Deciphering gamma-decalactone biosynthesis in strawberry fruit using a combination of genetic mapping, RNA-Seq and eQTL ...

MISSING IMAGE

Material Information

Title:
Deciphering gamma-decalactone biosynthesis in strawberry fruit using a combination of genetic mapping, RNA-Seq and eQTL analyses
Physical Description:
Mixed Material
Language:
English
Creator:
Sanchez-Sevilla, Jose F.
Cruz-Rus, Eduardo
Valpuesta, Victoriano
Botella, Miguel A.
Amaya, Iraida
Publisher:
BioMed Central (BMC Genomics)
Publication Date:

Notes

Abstract:
Background: Understanding the basis for volatile organic compound (VOC) biosynthesis and regulation is of great importance for the genetic improvement of fruit flavor. Lactones constitute an essential group of fatty acid-derived VOCs conferring peach-like aroma to a number of fruits including peach, plum, pineapple and strawberry. Early studies on lactone biosynthesis suggest that several enzymatic pathways could be responsible for the diversity of lactones, but detailed information on them remained elusive. In this study, we have integrated genetic mapping and genome-wide transcriptome analysis to investigate the molecular basis of natural variation in γ-decalactone content in strawberry fruit. Results: As a result, the fatty acid desaturase FaFAD1 was identified as the gene underlying the locus at LGIII-2 that controls γ-decalactone production in ripening fruit. The FaFAD1 gene is specifically expressed in ripe fruits and its expression fully correlates with the presence of γ-decalactone in all 95 individuals of the mapping population. In addition, we show that the level of expression of FaFAH1, with similarity to cytochrome p450 hydroxylases, significantly correlates with the content of γ-decalactone in the mapping population. The analysis of expression quantitative trait loci (eQTL) suggests that the product of this gene also has a regulatory role in the biosynthetic pathway of lactones. Conclusions: Altogether, this study provides mechanistic information of how the production of γ-decalactone is naturally controlled in strawberry, and proposes enzymatic activities necessary for the formation of this VOC in plants. Keywords: Aroma, Crop improvement, Desaturase, Flavor, Hydroxylase, Lactone, eQTL
General Note:
Sánchez-Sevilla et al. BMC Genomics 2014, 15:218 http://www.biomedcentral.com/1471-2164/15/218; Pages 1-15
General Note:
doi:10.1186/1471-2164-15-218 Cite this article as: Sánchez-Sevilla et al.: Deciphering gamma-decalactone biosynthesis in strawberry fruit using a combination of genetic mapping, RNA-Seq and eQTL analyses. BMC Genomics 2014 15:218.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
© 2014 Sánchez-Sevilla et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Resource Identifier:
System ID:
AA00021532:00001

Full Text

PAGE 1

RESEARCHARTICLEOpenAccessDecipheringgamma-decalactonebiosynthesisin strawberryfruitusingacombinationofgenetic mapping,RNA-SeqandeQTLanalysesJosFSnchez-Sevilla1,EduardoCruz-Rus1,VictorianoValpuesta2,MiguelABotella2andIraidaAmaya1,3*AbstractBackground: Understandingthebasisforvolatileorganiccompound(VOC)biosynthesisandregulationisofgreat importanceforthegeneticimprovementoffruitflavor.Lactonesconstituteanessentialgroupoffattyacid-derived VOCsconferringpeach-likearomatoanumberoffruitsincludingpeach,plum,pineappleandstrawberry.Early studiesonlactonebiosynthesissuggestthatseveralenzymaticpathwayscouldberesponsibleforthediversityof lactones,butdetailedinformationonthemremainedelusive.Inthisstudy,wehaveintegratedgeneticmapping andgenome-widetranscriptomeanalysistoinvestigatethemolecularbasisofnaturalvariationin -decalactone contentinstrawberryfruit. Results: Asaresult,thefattyaciddesaturase FaFAD1 wasidentifiedasthegeneunderlyingthe locus atLGIII-2that controls -decalactoneproductioninripeningfruit.The FaFAD1 geneisspecificallyexpressedinripefruitsandits expressionfullycorrelateswiththepresenceof -decalactoneinall95individualsofthemappingpopulation.In addition,weshowthatthelevelofexpressionof FaFAH1 ,withsimilaritytocytochromep450hydroxylases,significantly correlateswiththecontentof -decalactoneinthemappingpopulation.Theanalysisofexpressionquantitativetrait loci(eQTL)suggeststhattheproductofthisgenealsohasaregulatoryroleinthebiosyntheticpathwayoflactones. Conclusions: Altogether,thisstudyprovidesmechanisticinformationofhowtheproductionof -decalactoneis naturallycontrolledinstrawberry,andproposesenzymaticactivitiesnecessaryfortheformationofthisVOCinplants. Keywords: Aroma,Cropimprovement,Desaturase,Flavor,Hydroxylase,Lactone,eQTLBackgroundTheflavorandaromaofstrawberries( Fragariaananassa ) arisefromaspecificcombinationofsugars,acidsand volatileorganiccompounds(VOCs)thatvarieswidely amongdifferentcultivarsand Fragaria species[1]. Morethan360VOCshavebeendetectedinstrawberry, includingesters,aldehydes,ketones,alcohols,terpenes, furanones,andsulfurcompounds[2-6].Lactonesconstituteagroupoffattyacid-derivedflavormolecules, whichhave -(4-)or -(5-)-lactonestructures,andhave beenisolatedfrombacterial,plantsandanimalsources [7,8].Fruitsareconsideredasaparticularlyrichsource oflactones,conferringpeach-likearomaandflavorin ordertoattractfeedersforseeddispersal[9,10].During strawberrymaturation,thelevelsofcompoundsdefinedas green-volatilesdecreasewhereaslevelsofflavorcompounds characteristicofripefruits,includingestersandlactones, increaseinparalleltootherripening-regulatedprocesses suchasanthocyaninaccumulation[4].Upto10different lactoneshavebeenidentifiedinstrawberry[1,3,11]and, amongthem, -decalactoneisthemostabundant, reachingmaximumlevelsinfullyredripefruits[4,12]. Lactonescontaining8 – 12carbonatomsareverypotent flavorconstituentsinavarietyoffruitssuchasstrawberry, pineappleandpeach.Biosyntheticstudiesindicatethat severalpathwaysoriginatingfrom -oxidationofunsaturatedfattyacidsareresponsibleforthestructuraldiversity oflactones[9,10,13].Alllactonesoriginatefromtheir corresponding4-or5-hydroxycarboxylicacids,although theprecisemechanismbywhichthesesubstratesare *Correspondence: iraida.amaya@juntadeandalucia.es1InstitutoAndaluzdeInvestigacinyFormacinAgrariayPesquera, IFAPA-CentrodeChurriana,CortijodelaCruzs/n,29140Mlaga,Spain3HorticulturalSciencesDepartment,UniversityofFlorida,1301FifieldHall, Gainesville,FL32611,USA Fulllistofauthorinformationisavailableattheendofthearticle 2014Snchez-Sevillaetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsofthe CreativeCommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse, distribution,andreproductioninanymedium,providedtheoriginalworkisproperlycredited.TheCreativeCommonsPublic DomainDedicationwaiver(http://creativecommons.org/publicdomain/zero/1.0/)appliestothedatamadeavailableinthis article,unlessotherwisestated.Snchez-Sevilla etal.BMCGenomics 2014, 15 :218 http://www.biomedcentral.com/1471-2164/15/218

PAGE 2

producedremainselusive[9].However,fourdifferent mechanismshavebeenproposed,suggestingthatthe oxygenatomcouldbeintro ducedbyeither(1)reductionofoxoacidsbyNAD-linkedreductases,(2)hydrationofunsaturatedfattyacids,(3)epoxidationand hydrolysisofunsaturatedfattyacids,or(4)reductionof hydroperoxides[9,14].Tothebestourknowledge,the enzymesspecificallyinvolvedintheformationoflactoneshavenotyetbeenreported,however,candidate enzymaticactivities,suchasacyl-CoAdehydrogenase, whichisthefirstenzymeinfattyacid -oxidation,have beenproposedtobeimportantforlactoneproduction [15].Epoxidehydrolaseshavebeenassociatedto dodecalactonebiosynthesisinpeach,implyingthatthe synthesisofthislactonecouldproceedthroughepoxidationofunsaturatedfattyacids[10].Alternatively,the hydroxylationofunsaturatedfattyacidscouldinvolve desaturasesandcytochromesP450(CYP)orother hydroxylasesnotrelatedtoCYPs[14]. Theconcentrationoflactonesinpeachiscontrolled bymultiple loci withquantitativeeffects,quantitative traitloci(QTL),hamperingtheidentificationofthegeneticdeterminantscontrollingtheirbiosynthesisorregulation[16].Incontrast,thecontentof -decalactonehas beenshowntobecontrolledbyonedominant locus in strawberryand,consequently,anumberofstrawberry cultivarslacking -decalactonehavebeenreported[5,6,17]. Wehavepreviouslyreportedthat -decalactoneisproducedintheparentalline ‘ 1392 ’ butnotin ‘ 232 ’ ofastrawberrymappingpopulationandthatthesegregationoftheir F1progenymatchedaMendelian1:1ratiowiththe locus controllingthistraitmappedtothebottomarmofLG III-2[6].Inthiscontext,thispopulationrepresentsa valuabletooltoidentifythegene(s)responsibleforthe naturalvariationofthisVOCinstrawberry,andtoprovidenovelinformationaboutitsbiosynthesisinplants. Althoughcultivatedstrawberryisanoctoploid(2n= 8=56),andassuch,foursubgenomesarepresentinits complexgenome,most loci showadisomicsegregation. Furthermoreitsgenomehasahighlevelofconservation withthemodelspecies Fragariavesca (2n=2=14),includinganalmostcompletesyntenyandhighcolinearity [18-22].Thus,theavailablegenomesequenceofthe diploid F.vesca canbeusedasareferenceforgenomic andgeneticstudieswithinthegenus[23]. RNA-seqisreplacingothermethodsofquantifying transcriptexpression,includingmicroarrayplatforms [24],asitovercomessomeoftheirlimitations,suchas detectionofonlythosetranscriptsthatarerepresented onmicroarrays,lowdynamicrange(limitedupperand lowerlimitsofdetection),andthusprovidesmoreaccuratequantificationofdifferentialtranscriptexpression.A clearadvantageofRNA-seqisthedetectionofnovel non-annotatedtranscriptsand,mostrelevantforhighly heterozygousplantsandpolyploidssuchas F.ananassa, thedetectionofthedifferentallelesandhomoeologous geneswithintheirgenomes[24,25].Inthisreport,wehave combinedgenome-wideRNA-seqanalysistoabulksegregantapproachtoidentifyagenecontrolling -decalactone contentinstrawberry.Additionalcandidategenesofthe biosyntheticpathwayoflactonesarealsoreportedbased onthisgenome-wideanalysis.Alltogether,thisstudy providesinformationofhowthecontentof -decalactone isnaturallycontrolledinstrawberryfruitandproposes enzymaticactivitiesnecessaryfortheformationofthis VOCinplants.MethodsPlantmaterialThe ‘ 232 ’ ‘ 1392 ’ F1mappingpopulation,comprising95 progenylines,wasusedinthisstudy.Thispopulationis derivedfromthecrossbetweenselectionlines ‘ 232 ’ and ‘ 1392 ’ andisdescribedindetailin[19]. ‘ 232 ’ isavery productivestrawberry( Fragariaananassa )line,whereas ‘ 1392 ’ hasfirmerandtastierfruits[6,19].Themapping populationwasgrowninthestrawberry-producingareaof Huelva(Spain)undercommercialconditionsduringthe 2011/2012season.Sixplantsofeachlinewerevegetatively propagatedandgrown.Ripefruits(10-15)werecollected thesamedayfromthesixplantsofeachline,divided intothreebiologicalreplicatesandindependentlygrinded inliquidnitrogen.Sampleswerestoredat-80Cuntil furtheranalysis.RNAisolationandRNA-seqfrompooledsamplesEquivalentamountsofripefruittissuefrom10 decalactoneproducingandnon-producingprogenylines (Table1)werecollectedintriplicateandseparatelypooled forRNAextraction.Thethreebiologicalreplicatesof Table1Relativeconcentrationof -decalactoneinfruits ofselectedprogenylinesproducingandnotproducing thiscompoundFruitsampleswith -decalactoneFruitsw/o -decalactone Line200720082009Line200720082009 93-01 4.4561.2872.849 93-03 0.0000.0190.014 93-12 3.1141.1851.875 93-07 0.0020.0010.005 93-19 3.1014.3002.865 93-14 0.0100.0070.019 93-36 3.0223.8843.182 93-17 0.0010.0030.002 93-43 4.2373.3943.074 93-18 0.0010.0080.006 93-54 3.6753.3763.902 93-49 0.0090.0070.010 93-61 2.4031.5113.293 93-68 0.0050.0010.040 93-64 3.4131.1172.878 93-69 0.0000.0040.007 93-78 1.9261.1712.644 93-80 0.0050.0140.013 93-92 2.0941.4572.658 93-89 0.0020.0040.008Contentineachlineisexpressedasaratiorelativetothecontentof -decalactone inareferencesamplecontainingamixofallmappinglinesforeachyear.Snchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page2of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 3

eachbulkedpoolwerenamedH -DEC1-3andN DEC1-3(forHighandNo -decalactonepool,respectively)andusedintheanalysis.TotalRNAwasextracted frompooledstrawberryfruitsusingadifferential2butoxyethanolprecipitation-basedmethod[26].Priorto reversetranscription,RNAwastreatedwithDNaseI (Fermentas)toremovecontaminatinggenomicDNA. RNAquantityandqualityweredeterminedbasedon absorbanceratiosat260nm/280nmand260nm/230nm usingaNanodrop.RNAintegritywasconfirmedbythe appearanceofribosomalRNAbandsandlackofdegradationproductsafterseparationinagarosegelelectrophoresisandethidiumbromidestaining.Theintegrity oftheRNAsampleswasfurtherverifiedusingthe2100 Bioanalyzer(Agilent,Folsom,CA)andRINvaluesranged between7.2and7.4forthesixsamples. Foreachofthe6(2bulkswith3biologicalreplicates) samples,onepaired-endlibrarywithapproximately 300bpinsertsizewaspreparedusinganin-houseoptimizedIlluminaprotocolattheCentroNacionalde AnlisisGenmico(CNAG)facilities.LibrariesweresequencedonIlluminaHiSeq2000lanesusing2100bp reads.Morethan30millionreadsweregeneratedfor eachsample.Primaryanalysisofthedataincludedbase callingandqualitycontrol,withanassurancethat>80%of allbasespassingfilterhadaqualityvalueofatleast30.MappingRNA-seqreadstothereferencegenomeand generationofreadcountsRawRNA-seqreadswereprocessedtoremovelow-quality nucleotidesandalignedtothe Fragariavesca reference genome(v1.1)andCDS(v1.0)[23]usingtheprogram TopHatv2.0.6[27].DefaultparametersofTopHatwere used,allowing40multiplealignmentsperreadanda maximumof2mismatcheswhenmappingreadstothe reference.Themappingresultswerethenusedtoidentify “ islands ” ofexpression,whichcanbeinterpretedas potentialexons.TopHatbuildsadatabaseofpotential splicejunctionsandconfirmsthesebycomparingthe previouslyunmappedreadsagainstthedatabaseofputativejunctions. ThealignedreadfileswereprocessedbyCufflinks v2.0.2[28].Readswereassembledintotranscripts,their abundanceestimated,andtestsfordifferentialexpression andregulationbetweenthesampleswereperformed.Cufflinksdoesnotmakeuseofexistinggeneannotations duringassemblyoftranscripts,butratherassemblesa minimumsetoftranscriptsthatbestdescribethereadsin thedataset.ThisapproachallowsCufflinkstoidentifyalternativetranscriptionandsplicingthatarenotdescribed bypre-existinggenemodels[28].ThenormalizedRNAseqfragmentcountswereusedtomeasuretherelative abundancesoftranscriptsexpressedasFragmentsPer KilobaseofexonperMillionfragmentsmapped(FPKM). ConfidenceintervalsforFPKMestimateswerecalculated usingaBayesianinferencemethod[28].Comparisontoreferenceannotationanddifferential expressionanalysisOnceallshortreadsequenceswereassembledwith Cufflinks,theoutputGTFfilesweresenttoCuffcompare alongwithareferenceGTFannotationfile,downloaded fromGenomeDatabaseforRosaceae(GDR)database ( Fragariavesca WholeGenomev1.1Assembly&Annotation. http://www.rosaceae.org/).Thisclassifiedeachtranscript asknownornovel.Cuffcompareproduceda combined. GTF filewhichwaspassedtoCuffdiffalongwiththe originalalignment(.SAM)filesproducedbyTopHatto identifydifferentiallyexpressedtranscriptsbetweenthe twopools.TheCuffdiffalgorithmthenre-estimatedthe abundanceoftranscriptslistedintheGTFfileusing alignmentsfromtheSAMfile,andconcurrentlytested fordifferentialexpressionbetweenthehigh -decalactone andtheno -decalactonepoolsusingarigorousstatistical analysis[28].Thesignificancescoreswerecorrectedfor multipletestingusingtheBenjamini-Hochbergcorrection. Theexpressiontestingisdoneattheleveloftranscripts, primarytranscriptsandgenes.Bytrackingchangesin therelativeabundanceoftranscriptswithacommon transcriptionstartsite,Cuffdiffcanalsoidentifychanges insplicing.VisualizationofmappedreadsMappingresultswerevisualizedusingalocalcopyof theIntegrativeGenomicsViewersoftwareavailableat http://www.broadinstitute.org/igv/.Viewsofindividual genesweregeneratedbyuploadingTopHat-generated filescontainingthesequencealignmentdata(.bamfiles) tothegenomebrowser.FunctionalanalysisofgenelistsusingBLAST2GOTheBLAST2GOv2.4suitewasusedforfunctionalannotationofsequences,dataminingandgenesetenrichmentanalysis[29].Thefunctionalclusteringtoolwas usedtolookforfunctionalenrichmentforgenesoverandunder-expressedmorethantwo-foldbetweenthe pools.GOenrichmentwasderivedwithFisher ’ sexact testandacutoffoffalsediscoveryrate<0.05usingthe F.vesca genomeannotationasreferencebackground.A uniquelistofgenesymbolswasuploadedviatheweb interface.GeneOntologyBiologicalProcesswasselected asthefunctionalannotationcategoryforthisanalysis.Denovo assemblyof Fragariaananassa RNA-seqreadsSincethecurrent F.vesca genomesequenceandthe genemodelisstilladraft,someRNA-seqtranscript sequencesappearedtruncated.Therefore,weproceeded toa de-novo assemblyofthereadscorrespondingtotheSnchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page3of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 4

high-andno-decalactonepoolstoobtainthefulllengthtranscriptsexpressedin F.ananassa using Trinity [30].Thetranscriptcontigsmostsimilartothe F.vesca candidategeneswereidentifiedbymeanof blastsearch.SequenceanalysisMultiplesequencealignmentwascarriedoutwith CLUSTALWatthedefaultsettings.Phylogeneticanalyseswereconductedusingtheneighbor-joiningalgorithmandPoissonmodelinMEGAversion5[31]. ProteintargetingpredictionsweredoneusingWoLF PSORTanalysis(http://wolfpsort.org)andtransmembranedomainsearchwiththeTMpredprogram(http:// www.ch.embnet.org/software/TMPRED_form.html).RealtimeqRT-PCRanalysisTotalRNAwasextractedfromstrawberrytissuesasdescribedpreviouslyfortheRNA-seqexperiment.FirststrandcDNAwassynthesizedfrom1 goftotalRNA usingtheiScriptcDNASynthesiskit(Bio-Rad)accordingtothemanufacturer ’ sinstructions.Geneexpression wasanalyzedbyquantitativerealtimepolymerasechain reaction(qRT-PCR)usingthefluorescentintercalating dyeSYBRGreenIinaniQ5real-timePCRdetectionsystem(Bio-Rad).Threebiologicalreplicatesforeachline andthreeindependentsynthesisofcDNAforeachRNA samplewereusedforqRT-PCR.Relativequantificationof theexpressionlevelsforthetargetgeneswasperformed usingthecomparativeCtmet hod[32].Glyceraldehyde3-phosphatedehydrogenasegene( GAPDH )wasusedas normalizinggene[33].PrimersaredescribedinAdditional file1:TableS1.QTLandexpressionquantitativetraitloci(eQTL)analysisQTLanalyseswereperformedusingMapQTL5aspreviouslydescribed[6].Therawrelativedatawasanalyzed firstbythenonparametricKruskal-Wallisrank-sumtest. AstringentsignificancelevelofP=0.005wasusedas threshold.Second,theintegratedgeneticlinkagemap andtransformeddatasetsformosttraitswereusedto identifyandlocateQTLsusingIntervalMapping.SignificanceLODthresholdswereestimatedwitha1,000permutationtestforeachtraitandQTLswithLOD scoresgreaterthanthegenome-widethresholdat95% weredeclaredsignificant.ResultsInordertoincreasetheprecisionofthe ‘ 232 ’ ‘ 1392 ’ mapandidentifynewmarkerscloselylinkedtothe locus controlling -decalactone,wefirstsaturatedtheprevious mapwithDArT-derivedSNPmarkersanddevelopeda saturatedmap.Theoctoploidstrawberryhomoeology group(HG)III,wherethe locus waspreviouslymapped [6],ispresentedinFigure1incomparisontothe F.vesca pseudochromosome3(fvesca_v1.1_pseudo.fna).The4 homoelogouslinkagegroups(LGs),withlengthsof 79.4,106.2,102and88.8cM,couldnowbeidentified insteadof7shorterLGsinthepreviousintegratedmap [6].TheaveragemarkerdensityinHGIIIwasincreased to0.87cM/markerandthelargestgaprangedfrom 5.3cMforLGIII-1to7.7cMforLGIII-3(Figure1; Additionalfile2).Thelocuscontrolling -decalactone wasfine-mappedtothebottomof Fragariaananassa LG III-2,closelylinkedtomarkersBFACT-45andChFvM140, consistentwithourpreviousdata[6].Inaddition,six newSNPmarkersweremappedinthe3cMinterval tothe -decalactone locus (Figure1;Additionalfile2). Inordertoidentifythedeterminantsofthevariation in -decalactonecontentinstrawberryfruit,weaimed toidentifydifferentiallyexpressedgenesbetweenpools offruitsfromlinescontrastingin -decalactonecontent inthe ‘ 232 ’ ‘ 1392 ’ populationusingRNA-seq.Later, differentiallyexpressedgeneswouldbeanalyzedfortheir mappingposition.Thosegenesconveningthetwoconditions,i.e.,highlyexpressedinfruitsofhigh decalactonelinesandlocatedwithintheQTLinterval wouldbeconsideredforfurtheranalysis.RNAwasextractedfrombulkedpoolsofripefruitsfrom10progeny lineswithhigh -decalactonecontentandfrom10lines notproducingthevolatile(Table1)andusedinbiological triplicateforIlluminaRNAsequencing.Analignment ofsequencingreadswasperformedusingthereference Fragariavesca WholeGenome(v1.1)andannotation (CDSv1.0)[[23];GenomeDatabaseforRosaceae(GDR), www.rosaceae.org]usingTopHat[27].Over218million reads100bp-longweregeneratedandafterremovalof adaptorsequencesandlow-qualityreads,211.6million cleanreadsremained(97%oftherawdata).Between 68.7%and70%ofreadswerepairedforeachofthe6samplesandanaverageof68.2%offilteredpairedreadswere furthermappedtothe F.vesca genome.Somekeymetrics thatallowedtheassessmentofthequalityofmapping readstothereferencegenomewereextractedfromthe TopHatoutputandlogfiles,andareshowninAdditional file1:TableS2. AftermappingtheRNA-seqreadstothereference genome,transcriptswereassembledandtheirrelative abundancescalculatedusingCufflinks[28].Geneswith normalizedreadslowerthan0.1fragmentsperkilobase ofexonpermillionfragments(FPKM)wereconsidered asnotexpressed.Atotalof33,458gene/transcriptsfrom thetwo F.xananassa poolswerepredictedbasedinthe referencemodeland19,833and19,720wereexpressed intheripefruitsofthehigh -decalactoneandtheno -decalactonepools,respectively. Differentialgeneexpression(DGE)betweenthehigh -decalactoneandtheno -decalactonepoolswasSnchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page4of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 5

calculatedusingtheratioofFPKMvaluesofeachgenein bothpools.Atotalof617predictedgenesweredifferentiallyexpressedbetweenthetwopoolsandre-annotated using Blast2go [29].Ofthese,403wereup-regulatedand 214weredown-regulatedinthehigh-decalactonepool (Additionalfile3).Theobservedratios(log2foldchange) ofdifferentialexpressionrangedfrom-5.161to3.489, withnegativeandpositivevaluesindicatingup-and down-regulationinthehigh-decalactonepool,respectively.Onlyonegene(gene24970-v1.0-hybrid)encoding forapredictedproteinwithsimilaritytocinnamylalcohol dehydrogenase,wasnotexpressedatallinthenodecalactonepoolandexpressedinthehigh-decalactone pool,albeitwitharelativelylowvalueofexpression(3.79 FPKM).Amongthe617differentiallyexpressedtranscripts,577correspondedtoannotatedgenesinthe F.vesca genemodelv.1.0[23]while40matchedwith notannotatedgenomeregions Amongthese,28correspondedtopredictedgenesfrom F.vesca recentlyannotatedintheNCBI,whiletheremaining12transcriptshave notyetbeenannotated.Somegenefamiliesappeared over-representedinthefruitswithhigh -decalactone contentsuchascinnamylalcoholdehydrogenases,with6 differentiallyexpressedgenes,glutathiones-transferases, with7up-regulatedgenes,andcytochromep450,with5 up-regulatedmembers(Additionalfile3).FunctionalannotationandenrichmentanalysisInordertodescribegenefunctionsinastandardand controlledvocabulary,weusedthe Blast2GO suite.A totalof3,757geneontology(GO)termswereassigned toatotalof559differentiallyexpressedgenes,while58 Figure1 Comparisonofpseudochromosome3(FVG-III)ofthediploid Fragariavesca withthefourhomoeologouslinkagegroupson theintegrated ‘ 232 ’ ‘ 1392 ’ linkagemap(LGIII-1 – LGIII-4)oftheoctoploid F.xananassa The -decalactonelocusishighlightedinorange andlinkedSSRmarkersinblue.SSRandgenemarkersarehighlightedinbold.Positionofmarkers(incM)isindicatedontheleftofthelinkage groups.Forsimplicity,onlythepositionofanchorSSRmarkers(inMb)isstatedontheleftofthe F.vesca group. Snchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page5of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 6

didnotmatchanyterms.Sequencedistribution(atlevel 2,filteredbyacut-offof60sequences)forbiological processes,molecularfunctionsandcellularcomponent aresummarizedinAdditionalfile1:FigureS1.Within biologicalprocesses,themostabundantcategorieswere metabolicprocess(380sequencesor27%),cellular process(350sequences;25%)andresponsetostimulus (210sequences;15%).Themostrepresentedmolecular functionwascatalyticactivity(299sequences;49%)and alargeproportionofsequences(177;22%)wereassociatedwithmembraneascellularcompartment. Toinvestigatethebiologicalprocessesassociatedwith differencesin -decalactonecontent,aGOenrichment analysiswasperformedusingFisher ’ sexacttestusing thesetsofup-regulatedanddown-regulatedtranscripts separatelyincomparisontothoseinthereference F. vesca genemodel.Atotalof51biologicalprocesses weresignificantlyenrichedforthegenesup-regulated infruitswithhigh -decalactonecontent(Additional file1:TableS3).Mostofthese51commonontologies are ‘ descendants ’ of5higherhierarchicalnodesinthe GOtree:responsetostimulus(GO:0050896),cellular aromaticcompoundmetabolicprocess(GO:0006725), lipidhomeostasis(GO:0055088),nitrogencompound metabolicprocess(GO:0006807)andorganicsubstance metabolicprocess(GO:0071704).Withinthesebiological processes,themostsignificantlyoverrepresentedterm wasoxidation-reductionprocess(GO:0055114,92genes withinthisterm).Onepossibleinterpretationisthatenzymescatalyzingtheadditionorremovalofelectronsare neededinthebiosynthesisof -decalactoneinstrawberry. Thenumberofbiologicalprocessessignificantlyenriched withinthedown-regulatedgenes(up-regulatedinthe no-decalactonepool)washigher,101,andmore diverse(Additionalfile1:TableS4).Thethreemost significantlyoverrepresentedtermswereregulationof biologicalquality(GO:0065008),responsetobioticstimulus(GOO:0009607)andiontransport(GO:0006811).Globally,thesedatasuggestthatlacking -decalactonein strawberryfruitsisassociatedtoawiderangeofdifferent biologicalprocesses.Particularlyinterestingisthenumber ofgenesup-regulatedinthecategoriesofresponseto stimulusandbioticstressintheabsenceof -decalactone.Identificationof FaFAD1 asthegeneunderlyingthe locus controlling -decalactonecontentinLGIII-2Thetop25up-regulatedgenesinthepoolwithhigh -decalactonecontentarelistedinTable2.Thethird genewiththehighestup-regulationbetweenthepools correspondstothe Fragariavesca geneIDgene24414v1.0-hybrid(gene24414),withhomologytofattyacid desaturases(FAD)andinparticulartothemicrosomal -12oleatedesaturase(FAD2).Thisgeneshowsahigh expressioninthepooloffruitswith -decalactone (325.92FPKM)anditsexpressionis~30-foldhigher(4.8 log2-fold)thaninthepooloffruitswithout -decalactone (11.41FPKM;Table2;Additionalfile3).Mostinterestingly,gene24414mapstotheendofthepseudo-molecule 3ofthe Fragariavesca referencegenome,attheexact positionwherethegenecontrolling -decalactonehas beenmappedin F.xananassa (Figure1).Inadditionto gene24414,only3othergenesamongthe617differentiallyexpressedgenesmappedtothe -decalactonecontent locus .Twoofthem,gene24411andgene24415,at about34and9Kbfromgene24414,respectively,anda third,gene14386,separatedby808Kb.However,thefoldchangebetweenthebulkedpoolsforthese3geneswas muchsmallerthanforgene24414,rangingfrom0.5to0.9 log2-fold.Twoofthesegenes,24411and14386,with similarityto callosesynthase and glycerophosphoryldiester phosphodiesterase ,respectively,weredown-regulatedin thehigh -decalactonepool.Thethirdgene,24415with highestsimilaritytothe nucleolarcomplexprotein2 showedhigherexpressioninthehigh -decalactonepool (Additionalfile3). Allofthereadsfromthehigh -decalactonepool mappingtothegene24414-v1.0-hybrid(hereafternamed FaFAD1 and FvFAD1 forthecultivatedandwildstrawberry,respectively)correspondedtooneuniqueallele, indicatingthatonlyonealleleisexpressedinfruitsof the10selectedsiblings.Similarly,allthereadsfromthe no-decalactonepoolcorrespondedtothesameallele tothatinthefruitswithhighcontent. Thepredictedgene24414inthestrawberrydraftgenomesequence[23]contains5exons.However,when visualizedusingtheintegrativegenomicsviewer(IGV), thereadsoftheRNA-seqexperimentsonlyspannedthe firsttwoexonsindicatingthat FvFAD1 wasnotcorrectly annotatedinthestrawberrygenomesequence.Adifferentmodelofthesamegenethatonlyspansthetwofirst exonsisavailableintheNCBIunderaccessionnumber LOC101309231,andispredictedtoencodeaproteinof 393aminoacids.However,thelast16aminoacidsof thecarboxylicendofthepredictedproteindonothave similaritytoreportedFAD2proteins(datanotshown). Inordertounequivocallydeterminethe FragariaxananassaFAD1 transcript,weperformeda denovo assemblyoftheRNA-seqreadsfromthehigh -decalactone poolreplicates.Onlyonecontigof1847bpwithhigh similarity(excluding25bpofthe3 endoftheORFand the3 UTR)tothe F.vescaFvFAD1 genewasobtained, andcontainedanORFof1125bpencodingapredicted proteinof375aminoacidresidues.Inthisprediction, theC-terminusshareshighsimilaritytoFAD2proteins exceptthatFaFAD1lacksthetwolastaminoacids (Figure2).However,thelackofthesetwoaminoacids isalsofoundinthepredictedaminoacidsequenceencodedbya F.ananassa EST(accessionnumberSnchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page6of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 7

Table2Listofthetop25significantlyup-regulatedgenesinthehigh -decalactonepoolcomparedtotheNo -decalactonepoolGeneLocuspositionPredictedfunctionFPKMH -DECFPKMN -DEClog2foldchangeTeststatisticp-valueq-value gene24970-v1.0-hybridLG1:16175288-16176946Cinnamylalcoholdehydrogenase-like3.790.00-1.8E+308-1.8E+3083.78E-152.06E-12 gene22145-v1.0-hybridLG4:24174473-24176874Aldoketoreductase1.980.06-5.163.440.0005730.021971 gene24414-v1.0-hybridLG3:31112417-31114643Microsomaldelta-12oleatedesaturase325.9211.41-4.8433.6000 gene17831-v1.0-hybridLG1:12556715-12561321Isoflavone2-hydroxylase-like26.201.52-4.1013.8000 gene11616-v1.0-hybridunanchored — NA — 1.070.10-3.496.498.34E-112.37E-08 gene12565-v1.0-hybridLG7:19409089-19409688S-norcoclaurinesynthase-like8.521.00-3.096.157.56E-101.61E-07 gene09812-v1.0-hybridLG6:9651860-9658187Thaumatin-likeprotein9.641.18-3.038.5300 gene29430-v1.0-hybridunanchoredSalicylicacid-bindingprotein2-like4.750.60-2.984.623.92E-060.000362 gene09059-v1.0-hybridLG2:20948366-20950293Hypotheticalprotein1.100.14-2.983.890.0001020.005647 gene12485-v1.0-hybridLG1:6048496-6049132Auxin-bindingproteinabp19a-like2.150.28-2.963.500.0004680.018845 gene09427-v1.0-hybridLG5:10292998-10293780Probableglutathiones-transferase-like94.2113.04-2.8517.4900 gene16882-v1.0-hybridLG4:17649473-17650304Probableglutathiones-transferase-like5.130.76-2.755.749.30E-091.60E-06 gene05671-v1.0-hybridLG6:28779898-28789864Beta-glucanase9.321.45-2.6910.1300 -LG6:25256895-25257433Hypotheticalprotein2.320.37-2.673.240.0012160.038671 gene08424-v1.0-hybridunanchoredPathogenesis-relatedprotein47.041.15-2.616.471.01E-102.79E-08 -LG7:2164010-2164526 — NA — 4.040.67-2.604.094.29E-050.002708 -unanchored — NA — 77.5713.29-2.553.370.0007390.026493 gene13265-v1.0-hybridLG7:21691207-21692009Par-1aprotein3.390.59-2.534.104.17E-050.002653 -LG4:2760209-2761669Inhibitoroftrypsinandhagemanfactor4.340.76-2.513.410.0006560.024349 gene28799-v1.0-hybridLG3:9340369-9341925Nectarin-3-like2.840.52-2.454.742.12E-060.000217 gene32603-v1.0-hybridLG4:2356895-2357929Sieveelement-occludingprotein1.820.34-2.403.480.0005030.019820 gene02395-v1.0-hybridLG3:5514062-5518181Cytochromep450106.9220.98-2.3519.1500 gene21028-v1.0-hybridLG7:17655017-17664058Psbpdomain-containingproteinchlorop-like1.800.36-2.334.371.24E-050.000952 gene17832-v1.0-hybridLG1:12556715-12561321Hypotheticalprotein19.764.11-2.265.073.9E-074.78E-05 -LG3:10391258-10391650 — NA — 14.683.06-2.263.780.0001560.007817Genenumberaccordingtothe Fragariavesca genomedraft( www.Strawberrygenome.org ).Foranumberoftranscriptsdetectedbycufflinks(-),noreferencetranscriptwaspredictedinthe Fragariavesca genemodel.Snchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page7of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 8

CO381851)availableintheNCBI,indicatingthatthis mightbethecorrectsequence.ThefulllengthORFof FaFAD1 ,includinga3 un-translatedregion,wascloned fromparentalline ‘ 1392 ’ usingprimersdeducedfrom thetranscriptomeassemblyandconfirmedthepredicted sequence.Inagreementtopreviousresultsusingthe reference F.vesca genome,thesame FaFAD1 allelewas obtainedafter denovo assemblyoftheRNA-seqreads fromtheno-decalactonepool. ThededucedFaFAD1proteinsequencecontainsthe Delta12FattyAcidDesaturase(Delta12-FADS)-likeconserveddomain(E-value:1.74e-56).MembraneFADsare non-heme,iron-containing,oxygen-dependentenzymes involvedinregioselectiveintroductionofdoublebonds infattyacylaliphaticchains.Theseenzymesareresponsibleforthesynthesisof18:2fattyacidsintheendoplasmicreticulum.Sixputativetransmembranedomainsare predictedwithinFaFAD1usingtheTMpredprogramas expectedforanintegralmembraneprotein(Figure2). AlignmentwithothercharacterizedFAD2proteinsindicatedthatthecharacteristicHis-richmotifs,which contributetotheinteractionwiththeelectrondonor cytochromeb5,wereconservedinthededuced FaFAD1protein.ThemostsimilarproteintoFaFAD1in ArabidopsiswastheendoplasmidreticulumlocalizedoleatedesaturaseFAD2catalyzingtheconversionofoleic acid(18:1)tolinoleicacid(18:2)[34]. HighlysimilarproteinstoFaFAD1wereidentifiedafter ablastpsearchintheNCBIandthephytozomedatabase (www.phytozome.net).AsshowninFigure3,thephylogeneticanalysisindicatesthepresenceoftwomajor clusters.Asexpected,theFaFAD1proteinwasmost similartothe F.vesca predictedproteinencodedbythe gene24414,locatedatthebottomofchromosome3,and alsotoapredictedFADproteinfromthecloselyrelated Malus genus.Interestingly,thisgroupofproteinsequencesgroupedwiththe Ricinuscommunis fattyacid hydroxylaseRcFAH12.Thisprotein,whichshareshigh sequencesimilaritytodesaturases,hasbeenshownto catalyzethehydroxylationofoleatetoproducethehydroxyfattyacidricinoleate[35].Arecentlyidentified FADfrom Prunuspersica ,PpFAD1B-6,hasbeenassociatedwithlactonecontentinpeachfruitsusinganintegrative ‘ omics ’ approach[14].Thisproteingroupedina secondclusterwiththe Ricinuscommunis desaturase RcFAD2andotherreporteddesaturases,suchasthe ArabidopsisAtFAD2. Tofurtherinvestigatewhetherthedown-regulationof FaFAD1 isthecausefortheextremelylow -decalactone contentinstrawberryfruits,wefirstvalidatedthedifferentialexpressionobservedinthepoolsbyqRT-PCR.As showninAdditionalfile1:FigureS2A,theexpressionof FaFAD1 was~30-foldhigherinthehigh-decalactone pool,thesamedifferentialexpressionobtainedusing Figure2 ComparisonoftheaminoacidsequenceofstrawberryFaFAD1withotherplantfattyaciddesaturases( 12-FADs)and hydroxilases( 12-FAH). Identicalaminoacidresidueswereindicatedwithblackbackground.Darkandbrightgrayshadeindicated80%and60% ormoreconservationamongallthealignedsequences,respectively.Thepredictedtrans-membranedomains(TM-helixes)andhighlyconserved Hisboxesareshown.Thesevenaminoacidresiduesthatdifferbetweenoleatedesaturasesandhydroxilasesaccordingto[45](numberingbased onthearabidopsisFAD2sequence)areindicatedingreenwhentheaminoacidresidueisconservedbetweenFaFAD1andhydroxilasesandred whennot.Accessionnumbersforthesequenceswereasfollows: Fragariaxananassa FaFAD1(KF887973), Nicotianatabacum NtFAD(AAT72296), Oleaeuropaea OeFAD2-1(AAW63040), Davidiainvolucrate DiFAD2(ABZ05022), Crepisalpina CaFAD2-2(ABC00770), Arabidopsisthaliana AtFAD2 (AAA32782), Prunuspersica PpFAD1B-6(AGM53489), Ricinuscomunis hydroxylaseRcFAH12(AAC49010),(MDP0000288297), Lesquerellafendleri bifunctionalhydroxylase/desaturaseLFAH12(AAC32755). Snchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page8of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 9

RNA-seq(Table2).QuantitativeRT-PCRalsovalidated theRNA-seqdataforotherthreeup-regulatedgenes (seebelow;Additionalfile1:FigureS2). Wenextexaminedtheexpressionlevelofthegeneby qRT-PCRinthecomplete ‘ 232 ’ ‘ 1392 ’ populationcomposedof93siblingsandthetwoparentallines.51lines (~54%)showednodetectableexpressionof FaFAD1 withthresholdcycles(Ct)similar(2)totheno-template controlandrelativeexpressionlevelsrangingfrom0.01to 0.58(Figure4).Therestofthelinesshoweddifferent levelsofexpressionthatrangedfrom7to247timesthe averageexpressioninthepopulation(Figure4).Furthermore,co-segregationbetweenhigh/no FaFAD1 transcriptionand -decalactonecontentwasobserved(Figure4; Additionalfile1:FigureS4A).Strikingly,primersusedfor qRT-PCRof FaFAD1 failedtoamplifyingenomicDNA fromeachlineproducingfruitswithout -decalactone (Additionalfile1:FigureS3A). Several FAD2 genesshowaseedspecificexpression, havingaroleinseedstoragefattyacids,whileothers haveanubiquitousexpression,beingtheninvolvedin thegeneralbiosynthesisofmembranefattyacids[36]. Thiscorrelationbetweenexpressionandfunctionof otherdesaturasespromptedustoanalyzetheexpression patternof FaFAD1 inordertodeterminewhetheritis correlatedwiththeinductionof -decalactoneproductionduringthelaststagesoffruitripening.Theexpressionindifferenttissuesandduringfruitripeningwas analyzedbyqRT-PCRinthecommonlycultivated Chandlercultivar.Inthiscultivar,theexpressionlevelof FaFAD1 inredfruitswassimilartothatofline ‘ 1392 ’ (Additionalfile1:FigureS3B,C),consistentwithboth genotypesproducing -decalactoneinripefruits.Incontrast,expressionof FaFAD1 wasnotdetectedin ‘ 232 ’ and ‘ Camarosa ’ byqRT-PCR,indicativeofbothcultivars notproducing -decalactone.AsshowninFigure5A, FaFAD1 increaseditsexpression~150-foldbetween whiteandredfruit,consistentwiththebiosynthesisof -decalactoneduringthelatestagesoffruitripening. Supportingaspecificroleof FaFAD1 inripefruits,no expressionwasdetectedinleaves,andverylowexpressionof FaFAD1 wasdetectedinroots,greenand whitefruits.CollocationofQTLfor -decalactonecontentandeQTL forcandidategenesBasedintheirpredictedfunction,weselectedtwoadditionalcandidategenesforfurtheranalyseswithinthe top25highlyup-regulatedgenes(Table2).Thefourth transcriptinthelist,gene17831-v1.0-hybrid,showed 17-fold(4.1log2_fold_change)higherexpressioninthe high-decalactonepool(Table2;Additionalfile3).The predictedproteinsequencehashighsimilaritytothe cytochromeP450,family81,andcontainsthep450 superfamilyconserveddomain(E-value8.37e-96)andthe PLN021835-hydroxylasemultidomain(E-value1.22e-70). Thegene02395-v1.0-hybrid,atthe23rdpositionin Table2,showeda5-foldup-regulationandencodesfor apredictedproteinwithhighsimilaritytothecytochromeP450,family79,subfamilyAandthus,also containsthep450superfamilyconserveddomain(E-value 3.60e-40)andseveralhydroxylasedomainssuchas PLN03018(E-value6.14e-125).Thedifferentialgene expressionobservedforthesetwotranscriptswasvalidated byqRT-PCR,obtaininga14.8and6.5fold-changein theirexpressionbetweenthepoolsforgene17831and gene02395,respectively(Additionalfile1:FigureS2). Sincethesetwogenesencodeforproteinsequences withhighhomologytoCYPhydroxylases,wefurther Figure3 Phylogenetictreeshow ingproteinsequence relationshipsamongselected FAD2membersfromdifferent species. Bootstrapvalues(%)for1000replicatesareindicatedat thenodes.Positionofthe Fragaria Malus and Prunus aminoacid sequencesislabeledindarkred,lightredandorange,respectively. Accessionnumbersareshowninparenthesis: Prunuspersica PpFAD1B-6 (AGM53489), Fragariavesca Fv_predictedFAD(LOC101290788), Arabidopsisthaliana AtFAD2(AAA32782), Perseaamericana PaFAD2 (AAL23676), Glycinemax GmFAD2-2B(BAD89863), Linumusitatissimum LuFAD2-2(ACF49507), Ricinuscommunis RcFAD2(ABK59093), Theobromacacao Tc_predictedFAD(EOY09487), Punicagranatum PgFAD2(AAO37754), Xanthocerassorbifolia XsFAD2(AGO32050), Oleaeuropaea OeFAD2-1(AAW63040), Sesamumindicum SiFAD2 (AAF80560), Solanumlycopersicum Sl_predictedFAD(XP_004228665), Nicotianatabacum NtFAD(AAT72296), Davidiainvolucrate DiFAD2 (ABZ05022), Glycinemax GmFAD2-1B(BAD89861), Crepisalpina CaFAD2-2(ABC00770), Ricinuscomunis RcFAH12(AAC49010), Malusdomestica Md_predictedFAD(MDP0000288297), Fragariax ananassa FaFAD1(KF887973)and Fragariavesca Fv_predicted FAD1(LOC101309231). Snchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page9of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 10

investigatedtheirpossibleassociationto -decalactone biosynthesisbyanalyzingtheirexpressioninparental andallprogenylinesofthe ‘ 232 ’ ‘ 1392 ’ mapping population(Additionalfile1:FigureS4).Asignificant levelofcorrelationbetweenthetranscriptlevelofthe F.ananassa genecorrespondingtogene17831-v1.0hybrid(hereafterreferredtoas FaFAH1 )and -decalactone contentwasobserved(Pears oncorrelation=0.45).On thecontrary,noassociationbetweenthetranscriptlevel ofgene02395-v1.0-hybrid(hereafterreferredtoas FaCYP1 ) and -decalactonecontentwasobserved.Furthermore, expressionprofilingindifferenttissuesbyqRT-PCR showedthat FaFAH1 isexpressedinleafandripefruits while FaCYP1 washighlyexpressedinleafandtoa muchlesserextendingreenfruit(Figure5B,C).These resultsareconsistentwith FaFAH1 butnot FaCYP1 havingapossiblerolein -decalactoneaccumulationin ripeningstrawberries. Transcriptexpressionlevelsmeasuredforgenesina mappingpopulationallowthemtobetreatedastraits forgeneexpressionQTL(eQTL)analysis.Thelocations ofeQTLthatregulategeneexpressioncanbecorrelated withthoseofQTLfortraditionalphenotypictraitsand soprovideadditionalcluesastothegeneticbasisof quantitativegeneticvariation[37].Thecompletecorrelationobservedbetweenhighorno FaFAD1 expression Figure4 Comparisonofexpressionof FaFAD1 inthe2321392mappingpopulationbyrealtimeqRT-PCRwith -decalactonecontent infruits. FaFAD1expression(blackbars)isexpressedrelativetotheaverageexpressioninthepopulationanditisindicatedontheY-axistothe left.Theproductionof -decalactonescoredaspresence/absence(graydots)isindicatedontheY-axistotheright. Snchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page10of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 11

and -decalactonecontent(Figure4;Additionalfile1: FigureS4A)indicatesthataneQTLcontrollingtheexpressionof FaFAD1 collocateswithboththepositionof thegeneandthephenotypictrait.Inordertoevaluate thispredictionandtotestwhetherthedifferentialexpressionof FaFAH1 or FaCYP1 couldbecorrelatedwith thepositionofthelocuscontrolling -decalactonecontent,wenextusedtheqRT-PCRquantitativedatafor eQTLanalysisforthethreegenes.Asapositivecontrol were-analyzedtheQTLfor -decalactonecontent[6]. Interestingly,QTLanalysisperformedwithboththe non-parametricKruskal-Wallistestandintervalmappingusingtheintegratedmapof[6]resultedintheidentificationofthesameeQTLforboth FaFAD1 and FaFAH1 expression(Figure6;Additionalfile1:TableS5). TheeQTLfor FaFAD1 expression,asexpected,collocated withboththepositionoftheQTLcontrolling decalactonecontentandthepositionofthegene FaFAD1 atthebottomofLGIII-2andaccountedfor 90%ofthevariation(Additionalfile1:TableS5).Interestingly,aneQTLcontrolling55%ofthevariationinthe expressionof FaFAH1 wasdetectedalsoinLGIII-2,at theexactsamepositionaswhere FaFAD1 (andthe locus controlling -decalactonecontent)ismapped.Thepositionof FaFAH1 ispredictedtobeinoneLGofHGI basedinthe F.vesca genomesequence(Table2),implying thattheeQTLatLGIII,whichmostlikelyisthegene FaFAD1 ,isregulatingtheexpressionof FaFAH1 .When weanalyzedtheexpressionof FaCYP1 ,aneQTLwas detectedatthetopofadifferentLGbelongingtothe samehomoeologygroupIII(Figure6;Additionalfile1: TableS5).ThepositionoftheeQTLforFaCYP1matches thepositionofthegenebasedinthe F.vesca genome sequence(Table2).Thisdataisconsistentwiththelack ofassociationpreviouslyfoundbetweenthetranscript levelof FaCYP1 and -decalactonecontent.DiscussionTwobulkedpoolsofsegregantsrepresentingthephenotypicextremeswithinarelativelylargepopulationdisplayingwidevariationforagiventraitwouldonlydiffer atthe locus controllingthetrait.Althoughbulksegregantanalysis(BSA)hasgenerallybeingusedtotaggenes controllingMendeliantraits,themethodcanalsobe usedtoidentifymajorQTL[38].Theapplicabilityof BSAtoRNA-seqwasrecentlydemonstratedbymapping themaizemutantgene gl3 [39].Herewereportthe combinationofBSAandRNA-seqasapowerfuland validapproachforquantifyingdifferentialtranscript expressionandforcost-efficientidentificationofgenes underlying -decalactonevariationincultivatedstrawberry.Oncewefinemappedthe locus tothebottom ofchromosome3,theassump tionsmadeforcandidate geneswerethat(1)thegenesmustshowloworno Figure5 Expressionprofilesof candidategenes indifferent tissuesandduringfruitripeningdeterminedbyreal-time qRT-PCRanalysis.(A) Expressionof FaFAD1 (B) expressionof FaFAH1 and (C) expressionof FaCYP1 .Errorbarsindicatestandard deviationsfromthreebiologicalreplicates.Expressionlevelsare expressedasaratiorelativetotheroottissue. Snchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page11of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 12

expressioninfruitswithout -decalactonewhilein fruitsproducingthisVOChadtobehighand(2)the genemustencodeforanenzymeinvolvedinthebiosynthesisofthisvolatile,basedontheproposedpathways,orshouldencodeforaregulatoryprotein.Out ofthe33,458analyzedtranscripts,onlygene24414fulfilledbothrequirements.T hisgeneencodesforaprotein,FaFAD1,withextensivesimilaritytodelta-twelve fattyaciddesaturases,enzymesthatcatalyzetheregioselectiveintroductionofadoublebondatthe 12 positionduringlipidbiosynthesis[34].Therefore,the activityofthisproteincoul dsupplyfattyacidprecursorsforlactonebiosynthesis.Thesequencealignmentof FaFAD1withotherdesaturasesrevealedthepresenceof threeconservedhistidineboxesreportedtobeessential forthecatalysis,andproposedtobetheligandsforthe ironatomsinvolvedintheformationofthedi-ironoxygencomplex.Interestingly,thededucedFaFAD1 proteinisshorterthantherestofFADproteinsand neitherthedilysinenorthearomaticaminoacidenrichedretrievalsignal(-YKNKF)arepresentatthe C-terminusofFaFAD1(Figure2).Oneofthesemotifs isnecessaryformaintaininglocalizationoftheenzymes intheendoplasmicreticulum(ER)[40].However,a PSORTalgorithm(http://wolfpsort.org)predictsthat FaFAD1istargetedtotheERwithacertaintyof8.0, consistentwiththesixtransmembranedomainspredictedforFaFAD1. Inadditiontoadesaturaseactivity,anumberofFAD2 variantsareknowntopossessdiversifiedfunctionalities, catalyzinghydroxylations,epoxidations,ortheformation ofacetylenicandconjugateddoublebonds[35,41,42]. SomeotherFAD2enzymeshavebifunctionalhydroxylase/desaturaseoreventri-functionalactivities[43,44].A closehomologuetoFaFAD1inpeach,PpFAD1B-6,has beenproposedtobeinvolvedinlactoneproductionin fruits[14].Thisenzymeinsertsadoublebondbetween carbon12and13ofmonounsaturatedoleicacidtogeneratepolyunsaturatedlinoleicacid,butdonothaveany detectablehydroxylaseactivity.However,FaFAD1is Figure6 LODprofilesfor -decalactonecontentand FaFAD1 FaFAH1 and FaCYP1 expression(showninred)onlinkagegroupIII-2for theformerthreeandonLGIII-1for FaCYP1 (positionisindicatedincM). HorizontallinemarksthesignificantthresholdforeachQTL. Snchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page12of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 13

phylogeneticallylocatedinadifferentcladeandmore closelyrelatedtothecastorbeanhydroxylaseRcFAH12 [35].Sevenaminoacidresiduesthatdifferbetweenoleatedesaturasesandhydroxylaseshavebeenidentified andthesubstitutionsofalanine148andmethionine324 oftheArabidopsisAtFAD2byisoleucines,asfoundin RcFAH12or Lesquerellafendleri hydroxylase/desaturase (LfFAH12),causedasubstantialshiftincatalyticactivity [45,46].Interestingly,thesetwoisoleucinesareconservedbetweenFaFAD1andhydroxylases,suggesting thatthestrawberrygenecouldencodeforabifunctional enzyme(Figure2). Theexpressionprofilingof FaFAD1 indifferenttissues showedthatthegeneishighlyexpressedandspecificof redfruitoflineswithhigh -decalactonecontent.Therefore,theexpressionishighlycorrelatedwith -decalactone biosynthesis,whichoccursatthelatestagesoffruitripening[4].Inaddition,thecorrelationof FaFAD1 expression with -decalactonecontentinthemappingpopulation, thecoincidentmappositionbetween -decalactoneand FaFAD1 andthepredictedenzymaticactivityofFaFAD1 proteinindicatethatthisgeneisresponsibleforthenaturalvariationofthisVOCinstrawberry.Furthermore,it canbestatedthattheabsenceorextremelylowlevelsof -decalactoneinfruitsofhalfofthepopulationlinesisa consequenceoftheabsenceorextremelylowlevelsof FaFAD1 expressionintheselines.Thesame FaFAD1 allele wasdetectedinbothbulkedpoolseitherusingthereferencegenometomapthereadsorafter denovo assembly. Thedifferentialexpressionof FaFAD1 observedbetween bothpoolswasalikeusingbothmethods(Additional file1:TableS6)andwasalsovalidatedbyqRT-PCR (Additionalfile1:FigureS2;TableS6).However,when theprogenylineswereanalyzedindependently, FaFAD1 expressionwasnotdetectedbyqRT-PCRinfruitswithout -decalactone.Furthermore,different FaFAD1 primerpairsfailedtoamplifyingenomicDNAofthese lines(Additionalfile1:FigureS3;seealsocompanion manuscript),suggestingthatthe FaFAD1 genemaynot bepresentintheirgenome.Takingtheseresultstogether,themostplausibleexplanationisthattheno -decalactonepoolshadsomecontaminationduring processingwithsomefruitscontainingthevolatile. Twoothercandidategeneswerestudiedontheirpotentialcontributionto -decalactoneproductionbased ontheirincreasedexpressioninthehigh -decalactone poolandtheannotatedenzymaticactivity.While FaCYP1 wasnotassociatedto -decalactonecontent,thegene FaFAH1 wasup-regulatedduringfruitripening.Our eQTLanalysisof FaFAD1 and FaFAH1 indicatethatboth areassociatedwith -decalactone.Whiletheassociation of FaFAD1 expressionwith -decalactoneiscomplete, FaFAH1 onlyshowsahighassociationwith -decalactone. WhenoneeQTLmapsinthesamegeneticlocationasthegenewhosetranscriptisbeingmeasured,asitisthecase for FaFAD1 ,isgenerallycausedbycis-actingregulatory polymorphismsinthegene(cis-eQTL).Mostprobably throughapolymorphisminthepromoterregion,whichin turngivesrisetodifferentialexpression.Incontrast,eQTL thatdonotmaptothelocationofthegenebeingassayed, suchasfor FaFAH1, mostlikelyrepresenttrans-acting regulators(trans-eQTL)thatmaycontroltheexpression ofanumberofgeneselsewhereinthegenome[37].Based inthepredictedfunctionofFaFAD1andFaFAH1,we proposethatthepathwayfor -decalactonebiosynthesis infruitsproceedsthroughhydrationofunsaturatedfatty acids.Inthisproposedmodel,theenzymeFaFAD1would catalyzetheconversionofoleicacid(18:1)tolinoleicacid (18:2)bytheintroductionofadoublebondatthe 12 position,asperformedbyotherFAD2enzymes.Additionally,FaFAD1maypossesshydroxylaseactivity,catalyzing thehydroxylationofoleicacidtoricinoleicacid.Thefact thataneQTLfor FaFAH1 expressionwasdetectedatthe positionwhere FaFAD1 mapssuggeststhatFaFAD1,or mostlikelytheproductofFaFAD1activity(i.e.linoleic acid),up-regulatestheexpressionof FaFAH1 ,whichmay encodefortheenzymecatalyzingthenextreactioninthe biosyntheticpathway.Thisreactionmostprobablyisa hydroxylationalthoughsomeCYPrelatedenzymeshave beenshowntohaveepoxidaseactivity[47].Ricinoleic acidderivativeisthenshortenedbyfour -oxidation cyclestoformthecorresponding4-hydroxyacid.The laststepin -decalactonebiosynthesisinvolvesthecyclationofthemoleculeeitherbyanenzymewithalcohol acyl-transferaseactivityorbyspontaneouslactonisation underacidconditions[48].ConclusionsUnderstandingthebasisofvolatileorganiccompound (VOC)biosynthesisandregulationisofutmostimportanceforthegeneticimprovementoffruitflavor.This studyprovidesgeneticandmoleculardataonhowthe contentof -decalactoneisnaturallycontrolledinstrawberryandhighlightsenzymaticactivitiesnecessaryfor theformationofthisVOCinfruits. -decalactonehas beenshowntobeasensoryimportantVOCforstrawberryflavor[17,49].However,otherimportantfunctions ofvolatilesaretodefendplantsagainstpathogens,to attractpollinators,seeddispersers,andotherbeneficial animalsandmicroorganisms,andtoserveassignalsin plant – plantinteraction[50].GOenrichmentanalysisfor thegenesup-regulatedinfruitswithout -decalactone detectedasignificantenrichmentinGOcategoriesrelated toresponsetopathogens.Oneplausibleexplanationis thatthislactonecouldhaveanti-pathogenactivityand,in itsabsence,up-regulationofothermechanismsofbiotic stressresponseswouldcompensatethelackofthisVOC. Inthiscontext, -decalactonehasbeenshowntobetoxicSnchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page13of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 14

toyeastandbacteriathroughitscapacityforpermeabilizingmembranes[48].ThesedatasuggestthatthisVOC mighthaveafunctioninthisprocess,apossibilitythat deservesfurtherinvestigation.AvailabilityofsupportingdataThedatasetssupportingtheresultsofthisarticleare includedwithinthearticle(anditsadditionalfiles)and rawRNA-seqreadsavailableintheEuropeanNucleotide Archive(ENA)repositoryunderaccessionPRJEB5430 (http://www.ebi.ac.uk/ena/data/view/PRJEB5430).AdditionalfilesAdditionalfile1:FigureS1. Distributionofdifferentiallyexpressedgenes inmajorfunctionalterms(GOterms)forcategoriesBiologicalProcess, MolecularFunctionandCellularComponent. FigureS2. Validationof RNA-seqdatabyqRT-PCR. FigureS3. Polymorphismof FaFAD1 and expressionanalysisinripefruitsofdifferentaccessionsof Fragaria ananassa. FigureS4. Expressionprofilesofcandidategenesinthe ‘ 232 ’ x ‘ 1392 ’ mappingpopulationbyrealtimeqRT-PCRincomparison to -decalactonecontentinfruits. TableS1. PrimersusedinqRT-PCR. TableS2. Summaryofreadalignmentsforthethreehigh-decalactone (H -DEC)andthreenotproducing -decalactone(No -DEC)biological replicates. TableS3. GOenrichmentanalysisbymeanofFisher ’ sexact testwiththesetsofup-regulatedgenes/locus(highlyexpressedin high-decalactonepool)incomparisontogeneralmodelof Fragaria vesca. TableS4. GOenrichmentanalysisbymeanofFisher ’ sexacttest withthesetsofdown-regulatedgenes/locus(higherexpressioninthe No-decalactonepool)incomparisontogeneralmodelof Fragaria vesca. TableS5. QTLdetectedinthe ‘ 232 ’ ‘ 1392 ’ strawberrypopulation controllingthecontentof -decalactoneandeQTLcontrollingthe expressionof FaFAD1 FaFAH1 and FaCYP1 basedonKruskal-Wallis(K-W) andintervalmapping(IM). TableS6. Expressionofgene24414-v1.0-hybrid ineachofthebiologicalreplicatesbythreedifferentapproaches. Additionalfile2: ListoftheSSR,SNP,AFLPandgenemarkers mappedintheHGIIIalongwithDArTsequence,SNPpositionand theirgenotypesinthe2321392population. Additionalfile3: RNA-seqexpressionvaluesfordifferentially expressedgenesandforallanalyzedgenes. Competinginterests Theauthorswouldliketodeclarethattheyhavenofinancialornon-financial competinginterestsinthepublicationofthismanuscript. Authors ’ contributions JS-ScarriedouttheRNA-seqanalysisandbioinformaticsstudiesandparticipated todraftthemanuscript.EC-RparticipatedinqRT-PCRanalysisandgenecloning. VVparticipatedinthesequencealignmentandhelpedtodraftthemanuscript. MBparticipatedinthedesignofthestudyandhelpedtodraftthemanuscript. IAconceivedofthestudy,carriedoutthegeneticanalysesandRNAisolation, participatedinitsdesignandcoordinationanddraftedthemanuscript.All authorsreadandapprovedthefinalmanuscript. AcknowledgementsWearegratefultoAurelianoBombarelyforadviceonbioinformaticsanalysis ofRNA-seqdataandtotheCentroNacionaldeAnlisisGenmico(CNAG) forIlluminasequencing.ThisworkwassupportedbytheSpanishMinistryof EconomyandCompetitivityandFEDER(grantnumbersAGL2012-40066, BIO2010-15630),theEUBerryProject(EUFP7KBBE – 2010-4GrantAgreement number265942)andbyaMarieCurieInternationalOutgoingFellowship withinthe7thEuropeanCommunityFrameworkProgrammetoI.A(IOF Flavor328052). Authordetails1InstitutoAndaluzdeInvestigacinyFormacinAgrariayPesquera, IFAPA-CentrodeChurriana,CortijodelaCruzs/n,29140Mlaga,Spain.2DepartamentodeBiologaMolecularyBioqumica,Institutode HortofruticulturaSubtropicalyMediterrnea(IHSM-CSIC-UMA),29071Mlaga, Spain.3HorticulturalSciencesDepartment,UniversityofFlorida,1301Fifield Hall,Gainesville,FL32611,USA. Received:14November2013Accepted:17March2014 Published:17April2014 References1.PrezA,SanzA: Strawberryflavor. In HandbookofFruitandVegetable Flavors. EditedbyHuiHY.Hoboken,NewJersey:JohnWiley&Sons,Inc; 2010:437 – 455. 2.LatrasseA: FruitsIII. In VolatileCompoundsinFruitsandBeverages. Editedby MaarseH.NewYork:MarcekDekker,Inc;1991:329 – 387. 3.ZabetakisI,HoldenMA: Strawberryflavour:analysisandbiosynthesis. JSciFoodAgric 1997, 74: 421 – 434. 4.MnagerI,JostM,AubertC: Changesinphysicochemicalcharacteristics andvolatileconstituentsofstrawberry(Cv.Cigaline)duringmaturation. JAgricFoodChem 2004, 52: 1248 – 1254. 5.JettiRR,YangE,KurniantaA,FinnC,QianMC: Quantificationofselected aroma-activecompoundsinstrawberriesbyheadspacesolid-phase microextractiongaschromatographyandcorrelationwithsensory descriptiveanalysis. JFoodSci 2007, 72: S487 – S496. 6.Zorrilla-FontanesiY,RamblaJ-L,CabezaA,MedinaJJ,Snchez-SevillaJF, ValpuestaV,BotellaMA,GranellA,AmayaI: Geneticanalysisofstrawberry fruitaromaandidentificationofO-methyltransferaseFaOMTasthelocus controllingnaturalvariationinmesifuranecontent. PlantPhysiol 2012, 159: 851 – 870. 7.OsorioS,MuozC,ValpuestaV: Physiologyandbiochemistryoffruit flavors. In HandbookofFruitandVegetableFlavors. EditedbyHuiHY. Hoboken,NewJersey:JohnWiley&Sons,Inc;2010:25 – 43. 8.AragezI,ValpuestaFernndezV: Metabolicengineeringofaroma componentsinfruits. BiotechnolJ 2013, 8: 1144 – 1158. 9.SchwabW,Davidovich-RikanatiR,LewinsohnE: Biosynthesisofplant-derived flavorcompounds. PlantJ 2008, 54: 712 – 732. 10.SchttlerM,BolandW: Biosynthesisofdodecano-4-lactoneinripening fruits:crucialroleofanepoxide-hydrolaseinenantioselectivegeneration ofaromacomponentsofthenectarine(Prunuspersicavar.nucipersica) andthestrawberry(Fragariaananassa). HelvChimActa 1996, 79: 1488 – 1496. 11.OlbrichtK,GrafeC,WeissK,UlrichD: Inheritanceofaromacompoundsin amodelpopulationofFragariaananassaDuch. PlantBreed 2008, 127: 87 – 93. 12.DouillardC,GuichardE:Comparisonbymultidimensionalanalysisof concentrationsofvolatilecompoundsinfourteenfrozenstrawberry varieties[aroma,furaneol,mesifurane]. SciAliment 1989, 9: 53 – 76. 13.HusainQ: Chemistryandbiochemistryofsomevegetableflavors. In HandbookofFruitandVegetableFlavors. EditedbyHuiHY.Hoboken,New Jersey:JohnWiley&Sons,Inc;2010:575 – 625. 14.SnchezG,Venegas-CalernM,SalasJJ,MonforteA,BadenesML,GranellA: Anintegrative “ omics ” approachidentifiesnewcandidategenesto impactaromavolatilesinpeachfruit. BMCGenomics 2013, 14: 343. 15.XiW-P,ZhangB,LiangL,ShenJ-Y,WeiW-W,XuC-J,AllanAC,FergusonIB, ChenK-S: Postharvesttemperatureinfluencesvolatilelactoneproduction viaregulationofacyl-CoAoxidasesinpeachfruit. PlantCellEnviron 2012, 35: 534 – 545. 16.EduardoI,ChieteraG,PironaR,PachecoI,TroggioM,BanchiE,BassiD, RossiniL,VecchiettiA,PozziC: Geneticdissectionofaromavolatile compoundsfromtheessentialoilofpeachfruit:QTLanalysisand identificationofcandidategenesusingdenseSNPmaps. TreeGenetics& Genomes 2013, 9: 189 – 204. 17.LarsenM,PollL,OlsenC: Evaluationofthearomacompositionofsome strawberry(FragariaananassaDuch)cultivarsbyuseofodourthreshold values. ZeitschriftfrLebensmitteluntersuchungundForschung 1992, 195: 536 – 539. 18.Rousseau-GueutinM,Lerceteau-KohlerE,BarrotL,SargentDJ,MonfortA, SimpsonD,ArusP,GuerinG,Denoyes-RothanB: Comparativegeneticmapping betweenoctoploidanddiploidfragariaspeciesrevealsahighlevelofSnchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page14of15 http://www.biomedcentral.com/1471-2164/15/218

PAGE 15

colinearitybetweentheirgenomesandtheessentiallydisomicbehaviorof thecultivatedoctoploidstrawberry. Genetics 2008, 179: 2045 – 2060. 19.Zorrilla-FontanesiY,CabezaA,DomnguezP,MedinaJJ,ValpuestaV, Denoyes-RothanB,Snchez-SevillaJF,AmayaI: Quantitativetraitlociand underlyingcandidategenescontrollingagronomicalandfruitquality traitsinoctoploidstrawberry(Fragariaananassa). TheorApplGen 2011, 123: 755 – 778. 20.IsobeSN,HirakawaH,SatoS,MaedaF,IshikawaM,MoriT,YamamotoY, ShirasawaK,KimuraM,FukamiM,HashizumeF,TsujiT,SasamotoS,KatoM, NanriK,TsuruokaH,MinamiC,TakahashiC,WadaT,OnoA,KawashimaK, NakazakiN,KishidaY,KoharaM,NakayamaS,YamadaM,FujishiroT, WatanabeA,TabataS: Constructionofanintegratedhighdensitysimple sequencerepeatlinkagemapincultivatedstrawberry(fragariax ananassa)anditsapplicability. DNARes 2013, 20: 79 – 92. 21.SargentDJ,PasseyT, Š urbanovskiN,LopezGironaE,KuchtaP,DavikJ, HarrisonR,PasseyA,WhitehouseAB,SimpsonDW: Amicrosatellitelinkage mapforthecultivatedstrawberry(Fragariaananassa)suggestsextensive regionsofhomozygosityinthegenomethatmayhaveresultedfrom breedingandselection. TheorApplGen 2012, 124: 1229 – 1240. 22.BombarelyA,MerchanteC,CsukasiF,Cruz-RusE,CaballeroJL,MedinaEscobarN,Blanco-PortalesR,BotellaMA,Muoz-BlancoJ,Snchez-SevillaJF, ValpuestaV: GenerationandanalysisofESTsfromstrawberry(Fragaria xananassa)fruitsandevaluationoftheirutilityingeneticandmolecular studies. BMCGenomics 2010, 11: 503. 23.ShulaevV,SargentDJ,CrowhurstRN,MocklerTC,FolkertsO,DelcherAL, JaiswalP,MockaitisK,ListonA,ManeSP,BurnsP,DavisTM,SlovinJP,BassilN, HellensRP,EvansC,HarkinsT,KodiraC,DesanyB,CrastaOR,JensenRV,AllanAC, MichaelTP,SetubalJC,CeltonJ-M,ReesDJG,WilliamsKP,HoltSH,RojasJJR, ChatterjeeM, etal : Thegenomeofwoodlandstrawberry(Fragaria vesca). NatureGen 2011, 43: 109 – 116. 24.MartinLBB,FeiZ,GiovannoniJJ,RoseJKC: Catalyzingplantscience researchwithRNA-seq. FrontPlantSci 2013, 4: 66. 25.HigginsJ,MagusinA,TrickM,FraserF,BancroftI: UseofmRNA-seqto discriminatecontributionstothetranscriptomefromtheconstituent genomesofthepolyploidcropspeciesBrassicanapus. BMCGenomics 2012, 13: 1 – 1. 26.ManningK: Isolationofnucleicacidsfromplantsbydifferentialsolvent precipitation. AnalBiochem 1991, 195: 45 – 50. 27.KimD,PerteaG,TrapnellC,PimentelH,KelleyR,SalzbergSL: TopHat2: accuratealignmentoftranscriptomesinthepresenceofinsertions, deletionsandgenefusions. GenomeBiol 2013, 14: R36. 28.TrapnellC,HendricksonDG,SauvageauM,GoffL,RinnJL,PachterL: DifferentialanalysisofgeneregulationattranscriptresolutionwithrNA-seq.NatBiotechnol 2012, 31: 46 – 53. 29.ConesaA,GtzS: Blast2GO:Acomprehensivesuiteforfunctional analysisinplantgenomics. IntJPlantGenom 2008, 2008: 619832. 30.GrabherrMG,HaasBJ,YassourM,LevinJZ,ThompsonDA,AmitI,Adiconis X,FanL,RaychowdhuryR,ZengQ,ChenZ,MauceliE,HacohenN,GnirkeA, RhindN,diPalmaF,BirrenBW,NusbaumC,Lindblad-TohK,FriedmanN, RegevA: Full-lengthtranscriptomeassemblyfromRNA-Seqdatawithout areferencegenome. NatBiotechnol 2011, 29: 644 – 652. 31.TamuraK,PetersonD,PetersonN,StecherG,NeiM,KumarS: MEGA5: molecularevolutionarygeneticsanalysisusingmaximumlikelihood, evolutionarydistance,andmaximumparsimonymethods. MolBiolEvol 2011, 28: 2731 – 2739. 32.PfafflMW: Anewmathematicalmodelforrelativequantificationin real-timeRT-PCR. NucleicAcidsRes 2001, 29: 2002 – 2007. 33.SalvatierraA,PimentelP,Moya-LenMA,CaligariPDS,HerreraR: Comparison oftranscriptionalprofilesofflavonoidgenesandanthocyanincontents duringfruitdevelopmentoftwobotanicalformsofFragariachiloensisssp. chiloensis. Phytochemistry 2010, 71: 1839 – 1847. 34.OkuleyJ,LightnerJ,FeldmannK,YadavN,LarkE,BrowseJ: Arabidopsis FAD2geneencodestheenzymethatisessentialforpolyunsaturated lipidsynthesis. PlantCell 1994, 6: 147 – 158. 35.vandeLooFJ,BrounP,TurnerS,SomervilleC: Anoleate12-hydroxylase fromRicinuscommunisL.isafattyacyldesaturasehomolog. ProcNatl AcadSciUSA 1995, 92: 6743 – 6747. 36.HernndezML,ManchaM,Martnez-RivasJM: Molecularcloningand characterizationofgenesencodingtwomicrosomaloleatedesaturases (FAD2)fromolive. Phytochemistry 2005, 66: 1417 – 1426. 37.KliebensteinD: Quantitativegenomics:analyzingintraspecificvariation usingglobalgeneexpressionpolymorphismsoreQTLs. AnnuRevPlant Biol 2009, 60: 93 – 114. 38.CollardBCY,JahuferMZZ,BrouwerJB,PangECK: Anintroductionto markers,quantitativetraitloci(QTL)mappingandmarker-assisted selectionforcropimprovement:thebasicconcepts. Euphytica 2005, 142: 169 –196. 39.LiuS,YehC-T,TangHM,NettletonD,SchnablePS: Genemappingvia bulkedsegregantRNA-Seq(BSR-Seq). PLoSONE 2012, 7: e36406. 40.McCartneyAW,DyerJM,DhanoaPK,KimPK,AndrewsDW,McNewJA, MullenRT: Membrane-boundfattyaciddesaturasesareinserted co-translationallyintotheERandcontaindifferentERretrievalmotifsat theircarboxytermini. PlantJ 2004, 37: 156 – 173. 41.ShanklinJ,CahoonEB: Desaturationandrelatedmodificationsoffatty acids1. AnnuRevPlantPhysiolPlantMolBiol 1998, 49: 611 – 641. 42.ShanklinJ,GuyJE,MishraG,LindqvistY: Desaturases:emergingmodels forunderstandingfunctionaldiversificationofdiiron-containingenzymes. JBiolChem 2009, 284: 18559 – 18563. 43.BrounP,BoddupalliS,SomervilleC: Abifunctionaloleate12-hydroxylase: desaturasefromLesquerellafendleri. PlantJ 1998, 13: 201 – 210. 44.CaoS,ZhouX-R,WoodCC,GreenAG,SinghSP,LiuL,LiuQ: Alargeand functionallydiversefamilyofFad2genesinsafflower(Carthamustinctorius L.). BMCPlantBiol 2013, 13: 5. 45.BroadwaterJA,WhittleE,ShanklinJ: Desaturationandhydroxylation. Residues148and324ofArabidopsisFAD2,inadditiontosubstrate chainlength,exertamajorinfluenceinpartitioningofcatalytic specificity. JBiolChem 2002, 277: 15613 – 15620. 46.BrounP,ShanklinJ,WhittleE,SomervilleC: Catalyticplasticityoffattyacid modificationenzymesunderlyingchemicaldiversityofplantlipids. Science 1998, 282: 1315 – 1317. 47.PinotF,BeissonF: CytochromeP450metabolizingfattyacidsinplants: characterizationandphysiologicalroles. FEBSJ 2010, 278: 195 – 205. 48.WachY,AguedoM,NicaudJM,BelinJM: Catabolismofhydroxyacidsand biotechnologicalproductionoflactonesbyYarrowialipolytica. Appl MicrobiolBiotechnol 2003, 61: 393 – 404. 49.UbedaC,San-JuanF,ConcejeroB,CallejnRM,TroncosoAM,MoralesML, FerreiraV,Hernndez-OrteP: Glycosidicallyboundaromacompoundsand impactodorantsoffourstrawberryvarieties. JAgricFoodChem 2012, 60: 6095 –6102. 50.DudarevaN,PicherskyE: Metabolicengineeringofplantvolatiles. Curr OpinBiotechnol 2008, 19: 181 – 189.doi:10.1186/1471-2164-15-218 Citethisarticleas: Snchez-Sevilla etal. : Decipheringgamma-decalactone biosynthesisinstrawberryfruitusingacombinationofgeneticmapping, RNA-SeqandeQTLanalyses. BMCGenomics 2014 15 :218. Submit your next manuscript to BioMed Central and take full advantage of: € Convenient online submission € Thorough peer review € No space constraints or color “gure charges € Immediate publication on acceptance € Inclusion in PubMed, CAS, Scopus and Google Scholar € Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Snchez-Sevilla etal.BMCGenomics 2014, 15 :218 Page15of15 http://www.biomedcentral.com/1471-2164/15/218



PAGE 1

Additional file 1 Figure S1 Distribution of differentially expressed genes in major functional terms (GO terms) for categories Biological Process, Molecular Function and Cel lular Component cell 40% organelle 27% membrane 22% macromolecular complex 11% Go terms Cellular Components Level 2 Binding 51% catalytic activity 49% Go Terms Molecular Functions Level 2 metabolic process 27% cellular process 25% reponse to stimulus 15% biological regulation 9% location 8% cellular component organization or biogenesis 6% developmental process 5% multicellular organismal process 5% Go terms Biological Process. Level 2

PAGE 2

Figure S2 Validation of RNA seq data by qRT PCR. The relative expression of FaFAD1 (A), FaFAH1 (B), FaCYP1 (C) and FaCAD1 was tested by qRT PCR in the three biological replicates of the two pools used for RNA seq Error b ars represent standard deviations and asterisks den ote significant differences by S tudent t test (* P<0.05; ** P<0.01) For each gene, the fold change (in log2) obtained in the RNA seq is depicted on top of the graphs as well as the predicted gene IDs in the F. vesca genome.

PAGE 3

Figure S3 Genomic DNA from parental and 14 progeny lines screened wi th primers used in the qRT PCR ( A top panel) or with the FaFAD1 molecular marker developed in the companion paper by Chambers et al. ( A lower panel). Although 16 lines are shown in the figure, c o segregation between marker decalactone content ( indicated by a peach below the gels) was observed for all mapping individuals. B Relative expression of FaFAD1 in ripe fruits of different accessions of Fragaria ananassa d etermined by qRT PCR. Expression levels are expressed as a ratio relative to Chandler. C. Expression analysis of FaFAD1 in the same accessions by semi quantitative RT PCR (top panel). The number of amplification cycles was 29 and 25 for FaFAD1 and the constitutive GADPH genes, re spectively. The lower panel depicts FaFAD1 amplification on genomic DNA from the same cultivars. SSR marker ChFa M159 ( 250 260 bp; Zorrilla Fontanesi Y, Cabeza A, Torres A, Botella M, Valpuesta V, Monfort A, Snchez Sevilla J, Amaya I : Development and bin mapping of strawberry genic SSRs in diploid Fragaria and their transferability across the Rosoideae subfamily Mol Breed 2011, 27 : 137 156) was used a s positive control in the PCR.

PAGE 4

A B C Figure S4 Expression profiles of candidate genes population by real time qRT PCR in comparison to decalactone content in fruits. FaFAD1 (A), FaFAH1 (B) and FaCYP 1 (C) expression (red, purple and green lines, respectively) is expressed relative to the average expression in the population and it is indicated on the Y axis to the right. The average content of decalactone for seasons 2007 2009 (blue bars) is indicated on the Y axis to the left. Pearson correlation coefficients between each gene and decalactone content were 0.73, 0.45 and 0.06 for FaFAD1 FaFAH1 and FaCYP1 respectively.

PAGE 5

Table S1 Primers used in qRT PCR. Gene Primer Sequence 5 3' Product size (bp) FaFAD1 Forward TCTGTACTCTACCGCCTTGC 140 reverse TCGTAGTGTGGCAGTGAAGG FaFAH1 Forward CCTTTCATACGGCGGGGGAA 157 reverse CGAAGCTCTCTTGTTCCGGTG FaCYP1 Forward ATGCTCTTTGCCAGGCTTCT 132 reverse AGCCAAGCGAGGTTTAGCAT FaCAD1 Forward TTCCAGGGCATGAGATTGTTGG 201 reverse CATAGGTGGTGCTTCCGTCG GAPDH Forward TCCATCACTGCCACCCAGAAGACTG 132 reverse AGCAGGCAGAACCTTTCCGACAG

PAGE 6

Table S2 Summary of read alignments for the three high decalactone (H DEC ) and three not producing decalactone (No DEC ) biological replicates M, millions. ID Total Reads Clean Reads Paired in Sequencing Properly paired With itself and mate mapped Singletons M ate mapped to a different chrom. Reads Pair 1 (%) (%) Pair 2 (%) (%) mapQ>=5 H DEC 1 30.10 M 29.24 M 40.18 M 20.35 M 27.31 M 32.61 M 7.57 M 0.23 M 97.13% 68.72% 19.83 M 67.96% 18.85% 0.09 M H DEC 2 36.16 M 35.22 M 48.96 M 24.66 M 33.31 M 39.88 M 9.08 M 0.29 M 97.38% 69.52% 24.30 M 68.02% 18.55% 0.11 M H DEC 3 36.61 M 35.40 M 49.16 M 24.92 M 32.42 M 39.76 M 9.39 M 0.30 M 96.69% 69.43% 24.24 M 65.95% 19.11% 0.11 M No DEC 1 40.91 M 39.77 M 55.35 M 27.89 M 38.40 M 45.25 M 10.10 M 0.30 M 97.21% 69.59% 27.46 M 69.37% 18.25% 0.12 M No DEC 2 35.90 M 34.49 M 48.33 M 24.34 M 33.28 M 39.62 M 8.71 M 0.27 M 97.44% 70.06% 24.00 M 68.86% 18.03% 0.10 M No DEC 3 38.33 M 37.45 M 52.14 M 26.25 M 36.00 M 42.75 M 9.39 M 0.29 M 97.71% 69.62% 25.89 M 69.05% 18.02% 0.11 M

PAGE 7

Table S3 regulated genes/locus (highly expressed in high decalactone pool) in comparison to general model of F. vesca Category: P: Biological Process, F: Molecular function, C: Cellular c omponent. FDR: The value of the Fisher's test statistic used to compute significance P values represent significant differences between the number of genes assigned to the GO category in the reference F. vesca background and in the high decalactone induced genes. # T est: Number of sequences annotat ed in the set. GO ID Term Category FDR P Value #Test GO:0055114 oxidation reduction process P 2,00E 010 2,64E 014 92 GO:0016491 oxidoreductase activity F 1,06E 008 2,81E 012 86 GO:0016616 oxidoreductase activity, acting on the CH OH group of donors, NAD or NADP as acceptor F 1,42E 006 7,31E 010 24 GO:0016614 oxidoreductase activity, acting on CH OH group of donors F 1,42E 006 7,50E 010 25 GO:0042203 toluene catabolic process P 1,50E 006 1,98E 009 6 GO:0042184 xylene catabolic process P 1,50E 006 1,98E 009 6 GO:0072491 toluene containing compound catabolic process P 1,50E 006 1,98E 009 6 GO:0072490 toluene containing compound metabolic process P 1,50E 006 1,98E 009 6 GO:0018970 toluene metabolic process P 1,50E 006 1,98E 009 6 GO:0018948 xylene metabolic process P 1,50E 006 1,98E 009 6 GO:0006803 glutathione conjugation reaction P 2,56E 006 4,06E 009 8 GO:0004364 glutathione transferase activity F 2,56E 006 4,06E 009 8 GO:0018879 biphenyl metabolic process P 1,61E 005 2,97E 008 5 GO:0018456 aryl alcohol dehydrogenase (NAD+) activity F 1,61E 005 2,97E 008 5 GO:0044455 mitochondrial membrane part C 1,68E 005 3,32E 008 14 GO:0046029 mannitol dehydrogenase activity F 1,70E 005 3,82E 008 6 GO:0031320 hexitol dehydrogenase activity F 1,70E 005 3,82E 008 6 GO:0006950 response to stress P 2,24E 005 5,32E 008 99 GO:0004033 aldo keto reductase (NADP) activity F 3,21E 005 8,06E 008 7 GO:0022626 cytosolic ribosome C 3,30E 005 8,72E 008 20 GO:0044445 cytosolic part C 1,99E 004 5,53E 007 21 GO:0044429 mitochondrial part C 2,65E 004 7,69E 007 19 GO:0022625 cytosolic large ribosomal subunit C 2,89E 004 8,79E 007 11 GO:0018883 caprolactam metabolic process P 3,04E 004 1,04E 006 5 GO:0045551 cinnamyl alcohol dehydrogenase activity F 3,04E 004 1,04E 006 5 GO:0019384 caprolactam catabolic process P 3,04E 004 1,04E 006 5 GO:0050896 response to stimulus P 4,52E 004 1,65E 006 146 GO:0072340 cellular lactam catabolic process P 4,52E 004 1,67E 006 5 GO:0009607 response to biotic stimulus P 7,26E 004 2,78E 006 42 GO:0070401 NADP+ binding F 7,26E 004 2,88E 006 4 GO:0044391 ribosomal subunit C 9,24E 004 4,02E 006 15 GO:0008152 metabolic process P 9,24E 004 4,02E 006 256 GO:0005730 nucleolus C 9,24E 004 4,02E 006 25 GO:0005746 mitochondrial respiratory chain C 1,36E 003 6,10E 006 9 GO:0031966 mitochondrial membrane C 1,45E 003 6,68E 006 15 GO:0009409 response to cold P 1,45E 003 6,90E 006 24 GO:0016758 transferase activity, transferring hexosyl groups F 1,72E 003 8,42E 006 24 GO:0043605 cellular amide catabolic process P 2,05E 003 1,04E 005 5 GO:0016846 carbon sulfur lyase activity F 2,05E 003 1,06E 005 8 GO:0003735 structural constituent of ribosome F 2,15E 003 1,14E 005 20 GO:0042221 response to chemical stimulus P 2,17E 003 1,18E 005 86 GO:0004462 lactoylglutathione lyase activity F 2,28E 003 1,26E 005 6

PAGE 8

GO:0072341 modified amino acid binding F 2,44E 003 1,39E 005 5 GO:0005740 mitochondrial envelope C 2,66E 003 1,55E 005 15 GO:1900750 oligopeptide binding F 2,73E 003 1,66E 005 4 GO:0043295 glutathione binding F 2,73E 003 1,66E 005 4 GO:0015934 large ribosomal subunit C 3,33E 003 2,06E 005 11 GO:0019748 secondary metabolic process P 3,51E 003 2,23E 005 27 GO:0006749 glutathione metabolic process P 3,51E 003 2,35E 005 8 GO:0072338 cellular lactam metabolic process P 3,51E 003 2,36E 005 5 GO:0005743 mitochondrial inner membrane C 3,51E 003 2,36E 005 13 GO:0004032 alditol:NADP+ 1 oxidoreductase activity F 3,74E 003 2,57E 005 4 GO:0009266 response to temperature stimulus P 3,80E 003 2,66E 005 30 GO:0042816 vitamin B6 metabolic process P 4,22E 003 3,01E 005 5 GO:0016757 transferase activity, transferring glycosyl groups F 4,48E 003 3,26E 005 26 GO:0070469 respiratory chain C 4,70E 003 3,47E 005 9 GO:0050236 pyridoxine:NADP 4 dehydrogenase activity F 6,51E 003 4,90E 005 3 GO:0035251 UDP glucosyltransferase activity F 9,25E 003 7,08E 005 13 GO:0042277 peptide binding F 1,10E 002 8,60E 005 5 GO:0071824 protein DNA complex subunit organization P 1,18E 002 9,63E 005 9 GO:0065004 protein DNA complex assembly P 1,18E 002 9,63E 005 9 GO:0043450 alkene biosynthetic process P 1,18E 002 9,63E 005 9 GO:0044085 cellular component biogenesis P 1,30E 002 1,09E 004 45 GO:1900674 olefin biosynthetic process P 1,32E 002 1,11E 004 9 GO:0046527 glucosyltransferase activity F 1,32E 002 1,14E 004 13 GO:0005198 structural molecule activity F 1,37E 002 1,20E 004 21 GO:0019866 organelle inner membrane C 1,43E 002 1,26E 004 14 GO:0042178 xenobiotic catabolic process P 1,44E 002 1,29E 004 6 GO:0008106 alcohol dehydrogenase (NADP+) activity F 1,45E 002 1,32E 004 4 GO:0009811 stilbene biosynthetic process P 1,76E 002 1,65E 004 6 GO:0009810 stilbene metabolic process P 1,76E 002 1,65E 004 6 GO:0046482 para aminobenzoic acid metabolic process P 1,80E 002 1,71E 004 5 GO:0042537 benzene containing compound metabolic process P 1,92E 002 1,85E 004 6 GO:0043603 cellular amide metabolic process P 2,09E 002 2,07E 004 6 GO:0006518 peptide metabolic process P 2,49E 002 2,50E 004 8 GO:0051707 response to other organism P 2,56E 002 2,67E 004 35 GO:0006970 response to osmotic stress P 2,56E 002 2,69E 004 25 GO:0000786 nucleosome C 2,56E 002 2,79E 004 7 GO:0055091 phospholipid homeostasis P 2,56E 002 2,94E 004 2 GO:0055089 fatty acid homeostasis P 2,56E 002 2,94E 004 2 GO:0055088 lipid homeostasis P 2,56E 002 2,94E 004 2 GO:0006294 nucleotide excision repair, preincision complex assembly P 2,56E 002 2,94E 004 2 GO:0042171 lysophosphatidic acid acyltransferase activity F 2,56E 002 2,94E 004 2 GO:0070328 triglyceride homeostasis P 2,56E 002 2,94E 004 2 GO:0080018 anthocyanin 5 O glucosyltransferase activity F 2,56E 002 2,94E 004 2 GO:0080002 UDP glucose:4 aminobenzoate acylglucosyltransferase activity F 2,56E 002 2,94E 004 2 GO:0043449 cellular alkene metabolic process P 3,22E 002 3,74E 004 9 GO:0030639 polyketide biosynthetic process P 3,23E 002 3,88E 004 6 GO:0030638 polyketide metabolic process P 3,23E 002 3,88E 004 6 GO:0042181 ketone biosynthetic process P 3,23E 002 3,88E 004 6 GO:0016765 transferase activity, transferring alkyl or aryl (other than methyl) groups F 3,30E 002 4,04E 004 8 GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen F 3,30E 002 4,06E 004 19 GO:0005840 ribosome C 3,34E 002 4,15E 004 24

PAGE 9

GO:1900673 olefin metabolic process P 3,34E 002 4,19E 004 9 GO:0050662 coenzyme binding F 3,48E 002 4,41E 004 17 GO:0032993 protein DNA complex C 3,52E 002 4,51E 004 7 GO:0009072 aromatic amino acid family metabolic process P 3,67E 002 4,75E 004 15 GO:0008194 UDP glycosyltransferase activity F 3,85E 002 5,07E 004 15 GO:0034976 response to endoplasmic reticulum stress P 3,85E 002 5,09E 004 11 GO:0016597 amino acid binding F 3,87E 002 5,16E 004 6 GO:0005829 cytosol C 3,98E 002 5,36E 004 50 GO:0010033 response to organic substance P 4,39E 002 5,97E 004 53 GO:0009055 electron carrier activity F 4,40E 002 6,04E 004 22 GO:0009699 phenylpropanoid biosynthetic process P 4,51E 002 6,25E 004 14

PAGE 10

Table S4 ith the sets of down regulated genes /locus ( higher expression in the No decalactone pool) in comparison to general model of Fragaria vesca Category: P: Biological Process, F: Molecular function, C: Cellular component. FDR: The value of the Fisher's test statistic used to compute significance P v alues represent significant differences between the number of genes assigned to the GO category in the reference F. vesca background and in the No decalactone induced genes. # Test: Number of sequences annotaded in the set. GO ID Term Category FDR P Value #Test GO:0071944 cell periphery C 8,20E 008 1,08E 011 59 GO:0005886 plasma membrane C 4,34E 007 1,15E 010 50 GO:0042625 ATPase activity, coupled to transmembrane movement of ions F 2,10E 005 8,32E 009 12 GO:0015405 P P bond hydrolysis driven transmembrane transporter activity F 3,73E 005 2,14E 008 15 GO:0015399 primary active transmembrane transporter activity F 3,73E 005 2,46E 008 15 GO:0042626 ATPase activity, coupled to transmembrane movement of substances F 2,29E 004 2,12E 007 13 GO:0043492 ATPase activity, coupled to movement of substances F 2,29E 004 2,12E 007 13 GO:0016820 hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances F 2,41E 004 2,54E 007 13 GO:0022804 active transmembrane transporter activity F 3,29E 004 3,91E 007 20 GO:0065008 regulation of biological quality P 5,75E 004 7,59E 007 25 GO:0015662 ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism F 7,79E 004 1,13E 006 7 GO:0016020 membrane C 1,69E 003 2,68E 006 73 GO:0009607 response to biotic stimulus P 2,12E 003 3,82E 006 26 GO:0009653 anatomical structure morphogenesis P 2,12E 003 4,06E 006 28 GO:0006811 ion transport P 2,12E 003 4,20E 006 25 GO:0015748 organophosphate ester transport P 3,02E 003 7,97E 006 5 GO:0015716 organic phosphonate transport P 3,02E 003 7,97E 006 5 GO:0015605 organophosphate ester transmembrane transporter activity F 3,02E 003 7,97E 006 5 GO:0015604 organic phosphonate transmembrane transporter activity F 3,02E 003 7,97E 006 5 GO:0015416 organic phosphonate transmembrane transporting ATPase activity F 3,02E 003 7,97E 006 5 GO:0046034 ATP metabolic process P 4,33E 003 1,20E 005 11 GO:0051707 response to other organism P 5,26E 003 1,53E 005 24 GO:0022857 transmembrane transporter activity F 5,53E 003 1,72E 005 24 GO:0022892 substrate specific transporter activity F 5,53E 003 1,75E 005 23 GO:0046351 disaccharide biosynthetic process P 6,39E 003 2,11E 005 5 GO:0010016 shoot morphogenesis P 7,19E 003 2,47E 005 12 GO:0005215 transporter activity F 8,80E 003 3,14E 005 27 GO:0022891 substrate specific transmembrane transporter activity F 9,00E 003 3,45E 005 21 GO:0051704 multi organism process P 9,00E 003 3,55E 005 28 GO:0015075 ion transmembrane transporter activity F 9,00E 003 3,56E 005 18 GO:0019829 cation transporting ATPase activity F 9,08E 003 3,72E 005 7 GO:0048513 organ development P 9,21E 003 3,89E 005 29 GO:0048731 system development P 9,47E 003 4,13E 005 29 GO:0006812 cation transport P 1,02E 002 4,59E 005 19 GO:0007155 cell adhesion P 1,02E 002 4,82E 005 6 GO:0022610 biological adhesion P 1,02E 002 4,82E 005 6

PAGE 11

GO:0009312 oligosaccharide biosynthetic process P 1,20E 002 6,34E 005 5 GO:0051179 localization P 1,20E 002 6,42E 005 48 GO:0032502 developmental process P 1,20E 002 6,92E 005 46 GO:0030641 regulation of cellular pH P 1,20E 002 7,10E 005 2 GO:0035427 purine nucleoside transmembrane transport P 1,20E 002 7,10E 005 2 GO:0051453 regulation of intracellular pH P 1,20E 002 7,10E 005 2 GO:0015211 purine nucleoside transmembrane transporter activity F 1,20E 002 7,10E 005 2 GO:0010184 cytokinin transport P 1,20E 002 7,10E 005 2 GO:0048367 shoot development P 1,20E 002 7,23E 005 15 GO:0016787 hydrolase activity F 1,20E 002 7,37E 005 51 GO:0022621 shoot system development P 1,20E 002 7,68E 005 15 GO:0030838 positive regulation of actin filament polymerization P 1,20E 002 7,88E 005 6 GO:0045010 actin nucleation P 1,20E 002 7,88E 005 6 GO:0044262 cellular carbohydrate metabolic process P 1,20E 002 7,93E 005 22 GO:0031334 positive regulation of protein complex assembly P 1,28E 002 8,99E 005 6 GO:0051495 positive regulation of cytoskeleton organization P 1,28E 002 8,99E 005 6 GO:0032273 positive regulation of protein polymerization P 1,28E 002 8,99E 005 6 GO:0008514 organic anion transmembrane transporter activity F 1,29E 002 9,21E 005 5 GO:0010638 positive regulation of organelle organization P 1,30E 002 9,43E 005 7 GO:0006950 response to stress P 1,30E 002 9,63E 005 49 GO:0010090 trichome morphogenesis P 1,32E 002 9,91E 005 7 GO:0050896 response to stimulus P 1,36E 002 1,04E 004 75 GO:0030041 actin filament polymerization P 1,39E 002 1,09E 004 6 GO:0007275 multicellular organismal development P 1,39E 002 1,10E 004 43 GO:0051130 positive regulation of cellular component organization P 1,50E 002 1,21E 004 7 GO:0043225 anion transmembrane transporting ATPase activity F 1,51E 002 1,30E 004 5 GO:0009555 pollen development P 1,51E 002 1,30E 004 9 GO:0030833 regulation of actin filament polymerization P 1,51E 002 1,31E 004 6 GO:0032501 multicellular organismal process P 1,51E 002 1,36E 004 45 GO:0030832 regulation of actin filament length P 1,51E 002 1,39E 004 6 GO:0032970 regulation of actin filament based process P 1,51E 002 1,39E 004 6 GO:0032956 regulation of actin cytoskeleton organization P 1,51E 002 1,39E 004 6 GO:0008064 regulation of actin polymerization or depolymerization P 1,51E 002 1,39E 004 6 GO:0006810 transport P 1,51E 002 1,40E 004 45 GO:0043254 regulation of protein complex assembly P 1,54E 002 1,47E 004 6 GO:0032271 regulation of protein polymerization P 1,54E 002 1,47E 004 6 GO:0044248 cellular catabolic process P 1,54E 002 1,48E 004 30 GO:0010026 trichome differentiation P 1,63E 002 1,60E 004 7 GO:0016051 carbohydrate biosynthetic process P 1,84E 002 1,85E 004 18 GO:0051493 regulation of cytoskeleton organization P 1,84E 002 1,85E 004 6 GO:0042545 cell wall modification P 1,89E 002 1,93E 004 9 GO:0005986 sucrose biosynthetic process P 1,89E 002 2,02E 004 3 GO:0000084 S phase of mitotic cell cycle P 1,89E 002 2,12E 004 2 GO:0006059 hexitol metabolic process P 1,89E 002 2,12E 004 2 GO:0051320 S phase P 1,89E 002 2,12E 004 2 GO:0019594 mannitol metabolic process P 1,89E 002 2,12E 004 2

PAGE 12

GO:0019593 mannitol biosynthetic process P 1,89E 002 2,12E 004 2 GO:0019406 hexitol biosynthetic process P 1,89E 002 2,12E 004 2 GO:0019401 alditol biosynthetic process P 1,89E 002 2,12E 004 2 GO:0051234 establishment of localization P 1,98E 002 2,25E 004 45 GO:0008154 actin polymerization or depolymerization P 2,00E 002 2,30E 004 6 GO:0006200 ATP catabolic process P 2,02E 002 2,35E 004 8 GO:0071704 organic substance metabolic process P 2,26E 002 2,66E 004 30 GO:0005985 sucrose metabolic process P 2,70E 002 3,23E 004 11 GO:0042623 ATPase activity, coupled F 2,70E 002 3,24E 004 13 GO:0044087 regulation of cellular component biogenesis P 2,84E 002 3,46E 004 6 GO:0006073 cellular glucan metabolic process P 2,84E 002 3,48E 004 15 GO:0009888 tissue development P 3,13E 002 3,88E 004 17 GO:0015711 organic anion transport P 3,26E 002 4,09E 004 5 GO:0015860 purine nucleoside transport P 3,29E 002 4,21E 004 2 GO:0047274 galactinol sucrose galactosyltransferase activity F 3,29E 002 4,21E 004 2 GO:0070588 calcium ion transmembrane transport P 3,40E 002 4,41E 004 3 GO:0003824 catalytic activity F 3,40E 002 4,44E 004 108 GO:0006754 ATP biosynthetic process P 3,47E 002 4,63E 004 5 GO:0005975 carbohydrate metabolic process P 3,47E 002 4,63E 004 31 GO:0009642 response to light intensity P 3,60E 002 4,85E 004 8 GO:0031224 intrinsic to membrane C 3,78E 002 5,14E 004 28 GO:0019400 alditol metabolic process P 3,79E 002 5,20E 004 3 GO:0051258 protein polymerization P 3,80E 002 5,27E 004 6 GO:0048878 chemical homeostasis P 3,80E 002 5,32E 004 8 GO:0044459 plasma membrane part C 4,12E 002 5,82E 004 8 GO:1901135 carbohydrate derivative metabolic process P 4,17E 002 5,94E 004 27 GO:0009206 purine ribonucleoside triphosphate biosynthetic process P 4,24E 002 6,21E 004 5 GO:0009201 ribonucleoside triphosphate biosynthetic process P 4,24E 002 6,21E 004 5 GO:0009145 purine nucleoside triphosphate biosynthetic process P 4,24E 002 6,21E 004 5 GO:0009628 response to abiotic stimulus P 4,24E 002 6,30E 004 34 GO:0007015 actin filament organization P 4,24E 002 6,55E 004 6 GO:0009142 nucleoside triphosphate biosynthetic process P 4,24E 002 6,57E 004 5 GO:0046700 heterocycle catabolic process P 4,24E 002 6,59E 004 13 GO:0000904 cell morphogenesis involved in differentiation P 4,24E 002 6,66E 004 9 GO:0045087 innate immune response P 4,24E 002 6,70E 004 13 GO:0044270 cellular nitrogen compound catabolic process P 4,24E 002 6,70E 004 13 GO:0045543 gibberellin 2 beta dioxygenase activity F 4,24E 002 6,98E 004 2 GO:0030894 replisome C 4,24E 002 6,98E 004 2 GO:0043601 nuclear replisome C 4,24E 002 6,98E 004 2 GO:0043596 nuclear replication fork C 4,24E 002 6,98E 004 2 GO:0046173 polyol biosynthetic process P 4,24E 002 6,98E 004 2 GO:0044264 cellular polysaccharide metabolic process P 4,24E 002 6,98E 004 16 GO:0007010 cytoskeleton organization P 4,24E 002 7,00E 004 11 GO:0009205 purine ribonucleoside triphosphate metabolic process P 4,25E 002 7,18E 004 12 GO:0009199 ribonucleoside triphosphate metabolic process P 4,25E 002 7,18E 004 12 GO:0009144 purine nucleoside triphosphate metabolic process P 4,25E 002 7,18E 004 12

PAGE 13

GO:0006873 cellular ion homeostasis P 4,28E 002 7,43E 004 6 GO:0032535 regulation of cellular component size P 4,28E 002 7,43E 004 6 GO:0090066 regulation of anatomical structure size P 4,28E 002 7,43E 004 6 GO:0009141 nucleoside triphosphate metabolic process P 4,28E 002 7,45E 004 12 GO:0008509 anion transmembrane transporter activity F 4,32E 002 7,59E 004 7 GO:0009913 epidermal cell differentiation P 4,42E 002 7,82E 004 10 GO:0008544 epidermis development P 4,49E 002 7,99E 004 10 GO:0048522 positive regulation of cellular process P 4,62E 002 8,29E 004 15 GO:0005984 disaccharide metabolic process P 4,65E 002 8,46E 004 12 GO:0015672 monovalent inorganic cation transport P 4,65E 002 8,54E 004 9 GO:0055044 symplast C 4,65E 002 8,64E 004 14 GO:0009506 plasmodesma C 4,65E 002 8,64E 004 14 GO:0044042 glucan metabolic process P 4,65E 002 8,66E 004 15 GO:0048518 positive regulation of biological process P 4,65E 002 8,71E 004 16 GO:0005911 cell cell junction C 4,69E 002 8,91E 004 14 GO:0071555 cell wall organization P 4,69E 002 8,92E 004 12 GO:0030054 cell junction C 4,69E 002 9,04E 004 14 GO:0009694 jasmonic acid metabolic process P 4,69E 002 9,05E 004 5 GO:0055082 cellular chemical homeostasis P 4,69E 002 9,09E 004 6 GO:0009814 defense response, incompatible interaction P 4,70E 002 9,18E 004 9 GO:0010053 root epidermal cell differentiation P 4,93E 002 9,70E 004 8 GO:0006955 immune response P 4,94E 002 9,84E 004 13 GO:0005773 vacuole C 4,94E 002 9,87E 004 18 GO:0008324 cation transmembrane transporter activity F 4,94E 002 9,92E 004 12

PAGE 14

Table S5 QTL decalactone and eQTL controlling the expres s i on of FaFAD1 FaFAH1 and FaCYP1 based on Kruskal Wallis (K W) and interval mapping (IM). The position of the LOD peak (in cM) and the most closely associated mark er locus is indicated. The estimated mean effect o f the QTL (mu) associated with each of the genotyp es (ac, ad, bc, bd) with phase type {00} and the data transformation used in the analysis is also indicated. QTL Year K W a Location Thr b LOD Position Closest marker R (%) c mu_ac{00} mu_ad{00} mu_bc{00} mu_bd{00} Transf. Decalactone 2007 **** III 2 14.7 26.02 72.493 BF45175cIII 84.4 0.017 0.802 0.029 2.795 Decalactone 2008 **** III 2 9.3 21.52 69.644 BF45175cIII 92.8 0.023 1.392 0.032 3.571 Decalactone 2009 **** III 2 15.3 29.75 70.644 BF45175cIII 89.9 0.029 2.800 0.032 1.401 eFaFAD1 2009 **** III 2 7.8 29.88 71.644 BF45175cIII 90 9.106 0.204 4.346 0.163 1/SQRT eFaFAD1 2009 **** III 2 12.5 25.46 72.493 BF45175cIII 85 0.100 157.514 0.153 40.884 eFaFAH1 2009 **** III 2 4.5 8.17 64.644 BF45175cIII 55.4 1.140 0.278 0.385 1.217 Ln eFaCYP1 2009 **** III 1 4.7 13.86 5 ChFv233 218 55 1.696 1.236 0.762 1.310 Ln a Significance level of Kruskal Wallis test. *, p<0.005; **, p<0.001; ***, p<0.0005; ****, p<0.0001. b LOD threshold. c Percentage of the variance explained by the QTL. Table S6 Expression of gene24414 v1.0 hybrid in each of the biological replicates by three different approaches DEC 1 DEC 2 DEC 3 DEC 1 DEC 2 DEC 3 DEC DEC Ratio Log2ratio Using reference genome (FPKM) 483.69 464.52 471.99 28.69 10.33 7.33 325.92 11.41 28.56 4.84 de novo assembly (FPKM) 497.45 463.4 485.01 29.49 9.78 6.83 481.95 15.37 31.36 4.97 qRT PCR ( relative expression ) 88.44 113.77 71.01 6.99 1 0.99 91.07 2.99 30.43 4.93 *The final expression in each pool is lower than the average expression of the replicates because by mapping to the reference genome, cuffdiff uses the F. vesca predicted gene 24414 (which is longer than the F. x ananassa transcript) to quantify the expression as Fragments Per Kilobase of exon per Million fragments mapped (FPKM)