Identification of a virulence function in herpes simplex virus type l mapping to the latency associated transcript locus

MISSING IMAGE

Material Information

Title:
Identification of a virulence function in herpes simplex virus type l mapping to the latency associated transcript locus
Physical Description:
ix, 79 leaves : ill. ; 29 cm.
Language:
English
Creator:
Gary, Lee William
Publication Date:

Subjects

Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 2004.
Bibliography:
Includes bibliographical references.
General Note:
Printout.
General Note:
Vita.
Statement of Responsibility:
by Lee William Gary.

Record Information

Source Institution:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (dissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
oclc - 880637454
ocn880637454
System ID:
AA00024446:00001

Full Text










IDENTIFICATION OF A VIRULENCE FUNCTION IN HERPES SIMPLEX VIRUS-
TYPE I MAPPING TO THE LATENCY ASSOCIATED TRANSCRIPT LOCUS














By

LEE WILLIAM GARY













A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2004



















Copyright 2004

by

Lee William Gary














ACKNOWLEDGMENTS

I would like to thank my parents, Bill and Barbara, for their endless support and

encouragement. I also appreciate the support of Jia Liu, Karen Johnstone, Jason Liem,

Chuck Peek and many other friends at the University of Florida. My advisor, David

Bloom, made this work possible and I greatly appreciate his expertise and patience.




































iii



















TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS................................... ..............................iii

LIST OF TABLES .................. ....................... ................................vi

LIST OF FIGURES.......................................................................... vii

ABSTRACT......................................... ...... .......................................viii

CHAPTER

1 INTRODUCTION......... ...................................... ...... ....... .... 1

General Characteristics of HSV-1........................... ..................... 1
Viral Infections in Human Host................................................... 3
Animal Models ................................ ...................... ........... 5
LAT Mutants and Phenotypes..................................... ............. 8
Establishment ......................................... ........................ 9
Reactivation............ ... ..................................................... 10
Other Regulatory Regions of LAT........... ... ............. .................. 12
Neuronal Survival and Apoptosis.................................................. 13

2 METHODS............ .................................................................21

LAT Recombinant Viruses ......................... ....... ...................... 26
17A480R.......... ...................................................... 26
17APstA480....................................................... ....... 27
Analyses In Vivo and Cell Culture................................................29
Virulence Determination in Mouse Model............................. 29
Tissue Restriction......................................................... 30
Time Course Experiments................................................. 30





iv









3 R E SU LT S ................................................. .......................... 35

LDso/pfu Evaluation................................................................ 36
Tissue Restriction................................................................. 38
Cell Specific Replication Deficiency.......................................... 39
Additional LAT Recombinant Viruses........................................... 41
17A480R.................................................................. 41
17APstA480................................................................ 42

4 DISCUSSION.........................................................................53

Virulence Phenotype and Nervous System Restriction..................... 57
Cell Culture Phenotype................................................................58
LAT Mutants and Multiple Regulatory Functions............................59
Mechanism................. .............................................................61
Lytic Promoter in the LAT Region ................................... 62
Transcriptional Permissivity.............................................. 63
ICPO Enhancer................. ....................................... 64

LIST OF REFERENCES..................................................................66

BIOGRAPHICAL SKETCH............................................................. 79




























v














LIST OF TABLES

Table page

1-1. Analysis of the 5' LAT deletions on reactivation in the rabbit eye model........ 19

1-2. The ratio of HSV to actin DNA in rabbit trigeminal ganglia latently infected with
17A307 and 17A307R mutants of HSV-1......................................... 20

3-1. LD 50 values............................................................................... 44




































vi














LIST OF FIGURES

Figure page

1-1. Schematic of the LAT gene and the position of 17APst, 17A307, 17A480 and
17A489 recombinant viruses.......................................................... 17

1-2. Large LAT deletions used for virulence indications...............................18

2-1. 17A480R construction.................................................... ......... 32

2-2. Dot blot hybridization of second round plaque purification of 17A480R........ 33

2-3. Dot blot hybridization of second round plaque purification of 17APstA480......34

3-1. Reduced corneal pathology of 17A307 in the rabbit eye model........ ....... 43

3-2. Infectious virus recovered from mouse feet at 2 days post-infection.............. 45

3-3. Virus production in dorsal root ganglia at 3 and 5 days post-infection ..........46

3-4. Virus production in spinal cord at 5 and 7 days post-infection..................... 47

3-5. Virus production in brain at 7 days post-infection....................................48

3-6. 17A307 and 17A480 multi-step time course in PC-12 cells...................... 49

3-7. 17A480R multi-step time course in PC-12 cells......................................50

3-8. Multi-step time course in rabbit skin cells............................................51

3-9. Single step time course in PC-12 cells................................................52

4-1. Separate genetic regions of the LAT locus............................................65








vii













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

IDENTIFICATION OF A VIRULENCE FUNCTION IN HERPES SIMPLEX VIRUS-
TYPE I MAPPING TO THE LATENCY ASSOCIATED TRANSCRIPT LOCUS

By

Lee William Gary

May 2004

Chair: David C. Bloom
Major Department: Molecular Genetics and Microbiology

Two Herpes Simplex Virus type 1 (HSV-1) strain 17syn+ recombinants (17A307

and 17A480) possessing contiguous deletions spanning the 3' region of the Latency

Associated Transcript (LAT) exon 1 and the 5' portion of the LAT intron were analysed

for virulence in mouse footpad (f.p.) model. While the 17syn+ (parent) and 17APst (LAT

promoter mutant) yielded LD5o/pfu values of 3.25 x 102 and 5.11 x 102 respectively,

17A307 and 17A480 had LDso/pfu values of>7.0 x 104. A second independent

recombinant and a rescue (17A307a and 17A307aR) were constructed and yielded f.p.

LD50 values of>7.0 x 104 and 3.17 x 102 respectively, confirming that deletions within

this region of the LAT locus resulted in a dramatic reduction in virulence. Replication of

the recombinants was indistinguishable from wild-type 17syn+ and rescue viruses when

tested on rabbit skin cells but demonstrate 10-fold reduction in viral yields on PC-12 cells

as measured by multi-step growth curves. Significantly, the attenuation in virulence

displayed by 17A307 and 17A480 is not observed for the LAT promoter mutant, 17APst,,


viii








suggesting that the phenotype is independent of the LAT latent promoter (LAP1). In

addition, 17A480 possesses a wild-type reactivation in the rabbit eye model suggesting

that the virulence and reactivation phenotypes are genetically separable.














































ix













CHAPTER 1
INTRODUCTION

General Characteristics of HSV-1

Herpes Simplex Virus-type I (HSV-1) is a widely prevalent human pathogen that is

nuclear replicating, enveloped particle within an icosahedral capsid containing an

amorphous tegument (Roizman et al., 1974). The genome of HSV-1 is a double stranded

DNA molecule of 152 kb, encoding more than 70 protein products (Becker et al., 1968;

Kieffet al., 1971; McGeoch et al., 1985; McGeoch et al., 1988). Regions of the genome

are rich in repetitive sequence, whereas other areas contain mostly unique sequence. The

HSV-1 genome also has a high GC content in comparison to other viruses (Becker et al.,

1968; Kieffet al., 1971; McGeoch et al., 1988). HSV-1 is an alphaherpesvirus and as

such is neurotropic with rapid replication capabilities and exhibits a broad host and cell

range (Jamieson et al., 1974). While HSV-1 is able to infect a wide spectrum of different

mammalian cell types, the ability to replicate and establish a latent infection within

neurons is central to HSV-1's biology (Dotti et al., 1987; Dotti et al., 1990). Because

most neurons divide infrequently and consequently rarely express proteins necessary for

DNA replication, HSV-1 encodes specialized functions for existing within the highly

differentiated cells (Caradonna et al., 1981; Honess et al., 1974; Honess et al., 1975;

Huszer et al., 1981; Preston et al., 1984).

Attachment and entry of infectious viral particles involve interaction between

several cellular membrane glycoproteins and receptors (Baines et al., 1991; Cai et al.,

1988; Forrester et al., 1992; Javier et al., 1988; Johnson et al., 1986; Longnecker et al.,


1





2

1987; Longnecker et al., 1987; Roop et al., 1993). Once viral particles have entered the

cell, the nucleocapsid is transported to the nucleus to deposit viral DNA (Batterson et al.,

1983; Tognan et al., 1981). Along with the viral genome is the VP16 protein, which

functions in enhancing viral immediate-early gene transcription (Campbell et al., 1984;

Heine et al., 1974; Spear et al., 1972). HSV-1 encodes five immediate-early genes that

are expressed prior to viral protein production: ICPO, ICP4, ICP22, ICP27 and ICP47

(Mackem et al., 1982; Mackem et al., 1982; Post et al., 1981). The ICPO and ICP4

proteins initiate and regulate viral transcription (Everett et al., 1984; Everett et al., 1984;

Everett et al., 1987; Gelman et al., 1985; Gelman et al., 1986; Gelman et al., 1987;

O'Hare et al., 1985). ICP27 is also active in gene expression but acts at the level of RNA

transport from the nucleus into the cytoplasm (Sandri-Goldman et al., 1994). In order for

HSV-1 to replicate in neurons, which are non-dividing cells, the virus encodes many of

its own enzymes for DNA replication (Caradonna et al., 1981; Honess et al., 1974;

Honess et al., 1975; Huszer et al., 1981; Preston et al., 1984). These products are

generally included among the early genes of HSV-1.

Seven early genes are required for viral replication in all cell types and conditions:

DNA polymerase, DNA binding proteins, ORI binding protein and the helicase/primer

trimer (Chartrand et al., 1980; Coen et al., 1984; Hay et al., 1976; Honess et al., 1984).

A few other key early genes that include thymidine kinase, ribonucleotide reductase and

dUTPase are encoded and allow for replication in the neuronal environment (Caradonna

et al., 1981; Honess et al., 1974; Honess et al., 1975; Huszer et al., 1981; Preston et al.,

1984). Late genes begin to be expressed during DNA replication and are divided into 2

subclasses: leaky-late and strict late (Costa et al., 1985; Dennis et al., 1984; Everett et al.,





3

1984; Guzowski et al., 1993). The leaky-late gene products can be transcribed prior to

the conclusion of replication but strict late genes are only transcribed after replication has

completed. Regardless of these differences, late genes are mainly the structural products

of HSV-1 and include glycoproteins and capsid proteins.

Viral Infections in the Human Host

The majority of the U.S. and World population is infected with HSV-1. In most

cases, the virus does not induce a severe acute infection, but for a small percentage, it can

cause blindness or encephalitic death. Individuals infected with HSV-1 harbor a lifelong

latent infection in sensory and autonomic neurons, with occasional recurrences of an

acute infection at the site of initial infection. Latent infection of neurons results in the

replicative silencing of the HSV-1 genome. For the establishment of latency, after entry

of virus, a dramatic repression of gene expression must occur. Transcription of most

HSV-1 genes must be silenced, or restricted to very low levels with few transcripts being

expressed or detectable. During the maintenance stage of latency, the genome is present

as an episome within the nucleus of the cell (Mellerick et al., 1987; Rock et al., 1983;

Rock et al., 1985). Maintenance of HSV-1 latency involves the potential for latent

genomes to reactivate and produce infectious virus upon appropriate stimulus.

Reactivation from latency is believed to be a rare event and results in the reappearance of

infectious virus from sensory ganglia that travels back to the initial site of infection in the

epithelia. Clinical reactivation results in a lesion with detectable infectious virus.

Reactivation also has been determined to occur subclinically, with HSV-1 genomes

detected by PCR in the epithelia. It is unclear whether reactivation is lytic to neurons, but

the multiple occurrences of reactivation in the human population makes neuronal

destruction upon reactivation unlikely (Corey et al., 1996). It is more plausible that





4

reactivating neurons produce very low levels of infectious virus with high levels of

replication occurring in other cell types of the nervous system, or exclusively in the

epithelia. Lesions in the periphery form at a rate and with cytopathology that coincides

with rapid virus replication in cell culture (Stevens et al., 1975; Whitley et al., 1993).

In a suitable host, the immune system is an important regulator of HSV-1 severity.

During an HSV-1 infection in peripheral tissue, CD4+ cells function to activate and

recruit macrophages (Nash et al., 1993). CD4+ cells have also been shown to serve as

cytotoxic lymphocytes (CTLs) in culture. Important immunological players in the

nervous system are significantly different than other infected regions of the host during a

HSV-1 infection. CD8+ cells and IgG function to limit viral spread and severity of

infection (Kapoor et al., 1982; Simmons et al., 1987). It is important to note that infected

neurons are not targeted by CTLs and that their action in the nervous tissue appears to be

limited to non-neuronal cells. Although the involvement of the immune system functions

to reduce the severity of acute infection, it has been difficult to determine how the stages

of latency are affected by immune regulators. In many ways, sensory neurons are

immune privileged cells. With regard to regulation of the latent infection, most attention

has been directed away from the immune system and toward viral gene regulation and

expression.

In a latent infection of neurons, the latency-associated transcript is the only viral

RNA produced at readily detectable levels (Figure 1-1). The latency-associated transcript

(LAT) gene is positioned in the long repeat regions of the viral genome and is thus

diploid. During latency, two poly(A)- LAT products can be observed and have molecular

sizes of 2.0 and 1.5 kb (Spivack et al., 1998a; Spivack et al., 1998b; Wagner et al., 1988;





5

Wechsler et al., 1988). These products have been shown to be nuclear-localized, stable

introns (Farrell et al., 1994; Zabolotny et al., 1997) and are spliced from an 8.3 kb

primary transcript (Farrell et al., 1991). Stability of the introns is hypothesized to be due

to nonconsensus A or G branch point sequence and inhibits debranching of the lariat in

vivo (Rodahl et al., 1997; Tahl-Singer et al., 1997; Zabolotny et al., 1997). The 1.5 kb

intron is only observed in neurons, and is believed to be an alternative splice product of

the 2 kb intron (Zabolotny et al., 1997). The LAT promoter itself contains several

neuron-specific expression elements (Farrell et al., 1994; Morrow et al., 1994; Zwaagstra

et al., 1991), consistent with its high-level of expression in these cells (Dobson et al.,

1989). Further, in animal models, the LAT promoter demonstrates greater activity in

neurons and is specifically more active in neurons not expressing acute antigens

(Margolis et al., 1992). Since the LAT is the only viral transcript abundantly transcribed

during latency, its role in the establishment, maintenance and reactivation from latency in

the mammalian host has been sought. Because latency can only be established in vivo,

the use of animal models is required.

Animal Models

Several animal models are used in HSV-1 research that mimic the acute and latent

infections occurring in the human population. The mouse footpad model allows the study

of both acute and latent infections. In this model, the epidermis of the footpad is infected

which allows acute replication in this tissue. Infectious virus enters the nervous system

by infiltration of nerve termini located in the epidermis. Virus then travels by fast axonal

transport into dorsal root ganglia (DRG). In the sensory neurons of the DRG the virus

progresses down one of two paths: 1) acute replication and virus production may ensue;

or 2) genomes are silenced and latency is established. With a high viral dose, highly





6

virulent viral strain, or a virulence sensitive mouse strain, acute infection will spread to

the central nervous system where death of the animal may occur by encephalitis. The

mouse footpad model is especially useful for acute virulence experiments due to efficient

infection of epidermis and progression into the peripheral and central nervous systems. It

allows the study of both neuroinvasion and neurovirulence of HSV-1 strains and mutants

(Izumi et al., 1988; Izumi et al., 1990; Thompson et al., 1986). Neuroinvasion is the

ability of a virus to enter into and travel through the nervous system and is measured by

peripheral inoculation of the virus. Neurovirulence measures the ability of the virus to

replicate within neurons and is assessed by the lethality of viruses and their ability to

induce encephalitis.

The mouse footpad model is also utilized for latent analysis ofHSV-1, since the

virus efficiently establishes a latent infection in DRG. Reactivation can be studied in the

mouse model by the physical removal of DRG and incubation in cell culture media in a

process known as explant cultivation. Infectious virus is induced to emerge from these

sensory neurons and by placement upon a cell monolayer in culture the virus can be

readily detected (explant co-cultivation). Another mouse model for the study of HSV

latency and reactivation is the hyperthermic stress model. This model involves acute

infection of the cornea. After addition of virus on the cornea, HSV-1 then travels via

sensory axons to the trigeminal ganglion (TG) where a latent infection is established in

sensory neurons. Once a latent infection is established, latent virus can be reactivated by

placing the live infected mouse in a hyperthermic water bath set at 43C for 10 minutes.

Approximately 22 hours later, the TG are removed, sectioned and assayed for the

presence of virus by immunohistochemical methods (Sawtell and Thompson 1992). This





7

approach, and co-cultivation, does not adequately substitute for clinical reactivation since

virus detection in nervous tissue is very different from viral recovery in the periphery that

occurs in true reactivation. The mouse models have been useful in that they have

identified several aspects of the latent infection in vivo: identification of the neuron as

the site of latency, understanding of axonal transport of virus through the sciatic nerve,

the ability of non-replicating viruses to establish latent infections and characterization of

transcripts expressed during the stages of latency (Dobson et al., 1989; Kristensson et al.,

1971; Kwon et al., 1982; McLennan et al., 1980; Stevens et al., 1987; Wagner et al.,

1988).

Although the mouse models allow for the analysis of HSV-1 latency, the best

animal model would be one that allows reactivation to occur spontaneously but also

allows induction of reactivation with proper stress stimulus. Also, an ideal model would

result in the production of acute lesions at the periphery with the appearance of detectable

infectious virus. The mouse models require the physical removal of ganglia to detect

infectious virus. Latent infection and reactivation can also be induced in the TG of

rabbits upon corneal infection (Nesburn et al., 1967). From this discovery, the

spontaneous and inducible rabbit eye models were developed and function as superior

models for the study of reactivation since they allow for the detection of virus in the eye

after reactivation from the rabbit TG. The spontaneous model involves the detection of

random reactivation events by the sampling of tear film. The epinephrine-induced rabbit

eye model is one degree closer to the natural infection in humans than the spontaneous

model in that it is stress inducible. In this model, virus can be induced to reactivate by

application of current and epinephrine to the eye (Berman et al., 1985; Hill et al., 1986;





8

Hill et al., 1987a; Hill et al., 1987b; Kwon et al., 1981; Kwon et al., 1982). Viral

genomes within neurons of the TG reactivate and travel to the initial site of infection, the

eye. This model more closely mirrors the natural human infection in that infectious virus

can be recovered at the tissue initially infected with HSV-1 upon appropriate stress

stimuli. The rabbit models also are more discriminating than the mouse models in which

LAT mutants reactivate. Both the mouse model and the rabbit eye model have made it

possible to better understand the impact of the LAT upon the various stages of latency.

LAT Mutants and Phenotypes

From the use of animal models, the LAT has been shown to affect establishment

and reactivation phenotypes of latency. It has been proposed that the LAT may function

most directly on establishment and subsequently influence reactivation indirectly due to

decreased efficiency of establishment (Sawtell and Thompson 1992; Sawtell 1998;

Sawtell et al., 1998; Thompson and Sawtell 1997). When assayed with promoter reporter

viruses, it was determined that establishment of latent infections and the initiation of a

productive infection occur with the same kinetics (Margolis et al., 1992). This work also

identified four classes of neurons in the ophthalmic division of the trigeminal ganglion

that are susceptible to HSV-1 infection. These neuronal classes include substance P+,

CGRP+, LD2+ and SSEA-3+ neurons with the SSEA-3 (stage-specific embryonic

antigen 3) neurons to be the major class of these four to harbor a latent infection.

Additionally, with a similar reporter construct, the LAT promoter was shown to be most

active in both neuron number and intensity of staining during the acute stage of infection.

In this system, peak expression occurs in mouse trigeminal ganglia at 5-8 days post-

infection in concordance with the end of lytic infection and suggests a role in the

establishment of latency (Thompson and Sawtell 1997).





9



Establishment

As proposed by Sawtell and Thompson, the LAT is hypothesized to act upon the

latent HSV-1 infection at the establishment stage of latency. It has been shown that some

LAT mutants exhibit a reduction in the ability to establish a latent infection. In latently

infected neurons, the number of viral genomes has been calculated to exist in the range of

10-100 (Cabrera et al., 1980; Efstathiou et al., 1986; Hill et al., 1996; Rock et al., 1983;

Sawtell et al., 1997), although it is important to point out that the number of latently

infected neurons that express LAT is less than 30% of the total neurons that contain latent

genomes (Ecob-Prince et al., 1995; Ecob-Prince et al., 1993; Gressens et al., 1994; Hill et

al., 1996; Maggioncalda et al., 1996; Mehta et al., 1995). A LAT negative mutant,

KOS/62 derived from the KOS strain of HSV-1, was reported to have a reduced

reactivation phenotype and was attributed to a minor impairment of this mutant to

establish a latent infection. The number of latently infected neurons with the KOS/62

mutant was measurably lower than mice infected with the parental KOS (Sawtell and

Thompson 1992). In the comparison of latent genome numbers in neurons between high

reactivating strains of HSV-1 and low reactivators, a low reactivating strain, KOS, was

present in lower amounts than the strains 17syn+ and McKrae (Sawtell et al., 1998). In

support of the establishment findings, other laboratories have reported slight decreases in

establishment with LAT-negative mutants in murine eye models (Devi-Rao et al., 1994).

Indirect support for the role of LAT in establishment comes from the finding that LAT

expression in mouse DRG occurs at the end of lytic replication in neurons (Sawtell and

Thompson 1992).





10

Although some LAT mutations do alter the establishment of latency, these effects

are very low in magnitude. Also, most LAT mutants do not demonstrate measurable

establishment phenotypes and are not evident in both the mouse and the rabbit (Bloom et

al., 1994; Bloom et al., 1996; Jarman et al., 2002; Pemg et al., 1996). Specifically, the

establishment differences that have been reported are seen to occur only in the mouse,

and at most reflect 2 4 fold less viral DNA in the ganglia (Thompson and Sawtell

2001). Current understanding cannot rule out the action of the LAT on the establishment

of latency. It is possible that LAT does act in establishment and the lower levels of

establishment that have been observed may be due to an effect of LAT on down

regulating viral mRNA production in neurons (Garber et al., 1997).

Reactivation

The involvement of the LAT in any of the stages of HSV-1 latency has been shown

most conclusively for the reactivation phenotype in the epinephrine-induced rabbit eye

model. Initially, a HSV-1 mutant (X10-13) containing a large deletion encompassing the

LAT promoter and downstream region of the gene displayed a low level of reactivation in

the rabbit eye model (Hill et al., 1990). The reactivation phenotype was restored by use

of an EcoRI J+K subgenomic clone encompassing the LAT locus (Hill et al., 1990). A

smaller, engineered deletion of the core promoter (17APst) of LAT displayed a severe

reduction in reactivation (Bloom et al., 1994) and another group supported this finding

with a similar but independently constructed mutant (Pemg et al., 1994). In addition to

deletions that included the LAT promoter, it was shown that only a limited region of the

LAT primary transcript is required for efficient induced reactivation. Bloom et al.

(Bloom et al., 1996) showed that insertions of polyadenylation signals between the cap







site and the 3' end of LAT resulting in termination 1,500 base pairs from the cap site had

no impact upon reactivation (Bloom et al., 1996) and accumulation of the 2.0 kb LAT

intron has also been shown to not be required for reactivation (Jarman et al., 2002). The

17A348 mutant which contains a mutation engineered into the 5' region of exon 1 did

exhibit severe decreases in reactivation (Bloom et al., 1996). Another mutant, 17ASty,

partially overlaps the 17A348 mutant and is also reactivation impaired (Hill et al., 1996).

These mutations in exon 1 do not affect the transcriptional activity of the LAT promoter

and do not reduce the expression of the LAT introns. From these findings in the

epinephrine-induced rabbit eye model, the reactivation critical region (RCR) of LAT has

been mapped to the 5'region of exon 1 of the LAT gene.

Mutations in 5'region of exon 1 result in a dramatic reduction in the frequency of

induced, and spontaneous virus shedding in the tear film of infected rabbits. LAT null

mutants have also been shown to reactivate at reduced frequency in TG of mice (Sawtell

and Thompson 1992; Thompson and Sawtell 1997). With regard to mechanism, one

hypothesis is that the LAT gene may function directly to promote viral reactivation. LAT

has been shown to be actively transcribed in neurons during the latent state, which would

suggest a role in maintenance or reactivation. Examination of the sequence of LAT exon

1 found a surprisingly large occurrence of CpG motifs that suggested that LAT gene

transcription could be controlled by methylation (Bloom et al., 1996). It was shown,

however, that expression of the LAT gene is not influenced by a methylation mechanism

(Kubat et al., 2004). It is possible that LAT+ cells may only represent a small fraction of

latent neurons and could play a repressive role on reactivation. Recent data from our lab

suggest that the LAT is actively down-regulated 0.5-4.0 hours post-explant co-cultivation





12

and this may be due in part to a change in the acetylation profile of the region

(O'Neil/Kubat, in preparation). One could speculate that active LAT expression is not

compatible with reactivation, and its downregulation may in turn stimulate, or allow the

downstream, opposite strand regulatory protein, ICPO to be transcribed and initiate a lytic

cascade. Clearly, the LAT region has important regulatory implications for the regulation

of lytic and latent infections, and these will be discussed in further detail in the following

sections.

Other Regulatory Regions of LAT

The promoter responsible for expression of the 8.3 kb primary LAT transcript has

been shown to possess multiple control elements including cyclic AMP response

elements (CRE), CAT box, Spl, USF, YY1 and AP-2 sites (Kenny et al., 1994; Soares et

al., 1996; Wechsler et al., 1988; Wechsler et al., 1989; Zwaagstra et al., 1991). This

latent promoter has enhanced promoter activity in cells of neuronal origin (Zwaagstra et

al., 1990). It has been suggested that the LAT gene may encode an alternative, or

cryptic, downstream promoter element separate from the latent promoter that may be

active during acute viral replication (Nicosia et al., 1994; Goins et al., 1994). This

alternative promoter has been indicated by transient transfection assays and roughly

localizes to a region 5' of the 2.0 LAT intron splice donor site. The presence of a

neuronal enhancer approximately 60 base pairs downstream of the transcription start site

has been identified (Soares et al., 1996). This promoter has been incorrectly labeled as a

second latent promoter. It is clear that the promoter is active during the lytic infection

and not during latency (Soares et al., 1996). This region may play a very important role

in the acute phase of HSV-1 infection and the characterization of this downstream region





13

of the LAT gene may help to explain early events in latency or the reactivation from a

latent infection.

Neuronal Survival and Apoptosis

The region responsible for the reactivation phenotype of LAT has been well

mapped but the LAT gene may contain other regulatory motifs that control establishment

or functions in the acute infection. LAT may also play a role in neuronal survival and

apoptosis (for review see Bloom 2004). Portions of the LAT gene have been shown to

inhibit neuronal cell death and may function through suppression of receptor-mediated

(caspase-8) and mitochondrial-mediated (caspase-9) pathways. Results from in vivo

studies demonstrate that a large deletion of the promoter extending into the LAT intron

are reduced in establishment levels and cause a significant loss of sensory neurons (Perng

et al., 2000; Thompson and Sawtell 1997). Transient transfection of IMR-90 and CV-1

cells with a plasmid containing the 3' region of the LAT exon and most of the intron was

able to protect the majority of cells from ceramide, or fumonisin Bi-induced apoptosis

(Perng et al., 2000; Thompson et al., 2000). Expression of the bovine herpesvirus 1 LAT

(Perng et al., 2002) or portions of the HSV-1 LAT gene inhibit chemically induced

apoptosis in cell culture (Perng et al., 2002).

The anti-apoptotic effects of large portions of the LAT expressed by transfection

are also cell specific. In culture, the LAT is unable to protect 293, or COS-7 cells from

apoptosis (Inman et al., 2001). It is clear that the LAT does induce apoptosis in certain

cell lines using transient transfection assays with high multiplicities of infection and high

expression levels (Perng et al., 2000). These results indicate that the LAT may play a

role in apoptosis but it has not been conclusively shown to occur in vivo. It was reported

that LAT(-) viruses induce extensive apoptosis in rabbit TG (Perng et al., 2000) and that





14

the LAT gene promotes neuronal survival by reducing apoptosis. The apopotosis results

have been questioned due to incompatible reagents used in the p85 PARP and TUNEL

assays used to suggest an in vivo apoptotic role for the LAT (Thompson and Sawtell

2000). Another large LAT deletion mutant (17-AH) when used in the infection of the

mouse eye model showed a depletion of over half the TG neurons. Apoptosis in HSV-1

infected ganglia during lytic infection has been demonstrated. The 17N/H mutant

overlaps the impairment engineered in the 17-AH mutant but extends further into the

intron. Use of this mutant resulted in the loss of neurons as measured by an increase in

TUNEL-positive TG neurons (Ahmed et al., 2002), though the total numbers of TUNEL-

positive cells were low.

The LAT has been proposed to promote neuronal survival and consequently leads

to high levels of establishment (Thompson and Sawtell 2001). If this is true, then LAT(-)

viruses would be expected to demonstrate a reduced level of replication in sensory

ganglia and would have altered virulence phenotypes in the mouse. A possible reason

that this has not been observed is due to the impairment of several regulatory regions in

the construction of most of the relatively large LAT deletion mutants reported in the

literature. The LAT has been shown to influence reactivation, establishment, apoptosis in

cell culture and may affect neuronal survival. The reactivation phenotypes associated

with the LAT have been well mapped but the positions of other regulatory regions in the

LAT region are still uncertain. Mutants that have been used to show anti-apoptotic

include very large deletions that also affect the region of LAT known to function in

reactivation. To identify and characterize the motifs of LAT involved in the lytic





15

infection, it is necessary to construct discrete mutations beyond the reactivation critical

region.

The 17A307, 17A307R, 17A480 and 17A489 mutants (Figure 1-1) were generated

in the lab of Dr. Ed Wagner (U. C. Irvine). Characterization of these viruses with respect

to latency was performed by Dr. Jim Hill (L.S.U. Eye Center) by use of the epinephrine-

induced rabbit eye model. The 17A307, 17A307R, 17A480 and 17A489 mutants were

tested for reactivation differences in comparion to 17syn+ (parental) and 17APst

(promoter mutant). From these experiments, it was determined that 17A307 was reduced

in its ability to reactivate in the rabbit model in comparison to its rescue, 17A307R, and

17syn+. Mutants 17A480 and 17A489 did not display a reactivation restriction. All

results are shown in Table 1-1. Establishment was also determined by quantitative PCR

in rabbit TG with no significant difference detected between 17A307 and 17A307R (see

Table 1-2).

Based on these data we hypothesized that a downstream portion of LAT outside of

the reactivation critical region influences the acute infection. We demonstrated here that

mutation of this region of LAT results in a decrease in virulence in the mouse model.

Additionally, we believe that the HSV-1 recombinants with the large LAT deletions used

by Sawtell and Thompson as well as Wechsler (Figure 1-2) mask dramatic virulence

effects due to the impairment of multiple regulatory elements of the LAT locus. To

examine the possibility that LAT influences acute infection and/or early times in the

latent infection, we generated an additional series of mutants in a region of LAT 3' of the

reactivation critical region. These mutants allowed us to test the involvement of the 3'

end ofexon 1 and the intron upon latent and acute phenotypes of HSV-1. From the





16

secondary promoter and apoptosis/neuronal protection findings described above, regions

of the LAT gene neighboring the reactivation critical region may act in the acute

infection ofHSV-1. This action may be through a trans-mediated effect from lytic

transcription, or it may be mediated in cis as an enhancer function. An enhancer scenario

is quite possible, since the reactivation function of the LAT gene is hypothesized to

operate in a similar manner (Wagner and Bloom 1997). The small, downstream deletions

of viruses 17A307, 17A307R, 17A480, 17A480R and a double mutant 17APstA480 allow

the determination of virulence properties of the LAT locus without also impairing other

defined regulatory functions of LAT that may mask a full virulence effect. The results

presented in the following chapters put forth a case for two distinct genetic elements

within the LAT gene: one (controlled by the LAP1 or latent promoter) that seems to act

as a facilitator of reactivation; and a second that may encompass the LAP2 promoter that

exerts its influence on virulence during the acute phase of the infection. The data

presented here demonstrating the dramatic reduction in virulence in the mouse following

deletion of a region spanning the 3' end of the 5'exon and the first several hundred bases

of the region encoding the LAT intron is the first description of a major virulence

phenotype mapping to the LAT gene. Our results also indicate that this phenotype is

independent of the LAT promoter (LAP1). Finally, as discussed in detail in the last

chapter, we hypothesize that the deletion of these two distinct genetic elements in vivo

results in a phenotype distinct from deletion of either element individually, suggesting

these elements work together in regulating some aspect of acute replication.





17









RL UL RL Rs Us Rs



--..-------------- 8.3 kb primary LAT transcript
---------------- -- ---_-------..--

exon 1 ------
intron

17A307
17APst
17A480

17A489

Figure 1-1. Schematic of the LAT gene and the position of 17APst, 17A307, 17A480 and
17A489 recombinant viruses. The location of the LAT primary transcript is
shown along with its location in the HSV-1 genome. The promoter, exoni
and the 5' intron of LAT are depicted at the bottom of the figure along with
recombinant LAT viruses.





18




RL UL RL Rs Us Rs






S8.3 kb primary transcript

exon 1
intron



dLAT2903 (Pemg 2000)




17A-H (Thompson 2001) Region of Mutation
Region of Mutation |



Figure 1-2. Large LAT deletions used for virulence indications. An impact of the LAT
locus upon virulence has been implied by use of a couple of LAT deletion viruses. These
deletion viruses delete a large portion of the LAT locus and possibly remove several
regulatory regions in the LAT gene.





19

Table 1-1. Analysis of the 5' LAT deletions on reactivation in the rabbit eye modela

Positive Positive Total positive
Recombinant rabbits /total eyes/total eyes swabs/total swabs
rabbits


17syn+ 5/5 (100%) 8/9 (89%) 24/72 (33%)


17APst 2/8 (25%) 2/16 (13%) 5/105 (5%)


17A307b 2/8(25%) 3/16 (19%) 6/112 (5.4%)


17A307R(Rescue) 4/4 (100%) 5/8 (63%) 14/64 (22%)


17A480 8/8 (100%) 12/16 (75%) 27/70 (39%)


17A489 4/5 (80%) 6/10 (60%) 29/70(41%)


aReactivation was measured by the level of infectious virus by plaque assay detected
from tear film of infected rabbits. In this model, the rabbit eye is infected with HSV-1
with the virus traveling to the TG and establishing a latent infection. Reactivation is
stimulated by the administration of epinephrine and current to the rabbit eye. Infectious
virus is then detectable at the initial site of infection, the eye.
bIontophoresis was performed once a day for three consecutive days. Eye swabs were
performed for 7 consecutive days.
c17A307 is significantly different from 17syn+.





20

Table 1-2. The ratio of HSV to actin DNA in rabbit trigeminal ganglia
latently infected with 17A307 and 17A307R mutants of HSV-la
Rabbit infected with Ratio HSV to Rabbit infected with Ratio HSV
17A307 Tattoo(side) Actin DNA 17A307R Tattoo(side) to Actin
DNA
G2(od) 0.57 G23(od) 0.51
G2(os) 0.25 G23(os) 0.34
G3(od) 0.83 G24(od) 0.37
G3(os) 0.42 G24(os) 0.64
G4(od) 0.5 G28(od) 0.19
G4(os) 0.31 G28(os) 0.522
G6(od) 0.5 G32(od) 0.46
G6(os) 0.41 G32(os) 0.59
G8(od) 0.5 G34(od) 0.38
G8(os) 0.42 G34(os) 0.63
G9(od) 0.52 G35(od) 0.29
G9(os) 0.58 G35(os) 0.44
G1O(od) 0.36
G1O(os) 0.48
Average ratio = 0.480.14 Average ratio = 0.450.14
aThe 17A307 LAT recombinant virus was tested by semiquantitative PCR from
differences in establishment in comparison to its rescue, 17A307R. Values were plotted
for the HSV-1 gene DNA polymerase as a ratio to cellular rabbit actin DNA. From
measurement of the ratios between 17A307 and 17A307R, no detectable differences in
establishment were observed.












CHAPTER 2
METHODS

Technical details of the experiments used to generate the data presented in this

work are discussed in this chapter. The experiments were aimed at the generation of viral

recombinants and use of these mutants for characterization pertaining to virulence and

latency of HSV-1 in cell culture and animal models. This characterization involved

assessing virulence in the mouse model along with supportive replication data obtained

from cell culture assays. The examination of reactivation from and establishment of

latency were carried out at the LSU Eye Center by Drs. Jim Hill and Jeannette Loutsch,

and these results are summarized in chapter 1 (Table 1-1 and 1-2). In the determination

of virulence, the methods of creating viral recombinants by transfection, growth of

mutants in culture and infection and viral quantification from the animal models are

presented here in full.

Viral recombinants were constructed by use of homologous recombination in cell

culture. Recombinants were produced by either co-transfection of HSV-1 virion DNA

with a PCR fragment for recombining into full length genomic DNA (i.e. 17A480R), or

by co-infection with two HSV-1 LAT mutants (i.e. 17APstA480). The full length viral

genomic DNA was prepared in cell culture. A group of 8-10 T-150 flasks were infected

with the HSV-1 parental, or mutant strain of choice, at a multiplicity of infection (MOI)

of 0.01. Infections were maintained and monitored for 3 days until the cells were

completely detached. At this point, the suspension was removed and pelleted in a high

speed centrifuge at 16,000 x g for 40 minutes at 4C. The supernatant was removed and

21





22

the pellet was resuspended in 10 mL ofhypotonic lysis buffer (10 mM Tris pH 8.0, 10

mM EDTA, 0.5% NP-40 and 0.25% deoxycholic acid). This subsequent suspension was

vortexed, incubated briefly on ice and centrifuged at 3000 x g for 10 minutes at 40C to

pellet the nuclei from the fraction containing the viral DNA. After centrifugation, the

supernatant was removed and treated with a protein degradation solution (1% sodium

dodecyl sulfate and 1 mg/mL Proteinase K) at 500C for 1 hour. An additional 1 mg of

Proteinase K was added and the incubation was repeated an addition hour at 37"C to

further digest the protein in the sample. After this treatment, the solution was extracted

with sequentially with equal volumes of phenol, phenol/chloroform and chloroform. To

precipitate the full length viral DNA, the solution was treated with a 0.1 volume of 3M

sodium acetate and carefully layered with 25 mL of cold 95% ethanol. The DNA was

precipitated at the aqueous/ethanol mixing interface with moderate rotation by hand.

Once an appropriate amount of genomic DNA was visible, it was removed by spooling,

washed briefly with 70% ethanol, dried, resuspended in 100-500 pl of sterile water. The

DNA was quantified spectrophotometrically and the genomic quality of the DNA was

assessed by electrophoresis on an agarose gel. Full length viral DNA was then ready for

use in transfections to produce recombinant HSV-1 mutants.

Transfections utilized varying ratios of genomic DNA with a fixed amount of

plasmid, or PCR generated DNA where applicable. For this procedure, 60 mm2 dishes of

rabbit skins cells at 50% confluency were serum starved (1.5% calf serum, MEM)

overnight at 31.5"C in 5% CO2. The viral genomic DNA was used in a range of of 1, 2,

4, 8, 16 and 32 jg in addition to a 2 |jg amount ofrecombining DNA per dish. Each

transfection mix was prepared in a final volume of 225 jil of TNE buffer (10 mM Tris pH





23

7.4, 1 mM EDTA and 0.1 M NaCI). Upon dilution of the DNA into TNE, 25 ptl of CaCl2

was added per mix. DNA was precipitated by the administration of 250 pl of 2X HEPES

along with CO2 for pH adjustment. This DNA solution was incubated at room

temperature for 30 minutes. The transfection mix was then added to the dishes and

incubated at 25"C for 20-30 minutes. Media in a 5 mL volume was applied to the dishes

and transferred to 37C for 4 hours. The media was then aspirated and the cells were

hypotonically shocked with 1-2 mL of shock buffer (1X HEPES, 20% dextrose) for 60

seconds. The cells were briefly washed and 5 mL of media was added to the dishes.

Once these transfections were performed, viral infection was allowed to persist to full

cytopathic effect, usually 2-3 days post-infection. After the monolayer was depleted and

detached due to viral infection, any remaining cells were scraped and the entire solution

was vortexed and stored at -80C. This viral stock was frozen (-80C) and rapidly

thawed (37C) twice before isolating individual plaques.

Viruses produced from the transfections were detected and isolated by plaque

purification. Confluent 60 mm2 dishes of RS cells were infected with a series of dilutions

ranging from 10-3 to 10"8 in order to obtain dishes with well-isolated plaques. After a 1

hour inoculation, the infected dishes were covered with an overlay consisting of 1X 5%

calf serum MEM and 0.8% agarose. This solid overlay allowed the maintenance of the

monolayer during the infection and functioned to limit spread of virus through the

monolayer, allowing for discrete plaque formation and subsequent plaque isolation.

Infections were maintained and monitored for 2-3 days. Once plaques were visible, the

dishes were stained for 3 hours with neutral red at a 1:30 dilution. The neutral red stain

was absorbed by living cells and consequently left the plaques white. This contrast





24

allowed for easy visibility of plaques for picking with a Pasteur pipette. The plaques

were picked and each individual plaque was transferred to its own well of a 96 well plate

containing 200 pl of media per well. This plate was then frozen and thawed twice (-

800C/370C) and a 50 p volume was used per well to infect a 96 well plate that was

previously seeded with RS cells. Infection of this plate was allowed to proceed for 2-3

days (until 100% CPE) and was then frozen at -80C.

The recombinant viruses were screened by dot blot hybridization after each round

of plaque purification to determine the proper mutation has been engineered. In this

approach each 96 well plate that was infected with individual isolates per well was

thawed at 370C prior to the transfer for hybridization. On the bottom piece of the dot blot

apparatus, 3 layers of Whatman paper were applied followed by a section of Hybond

nitrocellulose membrane. The Whatman paper and the membrane were saturated with

solution C [(2X SSPE (0.36M sodium chloride, 0.02M sodium monophosphate, 0.002M

ethylene diaminotetraacetate)]. The dot blot apparatus was then sealed tightly and a

vacuum was applied. At this point, 50 pl of inoculum from each well of the 96 well plate

was transferred through the holes in the top of the dot blot apparatus and onto the

membrane. Each well in the dot blot manifold was subsequently washed with 200 pl of

fresh solution A (1.5M sodium chloride, 0.1N sodium hydroxide) followed by an equal

application of solution B (0.2M Tris, pH 7.5) and solution C. The nitrocellulose

membrane was then removed and baked in a vacuum oven for 1-2 hours at 80C. The

DNA was then covalently attached to the membrane and ready for labeling with

radioactive 32P [a-dCTP] probe.





25

Probes were created using the portion of DNA that identified the presence of the

proper mutation in the recombinant virus. To make the probe, 25 ng of DNA was diluted

to a total of 45 1l in TE (10mM Tris ImM EDTA, pH 8.0) and boiled in a water bath for

5 minutes. The DNA was then quickly transferred to ice and incubated for 5 minutes.

After this period, the DNA solution was added to a reaction tube from the RediprimeTM II

Random Prime Labelling System (Amersham Biosciences). A 50 LCi amount of32P [a-

dCTP] was also added and the reaction was performed at 37C for 10 minutes. The

reaction was quenched with the introduction of 5 ul of 0.2M EDTA. This probe was then

boiled for 5 minutes, placed on ice for 5 minutes and ready for use. Prior to the addition

of the probe to the hybridization, the blot itself was pre-hybridized at 63 C for 1 hour in a

shaking water bath to reduce nonspecific DNA labeling. After the pre-hybridization step,

the probe was added and the blot hybridized overnight at 630C. The next day, the blot

was washed twice with solution 1 (0.3M sodium chloride, 0.06M Tris-HCl pH 8.0,

0.002M EDTA) at 250C for 5 minutes, twice with solution 2 (0.3M sodium chloride,

0.06M Tris-HCl pH 8.0, 0.002M EDTA, 4% SDS) at 630C for 15 minutes and finally

twice with solution 3 (0.03M sodium chloride, 0.006M Tris-HCI pH 8.0, 0.0002M

EDTA) at 250C for 15 minutes. The blot was then dried briefly and covered with plastic

wrap before being exposed 8-12 hours on a Phosphor screen. Hybridization was then

visualized using a STORM phosphoimager (Molecular Dynamics, Sunnyvale, CA) in

order to identify the presence of the proper recombinant virus. This concludes the

general aspects of transfection and hybridization approaches used. The specific details of

the 17A480R and the 17APstA480 construction are described next.





26

LAT Recombinant Viruses

The HSV-1 recombinants 17APst, 17A307, 17A307a, 17A307R, 17A480, 17A480R

and 17APstA480 were all engineered by homologous recombination. Plasmids

containing the mutated regions were transfected into rabbit skin cells along with full

length 17syn+ HSV-1 genomic DNA. 17A307, 17A307a, 17A307R, 17A480 and 17A489

were constructed in the laboratory of Dr. Ed Wagner at U.C. Irvine. These recombinants

replaced portions of the LAT gene with stuffer DNA sequence and consequently retained

the size and spacing of the LAT gene. 17A480 and 17A489 contain inserted DNA from

the lacZ gene into the either the PpmuI-SfiI site for 17A480, or the SfiI-HpaI location for

17A489. The mutants 17A307 and 17A307a also contain stuffer sequences. 17A307 has

a polyadenylation sequence from SV-40, whereas the native DNA for 17A307a has been

replaced with a polyadenylation sequence from rabbit P-globin. The mutant 17APst is a

202 base pair clean deletion of DNA between the Pst I sites in the core latency promoter

of the LAT gene. This mutant was created in the Stevens lab at UCLA and has been

described previously (Bloom et al., 1994).

17A480R

For in vivo and cell culture experiments, it was critical to make two additional LAT

mutants. First, the fact that the phenotypes for the 17A480 were the result of the 480 bp

deletion was confirmed by the construction of a rescue of this virus (17A480R). This

rescue was generated by homologous recombination using a 1.2 kb DNA PCR product.

The PCR reaction was performed with oligonucleotides 17AB1R

(5'GAGATGAACACTCGGGGTTAC 3') and 17AB2R

(5'CGGACTBACCTGGCCTCTGG 3'). These primers begin at positions 119,181 and





27

120,347, respectively, in the 17syn+ genome and are shown schematically (Figure 2-1).

The amplified DNA was co-transfected with full length 17A480 DNA into RS cells. At

3-4 days post transfection, the cells were lysed by 2 rapid freeze/thaw (-800C/370C)

cycles and plated onto confluent 60 mm2 dishes of RS cells at varying dilutions of 10.3 to

10-8. These dishes were overlayed with a solution containing 0.8% SeaKem Agarose and

1X 5% calf serum MEM for 3 days. At this time, cells were stained with neutral red and

plaques were observed by absence of stain. Approximately 300 well-isolated plaques

were picked and tested by dot blot hybridization for the presence of the restored wild-

type sequence at the PpmuI-SfiI location (Figure 2-2). The HSV-1 viruses 17syn+ and

17A480 were included on the blots to serve as positive and negative controls,

respectively. Several positive plaques were detected after the first round of plaque

purification. Five of these positive samples were diluted and infected onto confluent 60

mm2 dishes ofRS cells. After the third round of purification, all plaques were positive.

To guarantee the purity of the 17A480R plaques, a couple of plaques were carried out for

a fourth round of purification which again yielded complete positives.

17APstA480

Another recombinant virus, 17APstA480, was engineered to complete the analysis

of the genetic basis of the virulence phenotype within the LAT locus in the mouse model.

As the name implies, this mutant contains mutations in both the latent promoter of the

LAT (APst) coupled with a mutation in the 5' portion of the LAT intron (A480). This

mutant was constructed by performing a co-infection of 17APst with 17A480 at an m.o.i.

of 3.0 for each virus in a T-75 flask of confluent rabbit skin cells. Plaque purified

isolates were tested by dot blot hybridization. In each round of plaque purification, each





28

96 well plate was blotted onto membrane in duplicate. One blot was tested with a probe

for the lacZ DNA present in the 480 region of the 17A480 mutation, and the other blot

was tested for the presence of the LAT promoter region (202 bp PstI fragment) from

wild-type HSV-1 strain 17syn+. If both mutations were correct in the 17APstA480 virus,

then plaque isolates would be positive when hybridized with the lacZ probe and negative

with the Pst region probe (Figure 2-3). Critical controls included in this analysis were the

inclusion of 17A480 and 17APst. In use of the lacZ probe, the 17A480 control produced a

positive signal and the 17APst remained negative. For the use of the Pst probe, the same

was also true, since the 17A480 mutant retained wild-type sequence at the latent promoter

and the 17APst mutant had the 202 bp PstI region removed.

In performing dual probing of 17APstA480 possible plaque isolates, a few viruses

were determined positive for the lacZ fragment and negative for the PstI fragment in

comparison to controls. After the first round of screening, a few properly hybridizing

isolates were selected and subjected to another round of plaque-purification. From the

second round of selection, approximately 30% of isolates produced desired hybridization

signals. Two of these samples were selected and put through another round of

purification. At this third round, 100% of samples were lacZ fragment-positive and PstI

fragment negative. To be certain of purity, two samples were taken into a fourth round of

purification and resulted again in 100% of isolates positive for lacZ and negative for the

PstI fragment. To prove that the PstI fragment-negative control contained adequate viral

DNA to be detected, it was included as a control in the final round of the 17A480R

plaque purification. This sample produced signal intensity equal to the other positive

control, 17syn+.





29

Analyses In Vivo and Cell Culture

The LAT mutants 17APst, 17A307, 17A307a, 17A307R, 17A480, 17A480R and

17APstA480 were tested for virulence phenotypes in the mouse model. After determining

the phenotypes of these mutants in vivo, they were also characterized using a cell culture

system. The cell culture experiments involved two different cell lines, PC-12 cells and

RS cells. These cell types and their experimental usage is described later in this chapter.

Virulence Determination in Mouse Model

The virulence determination of the engineered LAT mutants was performed by

LD5o/pfu analysis. For these experiments, female 4-6 week old out-bred Swiss Webster

mice were used. Virulence was measured by footpad infection and by direct intracranial

inoculation. For the footpad infection, each footpad of anesthetized mice was injected 4

hours pre-infection with 50 pl 10% (w/v) sodium chloride. At the appropriate time, mice

were then sedated with 0.010-0.020 mL of a cocktail containing xylazine (7.5-11.5

mg/kg), acetamine (2.5-3.75 mg/kg) and ketamine (30-45 mg/kg). The keratinized layer

of the footpad was then removed with mild abrasion using an emery board, and viral

dilutions (in MEM with 5% CS) were applied onto the ventral footpad surface in volumes

of 50 pl. The mice were then placed back into their cages in an inverted manner to allow

virus absorption and monitored until they regained consciousness and became active.

Infected mice were then observed twice daily until hind limb paralysis ensued in which

case they were euthanized, or until they died from encephalitic HSV-1 infection. After

two weeks, mice were scored for lethality and LDso/pfu values were assessed by the Reed

and Muench method (Reed and Muench 1938). Surviving mice were assessed for the

presence of latent virus by PCR.





30

Mice were also tested for virulence phenotypes by direct intracranial infection with

the appointed LAT mutants. These mice were sedated in the same manner as the footpad

experiments. Infection was performed by direct administration of virus into the left

cerebral hemisphere in volumes of 20 L of inoculum by use of a 1.0 mL syringe and a 27

gauge needle. These mice were also observed until conscious and active and were

checked twice daily for signs of nervous system impairment, or encephalitic death.

Tissue Restriction

The relative ability of the LAT recombinants to replicate in the feet, DRG, spinal

cord and brain was assessed following footpad inoculation. This analysis was performed

as a time course and for each time point, tissue and virus, samples were examined in

replicates of 3. The time points tested included 2, 3, 5 and 7 days post footpad

inoculation. At each of these times, all 4 of the designated tissues were removed and

homogenized in MEM containing 5% calf serum. The homogenates were diluted and

titered on confluent 24 well plates of RS cells in the presence of technical grade human

IgG to prevent viral spread through the monolayer. Plaques were counted at 2-3 days

post-infection and viral levels were calculated for each virus and tissue for the 4 time

points.

Time Course Experiments

Mutants 17APst, 17A307, 17A307a, 17A307R, 17A480 and 17A480R were tested

for infectious virus production in cell culture along with parental virus 17syn+.

Infectious virus levels were assessed in RS and PC-12 cells (rat pheochromocytoma cells)

in both multi-step and single step growth curves. The PC-12 cells are developmentally

linked to neurons and represent a specific cell type of the nervous system (Pizer et al.,





31

1978; Rubenstein et al., 1983). For the multistep growth curves, cells were infected at a

multiplicity of infection of 0.001 and infections were terminated and quantified by plaque

titration at hours 8, 24, 48, 72 and 96 hours post-infection. Each time point virus-' was

performed in triplicate. The single step growth curves were carried out in a similar

manner but with a higher multiplicity of infection (3.0). The time points were also

different and included 0, 3, 6, 12 and 18 hours post-infection. For this experiment,

samples were also tested in triplicate with titrations being performed on RS cells in the

presence of human IgG. Resulting plaques were counted and infectious virus levels were

thus quantitated.

The experimental techniques described in this chapter were used to test the HSV-1

LAT mutants 17APst, 17A307, 17A307a, 17A307R, 17A480, 17A480R, RHA-6 and

17APstA480 along with parental control, 17syn+ in the mouse model. These experiments

were aimed at the determination of the role of the 3' portion of LAT exon 1, and to

determine if a phenotype can be attributed to the 5' intron. The next chapter is dedicated

to the report of virulence, tissue restriction and cell specific infectious virus reduction

phenotypes obtained for these mutants.





32


RL UL RL Rs Us Rs

................ ....
Intron(s)

Latency associated
transcripts







119181 119502 119981 120347

PstI PstI 17A480 (Ppmu SftI)
....................... I ........................ I '

I I 480 bp
Sty I Sty I 321 bp 366 bp'


splice donor
119,463


Figure 2-1. 17A480R construction. The 17A480R recombinant virus was made by
co-transfection of a PCR amplified portion of the parental virus, 17syn+,
between genomic base pairs 119,181 and 120,347 and genomic 17A480
DNA. The 17A480R recombinant was screened by dot blot
hybridization.





33




















17syn+ 17A480

Figure 2-2. Dot blot hybridization of second round plaque purification of 17A480R. This
figure demonstrates that by the second round of plaque purification, most of
the viruses are positive for the region of the LAT gene corresponding to the
region that was altered in the 17A480 recombinant.






34

A.



















17A480 17APst
B.





















17A480 17APst

Figure 2-3. Dot blot hybridization of second round plaque purification of 17APstA480.
A) The blot at the top of the page was probed with a lacZ probe. B) The
bottom blot was probed with a Pst probe in order to identify 17APstA480
recombinants.












CHAPTER 3
RESULTS

In our pursuit to further understand the function of the LAT locus in HSV

biology, we made recombinant virus 17A307 deleted of a 307 bp fragment in the 3'

region ofexon 1 (Figure 1-1). The native region of HSV-1 LAT exon 1 was removed by

homologous recombination and replaced with DNA stuffer from a SV40 polyadenylation

sequence. This recombinant virus contained alterations 3' of a region that mapped to the

general region that we had evidence was involved in reactivation. To test the impact of

this portion of the LAT on reactivation from latency, we utilized the epinephrine-induced

reactivation rabbit eye model. Results showed that the 17A307 recombinant virus

exhibits a reduced reactivation phenotype (Table 1-1).

Additionally, it was observed that the 17A307 displayed reduced cornea scarring in

comparison to 17syn+ (parental virus) and 17APst (promoter mutant) at early times post

infection (Figure 3-1). This indicated that the 17A307 recombinant was altered in

pathogenesis due to the 307 bp deletion, or due to secondary mutations outside of the

LAT region. To test this second possibility, a second 17A307 virus was engineered

(17A307a). This recombinant is the same as the original 17A307, except that it contained

a stuffer sequence from the rabbit j globin gene (rabbit B-globin poly A region). Along

with the 17A307a recombinant, a corresponding rescue was made, 17A307aR. These

viruses were once again tested in the epinephrine-induced rabbit eye model for

reactivation effects and demonstrated reduced reactivation (Table 1-1). These results



35





36

indicated that the 17A307 virus was not only restricted in reactivation, but unlike the

LAT promoter mutant 17APst, had alterations in corneal pathology suggesting that it

might possess attenuated virulence or pathogenesis properties.

The mouse footpad model was used to test the virulence profile of the 17A307

recombinants. The rabbit model is a superior model for reactivation due to its close

parallel to the natural infection as described in chapter 1. For virulence studies, however,

the mouse footpad model is more useful due to the ability to infect larger sample sizes,

while also conserving many characteristics of natural HSV infection. The footpad

infection allows initial infection of the epidermis of the foot. Virus then enters the

peripheral nervous system via nerve termini present in the epidermis. Once in the

nervous system, virions progress to the body of the neurons in the dorsal root ganglia

(drg). From the DRG, HSV can then enter the central nervous system and progress

through the spinal cord to the brain. Infection in the CNS can lead to death resulting

from encephalitis.

LDso/pfu Evaluation

Initially, the 17A307 recombinant viruses were tested for virulence by LDso

(calculation of viral dose in plaque forming units required to kill 50% of animals in a

group) in comparison to 17syn+ (parental), 17APst and 17A307aR. Results in the mouse

showed that the 17A307 viruses did display a dramatic virulence phenotype. It is

important to note that the 17A307 mutation principally alters the 3' end of exon 1 but it

also changes the first 6 base pairs of the splice donor site. Additionally, the stuffer DNA

is a polyadenylation signal in the case of each 17A307 recombinant and the virulence

results could have been due to a RNA mediated effect. To answer these questions, I set





37

out to create additional 17A307 recombinants that do not mutate the splice donor site, or

any portion of the intron. I also planned to insert the polyadenylation sequences in each

orientation to test for a RNA directional effect. Prior to engineering and testing these

new 17A307 recombinants, we wanted to repeat the LDso experiments with the inclusion

of additional controls.

The LAT recombinants 17A307, 17A307a, 17A307aR, 17A480 and 17A489

(Figure 1-1) were analyzed for virulence phenotypes by use of the mouse footpad model

(Table 3-1). These viruses were used to infect the rear footpad of out-bred Swiss

Webster mice along with control viruses, 17syn+ (parental), 17APst (promoter mutant)

and RHA-6, which contains a polyadenylation signal at a HpaI site in the middle of the

intron. The footpad of out-bred Swiss Webster mice was infected with mutants 17A307,

17A307a, 17A307aR, 17A480, 17A489 and RHA-6 in varying dilutions (see Methods)

with 10 mice virus -1 dilution"'. In comparison to 17syn+ (parental), 17APst (promoter

mutant) and each rescuant virus included in the experiment, mutants 17A307, 17A307a

and 17A480 expressed dramatically increased LDso/pfu levels by mouse footpad

infection. Each of these displayed a greater than 500 fold increase in LDso/pfu levels

(Table 3-1). The virulence phenotype for the 17A480 recombinant made the creation of

the new 17A307 recombinants described above unnecessary. The 17A480 mutation

resides entirely in the intron and retains the splice donor site. This virus also contains a

lacZ DNA stuffer and its effect argues against the orientation of the polyadenylation

sequence having an impact in the 17A307 recombinants. It is important to recognize that

the 17A489 mutant had an equal virulence profile to 17syn+ and 17APst, which identifies

the 3' boundary of the virulence region due to the lack of virulence phenotype for





38

17A489. Results from the footpad infections indicate that 17A307, 17A307a and 17A480

are impaired in either neuroinvasion, or neurovirulence.

To determine if 17A307 and 17A307a were deficient in neurovirulence, the LAT

mutants were used to infect the mouse by intracranial inoculation along with 17syn+ and

17APst. These results showed that the 17A307 and 17A307a viruses were also restricted

in virulence measured by LDso/pfu upon direct inoculation into the mouse brain (Table 3-

1). Taken together, the footpad and intracranial LDso/pfu values show that mutants

17A307, 17A307a and 17A480 are greatly impaired in virulence in the mouse and that the

results are due to a neurovirulence phenotype and not likely due to a defect in

neuroinvasion or an inability to enter the central nervous system.

Tissue Restriction

To identify whether the 17A307, 17A307a and 17A480 mutants display a general

reduction in replication in the mouse causative of a virulence phenotype, several tissues

along the infection pathway from the foot were tested for production of infectious virus.

Tissues included the foot, DRG, spinal cord and brain with the inclusion of 17syn+,

17APst, 17A307a, 17A307aR, 17A480 viruses as controls. Infectious virus was assayed

for these tissues at 2, 3, 5 and 7 days post infection at an initial dose of 104 pfu virus"-

time-'. Each virus, time point and tissue was examined in triplicate.

Since the footpad is the initial site of infection in our model, it was critical to

determine if these mutants were impaired in virion production in this tissue. Upon

analyzing this tissue for plaque production, a significant difference in viral production

was not seen in the feet at any times tested (Figure 3-2). From previous data in our lab,

we know at the doses employed that 2 days post-infection is the peak of infectious virus





39

production in the feet (Jarman et al., 1999). The lack of a difference between 17A307

and 17A480 in comparison to 17syn+ (parental), 17APst and 17A307R demonstrates that

the mutants do not display a general replication defect in mouse tissue.

Infection in the footpad allows for the virus to enter the nervous system via nerve

termini in the epidermis. From the feet, virus progresses into the nervous system and

virus can be detected in the DRG. In examining the DRG, the 17A307 mutant does

display a reduction in infectious virus levels evident at 3 and 5 days post-infection (d.p.i.)

(Figure 3-3). Interestingly, 17A480 does not demonstrate a restriction at 3 d.p.i. and only

shows a possible reduction at 5 d.p.i. Both of these mutants, however, are restricted in

infectious virus production in the next tissue in the path of infection, the spinal cord.

Results from spinal cord show that both 17A307 and 17A480 have lower viral values in

comparison to 17syn+ (parental), 17APst, 17A307aR and 17A480R (Figure 3-4). Further

analysis reveals that 17A307 and 17A480 are also lower in abundance in brain tissue

(Figure 3-5). Values shown for these mutants only involve one positive sample for each

of the LAT virulence recombinant viruses, therefore, the brain restriction may be even

greater than depicted in the graph shown. Collectively, the tissue experiments display a

restriction in infectious virus production for 17A307 and 17A480 that is specific for

nervous tissue. These tissue restriction results show that the virulence deficient measured

by LD50 is due to a reduction of 17A307 and 17A480 for infectious virus production in

the nervous system.

Cell Specific Replication Deficiency

The tissue restriction results clearly demonstrate an impairment of infectious virus

production that is specific for nervous tissue. To identify a possible cell specific





40

phenotype for 17A307 and 17A480, replication of these viruses was tested by time course

in PC-12 cells and in rabbit skin cells. These LAT mutants were tested along with

17syn+, 17APst, 17A307R and 17A480R. The first experiment involved a multi-step time

course performed in PC-12 cells. The multi-step growth curves were performed with a

viral multiplicity of infection (m.o.i.) of 0.001 for each virus. A low dose of virus

administered, in addition to monitoring time points over several days, allows the

identification of subtle replication differences.

In the first experiments with 17A307 and 17A480, as early as 24 hours post-

infection, a 8-10 fold reduction in infectious virus was seen for both 17A307 and 17A480

in PC-12 cells (Figure 3-6). This decrease was also seen at 48, 72 and 96 hours post

infection. The experiment was repeated with 17A307 and 17A480 being tested in the

same experiment along with a few additional controls. As with the previous experiments,

17syn+ and 17A307R were included as controls but I additionally tested 17APst

(promoter mutant) along with 17A480R in the multi-step growth curve (Figure 3-7). The

17APst recombinant virus was shown to lack a virulence phenotype in the mouse but it

was important to compare a LAT recombinant with an alteration in a region of LAT that

is expected not to contain a cell specific replication function. In these experiments, an 8-

10 fold reduction was again observed for 17A307 and 17A480 (Figure 3-7). The 17syn+,

17APst and 17A480R viruses were not restricted in the production of infectious virus on

PC-12 cells. Multi-step growth curves were also performed in rabbit skin cells (Figure 3-

8) to test for a general growth restriction in cell culture. These results did not yield a

noticeable difference in virus production as compared with controls (Figure 3-8).





41

A single step growth curve was also conducted in PC-12 cells utilizing a higher

m.o.i (3.0) and shorter time points: 0, 3, 6, 12, 18 hours post-infection (Figure 3-9). This

experiment tested for dramatic replication differences due to the higher dose of virus and

the shorter time points. From these results, a difference between LAT mutants and

controls is not clearly evident. Together, these data show that a cell specific replication

effect is seen for the 17A307 and 17A480 LAT mutants at low multiplicities of infection.

The phenotype is only observed in PC-12 cells and is lacking in rabbit skin cells. From

these data, I hypothesize that the neuronal restriction of 17A307 and 17A480 in nervous

tissue is the result of growth restriction in neurons.

Additional LAT Recombinant Viruses

In addition to the LAT recombinants engineered by our collaborator, Dr. Wagner

(17A307, 17A307a, 17A307aR, 17A480 and 17A489), it was necessary to construct two

additional mutants. One necessary recombinant virus was 17A480R, which enables

validation of the findings for 17A480. Another mutant, 17APstA480, was also

constructed and is beneficial in understanding the different regulatory regions of the LAT

locus as described below.

17A480R

To verify the results observed for the 17A480 mutant in vivo and in cell culture,

the mutation was restored in a 17A480R recombinant virus. Restoration of biological

function was observed by multi-step time course on PC-12 cells (Figure 3-7). This

mutant is also being characterized for virulence properties in the mouse footpad model.





42

17APstA480

Another recombinant, 17APstA480, was also engineered to compare the findings

for the 17A480 with a recombinant that included a deletion in a different region of the

LAT locus. As shown by LD5o and tissue restriction experiments, 17A480 is greatly

reduced in virulence, while a deletion of the core latent promoter (17APst) is

indistinguishable from parental virus (17syn+). This led us to believe that the LAT locus

contains different regulatory regions and the impairment of more than one of these

regions may mask a severe phenotype. The 17APstA480 virus was a critical recombinant

for testing this hypothesis. Our expectation is to see an intermediate virulence phenotype

residing between what we observed for 17A480 and 17APst. In this virus, as the name

implies, the 480 mutation was coupled with a clean deletion in the latent core promoter.

The resulting mutant has impairments in two potentially different regulatory regions of

LAT. This will enable us to compare its phenotypes with other mutants in the literature

that contain very large deletions in the LAT locus (Perng et al., 2000; Thompson and

Sawtell 2001). These experiments are currently in progress.






43


3


25






9 -V----- -17''
o ---6-4-07A



0




PI3 PI5 P17 P110 PI12 P114 PI17 P119 PI 21 P124 PI27
days post-infection


Mean Values ( Standard Error of the Mean) (data points as plotted above):


meansem 17syn+ 17APst 17A307
PI 3 1.310.079 1.310.082 1.060.038
PI 5 1.920.078 1.860.089 1.530.049
PI 7 2.630.168 2.50.171 1.670.09
PI 10 1.180.193 0.980.184 0.810.156
PI 12 1.060.193 0.710.146 0.780.16
P 14 0.880.171 0.60.144 0.770.186
PI 17 0.0.840.178 0.390.084 0.610.206
PI 19 0.70.155 0.490.072 0.540.217
PI 21 0.660.153 0.470.028 0.660.199
PI 24 0.60.128 0.390.043 0.630.202
PI 27 0.550.124 0.410.093 0.540.216


Figure 3-1. Reduced corneal pathology of 17A307 in the rabbit eye model. The graph at
the top of the figure is a measurement of the severity of pathology of HSV-1
infection in the rabbit cornea. This was measured by slit lamp which
measures the number of dendrites and the severity of their pathology in the
cornea. These values closely compare with infectious virus levels. Values
below the graph are the raw data that are plotted above. The graph indicates
that 17A307 may have a virulence deficient phenotype.





44

Table 3-1. LD5o values*a
LD50/pfu Values for LAT Mutants

"_I "Route of Infection
Virus Footpad Intracranial
17syn+ 3.25 x 102 6.30 x 10'
17APst 5.11 x 102 9.30 x 10'
17A307 >7.0 x 104 >1.17 x 103
17A307a >7.0 x 104 9.63 x 102
17A307aR 3.17 x 102 9.10 x 10'
17A480 >4.0 x 104
17A489 1.10x 102
RHA-6 3.67 x 102
*This is a modified LD5o analysis. Mice were euthanized once they demonstrated an
infection of the central nervous system and a consequent impairment of motor function.
aThe values were recorded as a dose sufficient to induce lethality for half the mice in a
group. Two routes of infection were used in this experiment: footpad and intracranial.






45


1.00E+08


1.OOE+07


1.00E+06


1.00E+05


1.00E+04


1.00E+03


1.00E+02


1.00E+01


1.00E+0 00
17syn+ 17dPst 17d307 17d307R 17d480
Viruses


Figure 3-2. Infectious virus recovered from mouse feet at 2 days post-infection. Feet
were homogenized and tested for infectious virus by plaque assay on RS cells.
Values are recorded as pfu/g tissue.






46


A
A1.OOE+07


1.00E+06


1.00E+05


1.00E+04

B.
1.00E+03


1.00E+02


1.00E+01


1.00E+00
17syn+ 17dPst 17d307 17d307R 17d480
Viruses


B.
1.00E+07


1.OOE+06


1.00E+05


1.00E+04


1.00E+03


1.00E+02


1.00E+01


1.00E+00
17syn+ 17dPst 17d307 17d307R 17d480
Viruses

Figure 3-3. Virus production in dorsal root ganglia at 3 and 5 days post-infection. DRG
were homogenized and tested for infectious virus by plaque assay on RS cells.
Values are recorded as pfu/g tissue. A) The graph at the top is for 3 days post-
infection. B) The bottom is for DRG at 5 d.p.i. The difference between
17A307 and 17A307R is statistically significant P=0.0018 (unpaired t test,
Welsch corrected)






47


A.
1.OOE+08


1.OOE+07









0.
1.OOE+06



1.00E+02
1.00E+03 -


1.00E+02


1.00E+01


1.00E+00
17syn+ 17dPst 17d307 17d307R 17d480
Viruses






B.
1.00E+08

1.00E+07
1.OOE+07 -

1.00E+06

1.00E+05

M 1.00E+04
4-
0.
1.00E+03

1.00E+02

1.00E+01

1.00E+00
17syn+ 17dPst 17d307 17d307R 17d480
Viruses


Figure 3-4. Virus production in spinal cord at 5 and 7 days post-infection. A) Spinal
cord infectious virus levels at 5 dpi (P=0.002). B) Spinal cord at 7 dpi
(P=0.0030).






48


1.00E+08

1.00E+07

1.00E+06

1.00E+05 -

3 1.00E+04

1.00E+03

1.00E+02

1.00E+01

1.OOE+00
17syn+ 17dPst 17d307 17d307R 17d480
Viruses


Figure 3-5. Virus production in brain at 7 days post-infection. Mouse brains were
homogenized and tittered for infectious virus by plaque assay on RS cells.
Values are plotted as pfu/g tissue. The difference between 17A307 and
17A307R is statistically significant (P=0.009) and the difference between
17A480 and 17syn+ is also statistically significant (P-0.0022) as measured by
unpaired t test (Welsch corrected).






49



A. OE+08


1.00E+07


1.00E+06


1.00E+05


E
E 1.00E+04 -______ 017d307
m17d307R

1.00E+03


1.00E+02


1.00E+01


1.00E+00
8 24 48 72 96
Hour Pot-Infection



B. 1.00m0


1.00E408


I.00E+07


1.00E+06


5r 1.00E-05
E 17d480
I17syn+
1.OOE+04


1.00E+03


1.00E+02


1.00E+01


1.00E00
8 24 48 72 96
Houm Post-Infection

Figure 3-6. 17A307 and 17A480 multi-step time courses in PC-12 cells. A) 17A307 is
statistically different than 17A307R (P=0.0019). B) 17A480 is statistically
different than 17syn+ (P0.0232).






50


1.00E+07


1.00E+06


1.00E+05


1.00E+04. 17syn+
I E04 7dPs
017dP30
E 017007
eA17d307R
m1Td4O0R


1.00E+02


1.00E+01


1.00E+00









(parental) and 17APst (promoter deletion). 17A307 was statistically different
from 17A307R (P=0.02 at 24 hpi, P0.0069 at 48 hpi, P=0.0010 at 72 hpi) and
17A480 differed significantly from 17A480R (P=0.0364 at 24 hpi, Pm.0149
at 48 hpi, P=0.002 at 72 hpi).







51


1.00E+09----------------------- _________
1.00E+08


I.OoE+08


1.00E+07


1.00E+06


1.00E+05
S17d307

S1.OE+04 17d307aR













Hours Post4nfection



Figure 3-8. Multi-step time course in rabbit skin cells. This is a comparison of infectious
virus production of 17A307, 17A307a and 17A307aR on RS cells. All 3
viruses produce high levels of infectious virus on RS cells.
1.OOE+03


1 .OE+02


1.00E+O01



8 24 48 72 96
Hours Post-ctlon



Figure 3-8. Multi-step time course in rabbit skin cells. This is a comparison of infectious
virus production of 17A307, 17A307a and 17A307aR on RS cells. All 3
viruses produce high levels of infectious virus on RS cells.






52



1.00E+09


1.00E+08


1.00E+07





1.00E+05
E 7I17syn+
E 0170307
1.00E+04 7d307R


1.00E+03


1.00E+02


1.00E+01


1.00E+00
0 3 6 12 18
Hours Pout-lnfMd l



Figure 3-9. Single step time course in PC-12 cells. 17A307 was compared to 17A307R
along with 17syn+ in a single step growth curve utilizing an initial MOI of
3.0.












CHAPTER 4
DISCUSSION

The influence of the LAT gene upon dictating the outcome of the latent phase of

the HSV-1 infection is clear. Uncertainty, however, begins with understanding: 1)

whether LAT acts primarily at the level of establishing a latent infection and helping to

either suppress viral replication and prevent cell death, or 2) whether it exerts its primary

influence as a mediator of reactivation from latency. Another difficulty in dissecting the

LAT gene's role has been linking the biologically diverse functions attributed to the LAT

region with the LAT RNA itself, and whether different regions of the gene may actually

have different functions. LAT promoter mutants have been seen to have different

phenotypes than larger deletions that include the promoter and downstream transcript-

encoding sequence. The goal of this study was to utilize recombinant virology to attempt

to define the genetic basis for LAT phenotypes that might go beyond just controlling

reactivation.

Viruses with alterations in the LAT region exhibit severe impairment of

reactivation in both the induced and the spontaneous rabbit eye models, and in mouse

models involving infection of either the footpad or the cornea. Specifically, mutations in

the promoter and/or the 5' region of exon 1 have most discriminately resulted in severe

reactivation deficiencies in rabbit models (Bloom et al., 1994; Bloom et al., 1996; Perng

et al., 1994; Perng et al., 1996; Trousdale et al., 1991). It has been debated whether these

effects are due to decreased reactivation, or are the result of decreased establishment of

LAT mutants. With respect to early events in HSV-1 latency, the LAT gene has been


53





54

proposed to enhance the efficiency of establishment (Pemg et al., 2000; Thompson and

Sawtell 1997). These studies were performed with relatively large LAT deletions, so

while one cannot rule out that a portion of the LAT gene may act upon establishment

these data are not consistent with the observation that LAT promoter mutants do not

show impaired establishment, and instead seem to act primarily at the level of

reactivation. In addition to LAT promoter mutants, concise, small mutations (200-400

bp) in the LAT promoter and/or the 5' region of exon 1 result in a dramatic reduction

(70-100%) in reactivating virus in the absence of any detectable differences in

establishment (Bloom et al., 1994; Bloom et al., 1996).

It has been argued by Sawtell and Thompson that the LAT mediates its effects on

the establishment phase of the latent infection (Sawtell and Thompson 1992; Thompson

and Sawtell 1997). To test for an establishment decrease, they tested 17syn+ (parental)

along with 17-AH, which is a deletion of the LAT promoter, exon 1 and half of the 2.0 kb

intron in comparison to its rescue, 17-AHR (Thompson and Sawtell 2001). These viruses

were tested for a measurable difference in establishment in the mouse TG after corneal

infection. In these experiments, they report a decrease of approximately 33% in viral

DNA detected in TG for the 17-AH mutant in comparison to parental virus and 17-AHR.

They argue that these results demonstrate an establishment decrease sufficient to

facilitate the reactivation reductions in their experiments and reported by others (Bloom

et al., 1994; Perng et al., 1994; Perng et al., 1996).

A biological mechanism hypothesized to result in establishment decreases is a

difference in neuronal survival, or apoptosis, for LAT mutants in comparison to parental

HSV-1. Sawtell and Thompson produced data suggesting a role of LAT in protecting





55

neurons during the establishment of latency (Thompson and Sawtell 2001). A difference

in viral DNA levels in ganglia between the LAT(-) mutant, 17-AH, and its rescue, 17-

AHR was reported. This difference is proposed to occur due to a inhibition of apoptosis

and an increase of surviving neurons. In the determination of neuronal survival, it was

reported that 17-AH has a 2-fold reduction in total latent neurons in comparison to its

rescue (Thompson and Sawtell 2001). These viruses were also tested for differences in

their relative replication in mouse TG following coreal infection. Interestingly, no

detectable replication differences were observed in cornea or ganglia. If these viruses do

express neuronal survival phenotypes, one would expect to see a replication difference

between LAT(-) and LAT(+) viruses. A virulence phenotype would also be expected if

LAT plays a role in neuronal survival and/or apoptosis in vivo.

A portion of the LAT gene has been shown by Wechsler (Pemg et al., 2000) to

stimulate apoptosis in transient transfection in cell culture through suppression of

receptor-mediated (caspase-8) and mitochondrial-mediated (caspase-9) pathways (Pemg

et al., 2000). Results in vivo with the large LAT mutants demonstrated a reduction in

establishment levels leading to a significant loss of sensory neurons (Perng et al., 2000;

Thompson and Sawtell 1997). Transient transfection of IMR-90 and CV-1 cells with a

plasmid containing the 3' region of the LAT exon and most of the intron was able to

protect the majority of cells from ceramide, or fumonisin Bi-induced apoptosis (Pemg et

al., 2000; Thompson and Sawtell 2000). Expression of the bovine herpesvirus 1 LAT

(Jones et al., 1996) or portions of the HSV-1 LAT gene inhibit chemically induced

apoptosis in cell culture (Jones et al., 2001; Perng et al., 2000).





56

The LAT effects on apoptosis appear to be cell specific. In culture, LAT is unable

to protect 293, or COS-7 cells from apoptosis (Inman et al., 2001). It is clear that LAT

does induce apoptosis in certain cell lines using transient transfection assays with high

multiplicities of infection and high expression levels (Pemg et al., 2000). These results

are very interesting but it is uncertain if LAT plays an apoptotic role in the context of

whole virus and in animal models. These findings were used to develop the hypothesis of

an apoptotic function of LAT in TG, and that LAT mutants result in greater levels of

apoptosis within sensory ganglia. Unfortunately, an apoptotic role of LAT has not been

adequately proven in whole virus or in animal models. The neuronal survival and

apoptosis results present a potential additional role of the LAT locus upon the acute

infection and the establishment of latency, although the mutants used in these

experiments do not adequately allow the identification of a virulence function distinct

from latency phenotypes.

Analysis of a series ofHSV recombinants containing deletions in the region known

to be required for reactivation identified a deletion that exhibited decreased pathology in

the rabbit eye during the acute infection. We hypothesized that this might represent a

separate function encoded by the LAT region and sought to study this recombinant's

virulence in the well-defined mouse model. LDso analysis and infectious virus production

in neuronal and non-neuronal tissues revealed that this mutant was dramatically restricted

in virulence. Additional analyses also included 17A480 and 17A489, which have been

described previously (Jarman et al., 2002) and involve mutations in the 5' region of the

LAT intron. Analysis of the LAT mutants 17A307 and 17A480, and their rescues, in the

mouse model revealed a dramatic impact of this region of the LAT gene on the acute





57

infection ofHSV-1. From the LDso/pfu values from both a footpad route of infection and

from an intracranial infection, a greater than 500 fold reduction occurs in the 17A307 and

17A480 mutants in comparison to 17syn+ (parental), 17APst (promoter mutant),

17A307R and 17A489. The dramatic reduction in virulence by each route of infection

proves a neurovirulence phenotype for these viruses and is not simply due to a

neuroinvasive effect. Some virulence effects have been reported for LAT mutants

(Thompson and Sawtell 2001; Perng et al., 2000) but none have exhibited such severe

deviations from wild-type and rescuant viruses. These data demonstrate a virulence

function of HSV-1 localized to the 3' region of exon 1 and the 5' intron of the latency

associated transcript locus.

Virulence Phenotype and Nervous Tissue Restriction

The LD5o/pfu determinations of 17A307 and 17A480 were a test of their ability to

induce encephalitis in the mouse model. In addressing the basis for this impairment,

spinal cord and brain were also analyzed for relative viral yields in these tissues by

plaque assay. Titrations of these tissues again showed restriction in replication in

nervous tissue for 17A307 and 17A480. Both of these LAT mutants were dramatically

restricted in viral yields in the spinal cord and in the brain. These results could possibly

be due to an initial restriction in the DRG, which would lead to lower seeding of the

spinal cord and consequently the brain. This is unlikely, though, because direct

intracranial inoculations and LDso/pfu determinations also showed a significant reduction

in virulence as occurred with the footpad route of infection, suggesting that the restriction

in the nervous tissue is more general.





58

Two possible explanations for the decreased virulence of 17A307 and 17A480 in

the mouse model are either a global restriction of these mutants to replicate in murine

tissue, or a tissue specific replication phenotype in neurons. In testing both epidermal

and nervous tissue infected in the mouse footpad model and the successive path of

infection in the nervous system, it was determined that the virulence phenotype is the

caused by a tissue specific restriction of the downstream LAT mutants. After footpad

infection, 17A307 and 17A480 are indistinguishable in infectious virus levels in

comparison to 17A307R, 17syn+ and 17APst proving that these mutations do not have a

general replication restriction in vivo. These LAT mutants were equal in p.f.u.

production at 2 days post-infection, which has been shown previously in our lab to be the

peak time of HSV-1 infection in the mouse footpad model (Jarman et al., 1999). After

infection of the foot, virus then enters the peripheral nervous system by entering

innervating nerve termini in the epidermis. Virus then travels via the sciatic nerve to the

dorsal root ganglia. In examing DRG for virus production, 17A307 was decreased in

infectious virus load at 3 days post-infection. Interestingly, 17A480 did not display a

detectable reduction in infectious levels at 3 days but did have a significant restriction by

5 days post-infection. 17A307 was restricted at this time point as well for dorsal root

ganglia. The virulence effects of 17A307 and 17A480 in the mouse are due to tissue

specific restriction of these mutants in nervous tissue.

Cell Culture Phenotype

A nervous tissue restriction was clearly observed in the mouse model but it was

uncertain whether this effect was caused by a neuronal cell type, or from supporting cells

in ganglia. To test for a cell specific replication impairment, 17A307 and 17A480





59

mutants were analyzed for replication in PC-12 cells (pheochromocytoma cells) and RS

cells in time course experiments. The PC-12 cells were chosen due their close

developmental relationship with neurons. Both the PC-12 cells and the RS cells were

tested for infection virus production in multistep and single step growth curves. From

these experiments, 17A307 and 17A480 each displayed an 8-10 fold restriction in plaque

forming unit production on PC-12 cells by 48 hours post-infection at low multiplicities of

infection in comparison to 17syn+, 17APst, 17A307R and 17A480R. When compared in

the RS cells, all viruses tested replicated to indistinguishable levels. This result was not

unexpected due to what was seen for replication values from feet in the tissue restriction

experiments. Together, these results indicate that the restriction specific for nervous

tissue is due to reduced replication, or at least decreased infectious virus production, in

neurons.

As mentioned previously, from initial characterization of these mutants, a severe

reduction in epinephrine-induced reactivation in the rabbit eye model was evident for

17A307. In contrast, 17A480 did not exhibit a reactivation phenotype in comparison to

17syn+ (parental), or 17APst (latent promoter mutant). The region altered in the 17A307

mutant may include the 3' region of the reactivation critical portion of the LAT locus and

a virulence region. The 17A480 shows a separation of virulence from reactivation

providing evidence for another regulatory region of the LAT gene.

LAT Mutants and Multiple Regulatory Functions

Many of the LAT mutants described in the literature involve mutation of a very

large portion (>lkb) of the LAT locus. Two of these mutants are dLAT2903 and 17-AH

and each involves mutation of the latent promoter, exon 1 and half of the 2.0 intron





60

(Pemg et al., 1994; Thompson and Sawtell 2001). Examination of these mutants failed to

reveal dramatic virulence phenotypes. These viruses do show latent phenotypes as

described by other mutants that engineered changes into the 5' portion of exonl (Bloom

et al., 1994; Perng et al., 1994). The mutant dLAT2903 is indistinguishable from parental

or its rescue in cell culture replication, corneal replication or p.f.u. production in the TG

of the rabbit (Perng et al., 2001). Similarly, no replication differences were observed for

17-AH in cell culture, cornea and TG (Thompson and Sawtell 2001). The fact that these

recombinants do not display a clear virulence effect in animal models, coupled with the

data shown here for the 17A307 and 17A480 LAT recombinants, suggests that the LAT

locus contains several distinct regulatory regions (Figure 4-1). These regions are

involved in different stages of HSV-1 infection in the mouse model. The recombinant

viruses 17A307 and 17A480 display severe virulence reductions in the mouse footpad

model.

Another interesting phenotype for these mutants is their difference in reactivation

abilities in the epinephrine-induced rabbit eye model. Reactivation is significantly

reduced for 17A307 and, as observed in this report, the mutant also shows decreased

virulence. From the establishment hypothesis of Sawtell and Thompson, it may seem

that 17A307 is simply inhibited in its ability to protect neurons and consequently results

in lower virulence in the acute infection and lower genome levels for the ability to

reactivate. The problem with this interpretation stems from the acute and latent

phenotypes of the 17A480 mutant. This virus does display a virulence phenotype as

observed for 17A307 but is devoid of a reactivation phenotype. Therefore, the virulence

phenotype cannot be explained by a lower amount of DNA seeding the ganglia.





61

Together, these data argue for the presence of a virulence region in the LAT locus clear

and distinct from a reactivation critical region (Figure 4-1). The virulence phenotypes for

the dLAT2903 and 17-AH viruses are not severe and the net result of deleting a large

region of LAT encompassing multiple genetic elements may be a phenotype that is less

severe than deleting single elements individually.

My hypothesis is that mutation of a combination of potentially opposing regulatory

regions may result in the masking of a clear acute phenotype. To address this possibility,

we engineered a mutant that removes the core element of the latent promoter along with

the exchange of a 480 bp region of the 5' intron of LAT with a lacZ stuffer sequence.

This mutant, 17APstA480, as the name suggests is simply the combination of the 17APst

and the 17A480 mutants. The virulence characteristics of this mutant are currently being

examined.

Establishment differences were seen with large LAT deletions but the regulatory

element was not well defined. The apoptosis and neuronal survival results were obtained

using mutants with a large region of shared sequence removed. From comparison of the

mutants, and what has been shown for the involvement of the 5' region ofexon 1 in

reactivation, it would seem that the region of the LAT locus involved in establishment,

neuronal survival and possibly apoptosis maps to the 3' region of exon 1 and the 5'

portion of the intron. Our data shows that small, concise mutations in this region of the

LAT locus do result in dramatic virulence results.

Mechanism

From the virulence data for the recombinants 17A307 and 17A480, it is clear that

a downstream region of LAT involving the end ofexon 1 and the beginning of the 2.0 kb





62

intron is acting upon the severity of acute infection and possibly the establishment of

latency. This region may function to protect neurons in vivo as proposed by Thompson

and Sawtell (Thompson and Sawtell 2001). On the molecular level, a few possible

mechanisms can be envisioned. First, it is possible that this region of the LAT locus

involves a secondary promoter. Another potential mechanism is through differential

transcriptional permissivity of the LAT region. Lastly, the LAT locus may encode an

enhancer/silencer region functioning to regulate the ICPO promoter.

Lytic Promoter in the LAT Region

A second promoter in the LAT gene was identified by use of transient

transfections in cell culture (Goins et al., 1994). Sequence involving exon 1 was able to

drive transcription of a lacZ reporter in Vero cells and was designated as LAP2 (Goins et

al., 1994). Discovery of this promoter resulted in its unfortunate designation as a latent

promoter. In its initial characterization, the secondary promoter was shown to be

transcriptionally active in Vero cells and consequently demonstrates its ability to express

RNA during a lytic infection.

Since the data for 17A480 demonstrates a function for this area of the LAT gene

upon the acute infection and does not result in a detectable reactivation phenotype, the

secondary promoter would be expected to be active during an acute infection. Therefore,

the LAT locus would have separate, opposing promoters: one functioning in a latent

infection to act upon reactivation and one operating in the acute infection in ganglia.

Multiple other transcripts have been proposed for the LAT region but have not been well

mapped and their kinetics and cell specific expression are poorly understood. Our lab has

detected expression of a RNA molecule in this region from a latent promoter mutant





63

(17APst) and mapping of this potential transcript is currently underway. The use of

another promoter in the LAT locus is possible due to the opposing virulence and

reactivation phenotypes seen for 17APst (LAP1 mutant) and the 17A480 mutant. If only

a primary 8.5 kb transcript is expressed, and a subsequently spliced intron, than it would

be unusual that removal of a downstream region (i.e. A480) would give a virulence

phenotype when removal of its core promoter (APst) does not affect the acute infection.

This argues strongly that they are separate and perhaps opposing elements.

Transcriptional Permissivity

It is also possible to model an action from a transcription accessibility hypothesis.

During latency, we know that LAT is the only abundantly expressed gene of HSV-1. The

other genes of HSV-1 are tightly repressed. In examination of the mechanism for this

dramatic difference, our lab showed that the LAT region is present in a transcriptionally

permissive state during latency as seen with histone acetylation data (Kubat et al., 2004).

The severity of acute infection may also result from alterations in the transcriptional

accessibility of the LAT and surrounding genes. It is possible that the region deleted in

the 17A307 and 17A480 mutant comprises a key site for the transcriptional permissivity

of LAT and possibly the neighboring, antisense gene, ICPO. Influence on ICPO is

especially likely, since is functions as a key transcriptional activator of all 3 classes of

HSV-1 genes. The LAT virulence locus could function to dock transcription factors,

which exert their effects upon either the latent LAT promoter, or possibly the ICPO

promoter. An impairment of this region to recruit the binding of cellular, or viral factors

present explicitly in ganglia, which are involved in ICPO expression, would result in a

decrease in replication and severity of infection.





64

ICPO Enhancer

Another possible mechanism for the virulence region of LAT is through

transcriptional regulation of the ICPO promoter. It may not simply function through a

transcriptional permissivity hypothesis as described above but could directly enhance the

expression of ICPO. During the lytic infection, the enhancer encoded in the LAT locus

would increase expression from the ICPO promoter directly by a looping mechanism.

Additionally, I hypothesize this occurs in a neuron-specific manner. In acute infection,

the enhancer would associate with transcription factors present in neurons to promote

expression of ICPO. The mutations introduced into the LAT locus in the 17A307 and

17A480 recombinant impair this enhancer function. ICPO is consequently lower in

neuronal tissue and leads to a general decrease in HSV-1 gene expression. This decrease

causes lower viral production and a milder infection in the mouse model. An enhancer

function involving the LAT locus and neuronal specific factors would explain why the

virulence effects were specific for nervous tissue. Future experiments are aimed at

determining if a secondary promoter is active in the LAT locus and mapping of

subsequent RNA molecules. Additionally, our lab will analyze the ICPO promoter region

for differences in transcription with the virulence mutants, and for possible changes in

transcriptional permissivity.






65








HSV-1 Genome

,S S









Exon 1




17ASty 348bp

17A348


17A307


17A480
489bp

17A489
SRegion of mutation
M Reactivation
M Virulence


Figure 4-1. Separate genetic regions of the LAT locus. This is a representation of the
virulence data presented in this manuscript along with known reactivation data
for the LAT region. The combination of the reactivation and virulence
phenotypes identified for LAT recombinant viruses enabled the modeling of
separate regulatory regions ofthe LAT locus as shown in this figure.
17A*s 1T^y ".



























separate regulatory regions of the LAT locus as shown in this figure.










LIST OF REFERENCES

Ahmed, M., M. Lock, C. G. Miller and N. W. Fraser, 2002, Regions of the herpes
simplex virus type 1 latency-associated transcript that protect cells from apoptosis
in vitro and protect neuronal cells in vivo, J Virol 76(2): 717-29.

Baines, J. D., P. L. Ward, G. Campadelli-Fiume and B. Roizman, 1991, The UL20 gene
of herpes simplex virus 1 encodes a function necessary for viral egress, J Virol
65(12): 6414-24.

Batterson, W. and B. Roizman, 1983, Characterization of the herpes simplex virion-
associated factor responsible for the induction of alpha genes, J Virol 46(2): 371-7.

Becker, Y., H. Dym and I. Sarov, 1968, Herpes simplex virus DNA, Virology 36(2): 184-
92.

Berman, E. J. and J. M. Hill, 1985, Spontaneous ocular shedding of HSV-1 in latently
infected rabbits, Invest Ophthalmol Vis Sci 26(4): 587-90.

Bhattacharjee, P. S., R. K. Tran, M. E. Myles, K. Maruyama, A. Mallakin, D. C. Bloom
and J. M. Hill, 2003, Overlapping subdeletions within a 348-bp in the 5' exon of the
LAT region that facilitates epinephrine-induced reactivation of HSV-1 in the rabbit
ocular model do not further define a functional element, Virology 312(1): 151-8.

Bloom, D. C., G. B. Devi-Rao, J. M. Hill, J. G. Stevens and E. K. Wagner, 1994,
Molecular analysis of herpes simplex virus type 1 during epinephrine-induced
reactivation of latently infected rabbits in vivo, J Virol 68(3): 1283-92.

Bloom, D. C., N. T. Maidment, A. Tan, V. B. Dissette, L. T. Feldman and J. G. Stevens,
1995, Long-term expression of a reporter gene from latent herpes simplex virus in
the rat hippocampus, Brain Res Mol Brain Res 31(1-2): 48-60.

Bloom, D. C., J. M. Hill, G. Devi-Rao, E. K. Wagner, L. T. Feldman and J. G. Stevens,
1996, A 348-base-pair region in the latency-associated transcript facilitates herpes
simplex virus type 1 reactivation, J Virol 70(4): 2449-59.

Bloom, D. C., J. G. Stevens, J. M. Hill and R. K. Tran, 1997, Mutagenesis of a cAMP
response element within the latency-associated transcript promoter of HSV-1
reduces adrenergic reactivation, Virology 236(1): 202-7.

Bloom, D. C. and R. G. Jarman, 1998, Generation and use of recombinant reporter
viruses for study of herpes simplex virus infections in vivo, Methods 16(1): 117-25.

Bloom, D. C., 2004, Hsv Lat and Neuronal Survival, Int Rev Immunol 23(1-2): 187-198.




66





67

Cabrera, C. V., C. Wohlenberg, H. Openshaw, M. Rey-Mendez, A. Puga and A. L.
Notkins, 1980, Herpes simplex virus DNA sequences in the CNS of latently
infected mice, Nature 288(5788): 288-90.

Cai, W. H., B. Gu and S. Person, 1988, Role of glycoprotein B of herpes simplex virus
type 1 in viral entry and cell fusion, J Virol 62(8): 2596-604.

Campbell, M. E., J. W. Palfreyman and C. M. Preston, 1984, Identification of herpes
simplex virus DNA sequences which encode a trans-acting polypeptide responsible
for stimulation of immediate early transcription, J Mol Biol 180(1): 1-19.

Caradonna, S. J. and Y. C. Cheng, 1981, Induction of uracil-DNA glycosylase and dUTP
nucleotidohydrolase activity in herpes simplex virus-infected human cells, J Biol
Chem 256(19): 9834-7.

Chartrand, P., C. S. Crumpacker, P. A. Schaffer and N. M. Wilkie, 1980, Physical and
genetic analysis of the herpes simplex virus DNA polymerase locus, Virology
103(2): 311-26.

Coen, D. M., D. P. Aschman, P. T. Gelep, M. J. Retondo, S. K. Weller and P. A.
Schaffer, 1984, Fine mapping and molecular cloning of mutations in the herpes
simplex virus DNA polymerase locus, J Virol 49(1): 236-47.

Corey, L., A. Wald and L. G. Davis, 1996, Subclinical shedding of HSV: its potential for
reduction by antiviral therapy, Adv Exp Med Biol 394:11-6.

Costa, R. H., K. G. Draper, G. Devi-Rao, R. L. Thompson and E. K. Wagner, 1985,
Virus-induced modification of the host cell is required for expression of the
bacterial chloramphenicol acetyltransferase gene controlled by a late herpes
simplex virus promoter (VP5), J Virol 56(1): 19-30.

Dennis, D. and J. R. Smiley, 1984, Transactivation of a late herpes simplex virus
promoter, Mol Cell Biol 4(3): 544-51.

Devi-Rao, G. B., D. C. Bloom, J. G. Stevens and E. K. Wagner, 1994, Herpes simplex
virus type 1 DNA replication and gene expression during explant-induced
reactivation of latently infected murine sensory ganglia, J Virol 68(3): 1271-82

Devi-Rao, G. B., J. S. Aguilar, M. K. Rice, H. H. Garza, Jr., D. C. Bloom, J. M. Hill and
E. K. Wagner, 1997, Herpes simplex virus genome replication and transcription
during induced reactivation in the rabbit eye, J Virol 71(9): 7039-47.

Dobson, A. T., F. Sederati, G. Devi-Rao, W. M. Flanagan, M. J. Farrell, J. G. Stevens, E.
K. Wagner and L. T. Feldman, 1989, Identification of the latency-associated
transcript promoter by expression of rabbit beta-globin mRNA in mouse sensory
nerve ganglia latently infected with a recombinant herpes simplex virus, J Virol
63(9): 3844-51.





68

Drolet, B. S., G. C. Perng, J. Cohen, S. M. Slanina, A. Yukht, A. B. Nesburn and S. L.
Wechsler, 1998, The region of the herpes simplex virus type 1 LAT gene involved
in spontaneous reactivation does not encode a functional protein, Virology 242(1):
221-32.

Drolet, B. S., G. C. Perng, R. J. Villosis, S. M. Slanina, A. B. Nesburn and S. L.
Wechsler, 1999, Expression of the first 811 nucleotides of the herpes simplex virus
type 1 latency-associated transcript (LAT) partially restores wild-type spontaneous
reactivation to a LAT-null mutant, Virology 253(1): 96-106.

Ecob-Prince, M. S., C. M. Preston, F. J. Rixon, K. Hassan and P. G. Kennedy, 1993,
Neurons containing latency-associated transcripts are numerous and widespread in
dorsal root ganglia following footpad inoculation of mice with herpes simplex virus
type 1 mutant in1814, J Gen Virol 74( Pt 6): 985-94.

Ecob-Prince, M. S., K. Hassan, M. T. Denheen and C. M. Preston, 1995, Expression of
beta-galactosidase in neurons of dorsal root ganglia which are latently infected with
herpes simplex virus type 1, J Gen Virol 76( Pt 6): 1527-32.

Efstathiou, S., A. C. Minson, H. J. Field, J. R. Anderson and P. Wildy, 1986, Detection of
herpes simplex virus-specific DNA sequences in latently infected mice and in
humans, J Virol 57(2): 446-55.

Everett, R. D., 1984, A detailed analysis of an HSV-1 early promoter: sequences involved
in trans-activation by viral immediate-early gene products are not early-gene
specific, Nucleic Acids Res 12(7): 3037-56.

Everett, R. D., 1984, Trans activation of transcription by herpes virus products:
requirement for two HSV-1 immediate-early polypeptides for maximum activity,
Embo J 3(13): 3135-41.

Everett, R. D., 1987, A detailed mutational analysis ofVmwl 10, a trans-acting
transcriptional activator encoded by herpes simplex virus type 1, Embo J 6(7):
2069-76.

Farrell, M. J., T. P. Margolis, W. A. Gomes and L. T. Feldman, 1994, Effect of the
transcription start region of the herpes simplex virus type 1 latency-associated
transcript promoter on expression of productively infected neurons in vivo, J Virol
68(9): 5337-43.

Forrester, A., H. Farrell, G. Wilkinson, J. Kaye, N. Davis-Poynter and T. Minson, 1992,
Construction and properties of a mutant of herpes simplex virus type 1 with
glycoprotein H coding sequences deleted, J Virol 66(1): 341-8.

Gelman, I. H. and S. Silverstein, 1985, Identification of immediate early genes from
herpes simplex virus that transactivate the virus thymidine kinase gene, Proc Natl
Acad Sci U S A 82(16): 5265-9.





69

Gelman, I. H. and S. Silverstein, 1986, Co-ordinate regulation of herpes simplex virus
gene expression is mediated by the functional interaction of two immediate early
gene products, J Mol Biol 191(3): 395-409.

Gelman, I. H. and S. Silverstein, 1987, Herpes simplex virus immediate-early promoters
are responsive to virus and cell trans-acting factors, J Virol 61(7): 2286-96.

Goins, W. F., L. R. Sternberg, K. D. Croen, P. R. Krause, R. L. Hendricks, D. J. Fink, S.
E. Straus, M. Levine and J. C. Glorioso, 1994, A novel latency-active promoter is
contained within the herpes simplex virus type 1 UL flanking repeats, J Virol
68(4): 2239-52.

Gressens, P. and J. R. Martin, 1994, HSV-2 DNA persistence in astrocytes of the
trigeminal root entry zone: double labeling by in situ PCR and
immunohistochemistry, J Neuropathol Exp Neurol 53(2): 127-35.

Guzowski, J. F. and E. K. Wagner, 1993, Mutational analysis of the herpes simplex virus
type 1 strict late UL38 promoter/leader reveals two regions critical in
transcriptional regulation, J Virol 67(9): 5098-108.

Hay, J., H. Moss, A. T. Jamieson and M. C. Timbury, 1976, Herpesvirus proteins: DNA
polymerase and pyrimidine deoxynucleoside kinase activities in temperature-
sensitive mutants of herpes simplex virus type 2, J Gen Virol 31(1): 65-73.

Henderson, G., W. Peng, L. Jin, G. C. Perg, A. B. Nesburn, S. L. Wechsler and C.
Jones, 2002, Regulation of caspase 8- and caspase 9-induced apoptosis by the
herpes simplex virus type 1 latency-associated transcript, J Neurovirol 8 Suppl 2:
103-11.

Heine, J. W., R. W. Honess, E. Cassai and B. Roizman, 1974, Proteins specified by
herpes simplex virus. XII. The virion polypeptides of type 1 strains, J Virol 14(3):
640-51.

Hill, J. M., J. B. Dudley, Y. Shimomura and H. E. Kaufman, 1986, Quantitation and
kinetics of induced HSV-1 ocular shedding, Curr Eye Res 5(3): 241-6.

Hill, J. M., Y. Haruta and D. S. Rootman, 1987, Adrenergically induced recurrent HSV-1
corneal epithelial lesions, Curr Eye Res 6(8): 1065-71.

Hill, T. J., 1987, Ocular pathogenicity of herpes simplex virus, Curr Eye Res 6(1): 1-7.

Hill, J. M., Y. Shimomura, J. B. Dudley, E. Berman, Y. Haruta, B. S. Kwon and L. J.
Maguire, 1987, Timolol induces HSV-1 ocular shedding in the latently infected
rabbit, Invest Ophthalmol Vis Sci 28(3): 585-90.

Hill, J. M., F. Sedarati, R. T. Javier, E. K. Wagner and J. G. Stevens, 1990, Herpes
simplex virus latent phase transcription facilitates in vivo reactivation, Virology
174(1): 117-25.





70

Hill, J. M., B. M. Gebhardt, R. Wen, A. M. Bouterie, H. W. Thompson, R. J.
O'Callaghan, W. P. Halford and H. E. Kaufman, 1996, Quantitation of herpes
simplex virus type 1 DNA and latency-associated transcripts in rabbit trigeminal
ganglia demonstrates a stable reservoir of viral nucleic acids during latency, J Virol
70(5): 3137-41.

Hill, J. M., H. H. Garza, Jr., Y. H. Su, R. Meegalla, L. A. Hanna, J. M. Loutsch, H. W.
Thompson, E. D. Varnell, D. C. Bloom and T. M. Block, 1997, A 437-base-pair
deletion at the beginning of the latency-associated transcript promoter significantly
reduced adrenergically induced herpes simplex virus type 1 ocular reactivation in
latently infected rabbits, J Virol 71(9): 6555-9.

Honess, R. W., D. J. Purifoy, D. Young, R. Gopal, N. Cammack and P. O'Hare, 1984,
Single mutations at many sites within the DNA polymerase locus of herpes simplex
viruses can confer hypersensitivity to aphidicolin and resistance to phosphonoacetic
acid, J Gen Virol 65 (Pt 1): 1-17.

Honess, R. W. and B. Roizman, 1974, Regulation ofherpesvirus macromolecular
synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins, J
Virol 14(1): 8-19.

Honess, R. W. and B. Roizman, 1975, Regulation ofherpesvirus macromolecular
synthesis: sequential transition ofpolypeptide synthesis requires functional viral
polypeptides, Proc Natl Acad Sci U S A 72(4): 1276-80.

Huszar, D. and S. Bacchetti, 1981, Partial purification and characterization of the
ribonucleotide reductase induced by herpes simplex virus infection of mammalian
cells, J Virol 37(2): 580-8.

Inman, M., L. Lovato, A. Doster and C. Jones, 2001, A mutation in the latency-related
gene of bovine herpesvirus 1 leads to impaired ocular shedding in acutely infected
calves, J Virol 75(18): 8507-15.

Inman, M., G. C. Pemg, G. Henderson, H. Ghiasi, A. B. Nesburn, S. L. Wechsler and C.
Jones, 2001, Region of herpes simplex virus type 1 latency-associated transcript
sufficient for wild-type spontaneous reactivation promotes cell survival in tissue
culture, J Virol 75(8): 3636-46.

Izumi, K. M. and J. G. Stevens, 1988, Two thymidine kinase deficient herpes simplex
viruses exhibit unexpected virulence properties, Microb Pathog 4(2): 145-53.


Izumi, K. M. and J. G. Stevens, 1990, Molecular and biological characterization of a
herpes simplex virus type 1 (HSV-1) neuroinvasiveness gene, J Exp Med 172(2):
487-96.

Jamieson, A. T., G. A. Gentry and J. H. Subak-Sharpe, 1974, Induction of both thymidine
and deoxycytidine kinase activity by herpes viruses, J Gen Virol 24(3): 465-80.





71

Jarman, R. G., E. K. Wagner and D. C. Bloom, 1999, LAT expression during an acute
HSV infection in the mouse, Virology 262(2): 384-97.

Jarman, R. G., J. M. Loutsch, G. B. Devi-Rao, M. E. Marquart, M. P. Banaszak, X.
Zheng, J. M. Hill, E. K. Wagner and D. C. Bloom, 2002, The region of the HSV-1
latency-associated transcript required for epinephrine-induced reactivation in the
rabbit does not include the 2.0-kb intron, Virology 292(1): 59-69.

Javier, R. T., K. M. Izumi and J. G. Stevens, 1988, Localization of a herpes simplex virus
neurovirulence gene dissociated from high-titer virus replication in the brain, J
Virol 62(4): 1381-7.

Jin, L., W. Peng, G. C. Perng, D. J. Brick, A. B. Nesbur, C. Jones and S. L. Wechsler,
2003, Identification of herpes simplex virus type 1 latency-associated transcript
sequences that both inhibit apoptosis and enhance the spontaneous reactivation
phenotype, J Virol 77(11): 6556-61.

Johnson, P. A. and R. D. Everett, 1986, The control of herpes simplex virus type-1 late
gene transcription: a 'TATA-box'/cap site region is sufficient for fully efficient
regulated activity, Nucleic Acids Res 14(21): 8247-64.

Kapoor, A. K., A. A. Nash, P. Wildy, J. Phelan, C. S. McLean and H. J. Field, 1982,
Pathogenesis of herpes simplex virus in congenitally athymic mice: the relative
roles of cell-mediated and humoral immunity, J Gen Virol 60(Pt 2): 225-33.

Kenny, J. J., F. C. Krebs, H. T. Hartle, A. E. Gartner, B. Chatton, J. M. Leiden, J. P.
Hoeffler, P. C. Weber and B. Wigdahl, 1994, Identification of a second
ATF/CREB-like element in the herpes simplex virus type 1 (HSV-1) latency-
associated transcript (LAT) promoter, Virology 200(1): 220-35.

Kieff, E. D., S. L. Bachenheimer and B. Roizman, 1971, Size, composition, and structure
of the deoxyribonucleic acid of herpes simplex virus subtypes 1 and 2., J Virol
8(2): 125-32.

Kristensson, K., E. Lycke and J. Sjostrand, 1970, Transport of herpes simplex virus in
peripheral nerves, Acta Physiol Scand: 13-4.

Kubat, N. J., R. K. Tran, P. McAnany and D. C. Bloom, 2004, Specific histone tail
modification and not DNA methylation is a determinant of herpes simplex virus
type 1 latent gene expression, J Virol 78(3): 1139-49.

Kwon, B. S., L. P. Gangarosa, K. D. Burch, J. deBack and J. M. Hill, 1981, Induction of
ocular herpes simplex virus shedding by iontophoresis of epinephrine into rabbit
cornea, Invest Ophthalmol Vis Sci 21(3): 442-9.

Kwon, B. S., L. P. Gangarosa, Sr., K. Green and J. M. Hill, 1982, Kinetics of ocular
herpes simplex virus shedding induced by epinephrine iontophoresis, Invest
Ophthalmol Vis Sci 22(6): 818-21.





72

Longnecker, R., S. Chatterjee, R. J. Whitley and B. Roizman, 1987, Identification of a
herpes simplex virus 1 glycoprotein gene within a gene cluster dispensable for
growth in cell culture, Proc Natl Acad Sci U S A 84(12): 4303-7.

Longnecker, R. and B. Roizman, 1987, Clustering of genes dispensable for growth in
culture in the S component of the HSV-1 genome, Science 236(4801): 573-6.

Loutsch, J. M., G. C. Perg, J. M. Hill, X. Zheng, M. E. Marquart, T. M. Block, H.
Ghiasi, A. B. Nesburn and S. L. Wechsler, 1999, Identical 371-base-pair deletion
mutations in the LAT genes of herpes simplex virus type 1 McKrae and 17syn+
result in different in vivo reactivation phenotypes, J Virol 73(1): 767-71.

Mackem, S. and B. Roizman, 1982, Differentiation between alpha promoter and regulator
regions of herpes simplex virus 1: the functional domains and sequence of a
movable alpha regulator, Proc Natl Acad Sci U S A 79(16): 4917-21.

Mackem, S. and B. Roizman, 1982, Regulation of alpha genes of herpes simplex virus:
the alpha 27 gene promoter-thymidine kinase chimera is positively regulated in
converted L cells, J Virol 43(3): 1015-23.

Maggioncalda, J., A. Mehta, O. Bagasra, N. W. Fraser and T. M. Block, 1996, A herpes
simplex virus type 1 mutant with a deletion immediately upstream of the LAT
locus establishes latency and reactivates from latently infected mice with normal
kinetics, J Neurovirol 2(4): 268-78.

Margolis, T. P., C. R. Dawson and J. H. LaVail, 1992, Herpes simplex viral infection of
the mouse trigeminal ganglion. Immunohistochemical analysis of cell populations,
Invest Ophthalmol Vis Sci 33(2): 259-67.

Margolis, T. P., D. C. Bloom, A. T. Dobson, L. T. Feldman and J. G. Stevens, 1993,
Decreased reporter gene expression during latent infection with HSV LAT
promoter constructs, Virology 197(2): 585-92.

Marquart, M. E., X. Zheng, R. K. Tran, H. W. Thompson, D. C. Bloom and J. M. Hill,
2001, A cAMP response element within the latency-associated transcript promoter
of HSV-1 facilitates induced ocular reactivation in a mouse hyperthermia model,
Virology 284(1): 62-9.

McGeoch, D. J., 1985, On the predictive recognition of signal peptide sequences, Virus
Res 3(3): 271-86.

McGeoch, D. J., A. Dolan, S. Donald and F. J. Rixon, 1985, Sequence determination and
genetic content of the short unique region in the genome of herpes simplex virus
type 1, J Mol Biol 181(1): 1-13.

McLennan, J. L. and G. Darby, 1980, Herpes simplex virus latency: the cellular location
of virus in dorsal root ganglia and the fate of the infected cell following virus
activation, J Gen Virol 51(Pt 2): 233-43.





73

Mehta, A., J. Maggioncalda, O. Bagasra, S. Thikkavarapu, P. Saikumari, T. Valyi-Nagy,
N. W. Fraser and T. M. Block, 1995, In situ DNA PCR and RNA hybridization
detection of herpes simplex virus sequences in trigeminal ganglia of latently
infected mice, Virology 206(1): 633-40.

Mellerick, D. M. and N. W. Fraser, 1987, Physical state of the latent herpes simplex virus
genome in a mouse model system: evidence suggesting an episomal state, Virology
158(2): 265-75.

Morrow, J. A. and F. J. Rixon, 1994, Analysis of sequences important for herpes simplex
virus type 1 latency-associated transcript promoter activity during lytic infection of
tissue culture cells, J Gen Virol 75 (Pt 2): 309-16.

Mott, K. R., N. Osorio, L. Jin, D. J. Brick, J. Naito, J. Cooper, G. Henderson, M. Inman,
C. Jones, S. L. Wechsler and G. C. Perg, 2003, The bovine herpesvirus-1 LR
ORF2 is critical for this gene's ability to restore the high wild-type reactivation
phenotype to a herpes simplex virus-1 LAT null mutant, J Gen Virol 84(Pt 11):
2975-85.

Nash, A. A., and P. Cambouropoulos, 1993, The immune system response to herpes
simplex virus, Semin, Virol 4:181-186

Nesburn, A. B., J. H. Elliott and H. M. Leibowitz, 1967, Spontaneous reactivation of
experimental herpes simplex keratitis in rabbits, Arch Ophthalmol 78(4): 523-9.

Nicosia, M., J. M. Zabolotny, R. P. Lirette and N. W. Fraser, 1994, The HSV-1 2-kb
latency-associated transcript is found in the cytoplasm comigrating with ribosomal
subunits during productive infection, Virology 204(2): 717-28.

O'Hare, P. and G. S. Hayward, 1985, Evidence for a direct role for both the 175,000- and
110,000-molecular-weight immediate-early proteins of herpes simplex virus in the
transactivation of delayed-early promoters, J Virol 53(3): 751-60.

Peng, W., G. Henderson, G. C. Pemg, A. B. Nesburn, S. L. Wechsler and C. Jones, 2003,
The gene that encodes the herpes simplex virus type 1 latency-associated transcript
influences the accumulation of transcripts (Bcl-x(L) and Bcl-x(S)) that encode
apoptotic regulatory proteins, J Virol 77(19): 10714-8.

Perng, G. C., E. C. Dunkel, P. A. Geary, S. M. Slanina, H. Ghiasi, R. Kaiwar, A. B.
Nesburn and S. L. Wechsler, 1994, The latency-associated transcript gene of herpes
simplex virus type 1 (HSV-1) is required for efficient in vivo spontaneous
reactivation of HSV-1 from latency, J Virol 68(12): 8045-55.

Perng, G. C., J. C. Zwaagstra, H. Ghiasi, R. Kaiwar, D. J. Brown, A. B. Nesburn and S.
L. Wechsler, 1994, Similarities in regulation of the HSV-1 LAT promoter in
corneal and neuronal cells, Invest Ophthalmol Vis Sci 35(7): 2981-9.





74

Pemg, G. C., H. Ghiasi, S. M. Slanina, A. B. Nesbum and S. L. Wechsler, 1996, The
spontaneous reactivation function of the herpes simplex virus type 1 LAT gene
resides completely within the first 1.5 kilobases of the 8.3-kilobase primary
transcript, J Virol 70(2): 976-84.

Pemg, G. C., S. M. Slanina, H. Ghiasi, A. B. Nesburn and S. L. Wechsler, 1996, A 371-
nucleotide region between the herpes simplex virus type 1 (HSV-1) LAT promoter
and the 2-kilobase LAT is not essential for efficient spontaneous reactivation of
latent HSV-1, J Virol 70(3): 2014-8.

Perg, G. C., K. Chokephaibulkit, R. L. Thompson, N. M. Sawtell, S. M. Slanina, H.
Ghiasi, A. B. Nesbum and S. L. Wechsler, 1996, The region of the herpes simplex
virus type 1 LAT gene that is colinear with the ICP34.5 gene is not involved in
spontaneous reactivation, J Virol 70(1): 282-91.

Perng, G. C., S. M. Slanina, A. Yukht, B. S. Drolet, W. Keleher, Jr., H. Ghiasi, A. B.
Nesburn and S. L. Wechsler, 1999, A herpes simplex virus type 1 latency-
associated transcript mutant with increased virulence and reduced spontaneous
reactivation, J Virol 73(2): 920-9.

Perng, G. C., S. M. Slanina, A. Yukht, H. Ghiasi, A. B. Nesbum and S. L. Wechsler,
2000, The latency-associated transcript gene enhances establishment of herpes
simplex virus type 1 latency in rabbits, J Virol 74(4): 1885-91.

Perg, G. C., C. Jones, J. Ciacci-Zanella, M. Stone, G. Henderson, A. Yukht, S. M.
Slanina, F. M. Hofman, H. Ghiasi, A. B. Nesburn and S. L. Wechsler, 2000, Virus-
induced neuronal apoptosis blocked by the herpes simplex virus latency-associated
transcript, Science 287(5457): 1500-3.

Pemg, G. C., S. M. Slanina, H. Ghiasi, A. B. Nesburn and S. L. Wechsler, 2001, The
effect of latency-associated transcript on the herpes simplex virus type 1 latency-
reactivation phenotype is mouse strain-dependent, J Gen Virol 82(Pt 5): 1117-22.

Perg, G. C., D. Esmaili, S. M. Slanina, A. Yukht, H. Ghiasi, N. Osorio, K. R. Mott, B.
Maguen, L. Jin, A. B. Nesbum and S. L. Wechsler, 2001, Three herpes simplex
virus type 1 latency-associated transcript mutants with distinct and asymmetric
effects on virulence in mice compared with rabbits, J Virol 75(19): 9018-28.

Pemg, G. C., B. Maguen, L. Jin, K. R. Mott, J. Kurylo, L. BenMohamed, A. Yukht, N.
Osorio, A. B. Nesburn, G. Henderson, M. Inman, C. Jones and S. L. Wechsler,
2002, A novel herpes simplex virus type 1 transcript (AL-RNA) antisense to the 5'
end of the latency-associated transcript produces a protein in infected rabbits, J
Virol 76(16): 8003-10.





75

Pemg, G. C., B. Maguen, L. Jin, K. R. Mott, N. Osorio, S. M. Slanina, A. Yukht, H.
Ghiasi, A. B. Nesburn, M. Inman, G. Henderson, C. Jones and S. L. Wechsler,
2002, A gene capable of blocking apoptosis can substitute for the herpes simplex
virus type 1 latency-associated transcript gene and restore wild-type reactivation
levels, J Virol 76(3): 1224-35.

Pizer, L. I., S. U. Kim, P. Nystrom and V. C. Coates, 1978, Herpes simplex virus
replication in pheochromocytoma cell line that responds to nerve growth factor,
Acta Neuropathol (Berl) 44(1): 9-14

Post, L. E. and B. Roizman, 1981, A generalized technique for deletion of specific genes
in large genomes: alpha gene 22 of herpes simplex virus 1 is not essential for
growth, Cell 25(1): 227-32.

Powell, K. L., R. Mirkovic and R. J. Courtney, 1977, Comparative analysis of
polypeptides induced by type 1 and type 2 strains of herpes simplex virus,
Intervirology 8(1): 18-29.

Preston, V. G. and F. B. Fisher, 1984, Identification of the herpes simplex virus type 1
gene encoding the dUTPase, Virology 138(1): 58-68.

Reed, L. J. and H. Muench, 1938, A simple method of estimating fifty percent endpoints,
Am. J. Hyg. 27: 493-497

Rock, D. L. and N. W. Fraser, 1983, Detection ofHSV-1 genome in central nervous
system of latently infected mice, Nature 302(5908): 523-5.

Rock, D. L. and N. W. Fraser, 1985, Latent herpes simplex virus type 1 DNA contains
two copies of the virion DNA joint region, J Virol 55(3): 849-52.

Rock, D. L., A. B. Nesburn, H. Ghiasi, J. Ong, T. L. Lewis, J. R. Lokensgard and S. L.
Wechsler, 1987, Detection of latency-related viral RNAs in trigeminal ganglia of
rabbits latently infected with herpes simplex virus type 1, J Virol 61(12): 3820-6.

Rodahl, E. and L. Haarr, 1997, Analysis of the 2-kilobase latency-associated transcript
expressed in PC12 cells productively infected with herpes simplex virus type 1:
evidence for a stable, nonlinear structure, J Virol 71(2): 1703-7.

Roop, C., L. Hutchinson and D. C. Johnson, 1993, A mutant herpes simplex virus type 1
unable to express glycoprotein L cannot enter cells, and its particles lack
glycoprotein H, J Virol 67(4): 2285-97.


Rubenstein, R. and R. W. Price, 1983, Replication ofthymidine kinase deficient herpes
simplex virus type 1 in neuronal cell culture: infection of the PC 12 cell, Arch
Virol 78(1-2): 49-64.





76

Sandri-Goldin, R. M., 1994, Properties of an HSV-1 regulatory protein that appears to
impair host cell splicing, Infect Agents Dis 3(2-3): 59-67.

Sawtell, N. M. and R. L. Thompson, 1992, Herpes simplex virus type 1 latency-
associated transcription unit promotes anatomical site-dependent establishment and
reactivation from latency, J Virol 66(4): 2157-69.

Sawtell, N. M., 1997, Comprehensive quantification of herpes simplex virus latency at
the single-cell level, J Virol 71(7): 5423-31.

Sawtell, N. M., 1998, The probability of in vivo reactivation of herpes simplex virus type
1 increases with the number of latently infected neurons in the ganglia, J Virol
72(8): 6888-92.

Sawtell, N. M., D. K. Poon, C. S. Tansky and R. L. Thompson, 1998, The latent herpes
simplex virus type 1 genome copy number in individual neurons is virus strain
specific and correlates with reactivation, J Virol 72(7): 5343-50.

Sawtell, N. M., R. L. Thompson, L. R. Stanberry and D. I. Bernstein, 2001, Early
intervention with high-dose acyclovir treatment during primary herpes simplex
virus infection reduces latency and subsequent reactivation in the nervous system in
vivo, J Infect Dis 184(8): 964-71.

Schang, L. M., A. Hossain and C. Jones, 1996, The latency-related gene of bovine
herpesvirus 1 encodes a product which inhibits cell cycle progression, J Virol
70(6): 3807-14.

Simmons, A. and A. A. Nash, 1987, Effect of B cell suppression on primary infection and
reinfection of mice with herpes simplex virus, J Infect Dis 155(4): 649-54.

Soares, K., D. Y. Hwang, R. Ramakrishnan, M. C. Schmidt, D. J. Fink and J. C. Glorioso,
1996, cis-acting elements involved in transcriptional regulation of the herpes
simplex virus type 1 latency-associated promoter 1 (LAP1) in vitro and in vivo, J
Virol 70(8): 5384-94.

Spear, P. G. and B. Roizman, 1972, Proteins specified by herpes simplex virus. V.
Purification and structural proteins of the herpesvirion, J Virol 9(1): 143-59.

Speck, P. G. and A. Simmons, 1992, Synchronous appearance of antigen-positive and
latently infected neurons in spinal ganglia of mice infected with a virulent strain of
herpes simplex virus, J Gen Virol 73 (Pt 5): 1281-5.

Spivack, J. G. and N. W. Fraser, 1988, Expression of herpes simplex virus type 1 (HSV-
1) latency-associated transcripts and transcripts affected by the deletion in avirulent
mutant HFEM: evidence for a new class of HSV-1 genes, J Virol 62(9): 3281-7.





77

Spivack, J. G. and N. W. Fraser, 1988, Expression of herpes simplex virus type 1 latency-
associated transcripts in the trigeminal ganglia of mice during acute infection and
reactivation of latent infection, J Virol 62(5): 1479-85.

Stevens, J. G., 1975, Latent herpes simplex virus and the nervous system, Curr Top
Microbiol Immunol 70: 31-50.

Stevens, J. G., E. K. Wagner, G. B. Devi-Rao, M. L. Cook and L. T. Feldman, 1987,
RNA complementary to a herpesvirus alpha gene mRNA is prominent in latently
infected neurons, Science 235(4792): 1056-9.

Tal-Singer, R., T. M. Lasner, W. Podrzucki, A. Skokotas, J. J. Leary, S. L. Berger and N.
W. Fraser, 1997, Gene expression during reactivation of herpes simplex virus type
1 from latency in the peripheral nervous system is different from that during lytic
infection of tissue cultures, J Virol 71(7): 5268-76.

Thompson, R. L., M. L. Cook, G. B. Devi-Rao, E. K. Wagner and J. G. Stevens, 1986,
Functional and molecular analyses of the avirulent wild-type herpes simplex virus
type 1 strain KOS, J Virol 58(1): 203-11.


Thompson, R. L. and N. M. Sawtell, 1997, The herpes simplex virus type 1 latency-
associated transcript gene regulates the establishment of latency, J Virol 71(7):
5432-40.

Thompson, R. L. and N. M. Sawtell, 2000, Replication of herpes simplex virus type 1
within trigeminal ganglia is required for high frequency but not high viral genome
copy number latency, J Virol 74(2): 965-74.

Thompson, R. L. and N. M. Sawtell, 2001, Herpes simplex virus type 1 latency-
associated transcript gene promotes neuronal survival, J Virol 75(14): 6660-75.

Tognon, M., D. Furlong, A. J. Conley and B. Roizman, 1981, Molecular genetics of
herpes simplex virus. V. Characterization of a mutant defective in ability to form
plaques at low temperatures and in a viral fraction which prevents accumulation of
coreless capsids at nuclear pores late in infection, J Virol 40(3): 870-80.

Wagner, E. K. and D. C. Bloom, 1997, Experimental investigation of herpes simplex
virus latency, Clin Microbiol Rev 10(3): 419-43.

Wagner, E. K., W. M. Flanagan, G. Devi-Rao, Y. F. Zhang, J. M. Hill, K. P. Anderson
and J. G. Stevens, 1988, The herpes simplex virus latency-associated transcript is
spliced during the latent phase of infection, J Virol 62(12): 4577-85.

Wechsler, S. L., A. B. Nesburn, R. Watson, S. Slanina and H. Ghiasi, 1988, Fine
mapping of the major latency-related RNA of herpes simplex virus type 1 in
humans, J Gen Virol 69 (Pt 12): 3101-6.





78

Wechsler, S. L., A. B. Nesbum, R. Watson, S. M. Slanina and H. Ghiasi, 1988, Fine
mapping of the latency-related gene of herpes simplex virus type 1: alternative
splicing produces distinct latency-related RNAs containing open reading frames, J
Virol 62(11): 4051-8.

Wechsler, S. L., A. B. Nesburn, J. Zwaagstra and H. Ghiasi, 1989, Sequence of the
latency-related gene of herpes simplex virus type 1, Virology 168(1): 168-72.

Whitley, R. J., E. R. Kern, S. Chatterjee, J. Chou and B. Roizman, 1993, Replication,
establishment of latency, and induced reactivation of herpes simplex virus gamma
1 34.5 deletion mutants in rodent models, J Clin Invest 91(6): 2837-43.

Zabolotny, J. M., C. Krummenacher and N. W. Fraser, 1997, The herpes simplex virus
type 1 2.0-kilobase latency-associated transcript is a stable intron which branches at
a guanosine, J Virol 71(6): 4199-208.

Zwaagstra, J., H. Ghiasi, A. B. Nesburn and S. L. Wechsler, 1989, In vitro promoter
activity associated with the latency-associated transcript gene of herpes simplex
virus type 1, J Gen Virol 70 (Pt 8): 2163-9.

Zwaagstra, J. C., H. Ghiasi, S. M. Slanina, A. B. Nesburn, S. C. Wheatley, K. Lillycrop,
J. Wood, D. S. Latchman, K. Patel and S. L. Wechsler, 1990, Activity of herpes
simplex virus type 1 latency-associated transcript (LAT) promoter in neuron-
derived cells: evidence for neuron specificity and for a large LAT transcript, J Virol
64(10): 5019-28.

Zwaagstra, J. C., H. Ghiasi, A. B. Nesburn and S. L. Wechsler, 1991, Identification of a
major regulatory sequence in the latency associated transcript (LAT) promoter of
herpes simplex virus type 1 (HSV-1), Virology 182(1): 287-97.













BIOGRAPHICAL SKETCH

In the Fall of 1993, I started at Mars Hill College in Mars Hill, North Carolina. At

Mars Hill, I majored in biology with a chemistry minor and completed my Bachelor of

Science in May of 1997. I then entered into the Microbiology doctoral program at

Arizona State University in the Fall of 1997. After two years, my mentor accepted a

position at the University of Florida and I subsequently transferred to continue my

research. At the University of Florida, I entered into the Molecular Genetics and

Microbiology department and completed my Ph.D. in May of 2004.




























79








I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.


David C. Bloom, Chair
Assistant Professor of Molecular Genetics
and Microbiology

I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.


Rich Condit
Professor of Molecular Genetics and
Microbiology

I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.


Sue Moyer
Professor of Molecular Genetics and
Microbiology

I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope an ality, as a
dissertation for the degree of Doctor of Philosophy./


Kevin Andnrsn
Associate Professor of Physiological
Sciences

This dissertation was submitted to the College of Medicine and to the Graduate
School and was accepted as partial fulfillment of the requirements for the degree of
Doctor of Philosophy.

May 2004 DM ed
Dean, College of Medicine



Dean, Gradte School