CAGGACCCCGAG-CGCAGTAGTT AAACCCTCGCTCGGGA-GGCCC-TGGCGG-TGCC 528 CAGGACCCCGAG-CGCAGTAGTT AAACCCTCGCTCTGGAAGGCCC-TGGCGG-TGCC 522 CAGGACCCCGAG-CGCAGTAGTT AAACCCTCGCTCTGGAAGGCCC-TGGCGG-TGCC 512 CAGGACCCCGAG-CGCAGTAGTT AAACCCTCGCTCTGGAAGGCCC-TGGCGG-TGCC 537 CAGGACCCCGAG-CGCAGTAGTT AAACCCTCGCTCTGGAAGGCCC-TGGCGG-TGCC 476 CAGGACCCCGAG-CGCAGTAGTT AAACCCTCGCTTTGGAAGGCCC-TGGCGG-TGCC 4 68 CAGGACCCCGAG-CGCAGTAGTT AAACCCTCGCTTTGGAAGGCCC-TGGCGG-TGCC GLB06 CAGGACTCCGAG-CGCAGTAGTT AAACCCTCGCTTTGGAAGGAC— TGGCGG-TGCC PHO AAAAG — ACATG-GGT AAGAGGTAGCGGGCAAAGCCCA CAAACTCT MA AAAAG — ACATG-GGT AAGAGATAGCAGGCAAAGCCTA CAA-CTCT PO CGAGGCAACAAAAGGTATAAGTTCACAAAGGGTTTCTGGGTGCGCCTGG-GGCGCGTTCB CGAAGCAACAAGTTGT GTTCACAAAGGGTTGGAGGTCGAGCCCGAAGGCCCTCACT * gm2 CTGCCGTTAAACCCCC — AACTTTTGAAAATTTGACCTCGGATCAGGTA GAPO 8 CTGCCGTTAAACCCCC — AACTTTTGAAAATTTGACCTCGGATCAGGTA 597 CTGCCGTTAAACCCCCC-AACTCCTGAAAATTTGACCTCGG 64 9 CTGCCGTTAAACCCCC — AACTTCTGAAAATTTGACCTCGG 642 CTGCCGTTAAACCCCC — AACTTCTGAAAATTTGACCTCGG 452 CTGCCGTTAAACCCCC — AACTTCTGAAAATTTGACCTCGG 484 CTGCCGTTAAACCCCC — AACTTCTGAAAATTTGACCTCGG 456 CTGCCGTTAAACCCCC — AACTTCTGAAAATTTGACCTCGG 624 CTGCCGTTAAACCCCC — AACTCTTGAAAATTTGACCTCGG 528 CTGCCGTTAAACCCCC — AACTTCTGAAAATTTGACCTCGG 522 CTGCCGTTAAACCCCC — AACTTCTGAAAATTTGACCTCGG 512 CTGCCGTTAAACCCCC — AACTTCTGAAAATTTGACCTCGG 537 CTGCCGTTAAACCCCC — AACTTCTGAAAATTTGACCTC 476 CTGCCGTTAAACCCCC — AACTTCTGAAAATTTGACCTCGG 4 68 CTGCCTTTAAACCCCC — AACTTCTGAAAATTTGACCTCGG GLB06 CTGCCGTTAAACCCCC — AACTCTTGAAAATTTGACCTCGGATCAGGTA PHO AGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTAC — MA AGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTT PO CAGCAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTTTTACTB CAGTAATGATCCCTCCGCAGGTTCACCTACGGAGACCTTGTTACGACTTTTACT* ***** ***+ ^Second alignment was performed using all isolates listed in Table 2-5.

PAGE 171

APPENDIX B WEATHER DATA DURING FIELD EVALUATION OF PHOMOPSIS AMARANTHICOLA FOR CONTROL OF AMARANTHUS SPP. 100 T Figiire B-1 Maximum relative humidity during field evaluation of Phomopsis amaranthicola for control of Amaranthus spp. in 1993, 1994, and 1995. Data were provided by Wayne Williams, Senior Service Technologist, Agricultural and Biological Engineering, University of Florida, Gainesville. 161 I

PAGE 172

162 Figure B-2. Maximum and minimum temperatures during field evaluation of Phomopsis amaranthicola for control oi Amaranthus spp. in 1993, 1994, and 1995. Data were provided by Wayne Williams, Senior Service Technologist, Agricultural and Biological Engineering, University of Florida, Gainesville.

PAGE 173

Figure B-3. Total rainfall during the field evaluation of Phomopsis amaranthicola for Amaranthus spp. in 1993, 1994, and 1995. Data were provided by Wayne Williams, Senior Service Technologist, Agricultural and Biological Engineering, University of Florida, Gainesville.

PAGE 174

\ APPENDIX C GERMINATION OF CONIDIA OF PHOMOPSIS AMARANTHICOLA OVER TIME The effect of time in aqueous suspension before application was evaluated in terms of germination of a conidia of Phomopsis amaranthicola in suspension. Suspensions of a conidia were prepared as for greenhouse and field trials. The suspensions were then allowed to remain on the laboratory bench for varying periods of time before application with a hand-held pump sprayer on water agar plates with 0.02% sucrose added. Plates were allowed to incubate at room temperature for 24 h after spraying. Fifty conidia fi-om each of three replicated plates were counted for each time to determine the proportion of germination. 164

PAGE 175

165 Table C-1. Germination of a conidia of Phomopsis amaranthicola over time in suspension. Time CV{\ VJCillXlllaliUii Ul aipila L-UlliUlCl inai i inai z 1 tin.''oa 3ya 9 3 33bc 71cd 4 75de 77d 5 78e 67bc 6 84e 73d 7 63abc 8 76e 52ab 9 53cd 56ab ^ Due to differences in variability between trial 1 and trial 2, with the effect of trial being significant (P=0.0001), the trials could not be combined. Regression analysis resulted in a quadratic equation of y=-0.037x^ + 0.459x -0.299, widi significance of P=0.0001, RM.91 and CV=12.4 for trial 1; y=0.016x^ + 0.16x + 0.63, with significance of P=0.0001, R^=0.55, and CV=9.9 for trial 2. ^ Values with the same letter in the same column are not significantly different (P=0.05) according to mean separation based on the Tukey's Honestiy Significant Difference test.

PAGE 176

APPENDIX D CARBON DIOXIDE PRESSURIZATION AND pH Table D-1 Effect of pressurization of tap water with carbon dioxide on the pH of the water^. Time Under Pressure pH 0 10 20 30 60 70 8.36 4.66 4.46 4.42 4.36 4.34 ^ater was pressiirized for the specified time using a carbon dioxide backpack sprayer with 210-kPa of pressure. 3 42 1 0 — • — •TX-lOO TX-77 SL-77 o Meta — m — -Tween-20 Sun-It a o -Clio 20 Time Under Pressure (minutes) 30 60 Figure D-2. Effect of pressurization with carbon dioxide on the pH of a variety of amended solutions. Solutions were amended with 0.25% Silwet L-77, 0.3% Tween 20, 0.3% Triton X-77, 0.05% Triton X-100, 0.5% Metamucil, and 0.10% Sun-It 166

PAGE 177

167 Table D-3. Percentages of germinating a conidia oiPhomopsis amaranthicola after exposure to decreasing hydrogen ion concentration. pH Time (minutes) 10 20 30 60 1440 4 80 69 76 74 79 5 94 91 75 79 95 6 96 91 92 78 89 7 n/a n/a n/a n/a 85 8 91 81 84 82 72 The effect of hydrogen ion concentration on the germination of a conidia of Phomopsis amaranthicola was tested by preparing buffers with either succinic acid or monoand di-basic sodium phosphate. Conidia were added to the buffers and allowed to remain for the specified time and then the hydrogen ion concentration of the solution was adjusted to pH 7.0 and the conidia were plated onto water agar plates containing 0.02% sucrose. The percentages of germinating a conidia were calculated fi-om proportions of 50 germinating conidia fi-om each of three replicated plates for each time.

PAGE 178

APPENDIX E ISOLATION OF FUNGI FROM AMARANTHUS DUBIUS IN PUERTO RICO Isolations made from diseased pigweed plants {Amaranthus dubius) found at the experimental station located at Juana Dia, Puerto Rico in April, 1996 (Figure E-1) resulted in the identification of two pathogenic isolates belonging to the genus Colletotrichum. Isolate ST-2-JD does not produce setae on conidiomata m culture or on plant material. Conidia of this isolate are straight and cylindrical with rounded apex and base. The colonies of this isolate are white with orange conidial masses. Appressoria are simple and slightly lobed (Figure E-2). Isolate ST-4-JD does produce setae (Figure E-3a) on conidiomata in culture. The conidia of this isolate are falcate and fusiform with a tapered apex and truncate base (Figure E-3b). Appressoria produced by this isolate are complex (Figure E-3c). Conidial measurements have not yet been performed and are required for speciation. Inoculations have been performed twice, in a quarantine facility, using these isolates. The first inoculation was performed using ST-2-JD, ST-4-JD, and Phomopsis amaranthicola applied to Amaranthus hybridus plants grown from seed obtained from Aziin Seed Supply, Leland, MS. Plants were allowed to grow until four true leaves were present and then inoculated with suspensions of the individual fungi with concentrations of 1 million conidia/ml. Conidial suspensions were prepared by adding 25 ml of water to agar plates on which the fiingus had been allowed to grow for 14 days and scraping the plate with a rubber policeman to dislodge the conidia. 168

PAGE 179

169 Figure E-1. Disease of Amaranthiis dubius observed at the experimental station located at Juana Dia, Puerto Rico in April, 1996.

PAGE 180

Figure E-2. Appressoria of Colletotrichum sp. isolate ST-2-JD are simple and slightly lobed (lOOOX). Isolate ST-2-JD does not produce setae on the conidiomata in culture or on plant material. Conidia of this isolate are straight and cylindrical with rounded apex and base. The colonies of this isolate are white with orange conidial masses. Figure E-3 (a). Isolate ST-4-JD of Colletotrichum sp. from Amaranthus dubius produces setae on the conidiomata in culture (lOOX). (b). The conidia of this isolate are falcate and fusiform with a tapered apex and truncate base (lOOOX). (c). Appressoria produced by this isolate are complex (lOOOX).

PAGE 181

171 The suspensions were filtered through a double layer of sterilized cheesecloth and then standardized using a hemacytometer. A hydrophilic, psylliimi mucilloid (Metamucil, Procter and Gamble, Cincinnati, OH) was added to the suspensions at 0.5% m:v. Each treatment consisted of a single fungus applied using a hand-held, pump sprayer. Each treatment had three replications, with a pot being considered as a replication and each pot containing three plants. Controls consisted of inoculation with mucilloid alone. The pigweed plants were placed in plastic bags for 24 h after inoculation to maintain moisture. Disease developed only on the plants inoculated with Phomopsis amaranthicola. The second inoculation was performed using the two isolates of Colletotrichum spp. as the treatments with a mucilloid only control. The experiment was performed using the methods as described above with a few modifications. Conidia were harvested fi-om amaranth infusion agar plates, which provided substantially more conidia than the PDA previously used. Instead of A. hybridus plants, 1 1 different accessions of pigweed that had been collected in Puerto Rico were used for inoculation. These included: #1-5, 10, 12, and 13, which stqA. dubius; #7, 8, and 11, which are A. spinosus; and #9, which was an accession of A. viridus, not obtained in Puerto Rico. After inoculation, plants were exposed to 20 h of dew. Plants were maintained at 22C in a quarantine facility. Although inoculation with these isolates did not result in dramatically high levels of mortality to all plants tested, both isolates did affect at least one plant species (Tables E-1 and E-2). Symptoms produced were similar to those observed in the field (Figure E-1). Amaranthns

PAGE 182

172 Table E-1. Disease severity as a result of inoculation of Amaranthus spp. with Colletotrichum spp. isolates from Juana Dia, Puerto Rico. Disease Severity'' Replicate 1 Replicate 2 Replicate 3 Afttn.Tn.fith.'u^ Isolate No ST-2-JD ST-4-TD O 1 ^ J J-V /i. uUUlUS 1 1 1 u .0 / A u .0/ 2 0 1 0 0 n .J J 3 0 0 .33 0 0 0 4 0 0 0 0 0 0 5 0 1 0 1 0 .67 10 2 1.1 2.7 4.3 2.7 5 12 0 2 .33 2 .67 2 13 5.7 6.7 6 1.1 5.7 8 A. spinosus 7 1.1 1.1 1.1 9 6 11.7 8 0 1 0 1 0 1 11 8.7 10.7 5.3 6.7 4.7 6.3 A. viridus 9 2 0 2 0 2 0 Each replicate represents the average of three plants. Table E-2. Plant mortality as a result of inoculation of Amaranthus spp. with Colletotrichum spp. isolates from Juana Dia, Puerto Rico. Percentage Mortality Replicate T Replicate 2 Replicate 3 Amaranthus spp. Isolate ST-2-JD ST-4-JD ST-2-JD ST-4-JD ST-2-JD ST-4-JD No. A. duhius 1 0 0 0 0 0 0 2 0 0 0 0 0 0 3 0 0 0 0 0 0 4 0 0 0 0 0 0 5 0 0 0 0 0 0 10 0 67 0 33 0 33 12 0 0 0 0 0 0 13 33 33 33 33 33 33 A. spinosus 7 0 67 0 67 0 67 8 0 0 0 0 0 0 11 67 33 33 33 33 67 A. viridus 9 0 0 0 0 0 0 Each replicate represents the average of three plants.

PAGE 183

173 spinosus, #7 and A. dubius, #10 were susceptible to both isolates. Amaranthus dubius, #13 and^. spinosus, #11, were both susceptible to ST-4-JD. Due to the low levels of mortality attained at the extremely low temperature conditions maintained in the quarantine facility, these trials should be repeated under a higher temperatiu-e. The rapidity and severity of disease development on some of the plants tested indicate that isolate ST-4-JD may have potential for use as a biocontrol agent for the pigweed species present in Puerto Rico. Since the temperatures in the field where the isolates were found was significantly higher than that used in the screening procedure, it would be valuable to further test this isolate for the parameters that would be most conducive for disease development.

PAGE 184

REFERENCES Abbas, H. K., Egley, G. H., Johnson, B., and Paul, R. N. 1995a. The effect of changing temperature on the virulence of Altemaria helianthi spores to cocklebur {Xanthium strumarium L.). Proc. Southern Weed Sci. Soc. 48:166 (Abstract). Abbas, H. K., Egley, G. H., and Paul, R. N. 1995b. Effect of conidia production temperature on germination and infectivity of Altemaria helianthi. Phytopathology. 85:677-682. Abbasher, A. A. and Sauerbom, J. 1992. Fusarium nygamai, a potential bioherbicide for Striga hermonthica control in sorghum. Biol. Control 2:291-296. Adams, E.B. 1988. Fungi in classical biocontrol of weeds, Fungi in Biological Control Systems. M.N. Burge, ed. Manchester University Press, Manchester, England, pp. 11-124. Ahrens, W.H. and StoUer, E.W. 1983. Competition, growth-rate, and CO2 fixation in triazine-susceptible and -resistant smooth pigweed {Amaranthus hybridus). Weed Sci. 31:438-444. Ahrens, W.H., Wax, L.M. and StoUer, E.W. 1981. Identification of triazine-resistant Amaranthus spp. Weed Sci. 29:345-348. Alfieri, S.A, Langdon, K.R., Wehlburg, C. and Kimbrough, J. W. 1984. Index of Plant Diseases in Florida, Florida Dept. of Agriculture and Consumer Services, Bulletin 11, Department of Plant Industry. 389 pp. Altman, J. and Campbell, C. L. 1977. Effect of herbicides on plant disease. Annu. Rev. Phytopathol. 15:361-385. Amsellem, Z., Sharon, A., Gressel, J., and Quimby, P. C, Jr. 1990. Complete abolition of high inoculum threshold of two mycoherbicides {Altemaria cassiae and A. crassa) when appHed in invert emulsion. Phytopathology. 10:925-929. Anderson, J.B. and Stasovski, E. 1992. Molecular phylogeny of northern hemisphere species of Armillaria. Mycologia 84:505-5 1 6. Anderson, R.N. and Walker, H.L. 1985. Colletotrichum coccoides: A pathogen of eastern nightshade (i'o/a/JMm /7ycar/iMm). Weed Sci. 33:902-905. 174

PAGE 185

175 Anderson, W. P. 1983. Weed Science: Principles. West Publishing Company, St. Paul. 655 pp. Andres, L.A., Davis, C.J., Harris, P. and Wapshere, A.J. 1976. Biological control of weeds. In Theory and Practice of Biological Control. C.B. Huffaker and P.S. Messenger, eds. Academic Press, New York, NY. pp. 481-499. Andrews, J. H. 1992. Biological control in the phyllosphere. Annu. Rev. Phytopathol. 30:603-635. Auld, B. 1993. Vegetable oil suspension emulsions reduce dew dependence of a mycoherbicide. CropProt. 12:477-479 Auld, B. A. 1997. Chairman's comments. International Bioherbicide Group Newsletter, 6:1. Auld, B.A., McRae, C.F. and Say, M.M. 1988. Possible control of Xanthium spinosus by a fungus. Ag.Ecosyst.Env. 21:513-519. Auld, B. A. and Morin, L. 1995. Constraints on the development of bioherbicides. WeedTechnol. 9:638-652. Auld, B. A., Say, M. M., Ridings, H. I., and Andrews, J. 1990. Field application of Colletotrichum orbiculare to control Xanthium spinosum. Ag. Ecosyst. Env. 32:315323. Balducchi, A.J. and McGee, D.C. 1987. Environmental factors influencing infection of soybean seeds by Phomopsis and Diaporthe species during seed maturation. Plant Dis. 71:209-212. Bannon, J. S., White, J. C, Long, D., Riley, J. A., Baragona, J., Atkins, M., and Crowley, R. H. 1990. Bioherbicide technology: An industrial perspective. In Microbes and Microbial Products as Herbicides. R. E. Hoagland, ed., American Chemical Society, Washington, D. C. 341 pp. Batson, W. E. and Trevathan, L. E. 1988. Suitability and efficacy of ground corncobs as a carrier of FMi'anM/w 5o/a/zi spores. Plant Dis. 72:222-225. Baudoin, A.B.A.M., Abad, R.G., Kok, L.T. and Bruckart, W.L. 1993. Field evaluation of Puccinia carduorum for biological control of musk thistle. Biol. Control 3:53-60. Bellinder, R.R., ed. 1994. Herbicide reduction efforts in North America: Where do we go from here? Proc. of a Symposium of the Weed Science Society of America, 1993, Denver, Col. WeedTechnol. 8:331-412.

PAGE 186

176 Berthier, Y.T., Bruckart, W.L., Chaboudez, P., and Luster, D.G. 1996. Polymorphic restriction patterns of ribosomal transcribed spacers in the biocontrol fungus Puccinia carduorum correlates with weed host origin. Appl. Environ. Microbiol. 62:3037-3041. Bewick, T. A., Binning, L. K., Stevenson, W. R., and Stewart, J. 1986. Development of biological control for swamp dodder. Proc, North Central Weed Control Conf. 41: 24. Boyette, C. D. 1995. Improvement of mycoherbicidal activity of anthracnose pathogens with adjuvants and surfactants. Proc. Southern Weed Science Soc. 48:167 (Abstract). Boyette, C. D., Abbas, H. K., Connick, W.J. 1993a. Evaluation of Fusarium oxysporum as a potential bioherbicide for sicklepod {Cassia obtusifolia), coffee senna (C. occidentalis), and hemp sesbania (Sesbania exaltata). Weed Sci. 41:678-681. Boyette, C. D., Quimby, P. C, Bryson, C. T., Egley, G. H., and Fulgham, F. E. 1993b Biological control of hemp sesbania {Sesbania exaltata) under field conditions with Colletotrichum truncatum formulated in an invert emulsion. Weed Sci. 41:497-500. Boyette, C. D., Quimby, P. C, Caesar, A. J., Birdsall, J. L., Connick, W. J., Daigle, D. J., Jackson, M. A., Egley, G. H., Abbas, H. K. 1996. Adjuvants, formulations, and spraying systems for improvement of mycoherbicides. Weed Technol. 10:637-644. Boyette, C. D., Weidemann, G. J., TeBeest, D. O., and Turfitt, L. B. 1986. Biocontrol of jimsonweed in the field 'mih Altemaria crassa. Proc. So. Weed Sci. Soc. 39:388. Bradbury, J. F. 1986. Guide to Plant Pathogenic Bacteria. CAB. International, Wallingford, Oxon, UK. 332 pp. Brayford, D. 1990. Variation in Phomopsis isolates firom Ulmus species in the British Isles and Italy. Mycolog. Res. 94:691-697. Braverman, M. P. and Griffin, J. L. 1995. Effects of COjOn spray solution pH. Weed Technol. 9:23-28. Bruns, T.D., White, T.J. and Taylor, J.W. 1991. Fungal molecular systematics. Annu. Rev. Ecol. System. 22:525-564. Brunt, A., Crabtree, K., and Gibbs A. 1990. Viruses of Tropical Plants. C.A.B. International, Wallingford, Oxon, UK. 707 pp. Buchanan, G.A. Crowley, R.H., Street, J.E. and McGuire, J.A. 1980a. Competition of sicklepod {Cassia obtusifolia) and redroot pigweed {Amaranthus retroflexus) with cotton {Gossypium hirsutum). Weed Sci. 28:258-262.

PAGE 187

177 Buchanan, G. A., R. Crowley, J. Street, and J. McGuire. 1980b. Response of weeds to soil pH. Weed Sci. 23:473-477. Buhler, D. D., Mester, T. C, Kohler, K. A. 1996. The effect of maize residues and tillage on emergence of Setaria faberi, Abutilon theophrasti, Amaranthus retrqflexus, and Chenopodium album. Weed Res. 36:153-165. Biirki, H. M., Schroeder, D., Lawrie, J., Cagan, L., Vrablova, M., Aydam, M. E., Szentkiralyi, F., Ghorbani, R., Juttersonke, B., and Ammon, H. U. 1997. Biological control of pigweeds {Amaranthus retrqflexus L., A. Powellii S. Watson and A. bouchonii Thell.) with phytophagous insects, fungal pathogens and crop management. Int. Pest Man. Rev. 2:51-59. Byrd, J.D., Jr. and Coble, H.D. 1991. Interference of selected weeds in cotton (Gossypium hirsutum). WeedTechnol. 5:263-269. Campbell, C.L. and Madden, L. 1990. Introduction to Plant Disease Epidemiology. John Wiley and Sons, New York, NY. Carbone, I. and Kohn, L. A. 1993. Ribosomal DNA sequence divergence within internal transcribed spacer 1 of the Sclerotiniaceae. Mycologia 85:415-427. Cardina, J., Littrel, R.H., and Hanlin, R.T. 1988. Anthracnose of Florida beggarweed (Desmodium tortuosum) caused by Colletotrichum truncatum. Weed Sci. 36:329-334. Cerkausas, R.F. 1988. Latent colonization by Colletotrichum spp.: Epidemiological considerations and implications for mycoherbicides. Can. J. of Plant Pathol. 10:297-310. Chandramohan, S. and Charudattan, R. 1996. Multiple-pathogen strategy for bioherbicidal control of several weeds. WSSA Abstracts 36:49. Charudattan, R. 1986. Integrated control of waterhyacinth {Eichhornia crassipes) with a pathogen, insects and herbicides. Weed Sci. 34 (suppl. 1): 26. Charudattan, R. 1990. The mycoherbicide approach with plant pathogens. In Microbial Control of Weeds. D.O. TeBeest, ed. Chapman and Hall, New York, NY. pp. 24-57. Charudattan, R. 1993. The role of pesticides in altering biocontrol efficacy. In Pesticide Interactions in Crop Production: Beneficial and Deleterious Effects. J. Altman, ed. CRC Press, Boca Raton, FL. pp. 422-430. Charudattan, R., Walker, H.L., Boyette, CD., Ridings, W.H., TeBeest, D.O., VanDyke, C.G. and Worsham, A.D. 1986. Evaluation of Alternaria cassiae as a mycoherbicide for sicklepod (Cassia obtusifolia) in regional field tests. Southern Cooperative Series Bulletin 317. Dept. of Information, Alabama Agric. Expt. Station, Auburn University, Alabama.

PAGE 188

178 Cole, J.N. 1979. Amaranth: From the past for the futiire. Rodale Press, Ermnaus, Pemisylvania. 3 11 pp. Colvin, D. L. 1995. Weed Survey-Southern States (Florida). C. C. Dowler, Section Chair, Proc. So. Weed Sci. Soc. 48:290-325. Connick, W. L., Jr., Boyette, C. D., and McAlpine, J. R. 1991. Formulation of mycoherbicides using a pasta-like process. Biol. Control 1:281-287. Crop Protection Chemicals Reference. 1994. Chemical and Pharmaceutical Press, New York, NY. 1948 pp. Cross, J. V. and Polonenko, D. R. 1996. An industry perspective on registration and commercialization of biocontrol agents in Canada. Can. J. Plant Pathol. 18:446-454. Culvenor, C.C.J., Edgar, J.A., Mackay, M.F, Gorst-AUman, C. P., Marasas, W.F.O., Steyn, P.S., Vleggaar, R., and Wessels, P.L. 1989. Structure elucidation and absolute configuration of phomopsin A, a hexapeptide mycotoxin produced by Phomopsis leptostromiformis. Tetrahedron 45:2351-2372. Daigle, D. J. and Connick, W. J., Jr. 1990. Formulation and application technology for microbial weed control. In Microbes and Microbial Products as Herbicides. Hoagland, R. E., ed., American Chemical Society, Washington, D. C. 341 pp. Daigle, D. J., Connick, W. J., Jr., Quimby, P. C, Jr., Evans, J., Trask-Morrell, B. and Fulgham, F. E. 1990. Invert emulsions: Carrier and water source for the mycoherbicide, Altemaria cassiae. WeedTechnol. 4:327-331 Daigle, D. J. and Cotty, P. J. 1991. Factors that influence germination and mycoherbicidal activity oi Altemaria cassiae. Weed Technol. 5:82-86. Daigle, D. J. and Cotty, P. J. 1992. Production of conidia of Altemaria cassiae with alginate pellets. Biol. Control 2:278-281. Daniel, J.T., Templeton, G.E., Smith, Jr.,R.J. and Fox, W.T. 1973. Biological control of northern jointvetch in rice with an endemic fungal disease. Weed Sci. 21 :303-307. Dawson, J.H. 1977. Competition of late-emerging weeds with sugarbeets. Weed Sci. 25:168-170. DeLucca, A. J., II, Connick, W. J., Jr., Fravel, D. R., Lewis, J. A., and Bland, J. M. 1990. The use of bacterial alginates to prepare biocontrol formulations. J. Indust. Microbiol. 6:129-134.

PAGE 189

179 de Nooij, M.P. and van Damme, J.M.M. 1988. Variation in pathogenicity among and within populations of the fungus Phomopsis subordinaria infecting Plantago lanceolata. Evolution 42:1166-1171. Dhingra, O.D. and Sinclair, J.B. 1995. Basic Plant Pathology Methods, Lewis Publishers, Boca Raton, Florida. 434 pp. Dillard, H. M., 1988. Influence of temperature, pH, osmotic potential and fungicide sensitivity on germination of conidia and growth from sclerotia of Colletotrichum coccodes in wiXxo. Phytopathology. 78:1357-1361. Durgesha, M. 1994. Absorption, translocation and metabolism of fluchloralin in groimdnut {Arachis hypogaea) and pigweed (Amaranthus viridus). Crop Prot. 13:286289. Egger, K.N. 1992. Analysis of fungal population structure using molecular techniques. In The Fungal Community: Its Organization and Role in the Ecosystem. G.C. Carroll and D.T. Wickler, eds. Marcel Dekker, Inc. New York, NY. 976 pp. Egley, G. H., Boyette, D. 1995. Water-corn oil emulsion enhances conidia germination and mycoherbicidal activity of Colletotrichum truncatum. Weed Sci. 43:312-317. Eshenaur, B. C. and MilhoUand, R. D. 1989. Factors influencing the growth of Phomopsis obscurans and disease development on strawberry leaf and runner tissue. Plant Dis. 73:814-819. Farr, D.F., Bills, G.F., Chamuris, G. P. and Rossman, A. V. 1989. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN. 1251pp. FigHola, S. S., Camper, N. D., and Ridings, W. H. 1988. Potential biological control agents for goosegrass {Eleusine indica). Weed Sci. 36:830-835. Fuerst, E.P., Amtzen, C.J., Pfister, K. and Penner, D. 1986a. Herbicide cross-resistance in triazine-resistant biotypes of four species. Weed Sci. 34:344-353. Fuerst, E.P., Barrett, M. and Penner, D. 1986b. Control of triazine-resistant common lambsquarters {Chenopodium album) and two pigweed species (Amaranthus spp.) in com (Zeamays). Weed Sci. 34:440-443. Gemeiner, P., Kurillova, L., Markovic, O., Malovikova, A., Uhrin, D., Ilavsky, M., Stefuca, v., Polakovic, M., and Bales, V. 1991. Calcium pectate gel beads for cell entrapment. 3. physical properties of calcium pectate and calcium alginate gel beads. Biotechnol. Appl. Biochem. 13:335-345.

PAGE 190

180 Grichar, W.J. 1994. Spiny amaimith (Amaranthtis spinosus L.) control in peanut {Arachis hypogaea). Weed Technol. 8:199-202. Grove, W.B. 1935. British Stemand Leaf Fungi. Vol 1. Cambridge University Press, Cambridge, England. Grove W.B. 1937. British Stemand Leaf Fungi. Vol 2. Cambridge University Press, Cambridge, England. Grubben, G.J.H. 1977. Tropical Vegetables and Their Genetic Resources. International Board for Plant Genetic Resources. 197 pp. Hahn, G.G. 1930. Life history studies of the species of Phomopsis occurring on conifers. Trans. Br. Mycol. Society 15:32-93. Harrington, F. A. and Potter, D. 1997. Phylogenetic relationships within Sarcoscypha based upon nucleotide sequences of the internal transcribed spacer of nuclear ribosomal DNA. Mycologia 89:258-267. Heiny, D.K., Mintz, A.S. and Weidemann, G.J. 1992. Redisposition of Aposphaeria amaranthi in Microsphaeropsis. Mycotaxon 44: 137-154. Heiny, D. K. and Templeton, G. E. 1991. Effects of spore concentration, temperature, and dew period on disease of field bindweed caused by Phoma proboscis. Phytopathology. 81:905-909. HiUis, D. M. and Dixon, M. T. 1991. Ribosomal DNA: Molecular evolution and phylogenetic inference. Quart. Rev. Biol. 66:411-453. Hoagland, R. E. 1996. Chemical interactions with bioherbicides to improve efficacy. Weed Technol. 10:651-674. Hofineister, F. M. and Charudattan, R. 1987. Pseudocercospora nigricans, a pathogen of sicklepod {Cassia obtiisifolia) with biocontrol potential. Plant Dis. 71 :44-46. Hokn L. Pancho, J., Herberger, J., and Plucknett, D. 1979. A geographical atlas of weeds. Wiley Interscience Publications, New York, NY. 330 pp. Holm, L., Plucknett, D., Pancho, J., and Herberger, J. 1977. The world's worst weeds. The Univ. Press of Hawaii, Honolulu. 609 pp. Holm, L, Doll, J., Hohn, E., Pancho, J., and Herberger, J. 1997. World Weeds: Natural Histories and Distributions. John Wiley and Sons, Inc. New York, NY. 1129 pp.

PAGE 191

181 Holt, J. S. and LeBaron, H. M., 1990. Significance and distribution of herbicide resistance. WeedTechnol. 4:141-149. Imaizumi, S. Nishino, T., Miyabe, K., Fujimori, T., and Yamada, M. 1997. Biological control of annual bluegrass {Poa annua L.) with a Japanese isolate of Xanthomonas campestris pv. poae (n-P4S2). Biol. Control. 8:7-14. Inman, R.E. 1971 A preliminary evaluation ofRumex rust as a biological control agent for curly dock. Phytopathology. 61:102-107. Jachetta, J.J., Radosevich, S.R. and Elmore, C.L. 1979. Differential susceptibility of two pigweed (^mara/2r/iM5 spp.) species to napropamide. WeedSci. 27:189-191. Jacobs, J. S., Sheley, R. L., and Maxwell, B. D. 1996. Effect of Sclerotinia sclerotiorum on the interference between bluebunch wheatgrass (Agropogon spicatum) and spotted ymscp^CQd. {Centaur ea maculosa). WeedTechnol. 10:13-21. James, T. D. W. and Sutton, J. C. 1996. Biological control of Bortytis leaf blight of onion by Gliocladium roseum applied as sprays and with fabric applicators. Eur. J. Plant Pathol. 102:265-275. Jensen, J.D. 1983. The development of Diaporthe phaseolorum var. sojae in culture. Mycologia 75:1074-1091. Johal, G.S. and Rahe, J.E. 1990. Role of phytoalexins in the suppression of resistance of Phaseolus vulgaris to Colletotrichum lindemuthianum by glyphosate. Can. J. Plant Pathol. 12:225-235. Jordan, D.L., Wilcut, J.W. and Fortner, L.D. 1994. Utility of clomazone for annual grass and broadleaf weed control in peanut (Arachis hypogaea). Weed Technol. 8:23-27. Kadir, J. and Charudattan, R. 1996. Dactylaria higginsii (Lutrell) M. B. Ellis: A potential bioherbicide for nutsedges (Cyperus spp.). Proc.WSSA (Abstract). 36:49. Kahn, H.A. and Sempos, C.T. 1989. Statistical Methods in Epidemiology. Monographs on Epidemiology and Biostatistics, Vol 12. Oxford University Press, New York, N.Y. BCillebrew, J.F., Roy, K.W. and Abney, T.S. 1993. Fusaria and other fungi on soybean seedlings and roots of older plants and interrelationships among fimgi, symptoms, and soil characteristics. Can. J. Plant Pathol. 15:139-146. Klein, T. A. and Auld, B. A. 1995a. Influence of spore dose and water volume on a mycoherbicide's efficacy in field trials. Biol. Control 5:173-178.

PAGE 192

182 Klein, T. A. and Auld, B. A. 1995b. Evaluation of Tween 20 and glycerol as additives to mycoherbicide suspensions applied to bathurst burr. Plant Prot. Quart. 10:14-16. Klein, T. A., Auld, B. A., Fang, W. 1995. Evaluation of oil suspension emulsions of Colletotrichum orbiculare as a mycoherbicide in-field trials. Crop Prot. 14:193-197. Koenig, R. L. 1997. Phylogenetic and populations genetic analysis of Fusarium oxysporum f sp. cubense, the causal agent of fusarium wilt on banana. Ph. D. dissertation, University of Florida. 11 3 pp. Kohl, J., Molhoek, W. M., van der Plas, G. H., and Fokkema, N. J. 1995. Suppression of sporulation of Botrytis spp. as a valid biocontrol strategy. Eur. J. Plant Pathol. 101 :251259. Krausz, R.F., Kapusta, G. and Matthews, J.L. 1994. Soybean (G/yc/ne max) and rotational crop response to PPI chlorimuron, clomazone, imazaquin, and imazethapyr. WeedTechnol. 8:224-330. Kropff, M.J., Weaver, S.E. and Smits, M.A. 1992. Use of ecophysical models for cropweed interference: Relations amongst weed density, relative time of weed emergence, relative leaf area, and yield loss. Weed Sci. 40:296-301. Kulik, M.M. 1988. Observations by scaiming electron and bright-field microscopy of the mode of penetration of soybean seedlings by Phomopsis phaseoli. Plant Dis. 72: 1 15118. Li, Y., Kobayashi, H., Tokiwa, Y., Hashimoto, Y. and Iwasaki, S. 1992. Interactions of phomopsin A with porcine brain tubulin: Inhibition of tubulin polymerization and binding at a rhizoxin binding site. Biochem. Pharmacol. 43:219-224. Luc, M., Sikora, R.A and Bridge J., (eds.). 1990. Plant Parasitic Nematodes in Subtropical and Tropical Agriculture. C.A.B. International, Wallingford, Oxon, UK. 707 pp. Luduena, R.F., Roach, M.C., Prasad, V., and Lacey, E. 1990. Effect of phomopsin A on the alkylation of tubulin. Biochem. Pharmacol. 39:1603-1608. Lugo, M. 1996. Competitiveness of smooth pigweed, large crabgrass, and snap bean under greenhouse conditions. J. Agric. Univ. Puerto Rico 80:199-201. Luttrell, E.S. 1947. Diaporthe phaseolorum var. sojae on crop plants. Phytopathology. 37:445-465. Manley, B. S., Wilson, H. P., and Hines, T. E. 1996. Smooth pigweed {Amaranthus hybridus) and livid amaranth {A. lividus) response to several imidazolinone and sulfonylurea herbicides. WeedTechnol. 10:835-840.

PAGE 193

183 Marin, S., Sandis, V., and Magan, N. 1995. Water activity, temperature, and pH effects on the growth of Fusarium moniliforme and Fusarium proliferatum isolates from maize. Can. J. Microbiol. 41:1063-1070. Massion, C. L. and Lindow, S. E. 1986. Effects of Sphacelotheca hold infection on morphology and competitiveness of johnsongrass (Sorghum halepense). Weed Sci. 34:883-888. McGuire, M. R. and Shasha, B. S. 1992. Adherent starch granules for encapsulation of insect control agents. J. Econ. Entomol. 85:1425-1433. McPartland, J.M. 1983. Phomopsis gangae sp. now. on Cannabis sativa. Mycotaxon 18:527-530. McRae, C.F. and Auld, B.A. 1988. The influence of environmental factors on mthiacnose of Xanthium spinosum. Phytopathology. 78:1182-1186. Meijer, G., Megnegneau, B. and Linders, E. 1994. Variability for isozyme; vegetative compatibility and RAPD markers in natural populations of Phomopsis subordinaria. MycoI.Res. 98:267-276. Mekki, M. and Leroux, G.D. 1994. Activity of nicosulfuron, rimsulfuron, and their mixture on field com {Zea mays), soybean {Glycine max), and seven weed species. Weed Technol. 8:436-440. Mintz, A.S., Heiny, D.K. and Weidemann, G.J. 1992. Factors influencing the biocontrol of tumble pigweed (Amaranthus albus) with Aposphaeria amaranthi. Plant Dis. 76:267269. Monks, D.W. and Oliver, L.R. 1988. Interactions between soybean {Glycine max) cultivars and selected weeds. Weed Sci. 36:770-774. Moomaw, R.S. and Martin, A.R. 1985. Herbicide evaluations of no-till soybean {Glycine max) production in com {Zea mays) residue. Weed Sci. 33:679-685. Morin, L., Watson, A.K. and Reeleder, R.D. 1990a. Effect of dew, inoculum density, and spray additives on infection of field bindweed by Phomopsis convolvulus. Can. J. Plant Pathol. 12:48-52. Morin, L., Watson, A.K. and Reeleder, R.D. 1990b. Production of conidia by Phomopsis convolvulus. Can. J. Microbiol. 36:86-91. Mortensen, K. 1986. Biological control of weeds with plant pathogens. Can. J. Plant Pathol. 8:229-231.

PAGE 194

184 Muntanola-Cvetkovic, M., Bojovic-Cvetic, D., and Vukojevic, J. 1985. An ultrastructural study of alphaand beta-conidia in the fungal genus Phomopsis. Cryptogamie Mycologie 6:171-184. Murray, M.W., Arnold, R.N., Gregory, E.J. and Smeal, D. 1994. Early broadleaf weed control in potato (Solarium tuberosum) with herbicides. Weed Technol. 8:165-167. Murray, T.D. 1988. Influence ofpK on Cephalosporiumgramineum. I. Radial growth and dry matter accumulation. Can. J. Bot. 66:2299-2304. Nation, J.L. 1983a. Stain Technology. 58:34-351. Nation, J.L. 1983b. hit. J. Insect Morphol. Embryol. 12:201-210. National Research Council. 1984. Amaranth: Modem Prospects for an Ancient Crop., National Academy Press, Washington, D.C. 80 pp. National Research Council. 1989. Lost Crops of the Incas: Little-Known Plants of the Andes with Promise for Worldwide Cultivation. National Academy Press, Washington, D.C. Nielsen, D.C. and Anderson, R.L. 1994. Photosynthesis and transpiration response of redroot pigweed {Amaranthus retroflexus). Weed Technol. 8:265-269. O'Donnell, K. 1992. Ribosomal DNA mtemal transcribed spacers are highly divergent in the phytopathogenic ascomycete Fusarium sambucinum (Gibberella pulicularis). Curr. Gen. 22:213-220. Ormeno-Nunez, J., Reeleder, R.D. and Watson, A.K. 1988. A foliar disease of field bindweed {Convolvulus arvensis) caused by Phomopsis convolvulus. Plant Dis. 72:338342. Paredes-Lopez, O., (ed.). 1994. Amaranth: Biology, Chemistry and Technology. CRC Press, Inc., Boca Raton, Florida, USA. 223 pp. Patterson, D.T., Flint, E.P and Beyers, J.L. 1985 Effects of CO2 enrichment on competition between a C4 weed and a C3 crop. Weed Sci. 32: 101-105. Paul, N. D. and Ayres, P. G. 1986. Interference between healthy and rusted groundsel (Senecio vulgaris L.) within mixed populations of different densities and proportions. NewPhytol. 104:257-269. Pearcy, R.W., Tumosa, N. and Williams, K. 1981. Relationship between growth, photosynthesis and competitive interactions for a C3 and a C4 plant. Oecologia 48:371376.

PAGE 195

185 Peterson, J.E., Jago, M.V., Payne, A.L. and Stewart, P.L. 1987. The toxicity of phomopsin for sheep. Aust. Vet. J. 64:293-298. Prasad, R. 1993. Role of adjuvants in modifying the efficacy of a bioherbicide on forest species: Compatibility studies under laboratory conditions. Pest. Sci. 37: 427-433. Pimithalingam, E. 1975. Some new species and combinations in Phomopsis. Trans. Br. Mycol. Soc. 64:427-435. Punithalingam, E. and Sharma, N.D. 1979. New Micro fungi from South East Asia. Nova Hedwigia 31:881. Radford, A.E., Ahles, H.E. and Bell C.R. 1968. Manual of the Vascular Flora of the Carolinas. The University of North Carolina Press, Chapel Hill, North Carolina. 1 1 83 pp. Rehm, S. and G. Espig. 1991. The Cultivated Crops of the Tropics. Verlag Josef Margraf, West Germany. 552 pp. Rehner, S. A. and Uecker, F. A. 1994. Nuclear ribosomal internal transcribed spacer phylogeny and host diversity in the coelomycete Phomopsis. Can. J. Bot. 72: 1666-1674. Riedl, H. and Wechtl, E. 1981. Proposal to conserve the name Phomopsis (Sacc.) Bubak 1905 against Myxolibertella Hohnel (1903). Taxon 30:826-827. Rupe, J. C. and Ferris, R. S. 1987. A model for predicting the effects of microclimate on infection of soybean by Phomopsis longicolla. Phytopathology. 77: 1 162-1 166. Saccardo, P.A. 1884. Phoma. Sylloge Fungorum 3:65-66. Saccardo, P.A. 1906. Phomopsis. Sylloge Fungorum 18:264-266. Sankaran, K.V., Maria Florence, E.J. and Sharma, J.K. 1987. Two new species of Phomopsis from India. Trans. Br. Mycol. Soc. 89:404-407. SAS Institute. 1988. SAS/STAT Users Guide. SAS histitute Inc. Cary,N. C. Sauer, J.D. 1950. The grain amaranths: A survey of their history and classification. Ann. Missouri Bot. Garden 37:561-619. Sauer, J.D. 1967. Grain Amaranths. Annals of the Missouri Bot. Garden 54:102-133. Scher, F.M. and Castagno, J.R. 1986. Biocontrol: A view from industry. Can. J. Plant Pathol. 8:222-224.

PAGE 196

186 Schweizer, E.E. 1981. Broadleaf weed interference in sugarbeets vw/gam). Weed Sci. 29: 128-133. Schweizer, E.E. and Lauridson, T.C. 1985. Powell amaranth {Amaranthus powellii) interference in sugarbeet (5e/a vw/gam). Weed Sci. 33:518-520. Sealy, R.L., Kenerley, C. M., and Mc Williams, E.L. 1988. Evaluation o^ Amaranthus accessions for resistance to damping-offby Pythium myriotylum. Plant Dis. 72:985-989. Serooussi, E. Peery, T., Ginzberg, I., and Koltin, Y. 1989. Detection of killerindependent dsRNA plasmids in Ustilago maydis by a simple and rapid method of extraction of dsRNA. Plasmid 2 1 :2 1 6-225. Shabana, Y.M., Charudattan, R., DeValerio, J.T., and Elwakil, M.A.I 997. An evaluation of hydrophilic polymers for formulating the bioherbicide agents Altemaria cassiae and^. eichhomiae. Weed Technol. 11:21 2-220. Shivas, R.G. 1991 Biology of Phomopsis emicis Shivas and its potential to control Emex australis Steinheil. Ph.D. Thesis, University of Western Australia. Shivas, R. G. and Scott, J. K. 1993. Effect of the stem blight pathogen, Phomopsis emicis, and the weevil, Perapion antiquum, on the weed Emex australis. Annu AppI Biol. 122:617-622. Sivakumaran, K., Mulugeta, D., Fay, P.K. and Dyer, W.E. 1993. Differential herbicide response among sulfonylurea-resistant Kochia scoparia L. accessions. Weed Sci 41:159-165. Smith, R.J. 1982. Integration of microbial herbicides with existing pest management programs. In Biological Control of Weeds with Plant Pathogens. R. Charudattan and H.L. Walker, eds. John Wiley and Sons, New York, NY. pp. 189. Smith, R. J., Jr. 1991. Integration of biological control agents with chemical pesticides. In Microbial Control of Weeds. TeBeest, D. O., ed.. Chapman and Hall, London. 284 pp. Sorenson, M. D. 1996. Treerot. University of Michigan, Ann Arbor, MI. 3 pp. Sparace, S. A., Wymore, L. A., Menassa, R., and Watson, A. K. 1991. Effects of the Phomopsis convolvulus conidial matrix on conidia germination and the leaf anthracnose disease of field bindweed {Convolvulus arvensis). Plant Dis. 75 : 1 1 751 1 79. Spegazzini. 1909. Diaporthe:Amaranti. Anal. Mus. Nac. Buenos Aires, Ser. 3. 12:360.

PAGE 197

187 Spurr, H.W., Jr. and Van Dyke, C.G. 1982. Biocontrol of weeds with plant pathogens: four decisions mark the research progression. In Biological Control of Weeds with Plant Pathogens. R. Charudattan and H.L. Walker, eds. John Wiley and Sons, New York, NY. pp. 238-239. Stallings, G.P., Thill, D.C. and Mallory-Smith C.A. 1994. Sulfonylurea-resistant Russian thistle (Salsola iberica) survey in Washington state. Weed Technol. 8:258-264. Stevens, A. 1932. The number of weight of seeds produced by weeds. Am. J. Bot. 19:784-794. Stevens, P. J. G. 1994. Silwet L-77-' organosilicone surfactant to maximize infection of weeds with pathogens. Regional Research Project S234 Annual Meeting. Street, J.E., Buchanan, G.A., Crowley, R.H. and McGuire, J. A. 1981. Influence of cotton {Gossypium hirsutum) densities on competitiveness of pigweed {Amaranthus spp.) and sicklepod (Cassia obtusifolia). Weed Sci. 29:253-256. Sutton, B.C. 1980. The Coelomycetes. Fungi imperfecti with pycnidia, acervuH, and stromata. Commonwealth Mycol. Inst., Kew, Surrey, England. 696 pp. Swofford, D. L. 1993. PAUP. Phylogenetic analysis using parsimony. Version 3.1. Illinois Natural History Survey. Champaign, IL. Taylor, J. W. and Swaim, E. C. 1995. Molecular evolution of ascomycete fungi: Phylogeny and conflict. Mycol. Res. 99:1205-1210. Taylorson, R.B. 1989. Responses of redroot pigweed {Amaranthus retroflexus) and witchgrass {Panicum capillare) seeds to anesthetics. Weed Sci. 37:93-97. TeBeest, D.O. 1985. Techniques for testing and evaluating plant pathogens for weed control. J. Agric. Entomol. 2:123-129. TeBeest, D.O. and Templeton, G.E. 1985. Mycoherbicides: Progress in the biological control of weeds. Plant Dis. 69:6-10. Tekrony, D. M., Egli, D. B., Stuckey, R. E., and Balles, J. 1983. Relationship between weather and soybean sees infection by Phomopsis sp. Phytopathology. 73:914-918. Templeton, G.E., TeBeest, D.O. and Smith, R.J., Jr. 1979. Biological weed control with mycoherbicides. Annu. Rev. Phytopathol. 17:301-310. Teri, J.M. and Mlasani, D.K. 1994. Choanephora blight and altemaria leaf spot of amaranth in Tanzania. Plant Pathol. 43:228-229.

PAGE 198

188 Tindall, H. D. 1983. Vegetables in the Tropics. AVI Publishing, Connecticut. 533pp. Toesing, E.M., Steyn, P.S., Osbom, M. and Weber, K. 1984. Phomopsin A, the causative agent of lupinosis, interacts with microtubules in vivo and in vitro. Eur. J. Cell Biol. 35:156-164. Transue, D.K., Fairbanks, D.J., Robinson, L.R. and Anderson, W.R. 1994. Species identification by RAPD analysis of grain amaranth genetic resources. Crop Sci. 34:1385-1389. Ubriszy and Voros, 1966. Phytopathogenic and saprobic fungi fi-om Hungary, I. Acta Phytopathol. Acad. Sci. Hung. 1:145-163. Udin, W. 1996. Epidemiology and management of Phomopsis shoot blight of peach, Prunus persica (L.) Batsch. Ph.D. dissertation, University of Georgia. 93 pp. Uecker, F.A. 1988. A world list of Phomopsis names with notes on nomenclature, morphology and biology. Mycol. Mem. 13:1-123. Uecker, F.A. and Johnson, D.A. 1991 Morphology and taxonomy of species of Phomopsis on asparagus. Mycologia 83:192-199. Uecker, F.A. and Kuo, K-C. 1992. A new P/io/nop5w with long paraphyses. Mycotaxon 44:425-433. Valovage, W. D. and Kosaraju, R. S. 1992. Effect of pH and buffer system on resting spore germination of the grasshopper (C)rthoptera:Acrididae) pathogen, Entomophaga calopteri {^Entomophaga grylli, pathotype 2) (Entomophthorales: Entomophthoraceae). Env. Entomol. 2 1 : 1 2021 2 1 1 Vangessel, M.J. and Renner, K.A. 1990. Redroot pigweed (Amaranthus retroflexus) and barnyard grass {Echinocloa crus-galli) interference in potatoes (Solanum tuberosum). Weed Sci. 38:338-343. Vencill, W.K. and Foy, C.L. 1988. Distribution of triazine-resistant smooth pigweed (Amaranthus hybridus) and common lambsquarters (Chenopodium album) in Virginia. Weed Sci. 36:497-499. Verma, U. and Charudattan, R. 1993. Host range of Mycoleptodiscus terrestris, a microbial herbicide candidate for Eurasian watermilfoil, Myriophyllum spicatum. Biol. Control 3:271-280. Vilgalys, R. and Sun, B.L. 1994. Ancient and recent patterns of geographic speciation in the oyster mushroom Pleurotus revealed by phylogenetic analysis of the ribosomal DNA sequences. Proc. Nat'l. Acad. Sci. 91:4599-4603.

PAGE 199

189 Walters, D.R. and Keil, D.J. 1977. Vascular Plant Taxonomy. Kendall/Hunt Publishing Company. Dubuque, Iowa, pp.488. Wapshere, A.J. 1974. A strategy for evaluating the safety of organisms for biological weed control. Annu. Appl. Biol. 77:201-211. Watson, A.K. and Wymore, L.A. 1989. Biological control, a component of integrated weed management. Proc. VII. Int. Symp. Biol. Contr. Weeds. Delfosse, E.S., ed. 1st. Sper. Patol. Veg. (MAF), pp.101-106. Weaver, S.E., Kropff, M.J. and Groeneveld, R.M.W. 1992. Use of ecophysical models for crop-weed interference: The critical period of weed interference. Weed Sci. 40:302307. Weaver, S.E. and Tan, C.S. 1983. Critical period of weed interference in transplanted tomatoes (Lycopersicon esculentum): Growth analysis. Weed Sci. 31:476-481. Webber, J. and Gibbs, J.N. 1981. A natural control of Dutch elm disease. Nature 292:449-451. Wellman, F.L. 1977. Dictionary of Tropical American Crops and Their Diseases. Scarecrow Press, Inc., London. 495 pp. White, T. J., Bruns, T., Lee, S., and Taylor, J. 1990. Amplification and direct sequencing of ribosomal RNA genes for phylogenetics. pp. 315-322. In PCR Protocols: A guide to methods and applications. Academic Press, San Diego, CA. Wiley, E. O., Siegel-Causey, D., Brooks, D. R., and Funk, V. A. 1991. The Complete Cladist: A primer of phylogenetic procedures. Univ. Kansas Museum of Natural History Spec. Pub. No. 19. Univ. Kansas, Lawrence, KA, 159 pp. Williams, J.T.,(ed.). 1993. Pulses and Vegetables. Chapman and Hall, London. 247 pp. Wilson, R.G., Jr., Wicks. G.A. and Fenster, C.R. 1980. Weed control in field beans {Phaseolus vulgaris) in western Nebraska. Weed Sci. 28:295-299. Womack, J. G. and Burge, M. N. 1993. Mycoherbicide formulation and the potential for bracken control. Pest. Sci. 37:337-341. Yang, S-M., Johnson, D. R., and Dowles, W. M. 1993. Infection of leafy spurge by Alternaria alternata and A. angustiovoidea in the absence of dew. Phytopathology. 83:953-958. Yesodharan, K. and Sharma, J. K. 1987. Phomopsis ichnocarpi sp. nov. on Ichnocarpus frutescens. Curr. Sci. 56:1078-1079.

PAGE 200

190 Zidack, N.K., and Backman, P. A. 1996. Biological control of kudzu (Pueraria lobata) with the plant pathogen Pseudomonas syringae pv.phaseolicola. Weed Sci. 44:645-649.

PAGE 201

BIOGRAPHICAL SKETCH Erin Nichole Rosskopf was bom on August 18, 1967, in Baltimore, Maryland. She graduated from Kennard-Dale High School in 1985. She attended a branch campus of Penn State University and Indiana University of Pennsylvania before receiving her Bachelor of Science degree from Towson University, Towson, Maryland, in 1992. She served as the President of the Biology Club at Towson University, coordinating excursions for undergraduate biology students. During a brief respite from undergraduate school, Ms. Rosskopf explored the ecology of the Rocky Mountain Region of the United States and developed a keen appreciation for the natural resources of the U. S. It was during this period that Ms. Rosskopf discovered her personal need to find an area of work that could potentially contribute to the preservation of our natiaral lands. While a student at Towson University, Ms. Rosskopf discovered the work of Dr. R. Charudattan, and, after being accepted into his program in 1992, began work on her Ph.D. project on the development of a biocontrol agent for the management of pigweeds and amaranths. During the course of her Ph. D. career, Ms. Rosskopf has had the opportunity to study biological confrol of aquatic and terrestrial weeds in Brazil and Puerto Rico, as well as in the United States. Ms. Rosskopf has also participated extensively in the teaching of courses, both graduate and undergraduate, in the Plant Pathology Department, as well as serving as the President and Vice191

PAGE 202

192 President of the Plant Pathology Graduate Student Organization. She has won several awards for her research presentations, including the Agricultiiral Woman's Club award, the F. A. Wood Award, and the Sigma Xi Award, among others. Ms. Rosskopf is the ciurent chairperson of the Women in Plant Pathology committee of the American Phytopathological Society. Upon completion of her Ph. D. program, Ms. Rosskopf plans to pursue a career in Plant Pathology focusing on the development of alternative weed and disease control practices.

PAGE 203

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Raghavan Charudattan, Chair Professor of Plant Pathology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. David J. Mftchell Professor of Plant Pathology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. ames W. Kimbrough rofessor of Plant Pathology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Harold C. Kistler Professor of Plant Pathology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Thomas A. Bewick Associate Professor of Horticultural Science

PAGE 204

This dissertation was submitted to the Graduate Faculty of the College of Agriculture and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. December, 1997 A^^^ Dean, College of Agriculture Dean, Graduate School