Transformation of 'Nova' tangelo and 'Rodhe Red Valencia' sweet orange with the coat protein gene of citrus Tristeza clo...

MISSING IMAGE

Material Information

Title:
Transformation of 'Nova' tangelo and 'Rodhe Red Valencia' sweet orange with the coat protein gene of citrus Tristeza closterovirus
Physical Description:
vii, 126 leaves : ill. ; 29 cm.
Language:
English
Creator:
Schell, Jay L., 1962-
Publication Date:

Subjects

Subjects / Keywords:
Citrus -- Genetic engineering   ( lcsh )
Tristeza disease of citrus fruits   ( lcsh )
Citrus -- Diseases and pests   ( lcsh )
Horticultural Science thesis, Ph. D   ( lcsh )
Dissertations, Academic -- Horticultural Science -- UF   ( lcsh )
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1996.
Bibliography:
Includes bibliographical references (leaves 105-125).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Jay L. Schell.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 026484845
oclc - 36717538
System ID:
AA00022831:00001

Table of Contents
    Title Page
        Page i
    Acknowledgement
        Page ii
    Table of Contents
        Page iii
        Page iv
        Page v
    Abstract
        Page vi
        Page vii
    Chapter 1. Introduction
        Page 1
        Page 2
        Page 3
        Page 4
    Chapter 2. Review of the literature
        Page 5
        Page 6
        Page 7
        Page 8
        Page 9
        Page 10
        Page 11
        Page 12
        Page 13
        Page 14
        Page 15
        Page 16
        Page 17
        Page 18
        Page 19
        Page 20
        Page 21
        Page 22
        Page 23
        Page 24
        Page 25
        Page 26
        Page 27
        Page 28
        Page 29
        Page 30
        Page 31
        Page 32
        Page 33
    Chapter 3. Materials and methods
        Page 34
        Page 35
        Page 36
        Page 37
        Page 38
        Page 39
        Page 40
        Page 41
        Page 42
        Page 43
        Page 44
        Page 45
        Page 46
        Page 47
        Page 48
        Page 49
        Page 50
        Page 51
        Page 52
        Page 53
        Page 54
        Page 55
        Page 56
        Page 57
        Page 58
        Page 59
        Page 60
        Page 61
    Chapter 4. Results and discussion
        Page 62
        Page 63
        Page 64
        Page 65
        Page 66
        Page 67
        Page 68
        Page 69
        Page 70
        Page 71
        Page 72
        Page 73
        Page 74
        Page 75
        Page 76
        Page 77
        Page 78
        Page 79
        Page 80
        Page 81
        Page 82
        Page 83
        Page 84
        Page 85
        Page 86
        Page 87
        Page 88
        Page 89
        Page 90
    Chapter 5. Summary and conclusions
        Page 91
        Page 92
        Page 93
    Appendix A. Tissue culture and protoplast media
        Page 94
        Page 95
        Page 96
        Page 97
        Page 98
        Page 99
        Page 100
        Page 101
    Appendix B. Molecular biology buffers
        Page 102
        Page 103
        Page 104
    Literature cited
        Page 105
        Page 106
        Page 107
        Page 108
        Page 109
        Page 110
        Page 111
        Page 112
        Page 113
        Page 114
        Page 115
        Page 116
        Page 117
        Page 118
        Page 119
        Page 120
        Page 121
        Page 122
        Page 123
        Page 124
        Page 125
    Biographical sketch
        Page 126
        Page 127
        Page 128
        Page 129
Full Text















TRANSFORMATION OF 'NOVA' TANGELO AND 'ROHDE RED VALENCIA'
SWEET ORANGE WITH THE COAT PROTEIN GENE
OF CITRUS TRISTEZA CLOSTEROVIRUS


















By

JAY L. SCHELL


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF
THE UNIVERSITY OF FLORIDA IN PARTIAL
FULFILLMENT OF THE REQUIREMENTS FOR THE
DEGREE OF DOCTOR OF PHILOSOPHY


UNIVERSITY OF FLORIDA


1996


















ACKNOWLEDGEMENTS


There are many people I wish to thank for their contributions to

this work. First and foremost, I wish to thank my major professors- Dr.

Jude Grosser and Dr. Ken Derrick for their guidance, support and

friendship. I would also like to thank Dr. Chuck Niblett for his

contribution of the plasmids used in this study, Dr. Richard Lee for the

use of his lab and equipment, and both for their guidance and support

also. I also would like to thank Gary Barthe, Toni Ceccardi, Jiang

Jingrui, Adriana Quiros, J. L. Chandler, Mary Price, Manjunath Keremane

and Eliezer Louzada for their help in the lab.

There are several people whom I would like to offer a special thank

you. First, Francisco Mourao, my good friend and fellow student, who was

always there when I needed a shoulder to lean on. Also, Remei Albiach,

who helped me tremendously with all the molecular techniques, as well as

being a dear friend. Also, Beatriz Nielsen and all the Nielsen family,

Tim Widmer, Ana Mourao, Tom and Linda Fontana, my parents, Joel and Joan

Schell, my sisters- Joyce and Jane, my brother-in-laws-Cris and Dale, and

all my many friends who have supported me over the years. To all of you-

many Thanks.


















TABLE OF CONTENTS




ACKNOWLEDGEMENTS .............................................. i

ABSTRACT ....................................................... vi

CHAPTERS

INTRODUCTION ...................................... 1

2 REVIEW OF THE LITERATURE .......................... 5

Methods of Transformation .................... ..... 5
Agrobacterium tumefaciens-mediated
Transformation ............................ 5
Direct Gene Transfer Using Particle
Bombardment .......................... 8
Gene Transfer by Direct DNA-Uptake ........... 12
Other Methods of Transformation ............... 16
Microinjection ........................... 16
Liposome mediated transformation ..... 17
Transformation using silicon
carbide fibers .................... 18
Cross Protection ................................. 18
Cross Protection of CTV in Citrus ................... 20
Genetic Engineering for Virus Resistance ........... 22
Replicase Gene ............................. 23
Movement Protein ........................... 24
Protease ................................... 24
Antisense and sense-defective RNAs ............ 25
Coat Protein ............................... 26
Transformation of Citrus ......................... 31

3 MATERIALS AND METHODS ............................ 34

Plasmid Preparation .............................. 34
Transformation of E. coli .................... 37
Quick miniprep plasmid preparation ........... 38
Large scale isolation and preparation
of plasmid .............................. .40
Establishment and Maintainance of Suspension
Cultures ................................... 42


iii










Isolation and Transformation of Citrus
Protoplasts ................................... 43
Culturing and Regeneration of Treated
Protoplasts ................................... 45
Testing for Transformed Plants ..................... 46
Polymerase Chain Reaction for Detection
of Transformants ....................... 46
Testing for Transformed 'Rohde Red
Valencia' Sweet Orange Using
Dot Blot Analysis .................... 46
Isolation of DNA from Citrus leaves
for dot blot analysis .......... 46
Preliminary screening using dot
blots .... ....................... 49
Confirmation of Transformation ............. 49
Isolation of DNA for Southern Blot
Hybridization .................... 49
Southern Transfer of DNA Isolated
from Transformed Plants ...... 51
Transfer under neutral
conditions ............... 51
Transfer under alkaline
conditions ............... 53
Preparation of Radioactive Probes
by Random Primer for Southern
Hybridization .................. 54
Hybridization of DNA with a Labeled
Probe ............................ 56
Southern Blot Hybridization Using
the GENIUS non-radioactive
labeling system ................ 57
Western Immunoblot Analysis for
detection of the Coat Protein.. 59

4 RESULTS AND DISCUSSION ............................. 62

Plasmid Preparation ................................ 62
Transformation of Citrus Protoplasts and
Plant Regeneration ......................... 62
Screening for Transformants ........................ 65
Selection During the Early Stages of
Protoplast Growth and Microcalli
Development .......................... 65
Polymerase Chain Reaction for Selection
of Transformants ..................... 68
Testing of 'Nova' tangelo and
'Valencia' sweet orange
regenerates ...................... 68
Testing of the 'Rohde Red Valencia'
sweet orange regenerates ....... 70










Screening for Transformants Using
Southern Dot Blot Analysis... 75
Confirmation of Transformation ...................... 76
Southern Hybridization Analysis Using
the Non-radioactive GENIUS
system ................................. 76
Southern Hybridization Analysis Using
Radioactive Probes .................... 80
Western Analysis ........................... 84

5 SUMMARY AND CONCLUSIONS .......................... 91

APPENDIX A Tissue Culture and Protoplast Media ................. 94

APPENDIX B Molecular Biology Buffers ........................ 102

LITERATURE CITED ............................................. 105

BIOGRAPHICAL SKETCH .......................................... 126


















Abstract of Dissertation Presented to the Graduate
School of the University of Florida in Partial Fulfillment
of the Requirements for the Degree of Doctor of Philosophy

TRANSFORMATION OF 'NOVA' TANGELO AND 'ROHDE RED VALENCIA'
SWEET ORANGE WITH THE COAT PROTEIN GENE
OF CITRUS TRISTEZA CLOSTEROVIRUS

By

Jay L. Schell

December 1996

Chair: Jude W. Grosser
CoChair: Kenneth S. Derrick
Major Department: Horticultural Science

There has been considerable interest in using plant molecular

biology for crop improvement. The technology to isolate and clone a

specific gene is commonly utilized today. The methodology to insert these

genes has been well established for many crop species. One of these

methods is the use of PEG-mediated direct DNA uptake. This method relies

on the availability of a reliable protoplast isolation and plant

regeneration system, which is available for Citrus.

Protoplasts isolated from ovule-derived callus of 'Nova' tangelo

('Clementine' mandarin (Citrus reticulata Blanco) X 'Orlando' tangelo (C.

reticulata X C. paradisi Macf)) and 'Rohde Red Valencia' sweet orange (C.

sinensis L(Osbeck)) were

transformed by PEG-mediated direct DNA uptake using plasmids containing

the coat protein gene of citrus tristeza virus (CTV). Three transgenic

'Nova' tangelo plants were obtained using plasmid pMONI0098 containing the










coat protein gene of the Florida mild isolate T30. Twenty-two transgenic

'Rohde Red Valencia' sweet orange plants were obtained using plasmid

pBPFQ7 containing the coat protein gene of the Florida severe isolate T36.

Transformants were selected by PCR analysis or dot blot hybridization.

Confirmation of transformation was by Southern hybridization and western

immunoblot analysis. These transgenic plants will now be budded onto sour

orange rootstock and subjected to challenge inoculation with severe

isolates of citrus tristeza virus in the greenhouse, to determine if they

are resistant to CTV.


vii


















CHAPTER 1

INTRODUCTION




There is considerable interest in using plant molecular biology

techniques for crop improvement. The technology to isolate and clone a

specific gene is commonly utilized today. The number of genes and

proteins isolated and sequenced is in the thousands, and they are

cataloged in several databases. Latterich and Croy (1993) have published

a partial listing of these databases and many of the genes and proteins

isolated.

Along with the advances in gene and protein isolation and

characterization has been an increased interest in using this knowledge to

clone and insert these genes into plants. Transgenic plants have been

engineered with several purposes in mind, including development of new and

more efficient transformation methods, for the basic study of a specific

gene, and for crop improvement for a specific purpose (Kung, 1993). The

first transgenic plants were produced in the early 1980s. Murai et al.

(1983) transferred the -Phaseolin gene from bean to sunflower and tobacco

plants using Agrobacterium tumefaciens. At around the same time, several

transgenic tobacco plants transformed using Agrobacterium tumefaciens

vectors and expressing foreign genes were reported (Horsch et al.,1984; De

Block et al., 1984).










2

These first transformation reports, as well as many that followed,

utilized the Agrobacterium tumefaciens vector system. However a number of

alternative methods have been developed. These include direct DNA uptake,

electroporation, particle bombardment, and microinjection. These methods

are discussed in Chapter 2.

Citrus tristeza virus (CTV) is the most economically important viral

pathogen of citrus (Lee and Rocha-Pena, 1992) This member of the

closterovirus group has a flexous rod shaped particle and a positive-

sense, single stranded RNA genome with a molecular weight of approximately

6.5 X 106. The genome of CTV contains 19,296 nucleotides constituting a

single messenger- sense RNA, making it the largest single-stranded, plus-

sense RNA plant virus known (Karasev et al., 1995). The coat protein gene

was first identified and sequenced by Sekiya et al. (1991). Of the nearly

20 kb in the genome, the 7292 nucleotides at the 3' end were sequenced and

eight open reading frames (ORFs) were identified, including the coat

protein gene, by Pappu et al. (1994). The remaining genome was sequenced

by Karasev et al. (1995), and it was thus determined that the complete

genome encodes 12 ORFs, and potentially codes for at least 17 gene

products. CTV is transmitted in a semipersistent manner by several

species of aphids, most notably Aphis gossypii and Toxoptera citricida.

T. citricida is a much more effective vector than is A. gossypii (Lee and

Rocha-Pena, 1992).

Citrus tristeza virus exists as a number of strains with different

biological activities. Mild isolates which show little to no symptoms are

often found in most citrus plantings. Mild strains will cause a slight

stem-pitting, little to no vein clearing, and flecking in the indicator













plant, Mexican Lime (Citrus aurantifolia) The more serious seedling

yellows symptoms can be found in seedlings of sour orange (C. aurantium),

lemon (C. limon), and grapefruit (C. paradisi). Seedling yellows is

characterized by a severe chlorosis and dwarfing. Stem pitting can occur

in both sweet orange and grapefruit. These trees will be stunted and

often chlorotic, with pitting under the bark of the stem and branches.

The stunted trees will often show pronounced longitudinal ridges or

depressions running up and down the trunk. Fruit size and productivity is

greatly reduced. One of the more severe form of the tristeza disease is

quick decline. This is a disease of sweet orange grafted on sour orange

rootstock. With quick decline the leaves turn yellow or golden in color,

wilt and then fall from the tree, leaving only the fruit hanging from the

tree. The tree quickly dies. Often the bud union will have an overgrowth

immediately above it (Lee and Rocha-Pena, 1992). Plants exhibiting quick

decline symptoms often succumb to the disease in as little as three to six

weeks.

Since Beachy and his colleagues were able to transform tobacco with

the coat protein gene of tobacco mosaic virus (TMV) and obtain resistance

to TMV (Powell-Abel et al., 1986; Beachy et al., 1987) there has been

considerable interest in using this technology to develop plants resistant

to other viruses (See chapter 2 for a review of this work). The purpose

of the present study was to apply this technology to insert the coat

protein gene from CTV into citrus scion cultivars in an attempt to

engineer virus resistant plants. If successful, this could be a

significant step in eliminating one of the major disease problems in










4

Citrus, and could lead to the possibility of once again using the CTV

susceptible rootstock sour orange in areas where CTV is found.















CHAPTER 2

LITERATURE REVIEW




Methods of Transformation



Agrobacterium tumefaciens-mediated Transformation

Agrobacterium tumefaciens is the pathogen that causes crown gall

disease in many plant species. The infection cycle of Agrobacterium is

very complex, involving a number of chemical signals emitted by both the

host and the pathogen. Infection occurs when the bacteria are attracted

to a number of chemicals secreted by wounded plant cells (Gelvin, 1993).

The virulent strains of A. tumefaciens contain large plasmids which are

responsible for the DNA transfer that subsequently causes the gall

formation. These plasmids have been termed tumor-inducing or Ti plasmids

(Schell et al., 1979; Chilton et al., 1980). Among the genes residing in

the Ti plasmids are the genes for opine synthesis in infected plants, and

opine catabolism in the Agrobacterium (Bomhoff et al., 1976; Genotello et

al., 1977). Early studies had shown a genetic linkage between

oncogenicity and opine metabolism (Lippincott et al., 1973; Genetello et

al., 1977). This led to the hypothesis that somehow the Ti plasmid was

involved in some sort of DNA transfer mechanism from the bacterium to the

plant. This DNA transfer mechanism was first shown to occur by Chilton et

al (1977) using hybridization experiments. This same group later showed











6

transcription of a part of this T-DNA (transferred DNA) in the crown gall

cells (Drummond et al., 1977).

The T-DNA covalently integrates into plant nuclear DNA, where genes

encoded by the T-DNA direct the synthesis of auxins and cytokinins, as

well as the low molecular weight opines. Opines are secreted from the

tumorous cells and can be used as a carbon, and sometimes, nitrogen source

by the Agrobacterium. Some of these opines also induce the conjugal

transfer of the Ti plasmid between Agrobacterium cells (Gelvin, 1993).

Thomashow et al. (1980 a,b) demonstrated that a majority to all of the T-

DNA is integrated into the plant DNA and that the T-DNA can be inserted in

more than one site in the plant genome. The excision of the Ti plasmid

and its subsequent transfer from the Agrobacterium to plant cells is

controlled by a group of genes on the Ti plasmid called the vir genes.

These vir genes are induced by a group of phenolic compounds produced by

the plant (Garfinkel and Nester, 1980; Klee et al., 1982; Hooykaas et al.,

1984; Lundquist et al., 1984; Gelvin, 1993).

The T-DNA contains specific DNA sequences called T-DNA borders which

have been shown by mutational analysis to be essential for tumorigenesis.

These T-DNA borders are made up of 25 bp highly conserved DNA sequences in

a directly repeated orientation (Schell, et al., 1979; Lemmers et al,

1980; Thomashow et al., 1980a,b; Zambryski et al., 1983; Bevan, 1984).

The mechanisms by which the DNA crosses the plant cell wall, crosses

through the cytoplasm, enters into the nucleus, and becomes integrated

into the plant DNA, are still unknown.

It was these T-DNA properties that led researchers to investigate

the use of Agrobacterium and its Ti plasmid as a tool for genetic













engineering. In order for this to be possible, two major modifications

were found to be necessary. First, the non-essential sequences (those not

involved in T-DNA transfer) of the T-DNA must be replaced with the foreign

genes of interest. Secondly, the tumor inducing capabilities of the T-DNA

need to be inactivated without inactivating its DNA transfer capabilities

(Van Montagu and Schell, 1982). In addition, the large size of the Ti

plasmid (>200 kb) makes it necessary to produce a series of autonomously

replicating or integrative vectors to use in gene transfer. These

integrative vectors are constructed in such a way that they recombine

specifically with a resistant Ti plasmid in A. tumefaciens which has been

disarmed. An example of a disarmed A. tumefaciens Ti plasmid is pGV3850,

a Ti plasmid mutant in which all the oncogenic functions have been deleted

and replaced by pBR322. (The plasmid pBR322 was developed for use in a

multipurpose cloning system prior to the identification of the Ti plasmids

of Agrobacterium (Bolivar et al., 1977). This plasmid (pBR322) is a

relaxed replicating plasmid that is sensitive to colicin El and also

carries resistance to the antibiotics ampicillin and tetracycline.

Plasmid pBR322 also contains five unique restriction sites- BamHI, EcoRI,

HindIII, PstI, and SalI. The resulting pGV3850 plasmid is still capable

of mediating efficient transfer and stabilization of its truncated T-DNA

into infected plant cells, but its integration and expression does not

interfere with normal plant function (Zambryski et al., 1983; Rogers et

al., 1987). At a minimum, the chimeric genes that are integrated

generally include a promoter such as the cauliflower mosaic virus gene VI

promoter (Comai et al., 1983; Potrykus et al., 1985a,b) or the nopaline

synthase promoter (de Block et al., 1984; Hain et al., 1985), as well as













a prokaryotic antibiotic resistance gene for antibiotics such as

kanamycin, streptomycin, spectinomycin or chloramphenicol (Comai et al.,

1983; Paskowski et al., 1984; Hain et al., 1985; Potrykus et al., 1985;

Rogers et al., 1988). Generally other genes including a selectable marker

such as kanamycin (NPTII gene), hygromycin (hph gene), or bialophos (bar

gene) and/or reporter genes such as -glucuronidase (uidA gene), or

chloramphenicol acetyl transferase (cat gene) are also included for

selection of transformed plants or cells.

Many of the plasmids constructed today are integrative intermediary

plasmids that contain pBR322 sequences. Autonomously replicating vectors

are constructed similarly to integrative vectors but contain an additional

wide host range function and thus do not require a co-integrate formation

for stable maintenance in Agrobacterium and subsequent transfer to plant

cells (Hoekema et al., 1983; Bevan, 1984; Rogers et al., 1988).




Direct Gene Transfer Using Particle Bombardment

One of the most popular methods for gene transfer today is particle

acceleration (bombardment) In this method, the DNA to be transferred is

carried through the cell wall and into the cytoplasm on the surface of

small (0.5 to 5 Am) metal (usually tungsten or gold) particles which have

been accelerated to speeds of one to several meters per second (Klein et

al, 1987). These particles are capable of penetrating up to several

layers of cells and allow for the transformation of cells within tissue

explants. This method is very popular for the transformation of many

cereals in which protoplast culture is difficult, as well as dicots which

can be recalcitrant to Agrobacterium infection.













Particle bombardment has several advantages over Agrobacterium-

mediated transformation. First, nonhosts of Agrobacterium, such as

monocots, can be transformed. Second, plasmid construction does not

require insertion of the sequences essential for T-DNA replication and

transfer in Agrobacterium. Third, the introduction of multiple plasmids,

referred to as cotransformation, is possible with particle bombardment.

Fourth, false positives resulting from growth of the Agrobacterium in host

cells are eliminated. Finally, the transformation protocols are

simplified by eliminating the complex bacteria-plant interrelationships

present in Agrobacterium systems (Gray and Finer, 1993).

Virtually every type of cell or tissue has been used as a target for

gene transfer by particle bombardment (See Table 2-1). Particle

bombardment has been especially valuable for the transient assay of gene

constructs in specialized cells or tissues (Goldfarb et al., 1991; Lee et

al., 1991a; Seki et al., 1991). On the negative side, plants regenerated

from bombarded plant tissues are usually chimeric in terms of introduced

foreign genes due to random bombardment of a small number of cells in a

multiple cell system (Sanford, 1990). This requires an additional

selection using selectable markers to sort out transformants that are

stabilized in their progenies (McCabe et al., 1988; Finer and McMullen,

1990; Fromm et al., 1990; Gordon-Kamm et al., 1990; Tomes et al., 1990;

Christou et al., 1991; McCown et al., 1991; Lowe et al., 1995). In

addition, the success of particle bombardment transformation to produce

stable transgenic plants is partly dependent on having an efficient

multiple shoot regeneration or embryogenic system. Further, the failure















Table 2-1: Types of cells or tissues used for particle bombardment, and
whether or not transgenic plants were obtained.


Tissue used


Suspension


Callus


Plant
Species

Barley

Corn

Rice

wheat

Papaya

Tobacco

Cotton

Grape

Corn

Rice

Wheat

Peach


Transgenic
plants
obtained


References


Mendel et al., 1989

Gordon-Kamm et al., 1990

Wang et al., 1988

Wang et al., 1988

Fitch et al., 1990

Iida et al., 1990

Finer and McMullen, 1990

Hebert, et al., 1993

Fromm et al., 1990

Board et al., 1990

Daniell et al., 1991

Ye et al., 1994


Embryos Black Spruce no Bommineni et al., 1994

Barley no Kartha et al., 1989

Corn no Klein et al., 1989

Pearl Millet no Taylor and Vasil, 1991

Wheat no Lonsdale et al., 1990

Rice yes Christou et al., 1991

Peach no Ye et al., 1994

Leaf Tobacco yes Tomes et al., 1990

Wheat no Daniell et al., 1991

Peach no Ye et al., 1994

Sugarcane no Gallo-Meagher and Irvine, 1993

Meristems Soybean yes McCabe et al., 1988

Soybean Yes Christou et al., 1989

Nodules/Stems Poplar yes McCown et al., 1991











11

to regenerate transgenic plants after particle bombardment of either

embryogenic suspensions or immature scutelli may be due to the limited

amount of DNA carried into the cells by particles or in the efficiency

with which the DNA disassociates from the particle. As a result, there is

a low potential for integration even in cells containing the particles.

This low frequency has to be multiplied by the low frequency of competent

cells. Thus the production of transgenics by particle bombardment can be

expected at a low frequency (Potrykus, 1990).

The first report of microprojectile bombardment was made using a

gunpowder-based acceleration system to propel tungsten particles carrying

DNA through an evacuated chamber and into the cells (Klein et al., 1987).

Later modifications were made to optimize the gun parameters and

evaluation of gene expression (Russell et al., 1992; Morrish et al.,

1993). Modifications of the gunpowder version of particle bombardment

system used high pressure helium as a means to accelerate the

microprojectiles (Russell-Kikkert, 1993). This design is commercially

available from DuPont. A second design was a homemade version based on

the DuPont airgun which utilized accelerated tungsten particles to

transform monocot cells (ard et al., 1990; Oard, 1993). A third concept

utilized a stream of helium to deliver DNA (Takeuchi et al., 1992). This

concept was further refined to become the commercially available particle

inflow gun (PIG) (Finer et al., 1992).

Particle bombardment has made it possible to transfer foreign DNA

into organelles. Daniell et al. (1990) reported on the introduction and

transient expression of foreign genes in suspension cell-derived

chloroplasts of tobacco. Daniell et al. (1991) also reported the











12

successful transient expression of -glucuronidase in chloroplasts

isolated from wheat leaf and callus and transformed using particle

bombardment. Stable gene replacement at a very low frequency (a total of

five transformants from 245 particle bombardment events) has been reported

for tobacco (Svab et al., 1990; Staub and Maliga, 1992).




Gene Transfer By Direct DNA Uptake

In species with a reliable protoplast regeneration system, direct

gene transfer by either chemical (polyethylene glycol (PEG)- mediated), or

electroporation, or a combination of the two techniques has been quite

popular. Protoplasts are in principle ideal cells for the delivery of DNA

and selection of transgenic events. Removal of the cell wall eliminates

one of the major barriers to the delivery of DNA. Further, the efficiency

for recovery of transgenic events is higher because cross feeding and

chimerism between transgenic and wild-type cells is minimized in

comparison to transformation systems based on multicellular tissues

(Songstad et al., 1995). Because plants regenerated from protoplasts come

from a single cell, all cells in the transgenic plant should contain the

genes of interest that were inserted. It has been shown that foreign

genes integrate predominantly at a single locus, are inherited as single

mendelian traits, and can be as stable as the wild-type genes (Potrykus et

al., 1985a).

The most commonly used procedure for introduction of DNA into

protoplasts involves treatment with PEG, much the same as in somatic

hybridization. PEG alters the plasma membrane properties by causing a

reversible permeability that enable exogenous macro-molecules to enter the













cytoplasm. The exact mechanism of PEG-mediated membrane permeabilization,

and thus DNA delivery, is not completely understood (Songstad et al.,

1995).

The first report of direct DNA uptake and stable transformation

involved the transfer and expression of Agrobacterium tumefaciens T-DNA

into tobacco protoplasts using PEG (Draper et al., 1982; Krens et al.,

1982). The first transgenic plants obtained in this manner were reported

by Paszkowski et al. (1984). The keys to being able to accomplish this

were optimization of the protoplast to plant regeneration system,

development of the aminoglycoside phosphotransferase gene II from E. coli

transposon Tn5 as a selectable marker conferring plant cell resistance to

kanamycin, and optimization of the DNA delivery frequency (Potrykus et

al., 1985a).

PEG-mediated transformation is performed in much the same way as

protoplast fusion but with the second donor cell being the plasmid as

opposed to a second plant protoplast cell. Protoplasts are isolated the

same as for fusion, and 3-15 ug of plasmid DNA per ml of protoplasts, is

added (Krens et al., 1982; Saul et al., 1988; Paszkowski and Saul, 1988).

A variety of different procedures have been used depending on the species

being transformed. A number of different parameters have been looked at

in order to optimize the systems.

Many early experiments included calf thymus DNA in the protocol

(Krens et al., 1982; Krens et al., 1985; Shillito et al., 1985; Peerbolte

et al., 1985; Uchimaya et al., 1986), usually at concentrations of 5 times

the amount of calf thymus DNA as plasmid DNA. The calf thymus DNA acts as

a carrier in the transformation and has been shown to appear in











14

transformed plants when the transformation frequency is high (Krens et

al., 1985; Peerbolte et al., 1985); but has also been reported to not be

expressed in those plants (Krens et al., 1985). In many of the early

experiments in transformation of protoplasts, calf thymus DNA was reported

to be essential for transformation (Krens et al., 1982; Shillito et al.,

1985; Negrutiu et al., 1987). However this may not always be the case.

Successful transformation has been obtained without using calf thymus DNA

or other carrier DNA (Hain et al., 1985; Damm et al., 1989; Tautorus et

al., 1989).

Optimization of PEG-mediated transformation is more than likely

dependent on a number of factors other than just the presence of carrier

DNA. Shillito et al., (1985) demonstrated that, for electroporation (to

be discussed later), a PEG concentration of 7.8% w/v was optimum for

transformation, particularly when the protoplasts were heat shocked at 45

C for 5 minutes prior to the addition of DNA and PEG. More commonly,

particularly for PEG-mediated transformation, an optimum of 20% PEG has

been shown (Saul et al., 1988; Maas and Werr, 1989; Armstrong et al.,

1990). Damm et al. (1989) showed that with a final PEG concentration of

10-20% the transformation frequency was 3 to 5 times higher than at lower

concentrations, but at a PEG concentration of 30 % the frequency was

virtually the same. Others have reported success with PEG concentrations

of 10% (Tautorus et al., 1989) or 25 % (Antonelli and Stadler, 1989).

Divalent cations are also reported to play a major role in the

success of transforming protoplasts. Calcium has been shown to aid in the

uptake of DNA by protoplasts. It was thought that calcium phosphate co-

precipitates the DNA, which is then taken up by endocytosis (Hain et al.,










15

1985). This was supported by later research which showed that DNA

precipitation is more efficient in the presence of divalent cations (Ca2,

Mg2. and Mn ), and efficient DNA incorporation required both PEG and a

divalent cation (Maas and Werr, 1989). Ca2' and Mg2 were more efficient

than Mn2 Armstrong et al. (1990) reported higher transformation

frequencies with Ca2 than with MJ +. Other groups have reported higher

transformation frequencies with Mg2' than with Ca2+ (Negrutiu et al., 1987;

Vasil et al., 1988). This difference may be due to additional factors

including methods used, the species being transformed, and genotypic

effects.

Also reported to play a major role in the efficient transformation

of protoplasts is the pH of the PEG solution (Maas and Werr, 1989). This

is probably due to the fact that at higher pH (9.0) values large

aggregates of DNA are formed that can be taken up less efficiently than

the smaller DNA aggregates formed at lower pH (6.0) values.

As mentioned previously, heat shock treatment at 45 C for 5 minutes

prior to transformation may increase transformation frequency as in maize

(Zea mays) (Shillito et al., 1985), sunflower (Helianthus annuus) (Moyne

et al., 1989), black spruce (Pinus mariana), and jack pine (Pinus

banksiana) (Tautorius et al., 1989). Tyagi et al (1989) found little

effect from a heat shock treatment on tobacco (Nicotiana tabacum).

Electroporation is often used either alone or in combination with

PEG. Electroporation involves the subjecting of protoplasts to

electrical pulses of AC and DC current to cause reversible

permeabilization of the plasma membrane enabling macromolecule delivery.

Isolated protoplasts and the plasmid are mixed prior to electroporation.










16

An AC field giving 25 volts (peak-to-peak) at 500 KHz which aligns the

protoplasts in chains of varying lengths is applied. Excessively long

chains are avoided by using a voltage strong enough to bring about

alignment, but applied at a slow rate of increase over a five minute

period. A DC pulse of 2 milliseconds is given and a few seconds later the

AC field is progressively reduced to zero. (Power et al., 1988). Many of

the earlier successes in stably transforming tobacco protoplasts involved

combinations of PEG and electroporation treatments (Shillito, 1985; Fromm

et al., 1986; Negrutiu et al., 1987; Saul et al., 1988). Electroporation

is commonly used for transient gene expression studies in both mammalian

and plant protoplast systems (Songstad et al., 1995).



Other Methods of Transformation



Microinjection.

Microinjection is performed under the microscope with the DNA

injected directly into individual cells. Microinjection has the advantage

in that the amount of DNA injected into a cell is not limited, the

delivery is precise, and cells with high regeneration capacity can be

targeted. Microinjection is, however, very labor intensive and requires a

highly skilled individual to perform the injection (Potrykus, 1990). In

haploid canola, microspore-derived embryoids microinjected at the 12 cell

stage of development resulted in the recovery of transformed plants, but

they were chimeric and required recovery by secondary embryogenesis

(Neuhaus et al., 1987). Protoplasts have been shown to survive

microinjection (Griesbach, 1985; Lawrence and Davies, 1985; Morikawa and













Yamada, 1985 a,b; Reich et al., 1986a,b; Steinbiss and Stabel, 1983), as

have pollen grains (Crossway et al., 1986; Kranz and Lorz, 1990) and onion

epidermal cells (Bradley, 1979). However, transformation by

microinjection of protoplasts has not been reported (Songstad et al.,

1995).



Liposome Mediated Transformation.

Liposomes entrap a large variety of macromolecules such as enzymes

or nucleic acids and can be used to deliver them into cells by fusion with

the plasma membrane or by endocytosis. The choice of the proper lipid

composition is very important to the system. Most of the successes using

liposomes has been with animals (Gad et al., 1990). The mode of action

of DNA delivery is unclear, but there is evidence that it is by cellular

uptake (endocytosis) as determined by electron microscopy (Fukunga et al.,

1983; Nagata, 1984; Guerineau and Tailliez, 1986) Negatively charged

liposomes work better than positively charged liposomes (Gad et al.,

1986). The genetic material encapsulated in negatively charged liposomes

is inserted into the cells usually by the addition of fusogens to the

reaction mixture. Divalent cations such as Ca2* promote liposome fusion

(Gad et al., 1988).

Protoplasts appear to be best suited for receiving exogenous DNA

from liposomes. Both transient and stable gene expression has been

obtained in tobacco protoplasts using liposome-encapsulated DNA (Rosenberg

et al., 1988). The traits transformed to the zygotic offspring were shown

to be inherited as one dominant gene (Deshayes et al., 1985).













Transformation Using Silicon Carbide Fibers.

DNA delivery into plant cells using silicon carbide fibers was first

reported by Kaepler et al. (1990). This simple method involves vortexing

a mixture of plant cells, plasmid DNA and silicon carbide fibers. Silicon

carbide fibers likely mediate DNA delivery because of their shape, size,

strength, and chemical composition. However, silicon carbide fibers pose

a lung disease and carcinogenic danger similar to asbestos, if inhaled

(Songstad et al., 1995).



Cross Protection



Cross protection can be defined as the use of a mild or attenuated

strain of a virus to prevent further infection from more severe strains of

a virus or to other closely related viruses (Sequiera, 1984; Fulton, 1986;

Palukaitis and Zaitlin, 1984; Wilson, 1993). A variety of terms have been

applied to this phenomenon including acquired immunity, antagonism, cross

immunization, dominance, interference, premunity, induced immunity,

prophylactic inoculation and protective inoculation (Fulton, 1986).

The first report of cross protection was made in 1929 when McKinney,

working with tobacco mosaic virus, reported the ability of one strain of

the virus to protect against later infections by a second strain of the

virus (McKinney, 1929). Later Salaman (1933) found that tobacco plants

infected by a mild strain of potato virus X were protected against other

strains of this virus. Salaman proposed that this cross protection could

have economic importance, and since then there have been numerous attempts

to use avirulent strains to improve the yield of many crops, but with











19

limited success (Fletcher, 1978). However, for a number of viruses this

approach has been successfully applied. These include tomato mosaic virus

(Broadbent, 1976), papaya ringspot virus (Yeh et al., 1988), tobacco

mosaic virus (Rast, 1972), and citrus tristeza virus (Muller and Costa,

1966, 1969, 1977; Costa and Muller, 1980).

The mechanisms by which cross protection works are not well

understood (Gadani et al., 1990). Earlier theories on the mechanism of

action of cross protection centered around four general categories. First

was the theory of precursor exhaustion in which the inducing virus has

exhausted one or more of the essential materials required for the

replication of the challenging virus. The second theory is that the

inducing virus produces substances which specifically inhibit related

virus, but not unrelated viruses. It would be possible for this specific

inhibitor to bind to the incoming challenging virus. A possibility for

such a specific inhibitor would be the viral replicase. A third theory is

that the inducing virus has altered the metabolism of the host to such an

extent as to render it insusceptible to a challenging virus. Finally, a

fourth theory centers around coat protein sequestration. The coat protein

of the inducing virus encapsidates the nucleic acid of the related

challenging virus, and the virions that are then produced are not in an

environment of the cell enabling their nucleic acid to be released and

replication to begin. (Sherwood and Fulton, 1982; Palukaitis and Zaitlin,

1984). However, none of these theories can be shown to be correct for all

viruses, and in fact the true mechanism may be a combination of these or

an as yet undescribed mechanism.













Cross protection of CTV in Citrus



In order to have effective cross protection the mild isolate used

must be mild in all citrus cultivars and susceptible hosts grown in a

given area. In addition, the virus used must be genetically stable with

little or no chance of reverting to a severe form. Artificially

attenuated or mutated viruses might be more likely to revert back to the

severe form. Finally, the slight reduction in yield and performance of

the host due to the effects of the mild strain should be economically

acceptable (Lee and Rocha-Pena, 1992).

The first report that cross protection could be possible in citrus

was made in 1951 (Grant and Costa, 1951) Most early work on cross

protection of citrus was done to protect against the stem pitting isolates

of CTV. Consequently, a great deal of work has been done in countries

where severe stem pitting isolates exist. By 1980 over 15 million 'Pera'

sweet orange trees were inoculated for protection against CTV-induced stem

pitting in Brazil (Costa and Muller, 1980). Mild strain cross protection

has been used on grapefruit in Japan (Sasaki, 1979; Leki, 1989; Koizumi et

al, 1991), Australia (Stubbs, 1964; Cox et al., 1976; Thornton et al.,

1980), South Africa (De Lange et al., 1981) and Venezuela (Romero et al.,

1991). Also reported was cross protection of naval orange in Japan

(Koizumi, 1991), and limes in India (Balaraman and Ramakrishnan, 1980) and

Venezuela (Romero, et al., 1991).

Because most countries abandon sour orange as a rootstock when CTV-

induced quick decline occurs, relatively little research has been done on

cross protection against quick decline. However, because of its excellent











21

horticultural characteristics, there has been recent interest in

evaluating whether mild strain cross protection would work to prevent

quick decline of trees on sour orange rootstock. Thornton and Stubbs

(1976) reported a delay in the onset of tristeza induced quick decline of

'Marsh' grapefruit on sour orange. However, by 1980 they were reporting

some breakdown in the immunity of these trees (Thornton et al., 1980).

Wallace and Drake (1976) also reported a delay in symptoms of 'Valencia'

sweet orange on sour orange after preimmunization. Van Vuuren et al.

(1991) evaluated 11 mild CTV isolates from Florida, Israel, and South

Africa for cross protection of 'Valencia' sweet orange on sour orange in

South Africa. Quick decline symptoms appeared after 4 years for some of

the isolates. Only one isolate appeared to have potential commercial

value under the South African climatic conditions. In a similar study in

Florida, 'Hamlin' sweet orange and 'Redblush' grapefruit trees on sour

orange rootstock were preinfected with 14 different mild strain isolates

of CTV. These trees were exposed to natural challenge in an area where

severe decline strains were prevalent. The CTV decline was more prevalent

in the 'Hamlin' trees than in the 'Redblush' Grapefruit (Yokomi, et al.,

1991). Another field trial by Rocha-Pena et al. (1991) showed little or

no decline after four years for 'Hamlin' and Grapefruit on sour Orange,

suggesting that with proper selection of mild CTV isolates, cross

protection against quick decline on sour orange is possible.

There are, however, several problems involved in the use of cross

protection as a control strategy against severe strains of citrus tristeza

virus (Lee and Rocha-Pena, 1992). First, the budwood source trees have to

be biologically indexed on a frequent basis to ensure that a severe strain













has not been introduced (De Graca et al., 1982). The erratic distribution

of CTV within the scion can result in as much as 50% of the buds being

propagated that should contain the mild strain isolate, actually being

virus free (Lee et al., 1987). Hot weather can induce a kind of

thermotherapy which often prevents the spread of the mild strain isolates,

thus leaving parts of the tree virus free and exposed to infection from

severe isolates, breaking down the cross protection (Lee et al., 1988).

Selection of the mild isolates to use can be very difficult and

inefficient (Costa and Muller, 1980). This may be partly due to the fact

that many isolates which show cross protection in one environment may

express severe symptoms or at least fail to cross protect in other

environments (Lee and Rocha-Pena, 1992). It is these problems which have

contributed to the idea of genetically engineering the cross protection

into citrus.




Genetic Engineering for Virus Resistance



With the dramatic advances in plant transformation technology there

has been a tremendous interest in introducing virus resistance by genetic

engineering. With a few exceptions, the genes used to induce this virus

resistance have come from the genome of the virus. This is partly due to

the difficulties still inherent in isolating plant resistance genes from

the relatively large plant genome. In contrast, plant viruses contain

relatively few genes which can be more readily identified and cloned. A

majority of the examples of genetically engineered viral resistance have











23

involved the use of the coat protein gene but other genes have been used

to obtain virus resistance as well.




Replicase Gene

The first report of replicase mediated resistance was demonstrated

with tobacco mosaic virus (Golemboski et al, 1990; Carr et al., 1992).

While attempting to determine the role of a putative 54-kDa protein

encoded within the replicase of TMV, they found that the plants expressing

the 54-kDa protein were completely resistant to TMV, even at inoculum

levels up to 1000 fold higher than conferred by the TMV coat protein gene.

Donson et al., (1993) demonstrated no resistance to TMV in tobacco plants

transformed with the full length (183 kDa) replicase gene, but in

transgenic plants with an additional insertion which would terminate

translation in the middle of the 183 kDa gene, a high level of resistance

to systemic infection by TMV and other tobamoviruses was noted. Similar

results were obtained with cucumber mosaic virus (CMV) in tobacco

(Anderson et al., 1992), potato virus X (PVX) in tobacco (Braun and

Hemenway, 1992; Longstaff et al., 1993) pea early browning virus (PEBV) in

Nicotiana benthamiana (MacFarlane and Davies, 1993), potato virus Y (PVY)

in tobacco (Audy et al., 1994), and cymbidium ringspot virus (CyRSV) in N.

benthamiana (Rubino et al., 1993). Rubino and Russo (1995) later reported

that the transgenic N. benthamiana plants containing the CyRSV full-length

replicase gene were not resistant to the closely related artichoke mottled

crinkle tombusvirus (AMCV) and carnation italian ringspot tombus virus

(CIRV), indicating that the resistance was probably RNA-mediated

resistance. In most of these cases the resistance of the most resistant











24

replicase expressing lines was greater than for the coat protein

expressing lines. No field testing of the replicase expressing transgenic

plants has yet been reported.




Movement Protein

Tobacco plants expressing a defective movement protein of TMV or

transformed with the movement protein from brome mosaic virus (BrMV),

which cannot spread in tobacco, were shown to be protected from TMV

(Malyshenko et al., 1993). The authors theorized that the presence of

either of these movement proteins before viral inoculation inhibited the

ability of the incoming functional viral movement protein from TMV to

successfully interact with the plasmadesmata.



Protease

The potyvirus genome codes for a single large polypeptide that is

subsequently cleaved into individual mature viral proteins through the

action of three viral encoded proteases (Dougherty and Carrington, 1988).

One of these genes which encodes the NIa protein was used to transform

tobacco (Vardi et al., 1993). Of the 50 transgenic plants produced, 2

were found to be resistant to PVY. However the authors believe that this

resistance may be due to accidental alterations which may have occurred

during the cloning of the gene which may have resulted in a dysfunctional

protein. Nevertheless, this may lead to a possibility of intentionally

modifying the protease genes of viruses which produce polyproteins to

obtain virus resistance.













Antisense and Sense-defective RNAs

There have been several reports using antisense or sense-defective

RNAs to engineer virus resistance. It is thought that the interaction

between complementary transgene and viral encoded gene sequences

interferes with translation, replication or viral nucleic acid stability

(Grumet, 1995). Cuozzo et al. (1988) transformed tobacco plants with the

cauliflower mosaic virus (CMV) antisense coat protein (CP). They found

resistance only at low inoculum levels indicating that antisense CP-RNA

resistance was less effective than the coat protein mediated resistance.

Similar results were shown for PVX (Hemenway et al., 1988), TMV (Powell-

Abel et al., 1989), and zucchini yellow mosaic virus (ZyMV) (Fang and

Grumet, 1993). The lack of protection at higher inoculum levels may be

due to a gene dosage effect (Gadani et al., 1990). The mechanism of

action of viral antisense RNA may be due to an inhibition of coat protein

synthesis by the formation of an antisense-sense RNA hybrid, prevention of

replication by binding of the antisense RNA to the origin of replication

or by competition with the viral negative strand for viral or host

components necessary for replication (Gadani et al., 1990).

There are, however, examples where RNA mediated protection was much

more effective, most notably in the luteovirus and potyvirus groups.

Lindbo and Dougherty (1992a,b) demonstrated that both sense and antisense

forms of the coat protein gene of Tobacco Etch Virus (TEV) conferred a

high level of resistance to TEV. Hammond and Kamo (1993) demonstrated

varying degrees of resisance in their N. benthamiana plants transformed

with the antisense coat protein of bean yellow mosaic potyvirus (BYMV).

Kawchuk et al., (1991) showed that both the sense and antisense RNA of the










26

coat protein gene of potato leaf roll luteovirus (PLRV) showed a high

level of resistance to PLRV infection.



Coat Protein

Since the phenomenon of cross protection was first observed over 65

years ago by McKinney (1929) there has been considerable interest in the

development of plants protected from severe virus infection. There have

been several studies which have indicated that the coat protein plays a

major role in cross protection (DeZoeten and Fulton, 1975; Sherwood and

Fulton, 1982; DeZoeten and Gaard, 1984; Wilson and Watkins, 1986; Zinnen

and Fulton, 1986). In order to test this hypothesis, Powel-Abel and her

colleagues introduced the capsid protein gene of tobacco mosaic virus into

tobacco plants by using a chimeric gene construct containing a cDNA from

the coat protein coding sequence, with the CaMV 35S promoter and the

polyadenylation seguence from the Agrobacterium nopaline synthase gene.

After Agrobacterium-mediated transformation and subsequent plant

regeneration, these plants were tested for virus resistance. They

determined that high levels of accumulation of coat protein corresponded

to high levels of resistance to virus infection, and a corresponding delay

in symptom development in the progeny of self-fertilized transgenic

plants. The protection was overcome by inoculation of the transgenic

seedlings with unencapsidated viral RNA and was less effective when a high

virus concentration was used (Powel-Abel et al., 1986) This mimics what

happens with classical cross protection with TMV. Since this first

successful demonstration of coat protein-mediated resistance (CP-mediated










27

resistance), there has been a considerable interest in using this approach

in a variety of plant species (See Table 2-2).

There is no consensus on how CP-mediated resistance works. In fact,

the mechanism may be dependent on the virus-plant-coat protein system and

the exact nature of how the protection works may depend on the viral gene

construct used, transgene position effects, copy number, transcriptional

activity, the extent and site of uninhibited virus replication and spread

within the host plant, and secondary effects of transgenesis on host cell

metabolism and general stress anddisease resistance responses (Wilson,

1993). For example, in the case of TMV (Powel-Abel et al., 1986), alfalfa

mosaic virus (AlMV) (Loesch-Fries et al., 1987), and potato virus X

(PVX) (Hemenway, 1988) the level of resistance correlated positively with

the levels of coat protein in the transgenic plants. Plants that only

accumulated the coat protein transcript of TMV or AIMV and not the coat

protein itself were not resistant. However, in plants transformed with

the coat protein gene of potato virus Y (PVY) (Farinelli and Malnoe, 1993)

and potato leaf roll virus (PLRV) (Barker et al., 1993), resistance

correlated with the levels of coat protein transcripts and not with the

levels of coat protein. Moreover, in the case of PVY and PLRV some virus

resistant transgenic lines were identified in which the coat protein was

not detectable. To further complicate things, tobacco transformed with

the coat protein gene of tomato spotted wilt virus (TSWV) were resistant

when an intact coat protein gene was used, as well as when the transgene

was rendered untranslateable through the removal of the initiating start

codon (DeHaan et al., 1992). This would indicate that expression of the

coat protein is not necessarily required for resistance.












Table 2-2. Examples of coat protein-mediated resistance.


Plant


Resistance


Reference


Tobacco


Mosaic Virus


Alfalfa Mosaic Virus




Tobacco Rattle Virus


Tobacco Streak Virus

Cucumber Mosaic Virus








Tomato Spotted Wilt Virus





Potato Virus Y

Lettuce Mosaic Virus

Papaya Ringspot Virus


tobacco

tobacco

tomato

alfalfa

tobacco

tomato

tobacco


tobacco

cucumber

cucumber

tobacco

muskmelon


tobacco

tomato

chrysanthemum

potato

tobacco

papaya

plum


delay

to other Tobamo-also


yes

delay

yes (tobacco also)

yes- Pea Early Browning
Virus also

yes?

yes

field tested resistance

yes

yes


yes

yes

not tested



yes

yes


Powel-Abel et al., 1986

Nejidat and Beachy, 1990

Nelson et al., 1988

Halk et al., 1989

Loesch-Fries et al., 1987

Tumer et al., 1987

van Dun and Bol, 1988


van Dun et al., 1987

Gonsalves et al., 1991a

Gonsalves et al., 1992

Cuozzo et al., 1988

Gonsalves et al., 1991b;
Gonsalves et al., 1994

MacKenzie and Ellis, 1992

Ultzen et al., 1995

Yepes et al., 1995

Lawson et al., 1990

Dinant et al., 1993

Fitch et al., 1992

Scorza et al., 1991


Virus












Virus Plant Resistance Reference

Bean Yellow Mosaic Virus tobacco Hammond and Kamo, 1991

Plum Pox Virus plum yes Scorza et al., 1994

tobacco variable Ravelenandro et al., 1993
Tobacco Vein Mottling Virus tobacco Main et al., 1991
Soybean Mosaic Virus tobacco broad spectrum Stark and Beachy, 1989

Potato Leaf Roll Virus tobacco yes Kawchuck et al., 1990

potato +/- sense Kawchuck et al., 1991
Potato Virus X tobacco +/- sense Hemenway et al., 1988

potato yes Hoekema et al., 1989
potato yes- field tested Jongdijk et al., 1992
Cassava Mosaic Virus tobacco Fauquet et al., 1991
Potato Virus S tobacco Mackenzie and Tremaine, 1990

Rice Stripe Virus rice yes Hayakawa et al., 1993
Grapevine Fan Leaf Virus grape yes Bardonnet et al., 1994

grape variable Krastanova et al., 1995
Maize Dwarf Mosaic Virus maize yes- also MCMV" Murry et al., 1993

Tomato Yellow Leaf Curl tomato yes Kunik et al., 1994
Virus
Arabis Mosaic Virus tobacco yes Bertioli et al., 1992



MCMV is Maize Chlorotic Mottle Virus



Table 2-2 (continued). Examples of coat protein-mediated resistance.

















In the potyviruses (PVY, TEV, ZYMV), and luteoviruses (PLRV), when

intentionally truncated antisense or nonexpressing (with no start codon) coat

protein genes were transformed into plants, there was a measurable or even

complete protection against the parent virus (Kawchuck et al., 1991; van der Wilk

et al., 1991; Lindbo and Dougherty, 1992a,b; DeHaan et al., 1992; van der Vlugt

et al., 1992; Fang and Grumet, 1993; Farinelli and Malnoe, 1993; Lindbo et al.,

1993). In all these cases the resistance may be due to some direct form of RNA-

RNA interference between the transgene transcript and challenge virus. In TEV

with a truncated CP gene, it was common for the inoculated leaves to develop

symptoms and virus titer which was similar to that of control plants, but for the

plants to outgrow the infection, suggesting some interference with virus spread

(Lindbo and Dougherty, 1992a).

Recently, Dougherty and his colleagues have studied in detail coat protein-

mediated resistance using TEV. Their results confirm that transgene-derived RNA

may be either translatable or untranslatable indicating that a product of the

transcript is not involved in eliciting the resistance. That is, plants

displaying the virus resistance phenotype transcribe the transgene at a high

rate, yet accumulate the transcript at a low level (Dougherty et al., 1994; Smith

et al., 1994; Mueller et al., 1995). In plants which exhibit these

characteristics, the cytoplasmically located virus does not replicate to a

detectable level. It has been suggested that a post-transcriptional RNA

targeting system could be activated, resulting in the elimination of both

transgene and viral RNA from the cytoplasm (Lindbo et al, 1993; Dougherty and

Parks, 1995).














31

Dougherty and his colleagues (Smith et al., 1994) have further suggested

that there is a threshold level of transgene-derived transcripts that must be

exceded in order to activate the cytoplasmic post-transcriptional RNA degradation

process and thus elicit virus resistance. This suggests that the number of

transgenes and their level of expression are important in determining the

activation state of the cytoplasmic system. To further explore this RNA-mediated

virus resistance Dougherty and his colleagues (Goodwin et al., 1996) undertook

a study to characterize the biochemical and genetic processes of the resistance.

Using a set of plants that contained zero, one, two, or three copies of the

transgene in both a homozygous and heterozygous condition, it was determined that

three or more transgenes were necessary to establish the highly resistant state.

One or two transgene copies resulted in an inducible form of resistance. The

steady state RNA levels and the rates of transcription of the transgenes in the

plants in this study supported a post-transcriptional RNA degradation process as

the underlying mechanism for transgene transcript reduction and virus resistance.

Resistance appears to be initiated by a cleavage of specific sites within the

target RNA sequence. Further experiments are being conducted to see if this

really is the case.



Transformation of Citrus



The first successful transformation of Citrus was reported by Vardi et al.

(1990) using PEG-mediated direct DNA uptake. They were able to successfully

transform Rough Lemon (Citrus jambhiri) protoplasts. The first successful

















transformation of Citrus by Agrobacterium tumefaciens was reported by Moore et

al. (1992). Transgenic Carrizo Citrange (C. sinensis X Poncirus trifoliata) were

produced by co-culturing with Agrobacterium tumefaciens. Transformation and

stable integration in regenerated plants was confirmed by PCR and Southern

analyses. Hidaka et al. (1990) reported the recovery of transgenic 'Washington

Navel' sweet orange (C. sinensis) from Agrobacterium-mediated transformation.

Kobayashi and Uchimaya (1989) reported the transfer of foreign DNA into sweet

orange protoplasts by direct DNA uptake but since no plants were regenerated,

stable transformation can not be claimed. Schell (1991) reported the

transformation of 'Hamlin' sweet orange protoplasts and the regeneration of

transgenic plants as demonstrated by histochemical assaying for GUS and PCR

analysis, but not by genomic Southern analysis. Pena et al. (1995) reported the

transformation and subsequent regeneration of transgenic plants from sweet orange

by Agrobacterium mediated transformation. Integration of the UidA (GUS) gene was

confirmed by Southern analysis.

Attempts are now being made by several labs to insert the coat protein gene

from citrus tristeza closterovirus (CTV) into citrus. It is hoped that this

genetically engineered cross protection will result in the production of trees

resistant to the tristeza virus, which is one of the most economical damaging

pests of Citrus. Espinosa (1995) successfully introduced the coat protein gene

of CTV into 'Carrizo' citrange (C. sinensis X Poncirus trifoliata) and sour

orange. These results have been confirmed by Southern and western immunoblot

analyses. These are the only results so far confirmed.














33

In addition, Febres-Rodriguez (1995) has characterized the genes for three

other open reading frames (P18, P20, P27) and has attempted to transform Citrus

with these genes. He showed the production of plants which were GUS positive and

positive by PCR but not confirmed by Southern analysis.


















CHAPTER 3

MATERIALS AND METHODS




Plasmid Preparation



The two plasmids used in this research, were supplied by the

laboratory of Dr. C.L. Niblett. The two plasmids used were pMONI0098

(provided by Dr David Stark, Monsanto Corp. to Dr. Niblett) and pBPFQ-7

(provided by Dr. G. Selman, Institute for Genetic Engineering (Havana,

Cuba, to Dr. Niblett). The coat protein genes from Florida isolate T30 (a

mild isolate) of CTV, and Florida isolate T36 (a severe decline isolate)

of CTV were inserted into each of the two plasmids. The only difference

in the transformations into Escherichia coli for the two plasmids was that

pMONI0098 was selected for using spectinomycin (75Al/ml), and pBPFQ-7 was

selected for using ampicillin (50Ag/ml). The plasmid pMONI0098 contains

an enhanced CaMV 35 S promoter, nos terminator, and the NPTII gene. The

plasmid pBPFQ-7 contains two CaMV 35 S promoters in tandem, plus the 71

base pair non-coding 5' leader sequence of TMV (TMV Q) attached to the 3'

end of the nos terminator, in pUCI8 (See Figure 3-1). A detailed map of

the pUCl8 plasmid can be found in Sambrook, et al. (1989). Neither

plasmid contained a scoreable marker such as the uidA gene for -

glucuronidase.
















Pstl
EcoRI Pui

BglI 4 E9 -3
CTY CP ge ne r'. r h

M Py u I
P- e355left bo rde r--



right border i
0 ri -Y


pMON1 0098- CP
-9.3 kb





Pst I "o ri-322








Figure 3-1a. Map of pMON0098. Spc/str is the Spectinomycin
and streptomycin resistance gene. P-e35S is the enhanced CaMV
35S promoter. CP is the coat protein gene. E9 3' is the
terminator sequence. P-35S is the CaMV 35S promoter. Kan is
the Kanamycin resistance gene (equivalent to the NPTII gene).
Nos-3' is the Nopaline synthase terminator. ori-V is the
origin of replication. R is the right border and L is the
left border. The -> or <- is the direction of translation.
The Kan gene confers resistance in the plant cells. The
spc/str gene allows for selection in E. coli. The rest of the
plasmid that is not shown is pBR322 (See Sambrook et al., 1989
for the map of pBR322).


















Sally


Q leader seq
EcoRl

CTV CP aer e


1 e ft t O
border


Sall Bgltl






Figure 3-1b. Map of pBPFa-7. amp is the ampicillin gene used
for bacterial selection. P-35S is the enhanced CaMV 35S
promoter which consists of two CaMV 35S promoters in tandem.
CP is the coat protein gene. n is the 71 base pair 5' leader
sequence of TMV. The rest of the plasmid is pUC18 (See
Sambrook et al., 1989 for the map of pUC18).













Transformation of E. coli (Sambrook et al., 1989; E. Anderson, pers.
comm.).



Before a large scale plasmid preparation can be performed, the

plasmid must first be transformed into competent E. coli cells. Competent

cells were prepared using the following procedure (E. Anderson, pers.

comm.). An microfuge tube containing 1.5 ml of 2xYT medium (16 g/l

bactotryptone, 10 g/l yeast extract, 5 g/l NaCI) was inoculated with E.

coli strain HB101 and incubated overnight on a shaker at 225 RPM at 370C.

To 50 ml of 2xYT in a 125 ml Erlenmeyer flask was added 125 Al of the

bacterial culture. The bacterial culture was then incubated at 370C at on

a shaker at 225 RPM. After 2 hours 10 ml of this bacterial culture was

removed and placed in a prechilled Falcon 2056 tube and left on ice for 15

minutes. The sample was then centrifuged for 10 minutes at 5000 RPM in a

J-20 rotor. The supernatant was decanted off and the pellet resuspended

in 5 ml of 50 mM CaCl2 (sterile), vortexed, and incubated on ice for 15

minutes. The sample was again centrifuged at 5000 RPM for 10 minutes in

a J-20 rotor and the supernatant decanted off. The pellet was then

resuspended in 500 Al of 50 mM CaCl2 by gently tapping the sides of the

tube and placed back on ice for at least two hours. The cells were then

ready to be used or could be stored at -800C (with 50% glycerol added)

until needed for transformation with the plasmid.

To a prechilled Falcon 2056 tube was added 200 Al of competent cells

along with 1-2 il of plasmid. The cells and plasmid were gently mixed by

tapping the sides of the tube and the sample left on ice for 30 minutes.

The sample was then heat shocked for 2 minutes at 420C and immediately










38

placed back on ice for 5 minutes. To this sample was then added 1 ml of

2xYT and the sample gently mixed by tapping the sides of the tube, and the

samples incubated for 1 hour at 370C shaking at 225 RPM. After one hour

100 Al of sample was plated onto LB solid media (10 g/l bactotryptone, 5

g/l yeast extract, 10 g/l NaCl, 15 g.l agar) containing the appropriate

antibiotic, and incubated at 370C inverted in a 370C incubator.

The surviving colonies were selected for further use by transferring

cells from the colony with a sterile toothpick which was then swirled in

an microfuge tube containing 1 ml of 2XYT supplemented with 100 Ag/ml of

either spectinomycin or ampicillin (depending on the plasmid). These

cells were then grown overnight and tested for presence of the plasmid by

doing a plasmid miniprep, and then stored at -20 for future use.



Ouick Miniprep Plasmid Purification. (from E.J. Anderson, pers. comm.)



Plasmid DNA was extracted from bacterial increases of several of the

colonies and compared to the DNA from the known plasmid stock by

restriction analysis using agarose gel electrophoresis in the following

manner.

Single colonies were selected from the plated cultures using a

sterile toothpick to transfer cells from the individual colonies to an

microfuge tube containing 1.5 ml of 2xYT media and the appropriate

antibiotic, and grown overnight at 37 C, shaken at 225 RPM. The samples

were pelleted by centifuging in a microfuge for 2 minutes. The

supernatant was discarded and the tube shaken vigorously to remove as much

of the media as possible, and set upside down on a kimwipe to dry briefly.










39

The cells were then resuspended by gentle vortexing after adding 250 Y1 of

SucTET (8.8 g Sucrose, 1 ml of 1M Tris-HCl pH 8.0, 10 ml of 0.5 M EDTA,

500 Al Triton X100, volume adjusted to 100 ml) plus 15 y1 of lysozyme

(from 10 mg/ml stock), and placed on ice for 10 minutes. The cells were

then boiled for 50 seconds and placed on ice for another 10 minutes. The

cellular debris was pelleted by centrifuging for 10 minutes in a

microfuge. The debris was then removed using a sterile toothpick. To the

remaining liquid was added 65 Al of 7.5M ammonium acetate, and the samples

incubated for 10 minutes on ice. The samples were centrifuged for 5

minutes and the supernatant transferred to a fresh tube. To each sample

was added 200 ,I of isopropanol, the sample mixed by inversion, kept on

ice for 20 minutes, and then centrifuged for 10 minutes. The supernatant

was poured off, the pellet gently washed with 70% ethanol, and dryed under

vacuum. The pellet of plasmid DNA was then reuspended in 50 A1 of TE

buffer.

A restriction digest was then performed to test for the presence of

the coat protein gene. First, 5 A1 of the isolated plasmid (plus a

control of the original plasmid) was removed and placed in an microfuge

tube. To this was added 5 A1 of 1OX of the restriction enzyme buffer H

(Promega), 1.0 Al of EcoRI (Promega), and 39A1 of distilled water, and the

restriction digest allowed to proceed by incubating for at least 60

minutes at 370C. The plasmid was then ethanol precipitated by adding 5 gi

3 M sodium acetate and 200 g1 of 95% ethanol (cold) and centrifuging for

15 minutes. The supernatant was discarded and the pellet washed by

carefully adding 250 Al of 70% ethanol (cold) and centrifuging for another

5 minutes. The supernatant was then discarded and the pellet dried under











40

vacuum. The pellet was then resuspended in 44 Al of sterile ddH2o and 5

gi of restriction enzyme buffer D (Promega) and 1.0 Al of BglII was added.

The samples were placed at 370C for 1 hour and ethanol precipitated as

before. The dried sample was then resuspended in 10 Al of TE buffer.

Meanwhile, an agarose gel (1% agarose in TBE (see Appendix B)) was

prepared. Ten minutes before loading the gel 0.5 ml of RNase (10mg/ml)

was added to each tube. Indicator dye (3 Al of 6X loading buffer) was

added and the gel was loaded. The gel was run for 1 to 2 hours at 100

Volts. The gel was then removed and stained with 10 Al of ethidium

bromide (10 mg/ml) in 100 ml of distilled water with gentle shaking for 30

minutes or longer. The gel was de-stained in distilled water (approx. 100

ml) for at least 5 to 10 minutes, then observed and photographed on a UV

light box. Samples which contained the band corresponding to the band for

the coat protein gene (as observed in the control) were saved to use for

the large scale isolations.



Large Scale Isolation and Preparation of Plasmid (Sambrook et al., 1989)

The day before plasmid isolation, four 1-liter flasks containing 500

ml of Luria Broth plus the appropriate antibiotic were inoculated with the

transformed E. coli and the cells were incubated overnight at 370C on a

shaker at 225 rpm.

The next morning the bacterial cultures were dispensed into 500 ml

centrifuge bottles and centrifuged at 5000 rpm in a JA-10 rotor. The

supernatant was discarded and the bacterial pellet resuspended in 20 ml of

solution I (50 mM glucose, 25 mM Tris-HCl pH 8.0, 10 mM EDTA pH 8.0, with

5 mg/ml lysozyme added just before use). The solution was allowed to











41

stand at room temperature for 5 minutes and then 40 ml of freshly prepared

Solution II (0.2 M NaOH, 1% SDS) was added. The solution was then gently

mixed by inverting the bottles gently several times and allowed to set at

room temperature for 10 minutes.

The contents of each bottle were then split between two 50 ml

centrifuge tubes. To each tube was added 10 ml of ice-cold Solution III

(60% 5 M potassium acetate, 11.5% glacial acetic acid, 28.5% distilled

H20). The tubes were covered with a cap, mixed by shaking the tubes

several times, and placed on ice for 10 minutes. At this time a

flocculent white precipitate formed. The samples were then centrifuged at

10,000 rpm (JA-20 rotor) for 10 minutes at 4C and the rotor allowed to

stop without braking.

The supernatant from all eight tubes was filtered through four

layers of cheesecloth and into a 500 ml centrifuge bottle. The solution

was then equally divided between two 500 ml centrifuge bottles. To each

bottle, 100 ml of isopropanol was added and the bottles were placed at

room temperature for 30 minutes or longer.

The nucleic acids were recovered by centrifuging at 5000 rpm (JA-10

rotor) for 30 minutes at 40C. The supernatant was decanted off carefully

and discarded. The pellet was washed with 200 ml of cold 70% ethanol and

centrifuged again for 10 minutes at 5000 rpm at 40C. The alcohol was

poured off carefully and the pellet allowed to air dry. After air drying

the pellet was resuspended in 10 ml of TE buffer (see Appendix B) and

allowed to set at room temperature for at least an hour to allow for as

much of the plasmid as possible to go into solution. The solution was

transferred to a 50 ml centrifuge tube and 5 ml of chloroform-isoamyl










42

alcohol (24:1) and 5 ml of tris-equilibrated phenol (Sambrook et al. 1992)

was added. After thoroughly mixing, the solution was centrifuged at 5000

rpm (JA-20 rotor) for 10 minutes to separate the phases. The aqueous

(upper) phase containing the plasmid was removed and placed in another 50

ml centrifuge tube. The plasmid was ethanol precipitated by adding 3.5 ml

of sodium acetate and 35 ml of ethanol and placed in the refrigerator at

40C overnight, followed by centrifuging for 30 minutes at 10,000 rpm (JA-

20 rotor) at 40C.

Immediately after centrifuging the supernatant was decanted, 10 ml

of cold 70% ethanol added, and the tubes were recentrifuged for 10 minutes

at 10,000 rpm at 40C. The supernatant was immediately decanted and the

pellet dried under vacuum. The pellet was then resuspended in 10 ml of TE

buffer. To determine the concentration of plasmid DNA, an absorbance

reading at an O.D.260 was obtained. An absorbance reading of 1.0

corresponds to 50 Ag of plasmid DNA per ml. The plasmid was ethanol

precipitated as before and resuspended at 1 jig/gl in BH3 (See Appendix A).



Establishment and Maintainance of Suspension Cultures

The Citrus suspension cultures used for protoplast isolation were

obtained from ovule-derived callus of 'Nova' tangelo ('Clementine'

mandarin (Citrus reticulata Blanco) X 'Orlando' tangelo (C. reticulata X

C. paradisi Macf)) or 'Rohde Red Valencia' sweet orange (C. sinensis

L(Osbeck)). The suspensions were maintained in 40-50 ml of liquid 1/2-1/2

medium (see Appendix A) in 125 ml erlenmeyer flasks covered with aluminum

foil and sealed with masking tape. Cultures were maintained on a shaker

at 140 rpm with no supplemental lighting. These suspensions were










43

subcultured every two weeks by splitting the contents between two sterile

flasks and adding a half volume (25 ml) of fresh culture medium to each

flask. The cells were used for protoplast isolation 5-14 days after

subculture.



Isolation and Transformation of Citrus Protoplasts

Isolation of protoplasts from suspension cultures was performed as

follows (Grosser and Gmitter, 1990, as modified by Schell (1991)). First,

one ml of suspension culture was placed in a 10 mm X 60 mm petri plate

(usually 2 to 3 plates for each suspension used). Three ml of 0.7 M BH3

was added followed by 1 ml of enzyme solution (see Appendix A). Plates

were wrapped with Nesco film and placed on a shaker at 50 rpm inside an

incubator at 280C overnight (16 hours).

Protoplasts were collected by passing the above mixture through a

sterile 0.45 micron stainless steel screen (which had been adhered to the

top section of a 30 cc disposable syringe) and into a 50 ml collection

tube. This mixture was then transferred into a sterile 15 ml glass

conical centrifuge tube with a screw cap. The cells were then pelleted by

centrifuging for 5 minutes at 500 rpm (75 x g).

The supernatant was removed using a sterile pasteur pipet and the

pellet was resuspended in 4 pipets (approx. 6-7 ml) of CPW25SUC (see

Appendix A). Then the solution was overlayed with 5 pipets (approx 7-8

ml) of CPW13MAN (See Appendix A). The CPW13MAN was added slowly, and the

tube was slanted so that the two solutions were not mixed. At this point

there were two distinct layers visible- a lower layer containing the













protoplasts and debris, and an upper clear layer. They were then

centrifuged for 10 minutes at 500 rpm (75 x g).

After centrifugation a distinct band was visible at the interphase

of the two solutions, a pellet at the bottom of the tube, and a cloudy

appearance between the two. The band at the interphase layer contained

the viable protoplasts, and the other two layers contained the non-viable

protoplasts and debris. The top layer of CPW13MAN which remained clear

and did not contain any cellular debris or protoplasts was carefully

removed without disturbing the band (removing the top layer of CPW13MAN

prior to removal of the band minimizes the amount of debris removed with

the band) and placed in a second sterile tube. The band was then

carefully removed from the top, being careful to avoid taking any of the

cloudy layer of debris and transferred to the tube containing the CPW13MAN

and gently resuspended (Frearson et al., 1973; Schell, 1991). The

protoplasts were pelleted by centrufuging for 5 minutes at 500 rpm (75 x

g) and the supernatant removed. The cells were then resuspended to a

volume of approximately 10 times the volume of the pellet with 0.7 M BH3.

This corresponds to a density of approximately 1 X 106 protoplasts/ml and

can be confirmed by counting using a haemocytometer.

At this point the protoplasts were ready to be used for the

transformation experiments. First, 10-40 plates (10mm X 60mm) were laid

out and 3 drops of the protoplasts mixture was placed in the center of

each plate. Of these plates, 3-4 were used as control and are treated the

same as the other plates except no plasmid or other DNA was added. To the

other plates, 10-20 kil (10-20 jig) of plasmid DNA was added to the

protoplast drop. To this was added 4 drops of PEG solution (see Appendix













A), and the cells were allowed to stand for 10 minutes. To this mixture

was then added 4 drops of a 9:1 v:v solution of Solution A:Solution B (see

Appendix A) around the edge, and the cells incubated for another 20

minutes. Finally 15 drops of BH3 were added and the cells then incubated

another 10 minutes.

The liquid was then pipetted off very carefully, another 15 drops of

BH3 added, the cells allowed to stand another 5 minutes and the liquid

again removed carefully. This was repeated twice more to ensure that the

cells were adequately washed and the PEG removed. The cells were then

suspended in 1 ml of a 1:1 mixture of 0.6 M BH3 and 0.6 M EME (see

Appendix) and swirled to spread the medium thinly across the whole plate.

The plates were then wrapped with a double layer of Nesco film, placed in

a cardboard box, and incubated in the dark at 280C.




Culturing and Regeneration of Treated Protoplasts




Regeneration of plants from treated protoplasts requires close

observation as the cells grow. Not doing this may result in the cells

growing too fast and losing their embryogenic capacity. If this happens

it is virtually impossible to recover any plants, as rapid cell growth

inhibits somatic embryo induction. The procedure for culturing and

regenerating the treated protoplasts was as described in Schell (1991).













Testing for Transformed Plants



Polymerase Chain Reaction for Detection of Transformants

The polymerase chain reaction (PCR) was used to initially screen the

regenerated 'Nova' tangelo and 'Rohde Red Valencia' sweet orange plants.

Since the procedure used was directly related to the results obtained, the

discussion of the procedures, primers used, PCR profile and other elements

of the PCR procedure will be discussed in the Results and Discussion

section.



Testing for Transformed 'Rohde Red Valencia' Sweet Orange Using Dot Blot
Analysis



Isolation of DNA from Citrus Leaves for Dot Blot Analysis (Dellaporta et
al., 1983, as modified by R. Durham, pers. comm.; Sambrook et al., 1989;
Manning, 1991)


Approximately 0.75 to 1.00 g of young leaf tissue was ground in

liquid nitrogen using a mortar and pestle. The powder was then

transferred to a 50 ml Oak Ridge centrifuge tube and placed on ice. After

the nitrogen had evaporated, 15 ml of ice cold DNA extraction buffer (100

mM Tris-HCl pH 8.0, 50 mM Na2EDTA pH 8.0, 500 mM NaCI, 10mM Beta-

mercaptoethanol) and 2 ml of 10% SDS were added. The tube was capped and

shaken vigorously, then placed in a water bath at 650C for 10 minutes.

The tubes were then removed from the water bath and 5 ml of 3 M

potassium acetate solution (60 ml/100 ml 5 M potassium acetate, ll.5ml/100

ml glacial acetic acid, 28.5 ml/100 ml H20) were added. The tubes were

again capped, shaken vigorously, and incubated on ice for 20 minutes. The











47

samples were then centrifuged at 25,000 X g for 30 minutes. The

supernatant was filtered through a miracloth filter and into a clean 50 ml

Oak Ridge tube. To this was added 10 ml of isopropanol and the samples

allowed to sit at room temperature for 30 minutes or longer. At this

point a gelatinous polysaccharide material precipitated with the DNA.

This polysaccharide material did not appear to inhibit enzyme digestion

but made the final DNA solution very viscous. This could be partially

overcome by heating the DNA to 65C prior to pipetting the samples for

digestion.

The DNA was pelleted by centrifugation at 20,000 X g for 30 minutes.

The supernatant was poured off and the pellet lightly dried by inverting

the tubes on a paper towel for 10 to 15 minutes. The DNA was then

resuspended in 0.7 ml of Buffer B (50 mM Tris-HCl pH 8.0, 10 mM Na2EDTA pH

8.0) and transferred to a 1.5 ml microfuge tube, then centrifuged for 10

minutes in a microfuge to remove any debris. The supernatant was then

transferred to another 1.5 ml microfuge tube.

To the DNA solution was then added 0.7 ml of Tris-equilibrated

phenol, and the solutions mixed by inverting the tube several times. The

samples were then microfuged for two minutes followed by extracting the

aqueous upper phase and transferring it to a clean microfuge tube. This

was repeated using 0.7 ml of chloroform/iso-amyl alcohol (24:1).

The resulting DNA extract contains a large amount of polysaccharides

which can be a problem when resuspending the DNA after ethanol

precipitation in a small quantity of TE buffer or water. The extract can

be very viscous and difficult to pipet unless diluted. To remove the

polysaccharides so as to sufficiently concentrate the DNA for further uses











48

a differential precipitation with 2-butoxyethanol (ethylene glycol

monobutyl ether) was performed (Manning, 1991). The solution obtained

after phenol/chloroform extraction was supplemented with 100 il of a 1.0

M acetate solution (pH 6.5) and 0.4 volumes (250 Al) of 2-Butoxyethanol.

The samples were vortexed and placed on ice for 30 minutes (The

polysaccharides are visible as a whitish cloud). The samples were then

centrifuged in a microfuge for 30 minutes. The supernatant was then

removed and transferred to a fresh tube (the polysaccharides remain as a

pellet in the bottom of the tube). The volume was then brought up to one

volume of 2-butoxyethanol by the addition of another 400 jil 2-

butoxyethanol, vortexed and again placed on ice for 30 minutes. The

samples were again microfuged for 30 minutes, then the supernatant was

decanted off. The resulting DNA pellet was then washed by the addition of

500 Al of 95% ethanol. The samples were allowed to stand at -200C for at

least 30 minutes. At this point the DNA pellet becomes visible as a white

pellet in the bottom of the tube. The samples were then centrifuged for

10 minutes and the supernatant decanted off. A final wash with the

addition of 500 Al of 70% ethanol followed by microfuging for 5 minutes

was then performed. The supernatant was decanted off, the tubes inverted

on a kimwipe to remove excess alcohol, and then vacuum dried in a

dessicator. The pellet was then suspended in 50 pI of TE buffer and

quantified by spectrophometry. An O.D. at 260nm of 1.0 is equivalent to

50 Ag/ml of DNA. The quality of the DNA was checked by determining the

O.D. 260 to O.D. 280 ratio. DNA should have a ratio of 1.8, RNA a ration

of 2.0 (Sambrook et al., 1989). Alternatively the DNA was quantified by

agarose gel electrophoresis using lambda DNA of known quantities and










49

visually estimating DNA content in the samples. The DNA was then placed

in the -800C freezer until needed and thawed on ice prior to use.



Preliminary Screening Using DNA Dot Blots (from instructions supplied with
the Amersham Hybond N+ nylon membrane)

Five Mi of the sample from the DNA extraction just described was

removed, placed in a 1.5 ml microfuge tube, and placed on ice. The

samples were boiled for 10 minutes and quick chilled on ice to denature

the DNA. To each tube was added 5 il of 20X SSC (see Appendix B), the

samples spun briefly in the microfuge to collect all liquid at the bottom,

and placed back on ice. A nylon membrane was wet thoroughly in water,

then soaked in 6 X SSC and allowed to dry. The entire contents of each

sample were then spotted on the membranes 2.5 gl at a time. The DNA was

then cross linked using a DNA cross linker (1200 joules). The membrane

was then used for hybridization using radioactive probes as described

later.



Confirmation of Transformation



Isolation of DNA for Southern Blot Hybridization (Duran-Vila et al.,1986;
Marais et al., 1995)

Prior to isolation of nucleic acids, all labware was sterilized by

autoclaving for one hour at 15 psi and dried in the drying oven. All

buffers and solutions were sterilized by autoclaving. Gloves were used to

handle all glassware during isolation.

For each sample, 5 g of tissue were ground in liquid nitrogen and

transferred to a labeled 100 ml beaker containing 10 mls of extraction













buffer (0.4 M Tris-HCl (pH 8.9), 1 % SDS, 0.005 M EDTA (pH 8.0)) and 10

mls of phenol-Chloroform-isoamyl alcohol (12:12:1) and stirred on a stir

plate. After all samples were ground they were stirred for an additional

20 minutes, transferred to a 50 ml centrifuge tube, capped and centrifuged

at 12,000 RPM for 20 minutes in a JA-20 rotor. The top layer of liquid

was removed and placed in another 50 ml centrifuge tube and 3 mls of 3 M

sodium acetate (pH 5.5) and 30 mls of cold 95% ethanol added. Samples

were incubated for 30 minutes at -80'C and then centrifuged as before.

The supernatant was decanted and the tube containing the pellet air dried

inverted on several layers of paper towels. The pellet was resuspended in

3 mls of TKM buffer (0.01 M Tris-HCl (pH 7.4), 0.01 M KCl, 0.0001 M MgCl2).

The samples were then placed in dialysis tubing (6000-8000 MWCO) which had

been boiled in 1 %SDS, 10mM EDTA (pH 8.0) and dialyzed overnight in 1 L of

TKM buffer on a magnetic stirrer with gentle stirring at 40C. The samples

were then removed from the dialysis tubing using a pasteur pipet,

transferred to 50 ml centrifuge tubes and 3 mls of 4 M LiCL added.

Samples were gently mixed and incubated for 4 hours to overnight at 40C.

Samples were then centrifuged for 20 minutes at 12,000 RPM in a JA-20

rotor. The supernatant which contains the DNA was transferred to another

50 ml centrifuge tube and 18 mls of cold 95% ethanol added. Samples were

placed at -800C for 30 minutes and centrifuged as before. The supernatant

was discarded, the pellet air dried and resuspended in 100 Al of sterile

ddH20. The pellet from the LiCl precipitation, which contains ssRNA, was

dried and resuspended in 100 Al of sterile double distilled H20 (ddH20).

The samples (2 Al of each, with 8 Al H20 and 3 pi of loading buffer (40%

sucrose, 0.25% bromphenol blue) were then ran on a 1% agarose gel in TBE










51

(see Appendix B) at 100V for 1 hour to quantify the DNA (against Lambda

DNA of known concentrations), and to confirm that the desired nucleic

acids were in the proper fraction.



Southern Transfer of DNA Isolated from Transformed Plants (Sambrook et
al., 1989; R.F. Lee, pers. comm.).


Southern analysis is routinely used to prove that the target DNA has

been incorporated into the plant genome. The following procedures were

used to test plants which were positive in the preliminary testing by dot

blot or PCR assay.




Transfer under neutral conditions.

DNA was isolated from plants to be tested by the methods described

previously. At least one non-transformed (never exposed to the plasmid or

virus) plant was used as a control in every analysis. A sample of each

DNA to be analyzed (around 10-20 pg as determined by quantification) was

removed and placed in a separate 0.5 ml microfuge tube. The DNA was then

restriction digested by adding 2 jil/i0 pi of 10 X OPA enzyme buffer

(supplied by Pharmacia with the restriction enzymes) and 10-15

units/sample of restriction enzyme(s) (BglII with or without EcoRl) and

incubated for 3 hours to overnight at 370C. The samples were run on a gel

containing 0.5 X TBE (see Appendix B) and 1% agarose in 0.5 X TBE buffer.

The gel was then stained with 10 Al of ethidium bromide solution (10

mg/ml) in approximately 100 ml of distilled H20 for a minimum of 30

minutes, and then destained for 10 minutes in distilled H20. The gel was











52

then observed on the UV light box, photographed (if desired), and the

unused portions of the gel trimmed away.

The DNA was nicked by depurination in several volumes of 0.2 N HCl

for 10 minutes, followed by a brief rinse in distilled H20. The gel was

denatured by soaking the gel in several volumes of denaturation solution

(1.5 M NaCl, 0.5 M NaOH) for 45 minutes with constant gentle agitation on

a shaker. The gel was then rinsed for a few minutes in distilled H20. The

gel was neutralized by soaking under gentle agitation in several volumes

of neutralizing solution (1 M Tris pH 8.0, 1.5 M NaCI) for 15 minutes. The

neutralizing solution was then discarded and replaced with fresh

denaturing solution and allowed to soak under gentle agitation for another

15 minutes. This was repeated twice more.

While the gel was in the neutralizing solution a piece of Whatman

3MM paper was wrapped around a piece of plexiglass or a stack of glass

plates to form a support that was longer and wider than the gel. This was

placed in a large baking dish. The dish was then filled to just below the

rim of the top support with 10 X SSC (see Appendix B) After the paper

was thoroughly wetted, the air bubbles were smoothed out using a glass

rod. A piece of nylon membrane (Hybond N+) was cut to the size of the gel

and placed in a dish of distilled water until the membrane was wetted

completely. The membrane was then immersed in transfer buffer (10 X SSC)

for at least five minutes.

After neutralization was complete, the gel was removed, inverted so

that the gel was upside down and placed in the center of the wet filter

paper. All air bubbles were carefully removed. The wet nylon membrane

was than carefully placed on top of the gel and one corner cut to use as











53

a reference point. Once the membrane was placed on the gel it was not

moved. All air bubbles were again carefully removed so as not to

interfere with DNA transfer. Two pieces of 3MM paper were then cut to the

same size as the gel, wet with 2 X SSC, and placed on top of the nylon

membrane. The air bubbles were once again removed.

A stack of newspaper 3-5 cm high were cut just smaller than the 3MM

papers and placed on top of the 3MM papers. A glass plate was placed on

top of the stack and weighed down with a 500 g weight. The objective was

to set up a flow of liquid from the reservoir up through the gel and the

membrane and into the stack of newspaper. The DNA fragments should be

eluted from the gel and deposited onto the membrane. The transfer was

allowed to proceed overnight (8-24 hours).

After the transfer was completed, the newspaper and the 3MM papers

above the gel were removed. The gel, with the membrane still in place,

was turned over onto a dry sheet of 3MM paper and the positions of the gel

slots marked with a very soft lead pencil. The gel was then peeled away

and discarded. The membrane was soaked in 6 X SSC for 5-15 minutes with

gentle agitation to remove any pieces of agarose sticking to the membrane.

The membrane was removed and dried on a fresh piece of 3MM paper for 30-60

minutes. The DNA was then ready to be hybridized with a labeled probe.




Transfer under alkaline conditions,

The DNA extraction through electrophoresis and photographing of the

gel was performed in the same manner as for transfer under neutral

conditions. After electrophoresis the DNA in the gel was nicked by

placing the gel in 0.25 N HC1 for 15-20 minutes. The gel was then soaked











in 0.4 N NaOH for 30-45 minutes. At the same time the transfer system was

set up as for transfer using neutral conditions, but with the 1oX SSC

replaced by 0.4 N NaOH. The transfer was allowed to continue overnight.

The membrane was removed and the lanes marked with a red pen. The

membrane was soaked with gentle agitation in 5X SSC to neutralize, then

air dried for a few minutes. Many protocols call for baking the membrane

at 80'C for two hours or UV cross-linking to fix the DNA to the membrane,

but this is not necessary for positively charged membranes. The membrane

was then placed in a plastic bag and was ready for hybridization.



Preparation of Radioactive Probes by Random Primer for Southern Blot
Hybridization

The probe used for Southern blot hybridization was prepared using

PCR. The coat protein gene of T30 and T36 were amplified using primers

C104 (CCTACTCGAGATTAACGTGTGTTGAATTTCC, 3' neg. sense) and C118

(AACTGCAGCGGCCGCCGACGACGAAACAAAG,5' plus sense)(obtained from J.

Castillo). The PCR reaction was performed in capillary tubes using a

profile with an initial denaturation at 940C for 15 sec. followed by 30

cycles of denaturation at 940C for 5 sec., annealing at 500C for 10 sec.,

extension at 73C for 20 sec., followed by a final extension at 72C for

5 minutes. Samples were then ran on a 1 % agarose gel (using low melting

point agarose in 0.5 X TBE), and the band of the appropriate size (approx.

670 bp) was excised from the gel and placed in a 1.5 ml microfuge tube.

Five volumes of TE buffer were added and the samples incubated at 650C for

ten minutes or until the agarose was fully melted. If the volume was more

than 750 il, the samples were subdivided and then an equal volume of tris-










55

equilibrated phenol was added. Samples were vortexed, than centrifuged

for 3 minutes. The top layer containing the DNA was removed and placed in

another microfuge tube. To the sample was then added 0.5 volumes of Tris-

equilibrated phenol and 0.5 volumes of chloroform/iso-amyl alcohol (24:1)

and the samples vortexed and centrifuged for 3 minutes. The top layer was

again removed and transferred to a separate tube and an equal volume of

chlorform/iso-amyl alcohol (24:1) was added. Samples were vortexed and

centrifuged for 3 minutes and the top layer again removed and transferred

to a separate tube. The DNA was ethanol precipitated by the addition of

0.1 volumes on 3M sodium acetate and 3 volumes of 95 % ethanol followed by

centrifugation for 15 minutes. The supernatant was decanted and the DNA

pellet was then washed by the addition of one volume of 70% ethanol

followed by centrifugation for 5 minutes. The supernatant was again

decanted and the tube inverted on a Kim Wipe for a few minutes, then

placed in a vaccuum dessicator and the DNA dried under vacuum. The DNA

was then resuspended in sterile distilled water at an approximate

concentration of 25 ng/pl.

The probe was prepared by random primer labeling using the Prime-a

Gene Labeling System (Promega Corp.) as per the instructions provided.

For each labeling reaction 25 ng of probe DNA was denatured by boiling for

5 minutes and then quick chilling on ice. The DNA was usually placed in

nuclease free water to bring the final volume of the reaction up to 50 P1

prior to boiling. After denaturation, 10 Al of 5 X buffer, 2 Al of the

unlabeled dNTP mix (dATP, dCTP, dGTP), 2A1 nuclease free BSA, 5P1 [a-32p]

dCTP (50 ACI, 3000Ci/mmol), and 1 pl (5 units) DNA Polymerase (Large

(Klenow) fragment) were added. The reaction was allowed to proceed for 3










56

or more hours and the reaction stopped by the addition 2.5 Al of 0.5 M

EDTA (pH 8.0), followed by boiling for two minutes and quick chilling

prior to use.



Hybridization of DNA With a Labelled Probe. (Sambrook et al., 1989; T.
Kamps, pers.comm.)


The nylon membrane prepared previously for either the dot blot

analysis or Southern blot hybridization, was placed in a plastic bag and

prehybridization solution was added. The prehybridization solution

consisted of 6 X SSC, 5 X Denhardts reagent, 0.5 % SDS, and 100 Ag/ml

salmon testes DNA (boiled 10 minutes and quick chilled). The bag was

carefully sealed and placed inside a ziploc bag and incubated for 1-2

hours to overnight (16 hours) in a water bath at 680C. the probe prepared

by Random Priming was added at 5 X l05 to 2 X 106 CPM after boiling for 3

minutes and quick chilling on ice. The bag was resealed, placed in a

ziploc bag, and incubated overnight (16-24 hours) in a water bath at 650C.

The next morning the hybridization solution was disposed of in the

radioactive waste and the membrane was rinsed twice in wash solution (100

ml/l 20 X SSC, 10 ml/l 10% SDS, 200 ml/l of 0.1 M NaPO4, pH 7.2) for 15

minutes each at 65'C with occasional gentle agitation. The membrane was

placed in a plastic bag and approximately 50 mls of stringency buffer (5

ml/l 20 X SSC, 10 ml/l 10% SDS, 20 ml/l of Na P04 pH 7.2) was added, the

bag sealed and incubated in the water bath for 15 minutes at 650C. The

solution was discarded and fresh stringency buffer added and the membrane

was incubated in the water bath at 65C for another 15 minutes.










57

The membrane was dried on a piece of 3MM paper for a few minutes,

then placed on a fresh piece of 3 MM paper. The corners of the membrane

were taped down and then wrapped in plastic wrap. The membrane was placed

face down on a piece of X-Ray film in a film cassette with an intensifier

screen. The cassette was sealed, wrapped in aluminum foil, and placed in

the -800C freezer for 1 to 7 days (depending on the half-life status of

the isotope and the quality of the random priming). The film was

developed according to the directions provided with the developer.






Southern Blot Hybridization Using the GENIUS Non-radioactive
Labeling System (Boehringer-Mannheim)





Prior to hybridization, the labeled DNA to be used as a probe needed

to be prepared. The plasmid DNA which was to be used for the probe was

first denatured by boiling for 10 minutes followed by quick chilling in

ice/alcohol. An aliquot of 1 Ag of freshly denatured DNA was removed and

placed in a microfuge tube on ice and to this was added 2 pl of the

supplied hexanucleotide mixture, and 2 Al of the supplied dNTP labeling

mixture. The volume was then brought up to 19 Al with sterile distilled

H20, 1 Al of Klenow enzyme added and the mixture was incubated for 60

minutes or more at 37C. The reaction was stopped by adding 2 Al of EDTA

solution (0.2 M, pH 8.0).

The labeled DNA was then precipitated by adding 2 Al of LiCl (4M)

and 60 yi of cold 100% ethanol. The DNA was left for at least 30 minutes

at -70 C, or at least 2 hours at -20 C, and then centrifuged at 12,000 X










58

g for 10 minutes. The supernatant was then poured off and the pellet

washed with cold 70% ethanol and recentrifuged at 12,000 X g for 10

minutes. The alcohol was then poured off and the pellet dried under

vacuum. Finally, the DNA was dissolved in 50 il of TE buffer and stored

at -20'C until needed.

Approximately one hour before starting the hybridization, the

hybridization solution was prepared (the blocking reagent does not

dissolve very rapidly, thus the need to prepare in advance). The

hybridization solution consisted of 5X SSC (see Appendix B), 0.5% blocking

reagent (supplied), 0.1% N-laurylsarcosine (Na-salt), and 0.02% SDS. It

was heated in a 70'C water bath in order to facilitate the blocking

reagent going into solution.

The membranes which had been previously prepared (by Southern

transfer or dot blotting) were wet briefly with 5X SSC and then placed in

a plastic sealable bag. Hybridization solution (20 ml) was added, the bag

sealed, and prehybridization carried out at 68C for 4 hours. The

solution was replaced with 25 ml of hybridization solution and 50 Al of

labeled DNA. The membranes were incubated overnight (18 hours) at 680C.

The membranes were washed twice, 5 minutes each, with at least 100 ml of

wash buffer (2X SSC, 0.1% SDS), followed by two washes of 15 minutes each

at 68C in stringency buffer (0.1X SSC, 0.1% SDS). The membranes were air

dried and stored protected until used for the immunological detection

using the labeled DNA probe.

The membranes were first washed for 1 minute in buffer 1 (Tris-HCl,

100 mM, NaCl, 150 mM, pH 7.5). Buffer 1 was poured off and 100 ml of

buffer 2 (0.5% blocking reagent in Buffer 1) was added and the membranes













incubated for 30 minutes. The membranes were again washed for 1 minute

with buffer 1 and placed in a plastic sealable bag. Antibody-conjugate to

the labeled probe was diluted to 150 mU/ml (1:5000) in buffer 1, and added

to the membranes and incubated another 30 minutes. Unbound antibody-

conjugate was removed by washing twice (15 minutes each) with buffer 1.

The membranes were equilibrated for 2 minutes in 20 ml of Buffer 3 (Tris-

HCI, 100 mM, NaCl, 100 mM, MgCl2, 50 mM, pH 9.5) Freshly prepared color

solution (45 p1i NBT solution, 35 Al x-phosphate solution in 10 ml of

buffer 3) was added and the color precipitate allowed to form overnight in

the dark. The reaction was stopped by washing the membranes overnight in

TE buffer. The membranes were stored in TE Buffer until they were needed.

Alternatively, the membranes could be stored dry, however the color may

fade. The color could be enhanced by placing the dry membrane back in TE

buffer.



Western Immunoblot analysis for Detection of the Coat Protein



Leaves were collected and kept in the cold room or in the -20'C

freezer until needed. The leaves were then ground in liquid nitrogen and

the powder transferred to a 1.5 ml microfuge tube. Immediately, 1 ml of

1X treatment buffer (60 mM Tris, 2% SDS, and 1% 2-mercaptoethanol) was

added and the sample vortexed. This was repeated until all samples were

prepared. The samples were allowed to set for 15-30 minutes, then

centrifuged in the microfuge at 10,000 RPM for 10 minutes to pellet the

debris. The supernatant was removed and placed in another sterile 1.5 ml

microfuge tube. A 100 Al aliquot of the sample was removed and placed in










60

1.5 ml microfuge tube and frozen until used. The rest of the sample was

concentrated using an RC10 concentrator/evaporator (Jouan, Inc) to

approximately 1/5 the original volume. The heat setting of around 3.5 was

used in order to keep the samples from freezing. Concentration usually

was finished in around 2 hours. The volume of the samples was then

brought to approximately one fifth the original volume by the addition of

additional ix treatment buffer (all samples were not concentrated equally

so the volumes need to be made equal for all the samples) and the samples

placed at -200C until needed.

The proteins were separated on a 14% polyacrylamide gel on a BioRad

minigel apparatus. The gel was prepared by adding 4 ml/gel of running gel

stock (see Appendix B), 53 Al/gel of 10% TEMED, and 13 p1/gel of 10%

ammonium persulfate. The gel was then loaded to a depth of 5 cm using a

transfer pipet. This layer was then overlayed with Stacking gel

containing 2 ml/gel stacking gel stock (see Appendix B), 40 pi/gel TEMED,

and 10 pl/gel of 10% ammonium persulfate. A gel comb was then place in

the gel and the gel allowed to polymerize for at least one hour.

While the gel was polymerizing, the protein samples were aliquoted

into an microfuge tube and boiled for 10 minutes. After the gel was

polymerized the samples (30 Al) were loaded on the gel and the gel was run

at 40mA/gel for 105 minutes in SDS tank buffer (ig/l SDS, 14.5 g/l

Glycine, 3g/l Tris).

After the gel was finished running, the gel was removed and placed

in protein transfer buffer (25 mL Tris-HCl pH 8.3, 192 mM Glycine, 20 %

Methanol) for 15-20 minutes. The buffer was then removed and two pieces

of Whatmann filter paper cut to the size of the gel was wet with protein













transfer buffer and placed on top of the gel. The gel and filter paper

were carefully removed from the tray and trimmed to size. A nylon

membrane (Immobilon P from Millipore Corp.) was wet briefly in methanol,

the methanol removed by placing the membrane in H20 until submerged, and

soaked briefly in protein transfer buffer. (Alternatively, a

nitrocellulose filter wet in transfer buffer can be used.) The membrane

was placed on top of the gel and an additional two pieces of Whatmann

filter paper wet with protein transfer buffer placed on the membrane, and

again trimmed to size. The whole sandwich was placed with the membrane

side down on a semidry electroblotter and the proteins transferred by

running at 0.4A/cm2 for 2 hours.

The membrane was removed and placed in 20 ml TTBS (0.5M Tris-HCl pH

7.5, 2M NaCl, 0.0005% Tween-20) containing either 3% bovine serum albumin

(BSA) or 1% gelatin as a blocking agent, and placed on a shaker at 75RPM

for at least 20 minutes. The desired primary antibody was added at a

1:10000 v:v dilution and placed back on a shaker for 30-45 minutes (or

overnight). The membrane was then washed with TTBS at least 3 times for

10 minutes on a shaker. Fresh TTBS (20 ml) with 1% gelatin or 3% BSA was

added along with the appropriate secondary antibody at a dilution of

1:10000 v:v and again placed on shaker for 4-6 hours (or overnight). The

membranes were again washed at least 3 times for 10 minutes on shaker with

TTBS. The membranes were developed by the addition of a thin layer

(approx. 20 ml ) of NBT-BCIP substrate solution (12 g/l Tris, 5.8 g/l

NaCl, 1 g/l MgCl2, 80 mg/l BCIP (disodium salt), 160 mg/l NBT, pH 9.5).

Modifications of this procedure were used and are described as appropriate

in the results and discussion.


















CHAPTER 4

RESULTS AND DISCUSSION




Plasmid Preparation



The coat protein genes for CTV isolates T30 and T36 were inserted

into the plasmids pMONI0098 and pBPFQ-7 by Dr. Niblett's laboratory and

supplied in E. coli strain DH5. These plasmids were designated

pMONI0098-T30, pMONI0098-T36, pBPFQ7-T30, and pBPF07-T36. (Figure 3-3

shows a map of these plasmids.) Testing for correct orientation and coat

protein expression were performed in Dr. Niblett's laboratory prior to

sending the plasmids. The bacterial cultures were replated and single

colonies selected to begin large scale plasmid preparation as described in

the materials and methods.



Transformation of Citrus Protoplasts and Plant Regeneration



The success or failure of isolation and transformation of Citrus

protoplasts and the ultimate regeneration of plants is

contingent on the quality of the starting material and quality of the

protoplasts after isolation (high yields of viable protoplasts with little

debris). Citrus suspension cultures










63

used were chosen because they were exhibiting good regeneration capacity

at the time. The best protoplasts were obtained from suspensions 5 to 12

days after subculture when isolated as described in the materials and

methods. Many isolation procedures do not use the sucrose/mannitol

gradient for purification. However using the gradient allows for the

removal of the non-viable protoplasts and cellular debris which could

interfere with the uptake of the plasmid by the viable protoplasts,

possibly increasing efficiency.

After the protoplasts had been collected from the gradient, they

were resuspended in 0.6 M BH3 at a density of approximately 1 X 106/ml as

determined by visual observation of the pellet. This would usually yield

a final protoplast density after the transformation experiments of 5 X l05.

Transformation experiments and plant regeneration were performed as

described in the materials and methods. For each transformation

experiment attempted, 20 to 30 plates were used. Cell wall regeneration

was observed within 24 to 48 hours, and cell divisions began after

approximately three days. Colonies (microcalli) begin to form in as

little as two to three weeks. It was found to be critical to not let the

colonies develop too fast prior to osmoticum reduction and the eventual

plating of the developing microcolonies onto solid EME medium (see

Appendix A). With extremely rapid colony development, microcalli tended

to lose their embryogenic capacity, thereby inhibiting embryo and plant

recovery.

Generally, the colonies were ready to be transferred to solid EME in

4 to 8 weeks. Shortly thereafter embryos began to form. These embryos

were removed and transferred to another fresh plate containing EME, and










64

allowed to proliferate. Embryos were then transferred to 1500 medium (see

Appendix A) for further growth, and finally to B+ medium (see Appendix A)

for germination. After the formation of plantlets, the plantlets were

removed and placed on rooting medium (see Appendix A) until roots formed

and then subsequently transferred to soil.

The time from initial protoplast isolation to plant establishment in

soil was quite variable. Several factors influence this chain of events.

Delays in the osmoticum reduction process and in transferring slowed down

the growth. In some cases the developing embryos could be transferred

directly from EME to B+ medium, skipping the transfer to 1500 medium. At

other times they may need an additional pass on EME, 1500, or B+ media.

However, if all went smoothly plantlets were established in soil in as

little as 5 to 6 months.

Over 40 transformation experiments were attempted over the duration of

this project. These experiments were done with a variety of scion

cultures using all four of the plasmids. The reasons for the lack of

plants regenerated from many of the experiments can generally be traced to

problems related to the culturing of the protoplasts, or to the condition

of the suspension cultures used for protoplast isolation. If large

numbers of microcalli are produced (i.e. high plating efficiency) there is

a tendency for callus to be formed at the expense of the production of

embryos. If embryos do form there is often an overgrowth of these embryos

by the callus and the result is no further development of the embryos.

This is the biggest factor contributing to the lack of plant regeneration

in many of the transformation experiments. Other reasons for the failure

of plant regeneration include contamination of the media, the condition of










65

the protoplasts after isolation and transformation, and other undetermined

factors. For a detailed description and photograph of the developmental

sequence for protoplasts see Schell (1991).

As a result of these transformation experiments numerous regenerated

plants were obtained. Using the plasmid pMONI0098-T30, 59 'Nova' tangelo

plants were obtained. Using the plasmid pMONI0098-T36, 12 'Valencia'

sweet orange plants were obtained. Using the plasmid pBPF07-T36, 500

'Rohde Red Valencia' sweet orange plants were obtained. Several other

attempts were made to transform these and other scion varieties, with the

four plasmids but were unsuccessful due to difficulties in isolation,

culture, and regeneration. These difficulties are the limiting factors in

transformation by direct DNA uptake.

The number of plants recovered per embryo was not tracked due to the

amount of time necessary to do this. As a result, there is a possibility

that some of the individual plants may have come from the same embryo.

Multiple shoots from a single embryo were observed in these experiments.



Screening for Transformants



Selection During the Early Stages of Protoplast Growth and Microcalli
Development

The stage at which selection is performed is dependent on the method

of transformation and the plasmid used. Using Agrobacterium as a vector

for transformation of plant tissues, selection is commonly done

immediately after co-cultivation utilizing the antibiotic resistance

marker contained in the plasmid. This has also been done with protoplasts










66

transformed by direct DNA uptake (Davey et al., 1989). However, there are

problems with immediate selection for transformed protoplasts using the

antibiotic resistance conferred by the plasmid. First, plating density

plays a major role in regeneration and survival of protoplasts. Kao and

Michayluk (1975) developed a medium (K8P) for low density plating of Vicia

hajastana protoplasts which has been commonly used in other systems. This

is the medium from which the BH3 medium used in this study was derived

(Grosser, 1994). However no studies have been performed to determine the

lowest concentration at which Citrus protoplasts can survive. Some labs

have attempted to circumvent this problem by delaying the placement of the

protoplasts on antibiotic-containing medium for a period of time

(Paskowski and Saul, 1988) Secondly, if selection is done at the

protoplast level the effect of the dead protoplasts has to be considered.

If transformation efficiency is as good as 1%, then 99% of the protoplasts

would die under selection. These dying protoplasts could release many

toxic compounds into the medium which would adversely effect the

development and survival of those that are antibiotic resistant (or

putative transformants). Therefore selection at the protoplast level was

not a practical idea for Citrus.

The second most likely stage for selection is after the formation of

microcalli or calli. Experiments were conducted to test whether or not

the microcalli could survive on medium containing the antibiotic

geneticin. Resistance to geneticin is controlled by the NPTII gene

contained in both plasmids. Microcalli from transformation experiments

using 'Rohde Red Valencia' sweet orange, 'Nova' tangelo and 'Valencia'

sweet orange were placed on EME media containing 0, 5, 10, 20 and 50 Ag/ml










67

of geneticin. All of the microcalli died on levels of 20 and 50 Ag/ml and

little or no death was noted in the lower two levels of 0 and 5 Ag/ml.

The reaction at 10 gg/ml was mixed with either the whole plate of

microcalli dying or the whole plate of microcalli surviving. No selection

seemed to occur at any antibiotic concentration. No embryos developed

from any of the surviving microcalli. It appeared that some sort of

interaction between the microcolonies may have been taking place which was

interfering with any selection processes that may have been occurring.

Repeated experiments yielded the same results. The fact that the

antibiotic was in the medium may also have been playing a role. To test

this, experiments were also conducted placing the geneticin at levels of

0, 2.5, 5 and 10 Ag/ml in liquid EME, which was layered over the solid EME

at the rate of 1 ml/ plate (60mm X 10mm). Microcalli were placed in this

liquid EME. Death occurred at 10 Ag/ml, some of the plates showed no

effect at 5 pg/ml while others showed total death of the microcalli.

There seemed to be variable survival in some of the plates at 2.5 jg/ml,

ranging from death of the microcalli to total survival. However none of

the surviving microcalli were able to form embryos. (It should be noted

that these microcalli were from the same transformation experiments that

eventually gave rise to the transgenics reported herein) Because of the

wide variation in callus survival rates, and the lack of repeatability, it

was concluded that selection with geneticin at this stage was not the best

selection procedure.

It is quite common to use a scoreable marker such as the

histochemical GUS assay for the detection of the 1-glucuronidase product

of the uidA (GusA) gene (Jefferson et al., 1986; Jefferson, 1987;










68

Jefferson et al., 1987; Jefferson, 1989). This scoreable marker can be

used for selection by performing the assay on a sample of plant tissues

such as a leaf piece. However, the plasmids that were supplied did not

contain the uidA gene, thus selection by this method was not an option.

Selection using neomycin phosphotransferase (NPTII), was not performed as

the assays are tedious and relatively difficult, in addition to being

susceptible to various endogenous activities in the plant cells, which

limits the sensitivity (Reiss et al., 1984). Recently, easier and cheaper

ELISA procedures for NPTII selection have become available from many

commercial companies, but these were not available at the time these

experiments were performed.



Polymerase Chain Reaction for Selection of Transformants

Testing of 'Nova' tangelo and 'Valencia' sweet orange regenerants


The first plants regenerated were 59 'Nova' tangelo from experiments

using plasmid pMONI0098-T30, and 12 'Valencia' sweet orange from

experiments using plasmid pMONI0098-T36. Since the objective of this

study was the production of plants containing the coat protein gene, and

not in the development of an improved transformation procedure, data was

not taken to determine the percentage of protoplasts regenerated into

plants. It was determined that time was better spent in obtaining the

largest number of plants possible, rather then in the tedious chore of

cataloging the development of individual protoplasts and microcolonies.

These plants were tested by using a pooled polymerase chain reaction

(PCR) in which the samples were pooled together in groups of 5 (and one of










69

6) prior to DNA isolation. Isolation of DNA (see materials and methods)

is the most time consuming step in the PCR process and pooling the samples

in the initial screening process allows the test to be performed much

quicker. Also, the cost of all reagents can be greatly reduced. The

members of each positive pool could then be retested individually and

sorted out from the pool. The PCR reactions were carried out using a

Precision Scientific GTC1 Thermal Cycler. This is a water cooled (as

opposed to Peltier-effect cooled) machine. The PCR profile was an initial

2 minute denaturing at 940C, followed by 35 cycles of 1 minute

denaturation at 940C, 1 minute annealing at 550C, 1 minute extension at

72C, and then ending with a 10 minute final extension at 72'C. The

reaction was carried out in 1X Promega Taq Polymerase reaction buffer,

25kim MgCl2, 200 nmol of each primer and 1 unit of Taq polymerase per

sample. The T30 infected control also contained 0.001M DTT, 1 p1 RNasin,

and 1 unit AMV reverse transcriptase and was incubated at 42 C for 45

minutes prior to amplification. Final reaction volume was 50 Al, and the

samples were overlayed with 2 drops of sterile mineral oil. The primers

were JC-10 (5'-GAATTCGCGGCCGCTCAACGTGTGTTAAATTTCC) and JC-11 (5'-

AGATCTACCATGGACGACGAAACAAAG), specific to the coat protein gene of

isolates T36 and T30. The final PCR product was run on a 1% Agarose Gel

in TBE.

After performing the PCR on the pooled samples from the 59 'Nova'

tangelos and 12 'Valencia' sweet orange regenerants, one pool was

identified as containing at least one positive sample. DNA from the

individual plants represented in this pool (containing samples N29, N30,

N32, N33, and N34 where the N signifies a 'Nova' tangelo plant) was then










70

isolated and the PCR repeated as before. From this PCR, 3 plants (N32,

N33, N34) were identified as being PCR positive for the coat protein gene

(Figure 4-1). This result was repeatable. These plants were repotted and

placed in the greenhouse to allow for adequate leaf growth for Southern

analysis.



Testing of the 'Rohde Red Valencia' sweet orange regenerants

The 'Rohde Red Valencia' sweet orange plants were produced later

than the other two varieties described in the previous section. A new MJ

Research PTC-100 thermal cycler was purchased and used for testing these

plants. This machine is cooled by the Peltier effect and reactions are

carried out in 96 well plates, as opposed to the 0.5 ml tubes used with

the old machine. Initial experiments were performed using the method

described in the previous section except that the Idaho Technology medium

buffer was substituted for the Promega buffer A, and the final reaction

volume was 25 il/reaction. The PCR profile was as follows: an initial 2

minute denaturation at 930C; 35 cycles of 1 minute denaturation at 930C,

30 seconds annealing at 55C, 30 seconds extension at 72C; and a 5 minute

final extension at 72C.

While screening these plants 'false positives' began to be

produced. These 'false positives' would appear in all samples including

the non-transformed controls and sometimes the buffer controls. The bands

were of the same size (approx. 700 bp) as expected for the CTV coat

protein gene which we were trying to detect. The appearance of the bands,

however, differed in that the band was diffuse rather than a clear

distinct band as should be obtained. Even more problematic, these false



























1 2 3 4 5 6 7 8 9 10 11 12


Figure 4-1. Results of the PCR reaction of the samples contained in the
positive pool. Lanes 1 and 12 are Lambda HindIII markers. The arrow
points to the marker for 564 bp. Lane 10 is blank, Lane 11-- buffer
control. Lane 2-- N29, Lane 3-- N30, Lane 4-- N32, Lane 5-- N33, Lane 6--
N34, Lane 7-- untransformed control plant, Lane 8-- a T30 infected plant,
and Lane 9-- the plasmid control.










72

positives did not manifest themselves all the time, particularly in the

buffer control. As a result, we had to take a step backwards and try to

determine the source of this problem, and how to alleviate it.

The initial inclination was to blame the problem on the primers,

specifically the primers JC-10 and JC-1l. These primers were originally

used by H. R. Pappu (Dr. Niblett's Lab) to isolate and clone the CTV coat

protein gene from isolate T36, which was then inserted into the plasmids

that were used for transformation. Closer examination of the primers

revealed the possibility of a hairpin structure that could occur with

primer JC-10 (Figure 4-2) because there is a sequence of 4 bases at the

ends of the primer which can align with each other and anneal. This

hairpin structure could contribute to mispriming and result in false

positives. Onesolution obtained from the Molecular Biology usergroup on

the Internet was to denature the primers by boiling and quick chilling

them prior to adding them to the reaction mix. This was attempted and

seemed to work the first time; however, in subsequent experiments, the

same variability was evident. Consequently, new primers were obtained or

designed in an attempt to circumvent this problem (Figure 4-3). The

primers 728 and 729 are used to amplify a portion of the CaMV 35 S

promoter, which should have been inserted into the genome of the

transformants along with the coat protein gene. The other primers were

specific to various segments of the coat protein gene. Despite using

different primers, 'false positives' continued to be an intermittent

problem. Occasionally bands would be found for only a few of the samples,

indicating a true result ( that is-- no 'false positives'), but the

results were not repeatable.





































5' G


A-A-T-T

T-T-A-A


C-G-C-G-G-C-C-G-C-T


A
/
A-T-T-G-T-G-T-G-C-A


3' C


Figure 4-2. A Schematic diagram of how the Primer JC-10 can form a
secondary hairpin structure.















C-10 (equivalent to CN120 of C. L. Niblett)

5'- GAA TTC GCG GCC GCT CAA CGT GTG TTA AAT TTC C



C-Il (equivalent to CN119 of C. L. Niblett)

5'- AGA TCT ACC ATG GAC GAC GAA ACA AAG


Eli-i (CTV-CP,

5'- ACG



Eli-2 (CTV-CP,

5'- CAA

JS01 (CTV-CP)

5'- CCG

JS02 (CTV-CP)

5'- ATG

CN85 (CTV-CP,

5'- AAC C

CN86 (CTV-CP,

5'- CGG I


nt 116-139,

ATG TTG TTG



nt 577-600,

GAA ATC CGC


seq. from isolate T-36)

CTG CCG AGT CTT



seq. from isolate T-36)

ACA CAA GTA ATG


ACT ACT ACA GCA TCA ATG




GAC GAC GAA ACA AAC

internal primer)

;TA GCA TCG GGA GGG -3'

internal primer)

rTA CCA ATA CCC TTA G -3'


728 (CaMV 35 S PROMOTER)


5'- GAT

729 (CaMV 35

5'- CCT


ACA GTC TCA GAA

S PROMOTER)

CTC CAA ATG AAA


GAC C -3'




TGA AC -3'


Figure 4-3. PCR primers used for testing regenerated plants for
integration of the coat protein gene or CaMV 35 S promoter gene.










75

Other parameters were looked at as the source of the problem. These

included changing the reaction buffer, magnesium chloride concentration,

addition of bovine serum albumin, and lowering the DNA concentration. The

same variable results were obtained. Similarly, experiments with E. S.

Louzada looking at whether the concentration of the primers was

responsible for the 'false positive' results were also inconclusive. In

addition, changes in the PCR reaction profile involving the annealing

temperature were also unsuccessful.

As a result of these experiments the conclusion was drawn that these

'false positives' were the result of contamination in the laboratory

and/or equipment. Without significant expenditure to purchase PCR

dedicated equipment to use throughout the procedure this problem could not

be overcome. Because of this, screening by PCR was not a reliable

technique to screen for transformants, and another more reliable technique

had to be found.



Screening For Transformants Using Dot Blot Analysis



Although there were no recent reports in the literature of the use

of a pooled dot blot analysis for the detection of transformants, the

decision was made to see if it would be possible to select transformants

in this manner. The approach used was similar to that used with the PCR

screening, using pools of five samples in the initial screen.

DNA isolation and dot blot analysis were carried out as described in

the materials and methods section. From the 90 pools tested, 23 pools

showed a postive or inconclusive result. DNA from the members of these













pools was isolated and the procedure was repeated with these individuals.

From these blots 22 positive individuals were identified, representing 11

of the original 23 pools (figure 4-4) These positive plants were

identified as R73, R82, R83, R121, R124, R129, R140, R142, R146, R147,

R149, R150, R152, R153, R268, R269, R270,R271, R271b, R272, R276, R328,

and R368. The plant R368 died shortly after the Southern dot blot

analysis. The large size of the plasmid control blots is due to the

amount of sample in the blot. All trees testing positive were repotted

and saved for further analysis.




Confirmation of Transformation



Southern Hybridization Analysis Using the Non-radioactive GENIUS System


In order to confirm transformation, Southern hybridization analysis

of the PCR product of the 'Nova' tangelos was performed. This analysis

was performed using the GENIUS non-radioactive system as described in the

materials and methods. Using this method, all 3 'Nova'tangelos were shown

to be transformed. Figure 4-5 shows the results of the Southern

hybridization analysis experiment. In this experiment the lower band

corresponds to the coat protein gene, while the higher molecular weight

bands are probably the result of duplexes being amplified in the PCR

reaction.





































Figure 4-4. Dot blot hybridization screening for transformed 'Rohde Red
Valencia' sweet orange. Arrows point to the samples identified as
positive. Starting from the upper right hand corner of the top
autoradiograph, the positive plants are R146, R147, R149, R150, R152,
R153, R276, R328, R124, R129, R140, R142, and R271b. From the upper right
corner of the bottom autoradiograph the samples are R121, R73, R82, R83,
R268, R269, R270, R271, R272, and R368. The overexposed dark dots on the
bottom of each blot are plasmid controls.










78

























































Figure 4-5. Southern hybridization using the GENIUS Non-Radioactive
System with 'Nova' tangelo plants found to be transformed by PCR analysis.
Lane 1 is a non-transformed control plant Lanes 2-4 are transformants N32,
N33 and N34 respectively. Lane 5 is a confirmed transformed Carrizo (from
G. Moore). Lane 6 is a T30 infected plant. Lane 7 is the plasmid
control. The probe was made to the plasmid pMON10098-T30.













Southern Hybridization Analysis Using Radioactive Probes

Initial experiments using DNA isolated by the method used for dot

blot analysis were not successful. Efficient cutting of the DNA was

difficult to achieve. Changing from the Promega restriction enzymes to

enzymes purchased from Pharmacia Co. improved the efficiency, but the

digestions were still not complete. Consequently, it was concluded that

the problem was possibly due to the quality of the DNA isolated. To

improve the DNA quality and subsequent restriction digest, a new DNA

isolation procedure was used (see materials and methods) This procedure

was initially developed to isolate viroids from infected tissue (Marais et

al., 1995), but it was also efficient at isolating total genomic DNA from

the plant tissue. The method achieved the isolation of high yields of

high molecular weight DNA (up to 10 Ag/g of fresh leaf tissue). This DNA

could be very efficiently digested with the Pharmacia Co. restriction

enzymes. Using DNA isolated in this manner, Southern hybridization

analysis was performed on the putative transformants. The genomic DNA was

restricted with the restriction enzymes EcoRI and BglII to cut out the

coat protein gene. The results obtained with the 'Nova' tangelo plants

are shown in figure 4-6. The DNA was probed using a 32p labeled probe to

the plasmid pMONI0098-T30. The expected band of 670 bp for the coat

protein gene was obtained. The Southern hybridization analysis confirms

that the 'Nova' tangelo plants N32, N33, and N34 were transformed with the

coat protein gene of isolate T30.

Southern hybridization analysis was also performed on the healthiest

of the 'Rohde Red Valencia' sweet orange plants which were positive by the






















1 2 3


5 67


Figure 4-6. Southern hybridization of the 'Nova' tangelo transformants
using a radioactive probe to the coat protein gene that was prepared by
PCR (see text). Lane 1 is a nontransformed 'Nova' tangelo. Lane 2 is
N32, lane 3 is N33, and Lane 4 is N34. Lanes 5-7 are plasmid controls of
0.00001, 0.0001, and 0.001 jg. The arrows point to the coat protein gene
band. The bands for N32 and N34 are very faint and may not be visible in
the photograph, but are visible on the original autoradiograph. The top
band in the plasmid lanes is undigested plasmid and the visible smear in
the other lanes is the result on incomplete digestion of the DNA.






































Figure 4-7. Southern hybridization using a radioactive probe of the
transformed 'Rohde Red Valencia' sweet orange. In the upper
autoradiograph, lanes 1-8 are the transformants R121, R124, R129, R140,
R146, R150, R152, and R153. Lanes 9 and 10 are nontransformed 'Valencia'
controls. Lanes 11-13 are plasmid controls of 0.00001, 0.0001, and 0.001
Ag. In the lower autoradiograph lanes 108 are the transformants R268,
R269, R270, R271, R271 (second sample), R271b, R272, and R276. Lanes 9 and
10 are nontransformed 'Valencia' controls. Lanes 11-13 are plasmid
controls of 0.00001, 0.0001, and 0.001 Ag. The background is due to
incomplete cutting of the genomic DNA and the large amount of DNA present.










12345678 vv pp p


vv pp p


123 4 567 8










84

dot blot hybridization (figure 4-7). Not all of the plants could be

analyzed due to their poor growth and lack of leaf material.

This lack of growth could be due to a positional effect in regards

to the location of insertion of the coat protein gene in the DNA of the

plant. The large amount of background in the Valencia nontransformed

controls is due to the accidental loading of twice the quantity of sample

as for the putative transformants. Despite the increased amount of

sample, no band appeared corresponding to the coat protein gene.

Variability in the intensity of the bands in the transformants is due to

the variation in amount of DNA used, efficiency of restriction digestion,

and possibly due to copy number, although copy number was not determined.

The background at the top of the lanes is the result of undigested DNA and

background due to large amount of DNA present. Variation in the amount of

DNA used is due to the limits of quantification using gel electrophoresis

of a small quantity of the isolated DNA. Sensitivity could be increased

by using a higher percentage of the isolated DNA, but would compromise the

amount available for the Southern hybridization. Spectrophotometry for

quantifying the DNA was found to be more variable than gel

electrophoresis. Southern analysis was successfully repeated for all

samples shown.



Western Analysis

Western analysis of transformants can be difficult because

transformed plants often express the protein in very low quantities.

Initial experiments were performed using 12 il of sample removed from a

stock supply of approximately 1 cm2 of leaf material in 1000 il of protein











85

extraction buffer. No coat protein was detected in the transformants

although the coat protein could be detected in control plants inoculated

with CTV isolates T30 or T36. Western analysis was performed on the

'Nova' tangelo plants as described in the materials and methods. On one

occasion a very weak band was detected in N32 and N34 but not in N33, but

this was not repeatable.

It is often necessary to concentrate low abundance proteins in order

to detect them on a western blot. An experiment was performed to test

whether the coat protein gene could be detected after concentration using

a Jouan RC10 Concentrator/Evaporator. Duplicate samples were isolated

from the three 'Nova' tangelo plants, plus a healthy and CTV infected

control. One set of samples was boiled prior to concentration while the

other set was not. The samples were then concentrated to approximately

1/5 volume. Prior to loading the polyacrylamide gel both sets of samples

were then boiled and the western blotting performed as described in the

materials and methods. The antibody used for detection was the polyclonal

1053 antibody provided by Dr. R. F. Lee. The results using the samples

that were boiled prior to concentration were all negative. However, the

results from the samples which were not boiled were as expected and are

shown in figure 4-8.

Shortly after achieving the above results the Jouan RC10

concentrator/evaporator suffered a major breakdown, so a new way of

increasing the protein concentration in the samples for western

hybridizations. The same amount of leaf material (approx. 10 cm2) was

ground as before but resuspended in 700 i of protein extraction buffer.

Instead of using 12 pl of sample, 30 gi of sample was used. The exception






















































Figure 4-8. Western immunoblot of the 'Nova' tangelo transformants.
Samples were prepared as described in the text. Lane 1 is transformant
N32, lane 2 is transformant N33 lane 4 is transformant N34, lane 4 is a
T30 infected plant and lane 5 is a non-transformed 'Nova' tangelo control.











87

was the T36 or T30 positive controls for which only 5 pl of sample was

used. Also, the antibodies were diluted at 1:20000 v/v in order to

decrease the background (R.F. Lee, pers. comm.). The primary antibody

used for 'Nova' tangelo was G604 (from M. Keremane) and for 'Rohde Red

Valencia' sweet orange the primary antibody used was MCAl3. G604 will

detect isolate T30 while MCA13 is a monoclonal antibody specific to

decline isolates, including T36. The results for the 'Nova' tangelo are

shown in figure 4-9, and the results for 'Rohde Red Valencia' sweet orange

are shown in figure 4-10. Migration of the proteins in the transformant

samples was slowed because of the amount of sample loaded. Similarly,

partly due to the large amount of protein loaded, there was a significant

background for the high molecular weight, abundant proteins. These are

evident in the upper portion of the blots. Confirmation that these bands

are associated with the coat protein can be inferred based on the lack of

these bands in the non-infected controls. However, the quality of the

western blots suggests that the protein may be expressed in quantities too

low to be detected by western immunoblot analysis, and no definite

confirmation of protein expression can be made based on these results. It

is possible that proteins may be detectable using procedures to seperate

the proteins, but these experiments were not conducted.
























































Figure 4-9. Western immunoblot of transformed 'Nova' tangelo using
primary antibody G604. Lanes 1-3 -- transformants N32, N33, N34
respectively, lanes 4-7 -- non infected, non transformed Mexican Lime
plants, lane 8 -- a T30 infected control plant, and lane 9 -- molecular
weight markers. Arrow points to the band corresponding to the coat
protein. The Lane marked T36-8 is mislabeled and should be T30.





































a). lane 1 -- R73, lane 2 -- R82, lane 3 -- R121, lane 4 -- R129,
lane 5 -- R140, lane 6 -- R142, lane 7 -- 'valencia' nontransformed
control, lane 8 -- a T36 infected plant, lane 9 -- molecular weight
markers.


I ilsil ill


b). lane 1 -- R146, lane 2 -- R147, lane 3 -- RI50, lane 4 -- R152,
lane 5 -- R269, lane 6 -- R270, lane 7 -- 'Valencia' nontransformed
control, lane 8 -- T36 infected plant and lane 9 -- molecular weight
markers.

Figure 4-10. Western immunoblot analysis of the 'Rhode Red Valencia'
sweet orange transgenic plants using MCA13 antibody.








































c). lane 1 -- R83, lane 2 -- R124, lane 3 -- R149, lane 4 -- R153,
lane 5 -- R268, lane 7 -- 'valencia' nontransformed control, lane 8
-- T36 infected plant, lane 9 -- molecular weight markers.







ilu x.


















d) lane 1 --R271, lane 2 --R27lb, lane 3 --R272, lane 4 --R276,
lane 5 -- R328, lane 7 -- 'Valencia' nontransformed control, lane 8
-- T36 infected plant, and lane 9 -- molecular weight markers.


Figure 4-10- -continued


mfW


















CHAPTER 5

SUMMARY AND CONCLUSIONS



The successful transformation of Citrus scions with the coat protein

gene of Citrus Tristeza Virus using PEG-mediated direct DNA uptake was

achieved. Three 'Nova' tangelo transformed with the coat protein gene

from mild isolate T30 (from 59 total regenerants), and 22 'Rohde Red

Valencia' sweet orange transformed with the coat protein gene from florida

severe isolate T36 (from 500 total regenerants) were obtained. No

transformants were obtained from the 12 'Valencia' sweet orange

regenerants. It is important to note that these transgenic plants were

obtained without selection at the cellular level. Identification was made

using the polymerase chain reaction for the 'Nova' tangelos, and Dot Blot

hybridization for the 'Rohde Red Valencia' sweet orange plants. The time

required to select after regeneration of plants was not significantly

different than the time required for selection at the cellular level.

Confirmation of stable transformation was shown by Southern hybridization

and western analysis. Western analysis suggested a low level of

expression of the coat protein gene in the transgenic plants.

The results also showed that pooled PCR can be used for selection of

transgenics, as was demonstrated for the 'Nova' tangelos, but PCR is also

very susceptible to outside interference. In order to reliably use PCR

for screening, measures need to be taken to guard against contamination











from outside sources. Screening by pooled Southern dot blot hybridization

can also be used successfully, as was demonstrated with the 'Rohde Red

Valencia' sweet orange. Southern dot blot hybridization was found to be

as easy and fast as PCR, and by using the DNA isolation procedure that was

used for later experiments, efficiency could be even better. These

results are summarized in Figure 5-1.

Evidence of somaclonal variation was difficult to ascertain. There

were differences in growth rate, particularly for the 'Rohde Red Valencia'

sweet orange, but the reasons for this are difficult to determine. The

stunting of the plants could be due to a positional effect of the inserted

gene, or the effect of the coat protein expression, or a combination of

these, and a number of other unknown effects.

The regenerated transgenic plants are now ready to be tested by

challenge inoculation with different severe quick decline and stem-pitting

isolates of CTV in the greenhouse. The results of these tests will help

to determine whether these plants have acquired a greater level of

resistance against infection by CTV. If these tests are positive, field

testing can then be carried out. Selection will indirectly be made at

this point for other important horticultural traits, and thus for the

possible somaclonal variants exhibiting normal or improved horticultural

traits. Positive results in the field will mean that tristeza resistant

Citrus scions have been achieved.


















PLANT # APPEARANCE SOUTHERN WESTERN
POSITIVE POSITIVE

N32 Normal yes yes

N33 Normal yes yes

N34 Normal yes yes

R73 somewhat small plant No yes

R82 Small, w/ elongate leaves no yes

R83 Slow growing no yes

R121 Normal yes yes

R124 Normal yes yes

R129 Normal yes yes

R140 Normal yes yes

R142 Leaves slightly smaller no yes

R146 Normal yes yes

R147 Normal no yes

R149 Very small plant no yes

R150 Normal yes yes

R152 Normal yes yes

R153 Normal yes yes

R268 somewhat small plant yes yes

R269 Normal yes yes

R270 Normal ??? yes

R271 Normal yes yes

R271b Normal yes yes

R272 Normal yes yes

R276 Normal yes yes

R328 Normal yes yes




Table 5-1. Summary of the transgenic plants regenerated in this
experiment, and whether confirmed by Southern and/or Western analysis.