The Role of prostaglandins in the maturation and function of human monocyte derived dendritic cells

MISSING IMAGE

Material Information

Title:
The Role of prostaglandins in the maturation and function of human monocyte derived dendritic cells
Physical Description:
Book
Language:
English
Creator:
Whittaker, Donna S
Publication Date:

Record Information

Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 23265285
oclc - 51638981
System ID:
AA00022483:00001

Full Text











THE ROLE OF PROSTAGLANDINS IN THE MATURATION AND
FUNCTION OF HUMAN MONOCYTE DERIVED DENDRITIC CELLS

















By

DONNA S. WHITTAKER


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2000















ACKNOWLEDGMENTS


First, I would like to recognize the Medical Service Corps, United States Army,

that I proudly serve, for giving me the opportunity to fulfill a life long dream. Next, I

would like to thank my mentor, Michael Clare-Salzer, M.D., for his encouragement

and patience and for setting the bar high enough to challenge me but low enough to be

attainable. Dr. Clare-Salzler is an intelligent, gifted scientist/teacher and I feel honored to

have had the opportunity to work for him. Also, I would like to thank the members of my

supervisory committee, Drs. Lyle Moldawer, Margaret Wallace, Ammon Peck and

Maureen Goodenow, for their many hours of guidance and support through out this

process. I am also appreciative of my laboratory mate, Keith Bahjat, and the other

members of the Clare-SalzIer Laboratory, Rena Bahjat, Dr. Vikas Dhamidharka, Dr.

Sally Litherland and Dr. YiYu Li for all their suggestions and stimulating conversation

about immunology, science, and life.

Volunteer samples are vital to any human study. I would like to thank the

Diabetes Prevention Trial participants; the clinical research nurses, Karen Fuller, Mary

Alice Dennis, and Roberta Cook; and the many normal controls who contributed samples

for this study.

On a personal note, there are many people to whom I am grateful or indebted.

First, my parents, Colonel (retired) William P. and Samille Sewell, who dragged me

around the world, taught me to do my best and told me that I could be anything that I









wanted to be. I am forever thankful for their unconditional love and their never ending

support of my endeavors. Next, I would like to thank the members of the 0430 running

group, especially Dr. Sarah Martin, who listened to my complaints and helped me stay

focused during these last four years. Next, I am deeply indebted and have eternal

admiration, love and respect for my husband, Tom Steves, who gave up everything to be

everything to me, taught me how to relax, but most importantly showed me that life is

fun. Finally, to my children Garrett and Trevor, who cannot remember a time when their

mom wasn't in school, I appreciate their love, support and understanding even though

sometimes it was not convenient or easy. My hope is that they will benefit from this

experience by gaining an appreciation for the joy and happiness associated with life-long

learning.















TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ............................................................................................... ii

A B STR A C T ................................................................................................................... iv

CHAPTERS

1 INTRODUCTION .................................................................................................. 1

2 REVIEW OF LITERATURE .................................................................................. 8

Prostanglandins: Metabolism, Function and Receptors ........................................... 8
Eicosanoids .................................................................................................... 8
Prostaglandin Biosynthesis .................................................................................. 8
Prostaglandin Receptors ......................................................................................... 11
D endritic Cells ...................................................................................................... 14
Initiators of Immune Response ......................................................................... 14
Interleukin- 12 ........................................................................................................ 16
Lineages of Dendritic Cells ................................................................................. 17
Polarizing Thl and Th2 Responses in Naive T Cells ......................................... 19
Effects of Prostaglandins on Maturation and Function ...................................... 20
Pathogenesis of Diabetes ....................................................................................... 21
Prostaglandins and the Pathogenesis of IDD in Human and NOD .......................... 22

3 AUTOREGULATION OF HUMAN MONOCYTE DERIVED DENDRITIC CELL
MATURATION AND FUNCTION BY CYCLOOXYGENASE-2 MEDIATED
PROSTAGLANDIN PRODUCTION ................................................................... 25

Review of Literature .............................................................................................. 25
Materials and Methods ......................................................................................... 26
Isolation of Monocytes and Dendritic Cell Cultures ........................................... 26
Surface and Internal Protein Analysis .............................................................. 27
PGE2 and Cytokine Assays .............................................................................. 28
Antigen Uptake Measured by FITC-Dextran and Lucifer Yellow ....................... 29
R esults ....................................................................................................................... 29
MDC Express COX-1 and COX-2 ..................................................................... 29
Prostanoid Production by I-MDC and M-MDC .................................................. 33
COX-2 Mediated Prostaglandin Synthesis Promotes MDC Maturation .............. 37
Endogenous Prostanoid Production Affects Secretion of IL- 12 ......................... 39








IL- 10 Production by MDC is not Regulated by Prostaglandin Synthesis ........... 44
Prostaglandins Do Not Significantly Affect Antigen Uptake ............................. 44
D iscussion ................................................................................................................. 46

4 MATURATION STIMULI AND MODULATION OF PROSTAGLANDIN
RECEPTORS REGULATE THE EFFECTS OF PGE2 ON INTERLEUKIN-12
PRODUCTION BY MONOCYTE DERIVED DENDRITIC CELLS ................... 51

Review of Literature .............................................................................................. 51
Materials and Methods ......................................................................................... 53
M aterials ................................................................................................................ 53
Isolation of Monocytes and Dendritic Cell Cultures ........................................... 53
Isolation of Total RNA and Reverse Transcription ........................................... 54
Relative Polymerase Chain Reaction ................................................................. 55
IL-12p40 and IL-12p70 Assays .......................................................................... 55
Measurement of cAMP Formation ................................................................... 56
Quantitation of 3HPGE2 Binding on I- and M-MDC ......................................... 56
R esults ....................................................................................................................... 57
PGE2 Regulation IL-12 in I-MDC Through EP2 and EP4 Receptors ................. 57
EP2 Receptors Mediate the Suppressive Effects of PGE2 on IL-12p70
Production by Maturing MDC ......................................................................... 61
Fully Mature MDC Express EP4 Receptors But IL-12 Production is
Insensitive to the Regulatory Effects of PGE2 and cAMP .................................. 63
D iscussion ................................................................................................................. 68

5 GENERATION OF PHENOTYPICALLY AND FUNCTIONALLY NORMAL
MONOCYTE DERIVED DENDRITIC CELLS FROM SUBJECTS AT HIGH RISK
FOR AUTOIMMUNE INSULIN DEPENDENT DIABETES .............................. 72

Review of Literature .............................................................................................. 72
Materials and Methods ......................................................................................... 74
Subjects ................................................................................................................. 74
Isolation of Monocytes and MDC Cultures ........................................................ 74
Flow Cytometry for Surface and Internal Proteins .............................................. 75
Autologous and Allogeneic Mixed Lymphocyte Reaction (MLR) ..................... 76
Measurement of IL-12 and Prostanoids ............................................................. 76
Measurement of Endocytosis ............................................................................ 77
Statistical A nalysis ............................................................................................ 77
R esults ....................................................................................................................... 77
D iscussion ................................................................................................................. 86

6 SUMMARY AND CONCLUSIONS ..................................................................... 89

R EFEREN CES .............................................................................................................. 94

BIOGRAPHICAL SKETCH ....................................................................................... 107















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

THE ROLE OF PROSTAGLANDINS IN THE MATURATION AND
FUNCTION OF HUMAN MONOCYTE DERIVED DENDRITIC CELLS


By

Donna S. Whittaker

August 2000



Chairman: Michael J. Clare-Sazer, M.D.
Major Department: Pathology, Immunology, and Laboratory Medicine

Dendritic cells (DC) are important mediators of immunity and tolerance.

Prostaglandins, especially prostaglandin E2 (PGE2), have diverse affects on the adaptive

immune response including in vitro maturation and function of monocyte derived

dendritic cells (MDC). Using an established protocol for generation of MDC, the role of

prostaglandins in the maturation and function of MDC was investigated. This study

demonstrates that MDC constitutively express cyclooxygenase-2 (COX-2) during

differentiation from monocyte precursors and produce prostaglandins that autoregulate

expression of CD83, a mature DC specific marker, and secretion of interleukin- 12 (IL-

12), a critical proinflammatory cytokine responsible for Thl immune responses.

Interestingly, the effects of PGE2 are highly dependent on the maturation stage of the

MDC. In immature-MDC (I-MDC), the presence of PGE2, whether endogenously

produced or added to cultures, increases the secretion of IL-12 while in maturing MDC,









PGE2 profoundly decreases the secretion of IL-12. PGE2 mediates its response in MDC

through prostaglandin receptors EP2 and EP4, which are members of the G protein-

coupled receptor family. EP2 and EP4 stimulate adenylate cyclase which increases

cAMP in response to ligand binding. This study finds that I-MDC express mRNA for

EP2 and EP4. As MDC mature, the expression of mRNA for EP2 gradually declines by

50% at 24 hours and remains decreased after 48 hours while the mRNA for EP4 increases

four fold at two hours and remains significantly increased in the fully mature MDC.

Pharmacological agents that target specific prostaglandin receptors show that increases in

IL-12 in the I-MDC are mediated through EP2 and EP4 and downregulation of IL-12 in

the maturing MDC is mediated through EP2 and high cAMP production. Fully matured

MDC produce lower levels of cAMP in response to PGE2, have fewer PGE2 binding

sites, and are resistant to modulation of lL-12 by PGE2 as well as cAMP analogues.

These findings have important implications for the development of the MDC for

immunotherapy as well as the effects of COX inhibitors or selective prostaglandin

receptor agonists on immune function, and may provide new approaches to modulation of

the proinflammatory immune response.














CHAPTER 1
INTRODUCTION


Dendritic cells (DC) are the most potent antigen presenting cells (APC); they are

10-100 times more potent at activating naYve and memory T cells than B cells or

macrophages (MD). Constitutive high expression of costimulatory molecules, CD80 and

CD86, and major histocompatibility (MHC) molecules make DC unique in their ability to

activate naYve T cells (Steinman, 1991). Recently, two subsets of DC have been

phenotypically described, a myeloid derived DC that captures antigen in the periphery

and migrates to the draining lymph node and a lymphoid DC that resides in the lymph

node. Functional differences in the two subsets continue to headline the DC literature

(Shortman and Caux, 1997; Steinman et al., 1997a). DC have been shown to be

important in both immunity and tolerance. The ability of DC to induce T cell activation

or tolerance is dependent on the microenvironment during antigen capture and the antigen

itself (Kalinski et al., 1999a; Steinman et al., 1997b). Antigens that fail to induce an

inflammatory stimulus are considered safe and induce tolerance while antigens that are

accompanied by an inflammatory signal elicit an immune response directed at antigen

elimination (Finkelman et al., 1996). Activation of T cells by APC requires T cell

receptor (TCR) recognition of peptide presented in MHC molecules and co-stimulation of

CD28 on the T cell by CD80 or CD86 on the same APC. Lack of costimulation in the

presence of TCR engagement results in anergy of the T cell and presumed tolerance of

the antigen.









Because of their central role in the adaptive immune response, DC have become a

favorite target for research in many clinical diseases involving T cells including allergy,

transplantation, autoimmune disease, resistance to infection, resistance to tumors and

immunodeficiency. In autoimmune disease, defects in stimulatory capacity of the DC

may promote autoimmunity by impaired antigen presentation that leads to accumulation

of autoreactive T cells or deficient generation of regulatory cells. Impaired or suboptimal

T cell activation may be sufficient to induce T cell proliferation but not strong enough to

induce a tolerogenic or protective response, as generation of regulatory cells and

elimination of activated T cells requires a quantitatively higher level of activation than

what is required for T cell proliferation (Serreze et al., 1993). In human autoimmune

insulin dependent diabetes (IDD), defects in APC function have been described.

Monocyte derived DC (MDC) from subjects with IDD generated by triidothronine show

reduced ability to cluster and stimulate autologous and allogeneic T cells in vitro (Jansen

et al., 1995). Recently, Takahashi et al. (1998) showed that immature MDC (I-MDC)

from subjects at high risk for IDD expressed quantitatively lower levels of CD80 and

CD86 per cell than age/sex/human leukocyte antigen (HLA) matched controls (Takahashi

et al., 1998). Studies in the murine model for diabetes, the non-obese diabetic (NOD)

mouse, also suggest that DC play a protective role in the autoimmune process by

activation of regulatory T cells (Clare-Salzler et al., 1992).

In 1999, Litherland et al. (1999) found that monocytes from subjects at high risk

for IDD aberrantly expressed cyclooxygenase-2 (COX-2, also referred to as

prostaglandin synthase-2 or PGS2) and as a result produced increased quantities of

prostaglandins. The abnormal expression of COX-2 in pre-IDD subjects contributed to









impaired T cell activation by decreased CD25 expression and interleukin-2 (IL-2) in

phytohemagglutin (PHA)-activated T cells when compared to normal controls.

Inhibiting COX-2 activity with a specific inhibitor, NS398, significantly increased the

CD25 expression and IL-2 production in PHA- activated T cells in pre-IDD subjects

(Litherland et al., 1999). Additional studies from the same laboratory report that

peritoneal M(D from NOD mice constitutively express COX-2 and that this expression is

responsible for enhanced prostaglandin E2 (PGE2) production (Xie, 1997).

Prostaglandins apparently play a role in the pathogenesis of IDD as blocking the

cyclooxygenase activity delayed the onset as well, as reduced the incidence of diabetes in

the NOD mouse. These data suggest that abnormal expression of COX-2 in humans at

high risk for IDD and in the NOD mouse results in increased prostaglandin production by

McD/monocytes and limits T cell activation by APC. This limitation subsequently may

contribute to the pathogenesis of IDD by interference with peripheral tolerance

mechanism including generation of regulatory T cells or elimination of autoreactive T

cells by activation induced cell death (AICD).

Recent studies suggest that blood monocytes are an immature reservoir of cells

with dual potential that can be recruited to the tissues and differentiate into MD or DC

depending on the tissue microenvironment (Palucka et al., 1998). Peripheral blood

monocytes cultured with granulocyte-macrophage colony stimulating factor (GM-CSF)

and interleukin-4 (IL-4) for six days differentiate into cells with immature DC

morphology (Romani et al., 1994; Sallusto and Lanzavecchia, 1994). These monocyte

derived dendritic cells (MDC) express MHC class II molecules as well as low levels of

costimulatory molecules CD80 and CD86. They also express CDla, a tissue DC marker,









lack CD 14, a monocyte/MD surface receptor, are highly efficient in antigen capture but

are poor stimulators of T cells (Sallusto et al., 1995; Sallusto and Lanzavecchia, 1994).

After the addition of a maturation stimulus such as tumor necrosis factor-alpha (TNF-a),

lipopolysaccharide (LPS) or soluble trimeric CD40L (sCD40L), MDC upregulate MHC

class II, CD80, CD86, induces expression of CD83, a DC specific cell surface marker

(Zhou and Tedder, 1995; Zhou and Tedder, 1996). Matured DC also decrease

mechanisms of antigen capture and become highly immunostimulatory (Sallusto et al.,

1995). Kalinski et al. (1997) demonstrated that when high levels of PGE2 are present in

culture from inception, MDC do not lose CD14 expression, express lower levels of CDla

and produce significantly lower levels of interleukin- 12 (IL- 12), a proinflammatory

cytokine. Additionally, these MDC exposed to high levels of PGE2 stimulate nalve T

cells to produce Th2 cytokines, whereas DC cultured in the absence of high levels of

PGE2 stimulated Thl cytokines (Kalinski et al., 1997). Other studies suggest that

exogenous PGE2 added to cultures after monocytes have differentiated into I-MDC acts

synergistically with TNF-a to enhance maturation, indicated by increased expression of

CD83, and stimulatory capacity of the MDC (Jonuleit et al., 1997; Reddy et al., 1997a).

Rieser et al. (1997) also reported that addition of exogenous PGE2 increases IL-12

secretion by MDC by a cAMP mediated mechanism (Rieser et al., 1997) while others

have reported that PGE2 down regulates the secretion of IL-12p70 in MDC stimulated

with LPS (van der Pouw Kraan et al., 1995; 1996). Collectively, these data suggest that

PGE2 has a profound effect on MDC maturation and function but that the effects are

highly dependent on the state of MDC maturation. Early exposure of monocytes to

PGE2 limits MDC differentiation, for example, maintain CD14 and do not express CDla,









and promotes Th2 T cell response, while exposure to PGE2 after differentiation into I-

MDC results in increased maturation, stimulatory capacity, and secretion of IL- 12

(Jonuleit et al., 1997; Kalinski et al., 1997; Rieser et al., 1997).

Prostaglandins mediate their biological action through binding to specific cell

surface and nuclear membrane receptors. Four PGE2 receptor subtypes termed EP 1, EP2,

EP3, and EP4 are coupled to intracellular signaling pathway through GTP binding

proteins. EPI activatrs phosphotidylinositol turnover and increases intracellular CA++

by an unidentified G protein. EP2 and EP4 are coupled to Gs protein and transduce

activation of adenylate cyclase resulting in an increase in cAMP (Narumiya et al., 1999).

EP3 has multiple isoforms with identical extracellular domains differing only in the

cytoplasmic tail which differ in their signal transduction but most are coupled to Gi

inhibiting AC and reducing cAMP (Negishi et al., 1995). Secondary messengers, such as

cAMP, activated by ligation of prostaglandin receptors control cellular responses by

stimulating protein kinases which phosphorylate transcription factors and regulate gene

expression.

Recent studies suggest that EP2 and/or EP4 may contribute to the pathogenesis of

IDD. Bridgett et al. (1998) describes differential protection in two transgenic lines of

NOD mice hyperexpressing a peptide of glutamic acid decarboxylase (GAD), a candidate

autoantigen in diabetes. One transgene inserted into the Y chromosome provided no

protection from diabetes while the A-line (whose transgne integrated within 6 cM from

the centromere of chromosome 15) provided protection from diabetes in the hemizygous

state suggesting that protection may be associated with insertional mutagenesis (Bridgett

et al., 1998). Candidate genes in the transgene insertion region included EP2 and EP4.









EP2 and EP4 mediate cellular response through increased cAMP and protein kinase A. It

is possible that the increased prostaglandins reported in NOD mice mediate their affect

through EP2 and/or EP4 and that disruption of one or both of these genes may reduce the

level of cAMP generated when prostaglandins are present. Increases in cAMP have been

shown to be involved in preventing apoptosis (Boehme and Lenardo, 1993; Critchfield

and Lenardo, 1995) and cell cycle progression (Goetzl et al., 1995b; Smit et al., 1998),

events that would interrupt peripheral tolerance mechanisms including AICD and

possibly lead to an accumulation of autoreactive T cells. Additionally, PGE2 affects the

secretion of IL-12 in MDC through cAMP mediated mechanisms (Rieser et al., 1997; van

der Pouw Kraan et al., 1995; van der Pouw Kraan et al., 1996) and the maturation of

MDC (Jonuleit et al., 1997; Kalinski et al., 1997).

Because prostaglandins affect maturation and function of MDC (cells important in

immunity and tolerance) and the expression of COX-2 in monocytes (immature

reservoirs of cells with MDC potential) of subjects at risk for IDD, suggest that

prostaglandins may contribute to the pathogenesis of IDD by modulation of DC

maturation and function. This study was designed to answer the following questions:

Chapter 3: Do MDC express COX-1 and COX-2? What is the eicosanoid profile

produced by the MDC? Do endogenously produced PG regulate MDC surface antigen

expression, capture of antigen, and secretion of IL-12? Chapter 4: Do MDC express PG

receptors? What is the number of receptors on the cell surface? Which PG receptors

regulate IL-12 production in MDC? Chapter 5: Do MDC generated from subjects at

high risk for IDD have similar phenotype and function as MDC generated from normal






7


controls? Does the aberrant expression of COX-2 and increased PG production in

monocytes from subjects at high risk for IDD impairs MDC differentiation?














CHAPTER 2
REVIEW OF LITERATURE


Prostaglandins: Metabolism, Function and Receptors

Eicosanoids

Eicosanoids are a family of oxygenated metabolites of arachidonic acid (AA) that

mediate many cellular processes. Over the past 40 years the structures of eicosanoids,

which consist of prostaglandins (PG), thromboxane (TBX), hydroxyeicosatetraenoic

acids (HETES) and leukotrienes (LT), have been elucidated as well as their cellular

location, biosynthesis and action through specific cell surface and nuclear receptors.

Liberation of membrane AA by phospholipases (PLA) results from external signals such

as hormones, growth factors and cytokines, making AA available for oxygenation by

either the linear pathway which results in generation of HETES and LT or by the cyclic

pathway which yields PG and TBX (Piomelli, 1993).

Prostaglandin Biosynthesis

The biosynthesis of TBX and PG involves three sequential steps (Figure 2-1).

The first step is the release of AA from membrane phospholipid by phospholipase A2

(PLA2). Next, formation of prostaglandin H2 (PGH2) from AA is mediated through two

isoenzymes designated cyclooxygenase- 1 and -2 (also referred to as COX-1, -2 or

prostaglandin synthase-1, -2 or PGS-i, -2). Both isoenzymes catalyze the oxygenation of

AA to PGG2 (cyclooxygenase) and reduction to PGH2 (peroxidase) (Smith et al., 1996).















Membrane phospholipids
Phospholipase
A2
Arachidonic Acid (AA)

Cyclooxygenase- Cyclooxygenase 1
Prostaglandin G2 (PGG2) or
Peroxidase J Cycloxygenase 2


Pros

Prostcyclin
synthase

Prostacyclin (PGI2)


PGF2a
synthase



PGF2a


;taglandin H2 (PGH2)


Pros aglandins


PGE2


I7


PGE2


boxane (TBX)


;D2 synthase


PGD2


Figure 2-1. Cyclic pathway of arachindonic acid metabolism leading to
prostaglandins, prostacyclins and thromboxanes. Enzymes are italicized.
Cyclooxygenase I and 2 (COX-1 and COX-2 also referred to as Prostaglandin
Synthase 2, PGSl, and Prostaglandin Synthase 2, PGS2) has both
cyclooxygenase and peroxidase activity.


Thromboxane
synthase


Throni



synthase p

F









The last step is isomeriztion of PGH2 by specific synthases to produce prostacyclin

(PGI2), PG, and TBX, collectively referred to as prostanoids (Figure 1).

The evolutionary pressures that led to two isoforms of COX are not clear. COX- 1

is developmentally regulated, constitutively expressed in most tissues, and primarily

responsible for cellular homeostasis. In contrast, COX-2 is generally not expressed in

unstimulated cells but can be induced to produce large quantities of prostanoids. The

induction of COX-2 is not simply a matter of quantity of PG as induction of COX-2 in

fibroblast produces little increase in overall PG production (Goetzl et al., 1995a).

Additionally, COX-2 is expressed under non-stimulated conditions in the renal cortex and

the brain (Seibert et al., 1994). Evidence suggests that the COX-1 and COX-2 occupy

different subcellular compartments and may utilize different intracellular pools of AA

(Morita et al., 1995; Murakami et al., 1994). Immunostaining reveals that COX-1 is

localized to the endoplasmic reticulum (ER) while COX-2 is located in the ER but

concentrated in the nuclear envelope (NE). These data suggest that the nuclear location

of COX-2 is important in providing PG that interact with nuclear receptors and alter gene

expression directly by acting as transcription factors on genes that may be important in

cellular growth, replication and differentiation (Murakami et al., 1994; Smith et al.,

1996). However, other studies in COX-1 and COX-2 null cells indicate that cells

deficient in COX-1 or COX-2 compensate by expression of the alternative COX

isoenzyme (Kirtikara et al., 1998).

The human genes for COX- 1 and -2 are located on chromosome 9 and 1,

respectively. The structural differences in COX-l and COX-2 genes explain differing

patterns of expression of the two enzymes. The COX-2 gene has a TATA box as well as









a number of elements in the 5' promotor region such as a nuclear factor-kb (NFkB) site,

CAAT enhancer and a cyclic AMP (cAMP) response element that are generally involved

in highly regulated inflammatory genes (Appleby et al., 1994). The COX-l gene has no

TATA, characteristic of a housekeeping gene, and no significant inducible element has

been identified in the promotor region. Additionally, mRNA for COX-2 but not COX-l

has long a 3' untranslated region that contains multiple polyadenlyation sites and

instability sequences that signal rapid message degradation (Herschman et al., 1997;

Smith et al., 1996).

Although COX-1 and -2 have different gene and mRNA structure as well as

occupy different locations within the cell, the catalytic characteristics are almost identical

except for their susceptibility to inhibition by pharmacological agents. Glucocorticoids

inhibit expression of COX-2 while exhibiting little effect on COX-1 (Kujubu and

Herschman, 1992; Masferrer et al., 1994). Traditional nonsteroidal anti-inflammatory

drugs (NSAID) used to treat inflammatory diseases such as rheumatoid arthritis inhibit

both COX-1 and -2; however, a new class of specific inhibitors that target COX-2

(Futaki et al., 1994) has been developed that produce less ulcerogenic and nephrotoxic

side effects than NSAID.

Prostaglandin Receptors

Effects of eicosanoids are mediated through binding to specific seven-

transmembrane rhodopsin-like G-protein coupled receptors (Figure 2-2). The prostanoid

receptors include DP, EP, FP, IP and TP, which bind to PGD2, PGE2, PGF2, PGI2 and

TBX, respectively, and transduce secondary intracellular signals by changes in cAMP,











N-linked
Oligosaccharides sites


Extracellular




Plasma
Membrane




Intracellular


Figure 2-2. Representative structure of prostaglandin receptors which are
members of the G-protein coupled rhodopsin-type receptor with 7 putative
transmembrane domains. Solid circles indicate hydrophobic amino acids.
Conserved motifs include LXAXRXAS/TXNQILDPWVYIL in the
seventh transmembrane, GRYXXQXPGS/TWCF in the second
extracellular domain, and MXFFGLXXLLXXXAMAXER in the third
transmembrane domain are shared by most of the prostanoid receptors.
Different isoforms of receptors such as TBX or EP3 have identical amino
terminal (ligand binding) and vary only in the carboxy terminal tail (G-
protein binding/signal transduction).



















Table 2-1: Signal Transduction of prostanoid receptors


Type Subtype Isoform G protein Second Messanger


DP Gs cAMP t
EP EPI Unidentified Ca++ t
EP2 Gs cAMP
EP3 Gi cAMP ,
EP4 Gs cAMPt
FP Gq PI response
IP GsGq cAMP t PI response
TP TPax GsGi PI response, cAMP ,
TPP Gq,Gs PI response, cAMP









phosphotidylinositol (PI) or free CA++ concentrations in the cell (Kiriyama et al.,

1997)(Table 2-1).

Alignment of the amino acid sequences of the eight prostanoid receptors

including the subtypes of EP and TP reveal 28 residues that are conserved. Additionally,

all have one or more Asn-X-Ser/[hr in the extracellular amino terminal of the protein that

is a consensus sequence for N-glycosylation and is essential for ligand binding (Chiang

and Tai, 1998). But despite the conserved sequences, the overall homology of the

receptors is only 20-30% even among the subtypes of PGE2 receptors (Narumiya et al.,

1999).

Prostaglandins play a role in various central nervous system actions including

fever, sleep, acute inflammation and pain, thrombosis, hemostasis, bone resorption,

hypertension, and reproduction. However, the potent immunomodulatory affects of PG,

particulary PGE2, also suggest a role in immunity and allergy (Goetzl et al., 1995a).

Studies in immune cells and PG suggest that the immunomodulatory effects of PGE2 are

mediated through increases in cAMP suggesting the involvement of EP2 and/or EP4

(Anastassiou et al., 1992; Bauman et al., 1994; Betz and Fox, 1991; Blaschke et al.,

1996; Choung et al., 1998). PGE2-specific effects on immune function will be discussed

in subsequent paragraphs.

Dendritic Cells

Initiators of the Immune Response

Adaptive immune response results from antigen uptake, processing and

presentation by APC to T cells in lymphoid organs. Among professional APC including

DC, MD, and B-cells only DC are highly effective at stimulating naive T cells because of









constitutive expression of costimulatory molecules, CD80 and CD86, and high

expression of MHC class II molecules required for T cell activation. Immature DC are

distributed throughout the body and equipped with mechanisms to optimize antigen

capture including macropinocytosis, receptor-mediated endocytosis vis C-type lectin

receptor, Fcy receptors I and II for uptake of immune complexes or opsonized particles,

CD36 and avP5 integrins involved in phagocytosis of apotoptic and necrotic cells and

entry of intracellular parasites, bacteria, and viruses. Recently, a new receptor, DC-SIGN

was identified which, unlike the receptors that mediate antigen uptake which results in

antigen processing and presentation of peptide in MHC molecules to T cells, this receptor

binds to human immunodeficiency virus (HIV) and transports HIV to the draining

lymphnode where the receptor promotes binding and transmission of HIV to T cells

(Geijtenbeek et al., 2000). This mechanism, which is important in the pathogenesis of

HIV, may be involved in transport of other pathogens to target sites but to date only HIV

transport has been reported.

Following capture of antigen, DC migrate to the lymph node via the afferent

lymph where they upregulate MHC and costimulatory molecules and activate T cells.

Recent data indicate that the microenvironment during antigen capture polarize the DC so

that it not only provides signal 1 (peptide bound to MHC) and signal 2 (costimulatory

molecules) but also provides signal 3 in the form of release of polarizing cytokines that

directs the bias of Th cells towards Thl or Th2 (Kalinski et al., 1999a). A crucial factor

in the polarization towards Thl or Th2 cytokine production is the presence of IL-12 or

IL-4, respectively, during T cell receptor (TCR) engagement (Abbas et al., 1996). DC

are known producers of IL-12 but do not produce IL-4 (de Saint-Vis et al., 1998).









Interleukin-12

Interleukin-12 is a heterodimeric cytokine that is involved in priming the naive T

cell for high IFN-)y secretion resulting in a proinflammatory immune response.

Heterodimeric IL-12 or IL-12p70 is composed of two subunits of two chains, p35 and

p40, that are covalently linked. IL-12p40 is also secreted as a monomer or homodimer

generally in excess of 10-100 times that of the biologically active cytokine (Gately, 1999;

Sutterwala and Mosser, 1999). The biological activity of IL-12p40 homodimers is not

well defined, but several studies in human and mouse suggest that the IL-1 2p40

homodimer is an IL-12 receptor antagonist (Gillessen et al., 1995; Ling et al., 1995) and

may reduce the Thl response (Yoshimoto et al., 1998). Inducers of IL-12 in DC and

other APC include LPS, CpG motifs contained in bacterial DNA, and activated T cells

through direct interaction of CD40 with CD40L on the T cell (Macatonia et al., 1995;

Shu et al., 1995). Hilkens et al. (1997) found that IFN-y was an obligatory signal required

for DC secretion of the biologically active form of IL-12 via CD40-CD40L (Hilkens et

al., 1997). Three well-described inhibitors of IL-12 biosynthesis include IL-10,

transforming growth factor-O (TGF-01) and PGE2 (Strassmann et al., 1994; Sutterwala et

al., 1997; van der Pouw Kraan et al., 1995).

In vivo and in vitro studies concluded that IL- 12 is critical in the development of

immunity against intracellular pathogens. Animals treated with anti-IL-12 or that lack

the IL-12p40 gene are more susceptible to intracellular pathogen infection (Mattner et al.,

1993; Scharton-Kersten et al., 1995). Conversely, overproduction of IL-12 has

detrimental consequences including exacerbation of autoimmune disease as reported in









IDD (Trembleau et al., 1995) while administration of IL-12p40 to NOD mice prevented

disease (Rothe et al., 1997; Trembleau et al., 1999).

Lineages of Dendritic Cells

The multiple lineages and functions of DC remain complex. Clearly, subsets of

DC are derived from hematopoietic progenitor cells. Three distinct hematopoietic DC

have been described in the literature (Figure 2-3). Thymic DC and a subset of DC found

in the lymph node and spleen originate from a lymphoid lineage. In humans, culturing

CD34+ progenitors with IL-3 or flt3-ligand generates lymphoid DC that express CD8a.

Shortman et al.(1997) found that in marine lymph nodes two population of DC exist, a

CD8a+ (lymphoid DC) and CD8a- (non lymphoid) population. Both populations express

similar levels of HLA molecules, and costimulatory molecules CD80 and CD86, but

activate T cells differently. T cell proliferation studies demonstrated that lymphoid DC

did not activate CD8+ T cells as efficiently as non-lymphoid cells because of an

inadequacy of the lymphoid DC to induce IL-2 production. Additionally, lymphoid and

non lymphoid DC effectively activated CD4+ T cells but lymphoid DC eliminated the

CD4+ T cells after activation by FAS mediated apoptosis. These authors suggest that

because of the deletion of T cells via FAS-FASL interaction, lymphoid DC may play a

role in peripheral tolerance (Banchereau and Steinman, 1998; Heath et al., 1998;

Shortman and Caux, 1997).

A second subset of hematopoietically derived DC can be differentiated by

culturing CD34+ precursors with GM-CSF and TNF-cc. This yields a DC that is positive

for CDla and expresses markers similar to a Langerhan's cell (LC) or epidermal DC

(Caux et al., 1995; Caux et al., 1997). A third hematopoietically derived DC also begins























Precursors D





(Cymhok CD~a +
M-CSF

Monocyte CD14 +
IL-3 CD83 -
/'GM-CSF TFa P


CD3ur4______ CD14 -


CRJ-GM C0LMature CD1a +
3CD14 +- PGE2 DC

C D~ a +C D 1 4 -
CD83 +
Blood CDa -
DC d yd r e




Figure 2-3: Hemnatopoietic differentiation pathway for myeloid and lymphoid dendritic cells







00









with a CD34+ progenitor but has a transient CD14 + state. These DC can also be derived

from culturing peripheral blood monocytes (CD14+) with GM-CSF and IL-4 for 6-8

days, which yields a monocyte derived dendritic cell (MDC) (Romani et al., 1994;

Sallusto and Lanzavecchia, 1994). The latter two populations are both myeloid lineage

DC and express similar levels ofCDla, CD1 Ic, CD40, CD80, CD86, HLA-DR but can

be differentiated by expression of CD64 and E-cadherin which are expressed on CD34+

derived DC but not on MDC (Caux et al., 1997; de Saint-Vis et al., 1998).

It has been suggested that the key distinction between lymphoid DC and myeloid

DC may be tolerance versus immunity (Banchereau and Steinman, 1998; Shortman et al.,

1997); however, recent studies suggest that both lymphoid and myeloid DC have the

ability to exhibit tolerogenic activity (Inaba et al., 1998; Suss and Shortman, 1996).

Dendritic cells tolerized by TGF-P or IL- 10, or genetically engineered DC expressing

immunosuppressive activity such as TGF- 0, IL- 10 or molecules that induce apoptosis

such as FASL, may provide mechanisms for tolerance induction for treatment of

transplant rejection and autoimmunity (Lu, 1999).

Polarizing Thl and Th2 Responses in Naive T cells

Until recently myeloid DC were thought to only stimulated Thl producing T cells

by virtue of their ability to secrete IL-12. Recent studies in vitro and in vivo suggest that

myeloid DC can induce Thl or Th2 cytokine production in naive T cells (Macatonia et

al., 1995; Ronchese et al., 1994; Stumbles et al., 1998). The determining factor in

skewing the Th response by the DC is the secretion of IL-12 (Abbas et al., 1996; Snijders

et al., 1998) and the amount of IL-12 secreted by the DC is directed by the

microenvironmental factors present during antigen capture as well as the antigen itself









(Jonuleit et al., 1997; Kalinski et al., 1999a; Kalinski et al., 1999b). Microenvironmental

tissue factors that have been shown to affect IL- 12 modulation are PGE2, IL- 10, TGFO

and IFN-y (De Smedt et al., 1997; Kalinski et al., 1998).

Several pathogens, including intracellular bacteria and helminthes, have been

shown to modulate secretion of IL-12 by DC (Bancroft et al., 1997; Snijders et al., 1998;

Trinchieri, 1997; Trinchieri, 1996). Additionally, other pathogens including intracellular

parasites such as Leishmania major induce production of IL- 12 inhibitory factors in the

host which down modulate IL-12. Viruses such as HIV and measles virus have also been

shown to interfere with the production of IL-12 in DC (Karp, 1999; Marshall et al., 1999;

Weissman et al., 1996).



Effects of Prostaglandins on Dendritic Cell Maturation and Function

Few studies have examined the effects of PG on the differentiation and maturation

of MDC. Kalinski et al. (1997) showed that PGE2 added to cultures at high

concentration (106M) prevent the differentiating monocyte from acquiring the CD 1 a

marker and losing the monocyte marker, CD14. Additionally, the presence of PGE2

inhibited the ability of the matured MDC to produce IL-12p70 and, therefore, induces

Th2 cytokine production (Kalinski et al., 1997). The addition of PGE2 into cultures, in

combination with other maturation stimuli, such as TNF-a, LPS, or sCD40L, after the

differentiation process from monocyte to I-MDC was complete enhances maturation,

migratory, and immunostimulatory capacity of the MDC (Jonuleit et al., 1997; Reddy et

al., 1997). Rieser et al. (1997) reported that PGE2 in the absence of LPS stimulated the

production of total IL-12 (Rieser et al., 1997) while other have reported that PGE2 is a









potent inhibitor of IL-12 production (Strassmann et al., 1994; Sutterwala et al., 1997; van

der Pouw Kraan et al., 1995; van der Pouw Kraan et al., 1996). Although the studies by

Reiser et al. (1997) and van der Pouw Kraan et al.(1995) report increased and decreased

production of IL-12, respectively, in response to PGE2, both suggest that the mechanism

of action is through increase in cAMP production suggesting that the regulation of IL-12

by PGE2 may be through EP2 and/or EP4. Finally, Kalinski et al. (1998) found that filly

matured MDC are unresponsive to PGE2 regulation of IL-12. These data suggest that the

diverse response by MDC to PGE2 is highly dependent on the maturation stage of the

MDC (Kalinski et al., 1998). The autocrine effects of endogenously produced PG on the

maturation and function of MDC as well as the distribution of prostaglandin receptors on

MDC have not been examined, but are the focus of Chapter 3 and Chapter 4,

respectively.

Pathogenesis of Diabetes

Autoirmmune insulin dependent diabetes (IDD) results from a cell mediated

immune response that destroys the insulin producing cells of the pancreas (3 cells of the

islets of Langerhan's). Although T cells are critical to the pathogenesis of IDD, M1 and

DC may contribute as the initiation of the autoimmune process begins with the

presentation of 03 cell specific antigens by APC to autoreactive CD4+ T cells.

Alternatively, DC have been shown to be important in induction of tolerance through

generation of regulatory T cells (Clare-Salzler et al., 1992), anergy (Kirk et al., 1997;

Larsen et al., 1996), and AICD (Suss and Shortman, 1996). Initially, M43 and DC

infiltrate the islet of Langerhan's (Dahlen et al., 1998) followed by T cell infiltration and

Thl mediated destruction of the insulin secreting 3 cells. The secretion of IL-12 by the









APC polarizes the immune response toward Thl and induces the secretion of interferon-y

(IFN-y) by Thl cells. IFN-y activates MI) causing release of inflammatory cytokines

such as interleukin- 103 (IL- I(3) and tumor necrosis factor-a (TNF-a) as well as free

radicals. This release of cytokines results in increased apoptosis and/or necrosis of

(3 cells (Dahlen et al., 1998; Delaney et al., 1997; Heitmeier et al., 1997).

IDD susceptibility is associated with many genes including genes of MHC class

II. The most significant association is with MHC class II haplotypes DR3-DQBl*201

and DR4-DQBl*302. Although the MHC molecules are critical for presentation of

antigen to CD4+ T cells and the pathogenesis of IDD attributed to accumulation of islet

antigen specific ThI cells, the mechanism of immune dysregulation in IDD has not been

fully defined. The accumulation of autoreactive T cells may result from failure of

elimination by activation induced cell death, induction of anergy, or deficient generation

of regulatory cells caused by impaired antigen presentation. In humans with IDD as well

as the murine model, the NOD mouse, inability of the APC to activate T cells has been

described including decreased clustering, decreased production of IL-2, and deficient

activation of regulatory cells (Clare-Salzler and Mullen, 1992; Jansen et al., 1995).

Prostaglandins and Pathogenesis of IDD in Humans and NOD

As stated previously, PG, especially PGE2, have diverse effects on the immune

response. PGE2 can modulate T cell differentiation, tissue migration and effector

function. PGE2 protects thymocytes from activation-induced apoptosis through

thymocyte expression of EP2 and increased cAMP (Goetzl et al., 1995b). Migration of T

cells across basement membranes is enhanced by PGE2 (through EP2 and increases in

cAMP) and secretion of matrix metallproteinases (Leppert et al., 1995). Finally, PGE2









modulates T cell effector function by inhibiting the production of IL-2 and IFN-y and the

expression of CD25 (a-chain, IL-2 high affinity receptor) (Anastassiou et al., 1992;

Hancock et al., 1988; Katamura et al., 1995). The inhibition of CD25 and IL-2

production leads to inhibition of proliferation and subsequently blocked AICD that is

required for elimination of T cells after activation (Bauman et al., 1994). One group

reports that previous studies on the effects of PGE2 used high concentrations that are

above physiologic levels, and that physiologically relevant concentrations of PGE2

actually enhance the production of IFN-y by antigen-stimulated Thl cells (Bloom et al.,

1999). A recent report suggests that different strains of mice have sensitivity differences

to the suppressive effect of PGE2 possibly through the number of prostaglandin

receptors, and that this difference may account for preferential polarization to a Th2

response in Balb/c mice (Kuroda et al., 2000). Studies in the NOD strain have not been

reported.

Until recently, the suppressive effects of PGE2 in NOD mice had not been

studied; however, Ganapathy et al. (2000) recently suggested that PGE2 may be a less

effective negative regulator of activated CD8+ T cells IFN-y secretion in NOD than in

Balb/c mice (Ganapathy et al., 2000). PG apparently play a role in the pathogenesis of

disease since blocking endogenous production of PG delays onset and decreases

incidence of diabetes in NOD mice (Xie, 1997). Xie (1997) reported that peritoneal M$

from NOD mice constitutively expressed the normally inducible COX-2 enzyme and that

this constitutive expression was responsible for increased production of PGE2.

Litherland et al. (1999) reported similar findings, aberrant expression of COX-2 in human









peripheral blood monocytes, from subjects at increased risk for IDD (Litherland et al.,

1999).

The possible role of PG receptors in the pathogenesis of diabetes was suggested

by Bridgett et al.(1998) when two transgenic lines of NOD mice overexpressing the

putative autoantigen GAD (Kaufinan et al., 1993) in pancreatic 3 cells had differential

protection from diabetes. The Y-line integrated in the Y chromosome but showed similar

incidence of diabetes in male NOD than the standard NOD males, while the A-line which

incorporated into the proximal end of chromosome 15, where the genes for murine EP2

and EP4 are located, exhibited a markedly lower incidence of diabetes in both sexes.

Additionally, the ratio of IFN-y to IL-10 transcripts was reduced in the A-line suggesting

that the insertional mutagenesis is a possible mechanism in the A line protection from

diabetes (Bridgett et al., 1998).

Collectively, these studies suggest that PG could play a major role in the

pathogenesis of diabetes. First, activation of regulatory T cells for induction of tolerance

requires a highly immunostimulatory APC such as MDC. Subjects with a high risk for

IDD and NOD mice aberrantly express COX-2 and produce PG that could affect

differentiation and the immunostimulatory capacity of MDC. Second, increased

prostaglandin production during T cell activation may lead to decreased IL-2 production

and increased cAMP mediated antiapoptotic that could impair activation induced cell

death, a mechanism required for peripheral tolerance. Chapter 5 describes a comparative

study of MDC in normal human controls and subjects at high risk for IDD to ascertain if

atypical expression of COX-2 in subjects at high risk for IDD impair MDC maturation

and function.














CHAPTER 3
AUTOREGULATION OF HUMAN MONOCYTE DERIVED DENDRITIC
CELL MATURATION AND FUNCTION BY CYCLOOXYGENASE-2
MEDIATED PROSTAGLANDIN PRODUCTION


Review of Literature

Prostaglandins are important lipid mediators for a wide variety of physiological

cellular functions (Crofford, 1997; Morita et al., 1995; Smith et al., 1996; Williams and

Shacter, 1997). Prostaglandin synthesis is regulated by a series of steps involving the

release of endogenous arachidonic acid (AA) by phospholipase A2 (PLA2), and the

subsequent conversion of AA to prostaglandin H2 (PGH2). Conversion of AA to PGH2,

the first and rate limiting step in prostaglandin biosynthesis, is mediated through two

isoenzymes, cyclooxygenase 1 (COX-1 also referred to as prostaglandin synthase-1,

PGS-1) and cyclooxygenase-2 (COX-2, also known as PGS-2). Constitutively expressed

COX-1 is primarily responsible for cellular homeostasis while COX-2 is inducible and is

responsible for high-level production of prostanoids that modulate inflammation and

mitogensis (Brock et al., 1996). Monocyte expression of COX-2 is induced by a variety

of stimuli including LPS, PMA, and IL- 13 (Hwang et al., 1997; Yamaoka et al., 1998).

In monocytes, LPS upregulates COX-2 through induction of GM-CSF while IL-1f3

enhances and stabilizes COX-2 transcripts. In several cell types including monocytes,

COX-2 expression is suppressd by IL-4, IL- 10 and IL- 13 via transcriptional and

postranscriptional regulation (Endo et al., 1996).









Expression of COX enzymes, prostanoid production, and the autocrine effects of

these molecules have not been reported for MDC. Previous studies, however, described

the effects of exogenous prostaglandins on MDC maturation and function. Kalinsky et

al. (1997) demonstrated that high concentration (10-6 M) of exogenous PGE2 added to

monocytes in the presence of GM-CSF and IL-4 profoundly modulated MDC

development as these cells do not lose CD 14, expressed low levels of CDla, and

produced significantly less IL-12p70 and higher levels of IL-10 (Kalinski et al., 1997).

Additionally, MDC derived under these conditions stimulated Th2 responses whereas

MDC cultured without exogenous PGE2 stimulated Thl responses. Other studies

demonstrated that exogenous PGE2 (10-6M), when added to cultures following monocyte

differentiation into I-MDC, synergized with TNF-a or TNF-GtlL-IIL-6 at 10-8M to

induce maturation, immuno-stimulatory capacity and IL-12 production (Jonuleit et al.,

1997; Reddy et al., 1997a). These published studies demonstrate that exogenous

prostanoids markedly affect MDC maturation and function and that the effect is highly

dependent on the developmental stage of the MDC. Preliminary data from our laboratory

suggested that MDC express COX-2 constitutively; therefore, we asked if MDC

expressed COX-1 and COX-2 and produced prostaglandins that in an autocrine manner

regulated MDC maturation and function?

Materials and Methods

Isolation of Monocytes and Dendritic Cell Culture Conditions

PBMC were isolated from buffy coats from one unit of whole human blood using

Histopaque Ficoll (Sigma, 1.077, endotoxin tested, St. Louis, MO). Cells were washed

two times with Dulbecco's PBS (DPBS), Ca++ and Mg+ free (Cellgro, endotoxin tested)









and resuspended in RPMI 1640 media with L-glutamine (Gibco, BRL, Grand Island, NY)

supplemented with 10% fetal calf serum (Hyclone, endotoxin tested, Logan, UT), and 1%

streptomycin, penicillin, neomycin (Sigma). PBMC were allowed to adhere for 2 hours

at 37C, 5% CO2, 100% humidity and non-adherent cells were washed away with DPBS.

Complete RPMI tested negative for endotoxin (<2.0 EU/ml) (E-Toxate Kit, Sigma).

Adherent cells were cultured for 6 days in complete RPMI supplement with 500 U (50

ng/ml) GM-CSF (Endogen, Woburn, MA) and 500-1000 U IL-4 (R&D Systems,

Minneapolis, MN) to generate I-MDC (Sallusto and Lanzavecchia, 1994). To generate

M-MDC, day 6 I-MDC were harvested, washed and re-plated at 3.0 X 105 cells/mi and

supplemented with 1 gg/mI sCD40L (gift from Immunex, Seattle WA) and/or 1000 U of

IFN-y (human recombinant, Endogen). Some cultures were supplemented with NS-398

(Cayman Chemical, Cambridge, MA), a specific COX-2 inhibitor (I jig/ml), or

Indomethacin (Sigma) (1 Ojg/ml), a COX- 1 and COX-2 inhibitor.

Surface and Internal Protein Analysis

The following monoclonal antibodies directed against surface or internal proteins

were used: CD14, HLA-DR (Becton-Dickinson, San Jose, CA), CDla, CD86, CD80,

CD40 (Pharmingen, San Diego, CA), CD83 (Coulter-Immunotech, Miami, FL), and

COX-2 (FITC, Cayman Chemical). Appropriate fluorochrome labeled isotype control

antibodies were used. Cells were suspended in PBS with 1% BSA (reagent grade,

Sigma) and 0.1% Sodium Azide (Sigma). For surface marker labeling, cells were

incubated with 1 jig of fluorochrome conjugated antibody/1 X 106 cells for 20 minutes at

room temperature, then washed one time with 2.0 ml of PBS and resuspended in 500 jil

of 1% formaldehyde in PBS. Intracellular labeling of COX-2 was performed as









previously described (Litherland et al., 1999). All cells were analyzed on Becton-

Dickinson FACSCalibur or FACSort. Flow Cytometry data were analyzed and median

fluorescent intensity calculated with WinMidi (Version 2.7, Joseph Trotter).

Cultured MDC were washed with PBS supplemented with protease inhibitors (1

jig/ml of each leupeptin, pepstatin and aprotinin, Sigma) and 5 jig/ml indomethacin and

frozen at -70'C. Lysates were thawed, sonicated and centrifuged for 10 minutes at

14,000 rpm. Equal quantities of protein were separated by SDS-PAGE with a 10% Tris-

HCL gel (Biorad), and transferred to nitrocellulose (Optitran, Schleicher and Schull,

Keene, NH.) Nitrocellose was probe with monoclonal antibodies directed against COX- 1

and COX-2 (Cayman Chemical) and secondary antibodies (anti-mouse IgG-horseradish

peroxidase, Amersham, Arlington Heights, IL). Peroxidase activity was detected by

chemiluminescence (ECL Western Blotting detection system, Amersham Life Sciences).

PGE2 and Cytokine Assays

Supernatants from cultures of MDC were harvested for analysis of PGE2 and IL-

12. I-MDC were cultured for 6 days, washed from the plate, counted and re-plated at

3X105 cells/ml in media containing GM-CSF and IL-4. I-MDC were cultured for an

additional 48 hours before supernatants were harvested for analysis. Supernatants from

maturing M-MDC were prepared by harvesting I-MDC on day 6, re-plating these cells at

the same density in media containing GM-CSF, IL-4 and maturation stimuli. Cells were

cultured for an additional 48 hours and then supernatants harvested. MDC culture

supematants from various conditions were analyzed for IL-12p70 and IL-12p40 (gift

from Dr. Maurice Gately, Hoffinan Roche, Nutely, NJ), by ELISA in duplicate as

previously described (Zhang et al., 1994). The lower limit of IL-12p40 and IL-12p70









detection in this assay is 15.6 pg/ml. Supernatants for IL-10 were measured by ELISA

(Endogen, capture antibody clone 9D7 and detection antibody, clone 12G8 biotinylated).

The lower limit of detection for IL-10 is 20.5 pg/ml. PGE2, PGD2, PGF2a and

thrombaxane were measured by competitive enzyme immunoassay (Cayman Chemical).

The limit of detection for this assay is 30 pg/ml. Cytokine and prostanoid values were

standardized to pg/ml/l X 106 cells.

Antigen Uptake Measured by FITC-Dextran and Lucifer Yellow

Mannose receptor-mediated endocytosis was measured by the cellular uptake of

FITC-Dextran ( FD, 40,000 MW, Molecular Probes, Eugene, OR) and quantitated by

flow cytometry. Approximately 1.5 X 105 MDC were incubated in complete RPMI with

25 mM Hepes and 1 mg/ml of FITC-Detran for 1 hour at 0 C and 370C. After 1 hour,

cells were washed four times with ice-cold IX PBS with 0.1% sodium azide and

immediately run on the flow cytometer. Fluid-phase endocytosis by macropinocytosis

was measured by cellular uptake exactly as described for uptake of FD except 1 mg/ml

Lucifer Yellow (LY, dipotassium salt, Molecular Probes) was used. Mean fluorescent

intensity (MFI) of 37C 00C (baseline) was used to evaluate antigen uptake in different

maturation states of MDC.

Results

MDC Express COX-1 and COX-2

To determine whether MDC express COX-2, we employed an established

protocol employing GM-CSF and IL-4 to generate I-MDC from peripheral blood

monocytes (Sallusto and Lanzavecchia, 1994). After six days in culture, I-MDC were

harvested and washed then re-plated and cultured for an additional 48 hours in new media


































Figure 3-1. Monocyte derived DC express COX-2. SDS page electrophoresis
with a 10% Tris-HCL gel loaded with 30 jig of protein from MDC cell lysates
and 10 jig of protein from monocytes cell lysates. (A) COX-2 and (B) COX-
1 expression in Lane 1: I-MDC (GM-CSF and IL-4 for 8 days), Lane 2: M-
MDC matured with I jg/ml CD40L only, Lane 3: M-MDC matured with I
jig/ml CD40L and 1000 U/ml IFN-y. (C) Intracellular staining of COX-2 with
FITC conjugated monoclonal antibody (filled histogram is anti-COX-2 and
open histogram is isotype control) in I- MDC (A) (M-MDC not shown.). (D)
COX-2 expression in monocytes cultured for 24 hours Lane 1 :complete RPMI,
Lane 2: 1 jig/ml LPS, Lane 3: 1 jig/ml LPS with 500 U/ml of IL-4.









containing GM-CSF and IL-4. MDC maturation was stimulated by culturing I-MDC

with either soluble trimeric CD40L (sCD40L) in the presence or absence of human

recombinant IFN-y for the same 48-hour period. Cells and culture supernatants were

harvested at the 48 hours time point for analysis.

We first analyzed the MDC from these cultures for COX-1 and COX-2 expression

by intracelular flow cytometry (Litherland et al., 1999) and immunoblotting. As seen in

Figure IA and 1B, I-MDC, I-MDC stimulated with IFN-y only, sCD40L only, and

sCD40L/IFN-y constitutively express COX- 1 and COX-2. We were also able to detect

intracellular COX-2 expression by flow cytometry (see Figure 3-1 C) and further establish

expression in MDC. This is in marked contrast to monocytes that express COX-l

constitutively (data not shown) but require LPS induction for COX-2 expression (Figure

ID). Of interest, while monocyte COX-2 is readily suppressed by 500 U/ml of IL-4

(Figure 3-1D, Lane 3), the same concentration of IL-4 present in MDC cultures does not

regulate COX-2 in either I- or M-MDC (Figure 3-lA and B). Interleukin-10, also, does

not suppress COX-2 (data not shown). These findings with MDC are in marked contrast

to several studies demonstrating that LPS-induced monocyte COX-2 expression is readily

down regulated by anti-inflammatory cytokines IL-4, IL-10 and IL-13 (Endo et al., 1996;

Niiro et al., 1995). However, our results are similar to findings by Maloney et al. (1998)

that showed COX-2 induced by LPS or GM-CSF in neutrophils was not down regulated

by IL-4 or IL-10 (Maloney et al., 1998). These data suggest that GM-CSF, IL-4 or factors

produced in culture by monocytes or the differentiating process induce COX-2 in manner

that provides resistance to cytokine regulation.






















Immature MDC


60000-

50000 -

40000


30000


20000

10000 -


PGE2


TBX


PGF


<15 pg/ml

PGD2


Figure 3-2. Prostanoid production in immature monocyte derived dendritic
cells. TBX = Thromoboxane, PGF = PGF2a. Concentration of
agonist/antagonist isl X 10-6 M. Data represents one of at least three sets
performed. Prostanoids are expressed in pg/ml/ 1 X 106 cells.









Prostanoid Production by I-MDC and M-MDC

Next, COX-1 and COX-2 mediated prostanoid production by MDC populations

was examined. Supernatants of I- and maturing M-MDC cultured in the presence and

absence ofNS-398, a specific COX-2 inhibitor, or indomethacin, a COX-l and -2

inhibitor, added during the last 48 hours of cell culture were analyzed. Results show

MDC (in the absence of inhibitors) spontaneously produce thromboxane (TBX) > PGE2

> prostacyclin but no PGD2 (Figure 3-2). NS-398 and indomethacin significantly reduce

PGE2 production to a similar degree, suggesting that prostanoid synthesis occurs

predominantly through COX-2 in I-MDC (Figure 3-3). It is possible that small numbers

of residual monocytes, approximately 1% of our cultures, produce large quantities of

prostanoids and account for COX-2-mediated prostaglandins. Although this possibility

exists, monocytes do not express COX-2 during culture without activation. Furthermore,

the expression of this enzyme is readily suppressed in monocytes by the presence of IL-4

in the culture (see Figure 3-1d).

Next, production of prostaglandin by I-MDC undergoing maturation when

stimulated for 48 hours with sCD40L was evaluated. MDC cultured in these conditions

synthesize two-fold more PGE2 but utilize primarily COX-1 since indomethacin but not

NS-398 markedly reduced prostaglandin production (Figure 3). We also evaluated the

effects of IFN-y on sCD40L mediated maturation because this cytokine in combination

with sCD40L strongly influences MDC function and development especially secretion of

IL-12p70 (Hilkens et al., 1997). When MDC are matured with sCD40L in combination

with IFN-y, a 3-4 fold increase in COX-2 mediated PGE2 prostaglandin production

occurs which is reduced toI-MDC levels in the presence ofNS-398 (Figure 3-2).



















6000
M None

4500 LIONS-398
ED Indomethacin

3000 *


1500 T


I-MDC CD40L CD40L + IFN


Figure 3-3. PGE2 production by I- and M-MDC is suppressed by a COX-2
specific inhibitor. PGE2 was measured by competitive immunoassay and
expressed as pg/mi/I X 106 cells. Data represents the mean and SEM of at
least four independent experiments, *p<0.05 as calculated by one-way
ANOVA.









Interferon-y also stimulated a two-fold increase in COX-2 dependent PGE2 production

from I-MDC. The effects of IFN-y on COX-2-mediated prostaglandin production by in I-

MDC and maturing MDC may be related to the increased access of COX-2 to substrate,

as this cytokine readily stimulates AA release through G-protein mediated activation of

PLA2 (Visnjic et al., 1997). Overall, these data suggest that the synthesis of prostanoids

through COX-2 is the default pathway for I-MDC, whereas stimulation of I-MDC by

sCD40L in the absence of IFN-y switches AA metabolism to COX-1. However, when

inflammatory stimuli such as IFN-y or LPS and TNF-a are present, COX-2-mediated

prostaglandin synthesis again predominates.

The quantity of PGE2 produced by MDC (10-9M) is relatively small in

comparison to LPS activated monocytes which produce micromolar quantities of PGE2.

It is not readily evident why quantitative differences in prostaglandin metabolism exist

between these two types of myeloid cells. Based on the Western blots, monocytes do not

express a greater mass of COX-2 than MDC. Therefore, it may be that the presence of

IL-4 in MDC cultures limits PLA2 activity and substrate availability (Nassar et al.,

1994). However, culturing MDC in the absence of IL-4 for 24 hours increased PGE2

production, but the prostaglandin levels remained in the nanomolar range. Alternatively,

higher levels of AA may be liberated when monocytes are stimulated by LPS. However,

stimulation of maturing MDC with LPS or TNF-a leads to only nanomolar quantities of

PGE2. Thus the quantitative set point for production of prostanoids by MDC appears to

be substantially lower than that of macrophages or monocytes.















I-MDC



I -MDC
NS398



M-MDC U



M-MDC
NS398


In U. -.4 2 ".



4-1L:.1 ...1L L


I S 1 1
L:LoL


Fluorescence
Intensity


HLA-DR CD80 CD86 CD40 CDIlb CDlIc CDla CD14


Figure 3-4. Blocking cyclooxygenase activity does not affect expression of
HLA-DR and costimulatory molecules on I-MDC or MDC. I-MDC were
cultured with GM-CSF and LL-4 in presence and absence of COX-2
inhibitor, NS-398. M-MDC cultured for six days with GM-CSF and LL-4
then matured in the presence or absence of NS-398 with soluble trimeric
CD40L and IFN-y. MDC were stained with antibodies to cell surface
markers conjugated to fluorochromes listed in Materials and Methods. Filled
histogram indicates cell surface staining and open histogram represents
isotype antibody staining.


10









COX-2 Mediated Prostaglandin Synthesis Promotes MDC Maturation

To establish whether endogenous prostaglandins affect differentiation of I-MDC

from monocytes, surface antigen expression of CDIa, CD14, CD40, CD80, CD86, CD83

and HLA-DR on these cells cultured in the presence and absence ofNS-398 was

analyzed (Figure 3-4). These data demonstrate that blocking endogenous COX-2

mediated prostanoid production did not affect expression of CD Ia, HLA-DR or the

expression of the co-stimulatory molecules during differentiation from monocytes to I-

MDC (Figure 3-4). These data are consistent with Kalinski et al. (1997) who reported

that MDC exposed to 10-9 M exogenous PGE2, equivalent to levels produced by I-MDC,

did not affect MDC differentiation from monocytes (Kalinski et al., 1997).

The same series of antigen markers on I-MDC matured with sCD40L and

sCD40L with IFN-y in the presence of either NS-398 or indomethacin were examined.

Again, blocking COX-2 in MDC stimulated with sCD40L/IFN-y did not modify

expression of CD40, CD80, CD86 or HLA-DR (Figure 3-4). Additionally, when

indomethacin was used to block COX- 1, the predominant enzyme metabolizing

arachidonate in MDC matured with sCD40L alone, likewise there was no affect on

expression of these same antigens. Previous studies demonstrated that micromolar

concentrations of PGE2 enhanced I-MDC maturation when used in cell culture in

combination with LPS, TNF-a, or a mixture of inflammatory cytokines (Jonuleit et al.,

1997; Reddy et al., 1997a). However, in the present studies we did not find that reducing

prostaglandins limited MDC maturation based on the expression of these antigens. It

appears that large quantities of PGE2, such as that produced by macrophages, are

required to modulate surface molecules such as CD86.
























b101 L 1.0 1 10 10, 32 10'1
I-MDC I-MDC +
NS398


Co
sCD40L


sCD40L +
Indomethacin


None
100 NS398
Indomethacin


I-MDC


sCD40L sCD40L/IFN


sCD40L + sCD40L + IFN-y
IFN-y + NS398


Figure 3-5. Endogenous prostaglandins regulate CD83 in M-MDC matured
with sCD40L and IFN-,. (A) Flow cytometric analysis of CD83 in I-MDC
and M-MDC matured with sCD40L alone with our without Indomethacin, and
with sCD40L/ IFN-y in the presence or absence of NS398. (B) Bar graph
displays comparison of the median fluorescence intensity (MFI) in I-MDC
and M-MDC matured with sCD40L alone and sCD40L/ IFN-y in the presence
or absence ofNS398 or Indomethacin. These results are representative of
four independent experiments.









Prostanoids produced by MDC are, however, not without affect on MDC

maturation. Blocking COX-2 with NS-398 profoundly inhibited CD83 expression

following sCD40L/IFN-y stimulation (Figure 3-5). The predominant effect of

prostanoids appears to be mediated through COX-2, as the addition of indomethacin did

not enhance this effect (data not shown). When MDC were stimulated with sCD40L

alone, substantially lower levels of CD83 expression were achieved. Since MDC

stimulated in this manner produce PGE2 primarily through COX-l we blocked

prostaglandin production with indomethacin and evaluated CD83 expression. Unlike I-

MDC matured with sCD40L and IFN-y, the COX inhibitor did little to affect CD83

expression in these conditions. These data are consistent with the previous reports

suggesting that PGE2 increases CD83 expression on MDC. However, these studies

employed micromolar concentrations of PGE2 to enhance CD83 expression (Jonuleit et

al., 1997). Although lower doses of PGE2 equivalent to that made by MDC were not

tested in these reports, it may be that sCD40L provides a qualitatively different stimulus

than LPS, TNF-a or a combination of inflammatory cytokines such that nanomolar levels

of prostaglandins are effective. Based on the present findings, it appears that lower levels

of endogenous prostaglandins uniquely stimulate expression of CD83 in contrast to other

maturation antigens, e.g. CD86.

Endogenous Prostanoid Production Affects Secretion of IL-12

MDC secretion of the ThI polarizing cytokine, IL-12, has been extensively

studied (Celia et al., 1996; Hilkens et al., 1996; Hilkens et al., 1997; Rieser et al., 1997;

Snijders et al., 1996; Snijders et al., 1998). To examine the effect of endogenous












B
2000 IL-12p70


IL-12$O


I-MDC


IL-12p40


2000 IL-12p7O


1500

1000

500

0


sCD4OL


sCD4OL+ IFN


None
NS398
Indomethacin



Figure 3-6. Endogenous prostaglandins autoregulate L-12p4O and IL-12p7O
production by I-MDC and M-MDC. Supernatants from I-MDC and M-MDC
in the presence or absence of NS-398 or Indomethacin were analyzed for IL-
12p4O, IL-12p7O by ELISA. (A) IL-12p4O in I-MDC, *p=0.045, (B) IL-
12p7O in I-MDC, (C) IL-12p4O in MDC undergoing maturation with
sCD40L, (D) IL-12p7O in MDC undergoing maturation with sCD40L (E)
IL-12p40 in sCD40L/IFN-y matured MDC, *p =0.007 (F) IL-12p70 in
sCD40L/IFN-y matured MDC, p=0.06. Conditions analyzed by paired t test.


1500

1000

500

0


<30.8 <30.8

I-MDC


2500
2000
1500
1000
500

0


C
100000

75000

50000

25000


0


E
150000


100000


50000


0


IL-12p40


F
2000


<30.8 <30.8


sCD40L


sCD4OL+ IFN









prostaglandins on secretion of IL-12p40 and IL-12p70, MDC were prepared and assayed

for both forms of this cytokine in the supernatants in the presence and absence of COX

inhibitors. We chose to study IL-12 production during maturation of MDC using sCD40L

alone, and in combination with IFN-y, the latter combination stimulating production of

biologically active IL-12p70 (Hilkens et al., 1997). Consistent with previous reports, we

found that I-MDC produced only IL-12p40 and did not produce IL-12p70 (Celia et al.,

1996; Snijders et al., 1996). When I-MDC were cultured in the presence of NS-398 for

48 hours IL-12p40 levels were significantly reduced (Figure 3-6). The inhibition of IL-12

by indomethacin was not different from that ofNS-398, suggesting the effects of

prostanoids on this cytokine are predominantly mediated by the COX-2 isoform. These

results are consistent with those of Rieser et al. (1997) who showed an increase in total

IL-12 when I-MDC are exposed to PGE2 or other compounds which increase

intracellular cAMP (Rieser et al., 1997). In marked contrast, I-MDC undergoing

maturation for 48 hours with sCD40L and IFN-y in the presence of COX-2 inhibitor,

significantly increased IL-1 2p40 production (p=O.007) and increased, but not

significantly, IL-12p70 production (p=0.068)(Figure 3-6). These findings mirror

previous studies that showed that the addition of PGE2 to cell culture suppressed IL-

12p70 production by maturing MDC (Snijders et al., 1996; van der Pouw Kraan et al.,

1995). Studies show PGE2 to be the predominant prostanoid suppressing IL-12

production. Prostacyclin had similar but lesser effects than PGE2 on secretion of IL- 12

while TBX and metabolites PGD2 had little to no effect (Figure 3-7). Collectively, these

data further demonstrate that prostanoids produced via COX-2 modulate MDC function






42















16000
rA 14000 mU IL-12p4
0- 12000
o 10000
-8000

6b6000
4000
2000
0
none C U SQ P none C U SQ P

Immature MDC Maturing MDC



Figure 3-7. Agonistlantagonist stimulation and 11-12 production in
immature and maturing MDC. C=carbacyclin, prostacyclin agonist;
U=U46619, thromboxane agonist; SQ=SQ29548, thromboxane, antagonist;
P=PGE2. Concentration of agonist/antagonist is 1 X 10-6 M. IL-12 is
expressed in pg/mill X 106 cells.























<20.8 <20.8


I-MDC


CD40L


CD4OL+IFN


* None
F-1 NS398
E2 Indomethacin


Figure 3-8. Endogenous prostaglandins do not significantly affect IL-10
production in MDC. IL-10 production measure by direct ELISA in the
presence or absence of COX inhibitors (A) I-MDC presence and absence of
NS398, (B) sCD40L matured MDC with and without Indomethacin, (C)
sCD40L/IFN-y matured MDC with and without NS398. No statistically
differences noted using paired t test.


1500

1000

500


1500

1000

500


1500

1000

500


1111,11/1"'WIZZIM, -MME 0 =MR









and markedly affect the secretion of IL- 12. However, the effect is dependent on the state

of differentiation of these cells.

IL-10 Production by MDC is Not Regulated by Prostaglandin Synthesis

Previous studies in murine macrophages demonstrated that IL-10 production in

LPS stimulated macrophages occurred through a cAMP/PGE2 dependent mechanism

(Strassmann et al., 1994). Therefore, the production of IL-10 in I-MDC and maturing

MDC was evaluated. I-MDC do not produce detectable levels of IL- 10 while M-MDC

matured with soluble sCD40L alone or with and IFN-y produce low levels that are not

significantly reduced with NS-398 or Indomethacin (Figure 3-8). These experiments do

not suggest that prostaglandins produced by MDC stimulate IL-10 production.

Furthermore, they demonstrate that prostaglandin mediated suppression of IL-12 in

maturing MDC is mediated directly by endogenous PGE2 and not through its effect on

IL-10.

Prostaglandins Do Not Significantly Affect Antigen Uptake

Finally, the ability of the maturing MDC to shut down antigen uptake in the

presence and absence of endogenously produced prostaglandins as well as exogenously

added PGE2 was measured by the MDC ability to uptake two fluorescent dyes. I-MDC

express potent ability to uptake external molecules by two main mechanism, receptor-

mediated endocytosis and macropinocytosis. Two fluorescent markers, FITC-Dextran

(FD) and Lucifer Yellow (LY) measure receptor-mediated endocytosis and

macropinocytosis, respectively. MDC that are mature decrease the ability to take up

these markers thus reducing their antigen uptake. Figure 3-9 shows the reduce capacity







45




A.


800 0 None
|M NS398

600 0 PGE2


~400


200


0
I-MDC


B.

100


75


50


25


0-M
M-MDC (TNF)


C. 100 .

]NS398
75 L PGE2


50






M-MDC (CD40L+IFN)



Figure 3-9: Endogenous and exogenous prostaglandins do not significantly
affect antigen uptake in MDC. (A) I-MDC (B) TNF-a matured MDC (C)
sCD40L and IFN-y matured MDC incubated with 1 jig/ml of FITC dextran at
37oC for 1 hour in the presence or absence of NS398 or PGE2. MFI
represents median fluorescence intensity. Similar results obtained with
Lucifer yellow (data not shown).









of M-MDC to take up FD (the higher the MFI the higher the antigen uptake) and that

endogenously produced prostaglandins as well as exogenously added PGE2 has no affect

on the maturing MDC to shut down the antigen uptake machinery.



Discussion

This is the first report demonstrating that I-MDC and M-MDC constitutively

express both cyclooxygenases, COX- 1, and the normally inducible COX-2, and

synthesize nanomolar quantities of PGE2. The predominant isoform of COX utilized to

produce prostanoids by I-MDC is COX-2. An interesting finding of this study was that

when I-MDC undergo maturation with sCD40L alone, PGE2 synthesis proceeds through

COX-1. In contrast, MDC stimulated with sCD40L in combination with IFN-y leads to

higher levels of PGE2, but production reverts back to the COX-2 pathway. The

observation that prostaglandin synthesis fluctuates from one COX isoform to the other is

not a novel finding. Previous studies demonstrated that this phenomena occurs as a

consequence of the coupling of COX isoforms to distinct PLA2 isoenzymes, e.g.

cytoplasmic PLA2 to COX-2, and linkage of apparently discrete pools of AA to either

COX-l or COX-2 (Reddy et al., 1997b). Supporting these published studies, mouse

macrophages expressing both COX-1 and COX-2 produce PGE2 only through COX-1

when AA added to cultures, whereas IFN-y stimulates only COX-2 mediated

prostaglandin synthesis.

The regulation of COX-2 expression in MDC is unlike that of the precursor

monocyte population as this cell is highly resistant to suppression by the anti-

inflammatory cytokine IL-4 and IL- 10. The reason for the marked alteration in COX-2









regulation is not apparent but may be related to the continuous presence of GM-CSF in

vitro. Another possibility is that long-term culture or long-term exposure to IL-4 may also

diminish the MDC response to this cytokine. Alternatively, studies have demonstrated

that freshly isolated monocytes were more responsive to IL-4 induced TNF-

a suppression than macrophages cultured for 7 days (Hart et al., 1995). These studies

conclude that monocyte responses to immunoregulatory cytokines such as IL-4 may not

mirror responses by their differentiated or activated counterparts (Hart et al., 1995). This

suggestion is also supported by the studies of Maloney et al. (1998) in which neutrophil

expression of COX-2 was likewise found resistant to IL-4, IL-10 and 11-13 (Maloney et

al., 1998). Therefore, the pathway of myeloid differentiation or maturation may dictate

the responsiveness of COX-2 to anti-inflammatory cytokines.

The production of prostaglandins appears to autoregulate some aspects of MDC

maturation, e.g. CD83, and function, e.g. IL-12 production by MDC. These finding show

that endogenous prostanoids generated through COX-2 in vitro do not interfere with the

expression of HLA-DR and co-stimulatory molecules on I-MDC. This result was

expected since previous studies showed that less that 10-9 M PGE2 had little effect on

these differentiation antigens for MDC. Although endogenous production of prostanoids

does not modify HLA-DR or the co-stimulatory molecules CD40, CD80, and CD86,

COX-2 produced prostanoids do markedly modulate the expression of the maturation

antigen, CD83, in sCD40L/IFN-y stimulated MDC. It appears that the threshold for

prostanoid regulation of CD83 differs markedly from that of HLA-DR and co-stimulatory

molecules. In the case of co-stimulatory molecules, cells producing higher levels of









PGE2 than MDC, perhaps macrophages, within the local environment may be required to

affect the upregulation of these molecules as previously described (Jonuleit et al., 1997).

In this study, a divergent regulation of IL- 12 by COX-2 mediated prostanoid

production is described. It demonstrates that endogenously produced prostaglandins

increase the IL-12p40 in I-MDC but do not stimulate IL-12p70 production. This

prostanoid-mediated enhancement of IL-12p40 production by I-MDC may serve to limit

the Thl immune response as IL-12 p40 homodimers function as a receptor antagonist

(Ling et al., 1995; Mattner et al., 1993). As MDC mature in the presence of IFN-y the

level of COX-2-mediated prostanoid production increases, which effectively suppresses

IL-12p70 and p40. This is in agreement with studies of others demonstrating that

addition of PGE2 to cell culture reduces IL-12 production by M-MDC (van der Pouw

Kraan et al., 1995; 1996). Thus, endogenous prostanoids appear to play an important role

in limiting the capacity of M- MDC to become a potent Thl promoting antigen

presenting cells by down regulating the production of biologically active IL-12p70 these

cells. The mechanism responsible for the interesting divergence in prostanoid-mediated

regulation of IL-12 has not been defined. However, modulation of surface or nuclear

receptors for PGE2, e.g. EPI, EP2, EP3 or EP4 could be responsible for these changes in

the response of MDC as they mature. Preliminary studies indeed suggest (Chapter 4) that

the maturation stimuli regulate EP receptors expression and this defines the response of

MDC to PGE2.

Previous reports have suggested that COX-2 is important for high level

production of prostanoids by particular cells types and is the form of the enzyme

associated with inflammation. It is of interest that when MDC are exposed to IFN-y in








culture that PGE2 production is enhanced and that COX-2 is the predominant isoform of

the enzyme used to produce prostanoids. These findings suggest that a default setting for

I-MDC and maturing MDC is to increase COX-2 mediated PGE2 production when

involved in inflammation, when acting as an antigen presenting cell for established Thl

responses, or when encountering other IFN-y producing cells, e.g. NK or NK T cells.

Under these circumstances, MDC are thus programmed, via COX-2 expression, to

suppress IL- 12 production and thus autoregulate its capacity to further stimulate ThI T

cells.

Prostaglandin production by MDC appears to play an important and focused role

in the function of MDC. From the findings of this study it appears that MDC tend to

produce lower levels of PGE2 than produced by monocytes or macrophages. The lower

level of prostaglandins produced by MDC may be of a practical importance as that these

lipid molecules work in an autocrine fashion modulating MDC function, and perhaps in

regulating T cells within their microenviroment in a paracrine fashion. Working in this

manner the effects of prostanoids would be contained and limit the untoward effects of

these molecules. In this context, determining the regulation of the prostanoid receptors on

MDC and T cells thus becomes critical to understanding the effects of these lipid

molecules on their target cells. Furthermore, the production of prostaglandin by MDC

may provide these cells with a self-contained "signal 3" as proposed by Kalinski et al.

(1999) which would polarize the MDC away from stimulating ThI responses, perhaps

more toward a Th2 promoting antigen presenting cell (Kalinski et al., 1999a). These

findings also have important implications regarding the effects of COX inhibitors,

particularly the new class of COX-2 specific drugs, on the immune response. The potent






50


anti-inflammatory action of these drugs may in part be limiting MDC maturation. These

studies also raise a potential concern regarding the possibility that COX-2 specific drugs

could potentiate Thl responses by removing the suppressive effects of prostaglandins on

IL-12 production by M-MDC. Further study in vivo is required to establish the effect of

these drugs on the biology of MDC.














CHAPTER 4
MATURATION STIMULI AND MODULATION OF PROSTAGLANDIN
RECEPTORS REGULATE THE EFFECTS OF PGE2 ON INTERLEUKIN-12
PRODUCTION BY MONOCYTE DERIVED DENDRITIC CELLS


Review of Literature

Dendritic cells (DC) are potent antigen presenting cells that express high levels of

MHC and B7 molecules and readily activate T cells. Following interaction with CD40L

expressed on T cells, DC undergo maturation further up-regulate MHC and B7 molecules

and initiate production of the cytokine IL-12p70 (Cella et al., 1996). This cytokine is

composed of covalently linked p40 and p35 subunits and is central to the development of

a Thl immune response (Trinchieri and Gerosa, 1996). However, when DC are resting

or in an immature state, they secrete only IL-12p40 as a homodimer or monomer that

functions as an IL-12p70 antagonist (Ling et al., 1995; Mattner et al., 1993). Thus, the

capacity to regulate DC production of IL-12p70 and p40 is critical to controlling the

development of Thl responses important for inflammation, transplant rejection and many

autoimmune diseases (Sutterwala and Mosser, 1999).

Prostaglandins have been identified as potent regulators of IL- 12 production by

monocyte-derived DC (MDC) (Rieser et al., 1997; van der Pouw Kraan et al., 1995;

1996). Rieser et al. showed that addition of exogenous PGE2 to MDC cultures or the

addition of compounds increasing cAMP increased total IL- 12 secretion (IL- 12p40) in

immature MDC (Rieser et al., 1997). However, when MDC are undergoing maturation,

prostaglandins and cAMP analogues (N6,02'-dibutyryl adenosine-3',5'-cycic









monophosphate) inhibit production of both IL-12p70 and p40 (van der Pouw Kraan et al.,

1995; 1996). In addition, the previous chapter indicates endogenous prostaglandin

production by MDC stimulates immature (I-) MDC cells to produce IL-12p40 while

suppressing IL-12p40 and p70 production by maturing MDC (Chapter 3). However,

when MDC are fily mature, the production of IL-12p70 and p40 becomes resistant to

the regulatory effects of PGE2. These studies suggest that activation/maturation of MDC

causes a functional transition with regard to the action of prostaglandins on IL-12

production (Kalinski et al., 1999). The factors responsible for this transition remain

largely undefined.

A potential etiology for the change in response of MDC to prostaglandins could

be modulation of its prostaglandin receptor as these cells mature. PGE2 mediates a wide

variety of cellular responses by binding to a diverse repertoire of prostaglandin receptor

subtypes on nuclear and cellular membranes. PGE2 receptors (EP 1, 2, 3, 4) are members

of the seven transmembrane rhodopsin-type G protein coupled receptors and are

pharmacologically defined. EP1 is linked to an unidentified G protein and uses Ca' as a

second messenger. EP2 and EP4 receptors are coupled to a G-protein (Gs) that signals by

stimulation of adenylate cyclase and increases in cAMP. Seven different isoforms of EP3

resulting from splice variants in the carboxyl terminals have been described. The major

effect of signaling through the EP3 is the inhibition of adenylate cyclase and decreases in

cAMP, although one isoform of this receptor increases cAMP and another mediates

responses through inositol triphosphate (Narumiya et al., 1999).

Although the effects of PGE2 on the immune response have been widely studied,

studies examining the expression of these receptors in cells of the immune system are









limited. EP4 was recently shown to upregulated in THP-1 cells with stimulation by

phorbol esters (Mori et al., 1996). Eriksen et al. (1985) described the prostaglandin E2

receptors on human peripheral blood monocytes (Kd= 1.1 X 10-9 M and 240 sites per

cell) but did not characterize the subtypes of EP receptors on these cells (Eriksen et al.,

1985). Functionally, Meja, Barnes and Giembycz (1997) showed that either EP2 or EP4

contributed to the inhibition of LPS stimulated TNF-ct production in human blood

monocytes (Meja et al., 1997). There is, however, no report of the prostaglandin receptor

expression on MDC.

In order to determine if modulation of EP receptors was responsible for the drastic

changes in PGE2 mediated regulation of IL-12 in MDC, this study examines EP receptor

expression at distinct states of maturation (I-MDC, maturing MDC, and M-MDC). The

importance of these aspects of MDC IL-12 regulation by prostaglandins is discussed.

Materials and Methods

Materials

PGE2, Butaprost, 11 -deoxyPGE 1, 19-hydroxyPGE2, Sulprostone, AH6809, and

SQ29548 were purchased from Cayman Chemical (Ann Arbor MI). AH23848B was a

gift from GlaxoWellcome (United Kingdom). Forskolin, 3-isobutyl-a-methylxanthine

(IBMX) and N6,O2'-dibutyryl adenosine-3',5'-cyclic monophosphate (db-cAMP) were

purchased from Calbiochem (San Diego, CA).

Isolation of Monocytes and Dendritic Cell Culture Conditions

PBMC were isolated from buffy coats from one unit of whole human blood using

Histopaque Ficoll (Sigma, 1.077, endotoxin tested, St. Louis, MO). Cells were washed

two times with Dulbecco's PBS (DPBS), Ca++ and Mg++ free (Cellgro, endotoxin









tested) and resuspended in RPMI 1640 media with L-glutamine (Gibco, BRL, Grand

Island, NY) supplemented with 10% fetal calf serum (Hyclone, endotoxin tested, Logan,

UT), and 1% streptomycin, penicillin. neomycin (Sigma). PBMC were allowed to adhere

for 2 hours at 370C, 5% C02, 100% humidity and non-adherent cells were washed away

with DPBS. Complete RPMI tested negative for endotoxin (<2.0 EU/ml) (E-Toxate Kit,

Sigma). Adherent cells were cultured in complete RPMI supplement with 500 U (50

ng/ml) GM-CSF (Endogen, Woburn, MA) and 500-1000 U IL-4 (R&D Systems,

Minneapolis, MN) to generate I-MDC. To generate M-MDC, day 6 I-MDC were

harvested, washed and replated at 3.0 X 105 cells/mI and supplemented with 1 jig/ml

sCD40L (gifl from Immunex, Seattle WA), and/or 1000 U of human recombinant IFN-y

(Endogen, Boston, MA). Some cultures were supplemented with NS-398 (Cayman

Chemical), a specific COX-2 inhibitor, or indomethacin (Sigma), a COX-1 and COX-2

inhibitor.

Isolation of Total RNA and Reverse Transcription

On Day 6 I-MDC were stimulated with the maturation stimulus listed above and

harvested at various time points from 2 hours to 48 hours. After stimulation, MDC were

washed with PBS and immediately frozen at -70o C. Total RNA was extracted using the

High Pure Total RNA isolation kit (Boeringer Mannhiem, Indianapolis, IN) that contains

a DNAase treatment step. Total RNA quantity was determined by UV spectrophotometry

at 260 nm. First stand cDNA was synthesized from 250 ng of total RNA with a

combination of oligo dT and random hexamers (Perkin Elmer, Branchburg, NJ ) with

Superscript II reverse transcriptase (Gibco-BRL, Life Technologies, Grand Island, NY).









Relative Polymerase Chain Reaction (PCR)

A constant volume of the reverse transcriptase reaction (1 PI) was used in a

relative semi-quantitative PCR using P-actin as internal standard control. Because the

message for the EP receptors is rare in comparison to P3-actin, primer competitors to 3-

actin were used to ensure that amplification of the endogenous standard (1-actin) was in

the same linear range as the target mRNA for EP receptors. We found that a ratio of 3:7

P3-actin primers:13-actin competitors and 30 cycles of PCR was sufficient to yield similar

linearity to the mRNA for the EP receptors. The PCR protocol was 30 cycles of 0.5 min

at 94C, 0.5 min at 580C, and 0.5 min at 720C. The primers used were as follows (size of

base pairs in parenthesis): EPI (407):5'CTTCTTGGCGGCTCTCGG. 3'

AGGGTGGGCTGGCTTAGTC, EP2 (394):5'GCTGCTGCTTCTCATTGTCTCG,

3'TCCGACACCAGAGGACTGAACG, EP3 (366):5' ACCCGCCTCAACCACTCCT,

3' CCGAAAAAGGTGCAGAGCC, EP4 (334): 5' GGTCATCTTACTCATTGCCACC,

3' AGATGAAGGAGCGAGAGTGG, P3-actin (638):5' ATCTGGCACCACACCTTCTA,

3' GTGTTGGCGTACAGGTCTTT, competititor 13-actin:

5'ATCTGGCACCACACCTTCTAAGT, 3' GTGTTGGCGTACAGGTCTTTATT (EP2

and EP4 primers (Mukhopadhyay et al., 1999)). PCR products were resolved on a 2%

agarose (FMC Bioproducts, Rockland, MN) gel with ethidium bromide added (Gibco).

Bands were quantitated by Stratagene Eagle Eye.

IL-12p40 and IL-12p70 Assays

MDC culture supernatants from various conditions were analyzed for IL-12p70

and IL-12p40 (gift from Dr. Maurice Gately, Hoffman Roche, Nutely, NJ), by ELISA as

previously described (Gately, 1999). IL-12 was standardized to pg/ml/I X 106 cells.









Measurement of cAMP Formation

The cAMP level was determined by total cAMP determination kit (Amersham).

Briefly, I-MDC or M-MDC were cultured at 5 X 105 cells/ ml in 96 well plates. Cells

were incubated at 370 C for 30 minutes in complete RPMI supplemented with 5 pM

NS398 and 10 gM IBMX. Cells were stimulated for 5 minutes with various

agonist/antagonist to the prostaglandin receptors. After 5 minutes, cells were lysed with

lysing solution provided with the kit and total cAMP by indirect ELISA was determined.

cAMP is reported in pmol/ 1 X 105 cells.

Quantitation of 3H-PGE2 Binding on I- and M- MDC

Saturation binding studies were performed as previously described (Zeng et al.,

1998). Briefly, 5 X 105 MDC were suspended in 100 p.l of binding buffer in GF/C

microtiter plates (Millipore, Bedford, MA) and incubated at 4' C for 1 hour with various

concentration (0-30nM) of 3H-PGE2 (Amersham). Plates were washed ten times with ice

cold buffer to remove non-specific binding. Filtered plates were allowed to dry for 2-24

hours and then 25 p1 of scintillation fluid was added and radioactivity counted (1450

Microbeta Wallace, Trilux liquid scintillation counter, 58% efficiency). Specific binding

was calculated by subtraction of nonspecific binding, suspensions containing 10-5M

unlabelled PGE2 (Cayman Chemical) for each concentration of 3H PGE2. Saturation

data were analyzed by PrismGraphpad. Competitive binding studies were performed

exactly the same as described above except 109M -I 0'4M of unlabelled selective agonists

were employed.









Results

PGE2 Regulates IL-12 in I-MDC Through EP2 and EP4 Receptors

I-MDC were cultured with defined concentrations of PGE2 and secretion of IL-

l2p4O and IL-12 p70 were analyzed by ELISA after 48 hours. Because we previously

showed that MDC produce endogenous prostaglandins, particularly PGE2, we performed

this experiment in the presence of a cyclooxygenase-2 (COX-2) specific inhibitor, NS-

398. As seen in Figure 4-la, the cyclooxygenase-2 specific inhibitor NS-398 decreases

IL-12p40 production by I-MDC and replacement with nanomolar concentrations of

PGE2, equivalent to the level of prostaglandin produced spontaneously by these cells,

restores IL-12p40 production to baseline. As reported, we found that I-MDC do not

produce IL-12p70. However, I-MDC do produce IL-12p40 which is increased in a dose

dependent fashion when these cells are cultured in increasing concentrations of PGE2

(Figure 4-la). Previous reports suggested that PGE2 stimulates IL-12 production through

the activation of adenylate cyclase (Rieser et al., 1997). Indeed, this experiment shows

PGE2 readily stimulates cAMP in I-MDC (Figure 4-lb.). In addition, when I-MDC are

cultured with db-cAMP, IL-12 p40 secretion is increased to a similar degree as with

106M PGE2 (figure 4-1c; 2 and 3). These results suggested that EP receptors that

increase cAMP, most likely EP2 and/or EP4, may play a role in regulation of IL-12p40

production. To evaluate this possibility we assessed the effects of EP2, EP2/4 and EP3

specific agonists on IL-12 production in vitro. At the present time no EPI or EP4 specific

agonists are available. We find that the EP3 agonist had no effect on IL-12p40 production

(Figure 4-1 c;4). However, agonists that stimulate either the EP2 receptor (butaprost and

19-hydroxy PGE2) or both EP2 and EP4 (1 ldeoxy PGE1) stimulate IL-12p40 production



















4000- 3
3500 - 25
3000
2500 2
2000-
S1500 0
1 1000-
500
all~ 0 5
0 NS PGE2 PGE2 PGE2 PGE2 0


I0-9M 10-8M 10-7M ICOM
B.
1000 ....

750-
S5oo
6 250


z $


9


1 2 3 4 5 6 7 8 9

1 None
2 PGE2
3 cb-cAMP
4 SUiprostone
5 lldeoxyPGE1
6 19-hyodryPGE2
7 Butaprost
8 AH23848 + Butaprost
9 AH6809 + Butaprost


Figure 4-1: L-12 and cAMP production after stimulation with PGE2 or
prostaglandin receptor agonist in immature monocyte derived dendritic
cells. (A) Immature-MDC were stimulated 48 hours with increasing doses
of PGE2 in the presence of NS398, a specific COX-2 inhibitor.
Supernatants were harvested after 48 hours and IL-12p40 and IL-12p70
measured. IL-12p40 expressed in pg/ml/l X 106 cells. No IL-12p7O
detected.(B) Total cAMP production measured in I-MDC in the presence
of NS398 and IBMX, a PDE inhibitor, after 5 minute stimulation. Total
cAMP reported in fmol/1 X 105 cells. (C) IL-12 production in I-MDC after
48 hours with the agonist/antagonist 1-9: Sulprostone, EP1/EP3 agonist;
11 deoxyPGE 1, EP2/EP4 agonist; 19hydroxyPGE2 and Butaprost, EP2
agonist; AH23848, EP4 antagonist; and AH6809, EP2 antagonist. Data are
representative of at least three experiments and are presented as fold
changes from baseline of no agonist/antagonist added.


A


A









(Figure 4-1c; 5-7). Butaprost stimulation achieves approximately 60% of the IL-12p40

levels stimulated by PGE2 and the specificity is demonstrated by the EP2 specific

antagonist AH6089 that totally blocks this effect. The addition of the EP2/4 agonist

1 Ideoxy PGEI stimulates levels of this cytokine nearly identical to that of PGE2. These

results suggest that both EP2 and EP4 receptors are involved in mediating the effects of

PGE2 on IL-12p40 production with the EP2 receptor mediating the majority of the

effects of PGE2 on IL-12 production in I-MDC.

Because antibodies are not available to human EP receptors, mRNA expression of

these receptors on I-MDC was performed by a semi-quantitative competitive RT-PCR

assay using primer sequences for human EP1, 2, 3, and 4 (Mukhopadhyay et al., 1999).

I-MDC do not express mRNA for EPI and express very low levels of transcript for EP3

receptors (data not shown). I-MDC predominantly express mRNA for EP2 with lower

levels of EP4 message detected (Figure 4-2).

To evaluate the expression of the PGE2 receptors on I-MDC, saturation binding

studies using 0-30 nM 3H-PGE2 in the presence and absence of 1000-fold excess of

unlabeled PGE2 was employed. Figure 4-3a shows the saturation binding curves and

Figure 4-3b, the Scatchard transformation of the saturation binding data using Graphpad

Prism software. These studies reveal that I-MDC express 1087 binding sites per cell with

a Kd=3.2X10'M. To determine the relative expression of EP receptor subtypes on I-

MDC, competitive binding assays employing 3H-PGE2 and unlabeled EP specific

agonists were performed. As seen in Figure 4-3c-f, 3H-PGE2 is not displaced by

SQ29548, a thromboxane agonist and a negative control for EP receptor binding.

However, 1 Ideoxy PGE1, a combined EP2/4 agonist, displaces almost 100% of PGE2






60













A. C.
0.9
0.8
.S 0.7
U 0.6
Ca 0.5
B. 0 0.4
0.3
0.2
0.1
0
Immature MDC




Figure 4-2: EP2 and EP4 mRNA production in immature monocyte derived
dendritic cells. RT-PCR performed on day 6, I-MDC by semi-quantitative,
relative PCR exactly as described in Materials and Methods. (A) 03 actin (638
base pairs) and EP2 (394 base pairs). (B) 03 actin (638 base pairs) and EP4
(334 base pairs). (C) Graphic representation of ratio of EP2 and EP4 to 13 actin
as quantitated by band density on Stratagen Eagle Eye.









binding at 104M, while butaprost, an EP2 specific agonist, competes with PGE2

displacing over 60% of this ligand at a concentration of 104M. Finally, sulprostone, an

EPI/ EP3 agonist, displaced little PGE2 in these studies. These binding studies are

consistent with data from the RT-PCR and EP2, EP2/4 and EP3 agonist studies and

suggest that I-MDC express predominantly EP2 and EP4 receptors that mediate the

effects of PGE2 on IL-12p40 production.

EP2 Receptors Mediate the Suppressive Effects of PGE2 on IL-12p70 Production by

Maturing MDC

Studies by our laboratory and others (Hilkens et al., 1997) suggested that I-MDC

undergoing maturation with CD40L/IFN-y produce IL-12p70 and p40, however, in

contrast to I-MDC, PGE2 now suppresses production of both molecules. In order to

establish whether modulation of EP receptors is responsible for the switch in the effect of

prostaglandins, we repeated the RT-PCR analysis of EP receptors and agonist studies as

described above. First, various specific agonists were added to the culture of maturing

MDC and IL- 12p70 and IL-1 2p40 was measured in the supernatants. IL- 12p7O (Figure

4-4) and IL-12p40 (data not shown) were completely suppressed by EP2 agonists and this

effect was blocked by the addition of the EP2 antagonist (see figure 4-4, 6-9). These data

strongly argue that the EP2 receptor is dominant in regulating IL-12 production in

maturing MDC. To assess EP receptor expression in maturing MDC, I-MDC were

cultured in the presence of CD40L and IFN-y and harvested mRNA at 2, 4, 24 and 48

hours and relative RT-PCR performed. Again, we could not detect mRNA expression for

EP1 and only low levels of EP3 receptor transcripts were detected in maturing MDC at

any of the time points analyzed (data not shown). However, EP2 mRNA expression
















150


8.100

50


0 10 20 30 40
concentration of 3H PGE2 (nM)


B. 0.12

0.1


0.06
0.04


0.02
0
0 500 1000
Bound


120
100
80
60
40
20
0

E.
120
100
80
60
40
20
0


I1I deoxy PGEI

__PGE2







o 10-9 1o-9 10-7 10.6 10-' 104~


Butaptust
PGE2


0 10-9 10-9 0-' 10-6 10-5 10-4










0E2 1 1
0 10-9 10-8 10-7 10-6 10.5 10.4


20 ESQ29548 I
PGE2 I
0
0 t0-9 10-8 10-7 10-6 10-5 10-4
Figure 4-3: Saturation binding curves, Scatchard analysis, and competitive
displacement in I-MDC. (A) Specific binding of 3H PGE2 to I-MDC.
Specific binding calculated by subtracting non-specific binding, 3H PGE
bound with 1000 fold excess of unlabeled PGE2, from total binding. (B)
Scatchard transformation of saturation binding curve by GraphPad Prism.
Bmax = 1076 sites per cells, Kd=3.2 X 1010 M. Data are respresentative of
three donors. Competitive displacement of specific 3H PGE2 binding (C)
11 deoxyPGE 1, EP2/EP4 agonist (D) Butaprost, EP2 agonist (E) sulprostone,
EP1iEP3 agonist and (F) SQ29548, Thromboxane receptor agonist used as a
negative control.









declined 50% over a period of 24 hours from that of the baseline I-MDC. Meanwhile,

transcripts for EP4 increased rapidly within hours of stimulation and peaked almost three-

fold above baseline at 48 hours of culture when the MDC is fully mature (Figure 4-4b-d).

The dominance of the EP2 receptor control of IL-12p70 production was difficult to

reconcile with the EP2 receptor mRNA data as it was substantially reduced during the

culture period. We evaluated the possibility that the addition of PGE2 sustains the

mRNA expression of the EP2 receptor. However, the RT-PCR analysis for the EP2

receptors following culture in PGE2 did not substantiate this (data not shown). These

findings may be reconciled, however, if EP2 receptors are stable despite decreased

transcription. Another explanation may reside in the fact that over 75% of IL-12p70 is

produced within the first 24 hours of culture by maturing MDC (Figure 4-4e). Therefore,

the presence of higher levels of the EP2 receptors early in the culture period is critical.

These studies suggest that there are changes in the dominance of EP receptor, with the

EP2 receptor playing the major role in maturing MDC while both EP2 and EP4 are

important for I-MDC. However, the regulatory outcomes of PGE2 on IL-12 (e.g. up-

regulation in I-MDC with down-regulation in maturing MDC) are largely governed by

the maturation stimulus or by molecular changes that occur as a result of maturation.

Fully Mature MDC Express EP4 Receptors But IL-12 Production is Insensitive to

the Regulatory Effects of PGE2 and cAMP

Because IL-12p70 production by M-MDC is reported to be resistant to the effects

of PGE2, the regulation of this cytokine by EP specific agonists was evaluated. M-MDC

were generated from I-MDC after 48 hours of culture with CD40L/IFN-y. For the next

48 hours these cells were exposed to the same series of EP agonists as were immature and







64




A. B
1.25



o 0.5
jj Hours 0 4 24 48
2 3 C
1 2 3 4 5 6 7 8 9


1 None
2 PGE2
3 db-cAMP
4 Sulprostone
5 1ldeoxyPGE1
6 19-hydroxyPGE2
7 Butaprost
8 AH23848 + Butaprost
9 AH6809 + Butaprost


Hours 0 4 24 48
D 1.2 -~ ~EP2

S0.8
0 0.6
j 0.4
0.2
0
0 20 40 60
Hours
E
5000
4000


00
r2000 7 E


EL=


0 4 24 48
Hours

Figure 4-4: IL-12p7Osecretion and mRNA expression of EP2 and EP4
by relative RT-PCR in I-MDC matured with sCD40L and IFN-y. (A)
Immature-MDC were stimulated with sCD40L and IFN-y in the presence
of NS398 and various agonist listed 2-9. Forty-eight hours after
stimulation, IL-I2p7O and IL-12 p40 were measured (IL-12p40 gave
similar pattern of results, data not shown). Data are representative of at
least three donors and presented as fold changes from sample with no
agonist/antagonist added. Semiquantiative RT-PCR with 03 actin as
internal standard (638 base pairs) at 0, 4, 24, and 48 hours (B) EP2
(lower band 394 base pairs) (C) EP4 (lower band 334 base pairs). (D)
Graphic representation of EP2 and EP4 mRNA ratio to 03 actin mRNA
over a 48 hour period. (E) IL-12p70 production measured at identical
time points and expressed in pg/ml/ I X 106 cells.









maturing MDC. In stark contrast to the previous studies with less mature MDC, the fully

mature MDC were insensitive to PGE2, EP2, EP3 and EP2/4 agonists (Figure 4-5a;5-7.).

Additional studies indicated that these cells produced little cAMP in response to PGE2 or

even forskolin (Figure 4-5b) suggesting a modification of EP receptors, adenylate cyclase

activity or an increase in phosphodiesterase (PDE) activity. The latter would not appear

to be the cause since IBMX, a global PDE inhibitor was present throughout the cAMP

experiments.

To evaluate EP receptor expression on the fully mature MDC, once again RT-

PCR for the EP receptors and binding studies were performed to determine cell surface

receptor density and subtypes. Analysis of EP receptor mRNA expression indicated a

marked upregulation of EP4 message in comparison to I-MDC and a down-regulation of

EP2 message (Figure 4-4; 48 hour time point). Again, very low levels of transcripts for

EP3 were found and EP I was not expressed. Binding studies indicated that fully matured

MDC express 30% fewer EP receptors than do I-MDC and have a Kd of 7.7 X 10"'0M

(Figure 4-6a). Competitive binding studies suggest that the EP2 receptor is substantially

reduced and that of EP4 is increased (Figure 4-6c-f). These changes in

EP receptor expression could account for some of the reduced generation of cAMP as the

EP2 receptors stimulates larger cAMP increases in comparison to EP4 receptors. In

addition, we found a minimal response to forskolin (see figure 4-5a) suggesting

decreased adenylate cyclase activity, or enhanced phosphodiesterase activity in fully

mature MDC as a contributing cause for reduced cAMP generation. Finally,

compounding the effects of receptor modulation and reduced capacity to generate cAMP,

these experiment show that fully mature MDC IL- 12 production was insensitive to db-





























I 2 3 4 5 6 7


1 None
2 PGE2
3 db-cAMP
4 Sulprostone
5 1ldeoxyPGE1
6 19-hydroxyPGE2
7 Butaprost
8 AH23848 + Butaprost
9 AH6809 + Butaprost


o1000 -
0o
750
0500


0


8 9


Figure 4-5: IL-12 and cAMP production in fully mature MDC after
stimulation with prostaglandin receptor agonist. Day 6 I-MDC were
stimulated with sCD40L and IFN-g for 48 hours. M-MDC were harvested,
washed, replated and restimulated with sCD40L/IFN-y and the various
agonist/antagonist 2-9. Data are representative of at least three donors and
presented as fold changes in IL-12p7O levels from baseline (no
agonist/antagonist added). (B) Total cAMP was measured in MDC
matured for 48 hours in sCD40L and IFN-y stimulated for 5 minutes with
PGE2, sulprostone, or forskolin in the presence of NS-398 and IBMX.
cAMP is reported in fmol/1 X 105 cells.


A
1.25


0.75
S0.5
0.25











A.
120
100
80
. 60
40
20
0



B.
0.04
0.04
0.03.

002
'0.01
0.0
0.00


0 10 20 30
concentration of 3H PGE2 (nM)


5
!4

5

2
5
5 -

0 200 400 600 800 1000 1200
Bo"nd


40















4


F.
120
100
80
60
40
20
0


- I I deoxy PGE1

- PGE2


0 10-9 10-8 10-7 10-6 10-5 104









Suprostone
PGE2

o 10-9 10-8 10-7 10-6 10-5 10-4


0 10-' 108 10.' 10-6 10-5 104
Figure 4-6: Saturation binding curves, Scatchard analysis, and competitive
displacement in M-MDC. (A) Specific binding of 3H PGE2 to I-MDC. Specific
binding calculated by subtracting non-specific binding, 3H PGE bound with 1000
fold excess of unlabeled PGE2, from total binding. (B) Scatchard transformation
of saturation binding curve by GraphPad Prism. Bmax = 766 sites per cells,
Kd=7.7 X 1O M. Competitive displacement of specific 3H PGE2 binding (C)
11 deoxyPGE1, EP2/EP4 agonist (D) Butaprost, EP2 agonist (E) sulprostone,
EP1/EP3 agonist and (F) SQ29548, Thromboxane receptor agonist used as a
negative control.


0 10-9 10 10-7 10-6 10-5 10-1









cAMP (see figure 5a). These data suggest a series of modifications in components of the

regulatory signaling pathway used by PGE2 (e.g. receptor expression, cAMP generation

or stability, and cAMP sensitivity).

Discussion

These studies clearly point out differential regulation of IL-12 in MDC by

prostaglandins at three distinct phases of their development, I-MDC, MDC undergoing

maturation and fully M-MDC. They also for the first time characterize EP receptor by

mRNA expression, prostaglandin binding and modulation of these receptors during the

maturation of MDC. Collectively, these data provide a more complete understanding as

to: 1) which EP receptors regulate IL-12 production, 2) how the divergent regulatory

effects of PGE2 on IL-12 production are partially dictated by the dominant effect of EP2

receptors, 3) how modifications in several components of PGE2 signaling pathways

ensure resistance of IL-12 to this eicosanoid or other compounds that increase cAMP,

and 4) how the maturation stimulus ultimately governs the effect of prostaglandins on IL-

12 production.

This study demonstrates for the first time the repertoire of EP receptor expression

on human I-MDC. Based on competitive displacement studies I-MDC express EP2>

EP4>>EP3 and these cells respond to PGE2 and EP2 and EP2/4 agonists by increasing

the secretion of IL-12p40 with no IL-12p70 production. Stimulation of I-MDC with

PGE2 or selective EP2 or EP2/4 agonists (data not shown) confirms that these

eicosanoids utilize cAMP as a second messenger to mediate increases in IL-12p40. This

is consistent with published results indicating that both EP2 and EP4 are G proteins that

stimulate adenylate cyclase and increase cAMP (Blaschke et al., 1996). The results from









our study of I-MDC and IL-12 regulation are in complete agreement with Rieser et al.

(1997) who found an increase in total IL-12 when I-MDC were stimulated with PGE2,

forskolin, or db-cAMP (Rieser et al., 1997). The up-regulation of the IL-12p70

antagonist, IL-12p40 by PGE2 suggests that the presence of these lipid mediators may

initially limit the generation of Thl responses, or in pre-existing responses where I-MDC

may be recruited, would limit this type of immune response. Recent publications indeed

suggest that one of the actions of prostanoids is to down-regulate established

inflammation (Betz and Fox, 1991; Snijdewint et al., 1993; van der Pouw Kraan et al.,

1995).

The maturing MDC is complex with regard to PGE2 regulation of IL-12p70. The

addition of 10-6 M PGE2 from the inception of culture or when added up to four hours

after application of the maturation stimulus completely suppresses IL-12p70 production

by maturing MDC (Jonuleit et al., 1997; Kalinski et al., 1997). This study determined

that PGE2 suppression of IL- 12p7O is mediated through the EP2 receptor and its second

messenger cAMP. This regulation is somewhat perplexing as transcripts for EP2 are

down-regulated by 24 hours and the majority of EP2 binding is lost 48 hours after

application of the maturation stimulus. However, we find that 75% of the IL-12p70

produced by maturing MDC during a 48-hour culture is made in the first 24 hours.

Therefore, the continued presence and function of EP2 receptors in the early culture

period would be most critical for regulation of this cytokine.

When fully mature, MDC become highly insensitive to the effects of PGE2. We

found that maturation with CD40L/IFN-y modified M-MDC several components of the

signaling pathway utilized by PGE2 to mediate suppression IL-12p70. First, this









maturation stimulus resulted in a decrease in mRNA for EP2 receptors while mRNA for

EP4 receptor increased. In conjunction with these changes, PGE2 stimulation of M-

MDC led to minimal increases in cAMP in comparison to much larger responses in I-

MDC which express both EP2 and EP4 receptors. The limitation in cAMP production

following PGE2 exposure in M-MDC may be explained by the modulation of EP2 and 4

receptors as the latter produce lower levels of cAMP when stimulated by prostaglandin

binding compared to EP2 receptors (Choung et al., 1998). Another explanation for

decreased cAMP responses in M-MDC could be related to the described short-term

agonist induced desensitization that occurs with the EP4 receptor (Bastepe and Ashby,

1999; Nishigaki et al., 1998). In addition to these changes M-MDC also become

insensitive to cAMP since db-cAMP no longer suppresses IL- 12p7O. The reasons for this

loss of response have not been determined, but could be related to a loss of function of

specific isoforms of protein kinase A. Overall, these data suggest several components of

the prostaglandin signaling cascade are modified during maturation such that IL-12p70

production is now highly protected from PGE2 or other compounds which generate

cAMP down- regulation. This feature of M-MDC may help to maintain Thl immune

responses until such time as these cells are removed or I-MDC replenish M-MDC and

maturation stimuli.

In conclusion, these studies further define how PGE2 exerts diverse effects on the

regulation of IL-12 in MDC at various stages of development. Because IL-12 is critical

for Thl responses, these findings have important implications for creating approaches to

control Thl immune responses and Thl mediated-autoimmune diseases using agents such

as cyclooxygenase inhibitors and selective prostaglandin receptor agonist or antagonists.









Prostaglandin receptor agonists that mediate a desired response such as decreasing

secretion of IL-12p70 (e.g. butaprost) could result in desired cellular responses without

unwanted affects. Given the results of this study, timing the application of these agents

(e.g. early, when MDC are immature or maturing, and/or using agents such as anti-CD40

antibody to block maturation) may be critical for reducing IL-12 production. Further

study is needed, however, in order to determine the effects of EP agonists or Cox-2

inhibitors alone or in combination with others to modify immune responses in the desired

manner.














CHAPTER 5
GENERATION OF PHENOTYPICALLY AND FUNCTIONALLY NORMAL
MONOCYTE DERIVED DENDRITIC CELLS FROM SUBJECTS AT HIGH RISK
FOR AUTOIMMUNE INSULIN DEPENDENT DIABETES


Review of Literature

Autoimmune insulin dependent diabetes (IDD) results from a cell mediated

response that destroys the insulin producing cells of the pancreas. Although T cells are

critical to the pathogenesis of IDD, macrophages (MI)) and dendritic cells (DC),

professional antigen presenting cells (APC), are major contributors because the initiation

of the autoimmune process begins with the presentation of 0 cell specific antigens to

autoreactive CD4+ T cells as well as the important role of DC in tolerance. Defects in

the stimulatory capacity of APC may promote autoimmune disease by deficient

generation of regulatory cells or by impaired antigen presentation that leads to

accumulation of autoreactive T cells.

Recently, Litherland et al. (1999) reported that freshly isolated monocytes from

subjects at high risk for IDD aberrantly express cyclooxygenase-2 (COX-2 or

prostaglandin synthase-2, PGS-2). This abnormal expression results in high levels of

prostaglandin E2 (PGE2) (Litherland et al., 1999). Prostaglandins, especially PGE2,

have diverse effects on the immune response. PGE2 modulate T cell activation by down

regulation of IL-2 production and expression of CD25 (a chain, high affinity IL-2

receptor) while promoting Th2 associated cytokines IL-4 and IL-5 (Betz and Fox, 1991;

Katamura et al., 1995). Additionally, PGE2 down regulates IL- 12p70 production but









increases the immunostimulatory capacity of DC further modulating the response. In

1997, Kalinski et al. (1997) reported that exogenous PGE2 added to cultures of

monocytes differentiating into DC affected the ability of the monocyte derived dendritic

cell (MDC) to express CD 1 a and secrete IL-12 (Kalinski et al., 1997). Additionally,

Jansen et al. (1995) found that MDC from subjects with clinical IDD had reduced

clustering with autologous and allogeneic T cells as well as reduced activation of

autologous and allogeneic mixed lymphocyte reaction (MLR). Takahasi, Honeyman, and

Harrison (1998) reported that MDC from subjects at high risk for IDD had reduced

expression of co-stimulatory molecules, CD80 and CD86, and impaired antigen

presentation as measured by autologous and allogeneic MLR (Takahashi et al., 1998).

Because of the aberrant expression of COX-2 in peripheral blood monocytes of

subjects at risk for IDD, the publish abnormalities in clustering and T cell activation of

MDC in subjects with IDD, and the affects of PGE2 on MDC differentiation, this study

was designed to answer the question, does abnormal COX-2 expression in subjects at risk

for IDD impair MDC differentiation? Additionally, this study expands on previously

published data by examining the surface marker expression, antigen uptake, cytokine

production and activation of T cells by immature MDC (I-MDC) as well as MDC

matured with TNF-a or soluble trimeric CD40L (sCD40L) in subjects at high risk for

IDD compared to normal health controls. Using an established method for differentiating

DC from monocytes (Sallusto and Lanzavecchia, 1994), this study shows in vitro

generation of phenotypically and functionally normal MDC from subjects at high risk for

IDD when compared to normal controls. These results may have important clinical

relevance in recently proposed immunotherapy or vaccination for prevention of diabetes.









Materials and Methods

Subjects

Heparinized whole blood was collected from informed consented subjects (IRB

#372-96) participating in the University of Florida subcutaneous Insulin Diabetes

Prevention Trial (SQ), the Natural History of Diabetes Trial (NH) and the Diabetes

Prevention Trial (DPT). Because each study had different criteria for entry, subjects

were assigned risk based on the results of islet cell antibody (ICA), glutamic acid

decarboxylase antibody (GAD), insulin antibody (IAA), results of first phase insulin

response (FPIR) to intravenous glucose tolerance test (IVGTT), and genetic screening for

the protective HLA allele DQ0602. Subjects confirmed positive for ICA and an

abnormal (low) FPIR are designated high risk (HR) while subjects with a positive ICA

and IAA with a normal FPIR are moderate risk (MR). Subjects with positive ICA,

negative IAA and a normal FPIR are considered low risk (LR). Subjects positive for

protective allele DQ0602 or who are repeat negative for ICA are not eligible and

considered not at risk (NR). Heparinized whole blood from normal healthly controls was

collected on the same days as blood from the subjects. Some normal control had a family

history of autoinimune disease but either tested negative for ICA or had the protective

allele DQ0602 and are considered NR.

Isolation of Monocyte and MDC Culture Conditions

Peripheral blood mononuclear cells (PBMC) were isolated from heparized whole

blood from subjects and controls using Histopaque Ficoll (Sigma, 1.077, endotoxin

tested, St. Louis, MO). Cells were washed two times with Dulbecco's PBS (DPBS), Ca'

and Mg++ free (Cellgro, endotoxin tested) and resuspended in RPMI 1640 media with L-









glutamine (Gibco, BRL, Grand Island, NY) supplemented with 10% fetal calf serum

(Hyclone, endotoxin tested, Logan, UT), and 1% streptomycin, penicillin, neomycin

(Sigma). PBMC were allowed to adhere for 2 hours at 37C, 5% CO2, 100% humidity

and non-adherent cells were washed away with DPBS. Complete RPMI tested negative

for endotoxin (<2.0 EU/ml) (E-Toxate Kit, Sigma). Adherent cells were cultured for 6

days in complete RPM! supplement with 500 U (50 ng/ml) GM-CSF (Endogen, Woburn,

MA) and 500-1000 U IL-4 (R&D Systems, Minneapolis, MN) to generate I-MDC

(Sallusto and Lanzavecchia, 1994). To generate M-MDC, day 6 I-MDC were harvested,

washed and re-plated at 3.0 X 105 cells/ml and supplemented with 50 ng/ml of human

recombinant TNF-a (Endogen) or 1 jtg/ml sCD40L (gift from Immunex, Seattle WA).

Some cultures were supplemented with 5 IM NS-398 (Cayman Chemical, Ann Arbor,

M!), a specific COX-2 inhibitor.

Flow Cytometry for Surface and Internal Proteins

The following monoclonal antibodies directed against surface or internal proteins

were used: CD 14, HLA-DR (clone L243, Becton-Dickinson, San Jose, CA or clone

Ti36, Pharmingen, San Diego, CA), CDla, CD86, CD80, CD40 (Pharmingen), CD83

(Coulter-Immunotech, Miami, FL), and COX-2 (Cayman Chemical). Appropriate

fluorochrome labeled isotype control antibodies were used. Cells were suspended in PBS

with 1% BSA (reagent grade, Sigma) and 0.1% Sodium Azide (Sigma). For surface

marker labeling, cells were incubated with I jig of fluorochrome conjugated antibody/1 X

106 cells for 20 minutes at room temperature, then washed one time with 2.0 ml of PBS

and resuspended in 500 lil of 1% formaldehyde in PBS. Intracellular labeling of COX-2









was performed as previously described (Litherland et al., 1999). All cells were analyzed

on Becton-Dickinson FACSCalibur or FACSort.

Autologous and Allogeneic Mixed Lymphocyte Reaction (MLR)

MDC were washed and replated at various concentrations in 96-well plates.

Autologous or allogeneic nylon wool purified T cells were added at 1.5 X 105 cells/well.

Each condition was performed in triplicate. Proliferation was measure on day 5 by a 16-

hour pulse with [3H] Thymidine (1 pCi/well, Amersham Life Sciences, Arlington

Heights, IL). Some autologous MLR were supplemented with GAD, tetanus or insulin

peptide to measure specific T cell responses.

Measurement of 1L-12 and Prostanoids

Supernatants from cultures of MDC were harvested for analysis of PGE2 and IL-

12. I-MDC were cultured for 6 days, washed from the plate, counted and re-plated at 3 X

105 cells/ml in media containing GM-CSF and IL-4. I-MDC were cultured for an

additional 48 hours before supematants were harvested for analysis. Supernatants from

maturing M-MDC, were prepared by harvesting I-MDC on day 6, re-plating these cells at

the same density in media containing GM-CSF, IL-4 and maturation stimuli. Cells were

cultured for an additional 48 hours and then supernatants harvested. MDC culture

supernatants from various conditions were analyzed for IL-12p70 and IL-12p40 (gift

from Dr. Maurice Gately, Hoffiman Roche, Nutely, NJ), by ELISA in duplicate as

previously described (Zhang et al., 1994). The lower limit of IL-12p40 and IL-12p70

detection in this assay is 15.6 pg/ml. PGE2 and thromboxane were measured by

competitive enzyme immunoassay (Cayman Chemical). IL- 12, PGE2 and thromboxane

values were standardized to pg/ml/1 X 106 cells.









Measurement of Endocytosis

Mannose receptor-mediated endocytosis was measure by the cellular uptake of

FITC-Dextran ( FD, 40,000 MW, Molecular Probes, Eugene, OR) and quantitated by

flow cytometry (Sallusto et al., 1995). Approximately 1.5 X 10 5 MDC were incubated

in complete RPMI with 25 mM Hepes and 1 mg/ml of FITC-Detran for 1 hour at 0 C

and 37C. After 1 hour, cells were washed 4 times with ice-cold IX PBS with 0.1%

Sodium Azide and immediately tested on the flow cytometer (Becton-Dickinson

FACSCalibur, San Jose, CA). Fluid-phase endocytosis by macropinocytosis was

measured by cellular uptake exactly as described for uptake of FD except 1 mg/mI

Lucifer Yellow (LY, dipotassium salt, Molecular Probes) was used. Mean fluorescent

intensity (MFI) of 370C 0C was used to evaluate antigen uptake during different

maturation states of MDC.

Statistical Analysis

Surface marker expression data were statistically evaluated by analysis of

variance with log transformation. All other data were evaluated using two-tailed

Student's t test or pair t test as indicated in the table legends. Level of statistical

significance was set at p < 0.05.

Results

Table 5-1 details the demographics of the study set including the sex, age (mean

and range) and risk of normal controls and subjects with risk for IDD. Table 5-2 shows

the statistical summary for the surface markers used to distinguish DC in I-MDC and

table 5-3 shows the summary for I-MDC matured for 48 hours with sCD40L, a in vitro T

cell mimick. No statistical difference was noted for percent of cells positive (I-MDC
















Table 5-1: Demographics of study participants.


Number Age Sex RiskA
Total Sampling, Mean Range Female Male NR LR MR HR Diabetics
Controls 31 126 30.4 11 -47 12 19 31 0 0 0 0
Subjects 86 167 22.9 4-76 42 44 11 37 15 19 4

^ NR= not at risk, LR = low risk, MR= moderate risk, HR= High risk based on criteria listed
in Materials and Methods.


















Table 5-2: Phenotypic marker expression in I-MDC from normal controls and
subjects at risk for IDD.






Variable n Control Subject pA
CDla percent 24 82.8 70.5 0.1334
CD14 percent 24 14.1 13.5 0.8561
CD40 percent 14 95.5 92.2 0.2332
CD80 percent 16 49.0 36.3 0.4538
CD83 percent 8 5.4 3.6 0.7342
CD86 percent 16 44.9 45.3 0.6903
HLA-DR surface percent 26 91.7 86.5 0.3842
COX-2 percent 16 63.8 51.5 0.4016

CDla MFI 24 118.0 106.0 0.7419
CD14 MFI 24 24.0 23.0 0.9718
CD40 MFI 14 68.8 55.6 0.6313
CD80 MFI 16 26.1 24.3 0.7755
CD83 MFI 8 4.7 7.8 0.2571
CD86 MFI 16 45.1 45.5 0.9165
HLA-DR surface MFI 26 178.9 258.6 0.6899
COX-2 MFI 16 29.9 28.8 0.9595


^ No statistically significant differences were noted between the
two groups measured by the analysis of variance with log
transformation.









only) or mean fluorescence intensity (MFI) as measured by flow cytometry and analyzed

by analysis of variance with log transformation. Because of the small study size,

statistical analysis between risk groups was not possible.

Because of the importance of MHC molecules in T cells activation and the

reported association of HLA haplotypes and IDD, surface and total HLA-DR for I-MDC

and I-MDC matured with TNF-a for 48 hours in the absence and absence ofNS398 are

shown in Table 5-3. Initially, a difference was noted in the MFI of total HLA-DR for

TNF-a stimulated I-MDC (in the presence and absence ofNS398) using the Tu36

antibody. This difference could not be substantiated with a different HLA-DR clone,

L243. Both clones of antibody are documented to bind to the non-polymorphic region of

the a and P chains of human HLA-DR. HLA-DR is a known risk factor for IDD. It is

possible that the Tu36 antibody does not bind as well as L243 to HLA-DR molecules

associated with risk to IDD. The HLA-DR types for participants of the DPT are not

known; therefore, preferential binding to specific HLA molecules could not be

investigated at this time.

High levels of PGE2 (10-6M) inhibit the ability of the MDC to secrete IL-12. This

study evaluated the spontaneous production of PGE2 in I-MDC and the secretion of IL-

12 in I-MDC and I-MDC matured with TNF-a of subjects at high risk for IDD and

normal controls. The results are summarized in Table 5-5. The ability to uptake antigen

by receptor-mediated mechanisms by I-MDC as well as the ability to shut down the

antigen uptake machinery in M-MDC was investigated. No differences noted in I-MDC

or M-MDC (Table 5-6). Finally, MDC from subjects at risk for IDD and normal controls























Table 5-3: Phenotypic marker expression in M-MDC matured with sCD40L
from normal controls and subjects at risk for IDD.


Variable n Control Subject p A
CDla MFI 8 48.1 26.8 0.16
CD80 MFI 8 49.4 41.1 0.48
CD83 MFI 8 146.2 157.4 0.82
CD86 MFI 8 681.3 600.5 0.63
HLA-DR surface MFI 8 2141.2 2064.0 0.97

^ No statistically significant differences were noted between
the two groups measured by the analysis of variance with
log transformation.






















Table 5-4: Mean Fluorescent Intensity comparisons of Surface and
Total HLA-DR in I-MDC and I-MDC stimulated with TNF-a normal
controls and subjects at risk for IDD.


L243 Tu36
n Control Subjects p" n Control Subje p"
I-MDC Surfice 10 237.2 257.6 0.7522 14 49.4 323 0.4216
I-MDC Total 10 912.2 1042.2 0.7007 14 181.1 92-3 0.1148
I-MDC/NS Surfce 10 269.0 257.0 0.9155 14 33.1 33.3 0.9906
I-MDC/NS Total 10 818.2 941.8 0.5736 14 125.3 71.9 0.1394
I-MDC+TNF Surfae 12 671.5 904.5 0.1740 18 78.8 43.2 0.1068
I-MDC+TNF Total 12 2211.0 1739.5 0.3771 18 423.4 169.6 0.0151*
I-MDC+TNF/NS Surfce 10 657.6 775.2 0.5473 14 93.5 47.1 0.0932
I-MDC+TNF/NS Total 10 20%.2 1683.4 0.3933 14 339.1 137.4 0.0124*


L243 and Tu36 are two different clones of monoclonal antibody to
human HLA-DR. Total HLA-DR shows statistically significant
differences with Tu36 clone in I-MDC stimulated with TNF-a with
and without NS398, a specific COX-2 inhibitor, but no differences
were found with L243. t Student's t test (two tailed) used for
statistical analysis with p





















Table 5-5: IL-12 and PGE2 production in MDC from normal controls
and subjects at risk for IDD.


Variable MDC Type n Controls Subjects pt
IL-12 I-MDC 23 4873.6 3101.4 0.4304
IL-12 I-MDC + TNF 19 6661.6 9463.6 0.4673
PGE2 I-MDC 17 1670.8 1485.1 0.8534


* Differences in mean values were compared
by Student's t test

















Table 5-6: Comparison of receptor mediated antigen uptake in MDC
from normal controls and subjects at risk for IDD.


MDC n Controls Subjects :pt
I-MDC 19 396.2 466.1 0.6979
M-MDC 19 50.6 123.4 0.1544

Antigen uptake measured by FITC-Dextran (mean
MEFI). tStudent's t test (two tailed) used for
statistical analysis.



















Table 5-7: Mixed Lymphocyte Reaction in normal controls and subjects
at risk for IDD.


Allo Auto GAD Insulin Tetanus
n 8 8 7 7 7
Controls mean 2.74 4.17 1.34 1.21 1.13

Subjects mean 3.62 3.60 0.91 0.83 0.89

p# 0.28 0.84 0.20 0.08 0.23


Allo = allogeneic, Auto = autologous mean index shown. Index is
calculated by 3H thymidine incorportation of MLR divided by 3H
thymidine incorportation of T cells alone. GAD = glutamic acid
decarboxylase, index for GAD, insulin, and tetanus is 3H thymidine
incorportion in antigen specific MLR divided by 3H thymidine
incorportation of autologous MLR. #Indices were compared by the
Student's t test (two tailed) with p<0.05 as level of significance.









were compared in the ability to activate T cells in autologous, allogeneic, and peptide

specific mixed lymphocyte reactions. Table 5-7 summarizes the findings.

Discussion

Although previous investigators have reported differences in the expression of

costimulatory molecules, CD80 and CD86 (Takahashi et al., 1998) and stimulatory

capacity in autologous and allogeneic MLR (Jansen et al., 1995; Takahashi et al., 1998),

this study finds no phenotypical or functional differences in monocyte derived dendritic

cells for the studies performed between subjects at high, moderate or low risk for

developing diabetes and controls that are at no risk. Several differences between the

previous reported findings and this study exist which may account for differences in

findings. First, the quantity of GM-CSF and IL-4 used in the Takahasi, Honeyman, and

Harrison (1998) study was 400 U/ml of IL-4 while this study used 500-1000 U/ml.

Shuler et al. (1999) reports that <200 U/ml of IL-4 give variable generation of MDC from

monocytes whereas >200 U/ml of IL-4 was adequate for differentiation except in an

occasional donor and 1000 U/ml of IL-4 always was successful in generation of MDC

from monocytes (Shuler et al., 1999). These results suggest that the level of IL-4 used in

this study (>500 U/ml) may be artificially high when compared to physiological levels

and the results noted between this study and the Takahashi, Honeyman, and Harrison

study (1998) may explain the differences in the MDC generation. Additional studies

employing varying quantities of IL-4 may be helpful in sorting out the inconsistencies.

Although the method described in this study yielded phenotypically and

functionally "normal" MDC, it is possible that generation of MDC in vivo may be

defective in subjects at high risk for autoimmune diseases such as IDD. Recently, a









subset of circulating, mature T cells expressing an invariant TCR ac chain, referred to as

NK T cells or NKI .1 in mice, were shown to be able to produce large quantities of IL-4

or IFN-y rapidly upon interaction with CD 1 d molecules on dendritic cells, and may be

major source of these cytokines during an immune response (Chen and Paul, 1997).

Additionally, one study suggests that mice that are deficient in NK T cells naturally or by

selective reduction are prone to autoimmunity (Mieza et al., 1996). One study in

humans, also, reports deficiency of NK T cells in humans with IDD (Wilson et al.,

1998). Therefore, the possibility exist that subjects at high risk for IDD may indeed have

defects in differentiation or generation of MDC which were overcome as a result of the

culture conditions used (high levels of IL-4).

The ability to generate "normal" MDC from subjects at high risk for IDD may

have distinct advantages in using MDC as immunotherapy for prevention of IDD. The

ability of producing large quantities of immature DC from monocytes has led to many

studies proposing the use of dendritic cells as therapeutic agents in the treatment of

tumors, allograft tolerance, and autoimmunity. The ability to generate phenotypically

and functionally normal responding MDC from subjects at high risk for IDD may provide

a therapeutic mechanism for induction of islet cell tolerance. Indeed, adoptive transfer

studies of matured myeloid DC from the pancreatic draining lymph node of NOD mice

into young NOD resulted in transfer of protection from diabetes and tolerance to 3 cell

antigens (Clare-Sailer et al., 1992). Additionally, Shinomiya et al. (1999) showed that

DC from the spleens of non-diabetic female NOD mice matured in the presence of IFN-y

prevented diabetes by an unknown mechanism. They suggest that the age of the recipient

and route of entry of DC are important for the anti-diabetogenic capacity of the tolerizing









effect (Shinomiya et al., 1999). Others have suggested that genetically engineered DC

such as DC that express immunosuppressive agents such as IL- 10 or TGF-P3 may induce a

Th2 response or anergy. Alternatively, DC that express pro-apoptotic molecules such

FASL may induce activation induced cell death (Lu et al., 1999).

This study shows that regardless of in vivo defects associated with inability to

activate T cells, generation of phenotypically and functionally normal MDC can be

achieved using standard techniques. These ex vivo derived MDC may provide a

mechanism for induction of tolerance against 3 cell antigen or other autoantigens;

however, the mechanism of induction of tolerance needs to be elucidated.














CHAPTER 6
SUMMARY AND CONCLUSIONS


This study has examined the role of prostaglandins, especially PGE2, in the

maturation and function of MDC. Dendritic cells are the most potent antigen presenting

cells and are unique in their ability to activate naive T cells. Because of their critical role

in the adaptive immune response, their use in immunotherapy for treatment of tumors,

transplantation, vaccines and autoimmunity have been proposed. Understanding agents

that modify DC which subsequently alter the T cell activation process may provide

means to manipulate DC in vitro to achieve desired response in vivo.

Chapter 3 describes the constitutive expression of COX-2 in MDC and the

production of prostaglandins that autoregulate their maturation and secretion of IL-12, a

critical proinilammatory cytokine. Endogenously produced MDC prostaglandins do not

contribute to the differentiation of MDC from monocytes as measured by standard

surface marker expression (e.g., CDla, CD14, CD40, CD80, CD83, CD86 and HLA-DR)

but do contribute to the expression of CD83, a mature DC specific marker, in MDC

matured with sCD40L and IFN-y. The secretion of IL-12 in I-MDC and M-MDC is

regulated by endogenously produced prostanglandins; however, the effect is opposed.

Immature DC that only produced IL-12p40 decrease secretion in response to blocking

endogenous prostaglandins while M-MDC that produce IL-12p40 and IL-12p70 increase

secretion of both forms when COX-2 mediated prostaglandins are inhibited. These









results provided the basis for examination of prostaglandin receptors as a mechanism for

divergent regulation of IL-12 secretion in I- and M-MDC.

Chapter 4 focuses on the role of prostaglandin receptors as mediators of IL-12

regulation in I-MDC and M-MDC. This study examines EPI, EP2, EP3 and EP4 in I-

MDC, maturing and fully matured MDC by competitive RT-PCR, 'H-PGE displacement

with EP specific agonists, and measurement of IL-12p40 and p70 after exposure to

receptor specific agonists. I-MDC predominantly express EP2 and EP4 receptors and

when stimulated with EP2/EP4 agonists or cAMP analogues increased IL-12p40 two-

fold. In the presence of CD40L/IFN-y, the maturing MDC produces IL-12p70 and p40

that are completely suppressed by EP2 agonists and cAMP analogues. During MDC

maturation, EP2 mRNA gradually declines by 50% over 24 hours while EP4 mRNA

increases rapidly by two-fold at 4 hours and remains increase after 48 hours. After 48

hours of stimulation, MDC are fully mature and express 30% fewer prostaglandin

receptors and EP4 is dominantly expressed. Despite expressing EP receptors, IL- 12p70

production by fully mature MDC is completely insensitive to PGE2 as well as forskolin

or cAMP analogues. These studies demonstrate three diverse responses of MDC IL-12

production, corresponding to distinct maturation states and characterize the role of

specific EP receptors in each response. It is apparent from these studies that EP2 and EP4

receptors play a dominant role, however, the presence of the maturing stimulus reverses

the effects of the EP2-mediated signal from stimulatory in I-MDC to suppressive in

maturing MDC. These studies also demonstrate that full maturation alters several

components of the PGE2 signaling pathway such that MDC IL-12 production is well

protected from prostaglandin-mediated suppression.









Finally, studies described in Chapter 5 compared MDC from subjects at high risk

for IDD and normal controls. Previously described aberrant expression of COX-2 in

monocytes from subjects at high risk for IDD and effects of PGE2 on MDC

differentiation from monocytes, prompted this investigation. Although no significant

differences were noted between subjects with high risk for IDD and normal controls with

respect to typical DC surface marker expression, production of cytokines, antigen uptake

and ability T cell activation, this study provides a springboard for future studies including

the use of autologous MDC for induction of tolerance to P cell antigens in subjects at

high risk for IDD.

Several problems were encountered during these investigations. First, in any

human based study, the person-to-person differences, whether it is number of molecules

per cell of a specific cell surface marker or quantity of cytokine secreted, vary

tremendously and make between groups comparisons hard to interpret. Because of the

variability, sometimes displaying the data as "representation" instead of combining many

experiments by calculating means and standard error better characterizes the observable

result. Second, in the study comparing MDC from subjects at high risk for IDD and

normal controls, the amount of sample received on each subject and control was limited;

therefore, not every variable was tested on every subject or control. This resulted in a

small sample size for each variable. The small number of subjects for each variable made

stratification of risk groups (HR, MR, LR) impossible to analyze statistically with any

power and, perhaps, gave inaccurate conclusions when risk groups were lumped together

as "subjects". In retrospect, fewer variables and combination of risk group (for example,









NR with LR and MR with HR) may have increased the sample size for each group and

provided enough numbers to stratify the analysis such that differences could be realized.

There are three potential areas for future experiments involving comparisons of

MDC from subject at risk for IDD and normal controls. (1) Differentiation of MDC

using varying amounts of IL-4 to determine if a threshold for IL-4 is required for

differentiation of MDC from monocytes. It is possible that monocytes from subjects

require a higher units of activity of IL-4 that normal controls. This could explain

differences in the results of this study and previous studies. (2) Ability of the MDC to

shut down receptor mediated antigen capture machinery in MDC matured with TNF-a.

Although no statistically significant difference between normal controls and subjects at

risk for IDD was noted in the uptake of antigen as measure by FITC-Dextran in I-MDC,

the ability to shut down receptor mediated endocytosis in the M-MDC matured with

TNF-a approached statistically significance (p=O.1544) and with a larger number of

samples and risk stratification, it may be possible to detect differences. (3) The

differences detected in total HLA-D1, but not surface HLA-DR molecules, on MDC

from subjects at high risk for IDD and normal controls when using one clone of

monoclonal antibody, Tu36, but not clone L243, is intriguing and raises interesting

questions about the structure of intracellular HLA-DR in subjects. One potential

explanation that is easily answered is that Tu36 does not bind as well to intracellular

DR03 or DR04, HLA types associated with risk for IDD, compared to L243.

Intracellular HLA-DR of these HLA risk types compared to other HLA-DR types may

provide resolution to this query.









Characterization of prostaglandin receptors on I-MDC and M-MDC is a novel

discovery and opens many potential avenues of research. First, does the

microenvironment modulate the expression of these receptors? In these studies only

maturation stimuli was added to the cultures when expression of the receptors was

investigated. Of interest, does the expression of prostaglandin receptor change when

maturation or function modulators, such as IL-10 and TGF-P, are added to the culture.

Second, IFN-y is a potent activator of MDC. After encountering IFN-y is the MDC

terminally differentiated? Does IFN-y "lock" the MDC into a Thl versus a Th2 inducing

APC? Finally, previous studies suggest that differing numbers and subtypes of

prostaglandin receptors on T cells or APC modulate the effects of PGE2 and may be a

potential mechanism of skewing the T cell response toward Thl or T2. Additionally,

subjects at risk for IDD (and NOD mice) express COX-2 abnormally in monocytes (MD

in NOD mice) and produce higher levels of PGE2 compared to normal controls (and

control mice). Examination of prostaglandin receptors on activated T cells and APC from

subjects with high risk for IDD (and NOD mice) compared to normal controls (and

control mice) may provide differences in sensitivity to PGE2 and may provide better

understanding of polarization of T cells toward Thl or Th2.

In conclusion, these studies examine the role of prostaglandins in the maturation

and function of MDC. Understanding the effects of micronenviromental factors, present

during antigen capture and maturation that modulate MDC function, may provide new

approaches to manipulate the MDC to 1) induce T cell activation for immunity against

infectious agents or tolerance against self-peptides, 2) regulate T cell responses including

polarization toward Thl or Th2, and 3) terminate immune responses.