Citation
Structure of a Skp1-glycan and biogenesis of its peptide linkage in Dictyostelium

Material Information

Title:
Structure of a Skp1-glycan and biogenesis of its peptide linkage in Dictyostelium
Creator:
Teng-Umnuay, Patana, 1961-
Publication Date:
Language:
English
Physical Description:
xiv, 139 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Chromatography ( jstor )
Enzyme activity ( jstor )
Enzymes ( jstor )
Gels ( jstor )
Ions ( jstor )
pH ( jstor )
Polysaccharides ( jstor )
Purification ( jstor )
Sugars ( jstor )
Carbohydrate Conformation ( mesh )
Department of Anatomy and Cell Biology thesis Ph.D ( mesh )
Dictyostelium ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Anatomy and Cell Biology -- UF ( mesh )
Glycopeptides ( mesh )
Glycosylation ( mesh )
Polysaccharides ( mesh )
Research ( mesh )
Transferases ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1998.
Bibliography:
Bibliography: leaves 128-138.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Patana Teng-umnuay.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
029814217 ( ALEPH )
51618544 ( OCLC )

Full Text











STRUCTURE OF A SKP1-GLYCAN AND BIOGENESIS OF ITS PEPTIDE
LINKAGE IN DICTYOSTELIUM












By

PATANA TENG-UMNUAY













A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF TIlE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1998














ACKNOWLEDGEMENTS

I would like to acknowledge my supervisor, Dr. Christopher M. West, for

allowing me to be a part of this interesting project and for his time and guidance. I would also like to thank other members of my committee, Dr. Jeffrey K. Harrison, Dr. Gudrun S. Bennett, and Dr. William A. Dunn, for their time and advice.

In addition, I would like to acknowledge the scientists who helped me in this

project, Drs. Howard R. Morris, Anne Dell, Maria Panico, and Thanai Paxton for their QTOF-MS study on the fucoglycopeptide, Dr. Michael R. Bubb for bringing us an idea of the actin binding motif and for his work on Skpl-actin interaction, Ms. Hanke van der Wel for her assistance and the preliminary work on purifying glycopeptide, Dr. Emil Kozarov for preparing the HW120 strain and the recombinant Skpl-His, Mr.Toby ScottWard for sharing his time with me on the fucosyltransferase project, Miss Kathryn T. Dobson for helping me screening Skpl -c-myc co-expression colonies, and Mr. Benjamin G. Luttge, Ms. Bonita Werts, Mr. Ryan Frankel, and Mr. Slim Sassi for their help in the GlcNAc-transferase project.

I would like to express my gratitude to Dr. Nancy D. Denslow and the scientists at the University of Florida ICBR Protein Chemistry Core Laboratory, Ms. Sara E. Petruska for showing me how to use MALDI-TOF-MS instrument, Mr. Edy Segura for the Edman degradation sequencing, and Mr. Alfred Chung for preparing the synthetic


Hi











peptides. Dr. David Rentz and Mr. James B. Parker at the University of Florida ICBR Glycobiology Core Laboratory are acknowledged for their assistance in the GC-MS and the Dionex-HPLC.

I would like to thank faculty members, secretaries, and graduate students in the Department of Anatomy and Cell Biology for their valuable friendship and for being an important part of my education. I also acknowledge my professor at the Chulalongkorn University, Dr. Visit Sitprija, for inspiring me to become a scientist.

Finally, I would like to thank my mother for believing in me, for teaching me to be a strong person, and for telling me not to give up my dream. Without her understanding and support, I would not be able to achieve my goal.



























Ii













TABLE OF CONTENT

page

ACKNOWLEDGMENTS ....................................................................... ii

LIST OF TABLES .............................................................................. vii

LIST O F FIG U R E S ............................................................................... viii

LIST OF ABBREVIATIONS ...................................................................... xi

A B ST R A C T ........................................................................................ xiii

CHAPTERS

1 INTRODUCTION

Protein G lycosylation ........................................................................... 1
Dictyostelium Skpl, a Marker Protein for a Novel Glycosylation Pathway ............ 5
Skpl is a Highly Conserved Protein with Multiple Cytoplasmic/Nuclear
Functions ................................................................................ 5
Skpl Mediates its Actions through an F-box Motif ................................ 7
Skpl Mediates Ubiquitin-Dependent Proteolysis of Cell Cycle and Other
Proteins through SCF complex .......................................................... 10
Skpl Mediates Phosphorylation of a Kinetochore Protein through an F-box
Motif which is Important for Kinetochore Assembly ........................... 12
The Possible Role of Skp 1 in von Hippel-Lindau Disease ........................... 13
The Importance of Skpl-Glycosylation Study ..................................... 14
The Characteristics and Compartmentalization of Skpl-Glycosylation ........... 15

2 THE GLYCOSIDIC LINKAGE AND STRUCTURE OF SKP1 GLYCAN

Introduction ..................................................................................... 17
M aterials and M ethods ........................................................................ 19
C ells ................................................................................... .. 19
Construction of Skp 1-c-myc Overexpression Strain HW120 ....................... 19
Preparation of Recombinant Dictyostelium Skp 1 (Skp 1-His) .................... 20


iv











Purification of Skpl ...................................................................... 21
Metabolic Labeling of Skpl .............................................................. 23
Monosaccharide Composition Analysis of Skpl-c-myc ......................... 23
Purification of Glycosylated Peptides .................................................. 23
Matrix-Assisted Laser Desorption Time-of-Flight (MALDI-TOF) Mass
Spectrom etry .............................................................................. 24
Q-TOF Mass Spectrometry ......................................................... 24
Exoglycosidase Digestion of Skpl Glycopeptides ................................ 24
Mild Acid Hydrolysis of the Fucoglycopeptide ................................... 26
R esults ........................................................................................ 26
Skpl Contained Only a Single Fucoglycopeptide ..................................... 26
Edman Degradation of Fucoglycopeptide Yielded the Sequence of
Peptide 139-151 ..................................................................... 28
Q-TOF MS Analysis Directly Demonstrated the Attachment of
Pentasaccharide at Pro 143 .............................................................. 28
MALDI-TOF MS Analysis of the Fucoglycopeptide ............................ 37
Sugar Composition Analysis of Skp 1 -c-myc ....................................... 37
Exoglycosidase Digestion of Fucoglycopeptide ....................................... 40
MALDI-TOF-MS Analysis of Afucosylated-Glycopeptide ...................... 42
Glycosylation Heterogeneity ......................................................... 47
D iscussion ................................................................................... 50

3 CHARACTERIZATION OF SKP1-GLCNAC TRANSFERASE

Introduction ..................................................................................... 58
M aterials and M ethods ........................................................................ 59
GlcNAc-Transferase Assay ........................................................... 59
Protein Concentration Determination ............................................... 61
Preparation of 5-Hg-dUMP Resin ................................................... 62
Preparation of Aminoallyl-UDP-GlcNAc-Sepharose for Affinity
C hrom atography ......................................................................... 63
GlcNAc-Transferase Purification ..................................................... 65
High-pH Anion-Exchange Chromatography of the Acid Hydrolysis
Derivatives of [3H]GlcNAc-Skpl ................................................. 68
The Reductive Alkaline Degradation of [3H]GlcNAc-Skpl ......................... 68
R esults ........................................................................................ 69
GlcNAc-Transferase Activity that Modified Skpl was Found in
the S 100 Fraction of Dictyostelium ................................................... 69
Purification Step 1: Anion Exchange Chromatography on DEAE
Fast-Flow .............................................................................. 75


v











Purification Step 2: Ammonium Sulfate Precipitation ................................ 79
Purification Step 3: Hydrophobic Interaction Chromatography on
Phenyl-Sepharose-(Low-Sub) Fast-Flow ......................................... 83
Purification Step 4: Reactive Dye Chromatography on Reactive Red-120
Fast-Flow .............................................................................. 83
Purification Step 5: Gel Filtration Chromatography on Superdex HPLC .......... 87 The Effects of Nucleotide Analogues on GlcNAc-Transferase Activity ........... 93
Purification Step 6: 5-Hg-dUMP-Sepharose 6B Chromatography ................ 96
Purification Step 7: affinity Chromatography on
5-(-3-aminoallyl)-UDP-GlcNAc Sepharose-4 Fast-Flow ......................... 100
Characteristics of the Acceptor Substrate Product .................................. 103
Kinetic Properites of the Skpl-GlcNAc-Transferase ............................... 105
D iscu ssion ..................................................................................... 110

4 SUMMARY AND PERSPECTIVES

Structure and Biogenesis of a Skp 1 -Glycan ............................................... 114
Dictyostelium Skpl Contains a Novel Pentasaccharide Linked to
H ydroxyproline ........................................................................ 114
Evidence of Skpl-Prolylhydroxylase Activity in the Cytosol ..................... 115
Characterization of Cytosolic Skpl-GlcNAc-Transferase .......................... 117
Characterization of Cytosolic Skpl-Fucosyltransferase ............................ 118
Evidence of Skpl-Galactosyltransferase in the Cytosol of Dictyostelium ........ 119
The Effects of Dictyostelium Skpl on Actin Polymerization ........................... 119
Preparation of Skp 1-c-myc Co-expression Strains ....................................... 120
Construction of a Plasmid Encoding Skpl-c-myc .................................... 120
In Vitro Site-Directed Mutagenesis of p48 ........................................... 122
Transformation of Dictyostelium Strain Ax3 .......................................... 124
Future D irection .............................................................................. 126

R E FE R E N C E S .................................................................................... 128
BIOGRAPHICAL SKETCH .................................................................... 139











vi













LIST OF TABLES


Table page


1.1. Glycosidic peptide linkage ................................................................3
1.2. Amino acid sequences of Skpl at positions 35-40 .....................................9
2.1. Exoglycosidase treatments of glycopeptides .........................................25
2.2 Predicted m/z values of endo-Lys-C derived Skpl peptides .......................29
2.3 MALDI-TOF-MS m/z values for endo-lys-c-derived glycopeptides .............51
2.4 Phylogenetic comparison of sequences surrounding Pro 143 .......................54
3.1 Purification of GlcNAc-transferase activity ..........................................80
3.2 Relative activity of the GlcNAc-transferase in the presence of donor
substrate analogues .......................................................................94
4.1 The oligonucleotide primers used to prepare Skpl 1-c-myc plasmids .............123


























vii














LIST OF FIGURES

Figure page

1.1 Genomic map of the regions surrounding thejfal andfpa2 genes ..................8
2.1. Purification of the [3H]fucoglycopeptide from Skpl .................................27
2.2 Q-TOF MS analysis of Skpl fucoglycopeptide ......................................30
2.3 MS/MS collisionally activated decomposition spectrum of m/z 829.42 ........31
2.4 Parts of the MS/MS spectrum shown in Fig. 2.3 expanded to show lower
mass region containing peptide-derived fragment ions more clearly ...............33
2.5 Parts of the MS/MS spectrum shown in Fig. 2.3 expanded to show higher
mass region containing peptide-derived fragment ions more clearly ...............34
2.6 Predicted masses of N and C terminal sequence ions of the
fucoglycopeptide.. .........................................................................35
2.7 MALDI-TOF-MS analysis of Skpl glycopeptides from normal strain Ax3 ......38 2.8 Fractionation of endo-Lys-C generated Skpl-His peptides .........................39
2.9 GC-MS analysis of Skpl -c-myc total sugars .........................................41
2.10 A time course MALDI-TOF-MS analysis of Skpl fucoglycopeptide
after m ild acid hydrolysis ................................................................43
2.11 Fractionation of endo-Lys-C generated afucosylated Skpl peptides .............. 44
2.12 MALDI-TOF-MS analysis of Skpl glycopeptides from
afucosylation strain HL250 ..............................................................46
2.13 Fractionation of endo-Lys-C generated Skpl-c-myc peptides ......................48
2.14 The mass spectra of endo-Lys-C generated Skpl-c-myc peptides ................49
3.1 Transfer of [3H] from UDP-[3H]-GlcNAc into S100 fractions of normal strain
Ax3 and overexpression strain HW120 ...............................................71
3.2 Transfer of [3H] from UDP-[3H]GlcNAc into S100 fractions of normal strain Ax3
and overexpression strain HW120 in the presence of Skpl-peptide 133-155 .....72
3.3 Inhibition of GlcNAc-transferase activities by synthetic peptide 133-155 and
anti-Skpl -antibody .......................................................................73
3.4 GlcNAc-transferase activity is specific for Skp 1l-c-myc ............................74


viii











3.5 Transfer of [3H] from UDP-[3H]-GlcNAc into P100 fractions of normal strain
Ax3 in the presence of Skpl-c-myc ....................................................76
3.6 The effects of pH on Skpl-GlcNAc-transferase activity ...........................77
3.7 GlcNAc-transferase activities in the flowthrough and wash fractions from
D EA E-Sepharose .........................................................................78
3.8 The effects of NaCl and KCl on GlcNAc-transferase activity .....................81
3.9 The effects of CaCl2 and MnCl2 on GlcNAc-transferase activity .................82
3.10 Purification of GlcNAc-transferase on phenyl-Sepharose low-sub column .......84
3.11 Purification of GlcNAc-transferase on a Reactive Red-120 column ............... 85
3.12 Reactive Red flowthrough fractions could not restore GlcNAc-transferase
activity ......................................................................................86
3.13 Ax3-S 100 or phenyl-Sepharose fraction did not increase GlcNAc-transferase
activity in the Reactive-Red purified fraction .........................................88
3.14 Purification of GlcNAc-transferase on a Superdex gel filtration HPLC
colum n ......................................................................................89
3.15 The GlcNAc-transferase activity is dependent on DTT ............................90
3.16 The GlcNAc-transferase activity is dependent on MgCl2 ..........................91
3.17 The effects of detergents on G1cNAc-transferase activities..........................92
3.18 The chemical structure of UDP-G1cNAc and the potential enzyme recognition
sites tested by nucleotide analogues ....................................................95
3.19 The structure of 5-Hg-dUMP-Sepharose 6B .........................................97
3.20 The effects of uracil on Superdex purifed and dUMP-Sepharose purified
G lcN A c-transferase .......................................................................98
3.21 Time course analysis of GlcNAc-transferase activity ...............................99
3.22 Chromatography of the reaction products from 5-(3-aminoallyl)-UDP-GlcNAc
synthesis after purification over a DEAE Sepharose Fast Flow column .........101 3.23 The structure of 5-(3-aminoallyl)-UDP-GlcNAc Sepharose 4 ....................102
3.24 Purification of GlcNAc-transferase activity on 5-(3-aminoallyl)-UDP-GlcNAc
Sepharose ................................................................................104
3.25 High-pH anion-exchange chromatography of the acid hydrolysis derivatives
of [3H ]G lcN A c-Skpl ...................................................................106



ix











3.26 Kinetic properties of the GlcNAc-transferase with respect to the HyPro
p eptid e .................................................................................... 107
3.27 Kinetic properties of the GlcNAc-transferase with respect to
Skp 1 -c-m yc ............................................................................... 108
3.28 Kinetic properties of the GlcNAc-transferase with respect to
U D P-G lcN A c ............................................................................. 109
4.1 Inhibition of actin polymerization by Dictyostelium Skpl ......................... 121






































x













LIST OF ABBREVIATIONS

Ara arabinose
ATP adenine 5'-triphosphate
Bio- 11 -UTP 5-(N-[N-biotinyl-e-aminocaproyl]-3-aminoallyl)-2'-UTP
cFTase cytosolic facosyltransferase
CTP cytosine 5'-triphosphate
Da dalton
DEAE diethylarninoethyl
DMF NN-dimethylfonnainide
DTT dithiothreitol
dUDP 2'-deoxy-uridine 5'-diphosphate
dUMP 2'-deoxy-uridine 5'-monophosphate
EDTA ethylenediamine-tetraacetic acid
Gal D-galactose
GaINAc N-acetylgalactosamine
GC-MS gas chromatography mass spectrometry
Glc D-glucose
GlcNAc N-acetyl-D-glucosamine
H20 water
HCI hydrochloric acid
HEPES N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid)
Hg('-') mercury
HgCl mercury chloride
HPLC high pressure liquid chromatography
KCI potassium chloride
LiCl lithium chloride
LSB, Lammeli sample buffer
mAb monoclonal antibody
MALDI-TOF MS matrix-assisted laser desorption time-of-flight mass spectrometry
Man mannose
MeCN acetonitrile
M, molecular weight
NaBH4 sodium borohydride
NaCl sodium chloride
NaOAC sodium acetate
NaOH sodium hydroxide
NHS N-hydroxysuccinimide


?d











(NH4)2SO4 ammonium sulfate
ORF open reading frame
PAGE polyacrylamide gel electrophoresis
PCR polymerase chain reaction
POPOP (dimethyl) 1,4-Bis(2-(4-Methyl-5-Phenyloxazoyl))Benzene PPO 2,5-Diphenyloxazole
Q-TOF MS quadrupole time-of-flight mass spectrometry
Rha rhamnose
RP-HPLC reversed phase-high pressure liquid chromatography
SDS sodium dodecyl sulfate
TEA triethylamine
TEAB triethylamine-bicarbonate
TFA trifluoroacetic acid
TMS trimethylsilyl
UDP uridine 5'-diphosphate
UMP uridine 5'-monophosphate
UTP uridine 5'-triphosphate
Xyl xylose



























xii













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

STRUCTURE OF A SKP1-GLYCAN AND BIOGENESIS OF ITS PEPTIDE LINKAGE IN DICTYOSTELIUM

By

Patana Teng-umnuay

December, 1998

Chairman: Christopher M. West, Ph.D.
Major Department: Anatomy and Cell Biology

Skpl is involved in the ubiquitination of certain cell cycle and other proteins. In Dictyostelium discoideum, Skpl has an unusual O-linked carbohydrate modification. Based on Edman degradation, MALDI-TOF-MS, Q-TOF-MS-MS decomposition, acid hydrolysis, and exoglycosidase studies of Skp 1 -glycopeptides from both normal cells and a fucosylation mutant, and the sugar composition of the protein determined by GC/MS analysis of TMS-derivatives of methanolysates, the glycan is concluded to consist of a linear pentasaccharide (Gal 1 l-6Gala 1 -Fucoa 1 -2Galp 1-3 GlcNAc) attached to a hydroxyproline at codonl43, which lies in a highly conserved region of the protein. The structure of the pentasaccharide and its glycosidic peptide linkage indicate a novel pathway of protein glycosylation which is predicted to consist of six novel enzymes including a prolyl-hydroxylase and five glycosyltransferases. An assay was developed for



xiii











the GlcNAc-transferase responsible for the attachment of the first sugar to the HyPro residue, using UDP-[3H]GlcNAc as a donor, and underglycosylated Skpl isolated from a Dictyostelium overexpression strain or a synthetic peptide as an acceptor. Skp 1 -GlcNActransferase activity was found in the S100 fraction but not in the P100 particulate fraction. The recombinant Skp 1 from E. coli and the synthetic peptide containing Pro in place of HyPro were inactive. The radioactivity was recovered as GlcNH2 after acid hydrolysis, indicating the incorporation of GlcNAc. Incorporated GlcNAc could not be released by 3-elimination, indicating the attachment to HyPro. The GlcNAc-transferase activity was purified to 17,000 folds with 14% yield from the cytosolic S100 fraction over DEAE, phenyl, Reactive Red, Superdex, dUMP, and UDP-GlcNAc columns. The enzyme behaved as a single component with an apparent Mr of 33,000 and apparent Km for UDP-GlcNAc of 0.16 gM. Activity of the enzyme was absolutely dependent on DTT. The presence of this enzyme in the cytosolic fraction, its requirement for a reducing environment, and its high affinity for UDP-GlcNAc strongly suggest that the GlcNAc-transferase glycosylates Skp 1 in the cytoplasm. The Skp 1 -GlcNAc-transferase and the previously described Skpl-fucosyltransferase appear to belong to a glycosylation pathway which is novel with respect to the structure formed and its compartmentalization in the cytoplasm rather than in the secretory pathway.







xiv














CHAPTER 1
INTRODUCTION

Protein Glycosylation

Glycosylation, the construction of oligosaccharide side chains of proteins and lipids, is the most common and the most diverse type of protein posttranslational modification. It is known to occur in every eukaryotic organisms and in some prokaryotic organisms including many species of archaebacteria and eubacteria (reviewed in Hart, 1992, Opdenakker et al., 1993). In an individual glycoprotein, more than one carbohydrate attachment is often present and each attachment site may contain different glycans. This microheterogeneity generates multiple glycoforms which may have different physical and biochemical properties and may lead to different functions.

Glycans are conjugated to proteins by three types of covalent linkages: N-linked, O-linked, and phosphate-linked glycosylation. The most well known N-glycosidic linkages are formed between N-acetylglucosamine and the amido group of L-asparagine. It is initiated in the rER by the en bloc transfer of a Glc3Man9GlcNAc2 precursor from a dolichol carrier onto the nitrogen in the asparagine of nascent polypeptides. The oligosaccharide structures are later modified in the ER and in the Golgi apparatus (reviewed in Kornfeld & Kornfeld, 1985, Abeijon & Hirschberg, 1992). The asparagine which is the attachment site for the GlcNAc residue is a part of a consensus motif, AsnX-Ser/Thr, where X may be any amino acid except proline. The Asn-X-Thr motif is more commonly utilized compared to the Asn-X-Ser motif (Kasturi et al., 1995). The


1








2


exception to this motif is nephritogenoside, in which glucose is N-linked to the sequence Asn-Pro-Leu (Shibata et al., 1988). Other N-linked monosaccharides were discovered in bacterial glycoproteins including glucose, N-acetylgalactosamine and rhamnose (Lis and Sharon, 1993).

O-glycosidic linkages are formed between oligosaccharide side chains and the

hydroxyl group of serine, threonine, tyrosine, hydroxylysine, or hydroxyproline. Most of the O-linked glycosylation pathways also occur in the secretory pathway. The oligosaccharide side chains are linked through the oxygen of hydroxyl group of serine, threonine, tyrosine, hydroxylysine, or hydroxyproline by sequential enzymatic additions of monosaccharides directly to the protein, beginning with N-acetyl-galactosamine in mucin-type glycans. In contrast to N-linked glycosylation, different types of O-linked glycosidic-peptide linkages have been identified (Table 1.1). Whereas the existence of specific motifs for the acceptor site has been identified in most of O-glycosylproteins (Bourdon et al., 1987; Harris and Spellman, 1993; Pisano et al., 1993; Plummer et al., 1995, Prockop et al., 1979), the consensus motifs of O-linked glycosylation in the secretory pathway are less defined which might be explained by different types of GalNAc-transferases (reviewed in Clausen & Bennett, 1996).

Recently, a new type of carbohydrate-peptide linkage named

phosphoglycosylation has been demonstrated in Proteinase I isolated form Dictyostelium discoideumn. It contains GlcNAc-1-PO4 linked to serine (Gustafson and Milner, 1980). Thereafter, 2 other cystein proteinases from D.discoideum were also shown to posses GlcNAc-1- P04 phosphoglycosylation (Mehta et al., 1996). Besides D. discoideum,








3


Table 1.1 Glycosidic peptide linkage (modified from Vliegenthart and Montreuji, 1995)

Type of glycoprotein Amino acid Reducing terminus
monosaccharide
N-glycosylp~roteins
Secretory type Asn j3-GlcNAc
Bacterial proteins Asn 1-GalNAc
Bacterial proteins Asn cx! j-Glc
Bacterial proteins Asn L-Rha
0-glycosylproteins
Mucin type glycoproteins Ser/Thr cx-GalNAc
Cytosolic proteins Ser/Thr 1-GlcNAc
Yeast proteins Ser/Thr Man
Rat tissues Ser/Tbr c-L-Fuc
Proteoglycan Ser f3-Xyl
Worm collagen Ser u-Gal
Factor IX Ser f3-Glc
Collagen OH-Lys 1-Gal
Extensin OH-Pro j3-L-Araf
Algae proteins OH-Pro 1-Gal
Skpl OH-Pro GlcNAc
Glycogenin Tyr cx-Glc
Clostridium protein Tyr j3-Glc








4


other examples ofphosphoglycosylation were also identified in Leishmania secreted acid phosphatases, and Trypanosoma cruzi cell surface glycoproteins (reviewed in Haynes, 1998).

Even though glycosylation was first localized in the endoplasmic reticulum and the Golgi complex of eukaryotic cells, it has been shown that the cytosol is a site of a simple form of glycosylation: the attachment of single N-acetylglucosamine residues in Olinkage to serines and/or threonines on multiples sites of nuclear and cytoplasmic proteins (termed O-GlcNAc) (reviewed in Haltiwanger et al., 1992b, Hart 1997). The first OGlcNAc proteins to be identified were the nuclear pore proteins. Thereafter, an increasing number of O-GlcNAc proteins in cytosolic and nucleoplasmic compartments have been recognized. The model that O-GlcNAc occurs in the cytosol has been confirmed by the finding that a UDP-GlcNAc:polypeptide O-GlcNAc glycosyltransferase enzyme can be purified from a cytosolic preparation of the liver (Haltiwanger et al., 1992a). Besides OGlcNAc proteins, other known cytosolic proteins which contain carbohydrate include glycogenin, phosphoglucomutase, and Dictyostelium Skpl. Glycogenin is a precursor for glycogen synthesis. Its tyrosine residue is attached with glucose. After a glycogen synthesis is completed, the protein buries itself inside the glycogen molecule (Pitcher et al., 1987, reviewed in Alonso et al., 1995). Phosphoglucomutase or parafusin is a cytosoic enzyme catalyzing the converting reaction of glucose-1-PO4 into glucose-6- PO4. Its glycan consists of Man capped by Glc-1-PO4 (Dey et al. 1994, Marchase et al., 1993, Veyna et al., 1994).








5


Dictyostelium Skpl, a Marker Protein for a Novel Glycosylation Pathway

In Dictyostelium discoideum, Skpl (S phase kinase-associated protein 1 or

suppressor of kinetochore protein 1) was discovered in the mutant strain HL250 which is defective in the ability to make GDP-fucose from GDP-mannose and consequently, is unable to carry out any fucosylation (Gonzales-Yanes et al., 1992). When exogenous fucose was given, HL250 cells could synthesize GDP-fucose via a salvage pathway. Treatment of HL250 vegetative cells with 3H-fucose showed that majority of 3H-fucose was incorporated into a single protein, Skpl (previously known as FP21).

In a cytosolic preparation of Dictyostelium discoideum, Skpl was present in both the S100 which is a cytosolic fraction after centrifugation at 100,000 g, and the P100 which is a particle fraction. The P100-Skpl was salt but not detergent extractable. These data are relevant to immunofluorescence studies using antibody against Skp 1 showing the localization of Skpl in the cytosol, on the membrane of large vesicle-like structures, and in the membrane ruffle. The cytosolic-localization of Skpl raised the possibility of a novel pathway of glycosylation in the cytosolic compartment of eukaryotic cells. Skpl is a Highly Conserved Protein with Multiple Cytoplasmic/Nuclear Functions

Skp 1 is an evolutionarily conserved protein expressed in all eukaryotic organisms. Skpl homologs have been found in Saccharomyces cerevisiae, Homo sapiens, Cavia porcellus (OCP-II), Emericella nidulans (SconC), Arabidopsis thaliana, Phaseolus vulgaris, Caenorhabditis elegans, chlorella virus (PBCV-1) genome, and many others. The sequence analysis of homologs of Skpl gene shows more than 60% identity in pairwise comparisons. The cellular compartmentation of Skpl appears to be varied








6


depending on the tissue or cell type. The localization of Skpl indicates multiple proposed functions in both nuclei and cytoplasm.

In human transformed fibroblasts, Skpl was copurified with Skp2-cyclin A-Cdk2 complex and was named Skpl for S phase kinase-associated protein (Zhang et al., 1995). Skpl is indirectly associated with cyclin A by binding to a F-box motif on Skp2p. Even though the function of Skpl in mammalian cells seems to be cell cycle regulatory, the expression of Skpl in the cytosol of the inner ear organ of Corti in guinea pig (Chen et al., 1995) and in rat brain neurons which do not express cyclin A and CDKs (Uro-Coste et al., 1997) implicates other functions of Skpl.

In E. nidulans, the Skpl homolog, SconC, is important in sulphur metabolite repression, a condition when the addition of methionine to the growth medium reduces the utilization of less favored sulphur sources such as sulphate (Natorff et al., 1993).

Most of the known functions of Skpl came from studies in yeast. In S. cerevisiae, Skpl homolog was identified as a cyclin F binding protein using the two-hybrid system (Harper et al., 1993). It was also independently identified as a component ofS. cerevisiae kinetochore binding protein, Cbf3p, and was coincidentally named Skpl for suppressor of kinetochore protein 1 (Stemmann and Lechner, 1996).

Different temperature-sensitive alleles of Skpl show that Skpl is required for cell cycle progression at both the Gl/S and G2/M checkpoints. In one study, the mutation of Ile to Asn at codonl72 (Skpl-3) caused haploid cells to arrest with a Gl DNA content whereas the mutation of Leu to Ser at codonl46 (Skpl-4) caused haploid cells to arrest with a G2 DNA content with an increased rate of chromosome missegregation (Connelly








7


and Hieter, 1996). In another study, the temperature sensitive mutant carrying two mutations resulting in Gl60E and R167K changes caused cells to arrest with a GI DNA content whereas the mutant with L8G change caused cells to arrest in both G1 and G2 (Bai et al., 1996). It is notable that all of these amino acids where the mutation occured are well-conserved among species including D. discoideum.

S.cerevisiae Skpl has a 28 amino acid insertion (codon 37-64) when aligned with the other homologs of Skpl. Since a plasmid construct with an in-frame deletion of the 28 amino acids could rescue a null mutation of Skpl and high level of expression of the human gene can complement the Skpl temperature sensitive mutant, the amino acid insertion in the yeast protein seems not to be critically important (Bai et al., 1996).

In Dictyostelium, Skpl is encoded by 2 genes namedfral andfa2 which are wellconserved (Fig. 1.1, West et al., 1997). The coding regions of both genes differ by 33 nucleotides and a short intron within the codon33 inj~a2. Both genes encode identical proteins except a single amino acid Ser/Ala at the codon 39. The amino acid sequencing of Skpl detected both A and S at codon 39 indicating that both genes were expressed (Table

1.2, West et al., 1997). In comparison to Dictyostelium, there appears to be 1 gene in S. cerevisiae, more than 7 genes in C. elegan, and 2 loci in mammalian cells (Chen et al., 1995, Demetrick et al., 1996).

Skpl Mediates its Actions through an F-box Motif

Sequence comparison of Skpl-interacting proteins (Skp2 and cyclin F) revealed an important motif, F-box, as a Skpl binding site (Bai et al., 1996). The examples of F-box proteins include Cdc4, cyclin F, Skp2, Grrl, Scon-2, and other undefined sequences









8





















fpal v BI 1I; l IVRI VB A

ARRV BlA

-2.9 -1.2 -1.1 0 0.8 3.1 4.3 6.1 kb
0.33 0,41



fpa2 VV NB1X
RI BI
N A BI RIBI

-4.0 -2.5 -1.7 -1.0 0 0.0 .0 1.8 4.5 kb
0.34 0.55






Figure 1.1 Genomic map of the regions surrounding thefpal andfpa2 genes. The regions corresponding to the cDNA offal are represented by the boxes. Distances are given in kb from the start of thefal cDNA. N= Ndel, A=AccI, B1=BstBI, R1=EcoRI, V= EcoRV, X1= BstXL. (West et al., 1997)








9


Table 1.2 Amino acid sequences of Skpl at positions 35-40

Amino acid Position
35 36 37 38 39 40
Gly 5.73 0.95 0.24 0.00 0.09 0.00
Glu 0.00 5.12 0.54 0.00 0.15 0.00
Ser 0.07 0.00 1.85 0.14 0.45 0.00
Asp 0.07 0.00 0.00 3.85 0.51 0.17
Ala 0.02 0.00 0.02 0.00 2.46 0.49
Pro 0.00 0.14 0.00 0.00 0.01 3.02

Skpl sequence G E S D A'S P
fima1 sequence G E S D S P
fra2 sequence G E S D A P
Amino acid sequence of the M, 10,600 CNBr fragment isolated from total Skpl isolated from the soluble S100 fraction. Amino acid yields for cycles 5-10, corresponding to positions 35-40 of the intact protein, are given. In addition, both gene products are found in both soluble (I & 11) Skpl pools (West et al., 1997).








10


from Genebank database. Besides the F-box motif, these proteins usually contain either WD-40 repeats such as Cdc4 or leucine-rich repeats such as Skp2, Grrl, and p58 (Bai et al., 1996; Kaplan et al., 1997). The role of F-box proteins have been demonstrated in the ubiquitination of Sicl and Cln1 (Feldman et al., 1997; Skowyra et al., 1997), and the phosphorylation of p58, a subunit of a kinetochore binding protein, Cbf3p (Kaplan et al., 1997).

Skpl Mediates Ubiquitin-Dependent Proteolysis of Cell Cycle and Other Proteins through SCF Complex

Controlled intracellular proteolysis is important for many cell functions. One of the processes, ubiquitination, is composed of series of enzymatic reactions required for the attachment of a multiubiquitin chain on a target protein (reviewed in Hochstrasser, 1996). The first step is the activation of ubiquitin by the ubiquitin-activating enzyme

(El) resulting in the formation of an El-ubiquitin thiol ester. In the second step, ubiquitin-conjugating enzymes (E2) mediate the transfer of ubiquitin from El-ubiquitin complex to a substrate protein. This step usually requires an E3-enzyme (ubiquitinprotein ligase) for the substrate specificity. Then, ubiquitinated proteins are degraded by a specific multiprotein protease complex, the 26S protease.

Ubiquitin-dependent proteolysis is essential for two steps of cell cycle, G1 to Sphase, and metaphase to anaphase. Substrates for the ubiquitin proteolytic pathway include cyclins, which are positive regulators of cyclin-dependent kinases (Cdks), and Cdk inhibitors, which are negative regulators. In S. cerevisiae, Cdc 28 (Cdk 2,4,5, and 6 in higher eukaryotes) is activated in G1 phase by the G1 cyclins, Clnl,2, and 3 (cyclin C, D,








11

and E in higher eukaryotes) and in S through M phase by the mitotic cyclins, Clbl-Clb6 (reviewed in Nasmyth, 1996). Whereas mitotic cyclins degradation are regulated by E3 ubiquitin ligase called the anaphase promoting complex (APC), G1 cyclins and Cdk inhibitors are requlated by E3 ubiquitin ligase complex which recognizes phosphorylated substrate (reviewed in Hershko, 1997). One of the E3 ubiquitin ligase complex composed of Skpl, Cdc53 (Cullin) and the F-box protein (SCF complex) has been shown to regulate ubiquitin-dependent degradation of many GI cyclins and Cdk inhibitors (reviewed in Krek, 1998).

The entry into S-phase requires the activation of the Clb/Cdc28 kinase complex. These kinase complexes are initially inactive due to the presence of high levels of the Sphase Cdk inhibitor, Sicl (Nugroho and Mendenhall, 1994; Schwob et al., 1994) which is synthesized in late mitosis. Gl cyclin-dependent kinase proteins (Clns/Cdc28) phosphorylate Sicl (Verma et al., 1997a), which triggers the degradation of Sicl (Verma et al., 1997b). The degradation of phosphorylated Sicl is controlled by E2 ubiquitinconjugating enzyme, Cdc34 (Goebl et al., 1988; Schwob et al., 1994), and E3 ubiquitin ligase complex formed by three other proteins, Skpl, Cdc53, and F-box protein/Cdc4 (Schwob et al., 1994; Bai et al., 1996).

Similar to Sic 1, the degradation of G1 cyclins, Clns, also require Cdc34, Skpl, and Cdc53. However, the F-box component of SCF complex for Clns degradation process is Grrl instead of Cdc4 (Barral et al., 1995) indicating the role of F-box protein on substrate specificity. Grrl binds phosphorylated Clns and Grrl/Clns is connected to other ubiquitination regulatory proteins through Skpl ( Li and Johnston, 1997; Skowyra et al.,








12

1997; Kishi et al., 1998). GRR1 was initially identified as a gene required for glucose repression in S. cerevisiae (Flick and Johnston, 1991). Mutations in GRR1 relieve repression of many glucose-repressed genes (Bailey and Wood word, 1984; Flick and Johnston, 1991) and prevent glucose induction of hexose transporter (HXT) genes (Ozcan and Johnston, 1995). Interestingly, the binding of Skpl to Grrl is regulated by the presence of glucose in the media and Skplinteracts with Grrl and Cdc53 to mediate the glucose-induced HXT genes by an unknown mechanism which does not require Cdc34 (Li and Johnston, 1997).

The example of Sicl and Clns degradation indicates that one of the molecular mechanisms of Skpl is to link an F-box protein and its target to Cdc53 for ubiquitin dependent proteolysis. Besides Sicl and Clns, other regulatory proteins have been shown to be degraded by the SCF pathway, including the Cln/Cdc28 inhibitor Farl (Henchoz et al., 1997), the replication protein Cdc6 (Drury et al., 1997), and the transcription factor Gcn4 (Kornitzer et al., 1994).

Skpl Mediates Phosphorylation of a Kinetochore Protein through an F-box Motif which is Important for Kinetochore Assembly

Skpl has other functions that are not related to proteolysis as well. Skpl was independently identified as a component ofS. cerevisiae kinetochore binding protein, Cbf3 (Stemmann and Lechner, 1996). Cbf3 is a 240 kDa multicomponent protein that specifically binds to CDEIII, a conserved element of the centromere DNA sequence (lechner and carbon, 1991), Cbf3 is composed of 4 subunits, p23 (Skpl), p58, p64, and p110 (Lechner and Carbon, 1991; Stemmann and Lechner, 1996). All four components are








13


important for Cbf3 assembly and CDEIII binding (Lechner, 1994; Sorger et al., 1995; Kaplan et al., 1997). Yeast cells carrying the Skpl mutation arrest in G2 and exhibit an increased rate of chromosome loss (Connelly and Hieter, 1996).

Active Cbf3p can be formed from purifed p64, p110 and activated p58. Skpl activates p58 by an interaction with the F-box motif on p58 and mediates p58 phosphorylation. Recombinant Skpl alone was inactive in reconstituting the CDEIII binding activities of Cbf3p in Skpl-4 strain but recombinant p58 isolated from insect cells coexpressed with Skpl and p58 could restore the activities indicating the requirement of interaction between Skpl and p58 (Kaplan et al., 1997). Because Skpl does not contain any protein kinase motif, an unidentified kinase in Skpl-p58 complex is required for p58 phosphorylation.

The Possible Role of Skpl in von Hippel-Lindau Disease

Von Hippel-Lindau (VHL) disease is a hereditary syndrome characterized by the development of vascular tumors of the central nervous system, retina, kidney, pheochromocytomas, pancreatic islet cell tumors, and benign cysts in multiple organs. The defect occurs by germ line mutations of the tumor suppressor gene, VHL (reviewed in Maher and Kaelin, 1997). The VHL gene product, pVHL, blocks the binding of elongin A to elongin B and elongin C resulting in the inhibition of elongin activity (Duan et al., 1995). The elongin activity is important for stabilizing hypoxia-inducible mRNAs including vascular endothelial growth factor (VEGF) and Glutl glucose transporter and pVHL is a negative regulator. The role of SCF complex in von Hippel-Lindau disease has been investigated, based on the findings that elongin A is an F-box protein, elongin B








14


contains a region which is similar to ubiquitin and elongin C contains a region which is homologous to Skpl. Recently, cullin (Cul2), another component of SCF complex has been shown to interact with elongins B/C and pVHL (Lonergan et al., 1998). The similarity of pVHL-elongins B/C-Cul2 and SCF complex suggests the possible role of Skpl on the regulation of hypoxia-inducible mRNA by pVHL. The Importance of Skpl-Glycosylation Study

As described above, Skpl is an essential, multifunctional protein involved in

metabolite repression, kinetochore assembly, and cell cycle control in fungi, yeast, and mammalian cells. A putative mechanism of Skpl is to target F-box proteins and their complexes for specific activities, which can explain how the protein is associated with such diverse functions. Skpl binding to the F-box motif in Cdc4 and Grrl connects Sicl and Cln to the ubiquitin degradation complex, respectively. Another example is the binding of Skpl to p58 which leads to the activation of p58 by phosphorylation indicating that Skpl connects p58 to an unidentified kinase. Since many cytosolic and nuclei proteins have been found to contain the F-box motif, additional protein-complexes and functions of Skpl will likely be discovered.

In Dictyostelium, the finding that Skpl contains fucose, which is unusual for a cytosolic protein, has made Skpl a model for the study of a novel protein Oglycosylation pathway. It is yet to be proved whether glycosylation of Skp 1 occurs in other cell types. Structural heterogeneity mediated by glycosylation of Skpl may be important for the specificity of Skpl-protein interaction. Moreover, the carbohydrate structure may be important for cytosolic localization which consequently regulates Skp l








15


function in the nucleus.

Glycosylation in the secretory pathway of certain proteins has been shown to be important for protein folding, targeting, and/or ligand binding (reviewed in Varki, 1993). In addition, there is evidence that cytosolic glycosylation may have regulatory functions. Clostridial toxins inactivate Rho subfamily members of GTP-binding proteins by glycosylation (Just et al., 1995a; Just et al, 1995b). O-GlcNAc modifications are found to be dynamic and their attachment sites are indistinguishable from or close to those used by various protein kinases suggesting the competition of O-GlcNAcylation with phosphorylation (Chou et al., 1995; reviewed in Greis and Hart, 1997). Another example of the importance of cytosolic glycosylation is demonstrated in the O-GlcNAc protein, p67. Inactivation of eIF-2 kinase is dependent on the glycosylation state of p67. Deglycosylation of p67 activates eIF-2 kinase resulting in an inhibition of the translation factor, eIF-2o (Chakraborty et al., 1994).

The Characteristics and Compartmentalization of Skpl-Glycosylation

Indirect lines of evidence suggest that the glycosylation process of Skpl occurs in the cytosolic compartment. First, a fucosyltransferase (cFTase) which can fucosylate Skpl has been purified from the S100 of Dictyostelium (West et al., 1996). Moreover, the Skpl cDNA does not encode a targeting sequence essential for translocation into the secretory pathway. Finally, the Skpl sequence contains the consensus motif for N-linked glycosylation at amino acid residue 45, Asn45-Val-Thr, but it is not N-glycosylated. These reasons imply that Skpl remains in the cytoplasm after translation and is not translocated into the ER.








16

It will be impossible to study the importance of the cytosolic-fucosylation pathway of Skpl unless its glycan structure and biosynthesis are characterized. To support the future structure and function investigations of the Skpl glycan, the nature of the previously identified cytosolic fucosylation in Dictyostelium was determined in this study. The Skpl glycan has been identified as a linear pentasaccharide (Gall-6GalalFuccl-2GalP1-3GlcNAc) attached to a hydroxyproline at codonl43. The construction of this unusual structure is predicted to require six enzymes including one prolylhydroxylase and six glycosyltransferases. The Skpl-GlcNAc-transferase, the enzyme responsible for the attachment of the first sugar, GlcNAc, has been purified from the cytosol of Dictyostelium. Its activity is dependent on the presence of reducing reagent and has a submicromolar Km for the substrate, UDP-GlcNAc. These findings support the hypothesis that this new glycosylation pathway resides in the cytosolic compartment of the cell.













CHAPTER 2

THE GLYCOSIDIC-PEPTIDE LINKAGE AND STRUCTURE OF SKP1 GLYCAN Introduction

Skpl is found in a multiprotein complex with cullin (a cdc53 homologue) and an F-box containing protein to form the SCF complex, named as an acronym of the participating proteins. When this complex contains an E2 enzyme, it is responsible for ubiqutinating various target proteins, depending on the identity of the F-box protein. Targets for subsequent degradation identified in Saccharomyces cerevisiae include cell cycle proteins such as the S-phase kinase inhibitor Sic1 and G1 cyclins, and proteins specific to the nutrition of the cell (Bai et al., 1996; Skowra et al., 1997; Feldman et al., 1997; Li and Johnston, 1997). The SCF complex has also been implicated in phosphorylation of kinetochore proteins (Kaplan et al., 1997), and another distantly related complex affects mRNA metabolism (Lonergan et al., 1998). An SCF complex with Cyclin A and Cdk2 has been detected in mammalian cells and its abundance appears increased in transformed cells (Zhang et al, 1995; Lisatwan et al., 1998). Skpl itself is abundantly and dynamically expressed in the mouse embryo (Sowden et al., 1995) and central nervous system including post-mitotic neurons (Uro-coste et al., 1997) and at very high concentrations in the inner ear organ of Corti (Chen et al., 1995; Yoho et al., 1997), where it comprises up to 5% of total protein in the cytoplasm. The expression of several Skpl genes in plants appears to be governed by morphogenetic boundaries (Ingram et al., 1997). Thus Skpl is expressed ubiquitously in eukaryotes, and its role may


17








18


be to facilitate the selection of other proteins for specific posttranslational modification.

Binding of Skpl to different proteins may be regulated structurally, as it is encoded by multiple genes in multicellular organisms (Chen et al., 1995; Bai et al., 1996; Demetrick et al., 1996; Liang et al., 1997; West et al., 1997). Skpl structure is also altered by glycosylation in Dictyostelium discoideum (Gonzalez-Yanes et al., 1992; Kozarov et al., 1995), which may regulate its activity. Because complex glycosylation of cytoplasmic/nuclear proteins is unusual, we embarked on a study to establish the structure of the carbohydrate modification as a first step in investigating its function.

In order to determine the structure and site of attachment of the previously

described Skpl fuco-oligosaccharide(s) (Gonzalez-Yanes et al., 1992; Kozarov et al., 1995), mass spectrometric approaches were employed. Key to the success of the this methodology was the newly developed Q-TOF MS (Morris et al., 1996; Moris et al., 1997), which permitted MS-MS studies to be performed on the pmol quantities of material available from native sources. This recently designed instrument comprises a quadrupole with collision cell followed by an orthogonal acceleration time-of-flight (TOF) analyzer which confers a high degree of sensitivity and accuracy to the mass measurements. The ability of this instrument to sequence both the peptide and oligosaccharide chains of a Skpl fucoglycopeptide suggested that it consists of a linear pentasccharide, D-Galpcal,6-D-Galpc l,-L-Fucpol,2-D-Galpp31,3GlcNAc, attached to hydroxylated Pro 143. The sugar sequence was established from exoglycosidase studies using MALDI-TOF-MS and sugar analyses on genetically-overexpressed material. The protein attachment site was then confirmed by Edman degradation.








19

These results reinforce the model that complex O-linked glycosylation occurs in the eukaryotic cytoplasmic compartment. While there has been much circumstantial evidence to support this model (Hart et al., 1989), it has remained controversial (Medina and Haltiwanger, 1998). In contrast, simple glycosylation, in the form of GlcNAc O-linked to residues of Ser or Thr, is well established in this compartment (Hart, 1997). The sugar structures which have been described to date on cytoplasmic/nuclear proteins are generally distinctive from those produced in the secretory pathway, suggesting that there may be fundamental differences in the biogenesis and function of these modifications.

Materials and Methods

Cells

Strains Ax3 and HL250 were grown at 22oC in HL-5 medium on a gyratory shaker. In 6 liter flasks, cells grew to a density of 6-10 x 107per ml, which is referred to as stationary phase. Ax3 is a normal strain and HL250, derived from Ax3 by chemical mutagenesis, is unable to synthesize GDP-Fuc from GDP-Man and thus incorporates negligible Fuc into protein (Gonzalez-Yanes et al., 1992; Kozarov et al., 1995). Construction of Skpl-c-myc Overexpression Strain HW120

A full-length cDNA from thefpal gene with a decapeptide encoding the human cmyc epitope, EQKLISEEDL (Kolodziej, et al., 1991), inserted between codons 161 and 162 near the C-terminus was prepared by PCR and cloned into pT7Blue (Novagen). The cDNA was subcloned into pVEIIAATG (Rebstein et al., 1993) under the control of the inducible discoidin promoter and the actin 8 terminator. The plasmid was transformed








20

into D. discoideum by a CaPO4 precipitation method and selected in the presence of 15 mg/ml G418 (Ferguson et al., 1994). Strain HW120 was a clone which produced Skp 1-cmyc at higher levels than its companion strains based on Western blot analysis with mAb 9E10 against the c-myc epitope. Skpl-c-myc contained two missense mutations, T194C and A305G resulting in amino acid substitutions I34T and D71G, introduced by the PCR reaction and confirmed by MS analysis of its peptides (data not shown). Preparation of Recombinant Dictyostelium Skpl (Skpl-His)

The open reading frame of Skpl was amplified using Dictyostelium DNA as the template and oligonucleotides, 5'tgctctcgagctcggatccattttgtgatgctgtttgta3' and 5'gactgagctcgaggatccaatgtctttagttaaattagaatctt3' as primers in a polymerase chain reaction. these primers contained BamHI restriction sites which were used to clone the amplified DNA into the BamHI restriction site of the inducible (Dubendorff and studier, 1991; Studier, 1991) expression vector pET 19b (Novagen, Madison, WI), downstream of the T7 RNA polymerase transcription element such that an oligo-His tag was introduced at the NH2 terminus. The deduced NH2-terminal sequence of Skpl-His is MGHHHHHHHHHHSSGHIDDDDKHMLEDP followed by the natural Skpl sequence, which was verified by sequencing of the plasmid DNA and contained 2 nonsense mutations. Expression host Escherichia coli BL21(DE3) cells carrying a lysogen with a copy of the T7 RNA polymerase gene under lacUV5 control were transformed under carbenicillin selection. After induction with isopropyl-1-thio- 3-Dgalactopyranoside, expressing colonies were examined. Inclusion bodies were not observed. Skpl-His was isolated from a single colony under nondenaturing conditions








21

using an affinity column consisting of nickel cations immobilized on Sepharose 6B, essentially as described (Hochuli et al., 1988). Purified protein was exhaustively dialyzed against 50 mM HEPES-NaOH (pH 7.4) and concentrated in a centrifugal ultrafiltration concentrator (10-kDa molecular mass cut-off). Purified protein was shown to be recognized in a Western blot by monoclonal antibodies 3F9 and 4E1 confirming its identity as Skpl.

Purification of Skpl

Cell lysis. D. discoideum strains Ax3, HL250 or HW120 were grown to stationary phase in HL-5 medium. After washing once in ice-cold water, cells were resuspended in 50 mM Tris-HC1, 0.25 M sucrose, pH 7.4 containing protease inhibitors (10 gg/ml leupeptin, 10 gg/ml aprotinin, 1.0 mM phenylmethylsulfonyl fluoride). The suspension was suctioned though a bed of glass wool, and lysed by forced passage though a 47 mm diameter Nuclepore filter with 5 pm diameter pores mounted on the end of a 60 ml syringe. The lysate was centrifuged at 4,000 x g for 2 min, and the supernatant was centrifuged at 100,000 x g for 60 min. All procedures were performed at 0-40C.

DEAE-Sepharose-Fast-Flow chromatography. The final S100 supernatant was pumped onto a 450 ml DEAE-Sepharose Fast Flow Column (4.6 x 28 cm) preequilibrated in 50 mM HEPES-NaOH (pH7.4), 15% glycerol, 5 mM MgCl2, 0.1 mM disodiumEDTA, 1.0 mM DTT and the column was washed with the equilibration buffer until the A280 dropped below 1% of its maximum. Skpl was eluted in a linear gradient of 0-0.25 M NaCl, consisting of 2.5 x column bed volumn of equilibration buffer and 2.5 x








22

column bed volumn of 0.25 M NaC1 in the same buffer. Analysis of fractions using a mAb 3F9 ELISA/dot blot assay revealed that Skpl from Ax3 and HL250 were fractionated into pools-I and -II (Kozarov et al., 1995). Skpl-c-myc from strain HW120 was eluted after pool-II.

Phenyl-Sepharose 6 Fast-Flow chromatography. DEAE pools were pumped onto a phenyl-Sepharose 6 Fast Flow (high-sub) column pre-equilibrated in 15% saturated (NH4)2SO4, 85 mM NH4OAc and the column was washed with the equilibration buffer until the A280 dropped below 1% of its maximum. Skpl was eluted by a decreasing gradient of (NH4)2SO4, consisting of 2.5 x column bed vol. of starting buffer and 2.5 x column bed vol of 2 mM NH4OAc, pH 7.4.

Monoclonal antibody 3F9 affinity chromatography. Phenyl-Sepharose pools were applied to immobilized rabbit IgG (pre-column) and mAb 3F9 columns, which were connected in series and pre-equilibrated in PBS. After loading of the sample, the mAb 3F9 column was disconnected and washed with the same buffer until all nonbound protein was washed out. The column was eluted with 0.1 M glycine-HC1, pH 2.5. The eluted fractions were collected into 1.5 ml tubes containing 100 gl of 1M Tris, natural pH.

Reversed-phase high-performance liquid chromatography. In some cases, Skpl was reduced and carboxamidomethylated. The protein was partially dried down in a speed-vac, brought to 7.5 mM DTT in 8 M urea, 0.4 M NH4HCO3, pH 7.9, heated to 50'C for 15 min, and incubated at 220C in 17 mM iodoacetamide for 15 min in the dark. The carboxamidomethylated protein was further purified on a C2/C18 (PC 3.2/3) RP-








23


HPLC column on a Pharmacia SmartSystem HPLC and eluted with a gradient of 0% (v/v) MeCN in 0.1% (v/v) TFA to 100% MeCN in 0.085% TFA. The peak which contained more than 80% of total Skpl was examined further. Recombinant Skpl (fpal) containing an N-terminal oligo-His tag was isolated from E. coli as described (Kozarov et al., 1995), and further purified on a RP-column as above. Metabolic Labeling of Skpl

A 200 ml culture of Ax3 cells was grown for 3 generations in 0.05 mCi/ml [3H]Fuc in HL-5. Skpl was isolated in the same manner except the phenyl-Sepharose step was omitted. Purified radiolabeled Skpl was pooled with unlabeled Skpl. Monosaccharide Composition Analysis of Skpl-c-myc

Two nmol of mannitol was added as an internal standard to 1.5 nmol of Skpl -cmyc. The sample subjected to methanolysis, re-N-acetylation, and TMS-derivitization as described (Elwood et al., 1988), and analyzed in splitless mode on a 0.32 mm x 30 m SPB-1 column (Supelco) on a Shimadzu QP-5000 GC/MS workstation. Peaks were analyzed with selected ion monitoring at m/z 204 for the neutral sugars and m/z 173 for the N-acetylated amino sugars.

Purification of Glycosylated Peptides

Carboxamidomethylated Skpl was digested with endo-Lys-C from Achomobacter lyticus (Wako) in the presence of 2 M urea in 0.2 M Tris-HC1, pH 7.4, using an enzyme:substrate ratio of 1:200 (mol:mol), at 300C for 18 h. Peptides from metabolicallylabeled Skpl were fractionated on a Superdex Peptide HR10/30 HPLC column (Pharmacia) in 6 M urea in 50 mM NaCl, 50 mM Tris-HC1, pH 7.2, on an LKB GTi








24


HPLC system at 0.5 ml/min. Radioactive fractions were applied to a 4.6 x 150 mm, 3.5 mm particle C8 column (Zorbax) and eluted with a gradient of 5% (v/v) MeCN in 0.1% (v/v) TFA to 40% MeCN in 0.085% TFA at a flow rate of 1 ml/min. Peptides (25 pmol) were subjected to Edman degradation on an ABI model 494 Procise sequenator. Nonradiolabeled endo-Lys-C peptides were fractionated directly a C8 (Zorbac) or C2/C18 (PC

2.1/2; Smart System, Pharmacia) RP-columns as above. Matrix-Assisted Laser Desorption Time-of-Flight (MALDI-TOF) Mass Spectrometry

Samples were mixed with an equal volume of saturated a-cyano-4-hydroxycinnamic acid (Aldrich) in 70% acetonitrile. One gl (2-3 pmol) was deposited on a sample plate and allowed to air dry. Spectra were collected on a PerSeptive Biosystem Voyager RP MALDI-TOF-MS operated in the positive ion and linear modes. Q-TOF Mass Spectrometry

Samples from RP-fractions were introduced directly into the Q-TOF MS

(Micromass, UK) via a nanospray device. Primary and secondary ion spectra were collected in the positive ion mode.

Exoglycosidase Digestion of Skpl Glycopeptides

Approximate 15 pmol of glycopeptide from RP-fractions was partially dried by vacuum centrifugation, diluted to a final volume of 2.5 pl in a buffer containing the exoglycosidase (see Table 2-1), incubated at 370C for 18 h, and processed for MALDITOF-MS.









25


Table 2.1 Exoglycosidase treatments of glycopeptides

Pentasaccharide- peptide substrate
(initial mass m/z 2017) ______________________Enzyme Specificity Source Buffer b m/z
ct-galactosidase (10 mU/pil) Galcxl,2,3,4,6 green coffee 50 mM (NH4)2P04 2165
__________bean (B-M) d pH 6.0 (-2 hex)
oc-galactosidase (10 jiU/gl) Galcdl,3 recombinant 20 mM (NH4)2P04 2487
___________(Glyko) pH 6.0
c-galactosidase (IOjiU/jii) Galal,3/6 X.manihotis 20 mM (NH4)2P04 2327
____________________(NEB) pH 6.0 (-1 hex)
P-gucosidase (10 mU/gl) GluIGal/Fuc3 sweet almond 20 mM (NH4)2P04 2487
_____________________(B-M) pH 5.0
ax-fucosidase (2.5 mU/ Ll) Fuccl,2/314!6 bovine kidney 20 mM (NH4)2P04 2487
____________________(B-M) pH 5.0
cx-galactosidase (10 mU/ Ll) Galaxl,2,3,4,6 green coffee 50 mM (NH4)2P04 2017 + ax-fucosidase (IOWmU/ tl) -iFuccl,2 bean (B-M) d + pH 6.0 (-2 hex,
X.manihotis I dhex)
(NEB)

Disaccharide-4peptide substrate
(initial mass m/z 2017) ________ ________Enzyme Specificity Source Buffer b m/z
P-galactosidase (4 mU/[tl) Galfpl,3!4>6 bovine kidney 25 mM NH4OAc 1855
______________________________(OGS) pH 6.0 (-1 hex)
P-galactosidase (4.8 mU/gl) GalfPl,3/6 recombinant 20 mM (NH4)2P04 1855
___________(Glyko) pH 5.0 (-1 hex)
1-galactosidase (4.8 mU/pAl) Gal 31,3 X.manihotis 20 mM (NH4)2P04 1855
__________(NEB) pH 5.0 (-1 hex)
P-galactosidase (4 mU/gl ) Galfpl,3/4>6 bovine kidney 20 mM (NH4)2P04 1855
1-HexNAcase (6.5 mU/A) --GlcNAc/ (OGS) + pH 5.0 (-1 hex)
GalNAc3 jack bean (V________________________ ____________ Labs) _ _ ___aB-M = Boehinger-Mannheim, NEB = New England Biolabs, OGS =Oxford
GlycoSciences.
b. All reactions were incubated at 37'C for 18 h.
Glycopeptides purified by RP-HPLC were analyzed by MALDI-TOF-MS before and after treatment. All reactions were complete, that is, >95% of the parental ion was lost
and replaced by the major ion whose mass is described by the loss of one or more hex
or deoxyhex (dhex) units.
d. cx-galactosidase activity was purified from contaminating P-galactosidase activity as
described (Jacob and Scudder, 1994).








26


Mild Acid Hydrolysis of the Fucoglycopeptide

Approximate 20 pmol of the fucoglycopeptide was partially dried down in a

vacuum centrifuge, reconstituted in 10 gl of 0.05 M TFA, and incubated at 95C for up to 6 h.

Results

Skpl Contained Only a Single Fucoglycopeptide

To investigate the glycosylation of Skpl, normal cells (strain Ax3) were

metabolically labeled with [3H]Fuc, S 100 was extracted and purified by DEAE anion exchange chromatography. Skpl was separated into 2 pools as described (Kozarov et al., 1995; West et al., 1996). Skpl pool II was further purified to homogeneity by phenyl Sepharose chromatography and mAb 3F9 affinity chromatography. A pooled preparation of labeled and unlabeled material was denatured in urea, reduced and alkylated with iodoacetamide, and digested with endo-Lys-C in the presence of 2 M urea. When fractionated on a Superdex Peptide gel filtration column in the presence of 6 M urea, radioactivity eluted as a single peak centered at fraction 23 (Fig. 2.1A), which was further fractionated on a C8-reversed-phase (RP) HPLC column, again yielding a single radioactive peak centered at fraction 35 (Fig. 2.1B) which did not absorb at 280 nm and contained 30% of the original radioactivity. These results suggested that Skpl contained only a single fucoglycopeptide. A parallel experiment using unlabeled preparation showed an identical absorbance peak at fraction 35. Unlabeled purified peptide was used for MS analysis and Edman degradation.









27






A



E
o 023
0
O


10 20 30 40 50
35 time (min) 40 B
E






80
0






C2
20 40 60 80 35 time (min)





Figure 2.1 Purification of the [ H]fucoglycopeptide from Skpl. The normal strain Ax3 was metabolically labeled with [3H]Fuc, and Skpl pool II was purified from the
0
4


0 20 40 60 80
ti me (mi n)


Figure 2.1 Purification of the [3 Hjfuoglycopeptide from Skpl. The normal strain Ax3 was metabolically labeled with [3 H]Fuc, and Skpl pool Il was purified from the S 100 fraction to homogeneity. Reduced and alkylated Skpl was digested with Endo-LysC, and peptides were resolved on a Superdex Peptide gel filtration column (A). The radioactive fraction 23 was chomatographed on a C8-reversed phase column, which resolved 4 peptides (B). One of these, centered at fraction 35, was radioactive and did not absorb at 280 nm. This Skpl fucoglycopeptide was used for most of the structural studies.








28


Edman Degradation of Fucoglycopeptide Yielded the Sequence of Peptide 139-151

Edman degradation of unlabeled peptide fraction 35 yield the sequence

NDFTEEEEQIRK, which corresponded to that predicted for peptide 139-151 (Table 2.2) except that no signal was detected at the position of Pro 143. This finding suggested that Pro 143 was modified which could be explained if Pro 143 was glycosylated (Allen, 1981).

Q-TOF-MS Analysis Directly Demonstrates the Attachment of the Pentasaccharide at Pro143

This work was in collaboration with Dr. Howard R. Morris and Prof. Anne Dell at the Department of Biochemistry, Imperial College, London. The HPLC fraction (#35) containing the putative fucoglycopeptide was subjected to tandem mass spectrometry on a Q-TOF mass spectrometer. Analysis of a few picomoles in the MS-only mode gave a major [M+3H]3+ signal at m/z 829.42 (Fig. 2.2, including inset). Note the resolved natural abundance 13C isotopes at m/z 829.70 and 830.03 showing that this signal is triplycharged. It therefore derives from a molecule of mass 2485 Da. A series of doubly-charged ions were also apparent in the spectrum, separated by sugar mass differences (m/z 1244, 1163, 1081, 1008 and 927). The ion at m/z 1244 is the [M+2H]2+ ion corresponding to the [M+3H]3+ at m/z 829.42, and the mass differences from this correspond to intervals of Hex, Hex, Fuc and Hex respectively.

MS/MS of the m/z 829 [M+3H]3+ ion using argon gas and 50 eV collision energy produced the spectrum shown in Fig. 2.3. Interestingly, the spectrum shows the formation (from rn/z 829) of a number of doubly-charged ions at m/z 826, 927, 1009,









29


Table 2.2 Predicted m/z values of endo-Lys-C derived Skpl peptides

Peptide Sequence Predicted mass (mlz)
2-5 SLVK 447
6-12 LESSDEK 808
13-18 VFEIEK 765
19-28 EIAC*MSVTIK 1153
29-53 NMIEDIGESDS(A)PIPLPNVTSTILEK 2714
54-72 VLDYC*RHHHQHSPQGDDK 2328
73 K 147
74-76 DEK 391
77-90 RLDDIPPYDRDFC*K 1812
91-109 VDQPTLFELILAANYLDIK 2177
110-117 PLLDVTC*K 947
118-126 TVANMIRGK 990
127-133 TPEEJRK 873
134-138 IFNIK 635
139-151 NDFTPEEEEQIRK 1636
152-159 ENEWC*EDK 1111
160-162 GGN 247

* assume single C has carboxyamidomethyl substituent












30


















100- 829.70
+++
100 829.70


829.42 80.03










10




829 830 831/

p+

1008"46
~10089

37.009,47

84 .8209 +- 1009,92 108198
-- ,9 ,.,,,-, 2 27.4"1+ +
84 5 .41 927.9 954.91
~8 0 900.9K 1 10, 040.88 1162.91 124405


8 8 O 940 1000 1050 i10 Ii80 12b0 1250 1300 150 1400



Figure 2.2 Q-TOF MS analysis of Skpl fucoglycopeptide. A partial ES mass

spectrum of fraction 35 from Fig. 1 is presented, showing doubly and triply-charged ions.

The triply-charged ion at m/z 829 is expanded in the inset to show the isotope pattern.












31


















100. 16308

91 05







Peptide
I
HexNAc
[M+2H]2
927.92


927.45
204.12
Peptide

HexNAc, Hex
Peptide 28.42 [M+2H]2 M 2 .1008.94
826.41 Peptlde
825.90- 1
1008.46 HexNAc, Hex, Fuc 1009.43 [M+2H]2 Peptide Peptide
26.924 [M+H] + HexNAc
.230. 10 1851.79 tM+H)
2'9 y"' 1650.78
1081.48 1173.57 1 255,12377.17 .1081.48 Ha117.57xNAc 1
813.39 1019 175

4820 818.94 126
41 th a 11 4 2 61 L9 j1 1 1 1 7 1853.74
o260 360 460 60 s60 760 'abo ao' iooo ilbo 1200 130.1400 1800 i600 1f00 1800 1900 200




Figure 2.3 MS/MS collisionally activated decomposition spectrum of m/z 829.42+++. There is evidence in the MS and MS/MS spectra of minor variants in structure, but the data are consistent with the major molecular species present corresponding to the structure described in the text.








32

1081 and 1163 separated by sugar mass differences of HexNAc, Hex, Fuc and Hex respectively, suggesting a stepwise stripping of these sugars from a linear oligosaccharide attached to the glycopeptide. These data confirm that, in the MS spectrum shown in Fig.

2.2, the labeled doubly-charged ions were formed in that case by cone-voltage induced fragmentation from a true quasimolecular ion at m/z 829. The doubly-charged ion at m/z 826 (Fig. 2.3) showed no evidence of further sugar loss and is interpreted as the remaining peptide backbone. This is confirmed by the presence of a major singly-charged quasimolecular ion signal at m/z 1651 [M+H] for the peptide. A search for this mass in the gene derived sequence finds nothing, but the peptide identity can be determined from the presence of N- and C-terminal sequence ions (Morris et al., 1981) (Fig. 2.6, b and y" respectively) in the low mass range of the spectrum. This shows the presence of a Cterminal Lys in the molecule via an ion at m/z 147 which is extended via signals at m/z 303 (y2"), 416 (y3"), 544 (y4"), 673 (y5") and 802 (y6") (Figs. 2.3 and 2.4) to give the sequence ... EEQL/IRK. Note the relatively high intensity of the m/z 544 isotope peak at m/z 545 (Fig. 2.4) showing that the Q residue is partially deamidated. This is observed in all ions containing that residue and also accounts for the high intensity of the 1651.79 satellite to the quasimolecular ion signal in Fig. 2.3. The partial sequence determined from the C-terminal (y") ions is further complemented by N-terminal (b) ions at m/z 230, 377 and 478 corresponding to a (230)-F-T sequence. The sequence ion data thus lock the peptide portion of the molecule onto residues 139-151 in the sequence (NDFTPEEEEQIRK) except that the mass found in the Q-TOF MS/MS collision spectrum is 16 Da higher than that predicted for the peptide (1635 [M+H] ). This is












33
















100 230.10
b2









b3
377.17





% 255.12 36.1
386.18


618.94
273.13
b4
Y 47820
y2z
30324 587.33 YS 711.33

Y"4 802.47
378.15 y"3 544.38 63781 88.86 712,33 739,88
309.13 360.16 416.31 5323.4 2 3 8
50119 5.32 588.27 ,682 359.16 433.18 461.20 .19
.388.20 58.78 75832 7598811


225 25( 25 3 00 3 3 3~5 40 5 40 4 0 25 S6 55 600' 6 5 65 65 700 725 70 775 0





Figure 2.4 Parts of the MS/MS spectrum shown in Fig. 2.3 expanded to show lower

mass region containing peptide-derived fragment ions more clearly.













34













100 1173.57
y"a
Peptide
I
HoxNAc, Hex, Fuc
[M+2Hj 2*
1081.98





1174.54 1082.41

1081.48
y"9
I
HexNAa 1376.61


1082.91
1377.66

y"10 1274.64 y11 y y"
II y"8 1175.63 1378.62 1421.81 HexNAc HexNAe, Hex

112 75.48 1422.74 7 2
1 9.8 1162.7412 .6

1423.77 1 1522 3.94



1050 10 1 1100 11 5 111 115 1200 15 1250 12 130 1 S 1350 135 14 14 1450 14 5 150 2 125 190








Figure 2.5 Parts of the MS/MS spectrum shown in Fig. 2.3 expanded to show

higher mass region containing peptide-derived fragment ions more clearly.









35




















bl b2 b3 b4 b5 b6 b7 b8 b9 blO bl1 b12
11505 230.08 377.15 478j.19 591.24 720.28 849.32 978.36 1107.41 1235.47 1348.55 1504.65


NDFT EEEEQIRK

1536.71 1421M 1274-1 1173.56 1060,52 931Q48 802. 67339 544.35 41629 30321 147.11 y"12 y"11 y"10 y"9 y"8 y"7 y"6 y"5 y"4 y"3 y"2 y"l







Figure 2.6 Predicted masses of N and C terminal sequence ions of the fucoglycopeptide.








36


interpreted as a post-translational hydroxylation of one of the amino acids present, and this could not be at the C-terminal Lys residue, already assigned in the fragmentation data.

Screening the higher mass fragments in the spectrum alows a clear assignment of where the 16 Da increment is attached via the signals at m/z 1060 and 1173 in Fig. 2.5. These show that the Pro C-terminal sequence ion, y9", is 16 Da higher than the theoretical value for the sequence (1057 Da), showing that it is a HyPro in this position. The signals at m/z 1274 and 1421 complete a series showing -F-T-P(OH)- in the sequence.

Importantly, Fig. 2.5 also allows assignment of the attachment site of the

carbohydrate to the peptide. The signal at m/z 1376 is a HexNAc residue away from the m/z 1173 ion showing that the carbohydrate is attached via a HexNAc residue to the HyPro and not, as may have been expected, to the Thr residue. A further signal at m/z 1477 extends this ion series to the yl0" sequence ion TP(OH)EEEEQIRK substituted with HexNAc on the HyPro. The signal at m/z 1538 corresponds to the y9" ion with a Hex-HexNAc substituent, and the sugar sequence data assigned from the doubly-charged ions at m/z 826, 927, 1008, 1081, 1163 and 1244 (Figs. 2.2 and 2.3) now overlaps the singly-charged MS/MS glycopeptide data giving confirmation of the sequence. MS/MS data on several of the cone-voltage induced doubly-charged glycopeptide fragment ions also corroborated the above interpretation.

A mild TFA hydrolysis experiment on a remaining small quantity of sample

showed the disappearance of the m/z 829 triply-charged signal together with the other doubly-charged ions, excepting m/z 1008 and a weak triply-charged signal at m/z 672,








37

suggesting, as do the MS/MS data, that the saccharide is a linear molecule with Fuc midchain.

Taking all the MS and MS-MS data into consideration the structure of the

fucoglycopeptide was assigned as NDFT(Hex---Hex- Fuc- Hex--->HexNAc)hydroxyPEEEEQIRK. Subsequent Edman degradation sequencing on a 20 pmol sample confirmed the entire sequence of 13 residues, except for a blank at cycle 5, expected to be Pro. MALDI-TOF-MS Analysis of the Fucoglycopeptide

The MALDI spectrum contained a major [M+H] signal at m/z 2487 (Fig. 2.7A) which was equivalent to the triply-charged ion at m/z 829.70 in the Q-TOF spectrum. In addition, a series of low abundance ions were observed at m/z 2326, 2164, 2017, 1855 and 1652 consistent with sequential loss of Hex, Hex, Fuc, Hex and HexNAc respectively. The low abundance ions appeared to be fragmentation products of the m/z 2487 ion resulting from similar frequency of scission of each of the glycosidic linkages (Dell, 1983) rather than incompletely glycosylated species, because less-glycosylated peptides eluted later from the RP-column (see below). The m/z 2487 ion was not seen in a similar analysis of RP-fractionated peptides (Fig. 2.8) of recombinant Skpl isolated from E. coli (data not shown), showing that it was specific to the protein expressed in Dictyostelium. Sugar Composition Analysis of Skpl-c-myc

To determine its monosaccharide composition, Skpl was isolated from the S100 fraction of a D. discoideum strain (HW120) genetically modified to overexpress, under the control of the inducible discoidin promoter, a form of the protein with a c-myc-epitope tag near its C-terminus. The sugars of purified Skpl-c-myc were examined by GC/MS









38



A. Hex- Hex- deoxyHex- Hex- HexNAc- OHPro
2487










1653 1855 2017 2164 2326

B. [Galhl,6- Hex- deoxyHex- Hex- HexNAc- OHPro 2325

2487


C. [Gala1,6-Galal ]- deoxyHex- Hex-HexNAc- OHPro 2163




D. [Galal,6- Galal,- Fucal,2J- Hex- HexNAc- OHPr o 2017




I I I II
1600 1800 2000 2200 2400
Mass (m/z)


Figure 2.7 MALDI-TOF-MS analysis of Skpl glycopeptides from normal strain Ax3. A. Mass spectra of the fraction 35 fucoglycopeptide from Fig. 2.1, isolated from the normal strain Ax3. In addition to the primary ion, a series of low abundance fragment ions corresponding to selective glycosidic scissions of the glycan chain are noted. B. Treatment of the fraction 35 fucoglycopeptide with Xmanihotis al-->3/6-galactosidase. C. Treatment of the fraction 35 fucoglycopeptide with green coffee bean a-galactosidase. D. Treatment of the fraction 35 fucoglycopeptide with green coffee bean a-galactosidase and X manihotis oal-->2-fucosidase. Structures suggested by the experimental result shown and other results are given in each panel in brackets.









39






%B
A. RPC 3.2 100

a
AU 80
1.0
0.8- 60
S0.6- -40
S0.4
-20
S0.2
~0.0
2.0 4.0 6.0 ml
AU B. RPC 2.1
1.5


S1.0 Skpl peptide 139-151 %B
50
-40
0.5- 30
0
.20

-10
0.0
1.0 5.0 10.0 ml







Figure 2.8 Fractionation of endo-Lys-C generated Skpl-His peptides. A. Purified recombinant Skpl (Skp 1-His) from E.coli was reduced-alkylated and furthered purified over the RP-HPLC. The first peak (a) was used for Endo-Lys-C digestion. B. Endo-LysC digested Skp 1-His were fractionated over the RP-HPLC. The fractions containing peptide peak with 215 nm absorbance were subjected for MALDI-TOF mass spectrometry. Skpl-peptide 139-151 with a predicted m/z 1636 was eluted at 5.5 min.








40


after methanolysis, re-N-acetylation, and formation of TMS-derivatives. To achieve the sensitivity required to analyze 1.5 nmol of Skpl-c-myc, splitless injection and selected ion monitoring was employed. Fuc (0.33 nmol), Gal (0.70 nmol), and GlcNAc (0.32 nmol) were the three most abundant sugars detected (Fig. 2.9), and their low levels indicated that overexpressed Skpl was under-glycosylated. Fuc and Gal were previously detected after 2M TFA hydrolysis (Kozarov et al., 1995), but GlcNAc was not. The stronger acid conditions of methanolysis were probably required to liberate GlcNAc from its linkage with hydroxyproline, and Xyl is not found in the fucoglycopeptide according to the MS results. Thus the GC/MS data showed that the deoxyHex residue identified by MS was L-Fuc as suggested by metabolic labeling, and showed that all thee Hex residues were Gal and that the HexNAc was GlcNAc. Exoglycosidase Digestion of Fucoglycopeptide

To assign linkages, the fucoglycopeptide was treated with exoglycosidases and analyzed by MALDI-TOF-MS. The mass of the glycopeptide was reduced by 2 Gal residues (to m/z 2163) after treatment with the non-specific green coffee bean a-Dgalactosidase (Fig. 2.7C), but was not altered by non-specific bovine kidney Pgalactosidase, sweet almond 3-glucosidase, or bovine kidney a-fucosidase. Furthermore, one Gal residue was susceptible to removal by X manihotis c l--+3/6-galactosidase (Fig.

2.7B) but not recombinant Glyko al-+3-galactosidase, showing that it was cal--6linked. Fuc was susceptible to removal (yielding m/z 2017) only after removal of the ca-









41















Standard jMan
Fuc Gal GIC GIcNAc



ji IIlaIy A AAL MaAO GaINAcJ

FSkpl -c- myc ~Ga j 1a(
Mac GIcNAc



Blank




22 i4 26 8 3'0 3A 34 3,6 30 40

El uti on ti me





Figure 2.9 GC-MIS analysis of Skpl-c-mye total sugars. Standard sample containing 2 nmol of the indicated sugars, 1.5 nmnol Skpl-c-myc with 2 nmnol of added mannitol (ManOH) as an internal standard, and blank sample were subjected to methanolysis, reN-acetylation, and TMS-derivitization, and analyzed in splitless mode on a Shimadzu QP-5000GC/MS workstation.








42


linked Gal residues, as shown by double enzyme digestion experiments employing the oagalactosidase and either non-specific bovine kidney c-fucosidase or X manihotis cal ---2L-fucosidase (Fig. 2.7D). Since Fuc does not contain a 6-linkage site, this means that Fuc was capped by a Galcal--6Gal disaccharide, and the disaccharide was ca-linked to L-Fuc. These results indicate that the outer sugars form a linear trisaccharide, Gall -- 6Galal--4Fucal-->2, in accord with the MS data.

A time course MALDI-TOF-MS analysis during mild acid hydrolysis of the fucoglycopeptide yielded a mass decrease of 2 Hex residues and one deoxyHex residue (m/z 2487 to m/z 2017) with no intermediates detected (Fig. 2.10), as also seen in the corresponding Q-TOF experiment (see above), confirming that the outer Gala-linked residues were attached to the acid-labile internal Fuc residue, whose more rapid release resulted in the simultaneous loss of all three sugars. MALDI-TOF-MS Analysis of Afucosylated-Glycopeptide

The core region of the glycan was examined in a mutant strain (HL250) which does not synthesize GDP-Fuc and does not fucosylate Skpl (Kozarov et al., 1995). It was predicted that this strain would produce the truncated sugar chain Gal-GlcNAc if alternative processing did not occur. HL250 Skpl purified from pool II of the S100 fraction resolved into 2 closely spaced peaks during RP-HPLC, each yielding similar results (Fig. 2.11A). Each peak was digested with endo-Lys-C and fractionated on a C2/C18-RP-HPLC column (Fig. 2.11B), and all peptide peaks were examined by MALDITOF-MS. Ions with m/z values corresponding to each of the predicted unmodified 139-











43








0.05 M TFA, 0 h











0.05 M TFA, 2 h
C




N IN ,N




S0.05 M TFA, 4 h





t I Wi

IN



1500 2000 2500 3000






Figure 2.10 A time course MALDI-TOF-MS analysis of Skpl fucoglycopeptide after mild acid hydrolysis. The fucoglycopeptide fraction 35 was treated with 0.05 M TFA at 950C. At indicated times, the aliquots were subjected to MALDI-TOF-MS.









44













AU A. RPC3.2 a b
AU %B
0.05 80
S0.04 60
006
0.03 -4
-40
S0.02
0.01 .
S0.00

AU 1.0 2.0 3.0 ml
1.0 B. RPC 2.1

0.8

S0.6 %B
8 50 12 14 s
0.4 1 40
L -30
4 0.2 --20
-- -1,10
0.0
1.0 5.0 10.0 ml





Figure 2.11 Fractionation of endo-Lys-C generated afucosylated Skpl peptides. A.
The immunoaffinity purified Skpl from afucosylation mutant strain HL250 was reducedalkylated and furthered purified over the RP-HPLC. Two eluted peaks (a and b) yield similar results after digestion with Endo-Lys-C. B. Peak b was digested with endo-Lys-C and fractionated on a C2/C18 RP-HPLC. The eluted fractions were subjected to MALDITOF MS. The Skpl peptide 139-151 was found in peaks 11, 12, and 14.








45

151 peptides with Mr values >600 were detected, including the unmodified peptide (m/z 1636) (Fig. 2.12C). In addition, the expected Gal-GlcNAc--peptide ion (m/z 2017) was abundant (Fig. 2.12A) in an earlier eluting RP-fraction. No ions which might represent other glycosylated derivatives of peptidel39-151 were detected. The accumulation of this disaccharide, which corresponded to the two core sugars of the wild-type pentasaccharide, confirmed that the addition of the two a-linked Gal residues depends on Fuc. When the disaccharide--peptide was treated with X manihotis 31--+3 galactosidase or other -galactosidases capable of cleaving this linkage, an ion corresponding to the loss of one Hex residue (m/z 1855) appeared in place of the parent ion (Fig. 2.12B). The agalactosidases had no effect. The linking GlcNAc residue was not released in double digestion by bovine kidney [3-galactosidase and jack bean 0-hexosaminidase. The Galp l--+3HexNAc disaccharide found on HL250 Skpl is assumed to be equivalent to the core disaccharide of the normal Skpl pentasaccharide, because the previously characterized Skpl-fucosyltransferase (West et al., 1996) which fucosylates HL250 Skpl in vitro depends on a Gal31- -3HexNAc acceptor.

Taking all of the evidence together, the sugar sequence was assigned as DGalpoal--+6-D-Galpo1 ---L-Fucpxl1 -2-D-Galp1 ---3-D-GlcNAc--HyProl43.

Configurations and the assignment of Gal and Fuc as pyranose forms were based on the exoglycosidase specificities. This structure was derived from about 50 pmol of purified fucoglycopeptide. Methods which require substantially larger amounts of sugars will be










46














A. Hex-HexNAc- OHPro
2017





B. [Gal01,3]- HexNAc- OHPro 1855





C. Pro
1636





I I I I I
1600 1800 2000 2200 2400
Mass (m/z)





Figure 2.12 MALDI-TOF-MS analysis of Skpl glycopeptides from afucosylation strain HL250. A. Mass spectra of RP-HPLC peak # 12 from Fig. 2.11 containing the glycopeptidel39-151 isolated from the afucosylation mutant strain HL250. A. No treatment. B. Treatment with Xmanihotis 31--+3galactosidase. The structure suggested by the experimental result is given in a bracket. C. A later eluting peak #14 containing the unmodified peptide.








47


necessary to determine the exact linkage of the second a-linked Gal residue and the configuration of the GlcNAc-HyPro linkage. Glycosylation Heterogeneity

Detection of the unmodified peptide in the fucosylation mutant suggested that

hydroxylation of Pro 143, the first step in the glycosylation pathway, is rate-limiting and possibly regulatory. Similarly, MALDI-TOF-MS analysis of RP-fractions from endoLys-C released peptides from pool I of Skpl from normal cells yielded ions corresponding only to the pentasaccharide--peptide (m/z 2487) and unmodified peptide 139-151 (m/z 1637). It remains to be determined whether Pro 143 hydroxylation occurs on products of both Skpl genes, as each are present in pool I and pool II, as shown previously by Edman degradation (West et al., 1997) and confirmed here by MS. To characterize the glycosylation pathway further, Skpl-c-myc was expressed at an elevated level in strain HW120. Endo-Lys-C generated peptides were fractionated by RPHPLC (Fig. 2.13) and analyzed by MALDI-TOF-MS, yielding abundant [M+H] ions of 2487, 2327, 2165, 1652 and 1636 in successive fractions (Fig. 2.14). These corresponded to multiple glycoforms, including the full-length pentasaccharide, the pentasaccharide minus one or two of the outer a-linked Gal residues, the hydroxylated but unglycosylated peptide, and the unmodified peptide. These findings were consistent with the monosaccharide composition results shown (Fig. 2.9): 1) Fuc and GlcNAc were present at equal levels, as expected since no mono- and disaccharide intermediates were detected. 2) The Gal:Fuc ratio was 2.1, indicating that there is on average one a-linked Gal (the










48







A. RPC 3.2 %B
AU 100
0.5


0.4 80

0
00 60
S0.3

40
0.2 40
-4
b
0.1 20


0 .0 ----------1.0 2.0 3.0 4.0 ml


B. RPC 2.1
AU
0.6 %B
.1415 17 19 50
0.4

30

0.2 20
10
0.0
1.0 5.0 10.0 ml





Figure 2.13 Fractionation of endo-Lys-C generated Skpl-c-mye peptides. A. The immunoaffinity purified Skp-1-c-myc from the overexpression strain HW120 was reduced-alkylated and furthered purified over the RP-HPLC. The first peak (a) was used for endo-Lys-C digestion. B. Endo-lys-C digested Skpl-c-myc peptides were fractionated over the RP-HPLC. The fractions containing peptide peaks with 215 nm absorbance were subjected for MALDI-TOF mass spectrometry. The Skp 1 peptide 139-151 was found in the peaks 14, 15, 17, and 19.








49





Pk.14
N




Pk.1 5 m un rO N, CO N N00


Pk.17





Pk.19 o


Ii



1000 1500 2000 2500 3000
Mass (m/z)



Figure 2.14 The mass spectra of endo-Lys-C generated Skpl-c-myc peptides. The MALDI-TOF mass spectra of Skpl-c-myc peptides show multiple glycoforms of the peptide 139-151 including completely glycosylated peptide (m/z 2487), -1 and -2 hexoses peptides (m/z 2325 and m/z 2163), unglycosylated-hydroxylated peptide (m/z 1653), and unmodified peptide (m/z 1636).








50


other being P3-linked), which correlated with the detection of glycopeptides containing 0, 1 or 2 outer Gal residues. 3) Only 22% of the protein was glycosylated, which correlated with the high levels of unmodified and hydroxylated forms of peptide 139-151 detected. The results indicated that, secondary to Pro hydroxylation, attachment of the reducing terminal GlcNAc and the outer a-linked Gal residues were the next most rate limiting, suggesting that the enzymes which add these sugars may potentially regulate the structure of the Prol43 glycan at other stages of the life cycle.

Discussion

The mass spectrometric analyses (Table 2.3) suggested that the Skpl glycan

consists of a linear pentasaccharide attached to a HyPro at positionl143. The attachment site was confirmed by Edman degradation. The exoglycosidase studies and sugar analyses confirmed the linear model and showed the sequence to be D-Galpal-->6-D-GalpcI->LFucpa 1 --42-D-Galpl1 --3-D-GlcNAc-+HyPro 143. Substantially greater amounts of the fucoglycopeptide will be necessary to determine the linkage position of the second xlinked Gal residue, and the configuration of the GlcNAc-->HyPro linkage. The core trisaccharide, Fucal--2GalP31-->3GlcNAc, is equivalent to blood group H (type 1) expressed by mammalian cells (Greenwell, 1997). Although internal Fuc linkages have been found in glycoproteins (Zhang et al., 1997; Harris et al., 1993), the outer Galcl--->6Galocl--Fuc cap structure has not been previously described. However, this sugar chain is not immunogenic in mice (Kozarov et al., 1995), unlike other Dictyostelium








51


Table 2.3 MALDI-TOF-MS m/z values for endo-Lys-C-derived glycopeptides

Sample Strain HPLC Measured Derived structure
peaka m/z
[3H]glycopeptide Ax3 fr.35 2487 Hex2deoxyHexHexHexNAcOPro
2325b HexdeoxyHexHexHexNAcOPro
2163b deoxyHexHexHexNAcOPro
2017b HexHexNAcOPro
1855b HexNAcOPro
1653b HOPro

Skpl-II peptides HL250 pk. 11, 2017 HexHexNAcOPro
1855 HexNAcOPro
pk.14 1636 Pro

Skpl-His peptides E.coli pk. 18 1636 Pro

Skpl-I peptides Ax3 pk. 23 2487 Hex2deoxyHexHexHexNAcOPro
pk. 25 1636 Pro

Skpl-c-myc HW120 pk. 14 2487 Hex2deoxyHexHexHexNAcOPro
peptides
pk. 15 2325 HexdeoxyHexHexHexNAcOPro
2163 deoxyHexHexHexNAcOPro
pk. 17 1652 HOPro
pk. 19 1636 Pro

a. Fraction or peak (based on A214 tracings) numbers are consistent only within a given
experiment.
b. The structure given is based on the mass of the parent ion as MH+ and the m/z values
of the daughter ion set.
c. These are decomposition ions in the MALDI-TOF-MS analysis.








52


sugar protein conjugates (West et al., 1986; Freeze, 1997), suggesting that a similar structure may be expressed in mammals. The linkage amino acid, hydroxyproline, is possibly 4-hydroxylated based on the specificity of a Skp 1 :UDP-GlcNAc GlcNActransferase activity which has been detected and partially purified (Chapter 3). 4hydroxylation is phylogenetically ubiquitous and 4-OH-Pro has been found to be derivatized with Ara or Gal in plants and algae (Fincher et al., 1972; Allen et al., 1978) but substitution by GlcNAc has not been described previously. The double-negative charge previously attributed to the sugar moiety after attempted P-elimination (GonzalezYanes et al., 1992) may have resulted from base-catalyzed scission of the adjacent E-E peptide bond, as sugar-HyPro linkages are known to be alkali-resistant (Fincher et al., 1972; Allen et al., 1978). GlcNAc was not previously detected in Skpl (Kozarov et al., 1995), probably because methanolysis is more effective than 2 M TFA in causing its release from HyPro.

The aforementioned structures homologous to the Skpl oligosaccharide are synthesized in either the rER or the Golgi apparatus, and then expressed on the cell surface or secreted. However, Skpl is not secreted, but rather is located and functions in the cytoplasm and nucleus (Kozarov et al., 1995; Bai et al., 1996; Yoho et al., 1997). These data imply that known enzymes directing the synthesis of the homologous structures would not be accessible to Skp 1, unless Skp 1 transiently visits the lumen of the secretory pathway.








53


Current evidence suggests that Skpl is partially modified in the cytosol by a novel biosynthetic pathway. The enzyme which adds Fuc is likely to be the previously characterized cytosolic fucosyltransferase (cFTase). The cFTase fucosylates Skpl in vitro with a submicromolar Km (West et al., 1996), and catalyzes formation of the same Fuc linkage on the same acceptor disaccharide (West et al., 1996; Trincher, and Bozzarro, 1996) as the present results show occur naturally in Skpl. The cFTase is likely to reside in the cytoplasmic compartment of the cell as it was purified from the cytosolic fraction and its submicromolar Km for GDP-pFuc is more characteristic of cytoplasmic compared to Golgi glycosyltransferases (West et al., 1996). Recent studies on Pro hydroxylase and GlcNAcTase activities which modify overexpressed Skpl -c-myc and synthetic peptides suggest that they also reside in the cytoplasmic compartment. These enzymes may constitute a hitherto unrecognized complex pathway of O-glycosylation localized in the cytoplasm, not the secretory pathway, which attaches sugars to Skpl incrementally rather than en bloc. Although glycosylation heterogeneity was not observed in Skp 1 from cells at the end of the growth phase, accumulation of incompeletely glycosylated chains in the overexpression strain raises the possibility of the expression of glycoforms at Pro143 at other stages of the life cycle.

Pro 143 is located within the highly conserved C-terminal domain of the Skpl

amino acid sequence (West et al., 1997). The C-terminal domain sequences are identical in the two Dictyostelium Skpl genes, and a Pro at the equivalent position of Prol43 is present in each of the numerous yeast, fungal, plant and plant viral genes cloned to date (Table 2.4). Of the nine Skpl genes suggested by DNA sequencing data to exist in










54


Table 2.4 Phylogenetic comparison of sequences surrounding Prol.43

121 131 141 151 161 Dictyostelium a.a.
NMIRGKTPEE IRKiFNIKND FTPEEEEQIP KENEWCEDKG gn D. discoideum
NMIKGKTPEE IRKTFNIKND FTeEEEaQVR KENQWCEEK H. sapiens
EMIRGRSPEE IRRTFNIvND FTOEEEaaIR RENEWaEDR S. cerevislae
NMIKGKSPEE IRKTFNIQND FTNEEEDQIR RENEWAEE S. nidulans
DMIKGKTPEE IRKTFNIKND FT PEEEEEVR RENQWafE P. vulgaris
DRIRGKTPEQ IRevFgIeND LTOEEEaaAl aEhsWthlvP iedy Chlorella Virus DMIKGKTPEE IRtTFNIKND FTTEEEEEVR RENQWafE A. thaliana
NMIKGKSPEE IRRTFNIKND FTIPEEEEQIR KENaAWCED C. elegant (a)
NMIKGKSPdE IRRaFNIKdD FTaEErEQIR KENaWCDD C. elegant (c)
iML GRT1NE VKlmLrvggv eSOsDREDsl eDvlelEvdv d ... C. elegant (b)
qnPReiiD gl vndEEEEQpv ypvkkCknht n ... C. elegant (d)
nsAKGKnaEE MRe1F g ipepwEQpst statWdD C. elegant (e)
ELIRGKStEE IRKIYgIRsD eeqmEEalan ggegtsamtf t ... C. elegant (f) NMAKGKTtaE LReiFaIntD eadaaEEtaa Raaaeva C. elaaans (a)

Note: upper case letters denote similar residues; lower case denotes non-conserved residues.








55


Caenorhabditis elegans, three are highly homologous to Dictyostelium Skpl in this region, and two of these have the equivalent of Prol43 (West et al. 1997). Thus this key Pro residue may be modified in other organisms as well. The known mouse, guinea pig and human cDNAs encode nearly identical proteins (Chen et al., 1995; Zhang et al., 1995; Demetrick et al., 1996; Liang et al., 1997) and lack this Pro residue, despite a high degree of similarity (>80%) with the Dictyostelium sequence in the C-terminal domain. Other mammalian Skpl loci (Chen et al., 1995; Demetrick et al., 1996; Liang et al., 1997) may contain the equivalent ofProl43, or Skpl may be modified on a second, nearby TPEE sequence motif like that containing Pro 143.

The structural evidence shown here adds Skpl to the short list of examples that complex glycosylation does in fact occur on cytoplasmic and nuclear proteins, as has often been postulated based on indirect evidence (Medina and Haltiwanger, 1998). It has been well-documented in the past decade that many cytoplasmic/nuclear proteins are monoglycosylated by GlcNAc on Ser or Thr residues. However, the only generally accepted examples of oligo-glycosylation are an incompletely defined, pan-eukaryotic Glc-1-PO4 modification of phosphoglucomutase (Marchase et al., 1993), also known as parafusin, and glycogenin, the primer for glycogen (Alonso et al., 1995). The novel GlcNAc---HyPro linkage in Skpl is distinct from the GlcNAc-Ser/Thr (Hart, 1997), Glc-->Tyr (Alonso et al., 1995), and possible Man--Ser/Thr (Marchase et al., 1993) linkages found in the other cytoplasmic/nuclear proteins, and has not been detected on proteins modified in the secretory pathway. Though other proteins in the cytoplasmic








56


fraction appear to be metabolically-labelled by [3H]Fuc, Skpl appears to be a major recipient of cFTase-mediated fucosylation both in vivo and in vitro (Gonzalez-Yanes et al., 1992; Kozarov et al., 1995). Further studies are required to determine whether the other fucoproteins in this fraction reside in the cytoplasmic/nuclear compartment prior to cell lysis. The availability of the newly designed Q-TOF-MS is expected to make it more practical to investigate the posttranslational modifications of other lower abundance intracellular proteins, which must be isolated from natural sources to analyze their posttranslational modifications.

Cytoplasmic glycosylation can have dramatic consequences, as highlighted by a Clostridial enzyme toxin which applies Glc or GlcNAc to a specific Thr residue of cytoplasmic rho and cdc42 proteins resulting in major effects on the actin cytoskeleton (Selzer et al., 1996). The function of the Skpl pentasaccharide modification is not likely to involve competition with phosphorylation as proposed for the simple GlcNAc monosaccharide modification of many cytoplasmic/nuclear proteins (Hart, 1997). Instead, it may serve as a ligand for a cytoplasmic/nuclear carbohydrate-binding protein (Jung et al., 1996; Kasai and Hirabayashi, 1996), or as a steric shield. The observation that the pentasaccharide modification appears to be completed on all pool I and pool II Skpl proteins whose Pro143 residues are hydroxylated supports the model that it is a ligand for a receptor, which must be structurally rich and constant. Skp 1 subpopulations differing with respect to the pentasaccharide--HyPro modification might vary in their ability to interact with specific F-box containing proteins, thereby potentially regulating








57

ubiquitination or phosphorylation of selected target proteins in response to, e.g., changes in the nutritional, differentiation, or cell cycle status of the cell. The new knowledge of glycan structure and attachment now renders the function of Skpl glycosylation susceptible to genetic investigation.













CHAPTER 3
CHARACTERIZATION OF SKP1-GLCNAC TRANSFERASE Introduction

Skpl is found in the cytoplasmic SCF protein complex which helps target cell cycle and other proteins for ubiquitination. In Dictyostelium, Skpl is variably modified by an unusual linear pentasaccharide; Galal-6Gala l-Fucaxl-2Galpl-3GcNAc, attached to a hydroxyproline (HyPro) residue at amino acid position 143 (Teng-umnuay et al., 1998).The pentasaccharide structure of Skpl indicates a novel glycosylation pathway (HyPro-glycosylation). This pathway is predicted to contain a novel set of enzymes, including, prolylhydroxylase, GlcNAc-transferase, fucosyltransferase, and three distinct galactosyltransferases. Only one of these enzymes, the fucosyltransferase (cFTase), has been purified from a cytosolic preparation of Dictyostelium and characterized (West et al., 1996). This cFTase has characteristics of a cytosolic enzyme, although all other known eukaryotic fucosyltransferases reside in the golgi compartment.

Disruption of one of the first two key enzymes, Skpl-prolylhydroxylase and

Skpl-GlcNAc-transferase, would completely eliminate the Skpl-glycosylation and allow us to study the importance and function of the glycan. To achieve the goal, an enzyme purification is required in order to get the cDNA sequences. In this study, a UDP-Nacetylglucosamine: Skpl-N-acetylglucosaminyltransferase (GlcNAc-transferase), the enzyme responsible for the attachment of the first sugar to the HyPro residue, has been purified from the cytosol of Dictyostelium strain HW120 over DEAE, phenyl, Reactive



58








59


Red, Superdex, dUMP, and UDP-GlcNAc columns. The activity behaved as a single component with an apparent Mr of -33,000. The glycosidic linkage was alkali-resistant and was recovered as GlcNH2 after acid hydrolysis, consistent with a linkage to HyPro.

Activity of the purified enzyme was dependent on DTT and MgC12. Its apparent Km for UDP-GlcNAc was 0.16 gM. The presence of this enzyme in the cytosolic fraction, its requirement for a reducing environment, and its exceedingly high affinity for its donor substrate UDP-GlcNAc, strongly suggest that the GlcNAc-transferase glycosylates Skpl in the cytoplasm. The Skpl-GlcNAc-transferase and the previously described Skpl-fucosyltransferase appear to belong to a glycosylation pathway which is novel with respect to the structure formed and its compartmentalization in the cytosol rather than in the secretory pathway of the cell.

The characteristics of the enzyme give us a better knowledge about the

mechanism of Skpl glycosylation and its compartmentalization. Once the cDNA sequences of the enzyme is known, we will be able to screen genomic and cDNA databases and explore whether a similar pathway exists in other species. Moreover, it will be possible to create a GlcNAc-transferase co-expression and a GlcNAc-transferase knock-out strain to verify that it is the real enzyme in vivo.

Materials and Methods

GlcNAc-Transferase Assay

Substrates. Skpl-c-myc was purified from strain HW120 through the mAb 3F9 affinity column step as described (chapter 2). The recombinant Skpl-His was purified through a nickel metal chelating column as described (chapter 2) and further purified on a








60

mAb 3F9 affinity column. The purified proteins were concentrated in an ultrafiltration concentrator (Centriplus-10, Amicon) to the final concentration of 11 gM for Skpl-cmyc and 9 RM for Skpl-His, aliquoted, and kept as stock solutions at -80oC. Two synthetic peptides, KIFNIKDFTPEEEEQIRKENEW and KIFNIKNDFT4-hydroxyProEEEQIRKENEW, which corresponded to the amino acid 133-155 of Skpl, were synthesized by the ICBR Protein Core, University of Florida. The dried peptides were reconstituted in 50 mM HEPES-NaOH, pH 7.4 at the concentration of 20 mg/ml and kept as stock solutions at -80'C. UDP-[3H]GlcNAc in which [3H] was attached to C6 of the glucosamine group was from Dupont NEN. It had a specific activity of 34.8 Ci/mmol.

GlcNAc-transferase activity. GlcNAc-transferase activity was assayed as the transfer of [3H]GlcNAc from UDP-[3H]GlcNAc to Skpl-c-myc or synthetic peptides. Typically, each assay contained 1 RM Skpl-c-myc, 50 mM HEPES-NaOH (pH 7.8), 5 mM MgCl2, 1 mM ATP, 5 mM DTT, 0.5 mg/ml BSA, and 0.657 RM UDP-[3H]GlcNAc in a total volume of 35 gl in 1.6 ml microtubes. After enzyme fractions were added, the reactions were incubated at 30'C for 1 h, and stopped by diluting with 35 pl of 2 X LSB containing 2 gg of soybean trypsin inhibitor (Sigma) and frozen at -200C. Trypsin inhibitor has an Mr of 20,100 and served as a marker for the position of Skp 1 -c-myc. After boiling for 3 min, each sample was resolved on a 7%-20% SDS-PAGE gel. The gel was stained with Coomassie Blue R-250 (0.25% in 45% methanol, 10% acetic acid) for 1 h, destained (5% methanol, 7.5% acetic acid) overnight, and rinsed in distilled H20 for 0.5 1 h. The gel slice from each lane was cut from the region containing Skpl-c-myc








61


(21 kDa) or synthetic peptides with two additional slices, 4 mm above and 4 mm below. The gel slices were extracted in 10% TS-2 (Research Products International, Mt. Prospect, IL), 0.6% PPO, 0.015% dimethyl POPOP in toluene (scintanalysis grade). After 72 h, [3H]incorporation was determined by scintillation counting (Beckman LS6500). [3Hlincorporation into Skpl-c-myc was found in the slices of 21 kDa and one slice above. The test of Skp 1-His as a substrate was performed in a similar way except gel slices were excised from the 24 kDa region.

The test of optimum pH for GlcNAc-transferase activity was performed by

changing the buffer with desalting PD 10 columns. Five PD 10 columns were equilibrated with 50 mM Tris-HCl with different pH, 6.0, 6.5, 7.0, 7.5, and 8.0 measured at 22C. S100 500 pl was loaded on each column and 1 ml fractions were collected at 4C. Fractions # 3, containing the highest activity, were tested. Protein Concentration Determination

Protein concentration was determined by a commercial modification of a Coomassie Blue dye binding method (Sedmak and Grossberg, 1977) according the manufacturer's protocol (Pierce, Rockford, IL). One ml of a diluted sample was mixed with 1 ml of the reagent. After 5 min, absorbance at 595 nm was measured and the protein concentration was calculated from a standard curve of bovine serum albumin. To determine the protein concentration of the desalted affinity purified GlcNAc-transferase fraction, 20 gl of sample was dried down, acid hydrolyzed, and subjected to amino acid composition analysis at the ICBR Protein Chemistry Core Laboratory using norleucine as an internal standard. Total protein was calculated based on the molar content of amino








62


acids.

Preparation of the 5-Hg-dUMP Resin

Synthesis of 5-Hg-dUMP. 5-Hg-dUMP was synthesized as described (Meikle et al., 1991, Zeng et al. 1996) with some modifications. Fifteen ml of 20 mM dUMP in 15 ml of 0.5 M NaOAc buffer, pH 7.0 (prepared by adjusting pH of 0.5 M NaOAC with 0.5 M acetic acid) was added dropwise to 15 ml of 100 mM Hg-acetate in 0.5 M NaOAc buffer, pH 7.0. The process was performed in a light protected container since Hg-acetate is very light sensitive. The mixture was incubated at 50'C for 5 h. After cooling down to room temperature, 148 mg (3.5 mmol) of LiC1 was added to convert the excess Hgz+ into HgC2. Ethyl acetate extraction was performed 6 times by mixing the reaction mixture with an equal vol of cold ethyl acetate in a phase-separation flask and the lower aqueous phase was collected. Five ml aliquots of the aqueous phase in Corex centrifuge tubes were each diluted with 20 ml of ice-cold absolute ethanol to precipitate 5-Hg-dUMP. The precipitate was allowed to develop at 4C overnight. The precipitate was collected by centrifugation in a SS34 rotor at 7,500 rpm for 20 min. After the ethanol was discarded, the pellet in each tube was washed with a mixture of ethyl acetate:ethanol (1:4). The pellets were collected by centrifugation, dissolved in 50 ml H20, and loaded onto a Chelex- 100 resin (bed vol 10 ml, Biorad) to remove residual Hg2+. The flowthrough, containing 5Hg-dUMP, was collected and used for the coupling reaction. The yield of dUMP mercuration was estimated from the shift of maximum absorbance from 260 nm to 267 in. Absorbances were compared to the molar extinction coefficients of UDP (Max A260 = 1.00 x 104) and 5-HgUDP (Max A267 1.08 x 104) at pH 7.5. All solutions in this








63


procedure were degassed and free of reducing reagents.

Coupling of 5-Hg-dUMP to Thiopropyl Sepharose 6B. Thiopropyl Sepharose 6B gel was prepared according to the manufacturer's protocol (Pharmacia Biotech) as follows. The dried material was swollen in 50 mM Tris-HC1, 0.1 M NaC1, pH 7.0, at room temperature overnight and washed on a Buchner funnel with a large amount of H20. The free thiol group was released by suspending gel in 1% (w/v) DTT in 0.3 M NaHCO3, 1 mM disodium EDTA, pH 8.4 for 1 h. The gel was washed with a large amount of 0.5 M NaC1, 0.1 M acetic acid, 1 mM disodiumEDTA followed by H20. The coupling reaction with 5-Hg-dUMP was performed by resuspending the gel in the Chelex-100 flowthrough with gentle mixing on a shaking platform for 2 h at room temperature. The unreacted thiol group was inactivated in 0.2 M cysteine in 10 mM TrisHC1, pH 7.4. The yield of the coupling reaction was determined from the decrease of absorbance at 267 nm.

Preparation of Aminoallyl-UDP-GlcNAc-Sepharose for Affinity Chromatography

Synthesis of aminoallyl-UDP-GlcNAc. 5-(3-Amino)allyl-UDP-GlcNAc was synthesized from 5-Hg-UDP-GlcNAc as described (Zeng et al., 1996) with some modifications. Synthesis of 5-Hg-UDP-GlcNAc was performed in a similar manner to the synthesis of 5-Hg-dUMP except the Chelex-100 resin step was omitted. The 5-Hg-UDPGlcNAc precipitate was dissolved in 0.5 M NaOAc buffer, pH 5.0 to the final concentration of 20 mM. Twenty ml of 5-Hg-UDP-GlcNAc solution was mixed with 2.4 ml of freshly prepared 2 M allylamine-acetate, pH 6.0. To make 2 M allylamine-acetate, pH 6.0, 0.75 ml of allylamine is dissolved in 4.25 ml of 17.4 N acetic acid on ice. The








64

condensation reaction of allylamine with nucleotide sugar was initiated by adding 1 nucleotide equivalent of K2PdCI4 (Sigma-Aldrich) in 1 ml H20. The reaction was maintained at room temperature on a shaking platform for 16 h.

The black metal deposit was removed by filtration though a 0.2 micron syringe

filter twice. The yield of the reaction was determined from the absorbance at 288 nm (7.1 X 103 M-1cm-'). The yellow filtrate was diluted with 9 vol of H20 and applied to a DEAE-Sepharose Fast Flow column (2.6 cm x 37 cm) pre-treated with 1 M NaHCO3 and equilibrated with 1 1 of H20. Then the column was washed with H20 until the A280 returned to baseline. 5-(3-amino)allyl-UDP-GcNAc was eluted with a gradient of 0 300 mM triethylammonium bicarbonate (TEAB), pH 7.7, prepared from 500 ml of H20 and 500 ml of 300 mM TEAB, pH 7.7. Ten ml fractions were collected. TEAB buffer was prepared by adjusting the pH of 300 mM TEA in H20 with CO2.

Coupling reaction of 5-(3-amino)allyl-UDP-GlcNAc to NHS-activated

Sepharose-4 Fast-Flow. The fractions containing 5-(3-amino)allyl-UDP-GlcNAc were pooled and dried under vacuum centrifugation. The dried material was dissolved in anhydrous dimethylformamide stored in molecular sieves (pore diameter 3 angstrom, Sigma) and the pH was adjusted to 7.5 with TEA. The pH of the solution was measured with pH paper (Sigma) and higher pH resulted in insolubilization. Two ml of NHSactivated Sepharose-4 Fast Flow gel was washed with 10 ml of dimethylformamide on a Buchner funnel and the gel was resuspended in the 5-(3-amino)allyl-UDP-GlcNAc solution. The coupling reaction was performed for 24 h with gentle mixing on a shaking platform at room temperature; however, the maximum of coupling reaction, determined








65

by the decrease of absorbance at 288 nm, occurred in 2 h. The unreacted NHS group was inactivated in 1 M aminoethanol in 50 mM Tris-HC1, pH 7.8 for 2 h. One ml gel was packed in a HR5/5 column (Pharmacia). The column was installed in a Smart system HPLC and was run extensively with degassed 50 mM Tris-HC1, pH 7.8, followed by 0.1 M boric acid, pH 8.0, and stored in 2 M NaC1, 0.005% thimerosol in 50 mM HEPESNaOH (pH 7.8).

GlcNAc-Transferase Purification

Cell lysis and DEAE-Sepharose Fast-Flow chromatography. Cell lysis was performed and the final S100 supernatant was pumped onto a DEAE-Sepharose Fast Flow column equilibrated in 50 mM HEPES-NaOH (pH 7.4), 1 mM DTT, 5 mM MgCl2, 0.1 mM disodiumEDTA, 10% glycerol as described (chapter 2). Skpl was retained in the column whereas GlcNAc-transferase activity was found primarily in the wash fractions.

Ammonium sulfate precipitation. (NH4)2SO4 (ultrapure, ICN) was added to the wash fractions from DEAE-Sepharose column to the final concentration of 25% saturation with stirring at 40C for 30 min. The sample was centrifuged in a GSA rotor at 10,000 rpm for 20 min. The GlcNAc-transferase activity in the supernatant was precipitated by increasing (NH4)2SO4 to 60% saturation. The pellet was collected by centrifugation in a GSA rotor at 10,000 rpm for 20 min and dissolved in 300 ml of 25% saturated (NH4)20SO4, 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgCl2, 0.1 mM disodium EDTA, 1 mM DTT, 15% (v/v) glycerol.

Phenyl-Sepharose Fast-Flow (low-sub) chromatography. The ammonium sulfate precipitated sample was applied to a phenyl-Sepharose Fast Flow (low-sub)








66

column (2.6 cm x 20 cm) pre-equilibrated with 25% saturated (NH4)2SO4, 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgC12, 0.1 mM disodium EDTA, 1 mM DTT, 15% (v/v) glycerol at 4C at the flow rate of 190 ml/h. The column was washed with the same buffer until the A280 dropped below 1% of its maximum. GlcNAc-transferase activity was eluted by a decreasing gradient of saturated (NH4)2SO4 from 25% to 0% prepared from 300 ml of the equilibration buffer and 300 ml of the same buffer without (NH4)2SO4. Fractions were stored at -80'C.

Reactive Red-120 chromatography. Reactive Red-120 Fast Flow (1.6 cm x 5 cm) was equilibrated with 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgC12, 0.1 mM disodium EDTA, 1 mM DTT, 15% (v/v) glycerol. The phenyl-Sepharose fractions containing GlcNAc-transferase activities were pooled and loaded onto the column at 40C and at the flow rate of 80 ml/h. The column was washed with the equilibration buffer until the A280 dropped to within 10% of baseline. The column was eluted by an application of a 0 1.5 M NaCl gradient prepared from 75 ml of the equilibration buffer and 75 ml of 1.5 M NaC1 in the same buffer. Six ml fractions were collected and stored at

-800C.

Superdex HPLC chromatography. A Superdex 200 (16/60) HPLC column (Pharmacia Biotech) was equilibrated with 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgCl2, 0.1 mM disodium EDTA, 15% (v/v) glycerol at 220C on an LKB GTi HPLC system. The Reactive Red fractions containing GlcNAc-transferase activity were pooled, concentrated in Centriplus-10 ultrafiltration cartridges to less than 2 ml, and loaded onto








67


the column via a 2 ml injection loop. The isocratic run of the same buffer was performed at the flow rate of 0.8 ml/min and 1.2 ml fractions were collected and stored at -800C. The Mr was calculated based on horse spleen apoferritin (443,000), yeast alcohol dehydrogenase (150,000), bovine serum albumin (66,000), and soybean trypsin inhibitor (20,100).

5-Hg-dUMP chromatography. The Superdex fractions containing GlcNActransferase activity were pooled and loaded onto 5-Hg-dUMP column (bed vol 1 ml). DTT was added into the flowthrough to the final concentration of 5 mM. The flowthrough was concentrated in a Centriplus-10 cartridge to less than 2 ml. After use, the column was cleaned with 5 mM dUMP and stored in 2 M NaC1, 0.005% thimerosol in 50 mM HEPES-NaOH (pH 7.8).

Aminoallyl-UDP-G1cNAc affinity chromatography. The aminoallyl-UDPGlcNAc HR5/5 column was connected to a short adaptor in a Smart HPLC system and was equilibrated with 0.1% Tween-80, 5 mM DTT, 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgCl2, 0.1 mM disodium EDTA, 15% (v/v) glycerol. The concentrated flowthrough from 5Hg-dUMP column was loaded onto the column via a 2 ml injection loop at 100 gl/min. After 60 min, the column was eluted by a gradient of 0 2 mM UMP in the equilibration buffer at 250 pl/min. In order to identify enzyme activity, an aliquot from the fractions containing UMP were desalted in ultrafiltration concentrators (Microcon-10, Amicon) as follows. One hundred 4l of eluted fractions was diluted with 400 pl of 5 mM DTT, 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgC12, 0.1 mM disodium EDTA, 15% (v/v) glycerol in a Microcon-10 device and centrifuged at 6095 g for 20 min. New buffer








68


was added and the filtrate was discarded. The process was repeated 3 times to reduce the UMP concentration to less than 20 gM. The fractions containing activities were pooled, concentrated in a Centricon-10 cartridge, and desalted on a Fast Desalting PC3.2/10 column (Smart system HPLC). An isocratic run of 50 mM HEPES-NaOH (pH 7.8), 5 mM MgCl2, 0.1 mM disodium EDTA, 5 mM DTT was performed at the flow rate of 100 pl/min. Fractions of 100 pl were collected. The GlcNAc-transferase activity came out in fractions 3-6 which were pooled and used for subsequent studies. High-pH Anion-Exchange Chromatography of the Acid Hydrolysis Derivatives of [3H]GIcNAc-Skpl

GlcNAc-transferase assays using the aminoallyl-UDP-GlcNAc-affinity-purified GlcNAc-transferase were performed as described. The gel slices containing [3H]GlcNAcSkpl were rinsed with filtered H20. Minced gel slices were hydrolyzed in 1 ml of 4 M TFA at 1000C for 4 h. The soluble part was dried by vacuum centrifugation and resuspended in 1 ml methanol with vortexing. This process was repeated twice. The radioactive products were reconstituted in 100 .l of 0.2 pm filtered water, mixed with 1 nmol of D-glucosamine (GlcNH2), and chromatographed on a Dionex PA-10 HPLC column equilibrated in 17 mM NaOH at 1 ml/min. The flowthrough fractions were counted for [3H]radioactivity directly using Scintiverse-HP scintillation cocktail. Reductive Alkaline Degradation of [3H]GIcNAc-Skpl

GlcNAc-transferase assays using the aminoallyl-UDP-GlcNAc-affinity-purified enzyme were performed as described. The gel slices containing [3H]GlcNAc-Skpl were rinsed with filtered H20. The 8-elimination of gel slices was performed with the addition








69

of an equal vol of IM NaBH4 in 0.2 M NaOH in 5 ml Reacti-vials. After incubation at 450C for 20 h, the supernatant was transferred into a polypropylene tube, neutralized with an equal vol of 1 M acetic acid in methanol, and dried under vacuum centrifugation. The radioactive residue was dissolved in 2 ml of H20, adjusted the pH to 9.5 with 2-amino-2methyl-1 propanol determined by spotting 5 Rl of the sample on pH paper, and loaded onto 1 ml Dowex-1 strong anion exchange resin pre-activated with 5 ml of 1 M HCI and equilibrated with 10 ml of H20. The flowthrough was collected and an aliquot was measured for [3H] using Scintiverse-HP scintillation cocktail.

Results

GlcNAc-Transferase Activity that Modified Skpl was Found in the S100 Fraction of Dictyostelium

The monosaccharide composition analysis (Fig. 2.8) of Skpl-c-myc isolated from overexpression strain HW120 detected only one-sixth of the expected amount of Fuc and GlcNAc (Teng-umninuay et al., 1998). This finding suggested that Skpl-c-myc was under-glycosylated which was supported by the MALDI-TOF-MS data of Skp 1-cmyc peptide l39-155. The endolysin-C digested Skpl-c-myc peptides were separated on a reverse phase HPLC (Fig. 2.12) and the eluted fractions were subjected to MALDI-TOF MS study. The mass spectra of peptidel39-155 showed series of m/z 2487, 2325, 2163, 1653, and 1636 indicating various stages of glycosylation (Fig. 2.13). One of these peptides had an m/z 1652 which corresponded to the hydroxylated-unglycosylated-Skplpeptide 139-151. This finding indicated that Skpl-c-myc should contain a hydroxylated form which could be a suitable substrate for a GlcNAc-transferase predicted to attach the first sugar on to the hydroxyproline residue. To test the hypothesis, an assay for the








70


GlcNAc-transferase was developed, based on a transfer of [3H] from UDP-[3H]GlcNAc to Skpl-c-myc. The reactions were resolved by SDS-PAGE, and [3H] incorporation into gel slices containing Skpl-c-myc was measured. GlcNAc-transferase activities were tested in crude S 100 from the normal strain Ax3 and from the overexpression strain HW120 (Fig. 3.1). In the absence of Skpl-c-myc, incorporation of [3H] into Ax3-S100 was found throughout the gel indicating that multiple proteins could take up [3H]GlcNAc. However, in the presence of Skpl-c-myc, increased incorporation was found in the 21-24 kDa region of the gel as expected for Skpl-c-myc. In contrast, in HW120-S100, incorporation of [3H]GlcNAc into the region of the gel containing Skp 1-c-myc was found with a relatively high level and was stimulated only slightly by added Skp 1 -c-myc suggesting that endogenous Skpl-c-myc had nearly saturated the enzyme in vitro. The hypothesis was supported by the finding that the addition ofa Skpl mAb 3F9 greatly inhibited incorporation (Fig. 3.3).

To gain further evidence that [3H]GlcNAc was incorporated into Skpl, a synthetic peptide corresponding to residues 133-155 of Skpl with 4-hydroxyproline at the equivalent residue 143 was added to the reactions in addition to Ax3-S100 or HW120S100 (Fig. 3.2). The SDS-PAGE analyses showed that the region of the gel containing the peptide incorporated substantial levels of [3H] in both strains. In HW120-S100, there was less [3H]incorporation in the Skpl region suggesting that the peptide and endogenous Skpl were competitive as acceptor substrates (compare Fig. 3.1 and 3.2).

To address whether the attachment of [3H]GlcNAc occured at the hydroxyproline, His-tagged recombinant Skp-1 from E. coli (Skp l-His), in which Pro 143 was not








71











AX3-S100 HW120-S100
116-205 kDa
97-116 kDa O without Skpl-c-myc
66-97 kDa 1 with Skpl -c-myc
45-66 kDa
36-45 kDa
29-36 kDa
24-29 kDa
21-24 kDa
14-21 kDa
7.14 kDa
0.3-7 kDa
<0.3 kDa
400 300 200o 100 0 0 100 2o00 300 400
Activity (pmol/gm/h) Activity (pmol/gm/h)






Figure 3.1 Transfer of [3H] from UDP-[3H]-GlcNAc into S100 fractions of normal
strain Ax3 and Skpl-overexpression strain HW120. S100 fractions from normal strain
Ax3 and overexpression strain HW120 were incubated with 0.6 gM UDP-[3H]-GlcNAc in areaction mixture containing 50 mm Tris-HCi (pH 7.4), 14 mM MgC12, 3 mM MnC12, 3 mM ATP, and 6 mM NaF in the absence or presence of 0.54 gM Skpl-c-myc. After 2
h incubation at 300C, the samples were diluted with LSB, boiled and resolved by SDSPAGE. After staining and destaining, proteins in gel slices were extracted and measured for [3H] incorporation. The incorporation into Skpl-containing gel slices with the Mr of 21-24 kDa was greater in strain HW120 than those of strain Ax3 due to the higher level
of endogenous Skpl substrate. In the presence of Skpl-c-myc, [3H] incorporation in
Skp 1-containing gel slices was increased in both strains.








72











116-205 kDa
97-116 kDa ] AX3
66-97 kDa l HW120
45-66 kDa 36-45 kDa 29-36 kDa 24-29 kDa 21-24 kDa
21 kDa
14-20 kDa 0.3-14 kDa
peptide band
< 0.2 KDa
0 100 200 300 400
Activity (pmol/gm/h)


Figure 3.2 Transfer of [3H] from UDP-[3H]GlcNAc into S100 fractions of normal strain Ax3 and overexpression strain HW120 in the presence of Skpl-peptide 133155. S100 fractions from normal strain Ax3 and overexpression strain HW120 were incubated with 0.6 gM UDP-[3H]GlcNAc in the presence or absence of 0.18 mM synthetic Skp 1l-peptide 133-155 and GlcNAc-transferase assays were performed as described in Fig. 3.1. Increased incorporation in peptide containing gel slices was apparent in both strains. In comparison to Fig. 3.1, [3H]incorporation into the peptide and endogenous Skpl-c-myc in HW120-S 100 were competitive with each other.








73









2000
Ol Peptide slice Skp-1l-slice 1500

E CL
1000



500


0
1 2 3
Synthetic peptide +
mAb 3F9 +




Figure 3.3 Inhibition of GlcNAc-transferase activities by synthetic peptide 133-155 and anti-Skpl-antibody. S100 fractions from overexpression strain HW120 were assayed for GlcNAc-transferase activity as described in Fig. 3.1 in the absence or presence of 2.5 gl ofmAb3F9 ascites which is specific to Skpl. The mAb3F9 inhibited incorporation in both endogenous Skpl 1-c-myc and synthetic peptide suggesting the specificity of both substrates.








74





1.0

E HW120-S100 L AX3-S100
0.8



E 0.6
0
E 0.
0.4
>-.


0.2



0.0
Skpl-c-myc Skpl-His No substrate



Figure 3.4 GcNAc-transferase activity is specific for Skpl-c-myc. S100 from normal strain Ax3 and overexpression strain HW120 were assayed for the GlcNAc-transferase activities in the absence or presence of 0.54 gM Skpl-c-myc or 0.54 RM recombinant Skpl from E.coli (Skpl-His) as described in Fig 3.1. Only Skpl-c-myc, which contains the unglycosylated-hydroxylated form of Skp 1, can stimulate the GlcNAc-tranferase activities in both Ax3-S 100 and HW120-S 100.








75


hydroxylated, was tested as a substrate. The result (Fig. 3.4) showed that Skp 1-His could not stimulate the enzyme activity suggesting that [3H]GlcNAc was attached to the hydroxyproline residue. These data were supported by the evidence that synthetic peptide 133-155 with Pro in place of HyPro could not stimulate enzyme activity (data not shown).

To address the compartmentalization of the enzyme activity, GlcNAc-transferase activities were tested in P100 fraction from Ax-3 strain and P100 treated with 0.25% Tween-80 (Fig. 3.5). The [3H]incorporation in P100 treated with Tween-80 was expectedly higher than that of P 100 due to the leakage of membrane bound proteins. The incorporation in both P100 fractions was higher than that of S100 (compare Fig 3.1 and 3.5) indicating more proteins residing in P 100 could uptake [3H]GlcNAc. However, in P 100 fractions, the incorporation in [3H]incorporation in the 21-24kDa region of the gel was not increased when Skp 1 -c-myc was added.

The dependence of enzyme activities on pH was tested after enzyme buffer was

replaced by gel filtration (Fig. 3.6). The highest activity was found at pH 7.5 8.0 and pH

7.8 was chosen as the assay pH in subsequent studies. Purification Step 1: Anion Exchange Chromatography on DEAE Fast-Flow

The S 100 preparation from overexpression strain HW1 20 was loaded onto DEAE Fast-Flow Sepharose at pH 7.4 and eluted with a gradient of 0 0.25 M NaCl. GlcNActransferase activity was found in the wash fractions (Fig. 3.7) suggesting that the enzyme was bound weakly to the column. The result was reproducible when the buffer was replaced with 50 mM Tris-HC1, lmM DTT, pH 7.5. Since the total activity in S100 could











76























P100 P 100/0.25%Tween- 80

a without Skpl-c-myc 116205kDa
with Skpl -c-myc 977.116kDa
66-97 kDa
46-66 kDa
36-45 kVa
2946 k~a
24-29 kDa
21-24 KD8
14-21 hDa
7-14 Da
03-7 kDa
<0.3 KDa
800 600 400 200 0 0 200 400 600 800
Activity (pmol/gm/h) Activity (pmol/gm/h)






Figure 3.5 Transfer of [3H] from UDP-[3H]-GIcNAc into P100 fractions of normal strain Ax3 in the presence of Skpl-c-myc. The P100 fraction from normal strain Ax3 was diluted 5 times with 0.25 M sucrose in 50 mM Tris-HCI (pH 7.4). An aliquot of diluted P100 was treated with 0.25% Tween-80 to measure potential latent activity. GlcNAc-transferase assays of P100 and P100/Tween-80 were performed as described in Fig. 3.1. Exogenous Skpl1-c-myc did not stimulate incorporation in P100 fractions.








77






2000




1500




E
CL 1000




500



N .D .... .
0
6 6.5 7 7.5 8

pH

Figure 3.6 The effects of pH on Skpl-GIcNAc-transferase activity. SlO fractions from HW120 were applied to PD10 columns pre-equilibrated with 50 mM Tris-HCl with different pH. GlcNAc-transferase activity in PD-10 fractions 3 which contained the highest activity was assayed. The data showed that low pH inhibited and high pH stimulated enzyme activity.








78




14000 12000 10000


8000
E

6000 4000 2000 .


0
o3 o3 o3C) o CO c
o C C C C3 C3 C


o
U.


Figure 3.7 GlcNAc-transferase activities in the flowthrough and wash fractions from DEAE-Sepharose. HW120-S 100 was pumped onto a DEAE-Sepharose column. Twenty gl aliquots of the flowthrough (total vol = 800 ml) and wash fractions (approximate total vol = 200 ml each) were assayed for GlcNAc-transferase activity. Majority of the enzyme activity was found in the wash fractions.








79

not be determined due to the presence of an unknown amount of the endogenous substrate, Skp 1 -c-myc, the activity in the wash fractions was taken as 100% (Table 3.1, line 1).

To optimize the assay conditions of the enzyme, the DEAE wash fraction was concentrated in an ultrafiltration cell, and tested for enzyme activity in the absence or presence of various concentration of NaCl, KC1, MnC12, and CaC12. NaCl inhibited activities more than KC1 (Fig. 3.8) and both MnC12 and CaC12 inhibited enzyme activity (Fig.3.9). It is notable that the assays contained 5 mM MgC12 and the enzyme activity was partially inhibited at MgC12 concentration higher than 10 mM (see below). Purification Step 2: Ammonium Sulfate Precipitation

The enzyme activity was purified further by ammonium sulfate fractionation.

Ammonium sulfate ((NH4)2SO4) was added to the DEAE wash to 25% saturation. The enzyme activity which remained soluble could be precipitated by increasing (NH4)2SO4 to 60% saturation. The pellet was collected and redissolved in 25% saturated (NH4)2SO4 in 50 mM HEPES-NaOH (pH 7.8), 5 mM MgC12, 0.1 mM disodiumEDTA, 1 mM DTT, 15% glycerol. Small aliquots of the enzyme fractions containing (NH4)2SO4 were desalted in Microcon- 10 devices and tested for GlcNAc-transferase activity. The recovery of enzyme activity in 25% saturated (NH4)2SO4 supernatant and 60% saturated (NH4)2SO4 pellet (Table 3.1, line 3 and 4) was only 81% and 50%, respectively. The activities might be lower than expected due to inhibition by remaining (NH4)2SO4 in the assays. Enzyme activity was completely recovered after (NH4)2SO4was removed by purification over a phenyl-Sepharose column (see below).









80


Table 3.1 Purification of GlcNAc-transferase activity. Purification of GlcNActransferase activity from the cytosol of Dictyostelium strain HW120. S 100 extract was prepared and applied on DEAE-Sepharose Fast Flow. The wash fractions were further purified over phenyl-Sepharose (low sub), Reactive Red-120, Superdex HPLC, dUMP, and UDP-GlcNAc columns.
Preparation Protein Total Yield Specific Purification
(mg) activity (%) activity (fold)
(pmol/h) (pmol/mg/h)
1. S100 4431 480.84a 100 0.108 1
2. DEAE-Sepharose 1744 480.84 100 0.276 2.54
3. 25% Saturated (NH4)2SO4 sup. 1603 388.18 80.73 0.242 2.23
4. 60% Saturated (NH4)2SO4 pel. 745.5 242.79 50.49 0.326 3
5. Phenyl-Sepharose 161.6 759.99 158.05 4.703 43.3
6. Reactive Red-120 agarose 16.02 77.32 16.08 4.826 44.5
7. Superdex-HPLC 3.09 70.95 14.76 22.91 221
8. dUMP-Sepharose 2.25 70.41 14.64 31.29 288
9. UDP-GlcNAc-Sepharose 0.035 66.75 13.88 1887 17393
a Minimum estimate derived from the next stage of purification.








81





100% KCI


-NaCI

80%



> 60%,i


S 40%




20%



0%
0 0.05 0.1 0.2 0.5 1

Concentration (M)



Figure 3.8 The effects of NaCl and KCI on GcNAc-transferase activity. The concentrated DEAE wash fractions were assayed for GlcNAc-transferase activity in the presence of different concentration of NaCl or KC1. Each reaction contained 5 mM MgC12, 3 mM ATP, 5 mM DTT, 0.5 mg/ml BSA, and 0.6 gM UDP-GlcNAc. NaCl inhibited the activity more than KC1.








82










100% EI CaCI2
MnCI 2

80%


& 60%
.>
0

40%
-0


20% L


0%
0 1 2.5 5 10
Concentration (mM)



Figure 3.9 The effects of CaC12 and MnCl2 on GlcNAc-transferase activity. The concentrated DEAE wash fraction was assayed for GlcNAc-transferase activity in the presence of different concentration of CaC12 and MnC12. Each reaction contained 5 mM MgC12, 3 mM ATP, 5 mM DTT, 0.5 mg/ml BSA, and 0.6 pM UDP-GlcNAc. Both CaC12 and MnC12 inhibit the activity.








83


Purification Step 3: Hydrophobic Interaction Chromatography on PhenylSepharose-(Low-Sub) Fast-Flow

The enzyme activity which had been dissolved in 25% saturated (NH4)2SO4 was loaded onto a phenyl-Sepharose-low-sub column. Enzyme activity bound to the column could be eluted by decreasing the concentration of (NH4)2SO4. The enzyme activities were found in late fractions as (NH4)2SO4 concentration diminished near to zero (Fig.

3.10). Based on the purification yield (Table 3.1, line 5), the activity was recovered completely. Further elution with 50% ethylene glycol did not yield any more activity. Purification Step 4: Reactive Dye Chromatography on Reactive Red-120 Fast Flow

The phenyl-Sepharose fractions containing GlcNAc-transferase activity were

applied to a Reactive Red- 120 fast flow column. Activity bound to the column and eluted in a gradient of 0-1.5 M NaC1 (Fig. 3.11). A KC1 gradient was not as effective since the enzyme activity was eluted broadly across the gradient (data not shown).

Only 16% of the activity was recovered from Reactive Red purification (Table

3.1, line 6). The small amount of the activity (2%) found in the flowthrough fraction could not explain the significant losts of activity (Fig. 3.12). To test for a potential subunit which might have been separated during the purification, the flowthrough fractions mixed with the eluted fraction were assayed for the activity (Fig. 3.12). The addition of the flowthrough fractions to the eluted fraction could not recover any more activity but instead inhibited it by 45% indicating that an essential cofactor did not seem to be separated from the enzyme unless it was eluted at a higher NaC1 concentration or still bound to the column. To test for the possibility that an essential cofactor existed at an









84












T







(NH4)2 SO4 saturation
25% 1200
1000

800
600

f e -400 2 00
0% 0
0 10 20 30 40 50 60 70 Fraction number




Figure 3.10 Purification of GlcNAc-transferase on phenyl-Sepharose low-sub column. GlcNAc-transferase activity in DEAE wash fraction was precipitated with 60% saturated (NH4)2SO4 and applied onto a phenyl-Sepharose low-sub column preequilibrated with 25% saturated (NH4)2SO4 in 50 mM HEPES-NaOH (pH 7.8), 5 mM MgC12, 0.1 mM EDTA, 1 mM DTT, 15% glycerol. The column was eluted by decreasing (NH4)2SO4 concentration down to zero. The eluted fractions were tested for GlcNActransferase activity.








85









14~









NaCl
500- 1.5 M
400300
200100
0 ISt0 M
0 5 10 15 20 25 Fraction number





Figure 3.11 Purification of GleNAc-transferase on a Reactive Red-120 column. The phenyl-Sepharose eluted fractions which contained GlcNAc-transferase activities were pooled and loaded onto a Reactive Red-120 column. The column was eluted by an application of NaCI gradient to 1.5 M. The eluted fractions were tested for GlcNActransferase activity.








86





500



400



300
E
"O

200



100


N.D.
0
1 2 3 4 5

Reactive Red fr. 9 + + +
Flowthrough fr. 1 + +
Flowthrough fr. 2 + +




Figure. 3.12 Reactive Red flowthrough fractions could not restore GlcNActransferase activity. Reactive-Red eluted fraction 9 which contained the highest activity was assayed in the absence or presence of flowthrough fraction 1 and 2. The flowthrough fraction did not increase the GlcNAc-transferase activity but instead inhibited it.




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E4KH6146T_ORBXM6 INGEST_TIME 2014-08-28T20:53:08Z PACKAGE AA00025055_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES