Characterization of an inducible enhancer element and the signaling pathways involved in manganese superoxide dismutase ...

MISSING IMAGE

Material Information

Title:
Characterization of an inducible enhancer element and the signaling pathways involved in manganese superoxide dismutase gene regulation
Physical Description:
viii, 153 leaves : ill. ; 29 cm.
Language:
English
Creator:
Rogers, Richard James, 1957-
Publication Date:

Subjects

Subjects / Keywords:
Research   ( mesh )
Gene Expression Regulation   ( mesh )
Superoxide Dismutase   ( mesh )
Enhancer Elements (Genetics)   ( mesh )
Enzyme Induction   ( mesh )
Reactive Oxygen Species   ( mesh )
Interleukin-1 -- metabolism   ( mesh )
Tumor Necrosis Factor -- metabolism   ( mesh )
Lipopolysaccharides -- metabolism   ( mesh )
Department of Biochemistry and Molecular Biology thesis Ph.D   ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Biochemistry and Molecular Biology -- UF   ( mesh )
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 2000.
Bibliography:
Bibliography: leaves 130-152.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Richard James Rogers.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 025684153
oclc - 48668445
System ID:
AA00022100:00001

Full Text










CHARACTERIZATION OF AN INDUCIBLE ENHANCER ELEMENT AND THE
SIGNALING PATHWAYS INVOLVED IN MANGANESE SUPEROXIDE
DISMUTASE GENE REGULATION













By

RICHARD JAMES ROGERS


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2000

























To my parents who understood the significance of education.


Live as if you were to die tomorrow. Learn as if you were to live forever.

Ghandi














ACKNOWLEDGMENTS


I would like to thank Dr. Harry S. Nick, chairman of my graduate advisory

committee, for his support, trust, friendship, guidance, and encouragement throughout my

graduate studies. I am also grateful to the other committee members--Drs. Brian Cain,

Sarah Chesrown, Robert Ferl, and Michael Kilberg--for their assistance. I would like to

thank all members, professors and staff, from the Department of Biochemistry and

Molecular Biology from the University of Florida College of Medicine. I am deeply

indebted to the members of my laboratory, both past (Maureen, Jan-Ling, Michael, Yemi,

and Jane) and present (Yang, Chris, Nikki, and Ann), for their help along this journey. I

also wish to extend a special, heartfelt thanks to Joan Monnier, my second mom, for her

support, technical help and spiritual guidance, during the most emotionally trying time in

my personal life. I can never fully repay my debt to her. Finally, I would like to express

my gratitude, respect and love to Ming Ming Chow for helping me in countless ways to

become a better person, but especially for showing me how to feel joy again.














TABLE OF CONTENTS
page


ACKN OW LEDGM EN TS ................................................................................................. iii

ABSTRACT ................................................................................................................. vii

CHAPTERS

1 INTRODUCTION ......................................................................................................... 1

Oxygen and Free Radicals ............................................................................................. 1
Superoxide Dism utases ............................................................................................. 3
Inflam m ation ............................................................................................................ 5
Lipopolysaccharide ................................................................................................. 6
Tum or N ecrosis Factor ............................................................................................ 7
Interleukin-1 .............................................................................................................. 9
M olecular Biology of M nSOD ..................................................................................... 11
Enhancers ................................................................................................................ 14

2 M ATERIA LS AND M ETHOD S ........................................................................... 18

M aterials ...................................................................................................................... 18
M ethods ........................................................................................................................ 20
Tissue Culture ................................................................................................. 20
Polym erase Chain Reaction (PCR) .................................................................. 21
TA Cloning of PCR Products ........................................................................... 22
Reporter Vector Cloning ................................................................................... 23
Plasm id Purification ........................................................................................ 24
Transient Transfection of M amm alian Cells .................................................. 26
RNA Isolation ................................................................................................. 27
N orthern Analysis ............................................................................................ 28
Genom ic DNA Isolation ................................................................................... 29
Electrophoretic M obility Shift A ssay (EM SA) ................................................. 30
In Vivo DM S Treatm ent ................................................................................... 31
Ligation-M ediated PCR (LM PCR) .................................................................. 33
Site-Directed Mutagenesis and Substitutions by PCR ...................................... 37
Radiolabeled Probe Synthesis ......................................................................... 40
Hybridization of N orthern and Southern Blots ................................................ 41











3 CYTOKINE-INDUCIBLE ENHANCER WITH PROMOTER ACTIVITY IN
BOTH THE RAT AND HUMAN SUPEROXIDE DISMUTASE GENES .......... 42

Introduction ............................................................................................................ 42
R esults .......................................................................................................................... 44
An Inducible Cis-Acting Element Exists within MnSOD ................................. 44
The MnSOD Inducible Enhancer Element is Located within Intron 2 ............. 48
The Enhancer Is Likely Composed of A Complex Set of Interacting
Elem ents ....................................................................................................... 54
The Inducible Enhancer Elements within Rat and Human MnSOD Can Act
with A Heterologous Promoter .................................................................... 60
Evaluation of Promoter-Enhancer Interactions ................................................. 63
The Rat and Human Enhancer Elements Contain Inducible Promoter
A ctivity ...................................................................................................... 69
D iscussion .............................................................................................................. 70

4 IN VIVO FOOTPRINTING AND MUTAGENESIS OF THE RAT
MANGANESE SUPEROXIDE DISMUTASE ENHANCER .............................. 75

Introduction ............................................................................................................ 75
R esults .......................................................................................................................... 77
Multiple Potential Protein Binding Sites Exist within the MnSOD
Enhancer ...................................................................................................... 77
Mutagenesis of Putative DNA Binding Sites Alters Inducible MnSOD
Expression .................................................................................................... 83

D iscussion .............................................................................................................. 89

5 REACTIVE OXYGEN SPECIES AND MITOCHONDRIA-TO-NUCLEUS
SIGN A LIN G ......................................................................................................... 91

Introduction ............................................................................................................ 91
R esults .......................................................................................................................... 93
Mitochondrial Electron Transport Inhibitors Modulate TNF-a-Induced
Expression of MnSOD in Pulmonary Epithelial Cells ................................. 93
Antimycin A Strongly Decreases TNF-ot-Inducible MnSOD Expression in
Pulmonary Endothelial Cells ...................................................................... 96
The Signaling Pathway of TNF-ox Is Different from the Pathways of LPS-
or IL-1-Stimulated Expression of MnSOD ..................................................... 100
Inhibition of Mitochondrial ATPase with Oligomycin also Represses
TNF-ct-Stimulated Expression of MnSOD ..................................................... 103
Reactive Oxygen Species Are Important for TNF-a-Stimulated
Expression of MnSOD .................................................................................... 108









TNF-a-Stimulated Expression of MnSOD in Endothelial Cells Is
Dependent on Cytoplasmic Phospholipase A2 (cPLA2) ................................. 108
TNF-a-Inducible Expression of MnSOD Is Not Dependent on Nuclear
Factor- KcB (NF-cB) ........................................................................................ 115

Discussion .................................................................................................................. 116

6 CONCLUSIONS AND FUTURE DIRECTIONS ..................................................... 121

Conclusions ................................................................................................................ 121
Future Directions ....................................................................................................... 127

REFERENCES ................................................................................................................ 130

BIOGRAPHICAL SKETCH ........................................................................................... 153



































vi















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy



CHARACTERIZATION OF AN INDUCIBLE ENHANCER ELEMENT AND THE
SIGNALING PATHWAYS INVOLVED IN MANGANESE SUPEROXIDE
DISMUTASE GENE REGULATION


By

Richard James Rogers

December 2000


Chairman: Dr. Harry S. Nick
Major Department: Biochemistry and Molecular Biology

Manganese superoxide dismutase (MnSOD), an enzyme localized to the

mitochondria, converts superoxide (02") into oxygen (02) and hydrogen peroxide

(H202). The superoxide dismutases (SODs) are the first line of cellular defense against

the damaging effects of superoxide anion radicals. Manganese superoxide dismutase is

the most highly regulated of the three SODs. Multiple studies have shown that increased

cellular levels of MnSOD are cytoprotective during cellular oxidative stress or

inflammatory challenges. The major goals of this dissertation were to identify within the

MnSOD gene the regions of DNA that are responsible for inducible expression and to

understand some of the intracellular signaling pathways that control this induction. To do

so, I utilized the polymerase chain reaction method to create deletions of a large region









within the MnSOD gene as a means of creating reporter vectors, which could be

evaluated by transient transfection studies in a rat lung epithelial cell line. The results of

these experiments defined a small region (260 bp) within intron 2 as an enhancer, which

regulates the inducible expression seen in the endogenous MnSOD gene. In addition, by

utilizing a variety of specific pharmacologic inhibitors, I was able to show the differences

between signaling pathways (lipopolysaccharide, tumor necrosis factor, interleukin-1)

responsible for the inducible expression of MnSOD. Interestingly, reactive oxygen

species, which are byproducts of the mitochondrial electron transport chain, appear to be

important regulators of the tumor necrosis factor pathway, but not that of

lipopolysaccharide or interleukin-1. Finally, by using the method of in vivo footprinting,

I was able to identify putative protein-DNA binding sites within the enhancer region.

Using this data, I created a number of reporter vectors with mutations within the enhancer

region. By transiently transfecting these reporter vectors into rat lung epithelial cells, I

may have identified at least one important putative protein-DNA binding site in the

enhancer region. It is likely that the MnSOD enhancer contains multiple protein-DNA

binding sites which work to create a protein complex necessary for the inducible

expression seen in the endogenous MnSOD gene. This work will add to the

understanding of how the inducible MnSOD gene is regulated.













CHAPTER 1
INTRODUCTION



Oxygen and Free Radicals

The element oxygen (chemical symbol 0) exists in air as a diatomic molecule, 02,

which strictly should be called dioxygen. Over 99% of the 02 in the atmosphere is the

isotope oxygen- 16 but there are traces of oxygen- 17 (about 0.04%) and oxygen- 18 (about

0.2%). Except for certain anaerobic and aero-tolerant unicellular organisms, all animals,

plants, and bacteria require 02 for efficient production of energy by the use of 02-

dependent electron-transport chains, such as those in the mitochondria of eukaryotic

cells. This need for 02 obscures the fact that 02 is a toxic mutagenic gas; aerobes survive

because they have antioxidant defenses to protect against it.

Perhaps the earliest suggestion made to explain 02 toxicity was that 02 inhibits

cellular enzymes (Balentine, 1982; Haugaard, 1968). Indeed, direct inhibition by 02 is

thought to account for the loss of nitrogenase activity in 02-exposed C. pasterianum

(Gallon, 1981). Another good example of the direct effect of 02 comes from green

plants. During photosynthesis, illuminated green plants fix CO2 into sugars by a complex

metabolic pathway know as the Calvin cycle. The first enzyme in this pathway, ribulose

bisphosphate carboxylase, catalyses the reaction of CO2 with a five-carbon sugar

(ribulose 1,5-bisphosphate) to produce two molecules of phoshoglyceric acid. Oxygen is

an alternative substrate for this enzyme, competitive with C02, and so at elevated 02

concentrations there is less CO2 fixation and hence less plant growth (Halliwell, 1984).









In general, however, the rates of direct inactivation of enzymes by 02 in aerobic

cells are too slow and too limited in extent to account for the rate at which toxic effects

develop; most enzymes are totally unaffected by 02. In 1954, Rebecca Gershman and

Daniel L. Gilbert drew a parallel between the effects of 02 and those of ionizing radiation

and proposed that most of the damaging effects of 02 could be attributed to the formation

of free oxygen radicals (Gilbert, 1981).

The growth inhibition observed after exposing E. coli to high-pressure 02 can be

relieved by adding valine to the culture medium. Valine synthesis is impaired because of

a rapid inhibition of the enzyme dihydoxyacid dehydratase, which catalyzes a reaction in

the metabolic pathway leading to valine. This is probably not a direct inhibition by 02,

but rather by oxygen radicals such as superoxide (Flint et al., 1993). Other enzymes

inactivated by superoxide radical (02"') in E. coli exposed to high pressure 02 include the

Krebs cycle enzymes aconitase and fumarase. E. coli contains three fumarases: fumarase

A and B are inactivated by 02" whereas fumarase C is not. Levels of fumarase C

increase when E. coli is exposed to oxidizing conditions, perhaps as a replacement for the

superoxide-sensitive fumarases A and B. Aconitase may also be an important target of

damage by 02" in mammalian tissues exposed to excess 02 (Hausladen and Fridovich,

1994; Morton et al., 1998). The onset of 02-induced convulsions in animals is correlated

with a decrease in the cerebral content of the neurotransmitter GABA (y-aminobutyric

acid), perhaps because of an inhibition of the enzyme glutamate decarboxylase

(glutamine -+ GABA + C02) by 02 (Hori, 1982); it has not, however, been shown that









the enzyme inhibition in vivo is due to 02 itself rather than to the effects of an increased

production of oxygen radicals (Haugaard, 1968).

The term "free radical" has several definitions, however, the simplest one

describes a free radical as any species capable of independent existence and contains one

or more unpaired electrons (Halliwell and Gutteridge, 1999). The presence of one or

more unpaired electrons usually causes free radicals to be attracted slightly to a magnetic

field (i.e., to be paramagnetic), and sometimes makes them highly reactive, although the

chemical reactivity of radicals varies over a wide spectrum. Radicals can be formed

when a covalent bond is broken if one electron from each of the pair shared remains with

each atom, a process known as hemolytic fission (von Sonntag, 1987).

A:B -- A'+Be

For example, hemolytic fission of one of the O-H covalent bonds in the H20 molecule

will yield a hydrogen radical (H') and a hydroxyl radical (*OH). The opposite of

hemolytic fission is heterolytic fission, in which one atom receives both electrons when a

covalent bond breaks, i.e.

A:B -- A'+B+

Where A receives both electrons. A is now negatively charged and this gives A a

negative charge and B is left with a positive charge. Heterolytic fission of water gives

the hydrogen ion H+ and the hydoxide ion OH-.

Superoxide Dismutases

The superoxide dismutases (SODs) catalyze the dismutation of superoxide anion

radical (02*-) into hydrogen peroxide and oxygen as follows:


2H + 2 02*" -+ H202 + 02









SODs, isolated from a wide range of organisms, fall into three types depending on

the metals found in their active centers: copper/zinc, manganese, and iron. Cu/ZnSOD is

found mainly in the cytosol of eukaryotes (Slot et al., 1986) and in chloroplasts; MnSOD,

in prokaryotes and in the mitochondria of eukaryotes; and FeSOD, in prokaryotes and in

a few families of plants. In addition, an extracellular SOD similar to the Cu/ZnSOD had

also been found in the extracellular fluid of eukaryotic cells (Marklund, 1984;

Hjalmarsson et al., 1987). Amino acid sequence data had shown that these three types of

SODs fall into two distinct families (Bannister et al., 1987). The FeSOD and MnSOD

show a high degree of amino acid sequence and structural homology, while the second

family, which includes the Cu/ZnSOD, is completely unrelated.

Two major forms of SOD have been purified from rat liver (Assayama and Burr,

1985). The Cu/ZnSOD consists of two identical subunits with a total molecular weight

of 32 kilodaltons (kD). Each subunit contains a single Cu and Zn atom, noncovalently

linked. The copper ion appears to function in the enzymatic reaction, whereas the zinc

ion is noncatalytic and serves to stabilize the enzyme. The complete amino acid

sequence of Cu/ZnSOD has been determined from various species with a high level of

conservation (Bannister et al., 1987).

The rat MnSOD is a tetrameric enzyme containing four identical 21 kD subunits

with a total molecular weight of approximately 80 kD whereas most bacterial MnSODs

are dimeric enzymes of approximately 40 kD. The amino acid sequences of the MnSOD

enzyme from various species, including rat, mouse, and human, as well as from bacteria,

have been compared and are very similar (Bannister et al., 1987). These enzymes contain

Mn at the active site and the mammalian forms have been localized primarily in the









mitochondria, particularly in the matrix between the cristae (Slot et al., 1986).

Mitochondrial DNA and membranes are particularly prone to oxidation because

mitochondria themselves are a major source of free radicals. When mitochondria are

severely damaged, aerobically growing cells are starved for energy. The localization of

the MnSOD exclusively within the mitochondria suggests an important role for this

antioxidant enzyme in this organelle.

Both rat Cu/ZnSOD and MnSOD cDNAs have been isolated and characterized by

our laboratory and others (Ho and Crapo, 1987). The rat MnSOD cDNA encodes a

protein of 222 amino acids, which includes a putative mitochondrial targeting sequence

of 24 amino acids. The Cu/ZnSOD is sensitive to cyanide, whereas MnSOD is resistant

to this reagent (Weisinger and Fridovich, 1973; Fridovich, 1974). This difference in the

cyanide sensitivity makes it possible to distinguish the enzymatic activities of these two

SODs.

In general, the synthesis of Cu/ZnSOD is constitutive whereas MnSOD is

inducible. Induction of MnSOD in eukaryotes has been observed following treatment

with paraquat (Krall et al., 1988), X-irradiation (Oberley et al., 1987), and hyperoxia

(Freeman et al., 1986), suggesting that MnSOD induction is important for protection

against oxidative stress. Since inflammatory responses often result in generation of a

variety of free radicals, which can directly or indirectly lead to tissue injury, it is of

interest to further characterize the role of SOD in such inflammatory responses.

Inflammation

Microbial invasion, immunological reactions, and inflammatory processes induce

a complex set of responses in the host, collectively referred to as the acute phase response









(Kushner et al., 1989). This response is characterized by fever, metabolic changes,

increased peripheral white blood cell count, and an increased synthesis of acute phase

proteins including C-reactive protein, ceruloplasmin, serum amyloid A protein, and

various complement proteins.

In addition, the immune system produces a variety of inflammatory mediators

including cytokines, arachidonic acid metabolites, and oxygen free radicals to protect the

host when threatened by inflammatory agents, microbial invasion, or injury. In some

cases this complex defense network successfully restores normal homeostasis, but at

other times the overproduction of inflammatory mediators may actually prove deleterious

to the host (Welbourn and Young, 1992). For example, septic shock associated with

infection is generally caused by wide-spread and uncontrolled activation of the

mononuclear phagocyte cell population and the release of massive quantities of

inflammatory mediators (Molloy et al., 1993). The clinical characteristics of this

condition include fever, hypotension, hypoglycemia, disseminated intravascular

coagulation and increased vascular permeability. The acute phase response,

characterized by the release of pro-inflammatory mediators and the activation of immune

cells, can be produced upon exposure to bacterial cell wall materials, most notably,

lipopolysaccharide.

Lipopolysaccharide

One of the major toxic components contributing to the inflammatory response

during microbial invasions is lipopolysaccharide (LPS). LPS, a constituent of the cell

wall of gram-negative bacteria, consists of a polysaccharide portion and a covalently

linked lipid moiety termed lipid A (Rietschel and Brade, 1992). Wide derangements









including acute inflammatory responses, altered energy metabolism, and multiple tissue

injury are observed after LPS administration (Ghosh et al, 1993). The toxic properties of

LPS account for its other name, bacterial endotoxin.

Several lipopolysaccharide binding proteins (LBP), which specifically interact

with LPS, have been reported (Tobias et al., 1988). For example, Schumann et al. (1990)

have characterized a LBP which is a 60 kD plasma glycoprotein synthesized in

hepatocytes. After the LBP interacts with LPS, this LPS-LBP complex then binds to the

cell surface protein CD 14 and presumably elicits the cellular and tissue responses to LPS

(Wright et al., 1990). In addition, a membrane-localized 80 kD LPS-specific binding

protein has been identified in B lymphocytes, T lymphocytes, and macrophages (Lei and

Morrison, 1988). However, the roles of these different LBPs and the interaction between

them are still not clear.

Tumor Necrosis Factor

Tumor necrosis factor (TNF), also called cachectin, is synthesized principally by

monocytes and macrophages in response to macrophage activators such as endotoxin.

Human TNF has a molecular weight of 17 kD, which is synthesized as a propeptide of

233 amino acids with a precursor sequence of 76 amino acids (Pennica et al., 1984;

Aggarwal et al., 1985). The amino acid sequences of both the pro- and mature peptides

are highly conserved between mouse and human, with about 80% homology (Beutler et

al., 1985; Cseh and Beutler, 1989). A wide spectrum of possible physiological actions

for TNF, including its use in the management of certain tumors, its role in an

inflammatory reaction, and its involvement in the immune response, have been

documented (Beutler and Cerami, 1989).









TNF and lymphotoxin (a tumoricidal protein produced by lymphocytes),

sometimes referred to as TNF-t and TNF-P respectively, are structurally and

functionally related (Goeddel et al., 1986). They share about 28% homology and have

been shown to interact with the same receptors and exhibit a number of shared biological

activities. The genes for TNF and lymphotoxin are closely linked and separated by about

I kb in humans (Nedwin et al., 1985). Lymphotoxin lies 5' to TNF, and both genes

reside within the major histocompatibility complex locus on chomosome 6, indicating

that these two genes may have evolved from a gene duplication event.

Most cell types including liver, kidney, muscle, and adipose tissue have been

shown to possess specific high affinity receptors for TNF. Two distinct TNF receptors of

55-69 kD (p55) and 70-80 kD (p75) have been identified in the mouse (Goodwin et al.,

1991) and human systems which demonstrate ligand specificity for both TNF-a and

TNF-3 (Hohmann et al., 1990). The p75 receptor possesses greater affinity for TNF than

the p55 receptor (Tartaglia and Goeddel, 1992). The genes for the p55 and p75 receptors

map to chromosomes 12 and 1 in humans, and to chomosome 6 and 4 in the mouse,

respectively (Goodwin et al., 1991).

Based on their amino acid sequence, the two receptors are only 29% identical to

each other, and both share four cysteine-rich repeats in their extracellular domains that

are characteristic of the nerve growth factor (NGF) receptor family. For both proteins,

aggregation of receptors mediated by binding of dimeric or trimeric TNF is believed to

initiate the signaling process. However, several lines of evidence suggest that subsequent

steps of the signal transduction process may diverge. Studies have been conducted using

antibodies specific for either the p55 or p75 receptor. Heller et al. (1992) reported that









the cytotoxicity of TNF was mediated through the p75 receptor. Tartaglia et al. (1993)

provided evidence indicating that the cytotoxicity of TNF is signaled by the p55 receptor.

The controversy between these two hypotheses needs further investigation, but also

demonstrates the complexity of the TNF function.

Soluble forms of the TNF receptors are released from the cell surface by

proteolytic cleavage (Lantz et al., 1990; Gullberg et al., 1992). These soluble receptors

act as TNF binding proteins, which subsequently inhibit TNF interactions with surface

receptors. In addition, the release of soluble receptors results in the down-regulation of

cell surface receptors. Therefore, shedding of surface receptors enables target cells to

decrease their responsiveness to TNF. Binding of TNF to its receptor is followed by

rapid internalization and degradation via a lysosomal pathway (Tsujimoto et al., 1985;

Niitsu et al., 1985)

Interleukin-1

Interleukin- 1 (IL-1), initially recognized as a factor producing high fever and a

shock-like state (Okusawa et al., 1988; Fischer et al., 1991), is primarily synthesized by

macrophages and monocytes, but may also be produced by epithelial cells, endothelial

cells, keratinocytes, and glial cells. IL- 1 is an inflammatory cytokine, more closely

related to tumor necrosis factor (TNF) than any other cytokine, although the structure and

receptors for IL-I and TNF are clearly distinct. IL-I is biologically active in the low

picomolar or even femtomolar range. There is little evidence that cytokines, such as IL-

1, play any role in normal homeostasis such as hormonal regulation, metabolism or in

physiological regulation. In the absence of injury or damage, however, it is unclear

whether IL-I is needed.









During inflammation, injury, immunological challenge or infection, IL-I is

produced and because of its multiple biological properties, this cytokine appears to affect

the pathogenesis of disease. Specific physiological activities of IL-I include lymphocyte

stimulation, induction of acute phase proteins, helper activity for immunoglobulin

production by B lymphocytes, induction of interferon P-2, and radioprotection (Neta et

al., 1986; Fibbe et al., 1989). Most studies on IL-1 are derived from experiments in

which bacterial products such as lipopolysaccharide (LPS), endotoxins from Gram-

negative bacteria or exotoxins from Gram-positive organisms are used to stimulate

macrophages (Ikejima et al., 1988).

Two distinct genes, located on chromosome 2, code for the IL-I a and IL- I 3

precursor polypeptides both having molecular masses of 31 kD (Auron et al., 1984;

Lomedico et al., 1984; Clark et al., 1986; Dinarello, 1992). However, unlike most

proteins, both IL-l c and 3 lack a leader sequence of amino acids, which would enable

the precursor protein to be inserted into the Golgi and cleaved to a smaller, mature size to

be transported out of the cell. The mature protein of both IL-la and 3 is approximately

17 kD after enzymatic cleavage. IL-l a and IL- 13 have very different amino acid

sequences, sharing only 26% similarity; however, structurally the two isoforms of IL-I

are related at the three dimensional level, having been crystallized (Preistle et al., 1988,

1989). These two proteins have been found in human, mouse, rat, pig, and rabbit and

exhibit significant interspecies homology at the amino acid level (62% homology

between human and mouse IL-la, Auron et al., 1985). The third member of the IL-I

gene family is IL- 1 receptor antagonist (IL-IRa). The three members of the IL-I family









recognize and bind to the same cell surface receptors. IL-I a and IL-i 13 binding to the IL-

1 receptors transmits a signal whereas IL-1 Ra does not.

IL-1 is rapidly synthesized by mononuclear cells, which are stimulated by

microbial products or inflammatory agents. Because of the lack of a leader peptide, most

IL-I x remains in the cytosol of cells. There is some evidence that the precursor IL- I a is

transported to the cell surface where it has been identified as membrane IL-I (Brody and

Durum, 1989). In human monocytes, between 40-60% of IL-I P is transported out of the

cell but in contrast to IL-I a, IL- 113 enters the circulation. Various mechanisms for

transport include exocytosis from vesicles, active transport via multiple-drug-resistance

carrier proteins, or following cell death. Unlike the IL-i Ia precursor, the IL- 113 precursor

requires cleavage for optimal biological activity. Several common enzymes will cut the

IL- 113 precursor into smaller and more active forms. However, one particular protease

appears highly specific for cleaving the IL-I P precursor from 31 to 17.5 kD, its most

active form (Cerretti et al., 1992; Thornberry et al., 1992). This enzyme is known as the

IL-I P converting enzyme (ICE) and is a member of the cysteine protease family. ICE

does not cleave the IL-Ia precursor. Other enzymes have been found which cleave the

IL-Ia precursor, but these other enzymes seem less specific than ICE.

Molecular Biology of MnSOD

Our laboratory has previously characterized the rat MnSOD cDNA (Dougall,

1990). The rat MnSOD genomic locus was first sequenced by Ho et al. (1991). The

promoter region of MnSOD contains neither a "CAAT box" nor a "TATA box." Our

laboratory has also identified and characterized the rat MnSOD gene, which contains five

exons. Exon one encodes the 5' untranslated leader sequence, the mitochondrial signal









sequence, and the N-terminus of the rat MnSOD protein. Exon 2, 3, 4, and 5 encode the

mature MnSOD protein. Exon 5 contains the stop codon, TGA, and the 3' untranslated

region (Dougall, 1990). Primer extension analysis was used to locate the transcription

initiation site at between 70 and 74 nucleotides 5' to the start of translation (Hurt et al,

1992). There are five species of MnSOD mRNA identified by Northern analysis. Our

laboratory has demonstrated that these five species of MnSOD mRNA are the result of

differential polyadenylation (Hurt et al., 1992).

The regulation of MnSOD biosynthesis in E. coli is under rigorous control. The

induction of this enzyme is in response to the cellular environmental redox state. E. coli

grown in iron-poor medium or in the presence of iron-chelating agents results in an

induction of the bacterial MnSOD gene. On the other hand, cells grown in iron-enriched

medium produces an inhibition of MnSOD expression. All of these observations led

Fridovich to suggest that E. coli MnSOD is controlled by an iron-containing repressor

(Fridovich, 1986). More recently, the transcriptional regulators, Fnr, Fur, and Arc, were

identified (Hassan and Sun, 1992; Privalle and Fridovich, 1993) and found to negatively

regulate the expression of MnSOD in E. coli. Unlike bacteria, MnSOD synthesis in

eukaryotic cells is upregulated dramatically by proinflammatory mediators including

lipopolysaccharide (LPS), tumor necrosis factor alpha (TNF-a), interleukins-1 and -6

(IL-1, IL-6), and interferon gamma (IFN-,) (Wong and Goeddel, 1988; Shaffer et al.,

1990; Del-Vecchio and Shaffer, 1991; Dougall and Nick, 1991; Borg et al., 1992; Eddy et

al., 1992, Gibbs et al., 1992; Valentine and Nick, 1992; Visner et al., 1992; Whitsett et

al., 1992; Eastgate et al., 1993; Melendez and Baglioni, 1993; Bigdeli et al., 1994;









Jacoby et al., 1994; Akashi et al., 1995; Gwinner et al., 1995; Jones et al., 1995; Lontz et

al., 1995; Stephanz et al., 1996). In L2 cells, a rat pulmonary epithelial-like cell line,

MnSOD mRNA levels show an 18-23 fold induction after stimulation with LPS (Visner

et al., 1990). Cells treated with TNF-ox or IL-I showed similar results.

To evaluate the importance of on-going protein synthesis and de novo

transcription, studies with cycloheximide, an inhibitor of protein synthesis, showed no

effect on LPS-, TNF-a-, or IL-l-dependent induction of MnSOD mRNA level. On the

other hand, L2 cells co-treated with stimulant (LPS, TNF-cc, or IL-1) and actinomycin, an

inhibitor of mRNA transcription, inhibited the stimulus-dependent induction of MnSOD

mRNA expression (Visner et al., 1990). Furthermore, nuclear-run on data showed a 9

fold induction in MnSOD mRNA level (Hsu, 1993). The above evidence suggests that

the regulation of MnSOD gene expression is, at least partly, transcriptionally dependent.

The difference between nuclear run-on analysis and in vivo data on mRNA level

following LPS treatment may be caused by the stability of the mRNA or the loss of some

transcription factors during the preparation of nuclei for nuclear run-on experiments.

Examinations of other cell types treated with LPS, TNF-a, or IL-I also showed similar

results at the mRNA level, including rat pulmonary artery endothelial cells (Visner et al.,

1992), porcine pulmonary artery endothelial cells (Visner et al., 1991), and intestinal

epithelial cells (Valentine and Nick, 1992). Interestingly, though Cu/ZnSOD contributes

the major part of the total cellular SOD activity, its mRNA level is not regulated by any

known stimulant to any large degree.








Enhancers

The control of transcription in prokaryotes is largely governed by sequences in the

vicinity of the transcriptional start site. Most prokaryotic promoters consist of short

sequence motifs approximately 10 to 35 base pairs upstream of the transcriptional start

site; these motifs make direct contact with RNA polymerase and thus serve to position

the start site (Rosenberg and Court, 1979). The initial characterization of eukaryotic

promoters revealed a similar arrangement of sequence elements. Many eukaryotic

promoters possess the conserved sequence motif TATAAA (the TATA box) in the -20 to

-30 region, and some promoters contain an additional upstream conserved element GG(T

or C)CAATCT (the CAAT box). However, unlike the corresponding prokaryotic

element, deletion of the TATA box does not necessarily abolish expression, as shown by

early studies on the histones H2A gene (Grosschedl and Birnstiel, 1980a). In addition,

these studies revealed that DNA sequences lying several hundred base pairs (bp)

upstream of the transcriptional start site can positively influence transcription, even when

positioned in an inverted orientation (Grosschedl and Birnstiel, 1980b).

Similar work with the simian virus 40 (SV40) early region indicated that the

TATA box was not required for early gene expression (Benoist and Chambon, 1980) and

that its deletion resulted in heterogeneous transcriptional start sites (Benoist and

Chambon, 1981). In addition, deletion of sequences about 150 bp upstream of the

transcriptional start site had an adverse effect on early gene expression. Deletion of one

of the two 72 bp repeat elements upstream of the early gene did not greatly reduce early

gene expression or virus viability, but the additional removal of a portion of the second

repeat reduced expression dramatically (Gruss et al., 1981; Benoist and Chambon, 1981).









Thus, it was found that DNA sequences lying a considerable distance upstream of

transcriptional start sites play a significant role in transcriptional regulation.

Further characterization of these sequences revealed a surprising result. When a

366 bp DNA segment of the SV40 promoter region was linked to a P-globin gene,

transcription of the gene was enhanced up to 200-fold (Banerji et al., 1981). This

enhancement of transcription occurred only when the SV40 sequences were present in

cis, did not depend upon DNA replication, and could occur when the sequences were

placed in both orientations either 1400 bp 5' or 3300 bp 3' of the gene. Enhancement

was observed as long as one copy of the 72 bp repeats was present. Similar results were

obtained when the SV40 promoter region was placed adjacent to the chicken conablumin

or adenovirus major late promoters, or within the T antigen gene intron sequences

(Moreau et al., 1981; Fromm and Berg, 1983). Thus, sequences within and flanking the

SV40 72 bp repeats are important for enhancing the expression of cis-linked promoters in

an orientation and distance independent fashion, although in some cases distance effects

were observed (Moreau et al., 1981). Studies with polyoma virus also revealed the

existence of a DNA segment essential for viral viability and capable of enhancing

expression of cis-linked genes (Tyndall et al., 1981; de Villiers and Schaffner, 1981).

Shortly thereafter, retroviruses were found to possess similar DNA elements in their long

terminal repeat (LTR) regions (Levinson et al., 1982; Gorman et al., 1982).

The properties of these viral transcriptional control elements now constitute the

definition of an enhancer element. These properties include the ability to (a) increase

transcription of cis-linked promoters, (b) operate in an orientation independent manner,









(c) exert an effect over large distances independent of position, and (d) enhance the

expression of heterologous promoters.

Since the first identified enhancer was observed in viral genomes it was

conceivable that these transcriptional control elements might be unique to viruses and

represent a means that enables them to compete for the host cell transcriptional

machinery. However, the discovery and characterization of mammalian cellular enhancer

elements within the immunoglobulin (Ig) genes eliminated this possibility (Banerji et al.,

1983; Gillies et al., 1983; Neuberger 1983; Mercola et al., 1983). Banerji et al. (1983)

showed that a several hundred bp DNA segment derived from the Ig heavy chain locus

could enhance expression of a linked 3-globin promoter in an orientation and position-

independent manner. This effect occurred only when the Ig sequences were present in cis

and did not depend upon DNA replication. Furthermore, enhancement occurred in three

different lymphoid cell lines, but not in mouse 3T6, mink lung, or human HeLa cells.

Gillies et al. (1983) concurrently demonstrated that the same DNA segment increased

expression of the Igy2b gene in an orientation and position independent manner, and

functioned in lymphoid cells but not in L cells. Thus, the enhancing sequences operated

in a tissue-specific manner. Similar results were obtained with the Ig K gene, which

indicated that a tissue-specific transcriptional enhancer element is located within the

intron separating the joining (JK) and constant (CK) regions (Queen and Baltimore, 1983;

Stafford and Queen, 1983; Queen and Stafford, 1984; Picard and Shaffner, 1984). The

identification of enhancers in cellular genes indicated that enhancers are not

transcriptional control elements peculiar to viral genomes.









Previous work from our laboratory demonstrated that the regulatory element

responsible for the dramatic inductions in MnSOD mRNA was not contained within the

5' flanking region of the gene (Chesrown, 1994). Further work suggested that another

region of DNA within the gene might be responsible for the transcriptional regulation by

inflammatory mediators (Chesrown, 1994). The main objective of the research presented

in this dissertation was to investigate the molecular mechanisms responsible for the

dramatic inductions of MnSOD expression in response to inflammatory stimuli. The

ultimate goal of this study was to characterize the cis-element(s) within the gene

responsible for the inducibility of MnSOD. These results will provide information for

future identification of the trans-acting factors, and other steps and components involved

in the inflammatory pathway of MnSOD.















CHAPTER 2
MATERIALS AND METHODS

Materials


Ham's F12K Medium (Cat# N-3520), bovine serum albumin (Cat# A-751 1), and

dithiothreitol (Cat# D-0632), bacterial lipopolysaccharide (LPS) E.coli serotype 055:B5

(Cat#L 2880), amobarbital (Amytal) (Cat#A 4430), 2-heptyl-4-hydroxyquinoline N-

oxide (HQNO) (Cat#H 3875), oligomycin (Cat#O 4876), and myxothiazol (Cat#M 5779)

were purchased from Sigma Chemical Company, St. Louis, MO. Oligonucleotides,

deprotected, desalted, and dephosphorylated, Medium 199 with Earle's salts (Cat#3 1100-

035), fetal bovine serum (Cat# 16000-044), antibiotic-antimycotic solution (ABAM)

(Cat#15240-062), restriction enzymes, Taq DNA Polymerase (Cat# 18038-018), T4 DNA

Ligase (Cat# 15224), DH5a E. coli competent cells (Cat# 18265017), and Random

Primers DNA Labeling System (Cat# 18187-013) were purchased from Gibco BRL,

Gaitherburg, MD. Recombinant human TNF-a was a gift from Genentech. IL-103 was a

gift from the National Cancer Institute. Antimycin A (Cat#1782), N-acetyl cysteine

(Cat# 106425), SB 203580 (559389), and PD 98059 (Cat#513000) were purchased from

Calbiochem, San Diego, CA. The I kappa kinase inhibitor, Bay 11-7082, was purchased

from BioMol, Plymouth Meeting, PA. (Sigma Corp, St. Louis, MO.). VentR DNA

Polymerase (Cat# 254S), restriction enzymes, T4 Polynucleotide Kinase (Cat#201 S), and

calf intestinal alkaline phosphatase (CIP) (Cat#290S) were purchased from New England









Biolabs, Inc., Beverly, MA. Long Ranger Gel Solution (Cat# 50611), and Seakem HGT

agarose (Cat# 50040) were purchased from FMC BioProducts, Rockland, ME.

Proteinase K (Cat# 161519) and E. coli tRNA (Cat# 109541) were purchased from

Boehringer-Mannheim, Indianapolis, IN. TA Cloning kit (Cat# K2000) was purchased

from Invitrogen Corporation, Carlsbad, CA. pCRScript Cloning kit (Cat# 211188-5) was

purchased from Stratagene, La Jolla, CA. Zetabind positively charged nylon transfer

membrane (Cat# NM511-01-045SP) was purchased from Cuno, Meriden, CT. Dimethyl

sulfate (Cat#18,630-9) amd sodium cacodylate (Cat#23,385-4) were purchased from

Aldrich, Milwaukee, WI. Piperidine (Cat# P 125-100) was purchased from Fisher

Scientific, Pittsburg, PA. QlAquick Nucleotide Removal kit (Cat#28304), QlAquick Gel

Extraction kit (Cat#12162), QIAprep Spin Miniprep kit (Cat#27106), Qiagen Plasmid

Midi kit (Cat#12144), Qiagen Plasmid Maxi kit (Cat# 12162) were obtained from

Qiagen, Valencia, CA. Hyperfilm MP (Cat# RNP 1677K, Cat#RNP30H), Ultrapure

dNTP Set (Cat# 27-2035-01), and adenosine 5'-triphosphate (Cat#27-1006-01) were

purchased from Amersham-Pharmacia, Piscataway, NJ. [a-32p]dATP (3,000 Ci

(11 TBq)/mmol) (Cat# BLU013H) and ['-32p]ATP (3,000 Ci (11 1TBq)/mmol)

(Cat#BLU002A) were purchased from New England Nuclear (NEN) Life Sciences

Products, Boston, MA. Cell lines rat pulmonary epithelial-like L2 (Cat# ATCC CCL

149) was purchased from American Type Culture Collection, Manassas, VA. pOGH and

pTKGH were obtained as a kit (Cat# 40-2205) from Nichols Institute Diagnostics, San

Juan Capistrano, CA. All other chemicals not mentioned were obtained through either

Sigma Chemical Co. or Fisher Scientific.











Methods

Tissue Culture

The cell lines used in the studies described in this thesis were: L2 rat pulmonary

epithelial-like cells (ATCC CCL 149), rat pulmonary artery endothelial cells, VA cells,

isolated from segments of pulmonary artery by mechanical methods (Visner et al., 1992),

and, mouse fibroblast antimycin-resistant mutant cells, LA9 cells (generously provided

by Dr. Neil Howell, Howell et al., 1983). All cells were cultured as adherent monolayers.

The L2 rat pulmonary epithelial-like cell line (ATCC CCL 149) was grown as a

monolayer in 150 mm tissue culture plates containing Ham's modified F12K medium

(GIBCO) supplemented with 10% fetal bovine serum, 10 gg/ml penicillin G, 0.1 mg/ml

streptomycin, and 0.25 gg/ml amphotericin B at 370C in humidified air with 5% CO2. If

cells were used for in vivo footprinting experiments, then at approximately 90%

confluence, cells were treated with 0.5 gig/ml Escherischia coli (E. coli) LPS (E.coli

serotype 055:B5, Sigma), 10 ng/ml TNF-a (kindly provided by the Genentech Corp.), or

2 ng/ml IL- 1I0 (kindly provided by the National Cancer Institute) for 2 or 4 hours to

induce MnSOD gene expression. Untreated cells were used as controls. VA cells, a rat

pulmonary artery endothelial cell line, were grown in Medium 199 with Earle's salts

(Sigma Corp., St. Louis, MO.) with sodium bicarbonate to pH 7.4, 10% fetal bovine

serum, 10 mM L-glutamine and antibiotic-antimycotic solution at 370 C in room air, 5%

CO2. LA9 cells, a mouse fibroblast antimycin-resistant mutant cell line (Howell et al.,

1983), were grown in Ham's F12K media with 10% fetal bovine serum, 10 mM L-

glutamine, and antibiotic-antimycotic solution at 37' C in room air, 5% CO2.









Experiments with VA cells and LA9 cells were all performed with confluent 100 mm

tissue culture plates.

Polymerase Chain Reaction (PCR)

The PCR reaction contained: DNA template (10-20 ng), 20 mM Tris-HCl pH 8.0,

50 mM KCI, 1.5 mM MgCl2, 0.2 mM of each dNTP, 100 pmol of each oligonucleotide

primer (oligonucleotide primers for PCR were obtained deprotected, desalted, and

dephosphorylated) in a total volume of 99.5 pl covered with 60 p1 of mineral oil. This

mixture was heated for 5 minutes to allow denaturation of the template and 0.5 p1 (2.5 U)

of Taq DNA Polymerase were added after 3 minutes of this time. The PCR was run in a

Perkin Elmer 480 thermocycler (Perkin Elmer Corporation, Norwalk, CT) for 25 cycles,

1 minute and 30 seconds at 94'C for denaturation, 30 seconds at 55-65C for annealing,

and 1 minute at 72C for extension. After 25 cycles, samples were incubated at 72'C for

10 minutes to allow complete extension and addition of an extra deoxyadenosine

nucleotide in each fragment by Taq DNA polymerase and refrigerated at 4C. Mineral

oil was extracted by the addition of 120 p1 of chloroform:isoamyl alcohol (IAA),

vortexing, and centrifugation for 5 minutes at 13,000 x g at room temperature. The

aqueous phase was transferred to a new tube and 10 p1 of the PCR reaction plus 1/6

volume of bromophenol blue/xylene cyanol/Ficoll mixture was loaded on a 1-2% Seakem

HGT agarose gel containing ethidium bromide (0.1 mg/ml), 40 mM Tris-acetate, 20 mM

acetic acid, 1 mM EDTA and run with TAE buffer for 40-60 minutes at 80-100 volts.

The DNA templates for the PCR used to produce the MnSOD genomic fragments

in the enhancer deletion analyses were plasmids containing restriction-digested fragments

from the original genomic clones (Dougall, 1990).









TA Cloning of PCR Products

Taq DNA polymerase has a nontemplate-dependent activity, which adds a single

deoxyadenosine (A) to the 3' ends of PCR products. The linearized vector, pCR2. 1,

supplied in the TA Cloning kit (Invitrogen, Carlsbad, CA), has a single 3'

deoxythymidine (T) residue. This allows PCR inserts to ligate efficiently with those

vectors. To ligate the PCR product in the TA cloning vector, 1 g1 of fresh PCR reaction

was incubated with 2 gl of the pCR2.1 vector (50 ng in 10 mM Tris-HC1, 1 mM EDTA,

pH 7.5), 1 gl of lOX T4 DNA ligase buffer (60 mM Tris-HC1, pH 7.5, 60 mM MgC2, 50

mM NaCl, 1 mg/ml bovine serum albumin, 70 mM P-mercaptoethanol, 1 mM ATP, 20

mM dithithreitol, 10 mM spermidine), 5 gl of sterile ddH20, and 1 g1 of T4 DNA ligase

(4 U) for 16 hours at 160C.

Two g1 of the ligation reaction were used to transform 50 ml of E. coli competent

cells, INVaF' strain, in the presence of 2 ml of 0.5 M P-mercaptoethanol, for 30 minutes,

on ice. The transformation reaction was then heat shocked for 45 seconds at 42C and

450 gl of SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KC1, 10

mM MgCl2, 20 mM glucose, pH 7.0) were added. This mixture was incubated at 37C

for one hour in a rotary shaker at 225 rpm. After this time, 100 pl of the bacteria solution

were plated using a glass spreader on YT (1.6% bacto-tryptone, 1% yeast extract, 0.5%

NaCl, pH 7.0) agar plate (1.5% Bacto-agar added), supplemented with 50 gg/ml of

ampicillin and covered with 20 pl of 5-Bromo-4-Chloro-3-indolyl-3-D-galactoside (X-

gal) (40 mg/ml), and incubated at 37C overnight. X-gal is a substrate for 3-

galactosidase, and when this gene is present in the vector, P-galactosidase metabolizes X-

gal, a blue product is formed and the colony becomes blue. If an insert is present in the









plasmid, the P-galactosidase gene is disrupted, X-gal is not metabolized, and the colony

remains white.

Reporter Vector Cloning

A 4.5 kb EcoR I/Eag I fragment of 5' non-coding sequence was isolated from the

17 kb MnSOD genomic clone (Figure 3-1) and the 5' overhang ends filled in using the

large fragment of E. coli DNA polymerase I (Klenow fragment). The resulting blunt-end

Eco/Eag fragment was cloned into the Hinc II polylinker site in a promoterless, pUC 12-

based human growth hormone expression vector, pOGH, (Selden et al., 1986), creating a

9.3 kb plasmid referred to as Eco/E GH (Figure 3-10). The unique restriction enzyme

site, HindII, was utilized to delete a 2.0 Kb portion of the MnSOD Eco/E sequence,

creating the vector, Hind/E (Kuo et al., 1999, Figure 3-10). To test for non-specific

effects of the inflammatory mediators on hGH expression, we used an hGH expression

vector that contained the herpes simplex thymidine kinase minimal promoter, pTKGH

(Selden et al., 1986).

To identify possible regulatory elements in the remainder of MnSOD that might

interact with the 5' promoter, we cloned an internal 6.1 kb Hind III fragment (+1180 to

+7312) from the rat genomic clone into the HindlII site of the Hind/E GH vector, creating

a 13.45 kb vector (Figure 3-1). The same Hind III fragment was cloned into Hind/E GH

in the opposite orientation. To begin to localize observed enhancer effects, we removed

the Hind III/Hpa I fragment (+1180 to +5046) and the Hpa I/Hind III fragment (+5046 to

+7312) from the Hind III fragment in both orientations creating enhancer deletions of 3.8

Kb or 2.3 Kb in the Hind/E GH construct (Figure 3-3). To clarify the position of the

enhancer within the 3.8 kb fragment, serial 3' and 5' deletions of the area were performed









by creating PCR products (Figure 3-3) which were subsequently cloned into the Hind/E

GH vector at the HindIllI site or NdeI site. Oligonucleotides flanking the regions of

interest were designed containing either HindllI or NdeI sites for convenient ligation into

the restriction sites. To test whether the enhancer activity was specific to the MnSOD

promoter, we used the plasmid, TKGH, which contains a heterologous, TATA-

containing, non-GC-rich promoter. The 6.1 kb Hind III MnSOD genomic fragment

(+1180 to +7312) was cloned into the HindII site (Figure 3-9) in the TKGH polylinker in

both orientations. To evaluate the interaction of the promoter with the enhancer

fragment, the 919 bp (Figure 3-3) fragment of MnSOD containing the entire enhancer

region was ligated into the NdeI site of the promoter deletion constructs (Figure 3-10).

Comparison of the rat enhancer sequence with the analogous region in human

MnSOD revealed a high degree of homology in intron 2. PCR amplification of a 466 bp

fragment (+2410 to +2875, human manganese SOD, accession S77127) from human

genomic DNA with primers, 5' CGTTAGTGGTTTGCACAAGGAAGATAATCG 3'

and 5' GGCTCTGATTCCACAAGTAAAGGACTG 3', to create a fragment, which was

inserted into NdeI site of the TKGH vector in both orientations.

Plasmid Purification

For small scale plasmid isolation the QIAprep Spin miniprep from Qiagen was

used. A single bacterial colony from YT agar plates with ampicillin was used to

inoculate 5 ml of YT media (1.6% bacto-tryptone, 1% yeast extract, 0.5% NaCl, pH 7.0)

supplemented with 50 ig/ml of ampicillin and grown overnight at 37C in a rotary water

bath shaker. Plasmids were extracted using the QlAprep Spin Miniprep kit following the

manufacturer's protocol. Bacteria from 1.5 ml of YT culture were collected by









centrifugation at 13,000 x g for 5 minutes, resuspended in 250 111 of resuspension buffer

(50 mM Tris-HC1, pH 8.0, 10 mM EDTA, 100 gg/ml RNase), lysed with 250 g1 of lysis

buffer (200 mM NaOH, 1% SDS), neutralized and adjusted to high-salt binding

conditions with 350 gl of neutralization buffer (3 M potassium acetate, pH 5.5), and

centrifuged for 10 minutes at 13,000 x g, at 40C. The supernatant was applied to a

QlAprep silica-gel membrane column. A vacuum manifold was used for the following

steps. First, the supernatant was drawn through the column using the vacuum manifold.

The column was washed once with 500 gl wash buffer (10 mM Tris-HCl, 80 % ethanol)

containing chaotrophic salts and once with 750 ptl wash buffer (10 mM Tris-HC1, 80 %

ethanol). The column was then centrifuged at 13,000 x g for 2 minutes at room

temperature. The plasmid DNA was eluted from the column with addition of 100 gl of

TE buffer (50 mM Tris-HC1, pH 8.0, 10 mM EDTA), and centrifugation at 13,000 x g for

one minute at room temperature into a clean, DNase-free eppendorf tube.

For large, scale plasmid isolation a QIAGEN plasmid maxi kit was used. One ml

of a single colony overnight liquid culture (5 ml YT/ampicillin) was inoculated in 50 ml

(high copy plasmid) of YT media supplemented with 50 gg/ml of ampicillin, and grown

overnight at 370C in a rotary water bath shaker. Bacteria were collected by centrifugation

(4,000 x g, 15 minutes, 4C), pellets were resuspended in 10 ml of resuspension buffer

(50 mM Tris-HC1, pH 8.0, 10 mM EDTA, 100 gg/ml RNase), lysed with 10 ml of lysis

buffer (200 mM NaOH, 1% SDS) and incubated for 5 minutes at room temperature,

neutralized by addition of chilled (4C) neutralization buffer (3 M potassium acetate, pH

5.5), incubated on ice for 20 minutes, and centrifuged at 16,000 x g for 30 minutes at

4C. The supernatant was removed from the centrifugation tube with a sterile transfer









pipette and allowed to flow through by gravity on a QIAGEN-tip 500 column, that had

been previously equilibrated with 10 ml of equilibration buffer (750 mM NaCl, 50 mM

MOPS, pH 7.0, 15% isopropanol, 0.15% Triton X-100). The flow-through was discarded

and the column was washed twice with 30 ml of wash buffer (1 M NaCl, 50 mM 3-(N-

morholino)propane sulfonic acid (MOPS), pH 7.0, 15% isopropanol) by gravity flow.

Plasmid DNA was eluted from the column with 15 ml of elution buffer (1.25 M NaCl, 50

mM Tris-HCl, pH 8.5, 15% isopropanol). The DNA present in the eluate was

precipitated with 0.7 volumes (10.5 ml) of isopropanol, and collected by centrifugation

(16,000 x g, 30 minutes, 40C). The pellet was washed once with 5 ml of 70% ethanol and

centrifugation was repeated (16,000 x g, 30 minutes, 4C). The final pellet was

resuspended in 300-500 p1 of TE buffer.

Plasmid DNA concentration was estimated by measuring the absorbance at 260

mn in a Beckman DU-64 Spectrophotometer (Beckman Instruments, Inc., Fullerton, CA),

of water dilutions (1:50) from each sample. An absorbance of I at 260 m corresponds

to 50 mg of double-stranded DNA. The ratio between the readings taken at 260 nm and

280 nm (A260/A280) provided an estimate of DNA purity (1.5-2.0). Typical yield

depended on the size of the plasmid, but ranged from 20-50 pg of plasmid DNA for

QlAprep Spin minipreps and 400-800 pg for maxi-size preparations.

Transient Transfection of Mammalian Cells

L2 cells, a rat pulmonary epithelial-like cell line (ATCC CCL 149), were grown

in Ham's modified F12K medium (GIBCO) with 10% fetal bovine serum (Flow

Laboratories), ABAM (penicillin G 100 U/ml, streptomycin 0.1 mg/ml, amphotericin B

0.25 mg/ml (Sigma) and 4 mM glutamine at 37C in room air, 5% CO2. To control for









transfection efficiency, transfections were carried out using a batch transfection method.

Cells were grown as monolayers on 150 mm tissue culture plates until 70-90% confluent.

The cells were transfected with 10 mg of each expression vector using the DEAE-dextran

method (Kriegler et al., 1990). After 24 h, cells from each 150 mm, batch transfected

plate were trypsinized, pooled, and plated onto four separate 100 mm tissue culture

plates. Inflammatory mediators were added to the medium of each plate 24 h later with

final concentrations of 0.5 jig/ml Escherichia coli lipopolysaccharide (LPS, E. coli

serotype 055:B5, Sigma), 10 ng/ml TNF-cL, or 2 ng/ml IL-I P. Twenty-four hours later,

total RNA was isolated from the cell monolayers for northern analysis.

RNA Isolation

Total cellular RNA was isolated according to the procedure described by

Chomczynski and Sacchi (1987) with modifications (Visner et al, 1990). Briefly, the

monolayer cells (L2 cells or VA cells), cultured as noted above, were washed once with

room temperature PBS, and then 3 ml/100 mm tissue culture plate of guanidinium

thiocyanate solution (4 M guanidinium thiocyanate, 25 mM sodium citrate pH 7.0, 0.5%

sarcosyl, and 0.1 M 2-mercaptoethanol) were added. The homogenate was collected in a

15 ml conical polypropylene tube and extracted with 0.1 volume of 2 M sodium acetate

pH 4.0, and an equal volume of water-saturated phenol. This suspension was mixed

together and cooled on ice for at least 15 minutes. Before centrifugation at 3,000 x g for

20 minutes at 4C, 0.22 volumes of chloroform/isoamyl alcohol (IAA) (49:1) were added

and the mixture was shaken vigorously for 20 seconds. After centrifugation, the aqueous

phase was transferred to a fresh centrifugation tube and mixed with an equal volume of

isopropanol. This solution was placed at -20C for at least 1 hour and then centrifuged at









10, 000 x g for 25 minutes at 40C. The RNA pellet was resuspended in 500 PI of

guanidinium thiocyanate solution and transferred to a 1.5 ml microfuge tube. An equal

volume of isopropanol was added and the mixture was incubated for at least an hour at -

200C. RNA was collected by centrifugation at 10, 000 x g for 10 minutes at 4C, and 400

p of DEPC-treated water was added to the pellet and incubated at 500C for 15 minutes.

The RNA was precipitated with 0.1 volume of DEPC-treated 3 M sodium acetate pH 5.2,

and 2.2 volumes of 100% ethanol, followed by incubation at -20C for at least an hour.

The RNA was collected again by centrifugation, resuspended in 300 PI of DEPC-treated

water and ethanol precipitated one more time. The final pellet was dried in a Savant

speed-vacuum centrifuge to remove any trace amounts of ethanol, and then resuspended

in DEPC-treated water.

RNA concentration was estimated by measuring the absorbance at 260 nm in a

Beckman DU-64 Spectrophotometer (Beckman Instruments, Inc., Fullerton, CA), of two

water dilutions (1:20) from each sample. An absorbance of 1 at 260 nm corresponds to

40 pg of RNA. The ratio between the readings taken at 260 nm and 280 nm (A260/A28o)

provided an indication of RNA purity (1.5-2.0). Typical RNA yield for L2 cells or VA

cells was 80-150 pg per 70-100% confluent 100 mm tissue culture plate.

Northern Analysis

RNA was size-fractionated for 16 hours at 40 volts on a 1% Seakem HGT agarose

gel containing 6.6% formaldehyde, 40 mM MOPS pH 7.0, 10 mM sodium acetate pH

7.4, and 1 mM EDTA pH 8.0 with constant buffer recirculation. For each lane of the gel,

twenty pg of total RNA were dried and resuspended in 30 ml of 12.5 M formamide, 6.6%

formaldehyde, 6 mM sodium acetate pH 7.4, 0.5 mM EDTA pH 8.0,20 mM 3-(N-









morholino)propane sulfonic acid (MOPS) pH 7.0. This RNA was dissolved and heated

by incubations for 10 minutes at 50'C, then for 10 minutes at 650C. A 5 P1 aliquot of

loading dye (0.4% xylene cyanol FF, 0.4% bromophenol blue, 1 mM EDTA pH 8.0, 50%

glycerol, 0.3 pg/ptl ethidium bromide) was added prior to loading the gel. To confirm

that equal amounts of RNA had been loaded into each lane, after electrophoresis, each gel

was photographed under UV light and the level of ribosomal RNA assessed by the

ethidium bromide staining. Ethidium bromide was present in the loading dye and RNA

could be visualized promptly under UV light after electrophoresis. The gel was then

treated for 30 minutes with 50 mM NaOH, 30 minutes with 100 mM Tris-HCl pH 7.0,

and twice for 25 minutes with 50 mM TBE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH

8.0). The RNA was electo-transferred to a positively-charged nylon membrane in 40 mM

TBE for 75 minutes and then covalently cross-linked to the membrane with UV light

(Church and Gilbert, 1984).

Genomic DNA Isolation

For genomic DNA isolation, L2 cells were grown in 15 cm tissue culture plates

until 70-90% confluent, washed once with PBS and lysed with 3 ml lysis solution (50

mM Tris-HC1, pH 8.5, 25 mM EDTA, pH 8.0, 50 mM NaC1, 0.5% SDS, 300 Pg/ml

Proteinase K). The lysate was incubated overnight on a rocking platform at room

temperature. After this incubation, the lysate was then extracted once with equal volume

of Tris-equilibrated phenol for at least 1 hour at room temperature on a rocking platform.

The phases were separated by centrifugation at 3,000 x g for 20 minutes at room

temperature. The upper aqueous phase was transferred with a sterile large-bore, transfer

pipette to a new tube. Then the lysate was extracted once with an equal volume of








phenol/chloroform:isoamyl alcohol (IAA) (50/49:1) and once with chloroform:IAA, with

incubations of at least one hour at room temperature on a rocking platform, and

centrifugations at 3,000 x g for 20 minutes at room temperature to separate the phases.

After separation of the phases in the cholorform:IAA extraction, 2.5 ml of RNase A (750

U/ml) was added to the lysate, for digestion of contaminant RNA, and the mixture was

incubated overnight at room temperture on a rocking platform. The lysate was extracted

again, once with phenol/chloroform:IAA, and once with chloroform:IAA, as above.

DNA was precipitated from the aqueous phase by addition of 120 pl 5M NaC1 to final

concentration of 0.2 M and 2.5 volumes (7.5 ml) of ice-cold 100% ethanol. The cotton-

like DNA was collected with a sealed bent glass Pasteur pipette, washed by rinsing the

DNA with 2 ml of chilled (4C) 80% ethanol and resuspended in 300 pl of TE buffer (10

mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0).

Electrophoretic Mobility Shift Assay (EMSA)

EMSA were performed as previously described (Fried and Crothers, 1981) with 8

mg nuclear extract prepared from control and LPS, TNF-a, or IL-I P-treated L2 cells by

high salt extraction (Andrews and Faller, 1991). Binding reactions were carried out at

room temperature in 10 mM HEPES (N-[2-Hydroxyethyl]piperazine-N'-[2-

ethanesulfonic acid])-KOH, pH 7.9, 100 mM KC1, 1mM dithiothreitol, 0.5 mM MgCl2,

0.1 mM EDTA and 8.5% glycerol to yield a final volume of 20 Pl. EMSA probes were

made from cloned PCR products of the defined enhancer region between 4130 and 4491

and end-labeled by filling the recessed 3' termini of EcoRI digested fragments with 32p_

dATP using the large fragment of E. coli DNA polymerase I (Klenow fragment).

Fragments used in EMSAs were 143 bp (+4348 to +4491), 143 bp (+4231 to +4374), 100









bp (+4231 to +4331), 95 bp (+4331 to +4426), and 103 bp (+4426 to +4529). Numbers

shown in parentheses refer to sequence in the rat MnSOD gene (accession X56600).

In Vivo DMS Treatment

L2 cells were cultured as described above in 150 mm tissue culture plates. The

medium was removed by aspiration and the cells washed once with room temperature

phosphate buffered saline (PBS, 10 mM sodium phosphate, pH 7.4 and 150 mM NaCl).

The PBS buffer was removed and replaced with room temperature PBS containing

0.25%-0.5% demethyl sulfate (DMS, Aldrich) for 1-2 min. The PBS containing DMS

was rapidly removed (30-60 seconds), and the cell monolayer washed twice with 40C

PBS to quench the DMS reaction. The cells were lysed in 5 ml of lysis solution (50 mM

Tris pH 8.5, 25 mM EDTA pH 8.0, 50 mM NaCl, 0.5% SDS, 300 Ag/ml Proteinase K)

followed by incubation overnight at room temperature on a rocking platform. Genomic

DNA was then purified by phenol/chloroform extractions. Each sample was extracted

once with an equal volume of Tris-equilibrated phenol, followed by two extractions with

a 24:24:1 (v/v/v) mixture of Tris-equilibrated phenol/chloroform/isoamyl alcohol, and

finally by one extraction with a 24:1 (v/v) mixture of chloroform/isoamyl alcohol. Each

extraction was performed for at least an hour on a rocking platform prior to collection of

aqueous phase. The aqueous phase was collected each time by centrifugation at 14, 000 x

g for 10 minutes at room temperature and ethanol precipitated. Samples were then

treated with 100 pg/ml RNase A, organic extracted as above, ethanol precipitated and

suspended in TE (10 mM Tris pH 8.0 and 1 mM EDTA). The DNA samples were

digested with BamH I restriction endonuclease enzyme, and strand cleavage at modified

guanine residues was achieved by treatment with 1 M piperidine (Fisher Scientific) at









90C for 30 minutes. Naked genomic DNA was isolated and purified from cells without

any DMS treatment and digested with restriction endonuclease enzyme, BamHI (New

England Biolabs).

As a control, genomic DNA was extracted in the same way from cells incubated

in Ham's F12K medium for 2 or 4 hours, but not treated with DMS. One hundred Pg of

this "naked" DNA was restriction digested with BamHI. After digestion, DNA was

extracted once with pheno/chloroform:IAA, once with chloroform:IAA, and ethanol

precipitated with 2.5 volumes of 100% ethanol and 2.5 M ammonium acetate incubating

at -70*C for 30 minutes. DNA was collected by centrifugation at 16,000 x g for 30

minutes at 4C, and washed twice with 80% ethanol and centrifugation at 16,000 x g for

30 minutes at 40C. After lyophilizing, the pellet DNA was resuspended in 10 pl of sterile

water. The in vitro DMS treatment of the naked DNA recovered from digestion of

BamHI was done as described by Maxam and Gilbert (1980) with some modification.

Naked DNA (100 jg) in 10 pl of water was added to 190 p1 of DMS buffer (50 mM

sodium cacodylate, 0.1 M EDTA, pH 8.0), treated for 30 seconds with 0.5 P1 (0.25%) of

DMS, and immediately precipitated with addition of 7.5 M ammonium acetate to the

final concentration of 2.5 M, 14 jig of E. coli tRNA, and 2.5 volumes of 100% ice-cold

ethanol. After incubation in a dry ice/ethanol bath for at least 5 minutes, DNA was

collected by centrifugation at 13,000 x g for 30 minutes at 4C, resuspended in 250 p1 of

common reagent (2.5 M ammonium acetate, 0.1 mM EDTA, pH 8.0), and precipitated

again by addition of 14 pg of tRNA and 750 pl of ice-cold 100% ethanol. After

incubation for 5 minutes in the dry ice/ethanol bath, DNA was collected by centrifugation

at 13,000 x g, for 30 minutes at 40C and washed twice with 80% ethanol with









centrifugation as above. After lyophilization, the final DNA pellet was resuspended in 90

pl of sterile water.

Once the DMS-modified DNA (both in vivo- and in vitro-treated samples) were

precipitated and redissolved in water (approximately 70 mg in 90 ml of sterile water) as

described, the DNA was mixed with 10 ml of piperidine (10 M) and incubated at 900C

for 30 minutes to cleave the DNA at the modified guanine residues (Maxam and Gilbert,

1980). DNA was then ethanol precipitated, collected by centrifugation at 13,000 x g at

40C for 30 minutes, washed twice with 80% ethanol, lyophilized, and then resuspended

and lyophilized three more times in 500 p1 of sterile water. After the last lyophilization,

DNA was resuspended in 20 pil of TE buffer.

Ligation-Mediated PCR (LMPCR)

LMPCR was begun by annealing 3 pmol of primer I to 3 pig of DMS-modified

and piperidine cleaved DNA for each sample in 1 X Vent polymerase buffer (10 mM

KCI, 10 mM (NH4)2SO4, 20 mM Tris-HC1 (pH 8.8), 2 mM MgSO4, 0.1% Triton X-100),

in a total volume of 15 ml, with denaturation at 95C for 10 minutes followed by primer

annealing at 45C for 30 minutes. Primer 1 is the primer for the known site of the

cleaved DNA and is a synthetic single stranded oligonucleotide. The first strand primers

utilized for bottom strand, 5'-GGATAACTTTGGGGAGTTGGTTC-3' and 5'-

GAATAATGTTAGCCGTGTCTCTGGG-3', as well as for the top strand, 5'-

CCAACCTTTGGGTTCTCCAC-3'. The first strand synthesis was performed in 1 X

Vent polymerase buffer with 4 mM MgSO4, 0.25 mM of each dNTP, and 2 U of Vent

DNA polymerase. The samples were incubated for 1 minute each at 53'C, 550C, 570C,









60 C, 62 C, 64 C, 68 C, followed by incubations for 3 minutes each at 72C (Hornstra

and Yang, 1993). Separate primer 1 for top and bottom DNA sequence were designed.

Following the first strand synthesis, a common linker was ligated to the double-

stranded DMS-piperidine cleaved fragment. The linker sequences used were the same as

published by Mueller and Wold (1989). The double-stranded linker is composed of two

synthesized, dephosphorylated complementary oligonucleotides, a 25-mer

oligonucleotide (5'-GCGGTGACCCGGGACATCTGAATT-3') annealed to an 1 1-mer

oligonucleotide (5'-GAATTCAGATC-3'). The double stranded linker (20 pmol/ml) was

prepared from these oligonucleotides by mixing 2 nmol each in 250 mM Tris-HC1, pH

7.7 (total volume of 100 ml), and heating to 950C for 10 minutes followed by gradual

cooling down to 40C for 3 hours, in a thermocycler (Perkin Elmer 480, Applied

Biosciences PE, Norwalk, CT) and incubation at 4C overnight. After the primer

extension step with primer 1, 20 jt1 of 40C solution containing 50 mM dithiothreitol, 18

mM MgC12, 0.125 tg/ d nonacetylated BSA (Sigma Cat#A-751 1), and 110 mM Tris-

HC1, pH 7.5 (Garrity and Wold, 1992) were added, followed by addition of 25 ml of a

40C ligation solution containing 20 mM dithithreitol, 10 mM MgC12, 0.05 ptg/pl

nonacetylated BSA, 3 mM ATP, 4 pmol of annealed common linker, and 4 U of T4 DNA

ligase (Garrity and Wold, 1992). Ligation was performed at 160C overnight. The T4

DNA ligase and the Vent polymerase were removed by one extraction with an equal

volume of phenol/chloroform:IAA and one extraction with an equal volume of

chloroform:IAA. DNA was precipitated by the addition of 7.5 M ammonium acetate to a

final concentration of 2.5 M, 14 jig of tRNA, and 2.5 volumes of 100% ethanol and

incubation at -700C for 30 minutes. After precipitation, the DNA was collected by









centrifugation (13,000 x g, 30 minutes, 4C), washed once with 80 % ethanol, and again

DNA collected after centrifugation (13,000 x g, 30 minutes, 40C), lyophilized, and

resuspended in 20 ml of sterile water.

After ligation of the linker, the nested set of linear genomic DNA fragments from

the region of interest were amplified by PCR using a second gene-specific

oligonucleotide primer, termed primer 2 (5'-GGGGAGTTGGTTCTCTCCTTTCACTG-

3' and 5'-GCCGTGTCTCTGGGTTAGCTGTATTGC-3', respectively for bottom

strands and 5'-CCAACCTTTGGGTTCTCCAC-3' for the top strand, as well as the

complementary primer to the 25-mer linker-primer (5'-

CGCCACTGGGCCCTCTAGACTTAAG-3'). PCR conditions were the same for both

DNA strands and sets of primers, as described by Homstra and Yang (1993) with some

modifications. Freshly prepared Taq DNA polymerase mix (79.4 jLl) containing 1 x Taq

DNA polymerase buffer (1 x 20 mM Tris-HC1, pH 8.4, 50 mM KC1, 1.75 mM MgC12,

0.25 mM each dNTP, 15 pmol primer 2, and 10 pmol 25-mer complementary linker

primer were added to the common linker-ligated DNA samples. Samples were initially

heated to 95C for 5 minutes and 0.6 gl (3 U) of Taq DNA polymerase was added after

the first two minutes of this period. The annealing temperatures (53-65C) were

determined experimentally to establish the conditions that yielded the best results.

Samples were denatured at 95C for 1 minute, annealed at 58C for 2 minutes, and

extended at 76C for 3 minutes. Samples were denatured, annealed and extended in this

manner for 25 cycles. In addition, with each cycle of PCR amplification, the extension

time was increased by 5 seconds. After 25 cycles, samples were kept at 76C and 5 ml of

a fresh PCR incubation solution containing 2.5 mM each dNTP, 1.75 mM MgC12, 1 X









Taq DNA polymerase buffer, and I U of Taq DNA polymerase was added. Samples

were then incubated at 760C for 30 minutes to ensure full extension of each template

strand and addition of a single deoxyadenosine nucleotide to the end of every fragment.

After this incubation, samples were placed on ice, and 1 ml of 0.5 M EDTA was added to

stop the reaction. The DNA was precipitated by addition of 7.5 M ammonium acetate to

a final concentration of 2.5 M, 14 plg of tRNA, and 2.5 volumes of 100% ethanol, and

incubation at -700C for 30 minutes. DNA was collected by centrifugation (13,000 x g,

4C, 30 minutes), washed twice with 80% ethanol and collected again by centrifugation

(13,000 x g, 40C, 30 minutes), lyophilized, and resuspended in 20 P.t of water.

Following LMPCR amplification of the genomic DNA fragments from the region

of interest, the "footprint" is visualized by genomic sequencing (Church and Gilbert,

1984). For this protocol, a 2 ptl aliquot of each LMPCR sample is dried in a vacuum

concentrator and redissolved in 2 pll of formamide-dye solution (98% formamide, 0.025%

xylene cyanol, 0.025% bromophenol blue, and 0.5X TBE (44.5 mM Tris-base, 44.5 mM

boric acid, 1 mM Na2EDTA 2H20). Samples were then loaded onto a 8.3 M urea, 5%

Long Ranger polyacrylamide, TBE (89 mM Tris-base, 89 mM boric acid, 2 mM EDTA)

DNA sequencing gel (60 centimeters long), and size-fractionated, with TBE (89 mM

Tris-base, 89 mM boric acid, 2 mM EDTA) as tank buffer, at 120 W for 4-5 hours. The

PCR fragments were then electro-transferred as described in Hornstra and Yang (1993),

in an electro-transfer apparatus (Harvard Biolabs, Sommerville, MA), using 40 mM TBE

(40 mM Tris-base, 33.8 mM boric acid, 0.4 mM EDTA, pH 8.3) as transfer buffer, for 45

minutes, at 110 V, 2 A, to a Zetabind positively charged nylon membrane (Cuno,

Meriden, CT), with UV crosslinking (Church and Gilbert, 1984). The resulting









membrane containing the electro-transferred DNA was then hybridized with a 32P-radio-

labeled oligonucleotide positioned internal to primer 2, called primer 3. The

oligonucleotide was 32P-radio-labeled as described above for oligonucleotide probes and

separated from the free radiolabeled-nucleotide using the QlAquick Nucleotide Removal

kit from Qiagen as follows. The T4 polynucleotide kinase labeling reaction was added to

10 volumes of Qiagen PN buffer in the kit and passed through a QlAquick column.

Bound DNA was washed twice with a buffer containing 80% ethanol and eluted with 100

gl of TE buffer. The resulting autoradiograph of this preliminary gel was used as a

loading control to obtain data for more adequate loading of the final gel in which the

amount of each sample loaded was adjusted to obtain equal signal intensity in all lanes,

and the final gel was run, in the same way, but with only two samples of each treatment.

Site-Directed Mutagenesis and Substitutions by PCR

The technique of mutagenesis by overlap extension or site-directed mutagenesis

using PCR has been previously described (Ho et al., 1989). The method employs PCR as

a means of creating altered DNA fragments from cloned DNA in a vector with essentially

100% efficiency and in very few steps. Two inside primers (Primer 2 and Primer 3) are

designed for each mutation. For base mutation, the inside primers are mismatched to the

target sequence at the mutated base. Two PCR reactions (Figure 2-1), performed as

described, were run to generate the two overlapping products, one reaction using primer 3

(P3) and the 3' primer (P4) used to amplify the original wild-type 360 bp construct, and

the other reaction using primer 2 (P2) and the 5' primer (P 1) used to amplify the original

wild-type 360 bp construct. The PCR amplicons were agarose gel-purified using the









QlAquick Gel Extraction kit to remove the original PCR primers which might interfere

with the subsequent reaction. Because the mutagenesis primers are complementary to


First PCR Rea
- '4


-1 3'.LA4 .~ 59
P5'
53- 3, P2 59


tions

P3 4 5
5' 39 3'


59 3 5 *

Second PCR Reaction

dirt nleng 1 3 5'


5' *3* 3'
3' ** 5

5' AI I
59 P1 3' 3'P45
39 T** 3'


Figure 2-1. Schematic representation of PCR-based mutagenesis.


First Cycle
Extension



24 Cycles









each other, the two overlapping fragments can be fused in a subsequent extension

reaction. The overlapping gel-purified products (approx. 20 ng) were used as DNA

templates for a second PCR reaction and the PCR reaction conditions were the same as

described previously, using the 5' (P 1) and 3' (P4) primers used to amplify the original

wild-type 360 bp MnSOD enhancer fragment, which contains NdeI sites at both ends. In

the first round of denaturation/annealing/extension of the second PCR reaction, the two

PCR reaction products used as templates, which are the two overlapping parts of the final

amplicon, were denatured and annealed to each other, forming the two possible

heteroduplex products, with recessed 3' ends, that were subsequently extended by Vent

DNA polymerase to produce a product that was the sum of the two overlapping products

and containing the mutation. This product became the template for the second PCR

reaction and it was amplified by 25 cycles of denaturation/annealing/extension, resulting

in multiple copies of the full-length product containing the mutation.

The PCR product was cloned with the use of the PCR Script Cloning System

(Stratagene), and positive colonies were identified by the presence of a 360 bp restriction

fragment when the vector was digested with NdeI. The digested fragment was agarose

gel purified using QIAquick Gel Extraction kit, and the isolated DNA fragment was

cloned into the Ndel site of a linearized CIP-treated hGH vector containing the minimal

MnSOD promoter (Kuo, unpublished data). The directionality of the mutagenized

enhancer fragment was checked by PCR using primers specific to the enhancer fragment

and a primer specific to the vector. Directionality and mutations were also checked by

direct DNA sequencing. The final reporter gene plasmids containing these site-directed









mutant PCR fragments were grown in 50 ml DN5ot E. coli, isolated with a Qiagen

Plasmid Maxi kit and then used for transient transfections in L2 cells, as described above.

Radiolabeled Probe Synthesis

For radiolabel hybridization of UV-crosslinked RNA on positively-charged, nylon

membranes, the cDNA (MnSOD, hGH, or Cathepsin B) was radio-labeled using a

random primer DNA labeling system (Gibco BRL, Gaithersburg, MD) as follows. 100-

500 ng of DNA in 17 pl of ddH20 were boiled for 5 minutes and 15 pl of the random

primers-buffer solution (0.67 M HEPES, 0.17 M Tris-HC1, 17 mM MgCI2, 33 mM 2-

mercaptoethanol, 1.33 mg/ml BSA, 18 OD260 units/ml oligodeoxyribonucleotide primers

(hexamers), pH 6.8) were added together with 2 pl of each dCTP, dTTP, and dGTP (0.5

mM in Tris-HCl (pH 7.5)), 2 Al Klenow fragment (6 U), and 10 pl of [a -32p]dATP (100

iCi). The labeling process was allowed to proceed for 3-4 hours at room temperature.

The un-incorporated nucleotides were removed by passing the labeling reaction over a

Sephadex G-50 column using TE buffer with 100 mM NaCI as elution buffer. The probe

was incubated for five minutes in boiling water before being added to the membrane and

hybridization solution.

When the radiolabeled-probe was an oligonucleotide (for hybridization for in vivo

footprinting analyses), the labeling was done by phosphorylation with bacteriophage T4

polynucleotide kinase as described in Sambrook et al (1989), with some modifications.

Briefly, 30 pmol of oligonucleotide were incubated with 120 PCi of [Y-32p]ATP, 70 mM

Tris-HCl pH 7.6, 5 mM DTT, 10 mM MgCI2, and 20 units of T4 polynucleotide kinase,

in a total volume of 20 gal, for 30 minutes at 370C. The 32-radiolabeled oligonucleotide

was separated from the free radiolabeled-nucleotide, by precipitation with addition of 5









M NaC1 to the final concentration of 0.2 M, 25 pLg of tRNA, and 2.5 volumes of 100%

ethanol, followed by incubation at -70'C for 20 minutes. The precipitated probe was

collected by centrifugation at 13,000 x g for 30 minutes at room temperature,

resuspended in 200 p1 of TE buffer and added to the membrane hybridization solution

after incubating in boiling water for 5 minutes.

Hybridization of Northern and Southern Blots

Membranes were pre-hybridized with 20 ml of hybridization solution (0.5 M

sodium phosphate, pH 7.2, 7% SDS, 1 mM EDTA, pH 8.0, 1% BSA) for at least 20

minutes and then the probe was added after boiling for 5 minutes. After an overnight

incubation at 61C, the blots were washed 4 times for 10 minutes with each wash

temperature at 65C in a high-stringency buffer (0.04 M sodium phosphate, pH 7.2, 1

mM EDTA, pH 8.0, 1% SDS), blotted dry on Whatman filter paper #1 and exposed to

film. When the probe was an oligonucleotide, the incubation overnight was at 400C, the

washing temperature was 45C, and the high-stringency wash buffer had the Na+

concentration adjusted to 350 mM with 5M NaCl. After washing, the membrane was

subjected to autoradiography by exposure to Hyperfilm MP (Amersham-Pharmacia,

Piscataway, NJ).

The exposed film was scanned using a Hewlett-Packard ScanJet 4cIT into Adobe

Photoshop (Adobe Systems Incorporated, San Jose, CA) computer software for creation

of the figures displayed in this dissertation made in Microsoft Office Powerpoint

(Microsoft Corporaton, Redmond, WA).














CHAPTER 3
CYTOKINE-INDUCIBLE ENHANCER WITH PROMOTER ACTIVITY IN BOTH
THE RAT AND HUMAN MANGANESE SUPEROXIDE DISMUTASE GENES

Introduction

The superoxide dismutases (SODs) are the first line of cellular defense against the

damaging effects of superoxide anion radicals (Halliwell and Gutteridge, 1990).

Manganese superoxide dismutase (MnSOD) is the most highly regulated of the three

SODs (Visner et al., 1991; Dougall and Nick, 1991), being localized to mitochondria

(Suzuki et al., 1993; Del Maestro and McDonald, 1989) and conferring potent

cytoprotection (Shull et al., 1991; Wong and Goeddel, 1988; Wong et al., 1989; Visner et

al., 1990; Eastgate et al., 1993; Akashi et al, 1995; Manganaro et al., 1995; Baker et al.,

1998). Multiple studies have shown that increased cellular levels of MnSOD are

cytoprotective during cellular oxidative stress (Shull et al., 1991) or inflammatory

challenges, such as TNF-oa-mediated apoptosis (Wong and Goeddel, 1988; Wong et al.,

1989), IL-I cytotoxicity (Visner et al., 1990), ionizing radiation (Eastgate et al., 1993;

Akashi et al., 1995), and neurotoxicity (Manganaro et al., 1995; Baker et al., 1998). The

role of MnSOD as a potent cytoprotective enzyme is most strikingly illustrated in three

transgenic model studies. The first transgenic model involves targeted overexpression of

MnSOD in the pulmonary epithelium of mice resulting in a decreased level of

inflammation as a consequence of a hyperoxic exposure (Wispe et al., 1992). In the

second study, the physiological importance of this gene is best exemplified through gene

ablation where MnSOD knockout mice manifest severe dilated cardiac myopathy and die









within ten days of birth (Li et al., 1995). The third study shows that treatment of the

MnSOD knockout mouse with the superoxide dismutase mimetic, manganese 5,10,15,20-

tetakis (4-benzoic acid) porphyrin, rescues these mice from the systemic toxicity, but

allows development of a severe neurodegenerative disorder by three weeks of age (Melov

et al., 1998).

Previous investigations from this and other laboratories have established that

levels of steady state MnSOD mRNA and protein increase following exposure to

bacterial lipopolysaccharide (LPS), tumor necrosis factor (TNF) and interleukin- 1 (IL-1)

(Wong and Goeddel, 1988; Visner et al., 1990; Visner et al., 1991; Melov et al., 1998).

Stimulus-dependent increases in mRNA levels are inhibited by actinomycin D (Visner et

al., 1992), suggesting increased transcription of the gene, which has been confirmed by

subsequent nuclear run-on studies (Hsu, 1993). Results from DNase I hypersensitive

studies analyzing the chromatin structure of MnSOD have identified multiple regions of

increased nuclease accessibility located throughout the gene as well as a stimulus-

dependent alteration in chromatin structure in the 5' flanking region (Kuo et al., 1999).

Furthermore, dimethyl sulfate in vivo footprinting studies have identified the binding sites

for ten basal protein factors which interact with the promoter as well as stimulus-

dependent alterations in guanine residue reactivity near the hypersensitive site found only

in stimulus treated cells (Kuo et al., 1999). To complement the preceding studies on

chromatin structure and in vivo footprinting, functional studies of the promoter were

performed by analyzing deletions of the 5' flanking region. The promoter deletion data

suggest that basal promoter activity requires only a very small portion of the 5' flanking

region. Together these data suggest that multiple protein-DNA interactions occur during









transcription under basal conditions and that treatment with inflammatory mediators,

causes an alteration in chromatin structure in the promoter region of the gene.

Not all cis-acting regulatory elements are located in 5' flanking regions. In fact,

regulatory sequences have been identified within introns or in distant 3' flanking

sequences of the human and mouse immunoglobulin kappa gene (Queen and Baltimore,

1983; Judd and Max, 1992), platelet-derived growth factor gene (Takimoto and

Kuramoto, 1993), alcohol dehydrogenase-l-S (Callis et al., 1987) and collagen genes

(Simkevich et al., 1992). To identify regions of MnSOD that regulate basal and

stimulated expression, our present study utilized deletion analysis of rat MnSOD (Hurt et

al., 1992) coupled with transient transfection studies in a rat lung epithelial cell line.

Measuring mRNA expression levels of the human growth hormone reporter gene, we

have localized a complex enhancer element within intron 2 of the rat and a homologous

region in intron 2 of the human MnSOD. Most interestingly, this regulatory element

possesses the ability to promote cytokine-inducible transcription independent of a

promoter sequence.

Results

An Inducible Cis-Acting Enhancer Element Exists within MnSOD

Previous results of steady-state MnSOD mRNA levels in rat pulmonary epithelial

and endothelial cells demonstrated dramatic induction with inflammatory mediators

(Visner et al., 1991). In addition, nuclear run-on experiments showed that stimulus-

dependent MnSOD expression is at least in part a consequence of de novo transcription

(Hsu, 1993). MnSOD promoter deletion analysis demonstrated levels of stimulus-

dependent MnSOD expression that were far lower than that seen with the endogenous









steady-state mRNA. The vector constructs used in the analysis contained only 5'

flanking sequence, incorporating only one of the seven DNase I hypersensitive sites

within MnSOD (Kuo et al., 1999). To determine whether the remaining DNase I

hypersensitive sites within MnSOD contained regulatory function, we created hGH

expression vectors that combine both the MnSOD promoter (a 2.5 Kb HindIII to EagI

fragment) and a 6.1 kb HindIII fragment, containing the remaining DNase I

hypersensitive sites (Figure 3-1). Expression of hGH in cells transfected with these

vectors was compared in the same experiments to expression of hGH in cells transfected

with the vector construct, HindIE GH, containing only the 5' promoter fragment.

Of note, the data displayed in Fig. 3-2 and all subsequent figures use northern

analysis to directly assess transcription rates from the transfected reporter constructs.

This is distinct from studies which assay reporter protein levels or enzymatic activity that

must take into consideration potential effects of stimuli on translation and post-

translational events.

As shown in Fig. 3-2A, LPS treatment caused a dramatic enhancement of steady-

state mRNA expression as a result of adding the internal MnSOD genomic fragment, in a

manner independent of fragment orientation. The same result was obtained when

transfected cells were stimulated with TNF- or IL- I P (data not shown). Furthermore,

cleavage of the 6.1 kb HindIII fragment by making use of the unique HpaI site

demonstrated that the cis-acting element responsible for the inducible activity was

localized to the 5' 3.8 kb portion of the original HindIII fragment (Figure 3-2B). Again,

orientation did not influence the inducible activity in response to inflammatory












MnSOD Genomic Clone
19.5 Kb


EcoR I

Exons
DNase HS Sites


Hind III Eag I
[2.5 Kb Hi,
Fragment

12
1


6.1 Kb
nd III Hpa I Hind III


3 4 5
2 3 4 56 7


2.5 Kb MnSOD Promoter
Fragment (Hind-E).
Nde I Hind III
I I


human growth hormone gene


d %
Enhancer Fragments


p GH


Figure 3-1. Schematic representations and restriction maps of the MnSOD genomic clone
and the expression vectors constructed to assess potential enhancer activity. The
restriction enzyme sites are indicated above the sequence (e.g., HindII). The expression
vectors contain the 6.1 kb HindIII fragment from positions +1107 to +7238 of MnSOD,
with DNase-I hypersensitive sites 2-7 (*; Kuo et al., 1999) in either the 5'-to-3' or the 3'-
to-5' orientation. In addition, each expression vector contains the MnSOD 5' promoter
sequence from the HindlI site to the EagI site (Hind-E). The HindlI fragment, from
positions +1107 to +7238 of MnSOD, has been cut at position +4938 by HpaI digestion
creating the 3.8 kb and 2.3 kb fragments. The HindIllI (+1107) to HpaI (+4938) fragment
contains hypersensitive sites 2, 3, and 4 (*; Kuo et al., 1999). The HpaI (+4938) to
HindlII (+7238) fragment contains hypersensitive sites 5, 6, and 7. These two fragments
were tested in in transient transfections as was the 6.1 kb HindII fragment. The
restriction sites (HindIII and NdeI) into which the enhancer deletions were ligated are
denoted on the hGH vector, which also contains the MnSOD promoter (Hind-E).
Reproduced with permission from Rogers et al. (2000), Biochem. J., 347, 233-242.
Biochemical Society.


EcoR I
I


m

















Hind/E Hind/E Promoter and
Promoter 6.1 Kb Fragment
Alone
Orientation forward reverse
LPS + + +
hGH a

Cathepsin B


Hind/E Promoter plus


3.8 Kb Fragment 2.3 Kb Fragment
Orientation forward reverse forward reverse
LPS + -+ + +
hGH
Cathepsin B


MnSOD


MnSOD


Figure 3-2. hGH mRNA levels after transfection in rat lung epithelial cells with vectors
containing the internal HindIII fragment of MnSOD coupled to the promoter versus
MnSOD promoter alone. Northern analysis was done using radiolabeled probes
synthesized from hGH, MnSOD and cathepsin B cDNAs as described in the Methods
section. hGH mRNA expression in rat lung epithelial cells transfected with vectors
containing either the 3.8 kb or the 2.3 kb fragments which are deletions of the internal
HindIII fragment of MnSOD. Reproduced with permission from Rogers et al. (2000),
Biochem. J., 347, 233-242. Biochemical Society.










mediators, thus indicating that the element could partially satisfy the definition of an

enhancer.

The MnSOD Inducible Enhancer Element Is Located within Intron 2

To further localize the inducible cis-acting element within the 3.8 kb region, a set

of serial deletion fragments spanning this region were amplified by PCR using

complementary oligonucleotides and inserted into the MnSOD promoter vector, Hind-E

GH. Deletions of the fragment from the 5' end and from the 3' end (Fig. 3-3) were

generated in this manner. The inducible enhancer activity was evaluated by transient

transfections into L2 cells using northern analysis. Based on the 3' deletions of the 3.8

kb HindIII-HpaI fragment, the enhancer activity was localized to a region of

approximately 450 bp in the 5' end of this 3.8 Kb fragment (Fig. 3-4). This position

coincides extremely well with DNase hypersensitive site 2 (Kuo et al., 1999) located near

the intron 2-exon 3 boundary.

In an effort to localize the enhancer more precisely, 5' deletions were also

constructed as shown in Figure 3-5. Multiple 3' and 5' deletions containing the enhancer

fragment demonstrate inducible activity comparable to the steady-state mRNA levels of

the endogenous gene. Interestingly, the 338 and 227 bp deletions show reduced enhancer

activity relative to the 455 bp fragment as shown in figure 3-5B, thus further delineating

the enhancer activity regulated by LPS, TNF-a, and IL-I P to within a 200 to 300 bp

region near the 3' end of intron 2.












6.1 Kb


1.; 3.8 Kb
Restriction 3 K
Sites HindIII


900 hpI
Exon 3
116bp
0
2
Hi


Intron 3
2475 bp


3 4
dndlII/HpaI fragment


HpaI
Intron 4
1 552 bp1

Exon 4 Exon
179 bp 1451
5 6


2.3 Kb -1
HindIII

1765 bp d


919 bp


1 2.9 Kb


1.8Kb


I 765 bp

--- 542 bp

I- 455 bp


I--464 bp ..... H 338 bp

..H 227bp


Figure 3-3. Deletions of the 3.8 kb enhancer fragment. Seriel deletions from both the 5'
and 3' ends of the 3.8 kb fragment were created by PCR amplification and ligated into
either the HindII site or the NdeI site of the Hind/E GH vector (see Figure 3-1).
Reproduced with permission from Rogers et al. (2000), Biochem. J., 347, 233-242.
@ Biochemical Society.


HS Sites







CD
MT
0A






























Figure 3-4. Northern analysis of transient transfections of the 3' PCR deletions of the
3.8 kb enhancer fragment localized the inducible activity to the 464 bp/1.0 kb fragment.
Reproduced with permission from Rogers et al. (2000), Biochem. J., 347, 233-242.
Biochemical Society.










Hind/E Hind/E Promoter plus 3' Deletion Fragments
Promoter
Alone 464bp 1.0Kb 1.8Kb 2.9Kb 3.8Kb
Orientation fwd rev fwd rev fwd rev fwd rev fwd
LPS + + + + + + + + + +
hGH all $4 .... '4



MnSOD


Cathepsin B


Hind/E
Promoter


HindJE Promoter plus 3' Deletion Fragments


Alone 262bp 464bp 1.0Kb 464bp- 1.0Kb
Orientation fwd rev fwd rev fwd rev fwd rev
LPS + + + + + + + + -+


hGH


Cathepsin B



MnSOD


... W ,:: 1 1 r 1






























Figure 3-5. Northern analysis of transient transfections of the 5' PCR deletions of the 3.8
kb enhancer fragment localized the inducible activity to an area between the 455 bp and
the 227 bp fragments in the 3' end of the 1.0 kb PCR fragment. Reproduced with
permission from Rogers et al. (2000), Biochem. J., 347, 233-242. Biochemical
Society.













Hind/E Hin
Promoter
Alone 919 bp
orientation fwd rev
LPS + + +
hGH 'W 2V


I/E Promoter plus 5' Fragments


765 bp
fwd rev


542 bp
fwd rev


455 bp
fwd rev


Cathepsin B


A


Hind/E
Promoter


Hind/E Promoter plus 5' Fragments


Orientation


Alone 455 bp 338 bp 227 bp

forward forward reverse forward reverse


LPS + + -+-

hGH I'.060


Cathepsin B


+ + +









The Enhancer Is Likely Composed of A Complex Set of Interacting Elements

To further localize the enhancer within the 3' end of intron 2, additional deletion

constructs were created (Fig. 3-6). PCR amplification was used to generate a 260 bp

fragment spanning the region between the two 5' deletions shown in Figure 3-3 (455 bp

and 227 bp) as well as two 143 bp fragments which overlap each other within the 260 bp

fragment (Fig. 3-6). The ability of these fragments to cause inducible expression was

evaluated by transient transfection and northern analysis. The 260 bp fragment

reproduced the enhancer activity seen with the larger, 919 bp fragment (Fig. 3-7). In

addition, response to all the inflammatory mediators (LPS, TNF-a, and IL- 13) was

maintained. Interestingly, the two overlapping 143 bp fragments show reproducibly

diminished enhancer activity as compared to the 260 bp fragment (Fig. 3-7). These

results are consistent with the previous deletion analyses in Figure 3-5, which showed

partial enhancer activity in the 338 bp fragment compared to the 455 bp fragment and

loss of activity with the 227 bp fragment. Together the results summarized in Figures 3-5

and 3-7, demonstrate that the 260 bp fragment delineates the minimum functional

boundaries of the enhancer along with the complexity and interactive nature of this

important regulatory sequence, as displayed by the retention of enhancer activity in the

143 bp fragments relative to the promoter alone.

To further assess the complexity of the enhancer element, electrophoretic

mobility shift assays (EMSA) were performed with nuclear extracts from control and

treated (LPS, TNF-a, IL- 1 ) cells. Figure 3D illustrates the different protein binding

patterns between treated and control nuclear extracts as well as the different patterns of

protein binding between the two functional DNA fragments of the enhancer element.












Exon 3 Exon 4
I Intron 21 IIIntron 3



260bp

14 bp I [ Enhancer Fragments
00 Used in Transfections

143 bp
IA Ao
Enhancer Fragments 100 bp
Used in EMSA 00 & I
95 bp
AA
1103 bp
[A oAol








Figure 3-6. Schematic of the enhancer region in intron 2. A 260 bp PCR fragment of the
enhancer region totally contained within intron 2 and two overlapping 143 bp PCR
fragments encompassing the 260 bp region were created and ligated into the NdeI site of
the Hind/E GH vector (see Fig. 3-1) for transient transfection in rat epithelial cells and
northern analysis. In addition to the 143 bp fragments, three other fragments (100, 95
and 103 bp) were created by PCR amplification for EMSA. Putative constitutive and
inducible protein-binding sites are illustrated by open circles and filled triangles,
respectively. Reproduced with permission from Rogers et al. (2000), Biochem. J., 347,
233-242. Biochemical Society.































Figure 3-7. A. Northern analysis of transient transfections of the 919 bp (see Fig. 3-6) or
the 260 bp fragment (both orientations) in the Hind/E GH vectors in control, LPS, TNF-
a, and IL-1-stimulated rat pulmonary epithelial cells. B. Northern analysis of transient
transfections of the 260 bp fragment and 143 bp fragments in the Hind/E GH vectors in
control and LPS-stimulated rat pulmonary epithelial cells. Reproduced with permission
from Rogers et al. (2000), Biochem. J., 347, 233-242. Biochemical Society.














Hind/E Promoter
plus Enhancer Fragment


Orientation

Stimulus

hGH


Cathepsin B


919 bp 260 bp 260 bp
Forward Forward Reverse


HindIE Hind/E Promoter
Promoter plus Enhancer Fragment
Alone 260 bp 143 bp 143 bp

Orientation fwd rev fwd rev fwd rev
LPS + + + + + + +


hGH:


Cathepsin B


Hind/E
Promoter
Alone


--,&. I -II.&I-AkIM,































Figure 3-8. EMSA of the two 143 bp, as well as, the 100, 95 and 103 bp fragments using
nuclear extracts from untreated cells and cells treated with LPS, TNF-ox, and IL-I P.
Open circles refer to putative constitutive protein binding and filled triangles refer to
putative inducible protein binding. Reproduced with permission from Rogers et al.
(2000), Biochem. J., 347, 233-242. Biochemical Society.









DNA
Fragment


Stimulus


5' 143bp
0


3' 143 bp
>
ci


tii


DNA
Fragment

Stimulus


100 bp 95 bp 103 bp


~0




ii 0
4 0









Constitutive protein binding is observed in the 3' 143 bp fragment, but several

inducible binding proteins can be appreciated in both fragments. In an attempt to further

localize the protein binding sites, smaller fragments of the involved region were

generated by PCR and evaluated by EMSA (Fig. 3-8). Once again, constitutive protein

binding was observed in two of the fragments (100 bp and 103 bp). However, as with the

143 bp fragment, inducible protein binding was also observed in two of the smaller

fragments (100 bp and 95 bp), most notably in the 95 bp fragment with a dramatic

difference in binding between control and stimulated nuclear extracts. Further

localization of protein binding was attempted with 50 bp and 30 bp fragments from this

region, however, I was unable to obtain protein-DNA interactions, which displayed any

stimulus-specific pattern (Rogers, data not shown). Unlike the results with the larger

fragments (Fig. 3-8 A and B), EMSA with the smaller fragments (50 bp and 30 bp)

showed only constitutive binding patterns. I believe that multiple protein-protein

interactions are likely a prerequisite for the stimulus-specific DNA binding pattern, thus

explaining the loss of stimulus-specific protein-DNA interaction in the smaller deletions

of this complex regulatory element.

The Inducible Enhancer Elements within Rat and Human MnSOD Can Act with a

Heterologous Promoter

To determine whether the MnSOD enhancer could function with a heterologous

promoter, the enhancer fragment was cloned in both orientations into the TKGH

expression vector. The herpes virus thymidine kinase (TK) promoter in this vector is a

200 bp minimal, TATA-containing promoter, quite dissimilar to the GC-rich, TATA- and

CAAT-less MnSOD promoter. Results of transient transfections and northern analysis



























Figure 3-9. A. Interaction of the 6.1 kb MnSOD fragment with the heterologous herpes-
simplex TK promoter in the pTKGH expression vector. Expression vectors, pTKGH
alone and pTKGH containing the 6.1 kb enhancer (both orientations), were constructed
and a comparison of hGH mRNA levels in transiently transfected rat lung epithelial cells
treated with LPS, TNF-a, or IL-1 I3 was made. Northern analysis was done using
radiolabeled probes from hGH, MnSOD and cathepsin B cDNAs. B. Comparison of the
rat and human enhancer regions in the pTKGH vector. A 553 bp region encompassing
the rat enhancer as well as the analogous region of the human MnSOD (466 bp fragment)
were amplified by PCR and cloned into the HindII site of the pTKGH vector. Northern
analysis of transient transfections in rat pulmonary epithelial cells shown here and
described in the Methods section. Reproduced with permission from Rogers et al.
(2000), Biochem. J., 347, 233-242. Biochemical Society.







62






Thymidine Kinase Promoter

Hifpd I'll L


h


-- pIKtKl-i
man growth hormone gene


6.1 Kb Rat MnSOD Hind III Fragment


TK Promoter and 6.1 Kb Enhancer
TK Promoter (plus orientation)
Alone forward reverse
LPSTNFL1 LPSTNFLI LPSTNFIL1


A


Thymidine Kinase Promoter

Hipd ll K


hu


* plKGiH
man growth hormone gene


553 bp Rat Enhancer Fragment or
466 bp Human Enhancer Fragment

TK Promoter plus

553 bp 466 bp
Rat Enhancer Human Enhancer
Stimulus LPS TNF IL-I LPS TNF IL-I

hGH 00


Cathepsin B T~T~


hGH

Cathepsin B



MnSOD


Cathepsin B


v-v Tm wa~ Tw T ... ..Tvw-


I I


m w F TT









(Fig. 3-9) demonstrated that the enhancer element could cooperate with the minimal TK

promoter and dramatically increase the transcriptional activity of the hGH reporter gene

in response to LPS, TNF-a, and IL-13. The element functioned equally well in both

orientations and interestingly was able to orchestrate reporter induction to as much as 45

fold above baseline. The ability of this element to enhance transcriptional activity of

both the endogenous and a heterologous promoter in an orientation-independent and

position-independent manner further qualifies it as an enhancer element.

Given the potency of this enhancer element, we compared the sequence of intron

2 in the rat gene with the corresponding region in the human MnSOD locus and found a

high level of homology. In order to evaluate the functional significance of this region, a

553 bp fragment of the rat enhancer and an analogous 466 bp region of intron 2 of human

MnSOD were inserted into Nde I site of the TKGH vector. The ability of the fragments

to cause inducible enhancer activity was assessed by transient transfections and northern

analysis. Both the rat and the human fragments caused essentially identical inducible

expression in response to LPS, TNF-a and IL-13 (Fig. 3-9), indicating that this region of

human intron 2 likely acts as an enhancer in the endogenous gene and that the enhancer

activity itself is well conserved between species. We have also demonstrated that the rat

and human enhancer can function equally as well in human cell lines (data not shown).

Evaluation of Promoter-Enhancer Interactions

We have demonstrated by in vivo footprinting that the MnSOD promoter contains

10 potential basal protein-binding sites (Kuo et al., 1999). These sites are illustrated in

Figure 3-10 relative to the restriction sites that were employed for the promoter deletion

analysis. To define the areas within the promoter required for interaction with the













9= protein binding site by in vivo footprinting


Hind III
Hind/EI
-2500


Enhanced G's by
in vivo footprinting
GG Sfi I Sac II Nae I Eag I
1 000016000 OSooo I


-285


1
-134


I I
-46 +32


tExon i


Sfi/El 00000 000
Sac2/E1 -OOO

Nae/E -


Nde I
I


919 bp Rat Enhancer
Fragment


Deletions of MnSOD Promoter



human growth hormone gene


Figure 3-10. MnSOD promoter deletions summarizing the protein binding sites found by
in vitro footprinting (Kuo et al., 1999). The 919 bp fragment encompassing the entire
enhancer was ligated into the NdeI site of the hGH vector with the respective MnSOD
promoter deletions. Reproduced with permission from Rogers et al. (2000), Biochem. J.,
347, 233-242. Biochemical Society.


pOGH





























Figure 3-11. A. Northern analysis following transient transfections of promoter deletion
constructucts (Hind/E and Sfi/E containing the 919 bp enhancer fragment) into rat
pulmonary epithelial cells. B. Northern analysis following transient transfections of
promoter deletion constructs (Hind/E, Sac/E, and NaeE containing the 919 bp enhancer
fragment) into rat pulmonary epithelial cells. Reproduced with permission from Rogers
et al. (2000), Biochem. J., 347, 233-242. Biochemical Society.












Promoter
Fragment
Enhancer Orientation
LPS

hGH


919 bp Enhancer Fragment
plus Promoter Deletion

Hind/E Sfi/E Hind/E Sfi/E
forward reverse forward reverse
+ -+ -+ +-+ +


Cathepsin B


Hind/E
Promoter
Alone

LPS +


hGH


Cathepsin B


919 bp Enhancer
plus Promoter Deletion


Hind/E Sac/E Nae/E
- + .. + +





























Figure 3-12. A. Schematic of the promoter-less human growth hormone vector (pGH)
and the position of the human 466 bp enhancer fragment. Northern analysis of the 466
bp human enhancer in p4GH and pTKGH constructs transiently transfected into control
and treated (LPS, TNF-a, and IL-13) rat pulmonary epithelial cells. B. Schematic of the
promoter-less hGH vector (p GH) and the position of the 260, 553, or 746 bp enhancer
fragments. Northern analysis of the rat enhancer fragments (260, 553, and 746 bp) in
p4GH constructs transiently transfected into control and treated (LPS, TNF-ct, and IL- 13)
rat pulmonary epithelial cells. Reproduced with permission from Rogers et al. (2000),
Biochem. J., 347, 233-242. Biochemical Society.











466 bp Human Prohancer


Hind III A
r-_ pGH
human growth hormone gene


466 bp Human MnSOD 466 bp Human MnSOD
Prohancer Fragment Prohancer Fragment
in pbGH in pTKGH
Stimulus LPS TNF IL-1 LPS TNF IL-1


hGH


Cathepsin B


746, 553, or 260 bp Rat Prohancer



Hind III B
U- pGH
human growth hormone gene


Rat Prohancer Fragments in p)&GH
Prohafcer 746 bp 553 bp 260 bp
Fragment

Orientation 5'# 3' 3'* 5' 5'* 3' 3'* 5' 3'* 5'
Stimulus LPS TNF IL-1 LPS TNF IL-I LPS TNF IL-I LPS TNF IL-I LPS TNF IL-I

hGH


0-+U -1









enhancer element, the previous promoter deletion constructs (Kuo et al., 1999) were

coupled with a 919 bp enhancer fragment (Fig. 3-10). Transient transfection and

northern analysis were used to evaluate inducible activity for these vector constructs. Of

interest, the first five binding sites could be deleted without any detectable decrease in

inducible activity (Fig. 3-1 IA). It was not until the remaining five basal binding sites

were eliminated that the level of induction decreased (Fig. 3-11B) with almost complete

loss of basal activity. Interestingly, LPS-inducible transcription could still occur when all

promoter protein-binding sites were deleted, but only when the vector construct contained

the enhancer fragment (Fig. 3-11B). However, in the absence of the enhancer element,

deletion of the same promoter region, (construct Nae/E, 18), eliminated any transcription,

thus, indicating that the enhancer element contained DNA sequence potentially capable

of independently promoting transcription in a stimulus-regulated manner.

The Rat and Human Enhancer Elements Contain Inducible Promoter Activity

With the results of the previous experiment (Figure 3-11), we postulated that the

enhancer element might exhibit stimulus-dependent promoter activity in the absence of a

true promoter. Since the Nae/E GH construct did contain 77 bp from the 5' flanking

region of the MnSOD promoter, the rat and the human enhancer elements were inserted

into the promoter-less hGH vector (IGH) (Figure 3-12A). Figure 3-12A shows the

results of the 466 bp human MnSOD enhancer fragment in the presence and absence of

the TK promoter. Inducible transcription was observed with LPS, TNF-a and IL- 1 P, but

at lower levels than when the fragment was inserted into the pTKGH vector.

Interestingly, two transcripts, one the correct size and one approximately 200 to 300 bp

larger, were seen when the enhancer fragment acted as its own promoter. When the 553









bp and 746 bp rat enhancer fragments were tested in the promoter-less hGH vector

(pOGH), similar results to the human fragment were obtained, in that, two different-sized

transcripts were observed (Figure 3-12A and B). Of note, however, when either the 553

bp or the 746 bp enhancer fragment was inserted into p0GH in the 3' to 5' orientation,

the correct-sized transcript predominated. This result would indicate that the enhancer

can indeed act as a promoter, but its orientation and position relative to the start of

transcription are important. To determine if the preceding hypothesis was correct, p0GH

vector constructs containing the 260 bp enhancer fragment were created. As can be seen

in Figure 6B, when the 260 bp enhancer fragment acting as a promoter was inserted into

the p0GH vector in the 3' to 5' orientation, a single stimulus-responsive transcript

resulted.

Discussion

As a cellular antioxidant, mitochondrial MnSOD has been consistently shown to

be an effective cytoprotective enzyme. MnSOD expression is highly regulated in

response to a variety of pro-inflammatory mediators in many cell types. In rat lung

epithelial cells, the inflammatory mediators, LPS, TNF-a and IL-13, each cause MnSOD

steady-state mRNA levels to increase 10 to 20 fold, which has been shown in nuclear

run-on studies (Hsu, 1993) to be partly due to increased transcription of the gene. A

survey of the entire MnSOD locus for sites of possible protein-DNA interaction using

DNase I hypersensitive site analysis revealed increased nuclease accessibility at sites in

the 5' proximal promoter region and 6 other sites located within the gene (Kuo et al.,

1999). The present experiments further expand our understanding of the molecular









mechanisms regulating basal and induced expression of MnSOD by identifying an

enhancer region within the rat and human MnSOD.

The 5' flanking sequence of MnSOD is characterized by a GC-rich island, lacking

a TATA- and CAAT-box for initiation of transcription. In vivo footprinting studies have

defined protein binding sites for 10 basal transciption factors within 500 bp of the

transcriptional start site (Kuo et al., 1999). Promoter deletion analysis identified essential

cis-acting sequences located within 157 bp of the transcriptional start site (Kuo et al.,

1999). This region of the promoter includes 5 of the basal protein binding sites and is

capable of supporting basal and stimulated (LPS, TNF-a and IL- 13) expression.

However, protein and mRNA levels of the hGH reporter were only induced 2 to 3 fold in

transient transfection studies using vectors containing from 4.5 to 0.16 kb of the MnSOD

promoter region alone (Kuo et al., 1999). Examination of the MnSOD promoter for

known transcription factor consensus sequences by computer analysis revealed an NF-KB

sequence at -353 as well as Spl and gut-enriched Kriippel-like factor (GKLF) (Shields

and Yang, 1998; Zhang et al., 1998) sites corresponding to binding sites I-V. As

previously shown, the NF-KB site is not occupied based on in vivo footprinting data and

is not important for enhancer function (Fig. 3-11 A). On the other hand guanine contacts

from in vitro footprinting with purified Sp I and GKLF strongly implicates these proteins

with the in vivo contacts observed at sites I-V. However, previous data (Kuo et al., 1999)

and Figure 3-11 A seem to indicate that based on transient transfection studies the

potential Sp 1 and GKLF sites (I-V) are not essential for basal or enhancer-dependent

gene expression (using LPS, TNF-a, and IL- 113 as stimulants). These data may be

reconciled by appreciating that constitutive Sp I and/or GKLF binding to sites I-V might









be necessary for other stimuli known to induce INF-y (Harris et al., 1991; Valentine and

Nick, 1992), phorbol ester (Fujii and Taniguchi, 1991) or inhibit (glucocorticoids

(Dougall and Nick, 1991)) MnSOD expression. Alternatively, it should be noted that the

functional data was obtained by transient transfection of plasmid reporter gene DNA into

mammalian cells. Consequently, it is very possible that the plasmid DNA does not form

proper chromatin structures following transfection. Appropriate chromatin structure is

likely crucial for the correct alignment of DNA sequence important for the

promoter/enhancer interactions. Therefore, we must consider this as a possible

explanation for the data shown in Figure 3-1 lB. The data in Figure 3-1 lB does,

however, strongly implicate the functional importance of binding sites VI-X to both basal

and enhancer/stimulus-specific expression. The pNae/Eag GH vector was not sufficient

to drive either basal or stimulated expression (Kuo et al., 1999), suggesting that a

minimal promoter sequence for transcriptional initiation was no longer present.

The observed induction of the reporter gene from the 5' MnSOD promoter was

much lower than endogenous MnSOD expression following treatment with inflammatory

mediators (Kuo et al., 1999). These data and the presence of DNase I hypersensitive sites

within the gene suggested that regulatory elements might exist outside the 5' flanking

sequence. Results from transfections with vectors combining both the 5' promoter region

and the internal 6.1 kb fragment (containing the remainder of the DNase I hypersensitive

sites) confirmed that genomic sequences 3' to the transcriptional start site contain

enhancer activity. Most importantly, this region contains adequate enhancer activity to

mimic endogenous, stimulus-dependent transcription levels. Deletion analysis of this

region localized this activity to a 260 bp area within intron 2, which contains DNase I








hypersensitive site 2. When this 260 bp region is divided into two 143 bp fragments, we

found that each of these fragments independently retained inducible activity, albeit at a

lower level. Moreover, based on EMSA these same 143 bp fragments were able to bind

both constitutive nuclear factors as well as a number of factors specific to extracts from

induced cells. However, attempts to further delineate the enhancer by EMSA using DNA

fragments less than 50 bp (Rogers, unpublished data) led to the elimination of stimulus-

specific in vitro binding, further demonstrating the complexity of this enhancer and

implying that protein-protein interactions may be critical to the formation of specific

protein-DNA complexes between the promoter and enhancer. Therefore, we believe that

this enhancer is composed of a set of complex, interacting elements involved in the

inducible expression of MnSOD. Contrary to the published characterization of the

murine gene (Jones et al., 1995 and 1997), our data would indicate that separate elements

within this enhancer region retain an ability to induce MnSOD transcriptional activity, but

that small (25-30 bp) individual elements cannot act independently to confer the same

inducible levels seen in the endogenous gene.

Our results demonstrate that this enhancer element requires a portion of the

MnSOD promoter to achieve levels of induction analogous to steady-state northern

analysis. Using portions of the promoter coupled with the enhancer, we demonstrated the

requirement for sequences from -154 to the start of transcription, which include protein-

binding sites VI-X defined by in vivo footprinting (Kuo et al., 1999). Given the

functional connection between the enhancer and the MnSOD promoter, we postulate that

the enhancer may interact with the promoter through a mechanism involving DNA

bending (Ptashne, 1986). As support for this hypothesis, we have performed co-









transfection experiments with the promoter and enhancer on separate plasmids and found

under these conditions that inducible transcription could not be achieved (Rogers, data

not shown). This substantiates the argument that the MnSOD promoter and enhancer

must reside within a contiguous region of DNA. Therefore regulatory elements most

likely physically interact through DNA bending (Ptaslne, 1986) and possibly involving

an alteration in chromatin structure in the promoter as defined by Kuo et al., 1999.

Of particular interest is the existence of a homologous functional enhancer

element in human MnSOD (Fig. 3-10), which responds to the same inflammatory

mediators as the rat enhancer in both rat and human cells (data not shown). In addition,

another unique characteristic of the rat and human enhancer element is its ability to drive

transcription independent of a classical promoter (Figures 3-12A and B). As an

independent promoter/regulatory element, this sequence has the capacity to promote

stimulus-dependent transcription with negligible basal levels. Previous work in our

laboratory explored the possibility of an alternative promoter or differential mRNA

splicing as a cause for the multiple transcripts in the rat. Using primer extension and 32p_

labeled cDNA and genomic fragments as hybridization probes, it was determined that

alternative polyadenylation was the likely cause for the multiple transcripts seen in the rat

MnSOD (Hurt et al., 1992). Understanding the regulation of this enhancer region will be

important since it seems to be exquisitely responsive to acute cytokine mediators and, if

similar motifs are found in other genes, may exist as a regulatory unit that serves as a

general inflammatory response element. Current efforts are underway to further

characterize the enhancer by DMS in vivo footprinting and mutagenesis for functional

transfection studies.















CHAPTER 4
IN VIVO FOOTPRINTING AND MUTAGENESIS OF THE RAT MANGANESE
SUPEROXIDE DISMUTASE ENHANCER

Introduction

Gene activation in response to extracellular signals, infection by pathogens, or

environmental stresses requires highly integrated signal transduction pathways that direct

the transcriptional machinery to the appropriate set of genes. A crucial issue in

understanding inducible gene regulation is how a relatively small number of different

transcription factors is used to achieve the high level of specificity required to control

complex patterns of gene expression (Maniatis et al., 1987; McKnight and Yamamoto,

1992). The answer probably lies in the correct combination of transcription factors

aligning on the regulatory region to cause gene activation. Most genes are regulated by

multiple transcriptional activator proteins, each of which plays a role in controlling the

transcription of a variety of genes with different expression patterns. The expression of a

given gene depends, however, on the simultaneous interaction of a specific combination

of regulatory proteins with the control DNA elements. Indeed, most transcription

enhancers contain distinct sets of transcription factor-binding sites, and variations in the

arrangement of binding sites provide the potential to create unique nucleoprotein

complexes. Cooperative interactions between the proteins in these complexes can lead to

a high level of specificity in gene activation and to a high level of transcriptional synergy.









Perhaps one of the best examples of combinatorial interactions among distinct

regulatory elements is provided by the interferon-P (IFNP) gene (Maniatis et al., 1992;

Tijan and Maniatis, 1994). The IFN3 gene is activated in response to virus infection, and

the transcription factors required for activating the IFNP gene have been identified.

Detailed studies of this promoter revealed a highly compact and remarkably complex

organization of regulatory sequences containing four positive regulatory domains. None

of these domains function on their own, but two or more copies of any one of them can

act as a virus-inducible enhancer. However, the synthetic enhancers display varying

levels of basal activity, are less inducible than a natural enhancer, and can respond to

inducers other than virus infection. Thus, the specificity and activity of the natural intact

enhancer are distinct from those of the independent enhancer elements. The activation of

at least some natural enhancers appears to result from the precise arrangement of

transcription factors on DNA, resulting in the formation of a highly specific three-

dimensional nucleo-protein complex (stereospecific enhancer complex; Grosschedl,

1995).

Transcriptional activator proteins have been shown to synergize with each other

in vitro using synthetic enhancers containing multiple activator binding sites (McKnight

and Yamamoto, 1992; Tijian and Maniatis, 1994). In some cases, the observed

transcriptional synergy could be explained, at least in part, by cooperative binding of the

activators to their sites. However, in other cases, the transcriptional synergy could be

observed at concentrations of activator in which the binding sites are fully occupied

(Carey et al., 1990; Lin et al., 1990). The most straightforward explanation for this

synergy is that activators recruit the general transcription apparatus to nearby promoters,









and the transcriptional synergy is a consequence of multiple interactions between the

activators and components of the transcription apparatus (Ptashne and Gann, 1997). This

recruitment could involve the stepwise association of general transcription factors with

the promoter (Orphanides et al., 1996; Roeder, 1996), interactions between activators and

specific TATA box binding protein (TBP) associated factors (or TAFs) in the TFIID

complex (Sauer et al., 1995), or interactions between activators and components of the

RNA polymerase 1I holoenzyme (Koleske and Young, 1995). The best example of a

functional enhancer where the assembly of a protein-DNA complex is required for the

inducible transcription seen at the endogenous levels is the IFNP gene enhancer (Kim and

Maniatis, 1997).

In this study, I have used DMS in vivo footprinting to identify potential protein-

DNA interactions in the MnSOD enhancer element previously delineated by deletion

analysis and transient transfections. In addition, after identification of putative binding

sites, mutagenesis of the potential binding sites was used to verify whether the DNA

elements were crucial for the inducible MnSOD enhancer in a functional transient

transfection assay system.



Results

Multiple Potential Protein Binding Sites Exist within the MnSOD Enhancer

Using the technique of dimethyl sulfate (DMS) in vivo footprinting as the

molecular probe coupled with ligation-mediated polymerase chain reaction (LMPCR), it

is possible to identify cis-acting DNA elements at single nucleotide resolution and thus

display the in vivo protein-DNA contacts. As a small hydrophobic molecule, the









chemical DMS can enter intact cells and react predominantly by methylating the N-7

atom of guanine and, to a lesser extent, the N-3 atom of adenine in duplexed DNA.

Amino acid side chains of trans-acting factors, which contact guanine residues, can

protect these bases from methylation by DMS. Alternatively, amino acid side chains can

create a hydrophobic pocket around specific guanine residues, which increases the DMS

solubility and results in enhanced reactivity. Ultimately, protein side chains produce a

footprint composed of protections and/or enhancements which appear as diminished or

more intense bands as compared to the corresponding band in the naked DNA guanine

ladder on the final sequencing gel autoradiograph (Nick and Gilbert, 1985).

Previous work from this laboratory has established the timing of experimental

conditions when cell cultures are treated with inflammatory stimuli prior to DMS (Kuo,

1998). Kinetics of transcription factor binding is stable and comparable between control

and stimulus-treated samples. Those experiments demonstrated that protein-DNA

contacts were detectable as early as 0.5 hr and as late as 8 hr after addition of stimulus.

For the experiments in this thesis, time points of 2 and 4 hrs were chosen for DMS

treatment after addition of stimulus (LPS, TNF-a, IL-1 0).

Illustrated in Figure 4-1 is an autoradiograph of DMS in vivo footprinting and

LMPCR results of both control and treated samples. Several guanine and adenine

residues exhibited altered DMS reactivity, which appeared as diminished or enhanced

hybidization signals relative to in vitro DMS-treated DNA lanes. The existence of

several potential protein binding sites are postulated to account for patterns uncovered by

in vivo footprinting. Figure 4-2 summarizes the putative protein-DNA contacts




























Figure 4-1. Autoradiograph of DMS in vivo footprinting of enhancer region of MnSOD.
Lanes are as follows: G, naked DNA from L2 cells treated with DMS; C, control L2 cells
treated in vivo with DMS; T, TNF-a-treated L2 cells for 2 hours prior to in vivo
treatment with DMS; I, IL- 1 -treated L2 cells for 2 hours prior to in vivo treatment with
DMS. Open triangles refer to inducible protected sites; and closed triangles refer to
inducible enhanced sites. Site numbers 1-4 refer to regions where putative protein-
binding may occur on the enhancer element. Sequence refers to bottom strand.














Site 2

I>.~ to. 0*00


I
I
I
/
I I
~'00QQOm.is3O0
pm. ~

Site 1


Site 4


Site 3





























Figure 4-2. Sequence comparison of rat, human and mouse MnSOD enhancer regions of
intron 2. Open triangles refer to inducible protected sites; and closed triangles refer to
inducible enhanced sites. Site numbers 1-4 refer to regions where putative protein-
binding may occur on the enhancer element of the rat MnSOD gene. C/EBP-2 refers to
putative transcription factor binding site in the mouse MnSOD enhancer by consensus
sequence analysis and DMS in vivo footprinting. Arrows with numbers refer to
boundaries of smallest regions of the rat MnSOD enhancer tested in transient transfection
assays.















#4231
RAT 4190 CCCCGTAGATCACCTCTTCACACCATAAAATCGTATCAACACATTCACCGGGTTGGTTCTC
I ii1l1llilil1i II 1 itii11 1 1HI M1i I I I I
HUM 2577 CTCCGTAGATCACCTTTTTACGTCATAAAGTCGGACTAACACAAACTTCATTTACTAATTTTCTC
i i l l i i l I I l l l l i i I l l i l I I i I
MUS 2119 CCCCGTAGATCACCTCTTCATATCATAAAGTTGTATTAACACATTCACCGGTTAGGTTCTCTC

Site2 Site3
UAA" A AA A AA A
RAT 4251 TTCCTTTAATGGTGTAAGACCTTTAAAATGAACGTTATTCGTTTAGTGTATTAGCACTTATGCCCTTCTCTGAG
i IIIIIiIlllili i ilI 1 i 1 I I i i 1I1
HUM 2657 CTCCTTCAATGGTGTAAGACCTTCTAAATGAACTCTGTCTGCTTGGAACTTAATGCCCTTTTCCG C ..............
i IIIiiiIIlliiI 111lli1i iI 111II I I Ii i
MUS 2283 CCTTTATAATGGTGTAAGACCTTTAAAATGAACGTTATTCGTTTAGTGTGTTTAGAATTTATGCCCTTCTCTGAC
f 4374 Site4

44348 A A"A A
RAT 4325 ACTAAATCCTTTACTGTCTAAACCCTTCCGACACCATTATCACTCATCCCCTTTTCGCGTCAACCCTTTAGC
H lli I M 11 l1ii11 1 i1 i Iii I IIIIIIII 1111 00
HUM 2711 ACTAAATCCTTTATTGTTTAAACCCTTTGTACATTACCCCTCTCTGACCCCTTATGGGGTCAACACTTTCAT

MUS 2259 CCTAAAACCTTTAACGTCTAGACCCTCCTAACACCATTATCCTTCGTCCCCTTATCGGGTCAACCCTTTCGT
C/EBP-2

RAT 4397 AAAGGAGATTCCACTGTAGACTGTTGAAAGGAGAATTACAACATTTTTGTACCA
H ill Hilil IIIIIIIIII I I I
HUM 2783 GAAGGACATTCCGTTGTAGACTGTGGTCCTTGGAAAGAGAAGTCATAAAATTTT
ill1 l 11i lil ll l 1 I 1 I
MUS 2343 AAAGGAAATTCCACTGTAGACCGTAGATCTTTTGAAAGAAGAATTACAACAGGT


#441
RAT 4451 CTAAAGTTGGGAAGGCACCTCTGTCTCGACATAAACAAATCACTTACGAC
I I
HUM 2837 TGTTGAATTAAAGTCAGGAAATGAACACCTTAGTCTCGGAATGAATACAT
I I
MUS 2397 CTGTAGAACTAACATTAGGAAGACACCTCGGTCTCC-AAACGAAATTCCAC








being numbered sites 1 through site 4 over a region of approximately 150 to 200 bp.

Mutagenesis of Putative DNA Binding Sites Alters Inducible MnSOD Expression

Knowing the results of the DMS in vivo footprinting, mutagenesis of the

enhanced or protected nucleotides within the MnSOD enhancer region was performed

using PCR amplification. Mutations achieved were verified by sequencing. Figure 4-2

shows a comparison between the rat, human and murine sequences in intron 2 of each

gene. The sites that were shown to be enhanced or protected in the rat intron 2 enhancer

region are depicted as well as the in vivo footprinting sites found in the murine intron 2

enhancer region (Jones et al., 1997). The mutations within each of the 4 sites that were

created in the hGH reporter vectors used in the mutagenesis studies are shown in figure

4-3. Figures 4-4 and 4-5 demonstrate the results of northern analysis of transient

transfections of L2 cells with the wild type (WT), control, and mutated binding sites 1-4.

The results in both Figures 4-4 and 4-5 would suggest that the mutations made in site 2

seem to affect the level of inducible transcription to extent much greater than the other

site mutations. As way of control, the mutations made in the consensus sequence of

C/EBP, referred to as C/EBP-2, does not seem to change the level of inducible

expression. Also mutagenesis of the individual sites in Site 4 (4a and 4b) did not

influence the level of inducible transcription until the two site mutations were combined

into one vector construct.














Site 2


MUT CACATTCACC

WT CACATTCACC


TTGTTTTTTC
II II
GGGTTGGTTC


TCTTCCTTTA

TCTTCCTTTA


Site 3


MUT TTAACTTTAT TCTTTTATTT
I I I II
WT TGAACGTTAT TCGTTTAGTG


MUT AATCCTTTAC TGTCTAAACC

WT AATCCTTTAC TGTCTAAACC

Site 4B
MUT TCTTTTCAAC CCTTTCTCAA
Iii II
WT TCGGGTCAAC CCTTTAGCAA


TATTATCACT
I
TATTAGCACT


ATTTTTTAAG AAATTTAAAA
III il
ATGGTGTAAG ACCTTTAAAA


TATGCCCTTC TCTGAGACTA

TATGCCCTTC TCTGAGACTA


C/EBP-2
CTTCCGAAAA AATTATCACT


II
CTTCCGACAC


I
CATTATCACT


Site 4a
CATCAAATTT
III
CATCCCCTTT


AGGAGATTCC ACTGTAGACT GTTGAAAGGA

AGGAGATTCC ACTGTAGACT GTTGAAAGGA


Figure 4-3. The sequence of the rat MnSOD intronic enhancer region displaying the
putative protein-DNA binding sites and the mutations made in each site for construction
of hGH reporter vectors and transient transfection into L2 pulmonary epithelial cells.
Rectangles mark the mutated base pairs with the sequence for the wild type (WT)
MnSOD enhancer on the bottom and the mutated sequence on top.


Site 1



























Figure 4-4. Northern analysis of transient transfections of wild-type (WT) and mutated
binding site enhancer elements in hGH vector. WT refers to the unchanged rat 360 bp
enhancer fragment, control refers to the mutated CiEBP-2 site in the 360 bp fragment,
Site 2 refers to the Site 2 mutation in the 360 bp fragment, Site 4a and 4b refer to the site
4a and 4b mutations in the 360 bp enhancer fragment. The upper panel shows cells that
were stimulated with TNF-a for 8 hours prior to isolation of RNA and the lower panel
shows cells that were stimulated with IL- 10 for 8 hours prior to RNA isolation. In all
vectors in both panels the enhancer fragment was in a 5'-3' orientation. hGH refers to
the reporter gene product in each vector. Cathepsin B was used as a RNA loading
control.










Site Mutations


WT 4N_' Co_ _____
TNF-a -+ + - +

hGH

Cathepsin B





Site Mutations


WT_________
IL-13 -+ -+ + -

hGH

Cathepsin B .... .. ..

























Figure 4-5. Northern analysis of transient transfections of wild-type (WT) and mutated
binding site enhancer elements in hGH vector. WT refers to the unchanged rat 360 bp
enhancer fragment, Site 2 refers to the Site 2 mutation in the 360 bp fragment, Site 4
refers to the combination of mutations in sites 4a and 4b in the 360 bp enhancer
fragment. The upper panel shows cells that were stimulated with lipopolysacharride
(LPS) for 8 hours prior to isolation of RNA. The middle panel shows cells that were
stimulated with TNF-ax for 8 hours prior to isolation of RNA. The lower panel shows
cells that were stimulated with IL-1 I3 for 8 hours prior to RNA isolation. hGH refers to
the reporter gene product in each vector.










5'-3' Orientation
WT Site 2 Site 4
LPS -+ -+ +
hGH WU


5'-3' Orientation
WT Site 2 Site 4
TNF-a + -+ -+
hGH do', f


5'-3' Orientation
WT Site 2 Site 4
IL-105--t + + +


3'-5' Orientation
WT Site 2 Site 4


3'-5' Orientation
WT Site 2 Site 4


3'-5' Orientation
WT Site 2 Site 4


hGH











Discussion

A number of eukaryotic genes with complex enhancer elements exist in the

literature, such as P-interferon (Kim and Maniatis, 1997, Merika et al., 1998), T-cell

receptor a (Giese et al., 1995; Mayall et al., 1997), interleukin-4 (Henkel and Brown,

1994; Ranganath et al., 1998), and urokinase (De Cesare et al., 1995; De Cesare et al.,

1997). Within the cell, multiple factors not only participate in the initiation of

transcription but also share an active role in the regulation of gene expression. In

addition, from the data available on eukaryotic transcription, it is clear that the

mechanisms by which transcription is regulated are tremendously complex.

The data shown here in this chapter would agree with findings of other

investigators regarding the complex transcription factor binding patterns in inducible

enhancer elements. Perhaps the most studied eukaryotic enhancer element, the 3-

interferon enhancer, demonstrates the combinatorial complexity of inducible enhancers.

In vitro, it requires the binding of five different DNA binding proteins in order to

simulate the in vivo levels of inducible gene expression. The MnSOD enhancer element

likely requires a similar complex combination of DNA binding proteins to simulate the in

vivo levels of inducible expression. The in vivo footprinting data would suggest that

multiple proteins bind within the enhancer element (Figure 4-1). From the enhancer

mutagenesis experiments, I would propose that interaction of the enhancer element with

multiple DNA binding proteins is necessary to achieve the inducible expression seen in

vivo. Mutations created within the enhancer at site 2 appear to disrupt the inducible

levels of transcription as compared to the wild-type (WT) vector (Figures 4-4 and 4-5).









A protein binding at the putative site 2 may be found in further experiments to be a

crucial member of the protein DNA enhancer complex. Also, when mutations were made

individually at sites 4a and 4b, no significant reduction in inducible gene expression was

seen (Figure 4-4). When the mutated sites were combined in a single vector, a reduction

in the amount of inducible expression was observed, not unlike that seen in the deletion

experiments of chapter 3 (Figures 3-5B and 3-7B). So there may be another putative

protein that is integral to the inducible activity of the enhancer. This additional data lends

further support for the hypothesis that this is a complex enhancer with interacting

elements.

Many more experiments will need to be done with this regulatory element. More

in vivo footprinting data, will be necessary to get a clear picture of the proteins binding to

both strands of the enhancer element. Perhaps a different technique of footprinting, such

as DNase I footprinting, may delineate the protein boundaries better than DMS

footprinting since the GC ratio of this region of the MnSOD gene is only about 40%

compared to the promoter which is over 70% GC-rich. Further combinations of

mutagenesis combined with transient transfections may answer the questions regarding

the cooperativity of the proteins binding in this regulatory region. Perhaps, rather than

mutagenesis, simply altering the phasing by inserting DNA (6 bp) in key regions between

putative binding sites may be enough to disrupt the protein complex formation. Finally,

cloning the factors binding to the important putative binding sites within the enhancer

will be necessary to allow evaluation of the inducible transcriptional regulation in an in

vitro system.















CHAPTER 5
REACTIVE OXYGEN SPECIES AND MITOCHONDRIA-TO-NUCLEUS
SIGNALING

Introduction

Manganese superoxide dismutase (MnSOD), a vital anti-oxidant enzyme

localized to the mitochondrial matrix, catalyzes the dismutation of superoxide anions

(02) to hydrogen peroxide (H202). In aerobic cells, the mitochondrial electron transport

chain is probably the most abundant source of 02". At atmospheric oxygen

concentrations, it is estimated that between 1 to 3% of the 02 reduced in the

mitochondrial electron transport chain during ATP production may form 02".(Chance et

al., 1979; Beyer, 1990; Nohl et al., 1996). Although 02"and other reactive oxygen

species (ROS) are byproducts of normal respiration, imbalance or loss of cellular

homeostasis results in oxidative stress, causing damage to cellular components lipid

membranes, proteins, and nucleic acids (Freeman and Crapo, 1982; Fridovich, 1986).

MnSOD acts as the first line of cellular defense to detoxify these 02".(Fridovich, 1975).

Various inflammatory mediators (TNF-a, IL-1 3, IL-6 and LPS) in multiple tissues have

been demonstrated to elicit dramatic elevations of both the messenger RNA and protein

levels of MnSOD (Visner et al., 1990; Dougall and Nick, 1991; Visner et al., 1991;

Valentine and Nick, 1992; Visner et al., 1992; Eastgate et al., 1993). The increased

levels of MnSOD have been shown to be cytoprotective (Wong and Goeddel, 1988;

Wong et al., 1989; Warner et al., 1991; Wispe et al., 1992). However, the signaling








pathways responsible for MnSOD expression are numerous and are still far from being

fully elucidated.

Elaborate intercommunications take place between the nucleus and mitochondria

coordinating not only mitochondrial gene expression and genome maintenance, but also

nuclear gene expression (Poyton and McEwen, 1996). The classic view has been that

mitochondria simply function as organelles responding to changes in energy demand.

However, recent data would suggest a more complex picture where mitochondria also

function as active signaling organelles in a number of important intracellular pathways

(Surpin and Chory, 1997; Ichas and Mazat, 1998; Mignotte and Vayssiere, 1998; Chandel

and Schumacker, 1999). An example of such a complex signaling pathway would be the

role that mitochondria play in regulating cellular apoptosis initiated by TNF-L at

membrane receptors (Duriez et al., 2000).

It is well documented that TNF-a binding to membrane receptors triggers

complex signal transduction cascades (Feng et al., 1995; Warner et al., 1996; De

Keulenaer et al., 2000), some of which result in excess ROS production in the

mitochondria (Schulze-Osthoff, 1992; Schulze-Osthoff, 1993). The cytocidal-effect of

these ROS is either direct or necessary for downstream signaling events leading to cell

death. The crucial toxic role of ROS was demonstrated by the inhibition of

mitochondrial electron transport at specific sites, which differentially interferes with

TNF-ac-mediated cytotoxicity (Schulze-Osthoff, 1992) and by the correlation between

sensitivity to TNF-a. cytotoxicity and mitochondrial activity in the cell (Schulze-Osthoff,

1993). Pharmacological experiments revealed that the mitochondrial respiratory chain is

the major source of TNF-cx-induced ROS (Schulze-Osthoff, 1992; Schulze-Osthoff,