Knockout of an outer membrane protein operon of Anaplasma marginale by transposon mutagenesis

MISSING IMAGE

Material Information

Title:
Knockout of an outer membrane protein operon of Anaplasma marginale by transposon mutagenesis
Physical Description:
Mixed Material
Language:
English
Creator:
Crosby, Francy L.
Wamsley, Heather L.
Pate, Melanie G.
Lundgren, Anna M.
Noh, Susan M.
Munderloh, Ulrike G.
Barbet, Anthony F.
Publisher:
BioMed Central (BMC Genomics)
Publication Date:

Notes

Abstract:
Background: The large amounts of data generated by genomics, transcriptomics and proteomics have increased our understanding of the biology of Anaplasma marginale. However, these data have also led to new assumptions that require testing, ideally through classical genetic mutation. One example is the definition of genes associated with virulence. Here we describe the molecular characterization of a red fluorescent and spectinomycin and streptomycin resistant A. marginale mutant generated by Himar1 transposon mutagenesis. Results: High throughput genome sequencing to determine the Himar1-A. marginale genome junctions established that the transposon sequences were integrated within the coding region of the omp10 gene. This gene is arranged within an operon with AM1225 at the 5’ end and with omp9, omp8, omp7 and omp6 arranged in tandem at the 3’ end. RNA analysis to determine the effects of the transposon insertion on the expression of omp10 and downstream genes revealed that the Himar1 insertion not only reduced the expression of omp10 but also that of downstream genes. Transcript expression from omp9, and omp8 dropped by more than 90% in comparison with their counterparts in wild-type A. marginale. Immunoblot analysis showed a reduction in the production of Omp9 protein in these mutants compared to wild-type A. marginale. Conclusions: These results demonstrate that transposon mutagenesis in A. marginale is possible and that this technology can be used for the creation of insertional gene knockouts that can be evaluated in natural host-vector systems.
General Note:
Crosby et al. BMC Genomics 2014, 15:278 http://www.biomedcentral.com/1471-2164/15/278; Pages 1-15
General Note:
doi:10.1186/1471-2164-15-278 Cite this article as: Crosby et al.: Knockout of an outer membrane protein operon of Anaplasma marginale by transposon mutagenesis. BMC Genomics 2014 15:278.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
© 2014 Crosby et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
System ID:
AA00024414:00001

Full Text

PAGE 1

1 Figure 1 Specificity of primers and probes in RT qPCR reactions. To evaluate the target specificity of primers and probes 5 l of qPCR product from each target was analyzed in a 2% Seakem LE (Lonza) agarose gel stained with SYBR gold nucleic acid gel stain (Life Technologies), ( omp8 259bp), ( omp9 145bp), ( omp10 5 omp10 3 end, 140bp), ( msp5 139bp), ( rpoH 116bp) and ( 16S 131bp).

PAGE 2

2 Table 1 PCR conditions for the amplification of transcripts from omp7 through AM1225 intergenic regions. Step Temperature Time Denaturation 94C 2 minutes Denaturation 94C 10 seconds 35 cycles Annealing 65 C 30 seconds Extension 68C 15 seconds Extension 68C 5 minutes PCR reactions were performed in Bio Rad PTC 200 thermocycler E ach reaction contained units of primeSTAR GXL DNA polymerase (Takara). PCR products were electrophoretically separated using a 1 and 2% Seakem LE (Lonza) Agarose gel, and stained with SYBR gold nucleic acid gel stain (Life technologies) for UV visualization.

PAGE 3

3 Table 2 PCR conditions for the amplification of transcripts from omp6 through omp10 from cDNA obtained from ISE6 cells infected with A. marginale wild type and omp10::himar1 mutant organisms. Step Temperature Time Denaturation 94C 2 minutes Denaturation 94C 10 seconds 35 cycles Annealing *60C/**65C 58 seconds Extension 68C 2 minutes Extension 68C 10 minutes PCR reactions were performed in Bio Rad PTC 200 thermocycler Annealing temperatures used for the amplification of omp6 omp7 omp8 and 16S ribosomal subunit. ** Annealing temperature used for the amplification of omp9 and omp10 E reverse primers and 1.25 units of primeSTAR GXL DNA polymerase (Takara). PCR products were electrophoretically separated using a 1 and 2% Seakem LE (Lonz a) Agarose gel, and stained with SYBR gold nucleic acid gel stain (Life technologies) for UV visualization.

PAGE 4

4 Table 3 qPCR reactions and amplification conditions. Step Temperature Time Denaturation 95C 15 minutes Denaturation 94C 15 seconds 40 cycles Annealing/Extension 60C 1 minute Data collection Each reaction had a net volume of 25 l containing 5 l of cDNA, 1 X Quantitect Probe PCR master mix (QIAGEN), 0.4 M of forward and reverse primers, and 0.2 M of probe.

PAGE 5

5 Table 4 qPCR amplification efficienc ies *GOI qPCR efficiency E=(5 1/slope ) 1 omp8 0.98 omp9 0.96 omp10 5' end 0.93 omp10 3' end 0.97 msp5 0.95 rpoH 0.90 16S 0.90 Primer probe reaction efficiencies were determined for each primer probe set targeting omp8 omp9 omp10 omp10 5 msp5 rpoH and 16S rRNA by performing triplicate reactions of a ten log range of 5 fold serial dilutions of cDNA for the purpose of generating standard curves from which reaction efficiencies could be calculated [ 1 2 ] GOI, gene of interest.

PAGE 6

6 Table 5 Relative amplification efficiencies. Reference genes Relative efficiencies slopes omp8 0 .0327 msp5 omp9 0 .0182 omp10 5' end 0 .0267 omp10 3' end 0 .0826 omp8 0 .0273 rpoH omp9 0 .0127 omp10 5' end 0 .0676 omp10 3' end 0 .1211 omp8 0 .0226 16S omp9 0 .0848 omp10 5' end 0 .0061 omp10 3' end 0 .0223 R elative amplification efficiencies of the target genes ( o mp8, 9, 10 end and 10 reference genes ( msp5, rpoH and 16S ) were calculated by performing standard curves for each amplicon in the same manner and conditions to those used to determine the amplification efficiencies. The Ct values generated w Ct reference gene) for each sample which corrected for any template loading discrepancy between standard curve s [ 1 2 ]

PAGE 7

7 REFERENCE S. 1. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL et al : The MIQE guidelines: minimum information for publication of quantitative real time PCR experiments Clin C hemy 2009, 55 : 611 622. 2. Tuzmen S, Kiefer J, Mousses S: Validation of short interfering RNA knockdowns by quantitative real time PCR Methods Mol B iol 2007, 353 :177 203.



PAGE 1

RESEARCHARTICLEOpenAccessKnockoutofanoutermembraneproteinoperon of Anaplasmamarginale bytransposon mutagenesisFrancyLCrosby1*,HeatherLWamsley2,MelanieGPate2,AnnaMLundgren1,SusanMNoh3, UlrikeGMunderloh4andAnthonyFBarbet1AbstractBackground: Thelargeamountsofdatageneratedbygenomics,transcriptomicsandproteomicshaveincreased ourunderstandingofthebiologyof Anaplasmamarginale .However,thesedatahavealsoledtonewassumptions thatrequiretesting,ideallythroughclassicalgeneticmutation.Oneexampleisthedefinitionofgenesassociated withvirulence.Herewedescribethemolecularcharacterizationofaredfluorescentandspectinomycinand streptomycinresistant A.marginale mutantgeneratedby Himar1 transposonmutagenesis. Results: Highthroughputgenomesequencingtodeterminethe Himar1 A.marginale genomejunctionsestablished thatthetransposonsequenceswereintegratedwithinthecodingregionofthe omp10 gene.Thisgeneisarranged withinanoperonwith AM1225 atthe5 ’ endandwith omp9 omp8 omp7 and omp6 arrangedintandematthe3 ’ end. RNAanalysistodeterminetheeffectsofthetransposoninsertionontheexpressionof omp10 anddownstreamgenes revealedthatthe Himar1 insertionnotonlyreducedtheexpressionof omp10 butalsothatofdownstreamgenes. Transcriptexpressionfrom omp9 ,and omp8 droppedbymorethan90%incomparisonwiththeircounterpartsin wild-type A.marginale .ImmunoblotanalysisshowedareductionintheproductionofOmp9proteininthese mutantscomparedtowild-type A.marginale Conclusions: Theseresultsdemonstratetha ttransposonmutagenesisin A.marginale ispossibleandthat thistechnologycanbeusedforthecreationofinsertionalgeneknockoutsthatcanbeevaluatedinnatural host-vectorsystems.BackgroundAnaplasmamarginale isatick-borneandobligateintracellularbacteriumthatcausesbovineanaplasmosis,a diseasethathasgainedparticularattentionduetothe considerableeconomiclossesforthecattleindustry [1-4].Onsetofclinicaldiseaseismainlycharacterizedby aseverehemolyticanemia[1,2].Cattlethatsurviveacute infectionbecomecarriersof A.marginale andorganisms canbetransmittedtosusceptiblecattlemechanicallyor bytickbite[2]. A.marginale persistsincarriercattle becauseofitscapabilitytosubverttheimmunesystem usingantigenicvariationinwhichdifferentvariantsof outermembraneproteinssuchasMsp2andMsp3are expressed[5-8]. Workonthedevelopmentofapreventivevaccine againstthisdiseasebeganintheearly1900 ’ swiththe isolationof A.marginale subsp. centrale [9,10].Thisless virulentstrain,originallyfromSouthAfrica,isusedfor immunizationofcattleinAfrica,Australia,SouthAmerica andtheMiddleEastandremainsthemostwidely-used andpracticalvaccineagainstbovineanaplasmosis[9-11]. ThisvaccineisnotapprovedintheUnitedStatesbecause oftheriskoftransmittingcontaminantblood-borne pathogensthatwillinfectcattle[1].Recently,comparativegenomicstudiesdemonstratedthatproteinsthat areconservedinUSstrainswerenotconservedin A. marginale subsp. centrale [10-12]. Differentvaccinationmethodshavebeendeveloped forthecontrolofbovineanaplasmosisthatrangefrom *Correspondence: crosbyl@ufl.edu1CollegeofVeterinaryMedicine,UniversityofFlorida,Departmentof InfectiousDiseasesandPathology,2015SW16thavenue,Gainesville, FL32610,USA Fulllistofauthorinformationisavailableattheendofthearticle 2014Crosbyetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycredited.TheCreativeCommonsPublicDomain Dedicationwaiver(http://creativecommons.org/publicdomain/zero/1.0/)appliestothedatamadeavailableinthisarticle, unlessotherwisestated.Crosby etal.BMCGenomics 2014, 15 :278 http://www.biomedcentral.com/1471-2164/15/278

PAGE 2

attenuatedliveorkilledorganisms,toDNAandrecombinantproteinvaccines[9].But A.marginale derived fromcellculture,killedorganismsandDNAvaccinesinduceonlypartialprotection[13-15].Immunizationtrials usingoutermembraneproteinsoracomplexoflinked orunlinkedoutermembraneproteinsof A.marginale derivedfromerythrocyteshavedemonstratedgoodprotectionagainsthighbacteremia,anemiaandhomologous strainchallenge[16-20].However,topromotelonglastingprotection,severalimmunizationboostsmayberequiredandinadditiontothis,productionandpurification ofthesecomponentsistime-consumingandexpensive. Theincreaseduseofmolecularapproachessuchas wholegenome,RNAsequencing,proteomicsandcomparativegenomicsof A.marginale hasidentifiedpotentialvirulence-associatedtargetsthatcanbealteredor removedbyreversegeneticstechniques[12,21-25].This couldallowthecreationofattenuatedorganismsthat havereducedpathogenicitybutstillelicitcellularand antibodyresponsesthatstimulateimmunitywithoutcausingdisease.Consequentlythedevelopmentofgenetic toolstotransform A.marginale andgenerate in-vitro gene knockouts,orinsertionalmutantsthatcanbetested forattenuationintheir in-vivo environmentisofgreat significance. Onewaytocreateinsertionalmutationsinpathogenic bacteriaisviatransposonmutagenesis,inwhichalibrary ofrecombinantbacteriacontainingdifferenttransposon insertionscanbecreated,allowingforthescreening ofmutantstrainswithdiversephenotypes[26,27].The Himar1 transposonisanon-replicativeclassIIDNA transposonthatisamemberoftheTc1/marinerfamily andisoftenusedforthecreationofinsertionalmutants. Sincethesetypesoftransposonsarehorizontallytransferredbetweenspecies,theydonothavehostrestricted functions,makingthemsuitableforuseinawide-range ofeukaryoticandprokaryotichosts[27,28].Inaddition tothis,the Himar1 transposondoesnothaveDNAtargetspecificitysinceitisintegratedrandomlyinTAdinucleotidesites[28-30].Becauseoftheseadvantages, transposonmutagenesisusingthissystemhasbeensuccessfullydevelopedinothertick-bornepathogenssuch as Rickettsiarickettsii Coxiellaburnetii Borreliaburgdorferi Francisellatularensis Ehrlichiachaffeensis and Anaplasmaphagocytophilum [31-40].Thesepreviousresultssuggestthatthissystemcouldbeusefulforthe transformationof A.marginale Nevertheless,previousattemptstotransform A.marginale bytransposonmutagenesiswerenotsuccessful. Previously,the Himar1 transposonandtransposasewere deliveredintwoseparatevectorsinto A.marginale which resultedintheisolationofgreenfluorescentandantibiotic resistantbacteria.Howevermolecularcharacterizationof theserecombinantorganismsestablishedthattheentire plasmidcarryingthetransposonsequenceswasintegratedintothe A.marginale chromosomebyasingle crossoverhomologousrecombinationmechanisminstead oftheclassicalcutandpastemechanismoftransposition [41].Therefore,wewantedtoevaluatefirst,ifclassical transposonmutagenesisusingthe Himar1 transposonsystemisachievablein A.marginale ,andsecond,iftransposonmutagenesisusingthissystem,isusefulforthe creationofinsertionalknockoutmutations.ResultsTransformationof Anaplasmamarginale bytransposon mutagenesisAttemptstotransform A.marginale bytransposonmutagenesisusingthe Himar1 transposon/transposasesystem deliveredintwoseparateplasmidswerenotsuccessful. Theprobabilitythattwoplasmidsareintroducedatonce into A.marginale organismscouldbeverylow,especially whenviabilityintheextracellularenvironmentmightbe highlycompromised,resultinginalowfractionofcells competenttotakeupDNA. Thereforeinordertopromotetransposonmutagenesis inthesebacteria,thetransposasewasprovidedin cis withthe Himar1 transposonsequences(R.F.Felsheim unpublisheddata).The pHimarcisA7mCherry-SS containsthehyperreactiveallele A7 transposaseandthe Himar1 TIRflankingthe mCherry reportergeneandthe aadA gene,whichconfersresistanceagainstspectinomycinandstreptomycin.Ex pressionofthetransposaseandthereporterandantibioticselectiongenes isdrivenbythe A.marginaletr promoter[41,42] (Figure1A).Antibioticsel ectionpressureofelectroporatedbacteriawiththisconstructresultedinthe isolationofredfluorescen tandantibioticresistant bacteria(Figure1B).Mappingoftransposoninsertionwithinthe A.marginale chromosomeWeusedRoche/454andIlluminahigh-throughput genomesequencingtodetermine:1)thelocationof plasmidsequenceswithinthe A.marginale chromosome,2)therecombinationmechanismthatallowed thesegregationofmutantbacteriaand3)iftheserecombinantorganismscorrespondtoapopulationcontaininginsertionsindifferentgenomiclocationsorin asinglegenomesite. Mutationsproducedbytheintegrationofthe Himar1 transposonintothe A.marginale chromosomewill generatenewjunctionsequencesthatareabsentin thewild-type.Thesenewsequencesshouldinclude the Himar1 terminalinvertedrepeats(TIR)followed bythesequenceoftheregionsinwhichthetransposonisintegrated.Basedonthis,thestrategythat weusedtomapthe Himar1 insertionsiteinvolvedCrosby etal.BMCGenomics 2014, 15 :278 Page2of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 3

alignmentofthesequencingreadsobtainedby Roche/454andIlluminamethodstotworeferencesequences,the A.marginale str.StMariesgenomesequence(CP000030)andthe Himar1 TIRsequence. The Himar1 TIRA.marginale genomejunctionswere identifiedbyextractingr eadsthatalignedtothe A. marginale genomeatoneendandtothe Himar1 TIR attheotherend. AnalysisusingIlluminareadsmappedthe Himar1 TIRA.marginale genomejunctionsintoaregionof omp6 and omp10 genes.Interestinglythesereadscontainedthesamemutatedsequence.The omp6 and omp10 genessharealargestretchofidentity456nt/ 459nt(99%)[43].Theshort,100ntlengthofthe Illuminareads,madeitdifficulttodifferentiatewhich genecontainedthe Himar1 transposon.Additional analysisusinglongerreadsobtainedontheRoche/ 454platformrevealedthatthe Himar1 transposon wasintegratedwithinthe omp10 gene.Thesereads containedaregionof omp10 thatisnotsharedwith omp6 .Basedonthissequencinganalysisthegenomic locationofthe Himar1 transposoninthechromosomeofthetransformed A.marginale ,isatposition 245considering1asthefirstbaseofthe omp10 start codon(Figure2A). TheseresultswereverifiedbyPCRamplificationof gDNAfromISE6cellsinfectedwithwild-typeand transformed A.marginale using omp6 and omp10 specificprimers(Figure2A-B).Thesizeof omp6 amplicons(492bp)inwild -typeandtransformed A. marginale wasthesame.Howeverthesizeofthe omp10 ampliconintransformed A.marginale wasincreasedby1836bpwhencomparedtothewild-type (969bp),indicatingthatthetransposonwasintegrated withinthe omp10 gene. Thegenomesequenceof A.marginale str.Virginia isavailableonlyasunann otatedcontigswithgaps. Thereforeforouranalysisweusedthe A.marginale str.StMariesgenomeasreference.Forthisreason wewantedtoconfirmthatthetransposonlocationin themutatedVirginiastrainwasthesameastheone mappedinthereferencegenome.Forthis,combined Roche/454andIlluminareadswereassembledanda contigof21,324nucleotidesidentified.Alignmentof thiscontigwiththe A.marginale str.StMariesgenomeshowedthatthissequencecontainedpartof omp10 andupstreamgenes(99%identity)(Figure3) andthatthetransposon insertionsiteintheA.marginale str.Virginiamatchesthesameregionmapped usingthereferencegenome. Furtheranalysisofsequencingreadsdeterminedthat thereisonlyonetransposoninsertioninthechromosomeofrecombinant A.marginale .Thereadscontainingthe Himar1 TIRA.marginale junctionsalignedtoa singlegenomesite.Althoughthesetransformedorganismswerenotcloned,datasuggestthattheyare isogenicforthetransposoninsertionsitewithinthe omp10 gene. Figure1 Redfluorescent A.marginale .A .Plasmidmapof pHimarcisA7mCherry-SS usedfortheelectroporationof A.marginale str. Virginia. B .Fluorescent(left)andphasecontrast/fluor escencemerged(right)images,oftransformed A.marginale replicatinginISE6 tickcells. Crosby etal.BMCGenomics 2014, 15 :278 Page3of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 4

Themobilizationofthe Himar1 transposonfromone locustoanotherismediatedbyatransposaseusinga cutandpastemechanism[27,30].Ithasbeenshown previouslyinotherorganismsthatthe Himar1 transposonintegratespreferentiallyintoaTAsiteandleads toduplicationofthisdinucleotideuponintegrationinto thetargetsite[30].Thiswasfoundtobetruealsofor A. marginale .Sequencinganalysisrevealedthatthe Himar1 transposontargeted aTAdinucleotidein omp10 (Figure4A) anduponintegrationitisflankedbyaTAdinucleotide sequence(Figure4B).Thu s,themobilizationofthe Himar1 transposonintothe omp10 geneof A.marginale wasmediatedbymeansofthe A7 transposaseina cutandpastemechanism.Thistransformantof A.marginale willbereferredtoas omp10::himar1 mutant.Evidenceforexpressionof omp10 aspartofanoperonWehypothesizethatthetransposoninsertioncouldalter theexpressionof omp10 anddownstreamgenes.This hypothesisisbasedonrecentworkinwhichthetranscriptomeprofileof A.marginale usingRNAseqindicatedthat omp10 isexpressedaspartofasix-gene operoninerythrocytesofinfectedcattle[25].Thisoperonincludes AM1225 omp10 omp9 omp8 omp7 and omp6 (Figure5A). Becauseofthis,wewantedtodetermineif omp10 isexpressedwithinapolycistronicmessagein A.marginale replicatinginISE6tickcells.Theintergenicregionbetween AM1225 and omp10 is440bp long,whileintergenicregionsbetween omp10-9, omp9-8,omp8-7 and omp7-6 are62bp,63bp,64bp and36bprespectively(Figure5A).Totestwhether AM1225 through omp7 areexpressedasasingle transcriptionalunit,to talRNAisolatedfromISE6 cellsinfectedwithwild-type A.marginale wasreversetranscribedandtemplatecDNAwasusedfor amplificationofintergenicregionswithprimersthat connectneighboringgenes(Figure5A).The omp6 Figure2 Mappingof Himar1 transposoninsertionsite.A .Locationofprimerpairs(AB1553-AB1554)and(AB1561-AB1562)designedtotarget the omp6 and omp10 genesrespectively,inwild-type(WT)andtransformed A.marginale .Basedonsequencingresultsthe Himar1 sequencesare integratedinthechromosomeoftransformed A.marginale atnucleotide245afterthefirstbaseofthe omp10 startcodon(arrows)and mCherry and aadA (Str/Spcresistant)genesareintheoppositeorientationto omp10 B .AgaroseGelelectrophoresis.gDNAisolatedfromISE6tickcells infectedwithwild-type(WT)andtransformed A.marginale ,wasusedastemplateforPCRamplificationwithprimersshowninA.(Lane1)100bp/1Kb DNAladder, omp6 ampliconsintransformed(lane2)andWT(lane3) A.marginale wereofthesamesize492bp.The omp10 ampliconintransformed A.marginale (lane4)was2805bp,whileinwildtypewas969bp(lane5). Crosby etal.BMCGenomics 2014, 15 :278 Page4of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 5

genewasnotincludedintheseexperiments,because previouswork[43]andworkinourlabshowedthat transcriptsfromthisgenearenotdetectedin A.marginale duringinfectionoftickcells.Appropriatesizeampliconsoftheintergenicregionsbetween omp7-8,omp8-9,omp9-10 and omp10 AM1225 gene weredetected(Figure5B) ,providingevidencethat thesegenesaretranscribedasasinglemRNAin A.marginale infectedtickcells.RNAtranscriptanalysisNext,wedeterminedifinsertionofthe Himar1 sequencesresultedinalterationof omp10 expressionand theexpressionofgenesdo wnstream.Forthis,total RNAfromISE6tickcellsinfectedwith A.marginale wild-typeand omp10::himar1 mutantwasreversetranscribedandcDNAusedastemplateforPCRamplificationwithspecificprimersthatweredesignedto annealto omp6,omp7,omp8,omp9,andomp10 in wild-typeand omp10::himar1 mutantrespectively (Figure6A).The omp10,9,8, and 7 genes,butnot omp6 ,aretranscriptionall yactiveinwild-type A.marginale ,althoughatlowlevels(Figure6B).The Himar1 transposoninsertionintothecodingsequenceof omp10 ,disrupteditsexpressionandthatof omp9 omp8 ,and omp7 sincetranscriptsfromthesegenes werenotdetectedin omp10::himar1 mutantsof A.marginale bythismethod(Figure6B).Toensure integrity,cDNAsamplesfrom A.marginale wild-type and omp10::himar1 mutantwereusedforamplificationwithspecificprimersofaregionof131bpof the 16S rRNA.Ampliconsfromthisregionwere detectedinbothwild-typeand omp10::himar1 mutant.Nobandswerevisualizedinnegativecontrols (Figure6B). Since omp10 through omp7 areexpressedatlowlevels inISE6tickcells,RT-qPCRwasusedtoquantitatively determinedifferencesofexpressionbetween A.marginale wild-typeand omp10::himar1 mutant.Forthis,cDNA generatedfromISE6tickcellsinfectedwith A.marginale wild-typeand omp10::himar mutantwasusedfor realtimePCRamplificationusingprimersandprobes targeting omp8 omp9 ,andthe3 ’ and5 ’ endsof omp10 (Figure7A). Inordertocomparethesegeneexpressionresults betweenwild-typeand omp10:himar1A.marginale ,Ct valueswerenormalizedtothe rpoH msp5 and 16S rRNAgenes.Changesinexpressionofthesegeneswere calculatedbythe2Ctmethod,andresultswere expressedaspercentageofexpression,witha100%expressionlevelbeingassignedtothecalibratororcontrol group,whichinthiscaseiswild-type A.marginale Althoughthreedifferentreferencegeneswereused, RT-qPCRdatanormalizationledtosimilarresultsin Figure3 Himar1 transposoninsertionsiteinthe A.marginale str.Virginiagenome. ACT(ArtemisComparisonTool)windowshowingalignment betweenthe A.marginale genome(CP000030)usedasreference,the A.marginale str.Virginia omp10::himar1 contigformedbyRoche/454and Illuminasequencingreadsandthe Himar1 transposonsequences.Alignmentbetweenthe A.marginale strStMariesandthe omp10::himar1 mutant showsthatsequencesflankingthetransposoninsertionsitearehighlysimilarsharinganidentityof99%(matchingredband).Thisdemonstrates thatthetransposoninsertionsite(yellowboxes)occurredatnucleotide245afterthefirstbaseofthe omp10 startcodon(blackdottedline)in thereferencestrain.Alignmentwiththe Himar1 transposonsequencesclearlyshowtheinsertionofthesesequencesinthe omp10::himar1 mutantwhicharenotpresentinthe A.marginalestr .StMaries(absenceofmatchingband). Crosby etal.BMCGenomics 2014, 15 :278 Page5of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 6

whichtherewasasignificantlyreducedexpression for omp8 (97 – 99%), omp9 (90 – 99%)and omp103 ’ end(85-98%)relativetotheircounterpartsinwildtype A.marginale (Figure7B).Theseresultsshow that Himar1 transposoninsertioninto omp10 affecteditsexpressionandtheexpressionofgenes downstream,confirmingtheresultsobtainedby RT-PCRandagarosegelelectrophoresis.Asecond experimentinvestigated thepossibilityofthesame effectoccurringinregionsof omp10 beforethe Himar1 transposoninsertionsite.Forthis,aprimer andprobesetwasdesignedtoannealwitharegion atthe5 ’ endof omp10 (Figure7A).Eventhough therewasasignificantreductioninthedetectionof transcriptsfromthisregion(27-57%)relativetothe 5 ’ endof omp10 inwild-type,thisreductionwasnot asgreataswiththesequenceslocatedin omp10 downstreamofthe Himar1 transposoninsertionsite.WesternimmunoblotanalysisTodetermineifthedecreasedexpressionofmRNAin genesdownstreamof omp10 correlatedwithprotein expressionaWesternimmunoblotanalysisusinganti Omp9antibodywasperformed. Tocomparetheproteinexpressionof omp9 between A.marginaleomp10::himar1 andwild-type,thenumber oforganismspersamplewasquantifiedbyqPCRusing the opag2 singlecopygenetodeterminethecopynumberof A.marginale .Equalamounts(108)oforganisms of A.marginale wild-typeand omp10::himar1 mutant wereloadedperlane. A.marginale str.Virginiainitial Figure4 Characterizationof Himar1 transposoninsertionsite.A .Artemis(genomebrowserandannotationtool)windowshowingthe A.marginale genome(CP000030)usedasareferenceforthelocationofthe omp10 gene( AM1223 ,1092273 – 1093555),andtheTAdinucleotide (1093290 – 1093291)atthe Himar1 tninsertionsite(arrow)determinedbyhighthroughputgenomesequencinganalysis. B Himar1 tninsertion intothe omp10 genewasmediatedbytheA7transposaseinacutandpastemechanismleadingtotheduplicationofTAdinucleotide sequences. A.marginale genome(underlineduppercasetext,TAdinucleotideduplications(enhanceduppercasetext)flankingthetnelements (boldlowercase). Crosby etal.BMCGenomics 2014, 15 :278 Page6of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 7

bodiesanduninfectedISE6cellswereusedaspositive andnegativecontrolsrespectively. Westernimmunoblotshowedareducedexpressionof Omp9in omp10::himar1A.marginale mutantcompared withwild-type(Figure8A).TheOmp9bandof40kDa waspresentinwild-typeandinitialbodiesbutwasnot detectedinthemutantorusingnegativecontrolantibodyTryp1E1(Figure8B).AntibodyF16C1thatreacts withmajorsurfaceprotein5(Msp5)wasusedasaloadingcontrol.Anti-Msp5detectedthisprotein(19kDa)in wild-typeand omp10::himar1A.marginale (Figure8C). Theseresultscorrelatedwithresultsobtainedfromthe RNAtranscriptanalysis,showingthatthetransposon insertionseverelyaffectedtheexpressionofbothmRNA andproteinfromdownstreamgenessuchas omp9 .DiscussionThepossibilityofcreatinginsertionalmutationsin A. marginale notonlycouldprovideabroadunderstanding ofgeneproductsrequiredforinfectivity,growthorviabilityofthispathogeninthemammalianhostandthe tickvector,butalsowouldallowthegenerationofgeneticallyattenuatedorganismsthatcanbetestedinvaccinationtrials. Herewereportthattransposonmutagenesisusingthe Himar1 transposon/transposasesystemfor A.marginale isachievableanditcouldbeusefulforcreatinginsertionalmutationsintheseorganisms.Highthroughput genomesequencinganalysisforthecharacterizationof thesetransformantsestablishedthattransposonsequencesareintegratedwithinthe omp10 geneofthe A. marginale chromosomeanditsmobilizationwithinthis genewasmediatedbythetransposaseinacutandpaste mechanism,sincei.)thetransposonsequenceswere integratedwithinaTAdinucleotidesiteii.)uponintegrationofthetransposon,thissequencewasduplicated andisfoundflankingthetransposonTIRatthejunctionswiththe A.marginale genomeandiii.)sequences fromthedeliveringvectoroutsidethetransposonwere notfound. Althoughthese omp10 :: himar1 mutantorganismswere notcloned,theyareisogenicforthetransposoninsertion withinthe omp10 becauseallthesequencingreadscontainingthetransposonA.marginale genomejunctions alignedtothesamegenomesiteinthe A.marginale/St. Maries referencegenomesequence(CP000030).Possible reasonsincludetransposoninsertionintoothergenome regionsthatareessentialforgrowthintickcells,or Figure5 Intergenicregionsof omp7 to AM1225 wereanalyzedbyRT-PCR.A .Diagrammaticrepresentationofthe AM1225 omp6 operon with AM1225 omp10,omp9 omp8 omp7 and omp6 andintergenicregions.Locationofprimerpairs(AB1556-AB1591),(AB1592-AB1581), (AB1582-AB1569),and(AB1655-AB1595)designedforPCRamplificationof omp7-8 omp8-9 omp9-10 and omp10 -AM1225intergenicregions usingcDNAfromISE6cellsinfectedwith A.marginale wild-type. B .Agarosegelanalysisofampliconsconnectingintergenicregionsfrom omp7 through AM1225 (lanes2,5,8,and11).DNAwasusedaspositivecontrol(lanes4,7,10,and13).cDNAsfromreactionswithnoreverse transcriptasewereusedasnegativecontrols(lanes3,6,9and12).100bp/1KbDNAladder(lane1). Crosby etal.BMCGenomics 2014, 15 :278 Page7of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 8

insertionintoregionsthatcauseslowergrowthandnonrecoveryofthesemutants.Thissuggeststhatfurther optimizationisrequiredtoimprovetransformationefficienciesandformorerapididentificationandseparation ofmutantsbeforetheyarevisibleincultures. The omp10 geneispartofthe omp1 through omp14 clusters,membersofthe msp2 superfamilythatcorrespondtothepfam01617familyofbacterialsurfaceantigens[21].DeepsequencingofcDNAgeneratedfrom totalRNAoferythrocytesinfectedwith A.marginale identified70putativeoperonarrangements.Onecontained omp10 transcribedaspartofanoperonofsix geneswith AM1225 atthe5 ’ endandwith omp9 omp8 omp7 and omp6 arrangedintandematthe3 ’ end[25]. Inordertohaveabetterunderstandingoftheeffectsof thetransposoninsertionin omp10 onadjacentgenesit wasimportanttodetermineif omp10 isalsoexpressed aspartofapolycistronicmessagein A.marginale replicatingintickcellcultures. RT-PCRofintergenicregionsbetween omp7-8 omp8-9 omp9-10 and omp10 AM1225 providedevidencethat omp10 istranscribedwithinapolycistronicmessagein A. marginale infectedtickcells.Howevertranscriptsof omp6 werenotdetected.Similarresultsinwhich omp6 expressionwasnotdetectedin A.marginale infected IDE8tickcellsandintickmidgutswereobtainedby otherspreviously[43].Alackof omp6 transcriptssuggeststhatthisgenemaynotbeexpressedintickcells oronlyatverylowlevels.Ithasbeenshownthat,in bacteriawithreducedgenomessuchas Mycoplasma pneumoniae ,genemembersofanoperonarenotalwaysexpressedatthesamelevelsandthosegenesdistal fromthepromotermayhavelowerexpression[44]. RT-PCRandrelativegeneexpressionexperiments demonstratedthatinsertionof Himar1 into omp10 at nucleotide245fromthestartoftheORFalteredthe sequenceofthisgene.Thisresultedinthelossofits expressionsincetherewasasignificantreductioninthe detectionoftranscriptsfromthisgenewhencompared withtheexpressionof omp10 transcriptsfromwild-type A.marginale Ithasbeenshownthatinbacteriaproductionand/or stabilityofmRNAinregionsdownstreamofatransposoninsertionisgreatlyreduced,tothepointwhere verylittlemRNAcorrespondingtothisregioncanbe isolated[45].Insertionof Himar1 withinagenecan affecttheexpressionofneighboringgenes,asshowninavarietyofbacteriaandespeciallyinothertick-borne Figure6 Transcriptionalanalysisoftheeffectoftheinsertionofthe Himar1 transposonwithinthe omp10 genebyRT-PCR.A .Binding sitesofprimers(AB1553-AB1554),(AB1555-AB1556),(AB1591-AB1592),(AB1559-AB1560),and(AB1561-AB1562),designedtoamplifytranscriptson omp6,7,8,9 and 10 ,respectively,inwild-type(WT)ando mp10::himar1 mutant.ComplementaryDNAfromWTando mp10::himar1 mutantgrown inISE6tickcellswasusedforPCRamplificationforo mp6 through 10 withspecificprimerstoevaluategeneexpression. B .Agarosegelanalysisof PCRproductsfor omp6 through 10 in omp10::himar1 mutant(lanes2,8,14,20,and26).PCRproductsforo mp6 through 10 inWT(lanes5,11,17, 23,and29).GenomicDNAwasusedaspositivecontrol(lanes4,7,10,13,16,19,22,25,28,and31).ComplementaryDNAfromreactions withoutreversetranscriptasewereusedasn egativecontrols(lanes,3,6,9,12,15,18,21,24,27,and30).100bp/1KbDNAladderlane1). 16S rRNA(AB1572-AB1573)wasusedasaninternalcontroltoensureintegrityofcDNA(lanes32 – 37). Crosby etal.BMCGenomics 2014, 15 :278 Page8of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 9

bacteria[38,39,46].Therefore,weevaluatedtheeffectof the Himar1 insertionontheexpressionofgenesdownstreamandupstreamof omp10 in omp10::himar1A. marginale .Resultsshowedthatthetranscriptionalactivitiesof omp9 and omp8 werenegativelyinfluencedby theinsertionofthe Himar1 within omp10 sincedetection oftranscriptswassignificantlydecreasedinrelationto wild-type omp9 and omp8 Althoughthetranscriptionactivityofregionsupstream ofthetransposoninsertionsiteatthe5 ’ endof omp10 droppedsignificantlyinrelationtowild-type A.marginale itwasnotassevereaswithgenesdownstreamof omp10 Figure7 RelativegeneexpressionbyRT-qPCR.A .locationofbindingsitesforpri mersandprobesdesignedtotarget omp8 ( 1 .AB1591, 2 .AB1592, 3 .AB1593), omp9 ( 4 .AB1581, 5 .AB1582, 6 .AB1583),3 ’ endof omp10 ( 7 .AB1569, 8 .AB1570, 9 .AB1571),andthe5 ’ endof omp10 ( 10 .AB1594, 11 .AB1595, 12 .AB1596). B .Barlengthsrepresentthepercentageofexpressionof omp8 omp9 ,3 ’ endof omp10 and5 ’ endof omp10 in A.marginale wild-type (redbars)and omp10::himar1 mutant(bluebars). msp5 rpoH and 16S rRNAwereusedasreferencegenesfordatanormalization.Changesin expressionofthesegeneswerecalculatedusingthe2Ctmethod.*Significantdifferences(P<0.05)werecalculatedasdescribedinmaterials andmethods. Crosby etal.BMCGenomics 2014, 15 :278 Page9of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 10

Sequencinganalysisdeterminedthatthetransposonsense strandisfoundintheo ppositeorientationto omp10 ,soit mightbepossiblefortranscriptiontoreadthroughthe Himar1 sequencesandproduceanti-sensetranscriptsthat couldreduceexpressiono fsequencesupstreamof omp10 buttodemonstratethisfurthercharacterizationisrequired. Westernimmunoblotanalysisshowedthatthetransposoninsertioninto omp10 markedlyreducedprotein expressionof omp9 inthe omp10::himar1 mutant A. marginale whencomparedtowild-type,corroborating thatbothmRNAandproteinexpressionfromgenes downstreamof omp10 weredisrupted. Theevidencepresentedheresuggeststhatthesegenesare notessentialforgrowthof A.marginale intickcellculture. Significantworkonthepossibleinteractionsbetweenthe expressedproteinsindifferenthostenvironmentshasaccumulatedandoffersimportantcluesaboutthepossiblephenotypiceffectsofthedisruptionofthesegenesin A.marginale Forexample omp7 omp8 omp9 and omp10 aredifferentially expressedintickandmammaliancellswithlowerlevelsin tickmidgutandculturedtickcells[43].Detectionofproteins fromthesegeneshasbeenreported[43,47,48].Omp7,Omp8 andOmp9areconservedduringticktransmissionandin acuteandpersistentlyinfectedcattle[43].Characterizationof therepertoireofoutermembranesurfaceproteinsbymass spectrometryidentifiedOmp10andOmp7asimmunogenic incattle[47].Proteomeanalysisusingcrosslinkingandliquid chromatography – massspectrometry(LC-MS/MS)todeterminethecompositionandtopologicalorganizationofsurface proteinsin A.marginale inmammalianandtickcellsisolated alargeproteincomplexandanalysisdemonstratedthat Omp7,Omp8andOmp9arearrangedintheoutermembraneasnearneighborstoMsp2,Msp3,Msp4,Omp1, Opag2,Am779,Am780,Am1011,Am854andVirB1in A.marginale isolatedfromerythrocytes[18].Incontrasta similarsizedlargeproteincomplexin A.marginale isolated fromtickcellswasformedonlybyMsp2,Msp3,Msp4, Am778andAm854.AlthoughOmp7,Omp8andOmp9 wereexpressedtheydidnotseemtobelocalizedtothesurface,suggestingapossiblere-arrangementinthetopologyof thesurfaceof A.marginale duringthetransitionfromthe tickcellintothemammaliancell[18]. Interestingly,thenumbero fMsp2superfamilymembers suchas omp1 to omp15 in A.marginale subsp. centrale ,is reducedincomparisonwithUS A.marginale strains[10]. Forexample,closelyrelatedsequencesto omp8 and omp6 aremissingand omp10 isfoundwith omp7 andareduced omp9 intandem,whichmayindicateanimportantfunction ofthesegenesinthepathogenicityofA.marginale Basedonthis,furthercharacterizationofthese omp10::himar1 mutantstounderstandtheeffectsofthe disruptionofexpressionof omp10 9 8 and 7 onthe phenotypeof A.marginale isofcriticalimportance. Phenotypiceffectsmayincludeinfectivity,ticktransmissibility,stabilityundernonselectableconditions,abilityto induceimmuneresponsesandabilitytoestablishpersistentinfectionwithinthenaturalhost.ConclusionsTransposonmutagenesisisachievablefor A.marginale Highthroughputgenomesequencingofrecombinant bacteriaelectroporatedwithasingleplasmidcontaining Figure8 Immunoblottingof omp10::himar1 mutantandWT A.marginale usingthespecificmonoclonalantibodyOmp9. Proteinsfrom equalamountsofhostcell-freewild-type(WT)and omp10::himar1A.marginale wereseparatedbySDS-PAGEgelelectrophoresis.ImmunoblotPVDF membranesoftransferredproteinswerereactedwithmonoclonalantibodiesandreactionswerevisualizedbychemiluminescence. A .Monoclonal antibodyOmp9(4 g/ml)withspecificitytoOmp9protein(40kDa)(blackarrow). B .Negativecontrol,monoclonalTryp1E1(4 g/ml)(exhibits specificityforavariablesurfaceglycoproteinof Trypanosomabrucei C .MonoclonalF16C1(2 g/ml),reactswiththeMsp5(19kDa)(bluearrow)protein of A.marginale ,wasusedasloadingcontrol. A.marginale str.VirginiaanduninfectedISE6cellswereusedaspositiveandnegativecontrolsrespectively. Crosby etal.BMCGenomics 2014, 15 :278 Page10of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 11

the Himar1 sequencesandthe A7 transposaseshowed insertionofthe Himar1 sequencesintothe omp10 gene of A.marginale .Theinsertionwasmediatedbythe transposaseinacutandpastemechanism.Intickcells omp10 isexpressedasapolycistronicmessagewith AM1225 atthe5 ’ endand omp9 8 and 7 atthe3 ’ end. Insertionofthe Himar1 transposonwithin omp10 not onlydisrupteditsexpressionbutalsotheexpressionof genesdownstream,suchas omp9 omp8 and omp7 Thisworkshowstheutilityofthe Himar1 systemfor thegenerationofinsertionalmutantsin A.marginale fortheidentificationofgenesinvolvedinvirulenceand potentiallyforthedevelopmentofattenuatedorganisms.MethodsA.marginale cultivationCulturesof A.marginale str.Virginiawild-typeand omp10 :: himar1 mutantweremaintainedintickISE6 cellsderivedfromembryonatedeggsoftheblacklegged tick, Ixodesscapularis at34Cinnon-vented25-cm2cell cultureflasks(NUNC). A.marginale -infectedcellcultures weremaintainedinL15B300mediumsupplementedwith 5%fetalbovineserum(FBS,BenchMark,GeminiBioProducts),5%tryptosephos phatebroth(TPB,Difco, BectonDickinson),0.1%bovinelipoproteinconcentrate (LPC,MP-Biomedical),0.25%NaHCO3,and25mM HEPESbuffer,adjustedtopH7.8,aspreviouslydescribed[49].ThecellculturemediumforISE6cells infectedwiththe A.marginaleomp10 :: himar1 mutant wassupplementedwithspectinomycin(SigmaAldrich) andstreptomycin(SigmaAld rich)toafinalconcentrationof50 g/mleach.Isolationofthe A.marginale mutantbytransposon mutagenesisTomaximizechancesofobtainingatransformantusing transposonmutagenesis,weusedasingleplasmidconstructthatencodedboththetransposonandthetransposasein cis configurationasdescribed[50],exceptthat thefluorescentmarkerwasreplacedbysequencesencodingamonomericredfluorescentprotein, mCherry [51](Figure1A). A.marginale bacteriapassaged53times inISE6cellswereharvestedfromone25-cm2culturein 5mlofmediumwhen~80%ofcellswereinfected,and manycellswereundergoinglysis.Thecellswererecoveredin2mlofculturemedium,andaddedtoa2-ml microcentrifugetubecontaining0.3mlofsterilesilicon carbideabrasive(60/90grit;Lortone,Inc),vortexedat maximumspeedfor30sec,andthelysatetransferredtoa fresh2-mltubeonice.Bacteriawerecollectedbycentrifugationat11,000gfor10minat4C,andwashedtwicein ice-cold300mMsucrose.Theywerethenresuspendedin 50 lof300mMsucrosecontaining3 gofplasmid DNA,andincubatedonicefor15minbeforebeing electroporated(BioradGenePulserII)at2kV,400Ohm and25 Fina0.2cmgapcuvette.Theelectroporation mixturewasrecoveredin1.5mlofanISE6cell suspension(~2106cells),andcentrifugedinamicrocentrifugetubeat1,000gfor10minatroom temperature.Thetubewasleftundisturbedfor30min atroomtemperature,andthepelletthenresuspended inthesupernatantmediumandaddedtoa25-cm2flaskcontaining~5106ISE6cellsin3mlofL15B300 mediumsupplementedasdescribedfor Anaplasma infectedcultures.Theculturewasincubatedat34C inatightlycappedflask.Threedaysafterelectroporation, theculturemediumwasreplacedwith5mlofmedium additionallycontaining50 g/mlofspectinomycinand streptomycin(selectionmedium).Subsequently,theculturewasfedtwiceweeklywithselectionmediumand examinedweeklyonaninvertedmicroscope(Diaphot, Nikon)fittedforepifluorescenceusingaTexasRedfilter. Thefirstfluorescentcoloniesofbacteriawerenoted6wk followingelectroporation,andtheculturewasmaintained inselectionmediumwithtwice-weeklymediumchanges until~90%ofcellswereinfected.Atthattime,themutant waspassaged(ten-folddilution)tofreshcells,andthe remainderwasstoredinliquidnitrogen.Preparationofhostcell-free A.marginale wild-typeand o mp10 ::himar1mutantfromISE6tickcellsIsolationof A.marginale wild-typeand omp10 ::himar1 mutantwasperformedbydisruptionofISE6tickcells with1mmdiameterglassbeads(BioSpecTechnologies) inaMinibeadbeater(BioSpectechnologies)asdescribed elsewhere[52],withtheexceptionthatcellswereshaken onlyoncefor10sandimmediatelyplacedonice.Celllysatesweretransferredto1.5mlcentrifugetubesand centrifugedat100gfor5minat4Ctopelletcelldebris. Thesupernatantwasthencarefullyremovedandtransferredtoclean1.5mlcentrifugetubes. A.marginale organisms(wild-typeand omp10 :: himar1 mutant)were pelletedat11,000gfor10minat4C,andstoredat 20C.DNAisolationandPhi29amplificationofthe A.marginale omp10 :: himar1 mutantBeforeDNAisolation,pelleted A.marginaleomp10 :: himar1 mutantsweretreatedwithRNaseA(QIAGEN) andDNaseI(SigmaAldrich)toremoveISE6hostcell contaminantnucleicacids.DNAisolationwasperformed usingtheQIAampDNAMinikit(QIAGEN)aspermanufacturer ’ sinstructions,butinthiscasetheDNAwas elutedin50 lof1mMTrispH9.0.DNAconcentration wasdeterminedusingtheQubitdsDNAHSassaykit(Life technologies)onaQubitfluorometer(Lifetechnologies). 5reactionsof10ngofDNAwereusedforwholegenome amplificationusingtheGenomiPhiV2DNAamplificationkit(GEHealthcare)accordingtomanufacturer ’ sCrosby etal.BMCGenomics 2014, 15 :278 Page11of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 12

instructions.Followingamplification,aliquotswerepooled togetherandtheDNApurifiedwithGelEluteExtraction Kit(5PRIME)byadsorptiontosilicaparticlesandeluted with10mMTrispH8.2.GenomesequencingandbioinformaticsSamplesfrom2.0to3.6 gofamplifiedDNAderived fromthe omp10::himar1 mutant,wereprovidedforlibrary constructionandsequencingbytheRoche/454(GS-FLX) methodtotheInterdisciplinaryCenterforBiotechnology Research(ICBR)attheUniversityofFlorida.Also,samplesofequivalentamountswereprovidedtotheScripps ResearchInstitute,LaJolla,Californiaforsequencingby theIllumina(HiSeq)method. Atotalof374,151and207,288,916readsofRoche/454 andIlluminasequencingdata,respectively,wereobtained. TheFASTQfilesprovidedbythesequencingfacilities wereuploadedtotheUFGALAXYwebsitehttp://galaxy. hpc.ufl.edu,andanalyzedseparately. UploadedIlluminaFASTQfilesweregroomed,filtered andformattedintoFASTAfilesusingtheFASTQ Groomer,FilterFASTQandFASTQtoFASTAconverter toolslocatedintheNGS:QCandmanipulationtoolbox ofGALAXY.FASTAfileswerethenalignedtothe A.marginale str StMariesreferencegenomesequence (CP000030)usingtheMegablastalignmenttool(NCBI BLAST+blastn(version0.0.12)inGALAXY)toobtain sequencingreadsthatcontained A.marginale sequences. These A.marginale sequencingreadswerethenused forasecondMegablastalignmentusingasareference sequence28nucleotidesfromthe Himar1 terminal invertedrepeats(TIR).Thetransposoninsertionlocus withinthe A.marginale chromosomewasthendetermined,sincethereadsobtainedcontainedthe A.marginale Himar1 TIRjunctions. Asimilarstrategywasusedfortheanalysisofthe Roche/454sequencingreads.CLCgenomicsworkbench, version6.5wasusedforassembliesofRoche/454and Illuminareads.RNAisolationForRNAisolation,threesamplesofISE6cellsinfected with A.marginale wild-typeandthree omp10 :: himar1 sampleswereused.Eachsamplederivedfromseparate culturesgrowninT-25cellcultureflasks.Samplescontainingapproximatelyequalnumbersofinfectedcells werecollectedinRNAstabilizationreagentRNAlater (AMBION-Lifetechnologies)andstoredat 80C.Total RNAwasisolatedusingtheRNeasykit(QIAGEN)with anadded “ on-column ” DNaseItreatment(QIAGEN) accordingtomanufacturer ’ sinstructions.Aliquotsof extractedRNAwereusedtomeasurecontaminantDNA concentrationusingtheQubitdsDNAHSassaykit(Life technologies).Additionally,RNAwastreatedthreetimes withRNase-freeDnaseI(AMBION-Lifetechnologies)to removeanytraceofcontaminantDNAinthesample.RNA concentrationwasmeasuredwiththeQubitRNAassaykit (Lifetechnologies),andsampleswerestoredat 80C.RT-PCRandRT-qPCRexperimentsRNA(2 g)fromISE6cellsinfectedwith A.marginale wild-typeand omp10::himar1 mutantwasconvertedto cDNAbyrandomprimingusingaOmniscriptreverse transcriptasekit(QIAGEN)accordingtomanufacturer ’ s conditions.GenomicDNAandno-reversetranscriptase reactionswereincludedascontrolsforeachsampleand eachnucleicacidtarget.Specificprimers(Table1)were designedtoamplifytranscriptsfromintergenicregions between omp7 omp8 omp8 omp9 omp9 omp10 and omp10 AM1225 usingcDNAfromISE6cellsinfected with A.marginale wild-typeastemplate.Similarlytranscriptsfromwithin omp6 omp7 omp8 omp9 ,and omp10 genesweredetectedbyPCRamplificationof cDNAfromISE6cellsinfectedwith A.marginale wildtypeandthe omp10::himar1 mutantusing omp6-10 specificprimers(Table1).PCRamplificationconditionsfor eachPCRexperimentaredescribedinAdditionalfile1: TablesS1andS2respectively.RT-qPCRexperimentsTranscriptdifferencesbetween omp8 omp9 omp10-5 ’ end,and omp10-3 ’ genesin A.marginale wild-typeand omp10::himar1 mutantweredeterminedusingthecomparative2Ctmethod[53,54]andtheresultswere basedonthemeanofthreebiologicalsamples(individualRNAextracts).ForTaqmanquantitativePCR,cDNA obtainedfromISE6cellsinfectedwith A.marginale wild-typeandthe omp10::himar1 wasusedwithprimers andprobes(Table1)designedtoamplify omp8 omp9 omp10-5 ’ end, omp10-3 ’ end, msp5 rpoH andthe 16S genesequences.Reactionconditionsaredescribedin Additionalfile1:TableS3,specificityofprimersand probesisshowninAdditionalfile1:FigureS1andthe amplificationefficienciesforeachtargetarereportedin Additionalfile1:TableS4.Foravalid2Ctcalculation, relativeefficienciesoftargetvs.referencegeneswerecalculatedandarereportedinAdditionalfile1:TableS5. Significantdifferencesbetweenthe A.marginale wildtypeand omp10::himar1 mutantwerecalculatedby Student ’ sttest(P<0.05),comparing Ctvalues(target gene-referencegene)ofthe omp10::himar1 mutantand thewild-type.Thefolddifferencewasbasedon Ct ( omp10::himar1 mean Ct – wild-typemean Ct)and calculatedas2Ctwhichyieldstheexpressionratio.The expressionratiowasthenexpressedaspercentageofexpressionbymultiplyingthe2Ctvaluesby100.For normalizationofrelativegeneexpressiondata msp5 [55], rpoH ,and 16S wereusedasreferencegenes.Crosby etal.BMCGenomics 2014, 15 :278 Page12of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 13

WesternimmunoblotsExpressionoftheOmp9proteinin A.marginale wildtypeand omp10 :: himar1 mutantwasassessedbysodium dodecylsulfate-polyacrylamidegelelectrophoresisand immunoblottingusingequalamounts(108)ofhost-free bacteria.Membraneswereincubatedwiththreedifferent antibodies;theanti-Omp9monoclonalantibody(121/1055) [43],themonoclonalantibodyF16C1(reactswiththe Msp5proteinandservedasaloadingcontrol)[56]andthe monoclonalantibodyTryp1E1(exhibitsspecificityfora Table1PCRandTaqmanqPCRoligonucleotidesusedinthisstudyOligonucleotidesequence(5 ’ to3 ’ )TargetSizeReference PCR AB1553CTCCAATCGGAGGGGTTGTG omp6 492bp[ 43 ] AB1554GCATAAATCCAGTTTAGCCTCC AB1555GTGGTTAGATCTTTTCTGTTGGG omp7 399bp[ 43 ] AB1556CGCTCTACCACTGACCTTCATG AB1591GCTGGAGTTCGAAGCGATGC omp8 259bpThisstudy AB1592CAGAGCGCCCTGTTTCAGTG AB1559AGCTGGGGCTCTTGCGTTTG omp9 1096bp[ 43 ] AB1560AACATATTCACTATAATCTGACGCTGC AB1561TCCTTCGGGTTGCTGCGTTG omp10 969bp[ 43 ] AB1562GCTTACCCCCATTCCAGCAC AB1572AGGATGATCAGCCACACTGGAA 16S 131bpThisstudy AB1573TACAACCCTAAGGCCTTCCTCA **qPCR AB1591GCTGGAGTTCGAAGCGATGC AB1592CAGAGCGCCCTGTTTCAGTG omp8 259bpThisstudy AB1593 GCGTGAGCACTGCGGTACAGACGG AB1581GAAGTCACTACACGACCTGACTGT AB1582TAAAGCATCTTCGCGGGTCGT omp9 145bp[ 43 ] AB1583 TATTCAGTGCGCTGAACACTGCGATCCA AB1594GTGGGTGCTGTACGCACATT AB1595AAAGACAGCAGGCAGCAACA omp10-5' 170bpThisstudy AB1596 CGCGTGTCCTTCGGGTTGCT AB1569GGTGCTGAGTTGAAGCTTGC AB1570GCCACAGACCCACTATCAGC omp10-3' 140bp[ 43 ] AB1571 TATCTCGCGCTGCATCGGTG AB1572AGGATGATCAGCCACACTGGAA AB1573TACAACCCTAAGGCCTTCCTCA 16S 131bp[ 42 ] AB1574 TATTGGACAATGGGCGCAAGCCTGAT AB1606CTCACAGGCGAAGAAGCAGAC AB1607GCCCGACATACCTGCCTTT msp5 145bp[ 55 ] AB1610 TGGGCGACAAGAAGCCAAGTGA AB1608ATCAAAGCTATTGCGGAGGA AB1607ACAGAACTCTCCCCATGCAC rpoH 116bpThisstudy AB1611 TGCCAATCGGGACGTTTCGC AB1242AAAACAGGCTTACCGCTCCAA AB1243GGCGTGTAGCTAGGCTCAAAGT opag2 151bp[ 41 ] AB1250 CTCTCCTCTGCTCAGGGCTCTGCG*PrimersandTaqManprobesusedweremanufacturedatEurofinsMGMOperon. Oligonucleotides arelabeledwith6-Carboxyfluorescein6-FAMatthe5 ’ endandTetramethylrhodamineTAMRAatthe3 ’ end.Crosby etal.BMCGenomics 2014, 15 :278 Page13of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 14

variablesurfaceglycoproteinof Trypanosomabrucei )[56]. Thislastantibodyservedasanegativecontrol.Finalconcentrationsofeachantibodyusedwere4 g/ml,2 g/ml and4 g/ml.Antibodybindingwasdetectedwiththesecondaryantibodygoatanti-mouseIgG,horseradishperoxidaselabeledanddilutedto1:10,000usingthePierceECL Westernblottingsubstrate(Th ermoscientific)asdescribed inmanufacturer ’ sinstructions. Quantificationofthenumberof A.marginale wildtypeand omp10::himar1 organismswasperformedas describedelsewhere[41].GenBankaccessionnumbersforassembledcontigscontainingthe Himar1 transposon sequencesintegratedwithin omp10 andupstreamgenes (KJ567138)and omp10 (partial3 ’ end)and omp9 genes (KJ567139).AdditionalfileAdditionalfile1: RT-PCRandRT-qPCRexperimentsFigureandTables. Competinginterests Theauthorsdeclarethattheyhavenocompetinginterests. Authors ’ contributions FLCdesignedandcarriedoutexperiments,dataanalysisandauthoredthis manuscript.HLWandMGPcarriedouttickcellmediapreparation,maintenance ofuninfectedtickcellculturesandco-authoredthemanuscript.AMLperformed Westernblotexperimentsandco-authoredthemanuscript.AFBadvisedon experiments,genomesequencinganalysis,criticallyevaluatedandco-authored themanuscript.SMNprovidedmonoclonalantibodiesforWesternblot experiments,co-authoredandcriticallyevaluatedthemanuscript.UM kindlyprovidedtransformed A.marginale organismsco-authoredand criticallyevaluatedthemanuscript .Allauthorsreadandapprovedthe finalmanuscript. Acknowledgments ThisworkreceivedsupportfromgrantnumberGR075800Mfromthe WellcomeTrust. Authordetails1CollegeofVeterinaryMedicine,UniversityofFlorida,Departmentof InfectiousDiseasesandPathology,2015SW16thavenue,Gainesville, FL32610,USA.2PhysiologicalSciences,2015SW16thavenue,Gainesville,FL 32610,USA.3USDA-ARSAnimalDiseaseResearchUnit,AnimalDisease ResearchUnit,3003ADBF,Pullman,WA99164,USA.4Departmentof Entomology,UniversityofMinnesota,219HodsonHall1980Folwellavenue, St.Paul,Minneapolis,MN55108,USA. Received:23October2013Accepted:31March2014 Published:11April2014 References1.KocanKM,delaFuenteJ,BlouinEF,CoetzeeJF,EwingSA: Thenatural historyof Anaplasmamarginale VetParasitol 2010, 167: 95 – 107. 2.KocanKM,delaFuenteJ,BlouinEF,Garcia-GarciaJC: Anaplasmamarginale (Rickettsiales:Anaplasmataceae):recentadvancesindefininghost-pathogen adaptationsofatick-bornerickettsia. Parasitology 2004, 129 (Suppl):S285 – 300. 3.MorleyRS,Hugh-JonesME: ThecostofanaplasmosisintheRedRiver Plainsandsouth-eastareasofLouisiana. VetResCommun 1989, 13: 349 – 358. 4.GoodgerWJ,CarpenterT,RiemannH: Estimationofeconomicloss associatedwithanaplasmosisinCaliforniabeefcattle. JAmVetMed Assoc 1979, 174: 1333 – 1336. 5.PalmerGH,BraytonKA: Antigenicvariationandtransmissionfitnessas driversofbacterialstrainstructure. CellMicrobiol 2013, 12: 1969 – 1975. doi:10.1128/CVI.00600-12. 6.PalmerGH,FutseJE,KnowlesDPJr,BraytonKA: Insightsintomechanisms ofbacterialantigenicvariationderivedfromthecompletegenome sequenceof Anaplasmamarginale AnnNYAcadSci 2006, 1078: 15 – 25. 7.MeeusPF,BraytonKA,PalmerGH,BarbetAF: Conservationofagene conversionmechanismintwodistantlyrelatedparaloguesof Anaplasma marginale MolMicrobiol 2003, 47: 633 – 643. 8.MeeusPF,BarbetAF: Ingeniousgenegeneration. TrendsMicrobiol 2001, 9: 353 – 355.discussion355 – 356. 9.KocanKM,delaFuenteJ,GuglielmoneAA,MelendezRD: Antigensand alternativesforcontrolof Anaplasmamarginale infectionincattle. ClinMicrobiolRev 2003, 16: 698 – 712. 10.HerndonDR,PalmerGH,ShkapV,KnowlesDPJr,BraytonKA: Complete genomesequenceof Anaplasmamarginale subsp.centrale. JBacteriol 2010,192: 379 – 380. 11.AgnesJT,BraytonKA,LaFollettM,NorimineJ,BrownWC,PalmerGH: Identificationof Anaplasmamarginale outermembraneproteinantigens conservedbetween A.marginale sensustrictostrainsandthelive A. marginale subsp.centralevaccine. InfectImmun 2011, 79: 1311 – 1318. 12.DarkMJ,Al-KhederyB,BarbetAF: Multistraingenomeanalysisidentifies candidatevaccineantigensof Anaplasmamarginale Vaccine 2011, 29: 4923 – 4932. 13.delaFuenteJ,KocanKM,Garcia-GarciaJC,BlouinEF,ClaypoolPL,SalikiJT: Vaccinationofcattlewith Anaplasmamarginale derivedfromtickcell cultureandbovineerythrocytesfollowedbychallenge-exposurewith infectedticks. VetMicrobiol 2002, 89: 239 – 251. 14.RodriguezSD: GarciaOrtizMA,HernandezSalgadoG,SantosCerdaNA, AboytesTorreR,CantoAlarconGJ: Anaplasmamarginale inactivated vaccine:dosetitrationagainstahomologouschallenge. CompImmunol MicrobiolInfectDis 2000, 23: 239 – 252. 15.KanoFS,TamekuniK,CoelhoAL,GarciaJL,VidottoO,ItanoEN,VidottoMC: InducedimmuneresponseofDNAvaccineencodinganassociation MSP1a,MSP1b,andMSP5antigensof Anaplasmamarginale Vaccine 2008, 26: 3522 – 3527. 16.BrownWC,ShkapV,ZhuD,McGuireTC,TuoW,McElwainTF,PalmerGH: CD4(+)T-lymphocyteandimmunoglobulinG2responsesincalves immunizedwith Anaplasmamarginale outermembranesandprotected againsthomologouschallenge. InfectImmun 1998, 66: 5406 – 5413. 17.BrownWC,ZhuD,ShkapV,McGuireTC,BlouinEF,KocanKM,PalmerGH: Therepertoireof Anaplasmamarginale antigensrecognizedbyCD4(+) T-lymphocyteclonesfromprotectivelyimmunizedcattleisdiverseand includesmajorsurfaceprotein2(MSP-2)andMSP-3. InfectImmun 1998, 66: 5414 – 5422. 18.NohSM,BraytonKA,BrownWC,NorimineJ,MunskeGR,DavittCM,PalmerGH: Compositionofthesurfaceproteomeof Anaplasmamarginale anditsrolein protectiveimmunityinducedbyoutermembraneimmunization. Infect Immun 2008, 76: 2219 – 2226. 19.NohSM,TurseJE,BrownWC,NorimineJ,PalmerGH: Linkagebetween Anaplasmamarginale outermembraneproteinsenhances immunogenicitybutisnotrequiredforprotectionfromchallenge. ClinVaccineImmunol 2013, 20: 651 – 656. 20.SuttenEL,NorimineJ,BearePA,HeinzenRA,LopezJE,MorseK,BraytonKA, GillespieJJ,BrownWC: Anaplasmamarginale typeIVsecretionsystem proteinsVirB2,VirB7,VirB11,andVirD4areimmunogeniccomponentsofa protectivebacterialmembranevaccine. InfectImmun 2010, 78: 1314 – 1325. 21.BraytonKA,KappmeyerLS,HerndonDR,DarkMJ,TibbalsDL,PalmerGH, McGuireTC,KnowlesDPJr: Completegenomesequencingof Anaplasma marginale revealsthatthesurfaceisskewedtotwosuperfamiliesof outermembraneproteins. ProcNatlAcadSciUSA 2005, 102: 844 – 849. 22.PalmerGH,BrownWC,NohSM,BraytonKA: Genome-widescreeningand identificationofantigensforrickettsialvaccinedevelopment. FEMS ImmunolMedMicrobiol 2012, 64: 115 – 119. 23.DarkMJ,LundgrenAM,BarbetAF: Determiningtherepertoireof immunodominantproteinsviaw hole-genomeamplificationof intracellularpathogens. PLoSOne 2012, 7: e36456. doi:10.1371/journal.pone.0036456.Crosby etal.BMCGenomics 2014, 15 :278 Page14of15 http://www.biomedcentral.com/1471-2164/15/278

PAGE 15

24.BraytonKA,PalmerGH,BrownWC: Genomicandproteomicapproaches tovaccinecandidateidentificationfor Anaplasmamarginale ExpertRev Vaccines 2006, 5: 95 – 101. 25.PierleSA,DarkMJ,DahmenD,PalmerGH,BraytonKA: Comparative genomicsandtranscriptomicsoftrait-geneassociation. BMCGenomics 2012, 13: 669. 26.VanOpijnenT,CamilliA: Transposoninsertionsequencing:anewtoolfor systems-levelanalysisofmicroorganisms. NatRevMicrobiol 2013, 11: 435 – 442. 27.ClaeysBouuaertC,ChalmersRM: Genetherapyvectors:theprospectsand potentialsofthecut-and-pastetransposons. Genetica 2010, 138: 473 – 484. 28.PicardeauM: Transpositionofflymarinerelementsintobacteriaasa genetictoolformutagenesis. Genetica 2010, 138: 551 – 558. 29.LampeDJ,GrantTE,RobertsonHM: Factorsaffectingtranspositionofthe Himar1 marinertransposoninvitro. Genetics 1998, 149: 179 – 187. 30.PlasterkRH,IzsvakZ,IvicsZ: Residentaliens:theTc1/marinersuperfamily oftransposableelements. TrendsGenet 1999, 15: 326 – 332. 31.ClarkTR,EllisonDW,KlebaB,HackstadtT: Complementationof Rickettsia rickettsii RelA/SpoTrestoresanonlyticplaquephenotype. InfectImmun 2011, 79: 1631 – 1637. 32.ClarkTR,LackeyAM,KlebaB,DriskellLO,LutterEI,MartensC,WoodDO, HackstadtT: Transformationfrequencyofamariner-basedtransposonin Rickettsiarickettsii JBacteriol 2011, 193: 4993 – 4995. 33.KlebaB,ClarkTR,LutterEI,EllisonDW,HackstadtT: Disruptionofthe R ickettsiarickettsii Sca2autotransporterinhibitsactin-basedmotility. InfectImmun 2010, 78: 2240 – 2247. 34.BearePA,SandozKM,OmslandA,RockeyDD,HeinzenRA: Advancesin geneticmanipulationofobligateintracellularbacterialpathogens.Front Microbiol 2011, 2: 97. 35.BearePA: Geneticmanipulationof Coxiellaburnetii AdvExpMedBiol 2012, 984: 249 – 271. 36.BotkinDJ,AbbottAN,StewartPE,RosaPA,KawabataH,WatanabeH,NorrisSJ: Identificationofpotentialvirulencedeterminantsby Himar1 transposition ofinfectious Borreliaburgdorferi B31. InfectImmun 2006, 74: 6690 – 6699. 37.StewartPE,HoffJ,FischerE,KrumJG,RosaPA: Genome-widetransposon mutagenesisof Borreliaburgdorferi foridentificationofphenotypic mutants. ApplEnvironMicrobiol 2004, 70: 5973 – 5979. 38.MaierTM,CaseyMS,BeckerRH,DorseyCW,GlassEM,MaltsevN,ZahrtTC, FrankDW: Identificationof FrancisellatularensisHimar1 -basedtransposon mutantsdefectiveforreplicationinmacrophages. InfectImmun 2007, 75: 5376 – 5389. 39.ChengC,NairAD,IndukuriVV,GongS,FelsheimRF,JaworskiD,Munderloh UG,GantaRR: Targetedandrandommutagenesisof Ehrlichiachaffeensis fortheidentificationofgenesrequiredforinvivoinfection. PLoSPathog 2013, 9: e1003171.doi:10.1371/journal.ppat.1003171. 40.FelsheimRF,HerronMJ,NelsonCM,BurkhardtNY,BarbetAF,KurttiTJ, MunderlohUG: Transformationof Anaplasmaphagocytophilum BMC Biotechnol 2006, 6: 42. 41.FelsheimRF,ChavezAS,PalmerGH,CrosbyL,BarbetAF,KurttiTJ, MunderlohUG: Transformationof Anaplasmamarginale VetParasitol 2010, 167: 167 – 174. 42.BarbetAF,AgnesJT,MorelandAL,LundgrenAM,AllemanAR,NohSM, BraytonKA,MunderlohUG,PalmerGH: Identificationoffunctional promotersinthe msp2 expressionlociof Anaplasmamarginale and Anaplasmaphagocytophilum Gene 2005, 353: 89 – 97. 43.NohSM,BraytonKA,KnowlesDP,AgnesJT,DarkMJ,BrownWC,BaszlerTV, PalmerGH: DifferentialexpressionandsequenceconservationoftheAnaplasmamarginalemsp2 genesuperfamilyoutermembraneproteins. InfectImmun 2006, 74: 3471 – 3479. 44.GuellM,vanNoortV,YusE,ChenWH,Leigh-BellJ,MichalodimitrakisK, YamadaT,ArumugamM,DoerksT,KuhnerS,RodeM,SuyamaM,SchmidtS, GavinAC,BorkP,SerranoL: Transcriptomecomplexityinagenome-reduced bacterium. Science 2009, 326: 1268 – 1271. 45.KlecknerN: Translocatableelementsinprocaryotes. Cell 1977, 11: 11 – 23. 46.BearePA,GilkSD,LarsonCL,HillJ,SteadCM,OmslandA,CockrellDC, HoweD,VothDE,HeinzenRA: Dot/IcmtypeIVBsecretionsystem requirementsfor Coxiellaburnetii growthinhumanmacrophages. MBio 2011, 2: e00175 – 00111. 47.LopezJE,SiemsWF,PalmerGH,Brayton KA,McGuireTC,NorimineJ,BrownWC: Identificationofnovelantigenicproteinsinacomplex Anaplasmamarginale outermembraneimmunogenbymassspectrometryandgenomic mapping. InfectImmun 2005, 73: 8109 – 8118. 48.RidingG,HopeM,WaltisbuhlD,WilladsenP: Identificationofnovel protectiveantigensfrom Anaplasmamarginale Vaccine 2003, 21: 1874 – 1883. 49.MunderlohUG,BlouinEF,KocanKM,GeNL,EdwardsWL,KurttiTJ: Establishmentofthetick(Acari:Ixodidae)-bornecattlepathogen Anaplasmamarginale (Rickettsiales:Anaplasmataceae)intickcellculture. JMedEntomol 1996, 33: 656 – 664. 50.MunderlohUGFR,BurkhardtNY,HerronMJ,OliviaChavezAS,NelsonCM, KurttiTJ: Thewayforward:improvinggeneticsystems .In Intracellular PathogensII. EditedbyAzadA,PalmerG.Washington,DC:ASMPress; 2012:416 – 432. 51.ShannerN,CampbellRE,SteinbachPA,GiepmansBN,PalmerAE,TsienRY: Improvedmonomericred,orangeandyellowfluorescentproteinsderived fromDiscosomasp.redfluorescentprotein. NatBiotechnol 2004, 22: 5. 52.QinA,TuckerAM,HinesA,WoodDO: Transposonmutagenesisofthe obligateintracellularpathogen Rickettsiaprowazekii ApplEnviron Microbiol 2004, 70: 2816 – 2822. 53.SchmittgenTD,LivakKJ: Analyzingreal-timePCRdatabythecomparative C(T)method. NatProtoc2008, 3: 1101 – 1108. 54.LivakKJ,SchmittgenTD: Analysisofrelativegeneexpressiondatausing real-timequantitativePCRandthe2CtMethod. Methods 2001, 25: 402 – 408. 55.LohrCV,RurangirwaFR,McElwainTF,StillerD,PalmerGH: Specific expressionof Anaplasmamarginale majorsurfaceprotein2salivary glandvariantsoccursinthemidgutandisanearlyeventduringtick transmission. InfectImmun 2002, 70: 114 – 120. 56.BarbetAF,BlentlingerR,YiJ,LundgrenAM,BlouinEF,KocanKM: Comparison ofsurfaceproteinsof Anaplasmamarginale grownintickcellculture,tick salivaryglands,andcattle. InfectImmun 1999, 67: 102 – 107.doi:10.1186/1471-2164-15-278 Citethisarticleas: Crosby etal. : Knockoutofanoutermembrane proteinoperonof Anaplasmamarginale bytransposonmutagenesis. BMCGenomics 2014 15 :278. Submit your next manuscript to BioMed Central and take full advantage of: € Convenient online submission € Thorough peer review € No space constraints or color “gure charges € Immediate publication on acceptance € Inclusion in PubMed, CAS, Scopus and Google Scholar € Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Crosby etal.BMCGenomics 2014, 15 :278 Page15of15 http://www.biomedcentral.com/1471-2164/15/278