Major antigenic protein 2 of Cowdria ruminantium : potential value for serological diagnosis

MISSING IMAGE

Material Information

Title:
Major antigenic protein 2 of Cowdria ruminantium : potential value for serological diagnosis
Physical Description:
Book
Language:
English
Creator:
Bowie, Michael Vernon, 1965-
Publication Date:

Record Information

Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 029109740
oclc - 51005149
System ID:
AA00022864:00001

Table of Contents
    Title Page
        Page i
    Dedication
        Page ii
    Acknowledgement
        Page iii
        Page iv
    Table of Contents
        Page v
        Page vi
        Page vii
    List of Tables
        Page viii
        Page ix
    List of Figures
        Page x
        Page xi
    Abbreviations
        Page xii
    Abstract
        Page xiii
        Page xiv
        Page xv
    Chapter 1. Introduction
        Page 1
        Page 2
        Page 3
        Page 4
        Page 5
        Page 6
        Page 7
        Page 8
    Chapter 2. Literature review
        Page 9
        Page 10
        Page 11
        Page 12
        Page 13
        Page 14
        Page 15
        Page 16
        Page 17
        Page 18
        Page 19
        Page 20
        Page 21
        Page 22
        Page 23
        Page 24
        Page 25
        Page 26
        Page 27
        Page 28
        Page 29
        Page 30
    Chapter 3. Analysis of the major antigenic protein 2 genes from five geographic isolates of cowdria ruminantium
        Page 31
        Page 32
        Page 33
        Page 34
        Page 35
        Page 36
        Page 37
        Page 38
        Page 39
        Page 40
        Page 41
        Page 42
        Page 43
        Page 44
        Page 45
        Page 46
        Page 47
        Page 48
        Page 49
        Page 50
        Page 51
        Page 52
        Page 53
        Page 54
        Page 55
        Page 56
        Page 57
        Page 58
        Page 59
        Page 60
    Chapter 4. Immunoassays using map2 to identify anti-cowdria ruminantium antibodies in the sera of infected animals
        Page 61
        Page 62
        Page 63
        Page 64
        Page 65
        Page 66
        Page 67
        Page 68
        Page 69
        Page 70
        Page 71
        Page 72
        Page 73
        Page 74
        Page 75
        Page 76
        Page 77
        Page 78
        Page 79
        Page 80
        Page 81
    Chapter 5. Analysis of map2 homologs of ehrlichia chaffeensis and ehrlichia canis
        Page 82
        Page 83
        Page 84
        Page 85
        Page 86
        Page 87
        Page 88
        Page 89
        Page 90
        Page 91
        Page 92
        Page 93
        Page 94
        Page 95
        Page 96
        Page 97
        Page 98
        Page 99
        Page 100
        Page 101
        Page 102
        Page 103
        Page 104
        Page 105
        Page 106
        Page 107
        Page 108
        Page 109
        Page 110
        Page 111
        Page 112
        Page 113
        Page 114
        Page 115
        Page 116
        Page 117
        Page 118
    Chapter 6. Conclusions and recommendations
        Page 119
        Page 120
        Page 121
        Page 122
        Page 123
    List of references
        Page 124
        Page 125
        Page 126
        Page 127
        Page 128
        Page 129
        Page 130
        Page 131
        Page 132
        Page 133
        Page 134
        Page 135
        Page 136
        Page 137
        Page 138
        Page 139
        Page 140
        Page 141
    Biographical sketch
        Page 142
        Page 143
        Page 144
        Page 145
Full Text








MAJOR ANTIGENIC PROTEIN 2 OF COWDRIA RUMINANTIUM:
POTENTIAL VALUE FOR SEROLOGICAL DIAGNOSIS
















By

MICHAEL V. BOWIE
















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1997













IN MEMORY OF
Lewis R. Harris, Sr. (great-grandfather) Sidney Butler (uncle) R. Andy Norval (mentor and friend) Ronald Thornhill (brother in Omega) Andre Jervis (brother in Omega) Darrell Turner (roommate/brother in Omega)
Robert Johnson (roommate/friend)

MEN VMO HAVE GIVEN ME LIFE'S GREATEST GIFT "FRIENDSHIP"


First and foremost, Thank you Lord for all that You have given me, no one could ask for more.

To my mom, sister Karen, and brother Gerald.
Times have been hard and you stood by me.
Thanks for your support and love.

To my DAD Jay,
Continue to be an example for all men.
I am just as proud of you as you are of me.
Thanks for being a part of my life.
I love you.

To my fraternity brothers, who gave day to day guidance.
You knew when I needed it. "Friendship Is Essential to the Sour'

To my many friends 6611111anks"





"Life for me ain't been no crystal staircase"- Langston Hughes















ACKNOWLEDGMENTS



I would like to express my gratitude to my advisor and committee chairman Dr. Anthony Barbet, who gave many valuable suggestions throughout this work. His time and commitment will always be appreciated. I would also like to thank my committee cochairman Dr. Roman R. Ganta for his many recommendations, especially as they relate to obtaining fragments of the gene for the MAP2 homologs of the Ehrlichia species during Dr. Barbet's sabbatical leave.

I would like to acknowledge all my committee members for their assistance during my pursuit of this degree: Dr. Donald Forrester for his counseling, consultation, and expertise on wildlife diseases; Dr. Mary Brown for assisting with the ELISA studies and providing encouragement; Dr. Ramon Littell for his statistical guidance; and Dr. Kathy Kocan for her heartwater background and participation on my committee (she has help fill a void in my program).

I am greatly appreciative to Dr. Suman Mahan and the Veterinary Research Laboratory staff in Causeway (Zimbabwe) for providing blood samples and the inmunoblot data and for performing the peptide studies. I would like to acknowledge Dr. Michael Burridge for continuously supporting my project, both mentally and financially; Dr. David Allred for his advice; Dr. Jacqueline Dawson for the genomic DNA of Ehrlichia chaffeensis


iii









and Ehrlichia canis; and Dr. Emmanuel Camus for help offered during my collection of ticks from Guadeloupe. I would also like to recognize Linda Greene, Scherwin Henry, and Lucia Dinehart of Hybridoma Laboratory for their assistance in the isolation of monoclonal antibodies.

I am especially grateful to Anna Lundgren, Rene Blentlinger, Paul Meade, Sondra Kamper, John Thobourn, and Bill Whitmire of the Barbet Laboratory for providing assistance; Dr. Trevor Peter, Dr. Sharon Deem, Dr. Marty Ewing, Dr. Susan Oberle, Dr. Nareerat "Pop" Vishenakul, Dr. Jennifer Calder, Mr. Bigboy Simbi, Dr. Rick Alleman, Dr. Teresa Martinez, Mrs. Roberta O'Connor, Ms. Kelly Watts, and Mr. Aceme Nyika (past and present graduate students) for their friendship, ideas, and valuable help; and the Office and Research staff of the Department of Pathobiology, the Ticks and Tick-borne Diseases Program, and the Graduate Research Office, especially Tonya Gibbs, Eunice Mobley, Carlos Sulsona, Suzanne Stroup, Sharon Kitchen, and Sally O'Connell, for offering their expertise in their various areas.

Finally, I am greatly indebted to Annie Moreland, for her assistance and suggestions during my studies, as well as, for her friendship, and Debbie Couch for her guidance and support during my stay at the University of Florida.












iv















TABLE OF CONTENTS

ACKNOWLEDGMENTS............................................mii

LIST OF TABLES ................................................. vii

LIST OF FIGURES ................................................. x

ABBREVIATIONS ................................................ XII

ABSTRACT..................................................... xiii

CHAPTERS

1 INTRODUCTION....................................... I
Background............................................ 3
Justification......................7
Research Objectives ....................................... 7

2 LITERATURE REVIEW.................................. 9
Epizootiology........................................... 9
Biology and Distribution of the Vector ....................9
Parasite-Host Interactions ............................12
Vector-Parasite, Interactions ..........................14
Host-Vector Interactions ............................. 15
Control of Heartwater .................................... 17
Clinical Manifestations ..............................17
Therapy ......................................... 19
Vector Control .................................... 20
Vaccines........................................ 20
Enzootic Stability .................................. 23
Diagnosis of Cowdria ruminantium.......................... 23
The Research Problem .................................... 29

3 ANALYSIS OF THE MAJOR ANTIGENIC PROTEIN 2 GENES
FROM FIVE GEOGRAPIC ISOLATES OF COWDRIA
RUMINANTIUM....................................... 31
Introduction........................................... 31


v









M aterials and M ethods ..................................... 35
Origin of Cowdria ruminantium Isolates .................. 35
Amplification of the map2 Gene of Different Geographic
Isolates ........................................... 35
Cloning and Restriction Enzyme Analysis ................. 36
DNA Sequencing and Sequence Data Analysis ............. 37
Southern Blot Analysis ............................... 39
Results ................................................. 44
Cloning and Restriction Enzyme Analysis of the MAP2
Genes ......................................... 44
Sequence Analysis of MAP2 Genes ...................... 46
D iscussion .............................................. 57

4 IMMUNOASSAYS USING MAP2 TO IDENTIFY ANTI-COWDRIA
RUMINANTIUM ANTIBODIES IN THE SERA OF INFECTED
ANIM ALS .............................................. 61
Introduction ............................................. 61
Materials and Methods ..................................... 64
Cowdria ruminantium recombinant MAP2 Production
and Purification ..................................... 64
A ntisera .......................................... 65
MAP2 Coating Concentration .......................... 65
Indirect ELISA ..................................... 66
Immunization of Mice ................................ 67
Screening for Monoclonal Antibodies .................... 67
Competitive ELISA Development ....................... 68
Percent Inhibition ................................... 68
R esults ................................................. 71
Isolation and Characterization of Recombinant MAP2 ........ 71 Indirect ELISA for Heartwater Diagnosis Using MAP2 ...... 71 Responses by Immunized Mice ......................... 71
Competitive Inhibition ELISA for Heartwater Diagnosis
Using M AP2 ....................................... 72
D iscussion .............................................. 80

5 ANALYSIS OF MAP2 HOMOLOGS OF EHRLICHIA CHAFFEENSIS
AND EHRLICHIA CANIS .................................. 82
Introduction ............................................. 82
M aterials and M ethods ..................................... 85
Immunoblot of C. ruminantium and Ehrlichia canis Antigens .. 85 Origin of Ehrlichia canis and Ehrlichia chaffeensis ......... 85
Amplification of the MAP2 Homologs Genes of Ehrlichia canis
and Ehrlichia chaffeensis ............................. 86


vi









C losing ........................................... 87
DNA Sequencing and Sequence Data Analysis ............. 87
Southern Blot Analysis ............................... 89

R esults ................................................. 95
Immunoblot Demonstrating Antigenic Similarity between Cowdria ruminantium and Ehrlichia canis ................ 95
Cloning and Sequence Analysis of the MAP2 Homologs of Ehrlichia chaffeensis and Ehrlichia canis ................. 95
Sequence Analysis of the MAP2 Analogs ................. 97
D iscussion ............................................. 112

6 CONCLUSIONS AND RECOMMENDATIONS ............... 119

LIST OF REFERENCES ............................................. 124

BIOGRAPHICAL SKETCH ........................................... 142






























vii















LIST OF TABLES

Table Page
1. Primers Designed Based on the Reported Sequence of pF5.2 ........... 41

2. Primer Combinations and Projected Product Size .................... 43

3. Comparison of the MAP2 Coding Sequences at the Nucleotide Level ..... 52

4. MAP2 Amino Acid Sequence Changes Between Different Isolates of
Cowdria ruminantium ....................................... 54

5. Percent Identity Between the MAP2 Coding Sequences of Cowdria
ruminantium Isolates ........................................ 55

6. Percent Identity Between MAP2 Amino Acid Sequences of Cowdria
ruminantium Isolates ........................................ 56

7. Prediction of Antigenic Determinants of C ruminantium Isolates ........ 59

8. Position and Sequence of Flexible Segments ........................ 60

9. Ovine and Bovine Sera Tested ................................. 69

10. Primers Designed or Selected for Amplification of the Genes Encoding
the MAP2 Homologs of Ehrlichia canis and Ehrlichia chaffeensis ....... 91 11. Primer Combinations and Optimal Temperatures for Amplification of the
Genes Encoding the MAP2 Homologs of Ehrlichia canis and Ehrlichia
chaffeensis ................................................ 94

12. Percent Identity of Nucleic Acid Sequences of MAP2 Homologs of
Cowdria ruminantium, Ehrlichia canis, and Ehrlichia chaffeensis ...... 110 13. Percent (%) Identity of Amino Acid Sequences of MAP2 Homologs of
Cowdria ruminantium, Ehrlichia canis and Ehrlichia chaffeensis ...... .111




vM










Table Pae
14. Percent (%) Identity of map2 Nucleic Acid Sequences/1I6S rDNA Sequences.............................................. 117

15. Prediction of Antigenic Determinants ...........................118














































ix















LIST OF FIGURES

Figure Page
1. DNA Sequence of pF5.2 Plasmid Insert DNA ...................... 42

2. Analysis of PCR Products of the Highway Isolate of Cowdria ruminantium
Using Various Primer Combinations .............................. 46

3. Analysis of PCR Products of the Five Isolates of Cowdria ruminantium
Using Primers AB249 and AB251 ............................... 47

4. Southern Blot Analysis of PCR Products of the Five Isolates of
Cowdria ruminantium Using Primers AB249 and AB251 .............. 48

5. Restriction Maps of the map2 Genes from Cowdria ruminantium Isolates 49

6. Comparison of the MAP2 Coding Sequences at the Nucleotide Level ..... 50

7. Comparison of the MAP2 Coding Sequences at the Amino Acid Level .... 53

8. Major Antigenic Protein 2 ..................................... 73

9. Titration of MAP2 Antigen .................................... 74

10. Indirect ELISA Using Sheep Serum .............................. 75

11. Mouse Anti-MAP2 Antiserum Titer .............................. 76

12. 1 D5 Hybridoma Supernatant Versus Sheep Sera (1:50) ............... 77

13. 4D5 Hybridoma Supernatant Versus Sheep Sera (1:50) ............... 78

14. Monoclonal Antibodies Versus Sheep Sera ......................... 79

15. Gap Program Using the Major Surface Protein 5 of Anaplasma marginale versus MAP2 of Cowdria ruminantium ................... 92




x















16. Immunoblot Demonstrating Antigenic Similarity Between Cowdria
ruminantium and Ehrlichia canis ................................ 99

17. Analysis of PCR Products of Ehrlichia canis Using Primer
AB282/AB284 ............................................ 100

18. Analysis of PCR Products of Ehrlichia chaffeensis Using Primer
AB282/AB284 ............................................ 101

19. Analysis of PCR Products of Ehrlichia canis and Ehrlichia chaffeensis
Using Various Primer Combinations ............................. 102

20. Southern Blot Analysis of PCR Products of Ehrlichia canis and Ehrlichia
chaffeensis Using Various Primer Combinations .................... 103

21. Analysis of PCR Products of Ehrlichia canis and Ehrlichia chaffeensis
Using Various Combinations .................................. 104

22. Complete Sequence of the MAP2 Homolog of Ehrlichia canis ......... 105

23. Complete Sequence of the MAP2 Homolog of Ehrlichia chaffeensis .... 106

24. Comparison of the Coding Nucleotide Sequences of MAP2 and MAP2
Homologs of Isolates of Cowdria ruminantium and Ehrlichia Species ... 107 25. Comparison of the MAP2 and MAP2-like Coding Sequences at the
Amino Acid Level ......................................... 109

26. DNA Sequence of pF5.2 Plasmid Insert DNA ..................... 116












xi














ABBREVIATIONS

BAE bovine aortic endothelial
cELISA competitive enzyme-linked immunosorbent assay DNA deoxyribonucleic acid
dATP deoxyadenosine triphosphate
dCTP deoxycytidine triphosphate
dGTP deoxyguanosine triphosphate
dNTP deoxynucleotide
dTTP deoxythymidine triphosphate
DTT dithiothreitol
EDTA ethylenediaminetetraacetic acid
ELISA enzyme-linked immunosorbent assay EMVT Institute d'Elevage et de Medecine Veterinaire des Pays Tropicale
GCG Genetics Computer Group
ICBR Interdisciplinary Center for Biotechnology Research
IFA indirect fluorescent antibody assay
IPTG Isopropyl-1-D-thiogalactopyranoside
kDa kilodalton
M molar
MAb monoclonal antibodies
MAP major antigenic protein
map gene encoding major antigenic protein
ml milliliter
mM millimolar
MSP major surface protein
msp gene encoding major surface protein
N Normal
PCR polymerase chain reaction
rMAP2 recombinant major antigenic protein 2
SADC Southern African Development Community
SDS sodium dodecyl sulfate
USAID United States Agency for International Development
USDA United States Department of Agriculture
USFWS United States Fish and Wildlife Service
UTP uridine triphosphate
gl microliter
AM micromolar


xii















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy A MAJOR ANTIGENIC PROTEIN 2 OF COWDRIA RUMINANTIUM: POTENTIAL VALUE FOR SEROLOGICAL DIAGNOSIS By

Michael V. Bowie

December, 1997

Chairman: Dr. Anthony F. Barbet Cochairman: Dr. G. Roman Reddy Major Department: Veterinary Medicine

The overall objective of this dissertation was to determine the applicability of major antigenic protein 2 (MAP2) of Cowdria ruminantium for the diagnosis of heartwater. C. ruminantium is the etiologic agent of heartwater, a rickettsial disease that causes mortalities (up to 90%) in populations of susceptible ruminants in sub-Saharan Africa and in the Caribbean. In order to determine the heartwater status of animal populations, a rapid, sensitive, and specific diagnostic test must be developed. Two major antigenic proteins of C. ruminantium have been examined in heartwater diagnosis. The objectives of this dissertation were (1) to determine if MAP2 was conserved in five geographically different isolates of C. ruminantium, (2) to determine if MAP2 reacted with animal sera obtained from areas free of both the vector and the disease (false positive sera), and (3) to determine



xiii









whether MAP2 homologs occur in Ehrlichia chaffeensis, the organism responsible for human monocytic ehrlichiosis, and E. canis, a canine ehrlichiosis agent, both of which have been reported to be closely related to C ruminantium by rRNA studies.

The conservation of MAP2 among isolates of C ruminantium would be essential for developing a specific diagnostic test for heartwater. Primers were developed based on the reported sequence of the Crystal Springs isolate of C ruminantium. Target DNA of five isolates ofC. ruminantium was amplified, cloned and sequenced. All map2 genes were 627 bases and identical with the exception of ten nucleic acid substitutions between different isolates. These substitutions translated into only three amino acid changes indicating that MAP2 was conserved and may be a candidate for the development of serodiagnostic tests.

Recombinant MAP2 was isolated and reacted in an indirect ELISA with sera from heartwater-infected sheep and with false positive sera. In addition, monoclonal antibodies (MAbs), which reacted in an indirect ELISA with MAP2, were tested in a competitive ELISA (cELISA). Positive, negative, and false positive sera were used as the competing antibody against the MAbs. Both positive and false positive sera inhibited binding of all MAbs, therefore recombinant MAP2 was not useful in a cELISA using these four MAbs due to cross-reactivity.

A homolog to MAP2 has been reported in Anaplasma marginale (major surface protein 5; MSP5) which has been used for serodiagnosis ofbovine anaplasmosis. In addition, antisera against Ehrlichia canis, causative agent of canine ehrlichiosis, recognized MAP2 in immunoblots suggesting the presence of a MAP2 homolog. Genes representing the MAP2 homologs from E. canis and E. chaffeensis were amplified, cloned, and sequenced. MAP2 xiv









homologs ofE. chaffeensis and E. canis were 83.41% and 84.39%/ similar, respectively, with C ruminantium at the amino acid level. The initiator methionine ofthe homologs ofMAP2 were four amino acids downstream from the reported start codon of MAP2 of C rumninantium. Further examination of the MAP2 homologs in C ruminantium and Ehrlichiae allow for development of a specific test for serodiagnosis of heartwater.





































xv















CHAPTER 1
INTRODUCTION


Cowdriosis is one of the most economically important tick-borne diseases affecting wild and domestic ruminants in Africa (Uilenberg, 1983). This disease, transmitted by several ticks of the genus Amblyomma, is caused by the rickettsia Cowdria ruminantium (Cowdry, 1925a; Cowdry, 1925b) and is commonly referred to as heartwater disease. In addition to sub-Saharan Africa and Africa's neighboring islands, heartwater has been identified on several Caribbean islands (Perreau et al., 1980); thus, posing a threat of introduction into the Americas.

Heartwater infection causes high mortality and morbidity in susceptible populations of cattle, sheep, and goats (Provost and Bezuidenhout, 1987). Animals which recover from heartwater infection become asymptomatic carriers and may serve as reservoirs for the disease (Andrew and Norval, 1989). In order to determine populations of animals infected with C. ruminantium, a rapid, sensitive, and specific diagnostic test must be developed.

Isolation of genes encoding immunoreactive proteins of C. ruminantium enabled development into recombinant forms that may be used as antigens in diagnostic tests and vaccines. However, the uniqueness of the protein must be determined since many rickettsia possess common, surface proteins that function in recognition, adherence, and invasion. In 1991, a 32 kilodalton (kDa) protein, recently referred to as major antigenic protein 1 (MAP 1),



I









2

was isolated from C. ruminantium-infected endothelial cell cultures and used in a competitive enzyme-linked immunosorbent assay (cELISA) (Jongejan and Thielemans, 1989; Jongejan et al., 1991). However, MAP 1 reacted with sera from animals from a heartwater-free region of Zimbabwe in Western blots (Mahan et al., 1993). After several tests to determine whether these regions were truly free of the vector and the agent, it was found that a cross-reacting organism occurred in this region. Antibodies to this agent bound to MAPI of C. ruminantium and caused false positive reactions in various tests (e.g. indirect fluorescent antibody tests, ELISAs, direct fluorescent antibody tests, and complement fixation) that used either MAP I or whole organisms as antigen. The encoding gene of a second major antigenic protein with a molecular weight of 21 kDa, MAP2, was isolated, cloned and expressed in Escherichia coli (Mahan et al., 1994). The resulting recombinant MAP2 was shown to react with sera from C. ruminantium-infected animals (Mahan et al., 1994). The objective of this study was to examine whether MAP2 can be used as antigen in a sensitive and specific serodiagnostic test for heartwater.









3

Background

The Family Rickettsiaceae comprises three tribes Ehrlichieae, Rickettsieae, and Wolbachieae. Ehrlichia, Neorickettsia, and Cowdria are the three genera in the tribe Ehrlichieae, which contain the obligate intracellular bacterial parasites with a tropism for leukocytes and endothelial cells (Rikihisa, 1991). Members of the tribe are tiny Gramnegative cocci and are found in membrane-lined vacuoles within the cytoplasm of infected eukaryotic host cells. Originally Cowdria was classified in the tribe Chlamydieae, Family Phagosomaphilaceae (Scott, 1987). However, phylogenetic studies demonstrated clearly that Cowdria was different from the Chlamydieae (Dame et al., 1992; Van Vliet et al., 1992).

Cowdriosis was originally reported in South Africa in 1838 by Voortrekker pioneer Louis Trichardt who described this disease (nintas) as fatal to sheep following massive tick infestation with ticks (Provost and Bezuidenhout, 1987). The distribution of C ruminantium was similar to that of its vectors of the genus Amblyomma and has been identified in SubSaharan Africa and on several surrounding islands (Madagascar, La Reunion, Mauritius, the Comoros, Zanzibar, and Sio Tomd) (Walker and Olwage, 1987; Flach et al., 1990; Uilenberg, 1983). In addition, the organism has been isolated from animals on several islands in the Caribbean region where Amblyomma variegatum has become established (Perreau et al., 1980; Burridge, 1985).

Heartwater was believed to have become established on the island of Guadeloupe in the early 1800s during importation of cattle from Senegal (Barr6 et al., 1987). The tick has now been identified on Antigua, Martinique, Marie-Galante, Nevis, St. Martin, St. Lucia, St. Croix, and Puerto Rico 03(Burridge et al., 1984). The impact of heartwater on populations of









4

animals in the Caribbean coupled with the threat of the disease to the Americas led to development of an eradication program throughout the region.

Although eradication ofA. variegatum was accomplished on many islands, prevention of re-infestations has been extremely difficult. After two previous eradications (1970, 1987) on the U.S. Virgin Island St. Croix in 1993, a tick was found on a stray female Senepol calf. Approximately one month later, cattle were infested with engorged females. Fortunately, heartwater has not been observed. As a result of these infestations, the United States Department of Agriculture (USDA) and the St. Croix Department of Agriculture have once again eradicated the tick from this island (unpublished information).

Important factors contributing to the spread of C. ruminantium on Guadeloupe include (1) a highly virulent isolate, Gardel; (2) a resistant bovine population that is capable of maintaining the organism with little or no signs of infection; and (3) an optimal environment for the vector (Camus and Barre, 1987). Initially, movement of domestic animals between islands (livestock and dogs) may have played a role in the dissemination of A. variegatum (Camus and Barre, 1990). However, the introduction of ticks to various islands has continued despite development of regulations preventing the movement of animals between islands (Drummond and Butcher, 1988). The cattle egret (Bulbulcus ibis) may be a new source of tick dispersal. Egrets have been shown to migrate between islands and carry instars ofA. variegatum (Uilenberg, 1990). Egret migration poses a problem to eradication programs because of the inability to destroy ticks associated with this bird. The seriousness of the problem has been reported recently by the University of Georgia, the USDA, the United States Fish and Wildlife Service (USFWS), and the Institute dFElevage et de Mddecine









5

V6t6rinaire des Pays Tropicale (EMVT). When they examined cattle egret movement between islands using colored tags (Corn et al., 1993), 30% of the marked birds migrated between islands, including the identification of one bird from Antigua on Long Key, Florida.

Inadequate diagnostic tests may allow for importation ofheartwater-infected animals into heartwater-frees areas. Heartwater has been identified in several species of buffalo and antelopes (Uilenberg, 1983; Okoh et al., 1987), including black wildebeest Connochaetes gnou, blesbuck Damaliscus dorcas, springbuck Antidorcas marsupialis, eland Taurotragus oryx, bushbuck Tragelaphus scriptus, sitatunga Tragelaphus spekei, blackbuck Antilope cervicapra, and giraffe Giraffa camelopardalis. Andrew and Norval (1989) reported that African buffalo (Syncerus caffer) became carriers of heartwater after recovery from the disease. The status of infection in wild animals is important to determine because they may act as carriers or reservoirs of the agent and may result in the introduction of heartwater into the United States.

The discovery of C ruminantium-infected non-ruminants, such as rodents, guinea fowl, and leopard tortoises (Bezuidenhout and Olivier, 1985) was important in understanding transmission ofheartwater. Instars ofA. hebraeum and A. marmoreum are commonly found on goats, tortoises, and guinea fowl and may effect exchange and maintenance of C ruminantium between these vectors and their hosts (Dower et al., 1988). Cowdriosis is a major disease of livestock with high morbidity and mortality for populations of ruminants originating from heartwater-free areas and for populations of small ruminants in endemic areas (Uilenberg, 1983). Acute cowdriosis results in mortalities of 20% to 90% in susceptible livestock populations (Uilenberg, 1983). Its common name "heartwater" was









6

derived from one of the prominent lesions, hydropericardium, observed in animals that have died of this disease (Henning, 1957; Prozesky, 1987). Other lesions include ascites, hydrothorax, mediastinal edema and edema of the lungs (Uilenberg, 1983). Subendocardial, submucosal and subserosal hemorrhages are usually seen (Mare, 1984). Degeneration of the myocardium and liver parenchyma, splenomegaly, edema of the lymph nodes, enteritis and catarrhal and hemorrhagic abomasitis are all encountered commonly (Alexander, 1931; Mare, 1984). Brain congestion occurs, but brain lesions are remarkably few when one considers the severity of the nervous symptoms observed in this disease (Pienaar et al., 1966). Microscopically, colonies of the organism are observed in capillary endothelial cells of different tissues including the cerebral cortex and renal glomeruli (Cowdry, 1926). These macroscopic and microscopic lesions have been observed also in white-tailed deer experimentally infected with C ruminantium (Dardiri et al., 1987).









7

Justification

The presence of the etiological agent and vector in the Caribbean islands poses a threat of introduction of heartwater into the Americas. Fundamental to the prevention of the spread of the disease is development of a diagnostic test that could be used to screen imported animals from Africa and provide continuous surveillance of animals from the Caribbean. Existing diagnostic methods using whole organisms, MAPI, or genes lack specificity (IFAs and cELISAs) or sensitivity (DNA probes) or require equipment unavailable to most areas affected by the disease (PCR). The development of a specific and sensitive diagnostic test may be dependent upon the development and purification of recombinant major antigenic protein 2 (rMAP2) of C. ruminantium. This protein has been used as antigen in an indirect ELISA and a competitive ELISA, both applicable tests when dealing with a number of samples from different hosts. In this study, examination of the map2 gene at the molecular level was accomplished to determine the uniqueness of the protein in comparison to homologous proteins in Ehrlichia spp.



Research Objectives

The overall goal of this dissertation was to determine the usefulness of MAP2 in heartwater diagnosis. The specific aims to achieve these goals were:

[1.] To determine the conservation of the gene encoding MAP2 of C.

ruminantium among several geographic isolates (by the amplification, cloning, mapping, and sequencing of the map2 gene fragment of different isolates of

C. ruminantium);














8

[2.] To examine the sensitivity and specificity of MAP2-based serological assays; [3.] To evaluate the MAP2 homologs of two closely related Ehrlichia species, E.

canis and E. chaffeensis (by the amplification, cloning, mapping and sequencing of map2-like DNA encoding the homologous protein(s) in E.

chaffeensis and E. canis); and

[4.] To compare the sequences obtained from the C ruminantium isolates with

those obtained from E. chaffeensis and E. canis and identify unique sequences

and antigenic regions of MAP2 of C ruminantium.














CHAPTER 2

LITERATURE REVIEW

Epizootiology

Heartwater is distributed throughout sub-Saharan Africa, Africa's surrounding islands and in some Caribbean islands (Uilenberg, 1983). The presence of C. ruminantium follows the presence of tick vectors of the genus Amblyomma; thus, suitable environments and hosts for vectors are adequate for maintenance and transmission of the organism. The epizootiology ofcowdriosis is primarily affected by the biology and distribution of the vector, and by the parasite-host, vector-host and parasite-vector interactions.



Biology and Distribution of the Vector

In 1925(b), E. V. Cowdry ofthe Rockefeller Institute for Medical Research elucidated the mode of transmission of C. ruminantium byA. hebraeum, a three-host tick of the genus Amblyomma (Ixodidae, Ixodideae, Acarina). Presently, thirteen species ofAmblyomma have been demonstrated to be vectors or potential vectors of the organism. Many of these species occur in sub-Saharan Africa and Africa's surrounding islands (Perreau et al., 1980). However, heartwater is well documented in the Caribbean on the islands of Antigua, Guadeloupe and Marie Galante (Barre et al., 1987), where A. variegatum has been recognized as a vector for many years. It is suspected that this tick was introduced with a shipment of cattle from Senegal in the 1830s (Curasson, 1943); however, a separate


9









10

introduction ofA. variegatum onto St. Lucia may have occurred (Estrada-Pena et al., 1994). The basis for this theory is significant variations between two populations ofA. variegatum from Guadeloupe and St. Lucia by analysis of cuticular hydrocarbon. In addition, based on the analysis of mapl genes of C ruminantium isolates from Guadeloupe and Antigua and their relation to African isolates, Reddy et al. (1996) have suggested that two separate introductions of C ruminantium into the Caribbean took place.

Ten African species of Amblyomma are vectors for C. ruminantium: A. variegatum, A. hebraeum, A. lepidum, A. cohaerens, A. astrion, A. pomposum, A. marmoreum, A. sparsum, A. tholloni, and A. gemma (Uilenberg, 1983). The tropical bont tick, A. variegatum, is distributed throughout sub-Saharan Africa extending outside of the continent eastward to the Yemen Arab Republic and to the islands of Madagascar, R6union, Mauritius, westward to Cape Verde islands, and to some of the Caribbean islands (White, 1983). Amblyomma hebraeum, the South African bont tick, is distributed throughout most of southern Africa and has a higher susceptibility to infection with geographically different C ruminantium isolates than A. variegatum (Walker and Olwage, 1987; Mahan et al., 1995). Amblyomma gemma and A. lepidum have been important in outbreaks of heartwater in Ethiopia, Somalia, Kenya and Tanzania, and the Sudan, respectively (Yeoman and Walker, 1967; Walker and Olwage, 1987). Other reported natural vectors include A. astrion on Sao Tome and Principe (Uilenberg, 1982) and A. pomposum in Angola (Neitz, 1947). All other species are experimental vectors (Walker and Olwage, 1987).

Three species of Amblyomma (A. maculatum, A. dissimile, and A. cajennense) have been shown to be capable of transmitting C ruminantium in the United States (Uilenberg,









11

1982, 1983; Jongejan, 1992). Common on livestock and white-tailed deer Odocoileus virginianis, A. cajennense occurs in southern Texas and A. maculatum (the Gulf Coast tick) in eastern, southern and western United States (Bishopp and Trembley, 1945; Clifford et al., 1961; Cooney and Burgorfer, 1974; Samuel and Trainer, 1970; Strickland et al., 1981; Durden et al., 1991). Experiments with A. maculatum were performed to demonstrate transstadial transmission from larva to nymph to adult. Amblyomma maculatum was determined to be as good a vector for C. ruminantium as A. hebraeum (Uilenberg, 1982). Amblyomma dissimile, the American reptile tick, generally feeds on reptiles and amphibians; thus, its potential role in the maintenance of C. ruminantium in reptile populations may be significant (Jongejan, 1992). All three species of ticks may be important in the spread and maintenance of the disease if transported either via infected animals or infected ticks onto the Americas. A. americanum, the Lone Star Tick, which is located throughout the southeastern and south-central region of the U.S. and is a vector for the agents of Lyme borreliosis and human monocytic ehrlichiosis, has been demonstrated to be infected by C. ruminantium after feeding on infected animals; however, no transmission has been observed when these ticks were fed on susceptible hosts (Mahan, unpublished data).

The presence of potential American vectors of C. ruminantium and experimental studies showing the susceptibility of white-tailed deer to C. ruminantium and its disease (Dardiri et al., 1987) support the need for a reliable diagnostic test. When wildlife from heartwater-endemic countries are relocated in regions (i.e. southeastern U.S.) where both potential vectors and susceptible wildlife exist, outbreaks of heartwater may possibly occur,









12

in addition, surviving animals could maintain and transmit the disease throughout the American continent.

The life cycles ofA. hebraeum and A. variegatum may take from 5 months to 3 years to complete depending on the environment (habitat and climate) (Petney et al., 1987). Since a tick may pick up the infection as a larva or nymph, and transmit it as a nymph or adult, the infection can persist in the tick for a very long time. Since these ticks are multi-host, they can feed on a wide variety of livestock, wild ungulates, ground birds, small mammals, reptiles and amphibians, thus making control strategies difficult.

Transmission ofC. ruminantium is primarily transstadial; however, male ticks transmit intrastadially as well (Andrew and Norval, 1989). Transstadial transmission can be complete (i.e. from larva to nymph, from nymph to adult, or from larva through nymph to adult) or incomplete (from larva to nymph or from nymph to adult) (Bezuidenhout, 1987). Transovarial transmission of organisms from infected female ticks to their offspring is rare (Bezuidenhout and Jacobz, 1986); thus, it does not play an important role in the transmission cycle.



Parasite-Host Interactions

Ticks infected with C. ruminantium feed on a variety of host species including domestic and wild ruminants and release organisms during ingestion. C. ruminantium travels through the blood as single bodies or as very small clumps (Cowdry, 1926). The organisms then enter vascular endothelial cells, neutrophils, macrophages and reticuloendothelial cells (Prozesky and Du Plessis, 1987) through a process resembling phagocytosis and proliferate









13

primarily by binary fission (Pienaar, 1970; Prozesky et al., 1986). Several forms of C. ruminantium occur including electron-dense (elementary), intermediate and reticulate bodies; however, usually only organisms of the same form are found in a particular vacuole ofthe cell (Prozesky, 1987). The role of the bodies is unclear since it is difficult to separate them from their clusters. However, reticulated bodies are hypothesized to be a vegetative stage of the organism (Prozesky and Du Plessis, 1987). Electron-dense bodies increase in size and undergo division to form fragmented dense bodies. These subdivide and become organized to give rise to mature organisms.

Each organism is surrounded by a double membrane and a capsule has been reported around a few organisms in vitro (Prozesky, 1987). C. ruminantium released from reticuloendothelial cells subsequently penetrates endothelial cells where further multiplication occurs (Prozesky and Du Plessis, 1987).

Release of the organisms from the endothelial cell and host immune responses cause the pathogenicity of the disease. These responses differ significantly depending on the isolate of C. ruminantium (Du Plessis et al., 1989). Du Plessis et al. (1987b) reported that a hypersensitivity-type reaction may be the basis for the pathogenesis of heartwater, especially since only mild cytopathic changes are observed in parasitized cells (Prozesky, 1987). This may explain why macroscopic lesions include effusion from body cavities and edema of the lungs and lymph nodes; however, further studies on pathogenesis are needed.

Because mice can be infected with C. ruminantium, certain murine strains (Balb/C, CBA/CA, C57/BL6, DBA/2, CD1, C3H/HE) have been used to study the pathogenesis. Gross and microscopical lesions in mice closely resemble the lesions described in cattle, sheep,









14

and goats except there is a high concentration of organisms present in alveolar endothelial cells (Prozesky and Du Plessis, 1985).

Ilemobade and Blotkamp (1978) studied goats to outline the clinical pathological features. The following was observed:

a significant drop in hemoglobin values and marked leukopenia caused by lymphopenia and neutropenia and a fall in total serum protein during the course of the disease. A significant increase in a-globulins and an apparent decrease in y-globulins also occurred. Marked depletion of lymphocytes in the follicles of spleen and lymph nodes was observed in histological sections. A dramatic rise in blood levels of glucose, pyruvate, and lactate, and a drop in blood pH occurred terminally and appeared to contribute to the fatal outcome of the
disease (p.43).


Interpretation of these results suggests the presence of other chemotactic, hemopoetic, and immunological factors possibly influenced by cells infected by C. ruminantium.



Vector-Parasite Interactions

After ingestion by ticks in a blood meal, organisms invade gut epithelial cells and multiply; subsequent stages invade and develop in the salivary acini cells (Prozesky and Du Plessis, 1987). Kocan and Bezuidenhout (1987), using electron microscopy, observed colonies in the gut of unfed and feeding ticks. Mallory's phloxine-methylene blue stain differentiates colonies of C. ruminantium in the midgut epithelial cells of nymphal A. hebraeum that had been infected as larvae (Yunker et al., 1987). Nymphal ticks which had only colonies in the gut, after four days of feeding, had colonies also in their salivary gland acini (Kocan et al., 1987), which supports the theory that transmission stages appear to be coordinated with the feeding cycle of the ticks (Prozesky and Du Plessis, 1987).









15

Many studies have involved examination of the organism in the vector. Besides the gut and salivary glands, colonies have been demonstrated microscopically in heniocytes and malpighian tubules of infected Amblyomma ticks (Kocan and Bezuidenhout, 1987; Kocan et al., 1987; Viljoen et al., 1988). As in the host, the electron-dense and reticulated forms are observed in the gut; in the salivary glands, most are in the reticulated form, which is believed to be the infective form of the organism. The membrane-bound reticulated colonies in the salivary glands contain pleomorphic organisms which actively divide by binary fission; i.e., a developmental cycle for C. ruminantium occurs in the invertebrate host (Kocan et al., 1987; Kocan and Bezuidenhout, 1987). In recently fed ticks, many of the colonies have large, electron-dense inclusions that are morphologically similar to deposits of hemoglobin found in the cytoplasm of midgut epithelial cells (Kocan et al., 1987).



Host-Vector Interactions

Ticks are the most important ectoparasites of livestock in the tropical and subtropical regions of the world (Uilenberg et al., 1992). They are responsible for the transmission of diseases such as babesiosis, anaplasmosis, theileriosis, and cowdriosis, as well as a significant reduction in live weight gain, milk yield and calf damage to the cattle industry (Zwart and Buys, 1968; Uilenberg et al., 1984, 1992; Norval et al., 1989). Hide and udder damage, an entry region for screw-worm attack, and secondary bacterial infections have been reported (Uilenberg et al., 1992).

Major factors which affect the number of Amblyomma ticks found on hosts include, but are not limited to, host resistance and grooming, human intervention (primarily acaricide









16

usage), and the distinct signaling behavior of the ticks (Matheron et a!., 1991; Yunker et al., 199 1; Norval et a!., 1989a, 1989b).

Most tick-infested cattle mount an immune response to tick antigens such as salivary components (De Haan and Jongejan, 1990). Hypersensitivity reactions at the site of the bite provoke individual or mutual grooming behaviors which can result in ticks either being dislodged or squashed (Norval, 1992). A decrease in the percent of ticks surviving after attachment and a reduction in engorged weight of larvae, nymphs, and females result in either lower survivability and lower capacity at the next feed (larvae and nymphs) or the production and development of fewer viable eggs (Norval, 1978).

Control of heartwater has been by the use of acaricide either by dipping or spraying to control tick numbers. Although acaricides are effective, they are expensive, residuals may contaminate meat and milk, and ticks often become acaricide-resistant. In Swaziland, a small land-locked country in Southern Africa, 40% of the budget for the Ministry of Agriculture went to the tick control program in 1991 (Ranmsay, 1992). From personal observations, many of the acaricides are destructive to the environment resulting in degradation of land and loss of grazing land for animals which the acaricides were developed to protect.

The signaling behavior of members of the genus A mblyomma has been critical for the attraction of the tick to a suitable host. Feeding male ticks are attractive to unfed adult ticks due to the emission of attraction-attachment pheromones (Rechav et al., 1976; 1997). These pheromones allow unfed ticks to discriminate between suitable hosts and potentially unsuitable hosts (Norval et al., 1989).









17

Hosts have included, in addition to exotic and indigenous breeds of cattle, sheep, and goats, several species of indigenous antelope (Kock et al., 1995). These wild species have been implicated in the maintenance and transmission of the organism including the blesbok (Damaliscus albifrons), the black wildebeest (Connochaetes gnu) and the springbok (Antidorcas marsupialis), which have been experimentally shown to be susceptible to the disease (Neitz, 1935; Uilenberg, 1983).



Control of Heartwater

Control of heartwater has been primarily by the use of acaricidal dips and vaccines. However, strategic dipping is being practiced in enzootically stable regions in many countries as a form of control for cowdriosis.



Clinical Manifestations

Cowdriosis can be manifested clinically in four forms--peracute, subacute, mild (subclinical) and acute (Mare, 1984; Van de Pypekamp and Prozesky, 1987). Clinical forms primarily depend on the susceptibility of the host, quantity of organisms during exposure, route of infection, and virulence of the isolate (Alexander, 1931; Neitz, 1968; Uilenberg, 1983). The peracute form, consisting of a febrile response and convulsions followed by sudden death, is observed in susceptible animals introduced into a heartwater enzootic region (Henning, 1956; Van der Merwe, 1979). The subacute form is characterized by pyrexia, respiratory distress, and mild incoordination, with either recovery or death occurring up to two weeks after initial observation (Mare, 1984). The mild or subclinical form is observed









18

primarily in wild ungulates, in young animals with innate resistance, and in reinfected animals and may involve a mild febrile reaction (Mare, 1984; Van De Pypekamp and Prozesky, 1987).

The more common acute form involves a sudden febrile reaction followed by inappetence, depression, listlessness, rapid breathing and nervous signs including chewing movements, blinking, tongue protrusion and circling with high stepping gaits. While many of the early signs continue to persist, muscle twitches, galloping, opisthotonos, hyperesthesia, nystagmus (involuntary oscillations of the eyeballs) and frothing from the mouth are often observed in the terminal stages (Spreull, 1922; Van de Pypekamp and Prozesky, 1987). Finally, the animal becomes recumbent in convulsions (Mare, 1984). The acute form is usually fatal within a week of the onset of signs. Experimentally, febrile reactions are observed between seven and ten days in sheep and ten and 16 days in cattle (Mare, 1984). Under field conditions, susceptible animals can be expected to show signs of the disease 9 to 29 days after introduction into a heartwater-infected area (Alexander, 1931).

Unlike adult cattle, calves under the age of one month, irrespective of the immune status of the dam, have been observed to possess innate immunity (Neitz and Alexander, 1945; Du Plessis and Malan, 1987b; 1988). A longer level of immunity (up to 6 to 9 weeks of age) was suggested for calves from heartwater-immune dams; colostrum-derived C. ruminantium-specific immune factors have been reported as the reason for this protection (Deem et al., 1996a). In addition, Deem et al. (1996b) demonstrated vertical transmission by infected dams to their calves by possible oral uptake of C. ruminantium in colostrum. C. ruminantium has been observed in neutrophils and macrophages (Sahu, 1986; Logan et al., 1987) and may be present in bovine colostrum (Lee et al., 1980). Thus, there is an increased









19

possibility that calves born and raised in enzootic areas are protected via colostrum against C. ruminantium and hence are less likely to demonstrate clinical reactions to the disease.

Animals recovering from disease develop an isolate-specific immunity that protects them from future clinical illness (Jongejan et al., 1993; Audu et al., 1995; Pipano, 1995). Many of those recovered animals remain chronically infected and are considered carriers, without signs of clinical infection or microscopically detectable parasitemias (Barre and Camus, 1987). Andrew and Norval (1989) demonstrated this carrier state in sheep, cattle and African buffalo that had recovered from heartwater and from which the organism was transmitted by nymphs ofA. hebraeum. Carrier animals may be important reservoirs for C. ruminantium.



Therapy

Several therapeutic drugs, including sulfonamides (Neitz, 1940) and tetracyclines (Mare, 1972), are available for the treatment ofcowdriosis. Early treatment with tetracycline has been shown to be very effective in the suppression of clinical disease (Purnell et al., 1989). However, administration of tetracycline before clinical signs may reduce the establishment of immunity. Many studies have been done to test these tetracyclines for shortand long-term efficacy, when administered intravenously, or as slow-releasing doxycycline implants that can be administered subcutaneously (Olivier et al., 1988; Purnell et al., 1989).









20

Vector Control

Control of heartwater by tick eradication has focused on application of acaricides in sprays and dipping tanks. However, acaricide application has often been ineffective because three-host ticks have a high rate of reproduction, acaricide resistance, and various instars feed on a variety of (wild and stray) hosts (Bezuidenhout and Bigalke, 1987; Petney and Horak, 1987).

Control measures using acaricides are often contraindicated because (1) the herd is not immune and hence animals are vulnerable to the disease when tick control breaks down and (2) interruption in acaricide application due to mechanical failure of equipment, foreign exchange restrictions or political instabilities may result in losses due to host susceptibility (Norval, 1979). Intensive tick control is also expensive, causes acaricide residues in meat and milk and results in degradation of land (Norval et al., 1992). Strategic dipping based on fluctuations in the number of vectors during different seasons of the year has been suggested and is practiced in several countries as a means ofcontrol of heartwater (Norval et al., 1992).



Vaccines

In 1931, Alexander developed a live vaccine for cowdriosis using infected blood (inoculum) that was administered intravenously. This method was the primary vaccine used until 1981 when Bezuidenhout introduced the use of homogenized C ruminantium-infected nymphs as inoculum in an attempt to reduce the costs for production of the vaccine. However, both live, virulent vaccines were associated with problems.









21

Techniques used to produce the blood and nymph vaccines were similar. The two techniques differed only in the production of the working antigen and selection and preparation of the appropriate isolate, and production and storage of the isolate antigen (Oberem. and Bezuidenhout, 1987). Vaccination was done using deep-frozen animal blood containing an isolate of live heartwater organisms. Immunization was accomplished by the intravenous inoculation of infected blood into livestock followed by treatment with tetracyclines, by infection and block method in which livestock was inoculated and treated at the same time (Fivaz, 1990). With all of these methods, treated/vaccinated animals must be closely monitored for febrile reactions.

The infection and treatment method (Van der Merwe, 1987) was the method of choice and is described as follows:

The infect and treat method involves the inoculation of animals followed by the daily monitoring of animals for an increase in temperature. At the onset of a febrile reaction, the animal must be treated with tetracycline or its equivalent. Animals are protected from that stock of Cowdria. The danger with this method is that it can only be done on a few animals
because of the daily monitoring of large numbers could result in tedious work (p. 489).


In South Africa, the infection and treatment method is commonly practiced (Bezuidenhout, 1989). The optimal regimen for controlling reactions is to vaccinate the animals in small groups and to record rectal temperatures daily from 7-28 days after vaccination (Bezuidenhout, 1989). Cattle are treated on the first or second day of displaying an elevated temperature (over 39.5 0C). Even under careful supervision, some mortality occurred, occasionally reaching 5% in adult animals (Barnard, 1953; Sutton, 1960). For example, 0.6% of462 C ruminantiurn-immunized febrile-reacting crossbred zebu cattle died due to heartwater while using the infection and treatment method (Lawrence et al., 1995).









22

The infection and block method (Du Plessis and Malan, 1987c) involves simultaneous inoculation of animals followed by treatment with tetracycline. This method may result in mortality due to early febrile reactions or loss of immune protection of animals treated before the onset of disease.

Animals recovering from naturally or artificially-induced disease are rendered solidly immune for a variable period, ranging from 6 to 18 months. Exposure of animals to reinfection during this period of resistance will boost the immune response and periodic reinfection will insure continued immunity (Norval et al., 1990). The actual mechanism of immunity is obscure. Immunoglobulins transferred from heartwater-immune animals to susceptible ones did not protect against clinical heartwater infection (Stewart, 1987). When young animals were inoculated intravenously with heartwater-infected blood (Uilenberg, 1990), mild disease occurred. Upon recovery, these animals were immune to reinfection as long as their immunity was continuously stimulated by natural exposure to the organism (Uilenberg, 1990). Monitoring of older animals or valuable calves was done daily and these animals were treated with tetracycline as soon as they became febrile (Fivaz, 1990).

Inactivated vaccines made from C. ruminantium cultured in vitro (Byrom and Yunker, 1990) were tested successfully against experimental (Martinez et al., 1994; Mahan et al., 1995) and field tick challenge (Mahan, unpublished) but have not been marketed commercially. Cell culture-derived vaccines are likely to be less expensive, safer and simpler to produce and market than live vaccines.









23

Enzootic Stability

Enzootic stability occurs when animals become infected with C. ruminantium and recover without becoming significantly ill, thus developing immunity to the disease (Du Plessis et al., 1992). Enzootic stability with minimal losses is most successfully established when initial infection occurs during the first weeks of life (natural immunity) or by artificial immunization. Although enzootic stability does not decrease incidence of disease, mortality is often greatly reduced (Mare, 1984). In enzootic areas, populations of ticks are maintained by strategic dipping or spraying to insure minimal exposure of immune animals, thus providing reinforcement of immunity.



Diagnosis of Cowdria ruminantium

Tentative field diagnosis of heartwater infection was often by identification of the vector, characteristic signs and lesions, which must then be confirmed by demonstration of the organism (Alexander, 1931). Definitive diagnosis was either by brain biopsy (Purchase, 1945) or serodiagnostic tests utilizing antigen isolated from C. ruminantium-infected cells from infected hosts or vectors, because in vitro cultivation had not been accomplished.

Schreuder (1980) reported a simple technique for the collection of brain samples for the post-mortem diagnosis ofheartwater using a sharp spoon and a knife. "After the head has been removed ... a sample of cortex is collected with the spoon through the foramen occipitale, thus obviating the need for opening the skull itself' (Schreuder, 1980).

Examination of live animals suspected to be infected with the heartwater agent was done using a brain biopsy technique involving the removal of a small sample of the cerebral









24

cortex (Synge, 1978). The organism was then identified by microscopic examination of Giemsa-stained brain smears (Jackson, 1931; Jackson and Neitz, 1932). Clumps of blue to reddish-purple organisms occur in capillary endothelial cells using an oil immersion lens. Organisms were demonstrated also in smears prepared from the intima of large blood vessels or in stained sections of kidney glomeruli and lymph nodes (Cowdry, 1926; Jackson, 1931; Du Plessis, 1970). Animals with mild or atypical infections may remain undiagnosed (McHardy and MacKenzie, 1984). The epizootiological picture of heartwater is unclear because of this variability in clinical manifestations. Presently, the "gold standard" for confirmation of infection is by subinoculation of fresh blood into a susceptible animal with subsequent demonstration of clinical disease (Ilemobade and Blotkamp, 1976).

Serodiagnostic tests were developed using antigen obtained from infected hosts or vectors, including a capillary flocculation test using antigen prepared from the brains of infected animals (Ilemobade and Blotkamp, 1976) and a complement fixation test using infected brain and blood cells as antigen (Musisi and Hussein, 1985).

Isolation of C. ruminantium from either host tissues or ticks was done by percoll density gradient centrifugation, (Neitz et al., 1986a), immunoadsorbent affinity chromatography (Neitz and Vermeulen, 1987), lectin cellular affinity chromatography (Vermeulenet al., 1987), and density gradient centrifugation (Neitz et al., 1987). Baaxdon the isolation of these antigens, a number of serological assays were developed to detect C. ruminantium antibodies in animals (Oberem et al., 1984; Viljoen et al., 1985; Neitz et al., 1986b). In 1986b, Neitz et al. reported a sensitive and reliable ELISA for the detection of antibodies to C. ruminantium in serum by using organisms from nymphs of A. hebraeum









25

partially purified by wheat-germ lectin affinity chromatography. The presence of C. ruminantium in the blood fractions of diseased animals was demonstrated by an ELISA (Viljoen et al., 1987).

In 1985, Bezuidenhout et al. succeeded in cultivating continuous cultures of C. ruminantium in bovine endothelial cells in vitro. The culture-derived organisms were then used for development of several diagnostic tests for heartwater including an indirect fluorescent antibody assay (IFA) for detection of antibodies against the whole organisms and immunoblots for detection of antibodies produced against defined proteins (Jongejan and Thielemans, 1989; Rossouw et al., 1990) and the 32 kD protein-specific cELISA (Jongejan et al., 1991). Cultivation of the organism has made it possible to obtain large quantities of antigenic material for serological tests and immunizations. In addition, genomic DNA could be isolated for use in developing DNA probes and possibly recombinant or molecular vaccines.

With the successful cultivation of organisms came the development of immunoassays for diagnosis of heartwater. Many indirect fluorescent antibody tests using different types of cells (neutrophils, macrophages, and endothelial cells) for cultivation were described. Du Plessis (1987) reported the application of an IFA test using antigen isolated from peritoneal macrophages of mice infected with the Kumm isolate of C. ruminantium in heartwater research. Developers of this test boasted high specificity and sensitivity and possible usefulness in the epizootiology of the disease, determination of the infection rate of vectors, and the evaluation of immunization studies (Du Plessis and Malan, 1987a). Logan et al. (1986, 1987) developed an IFA test using C. ruminantium-infected caprine neutrophilic









26

granulocytes; however, neutrophils are end stage cells and cannot be maintained in culture for more than a few days (Cline, 1975).

Bezuidenhout et al. (1985, 1987) subsequently cultivated several isolates of C ruminantium in endothelial cells that provided an inexpensive source of antigen. Yunker et al. (1988) modified the methods ofBezuidenhout et al. (1985) and thus was able to cultivate 14 isolates of C ruminantium. In addition, they developed an IFA test using cultures of C ruminantium-infected bovine aortic endothelial (BAE) cells as antigens. Using this system, an IFA test using Ball3-, Crystal Springs-, Highway-, Lemco T3- or Palm River-infected BAE cells was developed and used to detect antibodies to C ruminantium in several breeds of cattle experimentally infected with Palm River or Ball3 isolates of C ruminantium. The BAE cells yielded large quantities of antigen and supported the growth of fourteen African and Caribbean isolates of C ruminantium (Semu et al., 1992).

In vitro cultures were used for studies on the antigenic composition of C ruminantium. Proteins were isolated which could be used in the development ofa diagnostic test. In 1989, Jongejan and Thielemans identified a periodate-resistant, proteinase K-sensitive immunodominant antigen of 32,000 daltons (MAPl) and found it to be conserved among both African and Caribbean isolates. A competitive ELISA using MAPI isolated from sonicated endothelial cell cultures for antigen and a monoclonal antibody reacting with this protein (Jongejan et al., 1991). Muller Kobold et al. (1992) reported the distribution of heartwater in the Caribbean based on the detection of antibodies to the conserved MAP 1.

In 1993, it was discovered that false positives occurred in field sera when MAPI of C ruminantium was used in serologic tests (Mahan et al., 1993). In addition, a MAPI









27

homolog was present within the genus Ehrlichia (Jongejan et al., 1993). These scientists disputed earlier results which suggested a wider distribution of C. ruminantium in the Caribbean and questioned the reliability of current serological assays for heartwater. Antibodies in the sera of domestic ruminants that were infected with Ehrlichia bovis and other ehrlichial agents reacted when the Kumm isolate of C. ruminantium was used as antigen in the IFA test and when the Ball3 isolate was used in an ELISA. Both the IFA and cELISA were used in serological surveys, but both tests apparently lacked sensitivity and specificity required for accurate epizootiological surveys.

The ability to detect C. ruminantium is of major importance for epizootiological studies and control strategies. The development of nucleic acid-based diagnostic methods that are specific and sensitive for detection of C. ruminantium in both recently-infected and carrier animals are needed for epizootiology studies. The polymerase chain reaction (PCR), involving the thermal denaturation of DNA, annealing of oligonucleotide primers to target DNA in a sequence-specific manner, and the synthesis of DNA using DNA polymerase, was described (Mullis and Faloona, 1987), which will be valuable to enhance the sensitivity of detection. In 1987, Ambrosio et al. (1987), cloned DNA of C ruminantium isolated from in vitro cultivated organisms. However, they contained a large proportion of host DNA. Wilkins and Ambrosio (1989) reported the isolation of nucleic acid sequences specific for C ruminantium and proposed the development of twelve clones into DNA probes; however, no information is available on these nucleic acid probes (Wilkins and Ambrosio, 1990).

Another probe, pCS20, was developed and used to determine C. ruminantium infectivity in A. variegatum ticks (Waghela et al., 1991), in A. hebraeum (Yunker et al.,









28

1993) and in sheep (Mahan et al., 1992). The addition of the PCR to DNA probe hybridization enhanced the sensitivity of the diagnostic test enabling detection of low quantities of C. ruminantium in ticks that were not detected by DNA probes. PCR was also useful in detection of C ruminantium in desiccated ticks and ticks fixed in 70% ethanol, 10% buffered formalin, or 2% glutaraldehyde (Peter et al., 1995). A second PCR based on the map l sequence was used to identify the presence of C ruminantium in blood and bone marrow samples from healthy, free-ranging Zimbabwean ungulates [tsessebe (Damaliscus lunatus), waterbuck (Kobus ellipsiprymnus), and impala (Aepyceros melampus)]. However, a specific serodiagnostic test may have several advantages over PCR. Although PCR has been useful in detecting ticks infected with C. ruminantium, it has not been as useful as a diagnostic tool for the detection of C ruminantium in host animals. The presence of minimal organisms in the blood of carrier animals often resulted in false negative results using PCR. C ruminantium has a tropism for endothelial cells, where they develop and multiply; thus, minimal organisms are found in the blood of carrier cattle. The average detection rate for a PCR-based assay for the hemoparasite Babesia bovis, which is found in bovine red blood cells of experimentally-infected cattle, ranged from 58 to 70% (Calder et al., 1996). In addition, assays for serodiagnosis of C ruminantium may be able to detect infection in carrier animals for long periods following acute infection. Antibodies to Anaplasma marginale, a rickettsia closely related to C ruminantium, were detectable for a 5-year evaluation period, despite the occurrence of a cyclic rickettsemia in the long-term carrier cattle (McGuire et al., 1991). Immunoassays developed for detection of animals infected previously with C ruminantium would be important for regional epizootiological studies. Finally, immunoassays are simpler









29

to perform than nucleic acid probe reactions and are less likely to be contaminated (false positive) than PCR assays.

The gene encoding an immunoreactive 21 kD protein (MAP2) ofC. ruminantium was isolated, cloned and expressed in E. coli (Mahan et al., 1994). Recombinant MAP2 was shown to react with sera from C ruminantium-infected sheep, goats, and cattle, suggesting that this protein may be useful as a diagnostic antigen (Mahan et al., 1994). In this dissertation, the use of native MAP2 or recombinant or synthetic MAP2 homologs for diagnosis was investigated. Further evaluation ofthe protein as an antigen in a serodiagnostic assay was warranted because MAP2 was conserved among several isolates of C ruminantium. In addition, this protein is a homolog of the major surface protein 5 (MSP5) of the rickettsia Anaplasma marginale (Visser et al., 1992). A competitive ELISA using infection antisera to inhibit the reaction between recombinant MSP5 and corresponding monoclonal antibody proved to be a sensitive serodiagnostic test for cattle infected with A. marginale for up to six years post-infection (Knowles et al., 1996).



The Research Problem

The development of a serodiagnostic test for C ruminantium is essential for development ofepizootiological studies and control strategies. Presently, serodiagnostic tests have been unreliable because of the occurrence of serologic cross-reactions. Presently, molecular diagnostic assays based on PCR and DNA probes for C ruminantium lack sensitivity, especially in carrier animals. Identification ofC. ruminantium-unique epitopes on immunodominant proteins may be required for development of a serodiagnostic test for









30

heartwater.

In this study, a gene encoding MAP2 of C. ruminantium was sequenced to determine the extent of genomic conservation among five geographic isolates of C. ruminantium from Zimbabwe and Sudan in Africa and Antigua in the French West Indies. The sensitivity and specificity ofMAP2-based diagnostic assays were investigated using indirect and competitive ELISAs. Finally, the sequences of MAP2 homologs in the related rickettsiae, Ehrlichia chaffeensis and E. canis, were determined to provide a basis for developing specific serologic assays using defined recombinant or synthetic fragments of MAP2.














CHAPTER 3
ANALYSIS OF THE MAJOR ANTIGENIC PROTEIN 2 GENES FROM FIVE
GEOGRAPHIC ISOLATES OF COWDRIA RUMINANTIUM


Introduction

Cowdria ruminantium causes the rickettsial disease, cowdriosis or heartwater, which has been identified in sub-Saharan Africa and in the Caribbean (Uilenberg, 1983). The presence of C. ruminantium in the Caribbean may be due to: (1) the accidental importation in the early 1800s of Amblyomma variegatum and thus, the organism, on Senegalese zebu cattle to Guadeloupe (Curasson, 1943; Perreau et al., 1980) and (2) the movement of birds, namely cattle egrets (Bubulcis ibis) harboring instars of A. variegatum, from the African continent either by migration or by hurricanes (Palmer, 1962; Albaine Pons, 1980). Regardless of how the organism became established in the Caribbean, suitable environmental conditions (Sutherst and Maywald, 1985) led to the spread of the vector and ultimately, the disease. Unfortunately, diagnostic tests for heartwater were found to be unreliable due to poor specificity because of cross-reacting agents (possibly Ehrlichia spp.) in heartwater-free and heartwater endemic areas (Du Plessis et al., 1987a; Mahan et al., 1993; Du Plessis et al., 1994). Thus, a diagnostic test specific for C ruminantium is required for epizootiological studies.

Seven major immunogenic proteins reacted in Western blots with antiserum from a hyperimmune sheep infected with the Crystal Springs isolate of C ruminantium. Three of 31









32

these proteins were cloned (21, 32, 58 kDas) (van Vliet et al., 1994; Mahan et al., 1994; Lally et al., 1995). The 32 kDa protein, termed major antigenic protein 1 or MAPI was found to be antigenically conserved in nine isolates of C. ruminantium from Africa and the Caribbean (Jongejan and Thielemans, 1989) and was used in a cELISA using monoclonal antibodies (Jongejan et al., 1991). However, further studies revealed that IAP1 also reacts with sera from cattle, sheep, and goats from heartwater-free areas of Zimbabwe (Mahan et al., 1993) and with several members of the genus Ehrlichia (Jongejan et al., 1993). Subsequently, the presence of genes coding homologous MAP 1 from two Ehrlichia species, E. canis and E. chaffeensis, has been analyzed (Reddy, submitted for publication). Importantly, variability in nucleotide sequences of MAP1 among four African and two Caribbean isolates ranged between 0.6 to 14.0% (Reddy et al., 1996). These nucleic acid differences translated to amino acid substitutions, deletions, or insertions at three hypervariable regions of the gene (Reddy et al., 1996). Genes encoding the MAPI homologs in Ehrlichia species also had hypervariable sequences at the same regions of the gene as C. ruminantium. Demonstration of both homology in MAP 1 coding sequence between C. ruminantium and Ehrlichia spp. and divergence in hypervariable region between isolates suggest that MAPI may not be useful as an antigen for serodiagnosis of heartwater. The second protein, 58 kDa, was found to be a heat shock protein (Lally et al., 1995) which was unlikely to be useful for serodiagnosis because of sequence conservation of this protein with many bacteria.

The third protein, referred to as MAP2, was obtained from a gene which was cloned and sequenced by Mahan et al. (1994). The function of MAP2 is unknown; however, it was found to be a surface protein (Mahan, unpublished report) and may play a role in adhesion,









33

invasion, or pathogenicity of C. ruminantium. A recombinant form of MAP2 was prepared and was recognized by all sera tested from heartwater infected animals (Mahan et al., 1994), suggesting that MAP2 may be usefi as an antigen in a serodiagnostic test.

In order to develop a specific diagnostic test using MAP2, the protein must be examined for variability between different geographic isolates. Molecular mapping of the map2 gene was accomplished by cloning, restriction mapping and sequencing to identify variations among MAP2 in all isolates examined. In addition to determining whether this protein is either highly conserved or varied geographically, examination at the molecular level may be useful in determining the direction of the spread of disease, i.e. evolutionary movement ofthe organism. This theory was postulated by Reddy et al.(1996) who suggested that the Antigua isolate (Antigua) and the Gardel isolate (Guadeloupe) originated from separate introductions of the tick to the Caribbean. This theory is supported by genetic variations discovered between the cuticular hydrocarbon compositions ofA. variegatum from St. Lucia and Guadeloupe (Estrada-Pena et al., 1994).

Cowdria ruminantium was isolated from animals and vectors from over twenty regions in sub-Saharan Africa, its neighboring islands, and the Caribbean. These isolates (material which has not been strictly defined after isolation by cloning [Wassink et al., 1990]), were shown to vary in their pathogenicity to livestock (Roussouw et al., 1990; Du Plessis et al., 1992) and mice (Wassink et al., 1986; Du Plessis et al., 1989; Wassink et al., 1990), and in their cross-protection against each other (Jongejan et al., 1988; Du Plessis et al., 1989; Jongejan, 1991; Audu et al., 1995). The selection of an antigen conserved among all isolates









34

regardless of pathogenicity would be ideal for the development of heartwater serodiagnostic tests for heartwater.

Five isolates were examined because of their geographical location. Three isolates were of Zimbabwe origin, Crystal Springs (Byrom et al., 1991), Highway (Byrom et al., 1991) and Palm River (Byrom and Yunker, 1990), one isolate each from Sudan in Africa and Antigua from the Caribbean, Um Banein (Jongejan et al., 1984) and Antigua (Birnie et al., 1985), respectively. In this report, it was determined, on the basis of sequence data, that the map2 gene was conserved among these five isolates.









35

Materials and Methods



Origin of Cowdria ruminantium Isolates

Three isolates ofC. ruminantium from Zimbabwe were used for these studies: Crystal Springs, Highway and Palm River (Byrom and Yunker, 1990); one isolate from Sudan, Um Banein (Jongejan et al., 1984); and the Antigua isolate from the Caribbean (Birnie et al., 1985). Organisms, cultured in bovine aortic endothelial cells (Bezuidenhout et al., 1985), were harvested from the culture following the complete lysis of endothelial cells. Culture supernatants were centrifuged at 400 x g for 10 minutes to remove host debris, and the organisms in the supernatant were washed twice in phosphate-buffered saline by centrifugation at 30,000 x g for 30 min. DNA isolation for all isolates was accomplished at the University of Florida/USAID/SADC Heartwater Research Project in Causeway, Zimbabwe. The final DNA pellet was resuspended in saline EDTA (0.15 M NaCl, 0.1 M Na2EDTA) (Mahan et al., 1994).



Amplification of the map2 Gene of Different Geographic Isolates

Six primers (Table 1), designed from the flanking regions of the entire MAP-2 gene (open reading frame 1) of C. ruminantium clone pF5.2 (Figure 1) were synthesized at the Oligonucleotide Synthesis Laboratory (Interdisciplinary Center for Biotechnology Research; University of Florida, Gainesville). These primers were used in nine combinations (Table 2) to amplify map2 gene of the Crystal Springs isolate of C. ruminantium. Briefly, target DNA (I ng) was amplified in a mixture of 0.4 mM dNTPs, 0.5 jiM (each) primer, 20 mM MgC12,









36

100 mM KC1, 200 mM Tris-HCl (pH 8.2), 60 mM (NH4)2SO4, 1% Triton X-100, 100 Ag/ml nuclease-free bovine serum albumin, and 2.5 units of native Pfu DNA polymerase. The reaction was performed at 94oC for 5 min; 30 cycles of 93 0C for 1 min, 400C for 1 min, and 72oC for 1.5 min; and a final extension step at 72C for 10 min. PCR samples with or without the Crystal Springs isolate DNA were used as positive and negative controls. The amplicons were analyzed by gel electrophoresis on a 0.8% agarose gel in IX TBE buffer (89 mM Tris, 89 mM boric acid, 2 mM disodium EDTA).

PCR samples were purified using the QIAquick Spin PCR purification kit (Qiagen, Inc., Chatsworth, CA) as described. The DNA was eluted in 50 Al 10 mM Tris-HC1, pH 8.3. The DNA concentrations were determined using a spectrophotometer at 260/280. DNA samples were digested with restriction enzymes HinclI, EcoRV, andXbaI and the appropriate bands confirmed using the reported Crystal Springs isolate map2 DNA (Genbank #g289922) determined by the map program of the Genetics Computer Group programs package (GCG, University of Wisconsin). All isolates, Highway, Palm River, Um Banein, and Antigua, were amplified with primers AB249 and AB251 and purified using the QIAquick PCR purification procedure.



Cloning and Restriction Enzyme Analysis

Amplicons were concentrated to 20 Al in a speed vac concentrator (Savant Instruments, Inc., Farmingdale, NY) and ligated to EcoRV-digested pBluescript SK+ (Stratagene, La Jolla, CA) at 160C in the presence of T4 DNA Ligase at an insert:vector molar ratio of 8:1. Escherichia coli strain XL 1-Blue cells were grown in L-broth containing









37

tetracycline (12.5 ug/ml). Cells were centrifuged at 5000 rpm for 5 min at 4C in a Jouan centrifuge, resuspended in 10 mM Tris-HC1 (pH 7.6), 50 mM CaC12 and incubated on ice. Cells were centrifuged again at 5000 rpm under the same conditions and resuspended gently. The recombinant plasmid was used to transform competent E. coli XL 1-Blue cells, and grown on LB agar plates in the presence of ampicillin (50 4tg/ml), X-Gal(50 mg/ml) and IPTG (0.2 mg/ml) (Sambrook et al., 1989). White colonies were picked from the plates, inoculated into terrific broth (Tartof and Hobbs, 1987) containing ampicillin, and incubated overnight at 370C with vigorous shaking. Plasmid DNA was extracted using the boiling prep method (Holmes and Quigley, 1981). DNA was reconstituted in TE buffer (pH 8.0) containing 20 i.g/ml DNase-free RNase and analyzed on a 0.8% agarose gel. Recombinant clones containing the map2 genes were digested with seven restriction enzymes (AccI, HincII, EcoRV, EcoRI, Xbal, BamI, and HindIII) to compare their various sizes with those reported previously for the Crystal Springs isolate. The resulting restriction enzyme-digested DNA was analyzed on a 0.8% agarose gel.



DNA Sequencing and Sequence Data Analysis

The DNA insert in pBluescript SK(+) was sequenced from both double-stranded DNA using the dideoxy chain termination reactions using Sequenase (United States Biochemical), as recommended by the manufacturer. Briefly, DNA was denatured using 20 mM EDTA and 1 N NaOH. The DNA was precipitated by incubation at -20'C in the presence of 3 M sodium acetate, pH 5.4 and 100% ethanol followed by centrifugation. The DNA was dried in a speed vac concentrator after a wash with 70% ethanol.









38

In the presence of Sequenase reaction buffer (200 mM Tris-HCl, pH 7.5; 100 mM MgC12; 250 mM NaCI), the primer (10 ng/l) was annealed to the DNA template by incubation at 37C. The annealed DNA was incubated with DTT (100 mM), labeling mix (0.3 4mdGTP, 0.3,umdCTP, 0.3 4M dTTP), dATP[35S] (6.25 uCi), and Sequenase Version 2.0 T7 DNA polymerase (26 units) at room temperature. The mixture was added to the appropriate dNTPs and incubated at 370 C. The reaction was stopped using stop solution (95% formamide; 20 mM EDTA; 0.05% bromophenol blue; 0.05% xylene cyanol FF) and the samples were stored at -20'C.

The sequence gel was heated to 50C and the samples were heated to 75 'C and then loaded onto the gel. Short (1.5 hr) and long runs (2.5 hr) were done and the gel was removed from the electrophoresis apparatus, transferred onto 3M paper (Whatman International Ltd, Maidstone, England), and dried in a gel vacuum dryer (Bio-Rad Laboratories, Melville, NY). The gel was exposed to X-ray film (HyperfilmT MP, Amersham Corporation, Arlington Heights, IL) and the sequence was recorded from the film. T3 and T7 plasmid-specific promoter primers were used in initial reactions and then new oligonucleotides were synthesized based on the sequences obtained ('primer walking'). Insert DNA was completely sequenced on both strands.

The complete sequences of DNA were analyzed on the VAX system using the Genetics Computer Group programs package (University of Wisconsin). Comparisons were made using the Map program for restriction enzyme analysis and the Pretty and Gap programs for comparisons between the different isolates. All DNA sequences were translated in six frames into polypeptides using the Map program of the GCG package. DNA sequences









39

translating into open reading frames were selected and compared with the reported Crystal Springs isolate reported previously. Comparisons were made of similarities and identities between the different isolates using the Translate, Pileup, and Pretty programs of GCG package.



Southern Blot Analysis

DNA probe labeling and probe hybridization were done according to instructions by the manufacturer of the DIG/GeniusTM System 1 kit (Boehringer-Mannheim). Amplified Crystal Springs DNA was incubated overnight at 37C in IX hexanucleotide mix (6.25 A260 units/ml random hexanucleotides, 50 mM Tris-HC1, 10 mM MgC12, 0.1 mM dithioerythritol, and 0.2 mg/ml BSA; pH 7.2), IX dNTP labeling mix (0.1 mM dATP, 0.1 mM dCTP, 0.1 mM dGTP, 65 MM dTTP, 35 MM DIG-dUTP; pH 6.5), and 2 units/Mi DNA polymerase I (Klenow enzyme, large fragment), labeling grade. Disodium EDTA (200 mM, pH 8.0) was added to the tube to terminate the reaction and glycogen solution (20 mg/ml) was added. The labeled DNA was precipitated with 0.1 volume of LiCl and 3 volumes of 100% ethanol (-20'C) and incubated at -70'C for 30 min. The solution was centrifuged at 13,000 x g for 15 min to pellet DNA, washed with 70% ethanol by centrifugation for 5 min, dried in a speed vac concentrator and resuspended in 50 M1 of TE/SDS buffer.

Gels containing target DNA were submerged in denaturing solution (0.5 N NaOH, 1.5 M NaCI) while shaking for 30 minutes at room temperature. Submerged gels were then neutralized in 1.0 M Tris-HC1, pH 8.0; 1.5 M NaCl for 30 min. DNA was blotted overnight to nylon membrane by capillary transfer to the membrane using lOX SSC buffer (1.5 M NaCI,









40

150 mM sodium citrate; pH 7.0). DNA was fixed to the membrane either by UV fixation in the Stratalinker or by incubation for one hour in an 80'C oven.

The membrane was placed in a rolling bottle with prehybridization solution [5X SSC, 1.0% (w/v) Blocking reagent for nucleic acid hybridization, 0.1% N-lauroylsarcosine, 0.02% sodium dodecyl sulfate (SDS)] and incubated for two hours. The DNA probe was heated in a boiling water bath for 10 min to denature DNA, then diluted into the prehybridization solution and added to the membrane for overnight incubation. The membranes were washed three times with 2X SSC, 0.1% SDS for 5 min at room temperature and three times with 0.5 X SSC, 0.1% SDS for 15 min at 50'C with heterologous DNA and 65'C with homologous DNA.

After washes, the membrane was equilibrated in filtered Genius buffer 1 (100 mM Tris-HCl, 150 mM NaC1; pH 7.5) for 1 min, and blocked with Genius buffer 2 (2% Blocking reagent in Genius buffer 1) for 60 min. After Genius buffer 1 was discarded, the membrane was incubated for 30 min in antibody solution (anti-digoxigenin [Fab] conjugated to alkaline phosphatase; 1:10,000 in Genius buffer 2). The antibody solution was discarded and the membrane was washed three times for 15 minutes each with Genius buffer 1. The membrane was equilibrated with Genius buffer 3 (100 mM Tris-HCl, 100 mM NaCl, 50 mM MgCI2; pH 9.5) and placed between two sheets of 3M transparency film. The top sheet was lifted and 0.5 ml of diluted Lumigen PPD (1:100) was added to the membrane surface, excess liquid was removed and the covered membrane was exposed at room temperature to HyperfilmTM.









41




















Table 1. Primers designed based on the reported sequence of pF5.2


PRIMER LABEL PRIMER (5-3') SEOUENCE

AB247 TAAATAACGAAACTCCTCTA

AB248 TAACTAAACAATACTAACCA

AB249 AAACTCTAATTTTATACA

AB250 CAAGCAGTAAAAATAAGAC

AB25 1 AAAATAAGACTAAAAGAAAC

AB252 TCTATTTAATTAAGTATTAAATTA











42

1 aaataatata gaaactacag cacaggtaat tagtaatctt atatcacaag cttgccaata 61 tataacttcc gtaaaaaata tcaaaatatc agatccaact tgatatgata actatctaac 121 tatagttttg ataacttata aactcttact aaaataccaa taggtaacaa taattaattt 181 taaagcttta atgcctatat aatataaaag caagtaaagt aattttttag ttattcattt 241 aatacattat gcaatttcaa aacttaccat tatgttacat acctatatta attattaagt 301 ttagtaatta attatatgaa ttataattat actatataaa tatgtaatat ttaacttaat 361 aaagttcttt catattacat aaatattgat agataaaaaa aatttaagat tattacgtag 421 taaagcatct ataaaacata cttaaaacaa gtagaactat tctcaagtat catacctatc 481 taactctcac ataaatatca accaatatat taacaaattc attacaaaat cctataatgc 541 aatatattaa acaacatgca tttaagaaaa aaggtataag ctatctcata gtgattatta 601 gtattacaat tataaataat aaacattagt acaaattaac ttttcaagaa ttcaatacaa 661 agtaccaaca tctatattaa ataattactt gaagaaaaat ttataagtac atactattct 721 acataacatt agtataaaaa aacatcaatg catattccag aaatctacta caaaatcaaa 781 tacataaata aagacaatta aaacatatta tactaacata tataaataat aagctattta
AB2 4 7 -4
841 attaatttaT AAKTAACGRA ACTCCTCTAc agcattttta gaataatacc tactacacta 901 ggaattattt acttgctata ttttatgcta gtcattgtaa taatacatat acaatagatt 961 cataatcaac tctgaaatgt aattactcat acactaaaaa tatcattttt tatagcgtaa
1021 gtatatacaa ttttactaca taactaaaag aaaaaacata gaagtttaaa ttttattTA&
AB248 -4
1081 CTAAACAATAgTAACCAaaa tatagaaatt ttagattcac aatttgcata tttaaatact 1141 acaaagataa aacatactat aaaaattttt agtaacttga cataacacaa cattgttata AB2 4 9 -4 Map2 gene -4
1201 gcatatatga tacgtgtttt tataaaAAAC TCTAATTTTA TACAATGGAG CACATCATGA 1261 AGGCTATCAA GTTTATACTT AATCTATGTT TACTATTTGC AGCAATTTTT TTGGGATATT 1321 CTTACATAAC AAAACAAGGT ATATTCCAAC CAAAATTACA CGACTCTCCT GATGTTAATA 1381 TATCGAACAA AGCGGATATA AATACTAGCT TTAGCTTAAT TAATCAGGAT GGTATTACGA 1441 TATCTAGTAA AGACTTCCTT GGAAAACATA TGTTAGTCCT TTTTGGGTTT TCTTCTTGTA 1501 AAACTATTTG CCCCATGGAA CTAGGGTTAG CATCCACAAT TCTAGATCAA CTTGGCAACG 1561 AATCTGACAA GTTACAAGTA GTCTTTATAA CTATTGATCC AACAAAAGAT ACTGTAGAAA 1621 CACTAAAAGA GTTTCACAAA AATTTTGACT CACGGATTCA AATGTTAACA GGAAACATTG 1681 AAGCTATTAA TCAAATAGTA CAAGGGTACA AAGTATATGT AGGTCAGCCA GACAATGATA 1741 ACCAAATTAA CCATTCTGGA ATAATGTATA TTGTAGACAA GAAAGGAGAA TATTTAACAC 1801 ATTTTGTACC AGATTTAAAG TCAAAAGAGC CTCAAGTGGA TAAATTACTT TCTTTAATTA
-AB252
1861 AGCAGTATCT TTAATTTAAT ACTTAATTAA ATAGhatagt acagactttt atatagaatc
-AB251 -AR250
1921 taacctttag gatatatatc taatgaagaa GTTTCTTTTA.GTCT!rATTTT TACTGCTTGt 1981 aatgttaccc aaagattcta atgcggaaca tatacatgtt gttggatcat ctacagcatt 2041 tccatttatc gcagcaatag cagaagaatt tgggaggttt tcagattatg gaacacctat 2101 aatagagtct gtggggagtg gtatgggttt tagtatgttt tgtcaaagtg tagaaaacag 2161 tacgccagat atagctatgt catctcgtaa gataaaggat gcagaggtag aattatgtaa 2221 aagtaatgac gttcatgaca ttattgaaat cattatagga tatgatggta ttgttattgc 2281 aaactctaac aatagcaata agcttgattt tacaaaaaaa gatctattca aagctttaag 2341 caagtatgca acgtcagaag aatatacaca tagtatacca gtaaatgatt ttaagtattg 2401 gtcagaaatt aataataggt tccccaatat tgatattgaa gtttacggac catacaaaaa 2461 cacaggtact tataatatac taatcgaaga aataatgcag gattcttgta tgaatcataa 2521 aaatttcatt gaagtatacc cagacttaaa aaaaagacaa cacgcatgca gtatgatccg 2581 caatgatggc aagtacattg aagttgcagc taatgaaaac attattatac aaaaaattgc 2641 aaaaaataat gctgcttttg gtatttttag ttttagcttt ttaatacaga atcaagataa 2701 aatacatgga aataaaattg caggtgtgga acctacatat gaaactattt cctctggaaa
2761 atatatttta tca
Figure I DNA sequence ofpF5.2 plasmid insert DNA. The map2 gene (1245 bp to 1871 bp) is shown (capitalized). The underlined and/or italicized areas 5' and 3' to the map2 gene represent PCR primers and the reverse complement of PCR primers developed, respectively.










43















Table 2. Primer Combinations and Projected Product Size


PRIMERS AB247 AB248 AB249

AB250 1130* 902 752

AB251 1120 892 742

AB252 1022 794 644
*Projected number of bases









44

Results



Cloning and Restriction Enzyme Analysis of the MAP2 Genes

Six different primer combinations were used to amplify Crystal Springs DNA (Figure 2) yielding bands approximately 1.13 kb, 1.12 kb, 0.9 kb, 0.9 kb, 0.75 kb, and 0.74 kb, respectively. Primer AB252 did not amplify DNA under the conditions used. Primers AB249 and AB251 were used to amplify the map2 gene of all isolates of C. ruminantium. The amplified products of approximately 0.74 kb were identified (Figure 3). Amplification of map2 gene products was confirmed by Southern hybridization with a DNA probe derived from the map2 gene of the Crystal Springs isolate (Figure 4). Amplicons were ligated into the EcoRV site of pBluescript SK+ and transformed into E. coli strain XLI Blue.

Restriction enzyme analysis of the map2 genes demonstrated similarities between Palm River, Um Banein, and Antigua and similarities between Crystal Springs and Highway (Figure 5). That is, EcoRV, XbaI, and HinclI restriction sites were found in all isolates analyzed. The AccI restriction site was observed in Crystal Springs reported previously and the Highway isolate, and was absent from all other isolates. Likewise, Palm River, Um Banein, and Antigua isolates had identical restriction enzyme maps and contained an additional HincI site.





Sequence Analysis of MAP2 Genes

The AB249 and AB251 primer paired-amplified DNAs of the four Cowdria isolates were sequenced and compared with the Crystal Springs isolate MAP2 sequences (Genbank









45

#g289922) at both the nucleotide (Figure 6 and Table 3) and amino acid (Figure 7 and Table 4) levels. At both the nucleotide and amino acid levels, Highway and Crystal Springs MAP2 sequences were identical. Palm River, Urn Banein, and Antigua differed at nucleotide positions 111, 192, 319, 465, 483, 534, 553, and 594 (Table 3). Urn Banein differed at position 150 from all isolates. Antigua differed at position 323 compared to other isolates. Two of these changes resulted in the gain or loss of restriction enzyme sites AccI [5'GTAGAC-3'] and HinclI (5'-GTCAAC-3'). In Palm River, Urn Banein, and Antigua isolates, a cytosine (C) was replaced with a thymine (T) resulting in the loss of the AccI site. The additional Hincl site observed in the Palm River, Urn Banein, and Antigua isolates was not present in Highway and Crystal Springs isolates due to a substitution of guanine (G) for the second adenine (A) in the additional HinclI site of the map2 gene. Of these ten nucleotide differences, seven represent silent mutations, but substitutions at positions 319, 323, and 553 lead to three amino acid substitutions (Table 4). Serine (a.a. 107) and threonine (a.a. 185) of Crystal Springs and Highway were both substituted by alanine in Palm River, Urn Banein, and Antigua. Antigua differed from all others at amino acid 108 where a glycine has been substituted for an aspartic acid.

Similarity between nucleotide sequences ranged from 98.56% to 100% translating into 0% to 1.44% variation in the predicted protein sequences, which illustrates the conservation of this protein (Tables 5 and 6).








46







1 2 3 4 5 6 7 8 9









16361018


517396







Figure 2. Analysis of PCR products of the Highway isolate of Cowdria ruminantium using various primer combinations. AB247/AB250 (lane 1), AB247/AB251 (lane 2), AB247/AB252 (lane 3), AB248/AB250 (lane 4), AB248/AB251 (lane 5), AB248/AB252 (lane 6), AB249/AB250 (lane 7), AB249/AB251 (lane 8), AB249/AB252 (lane 9).






47





1 2 3 4 5

203616361018



517


Figure 3. Analysis of PCR products of the five isolates of Cowdria ruminantium using primers AB249 and AB251. PCR amplicons of Antigua (lane 1), Highway (lane 2), Palm River (lane 3), Urn Banein (lane 4), and Crystal Springs (lane 5).






48



1 2 3 4 5





203616361018



517





Figure 4. Southern blot analysis of PCR products of the five isolates of Cowdria ruminantium using primers AB249 and AB25 1. Antigua (lane 1), Highway (lane 2), Palm River (lane 3), Urn Banein (lane 4), and Crystal Springs (lane 5).










49








RESTRICTION ENZYME ANALYSIS OF MAP2 GENES


0.2 kb


-/1
Crystal Springs pF5.2 (2.7 kb long)


Highway v A,


Palm River v


Um Banein


Antigua



Enzymes used for mapping:
A, Acci; B, BamHI; El, EcoRI; Ev, EcoRV; H, Hincldi; Hd, Hindill; X, Xbal





Figure 5. Restriction maps of the map2 genes from Cowdria ruminantium isolates. Maps are drawn left to right, 5' to 3' with respect to the MAP2 coding sequence. Restriction enzymes used for mapping are EcoRV (Ev), HinclI (H), XbaI (X), AccI (A), BamHI, EcoRI, and HindIII (Hd). The restriction map of the Crystal Springs isolate map2 gene is presented for comparison.












50

1
C.Springs ATGGAGCACA TCATGAAGGC TATCAAGTTT ATACTTAATC TATGTTTACT Highway .......... .......... .......... .......... ..........
PalmRiver .......... .......... .......... .......... ..........
UmBanein .......... .......... .......... .......... ..........
Antigua .......... .......... .......... .......... ..........

51
C.Springs ATTTGCAGCA ATTTTTTTGG GATATTCTTA CATAACAAAA CAAGGTATAT Highway .......... .......... .......... .......... ..........
PalmRiver .......... .......... .......... .......... ..........
UmBanein .......... .......... .......... .......... ..........
Antigua .......... .......... .......... .......... ..........

101
C.Springs TCCAACCAAA ATTACACGAC TCTCCTGATG TTAATATATC GAACAAAGCG Highway .......... .......... .......... .......... ..........
PalmRiver .......... G......... .......... .......... ..........
UmBanein .......... G......... .......... .......... ......... T
Antigua .......... G......... .......... .......... ..........

151
C.Springs GATATAAATA CTAGCTTTAG CTTAATTAAT CAGGATGGTA TTACGATATC Highway .......... .......... .......... .......... ..........
PalmRiver .......... .......... .......... .......... C ........
UmBanein .......... .......... .......... .......... C ........
Antigua .......... .......... .......... .......... C ........

201
C.Springs TAGTAAAGAC TTCCTTGGAA AACATATGTT AGTCCTTTTT GGGTTTTCTT Highway .......... .......... .......... .......... ..........
PalmRiver .......... .......... .......... .......... ..........
UmBanein .......... .......... .......... .......... ..........
Antigua .......... .......... .......... .......... ..........

251
C.Springs CTTGTAAAAC TATTTGCCCC ATGGAACTAG GGTTAGCATC CACAATTCTA Highway .......... .......... .......... .......... ..........
PalmRiver .......... .......... .......... .......... ..........
UmBanein .......... .......... .......... .......... ..........
Antigua .......... .......... .......... .......... ..........



Figure 6. Comparison of the MAP2 coding sequences at the nucleotide level. The MAP2 coding sequences of the four isolates were determined for both strands and were aligned with the MAP2 sequence from the Crystal Springs isolate using the Genetics Computer Group programs. The complete nucleotide sequence from the Crystal Springs isolate is presented. The sequences for other isolates are presented only when they differed from the Crystal Springs sequence. A dot indicates identity with the Crystal Springs sequences. Underlined sequences represent restriction enzyme sites altered by nucleotide substitutions.












51

301
C.Springs GATCAACTTG GCAACGAATC TGACAAGTTA CAAGTAGTCT TTATAACTAT Highway .......... .......... .......... .......... ..........
PalmRiver .................. G .......... .......... ..........
UmBanein .................. G .......... .......... ..........
Antigua ......... ... ........ G. ..G ....... .......... ..........

351
C.Springs TGATCCAACA AAAGATACTG TAGAAACACT AAAAGAGTTT CACAAAAATT Highway .......... .......... .......... .......... ..........
PalmRiver .......... .......... .......... .......... ..........
UmBanein .......... .......... .......... .......... ..........
Antigua .......... .......... .......... .......... ..........

401
C.Springs TTGACTCACG GATTCAAATG TTAACAGGAA ACATTGAAGC TATTAATCAA Highway .......... .......... .......... .......... ..........
PalmRiver .......... .......... .......... .......... ..........
UmBanein .......... .......... .......... .......... ..........
Antigua .......... .......... .......... .......... ..........

451 Hincll
C.Springs ATAGTACAAG GGTACAAAGT ATATGTAGGT CAGCCAGACA ATGATAACCA Highway .......... .......... .......... .......... ..........
PalmRiver .......... .... T ..... ........... A ................
UmBanein ................ T..... ........ .. A ...... .... ...
Antigua .......... .... T ..... ........ . A ....... ..........

501 AccI
C.Springs AATTAACCAT TCTGGAATAA TGTATATTLT AGACAAGAAA GGAGAATATT Highway .......... .......... ........ ...... ..........
PalmRiver .......... .......... .......... ... T ...... ..........
UmBanein .......... .......... .......... ... T ...... ..........
Antigua .......... .......... .......... ... T ...... ..........

551
C.Springs TAACACATTT TGTACCAGAT TTAAAGTCAA AAGAGCCTCA AGTGGATAAA Highway .......... .......... .......... .......... ..........
PalmRiver ..G....... .......... ............ ......... .....A ......A
UmBanein ..G. ....... .................... ......... .. A ......
Antigua ..G. ...... .................... ......... . A ......

601
C.Springs TTACTTTCTT TAATTAAGCA GTATCTT Highway .......... .......... .......
PalmRiver .......... .......... .......
UmBanein .......... .......... .......
Antigua .......... .......... .......



Figure 6.(continued)









52


















Table 3. Comparison of the MAP2 coding sequences at the nucleotide level. Capitalized letters represent changes that affect the coding sequence at the amino acid level.

NUCLEOTIDE POSITION
ISOLATE ill 150 192 319 323 465 483 534 553 594
C. SPRINGS a g t T A c g c A g
HIGHWAY a g t T A c g c A g

PALM RIVER g g c G A t a t G a
UM BANEIN g t c G A t a t G a
ANTIGUAg g C G G t a t G a
C. Springs = Crystal Springs












53









1 50
C.Springs MEHIMKAIKF ILNLCLLFAA IFLGYSYITK QGIFQPKLHD SPDVNISNKA Highway .......... .......... .......... .......... ..........
Palmrivr .......... .......... .......... .......... ..........
Umbanein .......... .......... .......... .......... ..........
Antigua .......... .......... .......... .......... ..........

51 100
C.Springs DINTSFSLIN QDGITISSKD FLGKHMLVLF GFSSCKTICP MELGLASTIL Highway .......... .......... .......... .......... ..........
Palmrivr .......... .......... .......... .......... ..........
Umbanein .......... .......... .......... .......... ..........
Antigua .......... .......... .......... .......... ..........

101 150
C.Springs DQLGNESDKL QVVFITIDPT KDTVETLKEF HKNFDSRIQM LTGNIEAINQ Highway .......... .......... .......... .......... ..........
Palmrivr ...... A ... .......... .......... .......... ..........
Umbanein ...... A ... .......... .......... .......... ..........
Antigua ..... AG .. .......... .......... .......... ..........

151 200
C.Springs IVQGYKVYVG QPDNDNQINH SGIMYIVDKK GEYLTHFVPD LKSKEPQVDK Highway .......... .......... .......... .......... ..........
Palmrivr .......... .......... .......... .... A ..... ..........
Umbanein .......... .......... .......... .... A ..... ..........
Antigua .......... .......... .......... .... A ..... ..........

201
C.Springs LLSLIKQYL*
Highway ..........
Palmrivr ..........
Umbanein ..........
Antigua ..........



Figure 7. Comparison ofthe MAP2 coding sequences at the amino acid level. The nucleotide sequences for all five isolates were translated. The complete sequence for the Crystal Springs isolate is presented. The sequences for other isolates are presented only when they differed from the Crystal Springs sequence. A dot indicates identity with the Crystal Springs sequence. The indicates the first amino acid, alanine, predicted to be the N-terminus of the mature protein.









54

















Table 4. MAP2 Amino Acid Sequence Changes between Different Isolates of Cowdria ruminantium

AMINO ACID POSITION
ISOLATE 107 108 185

CRYSTAL SPRINGS Ser Asp Thr
HIGHWAY Ser Asp Thr

I
PALM RIVER Ala Asp Ala

UM BANEIN Ala Asp Ala
ANTIGUA Ala Gly Ala










55

















Table 5. Percent Identities Between the MAP2 Coding Sequences of Isolates of Cowdria ruminantium

Isolates C. Springs Highway Palm River Um Banien Antigua

C. Springs 100.00% 98.72% 98.56% 98.56%

Highway 98.72% 98.56% 98.56%

Palm River 99.84% 99.84%

Um Banein 99.68%

Antigua -










56

















Table 6. Percent Identity between MAP2 Amino Acid Sequences of Isolates of Cowdria ruminantium

Isolates C. Springs Highway Palm River U Banien Antigua

C. Springs 100.00% 100.00% 99.04% 99.04% 98.56%

Highway 100.00% 99.04% 99.04% 98.56%

Palm River 100.00% 100.00% 99.52%

Um Banein 100.00% 99.52%

Antigua 00.00%









57

Discussion

The map2 sequence was highly conserved among the five isolates with only conservative substitutions detected at three positions (a variability between 0% to 1.44% in the predicted protein). This differed from the sequenced MAP I of several isolates which was found to contain three hypervariable regions, between 0 and 14% variability at the nucleotide level, and 0. 8 and 10.0% variability in the predicted protein (Reddy et al., 1996). MAP I also had several insertions and deletions resulting in products of different molecular weights ranging from 27.64 kDa (Antigua isolate) to 28.82 kDa (Nyatsanga isolate) (Reddy et al., 1996). Finally, MWPI may be a member of a multi-gene family (Reddy et al., unpublished) and subject to variation resulting from recombination events. MAP2, on the other hand, had similar molecular weights in all isolates.

The ten substitutions between the different isolates represented only three amino acid changes. As far as geographic correlation between the different isolates, MAP2 was identical between Crystal Springs and Highway isolates. However, it was important to note that these isolates were collected from neighboring farms. The third Zimbabwe isolate, Palm River, although geographically close to Crystal Springs and are transmitted by the same vector A. hebraeum, has a more similar amino acid sequence to Um Banein and Antigua. The Palm River isolate differed from Crystal Springs and Highway isolates at position 107, where the neutral, hydrophobic amino acid alanine was substituted for the neutral polar amino acid seine. Palm River was identical at the amino acid level to the Um Banein isolate. The Antigua isolate was similar to Um Banein and Palm River, except at amino acid 108 where the neutral, polar amino acid glycine has been substituted for the amino acid aspartic acid.









58

These changes had little effect on predicted antigenic determinants (Hopp and Woods, 1981) of Um Banein, Antigua, and Palm River; however, changes did affect one potential antigenic site (Table 7) of Highway and Crystal Springs. Flexibility regions (Flexpro Program of PC/Gene) were similar for all of the isolates (Table 8).

These results demonstrated that the MAP2 was conserved among different isolates of C ruminantium. The MAP2 antigen was recognized by infection sera from all sheep, goats, and cattle tested, indicating that it was an excellent candidate for diagnosis. A 55.5% identity between MAP2 and the coding DNA sequence for major surface protein 5 (Visser et al., 1992) of Anaplasma marginale was reported (Mahan et al., 1994). A competitive ELISA using infection antisera to inhibit the reaction between recombinant MSP5 and an antiMSP5 monoclonal antibody specifically was used to diagnose cattle infected with A. marginale for as long as six years post-infection (Knowles et al., 1996). The similarity between MSP5 and MAP2, the conservation of MAP2 antigenicity between isolates and for different animal species (Mahan et al., 1994), and the MAP2 sequence conservation reported here support the theory that MAP2 may be useful as an antigen in serodiagnosis of heartwater. Based on these data, MAP2 is a strong immunoassay candidate and further investigation is warranted to determine whether MAP2 is a good candidate antigen to be used for serodiagnosis of heartwater.









59













Table 7. Prediction of Antigenic Determinants

Highest Points of Hydrophilicity




I Isolate 1 2 3
isolate,
Crystal Springs Val-Asp-Lys-Lys-Gly-Glu Asp-Uu-Lys Ser-Lys-Glu Gly-Asn-Glu-Ser-Asp-Lys

Highway Val-Asp-Lys-Lys-Gly-Glu Asp-Leu-Lys-Ser-Lys-Glu Gly-Asn-GIU-Ser-Asp-Lys
Palm River Val Asp-Lys-Lys-Gly-Glu Asp-Leu-Lys-Ser-Lys-Glu Lys-Ser-Lys-Glu-Pro-Gln
Um Banein Val-Asp-Lys-Lys-Gly-Glu Asp-Leu-Lys-Ser-Lys-Glu Lys-Ser-Lys-Glu-Pro-Gln
Ant!gua j Val-Asp-Lys-Lys-Gly-Glu Asp-Leu-Lys-Ser-Lys-Glu Lys-Ser-Lys-Glu-Pro-Gln
*Calculations based on the method used by Hopp and Woods (1981). Theaveragegroup length is 6 amino acids. Sequences identical to Crystal Springs isolate are bold.










60



Table 8. Position and Sequence of Flexible Segments*


Isolate

No. Crystal Springs Highway Palm River Urn Banein Antigua

IDKKPDLKSKEP DLKSKEP DLKSKEP DLKSKEP

2 GQPDNDNE GQPDNDNE GQPDNDNE GQPDNDNE GQPDNDNE

3 VDKKGEY VDKKGEY VDKKGEY VDKKGEY VDKKGEY

4 LHDSPDV LHDSPDV LHDSPDV LHDSPDV LHDSPDV

5 TISSKDF TISSKDF TISSKDF TISSKDF TISSKDF

6 HDPTKDT IDPTKDT IDPTKDT IDPTKDT IDPTKDT
7 GNESDKL GNESDKL GNEADKL GNEADKL LGNEAGK

8 NISNKAD NISNKAD NISNKAD NISNKAD NISNKAD

9 KNFDSRI KNFDSRI KNFDSRI KNFDSR] KNFDSRI

10 ITKQGIF ITKQGIF ITKQGIF ITKQGLF ITKQGIF
*10 highest peaks of flexibility in the complete sequence. Calculations based on the FLEXPRO program of PCGENE. Underlined regions are flexibility sites that may vary in their amino acid composition, but are located at similar regions of their respective proteins.














CHAPTER 4
IMMUNOASSAYS USING MAP2 TO IDENTIFY ANTIBODIES TO COWDRIA
RUMINANTIUM IN THE SERA OF INFECTED ANIMALS


Introduction

Development of a serodiagnostic test specific for detection of animals infected with Cowdria ruminantium is needed for use in endemic and heartwater-free areas of the world. Detection of specific antibodies in the blood of infected animals is essential for determining the heartwater status of an animal. Two immune responses, humoral and cell-mediated, may be triggered when an animal has been invaded by an infectious agent, in this case, C. ruminantium. The parasite is present in the blood during the initial infection and after endothelial cell destruction and release of elementary bodies. During these times, antibodies are produced against the parasite, thus initiating the destruction of the organism by various immunological mechanisms (i.e. complement cascade, opsonization, antibody-dependent cellmediated cytotoxicity). It is the presence of these antibodies (specific for various epitopes on the surface of the organism) that may be used for diagnosis of the disease. While the presence of antibodies does not directly reflect the presence of the disease agent, antibody detection tests are a useful adjunct to PCR assays which detect the organism directly (see literature review).

The development of an indirect or competitive enzyme-linked immunosorbent assay (ELISA) for the diagnosis of C. ruminantium is needed to screen animals imported into the 61









62

United States, as well as to monitor the spread of the disease in the Caribbean and Africa. Many tests including indirect fluorescent antibody assays, immunoblots, and ELISAs have been used in the detection of antibodies against C. ruminantium using either cultured organisms or organisms isolated from infected animals or ticks as the antigen (see literature review). This can be time-consuming and expensive and requires full-time personnel and necessary equipment and solutions. In addition, cross-reactivity has been observed with species of Ehrlichia (Jongejan et al., 1993; Matthewman et al., 1994; Kelly et al., 1994), which may be avoided in development of a diagnostic based on recombinant proteins or synthetic truncated analogs.

Development of a serodiagnostic test for heartwater has been hindered by crossreactivity and the variability of target proteins among various C. ruminantium isolates (Mahan, 1995). Major antigenic protein 1 (MAP1), a major structural protein of C. ruminantium (Mahan et al., 1993), was determined to be conserved antigenically among various isolates of C. ruminantium (van Vliet et al., 1994). MAPI was developed into a competitive ELISA (Jongejan et al., 1991) and used in surveys on animals in Africa (Jongejan and Thielemans, 1989) and in the Caribbean (Muller Kobold et al., 1992). However, Mahan et al (1993) demonstrated that the MAPI also cross-reacted with an unknown organism because testing of animals from heartwater-free (absence of both the vector and the disease) regions of Zimbabwe resulted in false positive reactions. This cross-reaction was thought to be due to the presence of an organism belonging to the family Rickettsiaceae. Sera from dogs experimentally infected with Ehrlichia canis recognized MAP I in Western blots (Kelly et al., 1994). In addition, sequence analysis of MSP2 and MSP4 of Anaplasma marginale,









63

determined to be a close relative of C. ruminantium using 16S rDNA analysis, revealed highly significant homology with the C. ruminantium MAPI (Palmer et al., 1994; van Vliet et al. 1994). Also, sequence and size variability of MAPI between different isolates of C. ruminantium and evidence that MAP 1 is a member of a multi-gene family were reported (Reddy et al., 1996). Reddy et al. (manuscript submitted) reported that variability of MAPI may be possibly due to genetic recombination.

The MAP2 of C. ruminantium was determined to be highly conserved among geographic isolates based on serologic (Mahan et al., 1994) and molecular studies (Chapter 3). MAP2 was developed into a recombinant protein which reacts with sera from heartwater-infected animals in Western blots (Mahan et al., 1994). In addition, MAP2 is a homolog of MSP5 ofA. marginale which has been used successfully for development of an ELISA (Knowles et al., 1996). Although MAP2 and MSP5 are similar proteins, sufficient sequence differences exist to suggest that MAP2 may be useful in immunoassays that would be specific for the detection of C. ruminantium-infected animals. Sera to A. marginaleinfected cattle did not react with the Palm River or Ball3 isolates of C ruminantium (Semu et al., 1992).









64

Materials and Methods



Cowdria ruminantium Recombinant MAP2 Production and Purification

Nucleotide sequencing of the insert DNA in plasmid pF5.2 demonstrated that 627 bp of a 2773 bp cloned DNA insert encoded a protein with an approximate size of 21 kilodaltons (Mahan et al, 1994). The 627 base pair open reading frame (ORF) was subcloned into the expression vector pFLAG (International Biotechnologies, Inc., New Haven, CT) and transformed into Escherichia coli for expression of recombinant protein.

An E. coli colony expressing MAP2 was selected and expanded in L-broth (1% tryptone, 0.5% yeast extract, 1% NaCi), induced with 0.1 mM isopropyl P-Dthiogalactopyranoside (IPTG), and purified by monoclonal antibody affinity chromatography. Cultures were centrifuged at 5,000 rpm for 20 minutes and the supernatant discarded. Eight milliliters of IX phosphate-buffered saline (PBS; 0.01 M NaH2PO4, 0.15 M NaCl), pH 7.4, were added and the sediment was re-suspended and frozen. Sediments were quick-thawed and sonicated on ice four times at 30 seconds each with 15-second waits between bursts. Sediments were centrifuged at 4C for 45 min at 19,500 rpm. Supernatants were filtered through glass pre-filter, 5.0 gm PVDF, and 0.65 Atm cellulose acetate filters using the Sterifil Aseptic System (Millipore Corporation, Bedford, MA).

Anti-FLAG gel beads were added to the filtered supernatant and incubated for 30 minutes at 4'C or on ice swirling gently. Beads were collected in the Millipore device using a 5.0/m PVDF filter. The beads were washed three times with cold IX PBS containing 1.0 mM CaC12. Protein was eluted from the beads using IX PBS containing 2.0 mM









65

ethylenediaminetetraacetic acid (EDTA). Eluate was dialyzed three times in IX PBS. Protein concentration, size, and purity were determined on a 12% acrylamide gel. The antigenicity of the protein was determined using an indirect ELISA and hyperimmune serum from C ruminantium-infected sheep.



Antisera

Positive sera were collected from sheep and cattle that had been born and reared under tick-free conditions and experimentally infected with an isolate of C ruminantium. False positive sera were obtained from cattle and sheep born and raised in regions ofZimbabwe that were Amblyomma- and heartwater-free. Negative sera were obtained from sheep and cattle born and reared under tick-free conditions in Zimbabwe. The sera used for these studies are listed in Table 9.



MAP2 Coating Concentration

The optimum amount of recombinant MAP2 was determined by coating NUNC Maxisorp ELISA plates with 50 pl of the following protein concentrations: 8 pg/ml, 4 pg/ml, 2 gg/ml, 1 jig/ml, 0.5 pg/ml, 0.25 pg/ml, 0.125 jig/ml, and 0.0625 pg/ml. Test sera were obtained from BALB/C mice hyperimmunized with recombinant MAP2. Normal BALB/C mouse sera were used as a control.









66

Indirect ELISA

NUNC Maxisorp ELISA plates were coated using isolated recombinant MAP2 in IX phosphate buffer saline (lX PBS), 0.14 M NaC1, 20 mM Na2HPO4, 3 mM KH2PO4, pH 7.2, containing 0.02% sodium azide (lX PBS/azide) at 50 ,l per well and incubated overnight at 4oC. After five washes with washing buffer containing IX PBS/azide and 0.05% Tween-20, wells were blocked for 60 min at room temperature with 1.0% bovine serum albumin in lX PBS/azide. Plates were washed five times and 50 pl/well of serum or supernatant diluted in lX PBS/azide were added. Plates were incubated for 60 min at room temperature. The plates were washed five times and incubated at room temperature for a further 60 min in the presence of rabbit anti-species-specific immunoglobulin G linked to alkaline phosphatase (1:1000; 50 /l/well). Following another five washes, the substrate, p-nitrophenylphosphate (1 mg/ml; Sigma), in 0.16 M NaHCO3, 0.14 M Na2CO3, 0.02 M MgCl2, pH 9.6, was added at 50 Al/well to each well and incubated for 30 min at room temperature. Absorbance was read at 405 nm on a SLT-Lablnstruments EAR 400 AT.



Immunization of Mice

Three BALB/C mice were immunized subcutaneously in two groin sites (50 Al) and at two sites in the back (90 Il) with a 1:1 dilution of recombinant MAP2 (rMAP2; 50 Ig/mouse) and 2X Ribi monophosphoryl lipid A (MPL) and trehalose dicorynomycolate (TDM) adjuvant. Mice were boosted every two weeks after initial immunization as described during the primary immunization with an 1:1 emulsion of MAP2 and 2X Ribi MPL and









67

TDM's adjuvant. Mice were bled one week after each boost and the antibody titers of the sera were determined.



Screening for Monoclonal Antibodies

Spleen cells from Balb/C mice hyperimmunized with rMAP2 were fused with sp2/0 myeloma cells (ATCC #CRL 1581) using the polyethylene glycol method and selected using the conventional hypoxanthine aminopterin-thymidine (HAT) selection techniques (Galfre and Milstein, 1981). Hybridoma supernates were screened in an indirect ELISA using rMAP2 and anti-mouse IgG. Cells from antibody-positive wells were screened for competitive inhibition, and those showing inhibition with true positive (sheep #140) and no inhibition with the negative (Banks 014) or false positive (Rogers 060), were expanded, cryopreserved, cloned and re-cloned by limiting dilution.

Supernatants from pure hybridomas were tested for effectiveness against rMAP2. Hybridoma clones secreting antibodies that demonstrated competition with true positive sera, but not false positive or true negative sera were selected. Monoclonal antibodies were purified, their isotypes were determined and they were concentrated for further studies.



Competitive ELISA Development

A cELISA using MAP2 was developed involving competition between unknown serum and the selected monoclonal antibody (MAb). The procedures were similar to the indirect ELISA method described above except after the initial washes, sample serum was added and incubated. Wells were washed (five times) and MAb added at the appropriate









68

dilution and incubated. An alternate method included a 60 min incubation of a mixture of MAb and sample sera alter the initial washes. After washing, rabbit anti-mouse LgG linked with alkaline phosphatase (50 uI/well; 1:1000) was added and incubated for one hour followed by the addition of substrate as described earlier. Absorbance was read at 405 nm..



Percent Inhibition

Percent inhibition was calculated as follows:


optical density of MAb alone optical density of MAb versus coMneting sera x 100 optical density of MAb alone


Comparisons were made between the percent inhibition of true positive, false positive, and negative sera to determine whether any of the monoclonal antibodies were potential candidates for diagnostic development.










69

Table 9. Ovine and Bovine Sera Tested


Species Animal # Isolate(s) Known Origin
Positive Sera Ovine 123 Welgevonden/CS* VRL**
Ovine 127 Welgevonden VRL
Ovine 136 Welgevonden/CS VRL
Ovine 137 Welgevonden/CS VRL
Ovine 139 Welgevonden/CS VRL
Ovine 140 Welgevonden/CS VRL
Ovine 88219 Welgevonden/CS VRL
Ovine 369 +*** VRL
Ovine 385 + VRL
Ovine 2310 + VRL
Ovine 378 + VRL
Bovine 8 + VRL
Negative Sera Ovine 012 None**** Banks Farm
Ovine 014 None Banks Farm
Ovine 015 None Banks Farm
Ovine 181 None VRL
Ovine 183 None VRL
Ovine 188 None VRL
Ovine 193 None VRL
Ovine 134 None VRL
Bovine 1 None VRL
Bovine 2 None VRL
Bovine 4 None VRL
Bovine 5 None VRL
Bovine 6 None VRL
False Positive Ovine 056 None Rogers Farm
Ovine 060 None Rogers Farm
Ovine 062 None Rogers Farm
Ovine 066 None Rogers Farm
Ovine 2089 None VRL
Ovine 2123 None VRI,









70

Table 9 (continued).

False Positive Ovine 2012 None VRL
Ovine 2079 None VRL
Bovine 132 None VRL
Bovine 041 None VRL
aaine 004 None
*Crystal Springs isolate
**Veterinary Research Laboratory, Causeway, Zimbabwe
***Isolate unknown, animal positive for Cowdria ruminantium
** *Uninfected animal









71

Results



Isolation and Characterization of Recombinant MAP2

MAP2 (Figure 8) was eluted from anti-FLAG gel beads, dialyzed in IX PBS and analyzed using silver stain on a 12% SDS-PAGE gel. Recombinant MAP2 was shown to react with antibodies to C. ruminantium and thus maintained its antigenicity.



Indirect ELISA for Heartwater Diagnosis Using MAP2

The optimal concentration of rMAP2 was determined to be 4 jig/ml (Figure 9). Serum obtained from an animal experimentally infected with C. ruminantium (Sheep #140) tested positive at dilutions as low as 1:3200 (Figure 10). Serum (Rogers 060) obtained from an animal from a heartwater-free region (false positive) reacted in a similar pattern to the true positive serum. Negative serum (Banks 014) consistently gave optical density values lower than the true positive and false positive sera at similar dilutions down to 1:12,800.



Responses by Immunized Mice

Sera from immunized mice were diluted two-fold beginning at the dilution 1:100. Immunized mice developed similar antibody titers to rMAP2 in an indirect ELISA (Figure 11). Responses were at least two-fold the optical density of normal mice up to 1:204,800 titer for all three immunized mice.









72

Competitive Inhibition ELISA for Heartwater Diagnosis Using MAP2

Subclones were developed from hybridoma clones which demonstrated competition with the true positive sera (Figures 12 and 13). Clone 1D5 was analyzed for competitive inhibition against positive sera [0.88 (mean) + 0.04 (standard error)] versus competition against negative and true positive sera (1.06 + 0.04; grouped together). Clone 4D5 resulted in values of 0.56 + 0.03 for competitive inhibition against positive sera versus 0.80 0.03 for competition against negative and true positive sera. Using the unpaired t-test of the analysis of variance, iD5 and 4D5 were significant with P values of <.002 and <.0001, respectively. Two subclones were selected from each hybridoma clone and they were labeled HL945 and HL947 for hybridoma clone 1D5 and HL895 and HL896 for 4D5. These clones were tested in a competitive inhibition ELISA against true positive (OV2310 and OV385), false positive (OV2089 and OV2079), and negative (OV188 and OV134) sera. This competitive inhibition ELISA method contained a step whereby antisera were incubated for one hour before the monoclonal antibody was added. The results of the competitive inhibition are shown in Figure 14. Highest O.D.s were observed in CI-ELISAs with negative sera. True and false positive sera clearly inhibited both monoclonal antibodies. However, true and false positive sera were indistinguishable by this test.









73





6946

































Figure 8. Major Antigenic Protein 2. MAP2 (arrow) was eluted from anti-FLAG gel beads, dialyzed in I X PBS and analyzed using silver stain on a 12% SDS-PAGE gel.













3

2.5


2


1.5 Mouse Serum (1:5000)
<-] Normal 1 Immune


0.5


0
8 4 2 1 0.5 0.25 0.1250.0625
ug/ml rMAP2



Figure 9. Titration of MAP2 Antigen. Maxisorp ELISA plates were coated with 8 jg/ml, 4 Rg/ml, 2 pg/ml, 1 jg/ml, 0.5 Rg/ml, 0.25 pg/ml, 0.125 jg/ml, and 0.0625 ig/ml of MAP2 antigen. Sera were obtained from either BALB/C mice hyperimmunized with recombinant MAP2 (purple) or normal BALB/C mouse and tested in an indirect ELISA.

















3



2.5



2'

E

.5 1 s Positive
-False Positive
0 L Negative





0.5





1 2 3 4 5 6 7 8 9 10 11 12 Serial dilutions of serum; 1=1:100




Figure 10. Indirect ELISA using Sheep Sera. Serum obtained from an animal experimentally infected with C. ruminantium (positive), an animal from a heartwater-free region but reactive to C. ruminantium (false positive), and an animal with no previous exposure to C. ruminantium (negative) was tested in an indirect ELISA at various dilutions.





















CD






A405










co












la.










CL
CD CA
0 27 1 1 1 1




0













1.4

1.2

1I
E
C
Lo 0.8




0.4 0.2

0
False Positive Negative Positive




Figure 12. 1D5 Hybridoma Supernatant versus Sheep Sera (1:50). Sera obtained from sheep which were previously defined as positive, false positive, and negative were added prior to ID5 hybridoma supernatant. After washing, rabbit anti-mouse IgG linked with alkaline phosphatase (50 pl/well; 1:1000) and substrate were added and incubated. Absorbance was read at 405 nm..



















E0.8
C
0
'Rt0.6


00.4


0.2


0
False positive Negative Positive



Figure 13. 4D35 Hybridoma Supernatant versus Sheep Sera (1:50). Sera obtained from sheep which were previously defined as positive, false positive, and negative were added prior to 4D35 hybridoma supernatant. After washing, rabbit anti-mouse IgG linked with alkaline phosphatase (50 gl/well; 1: 1000) and substrate were added and incubated. Absorbance was read at 405 nm..














1.4

1.2
I

1 1


E Sheep Sera
C0.8
0V2310, Pos
e U 0V2089, FP
.0.6 0V188, Neg
0 0V385. Poe
[] 0V2079, FP
0.4 U OV1 34, Neg


0.2

0 I
HL945 HL947 HL895 HL896
Monoclonal Antibodies



Figure 14. Competitive ELISA using monoclonal antibodies versus Sheep Sera (1:50). Sera obtained from sheep which were previously defined as positive, false positive, and negative were incubated followed by incubation with the appropriate MAb. After washing, rabbit anti-mouse IgG linked with alkaline phosphatase (50 ,ul/well; 1:1000) and substrate were added and incubated. Absorbance was read at 405 nm.












80

Discussion

The MAP2 was determined to be conserved among the five geographic isolates of C. ruminantium (Chapter 3), therefore, it was important to determine whether sera obtained from both true positive and false positive animals would react with MAP2 of C. ruminantium. Data presented in this study confirmed the presence of a cross-reacting organism containing MAP2-like proteins.

A monoclonal antibody specific for an unique epitope on MAP2 of the C. ruminantium appeared to be difficult to isolate as observed in the development of this competitive ELISA. Although the negative sera did not inhibit the binding of the antibodies to the antigen, both true positive and false positive sera inhibited the binding of monoclonal antibodies examined.

Although the function of the MAP2 is not known, this protein is located on the surface of the organism and may be involved in adhesion, pathogenicity, or invasion, and therefore may be conserved among rickettsia. MSP5 of A. marginale, a closely related rickettsia, is similar to MAP2 (Visser et al., 1992) and their identity is 55.5% at the nucleic acid level (Mahan et al., 1994). In addition, examination of MAP2 (C. ruminantium) and MSP5 (A. marginale) at the amino acid level has shown identical stretches of six amino acids or more between A. marginale (Oklahoma strain) and the Crystal Springs isolate of C. ruminantium. Canine sera from Zimbabwe contained antibodies which were reactive with C. ruminantium and Ehrlichia canis in IFA tests (Matthewman et al., 1994). More importantly, anti-recombinant MAP2 antiserum reacted with a MAP2 homolog of Ehrlichia canis














81

(Chapter 5). Because MAP2 or its homologs appear to be represented in several rickettsia, these proteins may have a similar function in the development of these organisms. Similar surface proteins between closely-related microorganisms have been reported earlier. For example, antibodies raised to a 60 kDa Babesia divergens merozoite protein reacted with a similar protein of the invasive stage of Plasmodiumfalciparum on immunoblots (Carcy et al., 1994). This conservation among other rickettsia has been observed with MAPI of C. ruminantium which reacted with antisera to E. canis, Ehrlichia chaffeensis, Ehrlichia bovis (Jongejan et al., 1993) and sera obtained from white-tailed deer (Odocoileus virginianus) from southeastern U.S. (Katz et al., 1996). Development of an immunoassay for heartwater may be dependent upon the discovery of a monoclonal antibody specific for an unique epitope on MAP2 because it appears that the whole protein is cross-reactive with antisera against Ehrlichieae.

The examination of either truncated regions of MAP2, or monoclonal antibodies designed to epitopes shared among C ruminantium isolates, but different in Ehrlichia spp., may be necessary in the development of an immunoassay for C ruminantium. Examination of Ehrlichia spp. genomic DNA for sequences encoding MAP2 homologs will assist in the further development of an immunoassay for C ruminantium diagnosis.














CHAPTER 5
ANALYSIS OF MAP2 HOMOLOGS OF EHRLICHIA CHAFFEENSIS AND EHRLICHIA CANIS


Introduction

Serological tests for cowdriosis have been found to lack specificity due to crossreacting antibodies from animals suspected to be infected with closely related organisms of the genus Ehrlichia. Animals from regions free of both C. ruminantium and heartwater vectors were shown to react with rMAP2 in immunoassays (Chapter 4). These crossreactions may be due to the presence ofHyalomma and Rhipicephalus ticks that may transmit an Ehrlichia spp. to animals in these heartwater-free regions of Zimbabwe. In addition, studies on Ehrlichia spp. and C. ruminantium have shown a similarity in the ribosomal RNA (rRNA), a method used to elucidate phylogenetic relationships as well as for detection or identification of microorganisms (Woese, 1987). Two closely related ehrlichial species, E. canis and E. chaffeensis have been shown to be similar to C. ruminantium based on the 16S rRNA gene (van Vliet et al., 1992). In addition, antisera against various species of Ehrlichia reacted with or recognized several proteins of C. ruminantium including MAP I and MAP2 in Western blots. Antisera to all Ehrlichia spp. examined (E. canis, E. ovina, and E. bovis) recognized MAP 1; however, only E. canis and E. bovis antisera recognized the 21 kDa protein (Jongejan et al., 1993). Although E. bovis may be a good organism to examine for the presence of a MAP2 homolog, it is not a good candidate for these studies because it has


82









83

been established only recently in culture and is not as closely related to C ruminantium as E. canis and E. chaffeensis. Therefore, E. canis and E. chaffeensis were examined for MAP2 homologs because they have been successfully cultured and are more closely related to C. ruminantium.

Ehrlichia canis is the etiologic agent of tropical canine pancytopenia or canine ehrlichiosis and is transmitted by the brown dog tick Rhipicephalus sanguineus (Groves et al., 1975). This ubiquitous rickettsial organism (Donatien and Lestoquard, 1935) is common in Africa with a prevalence of 33% and 35% in dogs in Egypt and Zimbabwe, respectively (Matthewman et al., 1993). The disease is characterized by fever, depression, anorexia, and body weight loss in the acute phase. Clinically, the most overt sign of the disease is unilateral or bilateral epistaxis (Ewing, 1969; Walker et al., 1970) followed by death approximately one week later. Like most rickettsial diseases, tetracycline and its derivatives are the most effective clinical treatments (Amyx et al., 1971). The most widely used method of diagnosing canine ehrlichiosis in the U.S. is the indirect fluorescent antibody assay which has been shown to be both sensitive and specific for use in dogs. Cowdria ruminantium antigens have been used to detect antibodies to E. canis by immunofluorescence (van Vliet et al., 1992) and western blots (Jongejan et al., 1993).

Ehrlichia chaffeensis, a newly recognized member of the genus Ehrlichia, is the causative agent of human monocytic ehrlichiosis. Over 400 people from 30 states have been reported with the disease using both PCR and an IFA using cultured organisms (Dawson et al., 1996), and over 1500 people have been exposed to the organism using the IFA alone (Walker and Dumler, 1996). The first case was reported in 1987 from an army recruit at Fort









84

Chaffee, Arkansas (Maeda et al., 1987) and E. chaffeensis has been thus far identified in Amblyomma americanum using PCR amplification (Anderson et al., 1992). Approximately 60% of E. chaffeensis-infected patients required hospitalization (Kelly et al., 1994). In addition to the U.S., cases have been reported in Europe and Africa (Morais et al., 1991; Uhaa et al., 1992). Confirmation of E. chaffeensis infection has been accomplished using indirect immunofluorescence using E. chaffeensis-infected DH82 cells as antigen (Dawson et al., 1991). Use ofmonoclonal antibody 1 A9 specific for E. chaffeensis in an immunoassay may improve diagnosis since it does not react with E. canis (Yu et al., 1993) which has a 98.7% similarity at the rRNA level (van Vliet et al., 1992). With reference to possible diagnosis of C ruminantium using MAP2, an E. chaffeensis 22 kDa protein has been observed with antisera to E. chaffeensis in Western blots (Chen et al., 1994; Rikihisa et al., 1994; Chen et al., 1996).

In order to determine whether MAP2 of C ruminantium can be useful in heartwater diagnosis, MAP2 homologs have been cloned from the genomic DNA of E. canis and E. chaffeensis. Primers were designed from sequences conserved between map2 genes of C ruminantium and the msp5 gene ofAnaplasma marginale. The availability of the sequences of MAP2 homologs from E. chaffeensis and E. canis may enable the development of C ruminantium-specific diagnostic tests. This could be achieved using monoclonal antibodies against regions of MAP2 unique to C ruminantium or synthetic peptides of unique regions as diagnostic antigens.









85

Materials and Methods



Immunoblot of C. ruminantium and E. canis Antigens

Cowdria ruminantium (A) or E. canis (B) lysates were separated by SDS-PAGE and transferred to nitrocellulose membranes. Membranes were blocked with Tris-buffered saline (TBS) (0.1 M Tris HC1, 0.9% NaCl [pH 8.0])-0.25% gelatin, then reacted with anti-C. ruminantium antiserum (sheep 483; Crystal Springs isolate), anti-recombinant MAP2 antiserum (sheep 177), or anti-E. canis antiserum (Mukanya dog, E. canis Oklahoma strain). Membranes were washed three times in TBS containing 0.25% Tween 20, reacted with peroxidase-labeled protein G (Zymed) for 2 hours, washed three times as described above, and developed by incubation with 4CN peroxidase substrate (Kirkegaard and Perry, Gaithersburg, MD).



Origin of E. canis and E. chaffeensis

Ehrlichia canis (Arkansas isolate) and E. chaffeensis (Oklahoma strain), were obtained from Jacqueline E. Dawson at the Centers for Disease Control and Prevention (Atlanta, GA) and cultured in canine macrophage cell line DH82 in minimum essential medium (Rikihisa et al., 1992), containing 10% fetal bovine serum and 2 mM L-glutamine in a 5% CO2-air atmosphere. Following lysis ofhost cells, cultured organisms were harvested and purified as in Chen et al. (1996). The final pellet was resuspended in saline EDTA*(0.15 M NaC1, 0.1 M Na2EDTA) and used for extraction of genomic DNA by the SDS-proteinase K method (Reddy et al., 1996).