Citation
RNA-protein interactions of a mitochondrial group I intron in Saccharomyces cerevisiae

Material Information

Title:
RNA-protein interactions of a mitochondrial group I intron in Saccharomyces cerevisiae
Creator:
Tirupati, Hymavathi K
Publication Date:
Language:
English
Physical Description:
viii, 149 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Biochemistry ( jstor )
Crosslinking ( jstor )
Exons ( jstor )
Gels ( jstor )
Introns ( jstor )
Proteins ( jstor )
RNA ( jstor )
Splicing ( jstor )
Transfer RNA ( jstor )
Binding Sites ( mesh )
Cytochrome b Group ( mesh )
Department of Molecular Genetics and Microbiology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Molecular Genetics and Microbiology -- UF ( mesh )
Introns ( mesh )
Mutagenesis, Site-Directed ( mesh )
RNA, Fungal ( mesh )
Research ( mesh )
Ribonucleoproteins ( mesh )
Saccharomyces cerevisiae ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1998.
Bibliography:
Bibliography: leaves 130-148.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Hymavathi K. Tirupati.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
029444254 ( ALEPH )
51003784 ( OCLC )

Downloads

This item has the following downloads:


Full Text









RNA-PROTEIN INTERACTIONS OF A MITOCHONDRIAL
GROUP I INTRON IN Saccharomyces cerevisiae











By

HYMAVATHI K. TIRUPATI











A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1998














ACKNOWLEDGMENTS


I thank Dr. Alfred S. Lewin, my mentor and supervisor, for his constant support in both academic and personal matters. He gave me immense freedom in the conduct of experiments and stood by me during difficult times. I knew I could always count on him. I would also like to thank all the past and present colleagues in the lab, who have made life in the lab enjoyable and friendly.

I would like to thank the members of my advisory committee, Drs. Bert

Flanegan, Henry Baker, and Phil Laipis, for the various constructive suggestions they have made during the course of the investigation and for taking the time to review various documents, including this one. I also appreciate the input from all the other faculty and students in the department, which has helped in my personal growth. I also thank the other personnel in the Department, especially Joyce Conners and Brad Moore, for their efficient help.

My special thanks go to Chandu, my husband, who has stood by me during all times and made this all possible.















TABLE OF CONTENTS


ACKNOWLEDGMENTS .....................1

LIST OF TABLES. .. .....................v

LIST OF FIGURES .. ....................vi

ABSTRACT .. ........ ..............vii

CHAPTERS

1 INTRODUCTION. ...................

General Introduction .. .. ..................
Group I Introns. .. ..................4
Protein Facilitated Splicing ... ..............1
Two-component System of Cbp2 and Intron 5 RNA ... .. ....16 Major Objective of Dissertation .. ..............19

2 MATERIALS AND METHODS. .. ............21

Over-expression and Purification of Cbp2 .. .........21
In vitro Transcription. .. ... .............23
UV-crosslinking and Generation of Peptides. .........23
Site-directed Mutagenesis .. ...............27
In vitro Splicing Assay. ... .............29
Partial Proteolysis of Cbp2. .. ..............30
Equilibrium Binding Analysis. .. .............30

3 IDENTIFICATION OF INTRON 5 RNA CONTACT SITES ON CBP2
PROTEIN .. .... .................32

Introduction. .. ...................32
Results. .. .....................35
Discussion .. .. ...................46

iii










4 MUTATIONAL ANALYSIS OF THE N-TERMINUS OF CBP2 55

Introduction. .. ...................55
Results. .. .....................58
Discussion. .. ....................100

5 SUMMARY AND PERSPECTIVES. ......... ..112

LIST OF REFERENCES. ............... ...130

BIOGRAPHICAL SKETCH. .. ...............149



































iv














LIST OF TABLES


2-1 Oligonucleotides used for mutagenesis of Cbp2 . 28

4-1 Description of Cbp2 mutants . 59

4-2 Rate measurements for wild-type and mutant Cbp2 76 4-3 Dissociation constants of Cbp2 mutants . 81
































v












LIST OF FIGURES


1-1 Proposed secondary structure of yeast apocytochrome b intron 5 RNA. 6 3-1 Optimization of UV-dosage for crosslinking ... .......... .37

3-2 Chemical cleavage of Cbp2-intron 5 RNA complexes ... ...... 40

3-3 Confirmation of the crosslink site in the N-terminus of Cbp2. .. 44 3-4 Summary of UV-crosslinking results .... ............ .47

4-1 Western analysis of Cbp2 mutants .... ............. ..61

4-2 Functional analysis of deletion (aal7-aa28) and triple aromatic
mutants ......... ....................... .64

4-3 Partial proteolytic profiles of deletion (aal 7-aa28) and triple aromatic
mutants ......... ....................... .66

4-4 Time course of splicing for wild-type and mutant Cbp2 ......... 69

4-5 Splicing rates of wild-type and mutant Cbp2 ... .......... .72

4-6 Double filter-binding assay of wild-type and mutant Cbp2 ....... 77 4-7 UV-crosslinking of wild-type and mutant Cbp2 to intron 5 RNA 83 4-8 Effect of mutant proteins on wild-type Cbp2-mediated splicing 86 4-9 Effect of increasing concentrations of wild-type Cbp2 on proteinmediated splicing ....... ................... ..90

4-10 Effect of tRNA addition on wild-type Cbp2-mediated splicing 93 4-11 Effect of mutant proteins on wild-type Cbp2-mediated splicing at
low total protein to RNA ratios ..... .............. .97


vi













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy


RNA-PROTEIN INTERACTIONS OF A MITOCHONDRIAL
GROUP I INTRON IN Saccharomyces cerevisiae


By

Hymavathi K. Tirupati

December, 1998

Chairperson: Alfred S. Lewin
Major Department: Molecular Genetics and Microbiology


Group I introns and associated proteins represent simple but valuable systems for understanding more complex RNP systems such as the spliceosomes or ribosomes, which employ multiple RNA-protein interactions. The terminal intron of yeast cytochrome b pre-mRNA (a group I intron) requires the nuclear protein Cbp2 for splicing in vivo. However, in vitro, this intron can be made to either selfsplice or undergo protein-facilitated splicing by altering the Mg2+ concentration. Since catalysis is intrinsic to RNA, the protein is believed to promote RNA folding at secondary and tertiary structure levels, leading to the formation of a catalytically competent intron. Therefore, this two-component system provides a model for understanding the role of proteins in promoting RNA folding.

vii









The present study was aimed at identifying critical RNA binding sites on Cbp2 and gaining insights into Cbp2-intron 5 RNA interactions. 32p-labeled intron 5 RNA was UV-crosslinked to Cbp2, and the crosslink sites identified by chemical cleavage and label transfer. These experiments demonstrated that the termini of Cbp2 contain important RNA binding sites. A 12-amino acid region (aa17-28) in the N-terminal contact site (rich in basic and aromatic residues) was targeted for mutagenesis, and mutant proteins characterized for RNA binding and stimulation of splicing. Mutations in this region resulted in no, partial, and complete loss of function, demonstrating the importance of this N-terminal region for stimulation of RNA splicing. These studies also led to the finding that Cbp2 stimulates splicing only in a narrow range of concentrations, with higher concentrations being inhibitory. Addition of a non-specific competitor tRNA attenuated this inhibition, demonstrating the non-specific RNA binding ability of Cbp2.

The current study has identified an important RNA binding region (aal7-28aa) in the N-terminus of Cbp2. A tyrosine at position 21 is indispensable while three charged residues at positions 20, 22 and 24 are important for Cbp2 function. An offshoot of the current study is the identification of an RNA chaperone function for Cbp2. Cbp2 appears to engage in both non-specific and specific interactions with intron 5 RNA. At inhibitory concentrations of the protein, however, nonspecific interactions may predominate and preclude the formation of specific contacts that promote catalysis. This newly characterized chaperone function of Cbp2 may be important for promoting correct intron 5 RNA folding in vivo.

viii













CHAPTER 1
INTRODUCTION


General Introduction


Ribozymes, or catalytic RNA molecules, have been shown to catalyze reactions at phosphorus centers with RNA or DNA as the substrate (Cech, 1987; Herschlag and Cech, 1990; Robertson and Joyce, 1990; Forster and Altman, 1990). These reactions include transesterification or hydrolysis of phosphate diesters or phosphate monoesters. For instance, ribozymes have been shown to catalyze the polymerization of RNA monomer strands (Been and Cech, 1988), replication of RNA strands (Green and Szostak, 1992), and hydrolysis at internal processing sites (Decatur et al., 1995; Einvik et al., 1997; Jabri et al., 1997). RNA catalysts can also act on substrates other than nucleic acids. In vitro selected RNA molecules have been shown to interact with amino acids such as arginine, phenylalanine, tryptophan and valine (Majerfeld and Yarus, 1994; Yarus, 1991; Zinnen and Yarus, 1995). Arginine-binding RNA motifs (Tan et al., 1993) and aromatic side chains (Valegard et al., 1994) have been found to be important for protein-RNA interactions. Although aliphatic-RNA interactions have been frequently neglected, their avidity and specificity seem sufficient for a biological role. Also, the guanosine binding site of group I introns has been shown to bind arginine,

I







2


suggesting that the proto-ribosome might be related to group I introns (Yarus, 1991).


RNA catalysis is not limited to ribozymes alone. It is also involved in two

important steps of gene expression: mRNA processing and protein synthesis. In mRNA splicing, small nuclear RNAs recognize the reaction sites (Guthrie, 1991; Steitz, 1992) and may participate directly in the chemical steps (Madhani and Guthrie, 1992; McPheeters and Abelson, 1992), while the associated proteins may facilitate proper folding of these RNA molecules. It is also possible that, in addition to participating in mRNA splicing, RNAs can catalyze a variety of posttranscriptional RNA modifications. For instance, a calcium-metalloribozyme has been shown to efficiently catalyze a self-capping reaction with free GDP, yielding the same 5'-capped structure as that formed by protein guanylyltransferase (Huang and Yams, 1997a). This ribozyme was subsequently shown to possess selfdecapping and pyrophosphatase activities (Huang and Yarus, 1997b), adding to the growing repertoire of the catalytic capabilities of RNA.

The catalytic activities of RNA may also include facilitation of protein synthesis. Following extensive digestion of proteins from the prokaryotic ribosome, the large rRNA was shown to support the peptidyl transferase reaction, suggesting that RNA may be the catalytic component while ribosomal proteins may serve a scaffold function (Noller et al., 1992). Recently, in vitro selected RNA molecules with a peptidyl transferase-like motif have been shown to bind a







3

puromycin analog (a high-affinity ligand of ribosomal peptidyl transferase), in the absence of protein (Welch et al., 1997). Together, these results strengthen the hypothesis that peptidyl transfer originated in an RNA world.

The catalytic role of RNA in translation of mRNAs appears to be versatile. A ribozyme derived from the group I intron of Tetrahymena thermophila was shown to catalyze the hydrolysis of an aminoacyl ester bond (which involves a carbon center), suggesting that the first aminoacyl tRNA synthetase could have been an RNA molecule (Piccirilli et al., 1992). Furthermore, an RNA molecule identified by in vitro selection has been shown to rapidly aminoacylate its 2'(3') terminus when provided with phenylalanyl-adenosine monophosphate (Illangasekare et al., 1995; 1997). Thus, RNA can accelerate the same aminoacyl group transfer catalyzed by protein aminoacyl-tRNA synthetases.

The ongoing discovery of the versatile properties of catalytic RNA has lent

more credence to the theories of a prehistoric "RNA world". This pre-biotic world might have been populated by life forms that stored genetic information in RNA and employed RNA catalysts prior to the advent of ribosomal protein synthesis (Visser, 1984; Benner et al., 1989). It has also been proposed that the functions of these ancient catalytic RNAs may have been modulated by low molecular weight effectors related to antibiotics (Davies, 1990, Davies et al., 1992). Antibiotics have been shown to inhibit translation by the prokaryotic ribosome (Moazed and Noller, 1987; Powers and Noller, 1994; Yamada et al., 1978), either inhibit selfsplicing (von Ahsen et al., 1991; Davies et al., 1992; von Ahsen and Noller, 1993)







4

or promote oligomerization (Wank and Schroeder, 1996) of group I introns, and inhibit the self-cleavage reaction of the human hepatitis delta virus ribozyme (Rogers et al., 1996). Parallels between the inhibition of group I intron splicing and the protection of bacterial rRNAs by antibiotics also raises the possibility that group I intron splicing and tRNA selection by ribosomes involve similar RNA structural motifs.

Group I Introns

Group I introns are abundant in mitochondrial RNA of fungi and plants (Palmer and Logsdon, 1991). Coding regions for group I introns are also found in the nuclear genomes of other lower eukaryotes (rRNA genes of Tetrahymena), chloroplast DNAs, bacteriophages, and in several tRNA genes of eubacteria (Cech, 1988; Michel and Westhof, 1990; Palmer and Logsdon, 1991; Reinhold-Hurek and Shub, 1992). Some of these group I introns can self-splice. The ability to selfsplice is related to the highly conserved secondary and tertiary structures of these introns (Burke, 1988; Cech, 1988; Michel and Westhof, 1990). Although group I introns have relatively little sequence similarity, all share a series of short conserved elements designated P, Q, R and S. The secondary structure common to group I introns was first proposed by Michel et al. (1982) and Davies et al. (1982) based on comparative sequence analysis. This eventually led to the development of a three dimensional model of the catalytic core by Michel and Westhof (1990). The basic features of this model have been confirmed by mutational analysis, photochemical crosslinking and chemical modification studies employing several







5

affinity cleavage reagents (Pyle et al., 1992; Wang and Cech, 1992). On the basis of these studies, Cech et al. (1994) proposed a revised two-dimensional secondary structure for group I introns that represents more accurately the domain organization and orientation of helices within the intron, the coaxial stacking of certain helices, and the proximity of key nucleotides in three-dimensional space. Based on these revisions, the secondary structure of the fifth intron of the COB gene of Saccharomyces cerevisiae (used in the current study) is shown in Figure 11. The folded structure of group I introns consists of two co-axially stacked helices, P5-P4-P6 and P7-P3-P8, that form a cleft to enclose a third helical domain, P1P2, which contains the 5' splice site. The 5' and 3' splice sites are stabilized by P 1 and P 10 interactions respectively. P 1 is formed by base pairing between the 5' exon and the internal guide sequence (IGS), whereas P 10 is formed by base pairing between the 3' exon and the IGS (not shown in Figure 1-1). P9, a 2 base pair helix near P7 also contributes to the formation of 3' splice site.

The rRNA intron of Tetrahynena thermophila (considered to be the prototype group I intron) has been demonstrated to undergo autocatalytic splicing by a two step trans-esterification mechanism (Cech, 1990). The same mechanism has been documented for a number of other group I introns (Garriga and Lambowitz, 1984; Garriga and Lambowitz, 1986). The first step comprises a nucleophilic attack by guanosine at the 5' splice site, resulting in a free 3' OH group on the upstream exon and guanosine addition to the intron. In the second step, the free 3' OH group on the exon attacks the phosphodiester bond at the 3' splice site, leading to


















Figure 1-1. Proposed secondary structure of yeast apocytochrome b intron 5 RNA. The coaxially stacked helices, P4-P6 and P3-P7, along with the joining regions J3/4, J4/6, J6/7, and J8/7, constitute the catalytic core while P1-P2 forms the substrate domain. The peripheral element P7. I-P7.1 a is a signature element of subgroup IA introns. Lower and upper case letters represent the exons and the intron respectively. Short horizontal and vertical lines represent hydrogen bonds. Dotted lines represent long-range interactions. Sequences for LI and L8 are not shown.






















a u a c u u a u u a-31



Li A a 710
200 nt u a A AA U
A g U U AA

5- U A-U A-U
a A A c U-A U-A
u A A c pg1jCC U-A p9

AUAAA c A A 220 a U-A A-U
A U c A G u U-A U-A
AU-A A u A U g A-U U-A
A-U u U A u +1 U-A GACG-C
A-U uU A U A-C G 738 G A
P5 U-A a 1 UA U U A
A-U g 1 u- U U G:
CGu a-U A A U-A
AUA a 1u-A A A C 444
GUA-AUC a ca c c agcauc-C A C C-G
AAC-G U UAUAUA U-A P7
AACAAAC-GAUUAA 456
G-C

U-A 305 A-U G
U-A -AU-AGAAAG AG uA
P4 P2 U-A A ii 1 1 1 1 I-A G L7.1la
C-C P2 CCCUUUC UG
A-U A C A U A
A-UG A A
350 C-GC A .............................. ............... ............. U u 7l
AUA-U A C P. 71
40U-G A
A:
C-U U A
P6 C-C AA-...... .........;.................. ;......................
ACCAU-C U-A
AC-GCL6 A A U-A
GU-A
U-A U-A G-C P3
U-A
U-A A-U
A-U L2 EA
P6a U-A A-UCCAA-U C-CAU-A U-A .....U-A
37UAC- P2a U-A U-A
L6a C A U-C 660 A-U
UCU-A 250 C-C A-U
A-U C-C A-U P
U-A C-U U-A P
P6b A-U C-G A-U

U-A L u UUU-A 500
AU
UU-A
A-U L
AU-A

U U-A A-U A-U
P6c U-A
A-U

AUA-AUA
A A
U A

AUAA U AAU

400







8

excision of the intron and ligation of the exons. An exogenous guanosine nucleotide is used as the nucleophile in the first step while a universally conserved 3'-terminal guanosine residue of the intron is employed in the second step (Cech, 1990). These steps are chemically the reverse of each other, with the bound exogenous guanosine nucleophile in the first step equivalent to the 3'-terminal guanosine leaving group in the second step. This led to the proposal that a single guanosine-binding site was used in both steps (Inoue et al., 1986). Subsequent studies indicated that the rate constant of the chemical step is the same with exogenous guanosine bound to L-21Scal ribozyme (a model system for first step of splicing) and with the intramolecular guanosine residue of the L-21 G414 ribozyme (a model system for second step of splicing) (Mei and Herschlag, 1996). These results support the previously proposed single guanosine-binding site model, and further suggest that the orientation of the bound guanosine and the overall active site structure is the same in both steps of the splicing reaction.

Oligonucleotide substrate binding to the Tetrahymena ribozyme was found to be stronger than predicted for a simple duplex interaction with the IGS, suggesting that tertiary interactions in addition to base pairing stabilized the bound substrate (Herschlag and Cech, 1990; Pyle et al., 1990). These tertiary interactions were shown to involve specific 2'-OH groups on the substrate and IGS, as well as the GU wobble pair at the 5' cleavage site (Pyle and Cech, 1991; Pyle et al., 1994; Strobel and Cech, 1993, Strobel and Cech, 1995). These and other kinetic studies led to a 2-step model for substrate binding, wherein the substrate forms a duplex







9

(P1) with the IGS to give an 'open complex', followed by docking of the P1 duplex into tertiary interactions to give a closed complex (Herschlag, 1992). Thus, P 1 docking represents a tertiary-folding event in which a single duplex adopts its tertiary structure in the context of an otherwise fully folded ribozyme. P 1 docking was characterized further by isolating the open complex as a thermodynamically stable species using a site-specific modification and high Na+ ion concentrations (Narlikar and Herschlag, 1996). These authors proposed that P1 docking is entropically driven, and is possibly accompanied by a release of bound water molecules.

It is interesting to note that group I introns do not contain specific functional groups that are typically employed in the catalysis of protein-enzymes. Instead, they depend on divalent cations for chemistry and certain other functions such as structural stabilization of folded RNA and substrate binding. For instance, the Tetrahymena group I intron requires Mg2+ or Mn2+ ions for catalysis (Grosshans and Cech, 1989), while cations like Ca2+ can only promote RNA folding and substrate binding (Pyle et al., 1990). A two metal-ion mechanism has been proposed for group I introns and other catalytic RNAs (Steitz and Steitz, 1993). In this mechanism, one metal ion activates the 3'-OH of the guanosine factor which initiates the first step of group I intron splicing. The second one coordinates and stabilizes the oxyanion leaving group, that is, the 3'-OH of uridine created at the end of 5' exon which initiates the second step of group I intron splicing. These metal ions act as Lewis acids and stabilize the expected pentacovalent transition







10

states. In case of group I introns, the mirror symmetry Of two Mg2 ions in the catalytic center reflects the identical chemistry of the two transesterification reactions that effect splicing. The role of RNA in catalysis is to position the two metal ions and properly orient the substrates. Evidence for the involvement of two Mg 2+ions in the chemical step of group I intron splicing was provided by McConnell et al. (1997). Testudy alosoe htasingle Mg 2+ion increases the rate of RNA substrate binding while one or more Mg 2+ions reduce the rate of dissociation of substrate. Evidence for stabilization of the leaving group by a second Mg2 ion was subsequently provided by Weinstein et al. (1997). Studies on the crystal structure of the P4-P6 domain of Tetrahymena documented the first detailed view of metal-binding motifs in a structurally complex RNA (Cate et al., 1996). Three unique metal binding sites have been found in the major groove, two of which are occupied by fully hydrated magnesium ions in the native RNA (Cate and Doudna, 1996). It is interesting to note that the tandem GU wobble base pairs, which comprise two of these three metal binding sites, are also abundant and conserved in the ribosomal RNAs. These sites, upon metal binding, might facilitate higher order folding of ribosomal RNAs or their association with ribosomal proteins.

Group I introns have been classified into four major subgroups, IA through ID, based on distinctive structural and sequence features (Michel and Westhof, 1990). For example, group IA introns contain two extra base pairings, P7. 1 /P7. 1la or P7. 1/P7.2, between P3 and P7 while several other group IB and IC introns







11

including the Tetrahymena rRNA intron possess an extended RNA structure, P5abc, that is essential for catalysis (Joyce et al., 1989). Recent crystallographic studies revealed that P5abc stabilizes P4-P6, the major domain of the catalytic core, via two key interactions (Cate et al., 1996). The first one includes an adenosine-rich bulge which docks in the minor groove of the P4 helix while the second interaction takes place between a GAAA tetraloop and the minor groove of its conserved 11-nucleotide receptor. In addition to base-specific hydrogen bonding and base stacking, pairs of interdigitated riboses (ribose zippers) further stabilize these long-range interactions in the P4-P6 domain. Other group I introns lacking P5abc possess additional RNA structures such as a long, peripheral extension of the P9 stem, denoted P9.1 (Wallweber et al., 1997) or protein factors (Mohr et al., 1994) that bind and stabilize the intron active structure. For example, the mitochondrial large ribosomal intron of N. crassa that lacks this extended domain absolutely requires a protein factor Cyt- 18 for its activity, both in vitro and in vivo. The protein binds at the junction of P4-P6 stacked helices and facilitates correct geometry in this region (Saldanha et al., 1996). Cyt-18 could also replace the P5abc domain of Tetrahymena (Mohr et al., 1994). Thus an RNA-binding protein can provide substantial binding energy to stabilize the catalytic structure of the intron, obviating the requirement for an additional but important RNA element.

Protein Facilitated Splicing

Several mitochondrial transcripts in yeast employ protein factors to facilitate splicing of group I and group II introns, although some of them can self splice in







12

vitro. Protein-facilitated splicing has also been documented in other fungi such as Neurospora (Akins and Lambowitz, 1987; Saldanha et al., 1993) and Aspergillus (Ho et al., 1997). Some of these protein factors, termed maturases, are encoded within the intervening sequences (Carignani et al., 1983; Lamb et al., 1983; Lazowska et al., 1989). The reading frames encoding these maturases are in frame with the upstream exons. A proteolytic cleavage downstream of the 5' splice site generates the active form of maturase, presumably enabling a feedback mechanism of regulation. All yeast maturases (encoded by group I introns such as cob-I2 and 13, and group II introns like cox]-I and -I2) primarily function in splicing the intron that encodes them. However, the cob-I4 maturase enables splicing of both cob-I4 and another closely related group I intron, cox1-I4 (Burke, 1988; Lambowitz and Perlman, 1990).

The maturases encoded by group I introns are structurally related to sitespecific endonucleases that confer mobility (Bell-Pedersen et al., 1990; Perlman and Butow, 1989). It is well established that group I introns can transpose sitespecifically to intron-less alleles of the same gene after cleavage of the target DNA by an intron-encoded DNA endonuclease (Belfort and Perlman, 1995; Byrk and Mueller, 1996). This conservative process, known as intron homing (Dujon, 1989), is highly specific because of the large recognition sites (15-35 bp) of homing endonucleases (Byrk and Mueller, 1996). Group I introns are thought to have become mobile following the acquisition of open reading frames (ORFs) that encode specific DNA endonucleases (Dujon, 1989; Lambowitz and Bellfort,







13

1993). Evidence for this came from the demonstration of autonomous mobility of an ORF, independent of the entire intronic sequence, in the mitochondria of Podospora anserina (Sellem and Belcour, 1997). The mitochondrial nadl-i4 intron of Podospora contains one (monorfic) or two (biorfic) ORFs, according to the origin of the strain (Cummings et al., 1988; Sellem et al., 1996). The nadl-i4orfl, recently acquired by the Podospora nadl-i4 intron (Sellem et al., 1996), appears to remain as a mobile entity, as it could be efficiently transferred from a biorfic intron to its monoorfic counterpart, independent of the core intron sequence (Sellem and Belcour, 1997).

Reverse splicing coupled with reverse transcription and recombination may serve as an alternative mechanism for intron mobility (Cech, 1985; Sharp, 1985; Woodson and Cech, 1989). A related mechanism has been documented in the homing of group II introns of yeast mitochondria (e.g., a12 intron of coxl) (Zimmerly et al., 1995; Yang et al., 1996) and Lactobacillus lactis (e.g., LtrB intron) (Matsuura et al., 1997). The insertion of these introns has been shown to occur by reverse transcription of unspliced precursor RNA at a break in doublestrand DNA caused by an endonuclease activity. This DNA endonuclease activity is associated with RNP particles containing the excised intron RNA that cleaves the sense strand of the recipient DNA by reverse splicing and the intron-encoded reverse transcriptase protein that cleaves the anti-sense strand.

Integration of an intron into foreign RNA (instead of DNA) by reverse splicing, followed by reverse transcription and recombination, could also lead to its







14

transposition. Reverse splicing into RNA has been demonstrated in vitro for group I introns such as Tetrahymena rRNA intron (Woodson and Cech, 1989) and the 23S rRNA intron from Chlamydomonas reinhardtii chloroplast (Thompson and Herrin, 1994). Recently, RNA-dependent integration of the Tetrahymena group I intron into the 23S rRNA has been demonstrated in E. coli (Roman and Woodson, 1998). The process of reverse splicing into RNA, unlike homing of group I and group II introns, does not require intron-encoded proteins. However, stable transposition into the genome would presumably require reverse transcriptase activity in the host (Belfort and Perlman, 1995). This activity could be provided by "indigenous" group II introns (Kennell et al., 1993) or retroelements present in many cell types (Eickbush, 1994). Importantly, reverse splicing appears to be significantly less sequence-specific than homing endonucleases and could therefore expand the repertoire of intron-containing sites (Cech, 1985; Roman and Woodson, 1998).

In addition to maturases, several nuclear-encoded proteins essential for splicing of mitochondrial introns have been identified in yeast and Neurospora by screening cytochrome-deficient strains and by isolating nuclear suppressors of splicing mutants (Burke, 1988; Lambowitz and Perlman, 1990). In Neurospora, the products of three nuclear genes, cyt-18, cyt-19 and cyt-4 have been implicated in splicing the mitochondrial large rRNA intron and several other mitochondrial group I introns. In contrast, most of the yeast proteins facilitate splicing of a single intron. For instance, the product of MRS 1 in yeast appears to be specific to the







15

group I intron, cob-bl3 (Kreike et al., 1987, Kreike et al., 1986), although an intron-encoded maturase is also required for excision of this intron (Holl et al., 1985). Proteins facilitating the splicing of group I introns may exhibit additional biological functions as documented in the case of certain aminoacyl-tRNA synthetases. The yeast NAM2 gene, for example, encodes mitochondrial leucyltRNA synthetase which also facilitates the splicing of group I introns, cob-I4 and cox-I4 (Labouesse et al., 1987; Herbert et al., 1988). Similarly, the Cyt-18 protein of Neurospora which is responsible for the splicing of several group I introns also happens to be the mitochondrial tyrosyl tRNA synthetase (Akins and Lambowitz, 1987). These synthetases and other pre-existing RNA-binding proteins may have evolved to recognize sequences or structures in group I introns that resemble their normal cellular targets (Lambowitz and Perlman, 1990; Caprara et al., 1996).

Nuclear-encoded proteins also appear to be important for group II intron

splicing. Two genetically identified proteins that are likely to function directly in group II intron splicing are MRS2 and MSS 116 (Wiesenberger et al., 1992; Seraphin et al., 1989). MRS2 functions in splicing of all four yeast group II introns (coxl-I1, -12, -I5y and cob-Il 1), and is relatively specific for these introns, while MSS 116 is involved in splicing group II introns (cox]-I1 and cob-I1) and also some group I introns. However, both MRS2 and MSS 116 appear to have some additional function besides splicing, as gene disruptions result in a respiratory-deficient phenotype in yeast strains whose mtDNA contains no introns (Wiesenberger et al., 1992; Seraphin et al., 1989)







16

Two-Component System of Cbp2 and Intron 5 RNA

The yeast cytochrome b gene contains five introns, of which the terminal intron is a group IA intron (bI5). In some yeast strains, the gene has only two introns, with the terminal intron designated b12. The processing of this group I intron in vivo was demonstrated to be dependent on a protein factor designated Cbp2 (McGraw and Tzagoloff, 1983). The nuclear gene encoding Cbp2 was identified by complementation of cytochrome b mutants (defective in the excision of the terminal intron) with a yeast genomic library. This analysis identified an 1890 nucleotide-long ORF encoding a basic protein of 74 kDa. Deletion analysis revealed that the entire ORF was essential for complementation of the cbp2 mutants. Later, a mitochondrial revertant was shown to contain a precise deletion of the terminal intron of cytochrome b gene, demonstrating that neither Cbp2 nor the intron itself is required for growth on non-fermentable carbon sources (Hill et al., 1984). In addition to these findings, Cbp2 has been shown to be important in the splicing of the 0o intron of large ribosomal RNA (Shaw and Lewin, 1997).

The terminal intron (intron 5) of cytochrome b can self-splice in vitro at high concentrations of Mg2+ (Gampel and Tzagoloff, 1987; Partono and Lewin, 1988), whereas Cbp2 is essential to enable splicing at physiological concentrations of Mg2+ (Gampel et al., 1989). Although this group IA intron possesses the conserved secondary and tertiary structures found in all group I introns, it varies in important ways from the prototype, the Tetrahymena rRNA intron. The fifth intron of cytochrome b is about 738 nucleotides long, making structural probing







17

harder compared to the rRNA intron of Tetrahymena (-400 nucleotides long). The internal guide sequence (IGS) that establishes the substrate specificity starts 220 nucleotides downstream from the 5' splice junction, rather than the usual 14-20 nucleotides described for other group I introns. The intron is AU-rich, requiring higher levels of Mg2+ for stabilization of the active structure unlike the GC-rich Tetrahymena group I intron. It also possesses additional RNA structures like the P7.1 stem loop that are not found in Tetrahymena. Hence, intron 5 RNA, with its structural differences from the Tetrahymena rRNA intron, offers an opportunity to gain further insights into the mechanism of splicing of group IA introns.

The fifth intron of COB pre-mRNA is also devoid of the peripheral RNA

element, P5abc, that is important for the catalysis of Tetrahymena rRNA intron. It is therefore conceivable that Cbp2 compensates for this RNA structure and stabilizes its RNA partner by contributing substantial binding energy in a manner similar to the Cyt- 18 protein of Neurospora. UV-crosslinking, chemical and enzymatic modification studies indicate that Cbp2 contacts intron 5 RNA at multiple sites in the catalytic core (P4) and peripheral RNA elements such as exon 5, IGS, L2, L6 and stimulates the formation of the catalytically active structure (Shaw and Lewin, 1995; Weeks and Cech, 1995). Based on these and kinetic studies, Weeks and Cech (1996) proposed that Cbp2 serves as a tertiary structure capture protein. However, Cbp2 also induces the formation of RNA secondary structure, in addition to the stabilization of tertiary structure (Shaw and Lewin, 1995; Shaw et al., 1996). In addition, chemical modification studies (Shaw and







18

Lewin, manuscript in preparation) show that Cbp2 binds to intron 5 RNA even in the absence of Mg 2+and nucleates the formation of the catalytic core by stabilizing the P4/P6 domain. Thus, Cbp2 appears to be involved in a dynamic process of stabilizing RNA structure both at the secondary and tertiary structure levels, stimulating the formation of the catalytically active RNA structure.

Weeks and Cech (1995a; 1995b) provided a kinetic framework for both Cbp2mediated and self-splicing reactions of intron 5 RNA. At low Mg 2+ levels (5 mM), the self-splicing reaction is estimated to be 3 orders of magnitude slower than the protein-facilitated reaction. At near saturating concentrations of Mg 2+(40 mM), the protein-independent reaction is still 8-fold slower, indicating that high levels of the cation cannot completely compensate for Cbp2 function. The self-splicing reaction is always slower than the protein- facilitated reaction, since it has to proceed through two additional transitions compared to the latter. The first step involves a transition from secondary structure to an intermediate state that is efficiently promoted by Mg2+ However, self-splicing must still overcome a second barrier which is the transition from the intermediate to an active enzyme state that finally gives rise to products. The kinetics of Cbp2-mediated splicing, on the other hand, include two significant steps, namely, guanosine binding to the Cbp2-active intron 5 RNA complex followed by efficient conversion of this ternary complex to products. Studies on phosphorothioate substitution at the 5' splice site and pH profiles indicate that at physiological pH the self-splicing reaction is limited by chemistry while the Cbp2-facilitated reaction is limited by a







19

conformational step (Weeks and Cech, 1995a). These studies indicate that Cbp2 binding compensates for at least two structural defects while increasing the rate of chemistry.

Main Objective of Dissertation

The availability of a two-component in vitro system to study autocatalytic and protein- facilitated splicing offers the advantage of studying RNA catalysis in isolation or in combination with the RNA-binding protein simply by varying the Mg concentration. Insights obtained from the analyses of this one protein-one RNA system will aid in understanding more complex systems like the spliceosomes involved in nuclear pre-mRNA splicing or ribosomes involved in protein synthesis, all of which employ multiple protein and RNA components.

Studies so far have focused on mapping the Cbp2 contact sites on intron 5 RNA and the kinetics of splicing in the presence and absence of the protein. Little is known about the structure of Cbp2 protein or its interaction with intron 5 RNA from the protein point of view. In order to understand the role of Cbp2 in stimulation of splicing, it is important to determine the functional groups on the protein that intimately contact RNA and facilitate catalysis. Once the contact sites are identified, the actual mechanism of interaction between Cbp2 and intron 5 RNA can be investigated further. Therefore, one of the main aims of the current project was to identify potential intron 5 RNA binding regions of Cbp2 using the technique of UV-crosslinking and label transfer. Following the identification of major contact sites, site-directed mutagenesis was employed to confirm the






20

importance of various amino acid residues in these sites for interaction with intron

5 RNA and enable facilitation of splicing.

UTV-crosslinking identified two major RNA contact sites in the termini of Cbp2 with the N-terminal site comprising the first 37 amino acid residues. The deletion of a potential RNA binding motif (aal 7-SSSRYRYKFNM-aa28) in the Nterminal contact site abolished splicing activity, showing that this region was likely to be critical for Cbp2 function. Single and cluster mutagenesis of various residues in this region yielded a variety of mutants with no, partial, or complete loss of Cbp2 function. The characterization of these mutants and the significance of various amino acid residues in question are discussed in Chapter 4.

An offshoot of the current study was the identification of an RNA chaperone function for Cbp2. The studies reported in Chapter 4 show that Cbp2 has a nonspecific or generalized RNA binding capability besides its specific RNA binding component. Drawing parallels with studies on other RNA chaperones (Chapter 5), this study adds a new perspective on how the non-specific RNA binding activity of Cbp2 might play a critical role in the facilitation of intron 5 RNA splicing in vivo.













CHAPTER 2
MATERIALS AND METHODS


Over-Expression and Purification of CBP2

In vitro studies of CBP2-bI5 RNA interactions were done with CBP2 protein purified to near homogeneity after over-expression in E. coli. Two versions of the protein, 6x histidine-tagged and native, were employed for different studies. Expression Clones

His-tagged Cbp2. Plasmid pET15b-CBP2 was constructed by cloning the

NdeI-ClaI fragment carrying the CBP2 cDNA from pET3a-CBP2, downstream of the 6x histidine tag in the T7 expression vector, pET15b (Novagen). The histidine tag adds an additional 20 amino acid residues at the N-terminus of Cbp2 protein. The plasmid was transformed into JM IO09(DE3) strain of E. coli for overexpression. This strain carries the T7 RNA polymerase gene driven by lac-uv5 promoter on a lambda lysogen and enables the induction of Cbp2 in the presence of IPTG.

Native Cbp2. This form of Cbp2 protein was over-expressed from pET3aCBP2 plasmid in BL2 I1(DE3), another E.coli strain carrying the T7 RNA polymerase gene. This plasmid was constructed by introducing an NdeI site at the start codon of CBP2 gene by PCR-mutagenesis and cloning the NdeI-SnaBI 21






22

fragment between the NdeI-BamHI sites of pET3a expression vector (Studier et al., 1990). The Cbp2 protein expressed from this construct is 20 amino acid residues shorter than the his-tagged version. Induction of Cbp2

An overnight culture of bacteria carrying the Cbp2 expression plasmid was

used to inoculate a large volume of LB/ampicillin medium at 1:100 dilution. The cultures were grown at 370C until they reached an A550 of 0.35 and the expression of Cbp2 was induced with 0.4-1 mM IPTG for 1-3 hours. Cells were pelleted after addition of 17 ig/ml PMSF, washed with 20 mM Tris, pH 7.5, 50 mM NaCI, snap frozen in a dry ice/ethanol bath and stored at -700 C until purification. Purification of Cbp2

His-tagged Cbp2. The protein was purified on Ni-NTA Superflow (Qiagen) column, adapting the protocol of Weeks and Cech (1995). This purification system is based on the high affinity of histidine residues for nickel ions immobilized on nitrilotriacetate resin. The contaminant proteins can be efficiently removed at low levels of imidazole (a competitor), while the his-tagged protein can be specifically eluted at slightly higher concentrations of imidazole.

The bacterial pellet was resuspended in 10 ml of column buffer (50 mM

HEPES, pH 7.6, 700 mM NaCl, 1mM imidazole, 17.5 ug/ml PMSF) and lysed by two passages through a French pressure cell at 18000 p.s.i. The lysate was cleared by centrifugation at 35000 rpm for 30 minutes in a Beckman Ti 42.1 rotor. The






23

supernatant was loaded on a 2 ml Ni-NTA Superflow column pre-equilibrated with 10 volumes of column buffer. The column was washed with 10 volumes of column buffer (lmM imidazole) followed by 7.5 volumes of wash buffer (20 mM imidazole). Cbp2 protein was then eluted with 7.5 volumes each of column buffers containing 80 mM and 200 mM imidazole. The fractions containing Cbp2 (detected by SDS-polyacrylamide gel electrophoresis) were pooled and dialyzed twice against 1 liter each of 10 mM Tris, pH 7.5, ImM EDTA, 20% glycerol and once with a liter of 10 mM Tris, pH 7.5, 1 mM EDTA, 50% glycerol and stored at 700 C after rapid freezing in a dry ice/ethanol bath.

Native Cbp2. This version of Cbp2 protein was isolated according to the 4step purification protocol described by Shaw and Lewin (1995).

In Vitro Transcription

pSPI5 plasmid DNA purified by CsCl gradients (Maniatis et al., 1989) was

linearized with SmaI and used for in vitro transcription with T7 RNA polymerase (Partono and Lewin, 1988). The transcripts contain the entire intron 5 RNA sequence and the flanking exon sequences. The transcripts were internally labeled using Ca-32P UTP and/or a-32P ATP (ICN).

UV-Crosslinking and Generation of Peptides UV-Crosslinking

Cbp2-RNA complexes were generated according to the UV-crosslinking
technique of Zamore and Green 1989. 32-labeled intron 5 RNA transcripts were
technique of Zamore and Green, 1989). P-labeled intron 5 RNA transcripts were






24

incubated at room temperature or 370 C for 30 minutes with a molar excess of histagged Cbp2 (7 fold over RNA) or native Cbp2 (21 fold) in a low salt buffer (50 mM Tris, pH 7.5, 10 mM MgCl2, 50 mM NH4CI) containing excess tRNA (nonspecific competitor). Each sample was split into several aliquots, 10 p1 each, in a 96-well microtiter plate (Falcon) placed on ice (in a petridish) and exposed to 600 mJ of UV radiation in a UV-Stratalinker (Stratagene). The aliquots of each sample were pooled into a 1.5 ml Eppendorf tube and treated with 0.32 ug/ml of RNAse A and 100 units of RNAse TI (Boehringer Mannheim) at 370 C for 2 hours to remove uncrosslinked RNA. The samples were resolved by electrophoresis on a 10% SDS-polyacrylamide gel (Laemmli, 1970) and the band corresponding to Cbp2 excised after Coommassie blue staining. The Cbp2 thus purified includes both the crosslinked and un-crosslinked forms of the protein. Generation of Peptides

The purified gel fragments were incubated with chemical cleavage reagents such as hydroxylamine (NH20H) and 2-nitro-5-thiocyanobenzoate (NTCB) and the resulting peptides were resolved on high percentage tris-tricine gels.

Cleavage. The gel pieces were washed four times with distilled water over a period of 20 minutes, placed into appropriate cleavage buffer and thoroughly macerated with a Kontes Eppendorf pestle. The slurry so obtained was completely covered with the cleavage buffer and incubated overnight at appropriate temperature.






25

Chemical cleavage of proteins with hydroxylamine generates relatively large

peptides due to the infrequency of Asn-Gly bonds. The asparaginyl side chain has a tendency to form a cyclic imide that is susceptible to nucleophilic attack by hydroxylamine (Bornstein, 1977). The cyclization is more favored in the context of a smaller amino acid like glycine resulting in increased susceptibility of AsnGly bonds. Hydroxylamine (NH2OH) cleavage of Cbp2 was performed by overnight incubation of Cbp2 containing gel pieces in 2.4 M guanidine-HC1, 2M hydroxylamine buffer, pH 9, at room temperature, as described above. LiOH was used to neutralize the guanidine-HCI and hydroxylamine-HCl due to increased solubility of LiCl compared to NaCI. The process of gel purification contributes to partial denaturation of the protein while the presence of guanidine-HC1, a strong solvent, enhances the exposure of the Asn-Gly bonds to the nucleophile. Chain cleavage occurs in the presence of alkaline hydroxylamine liberating a new aminoterminal amino acid.

Cleavage with 2-nitro-5-thiocyanobenzoate (NTCB) is a two-step process.

First, the thiol groups on cysteine residues of denatured proteins are modified to SCN groups by NTCB (Jacobson et al., 1973; Degani and Patchornik, 1974), followed by cleavage at the amino group of the modified cysteine by exposure to alkaline pH conditions. Gel purified Cbp2 protein was incubated in 2.4 M guanidine-HC1, 5 mM DTT, 1 mM EDTA, 0.2 M tris acetate, pH 8, buffer at 370 C for 2 hours in order to denature the protein and reduce the disulfide bonds to SH groups. A 10 fold excess of NTCB (50 mM) over the total thiol was added to the






26

gel slurry, and the incubation was continued for half hour at the same temperature to effect modification of the SH groups to SCN groups. The slurry was filtered through a 0.22 LM low protein-binding, cellulose acetate spin column (CorningCostar), and washed once with distilled water. The slurry was later transferred to a

1.5 ml Eppendorf tube and incubated overnight in 2.4 M guanidine-HCl, pH 9, cleavage buffer at 370 C.

Extraction of peptides. After cleavage, the slurry was filtered through a

Costar column, washed once with distilled water and incubated overnight at 370C in the extraction buffer (0.1% SDS, 50 mM Tris pH 8.8, 0.1 mM EDTA and 0.2 M ammonium bicarbonate). On the third day, the gel slurry was heated at 850 C for 5 minutes and rapidly filtered through a Costar column to recover soluble peptides. The slurry was further incubated with 0.5% SDS, 10 mM Tris, pH 8, for 20 minutes at room temperature and filtered to extract the residual peptides in the gel.

Acetone precipitation and electrophoresis. The filtrates containing the

peptides were pooled, dried in a Speed-Vac (Savant), resuspended in water and precipitated overnight at -20o C with 9 volumes of acidified acetone. Peptides were pelleted at 12000 rpm in a microcentrifuge (Eppendorf) for 20 min and resuspended in 15 1l of SDS gel-loading buffer. The samples were dried in a Speed-Vac to remove the residual acetone, brought to a final volume of 40 g1 with water, resolved on 15% (for hydroxylamine ) or 16.5% (for NTCB) tris-tricine gels (Schagger and von Jagow, 1987), along with 14C-labeled low molecular weight peptide markers (Amersham Corporation), and autoradiographed.






27



Site-Directed Mutagenesis

The N-terminal RNA contact site on Cbp2 (identified by the UV-crosslinking strategy) was subjected to site-directed mutagenesis to identify key residues for Cbp2 function. Mutations were designed to either delete the region of interest (aal7 SSSRYRYKF aa25) or make point mutations that do not severely perturb the conformation of the protein. The Xbal-BamH1 fragment encoding the first 97 codons of CBP2 from pET15b-CBP2 was sub-cloned into the M13mpl 19 vector and used as the template for oligonucleotide-directed mutagenesis. Mutagenesis Scheme

Single stranded DNA isolated from the phage clone mentioned above was used as a template for mutagenesis. The oligonucleotides used for mutagenesis are shown in Table 2-1. The double primer method of Zoller and Smith (1984) was employed to introduce mutations into the CBP2 segment cloned into M13mpl9 vector. Briefly, 10 pmoles each of the kinased mutagenic oligonucleotide and the universal M13 primer were annealed to 0.5 pmoles of single-stranded DNA template by incubation at 650 C for 30 minutes, 370 C for 20 minutes and room temperature for 5 minutes. The annealed complexes were extended and ligated overnight at 150 C using 4 units of Klenow DNA polymerase (Promega) and 2.5 units of T4 DNA ligase (BRL) to form a gapped heteroduplex. The reaction was diluted 200-fold, transformed into competent TG 1 cells (Amersham) and overlaid






28







Table 2-1. Oligonucleotides used for mutagenesis of CBP2


Name Length Sequence (5' to 3') Description
(bases)
AL 260 19 TAGCAAGCCCAATAGGAAC Universal primer (position
1822-1804 in antisense
strand of M13mp 19)
AL 261 17 TAAACGCTTGCTTACAG Sequencing primer to
verify mutations (position
790-774 in antisense
strand of CBP2)
AL 262 40 TCTCCATGTTGAACAAATACA Changes RYRYKF to
AGTAAAGAGAGGAACTGCC LYLYLF at aa 20,22,24
AL 263 33 CACCTGATGTGTGATATTGCCC Deletion of aa 17-28 of
TGTCTCCTCAA Cbp2
AL 264 42 GATATTCTCCATGTTCAACTTC Changes RYRYKF to
AACCTTAAACGAGAGGAACT RLRLKL at aa 21,23,25
AL 290 30 GTTGAACTTATACCTTAAACG Changes Y to L at aa 21
AGAGGAACT
AL 291 30 CTCCATGTTGAACTTTAACCTG Changes Y to L at aa 23
TAACGAGA
AL 292* 36 GAACTTATACCTGTAACGACC Deletion of SSS at aa
CTGTCTCCTCAATGA 17,18,19
AL 293 31 GATATTCTCCATGTTCAACTTA Changes F to L at aa 25
TACCTGTAA


* AL292 also changes the codon usage for glycine at position 16 from GGC to GGU






29

with molten agar to allow formation of plaques. Mutants were identified by plaque lift hybridization with y-32P-labeled mutagenic oligonucleotide as the probe. The resulting mutants were plaque purified once and the single-stranded DNA sequenced. Double-stranded DNA was prepared by mini-prep protocols (Maniatis et al., 1989) from the mutant TG1 clones. The CBP2 segment carrying the mutation of interest was then recloned into pETI 5b-CBP2 expression vector, and sequenced using Sequenase 2.0 kits (Amershami).

In Vitro Splicing Assay

ihe act:i ity of various mutant Cbp2 proteins was determined by an in vitro spl.iciig assay (Partono and Lewin, 1988). 32P-labeled intron 5 RNA transcripts were incubated with wild-type or mutant Cbp2 proteins in 5 mM MgCl2, 50 mM Nt1CI, 50 mM tris-HC1, pH 7.5, buffer, in the presence of 5 mM DTT and 2 units of RNAsin RNase inhibitor (Promega), at 370 C for 10 minutes. Splicing was initiated with 0.2 mM GTP (Pharmacia) and the reactions allowed to continue for varying lengths of time. Reactions were terminated by the addition of equal volumes of 90% formamide, 25 mM EDTA or ethanol precipitated and resuspended in the formamide buffer. Reaction products were resolved on 4% polyacrylamide-8M urea gels and autoradiographed. Splicing Competition Assays

These assays were done essentially as described above but in the presence of a constant amount of the wild-type protein and increasing concentrations of mutant






30

Cbp2 proteins. The deletion mutant lacking amino acids 17-28 and the triple aromatic mutant with Y21, Y23 and F25 residues converted to leucine were employed to compete with the wild-type protein in splicing assays. As a control, the concentration of wild-type Cbp2 was increased to the same level of total Cbp2 protein (wild-type + mutant) used in the above reactions but in the absence of mutant proteins. Spliced products were resolved on denaturing gels and quantitated using Phosphorlmager (Molecular Dynamics).

Partial Proteolysis of Cbp2

The conformation of mutant Cbp2 proteins was determined by comparing the partial proteolytic profiles of wild-type and mutant Cbp2. Partial proteolysis was done by incubating 0.5-1 ug of the wild-type (native or heat-denatured) or the mutant Cbp2 protein with trypsin, at protease:Cbp2 ratios of 1:50 and 1:100 (w/w), for 1 hour at room temperature and the peptides resolved on 12% SDS-PAGE gels. The peptide profiles were detected by Western blotting performed according to Towbin et al. (1979), with a Cbp2-specific polyclonal antibody (a generous gift of Dr. Alexander Tzagaloff).

Equilibrium Binding Analysis

The affinity of wild-type and mutant Cbp2 proteins for b15 RNA was

determined by the double-filter binding assay (Wong and Lohman, 1993) with the exception that a charged nylon membrane (Hybond N+ from Amersham) was used in place of DEAE. This method involves filtration of protein-RNA mixtures through a sandwich of two membranes, a nitrocellulose filter on top and a nylon






31

membrane at the bottom, in a 96-well dot-blot apparatus. The protein-RNA complexes are retained on the nitrocellulose while the free RNA is trapped by the nylon membrane. The fraction [RNA bound] can be calculated as follows:

[RNA]bound = [RNA]total (CNc (Y CNY) / (CNC + CNY)

where, CNC and CNY correspond to the Phosphorlmager counts retained on the nitrocellulose and nylon filters respectively. The parameter refers to the RNA retained nonspecifically on nitrocellulose and is empirically derived from RNA bound in the absence of the protein (G = CNC / CNY at [protein] = 0).

Protein-RNA complexes were generated by incubating a low concentration (16 pM) of 32p-labeled intron 5 RNA with increasing concentrations (0-4000 pM) of wild-type or mutant Cbp2 in 5 mM MgCI2, 5 mM DTT, 50 mM NH4CI, 50 mM tris-HC1, pH 7.5, buffer at 370C for 30 minutes. The reactions exhibit equilibrium binding by 30 minutes. Duplicate reactions were filtered through a pre-soaked BA 85 nitrocellulose membrane (Schleicher and Schuell) overlaid on a pre-wetted Hybond N+ nylon membrane, in a 96-well dot-blot apparatus (Bio-Rad). The filters were washed four times with low salt buffer and the radioactivity retained on both the membranes was quantitated using a Phosphorlmager (Molecular Dynamics). The fraction [RNA bound] was calculated and Kd of the mutants determined by the Cbp2 concentration needed for half maximal RNA binding.















CHAPTER 3
IDENTIFICATION OF INTRON 5 RNA CONTACT SITES ON CBP2 PROTEIN


Introduction

Induction of crosslinks by ultraviolet light in nucleic acid-protein complexes has been a valuable tool for probing structural aspects of protein-DNA/RNA interactions. Ultraviolet (UV) photolysis provides a useful approach to determine the contact points between nucleic acid and protein, as it produces zero-length crosslinks in contrast to chemical crosslinking agents. The latter interpose spacers of varying lengths at the interface and hence are less appropriate to probe intimate contacts at the interface of protein-nucleic acid complexes. A free radical mechanism has been proposed to explain the process of UV-crosslinking of amino acids to nucleic acid bases (Shetlar, 1980). Photoexcitation of a nucleic acid base followed by abstraction of a hydrogen atom from a favorably positioned amino acid residue generates a purinyl or pyrimidinyl radical which recombines with the corresponding radical on the proximate amino acid residue. Such a zero-length recombination event requires an amino acid to be present in extremely close proximity to an excited base. Studies on the bacteriophage fd gene 5 protein, a single-stranded DNA-binding protein suggest that the amino acid and the base 32






33

must also be present in a relatively specific topological arrangement to achieve photochemical crosslinking (Williams and Konigsberg, 1991). For instance, the amino acids Tyr-26 and Phe-73 of the bacteriophage fd gene 5 protein could not be crosslinked in a gene 5-ssDNA complex (Paradiso et al., 1979; Paradiso and Konigsberg, 1982), although 'H nuclear magnetic resonance data suggest that these two residues form part of the DNA-binding domain of the protein (King and Coleman, 1988. The extent of photocrosslinking also depends on the intrinsic structure of the nucleic acid or protein. Among the nucleotides, thymine and uridine appear to be the most photoreactive, yielding greatest extent of crosslinking to proteins. On the other hand, in principle, any of the 20 amino acids found in proteins can be crosslinked to nucleic acids by UV-irradiation (Williams and Kongsberg, 1991).

Photochemical crosslinking has been adapted to detect protein bound to specific sites on double-stranded DNA using 32P-labeled, site-specific probes (Safer et al., 1988). This method permits transfer of 32P from specific phosphodiester bonds to amino acid residues at the interface upon photocrosslinking (Williams and Konigsberg, 1991). We have employed a similar method to detect intron 5 RNA binding sites on Cbp2 protein. We synthesized intron 5 RNA transcripts (internally labeled with a-32P UTP), UV-crosslinked it to purified Cbp2 under conditions that favor specific complex formation, and detected the crosslinked Cbp2-RNA complexes on SDS-polyacrylamide gels by autoradiography as the protein became indirectly labeled upon photocrosslinking.






34

Various biochemical methods have been employed by several groups to identify the crosslinked peptides and amino acid residues at the interface of protein-nucleic acid complexes. The most common approach has been to digest the crosslinked complex with trypsin, rapidly isolate the peptides using anion-exchange HPLC, detect the peptides by their absorbance at 220 nm or 254 nm, and identify the crosslinked fragments by Cerenkov counting of the resultant fractions (Merrill et al., 1984; Merrill et al., 1988 and Shamoo et al., 1988). In case of proteins with known primary structure, the crosslinked amino acid residues have been identified by amino acid analysis following acid hydrolysis. For example, the crosslink site in the bacteriophage fd gene 5 protein was identified as cysteine-33 by this method (Paradiso et al, 1979). However, this may not represent a general approach as it depends on the ability of acid hydrolysis to regenerate the free amino acid from the crosslinked adduct. In most instances, the crosslinked amino acid was identified by amino acid sequencing, based on the following principle. A gas or liquid phase sequencer cannot extract the phenylthiazolinone derivative of the crosslinked amino acid from the polybrene-coated support disk and therefore leaves a hole in the sequence at the crosslinked position. Thus, the site of crosslinking is determined by the absence of an identifiable phenylthiohydantion derivative in the peptide sequence. Using this approach, the contact sites in E. coli SSB (Merrill et al., 1984) and Al hnRNP (Merrill et al., 1988) proteins crosslinked to 32P-labeled

(dT)8 oligonucleotides were identified. In the case ofE. coli SSB, the site of crosslinking was further confirmed by solid-phase sequencing which employed a






35

sufficiently polar solvent such as trifluoroacetic acid to extract the 32P-labeled phenylthiohydantion derivative of the crosslinked amino acid.

In addition to the above biochemical methods, gel electrophoresis is a simple but powerful analytical technique to resolve complex mixtures of peptides and identify the indirectly labeled, crosslinked peptides by autoradiography. In the studies reported in this chapter, we have analyzed the UV-crosslinked, Cbp2-32P labeled intron 5 RNA complexes by digesting the protein-RNA complexes with non-enzymatic cleavage agents and resolving the resultant peptides by one dimensional tris-tricine gel electrophoresis. We have mapped the major crosslink sites of intron 5 RNA to the N- and C-termini of Cbp2.

Results

Optimization of UV-Crosslinking Conditions

One of the technical hurdles in biochemical characterization of crosslinked complexes is isolation of sufficient amounts of the protein-RNA complexes, relatively free from other species. As the yield of the product depends on the extent of crosslinking, reaction conditions must be optimized to maximize the crosslinking efficiency. To that end, the dosage of UV-radiation employed for crosslinking Cbp2 protein to intron 5 RNA was titrated, holding other conditions constant. 32P-labeled intron 5 transcripts were incubated with native Cbp2 under low salt conditions (5 mM MgCl2, 50 mM NH4C1) without GTP. Cbp2 binds to intron 5 RNA under these conditions and induces formation of the catalytic RNA conformation (Shaw and Lewin, 1995). The Cbp2-RNA complexes generated






36
were UV-crosslinked in the presence of excess tRNA (added as a non specific competitor) by the technique of Zamore and Green (1989), as described in Materials and Methods. The samples were irradiated at an increasing UV-dosage ranging from 100 to 950 mJ. As a control, intron 5 RNA was irradiated with a noncognate protein, BSA, at the highest UV-dosage (950 mJ) employed in the experiment. All samples were extensively treated with RNAse A and RNAse TI to remove uncrosslinked RNA, and the protein-RNA complexes were resolved on SDS-polyacrylamide gels. The gel was autoradiographed (Figure 3-1) and also quantitated using Phosphorlmager. No crosslinked complex was observed in the presence of BSA (lane 1) even at a high dosage of UV-radiation, demonstrating the specificity of Cbp2-intron 5 RNA interaction. The extent of crosslinking of intron 5 RNA to Cbp2 increased by about 2-fold at a UV-dosage of 600 mJ (lane 7) compared to that at 100mJ (lane 2) and almost remained the same at higher doses (lanes 8 and 9). Thus a UV-dosage of 600 mJ was chosen as the lowest UV-dosage which yielded optimal complex formation. Identification of Cbp2 Peptides that Contact Intron 5 RNA

The UV-crosslinking technique standardized above was successfully employed to identify the RNA contact sites on Cbp2 protein. 32P-labeled intron 5 RNA transcripts were crosslinked to his-tagged Cbp2 under low salt conditions at a UVdosage of 600 mJ as described above. The Cbp2-RNA complexes generated were purified on SDS-polyacrylamide gels. The gel fragments were then soaked in different chemical cleavage reagents like hydroxylamine (NH2OH) and 2-nitro-5-


















Figure 3-1. Optimization of UV-dosage for crosslinking. 32P -labeled intron 5 RNA was incubated with Cbp2 or BSA under low salt conditions as described in Materials and Methods. Samples were irradiated with UV-doses ranging from 100 to 950 mJ, extensively RNAase-treated, resolved on 10% SDS-polyacrylamide gels, and crosslinked complexes detected by autoradiography. UV-irradiation was done at 950 mJ for BSA (lane 1), and for Cbp2 at 100 mJ (lane 2), 200 mJ (lane 3), 300 mJ (lane 4), 400 mJ (lane 5), 500 mJ (lane 6), 600 mJ (lane 7), 800 mJ (lane 8), and 950 mJ (lane 9).







38
















UV-dosage (mJ) Ln
BSA +--------------Cbp2 -+ + + + + + + +









12 34 56 78 9






39

thiocyanobenzoate (NTCB) to generate peptides. The peptides were separated on high percentage tris-tricine gels (Schagger and Von Jagow, 1987), and the crosslinked peptides that retained the label were identified by autoradiography (Figure 3-2).

NH20H cleaves proteins at asparaginyl-glycyl peptide bonds (Bornstein and Balian, 1977) and would yield three large peptides (15.1, 24, 37.1 kDa) in a complete digest of Cbp2. Cleavage of the crosslinked Cbp2-RNA complex (Figure 3-2, panel A) showed that the 24 kDa amino terminal and the 15.2 kDa carboxy terminal fragments of Cbp2 strongly crosslinked with intron 5 RNA, whereas the large central 37.1 kDa fragment displayed only a very weak signal. The fact that only two of the three peptides were strongly labeled suggests that the terminal fragments of Cbp2 might comprise important RNA binding domains. The weak signal retained by the central 37.1 kDa peptide suggests that other minor contact sites may be distributed throughout the length of protein. These sites of interaction may also contribute to the stabilization of the active intron structure, although the termini may be absolutely essential for the activity.

NTCB is specific to amino groups of cysteines (Jacobson et al., 1973; Degani and Patchornik, 1974). NTCB Cleavage of Cbp2 would produce 9 peptides ranging from 0.17 to 29.5 kDa if the reaction proceeded to completion. However, for several reasons, only a partial digestion of the protein could be achieved. Incomplete cleavage results from p-elimination and/or incomplete modification due to the reversible nature of the cyanylation reaction (Degani and Patchornik,


















Figure 3-2. Chemical cleavage of Cbp2-intron 5 RNA complexes. His-tagged Cbp2 was crosslinked to 32P-labeled intron 5 RNA under low salt conditions in the absence of GTP, extensively RNAse treated, gel purified on 10% SDSpolyacrylamide gels, and digested in-gel with hydroxylamine (panel A) and NTCB (panel B). Following cleavage, peptides were extracted as described in Materials and Methods, separated on 15% (hydroxylamine) or 16.5% (NTCB) tris-tricine gels, dried and autoradiographed. Molecular weights of strongly crosslinked peptides are indicated by arrows, with asterisks representing partial cleavage products. Panel C. 0.2 mM GTP was added to the crosslinking reaction mixture and incubated at 370C for 30 minutes. The reaction products were ethanol precipitated, resolved on 4% polyacrylamide-8M urea gels and autoradiographed. Lane 1 shows intron 5 RNA alone incubated in the reaction mixture. Lanes 2 and 3 show the spliced products of intron 5 RNA incubated with native and his-tagged Cbp2 repectively. The input RNA and the spliced products are schematically represented on the left.







41



A. B.
NH OH NTCB










-4-19.3 kDa* 24 kDa-P 15 kDa-- -4-7 kDa








C.1 2 3






42

1974). While complete denaturation of the protein is essential to obtain cleavage at the internal sites, Cbp2, a relatively large protein (73.4 kDa), appears to be somewhat refractile even to the strong denaturation conditions employed in these cleavage reactions. Cleavage of crosslinked Cbp2-RNA complexes with NTCB (Figure 3-2, panel B) generated several peptides that retained the label. Among the various indirectly labeled peptides, the 7.0 kDa N-terminal peptide and its corresponding partials (indicated by asterisks) of sizes 8.7 and 19.3 kDa could be readily identified. This further supports the finding that the N-terminus comprises an important RNA binding domain. However, the 5.6 kDa C-terminal fragment generated by NTCB (identified by silver staining, data not shown) did not retain the label, suggesting that the extreme C-terminal region may not be important for Cbp2-RNA interactions. The putative C-terminal contact site identified by NI20H cleavage may therefore be located upstream of this 5.6 kDa C-terminal fragment.

In order to demonstrate that the conditions employed for UV-crosslinking

promote the formation of active Cbp2-intron 5 RNA complexes, the reaction mixes were incubated with 0.2 mM GTP at 370 C for 30 minutes and the products were resolved on denaturing gels and autoradiographed. The results are shown in Figure 3-2, panel C. Reaction mixes containing either his-tagged (lane 3) or native Cbp2 (lane 2) protein clearly demonstrated splicing, while the RNA alone (lane 1) could not splice under similar low salt conditions.






43

The 6x histidine tag adds an additional 20 amino acid residues (about 2 kDa) to the N-terminus of the his-tagged Cbp2 protein. Therefore, the indirectly labeled N-terminal peptide and the partials obtained with his-tagged Cbp2 would migrate slower in the gels than their non-tagged counterparts. This difference in electrophoretic mobility was used as an analytical tool to confirm the assignment of the crosslink site to the N-terminal fragment (Figure 3-3, panels A and B). The NH20H and NTCB digestion patterns of the crosslinked complexes using either his-tagged or native Cbp2 were compared on the same gel. The results for NH2OH cleavage reactions run on 15% tris-tricine gels are shown in Figure 3-3, panel A. The N-terminal peptide of the his-tagged protein (lane 2) obtained by NH2OH cleavage migrated at 24 kDa level while the non-tagged peptide (lane 1) migrated faster (at 21.6 kDa level). The C-terminal peptides derived from both versions exhibited similar mobilities, since the his-tag is present only at the N-terminus. The corresponding NTCB digests of both versions of crosslinked Cbp2 are shown in Figure 3-3, panel B. The N-terminal peptide (7kDa) and the corresponding 8.7 and 19.3kDa partials (shown by asterisks) of his-tagged Cbp2 (lane 2) were shifted up in the 16.5 % tris-tricine gels compared to those generated from the native Cbp2 (lane 1). No other peptides shifted in the gel relative to the non-tagged version. These experiments showing differential mobility clearly demonstrate that the N-terminal crosslink site corresponds to the extreme N-terminal fragment. The minimal N-terminal peptide that crosslinked with intron 5 RNA was the 4.6 kDa peptide of the native Cbp2 that corresponds to the first 37 residues of the protein.


















Figure 3-3. Confirmation of the crosslink site in the N-terminus of Cbp2.
Native and his-tagged Cbp2 proteins were crosslinked to 32P-labeled intron 5 RNA and digested with hydroxylamine (panel A) and NTCB (panel B) as described in the legend to Figure 3-2. Lanes 1 and 2 represent the cleavage patterns of native and his-tagged Cbp2, respectively. Molecular weights of strongly crosslinked peptides are indicated by arrows, with asterisks representing partial cleavage products. Note the slower migration of N-terminal derived fragments in the histagged Cbp2 lanes.







45








0
A. z





21.6 kDa--O- -4-24 kDa
15 kDa--*2







0
B. z







16.9 kDa--O- 1 1 -4-19.3 kDa*

It -4-8.7 kDa*
*6.3 kDa--po- -4-7.0 kDa
4.6 kDa---lo1 2






46

Further analysis of the identified contact sites (Chapter 4) was restricted to the identified N-terminal fragment. However, certain conclusions can be drawn about the C-terminal fragment from the experiments described above. The 15 kDa Cterminal peptide generated by NH2OH cleavage showed strong crosslinking with intron 5 RNA (Figure 3-2, panel A). But the 5.6 kDa C-terminal fragment generated by NTCB (Figure 3-2, panel B) did not retain the label in crosslinking experiments. These results suggest that the 29.5 kDa penultimate C-terminal peptide of Cbp2 (aa 502-aa582) generated by NTCB has a potential RNA binding site.

The summary of findings from the UV-crosslinking experiments are shown in Figure 3-4. The map shows the two strong RNA binding regions (hashed boxes) that have been identified by these experiments, with one site being in the first 37 amino acids of the N-terminus and the other in a distally located C-terminal region (aa 502-aa 582). The digestion sites of NH2OH and NTCB on Cbp2 are also indicated in Figure 3-4. Further analysis of the importance of amino acid residues in the N-terminal fragment was carried out using site-directed mutagenesis (Chapter 4).

Discussion

UV-crosslinking is a powerful tool to identify RNA contact sites on a protein, especially when the primary structure and homology searches do not afford any clues about critical functional elements of the protein. Cbp2, required for the

















Figure 3-4. Summary of UV-crosslinking results. The peptide map represents the cleavage sites of NTCB (top arrows) and hyroxylamine (bottom arrows) on the 630-aa long Cbp2 protein. From the UV-crosslinking and chemical cleavage results shown in Figures 3-2 and 3-3, the intron 5 RNA crosslink sites on Cbp2 were mapped to the first 37 amino acids at the N-terminus and aa502-aa582 in the C-terminus (hashed boxes).

















co 11 tC o0
CO LnC14 o coNTCB


Ir 00

__ __ __ I1l 630



79NH20H 501


1 -M VNWQTLFMVSLRRQG SS SRYRYKFNMENITHQVFPRC-37






49

splicing of intron 5 RNA, fits into this profile of proteins. Nothing is known so far about the RNA contact sites on the protein while extensive studies are available on the RNA component of the system. In the studies reported here, UV-crosslinking was employed to determine the contact points of intron 5 RNA on Cbp2 in an attempt to investigate the functional interactions between this group I intron and its protein co-factor. The photocrosslinking studies were performed under conditions that favored the formation of stable protein-RNA complexes. The Mg levels (10 mM) employed in these experiments were sufficient to promote 90-95% RNA binding to Cbp2 in equilibrium filter binding assays (data not shown), but splicing of RNA would not occur under these conditions due to the absence of guanosine (nucleophile). However, control experiments show that addition of GTP to the reaction facilitates splicing, demonstrating that the crosslinking conditions enable the formation of productive Cbp2-RNA complexes (Figure 3-2, panel C).

Prior to determining the sites of crosslinking, it is essential to establish the specificity of crosslinking between the RNA and the protein in question. In control experiments, intron 5 RNA failed to crosslink to the non-cognate protein BSA (Figure 3-1), showing that photocrosslinking (zero-length crosslinking) can occur only between functionally interacting species. Also, Cbp2 proteins carrying mutations in the N-terminal domain showed reduced or no crosslinking with intron

5 RNA compared to the wild-type protein (discussed in Chapter 4). Furthermore, Cbp2 does not facilitate splicing of intron 4 of COB pre-mRNA (Lewin, unpublished observation), a group I intron that also requires a protein co-factor in






50
vivo (Lamb et al., 1983; Banroques et al., 1986). Cbp2 protein is specific to intron 5 RNA in its splicing-enhancing function. This corroborates the authenticity of the crosslinking results, as UV-light crosslinks an amino acid to its neighboring nucleic acid base only when present in a specific orientation (Williams and Konigsberg, 1991). The results of various experiments described above strongly suggest that the crosslinking conditions employed permit the structural probing of specific, functional interactions between Cbp2 and intron5 RNA.

Precise identification of the residues that participate in photocrosslinking can be accomplished by amino acid analysis or amino acid sequencing, as described earlier. These conventional biochemical techniques, however, require crosslinking efficiencies of 20% or more. Unfortunately, low crosslinking efficiencies (less than 10%) were obtained under our conditions. Therefore, the RNA employed for some of the crosslinking experiments was double labeled with c 32P-UTP and a32PATP to increase the specific activity of RNA and enable detection of crosslinked peptides. There are several possibilities for the low yields of crosslinked product obtained in our system. Cbp2 and intron 5 RNA may have inherently poor tendencies to crosslink in spite of appreciable complex formation. On the other hand, exposure to UV-light could be causing significant photoinactivation of Cbp2. Photodamage of protein was reported to be a problem by other groups (Gott et al., 1991; Tanner et al., 1988). Finally, though UV-crosslinking indicates sites of protein-RNA contact, most of the affinity between protein and RNA may be attributable to contact sites that are not crosslinked under the conditions employed.






51



The low level of crosslinked product obtained in our system proved to be a potential problem for further biochemical characterization of crosslinked complexes. One of the ways to overcome this problem would be to enhance the photosensitivity of RNA using modified residues like 5-bromouridine or 5iodouracil and using a monochromatic laser instead of a broad spectrum ultraviolet light. For instance, the amino acid residue Tyr 85 of R17 bacteriophage coat protein was shown to be crosslinked with singly BrU-substituted hairpin RNA 1 (Gott et al., 1991) using a monochromatic XeCI excimer laser (308 nm) that yielded crosslinking levels exceeding 50%. Substitution of 5-iodouracil for uracil in the binding site for bacteriophage R 17 coat protein improved crosslinking levels to 80% in less than 5 minutes of irradiation (Willis et al., 1993). However, incorporation of 5-BrU into intron 5 RNA significantly reduced its autocatalytic activity, indicating that the structure of the ribozyme was perturbed (data not shown). Also, our attempts to crosslink Cbp2 protein with 5-BrU-RNA using a broad spectrum UV-source (Stratalinker) did not significantly enhance the extent of crosslinking. Since we did not have ready access to a monochromatic laser, we opted to employ alternative analytical methods which accommodate low crosslinking efficiencies.

A popular approach to analyze crosslinked complexes obtained at low yields is to employ extremely sensitive analytical techniques like Matrix-assisted, laser desorption/ionization-time of flight (MALDI-TOF) mass spectrometry (Karas and






52

Hillenkamp, 1988; Beavis and Chait, 1990 and Hillenkamp et al., 1991) and ladder sequencing (Chait et al., 1993), which typically require 10-15% crosslinking efficiency. Elaborate attempts were made to identify the crosslinked peptides/amino acid residues using this approach in collaboration with the Protein Core facility of the Interdisciplinary Center for Biotechnology Research (ICBR), University of Florida. Unfortunately, all attempts failed due to various technical problems including difficulty in removal of SDS, Coommassie Blue and other gelderived contaminants from the peptides. Consequently, the indirectly labeled Cbp2 peptides (crosslinked with intron 5 RNA) were identified by size separation on tris-tricine gels followed by Phosphorlmager analysis (Figures 3-2 and 3-3). Non-enzymatic cleavage agents were used instead of proteases to avoid interference from protease-derived peptides resulting from self-cleavage. Of several chemical cleavage reagents, hydroxylamine was chosen for the initial analysis of crosslinked complexes as it generates only a few large peptides in Cbp2 that can be readily identified on high percentage tris-tricine gels. NTCB was selected as a secondary reagent to further narrow down the contact points on Cbp2.

Chemical cleavage of the protein-RNA complexes with NH2OH and NTCB

showed that the termini of Cbp2 comprise important RNA binding domains, while several stretches in the central core of the protein may contribute to the overall stabilization of protein-RNA interactions (Figures 3-4). Experiments with histagged and native versions of Cbp2 (Figure 3-3) unambiguously demonstrate that the first 37 amino acids in the N-terminus of Cbp2 constitute a strong RNA contact






53
site. A second site may be located in the C-terminus between residues 502 and 582 of the protein. A similar architecture of RNA binding domains has been demonstrated with the mitochondrial tyrosyl-tRNA synthetase protein (Cyt- 18) of Neurospora which is essential for splicing several mitochondrial group I introns in addition to aminoacylation of tRNATyr (Akins and Lambowitz, 1987). The regions required for splicing are distributed throughout the Cyt-18 protein, as it binds the precursor RNA and facilitates formation of the catalytic RNA structure. These regions overlap with the stretches required for synthetase activity but are not identical to them. However, the principal RNA binding regions include a small, idiosyncratic N-terminal domain significantly absent in bacterial tyrosyl-tRNA synthetases (Cherniack et al., 1990) and a C-terminal tRNA-binding domain required for both splicing and synthetase activities (Kittle et al., 1991).

A comparison of Cyt 18 binding sites in N. crassa mt LSU and ND1 introns with that in N. crassa mt tRNATyr has revealed a remarkable three-dimensional overlap between the tRNA and the catalytic core of group I introns, suggesting an evolutionary relationship between group I introns and tRNA and perhaps the evolution of RNA splicing factors from cellular RNA-binding proteins (Caprara et al., 1996). Adaptation of a synthetase to facilitate group I intron splicing appears to be a relatively recent evolutionary improvement as it has been reported in only one other closely related fungus, Podospora anserina (Cherniack et al., 1990; Lambowitz and Perlman, 1990 and Kamper et al., 1992).






54

Cbp2 protein does not possess any sequence homology with Cyt 18 of N. crassa or Ytsl protein of P. anserina. However, the latter two share three blocks of amino acids required for splicing, of which one corresponds to the idiosyncratic Nterminal domain of Cyt- 18, while the other two are located in the putative Cterminal tRNA binding domain. Although Cbp2 is not a bifunctional protein, the structural similarities between the catalytic core of group I introns and tRNA may point to a common mechanism of recognition of a conserved tRNA-like structural motif in its cognate intron, intron 5 RNA.













CHAPTER 4
MUTATIONAL ANALYSIS OF THE N-TERMINUS OF CBP2


Introduction

UV-crosslinking studies (Chapter 3) show that the N- and C-termini of Cbp2 intimately contact intron 5 RNA. Now the challenge is to identify which amino acids in these regions are important for Cbp2 function. Unlike most other RNAbinding proteins, Cbp2 does not contain any well-characterized RNA binding motifs like the RGG box, RNP or KH motif (Burd and Dreyfuss, 1994). However, Cbp2 is rich in basic and hydrophobic amino acids, which is also a characteristic of double stranded RNA-binding proteins (St Johnston et al., 1992; Gatignol et al., 1993). The only protein with which Cbp2 displays any homology is its counterpart in S. douglasii (Li et al., 1996). However, the extremely high identity (87%) between the two homologs does not lend itself to the identification of potential RNA binding domains by sequence alignments. Therefore, the only viable alternative is to identify the important residues by biochemical or genetic methods. The low crosslinking efficiencies obtained in our system ruled out the use of biochemical methods such as anion-exchange HPLC or mass spectrometry to identify the critical residues. Therefore, site-directed mutagenesis was used to identify critical residues for Cbp2 function.


55






56
Site-directed mutagenesis is a powerful tool to study the structure-function relationship of single or combinations of amino acid residues in proteins. It has been classically used in probing various RNA-protein interactions. One of the many applications of this technique has been to dissect the individual functions of various amino acids in dual-function proteins. For instance, the MS2 (R17) bacteriophage coat protein which binds and encapsidates viral RNA also acts as a translational repressor of viral replicase by binding to an RNA hairpin in the RNA genome. LeCuyer et al., 1995, LeCuyer et al., 1996) successfully studied the RNA binding properties of MS2 coat protein independent of capsid assembly by isolating a Val75Glu; Ala8 1Gly double-mutant coat protein which had wild-typelike affinity and specificity for RNA, but was defective in capsid assembly.

Site-directed mutagenesis has also been employed to study the evolutionary

relationships of RNA-binding proteins in various species. For example, the second intron (bi2) of cyt b gene has two homologs in related Saccharomyces species that differ in their mobility. The S. capensis intron product is bifunctional, with both a DNA endonuclease and an RNA maturase function (Lazowska et al., 1992; Szczepanek and Lazowska, 1996), whereas the homologous S. cerevisiae intron product has only an RNA maturase function and is not mobile (Meunier et al., 1990; Lazowska et al., 1992). These two intron-encoded proteins differ by only four amino acid substitutions. Mutational analysis showed that replacement of two non-adjacent amino acids (Thr212Ala; Thr239His) in the S. cerevisiae maturase was necessary and sufficient for the acquisition of an endonuclease activity






57

promoting intron mobility (Szczepanek and Lazowska, 1996). Thus, the S. capensis protein could be considered more primitive in terms of mitochondrial group I intron-encoded protein evolution as the two activities have not yet diverged. The S. cerevisiae protein, on the other hand, lost the original function (intron mobility) and maintained the acquired one (RNA maturase function) during evolution.

Site-directed mutagenesis has been instrumental in delineating novel RNA binding motifs of proteins with little or no sequence homology to known RNA binding consensus sequences. The viral coat proteins of the plant viruses alfalfa mosaic virus (AMV) and tobacco streak virus (TSV) share little primary amino acid sequence identity (van Vloten-Doting, 1975; Reusken et al., 1995), but are functionally interchangeable in RNA binding (Zuidema and Jaspars, 1984) and initiation of infection (Gonsalves and Garnsey, 1975). The lysine-rich N-terminal RNA binding domain of the AMV coat protein lacks previously identified RNA binding motifs. Mutational analysis of this N-terminal region identified a single arginine whose specific side chain and position were crucial for RNA binding (Ansel McKinney et al., 1996). Consequently, protein sequence alignments between AMV, TSV, and other related viruses centered on this key arginine residue revealed a new RNA binding consensus sequence. This also explained in part why heterologous viral RNA-coat protein mixtures were infectious.

In the case of Cbp2, we employed site-directed mutagenesis to identify the

important residues (by either partial or complete loss of Cbp2 function) in the N-






58

terminus that crosslinked to intron 5 RNA. The C-terminal region that strongly crosslinked to RNA was not pursued further, as attempts to narrow down this region by double digestion of crosslinked complexes with NH2OH followed by cyanogen bromide were not feasible within the resolution of our gel system.

In order to identify targets for site-directed mutagenesis of Cbp2, the putative N-terminal RNA contact site on Cbp2 (spanning 37 residues) was scanned closely to allow the prediction of residues that might be important in RNA-protein interactions. This sequence, aal7 SSSRYRYKFNME aa28, has the following interesting features:

a. Charged residues alternate with aromatic residues. b. Polar residues flank the region of alternating charged and aromatic residues. While the charges could promote ionic interactions between protein and RNA, the aromatic residues could engage in stacking interactions. The stretch of serines could participate in hydrogen bonding interactions. These various possibilities led us to target this N-terminal region (aal7-aa28) for site-directed mutagenesis. The details of the analyses of all these mutants and a discussion of their implications are described in the following sections.

Results

All mutant his-tagged Cbp2 proteins (Table 4-1) were purified by one-step

metal affinity chromatography as described in Materials and Methods. The serine deletion mutant and the Y23L mutant could not be successfully purified. The






59











Table 4-1. Description of Cbp2 mutants



Name of Mutant Mutant Description


Deletion mutant Deletion of aal7-aa28

Triple aromatic mutant Changes Y21, Y23, and F25 to L Triple charged mutant Changes R20, R22, and K24 to L

Y21IL mutant Changes Y21 to L

Y23L mutant Changes Y23 to L

F25L mutant -Changes F25 to L

Serine, deletion mutant Deletion Of S17, S18, and S19






60

former eluted in the wash fractions with other E. coli proteins, while the latter copurified with a nuclease activity and could not be assayed. The serine deletion appears to have altered the global conformation of Cbp2 (perhaps the topology of the histidine tag), resulting in poor binding to the nickel column. Independent attempts to purify the Y23L mutant with fresh reagents and columns still yielded preparations with high nuclease activity, raising the possibility that this mutation has conferred a nuclease function to Cbp2. This problem was not encountered in parallel preparations of any of the other mutants. Although these mutants appear to possess interesting properties, they were not characterized further.

The mutant Cbp2 proteins purified from E.coli were first analyzed by Western blotting with a Cbp2-specific polyclonal antibody to check for production of the full-length protein. Mutant proteins were separated on a 10% SDS-polyacrylamide gel and electroblotted to a nitrocellulose membrane at 15 volts, overnight. The membrane was first probed with Cbp2-specific primary antibody followed by secondary goat anti-rabbit antibody as described by Towbin et al. (1979). The Cbp2 bands were detected by chemiluminescence using ECL detection system (Amersham) (Figure 4-1, panel A and panel B). All mutant proteins (in both panels) except the deletion mutant (lacking aal 7-aa28) exhibited electrophoretic mobilities similar to that of wild-type Cbp2. The deletion mutant (aa 17-aa28) was shorter by about 1.3 kDa, as expected. These data confirm the synthesis of full length mutant Cbp2 proteins in E. coli. To test the effects of these mutations on splicing function, in vitro splicing assays were carried out. 32P-labeled intron 5


















Cq

c! C-q





0 Cd > 0













Cq




aj


In.



p3
-0 C;3 cd





oj




eq
0 C'i
u
u



4 u





cq







00
tA C'j
ww







62






Lf)
ICZA lizlk


qszd Cl)


C'4





06












Cf)



(sz-zl) U014alaa C4


x4puio.ir aldiijL V-4






63

RNA transcripts were incubated with increasing concentrations of wild-type or mutant Cbp2 proteins under low salt splicing conditions. The reaction products were separated on 4% polyacrylamide-8M urea gels and autoradiographed (Figure 4-2). Increasing concentrations of deletion mutant (aal 7-aa28) (lanes 4 and 5) and triple aromatic mutant (lanes 6 and 7) failed to stimulate splicing of intron 5 RNA, while wild-type Cbp2 spliced normally at both concentrations tested (lanes 2 and 3). These results strongly suggest that the N-terminal residues (aal7-aa28) may comprise an important RNA binding domain essential for Cbp2 function. However, it is important to demonstrate that the loss of activity observed was not due to structural destabilization caused by these mutations.

Partial proteolysis is a useful technique to analyze the conformational states of proteins (Chang and Doi, 1993; Hay and Nicholson, 1993; Petersen et al., 1995; Ikeda et al., 1996; Liu et al., 1996). In this assay, deletion and triple aromatic mutant proteins (in native states) were incubated separately with trypsin under conditions that favored partial proteolysis as described in Materials and Methods. A control digest with native or heat-denatured wild-type Cbp2 was also done. The peptides were resolved on 12% SDS-PAGE gels and detected by Western blotting with a Cbp2-specific polyclonal antibody (Figure 4-3). The tryptic peptide profiles of native deletion (lanes 3 and 4, panel A) and triple aromatic (lanes 3 and 4, panel B) mutants closely resembled the pattern obtained with native wild-type Cbp2 (lanes 5 and 6 of both panels). In contrast, heat-treated wild-type samples (lanes 1 and 2 of both panels) exhibited a different pattern, showing aggregation of


















Figure 4-2. Functional analysis of deletion (aa17-aa28) and triple aromatic mutants. 32p-labeled intron 5 RNA was incubated with increasing concentrations of wild-type and mutant Cbp2 under low salt splicing conditions at 370C for 1 hour, ethanol precipitated, resolved on a 4% polyacrylamide-8M urea gel, and autoradiographed. The precursor RNA and the products of splicing are schematically represented on the left side of the gel, with the ratio of protein to RNA shown on top of the lanes. Lane 1, precursor RNA alone; lanes 2 and 3, incubation with wild-type Cbp2; lanes 4 and 5, incubation with deletion (aal7aa28); lanes 6 and 7, incubation with triple aromatic mutant (Y21, Y23, F25 to L).







65








5-4


4'

Protein: RNA 6































2 3 4 5 6 7




















cis 4.) 4 0
"Cl


0
4.



0 '74






la,
4-A




cd -r

0
tv rcis
0 0 J. .- 0 V) co cp

C-) u cq


u Cq u
rq

u 00 u
C4
0









o3 4-o a) q3
C8


42
-cl u V)
-C
C-q







cd



4


Qf) cn


4

14)







67












ZdqD 4m 09:1
1001:1 LO
os:l
:)i Pwon aldlijL
L001:1 Cf)
ZdcD Im F os:l
pajnjLuaP-4LaH 001:1

CA




F-4








zdqD IMF os:i
001:1 Ln

(qzuu-LTuu)Fos:l
U014ala(l 001:1 co


ZdcD ImF osi: I pajnlPuaP-ILaH
001:1 0-






68

denatured protein at the top of the gel. In addition, partial products corresponding to those obtained with native proteins were markedly absent in these digests. This is probably due to complete degradation of denatured protein molecules that were not present in aggregates. Thus, these results demonstrate that the mutations in Cbp2 did not alter the global conformation of these proteins.

Preliminary splicing experiments with triple charged mutant (R20, R22, K24 changed to leucine) and two point mutants, namely Y2 1 L (tyrosine to leucine change at position 2 1) and F25L (phenylalanine to leucine at position 25), showed varying degrees of activity. These mutants were characterized further by a series of time-course experiments that measured their initial rates of splicing (Figures 4-4 and 4-5). 32P-labeled transcripts were pre-incubated with each mutant protein at 37 0C for 10 minutes under low salt conditions and splicing was initiated by the addition of 0.2 mM GTP. The reactions were terminated at different times, resolved on denaturing polyacrylamide gels (Figure 4-4A & B) and autoradiographed. The F25L mutant (Figure 4-4A, right panel) stimulated splicing at levels comparable to wild-type Cbp2 (Figure 4-4A, left panel), while the triple charged and Y21IL mutants (Figure 4-413 left and right panels, respectively) showed drastic reduction in the extent of splicing. It is interesting to note that in the case of triple charged and Y2 I L mutants (compare Figures 4-4 A and 4-4B), the products of the first step of splicing (5' exon and the intron-3' exon) were barely detectable compared to the products of the second step (ligated exons and free intron), suggesting that the first step of splicing is rate limiting for these two


















Figure 4-4. Time course of splicing for wild-type and mutant Cbp2. Radiolabeled intron 5 RNA was incubated with wild-type or mutant Cbp2 proteins under low salt splicing conditions. Reactions were terminated at indicated times, resolved on 4% polyacrylamide-8M urea gels, and autoradiographed. A schematic representation of the precursor RNA and spliced products are given on the left side of the figures. A. Shows the splicing time course for the wild-type Cbp2 (left panel) and F25L mutant (right panel). B. Shows the splicing time course for the triple charged mutant (left panel) and the Y21L mutant (right panel). A marker lane with wild-type Cbp2 was run on the right of each panel to indicate the location of spliced products.








A.


Wt Cbp2 F25L

Time (min) 0 1 2 4 6 8 10 12 24 60 0 1 2 4 6 8 10 12 24 60
.. -..... .. .. -.... .. ......







.. .. ... .. .... .0









B.

Triple charged mutant Y21L mutant
Time (min) 0 1 2 4 6 8 10 12 24 60 0 1 2 4 6 8 10 12 24 60










Fgr t -A continued















Figure 4-4..continued


















Figure 4-5. Splicing rates of wild-type and mutant Cbp2. The gels shown in Figure 4-4 were quantitated using Phosphorlmager and the RNA fraction spliced calculated as the ratio of the sum of ligated exons and free 5' exon to the exon sequences present in the precursor RNA. The plots show RNA fraction spliced (+/-S.D) vs. time in min. A. Filled circles, Wt Cbp2; open circles, F25L mutant; filled squares, Triple charged (LYLYLF) mutant; open squares, Y2 1 L mutant. B. The plots for the last two mutants shown in A are plotted on an expanded scale to show initial rates of splicing. Filled circles, Triple charged (LYLYLF) mutant; open circles, Y2 1 L mutant.







73











A.



1.2
--- Wt Cbp2
--0-- F25L
--- LYLYLF
1.0 ---- Y21 L


0.8

CI)

o 0.6
- I
4-)

0.4 l<
z

0.2



0.0
0 5 10 15 20 25

Time (min)







74












B.




--- LYLYLF
0.08 -o- Y21L




.' 0.06 C-)


o 0.04

44

: 0.02
z



0.00,,
0 5 10 15 20 25

Time (min)













Figure 4-5...continued






75

mutants. A quantitative representation of splicing for the wild-type and mutant proteins is shown in Figure 4-5A. A re-plot of the data corresponding to triple charged and Y2 IL mutants is shown on an expanded scale in Figure 4-5B3. Initial rates of splicing were calculated from the above plots for all mutants (Table 4-2). Figure 4-5A shows that the triple charged (filled squares) and the Y2 1 L (open squares) mutants exhibited extremely low activity compared to F25L mutant (open circles) or wild-type Cbp2 (filled circles). However, it is obvious from Figure 45B that both triple charged and Y2 1 L mutants accumulated spliced products with time. Initial rate measurements (Table 4-2) indicated that the rate of splicing of the F25L mutant, though appreciable, was slightly lower than that of the wild-type protein. In the case of the Y2 I L and triple charged mutants, the initial rate of splicing was lowered by -45-fold and -4O-fold, respectively, in comparison to wild-type Cbp2. Thus, tyrosine at position 21 is critical for activity while a phenylalanine at position 25 is dispensable. The charged residues at positions 20, 22 and 24 are also important for Cbp2 function.

To determine if lower splicing activity of the Cbp2 mutants corresponded to a reduction in overall affinity for intron 5 RNA, equilibrium binding assays were performed. 32P-labeled intron 5 RNA (16 pM) was incubated with increasing concentrations of wild-type or mutant Cbp2 (0-4000 pM) at 370C for 30 minutes and equal aliquots were filtered in duplicate through a double-filter consisting of nitrocellulose on top and charged nylon at the bottom, as described in Materials and Methods. Representative filter binding data are shown in Figure 4-6A. The






76










Table 4-2. Rate measurements for wild type and mutant Cbp2

Cbp2 protein RNA fraction spliced Initial rate of splicing at 60 minutes (fraction min'l)

Wild-type 0.94 0.22 0.189

F25L 0.68 0.09 0.162

LYLYLF 0.11 0.01 0.474 x 10-2

Y21L 0.05 0.0005 0.417 x 10-2


















Figure 4-6. Double filter-binding assay of wild-type and mutant Cbp2. A. Radiolabeled RNA was incubated with increasing concentrations of wild-type and mutant proteins under low salt splicing conditions (without GTP) at 370C for 30 min. Equal aliquots of each reaction were filtered in duplicate through a sandwich consisting of nitrocellulose on top and charged nylon at the bottom, as described in Materials and Methods. RNA-binding patterns for the triple charged and F25L mutants and wild-type Cbp2 on nitrocellulose (left panel) and nylon (right panel) are shown. B. The dot blots shown in A. were quantitated using Phosphorlmager and the fraction RNA bound calculated as described in Materials and Methods. The fraction of RINA bound is plotted as a function of Cbp2 concentration. Open squares, Y2 1 L; filled squares, triple charged mutant; open circles, deletion (aalI7-aa28); filled circles, triple aromatic mutant; open triangles, F25L; filled triangles, wildtype Cbp2.















Nitrocellulose Nylon N+




[Cbp2] --o

Triple 0 0
charged 0 *#*#*0

00

F25L
mutant




Cbp2











B.


1.0





0.8




0 0.6-c 0.4,




--e-Triple charged
0.2 0 Deletion (aal7-28)
*-- Triple aromatic A-- Wild type & F25L
0.0 I I
0 1000 2000 3000 4000

Cbp2 (pM) Figure 4-6...continued






80

nitrocellulose membrane, which contains protein-RNA complexes (left panel) showed an increase in the bound RNA fraction with increasing Cbp2 concentrations, while the nylon membrane which contains free RNA (right panel) showed a corresponding decrease in the free RNA retained. Each filter binding experiment (in duplicate) was repeated at least two times and the RNA binding data (Figure 4-6B) used to calculate dissociation constants (kd) (Table 4-3).

The F25L mutant (open triangles), which showed wild-type-like splicing

activity, demonstrated RNA binding levels comparable to that of wild-type (filled triangles). The kd values of wild-type protein and F25L mutant were very similar (147 pM and 143 pM respectively). The triple charged (filled squares) and the Y21L mutants (open squares), which displayed partial splicing activity, showed reduced binding. These two mutants showed '-2.5-fold and '-5-fold increase in kd values, respectively, relative to wild-type Cbp2. The deletion mutant (open circles) showed slightly tighter binding (kd of 77 pM) than wild-type, whereas the triple aromatic mutant (filled circles) showed slightly lower binding levels (kd Of 184 pM) compared to wild-type Cbp2. Although the kd1 values are variable, the overall RNA binding profiles of mutants are similar to that of wild-type Cbp2 (hyperbolic). The similarity in binding isotherms for most of the mutant proteins confirms our conclusion that the amino acid changes have not significantly destabilized the higher order structure of protein. These results also suggest that the overall RNA binding pattern does not necessarily reflect the ability to stimulate splicing of intron 5 RNA.






81











Table 4-3. Dissociation constants of Cbp2 mutants



Cbp2 protein kd (pM)

Deletion (aal7-aa28) 77

Wild type Cbp2 147

F25L mutant 143

Triple aromatic mutant 184
(Y21, Y23, and F25 to L) Triple charged mutant 367
(R20, R22, and K24 to L) Y21L mutant 710






82



Since the putative contact sites in Cbp2 were initially identified by UVcrosslinking, the mutants were tested for their ability to crosslink to intron 5 RNA. 32P labeled RNA transcripts were UV-crosslinked to wild type or mutant Cbp2 protein, RNAase treated and resolved on 10% SDS-polyacrylamide gels. The crosslinked complexes were detected by autoradiography (Figure 4-7) and quantitated using PhosphorImager. RNA crosslinked in the absence of protein (lane 5) was almost completely degraded, without any detectable complexes. However, RNA crosslinked to wild type Cbp2 (lane 4) showed a prominent crosslinked species corresponding to the molecular weight of Cbp2. Crosslinking to triple charged (lane 3) and F25L (lane 1) mutant proteins was reduced by -50% and -53%, respectively, compared to wild type. The Y21L mutant (lane 2) showed extremely poor crosslinking to intron 5 RNA. The background bands seen below the level of Cbp2 (lanes 1 to 4) could be photodamaged Cbp2-RNA complexes or RNA-RNA crosslinks that were resistant to RNAase. Thus, mutations at positions R22, R24, K26, Y21 and F25 lowered the crosslinking efficiency of Cbp2. It is important to note that mutations targeting the above residues also affected splicing, with the exception of the F25L mutation. Thus, some of the residues in this region (aal7-aa28) that are important for Cbp2 function also appear to be involved in crosslinking Cbp2 to intron 5 RNA.

As partial proteolytic profiles (Figure 4-3) and filter binding curves (Figure 46B) of deletion (aal7-aa28) and triple aromatic mutants were similar to that of


















Figure 4-7. UV-crosslinking of wild-type and mutant Cbp2 to intron 5 RNA. Wild-type or mutant Cbp2 was incubated with radiolabeled intron 5 RNA under low salt conditions in the presence of 20 ug/ml tRNA. The samples were then UVcrosslinked at 600 mJ, extensively RNAase treated, resolved on 10% SDS-PAGE gels, and autoradiographed as described in Materials and Methods. Lane 1, F25L mutant; lane 2, Y21L mutant; lane 3, triple charged (LYLYLF) mutant; lane 4, wild-type Cbp2; lane 5, radiolabeled RNA alone. The molecular weight position of Cbp2 is indicated by the arrow.









84

















cu O-j
Ln
cq C4 74 kDa-01 2 3 4 5






85

wild-type, they were tested for their ability to compete with wild-type Cbp2 in splicing assays. Splicing reactions were set up at wvild-type Cbp2 to intron 5 RNA ratio of 7:1 in the presence of increasing concentrations of mutant proteins. Reaction products were resolved on denaturing gels and autoradiographed (Figure 4-8A). Wild-type Cbp2 alone (lane 1) spliced normally while the deletion (lane 2) or triple aromatic (lane 7) mutant alone was completely defective in splicing activity, as reported before. Addition of increasing concentrations of deletion (lanes 3 to 6) or triple aromatic (lanes 8 to 11) mutant protein to wild-type Cbp2mediated reactions showed a progressive inhibition of splicing (compare lane 1 with lanes 3 to 6 and 8 to 11). These results are quantitatively represented in Figure 4-8B3. The graphs show percentage splicing as a function of mutant:wildtype ratios, with the extent of splicing obtained in the presence of wild-type Cbp2 alone set to 100%. Results of the addition of deletion and triple aromatic mutants are shown in the left and right panels, respectively. Addition of a 3-fold excess of deletion mutant lowered splicing levels to 40% of control levels. A similar inhibition of splicing was observed with triple aromatic mutant, although at a higher ratio (9: 1) of mutant to wild-type Cbp2. Thus, Cbp2 mutants inhibited the protein-mediated splicing of intron 5 RNA when present in excess over the wildtype protein.

It is important to note that at the highest level of splicing inhibition (Figure 4813), total protein (mutant + wilId-type) to RNA ratio was 7 1: 1 for the deletion mutant and 140:1 for the triple aromatic mutant. It is, therefore, possible that the

















Figure 4-8. Effect of mutant proteins on wild-type Cbp2-mediated splicing. Splicing reactions were performed at 7:1 wild-type Cbp2:RNA in the presence of increasing concentrations of deletion (aal 7-aa28) or triple aromatic mutant proteins. Reactions were resolved on 4% polyacrylamide-8M urea gels and autoradiographed. A. Lane 1, wild-type Cbp2 alone; lane 2, deletion mutant (aal7-aa28) alone; lanes 3-6, constant amount of wild-type + increasing concentrations of deletion mutant proteins; lane 7, triple aromatic mutant alone; lanes 8-11, constant amount of wild-type + increasing concentrations of triple aromatic mutant proteins. The ratio of mutant to wild-type Cbp2 in each reaction is indicated above the lanes. The precursor RNA and spliced products are schematically represented on the left of the gel. B. The splicing gels in A were quantitated using PhosphorImager and the % splicing (determined from ligated exons) plotted as a function of mutant:wildtype Cbp2, setting the extent of splicing with wild-type Cbp2 alone to 100%. The left and right panels show data corresponding to deletion (aal 7-aa28) and triple aromatic mutants, respectively.










A.
Deletion Triple aromatic
(aal7-aa28) (RLRLKL)

Mutant: Wt Cbp2 ', 7 71 71' c: 00 67 6 6$




C) CD M cr, 00




















12 3 4 56 78 910 1










B.

Deletion (aal7-28) Triple aromatic mutant
120 120

100 100.


0 80
00
00
0
60 6040o 40

20 20

0. 0
0:1 0.6:1 3:1 6:1 9:1 0:1 1.8:1 9:1 18:1 27:1
Mutant: Wt-Cbp2 Mutant : Wt-Cbp2



Figure 4-8...continued






89

inhibition observed in this experiment was a function of total protein concentration (mutant + wild-type Cbp2), rather than being a property of mutants. To test this possibility, splicing was performed with increasing concentrations of wild-type Cbp2 alone (Figures 4-9A and 4-9B3). Maximum splicing activity was obtained at a protein:RNA ratio of 7:1 (lane 4 in Figure 4-9A; expressed as 100% activity in Figure 4-9B3). However, splicing was severely inhibited at 28:1 (lane 6), and almost completely inhibited at higher ratios (lanes 7 and 8) of wild-type Cbp2:RNA. The splicing levels dropped to 21% (for 28:1) and -1% (for 56:1 and 112: 1) of the activity obtained at 7:1 ratio (Figure 4-9B3). Thus, wild-type Cbp2 appears to stimulate splicing only in a narrow range of protein:RNA ratios, with higher levels being inhibitory. In order to determine whether aggregation was the cause for the observed inhibition of activity, these experiments were repeated over a wide range of concentrations of wild-type Cbp2. Identical inhibition was observed whether the protein was titrated at lower (3.6-5 8 nM) or higher (up to 116 nM) ranges, suggesting that aggregation of protein was not a problem in these experiments (data not shown).

It is possible that the observed inhibition of splicing at higher concentrations of wild-type protein could be due to non-specific interactions of Cbp2 (a highly basic protein) with its RNA counterpart. This possibility was tested using the nonspecific competitor, tRNA, in partially inhibited splicing reactions. A titration of Cbp2 concentration in the absence of tRNA is shown in Figures 4- 1 OA (lanes 1 to 6) and 4-l1OB (left panel). The maximal splicing observed at 14:1 ratio (lane 3,


















Figure 4-9. Effect of increasing concentrations of wild-type Cbp2 on proteinmediated splicing. Radiolabeled intron 5 RNA was pre-incubated with increasing concentrations of wild-type Cbp2 for 10 min at 370C. Splicing was initiated by the addition of 0.2 mM GTP and incubation continued at 37'C for 30 min. Spliced products were resolved on 4% polyactylamide-8M urea gels and autoradiographed. A. Lane 1, intron 5 RNA alone; lane 2, splicing at protein:RNA of 1:1; lane 3, 3.5:1; lane 4, 7:1; lane 5, 14:1; lane 6, 28:1; lane 7, 56:1; and lane 8, 112:1. B. PhosphorImager quantitation of the gel shown in A was used to plot the % splicing (ratio of the sum of ligated exons and 5' exon to unspliced precursor) as a function of wild type-Cbp2 to RNA ratios, setting the extent of splicing obtained at 7:1 to 100%.







91



A.




Cbp2: RNA 5 t 4 N



































1 2 3 4 5 6 7 8







92












B.



100 80



60



40 20




1:1 3.5:1 7:1 14:1 28:1 56:1 112:1

Wt-Cbp2:RNA









Figure 4-9... continued




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E8M8014TB_HM62FR INGEST_TIME 2014-07-28T22:34:46Z PACKAGE AA00022301_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

51$3527(,1 ,17(5$&7,216 2) $ 0,72&+21'5,$/ *5283 ,,17521 ,1 6DFFKDURP\FHV FHUHYLVLDH %\ +<0$9$7+, 7,583$7, $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*0(176 WKDQN 'U $OIUHG 6 /HZLQ P\ PHQWRU DQG VXSHUYLVRU IRU KLV FRQVWDQW VXSSRUW LQ ERWK DFDGHPLF DQG SHUVRQDO PDWWHUV +H JDYH PH LPPHQVH IUHHGRP LQ WKH FRQGXFW RI H[SHULPHQWV DQG VWRRG E\ PH GXULQJ GLIILFXOW WLPHV NQHZ FRXOG DOZD\V FRXQW RQ KLP ZRXOG DOVR OLNH WR WKDQN DOO WKH SDVW DQG SUHVHQW FROOHDJXHV LQ WKH ODE ZKR KDYH PDGH OLIH LQ WKH ODE HQMR\DEOH DQG IULHQGO\ ZRXOG OLNH WR WKDQN WKH PHPEHUV RI P\ DGYLVRU`n FRPPLWWHH 'UV %HUW )ODQHJDQ +HQU\ %DNHU DQG 3KLO /DLSLV IRU WKH YDULRXV FRQVWUXFWLYH VXJJHVWLRQV WKH\ KDYH PDGH GXULQJ WKH FRXUVH RI WKH LQYHVWLJDWLRQ DQG IRU WDNLQJ WKH WLPH WR UHYLHZ YDULRXV GRFXPHQWV LQFOXGLQJ WKLV RQH DOVR DSSUHFLDWH WKH LQSXW IURP DOO WKH RWKHU IDFXOW\ DQG VWXGHQWV LQ WKH GHSDUWPHQW ZKLFK KDV KHOSHG LQ P\ SHUVRQDO JURZWK DOVR WKDQN WKH RWKHU SHUVRQQHO LQ WKH 'HSDUWPHQW HVSHFLDOO\ -R\FH &RQQHUV DQG %UDG 0RRUH IRU WKHLU HIILFLHQW KHOS 0\ VSHFLDO WKDQNV JR WR &KDQGX P\ KXVEDQG ZKR KDV VWRRG E\ PH GXULQJ DOO WLPHV DQG PDGH WKLV DOO SRVVLEOH X

PAGE 3

7$%/( 2) &217(176 $&.12:/('*0(176 LL /,67 2) 7$%/(6 Y /,67 2) ),*85(6 YL $%675$&7 YLL &+$37(56 ,1752'8&7,21 *HQHUDO ,QWURGXFWLRQ *URXS ,QWURQV 3URWHLQ )DFLOLWDWHG 6SOLFLQJ 7ZRFRPSRQHQW 6\VWHP RI &ES DQG ,QWURQ 51$ 0DMRU 2EMHFWLYH RI 'LVVHUWDWLRQ 0$7(5,$/6 $1' 0(7+2'6 2YHUH[SUHVVLRQ DQG 3XULILFDWLRQ RI &ES ,Q YLWUR 7UDQVFULSWLRQ 89FURVVOLQNLQJ DQG *HQHUDWLRQ RI 3HSWLGHV 6LWHGLUHFWHG 0XWDJHQHVLV ,Q YLWUR 6SOLFLQJ $VVD\ 3DUWLDO 3URWHRO\VLV RI &ES (TXLOLEULXP %LQGLQJ $QDO\VLV ,'(17,),&$7,21 2) ,17521 51$ &217$&7 6,7(6 21 &%3 3527(,1 ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ LQ

PAGE 4

087$7,21$/ $1$/<6,6 2) 7+( 17(50,186 2) &%3 ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ 6800$5< $1' 3(563(&7,9(6 /,67 2) 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ ,9

PAGE 5

/,67 2) 7$%/(6 2OLJRQXFOHRWLGHV XVHG IRU PXWDJHQHVLV RI &ES 'HVFULSWLRQ RI &ES PXWDQWV 5DWH PHDVXUHPHQWV IRU ZLOGW\SH DQG PXWDQW &ES 'LVVRFLDWLRQ FRQVWDQWV RI &ES PXWDQWV Y

PAGE 6

/,67 2) ),*85(6 3URSRVHG VHFRQGDU\ VWUXFWXUH RI \HDVW DSRF\WRFKURPH E LQWURQ 51$ 2SWLPL]DWLRQ RI 89GRVDJH IRU FURVVOLQNLQJ &KHPLFDO FOHDYDJH RI &ESLQWURQ 51$ FRPSOH[HV &RQILUPDWLRQ RI WKH FURVVOLQN VLWH LQ WKH 1WHUPLQXV RI &ES 6XPPDU\ RI 89FURVVOLQNLQJ UHVXOWV :HVWHUQ DQDO\VLV RI &ES PXWDQWV )XQFWLRQDO DQDO\VLV RI GHOHWLRQ DDODDf DQG WULSOH DURPDWLF PXWDQWV 3DUWLDO SURWHRO\WLF SURILOHV RI GHOHWLRQ DDODDf DQG WULSOH DURPDWLF PXWDQWV 7LPH FRXUVH RI VSOLFLQJ IRU ZLOGW\SH DQG PXWDQW &ES 6SOLFLQJ UDWHV RI ZLOGW\SH DQG PXWDQW &ES 'RXEOH ILOWHUELQGLQJ DVVD\ RI ZLOGW\SH DQG PXWDQW &ES 89FURVVOLQNLQJ RI ZLOGW\SH DQG PXWDQW &ES WR LQWURQ 51$ (IIHFW RI PXWDQW SURWHLQV RQ ZLOGW\SH &ESPHGLDWHG VSOLFLQJ (IIHFW RI LQFUHDVLQJ FRQFHQWUDWLRQV RI ZLOGW\SH &ES RQ SURWHLQ PHGLDWHG VSOLFLQJ (IIHFW RI W51$ DGGLWLRQ RQ ZLOGW\SH &ESPHGLDWHG VSOLFLQJ (IIHFW RI PXWDQW SURWHLQV RQ ZLOGW\SH &ESPHGLDWHG VSOLFLQJ DW ORZ WRWDO SURWHLQ WR 51$ UDWLRV YL

PAGE 7

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 51$3527(,1 ,17(5$&7,216 2) $ 0,72&+21'5,$/ *5283 ,,17521 ,1 6DFFKDURP\FHV FHUHYLVLDH %\ +\PDYDWKL 7LUXSDWL 'HFHPEHU &KDLUSHUVRQ $OIUHG 6 /HZLQ 0DMRU 'HSDUWPHQW 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ *URXS LQWURQV DQG DVVRFLDWHG SURWHLQV UHSUHVHQW VLPSOH EXW YDOXDEOH V\VWHPV IRU XQGHUVWDQGLQJ PRUH FRPSOH[ 513 V\VWHPV VXFK DV WKH VSOLFHRVRPHV RU ULERVRPHV ZKLFK HPSOR\ PXOWLSOH 51$SURWHLQ LQWHUDFWLRQV 7KH WHUPLQDO LQWURQ RI \HDVW F\WRFKURPH E SUHP51$ D JURXS LQWURQf UHTXLUHV WKH QXFOHDU SURWHLQ &ES IRU VSOLFLQJ LQ YLYR +RZHYHU LQ YLWUR WKLV LQWURQ FDQ EH PDGH WR HLWKHU VHOI VSOLFH RU XQGHUJR SURWHLQIDFLOLWDWHG VSOLFLQJ E\ DOWHULQJ WKH 0J FRQFHQWUDWLRQ 6LQFH FDWDO\VLV LV LQWULQVLF WR 51$ WKH SURWHLQ LV EHOLHYHG WR SURPRWH 51$ IROGLQJ DW VHFRQGDU\ DQG WHUWLDU\ VWUXFWXUH OHYHOV OHDGLQJ WR WKH IRUPDWLRQ RI D FDWDO\WLFDOO\ FRPSHWHQW LQWURQ 7KHUHIRUH WKLV WZRFRPSRQHQW V\VWHP SURYLGHV D PRGHO IRU XQGHUVWDQGLQJ WKH UROH RI SURWHLQV LQ SURPRWLQJ 51$ IROGLQJ 9OO

PAGE 8

7KH SUHVHQW VWXG\ ZDV DLPHG DW LGHQWLI\LQJ FULWLFDO 51$ ELQGLQJ VLWHV RQ &ES DQG JDLQLQJ LQVLJKWV LQWR &ESLQWURQ 51$ LQWHUDFWLRQV 3ODEHOHG LQWURQ 51$ ZDV 89FURVVOLQNHG WR &ES DQG WKH FURVVOLQN VLWHV LGHQWLILHG E\ FKHPLFDO FOHDYDJH DQG ODEHO WUDQVIHU 7KHVH H[SHULPHQWV GHPRQVWUDWHG WKDW WKH WHUPLQL RI &ES FRQWDLQ LPSRUWDQW 51$ ELQGLQJ VLWHV $ DPLQR DFLG UHJLRQ DDOf LQ WKH 1WHUPLQDO FRQWDFW VLWH ULFK LQ EDVLF DQG DURPDWLF UHVLGXHVf ZDV WDUJHWHG IRU PXWDJHQHVLV DQG PXWDQW SURWHLQV FKDUDFWHUL]HG IRU 51$ ELQGLQJ DQG VWLPXODWLRQ RI VSOLFLQJ 0XWDWLRQV LQ WKLV UHJLRQ UHVXOWHG LQ QR SDUWLDO DQG FRPSOHWH ORVV RI IXQFWLRQ GHPRQVWUDWLQJ WKH LPSRUWDQFH RI WKLV 1WHUPLQDO UHJLRQ IRU VWLPXODWLRQ RI 51$ VSOLFLQJ 7KHVH VWXGLHV DOVR OHG WR WKH ILQGLQJ WKDW &ES VWLPXODWHV VSOLFLQJ RQO\ LQ D QDUURZ UDQJH RI FRQFHQWUDWLRQV ZLWK KLJKHU FRQFHQWUDWLRQV EHLQJ LQKLELWRU\ $GGLWLRQ RI D QRQVSHFLILF FRPSHWLWRU W51$ DWWHQXDWHG WKLV LQKLELWLRQ GHPRQVWUDWLQJ WKH QRQVSHFLILF 51$ ELQGLQJ DELOLW\ RI &ES 7KH FXUUHQW VWXG\ KDV LGHQWLILHG DQ LPSRUWDQW 51$ ELQGLQJ UHJLRQ DDODDf LQ WKH 1WHUPLQXV RI &ES $ W\URVLQH DW SRVLWLRQ LV LQGLVSHQVDEOH ZKLOH WKUHH FKDUJHG UHVLGXHV DW SRVLWLRQV DQG DUH LPSRUWDQW IRU &ES IXQFWLRQ $Q RIIVKRRW RI WKH FXUUHQW VWXG\ LV WKH LGHQWLILFDWLRQ RI DQ 51$ FKDSHURQH IXQFWLRQ IRU &ES &ES DSSHDUV WR HQJDJH LQ ERWK QRQVSHFLILF DQG VSHFLILF LQWHUDFWLRQV ZLWK LQWURQ 51$ $W LQKLELWRU\ FRQFHQWUDWLRQV RI WKH SURWHLQ KRZHYHU QRQn VSHFLILF LQWHUDFWLRQV PD\ SUHGRPLQDWH DQG SUHFOXGH WKH IRUPDWLRQ RI VSHFLILF FRQWDFWV WKDW SURPRWH FDWDO\VLV 7KLV QHZO\ FKDUDFWHUL]HG FKDSHURQH IXQFWLRQ RI &ES PD\ EH LPSRUWDQW IRU SURPRWLQJ FRUUHFW LQWURQ 51$ IROGLQJ LQ YLYR YQL

PAGE 9

&+$37(5 ,1752'8&7,21 *HQHUDO ,QWURGXFWLRQ 5LER]\PHV RU FDWDO\WLF 51$ PROHFXOHV KDYH EHHQ VKRZQ WR FDWDO\]H UHDFWLRQV DW SKRVSKRUXV FHQWHUV ZLWK 51$ RU '1$ DV WKH VXEVWUDWH &HFK +HUVFKODJ DQG &HFK 5REHUWVRQ DQG -R\FH )RUVWHU DQG $OWPDQ f 7KHVH UHDFWLRQV LQFOXGH WUDQVHVWHULILFDWLRQ RU K\GURO\VLV RI SKRVSKDWH GLHVWHUV RU SKRVSKDWH PRQRHVWHUV )RU LQVWDQFH ULER]\PHV KDYH EHHQ VKRZQ WR FDWDO\]H WKH SRO\PHUL]DWLRQ RI 51$ PRQRPHU VWUDQGV %HHQ DQG &HFK f UHSOLFDWLRQ RI 51$ VWUDQGV *UHHQ DQG 6]RVWDN f DQG K\GURO\VLV DW LQWHUQDO SURFHVVLQJ VLWHV 'HFDWXU HW DO (LQYLN HW DO -DEUL HW DO f 51$ FDWDO\VWV FDQ DOVR DFW RQ VXEVWUDWHV RWKHU WKDQ QXFOHLF DFLGV ,Q YLWUR VHOHFWHG 51$ PROHFXOHV KDYH EHHQ VKRZQ WR LQWHUDFW ZLWK DPLQR DFLGV VXFK DV DUJLQLQH SKHQ\ODODQLQH WU\SWRSKDQ DQG YDOLQH 0DMHUIHOG DQG
PAGE 10

VXJJHVWLQJ WKDW WKH SURWRULERVRPH PLJKW EH UHODWHG WR JURXS LQWURQV
PAGE 11

SXURP\FLQ DQDORJ D KLJKDIILQLW\ OLJDQG RI ULERVRPDO SHSWLG\O WUDQVIHUDVHf LQ WKH DEVHQFH RI SURWHLQ :HOFK HW DO f 7RJHWKHU WKHVH UHVXOWV VWUHQJWKHQ WKH K\SRWKHVLV WKDW SHSWLG\O WUDQVIHU RULJLQDWHG LQ DQ 51$ ZRUOG 7KH FDWDO\WLF UROH RI 51$ LQ WUDQVODWLRQ RI P51$V DSSHDUV WR EH YHUVDWLOH $ ULER]\PH GHULYHG IURP WKH JURXS LQWURQ RI 7HWUDK\PHQD WKHUPRSKLOD ZDV VKRZQ WR FDWDO\]H WKH K\GURO\VLV RI DQ DPLQRDF\O HVWHU ERQG ZKLFK LQYROYHV D FDUERQ FHQWHUf VXJJHVWLQJ WKDW WKH ILUVW DPLQRDF\O W51$ V\QWKHWDVH FRXOG KDYH EHHQ DQ 51$ PROHFXOH 3LFFLULOOL HW DO f )XUWKHUPRUH DQ 51$ PROHFXOH LGHQWLILHG E\ LQ YLWUR VHOHFWLRQ KDV EHHQ VKRZQ WR UDSLGO\ DPLQRDF\ODWH LWV fff WHUPLQXV ZKHQ SURYLGHG ZLWK SKHQ\ODODQ\ODGHQRVLQH PRQRSKRVSKDWH ,OODQJDVHNDUH HW DO f 7KXV 51$ FDQ DFFHOHUDWH WKH VDPH DPLQRDF\O JURXS WUDQVIHU FDWDO\]HG E\ SURWHLQ DPLQRDF\OW51$ V\QWKHWDVHV 7KH RQJRLQJ GLVFRYHU\ RI WKH YHUVDWLOH SURSHUWLHV RI FDWDO\WLF 51$ KDV OHQW PRUH FUHGHQFH WR WKH WKHRULHV RI D SUHKLVWRULF f51$ ZRUOGf 7KLV SUHELRWLF ZRUOG PLJKW KDYH EHHQ SRSXODWHG E\ OLIH IRUPV WKDW VWRUHG JHQHWLF LQIRUPDWLRQ LQ 51$ DQG HPSOR\HG 51$ FDWDO\VWV SULRU WR WKH DGYHQW RI ULERVRPDO SURWHLQ V\QWKHVLV 9LVVHU %HQQHU HW DO f ,W KDV DOVR EHHQ SURSRVHG WKDW WKH IXQFWLRQV RI WKHVH DQFLHQW FDWDO\WLF 51$V PD\ KDYH EHHQ PRGXODWHG E\ ORZ PROHFXODU ZHLJKW HIIHFWRUV UHODWHG WR DQWLELRWLFV 'DYLHV 'DYLHV HW DO f $QWLELRWLFV KDYH EHHQ VKRZQ WR LQKLELW WUDQVODWLRQ E\ WKH SURNDU\RWLF ULERVRPH 0RD]HG DQG 1ROOHU 3RZHUV DQG 1ROOHU
PAGE 12

RU SURPRWH ROLJRPHUL]DWLRQ :DQN DQG 6FKURHGHU f RI JURXS LQWURQV DQG LQKLELW WKH VHOIFOHDYDJH UHDFWLRQ RI WKH KXPDQ KHSDWLWLV GHOWD YLUXV ULER]\PH 5RJHUV HW DO f 3DUDOOHOV EHWZHHQ WKH LQKLELWLRQ RI JURXS LQWURQ VSOLFLQJ DQG WKH SURWHFWLRQ RI EDFWHULDO U51$V E\ DQWLELRWLFV DOVR UDLVHV WKH SRVVLELOLW\ WKDW JURXS LQWURQ VSOLFLQJ DQG W51$ VHOHFWLRQ E\ ULERVRPHV LQYROYH VLPLODU 51$ VWUXFWXUDO PRWLIV *URXS ,QWURQV *URXS LQWURQV DUH DEXQGDQW LQ PLWRFKRQGULDO 51$ RI IXQJL DQG SODQWV 3DOPHU DQG /RJVGRQ f &RGLQJ UHJLRQV IRU JURXS LQWURQV DUH DOVR IRXQG LQ WKH QXFOHDU JHQRPHV RI RWKHU ORZHU HXNDU\RWHV U51$ JHQHV RI 7HWUDK\PHQDf FKORURSODVW '1$V EDFWHULRSKDJHV DQG LQ VHYHUDO W51$ JHQHV RI HXEDFWHULD &HFK 0LFKHO DQG :HVWKRI 3DOPHU DQG /RJVGRQ 5HLQKROG+XUHN DQG 6KXE f 6RPH RI WKHVH JURXS LQWURQV FDQ VHOIVSOLFH 7KH DELOLW\ WR VHOIn VSOLFH LV UHODWHG WR WKH KLJKO\ FRQVHUYHG VHFRQGDU\ DQG WHUWLDU\ VWUXFWXUHV RI WKHVH LQWURQV %XUNH &HFK 0LFKHO DQG :HVWKRI f $OWKRXJK JURXS LQWURQV KDYH UHODWLYHO\ OLWWOH VHTXHQFH VLPLODULW\ DOO VKDUH D VHULHV RI VKRUW FRQVHUYHG HOHPHQWV GHVLJQDWHG 3 4 5 DQG 6 7KH VHFRQGDU\ VWUXFWXUH FRPPRQ WR JURXS LQWURQV ZDV ILUVW SURSRVHG E\ 0LFKHO HW DO f DQG 'DYLHV HW DO f EDVHG RQ FRPSDUDWLYH VHTXHQFH DQDO\VLV 7KLV HYHQWXDOO\ OHG WR WKH GHYHORSPHQW RI D WKUHH GLPHQVLRQDO PRGHO RI WKH FDWDO\WLF FRUH E\ 0LFKHO DQG :HVWKRI f 7KH EDVLF IHDWXUHV RI WKLV PRGHO KDYH EHHQ FRQILUPHG E\ PXWDWLRQDO DQDO\VLV SKRWRFKHPLFDO FURVVOLQNLQJ DQG FKHPLFDO PRGLILFDWLRQ VWXGLHV HPSOR\LQJ VHYHUDO

PAGE 13

DIILQLW\ FOHDYDJH UHDJHQWV 3\OH HW DO :DQJ DQG &HFK f 2Q WKH EDVLV RI WKHVH VWXGLHV &HFK HW DO f SURSRVHG D UHYLVHG WZRGLPHQVLRQDO VHFRQGDU\ VWUXFWXUH IRU JURXS LQWURQV WKDW UHSUHVHQWV PRUH DFFXUDWHO\ WKH GRPDLQ RUJDQL]DWLRQ DQG RULHQWDWLRQ RI KHOLFHV ZLWKLQ WKH LQWURQ WKH FRD[LDO VWDFNLQJ RI FHUWDLQ KHOLFHV DQG WKH SUR[LPLW\ RI NH\ QXFOHRWLGHV LQ WKUHHGLPHQVLRQDO VSDFH %DVHG RQ WKHVH UHYLVLRQV WKH VHFRQGDU\ VWUXFWXUH RI WKH ILIWK LQWURQ RI WKH &2% JHQH RI 6DFFKDURP\FHV FHUHYLVLDH XVHG LQ WKH FXUUHQW VWXG\f LV VKRZQ LQ )LJXUH 7KH IROGHG VWUXFWXUH RI JURXS LQWURQV FRQVLVWV RI WZR FRD[LDOO\ VWDFNHG KHOLFHV 333 DQG 333 WKDW IRUP D FOHIW WR HQFORVH D WKLUG KHOLFDO GRPDLQ 33 ZKLFK FRQWDLQV WKH f VSOLFH VLWH 7KH f DQG f VSOLFH VLWHV DUH VWDELOL]HG E\ 3, DQG 3 LQWHUDFWLRQV UHVSHFWLYHO\ 3, LV IRUPHG E\ EDVH SDLULQJ EHWZHHQ WKH f H[RQ DQG WKH LQWHUQDO JXLGH VHTXHQFH ,*6f ZKHUHDV 3 LV IRUPHG E\ EDVH SDLULQJ EHWZHHQ WKH f H[RQ DQG WKH ,*6 QRW VKRZQ LQ )LJXUH f 3 D EDVH SDLU KHOL[ QHDU 3 DOVR FRQWULEXWHV WR WKH IRUPDWLRQ RI f VSOLFH VLWH 7KH U51$ LQWURQ RI 7HWUDK\PHQD WKHUPRSKLOD FRQVLGHUHG WR EH WKH SURWRW\SH JURXS LQWURQf KDV EHHQ GHPRQVWUDWHG WR XQGHUJR DXWRFDWDO\WLF VSOLFLQJ E\ D WZR VWHS WUDQVHVWHULILFDWLRQ PHFKDQLVP &HFK f 7KH VDPH PHFKDQLVP KDV EHHQ GRFXPHQWHG IRU D QXPEHU RI RWKHU JURXS LQWURQV *DUULJD DQG /DPERZLW] *DUULJD DQG /DPERZLW] f 7KH ILUVW VWHS FRPSULVHV D QXFOHRSKLOLF DWWDFN E\ JXDQRVLQH DW WKH f VSOLFH VLWH UHVXOWLQJ LQ D IUHH f 2+ JURXS RQ WKH XSVWUHDP H[RQ DQG JXDQRVLQH DGGLWLRQ WR WKH LQWURQ ,Q WKH VHFRQG VWHS WKH IUHH f 2+ JURXS RQ WKH H[RQ DWWDFNV WKH SKRVSKRGLHVWHU ERQG DW WKH f VSOLFH VLWH OHDGLQJ WR

PAGE 14

)LJXUH 3URSRVHG VHFRQGDU\ VWUXFWXUH RI \HDVW DSRF\WRFKURPH E QLWURQ 51$ 7KH FRD[LDOO\ VWDFNHG KHOLFHV 33 DQG 33 DORQJ ZLWK WKH MRLQLQJ UHJLRQV DQG FRQVWLWXWH WKH FDWDO\WLF FRUH ZKLOH 33 IRUPV WKH VXEVWUDWH GRPDLQ 7KH SHULSKHUDO HOHPHQW 33D LV D VLJQDWXUH HOHPHQW RI VXEJURXS ,$ LQWURQV /RZHU DQG XSSHU FDVH OHWWHUV UHSUHVHQW WKH H[RQV DQG WKH LQWURQ UHVSHFWLYHO\ 6KRUW KRUL]RQWDO DQG YHUWLFDO OLQHV UHSUHVHQW K\GURJHQ ERQGV 'RWWHG OLQHV UHSUHVHQW ORQJUDQJH LQWHUDFWLRQV 6HTXHQFHV IRU /, DQG / DUH QRW VKRZQ

PAGE 15

3 $8 $$ $ 8 DXDD $8 $8 8$ $8 &* $ &DDFADDD$ / D D X F F X X X D J X D D F D F F D X D F X X D X X J $ X $ D QW 8 D DDDX $ J X X $$ $ $ $ $8 $8 $ $ F 8$ 8$ $ $ F 3 &* 8$ $ D D 8$ $8 $ X 8$ 8$ $ 8 J $8 8$ 8 $ X 8$*$*& 3 X J F D 8 $ *& 8$ X* D8 3 X$ X F* 8$ 8$ 3 *& L 8 &* &$ $8 *8 fX 3 &* $$ 3 &* $ 8 $8 8$ 8$ $8 $8 8 $ 8 $8 $8 $ / 3D /D 3E 3F $r *X$r 8$ 8$ $8 8$ $8 8$ $&* & $ 8&8$ $8 8$ $8 8$ 8$ $8 8$ $8 $8fr 88$ $8 $8 8$ $8 $ 8$ D / 3D /D $8 8* $ M LW87$ LP7 &* 8$ 8$ $8 $8 *& 8$ 8$ 8* &* &* *8 &* 8 8 8 FF $XQn AXD 8 D $ 8 8 $ $ $ 8$$8D$8 8 $ *D 8$*$$$* $ & 8 $ , O L ,,, FFXXXFF DXJ DX$ $ $ 3 X 3D /D

PAGE 16

H[FLVLRQ RI WKH LQWURQ DQG OLJDWLRQ RI WKH H[RQV $Q H[RJHQRXV JXDQRVLQH QXFOHRWLGH LV XVHG DV WKH QXFOHRSKLOH LQ WKH ILUVW VWHS ZKLOH D XQLYHUVDOO\ FRQVHUYHG fWHUPLQDO JXDQRVLQH UHVLGXH RI WKH LQWURQ LV HPSOR\HG LQ WKH VHFRQG VWHS &HFK f 7KHVH VWHSV DUH FKHPLFDOO\ WKH UHYHUVH RI HDFK RWKHU ZLWK WKH ERXQG H[RJHQRXV JXDQRVLQH QXFOHRSKLOH LQ WKH ILUVW VWHS HTXLYDOHQW WR WKH fWHUPLQDO JXDQRVLQH OHDYLQJ JURXS LQ WKH VHFRQG VWHS 7KLV OHG WR WKH SURSRVDO WKDW D VLQJOH JXDQRVLQHELQGLQJ VLWH ZDV XVHG LQ ERWK VWHSV ,QRXH HW DO f 6XEVHTXHQW VWXGLHV LQGLFDWHG WKDW WKH UDWH FRQVWDQW RI WKH FKHPLFDO VWHS LV WKH VDPH ZLWK H[RJHQRXV JXDQRVLQH ERXQG WR /6FD, ULER]\PH D PRGHO V\VWHP IRU ILUVW VWHS RI VSOLFLQJf DQG ZLWK WKH LQWUDPROHFXODU JXDQRVLQH UHVLGXH RI WKH /* ULER]\PH D PRGHO V\VWHP IRU VHFRQG VWHS RI VSOLFLQJf 0HL DQG +HUVFKODJ f 7KHVH UHVXOWV VXSSRUW WKH SUHYLRXVO\ SURSRVHG VLQJOH JXDQRVLQHELQGLQJ VLWH PRGHO DQG IXUWKHU VXJJHVW WKDW WKH RULHQWDWLRQ RI WKH ERXQG JXDQRVLQH DQG WKH RYHUDOO DFWLYH VLWH VWUXFWXUH LV WKH VDPH LQ ERWK VWHSV RI WKH VSOLFLQJ UHDFWLRQ 2OLJRQXFOHRWLGH VXEVWUDWH ELQGLQJ WR WKH 7HWUDK\PHQD ULER]\PH ZDV IRXQG WR EH VWURQJHU WKDQ SUHGLFWHG IRU D VLPSOH GXSOH[ LQWHUDFWLRQ ZLWK WKH ,*6 VXJJHVWLQJ WKDW WHUWLDU\ LQWHUDFWLRQV LQ DGGLWLRQ WR EDVH SDLULQJ VWDELOL]HG WKH ERXQG VXEVWUDWH +HUVFKODJ DQG &HFK 3\OH HW DO f 7KHVH WHUWLDU\ LQWHUDFWLRQV ZHUH VKRZQ WR LQYROYH VSHFLILF f2+ JURXSV RQ WKH VXEVWUDWH DQG ,*6 DV ZHOO DV WKH *8 ZREEOH SDLU DW WKH f FOHDYDJH VLWH 3\OH DQG &HFK 3\OH HW DO 6WUREHO DQG &HFK 6WUREHO DQG &HFK f 7KHVH DQG RWKHU NLQHWLF VWXGLHV OHG WR D VWHS PRGHO IRU VXEVWUDWH ELQGLQJ ZKHUHLQ WKH VXEVWUDWH IRUPV D GXSOH[

PAGE 17

3,f ZLWK WKH ,*6 WR JLYH DQ fRSHQ FRPSOH[f IROORZHG E\ GRFNLQJ RI WKH 3, GXSOH[ LQWR WHUWLDU\ LQWHUDFWLRQV WR JLYH D FORVHG FRPSOH[ +HUVFKODJ f 7KXV 3, GRFNLQJ UHSUHVHQWV D WHUWLDU\IROGLQJ HYHQW LQ ZKLFK D VLQJOH GXSOH[ DGRSWV LWV WHUWLDU\ VWUXFWXUH LQ WKH FRQWH[W RI DQ RWKHUZLVH IXOO\ IROGHG ULER]\PH 3, GRFNLQJ ZDV FKDUDFWHUL]HG IXUWKHU E\ LVRODWLQJ WKH RSHQ FRPSOH[ DV D WKHUPRG\QDPLFDOO\ VWDEOH VSHFLHV XVLQJ D VLWHVSHFLILF PRGLILFDWLRQ DQG KLJK 1D LRQ FRQFHQWUDWLRQV 1DUOLNDU DQG +HUVFKODJ f 7KHVH DXWKRUV SURSRVHG WKDW 3, GRFNLQJ LV HQWURSLFDOO\ GULYHQ DQG LV SRVVLEO\ DFFRPSDQLHG E\ D UHOHDVH RI ERXQG ZDWHU PROHFXOHV ,W LV LQWHUHVWLQJ WR QRWH WKDW JURXS LQWURQV GR QRW FRQWDLQ VSHFLILF IXQFWLRQDO JURXSV WKDW DUH W\SLFDOO\ HPSOR\HG LQ WKH FDWDO\VLV RI SURWHLQHQ]\PHV ,QVWHDG WKH\ GHSHQG RQ GLYDOHQW FDWLRQV IRU FKHPLVWU\ DQG FHUWDLQ RWKHU IXQFWLRQV VXFK DV VWUXFWXUDO VWDELOL]DWLRQ RI IROGHG 51$ DQG VXEVWUDWH ELQGLQJ )RU LQVWDQFH WKH 7HWUDK\PHQD JURXS LQWURQ UHTXLUHV 0J RU 0Q LRQV IRU FDWDO\VLV *URVVKDQV DQG &HFK f ZKLOH FDWLRQV OLNH &D FDQ RQO\ SURPRWH 51$ IROGLQJ DQG VXEVWUDWH ELQGLQJ 3\OH HW DO f $ WZR PHWDOLRQ PHFKDQLVP KDV EHHQ SURSRVHG IRU JURXS LQWURQV DQG RWKHU FDWDO\WLF 51$V 6WHLW] DQG 6WHLW] f ,Q WKLV PHFKDQLVP RQH PHWDO LRQ DFWLYDWHV WKH f2+ RI WKH JXDQRVLQH IDFWRU ZKLFK LQLWLDWHV WKH ILUVW VWHS RI JURXS LQWURQ VSOLFLQJ 7KH VHFRQG RQH FRRUGLQDWHV DQG VWDELOL]HV WKH R[\DQLRQ OHDYLQJ JURXS WKDW LV WKH f2+ RI XULGLQH FUHDWHG DW WKH HQG RI f H[RQ ZKLFK LQLWLDWHV WKH VHFRQG VWHS RI JURXS LQWURQ VSOLFLQJ 7KHVH PHWDO LRQV DFW DV /HZLV DFLGV DQG VWDELOL]H WKH H[SHFWHG SHQWDFRYDOHQW WUDQVLWLRQ

PAGE 18

VWDWHV ,Q FDVH RI JURXS LQWURQV WKH PLUURU V\PPHWU\ RI WZR 0J LRQV LQ WKH FDWDO\WLF FHQWHU UHIOHFWV WKH LGHQWLFDO FKHPLVWU\ RI WKH WZR WUDQVHVWHULILFDWLRQ UHDFWLRQV WKDW HIIHFW VSOLFLQJ 7KH UROH RI 51$ LQ FDWDO\VLV LV WR SRVLWLRQ WKH WZR PHWDO LRQV DQG SURSHUO\ RULHQW WKH VXEVWUDWHV (YLGHQFH IRU WKH LQYROYHPHQW RI WZR 0J LRQV LQ WKH FKHPLFDO VWHS RI JURXS LQWURQ VSOLFLQJ ZDV SURYLGHG E\ 0F&RQQHOO HW DO f 7KH VWXG\ DOVR VKRZHG WKDW D VLQJOH 0J LRQ LQFUHDVHV WKH UDWH RI 51$ VXEVWUDWH ELQGLQJ ZKLOH RQH RU PRUH 0J LRQV UHGXFH WKH UDWH RI GLVVRFLDWLRQ RI VXEVWUDWH (YLGHQFH IRU VWDELOL]DWLRQ RI WKH OHDYLQJ JURXS E\ D VHFRQG 0J LRQ ZDV VXEVHTXHQWO\ SURYLGHG E\ :HLQVWHLQ HW DO f 6WXGLHV RQ WKH FU\VWDO VWUXFWXUH RI WKH 33 GRPDLQ RI 7HWUDK\PHQD GRFXPHQWHG WKH ILUVW GHWDLOHG YLHZ RI PHWDOELQGLQJ PRWLIV LQ D VWUXFWXUDOO\ FRPSOH[ 51$ &DWH HW DO f 7KUHH XQLTXH PHWDO ELQGLQJ VLWHV KDYH EHHQ IRXQG LQ WKH PDMRU JURRYH WZR RI ZKLFK DUH RFFXSLHG E\ IXOO\ K\GUDWHG PDJQHVLXP LRQV LQ WKH QDWLYH 51$ &DWH DQG 'RXGQD f ,W LV LQWHUHVWLQJ WR QRWH WKDW WKH WDQGHP *8 ZREEOH EDVH SDLUV ZKLFK FRPSULVH WZR RI WKHVH WKUHH PHWDO ELQGLQJ VLWHV DUH DOVR DEXQGDQW DQG FRQVHUYHG LQ WKH ULERVRPDO 51$V 7KHVH VLWHV XSRQ PHWDO ELQGLQJ PLJKW IDFLOLWDWH KLJKHU RUGHU IROGLQJ RI ULERVRPDO 51$V RU WKHLU DVVRFLDWLRQ ZLWK ULERVRPDO SURWHLQV *URXS LQWURQV KDYH EHHQ FODVVLILHG LQWR IRXU PDMRU VXEJURXSV ,$ WKURXJK ,' EDVHG RQ GLVWLQFWLYH VWUXFWXUDO DQG VHTXHQFH IHDWXUHV 0LFKHO DQG :HVWKRI f )RU H[DPSOH JURXS ,$ LQWURQV FRQWDLQ WZR H[WUD EDVH SDLULQJV 33D RU 33 EHWZHHQ 3 DQG 3 ZKLOH VHYHUDO RWKHU JURXS ,% DQG ,& LQWURQV

PAGE 19

LQFOXGLQJ WKH 7HWUDK\PHQD U51$ LQWURQ SRVVHVV DQ H[WHQGHG 51$ VWUXFWXUH 3DEF WKDW LV HVVHQWLDO IRU FDWDO\VLV -R\FH HW DO f 5HFHQW FU\VWDOORJUDSKLF VWXGLHV UHYHDOHG WKDW 3DEF VWDELOL]HV 33 WKH PDMRU GRPDLQ RI WKH FDWDO\WLF FRUH YLD WZR NH\ LQWHUDFWLRQV &DWH HW DO f 7KH ILUVW RQH LQFOXGHV DQ DGHQRVLQHULFK EXOJH ZKLFK GRFNV LQ WKH PLQRU JURRYH RI WKH 3 KHOL[ ZKLOH WKH VHFRQG LQWHUDFWLRQ WDNHV SODFH EHWZHHQ D *$$$ WHWUDORRS DQG WKH PLQRU JURRYH RI LWV FRQVHUYHG QXFOHRWLGH UHFHSWRU ,Q DGGLWLRQ WR EDVHVSHFLILF K\GURJHQ ERQGLQJ DQG EDVH VWDFNLQJ SDLUV RI LQWHUGLJLWDWHG ULERVHV ULERVH ]LSSHUVf IXUWKHU VWDELOL]H WKHVH ORQJUDQJH LQWHUDFWLRQV LQ WKH 33 GRPDLQ 2WKHU JURXS LQWURQV ODFNLQJ 3DEF SRVVHVV DGGLWLRQDO 51$ VWUXFWXUHV VXFK DV D ORQJ SHULSKHUDO H[WHQVLRQ RI WKH 3 VWHP GHQRWHG 3 :DOOZHEHU HW DO f RU SURWHLQ IDFWRUV 0RKU HW DO f WKDW ELQG DQG VWDELOL]H WKH LQWURQ DFWLYH VWUXFWXUH )RU H[DPSOH WKH PLWRFKRQGULDO ODUJH ULERVRPDO LQWURQ RI 1 FUDVVD WKDW ODFNV WKLV H[WHQGHG GRPDLQ DEVROXWHO\ UHTXLUHV D SURWHLQ IDFWRU &\W IRU LWV DFWLYLW\ ERWK LQ YLWUR DQG LQ YLYR 7KH SURWHLQ ELQGV DW WKH MXQFWLRQ RI 33 VWDFNHG KHOLFHV DQG IDFLOLWDWHV FRUUHFW JHRPHWU\ LQ WKLV UHJLRQ 6DOGDQKD HW DO f &\W FRXOG DOVR UHSODFH WKH 3DEF GRPDLQ RI 7HWUDK\PHQD 0RKU HW DO f 7KXV DQ 51$ELQGLQJ SURWHLQ FDQ SURYLGH VXEVWDQWLDO ELQGLQJ HQHUJ\ WR VWDELOL]H WKH FDWDO\WLF VWUXFWXUH RI WKH LQWURQ REYLDWLQJ WKH UHTXLUHPHQW IRU DQ DGGLWLRQDO EXW LPSRUWDQW 51$ HOHPHQW 3URWHLQ )DFLOLWDWHG 6SOLFLQJ 6HYHUDO PLWRFKRQGULDO WUDQVFULSWV LQ \HDVW HPSOR\ SURWHLQ IDFWRUV WR IDFLOLWDWH VSOLFLQJ RI JURXS DQG JURXS ,, LQWURQV DOWKRXJK VRPH RI WKHP FDQ VHOI VSOLFH LQ

PAGE 20

YLWUR 3URWHLQIDFLOLWDWHG VSOLFLQJ KDV DOVR EHHQ GRFXPHQWHG LQ RWKHU IXQJL VXFK DV 1HXURVSRUD $NLQV DQG /DPERZLW] 6DOGDQKD HW DO f DQG $VSHUJLOOXV +R HW DO f 6RPH RI WKHVH SURWHLQ IDFWRUV WHUPHG PDWXUDVHV DUH HQFRGHG ZLWKLQ WKH LQWHUYHQLQJ VHTXHQFHV &DULJQDQL HW DO /DPE HW DO /D]RZVND HW DO f 7KH UHDGLQJ IUDPHV HQFRGLQJ WKHVH PDWXUDVHV DUH LQ IUDPH ZLWK WKH XSVWUHDP H[RQV $ SURWHRO\WLF FOHDYDJH GRZQVWUHDP RI WKH f VSOLFH VLWH JHQHUDWHV WKH DFWLYH IRUP RI PDWXUDVH SUHVXPDEO\ HQDEOLQJ D IHHGEDFN PHFKDQLVP RI UHJXODWLRQ $OO \HDVW PDWXUDVHV HQFRGHG E\ JURXS LQWURQV VXFK DV FRE DQG DQG JURXS ,, LQWURQV OLNH FR[O,, DQG f SULPDULO\ IXQFWLRQ LQ VSOLFLQJ WKH LQWURQ WKDW HQFRGHV WKHP +RZHYHU WKH FRE? PDWXUDVH HQDEOHV VSOLFLQJ RI ERWK FRE DQG DQRWKHU FORVHO\ UHODWHG JURXS LQWURQ FR[O %XUNH /DPERZLW] DQG 3HUOPDQ f 7KH PDWXUDVHV HQFRGHG E\ JURXS LQWURQV DUH VWUXFWXUDOO\ UHODWHG WR VLWH VSHFLILF HQGRQXFOHDVHV WKDW FRQIHU PRELOLW\ %HOO3HGHUVHQ HW DO 3HUOPDQ DQG %XWRZ f ,W LV ZHOO HVWDEOLVKHG WKDW JURXS LQWURQV FDQ WUDQVSRVH VLWH VSHFLILFDOO\ WR LQWURQOHVV DOOHOHV RI WKH VDPH JHQH DIWHU FOHDYDJH RI WKH WDUJHW '1$ E\ DQ LQWURQHQFRGHG '1$ HQGRQXFOHDVH %HOIRUW DQG 3HUOPDQ %\UN DQG 0XHOOHU f 7KLV FRQVHUYDWLYH SURFHVV NQRZQ DV LQWURQ KRPLQJ 'XMRQ f LV KLJKO\ VSHFLILF EHFDXVH RI WKH ODUJH UHFRJQLWLRQ VLWHV ESf RI KRPLQJ HQGRQXFOHDVHV %\UN DQG 0XHOOHU f *URXS LQWURQV DUH WKRXJKW WR KDYH EHFRPH PRELOH IROORZLQJ WKH DFTXLVLWLRQ RI RSHQ UHDGLQJ IUDPHV 25)Vf WKDW HQFRGH VSHFLILF '1$ HQGRQXFOHDVHV 'XMRQ /DPERZLW] DQG %HOOIRUW

PAGE 21

f (YLGHQFH IRU WKLV FDPH IURP WKH GHPRQVWUDWLRQ RI DXWRQRPRXV PRELOLW\ RI DQ 25) LQGHSHQGHQW RI WKH HQWLUH LQWURQLF VHTXHQFH LQ WKH PLWRFKRQGULD RI 3RGRVSRUD DQVHULQD 6HOOHP DQG %HOFRXU f 7KH PLWRFKRQGULDO QDGOL LQWURQ RI 3RGRVSRUD FRQWDLQV RQH PRQRUILFf RU WZR ELRUILFf 25)V DFFRUGLQJ WR WKH RULJLQ RI WKH VWUDLQ &XPPLQJV HW DO 6HOOHP HW DO f 7KH QDGOL RUIO UHFHQWO\ DFTXLUHG E\ WKH 3RGRVSRUD QDGOL LQWURQ 6HOOHP HW DO f DSSHDUV WR UHPDLQ DV D PRELOH HQWLW\ DV LW FRXOG EH HIILFLHQWO\ WUDQVIHUUHG IURP D ELRUILF LQWURQ WR LWV PRQRRUILF FRXQWHUSDUW LQGHSHQGHQW RI WKH FRUH LQWURQ VHTXHQFH 6HOOHP DQG %HOFRXU f 5HYHUVH VSOLFLQJ FRXSOHG ZLWK UHYHUVH WUDQVFULSWLRQ DQG UHFRPELQDWLRQ PD\ VHUYH DV DQ DOWHUQDWLYH PHFKDQLVP IRU LQWURQ PRELOLW\ &HFK 6KDUS :RRGVRQ DQG &HFK f $ UHODWHG PHFKDQLVP KDV EHHQ GRFXPHQWHG LQ WKH KRPLQJ RI JURXS ,, LQWURQV RI \HDVW PLWRFKRQGULD HJ D, LQWURQ RI FR[Of =LPPHUO\ HW DO
PAGE 22

WUDQVSRVLWLRQ 5HYHUVH VSOLFLQJ LQWR 51$ KDV EHHQ GHPRQVWUDWHG LQ YLWUR IRU JURXS LQWURQV VXFK DV 7HWUDK\PHQD U51$ LQWURQ :RRGVRQ DQG &HFK f DQG WKH 6 U51$ LQWURQ IURP &KODP\GRPRQDV UHLQKDUGWLL FKORURSODVW 7KRPSVRQ DQG +HUULQ f 5HFHQWO\ 51$GHSHQGHQW LQWHJUDWLRQ RI WKH 7HWUDK\PHQD JURXS LQWURQ LQWR WKH 6 U51$ KDV EHHQ GHPRQVWUDWHG LQ ( FROL 5RPDQ DQG :RRGVRQ f 7KH SURFHVV RI UHYHUVH VSOLFLQJ LQWR 51$ XQOLNH KRPLQJ RI JURXS DQG JURXS ,, LQWURQV GRHV QRW UHTXLUH LQWURQHQFRGHG SURWHLQV +RZHYHU VWDEOH WUDQVSRVLWLRQ LQWR WKH JHQRPH ZRXOG SUHVXPDEO\ UHTXLUH UHYHUVH WUDQVFULSWDVH DFWLYLW\ LQ WKH KRVW %HOIRUW DQG 3HUOPDQ f 7KLV DFWLYLW\ FRXOG EH SURYLGHG E\ fLQGLJHQRXVf JURXS ,, LQWURQV .HQQHOO HW DO f RU UHWURHOHPHQWV SUHVHQW LQ PDQ\ FHOO W\SHV (LFNEXVK f ,PSRUWDQWO\ UHYHUVH VSOLFLQJ DSSHDUV WR EH VLJQLILFDQWO\ OHVV VHTXHQFHVSHFLILF WKDQ KRPLQJ HQGRQXFOHDVHV DQG FRXOG WKHUHIRUH H[SDQG WKH UHSHUWRLUH RI LQWURQFRQWDLQLQJ VLWHV &HFK 5RPDQ DQG :RRGVRQ f ,Q DGGLWLRQ WR PDWXUDVHV VHYHUDO QXFOHDUHQFRGHG SURWHLQV HVVHQWLDO IRU VSOLFLQJ RI PLWRFKRQGULDO LQWURQV KDYH EHHQ LGHQWLILHG LQ \HDVW DQG 1HXURVSRUD E\ VFUHHQLQJ F\WRFKURPHGHILFLHQW VWUDLQV DQG E\ LVRODWLQJ QXFOHDU VXSSUHVVRUV RI VSOLFLQJ PXWDQWV %XUNH /DPERZLW] DQG 3HUOPDQ f ,Q 1HXURVSRUD WKH SURGXFWV RI WKUHH QXFOHDU JHQHV F\W F\W DQG F\W KDYH EHHQ LPSOLFDWHG LQ VSOLFLQJ WKH PLWRFKRQGULDO ODUJH U51$ LQWURQ DQG VHYHUDO RWKHU PLWRFKRQGULDO JURXS LQWURQV ,Q FRQWUDVW PRVW RI WKH \HDVW SURWHLQV IDFLOLWDWH VSOLFLQJ RI D VLQJOH LQWURQ )RU LQVWDQFH WKH SURGXFW RI 056 LQ \HDVW DSSHDUV WR EH VSHFLILF WR WKH

PAGE 23

JURXS LQWURQ FREE
PAGE 24

7ZR&RPSRQHQW 6\VWHP RI &ES DQG ,QWURQ 51$ 7KH \HDVW F\WRFKURPH E JHQH FRQWDLQV ILYH LQWURQV RI ZKLFK WKH WHUPLQDO LQWURQ LV D JURXS ,$ LQWURQ E,f ,Q VRPH \HDVW VWUDLQV WKH JHQH KDV RQO\ WZR LQWURQV ZLWK WKH WHUPLQDO LQWURQ GHVLJQDWHG E, 7KH SURFHVVLQJ RI WKLV JURXS LQWURQ LQ YLYR ZDV GHPRQVWUDWHG WR EH GHSHQGHQW RQ D SURWHLQ IDFWRU GHVLJQDWHG &ES 0F*UDZ DQG 7]DJRORII f 7KH QXFOHDU JHQH HQFRGLQJ &ES ZDV LGHQWLILHG E\ FRPSOHPHQWDWLRQ RI F\WRFKURPH E PXWDQWV GHIHFWLYH LQ WKH H[FLVLRQ RI WKH WHUPLQDO LQWURQf ZLWK D \HDVW JHQRPLF OLEUDU\ 7KLV DQDO\VLV LGHQWLILHG DQ QXFOHRWLGHORQJ 25) HQFRGLQJ D EDVLF SURWHLQ RI N'D 'HOHWLRQ DQDO\VLV UHYHDOHG WKDW WKH HQWLUH 25) ZDV HVVHQWLDO IRU FRPSOHPHQWDWLRQ RI WKH FES PXWDQWV /DWHU D PLWRFKRQGULDO UHYHUWDQW ZDV VKRZQ WR FRQWDLQ D SUHFLVH GHOHWLRQ RI WKH WHUPLQDO LQWURQ RI F\WRFKURPH E JHQH GHPRQVWUDWLQJ WKDW QHLWKHU &ES QRU WKH LQWURQ LWVHOI LV UHTXLUHG IRU JURZWK RQ QRQIHUPHQWDEOH FDUERQ VRXUFHV +LOO HW DO f ,Q DGGLWLRQ WR WKHVH ILQGLQJV &ES KDV EHHQ VKRZQ WR EH LPSRUWDQW LQ WKH VSOLFLQJ RI WKH FR LQWURQ RI ODUJH ULERVRPDO 51$ 6KDZ DQG /HZLQ f 7KH WHUPLQDO LQWURQ LQWURQ f RI F\WRFKURPH E FDQ VHOIVSOLFH LQ YLWUR DW KLJK FRQFHQWUDWLRQV RI 0J *DPSHO DQG 7]DJRORII 3DUWRQR DQG /HZLQ f ZKHUHDV &ES LV HVVHQWLDO WR HQDEOH VSOLFLQJ DW SK\VLRORJLFDO FRQFHQWUDWLRQV RI 0J *DPSHO HW DO f $OWKRXJK WKLV JURXS ,$ LQWURQ SRVVHVVHV WKH FRQVHUYHG VHFRQGDU\ DQG WHUWLDU\ VWUXFWXUHV IRXQG LQ DOO JURXS LQWURQV LW YDULHV LQ LPSRUWDQW ZD\V IURP WKH SURWRW\SH WKH 7HWUDK\PHQD U51$ LQWURQ 7KH ILIWK LQWURQ RI F\WRFKURPH E LV DERXW QXFOHRWLGHV ORQJ PDNLQJ VWUXFWXUDO SURELQJ

PAGE 25

KDUGHU FRPSDUHG WR WKH U51$ LQWURQ RI 7HWUDK\PHQD QXFOHRWLGHV ORQJf 7KH LQWHUQDO JXLGH VHTXHQFH ,*6f WKDW HVWDEOLVKHV WKH VXEVWUDWH VSHFLILFLW\ VWDUWV QXFOHRWLGHV GRZQVWUHDP IURP WKH f VSOLFH MXQFWLRQ UDWKHU WKDQ WKH XVXDO QXFOHRWLGHV GHVFULEHG IRU RWKHU JURXS LQWURQV 7KH LQWURQ LV $8ULFK UHTXLULQJ KLJKHU OHYHOV RI 0J IRU VWDELOL]DWLRQ RI WKH DFWLYH VWUXFWXUH XQOLNH WKH *&QFK 7HWUDK\PHQD JURXS LQWURQ ,W DOVR SRVVHVVHV DGGLWLRQDO 51$ VWUXFWXUHV OLNH WKH 3 VWHP ORRS WKDW DUH QRW IRXQG LQ 7HWUDK\PHQD +HQFH LQWURQ 51$ ZLWK LWV VWUXFWXUDO GLIIHUHQFHV IURP WKH 7HWUDK\PHQD U51$ LQWURQ RIIHUV DQ RSSRUWXQLW\ WR JDLQ IXUWKHU LQVLJKWV LQWR WKH PHFKDQLVP RI VSOLFLQJ RI JURXS ,$ LQWURQV 7KH ILIWK LQWURQ RI &2% SUHP51$ LV DOVR GHYRLG RI WKH SHULSKHUDO 51$ HOHPHQW 3DEF WKDW LV LPSRUWDQW IRU WKH FDWDO\VLV RI 7HWUDK\PHQD U51$ LQWURQ ,W LV WKHUHIRUH FRQFHLYDEOH WKDW &ES FRPSHQVDWHV IRU WKLV 51$ VWUXFWXUH DQG VWDELOL]HV LWV 51$ SDUWQHU E\ FRQWULEXWLQJ VXEVWDQWLDO ELQGLQJ HQHUJ\ LQ D PDQQHU VLPLODU WR WKH &\W SURWHLQ RI 1HXURVSRUD 89FURVVOLQNLQJ FKHPLFDO DQG HQ]\PDWLF PRGLILFDWLRQ VWXGLHV LQGLFDWH WKDW &ES FRQWDFWV LQWURQ 51$ DW PXOWLSOH VLWHV LQ WKH FDWDO\WLF FRUH 3f DQG SHULSKHUDO 51$ HOHPHQWV VXFK DV H[RQ ,*6 / / DQG VWLPXODWHV WKH IRUPDWLRQ RI WKH FDWDO\WLFDOO\ DFWLYH VWUXFWXUH 6KDZ DQG /HZLQ :HHNV DQG &HFK f %DVHG RQ WKHVH DQG NLQHWLF VWXGLHV :HHNV DQG &HFK f SURSRVHG WKDW &ES VHUYHV DV D WHUWLDU\ VWUXFWXUH FDSWXUH SURWHLQ +RZHYHU &ES DOVR LQGXFHV WKH IRUPDWLRQ RI 51$ VHFRQGDU\ VWUXFWXUH LQ DGGLWLRQ WR WKH VWDELOL]DWLRQ RI WHUWLDU\ VWUXFWXUH 6KDZ DQG /HZLQ 6KDZ HW DO f ,Q DGGLWLRQ FKHPLFDO PRGLILFDWLRQ VWXGLHV 6KDZ DQG

PAGE 26

/HZLQ PDQXVFULSW LQ SUHSDUDWLRQf VKRZ WKDW &ES ELQGV WR LQWURQ 51$ HYHQ LQ WKH DEVHQFH RI 0J DQG QXFOHDWHV WKH IRUPDWLRQ RI WKH FDWDO\WLF FRUH E\ VWDELOL]LQJ WKH 33 GRPDLQ 7KXV &ES DSSHDUV WR EH LQYROYHG LQ D G\QDPLF SURFHVV RI VWDELOL]LQJ 51$ VWUXFWXUH ERWK DW WKH VHFRQGDU\ DQG WHUWLDU\ VWUXFWXUH OHYHOV VWLPXODWLQJ WKH IRUPDWLRQ RI WKH FDWDO\WLFDOO\ DFWLYH 51$ VWUXFWXUH :HHNV DQG &HFK D Ef SURYLGHG D NLQHWLF IUDPHZRUN IRU ERWK &ES PHGLDWHG DQG VHOIVSOLFLQJ UHDFWLRQV RI LQWURQ 51$ $W ORZ 0J OHYHOV P0f WKH VHOIVSOLFLQJ UHDFWLRQ LV HVWLPDWHG WR EH RUGHUV RI PDJQLWXGH VORZHU WKDQ WKH SURWHLQIDFLOLWDWHG UHDFWLRQ $W QHDU VDWXUDWLQJ FRQFHQWUDWLRQV RI 0J P0f WKH SURWHLQLQGHSHQGHQW UHDFWLRQ LV VWLOO IROG VORZHU LQGLFDWLQJ WKDW KLJK OHYHOV RI WKH FDWLRQ FDQQRW FRPSOHWHO\ FRPSHQVDWH IRU &ES IXQFWLRQ 7KH VHOIVSOLFLQJ UHDFWLRQ LV DOZD\V VORZHU WKDQ WKH SURWHLQIDFLOLWDWHG UHDFWLRQ VLQFH LW KDV WR SURFHHG WKURXJK WZR DGGLWLRQDO WUDQVLWLRQV FRPSDUHG WR WKH ODWWHU 7KH ILUVW VWHS LQYROYHV D WUDQVLWLRQ IURP VHFRQGDU\ VWUXFWXUH WR DQ LQWHUPHGLDWH VWDWH WKDW LV HIILFLHQWO\ SURPRWHG E\ 0J +RZHYHU VHOIVSOLFLQJ PXVW VWLOO RYHUFRPH D VHFRQG EDUULHU ZKLFK LV WKH WUDQVLWLRQ IURP WKH LQWHUPHGLDWH WR DQ DFWLYH HQ]\PH VWDWH WKDW ILQDOO\ JLYHV ULVH WR SURGXFWV 7KH NLQHWLFV RI &ESPHGLDWHG VSOLFLQJ RQ WKH RWKHU KDQG LQFOXGH WZR VLJQLILFDQW VWHSV QDPHO\ JXDQRVLQH ELQGLQJ WR WKH &ESDFWLYH LQWURQ 51$ FRPSOH[ IROORZHG E\ HIILFLHQW FRQYHUVLRQ RI WKLV WHUQDU\ FRPSOH[ WR SURGXFWV 6WXGLHV RQ SKRVSKRURWKLRDWH VXEVWLWXWLRQ DW WKH f VSOLFH VLWH DQG S+ SURILOHV LQGLFDWH WKDW DW SK\VLRORJLFDO S+ WKH VHOIVSOLFLQJ UHDFWLRQ LV OLPLWHG E\ FKHPLVWU\ ZKLOH WKH &ESIDFLOLWDWHG UHDFWLRQ LV OLPLWHG E\ D

PAGE 27

FRQIRUPDWLRQDO VWHS :HHNV DQG &HFK Df 7KHVH VWXGLHV LQGLFDWH WKDW &ES ELQGLQJ FRPSHQVDWHV IRU DW OHDVW WZR VWUXFWXUDO GHIHFWV ZKLOH LQFUHDVLQJ WKH UDWH RI FKHPLVWU\ 0DLQ 2EMHFWLYH RI 'LVVHUWDWLRQ 7KH DYDLODELOLW\ RI D WZRFRPSRQHQW LQ YLWUR V\VWHP WR VWXG\ DXWRFDWDO\WLF DQG SURWHLQIDFLOLWDWHG VSOLFLQJ RIIHUV WKH DGYDQWDJH RI VWXG\LQJ 51$ FDWDO\VLV LQ LVRODWLRQ RU LQ FRPELQDWLRQ ZLWK WKH 51$ELQGLQJ SURWHLQ VLPSO\ E\ YDU\LQJ WKH 0J FRQFHQWUDWLRQ ,QVLJKWV REWDLQHG IURP WKH DQDO\VHV RI WKLV RQH SURWHLQRQH 51$ V\VWHP ZLOO DLG LQ XQGHUVWDQGLQJ PRUH FRPSOH[ V\VWHPV OLNH WKH VSOLFHRVRPHV LQYROYHG LQ QXFOHDU SUHP51$ VSOLFLQJ RU ULERVRPHV LQYROYHG LQ SURWHLQ V\QWKHVLV DOO RI ZKLFK HPSOR\ PXOWLSOH SURWHLQ DQG 51$ FRPSRQHQWV 6WXGLHV VR IDU KDYH IRFXVHG RQ PDSSLQJ WKH &ES FRQWDFW VLWHV RQ LQWURQ 51$ DQG WKH NLQHWLFV RI VSOLFLQJ LQ WKH SUHVHQFH DQG DEVHQFH RI WKH SURWHLQ /LWWOH LV NQRZQ DERXW WKH VWUXFWXUH RI &ES SURWHLQ RU LWV LQWHUDFWLRQ ZLWK LQWURQ 51$ IURP WKH SURWHLQ SRLQW RI YLHZ ,Q RUGHU WR XQGHUVWDQG WKH UROH RI &ES LQ VWLPXODWLRQ RI VSOLFLQJ LW LV LPSRUWDQW WR GHWHUPLQH WKH IXQFWLRQDO JURXSV RQ WKH SURWHLQ WKDW LQWLPDWHO\ FRQWDFW 51$ DQG IDFLOLWDWH FDWDO\VLV 2QFH WKH FRQWDFW VLWHV DUH LGHQWLILHG WKH DFWXDO PHFKDQLVP RI LQWHUDFWLRQ EHWZHHQ &ES DQG LQWURQ 51$ FDQ EH LQYHVWLJDWHG IXUWKHU 7KHUHIRUH RQH RI WKH PDLQ DLPV RI WKH FXUUHQW SURMHFW ZDV WR LGHQWLI\ SRWHQWLDO LQWURQ 51$ ELQGLQJ UHJLRQV RI &ES XVLQJ WKH WHFKQLTXH RI 89FURVVOLQNLQJ DQG ODEHO WUDQVIHU )ROORZLQJ WKH LGHQWLILFDWLRQ RI PDMRU FRQWDFW VLWHV VLWHGLUHFWHG PXWDJHQHVLV ZDV HPSOR\HG WR FRQILUP WKH

PAGE 28

LPSRUWDQFH RI YDULRXV DPLQR DFLG UHVLGXHV LQ WKHVH VLWHV IRU LQWHUDFWLRQ ZLWK LQWURQ 51$ DQG HQDEOH IDFLOLWDWLRQ RI VSOLFLQJ 89FURVVOLQNLQJ LGHQWLILHG WZR PDMRU 51$ FRQWDFW VLWHV LQ WKH WHUPLQL RI &ES ZLWK WKH 1WHUPLQDO VLWH FRPSULVLQJ WKH ILUVW DPLQR DFLG UHVLGXHV 7KH GHOHWLRQ RI D SRWHQWLDO 51$ ELQGLQJ PRWLI DDO6665<5<.)10(DDf LQ WKH 1 WHUPLQDO FRQWDFW VLWH DEROLVKHG VSOLFLQJ DFWLYLW\ VKRZLQJ WKDW WKLV UHJLRQ ZDV OLNHO\ WR EH FULWLFDO IRU &ES IXQFWLRQ 6LQJOH DQG FOXVWHU PXWDJHQHVLV RI YDULRXV UHVLGXHV LQ WKLV UHJLRQ \LHOGHG D YDULHW\ RI PXWDQWV ZLWK QR SDUWLDO RU FRPSOHWH ORVV RI &ES IXQFWLRQ 7KH FKDUDFWHUL]DWLRQ RI WKHVH PXWDQWV DQG WKH VLJQLILFDQFH RI YDULRXV DPLQR DFLG UHVLGXHV LQ TXHVWLRQ DUH GLVFXVVHG LQ &KDSWHU $Q RIIVKRRW RI WKH FXUUHQW VWXG\ ZDV WKH LGHQWLILFDWLRQ RI DQ 51$ FKDSHURQH IXQFWLRQ IRU &ES 7KH VWXGLHV UHSRUWHG LQ &KDSWHU VKRZ WKDW &ES KDV D QRQn VSHFLILF RU JHQHUDOL]HG 51$ ELQGLQJ FDSDELOLW\ EHVLGHV LWV VSHFLILF 51$ ELQGLQJ FRPSRQHQW 'UDZLQJ SDUDOOHOV ZLWK VWXGLHV RQ RWKHU 51$ FKDSHURQHV &KDSWHU f WKLV VWXG\ DGGV D QHZ SHUVSHFWLYH RQ KRZ WKH QRQVSHFLILF 51$ ELQGLQJ DFWLYLW\ RI &ES PLJKW SOD\ D FULWLFDO UROH LQ WKH IDFLOLWDWLRQ RI LQWURQ 51$ VSOLFLQJ LQ YLYR

PAGE 29

&+$37(5 0$7(5,$/6 $1' 0(7+2'6 2YHU([SUHVVLRQ DQG 3XULILFDWLRQ RI &%3 ,Q YLWUR VWXGLHV RI &%3E, 51$ LQWHUDFWLRQV ZHUH GRQH ZLWK &%3 SURWHLQ SXULILHG WR QHDU KRPRJHQHLW\ DIWHU RYHUH[SUHVVLRQ LQ ( FROL 7ZR YHUVLRQV RI WKH SURWHLQ [ KLVWLGLQHWDJJHG DQG QDWLYH ZHUH HPSOR\HG IRU GLIIHUHQW VWXGLHV ([SUHVVLRQ &ORQHV +LVWDJJHG &ES 3ODVPLG S(7E&%3 ZDV FRQVWUXFWHG E\ FORQLQJ WKH 1GHO&ODO IUDJPHQW FDUU\LQJ WKH &%3 F'1$ IURP S(7D&%3 GRZQVWUHDP RI WKH [ KLVWLGLQH WDJ LQ WKH 7 H[SUHVVLRQ YHFWRU S(7E 1RYDJHQf 7KH KLVWLGLQH WDJ DGGV DQ DGGLWLRQDO DPLQR DFLG UHVLGXHV DW WKH 1WHUPLQXV RI &ES SURWHLQ 7KH SODVPLG ZDV WUDQVIRUPHG LQWR -0'(f VWUDLQ RI ( FROL IRU RYHUn H[SUHVVLRQ 7KLV VWUDLQ FDUULHV WKH 7 51$ SRO\PHUDVH JHQH GULYHQ E\ ODFXY SURPRWHU RQ D ODPEGD O\VRJHQ DQG HQDEOHV WKH LQGXFWLRQ RI &ES LQ WKH SUHVHQFH RI,37* 1DWLYH &ES 7KLV IRUP RI &ES SURWHLQ ZDV RYHUH[SUHVVHG IURP S(7D &%3 SODVPLG LQ %/'(f DQRWKHU (FROL VWUDLQ FDUU\LQJ WKH 7 51$ SRO\PHUDVH JHQH 7KLV SODVPLG ZDV FRQVWUXFWHG E\ LQWURGXFLQJ DQ 1GHO VLWH DW WKH VWDUW FRGRQ RI &%3 JHQH E\ 3&5PXWDJHQHVLV DQG FORQLQJ WKH 1GHO6QD%,

PAGE 30

IUDJPHQW EHWZHHQ WKH 1GHO%DP+, VLWHV RI S(7D H[SUHVVLRQ YHFWRU 6WXGLHU HW DO f 7KH &ES SURWHLQ H[SUHVVHG IURP WKLV FRQVWUXFW LV DPLQR DFLG UHVLGXHV VKRUWHU WKDQ WKH KLVWDJJHG YHUVLRQ ,QGXFWLRQ RI &ES $Q RYHUQLJKW FXOWXUH RI EDFWHULD FDUU\LQJ WKH &ES H[SUHVVLRQ SODVPLG ZDV XVHG WR LQRFXODWH D ODUJH YROXPH RI /%DPSLFLOOLQ PHGLXP DW GLOXWLRQ 7KH FXOWXUHV ZHUH JURZQ DW r & XQWLO WKH\ UHDFKHG DQ $ RI DQG WKH H[SUHVVLRQ RI &ES ZDV LQGXFHG ZLWK P0 ,37* IRU KRXUV &HOOV ZHUH SHOOHWHG DIWHU DGGLWLRQ RI SJPO 306) ZDVKHG ZLWK P0 7ULV S+ P0 1D&O VQDS IUR]HQ LQ D GU\ LFHHWKDQRO EDWK DQG VWRUHG DW r & XQWLO SXULILFDWLRQ 3XULILFDWLRQ RI &ES +LVWDJJHG &ES 7KH SURWHLQ ZDV SXULILHG RQ 1L17$ 6XSHUIORZ 4LDJHQf FROXPQ DGDSWLQJ WKH SURWRFRO RI :HHNV DQG &HFK f 7KLV SXULILFDWLRQ V\VWHP LV EDVHG RQ WKH KLJK DIILQLW\ RI KLVWLGLQH UHVLGXHV IRU QLFNHO LRQV LPPRELOL]HG RQ QLWULORWULDFHWDWH UHVLQ 7KH FRQWDPLQDQW SURWHLQV FDQ EH HIILFLHQWO\ UHPRYHG DW ORZ OHYHOV RI LPLGD]ROH D FRPSHWLWRUf ZKLOH WKH KLVWDJJHG SURWHLQ FDQ EH VSHFLILFDOO\ HOXWHG DW VOLJKWO\ KLJKHU FRQFHQWUDWLRQV RI LPLGD]ROH 7KH EDFWHULDO SHOOHW ZDV UHVXVSHQGHG LQ PO RI FROXPQ EXIIHU P0 +(3(6 S+ P0 1D&O ,P0 LPLGD]ROH XJPO 306)f DQG O\VHG E\ WZR SDVVDJHV WKURXJK D )UHQFK SUHVVXUH FHOO DW SVL 7KH O\VDWH ZDV FOHDUHG E\ FHQWULIXJDWLRQ DW USP IRU PLQXWHV LQ D %HFNPDQ 7L URWRU 7KH

PAGE 31

VXSHUQDWDQW ZDV ORDGHG RQ D PO 1L17$ 6XSHUIORZ FROXPQ SUHHTXLOLEUDWHG ZLWK YROXPHV RI FROXPQ EXIIHU 7KH FROXPQ ZDV ZDVKHG ZLWK YROXPHV RI FROXPQ EXIIHU ,P0 LPLGD]ROHf IROORZHG E\ YROXPHV RI ZDVK EXIIHU P0 LPLGD]ROHf &ES SURWHLQ ZDV WKHQ HOXWHG ZLWK YROXPHV HDFK RI FROXPQ EXIIHUV FRQWDLQLQJ P0 DQG P0 LPLGD]ROH 7KH IUDFWLRQV FRQWDLQLQJ &ES GHWHFWHG E\ 6'6SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLVf ZHUH SRROHG DQG GLDO\]HG WZLFH DJDLQVW OLWHU HDFK RI P0 7ULV S+ ,P0 ('7$ b JO\FHURO DQG RQFH ZLWK D OLWHU RI P0 7ULV S+ ,P0 ('7$ b JO\FHURO DQG VWRUHG DW r & DIWHU UDSLG IUHH]LQJ LQ D GU\ LFHHWKDQRO EDWK 1DWLYH &ES 7KLV YHUVLRQ RI &ES SURWHLQ ZDV LVRODWHG DFFRUGLQJ WR WKH VWHS SXULILFDWLRQ SURWRFRO GHVFULEHG E\ 6KDZ DQG /HZLQ f ,Q 9LWUR 7UDQVFULSWLRQ S63, SODVPLG '1$ SXULILHG E\ &V&O JUDGLHQWV 0DQLDWLV HW DL f ZDV OLQHDUL]HG ZLWK 6PDO DQG XVHG IRU LQ YLWUR WUDQVFULSWLRQ ZLWK 7 51$ SRO\PHUDVH 3DUWRQR DQG /HZLQ f 7KH WUDQVFULSWV FRQWDLQ WKH HQWLUH LQWURQ 51$ VHTXHQFH DQG WKH IODQNLQJ H[RQ VHTXHQFHV 7KH WUDQVFULSWV ZHUH LQWHUQDOO\ ODEHOHG XVLQJ D3 873 DQGRU D3 $73 ,&1f 89&URVVOLQNLQJ DQG *HQHUDWLRQ RI 3HSWLGHV 89&URVVOLQNLQJ &ES51$ FRPSOH[HV ZHUH JHQHUDWHG DFFRUGLQJ WR WKH 89FURVVOLQNLQJ WHFKQLTXH RI=DPRUH DQG *UHHQ f 3ODEHOHG LQWURQ 51$ WUDQVFULSWV ZHUH

PAGE 32

LQFXEDWHG DW URRP WHPSHUDWXUH RU r & IRU PLQXWHV ZLWK D PRODU H[FHVV RI KLV WDJJHG &ES IROG RYHU 51$f RU QDWLYH &ES IROGf LQ D ORZ VDOW EXIIHU P0 7ULV S+ P0 0J&K P0 1+&,f FRQWDLQLQJ H[FHVV W51$ QRQn VSHFLILF FRPSHWLWRUf (DFK VDPSOH ZDV VSOLW LQWR VHYHUDO DOLTXRWV S HDFK LQ D ZHOO PLFURWLWHU SODWH )DOFRQf SODFHG RQ LFH LQ D SHWULGLVKf DQG H[SRVHG WR PRI 89 UDGLDWLRQ LQ D 896WUDWDOLQNHU 6WUDWDJHQHf 7KH DOLTXRWV RI HDFK VDPSOH ZHUH SRROHG LQWR D PO (SSHQGRUI WXEH DQG WUHDWHG ZLWK XJPO RI 51$VH $ DQG XQLWV RI 51$VH 7 %RHKULQJHU 0DQQKHLPf DW r & IRU KRXUV WR UHPRYH XQFURVVOLQNHG 51$ 7KH VDPSOHV ZHUH UHVROYHG E\ HOHFWURSKRUHVLV RQ D b 6'6SRO\DFU\ODPLGH JHO /DHPPOL f DQG WKH EDQG FRUUHVSRQGLQJ WR &ES H[FLVHG DIWHU &RRPPDVVLH EOXH VWDLQLQJ 7KH &ES WKXV SXULILHG LQFOXGHV ERWK WKH FURVVOLQNHG DQG XQFURVVOLQNHG IRUPV RI WKH SURWHLQ *HQHUDWLRQ RI 3HSWLGHV 7KH SXULILHG JHO IUDJPHQWV ZHUH LQFXEDWHG ZLWK FKHPLFDO FOHDYDJH UHDJHQWV VXFK DV K\GUR[\ODPLQH 1+2+f DQG QLWURWKLRF\DQREHQ]RDWH 17&%f DQG WKH UHVXOWLQJ SHSWLGHV ZHUH UHVROYHG RQ KLJK SHUFHQWDJH WULVWULFLQH JHOV &OHDYDJH 7KH JHO SLHFHV ZHUH ZDVKHG IRXU WLPHV ZLWK GLVWLOOHG ZDWHU RYHU D SHULRG RI PLQXWHV SODFHG LQWR DSSURSULDWH FOHDYDJH EXIIHU DQG WKRURXJKO\ PDFHUDWHG ZLWK D .RQWHV (SSHQGRUI SHVWOH 7KH VOXUU\ VR REWDLQHG ZDV FRPSOHWHO\ FRYHUHG ZLWK WKH FOHDYDJH EXIIHU DQG LQFXEDWHG RYHUQLJKW DW DSSURSULDWH WHPSHUDWXUH

PAGE 33

&KHPLFDO FOHDYDJH RI SURWHLQV ZLWK K\GUR[\ODPLQH JHQHUDWHV UHODWLYHO\ ODUJH SHSWLGHV GXH WR WKH LQIUHTXHQF\ RI $VQ*O\ ERQGV 7KH DVSDUDJLQ\O VLGH FKDLQ KDV D WHQGHQF\ WR IRUP D F\FOLF LPLGH WKDW LV VXVFHSWLEOH WR QXFOHRSKLOLF DWWDFN E\ K\GUR[\ODPLQH %RPVWHLQ f 7KH F\FOL]DWLRQ LV PRUH IDYRUHG LQ WKH FRQWH[W RI D VPDOOHU DPLQR DFLG OLNH JO\FLQH UHVXOWLQJ LQ LQFUHDVHG VXVFHSWLELOLW\ RI $VQ *O\ ERQGV +\GUR[\ODPLQH 1+2+f FOHDYDJH RI &ES ZDV SHUIRUPHG E\ RYHUQLJKW LQFXEDWLRQ RI &ES FRQWDLQLQJ JHO SLHFHV LQ 0 JXDQLGLQH+&O 0 K\GUR[\ODPLQH EXIIHU S+ DW URRP WHPSHUDWXUH DV GHVFULEHG DERYH /L2+ ZDV XVHG WR QHXWUDOL]H WKH JXDQLGLQH+&O DQG K\GUR[\ODPLQH+&O GXH WR LQFUHDVHG VROXELOLW\ RI /L&O FRPSDUHG WR 1D&O 7KH SURFHVV RI JHO SXULILFDWLRQ FRQWULEXWHV WR SDUWLDO GHQDWXUDWLRQ RI WKH SURWHLQ ZKLOH WKH SUHVHQFH RI JXDQLGLQH+&O D VWURQJ VROYHQW HQKDQFHV WKH H[SRVXUH RI WKH $VQ*O\ ERQGV WR WKH QXFOHRSKLOH &KDLQ FOHDYDJH RFFXUV LQ WKH SUHVHQFH RI DONDOLQH K\GUR[\ODPLQH OLEHUDWLQJ D QHZ DPLQR WHUPLQDO DPLQR DFLG &OHDYDJH ZLWK QLWURWKLRF\DQREHQ]RDWH 17&%f LV D WZRVWHS SURFHVV )LUVW WKH WKLRO JURXSV RQ F\VWHLQH UHVLGXHV RI GHQDWXUHG SURWHLQV DUH PRGLILHG WR 6&1 JURXSV E\ 17&% -DFREVRQ HW DO 'HJDQL DQG 3DWFKRPLN f IROORZHG E\ FOHDYDJH DW WKH DPLQR JURXS RI WKH PRGLILHG F\VWHLQH E\ H[SRVXUH WR DONDOLQH S+ FRQGLWLRQV *HO SXULILHG &ES SURWHLQ ZDV LQFXEDWHG LQ 0 JXDQLGLQH+&O P0 '77 P0 ('7$ 0 WULV DFHWDWH S+ EXIIHU DW r & IRU KRXUV LQ RUGHU WR GHQDWXUH WKH SURWHLQ DQG UHGXFH WKH GLVXOILGH ERQGV WR 6+ JURXSV $ IROG H[FHVV RI 17&% P0f RYHU WKH WRWDO WKLRO ZDV DGGHG WR WKH

PAGE 34

JHO VOXUU\ DQG WKH LQFXEDWLRQ ZDV FRQWLQXHG IRU KDOI KRXU DW WKH VDPH WHPSHUDWXUH WR HIIHFW PRGLILFDWLRQ RI WKH 6+ JURXSV WR 6&1 JURXSV 7KH VOXUU\ ZDV ILOWHUHG WKURXJK D S0 ORZ SURWHLQELQGLQJ FHOOXORVH DFHWDWH VSLQ FROXPQ &RPLQJ &RVWDUf DQG ZDVKHG RQFH ZLWK GLVWLOOHG ZDWHU 7KH VOXUU\ ZDV ODWHU WUDQVIHUUHG WR D PO (SSHQGRUI WXEH DQG LQFXEDWHG RYHUQLJKW LQ 0 JXDQLGLQH+&O S+ FOHDYDJH EXIIHU DW r & ([WUDFWLRQ RI SHSWLGHV $IWHU FOHDYDJH WKH VOXUU\ ZDV ILOWHUHG WKURXJK D &RVWDU FROXPQ ZDVKHG RQFH ZLWK GLVWLOOHG ZDWHU DQG LQFXEDWHG RYHUQLJKW DW r & LQ WKH H[WUDFWLRQ EXIIHU b 6'6 P0 7ULV S+ P0 ('7$ DQG 0 DPPRQLXP ELFDUERQDWHf 2Q WKH WKLUG GD\ WKH JHO VOXUU\ ZDV KHDWHG DW r & IRU PLQXWHV DQG UDSLGO\ ILOWHUHG WKURXJK D &RVWDU FROXPQ WR UHFRYHU VROXEOH SHSWLGHV 7KH VOXUU\ ZDV IXUWKHU LQFXEDWHG ZLWK b 6'6 P0 7ULV S+ IRU PLQXWHV DW URRP WHPSHUDWXUH DQG ILOWHUHG WR H[WUDFW WKH UHVLGXDO SHSWLGHV LQ WKH JHO $FHWRQH SUHFLSLWDWLRQ DQG HOHFWURSKRUHVLV 7KH ILOWUDWHV FRQWDLQLQJ WKH SHSWLGHV ZHUH SRROHG GULHG LQ D 6SHHG9DF 6DYDQWf UHVXVSHQGHG LQ ZDWHU DQG SUHFLSLWDWHG RYHUQLJKW DW r & ZLWK YROXPHV RI DFLGLILHG DFHWRQH 3HSWLGHV ZHUH SHOOHWHG DW USP LQ D PLFURFHQWULIXJH (SSHQGRUIf IRU PLQ DQG UHVXVSHQGHG LQ SL RI 6'6 JHOORDGLQJ EXIIHU 7KH VDPSOHV ZHUH GULHG LQ D 6SHHG9DF WR UHPRYH WKH UHVLGXDO DFHWRQH EURXJKW WR D ILQDO YROXPH RI SL ZLWK ZDWHU UHVROYHG RQ b IRU K\GUR[\ODPLQH f RU b IRU 17&%f WULVWULFLQH JHOV 6FKDJJHU DQG YRQ -DJRZ f DORQJ ZLWK &ODEHOHG ORZ PROHFXODU ZHLJKW SHSWLGH PDUNHUV $PHUVKDP &RUSRUDWLRQf DQG DXWRUDGLRJUDSKHG

PAGE 35

6LWH'LUHFWHG 0XWDJHQHVLV 7KH 1WHUPLQDO 51$ FRQWDFW VLWH RQ &ES LGHQWLILHG E\ WKH 89FURVVOLQNLQJ VWUDWHJ\f ZDV VXEMHFWHG WR VLWHGLUHFWHG PXWDJHQHVLV WR LGHQWLI\ NH\ UHVLGXHV IRU &ES IXQFWLRQ 0XWDWLRQV ZHUH GHVLJQHG WR HLWKHU GHOHWH WKH UHJLRQ RI LQWHUHVW DDO 6665<5<.) DDf RU PDNH SRLQW PXWDWLRQV WKDW GR QRW VHYHUHO\ SHUWXUE WKH FRQIRUPDWLRQ RI WKH SURWHLQ 7KH ;EDO%DP+O IUDJPHQW HQFRGLQJ WKH ILUVW FRGRQV RI &%3 IURP S(7E&%3 ZDV VXEFORQHG LQWR WKH 0PSO YHFWRU DQG XVHG DV WKH WHPSODWH IRU ROLJRQXFOHRWLGHGLUHFWHG PXWDJHQHVLV 0XWDJHQHVLV 6FKHPH 6LQJOH VWUDQGHG '1$ LVRODWHG IURP WKH SKDJH FORQH PHQWLRQHG DERYH ZDV XVHG DV D WHPSODWH IRU PXWDJHQHVLV 7KH ROLJRQXFOHRWLGHV XVHG IRU PXWDJHQHVLV DUH VKRZQ LQ 7DEOH 7KH GRXEOH SULPHU PHWKRG RI =ROOHU DQG 6PLWK f ZDV HPSOR\HG WR LQWURGXFH PXWDWLRQV LQWR WKH &%3 VHJPHQW FORQHG LQWR 0PSO YHFWRU %ULHIO\ SPROHV HDFK RI WKH NLQDVHG PXWDJHQLF ROLJRQXFOHRWLGH DQG WKH XQLYHUVDO 0O SULPHU ZHUH DQQHDOHG WR SPROHV RI VLQJOHVWUDQGHG '1$ WHPSODWH E\ LQFXEDWLRQ DW r & IRU PLQXWHV r & IRU PLQXWHV DQG URRP WHPSHUDWXUH IRU PLQXWHV 7KH DQQHDOHG FRPSOH[HV ZHUH H[WHQGHG DQG OLJDWHG RYHUQLJKW DW r & XVLQJ XQLWV RI .OHQRZ '1$ SRO\PHUDVH 3URPHJDf DQG XQLWV RI 7 '1$ OLJDVH %5/f WR IRUP D JDSSHG KHWHURGXSOH[ 7KH UHDFWLRQ ZDV GLOXWHG IROG WUDQVIRUPHG LQWR FRPSHWHQW 7*, FHOOV $PHUVKDPf DQG RYHUODLG

PAGE 36

7DEOH 2OLJRQXFOHRWLGHV XVHG IRU PXWDJHQHVLV RI &%3 1DPH /HQJWK EDVHVf 6HTXHQFH f WR ff 'HVFULSWLRQ $/ 7$*&$$*&&&$$7$**$$& 8QLYHUVDO SULPHU SRVLWLRQ LQ DQWLVHQVH VWUDQG RI 0 PS f $/ 7$$$&*&77*&77$&$* 6HTXHQFLQJ SULPHU WR YHULI\ PXWDWLRQV SRVLWLRQ LQ DQWLVHQVH VWUDQG RI &%3f $/ 7&7&&$7*77*$$&$$$7$&$ $*7$$$*$*$**$$&7*&& &KDQJHV 5<5<.) WR /
PAGE 37

ZLWK PROWHQ DJDU WR DOORZ IRUPDWLRQ RI SODTXHV 0XWDQWV ZHUH LGHQWLILHG E\ SODTXH OLIW K\EULGL]DWLRQ ZLWK \ 3ODEHOHG PXWDJHQLF ROLJRQXFOHRWLGH DV WKH SUREH 7KH UHVXOWLQJ PXWDQWV ZHUH SODTXH SXULILHG RQFH DQG WKH VLQJOHVWUDQGHG '1$ VHTXHQFHG 'RXEOHVWUDQGHG '1$ ZDV SUHSDUHG E\ PLQLSUHS SURWRFROV 0DQLDWLV H DL f IURP WKH PXWDQW 7*, FORQHV 7KH &%3 VHJPHQW FDUU\LQJ WKH PXWDWLRQ RI LQWHUHVW ZDV WKHQ UHFORQHG LQWR S(7E&%3 H[SUHVVLRQ YHFWRU DQG VHTXHQFHG XVLQJ 6HTXHQDVH NLWV $PHUVKDPf ,Q 9LWUR 6SOLFLQJ $VVD\ ,KH DFWLYLW\ RI YDULRXV PXWDQW &ES SURWHLQV ZDV GHWHUPLQHG E\ DQ LQ YLWUR VSOLFLQJ DVVD\ 3DUWRQR DQG /HZLQ f 3ODEHOHG LQWURQ 51$ WUDQVFULSWV ZHUH LQFXEDWHG ZLWK ZLOGW\SH RU PXWDQW &ES SURWHLQV LQ P0 0J&K P0 17/&7 P0 WULV+&O S+ EXIIHU LQ WKH SUHVHQFH RI P0 '77 DQG XQLWV RI 51$VLQ 51DVH LQKLELWRU 3URPHJDf DW r & IRU PLQXWHV 6SOLFLQJ ZDV LQLWLDWHG ZLWK P0 *73 3KDUPDFLDf DQG WKH UHDFWLRQV DOORZHG WR FRQWLQXH IRU YDU\LQJ OHQJWKV RI WLPH 5HDFWLRQV ZHUH WHUPLQDWHG E\ WKH DGGLWLRQ RI HTXDO YROXPHV RI b IRUPDPLGH P0 ('7$ RU HWKDQRO SUHFLSLWDWHG DQG UHVXVSHQGHG LQ WKH IRUPDPLGH EXIIHU 5HDFWLRQ SURGXFWV ZHUH UHVROYHG RQ b SRO\DFU\LDPLGH0 XUHD JHOV DQG DXWRUDGLRJUDSKHG 6SOLFLQJ &RPSHWLWLRQ $VVD\V 7KHVH DVVD\V ZHUH GRQH HVVHQWLDOO\ DV GHVFULEHG DERYH EXW LQ WKH SUHVHQFH RI D FRQVWDQW DPRXQW RI WKH ZLOGW\SH SURWHLQ DQG LQFUHDVLQJ FRQFHQWUDWLRQV RI PXWDQW

PAGE 38

&ES SURWHLQV 7KH GHOHWLRQ PXWDQW ODFNLQJ DPLQR DFLGV DQG WKH WULSOH DURPDWLF PXWDQW ZLWK < < DQG ) UHVLGXHV FRQYHUWHG WR OHXFLQH ZHUH HPSOR\HG WR FRPSHWH ZLWK WKH ZLOGW\SH SURWHLQ LQ VSOLFLQJ DVVD\V $V D FRQWURO WKH FRQFHQWUDWLRQ RI ZLOGW\SH &ES ZDV LQFUHDVHG WR WKH VDPH OHYHO RI WRWDO &ES SURWHLQ ZLOGW\SH PXWDQWf XVHG LQ WKH DERYH UHDFWLRQV EXW LQ WKH DEVHQFH RI PXWDQW SURWHLQV 6SOLFHG SURGXFWV ZHUH UHVROYHG RQ GHQDWXULQJ JHOV DQG TXDQWLWDWHG XVLQJ 3KRVSKRUOPDJHU 0ROHFXODU '\QDPLFVf 3DUWLDO 3URWHRO\VLV RI &ES 7KH FRQIRUPDWLRQ RI PXWDQW &ES SURWHLQV ZDV GHWHUPLQHG E\ FRPSDULQJ WKH SDUWLDO SURWHRO\WLF SURILOHV RI ZLOGW\SH DQG PXWDQW &ES 3DUWLDO SURWHRO\VLV ZDV GRQH E\ LQFXEDWLQJ XJ RI WKH ZLOGW\SH QDWLYH RU KHDWGHQDWXUHGf RU WKH PXWDQW &ES SURWHLQ ZLWK WU\SVLQ DW SURWHDVH&ES UDWLRV RI DQG ZZf IRU KRXU DW URRP WHPSHUDWXUH DQG WKH SHSWLGHV UHVROYHG RQ b 6'63$*( JHOV 7KH SHSWLGH SURILOHV ZHUH GHWHFWHG E\ :HVWHUQ EORWWLQJ SHUIRUPHG DFFRUGLQJ WR 7RZELQ HW DO f ZLWK D &ESVSHFLILF SRO\FORQDO DQWLERG\ D JHQHURXV JLIW RI 'U $OH[DQGHU 7]DJDORIIf (TXLOLEULXP %LQGLQJ $QDO\VLV 7KH DIILQLW\ RI ZLOGW\SH DQG PXWDQW &ES SURWHLQV IRU E, 51$ ZDV GHWHUPLQHG E\ WKH GRXEOHILOWHU ELQGLQJ DVVD\ :RQJ DQG /RKPDQ f ZLWK WKH H[FHSWLRQ WKDW D FKDUJHG Q\ORQ PHPEUDQH +\ERQG 1 IURP $PHUVKDPf ZDV XVHG LQ SODFH RI '($( 7KLV PHWKRG LQYROYHV ILOWUDWLRQ RI SURWHLQ51$ PL[WXUHV WKURXJK D VDQGZLFK RI WZR PHPEUDQHV D QLWURFHOOXORVH ILOWHU RQ WRS DQG D Q\ORQ

PAGE 39

PHPEUDQH DW WKH ERWWRP LQ D ZHOO GRWEORW DSSDUDWXV 7KH SURWHLQ51$ FRPSOH[HV DUH UHWDLQHG RQ WKH QLWURFHOOXORVH ZKLOH WKH IUHH 51$ LV WUDSSHG E\ WKH Q\ORQ PHPEUDQH 7KH IUDFWLRQ >51$ ERXQG@ FDQ EH FDOFXODWHG DV IROORZV >51$@ERXQG >51$@WRWDL &QF R &Q\f &QF &Q\f ZKHUH &QF DQG &Q\ FRUUHVSRQG WR WKH 3KRVSKRUOPDJHU FRXQWV UHWDLQHG RQ WKH QLWURFHOOXORVH DQG Q\ORQ ILOWHUV UHVSHFWLYHO\ 7KH SDUDPHWHU DBUHIHUV WR WKH 51$ UHWDLQHG QRQVSHFLILFDOO\ RQ QLWURFHOOXORVH DQG LV HPSLULFDOO\ GHULYHG IURP 51$ ERXQG LQ WKH DEVHQFH RI WKH SURWHLQ D &QF &Q\ DW >SURWHLQ@ f 3URWHLQ51$ FRPSOH[HV ZHUH JHQHUDWHG E\ LQFXEDWLQJ D ORZ FRQFHQWUDWLRQ S0f RI 3ODEHOHG LQWURQ 51$ ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV S0f RI ZLOGW\SH RU PXWDQW &ES LQ P0 0J&K P0 '77 P0 1+&, P0 WULV+&O S+ EXIIHU DW r & IRU PLQXWHV 7KH UHDFWLRQV H[KLELW HTXLOLEULXP ELQGLQJ E\ PLQXWHV 'XSOLFDWH UHDFWLRQV ZHUH ILOWHUHG WKURXJK D SUHVRDNHG %$ QLWURFHOOXORVH PHPEUDQH 6FKOHLFKHU DQG 6FKXHOOf RYHUODLG RQ D SUHZHWWHG +\ERQG 1 Q\ORQ PHPEUDQH LQ D ZHOO GRWEORW DSSDUDWXV %LR5DGf 7KH ILOWHUV ZHUH ZDVKHG IRXU WLPHV ZLWK ORZ VDOW EXIIHU DQG WKH UDGLRDFWLYLW\ UHWDLQHG RQ ERWK WKH PHPEUDQHV ZDV TXDQWLWDWHG XVLQJ D 3KRVSKRUOPDJHU 0ROHFXODU '\QDPLFVf 7KH IUDFWLRQ >51$ ERXQG@ ZDV FDOFXODWHG DQG .D RI WKH PXWDQWV GHWHUPLQHG E\ WKH &ES FRQFHQWUDWLRQ QHHGHG IRU KDOI PD[LPDO 51$ ELQGLQJ

PAGE 40

&+$37(5 ,'(17,),&$7,21 2) ,17521 51$ &217$&7 6,7(6 21 &%3 3527(,1 ,QWURGXFWLRQ ,QGXFWLRQ RI FURVVOLQNV E\ XOWUDYLROHW OLJKW LQ QXFOHLF DFLGSURWHLQ FRPSOH[HV KDV EHHQ D YDOXDEOH WRRO IRU SURELQJ VWUXFWXUDO DVSHFWV RI SURWHLQ'1$51$ LQWHUDFWLRQV 8OWUDYLROHW 89f SKRWRO\VLV SURYLGHV D XVHIXO DSSURDFK WR GHWHUPLQH WKH FRQWDFW SRLQWV EHWZHHQ QXFOHLF DFLG DQG SURWHLQ DV LW SURGXFHV ]HUROHQJWK FURVVOLQNV LQ FRQWUDVW WR FKHPLFDO FURVVOLQNLQJ DJHQWV 7KH ODWWHU LQWHUSRVH VSDFHUV RI YDU\LQJ OHQJWKV DW WKH LQWHUIDFH DQG KHQFH DUH OHVV DSSURSULDWH WR SUREH LQWLPDWH FRQWDFWV DW WKH LQWHUIDFH RI SURWHLQQXFOHLF DFLG FRPSOH[HV $ IUHH UDGLFDO PHFKDQLVP KDV EHHQ SURSRVHG WR H[SODLQ WKH SURFHVV RI 89FURVVOLQNLQJ RI DPLQR DFLGV WR QXFOHLF DFLG EDVHV 6KHWODU f 3KRWRH[FLWDWLRQ RI D QXFOHLF DFLG EDVH IROORZHG E\ DEVWUDFWLRQ RI D K\GURJHQ DWRP IURP D IDYRUDEO\ SRVLWLRQHG DPLQR DFLG UHVLGXH JHQHUDWHV D SXULQ\O RU S\ULPLGLQ\O UDGLFDO ZKLFK UHFRPELQHV ZLWK WKH FRUUHVSRQGLQJ UDGLFDO RQ WKH SUR[LPDWH DPLQR DFLG UHVLGXH 6XFK D ]HUROHQJWK UHFRPELQDWLRQ HYHQW UHTXLUHV DQ DPLQR DFLG WR EH SUHVHQW LQ H[WUHPHO\ FORVH SUR[LPLW\ WR DQ H[FLWHG EDVH 6WXGLHV RQ WKH EDFWHULRSKDJH IG JHQH SURWHLQ D VLQJOHVWUDQGHG '1$ELQGLQJ SURWHLQ VXJJHVW WKDW WKH DPLQR DFLG DQG WKH EDVH

PAGE 41

PXVW DOVR EH SUHVHQW LQ D UHODWLYHO\ VSHFLILF WRSRORJLFDO DUUDQJHPHQW WR DFKLHYH SKRWRFKHPLFDO FURVVOLQNLQJ :LOOLDPV DQG .RQLJVEHUJ f )RU LQVWDQFH WKH DPLQR DFLGV 7\U DQG 3KH RI WKH EDFWHULRSKDJH IG JHQH SURWHLQ FRXOG QRW EH FURVVOLQNHG LQ D JHQH VV'1$ FRPSOH[ 3DUDGLVR HW DO 3DUDGLVR DQG .RQLJVEHUJ f DOWKRXJK r+ QXFOHDU PDJQHWLF UHVRQDQFH GDWD VXJJHVW WKDW WKHVH WZR UHVLGXHV IRUP SDUW RI WKH '1$ELQGLQJ GRPDLQ RI WKH SURWHLQ .LQJ DQG &ROHPDQ 7KH H[WHQW RI SKRWRFURVVOLQNLQJ DOVR GHSHQGV RQ WKH LQWULQVLF VWUXFWXUH RI WKH QXFOHLF DFLG RU SURWHLQ $PRQJ WKH QXFOHRWLGHV WK\PLQH DQG XULGLQH DSSHDU WR EH WKH PRVW SKRWRUHDFWLYH \LHOGLQJ JUHDWHVW H[WHQW RI FURVVOLQNLQJ WR SURWHLQV 2Q WKH RWKHU KDQG LQ SULQFLSOH DQ\ RI WKH DPLQR DFLGV IRXQG LQ SURWHLQV FDQ EH FURVVOLQNHG WR QXFOHLF DFLGV E\ 89LUUDGLDWLRQ :LOOLDPV DQG .RQJVEHUJ f 3KRWRFKHPLFDO FURVVOLQNLQJ KDV EHHQ DGDSWHG WR GHWHFW SURWHLQ ERXQG WR VSHFLILF f VLWHV RQ GRXEOHVWUDQGHG '1$ XVLQJ 3ODEHOHG VLWHVSHFLILF SUREHV 6DIHU HW DO f 7KLV PHWKRG SHUPLWV WUDQVIHU RI 3 IURP VSHFLILF SKRVSKRGLHVWHU ERQGV WR DPLQR DFLG UHVLGXHV DW WKH LQWHUIDFH XSRQ SKRWRFURVVOLQNLQJ :LOOLDPV DQG .RQLJVEHUJ f :H KDYH HPSOR\HG D VLPLODU PHWKRG WR GHWHFW LQWURQ 51$ ELQGLQJ VLWHV RQ &ES SURWHLQ :H V\QWKHVL]HG LQWURQ 51$ WUDQVFULSWV LQWHUQDOO\ ODEHOHG ZLWK D 3 873f 89FURVVOLQNHG LW WR SXULILHG &ES XQGHU FRQGLWLRQV WKDW IDYRU VSHFLILF FRPSOH[ IRUPDWLRQ DQG GHWHFWHG WKH FURVVOLQNHG &ES51$ FRPSOH[HV RQ 6'6SRO\DFU\ODPLGH JHOV E\ DXWRUDGLRJUDSK\ DV WKH SURWHLQ EHFDPH LQGLUHFWO\ ODEHOHG XSRQ SKRWRFURVVOLQNLQJ

PAGE 42

9DULRXV ELRFKHPLFDO PHWKRGV KDYH EHHQ HPSOR\HG E\ VHYHUDO JURXSV WR LGHQWLI\ WKH FURVVOLQNHG SHSWLGHV DQG DPLQR DFLG UHVLGXHV DW WKH LQWHUIDFH RI SURWHLQQXFOHLF DFLG FRPSOH[HV 7KH PRVW FRPPRQ DSSURDFK KDV EHHQ WR GLJHVW WKH FURVVOLQNHG FRPSOH[ ZLWK WU\SVLQ UDSLGO\ LVRODWH WKH SHSWLGHV XVLQJ DQLRQH[FKDQJH +3/& GHWHFW WKH SHSWLGHV E\ WKHLU DEVRUEDQFH DW QP RU QP DQG LGHQWLI\ WKH FURVVOLQNHG IUDJPHQWV E\ &HUHQNRY FRXQWLQJ RI WKH UHVXOWDQW IUDFWLRQV 0HUULOO HW DO 0HUULOO HW DO DQG 6KDPRR HW DO f ,Q FDVH RI SURWHLQV ZLWK NQRZQ SULPDU\ VWUXFWXUH WKH FURVVOLQNHG DPLQR DFLG UHVLGXHV KDYH EHHQ LGHQWLILHG E\ DPLQR DFLG DQDO\VLV IROORZLQJ DFLG K\GURO\VLV )RU H[DPSOH WKH FURVVOLQN VLWH LQ WKH EDFWHULRSKDJH IG JHQH SURWHLQ ZDV LGHQWLILHG DV F\VWHLQH E\ WKLV PHWKRG 3DUDGLVR HW DO f +RZHYHU WKLV PD\ QRW UHSUHVHQW D JHQHUDO DSSURDFK DV LW GHSHQGV RQ WKH DELOLW\ RI DFLG K\GURO\VLV WR UHJHQHUDWH WKH IUHH DPLQR DFLG IURP WKH FURVVOLQNHG DGGXFW ,Q PRVW LQVWDQFHV WKH FURVVOLQNHG DPLQR DFLG ZDV LGHQWLILHG E\ DPLQR DFLG VHTXHQFLQJ EDVHG RQ WKH IROORZLQJ SULQFLSOH $ JDV RU OLTXLG SKDVH VHTXHQFHU FDQQRW H[WUDFW WKH SKHQ\OWKLD]ROLQRQH GHULYDWLYH RI WKH FURVVOLQNHG DPLQR DFLG IURP WKH SRO\EUHQHFRDWHG VXSSRUW GLVN DQG WKHUHIRUH OHDYHV D KROH LQ WKH VHTXHQFH DW WKH FURVVOLQNHG SRVLWLRQ 7KXV WKH VLWH RI FURVVOLQNLQJ LV GHWHUPLQHG E\ WKH DEVHQFH RI DQ LGHQWLILDEOH SKHQ\OWKLRK\GDQWLRQ GHULYDWLYH LQ WKH SHSWLGH VHTXHQFH 8VLQJ WKLV DSSURDFK WKH FRQWDFW VLWHV LQ ( FROL 66% 0HUULOO HW DO f DQG $O KQ513 0HUULOO HW DO f SURWHLQV FURVVOLQNHG WR M3ODEHOHG G7f ROLJRQXFOHRWLGHV ZHUH LGHQWLILHG ,Q WKH FDVH RI ( FROL 66% WKH VLWH RI FURVVOLQNLQJ ZDV IXUWKHU FRQILUPHG E\ VROLGSKDVH VHTXHQFLQJ ZKLFK HPSOR\HG D

PAGE 43

VXIILFLHQWO\ SRODU VROYHQW VXFK DV WULIOXRURDFHWLF DFLG WR H[WUDFW WKH 3ODEHOHG SKHQ\OWKLRK\GDQWLRQ GHULYDWLYH RI WKH FURVVOLQNHG DPLQR DFLG ,Q DGGLWLRQ WR WKH DERYH ELRFKHPLFDO PHWKRGV JHO HOHFWURSKRUHVLV LV D VLPSOH EXW SRZHUIXO DQDO\WLFDO WHFKQLTXH WR UHVROYH FRPSOH[ PL[WXUHV RI SHSWLGHV DQG LGHQWLI\ WKH LQGLUHFWO\ ODEHOHG FURVVOLQNHG SHSWLGHV E\ DXWRUDGLRJUDSK\ ,Q WKH VWXGLHV UHSRUWHG LQ WKLV FKDSWHU ZH KDYH DQDO\]HG WKH 89FURVVOLQNHG &ES 3 ODEHOHG LQWURQ 51$ FRPSOH[HV E\ GLJHVWLQJ WKH SURWHLQ51$ FRPSOH[HV ZLWK QRQHQ]\PDWLF FOHDYDJH DJHQWV DQG UHVROYLQJ WKH UHVXOWDQW SHSWLGHV E\ RQH GLPHQVLRQDO WULVWULFLQH JHO HOHFWURSKRUHVLV :H KDYH PDSSHG WKH PDMRU FURVVOLQN VLWHV RI LQWURQ 51$ WR WKH 1 DQG &WHUPLQL RI &ES 5HVXOWV 2SWLPL]DWLRQ RI 89&URVVOLQNLQJ &RQGLWLRQV 2QH RI WKH WHFKQLFDO KXUGOHV LQ ELRFKHPLFDO FKDUDFWHUL]DWLRQ RI FURVVOLQNHG FRPSOH[HV LV LVRODWLRQ RI VXIILFLHQW DPRXQWV RI WKH SURWHLQ51$ FRPSOH[HV UHODWLYHO\ IUHH IURP RWKHU VSHFLHV $V WKH \LHOG RI WKH SURGXFW GHSHQGV RQ WKH H[WHQW RI FURVVOLQNLQJ UHDFWLRQ FRQGLWLRQV PXVW EH RSWLPL]HG WR PD[LPL]H WKH FURVVOLQNLQJ HIILFLHQF\ 7R WKDW HQG WKH GRVDJH RI 89UDGLDWLRQ HPSOR\HG IRU FURVVOLQNLQJ &ES SURWHLQ WR LQWURQ 51$ ZDV WLWUDWHG KROGLQJ RWKHU FRQGLWLRQV FRQVWDQW 3ODEHOHG LQWURQ WUDQVFULSWV ZHUH LQFXEDWHG ZLWK QDWLYH &ES XQGHU ORZ VDOW FRQGLWLRQV P0 0J&E P0 1+&f ZLWKRXW *73 &ES ELQGV WR LQWURQ 51$ XQGHU WKHVH FRQGLWLRQV DQG LQGXFHV IRUPDWLRQ RI WKH FDWDO\WLF 51$ FRQIRUPDWLRQ 6KDZ DQG /HZLQ f 7KH &ES51$ FRPSOH[HV JHQHUDWHG

PAGE 44

ZHUH 89FURVVOLQNHG LQ WKH SUHVHQFH RI H[FHVV W51$ DGGHG DV D QRQ VSHFLILF FRPSHWLWRUf E\ WKH WHFKQLTXH RI =DPRUH DQG *UHHQ f DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH VDPSOHV ZHUH LUUDGLDWHG DW DQ LQFUHDVLQJ 89GRVDJH UDQJLQJ IURP WR P$V D FRQWURO LQWURQ 51$ ZDV LUUDGLDWHG ZLWK D QRQFRJQDWH SURWHLQ %6$ DW WKH KLJKHVW 89GRVDJH P-f HPSOR\HG LQ WKH H[SHULPHQW $OO VDPSOHV ZHUH H[WHQVLYHO\ WUHDWHG ZLWK 51$VH $ DQG 51$VH 7 WR UHPRYH XQFURVVOLQNHG 51$ DQG WKH SURWHLQ51$ FRPSOH[HV ZHUH UHVROYHG RQ 6'6SRO\DFU\ODPLGH JHOV 7KH JHO ZDV DXWRUDGLRJUDSKHG )LJXUH f DQG DOVR TXDQWLWDWHG XVLQJ 3KRVSKRUOPDJHU 1R FURVVOLQNHG FRPSOH[ ZDV REVHUYHG LQ WKH SUHVHQFH RI %6$ ODQH f HYHQ DW D KLJK GRVDJH RI 89UDGLDWLRQ GHPRQVWUDWLQJ WKH VSHFLILFLW\ RI &ESLQWURQ 51$ LQWHUDFWLRQ 7KH H[WHQW RI FURVVOLQNLQJ RI LQWURQ 51$ WR &ES LQFUHDVHG E\ DERXW IROG DW D 89GRVDJH RI PODQH f FRPSDUHG WR WKDW DW O22PODQH f DQG DOPRVW UHPDLQHG WKH VDPH DW KLJKHU GRVHV ODQHV DQG f 7KXV D 89GRVDJH RI PZDV FKRVHQ DV WKH ORZHVW 89GRVDJH ZKLFK \LHOGHG RSWLPDO FRPSOH[ IRUPDWLRQ ,GHQWLILFDWLRQ RI &ES 3HSWLGHV WKDW &RQWDFW ,QWURQ 51$ 7KH 89FURVVOLQNLQJ WHFKQLTXH VWDQGDUGL]HG DERYH ZDV VXFFHVVIXOO\ HPSOR\HG WR LGHQWLI\ WKH 51$ FRQWDFW VLWHV RQ &ES SURWHLQ 3ODEHOHG LQWURQ 51$ WUDQVFULSWV ZHUH FURVVOLQNHG WR KLVWDJJHG &ES XQGHU ORZ VDOW FRQGLWLRQV DW D 89 GRVDJH RI PDV GHVFULEHG DERYH 7KH &ES51$ FRPSOH[HV JHQHUDWHG ZHUH SXULILHG RQ 6'6SRO\DFU\ODPLGH JHOV 7KH JHO IUDJPHQWV ZHUH WKHQ VRDNHG LQ GLIIHUHQW FKHPLFDO FOHDYDJH UHDJHQWV OLNH K\GUR[\ODPLQH 1+2+f DQG QLWUR

PAGE 45

)LJXUH 2SWLPL]DWLRQ RI 89GRVDJH IRU FURVVOLQNLQJ 3 ODEHOHG LQWURQ 51$ ZDV LQFXEDWHG ZLWK &ES RU %6$ XQGHU ORZ VDOW FRQGLWLRQV DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 6DPSOHV ZHUH LUUDGLDWHG ZLWK 89GRVHV UDQJLQJ IURP WR PH[WHQVLYHO\ 51$DVHWUHDWHG UHVROYHG RQ b 6'6SRO\DFU\ODPLGH JHOV DQG FURVVOLQNHG FRPSOH[HV GHWHFWHG E\ DXWRUDGLRJUDSK\ 89LUUDGLDWLRQ ZDV GRQH DW PIRU %6$ ODQH f DQG IRU &ES DW PODQH f PODQH f PODQH f PODQH f PODQH f PODQH f PODQH f DQG PODQH f

PAGE 46

F D R Z }! I &ES %6$ e f§N 1! 2A &2Q RR Y2 _O /rRR

PAGE 47

WKLRF\DQREHQ]RDWH 17&%f WR JHQHUDWH SHSWLGHV 7KH SHSWLGHV ZHUH VHSDUDWHG RQ KLJK SHUFHQWDJH WULVWULFLQH JHOV 6FKDJJHU DQG 9RQ -DJRZ f DQG WKH FURVVOLQNHG SHSWLGHV WKDW UHWDLQHG WKH ODEHO ZHUH LGHQWLILHG E\ DXWRUDGLRJUDSK\ )LJXUH f 1+2+ FOHDYHV SURWHLQV DW DVSDUDJLQ\OJO\F\O SHSWLGH ERQGV %RPVWHLQ DQG %DOLDQ f DQG ZRXOG \LHOG WKUHH ODUJH SHSWLGHV N'Df LQ D FRPSOHWH GLJHVW RI &ES &OHDYDJH RI WKH FURVVOLQNHG &ES51$ FRPSOH[ )LJXUH SDQHO $f VKRZHG WKDW WKH N'D DPLQR WHUPLQDO DQG WKH N'D FDUER[\ WHUPLQDO IUDJPHQWV RI &ES VWURQJO\ FURVVOLQNHG ZLWK LQWURQ 51$ ZKHUHDV WKH ODUJH FHQWUDO N'D IUDJPHQW GLVSOD\HG RQO\ D YHU\ ZHDN VLJQDO 7KH IDFW WKDW RQO\ WZR RI WKH WKUHH SHSWLGHV ZHUH VWURQJO\ ODEHOHG VXJJHVWV WKDW WKH WHUPLQDO IUDJPHQWV RI &ES PLJKW FRPSULVH LPSRUWDQW 51$ ELQGLQJ GRPDLQV 7KH ZHDN VLJQDO UHWDLQHG E\ WKH FHQWUDO N'D SHSWLGH VXJJHVWV WKDW RWKHU PLQRU FRQWDFW VLWHV PD\ EH GLVWULEXWHG WKURXJKRXW WKH OHQJWK RI SURWHLQ 7KHVH VLWHV RI LQWHUDFWLRQ PD\ DOVR FRQWULEXWH WR WKH VWDELOL]DWLRQ RI WKH DFWLYH LQWURQ VWUXFWXUH DOWKRXJK WKH WHUPLQL PD\ EH DEVROXWHO\ HVVHQWLDO IRU WKH DFWLYLW\ 17&% LV VSHFLILF WR DPLQR JURXSV RI F\VWHLQHV -DFREVRQ HW DL 'HJDQL DQG 3DWFKRPLN f 17&% &OHDYDJH RI &ES ZRXOG SURGXFH SHSWLGHV UDQJLQJ IURP WR N'D LI WKH UHDFWLRQ SURFHHGHG WR FRPSOHWLRQ )ORZHYHU IRU VHYHUDO UHDVRQV RQO\ D SDUWLDO GLJHVWLRQ RI WKH SURWHLQ FRXOG EH DFKLHYHG ,QFRPSOHWH FOHDYDJH UHVXOWV IURP SHOLPLQDWLRQ DQGRU LQFRPSOHWH PRGLILFDWLRQ GXH WR WKH UHYHUVLEOH QDWXUH RI WKH F\DQ\ODWLRQ UHDFWLRQ 'HJDQL DQG 3DWFKRPLN

PAGE 48

)LJXUH &KHPLFDO FOHDYDJH RI &ESLQWURQ 51$ FRPSOH[HV +LVWDJJHG &ES ZDV FURVVOLQNHG WR 3ODEHOHG LQWURQ 51$ XQGHU ORZ VDOW FRQGLWLRQV LQ WKH DEVHQFH RI *73 H[WHQVLYHO\ 51$VH WUHDWHG JHO SXULILHG RQ b 6'6 SRO\DFU\ODPLGH JHOV DQG GLJHVWHG LQJHO ZLWK K\GUR[\ODPLQH SDQHO $f DQG 17&% SDQHO %f )ROORZLQJ FOHDYDJH SHSWLGHV ZHUH H[WUDFWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV VHSDUDWHG RQ b K\GUR[\ODPLQHf RU b 17&%f WULVWULFLQH JHOV GULHG DQG DXWRUDGLRJUDSKHG 0ROHFXODU ZHLJKWV RI VWURQJO\ FURVVOLQNHG SHSWLGHV DUH LQGLFDWHG E\ DUURZV ZLWK DVWHULVNV UHSUHVHQWLQJ SDUWLDO FOHDYDJH SURGXFWV 3DQHO & P0 *73 ZDV DGGHG WR WKH FURVVOLQNLQJ UHDFWLRQ PL[WXUH DQG LQFXEDWHG DW r& IRU PLQXWHV 7KH UHDFWLRQ SURGXFWV ZHUH HWKDQRO SUHFLSLWDWHG UHVROYHG RQ b SRO\DFU\ODPLGH0 XUHD JHOV DQG DXWRUDGLRJUDSKHG /DQH VKRZV LQWURQ 51$ DORQH LQFXEDWHG LQ WKH UHDFWLRQ PL[WXUH /DQHV DQG VKRZ WKH VSOLFHG SURGXFWV RI LQWURQ 51$ LQFXEDWHG ZLWK QDWLYH DQG KLVWDJJHG &ES UHSHFWLYHO\ 7KH LQSXW 51$ DQG WKH VSOLFHG SURGXFWV DUH VFKHPDWLFDOO\ UHSUHVHQWHG RQ WKH OHIW

PAGE 49

$ 1+ 2+ N'D N'D % 17&% N'Dr N'Dr N'Dr N'D

PAGE 50

f :KLOH FRPSOHWH GHQDWXUDWLRQ RI WKH SURWHLQ LV HVVHQWLDO WR REWDLQ FOHDYDJH DW WKH LQWHUQDO VLWHV &ES D UHODWLYHO\ ODUJH SURWHLQ N'Df DSSHDUV WR EH VRPHZKDW UHIUDFWLOH HYHQ WR WKH VWURQJ GHQDWXUDWLRQ FRQGLWLRQV HPSOR\HG LQ WKHVH FOHDYDJH UHDFWLRQV &OHDYDJH RI FURVVOLQNHG &ES51$ FRPSOH[HV ZLWK 17&% )LJXUH SDQHO %f JHQHUDWHG VHYHUDO SHSWLGHV WKDW UHWDLQHG WKH ODEHO $PRQJ WKH YDULRXV LQGLUHFWO\ ODEHOHG SHSWLGHV WKH N'D 1WHUPLQDO SHSWLGH DQG LWV FRUUHVSRQGLQJ SDUWLDOV LQGLFDWHG E\ DVWHULVNVf RI VL]HV DQG N'D FRXOG EH UHDGLO\ LGHQWLILHG 7KLV IXUWKHU VXSSRUWV WKH ILQGLQJ WKDW WKH 1WHUPLQXV FRPSULVHV DQ LPSRUWDQW 51$ ELQGLQJ GRPDLQ +RZHYHU WKH N'D &WHUPLQDO IUDJPHQW JHQHUDWHG E\ 17&% LGHQWLILHG E\ VLOYHU VWDLQLQJ GDWD QRW VKRZQf GLG QRW UHWDLQ WKH ODEHO VXJJHVWLQJ WKDW WKH H[WUHPH &WHUPLQDO UHJLRQ PD\ QRW EH LPSRUWDQW IRU &ES51$ LQWHUDFWLRQV 7KH SXWDWLYH &WHUPLQDO FRQWDFW VLWH LGHQWLILHG E\ 1+2+ FOHDYDJH PD\ WKHUHIRUH EH ORFDWHG XSVWUHDP RI WKLV N'D &WHUPLQDO IUDJPHQW ,Q RUGHU WR GHPRQVWUDWH WKDW WKH FRQGLWLRQV HPSOR\HG IRU 89FURVVOLQNLQJ SURPRWH WKH IRUPDWLRQ RI DFWLYH &ESLQWURQ 51$ FRPSOH[HV WKH UHDFWLRQ PL[HV ZHUH LQFXEDWHG ZLWK P0 *73 DW r & IRU PLQXWHV DQG WKH SURGXFWV ZHUH UHVROYHG RQ GHQDWXULQJ JHOV DQG DXWRUDGLRJUDSKHG 7KH UHVXOWV DUH VKRZQ LQ )LJXUH SDQHO & 5HDFWLRQ PL[HV FRQWDLQLQJ HLWKHU KLVWDJJHG ODQH f RU QDWLYH &ES ODQH f SURWHLQ FOHDUO\ GHPRQVWUDWHG VSOLFLQJ ZKLOH WKH 51$ DORQH ODQH f FRXOG QRW VSOLFH XQGHU VLPLODU ORZ VDOW FRQGLWLRQV

PAGE 51

7KH [ KLVWLGLQH WDJ DGGV DQ DGGLWLRQDO DPLQR DFLG UHVLGXHV DERXW N'Df WR WKH 1WHUPLQXV RI WKH KLVWDJJHG &ES SURWHLQ 7KHUHIRUH WKH LQGLUHFWO\ ODEHOHG 1WHUPLQDO SHSWLGH DQG WKH SDUWDLV REWDLQHG ZLWK KLVWDJJHG &ES ZRXOG PLJUDWH VORZHU LQ WKH JHOV WKDQ WKHLU QRQWDJJHG FRXQWHUSDUWV 7KLV GLIIHUHQFH LQ HOHFWURSKRUHWLF PRELOLW\ ZDV XVHG DV DQ DQDO\WLFDO WRRO WR FRQILUP WKH DVVLJQPHQW RI WKH FURVVOLQN VLWH WR WKH 1WHUPLQDO IUDJPHQW )LJXUH SDQHOV $ DQG %f 7KH 1+2+ DQG 17&% GLJHVWLRQ SDWWHUQV RI WKH FURVVOLQNHG FRPSOH[HV XVLQJ HLWKHU KLVWDJJHG RU QDWLYH &ES ZHUH FRPSDUHG RQ WKH VDPH JHO 7KH UHVXOWV IRU 1+2+ FOHDYDJH UHDFWLRQV UXQ RQ b WULVWULFLQH JHOV DUH VKRZQ LQ )LJXUH SDQHO $ 7KH 1WHUPLQDO SHSWLGH RI WKH KLVWDJJHG SURWHLQ ODQH f REWDLQHG E\ 1+2+ FOHDYDJH PLJUDWHG DW N'D OHYHO ZKLOH WKH QRQWDJJHG SHSWLGH ODQH f PLJUDWHG IDVWHU DW N'D OHYHOf 7KH &WHUPLQDO SHSWLGHV GHULYHG IURP ERWK YHUVLRQV H[KLELWHG VLPLODU PRELOLWLHV VLQFH WKH KLVWDJ LV SUHVHQW RQO\ DW WKH 1WHUPLQXV 7KH FRUUHVSRQGLQJ 17&% GLJHVWV RI ERWK YHUVLRQV RI FURVVOLQNHG &ES DUH VKRZQ LQ )LJXUH SDQHO % 7KH 1WHUPLQDO SHSWLGH N'Df DQG WKH FRUUHVSRQGLQJ DQG N'D SDUWDLV VKRZQ E\ DVWHULVNVf RI KLVWDJJHG &ES ODQH f ZHUH VKLIWHG XS LQ WKH b WULVWULFLQH JHOV FRPSDUHG WR WKRVH JHQHUDWHG IURP WKH QDWLYH &ES ODQH f 1R RWKHU SHSWLGHV VKLIWHG LQ WKH JHO UHODWLYH WR WKH QRQWDJJHG YHUVLRQ 7KHVH H[SHULPHQWV VKRZLQJ GLIIHUHQWLDO PRELOLW\ FOHDUO\ GHPRQVWUDWH WKDW WKH 1WHUPLQDO FURVVOLQN VLWH FRUUHVSRQGV WR WKH H[WUHPH 1WHUPLQDO IUDJPHQW 7KH PLQLPDO 1WHUPLQDO SHSWLGH WKDW FURVVOLQNHG ZLWK LQWURQ 51$ ZDV WKH N'D SHSWLGH RI WKH QDWLYH &ES WKDW FRUUHVSRQGV WR WKH ILUVW UHVLGXHV RI WKH SURWHLQ

PAGE 52

)LJXUH &RQILUPDWLRQ RI WKH FURVVOLQN VLWH LQ WKH 1WHUPLQXV RI &ES 1DWLYH DQG KLVWDJJHG &ES SURWHLQV ZHUH FURVVOLQNHG WR M3ODEHOHG LQWURQ 51$ DQG GLJHVWHG ZLWK K\GUR[\ ODPLQH SDQHO $f DQG 17&% SDQHO %f DV GHVFULEHG LQ WKH OHJHQG WR )LJXUH /DQHV DQG UHSUHVHQW WKH FOHDYDJH SDWWHUQV RI QDWLYH DQG KLVWDJJHG &ES UHVSHFWLYHO\ 0ROHFXODU ZHLJKWV RI VWURQJO\ FURVVOLQNHG SHSWLGHV DUH LQGLFDWHG E\ DUURZV ZLWK DVWHULVNV UHSUHVHQWLQJ SDUWLDO FOHDYDJH SURGXFWV 1RWH WKH VORZHU PLJUDWLRQ RI 1WHUPLQDO GHULYHG IUDJPHQWV LQ WKH KLV WDJJHG &ES ODQHV

PAGE 53

$ 7 /! F r} L F R = 7 8 DM rr L LQ N'D N'D N'D % r N'D r N'D N'D 7 f E2 ER m} } & R & = ; N'Dr N'Dr N'D

PAGE 54

)XUWKHU DQDO\VLV RI WKH LGHQWLILHG FRQWDFW VLWHV &KDSWHU f ZDV UHVWULFWHG WR WKH LGHQWLILHG 1WHUPLQDO IUDJPHQW +RZHYHU FHUWDLQ FRQFOXVLRQV FDQ EH GUDZQ DERXW WKH &WHUPLQDO IUDJPHQW IURP WKH H[SHULPHQWV GHVFULEHG DERYH 7KH N'D & WHUPLQDO SHSWLGH JHQHUDWHG E\ 1+2+ FOHDYDJH VKRZHG VWURQJ FURVVOLQNLQJ ZLWK LQWURQ 51$ )LJXUH SDQHO $f %XW WKH N'D &WHUPLQDO IUDJPHQW JHQHUDWHG E\ 17&% )LJXUH SDQHO %f GLG QRW UHWDLQ WKH ODEHO LQ FURVVOLQNLQJ H[SHULPHQWV 7KHVH UHVXOWV VXJJHVW WKDW WKH N'D SHQXOWLPDWH &WHUPLQDO SHSWLGH RI &ES DD DDf JHQHUDWHG E\ 17&% KDV D SRWHQWLDO 51$ ELQGLQJ VLWH 7KH VXPPDU\ RI ILQGLQJV IURP WKH 89FURVVOLQNLQJ H[SHULPHQWV DUH VKRZQ LQ )LJXUH 7KH PDS VKRZV WKH WZR VWURQJ 51$ ELQGLQJ UHJLRQV KDVKHG ER[HVf WKDW KDYH EHHQ LGHQWLILHG E\ WKHVH H[SHULPHQWV ZLWK RQH VLWH EHLQJ LQ WKH ILUVW DPLQR DFLGV RI WKH 1WHUPLQXV DQG WKH RWKHU LQ D GLVWDOO\ ORFDWHG &WHUPLQDO UHJLRQ DD DD f 7KH GLJHVWLRQ VLWHV RI 1+2+ DQG 17&% RQ &ES DUH DOVR LQGLFDWHG LQ )LJXUH )XUWKHU DQDO\VLV RI WKH LPSRUWDQFH RI DPLQR DFLG UHVLGXHV LQ WKH 1WHUPLQDO IUDJPHQW ZDV FDUULHG RXW XVLQJ VLWHGLUHFWHG PXWDJHQHVLV &KDSWHU f 'LVFXVVLRQ 89FURVVOLQNLQJ LV D SRZHUIXO WRRO WR LGHQWLI\ 51$ FRQWDFW VLWHV RQ D SURWHLQ HVSHFLDOO\ ZKHQ WKH SULPDU\ VWUXFWXUH DQG KRPRORJ\ VHDUFKHV GR QRW DIIRUG DQ\ FOXHV DERXW FULWLFDO IXQFWLRQDO HOHPHQWV RI WKH SURWHLQ &ES UHTXLUHG IRU WKH

PAGE 55

)LJXUH 6XPPDU\ RI 89FURVV,cQNLQJ UHVXOWV 7KH SHSWLGH PDS UHSUHVHQWV WKH FOHDYDJH VLWHV RI 17&% WRS DUURZVf DQG K\UR[\ODPLQH ERWWRP DUURZVf RQ WKH DD ORQJ &ES SURWHLQ )URP WKH 89FURVVOLQNLQJ DQG FKHPLFDO FOHDYDJH UHVXOWV VKRZQ LQ )LJXUHV DQG WKH LQWURQ 51$ FURVVOLQN VLWHV RQ &ES ZHUH PDSSHG WR WKH ILUVW DPLQR DFLGV DW WKH 1WHUPLQXV DQG DDDD LQ WKH &WHUPLQXV KDVKHG ER[HVf

PAGE 56

A RR 0 91 : 47/)0 9 6/554* 6 6 6 5 <5 <.)10 (1,7+4 9)35&

PAGE 57

VSOLFLQJ RI LQWURQ 51$ ILWV LQWR WKLV SURILOH RI SURWHLQV 1RWKLQJ LV NQRZQ VR IDU DERXW WKH 51$ FRQWDFW VLWHV RQ WKH SURWHLQ ZKLOH H[WHQVLYH VWXGLHV DUH DYDLODEOH RQ WKH 51$ FRPSRQHQW RI WKH V\VWHP ,Q WKH VWXGLHV UHSRUWHG KHUH 89FURVVOLQNLQJ ZDV HPSOR\HG WR GHWHUPLQH WKH FRQWDFW SRLQWV RI LQWURQ 51$ RQ &ES LQ DQ DWWHPSW WR LQYHVWLJDWH WKH IXQFWLRQDO LQWHUDFWLRQV EHWZHHQ WKLV JURXS LQWURQ DQG LWV SURWHLQ FRIDFWRU 7KH SKRWRFURVVOLQNLQJ VWXGLHV ZHUH SHUIRUPHG XQGHU FRQGLWLRQV WKDW IDYRUHG WKH IRUPDWLRQ RI VWDEOH SURWHLQ51$ FRPSOH[HV 7KH 0J OHYHOV P0f HPSOR\HG LQ WKHVH H[SHULPHQWV ZHUH VXIILFLHQW WR SURPRWH b 51$ ELQGLQJ WR &ES LQ HTXLOLEULXP ILOWHU ELQGLQJ DVVD\V GDWD QRW VKRZQf EXW VSOLFLQJ RI 51$ ZRXOG QRW RFFXU XQGHU WKHVH FRQGLWLRQV GXH WR WKH DEVHQFH RI JXDQRVLQH QXFOHRSKLOHf +RZHYHU FRQWURO H[SHULPHQWV VKRZ WKDW DGGLWLRQ RI *73 WR WKH UHDFWLRQ IDFLOLWDWHV VSOLFLQJ GHPRQVWUDWLQJ WKDW WKH FURVVOLQNLQJ FRQGLWLRQV HQDEOH WKH IRUPDWLRQ RI SURGXFWLYH &ES51$ FRPSOH[HV )LJXUH SDQHO &f 3ULRU WR GHWHUPLQLQJ WKH VLWHV RI FURVVOLQNLQJ LW LV HVVHQWLDO WR HVWDEOLVK WKH VSHFLILFLW\ RI FURVVOLQNLQJ EHWZHHQ WKH 51$ DQG WKH SURWHLQ LQ TXHVWLRQ ,Q FRQWURO H[SHULPHQWV LQWURQ 51$ IDLOHG WR FURVVOLQN WR WKH QRQFRJQDWH SURWHLQ %6$ )LJXUH f VKRZLQJ WKDW SKRWRFURVVOLQNLQJ ]HUROHQJWK FURVVOLQNLQJf FDQ RFFXU RQO\ EHWZHHQ IXQFWLRQDOO\ LQWHUDFWLQJ VSHFLHV $OVR &ES SURWHLQV FDUU\LQJ PXWDWLRQV LQ WKH 1WHUPLQDO GRPDLQ VKRZHG UHGXFHG RU QR FURVVOLQNLQJ ZLWK LQWURQ 51$ FRPSDUHG WR WKH ZLOGW\SH SURWHLQ GLVFXVVHG LQ &KDSWHU f )XUWKHUPRUH &ES GRHV QRW IDFLOLWDWH VSOLFLQJ RI LQWURQ RI &2% SUHP51$ /HZLQ XQSXEOLVKHG REVHUYDWLRQf D JURXS LQWURQ WKDW DOVR UHTXLUHV D SURWHLQ FRIDFWRU LQ

PAGE 58

YLYR /DPE HW DO %DQURTXHV HW DO f &ES SURWHLQ LV VSHFLILF WR LQWURQ 51$ LQ LWV VSOLFLQJHQKDQFLQJ IXQFWLRQ 7KLV FRUURERUDWHV WKH DXWKHQWLFLW\ RI WKH FURVVOLQNLQJ UHVXOWV DV 89OLJKW FURVVOLQNV DQ DPLQR DFLG WR LWV QHLJKERULQJ QXFOHLF DFLG EDVH RQO\ ZKHQ SUHVHQW LQ D VSHFLILF RULHQWDWLRQ :LOOLDPV DQG .RQLJVEHUJ f 7KH UHVXOWV RI YDULRXV H[SHULPHQWV GHVFULEHG DERYH VWURQJO\ VXJJHVW WKDW WKH FURVVOLQNLQJ FRQGLWLRQV HPSOR\HG SHUPLW WKH VWUXFWXUDO SURELQJ RI VSHFLILF IXQFWLRQDO LQWHUDFWLRQV EHWZHHQ &ES DQG LQWURQ 51$ 3UHFLVH LGHQWLILFDWLRQ RI WKH UHVLGXHV WKDW SDUWLFLSDWH LQ SKRWRFURVVOLQNLQJ FDQ EH DFFRPSOLVKHG E\ DPLQR DFLG DQDO\VLV RU DPLQR DFLG VHTXHQFLQJ DV GHVFULEHG HDUOLHU 7KHVH FRQYHQWLRQDO ELRFKHPLFDO WHFKQLTXHV KRZHYHU UHTXLUH FURVVOLQNLQJ HIILFLHQFLHV RI b RU PRUH 8QIRUWXQDWHO\ ORZ FURVVOLQNLQJ HIILFLHQFLHV OHVV WKDQ bf ZHUH REWDLQHG XQGHU RXU FRQGLWLRQV 7KHUHIRUH WKH 51$ HPSOR\HG IRU VRPH RI WKH FURVVOLQNLQJ H[SHULPHQWV ZDV GRXEOH ODEHOHG ZLWK D 3873 DQG D f3 $73 WR LQFUHDVH WKH VSHFLILF DFWLYLW\ RI 51$ DQG HQDEOH GHWHFWLRQ RI FURVVOLQNHG SHSWLGHV 7KHUH DUH VHYHUDO SRVVLELOLWLHV IRU WKH ORZ \LHOGV RI FURVVOLQNHG SURGXFW REWDLQHG LQ RXU V\VWHP &ES DQG LQWURQ 51$ PD\ KDYH LQKHUHQWO\ SRRU WHQGHQFLHV WR FURVVOLQN LQ VSLWH RI DSSUHFLDEOH FRPSOH[ IRUPDWLRQ 2Q WKH RWKHU KDQG H[SRVXUH WR 89OLJKW FRXOG EH FDXVLQJ VLJQLILFDQW SKRWRLQDFWLYDWLRQ RI &ES 3KRWRGDPDJH RI SURWHLQ ZDV UHSRUWHG WR EH D SUREOHP E\ RWKHU JURXSV *RWW HW DO 7DQQHU HW DO f )LQDOO\ WKRXJK 89FURVVOLQNLQJ LQGLFDWHV VLWHV RI SURWHLQ51$ FRQWDFW PRVW RI WKH DIILQLW\ EHWZHHQ SURWHLQ DQG 51$ PD\ EH DWWULEXWDEOH WR FRQWDFW VLWHV WKDW DUH QRW FURVVOLQNHG XQGHU WKH FRQGLWLRQV HPSOR\HG

PAGE 59

7KH ORZ OHYHO RI FURVVOLQNHG SURGXFW REWDLQHG LQ RXU V\VWHP SURYHG WR EH D SRWHQWLDO SUREOHP IRU IXUWKHU ELRFKHPLFDO FKDUDFWHUL]DWLRQ RI FURVVOLQNHG FRPSOH[HV 2QH RI WKH ZD\V WR RYHUFRPH WKLV SUREOHP ZRXOG EH WR HQKDQFH WKH SKRWRVHQVLWLYLW\ RI 51$ XVLQJ PRGLILHG UHVLGXHV OLNH EURPRXULGLQH RU LRGRXUDFLO DQG XVLQJ D PRQRFKURPDWLF ODVHU LQVWHDG RI D EURDG VSHFWUXP XOWUDYLROHW OLJKW )RU LQVWDQFH WKH DPLQR DFLG UHVLGXH 7\U RI 5 EDFWHULRSKDJH FRDW SURWHLQ ZDV VKRZQ WR EH FURVVOLQNHG ZLWK VLQJO\ %U8VXEVWLWXWHG KDLUSLQ 51$ *RWW HW DO f XVLQJ D PRQRFKURPDWLF ;H&O H[FLPHU ODVHU QPf WKDW \LHOGHG FURVVOLQNLQJ OHYHOV H[FHHGLQJ b 6XEVWLWXWLRQ RI LRGRXUDFLO IRU XUDFLO LQ WKH ELQGLQJ VLWH IRU EDFWHULRSKDJH 5 FRDW SURWHLQ LPSURYHG FURVVOLQNLQJ OHYHOV WR b LQ OHVV WKDQ PLQXWHV RI LUUDGLDWLRQ :LOOLV HW DO f +RZHYHU LQFRUSRUDWLRQ RI %U8 LQWR LQWURQ 51$ VLJQLILFDQWO\ UHGXFHG LWV DXWRFDWDO\WLF DFWLYLW\ LQGLFDWLQJ WKDW WKH VWUXFWXUH RI WKH ULER]\PH ZDV SHUWXUEHG GDWD QRW VKRZQf $OVR RXU DWWHPSWV WR FURVVOLQN &ES SURWHLQ ZLWK %U851$ XVLQJ D EURDG VSHFWUXP 89VRXUFH 6WUDWDOLQNHUf GLG QRW VLJQLILFDQWO\ HQKDQFH WKH H[WHQW RI FURVVOLQNLQJ 6LQFH ZH GLG QRW KDYH UHDG\ DFFHVV WR D PRQRFKURPDWLF ODVHU ZH RSWHG WR HPSOR\ DOWHUQDWLYH DQDO\WLFDO PHWKRGV ZKLFK DFFRPPRGDWH ORZ FURVVOLQNLQJ HIILFLHQFLHV $ SRSXODU DSSURDFK WR DQDO\]H FURVVOLQNHG FRPSOH[HV REWDLQHG DW ORZ \LHOGV LV WR HPSOR\ H[WUHPHO\ VHQVLWLYH DQDO\WLFDO WHFKQLTXHV OLNH 0DWUL[DVVLVWHG ODVHU GHVRUSWLRQLRQL]DWLRQWLPH RI IOLJKW 0$/',72)f PDVV VSHFWURPHWU\ .DUDV DQG

PAGE 60

+LOOHQNDPS %HDYLV DQG &KDLW DQG +LOOHQNDPS HW DO f DQG ODGGHU VHTXHQFLQJ &KDLW HW DO f ZKLFK W\SLFDOO\ UHTXLUH b FURVVOLQNLQJ HIILFLHQF\ (ODERUDWH DWWHPSWV ZHUH PDGH WR LGHQWLI\ WKH FURVVOLQNHG SHSWLGHVDPLQR DFLG UHVLGXHV XVLQJ WKLV DSSURDFK LQ FROODERUDWLRQ ZLWK WKH 3URWHLQ &RUH IDFLOLW\ RI WKH ,QWHUGLVFLSOLQDU\ &HQWHU IRU %LRWHFKQRORJ\ 5HVHDUFK ,&%5f 8QLYHUVLW\ RI )ORULGD 8QIRUWXQDWHO\ DOO DWWHPSWV IDLOHG GXH WR YDULRXV WHFKQLFDO SUREOHPV LQFOXGLQJ GLIILFXOW\ LQ UHPRYDO RI 6'6 &RRPPDVVLH %OXH DQG RWKHU JHO GHULYHG FRQWDPLQDQWV IURP WKH SHSWLGHV &RQVHTXHQWO\ WKH LQGLUHFWO\ ODEHOHG &ES SHSWLGHV FURVVOLQNHG ZLWK LQWURQ 51$f ZHUH LGHQWLILHG E\ VL]H VHSDUDWLRQ RQ WULVWULFLQH JHOV IROORZHG E\ 3KRVSKRUOPDJHU DQDO\VLV )LJXUHV DQG f 1RQHQ]\PDWLF FOHDYDJH DJHQWV ZHUH XVHG LQVWHDG RI SURWHDVHV WR DYRLG LQWHUIHUHQFH IURP SURWHDVHGHULYHG SHSWLGHV UHVXOWLQJ IURP VHOIFOHDYDJH 2I VHYHUDO FKHPLFDO FOHDYDJH UHDJHQWV K\GUR[\ODPLQH ZDV FKRVHQ IRU WKH LQLWLDO DQDO\VLV RI FURVVOLQNHG FRPSOH[HV DV LW JHQHUDWHV RQO\ D IHZ ODUJH SHSWLGHV LQ &ES WKDW FDQ EH UHDGLO\ LGHQWLILHG RQ KLJK SHUFHQWDJH WULVWULFLQH JHOV 17&% ZDV VHOHFWHG DV D VHFRQGDU\ UHDJHQW WR IXUWKHU QDUURZ GRZQ WKH FRQWDFW SRLQWV RQ &ES &KHPLFDO FOHDYDJH RI WKH SURWHLQ51$ FRPSOH[HV ZLWK 1+2+ DQG 17&% VKRZHG WKDW WKH WHUPLQL RI &ES FRPSULVH LPSRUWDQW 51$ ELQGLQJ GRPDLQV ZKLOH VHYHUDO VWUHWFKHV LQ WKH FHQWUDO FRUH RI WKH SURWHLQ PD\ FRQWULEXWH WR WKH RYHUDOO VWDELOL]DWLRQ RI SURWHLQ51$ LQWHUDFWLRQV )LJXUHV f ([SHULPHQWV ZLWK KLV WDJJHG DQG QDWLYH YHUVLRQV RI &ES )LJXUH f XQDPELJXRXVO\ GHPRQVWUDWH WKDW WKH ILUVW DPLQR DFLGV LQ WKH 1WHUPLQXV RI &ES FRQVWLWXWH D VWURQJ 51$ FRQWDFW

PAGE 61

VLWH $ VHFRQG VLWH PD\ EH ORFDWHG LQ WKH &WHUPLQXV EHWZHHQ UHVLGXHV DQG RI WKH SURWHLQ $ VLPLODU DUFKLWHFWXUH RI 51$ ELQGLQJ GRPDLQV KDV EHHQ GHPRQVWUDWHG ZLWK WKH PLWRFKRQGULDO W\URV\OW51$ V\QWKHWDVH SURWHLQ &\Wf RI 1HXURVSRUD ZKLFK LV HVVHQWLDO IRU VSOLFLQJ VHYHUDO PLWRFKRQGULDO JURXS LQWURQV LQ DGGLWLRQ WR DPLQRDF\ODWLRQ RI W51$7!U $NLQV DQG /DPERZLW] f 7KH UHJLRQV UHTXLUHG IRU VSOLFLQJ DUH GLVWULEXWHG WKURXJKRXW WKH &\W SURWHLQ DV LW ELQGV WKH SUHFXUVRU 51$ DQG IDFLOLWDWHV IRUPDWLRQ RI WKH FDWDO\WLF 51$ VWUXFWXUH 7KHVH UHJLRQV RYHUODS ZLWK WKH VWUHWFKHV UHTXLUHG IRU V\QWKHWDVH DFWLYLW\ EXW DUH QRW LGHQWLFDO WR WKHP +RZHYHU WKH SULQFLSDO 51$ ELQGLQJ UHJLRQV LQFOXGH D VPDOO LGLRV\QFUDWLF 1WHUPLQDO GRPDLQ VLJQLILFDQWO\ DEVHQW LQ EDFWHULDO W\URV\OW51$ V\QWKHWDVHV &KHUQLDFN HW DO f DQG D &WHUPLQDO W51$ELQGLQJ GRPDLQ UHTXLUHG IRU ERWK VSOLFLQJ DQG V\QWKHWDVH DFWLYLWLHV .LWWOH HW DO f $ FRPSDULVRQ RI &\W ELQGLQJ VLWHV LQ 1 FUDVVD PW /68 DQG 1' LQWURQV ZLWK WKDW LQ 1 FUDVVD PW W51$7!U KDV UHYHDOHG D UHPDUNDEOH WKUHHGLPHQVLRQDO RYHUODS EHWZHHQ WKH W51$ DQG WKH FDWDO\WLF FRUH RI JURXS LQWURQV VXJJHVWLQJ DQ HYROXWLRQDU\ UHODWLRQVKLS EHWZHHQ JURXS LQWURQV DQG W51$ DQG SHUKDSV WKH HYROXWLRQ RI 51$ VSOLFLQJ IDFWRUV IURP FHOOXODU 51$ELQGLQJ SURWHLQV &DSUDUD HW DO f $GDSWDWLRQ RI D V\QWKHWDVH WR IDFLOLWDWH JURXS LQWURQ VSOLFLQJ DSSHDUV WR EH D UHODWLYHO\ UHFHQW HYROXWLRQDU\ LPSURYHPHQW DV LW KDV EHHQ UHSRUWHG LQ RQO\ RQH RWKHU FORVHO\ UHODWHG IXQJXV 3RGRVSRUD DQVHULQD &KHUQLDFN HW DO /DPERZLW] DQG 3HUOPDQ DQG .DPSHU HW DO f

PAGE 62

&ES SURWHLQ GRHV QRW SRVVHVV DQ\ VHTXHQFH KRPRORJ\ ZLWK &\W RI 1 FUDVVD RU
PAGE 63

&+$37(5 087$7,21$/ $1$/<6,6 2) 7+( 17(50,186 2) &%3 ,QWURGXFWLRQ 89FURVVOLQNLQJ VWXGLHV &KDSWHU f VKRZ WKDW WKH 1 DQG &WHUPLQL RI &ES LQWLPDWHO\ FRQWDFW LQWURQ 51$ 1RZ WKH FKDOOHQJH LV WR LGHQWLI\ ZKLFK DPLQR DFLGV LQ WKHVH UHJLRQV DUH LPSRUWDQW IRU &ES IXQFWLRQ 8QOLNH PRVW RWKHU 51$ ELQGLQJ SURWHLQV &ES GRHV QRW FRQWDLQ DQ\ ZHOOFKDUDFWHUL]HG 51$ ELQGLQJ PRWLIV OLNH WKH 5** ER[ 513 RU .+ PRWLI %XUG DQG 'UH\IXVV f +RZHYHU &ES LV ULFK LQ EDVLF DQG K\GURSKRELF DPLQR DFLGV ZKLFK LV DOVR D FKDUDFWHULVWLF RI GRXEOH VWUDQGHG 51$ELQGLQJ SURWHLQV 6W -RKQVWRQ HW DO *DWLJQRO HW DO f 7KH RQO\ SURWHLQ ZLWK ZKLFK &ES GLVSOD\V DQ\ KRPRORJ\ LV LWV FRXQWHUSDUW LQ 6 GRXJODVLL /L HW DO f +RZHYHU WKH H[WUHPHO\ KLJK LGHQWLW\ bf EHWZHHQ WKH WZR KRPRORJV GRHV QRW OHQG LWVHOI WR WKH LGHQWLILFDWLRQ RI SRWHQWLDO 51$ ELQGLQJ GRPDLQV E\ VHTXHQFH DOLJQPHQWV 7KHUHIRUH WKH RQO\ YLDEOH DOWHUQDWLYH LV WR LGHQWLI\ WKH LPSRUWDQW UHVLGXHV E\ ELRFKHPLFDO RU JHQHWLF PHWKRGV 7KH ORZ FURVVOLQNLQJ HIILFLHQFLHV REWDLQHG LQ RXU V\VWHP UXOHG RXW WKH XVH RI ELRFKHPLFDO PHWKRGV VXFK DV DQLRQH[FKDQJH +3/& RU PDVV VSHFWURPHWU\ WR LGHQWLI\ WKH FULWLFDO UHVLGXHV 7KHUHIRUH VLWHGLUHFWHG PXWDJHQHVLV ZDV XVHG WR LGHQWLI\ FULWLFDO UHVLGXHV IRU &ES IXQFWLRQ

PAGE 64

6LWHGLUHFWHG PXWDJHQHVLV LV D SRZHUIXO WRRO WR VWXG\ WKH VWUXFWXUHIXQFWLRQ UHODWLRQVKLS RI VLQJOH RU FRPELQDWLRQV RI DPLQR DFLG UHVLGXHV LQ SURWHLQV ,W KDV EHHQ FODVVLFDOO\ XVHG LQ SURELQJ YDULRXV 51$SURWHLQ LQWHUDFWLRQV 2QH RI WKH PDQ\ DSSOLFDWLRQV RI WKLV WHFKQLTXH KDV EHHQ WR GLVVHFW WKH LQGLYLGXDO IXQFWLRQV RI YDULRXV DPLQR DFLGV LQ GXDOIXQFWLRQ SURWHLQV )RU LQVWDQFH WKH 06 5f EDFWHULRSKDJH FRDW SURWHLQ ZKLFK ELQGV DQG HQFDSVLGDWHV YLUDO 51$ DOVR DFWV DV D WUDQVODWLRQDO UHSUHVVRU RI YLUDO UHSOLFDVH E\ ELQGLQJ WR DQ 51$ KDLUSLQ LQ WKH 51$ JHQRPH /H&X\HU HW DO /H&X\HU HW DO f VXFFHVVIXOO\ VWXGLHG WKH 51$ ELQGLQJ SURSHUWLHV RI 06 FRDW SURWHLQ LQGHSHQGHQW RI FDSVLG DVVHPEO\ E\ LVRODWLQJ D 9DO*OX $OD*O\ GRXEOHPXWDQW FRDW SURWHLQ ZKLFK KDG ZLOGW\SHn OLNH DIILQLW\ DQG VSHFLILFLW\ IRU 51$ EXW ZDV GHIHFWLYH LQ FDSVLG DVVHPEO\ 6LWHGLUHFWHG PXWDJHQHVLV KDV DOVR EHHQ HPSOR\HG WR VWXG\ WKH HYROXWLRQDU\ UHODWLRQVKLSV RI 51$ELQGLQJ SURWHLQV LQ YDULRXV VSHFLHV )RU H[DPSOH WKH VHFRQG LQWURQ ELf RI F\W E JHQH KDV WZR KRPRORJV LQ UHODWHG 6DFFKDURP\FHV VSHFLHV WKDW GLIIHU LQ WKHLU PRELOLW\ 7KH 6 FDSHQVLV LQWURQ SURGXFW LV ELIXQFWLRQDO ZLWK ERWK D '1$ HQGRQXFOHDVH DQG DQ 51$ PDWXUDVH IXQFWLRQ /D]RZVND HW DO 6]F]HSDQHN DQG /D]RZVND f ZKHUHDV WKH KRPRORJRXV 6 FHUHYLVLDH LQWURQ SURGXFW KDV RQO\ DQ 51$ PDWXUDVH IXQFWLRQ DQG LV QRW PRELOH 0HXQLHU HW DO /D]RZVND HW DO f 7KHVH WZR LQWURQHQFRGHG SURWHLQV GLIIHU E\ RQO\ IRXU DPLQR DFLG VXEVWLWXWLRQV 0XWDWLRQDO DQDO\VLV VKRZHG WKDW UHSODFHPHQW RI WZR QRQDGMDFHQW DPLQR DFLGV 7KU$OD 7KU+LVf LQ WKH 6 FHUHYLVLDH PDWXUDVH ZDV QHFHVVDU\ DQG VXIILFLHQW IRU WKH DFTXLVLWLRQ RI DQ HQGRQXFOHDVH DFWLYLW\

PAGE 65

SURPRWLQJ LQWURQ PRELOLW\ 6]F]HSDQHN DQG /D]RZVND f 7KXV WKH 6 FDSHQVLV SURWHLQ FRXOG EH FRQVLGHUHG PRUH SULPLWLYH LQ WHUPV RI PLWRFKRQGULDO JURXS LQWURQHQFRGHG SURWHLQ HYROXWLRQ DV WKH WZR DFWLYLWLHV KDYH QRW \HW GLYHUJHG 7KH 6 FHUHYLVLDH SURWHLQ RQ WKH RWKHU KDQG ORVW WKH RULJLQDO IXQFWLRQ LQWURQ PRELOLW\f DQG PDLQWDLQHG WKH DFTXLUHG RQH 51$ PDWXUDVH IXQFWLRQf GXULQJ HYROXWLRQ 6LWHGLUHFWHG PXWDJHQHVLV KDV EHHQ LQVWUXPHQWDO LQ GHOLQHDWLQJ QRYHO 51$ ELQGLQJ PRWLIV RI SURWHLQV ZLWK OLWWOH RU QR VHTXHQFH KRPRORJ\ WR NQRZQ 51$ ELQGLQJ FRQVHQVXV VHTXHQFHV 7KH YLUDO FRDW SURWHLQV RI WKH SODQW YLUXVHV DOIDOID PRVDLF YLUXV $09f DQG WREDFFR VWUHDN YLUXV 769f VKDUH OLWWOH SULPDU\ DPLQR DFLG VHTXHQFH LGHQWLW\ YDQ 9ORWHQ'RWLQJ 5HXVNHQ HW DO f EXW DUH IXQFWLRQDOO\ LQWHUFKDQJHDEOH LQ 51$ ELQGLQJ =XLGHPD DQG -DVSDUV f DQG LQLWLDWLRQ RI LQIHFWLRQ *RQVDOYHV DQG *DPVH\ f 7KH O\VLQHULFK 1WHUPLQDO 51$ ELQGLQJ GRPDLQ RI WKH $09 FRDW SURWHLQ ODFNV SUHYLRXVO\ LGHQWLILHG 51$ ELQGLQJ PRWLIV 0XWDWLRQDO DQDO\VLV RI WKLV 1WHUPLQDO UHJLRQ LGHQWLILHG D VLQJOH DUJLQLQH ZKRVH VSHFLILF VLGH FKDLQ DQG SRVLWLRQ ZHUH FUXFLDO IRU 51$ ELQGLQJ $QVHO 0F.LQQH\ HW DO f &RQVHTXHQWO\ SURWHLQ VHTXHQFH DOLJQPHQWV EHWZHHQ $09 769 DQG RWKHU UHODWHG YLUXVHV FHQWHUHG RQ WKLV NH\ DUJLQLQH UHVLGXH UHYHDOHG D QHZ 51$ ELQGLQJ FRQVHQVXV VHTXHQFH 7KLV DOVR H[SODLQHG LQ SDUW ZK\ KHWHURORJRXV YLUDO 51$FRDW SURWHLQ PL[WXUHV ZHUH LQIHFWLRXV ,Q WKH FDVH RI &ES ZH HPSOR\HG VLWHGLUHFWHG PXWDJHQHVLV WR LGHQWLI\ WKH LPSRUWDQW UHVLGXHV E\ HLWKHU SDUWLDO RU FRPSOHWH ORVV RI &ES IXQFWLRQf LQ WKH 1

PAGE 66

WHUPLQXV WKDW FURVVOLQNHG WR LQWURQ 51$ 7KH &WHUPLQDO UHJLRQ WKDW VWURQJO\ FURVVOLQNHG WR 51$ ZDV QRW SXUVXHG IXUWKHU DV DWWHPSWV WR QDUURZ GRZQ WKLV UHJLRQ E\ GRXEOH GLJHVWLRQ RI FURVVOLQNHG FRPSOH[HV ZLWK 1+2+ IROORZHG E\ F\DQRJHQ EURPLGH ZHUH QRW IHDVLEOH ZLWKLQ WKH UHVROXWLRQ RI RXU JHO V\VWHP ,Q RUGHU WR LGHQWLI\ WDUJHWV IRU VLWHGLUHFWHG PXWDJHQHVLV RI &ES WKH SXWDWLYH 1WHUPLQDO 51$ FRQWDFW VLWH RQ &ES VSDQQLQJ UHVLGXHVf ZDV VFDQQHG FORVHO\ WR DOORZ WKH SUHGLFWLRQ RI UHVLGXHV WKDW PLJKW EH LPSRUWDQW LQ 51$SURWHLQ LQWHUDFWLRQV 7KLV VHTXHQFH DDO 6665<5<.)10( DD KDV WKH IROORZLQJ LQWHUHVWLQJ IHDWXUHV D &KDUJHG UHVLGXHV DOWHUQDWH ZLWK DURPDWLF UHVLGXHV E 3RODU UHVLGXHV IODQN WKH UHJLRQ RI DOWHUQDWLQJ FKDUJHG DQG DURPDWLF UHVLGXHV :KLOH WKH FKDUJHV FRXOG SURPRWH LRQLF LQWHUDFWLRQV EHWZHHQ SURWHLQ DQG 51$ WKH DURPDWLF UHVLGXHV FRXOG HQJDJH LQ VWDFNLQJ LQWHUDFWLRQV 7KH VWUHWFK RI VHULQHV FRXOG SDUWLFLSDWH LQ K\GURJHQ ERQGLQJ LQWHUDFWLRQV 7KHVH YDULRXV SRVVLELOLWLHV OHG XV WR WDUJHW WKLV 1WHUPLQDO UHJLRQ DDODDf IRU VLWHGLUHFWHG PXWDJHQHVLV 7KH GHWDLOV RI WKH DQDO\VHV RI DOO WKHVH PXWDQWV DQG D GLVFXVVLRQ RI WKHLU LPSOLFDWLRQV DUH GHVFULEHG LQ WKH IROORZLQJ VHFWLRQV 5HVXOWV $OO PXWDQW KLVWDJJHG &ES SURWHLQV 7DEOH f ZHUH SXULILHG E\ RQHVWHS PHWDO DIILQLW\ FKURPDWRJUDSK\ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH VHULQH GHOHWLRQ PXWDQW DQG WKH
PAGE 67

7DEOH 'HVFULSWLRQ RI &ES PXWDQWV 1DPH RI 0XWDQW 0XWDQW 'HVFULSWLRQ 'HOHWLRQ PXWDQW 'HOHWLRQ RI DDODD 7ULSOH DURPDWLF PXWDQW &KDQJHV
PAGE 68

IRUPHU HOXWHG LQ WKH ZDVK IUDFWLRQV ZLWK RWKHU (FROL SURWHLQV ZKLOH WKH ODWWHU FRn SXULILHG ZLWK D QXFOHDVH DFWLYLW\ DQG FRXOG QRW EH DVVD\HG 7KH VHULQH GHOHWLRQ DSSHDUV WR KDYH DOWHUHG WKH JOREDO FRQIRUPDWLRQ RI &ES SHUKDSV WKH WRSRORJ\ RI WKH KLVWLGLQH WDJf UHVXOWLQJ LQ SRRU ELQGLQJ WR WKH QLFNHO FROXPQ ,QGHSHQGHQW DWWHPSWV WR SXULI\ WKH
PAGE 69

)LJXUH :HVWHUQ DQDO\VLV RI &ES PXWDQWV 0XWDQW DQG ZLOGW\SH &ES SURWHLQV ZHUH UHVROYHG RQ b 6'6 SRO\DFU\ODPLGH JHOV HOHFWUREORWWHG WR QLWURFHOOXORVH PHPEUDQHV SUREHG ZLWK &ESVSHFLILF SRO\FORQDO DQWLERG\ DQG EDQGV GHWHFWHG XVLQJ (&/ FKHPLOXPLVFHQFH NLW $PHUVKDPf 3DQHO $ /DQH WULSOH DURPDWLF PXWDQW ODQH GHOHWLRQ DDO DDf PXWDQW ODQH ZLOGW\SH &ES 3DQHO % /DQH ZLOGW\SH &ES ODQH WULSOH FKDUJHG PXWDQW ODQH )/ ODQH
PAGE 70

2 r 7ULSOH DURPDWLF 5/5/./f .f 'HOHWLRQ f Z :W .f : HQ FG /
PAGE 71

51$ WUDQVFULSWV ZHUH LQFXEDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI ZLOGW\SH RU PXWDQW &ES SURWHLQV XQGHU ORZ VDOW VSOLFLQJ FRQGLWLRQV 7KH UHDFWLRQ SURGXFWV ZHUH VHSDUDWHG RQ b SRO\DFU\ODPLGH0 XUHD JHOV DQG DXWRUDGLRJUDSKHG )LJXUH f ,QFUHDVLQJ FRQFHQWUDWLRQV RI GHOHWLRQ PXWDQW DDODDf ODQHV DQG f DQG WULSOH DURPDWLF PXWDQW ODQHV DQG f IDLOHG WR VWLPXODWH VSOLFLQJ RI LQWURQ 51$ ZKLOH ZLOGW\SH &ES VSOLFHG QRUPDOO\ DW ERWK FRQFHQWUDWLRQV WHVWHG ODQHV DQG f 7KHVH UHVXOWV VWURQJO\ VXJJHVW WKDW WKH 1WHUPLQDO UHVLGXHV DDODDf PD\ FRPSULVH DQ LPSRUWDQW 51$ ELQGLQJ GRPDLQ HVVHQWLDO IRU &ES IXQFWLRQ +RZHYHU LW LV LPSRUWDQW WR GHPRQVWUDWH WKDW WKH ORVV RI DFWLYLW\ REVHUYHG ZDV QRW GXH WR VWUXFWXUDO GHVWDELOL]DWLRQ FDXVHG E\ WKHVH PXWDWLRQV 3DUWLDO SURWHRO\VLV LV D XVHIXO WHFKQLTXH WR DQDO\]H WKH FRQIRUPDWLRQDO VWDWHV RI SURWHLQV &KDQJ DQG 'RL +D\ DQG 1LFKROVRQ 3HWHUVHQ HW DO ,NHGD HW DO /LX HW DO f ,Q WKLV DVVD\ GHOHWLRQ DQG WULSOH DURPDWLF PXWDQW SURWHLQV LQ QDWLYH VWDWHVf ZHUH LQFXEDWHG VHSDUDWHO\ ZLWK WU\SVLQ XQGHU FRQGLWLRQV WKDW IDYRUHG SDUWLDO SURWHRO\VLV DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV $ FRQWURO GLJHVW ZLWK QDWLYH RU KHDWGHQDWXUHG ZLOGW\SH &ES ZDV DOVR GRQH 7KH SHSWLGHV ZHUH UHVROYHG RQ b 6'63$*( JHOV DQG GHWHFWHG E\ :HVWHUQ EORWWLQJ ZLWK D &ESVSHFLILF SRO\FORQDO DQWLERG\ )LJXUH f 7KH WU\SWLF SHSWLGH SURILOHV RI QDWLYH GHOHWLRQ ODQHV DQG SDQHO $f DQG WULSOH DURPDWLF ODQHV DQG SDQHO %f PXWDQWV FORVHO\ UHVHPEOHG WKH SDWWHUQ REWDLQHG ZLWK QDWLYH ZLOGW\SH &ES ODQHV DQG RI ERWK SDQHOVf ,Q FRQWUDVW KHDWWUHDWHG ZLOGW\SH VDPSOHV ODQHV DQG RI ERWK SDQHOVf H[KLELWHG D GLIIHUHQW SDWWHUQ VKRZLQJ DJJUHJDWLRQ RI

PAGE 72

)LJXUH )XQFWLRQDO DQDO\VLV RI GHOHWLRQ DDODDf DQG WULSOH DURPDWLF PXWDQWV M3ODEHOHG LQWURQ 51$ ZDV LQFXEDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI ZLOGW\SH DQG PXWDQW &ES XQGHU ORZ VDOW VSOLFLQJ FRQGLWLRQV DW r& IRU KRXU HWKDQRO SUHFLSLWDWHG UHVROYHG RQ D b SRO\DFU\ODPLGH0 XUHD JHO DQG DXWRUDGLRJUDSKHG 7KH SUHFXUVRU 51$ DQG WKH SURGXFWV RI VSOLFLQJ DUH VFKHPDWLFDOO\ UHSUHVHQWHG RQ WKH OHIW VLGH RI WKH JHO ZLWK WKH UDWLR RI SURWHLQ WR 51$ VKRZQ RQ WRS RI WKH ODQHV /DQH SUHFXUVRU 51$ DORQH ODQHV DQG LQFXEDWLRQ ZLWK ZLOGW\SH &ES ODQHV DQG LQFXEDWLRQ ZLWK GHOHWLRQ DDO DDf ODQHV DQG LQFXEDWLRQ ZLWK WULSOH DURPDWLF PXWDQW < < ) WR /f

PAGE 73

12, / LL LL YL :W 'HOHWLRQ DDODDf 7ULSOH DURPDWLF 5/5/./f

PAGE 74

)LJXUH 3DUWLDO SURWHRO\WLF SURILOHV RI GHOHWLRQ DDOf DQG WULSOH DURPDWLF PXWDQWV 1DWLYH RU KHDW GHQDWXUHG ZLOGW\SH DQG QDWLYH PXWDQW SURWHLQV ZHUH GLJHVWHG ZLWK WU\SVLQ XQGHU FRQGLWLRQV DOORZLQJ RQO\ SDUWLDO GLJHVWLRQ UHVROYHG RQ b 6'6SRO\DFU\ODPLGH JHOV DQG :HVWHUQ EORWWHG ZLWK &ESVSHFLILF SRO\FORQDO DQWLERG\ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 3DQHO $ /DQHV DQG KHDWGHQDWXUHG ZLOGW\SH &ES ODQHV DQG GHOHWLRQ PXWDQW ODQHV DQG QDWLYH ZLOGW\SH 3DQHO % /DQHV DQG KHDWGHQDWXUHG ZLOGW\SH &ES ODQHV DQG WULSOH DURPDWLF PXWDQW ODQHV DQG QDWLYH ZLOGW\SH 7KH GXSOLFDWH ODQHV IRU HDFK SURWHLQ LQ ERWK SDQHOV UHIHU WR WKH UDWLR RI WU\SVLQ WR &ES ZZf DV LQGLFDWHG DERYH WKH ODQHV

PAGE 75

1L 8! A &21 +HDWGHQDWXUHG B ZW &ES 'HOHWLRQ B DDODDf f :W &ES + : 6n 4 FU 7 1RG ? KN ? ? +HDWGHQDWXUHG 1f ? } B ZW &ES & L_ 7ULSOH DURPDWLF L B 5/5/./f 0 L L 2, M IO Lc L :W &ES 2V 9 I 

PAGE 76

GHQDWXUHG SURWHLQ DW WKH WRS RI WKH JHO ,Q DGGLWLRQ SDUWLDO SURGXFWV FRUUHVSRQGLQJ WR WKRVH REWDLQHG ZLWK QDWLYH SURWHLQV ZHUH PDUNHGO\ DEVHQW LQ WKHVH GLJHVWV 7KLV LV SUREDEO\ GXH WR FRPSOHWH GHJUDGDWLRQ RI GHQDWXUHG SURWHLQ PROHFXOHV WKDW ZHUH QRW SUHVHQW LQ DJJUHJDWHV 7KXV WKHVH UHVXOWV GHPRQVWUDWH WKDW WKH PXWDWLRQV LQ &ES GLG QRW DOWHU WKH JOREDO FRQIRUPDWLRQ RI WKHVH SURWHLQV 3UHOLPLQDU\ VSOLFLQJ H[SHULPHQWV ZLWK WULSOH FKDUJHG PXWDQW 5 5 FKDQJHG WR OHXFLQHf DQG WZR SRLQW PXWDQWV QDPHO\
PAGE 77

)LJXUH 7LPH FRXUVH RI VSOLFLQJ IRU ZLOGW\SH DQG PXWDQW &ES 5DGLRODEHOHG LQWURQ 51$ ZDV LQFXEDWHG ZLWK ZLOGW\SH RU PXWDQW &ES SURWHLQV XQGHU ORZ VDOW VSOLFLQJ FRQGLWLRQV 5HDFWLRQV ZHUH WHUPLQDWHG DW LQGLFDWHG WLPHV UHVROYHG RQ b SRO\DFU\ODPLGH0 XUHD JHOV DQG DXWRUDGLRJUDSKHG $ VFKHPDWLF UHSUHVHQWDWLRQ RI WKH SUHFXUVRU 51$ DQG VSOLFHG SURGXFWV DUH JLYHQ RQ WKH OHIW VLGH RI WKH ILJXUHV $ 6KRZV WKH VSOLFLQJ WLPH FRXUVH IRU WKH ZLOGW\SH &ES OHIW SDQHOf DQG )/ PXWDQW ULJKW SDQHOf % 6KRZV WKH VSOLFLQJ WLPH FRXUVH IRU WKH WULSOH FKDUJHG PXWDQW OHIW SDQHOf DQG WKH
PAGE 78

$ :W &ES )/ 7LPH PLQf

PAGE 79

7ULSOH FKDUJHG PXWDQW 2
PAGE 80

)LJXUH 6SOLFLQJ UDWHV RI ZLOGW\SH DQG PXWDQW &ES 7KH JHOV VKRZQ LQ )LJXUH ZHUH TXDQWLWDWHG XVLQJ 3KRVSKRUOPDJHU DQG WKH 51$ IUDFWLRQ VSOLFHG FDOFXODWHG DV WKH UDWLR RI WKH VXP RI OLJDWHG H[RQV DQG IUHH f H[RQ WR WKH H[RQ VHTXHQFHV SUHVHQW LQ WKH SUHFXUVRU 51$ 7KH SORWV VKRZ 51$ IUDFWLRQ VSOLFHG 6'f YV WLPH LQ PLQ $ )LOOHG FLUFOHV :W &ES RSHQ FLUFOHV )/ PXWDQW ILOOHG VTXDUHV 7ULSOH FKDUJHG /
PAGE 81

51$ IUDFWLRQ VSOLFHG $ 7LPH PLQf

PAGE 82

51$ IUDFWLRQ VSOLFHG % )LJXUH FRQWLQXHG

PAGE 83

PXWDQWV $ TXDQWLWDWLYH UHSUHVHQWDWLRQ RI VSOLFLQJ IRU WKH ZLOGW\SH DQG PXWDQW SURWHLQV LV VKRZQ LQ )LJXUH $ $ UHSORW RI WKH GDWD FRUUHVSRQGLQJ WR WULSOH FKDUJHG DQG
PAGE 84

7DEOH 5DWH PHDVXUHPHQWV IRU ZLOG W\SH DQG PXWDQW &ES &ES SURWHLQ 51$ IUDFWLRQ VSOLFHG DW PLQXWHV ,QLWLDO UDWH RI VSOLFLQJ IUDFWLRQ PLQf :LOGW\SH )/ s /
PAGE 85

)LJXUH 'RXEOH ILOWHUELQGLQJ DVVD\ RI ZLOGW\SH DQG PXWDQW &ES $ 5DGLRODEHOHG 51$ ZDV LQFXEDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI ZLOGW\SH DQG PXWDQW SURWHLQV XQGHU ORZ VDOW VSOLFLQJ FRQGLWLRQV ZLWKRXW *73f DW r& IRU PLQ (TXDO DOLTXRWV RI HDFK UHDFWLRQ ZHUH ILOWHUHG LQ GXSOLFDWH WKURXJK D VDQGZLFK FRQVLVWLQJ RI QLWURFHOOXORVH RQ WRS DQG FKDUJHG Q\ORQ DW WKH ERWWRP DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 51$ELQGLQJ SDWWHUQV IRU WKH WULSOH FKDUJHG DQG )/ PXWDQWV DQG ZLOGW\SH &ES RQ QLWURFHOOXORVH OHIW SDQHOf DQG Q\ORQ ULJKW SDQHOf DUH VKRZQ % 7KH GRW EORWV VKRZQ LQ $ ZHUH TXDQWLWDWHG XVLQJ 3KRVSKRUOPDJHU DQG WKH IUDFWLRQ 51$ ERXQG FDOFXODWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH IUDFWLRQ RI 51$ ERXQG LV SORWWHG DV D IXQFWLRQ RI &ES FRQFHQWUDWLRQ 2SHQ VTXDUHV
PAGE 86

$ 1LWURFHOOXORVH 1\ORQ 1 >&ES@f§ 7ULSOH FKDUJHG )/ PXWDQW RR :W &ES

PAGE 87

% &ES S0f M 92 )LJXUH FRQWLQXHG

PAGE 88

QLWURFHOOXORVH PHPEUDQH ZKLFK FRQWDLQV SURWHLQ51$ FRPSOH[HV OHIW SDQHOf VKRZHG DQ LQFUHDVH LQ WKH ERXQG 51$ IUDFWLRQ ZLWK LQFUHDVLQJ &ES FRQFHQWUDWLRQV ZKLOH WKH Q\ORQ PHPEUDQH ZKLFK FRQWDLQV IUHH 51$ ULJKW SDQHOf VKRZHG D FRUUHVSRQGLQJ GHFUHDVH LQ WKH IUHH 51$ UHWDLQHG (DFK ILOWHU ELQGLQJ H[SHULPHQW LQ GXSOLFDWHf ZDV UHSHDWHG DW OHDVW WZR WLPHV DQG WKH 51$ ELQGLQJ GDWD )LJXUH %f XVHG WR FDOFXODWH GLVVRFLDWLRQ FRQVWDQWV NGf 7DEOH f 7KH )/ PXWDQW RSHQ WULDQJOHVf ZKLFK VKRZHG ZLOGW\SHOLNH VSOLFLQJ DFWLYLW\ GHPRQVWUDWHG 51$ ELQGLQJ OHYHOV FRPSDUDEOH WR WKDW RI ZLOGW\SH ILOOHG WULDQJOHVf 7KH NG YDOXHV RI ZLOGW\SH SURWHLQ DQG )/ PXWDQW ZHUH YHU\ VLPLODU S0 DQG S0 UHVSHFWLYHO\f 7KH WULSOH FKDUJHG ILOOHG VTXDUHVf DQG WKH
PAGE 89

7DEOH 'LVVRFLDWLRQ FRQVWDQWV RI &ES PXWDQWV &ES SURWHLQ NG 30f 'HOHWLRQ DDODDf :LOG W\SH &ES )/ PXWDQW 7ULSOH DURPDWLF PXWDQW
PAGE 90

6LQFH WKH SXWDWLYH FRQWDFW VLWHV LQ &ES ZHUH LQLWLDOO\ LGHQWLILHG E\ 89 FURVVOLQNLQJ WKH PXWDQWV ZHUH WHVWHG IRU WKHLU DELOLW\ WR FURVVOLQN WR LQWURQ 51$ 3 ODEHOHG 51$ WUDQVFULSWV ZHUH 89FURVVOLQNHG WR ZLOG W\SH RU PXWDQW &ES SURWHLQ 51$DVH WUHDWHG DQG UHVROYHG RQ b 6'6SRO\DFU\ODPLGH JHOV 7KH FURVVOLQNHG FRPSOH[HV ZHUH GHWHFWHG E\ DXWRUDGLRJUDSK\ )LJXUH f DQG TXDQWLWDWHG XVLQJ 3KRVSKRUOPDJHU 51$ FURVVOLQNHG LQ WKH DEVHQFH RI SURWHLQ ODQH f ZDV DOPRVW FRPSOHWHO\ GHJUDGHG ZLWKRXW DQ\ GHWHFWDEOH FRPSOH[HV +RZHYHU 51$ FURVVOLQNHG WR ZLOG W\SH &ES ODQH f VKRZHG D SURPLQHQW FURVVOLQNHG VSHFLHV FRUUHVSRQGLQJ WR WKH PROHFXODU ZHLJKW RI &ES &URVVOLQNLQJ WR WULSOH FKDUJHG ODQH f DQG )/ ODQH f PXWDQW SURWHLQV ZDV UHGXFHG E\ b DQG b UHVSHFWLYHO\ FRPSDUHG WR ZLOG W\SH 7KH
PAGE 91

)LJXUH 89FURVVOLQNLQJ RI ZLOGW\SH DQG PXWDQW &ES WR LQWURQ 51$ :LOGW\SH RU PXWDQW &ES ZDV LQFXEDWHG ZLWK UDGLRODEHOHG LQWURQ 51$ XQGHU ORZ VDOW FRQGLWLRQV LQ WKH SUHVHQFH RI XJPO W51$ 7KH VDPSOHV ZHUH WKHQ 89 FURVVOLQNHG DW PH[WHQVLYHO\ 51$DVH WUHDWHG UHVROYHG RQ b 6'63$*( JHOV DQG DXWRUDGLRJUDSKHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV /DQH )/ PXWDQW ODQH
PAGE 92

)/
PAGE 93

ZLOGW\SH WKH\ ZHUH WHVWHG IRU WKHLU DELOLW\ WR FRPSHWH ZLWK ZLOGW\SH &ES LQ VSOLFLQJ DVVD\V 6SOLFLQJ UHDFWLRQV ZHUH VHW XS DW ZLOGW\SH &ES WR LQWURQ 51$ UDWLR RI LQ WKH SUHVHQFH RI LQFUHDVLQJ FRQFHQWUDWLRQV RI PXWDQW SURWHLQV 5HDFWLRQ SURGXFWV ZHUH UHVROYHG RQ GHQDWXULQJ JHOV DQG DXWRUDGLRJUDSKHG )LJXUH $f :LOGW\SH &ES DORQH ODQH f VSOLFHG QRUPDOO\ ZKLOH WKH GHOHWLRQ ODQH f RU WULSOH DURPDWLF ODQH f PXWDQW DORQH ZDV FRPSOHWHO\ GHIHFWLYH LQ VSOLFLQJ DFWLYLW\ DV UHSRUWHG EHIRUH $GGLWLRQ RI LQFUHDVLQJ FRQFHQWUDWLRQV RI GHOHWLRQ ODQHV WR f RU WULSOH DURPDWLF ODQHV WR f PXWDQW SURWHLQ WR ZLOGW\SH &ES PHGLDWHG UHDFWLRQV VKRZHG D SURJUHVVLYH LQKLELWLRQ RI VSOLFLQJ FRPSDUH ODQH ZLWK ODQHV WR DQG WR f 7KHVH UHVXOWV DUH TXDQWLWDWLYHO\ UHSUHVHQWHG LQ )LJXUH % 7KH JUDSKV VKRZ SHUFHQWDJH VSOLFLQJ DV D IXQFWLRQ RI PXWDQWZLOG W\SH UDWLRV ZLWK WKH H[WHQW RI VSOLFLQJ REWDLQHG LQ WKH SUHVHQFH RI ZLOGW\SH &ES DORQH VHW WR b 5HVXOWV RI WKH DGGLWLRQ RI GHOHWLRQ DQG WULSOH DURPDWLF PXWDQWV DUH VKRZQ LQ WKH OHIW DQG ULJKW SDQHOV UHVSHFWLYHO\ $GGLWLRQ RI D IROG H[FHVV RI GHOHWLRQ PXWDQW ORZHUHG VSOLFLQJ OHYHOV WR b RI FRQWURO OHYHOV $ VLPLODU LQKLELWLRQ RI VSOLFLQJ ZDV REVHUYHG ZLWK WULSOH DURPDWLF PXWDQW DOWKRXJK DW D KLJKHU UDWLR f RI PXWDQW WR ZLOGW\SH &ES 7KXV &ES PXWDQWV LQKLELWHG WKH SURWHLQPHGLDWHG VSOLFLQJ RI LQWURQ 51$ ZKHQ SUHVHQW LQ H[FHVV RYHU WKH ZLOG W\SH SURWHLQ ,W LV LPSRUWDQW WR QRWH WKDW DW WKH KLJKHVW OHYHO RI VSOLFLQJ LQKLELWLRQ )LJXUH %f WRWDO SURWHLQ PXWDQW ZLOGW\SHf WR 51$ UDWLR ZDV IRU WKH GHOHWLRQ PXWDQW DQG IRU WKH WULSOH DURPDWLF PXWDQW ,W LV WKHUHIRUH SRVVLEOH WKDW WKH

PAGE 94

)LJXUH (IIHFW RI PXWDQW SURWHLQV RQ ZLOGW\SH &ESPHGLDWHG VSOLFLQJ 6SOLFLQJ UHDFWLRQV ZHUH SHUIRUPHG DW ZLOGW\SH &ES51$ LQ WKH SUHVHQFH RI LQFUHDVLQJ FRQFHQWUDWLRQV RI GHOHWLRQ DDODDf RU WULSOH DURPDWLF PXWDQW SURWHLQV 5HDFWLRQV ZHUH UHVROYHG RQ b SRO\DFU\ODPLGH0 XUHD JHOV DQG DXWRUDGLRJUDSKHG $ /DQH ZLOGW\SH &ES DORQH ODQH GHOHWLRQ PXWDQW DDODDf DORQH ODQHV FRQVWDQW DPRXQW RI ZLOGW\SH LQFUHDVLQJ FRQFHQWUDWLRQV RI GHOHWLRQ PXWDQW SURWHLQV ODQH WULSOH DURPDWLF PXWDQW DORQH ODQHV FRQVWDQW DPRXQW RI ZLOGW\SH LQFUHDVLQJ FRQFHQWUDWLRQV RI WULSOH DURPDWLF PXWDQW SURWHLQV 7KH UDWLR RI PXWDQW WR ZLOGW\SH &ES LQ HDFK UHDFWLRQ LV LQGLFDWHG DERYH WKH ODQHV 7KH SUHFXUVRU 51$ DQG VSOLFHG SURGXFWV DUH VFKHPDWLFDOO\ UHSUHVHQWHG RQ WKH OHIW RI WKH JHO % 7KH VSOLFLQJ JHOV LQ $ ZHUH TXDQWLWDWHG XVLQJ 3KRVSKRUOPDJHU DQG WKH b VSOLFLQJ GHWHUPLQHG IURP OLJDWHG H[RQVf SORWWHG DV D IXQFWLRQ RI PXWDQWZLOG W\SH &ES VHWWLQJ WKH H[WHQW RI VSOLFLQJ ZLWK ZLOGW\SH &ES DORQH WR b 7KH OHIW DQG ULJKW SDQHOV VKRZ GDWD FRUUHVSRQGLQJ WR GHOHWLRQ DDDDf DQG WULSOH DURPDWLF PXWDQWV UHVSHFWLYHO\

PAGE 95

$ 2f 2 e 'HOHWLRQ DDDDf 92 U_+ R UL YM •“ 0XWDQW :W &ES R 7ULSOH DURPDWLF 5/5/./f

PAGE 96

% 'HOHWLRQ DDOf 7ULSOH DURPDWLF PXWDQW I rf rf rf f f f f rrf rf rrf ff rf rf rf f ‘ f / f frr frr rf fr f fr f f ff f rrf rrf rrf ff rr rf ff f ff f ‘ rr f f f U ff frr frr frr ff f f rn‘ rrf rrfn ff rf r f f \U$$UU f f f ‘ ‘f ‘ ff ? ‘f f rf f f r f r f f r f f f f f bf f f9f ‘ f ff ‘ fY f f f f ‘ ‘ ffff f ‘ ‘ f ‘ ‘ U f f f f f r f ? f r f r f f ‘ f ‘ f f ‘ ‘ f f ‘9 ‘ LL 9L f ‘ f f ff ‘ rf rrf rrf rf rf rrf rrf frr frr frr fnr f f rf rrf f rr‘ ff9f 9fr9fr ? 7 fff fn9fr9fr A A ‘ ‘‘f$LO ‘‘‘ 9 rrf fr fr rrf frrfrrfr fr f frrfrrfrrfnr f r f r f r f f f f f f f f f f f f r ‘ !9 f f rf rf f RR 0XWDQW :W&ES 0XWDQW :W&ES )LJXUH FRQWLQXHG

PAGE 97

LQKLELWLRQ REVHUYHG LQ WKLV H[SHULPHQW ZDV D IXQFWLRQ RI WRWDO SURWHLQ FRQFHQWUDWLRQ PXWDQW ZLOGW\SH &ESf UDWKHU WKDQ EHLQJ D SURSHUW\ RI PXWDQWV 7R WHVW WKLV SRVVLELOLW\ VSOLFLQJ ZDV SHUIRUPHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI ZLOGW\SH &ES DORQH )LJXUHV $ DQG %f 0D[LPXP VSOLFLQJ DFWLYLW\ ZDV REWDLQHG DW D SURWHLQ51$ UDWLR RI ODQH LQ )LJXUH $ H[SUHVVHG DV b DFWLYLW\ LQ )LJXUH %f +RZHYHU VSOLFLQJ ZDV VHYHUHO\ LQKLELWHG DW ODQH f DQG DOPRVW FRPSOHWHO\ LQKLELWHG DW KLJKHU UDWLRV ODQHV DQG f RI ZLOGW\SH &ES51$ 7KH VSOLFLQJ OHYHOV GURSSHG WR b IRU f DQG ab IRU DQG f RI WKH DFWLYLW\ REWDLQHG DW UDWLR )LJXUH %f 7KXV ZLOGW\SH &ES DSSHDUV WR VWLPXODWH VSOLFLQJ RQO\ LQ D QDUURZ UDQJH RI SURWHLQ51$ UDWLRV ZLWK KLJKHU OHYHOV EHLQJ LQKLELWRU\ ,Q RUGHU WR GHWHUPLQH ZKHWKHU DJJUHJDWLRQ ZDV WKH FDXVH IRU WKH REVHUYHG LQKLELWLRQ RI DFWLYLW\ WKHVH H[SHULPHQWV ZHUH UHSHDWHG RYHU D ZLGH UDQJH RI FRQFHQWUDWLRQV RI ZLOGW\SH &ES ,GHQWLFDO LQKLELWLRQ ZDV REVHUYHG ZKHWKHU WKH SURWHLQ ZDV WLWUDWHG DW ORZHU Q0f RU KLJKHU XS WR Q0f UDQJHV VXJJHVWLQJ WKDW DJJUHJDWLRQ RI SURWHLQ ZDV QRW D SUREOHP LQ WKHVH H[SHULPHQWV GDWD QRW VKRZQf ,W LV SRVVLEOH WKDW WKH REVHUYHG LQKLELWLRQ RI VSOLFLQJ DW KLJKHU FRQFHQWUDWLRQV RI ZLOGW\SH SURWHLQ FRXOG EH GXH WR QRQVSHFLILF LQWHUDFWLRQV RI &ES D KLJKO\ EDVLF SURWHLQf ZLWK LWV 51$ FRXQWHUSDUW 7KLV SRVVLELOLW\ ZDV WHVWHG XVLQJ WKH QRQn VSHFLILF FRPSHWLWRU W51$ LQ SDUWLDOO\ LQKLELWHG VSOLFLQJ UHDFWLRQV $ WLWUDWLRQ RI &ES FRQFHQWUDWLRQ LQ WKH DEVHQFH RI W51$ LV VKRZQ LQ )LJXUHV $ ODQHV WR f DQG % OHIW SDQHOf 7KH PD[LPDO VSOLFLQJ REVHUYHG DW UDWLR ODQH

PAGE 98

)LJXUH (IIHFW RI LQFUHDVLQJ FRQFHQWUDWLRQV RI ZLOGW\SH &ES RQ SURWHLQ PHGLDWHG VSOLFLQJ 5DGLRODEHOHG LQWURQ 51$ ZDV SUHLQFXEDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI ZLOGW\SH &ES IRU PLQ DW r& 6SOLFLQJ ZDV LQLWLDWHG E\ WKH DGGLWLRQ RI P0 *73 DQG LQFXEDWLRQ FRQWLQXHG DW r& IRU PLQ 6SOLFHG SURGXFWV ZHUH UHVROYHG RQ b SRO\DFW\ODPLGH0 XUHD JHOV DQG DXWRUDGLRJUDSKHG $ /DQH LQWURQ 51$ DORQH ODQH VSOLFLQJ DW SURWHLQ51$ RI ODQH ODQH ODQH ODQH ODQH DQG ODQH % 3KRVSKRUOPDJHU TXDQWLWDWLRQ RI WKH JHO VKRZQ LQ $ ZDV XVHG WR SORW WKH b VSOLFLQJ UDWLR RI WKH VXP RI OLJDWHG H[RQV DQG f H[RQ WR XQVSOLFHG SUHFXUVRUf DV D IXQFWLRQ RI ZLOG W\SH&ES WR 51$ UDWLRV VHWWLQJ WKH H[WHQW RI VSOLFLQJ REWDLQHG DW WR b

PAGE 99

' , , RR ( &ES 51$ O 0 1 f WL m A f

PAGE 100

% :W&ES51$ )LJXUH FRQWLQXHG

PAGE 101

)LJXUH (IIHFW RI W51$ DGGLWLRQ RQ ZLOGW\SH &ESPHGLDWHG VSOLFLQJ $ 5DGLRODEHOHG LQWURQ 51$ ZDV SUHn LQFXEDWHG ZLWK ZLOGW\SH &ES DW LQFUHDVLQJ SURWHLQ WR 51$ UDWLRV DV LQGLFDWHGf IRU PLQ DW r& LQ WKH DEVHQFH RI W51$ ODQHV f RU DW D SURWHLQ 51$ UDWLR RI LQ WKH SUHVHQFH RI LQFUHDVLQJ FRQFHQWUDWLRQV RI W51$ ODQHV f 6SOLFLQJ ZDV LQLWLDWHG ZLWK P0 *73 DQG LQFXEDWLRQ ZDV FRQWLQXHG DW r& IRU PLQ DIWHU ZKLFK VDPSOHV ZHUH UHVROYHG RQ b SRO\DFU\ODPLGH0 XUHD JHOV DQG DXWRUDGLRJUDSKHG /DQH 51$ DORQH ODQH VSOLFLQJ DW SURWHLQ WR 51$ UDWLR RI ODQH ODQH ODQH ODQH /DQHV VSOLFLQJ DW SURWHLQ51$ UDWLR LQ WKH DEVHQFH RI W51$ ODQH f RU LQ WKH SUHVHQFH RI W51$ DW PJPO ODQH f PJPO ODQH f PJPO ODQH f PJPO ODQH f PJPO ODQH f PJPO ODQH f % 4XDQWLWDWLRQ RI WKH JHO VKRZQ DERYH ZDV XVHG WR FDOFXODWH b VSOLFLQJ UDWLR RI VXP RI OLJDWHG H[RQV DQG f H[RQ WR XQVSOLFHG SUHFXUVRUf VHWWLQJ WKH H[WHQW RI VSOLFLQJ DW WR b 7KH b VSOLFLQJ LV SORWWHG DV D IXQFWLRQ RI ZLOG W\SH&ES51$ OHIW SDQHOf DQG W51$ FRQFHQWUDWLRQ WLWUDWHG DW SURWHLQ51$ UDWLR RI ULJKW SDQHOf

PAGE 102

$ &ES 51$ QR W51$f 1 LQ Â’ W51$ PJPOf DW &ES 51$ RI e

PAGE 103

b 6SOLFLQJ % :W&ES51$ W51$ PJPOf )LJXUH FRQWLQXHG

PAGE 104

)LJXUH $f RI &ES WR 51$ ZDV VHW WR b )LJXUH 2%f 6LPLODU WR WKH UHVXOWV UHSRUWHG DERYH )LJXUHV $ DQG %f D SURWHLQ51$ UDWLR RI ORZHUHG VSOLFLQJ WR ab RI WKDW DW ZLWK DOPRVW FRPSOHWH LQKLELWLRQ DW KLJKHU UDWLRV )LJXUH 2% OHIW SDQHOf $GGLWLRQ RI LQFUHDVLQJ FRQFHQWUDWLRQV RI W51$ WR VSOLFLQJ UHDFWLRQV FRQWDLQLQJ SURWHLQ51$ UDWLR RI SDUWLDOO\ LQKLELWHG UHDFWLRQVf UHVWRUHG VSOLFLQJ DFWLYLW\ WR WKH OHYHOV REWDLQHG DW UDWLR )LJXUH $ ODQHV ULJKW SDQHO LQ )LJXUH 2%f ,W LV LQWHUHVWLQJ WR QRWH WKDW WKH DGGLWLRQ RI MXVW XJPO W51$ UHVXOWHG LQ D PDUNHG UHVFXH RI VSOLFLQJ DFWLYLW\ 7KHVH UHVXOWV VXJJHVW WKDW W51$ RYHUFRPHV WKH LQKLELWLRQ RI VSOLFLQJ E\ UHGXFLQJ QRQVSHFLILF LQWHUDFWLRQV RI &ES DOORZLQJ WKH IRUPDWLRQ RI VSOLFLQJFRPSHWHQW SURWHLQ51$ FRPSOH[HV ,Q OLJKW RI WKH DERYH UHVXOWV WKH LQKLELWLRQ RI ZLOGW\SH &ESPHGLDWHG VSOLFLQJ E\ GHOHWLRQ DQG WULSOH DURPDWLF PXWDQWV ZDV UHH[DPLQHG XQGHU FRQGLWLRQV WKDW PLQLPL]H QRQVSHFLILF SURWHLQ51$ LQWHUDFWLRQV .HHSLQJ WKH ZLOGW\SH &ES51$ UDWLR DW WKH FRQFHQWUDWLRQV RI GHOHWLRQ DQG WULSOH DURPDWLF PXWDQW SURWHLQV ZHUH LQFUHDVHG VXFK WKDW WKH WRWDO SURWHLQ ZLOGW\SH PXWDQW &ESf WR 51$ UDWLRV GLG QRW H[FHHG )LJXUHV $f )LJXUH ,% VKRZV WKH VSOLFLQJ DFWLYLW\ XQGHU WKHVH FRQGLWLRQV DV D IXQFWLRQ RI PXWDQW WR ZLOGW\SH &ES UDWLRV 1HLWKHU PXWDQW LQKLELWHG ZLOGW\SH &ESPHGLDWHG VSOLFLQJ DW WKH PXWDQWZLOGW\SH &ES UDWLRV WHVWHG )LJXUH ,%f 7KHVH UHVXOWV FOHDUO\ VKRZ WKDW WKH LQKLELWLRQ RI VSOLFLQJ E\ KLJKHU FRQFHQWUDWLRQV RI &ES ZLOGW\SH RU PXWDQWf ZDV D IXQFWLRQ RI WRWDO SURWHLQ WR 51$ UDWLRV DQG QRW D FKDUDFWHULVWLF RI WKH PXWDQWV SHU VH

PAGE 105

)LJXUH (IIHFW RI PXWDQW SURWHLQV RQ ZLOGW\SH &ESPHGLDWHG VSOLFLQJ DW ORZ WRWDO SURWHLQ WR 51$ UDWLRV $ 5DGLRODEHOHG LQWURQ 51$ ZDV SUHn LQFXEDWHG IRU PLQ DW r& ZLWK D FRQVWDQW DPRXQW RI ZLOGW\SH &ES DQG LQFUHDVLQJ FRQFHQWUDWLRQV RI GHOHWLRQ DDODDf RU WULSOH DURPDWLF PXWDQWV VXFK WKDW WRWDO SURWHLQ WR 51$ UDWLRV GLG QRW H[FHHG WR 6SOLFLQJ ZDV LQLWLDWHG ZLWK P0 *73 SURGXFWV UHVROYHG RQ b SRO\DFU\ODPLG0 XUHD JHOV DQG DXWRUDGLRJUDSKHG $ 51$ DORQH ODQHV DQG f VSOLFLQJ LQ WKH SUHVHQFH RI ZLOG W\SH &ES DORQH ODQHV DQG f VSOLFLQJ LQ WKH SUHVHQFH RI D FRQVWDQW DPRXQW RI ZLOGW\SH &ES LQFUHDVLQJ FRQFHQWUDWLRQV RI GHOHWLRQ DDODDf PXWDQW ODQHV f RU WULSOH DURPDWLF PXWDQW ODQHV f 7KH UDWLR RI PXWDQW WR ZLOGW\SH &ES LQ HDFK UHDFWLRQ LV LQGLFDWHG DERYH WKH ODQHV 7KH SUHFXUVRU 51$ DQG VSOLFHG SURGXFWV DUH VFKHPDWLFDOO\ UHSUHVHQWHG RQ WKH OHIW RI WKH JHO % 4XDQWLWDWLRQ RI WKH JHO VKRZQ LQ $ ZDV XVHG WR SORW WKH VSOLFLQJ UDWLR VXP RI OLJDWHG H[RQV DQG f H[RQ WR XQVSOLFHG SUHFXUVRUf DV D IXQFWLRQ RI PXWDQW ZLOGW\SH &ES UDWLR

PAGE 106

$ 'HOHWLRQ DDDDf 7ULSOH DURPDWLF 5/5/./f

PAGE 107

6SOLFLQJ 5DWLR % 0XWDQW:W&ES )LJXUH FRQWLQXHG

PAGE 108

'LVFXVVLRQ 89FURVVOLQNLQJ VWXGLHV &KDSWHU f VKRZHG D DPLQR DFLG 1WHUPLQDO UHJLRQ WR EH LQ FORVH SUR[LPLW\ ZLWK LQWURQ 51$ XQGHU IDFLOLWDWHG VSOLFLQJ FRQGLWLRQV 7KHVH ILQGLQJV SURYLGHG VSHFLILF WDUJHWV IRU PXWDJHQHVLV REYLDWLQJ WKH QHHG IRU JHQHUDO VXUIDFH VFDQQLQJ PHWKRGV OLNH DODQLQH VFDQQLQJ &XQQLQJKDP DQG :HOOV f $ DPLQR DFLG VWUHWFK DDO6665<5<.)10(DDf LQ WKLV DPLQR DFLG UHJLRQ ZDV SUHGLFWHG WR EH FULWLFDO IRU 51$SURWHLQ LQWHUDFWLRQV EDVHG RQ WKH ELRFKHPLFDO SURSHUWLHV RI WKH UHVLGXHV 7KHUHIRUH WKLV DPLQR DFLG UHJLRQ ZDV WDUJHWHG IRU LQGLYLGXDO RU FOXVWHU PXWDJHQHVLV WR DOWHU WKH VXUIDFH SURSHUWLHV RI WKLV UHJLRQ DQG VWXG\ WKHLU HIIHFWV RQ SURWHLQ IXQFWLRQ 'HOHWLRQ DDODDf DQG WULSOH DURPDWLF < < DQG ) WR /f PXWDQWV ZHUH FRPSOHWHO\ GHIHFWLYH LQ VSOLFLQJ XQGHU ORZ VDOW FRQGLWLRQV HYHQ DW KLJK SURWHLQ FRQFHQWUDWLRQV )LJXUH f 7KHVH GDWD FRQILUP WKH SUHGLFWLRQ WKDW DDODD LV D FULWLFDO UHJLRQ HVVHQWLDO IRU &ES IXQFWLRQ +RZHYHU LW LV LPSRUWDQW WR VKRZ WKDW WKHVH FKDQJHV GLG QRW DOWHU WKH FRQIRUPDWLRQ DQG VWDELOLW\ RI PXWDQW SURWHLQV 8QIRUWXQDWHO\ &ES KDV QR NQRZQ IXQFWLRQ RWKHU WKDQ IDFLOLWDWLQJ WKH SURFHVVLQJ RI LQWURQ 0F*UDZ DQG 7]DJRORII f DQG WKH FR LQWURQ 6KDZ DQG /HZLQ f XQOLNH ELIXQFWLRQDO 51$ ELQGLQJ SURWHLQV OLNH WKH PLWRFKRQGULDO W\URV\O W51$ V\QWKHWDVH &\WOf RI 1HXURVSRUD FUDVVD &\WO LQ DGGLWLRQ WR LWV V\QWKHWDVH IXQFWLRQ IDFLOLWDWHV WKH VSOLFLQJ RI VHYHUDO PLWRFKRQGULDO JURXS LQWURQV $NLQV DQG /DPERZLW] f 7KLV ELIXQFWLRQDOLW\ RI &\WO ZDV H[SORLWHG WR GHPRQVWUDWH WKH QDWLYH FRQIRUPDWLRQ RI VSOLFLQJGHIHFWLYH PXWDQWV E\ DVVD\V IRU V\QWKHWDVH IXQFWLRQ

PAGE 109

&KHPLDFN HW DO f 6LQFH RXU V\VWHP GRHV QRW DIIRUG WKLV OX[XU\ WKH FRQIRUPDWLRQDO LQWHJULW\ RI WKH &ES PXWDQWV ZDV DGGUHVVHG XVLQJ SDUWLDO SURWHRO\VLV DQG HTXLOLEULXP 51$ ELQGLQJ DVVD\V 3DUWLDO SURWHRO\VLV LV D VLPSOH DQG SRZHUIXO WRRO WR DQDO\]H WKH FRQIRUPDWLRQDO VWDWHV DQG GRPDLQ VWUXFWXUH RI SURWHLQV ,W LV EDVHG RQ WKH SULQFLSOH WKDW SURWHDVH VXVFHSWLEOH VLWHV RIWHQ RFFXU EHWZHHQ LQGHSHQGHQWO\ IROGHG GRPDLQV 7KH SRWHQWLDO FOHDYDJH VLWHV ZLWKLQ WKHVH GRPDLQV DUH SURWHFWHG IURP SURWHDVHV LQ WKH QDWLYH VWDWH DQG H[SRVHG WR YDULRXV GHJUHHV LQ WKH GHQDWXUHG RU SDUWO\ XQIROGHG VWDWHV &OHJKRQ DQG.OHVVLJ 3DUNHU HW DO f 3DUWLDO SURWHRO\VLV KDV EHHQ VXFFHVVIXOO\ XVHG WR VWXG\ FRQIRUPDWLRQDO FKDQJHV LQ SURWHLQV LQGXFHG E\ '1$ ELQGLQJ &KDQJ DQG 'RL +D\ DQG 1LFKROVRQ 3HWHUVHQ HW DO ,NHGD HW DO f RU ELQGLQJ WR D VSHFLILF OLJDQG 9DLVDQHQ HW DO 0RGDUUHVV HW DO &KX HW DO f 7KLV DSSURDFK ZDV DOVR XVHG WR FRPSDUH WKH FRQIRUPDWLRQ RI ZLOG W\SH DQG PXWDQW SURWHLQV LQ PXWDJHQHVLV H[SHULPHQWV WR GHWHFW VWUXFWXUDO SHUWXUEDWLRQV LI DQ\ FDXVHG E\ WKH PXWDWLRQV )RU LQVWDQFH /LX HW DO f FRPSDUHG WKH IROGLQJ SDWWHUQV RI VHYHUDO UKRGRSVLQ SRLQW PXWDQWV E\ SDUWLDO WU\SWLF GLJHVWV DQG &' VSHFWURVFRS\ 7KH\ IRXQG WKDW FKDQJHV LQ SURWHLQ FRQIRUPDWLRQ EHWZHHQ ZLOGW\SH DQG PXWDQW SURWHLQV LQGLFDWHG E\ SDUWLDO SURWHRO\VLV ZHUH LQ JRRG DJUHHPHQW ZLWK WKH UHVXOWV RI &' VSHFWURVFRS\ 7KHUHIRUH ZH XWLOL]HG SDUWLDO SURWHRO\VLV WR SUREH WKH FRQIRUPDWLRQDO VWDWHV RI ZLOGW\SH DQG PXWDQW &ES SURWHLQV 7KH SDUWLDO SURWHRO\WLF SURILOHV REWDLQHG ZLWK PXWDQW &ES SURWHLQV ZHUH VLPLODU WR WKDW RI WKH QDWLYH EXW QRW WKH KHDWGHQDWXUHG &ES )LJXUH f 7KHVH

PAGE 110

UHVXOWV VXJJHVW WKDW WKH GHOHWLRQ DQG WULSOH DURPDWLF PXWDQWV SRVVHVV D FRQIRUPDWLRQ VLPLODU WR WKDW RI ZLOGW\SH SURWHLQ DQG \HW ODFN VRPH RI WKH NH\ DPLQR DFLG UHVLGXHV HVVHQWLDO IRU &ES IXQFWLRQ 7KH IRUPDWLRQ RI D IXQFWLRQDO &ESLQWURQ 51$ FRPSOH[ UHTXLUHV SURSHU IROGLQJ RI 51$ DQG DQ LQWDFW QDWLYH FRQIRUPDWLRQ RI SURWHLQ )LOWHUELQGLQJ DVVD\V ZLWK GHOHWLRQ DQG WULSOH DURPDWLF PXWDQWV H[KLELWHG K\SHUEROLF 51$ ELQGLQJ SDWWHUQV VLPLODU WR WKDW RI ZLOGW\SH &ES )LJXUH %f $OWKRXJK WKH PXWDQWV YDULHG LQ WKHLU DIILQLW\ IRU 51$ NG PHDVXUHPHQWV LQ 7DEOH f WKHLU LGHQWLFDO ELQGLQJ SURILOHV VXJJHVW WKDW WKHVH SURWHLQV KDYH D ZLOGW\SHOLNH FRQIRUPDWLRQ WKDW DOORZV LQWHUDFWLRQ ZLWK FRJQDWH 51$ LQWURQ 51$f +RZHYHU DV GLVFXVVHG DERYH WKHVH WZR PXWDQWV GLG QRW SURPRWH VSOLFLQJ RI LQWURQ 51$ XQGHU ORZ VDOW FRQGLWLRQV 7RJHWKHU WKHVH GDWD VXJJHVW WKDW WKH 51$ ELQGLQJ SURSHUW\ RI &ES DV GHWHFWHG E\ WKH ILOWHU ELQGLQJ DVVD\f FDQ EH VHSDUDWHG IURP LWV VSOLFLQJ HQKDQFHPHQW IXQFWLRQ DV HYLGHQFHG E\ WKH DEVHQFH RI VSOLFHG SURGXFWV XQGHU ORZ VDOW FRQGLWLRQVf 7KH\ DOVR VXJJHVW WKDW WKH 51$ ELQGLQJ DELOLW\ PD\ QRW EH VXIILFLHQW E\ LWVHOI WR SURPRWH VSOLFLQJ DW SK\VLRORJLFDO FRQFHQWUDWLRQV RI 0J HPSOR\HG LQ WKHVH H[SHULPHQWVf 7KH SURWHLQ51$ FRPSOH[ PD\ KDYH WR DWWDLQ D SDUWLFXODU DFWLYH FRQIRUPDWLRQ WKURXJK VSHFLILF FRQWDFWVf EHIRUH VSOLFLQJ FDQ EH LQLWLDWHG 7KH VDOLHQW IHDWXUHV RI WKH UHVLGXHV LQ DDODD UHJLRQ PD\ HQDEOH WKLV IXQFWLRQ ,Q RUGHU WR SLQSRLQW WKH HVVHQWLDOLW\ RI LQGLYLGXDO UHVLGXHV LQ WKH DDODD UHJLRQ D VHULHV RI SRLQW PXWDWLRQV ZHUH PDGH DQG FKDUDFWHUL]HG LQ YLWUR $QDO\VLV

PAGE 111

RI WKHVH PXWDQW SURWHLQV DJDLQ HPSKDVL]HG WKH LPSRUWDQFH RI WKH DURPDWLF DQG FKDUJHG UHVLGXHV LQ WKLV UHJLRQ 7KH WULSOH FKDUJHG PXWDQW 5 5 WR /f \LHOGHG D SURWHLQ ZLWK SDUWLDO DFWLYLW\ LQ VSOLFLQJ DVVD\V )LJXUHV DQG f LQ FRQWUDVW WR WKH WULSOH DURPDWLF PXWDQW < < DQG ) WR /f ZKLFK ZDV FRPSOHWHO\ GHIHFWLYH LQ VSOLFLQJ )LJXUH f 7KHUHIRUH WKH FKDUJHG UHVLGXHV DW SRVLWLRQV DQG DUH LPSRUWDQW IRU &ES IXQFWLRQ WKRXJK QRW DV FULWLFDO DV WKH DURPDWLF UHVLGXHV DW SRVLWLRQV DQG 6LQJOH PXWDWLRQV FKDQJLQJ HDFK DURPDWLF UHVLGXH WR OHXFLQH JDYH FRQWUDVWLQJ UHVXOWV 7KH
PAGE 112

DFLGV 7KH SDUWLDO DFWLYLW\ RI
PAGE 113

KDV K\GURSKRELF DQG EDVLF UHVLGXHV VFDWWHUHG WKURXJKRXW WKH OHQJWK RI WKH SURWHLQ +HQFH LW LV OLNHO\ WKDW GLIIHUHQW UHJLRQV RI WKLV SURWHLQ PD\ SDUWLFLSDWH LQ VHTXHQFHLQGHSHQGHQW UHFRJQLWLRQ RI WKH FRQVHUYHG LQWURQ VWUXFWXUH LQ DGGLWLRQ WR HQJDJLQJ LQ VSHFLILF LQWHUDFWLRQV ZLWK WKH EDVHV ([SHULPHQWV ZLWK WKH WULSOH FKDUJHG PXWDQW RI &ES LQGLFDWH WKDW WKH FKDUJHG UHVLGXHV DUH LPSRUWDQW EXW QRW DEVROXWHO\ HVVHQWLDO IRU DFWLYLW\ VXJJHVWLQJ WKDW WKHVH UHVLGXHV PD\ QRW IRUP VSHFLILF LRQ SDLUV ZLWK WKH SKRVSKDWHV RI 51$ ,W LV SRVVLEOH WKDW &ES PLJKW EH LQYROYHG LQ D YDULHW\ RI QRQVSHFLILF LQWHUDFWLRQV ZLWK WKH VXJDUSKRVSKDWH EDFNERQH RI LQWURQ 51$ 7KHVH PLJKW LQFOXGH QRQHOHFWURVWDWLF LQWHUDFWLRQV ZLWK f2+ JURXSV RI VXJDU UHVLGXHV RU IXQFWLRQDO JURXSV RI EDVHV $QRWKHU PRWLI WKDW VKDUHV D IHZ VLPLODULWLHV ZLWK &ES LV WKH DUJLQLQHULFK PRWLI $50f IRXQG LQ VHYHUDO YLUDO EDFWHULRSKDJH DQG ULERVRPDO 51$ELQGLQJ SURWHLQV 7KHUH LV YHU\ OLWWOH LGHQWLW\ EHWZHHQ $50 VHTXHQFHV RI GLIIHUHQW 51$ELQGLQJ SURWHLQV RWKHU WKDQ WKH SUHSRQGHUDQFH RI DUJLQLQH UHVLGXHV /D]LQVNL HW DO f )RU LQVWDQFH WKH $50 UHJLRQV RI WZR +,9 51$ELQGLQJ SURWHLQV 7DW DQG 5HY DUH GLVVLPLODU 3HSWLGHV FRQWDLQLQJ WKH 5HY $50 VSHFLILFDOO\ ELQG 55( 5HY UHVSRQVLYH HOHPHQWf DV DQ DOSKD KHOL[ 7DQ HW DO f ZKLOH 7DW $50 SHSWLGHV DUH ODUJHO\ XQVWUXFWXUHG EXW DGRSW D VWDEOH FRQIRUPDWLRQ XSRQ ELQGLQJ WKH 7$5 VHTXHQFH &DOQDQ HW DO f $PLQR DFLGV RXWVLGH WKH FRQVHUYHG $50 UHJLRQV DUH LPSRUWDQW IRU LQ YLWUR 51$ ELQGLQJ E\ 5HY DQG 7DW 7DQ HW DO f DV ZHOO DV IRU ZLOGW\SH DFWLYLW\ RI RWKHU $50 SURWHLQV /D]LQVNL HW DO f 7KXV WKH RYHUDOO VWUXFWXUH RI WKH $50 SURWHLQ LV LPSRUWDQW IRU 51$ ELQGLQJ 7ZR JHQHUDO

PAGE 114

UROHV KDYH EHHQ DWWULEXWHG WR WKH DUJLQLQH UHVLGXHV RI $50 SURWHLQV 7KH SRVLWLYH FKDUJH RI DUJLQLQH PD\ LQFUHDVH QRQVSHFLILF DIILQLW\ IRU 51$ WKHUHE\ IDFLOLWDWLQJ WKH VHDUFK IRU KLJKDIILQLW\ ELQGLQJ VLWHV $ VHFRQG UROH FRXOG EH LQ WKH IRUPDWLRQ RI VSHFLILF K\GURJHQ ERQGV ZLWK WKH SKRVSKRULERVH EDFNERQH DQG EDVHV RI 51$ $V WZR RI WKH WKUHH EDVLF UHVLGXHV LQ WKH SXWDWLYH 1WHUPLQDO 51$ ELQGLQJ UHJLRQ DDODDf RI &ES DUH DUJLQLQH UHVLGXHV RQH RU ERWK RI WKH DERYH PHQWLRQHG UROHV PD\ EH LPSRUWDQW IRU &ES51$ LQWHUDFWLRQV +RZHYHU WKH SDUWLDO VSOLFLQJ DFWLYLW\ RI WKH WULSOH FKDUJHG PXWDQW VXJJHVWV WKDW WKH QHW SRVLWLYH FKDUJH RQ &ES PD\ VHUYH WR EULQJ WKH 51$ PROHFXOH FORVHU E\ QRQVSHFLILF LQWHUDFWLRQVf DOORZLQJ WKH VHDUFK IRU VSHFLILF KLJK DIILQLW\ VLWHV DVVRFLDWHG ZLWK RWKHU IXQFWLRQDO JURXSV RQ WKH SURWHLQ ,Q DGGLWLRQ UHJLRQV RXWVLGH LQGHSHQGHQW 51$ELQGLQJ GRPDLQV PD\ DOVR FRQWULEXWH WR WRWDO 51$ ELQGLQJ DQDORJRXV WR WKH $50 SURWHLQVf DV EDVLF UHVLGXHV DUH VFDWWHUHG WKURXJKRXW WKH OHQJWK RI &ES 7KH W\URVLQH UHVLGXH DW SRVLWLRQ LQ &ES DSSHDUV WR EH LQGLVSHQVDEOH IRU DFWLYLW\ SRLQWLQJ WR VHYHUDO SRVVLEOH UROHV LQ WKH VWDELOL]DWLRQ RI SURWHLQ51$ LQWHUDFWLRQV 7KH SRODU QDWXUH RI WKH UHVLGXH ZRXOG DOORZ SRODU LQWHUDFWLRQV ZLWK WKH SKRVSKDWH EDFNERQHEDVHV RI 51$ ZKLOH WKH DURPDWLF SURSHUW\ ZRXOG DOORZ VWDFNLQJ LQWHUDFWLRQV ZLWK WKH EDVHV +RZHYHU SRODU LQWHUDFWLRQV PD\ SOD\ D NH\ UROH LQ WKLV FRQWH[W DV DGGLWLRQDO SRODU DPLQR DFLGV VXFK DV VHULQH UHVLGXHVf DQG DVSDUDJLQH IODQN WKLV UHVLGXH 7KH DURPDWLF SURSHUW\ LI HVVHQWLDO PD\ EH OLPLWHG WR SRVLWLRQ DV SKHQ\ODODQLQH DQRWKHU DURPDWLF UHVLGXHf DW SRVLWLRQ LV GLVSHQVDEOH IRU DFWLYLW\ 7KH LPSRUWDQFH RI KDYLQJ D SRODUQRQSRODU DURPDWLF

PAGE 115

UHVLGXH DW SRVLWLRQ FRXOG EH DGGUHVVHG E\ VXEVWLWXWLRQ ZLWK SKHQ\ODODQLQH <)f $ UHGXFWLRQ LQ DFWLYLW\ ZRXOG VXJJHVW WKH H[LVWHQFH RI D SRODU LQWHUDFWLRQ ZKLOH QR HIIHFW ZRXOG DUJXH IRU D VWDFNLQJ UROH RI WKH < UHVLGXH ,I WKLV PXWDQW <)f KDV WKH IRUPHU SKHQRW\SH VXEVWLWXWLRQ RI ) ZLWK D SRODU UHVLGXH OLNH VHULQH RU WKUHRQLQH VKRXOG UHVWRUH DFWLYLW\ SURYLQJ WKH LPSRUWDQFH RI D SRODU UHVLGXH DW SRVLWLRQ 7KH LPSRUWDQFH RI ERWK SRODU DQG VWDFNLQJ LQWHUDFWLRQV LQ SURWHLQ51$ FRPSOH[HV KDV EHHQ GRFXPHQWHG LQ VHYHUDO V\VWHPV )RU LQVWDQFH FU\VWDO VWUXFWXUH RI WKH 51$ EDFWHULRSKDJH 06 FRDW SURWHLQ FRPSOH[HG ZLWK LWV 51$ VXEVWUDWH QXFOHRWLGH VWHPORRS VWUXFWXUH FRQWDLQLQJ WKH LQLWLDWLRQ FRGRQ RI WKH UHSOLFDVH JHQHf VKRZV WKDW DERXW SKRVSKDWHV DUH LQYROYHG LQ LQWHUDFWLRQV ZLWK WKH SURWHLQ 9DOHJDUG HW DO f 2I WKHVH VL[ DUH SRODU LQWHUDFWLRQV LQYROYLQJ DVSDUDJLQH VHULQH RU W\URVLQH ZKLOH D FRQVHUYHG W\URVLQH DW SRVLWLRQ RI 06 SURWHLQ $ VXEXQLWf LV LQYROYHG LQ VWDFNLQJ LQWHUDFWLRQV ZLWK WKH EDVHV RI 51$ $Q RIIVKRRW RI WKH PXWDWLRQDO DQDO\VHV KDV EHHQ DQ LQVLJKW LQWR WKH W\SHV RI LQWHUDFWLRQV EHWZHHQ &ES DQG LQWURQ 51$ 6SOLFLQJ H[SHULPHQWV ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI ZLOGW\SH &ES LQGLFDWHG WKDW KLJKHU UDWLRV RI SURWHLQ WR 51$ ZHUH LQKLELWRU\ )LJXUH f $ VLPLODU LQKLELWLRQ ZDV REVHUYHG ZLWK WKH GHOHWLRQ DQG WULSOH DURPDWLF PXWDQWV DW WRWDO SURWHLQ ZLOGW\SH PXWDQWf WR 51$ UDWLRV RI RU DERYH )LJXUH f $OVR ZKHQ WKH UDWLR RI WRWDO &ES ZLOGW\SH PXWDQWf WR 51$ ZDV NHSW DW RU EHORZ WKHUH ZDV QR LQKLELWLRQ RI ZLOGW\SH PHGLDWHG VSOLFLQJ )LJXUH f E\ WKHVH PXWDQW SURWHLQV 7KHVH UHVXOWV LQGLFDWH

PAGE 116

WKDW WKH REVHUYHG LQKLELWLRQ ZDV QRW D SURSHUW\ RI WKH PXWDQW SURWHLQV EXW D IXQFWLRQ RI WKH UDWLR RI WRWDO &ES WR 51$ ,W LV LPSRUWDQW WR QRWH WKDW WKH SURWHLQ WR 51$ UDWLRV EHORZ f WKDW VWLPXODWHG VSOLFLQJ FRUUHVSRQGHG WR WKH OLQHDU UDQJH RI 51$ ELQGLQJ SURILOHV PHDVXUHG E\ ILOWHU ELQGLQJ DVVD\V )LJXUH %f 7KXV &ES FRQFHQWUDWLRQV FRUUHVSRQGLQJ WR VXEPD[LPDO 51$ ELQGLQJ DSSHDU WR EH LPSRUWDQW IRU VSHFLILF SURGXFWLYH LQWHUDFWLRQV EHWZHHQ 51$ DQG SURWHLQ 51$ELQGLQJ SURWHLQV VXFK DV &\W RI 1HXURVSRUD FUDVVD KDYH EHHQ REVHUYHG WR HQJDJH LQ QRQVSHFLILF LQWHUDFWLRQV ZLWK 51$ LQ YLWUR 6DOGDQKD HW DO f 7KHVH QRQVSHFLILF LQWHUDFWLRQV ZHUH UHGXFHG E\ WKH DGGLWLRQ RI DQ 51$ PLPHWLF OLNH KHSDULQ ,Q RUGHU WR WHVW LI WKH LQKLELWRU\ HIIHFWV RI KLJKHU &ES FRQFHQWUDWLRQV FRXOG DOVR EH RYHUFRPH E\ D QRQVSHFLILF FRPSHWLWRU VSOLFLQJ H[SHULPHQWV ZHUH SHUIRUPHG ZLWK ZLOGW\SH SURWHLQ DW DQ LQKLELWRU\ UDWLR RI EXW LQ WKH SUHVHQFH RI H[FHVV W51$ 6SOLFLQJ DFWLYLW\ ZDV DOPRVW FRPSOHWHO\ UHVFXHG ZLWK WKH DGGLWLRQ RI W51$ )LJXUHV $ DQG 2%f GHPRQVWUDWLQJ WKDW FRXQWHUDFWLQJ WKH QRQVSHFLILF LQWHUDFWLRQV FRXOG DOOHYLDWH WKH LQKLELWLRQ RI VSOLFLQJ 7KHUH DUH DW OHDVW WZR LQVWDQFHV LQ WKH OLWHUDWXUH ZKHUH VLPLODU SKHQRPHQD ZHUH REVHUYHG 1XFOHRFDSVLG SURWHLQ 1&f RI +,9 D QRQVSHFLILF 51$ELQGLQJ SURWHLQ HQKDQFHV WKH DFWLYLW\ RI D KDPPHUKHDG ULER]\PH ++f LQ YLWUR RQO\ LQ D QDUURZ UDQJH RI SURWHLQ FRQFHQWUDWLRQV +HUVFKODJ HW DO f 7KH REVHUYHG UDWH FRQVWDQW IRU VLQJOH WXUQRYHU UHDFWLRQV VKRZHG DQ LQFUHDVH IROORZHG E\ D GHFUHDVH ZLWK LQFUHDVLQJ 1& SURWHLQ FRQFHQWUDWLRQ 3URWHLQ FRQFHQWUDWLRQV KLJKHU WKDQ WKDW

PAGE 117

UHTXLUHG IRU VWLPXODWLQJ PXOWLSOH WXUQRYHU GHFUHDVHG WKH UDWH RI UHDFWLRQ 7KRXJK WKH WUHQGV REVHUYHG ZHUH UHSURGXFLEOH WKH H[DFW FRQFHQWUDWLRQ RI 1& SURWHLQ UHTXLUHG IRU VWLPXODWLRQ DQG LQKLELWLRQ YDULHG ZLWK WKH H[SHULPHQW $GGLWLRQ RI LQWHUPHGLDWH FRQFHQWUDWLRQV RI WKH QRQVSHFLILF FRPSHWLWRU VV'1$ WR UHDFWLRQV FRQWDLQLQJ DQ LQKLELWRU\ 1& FRQFHQWUDWLRQ VWLPXODWHG PXOWLSOH WXUQRYHU )XUWKHU H[SHULPHQWV GHPRQVWUDWHG WKDW 1& SURWHLQ DW KLJKHU FRQFHQWUDWLRQV VKXWV GRZQ 51$ IXQFWLRQ E\ ELQGLQJ WR WKH ULER]\PHVXEVWUDWH FRPSOH[ DQG EORFNLQJ WKH FOHDYDJH VWHS 7KXV KLJK FRQFHQWUDWLRQV RI 1& SURWHLQ DSSHDU WR ELQG PRUH VWURQJO\ WR WKH GHQDWXUHG RU LQDFWLYH UDWKHU WKDQ WKH DFWLYH FRQIRUPDWLRQ RI WKH KDPPHUKHDG FDWDO\WLF FRUH 7KH KQ513 SURWHLQV VXFK DV KQ513$ & DQG 8 KDYH EHHQ VKRZQ WR SURPRWH DQQHDOLQJ EHWZHHQ FRPSOHPHQWDU\ VLQJOH VWUDQGV RI 51$ LQ YLWUR .XPDU DQG :LOVRQ 3RUWPDQ DQG 'UH\IXVV f ,QWHUHVWLQJO\ WKH 51$ DQQHDOLQJ DFWLYLW\ LV UHGXFHG RU DEROLVKHG DW KLJK SURWHLP51$ UDWLRV 0XQURH DQG 'RQJ 3RUWPDQ DQG 'UH\IXVV f 3RUWPDQ DQG 'UH\IXVV f SURSRVHG WKDW H[FHVV SURWHLQ PD\ LQKLELW DQQHDOLQJ E\ VWDELOL]LQJ WKH VLQJOH VWUDQGV VWHULFDOO\ EORFNLQJ 51$ EDVHSDLULQJ DQGRU VTXHOFKLQJ VLWHV UHTXLUHG IRU SURWHLQSURWHLQ LQWHUDFWLRQV LQYROYHG LQ 51$ DQQHDOLQJ $QDORJRXV WR WKH DERYH V\VWHPV LW LV SRVVLEOH WKDW &ES DW KLJK SURWHLQ WR 51$ UDWLRV VKXWV GRZQ VSOLFLQJ E\ ELQGLQJ WR DOWHUQDWH VLWHV RQ LQWURQ 51$ DQG VWDELOL]LQJ DQ LQDFWLYH FRQIRUPDWLRQ +RZHYHU LQ WKH UDQJH RI SURWHLQ FRQFHQWUDWLRQV WKDW VWLPXODWH VSOLFLQJ SURWHLP51$ UDWLRV RI RU EHORZf WKLV

PAGE 118

QR QRQVSHFLILF 51$ ELQGLQJ PD\ EH QHFHVVDU\ WR SURPRWH WKH IRUPDWLRQ RI WKH DFWLYH LQWURQ VWUXFWXUH DQG IDFLOLWDWH VSOLFLQJ 7KXV &ES DSSHDUV WR HQJDJH LQ ERWK QRQn VSHFLILF DQG VSHFLILF LQWHUDFWLRQV ZLWK LQWURQ 51$ 89FURVVOLQNLQJ PRQLWRUV WKH LQWHUDFWLRQ EHWZHHQ FORVHO\ DSSRVHG IXQFWLRQDO JURXSV LQ 513 FRPSOH[HV ZLWK WKH H[WHQW RI FURVVOLQNLQJ UHSUHVHQWLQJ WKH H[WHQW RI VSHFLILF LQWHUDFWLRQV )LOWHU ELQGLQJ DQDO\VLV RQ WKH RWKHU KDQG GHWHUPLQHV WKH JHQHUDO 51$ ELQGLQJ SURILOHV RI SURWHLQV HPSKDVL]LQJ WKH QRQVSHFLILF LQWHUDFWLRQV &HUWDLQ PXWDWLRQV LQ WKH 1WHUPLQDO FURVVOLQN VLWH RI &ES ILUVW UHVLGXHVf QRW RQO\ DIIHFWHG VSOLFLQJ EXW DOVR ORZHUHG WKH H[WHQW RI FURVVOLQNLQJ WR LQWURQ 51$ )RU LQVWDQFH WULSOH FKDUJHG DQG
PAGE 119

,OO OHDG WR FDWDO\VLV $W KLJK SURWHLQ FRQFHQWUDWLRQV KRZHYHU QRQVSHFLILF LQWHUDFWLRQV PD\ SUHGRPLQDWH DQG SUHFOXGH WKH IRUPDWLRQ RI VSHFLILF FRQWDFWV WKDW DUH HVVHQWLDO IRU SURPRWLQJ WKH FDWDO\WLF FRQIRUPDWLRQ RI 51$ ,W FDQ EH VSHFXODWHG WKDW WKH FKDUJHG UHVLGXHV RQ &ES PD\ LQ SDUW EH LPSRUWDQW IRU WKHVH LQLWLDO QRQVSHFLILF HQFRXQWHUV ZKLOH DURPDWLF UHVLGXHV VXFK DV
PAGE 120

&+$37(5 6800$5< $1' 3(563(&7,9(6 %LRORJLFDO SURFHVVHV VXFK DV 51$ VSOLFLQJ 51$ SURFHVVLQJ DQG WUDQVODWLRQ UHTXLUH WKH LQWHUSOD\ EHWZHHQ 51$ DQG SURWHLQV 7KHUH LV VXEVWDQWLDO HYLGHQFH WKDW WKH HVVHQWLDO DFWLYH VLWH VWUXFWXUHV IRU WKHVH ULERQXFOHRSURWHLQ 513f HQ]\PHV DUH SURYLGHG E\ WKH IROGHG 51$ LWVHOI *XHUULHU 7DNDGD HW DO 0DGKDQL DQG *XWKULH 0\HUV HW DO 1ROOHU HW DO f 7KH SURWHLQ FRPSRQHQW RI WKHVH 513V PD\ IDFLOLWDWH 51$ FDWDO\VLV E\ VWDELOL]LQJ WKH DFWLYH 51$ VWUXFWXUH 6DOGDQKD HW DO 6KDZ DQG /HZLQ :HHNV DQG &HFK f LQFUHDVLQJ DIILQLW\ IRU VXEVWUDWH .XU] HW DO f RU UHJXODWLQJ DFWLYLW\ RI WKH 513 FRPSOH[ 0RJULGJH HW DO f $OWKRXJK PDQ\ JURXS LQWURQV KDYH EHHQ VKRZQ WR VHOI VSOLFH LQ YLWUR PRVW LI QRW DOO UHTXLUH SURWHLQ IDFWRUV IRU HIILFLHQW VSOLFLQJ LQ YLYR 6HOIVSOLFLQJ LQ YLWUR UHTXLUHV XQXVXDOO\ KLJK 0J FRQFHQWUDWLRQV IRU RSWLPDO DFWLYLW\ +LFNH HW DO -DHJHU HW DO 3DUWRQR DQG /HZLQ 3DUWRQR DQG /HZLQ f DQG LQYROYHV FRPSOH[ UHDFWLRQ NLQHWLFV WKDW RIWHQ UHVXOW LQ ORZHU UHDFWLRQ UDWHV %DVV DQG &HFK YDQ GHU +RUVW DQG 7DEDN 3DQ HW DO f 7KH VHOI VSOLFLQJ UDWH RI WKH SURWRW\SLF 7HWUDK\PHQD ULER]\PH IRU H[DPSOH LV WLPHV ORZHU DW SK\VLRORJLFDO 0J FRQFHQWUDWLRQV LQ YLWUR FRPSDUHG WR WKDW LQ YLYR %UHKP DQG &HFK f VXJJHVWLQJ WKH UHTXLUHPHQW RI SURWHLQ FRn IDFWRUV IRU HIILFLHQW VSOLFLQJ LQ WKH FHOO

PAGE 121

7KH &ESLQWURQ 513 FRPSOH[ RI 6DFFKDURP\FHV FHUHYLVLDH UHSUHVHQWV D VLPSOH EXW YDOXDEOH RQH SURWHLQRQH 51$ V\VWHP WR JDLQ LQVLJKWV LQWR 51$ SURWHLQ LQWHUDFWLRQV 7KH 51$ FRPSRQHQW LQWURQ f LV WKH WHUPLQDO LQWURQ RI WKH PLWRFKRQGULDO F\WRFKURPH E &2%f SUHP51$ ZKLOH WKH SURWHLQ FRPSRQHQW &ESf LV QXFOHXVHQFRGHG DQG LV HVVHQWLDO IRU WKH VSOLFLQJ RI LQWURQ LQ YLYR +LOO HW DO 0F*UDZ DQG 7]DJRORII f RU DW SK\VLRORJLFDO PDJQHVLXP FRQFHQWUDWLRQV LQ YLWUR *DPSHO HW DO /HZLQ HW DO :HHNV DQG &HFK f 7KH FXUUHQW VWXG\ UHSUHVHQWV WKH ILUVW DWWHPSW DW PDSSLQJ LQWURQ 51$ ELQGLQJ VLWHV RQ &ES 7KH 89FURVVOLQNLQJ VWUDWHJ\ RI =DPRUH DQG *UHHQ f ZDV HPSOR\HG WR PDS WKH DPLQR DFLG UHVLGXHV RQ &ES WKDW LQWLPDWHO\ FRQWDFW LQWURQ 51$ %ULHIO\ SURWHLQ51$ FRPSOH[HV JHQHUDWHG XQGHU ORZ VDOW VSOLFLQJ FRQGLWLRQV ZHUH LPPRELOL]HG ZLWK 89 OLJKW DQG WKH FURVVOLQN VLWHV RQ &ES ZHUH LGHQWLILHG E\ LQGLUHFW ODEHO WUDQVIHU WR SHSWLGHV JHQHUDWHG E\ WZR FOHDYDJH UHDJHQWV K\GUR[\ODPLQH 1+2+f DQG QLWURWKLRF\DQREHQ]RDWH 17&%f +\GUR[\ODPLQH ZDV WKH LGHDO UHDJHQW WR REWDLQ DQ LQLWLDO KDQGOH RQ &ES VLWHV FRQWDFWLQJ LQWURQ 51$ VLQFH LW LV VSHFLILF WR WKH UHODWLYHO\ LQIUHTXHQW DVSDUDJLQ\OJO\F\O SHSWLGH ERQG %RUQVWHLQ DQG %DOLDQ f DQG \LHOGV IHZHU SHSWLGH IUDJPHQWV 6WURQJ FURVVOLQN VLWHV PDSSHG WR D N'D 1WHUPLQDO SHSWLGH DDODDf DQG D N'D &WHUPLQDO IUDJPHQW DD2DDf VKRZLQJ WKDW WKH WHUPLQL RI &ES FRPSULVH LPSRUWDQW 51$ ELQGLQJ GRPDLQV +RZHYHU WKH N'D FHQWUDO IUDJPHQW DDO ODDf GLVSOD\HG YHU\ ZHDN FURVVOLQNLQJ 7KH FHQWUDO

PAGE 122

UHJLRQ PD\ EH FRPSULVHG RI ZHDNHU ELQGLQJ VLWHV WKDW PD\ EH LPSRUWDQW IRU WKH RYHUDOO VWDELOL]DWLRQ RI WKH 513 FRPSOH[ 7KH LPSRUWDQFH RI VXFK ZHDN 51$ ELQGLQJ GRPDLQV LQ SURWHLQ51$ LQWHUDFWLRQV LV H[HPSOLILHG E\ WKH JOXWDPLQ\O W51$ V\QWKHWDVH RI 6DFFKDURP\FHV FHUHYLVLDH 7KLV SURWHLQ FDUULHV D QRYHO DQG GLVSHQVDEOH 1WHUPLQDO GRPDLQ LQ DGGLWLRQ WR LWV DFWLYH 51$ ELQGLQJ VLWH ZKLFK LV FORVHO\ KRPRORJRXV WR LWV (VFKHULFLD FROL FRXQWHUSDUW $OWKRXJK WKH EDFWHULDO V\QWKHWDVH LV QRW FDSDEOH RI FKDUJLQJ \HDVW W51$HOX DGGLWLRQ RI WKH DSSHQGHG GRPDLQ RI WKH \HDVW SURWHLQ FRQIHUV VSHFLILFLW\ WR \HDVW W51$JOX :KHOLKDQ DQG 6FKLPPHO f 7KLV VXJJHVWV WKDW WKH DSSHQGHG GRPDLQ PD\ HQJDJH LQ DQ DGGLWLRQDO 51$ LQWHUDFWLRQ WKDW FRPSHQVDWHV IRU SRRU FRPSOH[IRUPDWLRQ E\ WKH QDWLYH EDFWHULDO HQ]\PH ,Q HXNDU\RWHV VXFK DSSHQGHG GRPDLQV DUH FRPPRQ LQ WKHVH SURWHLQV DQG PD\ VHUYH WR RYHUFRPH FRQGLWLRQV WKDW ZRXOG RWKHUZLVH ZHDNHQ RU GLVUXSW WKH IRUPDWLRQ RI D FULWLFDO 51$SURWHLQ FRPSOH[ :KHOLKDQ DQG 6FKLPPHO f ,Q RUGHU WR UHILQH WKH PDSSLQJ RI WKH FURVVOLQN VLWHV LGHQWLILHG LQ WKH WHUPLQDO IUDJPHQWV QLWURWKLRF\DQREHQ]RDWH 17&%f VSHFLILF WR F\VWHLQHV -DFREVRQ HW DO 'HJDQL DQG 3DWFKRUQLN f ZDV HPSOR\HG DV FOHDYDJH ZLWK WKLV UHDJHQW JHQHUDWHV VHYHUDO SHSWLGHV ZLWKLQ WKH WHUPLQL RI &ES 7KH DYDLODELOLW\ RI KLVWDJJHG DQG QDWLYH YHUVLRQV RI &ES ZDV H[SORLWHG WR XQDPELJXRXVO\ PDS WKH 1WHUPLQDO FRQWDFW VLWH WR WKH ILUVW DPLQR DFLG UHVLGXHV RI &ES E\ 17&% FOHDYDJH )LJXUH f 7KH &WHUPLQDO FRQWDFW VLWH ZDV WHQWDWLYHO\ PDSSHG WR D UHJLRQ VSDQQLQJ DDDD DV WKH H[WUHPH &WHUPLQDO IUDJPHQW IDLOHG WR

PAGE 123

FURVVOLQN LQWURQ 51$ $WWHPSWV WR SLQSRLQW WKH 51$ FRQWDFW VLWHV LQ WKLV DPLQR DFLGUHJLRQ ZHUH QRW VXFFHVVIXO DV WKH SHSWLGHV JHQHUDWHG E\ D FRPELQDWLRQ RI 1+2+ DQG F\DQRJHQ EURPLGH ZHUH WRR VPDOO WR EH UHVROYHG E\ WKH WULVWULFLQH JHO V\VWHP 7KH XVH RI +3/& RU PDVV VSHFWURPHWU\ WR UHVROYH WKHVH VPDOOHU FURVVOLQNHG SHSWLGHV ZLOO DOOHYLDWH WKLV SUREOHP DQG OHDG WR WKH LGHQWLILFDWLRQ RI WKH VSHFLILF &WHUPLQDO UHVLGXHV WKDW FURVVOLQN WR LQWURQ 51$ 7KXV WKH UHVXOWV RI WKH VWXG\ KDYH OHG WR WKH LGHQWLILFDWLRQ RI NH\ DPLQR DFLG UHVLGXHV LQ WKH 1 WHUPLQXV WKDW DUH FULWLFDO IRU &ES IXQFWLRQ )LQH VWUXFWXUH PDSSLQJ RI WKHVH 51$ FRQWDFW VLWHV XVLQJ RWKHU FOHDYDJH UHDJHQWV ZLOO HYHQWXDOO\ OHDG WR D EHWWHU XQGHUVWDQGLQJ RI WKH PHFKDQLVPV XQGHUO\LQJ &ESLQWURQ 51$ LQWHUDFWLRQV ,W LV LQWHUHVWLQJ WR QRWH WKDW WKH WZR VWURQJ 51$ FRQWDFW VLWHV LGHQWLILHG E\ 89 FURVVOLQNLQJ FXUUHQW VWXG\f DUH GLVWDOO\ ORFDWHG DW WKH 1 DQG &WHUPLQL RI &ES ,W LV SRVVLEOH WKDW WKHVH WHUPLQDO UHJLRQV FRQWDFW LPSRUWDQW HOHPHQWV RI WKH LQWURQ WKDW DUH ZLGHO\ VHSDUDWHG LQ WKH VHFRQGDU\ VWUXFWXUH DQG VWDELOL]H WKH DFWLYH LQWURQ VWUXFWXUH 7KLV LQ IDFW VHHPV WR EH WKH FDVH &KHPLFDO PRGLILFDWLRQ DQG 89 FURVVOLQNLQJ VWXGLHV RI WKH &ESLQWURQ 51$ FRPSOH[ VKRZ WKDW &ES PDNHV LQWLPDWH FRQWDFWV LQ PXOWLSOH UHJLRQV RI WKH 51$ VXFK DV 3, / 3 DQG 3D RI LQWURQ 51$ 6KDZ DQG /HZLQ f ,Q DGGLWLRQ &ES DSSHDUV WR ELQG DFURVV 3 VDQGZLFKLQJ 3,3 EHWZHHQ 3 DQG WKH UHVW RI WKH FRUH :HHNV DQG &HFK f 7KXV &ES SURWHLQ DSSHDUV WR ELQG RQH IDFH RI LQWURQ 51$ ZLWK DQ HVWLPDWHG GLVWDQFH RI ƒ EHWZHHQ WKH SURWHFWHG UHJLRQV 7KLV GLVWDQFH LQ WKHRU\ FDQ EH UHDGLO\ VSDQQHG E\ WKH DDORQJ &ES SURWHLQ :HHNV DQG &HFK Ef

PAGE 124

7KH LPSRUWDQFH RI 1WHUPLQDO UHVLGXHV DDODD LGHQWLILHG E\ 89 FURVVOLQNLQJf IRU &ES IXQFWLRQ ZDV IXUWKHU LQYHVWLJDWHG E\ VLWHGLUHFWHG PXWDJHQHVLV $ SRWHQWLDO 51$ ELQGLQJ UHJLRQ DDO6665<5<.)10(DDf LGHQWLILHG E\ SK\VLFDO VFDQQLQJ RI WKH ILUVW UHVLGXHV RI &ES ZDV WDUJHWHG IRU VLQJOH DQG FOXVWHU PXWDJHQHVLV 'HOHWLRQ RI WKLV DPLQR DFLG UHJLRQ DDODDf LQ WKH 1WHUPLQXV SURGXFHG D PXWDQW SURWHLQ WKDW IDLOHG WR H[KLELW DQ\ GHWHFWDEOH VSOLFLQJ DFWLYLW\ EXW UHWDLQHG D QHDU QDWLYH FRQIRUPDWLRQ DV FRQILUPHG E\ SDUWLDO WU\SWLF SURILOHVf 7KLV GHPRQVWUDWHG WKDW WKH DPLQR DFLG UHJLRQ DDO 6665<5<.)10(DDf LQ WKH 1WHUPLQXV ZDV LQGLVSHQVDEOH IRU &ES IXQFWLRQ 7KH DPLQR DFLGORQJ 51$ FRQWDFW VLWH LGHQWLILHG E\ GHOHWLRQ DQDO\VLV ZDV SUREHG IXUWKHU WR HYDOXDWH WKH LPSRUWDQFH RI LQGLYLGXDO DPLQR DFLG UHVLGXHV IRU &ES51$ LQWHUDFWLRQV 7KLV 51$ ELQGLQJ UHJLRQ FRQWDLQV WKUHH DURPDWLF UHVLGXHV WKDW DOWHUQDWH ZLWK WKUHH FKDUJHG UHVLGXHV ,W ZDV K\SRWKHVL]HG WKDW UHPRYLQJ WKH DURPDWLF UHVLGXHV ZRXOG KDYH PRUH GUDVWLF HIIHFWV RQ &ES IXQFWLRQ FRPSDUHG WR FKDUJHG UHVLGXHV DV WKH IRUPHU RIWHQ HQJDJH LQ FRQWDFWV WKDW DUH PRUH LQWLPDWH ZLWK 51$ E\ VWDFNLQJ ZLWK WKH EDVHV $ WULSOH DURPDWLF PXWDQW < < DQG ) WR OHXFLQHf DQG D WULSOH FKDUJHG PXWDQW 5 5 DQG WR OHXFLQHf ZHUH FRQVWUXFWHG WR WHVW WKLV K\SRWKHVLV /HXFLQH ZDV FKRVHQ WR VXEVWLWXWH WKHVH UHVLGXHV EHFDXVH RI VLPLODU FKDLQ OHQJWKV 7KLV ZRXOG DOORZ VXUIDFH SURSHUWLHV WR EH DOWHUHG ZLWK PLQLPDO SHUWXUEDWLRQ RI WKH WRSRORJ\ RI PXWDQW SURWHLQV $V H[SHFWHG WKH WULSOH DURPDWLF PXWDQW FRPSOHWHO\ DEURJDWHG &ES IXQFWLRQ ZKLOH WKH WULSOH FKDUJHG PXWDQW GLVSOD\HG SDUWLDO DFWLYLW\ ZLWK DQ LQLWLDO UDWH RI VSOLFLQJ aIROG

PAGE 125

ORZHU WKDQ WKDW RI ZLOGW\SH SURWHLQ 6LQFH WKH WULSOH DURPDWLF PXWDQW ZDV FRPSOHWHO\ GHIHFWLYH LQ VSOLFLQJ WKH DURPDWLF UHVLGXHV < < DQG ) ZHUH LQGHSHQGHQWO\ VXEVWLWXWHG ZLWK OHXFLQH WR HYDOXDWH WKH FRQWULEXWLRQ RI HDFK UHVLGXH IRU &ES IXQFWLRQ 7KH VLQJOH PXWDWLRQ FKDQJLQJ < WR OHXFLQH ORZHUHG WKH VSOLFLQJ UDWH E\ aIROG FRPSDUHG WR ZLOGW\SH &ES VLPLODU WR WKH WULSOH FKDUJHG PXWDQWf +RZHYHU WKH PXWDWLRQ FRQYHUWLQJ ) WR OHXFLQH GLG QRW DIIHFW VSOLFLQJ 7KH
PAGE 126

7KH SDQHO RI PXWDQWV GHVFULEHG DERYH ZDV DOVR FKDUDFWHUL]HG IRU 51$ ELQGLQJ E\ HTXLOLEULXP ILOWHU ELQGLQJ DVVD\V :RQJ DQG /RKPDQ f 7KH JHQHUDO 51$ ELQGLQJ SURILOHV RI DOO PXWDQW SURWHLQV ZHUH PRUH RU OHVV FRPSDUDEOH WR WKDW RI ZLOGW\SH &ES LQGLFDWLQJ OLWWOH RU QR SHUWXUEDWLRQ RI WKH QDWLYH FRQIRUPDWLRQ RI WKHVH SURWHLQV +RZHYHU WKH GLVVRFLDWLRQ FRQVWDQWV RI PXWDQW SURWHLQV ZHUH IRXQG WR EH YDULDEOH )RU H[DPSOH WKH
PAGE 127

FRPSHWLWRU VXFK DV W51$ WR D SDUWLDOO\ LQKLELWHG UHDFWLRQ DW UDWLRVf FRPSOHWHO\ DOOHYLDWHG WKLV LQKLELWLRQ VXJJHVWLQJ WKDW QRQVSHFLILF LQWHUDWLRQV PD\ SUHGRPLQDWH DW KLJKHU SURWHLQ FRQFHQWUDWLRQV SUHYHQWLQJ WKH IRUPDWLRQ RI D SURGXFWLYH 513 FRPSOH[ 51$ KDV WZR IXQGDPHQWDO IROGLQJ SUREOHPV D WHQGHQF\ WR EHFRPH NLQHWLFDOO\ WUDSSHG LQ DOWHUQDWLYH FRQIRUPDWLRQV DQG D GLIILFXOW\ LQ VSHFLI\LQJ D VLQJOH WHUWLDU\ VWUXFWXUH WKDW LV WKHUPRG\QDPLFDOO\ IDYRUHG RYHU FRPSHWLQJ VWUXFWXUHV +HUVFKODJ f 1RQVSHFLILF 51$ELQGLQJ SURWHLQV VROYH WKH NLQHWLF SUREOHP E\ DFWLQJ DV 51$ FKDSHURQHV WKDW HLWKHU SUHYHQW PLVIROGLQJ RU UHVROYH PLVIROGHG 51$ LQ YLYR 0XQURH DQG 'RQJ f 2Q WKH RWKHU KDQG VSHFLILF 51$ELQGLQJ SURWHLQV RYHUFRPH WKH WKHUPRG\QDPLF IROGLQJ SUREOHP E\ VWDELOL]LQJ D VSHFLILF WHUWLDU\ VWUXFWXUH :HHNV DQG &HFK f 6XFK SURWHLQV FDQ DOVR KDYH 51$ FKDSHURQHn OLNH DFWLYLWLHV QRQVSHFLILF ELQGLQJf WKDW KHOS SUHYHQW PLVIROGLQJ RI WKHLU FRJQDWH 51$V +HUVFKODJ f $Q LQYHVWLJDWLRQ RI 0J GHSHQGHQW IROGLQJ RI WKH 7HWUDK\PHQD ULER]\PH UHYHDOHG WKDW WKLV ODUJH 51$ SDUWLWLRQV LQWR D SRSXODWLRQ WKDW UDSLGO\ UHDFKHV WKH QDWLYH VWDWH DQG D VORZIROGLQJ SRSXODWLRQ WKDW LV WUDSSHG LQ PHWDVWDEOH PLVIROGHG VWUXFWXUHV 7UDQVLWLRQ IURP WKLV PLVIROGHG WR WKH QDWLYH VWDWH LQYROYHV SDUWLDO XQIROGLQJ 7KXV IROGLQJ RI ODUJH 51$ PROHFXOHV DSSHDUV WR LQYROYH PXOWLSOH SDUDOOHO SDWKZD\V ZLWK QRQQDWLYH LQWHUPHGLDWHV GRPLQDWLQJ WKH IROGLQJ NLQHWLFV 3DQ HW DK f +\GUR[\O UDGLFDO IRRWSULQWLQJ RI 7HWUDK\PHQD ULER]\PH XVLQJ D V\QFKURWURQ [UD\ EHDP HQDEOHG WKH VWXG\ RI 51$ IROGLQJ DW PLOOLVHFRQG LQWHUYDOV

PAGE 128

6FODYL HW DL f 7KH VWXG\ UHYHDOHG WKDW 33 WKH PRVW VWDEOH GRPDLQ RI WKH WHUWLDU\ VWUXFWXUH IROGV ZLWKLQ VHFRQGV ZKLOH FRPSOHWH IROGLQJ RI WKH FDWDO\WLF FHQWHU WDNHV PLQXWHV VXJJHVWLQJ WKDW 33 DQRWKHU PDMRU GRPDLQ RI WKH FDWDO\WLF FRUHf UHPDLQV GLVRUGHUHG XQWLO ODWH LQ WKH IROGLQJ SURFHVV $Q DOWHUQDWH NLQHWLF EDUULHU WR 0J GHSHQGHQW IROGLQJ RI 7HWUDK\PHQD ULER]\PH ZDV FRQFXUUHQWO\ SURSRVHG E\ 7UHLEHU HW DO f ,Q YLWUR VHOHFWLRQ ZDV HPSOR\HG WR LGHQWLI\ PXWDQW ULER]\PHV ZLWK DFFHOHUDWHG IROGLQJ RI WKH 33 GRPDLQ 0XWDWLRQV WKDW LQFUHDVHG WKH UDWH RI 33 IRUPDWLRQ ZHUH IRXQG WR GHVWDELOL]H WKH 33 GRPDLQ VXJJHVWLQJ WKDW WKH ODWWHU PD\ VHUYH DV D QDWLYH NLQHWLF WUDS LQ 7HWUDK\PHQD ULER]\PH IROGLQJ 7KH DXWKRUV SURSRVHG WKDW NLQHWLF WUDSV VWDELOL]HG E\ QDWLYH LQWHUDFWLRQV LQ DGGLWLRQ WR PLVIROGHG QRQQDWLYH VWUXFWXUHV FDQ SUHVHQW D VXEVWDQWLDO EDUULHU WR 51$ IROGLQJ $QDORJRXV WR WKH 7HWUDK\PHQD ULER]\PH WKH VHOIVSOLFLQJ RI LQWURQ 51$ LV QRW HIILFLHQW 7KH UDWH RI VHOIVSOLFLQJ LV HVWLPDWHG WR EH IROG VORZHU WKDQ WKDW RI &ESIDFLOLWDWHG UHDFWLRQ DW SK\VLRORJLFDO S+ DQG 0J FRQFHQWUDWLRQV :HHNV DQG &HFK Df $W VDWXUDWLQJ 0J FRQFHQWUDWLRQV P0f VHOIVSOLFLQJ LV IROG VORZHU WKDQ WKH SURWHLQIDFLOLWDWHG UHDFWLRQ VXJJHVWLQJ WKDW KLJK 0J FRQFHQWUDWLRQV FDQQRW FRPSOHWHO\ FRPSHQVDWH IRU &ES IXQFWLRQ ,W ZDV SURSRVHG WKDW WUDQVLWLRQ IURP DQ LQWHUPHGLDWH WR WKH DFWLYH HQ]\PH VWDWH FRXOG SRVH D SRWHQWLDO EDUULHU IRU VHOIVSOLFLQJ 6XEVHTXHQWO\ FKHPLFDO PRGLILFDWLRQ VWXGLHV E\ :HHNV DQG &HFK Ef LQGLFDWHG WKDW WKH VORZ UDWH RI VHOIVSOLFLQJ ZDV GXH WR WKH IRUPDWLRQ RI D SDUWLDOO\ IROGHG VWUXFWXUDO LQWHUPHGLDWH LQ ZKLFK WKH FDWDO\WLF

PAGE 129

FRUH ZDV IRUPHG EXW WKH f GRPDLQ 3,f ZDV QRW GRFNHG %DVHG RQ WKHVH DQG RWKHU VWXGLHV LW ZDV SURSRVHG WKDW &ES IDFLOLWDWHV VSOLFLQJ E\ DVVHPEOLQJ SUHIRUPHG 51$ VHFRQGDU\ VWUXFWXUH HOHPHQWV LQWR D VSHFLILF WKUHHGLPHQVLRQDO DUUD\ IRUPDWLRQ RI FDWDO\WLF FRUH DQG 3, GRFNLQJf :HHNV DQG &HFK D Ef DQG VHUYHV SULPDULO\ WR FDSWXUH RWKHUZLVH WUDQVLHQW 51$ WHUWLDU\ VWUXFWXUHV :HHNV DQG &HFK f +RZHYHU 6KDZ DQG /HZLQ f EDVHG RQ FKHPLFDO DQG HQ]\PDWLF PRGLILFDWLRQ VWXGLHV UHSRUWHG WKDW &ES IDFLOLWDWHV WKH IRUPDWLRQ RI VHFRQGDU\ VWUXFWXUHV LQ DGGLWLRQ WR VWLPXODWLQJ WHUWLDU\ LQWHUDFWLRQV 7KH\ DOVR IRXQG WKDW &ES FDQ QXFOHDWH WKH IRUPDWLRQ RI WKH FDWDO\WLF FRUH LQ WKH DEVHQFH RI 0J E\ SURPRWLQJ GXSOH[ IRUPDWLRQ ZLWKLQ 33 DQG 33 ZLWK 0J DGGLWLRQ OHDGLQJ WR UDSLG FDWDO\WLF DFWLYDWLRQ RI WKLV IROGLQJ LQWHUPHGLDWH 6KDZ DQG /HZLQ PDQXVFULSW LQ SUHSDUDWLRQf 7KXV WKHUH DUH PHFKDQLVWLF JDSV LQ RXU FXUUHQW XQGHUVWDQGLQJ RI WKH YDULRXV UROHV DWWULEXWHG WR &ES PDNLQJ WKH JOREDO SLFWXUH SHUSOH[LQJ 7KH UHVXOWV RI WKH FXUUHQW VWXG\ SURYLGH LQWHUHVWLQJ SHUVSHFWLYHV WR DFFRPPRGDWH WKH REVHUYHG SOHLRWURSLF HIIHFWV RI &ES RQ WKH SURFHVVLQJ RI LQWURQ 51$ DV GLVFXVVHG EHORZ 7KH (FROL 6 ULERVRPDO SURWHLQ IDFLOLWDWHV SURSHU IROGLQJ RI JURXS LQWURQV IURP EDFWHULRSKDJH 7 E\ QRQVSHFLILF ELQGLQJ VXJJHVWLQJ D VHFRQG PHFKDQLVP IRU VWLPXODWLRQ RI JURXS LQWURQ VSOLFLQJ LQ YLYR &RHW]HH HW DO +HUVFKODJ f 7KH 6 SURWHLQ GRHV QRW SUHIHUHQWLDOO\ ELQG WR JURXS LQWURQV RYHU H[RQV RU RWKHU 51$V LQGLFDWLQJ WKDW VSOLFLQJ LV IDFLOLWDWHG E\ D QRQVSHFLILF PRGH RI DFWLRQ UDWKHU WKDQ E\ VSHFLILF VWDELOL]DWLRQ RI WKH FDWDO\WLF FRUH 7KH SURWHLQ FDQ

PAGE 130

DOVR IDFLOLWDWH DQ XQUHODWHG UHDFWLRQ VXFK DV FDWDO\VLV RI D KDPPHUKHDG ULER]\PH ++f &RHW]HH HW DO f VLPLODU WR WKH WZR ZLGHO\ VWXGLHG 51$ FKDSHURQHV WKH QXFOHRFDSVLG SURWHLQ 1&f RI +,9 DQG WKH KQ513 $O SURWHLQ 6 FDQ DOVR SURPRWH WKH VSOLFLQJ RI NLQHWLFDOO\ WUDSSHG LQDFWLYH SUHFXUVRU 51$ VXJJHVWLQJ DQ DELOLW\ WR UHVROYH PLVIROGHG 51$ VWUXFWXUHV DQDORJRXV WR 51$ FKDSHURQHV )LQDOO\ 6 SURWHLQ VWLPXODWHV JURXS LQWURQ VHOIVSOLFLQJ HYHQ DIWHU UHPRYDO E\ SURWHRO\VLV SULRU WR WKH LQLWLDWLRQ RI VSOLFLQJ IXUWKHU FRQILUPLQJ WKDW WKH SURWHLQ LV VROHO\ UHTXLUHG IRU IROGLQJ VLPLODU WR D SURWHLQ FKDSHURQH WKDW IXQFWLRQV VROHO\ GXULQJ D IROGLQJ VWHS DQG LV QRW SUHVHQW LQ WKH ILQDO DFWLYH VSHFLHV 7KH DELOLW\ RI 6 ULERVRPDO SURWHLQ WR DFW DV DQ 51$ FKDSHURQH LQ WKH IROGLQJ RI JURXS LQWURQV LQ YLWUR UDLVHV WKH LQWHUHVWLQJ SRVVLELOLW\ WKDW D FKDSHURQHOLNH DFWLYLW\ LQ VSHFLILF 51$ELQGLQJ SURWHLQV FRXOG DOVR VROYH WKH NLQHWLF SUREOHPV RI 51$ IROGLQJ %DVHG RQ WKLV LGHD +HUVFKODJ f SURSRVHG WKDW VSHFLILF 51$ ELQGLQJ SURWHLQV FRXOG RYHUFRPH WKH NLQHWLF SUREOHPV RI 51$ IROGLQJ E\ IROORZLQJ D fSUHDVVRFLDWLRQf ELQGLQJ PHFKDQLVP $FFRUGLQJ WR WKLV WKH SURWHLQ LQLWLDOO\ HQJDJHV LQ QRQVSHFLILF DQG RU D VXEVHW RI VSHFLILF LQWHUDFWLRQV WR ELQG WKH XQIROGHG 51$ DQG SUHYHQW PLVIROGLQJ 6XEVHTXHQWO\ WKH 51$ VWUXFWXUH XQGHUJRHV FRQIRUPDWLRQDO UHDUUDQJHPHQWV ZLWKLQ WKH FRPSOH[ YLD PXOWLSOH GLVVRFLDWLRQV DQG DVVRFLDWLRQV XQWLO WKH FRUUHFW FRQIRUPDWLRQ LV DWWDLQHG DQG WUDSSHG E\ VSHFLILF LQWHUDFWLRQV ZLWK WKH SURWHLQ 7KH KLJK OHYHOV RI QRQVSHFLILF ELQGLQJ H[KLELWHG E\ VRPH VSHFLILF 51$ELQGLQJ SURWHLQV OLNH WKH &\W SURWHLQ

PAGE 131

RI 1HXURVSRUD 6DOGDQKD HW DO f RU WKH &ES SURWHLQ WKLV VWXG\f FRXOG UHIOHFW WKLV FKDSHURQH DFWLYLW\ (TXLOLEULXP ELQGLQJ VWXGLHV VKRZ WKDW &ES IDLOV WR GLVFULPLQDWH EHWZHHQ FRJQDWH LQWURQ f DQG QRQFRJQDWH QUG% LQWURQf 51$V DW ORZ 0J FRQFHQWUDWLRQV P0f VXJJHVWLQJ WKDW WKH SURWHLQ PD\ HLWKHU SRVVHVV D VWURQJ JHQHUDOL]HG 51$ ELQGLQJ DELOLW\ RU PD\ UHFRJQL]H LQ SDUW IHDWXUHV FRQVHUYHG DPRQJ JURXS LQWURQV :HHNV DQG &HFK Df (TXLOLEULXP ILOWHU ELQGLQJ DQDO\VLV RI ZLOGW\SH DQG VSOLFLQJGHIHFWLYH &ES PXWDQWV UHYHDOHG PRUH RU OHVV FRPSDUDEOH 51$ ELQGLQJ SURILOHV GHPRQVWUDWLQJ WKDW &ES SRVVHVVHV VXEVWDQWLDO QRQVSHFLILF RU JHQHUDOL]HG 51$ ELQGLQJ DELOLW\ DQG WKDW PXWDWLRQV GLVUXSWLQJ WKH VSOLFLQJHQKDQFHPHQW IXQFWLRQ GR QRW DIIHFW WKLV SURSHUW\ )LJXUH f 7KLV QRQ VSHFLILF 51$ ELQGLQJ GLVSOD\HG E\ &ES DW SK\VLRORJLFDO 0J FRQFHQWUDWLRQV VXJJHVWV WKDW WKH SURWHLQ PD\ HQJDJH LQ D FKDSHURQHOLNH DFWLYLW\ LQ YLYR &ES VWLPXODWHV LQWURQ 51$ VSOLFLQJ RQO\ LQ D QDUURZ UDQJH RI SURWHLQ51$ UDWLRV ZLWK VHYHUH LQKLELWLRQ RI VSOLFLQJ DFWLYLW\ DW KLJKHU FRQFHQWUDWLRQV RI SURWHLQ $GGLWLRQ RI D QRQVSHFLILF FRPSHWLWRU OLNH W51$ DOOHYLDWHV WKLV LQKLELWLRQ )LJXUH f ,QKLELWLRQ RI 51$ IXQFWLRQ DW KLJKHU SURWHLQ FRQFHQWUDWLRQV KDV EHHQ UHSRUWHG IRU 51$ FKDSHURQHV VXFK DV KQ513 $O &O 8 0XQURH DQG 'RQJ 3RUWPDQ DQG 'UH\IXVV f DQG WKH QXFOHRFDSVLG 1&f SURWHLQ RI (IO9 +HUVFKODJ HW DO f ,Q WKH FDVH RI KQ513 $O LQKLELWLRQ RI 51$ DQQHDOLQJ DFWLYLW\ E\ H[FHVV SURWHLQ ZDV VSHFXODWHG WR DULVH IURP WKH VWDELOL]DWLRQ RI VLQJOH VWUDQGV 3RUWPDQ DQG 'UH\IXVV f )RU WKH 1& SURWHLQ WKH LQKLELWLRQ RI

PAGE 132

KDPPHUKHDG ++f FDWDO\VLV ZDV VKRZQ WR UHVXOW IURP SURWHLQ ELQGLQJ WR WKH ULER]\PHVXEVWUDWH FRPSOH[ EORFNLQJ WKH FOHDYDJH VWHS $OVR WKH LQKLELWLRQ REVHUYHG ZLWK H[FHVV 1& SURWHLQ FRXOG EH DOOHYLDWHG E\ WKH DGGLWLRQ RI VV'1$ D QRQVSHFLILF FRPSHWLWRU +HUVFKODJ HW DO f 7KXV KLJK FRQFHQWUDWLRQV RI WKHVH SURWHLQV DSSHDU WR ELQG PRUH VWURQJO\ WR D GHQDWXUHG RU LQDFWLYH FRQIRUPDWLRQ UDWKHU WKDQ WKH DFWLYH FRQIRUPDWLRQ RI 51$ VKXWWLQJ GRZQ 51$ IXQFWLRQ 6LPLODUO\ &ES PLJKW VWDELOL]H PLVIROGHG UDWKHU WKDQ QDWLYH FRQIRUPDWLRQV RI LQWURQ 51$ DW KLJK SURWHLQ51$ UDWLRV LQKLELWLQJ VSOLFLQJ 0RGLILFDWLRQ VWXGLHV DW KLJK SURWHLQ51$ UDWLRV ZRXOG YHULI\ WKLV K\SRWKHVLV DV WKH SURWHFWLRQ SDWWHUQV RI PLVIROGHG 51$ ZRXOG EH GLIIHUHQW IURP WKH FRUUHFWO\ IROGHG FRQIRUPDWLRQ REWDLQHG DW ORZ SURWHLP51$ UDWLRV WKDW DUH RSWLPDO IRU VSOLFLQJ 6KDZ DQG /HZLQ f 51$ FKDSHURQHV DV PHQWLRQHG HDUOLHU DLG LQ WKH SURFHVV RI 51$ IROGLQJ E\ SUHYHQWLQJ PLVIROGLQJ RU E\ UHVROYLQJ PLVIROGHG VSHFLHV )RU H[DPSOH 83 WKH 1WHUPLQDO IUDJPHQW RI KQ513 $O ZDV VKRZQ WR UHQDWXUH 6 51$ DQG VHYHUDO W51$V WKDW ZHUH NLQHWLFDOO\ WUDSSHG LQ DOWHUQDWH FRQIRUPDWLRQV .DUSHO HW DO f 6LPLODUO\ 1& SURWHLQ RI +,9 ZDV VKRZQ WR UHVROYH D NLQHWLFDOO\ WUDSSHG PLVIROGHG KDPPHUKHDG ULER]\PH FRPSOH[ %HUWUDQG DQG 5RVVL +HUVFKODJ HW DO 0XOOHU HW DO 7VXFKLKDVKL HW DO f 7KH &ES SURWHLQ DOVR DSSHDUV WR UHVROYH 51$ VWUXFWXUHV WKDW DUH NLQHWLFDOO\ WUDSSHG LQ PLVIROGHG FRQIRUPDWLRQV :HHNV DQG &HFK Ef UHSRUWHG WKH IRUPDWLRQ RI D SURPLVFXRXV LQDFWLYH 51$ VWUXFWXUH PRQLWRUHG E\ D 89FURVVOLQN EHWZHHQ WKH

PAGE 133

FRUH DQG fH[RQf DW ORZ 0J WKDW ZDV GHVWDELOL]HG LQ WKH SUHVHQFH RI &ES DQGRU KLJKHU FRQFHQWUDWLRQV RI 0J $OVR 6KDZ DQG /HZLQ PDQXVFULSW LQ SUHSDUDWLRQf REVHUYHG WKDW SUHLQFXEDWLRQ RI LQWURQ 51$ ZLWK &ES IROORZHG E\ DGGLWLRQ RI 0J P0f DQG *73 UHVXOWHG LQ LPPHGLDWH RQVHW RI VSOLFLQJ 2Q WKH RWKHU KDQG SUHLQFXEDWLRQ ZLWK 0J IROORZHG E\ DGGLWLRQ RI &ES DQG *73 FDXVHG D ODJ LQ VSOLFLQJ 7KLV ODJ PD\ UHVXOW IURP IRUPDWLRQ RI PLVIROGHG 51$ VWUXFWXUHV DW ORZ 0J WKDW PD\ KDYH WR EH UHVROYHG E\ &ES EHIRUH VSOLFLQJ FDQ RFFXU ,Q DGGLWLRQ &ES ZKHQ SUHVHQW GXULQJ WUDQVFULSWLRQ RI LQWURQ 51$ FDQ PLWLJDWH WKH HIIHFWV RI FHUWDLQ 51$ PXWDWLRQV WKDW FDQQRW EH UHVFXHG E\ DGGLWLRQ RI SURWHLQ DIWHU WUDQVFULSWLRQ /HZLQ HW DO 6KDZ HW DO f 7KXV GXULQJ FR WUDQVFULSWLRQDO VSOLFLQJ &ES DSSHDUV WR ELQG WR QDVFHQW WUDQVFULSWV DQG KHOS ELDV WKH 51$ WR IROG FRUUHFWO\ 7KH UHFHQW ILQGLQJ WKDW WKH 33 GRPDLQ DFWV DV D QDWLYH NLQHWLF WUDS IRU WKH 0J GHSHQGHQW IROGLQJ RI WKH 7HWUDK\PHQD ULER]\PH VORZLQJ WKH IROGLQJ RI WKH 33 GRPDLQ 7ULHEHU HW DO f UDLVHV WKH LQWHUHVWLQJ SRVVLELOLW\ WKDW VWDELOL]DWLRQ RI 33 GRPDLQ VHUYHV DV D PHDQV WR HQVXUH FRUUHFW 51$ IROGLQJ 51$ELQGLQJ SURWHLQV WKDW VWDELOL]H 33 GRPDLQ PD\ VHUYH D VLPLODU SXUSRVH 7KH &\WO SURWHLQ RI 1HXURVSRUD FUDVVD ZKLFK SURPRWHV WKH VSOLFLQJ RI VHYHUDO PLWRFKRQGULDO JURXS LQWURQV KDV EHHQ VKRZQ WR ELQG DQG VWDELOL]H WKH 33 GRPDLQ RI LWV FRJQDWH 51$ 6DOGDQKD HW DO f 6LPLODUO\ WKH &ES SURWHLQ RI 6 FHUHYLVLDH KDV EHHQ WR VKRZQ WR PDNH LQWLPDWH FRQWDFWV LQ WKH 33 GRPDLQ RI LQWURQ 51$ 6KDZ DQG /HZLQ f DQG VWDELOL]H WKLV GRPDLQ HYHQ LQ WKH

PAGE 134

DEVHQFH RI 0J 6KDZ DQG /HZLQ PDQXVFULSW LQ SUHSDUDWLRQf 7KRXJK WKH &\W DQG &ES SURWHLQV DUH VSHFLILF 51$ELQGLQJ SURWHLQV WKDW SURPRWH VSOLFLQJ RI RQO\ FRJQDWH 51$V WKH\ H[KLELW VXEVWDQWLDO QRQVSHFLILF 51$ ELQGLQJ DFWLYLW\ 6DOGDQKD HW DO FXUUHQW VWXG\f D SURSHUW\ RI 51$ FKDSHURQHV 51$ FKDSHURQHV DUH NQRZQ WR DLG LQ FRUUHFW 51$ IROGLQJ E\ SUHYHQWLQJ RU VORZLQJ WKH IRUPDWLRQ RI FHUWDLQ PLVIROGHG LQWUDPROHFXODU VWUXFWXUHV +HUVFKODJ f ,W LV WKHUHIRUH LQWHUHVWLQJ WR VSHFXODWH WKDW 51$ELQGLQJ SURWHLQV VXFK DV &ES DQG SHUKDSV &\Wf ZKLFK VWDELOL]H WKH IRUPDWLRQ RI WKH 33 GRPDLQ PD\ DOVR VORZ WKH IROGLQJ RI WKH UHVW RI WKH PROHFXOH DV D PHDQV WR IDFLOLWDWH FRUUHFW 51$ IROGLQJ SUHYHQWLQJ WKH IRUPDWLRQ RI PLVIROGHG VWUXFWXUHV $IWHU &ES IDFLOLWDWHV WKH IRUPDWLRQ RI WKH FDWDO\WLF VWUXFWXUH RI LQWURQ 51$ LQ WKH SUHVHQFH RI 0J f WKH SURWHLQ FDQ EH UHPRYHG E\ SURWHLQDVH GLJHVWLRQ SULRU WR WKH LQLWLDWLRQ RI VSOLFLQJ ZLWKRXW VLJQLILFDQW UHGXFWLRQ LQ FDWDO\WLF DFWLYLW\ 6KDZ DQG /HZLQ PDQXVFULSW LQ SUHSDUDWLRQf 7KLV VXJJHVWV WKDW &ES LV VROHO\ UHTXLUHG IRU IROGLQJ VLPLODU WR WKH 6 ULERVRPDO SURWHLQ RI ( FROL DQ 51$ FKDSHURQH 51$ FKDSHURQHV PD\ VWD\ ERXQG WR FRUUHFWO\ IROGHG 51$ DIWHU H[HUWLQJ WKHLU FKDSHURQH DFWLYLW\ GXH WR WKH VWUHQJWK RI QRQVSHFLILF 51$SURWHLQ LQWHUDFWLRQV VHUYLQJ DGGLWLRQDO VSHFLILF UROHV +HUVFKODJ HW DO f )RU H[DPSOH WKH QXFOHRFDSVLG 1&f SURWHLQ RI +,9 DQ 51$ FKDSHURQH HQKDQFHV FDWDO\VLV RI WKH KDPPHUKHDG ULER]\PH ++f E\ QRW RQO\ LQFUHDVLQJ WKH UDWH RI DQQHDOLQJ RI WKH ULER]\PHVXEVWUDWH FRPSOH[ EXW DOVR E\ VWLPXODWLQJ WKH UDWH RI GLVVRFLDWLRQ RI WKH SURGXFWV +HUVFKODJ HW DO f ,Q WKH FDVH RI &ES WKHUH LV

PAGE 135

HYLGHQFH WKDW WKH SURWHLQ PD\ UHPDLQ ERXQG WR WKH VSOLFLQJ LQWHUPHGLDWHV GXULQJ FDWDO\VLV 2UJDQLF H[WUDFWLRQ RI SURWHLQDVH WUHDWHG VSOLFLQJ UHDFWLRQV GHVFULEHG DERYHf UHVXOWHG LQ VHOHFWLYH UHPRYDO RI WKH XQVSOLFHG SUHFXUVRU DQG VSOLFLQJ LQWHUPHGLDWHV f H[RQ DQG LQWURQf H[RQf IURP WKH DTXHRXV SKDVH ZKLOH WKH VSOLFHG SURGXFWV OLJDWHG H[RQV DQG IUHH LQWURQf UHPDLQHG LQ WKH DTXHRXV SKDVH 6KDZ DQG /HZLQ PDQXVFULSW LQ SUHSDUDWLRQf 0HL DQG +HUVFKODJ f SURSRVHG WKDW WKH UHOHDVH RI OLJDWHG H[RQV LQ YLYR IRU WKH 7HWUDK\PHQD JURXS LQWURQ UHDFWLRQ FRXOG EH DFFRPSOLVKHG E\ FKDQJHV LQ 51$ VWUXFWXUH EURXJKW DERXW E\ HLWKHU IHDWXUHV LQWULQVLF WR WKH LQWURQ RU FHOOXODU FRPSRQHQWV VXFK DV 51$ FKDSHURQHV $VVRFLDWLRQ RI &ES SURWHLQ ZLWK WKH VSOLFLQJ LQWHUPHGLDWHV GXULQJ FDWDO\VLV VXJJHVWV WKDW WKLV SURWHLQ FRXOG KDYH DQ DGGLWLRQDO UROH LQ WKH GLVVRFLDWLRQ RI VSOLFHG SURGXFWV EHVLGHV IDFLOLWDWLQJ FRUUHFW 51$ IROGLQJ 7KXV &ES DSSHDUV WR KDYH PXOWLSOH UROHV LQ WKH IDFLOLWDWLRQ RI LQWURQ 51$ FDWDO\VLV 7KH QRQVSHFLILF 51$ ELQGLQJ RU FKDSHURQH DFWLYLW\ RI &ES PD\ VROYH YDULRXV NLQHWLF SUREOHPV RI 51$ IROGLQJ HQVXULQJ FRUUHFW IROGLQJ RI LQWURQ 51$ 7KH VSHFLILF 51$ ELQGLQJ DFWLYLW\ RI WKH SURWHLQ FDQ RYHUFRPH WKH WKHUPRG\QDPLF SUREOHP RI 51$ IROGLQJ E\ VWDELOL]LQJ WKH FDWDO\WLF FRQIRUPDWLRQ RI 51$ ,Q DGGLWLRQ &ES PD\ KDYH D VSHFLILF UROH LQ GLVVRFLDWLRQ RI WKH VSOLFHG SURGXFWV 9DULRXV VWHSV LQ WKH SURWHLQIDFLOLWDWHG VSOLFLQJ RI LQWURQ 51$ FDQ EH YLVXDOL]HG DV IROORZV &ES PD\ ELQG WR WKH XQIROGHG RU QDVFHQW 51$ DQG SURPRWH FRUUHFW 51$ IROGLQJ E\ HPSOR\LQJ ZHDN QRQVSHFLILF DQGRU D VXEVHW RI VSHFLILF LQWHUDFWLRQV &KDUJHG UHVLGXHV LQ WKH SURWHLQ VXFK DV 5 5 DQG .f PD\

PAGE 136

FRQWULEXWH WR WKLV QRQVSHFLILF 51$ ELQGLQJ FRPSRQHQW 7KH FRUUHFWO\ IROGHG 51$ PD\ WKHQ DFFHVV KLJK DIILQLW\ VLWHV VXFK DV WKH W\URVLQH UHVLGXH DW SRVLWLRQ f RQ WKH &ES SURWHLQ WKURXJK VSHFLILF LQWHUDFWLRQV OHDGLQJ WR VWDELOL]DWLRQ RI WKH FDWDO\WLF VWUXFWXUH DQG 51$ VSOLFLQJ )URP DQ HYROXWLRQDU\ YLHZSRLQW 51$ FKDSHURQHV PLJKW KDYH HYROYHG WR UHVFXH 51$ PROHFXOHV IURP NLQHWLF WUDSV DQG KHOS WKHP H[SORUH VWUXFWXUDO DOWHUQDWLYHV 7KHVH QRQVSHFLILF 51$ELQGLQJ SURWHLQV VXEVHTXHQWO\ PLJKW KDYH DFTXLUHG ELQGLQJ SUHIHUHQFHV YLD FRRSHUDWLRQ EHWZHHQ 51$ DQG SURWHLQVf DQG HYROYHG LQWR VSHFLILF 51$ELQGLQJ SURWHLQV )RU H[DPSOH KQ513 $ SURWHLQ ZKLFK KDV 51$ FKDSHURQH DFWLYLW\ +HUVFKODJ HW DO 3RUWPDQ DQG 'UH\ IXVV %HUWUDQG DQG 5RVVL f DSSHDUV WR KDYH DFTXLUHG D VSHFLILF UROH LQ VSOLFH VLWH VHOHFWLRQ &DFHUHV HW DK f 7KH 1& SURWHLQ RI +,9 KDV FKDSHURQH DFWLYLW\ DQG DSSHDUV WR ELQG VSHFLILFDOO\ WR YLUDO 51$ GXULQJ SDFNDJLQJ 7VXFKLKDVKL HW DO f 3URWHLQV LQYROYHG LQ JURXS LQWURQ VSOLFLQJ PLJKW KDYH HYROYHG IURP SUHn H[LVWLQJ 51$ELQGLQJ SURWHLQV $NLQV DQG /DPERZLW] /DPERZLW] DQG 3HUOPDQ f DV FRPSOH[ FDWDO\WLF 51$V DOVR DSSHDU WR KDYH RULJLQDWHG IURP SUHH[LVWLQJ VWUXFWXUHG 51$V HJ W51$V RU U51$Vf 7KH W\URV\O W51$ V\QWKHWDVH &\Wf RI 1 FUDVVD ZKLFK DOVR IDFLOLWDWHV WKH VSOLFLQJ RI VHYHUDO JURXS LQWURQV PLJKW KDYH DFTXLUHG WKLV SURSHUW\ UHODWLYHO\ ODWHU LQ HYROXWLRQ E\ UHFRJQL]LQJ D FRQVHUYHG W51$OLNH VWUXFWXUH LQ JURXS LQWURQV &DSUDUD HW DO f 6LQFH LQWURQ 51$ LV DOVR D JURXS LQWURQ LW LV OLNHO\ WKDW &ES

PAGE 137

UHFRJQL]HV D VLPLODU W51$OLNH VWUXFWXUDO PRWLI LQ LWV FRJQDWH 51$ ,W LV WHPSWLQJ WR VSHFXODWH WKDW WKH JHQHUDOL]HG 51$ ELQGLQJ DFWLYLW\ FRPPRQ WR WKHVH WZR SURWHLQV &\W DQG &ESf PD\ FRQWULEXWH WR UHFRJQLWLRQ RI WKLV FRQVHUYHG VWUXFWXUDO IHDWXUH RI JURXS LQWURQV ZKLOH WKH VSHFLILF 51$ ELQGLQJ DELOLW\ PD\ OLPLW VSOLFLQJ HQKDQFHPHQW WR WKHLU FRJQDWH 51$ SDUWQHUV ,W LV DOVR LQWHUHVWLQJ WR QRWH WKDW WKHVH SURWHLQV UHWDLQHG WKHLU DQFHVWUDO FKDSHURQHOLNH DFWLYLW\ HYHQ DIWHU HYROYLQJ LQWR VSHFLILF 51$ELQGLQJ SURWHLQV SHUKDSV WR WKHLU DGGHG DGYDQWDJH LQ VROYLQJ YDULRXV NLQHWLF SUREOHPV RI 51$ IROGLQJ

PAGE 138

/,67 2) 5()(5(1&(6 $NLQV 5 $ DQG $ 0 /DPERZLW] $ SURWHLQ UHTXLUHG IRU VSOLFLQJ JURXS LQWURQV LQ 1HXURVSRUD PLWRFKRQGULD LV PLWRFKRQGULDO W\URV\OW51$ V\QWKHWDVH RU D GHULYDWLYH WKHUHRI &HOO $QVHO 0F.LQQH\ 3 6 : 6FRWW 0 6ZDQVRQ ; *H DQG / *HKUNH $ SODQW YLUDO FRDW SURWHLQ 51$ ELQGLQJ FRQVHQVXV VHTXHQFH FRQWDLQV D FUXFLDO DUJLQLQH >SXEOLVKHG HUUDWXP DSSHDUV LQ (0%2 'HF f@ (0%2%DQURTXHV $ 'HODKRGGH DQG & -DFT $ PLWRFKRQGULDO 51$ PDWXUDVH JHQH WUDQVIHUUHG WR WKH \HDVW QXFOHXV FDQ FRQWURO PLWRFKRQGULDO P51$ VSOLFLQJ &HOO %DVV % / DQG 7 5 &HFK 6SHFLILF LQWHUDFWLRQ EHWZHHQ WKH VHOIVSOLFLQJ 51$ RI 7HWUDK\PHQD DQG LWV JXDQRVLQH VXEVWUDWH LPSOLFDWLRQV IRU ELRORJLFDO FDWDO\VLV E\ 51$ 1DWXUH %HDYLV 5 & DQG % 7 &KDLW 5DSLG VHQVLWLYH DQDO\VLV RI SURWHLQ PL[WXUHV E\ PDVV VSHFWURPHWU\ 3URF 1DWO $FDG 6FL 86$ %HHQ 0 DQG 7 5 &HFK 51$ DV DQ 51$ SRO\PHUDVH QHW HORQJDWLRQ RI DQ 51$ SULPHU FDWDO\]HG E\ WKH 7HWUDK\PHQD ULER]\PH 6FLHQFH %HOIRUW 0 DQG 3 6 3HUOPDQ 0HFKDQLVPV RI LQWURQ PRELOLW\ %LRO &KHP %HOO 3HGHUVHQ 6 4XLUN &O\PDQ DQG 0 %HOIRUW ,QWURQ PRELOLW\ LQ SKDJH 7 LV GHSHQGHQW XSRQ D GLVWLQFWLYH FODVV RI HQGRQXFOHDVHV DQG LQGHSHQGHQW RI '1$ VHTXHQFHV HQFRGLQJ WKH LQWURQ FRUH PHFKDQLVWLF DQG HYROXWLRQDU\ LPSOLFDWLRQV 1XFOHLF $FLGV 5HV %HQQHU 6 $ $ (OOLQJWRQ DQG $ 7DXHU 0RGHP PHWDEROLVP DV D SDOLPSVHVW RI WKH 51$ ZRUOG 3URF 1DWO $FDG 6FL 8 6 $

PAGE 139

%HYLODFTXD 3 & DQG 7 5 &HFK 0LQRUJURRYH UHFRJQLWLRQ RI GRXEOH VWUDQGHG 51$ E\ WKH GRXEOHVWUDQGHG 51$ELQGLQJ GRPDLQ IURP WKH 51$ DFWLYDWHG SURWHLQ NLQDVH 3.5 %LRFKHPLVWU\ %RPVWHLQ 3 &OHDYDJH DW DVQJO\ ERQGV ZLWK K\GUR[\ODPLQH 0HWKRGV (Q]\PRO %UHKP 6 / DQG 7 5 &HFK )DWH RI DQ LQWHUYHQLQJ VHTXHQFH ULERQXFOHLF DFLG H[FLVLRQ DQG F\FOL]DWLRQ RI WKH 7HWUDK\PHQD ULERVRPDO ULERQXFOHLF DFLG LQWHUYHQLQJ VHTXHQFH LQ YLYR %LRFKHPLVWU\ %XUG & DQG 'UH\IXVV &RQVHUYHG VWUXFWXUHV DQG GLYHUVLW\ RI IXQFWLRQV RI 51$ELQGLQJ SURWHLQV 6FLHQFH %XUNH 0 0ROHFXODU JHQHWLFV RI JURXS LQWURQV 51$ VWUXFWXUHV DQG SURWHLQ IDFWRUV UHTXLUHG IRU VSOLFLQJf§D UHYLHZ *HQH %\UN 0 DQG ( 0XHOOHU ,Q 5LERVRPDO 51$ DQG *URXS LQWURQV 5 *UHHQ DQG 5 6FKURHGHU HGf /DQGHV 5 $XVWLQ 7;f SS &DOQDQ % 6 %LDQFDODQD +XGVRQ DQG $ )UDQNHO $QDO\VLV RI DUJLQLQHULFK SHSWLGHV IURP WKH +,9 7DW SURWHLQ UHYHDOV XQXVXDO IHDWXUHV RI 51$ SURWHLQ UHFRJQLWLRQ *HQHV 'HY &DSUDUD 0 9 /HKQHUW $ 0 /DPERZLW] DQG ( :HVWKRI $ W\URV\O W51$ V\QWKHWDVH UHFRJQL]HV D FRQVHUYHG W51$OLNH VWUXFWXUDO PRWLI LQ WKH JURXS LQWURQ FDWDO\WLF FRUH &HOO &DULJQDQL 2 *URXGLQVN\ )UH]]D ( 6FKLDYRQ ( %HUJDQWLQR DQG 3 3 6ORQLPVNL $Q P51$ PDWXUDVH LV HQFRGHG E\ WKH ILUVW LQWURQ RI WKH PLWRFKRQGULDO JHQH IRU WKH VXEXQLW RI F\WRFKURPH R[LGDVH LQ 6 FHUHYLVLDH &HOO &DWH + DQG $ 'RXGQD 0HWDOELQGLQJ VLWHV LQ WKH PDMRU JURRYH RI D ODUJH ULER]\PH GRPDLQ 6WUXFWXUH &DWH + $ 5 *RRGLQJ ( 3RGHOO =KRX % / *ROGHQ $ $ 6]HZF]DN & ( .XQGURW 7 5 &HFK DQG $ 'RXGQD 51$ WHUWLDU\ VWUXFWXUH PHGLDWLRQ E\ DGHQRVLQH SODWIRUPV 6FLHQFH

PAGE 140

&HFK 7 5 7KH FKHPLVWU\ RI VHOIVSOLFLQJ 51$ DQG 51$ HQ]\PHV 6FLHQFH &HFK 7 5 &RQVHUYHG VHTXHQFHV DQG VWUXFWXUHV RI JURXS LQWURQV EXLOGLQJ DQ DFWLYH VLWH IRU 51$ FDWDO\VLVf§D UHYLHZ *HQH &HFK 7 5 6HOIVSOLFLQJ RI JURXS LQWURQV $QQX 5HY %LRFKHP &HFK 7 5 6HOIVSOLFLQJ 51$ LPSOLFDWLRQV IRU HYROXWLRQ ,QW5HY&\WRO &HFK 7 5 6 + 'DPEHUJHU DQG 5 5 *XWHOO 5HSUHVHQWDWLRQ RI WKH VHFRQGDU\ DQG WHUWLDU\ VWUXFWXUH RI JURXS LQWURQV 1DW 6WUXFW %LRO &KDLW % 7 5 :DQJ 5 & %HDYLV DQG 6 % .HQW 3URWHLQ ODGGHU VHTXHQFLQJ 6FLHQFH &KDQJ % < DQG 5 + 'RL &RQIRUPDWLRQDO SURSHUWLHV RI %DFLOOXV VXEWLOLV 51$ SRO\PHUDVH VLJPD $ IDFWRU GXULQJ WUDQVFULSWLRQ LQLWLDWLRQ %LRFKHP &KHPLDFN $ *DUULJD .LWWOH -U 5 $ $NLQV DQG $ 0 /DPERZLW] )XQFWLRQ RI 1HXURVSRUD PLWRFKRQGULDO W\URV\OW51$ V\QWKHWDVH LQ 51$ VSOLFLQJ UHTXLUHV DQ LGLRV\QFUDWLF GRPDLQ QRW IRXQG LQ RWKHU V\QWKHWDVHV &HOO &KX 0 &RUELQ $ *ULPHV DQG 6 + )UDQFLV $FWLYDWLRQ E\ F\FOLF *03 ELQGLQJ FDXVHV DQ DSSDUHQW FRQIRUPDWLRQDO FKDQJH LQ F*03 GHSHQGHQW SURWHLQ NLQDVH %LRO &KHP &OHJKRQ 9 DQG ) .OHVVLJ &KDUDFWHUL]DWLRQ RI WKH QXFOHLF DFLG ELQGLQJ UHJLRQ RI DGHQRYLUXV '1$ELQGLQJ SURWHLQ E\ SDUWLDO SURWHRO\VLV DQG SKRWRFKHPLFDO FURVVOLQNLQJ %LRO &KHP &RHW]HH 7 +HUVFKODJ DQG 0 %HOIRUW (VFKHULFKLD FROL SURWHLQV LQFOXGLQJ ULERVRPDO SURWHLQ 6, IDFLOLWDWH LQ YLWUR VSOLFLQJ RI SKDJH 7 LQWURQV E\ DFWLQJ DV 51$ FKDSHURQHV *HQHV 'HY

PAGE 141

&XPPLQJV 0 'RPHQLFR DQG ) 0LFKHO '1$ VHTXHQFH DQG RUJDQL]DWLRQ RI WKH PLWRFKRQGULDO 1' JHQH IURP 3RGRVSRUD DQVHULQD DQDO\VLV RI DOWHUQDWH VSOLFH VLWHV &XUU *HQHW &XQQLQJKDP % & DQG $ :HOOV +LJKUHVROXWLRQ HSLWRSH PDSSLQJ RI K*+UHFHSWRU LQWHUDFWLRQV E\ DODQLQHVFDQQLQJ PXWDJHQHVLV 6FLHQFH 'DYLHV :KDW DUH DQWLELRWLFV" $UFKDLF IXQFWLRQV IRU PRGHP DFWLYLWLHV 0RO 0LFURELRO 'DYLHV 8 YRQ $KVHQ + :DQN DQG 5 6FKURHGHU (YROXWLRQ RI VHFRQGDU\ PHWDEROLWH SURGXFWLRQ SRWHQWLDO UROHV IRU DQWLELRWLFV DV SUHELRWLF HIIHFWRUV RI FDWDO\WLF 51$ UHDFWLRQV &LED )RXQG 6\PS 'DYLHV 5 : 5 % :DULQJ $ 5D\ 7 $ %URZQ DQG & 6FD]]RFFKLR 0DNLQJ HQGV PHHW D PRGHO IRU 51$ VSOLFLQJ LQ IXQJDO PLWRFKRQGULD 1DWXUH 'HFDWXU : $ & (LQYLN 6 -RKDQVHQ DQG 9 0 9RJW 7ZR JURXS ULER]\PHV ZLWK GLIIHUHQW IXQFWLRQV LQ D QXFOHDU U'1$ LQWURQ (0%2 'HJDQL < DQG $ 3DWFKRUQLN &\DQ\ODWLRQ RI VXOIK\GU\O JURXSV E\ QLWURWKLRF\DQREHQ]RLF DFLG +LJK\LHOG PRGLILFDWLRQ DQG FOHDYDJH RI SHSWLGHV DW F\VWHLQH UHVLGXHV %LRFKHPLVWU\ 'XMRQ % *URXS LQWURQV DV PRELOH JHQHWLF HOHPHQWV IDFWV DQG PHFKDQLVWLF VSHFXODWLRQVf§D UHYLHZ *HQH (LFNEXVK 7 + ,Q (YROXWLRQDU\ ELRORJ\ RI YLUXVHV 6 6 0RUVH HGf 5DYHQ 1HZ
PAGE 142

*DPSHO $ 0 1LVKLNLPL DQG $ 7]DJRORII &%3 SURWHLQ SURPRWHV LQ YLWUR H[FLVLRQ RI D \HDVW PLWRFKRQGULDO JURXS LQWURQ 0RO &HOO %LRO *DPSHO $ DQG $ 7]DJRORII ,Q YLWUR VSOLFLQJ RI WKH WHUPLQDO LQWHUYHQLQJ VHTXHQFH RI 6DFFKDURP\FHV FHUHYLVLDH F\WRFKURPH E SUHP51$ 0RO &HOO %LRO *DUULJD DQG $ 0 /DPERZLW] 3URWHLQGHSHQGHQW VSOLFLQJ RI D JURXS LQWURQ LQ ULERQXFOHRSURWHLQ SDUWLFOHV DQG VROXEOH IUDFWLRQV &HOO *DUULJD DQG $ 0 /DPERZLW] 51$ VSOLFLQJ LQ QHXURVSRUD PLWRFKRQGULD VHOIVSOLFLQJ RI D PLWRFKRQGULDO LQWURQ LQ YLWUR &HOO *DWLJQRO $ & %XFNOHU DQG 7 -HDQJ 5HODWHGQHVV RI DQ 51$ELQGLQJ PRWLI LQ KXPDQ LPPXQRGHILFLHQF\ YLUXV W\SH 7$5 51$ELQGLQJ SURWHLQ 75%3 WR KXPDQ 3OGV, NLQDVH DQG 'URVRSKLOD VWDXIHQ 0RO &HOO %LRO *DWLJQRO $ $ %XFNOHU :KLWH % %HUNKRXW DQG 7 -HDQJ &KDUDFWHUL]DWLRQ RI D KXPDQ 7$5 51$ELQGLQJ SURWHLQ WKDW DFWLYDWHV WKH +,9 /75 6FLHQFH *RQVDOYHV DQG 6 0 *DPVH\ ,QIHFWLYLW\ RI KHWHURORJRXV 51$SURWHLQ PL[WXUHV IURP DOIDOID PRVDLF FLWUXV OHDI UXJRVH FLWUXV YDULHJDWLRQ DQG WREDFFR VWUHDN YLUXVHV 9LURORJ\ *RWW 0 0 & :LOOLV 7 + .RFK DQG 2 & 8KOHQEHFN $ VSHFLILF 89LQGXFHG 51$SURWHLQ FURVVOLQN XVLQJ EURPRXULGLQHVXEVWLWXWHG 51$ %LRFKHPLVWU\ *UHHQ 5 DQG : 6]RVWDN 6HOHFWLRQ RI D ULER]\PH WKDW IXQFWLRQV DV D VXSHULRU WHPSODWH LQ D VHOIFRS\LQJ UHDFWLRQ 6FLHQFH *UHHQ 6 5 DQG 0 % 0DWKHZV 7ZR 51$ELQGLQJ PRWLIV LQ WKH GRXEOH VWUDQGHG 51$DFWLYDWHG SURWHLQ NLQDVH '$, *HQHV 'HY *URVVKDQV & $ DQG 7 5 &HFK 0HWDO LRQ UHTXLUHPHQWV IRU VHTXHQFH VSHFLILF HQGRULERQXFOHDVH DFWLYLW\ RI WKH 7HWUDK\PHQD ULER]\PH %LRFKHPLVWU\

PAGE 143

*XWKULH & 0HVVHQJHU 51$ VSOLFLQJ LQ \HDVW FOXHV WR ZK\ WKH VSOLFHRVRPH LV D ULERQXFOHRSURWHLQ 6FLHQFH +D\ 5 7 DQG 1LFKROVRQ '1$ ELQGLQJ DOWHUV WKH SURWHDVH VXVFHSWLELOLW\ RI WKH S VXEXQLW RI 1)NDSSD % 1XFOHLF $FLGV 5HV +HUEHUW & 0 /DERXHVVH 'XMDUGLQ DQG 3 3 6ORQLPVNL 7KH 1$0 SURWHLQV IURP 6 FHUHYLVLDH DQG 6 GRXJODVLL DUH PLWRFKRQGULDO OHXF\OW51$ V\QWKHWDVHV DQG DUH LQYROYHG LQ P51$ VSOLFLQJ (0%2 +HUVFKODJ (YLGHQFH IRU SURFHVVLYLW\ DQG WZRVWHS ELQGLQJ RI WKH 51$ VXEVWUDWH IURP VWXGLHV RI PXWDQWV RI WKH 7HWUDK\PHQD ULER]\PH %LRFKHPLVWU\ +HUVFKODJ 51$ FKDSHURQHV DQG WKH 51$ IROGLQJ SUREOHP %LRO &KHP +HUVFKODJ DQG 7 5 &HFK &DWDO\VLV RI 51$ FOHDYDJH E\ WKH 7HWUDK\PHQD WKHUPRSKLOD ULER]\PH .LQHWLF GHVFULSWLRQ RI WKH UHDFWLRQ RI DQ 51$ VXEVWUDWH FRPSOHPHQWDU\ WR WKH DFWLYH VLWH %LRFKHPLVWU\ +HUVFKODJ DQG 7 5 &HFK '1$ FOHDYDJH FDWDO\VHG E\ WKH ULER]\PH IURP 7HWUDK\PHQD >SXEOLVKHG HUUDWXP DSSHDUV LQ 1DWXUH $SU f@ 1DWXUH +HUVFKODJ 0 .KRVOD = 7VXFKLKDVKL DQG 5 / .DUSHO $Q 51$ FKDSHURQH DFWLYLW\ RI QRQVSHFLILF 51$ELQGLQJ SURWHLQV LQ KDPPHUKHDG ULER]\PH FDWDO\VLV >SXEOLVKHG HUUDWXP DSSHDUV LQ (0%2 $XJ f@ (0%2 +LFNH % ( / &KULVWLDQ DQG 0
PAGE 144

+LOOHQNDPS ) 0 .DUDV 5 & %HDYLV DQG % 7 &KDLW 0DWUL[DVVLVWHG ODVHU GHVRUSWLRQLRQL]DWLRQ PDVV VSHFWURPHWU\ RI ELRSRO\PHUV $QDO &KHP +R < 6 .LP DQG 5 % :DULQJ $ SURWHLQ HQFRGHG E\ D JURXS LQWURQ LQ $VSHUJLOOXV QLGXODQV GLUHFWO\ DVVLVWV 51$ VSOLFLQJ DQG LV D '1$ HQGRQXFOHDVH 3URF 1DWO $FDG 6FL 8 6 $ +ROO & 6FKPLGW DQG 5 6FKZHL\HQ ,Q $FKLHYHPHQWV DQG SHUVSHFWLYHV RI PLWRFKRQGULDO UHVHDUFK 9RO,, %LRJHQHVLV ( 4XDJOLDULHOOR ( & 6ODWHU ) 3DOPLHUL & 6DFFRQH DQG $ 0 .URRQ HGf (OVHYLHU $PVWHUGDPf SS +XDQJ ) DQG 0
PAGE 145

-DFREVRQ 5 0 + 6FKDIIHU 5 6WDUN DQG 7 & 9DQDPDQ 6SHFLILF FKHPLFDO FOHDYDJH LQ KLJK \LHOG DW WKH DPLQR SHSWLGH ERQGV RI F\VWHLQH DQG F\VWLQH UHVLGXHV %LRO &KHP -DHJHU / ( :HVWKRI DQG ) 0LFKHO )XQFWLRQ RI 3, D WHUWLDU\ EDVH SDLULQJ LQ VHOIVSOLFLQJ LQWURQV RI VXEJURXS ,$ 0RO %LRO -R\FH ) YDQ GHU +RUVW DQG 7 ,QRXH &DWDO\WLF DFWLYLW\ LV UHWDLQHG LQ WKH 7HWUDK\PHQD JURXS LQWURQ GHVSLWH UHPRYDO RI WKH ODUJH H[WHQVLRQ RI HOHPHQW 3 1XFOHLF $FLGV 5HV .DPSHU 8 8 .XFN $ &KHPLDFN DQG $ 0 /DPERZLW] 7KH PLWRFKRQGULDO W\URV\OW51$ V\QWKHWDVH RI 3RGRVSRUD DQVHULQD LV D ELIXQFWLRQDO HQ]\PH DFWLYH LQ SURWHLQ V\QWKHVLV DQG 51$ VSOLFLQJ 0RO &HOO %LRO .DUDV 0 DQG ) +LOOHQNDPS /DVHU GHVRUSWLRQ LRQL]DWLRQ RI SURWHLQV ZLWK PROHFXODU PDVVHV H[FHHGLQJ GDOWRQV $QDO &KHP .HQQHOO & 9 0RUDQ 3 6 3HUOPDQ 5 $ %XWRZ DQG $ 0 /DPERZLW] 5HYHUVH WUDQVFULSWDVH DFWLYLW\ DVVRFLDWHG ZLWK PDWXUDVHHQFRGLQJ JURXS ,, LQWURQV LQ \HDVW PLWRFKRQGULD &HOO .KDUUDW $ 0 0DFLDV 7 *LEVRQ 0 1LOJHV DQG $ 3DVWRUH 6WUXFWXUH RI WKH GV51$ ELQGLQJ GRPDLQ RI ( FROL 51DVH ,,, (0%2 .LQJ & DQG ( &ROHPDQ 7KH )I JHQH SURWHLQGS$f FRPSOH[ + 105 VXSSRUWV D ORFDOL]HG EDVHELQGLQJ PRGHO %LRFKHPLVWU\ .LWWOH -U 0RKU $ *LDQHORV + :DQJ DQG $ 0 /DPERZLW] 7KH 1HXURVSRUD PLWRFKRQGULDO W\URV\OW51$ V\QWKHWDVH LV VXIILFLHQW IRU JURXS LQWURQ VSOLFLQJ LQ YLWUR DQG XVHV WKH FDUER[\WHUPLQDO W51$ELQGLQJ GRPDLQ DORQJ ZLWK RWKHU UHJLRQV *HQHV 'HY .UHLNH 0 6FKXO]H ) $KQH DQG % ) /DQJ $ \HDVW QXFOHDU JHQH 056 LQYROYHG LQ PLWRFKRQGULDO 51$ VSOLFLQJ QXFOHRWLGH VHTXHQFH DQG PXWDWLRQDO DQDO\VLV RI WZR RYHUODSSLQJ RSHQ UHDGLQJ IUDPHV RQ RSSRVLWH VWUDQGV (0%2

PAGE 146

.UHLNH 0 6FKXO]H 7 3LOODU $ .RUWH DQG 5RGHO &ORQLQJ RI D QXFOHDU JHQH 056 LQYROYHG LQ WKH H[FLVLRQ RI D VLQJOH JURXS LQWURQ E,f IURP WKH PLWRFKRQGULDO &2% WUDQVFULSW LQ 6 FHUHYLVLDH &XUU *HQHW .XPDU $ DQG 6 + :LOVRQ 6WXGLHV RI WKH VWUDQGDQQHDOLQJ DFWLYLW\ RI PDPPDOLDQ KQ513 SURWHLQ $O %LRFKHPLVWU\ .XU] & 6 1LUDQMDQDNXPDUL DQG & $ )LHUNH 3URWHLQ FRPSRQHQW RI %DFLOOXV VXEWLOLV 51DVH 3 VSHFLILFDOO\ HQKDQFHV WKH DIILQLW\ IRU SUHFXUVRU W51$$VS %LRFKHPLVWU\ /DERXHVVH 0 & +HUEHUW 'XMDUGLQ DQG 3 3 6ORQLPVNL 7KUHH VXSSUHVVRU PXWDWLRQV ZKLFK FXUH D PLWRFKRQGULDO 51$ PDWXUDVH GHILFLHQF\ RFFXU DW WKH VDPH FRGRQ LQ WKH RSHQ UHDGLQJ IUDPH RI WKH QXFOHDU 1$0 JHQH (0%2 /DHPPOL 8 &OHDYDJH RI VWUXFWXUDO SURWHLQV GXULQJ WKH DVVHPEO\ RI WKH KHDG RI EDFWHULRSKDJH 7 1DWXUH /DPE 0 5 3 4 $Q]LDQR 5 *ODXV +DQVRQ + .ODSSHU 3 6 3HUOPDQ DQG + 5 0DKOHU )XQFWLRQDO GRPDLQV LQ LQWURQV 51$ SURFHVVLQJ LQWHUPHGLDWHV LQ FLV DQG WUDQVDFWLQJ PXWDQWV LQ WKH SHQXOWLPDWH LQWURQ RI WKH PLWRFKRQGULDO JHQH IRU F\WRFKURPH E %LRO &KHP /DPERZLW] $ 0 DQG 3 6 3HUOPDQ ,QYROYHPHQW RI DPLQRDF\OW51$ V\QWKHWDVHV DQG RWKHU SURWHLQV LQ JURXS DQG JURXS ,, LQWURQ VSOLFLQJ 7UHQGV %LRFKHP 6FL /D]LQVNL ( *U]DG]LHOVND DQG $ 'DV 6HTXHQFHVSHFLILF UHFRJQLWLRQ RI 51$ KDLUSLQV E\ EDFWHULRSKDJH DQWLWHUPLQDWRUV UHTXLUHV D FRQVHUYHG DUJLQLQH ULFK PRWLI &HOO /D]RZVND 0 &ODLVVH $ *DUJRXUL = .RW\ODN $ 6S\ULGDNLV DQG 3 3 6ORQLPVNL 3URWHLQ HQFRGHG E\ WKH WKLUG LQWURQ RI F\WRFKURPH E JHQH LQ 6DFFKDURP\FHV FHUHYLVLDH LV DQ P51$ PDWXUDVH $QDO\VLV RI PLWRFKRQGULDO PXWDQWV 51$ WUDQVFULSWV SURWHLQV DQG HYROXWLRQDU\ UHODWLRQVKLSV 0RO %LRO /D]RZVND 7 6]F]HSDQHN & 0DFDGUH DQG 0 'RNRYD 7ZR KRPRORJRXV PLWRFKRQGULDO LQWURQV IURP FORVHO\ UHODWHG 6DFFKDURP\FHV VSHFLHV

PAGE 147

GLIIHU E\ RQO\ D IHZ DPLQR DFLG UHSODFHPHQWV LQ WKHLU 2SHQ 5HDGLQJ )UDPHV RQH LV PRELOH WKH RWKHU LV QRW &5 $FDG 6FL ,,, /H&X\HU $ / 6 %HKOHQ DQG 2 & 8KOHQEHFN 0XWDJHQHVLV RI D VWDFNLQJ FRQWDFW LQ WKH 06 FRDW SURWHLQ51$ FRPSOH[ (0%2 /H&X\HU $ / 6 %HKOHQ DQG 2 & 8KOHQEHFN 0XWDQWV RI WKH EDFWHULRSKDJH 06 FRDW SURWHLQ WKDW DOWHU LWV FRRSHUDWLYH ELQGLQJ WR 51$ %LRFKHPLVWU\ /L < / 7LDQ 3 3 6ORQLPVNL DQG & +HUEHUW 7KH &%3 JHQH IURP 6DFFKDURP\FHV GRXJODVLL LV D IXQFWLRQDO KRPRORJXH RI WKH 6DFFKDURP\FHV FHUHYLVLDH JHQH DQG LV HVVHQWLDO IRU UHVSLUDWRU\ JURZWK LQ WKH SUHVHQFH RI D ZLOG W\SH LQWURQFRQWDLQLQJf PLWRFKRQGULDO JHQRPH 0RO *HQ *HQHW /LX ; 3 *DUULJD DQG + .KRUDQD 6WUXFWXUH DQG IXQFWLRQ LQ UKRGRSVLQ FRUUHFW IROGLQJ DQG PLVIROGLQJ LQ WZR SRLQW PXWDWLRQV LQ WKH LQWUDGLVFDO GRPDLQ RI UKRGRSVLQ LGHQWLILHG LQ UHWLQLWLV SLJPHQWRVD 3URF 1DWO $FDG 6FL 0DGKDQL + DQG & *XWKULH $ QRYHO EDVHSDLULQJ LQWHUDFWLRQ EHWZHHQ 8 DQG 8 VQ51$V VXJJHVWV D PHFKDQLVP IRU WKH FDWDO\WLF DFWLYDWLRQ RI WKH VSOLFHRVRPH &HOO 0DMHUIHOG / DQG 0 VHH FRPPHQWV@ 1DW 6WUXFW %LRO 0DWVXXUD 0 5 6DOGDQKD + 0D + :DQN
PAGE 148

0F*UDZ 3 DQG $ 7]DJRORII $VVHPEO\ RI WKH PLWRFKRQGULDO PHPEUDQH V\VWHP &KDUDFWHUL]DWLRQ RI D \HDVW QXFOHDU JHQH LQYROYHG LQ WKH SURFHVVLQJ RI WKH F\WRFKURPH E SUHP51$ %LRO &KHP 0F3KHHWHUV 6 DQG $EHOVRQ 0XWDWLRQDO DQDO\VLV RI WKH \HDVW 8 VQ51$ VXJJHVWV D VWUXFWXUDO VLPLODULW\ WR WKH FDWDO\WLF FRUH RI JURXS LQWURQV &HOO 0HL 5 DQG +HUVFKODJ 0HFKDQLVWLF LQYHVWLJDWLRQV RI D ULER]\PH GHULYHG IURP WKH 7HWUDK\PHQD JURXS LQWURQ ,QVLJKWV LQWR FDWDO\VLV DQG WKH VHFRQG VWHS RI VHOIVSOLFLQJ %LRFKHPLVWU\ 0HUULOO % 0 / 6WRQH ) &RELDQFKL 6 + :LOVRQ DQG 5 :LOOLDPV 3KHQ\ODODQLQHV WKDW DUH FRQVHUYHG DPRQJ VHYHUDO 51$ELQGLQJ SURWHLQV IRUP SDUW RI D QXFOHLF DFLGELQGLQJ SRFNHW LQ WKH $ KHWHURJHQHRXV QXFOHDU ULERQXFOHRSURWHLQ %LRO &KHP 0HUULOO % 0 5 :LOOLDPV : &KDVH DQG : + .RQLJVEHUJ 3KRWRFKHPLFDO FURVVOLQNLQJ RI WKH (VFKHULFKLD FROL VLQJOHVWUDQGHG '1$ELQGLQJ SURWHLQ WR ROLJRGHR[\QXFOHRWLGHV ,GHQWLILFDWLRQ RI SKHQ\ODODQLQH DV WKH VLWH RI FURVVOLQNLQJ %LRO &KHP 0HXQLHU % 7 */ & 0DFDGUH 3 3 6ORQLPVNL DQG /D]RZVND *URXS ,, LQWURQV WUDQVSRVH LQ \HDVW PLWRFKRQGULD ,Q 6WUXFWXUH IXQFWLRQ DQG ELRJHQHVLV RI HQHUJ\ WUDQVIHU V\VWHPV ( 4XDJOLDULHOOR 6 3DSD ) 3DOPLHUL DQG & 6DFFRQH HGf (OVHYLHU 6FLHQFH 3XEOLVKHUV $PVWHUGDPf SS 0LFKHO ) $ -DFTXLHU DQG % 'XMRQ &RPSDULVRQ RI IXQJDO PLWRFKRQGULDO LQWURQV UHYHDOV H[WHQVLYH KRPRORJLHV LQ 51$ VHFRQGDU\ VWUXFWXUH %LRFKLPLH 0LFKHO ) DQG ( :HVWKRI 0RGHOOLQJ RI WKH WKUHHGLPHQVLRQDO DUFKLWHFWXUH RI JURXS FDWDO\WLF LQWURQV EDVHG RQ FRPSDUDWLYH VHTXHQFH DQDO\VLV 0RO %LRO 0RD]HG DQG + ) 1ROOHU &KORUDPSKHQLFRO HU\WKURP\FLQ FDUERP\FLQ DQG YHPDP\FLQ % SURWHFW RYHUODSSLQJ VLWHV LQ WKH SHSWLG\O WUDQVIHUDVH UHJLRQ RI 6 ULERVRPDO 51$ %LRFKLPLH

PAGE 149

0RGDUUHVV 2SRNX 0 ;X 1 6DUOLV DQG 6 6 6LPRQV -U 6WHURLGLQGXFHG FRQIRUPDWLRQDO FKDQJHV DW HQGV RI WKH KRUPRQHELQGLQJ GRPDLQ LQ WKH UDW JOXFRFRUWLFRLG UHFHSWRU DUH LQGHSHQGHQW RI DJRQLVW YHUVXV DQWDJRQLVW DFWLYLW\ %LRO &KHP 0RJULGJH 7 ) 0DK DQG *UHHQEODWW ,QYROYHPHQW RI ER[$ QXFOHRWLGHV LQ WKH IRUPDWLRQ RI D VWDEOH ULERQXFOHRSURWHLQ FRPSOH[ FRQWDLQLQJ WKH EDFWHULRSKDJH ODPEGD 1 SURWHLQ %LRO &KHP 0RKU 0 &DSUDUD 4 *XR DQG $ 0 /DPERZLW] $ W\URV\OW51$ V\QWKHWDVH FDQ IXQFWLRQ VLPLODUO\ WR DQ 51$ VWUXFWXUH LQ WKH 7HWUDK\PHQD ULER]\PH >VHH FRPPHQWV@ 1DWXUH 0XQURH 6 + DQG ; 'RQJ +HWHURJHQHRXV QXFOHDU ULERQXFOHRSURWHLQ $ FDWDO\]HV 51$51$ DQQHDOLQJ 3URF 1DWO $FDG 6FL 0\HUV & $ :DOOYYHEHU 5 5HQQDUG < .HUQHO 0 &DSUDUD 0RKU DQG $ 0 /DPERZLW] $ W\URV\OW51$ V\QWKHWDVH VXSSUHVVHV VWUXFWXUDO GHIHFWV LQ WKH WZR PDMRU KHOLFDO GRPDLQV RI WKH JURXS LQWURQ FDWDO\WLF FRUH 0RO %LRO 1DUOLNDU DQG +HUVFKODJ ,VRODWLRQ RI D ORFDO WHUWLDU\ IROGLQJ WUDQVLWLRQ LQ WKH FRQWH[W RI D JOREDOO\ IROGHG 51$ 1DW 6WUXFW %LRO 1ROOHU + ) 9 +RIIDUWK DQG / =LPQLDN 8QXVXDO UHVLVWDQFH RI SHSWLG\O WUDQVIHUDVH WR SURWHLQ H[WUDFWLRQ SURFHGXUHV >VHH FRPPHQWV@ 6FLHQFH 3DOPHU DQG 0 /RJVGRQ -U 7KH UHFHQW RULJLQV RI LQWURQV &XUU 2SLQ *HQHW 'HY 3DQ 7KLUXPDODL DQG 6 $ :RRGVRQ )ROGLQJ RI 51$ LQYROYHV SDUDOOHO SDWKZD\V 0RO %LRO 3DUDGLVR 3 5 DQG : .RQLJVEHUJ 3KRWRFKHPLFDO FURVVOLQNLQJ RI WKH JHQH SURWHLQIG '1$ FRPSOH[ IURP IGLQIHFWHG FHOOV %LRO &KHP

PAGE 150

3DUDGLVR 3 5 < 1DNDVKLPD DQG : .RQLJVEHUJ 3KRWRFKHPLFDO FURVV OLQNLQJ RI SURWHLQ QXFOHLF DFLG FRPSOH[HV 7KH DWWDFKPHQW RI WKH IG JHQH SURWHLQ WR IG '1$ %LRO &KHP 3DUNHU ( & + %RWWLQJ $ :HEVWHU DQG 5 7 +D\ $GHQRYLUXV '1$ SRO\PHUDVH GRPDLQ RUJDQLVDWLRQ DQG LQWHUDFWLRQ ZLWK SUHWHUPLQDO SURWHLQ 1XFOHLF $FLGV 5HV 3DUWRQR 6 DQG $ 6 /HZLQ $XWRFDWDO\WLF DFWLYLWLHV RI LQWURQ RI WKH FRE JHQH RI \HDVW PLWRFKRQGULD 0RO &HOO %LRO 3DUWRQR 6 DQG $ 6 /HZLQ 7KH UDWH DQG VSHFLILFLW\ RI D JURXS ULER]\PH DUH LQYHUVHO\ DIIHFWHG E\ FKRLFH RI PRQRYDOHQW VDOW 1XFOHLF $FLGV 5HV 3HUOPDQ 3 6 DQG 5 $ %XWRZ 0RELOH LQWURQV DQG LQWURQHQFRGHG SURWHLQV 6FLHQFH 3HWHUVHQ 0 6NDOLFN\ / : 'RQDOGVRQ / 3 0F,QWRVK 7 $OEHU DQG % *UDYHV 0RGXODWLRQ RI WUDQVFULSWLRQ IDFWRU (WV '1$ ELQGLQJ '1$ LQGXFHG XQIROGLQJ RI DQ DOSKD KHOL[ 6FLHQFH 3LFFLULOOL $ 7 6 0F&RQQHOO $ =DXJ + ) 1ROOHU DQG 7 5 &HFK $PLQRDF\O HVWHUDVH DFWLYLW\ RI WKH 7HWUDK\PHQD ULER]\PH >VHH FRPPHQWV@ 6FLHQFH n 3RUWPDQ 6 DQG 'UH\IXVV 51$ DQQHDOLQJ DFWLYLWLHV LQ +H/D QXFOHL (0%23RZHUV 7 DQG + ) 1ROOHU 6HOHFWLYH SHUWXUEDWLRQ RI RI 6 U51$ E\ WUDQVODWLRQDO PLVFRGLQJ DJHQWV DQG D VWUHSWRP\FLQGHSHQGHQFH PXWDWLRQ LQ SURWHLQ 6 0RO %LRO 3\OH $ 0 DQG 7 5 &HFK 5LER]\PH UHFRJQLWLRQ RI 51$ E\ WHUWLDU\ LQWHUDFWLRQV ZLWK VSHFLILF ULERVH n2+ JURXSV 1DWXUH 3\OH $ 0 $ 0F6ZLJJHQ DQG 7 5 &HFK 'LUHFW PHDVXUHPHQW RI ROLJRQXFOHRWLGH VXEVWUDWH ELQGLQJ WR ZLOGW\SH DQG PXWDQW ULER]\PHV IURP 7HWUDK\PHQD 3URF 1DWO $FDG 6FL 8 6 $

PAGE 151

3\OH $ 0 6 0RUDQ 6 $ 6WUREHO 7 &KDSPDQ + 7XUQHU DQG 7 5 &HFK 5HSODFHPHQW RI WKH FRQVHUYHG *8 ZLWK D *& SDLU DW WKH FOHDYDJH VLWH RI WKH 7HWUDK\PHQD ULER]\PH GHFUHDVHV ELQGLQJ UHDFWLYLW\ DQG ILGHOLW\ %LRFKHPLVWU\ 3\OH $ 0 ) / 0XUSK\ DQG 7 5 &HFK 51$ VXEVWUDWH ELQGLQJ VLWH LQ WKH FDWDO\WLF FRUH RI WKH 7HWUDK\PHQD ULER]\PH 1DWXUH 5HLQKROG +XUHN % DQG $ 6KXE 6HOIVSOLFLQJ LQWURQV LQ W51$ JHQHV RI ZLGHO\ GLYHUJHQW EDFWHULD 1DWXUH 5HXVNHQ & % / 1HHOHPDQ DQG ) %RO $ELOLW\ RI WREDFFR VWUHDN YLUXV FRDW SURWHLQ WR VXEVWLWXWH IRU ODWH IXQFWLRQV RI DOIDOID PRVDLF YLUXV FRDW SURWHLQ 9LURO 5REHUWVRQ / DQG ) -R\FH 6HOHFWLRQ LQ YLWUR RI DQ 51$ HQ]\PH WKDW VSHFLILFDOO\ FOHDYHV VLQJOHVWUDQGHG '1$ 1DWXUH 5RJHUV $ + &KDQJ 8 YRQ $KVHQ 5 6FKURHGHU DQG 'DYLHV ,QKLELWLRQ RI WKH VHOIFOHDYDJH UHDFWLRQ RI WKH KXPDQ KHSDWLWLV GHOWD YLUXV ULER]\PH E\ DQWLELRWLFV 0RO %LRO 5RPDQ DQG 6 $ :RRGVRQ ,QWHJUDWLRQ RI WKH 7HWUDK\PHQD JURXS LQWURQ LQWR EDFWHULDO U51$ E\ UHYHUVH VSOLFLQJ LQ YLYR 3URF 1DWO $FDG 6FL 8 6 $ 6DIHU % 5 % &RKHQ 6 *DUIPNHO DQG $ 7KRPSVRQ '1$ DIILQLW\ ODEHOLQJ RI DGHQRYLUXV W\SH XSVWUHDP SURPRWHU VHTXHQFHELQGLQJ IDFWRUV LGHQWLILHV WZR GLVWLQFW SURWHLQV 0RO &HOO %LRO 6DOGDQKD 5 $ (OOLQJWRQ DQG $ 0 /DPERZLW] $QDO\VLV RI WKH &<7 SURWHLQ ELQGLQJ VLWH DW WKH MXQFWLRQ RI VWDFNHG KHOLFHV LQ D JURXS LQWURQ 51$ E\ TXDQWLWDWLYH ELQGLQJ DVVD\V DQG LQ YLWUR VHOHFWLRQ 0RO %LRO 6DOGDQKD 5 0RKU 0 %HOIRUW DQG $ 0 /DPERZLW] *URXS DQG JURXS ,, LQWURQV )$6(% 6FKDJJHU + DQG YRQ -DJRZ 7ULFLQHVRGLXP GRGHF\O VXOIDWH SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV IRU WKH VHSDUDWLRQ RI SURWHLQV LQ WKH UDQJH IURP ,WRO22N'D $QDO %LRFKHP

PAGE 152

6FODYL % 0 6XOOLYDQ 0 5 &KDQFH 0 %UHQRZLW] DQG 6 $ :RRGVRQ 51$ IROGLQJ DW PLOOLVHFRQG LQWHUYDOV E\ V\QFKURWURQ K\GUR[\O UDGLFDO IRRWSULQWLQJ 6FLHQFH 6HOOHP & + DQG / %HOFRXU ,QWURQ RSHQ UHDGLQJ IUDPHV DV PRELOH HOHPHQWV DQG HYROXWLRQ RI D JURXS LQWURQ 0RO %LRO (YRO 6HOOHP & + < Gn$XEHQWRQ &DUDID 0 5RVVLJQRO DQG / %HOFRXU 0LWRFKRQGULDO LQWURQLF RSHQ UHDGLQJ IUDPHV LQ 3RGRVSRUD PRELOLW\ DQG FRQVHFXWLYH H[RQLF VHTXHQFH YDULDWLRQV *HQHWLFV 6HUDSKLQ % 0 6LPRQ $ %RXOHW DQG )D\H 0LWRFKRQGULDO VSOLFLQJ UHTXLUHV D SURWHLQ IURP D QRYHO KHOLFDVH IDPLO\ 1DWXUH 6KDPRR < 5 :LOOLDPV DQG : + .RQLJVEHUJ 3KRWRFKHPLFDO FURVVOLQNLQJ RI EDFWHULRSKDJH 7 VLQJOHVWUDQGHG '1$ELQGLQJ SURWHLQ JSf WR ROLJRSG7f LGHQWLILFDWLRQ RI SKHQ\ODODQLQH DV WKH VLWH RI FURVVOLQNLQJ 3URWHLQV 6KDUS 3 $ 2Q WKH RULJLQ RI 51$ VSOLFLQJ DQG LQWURQV &HOO 6KDZ / & DQG $ 6 /HZLQ 7KH &ES SURWHLQ VWLPXODWHV WKH VSOLFLQJ RI WKH RPHJD LQWURQ RI \HDVW PLWRFKRQGULD 1XFOHLF $FLGV 5HV 6KDZ / & DQG $ 6 /HZLQ 3URWHLQLQGXFHG IROGLQJ RI D JURXS LQWURQ LQ F\WRFKURPH E SUHP51$ %LRO &KHP 6KDZ / & 7KRPDV -U DQG $ 6 /HZLQ 7KH &ES SURWHLQ VXSSUHVVHV VSOLFH VLWH PXWDWLRQV LQ D JURXS LQWURQ 1XFOHLF $FLGV 5HV 6KHWODU 0 &URVVOLQNLQJ RI SURWHLQV WR QXFOHLF DFLGV E\ XOWUDYLROHW OLJKW ,Q 3KRWRFKHPLFDO DQG 3KRWRELRORJLFDO UHYLHZV & 6PLWK HGf 3OHQXP 3UHVV 1HZ VHH FRPPHQWV@ 6FLHQFH

PAGE 153

6WHLW] 7 $ DQG $ 6WHLW] $ JHQHUDO WZRPHWDOLRQ PHFKDQLVP IRU FDWDO\WLF 51$ 3URF 1DWO $FDG 6FL 86$ 6WUREHO 6 $ DQG 7 5 &HFK 0LQRU JURRYH UHFRJQLWLRQ RI WKH FRQVHUYHG *8 SDLU DW WKH 7HWUDK\PHQD ULER]\PH UHDFWLRQ VLWH 6FLHQFH 6WUREHO 6 $ DQG 7 5 &HFK 7HUWLDU\ LQWHUDFWLRQV ZLWK WKH LQWHUQDO JXLGH VHTXHQFH PHGLDWH GRFNLQJ RI WKH 3, KHOL[ LQWR WKH FDWDO\WLF FRUH RI WKH 7HWUDK\PHQD ULER]\PH %LRFKHPLVWU\ 6WXGLHU ) : $ + 5RVHQEHUJ 'XQQ DQG : 'XEHQGRUII 8VH RI 7 51$ SRO\PHUDVH WR GLUHFW H[SUHVVLRQ RI FORQHG JHQHV 0HWKRGV (Q]\PRO 6]F]HSDQHN 7 DQG /D]RZVND 5HSODFHPHQW RI WZR QRQDGMDFHQW DPLQR DFLGV LQ WKH 6FHUHYLVLDH EL LQWURQHQFRGHG 51$ PDWXUDVH LV VXIILFLHQW WR JDLQ D KRPLQJHQGRQXFOHDVH DFWLYLW\ (0%2 7DQ 5 / &KHQ $ %XHWWQHU +XGVRQ DQG $ )UDQNHO 51$ UHFRJQLWLRQ E\ DQ LVRODWHG DOSKD KHOL[ &HOO 7DQQHU 1 0 0 +DQQD DQG $EHOVRQ %LQGLQJ LQWHUDFWLRQV EHWZHHQ \HDVW W51$ OLJDVH DQG D SUHFXUVRU WUDQVIHU ULERQXFOHLF DFLG FRQWDLQLQJ WZR SKRWRUHDFWLYH XULGLQH DQDORJXHV %LRFKHPLVWU\ 7KRPSVRQ $ DQG / +HUULQ $ FKORURSODVW JURXS LQWURQ XQGHUJRHV WKH ILUVW VWHS RI UHYHUVH VSOLFLQJ LQWR KRVW F\WRSODVPLF 6 U51$ ,PSOLFDWLRQV IRU LQWURQPHGLDWHG 51$ UHFRPELQDWLRQ LQWURQ WUDQVSRVLWLRQ DQG 6 U51$ VWUXFWXUH 0RO %LRO 7RZELQ + 7 6WDHKHOLQ DQG *RUGRQ (OHFWURSKRUHWLF WUDQVIHU RI SURWHLQV IURP SRO\DFU\ODPLGH JHOV WR QLWURFHOOXORVH VKHHWV SURFHGXUH DQG VRPH DSSOLFDWLRQV 3URF 1DWO $FDG 6FL 8 6 $ 7UHLEHU 0 6 5RRN 3 3 =DUULQNDU DQG 5 :LOOLDPVRQ .LQHWLF LQWHUPHGLDWHV WUDSSHG E\ QDWLYH LQWHUDFWLRQV LQ 51$ IROGLQJ 6FLHQFH

PAGE 154

9DLVDQHQ 6 -XQWXQHQ $ ,WNRQHQ 3 9LKNR DQG 3 + 0DHQSDD &RQIRUPDWLRQDO VWXGLHV RI KXPDQ YLWDPLQ' UHFHSWRU E\ DQWLSHSWLGH DQWLERGLHV SDUWLDO SURWHRO\WLF GLJHVWLRQ DQG OLJDQG ELQGLQJ (XU %LRFKHP 9DOHJDUG % 0XUUD\ 3 6WRFNOH\ 1 6WRQHKRXVH DQG / /LOMDV &U\VWDO VWUXFWXUH RI DQ 51$ EDFWHULRSKDJH FRDW SURWHLQRSHUDWRU FRPSOH[ 1DWXUH YDQ GHU +RUVW DQG + ) 7DEDN 6HOIVSOLFLQJ RI \HDVW PLWRFKRQGULDO ULERVRPDO DQG PHVVHQJHU 51$ SUHFXUVRUV &HOO YDQ 9ORWHQ'RWLQJ / &RDW SURWHLQ LV UHTXLUHG IRU LQIHFWLYLW\ RI WREDFFR VWUHDN YLUXV ELRORJLFDO HTXLYDOHQFH RI WKH FRDW SURWHLQV RI WREDFFR VWUHDN DQG DOIDOID PRVDLF YLUXVHV 9LURORJ\ 9LVVHU & 0 (YROXWLRQ RI ELRFDWDO\VLV 1LFRWLQDPLGH DQGRU IODYLQ FRQWDLQLQJ 51$ PROHFXOHV DV SRVVLEOH SUHJHQHWLFFRGH UHSOLFDWLQJ R[LGR UHGXFWDVHV 2ULJ/LIH YRQ $KVHQ 8 'DYLHV DQG 5 6FKURHGHU $QWLELRWLF LQKLELWLRQ RI JURXS ULER]\PH IXQFWLRQ >VHH FRPPHQWV@ 1DWXUH YRQ $KVHQ 8 DQG + ) 1ROOHU )RRWSULQWLQJ WKH VLWHV RI LQWHUDFWLRQ RI DQWLELRWLFV ZLWK FDWDO\WLF JURXS LQWURQ 51$ >VHH FRPPHQWV@ 6FLHQFH YRQ +HLMQH 0LWRFKRQGULDO WDUJHWLQJ VHTXHQFHV PD\ IRUP DPSKLSKLOLF KHOLFHV (0%2 :DOOZHEHU 6 0RKU 5 5HQQDUG 0 &DSUDUD DQG $ 0 /DPERZLW] &KDUDFWHUL]DWLRQ RI 1HXURVSRUD PLWRFKRQGULDO JURXS LQWURQV UHYHDOV GLIIHUHQW &<7 GHSHQGHQW DQG LQGHSHQGHQW VSOLFLQJ VWUDWHJLHV DQG DQ DOWHUQDWLYH nVSOLFH VLWH IRU DQ LQWURQ 25) 51$ :DQJ ) DQG 7 5 &HFK 7HUWLDU\ VWUXFWXUH DURXQG WKH JXDQRVLQHn ELQGLQJ VLWH RI WKH 7HWUDK\PHQD ULER]\PH 6FLHQFH :DQN + DQG 5 6FKURHGHU $QWLELRWLFLQGXFHG ROLJRPHULVDDWLRQ RI JURXS LQWURQ 51$ 0RO %LRO

PAGE 155

:HHNV 0 DQG 7 5 &HFK $VVHPEO\ RI D ULERQXFOHRSURWHLQ FDWDO\VW E\ WHUWLDU\ VWUXFWXUH FDSWXUH 6FLHQFH :HHNV 0 DQG 7 5 &HFK D (IILFLHQW SURWHLQIDFLOLWDWHG VSOLFLQJ RI WKH \HDVW PLWRFKRQGULDO E, LQWURQ %LRFKHPLVWU\ :HHNV 0 DQG 7 5 &HFK E 3URWHLQ IDFLOLWDWLRQ RI JURXS LQWURQ VSOLFLQJ E\ DVVHPEO\ RI WKH FDWDO\WLF FRUH DQG WKH n VSOLFH VLWH GRPDLQ &HOO :HLQVWHLQ / % % & 1 0 -RQHV 5 &RVVWLFN DQG 7 5 &HFK $ VHFRQG FDWDO\WLF PHWDO LRQ LQ D JURXS ULER]\PH 1DWXUH :HOFK 0 0DMHUIHOG DQG 0
PAGE 156

VHH FRPPHQWV@ 1DWXUH
PAGE 157

%,2*5$3+,&$/ 6.(7&+ +\PDYDWKL 7LUXSDWL REWDLQHG KHU XQGHUJUDGXDWH GHJUHH LQ DJULFXOWXUH LQ IURP WKH $QGKUD 3UDGHVK $JULFXOWXUDO 8QLYHUVLW\ ,QGLD IROORZHG E\ D PDVWHUfV GHJUHH LQ JHQHWLFV DQG SODQW EUHHGLQJ LQ IURP WKH ,QGLDQ $JULFXOWXUDO 5HVHDUFK ,QVWLWXWH ,QGLD $IWHU WZR \HDUV RI JUDGXDWH VWXGLHV LQ PROHFXODU JHQHWLFV VKH HQWHUHG WKH JUDGXDWH SURJUDP LQ PROHFXODU JHQHWLFV DQG PLFURELRORJ\ DW WKH 8QLYHUVLW\ RI )ORULGD LQ 6KH MRLQHG WKH ODERUDWRU\ RI 'U $OIUHG 6 /HZLQ IRU KHU JUDGXDWH UHVHDUFK LQ

PAGE 158

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ $OIUHG 6/HZLQ &KDLU 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ LPHV % )ODQHJDQ 3URIHVVRU RI 0ROHFXODU DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ $F" nWn f§ +HQU\ 9 %DNHU $VVRFLDWH 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\

PAGE 159

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 3KLOLS 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU 'HDQ &ROOHJH RI 0HGLFLQH 'HDQ *UDGXDWH 6FKRRO

PAGE 160

81,9(56,7< 2) )/25,'$