Poliovirus RNA replication

MISSING IMAGE

Material Information

Title:
Poliovirus RNA replication separation of initiation and elongation functions of the viral polymerase using a cell-free system
Alternate title:
Separation of initiation and elongation functions of the viral polymerase using a cell-free system
Physical Description:
xiv, 149 leaves : ill. ; 29 cm.
Language:
English
Creator:
Smerage, Lucia Eisner, 1965-
Publication Date:

Subjects

Subjects / Keywords:
Polioviruses   ( mesh )
RNA, Viral -- biosynthesis   ( mesh )
DNA-Directed RNA Polymerases -- physiology   ( mesh )
Mutation   ( mesh )
Protein Binding   ( mesh )
Cell-Free System   ( mesh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1998.
Bibliography:
Includes bibliographical references (leaves 135-148).
Additional Physical Form:
Also available online.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Lucia Eisner Smerage.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
oclc - 51651706
ocm51651706
System ID:
AA00022315:00001

Table of Contents
    Title Page
        Page i
    Acknowledgement
        Page ii
    Table of Contents
        Page iii
        Page iv
        Page v
        Page vi
    List of Tables
        Page vii
    List of Figures
        Page viii
        Page ix
    List of abbreviations
        Page x
        Page xi
        Page xii
    Abstract
        Page xiii
        Page xiv
    Chapter 1. Introduction and literature review
        Page 1
        Page 2
        Page 3
        Page 4
        Page 5
        Page 6
        Page 7
        Page 8
        Page 9
        Page 10
        Page 11
        Page 12
        Page 13
        Page 14
        Page 15
        Page 16
        Page 17
        Page 18
        Page 19
        Page 20
        Page 21
        Page 22
        Page 23
        Page 24
        Page 25
        Page 26
        Page 27
        Page 28
        Page 29
        Page 30
        Page 31
        Page 32
    Chapter 2. Methodology
        Page 33
        Page 34
        Page 35
        Page 36
        Page 37
        Page 38
        Page 39
        Page 40
        Page 41
        Page 42
        Page 43
        Page 44
        Page 45
        Page 46
        Page 47
        Page 48
        Page 49
        Page 50
        Page 51
        Page 52
    Chapter 3. Scope of the investigation
        Page 53
        Page 54
        Page 55
    Chapter 4. Analysis of polymerase mutants
        Page 56
        Page 57
        Page 58
        Page 59
        Page 60
        Page 61
        Page 62
        Page 63
        Page 64
        Page 65
        Page 66
        Page 67
        Page 68
        Page 69
        Page 70
        Page 71
        Page 72
        Page 73
        Page 74
        Page 75
        Page 76
        Page 77
    Chapter 5. Two distinct roles for the viral polymerase in RNA replication
        Page 78
        Page 79
        Page 80
        Page 81
        Page 82
        Page 83
        Page 84
        Page 85
        Page 86
        Page 87
        Page 88
        Page 89
        Page 90
        Page 91
        Page 92
        Page 93
        Page 94
        Page 95
        Page 96
        Page 97
        Page 98
        Page 99
        Page 100
        Page 101
        Page 102
        Page 103
        Page 104
        Page 105
        Page 106
        Page 107
        Page 108
        Page 109
        Page 110
        Page 111
        Page 112
    Chapter 6. Analysis of mutants in the genome-linked protein
        Page 113
        Page 114
        Page 115
        Page 116
        Page 117
    Chapter 7. Summary of results
        Page 118
        Page 119
        Page 120
    Chapter 8. Discussion and perspectives
        Page 121
        Page 122
        Page 123
        Page 124
        Page 125
        Page 126
        Page 127
        Page 128
        Page 129
        Page 130
        Page 131
        Page 132
        Page 133
        Page 134
    References
        Page 135
        Page 136
        Page 137
        Page 138
        Page 139
        Page 140
        Page 141
        Page 142
        Page 143
        Page 144
        Page 145
        Page 146
        Page 147
        Page 148
    Biographical sketch
        Page 149
        Page 150
        Page 151
        Page 152
Full Text














POLIOVIRUS RNA REPLICATION: SEPARATION OF INITIATION AND ELONGATION
FUNCTIONS OF THE VIRAL POLYMERASE USING A CELL-FREE SYSTEM












By

LUCIA EISNER SMERAGE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY
OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE
OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1998













ACKNOWLEDGEMENTS

I would like to thank Dr. J. Bert Flanegan for his advice, guidance,

encouragement and friendship throughout this study. I truly could not have had

a better mentor.

For their insightful evaluation of the experiments and the dissertation, I

would like to thank the members of my committee, Dr. Rich Condit, Dr. Ernest

Hiebert, Dr. Sue Moyer and Dr. Maury Swanson. I would also like to thank Dr.

Ellie Ehrenfeld who was kind enough to serve as my outside examiner and who

offered many helpful suggestions.

I would like to thank other members of the faculty of the Department of

Molecular Genetics and Microbiology for their helpful discussions, particularly Dr.

Donna Duckworth and Dr. Al Lewin. I sincerely appreciate the encouragement

and suggestions of my present and former colleagues, Dr. Dave Barton, Dr.

Virginia Chow, Dr. Sushma Abraham Ogram, Joan Morasco, Brian O'Donnell and

Lynn Shiels. I also appreciate the assistance of Joyce Conners and Brad Moore,

and the encouragement of Liz Ghini. For their contribution, I also thank Roland

Eisner and Ron Frashour, and for their support, I'd like to thank the rest of my

family. Finally, I wish to thank my husband, Jeff, for his encouragement

throughout this study.














TABLE OF CONTENTS


ACKNOWLEDGEMENTS........................................................................................... ii

U ST OF TABLES....................................................................................................... vii

U ST OF FIGURES...................................................................................................... viii

LIST OF ABBREVIATIONS....................................................................................... x

A BSTRA CT................................................................................................................ xiii

CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW.................................. 1

Poliovirus is the Etiologic Agent of Poliomyelitis..................................... 1
Development of Poliovirus Vaccines and Worldwide Vaccination....... 4
Poliovirus is the Prototypic Member of the Picomaviridae.................. 6
Genomic Organization Contributes to Economy of Size and Genetic
Stability of Poliovirus...................................................................... 7
Poliovirus Replication.................................................................................. 8
Perturbation of Host Cell Metabolism..................................................... 13
Contribution of Cellular Proteins to the Viral Replication Cycle........... 17
Structure of 3Dpoi and Studies with Polymerase Mutants.................. 21
Mutational Studies with the Viral Genome-Linked Protein 3BVPg
and its precursor 3AB................................................................... 27
Evidence for an Interaction Between 3Dpol and 3BvPg Precursor
3A B.................................................................................................... 28
The Cell-Free System as a Tool for the Analysis of Poliovirus
M utants............................................................................................. 30

CHAPTER 2: METHODOLOGY................................................................................ 33

DNA Manipulation and Plasmid Construction......................................... 33
Bacterial Transformation and Growth.................................................... 36
Isolation of Plasmid DNA........................................................................... 36








DNA Sequence Analysis............................................................................. 38
Media and Cell Growth................................................................................ 38
Virus Amplification and Growth............................................................... 38
Quantitation of Virus................................................................................. 40
Viral RNA Isolation...................................................................................... 42
RNA Transcription....................................................................................... 42
Preparation of HeLa S10 Cellular Extracts............................................ 44
Preparation of HeLa Initiation Factor Extracts..................................... 45
Translation of Viral and Transcript RNAs In Vitro............................... 47
Quantitation of Radiolabelled Protein by TCA Precipitation................ 47
Resolution of Product Proteins by Electrophoresis Through SDS-
Polyacrylam ide Gels........................................................................ 48
Fluorography of SDS-Polyacrylamide Gels............................................. 48
Formation of Pre-lnitiation Replication Complexes In Vitro................. 49
Replication of Viral and Transcript RNAs In Vitro................................ 49
RNA Isolation............................................................................................... 50
Resolution of Product RNAs by Electrophoresis Through Denaturing
Agarose Gels................................................................................... 50
Polymerase Assays on Exogenous Template......................................... 51
Quantitation of Radiolabelled Products on Gels..................................... 51

CHAPTER 3: SCOPE OF THE INVESTIGATION..................................................... 53

CHAPTER 4: ANALYSIS OF POLYMERASE MUTANTS....................................... 56

Translation and Processing of 3D-M394T are Wild-Type.................... 56
Characterization of the Replication Deficit of the Mutant at the
Restrictive Temperature................................................................ 56
Mutant 3D-M394T Polymerase is Irreversibly Inactivated at the
Restrictive Temperature............................................................... 58
Mutant 3D-M394T Polymerase is Defective for Negative-Strand
Production....................................................................................... 60
Polymerase Mutant 3D-M394T has a Wild-Type Negative-Strand
Chain Elongation Rate..................................................................... 65
Polymerase Mutant 3D-M394T is Defective for the Initiation of
Both Negative and Positive Strands........................................... 69
Characterization of Polymerase Mutant 3D-V391L ............................. 72
Polymerase Mutant 3D-V391 L Also has a Wild-Type Negative-
Strand Chain Elongation Rate...................................................... 74
Construction and Characterization of Polymerase Mutant
3D-G327M ......................................................................................... 75








CHAPTER 5: TWO DISTINCT ROLES FOR THE VIRAL POLYMERASE IN RNA
REPUCATION.................................................................................... 78

Cloning of Complementing Constructs.................................................... 78
Characterization of the Complementing Constructs........................... 81
3D Construct pLES19 Expresses an Active Polymerase..................... 84
3CD, but not 3D, Can Complement Mutant 3D-M394T in trans........ 87
Positive-Strand Replication of Mutant 3D-M394T can also be
Rescued by 3CD............................................................................. 93
Mutant 3D-V391L has the Same Complementation Phenotype
as 3D-M394T.................................................................................. 96
Mutant 3D-G327M can be Complemented in trans with 3D............... 100
Intraallelic Complementation Shows that Mutations 3D-M394T
and 3D-G327M Disrupt Different Functions of the
Polym erase...................................................................................... 110

CHAPTER 6: ANALYSIS OF MUTANTS IN THE GENOME-LINKED PROTEIN.... 113

Cloning of Complementing Constructs................................................... 113
Characterization of Complementing Constructs.................................. 114
Linkage Mutant 3B-Y3F can be Complemented in trans with P3,
but not 3AB.................................................................................... 115

CHAPTER 7: SUMMARY OF RESULTS................................................................ 118

CHAPTER 8: DISCUSSION AND PERSPECTIVES................................................. 121

Polymerase Mutants 3D-M394T and 3D-V391L Disrupt the Same
Dom ain of Poliovirus...................................................................... 121
Complementation Studies Distinguish the Roles of a
Multifunctional Protein.................................................................... 122
Intraallelic Complementation Confirms that the Poliovirus
Polymerase has at Least Two Distinct Roles........................... 124
3Dpol as a Multifunctional Protein............................................................ 125
Complementation of 3D-G327M is Stronger with Precursors
Larger Than 3D............................................................................... 126
The Function of 3CD in Initiation of RNA Replication............................. 127
Linkage of 3BVPg to Nascent RNA Requires P3................................... 131
P23 is an Efficient Replicon........................................................................ 132

REFERENCES............................................................................................................. 135









BIOGRAPHICAL SKETCH......................................................................................... 149












LIST OF TABLES


Table

1 Poliovirus Replication Proteins and Functions......................................... 14

2 List of Restriction Enzymes....................................................................... 35

3 Buffers........................................................................................................... 41

4 Sizes of RNA Transcripts.......................................................................... 73

5 Oligonucleotides Used for Cloning Complementing Constructs........... 79












LIST OF FIGURES


Figure

1 Poliovirus Genom e........................................................................................ 10

2 Subdomains of 3D and Positions of Mutations..................................... 23

3 Translation of 3D Constructs................................................................... 57

4 Total RNA Replication of 3D-M394T is Significantly Inhibited at
39.50C................................................................................................ 59

5 Irreversible Heat Inactivation of 3D-M394T PI-RCs.............................. 61

6 Heat Inactivation of Negative-Strand RNA Synthesis in 3D-M394T
PI-RCs ............................................................................................... 63

7 Polymerase Assay of 3D-M394T on Exogenous Template Shows a
Decay in Elongation Activity.......................................................... 64

8 Heat-Inactivation Profile of 3D-M394T Polymerase.............................. 66

9 Elongation of Negative-Strand RNA Within 3D-M394T RNA
Replication Complexes is Not Inhibited at 39.5C...................... 68

10 3D-M394T is Thermosensitive for Both Negative and Positive
Strand Initiation ............................................................................. 70

11 Elongation of Negative-Strand RNA Within 3D-V391 L RNA
Replication Complexes is Not Inhibited at 39.5C...................... 76

12 Structures of Complementing Constructs.............................................. 82

13 Translation of 3D-M394T and Complementing Constructs................. 83

14 Processing Timecourse of P3.................................................................... 85








15 Activity of Expressed Polymerase on Exogenous RNA Template.......86

16 3CD, but not 3D, Can Complement 3D-M394T in trans....................... 89

17 Purified Polymerase Protein does not Rescue Mutant 3D-M394T...... 92

18 3CD Can Rescue Positive-Strand Replication of Mutant 3D-M394T... 95

19 3CD, but not 3D, Can Complement 3D-V391 L in trans....................... 97

20 Translation of 3D-V391 L with Complementing Constructs................. 99

21 3D Can Complement 3D-G327M in trans................................................ 101

22 Translation of 3D-G327M with Complementing Constructs................ 103

23 3D-G327M Complementation with P3 and 3CD is Optimal at a 1:1
Molar Ratio....................................................................................... 105

24 Translation of 3D-G327M with Titrations of P3 and 3CD.................... 106

25 3D-G327M Complementation with 3D Decreases Proportionally
to the Amount of 3D...................................................................... 108

26 Translation of 3D-G327M with Titrations of 3D.................................... 109

27 Intraallelic Complementation of 3D Mutants.......................................... 111

28 3BvPg Mutant 3B-Y3F can be Complemented in trans with P3........... 116

29 Model of Replication.................................................................................... 120













LIST OF ABBREVIATIONS


Ap
ATP
BSC-40
C
CaC2lz
CBP
cDNA
CH3HgOH
Ci
CNS
CsCI
CTP
ddHzO
DMSO
DNA
DTT
EGTA

elF-4F
elPV
EMCV
g
GTP
GuHCI
h
H3B03
HeLa
HEPES
HIV1
IF
IRES
Kb
KCH3COz
KCI


Ampicillin
Adenosine 5'-triphosphate
African green monkey kidney cell line
Celsius
Calcium chloride
Cap-binding complex
Complementary DNA
Methylmercury hydroxide
Curie
Central nervous system
Cesium chloride
Cytidine 5'-triphosphate
Sterile distilled water
Dimethyl sulfoxide
Deoxyribonucleic acid
Dithiothreitol
Ethylene glycol-bis(p-aminoethyl ether)-N,N,N',N'-tetraacetic
acid
Cap-binding complex
Enhanced inactivated poliovirus vaccine
Encephalomyocarditis virus
Gravity
Guanosine 5'-triphosphate
Guanidine hydrochloride
Hour
Boric acid
Human cervical carcinoma cell line
N-2-hydroxyethylpiperazine-N'-2-ethane-sulfonic acid
Human immunodeficiency virus 1
Initiation factor
Internal Ribosomal Entry Site
Kilobase
Potassium acetate
Potassium chloride








KDa
LB
LB ap
M
mAp
mCi
MEM
Mg(CH3CO2)2
MgCl2
min
ml
mmol
MOI
N
Na2B407-1 OH20
NazEDTA
Na2S04
NaCH3CO2
NH4CH3CO2
nm
NTR
OPV
Pabl1
PAGE
PBS
PCBP1
PCBP2
pcr
pfu
pH
PI-RC
pol
poly [A]
PPO
RNA
rpm
S
S10
Sam68
SDS


Kilodalton
Luria broth media
Luria broth with 100 ug/ml ampicillin
Molarity
Milliampere
Millicurie
Minimal essential medium
Magnesium acetate
Magnesium chloride
Minute
Milliliter
Millimole
Multiplicity of Infection
Normal
Sodium borate
Sodium ethylenediaminetetraacetic acid
Sodium sulfate
Sodium acetate
Ammonium acetate
Nanometer
Non-translated region
Oral poliovirus vaccine
Poly-(A) binding protein 1
Polyacrylamide gel electrophoresis
Phosphate-buffered saline
Poly (rC) binding protein 1
Poly (rC) binding protein 2
Polymerase chain reaction
Plaque-forming unit
Percentage of hydrogen ion concentration
Pre-initiation replication complex
Polymerase
Polyadenosine triphosphate
2,5-diphenyloxazole
Ribonucleic acid
Revolutions per minute
Second
Supernatant from a 10,000 x g centrifugation
Src-associated in mitosis, 68 KDa
Sodium dodecyl sulfate








T7 Bacteriophage T7
TAE Tris-acetate EDTA
TBP TATA-binding protein
TCA Trichloroacetic acid
Tm Melting temperature
Tris HCI Tris(hydroxymethyl)aminomethane hydrochloride
P Microliter
UTP Uridine 5'-triphosphate
uv Ultraviolet
v/v Volume per volume
vRNA Virion RNA
wt Wild-type













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy


POLIOVIRUS RNA REPLICATION: SEPARATION OF INITIATION AND ELONGATION
FUNCTIONS OF THE VIRAL POLYMERASE USING A CELL-FREE SYSTEM

By

Lucia Eisner Smerage

December 1998

Chairman: J. Bert Flanegan
Major Department: Molecular Genetics and Microbiology

An ideal prototype for the study of small, positive-stranded RNA viruses

which cause human disease is poliovirus. In this study, the role of poliovirus

polymerase in the replication of viral RNA was assessed using a cell-free

system. An in vitro complementation assay based on an in vitro translation-

replication system was developed. Analysis of mutations in the viral

polymerase by complementation with defined precursor proteins resulted in the

discovery that there were at least two separable functions of this protein. One

such function was in the elongation of nascent RNA strands. Such mutants

were represented by catalytic core mutant 3D-G327M, which could be rescued

with RNA encoding the mature polymerase protein. The second function was in








the initiation of viral RNA synthesis, and mutants defective for this function

could not be rescued by the mature protein. These initiation-defective mutants,

3D-M394T and 3D-V391 L, required polymerase precursor 3CD for rescue.

These mutations lie in the 3AB-interacting region of the protein, suggesting that

the initiation defect of these mutants was a disruption of the ability of the

protein to bind the precursor to the genome-linked protein. Intraallelic

complementation of the 3D-M394T and 3D-G327M mutant confirmed that these

two required polymerase functions could be separated. Characterization of

these mutants was also performed.

In vitro complementation with mutants in the genome-linked protein was

also performed. These results indicated that mutant 3B-Y3F, which has been

shown to be defective in linkage to nascent viral RNA, could not be rescued with

precursor 3AB, but that P3 was required.

Based on these findings, a model for poliovirus RNA replication was

proposed. In this model, replication complexes assemble at the 3' end of viral

RNA with a P3 precursor, followed by an initiation step in which this precursor is

cleaved to generate 3CD and 3BvPg. Soluble 3DPO' subsequently enters the

complex to uridylate the 3BvPg primer and elongate the nascent negative-

strand RNA.














CHAPTER 1
INTRODUCTION AND LITERATURE REVIEW


Poliovirus is the Etiologic Agent of Poliomyelitis

Poliovirus is an enterovirus which has plagued humankind with the

debilitating infectious disease poliomyelitis since antiquity. Notably, paralytic

poliomyelitis is the first known disease immortalized in art. Dated about 1500

B.C., a clay plaque depicting the ancient Egyptian priest Ruma shows a tall man

with a withered leg and arched, rigid foot leaning on a crutch (displayed at the

Ny Carlsberg Glyptotek, Copenhagen). Until the advent of modem sanitation,

particularly in the developing world, and the vaccination campaigns of this

century, poliovirus was worldwide in distribution and infection was endemic.

Poliomyelitis is an acute disease which affects approximately 1 in 200 of

those infected. Transmission is primarily via oral inoculation with fecally

contaminated sources. While most persons infected with poliovirus have

asymptomatic replication in the mucosal tissues of the gut followed by

clearance of the virus, 4-8% progress to a transient viremia and viral

replication in the bone marrow, spleen, liver and lymph nodes 3 to 7 days after

inoculation (24,25,64,65,93,96). This is known as the "minor illness," since the








patients have fever, headache, sore throat, anorexia and generalized fatigue.

The vast majority of patients resolve their illness after 2 days and clear the

viremia, although subclinical fecal shedding of the virus from replication in the

gut does continue for 5-8 weeks following infection. Those 0.1-1% of patients

who do not resolve their illness progress to the "major illness," or central

nervous system (CNS) disease.

The major illness reflects the highly neurotropic nature of poliovirus. The

virus replicates in the gray matter of the anterolateral tracts of the spinal

cord, the site of the motor neurons. In the late 1860s, French scientists Cornil

and Charcot used newly-developed histologic staining techniques and discovered

atrophy of the gray matter in the anterior horns of the spinal cords of infants

with fatal paralytic disease (93,96). Their findings resulted in the disease name

poliomyelitis, from the Greek "polios" (gray) and "myelos" (spinal cord).

Symptoms of the major illness are sudden onset of fever, headache, vomiting

and meningitis 9-12 days after infection. The flaccid paralysis, often

asymmetric in the affected extremities, is preceded by intense muscle pain.

While leg involvement is the most common, arms can also become paralyzed.

Cranial nerve involvement occurs in 5-35% of paralytic patients, and this can

result in the most serious complication of poliomyelitis, respiratory failure from

the paralysis of the diaphragm and intercostal muscles. The "iron lung" was in

fact developed in the early 20th century for the mechanical ventilation of

patients with respiratory paralysis due to poliovirus infection (96).








While the factors that determine which infected people are more likely to

progress to major illness and CNS involvement are not fully understood,

epidemiologic studies have shed some light on this issue. Analysis of

unvaccinated populations has shown that the most important factor seems to

be age of infection. Generally, infants and children have a much milder disease

than people who are infected later in life. For reasons which are unclear, males

tend to be about twice as likely as females to contract the major illness. In

addition, higher socioeconomic status seems to also correlate with more

severe disease (93,99).

In general, poliomyelitis has been a disease which occurs with greater

frequency as the population's socioeconomic situation improves. This is

thought to be due to the evolutionary adaptation of the virus to a young host,

wherein it is advantageous to cause mild or inapparent disease and allow for

continual and efficient viral propagation. Poliovirus is ubiquitous and persists

well in the environment, so in prehistoric times and in underdeveloped countries,

the population would typically be infected in childhood. As the socioeconomic

status and hygiene of an unvaccinated population improves, individuals tend to

become infected later in life. Since this is correlated with more severe disease,

the population trends toward a higher incidence of poliomyelitis. It was the

trend of increasing epidemics of the disease in Europe and the Americas in the

19th and early 20th centuries that led to increasing scientific scrutiny and

ultimately the development of two different vaccines.








Development of Poliovirus Vaccines and Worldwide Vaccination

One of the greatest achievements of modern medicine has been the

development of safe and effective vaccines to protect against poliomyelitis.

The two currently available vaccines include a live, attenuated vaccine, and an

inactivated vaccine. The inactivated vaccine was originally developed in the

1950s by Jonas Salk. The poliovirus cultures for his vaccine were killed by

treatment with formalin before administration to patients. This technique was

the basis for the modern elPV, or enhanced inactivated poliovirus vaccine, which

is part of the current recommended vaccination schedule for children in the

United States (1,2). The modern Salk vaccine is a trivalent vaccine prepared

from all three serotypes of poliovirus.

While the Salk vaccine was effective in providing protection in clinical

studies in the 1950s, an unfortunate incident occurred wherein several large

lots of commercially-prepared vaccine were distributed to the population

without having been completely inactivated. This resulted in about 200 vaccine-

associated cases of type I poliomyelitis and a public outcry for a safer

alternative. Simultaneous to these events, several laboratories were working

to develop attenuated live strains of poliovirus which could be used as an

alternative type of vaccine. They based their studies on the discovery that

passage of poliovirus type III in mice resulted in a strain that was avirulent in

rhesus monkeys (81). Albert Sabin developed three monovalent strains (one

for each poliovirus serotype) which were sufficiently attenuated in clinical trials

for vaccine use, yet were still sufficiently replication-competent to induce a






5

protective immune response in the vaccinee. The three Sabin strains were

ultimately combined into trivalent OPV (oral poliovirus vaccine). Their molecular

biology was reviewed by Minor (94). The OPV was licensed for use in the United

States in 1964, and since that time has been the predominant vaccine used

worldwide. This live vaccine is not without risk, as one in about 2.5 million

vaccinees or close contacts contract paralytic disease. Immunodeficient

recipients are also at risk of developing neurologic symptoms.

Currently, there are three options from which pediatricians choose for

vaccination of children in the United States (1,2). They are i) elPV at 2 months

and 4 months, followed by OPV at 6-18 months and 4-6 years; ii) elPV at the

same intervals as above; or iii) OPV at 2, 4 and 6-18 months, and again at 4-6

years. The mixed schedule of elPV and OPV seems to be the most popular

choice of physicians and parents. Other countries use schedules similar to

these. Immunization of people from underdeveloped countries has been

organized and funded by the World Health Organization and has been

accomplished with the inexpensive and more easily administered OPV. In fact, in

1994 the western hemisphere was certified free of wild-type poliovirus, and

currently the remaining cases of poliomyelitis are in rural Asia, Africa, the Middle

East, India and a handful of other war-torn areas. The widespread use of OPV

has resulted in environmental replacement of the wild-type strains of poliovirus

with the less virulent Sabin strains, so some scientists advocate a switch to

vaccination with elPV (44,122). However, this approach may be too expensive

for the worldwide eradication campaign. Nonetheless, with the continued








support of vaccination programs, eradication of poliomyelitis remains an

attainable goal.


Poliovirus is the Prototypic Member of the Picornaviridae

While poliomyelitis and infection by wild-type poliovirus have been

successfully eliminated from much of the world by mass vaccination campaigns,

there was intense scrutiny afforded poliovirus by scientists of the past.

Consequently, great strides were made in the study of poliovirus biology, and

not merely in the area of vaccine development. Although the disease threat is

abating, poliovirus is remarkably similar to many other small, pathogenic RNA

viruses. Made safe to work with in the laboratory setting by the availability of

vaccines, modern virologists view poliovirus as the ideal prototype for the

study of the picornaviridae family of viruses, as well as other small, positive-

stranded RNA viruses. The picornaviridae include such pathogens as the

enteroviruses which can cause meningitis, paralysis, rashes and conjunctivitis,

the 100+ rhinoviruses which cause colds and upper respiratory disease, the

Coxsackieviruses which cause myocarditis and meningitis, and the hepatitis A

virus. Other related human pathogens which seem to have similar biology

include hepatitis C virus and caliciviruses, which commonly cause gastroenteritis.

Many advances in the understanding of poliovirus have been on the forefront of

modern virology, and have later been shown to be applicable to other positive-

stranded RNA viruses as well.









Genomic Organization Contributes to Economy of Size and Genetic Stability of
Poliovirus

Two remarkable characteristics of wild-type poliovirus are its small size

and its genomic stability over countless rounds of replication under a variety of

conditions. In fact, the taxonomic classification of poliovirus in the family

picornaviridae implies that these are the smallest of the RNA viruses

(picornaviridae meaning pk, or small, RNA irus). The genome is a mere 7.5

kilobases (Kb), and it encodes all of the specialized genes that are needed for

an RNA virus to replicate in a host cell which is equipped to replicate DNA, not

RNA. All of the genes are present in one long stretch of about 6.5 Kb without

intervening or spacer regions. The capsid genes are 5'-most, followed

immediately by the genes encoding the replication proteins. The separation of

different gene products occurs at the protein level after translation of a single

large polyprotein, which is then cleaved by virally-encoded proteases. While this

genomic organization requires the virus to be large enough to make these

proteases, economy of scale is preserved since intergenic regions are

unnecessary.

Size conservation is also aided by the fact that poliovirus encodes some

proteins which have enzymatic functions as mature gene products, but which

have distinctly different functions in precursor form. While it encodes only a

handful of proteins, the virus has at least three precursor proteins which have

vital functions which are different from the mature proteins they include.








The preservation of small size is also aided by the ability of the virus to

use multimers of gene-coding regions to perform functions. Rather than

encoding a large polymerase, the virus encodes the'small polymerase 3DPO.

There is evidence that 3Dp' is able to multimerize to form the functional

enzyme, both from structural and biochemical studies which will be discussed in

more detail below.

The viral genome also is economized in the organization of its 5' and 3'

ends. The virus has a 5' non-coding region of 744 nucleotides, and a 3' non-

coding region of 70 nucleotides. These ends contain sequences and structures

required for the translation and replication of the genome. The majority of the

length of the 5' non-coding region has evolved into an internal ribosomal entry

site (IRES), a complex series of RNA stem-loops which is capable of binding

cellular translation factors and ribosomes (7,8,52,91,100,103,118,129,136).

This region enables the virus to subvert the cellular translation machinery,

freeing the virus from any need to encode such factors of its own. The 3' end

of the virus has also been shown to contain a number of higher-order RNA

structures. These are thought to be necessary for the initiation of negative-

strand synthesis.


Poliovirus Replication

Poliovirus replication has been shown to occur in a cascade of events

which has been extensively reviewed by several scientists (71,111,121) and will

be outlined here. Attachment onto human cells occurs with an interaction








between the viral capsid and the cellular poliovirus receptor, and entry occurs

with the uncoating of the viral genome. The virion RNA is then extruded into the

cytoplasm and the cell's translation machinery is utilized to generate large

amounts of the viral polyprotein. Poliovirus replicates entirely in the cytoplasm

of the host cell. The covalently attached genome-linked protein 3BvPg is

removed by a cellular unlinking enzyme (5). The normal function of this enzyme

is unknown. Translation of the uncapped virion RNA message occurs with

factor-mediated loading of ribosomes onto a specific site in the IRES, followed

by ribosome scanning to the initiating AUG sequence (19,76). The coding

sequence is translated into a 6.5 Kb polyprotein. The organization of the viral

genome is depicted in Figure 1, with the capsid proteins encoded by the P1

region of the genome, and the replication proteins encoded by the P2 and P3

regions of the genome.

Cleavage of the polyprotein is achieved by the virus-encoded proteases,

ZAPrO and 3CPrO/3CDPro (102). Most of the cleavages are performed by the

protease 3CPr (or 3CDpro), while liberation of the amino-terminal capsid

proteins from the downstream replication proteins results from an

autocatalytic cleavage by the protease 2APro. Not all of the viral protein

precursors are cleaved quantitatively. Therefore even at late times in infection,

significant quantities of precursor proteins, most notably 3AB, 3CD and 2BC,

are evident.













5'
Cloverleaf IRES
I --II--117-


3' NTR
m"--1


P3


I a-d II III IV V VI


PRIMARY CLEAVAGE PRODUCTS


CAPSID PROTEINS


REPLICATION PROTEINS


VPO VP1

VPVP4 VP2
VP4 VP2


P2
2A pro
- 2BC


2B 2C


3AB


3CDpro


3A VPg 3C pro 3D pol
3A(not shown: 3C' and 3')
(not shown: 3C' and 3D')


Figure 1 Poliovirus Genome. Poliovirus genome organization and
structural features of the viral RNA are indicated. Stem-loops of the 5'
non-coding region are designated 1-VI. Primary cleavage products of the
capsid and replication portions of the coding region are indicated below.








As the newly-made viral replication proteins are liberated from the

polyprotein, they begin assembly of replication complexes. Replication of a

template appears to require that it be translated (101, Barton, O'Donnell,

Morasco and Flanegan, unpublished observations). Protein 3CD, in addition to

having protease activity, has been shown to bind to specific stem-loops near

the ends of virion RNA (vRNA) at the sites of negative-strand and positive-

strand initiation (7,8,59). There is evidence that 3AB acts as a cofactor for

this binding (136).

Protein 3BvPg is the small genome-linked protein, which appears to act as

a primer for replication (47,85,107,131). 3BvPg is thought to be delivered to

membranes, the site of replication, by its precursor, 3AB (53,121). Protein

3AB contains the highly hydrophobic 3A, which is thought to aid in this

localization. Smooth membranes are the intracellular location of poliovirus

replication. 3AB may also be a cofactor in stimulating polymerase activity

(82,105). Polymerase activity resides in the mature 3Dp'* protein, but not with

its precursors. Purified polymerase has been reported to uridylate 3BvPg, so

VPg-pUpU may serve as the primer for viral RNA replication (107).

Interestingly, even at late times in infection, little mature 3DP01 is seen

(73,132). Most of the 3DPOI is present in the form of precursors, most

prominently 3CD. It is possible that the P3 proteins form a ribonucleoprotein

complex (RNP) which functions to localize a polymerase precursor, the 3BvPg








precursor and the protease which is required to liberate them at the site of

initiation.

The functions of other replication proteins are less well characterized.

Protein 2B is of unknown function, but is required for replication (121,132).

Purified protein 2C is known to be an ATPase and GTPase (95,116), and based

on the conserved domains of 2C, it has been suggested that it may be an RNA

helicase (54-56). Although the exact function of 2C is unknown, initiation of

viral replication can be blocked in a 2C-dependent fashion by the reversible

inhibitor guanidine HCI (GuHCI) (15), so it may also be part of the initiation

complex. The evidence for this hypothesis is that while translation is unaffected

by this drug, replication mutants of poliovirus which are GuHCI sensitive,

resistant, and dependent all map to the 2C coding region (6,11,108,125,132).

The 2C protein has been shown to associate with membranes via an

amphipathic helix structure in its amino-terminus (106). In addition, 2C has

been shown to bind the 5' terminal stem-loop structure of positive-strand RNA

and the complementary stem-loop in the negative strand (12). Together, these

data imply that 2C plays an integral part in the initiation process together with

3AB, 3CD and 3DPI1.

Once translation of sufficient viral proteins has occurred and initiation

complexes assemble, the input genomic RNA becomes a template for the

synthesis of negative strand RNA. Negative strand RNA, in turn, acts as a

template for the abundant synthesis of positive strands, which are made in 20-








50-fold excess over negative strands (73,121). RNAs of both negative and

positive sense are covalently linked at their 5' ends to the small viral protein

3BvPg (4,31,85). Each positive-stranded RNA is encapsidated to form a

mature virus particle housed by a shell of 60 copies of each of the viral capsid

proteins. Nascent virus particles are released when the host cell lyses. A

summary of the poliovirus proteins and some possible functions are listed in

Table 1.


Perturbation of Host Cell Metabolism

Because poliovirus is a lytic virus, its replication significantly disrupts the

host cell, finally resulting in cell death. This disruption is not limited to lysis of

the cellular membrane at the final step in viral release. Shortly after poliovirus

enters the host cell, it begins to alter the cellular protein synthesis machinery,

the membrane and cytoskeletal structure of the cell and the ability of the cell to

replicate its DNA and transcribe RNA.

About 1 hour (h) after a cell becomes infected by poliovirus the level of

protein synthesis begins a significant decline, until at 2 h post-infection the

overall level of protein synthesis is 10-20% of that seen in an uninfected cell.

This decline is due to a specific viral mechanism by which it binds host

translation factors and inhibits translation of cellular capped messages. The

IRES is a strong binding site for the host-cells's ribosomes. However, this

competition for ribosomes and other translational machinery is not sufficient to

explain the great decline in host protein synthesis caused by poliovirus. In fact,













TABLE 1: Poliovirus Replication Proteins and Functions


Protein Function
2Apro Protease
Inhibition of host protein synthesis
2B Asssociation with membranes
2BC Induction of membrane vesicles
2C ATPase/GTPase
Initiation of replication
Vesicle induction
Putative helicase
3A Association with membranes
Disruption of host secretary pathway
3AB Delivery of 3BvPg to membranes
3DPol cofactor?
3CD cofactor?
3BvPg Genome-linked viral protein
Initiation of replication
Primer for RNA synthesis
Encapsidation of viral RNA
3CPr Protease
3CDPro Protease
Binding of viral RNA
Polymerase precursor
Binding of PCBP
Binding of 3AB
3DPOI RNA-dependent RNA polymerase
Binding of 3AB
VPg uridylation
Terminal adenyl-transferase






15

this decline seems to be due in large part to the ability of the virus to inactivate

at least one protein component of the cap-binding protein complex, elF-4F or

CBP. Etchison et al. reported that inhibition of host cell protein synthesis by

poliovirus correlated to the proteolysis of a 220 KDa protein component of the

CBP named p220 (46). Proteolysis of p220 by the major viral protease 3Cpr0

was ruled out (84,86). While the cleavage of p220 by 2Apro may not be direct

(45,87,134), poliovirus mutants that were disrupted for 2AprO activity were

unable to mediate cleavage of p220 (78). Whether direct or indirect, it is viral

protein 2APr' rather than 3CPro which is required to achieve cleavage of p220,

which causes the shut-down of translation of cellular capped messages. The

cleavage of p220 may not be the only viral mechanism for this inhibition, since

one report showed that p220 cleavage was only able to suppress translation

by about two-thirds (26).

In addition to interfering with host-cell translation, the virus interferes

with transcription as well. Transcription by all three cellular RNA polymerases

polss), RNA pols I, II and III, is inhibited by cleavage of their associated

transcription factors by the viral proteases (37,119). Cell fractionation studies

showed that a specific RNA pol I transcription factor was inhibited by

poliovirus-infected cells (119). This inhibition was shown to be due to cleavage

of the factor by 3CPro (120). Expression of 2AprO results in the inhibition of

RNA pol 1I transcription and DNA replication (38). Expression of 3Cpr results in

the cleavage and inactivation of transcription factor IIIC and subsequent








inhibition of RNA pol III transcription (34). Protein 3Cpr also has been found to

cleave the transcriptional activator Oct1 (137). In addition, 3CPr, cleaves the
I
TATA-binding protein (TBP) and in turn causes inhibition of transcription by RNA

pol II (35). Since TBP is also a component of the RNA pol I and III complexes,

its cleavage presumably also interferes with their function as well. Interference

with host-cell transcription clearly enables the viral RNA to outcompete the

intrinsic cellular RNAs for the limited translational apparatus, ribonucleotides

and stored energy the virus requires for its own replication.

In addition to the perturbation of host macromolecular synthesis, the

morphology of the poliovirus-infected cell is also dramatically altered (124).

Microscopic analysis has shown that the infected cell develops an abnormal

nucleus, nucleolus, ribosomes, and membrane system. The nucleus becomes

crescent-shaped and the chromatin marginalized to the nuclear membrane.

The nucleolus diminishes in size. The ribosomes clump in the cytoplasm. Most

dramatically, however, the membranous structures of the cell become

unrecognizable as hundreds of membrane vesicles fill the cytoplasm. These

vesicles appear to be the site of viral replication and their appearance after

viral protein synthesis begins implies that membrane induction is mediated by a

viral protein or proteins (21). Biochemical and immunocytochemical analysis

has shown that viral proteins 2C, 2B, 2BC, 3A and 3AB are all tightly bound to

or imbedded in the membrane structures (124). Recently it was shown that 2C

and 2BC expressed without the other poliovirus proteins are able to induce








membranous vesicles of appropriate morphology, and that while 2C also

induced cytoskeletal changes which are atypical of poliovirus infection, 2BC did

not (33). These results show that the induction of membranous vesicles for

viral replication is the function of 2BC.

The origin of the membrane vesicles has been shown to be the

endoplasmic reticulum and Golgi apparatus, the latter of which is absent after

poliovirus infection (33). This organelle is responsible for encapsidating the

host cell's secretary material for intracellular transport or export from the cell.

Specific disruption of the secretary apparatus by poliovirus infection, therefore,

makes available the membranes which the virus requires for replication. In fact,

research has shown that the drug brefeldin A, which inhibits membrane budding

and vesicle formation, is a potent inhibitor of poliovirus RNA synthesis

(42,66,89). Clearly, membrane vesicles are required for poliovirus replication.


Contribution of Cellular Proteins to the Viral Replication Cycle

Poliovirus RNA replication requires not only the host cell's metabolic

capability and subcellular ultrastructure, but also specific cellular proteins. While

these specific proteins have not all been identified and characterized, research

has identified a few. Of those which have been identified, some have been

implicated in the initiation of viral translation, while others may be involved in

replication of the viral RNA. Those cellular factors which may have a role in

viral translation include human cellular proteins elF-4F, La and a pyrimidine-tract

binding protein. Those which may be involved in RNA replication include nucleolin








and Sam68 (Src-associated in mitosis, 68 KDa). In addition, the poly (rC)

binding proteins 1 and 2 (PCBP1 and PCBP2) appear to have a dual role in both

translation and viral replication.

Viral translation seems to be enhanced by translation initiation factor

elF-4F (9). This factor has been shown to enhance internal ribosome entry.

Curiously, this is the same cellular factor which is cleaved to inactivate the cell's

cap-dependent translation. However, this cleavage event does not interfere

with the stimulation of cap-independent translation (28).

A 52 KDa protein identified as the human La protein has been shown to

bind to stem-loop VI of the IRES (91,92). These results also showed that

supplementing rabbit reticulocyte lysates with the La protein corrected the

aberrant initiation of translation noted in this system, a problem not seen with

HeLa extracts (43,92).

Three pyrimidine-rich sites in the IRES have been shown to crosslink a 57

KDa protein which may be part of the polypyrimidine tract binding protein

family (60). This family of proteins is involved in pre-mRNA splicing in the

nucleus. However, the cellular rearrangements from poliovirus infection may

make proteins such as this, Sam68, nucleolin and La more available to the

cytoplasm than they would be in intact cells.

Andino et al. described the formation of a RNP complex at the 5'

terminal cloverleaf with binding by both 3CD and a 36 KDa cellular protein

(Figure 1) (7,8). 3CD was shown to bind stem-loop d of the cloverleaf,

whereas the cellular protein binds to the sequences of stem-loop b (7). There






19

is also evidence that 3CD binding to the 5' cloverleaf may be enhanced by viral

protein 3AB (59,136). However, the cellular factors which bind to stem-loop b

of the cloverleaf have recently been identified as PCBP1 and PCBP2 (49,50,103).

These cellular factors may be involved, together with viral 3CD, in the switch

from translation to replication of the viral RNA (50).

Contribution of other cellular factors to the replication of viral RNA is

less clear. Nucleolin, a nucleolar protein which normally shuttles between the

nucleolus and the cytoplasm, has been reported to become sequestered in the

cytoplasm upon poliovirus infection (129). This sequestration is due to a

specific binding of the nucleolin protein to the poliovirus 3' non-coding region

(129). The location of this interaction at the 3' end of the virus may imply a

role for nucleolin in the initiation of negative-strand RNA synthesis. In addition,

McBride et al. have reported the relocalization of nuclear Sam68 to the

cytoplasm in poliovirus-infected cells (90). This protein was also shown to bind

the viral polymerase, so it may also have a role in viral replication.

In addition to the cellular proteins described above, crosslinking and

electrophoretic mobility-shift analyses have identified other cellular proteins

which can bind to the IRES (Figure 1). Proteins which are 38 KDa and 48 KDa in

size can bind to stem-loop IV (52). Further identification of the 48 KDa protein

has not yet been made, but the 38 KDa protein is the same PCBP2 protein

which binds the 5' cloverleaf (22,23,49). PCBP2 has 3 RNA binding domains, so

the binding of one molecule of this protein to both sites in the 5' non-coding

region is possible (49,103). Another unidentified 36 KDa protein binds to an








RNA which contains both stem-loops V and VI (49). In addition, a HeLa cell

protein of 50 KDa has been shown to both crosslink to and bandshift stem-

loop III of the poliovirus IRES (41,100). However, this portion of the genome is

is not required for IRES function in tissue culture systems (41). Therefore the

significance of this interaction may lie in RNA replication or another viral

function. Finally, 3CD has been shown to process a 38 KDa cellular protein at

the 3' end of the negative strand at a site complementary to the 5' cloverleaf

(117). The relationship of these biochemical interactions to the replication of

the virus remains unclear.

In addition to these factors which have been shown by biochemical

analysis to interact with the viral RNA, replication of poliovirus has a presumed

role by such cellular factors as poly-(A) binding protein 1 (Pabl), which may

stabilize the poly-(A) tail and perhaps interact with other cellular factors.

Together, the viral and cellular proteins described contribute to the translation

of viral RNA, the initiation of RNA synthesis, and the replication of the viral

genome. Although the proteins would seem to bind the viral RNA at distant

portions of the genome, there is some evidence for the interaction of

translation initiation factors such as adaptor elF-4G to RNA-bound Pabl (61).

This evidence suggests a model of translation whereby the proteins and

ribosomes recruited to bind the RNA create a large RNP which anchors both

the 5' and 3' ends of the viral genome (61,118).








Structure of 3DD and Studies with Polvmerase Mutants

The poliovirus polymerase is expressed as a 52 KDa protein, making it

slightly smaller than other related polymerases. The three-dimensional

structure of 3DPO' has recently been solved by X-ray crystallographic analysis

(58). This analysis has shown that the protein is capable of forming

homodimers or homotetramers, and has determined which amino acids of the

protein are near the surface and are likely responsible for this interaction. The

potential for multimerization has also been identified biochemically (104) and by

two-hybrid analysis (135). If the enzymatic polymerase is a multimer, then

initiation of RNA replication would require several molecules of 3DPO' to be

present at the proper intracellular location.

All RNA-dependent RNA polymerases contain four conserved motifs A-D

as described by Poch et al. (109). Motif C contains the catalytic core of the

polymerase, the tetrapeptide YGDD. All four conserved motifs A-D fold

together in three dimensions to form the core of the "palm" subdomain of a

stylized hand, thumb and fingers often used to describe the basic shape of

polymerases (57). Regions of 3DP1t thought to bind other molecules of 3DP0'

are in linear regions at the amino and extreme carboxy-terminal ends of the

protein. These do not fall into any of the four conserved motifs. Another set

of sequence alignments of RNA-dependent RNA polymerases, these specifically

from positive-strand RNA viruses, has been published by Koonin (74). Koonin

identified eight conserved motifs (1-VIII) in this group of viral polymerases.






22

Koonin's motifs I and II may contribute to the non-linear 3D-3D-interacting sites,

as well as the extreme carboxy-terminal end of the protein, which is not

represented by a conserved region. Motif VI contains the catalytic core

tetrapeptide YGDD. Figure 2 depicts the motifs of the poliovirus polymerase as

described in these studies.

While originally hypothesized to be important for nucleotide binding,

studies have identified the catalytic core sequence YGDD as essential in

positioning the metal-binding pocket of the viral polymerase (39). The

aspartates in this sequence (positions 328 and 329 of 3DPOI), together with

nearby aspartate residue 233 of motif A are thought to bind the divalent

magnesium ion. In fact, a 3D-D329 mutation was shown to alter the

requirement of the enzyme's divalent cation from magnesium to manganese or

iron (69). In addition, Morrow et al. performed comprehensive mutational

analysis of the YGDD motif and tested the mutants for their ability to elongate

an exogenous primed template (67,68). This research showed that the

majority of mutations in this region eliminated or severely inhibited the function

of the enzyme. Analysis of the YGDD motif in the crystallographic structure

indicates that the glycine at position 327 (G of the YGDD sequence) is in fact at

the outermost edge of a R-turn (58). Of all of the changes which Morrow et al.

tested in this amino acid, replacement of the glycine at this position with

methionine was predicted cause the least disruption of the overall structure of

the turn (67). However, the 3D-G327M mutation eliminated all polymerase









D. Conserved E. 3AB-Binding
YGDD Motif Region
YGDD PvMPMKelHE
V-,,,J


A. Poch's Conserved Motifs
B. Koonin's Conserved Motifs I II HI .
C iltz'* R Contributing to Homodlmerlzatlon

50 100 150 200 250


Thum ,.,,
F.^


I
300


350
350


400
400


Fingers


Figure 2 Subdomains of 3D and Positions of Mutations. Conserved
motifs A-D of the core polymerase (109) are shown at A. Conserved motifs of
polymerases of positive-stranded RNA viruses (74) are shown at B. Residues
which contribute to oligomerization of 3D in crystals (58) are indicated by
black bars at C. The conserved YGDD motif is shown at D. The region
responsible for binding 3AB (63) is shown at E. The residues indicated in D and
E by capitalization are absolutely conserved among the enteroviruses. Three
dimensional structure of the polymerase (58) as modelled by RasMol based on
the coordinates in the Protein Data Bank (1 RDR) is shown at F. Polymerase
mutants characterized in this study are indicated by stars (D and E) or labelled
by name (F).


450






24

elongation activity, and therefore the mutation was lethal. Curiously, wt (wild-

type) human immunodeficiency virus 1 (HIV1) reverse transcriptase has the

YMDD motif at the analogous I-turn position in its catalytic core (72). This

enzyme prefers magnesium but can use manganese as its divalent cation (36).

Studies have also identified two nucleotide-binding sites in the polymerase

(114,115). These are located at amino acid positions 61 and 276 (112). The

downstream site is located in a domain conserved among polymerases.

However, genetic and biochemical studies have shown that the upstream site,

which is not in a conserved domain, is required for RNA replication, whereas the

downstream site is not (113). Crystallographic studies, however, align

poliovirus polymerase aspartate residue 238 with tyrosine residue 115 of HIV1

reverse transcriptase (58). Conservation of this residue among positive-

stranded RNA viruses is hypothesized to be critical for nucleotide substrate

discrimination between NTPs and dNTPs. The analogous position in RNA-

dependent DNA polymerases is highly conserved as either tyrosine or

phenylalanine, and research has shown that point mutation of this residue from

phenylalanine to valine changes the substrate of Moloney murine leukemia virus

reverse transcriptase from dNTPs to NTPs (51).

Additional studies have identified mutations in motif VIil. While most

polymerase mutants described result in a lethal phenotype, two mutations in

this domain have been identified as having a conditional thermosensitive

phenotype in replication assays (62,63). One such mutant is 3D-M394T, and

another is 3D-V391L. Mutant 3D-M394T was originally isolated as an RNA-








negative mutant identified as tsl 0 following a hydroxylamine mutagenesis

protocol (62). Sequencing of the 3DPO' coding region showed that a U to C

transition mutation existed at nucleotide 7167, changing an AUG methionine

codon to an ACG threonine codon at residue 394 of 3DPo1 (17). Subsequently,

the mutation was engineered into a full-length clone with a two-nucleotide

change at positions 7167 and 7168 for decreased reversion potential. The

resultant RNA which contained an ACU threonine codon at amino acid 394 was

transfected into HeLa cells and temperature-sensitive virus recovered (17).

The mutant virus 3D-V391L was originally made in an entirely different manner.

Based on analysis using the two-hybrid system, Hope et al. discovered an

interaction between 3D and 3AB (63). By mutagenizing the 3D constructs and

screening for those which lost the ability to bind VPg-precursor 3AB, 3D-V391L

was identified. The mutation was engineered into a full-length clone, RNA was

transfected into HeLa cells, and temperature-sensitive virus defective in RNA

synthesis was recovered. Both mutant 3D-M394T and 3D-V391 L are in amino

acids which are highly conserved among the enteroviruses. These mutations lie

near each other in the thumb region of the viral polymerase on an exposed

surface of the protein (58).

Interestingly, another thermosensitive replication-deficient polymerase

mutant has been identified near the carboxy-terminal end of the protein (3).

This mutation, a 3D-N424D change, lies outside of the conserved motifs for

polymerases. Subsequently, mutation of this amino acid to H, D and Y was






26

performed and the mutants analyzed (30). These mutants were also shown to

be unaffected for elongation. Based on the structural studies of the

polymerase, mutants at position'424 lie near the 3D-M394T and 3D-V391L

mutations in the base of the thumb domain of the polymerase. While the 3D-

N424D change is present on a parallel a-helix to that where the other

mutations are found, the positioning of these mutations is remarkably close.

Several mutations throughout the polymerase coding region have been

identified which result in improper cleavage of the P1 capsid precursor

(29,30,32). These mutants likely affect the structure of the polymerase

precursor, 3CDPr.

An insertion mutation after polymerase position 365 resulted in a

mutation which could not be complemented in trans (20). While this implied

that the polymerase may have a function that is required in cis, these results

were contrasted by a report in which insertion of a stop codon in the

polymerase coding region was complementable in trans (101).

In addition to these studies, Diamond and Kirkegaard performed

clustered-charge-to-alanine mutagenesis on the polymerase gene and

generated an array of different mutants (40). The majority of these were

lethal, but a number of mutations throughout the amino-terminal coding portion

of the protein were thermosensitive. Further functional analysis of these

mutants has yet to be performed.








Clearly, there are a number of different regions of the polymerase gene

which have been characterized by mutational analyses. The different

phenotypes uncovered by these studies hint that 3DP0' is a multifunctional

protein which may have specialized subdomains.

Mutational Studies with the Viral Genome-Linked Protein 3BYEPa and its Precursor

3AB

The genome-linked protein of poliovirus is a small, highly basic protein of

22 amino acids. In infected cells it is found linked to newly-replicated strands of

both negative and positive sense, or localized to membranes in the form of

precursor 3AB. It may be the primer for replication of viral RNA (107). It

binds the viral RNA via a covalent linkage of its tyrosine residue at position 3

via a phosphodiester bond to the terminal uridylate (4). Replacement of the

tyrosine with phenylalanine results in a lethal phenotype (79). Mutation of this

residue to threonine and replacement of the fourth amino acid residue of the

protein with tyrosine resulted in a lethal defect (79). These results indicate

that the tyrosine position may be invariant.

Several mutations near the carboxy-terminal end of 3BvPg have also

been identified. Changes to the arginine residue at position 17 of 3BvPg have

been reported to result in a lethal phenotype, while the lysine at position 20

could be altered without loss of viability (80). Charged-to-alanine mutagenesis

of lysines 9 and 10, as well as alteration of the arginine at position 17, resulted

in interference with the binding of 3AB to 3D in the yeast two-hybrid system








(135). The importance of the 3AB-3DPO' interaction to several viral functions

has been reported, as described below.

In addition to serving as a precursor for the viral genome-linked protein,

3AB has been shown to interact with itself via yeast two-hybrid analysis (135).

While the functional significance of this interaction is unknown, one possibility is

that several molecules of the protein align themselves in cellular membranes in a

higher-order structure. Exposure of the hydrophilic 3B portion of membrane-

embedded 3AB molecules could result in the formation of pores and thereby

the permeabilization of cellular structures. It is clear that mutational and

biochemical analyses have elucidated a number of different functions for the

3AB and 3BvPg coding regions in viral replication.


Evidence for an Interaction Between D Precursor AB

Several lines of study have been used to characterize an interaction

between the proteins 3DPO' and 3AB, the precursor of the small genome-linked

protein. These have included two-hybrid analyses and reconstitution assays. In

addition to these studies, 3AB has been shown by gel mobility shift and

crosslinking analyses to bind together with 3CD to the 5' cloverleaf structure

and 3' non-translated region (NTR) of poliovirus RNA (59,136). This RNA

binding function, however, appears to be via residues in the 3C portion of 3CD,

not those in the polymerase.

As described above, analysis by the yeast two-hybrid system has

detected dimerization of 3DPO' and 3AB and has also shown that 3AB binds to






29

3DpoI (63,135). Residues of 3AB thought to contribute to the binding of 3DP01

have been identified as being in the 3B portion of the protein. Specifically,

alanine mutations at 3BvPg lysine residues K9 and K1 0 eliminated binding of 3AB

to the polymerase, as did mutation of arginine residue R17 to Q, E or K (135).

Interestingly, residues which contribute to 3AB dimerization are located in the

hydrophobic 3A portion of the protein (135). Residues of 3DPO1 which interact

with 3AB were identified as being in the thumb region of the viral polymerase

(63). Detection of binding by two-hybrid analysis is not sufficient evidence that

the interaction has functional significance to viral replication, however. All

interactions described above for 3DP01 and 3AB were so weak that detection of

the interactions were reportedly difficult (135). While this weak interaction may

be due to technical reasons, two-hybrid analysis has been used to detect

enzyme-substrate pairs as well as structural complexes (138), so further

investigation is required to determine whether these proteins form a stable or

transient complex.

The functional significance of the 3AB-3DpOI interaction has been probed.

Point mutation of the polymerase at 3D-V391L results in a defect in RNA

synthesis (63), as does mutation of a nearby residue at 3D-M394T (62). In

addition, reconstituted cleavage reactions have shown that addition of purified

3AB to 3CDpr results in slight stimulation of autocatalytic cleavage of the

protease (97). This stimulation, however, appears limited to this site, since

trans-cleavage of the P1 capsid precursor by 3CDpro was inhibited by 3AB. In








both of these assays, 3CDPr had significant protease activity alone.

Stimulation of polymerase activity on an exogenous poly-(A) template by 3AB

has also been probed (82,105). Polymerase activity was shown to be

stimulated 50-100 fold by the addition of 3AB to these reconstituted assays

(105). However, in order to achieve the stimulation, 3AB was delivered at

100-fold molar excess over 3DPo1, so the relevance of these findings to viral

RNA replication requires further investigation.

There is a growing body of scientific evidence for a physical interaction

between poliovirus proteins 3AB and 3DP01. The evidence also suggests several

possible roles for this interaction, including initiation of RNA replication via

interaction at the ends of viral RNA, polymerase elongation activity and

protease activity.


The Cell-Free System as a Tool for the Analysis of Poliovirus Mutants

A powerful tool recently developed for the analysis of poliovirus mutants

is the cell-free translation-replication system (13,14,16,18,98,133). Assays of

this type utilize the necessary host factors and membranes in cellular extracts

from these permissive HeLa cells to support translation and asymmetrical RNA

replication of input poliovirus RNAs. Nascent RNA strands are VPg-linked as in

normal infections, and they are encapsidated to form high titers of viral

particles. This system allows the researcher to manipulate each step in the

translation and replication of the viral genome, examine the effect of mutations








whether encoded by transcripts or in virion RNA, discover the effect of the

addition of drugs, and to perform countless other biochemical assays.

One development that has significantly improved the array of studies

which can be performed with the in vitro system was the discovery that viral

RNA transcripts could be replicated in transfected cells (127). Therefore,

cDNA encoding the poliovirus genome, whether wt or with mutations, can be

transcribed in vitro using T7 RNA polymerase. Improvements in transcript

quality when more authentic ends are provided have been described

(18,123,126). These RNAs with minimal extra 5' and 3' sequence can be added

to the in vitro reactions and utilized as if they were authentic virion RNAs. The

amount of translation and replication of these transcribed RNAs more closely

approximates that of virion RNAs when the extra sequences are minimized

(126).

Another particularly useful tool in the manipulation of the viral life cycle in

the cell-free system is the drug GuHCI. Addition of this drug has been shown to

inhibit the initiation of viral RNA synthesis without affecting either translation or

elongation of RNA chains (13,31). Therefore, methods can be designed

whereby RNA synthesis is assayed synchronously after translation, processing

and replication-complex formation occurs (15).

Analysis of poliovirus mutants, whether lethal or conditional, can be

performed in great detail through the use of this in vitro system. In addition to

determination of the precise step in the viral life cycle affected by the

mutations, complementation tests can be performed. The ability to






32

concentrate input RNAs in these complementation assays without the barriers

of cellular membranes and subcellular compartments has proven to be a

significant advantage. While Johnson and Sarnow reported a

noncomplementable mutant in 2B when analyzed in transfected cells (70),

studies have shown that internal deletions of the virus, including 2B deletions,

can be complemented in vitro (Barton, O'Donnell, Morasco and Flanegan,

unpublished observation). Towner et al. recently reported the in vitro

complementation of a 3AB mutant with precursor P3, but not 3AB (126).

Clearly, the technological advances of the HeLa S10 translation-replication

system and the availability of mutants make a detailed analysis such as that

described within this document as feasible as it is interesting.














CHAPTER 2
METHODOLOGY


DNA Manipulation and Plasmid Construction

DNA for plasmid construction was manipulated by standard molecular

biological procedures (10,88). DNA inserts for cloning were prepared by

polymerase chain reaction (pcr) using oligonucleotide primers with melting

temperatures (Tm) of 55-75C and amplified in 100 ml reactions with VENT

polymerase (New England Biolabs) as per manufacturer's specifications.

Typical reactions were amplified for 30 cycles as follows: denaturation for 30

sec at 94C, annealing for 45 sec at 2C below the lowest Tm of the primer

pair, and elongation for 30 sec per kilobase of product size at 72C. Reactions

were incubated in a GeneAmp PCR System 9600 (Perkin-Elmer Cetus).

Products of per reactions were sized on 1 % agarose (Ultrapure, Life

Technologies) TAE gels (10,88), stained with ethidium bromide, visualized with

low-intensity uv (ultraviolet) light and excised. DNA was recovered from

agarose by the rapid purification technique Geneclean (Bio 101) and purified by

sequential extraction with phenol:chloroform:isoamyl alcohol (25:24:1) and

chloroform:isoamyl alcohol (24:1). DNA was recovered by precipitation in 70%








ethanol at -20C followed by centrifugation. The gel-purified, phosphatase-

treated insert DNA of interest was resuspended in a suitable volume of ddHO0

(sterile distilled water) in preparation for addition to ligation reactions.

Preparation of vector DNA for cloning was also performed by standard

procedures. Restriction enzymes used for these studies are summarized in

Table 2. Plasmid DNA was restricted with the appropriate enzyme(s) in a 2-

10-fold overdigest according to the manufacturer's specifications. The entire

reaction mixture was loaded onto a 1 % agarose (Ultrapure, Life Technologies)

TAE gel and products were separated by electrophoresis. Bands of interest

were visualized by low-intensity ultraviolet (uv) light after ethidium bromide

staining, then recovered as described above. The gel-purified vector DNA was

then treated with Shrimp alkaline phosphatase (Amersham) according to

manufacturer's specifications. The enzyme was inactivated by heating to 65C

for 15 min. Vector DNA was then purified for ligation by sequential phenol

extraction and ethanol precipitation as described above for insert DNA.

Ligation reactions were performed with 100-200 ng of DNA per 20 Jl

reaction, with a 3:1 molar ratio of insert to vector. Reactions were performed

with 3 units of T4 DNA ligase (Promega). Each reaction was incubated

overnight at room temperature before transformation into competent

bacterial cells.
















TABLE 2: List of Restriction Enzymes


Name Recognition Vendor Restriction Sites Procedure
sequenceT_
EcoRV GAT/ATC Promega within 3D coding region confirm insert
directionality
Fspl TGC/GCA New England within plasmid origin of replication selection for site-
Biolabs directed
mutagenesis
HinCII GTY/RAC New England within 2B coding region linearize for
Biolabs transcription
Mlul A/CGCGT Boehringer 3' of poly [A] sequence, all clones linearize for
Mannheim transcription
Mscl TGG/CCA New England 3' of IRES and within 3D coding preparation of
Biolabs region cloning vector
Ncol C/CATGG New England within IRES, within 3A and within confirm insert
Biolabs 3D coding regions directionality
Ndel CA/TATG New England within 3D and within plasmid confirm insert
Biolabs origin of replication directionality
Nsil ATGCA/T New England within 3C and within 3D coding confirm insert
Biolabs regions directionality
Smal CCCGA3GG New England 3' of IRES in pLES16-24 preparation of
Biolabs cloning vector








Plasmids of interest which were created by site-directed mutagenesis

utilized the Transformer kit (Clontech) according to the manufacturer's

specification sheet.


Bacterial Transformation and Growth

Plasmid DNA was transformed into competent SURE cells (Stratagene)

according to the manufacturer's specification sheet. Briefly, 1 pl of plasmid

DNA containing 2-10 ng DNA was added to 20 gl SURE cells. Cells were

incubated on ice for 20 min, heat shocked for 45 sec at 42C, then further

incubated on ice for 2 min. Cells were then suspended in 500 pl of LB media

(Life Technologies), and incubated while shaking at 225 rpm at 37C for 1 h.

Cells were then pelleted by a 30-second pulse centrifugation in a microfuge

(Eppendorf), 300 |l of the media was removed, and the cells were resuspended

in the remaining media. The mixture was plated on an LB plate containing 100

[tg/ml ampicillin (Ap, Boehringer Mannheim Biochemicals) and incubated

overnight at 37C. Colonies which grew on the plates were picked and streaked

onto sectored fresh LB Ap plates with a sterile pick. Plates were incubated

overnight at 37C.


Isolation of Plasmid DNA

In order to perform plasmid miniprep analysis, isolated bacterial colonies

from sectored plates were inoculated into 3 ml liquid LB ap media and

incubated at 37C overnight while shaking at 225 rpm. Cultures were








transferred to microfuge tubes and pelleted 30 seconds (s) at 1 5,000 x g.

The media was decanted, and the remainder of each culture added to the

microfuge tube and pelleted 30 s at 15,000 x g. The media was again

decanted. Plasmid DNA was extracted from the bacterial cell pellets using

miniprep kits from RPM (Bio 101) according to the manufacturer's

specifications. The final elution was done with 25 p] TE (pH 7.5).

Large-scale plasmid preparations were performed using a Qiagen

midiprep kit. Three ml liquid cultures of LB ap were inoculated with bacterial

cells from glycerol stocks stored at -70C. Cultures were incubated at 37C

while shaking at 225 rpm for 8-12 h. Starter cultures were added to 250 ml

liquid LB ap media and incubated at 37C while shaking at 225 rpm for 5-8 h.

Bacterial cells were pelleted by centrifuging at 6,000 x g for 15 minutes. The

media was decanted, and the plasmid DNA was extracted from the bacterial

cell pellet using a Qiagen midiprep kit according to the manufacturer's

specifications. The DNA pellet was resuspended in 250 d TE (pH 7.5) and

precipitated with the addition of 35 [1 4 M NaCH3CO2 and 750 [l 100% ethanol.

The tubes were incubated at -20C overnight. The plasmid DNA was recovered

by pelleting in a microfuge at 15,000 x g at 4C for 15 min. DNA pellets were

washed in 70% ethanol, centrifuged at 15,000 x g at 4 C for 5 min, and dried

briefly in vacuo. Pellets were then resuspended in 30-50 td of sterile distilled

water and quantitated by spectrophotometric absorbance at 260 nm.








DNA Sequence Analysis

Plasmid DNA was sequenced by the DNA sequencing core laboratory of

the Interdisciplinary Center for Biotechnology Research (University of Florida,

Gainesville, FL) with an ABI 373a DNA sequencer. Confirmation of mutation

sites from site-directed mutagenesis procedures and cloning junctions for

constructed plasmids was performed by cycle sequencing using a DS Cycle

Sequencing kit (Life Technologies) according to manufacturer's

recommendations. Radiolabelled products were resolved by electrophoresis

through 8% acrylamide 7 M urea gels and visualized by autoradiography.


Media and Cell Growth

HeLa S3 cells were grown in suspension culture in Joklik's modified

Minimal Essential Medium (MEM, Life Technologies) supplemented with 2% Fetal

Clone (Hyclone) and 5% Bovine Calf Serum (Life Technologies). Cells were

maintained in log phase growth at 37C at a density of 2-4 x 105 cells/ml.


Virus Amplification and Growth

Virus was amplified according to standard procedures (128) with

modifications as described. Amplification of plaque-purified virus was

performed by infection of confluent monolayers of BSC-40 cells at low

multiplicity of infection (MOI), usually 0.3-0.4 plaque-forming units per cell

(pfu/cell). Monolayers were prepared for infection by removal of growth media

and washing with PBS warmed to 37C. The PBS was decanted, and cells were








treated with virus suspended in warmed PBS at a volume of 1/10 that of the

appropriate volume of media overlay used for cell growth. Virus was then

adsorbed for 40 min at 37C, with rocking every 10 min, followed by the

addition of 1 volume of Eagle's MEM (Cellgro) supplemented with 10% Fetal

Clone (Hyclone). For example, confluent BSC-40 cells grown on 25 cm2 dishes

were treated with virus suspended in 400 ul virus/PBS mixture for adsorption,

followed by the addition of 4 ml of media for incubation of infected cells.

Infected cells were incubated at 37C for growth of wild-type virus or 32.5C

for growth of temperature-sensitive virus until complete cytopathic effect was

noted by low-magnification light microscopy (usually 2 days). Dishes containing

the disrupted cells were subjected to three cycles of freezing and thawing,

followed by collection of the virus-containing media and cell debris mixture. This

mixture was either quantitated and retained as a virus stock stored at -20C,

or virus was further amplified by the infection of larger dishes of BSC-40 cell

monolayers as described above.

When required, virus was concentrated from mixtures of media and cell

debris by differential centrifugation. Cell debris was pelleted by centrifugation

at 2,000 rpm for 5 min at 4C in a JS 4.2 rotor (Beckman). The clarified

supernatant was transferred to ultracentrifuge tubes and centrifuged for 2 h

at 40,000 rpm in a Ti-50.2 rotor (Beckman). Pelleted virus was resuspended in

500-1000 1I of Eagle's MEM (Cellgro), quantitated and stored at -20C.






40

Virus amplification for the preparation of viral RNA was performed using

HeLa suspension cultures. Cells were grown to 5 x 105 cells/ml, infected with

concentrated virus stock at a MOI of 0.3, resuspended at a concentration of 5

x 106 cells/ml in Joklik's modified MEM (Life Technologies) and incubated on a

stir plate at 32.5C for 24 h. Virus was recovered and concentrated as

described above. Pelleted virus was resuspended in 2 ml 0.5% SDS buffer

(Table 3) and layered onto a CsCI gradient.


Ouantitation of Virus

Virus was quantitated by serial dilution in PBS followed by plaque assay

on BSC-40 monolayers. BSC-40 cells were grown to confluence in 6-well dishes

(Corning). Typically, virus stock was subjected to ten 1 0-fold serial dilutions in

PBS. Media was removed from the cells and aliquots of 200 ul from each virus

dilution were applied to the cells. Virus was allowed to adsorb for 40 min at

37C with rocking every 10 min. Then cells were overplayed with 5 ml 1%

methylcellulose (Fisher) and incubated for 2 days at 37C for wild-type virus or

32.5C for thermosensitive virus. Plaques were visualized by removal of the

methylcellulose overlay, staining with crystal violet dye for 20 min, and multiple

rinses with distilled water. Virus stock was recorded in units of pfu/ml based

on the plaque count for the appropriate serial dilution.













TABLE 3: Buffers


0.5% SDS buffer:



5x SP6 buffer:



Hypotonic buffer:



IF dialysis buffer:



Isotonic buffer:

CH3HgOH sample buffer:


0.5% SDS (Sigma), 10 mM Tris-HCI (pH 7.5), 1 mM EDTA,
100 mM NaCI

200 mM Tris-HCI (pH 7.9), 30 mM MgCI2, 10 mM
spermidine (Sigma)

20 mM HEPES (pH 7.4), 10 mM KCI, 1.5 mM
Mg(CH3C02)2, 1 mM DTT

5 mM Tris-HCI (pH 7.5), 100 mM KCI, 0.05 mM EDTA, 1
mM DTT, 5% glycerol

35 mM HEPES (pH 7.4), 146 mM NaCI, 11 mM glucose

50 mM methylmercury hydroxide (Alfa), 50 mM H3BO3, 5
mM Na2B4O7-10H20, 10 mM Na2SO4, 1 mM EDTA, pH
8.2








Viral RNA Isolation

Viral RNA was isolated from virus which had been purified by banding

through a CsCI density gradient (48). RNA was isolated from virions with five

sequential phenol:chloroform:isoamyl alcohol (25:24:1) extractions followed by

three chloroform:isoamyl alcohol (24:1) extractions. RNA was then

concentrated by precipitation in 70% ethanol, followed by centrifugation at

15,000 x g at 4C for 15 min. The RNA pellet was then washed with 70%

ethanol, centrifuged at 1 5,000 x g at 4C for 5 min, and dried briefly in vacuo.

Resulting RNAs were resuspended in sterile distilled water, quantitated by

spectrophotometric absorbance at 260 nm, and suspended in 70% ethanol at

a final concentration of 0.5 [ig/[il. RNAs were stored at -20C.


RNA Transcription

Preparation of all reagents and manipulation of RNA transcripts were

performed with care to ensure that the resultant RNA was of the highest

possible quality. Transcription reactions were performed using T7 polymerase

reading linearized cDNA clones as template. Most cDNA clones were originally

derived from T7D (A)83 (18), and contained a unique Mlul restriction site 3' of

the poly [A] tail. This restriction site was used to prepare linearized plasmids

for run-off transcription reactions unless otherwise noted.

Reactions were performed in a 100 gl mixture containing 20 [d 5x SP6

buffer (Table 3), 10 tl 10 mM nucleotide mix (10 mM ATP, 10 mM CTP, 10 mM

GTP and 10 mM UTP [Amersham/Pharmacia]), 10 [1 100 mM DTT (Amersham),






43

2 il RNasin (Promega), 1.5 !tg linearized DNA, and 2 d T7 RNA polymerase (gift

from S.A. Moyer). The balance of the reaction volume was sterile distilled

water. Transcription reactions were incubated at 37C for 2 h.

Reactions were stopped with the addition of 200 0d 0.5% SDS buffer,

and the RNA was separated from other reaction components by 3 sequential

extractions with phenol:chloroform:isoamyl alcohol (25:24:1) followed by

extraction with chloroform:isoamyl alcohol (24:1). RNA was recovered by

precipitation with 2.5 volumes of ethanol and incubation on ice for 1-2 h or at

-20C overnight.

Transcript RNA was centrifuged at 15,000 x g at 4C for 15 min and the

ethanol discarded. Pelleted RNA was dried briefly in vacuo and solubilized in 50

[.l sterile distilled water. The RNA was then fractionated from excess salts and

unincorporated nucleotides by G-50 Sephadex column chromatography in a 0.5

x 8 cm column equilibrated in water. Three-drop fractions of approximately

150 VL\ were collected in ten microfuge tubes. Samples from each fraction were

diluted and analyzed for RNA content by spectrophotometric absorbance at

260 nm. Fractions containing RNA were precipitated with the addition of

NaCH3CO2 to 0.2 M and 3 volumes of ethanol and stored at -20C until needed

for further analysis.

Immediately prior to use, RNAs were recovered by centrifugation at

15,000 x g at 4C for 15 min. Ethanol was decanted, and pellets were washed

with 100 [1l 70% ethanol, followed by brief centrifugation. The wash was








decanted, and the RNA pellets dried in vacuo and solubilized in sterile distilled

water at approximately 1 jig/Rl. Actual concentrations were determined by

spectrophotometric absorbance at 260 nm.


Preparation of HeLa S10 Cellular Extracts

HeLa cell S10 extracts were made according to a protocol described by

Brown and Ehrenfeld (27) as modified by Barton and Flanegan (14).

Approximately 2.5 liters of cells in log-phase growth at a density of

approximately 4.5 x 105 cells/ml (approximately 109 cells) were used for each

preparation. HeLa cells growing in suspension cultures in Joklik's modified MEM

(Life Technologies) supplemented with 5% bovine calf serum (Life Technologies)

and 2% Fetal Clone (Hyclone) were collected by centrifugation at 1,250 rpm

for 5 min in a JS-4.2 rotor (Beckman). The cells were washed with 2 liters of

isotonic buffer (Table 3) and pellets pooled together into a 50-ml conical tube

(Sarstedt). The final cell pellet was resuspended in 1.5 volumes of hypotonic

buffer (Table 3) and incubated on ice for 10 min with intermittent vortexing.

The cells were lysed by passing them 25 times in a glass Dounce

homogenizer (Wheaton) using an "A" pestle. The resulting homogenate was

equilibrated to the desired salt content with the addition of 0.1 volumes of a

1 Ox buffer containing 0.2 M HEPES (pH 7.4), 1.2 M KCH3CO, 40 mM

Mg(CH3CO2)2 and 50 mM DTT. The mixture was centrifuged at 2,000 rpm for

10 min at 4C in a JS 4.2 rotor (Beckman) to pellet the nuclei. The clarified

supernatant was poured into a 30-ml Corex tube and centrifuged at 10,000








rpm for 1 5 min at 4C in a JA-20 rotor (Beckman). The S10 supernatant was

transferred to a 50-ml conical tube (Sarstedt).

Nucleic acid was then removed from the S10 fraction. This was

accomplished by first adjusting the fraction to 1 mM CaCIL2 by the addition of

1/100th volume 0.1 M CaCI2 and then adding 1 U/ml of 5 g/ml

micrococcalnuclease (Sigma). Reactions were incubated at 20C for 15 min.

The digestions were terminated with the addition of EGTA (pH 7.5) to a final

concentration of 2 mM. The S10 extracts were then transferred to a 30-ml

Corex tube and centrifuged again at 10,000 rpm at 4C for 15 min in a JA-20

rotor. Finally, the supernatant was aliquoted into microfuge tubes in convenient

single-use volumes (100-250 1.d) and stored at -70C until required.


Preparation of HeLa Initiation Factor Extracts

HeLa cell Initiation Factor (IF) extracts were made according to a

protocol described by Brown and Ehrenfeld (27) as modified by Barton and

Flanegan (14). HeLa cells growing in suspension cultures in Joklik's modified

MEM (Life Technologies) supplemented with 5% bovine calf serum (Life

Technologies) and 2% Fetal Clone (Hyclone) were harvested as described

above for the preparation of the HeLa S10 extracts. The cell pellet was

resuspended in 1.5 volumes of hypotonic buffer (Table 3) and incubated 10 min

on ice. The tube was occasionally vortexed.

The cells were lysed by passing them 25 times in a glass Dounce

homogenizer (Wheaton) using an "A" pestle. The resulting homogenate was








centrifuged at 2,000 rpm for 10 min at 4C in a JS 4.2 rotor (Beckman) in

order to remove the nuclei. The supernatant was decanted into a 30-ml Corex

tube and clarified by centrifugation at 10,000 rpm for 15 min in a JA-20 rotor

(Beckman). The S10 was then decanted into a 15-ml Ti 70.1 ultracentrifuge

tube (Beckman) and spun at 60,000 rpm at 4C for 1 h to pellet the

ribosomes. The supernatant was discarded.

The ribosomal pellet was resuspended in 1-2 ml hypotonic buffer (Table

3) with vigorous vortexing and stirring with a microbar at 4C for

approximately 45 min (or until fully resuspended). After resuspension, the

spectrophotometric absorbance at 260 nm of a diluted aliquot was

determined. Optimally, IF preparations had an optical density of 250 A260

units/ml, and further dilution of the ribosomal pellet was performed if

necessary.

Next, the ribosomes were adjusted to a higher potassium concentration

with the addition of KCI to a final concentration of 0.5 M. The ribosomes were

stirred with the microbar another 1 5 min at 4C. Then, the microbar was

removed and the ribosomes again pelleted by ultracentrifugation at 60,000

rpm for 60 min at 4C in a Ti 70.1 rotor. The clarified supernatant was

recovered into sterile dialysis tubing MWCO 12-14,000 (Spectra/Por) and

dialyzed for 2 h at 4C against 500 ml IF dialysis buffer (Table 3). The IF

extract was pipetted out of the dialysis tubing into a 15-ml conical tube

(Sarstedt) and placed on ice while aliquoting into microfuge tubes in convenient








single-use volumes (usually 50 j.1). The extracts were stored at -70C until

required.


Translation of Viral and Transcript RNAs In Vitro

Translation of viral and transcript RNAs was performed in a reaction

mixture containing 50% v/v HeLa S10 extract, 20% v/v translation initiation

factors from a HeLa cell ribosomal salt wash, 1 mM ATP, 0.2 mM GTP, 0.2 mM

UTP, 120 mM KCH3CO2, 3 mM DTT, 35 mM HEPES (pH 7.4), 25 mM creatine

phosphate (Boehringer Mannheim), 400 jg of creatine phosphokinase

(Boehringer Mannheim) per ml, 2 mM GuHCI (Amersham) and 1.2 mCi of

[35S]methionine per ml (1,200 Ci/mmol, Amersham). Reaction components

were combined while on ice and vortexed thoroughly before the addition of

RNAs. Viral RNAs were translated at a concentration of 25 gg/ml. Transcript

RNAs were translated at a concentration of 50 jig/ml. Translation reactions

were performed in a volume of 30 ji1. Reactions were incubated at 34C for the

indicated times.


Ouantitation of Radiolabelled Protein bv TCA Precipitation

Acid-precipitable radiolabelled product in the in vitro translation

reactions was determined by analysis of 1 il samples. Typically, samples were

taken at 0, 0.5, 1, 2 and 4 h. Samples were added to prepared borosilicate

tubes containing 100 gl 0.1 N NaOH and 1% casamino acids, and left at room

temperature until the final samples were taken. Then 2 ml of chilled 5% TCA








was added to each tube, which was then vortexed briefly and incubated on ice

for 10 min. The samples were filtered in a vacuum flask prepared with a filter

pre-wetted with 5% TCA. The filters were then washed three times with 5 ml of

5% TCA. The filters were added to vials, wetted with 5 ml CytoScint (ICN

Biomedicals) scintillation fluid, and counted using a Beckman LS5801 liquid

scintillation counter.


Resolution of Product Proteins byv Electrophoresis Through SDS-Polvacrylamide
Gels

Radiolabelled proteins were solubilized in protein sample buffer which

contained 2% SDS (Sigma), 62.5 mM Tris HCI (pH 6.8), 0.5% 2-

mercaptoethanol, 0.1% bromophenol blue and 20% glycerol. Proteins were

separated by SDS-polyacrylamide gel electrophoresis (PAGE) in 0.75 mm thick,

9-18% gradient polyacrylamide gels (29:1 acrylamide-bisacrylamide) containing

0.1% SDS and 187.5 mM Tris HCI (pH 8.8). Electrophoresis was performed in

a vertical apparatus (Hoeffer) for 45 mAp*h.


Fluorography of SDS-Polvacrylamide Gels

SDS-acrylamide gels were fixed in 50% TCA for at least 1 h. Gels were

then equilibrated with dimethylsulfoxide (DMSO) and fluorographed with 22%

2,5-diphenyloxazole (PPO, Fisher Scientific) in DMSO. Gels were then equilibrated

with water, dried, and exposed to Reflections film (DuPont) at -70C.








Formation of Pre-lnitiation Replication Complexes In Vitro

Pre-initiation replication complexes (PI-RCs) of viral and transcript RNAs

were formed in a reaction mixture containing 50% v/v HeLa S10 extract, 20%

v/v translation initiation factors from HeLa cells, 1 mM ATP, 0.2 mM GTP, 0.2

mM UTP, 60 mM KCH3CO2, 16 mM HEPES (pH 7.4), 30 mM creatine phosphate

(Boehringer Mannheim), 400 jIg of creatine phosphokinase (Boehringer

Mannheim) per ml and 2 mM GuHCI (Amersham). Reaction components were

combined while on ice and vortexed thoroughly before the addition of RNAs.

Viral RNAs were translated at a concentration of 25 !tg/ml, whereas transcript

RNAs were used at a concentration of 50 tig/ml. Typically, reactions containing

one RNA were performed in a volume of 50 td. Reactions in which two RNAs

were co-translated were performed in a volume of 100 1d. Reactions were

incubated at 34C for 4 h. Where indicated, reactions to form PI-RCs of

temperature-sensitive mutants were further incubated for 5-30 min at 39.5C in

a heat inactivation step. Complexes were isolated by centrifugation at 15,000

x g at 4C for 15 min. Supernatants were carefully removed and the pelleted

PI-RCs placed on ice.


Replication of Viral and Transcript RNAs In Vitro

Pelleted PI-RCs were resuspended in 50 [d of a labelling mix comprised of

25 itl of S10 buffer (Table 3), 5 dpJ of 1 Ox nucleotide reaction mix without CTP

(10 mM ATP, 2.5 mM GTP, 2.5 mM UTP, 600 mM KCH3CO2, 155 mM HEPES (pH

7.4), 300 mM creatine phosphate (Boehringer Mannheim) and 4 mg of creatine








phosphokinase (Boehringer Mannheim) per ml), and [ca-3P]CTP (Amersham)

adjusted to a final concentration of 5 VM. The balance of the 50 t1 reaction

volume was sterile distilled water. Unless otherwise noted, replication reactions

were performed with 400 [tCi [a-3P]CTP (10 mCi/ml, Amersham) per ml of

reaction volume. Reactions were incubated at the indicated temperatures for

the indicated times. Most reactions with temperature-sensitive mutants were

labelled for 1 h at 39.5C, a restrictive temperature for all such mutants

described in this study. Most reactions with mutants with a replication-

negative phenotype were labelled for 1 h at 37C. The reactions were stopped

with the addition of 350 l of 0.5% SDS buffer (Table 3).


RNA Isolation

RNA was isolated from replication reactions or polymerase assays by

three sequential extractions with 600 [l phenol:chloroform:isoamyl alcohol

(25:24:1) which had been water saturated and equilibrated with 50 mM Tris-

HCI, followed by an extraction with chloroform:isoamyl alcohol (24:1). Purified

RNA was precipitated with the addition of 900 [i 100% ethanol and incubated

at -20C overnight. RNA was recovered by centrifugation at 15,000 x g for 15

min at 4C.


Resolution of Product RNAs by Electroohoresis Through Denaturing Agarose
Gels

Dried virion RNA (vRNA) pellets were solubilized in 30 p] of methylmercury

hydroxide sample buffer (Table 3). The RNAs were then fractionated by








electrophoresis through 3 mm-thick 1 % agarose gels containing 5 mM

methylmercury hydroxide (Alfa) in a vertical apparatus (Hoeffer) for

approximately 175 mAp*h. The gels were rinsed briefly in 0.5 M NH4CH3CO2

and stained with 1 fLg/ml ethidium bromide in 0.5 M NH4CH3CO. Stained gels

were visualized with uv light and photographed, then dried in vacuo and

exposed to Reflections (DuPont) film with an intensifying screen.


Polvmerase Assays on Exogenous Template

Assays for polymerase activity on a purified exogenous template were

performed essentially as described (14). Reactions were performed in a

volume of 30 RI and contained 50 mM HEPES (pH 8.0); 3 mM MgCI 2; 10 mM

DTT; 0.5 mM unlabelled ATP, GTP and UTP; 10 [tCi [a-32p]CTP (10 mCi/ml,

Amersham); 2 Rg vRNA template; 45 ng oligo (U) primer and 2.5 Vd in vitro

translation product. The reactions were incubated at 30C for 1 h. Reactions

were stopped with the addition of 270 tl of 0.5% SDS buffer (Table 3).

Product RNA was isolated as described above and resolved on a denaturing

agarose gel.


Quantitation of Radiolabelled Products on Gels

Radiolabelled bands on gels were quantitated by scanning to a

phosphorimager (Molecular Dynamics). Analysis of the bands of interest was

done using the accompanying software by ImageQuant. Briefly, bands chosen

for analysis were boxed with grid or rectangular tools, then a volume report






52

was made. Representative background signal was subtracted from each band

of interest.












CHAPTER 3
SCOPE OF THE INVESTIGATION


The poliovirus replication proteins are all required for viral RNA synthesis.

The genomic organization of the replication proteins is such that the four

required proteins 3A, 3B, 3C and 3D are located on the precursor P3, and each

of these has a required function at the site of initiation. One hypothesis for the

initiation of viral replication is that these proteins are delivered in precursor

form and cleaved as needed at the point of initiation. This model is consistent

with the finding that 3CD and 3AB form RNP complexes near the ends of

poliovirus RNAs, coupled with the fact that these two precursors contain the

required polymerase and genome-linked proteins, 3DPOl and 3BvPg. If delivery of

these four proteins to the RNP complex is in the form of P3, then it would be

expected that mutants in the polymerase (or 3Cpro/3CDPro or 3BvP9) could be

complemented with wild-type P3, but not with smaller precursors. Alternatively,

if delivery of the four individual proteins occurs in the form of 3AB plus 3CD, or

a combination of smaller proteins, then it would be expected that rescue of a

polymerase mutant could occur with a precursor smaller than P3.

Although P3 is an abundant precursor for replication and therefore

would be a plausible candidate protein for entry into the replication complex en






54

toto, an alternative mechanism for delivery of the replication machinery is also

possible. The polymerase, by definition absolutely required for replication, may

alternatively have two distinct functions, one in an initiation step and a

separate function as an elongating polymerase. This model implies that a

precursor of the polymerase would be required for one step in replication, while

a second molecule of the mature polymerase would be required for a

subsequent step in replication. A similar dual-role model for the genome-linked

protein could also be surmised, whereby the mature protein and its precursors

have different functions.

The scope of this investigation is to determine the forms of the

polymerase and the genome-linked protein which enter the replication complex,

whether as precursor or mature protein, and to distinguish between the two

models of replication outlined above. The methods designed to determine these

results were the in vitro complementation of polymerase and VPg mutants with

defined precursors of poliovirus replication proteins. Some mutants assayed

by complementation were also characterized using a cell-free replication

system.

Discovery of the protein configuration required for delivery of the

polymerase and the genome-linked proteins in a natural infection would

constitute considerable advancements in the understanding of poliovirus RNA

replication. Since the genomic organization of other small positive-strand RNA

viruses is the same as that of poliovirus, and because many of these contain a

high degree of similarity in the polymerase coding region, it is likely that other






55

related viral families and genera use a similar strategy for initiation and

replication and that these results may also be applicable to other viral

systems.











CHAPTER 4
ANALYSIS OF POLYMERASE MUTANTS


Translation and Processing of 3D-M394T are Wild-Type

Translation and processing of 3D-M394T virion RNA was compared to

wt Mahoney type 1 RNA. RNAs were isolated from purified virions as described

in Chapter 2. The RNAs were then translated in vitro in the presence of 1.2 mCi

[35S]-met per ml (Figure 3, lanes 2 and 4). These results showed that 3D-

M394T protein products were made to wt levels and processed normally and

confirmed the results reported by Barton et al. (17).


Characterization of the Replication Deficit of the Mutant at the Restrictive
Temperature

Experiments were designed to compare the level of RNA synthesis of the

mutant at the permissive and restrictive temperatures using pre-initiation

replication complexes (PI-RCs). High-level RNA synthesis from PI-RCs requires

that the initiation and elongation of negative strands be normal, as well as the

initiation and elongation of positive strands. RNA synthesis of the wild-type

virus is just as vigorous at 39.5 as it is at 34C, indicating that the wild-type

virus is not altered in any of these four steps in viral replication by incubation at

39.5C (see Figure 5). It was clear that 3D-M394T was an RNA-negative










I- -" J
0)W 0) 04
CCO < CO O .
.X 0 > 0 0
o o o o o c* o U
o X 0 7 00 0 0 0
0 (a0 6 Q6 ^ O 0
5 5 S w S_ I- S C 5 c')


P3 -
3CD

P21- if i


2BC -

2C -
VP1-
VP2 -

VP3 W w





2A .
3AB -



1 2 3 4 5 6 7 8 9 10 11







Figure 3 Translation of 3D Constructs. In vitro translation reactions
in HeLa S10 extracts were performed with RNAs from the different polymerase
mutants in the presence of 1.2 mCi [35S]-met per ml. The 25 41 reactions were
incubated at 34C for 4 h. Ten dpJ of each reaction was added to 100 il 1 x
Laemmli sample buffer, heated to 100C for 4 min, and a 20 [d aliquot was
loaded onto a 9-18% SDS gradient gel as follows: lanes 1, 3, 5, 7, 9 and 11,
mock reactions without any added RNA; lane 2, Mahoney vRNA; lane 4, 3D-
M394T vRNA; lane 6, T7D A(83) RNA; lane 8, 3D-V391 L RNA; lane 10, 3D-
G327M RNA. Proteins were separated for 45 mAp*h. The gel was dried and
fluorographed.









mutant at the higher temperature (17), and further characterization of the

defect was performed.

Assays using PI-RCs were done to compare overall replication of 3D-

M394T at 34C, its optimal permissive temperature, and 39.5C, the restrictive

temperature. Replication was measured for 1 h at both 34C and 39.5C to

provide sufficient time for the synthesis of both negative and positive strands

(Figure 4). A comparison of the amount of radiolabel incorporated into full-

length product as measured by phosphorimager analysis showed that the

mutant replicated only 3% as well at the higher temperature as it did at the

permissive temperature. Clearly, this was a significant defect in total RNA

synthesis. The product generated at 39.5C in this assay was full-length,

however, indicating that the elongation activity of the polymerase was intact

under these conditions.


Mutant 3D-M394T Polymerase is Irreversibly Inactivated at the Restrictive
Temperature

Experiments to further characterize the thermosensitive mutant were

designed in order to determine whether the mutant polymerase, once heated to

the restrictive temperature, would regain activity if returned to the permissive

temperature. Assays using PI-RCs were modified to include a heating step to

the restrictive temperature. In these experiments, after 4 h of translation in

the HeLa extracts, reactions were shifted to 39.5C for 30 min. Then,












011 I2
0 1 2 3 4 5


I ranslalion in neLa erdXLrdLL WILFl
2 mM Guanidine HCI (Form PI-RCs)


t RNAU
SRNA


B. Replication Temp. (C)

GuHCI


34 34 39.5

+ -


- vRNA


I!


1 2 3



Figure 4 Total RNA Replication of 3D-M394T is Significantly
Inhibited at 39.5C. 3D-M394T RNA was added to HeLa S10 translation
reactions containing 2 mM GuHCI and incubated at 34C for 4 h to form PI-RCs
as outlined in A. Replication was measured for 1 h at 34C (B, lanes 1 and 2)
or 39.5C (lane 3) in reactions containing 400 .Ci [32P]CTP per ml. 2mM GuHCI
was included in 1.


Time (h)


1. Centrifuge the reaction at 1 5,000 x g to pellet PI-RCs
2. Discard the supernatant

3. Resuspend the pelleted fraction (i.e. PI-RCs) in
replication buffer with [J-2P]CTP
4. Continue incubation at desired temperature








preinitiation complexes were recovered as before and assayed for 1 h at the

permissive temperature. If the mutation resulted in a reversible defect, the

mutant polymerase would allow replication of the input RNA despite the heating

step. If, however, the mutation results in irreversible inactivation after the

heating step, then no replication would be detected in this experiment.

Variations on this experiment to further refine the temperature sensitive

phenotype of 3D-M394T were also planned. In these experiments, reactions

which were heated for various amounts of time were compared for their ability

to replicate when returned to the permissive temperature. Results from such

experiments are described below.

Assays using PI-RC's were performed to determine if the temperature-

sensitive defect in 3D-M394T was reversible. After translation, reactions were

incubated for 30 min at 39.5C prior to recovery of the PI-RCs. Replication was

assayed at 34C for 1 h, sufficient time for both negative and positive strands

to be made. These results showed that 30 min of incubation at the restrictive

temperature irreversibly disrupted the mutant protein (Figure 5), since no

replication was detected in lanes 3 or 4.


Mutant 3D-M394T Polymerase is Defective for Negative-Strand Production

Further analysis of the time required at the restrictive temperature to

inactivate the mutant polymerase was performed. Analysis was made both by

assaying for polymerase activity within replication complexes, and polymerase

activity on exogenous RNA templates. For the analysis of complex-associated
















Preincubation
Assay Temp. (C)


3D-M394T
+ +


34


34 34


39.5


Mahoney
4 43+ +
34 34 34 39.5


GuHCI +


+


vRNA-











1 2 3 4 5 6 7 8




Figure 5 Irreversible Heat Inactivation of 3D-M394T PI-RCs. Pl-
RCs were formed with 3D-M394T and wt Mahoney RNAs by allowing translation
for 4 h at 34C in the presence of 2 mM GuHCI. Reactions were then incubated
for 30 min at 34C (lanes 1, 2, 5 and 6) or 30 min at 39.5C (lanes 3, 4, 7 and
8). PI-RCs were isolated by centrifugation and resuspended in replication-
competent buffer containing 400 [Ci [a-32P]CTP per ml. The reactions were
then incubated for 1 h at 34C (lanes 1, 2, 3, 5, 6 and 7) or 39.5C (lanes 5
and 8). Two reactions also included 2 mM GuHCI (lanes 1 and 5). The RNAs
were recovered and separated by electrophoresis on a CH3HgOH-1 % agarose
gel for 180 mAp*h. The gel was dried and autoradiographed with an
intensifying screen.






62

polymerase, replication reactions were terminated after 20 min to examine the

effect on negative-strand production. After translation, samples were heated

to 39.5C for 0, 5, 10 and 15 min before assaying for replication of negative

strands for 20 min (Figure 6). This experiment showed that 70% of the

activity of the mutant was irreversibly inactivated after only 5 min of incubation

at 39.5C (lane 3), and over 95% of the activity was lost after 10 min (lane 4).

In contrast, the wild-type control was only slightly affected by the heating step,

and lost 30% of its activity after 10 min (lane 9). These results showed that

most of the complex-associated mutant polymerase was inactivated after only

5 min at the restrictive temperature. These results also showed that the 3D-

M394T mutation inhibited the initiation of negative-strand synthesis.

Evaluation of the time required to inactivate soluble 3D-M394T

polymerase activity on exogenous templates was also performed. For these

assays, wild-type and mutant RNAs were translated in vitro as described in

Chapter 2, then heated to 39.5C for 0, 5, 10 and 15 min. Complexes were

pelleted, and aliquots of 2.5 R1 from the supernatants were added to reactions

with exogenous vRNA template and oligo (U) primer as described in Chapter 2.

Previously it had been shown that reactions of this type without the addition of

exogenous vRNA template resulted in no detectable product (14). Product RNA

from the experiment shown in Figure 7 was recovered and resolved on a

CH3HgOH agarose gel. The results of this experiment showed that only 20% of

the activity was lost after 5 min of incubation at 39.5C (Figure 7, lane 3), and















3D-M394T
Prelncubatlon (min) 0 0 5 10 15
GuHCI + -


1 2 3 4


Mahoney
0 0 5 10 15


II"


5 6 7 8 9 10


Figure 6 Heat Inactivation of Negative-Strand RNA Synthesis in
3D-M394T PI-RCs. PI-RCs were formed with 3D-M394T and wt Mahoney
RNAs by allowing translation for 4 h at 34C in the presence of 2 mM GuHCI.
The reactions were then further incubated a total of 15 min at either 34C or
39.5C as follows: 15 min at 34C (lanes 1, 2, 6 and 7); 10 min at 34C, and
then 5 min at 39.5C (lanes 3 and 8); 5 min at 34C, and then 39.5C for 10 min
(lanes 4 and 9); or 15 min at 39.5C (lanes 5 and 10). PI-RCs were then
recovered by centrifugation and resuspended in a replication mixture containing
400 RCi [a-32P]CTP per ml and incubated at 34C for 20 min. GuHCI (2 mM)
was added to two reactions (lanes 1 and 6). The RNAs were recovered and
separated by electrophoresis on a CH3HgOH-1% agarose gel for 180 mAp*h.
The gel was dried and autoradiographed with an intensifying screen.


vRNA-


I R


I m













3D-M394T


Mahoney


Preincubatlon (min) 0


0 5 10


vRNA- 0 .
















1 2 3 4


15 0 0 5 10 15


q yPq















5 6 7 8 9 10


Figure 7 Polymerase Assay of 3D-M394T on Exogenous Template
Shows a Decay in Elongation Activity. 3D-M394T and Mahoney vRNAs
were translated in vitro for 4 h at 34C. The reactions were then further
incubated a total of 15 min at either 34C or 39.5C as follows: 15 min at 34C
(lanes 1,2, 6 and 7); 10 min at 34C, and then 5 min at 39.5C (lanes 3 and 8);
5 min at 34C, and then 39.5C for 10 min (lanes 4 and 9); or 15 min at 39.5C
(lanes 5 and 10). Aliquots of 2.5 I1 were removed and added to polymerase
reactions containing vRNA template, oligo (U) primer and 200 [iCi [a-32P]CTP
per ml. Reactions were incubated 1 h at 30C. RNAs were recovered and
resolved on a denaturing agarose gel for 180 mAp*h. The gel was dried and
autoradiographed with an intensifying screen.








after 15 min the polymerase had lost 82% of its activity on the exogenous

template (Figure 7, lane 5). A graphical comparison of the activities of the 3D-

M394T mutant polymerase as represented in Figures 6 and 7 was shown in

Figure 8. These results show that the inactivation rate of the polymerase

differs between these two types of analyses and suggest a dual function for

the enzyme.


Polvmerase Mutant 3D-M394T has a Wild-Type Negative-Strand Chain
Elongation Rate

In order to discover whether the replication defect of this mutant affects

the synthesis of negative strands or of positive strands, experiments were

designed to take advantage of the synchronous replication of input RNA which

occurs when the PI-RCs are resuspended in replication buffers lacking GuHCI. No

longer inhibited by the drug, the preinitiation complexes all begin to synthesize

first negative strands, then positive strands. By altering the precise time at

which a reaction is terminated, comparison can be made of solely negative

strand replication, or of both negative and positive strand replication.

Next, assays were designed to test whether the negative-strand defect

occurred at the initiation step or the elongation step, or both. By comparing

the elongation rate of the mutant at the restrictive temperature with its wild-

type parent Mahoney type 1 poliovirus, elongation defects could be detected.

For this experiment, both RNAs could be translated, then assayed for

replication at 39.5C. By removing reaction aliquots at various times after















A. 3D-M394T Polymerase


125%-






100%-


U
a)
,<

(D
75%.
0)
E
0
0.~
0)
S50%






25%






0%


125%-






100%-



CD
0)
U)
e 75%
a)
E

0-
0)

- 50%-
CO


25% -






0%


I I
Ln C


Time of Inactivation


Time of Inactivation


Figure 8 Heat-Inactivation Profile of 3D-M394T Polymerase.
Comparison was made of the rate of inactivation of the mutant (A) and wt (B)
polymerases in assays detecting activity on endogenous (hatched) and
exogenous (gray) RNA templates. Quantitation of full-length radiolabelled RNA
was made by phosphorimager analysis of the dried gels shown in Figures 6 and
7. A value of 100% was assigned to those reactions which had not been
subjected to heat treatment for each assay. These values were compared to
the amount of RNA detected after 5, 10 and 15 min of incubation at 39.5C.


I ,'," F. . . ..


I


B. Mahoney Polymerase








resuspension in the replication buffer and analyzing the resultant RNA on

denaturing gels, elongating chains could be visualized over time. Comparison of

the chain-elongation rates of the mutant and the wild-type would confirm or

disprove an elongation defect in the mutant. A difficulty with this experiment

was the poor replication of the mutant at this high temperature, making

elongating chains very difficult to detect even after long exposures. This could

be overcome, however, by resuspending both the wild-type and the mutant

reactions at 5 tM CTP, while increasing the specific radioactivity of the

radiolabelled reaction with the mutant to increase the signal.

Since the earlier results (Figure 6) impled that the defect was in overall

negative-strand synthesis, experiments were designed to distinguish whether

the mutant polymerase was defective for initiation, or for elongation, or both.

Both wild-type and mutant vRNAs were translated, then assayed for replication

at 39.5C for 6 to 16 min. Replication assays were performed at 5 PM CTP,

and adjusted to a higher specific activity for the more poorly replicating

mutant. The results of this experiment showed an identical chain-elongation

rate of 800 nucleotides per minute for both the mutant and the 3D-M394T

polymerases. For both viruses, full-length chains were first evident after 10 min

of replication (Figure 9). Therefore, 3D-M394T polymerase was capable of

elongation at the normal rate for those strands which did initiate. The deficit

for this mutant was found to be in its ability to initiate negative strand

synthesis.














Mahoney


3D-M394T


Time 6 8 10 12 14 16

Length
9500-
7500- 0 4 M


6 8 10 12 14 16



-VRNA


4400-

2400-


1400-


1 2 3 4 5 6


7 8 9 10 11 12


Figure 9 Elongation of Negative-Strand RNA Within 3D-M394T
RNA Replication Complexes is Not Inhibited at 39.5C. PI-RCswere
formed with Mahoney and 3D-M394T RNAs by allowing translation for 4 h at
34C in the presence of 2 mM GuHCI. Complexes were isolated by centrifugation
and resuspended in replication mixtures containing 200 1Ci [a-32P]CTP per ml or
1 mCi [a-32P]CTP per ml for the wt and mutant PI-RCs, respectively. Reactions
were then incubated for the indicated periods of time (minutes) at 39.5C. The
product RNAs were recovered and separated by electrophoresis on a
CH3HgOH-1% agarose gel for 180 mAp*h. The gel was dried and
autoradiographed with an intensifying screen. The lengths (nucleotides) of the
growing RNA chains are indicated.






69

Polymerase Mutant 3D-M394T is Defective for the Initiation of Both Negative
and Positive Strands

To compare the replication of negative strands at the permissive and

restrictive temperatures, assays of PI-RCs were planned which terminated

replication after 20 min. This allowed sufficient time for full-length negative

strands to be formed, but the nascent positive-strand chains were not yet full-

length. By comparing the amount of radiolabelled CTP incorporated into full-

length strands using phosphorimager analysis of the dried gels, the relative

degree of defect seen in total negative-strand replication could be quantitated.

The results of such an experiment were shown in Figure 10. Comparison of

lanes 2 and 3 showed a 30% defect in negative-strand synthesis after 20 min

at 39.5C. No replication was detected in the presence of GuHCI (lane 1).

Experiments were also performed to determine whether the mutant was

defective for the production of positive strands as well as for negative strands.

For these assays, it was necessary to compare the amount of replication at

the permissive temperature to the amount of replication seen when heating to

the restrictive temperature is delayed until after negative-strand synthesis had

initiated. Therefore, after isolation of the pre-initiation replication complexes,

two separate reactions were incubated for 12 min at 34C in the presence of

radiolabel (Figure 10, lanes 4 and 5). At 12 min, one reaction was shifted to

39.5C for an additional 18 min (Figure 10, lane 5). This allowed for negative-

strand synthesis to initiate at the permissive temperature and positive-strand

synthesis to initiate at the nonpermissive temperature. The results of this


















Assay Temp. (C)

GuHCI


(-) Strand
Synthesis

34 34 39.5


(-) and (+) Strand
Synthesis
34/
34 39.5 39.5


vRNA-


I!


1 2 3 4 5 6


Figure 10 3D-M394T is Thermosensitive for Both Negative and
Positive Strand Initiation. PI-RCs were formed with 3D-M394T RNAs by
allowing translation for 4 h at 34C in the presence of 2 mM GuHCI. Complexes
were isolated by centrifugation and resuspended in replication mixtures
containing 200 jCi [a-32P]CTP per ml. Reactions were then incubated as
follows: lanes 1 and 2 at 34C for 21 min, lane 3 at 39.5C for 12 min, lane 4
at 34C for 42 min, lane 5 at 34C for 12 min, then a further 18 min at 39.5C
and lane 6 at 39.5C for 24 min. GuHCI was added back to the reaction in lane
1. The product RNAs were recovered and separated by electrophoresis on a
CH3HgOH-1% agarose gel for 180 mAp*h. The gel was dried and
autoradiographed with an intensifying screen.








assay were compared to those which were maintained at the permissive

temperature for a total of 42 min (lane 4), or at 39.5C for a total of 24 min

(lane 6). Appropriate incubation times and time of shift-up were determined by

careful analysis of multiple experiments done to show the chain-elongation rates

at various temperatures. The results of these experiments showed that 18 min

or 10 min were required for the synthesis of full-length product RNA at 34C or

39.5C, respectively. By comparing the experimental and control reactions as

described, the mutant's defect in positive strand synthesis could be detected

and compared to the negative-strand synthesis defect. Quantitation by

phosphorimager analysis was performed in 3 separate experiments. Results

reported below were from the average of these 3 experiments.

Comparison of lanes 2 and 3 of Figure 10 indicated that the amount of

negative-strand RNA synthesized at 39.5C was about 30% of the amount

synthesized at 34C. Likewise, comparison of lanes 4 and 5 showed that the

amount of positive-strand RNA synthesis at 39.5C was 25% of the amount

synthesized at 34C. The amount of positive-strand RNA synthesis in lanes 4

and 5 was estimated by subtracting the amount of negative-strand RNA

synthesized in lane 2 from the total amount of radiolabelled RNA synthesized in

lanes 4 and 5. These results indicated that the initiation of positive-strand

synthesis was significantly inhibited at 39.5C.

Another example of the inhibition of positive-strand RNA synthesis was

seen by comparing lanes 3 and 6. In this case, about the same amount of

labelled RNA was synthesized in both reactions. In 3 repeated experiments, the








amount of radiolabel incorporated into the RNAs in lanes 3 and 6 differed by

about 10%. This indicated that positive-strand synthesis was almost

completely inhibited at 39.5C (lane 6), assuming that the same amount of

negative-strand RNA (lane 3) was synthesized in both reactions.


Characterization of Polymerase Mutant 3D-V391 L

The mutant construct 3D-V391 L was constructed by site-directed

mutagenesis of the plasmid T7D (A)83 clone (18). The mutagenic

oligonucleotide used was pCTTATCATCCACTAATGCCAATGAAG, which anneals to

the wt poliovirus sequence at nucleotide positions 7145-7171. This

oligonucleotide was constructed to change the wt GUA valine codon to the

mutant CUA leucine codon at amino acid 391 of the 3D coding region. The

selection oligonucleotide used disrupted a unique Fspl (Table 2) site in the non-

poliovirus sequence of the parent clone, and contained the sequence

pGGCAACAACGTGQGCGCCAACTATTAAC. A transformant which contained the

desired mutation was named pLES25 (Table 4) and sequenced throughout the

P2 and P3 regions of the genome and within the non-coding regions. This

sequence analysis reconfirmed the presence of the desired mutation. In

addition, two silent changes and one conservative change were noted. One

silent mutation was in the 3A coding sequence at position 5329 (wt nucleotide

sequence) and changed a GCT alanine codon to GCG. Another silent mutation

was in the 3C sequence and changed a GGA glycine codon at position 5737 to














TABLE 4: Sizes of RNA Transcripts


Plasmid Name Proteins Expressed RNA Transcript Size
pLES16 P23 5.3 Kb
pLES17 P3 3.6 Kb
pLES21 3CD 3.3 Kb
pLES19 3D 2.7 Kb
pLES23 3AB 3.1 Kb
pLES24 3B 2.8 Kb
pLES25 P1 23, 3D-V391L 7.5 Kb
pLES26 P123, 3D-G327M 7.5 Kb
Y3F P1 23, 3B-Y3F 7.5 Kb
R17K P123, 3B-R17K 7.5 Kb
P1 + capsidd) 3.9 Kb








a GGG glycine codon. The conservative change was within the 2A coding region

and changed a GCT alanine codon to a GGT glycine codon at position 3655.

Plasmid pLES25 was linearized with Mlul and transcribed. The resultant

RNA was confirmed to be intact and of appropriate size (Table 4). The RNA

was then translated in vitro in the presence of 1.2 mCi [35S]-met per ml (Figure

3, lane 8). These results showed that the protein products were processed

normally, and confirmed that the conservative alanine-glycine change in 2A did

not interfere with the protease activity associated with 2A. Translation with

this construct was slightly lower than with the wt in repeated experiments.

The 3D-V391 L RNA was also assessed for its ability to support RNA

replication in the HeLa S10 extracts. Originally described as a temperature-

sensitive mutant (63), replication assays confirmed that the construct

replicated optimally at 37C, and less well at 39.5C and 34C (data not

shown). Replication at 30C was not detected. Overall replication was poor

even at 37C.


Polvmerase Mutant 3D-V391L Also has a Wild-Type Negative-Strand Chain
Elongation Rate

In order to determine whether the replication defect of the 3D-V391 L

mutant was similar to nearby mutant 3D-M394T, experiments were designed to

test whether this mutant also was defective for initiation, and not elongation.

These experiments were modelled after those shown in Figure 9. Both wild-type

and mutant transcript RNAs were made and purified. These were translated in








standard in vitro reactions as described in Chapter 2. Replication was then

assayed at 39.5C for 6 to 16 min. Replication assays were performed at 5

pM CTP, and adjusted to a higher specific activity for the more poorly

replicating mutant. For both polymerases, full-length chains were first evident

after 12 min of replication (Figure 11). Therefore, it could be concluded that

both the wt and the 3D-V391 L polymerases had an identical chain-elongation

rate of 700 nucleotides per minute. As seen with mutant 3D-M394T, 3D-V391 L

polymerase was capable of elongation at the normal rate for those strands

which did initiate. The deficit for this mutant was, therefore, in its ability to

initiate negative strand replication.


Construction and Characterization of Polymerase Mutant 3D-G327M

The mutant 3D-G327M was constructed by site-directed mutagenesis of

a derivative of the plasmid T7D (A)83 clone (18). This parent clone, named

DJB22, encodes a ribozyme sequence which is capable of removing the 5' GG

sequence of the resultant transcript, thus repairing the RNA to the wt sequence

at the 5' end. The mutagenic oligonucleotide used was

pGATTGCCTATATGGATGATGTAATTGC, which annealed to the wt poliovirus

sequence at nucleotide positions 6955 to 6982. This oligonucleotide was

constructed to change the wt GGT glycine codon to the mutant ATG methionine

codon at amino acid 327 of the 3D coding region. The selection oligonucleotide

used was the same used for the construction of pLES25 above.














WT


Time 6 8 10 12 14 16


3D-V391L

6 8 10 12 14 16


Length
9500-
7500-

4400-

2400- -


, -vRNA


1 2 3 4 5 6 7 8 9 10 11 12









Figure 11 Elongation of Negative-Strand RNA Within 3D-V391L
RNA Replication Complexes is Not Inhibited at 39.5C. Large-scale Pl-
RCs were made with either T7D A(83) RNA (lanes 1-6) or 3D-V391L RNA
(lanes 7-12). Each reaction was performed in 500 il, and was translated for 4
h at 34C. PI-RCs were then recovered by centrifugation, and resuspended in
replication buffer containing either 400 RtCi/ml CTP (T7D (A)83) or 1 mCi/ml
CTP (3D-V391 L) and adjusted to a final concentration of 5 VM CTP. The
different specific activities were chosen for optimal exposure in the same
experiment. Labelling was performed at 39.5C for 6 min (lanes 1 and 7), 8
min (lanes 2 and 8), 10 min (lanes 3 and 9), 12 min (lanes 4 and 10), 14 min
(lanes 5 and 11), and 16 min (lanes 6 and 12). Labelled RNAs were recovered
and resolved on a denaturing agarose gel for 175 mAp*h. The gel was dried
and autoradiographed with a screen.








A transformant which contained the desired mutation was named

pLES26 (Table 4) and sequenced throughout the P2 and P3 regions of the

genome and within the non-coding regions. This sequence analysis reconfirmed

the presence of the desired mutation. In addition, two silent changes in the 3C

sequence were noted. One changed an ACA threonine codon to an ACG

threonine codon at position 5437, and the other changed GGA glycine codon at

position 5737 to a GGG glycine codon. In addition to these changes, the parent

clone and pLES26 contained a change in the 3DPo1 coding region derived from

an infectious clone of poliovirus but differing from the published consensus

sequence. This change was a C to T transition at position 6261 and resulted in

a isoleucine at this position rather than a threonine. This change has no known

effect on either polymerase activity or infectivity.

Plasmid pLES26 was linearized with Mlul and transcribed with T7 RNA

polymerase. Resultant RNA was confirmed to be intact and of appropriate

size (Table 4). The RNA was then translated in vitro in the presence of 1.2 mCi

[35S]-met per ml (Figure 3, lane 10). These results showed that the protein

products were made to higher than wt levels. The augmentation of protein

synthesis may be due to the ribozyme background of this clone and the

authentic 5' end of the RNA template. The results in Figure 3 also showed that

processing of the viral proteins was normal.










CHAPTER 5
TWO DISTINCT ROLES FOR THE VIRAL POLYMERASE IN RNA REPLICATION
t

Cloning of Complementing Constructs

Clones containing cDNA sequence encoding wild-type poliovirus proteins

P23, P3, 3CD and 3D were generated using standard DNA procedures as

described in Chapter 2. Inserts containing the coding region of interest were

generated by pcr and vectors were prepared by restriction of plasmid DNA.

Complementing constructs were cloned into plasmids with a background of

poliovirus cDNA.

Preparation of pcr inserts used custom oligonucleotides (BRL or Fisher)

as summarized in Table 5. Each upstream primer contained the coding region

for the Smal restriction enzyme, a novel unique site in these poliovirus cDNA

clones, followed by sequence from the consensus for optimal translational start

as determined by Kozak (75-77) and coding sequence from the upstream gene

of interest. Downstream primers were made to abut the Mscl site in the 3DPOI

coding region (see Tables 2 and 5). Pcr reactions were performed for 30

cycles under the following conditions: denaturation at 94C for 30 s, annealing

at 2C below the lowest Tm of the primer pair (Table 5), and elongation at

72C for 45 s (3D), 60 s (3CD and P3) or 90 s (P23). Per products were

purified as described in Chapter 2.
















TABLE 5: Oligonucleotides Used for Cloning Complementing Constructs


plasmid upstream oligo Tm annealing downstream oligo Tm annealing insert
name position (wt) position (wt) size
pLES16 pGGGCCACCATG 54 3386 (2A) pCCAGCATAGTG 62 6233 (in 3D) 2862 bp
(P23) GGATTCGGACAC GTCTACTGC
CAAAAC
pLES17 pCCCGGGCCACC 56 5111 (3A) pCCAGCATAGTG 62 6233 (in 3D) 1137 bp
(P3) ATGGGACCACTC GTCTACTGC
CAGTATAAAG
pLES21 pCCCGGGCCACC 56 5438 (3C) pCCAGCATAGTG 62 6233 (in 3D) 810 bp
(3CD) ATGGGACCAGGG GTCTACTGC
TTCGATTAC
pLES19 pCCCGGGCCACC 50 5987 (3D) pCCAGCATAGTG 62 6233 (in 3D) 261 bp
(3D) ATGGGTGAAATC GTCTACTGC
CAGTGG
pLES23 pCCCGGGCCACC 56 5111 (3A) pCCCGGGTTACT 54 5437 (3B) 353 bp
(3AB) ATGGGACCACTC ATTGTACCTT-GC
CAGTATAAAG TGTCCG
pLES24 pCCCGGGCCACC 60 5372 (3B) pCCCGGGTTACT 54 5437 (3B) 89 bp
(3B) ATGGGAGCATAC ATTGTACCTTTGC
ACTGGTTTACC TGTCCG








Vector DNA was prepared by digestion of plasmid DJB2 (Barton,

O'Donnell and Flanegan, unpublished results) with Mscl and isolation of a 4109

bp fragment. DJB2 is a derivative of the T7D (A)83 clone (18) with an internal

deletion in the coding sequence, and for these cloning purposes use of the

original full-length clone would have been equivalent. Mscl cuts at several

positions within the cDNA of the poliovirus genome but not in the vector

sequence of DJB2 (Table 2). Therefore, restriction with Mscl results in several

fragments. The fragment of interest was 4109 bp, and comprised nucleotides

0-629 and 6234-7441 (wt sequence). This fragment contained the vector

sequence of the parent, the sequences in the 5' non-coding region required for

replication and IRES-driven translation, a portion of the 3D coding region, the 3'

non-coding region of the virus and the poly(A) tail. This cloning strategy

retained the stem-loop structures of the IRES, however, the spacer region

between the 3' end of the IRES and the natural translational start site was

eliminated in the resulting plasmids. After restriction, the DNA was

phosphatase-treated and purified as described in Chapter 2.

Ligation of insert and vector was performed as described in Chapter 2.

Competent E. coli SURE cells (Stratagene) were transformed with ligated

products as described. Transformants were isolated and resulting plasmids

were screened by restriction digest for size and orientation of insert. Plasmids

pLES-1 6 and -17 were screened with Nsil (Table 2). Plasmids pLES-19 and -21

were screened with Ndel/EcoRV double digests (Table 2). Clones which

restricted properly were confirmed by sequence analysis. Sequences from








pLES1 6, pLES21 and pLES1 9 constructs were wt other than the variant

sequence in the 3DPO' coding region described above for pLES26. In addition,

the sequence for pLES1 7 showed a nucleotide change which resulted in a silent

change in a glycine codon corresponding to wild-type position 5737 in the 3C

coding region. Because poliovirus uses a replication strategy whereby its

proteins are cleaved from a polyprotein, the only poliovirus protein which begins

with a methionine is VP4. Therefore, each of the complementing constructs by

design differs from the wild-type protein with the addition of an amino-terminal

methionine for translational start. It is unclear whether the extracts used in the

in vitro replication system contain amino-terminal methionyl proteases which

correct this difference during translation.


Characterization of the Complementing Constructs

RNAs were generated from Mlul-cut plasmids pLES-1 6, -17, -19 and -21

by transcription with T7 pol. These were analyzed and found to be intact and

of appropriate size (Table 4). Figure 12 summarizes the structures of the

RNAs generated from these plasmids.

In vitro translation experiments were performed on these RNAs using 0.6

mCi [35S]-met per ml as outlined in Chapter 2. Incorporation of radiolabel by

TCA precipitation indicated that they translated well. Results of 4 h

translations of the constructs were shown in Figure 13, lanes 9-12. The

analysis showed that the proteins were expressed to high levels, and protein

size and processing were as expected. Efficient processing of the proteins









5,
Stem-Loop IRES
I --II- I


3D-M394T vRNA


vPgpUpU ll VP4 VPV 2B 2C A3 3C


-A
(-80)


P23


P2 3A3B 3C 3D
I I I I I


pppGpGpUptU dlgi Smal Kozak's


-A CGCG
(-83)


P 3
P3 3A3B 3C 3D
pppGpGpUpU s uumiai K-za----- ......-.-.... IIA-- CGCG
(-83)


pppGpGpUpUL ? Smal Kozak'sL


3CD

3C 3D
-----------...... .......- ... -- c
I(-83)


I-IZJ (-83)

3AB

pppGpGpUpu IfjI Sinai Kozak's ------- FF Stop 3D coding A
ppp........ [ j f A CG CG
(-83)


( 3B3B
pppGpGpUpU- h Smal Kozak's ---- So 3D codin A
. A CGCG
LJ (-83)


Figure 12 Structures of Complementing Constructs


I






83
"o

CM wo

0 6 6 CM CO 0
M 0. 0. co O
U + + + +
-!- -I-4" -I
I- M- I- I- I- I-

0 3 I I I 0 ~
c' () C) C') C) C C) 0, 0_ c-, C,,-,
3CD'- uu5 nw,,,



VP2-
2B0- ... -

2C- ql 4m-"
VP2-
VP3- ,,.-






2A- -.

3AB-


1 2 3 4 5 6 7 8 9 10 11 12 13

Figure 13 Translation of 3D-M394T and Complementing
Constructs. In vitro translation reactions were performed with the indicated
RNAs in the presence of 0.6 mCi [35S]-met per ml. For the reactions in lanes 3-
7, RNAs were added at a 1:2 molar ratio of 3D-M394T RNA to complementing
RNA. Reactions were incubated at 34C for 4 h. Ten 1d of each was then
added to 100 1 1 x Laemmli sample buffer, heated to 100C for 4 min, and a
20 Fl aliquot was loaded onto a 9-18% SDS gradient gel as follows: lanes 1
and 13, mock reactions without additional RNA; lane 2, 3D-M394T RNA; lane 3,
3D-M394T RNA and capsid RNA; lane 4, 3D-M394T RNA and P23 RNA; lane 5,
3D-M394T RNA and P3 RNA; lane 6, 3D-M394T RNA and 3CD RNA; lane 7, 3D-
M394T RNA and 3D RNA; lane 8, capsid RNA; lane 9, P23 RNA; lane 10, P3 RNA;
lane 11, 3CD RNA; lane 12, 3D RNA. Proteins were separated for 45 mAp*h.
The gel was dried and fluorographed.








from the P23 RNA was observed (lane 9), whereas processing by the P3 and

3CD proteins was less efficient (lanes 10 and 11). Figure 13 also showed

translation of a capsid-encoding RNA transcribed from a wt cDNA clone

linearized beyond the capsid-coding region at nucleotide 3912 with enzyme

HinCII (lane 8).

In vitro translation of the P3 RNA from plasmid pLES17 was performed

over a 24 h time course, and the processing profile of this construct was

shown in Figure 14. These results showed that over time, the P3 polyprotein

was cleaved into its component proteins by the protease which it encoded.

However, the cleavage was not quantitative and, in fact, the majority of the

protein remained in the form of precursor 3CD. In addition, accumulation of

product 3BCD was noted to be greater than that seen with normal processing

of poliovirus. The small amount of processing of the P3 construct detected in

Figure 14 does differ from a report by Porter et al. that vaccinia-expressed P3

failed to process 3CD to 3C and 3D (110).


3D Construct pLES19 Expresses an Active Polymerase

Extracts from translation reactions from 3D RNA from clone pLES19

were tested for polymerase activity in assays using oligo(U)-primed vRNA

template. The experiment showed that the polymerase generated from this

construct was enzymatically active (Figure 15, lane 1). Activity was compared

to extracts from a 4 h translation with Mahoney type 1 vRNA (lane 2). These

results indicated that the expression system developed for use in in vitro














Is
Cn
I
6
C',


Time (h) 0


0.5 1 2 4 6 24 4


- N-


aa


--a
-
e


fl


so
0m


- P3
- 3CD
--3D


(2C)
-3ABC

-3BC
-3C


-3AB
-3A


1 2 3 4 5 6 7 8


Figure 14 Processing Timecourse of P3. In vitro translation reactions in
HeLa S10 extracts were performed with P3 RNA at 34C in the presence of 1.2
mCi [35S]-met per ml. Reaction volume was 100 [1, and 10 Fil samples were
removed at 0, 0.5, 1, 2, 4, 6 and 24 h into 100 1d 1 x Laemmli sample buffer. A
20-[d aliquot was loaded onto a 9-18% SDS gradient gel as indicated (lanes 1-
7). Lane 8 contains a similar reaction with 3D-M394T RNA translated for 4 h
at 34C before dilution for gel loading. Proteins were separated for 45 mAp*h.
The gel was dried and fluorographed.


1W TF -
7 7- -"W-7ffiL















WT Mock


Full-length RNA


Figure 15 Activity of Expressed Polymerase on Exogenous RNA
Template. Construct 3D RNA (lane 1) and Mahoney vRNA (lane 2) were
translated in vitro in the absence of radiolabel for 4 h at 34C. Aliquots of 2.5
1 were removed and added to polymerase reactions containing vRNA
template, oligo (U) primer and 200 IiCi [a-32P]CTP per ml. Lane 3 contained a
polymerase reaction with 2.5 (i of mock translation mixture without added
RNA. Reactions were incubated 1 h at 30C. RNAs were recovered and
resolved on a denaturing agarose gel for 180 mAp*h. The gel was dried and
autoradiographed with an intensifying screen.


3D