Fidelity of end joining in mammalian episomes and the impact of Metnase on joint processing

MISSING IMAGE

Material Information

Title:
Fidelity of end joining in mammalian episomes and the impact of Metnase on joint processing
Physical Description:
Mixed Material
Language:
English
Creator:
Rath, Abhijit
Hromas, Robert
Benedetti, Arrigo De
Publisher:
Bio Med Central (BMC Molecular Biology)
Publication Date:

Notes

Abstract:
Background: Double Stranded Breaks (DSBs) are the most serious form of DNA damage and are repaired via homologous recombination repair (HRR) or non-homologous end joining (NHEJ). NHEJ predominates in mammalian cells at most stages of the cell cycle, and it is viewed as ‘error-prone’, although this notion has not been sufficiently challenged due to shortcomings of many current systems. Multi-copy episomes provide a large pool of genetic material where repair can be studied, as repaired plasmids can be back-cloned into bacteria and characterized for sequence alterations. Here, we used EBV-based episomes carrying 3 resistance marker genes in repair studies where a single DSB is generated with virally-encoded HO endonuclease cleaving rapidly at high efficiency for a brief time post-infection. We employed PCR and Southern blot to follow the kinetics of repair and formation of processing intermediates, and replica plating to screen for plasmids with altered joints resulting in loss of chloramphenicol resistance. Further, we employed this system to study the role of Metnase. Metnase is only found in humans and primates and is a key component of the NHEJ pathway, but its function is not fully characterized in intact cells. Results: We found that repair of episomes by end-joining was highly accurate in 293 T cells that lack Metnase. Less than 10% of the rescued plasmids showed deletions. Instead, HEK293 cells (that do express Metnase) or 293 T transfected with Metnase revealed a large number of rescued plasmids with altered repaired joint, typically in the form of large deletions. Moreover, quantitative PCR and Southern blotting revealed less accurately repaired plasmids in Metnase expressing cells. Conclusions: Our careful re-examination of fidelity of NHEJ repair in mammalian cells carrying a 3′ cohesive overhang at the ends revealed that the repair is efficient and highly accurate, and predominant over HRR. However, the background of the cells is important in establishing accuracy; with human cells perhaps surprisingly much more prone to generate deletions at the repaired junctions, if/when Metnase is abundantly expressed. Keywords: Accuracy of DSB repair in mammalian cells, Episomal model of NHEJ, End- processing and re-ligation, Metnase nuclease, Joint accuracy
General Note:
Rath et al. BMC Molecular Biology 2014, 15:6 http://www.biomedcentral.com/1471-2199/15/6; Pages 1-15
General Note:
doi:10.1186/1471-2199-15-6 Cite this article as: Rath et al.: Fidelity of end joining in mammalian episomes and the impact of Metnase on joint processing. BMC Molecular Biology 2014 15:6.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
© 2014 Rath et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
System ID:
AA00024681:00001

Full Text

PAGE 1

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add5.txt [8/1/2014 10:47:57 AM] Please wait ... Muscle output >clone 41 NN--------------------------------NNNNNNNNGGNCATACGCCCGCGTTT CTTCCTTTTCCCCNCCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACG TCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCAT GGGGAATGGTTTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCA CGACTGGACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGTA CTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCCCCAAAAACC ACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATC ATCGCAGATCC---------------------------------GTAGTCAAACATGAGA ATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGT--------------------------------------------TAATGTCATGATAATAATGGTTTCTTAGA CGTCAGGT------------------GGCACTTTTCGGGGAAATGTGCGCGGAACCCCTA TTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTC-------ATGAGACAATAA CC-CTGATAAATGCTTCAATAATATTGAAA-------AAGGAAGAGTATGAGTATTCAAC ATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCAC---------CCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGA GTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGT-------TTTCG CCCC------------GAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATG TGGCGCGG-------------------------------TATTATCCCGTG-TTGACGCC GGGCAAGAGCAACTCGGTCGCCGCATACNCTATTCT--------CAGAATGACTTGGTTG ANTACTCACCAGTCACAGAAAANCANNNTAN--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 2

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add5.txt [8/1/2014 10:47:57 AM] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGATGGCATG---ACAGTANANAATNNNGCAGNG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 3

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add5.txt [8/1/2014 10:47:57 AM] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCCATNNNATGNNNNNNANNNNGGNGNNNNTTA CTTCTGANNNNATNGNANGANNNANNNNCTANCNNN--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------NN >parental partial sequence AGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTT CTTCCTTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACG TCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCAT GGGGAATGGTTTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCA CGACTGGACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGTA CTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCCCCAAAAACC ACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATC ATCGCAGATCCGGGCAACGTTGTTGCCATTGCTGCAGGCGCAGAACTGGTAGGTATGGAA GATCTATACATTGAATCAATATTGGCAATTAGCCATATTAGTCATTGGTTATATAGCATA AATCAATATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTA TATTGGCTCATGTCCAATATGACCGCCATAC-TCTCAGTACAATCTGCTCTGATGCCGCA T--------------------AGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGG TCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGA----CCGAC AATTGCATGAAGAATCTGCTTAGGGTT---AGGCGTTTTGCGCTGCT--------TCGCG ATGTACGGGCCAGATATACGCGT---ATCTGAGGGGACTAGGGTGTGTTTAGGCGAAAAG CGGGGCTTC--------GGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCG CTTTTGCATAGGGAGGGGGAAATGTAGTCTTATGC--AATACTCTTGTAGTCTTGCAACA TGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGAT TGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACAT GGATTGGACGAACCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCG ATACAATAAACGCCATTTGACCATTCACCACATTGGTGTGCACCTCCAAGCTGGGTACCA GCTGCTAGCAAGCTGCGGCCGCAGATCTTTTAGTTTCAGCTTTCCGCAACAGTATAGCTT GGCTAGCGGCCGCCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACC ACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCT CAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAG AAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCT CATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCAC CCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATAC CACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAA AACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCC TGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCC GTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATT CAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAA CAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCT TGGCCGGCAAGGCCGGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACA ACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTT GTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTT CAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGT ATGGCTGATTATGATCCGGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGAC ACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAG CCCGTCAGGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGAGGTCGACTCTAG AGGATCGATGCCCCGCCCCGGACGAACTAAACCTGACTACGACATCTCTGCCCCTTCTTC GCGGGGCAGTGCATGTAATCCCTTCAGTTGGTTGGTACAACTTGCCAACTGGGCCCTGTT

PAGE 4

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add5.txt [8/1/2014 10:47:57 AM] CCACATGTGACACGGGGGGGGACCAAACACAAAGGGGTTCTCTGACTGTAGTTGACATCC TTATAAATGGATGTGCACATTTGCCAACACTGAGTGGCTTTCATCCTGGAGCAGACTTTG CAGTCTGTGGACTGCAACACAACATTGCCTTTATGTGTAACTCTTGGCTGAAGCTCTTAC ACCAATGCTGGGGGACATGTACCTCCCAGGGGCCCAGGAAGACTACGGGAGGCTACACCA ACGTCAATCAGAGGGGCCTGTGTAGCTACCGATAAGCGGACCCTCAAGAGGGCATTAGCA ATAGTGTTTATAAGGCCCCCTTGTTAACCCTAAACGGGTAGCATATGCTTCCCGGGTAGT AGTATATACTATCCAGACTAACCCTAATTCAATAGCATATGTTACCCAACGGGAAGCATA TGCTATCGAATTAGGGTTAGTAAAAGGGTCCTAAGGAACAGCGATATCTCCCACCCCATG AGCTGTCACGGTTTTATTTACATGGGGTCAGGATTCCACGAGGGTAGTGAACCATTTTAG TCACAAGGGCAGTGGCTGAAGATCAAGGAGCGGGCAGTGAACTCTCCTGAATCTTCGCCT GCTTCTTCATTCTCCTTCGTTTAGCTAATAGAATAACTGCTGAGTTGTGAACAGTAAGGT GTATGTGAGGTGCTCGAAAACAAGGTTTCAGGTGACGCCCCCAGAATAAAATTTGGACGG GGGGTTCAGTGGTGGCATTGTGCTATGACACCAATATAACCCTCACAAACCCCTTGGGCA ATAAATACTAGTGTAGGAATGAAACATTCTGAATATCTTTAACAATAGAAATCCATGGGG TGGGGACAAGCCGTAAAGACTGGATGTCCATCTCACACGAATTTATGGCTATGGGCAACA CATAATCCTAGTGCAATATGATACTGGGGTTATTAAGATGTGTCCCAGGCAGGGACCAAG ACAGGTGAACCATGTTGTTACACTCTATTTGTAACAAGGGGAAAGAGAGTGGACGCCGAC AGCAGCGGACTCCACTGGTTGTCTCTAACACCCCCGAAAATTAAACGGGGCTCCACGCCA ATGGGGCCCATAAACAAAGACAAGTGGCCACTCTTTTTTTTGAAATTGTGGAGTGGGGGC ACGCGTCAGCCCCCACACGCCGCCCTGCGGTTTTGGACTGTAAAATAAGGGTGTAATAAC TTGGCTGATTGTAACCCCGCTAACCACTGCGGTCAAACCACTTGCCCACAAAACCACTAA TGGCACCCCGGGGAATACCTGCATAAGTAGGTGGGCGGGCCAAGATAGGGGCGCGATTGC TGCGATCTGGAGGACAAATTACACACACTTGCGCCTGAGCGCCAAGCACAGGGTTGTTGG TCCTCATATTCACGAGGTCGCTGAGAGCACGGTGGGCTAATGTTGCCATGGGTAGCATAT ACTACC-CAAATATCTGGATAGCATATGCTATCCTAATCTATATCTGGGTAGCATAGGCT ATCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGTATATGCT ATCCTAATTTATATCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATATGCT ATCCTAATCTATATCTGGGTAGTATATGCTATCCTAATCTGTATCCGGGTAGCATATGCT ATCCTAATAGAGATTAGGGTAGTATATGCTATCCTAATTTATATCTGGGTAGCATATACT ACCCAAATATCTGGATAGCATATGCTATCCTAATCTATATCTGGGTAGCATATGCTATCC TAATCTATATCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATATGCTATCC TAATCTATATCTGGGTAGTATATGCTATCCTAATTTATATCTGGGTAGCATAGGCTATCC TAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGTATATGCTATCC TAATCTGTATCCGGGTAGCATATGCTATCCTCATGCATATACAGTCAGCATATGATACCC AGTAGTAGAGTGGGAGTGCTATCCTTTGCATATGCCGCCACCTCCCAAGGGGGCGTGAAT TTTCGCTGCTTGTCCTTTTCCTGCTGGTTGCTCCCATTCTTAGGTGAATTTAAGGAGGCC AGGCTAAAGCCGTCGCATGTCTGATTGCTCACCAGGTAAATGTCGCTAATGTTTTCCAAC GCGAGAAGGTGTTGAGCGCGGAGCTGAGTGACGTGACAACATGGGTATGCCCAATTGCCC CATGTTGGGAGGACGAAAATGGTGACAAGACAGATGGCCAGAAATACACCAACAGCACGC ATGATGTCTACTGGGGATTTATTCTTTAGTGCGGGGGAATACACGGCTTTTAATACGATT GAGGGCGTCTCCTAACAAGTTACATCACTCCTGCCCTTCCTCACCCTCATCTCCATCACC TCCTTCATCTCCGTCATCTCCGTCATCACCCTCCGCGGCAGCCCCTTCCACCATAGGTGG AAACCAGGGAGGCAAATCTACTCCATCGTCAAAGCTGCACACAGTCACCCTGATATTGCA GGTAGGAGCGGGCTTTGTCATAACAAGGTCCTTAATCGCATCCTTCAAAACCTCAGCAAA TATATGAGTTTGTAAAAAGACCATGAAATAACAGACAATGGACTCCCTTAGCGGGCCAGG TTGTGGGCCGGGTCCAGGGGCCATTCCAAAGGGGAGACGACTCAATGGTGTAAGACGACA TTGTGGAATAGCAAGGGCAGTTCCTCGCCTTAGGTTGTAAAGGGAGGTCTTACTACCTCC ATATACGAACACACCGGCGACCCAAGTTCCTTCGTCGGTAGTCCTTTCTACGTGACTCCT AGCCAGGAGAGCTCTTAAACCTTCTGCAATGTTCTCAAATTTCGGGTTGGAACCTCCTTG ACCACGATGCTTTTCCAAACCACCCTCCTTTTTTGCGCCCTGCCTCCATCACCCTGACCC CGGGGTCCAGTGCTTGGGCCTTCTCCTGGGTCATCTGCGGGGCCCTGCTCTATCGCTCCC GGGGGCACGTCAGGCTCACCATCTGGGCCACCTTCTTGGTGGTATTCAAAATAATCGGCT TCCCCTACAGGGTGGAAAAATGGCCTTCTACCTGGAGGGGGCCTGCGCGGTGGAGACCCG GATGATGATGACTGACTACTGGGACTCCTGGGCCTCTTTTCTCCACGTCCACGACCTCTC

PAGE 5

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add5.txt [8/1/2014 10:47:57 AM] CCCCTGGCTCTTTCACGACTTCCCCCCCTGGCTCTTTCACGTCCTCTACCCCGGCGGCCT CCACTACCTCCTCGACCCCGGCCTCCACTACCTCCTCGACCCCGGCCTCCACTGCCTCCT CGACCCCGGCCTCCACCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTCCTGCTCCT GCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCC CCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCT GCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCT CCTGCCCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCT CCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCT CCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCT--------------------CCTCCTG CTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTC CTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTC CTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCC CTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTG CCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCT >clone 43 NN------------------------------NNNNNNNNNNNNNCATACGCCCGCGTTT CTTCCTTTTCCCCNCCCCACCCCCCAAGTTCGGGTGAAGGCNNNNNNNNNNCAGCCAACG TCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCAT GGGGAATGGTTTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCA CGACTGGACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGTA CTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCCCCAAAAACC ACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATC ATCGCAGATCC-----------------------------------------GTATGG-------------------------------------------------------------------------------------------------------------------------------------------------TGCAC-TCTCAGTACAATCTGCTCTGATGCCGCA T--------------------AGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGG TCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGA----CCGAC AATTGCATGAAGAATCTGCTTAGGGTT---AGGCGTTTTGCGCTGCT--------TCGCG ATGTACGGGCCAGATATACGCGT---ATCTGAGGGGACTAGGGTGTGTTTAGGCGAAAAG CGGGGCTTC--------GGTTGTACGCGGTTACACTCACCTCC--------------------------------------------CCTGTGC--ACCAGTTCC----------------------------------------------------TAACAGGCCATG------GAC TGGT-------------------------------------------ACTGGTCTG---T GGCCTGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 6

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add5.txt [8/1/2014 10:47:57 AM] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGTTGGGGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 7

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add5.txt [8/1/2014 10:47:57 AM] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCCCCTCCTGCTCCTGCCCCT CCTGCCCCTNNNNNNNCTCCTGCTCCTGCCCCT--------------------CCTCCTG CTCCTGCCCCTCCTGNCCCTNCTGCNCNTCCTCCNGCTCCTGNNCCTCCTG-CCCTCCTC CTGCTCCTGCNNCTTCNTCCNGNTCCNGCCCTCNNGCNCNTCNTGNCCNTNNNNNNGNNN NNGNACNNNNNNNNNNNNNNNNNGNTCNNGCNC-------------------------------------------------------------------------------------------------------------------------------------------NN >clone 39 NN-----------------------------NNNNNNNNNNNNNNNNNNCGCCCGCGTTT CTTCCTTTTCCCCNCCCCACCCCCCAAGTTCGGGTGAAGGCCCNNGGCTCGCAGCCAACG TCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCAT GGGGAATGGTTTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCA CGACTGGACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGTA CTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCCCCAAAAACC ACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATC ATCGCAGATCC-----------------------------------------GTATGG-------------------------------------------------------------------------------------------------------------------------------------------------TGCAC-TCTCAGTACAATCTGCTCTGATGCCGCA T--------------------AGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGG TCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGA----CCGAC AATTGCATGAAGAATCTGCTTAGGGTT---AGGCGTTTTGCGCTGCT--------TCGCG ATGTACGGGCCAGATATACGCGT---ATCTGAGGGGACTAGGGTGTGTTTAGGCGAAAAG CGGGGCTTC--------GGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCG CTTTTGCATAGGGAGGGGGAAATGTAGTCTTATGC--AATACTCTTGTAGTCTTGCAACA TGGTAACGATGANTTAGCAACATGCCTTACAAGGAGANAAAAAGCACCGTGCATGCCGAT TGGTGNAAGTAAGGTGGTACGATCGTGNCTTATTANGAANGCAACAGACGGGTCTGACAT GGNNTGGANNAACCACTGAANTCCGCATTGCANAGATATTGTATTTAAGTGNCTAGCTCG NNNNNATAANC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 8

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add5.txt [8/1/2014 10:47:57 AM] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------NTGNTNNCATGGGTAGNATAT ACTACCNNAANTANNNGGATANN----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 9

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add5.txt [8/1/2014 10:47:57 AM] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------NNNNCNA NTNCNANTCTANNNNNNNGGNNNNCNNAAGNNNNNNNNNN----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------NN RunMUSCLE--V1.0--09-Sep-2004 / JL, Lab. of Bioinformatics, WUR



PAGE 1

RESEARCHARTICLEOpenAccessFidelityofendjoininginmammalianepisomes andtheimpactofMetnaseonjointprocessingAbhijitRath1,RobertHromas2andArrigoDeBenedetti1*AbstractBackground: DoubleStrandedBreaks(DSBs)arethemostseriousformofDNAdamageandarerepairedvia homologousrecombinationrepair(HRR)ornon-homologousendjoining(NHEJ).NHEJpredominatesinmammalian cellsatmoststagesofthecellcycle,anditisviewedas ‘ error-prone ’ ,althoughthisnotionhasnotbeensufficiently challengedduetoshortcomingsofmanycurrentsystems.Multi-copyepisomesprovidealargepoolofgenetic materialwhererepaircanbestudied,asrepairedplasmidscanbeback-clonedintobacteriaandcharacterizedfor sequencealterations.Here,weusedEBV-basedepisomescarrying3resistancemarkergenesinrepairstudieswhere asingleDSBisgeneratedwithvirally-encodedHOendonucleasecleavingrapidlyathighefficiencyforabrieftime post-infection.WeemployedPCRandSouthernblottofollowthekineticsofrepairandformationofprocessing intermediates,andreplicaplatingtoscreenforplasmidswithalteredjointsresultinginlossofchloramphenicol resistance.Further,weemployedthissystemtostudytheroleofMetnase.Metnaseisonlyfoundinhumansand primatesandisakeycomponentoftheNHEJpathway,butitsfunctionisnotfullycharacterizedinintactcells. Results: Wefoundthatrepairofepisomesbyend-joiningwashighlyaccuratein293TcellsthatlackMetnase. Lessthan10%oftherescuedplasmidsshoweddeletions.Instead,HEK293cells(thatdoexpressMetnase)or293 TtransfectedwithMetnaserevealedalargenumberofrescuedplasmidswithalteredrepairedjoint,typicallyinthe formoflargedeletions.Moreover,quantitativePCRandSouthernblottingrevealedlessaccuratelyrepairedplasmids inMetnaseexpressingcells. Conclusions: Ourcarefulre-examinationoffidelityofNHEJrepairinmammaliancellscarryinga3 cohesive overhangattheendsrevealedthattherepairisefficientandhighlyaccurate,andpredominantoverHRR.However, thebackgroundofthecellsisimportantinestablishingaccuracy;withhumancellsperhapssurprisinglymuchmore pronetogeneratedeletionsattherepairedjunctions,if/whenMetnaseisabundantlyexpressed. Keywords: AccuracyofDSBrepairinmammaliancells,EpisomalmodelofNHEJ,End-processingandre-ligation, Metnasenuclease,JointaccuracyBackgroundDoubleStrandedBreaks(DSBs),aserioustypeof chromosomedamageareusuallycausedbyexogenous agentssuchasionizingradiation(IR),topoisomerase poisons,radiomimeticdrugslikebleomycinanddoxorubicin,orendogenousdamageswhichariseasaresult ofcellularmetabolism(freeradicalsandDNAreplicationerrorsorcollapseofstalledforks).Programmed DSBsarealsogeneratedduringprocessessuchasV(D)J recombinationofimmunoglobulingenesandduringallelicexchangesatmeiosisorzygoticfusion.Ifmisrepaired,DSBscanresultinchromosomaltranslocations, oncogenesis,andgenomicinstability[1-3].DSBrepair canbebroadlydividedintotwomajorpathways:homologousrecombination(HR)andnon-homologousend joining(NHEJ)[4].HRrequiresthepresenceofanintact homologoustemplate,oftenasisterchromatid,whichallowsaccuraterepairofDSBsviaareplicativeintermediateandisthepreferredmodeofrepairinSandG2 phaseofcell-cycle[5].Incontrast,NHEJoperateswithouttheneedforatemplateDNA;sometimesjoiningthe endswithminimalprocessing,henceconsideredpotentiallyerroneous/mutagenic.NHEJisthepredominant *Correspondence: adeben@lsuhsc.edu1DepartmentofBiochemistryandMolecularBiology,LouisianaState UniversityHealthSciencesCenter,1501KingsHighway,Shreveport,LA 71130,USA Fulllistofauthorinformationisavailableattheendofthearticle 2014Rathetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycredited.TheCreativeCommonsPublicDomain Dedicationwaiver(http://creativecommons.org/publicdomain/zero/1.0/)appliestothedatamadeavailableinthisarticle, unlessotherwisestated.Rath etal.BMCMolecularBiology 2014, 15 :6 http://www.biomedcentral.com/1471-2199/15/6

PAGE 2

formofrepairinmammaliansystemandhadbeen showntooperateallthroughoutthecellcycle[6]. CurrentlyusedDSBrepairassayshaveseveralshortcomings.Researchersemployseveralmethodssuchas Ionizingradiation(IR),radiomimeticdrugs,laser,and site-specificendonucleasesforinductionofDNAdamage[7].Ofnote, -irradiationanddruginduceddamage fociarerandomlydispersedandnon-homogenousinnature.LaserscreatelocalizedbutexceedinglystrongDNA damage.Inaddition,differentwavelengthsofthelaser largelydeterminethedamagedendstructuressubsequentlyresultinginwidelydifferentkineticsofrepair withdifferentialproteinrequirement(forareviewsee [7,8]).DSBsintroducedwithanucleaseareadequatefor studiesofthemolecular/cellularmechanisms,butestimatesofrepairaccuracyareproblematicsincetheseenzymesturnoverslowlyandthusselectingforerroneous processingoftheendsthateliminatethetargetsequence.Thisiswell-knownfortheEndonucleaseI-SceI inducedDSBs[9],amodelthatalsosuffersfromthe needofpre-integrationofthetargetsequence,andoften lowcuttingefficiency(eitherduetolowtransfectionof thecellpopulationorbecauseofthechromosomallocationofitstargetsequence).TheEndonucleaseI-Ppol alsosuffersfromlowcleavageefficiencybecauseofits uniquetargetlocationinthehighlycondensedandrepetitiveribosomalDNAgeneclusters.Furthermore, studyofrepairatdefinedgenomicDSBsisproblematic duetothedifficultyinre-obtaining ‘ cleanclonal ’ isolates foranalysisinsufficientrepresentation.Likewise,useof yeastasamodelsystemtoparlaymammalianNHEJis notentirelyacceptable.Yeastlike Saccharomycescerevisiae or Saccharomycespombe lackmanywellestablished componentsofmammalianNHEJ,likeDNA-PKcsand Artemis.Todate,orthologsfornewlydiscoveredNHEJ componentsofhumanAPLF,PNK,Metnase,andAPTX havenotbeenidentifiedinyeast[10].Furthermore,HR isthepreferredrepairpathwayinyeast,whereasNHEJ isthepredominantpathwayinmammaliancells[11]. Inyeast,IR-inducedandendonuclease-inducedDSBs aredifferentiallyprocessedinacellcycle-dependent manner[12]. Hence,wesetouttodeveloponemodelsystemtoefficientlyrepresentrepairactivitiesinmammaliancellsin aphysiologicalsetting,withepisomes.Repairofmulticopyplasmidsprovidesalargepoolofmostlyuniform geneticmaterialwheretherepairprocesscanbestudied [13-15].WeutilizedtheyeastHOendonuclease(akey componentofthemechanismformating-typeswitchin yeast)foruseinmammaliancells.Inthissystem,the HOendonucleaseisexpressedbyarecombinantadenovirusresultingincleavageofitstargetsite(onepisomes) withhighefficiency(dependingontheMOI),andrepair occursviasimpleend-joiningduringatimecourseof infection.Wepreviouslyutilizedamousemammarycell linecontainingasingleintegratedHOtargetsiteatadefinedgenomiclocation[16].Whereas,thishasgenerated powerfulandusefulinformation,forexampleinterms oftheeffectsofchromatinongenerationoftheDSB andinrepair[16,17],forotherpurposesthesystemis limiting.Forinstance,damageinducedbyIRorgenotoxinsresultsinmultiplesimultaneousDSBsinstead ofasinglebreak,whichimmediatelyraisesquestions intermsofsimilarityofactivationanddeactivationof theDNAdamageresponse(DDR).Itisofsignificant interesttothefieldofmammalianDSBrepairtodevelopamodelsystem,wherethereissynchronousinductionofmultiple ‘ homogeneous ’ site-specificDSBs inapopulation,andthenbeabletostopthenuclease activityrapidly[18]. Differentassays,suchastreatmentofpre-cleavedplasmidswithcellularextractsortransfectionoflinearized DNAtemplatesintomammaliancellshavebeenemployed tostudyseveraldifferentaspectsofend-joining(efficiency ofjoiningofdifferentDNAends,fidelityofrepair [13,19-21]).However,technicallimitationspreventaclear picturefromemergingregardingtheend-joiningefficiency/fidelityandnatureofsequencerearrangements. Forinstance, Smithetal. ,usingatransfectionassayreportedasimilarefficiencyofend-joiningfordifferent DNAends.However, Poplawskietal. ,usingcellularextractshavereportedwidelyvaryingdegreeofefficiencyof end-joiningwithdifferentendstructures[13,22].Infact,a recentreportpresentedevidenceforstrikinglydifferent repairefficiencyusingeitherlipid-basedtransfectionvs. nucleofection[23].Thishighlightstheimportanceofconductingend-joiningassaysina ‘ nearlyunperturbed ’ cellularenvironment.WherelookedatrepairfidelityofaDSB atanintegratedchromosomallocus[24]moststudies werelimitedintermsoflowcleavageefficiency,absence ofmultipledefinedsite-specificDSBsites,andalsothe persistentactivityofthenucleaseemployed.Wethus wantedtoinvestigatetherepairfidelityinanepisomal population.ItiswellestablishedthatEBV-basedepisomes becomechromatinizedandbehaveasminichromosomes [15,25].HighdensityMNasemapsforEBV-basedepisomeshavebeengeneratedthathaverevealedhighlypositionednucleosomesandputativeoriginsofreplication [26].Hence,repairstudiesofminichromosomescan alsobringintofocusthecontributionofchromatin, closelyresemblinggenomicdamage.Finally,wewanted tocharacterizetheeffectofarecentlyidentifiedimportantcomponentofhumanNHEJ,knownasMetnase,asanendonucleaseonepisomalrepairfidelityin intactcells.MetnasehasbeenshowntobeageneralfacilitatorofNHEJincreasingbothaccurateandinaccuraterepair[27].Mutationofitsnucleasedomainhas beenshowntopreventthisrole,atleastinasubsetofRath etal.BMCMolecularBiology 2014, 15 :6 Page2of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 3

end-joiningevents[28,29].Using invitro assays,Metnasehasbeenshowntohaveapreferenceforsingle strandedDNAoverhangofapartiallyduplexmolecule withaneffectmorepronouncedona3 overhang[29]. Evidencefromexperimentsdonewithplasmid-hostcell transfectionsystem,pointtoasignificantroleofMetnaseindeterminingrepairedjunctionfidelityforbreaks with3 overhangs.Also,inatransfectionassaycoupled withintegration,over-expressionofMetnasedidnotsignificantlyincreaseaccurateNHEJatthebreaksite[27]. Becketal. ,reportedaroleofMetnaseinpromotingendjoiningwithnon-compatibleends(both5 &3 )inacell freesystem[29].However,averyrecentstudyreported againstanyfunctionalroleofMetnaseinpromotingendjoiningofmodifiedDNAendsusingasimilarcellfreesystem[30].Thesecontradictoryfindingshinttowardsagap inknowledgeregardingtheroleofMetnaseasanendonucleaseprocessingdifferentends[31],andevengreater inintactcells.Wewantedtodeterminethecontribution ofMetnaseinalteringrepairfidelity(accuratevs.inaccuraterepair)inourmodelsystemandtocharacterizethe natureofnucleotiderearrangementstounderstandmore indepthNHEJfidelityinhumancells.MethodsPreparationofstablecelllinesmaintainingepisomal HO-CATplasmidThe34bpHOendonucleasetargetsequence(agatcttttagtttcagctttccgcaacagtata)wasclonedintotheHindIIIsite ofthepREP4/CATshuttlevectorjustbeforethechloramphenicolacetyltransferase( CAT)codingsequenceandthe plasmidwasrenamedasHO-CATplasmid.Further,HOCATplasmidwastransfectedinto293TcellswhichmaintaintheplasmidepisomalduetopresenceofEBNA-1, underhygromycinselection(HygromycinB/Calbiochem, Cat#400052).Thecelllinewasnamed293T-HO-CAT. SimilarlyHEK293cellsweretransfectedandselectedto producethe3-HO-CATcellline.Metnaseexpressing pCAPP-Metnase-V5plasmidwhichwaspreparedinRobert Hromas ’ labwastransfectedinto293Tcellsandpuromycin(PuromycinDihydroch loride/MPbiomedicals,Cat# 100552)selectedtoproducetheMetnaseoverexpressing 293Tstablecellline.Subsequently,HO-CATplasmidwas transfectedintothesecellstoproducetheMet-T-HO-CAT celllineandmaintainedunderdualselectionofhygromycinandpuromycin.GenePORTER(Genlantis,Cat# T201007)wasusedasthetransfectionreagentforallthe abovementionedtransfections.Allthethreecelllineswere culturedusingDMEMwith 10%FCSasgrowthmediumat 5%CO2and37C.AssayforDNAcleavageandrepairInatypicalassay,foreachdifferenttimepoint,150,000 cellswereinfectedwiththerecombinantadenovirus encodingHOendonuclease(GiftfromDr.HamishYoung, ColumbiaUniversity,NY,USA)at10 … 30MOI,referredto aspPF446::HOinaplasmidmapin[32].DNAfromcells wascollectedusingeitherWizardSVgenomicDNApurificationsystem(Promega,Cat#A2360)orWizardplusSV miniprepDNApurification( Promega,Cat#A1460)protocol.EquivalentamountofDNAwasusedinPCRand qPCRreactionsforCATandAMPregionsusingGoTaq DNApolymerasekit(Promega)andDynAmoFlashSYBR GreenqPCRkit(ThermoScientific,Cat#F-415S)respectively.5 -CTACAACAAGGCAAGGCTTGACC-3 and5 TCTAGTTGTGGTTTGTCCAAACTCATC-3 wereused asforwardandreverseprimersrespectivelyforCATamplicon.5 -TTCCGTGTCGCCCTTATTCCC-3 and5 -GG CACCTATCTCAGCGATCTG-3 wereusedasforward andreverseprimersrespectivelyforAMPregioninPCR reactions.PCRconditions:30cyclesof94Cfor30s,55C for30s,and72Cfor39swithafinalextensionof10minutesat72C.TheCATsignalwasnormalizedtoAMPsignal.ForqPCR,5 -GTACCAGCTGCTAGCAAGCT-3 and5 -TCAACGGTGGTATATCCAGTGAT-3 wereused asforwardandreverseprimersrespectivelyfortheCAT region(ampliconsize133bp).5 -CATCGAACTGGAT CTCAACAGCG-3 and5 -GTCATGCCATCCGTAAGA TGCT-3 wereusedasforwardandreverseprimers respectivelyforAMPregion.ImmunoblottingProteinsamplesfromdifferenttimepointswerecollectedbyRIPAlysisbuffer(50mMTrispH8.0,0.1% SDS,1%Triton-X,1mMEDTA,150mMNaCl,and with1Xproteaseinhibitors … SIGMAFASTproteaseinhibitorcocktailtablets,Cat#S8820)andquantitated usingBCAproteinassaykit(Pierce,Cat#23223).Equal amountswererunona12%polyacrylamidegel,blotted ontoImmobilon-P(Millipore,Cat#IPVH08100),and subsequentlyprobedwithanti-E3-11.6Kantibody(fusionproteinwithHO).Theantibodywasakindgift fromDr.WilliamS.M.Wold,St.Louisschoolofmedicine, Missouri,USA.Theblotwasre-probedwithPhospho(S/T)Q-ATM/ATRsubstrateantibody(CellSignaling,Cat #2909S).Anti-Rabbit-HRPconjugatedantibody(Cellsignaling,cat#7074S)wasusedasthesecondaryantibody. StrippingwasdoneusingRe-Blotplusmild(Millipore, Cat#2502).TheblotwaseitherdevelopedusingPierce ECLreagent(ThermoScientific,Cat#32106)orOpti4CN(Bio-Rad,Cat#170 … 8235).NheIorNotIscreeningandbacterialtransformationPlasmidsrecoveredfromeachdifferenttimepointwere subjectedtoNheI(orNotI)digestion(Promega,Cat# R6501)whichhasitsrecognitionsequenceverycloseto HOinducedcleavagesite.Subsequently,theenzyme washeatinactivatedandtheminiprepDNAwasusedRath etal.BMCMolecularBiology 2014, 15 :6 Page3of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 4

totransformXL-1Bluesupercompetentcells(Agilent, Cat#200236)andplatedonanAmpicillinplate (100 g/mL).ReplicaplatingassayPlasmidDNAisolatedfromdifferentcelllinesatdifferenttimepointswasusedtotransformwasincubatedfor 16hat37Candsubsequentlyreplicaplatedonachloramphenicolplate(50 g/mL).Colonieswerecounted withBio-RadChemiDoc(Cat#170 … 8265)machine usingQuantity-Onesoftware.LuciferaseassayTheHO-LucplasmidwastransfectedusingGenePORTER(Genlantis,Cat#T201007)andconcomitantlyinfectedwithadeno-HOvirusineither293T-HO-CAT cellsor293Tcells.Ateachtimepoint,cellswere takenoftheplateandonealiquotofitwasusedtoextracttheDNAtobeusedforPCRtoassaycleavage andrepair.TherestofthecellswereassayedforluminescenceusingLuciferaseAssaysystem(Promega,Cat #E1501).GFPfluorescencewasusedtonormalizethe luminescencevalues.BothluminescenceandfluorescenceweremeasuredbySynergy4platereaderby BioTEKinstruments.SouthernBlottingforplasmidDNAOnefullyconfluentT75flaskwasusedforeachtime point.PlasmidswererecoveredusingZyppyplasmidKit (ZymoResearch,Cat#D4019).10ugofplasmidDNA fromeachtimepointwasdigestedwitheitherCsp45I andNotIorCsp45Ialone.Heatinactivatedsamples wererunin1%agarose-gel.BlottingontoImmobilonNy+(Millipore,Cat#INYC00010)wasachievedusing Trans-BlotSDsemi-drytransfercell(Biorad,Cat# 170 … 3957).EKONOhybridizationbuffer(Research ProductsInternational,Cat#248800)wasusedfor bothpre-hybridizationandhybridization.Hybridization probewassynthesizedbyrandomprimingusingrandomhexamers(Invitrogen,Cat#51709)usingwhole plasmidDNAastemplate.Finally,theblotwasexposed toX-rayfilmsanddevelopedusingstandarddeveloper.PreparationofcellextractsAbout1millioncellswereusedtopreparethewhole cellextractforeachmentionedtimepoint.Cellswere collectedofftheplateandwashedoncewithcold1X PBS.Subsequently,thecellsarewashedoncewithhypotonicbuffer(25mMTrispH7.9,1mMMgCl2,0.4mM CaCl2,and0.5mMDTT),spundown,andresuspended againin200 Lofhypotonicbufferandkeptinicefor 20minutes.ThecellswerehomogenizedinatightfittingDouncehomogenizer(30strokes)andthedebris wasspundownbyspinningat13000rpmfor10minutes at4C.Thesupernatantiscollectedandusedinthe DNAcleavagereaction.Invitro DNAcleavageassayThereactionwascarriedoutina10 Lreactionmixturewith250ngofpMat-Puroplasmid,6mMMgCl2, 50mMNaCl,5unitsofXmnIenzyme(Promega,Cat# R727A)(0.5 L),and2 Lcellextractforeachgiven time.Themixturewasincubatedat30Cfor1h. Then,thereactionswerestoppedbyadding5 Lof stopsolution(100mMEDTA,1%SDS,1mg/mLProteinaseK)and3 Lof6loadingdyeandincubated at55Cfor30min-1h.Then,themixturewasrunin a1%agarosegel.ResultsDevelopmentofanepisomalmodelsystemtostudyDSB repairWeinitiallyestablishedacellline(human293T)transfectedwithashuttlevectorwiththeHOtargetsite clonedintoit(293T-HO-CAT)(seemethodsfordetaileddescription).Thevectorismaintainedasastable copynumberepisomalunitinsidethemammaliancells becauseofthepresenceofEBNA-1proteinencodedby thevector(Figure1A)[33].Thisprovidesuswithmultiplecopiesofhomogenoustemplatewhichbecome chromatinizedandhavebeenshowntoaccuratelyreflect repairofgenomicDNA[14].Minichromosomesare physiologicallyrelevantbutsimplesubstratestostudy DNArepair.Beinghomogenousinnatureandalsothe abilitytoisolatethemfrombulkchromatinaresome otheradvantagesoftheepisomalsystem.Weareconductingstudiesbysucrosegradientsedimentationofisolated episomesthathaverevealedhighlyordered,chromatinized plasmidspecies(tobepublishedelsewhere). Inatypicalcleavageandrepairassay,asinglesitespecificDSBwasgeneratedintheepisomalpopulationby infectingthecellswithrecombinantadeno-virus(AdHO)encodedHOendonuclease[16,32]thatrecognizes a34basepair(bp)specificsequenceandproducesa DSBwitha4bp3 overhang.Repairwasfollowedina timecourseafterisolatingthepopulationofplasmids andusingendpointPCRandq-PCRdetectinganampliconspanningthebreaksite(Figure1B,CATamplicon, Figure1C).UponinductionoftheDSB,thePCRproductislost,butthenrecoverswithtimeastherepair proceeds.TheAmpicillinregiononthevectorwasused asaninternalnormalizationcontrolforplasmidrecovery.ThecleavageefficiencyofHO-sitewasconsistently >90%asjudgedfrommultipleexperimentsat10 … 30 MOI.WehavepreviouslyshownrobustDDRactivation duetoHOinducedsite-specificcleavageacrossthe episomalpopulationthatmatchesthekineticsofrepair intermsofappearanceanddisappearanceofS1981Rath etal.BMCMolecularBiology 2014, 15 :6 Page4of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 5

phosphorylationofATM(Figure2in[34];reproduced withpermissioninAdditionalfile1:FigureS1).Such dataconfirmpreviousobservationsofDDRactivation withaslittleas10 … 20DSBsorevenwithasingleDSB [35-37].ToensurethattheepisomalrepairderivesasignificantcontributionfromtheDDR,wetreatedthecells withtheATMinhibitorKU55933.Thekineticsofrepair inthedrugtreatedcellswasslowerincomparisonto untreatedcontrol(Figure1D).Theseresultsshowthat inthissystemanactiveDDRpathwayiseliciteddueto presenceofmultipleDSBs.Ofinterest,someprevious studieshavesuggestedthenon-essentialroleofATM duringmuchofNHEJevents,basedlargelyonevidence frommutantcelllines,exceptforinstancesofcondensed heterochromaticsites[38].Inthisepisomalsystem, whilewehaveabundantdirectevidencethattheplasmidsarechromatinizedandsupercoiled,presenceof heterochromaticregionsarenotbelievedtobelikely. Since,forexample,histoneH1isfoundonlyinsmall amountsinassociationwithepisomes(andtheirnucleosomes)afterisolationonsucrosegradients[[25]and datanotshown].KineticsofHOexpressionandinactivationInFigure2weshowatypicalexperimentwiththekineticsofHOexpression.Ininitialstudies,wehaveobserved asecondcleavagecyclebetween24-36hPost-infection (PI)thatcouldbeexplainedbyreleaseofnewvirusand reactivationofthepromoterdrivingHOexpressionin 293Tcells.Forastudyofrepairfidelity,itisimportant tohavethecleavingendonucleasetransientlyactive. Thisreducesthebiastowardinaccuraterepairofthe jointintroducedinthesystembytherecurrentcutting andaccuraterestorationoftherecognitionsequence.In thiscontext, Kaplunetal. ,haveshownthatHOisatargetofMec1/ATRmediatedphosphorylationleadingto itssubsequentubiquitinationanddegradationinyeast [39];anobviousmechanismforhaploidyeasttoavoid Figure1 Typicalepisomalcleavageandrepairassay.(A) MapofthepRep4-HO-CATplasmidshowingkeyfeatures.HOrecognitioncassetteis clonedinjustbeforeCATgene.Arrowsindicatelocationoftheprimers. (B) Episomalcleavage-and-repairassayattheHOsiteDSBduringatime courseofAd-HOinfection.T-HO-CATcellswereinfectedwithadeno-HO(Ad-HO)virus,cellswerecollectedatdifferenttimepoints,andepisomes wererecovered.PCRwasperformedbyputtingprimersacrossthebreaksite(CATamplicon).AMP(Ampicillin)regionontheepisomeactsasthe positiveinternalcontrolandusedfornormalization.Inaddition,agenomicproductwasalsousedtoensureequaltotalDNArecoveryfromthe samples. (C) qPCRanalysisforkineticsofcleavageandrepairofepsiomesasexplainedin (B) .qPCRvaluesarerepresentedas(CAT/AMP)%over control. (D) Sameasin (C) butinpresenceoftheATMinhibitior-KU55933(10 M). Rath etal.BMCMolecularBiology 2014, 15 :6 Page5of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 6

repeatedmating-typeswitchinguntilthenextcelldivision. Wehavepreviouslyshownthatinanon-permissivecell system,HOexpressionshutsdownby3hofinfection, ensuring(mostly)asingleroundofcleavage/repairimplicatingtheexistenceofasimilarmechanisminmouse cells[40].Inthesecells(MM3MGmousecells-nonpermissivetohumanadenovirus)theHOprotein,is expressedsoonafterinfectionleadingtocleavageof itstargetsite.Butsubsequently,ATMactivation,and phosphorylationofHOresultsinitsproteolyticlosswith nonewnetsynthesis[16],thusexplainingabsenceofrecurrentcuttingoftherestoredtargetsiteandtheenzyme isthendegraded. However,inareplicationpermissivesystem(human 293Tcells)HOnucleasepersiststhroughouttheinfection (Figure2A)duetoacomplexpatternofactivationofearly andlatepromotersusage[41]drivingtheE3/11.6-HOfusion[42].Weshouldcautionthattheidentificationofthis Figure2 ExpressionandactivityofHO-fusionproteininpermissivecellsystem(293Tcells).(A) DepictsimmunoblotofHOfusionprotein uponinfectionwithadeno-HOvirusatdifferenttimepointsin293T-HO-CATcells.AmapofthevirusshowingtheHOfusionispresentedin [32],andgeneratesapresumedchimericproteinwiththe11.6kadenovirusgeneproduct.CellswerelysedusingRIPAlysisbufferandequal amountsofproteinswereloadedandrunina10%SDS-PAGEgelandsubsequentlyprobedwithanti-E3-11.6K(fusionproteinwithHO)antibody. Theblotinpanel (A) wasre-probedwithphospho-(S/T)Q-ATM/ATRsubstrateantibody,andtheregionoftheblotcorrespondingtotheposition ofHOinpanel(A)isshown.Alsoshown,thep(S/T)-Qbandingpatternin293TcellswhichlacktheepisomesafterAd-HOinfection,toserveas acontrol.?denotesundeterminedbandsobtainedafterprobingwithp(S/T)-Qantibody. (B) HOactivitywasmeasuredinan invitro cleavagereaction. Cellextractswerepreparedfrom293Tcells(lanes1 – 5)andcellscarryingpRep4-HO-CATepisomes(T-HO-CATcells)(lanes6 – 7)afterAd-HOinfection atgiventimepoints.TheplasmidpMat-Puro,harboringtheHOrecognitionsite[16],wasaddedexogenouslyat250ngperreaction.Theplasmidwas treatedwithcellextractsobtainedfromdifferenttimepointsfromboth293TcellsandT-HO-CATcells.HOactivitywasjudgedbypresence/absenceof acleavedproduct.Inreactionsshowninlanes1 – 7,wehaveaddedXmn1toproducethe~750bpbandandcorroboratethecleavageattheHOsite. Lane8showsthetreatmentofthepMat-Puroplasmidwithextractsobtainedfromuninfectedcells(Unc). “ M ” denotesthePromega1KbDNAladder asamolecularweightmarker. Rath etal.BMCMolecularBiology 2014, 15 :6 Page6of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 7

band,clearlyaviralproduct,astheE3/11.6-HOfusionremainsuncertain.UnfortunatelyapublishedHOantiserum isnotavailable,andthewaytodetecttheHOwasthrough itsfusionwiththe11.6kprotein[32,42],butpreviously presenceofthisproducthadbeencorrelatedwiththenucleaseactivity[16].Assumingwehavecorrectlyidentified theHOprotein,however,itwasunclearwhethertheHO enzymeremainedactiveaftercuttingitstarget(s)orifit becamenonethelessinactivatedviaitsATM/ATR-mediatedphosphorylation.MaintenanceofHOactivitywould elicitmultipleroundsofcleavageandrepairoftheepisomaltargets,andthefundamentalquestionwaswhether thepatternofrepair(recoveryoftheCATPCRproduct) wastheresultofasingleroundofcuttingandrepair,ora morecomplexpatternofcyclesofcleavageandreligation.Toanswerthis,firstwedeterminedthatHOindeedbecamephosphorylated(byATM/ATR)inthissystem,afterwere-probedtheHO-WBwithaphospho-Ser/ Thr(S/T)ATM/ATRsubstrateantibody(S/T-Qmotif isthewellcharacterizedtargetofATM/ATRsubstrates [43]andisalsopresentinHO).Figure2Ashowsrapid S/T-Qphosphorylationofthebandco-migratingwith HOthatparalleledthecleavageofplasmidandthekineticsofATMactivationinthissystem[34](Additional file1:FigureS1).Treatmentwith phosphataseabolished thesignal(notshown).Incontrast,infectionofplain 293Tcellsshowedanumberofphospho-S/T-Qimmunereactivebands,butnonethatcorrespondedtotheHO positionorthatcorrespondedtophospho-proteinsinducedafterdoxorubicintreatment(Additionalfile2: FigureS2).Inshort,apossiblescenarioisthatHObecomesS/T-Qphosphorylatedafter(maximal)cleavage ofthebulkofepisomes;andnolongerseemstocleave untilviralreplicationiscompleteandthenextcycleof infectionbegins(thecellsdonotlyseuntil~5-7dayslater). ToconfirmthatHOisindeedinhibitedfollowinga singleroundofcleavageandrepair,weperformedtwo typesofexperiments,onewithextractofHO-infected cellssupplementedwithareporterplasmidexogenously andoneinintactcells.WealreadyknewbyWBsthat theHOfusionproteinvarieslittlethroughoutthetime courseofinfection,butitsactivityseemstobelimitedto thefirsthour,afterwhichtheenzymeisphosphorylated byATM/ATRandappearstobeinhibited.WepostulatedthatthesourceofATM/ATRactivationistheHO inducedcleavageofHO-CATepisomesasshownpreviously(Figure2in[34];Additionalfile1:FigureS1). Hence,preparingthecellextractfromAd-HOinfected 293Tcellsnotcarryingtheepisomeswouldeffectively avoidATM/ATRactivation,thusmaintaininganactive HOendonuclease.Wethuspreparedcellextractfrom both293Tcellsandcellscarryingtheepisomes(T-HOCATcells)atdifferenttimepointspostinfectionwith Ad-HOvirus.AsshowninFigure2B,additionofpMatpuroplasmid(carryingaHOrecognitionsite,[16])to uninfectedcellextract(lane8)resultsinnoappreciable cleavage(after1hofincubation invitro ).However,incubationinAd-HOinfected293Tcellextractscollected atdifferenttimepointsresultsincompletelinearization oftheplasmidevenafterthefirsthourPI,andtheHO activityremainssoforthenext6h,asjudgedbytheappearanceofcleavedproduct(wealsoaddedXmn1to thesereactionstoenhancethedistinctionbetweenthe linearizedplasmidandthemobilityoftherelaxedcircularform).Incontrast,incellscarryingthepRep4-HOCATplasmid(labeledT-HO-CAT),theenzymeisactive onlyforthefirsthourPI,butnotafter4h(notepresence/absenceofthecleavedproduct)(Figure2B),indicatingthattheHOisinactivefollowingcleavageofthe endogenousepisomes.Treatmentofthis ‘ HOextract ’ with phosphatasegavesomereturnofcleavagebut withunclearresultsastherewasmoreplasmidsmear (notshown). Fortheexperiment invivo ,wetransfectedaLuciferase/GFPreporter[44]inAd-HO-infectedthe293THO-CATcells.IntheLuciferasereporter,theHOtarget siteseparatesthepromoterfromtheORF.TheLuciferaseexpressedisshort-lived,sothatonlysustainedsynthesisresultsinsufficientexpression.Newsynthesisof Luciferase,measuredasenzymeactivitylagsaboutan hourafterDSBrepair,whencomparedwithPCR,which alsoshowedasingleprominentrepairedbandofcorrect sizewithnoevidenceofdeletedproducts[44].Luciferasewasmeasuredat2hintervalsfor12h,andtheAdHOinfectedsampleswerecomparedtotheuninfected samplesforthesametimepoints(Figure3).Inaddition, DNAfromeachtimepointwasrecoveredtodetermine thekineticsofcleavageandrepairoftheHO-CATepisomes.Figure3,lowerpanel(CATamplicon)showsthat mostofthetargetsiteiscleavedby2hwiththerepair productbacktocontrollevelby6-8hpostinfection. Thereporterplasmidalsoshowedasimilarpatternof Lucactivity,anindicationofcleavage/repairandthen expressionkinetics.IftheHOwasstillactiveafter4hof infection,thenthiswouldresultinconcomitantcutting oftheLucreporter,andbereflectedasaninitialdelayin Luciferaseexpression(asevidentindifferenceofslopes betweenuninfectedandinfectedsamplesbetween0-6h) orsloweraccumulationkinetics(RLUsproduced)in comparisontotheuninfectedcontrol.Figure3shows thatthepatternofLuciferaseactivityintheinfected samplescloselyparallelsthepatternasintheuninfected samples.Takentogether,theseresultsstronglysuggest thateveninapermissivesystem,HOgetsinactivated by4htimepointafterinfection,limitingitscleavage activitytojustonceinanexperimentalwindowof 0-12h,oratleastalltheperiodinwhichATMremains active.Ofcourse,thesituationchangesoncetheviralRath etal.BMCMolecularBiology 2014, 15 :6 Page7of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 8

replicationiscompleteandonemusttakeintoaccount multipleroundsofinfectionintheeventofabsenceof celllysis.DespitetheappealofthismechanismofATM involvementinHOinactivation,weacknowledgethat ourresultsremaincorrelative.Adefinitiveproofcould beobtainedwiththegenerationofanewsysteminATcells,butthenagainthepossibilityexiststhatitisinsteadATRthatisinvolvedinphosphorylationand inactivationofHO.However,itremainsclearthatonly oneroundofcuttingisobtainedinthefirstfewhours ofAd-HOinfection.HighFidelityrepairofepisomesviaNHEJWewantedtostudytherepairfidelityofend-joiningin thisepisomalsystem.TheHOsiteispositionedjust beforethechloramphenicolresistancemarker(CAT) Figure3 Luciferaseexpressionin293T-HO-CATcellsatdifferenttimepoints. ThecellsweretransfectedwiththevectorconstructwithHO targetsiteclonedinjustbeforetheLuciferaseORF(shownontop).LuciferaseexpressionwasmeasuredinbothuninfectedandAd-HOinfected cellsandnormalizedtoGFPexpression.Bothinfectionandplasmidreportertransfectionwerecarriedoutconcomitantly.PCRshowsthecleavage andrepairkineticsacrossthetimepointsintheHO-CATepisomes. Rath etal.BMCMolecularBiology 2014, 15 :6 Page8of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 9

(35bpawayfromtheATGstartsite)intheplasmid.So, anyalterationintheformofdeletionsorinsertions wouldprofoundlyaffectexpressionofCATandresultin chloramphenicolsensitivity,detectedbyreplicaplating theLB-Ampicillinbacterialplateontochloramphenicol Plates.293T-HO-CATcellswereinfectedwithadenoHOvirustoinducethesite-specificDSB.Plasmidswere rescuedfromcellsateachtimepointandwereback transformedintosupercompetentbacteriaandplated onLB-Ampicillin.Somewhattooursurprise,almost allofthebacterialcoloniescouldreplica-plateonchloramphenicolandvirtuallyalltherescuedplasmidswere ‘ unmutated ’ .Boilprepswereanalyzedfromover200 randomlychosenclonesacrossdifferenttimepoints.As showninFigure4A,almostallofthemrevealedpresence ofrightsizedplasmids(10.9Kb). Smithetal., havepreviouslyreportedanaveragedeletionsizeof250bpfora3 ’ complementaryoverhanginaplasmidhost-celltransfectionassay[13].Toeasilyidentifycloneswithinadeletion rangeof250 … 500bp,weemployedSalIdigestionto screenrandomclonespickedfromtwodifferenttime points.SalIrestrictionsitesarepresentonbothsidesof thebreaksite(referplasmidmapinFigure1A)andupon digestionshouldgivea9Kbfragmentanda1.9Kbfragment.Wecouldnotdetectanyobviousdeletionsamong theserandomclones,noneaffectingSalIsite(s),andallof themyieldedcorrectsizedfragments(Figure4B).Wealso performedaPCRscreenacrossthebreakusingclosely spacedprimers(120bpamplicon)inordertodetect micro-deletionsorinsertions.Plasmidsobtainedfrom Figure4 HighfidelityrepairinT-HO-CATcells.(A) EpisomeswererecoveredfromcellsafterAd-HOinfectionat4hand6htimepoint, subsequentlyusedtotransformbacteria,andplatedonampicillinplates.Boilprepofrandomclonesfromthe4hand6hplateswasperformed toobtaintheepisomesandwererunon0.8%agarosegeltodepictdifferenceinsizeafterrepair(10.9Kbinsize). (B) SalIdigestionofplasmids obtainedfromrandomclonesof4,6,and8hplatesPIwasperformedtorevealdeletionintherangeof250 – 500bpinsize(Referplasmidmap anddescriptionintext). (C) PCRwasperformedacrosstheDSBsiteusingprimersgeneratingampliconsizeof120bpwithplasmidsfromrandom clonespickedupfrom4hand6htimepointplatesandsubsequentlyrunina2.5%agarosegeltorevealmicrodeletionsorinsertions. (D) Accurately repairedcloneswereremovedafterisolatingtheepisomesfromcellsat giventimepointsPIbyemployingNheIdigestion,thusenrichingfor inaccuratelyrepairedplasmids(truncatedones).Episomesrecovere dfromcellsatindicatedtimepointsweredigestedwithNheIovernight andsubsequentlytransformed.Plasmidsweresubsequentlyobtainedfromrandomclonesacrossdifferenttimepointsandwererunona 0.8%agarosegel. ‘ U ’ denotesuncutcontrolplasmid. ‘ C ’ denotesSalIcleavedcontrolplasmid. Rath etal.BMCMolecularBiology 2014, 15 :6 Page9of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 10

dozensofrandomlypickedcoloniesweresubjectedto PCRusingtheseprimers.However,wewereunabletodetectanysuchcloneswithsmalldeletions(Figure4C)(we previouslynotedthatresectionofa4bp5 -overhangwith S1nucleaseoritsfill-inwithKlenowwasvisiblyshifted ona2.5%agarosegel).Infact,mostinstancesofrearrangedclonescouldonlybeidentifiedafterdigestingthe rescuedplasmidswithNheIwhichhasitsrecognitionsequenceonbothsidesandveryclosetotheHOsite.AccuratelyrepairedplasmidswouldmaintaintheNheIsite andgetlinearizedupondigestionandthushardlytransformbacteria[ThebackgroundofcoloniesfromNheI-cut plasmidsnotprocessedforrepairinmammaliancellswas ~4logslessthanuncutplasmids;whileforplasmidswith 3 overhangs(asproducedbydigestingwith Pst IorHO) wasevenless].Forcedselectionofplasmids(deletedin mammaliancells)inthisfashion;revealedpresenceofextensivelytruncatedplasmidsfromdifferenttimepoints, upontransformationintobacteria(Figure4D). Tosummarize,deletions/insertionsintherecovered plasmidpopulationfromT-HO-CATcellsatdifferent timepointsduringthecourseofrepairwasaveryrare eventandcouldonlybedetectedinlessthan10%ofrescuedplasmids. Asameanstoquantitativelyandindependentlyestimateaccurate/inaccuraterepair,andalsotobesurethat cuttingandrepairwasindeedtakingplace,wealso employedtheLucreporterasinFigure3.SincetheHO siteisclonedimmediateupstreamoftheLuciferase ORF,anyalterationattherepairsitewouldresultinloss ofLuciferasenormalizedtoGFPfluorescenceatthe undamagedsite.Inatransienttransfectionassay, 293Tcellsweretransfectedwiththereporterplasmid withorwithoutconcomitantinfectionwithAd-HO virus.LuciferaseandGFPexpressionintheseassaysbecomesclearlydetectableby4hevenwithatransfectionefficiencyof20-30%(Figure5B).Maximal Luciferaseaccumulation(~106photons/sec-setas1) isachievedafter~16h(Figure5A).AninitialreductioninLuciferaselightunitsisindicativeofDSBinductionduetoturnoveroftheenzymeabout3h later,butsubsequentlyaccuraterepairrevealsfullrecoveryofluminescence(Figure5A).Theseresultsindicatedthatatleastinthissystem,NHEJmediated end-joiningisgenerallyhighlyaccurate.Metnasepromotesend-processinganderroneousrepairIncontextofDNArepairproteins,amajordifference between293TcellsandHEK293cellsisthatMetnase isnotexpressedin293TcellsbutisexpressedinHEK293cells[45].TodeterminetheeffectofMetnase expressiononepisomalrepairfidelity,weconducted anidenticalstudyusingHEK293cells.Stablecellline (3-HO-CAT)wasgeneratedmaintainingmultiplecopies ofpREP4/HO-CATplasmid.Wealsoover-expressed Metnaseinthe293T-HO-CATcelllinethatlacksendogenousMetnase(Figure6A).DSBrepairassaysinall the3celllineswerecarriedoutinparallelandreplica platingwascarriedouttofishoutcloneswithalteredrepairjunction.AsshowninFigure6Cand6D,HEK293 cells(expressMetnase)revealedapopulationofplasmids(30-35%)harboringdeletions.Similarly,overexpressionofMetnaseinMet-T-HO-CATcellline (293TcellslackMetnase)resultedinhighfrequencies ofdeletionsin40-45%oftotalplasmidpopulation(we analyzedtypicallyatleast10plates).Inaddition,there werefeweroverallcoloniesobtained,suggestingmore degradationinMetnaseexpressingcells.Theseresults suggestaprominentroleforMetnaseinendonuclease processingatleastincaseofDSBsthatleavea4bp 3 overhang.Further,usingqPCRwealsofoundthatthe yieldofplasmidswithrepairedjoint,generatingthe CATPCRproduct,waslowerincellsoverexpressing MetnaseacrossdifferenttimepointsPI(Figure6B). Further,toassessthefrequencyandnatureofrearrangements,weremovedtheaccuratelyrepaired clonesfromtherescuedplasmidpopulation(at4hPI) byNotIdigestion(refertoplasmidmapinFigure7C) fromboth293T-HO-CATcellsandMet-T-HO-CAT cells.Alargeincreaseinnumberofcoloniesthatdidnot replica-platewasobtainedwithepisomesrescuedfrom Met-T-HO-CATcelllineincomparisontoT-HO-CAT cells,independentlyconfirmingresultsobtainedinFigure6C.AsshowninFigure7A(upperpanel),presence ofMetnasegeneratedapopulationofplasmidswidely varyingintheirdeletions.Asignificantlysmallernumber ofcloneswererecoveredfromT-HO-CATcellsforthe correspondingtimepoint(Figure7A,lowerpaneland Figure4D)andalmostallofthemareextensivelydeleted.Figure7Bshowsdistributionofrandomclones obtainedfromthesetwodifferentcelllineswithdifferentextentofdeletions.Studyofearlyrepairevents andnucleolyticprocessing oftheepisomesafterHOinducedcleavageby SouthernblottingToprobethecleavageandrepairofepisomesatamolecularlevel,weresortedtosouthernblottingatdifferenttimepointspost-Ad-HOinfection.Suchamethodis expectedtoemphasizethemostprominentcleavage productsobtainedintheHO-infectedpopulation,to generateprototypicalepisomalprocessingpatterns.The controlplasmid(pREP4-HO-CATfromnon-infected cells)wasdigestedwithCsp45IandNotItoyieldbands ofsizecloseto9Kband2Kb(N.I.1stlane,Figure7D). Plasmidsrescuedatdifferenttimepointsfrominfected cellsweredigestedwithCsp45Ionly(referplasmidmap inFigure7C).AstheNotIsiteisadjacenttheHOsite,Rath etal.BMCMolecularBiology 2014, 15 :6 Page10of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 11

weshouldexpecttoobserveasimilarbandingpatternas forthecontrol(1stlane)uponactionbyHOendonuclease.Figure7Dshowsanexpectedcleavagepattern. Interestingly,wealsoobservedabandmigratingfaster thanthe9Kbproduct(see4htimepoint,arrowhead) andasmallerspeciesofapproximately1.5kbthatcould representfurthernucleolyticprocessingofDNAfragmentsfollowingtheinitialHOcleavage. InthepresenceofelevatedMetnaseexpression(MetT-HO-CATcells),quantitativelytherecoveryofintact episomesafterthegiventimewindowforrepair(indicatedas11Kbbandproduct)waslessincomparisonto episomesrecoveredfromcellswithoutMetnase(comparethe4hand6hPIlanes;Figure7D).Ofnote,we wouldliketoremindthatsimilarresultswereobtained withquantitativePCRshowingthatoverexpressionof Metnasedelayedthekineticsofrepair,resultingindiminishedyieldofrepairedepisomesforagiventime pointincomparisontocontrol(Figure6B),independentlyconfirmingthesouthernblotfinding. SequencingofdeletedclonesobtainedfromMetnase overexpressingcellsrevealedarecurrentpatternofDNA resectionobservedatthebreaksite.Manycloneslacka regionofsequence,closeto200bpinlength,upstreamof Figure5 AssayforrepairfidelityinT-HO-CATcellsusingluciferasereporter.(A) Luciferaseactivityin293Tcellsupontransfectionof HO-LucreporterasinFigure3atdifferenttimepoints. (B) DemonstrationofGFP-positivecellsat4hposttransfectionasameasureof transfectionefficiency. Rath etal.BMCMolecularBiology 2014, 15 :6 Page11of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 12

thecleavagesite(leftward)whilegettingmoreheterogeneouslyresected(5 to3 direction)ontheothersideof theDSB(Additionalfile3:Supplementarytextfiles1& 2).ThisisconsistentwithaverysimilarobservationpreviouslyreportedinyeastforHOinducedbreaks[46].There isremarkablesimilarityintermsofpositionandsegment lengthofthemissingregionfoundondifferentclones, whichareofdifferentsizes.Inthisregard,itisworthmentioningaveryrecentreportbyAdkins etal. ,involving studiesdonewithnucleosomalsubstrates,presentedevidenceforrequirementofanucleosome-freegapregion adjacenttotheDSBforSgs1-Dna2dependentresection machinery[47].Veryrecently,resectionproteinsSgs1and Exo1havebeenalsoimplicatedinG1checkpointactivationinbuddingyeast[48].Ofnote,anucleosomeplus thelinkerregionisapproximately200bpofDNAsequence.Wealsohadmadesimilarobservationsforprecise removalofnucleosomal-lengthfragmentsatthesingle genomicHO-DSBintheMM3MGmodelwhenin thecontextofheterochromatin[17].Thissuggeststheinvolvementofacommonmechanismforprovidingatemplatemoreamenableforendonucleolyticprocessing, especiallyactiveinpresenceofMetnase.AsalastobservationweshouldnotethattheSouthernblotsalsoindicate thattherepairmechanismappearstobepredominantly accurateNHEJ(simpleplasmidre-ligation)fortheseepisomes,aswehaverarelyobservedevidenceofformation ofconcatemers,evenwhenthepopulationofplasmids wasnotcompletelycut,andthusofferingintacttemplate strandsforHRbetweenplasmidmolecules,thuspresumablyresultinginHollidayjunctionsandconcatemeric unitsthatwewereunabletodetectonSouthernblots. EvenafterpresumablyinhibitingNHEJwithageneralinhibitorofPIKs(Wortmannin)oramorespecificinhibitor ofDNA-PKcs(KU55933)andhenceshiftingthebalance moreinfavorofHRR,themajorityofrepairwasagain Figure6 Metnasepromoteserroneousend-processing.(A) ImmunoblotshowingstableMetnaseoverexpressioninMet-THO-CATcellsalong withendogenouslevelofMetnasein3-HO-CATcells.ArrowmarksthecorrectsizebandforMetnaseintheindicatedcells. (B) qPCRanalysisof kineticsofepisomalcleavageandrepairin293Tcells(withoutMetnase)andMet-T-HO-CATcells(expressingMetnase)asdescribedinFigure1B &1C.qPCRvaluesarerepresentedas(CAT/AMP)%overcontrol. (C) Replicaplatingassayconductedforindicatedtimepointsinthreedifferent celllineswithvaryingMetnaseexpression. (D) Tableshowingaveragereplicaplatingefficiencyobtainedfrom3differenttimepointsforeachcell lineandfromthreeindependentexperiments. Rath etal.BMCMolecularBiology 2014, 15 :6 Page12of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 13

NHEJandtheproportionofconcatemers(basedonpositionofthegel)washardlyincreased(Additionalfile4: FigureS3).TheSouthernblotshowedthatNHEJwas inhibitedbytheKU55933(reductionofthe11kbreligatedproduct)buttherewasonlyamodestshifttoward formationofconcatemers(generatedviaHRR).DiscussionInthisreport,wepresentresultsfromanepisomal modelsystemtostudyend-joiningprocessinintact mammaliancellsuponinductionofaDSB.Thissystem isdesignedtoovercomethelimitationsofexistingDSB repairassaysandgivestheopportunitytoevaluateendjoiningfidelityofmultipleDSBsinasinglecellwith 4bp3 overhang invivo. Wealsoevaluatedtheroleof Metnaseanditscontributiontowardsdeterminingrepair fidelityinthissystem.Wefoundthat>90%oftherecoveredclonesfromtheT-HO-CATcells,whichlackendogenousMetnase,arepreciselyrejoinedindicatinghigh fidelityofrepair(Figure4).Thisisinagreementwith somepreviousreportsindicatinghighlyaccurateNHEJ inmammaliancells[49-51].Infact,averyrecentreport suggestedtherepairaccuracytobeashighas99%ina modifiedI-SceImediatedcleavageandrepairassayand alsoshowedpreciseligationtobemediatedbyclassical NHEJcomponents[52].However,Metnaseexpression mayplayauniqueroleindeterminingthefidelityofrepairspecificallyinhumans.Metnaseisonlyknowntobe expressedinanthropoidprimates(humansandapes).It hasbothhistonemethylaseandDNAendonuclease Figure7 CharacterizationofeffectofMetnaseonend-processing.(A) RepresentationofdeletedclonesobtainedfromMet-T-HO-CATcells andT-HO-CATcellsafterNotIdigestionofrescuedplasmidpopulationat6htimepointpost-infection. (B) Sizedistributionofdeletedclones obtainedfromthetwodifferentcelllines. (C) CartoondisplayingpositionofdifferentrestrictionenzymesonHO-CATepisomeusedforvarious digestionsandsouthernblot. (D) SouthernblotforpRep4-HO-CATfragmentsrecoveredatgiventimepointsPIfromcelllinesinpresenceor absenceofMetnase,afterappropriaterestrictiondigestion(seethedescriptionintext).N.I.denotestheepisomesrecoveredfromnon-infected cells.Differentarrowpositionsshowprocessedepisomalproducts.11Kbsizearrowdenotesthesingly-cutplasmid.Mdenotesthemolecular weightmarker,thatisNEB1kbladderlabeledwithPNKand ATP32. Rath etal.BMCMolecularBiology 2014, 15 :6 Page13of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 14

activityandhasbeenshowntopromoteNHEJ-mediated erroneousrepairofDSBs(forareview[53]).Previous reportsusingcellextractbasedassayshavebeeninconclusiveindeterminingtheexactroleofMetnaseinprocessingofDSBswithoverhangs[29,30].UponMetnase overexpression,weobserveda25-30%ofinaccurately repairedplasmidsbyreplicaplatingassay.Molecular analysisofrecoveredclonesanddirectsouthernblotresultsindependentlyconfirmthisobservation.Thisis suggestiveofaprominentroleofMetnaseasanendonucleaseforprocessingofDSBs.Thesouthernblotsspecificallyindicatealossoffull-lengthrepairedproducts (compare6htimepointofT-HO-CATandMet-T-HOCATcellsinFigure7D).ThisisinaccordancetoarecentreportusingcellularextractwhereadditionofMetnasedidnotincreaseyieldofrepairedproductsbut resultedinincreasedresectionandseemedtoinhibitrepair[30].However,bySouthernblottingwealsodidnot findevidenceofaroleforMetnaseinpreventinglarger deletions(Figure7B)aspreviouslyreported[27].These findings,alongwithevidenceofcloneswithpreciseremovalofanucleosomal-lengthfragmentattheleft(5 side)ofthebreakmayimplicateabroaderroleofMetnaseindeterminingtheoutcomeofend-joiningevents inmammaliancells.ConclusionWehavecarriedoutacarefulanalysisofthefidelityof repairviaNHEJinmammaliancellsusingahighcopy numberepisomalsystemthatcanbecleavedtogenerate homogeneousDSBs,andfoundthatratherthanerrorprone,therepairwashighlyaccurateinmostcases. NHEJwasthepredominantpathwayofrepairinthis system,wherethemajorityofplasmidwascleavedand leavingminimumnumberofintactcopiesforHR.The outcomeoftheaccuraterepairdependedonpresenceof Metnase,anucleasepresentinhumancells,andwhich generatedapatternofdiscretedeletionsneartheDSB andresultinginmuchlessaccuraterepair.AdditionalfilesAdditionalfile1:FigureS1. DNAdamageresponse(DDR)activationin 293T-HO-CATcellsuponAd-HOinfection.InfectionwithAd-HOvirus andgenerationofasingleDSBinepisomes(inT-HO-CATcells)resultsin thephosphorylationofATMatS1981(activation),TLK1(S695,inhibition), andH2AX(S139).Infectionof293TcellsthatdonotcontaintheHOtargetedepisomesdoesnotresultinsufficientATMactivation(bottom panel).Cellswereinfectedandwholecelllysateswerecollectedat indicatedtimepointsandimmunoblottedwithappropriateantibody. “ C ” denotestheuninfectedcontrol.Drugcombination(HU+TFP)was usedasapositivecontrolforATMactivationduetoDNAdamage (Reproducedwithpermissionfrom[34]). Additionalfile2:FigureS2. pS/T-Qstatusin293Tcellsupon doxorubicintreatment.WBforpS/T-Qproteinsof293Tcellsincubatedor notwithdoxorubicinandthenallowedtorecoverafterremovingthe drugfordifferenthours(R1,R3,R5). Additionalfile3: Supplementarytextfiles1and2. Sequencingdata andalignmentfromselecteddeletedclones. Additionalfile4:FigureS3. Evidenceforpresenceofrareconcatemers afterDN-PKcsinhbition.293T-HO-CATcellsweretreated2hpriorto Ad-HOinfectioneitherwithWortmannin(20 M)orKU55933(10 M) (potentATMinhibitor).Episomesrecoveredfromcellsatindicatedtime pointsandwereprocessedasdescribedpreviouslyintextandFigure7. Concatamerscanbeobservedasslowmigratinghighmolecularweight forms(>11Kb). Competinginterests Theauthorsdeclarethattherearenonewithpublicationofthisstudy. Authors ’ contributions ADBandARandRHconceivedthestudyandwrotethemanuscript.AR carriedouttheexperiments.Allauthorshaveapprovedthefinalmanuscript. Acknowledgements WethankMs.SharonRonaldandMr.SanketAwatefortechnicalhelpand Dr.BrentReedforhelpwithdesigningthevectormap. Funding ThisworkwassupportedbygrantW81XWH-10-1-0120IDEADevelopment AwardfromtheDepartmentofDefenseProstateCancerResearchProgram. Authordetails1DepartmentofBiochemistryandMolecularBiology,LouisianaState UniversityHealthSciencesCenter,1501KingsHighway,Shreveport,LA 71130,USA.2DepartmentofMedicine,CollegeofMedicine,Universityof Florida&Shands,Gainesville,FL32610-0277,USA. Received:29October2013Accepted:12March2014 Published:22March2014 References1.CicciaA,ElledgeSJ: TheDNAdamageresponse:makingitsafetoplay withknives. MolCell 2010, 40 (2):179 – 204. 2.HelledayT,LoJ,vanGentDC,EngelwardBP: DNAdouble-strandbreak repair:frommechanisticunderstandingtocancertreatment. DNARepair (Amst) 2007, 6 (7):923 – 935. 3.JacksonSP,BartekJ: TheDNA-damageresponseinhumanbiologyand disease. Nature 2009, 461 (7267):1071 – 1078. 4.PardoB,Gomez-GonzalezB,AguileraA: DNArepairinmammaliancells: DNAdouble-strandbreakrepair:howtofixabrokenrelationship. CellMolLifeSci 2009, 66 (6):1039 – 1056. 5.MoynahanME,JasinM: Mitotichomologousrecombinationmaintains genomicstabilityandsuppressestumorigenesis. NatRevMolCellBiol 2010, 11 (3):196 – 207. 6.LieberM: Themechanismofdouble-strandDNAbreakrepairbythe nonhomologousDNAend-joiningpathway. AnnuRevBiochem 2010, 79: 181 – 211. 7.NagyZ,SoutoglouE: DNArepair:easytovisualize,difficulttoelucidate. TrendsCellBiol 2009, 19 (11):617 – 629. 8.ReynoldsP,BotchwaySW,ParkerAW,O'NeillP: Spatiotemporaldynamics ofDNArepairproteinsfollowinglasermicrobeaminducedDNAdamage -WhenisaDSBnotaDSB? MutatRes 2013, 756 (1-2):14 – 20. 9.PerrinA,BuckleM,DujonB: Asymmetricalrecognitionandactivityofthe I-SceIendonucleaseonitssiteandonintron-exonjunctions. EMBOJ 1993, 12 (7):2939 – 2947. 10.PoloSE,JacksonSP: DynamicsofDNAdamageresponseproteinsatDNA breaks:afocusonproteinmodifications. GenesDev 2011, 25 (5):409 – 433. 11.SonodaE,HocheggerH,SaberiA,TaniguchiY,TakedaS: Differentialusage ofnon-homologousend-joiningandhomologousrecombinationin doublestrandbreakrepair. DNARepair 2006, 5 (9 – 10):1021– 1029. 12.BarlowJH,LisbyM,RothsteinR: Differentialregulationofthecellular responsetoDNAdouble-strandbreaksinG1. MolCell 2008, 30 (1):73 – 85.Rath etal.BMCMolecularBiology 2014, 15 :6 Page14of15 http://www.biomedcentral.com/1471-2199/15/6

PAGE 15

13.SmithJ,BaldeyronC,DeOliveiraI,Sala-TrepatM,PapadopouloD: TheinfluenceofDNAdouble-strandbreakstructureonend-joining inhumancells. NucleicAcidsRes 2001, 29 (23):4783 – 4792. 14.SenSP,DeBenedettiA: TLK1BpromotesrepairofUV-damagedDNA throughchromatinremodelingbyAsf1. BMCMolBiol 2006, 7: 37. 15.KumalaS,FujarewiczK,JayarajuD,Rzeszowska-WolnyJ,HancockR: RepairofDNAstrandbreaksinaminichromosomeinvivo:kinetics, modeling,andeffectsofinhibitors. PLoSOne 2013, 8 (1):e52966. 16.Sunavala-DossabhoyG,DeBenedettiA: Tousledhomolog,TLK1,binds andphosphorylatesRad9;TLK1actsasamolecularchaperoneinDNA repair. DNARepair 2009, 8 (1):87 – 102. 17.Kanikarla-MarieP,RonaldS,DeBenedettiA: Nucleosomeresectionat adouble-strandbreakduringNon-HomologousEndsJoiningin mammaliancells-implicationsfromrepressivechromatinorganization andtheroleofARTEMIS. BMCResNotes 2011, 4: 13. 18.DeemAK,LiX,TylerJK: Epigeneticregulationofgenomicintegrity. Chromosoma 2012, 121 (2):131 – 151. 19.NorthP,GaneshA,ThackerJ: Therejoiningofdouble-strandbreaksin DNAbyhumancellextracts. NucleicAcidsRes 1990, 18 (21):6205 – 6210. 20.ChenS,InamdarKV,PfeifferP,FeldmannE,HannahMF,YuY,LeeJW,ZhouT, Lees-MillerSP,PovirkLF: AccurateinvitroendjoiningofaDNAdouble strandbreakwithpartiallycohesive3'-overhangsand3'-phosphoglycolate termini:effectofKuonrepairfidelity. JBiolChem 2001, 276 (26):24323 – 24330. 21.VerkaikNS,Esveldt-vanLangeRE,vanHeemstD,BruggenwirthHT,Hoeijmakers JH,ZdzienickaMZ,vanGentDC: DifferenttypesofV(D)Jrecombinationand end-joiningdefectsinDNAdouble-strandbreakrepairmutantmammalian cells. EurJImmunol 2002, 32 (3):701 – 709. 22.PoplawskiT,PastwaE,BlasiakJ: Non-homologousDNAendjoiningin normalandcancercellsanditsdependenceonbreakstructures. GenetMolBiol 2010, 33 (2):368 – 373. 23.MaginS,SahaJ,WangM,MladenovaV,CoymN,IliakisG: Lipofectionand nucleofectionofsubstrateplasmidcangeneratewidelydifferentreadings ofDNAend-joiningefficiencyindifferentcelllines. DNARepair 2013, 12: 148 – 160. 24.Guirouilh-BarbatJ,HuckS,BertrandP,PirzioL,DesmazeC,SabatierL,LopezB: ImpactoftheKU80pathwayonNHEJ-inducedgenomerearrangementsin mammaliancells. MolCell 2004,14 (5):611 – 623. 25.ReevesR,GormanCM,HowardB: Minichromosomeassemblyof non-integratedplasmidDNAtransfectedintomammaliancells. NucleicAcidsRes 1985, 13 (10):3599 – 3615. 26.PapiorP,Arteaga-SalasJM,GntherT,GrundhoffA,SchepersA: Openchromatin structuresregulatetheefficiencie sofpre-RCformationandreplication initiationinEpstein-Barrvirus. JCellBiol 2012, 198 (4):509 – 528. 27.HromasR,WrayJ,LeeSH,MartinezL,FarringtonJ,CorwinLK,RamseyH, NickoloffJA,WilliamsonEA: Thehumansetandtransposasedomain proteinMetnaseinteractswithDNALigaseIVandenhancesthe efficiencyandaccuracyofnon-homologousend-joining. DNARepair (Amst) 2008, 7 (12):1927 – 1937. 28.LeeSH,OshigeM,DurantST,RasilaKK,WilliamsonEA,RamseyH,KwanL, NickoloffJA,HromasR: TheSETdomainproteinMetnasemediates foreignDNAintegrationandlinksintegrationtononhomologous end-joiningrepair. ProcNatlAcadSciUSA 2005, 102 (50):18075 – 18080. 29.BeckBD,LeeSS,WilliamsonE,HromasRA,LeeSH: Biochemicalcharacterization ofmetnase ’ sendonucleaseactivityanditsroleinNHEJrepair. Biochemistry 2011, 50 (20):4360 – 4370. 30.MohapatraS,YannoneSM,LeeSH,HromasRA,AkopiantsK,MenonV, RamsdenDA,PovirkLF: Trimmingofdamaged3 ’ overhangsofDNA double-strandbreaksbytheMetnaseandArtemisendonucleases. DNA Repair(Amst) 2013, 12 (6):422 – 432. 31.PovirkLF: ProcessingofDamagedDNAEndsforDouble-StrandBreak RepairinMammalianCells. ISRNMolecularBiology 2012, 2012: 16. 32.NicolasAL,MunzPL,Falck-PedersenE,YoungCS: Creationandrepairof specificDNAdouble-strandbreaksinvivofollowinginfectionwith adenovirusvectorsexpressingSaccharomycescerevisiaeHOendonuclease. Virology 2000, 266 (1):211 – 224. 33.MiddletonT,SugdenB: RetentionofplasmidDNAinmammaliancellsis enhancedbybindingoftheEpstein-BarrvirusreplicationproteinEBNA1. JVirol 1994, 68 (6):4067 – 4071. 34.RonaldS,AwateS,RathA,CarrollJ,GalianoF,DwyerD,Kleiner-HancockH, MathisJM,VigodS,DeBenedettiA: PhenothiazineInhibitorsofTLKs AffectDouble-StrandBreakRepairandDNADamageResponseRecovery andPotentiateTumorKillingwithRadiomimeticTherapy. GenesCancer2013, 4: 39 – 53. 35.DeckbarD,BirrauxJ,KremplerA,TchouandongL,BeucherA,WalkerS,StiffT, JeggoP,LobrichM: ChromosomebreakageafterG2checkpointrelease. JCellBiol 2007, 176 (6):749 – 755. 36.HuangLC,ClarkinKC,WahlGM: SensitivityandselectivityoftheDNA damagesensorresponsibleforactivatingp53-dependentG1arrest. ProcNatlAcadSciUSA 1996, 93 (10):4827 – 4832. 37.Ben-YehoyadaM,WangLC,KozekovID,RizzoCJ,GottesmanME,GautierJ: CheckpointsignalingfromasingleDNAinterstrandcrosslink. MolCell 2009, 35 (5):704 – 715. 38.GoodarziA,JeggoP,LobrichM: Theinfluenceofheterochromatinon DNAdoublestrandbreakrepair:Gettingthestrong,silenttypetorelax. DNARepair 2010, 9: 1273 – 1282. 39.KaplunL,IvantsivY,KornitzerD,RavehD: FunctionsoftheDNAdamage responsepathwaytargetHoendonucleaseofyeastfordegradation viatheubiquitin-26Sproteasomesystem. ProcNatlAcadSci 2000, 97 (18):10077 – 10082. 40.CanfieldC,RainsJ,DeBenedettiA: TLK1BpromotesrepairofDSBsviaits interactionwithRad9andAsf1. BMCMolBiol 2009, 10: 110. 41.PahlHL,SesterM,BurgertHG,BaeuerlePA: Activationoftranscriptionfactor NF-kappaBbytheadenovirusE3/19KproteinrequiresitsERretention. JCellBiol 1996, 132 (4):511 – 522. 42.TollefsonAE,RyerseJS,ScariaA,HermistonTW,WoldWS: TheE3-11.6-kDa adenovirusdeathprotein(ADP)isrequiredforefficientcelldeath: characterizationofcellsinfectedwithadpmutants. Virology 1996, 220 (1):152 – 162. 43.KimST,LimDS,CanmanCE,KastanMB: Substratespecificitiesand identificationofputativesubstratesofATMkinasefamilymembers. JBiolChem 1999, 274 (53):37538 – 37543. 44.RonaldS,Sunavala-DossabhoyG,AdamsL,WilliamsB,DeBenedettiA: TheexpressionoftousledkinasesinCaPcelllinesanditsrelationto radiationresponseandDSBrepair. Prostate 2011, 71: 1367 – 1373. 45.WrayJ,WilliamsonEA,SheemaS,LeeSH,LibbyE,WillmanCL,NickoloffJA, HromasR: Metnasemediateschromosomedecatenationinacute leukemiacells. Blood 2009, 114 (9):1852 – 1858.46.LeeSE,MooreJK,HolmesA,UmezuK,KolodnerRD,HaberJE: SaccharomycesKu70,mre11/rad50andRPAproteinsregulate adaptationtoG2/MarrestafterDNAdamage. Cell 1998, 94 (3):399 – 409. 47.AdkinsNL,NiuH,SungP,PetersonCL: Nucleosomedynamicsregulates DNAprocessing. NatStructMolBiol 2013, 20: 836 – 842. 48.BalogunFO,TrumanAW,KronSJ: DNAresectionproteinsSgs1andExo1 arerequiredforG1checkpointactivationinbuddingyeast. DNARepair 2013, 12 (9):751 – 760. 49.AdamsBR,HawkinsAJ,PovirkLF,ValerieK: ATM-independent,high-fidelity nonhomologousendjoiningpredominatesinhumanembryonicstem cells. Aging(AlbanyNY) 2010, 2 (9):582 – 596. 50.JiangG,PloI,WangT,RahmanM,ChoJH,YangE,LopezBS,XiaF: BRCA1-Ku80 proteininteractionenhancesend-joiningfidelityofchromosomal double-strandbreaksintheG1phaseofthecellcycle. JBiolChem 2013, 288 (13):8966 – 8976. 51.HonmaM,SakurabaM,KoizumiT,TakashimaY,SakamotoH,HayashiM: Non-homologousend-joiningforrepairingI-SceI-inducedDNAdouble strandbreaksinhumancells. DNARepair(Amst) 2007, 6 (6):781 – 788. 52.LinWY,WilsonJH,LinY: Repairofchromosomaldouble-strandbreaksby preciseligationinhumancells. DNARepair(Amst) 2013, 12 (7):480 – 487. 53.ShaheenM,WilliamsonE,NickoloffJ,LeeSH,HromasR: Metnase/SETMAR: adomesticatedprimatetransposasethatenhancesDNArepair, replication,anddecatenation. Genetica 2010, 138 (5):559 – 566.doi:10.1186/1471-2199-15-6 Citethisarticleas: Rath etal. : Fidelityofendjoininginmammalian episomesandtheimpactofMetnaseonjointprocessing. BMCMolecular Biology 2014 15 :6.Rath etal.BMCMolecularBiology 2014, 15 :6 Page15of15 http://www.biomedcentral.com/1471-2199/15/6


Please wait ...

Muscle output


>clone 41
NN--------------------------------NNNNNNNNGGNCATACGCCCGCGTTT
CTTCCTTTTCCCCNCCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACG
TCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCAT
GGGGAATGGTTTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCA
CGACTGGACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGTA
CTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCCCCAAAAACC
ACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATC
ATCGCAGATCC---------------------------------GTAGTCAAACATGAGA
ATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGT--------------
-------------------------------TAATGTCATGATAATAATGGTTTCTTAGA
CGTCAGGT------------------GGCACTTTTCGGGGAAATGTGCGCGGAACCCCTA
TTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTC-------ATGAGACAATAA
CC-CTGATAAATGCTTCAATAATATTGAAA-------AAGGAAGAGTATGAGTATTCAAC
ATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCAC-
---------CCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGA
GTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGT-------TTTCG
CCCC------------GAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATG
TGGCGCGG-------------------------------TATTATCCCGTG-TTGACGCC
GGGCAAGAGCAACTCGGTCGCCGCATACNCTATTCT--------CAGAATGACTTGGTTG
ANTACTCACCAGTCACAGAAAANCANNNTAN-----------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
-------------------------------------------------GGATGGCATG-
---ACAGTANANAATNNNGCAGNG------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
-------------------------CTGCCATNNNATGNNNNNNANNNNGGNGNNNNTTA
CTTCTGANNNNATNGNANGANNNANNNNCTANCNNN------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------NN
>parental partial sequence
AGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTT
CTTCCTTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACG
TCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCAT
GGGGAATGGTTTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCA
CGACTGGACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGTA
CTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCCCCAAAAACC
ACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATC
ATCGCAGATCCGGGCAACGTTGTTGCCATTGCTGCAGGCGCAGAACTGGTAGGTATGGAA
GATCTATACATTGAATCAATATTGGCAATTAGCCATATTAGTCATTGGTTATATAGCATA
AATCAATATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTA
TATTGGCTCATGTCCAATATGACCGCCATAC-TCTCAGTACAATCTGCTCTGATGCCGCA
T--------------------AGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGG
TCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGA----CCGAC
AATTGCATGAAGAATCTGCTTAGGGTT---AGGCGTTTTGCGCTGCT--------TCGCG
ATGTACGGGCCAGATATACGCGT---ATCTGAGGGGACTAGGGTGTGTTTAGGCGAAAAG
CGGGGCTTC--------GGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCG
CTTTTGCATAGGGAGGGGGAAATGTAGTCTTATGC--AATACTCTTGTAGTCTTGCAACA
TGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGAT
TGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACAT
GGATTGGACGAACCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCG
ATACAATAAACGCCATTTGACCATTCACCACATTGGTGTGCACCTCCAAGCTGGGTACCA
GCTGCTAGCAAGCTGCGGCCGCAGATCTTTTAGTTTCAGCTTTCCGCAACAGTATAGCTT
GGCTAGCGGCCGCCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACC
ACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCT
CAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAG
AAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCT
CATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCAC
CCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATAC
CACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAA
AACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCC
TGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCC
GTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATT
CAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAA
CAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCT
TGGCCGGCAAGGCCGGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACA
ACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTT
GTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTT
CAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGT
ATGGCTGATTATGATCCGGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGAC
ACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAG
CCCGTCAGGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGAGGTCGACTCTAG
AGGATCGATGCCCCGCCCCGGACGAACTAAACCTGACTACGACATCTCTGCCCCTTCTTC
GCGGGGCAGTGCATGTAATCCCTTCAGTTGGTTGGTACAACTTGCCAACTGGGCCCTGTT
CCACATGTGACACGGGGGGGGACCAAACACAAAGGGGTTCTCTGACTGTAGTTGACATCC
TTATAAATGGATGTGCACATTTGCCAACACTGAGTGGCTTTCATCCTGGAGCAGACTTTG
CAGTCTGTGGACTGCAACACAACATTGCCTTTATGTGTAACTCTTGGCTGAAGCTCTTAC
ACCAATGCTGGGGGACATGTACCTCCCAGGGGCCCAGGAAGACTACGGGAGGCTACACCA
ACGTCAATCAGAGGGGCCTGTGTAGCTACCGATAAGCGGACCCTCAAGAGGGCATTAGCA
ATAGTGTTTATAAGGCCCCCTTGTTAACCCTAAACGGGTAGCATATGCTTCCCGGGTAGT
AGTATATACTATCCAGACTAACCCTAATTCAATAGCATATGTTACCCAACGGGAAGCATA
TGCTATCGAATTAGGGTTAGTAAAAGGGTCCTAAGGAACAGCGATATCTCCCACCCCATG
AGCTGTCACGGTTTTATTTACATGGGGTCAGGATTCCACGAGGGTAGTGAACCATTTTAG
TCACAAGGGCAGTGGCTGAAGATCAAGGAGCGGGCAGTGAACTCTCCTGAATCTTCGCCT
GCTTCTTCATTCTCCTTCGTTTAGCTAATAGAATAACTGCTGAGTTGTGAACAGTAAGGT
GTATGTGAGGTGCTCGAAAACAAGGTTTCAGGTGACGCCCCCAGAATAAAATTTGGACGG
GGGGTTCAGTGGTGGCATTGTGCTATGACACCAATATAACCCTCACAAACCCCTTGGGCA
ATAAATACTAGTGTAGGAATGAAACATTCTGAATATCTTTAACAATAGAAATCCATGGGG
TGGGGACAAGCCGTAAAGACTGGATGTCCATCTCACACGAATTTATGGCTATGGGCAACA
CATAATCCTAGTGCAATATGATACTGGGGTTATTAAGATGTGTCCCAGGCAGGGACCAAG
ACAGGTGAACCATGTTGTTACACTCTATTTGTAACAAGGGGAAAGAGAGTGGACGCCGAC
AGCAGCGGACTCCACTGGTTGTCTCTAACACCCCCGAAAATTAAACGGGGCTCCACGCCA
ATGGGGCCCATAAACAAAGACAAGTGGCCACTCTTTTTTTTGAAATTGTGGAGTGGGGGC
ACGCGTCAGCCCCCACACGCCGCCCTGCGGTTTTGGACTGTAAAATAAGGGTGTAATAAC
TTGGCTGATTGTAACCCCGCTAACCACTGCGGTCAAACCACTTGCCCACAAAACCACTAA
TGGCACCCCGGGGAATACCTGCATAAGTAGGTGGGCGGGCCAAGATAGGGGCGCGATTGC
TGCGATCTGGAGGACAAATTACACACACTTGCGCCTGAGCGCCAAGCACAGGGTTGTTGG
TCCTCATATTCACGAGGTCGCTGAGAGCACGGTGGGCTAATGTTGCCATGGGTAGCATAT
ACTACC-CAAATATCTGGATAGCATATGCTATCCTAATCTATATCTGGGTAGCATAGGCT
ATCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGTATATGCT
ATCCTAATTTATATCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATATGCT
ATCCTAATCTATATCTGGGTAGTATATGCTATCCTAATCTGTATCCGGGTAGCATATGCT
ATCCTAATAGAGATTAGGGTAGTATATGCTATCCTAATTTATATCTGGGTAGCATATACT
ACCCAAATATCTGGATAGCATATGCTATCCTAATCTATATCTGGGTAGCATATGCTATCC
TAATCTATATCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATATGCTATCC
TAATCTATATCTGGGTAGTATATGCTATCCTAATTTATATCTGGGTAGCATAGGCTATCC
TAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGTATATGCTATCC
TAATCTGTATCCGGGTAGCATATGCTATCCTCATGCATATACAGTCAGCATATGATACCC
AGTAGTAGAGTGGGAGTGCTATCCTTTGCATATGCCGCCACCTCCCAAGGGGGCGTGAAT
TTTCGCTGCTTGTCCTTTTCCTGCTGGTTGCTCCCATTCTTAGGTGAATTTAAGGAGGCC
AGGCTAAAGCCGTCGCATGTCTGATTGCTCACCAGGTAAATGTCGCTAATGTTTTCCAAC
GCGAGAAGGTGTTGAGCGCGGAGCTGAGTGACGTGACAACATGGGTATGCCCAATTGCCC
CATGTTGGGAGGACGAAAATGGTGACAAGACAGATGGCCAGAAATACACCAACAGCACGC
ATGATGTCTACTGGGGATTTATTCTTTAGTGCGGGGGAATACACGGCTTTTAATACGATT
GAGGGCGTCTCCTAACAAGTTACATCACTCCTGCCCTTCCTCACCCTCATCTCCATCACC
TCCTTCATCTCCGTCATCTCCGTCATCACCCTCCGCGGCAGCCCCTTCCACCATAGGTGG
AAACCAGGGAGGCAAATCTACTCCATCGTCAAAGCTGCACACAGTCACCCTGATATTGCA
GGTAGGAGCGGGCTTTGTCATAACAAGGTCCTTAATCGCATCCTTCAAAACCTCAGCAAA
TATATGAGTTTGTAAAAAGACCATGAAATAACAGACAATGGACTCCCTTAGCGGGCCAGG
TTGTGGGCCGGGTCCAGGGGCCATTCCAAAGGGGAGACGACTCAATGGTGTAAGACGACA
TTGTGGAATAGCAAGGGCAGTTCCTCGCCTTAGGTTGTAAAGGGAGGTCTTACTACCTCC
ATATACGAACACACCGGCGACCCAAGTTCCTTCGTCGGTAGTCCTTTCTACGTGACTCCT
AGCCAGGAGAGCTCTTAAACCTTCTGCAATGTTCTCAAATTTCGGGTTGGAACCTCCTTG
ACCACGATGCTTTTCCAAACCACCCTCCTTTTTTGCGCCCTGCCTCCATCACCCTGACCC
CGGGGTCCAGTGCTTGGGCCTTCTCCTGGGTCATCTGCGGGGCCCTGCTCTATCGCTCCC
GGGGGCACGTCAGGCTCACCATCTGGGCCACCTTCTTGGTGGTATTCAAAATAATCGGCT
TCCCCTACAGGGTGGAAAAATGGCCTTCTACCTGGAGGGGGCCTGCGCGGTGGAGACCCG
GATGATGATGACTGACTACTGGGACTCCTGGGCCTCTTTTCTCCACGTCCACGACCTCTC
CCCCTGGCTCTTTCACGACTTCCCCCCCTGGCTCTTTCACGTCCTCTACCCCGGCGGCCT
CCACTACCTCCTCGACCCCGGCCTCCACTACCTCCTCGACCCCGGCCTCCACTGCCTCCT
CGACCCCGGCCTCCACCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTCCTGCTCCT
GCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCC
CCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCT
GCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCT
CCTGCCCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCT
CCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCT
CCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCT--------------------CCTCCTG
CTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTC
CTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTC
CTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCC
CTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTG
CCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCT
>clone 43
NN------------------------------NNNNNNNNNNNNNCATACGCCCGCGTTT
CTTCCTTTTCCCCNCCCCACCCCCCAAGTTCGGGTGAAGGCNNNNNNNNNNCAGCCAACG
TCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCAT
GGGGAATGGTTTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCA
CGACTGGACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGTA
CTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCCCCAAAAACC
ACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATC
ATCGCAGATCC-----------------------------------------GTATGG--
------------------------------------------------------------
------------------------------------------------------------
--------------------------TGCAC-TCTCAGTACAATCTGCTCTGATGCCGCA
T--------------------AGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGG
TCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGA----CCGAC
AATTGCATGAAGAATCTGCTTAGGGTT---AGGCGTTTTGCGCTGCT--------TCGCG
ATGTACGGGCCAGATATACGCGT---ATCTGAGGGGACTAGGGTGTGTTTAGGCGAAAAG
CGGGGCTTC--------GGTTGTACGCGGTTACACTCACCTCC-----------------
----------------------------CCTGTGC--ACCAGTTCC--------------
---------------------------------------TAACAGGCCATG------GAC
TGGT-------------------------------------------ACTGGTCTG---T
GGCCTGG-----------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
-------------------------------------------------GGGTTGGGGA-
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
--------------------------------------CCCCCCTCCTGCTCCTGCCCCT
CCTGCCCCTNNNNNNNCTCCTGCTCCTGCCCCT--------------------CCTCCTG
CTCCTGCCCCTCCTGNCCCTNCTGCNCNTCCTCCNGCTCCTGNNCCTCCTG-CCCTCCTC
CTGCTCCTGCNNCTTCNTCCNGNTCCNGCCCTCNNGCNCNTCNTGNCCNTNNNNNNGNNN
NNGNACNNNNNNNNNNNNNNNNNGNTCNNGCNC---------------------------
------------------------------------------------------------
------------------------------------------------------NN
>clone 39
NN-----------------------------NNNNNNNNNNNNNNNNNNCGCCCGCGTTT
CTTCCTTTTCCCCNCCCCACCCCCCAAGTTCGGGTGAAGGCCCNNGGCTCGCAGCCAACG
TCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCAT
GGGGAATGGTTTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCA
CGACTGGACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGTA
CTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCCCCAAAAACC
ACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATC
ATCGCAGATCC-----------------------------------------GTATGG--
------------------------------------------------------------
------------------------------------------------------------
--------------------------TGCAC-TCTCAGTACAATCTGCTCTGATGCCGCA
T--------------------AGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGG
TCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGA----CCGAC
AATTGCATGAAGAATCTGCTTAGGGTT---AGGCGTTTTGCGCTGCT--------TCGCG
ATGTACGGGCCAGATATACGCGT---ATCTGAGGGGACTAGGGTGTGTTTAGGCGAAAAG
CGGGGCTTC--------GGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCG
CTTTTGCATAGGGAGGGGGAAATGTAGTCTTATGC--AATACTCTTGTAGTCTTGCAACA
TGGTAACGATGANTTAGCAACATGCCTTACAAGGAGANAAAAAGCACCGTGCATGCCGAT
TGGTGNAAGTAAGGTGGTACGATCGTGNCTTATTANGAANGCAACAGACGGGTCTGACAT
GGNNTGGANNAACCACTGAANTCCGCATTGCANAGATATTGTATTTAAGTGNCTAGCTCG
NNNNNATAANC-------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
---------------------------------------NTGNTNNCATGGGTAGNATAT
ACTACCNNAANTANNNGGATANN-------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
-----------------------------------------------------NNNNCNA
NTNCNANTCTANNNNNNNGGNNNNCNNAAGNNNNNNNNNN--------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------NN
RunMUSCLE--V1.0--09-Sep-2004 / JL, Lab. of Bioinformatics, WUR


>clone 43

NNNNNNNNNNNNNNNCATACGCCCGCGTTTCTTCCTTTTCCCCNCCCCACCCCCCAAGTTCGGGTGAAGGCNNNNNNNNN
NCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGGT
TTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGGACTGAGCAGACAGACCCATGGTT
TTTGGATGGCCTGGGCATGGACCGCATGTACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACC
CCCAAAAACCACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATCATCGCAGATC
CGTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGG
TCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGG
GTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTATCTGAGGGGACTAGGGTGTGTTTAGGCGAAA
AGCGGGGCTTCGGTTGTACGCGGTTACACTCACCTCCCCTGTGCACCAGTTCCTAACAGGCCATGGACTGGTACTGGTCT
GTGGCCTGGGGGTTGGGGACCCCCCTCCTGCTCCTGCCCCTCCTGCCCCTNNNNNNNCTCCTGCTCCTGCCCCTCCTCCT
GCTCCTGCCCCTCCTGNCCCTNCTGCNCNTCCTCCNGCTCCTGNNCCTCCTGCCCTCCTCCTGCTCCTGCNNCTTCNTCC
NGNTCCNGCCCTCNNGCNCNTCNTGNCCNTNNNNNNGNNNNNGNACNNNNNNNNNNNNNNNNNGNTCNNGCNCNN

>clone 39

NNNNNNNNNNNNNNNNNNNNCGCCCGCGTTTCTTCCTTTTCCCCNCCCCACCCCCCAAGTTCGGGTGAAGGCCCNNGGCT
CGCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGG
TTTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGGACTGAGCAGACAGACCCATGGT
TTTTGGATGGCCTGGGCATGGACCGCATGTACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGAC
CCCCAAAAACCACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATCATCGCAGAT
CCGTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAG
GTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAG
GGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTATCTGAGGGGACTAGGGTGTGTTTAGGCGAA
AAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCGCTTTTGCATAGGGAGGGGGAAATGT
AGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGANTTAGCAACATGCCTTACAAGGAGANAAAAAGCAC
CGTGCATGCCGATTGGTGNAAGTAAGGTGGTACGATCGTGNCTTATTANGAANGCAACAGACGGGTCTGACATGGNNTGG
ANNAACCACTGAANTCCGCATTGCANAGATATTGTATTTAAGTGNCTAGCTCGNNNNNATAANCNTGNTNNCATGGGTAG
NATATACTACCNNAANTANNNGGATANNNNNNCNANTNCNANTCTANNNNNNNGGNNNNCNNAAGNNNNNNNNNNNN

>clone 41

NNNNNNNNNNGGNCATACGCCCGCGTTTCTTCCTTTTCCCCNCCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGC
AGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGGTTT
ATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGGACTGAGCAGACAGACCCATGGTTTT
TGGATGGCCTGGGCATGGACCGCATGTACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCCC
CAAAAACCACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATCATCGCAGATCCG
TAGTCAAACATGAGAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATG
GTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAA
TATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATT
TCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAA
GATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCG
CCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGC
AAGAGCAACTCGGTCGCCGCATACNCTATTCTCAGAATGACTTGGTTGANTACTCACCAGTCACAGAAAANCANNNTANG
GATGGCATGACAGTANANAATNNNGCAGNGCTGCCATNNNATGNNNNNNANNNNGGNGNNNNTTACTTCTGANNNNATNG
NANGANNNANNNNCTANCNNNNN


>parental partial sequence

AGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGGTTTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGGACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGTACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCCCCAAAAACCACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATCATCGCAGATCCGGGCAACGTTGTTGCCATTGCTGCAGGCGCAGAACTGGTAGGTATGGAAGATCTATACATTGAATCAATATTGGCAATTAGCCATATTAGTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTATCTGAGGGGACTAGGGTGTGTTTAGGCGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCGCTTTTGCATAGGGAGGGGGAAATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGCCATTTGACCATTCACCACATTGGTGTGCACCTCCAAGCTGGGTACCAGCTGCTAGCAAGCTGCGGCCGCAGATCTTTTAGTTTCAGCTTTCCGCAACAGTATAGCTTGGCTAGCGGCCGCCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCTTGGCCGGCAAGGCCGGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCGGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGAGGTCGACTCTAGAGGATCGATGCCCCGCCCCGGACGAACTAAACCTGACTACGACATCTCTGCCCCTTCTTCGCGGGGCAGTGCATGTAATCCCTTCAGTTGGTTGGTACAACTTGCCAACTGGGCCCTGTTCCACATGTGACACGGGGGGGGACCAAACACAAAGGGGTTCTCTGACTGTAGTTGACATCCTTATAAATGGATGTGCACATTTGCCAACACTGAGTGGCTTTCATCCTGGAGCAGACTTTGCAGTCTGTGGACTGCAACACAACATTGCCTTTATGTGTAACTCTTGGCTGAAGCTCTTACACCAATGCTGGGGGACATGTACCTCCCAGGGGCCCAGGAAGACTACGGGAGGCTACACCAACGTCAATCAGAGGGGCCTGTGTAGCTACCGATAAGCGGACCCTCAAGAGGGCATTAGCAATAGTGTTTATAAGGCCCCCTTGTTAACCCTAAACGGGTAGCATATGCTTCCCGGGTAGTAGTATATACTATCCAGACTAACCCTAATTCAATAGCATATGTTACCCAACGGGAAGCATATGCTATCGAATTAGGGTTAGTAAAAGGGTCCTAAGGAACAGCGATATCTCCCACCCCATGAGCTGTCACGGTTTTATTTACATGGGGTCAGGATTCCACGAGGGTAGTGAACCATTTTAGTCACAAGGGCAGTGGCTGAAGATCAAGGAGCGGGCAGTGAACTCTCCTGAATCTTCGCCTGCTTCTTCATTCTCCTTCGTTTAGCTAATAGAATAACTGCTGAGTTGTGAACAGTAAGGTGTATGTGAGGTGCTCGAAAACAAGGTTTCAGGTGACGCCCCCAGAATAAAATTTGGACGGGGGGTTCAGTGGTGGCATTGTGCTATGACACCAATATAACCCTCACAAACCCCTTGGGCAATAAATACTAGTGTAGGAATGAAACATTCTGAATATCTTTAACAATAGAAATCCATGGGGTGGGGACAAGCCGTAAAGACTGGATGTCCATCTCACACGAATTTATGGCTATGGGCAACACATAATCCTAGTGCAATATGATACTGGGGTTATTAAGATGTGTCCCAGGCAGGGACCAAGACAGGTGAACCATGTTGTTACACTCTATTTGTAACAAGGGGAAAGAGAGTGGACGCCGACAGCAGCGGACTCCACTGGTTGTCTCTAACACCCCCGAAAATTAAACGGGGCTCCACGCCAATGGGGCCCATAAACAAAGACAAGTGGCCACTCTTTTTTTTGAAATTGTGGAGTGGGGGCACGCGTCAGCCCCCACACGCCGCCCTGCGGTTTTGGACTGTAAAATAAGGGTGTAATAACTTGGCTGATTGTAACCCCGCTAACCACTGCGGTCAAACCACTTGCCCACAAAACCACTAATGGCACCCCGGGGAATACCTGCATAAGTAGGTGGGCGGGCCAAGATAGGGGCGCGATTGCTGCGATCTGGAGGACAAATTACACACACTTGCGCCTGAGCGCCAAGCACAGGGTTGTTGGTCCTCATATTCACGAGGTCGCTGAGAGCACGGTGGGCTAATGTTGCCATGGGTAGCATATACTACCCAAATATCTGGATAGCATATGCTATCCTAATCTATATCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGTATATGCTATCCTAATTTATATCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGTATATGCTATCCTAATCTGTATCCGGGTAGCATATGCTATCCTAATAGAGATTAGGGTAGTATATGCTATCCTAATTTATATCTGGGTAGCATATACTACCCAAATATCTGGATAGCATATGCTATCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGTATATGCTATCCTAATTTATATCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGTATATGCTATCCTAATCTGTATCCGGGTAGCATATGCTATCCTCATGCATATACAGTCAGCATATGATACCCAGTAGTAGAGTGGGAGTGCTATCCTTTGCATATGCCGCCACCTCCCAAGGGGGCGTGAATTTTCGCTGCTTGTCCTTTTCCTGCTGGTTGCTCCCATTCTTAGGTGAATTTAAGGAGGCCAGGCTAAAGCCGTCGCATGTCTGATTGCTCACCAGGTAAATGTCGCTAATGTTTTCCAACGCGAGAAGGTGTTGAGCGCGGAGCTGAGTGACGTGACAACATGGGTATGCCCAATTGCCCCATGTTGGGAGGACGAAAATGGTGACAAGACAGATGGCCAGAAATACACCAACAGCACGCATGATGTCTACTGGGGATTTATTCTTTAGTGCGGGGGAATACACGGCTTTTAATACGATTGAGGGCGTCTCCTAACAAGTTACATCACTCCTGCCCTTCCTCACCCTCATCTCCATCACCTCCTTCATCTCCGTCATCTCCGTCATCACCCTCCGCGGCAGCCCCTTCCACCATAGGTGGAAACCAGGGAGGCAAATCTACTCCATCGTCAAAGCTGCACACAGTCACCCTGATATTGCAGGTAGGAGCGGGCTTTGTCATAACAAGGTCCTTAATCGCATCCTTCAAAACCTCAGCAAATATATGAGTTTGTAAAAAGACCATGAAATAACAGACAATGGACTCCCTTAGCGGGCCAGGTTGTGGGCCGGGTCCAGGGGCCATTCCAAAGGGGAGACGACTCAATGGTGTAAGACGACATTGTGGAATAGCAAGGGCAGTTCCTCGCCTTAGGTTGTAAAGGGAGGTCTTACTACCTCCATATACGAACACACCGGCGACCCAAGTTCCTTCGTCGGTAGTCCTTTCTACGTGACTCCTAGCCAGGAGAGCTCTTAAACCTTCTGCAATGTTCTCAAATTTCGGGTTGGAACCTCCTTGACCACGATGCTTTTCCAAACCACCCTCCTTTTTTGCGCCCTGCCTCCATCACCCTGACCCCGGGGTCCAGTGCTTGGGCCTTCTCCTGGGTCATCTGCGGGGCCCTGCTCTATCGCTCCCGGGGGCACGTCAGGCTCACCATCTGGGCCACCTTCTTGGTGGTATTCAAAATAATCGGCTTCCCCTACAGGGTGGAAAAATGGCCTTCTACCTGGAGGGGGCCTGCGCGGTGGAGACCCGGATGATGATGACTGACTACTGGGACTCCTGGGCCTCTTTTCTCCACGTCCACGACCTCTCCCCCTGGCTCTTTCACGACTTCCCCCCCTGGCTCTTTCACGTCCTCTACCCCGGCGGCCTCCACTACCTCCTCGACCCCGGCCTCCACTACCTCCTCGACCCCGGCCTCCACTGCCTCCTCGACCCCGGCCTCCACCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCT




PAGE 1

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add4.txt [8/1/2014 10:47:59 AM] >clone 43 NNNNNNNNNNNNNNNCATACGCCCGCGTTTCTTCCTTTTCCCCNCCCCACCCCCCAAGTTCGGGTGAAGG CNNNNNNNNN NCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCAT GGGGAATGGT TTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGGACTGAGCAGACAG ACCCATGGTT TTTGGATGGCCTGGGCATGGACCGCATGTACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAAC ACCCCCGACC CCCAAAAACCACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATCA TCGCAGATC CGTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTG TGTTGGAGG TCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGA ATCTGCTTAGG GTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTATCTGAGGGGACTAGGGTGTGTT TAGGCGAAA AGCGGGGCTTCGGTTGTACGCGGTTACACTCACCTCCCCTGTGCACCAGTTCCTAACAGGCCATGGACTGG TACTGGTCT GTGGCCTGGGGGTTGGGGACCCCCCTCCTGCTCCTGCCCCTCCTGCCCCTNNNNNNNCTCCTGCTCCTGCC CCTCCTCCT GCTCCTGCCCCTCCTGNCCCTNCTGCNCNTCCTCCNGCTCCTGNNCCTCCTGCCCTCCTCCTGCTCCTGCNN CTTCNTCC NGNTCCNGCCCTCNNGCNCNTCNTGNCCNTNNNNNNGNNNNNGNACNNNNNNNNNNNNNNNNNGNTCN NGCNCNN >clone 39 NNNNNNNNNNNNNNNNNNNNCGCCCGCGTTTCTTCCTTTTCCCCNCCCCACCCCCCAAGTTCGGGTGAAG GCCCNNGGCT CGCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCA TGGGGAATGG TTTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGGACTGAGCAGACAG ACCCATGGT TTTTGGATGGCCTGGGCATGGACCGCATGTACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAA CACCCCCGAC CCCCAAAAACCACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATC ATCGCAGAT CCGTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGT GTGTTGGAG GTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAG AATCTGCTTAG GGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTATCTGAGGGGACTAGGGTGTG TTTAGGCGAA AAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCGCTTTTGCATAGGGAG GGGGAAATGT AGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGANTTAGCAACATGCCTTACAAGGAGA NAAAAAGCAC CGTGCATGCCGATTGGTGNAAGTAAGGTGGTACGATCGTGNCTTATTANGAANGCAACAGACGGGTCTGA CATGGNNTGG ANNAACCACTGAANTCCGCATTGCANAGATATTGTATTTAAGTGNCTAGCTCGNNNNNATAANCNTGNTN NCATGGGTAG

PAGE 2

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add4.txt [8/1/2014 10:47:59 AM] NATATACTACCNNAANTANNNGGATANNNNNNCNANTNCNANTCTANNNNNNNGGNNNNCNNAAGNNN NNNNNNNNN >clone 41 NNNNNNNNNNGGNCATACGCCCGCGTTTCTTCCTTTTCCCCNCCCCACCCCCCAAGTTCGGGTGAAGGCC CAGGGCTCGC AGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGG GGAATGGTTT ATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGGACTGAGCAGACAGAC CCATGGTTTT TGGATGGCCTGGGCATGGACCGCATGTACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACAC CCCCGACCCC CAAAAACCACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATCATC GCAGATCCG TAGTCAAACATGAGAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATG ATAATAATG GTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATA CATTCAAA TATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGT ATTCAACATT TCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGA AAGTAAAA GATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTG AGAGTTTTCG CCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTG ACGCCGGGC AAGAGCAACTCGGTCGCCGCATACNCTATTCTCAGAATGACTTGGTTGANTACTCACCAGTCACAGAAAA NCANNNTANG GATGGCATGACAGTANANAATNNNGCAGNGCTGCCATNNNATGNNNNNNANNNNGGNGNNNNTTACTTC TGANNNNATNG NANGANNNANNNNCTANCNNNNN >parental partial sequence AGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCC CCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAGGCCCTGCCA TAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGGTTTATGGTTCGTGGGGGTTATT ATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGGACTGAGCAGACAGACCCATGGTTTTTGGATGGCC TGGGCATGGACCGCATGTACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCC CCAAAAACCACCGCGCGGATTTCTGGCGTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATCAT CGCAGATCCGGGCAACGTTGTTGCCATTGCTGCAGGCGCAGAACTGGTAGGTATGGAAGATCTATACATT GAATCAATATTGGCAATTAGCCATATTAGTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCAT TGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATACTCTC AGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGA GTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTT AGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTATCTGAGGGGACTAGGGTG TGTTTAGGCGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCGCTTT TGCATAGGGAGGGGGAAATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTA GCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCG TGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTCCGCATTGCAGAG ATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGCCATTTGACCATTCACCACATTGGTGTGCACCTC CAAGCTGGGTACCAGCTGCTAGCAAGCTGCGGCCGCAGATCTTTTAGTTTCAGCTTTCCGCAACAGTATAG

PAGE 3

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add4.txt [8/1/2014 10:47:59 AM] CTTGGCTAGCGGCCGCCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTT GATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCA GACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCC TTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCT GGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCT GGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGA AAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTT CACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATT ATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCAT GTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATTTTTTTAAG GCAGTTATTGGTGCCCTTGGCCGGCAAGGCCGGATCCAGACATGATAAGATACATTGATGAGTTTGGACA AACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAA CCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAG GTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCGGCTGCCTC GCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGT AAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCA TGAGGTCGACTCTAGAGGATCGATGCCCCGCCCCGGACGAACTAAACCTGACTACGACATCTCTGCCCCT TCTTCGCGGGGCAGTGCATGTAATCCCTTCAGTTGGTTGGTACAACTTGCCAACTGGGCCCTGTTCCACAT GTGACACGGGGGGGGACCAAACACAAAGGGGTTCTCTGACTGTAGTTGACATCCTTATAAATGGATGTGC ACATTTGCCAACACTGAGTGGCTTTCATCCTGGAGCAGACTTTGCAGTCTGTGGACTGCAACACAACATTG CCTTTATGTGTAACTCTTGGCTGAAGCTCTTACACCAATGCTGGGGGACATGTACCTCCCAGGGGCCCAGG AAGACTACGGGAGGCTACACCAACGTCAATCAGAGGGGCCTGTGTAGCTACCGATAAGCGGACCCTCAA GAGGGCATTAGCAATAGTGTTTATAAGGCCCCCTTGTTAACCCTAAACGGGTAGCATATGCTTCCCGGGTA GTAGTATATACTATCCAGACTAACCCTAATTCAATAGCATATGTTACCCAACGGGAAGCATATGCTATCGA ATTAGGGTTAGTAAAAGGGTCCTAAGGAACAGCGATATCTCCCACCCCATGAGCTGTCACGGTTTTATTTA CATGGGGTCAGGATTCCACGAGGGTAGTGAACCATTTTAGTCACAAGGGCAGTGGCTGAAGATCAAGGA GCGGGCAGTGAACTCTCCTGAATCTTCGCCTGCTTCTTCATTCTCCTTCGTTTAGCTAATAGAATAACTGCT GAGTTGTGAACAGTAAGGTGTATGTGAGGTGCTCGAAAACAAGGTTTCAGGTGACGCCCCCAGAATAAAA TTTGGACGGGGGGTTCAGTGGTGGCATTGTGCTATGACACCAATATAACCCTCACAAACCCCTTGGGCAA TAAATACTAGTGTAGGAATGAAACATTCTGAATATCTTTAACAATAGAAATCCATGGGGTGGGGACAAGC CGTAAAGACTGGATGTCCATCTCACACGAATTTATGGCTATGGGCAACACATAATCCTAGTGCAATATGA TACTGGGGTTATTAAGATGTGTCCCAGGCAGGGACCAAGACAGGTGAACCATGTTGTTACACTCTATTTGT AACAAGGGGAAAGAGAGTGGACGCCGACAGCAGCGGACTCCACTGGTTGTCTCTAACACCCCCGAAAAT TAAACGGGGCTCCACGCCAATGGGGCCCATAAACAAAGACAAGTGGCCACTCTTTTTTTTGAAATTGTGG AGTGGGGGCACGCGTCAGCCCCCACACGCCGCCCTGCGGTTTTGGACTGTAAAATAAGGGTGTAATAACT TGGCTGATTGTAACCCCGCTAACCACTGCGGTCAAACCACTTGCCCACAAAACCACTAATGGCACCCCGG GGAATACCTGCATAAGTAGGTGGGCGGGCCAAGATAGGGGCGCGATTGCTGCGATCTGGAGGACAAATT ACACACACTTGCGCCTGAGCGCCAAGCACAGGGTTGTTGGTCCTCATATTCACGAGGTCGCTGAGAGCAC GGTGGGCTAATGTTGCCATGGGTAGCATATACTACCCAAATATCTGGATAGCATATGCTATCCTAATCTAT ATCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGT ATATGCTATCCTAATTTATATCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATATGCTATCCT AATCTATATCTGGGTAGTATATGCTATCCTAATCTGTATCCGGGTAGCATATGCTATCCTAATAGAGATTA GGGTAGTATATGCTATCCTAATTTATATCTGGGTAGCATATACTACCCAAATATCTGGATAGCATATGCTA TCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGCATAGGCTATCCTAATCTATA TCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGTATATGCTATCCTAATTTATATCTGGGTAGCAT AGGCTATCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTAGTATATGCTATCCTA ATCTGTATCCGGGTAGCATATGCTATCCTCATGCATATACAGTCAGCATATGATACCCAGTAGTAGAGTGG GAGTGCTATCCTTTGCATATGCCGCCACCTCCCAAGGGGGCGTGAATTTTCGCTGCTTGTCCTTTTCCTGCT GGTTGCTCCCATTCTTAGGTGAATTTAAGGAGGCCAGGCTAAAGCCGTCGCATGTCTGATTGCTCACCAGG TAAATGTCGCTAATGTTTTCCAACGCGAGAAGGTGTTGAGCGCGGAGCTGAGTGACGTGACAACATGGGT ATGCCCAATTGCCCCATGTTGGGAGGACGAAAATGGTGACAAGACAGATGGCCAGAAATACACCAACAG CACGCATGATGTCTACTGGGGATTTATTCTTTAGTGCGGGGGAATACACGGCTTTTAATACGATTGAGGGC GTCTCCTAACAAGTTACATCACTCCTGCCCTTCCTCACCCTCATCTCCATCACCTCCTTCATCTCCGTCATC TCCGTCATCACCCTCCGCGGCAGCCCCTTCCACCATAGGTGGAAACCAGGGAGGCAAATCTACTCCATCG

PAGE 4

file:///Y|/Main/Load/BIOMED%2020140801/AA00024681_00001/1022289421111828_add4.txt [8/1/2014 10:47:59 AM] TCAAAGCTGCACACAGTCACCCTGATATTGCAGGTAGGAGCGGGCTTTGTCATAACAAGGTCCTTAATCG CATCCTTCAAAACCTCAGCAAATATATGAGTTTGTAAAAAGACCATGAAATAACAGACAATGGACTCCCT TAGCGGGCCAGGTTGTGGGCCGGGTCCAGGGGCCATTCCAAAGGGGAGACGACTCAATGGTGTAAGACG ACATTGTGGAATAGCAAGGGCAGTTCCTCGCCTTAGGTTGTAAAGGGAGGTCTTACTACCTCCATATACG AACACACCGGCGACCCAAGTTCCTTCGTCGGTAGTCCTTTCTACGTGACTCCTAGCCAGGAGAGCTCTTAA ACCTTCTGCAATGTTCTCAAATTTCGGGTTGGAACCTCCTTGACCACGATGCTTTTCCAAACCACCCTCCTT TTTTGCGCCCTGCCTCCATCACCCTGACCCCGGGGTCCAGTGCTTGGGCCTTCTCCTGGGTCATCTGCGGG GCCCTGCTCTATCGCTCCCGGGGGCACGTCAGGCTCACCATCTGGGCCACCTTCTTGGTGGTATTCAAAAT AATCGGCTTCCCCTACAGGGTGGAAAAATGGCCTTCTACCTGGAGGGGGCCTGCGCGGTGGAGACCCGGA TGATGATGACTGACTACTGGGACTCCTGGGCCTCTTTTCTCCACGTCCACGACCTCTCCCCCTGGCTCTTTC ACGACTTCCCCCCCTGGCTCTTTCACGTCCTCTACCCCGGCGGCCTCCACTACCTCCTCGACCCCGGCCTCC ACTACCTCCTCGACCCCGGCCTCCACTGCCTCCTCGACCCCGGCCTCCACCTCCTGCTCCTGCCCCTCCTGC TCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCC CCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTC CTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCC TGCCCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCT CCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTCCTGCTC CTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCC TCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCT GCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTG CCCCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGC T