Purification, kinetic properties, inhibition characteristics, and unique active site features of carbonic anhydrase V

MISSING IMAGE

Material Information

Title:
Purification, kinetic properties, inhibition characteristics, and unique active site features of carbonic anhydrase V
Physical Description:
Book
Creator:
Heck, Robert Wilson, 1966-
Publication Date:

Record Information

Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 028194732
oclc - 48660274
System ID:
AA00022853:00001

Full Text










PURIFICATION, KINETIC PROPERTIES, INHIBITION CHARACTERISTICS,
AND UNIQUE ACTIVE SITE FEATURES OF CARBONIC ANHYDRASE V














BY
ROBERT WILSON HECK













A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1996














ACKNOWLEDGMENTS


This dissertation was made possible by the contributions of Dr. Sue

Tanhauser, Rajyalakshmi Manda, and Ann Boriack-Sjodin. I feel grateful to

many people who have supported and helped me throughout this process.

Without their contributions, completion of this work would not have been

possible.

I would like to extend many thanks to Dr. Philip J. Laipis, Dr. David N.

Silverman, and Dr. C. K. Tu. Their guidance kept me on track and helped me

focus on the important aspects. Having worked closely with them, I hope to

take their words of wisdom with me and always strive to become a better

researcher.

I would also like to thank Dr. Nancy Denslow and Dr. Thomas O'Brien.

Their enthusiasm and love of science inspired my entry into research. They

gave me a vision and taught me the methodology. I am forever grateful.

I was fortunate to have Dr. Daniel L. Purich and Dr. Richard Boyce to

give me counsel and advice during times of difficulty. They helped me see the

light at the end of the long tunnel. I would like to thank them for their insight










and for believing in me. Finally, special thanks go to Dr. Brian Cain and Dr.

Maurice Swanson for their advice and patience.














TABLE OF CONTENTS


ACKNO W LEDG M ENTS................................................................................. ii

LIST O F TABLES.......................................................................................... vi

LIST O F FIG URES......................................................................................... vii

LIST O F ABBREVIATIO NS............................................................................ ix

ABSTRACT.................................................................................................... x

CHAPTERS
1 INTRO DUCTIO N................................................................................ 1

Carbonic Anhydrase Isozym es........................................................... 1
M itochondrial Carbonic Anhydrases................................................... 2
Comparison Of Carbonic Anhydrase V Sequence With Other
Isozym es.............................................................................................. 4
Structure Of Carbonic Anhydrase V.................................................... 8
Inhibition And Physiology Of Carbonic Anhydrase V.......................... 12
Enzym atic M echanism ......................................................................... 14

2 PURIFICATION OF NATIVE CARBONIC ANHYDRASE V................ 18

Introduction.......................................................................................... 18
M materials And M ethods........................................................................ 20
Results................................................................................................. 30
Discussion........................................................................................... 35

3 CLONING, MUTAGENESIS, SEQUENCING, EXPRESSION,
AND PURIFICATION OF CARBONIC ANHYDRASE V....................... 39

Introduction.......................................................................................... 39
M materials And M ethods........................................................................ 41
Results................................................................................................. 52
Discussion....................................................................................... 57









4 KINETIC AND INHIBITION PROPERTIES OF CARBONIC
ANHYDRASE V................................................................................... 60

Introduction......................................................................................... 60
M materials And M ethods....................................................................... 62
Results................................................................................................ 65
Discussion........................................................................................... 67

5 PROTON TRANSFER AND THE EFFECTS OF ACTIVE SITE
RESIDUES 64,65, AND 131 UPON THE CATALYTIC ACTIVITY OF
CARBO NIC ANHYDRASE V............................................................... 73


Introduction......................................................................................... 73
M materials And M ethods....................................................................... 76
Results................................................................................................ 77
Discussion........................................................................................... 89

6 DISCUSSION AND CONCLUSIONS.................................................. 94

REFERENCES.............................................................................................. 101

BIOG RAPHICAL SKETCH............................................................................ 106














LIST OF TABLES


Table Page

2-1 Marker Enzyme Analysis of Mitochondria Preparation......................... 31

2-2 R1 and RH2o for Mouse Mitochondria and Mouse Blood in the
Presence and Absence of Cupric Ions................................................ 31

2-3 Purification of Mitochondrial Carbonic Anhydrase............................... 31

3-1 Oligonucleotides Used for the Cloning, Sequencing, and
Mutagenesis of Mouse CA V........................................................... 45

3-2 Expression Vectors of CA V and CA V Mutants............................... 55

4-1 Maximal Values of the Steady-State Constants for the Hydration of
CO2 Catalyzed by Isozymes of Carbonic Anhydrase at 25 C ....... 69

4-2 Inhibition of Isozymes of Carbonic Anhydrase Measured by 180
Exchange at pH 7.2-7.5 and 25 C................................................... 69

5-1 Apparent pKa and Maximal Values of kc/KM Stopped Flow and 180
Exchange Measurements of Catalysis by Mouse Carbonic
Anhydrase V and Mutants of CA V................................................... 80

5-2 Apparent pKa and Maximal Values of kc, and RH2o for Mouse
Carbonic Anhydrase V and Mutants of CA V................................... 87














LIST OF FIGURES


Figure Page

1-1 Comparison of amino acid sequences for mouse, rat, and human
carbonic anhydrase isozymes I, II, III, and V................................... 5

1-2 Ribbon-type structure of the backbone of carbonic anhydrase V..... 9

1-3 Overlay of ribbon structures of CA V and CA II highlighting
position 7 and position 64................................................................. 11

2-1 Sequence comparison of rat and guinea pig CA V N-termini with
the deduced amino acid sequences for mouse, human, and rat
C A V ................................................................................................. 19

2-2 Stained blot of SDS-polyacrylamide gel electrophoretic separation
of proteins from the purification of mitochondrial carbonic
anhydrase......................................................................................... 34

3-1 NH2-terminal amino acid sequence of mouse CA V........................ 42

3-2 Coomassie Blue-stained electrophoretic separation of purified
recombinant CA V enzymes on a SDS-polyacrylamide gel............. 51

3-3 Nucleotide and deduced amino acid sequence for the coding
region of CA V cDNA from BALB/c mice........................................... 53

4-1 kJ/KM catalytic constants for hydration of CO2 catalyzed by mouse
carbonic anhydrase Vc and Vb........................................................ 66

4-2 kt catalytic constants for hydration of CO2 catalyzed by mouse
carbonic anhydrase Vc and Vb........................................................ 68

5-1 180 exchange k,/KM catalytic constants for hydration of CO2
catalyzed by mouse carbonic anhydrase Vc, mutants Y64A CA Vc,
Y131A CA Vc, and Y64A/Y131A CA Vc.......................................... 78









5-2 180 exchange kc/KM catalytic constants for hydration of CO2
catalyzed by mouse carbonic anhydrase Vc, mutants Y64H CA Vc,
Y131H CA Vc, and Y64H/F65A CA Vc............................................. 79

5-3 Stopped-flow k./KM catalytic constants for hydration of CO2
catalyzed by mouse carbonic anhydrase Vc, mutants Y64A CA Vc,
Y131A CA Vc, and Y64NY131A CA Vc ........................................... 82

5-4 Stopped-flow kt/KM catalytic constants for hydration of CO2
catalyzed by mouse carbonic anhydrase Vc, mutants Y64H CA Vc,
Y131H CA Vc, and Y64H/F65A CA Vc............................................. 83

5-5 Stopped-flow kt, catalytic constants for hydration of CO2 catalyzed
by mouse carbonic anhydrase Vc, mutants Y64A CA Vc, Y131A
CA Vc, and Y64A/Y131A CA Vc....................................................... 85

5-6 Stopped-flow kct catalytic constants for hydration of C02 catalyzed
by mouse carbonic anhydrase Vc, mutants Y64H CA Vc, Y131 H
CA Vc, and Y64H/F65A CA Vc......................................................... 88














LIST OF ABBREVIATIONS


CA, carbonic anhydrase
CHES, cyclohexylaminoethanesulfonic acid
cDNA, complementary DNA
Da, dalton
DNA, deoxyribonucleic acid
DNase, deoxyribonuclease
dNTPs, dATP + dCTP + dGTP + dTTP
dsDNA, double stranded DNA
E. coli, Escherichia coli
EDTA, ethylenediaminetetraacetic acid
g, gravitational force
HEPES, N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid
IPTG, isopropylthio-3-D-galactopyranoside
kc,, turnover number
kDa, kilodalton
KM, Michaelis-Menten constant
I, liter
LB, Luria broth
MES, 2-(N-morpholino) ethanesulfonic acid
MSB, mannitol sucrose buffer
MW, molecular weight
MOPS, 3-(N-morpholino) propanesulfonic acid
NAD, nicatinamide adenine dinucleotide
NADH, reduced nicatinamide adenine dinucleotide
NH2-terminus, amino terminus
Oligo, oligonucleotide
PEG, polyethylene glycol
R1, rate of interconversion of C02 and HC03
RH2O, rate of release of H21O from the enzyme
RNase, ribonuclease
SDS, sodium dodecyl sulfate
SDS-PAGE, polyacrylamide gel electrophoresis with sodium dodecyl sulfate
ssDNA, single stranded DNA
TAPS, 3-{[tris(hydroxymethyl)methyl]amino} propanesulfonic acid
TCA, trichloroacetic acid
TE, 10 mM Tris-HCL, 1 mM EDTA
Tris, tris(hydroxymethyl)aminomethane














Abstract of Dissertation Presented to the Graduate School of the University of
Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of
Philosophy

PURIFICATION, KINETIC PROPERTIES, INHIBITION CHARACTERISTICS,
AND UNIQUE ACTIVE SITE FEATURES OF CARBONIC ANHYDRASE V

By

Robert Wilson Heck

August 1996

Chairman: David N. Silverman
Major Department: Biochemistry And Molecular Biology

A cDNA encoding a new carbonic anhydrase isozyme reported by

Amor-Gueret and Levi-Strauss (1990), CA V, was cloned and used to express

active protein in E. coil. Purification and protein sequencing of the CA activity

present in mouse liver mitochondria confirmed that the cDNA encoded a

mitochondrial CA. Two potential mature forms were isolated, with N-terminal

deletions of 29 or 51 amino acids. Two truncated CA V cDNAs, corresponding

to the forms isolated from mitochondria, were created and used to express CA

V in E. coil. These two forms of CA V had identical steady state constants for

the hydration of C02, with k,/KM = 3 x 107 M1 s1 and kct = 3 x 105 s-1. These

values are very similar to the rates determined for CA I and about 20% of the










values for CA II. CA V was inhibited by nanomolar concentrations of

ethoxzolamide or acetazolamide, but was resistant to inhibition by micromolar

concentrations of cupric ions.

The apparent pKa of 9.2 for k,t is much higher than seen in other

isozymes. Substitutions of alanines or histidines for the tyrosines at positions

64 and 131 suggest that these tyrosines are not necessary for proton transfer.

A mutant with a histidine at position 64 did not alter the high pK, seen for kt

although it did cause a slight increase in kt at low pH. The xray crystal

structure of CA V indicated that a large phenylalanine at position 65 forces

tyrosine 64 away from the active site. A double mutant with histidine 64 and

alanine 65 had a maximal k,t twice that seen for wild type CA V and a pH

profile of k^, that described two pKas of 6.3 and 9.0. This is the first example

of a second proton shuttle being introduced into a carbonic anhydrase.














CHAPTER 1
INTRODUCTION


Carbonic Anhydrase Isozymes

Carbonic anhydrases (CA) are zinc containing metalloenzymes which

catalyze the reversible hydration of CO2 to form bicarbonate and a proton.

The earliest reports of CA activity demonstrated that red blood cells contained

a hemoglobin free extract that catalyzed the hydration of CO2 (Meldrum and

Roughton, 1933; Stadie and O'Brien, 1933). Purification of carbonic

anhydrase from human blood resulted in the isolation of two distinct carbonic

anhydrase isozymes (Nyman, 1961). These two isozymes were originally

named carbonic anhydrase B and carbonic anhydrase C. Following the

purification of a third isozyme of carbonic anhydrase from muscle tissue

(H1olmes, 1977), the isozymes were designated by Roman numerals. CA B

and CA C are now named CA I and CA II. The muscle isozyme is now

designated as CA II1.

To date, at least seven different isozymes of carbonic anhydrase are

known to exist in amniotes, mostly from mammals (Tashian, 1989). These

isozymes exhibit a remarkable diversity in tissue distribution, subcellular

location, enzymatic activity, and inhibition properties. CA II is a cytosolic










enzyme found in nearly every tissue, while CA VI is secreted and found only in

the salivary glands. There are even carbonic anhydrases found in plant

chloroplasts which have completely unrelated amino acid sequences (Tashian

et al., 1991) and appear to be an example of convergent evolution.



Mitochondrial Carbonic Anhydrases

A carbonic anhydrase activity associated with mitochondria was noted

in early reports (Datta and Shepherd, 1959; Maren and Ellison, 1967). The

physiological function of mitochondrial carbonic anhydrase was initially

suggested from the observation of decreased synthesis of urea and glucose in

chameleons and alligators treated with CA inhibitors (Coulson and Herbert,

1984). Many subsequent studies (reviewed by Dodgson, 1991 a) have

suggested that a mitochondrial carbonic anhydrase activity is used in the

metabolic pathways of gluconeogenesis and ureagenesis, both of which

require bicarbonate as substrate for enzymes compartmentalized within the

mitochondria. Although many of these studies postulated a unique

mitochondrial form of carbonic anhydrase, the first evidence for a specific

mitochondrial isozyme came from characterization of a protein purified from

guinea pig liver mitochondria by Hewett-Emmett et al. (1986). They reported









an amino acid sequence of 24 residues with distinct similarities to other

carbonic anhydrases (this isoform was subsequently termed CA V).

More recently, Amor-Gueret and Levi-Strauss (1990), while screening a

mouse liver cDNA library for mRNA clones containing a mouse B2 repeat,

isolated a cDNA which encoded a protein with strong sequence similarities to

a carbonic anhydrase. Messenger RNA was detectable only in the liver when

seven tissues were tested by Northern blotting and hybridization (Amor-Gueret

and Levi-Strauss, 1990). Examination of this cDNA sequence and comparison

with the partial sequence of Hewett-Emmett et al. (1986) suggested that the

cDNA encoded the mouse homolog of the guinea pig mitochondrial carbonic

anhydrase (CA V) with the addition of a potential mitochondrial leader

sequence. Cloning and expression of the carbonic anhydrase V cDNA

homologues from mouse, human, and rat liver mRNA has shown that CA V is

targeted to and processed in the mitochondria of COS cells (Nagao et al.,

1994). Immunoblot analysis with antibodies raised against recombinant CA V

in mouse and rat tissues shows that CA V is primarily found in liver, although

immunoreactive bands are seen in all of the rat tissues tested (Nagao et al.,

1994). Immunological studies with polyclonal antibodies raised against a CA

V extract prepared from mitochondria have also placed CA V in rat heart,










gastric parietal cell, and kidney intercalated cell mitochondria (V&dndnen et

aL, 1991; Karhukorpi etaaL, 1992).



Comparison of Carbonic Anhydrase V Sequence with Other Isozymes

A comparison of the deduced amino acid sequences of carbonic

anhydrase V with other isozymes of carbonic anhydrase (Fig. 1-1) shows that

there is a high degree of sequence similarity. Mouse carbonic anhydrase V

has 70%, 86%, 45%, 49%, and 43% sequence identity with the human CA V,

rat CA V, mouse CA I, mouse CA II, and mouse CA III, respectively. The most

highly conserved regions are found near residues which surround the active

site, especially the histidines that coordinate the zinc ion (94, 96,119) and

threonine 199.

There are several regions of carbonic anhydrase V that differ

significantly from the other isozymes. The most noticeable is the addition of

30-40 residues at the amino terminal end. This region has many of the

structural properties of the mitochondrial targeting sequences collated by Hartl

et aL (1989). It is rich in positively charged residues, lacks acidic residues

(with the exception of a single aspartate in the fifth residue of mouse CA V),

and has the potential to form an amphipathic helix.











.......o..
..... MLRA
.....MLGRN


Musca5
Ratca5
Humca5
Musca3
Ratca3
Humca3
Humcal
Muscal
Musca2
Ratca2
Humca2


Musca5
Ratca5
Humca5
Musca3
Ratca3
Humca3
Humcal
Muscal
Musca2
Ratca2
Humca2


Musca5
Ratca5
Humca5
Musca3
Ratca3
Humca3
Humcal
Muscal
Musca2
Ratca2
Humca2


.MLRRDPRKP
KMLGRGPYKP
TWKTSAFSFL


20
VSSAEGTRQS
VSSPGGTQQS
VSVPGGTRQS
YPIAKGDNQS
YPIAKGDNQS
FPNAKGENQS
YPIANGNNQS
YPIANGNNQS
FPIANGDRQS
FPIANGDRQS
FPIAKGERQS

70
FDDSCEDSGI
FDDSCEESGI
FDDATEASGI
FDDTYDRSML
FDDTFDRSML
FDDTYDRSML
FEDNDNRSVL
FDDSSNQSVL
FDDSQDNAVL
FDDSQDFAVL
FDDSQDKAVL


LAILRHVGLL
LAILRHMGPL
VEQMWAPLWS


30
PINIQWKDSV
PINIQWTDSV
PINIQWRDSV
PIELHTKDIK
PIELHTKDIR
PVELHTKDIR
PVDIKTSETK
PIDIKTSEAN
PVDIDTATAH
PVDIDTGTAQ
PVDIDTHTAK

80
SGGPLGNHYR
SGGPLGNHYR
SGGPLENHYR
RGGPLSRPYR
RGGPLSGPYR
RGGPLPGPYR
KGGPFSDSYR
KGGPLADSYR
KGGPLSDSYR
KEGPLSGSYR
KGGPLDGTYR


CATGPQRWRF
CATRPQHWRF
RSMRPGRWCS


YDPQLAPLRV
YDPKLAPLRV
YDPQLKPLRV
HDPSLQPWSA
HDPSLQPWSV
HDPSLQPWSV
HDTSLKPISV
HDSSLKPLSI
HDPALQPLLI
HDPSLQPLLI
YDPSLKPLSV

90
LKQFHFHWGA
LKQFHFHWGA
LKQFHFHWGA
LRQFHLHWGS
LRQFHLHWGS
LRQFHLHWGS
LFQFHFHWGS
LTQFHFHWGN
LIQFHFHWGS
LIQFHFHWGS
LIQFHFHWGS


1 7
QHSCAEEHSN
QHSYAEKHSN
QRSCAWQTSN
MAKEWGYAR
.MAKEWGYGS
MAKEWGYAS
MASPDWGYDD
MASADWGYGS
MSHHWGYSK
MSHHWGYSK
MSHHWGYGK

50
SYDAASCRYL
SYDAASCRYL
SYEAASCLYI
SYDPGSAKTI
SYDPGSAKTI
SYDGGSAKTI
SYNPATAKEI
SYNPATAKEI
SYDKAASKSI
CYDKVASKSI
SYDQATSLRI

100
TDEWGSEHAV
TDEWGSEHMV
VNEGGSEHTV
SDDHGSEHTV
SDDHGSEHTV
SDDHGSEHTV
TNEHGSEHTV
SNDHGSEHTV
SDGQGSEHTV
SDGQGSEHTV
LDGQGSEHTV


Figure 1-1. Comparison of amino acid sequences for mouse, rat, and human
carbonic anhydrase isozymes I, II, III, and V. Numbering is based on human CA I
(humcal).


CARHPLWTGP
CARHPLWTGP
NTLHPLWTVP
HNGPDHWHEL
HNGPEHWHEL
HNGPDHWHEL
KNGPEQWSKL
ENGPDQWSKL
HNGPENWHKD
SNGPENWHKE
HNGPEHWHKD

60
WNTGYFFQVE
WNTGYFFQVE
WNTGYLFQVE
LNNGKTCRVV
LNNGKTCRVV
LNNGKTCRVV
INVGHSFHVN
VNVGHSFHVI
VNNGHSFNVE
VNNGHSFNVE
LNNGHAFNVE












Musca5
Ratca5
Humca5
Musca3
Ratca3
Humca3
Humcal
Muscal
Musca2
Ratca2
Humca2


Musca5
Ratca5
Humca5
Musca3
Ratca3
Humca3
Humcal
Muscal
Musca2
Ratca2
Humca2


Musca5
Ratca5
Humca5
Musca3
Ratca3
Humca3
Humcal
Muscal
Musca2
Ratca2
Humca2


Musca5
Ratca5
Humca5
Musca3
Ratca3
Humca3
Humcal
Muscal
Musca2
Ratca2
Humca2


110
DGHTYPAELH
DGHAYPAELH
DGHAYPAELH
DGVKYAAELH
DGVKYAAELH
DGVKYAAELH
DGVKYSAELH
DGTRYSGELH
NKKKYAAELH
NKKKYAAELH
DKKKYAAELH

160
LVDVLPEVRH
LVDILPEVRH
LVDILPEIKH
LLDALDKIKT
LLDALDKIKT
FLDALDKIKT
VLDALQAIKT
VLDALNSVKT
VLEALHSIKT
ITEALHSIKT
VVDVLDSIKT

210
IVQKTPVEVS
IVHKMPIEVS
IIQKEPVEVA
LLLKEPMTVS
LLLKEPMTVS
LLLKEPMTVS
IICKESISVS
VICKDSISLS
IVLREPITVS
IVLKEPITVS
IVLKEPISVS

260
FRLDRTKMRS
FQVPRVGTKS
FQATNEGTRS
FK ........
FK ........
FK ........
F.........
F.........
FK ........
FK ........
FK ........


120
LVHWNSTKYE
LVHWNSMKYE
LVHWNSVKYQ
LVHWN.PRYN
LVHWN.PKYN
LVHWN.PKYN
VAHWNSAKYS
LVHWNSAKYS
LVHWN.TKYG
LVHWN.TKYG
LVHWN.TKYG

170
KDTQVAMGPF
KDTQVTMGPF
KDARAAMRPF
KGKEAPFTHF
KGKEAPFNHF
KGKEAPFTKF
KGKRAPFTNF
KGKRAPFTNF
KGKRAAFANF
KGKRAAFANF
KGKSADFTNF

220
PSQLSMFRTL
PSQLSTFRTL
PSQLSAFRTL
SDQMAKLRSL
SDQMANVRSL
SDQMAKLRSL
SEQLAQFRSL
PEQLAQLRGL
SEQMSHFRTL
SEQMSHFRKL
SEQVLKFRKL


130
NYKKASVGEN
NYKKATTGEN
NYKEAVVGEN
TFGEALKQPD
TSEEALKQPD
TFKEALKQRD
SLAEAASKAD
SASEAISKAD
DFGKAVQQPD
DFGKAVQHPD
DFGKAVQQPD

180
DPSCLMPACR
DPSCLLPACR
DPSTLLPTCW
DPSCLFPACR
DPSCLFPACR
DPSCLFPACR
DPSTLLPSSL
DPSSLLPSSL
DPCSLLPGNL
DPCSLLPGNL
DPRGLLPESL

230
LFSGRGEEED
LFSGRGEDEE
LFSALGEEEK
FSSAENEPPV
FASAENEPPV
LSSAENEPPV
LSNVEGDNAV
LSSAEGESAV
NFNEEGDAEE
NFNSEGEAEE
NFNGEGEPEE


140
GLAVIGVFLK
GLAVIGVFLK
GLAVIGVFLK
GIAVVGILLK
GIAVVGIFLK
GIAVIGIFLK
GLAVIGVLMK
GLAILGVLMK
GLAVLGYFLK
GLAVLGIFLK
GLAVLGIFLK

190
DYWTYPGSLT
DYWTYPGSLT
DYWTYAGSLT
DYWTYHGSFT
DYWTYHGSFT
DYWTYQGSFT
DFWTYPGSLT
DYWTYFGSLT
DYWTYPGSLT
DYWTYPGSLT
DYWTYPGSLT

240
VMVNNYRPLQ
VMVNNFRPLQ
MMVNNYRPLQ
PLVGNWRPPQ
PLVGNWRPPQ
PLVSNWRPPQ
PMQHNNRPTQ
PVLSNHRPPQ
AMVDNWRPAQ
LMVDNWRPAQ
LMVDNWRPAQ


Figure 1-1 (continued)


150
LGAHHQALQK
LGAHHEALQR
LGAHHQTLQR
IGREKGEFQI
IGREKGEFQI
IGHENGEFQI
VGEANPKLQK
VGPANPSLQK
IGPASQGLQK
IGPASQGLQK
VGSAKPGLQK

200
TPPLAESVTW
TPPLAESVTW
TPPLTESVTW
TPPCEECIVW
TPPCEECIVW
TPPCEECIVW
HPPLYESVTW
HPPLHESVTW
TPPLLECVTW
TPPLLECVTW
TPPLLECVTW

250
PLRDRKLRSS
PLRGRNVRSS
PLMNRKVWAS
PVKGRVVRAS
PIKGRVVRAS
PINNRVVRAS
PLKGRTVRAS
PLKGRTVRAS
PLKNRKIKAS
PLKNRKIKAS
PLKNRQIKAS










Amino terminal sequencing of CA V purified from guinea pig and rat

mitochondria suggests that not only are these extra amino terminal residues

not present in the mature form of CA V, but that an additional 20 residues,

corresponding to the amino termini of the other CA isozymes, are also

removed (Hewett-Emmett et al. 1990, and Ohlinger et al., 1993). This result is

surprising since the tyrosine at position 7 of CA I, II, and III is thought to form a

hydrogen bond with water in the active site of these enzymes (Erricksson et

al., 1986, Erricksson, 1988). However, carbonic anhydrase V lacks this

conserved tyrosine and has a histidine (mouse and rat CA V) or a threonine

(human CA V) at position 7. Tashian et al. (1991) have identified a partially

conserved three-amino acid motif found in mitochondrial leader peptides that

undergo a two step cleavage during import (Hendrick et al., 1989) in the

sequence for mouse carbonic anhydrase V. This motif predicts a cleavage

after position 21 that would create a mature form of CA V that corresponds to

the experimentally determined amino termini of guinea pig and rat CA V.

There is also some evidence that the region of CA V corresponding to

residues 1-21 of CA I, II, and III is not removed. Ngao etal. (1994) have

expressed human, mouse, and rat CA V in COS cells and found that these CA

Vs, when purified from the mitochondria of the COS cells, have amino termini

that begin at positions -3, -1, and 1, respectively. These sites are all preceded










by an arginine two residues into the leader sequence as is found in 74% of

matrix protease cleavage sites (Hendrick et al., 1989). A shortened form of

human CA V with an amino terminus corresponding to that found for guinea

pig and rat CA V was also extracted in the absence of protease inhibitors by

Ngao et al. (1993), leading to the suggestion that the shorter forms are the

result of proteolytic degradation during isolation.

The carboxy terminus of carbonic anhydrase V also has seven

additional residues not found in isozymes I, II, and II. The purpose of these

residues is not known. Other notable sequence differences are more easily

described by comparing the three dimensional structure of the isozymes of

carbonic anhydrases.



Structure Of Carbonic Anhydrase V

Boriack et al. (1995) have recently determined the structure of a

truncated form of mouse carbonic anhydrase V lacking the putative

mitochondrial leader sequence and residues corresponding to positions 1-21

(Fig. 1-2). This structure is very similar to the reported structures for human

CA I and CA II (Eriksson etal., 1986) and for bovine CA III (Eriksson, 1988) as

would be expected from the high degree of sequence homology seen between

all of these isozymes. The central portion of carbonic anhydrase V as well as











































Figure 1-2. Ribbon-type structure of the backbone of carbonic anhydrase V.










CAs I-111 is composed of a prominent B-saddle that enfolds the active site. The

catalytic center of the active site is composed of a divalent zinc ion

tetrahedrally liganded by three histidine residues at positions 94, 96, and 119

and a hydroxide ion. In terms of backbone atoms, all of these carbonic

anhydrases have nearly identical structures near the active site.

An important feature of the active site of carbonic anhydrase II is the

presence of a histidine at position 64. Tu and Silverman (1989) have shown

that this residue functions as an intramolecular proton shuttle necessary for

the high rate of catalysis seen in CA II. A histidine is also found at position 64

for CA I, IV, VI, and VII as well. CA III, which has significantly lower activity

than the other isozymes, has a lysine at this position. Mutagenesis of

lysine-64 to histidine-64 in HCA III results in a significant increase in

enzymatic activity (Jewel et al., 1991). Carbonic anhydrase V has a tyrosine

at position 64. If this tyrosine is utilized as a proton transfer site, it should

function differently than the histidine found in the other isozymes.

CA V is also unusual in that it has a bulky phenylalanine-65 (mouse and

rat) or a leucine-65 (human) adjacent to tyrosine-64. All of the other isozymes

have serine (CA I, IV, and VII), threonine (CA III and VI) or alanine (CA II) in

this position. The xray crystal structure for mouse CA V (Boriack et al., 1995)

shows that this phenylalanine sterically hinders tyrosine-64 resulting in an















































Figure 1-3. Overlay of ribbon structures of CA V and CA II highlighting position
7 and position 64










orientation away from the active site. The hydroxyl group of tyrosine-64 of CA

V actually occupies the same space as the hydroxyl of tyrosine-7 in human CA

II if the backbone atoms are superimposed (Fig. 1-3).

A search for other possible ionizable residues within the active site of

mouse CA V that may act as proton shuttles identifies four other residues:

histidine-7, lysine-91, tyrosine-131, and lysine-132. Histidine-7 is unusual

since CA I, II, and III have a conserved tyrosine at this position. The proximity

of histidine-7 to the active site and its physiological pKa make it a likely

candidate as a proton transfer site. Tyrosine-131, lysine-132, and lysine-91

may also function as proton acceptors, although at a higher pH than histidine.



Inhibition and Physiology of Carbonic Anhydrase V

Following the simultaneous discovery of carbonic anhydrases (Meldrum

and Roughton, 1933; Stadie and O'Brien, 1933), much of the early research

on carbonic anhydrases focused upon their inhibition by sulfonamide type

inhibitors. An understanding of the physiology of carbonic anhydrases has

mostly come about from the study of the inhibition of carbonic anhydrases.

With the discovery of at least seven distinct mammalian isozymes to date, the

differences in inhibition properties of these isozymes have become










increasingly important in trying to determine the specific physiological role of

each isozyme.

CA I, II, III, IV, and V have all been found in hepatocytes (Gros and

Dodgson, 1988). CA I, II, and III are present in the hepatic cytosol. CA IV is

thought to be bound to the plasma membrane. CA V is in the mitochondria of

the liver and possibly the kidney (Dodgson et al. 1980). Since CA V makes up

less than 5% of the total hepatocytic CA activity (Dodgson and Watford, 1990),

determining its in vivo function has relied upon the effect of sulfonamide

inhibitors that could penetrate the membrane of the mitochondria. These

studies have been confounded by the presence of the cytosolic CA isozymes.

Early attempts to isolate CA V from guinea pig liver mitochondria

(Dodgson et al., 1980; Hewett-Emmett et al. 1986) have shown that CA

activity in mitochondria is strongly inhibited by sulfonamide type inhibitors.

Since acetazolamide reduced the synthesis of citrulline production in isolated

liver mitochondria, Dodgson et al. (1983) proposed that the function of CA V

was to provide bicarbonate for carbamoyl phosphate synthetase in the urea

synthetic pathway. Other studies have also suggested that CA V supplies

bicarbonate for pyruvate carboxylation and subsequently glucose synthesis

(for a review, see Dodgson, 1991b). The inner mitochondrial membrane has a

low permeability to bicarbonate and entry of bicarbonate through the general










anion carrier in the inner membrane is also slow (Dodgson et al., 1980;

Beavis and Garlid, 1987). Carbonic anhydrase V may be necessary to convert

carbon dioxide into a ready supply of bicarbonate inside the mitochondria.

Many sulfonamide and thiazide diuretics also inhibit carbonic

anhydrases. These drugs caused a decrease in urea synthesis in perfused

rat livers (Haussinger et al., 1986). This led to the hypothesis that the cause

of hepatic encephalopathy in patients with liver cirrhosis treated with diuretics

is from the inhibition of carbonic anhydrase V, resulting in a decrease in urea

synthesis and increased hyperammonemia.

However, none of the above studies has shown that purified carbonic

anhydrase V is inhibited by sulfonamides, nor to what extent. One minor

aspect of this present work is to determine the K, of sulfonamide type inhibitors

upon purified carbonic anhydrase V.



Enzymatic Mechanism

The uncatalyzed interconversion of CO2and HC03 has been

extensively studied (Magid and Turbeck, 1968; Liang and Lipscomb, 1988).

The reaction catalyzed by carbonic anhydrases at pH 7 is:
CO2+ H20 = HCO3- + H+ (1)

However, at higher pH, where hydroxide concentration is increased, the









following reaction must also be considered:

C02+ "H '5 HC03 (2)

The uncatalyzed rate constants for reactions (1) and (2) are 3.5 x 10.2 s' and

8.5 x 103 s1 at 25 C respectively. Measurements of a turnover number as

great as 1.4 x 106 s1 have been made for the reaction catalyzed by human

carbonic anhydrase isozyme II, making it one of the fastest enzymes known

(Khalifah, 1971). The maximal value of ka/KM for human CA II is greater than

108 M1 s', approaching a rate value that is diffusion controlled (Khalifah,

1973; Lindskog and Coleman, 1973).

It is generally accepted that the high catalytic rate of interconversion of

CO2 and HC03 occurs through a nucleophilic attack on CO2 by a zinc-bound

hydroxide in the active site of carbonic anhydrases and that the regeneration

of this hydroxide requires a separate proton transfer step (Simonsson et al.,

1979). Therefore the overall mechanism for the hydration of C02 by carbonic

anhydrases can be divided into two distinct reactions:



,k2 [H20]
CO2 + E.OH- E-OC02H" E*KH2 + HC03 (3)
k.1 k.2

k3
EOH2 + B EOH + BH* (4)
k.3









To regenerate the form of the enzyme active in hydration, the proton transfer

in equation 4 requires a proton acceptor, B.

The apparent second order rate constant for the reaction in equation 3,

k./KM, is equal to klk/(k., + k2). Lindskog et al. (1984) has shown that kc/KM

is dominated by k, for CA II. The hydration of C02 catalyzed by carbonic

anhydrase II has a pH profile for k./KM that is described by a titration curve

with a single ionization with a pKa near 7. The ionization of the zinc-bound

water is thought to be the determining factor for this apparent pKa (Simonsson

and Lindskog, 1982).

Measurements of carbonic anhydrase II activity at steady state show an

inverse relationship between pH and the turnover number, kt (Pocker and

Bjorkquist, 1977). These pH profiles describe a titration curve also with a pKa

of 7, suggesting that the catalytic rate is dependent upon the ionization of a

residue, or residues, with pKa's near 7.

Site-specific mutagenesis studies have clearly demonstrated that the

proton transfer step described by equation 4 is mediated by a single histidine

at position 64 of carbonic anhydrase II (Jewel et al., 1991). In CA I there are

three possible proton acceptors, His-64, His 67, and His-200 (Lindskog et al.,

1984). CA III has been shown to lack significant intramolecular proton transfer

except in mutants where a histidine has been inserted at position 64, 65, and






17


67 (Jewel et al., 1991; Ren et al., 1995). As mentioned previously, carbonic

anhydrase V differs substantially from the other isozymes in terms of likely

proton shuttle groups. Chapter 4 of this work will present data from several

site-specific mutants used to investigate the possible sites of proton transfer in

carbonic anhydrase V.














CHAPTER 2
PURIFICATION OF NATIVE CARBONIC ANHYDRASE V


Introduction

The presence of a carbonic anhydrase activity in mitochondria was

reported in 1959 by Datta and Shepherd. Over twenty years later a unique

mitochondrial specific isozyme of carbonic anhydrase was defined as carbonic

anhydrase V (Dodgson et al., 1980). This isozyme has been isolated and

amino terminally sequenced from guinea pig and rat liver mitochondria

(Hewett-Emmett et al., 1986; Ohlinger, et al., 1993). Comparison of these

amino terminal sequences with known carbonic anhydrases confirmed that CA

V was indeed a unique isozyme of carbonic anhydrase found in liver

mitochondria. A candidate for the complete coding sequence for carbonic

anhydrase V was found accidentally by Amor-Gueret and Levi-Strauss (1990)

as they were searching a mouse liver library for B2 repeat sequences. The

deduced amino acid sequence from this mouse cDNA clone had significant

sequence homology, 40-70%, with other carbonic anhydrases, particularly with

the partial amino terminal sequences for guinea pig and rat CA V (Figure 2-1).










-40 -30 -20 -10 1
MUSCA5 .......... MLRRDPRKPL AILRHVGLLC ATGPQRWRFQ HSCAEEHSNC
RCA5-N .......... .......... .......... .......... ..........
GCA5-N .......... .......... .......... .......... ..........
RATCA5 ..... MLRAK MLGRGPYKPL AILRHMGPLC ATRPQHWRFQ HSYAEKHSNC
HUMCA5 .... MLGRNT WKTSAFSFLV EQMWAPLWSR SMRPGRWCSQ RSCAWQTSNN

11 21 31 41 51
MUSCA5 ARHPLWTGPV SSAEGTRQSP INIQWKDSVY DPQLAPLRVS YDAASCRYL
RCA5-N .......... .VPRGTRQSP INIQWRN
GCA5-N .......... .VPRGTRQSP INIQRRD?IY D??LP??KL? Y
RATCA5 ARHPLWTGPV SSPGGTQQSP INIQWTDSVY DPKLAPLRVS YDAASCRYL
HUMCA5 TLHPLWTVPV SVPGGTRQSP INIQWRDSVY DPQLKPLRVS YEAASCLYI

Figure 2-1: Sequence comparison of rat (RCA5-N) and guinea pig (GCA5-N) CA V
N-termini with the deduced amino acid sequences for mouse (MUSCA5), human
(HUMCA5), and rat (RATCA5) CA V. Numbering is based upon sequence alignment
with human CA I. Sequences from Ohlinger etal., 1993; Hewett-Emmett, 1986;
Ngao, etal., 1993, and Ngao, etal., 1994.







This cDNA sequence was subsequently used as a probe to isolate human and

rat CA V cDNA sequences as well (Ngao eta/., 1993;1994).

An unusual feature of all three of the cDNA sequences encoding CA V

is the addition of 30-40 residues at their amino termini (when aligned and

compared with several of the other isozymes of carbonic anhydrase, Figure 1).

These additional residues exhibit several of the characteristics of a

mitochondrial import signal sequence as discussed in Chapter 1.

The absence of these leader sequences in purified guinea pig and rat

CA V proteins supports the hypothesis that they are mitochondrial leader

sequences which are proteolytically removed during or after import into the










mitochondria. However, the mature form of CA V found in the mitochondria of

mice was not clear from the purification and amino terminal sequencing of

guinea pig and rat CA V. Based upon the work of Hewett-Emmett et al. (1986)

and Ohlinger etal. (1993), the mature form of CA V would have an amino

terminus that lacked twenty residues found in all of the other carbonic

anhydrases. In order to construct a recombinant clone of mouse CA V that

closely resembled the mature form of CA V found in the mitochondria, carbonic

anhydrase was purified from mouse liver mitochondria and two potential amino

terminal sequences were determined for the mature form of the enzyme.

Several activity assays for cytosolic and mitochondrial specific enzymes were

used to demonstrate that the purified protein was obtained from mitochondria.



Materials And Methods

Preparation of Mouse Liver Mitochondria

Mitochondria were purified from mouse liver homogenates by

differential centrifugation using the procedures of Lansman et al. (1981) with

the addition of a 15 minute incubation with 0.1 % digitonin prior to the final

pelleting step. Livers were removed immediately after cervical dislocation of a

mouse and placed in ice cold MSB (0.21 M mannitol, 0.07 M sucrose, 0.05 M

tris, 0.003 M CaCI2, and 0.01 EDTA). A few ml of blood was mixed with










heparin and saved at 4 C for use as a control for contamination by other

carbonic anhydrases. Livers were rinsed twice in MSB to remove excess

blood. MSB was removed by filtering the livers through a nylon screen.

As much as possible of the following procedures were performed in

trays of ice. Centrifuges were maintained at 4 C. Liver tissue was sliced

repeatedly with razor blades custom-fitted to an electric carving knife until it

had a paste-like consistency. The liver paste was resuspended in 140 ml MSB

(less than 0.3 g liver per ml) and passed ten times through a Dounce glass

homogenizer with a type A pestle and then ten times through with a type B

pestle to disrupt the liver cells. Cellular debris was removed from the

homogenized solutions with two low speed spins of 2200 rpm for 5 minutes in

a Sorval HB-4 swinging bucket rotor. Pelleted material from the first low speed

spin was resuspended in 140 ml MSB, passed through the Dounce glass

homogenizer using a type B pestle ten times, and subjected to two additional

low speed spins. The supernatants were pooled. Mitochondrial fractions

were pelleted by centrifuging the supernatant at 9000 rpm for 30 minutes.

Pellets were resuspended in 90 ml of MSB and passed through the glass

homogenizer ten times with a type B pestle. The mitochondrial suspension

was again centrifuged at 9000 rpm for 30 minutes and pelleted material was

resuspended in 90 ml MSB without EDTA. Nine mg of Digitonin (0.1 mg / ml)

were added to the suspension. The solution was kept on ice for 15 minutes

with occasional stirring. Following the digitonin treatment, the mitochondria









were pelleted again at 9000 rpm for 30 minutes. Following removal of the

supernatant, the pellets were weighed, resuspended in a minimum of MSB

without EDTA (from 0.3 to 0.5 g mitochondria per ml), quick frozen in a

dry ice/ethanol bath, and stored at -70 C.


Purification of Carbonic Anhydrase V from Mouse Liver Mitochondria


Frozen mouse liver mitochondria were thawed, resuspended, and lysed

at a concentration of 20 mg protein / ml in a lysis solution containing 1 % triton

X-100, 100 mM tris, 200 mM sodium sulfate, 1 mM mercaptoethanol at pH 9

supplemented with the following protease inhibitors: 1 mM

phenylmethylsulfonylfluoride, 1 mM benzamidine, 5 mM iodacetamide, 1 mM

EDTA, and 2 M leupeptin. Following centrifugation at 23,000 x g for one hour,

carbonic anhydrase was purified from the clear supernatant of these

mitochondrial lysates by affinity chromatography using a procedure based

upon the methods of Khalifah et al. (1977). Affinity gel,

p-aminomethylbenzenesulfonamide coupled to agarose beads (Sigma

Chemicals), was rinsed in a wash solution identical to the lysis solution except

for the omission of triton X-100. The washed affinity gel was added to the

supernatant of the mitochondrial lysate (1 ml affinity gel per 150 ml

mitochondrial lysate) and stirred for 90 minutes at 4 C. The affinity gel was

separated from the lysate by 1 minute of low speed centrifugation (1000-2000

x g). Following careful removal of the supernatant, the affinity gel was washed









by resuspending it in 5 volumes of wash solution and then pelleting it again by

low speed centrifugation. This batchwise washing step was repeated until

absorbance of the supernatant at 260 and 280 nm reached a minimum. The

washed affinity gel was loaded onto a column and carbonic anhydrase was

eluted with 0.4 M sodium azide, 0.1 M tris, pH 7.1. The collected fractions

were checked for eluted protein by looking for an absorbance peak at 280 nm.

Protein containing fractions were combined (40 ml total) and dialyzed against

4 1 of 15 mM tris, 4 mM mercaptoethanol, pH 8.1. Dialysis buffer was changed

every 4 to 8 hours for a total of six buffer changes. The affinity gel eluate was

concentrated from a volume of 40 ml down to 1 ml using an Amicon Centriprep

concentrator with a 10,000 Da molecular weight cut-off. 0.5 ml of the

concentrated eluate was tested for carbonic anhydrase activity by the 80

exchange method described below, and the remainder was further

concentrated with an Amicon Centricon concentrator (10,000 Da cut-off) to a

volume of 40 !jl prior to SDS-PAGE, blotting, and N-terminal analysis.


Total Protein Concentration Assays


Total protein concentrations in liver homogenates and purified

mitochondria were determined with the Total Protein Reagent, Sigma

Diagnostics kit #541. 20 p1l homogenized liver or lysed mitochondria were

mixed with 1 ml of Sigma's Total Protein Reagent and incubated at room

temperature for 10 minutes. Absorbance was measured at 540 nm and









compared to protein standards prepared from 20, 40, 60, 80, and 100 mg / ml

Protein Standard (supplied with Sigma kit # 690 described below) in 1 ml of

the Total Protein Reagent.

The concentration of protein in the purified mitochondrial carbonic

anhydrase dialyzedd and concentrated affinity gel eluate) was determined

using Sigma's Micro Protein Determination Kit #690, a modified Lowry

procedure based upon the procedures of Ohnishi and Barr (1978). 200 Rl of

the purified carbonic anhydrase were mixed with 2.2 ml of the Biuret Reagent

and incubated at room temperature for 10 minutes. 0.1 ml of Folin and

Ciocalteu's Phenol Reagent was then added. The mixture was immediately

vortexed and then incubated for 30 minutes at room temperature. Absorbance

was measured at 725 nm and compared with standard protein concentrations

of 0.25, 0.5, 0.75, and 1.0 mg / ml of Sigma's Protein Standard prepared by the

same procedure.


Marker Enzyme Assays


Marker enzyme assays were used to determine the purity of isolated

mitochondria compared to liver homogenates. Solutions of 1 mg / ml liver

homogenate and 1 mg / ml mitochondria were prepared with 1% triton X-100

for use in the following marker enzyme assays.

The activity of glutamate dehydrogenase, a mitochondrial matrix

enzyme, was determined using the procedures of Beaufay, etal. (1959). 100










g1 of 1 mg / ml liver homogenate or 0.1 mg / ml mitochondria were combined

with 700 gLl of 37.5 mM nicatinamide, 0.4 mM NaCN, 0.125% triton X-100, 1.75

mM NAD, 1.25 mM EDTA, vortexed, and incubated at room temperature for 15

minutes. A Beckman DU600 spectrophotometer was set up to measure

absorbance at 340 nm every 10 seconds over a 10 minute time period. The

data collection was initiated immediately after addition and complete mixing of

200 g1 of 65 mM L-glutamate at pH 7.4 in a 1 ml quartz cuvette. Uncatalyzed

reactions rates were determined by substituting water for the enzyme sample

and background was determined for each sample by substituting water for the

substrate mix of 65 mM L-glutamate. The measured rates were converted to

mol NAD reduced (mg protein)1 min"1 using an extinction coefficient of 1.8 x

104 M1 cm1 for NADH at 340 nm.

Lactate dehydrogenase activity was used as a cytosolic marker

enzyme. Lactate dehydrogenase activity was determined using Sigma

Diagnostics kit #340 using procedures based on the spectrophotometric

method of Wroblewski and LaDue (1955). For every three reactions, 2.7 ml of

0.1 M potassium phosphate buffer, pH 7.5, were added to 0.2 mg NADH (1

substrate vial) and 0.95 ml was aliquotted into eppendorfs. 50 p.l of 2% triton

X-100 and 15 g1l of 1 mg / ml liver homogenate or mitochondria were added

and incubated at room temperature for 20 minutes. A Beckman DU600

spectrophotometer was set up to measure absorbance at 340 nm every 5









seconds over a 5 minute time period. The data collection was initiated

immediately after addition and complete mixing of the preincubated samples

with 35 p1 of 22.7 mM sodium pyruvate, 0.1 M phosphate buffer, pH 7.5 in a 1

ml quartz cuvette. Uncatalyzed reactions rates were determined by

substituting water for the enzyme sample and background was determined for

each sample by substituting water for the substrate mix of sodium pyruvate.

The measured rates were converted to mol NADH oxidized (mg protein)' min1

using an extinction coefficient of 1.8 x 104 MW1 cm1 for NADH at 340 nm.

5'-nucleotidase enzyme activity was used as a plasma membrane

marker enzyme. Activity was measured using Sigma Diagnostics kit #675

which is based on the methods of Dixon and Purdom (1954). Four different

assays were used for each sample to be tested: A) an apparent

5'-nucleotidase phosphatase activity, B) an uncatalyzed apparent

5'-nucleotidase phosphatase activity, C) a nonspecific phosphatase activity,

and D) an uncatalyzed nonspecific phosphatase activity. For assay A, 0.96 ml

of freshly prepared 2.5 mM adenosine phosphate substrate was mixed with 40

gl of 1 mg / ml liver homogenate or mitochondria and incubated at 37 C for

2.5 hours. 200 pl cold 30% TCA was added and reactions were placed on ice

for 5-10 minutes. Unconsumed substrate was precipitated by spinning tubes 5

minutes in a microfuge. The supernatant was saved for inorganic phosphorus

analysis. Assay B was performed identically except liver homogenate or

mitochondria were not added until after the addition of TCA. Assays C and D









were performed identically to assays A and B, respectively, except 0.96 ml of

1.6 mM glycerophosphate, pH 7.5, was used instead of adenosine phosphate.

The amount of phosphate released by assay A-D (as determined by the

inorganic phosphorus analysis described below) was added or subtracted as

follows to determine the pmol phosphate released mg1 min' by 5'

nucleotidase activity: (A B) (C D).

Inorganic phosphorus analysis was used to determine the phosphate

released during the 5' nucleotidase assays and the glucose-6-phosphatase

assays. The analysis was performed using the Phosphorus, Inorganic

detection kit #670 from Sigma Diagnostics. This kit employs a modification of

the methods described by Fiske and SubbaRow (1925). 800 gl of test sample

were mixed with 200 gl of acid molybdate solution (ammonium

molybdate*4H20, 0.125 g / L, in 2.5 N sulfuric acid) and 50 gl of Fiske &

SubbaRow reducer (1-amino-2-naphthol-4-sulfonic acid, 0.8%, sodium sulfite

and sodium bisulfite). This solution was left at room temperature for 10

minutes and then absorbance at 660 nm was determined. Measurements

were compared to a calibration curve based on the results from phosphorus

determinations of 5 potassium phosphate standards of 26, 52, 104, and 156

nmol / ml.










Glucose-6-phosphatase activity was used as an endoplasmic reticulum

marker enzyme. Activity was measured using the procedure of Swanson

(1955). For each assay, 100 gl 1 mg / ml liver homogenate, mitochondria, or

water (blank) was combined with 300 p1 65 mM maleic acid, pH 6.5 and 100 1l

0.1 M glucose-6-phosphate. Following an incubation of 15 minutes at 37 C,

200 p.1 30% TCA and 300 p!1 water were added. The reactions were

centrifuged 10 minutes at 10,000 x g. The resulting supernatant was saved for

inorganic phosphorus analysis. The amount of phosphorus detected for the

blank was subtracted from the catalyzed reactions resulting in a determination

of pmol phosphate released mg1 ml-1.

Acid phosphatase activity was used as a lysosomal marker enzyme.

Activity was measured using the Sigma Diagnostics kit #104: Phosphatases,

Alkaline, Acid, Prostatic Acid. For each assay, 100 1l of 4 mg / ml

p-nitrophenol phosphate and 100 g1 of 90 mM citrate, 10 mM chloride, pH 4.8

were mixed and pre-incubated at 37 C for 2 minutes. 40 g1 of 1 mg / ml liver

homogenate, mitochondria, or water (blank) were added and the solutions

were incubated for 30 minutes at 37 C. The reactions were stopped with the

addition of 1 ml 0.1 N NaOH and absorbance at 410 nm was determined after

zeroing the spectrophotometer with a blank reaction. The background

absorbance of 1.2 ml 0.1 N NaOH mixed with 40 p1 of liver homogenate or










mitochondria was subtracted from the catalyzed measurement. The adjusted

absorbances were compared to the absorbances measured for standard

solutions of 0.91 to 9.1 iM p-nitrophenol to determine the amount of nmol

p-nitrophenol released mg1 min1.


SDS-PAGE and N-Terminal Sequencing


The carbonic anhydrase purified from the mitochondria was separated

by electrophoresis on a 10% SDS-polyacrylamide gel, transferred to a Pro-Blot

membrane (Applied Biosystems), stained with Coomassie blue, and

photographed. The bands at 28, 30, and 31 kDa were sequenced at their

N-terminus. Sequence analysis was performed on an Applied Biosystems

Automated Gas Phase Sequencer at the Interdisciplinary Center for

Biotechnology Research at this University.


Oxygen-18 Exchange Activity Measurements


Carbonic anhydrase activity was determined by measuring the rate of

exchange of 10 from 12CO2 to 13CO2 caused by the transitory labeling of the

active site of carbonic anhydrase using the method described in Silverman

(1982). These exchanges are observed at chemical equilibrium. The reaction

solution was in contact with a membrane permeable to gases; CO2 passing

across the membrane entered a mass spectrometer (Extrel EXM-200)









providing a continuous measure of isotopic content of C02. Two rates were

determined: R1, the rate of interconversion of C02 and HCO3 ; and RH2o, the

rate of release from the enzyme of H2180 (Silverman, 1982). All measurements

were performed in 8-10 ml total volume of 100 mM Hepes, pH 7.5, 25 mM total

(HCO3 + C02), at 10 C. Triton X-100 was added to 1% to ensure lysis of the

liver homogenate and mitochondrial samples.



Results

Purification of Mouse Liver Mitochondria

Mitochondria isolated from mouse livers was tested for the presence of

several marker enzymes to demonstrate the purity of the mitochondrial

preparation. Table 2-1 shows that the activity of glutamate dehydrogenase, a

mitochondrial matrix enzyme, was increased 3-fold in the purified liver

mitochondria compared to the total liver homogenate. Contaminating cytosol

and plasma membrane, as indicated by the presence of lactate

dehydrogenase and 5' nucleotidase, were reduced to less than 11% and 5%,

respectively. The amounts of lysosomal and endoplasmic reticulum

components that copurified with the mitochondria were somewhat higher with

27% and 21% of the original activity of acid phosphatase and

glucose-6-phosphatase still present.











Table 2-1
Marker Enzyme Analysis of Mitochondria Preparation

Glutamate Lactate 5' Nucleotidase Acid Glucose-6-
Dehydrogenase Dehydrogenase Phosphatase Phosphatase
(Mit Matrix) (Cytosol) (Plasma Membrane)(Lysosomes) (Endoplasmic
Reticulum)

Liver Homogenate 5.3 0.3 220 21 4.4 0.5 146 5 12 4
Liver Mitochondria 14.8 0.2 25 5 0.22 0.09 39 20 2.5 .5
RSA 2.8 0.11 .05 .27 .21

Enzyme activities are expressed as nmol NAD reduced mg"' min1 for Glutamate Dehydrogenase and
Lactate Dehydrogenase. 5' Nucleotidase activity and Glucose-6-phosphatase activity is expressed as
pmol phosphate released mg"1 min1. Acid Phosphatase activity is expressed as nmol p-nitrophenol
released mg-1 min-'. Relative specific activity (RSA) is the ratio of mitochondrial specific activity / liver
homogenate specific activity.

Table 2-2
R, and R. for Mouse Mitochondria and Mouse Blood in the Presence and Absence of Cupric Ions.

Sample R1 R20o
(mol sec"') (mol sec"1)

Mitochondria 0.18 0.02 0.42 0.09
Blood 0.11 0.03 0.27 0.08

Mitochondria + Cu2 0.16 0.01 0.39 0.04
Blood + Cu2 0.06 0.01 0.01 0.01

Mitochondria + Blood 0.28 0.83
Mitochondria + Blood + Cu2. 0.25 0.65

Data were measured in 8 ml of 100 mM Hepes, 1% triton X-100, at pH 7.4 and 10 C. The total
concentration of CO2 + HC03 was 25 mM. The same quantities of mitochondria, blood, and Cu2 were
used for each individual assay as well in the mixtures. Mitochondria were tested at 6.9 mg mitochondria
/ ml, whole mouse blood at a dilution of 1:533, and Cu2 at 10 mM.

Table 2-3
Purification of Mitochondrial Carbonic Anhydrase

Purification Step Total Protein Total Activity Specific Activity Yield Purification
(grams) (mol sec-)(mol sec-1 mg protein-) (%) (fold)

Liver Homogenate 20.4 1760 0.0865 100 6
Liver Mitochondria 6.1 88 0.0145 5 1
Affinity Gel Eluate 0.00015 42 281 2.4 19400

R, was used as a measure of activity. Data were measured in 100 mM Hepes, 1% triton X-100, at pH
7.4 and 10 C. The total concentration of CO2 + HC03 was 25 mM.









Identification of Carbonic Anhydrase Activity in Mouse Liver Mitochondria

Carbonic anhydrase activity was found in the purified mouse

mitochondria using the 180 exchange method. The rates of interconversion of

CO2and HCO3 at chemical equilibrium, R1 and the rates of dissociation of

water from the active site, RH2O catalyzed by various forms of carbonic

anhydrase in samples of mitochondria and blood are shown in Table 2-2. The

values of R1 and RH2o for the mitochondrial sample indicate a low, but

significant, amount of carbonic anhydrase activity exists in isolated

mitochondria as compared to mouse blood. Cupric ions, inhibitors of RH2o in

CA II (Tu et aL, 1981), eliminated almost all RH2o carbonic anhydrase activity in

mouse blood, but had little effect upon the mitochondrial carbonic anhydrase

activity. The inhibition of the blood component of a mitochondrial lysate +

blood + cupric ion mixture demonstrated that the lack of effect of the cupric

ions on the mitochondrial CA activity was not caused by sequestration of a

component of the lysed mitochondrial suspension.

1 IgM ethoxzolamide, a potent inhibitor of CA I, II, and IV, was also

tested for its effects upon CA activity. The addition of ethoxzolamide

completely abolished almost all CA activity in every sample of mitochondria or

blood tested (data not shown).









Purification of Mitochondrial Carbonic Anhydrase

Table 2-3 shows the amount of carbonic anhydrase activity recovered

from the liver mitochondria after affinity chromatography. The specific activity

of carbonic anhydrase present in the purified sample was increased over

19,000-fold compared to the activity in the mitochondria. Almost half of all of

the carbonic anhydrase activity detected in the mitochondria preparation was

recovered during the purification. The six-fold decrease in activity and yield of

carbonic anhydrase following the purification of the mitochondria from the liver

homogenate was expected since several cytosolic and blood carbonic

anhydrases were removed during this step.

N-Terminal Analysis of Native Carbonic Anhydrase V

The proteins present in the preparation of mitochondrial carbonic

anhydrase are shown on a Coomassie blue stained blot of a 10%

SDS-polyacrylamide gel in Figure 2-2. The bands at 28, 30, and 31 kDa were

excised from the blot and sequenced at their N-termini. The bands at 30 and

31 kDa were mixtures of proteins which appeared to contain the sequence

QHS, but the sequencing data was not definitive. Figure 2-1 shows this

sequence beginning at position -1 of the deduced amino acid sequence from

the cDNA for mouse CA V. The band at 28 kDa showed one major component























MCA Vc MitoCA MCA Vc


"^~~~ ~ "*",. i b~ii





28 kDa




















Figure 2-2. Stained blot of SDS-polyacrylamide gel electrophoretic separation of
proteins from the purification of mitochondrial carbonic anhydrase, MitoCA.
Lanes marked with MCA Vc are the truncated recombinant form of MCA V
described in Chapter 3.










which had an N-terminal sequence of AEGTR. This sequence is found at

positions 23 through 27 in the mouse CA V sequence shown in Figure 2-1.

These results indicated that the protein isolated from the mitochondria

matched an internal portion of the deduced amino acid sequence of the

carbonic anhydrase cDNA discovered by Amor-Gueret and Levi-Strauss

(1990). The 28 kDa protein had an amino terminus consistent with the

removal of 52 residues from the full length CA V encoded by the cDNA. The

data from the N-terminal analysis of the 30 and 31 kDa bands also suggested

that CA V from mitochondria may have an amino terminus that begins at

position -1 after the removal of only 29 residues. Based on the deduced

amino acid sequence of Amor-Gueret and Levi Strauss (1990), the predicted

molecular weights for truncated forms of mouse CA V lacking 29 or 52

residues would be 28 or 31 kDa.



Discussion

Carbonic anhydrase purified from mouse liver mitochondria has an

amino terminal sequence that confirms the identity of the cDNA of

Amor-Gueret and Levi-Strauss (1990) to be carbonic anhydrase V. The

clearest amino terminal sequence of CA V that I found in lysates of liver

mitochondria that were heavily inhibited with protease blockers was a










truncated form that lacks a region homologous to the initial 22 or 23 residues

found in carbonic anhydrases I, II, and III. This truncated form of CA V is

within one residue of the homologous amino terminal sequence positions

determined for CA V isolated from rat and guinea pig mitochondria as shown

in Figure 2-1. However, it is still quite possible that this short form is a

proteolytic product of a full length CA V found in the mitochondrial matrix.

Ngao etal. (1993; 1994) have expressed human, rat, and mouse CA V in COS

cells and found amino termini corresponding to position -1 for mouse and rat

CA V and position 3 for human CA V. However, these overexpressed CA V

proteins were purified from whole cell lysates of COS cells, so the degree of

mitochondrial processing is uncertain.

All of the results to date indicate that a portion of the carbonic

anhydrase V amino terminal sequence is absent in samples isolated from

mitochondria. This is consistent with many other mitochondrial matrix proteins

which have an amino terminal leader sequence that is proteolytically removed

during import into the mitochondria (HartI et al., 1989). The amino terminus of

mouse CA V has several of the structural properties of the mitochondrial

leader sequences described by HartI et al. (1989). It is rich in positively

charged residues, lacks acidic residues, and could possibly form an

amphipathic helix.









Arginine 12, proline 14, and threonine 17 comprise a partially

conserved three amino acid motif (arginine at -10, hydrophobic residue at -8,

and serine, threonine, or glycine at position -5 relative to the cleavage point)

found in mitochondrial leader peptides that undergo a two-step cleavage

during import (Hendrick et al., 1989). This motif predicts a cleavage after

residue 21 of mouse CA V, resulting in an amino terminus with an initial

sequence of SAEGT that is within one residue of the results of my purification

and sequencing of mouse CA V and in direct alignment with the results for

guinea pig and rat CA V (Hewett-Emmett et al., 1986; Ohlinger et al., 1993).

The mature form of mouse CA V was not unambiguously identified by

these studies. Indeed, there is substantial evidence to indicate that mouse CA

V could have an amino terminus that begins near position 1, position 22, or

both. It would be interesting to see if the mouse CA V cDNA transfected into a

mouse cell line will be processed similar to the results seen by transfecting

mouse CA V into human COS cells by Ngao etal. (1994).

There is little sequence conservation in the region of residues 1-22 of

CA V when compared to other isozymes (see Figure 1, Chapter 1). CA I, II,

and III have nine highly conserved residues within this region. However, the

only two residues of CA V that are even partially conserved in this region,

serine 8 and tryptophan 16, match two structurally important residues in CA II










that comprise the internal portion of a loose alpha helix in the crystal structure

of CA II (Eriksson etal., 1988). Therefore, evolutionary sequence

comparisons provide some support for both the presence and the absence of

residues 1-22 in the mature form of mouse CA V.

The mitochondrial CA preparation could have been contaminated by

several other isozymes, notably CA I, II, III, and IV. The possibility of

contamination by CA III, a sulfonamide resistant isozyme, could be eliminated

since all mitochondrial carbonic anhydrase activity was completely inhibited by

ethoxzolamide inhibition. The lack of inhibition by cupric ions on the carbonic

anhydrase activity detected in the mitochondria demonstrated that CA I and

CA II were not present as well. Tu etal. (1981) have shown that RiM Cu2l

inhibits the rate of dissociation of water from the active site, RH2o, of CA II,

most likely by binding to histidine 64 and interfering with proton transfer.

Since the proton transfer step is thought to be mediated by a histidine in CA I

(Lindskog et al., 1984), it is not surprising that Cu2l inhibited almost all of the

RH20 CA activity in the mouse blood sample. Although there are no reports of

inhibition of CA IV by cupric ions, it is likely that the histidine at position 64 of

this isozyme is similarly affected. The lack of inhibition of CA V by cupric ions

points that this isozyme may function differently than the other isozymes,

especially in terms of proton transfer.














CHAPTER 3
CLONING, SEQUENCING, MUTAGENESIS, EXPRESSION, AND
PURIFICATION OF CARBONIC ANHYDRASE V

Introduction

Amor-Gueret and Levi-Strauss (1990), while screening a mouse liver

cDNA library for mRNA clones containing a mouse B2 repeat, isolated a cDNA

encoding a protein with strong sequence similarities to a carbonic anhydrase.

Of seven tissues tested, messenger RNA was detectable only in liver

(Amor-Gueret and Levi-Strauss, 1990). Examination of this cDNA sequence

and comparison with the partial sequence of Hewett-Emmett etal. (1986)

suggested that the cDNA encoded the mouse homolog of guinea pig

mitochondrial carbonic anhydrase (CA V).

Chapter 2 described the purification of carbonic anhydrase from mouse

liver mitochondria and the use of NH2-terminal sequence analysis to confirm

that this cDNA encoded mouse CA V. The NH2-terminal sequencing results

also suggested that mouse CA V may exist as two different mature forms

within the mitochondria.

The cDNA sequence of Amor-Gueret and Levi-Strauss (1990) was

used to amplify and clone a full-length CA V sequence from mouse liver RNA

39










by reverse transcription-PCR (Heck et al., 1994). The entire mouse CA V

coding sequence (MCA Va) was expressed using the T7 expression vector

system described in Tanhauser et al. (1992). Two shorter forms of the

enzyme, MCA Vb and MCA Vc were also expressed. These shorter forms

were truncated at the amino terminus to correspond with the NH2-termini of CA

V purified from mouse liver mitochondria. All three forms of the expressed

proteins were purified and characterized by NH2-terminal analysis.

Two independently obtained clones of the coding sequence of mouse

CA V were sequenced to confirm the published sequence of Amor-Gueret and

Levi-Strauss and to identify any sequence errors that may have been

introduced during cloning.

Several site specific mutants of carbonic anhydrase V were constructed

to investigate the function of three unique residues, tyrosine 64, phenylalanine

65, and tyrosine 131, found in the active site of CA V. All of these mutant

constructs expressed as active carbonic anhydrase enzymes and DNA

sequencing confirmed that the coding sequence was indeed changed as

expected.










Materials and Methods

Cloning of Mouse CA V

The cloning of the full length mouse CA V coding sequence was

done by Dr. Susan Tanhauser, in the laboratory of Dr. Philip Laipis at the

University of Florida. The cloning of the two NH2-terminal deletion mutants,

MCA Vb and MCA Vc, was done by Ms. Rajyalakshmi Manda in the same

laboratory. The mouse CA V coding sequence was reverse-transcribed from

BALB/c mouse liver RNA using an antisense 3' -end primer (nucleotides

1030-1049; a Barn HI site was added to the 5'-end) based upon the cDNA

sequence of Amor-Gueret and Levi-Strauss (1990). The products of first

strand synthesis were amplified using the polymerase chain reaction and a

5'-sense primer (nucleotides 105-123; an Eco RI site was added to the 5'-end).

A major PCR product of 962 base pairs was obtained. It was inserted into a

Bluescribe vector (Stratagene) that had been cut with Sma I and T-tailed

(Marchuk et al., 1991). The cloned products were identified as mouse CA V by

restriction site analysis and partial DNA sequencing. A full-length coding

sequence, CA Va, as well as two deletion mutants, mouse CA Vb and CA Vc,

were synthesized by PCR from the initial PCR-derived clones using the

original 3'-oligonucleotide and three new 5'-primers, which added a Nde I











-30 -20 -10 1 11 21
t t t
Mouse CA Va MLRRDPRKPL AILRHVGLLC ATGPQRWRFQ HSCAEEHSNC ARHPLWTGPV SSAEGTRQSP
Mouse CA Vb ............................ MQ HSCAEEHSNC ARHPLWTGPV SSAEGTRQSP
Mouse CA Vc ......... .................... ......... ..................... ..SAEGTRQSP

Figure 3-1. NH2-terminal amino acid sequence of mouse CA V. The numbering is based upon
the sequence for CA I. The sequence for CA Va is the deduced amino acid sequence from the
nucleotide sequence of Amor-Gueret and Levi-Strauss (1990). CA Vb and CA Vc are truncated
proteins which correspond to the mature forms of CA V found in the mitochondria of mouse
livers. The presence of a methionine at the initial position of recombinant CA Vb and the
absence of a methionine for CA Vc were detected by amino terminal analysis. The daggers
designate the most abundant amino-terminal residues found in several preparations of CA Va.





restriction site and Met start codon at the positions shown in Figure 3-1. The

Nde I and Barn HI restriction sites allowed the constructs to be inserted into

the pET31 T7 expression vector (Tanhauser et al., 1992). These clones were

transformed into Escherichia co/i BL21 (DE3) pLysS, a strain optimized for T7

RNA polymerase expression.


Sequencing of the Mouse CA V Coding Sequence


The entire CA V coding sequence cloned into Bluescribe (Stratagene)

was sequenced as well as the CA V regions of the pET31 expression vectors

(Tanhauser et aL., 1992) to confirm the published sequence of Amor-Gueret

and Levi-Strauss and to identify any sequence errors that may have occurred


during cloning.









Plasmid DNA was prepared for sequencing by an alkaline lysis miniprep

procedure, followed by an additional PEG precipitation to remove RNA. This

alkaline lysis miniprep procedure was also used extensively to prepare DNA

samples for restriction analysis during mutagenesis and cloning procedures. 4

ml of LB media (Luria broth: 5 g yeast extract, 5 g NaCI, 10 g bactotryptone,

pH 7.4, per liter of deionized water) containing 100 mg / I ampicillin were

inoculated with TG1 or BL21 cells containing the plasmid to be sequenced.

The cultures were grown overnight at 37 C to saturation. Cells were pelleted

in a 1.5 ml eppendorf tube by a 20 second centrifugation followed by removal

of the supernatant. The pellets were resuspended by vortexing in 100 RII of 50

mM glucose, 10 mM EDTA, 25 mM tris-HCL, pH 8.0. After a 5 minute

incubation at room temperature, 200 gl of freshly prepared 0.2 N NaOH, 1%

(w/v) SDS was added and mixed by gentle rocking. Solutions were placed on

ice for at least 5 minutes. The solution was neutralized with 150 uil of ice cold

5 M potassium acetate, pH 4.8, and vortexed on high for at least 2 seconds.

Following a 5 minute incubation on ice, the samples were centrifuged for 1

minute and the supernatant was transferred to a clean microfuge tube.

Samples were ethanol precipitated by adding 0.9 ml of cold ethanol and

centrifuging for 10 minutes at 4 C. After removing the supernatant, the pellets

were washed with 0.9 ml cold 70% ethanol and centrifuged for 1 minute.










Following removal of the supernatant, the pellets were dried under vacuum for

15 minutes. The pellets were dissolved in 400 gl 10 mM tris-HCL, 1 mM

EDTA, pH 8 (TE) and 16 gl 1 mg / ml boiled RNase A. The solutions were

incubated for 30 minutes at room temperature and then protein was extracted

with an equal volume of phenol:chloroform (equal parts v/v). The aqueous

phase was collected and 3 M sodium acetate, pH 5.2, was added to bring the

solution to 0.3 M sodium acetate. DNA was ethanol precipitated with the

addition of 0.9 ml cold ethanol and centrifugation for 10 minutes at 4 C.

Pellets were washed with 70% cold ethanol and then again dried under

vacuum. Dried pellets were dissolved in 50 gil TE. DNA was precipitated

again by adding 30 pl. of 20% polyethylene glycol (PEG), MW 8000, 2.5 M

NaCI. Solutions were left on ice for 1 hour and then centrifuged for 15 minutes

at 4 C. The pellets were washed with cold 70% ethanol, dried under vacuum,

and dissolved in 20 1I TE.

Sequencing of double stranded DNA plasmids was by cycle sequencing

using the procedures and materials in the Promega fmol Cycle Sequencing kit.

Table 3-1 includes the oligonucleotides used as sequencing primers.









Table 3-1
Oligonucleotides Used for the Cloning, Sequencing, and Mutagenesis of Mouse CA V
Name Sequence (5'-3') Description
DS44 CCG AAT TCA TAT GCT CAG 101-132. NH2-end with added
GAG AGA CCC CCG C Nde I and Eco RI sites.
DS45 CGG ATC CTC AGA TTA AGA M1011-993. COOH-endwith
CCT CAT CTT G added Barn HI site
DS58 CGC GGA TCC GGT CTG CTC M1049-1030. COOH-end with
TGC CTA TC added Barn HI site.
DS 59 CGG AAT TCA GCC AAG ATG 105-133. MCA Va NH2-end with
CTC AGG AGA added Eco RI site.
DS100 CAT ATG TCA GCA GAA GGC 265-281. MCA Vc NH2-end with
ACC CG added Nde I site.
DS101 CAT ATG TCA GCA GAA GGC 198-215. MCA Vb NH2-end with
ACC CG added Nde I site.
DS102 CAC TGG C.A CTT CTT CCA 384-403. Tyr 64 to His 64.
GG Creates a Bal I site.
DS103 CAC TGG CGC TTT CTT CCA 384-403. Tyr 64 to Ala 64.
GG Creates a Hae II site.
DS146 TGC TCT GAG CCC CAT TCA M521-502. Exon 3 minus primer.
_____TC
DS150 GAA _QTC CAC GAA ATA TGA 567-593. Tyr 131 to His 131.
AAA TCA CAA Knocks out an Eco RI site.
DS151 GAA _QTC CAC GAA ATA TGA 567-595. Tyr 131 to Ala 131.
AAA TGC CAA GA Knocks out an Eco RI site
DS159 GGG GAG CAA CAG ATG AAT 491-508. Exon 3 plus primer.
DS160 AGC CAG TGT TCC AGA GGT M391-374. Exon 2 minus primer.
DS161 GCC AAG ATG CTC AGG AGA 106-123. NH,-end primer
DS162 CCA GGG TAG GTC CAG TAA M785-768. Exon 6 minus primer.
DS163 GGT CAT CGG CGT GTT TCT 624-641. Exon 4 plus primer.
DS164 CGG TCT GCT CTG CCT ATC M1047-1030. COOH-end primer
DS165 CTC ACC ACC CCG CCA CTT 790-807. Exon 6 plus primer
PL97 CAG AAA CAG GCC GAT GAC M642-625. Exon 4 minus primer
Numerical locations are based on the sequence of Amor-Gueret and Levi-Strauss (1990). An
M prior to the numerical position indicates that the oligonucleotide sequence is based on the
complementary sequence. Nucleotides not found in the published sequence are underlined.










Each sequencing primer was end-labeled with [y-3P] adenosine

triphosphate (ATP) using T4 polynucleotide kinase. 2 lI of template DNA

(usually approximately 1 gg was used although Promega claimed fmol

amounts could be used) were mixed with the end labeled primers and TAQ

DNA polymerase in the supplied sequencing buffer. 2 gl of this primer /

template mix were added to four 0.5 ml thermal cycler tubes preloaded with 4

il of dNTPs + ddATP, dNTPs + ddCTP, dNTPs + ddGTP, or dNTPs + ddTTP.

Sequencing reactions were overlaid with 20 gl mineral oil and placed in a

thermal cycler programmed to heat the samples to 95 C for 2 minutes

followed by 30 cycles of 95 C for 30 seconds, 42 C for 30 seconds, and 70

C for 1 minute. At the end of the thermal cycling, 3 p!1 of Promega stop buffer

were added and reactions were placed at -20 C until ready for loading. Just

prior to loading on a 6% polyacrylamide, 6M urea sequencing gel, samples

were heated to 72 C for 2 minutes. Following electrophoresis, gels were

transferred to Whatman 3M paper, covered with plastic wrap, and visualized

by autoradiography on Kodak X-Omat XAR film.

Mutagenesis of CA V

Mutant carbonic anhydrase V enzymes were created using the methods

of Kunkel etal. (1987). No subcloning of the pET31 CA V vectors into M13










was necessary since Tanhauser et al. (1992) engineered an f1 replication

origin for the efficient synthesis of the single stranded DNA (ssDNA) template

needed for this mutagenesis procedure. Single stranded pET31 CA V DNA

was produced by transforming a pET31 CA V vector into E. coli BW313 (a dut

, ung strain which misincorporates uracils in place of thymines) and inducing

ssDNA synthesis by incubating these cells in presence of VCS-M13 helper

phage (Stratagene). Following the preparation of the ssDNA, a

phosphorylated mutagenic oligonucleotide (see Table 3-1 for oligos used) was

annealed to the single stranded template and used to prime second strand

synthesis in the presence of T4 DNA polymerase, T4 DNA ligase, ATP, and

dNTPs. The resulting hybrid double stranded DNA plasmid, consisting of the

template uridine-containing DNA strand and a mutated strand without uridines,

was transformed into E. coll strain TG1 and plated onto LB agar plates

supplemented with 100 gg / ml ampicillin to screen for cells containing the

ampicillin resistant pET31 plasmid. Since TG1 preferentially degrades

uracyl-containing DNA, the yield of mutated plasmids found is enhanced.

Each mutagenic oligonucleotide was designed to alter a restriction site.

Mutant plasmids were detected by restriction digests of DNA purified using the

miniprep procedure described above. Every mutant plasmid used for










subsequent expression of mutant CA V was DNA sequenced to confirm the

altered sequence introduced.

Expression of Mouse CA V in E Coi

The growth of E. coil BL21 (DE3) pLysS cells containing mouse CA V

constructs and the subsequent expression of CA V protein was optimized for

maximum levels of expressed CA V protein. The most effective growth

conditions were found to include a lengthening of the incubation times

described in Tanhauser et al. (1992) as described below. 4 ml of growth

media (LB supplemented with 200 mg / I ampicillin and 35 mg / I

chloramphenicol) were inoculated with E. coli BL21 (DE3) pLysS cells

containing a pET31 mouse CA V construct and incubated at 37 C for 8-12

hours. Fresh growth media was inoculated with these cultures at a ratio of

1000 to 1 of fresh media to culture, and incubated at 37 C with orbital shaking

at 260 rpm. The optical density (OD) of the culture was monitored at 600 nm.

Upon reaching an ODoo of 1, 50 IM IPTG, 10 iM ZnSO4, and 0.2% (w/v)

glucose were added. The cells were incubated an additional 4 to 6 hours after

induction. Cells were harvested by centrifugation at 6000 x g for 10 minutes

and stored frozen at -70 C.









Purification of Expressed Mouse CA V

The purification procedure for CA V is based upon the methods used to

purify carbonic anhydrase II as described by Khalifah et al. (1977). Frozen

cell pellets containing expressed CA V were thawed and resuspended in 1 ml

cold wash buffer per liter of original culture. Wash buffer consists of 100 mM

tris, 200 mM sodium sulfate, pH 9 with the addition of the following protease

inhibitors for the purification of the full length MCA Va expression product: 1

mM phenylmethylsulfonylfluoride, 1 mM benzamidine, 5 mM iodacetamide, 1

mM EDTA, and 2 M leupeptin. DNase I was added at 1 mg per 10 ml of

suspended cells and solutions were stirred for 1 hour at 4 C. Following

centrifugation at 23,000 x g for one hour, carbonic anhydrase was purified

from the clear supernatant of these bacterial lysates by affinity

chromatography using a procedure based upon the methods of Khalifah et al.

(1977). Affinity gel, p-aminomethylbenzenesulfonamide coupled to agarose

beads (Sigma Chemicals), was rinsed in the wash buffer. The washed affinity

gel was added to the supernatant (1 ml affinity gel per 20 ml supernatant) and

stirred for 90 minutes at 4 C. The affinity gel was separated from the

bacterial lysate by 1 minute of low speed centrifugation (1000-2000 x g).

Following careful removal of the supernatant, the affinity gel was washed by

resuspending it in 5 volumes of wash solution and then pelleting it again by










low speed centrifugation. This batchwise washing step was repeated until

absorbance of the supernatant at 260 and 280 nm reached a minimum. The

washed affinity gel was loaded onto a column and carbonic anhydrase was

eluted with 0.4 M sodium azide, 0.1 M tris, pH 7.1. The collected fractions

were checked for eluted protein by looking for an absorbance peak at 280 nm.

Protein containing fractions were combined and dialyzed against 4-6 1 of 15

mM tris, 4 mM mercaptoethanol, pH 8.1. Dialysis buffer was changed every 4

to 8 hours for a total of six buffer changes. Most preparations of CA V were

stored frozen at -20 C in small aliquots although some samples were kept at

4 C for testing that occurred within a day of the purification.

The purity and molecular weight of each purified enzyme was checked

by electrophoresis on a SDS-polyacrylamide gel as shown in Figure 3-2. The

expressed enzymes, CA Va, Vb, and Vc were also separated by

SDS-polyacrylamide gel electrophoresis, blotted onto a Pro-Blot membrane

(Applied Biosystems), and amino terminally sequenced on an Applied

Biosystems Automated Gas-phase Sequencer (Model 473A) at the

Interdisciplinary Center for Biotechnology Research at this University.





















a b c









. . .: .. ..


M, 1"












Figure 3-2. Coomassie Blue-stained electrophoretic separation of purified
recombinant CA V enzymes on a SDS- polyacrylamide gel. Lane A, mouse CA
Va; lane B, mouse CA Vb; lane c, mouse CA Vc. The outer lanes are molecular
weight standards (Amersham Rainbow protein molecular weight markers,
RPN.755).










Results

Cloning of Mouse CA V

Reverse transcription of BALB/c liver mRNA followed by PCR

amplification yielded several independent clones very similar to the cDNA

reported by Amor-Gueret and Levi-Strauss (1990). The sequences coding for

the three forms of mouse CA V were inserted into the T7 expression vector

pET31 (Tanhauser et al., 1992). Their amino termini are shown in Figure 3-1.

CA Va is contains the full length coding sequence including the 29 amino

acids at the NH2-terminus which could represent a mitochondrial targeting

sequence. This amino terminal sequence has no counterpart in CA I, II, or II1.

CA Vb and CA Vc are shorter forms of CA V representing two possible mature

forms of found in the mitochondria.

Two independently obtained clones of CA V were sequenced to check

for cloning errors and to check for possible sequence variations due to strain

differences; Amor-Gueret and Levi-Strauss (1990) obtained their cDNA from

B10.HTT mice while the clones used in this study originated from the cDNA of

BALB/c mice. The full sequence for mouse CA V from BALB/c mice is listed in

Figure 3-3. The underlined sequences represent changes from the originally

published sequence of Amor-Gueret and Levi-Strauss (1990). There were 8










1
ATGCTCAGGAGAGACCCCCGCAAGCCCTTAGCCATCCTCAGGCATGTGGGACTTCTCTGT
M L R R D P R K P L A I L R H V G L L C
61
GCCACAGGGCCACAGCGCTGGCGTTTCCAGCATTCCTGTGCAGAGGAACACAGCAACTGT
A T G P Q R W R F Q H S C A E E H S N C
121
GCCCGACACCCCCTCTGGACTGGCCCAGTGTCCTCAGCAGAAGGCACCCGGCAGTCTCCC
A R H P L W T G P V S S A E G T R Q S P
181
ATCAACATCCAGTGGAAGGACAGTGTGTATGACCCGCAGCTGGCACCACTCAGGGTCTCC
IN I Q W K D S V Y D P Q L A P L R VS
241
TATGATGCCGCGTCCTGCAGATACCTCTGGAACACTGGCTACTTCTTCCAGGTGGAGTTT
Y D A A S C R Y L W N T G Y F F Q V E F
301
GACGATTCCTGTGAGGATTCAGGGATCAGCGGTGGGCCTCTGGGAAACCACTACAGGCTG
D D S C E D S G I S G G P L G N H Y R L
361
AAGCAGTTTCATTTCCACTGGGGAGCAACAGATGAATGGGGCTCAGAGCACGCAGTGGAC
K Q F H F H W G A T D E W G S E H A V D
421 *
GGCCATACCTACCCAGCTGAGCTCCATCTGGTTCATTGGAATTCCACGAAATATGAAAAT
G H T Y P A E L H L V H W N S T K Y E N
481
TACAAGAAAGCCTCCGTGGGGGAGAACGGGCTGGCGGTCATCGGCGTGTTTCTGAAGCTC
Y K K A S V G E N G L A V I G V F L K L
541 (C)
GGGGCGCATCACCAGGCICTGCAGAAGCTGGTGGATGTCTTGCCGGAAGTAAGACACAAG
G A H H Q A L Q K L V D V L P E V R H K
601 (C)
GATACACAGGTGGCCATGGGACCCTTTGACCCCTCTTGTCTGATGCCTGCCTGCCGGGAT
D T Q V A M G P F D P S C L M P A C R D
661
TACTGGACCTACCCTGGCTCCCTCACCACCCCGCCACTTGCTGAGTCAGTCACCTGGATT
Y W T Y P G S L T T P P L A E S V T W I
721 (C) (G)
GTGCAGAAGACGCCTGTTGAGGTGTCCCCGAGCCAGCTATCCATGTTCCG ACACTCTTG
V Q K T P V E V S P S Q L S M F R T L L
781
TTCTCCGGGCGAGGTGAGGAAGAGGATGTGATGGTGAACAACTACCGCCCGCTCCAGCCC
F S G R G E E E D V M V N N Y R P L Q P
841 (C) 901
CTCAGGGACCGCAAACTTCGCTCGTCGTTCCGGCTTGATCGGACCAAGATGAGGTCT
L R D R K L R S S F R L D R T K M R S

Figure 3-3. Nucleotide and deduced amino acid sequence for the coding region of CA V cDNA
from BALB/c mice. The full length sequence, including the putative mitochondrial leader
sequence, is shown. Differences from the sequence of Amor-Gueret and Levi-Strauss (1990)
are underlined. Parenthesis enclose the nucleotides reported by Amor-Gueret and Levi-Strauss
(1990). Asterisks mark inserted nucleotides that were not in the originally published sequence.










sequence changes out of the 900 nucleotides that compose the coding region

for mouse CA V. Three of those changes, at positions 558, 771, and 867, are

silent and do not change the amino acid sequence. However, the other 5

changes do result in changes to the coding sequence for mouse CA V. The

changes at positions 643 and 764 change the codons for a leucine and a

threonine into methionine codons. An even more significant change was

caused by the insertion of three nucleotides at positions 451,456, and 459.

These insertions resulted in two sequential amino acids,

phenylalanine-methionine, being changed to three amino acids,

valine-histidine-tryptophan. This restored a conserved amino acid sequence

found in all but one of the carbonic anhydrase isozymes shown in Figure 1-1.

Sequencing of the pET expression vectors encoding the various forms

of CA V used in this study showed that all of the sequences were correct and

in the correct reading frame.

Mutagenesis of Mouse CA V

Table 3-2 lists all of the vectors used to express the full length and

truncated forms of wild type mouse carbonic anhydrase V and its mutants.

The following plasmids were created by site-specific mutagenesis of

pET31f1mMCA5: pET31f1mMCA5Y64A, pET31f1mMCA5Y64H, and










Table 3-2

Expression Vectors of CA V and CA V Mutants


Vector Name

pET31fl mMCA5

pET31fl1mMCA5b

pET31fl mMCA5c

pET31fl mMCA5Y64A

pET31flmMCA5cY64A

pET31f1mMCA5Y64H

pET31fl mMCA5cY64H

pET31f1mMCA5cY131A

pET31fl mMCA5cY131H

pET31 f1 mMCA5cY64A/Y131 A

pET31 fl mMCA5Y64H/F65A

pET31 f1 mMCA5cY64H/F65A


Protein Product

Mouse CA Va

Mouse CA Vb

Mouse CA Vc

Mouse CA Va Y64A

Mouse CA Vc Y64A

Mouse CA Va Y64H

Mouse CA Vc Y64H

Mouse CA Vc Y131A

Mouse CA Vc Y131 H

Mouse CA Vc Y64A/Y131A

Mouse CA Va Y64H/F65A

Mouse CA Vc Y64H/F65A










pET31 fl mMCA5Y64H/F65A. The pET31 f1 mMCA5c vector was mutated by

site specific mutagenesis to create pET31f1mMCA5cY131H and

pET31fl mMCA5cY131A. The mutant plasmids, pET31 f1mMCA5cY64H,

pET31 f1 mMCA5cY64A, and pET31 f1 mMCA5cY64H/F65A were created by

lighting a 301 base pair (bp) Pst I restriction fragment containing the mutated

sequence into a backbone derived from pET31 f1mMCA5c that had the 301 bp

Pst I fragment removed. The double mutant, pET31 f1mMCA5Y64A/Y131A,

was produced by lighting the 301 bp Pst I fragment from

pET31 f1 mMCA5cY64A into a backbone derived from pET31f1 mMCA5cY131A

with the 301 bp Pst I fragment removed. All of the truncated and mutated

sequences were confirmed by DNA sequencing.

Expression and Purification of Mouse CA V

The levels of CA V production from the CA V expression vectors ranged

from 1 to 4 mg / liter of culture. Lengthening the time of incubation after

induction to six hours increased yields by 20-50%. Electrophoresis of the

purified enzymes on an SDS-polyacrylamide gels showed that mouse CA Vb

and Vc were >95% pure and had the expected molecular masses of 31 and 28

kDa (Figure 3-2). The expressed enzymes CA Va, Vb, and Vc were amino

terminally sequenced. Analysis of several preparations of CA Va indicated










that it was a mixed fraction with 18-51 residues of the expected NH2-terminal

sequence removed by E. coli proteases, even in the presence of several

protease inhibitors during the lysis and purification. CA Vb had the expected

amino terminal residues; CA Vc had the initial methionine removed (Figure

3-1).



Discussion

The nucleotide sequence reported by Amor-Gueret and

Levi-Strauss was found to differ from the nucleotide sequence we isolated

from cDNA for mouse CA V. Five of the differences, three silent mutations and

two resulting in amino acid changes as well, appear to be simple point

mutations that may be the result of strain differences between the mice used

(Figure 3-3). The nucleotide sequence of the mouse CA V cDNA reported by

Ngao et al. (1994) matches the sequence of Amor-Gueret and Levi-Strauss

(1990) at these five positions. The two amino acid sequence alterations at

nucleotide positions 643 and 764 of Figure 3-3 result in somewhat

conservative amino acid substitutions of leucine to methionine and threonine

to methionine. The crystal structure of CA Vc (Boriack et al., 1995) places

these residue at the surface of the enzyme, their side-chains extending into










solution and not participating in any obvious secondary or tertiary structural

interactions.

However, the sequence differences noted at positions 451-459 (Figure

3-3) do occur within a structurally and functionally important region of CA V.

The insertion of three nucleotides in this region restores an amino acid

sequence, valine-histidine-tryptophan, that is highly conserved in nearly all of

the mammalian carbonic anhydrase isozymes (see Figure 1-1, amino acid

positions 121-123). Ngao et al. (1994) also reported a nucleotide sequence

which restored the valine-histidine-tryptophan motif for CA V cDNA isolated

from C57BL mice. The crystal structure of CA Vc (Boriack et al., 1995) places

these residues along the hydrophobic cavity within the active site. While it is

possible that the sequence reported by Amor-Gueret and Levi-Strauss (1990)

in this region is correct and represents a strain difference between B10.HTT

mice and BALB/c or C57BL, it is more likely due to an sequencing error or

cloning artifact since the sequence motif, Val-His-Trp, is found in nearly all of

the carbonic anhydrase isozymes and is located within the active site.

I expressed and purified three types of mouse carbonic anhydrase V

(forms Va, Vb, and Vc; Figure 3-1) that represent possible isoforms of this

enzyme in the cytoplasm and mitochondria. CA Va is a potentially full-length

protein product based on the complete cDNA sequence (Amor-Gueret and










Levi-Strauss, 1990). Electrophoretic analysis and amino-terminal sequencing

(Figures 3-1 and 3-2) show that this protein is a mixture of at least four

species, with loss of between 18 and 51 amino acids. The initial 29 amino

acid residues of mouse CA Va shown in Figure 3-1 are presumably part of a

mitochondrial targeting sequence and should play no role in catalysis (as will

be demonstrated in Chapter 4 of this work). The observation that many

cleavages can occur within the first 50 amino acids of the NH2-terminus of CA

V when it is expressed in E. co/i may be an indication that this region is very

susceptible to proteolysis. SDS-PAGE analysis of several of the MCA Va

mutants also revealed a mixture of smaller than expected proteins.

The CA Vb and CA Vc proteins, and all the mutants derived from these

proteins, have been produced as pure, homogeneous preparations in

milligram quantity for many types of analysis. Amino terminal analysis of CA

Vb and CA Vc indicates that these proteins have the expected amino termini

except for the removal of the initial methionine in MCA Vc.

MCA Vc that I prepared has been crystallized and its xray crystal

structure has been solved at a resolution of 2.45 angstroms (Boriack et al.,

1995) and shown to be highly similar to the structure for human CA II.














CHAPTER 4
KINETIC AND INHIBITION PROPERTIES OF CARBONIC ANHYDRASE V

Introduction

Although a mitochondrial carbonic anhydrase activity was first

described over 35 years ago (Datta and Shepard, 1959), little is known about

the kinetic or inhibition properties of the isozyme now known as carbonic

anhydrase V. Comparison of the primary sequence of CA V with that of CA I,

II, and III at positions which have been shown to directly affect activity

suggests that CA V may have significantly different properties than the other

isozymes of carbonic anhydrase.

The turnover number (kc) for CA V from rat kidney mitochondria has

been reported as 24,000 s1 when measured at 37 C and a pH of 7.4

(Dodgson and Cherian, 1989). This turnover number is larger than that of

human CA I, with a maximal value of kt of 10,000 s1 and substantially less

than the values determined for human CA I and CA II of 2 x 105 s' and 1.4 x

106 s- determined at 25 C (Khalifah, 1971; Jewell et aL, 1991). However, the

activity of CA V has been reported to be highly sensitive to pH, with an 8-fold










increase in CA V activity from pH 7 to 8 (Dodgson et aL., 1982). Therefore the

maximal turnover number of CA V is presumably higher than 24,000 s1.

Numerous studies (reviewed by Dodgson (1991)) have suggested that

mitochondrial anhydrase activity is used in the metabolic pathways of

gluconeogenesis and ureagenesis to provide a ready source of bicarbonate as

substrate for carbamoyl phosphate synthetase and pyruvate carboxylase.

Most of this data has been based upon the correlation of the effect of

sulfonamide inhibitors such as ethoxzolamide or acetazolamide upon CA V

activity and upon the synthesis of citrulline, urea, and glucose. These studies

have been difficult to interpret quantitatively in many cases due to the

possibility of other carbonic anhydrase isozymes being present and a paucity

of CA V inhibition constants.

Stopped-flow spectrophotometry and 180 exchange were used to

measure the catalytic rate constants for full length and truncated forms of

mouse carbonic anhydrase V synthesized in a bacterial expression system. I

have determined the maximal steady state constants for the hydration of CO2

to be substantially higher than previously reported for CA V, with maximal

values very similar to carbonic anhydrase I. The pH-rate profile for kt

indicates that CA V is quite sensitive to pH, not achieving a maximal turnover

number until pH is higher than 9. A comparison the kinetic properties of MCA









Vb and MCA Vc was made to show that the different amino termini of these

isoforms do not affect catalytic activity. The inhibition constants of

ethoxzolamide, acetazolamide, and cyanate were determined to be similar to

CA II, with K,'s for ethoxzolamide and acetazolamide in the low nanomolar

range.

Material and Methods

Measurement of Catalysis at Steady State

Initial velocities of CO2 hydration were measured by stopped-flow

spectrophotometry (Applied Photophysics Model SF.17MV) following the

change in absorbance of a pH indicator at 25 C. (Khalifah, 1971). Solutions

of CO2 were prepared by bubbling CO2 into water under controlled conditions

for which the concentration of saturated CO2 is known. Dilutions were done

between syringes with a gas-tight connection. Final concentrations of CO2

were varied from 0.5 to 17 mM. The buffer-indicator pairs, their pK8 values,

and the wavelength observed were as follows; Mes (pK, = 6.1) with

chlorophenol red (pK, = 6.3), 574 nm; Mops (pK, = 7.2) with p-nitrophenol

(pK, = 7.1), 400 nm; Hepes (pKa = 7.5) with phenol red (pKa = 7.5), 557 nm;

Taps (pK, = 8.4) with m-cresol purple (pK, = 8.3), 578 nm; Ches (pK, = 9.3)

with thymol blue (pK, = 8.9), 590 nm. Solutions were maintained at a constant










total ionic strength of 0.2 M by addition of the appropriate amount of sodium

sulfate. The mean initial rate in each case was determined from at least six

reaction traces comprising the initial 5-10% of the reaction. Uncatalyzed rates

were subtracted, and determination of the kinetic constants kc and kKM was

by nonlinear least-squares methods (Enzfitter, Elsevier-Biosoft).

Oxygen-18 Exchange Kinetics

The rate of exchange of 180 between C02 and water and the rate of

exchange of 180 from 12CO2 to 13CO2 caused by the transitory labeling of the

active site of carbonic anhydrase were determined using the method described

by Silverman (1982). Both of these exchanges were observed at chemical

equilibrium. The reaction solution was in contact with a membrane permeable

to gases; C02 passing across the membrane entered a mass spectrometer

(Extrel EXM-200) providing a continuous measure of isotopic content of CO2.

Experiments were performed without added buffers. Solutions were

maintained at a constant total ionic strength of 0.2 M by the addition of the

appropriate amount of sodium sulfate.

The 80 exchange method is useful because it measures the rate of

interconversion of C02 and HCO3 at chemical equilibrium, Rp, as shown in

Equation 5.









HCOO180 + E-ZnH20 E-Zn80OH + C02+ H20 (5)

The substrate dependence of R1 is given by R1/[E] = kct6[SY(Keffs + [S]), where

kt' is a rate constant for maximal interconversion of C02 and HCO3, Kffs is

an apparent substrate binding constant, and [S] is the concentration of CO2 or

HCO3 or both (Simonsson et al., 1979). Values of kt./Keff for the enzymes

were determined by nonlinear least-squares fit of the above expression for R,

to the data for varying substrate concentration or by measurement of R1 at

values of [S] much smaller than K8ffs. In theory and in practice, kct-/KffC02 is

equal to k./KM for the hydration of C02 obtained by steady-state methods

(Simonsson et aL., 1979; Silverman, 1982).

Values of K, were obtained from 18O exchange experiments and were

determined from the least-squares fit of R, at various inhibitor concentrations

to the expression for mutual depletion of free enzyme and inhibitor (Segel,

1975). Since the total substrate concentration ([C02] + [HC03-] = 25 mM) is

much less than Kffs (>100 mM) for these experiments, we cannot differentiate

between competitive and noncompetitive modes of inhibition.










Results

Measurement of Catalytic Activity

The catalytic constant kc/JKM for CO2 hydration catalyzed by CA Vc (the

shortest form; see Figure 3-1) was determined by stopped-flow

spectrophotometry and by 180 exchange measured by mass spectrometry.

Over the range of pH 5-9, kJ/KM determined from 180 exchange could be

described as dependent on the unprotonated state of a single ionizable group

with pK, = 7.4 0.1 and a maximum of (3.5 0.1) x 107 M1 s1 (Figure 4-1).

The results for kc/KM obtained by stopped-flow spectrophotometry were pKa =

7.8 0.1 and a maximum of (3.2 0.3) x 107 M1 s1. The values of k/KM and

apparent pKa obtained by stopped-flow spectrophotometry and 180 exchange

for the longer form, CA Vb, were identical to those obtained for CA Vc. The

longest form, CA Va, was subject to proteolysis, and I was not able to isolate a

pure form for kinetic analysis. While the concentration of active sites could

determined by titration with an inhibitor, purified samples of CA Va were

considered to be heterogeneous mixtures of CA V with amino terminal

truncations. However, the catalytic activity of these mixtures was not

appreciably different from that of the two purified shorter forms, suggesting













108


1 7

kcaKi
M-1s-1 f

106




105 .4,-,-, ,i ,
5 6 7 8 9
pH




Figure 4-1. ka /KM catalytic constants for hydration of C02 catalyzed by mouse
carbonic anhydrase Vc (0) and Vb (0). These data were obtained at 25 C
using 180 exchange measured in the absence of buffers. The dotted line (for CA
Vb) is a least-squares fit to a single ionization with pKa = 7.4 0.1 and a maximal
value of k,/KM = (2.5 0.1) x 107 M1 s-1. The solid line (for MCA Vc) is a fit with
pKa = 7.4 0.1 and a maximal value of k/KM, = (3.5 0.1) x 107 M'1 s-1.










that the presence of portions of the amino terminal region in the longer form do

not affect catalysis.

The values of kc, for the hydration of CO2 for the two forms CA Vb and

Vc showed a monotonic increase with pH. In each case, measurement of a

maximal value of kt was hampered by the loss of activity for enzymes placed

in solutions with a pH above 9.5. For CA Vb, there was only a hint of reaching

a maximum, with values of kct near 3 x 105 s'1 at pH 9.5. Extended work with

CA Vc gave the clearest indication of the maximal value of kct at (3.2 0.3) x

105 s-' and an apparent pKa of 9.2 0.2 (Figure 4-2). The steady-state

constants for CA V and comparisons with isozymes I, II, and III are given in

Table 4-1. Comparison of the inhibition of these enzymes by the sulfonamides

acetazolamide and ethoxzolamide, as well as by cyanate, are given in Table

4-2.

Discussion

I have found that the two shorter forms of CA V (forms Vb and Vc;

Figure 4-1) have nearly the same catalytic properties in the hydration of CO2.

This is consistent with the report that a deletion mutant of HCA II lacking 24

residues at the NH2-terminus is nearly fully active (Aronsson et al., 1995).

This segment of CA II (as well as of CA I and III) contains Tyrosine 7, the side

chain of which extends into the active-site cavity and is a component of the











106


(s1)


10i 4 ". '

103 ."


3
10-
6 7 8 9 10
pH






Figure 4-2. kct catalytic constants for hydration of CO2 catalyzed by mouse
carbonic anhydrase Vc (0) and Vb (0). These data were obtained at 25 C
using stopped-flow measurements. The dotted line (for CA Vb) is a
least-squares fit to a single ionization with pKa = 9.1 0.3 and a maximal value
of kct = (3.5 0.4) x 10' s1. The solid line (for MCA Vc) is a fit with pK, = 9.2
0.2 and a maximal value of kc. = (3.2 0.3) x 105 s1.









Table 4-1
Maximal Values Of The Steady-State Constants For The Hydration Of C02 Catalyzed
By Isozymes Of Carbonic Anhydrase At 25 C

CA k kca/KM Ref.
(s") (M1 s-1)


Human I 2 x 105 5 x 107 Khalifah (1971)
Human II 1.4 x 106 1.5 x 108 Khalifah (1971)
Human III 1 x 104 3 x 105 Jewel etal. (1991)
Mouse Va 3 x 105 3 x 107 This work

a These values are for the two short forms of CA V designated b and c in Figure 3-1.


Table 4-2
Inhibition of Isozymes of Carbonic Anhydrase Measured by 180 Exchange at pH 7.2-7.5
and 25 C
K,
CA Acetazolamide Ethoxzolamide Cyanate

mM

Human Ia 0.2 0.002 0.7
Human II 0.06 0.008 30
Human III 40 8 30
Mouse Vcb 0.06 0.005 30

The inhibition data were obtained using a least-squares fit to the expression for mutual
depletion of inhibitor and free enzyme (Segel, 1975) with total substrate concentration
much less than the apparent binding constant of substrate to enzyme ([S] << Kfs)
a These data for HCA I are taken from Sanyal et aL. (1982) and were measured at 0
C for acetazolamide and ethoxzolamide and at 25 C for cyanate.
b These values are for CA Vc, the shortest form of CA V (Figure 3-1).










hydrogen-bonded array of side chains and water molecules found in the

active-site cavity of the crystal structure (Eriksson et al., 1988). Mouse and

human CA V contain a histidine or threonine at position 7, respectively. It

seems clear that the absence of residue 7 and the NH2-terminal segment in

which it is found do not contribute significantly to the catalytic pathway under

the conditions of this study. This is further emphasized by the result from

kinetic analysis that mixtures of the longer forms of CA V, obtained from

proteolytic products of CA Va such as shown in Figure 3-2, had catalytic

activity equivalent to that of CA Vb and Vc.

The maximal values of the kinetic constant kc=t/K for the hydration of

CO for CA Vb and Vc were 3 x 107 M1 S'. The pH profile of k/Km appeared

to be dependent on the basic form of a single ionizable group with apparent

pK, near 7.4 (Figure 4-1). This pKa has been shown to represent the

ionization of the zinc-bound water (Simonsson and Lindskog, 1982), which in

isozyme II is close to 7, although it is dependent on experimental conditions

and the ionization state of the nearby Histidine 64 (Simonsson and Lindskog,

1982). Thus, isozyme V has an apparent pK, for this zinc-bound water close

to that of isozyme II. A comparison of maximal values of k./Km for the

hydration of CO2 catalyzed by several isozymes is shown in Table 4-1.










A significant difference in catalysis by isozymes I and II compared with

isozyme V was found in kat for hydration. For CA I and II, kt is described by a

titration curve with a pK, near 7 reaching a maximum at high pH (Khalifah,

1971; Steiner et al., 1975). In CA II, this behavior is a reflection of the pKa of

histidine 64, the proton acceptor in the intramolecular proton shuttle that

transfers a proton to solution and regenerates the zinc-bound hydroxide

(Steiner et al., 1975; Silverman and Lindskog, 1988). In mouse CA Vb and Vc,

we observed an increase in k., for hydration with an increase in pH and an

apparent pKa of 9.2 (Figure 4-2). However, the maximal values of k^t for the

hydration of CO2 by mouse CA Vb and Vc are near 3 x 105 s', a very sizable

value. Together, these data suggest the presence of a proton acceptor in the

active-site cavity with a pKa near 9. There could be more than one proton

acceptor, of course, but there does not appear to be a predominant proton

acceptor in the initial 51 residues of CA Va (Figure 3-1) since the deletion of

the segment leaves kct relatively unchanged.

One prominent difference in the active-site cavities of CA V and II is at

position 64. The histidine at this position in human CA II has been shown to

act as a proton shuttle, accepting protons from the zinc-bound water and

transferring them to solution (Tu et al., 1989). The presence of Histidine 64 in

CA II is responsible for the apparent pK, near 7 in kct for the hydration of CO2






72


(Tu etal., 1989; Steiner etal., 1975). CA V has a tyrosine at position 64 that

is a poor proton shuttle at pH 7, but is a more efficient shuttle at pH near the

pKa of the phenolic hydroxyl.














CHAPTER 5
PROTON TRANSFER AND THE EFFECTS OF ACTIVE SITE RESIDUES
64,65, AND 131 UPON THE CATALYTIC ACTIVITY OF CARBONIC
ANHYDRASE V

Introduction

The catalytic properties of carbonic anhydrase V appear similar to those

of the well studied isozymes CA I and CA II, except for an unusually high pH

sensitivity. CA V's maximal rate constants for the hydration of CO2 are similar

to those for CA I and about 20% as high as CA II (Table 4-1), one of the

fastest enzymes known. The apparent pKa near 7 for the zinc-bound water, as

determined by pH-rate profiles of k./KM, is quite similar for CA I, II, and V.

Mitochondrial carbonic anhydrase activity has been reported as being

very sensitive to pH, with an 8-fold increase in CA activity from pH 7 to 8

compared with a 2-fold increase for erythrocyte CA (Dodgson et al., 1980;

Dodgson et al., 1982). Careful measurements of the pH rate profiles for

turnover number, k,, of CA V as shown in Figure 4-2 support these earlier

observations. The measured values of k ,, increase 5-fold from pH 7.2 to pH

8.1 and 9-fold from pH 7 to pH 8 when plotted on the best-fit line for the data.









The increase in k,t with increasing pH appears dependent upon the ionization

of a residue in the active site of CA V with a pKa greater than 9.

In carbonic anhydrase II the rate limiting step for the hydration of CO2 is

the transfer of a proton from the zinc-bound water to solution to generate the

zinc-bound hydroxide. Steiner et al. (1975) and Pocker and Bjorkquist (1977)

demonstrated that CA II has a solvent deuterium isotope effect between 3-4 for

Vr and an isotope effect of 1 for VrjKM. Steiner et al. (1975) proposed that

this was an indication that the proton transfer step was rate limiting and

therefore VrM was affected by deuterium, but not V"/KM. The assumption

that proton transfer is rate limiting in the catalytic mechanism for CA V was

confirmed by measuring the solvent hydrogen isotope effects upon CA V

catalytic activity.

The value of kc, in CA II is dependent upon the ionization of a residue

with an apparent pKa near 7 (Pocker and Bjorkquist, 1977). This residue was

shown to be histidine 64 by site specific mutagenesis (Tu et al., 1989).

Carbonic anhydrase V has a tyrosine at position 64. The pKa for the ionization

of the phenolic hydroxide of tyrosine is consistent with the much higher

apparent pKa observed for pH profiles of kt in CA V. To test if the tyrosine at

position 64 of CA V is necessary for proton transfer, the catalytic activity of a









mutant with an alanine at position 64 was compared with that of the wild type

enzyme.

Jewel et al. (1991) have shown that a proton transfer site can be

introduced into CA III by substituting a histidine for the naturally occurring

lysine at position 64. A Y64H mutant of CA V was tested to see if the catalytic

properties of CA V could be altered to more closely resemble those of CA II.

A detailed examination of the crystal structure of CA V (Boriack et al.,

1995) reveals only five ionizable residues within 12 A of the zinc bound water

which may act as proton acceptors: histidine 7, tyrosine 64, lysine 91, tyrosine

131, and lysine 132. MCA Vc, the deletion mutant lacking residues 1-21, has

previously been shown to function similarly to MCA Vb, implying that histidine

7 is not necessary for proton transfer. Tyrosine 131 fulfills several of the

criteria for a potential proton transfer site listed by Boriack et al. (1995); 1) the

pKa of tyrosine is close to the pH of the biological environment of the enzyme,

2) the hydroxide of tyrosine 131 is less than 10 A from the zinc-bound water,

and 3) tyrosine 131 has a solvent accessible surface area greater than 85 A2.

Mutants of CA V with an alanine or a histidine at position 131 were created

and their pH profiles measured to test if changes at this position affected the

catalytic rate of CA V. In order to test the possibility that both tyrosine 64 and










tyrosine 131 could facilitate proton transfer, a double mutant with alanines at

positions 64 and 131 was also constructed and tested.

The phenylalanine at position 65 of carbonic anhydrase V is unusual

among the isozymes of carbonic anhydrase. Boriack et al. (1995) have shown

that this residue sterically hinders the access of position 64 to the active site.

The Y64H CA V mutant had catalytic properties very similar to the wild type

CA V. To test if proton transfer from a histidine at position 64 could be

enhanced by reducing the size of the adjacent residue at position 65, the

catalytic activity of Y64H/F65A CA Vc was compared to that of CA V and Y64H

CA V.

Materials And Methods

Wild type and mutant forms of mouse carbonic anhydrase V were

cloned, mutated, and expressed as described in Chapter 3. Stopped flow

spectrophotometry and "O exchange were used to determine the steady state

and equilibrium rates for the hydration of CO2 and the dehydration of HCO3as

described in Chapter 4.









Results

Interconversion of Carbon Dioxide and Bicarbonate

For the hydration of CO2 catalyzed by carbonic anhydrases, the ratio of

k/Kj contains rate constants from the binding of CO2 to the departure of

HC03' and describes the steps in the conversion of CO2 and HCO3 (eq. 6).

ki k2 [H20]
CO2 + EZnOH- EZnOCO2H EZnOH2 + HCO03 (6)
k.1 K2

The zinc-bound hydroxide is regenerated in a separate step (7) in which

a proton is transferred from the zinc-bound water to a proton acceptor, B,

which can be water in the active-site cavity, a side chain of the enzyme such

as histidine 64 in CA II, or a small buffer molecule (Kararli and Silverman,

1985; Tu et al., 1990; Paranawithana et al., 1990).

k3

EZnOH2 + B EZnOH + BH (7)
k-3

The values of km/KM reported in Figures 5-1 and 5-2 were determined

by 180 exchange in the absence of buffers. The maximal value of k=,/KM and

the apparent pKa for catalysis are listed in Table 5-1. These values were

determined by a least squares fit of the data to equation 8.

kc,/KM = KE M/ ([H+] + KE) (8)













109
MCAVc
0 MCA Vc Y64A
18 0 MCAVcY131A
10 MCAVcY64AY131A


107 67O 09
kca/Ki : .E

(W \ 1K66
O/











Figure 5-1. 1Q exchange k./Km catalytic constants for hydration of CO2
catalyzed by mouse carbonic anhydrase Vc (0) mutants Y64A CA Vc (0),
Y131A CA Vc (0), and Y64A/Y131A CA Va (*). The lines are least-squares fits
of the data with values of apparent pKa and maximal k,/KM, given in Table 5-1.















109


kcKM V. ""
0.1
106 '




/
105,, "


/
1044 4
5 6 7 8 9
pH





Figure 5-2. "0 exchange kj/KM catalytic constants for hydration of CO2
catalyzed by mouse carbonic anhydrase Vc (*) mutants Y64H CA Vc (0),
Y131H CA Vc (0), and Y64H/F65A CA Va (*). The lines are least-squares fits
of the data with values of apparent pKa and maximal k./KM given in Table 5-1.









Table 5-1
Apparent pKa and Maximal Values of kc/Km Stopped Flow and 180 Exchange
measurements of Catalysis by Mouse Carbonic Anhydrase V
and Mutants of CA V.

enzyme 180 Exchange stopped flow
kc/KM PKa kc/KM pKa
(x107 M1 s'1) (x107 M-1 s-')


CAVc 3.5 0.1 7.4 0.1 2.5 0.1 7.4 0.1

Y64A 1.9 0.1 7.80.1 3.1 0.3 8.80.2
Y131A 3.7 0.1 7.1 0.1 6.4 0.4 8.2 0.1
Y64A/Y131A 2.2 0.1 7.4 0.1 6.1 0.2 8.3 0.1

Y64H 2.7 0.1 7.5 0.1 4.6 0.1 8.5 0.1
Y131H 2.50.1 7.90.1 1.0 0.1 8.60.1
Y64H/F65A (c) 2.6 0.1 6.9 0.1 6.6 0.4 8.1 0.1


Apparent pKa and maximal kc/KM are calculated from the least squares fit to a
single ionization.










KE is the apparent ionization constant and M is the maximal value of

kca/KM.

When determined by 180 exchange at equilibrium, the k/KM, pH profiles

for all of the mutants tested were qualitatively similar to that of the wild type

enzyme (Figures 5-1, 5-2). Table 5-1 shows the largest deviation of maximal

kc/KM from wild type was a 46% reduction for Y64A CA Vc and the apparent

pKa determined from these pH profiles agreed to within 0.5 pH units of the

apparent pKa for the wild type CA V enzyme. The highest pK. determinations

were from the pH profiles of Y64A CA Vc and Y131 H, with values for pKa of 7.8

and 7.9 respectively.

Stopped-flow measurements of C02 hydration at steady state were also

used to determine the pH profiles of kc/KM shown in Figures 5-3 and 5-4 and

the values of maximal kc/KM and apparent pKa listed in Table 5-1. These pH

profile determinations of k,/KM were less consistent and more complex than

those from 180 exchange measurements made at equilibrium. All of the mutant

enzymes had an apparent pK, that was significantly higher (from 8.1 to 8.8,

Table 5-1) than the observed pKa for wild type CA Vc (pKa = 7.4) and the

apparent pKa measured by 180 exchange for each mutant (from 6.9 to 7.9).

The differences in apparent pKa determined by "0 exchange and stopped flow






















kc/KuKM 3 "" D
(M s-) 106. 3
106] ^ D *
0$o' P7'

105, -"

4
10 4'

6 7 8 9 10
pH




Figure 5-3. Stopped-flow k,/Km catalytic constants for hydration of CO2
catalyzed by mouse carbonic anhydrase Vc (0) mutants Y64A CA Vc (0),
Y131A CA Vc (0), and Y64ANY131A CA Va (*). The lines are least-squares fits
of the data with values of apparent pK, and maximal kc/KM given in Table 5-1.













109


VKM 106 -
-~0
I 4- .. .- 0
5 ...."" .-

1 0 5 1 .
-. 0
104 -

103 i ,-. - ,-.
6 7 8 9 10
pH




Figure 5-4. Stopped-flow kc/KM catalytic constants for hydration of CO2
catalyzed by mouse carbonic anhydrase Vc (0) mutants Y64H CA Vc (0),
Y131H CA Vc (0), and Y64H/F65A CA Va (*). The lines are least-squares fits
of the data with values of apparent pKa and maximal km/KM given in Table 5-1.










(from 0.7 to 1.2) were consistent; the mutants with the highest apparent pKa

for kc/KM from stopped flow also had the highest pKa from 180 exchange.

For the mutants Y131A CA Vc, Y64H CA Vc, and Y64H F65A cA Vc, the

pH profiles did not fit a line describing a single pKa well at lower pH and may

describe a dependence of kc/KM upon more than a single ionization event.



Proton Transfer

To investigate the importance of proton transfer upon the catalytic

properties of CA V, site specific mutants of potential proton transfer sites were

tested for alterations in turnover number. Stopped flow spectrophotometry

was used to determine the turnover number at steady state. The mutants were

designed to test the effects of alanine and histidine residues substituted for the

tyrosines at positions 64 and 131 in carbonic anhydrase V.

Figure 5-5 compares the pH profiles of kcat for mutants with alanines

substituted for the tyrosines at positions 64 or 131 or both. The substitution of

an alanine for either tyrosine 64 or 131 did not affect the apparent pK, of 9.2

observed in the wild type CA Vc. The apparent pKa observed for the double

mutant, Y64A/Y131A CA Vc, was slightly decreased to 8.8, but there was still

a strong pH dependence for this double mutant with alanines at positions 64

and 131. The maximal turnover numbers determined for the mutants were





















kcart 13-^
(S"1) ,
103 '


102,


101 ---
6 7 8 9 10
pH




Figure 5-5. Stopped-flow kct catalytic constants for hydration of CO2 catalyzed
by mouse carbonic anhydrase Vc (0) mutants Y64A CA Vc (0), Y131A CA Vc
(0), and Y64A/Y131A CA Va (*). The lines are least-squares fits of the data
with values of apparent pKa and maximal kct given in Table 5-2.










decreased from that of the wild type enzyme (Table 5-2). The total decrease

from CA Vc in maximal kt for Y64NY131A CA Vc (2.4 x 10' s1) is near to the

sum of the decreases for Y64A CA Vc and Y131A CA Vc (0.7 x 10' s1' + 1.4 x

10 s-1).

A second approach to determine if a specific site of CA V could

participate in proton transfer was to place a histidine at position 64 or 131.

The pH profiles for k. for these mutants are shown in Figure 5-6. The

substitution of a histidine for either tyrosine 64 or 131 did not affect the

apparent pKa of 9.2 observed in the wild type CA Vc. The maximal turnover

number for Y131 H was significantly reduced, with the lowest value (6 x 104 s1)

seen for any of the mutants of CA V used in this study as shown in Table 5-2.

The value of kca for Y64H CA Vc was slightly elevated over wild type,

particularly below pH 7.5. A line describing two ionizations with pKa of 9.3 and

6.2 and maxima of 3.8 x 10s s'1 and 6 x 103 s1 is shown with the data for Y64H

CAVc.

To test the influence of phenylalanine 65 upon position 64, a double

mutant, Y64H/F65A was constructed. This double mutant had a substantial

increase in catalytic activity as shown in Figure 5-6. The maximal k, was

twice that of the wild type CA V. The increase in kc, was even more

pronounced at lower pH with an approximately 80-fold increase over wild type









Table 5-2
Apparent pKa and Maximal Values of kct and RH2o for Mouse Carbonic
Anhydrase V and Mutants of CA V.

enzyme kt pKa
(x 10 s-1)


CAVc 3.2 0.2 9.2 0.1

Y64A 2.5 0.5 9.2 0.1
Y131A 1.8 0.2 9.2 0.1
Y64AY131A 0.8 0.1 8.8 0.1

Y64H 3.8 0.6 9.2 0.1
Y131H 0.6 0.1 9.2 0.1
Y64H/F65A 7.5 0.71 6.3, 9.0w
(1.5+5.9)b

kt values were obtained from stopped flow measurements at steady state. All
measurements were made at 25 C. Apparent pK, is calculated from the best fit
line for a single ionization for k., determined by nonlinear regression analysis.
a The data was fit to a line describing two ionizations
b Two maxima were observed and summed to arrive at 7.5 x 10".

























s.-) 1"" 0
S- ,,D /

103 0
00
0 MCAVc
102 MCAVc Y64H
10 0 MCAVcY131H
0 MCAVcY64HF65A
/
/

101
6 7 8 9 10
pH





Figure 5-6. Stopped-flow k., catalytic constants for hydration of CO2 catalyzed
by mouse carbonic anhydrase Vc (@) mutants Y64H CA Vc (0), Y131 H CA Vc
(0), and Y64H/F65A CA Va (*). The lines are least-squares fits of the data
with values of apparent pK, and maximal kc/KM given in Table 5-2.










seen at pH 7. The data for Y64H/F65A CA Vc could be fit by nonlinear

regression to a line describing the ionization of two moieties with pKI of 6.3

and 9.0 and maxima of 1.5 x 10s s'1 and 5.9 x 105 s'.



Discussion

Measurements of the catalytic rate constants for carbonic anhydrase V,

as well as data from sequence and structure comparisons with other isozymes

of carbonic anhydrase, suggest that the elevated pH sensitivity of CA V may

arise from differences in its proton transfer pathway compared to other

isozymes. The importance of tyrosine 64, phenylalanine 65, and tyrosine 131

in proton transfer were by determined by testing the effects of histidine or

alanine substitutions at these positions.

A histidine at position 64 of wild type CA II or a mutant of CA III is

necessary for intramolecular proton transfer to occur (Tu et al., 1989; Jewel et

al., 1991). Replacement of histidine 64 with alanine in CA II results in a

greater than 10-fold decrease in the proton transfer dependent rate, kct, and

eliminates the pH dependence of this rate compared to the wild type enzyme

(Tu et al., 1989). Replacement of tyrosine 64 with alanine in CA V did not

eliminate the pH dependence of kc, seen in the wild type CA V and only

caused a modest decrease in their maximal values. Analysis of the crystal