Progesterone and corticosteroid interaction during pregnancy in ewes

MISSING IMAGE

Material Information

Title:
Progesterone and corticosteroid interaction during pregnancy in ewes
Physical Description:
viii, 105 leaves : ill. ; 29 cm.
Language:
English
Creator:
Hua, Yi
Publication Date:

Subjects

Subjects / Keywords:
Progesterone -- physiology   ( mesh )
Pregnancy   ( mesh )
Sheep   ( mesh )
Hydrocortisone -- physiology   ( mesh )
Corticotropin   ( mesh )
Receptors, Mineralocorticoid   ( mesh )
Receptors, Glucocorticoid   ( mesh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 2002.
Bibliography:
Includes bibliographical references (leaves 86-104).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Yi Hua.

Record Information

Source Institution:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
oclc - 53985010
ocm53985010
System ID:
AA00024438:00001

Full Text










PROGESTERONE AND CORTICOSTEROID INTERACTION DURING
PREGNANCY IN EWES












By

YI HUA













A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2002





























A dedication to my parents, for their love and believing in me.















ACKNOWLEDGMENTS

First of all, I would like to thank my mentors, Dr. Charles Wood and Dr. Maureen

Keller-Wood for their immeasurable guidance, support and dedication to my doctoral

training. They are role models both in academic life and in real life for me. Their

enthusiastic attitude to science and their keen insight always inspired me when I felt in

the darkness of my research.

I am also very thankful to my committee members: Dr. Colin Sumners, Dr. Paul Oh

and Dr. Rosalia Simmen. They gave me a lot of intellectual advice for my project and

they were always there to help when I had any questions.

I thank Dr. Elaine Sumners for her help and patience. She taught me the techniques

step by step when I first came to the lab and gave me daily-basis trouble shooting for the

experiments.

My appreciation also goes to all the members in the lab for their encouragement,

support and friendship which made me confident and felt like I was part of a big family.

I thank my sister from the bottom of my heart for her support and taking care of our

parents during the hard times which made this dissertation possible.

Finally, my deep appreciation goes to my husband for his support, understanding and

love in every single aspect, which helped me achieve this height.








iii
















TABLE OF CONTENTS
page

ACKNOWLEDGMENTS............................................................................................ iii

A B ST R A C T ................................................................................................................ vii

CHAPTER

1 INTRODUCTION.................................................................................................... 1

2 LITERATURE REVIEW......................................................................................... 3

2.1 Corticosteroid and Corticosteroid Receptor.............................................................. 3
2.1.1 General Introduction................................................................................ 3
2.1.2 Pharmacological Characterization...........................................................4
2.1.3 Localization ............................................................................................... 5
2.1.4. Isoform s.................................................................................................... 6
2.1.4.1. Isoforms of GR............................................................................. 6
2.1.4.2 Isoforms of MR ............................................................................. 7
2.1.5 Genetic Characterization of MR and GR .................................... ............ 8
2.1.6 Mechanisms of Action............................................................................. 9
2.1.6.1 Genomic actions............................................................................ 9
2.1.6.2 Nongenomic action ...................................... .............................. 11
2.1.7 Specificity in Mineraloccorticoid verus Glucocorticoid Action .................. 11
2.1.8 MR/GR Mediated Physiological Function of Glucocorticoids................... 13
2.1.9 Regulation of Receptors ............................................................................. 14
2.1.10 11 P-Hydroxysteroid Dehydrogenase (11 3-HSD) ................................... 16
2.2 Corticosteroid and HPA Axis.......................................................................... 17
2.2.1 Introduction ............................................................................................. 17
2.2.2 Fast Feedback ................................................................................................ 18
2.2.3 Intermediate and Slow Feedback........................................................... 19
2.3 Hippocampus and Its Connection ................................................................... 20
2.3.1 Role of Hippocampus in HPA Regulation................................... .......... 20
2.3.2 Hippocampus and Its Connection...............................................................21
2.4 Physiological Adaptation During Pregnancy ...................................... ........... 22
2.4.1 Changes in Cardiovascular Function in Pregnancy................................... 22
2.4.2 Changes in Regulation of Cortisol and ACTH During Pregnancy................ 23
2.4.2.1 Basal activity ............................................................................... 23
2.4.2.2 Feedback sensitivity .................................................................... 24
2.4.3 Role of Ovarian/Placental Steroid ............................................ .......... ... 25



iv









2.4.3.1 E strogen........................................................................................... 25
2.4.3.2 Progesterone................................................................................... 26
2.4.4 Significance of Elevated Cortisol in Pregnancy.......................................... 27
2.5 Corticosteroids Effects on Serotonin Receptors................................. ............. 27
2.6 Animal Models.................................................................................................. 29
2.7 Significance....................................................................................................... 30
2.8 O bjectives.......................................................................................................... 31

3 GENERAL MATERIALS AND METHODS ........................................ ........... .. 36

3.1 A nim al C are ...................................................................................................... 36
3.2 General Surgical Procedure............................................................................. 36
3.2.1 Adrenalectomy and Ovariectomy.......................................................... 36
3.2.2 Vascular Catheterization ................................... .................................. 37
3.3 Chronic Steroid Implantation.......................................................................... 37
3.4 Tissue Collection............................................................................................... 37
3.5 Collecting Blood Samples and Measurement.................................... ............ 38
3.5.1 Sampling and Storage................................... .........................................38
3.5.2 Hormones: Cortisol, Aldosterone and Progesterone ................................. 38
3.5.3 Free Cortisol and Progesterone ............................................... ............ 39
3.6 Receptor Binding Assays ................................................................................ 39
3.6.1 General Methodology............................................................................ 39
3.6.1.1 Tissue preparation ...................................... ................................. 39
3.6.1.2 Incubation.................................................................................... 40
3.6.1.3 Separation of bound from free .......................................................... 42
3.6.2 Saturation Binding Analysis..................................................................... 42
3.6.3 Total Receptor Availability ................................................................... 43
3.7 Western Blot Analysis....................................................................................... 44
3.7.1 Tissue Preparation ................................................................................. 44
3.7.2 Electrophoresis and Transfer.................................................................... 44
3.7.3 MR Western Blotting Method ............................................................... 44
3.7.4 GR Western Blotting Method............................................................. 45
3.7.5 P-actin Western Blotting Method........................................... ............... 46
3.8 R T -PC R ............................................................................................................. 46
3.9 Statistic Analysis............................................................................................... 46

4 R T -PC R ................................................................ . ............. ........................................ 48

4.1 Semi-Quantitative RT-PCR ............................................................................ 49
4.1.1 RNA Extraction and Sample Preparation.................................................49
4.1.2 Primer Design..........................................................................................49
4.1.3 Semi-quantitative RT-PCR.................................................................... 50
4.1.4 PCR Product Purification and Sequencing............................... ............. 51
4.2 Real-Time RT-PCR........................................................................................... 52
4.2.1 RNA Extraction and Sample Preparation................................ ........... ... 52
4.2.2 Primer and Probe Design...................................................................... 53
4.2.3 Real-time RT-PCR ................................................................................ 54


v









4.2.3.1 M ixture .......................................................................................... 54
4.2.3.2 Primer, probe and starting RNA concentration............................... 54
4.2.3.3 RT-PCR cycles............................................................................ 55
4.2.4 Expression of Data ................................................................................ 55
4.3 Corticosteroid Receptor Regulation in Sheep after Acute Adrenalectomy.............55
4.3.1 Introduction ............................................................................................. 55
4.3.2 M ethods ................................................................................................... 56
4.3.3 R esults ..................................................................................................... 57
4.3.3.1 Semi-Quantitative analysis of mRNA for MR and GR................... 57
4.3.3.2 Sequence of PCR product of MR and GR......................................... 57
4.3.4 D iscussion ..................................................................................................... 58
4.4 MR Expression in Late-Gestation Ovine Fetal Lung............................ ........... 59
4.4.1 Introduction ............................................................................................. 59
4.4.2 M ethods ................................................................................................... 60
4.4.3 R esults ..................................................................................................... 60
4.4.4 D iscussion ............................................................................................... 60

5 ALTERATION OF MINERALOCORTICOID RECEPTOR FUNCTION BY
PREGNANCY AND PROGESTERONE................................................................. 66

5.1 Introduction ....................................................................................................... 66
5.2 Materials and Methods...................................................................................... 67
5.3 R esults ............................................................................................................ . 69
5.3.1 Cortisol, Progesterone and Aldosterone Level in Plasma ........................... 69
5.3.2 Total Available Receptor Binding at MR and GR in Hippocampus............. 69
5.3.3 Apparent Kd of MR with Cortisol in Hippocampus ..................................... 70
5.3.4 MR and GR Protein Levels and mRNA Expression in Hippocampus.......... 71
5.3.5 5-HT1A Receptor mRNA Level in Hippocampus...................................... 71
5.4 D iscussion ..................................................................................................... . . 72

6 SUMMARY AND CONCLUSIONS................................................................... 84

LIST OF REFERENCES ............................................................................................ 86

BIOGRAPHICAL SKETCH........................................................................................... 105















vi















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

PROGESTERONE AND CORTICOSTEROIDS INTERACTION DURING
PREGNANCY IN EWES
By

Yi Hua



December, 2002


Chair: Charles E.Wood
Cochair: Maureen Keller-Wood
Major Department: Physiology and Functional Genomics

Adrenal steroids are critical hormones for the maintenance of body homeostasis.

Cortisol and adrenalcorticotropic hormone (ACTH) are strictly regulated by a closed

feedback loop. During pregnancy, both plasma ACTH and cortisol levels increase in

sheep as well as in humans. This increased level of cortisol is important and necessary for

maternal and fetal normal health. Previous results showed that the set point for regulation

of ACTH and cortisol has been increased during pregnancy. This dissertation is trying to

explain why this set point can be increased and how it works.

Studies in rats showed that ACTH level is controlled by a dual receptor system. At

basal level of cortisol, it is controlled by mineralocorticoid receptor (MR) which has high

affinity and low capacity for corticosteroid. In stimulated situations when cortisol level

increases, it is controlled by glucocorticoid receptor (GR) which has low affinity and high




vii









capacity. I hypothesize that during pregnancy, with high level of progesterone, MR

function decreases and GR function keeps normal. I hypothesize progesterone acts as an

antagonist of cortisol at MR and/or reduces MR number in the pregnant state and it acts

with cortisol at GR as a partial agonist which results in the combined effects of

progesterone and cortisol. To test these hypotheses, we studied pregnant or progesterone-

treated nonpregnant ewes with sham adrenalectomy or adrenalectomy. Receptor binding

studies showed that there was a significant relationship between the plasma progesterone

concentration and the availability of MR, and between the plasma progesterone

concentration and the apparent Kd of MR for cortisol. There was a significant increase in

MR availability and Kd for cortisol in hippocampal cytosol in pregnant ewes as

compared to nonpregnant ewes whether they were sham- adrenalectomized or

adrenalectomized. The apparent Kd was also increased in the progesterone-treated,

nonpregnant adrenalectomized ewes relative to the nonpregnant adrenalectomized ewes

without progesterone treatment. There were no differences in hippocampal GR binding.

In addition, using Western blot and real-time RT-PCR, we measured the protein and

mRNA expression in hippocampus for MR as well as GR. No significant difference had

been detected.

These studies support the hypothesis that increased progesterone during pregnancy

reduces MR-mediated effects of cortisol, resulting in decreased feedback effects in the

hippocampus at the basal level of cortisol. In addition, GR-mediated effects of cortisol

haven't been changed by progesterone so that a feedback effects at the stimulated level of

cortisol during pregnancy are the same as in nonpregnant state.






viii














CHAPTER 1
INTRODUCTION

The adrenal steroid hormones are critical for maintenance of body homeostasis. The

concentrations of adrenocorticotropic hormone (ACTH) and cortisol, the major

glucocorticoid in human and sheep, are tightly regulated by a negative feedback loop axis

(Dallman et al., 1987b). However, during pregnancy, both maternal cortisol and ACTH

levels are increased in sheep, as well as in humans (Bell et al., 1991; Carr et al., 1981).

Previous studies in our laboratory in sheep showed that the set point for the feedback

regulation of basal plasma cortisol is increased during pregnancy (Keller-Wood, 1998).

This would allow the basal plasma concentration of cortisol to be maintained at a higher

level without suppression of ACTH, whereas further increases in cortisol concentration

would suppress plasma ACTH concentration, as it does in nonpregnant sheep. However,

the mechanism of the normal pregnancy-induced increase in set point for cortisol is

unknown.

Regulation of ACTH is thought to involve both corticosteroid receptor subtypes, the

mineralocorticoid receptor (MR) and the glucocorticoid receptor (GR). Whereas MR has

a high affiity for cortisol and is almost fully occupied at the basal concentration of

cortisol, GR has a lower affmity for cortisol, but higher capacity (de Kloet and Reul,

1987). We estimate that approximately 90% of MR, but only 30% of GR are occupied at

the basal steroid level in adrenal intact ewes. This difference in affinity and occupancy of

the two receptor subtypes has led to the hypothesis that MR are more involved in the

regulation of the basal concentration of cortisol, whereas GR participate in the feedback


1






2

regulation when the cortisol concentration increases (Bradbury et al., 1994;Reul et al.,

1987). The localization of MR and GR is also consistent with MR effects mediating

tonic, basal control of the axis, and GR mediating control of stimulated responses. GR is

distributed in all the brain regions, but MR has highest abundance in the hippocampus

(Herman et al., 1989a;Reul and DeKloet, 1985), suggesting that whereas glucocorticoid

feedback is exerted at multiple sites (including hypothalamus and pituitary), MR-

mediated feedback effects occur primarily in the hippocampus, which regulates basal

ACTH through inhibitory connections to the paraventricular nucleus (PVN) (Herman and

Cullinan, 1997).

It has been shown that progesterone can antagonize MR-mediated effects in vivo

(Wambach and Higgins, 1979;Spence et al., 1989) and in vitro (Jones et al.,

1977;Rupprecht et al., 1993). Progesterone has very high affinity for the human MR, but

progesterone exerts very low transcriptional activity after binding MR (Rupprecht et al.,

1993b). Progesterone also binds to human GR with an affinity similar to that of cortisol,

and exerts moderate activity after binding, suggesting that progesterone can act as partial

agonist at human GR. Progesterone has an approximately equal affinity compared to

cortisol at the ovine MR and lower affinity for ovine GR. Studies in rats have suggested

that progesterone treatment in vivo alters corticosterone binding at MR (Carey et al.,

1995). We therefore hypothesized that during pregnancy or during chronic progesterone

treatment, progesterone will act as an antagonist to cortisol binding at MR, reducing MR

availability and increasing the apparent Kd of MR for cortisol in hippocampal cytosol.














CHAPTER 2
LITERATURE REVIEW

Corticosteroids are hormones secreted from cortex of adrenal gland. They have

tremendous effects on different systems. Corticosteroid hormone action involves binding

to two intracellular receptors. Both of these two receptors can bind with corticosteroids.

However, they show a lot of differences in their pharmacological and physiological

characteristics. This dissertation is based on the hypothesis that elevated ovarian steroids,

especially the progesterone, contribute to the adaptation of pregnancy by decreasing

feedback effects at the basal level of cortisol without interfering with the feedback effects

when the level of cortisol are increased after stress or stimulation. This chapter reviews

the current knowledge about corticosteroids, their receptors and their regulation,

physiological adaptation during pregnancy, ovarian steroids' effects on corticosteroid

receptor and potential mechanisms for set point adaptation by progesterone.

2.1 Corticosteroid and Corticosteroid Receptor

2.1.1 General Introduction

Corticosteroids are synthesized in the adrenal gland and participate in the regulation of

physiological processes in a variety of organ systems (Miller, 1995). They exert a wide

range of functions throughout the body to keep the homeostasis of the body and respond

to stress or stimulus from internal or external environment. There are two types of

corticosteroid receptors, through which corticosteroids modulate their target tissues. The

two receptors co-localize in many tissues (McEwen et al., 1986). These receptors not

only mediate the physiological effects of corticosteroids, but also participate in the


3






4

feedback loop that regulates plasma levels of cortisol (Bradbury et al., 1994;Reul and

DeKloet, 1985).

2.1.2 Pharmacological Characterization

Corticosteroid receptor type I, also called the mineralocorticoid receptor (MR), have

high affinity with corticosteroids and low capacity (de Kloet and Reul, 1987). In different

species, its affinity with these hormones shows variation. The affinity's rank order for the

major circulating corticosteroids (corticosterone, cortisol, and aldosterone) is as follows.

In the rat and the mouse, which uses corticosterone as the principal corticosteroid, MR

displays a high affinity for aldosterone and corticosterone (~0.5 nM) and a lower affinity

for cortisol (Reul and DeKloet, 1985). In the dog, which like humans and sheep uses

cortisol as the principal corticosteroid, the MR also has a very high affmity for

corticosterone (~0.05nM) and a lower affinity (~0.2nM) for cortisol and aldosterone

(Reul et al., 1990). In human, MR binds those steroids with similar order: high affinity

for corticosterone (<0.0lnM), lower affinity for cortisol(0.13nM) and aldosterone

(0.09nM) (Rupprecht et al., 1993b). In Dr. Keller-Wood's lab, we characterized the

binding affiity in sheep. Ovine MR has similar high affinity for aldosterone (0.17 nM)

and cortisol (0.19nM). Because of its high affinity with corticosteroids, MR is almost

fully occupied at the basal concentration of cortisol. It is thought to mediate tonic actions

of corticosteroid.

Corticosteroid receptor type II, also called the glucocorticoid receptor (GR), has lower

affinity with glucocorticoid compared with MR and higher capacity. The parallel

experiments showed that in the rat, the GR has a relatively high affinity (but lower than

the MR) for corticosterone (~5nM) and even lower affinity for cortisol and aldosterone

(-20nM) (Reul and DeKloet, 1985). In the dog, the GR has an equal but lower affinity






5

than the MR for corticosterone and cortisol (~5nM) and two-fold lower affinity for

aldosteorne (-10nM) (Reul et al., 1990). In human, the GR has a lower affinity for

cortisol (15nM) than MR and much lower affinity for corticosterone (40nM) and

aldosterone (63nM) (Rupprecht et al., 1993b). In sheep, the GR's affinity for cortisol is

also lower than MR (0.7nM) and its affinity for aldosterone is even lower (10.2nM).

Therefore, GR is much less occupied at basal level of cortisol, but occupation increases

with the increase of cortisol concentration after internal or external stimulation. So, GR

shows its effects more when the cortisol level is relatively high. In our lab, we measured

and estimated that approximately 90% of MR and 30% of GR are occupied at the basal

steroid level in adrenal intact ewes. This difference in affinity and occupancy of the two

receptor subtypes has led to the hypothesis that MR is more involved in the regulation of

the basal level of cortisol at the feedback sites, while GR participates in the feedback

regulation when cortisol level increases (Bradbury et al., 1994;Reul et al., 1987).

2.1.3 Localization

By in situ hybridization and immunohistochemistry, different labs localized the MR

and GR in central nervous system and peripheral tissues. GR is widely expressed in most

cell types whereas MR expression is restricted to epithelial cells in kidney, colon and the

salivary glands, and non-epithelial cells in brain and heart (Reichardt and Schutz, 1998).

In the periphery, access of cortisol and corticosterone to MR is prevented by a pre-

receptor mechanism (see section on 11 1-HSD) and as a consequence,

cortisol/corticosterone binding to MR mainly plays a role in the brain. In the brain, GR is

widely distributed in a large number of CNS nuclei with higher concentrations in regions

involved in the stress response such as the paraventricular nucleus (PVN) of the






6

hypothalamus, anterior pituitary and in the hippocmapus (Herman et al., 1989a;Reul and

DeKloet, 1986;Van Eekelen et al., 1988). The distribution of MR is somewhat more

limited with the highest abundance in pyramidal neurons of the hippocampus (Herman et

al., 1989a;Reul and DeKloet, 1985), suggesting that whereas GR-mediated feedback is

exerted at multiple sites (including pituitary and hypothalamus, especially PVN), MR-

mediated feedback effects occur primarily in the hippocampus. The localization of MR

and GR is consistent with MR effects mediating tonic, basal control of the axis, and GR

mediating control of stimulated responses. Both MR and GR mRNA exhibit highest

levels of expression in the limbic system, most notably in the hippocampal formation.

However, within hippocampal formation, GR and MR show wide differences in relative

level of abundance. GR mRNA has highest levels in CA1, intermediate levels in dentate

gyrus (DG), and low levels in CA3, whereas MR signal is heaviest in CA2, CA3, is

approximately equal in intensity in CAl and DG (Aronsson et al., 1988;Arriza et al.,

1988;Herman et al., 1989a;Sousa et al., 1989;Van Eekelen et al., 1988;Yang et al., 1988).

The picture emerging from these reports is that both the concentration of circulating

corticoids and the cellular availability of the corticosteroid receptor subtypes are critical

in determining how individual cells interpret the corticoid signals

2.1.4. Isoforms

2.1.4.1. Isoforms of GR

In human, there are at least two isoforms of GR that have been identified, GRa and

GRP. They are the product of alternative splicing of the 3'-end of the GR (hGR), which

encodes the ligand binding domain (Encio and Detera-Wadleigh, 1991;Hollenberg et al.,

1985). Translation of GRa and GR3 produces two proteins identical in the first 727 N-







7

terminal amino acids containing the transactivation and DNA-binding domains. The only

difference is in their carboxy-terminal; as a result, GRa binds cortisol while GRO does

not (Oakley et al., 1996). GRa's activity is inhibited by GRO (Oakley et al., 1996). In rat

GR pre-mRNA lacks this splice site (Otto et al., 1997).

2.1.4.2 Isoforms of MR

Expression of the human MR gene may result in the formation of at least four

transcripts, which are derived from two different promoters (Arriza et al., 1987;Kwak et

al., 1993;Zennaro et al., 1995). The two main transcripts, MRa and MR3, are different in

5'-untranslated exon 1 and so they have identical amino acids. In rat, a MRy transcript

derived from exon 1 is detectable in very low amounts. There is also another splice

variant in MR, which is between exon 3 and 4. It creates a 12bp difference in mRNA and

4 amino acids in protein (Bloem et al., 1995). These four amino acids are in the two zinc

finger domains of the DNA-binding domain. A low abundance had been detected for this

splice variant in hippocampus in human and rat (Bloem et al., 1995). Since the difference

is in the DNA binding domain, it is quite possible that this splice variant would have

aberrant functional properties.

In ovine, the MR has not been cloned, but a 942 base pair segment of the ovine GR

corresponding to residues 143-453 of the human GR (80% identity) has been cloned

(Yang et al., 1992).

The availability of multiple isoforms of MR and GR indicates that the physiological

function of the steroid receptors is very complicated. Each receptor isoform would be

expected to have a different rank order of affinity for the endogenous ligands and each






8

ligand receptor complex would be expected to bind various genetic response elements

with varying affinity and efficacy.

2.1.5 Genetic Characterization of MR and GR

The amino acid sequences of the two proteins are highly homologous and their

structural and functional domains are similar (Arriza et al., 1987). Both receptors are

considered to be divided into functional domains designated domains A through F. The

DNA-binding domain is mapped to the well conserved middle region (C domain) of the

receptor. The less conserved carboxy-terminal E/F domain is the ligand binding domain.

The amino terminus is A/B domain. The amino terminal region contains an autonomous

activation function, AF-1. It was thought to be a key element in transactivation together

with AF-2, which is located at carboxy-terminal domains. The amino terminus varies in

size and bares no structural homology among the MR and GR. In human, the N-terminal

region of MR and GR has only 15% homology. This difference seems to be a critical

determinant for the different efficiency in stimulating gene expression by MR and

GR(Arriza et al., 1987;Arriza et al., 1988;Hollenberg et al., 1985;Rupprecht et al.,

1993b). In the GR, this region contains a stronger transactivation function than MR and is

necessary for efficient stimulation of gene transcription (Danielsen et al., 1987;Giguere et

al., 1986;Hollenberg and Evans, 1988). It has been shown that MR exerts a less

pronounced stimulation of transcription rate than the GR and does not show synergistic

activity on promoters containing two copies of a pallindromic binding site (Rupprecht et

al., 1993a). However, the carboxy-terminal ligand binding domain (57% identity in

human) and the cysteine rich zinc finger DNA binding domain (94% identity in human)

are highly homologous (Arriza et al., 1987) (Fig 2-1). These structural similarities allow

the two receptors to have similar steroid binding and activation profiles (Rupprecht et al.,






9

and to bind closely related DNA target sequences (Arriza et al., 1987). In addition, the

ligand-binding domain contains sequences responsible for heat-shock protein

interactions, nuclear translocation, dimerization and transcription activation function

(AF-2) (Hollenberg and Evans, 1988).

2.1.6 Mechanisms of Action

2.1.6.1 Genomic actions

2.1.6.1.1 DNA binding dependent mechanism

Corticosteroid receptors are nuclear receptors, which are ligand inducible transcription

factors that specifically regulate the expression of target genes. They reside in cytosol

associated with heat shock proteins (hsp)(two molecules of hsp90, one hsp70, one hsp56,

and an immunophilin) (Hutchison et al., 1994;Nathan and Lindquist, 1995;Smith and

Toft, 1993) Glucocorticoids can cross plasma membranes freely. After binding with the

ligand, the receptors will dissociate from heat shock proteins and form dimers (either

homodimer of MRMR/ GRGR or heterodimer of MRGR). The ligand-receptor complex

will then translocate into the nucleus where it binds to pallindromic consensus elements

on promoter sequences of target genes to have effects on the gene transcription

(Aronsson et al., 1988;Eriksson and Wrange, 1990). Depending on either the nature of

the DNA consensus sequence or interactions with other transcription factors, the steroid -

receptor complex can act as either positive or negative regulators of gene expression

(Drouin et al., 1989;Pearce and Yamamoto, 1993;Tsai et al., 1988). Numerous studies

showed that they act at the level of DNA to enhance recruitment of the preinitiation

complex of general transcription factors (GTFs) at target promoters. Liganded receptors

recruit members of the SRC (steroid receptor-coactivator) family, a group of structurally






10

and functionally related transcriptional coactivators. Receptors also interact with the

transcriptional cointegrators p300 and CBP, which are proposed to integrate diverse

afferent signals at hormone-regulated promoters (McKenna et al., 1999).

2.1.6.1.2 DNA binding independent mechanism

Apart from DNA binding-dependent mechanisms of GR and MR's function, DNA

binding-independent mechanisms are also used by both GR and MR. The studies of

targeted disruption of the GR DNA binding domain suggested that trancriptional

regulation by GR is achieved via DNA-binding dependent as well as independent

mechanims (Jonat et al., 1990;Schule et al., 1990;Yang-Yen et al., 1990). It is the cross-

talk between GR, MR and other transcription factors, such as activating protein 1(AP-1),

nuclear factor-KB(NF-KB), cAMP-response element binding protein(CREB), GATA-1

and Stat-5 (Caldenhoven et al., 1995;Imai et al., 1993;Stocklin et al., 1996). And we also

know now that not only repression can be exerted by GR/MR via protein-protein

interaction, but also activation can be exerted in this way.

By the studies of receptor with mutation at different region, especially a lot of studies

done with GR, it has been suggested that the HPA axis represents a physiological system

involving different modes of action. On the level of hypothalamus, repression of

corticotropin-releasing factor (CRF) synthesis by the GR is independent of receptor DNA

binding (Reichardt et al., 1998). Since mice with a targeted disruption of the GR gene

showed a dramatic upregulation of CRF in the median eminence (Kretz et al., 1999),

protein-protein interaction is most likely responsible for CRF repression. Possible targets

for such cross-talk are the transcription factors CREB and Nur77; for both, the CRF

promoter contains response elements (Murphy and Conneely, 1997;Seasholtz et al.,









1988). On the level of pituitary, DNA binding is required for repression of the POMC

gene (Reichardt et al., 1998). Obviously, binding of the GR to the negative GRE (nGRE)

in the promoter (Drouin et al., 1993) is a prerequisite for repression of basal POMC gene

transcription. DNA-binding-independent mechanisms are responsible for repression of

secretion (Reichardt et al., 2000)

2.1.6.2 Nongenomic action

While genomic steroid effects are characterized by their delayed onset of action since

time is needed for new protein production, and their sensitivity to blockers of

transcription and protein synthesis, the rapid action of steroids has been less widely

recognized, and characterized in detail. These nongenomic steroid effects are likely to be

transmitted via specific membrane receptors for steroids (Christ and Wehling,

1998;Picard, 1998;Wehling, 1997). Nongenomic steroid actions are mainly characterized

by short delay of onset (within 1-2 minutes). Investigators have used steroid coupled with

macromolecules, such as bovine serum albumin, which prevent the steroid from entering

the cell, to study this action. However, endocytosis resulting in the uptake of active

steroid into the cell might obscure the conclusion. We still do not completely understand

how or if nongenomic actions influence the HPA axis. One thing that should be kept in

mind is that the mechanism of corticosteroid receptor function might be more

complicated than what we have understood so far.

2.1.7 Specificity in Mineraloccorticoid verus Glucocorticoid Action

As described above, MR and GR share considerable structural and functional

homology, especially at their ligand binding domain and DNA binding domain. MR and

GR bind as dimers to common glucocorticoid-response elements (GRE), which comprise

or approximate the nucleotide sequence GCTACAnnnTGTTCT. No specific






12

mineralocrticoid-response element has been identified so far. However, MR and GR can

elicit markedly different physiological effects, even in cells expressing both receptors.

There are several mechanisms may be involved in delivering the specificity. First, it is

determined by the actions of 11 B-HSD (see detail in section of 11 P-HSD). Second,

different tissue may express different types of receptors, either MR or GR which deliver

the specificity by receptor availability. Beyond that, Pearce and Yamamoto also showed

that MR and GR mediate different effects at plfG, a 25-nucleotide "composite response

element" containing both a low-affinity GRE and an AP1 binding site. The API binding

site binds heterodimers of c-Fos and c-Jun (or c-Jun homodimers). An activated (ligand-

bound) GR can block c-Jun-c-Fos-enhanced transcription from the composite response

element, but an activated MR can not (Pearce and Yamamoto, 1993). With the use of

chimeras of MR-GR, a segment of the N-terminal region of GR (amino acids 105-440)

was shown to be required for this repression. Thus, the distinct physiological effects

mediated by MR and GR may be determined by differential interactions ofnonreceptor

factors with specific receptor domains at composite response elements. In tissues where

MR and GR are co-localized, such as lymphocytes, muscle and kidney cells and various

areas of the brain, especially the hippocampus, it has been shown that MR and GR can

form a heterodimer and might be more active than MR or GR homodimers (Trapp et al.,

1994). For homodimers of GRGR and MRMR, their transcription activities are different,

too. Usually, MR exerts a less pronounced sitmulation of transcription rate than the GR

and does not show synergistic activity on two copies of GRE as shown by GR (Rupprecht

et al., 1993a). This difference is thought to be due to the genetic structure difference at

the least conserved amino-terminal region of MR and GR.






13

Some evidence suggests intrinsic receptor properties also contribute to the ability of

this differentiation. Although the MR binds corticosterone and cortisol with a high

affinity, the aldosterone-MR complex is more potent than the cortisol/corticosterone-MR

complex since the half maximal effective dose is approximately 100-fold lower (Lombes

et al., 1994;Rupprecht et al., 1993b). Aldosterone dissociates more slowly from MR than

does cortisol, indicating that the stability of the aldosteorne-MR complex is higher than

that of the cortisol-MR complex (Hellal-Levy et al., 1999;Hellal-Levy et al.,

2000;Lombes et al., 1990) and this slow off-rate of aldosterone from MR is responsible

for its high efficiency in stimulating MR transcriptional activity.

2.1.8 MR/GR Mediated Physiological Function of Glucocorticoids

Glucocrticoids are of major importance for maintaining cellular and humoral

homeostasis. They exert these functions by MR and GR.

In the periphery, one of the well-established functions assigned to glucocorticoids is

the control of carbohydrate and lipid metabolism. For example, the glucocorticoids

induce glucose synthesis by activation of gluconeogenesis, and important genes involved

in this process such as glucose-6-phosphatase, phosphoenolpyruvate

carboxykinase(PEPCK), and tyrosine aminotransferase (TAT) have been shown to be

direct targets of glucocorticoids (Ruppert et al., 1990). In the lung, glucocorticoids are

able to promote maturation during development, and in the adrenal gland, they are

involved in the biosynthesis of catecholamines. Furthermore, glucocorticoids participate

in the suppression of inflammatory reactions, which is achieved by repressing mRNA

expression of cytokines and regulation of lymphocyte migration (Barnes and Adcock,

1993).Additionally, glucocorticoids are able to induce apoptosis ofthymocytes






14

(Chapman et al., 1996), and in the erythroid compartment they are involved in long-term

proliferation of erythroblasts (Wessely et al., 1997).

In the central nervous system, glucocorticoids are involved in the negative feedback

regulation of the HPA-axis, but they also have tremendous effects on behavior, learning,

and memory (McEwen and Sapolsky, 1995;McGaugh et al., 1996;Sapolsky, 1996). Both

receptor species are present during development, implying ability for these transcription

factors to interact with neuronal differentiation, growth, and viability. Cognitive process,

electrophysiological properties of hippocampal neurons, and anxiety clearly involve

glucocorticoid action, and both the GR and the MR may contribute to these effects.

Hipppocampus is a key site for these functions. Brain MR and GR also appear to regulate

neural control of blood pressure (Gomez-Sanchez and Gomez-Sanchez, 1992;Kageyama

and Bravo, 1988;Peysner et al., 1990). Some evidence suggests that brain MR modulate

sympathetic outflow and it is possibly mediated by the brain renin-angiotensin system

(Takahashi et al., 1983;Van den Berg et al., 1994b;Van den Berg et al., 1994a). Currently

available data suggest activation of central MR increases sympathetic outflow and central

GR decreases or does not control sympathetic outflow to the vascular system (Gomez-

Sanchez et al., 1990;van den Berg et al., 1990). For the effects on HPA-axis, it was

proposed that MR mediates the tonic inhibitory control of the hippocampus in HPA

activity, whereas GR mediates the negative feedback of elevated glucocorticoid levels to

restrain HPA drive (de Kloet and Reul, 1987)(see detail in section 2.3 hippocampus and

its connection).

2.1.9 Regulation of Receptors

Corticosteroid receptors levels are regulated at multiple levels including mRNA and

protein (Oakley and Cidlowski, 1993;Schmidt and Meyer, 1994) At the protein level,






15

steroid receptors undergo hormone dependent hyperphosphorylation (Orti et al.,

1992;Weigel, 1996). Recent studies showed that phosphorylation status plays an

important role in receptor's stability and turnover (Webster et al., 1997). It is a major

signal in ubiquitination and proteosome mediated degradation and thus regulates the

number of receptors in cytosol and their ability to transactivate (Wallace and Cidlowski,

2001). Phosphorylation is thought to be the signal to allow substrate recognition by

enzymes in the ubiquitination pathway. Poly-ubiquitination of a protein is recognized by

the multi-subunit protein complex known as the proteasome, which degrades the protein

into small peptides and amino acids. This is at least part of the reasons for ligand

dependent down-regulation of the receptors. Studies examining the half-life of the GR

protein, separate from any ligand affects on RNA, have shown that ligand occupation of

the receptor significantly decreases GR protein half-life from eighteen hours to nine

hours (Dong et al., 1988;Hoeck et al., 1989). Phospho-deficient mutant of mouse GR

does not undergo ligand dependent down-regulation (Webster et al., 1997)

At mRNA level, many studies showed that glucocorticoid treatment significantly

decreased mRNA level of GR and MR in many different tissues (Burstein et al.,

1994;Dong et al., 1988;Okret et al., 1986). Also, adrenalectomy-induced steroid depletion

elicits reliable increases in the GR mRNA from 40-100%, as measured in different labs

by a variety of methods, including Northern, RNAse protection, and in situ hybridization

analyses (Herman et al., 1989a;Herman, 1993;Kalinyak et al., 1987;Patel et al.,

1992;Peiffer et al., 1991;Reul et al., 1989;Sheppard et al., 1990). Adrenalectomy effects

on MR mRNA expression are smaller, falling in the 25-50% range (Herman et al.,

1989a;Herman, 1993;Patel et al., 1992;Reul et al., 1989)






16


2.1.10 11 P-Hydroxysteroid Dehydrogenase (11 P-HSD)

There is an enzyme called 11 3-Hydroxysteroid dehydrogenase (11 0-HSD). It plays

an important role in controlling the local tissue concentration of cortisol. Two distinct

isoforms of 11 P-HSD have been identified, 11 P-HSD type 1 and type 2. (Michael et al.,

1997;Tetsuka et al., 1997). 11 3-HSD type 2 primarily catalyzes the reaction in one

direction, resulting in the conversion of physiological glucocorticoids (cortisol in human

and sheep, corticosterone in rats) to inactive 11-keto products (cortisone, 11-

dehydrocorticosterone) (Seckl, 1993). 11 P-HSD type 1 is bi-directional (Monder and

White, 1993) and has a relatively low affinity (in the uM range) for cortisol and

corticosterone. It appears to proceed in the direction favoring conversion of cortisone to

cortisol or 11-dehydrocorticosterone to corticosterone at physiological glucocorticoid

concentration (Mercer et al., 1993;Michael et al., 1997;Monder and Lakshmi, 1989;Seckl,

1993). As a result, 11 P-HSD type 1 appears to inactivate glucocorticoids only when

circulating concentrations are high (Seckl, 1993). This isoform exists in the liver of most

species and the brain of species including the sheep and human (Seckl, 1993). The

relative expression of the two types of 11 3-HSD in specific organs modifies cortisol

exposure by interconversion between active and inactive glucocorticoids. Cortisone or

11-dehydrocorticosterone do not bind to or activate receptors, and thus controls

corticosteroids access to receptors in a tissue specific manner. 11 3-HSD type 2

colocalizes with MR, protects MR from cortisol and lets MR combine with aldosterone in

the kidney of most species (Funder, 1996), so that in the kidney, most of MRs are

occupied by aldosterone instead of cortisol. Deficiency of 11 P-HSD type 2 in humans

leads to the syndrome of apparent mineralocorticoid excess (SAME), in which cortisol






17

illicitly occupies MR, causing sodium retension, hypokalemia, and hypertension. In rats

this enzyme is also present in the brain (Lakshmi et al., 1991), but in ewes, there is no

detectable 11 P-HSD type 2 activity in brain. In the ovine brain it is thought that

conversion is in the opposite direction, from cortisone to cortisol (Kim et al., 1995) and it

is catalyzed by 11 I-HSD type 1. This results in the possibility that MR is not protected

in the brain and cortisol can have an action via MR in the brains of sheep.

2.2 Corticosteroid and HPA Axis

2.2.1 Introduction

Glucocorticoid secretion of the adrenal cortex is stimulated by pituitary release of

ACTH, which is one of the end products generated from the large precursor molecule,

pro-opiomelanocortin (POMC). ACTH, in turn, is under the control of a number of

hypothalamic releasing and inhibiting factors, of which CRF and vasopressin (VP) are

the best known. Both peptides are colocalized in parvocellular neurons of the

paraventricular nucleus (PVN) which project to the median eminence and release the

peptides in the portal vessel system (Plotsky et al., 1991). The parvocellular PVN neurons

receive information from numerous brain regions, such as nuclei of limbic system, brain

stem nuclei and the suprachiasmatic nuclues. Hypothalamic PVN appears to be the

crucial focus for central regulation of the HPA axis.

Levels of corticosteroids are tightly regulated by the closed feedback loop of HPA axis

(Fig 2-2). It is regulated at a set point by cortisol negative feedback on ACTH and CRF

(Dallman et al., 1987a). Small physiological increases in plasma cortisol suppress ACTH

in a logarithmic manner (Keller-Wood and Dallman, 1984). The pituitary corticotrophs

and the parvocellular PVN are well-established targets for the suppressive action of high






18

amounts of endogenous corticosterone or cortisol and exogenous synthetic

glucocorticoids on stress-induced HPA activity(Dallman et al., 1987a;Keller-Wood and

Dallman, 1984). GR are abundant in these cells and thought to be involved in this

feedback regulation after stress or stimulation. As described above in section of receptor

localization, MR doesn't show a high expression in these areas. It has highest abundance

in hippocampus. Hippocampus is also an important site in cortisol feedback regulation

since the PVN neurons of hypothalamus receive input from hippocampal neurons.

Hippocampal MRs are important in terms of exerting inhibitory tone over the HPA axis

(see detail in section 2.3 hippocampus and its connection).

There appear to be three major time frames of corticosteroid action: fast (seconds to

minutes), intermediate (hours) and slow (hours to days). These time frames probably are

the consequence of three separate mechanisms of corticosteroid action at feedback-

sensitive sites. MR and GR mediate intermediate and slow feedback inhibition of the axis

in the hippocampus (Jacobson and Sapolsky, 1991), hypothalamus, pituitary, and perhaps

even the adrenal itself (Keller-Wood and Dallman, 1984). The receptors involved in fast

feedback inhibition are unknown.

2.2.2 Fast Feedback

The time of occurrence of fast feedback is not compatible with a nuclear site of

corticosteroid action, and protein synthesis is not required. Dallman and Yates also

postulated that this fast feedback is rate sensitive (Dallman and Yates, 1969).

Glucocorticoid feedback inhibition has been demonstrated to have rapid effects on both

stimulated CRF secretion (Vermes et al., 1977) and stimulated ACTH secretion

(Buckingham and Hodges, 1977;Vale and River, 1977). Although the mechanism of fast

inhibition is unknown, the rapidity of the effect suggests that the effect is on hormone






19


release and not hormone synthesis, and that protein synthesis is not involved. Some

studies suggest that fast feedback acts to stabilize the cell membrane and that fast

feedback involves Ca++ fluxes.

2.2.3 Intermediate and Slow Feedback

Intermediate and slow feedback inhibition requires genomic events and protein

synthesis (Keller-Wood and Dallman, 1984). While intermediate feedback inhibits the

release of ACTH and the synthesis and release of CRF, slow feedback inhibits both the

synthesis and release of CRF and ACTH (Keller-Wood and Dallman, 1984).

Intermediate (and fast) feedback would be expected to occur under physiological

conditions when increases in plasma corticosteroids are produced in response to moderate

or punctuate stress. While slow feedback would only occur under pathological conditions

or under pharmacological treatment of corticosteroids when increased corticosteroid can

be kept for at least several days. Under normal conditions, therefore, decrease in POMC

mRNA synthesis or pituitary ACTH content would not be expected to occur following

moderate stress.(Keller-Wood and Dallman, 1984).

These three feedbacks have their specific roles in regulation of the HPA axis

respectively. Fast, rate sensitive feedback controls the rate and magnitude of ACTH in

response to a stress or stimulation. Delayed or intermediate feedback may limit the

response of the system to repeated stimulus within a relatively short period of time

(hours), while slow feedback limit the response to repeated stimulus during prolonged

period of time (days).(Keller-Wood and Dallman, 1984)






20


2.3 Hippocampus and Its Connection

2.3.1 Role of Hippocampus in HPA Regulation

The importance of maintaining glucocorticoid secretion with tolerable limits requires

an efficient mechanism. This process appears to be accomplished by multiple pathways.

As described above, PVN is an important negative feedback site in HPA axis. However,

feedback at the PVN or pituitary can not account for all aspects of HPA inhibition. A lot

of evidence supports the existence of neuronal inhibitory pathways working in parallel

with steroid feedback. Furthermore, total or anterior deafferentations of the PVN increase

the expression of mRNA of CRF and AVP (Herman et al., 1990), indicating that the one

or more neuronal inhibitory pathways are also required for maintenance of basal HPA

tone.

Neuronal mediated inhibition of the HPA axis might emanate from several sources.

Perhaps the most intensely studied of these has been the hippocampus. The hippocampus

has been implicated in the neuronal regulation of the HPA axis activity by several

different research groups (Feldman and Conforti, 1980;Herman et al., 1989b;Jacobson

and Sapolsky, 1991;Magarinos et al., 1987;Sapolsky et al., 1984). Implication of the

hippocampus as a suprahypothalamic site mediating glucocorticoid feedback inhibition of

the HPA axis was suggested by the demonstration that the hippocampus exhibits the

highest brain levels of glucocorticoid binding and high-affinity receptors of

glucocorticoid (Herman, 1993;Jacobson and Sapolsky, 1991). Both lesion and electrical

stimulation studies suggest an overall inhibitory influence of the hippocampus on HPA

activity (Jacobson and Sapolsky, 1991). Dorsal hippocampectomy or transection of the

fornix elevates the basal HPA activity at the circadian trough in particular, and CRF

mRNA and VP mRNA expression in the morning.(Herman et al., 1989b). Conversely,






21

stimulation of the hippocampal formation results in decreased HPA activity in both rat

and human (Jacobson and Sapolsky, 1991). The effect of hippocampal manipulation on

the HPA axis is "state dependent," varying both during the day and with or without

stress, suggesting a modulatory role for corticosteroids (Canny et al., 1989;De Kloet et

al., 1991 ;Jacobson and Sapolsky, 1991). Hippocampal MRs, which have higher affinity

with corticosteroid compared to GR, are important in terms of control of inhibitory tone

over the HPA axis. This effect of corticosteroid via MRs is modulated by GRs that

become progressively occupied after stress, which also negatively feed back on the PVN

(Fig.2-3).

2.3.2 Hippocampus and Its Connection

It is generally accepted that hippocampal formation plays a key role in animals'

reactivity to novelty and provides an essential contribution to learning and memory

(Gray, 1987).

Anatomically, the hippocampus has two major outputs: multisynaptic pathways to the

cerebral cortex and a massive descending projection directly to the lateral septum of the

basal ganglia. It has been shown that the descending output is organized in such a way

that different hippocampal regions map in an orderly way onto hypothalamic systems

mediating the expression of different classes of goal-oriented behavior (Risold and

Swanson, 1996). This mapping is characterized by a unidirectional hippocampo-lateral

septal projection and then by bidirectional lateral septo-hypothalamic projections, all

topographically organized. The bed nucleus of the stria terminalis (BST) may convey

excitation of the HPA axis. This limbic forebrain structure links regions such as the

amygdala and hippocampus with hypothalamic and brainstem regions controlling vital






22

homeostatic functions, such as the PVN (Cullinan et al., 1993;Moga et al., 1989;Weller

and Smith, 1982).

In summary, hippocampus plays an important role in regulation of HPA axis. Under

basal conditions, MRs mediate tonic inhibitory effects of in HPA activity, whereas under

condition of elevated cortisol level, the GR mediates the negative feedback to restrain

HPA drive (de Kloet and Reul, 1987). Hippocampus has its input to PVN of

hypothalamus via GABA containing neurons. It has its inhibitory effects by stimulating

GABAnergic neurons.

2.4 Physiological Adaptation During Pregnancy

Pregnancy involves profound changes in the hormones and tissues of the reproductive

axis and tract. However, pregnancy also induces changes in cardiovascular function and

in hormones involved in regulating pressure, volume and blood flow, including the renin-

angiotensin system, vasopressin and the HPA axis.

2.4.1 Changes in Cardiovascular Function in Pregnancy

During pregnancy blood volume is increased by 20-50% and cardiac output is

increased proportionately. Mean arterial pressure is decreased, reflecting decreased

peripheral resistance (Christianson, 1976;Metcalfe and Parer, 1966). This is accompanied

by a decrease in vascular responses to pressor agents (Longo, 1983). There is evidence in

a number of species that baroreflex control of blood pressure is altered in the pregnant

state (Brooks and Keil, 1994;Crandall and Heesch, 1990;Heesch and Rogers,

1995;Humphreys and Joels, 1977;Ismay et al., 1979); the baroreceptors regulate pressure

about the lower set-point with reduced sensitivity. Hormone responses to hypotension

and to hemorrhage are altered by pregnancy (Brooks and Keil, 1994); there is a decreased

response to hypotension, but the response to volume loss occurs with a smaller percent






23

loss in pregnant subjects. These results are consistent with a reset of regulated blood

volume to a higher level and reset of blood pressure to a lower level in the pregnant state.

The alterations in regulated blood pressure, volume, and baroreflex regulation in the

pregnant state likely represents a combination of effects of many hormones (Longo,

1983). The estrogen, progesterone and cortisol's effects on the renin-angiotensin system,

nitric oxide, uteroplacental circulation may all contribute to these changes.

2.4.2 Changes in Regulation of Cortisol and ACTH During Pregnancy

2.4.2.1 Basal activity

During pregnancy, both plasma maternal ACTH and cortisol increased in sheep as

well as in human (Bell et al., 1991;Carr et al., 1981). The plasma cortisol level is almost

doubled compared with nonpregnant sheep. Both total and free cortisol concentrations are

also increased. Previous studies in Dr. Keller-Wood's lab showed that in sheep the set

point for the feedback regulation of basal plasma cortisol is increased during pregnancy

(Keller-Wood, 1998). The mechanism of the normal pregnancy induced increase in set

point for cortisol remains unknown. Although elevated concentrations of plasma

corticosteroid binding globulin (CBG) may contribute to the elevation in plasma cortisol

in women, CBG concentration does not increase in the pregnant ewe and the

concentration of the free plasma cortisol is increased in both species during pregnancy

(Keller-Wood, 1996). Extrapituitary secretion of ACTH or corticotropin-releasing

hormone (CRF) has been proposed by a number of investigators as a stimulus to

adrenocortical secretion in pregnancy (Campbell et al., 1987;Rees et al., 1975), however,

in humans the CRF in plasma during pregnancy is bound to a protein (Orth and Mount,

1987;Suda et al., 1988)so that only a small proportion is biologically active. In sheep, Dr.

Keller-Wood' lab found that there was no net secretion of ACTH or CRF from the






24

placenta under basal conditions or during hypoxia induced by maternal inhalation of a

hypoxic gas mixture. Therefore, neither extra pituitary secretion of ACTH nor extra

hypothalamic secretion of CRF seem to adequately explain the change in ACTH or free

cortisol in pregnancy (Allolio et al., 1990;Keller-Wood and Wood, 1991a;Keller-Wood

and Wood, 1991b), or the change in relationship between cortisol and ACTH.

2.4.2.2 Feedback sensitivity

During pregnancy the feedback regulation of HPA axis has been attenuated. Evidence

also suggests the ability of dexamethasone to reduce free cortisol concentrations be

attenuated in the pregnant women (Nolten and Rueckert, 1981;Odagiri et al., 1988).

However, pregnancy does not reduce the absolute suppression of ACTH by a two-hour

infusion of cortisol in the sheep (Keller-Wood, 1996). Decreasing cortisol to levels less

than normal for pregnancy (but similar to those of nonpregnant subjects ) can

dramatically increase plasma ACTH. Increase in cortisol, to levels similar to those during

stress, decreases ACTH concentration in pregnant animals to the same extent as in

nonpregnant animals(Keller-Wood and Wood, 2001). These results suggested that during

pregnancy, the regulation of ACTH by cortisol at basal levels, but not the effects of

elevated or stimulus-induced increases in cortisol, is altered. The HPA axis feedback still

exists, but it has been set at a higher level. Since MR is the high affinity receptor that is

activated by basal concentration of cortisol, the inability of low concentrations of cortisol

to decrease ACTH suggests that the MR-mediated mechanism, rather than the GR-

mediated mechanism, may be altered during pregnancy.






25


2.4.3 Role of Ovarian/Placental Steroid

2.4.3.1 Estrogen

Estrogens appear to cause generalized increases in basal ACTH and ACTH responses

to stimuli. For examples, female rats tend to have higher circulating levels of both ACTH

and corticosterone than male rats and in cycling female rats, the HPA axis is significantly

more responsive during proestrus (when estradiol levels are highest) than during estrous

or diestrous (Viau and Meaney, 1991). Estrogens increase activity of the axis by

increasing hypothalamic CRF expression (Hiroshige and Wada-Okada, 1973), adrenal

responsiveness to ACTH (Kitay, 1975), and attenuating the glucocorticoid feedback

signal (Burgess and Handa, 1992;Redei et al., 1994). Although estrogens have been

shown to decrease corticosterone binding capacity at MR in the hippocampus and

estrogen treatment can cause a decrease in the mRNA for MR in the CA2 region of the

hippocampus (Carey et al., 1995), the progesterone appeared to attenuate the effects of

estrogen on both MR binding capacity and mRNA (Carey et al., 1995), suggesting that in

the pregnant state these effects of estrogen may not be expressed. In summary, the

activating effects of estrogens may play a role in the adaptation of the axis to pregnancy,

but since absolute feedback sensitivity is not reduced during ovine pregnancy, the effects

of estrogens on feedback do not appear to be physiologically relevant to pregnancy.

Further, ACTH and cortisol levels in pregnancy also do not appear to temporally follow

the pattern of increase in estrogens, particularly in sheep in whom an increase in cortisol

occurs before 90 days, but the increase in estrogens (primarily estrone) is small within the

last 1-2 weeks of pregnancy.






26

2.4.3.2 Progesterone

Progesterone's effects on HPA axis is the theme of this whole dissertation. Evidence

suggests that progesterone could antagonize feedback regulation of the HPA axis and has

been thought to act as an anti-corticosteroid. Progesterone administration reduces the

hypertensive effect of aldosterone (Landau and Lugibihl, 1958). In relatively high doses,

progesterone also appears to antagonize corticoid inhibition of CRF and ACTH secretion

(Abou-Samra et al., 1984;Duncan and Duncan, 1979;Jones and Hillhouse, 1976). In the

absence of cortisol, progesterone appears to have partial agonist activity to inhibit CRF

and ACTH (Buckingham, 1982;Vale et al., 1978). In Dr. Keller-Wood's lab, data have

shown that acute treatment with progesterone reduced the inhibition of ACTH produced

by infusion of cortisol (Keller-Wood et al., 1988). This effect was found with an infusion

of progesterone that increased plasma progesterone to concentrations within the

physiological range.

It has been shown that progesterone can antagonize MR-mediated effects in vivo

(Spence et al., 1989;Wambach and Higgins, 1979) and in vitro (Jones et al.,

1977;Rupprecht et al., 1993b). Progesterone has very high affinity for the human MR,

but progesterone exerts very low transcriptional activity after binding MR (Rupprecht et

al., 1993b). Progesterone also binds to human GR with an affinity similar to that of

cortisol, and exerts moderate activity after binding, suggesting that progesterone can act

as partial agonist at human GR. Progesterone has an approximately equal affinity

compared to cortisol at the ovine MR and lower affinity for ovine GR. Studies in rats

have suggested that progesterone treatment in vivo alters corticosterone binding at MR

(Carey et al., 1995). We therefore hypothesized that during pregnancy or during chronic

progesterone treatment, progesterone will act as an antagonist to cortisol binding at MR,






27

reducing MR availability and increasing the apparent Kd of MR for cortisol. The first

region we studied is hippocampus in this dissertation. As described above, hippocampus

is one of the most important sites which regulates the tonic activity of HPA axis.

Hypothalamus, pituitary, brainstem and kidney are also important and will be studied in

the future.

2.4.4 Significance of Elevated Cortisol in Pregnancy

The elevated cortisol is necessary and critical for normal pregnancy. In experiments in

pregnant ewes in Dr. Keller-Wood's lab, we have found that there was an increased

incidence of fetal loss and abortion when ewes were adrenalectomized and replaced with

cortisol to levels less than normal for pregnant ewes (i.e. normal for nonpregnant ewes).

We are currently studying the role of reduced maternal cortisol on fetal volume

homeostasis and growth.

In human, cases of hyper- or hypocorticism in pregnant women are relatively rare

because these conditions are also associated with infertility. However, it has been

observed that woman with untreated hyper- or hypocorticism during pregnancy appears

to have increased incidence of fetal death or abortionn (Aron et al., 1990;O'Shaughnessy

and Hackett, 1984;Osler, 1962;Pickard et al., 1990). When Addison's disease presents

during pregnancy there appears to be a decrease in birth weight relative to gestational age

(O'Shaughnessy and Hackett, 1984;Osler, 1962), and an increased risk of maternal death,

particularly in late gestation, during labor or in the immediate peripartum period (Drucker

et al., 1984;Seaward et al., 1989).

2.5 Corticosteroids Effects on Serotonin Receptors

Serotonin (5-hydroxytryptamine, 5-HT) neurotransmitter system and the HPA axis

have a reciprocal regulatory function in the feedback management of an organism's






28

response to stress. Serotonergic cell bodies are located in the raphe and project to many

brain areas, including the hippocampus, hypothalamus and cortex. 5-HT receptors are G-

protein coupled receptors. Seven distinct families of 5-HT receptors (5-HT 1-5-HT7) have

been identified so far. Subpopulations have been described for several of these. At least

15 subpopulations have been cloned. The 5-HT1A receptor is a somatodendritic

autoreceptor in raphe neurons that mediates a reduction in firing rate. The 5-HT1A

receptor is also found postsynaptically in brain nuclei receiving 5-HT axon projections. It

is strongly expressed in the hippocampus, septum, and other limbic areas (Albert et al.,

1990;Pompeiano et al., 1992) and functions as a key regulator of the limbic system. It has

been shown that 5-HT1A receptor is suppressed by corticosteroids.(Neumaier et al.,

2000;Nishi and Azmitia, 1996;Wissink et al., 2000). Electrophysiological studies have

demonstrated suppression of 5-HT induced hyperpolariation with CAl pyramidal cells

after brief application of steroids which act at MR and GR (Joels and de Kloet, 1994).

Furthermore, corticosteroids removal by bilateral adrenalectomy (ADX) results in an

increase in brain hippocampal 5-HT1A receptor mRNA expression (Chalmers et al.,

1993;Chalmers and Watson, 1991;Meijer and de Kloet, 1994). Using MR- and GR-

selective ligands (in rat) and gene knockout approaches (in mouse) (Meijer et al.,

1997;Meijer and de Kloet, 1995;Nishi and Azmitia, 1996), MR (primarily) and GR have

been implicated in negative regulation of 5-HT1A gene expression, but the precise

mechanism remains unclear. Dysregulation of the serotonergic system and abnormalities

of the HPA axis function have been implicated to be involved in neuropsychiatric

disorders, such as major depression, anxiety, and related disorders. For example, gene






29

knockout of the 5-HT1A receptor gene results in mice with increase anxiety-related

behaviors (Heisler et al., 1998;Parks et al., 1998;Ramboz et al., 1998).

In this project, we use 5-HT1A receptor as an indicator for MR or GR mediated

effects in hippocampus. Since we proposed that progesterone acts as an antagonist of

cortisol at MR to reduce the action of cortisol in brain, we expected to see that the

suppression effects of cortisol at 5-HT 1A receptor would be reduced.

2.6 Animal Models

Sheep are widely used in endocrine physiological studies, in particular in the study of

reproductive and adrenal gland control mechanisms. Sheep also offer a good model for

maternal physiology during pregnancy. In sheep, as in humans, the maternal adrenal

cortex is more active in secretion of cortisol during pregnancy than during the

nonpregnant state. During ovine and human pregnancy, maternal plasma cortisol

concentration approximately doubles (Bell et al., 1991;Nolten and Rueckert, 1981). On

the other hand, the fetal adrenal cortex is inactive as a source of corticosteroids until late

gestation. It has been calculated, in ovine and primate models, that transfer of cortisol

from the mother to the fetus, therefore, accounts for most (90 to 95%) plasma cortisol

measured in the fetus before the time of fetal adrenal gland maturation (approximately

0.8 of gestation (Hennessy et al., 1982;Pepe and Albrecht, 1984), approximately day 125

in sheep). In fact, fetal adrenalectomy before that time does not appreciably reduce

cortisol concentration in the fetal circulation (Ray et al., 1988). Study of the role of high

maternal cortisol concentration as a mediator of maternal and fetal cardiovascular and

fluid homeostasis is therefore of interest. Also, there are several aspects of the HPA in

sheep are similar to human physiology, for example, secretion of cortisol as the major

"glucocorticoid" hormone by the adrenal, and the inability to survive after adrenalectomy






30

without corticosteroid replacement. Further, the average gestation period for sheep is

about 150 days, which is much longer than rats or mice and long enough to allow chronic

adaptation of pregnancy to occur.

2.7 Significance

Inadequate control of glucocorticoid responses may lead to a severe threat to the

health and well-being of the organism. Hypersecretion of glucocorticoids can promote the

development of physiologic and psychological dysfunction. For example, inappropriate

regulation of stress has been implicated in the pathogenesis of systemic disease (such as

colitis, asthma, hypertension)(McEwen and Stellar, 1993), affective disorders (such as

depression, post-traumatic stress disorder)(Charey et al., 1993;Kathol et al., 1989)and

neurodegenerative disease (such as Alzheimer's disease).(Landfield and Eldridge, 1991).

Also, the increase of levels of cortisol and ACTH is very important for normal maternal

and fetal homeostasis. Hyper- or hypocorticism during pregnancy may result in an

increased incidence of fetal death or abortion (Aron et al., 1990;O'Shaughnessy and

Hackett, 1984;Pickard et al., 1990). Risk of maternal death also increases significantly

according to clinic case reports and animal experiments (Drucker et al., 1984;Seaward et

al., 1989). The adrenocortical system is very critical for the maintenance of

cardiovascular homeostasis (Loriaux, 1990;Mantero and Boscaro, 1992). Increases or

decreases in adrenocortical activity may lead animals or human beings to suffer from

disturbance of the cardiovascular system. In the clinic, these disturbances are shown in

Cushing's and Addison's diseases. In Cushing's disease, which is a hypercortisolism

state, patients have symptoms of hypertension, and the blood volume increases which

leads to edema. In Addison's disease, patients have symptoms of hypotension, caused by

decreased glucocorticoid effects on vascular reactivity which can be reversed by cortisol






31

replacement, and a decreased cardiac output caused by decreased blood volume.

Understanding the action of progesterone and cortisol is critical for understanding many

common symptoms during pregnancy, such as edema (fluid retention) and reduced

glucose tolerance which are the signs ofhypercorticism with glucocorticoid action, but

absent signs with mineralocorticoid action. While another interesting but not very

common pathophysiological symptom during pregnancy in some women is increased

blood pressure. Severe increases in blood pressure may lead to eclampsia which may be

very dangerous for maternal and fetal life. In some severe situations, pregnancy will have

to be stopped. After delivery, the increased blood pressure may decrease to normal level

spontaneously. The mechanism of eclampsia remains unknown until now, but changes in

HPA axis with interaction of placental steroid may play a role on it. It is important that

we understand the interaction between progesterone and cortisol during pregnancy in

order to understand the change in regulation of ACTH and the role of elevated

corticosteroids in the creation of a new homeostasis during pregnancy.

2.8 Objectives

In summary of this literature review, concentrations of cortisol, aldosterone, and

ACTH increase during pregnancy. Specifically, the increases in cortisol and aldosterone

secretion during pregnancy are important for the normal pregnancy adaptation.

Importantly, cortisol expands the blood volume during pregnancy because of both

glucocorticoid and mineralocorticoid effects at the kidney and in the vasculature. Both

cortisol and aldosterone also act in specific hypothalamic and brainstem nuclei to affect

both cardiovascular and endocrine function. The physiological changes in cardiovascular

function are critical for providing the maternal environment necessary for proper fetal

development. Cortisol is normally under negative feedback control. This negative






32

feedback mechanism is altered in pregnancy, allowing chronic increases in cortisol

secretion rate. I have hypothesized that the placental steroid progesterone acts to cause

the changes in regulation of the hypothalamus-pituitary-adrenal axis which result in the

increased plasma cortisol levels and contributes to the changes in cardiovascular

homeostasis in pregnancy. Cortisol and aldosterone exert glucocorticoid and

mineralocorticoid effects via action at MR and GR. Cortisol and other steroids, such as

progesterone, bind to both GR and MR. There is in vitro evidence that progesterone acts

as mineralocorticoid receptor antagonist, and I hypothesize that this results in decreased

MR mediated action, although the plasma concentration of cortisol and aldosterone

increases. It allows the effect of decreased blood pressure in the presence of increased

aldosterone and cortisol and causes a reduced negative feedback on basal ACTH (which,

in turn, allows chronic increases in plasma cortisol concentration). I will investigate the

action of these steroids using a molecular biology approach to the study of the steroid

receptors. Specifically I will test the following hypotheses:

1. Progesterone acts as an antagonist of cortisol at MR and/or reduces MR number in

the pregnant state to reduce the action of cortisol in brain.

2. Progesterone doesn't interfere with cortisol effect at GR, but as an agonist results in

the combined effect of progesterone and cortisol at GR.






33













A/B C D E
1 602 670 734 984



15% 4% 6% 57 %


hGR
1 420 488528 777














Fig. 2-1: Schematic representation of the structures of the human MR (hMR) and
GR (hGR) with the percentage of amino acid identity appearing between each of
the domains (A-E); the figure has been adapted from Arriza et al., 1987.







34












amygdala
hippocampus





CRF





PRL

POMC


ACTH-
release

adrenal cortex






glucocorticoids





nemarrw)

inmune system)

(adrenal medulla)



Fig. 2-2: Control ofglucocorticoid secretion by HPA axis. The figure has been
adapted from Reichardt et al., 2000.






35











() Hypothalamus


Hippocampus CRH/AVP


< > Pituitary

Basal Tone / P t
ACTH




Cortisol/Corticosterone Adrenal gland









Fig. 2-3: Hippocampal regulations of HPA axis














CHAPTER 3
GENERAL MATERIALS AND METHODS

3.1 Animal Care

The ewes were housed and studied in the Health Science Center Animal Resources

Department. They were maintained in a controlled environment (12-hour light/dark cycle

and a constant 19C-210C temperature).

3.2 General Surgical Procedure

The ewes used in the experiments were surgically prepared according to the following

protocols. Before surgery, food was withheld from the ewe for 24 hours. Before and

during surgery, the ewe is anesthetized with halothane (0.5 2.0%) in oxygen. All

surgery were performed in the surgery suite of the Health Center Animal Resources

Department. All ewes were treated with ampicillin (750 mg im) for 5 days post-

operatively and on each experimental day. All animals were allowed at least 5 days to

recover from surgery before study.

3.2.1 Adrenalectomy and Ovariectomy

Adrenalectomy, ovariectomy or sham adrenalectomy were performed according to

previously published protocols (Bell et al., 1991;Keller-Wood et al., 1998;Pecins-

Thompson and Keller-Wood, 1994). Briefly, adrenal glands or ovaries were isolated

through a midline abdominal incision, the vascular supply was ligated, and adrenal glands

or ovaries were removed.






36






37

3.2.2 Vascular Catheterization

All ewes had polyvinylchloride catheters (0.090" OD, 0.050" ID) implanted into the

femoral artery and vein at the femoral triangle for steroid delivery and blood sampling.

This method has been previously described in detail (Bell et al., 1991). Briefly, an

incision was made in the femoral triangle, and the artery and vein were exposed. Each

vessel was ligated distally, and a 0.05mm catheter was advanced approximately 10 inches

into the descending aorta or inferior vena cava. Each catheter was secure with surgical

ties, filled with heparinized saline, plugged with a sterile nail, and routed subcutaneously

with a trocar to exit the flank. When not in use, the exteriorized catheters were stored in a

paper pocket and protected by a spandage wrap.

3.3 Chronic Steroid Implantation

In adrenalectomized ewes, cortisol was replaced to the normal nonpregnant level (2-5

ng/ml) by implanting pellets of cortisol hemisuccinate (estimated release of 0.5 mg/kg/d;

Inovative Research, Sarasota, FL). Aldosterone was replaced by infusion of

approximately 3ig/kg/d. Ewes were treated with progesterone by placement of

subcutaneous implants for 60 days prior to adrenalectomy. Ewes were treated with

25mg/d for 30 days, followed by treatment with 67mg/d for the next 30 days, and

117mg/d from the time of adrenalectomy through the time of sacrifice.

3.4 Tissue Collection

The ewes were killed with an intravenous overdose ofpentobarbital under basal

conditions ( at least 3 days after the last experiment). As rapidly as possible, their carotid

arteries were cannulated, jugular veins were cut, and their brains were perfused with

approximately 3L ice-cold isotonic saline containing 10% (v/v) dimethyl sulfoxide






38

(DMSO, Sigma, St. Louis, MO). This served to protect the receptors during freezing and

to remove any blood-borne corticosteroid-binding globulin (CBG) (MacLusky et al.,

1986). The brains were quickly removed, and specific brain areas were disseccted and

frozen in liquid nitrogen. Then they were stored at -800C until assay. All studies were

approved by the Institutional Animal Care and Use Committee of the University of

Florida and were in compliance with NIH guidelines for the use of animals in research.

3.5 Collecting Blood Samples and Measurement

3.5.1 Sampling and Storage

At the time of sacrifice (immediately prior to the injection of pentobarbital), a blood

sample was taken for measurements of plasma cortisol, aldosterone and progesterone.

Blood samples were collected in tubes containing sodium EDTA (0.015 M, for analysis

of hormones). The whole blood samples were placed on ice until the end of the

experiment. Samples were then centrifuged, and plasma aliquots were stored at -200C

until analysis.

3.5.2 Hormones: Cortisol, Aldosterone and Progesterone

Plasma cortisol was measured by radioimmunoassay with an antibody raised in our

laboratory (Wood et al., 1993). The lower limit of detection in the assay is 0.4 ng/ml

using an 0.05ml aliquot of plasma. Plasma progesterone and aldosterone were measured

by radioimmunoassay using kits obtained from Diagnostic Products Corp. (Los Angeles,

CA). The lower limit of detection of the progesterone assay is 100 pg/ml using a 0.1 ml

aliquot of plasma. The antibody used does not bind the adrenal steroids. The lower limit

of detection of the aldosterone assay is 12.5 pg/ml using 400ul plasma.






39

3.5.3 Free Cortisol and Progesterone

Free cortisol and progesterone were estimated using a modification of the equilibrium

dialysis method of Hammond (Hammond et al., 1980). Aliquots of plasma were

incubated at 390C with 3H-cortisol or 3H-progesterone and 14C-glucose for one hour, and

bound and free steroid were separated by centrifugation at 800 g for 2 minutes at 390C

using 30,000 MW exclusion filters (Centrifree; Millipore Corp, Bedford, MA); although

the separation method was modified, the requirement for equilibrium was maintained by

adjusting separation conditions so that only a small quantity of the total volume was

filtered (approximately 35 [l out of 400 pl ). The relative ratio of 3HW4C in filtrate (lower

chamber) as compared to the non-filtered sample (upper chamber of filtration device) is

an estimate of the percent free steroid in the sample.

3.6 Receptor Binding Assays

Receptor binding assays were performed with 3H-cortisol, using a modification of the

method used by Reul et al for determination of binding in brain (Reul and DeKloet,

1985).

3.6.1 General Methodology

3.6.1.1 Tissue preparation

Cytosol was prepared from hippocampus according to previously published protocols

(Roesch and Keller-Wood, 1999).Briefly, hippocampus was homogenized using a motor-

driven Teflon pestle and glass tube (Wheaton Science Products) in a reducing

homogenization buffer (RHB) which contained 10 mM Tris-HCL, pH 7.4, 10 mM

sodium molybdate, 2mM ethylenediaminetetraacetic acid, 10% (v/v) glycerol, 4 mM

dithiothreitol and 4mM 3-mercaptoethanol. The components of this buffer have been






40

shown to stabilze corticosteroid receptor (Hubbard and Kalimi, 1982). The homogenate

was centrifuged at 35,000x g for 75 minutes at 40C to obtain a cytosolic fraction

(supernatant). Aliquots of cytosol were stored at -800C until assayed. Protein content of

the cytosol was measured with a Bradford assay kit (Biorad, Hercules, CA) using bovine

serum albumin as the standard. The binding experiments were carried out essentially as

previously described (Reul et al., 1990), as modified in our laboratory (Roesch and

Keller-Wood, 1999)

3.6.1.2 Incubation

Cortisol is the major adrenal steroid of sheep (and humans) and binds to MR, GR and

CBG. GR receptor binding was measured as the difference between binding in the

absence and presence of 1.25 pM RU 28362, a specific GR agonist (Roussel-Uclaf,

Romainville, France). MR was measured as the difference between binding in the

presence of 1.25 gpM RU 28362 and 12.5 pM dexamethasone, which binds to both MR

and GR, but not CBG. The MR and GR are calculated in this indirect way because of

the lack of a high affinity, MR-specific ligands. CBG binding was defined as the

difference between binding in the presence of 12.5 pgM dexamethasone and 12.5 pM

cortisol. In this case the cortisol is in excess so the only remaining binding should be

nonspecific. The table below showed the detailed binding status in each tube and how to

calculate the binding data for MR, GR and CBG. This calculation method was originally

generated by Reul and De Kloet (Reul and DeKloet, 1985).






41


Expected binding by H-cortisol

Tube contents GR MR CBG NSB

3H-cortisol X X X X


3H-cortisol + X X X

50x RU 28362

SH-cortisol + X X

500x

dexamethasone

H-cortisol + X

500x cortisol



Note: NSB= non specific binding
X in the cell stands for the binding by 3H-cortisol at the specific site
Calculation Equations:

Specific GR binding = total binding ( of 3H-cortisol )-binding in the
presence of excess RU28362

Specific MR binding = binding in the presence of excess RU28362-
binding in the presence of excess of dexamethasone

Specific CBG binding = binding in the presence of excess dexamethasone-
binding in the presence of excess cortisol

Steroid ligands were made fresh from stock ethanol solutions, dried in glass tubes in

Jouan evaporating centrifuge (Jouan Inc, Winchester, VA) and then resuspended in

binding buffer (RHB). The solvent of the 3H-cortisol (Amersham, Arlington Heights, IL)

was evaporated under a gentle air stream and diluted in binding buffer before addition to

the tubes. All components of the binding reaction were mixed in the glass tubes with






42


addition of 200-250 pg cytosol being the last step. Final volume was 200 ul in each tube.

Binding was allowed to proceed for overnight at 40C.

3.6.1.3 Separation of bound from free

Receptor-bound and free ligand were separated on LH-20 Sephadex columns at 40C as

previously described (Roesch and Keller-Wood, 1999). Chromatography columns were

prepared by plugging 5ml PYREXT serological pipettes (Coring, Inc.) with 3 mm

diameter borosilicate beads (Kimble Glass Company). The columns were filled to a

height of 8 cm with Sephadex LH-20 (Pharmacia Biotech, Uppsala, Sweden)

reconstituted in RHB. For separation of bound from free, 200 ul of the incubate was

loaded to the top of the column bed, washed into the column bed with 100 ul buffer.

Receptor-bound radioactivity eluted in 1 ml of binding buffer was counted in a liquid

scintillation counter (Beckman LS 3801, Beckman Inc., Fullerton, CA) with 4.5 ml

scintillant (Scintisafe 30 Fisher). Counts were expressed as femtomoles of 3H-cortisol

specifically bound per milligram protein. After each use, the columns were washed with

15 volumes of methanol and 15 volumes of RHB. During the buffer RHB re-equilibration

portion of the wash, the bead bed was agitated and allowed to resettle. Columns were

maintained at 40C.

3.6.2 Saturation Binding Analysis

These experiments were performed to determine the binding affinity (Kd) of MR in

the hippocampus of sheep during pregnancy and with various levels of progesterone.

Bmax values were also determined to confirm the Bmax value, or total available binding,

determined using a single, saturation dose of cortisol (see below).






43

Saturation binding curves were generated for three ewes in each treatment group

(n=15 ewes total). In these experiments cytosol from each hippocampus was incubated

with increasing concentrations of 3H-cortisol from 0.05 nM to 35 nM. Four tubes were

assayed at each concentration. Two contained 50-fold RU 28362 (2.5 nM to 1.75 giM)

and two 500-fold dexamethasone (25 nM to 17.5 gM). The difference between the mean

binding in these two sets of tubes at each 3H-cortisol concentration was specific binding

at MR.

Saturation binding isotherms were calculated by non-linear regression analysis of the

binding data (Graphpad Prism, Graphpad Software, Inc, San Diego, CA). The binding

affinity (Kd) and maximal binding capacity (Bmax) were determined from this curve. The

equation of the curve was Y = BmaxX / Kd + X; where Bmax is the maximal binding and Kd

is the concentration of ligand required to reach half-maximal binding.

3.6.3 Total Receptor Availability

Total available receptors measurements are indicative of the degree of activation of

GR and MR. They reflect the number of receptors that had not been activated in vivo by

steroid, so are inversely proportional to the number of activated receptors. This is because

the assay conditions used prevent the recycling of MR or GR from the conformation

following receptor activation to the receptor conformation required for ligand binding.

Total available receptor were measured in all 25 of the ewes studied (n=5 per group)

using a single saturating concentration of 3H-cortisol (25 nM) as previously described.

MR, GR, CBG and NSB were determined in triplicate tubes (12 tubes per hippocampus)

and the mean of the triplicates used for analysis. CBG binding was always less than 10






44

fmol/mg protein and was not significantly altered by any of the treatments, hence it is not

reported here.

3.7 Western Blot Analysis

An aliquot of the cytosolic preparations from hippocampus of individual ewes was

analyzed by Western blot for the total amount of GR and MR proteins present in the

preparation. This allowed differentiation of changes in the level of 3H-cortisol binding

due to increases in receptor protein from increases in the level of available receptor.

3.7.1 Tissue Preparation

Tissues were prepared in the same way as in receptor binding assay. Prior to gel

electrophoresis, samples were diluted in Laemmli (Laemmli, 1970) reducing loading

buffer (0.0625M Tris-HCL, 10% glycerol (v/v), 2% SDS (w/v), 0.72 M (3-

mercaptoethanol and 0.001% bromophenol blue) and heated in boiling water for 5

minutes.

3.7.2 Electrophoresis and Transfer

60 lpg (for MR) or 40 ptg (for GR) of cytosol protein prepared from hippocampus was

separated by size on 7.5% Tris-HCl gels (Biorad, Hercules, CA) by SDS-PAGE at 200

V. After electrophoresis, the proteins were transferred to 0.45 pm nitrocellulose

membranes (Biorad, Hercules, CA) for 1 hour at 100V. The membrane was washed

once with phosphate buffered saline containing 0.5% Tween 20 (PBST) and left to dry

overnight. The membrane was wetted with PBST on the day of staining.

3.7.3 MR Western Blotting Method

For detection of MR the blot was blocked in 5% non-fat dried milk in PBST

containing 1 % bovine serum albumin (Sigma #7638, Sigma, St. Louis MO) for 3 hours

at room temperature. Primary antibody (N17, SC 6860, Santa Cruz Biotechnologies Inc.,






45


Santa Cruz, CA) at a final concentration of 0.4 pg IgG/ml (1: 500) in blocking solution

was incubated with the blot for overnight at 40C. The blot was washed once for 10

minutes and twice for 5 minutes in PBST, then incubated with peroxidase linked

secondary antibody (SC 2350) at a dilution of 1:5000 in PBST:1% BSA for 1.5 hours at

room temperature. The blot was rinsed and then washed five times (once for 15 minutes

and four times for 5 minutes) in PBST. After washing, MR bands were visualized with an

enhanced chemiluminescence kit (NEN Renaissance, NEN Life Sciences, Boston, MA)

according to the manufacturer's directions. Films (Kodak Biomax ML) were developed

and the bands quantified on densitometer and image analysis software (BioRad GS 710

linked to Quantity One software, Bio-Rad). Preliminary experiments defined the antibody

conditions used in these determinations and also showed that the amount of protein

loaded in each lane on these gels was approximately in the center of the dynamic range of

band detection. This ensured that any changes in the amount of MR (or GR, as described

below) protein in a sample compared to control could be readily detected. Preliminary

blocking experiments with cognate peptide decreased the intensity of the band,

suggesting that it was specific.

3.7.4 GR Western Blotting Method

GR protein bands were detected using similar methodology as that used for MR,

except the blot was blocked in 7.5% non-fat dried milk in PBST overnight at 40C. Anti-

GR antibody (PAI-511, Affinity BioReagents, Golden, CO) at 0.5 jtg/ml in blocking

solution was incubated with the blot overnight at 40C. Previous studies in these labs have

shown that this antibody recognizes a 97 kD protein in sheep hypothalamus and pituitary,

and is specific, as it was preabsorbed by immunizing peptide (Saoud and Wood, 1996).






46


3.7.5 P-actin Western Blotting Method

A P-actin antibody was used to reprobe the membrane after MR and GR bands were

detected to assure that equal amounts of protein was loaded in each lane and equally

transferred to the membrane. After quantification of the MR or GR bands the membrane

was stripped at 570C for 20 minutes with 2% SDS, 62.5mM Tris-HCL PH=6.8 and

100mM /f-mercaptoethonol. Then it was washed with PBST 6 times for 5 minutes each.

The membrane was blocked in 10% non-fat dried milk in PBST. 1% BSA at room

temperature for 2 hours. Anti /f-actin antibody (A5441, Sigma, St.Louis, Missouri) at

1:100,000 in PBST 1%BSA was incubated with the blot for 1 hour at room temperature.

The blot was then incubated with peroxidase linked secondary antibody (A9044) at a

dilution of 1:16,000 in PBST. 1% BSA for 1 hours at room temperature. After washing,

P-actin bands were detected using similar methodology as that used for MR and GR

3.8 RT-PCR

See Chapter 4 for details.

3.9 Statistic Analysis

The values of hormone concentration, Bmax of MR/GR, and Kd of MR were

analyzed by analysis of variance (ANOVA). Individual means were compared by

Newman-Keuls multiple comparison test. For Western blotting, samples from the two

adrenal-intact groups were loaded in one gel, and the samples from adrenalectomized

groups were run in another gel. The results of densitometric analysis of the blots for MR

and GR were analyzed by unpaired t test for two groups of adrenal intact ewes and by

ANOVA for the three groups of adrenalectomizd ewes. The ACt calculated from real-

time RT-PCR was analyzed by ANOVA; the fold change is not a linear variable so that







47


data is not normally distributed and cannot be analyzed by ANOVA. The null hypothesis

was rejected when P<0.05.














CHAPTER 4
RT-PCR

RT-PCR is an important tool for detecting or quantitating the mRNA in tissues or

cells. It has been widely used in numerous areas. A number of widely used procedures

exist for detecting and determining the abundance of a particular mRNA in a total or poly

(A) RNA sample. Four methods are most frequently used, they are nuclease protection

assay, northern blot, in situ hybridization and RT-PCR. Each of them has inherent

advantages and limitations. In general, Northern analysis is the only method that provides

information about transcript size, whereas nuclease protection assays are the easiest way

to simultaneously examine multiple messages. In situ hybridization is used to localize

expression of a particular gene within a tissue or cell type, and RT-PCR is the most

sensitive method for detecting and quantitating gene expression. In my project, I chose

RT-PCR because of following two reasons. First, as described above, RT-PCR is the

most sensitive method for detecting and quantitating gene expression. My goal in this

research project is quantitating MR and GR mRNA in certain brain area. Second, it is a

well-developed technique in Dr. Keller-Wood's lab. Both semi-quantitative RT-PCR and

real-time PCR are used in this project. By semi-quantitative PCR, we also got the part of

the sequence for ovine MR, which is necessary in primer and probe design for real-time

PCR. This chapter described the methodology in detail for both semi-quantitative RT-

PCR and real-time RT-PCR and some data obtained in the process of developing the

method.




48






49


4.1 Semi-Quantitative RT-PCR

4.1.1 RNA Extraction and Sample Preparation

Total RNA was extracted from 150-200mg of tissue with Trizol(GIBCO/BRL, Grand

Island, NY) following the manufacturer's recommended method. Tissues were

homogenized in Trizol, then extracted with chloroform(0.2ml/ ml Trizol). The RNA was

precipitated from aqueous phase by the addition ofisopropanol (0.5ml/ ml Trizol) and

pelleted by centrifugation at 12,000g for 10min. After washing the pellets in 75%

ethanol, the RNA was dissolved in 200ul HPLC water. The integrity of RNA was

assessed by 1% non-denaturing agarose gel electrophoresis and visualization of the 18s

and 28s ribosomal RNA bands with ethidium bromide staining.

4.1.2 Primer Design

PCR primers for regular PCR for MR were designed using published human DNA

sequences (Arriza et al., 1987) with the aid of the Primer Design software and

synthesized by a commercial vendor (Gemini Biotechnology, Alachua, FL). Primers for

GR were similarly designed using published ovine RNA sequences (Yang et al., 1992).

The expression of the MR gene was determined by amplification of 277 bp region of

the MR cDNA sequence (4846-5122) (Arriza et al., 1987).

The sense upstream primer sequence:

5'-GGCACTGATGCAATGTATGG-3'

The antisense downstream primer sequence:

5'-GTAATGTTGCCTGCATGGTG-3'.

The expression of GR was determined by amplification of a 275 bp region of the ovine

GR cDNA sequence (301-575) (Yang et al., 1992).

The sense upstream primer sequence:






50

5'-GGAAGCTCGAATGAGGACTG-3'

The antisense downstream primer sequence:

5'-TGTCCCCCAGAGGTACTCAC-3'.

RT-PCR for MR and GR produced products whose sizes were consistent with the

predicted products, respectively.

As a positive control for each RNA preparation, an ovine 3-actin sequence was also

amplified simutaneously in adjacent tube.

The sense upstream primer of ovine 3-actin cDNA sequence:

5'-GAGAAGATGACCCAGATCATGT-3'

The antisense downstream primer sequence:

5'-TCCATGCCCAGGAAGGAAG-3'

4.1.3 Semi-quantitative RT-PCR

Total RNA (1 [pg) was treated with 1U DNase (Promega) at a temperature of 370C for

30 min. The DNase reaction was stopped by incubation at 750C for 5 min before cooling

to 40C. The RNA was then reverse transcribed in buffer containing 50 U of MuLV

reverse transcriptase, ImM each dNTP, 20 U RNase inhibitor and 50 pmol of

oligo(dT)15 primer in a total volume of 20 gl according to the manufacturer's protocol

(Perkin-Elmer Gene Amp PCR Core Kit, Perkin-Elmer Co., Foster City, CA).

Preliminary experiments determined the PCR conditions necessary for amplification of

product to be in the linear range. Briefly, the mixture was incubated for 10 minutes at

250C, then for 30 minutes at 420C. The RT reaction was stopped by incubation at 950C

for 5 minutes. The cDNA sample (10 pJl) was used for amplification by specific primer

for MR and GR. PCR reactions were carried out in 1X PCR buffer containing 1.0 mM






51


MgC12, 0.2 mM each dNTP, 0.15 gjM primers and 1.25 U of Taq DNA polymerase. The

cycling program was 95C for 30 seconds for denaturation, 55C for 1 minute for

annealing and 720C for 1 minute for elongation for 31 cycles. After the end of 31st cycle,

we allowed an additional 10 minutes for extension. The PCR bands were separated by

electrophoresis on 1% agarose gels containing ethidium bromide and visualized under

UV transillumination. The density of PCR bands were determined using a densitometer

and image analysis software (Bio-Rad, Hercules, CA).

4.1.4 PCR Product Purification and Sequencing

To get the primer and probe for real-time PCR, the specific ovine sequence of MR and

GR had to be obtained. Ovine GR sequence was available in published paper (Yang et al.,

1992), but the ovine MR sequence was not available. We sequenced the PCR product of

MR from regular RT-PCR and used that piece of sequence to design the primer and probe

for real-time PCR of MR RNA.

At the end of the PCR cycle, the solution of PCR product was collected and purified

by Wizard PCR Preps DNA Purification System (Promega, Madison, WI). According to

the protocol, the PCR reaction was transferred to a clean microcentrifuge tube, 100 pl of

direct Purification Buffer was added into 30-300 pl of the PCR reaction, and then 1 ml of

resin was added and vortexed. The mixture was filtered through a Minicolumn, and 2ml

of 80% isopropanol was used to washed the column. The Minicolumn was then

transferred to a 1.5ml microcentrifuge tube and centrifuged it for 2 minutes at 10,000 x g

to dry the resin. Finally, the DNA in the column was eluted with 50 pl of water with a 20

seconds spin at 10,000 x g.







52

The purified DNA was sent to Interdisciplinary Center for Biotechnology Research

(ICBR) at the University of Florida for sequencing. The sequences obtained were

compared to the previously published ovine GR sequence and the human MR sequence

(ovine MR sequence has not been completely cloned and sequenced) using BLAST. The

results of the BLAST search showed the PCR product for GR was 100% homologous to

the published ovine glucocorticoid receptor sequence (Yang et al., 1992). The PCR

product for MR was 90% homologous to the human MR (Arriza et al., 1987). This

confirmed the PCR products were from GR and MR mRNA.

4.2 Real-Time RT-PCR

4.2.1 RNA Extraction and Sample Preparation

RNA extraction from tissue for real-time RT-PCR is the same as that used for regular

RT-PCR, except that the RNA pellet after ethanol washing was dissolved in 200ul

RNAsecure Resuspension Solution (Ambion, Inc. Austin, TX). The RNAsecure

Resuspension Solution helped to stabilize RNA and to prevent RNA degradation in thaw-

freezing cycle and sample handling procedure. After that, RNA was immediately treated

with DNase (Promega)(lU/ug RNA) at a temperature of 370C for 30 min in the presence

of reaction buffer. The DNase activity was stopped by incubation at 650C for 10 min by

adding stop solution (half volume of DNase) before cooling to 40C. Then the quantity of

total RNA extracted was measured spectrophotometrically. The RNA was stored in many

aliquots and for use in the real-time RT-PCR.







53

4.2.2 Primer and Probe Design

PCR primers and Taqman probe specific for the ovine mineralocorticoid receptor was

designed using Primer Express software (Applied Biosystems) according to the sequence

which was obtained from regular RT-PCR in our lab.

Forward primer: ATTTCACTGAGTACCTGTTGATTATCATC

Reverse Primer: GGGAAACTTAATATGATTGCACTAAATAAA

TaqMan Probe: CTTTTCCAAGATTAATTTGGCCTCTATTCAAAGCA

The probes and primers used to detect MR mRNA will recognize all 3 subtypes of MR

found in rat hippocampus (Kwak et al., 1993), which vary in the 5' untranslated region,

and will also recognize the MR+4 mRNA splice variant found in human brain which has

12 additional base pairs between exons 3 and 4 in the DNA binding domain (Wickert et

al., 2000).

PCR primers and Taqman probe specific for the ovine glucocorticoid receptor was

designed using the same software according to the sequence which has been cloned and

published at Genebank(Yang et al., 1992).

Forward primer: ACTGCCCCAAGTGAAAACAGA

Reverse Primer: GCCCAGTTTCTCCTGCTTAATTAC

TaqMan Probe: AAAGAAGATTTTATCGAACTCTGCACCCCTGG

The GR primer and probe will recognize both splice variants of human GR, which

occur in sequences encoding for the carboxy terminus of the peptide (Oakley et al., 1996)

The 18s rRNA primer and probe were from TaqMan ribosomal RNA control reagents

(Applied Biosystems).






54

4.2.3 Real-time RT-PCR

4.2.3.1 Mixture

The reaction was performed in an ABI Prism 5700 sequence detector (Applied

Biosystems) using a Taqman One-Step RT-PCR Master Mix Reagents kit (Applied

Biosystems) and following the protocol laid out therein except that the reaction volume

was 25 ul. 2.5ul RNA was mixed with 12.5 ul 2X master mix 0.625ul 40X multiScribe

reverse transcriptase/RNase inhibitor mix, forward primer, reverse primer and Taqman

probe with addition of water in a total volume of 25 ul.

4.2.3.2 Primer, probe and starting RNA concentration

Initial experiments defined primer, probe and starting RNA concentration for the

mRNA being measured. For each gene, we optimized the primer concentration from 50-

900nM and probe concentration from 50-250nM. We select the primer and probe

concentration which gave the lowest Ct and highest ARn. After these optimizations, we

performed validation experiment by using increasing amount of RNA input for interested

gene and rRNA to verify that they had the same amplificatin efficiency. The final

concentrations of primer and probe for MR were: 400nM forward primer, 800nM reverse

primer and 150nM probe. The final concentrations of primer and probe for GR were: 900

nM each of forward and reverse primer, 100 nM probe. The final concentrations of

primer and probe for 18s rRNA, which was used as internal control for normolization of

the samples' variation were: 50nM each of forward primer and reverse primer, 200nM

probe. 100ng RNA was added for MR, 10ng RNA was added for GR and 0.5ng RNA

was added for rRNA in each reaction.






55


4.2.3.3 RT-PCR cycles

Reverse transcription was carried out at 480C for 30 min. Thermal cyclying for PCR

was initiated with incubation at 950C for 10 min for activation of AmpliTaq Gold DNA

polymerase. After this initial step, 40 cycles of PCR were performed. Each cycle

consisted of heating at 950C for 15s for melting and 600C for Imin for annealing and

extension.

4.2.4 Expression of Data

Each sample was analyzed in triplicate for MR, GR and rRNA. The data was

analyzed by calculating the threshold number of cycles (Ct), and determining ACt

between the mean Ct for each gene and the mean Ct for rRNA from the same sample;

differences among groups were analyzed by ANOVA using the ACt data. The fold

change in mRNA relative to control can then be calculated as 2-Act, where AACt=ACt in

each animal in the experimental group mean ACt in the control group( nonpregnant

adrenal intact ewes).

4.3 Corticosteroid Receptor Regulation in Sheep after Acute Adrenalectomy

4.3.1 Introduction

In these experiments, we measured the levels of mRNA for the MR and GR in

hippocampus and kidney to test whether receptor gene expression is increased under

conditions of acute withdrawal of adrenal steroids in adult female ewes. The reasons for

studying the effects of adrenalectomy in the sheep are as follows. First, we wanted to

examine the receptor regulation in the acute and complete absence of steroid in sheep.

There are similar studies in this area but no study has been done in species of sheep.

Second, it is part of the study of characterization of ovine corticosteroid receptors. In this






56

study, receptor-binding assay was used to estimate of the total number of receptors when

cortisol level was close to zero. This is a parameter difficult to directly determine for

steroid receptors because of the inability of activated receptors to rebind steroid under the

conditions used in binding assays (Chou and Luttge, 1988;Galigniana et al., 2000). This

provides both a maximum binding capacity for comparison with other, more physiologic

states, and allows an estimation of the percent occupancy of the MR and GR at

physiologic concentrations of steroid. Knowing whether there is a regulation of receptor

in condition of acute withdrawal of steroid or complete absence of steroid is a useful

information when interpretate the data from receptor-binding assay.

4.3.2 Methods

Ten adult female sheep of mixed breed were randomly assigned to two groups. The

first group was ovariectomized and sham-adrenalectomized ("adrenal-intact", ADI). The

second group was ovariectomized and adrenalectomized ("adrenalectomized", ADX)

according to previously published protocols (Keller-Wood et al., 1998). The

adrenalectomized ewes were maintained on replacement infusions of cortisol and

aldosterone for one week after surgery to allow them to recover from the surgical stress.

The replacement steroid infusions (0.33 mg/kg/d cortisol and 2.88 ig/kg/d aldosterone)

were then withdrawn from the adrenalectomized ewes and their blood pressure and blood

potassium levels were measured as previously described (Orbach et al., 2001). Once the

ewes showed signs of hypoadrenocorticism, defined as mean arterial blood pressure

below 75 mm Hg and /or serum potassium above 6 mEq/dL, the ewes were killed with an

overdose of pentobarbitol. Sham-adrenalectomized ewes were killed at the same time

after surgery as the adrenalectomized animals. Their brains were perfused with ice-cold







57

isotonic saline containing 10% (v/v) DMSO (Sigma, St.Louis, MO). This served to

protect the receptors during during freezing and to remove any blood borne

corticosteroid-binding globulin (CBG) (MacLusky et al., 1986). The brains were

dissected and frozen in a dry ice-acetone bath, and then stored at -800C until assay.

4.3.3 Results

4.3.3.1 Semi-Quantitative analysis of mRNA for MR and GR

MR and GR in hippocampus and kidney were compared between the ADX group and

control groups using semi-quantitative RT-PCR. Sequence analysis of the products

showed that the GR product was 100% homologous to the published ovine GR sequence.

The MR product was 90% identical to the human MR sequence. Hence we believe that

the PCR products were derived from the RNA for GR and MR.

There was no significant difference between steady-state mRNA levels in the

hippocampus of control or adrenalectomized ewes for either MR or GR (Figure 4-1;

relative optical densities MR: 0.920.29 in ADX versus 0.730.10 in ADI; GR:

0.900.10 in ADX versus 0.980.26 in ADI; n=5 in each group). There was also no

significant difference in steady-state levels of mRNA for either receptor in the kidneys of

these animals (GR: 0.950.12 in ADX and 1.040.10 in ADI; MR: 0.730.19 in ADX

and 0.900.15 in ADI; n=5 in each group; Figure 4-2).

4.3.3.2 Sequence of PCR product of MR and GR

Since no ovine MR has been cloned, we sent the products of the PCR reactions to

ICBR DNA sequencing core labs in the University of Florida. At the same time, we can

also check if the product is the product we expected.

The GR sequence obtained was:






58

AAGCCTCTTC TTTTACCGGA CGCTAAGCCT AAAATTAAAG

ATAATGGAGA TTTGATCTTA CCAAGTCCTA ACAGTGTGCC ACTGCCCCAA

GTGAAAACAG AAAAAGAAGA TTTTATCGAA CTCTGCACCC CTGGGGTAAT

TAAGCAGGAG AAACTGGGCC CAGTTTATTG TCAGGCCAGC TTTCCTGGGG

CCAACATAAT TGGCAATAAA ATGTCTGCCA TTTCTGTTCA TGGTGTGAGT

ACCTCTGGGG GACAA.

The MR sequence obtained was:

AGAAAAGGGT TGATCCCAGC GCTGCCATCT CCCGGCCTTG GGGCTCCCCA

GCTCTAGCTT TTAGGTTTTG GAAAAGAATA CGATTTCACT GAGTACCTGT

TGATTATCAT CACTTTTCCA AGATTAATTT GGCCTCTATT CAAAGCAGTT

TATTTAGTGC AATCATATTA AGTTTCCCCA AAGATATATA TATATATGTT

TGTGATTTGG GGCAAGAGAA AAAGCCATAC ATTGCATCAG TGC.

The sequences obtained were compared to the previously published ovine GR sequence

and the human MR sequence (ovine MR has not been completely cloned and sequenced)

using BLAST. The results of the BLAST search showed the PCR product for GR was

100% homologous to the published ovine glucocorticoid receptor sequence (Yang et al.,

1992). The PCR product for MR was 90% homologous to the human MR (Arriza et al.,

1987). This confirmed the PCR products were from GR and MR mRNA.

4.3.4 Discussion

Although upregulation of rodent hippocampal MR and GR mRNA after

adrenalectomy has been documented (Herman and Spencer, 1998;Patel et al., 1992), we

did not detect the changes in the adrenalectomized sheep. There might be several reasons

for this difference. First, it is possible that the regulation of the system may be different in

the two species. In addition, adrenalectomized rats can be maintained for at least two






59

weeks by supplying salt water to drink. However, increased sodium intake is not a

sufficient treatment for adrenalectomized sheep or human. Secondly, it is possible that

our method of examining a large portion of the hippocampus masked any regional

changes within the hippocampus. Some regions may have undergone upregulation of the

receptors due to lack of steroid, while other regions of the hippocampus, where steroid is

required to keep the cells viable, may have undergone apoptosis. It has been proposed

that MR mediate cell survival in the hippocampus, and adrenalectomy results in loss of

cells in dentate gyrus (Reagan and McEwen, 1997;Woolley et al., 1991). In this situation,

the average receptor number or message or protein would appear to be unchanged by

steroid, whereas in fact, regulation may have occurred in subregions.

4.4 MR Expression in Late-Gestation Ovine Fetal Lung

4.4.1 Introduction

The role of the glucocorticoid, such as cortisol and betamethasone in accelerating the

maturation of the lung and in production of surfactant is well known (Froh and Ballard,

1994). It has been widely used in clinics. GR has been found in fetal lungs late in

gestation and are localized in alveolar type II cells which produce surfactant, as well as

fibroblasts and epithelial cells. However, studies showed that corticosteroids may also

participate in reabsorption of lung liquid at birth in fetal sheep and guinea pigs.(Barker et

al., 1994; Harding, 1994). Aldosterone or cortisol alone both significantly decrease the

rate of lung liquid production. This effects of aldosterone and cortisol suggests that MR,

which has high affinity with aldosterone and cortisol, may mediate this effect.

In this study, we exam MR gene expression in the fetal lung by using both

semiquantitative RT-PCR and real-time RT-PCR. This is the part of the whole study

which also include examing the relative location of the Na/K ATPase isoform in lung. In






60

fetal lung, sodium reabsorption is thought to be dependent upon Na/K ATPase activity

acting in concert with luminal Na influx (Harding, 1994).

4.4.2 Methods

Lungs were collected from fetal sheep (120-125 days' gestation) at sacrifice.

Pulmonary tissue for analysis of mRNA was immediately snap-frozen in RNAse-free

tubes in a dry ice/acetone bath, and stored at -800C until analysis.

4.4.3 Results

We used both semiquantitative RT-PCR and real-time PCR technology to identify MR

mRNA in lungs collected from a large group of animals (120-131 day's gestation). MR

mRNA was detected in samples of four fetal lungs using semi-quantitative RT-PCR (Fig.

4-3). By real-time RT-PCR, MR mRNA was also identified in the lungs of eleven fetal

sheep (Fig.4-4 top left panel). In the fetal lungs, the generation of cDNA was

significantly greater than the generation of product in reaction in which there was no

added mRNA (Fig 4-4, "no RNA control"). MR mRNA was undetectable in the lungs of

seven pregnant ewes (Fig 4-4 top right panel). Product generation in samples from

maternal lungs was not different than that of the negative control. There was no influence

of fetal gestational age on the abundance of MR mRNA in the fetal lungs, normalized to

the abundance of 28S rRNA (Fig 4-4 bottom panel).

4.4.4 Discussion

The data from semi-quantitative RT-PCR is consistent with the data from real-time

RT-PCR. This implies that the method of real-time PCR works well and data is valid

since this is the first data obtained from real-time PCR in our laboratory. We also

measured mRNA of MR in many different tissues, including many different brain

regions. Most of them have detectable mRNA of MR. This implies that mRNA of MR is







61


undetectable in maternal lung is not a problem caused by tissue specific detection from

primer or probe.






62



Ethidium bromide-stained PCR products for MR, GR and P-actin
from ADI or ADX sheep hippocampus

STD 1A 1B 1C 2A 2B 2C 3A 3B 3C 4A 4B 4C















STD 5A 5B 5C 6A 6B 6C 7A 7B 7C 8A 8B

MR- and GR- specific PCR products in
hippocampus of ADI and ADX ewes

1.5-
Co =ADI
O C ADX

c 1.0-
o

0.5-


0.0
MR GR

Fig. 4-1: Total RNA isolated from hippocampus of adrenal-intact or adrenalectomized ewes
was subjected to RT-PCR with primers specific for MR,GR or 0-actin.
Top panel: gel showing RT-PCR products from 4 adrenal-intact (ADI) and 4
adrenalectomized (ADX) ewes. Odd numbered lanes are ADI, even numbers ADX. A=GR,
B=MR, C=P-actin. The arrow indicated the 500bp marker in a 100 bp ladder (Promega). The
PCR product for MR was 277 bp, for GR was 275 bp, and for P-actin was 461 bp.
Bottom panel: Mean data for ADI vs ADX animals, n=4 per group, normalized to P-actin.
The data shown in the top panel were normalized to p-actin in each individual ewe; the mean
normalized data is shown in this panel. There were no significant differences between ADI
and ADX ewes (by t test).








Ethidium bromide-stained PCR products for MR, GR and O-actin from ADI or ADX sheep kidney

STD AB C ABCABC A BCABC ABCA BCA BC A B CA B










4 ADI (n=5) ADX (n=5) -



MR- and GR- specific PCR products in Fig. 4-2: Total RNA isolated from kidney of adrenal-intact
kidney of ADI and ADX ewes or adrenalectomized ewes was subjected to RT-PCR with
primers specific for MR,GR or P-actin.
1.5- Top panel: gel showing RT-PCR products from 5 adrenal-
S" "- ADI intact (ADI) and 5 adrenalectomized (ADX) ewes. The
O ADX arrows beneath the scan indicate ADI and ADX ewes.
.- A=GR, B=MR, C=3-actin. The arrow indicated the 500bp
0 1.0 marker in a 100 bp ladder (Promega). The PCR product for
a. MR was 277 bp, for GR was 275 bp, and for P-actin was
o 1- 461 bp.
0.. 0.5- Bottom panel: Mean data for ADI vs ADX animals, n=5
O per group, normalized to P-actin. The data shown in the top
CO panel were normalized to P-actin in each individual ewe;
0.0 the mean normalized data is shown in this panel. There
MR GR were no significant differences between ADI and ADX
ewes (by t test).






64






































Fig. 4-3 : cDNA polymerase chain reaction product for MR, GR and P-actin mRNA.
Adjacent lanes demonstrate lack of product when P-actin primers are used after omission
of the reverse transcriptase (RT) reaction and after omission of mRNA.







65








21 02

n N RN 01
nO ." OD "-
0 10 20 3 4D s0 0 10 20 90 4 0 o
Cycle Nunber Cyde Number




Fetal MR mRNA in LUNG



4








120-125d 129-131d








Fig. 4-4: (top panel) Tapman fluorophore signal intensity (Rn) generated in response to
real-time PCR in fetal (left) and meternal (right) lung samples. MR mRNA was detected
in all samples of fetal lung (n=l 1) and in none of the samples of maternal lung (n=7). For
comparision, Rn in a reaction containing no mRNA is also plotted in the left panel.
(bottom panel) Differeces of cycle threshold of MR mRNA and 28s rRNA (ACt) for
ovine fetal lungs at two gestational ages (120-125, n=7 and 129-131 days, n=4),
demonstrating a similar abundance of MR mRNA in both groups.














CHAPTER 5
ALTERATION OF MINERALOCORTICOID RECEPTOR FUNCTION BY
PREGNANCY AND PROGESTERONE

5.1 Introduction

As described in the Literature Review, studies in our laboratory in sheep have shown

that the set point for the feedback regulation of basal plasma cortisol concentration is

increased during pregnancy(Keller-Wood, 1998). This would allow the basal plasma

concentration of cortisol to be maintained at a higher level without suppression of ACTH,

whereas further increases in cortisol concentration would suppress plasma ACTH

concentration, as it does in nonpregnant sheep. However, the mechanism of the normal

pregnancy-induced increase in set point for cortisol is still unknown.

Also as previously described in Literature Review, it has been shown that

progesterone can antagonize MR-mediated effects in vivo (Spence et al., 1989;Wambach

and Higgins, 1979) and in vitro (Jones et al., 1977;Rupprecht et al., 1993b). Progesterone

has very high affinity for the human MR, but it exerts very low transcriptional activity

after binding MR (Rupprecht et al., 1993b). In sheep, progesterone has an approximately

equal affinity compared to cortisol at the MR and lower affinity for ovine GR

(unpublished data).

We therefore hypothesized that elevated progesterone acts as an antagonist to cortisol

binding at MR, reducing MR availability and increasing the apparent Kd of MR for

cortisol in hippocampal cytosol. This results in the up-regulation of set-point for

regulation of cortisol during pregnancy since MR-mediated effects have been decreased.



66






67

To test our hypothesis, we used saturation binding assay to determine the Kd of MR

for cortisol in hippocampus and measured receptor availability for MR and GR. mRNA

and protein level were also measured for MR and GR. Finally, 5-HT1A receptor were

used as an indicator for MR/GR mediated action in hippocampus. Expression of 5-HTIA

receptor has been shown to be suppressed by cortisol in hippocampus. If progesterone

indeed antagonizes MR mediated effects of cortisol, this suppression would be

attenuated. Real-time PCR was used to meausre the mRNA of 5-HTIA receptor in

hippocampus.

5.2 Materials and Methods

In order to compare the effects of pregnancy and progesterone on mineralocorticoid

receptor mediated function, twenty-five adult female sheep, including ten pregnant and

fifteen nonpregnant, were studied in five experimental groups. Group (1) were

nonpregnant, sham-adrenalectomized and ovariectomized ewes. Group (2) were

pregnant, sham- adrenalectomized ewes. Group (3) were nonpregnant, adrenalectomized

and ovariectomized ewes. Group (4) were pregnant, adrenalectomized ewes. Group (5)

were nonpregnant, adrenalectomized ewes chronically treated with progesterone. Data

from one adrenalectomized pregnant ewe was excluded from analysis because both MR

and GR binding and protein levels were all markedly lower than all other animals (20-

40%), suggesting degradation of the receptors in the cytosol preparation.

The adrenalectomy and ovariectomy were performed according to previously

published protocols(Keller-Wood et al., 1998) as described in Methods(Pecins-Thompson

and Keller-Wood, 1994). Steroid implantation was performed to keep the cortisol and

aldosterone at a low, consistent level (2-5 ng/ml, 20-40pg/ml respectively). Ewes in






68


group 5 were also treated with progesterone to increase its level to that of the normal

pregnant sheep (O1ng/ml).

After collecting the hippocampal tissue, the plasma hormone levels were measured.

Receptor binding assay, Western blot and real-time RT-PCR were all done according to

the protocol described in Methods and RT-PCR chapters.

For this project, we did saturation binding assay followed by nonlinear regression

analysis for MR for three animals in each group. With increased concentration of 3H-

cortisol from 0.05 to 35 nM, the saturation binding curves were generated and the binding

affinity (Kd) of MR in the hippocampus and Bmax of MR were determined. For all

animals, we also measured total receptor availability for MR and GR using a single

saturating concentration of 3H-cortisol (25 nM) as previously described.

For real-time PCR for 5-HT1A receptor, the methodology was exactly the same as

measurement for MR and GR. A pair of primer was first designed according to human 5-

HT1A receptor sequence (448-624) in Genebank for regular RT-PCR.

Forward Primer: ACC CCA TCG ACT ACG TGA AC

Reverse Primer: CAG CGG GAT GTA GAA AGC TC

After sequencing the PCR product, we got a piece of 177bp sequence. The sequence was

compared with 5-HT1A receptor of human and other species by BLAST. It was 93%

homologous to the human 5-HTIA receptor. This confirmed the PCR product was from

5-HT1A receptor mRNA.

Then primer and probe for real-time PCR were designed according to this 177bp

sequence.

Forward primer: GCGCACCCCGGAAGA






69

Reverse primer: GTAAATAGTGTAGCCGTGGTCCTTGCT

Probe: CGGACCCGGACGCGTGCA

5.3 Results

5.3.1 Cortisol, Progesterone and Aldosterone Level in Plasma.

Plasma levels of cortisol, progesterone and aldosterone at the time of sacrifice were

shown in Table 5-1. In the cortisol-replaced adrenalectomized ewes, plasma cortisol

levels were similar (3-5 pg/ml) to those of the nonpregnant, adrenal-intact ewes. As

expected, plasma cortisol levels were higher in the pregnant adrenal intact group of ewes;

free cortisol levels also tended to be higher, however this difference was not significant.

Progesterone levels were low in nonpregnant, ovariectomized sheep, and both total and

free progesterone concentrations were increased in both groups of pregnant ewes.

Progesterone treatment increased plasma progesterone concentration to a level similar to

that in adrenal- intact pregnant ewes.

5.3.2 Total Available Receptor Binding at MR and GR in Hippocampus

The estimate of Bmax values for MR obtained by binding at a single saturating

concentration of 3H- cortisol was very similar to that obtained by saturation binding

experiments with multiple 3H- cortisol concentrations, confirming the validity of the

results (r=0.91, n=24). In the adrenal-intact ewes, there were significantly more MR sites

available in hippocampus from pregnant as compared to nonpregnant ewes (Figure 5-1,

lower right), despite the higher plasma cortisol concentrations in the pregnant ewes. In

the adrenalectomized ewes, there were also significantly more MR sites available in the

pregnant ewes as compared to the nonpregnant ewes (Figure 5-1, lower left). MR

availability in the nonpregnant adrenalectomized, progesterone-treated group was

intermediate between that in the pregnant and nonpregnant adrenalectomized groups, but







70

these differences were not statistically significant. There was, however, a statistically

significant relationship between total plasma progesterone concentration and MR

availability (r=0.57, p<0.003, n=24), and free plasma progesterone concentration and MR

availability (r=0.56, P<0.004; n=24).

There were no differences in Bmax for GR between pregnant and nonpregnant (85.2

10.3 vs 91.9 7.0 fmol/mg protein, respectively) adrenal-intact ewes, or among

nonpregnant, pregnant and nonpregnant-progesterone-treated ewes (90.5 10.4, 84.9 +

14.4, 93.3 6.9 fmol/mg protein, respectively)

5.3.3 Apparent Kd of MR with Cortisol in Hippocampus

To determine if progesterone was acting as an antagonist in vivo, we measured the

apparent Kd for 3H cortisol in hippocampal cytosols using a saturation binding assay

followed by nonlinear regression analysis (Figure 5-2). Pregnancy or progesterone

treatment increased the apparent Kd of MR in the adrenalectomized ewes (Figure 5-1,

upper left). There was also a significant difference in the apparent Kd of MR between

nonpregnant and pregnant adrenal-intact ewes (Figure 5-1, upper right). There was no

significant difference between the apparent Kd of MR in hippocampus of

adrenalectomized ewes who were pregnant versus progesterone treated. Overall, there

was a strong positive linear relationship between progesterone level and the apparent Kd

of MR using data from all 5 groups, indicating reduced affinity of cortisol at MR with

increasing total plasma progesterone concentrations (r =0.85, p<0.0001, n=15) or free

plasma progesterone concentrations (r =0.84, p<0.0001, n=15). There was not a

significant relationship between either total or free plasma cortisol concentration and the

apparent Kd (p=0.09 and p=0.27, respectively).







71


5.3.4 MR and GR Protein Levels and mRNA Expression in Hippocampus

Since we detected differences in receptor availability among the different groups of

sheep, we examined if these changes were partly due to changes in the total amount of

receptor protein or MR and GR gene expression. We used Western blot analysis to

measure the protein level of MR and GR in cytosol of hippocampus for each animal.

There was no significant difference between the nonpregnant intact group and pregnant

intact group (Figure 5-3 and Table 5-2). There was also no significant difference among

the three groups of adrenalectomized ewes (Table 5-2).

We also examined the mRNA expression for MR or GR using the real-time RT-PCR

method (Table 5-2). There was no significant difference among the groups in steady state

levels of MR or GR mRNA in hippocampus.

5.3.5 5-HT1A Receptor mRNA Level in Hippocampus

The cDNA product of the RT-PCR experiments was sequenced and the sequence

obtained was compared to the human 5-HTIA receptor sequences using BLAST.

the sequence obtained was:

CCCCGGCGCG CCGCTGCGCT CATCTCGCTC ACCTGGCTCA TTGGCTTCCT

CATCTCCATC CCGCCCATGC TGGGCTGGCG CACCCCGGAA GACCGCTCGG

ACCCGGACGC GTGCACTATC AGCAAGGACC ACGGCTACAC TATTTACTCC

ACCTTCGGAG CTTTCTACAT CCCGCTG.

We used real-time PCR to measure to mRNA level of 5-HT1A level in hippocampus.

There was no significant difference among the groups in steady state levels of 5-HT1A

receptor mRNA in hippocampus (Fig.5-4).






72


5.4 Discussion

An increased concentration of plasma progesterone, induced either by pregnancy or

progesterone administration, increased the number of available MR in sheep

hippocampus, and decreased the affinity of those sites for cortisol. These results support

and extend our previous observations that MR availability in the hippocampus is

increased during ovine pregnancy (Roesch and Keller-Wood, 1999). This increase in

availability is not predicted from consideration of plasma cortisol and aldosterone

concentrations, given that circulating free concentrations of both are increased in the

pregnant state. This suggested that another ligand antagonized cortisol binding to MR in

hippocampus during pregnancy. In present study, we used progesterone-treated ewes to

mimic the pregnant state to test the hypothesis that it is the progesterone during

pregnancy that caused this change. To avoid the possible confounding effects of

differences in plasma corticosteroids, the animals were adrenalectomized and treated with

a low dose of cortisol and aldosterone.

Since activated steroid receptors will not rebind ligand under the conditions used in

our assay, the measure of receptor availability in our study presumably reflects an inverse

change in receptor activation. This would suggest that progesterone reduce MR

occupancy and activation in hippocampus in vivo.. The affinity of MR for progesterone

is similar to that of cortisol and corticosterone (Rupprecht et al., 1993b); in the present

studies the estimated concentration of free progesterone during pregnancy is several fold

higher than that of cortisol or aldosterone. It would therefore be expected that

progesterone would competitively inhibit cortisol binding to MR. If progesterone acts as

an antagonist at MR, then the apparent Kd for the receptor for cortisol should be

increased. In this study, we found a significant positive linear relationship between the






73

plasma concentration of progesterone and both the apparent Kd of cortisol at MR and MR

availability. The analysis of the apparent Kd at MR showed a similar pattern as MR

availability. i.e. there was a greater concentration of cortisol required to achieve 50%

binding in pregnant intact ewes compared to nonpregnant intact ewes, and in pregnant

adrenalectomized ewes as compared to nonpregnant adrenalectomized and

ovariectomized ewes. The apparent Kd for MR and MR availability in nonpregnant

adrenalectomized ewes treated with progesterone was intermediate, however the

progesterone concentration was also intermediate.

An effect of progesterone has also been shown in rats after acute progesterone

treatment (Carey et al., 1995). The apparent Kd of corticosterone for MR was increased

in hippocampal cytosol obtained from rats 4h after injection with progesterone (Castren

et al., 1995). Studies in cells transfected with MR or GR and treated with various

steroids showed that progesterone is a potent antagonist at the human MR (Rupprecht et

al., 1993b), binding with high affinity, but resulting in little transcriptional activity.

Modeling of the human MR has also suggested that progesterone normally can bind in

the ligand binding pocket of the human MR, but will not allow the conformational

change necessary for transactivation (Geller et al., 2000); a mutation in one residue

within the binding pocket can result in constitutive transcriptional activity, and enhanced

transcriptional activity after progesterone binding. Women with this mutation are

hypertensive during pregnancy (Geller et al., 2000). These studies have suggested that

progesterone inhibition of MR-mediated actions can occur via antagonism of the

receptor. However, it is possible that progesterone also inhibits MR activity through

another mechanism. In other studies in cultured cells, progesterone inhibited the






74

transcriptional activity of MR through a progesterone receptor (PR-A) mediated effect

(McDonnell et al., 1994).

In sheep, the change in MR availability in the hippocampus during pregnancy or by

progesterone treatment cannot be accounted for by the increase in cortisol binding to

binding globulin, since corticosteroid binding globulin (CBG) levels do not increase

during pregnancy or with steroid treatments (Lindner, 1964;Rosenthal et al., 1969).

Consistent with this, there was no significant difference in the percentage of free cortisol

in plasma with pregnancy in this study, nor were the changes in MR availability or

apparent affinity related to concentrations of free cortisol. The change is also not

accounted for by an increase in metabolism of cortisol to cortisone by 11 3-

hydroxysteroid dehydrogenase. We have measured 11 1- hydroxysteroid dehydrogenase

activity in several brain regions and found that its activity was below or at the limit of

detection in hippocampus in nonpregnant or pregnant ewes (Kim et al., 1995).

Since availability of MR could also be increased by an effect of progesterone on the

synthesis or expression of MR, we also measured MR mRNA and protein levels for MR

in hippocampus following progesterone treatment and during pregnancy. Despite the

change in availability, the protein and mRNA levels were not significantly different

during pregnancy or with progesterone treatment. This suggests that the change in

availability is related to presence of a competitive antagonist, which would increase

apparent Kd, decrease MR activation and increase receptor availability, rather than to a

change in MR expression. However, it is possible that there are either regional or splice-

variant selective changes in MR and GR which would not be detected with the methods

used.






75

Although we did not find a change in MR expression or protein with pregnancy or

progesterone treatment, other studies using adrenalectomized animals without steroid

replacement or using cell culture systems have found changes in MR mRNA levels with

gonadal steroid administration. In cultures of hippocampal neurons, or neuroblastoma

cells, progesterone increases MR expression (Castren et al., 1995). Progesterone also

increased MR mRNA in hippocampus of adrenalectomized, ovariectomized rats after 2

days of administration if they were pre-treated with estrogen, suggesting that this effect is

mediated by progesterone receptors (Castren et al., 1995). However, other studies with 6

days of administration have shown that ovariectomy does not change MR mRNA or the

increase in MR expression after adrenalectomy; progesterone adminstration in the

adrenalectomized, ovariectomized rat also did not change the suppression of MR by high

dose corticosterone (Patchev and Almeida, 1996). However, progesterone blocked the

inhibitory effect of estradiol on MR mRNA; and no effect of progesterone occurred if the

rats were treated with high doses of corticosterone after adrenalectomy. In these studies

progesterone attenuated both the increase in GR mRNA after adrenalectomy and the

suppression of this increase by high dose corticosterone; this effect is consistent with

progesterone action as a weak agonist at GR, in this case modulating the GR

autoregulation. An interactive effect of progesterone with estradiol was also observed

with acute steroid administration over 4 hours in adrenalectomized, ovariectomized rats.

Whereas acute estrogen treatment decreased MR availability in hippocampus, and levels

of MR mRNA in the CA2 region of the hippocampus, progesterone with estradiol

increased both MR binding capacity and mRNA (Carey et al., 1995). Taken together

with the results of our study, these studies suggest that progesterone may modulate the







76

response to chronic, dramatic increases or decreases in corticosteroids, but in the

pregnant state, in the presence of both corticosteroids and estrogen, the overall effects of

progesterone on steady-state levels of MR mRNA and GR mRNA are minimal.

We did not detect any significant change of 5-HT1A receptor mRNA level in

hippocampus among five groups, while we expected that suppression of 5-HT1A receptor

by cortisol would be attenuated by progesterone if progesterone antagonize cortisol

effects in vivo in sheep. In three ADX groups, the levels of plasma cortisol are all at the

similar range. If progesterone antagonize MR mediated cortisol activity, the ewes with

higher progesterone level (group 4 and 5) would have a higher 5-HT1A receptor mRNA.

There are several possible reasons to explain this discrepancy. First, in our experiment,

cortisol levels were at the range of normal nonpregnant level (2-5ng/ml). It is possible

that this level is too low to have the effects on 5-HTIA receptor gene expression.

Neumaier and his colleagues detected regulation of 5-HT1A receptor mRNA in rat in

hippocampus by corticosteroids at the level of 25-30 ng/ml (Neumaier et al., 2000). If no

regulation occurred at the low, normal level of cortisol, progesterone would not have

effects on 5-HT1A receptor mRNA. Seceond, no previous studies have been done on

sheep. Suppression of 5-HT1A receptor by corticosteroid were reported in rats or

cultured hippocampal cells. There might be species different on gene regulation. Third,

progesterone might have its own effects on 5-HT1A receptor by progesterone receptor.

Both cortisol and progesterone effects may work on gene regulation of 5-HT1A receptor

and net effects might be zero. Further studies need to be done to really explain the effects

of cortisol and progesterone action on this 5-HT1A receptor gene regulation.







77


In summary, we have found that the apparent Kd of cortisol at MR in the hippocampus

is increased by an increase in progesterone concentration, produced either by pregnancy

or progesterone treatment. The increase in apparent Kd is also reflected in an increase in

MR availability in hippocampus in pregnant ewes and in nonpregnant ewes with chronic

progesterone treatment. These changes are not related to the level of circulating cortisol,

and there was no change in GR availability in hippocampus. The change in MR

availability was not due to the level of receptors in vivo since neither mRNA nor protein

level of MR and GR changed. These data are consistent with competition of progesterone

with cortisol for binding at MR, resulting in fewer activated MR and more unactivated

MR available for ligand binding in the cytosolic assay. These studies therefore support

the hypothesis that increased progesterone during pregnancy reduces the MR-mediated

effects of cortisol. This action of progesterone may result in decreased cortisol feedback

effects in the hippocampus during pregnancy.







Table 5-1 Plasma hormone levels in five groups

Total Plasma Free Plasma Total Plasma Free Plasma Aldosterone
Cortisol Cortisol Progesterone Progesterone (pg/ml)
(ng/ml) nM (ng/ml) (nM)
Adrenal-Intact (sham)
Nonpregnant 5.4 1.7 2.1 0.8 2.2 + 2.0 6.1 + 5.6 35 14
ovariectomized
Pregnant 11.7 3.0* 3.4 0.9 14 2* 33 6* 26 5
Adrenalectomized
Nonpregnant 4.2 0.7 1.4 0.3 0.14 0.04 0.3 +0.1 21 4
ovariectomized
Pregnant 4.3 0.8 1.2 + 0.2 32 8* 69 22* 48 12
Nonpregnant + progesterone 3.6 0.5 1.9 0.3 12 4* 28 9* 59 12

00
Data expressed as mean SEM
* indicates different than nonpregnant






79




Table 5-2 MR and GR Protein and mRNA in hippocampus

Receptor Protein Receptor mRNA
OD*mm2)* (fold change)**
MR GR MR GR
Adrenal-Intact (sham)
Nonpregnant 0.64 0.05 14.9 2.1 1 (0.6-1.6) 1 (0.7-1.4)
Pregnant 0.66 + 0.05 13.4 3.2 0.4 (0.2-0.8) 0.6 (0.4-0.9)
Adrenalectomized
Nonpregnant 0.88 0.14 11.8 + 2.4 0.9 (0.6-2.3) 0.5 (0.3-0.7)
Pregnant 0.72 0.17 10.2 + 1.9 0.6 (0.4-1.1) 0.9 (0.7-1.0)
Nonpregnant + P4 1.11 0.22 13.0 1.4 0.9 (0.6-1.3 0.7 (0.5-0.8)

Data expressed as mean + SEM
* Data expressed as mean SEM of adjusted volume(OD*mm2) above background SEM
** Data for receptor mRNA are expressed as fold change relative to nonpregnant adrenal
intact; the range is indicated in parentheses.







80







1.5 1.5



1.0 1.0



0.5 0.5


0.0 0.0

30 30
r *
2 25 25
Q..
0)
E 20 20
U)
15 T : 15

X10 I1 | r10



0 01
o os-

NonPreg Preg NonPreg NonPreg Preg
ADX ADX ADX+P4 Intact Intact










Fig.5-1 MR binding parameters in ovine hippocampus with pregnancy or progesterone
treatment. Kd and Bmax of MR for cortisol in pregnant and nonpregnant adrenal-intact
ewes (right, upper and lower panels), and in pregnant, nonpregnant and nonpregnant,
progesterone-treated adrenalectomized (ADX) ewes (left, upper and lower panels).
Data are shown as mean SEM. indicates significantly different from nonpregnant
animals in same corticosteroid treatment group (ie adrenal-intact or ADX).









81







0 5 10 15 20
Bound
20-







0)

1'0 20 30 40
3H cortisol concentration (nM)






Bound
20-




10-





0 10 20 30 40
3H cortisol concentration (nM)






0 10 20
Bound
20-




10-




0 10 20 30 40

3H cortisol concentration (nM)


Fig.5-2: MR binding curves in representative nonpregnant (top), pregnant (middle), and
nonpregnant progesterone-treated (bottom)
adrenalectomized ewe.
At each upper-right corner, it is the Scatchard plot converted from nonlinear regression data.








INTACT ADX

1212121212 345345345345345

MR: 110 kDaf



GR: 97 kDa- .-*.* 7 i "

NP
4 NP P-- -P- + -NP- -P--
+P4


Figure 5-3: Western blot images for MR (top) and GR (bottom) in hippocampal cytosol.
Lanes in the MR immunoblot are identified as :
1, samples from nonpregnant adrenal-intact ewes
2, samples from pregnant adrenal-intact ewes
3, samples from nonpregnant adrenalectomized ewes
4, samples from pregnant adrenalectomized ewes
5, samples from nonpregnant progesterone-treated adrenalectomized ewes
Lanes in the GR immunoblot are idnetified as:
NP, nonpregnant; P, pregnant; NP+P4, nonpregnant progesterone-treated.
Samples from adrenal-intact ewes are shown in panels on the left, those from adrenalcetomized ewes on the right.






83



10.0-


7.5-


5.0-


2.5-


0.0
NP intact P intact




10.0-


7.5-


5.0-


2.5-


0.0
NP Adx P Adx NPAdx+P4


Fig. 5-4 5-HT1A receptor mRNA level measured by real-time RT-PCR in hippocampus.
Top panel: comparison ofmRNA in two adrenal intact groups. There was no significant
difference by unpaired t test
Bottom panel: comparison of mRNA in three ADX groups. There was no significant
difference by one way ANOVA.
Data was showed by delta Ct, which is the difference between Ct of 5-HT1A receptor and Ct
of rRNA from the same sample.














CHAPTER 6
SUMMARY AND CONCLUSIONS

The studies presented in this dissertation were designed to explain how the set point

for the feedback regulation of cortisol and ACTH can be increased during pregnancy in

sheep as well as in humans. We hypothesize that the changes in pregnancy result from a

decrease in cortisol action at the MR, but no decrease in action at the GR. we hypothesize

that these changes, and therefore the elevation of cortisol, are related to the increase in

plasma progesterone during pregnancy. The specific hypotheses in this dissertation are:

1. Progesterone acts as an antagonist of cortisol at MR and/or reduces MR number in

the pregnant state to reduce the mineralocorticoid action of cortisol in brain.

2. Progesterone doesn't interfere with cortisol effect at GR, but as partial agonist

results in the combined effect of progesterone and cortisol at GR.

By the data shown above, we found that the apparent Kd of cortisol at MR in the

hippocampus is increased by an increase in progesterone concentration, produced either

by pregnancy or progesterone treatment. The increase in apparent Kd is also reflected in

an increase in MR availability in hippocampus in pregnant ewes and in nonpregnant ewes

with chronic progesterone treatment. These changes are not related to the level of

circulating cortisol, and there was no change in GR availability in hippocampus. The

change in MR availability was not due to the level of receptors in vivo since neither

mRNA nor protein level of MR and GR changed. These data are consistent with

competition of progesterone with cortisol for binding at MR, resulting in fewer activated

MR and more unactivated MR available for ligand binding in the cytosolic assay. 5-


84







85


HT1A receptor data didn't show an increase in mRNA expression in ewes with high

progesterone level. There are several possible explanations for this negative result as I

stated in Chapter 5.

These studies therefore support the hypothesis that increased progesterone during

pregnancy reduces the MR-mediated effects of cortisol and progesterone doesn't interfere

the GR-mediated effects of cortisol. This action of progesterone may result in decreased

cortisol feedback effects at the basal level in the hippocampus during pregnancy.
















LIST OF REFERENCES


Abou-Samra,AB, B Loras, M Pugeat, J Tourniaire, J Bertrand, 1984, Demonstration of
an antigluccorticoid action of progesterone on the corticosterone inhibition ofb-
endorphin release by rat anterior pituitary in primary culture: Endocrinology, v. 115, p.
1471-1475.

Albert,PR, Q Y Zhou, H H Van Tol, J R Bunzow, O Civelli, 1990, Cloning, functional
expression, and mRNA tissue distribution of the rat 5-hydroxytryptaminelA receptor
gene: J Biol.Chem., v. 265, p. 5825-5832.

Allolio,B, J Hoffmann, E A Linton, W Winkelmann, M Kusche, H M Schulte, 1990,
Diurnal salivary cortisol patterns during pregnancy and after delivery: relationship to
plasma corticotrophin-releasing-hormone: Clin.Endocrinol.(Oxf), v. 33, p. 279-289.

Aron,DC, A M Schnall, L R Sheeler, 1990, Cushing's syndrome and pregnancy.:
American Journal of Obstetrics and Gynecology, v. 162, p. 244-252.

Aronsson,M, K Fuxe, Y Dong, L F Agnati, S Okret, J A Gustafsson, 1988, Localization
of glucocorticoid receptor mRNA in the male rat brain by in situ hybridization:
Proc.Natl.Acad.Sci.U.S.A, v. 85, p. 9331-9335.

Arriza,JL, R B Simerly, L W Swanson, R M Evans, 1988, The neuronal
mineralocorticoid receptor as a mediator of glucocorticoid response: Neuron, v. 1, p. 887-
900.

Arriza,JL, C Weinberger, G Cerelli, T M Glaser, B L Handelin, D E Housman, R M
Evans, 1987, Cloning of human mineralocorticoid receptor complementary DNA:
structural and functional kinship with the glucocorticoid receptor.: Science, v. 237, p.
268-275.

Barker,PM, D V Walters, M Markiewicz, L B Strang, 1994, Development of the lung
liquid resorptive mechanism in fetal sheep:synergism of triiodothyronine and
hydrocortisone: Journal of Physiology, v. 433, p. 435-449.

Barnes,PJ, I Adcock, 1993, Anti-inflammatory actions of steroids: molecular
mechanisms: Trends Pharmacol.Sci., v. 14, p. 436-441.



86






87

Bell,ME, C E Wood, W M Keller, 1991, Influence of reproductive state on pituitary-
adrenal activity in the ewe: Domest.Anim.Endocrinol., v. 8, p. 245-254.

Bloem,LJ, C Guo, J H Pratt, 1995, Identification of a splice variant of the rat and human
mineralocorticoid receptor genes: J.Steroid Biochem.Mol.Biol., v. 55, p. 159-162.

Bradbury,MJ, S F Akana, M F Dallman, 1994, Roles of type I and II corticosteroid
receptors in regulation of basal activity in the hypothalamo-pituitary-adrenal axis during
the diurnal trough and the peak: evidence for a nanadditive effect of combined receptor
occupation.: Endocrinology., v. 134, p. 1286-1296.

Brooks,VL, L C Keil, 1994, Changes in the baroreflex during pregnancy in conscious
dogs: heart rate and hormonal responses: Endocrinology, v. 135, p. 1894-1901.

Buckingham,JC, 1982, Effects of adrenocortical and gonadal steroids on the secretion in
vitro of corticotrophin and its hypothalamic releasing factor: J Endocrinol, v. 93, p. 123-
132.

Buckingham,JC, J R Hodges, 1977, The use of corticotrophin production by
adenohypophysial tissue in vitro for the detection and estimation of potential
corticotrophin releasing factors: J.Endocrinol., v. 72, p. 187-193.

Burgess,LH, R J Handa, 1992, Chronic estrogen-induced alterations in
adrenocorticotropin and corticosterone secretion, and glucocorticoid receptor-mediated
function in female rats.: Endocrinology, v. 131, p. 1261-1269.

Burnstein,KL, C M Jewell, M Sar, J A Cidlowski, 1994, Intragenic sequences of the
human glucocorticoid receptor complementary DNA mediate hormone-inducible receptor
messenger RNA down-regulation through multiple mechanisms: Molecular
Endocrinology, v. 8, p. 1764-1773.

Caldenhoven,E, T van Dijk, J A Raaijmakers, J W Lammers, L Koenderman, R P De
Groot, 1995, Activation of the STAT3/acute phase response factor transcription factor by
interleukin-5: J.Biol.Chem., v. 270, p. 25778-25784.

Campbell,EA, E A Linton, C D A Wolfe, P R Scraggs, M T Jones, P J Lowry, 1987,
Plasma corticotropin-releasing hormone concentrations during pregnancy and parturition:
Journal of Clinical Endocrinology and Metabolism, v. 64, p. 1054-1059.

Canny,BJ, J W Funder, I J Clarke, 1989, Glucocorticoids regulate ovine hypophysial
portal levels of corticotropin-releasing factor and arginine vasopressin in a stress-specific
manner: Endocrinology, v. 125, p. 2532-2539.






88

Carey,MP, C H Deterd, J deKonig, F Helmerhost, E R DeKloet, 1995, The influence of
ovarian steroids on hypothalamic-pituitary-adrenal regulation in the female rat.:
J.Endocrinol, v. 144, p. 311-321.

Carr,BR, C R Parker, J D Madden, P C MacDonald, J C Porter, 1981, Maternal
adrenocorticotropin and cortisol relationships throughout human pregnancy.: American
Journal of Obstetrics and Gynecology, v. 139, p. 416-422.

Castren,M, V K Patchev, 0 F Almeida, F Holsboer, T Trapp, E Castren, 1995,
Regulation of rat mineralocorticoid receptor expression in neurons by progesterone:
Endocrinology, v. 136, p. 3800-3806.

Chalmers,DT, S P Kwak, A Mansour, H Akil, S J Watson, 1993, Corticosteroids regulate
brain hippocampal 5-HT1A receptor mRNA expression: J Neurosci., v. 13, p. 914-923.

Chalmers,DT, S J Watson, 1991, Comparative anatomical distribution of 5-HTIA
receptor mRNA and 5-HT1A binding in rat brain--a combined in situ hybridisation/in
vitro receptor autoradiographic study: Brain Res., v. 561, p. 51-60.

Chapman,MS, D J Askew, U Kuscuoglu, R L Miesfeld, 1996, Transcriptional control of
steroid-regulated apoptosis in murine thymoma cells: Mol.Endocrinol., v. 10, p. 967-978.

Charney,DS, A Y Deutch, J H Krystal, S M Southwick, M Davis, 1993, Psychobiologic
mechanisms ofposttraumatic stress disorder: Arch.Gen.Psychiatry, v. 50, p. 295-305.

Chou,YC, W G Luttge, 1988, Activated type II receptors in brain cannot rebind
glucocorticoids: relationship to progesterone's antiglucocorticoid actions: Brain Research,
v. 440, p. 67-78.

Christ,M, M Wehling, 1998, Cardiovascular steroid actions: swift swallows or sluggish
snails?: Cardiovasc.Res., v. 40, p. 34-44.

Christianson,RE, 1976, Studies on blood pressure during pregnancy. I. Influence of parity
and age: Am.J.Obstet.Gynecol., v. 125, p. 509-513.

Crandall,ME, C M Heesch, 1990, Baroreflex control of sympathetic outflow in pregnant
rats: effects of captopril: Am.J.Physiol, v. 258, p. R1417-R1423.

Cullinan,WE, J P Herman, S J Watson, 1993, Ventral subicular interaction with the
hypothalamic paraventricular nucleus: evidence for a relay in the bed nucleus of the stria:
J.Comp Neurol., v. 332, p. 1-20.






89


Dallman,MF, S F Akana, C S Cascio, D N Darlington, L Jacobson, N Levin, 1987a,
Regulation of ACTH secretion: Variations on a theme of B.: Recent Progress in Hormone
Research, v. 43, p. 113-173.

Dallman,MF, S F Akana, L Jacobson, N Levin, C S Cascio, J Shinsako, 1987b,
Characterization of corticosterone feedback regulation of ACTH secretion.: Ann-N-Y-
Acad-Sci., v. 512, p. 402-414.

Dallman,MF, F E Yates, 1969, Dynamic asymmetries in the corticosteroid feedback path
and distribution-metabolism-binding elements of the adrenocortical system.PG:
Ann.N.Y.Acad.Sci., v. 156.

Danielsen,M, J P Northrop, J Jonklaas, G M Ringold, 1987, Domains of the
glucocorticoid receptor involved in specific and nonspecific deoxyribonucleic acid
binding, hormone activation, and transcriptional enhancement: Mol.Endocrinol, v. 1, p.
816-822.

de Kloet,ER, J M Reul, 1987, Feedback action and tonic influence of corticosteroids on
brain function: a concept arising from the heterogeneity of brain receptor systems:
Psychoneuroendocrinology, v. 12, p. 83-105.

De Kloet,ER, W Sutanto, N Rots, A van Haarst, B D van den, M Oitzl, A van Eekelen, D
Voorhuis, 1991, Plasticity and function of brain corticosteroid receptors during aging:
Acta Endocrinol.(Copenh), v. 125 Suppl 1, p. 65-72.

Dong,Y, L Poellinger, J A Gustafsson, S Okret, 1988, Regulation of glucocorticoid
receptor expression: evidence for transcriptional and posttranslational mechanisms:
Molecular Endocrinology, v. 2, p. 1256-1264.

Drouin,J, Y L Sun, M Chamberland, Y Gauthier, A De Lean, M Nemer, T J Schmidt,
1993, Novel glucocorticoid receptor complex with DNA element of the hormone-
repressed POMC gene: EMBO J, v. 12, p. 145-156.

Drouin,J, Y L Sun, M Nemer, 1989, Glucocorticoid repression of pro-opiomelanocortin
gene transcription: J.Steroid Biochem., v. 34, p. 63-69.

Drucker,D, S Shumak, A Angel, 1984, Schmidt's syndrome presenting with intrauterine
growth retardation and postpartum addisonian crisis: Am J Obstet Gynecol, v. 149, p.
229-230.

Duncan,MR, G R Duncan, 1979, An in vivo study of the action of antiglucocorticoids on
thymus weight ratio, antibody titre and the adrenal-pituitary-hypothalamus axis.PG -: J
Steroid Biochem., v. 10.






90

Encio,IJ, S D Detera-Wadleigh, 1991, The genomic structure of the human
glucocorticoid receptor: Journal of Biological Chemistry, v. 266, p. 7182-7188.

Eriksson,P, O Wrange, 1990, Protein-protein contacts in the glucocorticoid receptor
homodimer influence its DNA binding properties: J.Biol.Chem., v. 265, p. 3535-3542.

Feldman,S, N Conforti, 1980, Participation of the dorsal hippocampus in the
glucocorticoid feedback effect on adrenocortical activity: Neuroendocrinology, v. 30, p.
52-55.

Froh,DK, P L Ballard, 1994, Fetal Lung Maturation, in GD Thorburn and R Harding
(eds), Textbook of Fetal Physiology: Oxford, Oxford University Press, p. 168-185.

Funder,JW, 1996, Mineralocorticoid receptors and glucocorticoid receptors:
Clin.Endocrinol.(Oxf), v. 45, p. 651-656.

Galigniana,MD, G P Vicent, G Piwien-Pilipuk, G Burton, C P Lantos, 2000, Mechanism
of action of the potent sodium-retaining steroid 11, 19- oxidoprogesterone:
Mol.Pharmacol., v. 58, p. 58-70.

Geller,DS, A Farhi, N Pinkerton, M Fradley, M Moritz, A Spitzer, G Meinke, F T Tsai, P
B Sigler, R P Lifton, 2000, Activating mineralocorticoid receptor mutation in
hypertension exacerbated by pregnancy: Science, v. 289, p. 119-123.

Giguere,V, S M Hollenberg, M G Rosenfeld, R M Evans, 1986, Functional domains of
the human glucocorticoid receptor.: Cell, v. 55, p. 899-906.

Gomez-Sanchez,EP, C E Gomez-Sanchez, 1992, Central mineralocorticoid receptor
antagonism blocks hypertension in Dahl/S/JR rats.: American Journal of Physiology, v.
262, p. E96-E99.

Gomez-Sanchez,EP, M T Venkataraman, D Thwaites, C Fort, 1990, ICV infusion of
corticosterone antagonizes ICV-aldosterone hypertension.: American Journal of
Physiology, v. 258, p. E649-E653.

Gray,JA, 1987, The Psychology of Fear and Stress, University Press, Cambride, MA.

Hammond,GC, J A Nisker, L A Jones, P K Siiteri, 1980, Estimation of the percentage of
free steroid in undiluted serum by centrifugal ultrafiltration-dialysis.: Journal of
Biological Chemistry, v. 255, p. 5023-5025.

Harding,R, 1994, Development of the respiratory system, in GD Thorburn and R Harding
(eds), Textbook of Fetal Physiology: Oxford, Oxford University Press, p. 140-167.






91

Heesch,CM, R C Rogers, 1995, Effects of pregnancy and progesterone metabolites on
regulation of sympathetic outflow.: Clinical and Experimental Pharmacology and
Physiology, v. 22, p. 136-142.

Heisler,LK, H M Chu, T J Brennan, J A Danao, P Bajwa, L H Parsons, L H Tecott, 1998,
Elevated anxiety and antidepressant-like responses in serotonin 5-HT1A receptor mutant
mice: Proc.Natl.Acad.Sci.U.S.A, v. 95, p. 15049-15054.

Hellal-Levy,C, B Couette, J Fagart, A Souque, C Gomez-Sanchez, M Rafestin-Oblin,
1999, Specific hydroxylations determine selective corticosteroid recognition by human
glucocorticoid and mineralocorticoid receptors: FEBS Lett., v. 464, p. 9-13.

Hellal-Levy,C, J Fagart, A Souque, M E Rafestin-Oblin, 2000, Mechanistic aspects of
mineralocorticoid receptor activation: Kidney Int., v. 57, p. 1250-1255.

Hennessy,DP, J P Coghlan, K J Hardy, B A Scoggins, E M Wintour, 1982, The origin of
cortisol in the blood of fetal sheep.: Journal of Endocrinology, v. 95, p. 71-79.

Herman,JP, 1993, Regulation of adrenocorticosteroid receptor mRNA expression in the
central nervous system: Cell Mol.Neurobiol., v. 13, p. 349-372.

Herman,JP, W E Cullinan, 1997, Neurocircuitry of stress: central control of the
hypothalamo-pituitary-adrenocortical axis.: Trends in Neurosciences, v. 20, p. 78-84.

Herman,JP, P D Patel, H Akil, S J Watson, 1989a, Localization and regulation of
glucocorticoid and mineralocorticoid receptor messenger RNAs in the hippocampal
formation of the rat: Molecular Endocrinology, v. 3, p. 1886-1894.

Herman,JP, M K Schafer, E A Young, R Thompson, J Douglass, H Akil, S J Watson,
1989b, Evidence for hippocampal regulation of neuroendocrine neurons of the
hypothalamo-pituitary-adrenocortical axis: J.Neurosci., v. 9, p. 3072-3082.

Herman,JP, R Spencer, 1998, Regulation of hippocampal glucocorticoid receptor gene
transcription and protein expression in vivo: J.Neurosci., v. 18, p. 7462-7473.

Herman,JP, S J Wiegand, S J Watson, 1990, Regulation of basal corticotropin-releasing
hormone and arginine vasopressin messenger ribonucleic acid expression in the
paraventricular nucleus: effects of selective hypothalamic deafferentations:
Endocrinology, v. 127, p. 2408-2417.

Hiroshige,T, S Wada-Okada, 1973, Diurnal changes of hypothalamic content of
corticotropin-releasing activity in female rats at various stages of the estrous cycle:
Neuroendocrinology, v. 12, p. 316-319.






92

Hoeck,W, S Rusconi, B Groner, 1989, Down-regulation and phosphorylation of
glucocorticoid receptors in cultured cells. Investigations with a monospecific antiserum
against a bacterially expressed receptor fragment: J.Biol.Chem., v. 264, p. 14396-14402.

Hollenberg,SM, R M Evans, 1988, Multiple and cooperative trans-activation domains of
the human glucocorticoid receptor: Cell, v. 55, p. 899-906.

Hollenberg,SM, C Weinberger, E S Ong, G Cerelli, A Oro, R Lebo, E B Tompson, M G
Rosenfeld, R M Evans, 1985, Primary structure and expression of a functional human
glucocorticoid receptor cDNA.: Nature, v. 318, p. 635-641.

Hubbard,J, M Kalimi, 1982, Synergistic effect of molybdate plus dithiothreitol on
stabilization, reactivation, and partial purification of the kidney glucocorticoid receptor: J
Biol.Chem., v. 257, p. 14263-14270.

Humphreys,PW, N Joels, 1977, Changes in cardiac output and total peripheral resistance
during the carotid sinus baroreceptor reflex in the pregnant rabbit: J.Physiol, v. 272, p.
45-55.

Hutchison,KA, K D Dittmar, W B Pratt, 1994, All of the factors required for assembly of
the glucocorticoid receptor into a functional heterocomplex with heat shock protein 90
are preassociated in a self-sufficient protein folding structure, a "foldosome":
J.Biol.Chem., v. 269, p. 27894-27899.

Imai,E, J N Miner, J A Mitchell, K R Yamamoto, D K Granner, 1993, Glucocorticoid
receptor-cAMP response element-binding protein interaction and the response of the
phosphoenolpyruvate carboxykinase gene to glucocorticoids: J.Biol.Chem., v. 268, p.
5353-5356.

Ismay,MJA, E R Lumbers, A D Stevens, 1979, The action of angiotensin II on the
baroreflex response of the conscious ewe and the conscious fetus: Journal of Physiology,
v. 288, p. 467-479.

Jacobson,L, R Sapolsky, 1991, The role of the hippocampus in feedback regulation of the
hypothalamic-pituitary-adrenocortical axis: Endocr.Rev., v. 12, p. 118-134.

Joels,M, E R de Kloet, 1994, Mineralocorticoid and glucocorticoid receptors in the brain.
Implications for ion permeability and transmitter systems: Prog.Neurobiol., v. 43, p. 1-36.

Jonat,C, H J Rahmsdorf, K K Park, A C Cato, S Gebel, H Ponta, P Herrlich, 1990,
Antitumor promotion and antiinflammation: down-modulation ofAP-1 (Fos/Jun) activity
by glucocorticoid hormone: Cell, v. 62, p. 1189-1204.