Accumulation of interspersed and sex-specific repeats in the non-recombining region of papaya sex chromosomesAccumulatio...

MISSING IMAGE

Material Information

Title:
Accumulation of interspersed and sex-specific repeats in the non-recombining region of papaya sex chromosomesAccumulation of interspersed and sex-specific repeats in the non-recombining region of papaya sex chromosomes
Physical Description:
Mixed Material
Language:
English
Creator:
Na, Jong-Kuk
Wang, Jianping
Ming, Ray
Publisher:
BioMed Central (BMC Genomics)
Publication Date:

Notes

Abstract:
Background: The papaya Y chromosome has undergone a degenerative expansion from its ancestral autosome, as a consequence of recombination suppression in the sex determining region of the sex chromosomes. The non-recombining feature led to the accumulation of repetitive sequences in the male- or hermaphrodite-specific regions of the Y or the Yh chromosome (MSY or HSY). Therefore, repeat composition and distribution in the sex determining region of papaya sex chromosomes would be informative to understand how these repetitive sequences might be involved in the early stages of sex chromosome evolution. Results: Detailed composition of interspersed, sex-specific, and tandem repeats was analyzed from 8.1 megabases (Mb) HSY and 5.3 Mb corresponding X chromosomal regions. Approximately 77% of the HSY and 64% of the corresponding X region were occupied by repetitive sequences. Ty3-gypsy retrotransposons were the most abundant interspersed repeats in both regions. Comparative analysis of repetitive sequences between the sex determining region of papaya X chromosome and orthologous autosomal sequences of Vasconcellea monoica, a close relative of papaya lacking sex chromosomes, revealed distinctive differences in the accumulation of Ty3-Gypsy, suggesting that the evolution of the papaya sex determining region may accompany Ty3-Gypsy element accumulation. In total, 21 sex-specific repeats were identified from the sex determining region; 20 from the HSY and one from the X. Interestingly, most HSY-specific repeats were detected in two regions where the HSY expansion occurred, suggesting that the HSY expansion may result in the accumulation of sex-specific repeats or that HSY-specific repeats might play an important role in the HSY expansion. The analysis of simple sequence repeats (SSRs) revealed that longer SSRs were less abundant in the papaya sex determining region than the other chromosomal regions. Conclusion: Major repetitive elements were Ty3-gypsy retrotransposons in both the HSY and the corresponding X. Accumulation of Ty3-Gypsy retrotransposons in the sex determining region of papaya X chromosome was significantly higher than that in the corresponding region of V. monoica, suggesting that Ty3-Gypsy could be crucial for the expansion and evolution of the sex determining region in papaya. Most sex-specific repeats were located in the two HSY expansion regions. Keywords: Bacterial artificial chromosome (BAC), Carica papaya, Hermaphrodite-specific region of the Y chromosome (HSY), Recombination suppression, Repetitive sequence, Sex-specific repeat
General Note:
Na et al. BMC Genomics 2014, 15:335 http://www.biomedcentral.com/1471-2164/15/335; Pages 1-12
General Note:
doi:10.1186/1471-2164-15-335 Cite this article as: Na et al.: Accumulation of interspersed and sexspecific repeats in the non-recombining region of papaya sex chromosomes. BMC Genomics 2014 15:335.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
© 2014 Na et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated
System ID:
AA00024415:00001

Full Text

PAGE 1

RESEARCHARTICLEOpenAccessAccumulationofinterspersedandsex-specific repeatsinthenon-recombiningregionofpapaya sexchromosomesJong-KukNa1,2 †,JianpingWang1,3,4 †andRayMing1,4*AbstractBackground: ThepapayaYchromosomehasundergoneadegenerativeexpansionfromitsancestralautosome, asaconsequenceofrecombinationsuppressioninthesexdeterminingregionofthesexchromosomes.The non-recombiningfeatureledtotheaccumulationofrepetitivesequencesinthemale-orhermaphrodite-specific regionsoftheYortheYhchromosome(MSYorHSY).Therefore,repeatcompositionanddistributioninthesex determiningregionofpapayasexchromosomeswouldbeinformativetounderstandhowtheserepetitive sequencesmightbeinvolvedintheearlystagesofsexchromosomeevolution. Results: Detailedcompositionofinterspersed,sex-specific,andtandemrepeatswasanalyzedfrom8.1megabases (Mb)HSYand5.3MbcorrespondingXchromosomalregions.Approximately77%oftheHSYand64%ofthe correspondingXregionwereoccupiedbyrepetitivesequences. Ty3-gypsy retrotransposonswerethemostabundant interspersedrepeatsinbothregions.Comparativeanalysisofrepetitivesequencesbetweenthesexdeterminingregion ofpapayaXchromosomeandorthologousautosomalsequencesof Vasconcelleamonoica ,acloserelativeofpapaya lackingsexchromosomes,revealeddistinctivedifferencesintheaccumulationof Ty3-Gypsy ,suggestingthatthe evolutionofthepapayasexdeterminingregionmayaccompany Ty3-Gypsy elementaccumulation.Intotal,21 sex-specificrepeatswereidentifiedfromthesexdeterminingregion;20fromtheHSYandonefromtheX.Interestingly, mostHSY-specificrepeatsweredetectedintworegionswheretheHSYexpansionoccurred,suggestingthattheHSY expansionmayresultintheaccumulationofsex-specificrepeatsorthatHSY-specificrepeatsmightplayanimportant roleintheHSYexpansion.Theanalysisofsimplesequencerepeats(SSRs)revealedthatlongerSSRswerelessabundant inthepapayasexdeterminingregionthantheotherchromosomalregions. Conclusion: Majorrepetitiveelementswere Ty3-gypsy retrotransposonsinboththeHSYandthecorrespondingX. Accumulationof Ty3-Gypsy retrotransposonsinthesexdeterminingregionofpapayaXchromosomewassignificantly higherthanthatinthecorrespondingregionof V.monoica ,suggestingthat Ty3-Gypsy couldbecrucialforthe expansionandevolutionofthesexdeterminingregioninpapaya.Mostsex-specificrepeatswerelocatedinthetwo HSYexpansionregions. Keywords: Bacterialartificialchromosome(BAC), Caricapapaya ,Hermaphrodite-specificregionoftheYchromosome (HSY),Recombinationsuppression,Repetitivesequence,Sex-specificrepeat *Correspondence: rming@life.illinois.edu†Equalcontributors1DepartmentofPlantBiology,UniversityofIllinoisatUrbana-Champaign, Urbana,IL61801,USA4FAFUandUIUC-SIBJointCenterforGenomicsandBiotechnology,Fujian AgricultureandForestryUniversity,Fuzhou,Fujian350002,China Fulllistofauthorinformationisavailableattheendofthearticle 2014Naetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycredited.TheCreativeCommonsPublicDomain Dedicationwaiver(http://creativecommons.org/publicdomain/zero/1.0/)appliestothedatamadeavailableinthisarticle, unlessotherwisestated.Na etal.BMCGenomics 2014, 15 :335 http://www.biomedcentral.com/1471-2164/15/335

PAGE 2

BackgroundPapaya( Caricapapaya L.)isamajortropicalfruitcrop, andtheonlyspeciesinthegenus Carica .Papayashared acommonancestorwith Arabidopsis approximately 72millionyearsago.Itsshortjuvenilephaseof3to 4months,continuousflowering,shortgenerationtime of9months,andsmallgenomesizeof372Mb[1]make papayaapromisingmodelfortropicalfruittreegenomics[2].Thoughthepapayagenomesizeisthreetimes thatof Arabidopsis ,theannotationofpapaya ’ swhole genomesequencerevealedthatitcontainsfewergenes than Arabidopsis [2],suggestingthatthepapayagenome mightcontainsignificantlymorerepetitivesequences thanthe Arabidopsis genome. The Caricaceae familyconsistsof35species;one monoecious,32dioecious,andtwotrioeciousspecies, providinganinvaluablesystemforstudyingplantsex determination. VasconcelleaMonoica isamonoecious specieswithnosexchromosomes,whereasalldioecious andtrioeciousspeciesarelikelytohavesexchromosomes. Papayaisatrioeciousspecieswiththreesexphenotypes; female,male,andhermaphrodite.Thesexdetermination ofpapayaiscontrolledbyapairofprimitivesexchromosomes.FemalepapayahashomogameticXXchromosomes,whereasmaleandhermaphroditeplantshave heterogameticXYchromosomes.ThemaleandthehermaphroditehaveslightlydifferentYchromosomes,Yfor malesandYhforhermaphrodites[3,4]. Thepapayahermaphrodite-specificYhchromosome (HSY)regionoccupiesapproximately13%oftheYhchromosome[5],andthechromosomalgeneticrecombinationaroundthisregionissuppressed[6,7],atypical featureofsexchromosomes[4].Thesuppressionof recombinationcreatesconditionsthatarefavorablefor theaccumulationofdeleteriousmutationsinthenonrecombiningregionofYhchromosome,andconsequently theHSYhasevolvedinbothphysicalsizeandgenecontenttodifferentiatefromthecorrespondingX[8].The highlydivergedhumanXandYchromosomesonlyshare aboutadozenpairsofgenesinthemalespecificregionof theYchromosome(MSY).ThehumanYchromosomeis occupiedbynearly95%MSY,andonly5%terminalarea, calledpseudoautosomalregions,accountingforcrossing overwiththeXchromosome[9].ThehumanYchromosomecontainsahighpercentageofrepetitiveelements andduplicatedregionsbutlowgenecontent[9,10].ComparedtothehumanMSY,thepapayaHSYisattheearly stageofitsevolutionandoccupiesonly13%oftheYhchromosome[5],butanalysisofHSYbacterialartificial chromosomes(BACs)reveal edthatthepapayaHSYcontainedsignificantlyhigherrep eatcontent[3,11].Inaddition, thesequenceanalysisoftheseBACsexhibitedahighercontentof Ty3-gypsy andsome Ty1-copia retroelements,which arenormallyabundantnearthecentromericregion. Althoughitiswellknownthattherecombinationsuppressionofhomologoussexchromosomescausestheaccumulationofrepetitivesequences,littleisknownabout thefeatureofsex-specificrepeatsinplants.Sex-specific markersareimportantfordeterminingthepresenceof sexchromosomes[12].Indatepalm( Phoenixdactylifera ),thepresenceofsexchromosomeswasverifiedby theidentificationofsex-specificDNAmarkers[13].In hop( Humuluslupulus L.),intersimplesequencerepeat (ISSR)markerswereidentifiedassex-specificmarkers [14].Todate,dozensofsex-specificmarkershavebeen identifiedinvariousplantspeciesandtheyaremostly usedtosupportthepresenceofsexchromosomes[15]. IftheYchromosomeisdegeneratedprogressively,then sex-specificrepeatscouldbeaveryusefulmarkerto examinethelineageofYchromosomesamongplant speciesandperhapstheyareusefultounderstandduplicationeventsoccurredinagivenYchromosome.Recently,fourY-specificsatelliteDNAfamilies,RAYSI, RAE180,RAYSI-S,andRAYSI-J,wereidentifiedfrom Rumexacetosa andusedsuccessfullyasthereferencesto examinethedegenerationoftheYchromosomeamong thegenus Rumex [16,17].Therefore,identificationof sex-specificrepeatsandanalysisoftheirsequencefeaturesinpapayacanprovidevaluablegenomicresources forunravelinggeneticlineagesofsexchromosomes amongdioeciousandtrioeciousspeciesinthe Caricaceae familyandforrevealingtherolesthatsex-specific repeatsplayinthesexchromosomeevolution.Asfor agriculturalaspectsofpapayaorotherfruitcropswith differentsextypes,sex-specificrepeatscanbeusedto developmolecularmarkersthatdistinguishplantsex typesattheseedlingstage. Theinsertionsoftransposableelementsarebelievedto beoneoftheearliesttriggersthatcausethesuppression ofrecombination[18].Sincepapayasexchromosomesare believedtobeatanearlystageofevolution,theinformationfrompapayarepetitivesequenceanalysiscouldbe usedtotestwhethersuchinsertionsoftransposableelementsareindeedacausefortherecombinationsuppressionbyout-crossingwithmonoecious V.monoica .Here, wereportnotonlythedetailedrepetitivesequencefeaturesofthenewlysequencedpapayaHSYandthecorrespondingX,butalsothecomparisonofrepetitive sequencefeaturesbetweenthepapayasexdeterminingregionandtheorthologousautosomalregionin V.monoica whichhasnosexchromosomes[19],toprovideinsights intopapayasexchromosomeevolutionandtheirsequence features.Asexpected,theHSYishighlyabundantwithinterspersedrepeatscomparedtothecorrespondingX chromosomeandthepapayagenome.Anewsearchofinterspersedrepeatsinthegivensequencesenabledthe identificationof36newrepeatswith21ofthembeing sex-specificrepeats,whichprobablycouldbeusedasaNa etal.BMCGenomics 2014, 15 :335 Page2of12 http://www.biomedcentral.com/1471-2164/15/335

PAGE 3

referenceforanalysisofYchromosomesamongtheother speciesinthe Caricaceae family.ResultsCompositionofinterspersedrepeatsinthesex determiningregionofpapayaToexaminerepetitivesequencesinboththeHSYandthe correspondingX,thesequencesweremaskedbyRepeatMaskerusingacustomizedrepeatdatabaseasalibrary consistingofRepbase,TIGRrepeatdata,andpapayarepeats[20].Resultsshowedthattheinterspersedrepeatsoccupiedapproximately77%oftheHSY(6,226,262bp),64% ofthecorrespondingX(3,379,825bp),andonly20.9%of V.monoica (Table1).Amongallinterspersedrepeatsidentified,theretroelementswerethemostabundantrepeats, 64%,54%,and16%intheHSY,thecorrespondingX,and V.monoica ,respectively.Theseretroelementsaccounted forthevastmajorityofallidentifiableinterspersedrepeats andonlyasmallfraction(<1%)oftheinterspersedrepeats wereDNAtransposonsintheHSY,thecorrespondingX, and V.monoica (Table1).Therefore,itislikelythatthe majorityofunclassifiedinterspersedrepeats(13.5%inthe HSYand9.6%inthecorrespondingX)couldbeclassified intoretroelementsiftheycouldbeannotated(Table1). Longterminalrepeats(LTRs)accountedformorethan 97%ofallidentifiableretroelementsinallthreesourcesof sequencesandthe Ty3-gypsy elementwasthemostabundantLTRintheHSYandthecorrespondingX,whereas Ty1-copia elementwasmoreabundantin V.monoica (Table1).Thenumberandsequencesof Ty3-gypsy elementsincreasednotablyalongtheincreaseofsequence lengthintheHSYandthecorrespondingX(Figure1Aand B).Toexaminetheportionofpapaya-specificrepeatsaccountingforinterspersedrepeats,theHSYandthecorrespondingXsequenceswerealsomaskedbyonlyknown repeats,consistingofRepbaseandTIGRrepeatsexcluding papayarepeats.Theknownrepeatcontentwasapproximately19.5%intheHSY;2%higherthan17.5%inthecorrespondingX(Table1).Asaresult,papaya-specificrepeats wereatleast57.8%and46.3%intheHSYandinthecorrespondingX,respectively. AlthoughtheHSYandthecorrespondingXwerehighly occupiedbyinterspersedrepeats,therewerepotentialgene richregionswithsignificantlylowrepeataccumulation. Twolargesequenceblockswithscarceornorepeatswere detectedfrom1.8to2.2Mbandfrom3.2to3.7Mbinthe correspondingX[21],whereasonlyonelargeblockwith lowrepeatcontentwasfoundfrom4.6to5.3Mbregionin theHSY[21].Identificationofsex-specificrepeatsinthepapayasex determiningregionFromtheextensivesearchforsex-specificrepeatsinthe sexdeterminingregion,36putativesex-specificrepeats wereidentified,33fromtheHSYandthreefromthe correspondingX(Additionalfile1:Note1).Inorderto determinesex-specificrepeatsamongthe36newlyidentifiedrepeats,allrepeatswerealignedagainstpapaya genomesequences.Amongthem,21repeatswereselectedaspotentialsex-specificrepeatsbecausetheyhad nomatchorverylowoccurrenceinthepapayagenome (<10times;Additionalfile2:TableS1).Althoughthe restoftherepeatswerepresentinboththesexdeterminingregionandthepapayagenome,theyweremore frequentinthesexdeterminingregion(Additionalfile2: TableS1).The36newrepeatsoccupiedapproximately 19.9%oftheHSY,12.9%ofthecorrespondingX,and 5.7%ofthepapayagenome(Table2).Bycontrast,the21 sex-specificrepeatsaccountedfor10.7%oftheHSY sequences,3.5%ofthecorrespondingX,and0.9%of thepapayagenome(Table2).Totestwhetherpapaya and V.monoica shareanycommonrepeatsequences, weanalyzedtheaccumulationofthesex-specificrepeats in V.monoica shotgunsequencesandthe11 V.monoica BACsequencescorrespondingtothesexdetermining regionoftheXchromosome.Both V.monoica genome andtheBACsequenceshowedmuchlesssex-specific repeataccumulation(Table2). Toexaminethelocalizationofthesex-specificrepeats inthesexdeterminingregion,allpositionsalignedwith thesex-specificrepeatswereplottedtotheircorrespondinglocationsintheHSY(Figure2A)orinthecorrespondingX(Figure2B).MostHSY-specificrepeatswere locatedintworegionsintheHSY,from2.0to4.0and5.0 to7.5Mb(Figure2A),butrarelyfoundinthecorrespondingXexceptforX-R55(Figure2B),anX-specificrepeat. Remarkably,thetworegionsintheHSYwithhighHSYspecificrepeatswerematchedtotwoHSYexpansionregionsverywell[21]. Amongthe21potentialsex-specificrepeats,twoHSYspecificrepeats,HSY-R29andHSY-R162,andone X-specificrepeat,X-R55,wereselectedforfurtheranalyses.HermaphroditespecificityofbothHSY-specificrepeatswasconfirmedbyPCRusinggenomicDNAsamples astemplates.Bothrepeatswereconfirmedtobepresent onlyinSunUphermaphroditeplantshavingboththe hermaphroditeYhandXchromosomes,butnotinSunUp femaleshavingtwoXchromosomes(Figure3A).Sinceall HSY-specificrepeatswerepresentinmorethan10copies (Additionalfile3:TableS2),itwasofinteresttoexamine thephylogeneticrelationshipamongcopiesofeachHSY repeat.Twenty-twoalignedsequencestoHSY-R29and thirteenalignedsequencestoHSY-R162wereretrieved fromtheHSYsequencesforphylogeneticanalysis.Phylogeneticanalysisrevealedthattherewasnocorrelation betweendistanceandsequenceidentityamongcopies (Figure3BandC),whichwasfurtherconfirmedbythe Manteltest(Additionalfile4:FigureS1).ThecorrelationNa etal.BMCGenomics 2014, 15 :335 Page3of12 http://www.biomedcentral.com/1471-2164/15/335

PAGE 4

Table1InterspersedrepeatsinthesexdeterminingregiononpapayasexchromosomesRepeatclass/familyHSY(8062184bp)CorrespondingX(5298217bp) Vm X(1079651bp) KnownrepeatsKnownpluspapaya repeats KnownrepeatsKnownpluspapaya repeats KnownrepeatsKnownpluspapaya repeats Length occupied (bp) Percentageof sequence(%) Length occupied (bp) Percentageof sequence(%) Length occupied (bp) Percentageof sequence(%) Length occupied (bp) Percentageof sequence(%) Length occupied (bp) Percentageof sequence(%) Length occupied (bp) Percentageof sequence(%) Retroelements137515317.0513040263.688256916.4286760254.111411610.517817416.4 LINEs5600.0500370.67780.0640041.23330.063510.6 LTRelements137459317.0508036563.088179116.4280359852.911378210.517182315.9 Ty1/Copia1809932.24006195.01660093.13328506.3594035.5975549.0 Ty3/Gypsy106513713.2373552046.361637911.5199787737.7326313.0481444.4 DNAtransposons11110.078190.112560.047040.141470.488630.8 En-Spm81-810.05260.05120.025810.245130.4 MuDR-IS905----93-930.04020.09010.1 Unclassified1932582.4108804113.5578901.15075199.658760.5397843.7 Totalinterspersedrepeats156952219.5622626277.294171517.5337982563.812413911.522682120.9Na etal.BMCGenomics 2014, 15 :335 Page4of12 http://www.biomedcentral.com/1471-2164/15/335

PAGE 5

coefficientoftheManteltest(Rxy)andtheone-tailed p-value(rxy-rand rxy-data)were0.014and0.511forthe HSY-R29and-0.033and0.378fortheHSY-R162, respectively. ThepotentialX-specificrepeat,X-R55,appeared22 times(>100bp)onlyinthecorrespondingX,butnotin theHSYandpapayagenomesequences(excludingX chromosome).ThecopiesoftheX-R55repeatwere presentwithinasmallrangewith~50kb(Figure4A)in thecorrespondingX,andtherepeatsizerangedfrom 109to306bp.Exceptforthetwocopiesatbothends, therestofthe20copieswereorientedinthesame directionandtandemlyrepeatedinthreeseparaterepeat blocks,apartfromeachotherbyabout8to15kb (Figure4A).Thefirstrepeatblocknearazincfinger proteinconsistedof4tandemrepeats,thesecondblock of11,andthethirdblockof5(Figure4A).Amongthe 22copiesofX-R55repeat,the17copieslongerthan 200bpwereusedforphylogeneticanalysis.Similarto theresultofphylogeneticanalysisoftwoHSY-specific repeats,thedistanceamongindividualcopiesdidnot showcorrelationtothesequencesimilarity(Figure4B, Additionalfile4:FigureS1).Aninterestingfeatureof theX-R55repeatwasthatitshowedveryhighsequence identity(91%)withthethirdexonofapotential Carica papaya ( Cp )zincfingerproteinnearby(Figure4A), whoseexpressionwasconfirmedbyanexpressedsequencetag(GB:EX272522.1).IftheX-R55repeatsoriginatedfromthethirdexonofthe Cp zincfingerprotein, thesecondrepeatblockcouldbethemostrecentlyduplicated,onthebasisofphylogeneticanalysis(Figure4B). ThepresenceoftheX-R55repeatwasconfirmedby PCR(Figure4C).Theexpressionofthe Cp zincfinger proteinwasexaminedbyRT-PCRanddetectedinallsex typesofflowersandleaftissuesfrom ‘ SunUp ’ and ‘ AU9 ’ papayas,andalsoinseedandhalfripenedfruitof ‘ SunUp ’ (Figure4D).Phylogeneticanalysisrevealedthat the Cp zincfingerproteinwascloselyrelatedto Arabidopsis zincfingergene(NP_565037)(Figure4E).AccumulationofSSRsinthesexdeterminingregionAccumulationofrepetitivesequencesisoneofthekey elementsforthedegenerationofsexchromosomes.Accordingly,highrepetitivesequenceaccumulationwas observedinpapayaHSYandinthecorrespondingX comparedtothatofpapayagenome[2,21].However,not Sequence length (Mb) 02468 Sequence occupied by repeats (x Mb) 0 1 2 3 4 5 HSY: Gypsy + Copia X: Gypsy + Copia HSY-Gypsy X-Gypsy HSY-Copia X-Copia Sequence len g th (Mb) 02468 Cumulative numbers of repeats (x 1000) 0 1 2 3 4 5 6 HSY: Gypsy + Copia X: Gypsy + Copia HSY-Gypsy X-Gypsy HSY-Copia X-Copia B A Figure1 Cumulativedistributionsof Ty3-gypsy and Ty1-copia longterminalrepeat(LTR)elementsinthesex-determiningchromosome regions.(A) Thecumulativeincreaseofsequencesoccupiedby Ty3-gypsy and Ty1-copia LTRelementsinhermaphrodite-specificY(HSY)chromosome regionanditscorrespondingXregion. (B) Thecumulativenumbersof Ty3-gypsy and Ty1-copia LTRelementsintheHSYandthecorrespondingX region.Thedistancebetweentwodotsrepresents250kb.ColoredbarsatanX-axisdenoteregionswithsignificantlylowrepeatcontentsintheHSY (red)orinthecorrespondingXregion(blue). Table2AccumulationofnewlyidentifiedrepeatsfromthesexdeterminingregionSequence source AllnewrepeatsSexspecificrepeatsSequence length(bp) #ofelementsLengthoccupied(bp)%ofsequence#ofelementsLengthoccupied(bp)%ofsequence HSY3762160917319.9194486669410.78062184 CorrespondingX151669289412.94831889433.515298217 Vm X1247790.4737830.41079651 Cp genome47698212039935.7924534364690.9271742010 Vm genome60527233350.334694758080.2245072629 Na etal.BMCGenomics 2014, 15 :335 Page5of12 http://www.biomedcentral.com/1471-2164/15/335

PAGE 6

onlyinterspersedrepeatsbutalsotandemDNArepeats wereaccumulatedinsexchromosomes[22].Simplesequencerepeats(SSRs)oftheshorttandemDNArepeats normallyoriginatefromslippageduringDNAreplication.Therefore,SSRswereexaminedintheHSYandthe correspondingX(Figure5andTable3).TheSSRdensitiesweremuchlowerintheHSY(oneper8.1kb)than inthecorrespondingX(oneper5.4kb)andthepapaya genome(oneper3.2kb).Ontheotherhand,SSRdensitiesof V.monoica BACsequenceswereevenhigher HSY sequence (Mb) 02468 Cumulative number of sex-specific repeat 0 5 10 15 20 25 30 HSY-R29 HSY-R162 RHSY15_29 RHSY15_40 RHSY15_46 RHSY15_48 RHSY15_56 RHSY15_57 RHSY15_65 RHSY15_92 RHSY15_97 RHSY15_136 RHSY15_171 RHSY15_201 RHSY15_213 RHSY15_216 RHSY15_229 RHSY15_253 RHSY15_326 RHSY15_568 X sequence (Mb) 012345 Cumulative number of sex-specific repeats 0 5 10 15 20 25 X-R55 RHSY15_29 RHSY15_46 RHSY15_48 RHSY15_57 RHSY15_65 RHSY15_253 B A Figure2 Cumulativedistributionsofthesex-specificrepeatsidentifiedfromthesex-determiningchromosomeregions.(A) The accumulativenumberofeachsex-specificrepeatinthehermaphrodite-specificY(HSY)chromosomeregion. (B) Theaccumulativenumberof eachsex-specificrepeatintheHSY-correspondingXregion.Intotal,21sex-specificrepeatswereidentifiedfromthesexdeterminingregion;20 fromtheHSYandonefromthecorrespondingX.MostofHSY-specificrepeatswerelocatedintworegionswheretheHSYexpansionoccurred. HSY-R29 HSY-R162 Positive SF AU9F AU9M SHB C AHSY-R162 HSY-R29 2421137 2898383 3063273 6073943 6579622 3653005 5923890 3478650 3563454 5546542 7440094 2988972 5975925 2960536 3116553 7489503 2490399 3494249 3579012 6497447 3079559 5987237 100 99 84 58 46 100 100 31 5 5 39 3 100 100 39 100 98 11 43 0.01 7516045 6507972 5563875 3589575 3504812 6702526 6582440 6071173 2895675 3655498 2986779 7491815 5921640 61 100 49 57 89 94 95 35 27 22 0.01 Figure3 Identification,validation,andphylogeneticanalysesofsex-specificrepeatsinthesexdeterminingchromosomeregions. (A) GelimageofgenomicPCRresultfrommale-specificitytestofHSY-R29andHSY-R162(SF:SunUpfemale,SH:SunUphermaphrodite,AU9F: AU9Female,AU9M:AU9male).PhylogeneticanalysesofpapayaHSY-specificrepeats,HSY-R162 (B) andHSY-R29 (C) .IndividualrepeatID representsitsproximallocation(bp)intheHSY. Na etal.BMCGenomics 2014, 15 :335 Page6of12 http://www.biomedcentral.com/1471-2164/15/335

PAGE 7

(oneper2.3kb)thanpapayagenome(Table3).SSRs havebeencategorizedintotwoclasses,classIandclass II.ClassIincludeshypervariableSSRs 20bp,whereas classIIconsistsoflessvariableSSRs 12bpand<20bp [23].ClassIandclassIISSRdensitieswerelowereitherin theHSYorinthecorrespondingXcomparedtothose inthepapayagenome(Table3).ClassIandClassIISSR densitiesin V.monoica BACsequencewerecomparable tothosein V.monoica shotgungenome(Table3).ClassI SSRdensitiesinthecorrespondingX, V.monoica BACs andshotgunsequence,andpapayagenomewereapproximatelytwo-foldlessthanthatofclassIISSR,but muchlessintheHSYcomparedtotherest.SSRdensity ofdi-nucleotideSSRunitsweresimilarbetweenpapaya genomeand V.monoica shotgunorBACsequences,but SSRdensityoftri-nucleotideSSRunitsin V.monoica genomewassignificantlyhigherthanthatofthepapaya genome(Table4).Therefore,itwasevidentthatSSRfrequencyinthesexdeterminingregionwaslowerthan thatinpapayagenomeand V.monoica genome. E B CSunUp SunUp FFFL HFHLFFFL MFMLSDFT AU9Cp zinc finger ActinA DSF AU9F AU9M SH X-R55 PositiveX-R55 Cp zinc finger protein 15 kb 8 kb 12 kb 9kb 1 22 X-R55-1 X-R55-10 X-R55-11 X-R55-3 X-R55-8 X-R55-6 X-R55-15 X-R55-14 X-R55-5 X-R55-2 X-R55-9 X-R55-13 X-R55-7 X-R55-4 X-R55-16 X-R55-12 91 48 68 23 3 33 17 78 35 23 2 27 6 0.02 NP 001051839 EAY92505 EAZ29234 XP 001769535 NP 567943 BAC43725 AAM62531 CAO64673 CAN71768 AAM63145 NP 564172 AAF18527 NP 565037 Cp zinc finger 98 100 76 100 78 94 100 87 100 91 97 0.05 Figure4 AssociationofpotentialX-specificrepeatintheexonduplicationofpapayazincfingerprotein.(A) Schematicdemonstrationof theduplicationofX-specificrepeat,X-R55,containingthe3rdexonofpapayazincfingerprotein(accessionID:EX272522.1). (B) Phylogenetictree ofmultipleX-R55copies.Thenumbersattherootofeachbranchjoiningpointarebootstrapvalues. (C) GelimageofgenomicPCRresultfor testingpresenceoftheX-R55(SF:SunUpfemale,SH:SunUphermaphrodite,AU9F:AU9Female,AU9M:AU9male). (D) GelimageofRT-PCRresult fortestingtheexpressionofpapayazincfingerproteininvarioustissuesfromSunUpandAU9papaya(FF:femaleflower,FL:femaleleaf,HF: hermaphroditeflower,HL:hermaphroditeleaf,MF:maleflower,ML:maleleaf,SD:seeds,FT:50%maturefruit). (E) .Phylogenetictreeofpapaya zincfingerprotein( Cp zincfinger)withhomologousproteinsfromotherplantspecieswithaccessionIDinNCBI. Sequence len g th (Mb) 02468 Cumulative increase of SSRs (x 100) 0 2 4 6 8 10 12 HSY X Figure5 Cumulativedistributionsofsimplesequencesrepeats (SSRs)inthesexdeterminingchromosomeregions. SSRswitha lengthgreaterthan12nucleotides,motiflengthsof2to6bp,anda minimumof5repeats,weredetectedfromtheHSYandthe correspondingXsequences.NumberoftotalSSRsidentifiedfrom each0.5MbwasplottedatthecorrespondingpositionsontheHSY andthecorrespondingX. Na etal.BMCGenomics 2014, 15 :335 Page7of12 http://www.biomedcentral.com/1471-2164/15/335

PAGE 8

DiscussionInthisstudy,wecharacterizedthedetailedgenomic structureofthepapayasexdeterminingregionbyanalyzingtheinterspersedandshorttandemrepeatdistributionandidentifyingpotentialsex-specificrepeats. Analysisofsex-specificrepeatsrevealedthattheaccumulationanddistributionoftheserepeatshaveavery closerelationshipwiththeexpansionofthesexdeterminingregion,implyingthatsex-specificrepeatsmay playcrucialrolesinthedifferentiationofsexchromosomes.Inaddition,thecorrespondingXwascompared toorthologousautosomalsequencesof V.monoica ,revealingthattheexpansionofthepapayasexdetermining regionisassociatedwithincreasedfrequencyof Ty3gypsy retroelements.DistributionofrepetitivesequencesYchromosomesarefeaturedbydegeneration,duplication,andabundanceofrepetitivesequencesduetoa non-recombiningproperty.TheHSYsequencesonthe papayaYhchromosomewereoccupiedbyhigherrepetitivesequences,comparedtoitsXcounterpart[2,21]. TheaveragerepeatcontentoftheHSYwasapproximately77%,13%higherthanthe64%ofthecorrespondingX(Table1).Thesenumbersweredifferentfrom whatwereportedpreviously[2,21],whichwascausedby theanalysisofall5.3MbXsequencesincluding1.8Mb Knob1sequencesthatwerenotincludedintheprevious report.ThehighaccumulationofrepetitiveDNAsequenceswasshowninancientYchromosomesinhuman[24]and Drosophilamelanogaster [25],alsointhe nascentYchromosomein DrosophilaMiranda [26]and Silenelatifolia [22].RepeatcontentsoftheHSYandthe correspondingXincreaseddramaticallywhenmasked byarepeatlibrarycontainingbothpapayaandpublic repeatsequences,comparedtotherepeatcontentsof 19.5%oftheHSYand17.5%ofthecorrespondingX whenbothsequencesweremaskedbyonlypublicly availableknownrepeatsequences(Table1),indicating thatthemajorityofrepeatsaccumulatedinthesexdeterminingregionsaremostlikelypapaya-specific[20].It isworthnotingthattheconservedrepetitivesequences intheHSYanditsXcounterpartweremorethanthe genome-wideaverageof14%[2]andalsohigherthan therepeatcontentin V.monoica ,whichhasnosex chromosomes,reinforcingthenotionthatincreasedrepetitivesequencesareafeatureofthesexdetermining region. Ty3-gypsy elementswerehighlyaccumulatedinthe sexdeterminingregionandaccountedfor46.3%ofthe HSYand37.7%ofthecorrespondingX(Table1and Figure1).The Ty3-gypsy contentoftheHSYwas~8% lowerthanthatthepreviousstudyestimatedfromsequencesofsevenHSYBACswhereitwas54%[2],which mightbeduetounevendistributionof Ty3-gypsy elements throughouttheHSY.Ontheotherhand,the Ty1-copia elementswerelessabundantcomparedto Ty3-gypsy in boththeHSYandthecorrespondingX(Table1and Figure1). Ty1-copia contentinthecorrespondingXwas 1.3%higherthanthatintheHSY(Table1),suggesting that Ty1-copia elementswerenotamajorcontributorto repeataccumulationinboththeHSYandthecorrespondingX.Thisresultisdifferentfromtheretroelementaccumulationin S.latifolia Ychromosomewhere Ty1-copia elementsaremoreabundantthan Ty3-gypsy elements [27].Itcouldbeduetotheincompletesequencesof Table3DistributionofSSRclassesidentifiedindifferencesourcesofsequencesSequence sources Size(Mb)ClassISSRClassIISSRTotalSSR NumberDensity(Kb/SSR)NumberDensity(Kb/SSR)NumberDensity(Kb/SSR) HSY8.124832.574810.89968.1 CorrespondingX5.331716.76608.09775.4 Vm X1.11736.22893.74622.3 Cp genome271.7287999.4551624.9839613.2 Vm genome245.1293648.3693463.5987102.5 Table4SSRdistributionbySSRunitsizeUnit size HSYCorrespondingX Vm X Cp genome Vm genome NumberDensity (Kb/SSR) NumberDensity (Kb/SSR) NumberDensity (Kb/SSR) NumberDensity (Kb/SSR) NumberDensity (Kb/SSR) 274210.97696.93313.3664314.1684053.6 321238.017131.01199.11386619.6271899.0 415537.511481.74269.92248120.92070118.4 524335.919278.94269.91062255.9463529.3 632687.47756.94269.9354767.6583420.4 Na etal.BMCGenomics 2014, 15 :335 Page8of12 http://www.biomedcentral.com/1471-2164/15/335

PAGE 9

S.latifolia Ychromosomeorthefeatureoftheveryearly evolutionarystageofhomomorphicYhchromosomein C.papaya comparedtoheteromorphicYchromosome suchasin S.latifolia Rumenacetosella ,and Marchantia polymorpha .DecreasedSSRfrequencyinthesexdeterminingregionSSRdensitywassignificantlylowerintheHSYandinthe correspondingXcomparedtothatinpapayaor V.monoica genomes(Table3)duetotheincreaseoftheoverall repetitivesequenceandthedecreaseofgenecontent[21]. TheseresultssuggestthattheHSYislessvulnerableto mutationcausedbyreplicationslippagecomparedto otherchromosomeregionstomaintainitsuniquesequencefeature.ClassIandclassIIdensitiesin V.monoica BACsequenceswerecomparabletothosein V.monoica shotgungenome,whereasthosedensitiesinthesexdeterminingregionweremuchlowerthanthoseinthepapaya genome(Table3),indicatingthatlowSSRdensityinthe HSYandthecorrespondingXwasmostlikelycausedby theprocessoftheevolutionofpapayasexchromosomes accompaniedbytheinsertionofrepetitivesequences.The densityofClassISSR(longerthanclassIISSR)inthe HSYwaslowerthantherest,suggestingthatthelonger SSRsmightbemoresusceptibletodegenerationinthe HSY.Sex-specificrepeatsPapayasextypesaredeterminedbyasmallnon-recombiningregionofrecentlyevolvedsexchromosomes[2]. ThesuppressionofrecombinationintheHSYaccompaniestheaccumulationofrepetitivesequencesand chromosomalrearrangements.Thesechangesmightultimatelyresultintheevolutionofsex-specificrepeats andthedifferentiationofsexchromosomesfromtheir ancestralautosomes.PhylogeneticanalysisandMantel testofthreesex-specificrepeats,HSY-R29,HSY-R162, andX-R55,revealedthatthedistanceandsequence similarityamongcopiesofeachrepeathadnocorrelation(Figure3BandC,Additionalfile4:FigureS1), indicatingthattheinsertionofrepeatsoccurredeitherin arandommannerregardlessofthephysicaldistance betweenoriginalandnewtargetsitesorrearrangements occurredaftertandemduplications.TheHSY-R29and HSY-R162didnotshowanysimilarsequencematch fromtheNCBInucleotidedatabaseandTIGRplant repeatdatabase(http://plantrepeats.plantbiology.msu. edu/).However,manyHSY-R29flankingsequences (~500bp)showedsimilaritytochloroplastDNAofpapaya andotherplantspecies(datanotshown),suggestingthat thepossibleoriginofHSY-R29mightbeassociatedwith chloroplastDNAinsertions.DNAfragmentstransferring fromorganellesarenotrare.Forexample,thereisover 100kbchloroplastDNAinricechromosome10[28].The papayagenomealsocontainsnearly1Mbchloroplast DNA[2].ThepapayaHSYaccumulatedastaggering amountofchloroplastDNAduetoitslackofrecombinationwiththecorrespondingXchromosome.The chloroplastDNAinsertioncouldbeanothermeansofsex chromosomeevolution. Severalsex-specificrepeatswereidentifiedinother plantspecies,suchastheRAYSI-IIIfamilyintheplant Rumexacetosa [17,29],MADC1in Cannabissativa [30], andthetandemY-specificDNArepeatsin Marchantia polymorpha [31].TheRAYSI-IIIfamilyissatelliteDNAs andMADC1ishomologoustoLINE-likeretrotransposonswithasite-specificaccumulationofthelongarmof theYchromosome[30].LiketheY-specificrepeatsin M.polymorpha [31],theHSY-R29andHSY-R162were identifiedassex-specificrepeatsandexhibitednosimilaritytoanyknownrepetitivesequencessuchasretroelementsorsatelliteDNAs,indicatingthattheserepeats arespecifictothesexdeterminingregionofthepapaya genome. TheY-specificrepeatsof M.polymorpha arenotonly tandemlyduplicated,butalsocontainmale-specificgenes [31].Inhumans,itwasalsoreportedthattheactivegene couldbemultipliedasaresultoftandemduplicationsand largesequenceinversions,suchastheAZFcregionofthe Ychromosome[32,33]andtheZNF91genefamilyin chromosomes19and7[34,35].Inthisstudy,weidentified apotentialX-specificrepeatX-R55,whichcontainedthe thirdexonofapapayazincfingerprotein(Figure4A). ThetandemduplicationofX-R55wasquitesimilartothe ZNF91subfamilyofprimate-specificzincfingergenes, consistingoflargegeneclusterswithsomedysfunctional copies[34].AnotherinterestingfeatureoftheZNF91gene familywasthatthelargegeneclustersarelocatednearthe centromereofchromosomes19and7[34].Inpapaya, geneduplicationwasreported[20],andsomeofthose genesmaybeclusteredassimilartotheZNF91gene family.Nevertheless,thisfindingraisesquestionsabout whethertheX-R55repeatsarelocatednearthecentromereofpapayaXchromosomeandwhethertheduplicationoftheX-R55passedthroughasimilarprocessas ZNF91afterduplication,suchaslossoffunctionand alternativesplicing.Thesequestionsremaintobefurther investigated.ConclusionsWeanalyzedrepetitivesequencesandsex-specificrepeatsaccumulatedintheHSYanditsXcounterpartof papayasexchromosomes.ThesequencesoftheHSY andthecorrespondingXwerehighlyrepetitiveas77% oftheHSYand64%oftheXcounterpartsequences werefoundtoberepetitive,ofwhichthemajorrepeat elementwas Ty3-gypsy .TheHSYanditsXcounterpart containedsex-specificrepeats,including20HSY-specificNa etal.BMCGenomics 2014, 15 :335 Page9of12 http://www.biomedcentral.com/1471-2164/15/335

PAGE 10

repeatsandoneX-specificrepeat.MostHSY-specific repeatsexhibitedaccumulationatspecificlocationsin theHSY,wheretheHSYexpansionstookplace.The HSYexpandedatanacceleratedpacecomparedtoitsX counterpartandtheHSY-specificrepeatscontributedto itsrapidexpansion.MethodsDNAsequencesThesequencesof13.4Mbconsistingof8.1MbofHSY and5.4MbofthecorrespondingXchromosome[21,36] wereusedtoexaminerepetitivegenomicfeaturesand SSRdistribution.Inaddition,a245Mbof V.monoica genomicshotgunsequencesanda1.1Mbof11 V. monoica BACsequences[19]wereusedtocompareaccumulationanddistributionofrepetitivesequencesand SSRswiththoseintheHSY,thecorrespondingX,and papayagenome.TandemrepeatsAperlprogram, MI cro SA telliteidentificationtool(MISA; http://pgrc.ipk-gatersleben.de/misa/download/misa.pl),was usedtomineSSRsinthegivensequences.SSRswitha lengthgreaterthan12nucleotides,motiflengthsof2to 6bp,andaminimumof5repeatsweredetectedand analyzed.Interspersedrepeatsanalysisagainstknownrepeat databasesTherepeatlibrarywasgeneratedbycombiningRepbase [37],TIGRplantrepeats(ftp://ftp.tigr.org/pub/data/ TIGR_Plant_Repeats),andpapayarepeats[20].ForanalyzingtherepeatcompositionintheHSYandthecorrespondingX,RepeatMasker(http://www.repeatmasker. org)wasusedtoanalyzetherepeatcompositioninthe HSYandthecorrespondingXusingtherepeatlibrary withdefaultsettings.Identificationofnewrepeatsinthesexdetermining regionToidentifynewrepeats,thesequencesoftheHSYandthe correspondingXwerefirstrunonRepeatScout[38]to generateputativerepeatsequences.Then,theresultingrepeatswererunonRepeatMasker(http://repeatmasker. org)tomasktheHSYorthecorrespondingXsequences andtoscreentherepeatswiththeoccurrenceofmore than10timesandalignedlengthlongerthan100bp. Next,thenon-redundantrepeatspassingabovecriteria weredeterminedasnewrepeatsbycomparingthemto previouslyidentifiedpapayarepeatsfromfemalepapaya genomesequence[20]usingCD-HITsoftware[39]witha cutoffof70%similarity.Finally,thenewrepeatswere blastedagainsttheHSYandthecorrespondingXsequencesusingStandaloneBLASTsoftware(NCBI)and screenedbasedonthefollowingmorestringentcriteria: 1)atleasta50%alignmentoveraconsensussequence, 2)occurrenceofatleast10times,and3)analignedregion withatleast100bpand>75%identity.Therepeatsthat metthesecriteriawerere-screenedwithpropertyofless than10hitsinthepapayagenomeinordertoobtainpotentialsex-specificrepeats.Clustalw[40]andMEGA[41] softwarewereusedforphylogeneticanalysisofthe repeats.PCRforsex-specificrepeatsSamplesfromSunUpfemale,SunUphermaphrodite,AU9 female,andAU9malewereusedtoisolategenomicDNAs asdescribedbyKEdwards,CJohnstoneandCThompson [42]withslightmodifications.PCRwascarriedoutwith 5ngofDNAasatemplatewiththefollowingprimersets: HSY-R162(Forward:5 -TTTGTTCTCCTCTCAGCTT GC-3 ;Reverse:5 -GCCATACACGTAATGGGAAAA3 ), HSY-R29(Forward:5 -GAAACCCATGCGAAGGAATA3 ;Reverse:5 -TGGGATTCTTTTTGGGTCAG),andXR55(Forward:5 -CCTTAGGAAGTTGCATTATGCTG; Reverse:5 -ATTTATGAATTGAAAAGTTCAAGCAA). OneofthepapayaBACendsequenceswasusedtoamplifyapositivecontrolforPCRofsex-specificrepeatsusing thefollowingprimers:Foward5 -TGACTCCATTGCCT GAATTTT-3 ,andReverse5 -TCCTCTCCATACCTTCT CGTG-3 .RT-PCRanalysisTotalRNAswereextractedfromsamples(SunUpfemale, hermaphroditeplant,seedsandhalfripenfruit,andAU9 femaleandmaleplantleaf)usingthehotphenolextractionmethod(Sambrooketal.,1989).ThecDNAwas synthesizedusingSuperScriptII ™ reversetranscriptase accordingtothemanufacturer ’ sinstructions(Invitrogen). Theexpressionofthepapayazincfingerproteinwas examinedbyRT-PCRusingthefollowingprimers:(F:5 CACTGGTTTTGCGGAAATTG;R:5 -TGCACTTAGC ATCATTGCAATG).AsaninternalcontrolforRT-PCR analysis,papaya Actin genewasused[43].ManteltestToexaminerelationshipsbetweenphysicaldistancesand sequenceidentitiesamongsex-specificrepeats,allpairwisesequenceidentitieswereobtainedfromtheclastalW2 onlinetool(http://www.ebi.ac.uk/Tools/msa/clustalw2) andallpairwisephysicaldistanceswerecalculatedmanually.Thesequenceidentitiesandthephysicaldistances wereusedforManteltestimplementedinGeneticAnalysisinExcel(GenAlEx6.5)program[44].Briefly,the sequenceidentitiesweremanuallyarrangedtoYmatrix andthephysicaldistancestoXmatrixasdescribedin GenAlExTutorial3.Then,Manteltestwasperformed withdefaultsetexceptforpermutationsof9,999.Na etal.BMCGenomics 2014, 15 :335 Page10of12 http://www.biomedcentral.com/1471-2164/15/335

PAGE 11

AdditionalfilesAdditionalfile1: NoteGenBankaccessionnumbersofnewrepeats identifiedfromthesexdeterminingregionofpapayasex chromosomes. Additionalfile2:TableS1. Blastresultofnewlyidentifiedrepeats againstthesexdeterminingregionandpapayagenome. Additionalfile3:TableS2. Blastresultofsex-specificrepeatsagainst theHSYandthecorrespondingX. Additionalfile4:FigureS1. Pairwisesequenceidentitiesamong differentcopiesofeachsex-specificrepeat,(A)HSY-R29,(B)HSY-R162,or (C)X-R55wereplottedaccordingtotheirphysicaldistance. Competinginterests Theauthorsdeclarethattheyhavenocompetinginterests. Authors ’ contributions JKNcarriedoutexperiments.JKNandJWanalyzedthedataandwrotethe manuscript.RMconceivedthestudy,coordinated,andorganizedallresearch activities.Allauthorsreadandapprovedthefinalmanuscript. Acknowledgements ThisworkwassupportedbyagrantfromtheNationalScienceFoundation (NSF)PlantGenomeResearchProgramtoRM(AwardNos.DBI0922545). Authordetails1DepartmentofPlantBiology,UniversityofIllinoisatUrbana-Champaign, Urbana,IL61801,USA.2MolecularBreedingDivision,NationalAcademyof AgriculturalScience,RDA,Suwon441-701,RepublicofKorea.3Department ofAgronomy,GeneticsInstitute,PlantMolecularandCellularBiology program,UniversityofFlorida,Gainesville,FL32610,USA.4FAFUand UIUC-SIBJointCenterforGenomicsandBiotechnology,FujianAgriculture andForestryUniversity,Fuzhou,Fujian350002,China. Received:2October2013Accepted:22April2014 Published:4May2014 References1.ArumuganathanK,EarleED: NuclearDNAcontentofsomeimportant plantspecies. PlantMolBiolRep 1991, 9: 208 – 218. 2.MingR,HouS,FengY,YuQ,Dionne-LaporteA,SawJH,SeninP,WangW, LyBV,LewisKL,SalzbergSL,FengL,JonesMR,SkeltonRL,MurrayJE,Chen C,QianW,ShenJ,DuP,EusticeM,TongE,TangH,LyonsE,PaullRE, MichaelTP,WallK,RiceDW,AlbertH,WangML,ZhuYJ, etal : Thedraft genomeofthetransgenictropicalfruittreepapaya(Caricapapaya Linnaeus). Nature 2008, 452 (7190):991 – 996. 3.LiuZ,MoorePH,MaH,AckermanCM,RagibaM,YuQ,PearlHM,KimMS, CharltonJW,StilesJI,ZeeFT,PatersonAH,MingR: AprimitiveY chromosomeinpapayamarksincipientsexchromosomeevolution. Nature 2004, 427 (6972):348 – 352. 4.MingR,YuQ,MoorePH: Sexdeterminationinpapaya. SeminCellDevBiol 2007, 18 (3):401 – 408. 5.ZhangWL,WangXU,YuQY,MingR,JiangJ: DNAmethylationand heterochromatinizationinthemale-specificregionoftheprimitiveY chromosomeofpapaya. GenomeRes 2008, 18 (12):1938 – 1943. 6.ChenCX,YuQ,HouS,LiY,EusticeM,SkeltonRL,VeatchO,HerdesRE, DieboldL,SawJ,FengY,QianW,BynumL,WangL,MoorePH,PaullRE, AlamM,MingR: Constructionofasequence-taggedhigh-densitygenetic mapofpapayaforcomparativestructuralandevolutionarygenomicsin brassicales. Genetics 2007, 177 (4):2481 – 2491. 7.MaH,MoorePH,LiuZ,KimMS,YuQ,FitchMM,SekiokaT,PatersonAH, MingR: High-densitylinkagemappingrevealedsuppressionof recombinationatthesexdeterminationlocusinpapaya. Genetics 2004, 166 (1):419 – 436. 8.CharlesworthB,CharlesworthD: ThedegenerationofYchromosomes. PhilosTRoySocB 2000, 355 (1403):1563 – 1572. 9.SkaletskyH,Kuroda-KawaguchiT,MinxPJ,CordumHS,HillierL,BrownLG, ReppingS,PyntikovaT,AliJ,BieriT,ChinwallaA,DelehauntyA,Delehaunty K,DuH,FewellG,FultonL,FultonR,GravesT,HouSF,LatrielleP, LeonardS,MardisE,MaupinR,McPhersonJ,MinerT,NashW,NguyenC, OzerskyP,PepinK,RockS, etal : Themale-specificregionofthehuman Ychromosomeisamosaicofdiscretesequenceclasses. Nature 2003, 423 (6942):825 – 837. 10.GravesJAM,KoinaE,SankoviCN: Howthegenecontentofhumansex chromosomesevolved. CurrOpinGenetDev 2006, 16 (3):219 –224. 11.YuQY,HouS,HobzaR,FeltusFA,WangX,JinW,SkeltonRL,BlasA,Lemke C,SawJH,MoorePH,AlamM,JiangJ,PatersonAH,VyskotB,MingR: Chromosomallocationandgenepaucityofthemalespecificregionon papayaYchromosome. MolGenGenomics 2007, 278 (2):177 – 185. 12.MingR,BendahmaneA,RennerSS: Sexchromosomesinlandplants. AnnuRevPlantBiol 2011, 62: 485 – 514. 13.YounisRAA,IsmailOM,SolimanSS: Identificationofsex-specificDNA markersfordatepalm(PhoenixdactyliferaL.)usingRAPDandISSR techniques. JAgricBiolSci 2008, 4 (4):278 – 284. 14.DanilovaTV,KarlovGI: Applicationofintersimplesequencerepeat(ISSR) polymorphismfordetectionofsex-specificmolecularmarkersinhop (HumuluslupulusL.). Euphytica 2006, 151 (1):15 – 21. 15.MilewiczM,SawickiJ: Sex-linkedmarkersindioeciousplants. PlantOmics J 2013, 6 (2):144 – 149. 16.Navajas-PerezR,laHerranR,JamilenaM,LozanoR,RejonCR,RejonMR, Garrido-RamosMA: ReducedratesofsequenceevolutionofY-linked satelliteDNAinRumex(Polygonaceae). JMolEvol 2005, 60 (3):391 – 399. 17.Navajas-PerezR,SchwarzacherT,delaHerranR,RuizRejonC,RuizRejonM, Garrido-RamosMA: Theoriginandevolutionofthevariabilityina Y-specificsatellite-DNAofRumexacetosaanditsrelatives. Gene 2006, 368: 61 – 71. 18.CharlesworthD: Plantsexchromosomeevolution. JExpBot 2013, 64 (2):405 – 420. 19.GschwendAR,YuQ,TongEJ,ZengF,HanJ,VanBurenR,AryalR, CharlesworthD,MoorePH,PatersonAH,MingR: Rapiddivergenceand expansionoftheXchromosomeinpapaya. ProcNatlAcadSciUSA 2012, 109 (34):13716 – 13721. 20.NagarajanN,Navajas-PerezR,PopM,AlamM,MingR,PatersonAH, SalzbergSL: Genome-wideanalysisofrepetitiveelementsinpapaya. TropPlantBiol 2008, 1: 191 – 201. 21.WangJ,NaJK,YuQ,GschwendAR,HanJ,ZengF,AryalR,VanBurenR, MurrayJE,ZhangW,Navajas-PrezR,FeltusFA,LemkeC,TongEJ,ChenC, WaiCM,SinghR,WangML,MinXJ,AlamM,CharlesworthD,MoorePH, JiangJ,PatersonAH,MingR: SequencingpapayaXandYhchromosomes revealsmolecularbasisofincipientsexchromosomeevolution. ProcNatlAcadSciUSA 2012, 109 (34):13710 – 13715. 22.HobzaR,LengerovaM,SvobodaJ,KubekovaH,KejnovskyE,VyskotB: An accumulationoftandemDNArepeatsontheYchromosomeinSilene latifoliaduringearlystagesofsexchromosomeevolution. Chromosoma 2006, 115 (5):376 – 382. 23.TemnykhS,DeClerckG,LukashovaA,LipovichL,CartinhourS,McCouchS: Computationalandexperimentalanalysisofmicrosatellitesinrice(Oryza sativaL.):frequency,lengthvariation,transposonassociations,and geneticmarkerpotential. GenomeRes 2001, 11 (8):1441 – 1452. 24.ErlandssonR,WilsonJF,PaaboS: Sexchromosomaltransposableelement accumulationandmale-drivensubstitutionalevolutioninhumans. MolBiolEvol 2000, 17 (5):804 – 812. 25.PimpinelliS,BerlocoM,FantiL,DimitriP,BonaccorsiS,MarchettiE,CaizziR, CaggeseC,GattiM: Transposableelementsarestablestructural componentsofDrosophilamelanogasterheterochromatin. ProcNatl AcadSciUSA 1995, 92 (9):3804 – 3808. 26.SteinemannM,SteinemannS: DegeneratingY-Chromosomeof Drosophila-Miranda-atrapforretrotransposons. ProcNatlAcadSciUSA 1992, 89 (16):7591 – 7595. 27.KejnovskyE,HobzaR,CermakT,KubatZ,VyskotB: Theroleofrepetitive DNAinstructureandevolutionofsexchromosomesinplants. Heredity 2009, 102 (6):533 – 541. 28.RiceChromosome10SequencingC: In-depthviewofstructure,activity, andevolutionofricechromosome10. Science 2003, 300 (5625):1566 – 1569. 29.MariottiB,ManzanoS,KejnovskyE,VyskotB,JamilenaM: Accumulationof Y-specificsatelliteDNAsduringtheevolutionofRumexacetosasex chromosomes. MolGenetGenomics 2009, 281 (3):249 – 259. 30.SakamotoK,OhmidoN,FukuiK,KamadaH,SatohS: Site-specific accumulationofaLINE-likeretrotransposoninasexchromosomeofthe dioeciousplantCannabissativa. PlantMolBiol 2000, 44 (6):723 – 732.Na etal.BMCGenomics 2014, 15 :335 Page11of12 http://www.biomedcentral.com/1471-2164/15/335

PAGE 12

31.OkadaS,SoneT,FujisawaM,NakayamaS,TakenakaM,IshizakiK,KonoK, Shimizu-UedaY,HanajiriT,YamatoKT,FukuzawaH,BrennickeA,OhyamaK: TheYchromosomeintheliverwortMarchantiapolymorphahas accumulateduniquerepeatsequencesharboringamale-specificgene. ProcNatlAcadSciUSA 2001, 98 (16):9454 – 9459. 32.JamilenaM,MariottiB,ManzanoS: Plantsexchromosomes:molecular structureandfunction. CytogenetGenomeRes 2008, 120 (3 – 4):255 – 264. 33.Kuroda-KawaguchiT,SkaletskyH,BrownLG,MinxPJ,CordumHS, WaterstonRH,WilsonRK,SilberS,OatesR,RozenS,PageDC: TheAZFc regionoftheYchromosomefeaturesmassivepalindromesanduniform recurrentdeletionsininfertilemen. NatGenet 2001, 29 (3):279 – 286. 34.HamiltonAT,HuntleyS,Tran-GyamfiM,BaggottDM,GordonL,StubbsL: EvolutionaryexpansionanddivergenceintheZNF91subfamilyof primate-specificzincfingergenes. GenomeRes 2006, 16 (5):584 – 594. 35.TadepallyHD,BurgerG,AubryM: EvolutionofC2H2-zincfingergenesand subfamiliesinmammals:species-specificduplicationandlossofclusters, genesandeffectordomains. BMCEvolBiol 2008, 8: 176. 36.NaJK,WangJ,MurrayJE,GschwendAR,ZhangW,YuQ,Navajas-PrezR, FeltusFA,ChenC,KubatZ,MoorePH,JiangJ,PatersonAH,MingR: Constructionofphysicalmapsforthesex-specificregionsofpapayasex chromosomes. BMCGenomics 2012, 13: 176. 37.JurkaJ,KapitonovVV,PavlicekA,KlonowskiP,KohanyO,WalichiewiczJ: Repbaseupdate,adatabaseofeukaryoticrepetitiveelements. Cytogenet GenomeRes 2005, 110 (1 – 4):462 – 467. 38.PriceAL,JonesNC,PevznerPA: Denovoidentificationofrepeatfamilies inlargegenomes. Bioinformatics 2005, 21 (Suppl1):i351 – i358. 39.LiW,GodzikA: Cd-hit:afastprogramforclusteringandcomparinglarge setsofproteinornucleotidesequences. Bioinformatics 2006, 22 (13):1658 – 1659. 40.LarkinMA,BlackshieldsG,BrownNP,ChennaR,McGettiganPA,McWilliam H,ValentinF,WallaceIM,WilmA,LopezR,ThompsonJD,GibsonTJ, HigginsDG: ClustalWandclustalXversion2.0. Bioinformatics 2007, 23 (21):2947 – 2948. 41.TamuraK,DudleyJ,NeiM,KumarS: MEGA4:molecularevolutionary geneticsanalysis(MEGA)softwareversion4.0. MolBiolEvol 2007, 24 (8):1596 – 1599. 42.EdwardsK,JohnstoneC,ThompsonC: AsimpleandrapidmethodforthepreparationofplantgenomicDNAforPcranalysis. NucleicAcidsRes 1991, 19 (6):1349 – 1349. 43.BlasAL,MingR,LiuZ,VeatchOJ,PaullRE,MoorePH,YuQ: Cloningofthe papayachromoplast-specificlycopenebeta-cyclase,CpCYC-b,controlling fruitfleshcolorrevealsconservedmicrosyntenyandarecombination hotspot. PlantPhysiol 2010, 152 (4):2013 – 2022. 44.PeakallR,SmousePE: GenAlEx6.5:geneticanalysisinExcel:population geneticsoftwareforteachingandresearch – anupdate. Bioinformatics 2012, 28 (19):2537 – 2539.doi:10.1186/1471-2164-15-335 Citethisarticleas: Na etal. : Accumulationofinterspersedandsexspecificrepeatsinthenon-recombiningregionofpapayasex chromosomes. BMCGenomics 2014 15 :335. Submit your next manuscript to BioMed Central and take full advantage of: € Convenient online submission € Thorough peer review € No space constraints or color “gure charges € Immediate publication on acceptance € Inclusion in PubMed, CAS, Scopus and Google Scholar € Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Na etal.BMCGenomics 2014, 15 :335 Page12of12 http://www.biomedcentral.com/1471-2164/15/335