Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR

MISSING IMAGE

Material Information

Title:
Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR
Physical Description:
Mixed Material
Language:
English
Creator:
Kogenaru, Sunitha
Yan, Qing
Riera, Nadia
Roper, M Caroline
Deng, Xiaoling
Ebert, Timothy A.
Rogers, Michael
Publisher:
BioMed Central (BMC Microbiology)
Publication Date:

Notes

Abstract:
Background: Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results: We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions: We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. Keywords: Detection system, Diagnostic, Candidatus Liberibacter asiaticus, Greening, Huanglongbing, Bacteria, Psyllid, Citrus
General Note:
Kogenaru et al. BMC Microbiology 2014, 14:39 http://www.biomedcentral.com/1471-2180/14/39; Pages 1-11
General Note:
doi:10.1186/1471-2180-14-39 Cite this article as: Kogenaru et al.: Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR. BMC Microbiology 2014 14:39.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
© 2014 Kogenaru et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Resource Identifier:
System ID:
AA00021510:00001

Full Text



PAGE 1

1471-2180-14-39-S2.TXT #!/usr/bin/perl -w #---------------------------------------------------------------------------------# Title : script-2.pl # Function : Parse the blast output files to find unique sequences # Version : 1.0 # Comments : Kogenaru et al. Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR #---------------------------------------------------------------------------------use strict; # Global variables my $options = ""; # users input options my $infile = ""; # database file my $outfile = "unique_seq"; # output file my $help = Read in the BLAST output files present in the current working directory and parse them to find unique sequences and write them to a outfile called unique_seq usage: script-2.pl Example: script-2.pl *.blast '; # Processing command line options if (scalar(@ARGV)<1) {die $help;} # Extra safety if ($ARGV[0] eq "") {die $help;} my $blast_files = ''; # store in all the files in the given directory # reads all the *.blast file from the directory and store then in string variable for (my $i=0; $i<@ARGV; $i++) { $blast_files .= $ARGV[$i] "; } # end of for (my $i=0; $i<@ARGV; $i++) { my @files = glob("$blast_files"); #read all such files into @files my $blast_files_nr = scalar(@files); # counts the number of files read printf(STDERR "Found %i BLAST output files...\n",$blast_files_nr); # open file for writing output open (OUT, ">$outfile") || die ("WARNING: could not open the $outfile: $!\n"); #Handle one by one files foreach $infile (@files) { # variables for each blast output file my $blast_output = ""; # store the whole blast output in line my @blast_array = ""; # store each entry in array my $query_id = ""; # store the query ID my $hlb = ""; # if hlb hit found my $non_hlb = ""; # if non hlb hit found # parese only querey ID from $infile if ($infile =~ /([-\w+]+).blast/){$query_id = $1;} # Open the current file open (IN, "<$infile") || die ("WARNING: could not open the $infile: $!\n"); while (defined(my $line = )){ # retrieve file, line by line $blast_output .= $line; Page 1

PAGE 2

1471-2180-14-39-S2.TXT }# End of the while loop close (IN); # store each hit in an array @blast_array = split(/>/, $blast_output); shift (@blast_array); # removes hit least information # process hit by hit for each blast output foreach my $hits (@blast_array) { # variables my $gi = ""; # gi number my $org = ""; # organism name #process each hit if ($hits =~/^gi\|(\d+)\|(\w+)\|(\w+).(\d+)\|(.*)/){ $gi = $1; $org = $5; if($org =~/ Candidatus Liberibacter asiaticus str./){ $hlb = "yes"; } else { $non_hlb = "no"; } } # end of if ($hits =~/Cand } # end of foreach my $hits (@blast_array) { #check if the hit found only in hlb then write to file if ($hlb eq "yes" && $non_hlb eq ""){ printf (OUT "$query_id\n"); } } # end of foreach $infile (@files) { close(OUT); Page 2


#!/usr/bin/perl -w
#----------------------------------------------------------------------------------
# Title : script-1.pl
# Function : Reads in multiple gene sequences in FASTA format and runs blast for each entry against chosen database
# Version : 1.0
# Comments : Kogenaru et al. Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR
#----------------------------------------------------------------------------------
use strict;

# Global variables
my $options = ""; # users input options
my $infile = ""; # input fasta file
my $dbfile = ""; # database file to search
my $instring = ""; # put infile in one string
my @inarray = ""; # store each entry in array
my %unique=(); # unique names

my $help = '
Read in the input FASTA file containing multiple entries and run blast for each entry against database specified.
The blast options are hard coded in the script

usage: script-1.pl -i -d

Example: script-1.pl -i Las.fa -d nt.fa
';

# Processing command line options
if (@ARGV<1) {die $help;}

# if input file is given without -i option: insert -i before the file name
if ($ARGV[0]!~/^-/) {unshift(@ARGV,"-i");}

foreach my $argv (@ARGV){
$options .= "$argv ";
} #-- end of foreach loop

# Set options
if ($options =~ s/-i\s+(\S+)//g) {$infile = $1;}
if ($options =~ s/-d\s+(\S+)//g) {$dbfile = $1;}

# Warn if unknown options found
if ($options !~ /^\s*$/) {
$options =~ s/^\s*(.*?)\s*$/$1/g;
printf ("WARNING: unknown options '$options'\n");
} #-- end of if loop

# Extra safety
if ($infile eq "" && $dbfile eq "") {die $help;}

# Handling the input file
open (IN, "<$infile") || die ("WARNING: could not open the $infile: $!\n");
while (defined(my $inline = )){ # retrieve file,line by line
$instring .= $inline; # append lines
} #-- End of the second while loop
close (IN);

@inarray = split(/>/, $instring); # split on fasta > character
shift (@inarray); # removes the empty element
my $seq_nr = @inarray;
my $count = 0;
my $entry_name = ""; # each entry name

# print number of sequence found in the input multifasta file
printf(STDERR "\nFound %i sequences in the input file: %s\n\n",$seq_nr,$infile);

foreach my $seq (@inarray) { # split each seq

#>ref|NC_012985.2|:36-407 hypothetical protein CLIBASIA_00005 [Candidatus Liberib acter asiaticus str. psy62]
if ($seq =~/^\s*(\w+)\|(\w+).(\d+)\|:([-\w+]+)/){ #110703 MK
$entry_name = $4;
$unique{$4}="defined"; #110704 mk
} #-- if ($seq =~

my $tempin = "$entry_name" ".seq";
my $blastout = "$entry_name" ".blast";

open(TMP,">$tempin") or die ("WARNING: could not write $tempin: $!\n");
printf (TMP ">$seq"); # write the entry into temp file for blast
close (TMP);

# calling blast program: blastall -p blastn -d dbfile -i infile -o outfile -a 10
&syscall (" blastall -p blastn -d $dbfile -i $tempin -o $blastout -e 1e-3 -a 10"); #110707 sk
$count++;
printf(STDERR "BLAST searches done for %i of %i\n",$count,$seq_nr);
&syscall ("rm -rf $tempin");
} #-- end of foreach my $seq

# count unique sequence file names found
my @keys = keys %unique;
my $size = @keys;

printf(STDERR "\nFound %i unique sequences in the input file: %s\n\n",$size,$infile);

printf(STDERR "\nSearching done!....\n\n");

# subroutine to call system commands
sub syscall {
my $cmd=$_[0];
printf("exec: '$cmd'\n");
return system($cmd)/256;
}





PAGE 1

1471-2180-14-39-S1.TXT #!/usr/bin/perl -w #---------------------------------------------------------------------------------# Title : script-1.pl # Function : Reads in multiple gene sequences in FASTA format and runs blast for each entry against chosen database # Version : 1.0 # Comments : Kogenaru et al. Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR #---------------------------------------------------------------------------------use strict; # Global variables my $options = ""; # users input options my $infile = ""; # input fasta file my $dbfile = ""; # database file to search my $instring = ""; # put infile in one string my @inarray = ""; # store each entry in array my %unique=(); # unique names my $help = Read in the input FASTA file containing multiple entries and run blast for each entry against database specified. The blast options are hard coded in the script usage: script-1.pl -i -d Example: script-1.pl -i Las.fa -d nt.fa '; # Processing command line options if (@ARGV<1) {die $help;} # if input file is given without -i option: insert -i before the file name if ($ARGV[0]!~/^-/) {unshift(@ARGV,"-i");} foreach my $argv (@ARGV){ $options .= "$argv "; } #-end of foreach loop # Set options if ($options =~ s/-i\s+(\S+)//g) {$infile = $1;} if ($options =~ s/-d\s+(\S+)//g) {$dbfile = $1;} # Warn if unknown options found if ($options !~ /^\s*$/) { $options =~ s/^\s*(.*?)\s*$/$1/g; printf ("WARNING: unknown options '$options'\n"); } #-end of if loop # Extra safety if ($infile eq "" && $dbfile eq "") {die $help;} # Handling the input file open (IN, "<$infile") || die ("WARNING: could not open the $infile: $!\n"); while (defined(my $inline = )){ # retrieve file,line by line $instring .= $inline; # append lines } #-End of the second while loop close (IN); @inarray = split(/>/, $instring); # split on fasta > character shift (@inarray); # removes the empty element my $seq_nr = @inarray; Page 1

PAGE 2

1471-2180-14-39-S1.TXT my $count = 0; my $entry_name = ""; # each entry name # print number of sequence found in the input multifasta file printf(STDERR "\nFound %i sequences in the input file: %s\n\n",$seq_nr,$infile); foreach my $seq (@inarray) { # split each seq #>ref|NC_012985.2|:36-407 hypothetical protein CLIBASIA_00005 [Candidatus Liberib acter asiaticus str. psy62] if ($seq =~/^\s*(\w+)\|(\w+).(\d+)\|:([-\w+]+)/){ #110703 MK $entry_name = $4; $unique{$4}="defined"; #110704 mk } #-if ($seq =~ my $tempin = "$entry_name" ".seq"; my $blastout = "$entry_name" ".blast"; open(TMP,">$tempin") or die ("WARNING: could not write $tempin: $!\n"); printf (TMP ">$seq"); # write the entry into temp file for blast close (TMP); # calling blast program: blastall -p blastn -d dbfile -i infile -o outfile -a 10 &syscall (" blastall -p blastn -d $dbfile -i $tempin -o $blastout -e 1e-3 -a 10"); #110707 sk $count++; printf(STDERR "BLAST searches done for %i of %i\n",$count,$seq_nr); &syscall ("rm -rf $tempin"); } #-end of foreach my $seq # count unique sequence file names found my @keys = keys %unique; my $size = @keys; printf(STDERR "\nFound %i unique sequences in the input file: %s\n\n",$size,$infile); printf(STDERR "\nSearching done!....\n\n"); # subroutine to call system commands sub syscall { my $cmd=$_[0]; printf("exec: '$cmd'\n"); return system($cmd)/256; } Page 2



PAGE 1

Table S1. Custom designed primer pairs specific to the unique sequences of Las identified by bioinformatic analysis. Primer pairs Target gene locus# PCR product Primer se quence (5’ to 3’) Size (bp) GC content % Forward primer (f) Reverse primer (r) P1 CLIBASIA_05555 157 43.31 TTGAATATGACGGTGGGTCTCGCA ACTTCTCTTTGGCCTCACTGAGCA P2 CLIBASIA_04315 86 38.3 GGGTATAAGCAC TTAGGCTTTAAGAAACC TCACGTCGTAAAGACATCCTGCCT P3 CLIBASIA_05575 156 44.87 TCTGGCAGTAAGGGCGATGAACTT ATGCATCCAATGAATGGTGCTCGC P4 CLIBASIA_05465 95 41.05 ATGCGAATGGGATAGGAGCGGTTA AGCCACACTACTTCGTTGACCCAA P5 CLIBASIA_01460 96 42.7 AGGCCTTCAT CGCACTGAATCT CATG CGACTGTGATCCCATAATCC P6 CLIBASIA_05145 133 35.33 TGAAGAGTTTA GTTCGCGACTACTT CCTCTA CCCACATTAGCT TTGTGCT P7 CLIBASIA_05545 104 45.19 TGAGTGTTGATAAGCTCCGTGCGA AAGCGGTGTTCCGTCGATATCCTT P8 CLIBASIA_05560 96 51.04 ACACCCGCAAC GCCTATAAAGGTA TAGC TCTGTGCCATCCTGCTTCTT P9 CLIBASIA_02025 83 48.19 TCTGTAGCCTGT ACATCGGAAACG AAACTGACGCCTCGAGAAGCAGCAA P10 CLIBASIA_05605 100 49 TTCGGTTCATCG CTATCCAGTGGT TATATA AACCTGCTGCTCCGCCCA P11 CLIBASIA_03090 128 33.59 ATGCAACGAC TTATCGAGATTC TTGACCA ATGCTATTGGAATATCTC P12 CLIBASIA_03875 150 31. 33 GGGTTTCGTTTTTGGGTATCAC C TTACAAAAAAAGGTC ATTTGAAAATC P13 CLIBASIA_02305 86 50 AGCCAAGCAGTCT AGGGACGATTT TTGCCAACATCAACATATCGGCGG P14 CLIBASIA_05495 164 43.29 ATGAAGCGTACTGGCCGATATCCA TCCGTAACCTCTTGAACGTGACGA P15 CLIBASIA_02660 97 43.29 CGAAAGTTATCTGAGAAGGAGAGC TCAGGTATGCACCTGTGCTTGTAG P16 CLIBASIA_02715 85 43.52 GTCGATGAATTAAACTCGATATCCTCTCG CATGAGGATGCACGACTAGATCAGA P17 CLIBASIA_03110 87 45.97 TGCTGTAGCTATTATTGCCGCCGT TGGTGAGACATCTGGTTTGCGACT P18 CLIBASIA_03675 93 43. 01 GGGAAAGATTTCACACGGTATCGG AGGGCTATACGGACTACAACCCTA P19 CLIBASIA_03725 84 48.8 ACAGGATGTGAACAGGAAGTAGGG GCGATCTTTCCAGTCACTAAATTGACCC P20 CLIBASIA_03955 152 36.84 CAATTGCAACAACTGCGAGCAACG ATTCTTTGGCGTGCAGACTTAGCC P21 CLIBASIA_04030 103 51.45 TCCAGTATTTGCAATGGGCACAGC AAGAGCGACGGGAGCAGGAGGGATA P22 CLIBASIA_04150 80 33.75 ATGGATTACCCTTGTAACAAAGAA TTCTGTGCTCGCATATCTCCTAGT P23 CLIBASIA_04310 133 36.84 GTCCAATTTA TTCCCTCTCACCCG ACGATC GCTTTAGATCCCGTGGAA P24 CLIBASIA_04330 141 40.42 AGCGGTATGGAAAGGAGATTCGGA AGATATTGAGCCGCTCGTAACGCT P25 CLIBASIA_04405 187 41.17 CGACTCTTCTTA CAATCGGTGGTTG GCGCGTTCTTCGACTTCTTTCACT P26 CLIBASIA_04425 80 46.25 GTAACGTGCTGA ACCTGTATGATGCG TGCGCACGTTGCTATACGTTCTTC P27 CLIBASIA_02645 97 40.2 AAGTGCTAAGGCTTTACACGAGCG TTCCAGAAGAGAGCTAGCAATTC P28 CLIBASIA_04515 185 30.8 CAGGCGTAAGTAT GTATTAACAGCG CCCTACGT CCCATAGATACTGATGCT P29 CLIBASIA_04530 101 46.53 TGAGTGGGTG TTCCGAGACTTTAG TCCTCCGATGGGTTGATCAGCTTT P30 CLIBASIA_04550 162 41.97 CCCATTGGCG TTCTTGATTCTCCA AGAG CTGAGACGCATATCCTCCAT P31 CLIBASIA_05230 98 40.81 GATGGGACAAC GCAACCAATTGAC TGCGTCGGTTCTTTCCCATTCCTA P32 CLIBASIA_05480 86 50 CACGATGGCGCAAATCGAAGCTAA TCCTAAAGCACCTAAGGGAAGGGA P33 CLIBASIA_04475 106 40.56 TGCATCGGAGG GATGAGATGGATT CCCTCACCCA TACCGATAAGGATAGGATT

PAGE 2

P34 CLIBASIA_05505 172 42.44 TCATTAACC AGCGAGGTTGTCCTG ACTTCCTCCGTAGAACTCAGAACC # the target gene locus of each primer pair as indicated in the reference strain Candidatus Liberibacter asiaticus psy62.


#!/usr/bin/perl -w
#----------------------------------------------------------------------------------
# Title : script-2.pl
# Function : Parse the blast output files to find unique sequences
# Version : 1.0
# Comments : Kogenaru et al. Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR
#----------------------------------------------------------------------------------

use strict;

# Global variables
my $options = ""; # users input options
my $infile = ""; # database file
my $outfile = "unique_seq"; # output file

my $help = '
Read in the BLAST output files present in the current working directory and parse them to find unique sequences and write them to a outfile called unique_seq

usage: script-2.pl

Example: script-2.pl *.blast
';

# Processing command line options
if (scalar(@ARGV)<1) {die $help;}

# Extra safety
if ($ARGV[0] eq "") {die $help;}

my $blast_files = ''; # store in all the files in the given directory

# reads all the *.blast file from the directory and store then in string variable
for (my $i=0; $i<@ARGV; $i++) {
$blast_files .= $ARGV[$i] ";
} # end of for (my $i=0; $i<@ARGV; $i++) {

my @files = glob("$blast_files"); #read all such files into @files
my $blast_files_nr = scalar(@files); # counts the number of files read

printf(STDERR "Found %i BLAST output files...\n",$blast_files_nr);

# open file for writing output
open (OUT, ">$outfile") || die ("WARNING: could not open the $outfile: $!\n");

#Handle one by one files
foreach $infile (@files) {

# variables for each blast output file
my $blast_output = ""; # store the whole blast output in line
my @blast_array = ""; # store each entry in array
my $query_id = ""; # store the query ID
my $hlb = ""; # if hlb hit found
my $non_hlb = ""; # if non hlb hit found
# parese only querey ID from $infile
if ($infile =~ /([-\w+]+).blast/){$query_id = $1;}

# Open the current file
open (IN, "<$infile") || die ("WARNING: could not open the $infile: $!\n");
while (defined(my $line = )){ # retrieve file, line by line
$blast_output .= $line;
}# End of the while loop
close (IN);

# store each hit in an array
@blast_array = split(/>/, $blast_output);
shift (@blast_array); # removes hit least information

# process hit by hit for each blast output
foreach my $hits (@blast_array) {

# variables
my $gi = ""; # gi number
my $org = ""; # organism name

#process each hit
if ($hits =~/^gi\|(\d+)\|(\w+)\|(\w+).(\d+)\|(.*)/){
$gi = $1;
$org = $5;
if($org =~/ Candidatus Liberibacter asiaticus str./){
$hlb = "yes";
}
else {
$non_hlb = "no";
}
} # end of if ($hits =~/Cand
} # end of foreach my $hits (@blast_array) {

#check if the hit found only in hlb then write to file
if ($hlb eq "yes" && $non_hlb eq ""){
printf (OUT "$query_id\n");
}
} # end of foreach $infile (@files) {
close(OUT);



PAGE 1

RESEARCHARTICLEOpenAccessRepertoireofnovelsequencesignaturesforthe detectionof Candidatus Liberibacterasiaticusby quantitativereal-timePCRSunithaKogenaru1,2,QingYan1,NadiaRiera1,MCarolineRoper3,XiaolingDeng4,TimothyAEbert5, MichaelRogers5,MichaelEIrey6,GerhardPietersen7,CharlesMRush8andNianWang1*AbstractBackground: Huanglongbing(HLB)orcitrusgreeningisadevastatingdiseaseofcitrus.Thegram-negativebacterium Candidatus Liberibacterasiaticus(Las)belongingtothe -proteobacteriaisresponsibleforHLBinNorthAmericaaswell asinAsia.Currently,thereisnocureforthisdisease.EarlydetectionandquarantineofLas-infectedtreesareimportant managementstrategiesusedtopreventHLBfrominvadingHLB-freecitrusproducingregions.Quantitativereal-time PCR(qRT-PCR)basedmoleculardiagnosticassayshavebeenroutinelyusedinthedetectionanddiagnosisofLas.The oligonucleotideprimerpairsbasedonconservedgenesorregions,whichinclude16SrDNAandthe -operon,have beenwidelyemployedinthedetectionofLasbyqRT-PCR.TheavailabilityofwholegenomesequenceofLas nowallowsthedesignofprimersbeyondtheconservedregionsforthedetectionofLasexplicitly. Results: Wetookacomplimentaryapproachbysystematical lyscreeningthegenesinagenome-widefashion, toidentifytheuniquesignaturesthatareonlypresenti nLasbyanexhaustivesequencebasedsimilaritysearch againstthenucleotidesequencedata base.Oursearchresultedin34probableuniquesignatures.Furthermore, bydesigningtheprimerpairspecifictotheidentifiedsignatures,weshowedthatmostofourprimersetsare abletodetectLasfromtheinfectedplantandpsyllidmat erialscollectedfromtheUSAandChinabyqRT-PCR. Overall,18primerpairsofthe34arefoundtobehighlyspecifictoLaswithnocrossreactivitytothecloselyrelated species Ca .L.americanus(Lam)and Ca. L.africanus(Laf). Conclusions: WehavedesignedqRT-PCRprimersbasedonLasspecificgenes.Amongthem,18aresuitableforthe detectionofLasfromLas-infectedplantandpsyllidsamples.Therepertoireofprimersthatwehavedevelopedand characterizedinthisstudyenhancedtheqRT-PCRbasedmoleculardiagnosisofHLB. Keywords: Detectionsystem,Diagnostic, Candidatus Liberibacterasiaticus,Greening,Huanglongbing,Bacteria,Psyllid, CitrusBackgroundHuanglongbing(HLB)orcitrusgreeningisthemost devastatingdiseaseofcitrus,threateningthecitrusindustryworldwide,andleadingtomassivereductionin fruitproductionaswellasdeathofinfectedtrees[1]. ThecausalagentsofHLBarethreecloselyrelatedgramnegative,phloem-limited -proteobacteria Candidatus Liberibacterspecies[2,3].Theheattolerantstrain Ca. L. asiaticus(Las)isthemostwidespreadinAsiaaswellas intheUSAwhereas Ca. L.americanus(Lam)ismostly limitedtoSouthAmerica[2-4]. Ca. L.africanus(Laf)is heatsensitiveandlocalizedtotheAfricancontinent.All thethreeLiberibacterspeciesarecurrentlyuncultured andareknowntoresideinthesievetubesoftheplant phloem[5]orinthegutofthephloem-feedingpsyllids[6].Psyllidsarethenaturalvectorsintransmittingthebacteriabetweenplants[1,6].TheAsian psyllid, Diaphorinacitri Kuwayama(Homoptera:Psyllidae) isresponsiblefortransmittingLasandLaminAsiaand America,whiletheAfricancitruspsyllid, Triozaerytreae *Correspondence: nianwang@ufl.edu1CitrusResearchandEducationCenter,DepartmentofMicrobiologyandCell Science,IFAS,UniversityofFlorida,LakeAlfred33850,USA Fulllistofauthorinformationisavailableattheendofthearticle 2014Kogenaruetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycredited.TheCreativeCommonsPublicDomain Dedicationwaiver(http://creativecommons.org/publicdomain/zero/1.0/)appliestothedatamadeavailableinthisarticle, unlessotherwisestated.Kogenaru etal.BMCMicrobiology 2014, 14 :39 http://www.biomedcentral.com/1471-2180/14/39

PAGE 2

DelGuercio(Homoptera:Psyllidae),isthenaturalvector ofLafinAfrica[7].Thecharacteristicsymptomsoftheinfectedplantsincludetheyellowshoots,foliarblotchymottles,alongwithpoorfloweringandstunting[1].HLBalso resultsinpoorlycolored,unpleasanttasting,reducedsize fruitthatshowsstainingofvascularcolumellaandseed abortion[1].Generallythefruitmayremainpartiallygreen, forthisreasonHLBisalsocalledcitrusgreening[1]. Chronicallyinfectedtreesaresparselyfoliatedanddisplay extensivetwigorlimbdie-backandeventuallydiewithin threetofiveyears[1].Moreover,thedisordersinducedin diseasedplantsvarywithcultivar,treematurity,timeofinfection,stagesofdiseaseandotherabioticorbioticagents thataffectthetree[1].HLBsymptomsalsosharecertain similaritiestonutrientdefici ency[1],citrusstubborndiseasecausedby Spiroplasmacitri [8]andaHLB-likedisease causedbyaphytoplasma[9,10].EarlydiagnosisanddifferentiationofLasinfectionsfromthosedefectsandagents mentionedabove,isthuscriticaltoreducingthespread anddevastationofthisdiseaselocallyandviainternational trade,aswellasminimizingtheeconomicimpactofpotentialfalsepositivediagnoses. Importantly,HLBandtheAsiancitruspsyllid( D.citri ) areexpandingtonewcitrusproductionareas.Currently, AsiancitruspsyllidhasbeenfoundinFlorida,Texas, California,Arizona,Hawaii,Louisiana,Georgia,and AlabamaintheUSA,aswellasinpartsofSouthand CentralAmerica,Mexico,andtheCaribbean.Meanwhile, HLBhasnotonlybeenidentifiedinFlorida,Louisiana, SouthCarolina,Louisiana,Georgia,TexasandCalifornia oftheUSA;ithasalsobeendiscoveredinCuba,Belize, Jamaica,Mexico,andothercountriesintheCaribbean [11].WhileHLBand D.citri havebeenfoundindifferent producingareas,thenumberofinfectedtreesandthe psyllidvectorpopulationvarydramaticallyamongdifferentregions.Thus,differentstrategiesofmanagementofHLBarerecommendedfordifferentregions, accordingtothecorrespondingseverityofHLBand occurrenceofpsyllidvectors. Currently,noefficientmanagementstrategyisavailabletocontrolHLB.FortherecentlyLas-infectedcitrus producingareassuchasCalifornia,preventionand eradicationofHLBarethemostefficientandcosteffectiveapproaches.Additionally,Lasinfectedtreesare mostoftenfoundtobeasymptomaticduringtheearly stageofinfection.Thus,accurateearlydetectionofLas incitrusplantsandpsyllidsiscriticalforenactingcontainmentmeasuresinnon-endemiccitrusproducing areas.ForthecitrusproducingareaswithoutHLB, suchastheMediterraneanregion,accuratedetection iscriticalforthesuccessofquarantinemeasures against Ca .Liberibacter. Methodssuchasbiologicalindexingusinggraft,dodder transmission[12],isothermalloopamplification(LAMP) [13],electronmicroscopy[1],DNAprobes[14],enzymelinkedimmunosorbentassays(ELISA)[15],conventional PCR[16-22]andquantitativereal-timePCR(qRT-PCR) [22-26]areusedforthediagnosisandconfirmationof HLB.AlthoughdiagnostictoolslikeconventionalPCR andLAMPshowedgoodsensitivity,theywerenotconsistentindetectionofLasbacteriumfrominfectedplantand psyllidmaterials[6,13,25].ThecurrentHLBdiagnosticdetectionmainlyemploysqRT-PCRbasedmethodsdueto theirsensitiveandquantitativenature.TheinitialqRTPCRoligonucleotideprimersetsforthedetectionofLas, targeted rplKAJL-rpoBC operon( -operon:CQULA04f/r) [26],16SribosomalRNAgene(rDNA)(HLBasf/r)[23], EUB338f/EUB518r[27],ALF518f/EUB518r[27]orspeciesspecificvariableregions.EUB338f/EUB518rprimers areuniversaltoEubacteria[27],whileALF518f/EUB518r primersidentify -proteobacteriauniversally[27]includingLas,thereforenotspecific.Furthermore,theprimers basedontheconserved16Sand -operonregionsare popularbutneverthelesshavebeenshowntoposeapotentialspecificityissue,asbothfalsenegativesandfalse positiveshavebeenreported[28].Therefore,effortshave beendirectedtowardsdevelopingeffectiveqRT-PCR primersthattargetothernon-conservedsequences.Recentstudiesmadeuseofintragenicrepeatregionsofthe prophagesequenceforthedetectionofLasbyqRT-PCR [25].However,theintragenicrepeatregionsoftheprophagesequencewerealsoidentifiedinLam.Therefore, theseprimerpairs,hyvi/hyviididnotdistinguishbetween LasandLam,posingaspecificityissue[25].Consequently, primerpairsthatspecificallydetectLasandmakeclear distinctionamongotherphylogeneticallycloselyrelated bacteriaareessential. Herewetookacomplimentaryapproachtoidentify thegenesthatareuniquetoLasbyabioinformaticanalysiswiththegoalofexpandingthearsenaloftoolsfor Lasdetection.TheadvancementinthegenomesequencingofLas[29]providesanopportunitytodesign primersbasedonspeciesspecificsequencesforthedetectionofLas.Wedesignedtheoligonucleotideprimer pairsspecifictotheidentifieduniquegenicsignatures. Wefurthervalidatedtheirspecificitiesandselectivity againstcloselyrelatedstrainsthatdemonstratedtheapplicationtoLas-infectedtissuesandinsectvectorsbya qRT-PCR.ResultsanddiscussionRecently,thewholegenomesequencesofLas[29,30] havebeensequenced.ThisallowsforsystematicscreeningofuniqueLasgenesinagenome-widefashion. Theavailabilityofthegenomesequencesoftheclosely relatedspeciesLam[31], L.crescens (Lcr)[32]and Ca. L.solanacearum (Lso)[33],furthereffectivelyhelpsin identificationofuniqueregions,byminimizingtheKogenaru etal.BMCMicrobiology 2014, 14 :39 Page2of11 http://www.biomedcentral.com/1471-2180/14/39

PAGE 3

cross-speciesreactions,therebyenhancingthediagnosticidentificationofLasinamoredistinctmanner.BioinformaticanalysisSeveralhigh-throughputapplicationshavebeendevelopedrecentlytodesigndiagnosticprimersusingthe wholegenomesequenceinformationincludingKPATH, Insignia,TOFI,andTOPSI[34-40].Amongthem,KPATH, Insignia,andTOPSIhavethepotentialtobeusedfordesignofreal-timePCRprimersforqRT-PCRbasedassays forLas,whereasTOFIisusedtodesignsignaturesfor microarray-basedassays.Thesemethodsmentionedabove canbebasicallycategorizedintoalignment-freeand alignment-basedapproaches.Thealignment-freeapproach usesbothcodingandnon-codingregionsofthegenome andisusefulforthegenomeswithlessaccuratesequence information,butgenerallyresultinhighfalsepositiverates asitdoesnotinvolvepre-screeningoftheselectedgenomiclocifortheirdiscriminatoryability[37].The alignment-basedapproachinvolvespre-screeningof theselectedgenomiclocifortheirdiscriminatoryability [34].Thisapproachdoesnotconsiderthegenomeannotationofgenicandnon-genicinformation,butratheraligns biggerregionsofthegenome,hencepronetoloseshorter discriminatorysequenceregions.Additionally,discriminatoryabilityoftheselectedregionsarescreenedbioinformaticallyonlyonlimitednumberofcloselyrelated species,whichprovidemoreopportunitiesforfalsepositives.Wethereforetookacomplementarybioinformatics approachbypre-screeningshortergenicregionsagainst thenucleotidesequencedatabase(nt)atNCBI,toidentify allthepossibleuniquegenicregionsfromtheLasgenome.Thenaturalselectionactsmorestronglyongenicregion,henceuseofdiscriminatorysequencesinthisregion resultsinlessfalsepositivesastheorganismsareunder selectionpressure[41].Additionally,pre-screeningagainst thentismoreeffectiveasitcontainsthelargestpoolof well-annotatednucleotidesequencesfromdifferentorganisms.Weenvisionedthatthesetwostepswouldresultin morespecificdetectionoftargetorganismwithless falsepositives,hencearei ncludedinourbioinformaticsapproach. Thereare~1100genesassignedtotheLasgenome. Therefore,manualsearchingofeachofthesesequences againstthentdatabaseusingBLASTprogram[42,43]is alaboriousandtimeconsumingprocedure.Hence,we automatedthissequencesimilaritysearchstepbydevelopingastandalonePERLscript(Additionalfile1).This scriptperformedthesimilaritysearchesforeachofthe Lasgeneagainstthespecifieddatabasewithhard-coded parametersfortheBLASTprogram.Further,manual analysisoftheresultingBLASTsearchoutputfilesis alsolaboriousandtimeconsuming;wetherefore,automatedthisstepbydevelopingasecondPERLscript (Additionalfile2).Thisscriptautomaticallyparsedall theBLASToutputfilesandreturnedtheLassequences forwhich,nohitswerefoundinotherorganisms.We refertothesesequencesasprobableuniquesequences, becausetherearenearlynoidenticalsequencesfoundin otherorganisms(Figure1). Weperformedthesequencesimilaritysearchesfirstby usingstringentE-valueof 110-3againstntdatabase (Figure1).Thissearchresultedin~200sequencesthat areuniquetoLas.Thissetofsequencesisrelativelyhigh tovalidateexperimentally;therefore,tofurtherreduce thenumberofuniquesequences,weperformedthe Figure1 Pictorialrepresentationofthebioinformaticsstrategy employedtochurnouttheuniquegenicregionsfromLas genome. Theinputandoutputofeachstepareshowninovalor squareboxes.Actionstakenarenotedtotheleftsideofthearrow mark,whiletheinformationusedisindicatedtotherightsideof thearrow. Kogenaru etal.BMCMicrobiology 2014, 14 :39 Page3of11 http://www.biomedcentral.com/1471-2180/14/39

PAGE 4

secondsequencesimilaritysearchwitharelaxedE-value of 1.Thissearchresultedin38uniquesequences.The E-valueof 1excludesthesequenceswithevenlittle similaritytootherorganisms.Therefore,theresulting38 uniquesequencesareconsidereduniquetoLasandconstitutethepromisingcandidatesforqRT-PCRbaseddetection(Figure1). Wefurthersearchedthe38uniquesequencesofLas againstthephylogeneticallycloselyrelatedLso,Lam, andLcr.Becausetheseorganismsarecloselyrelated,we usedthestringentE-valuethresholdof 110-3forthis similaritysearch.InordertoachievethisE-value,thesequencesneedtobehighlysimilarbetweentheLas,Lso, Lam,andLcr.Therefore,thisclosespeciesfilterprocedurepotentiallyeliminatesalltheLassequencetargets thatcouldleadtofalsepositiveresultsinqRT-PCR basedmoleculardiagnosticassays.Consequently,wefurthereliminatedfourconservedsequencesfromthelist of38uniquesequences,resultinginatotalof34potentialsequencesignatures.Wecouldnotapplythisclose speciesfilterstepagainstLafgenomeasitsgenomeis yettobesequenced. Five(~15%)ofthe34uniquegenesequencesnamely CLIBASIA_05545,CLIBASIA_05555,CLIBASIA_05560, CLIBASIA_05575andCLIBASIA_05605areintheprophageregionoftheLasgenome.Allthesefiveunique sequencesarelocatedupstreamofthegenomiclocus CLIBASIA_05610encodingaphageterminase.There arepossibly30genesthatrepresentthecompleteprophagegenomewithintheLasgenome[25,44],ofwhich 16openreadingframes(ORFs)areupstreamofthe phageterminase,whiletheremaining13ORFsaredownstream.TheprophagegenesCLIBASIA_05610(primer pair766Fand766R)andCLIBASIA_05538(primer pairLJ900FandLJ900R)havebeentargetedinprevious studiesbybothconventionalaswellasqRT-PCRbased assays[25,44]. Wefurtheranalyzedthegenomicorientationofthe34 uniquegenes.Thisanalysisrevealedthat15(~44%)of themareorientedonthesensestrand,whiletheremaining 19(~56%)werepresentontheanti-sensestrand(Additionalfile3:FigureS1).Thesequencelengthofthese uniquegenesrangedfrom93to2595basepairs(bp) (Additionalfile4:TableS1).DesigningofLasspecificprimersandexperimental validationofthespecificityandsensitivityofqRT-PCR assaytodetectLasBasedonthegenomesequenceofLasstrainpsy62,we designed34qRT-PCRprimerpairsthatspecificallytargetthe34uniquesequencesidentifiedinourbioinformaticanalyses(Additionalfile4:TableS1).Wedesigned themeltingtemperature(Tm)ofeachoftheseprimers torangefrom59Cto65Cwithanoptimumof62C. TheGCcontentoftheprimersrangedfrom35%to65% withanoptimumof50%.ThePCRampliconsizesfor eachprimersetarebetween84to185bp(Additional file4:TableS1). Inadditiontothenovelprimersdesignedinthiswork, wealsousedasetofcontrolprimersthathavebeenpreviouslyusedinaqRT-PCRbaseddetectionofLas.These knownprimersinclude16SrDNApairsspecifictothe threedifferent Candidatus Liberibacterspecies(HLBasf/ r:Las,HLBamf/r:LamandHLBaf/r:Laf)[23], -operon (CQULA04f/r: -operon)[26],intragenicrepeatsregions oftheprophagesequence(LJ900f/r:Prophage)[25],and theprimerpairspecifictotheplantcytochromeoxidase (COXf/r:COX)gene[23]asapositiveendogenous control. WeperformedqRT-PCRassaystotestthespecificity ofthedesignedprimersusingtotalDNAextractedfrom Las-infectedcitrusplantsasatemplate.Tofurthervalidatethespecificityoftheseprimers,wealsoincluded totalDNAfromthephylogeneticallycloselyrelatedspeciesLamandLafinourtest.Additionally,DNAextractedfromhealthycitrusplantwasusedasanegative control,whereaswaterservedasanotemplatecontrol. TheresultsofqRT-PCRassaysarelistedinTable1. Mostofournovelcustomdesignedprimerpairstargetingtheuniquegenesequenceswereindeedfoundto behighlyspecifictoLas,asassessedbyqRT-PCRassays (Table1).Amongthe34primerpairs,29produced ampliconsonlywhenLas-infectedcitrusplantDNAwas usedasatemplate,withanaverageCTvalueranged from19.48to27.47.Twoprimerpairs,P13andP15, didn ’ tproduceanyampliconsunderthestandardconditionstested.Theotherthreeprimerpairs,P19,P27and P28,producedampliconswhenLasorLafinfectedplant DNAwasusedasatemplate,indicatingP19,P27and P28couldbeusedtodetectbothLasandLaf.Wewere unabletofilterforcross-reactivityofP19,P27andP28 inthebioinformaticanalysis,becausetheLafgenome sequenceiscurrentlyunavailable.Withtheexceptionof thesethreeprimersetsthatshowedampliconswithLaf template,noneoftheotherprimersetsproducedany ampliconswithDNAofLam,Laf,andhealthycitrusor waterastemplate,whichfurtherconfirmsthespecificity oftheseprimerstotheLas. Wefurtherevaluatedthespecificityoftheseprimer setsusingDNAtemplatesfromvariouscitrusassociated fungalandbacterialpathogensincluding Colletotrichum acutatum KLA-207, Elsinoefawcettii Xanthomonasaxonopodis pv. citrumelo 1381, X.citri subsp. citri strains 306,Aw,andA*.Onlytwoprimerssets,P20andP21 showedunspecificamplificationagainsttemplateDNA extractedfromfungalpathogen C.acutatum KLA-207 (Table1). C.acutatum causescitrusblossomblight, post-bloomfruitdropandanthracnosesymptomsthatKogenaru etal.BMCMicrobiology 2014, 14 :39 Page4of11 http://www.biomedcentral.com/1471-2180/14/39

PAGE 5

Table1SpecificityandsensitivityofthenovelprimersinthedetectionofLasasshownbyqRT-PCRassayPrimer pairs TargetgeneLasCTvalueoftheqRT-PCR#NegativecontrolOthercontrols CTvalue R2value†Slope†LafLamHealthyplant tissue WaterC1C2C3C4C5C6 P1CLIBASIA_0555520.540.9944 0.2883UDUDUDUDUDUDUDUDUDUD P2CLIBASIA_0431519.990.9867 0.2849UDUDUDUDUDUDUDUDUDUD P3CLIBASIA_0557520.150.9991 0.2847UDUDUDUDUDUDUDUDUDUD P4CLIBASIA_0546519.520.9618 0.2897UDUDUDUDUDUDUDUDUDUD P5CLIBASIA_0146019.480.9995 0.2969UDUDUDUDUDUDUDUDUDUD P6CLIBASIA_0514522.290.9971 0.3057UDUDUDUDUDUDUDUDUDUD P7CLIBASIA_0554520.110.9972 0.3407UDUDUDUDUDUDUDUDUDUD P8CLIBASIA_0556019.920.9982 0.3132UDUDUDUDUDUDUDUDUDUD P9CLIBASIA_0202520.120.9875 0.2743UDUDUDUDUDUDUDUDUDUD P10CLIBASIA_0560520.180.9945 0.2781UDUDUDUDUDUDUDUDUDUD P11CLIBASIA_0309023.610.9997 0.2867UDUDUDUDUDUDUDUDUDUD P12CLIBASIA_0387527.470.9992 0.2563UDUDUDUDUDUDUDUDUDUD P13CLIBASIA_02305UDNTNTUDUDUDUDUDUDUDUDUDUD P14CLIBASIA_0549521.250.9974 0.2594UDUDUDUDUDUDUDUDUDUD P15CLIBASIA_02660UDNTNTUDUDUDUDUDUDUDUDUDUD P16CLIBASIA_0271520.260.9411 0.3480UDUDUDUDUDUDUDUDUDUD P17CLIBASIA_0311020.110.9994 0.2786UDUDUDUDUDUDUDUDUDUD P18CLIBASIA_0367520.020.9967 0.2780UDUDUDUDUDUDUDUDUDUD P19CLIBASIA_0372519.91NTNT35.29UDUDUDUDUDUDUDUDUD P20CLIBASIA_0395521.08NTNTUDUDUDUD37.41UDUDUDUDUD P21CLIBASIA_0403020.30NTNTUDUDUDUD32.93UDUDUDUDUD P22CLIBASIA_0415024.00NTNTUDUDUDUDUDUDUDUDUDUD P23CLIBASIA_0431020.760.991 0.2976UDUDUDUDUDUDUDUDUDUD P24CLIBASIA_0433020.850.9986 0.2635UDUDUDUDUDUDUDUDUDUD P25CLIBASIA_0440521.600.9987 0.3051UDUDUDUDUDUDUDUDUDUD P26CLIBASIA_0442520.410.9994 0.3032UDUDUDUDUDUDUDUDUDUD P27CLIBASIA_0264521.77NTNT38.61UDUDUDUDUDUDUDUDUD P28CLIBASIA_0451522.00NTNT38.63UDUDUDUDUDUDUDUDUD P29CLIBASIA_0453019.000.9919 0.2852UDUDUDUDUDUDUDUDUDUD P30CLIBASIA_0455022.480.9938 0.2708UDUDUDUDUDUDUDUDUDUD P31CLIBASIA_0523021.680.9941 0.2771UDUDUDUDUDUDUDUDUDUD P32CLIBASIA_0548021.480.988 0.2776UDUDUDUDUDUDUDUDUDUD P33CLIBASIA_0447520.840.9913 0.2644UDUDUDUDNTUDUDUDUDUD P34CLIBASIA_0550522.700.9893 0.2791UDUDUDUDNTUDUDUDUDUD CQULA04F/R -operon22.11NTNTUDUDUDUDNTNTNTNTNTNT LJ900f/rProphage22.25NTNTUDUDUDUDNTNTNTNTNTNT HLBas/r16Sas24.330.9998 0.3057NTNTUDUDNTNTNTNTNTNT HLBam/r16SamNTNTNTNT24.68UDUDNTNTNTNTNTNT HLBaf/r16SafNTNTNT21.28NTUDUDNTNTNTNTNTNT COXf/rCox14.80NTNT15.2118.5416.15UDNTNTNTNTNTNT†Las-infectedpsyllidstotalDNAwasseriallydilutedspanninguptofivelogsandusedasatemplateintheqRT-PCRassay.R2andslopewerefurthercalculated fromaplotofCTvaluesversuslogdilutionfactor.#qRT-PCRwasconductedbyusingtemplateDNAsamplesofLas,Laf,Lam,C1: Colletotrichumacutatum KLA-207, C2: Elsinoefawcettii ,C3: Xanthomonasaxonopodis pv. citrumelo 1381,C4: Xanthomonascitri subsp. citri Aw,C5: Xanthomonascitri subsp. citri A*,C6: Xanthomonas citri subsp .citri 306.TheCTvaluesareaverageofthreereplicatesforeachprimerpair.UD:undetected;NT:Nottested.Kogenaru etal.BMCMicrobiology 2014, 14 :39 Page5of11 http://www.biomedcentral.com/1471-2180/14/39

PAGE 6

Table2qRT-PCRdetectionofLasfromplantsamplesthatwerecollectedfromdifferentlocationsinUSAandChinaPrimer pairs CTvalueofqRT-PCRusinginfectedplantDNAsamplesastemplate#DNAsamplesfromFlorida,USADNAsamplesfromChina HomesteadOrangePolkLakewalesHighlandsdeSotoStLucieHendryHickoryHardeeCharlotteIndianriverHainanJiangxiGuangxiYunnanGuangdong P123.4622.2425.3322.3524.7226.3523.8426.0028.8926.8824.7123.7327.28UD32.5528.18UD P224.8023.1027.4123.0726.9028.3125.3029.2729.9029.7026.9928.9428.1525.6930.6828.0527.67 P323.9722.5625.0322.6424.4826.0624.1125.7228.6227.9924.9424.3127.11UD34.5929.9536.57 P424.9923.0327.7123.0727.1228.3025.2928.4929.0327.6427.4628.1228.2725.7731.4827.9128.03 P524.4422.5027.4022.4726.0728.1724.4528.6028.9128.5326.6627.6927.3125.0231.6828.4926.98 P625.4923.1628.0223.2627.1429.0325.2728.8429.7030.0827.5328.7927.6825.2633.5427.7929.30 P724.3323.0125.3022.7525.3126.0324.5526.5528.1628.3224.8725.0727.69UD34.7130.97UD P823.8522.7325.8022.6424.6226.0023.8426.2027.6626.1425.5824.2027.47UD31.1927.40UD P1024.7523.7625.9623.6826.0527.3825.2827.8529.0928.8126.1125.4328.40UD31.7430.97UD P1125.8924.0228.5124.8428.5530.5226.6030.5231.7230.6628.0830.5428.4726.0937.5635.4129.28 P1625.5023.3627.8723.2026.8528.4125.6729.1829.4129.5427.5728.8828.1025.8230.5427.2727.81 P1725.9524.0928.1823.6527.5429.3626.6129.9029.5031.0928.1430.9229.3427.0136.1230.2829.20 P1825.1723.1128.0223.0727.4328.7525.9928.9629.3629.1528.1929.0928.6726.4132.1727.8928.79 P2326.4124.0529.2824.3528.0430.2227.7531.1532.1432.9529.7731.4830.3127.6736.7330.8630.63 P2426.1423.8328.8023.6827.5829.6827.2830.8632.1431.8730.7131.8429.7527.5137.7030.8030.05 P2525.0422.6827.9722.9026.6728.2825.9228.6329.0430.8027.3029.7727.8125.4736.4929.3129.31 P2625.1123.1127.6522.8627.3128.5325.7128.5529.5728.6627.8929.4928.4126.2031.6727.5028.38 P2924.7322.7227.2122.6026.6527.8525.4229.3629.5629.2827.1729.1327.3925.3334.1228.0327.51 P3026.4624.8730.5924.5528.9130.7327.7929.6931.2531.8928.3330.6929.3226.6035.9129.9030.71 P3127.1925.0529.8324.7729.4331.0327.8831.2332.6731.1429.9430.7130.2827.9634.2829.9431.58 P3226.6524.6529.1323.7328.2429.4025.9329.4430.5830.2028.1129.8228.9426.6033.8329.2328.77 P3325.5523.3528.0823.3327.0328.4226.3230.3230.5830.3627.8329.7928.4125.8032.9930.7128.37 P3426.4924.2929.6224.4628.1429.4526.2228.5029.6630.8526.6729.2827.2425.6636.1429.0729.52 HLBas/r24.7622.9727.5522.8031.0229.9427.2427.4528.0227.2028.9027.9527.0625.0430.4025.9325.78#Las-infectedplantDNAsampleswerecollectedfrom12differentlocationsinFlorida,USA,and5differentlocationsinChina.TheCTvaluesindicatedareaverageofthreereplicatesforeachprimerpairs. UD:Underdetermined.Kogenaru etal.BMCMicrobiology 2014, 14 :39 Page6of11 http://www.biomedcentral.com/1471-2180/14/39

PAGE 7

arephenotypicallydistinguishablefromcitrusHLB.The P20andP21werenotfilteredbythebioinformaticanalysissince C.acutatum genomesequencewasunavailableinthedatabase.Becauseofthecomplexityofthe naturalmicrobialcommunityandthelimitednumberof sequencesavailableinthecurrentnucleotidesequence database,itisimpossibletocompletelyfilteroutallthe potentialfalsepositivesbioinformatically.However,false positivescouldbeidentifiedexperimentallybycombiningthedifferentsetsofprimerpairsbyaconsensusapproach[37].Weeliminatedthesetwoprimersetsfrom furtherevaluationinthisstudy. Themeltingtemperatureanalysisoftheamplicons producedfromournovelprimersetwithLasasatemplateindicatedthatampliconswereofasinglespecies. Thissuggeststhatthereisnoofftargetamplificationfor ourprimerpairsontheLasgenome.Overall,theexperimentalvalidationofthe34novelprimersetsspecificto uniquetargetsrevealedthat27(~80%)ofthesetargets areindeedspecifictotheLasgenome(Table1).This demonstratesthesignificanceofthebioinformaticsstrategyemployedhereforidentifyingthesuitabletargetregionsforthedetectionofthebacteriabyqRT-PCR basedmethods.These27novelprimerpairswereselectedforfurthercharacterization. Totestthesensitivityofourdesignednovelprimers, serialdilutionsofLas-infectedpsyllidDNAwasusedas atemplateintheqRT-PCRassay.Thisserialdilution qRT-PCRassayindicatedthatmostofournovelprimer pairswereabletodetectLasupto104dilutionsfrom theinitialtemplateDNAconcentration,whichiscomparabletothatoftheprimersettargetingLas16S rDNA(Table1).However,lowersensitivitywasobservedinthecaseofprimerpairsP9,P12,P14and P22,whichwereeliminatedfromfurtherstudy.The remaining23primerpairswereabletodetectLasup to104dilutions,withacorrelationco-efficient(R2>0.94) betweentheCTvaluesanddilutions(Table1).Thisdemonstratesthehighsensitivityofthese23primersinthedetectionofLas. Figure2 SchematicrepresentationoftheplantandthepsyllidsamplescollectedfromFlorida. Las-infectedplantDNAsampleswere collectedfrom12differentlocationsandpsyllidsfrom5differentlocationsinFlorida,USA.Thecolorshadedsymbolsforrepresentativeplantand psyllidsamplesarebasedontheiraverageinfectionlevelacrossalltheprimerpairstestedbasedonCTvalues. Kogenaru etal.BMCMicrobiology 2014, 14 :39 Page7of11 http://www.biomedcentral.com/1471-2180/14/39

PAGE 8

qRT-PCRdetectionofLasfromplantandpsyllidDNA samplesisolatedfromdiverselocationsinUSAand ChinaInordertofurtherdemonstratethedegreeofapplicabilityofthe23primerpairsinthedetectionofLasfrom infectedbiologicalmaterial,weperformedqRT-PCRon thevariousLas-infectedplantandpsyllidDNAsamples. ConsideringthepotentialvariationinnucleotidesequencesofLasisolatesindifferentgeographiclocations thatmightaffectourdetectionduetothepotentialnucleotideschangesofthetargetuniquegenes,wecollectedLas-infectedplantDNAsamplesastabulatedin Table2,fromnotonlyUSA,butalsofromChina,where Laswasreportedmorethan100yearsago[1].Wetested the23primerpairson17Las-infectedplantDNAsamples.Ofthese17,12werecollectedfromdifferentlocationsinFlorida,USA(Figure2,Table2),andthe remainingfivewerecollectedfromdifferentlocationsin China(Table2).Additionally,Las-infectedpsyllidDNA samplescollectedfromfivedifferentlocationsinFlorida, USA,werealsoincludedintheqRT-PCRassays(Table3, Figure2). Allthe23primerpairsdetectedLasfromall12FloridaHLBdiseasedplantsamples(Table2)and5psyllid DNAsamples(Table3)inaqRT-PCRassay,whichfurthervalidatedthedetectionapplicabilityofournovel primers(Figure2).However,4ofthe23primerpairs (P1,P7,P8andP10)failedtoproduceampliconswiththe infectedplantDNAsamplefromJiangxiandGuangdong Province,China(Table2).PrimerpairP3producedno ampliconwithJiangxisample,andproducedunspecific ampliconwiththeGuangdongsample(withanaltered PCRproductsize, datanotshown ).Interestingly,allthese 5primerpairstargetthegeneslocatedinprophageregion oftheLasgenome(Additionalfile3).Theseprimers(P1, P3,P7,P8andP10)basedonprophagegenescoulddetect LasfromFlorida,butnotfromJiangxiandGuangdong province,China.Thisisconsistentwithpreviousreport [44],thatprophagewasdetectedinonly15.8%ofthe120 HLBdiseasedcitrussamplesacquiredinGuangdong Province,China,butwasdetectedin97.4%ofthe39Las positivecitrussamplesacquiredinYunnanProvince, China.Thissuggeststhatthoseprophagegenesarenot universallypresentinallstrainsofLas.Alternately,the prophagesequenceswerefoundtobehighlyvariable amongthestrainstested.ConclusionsWehavesuccessfullydesigned18novelprimerpairs, whicharespecifictoLas.Theseprimerswillprovidean additionalarsenaltoqRT-PCRbaseddetectionofLasinfectedplantsandpsyllids.Comparedtothecommonly usedprimersbasedon16SrDNAand -operon,the 18primersdevelopedinthisstudyhavecomparable sensitivity.Moreover,theseprimerscouldsuccessfully differentiateLasfromLam,Lafandothercommon microbesassociatedwithcitrus.MethodsBioinformaticsThenucleotidesequencesofLaswithaccessionnumber NC_012985[29,45],LsowithaccessionnumberNC_014774 [33],LcrwithaccessionnumberNC_019907andcomprehensivenucleotide(nt)database(26thJuly2012)were downloadedfromtheNCBIftpserver(ftp.ncbi.nih. gov).Thestand-aloneBLAST[42,43]wasusedto searchtheLasgenesagainstnt,LsoandLcrdatabases usingacustom-madePERLscript1(Additionalfile1) byvaryingtheE-valuewithallotherparameterskept toadefaultvalue.TheoutputfilesoftheBLAST Table3qRT-PCRdetectionofLasfrompsyllidDNA samplesthatwerecollectedfromdifferentlocationsin Florida,USAPrimer pairs CTvalueofqRT-PCRusinginfectedpsyllidDNA samplesastemplate#PolkMiamiHighlandsOrangeCREC P132.2024.7028.7626.6024.87 P233.6425.6329.9627.7125.75 P332.1924.3929.4526.5724.95 P433.9225.4730.0928.2725.81 P533.1224.7428.5426.2225.14 P633.5225.4529.9827.8025.60 P732.6427.2929.3627.1225.42 P832.4624.6428.8227.4825.62 P1033.2026.3030.3728.6526.52 P1134.3026.4730.3428.1626.14 P1633.7624.9928.9728.2326.05 P1734.8726.0830.3028.4526.91 P1834.0225.4029.7328.2826.38 P2334.6925.4630.4328.6026.30 P2434.8425.5830.6128.7126.45 P2533.1524.1028.4626.7824.77 P2633.4025.5929.7428.0725.58 P2933.4225.1429.4927.7325.29 P3036.2826.5332.1229.6527.07 P3136.1027.1331.6729.9427.43 P3235.5326.4031.0629.2227.23 P3333.8625.0130.0027.9225.65 P3434.9925.7430.9328.5826.43 HLBas/r33.4125.1029.0927.8625.57#Las-infectedpsyllidDNAsampleswerecollectedfrom5differentlocationsin Florida,USA.TheCTvaluesindicatedareaverageofthreereplicatesforeach primerpair.Kogenaru etal.BMCMicrobiology 2014, 14 :39 Page8of11 http://www.biomedcentral.com/1471-2180/14/39

PAGE 9

searcheswerefurtherparsedusingasecondcustommadePERLscript2(Additionalfile2).PlantandpsyllidmaterialsandextractionofDNALasinfectedcitrusleafsampleswithtypicalvisible symptomswerecollectedfrom2yearsoldinfectedsweet orange( Citrussinensis )plantsmaintainedattheCitrus ResearchandEducationCenter(CREC),LakeAlfred, Florida,USA.Asanegativecontrol,theleavesfrom healthycitrusplantswerecollectedfrompathogen-free seedlingsgrowninthehealthyplantgreenhousemaintainedatCREC,LakeAlfred,Florida,USA.TheLafand LaminfectedsampleswereobtainedfromSouthAfrica andBrazilrespectively.ThetotalDNAfromtheleaves ofcitruswasextractedusingtheprotocolmentioned elsewhere[46].Briefly,theleaveswerewashedundertap waterandsurfacesterilizedin35%bleach(2%active Chlorine)and70%(v/v)ethanolfor2mineach.The sterilizedleaveswerefurtherrinsedthreetimesinsterile water.Themidribsfromtheleafsampleswereseparated andcutintosmallpieces.Approximately100mgof midribpieceswereusedfromeachsampletoextractthe DNAusingtheWizardgenomicsDNApurificationkit (Promega,Madison,WI,USA).TheextractedDNAwas suspendedin100 lH2O. Lasinfectedpsyllids( Diaphorinacitri )weremaintained onconfirmedLas-infectedsweetorangeplantsatthe CREC,LakeAlfred,FL,USA.Inthiswork,16psyllids (around20mg)werepooledandthetotalDNAwas extractedusingaDNeasyBlood&TissueKit(Qiagen, Valencia,CA).TheextractedDNAwassuspendedin 100 lH2O.ThequalityandquantityoftheextractedDNA wasdeterminedusingaNanoDrop ™ 1000spectrophotometer(NanoDropTechnologies,Inc.,Wilmington,DE).Quantitativereal-timepolymerasechainreaction(qRT-PCR)GenespecificprimersweredesignedusingPrimerQuestSMfromIntegratedDNAtechnologies(IDT), Coralville,Iowa(Additionalfile4:TableS1).qRT-PCR experimentswereperformedusingABIPRISM7500 FASTReal-timePCRSystem(AppliedBiosystems,Foster City,CA,US)ina96-wellplatebyusinganabsolute quantificationprotocol.Thereactionmixtureineachwell contained12.5 L2xFASTSYBRGreenPCRMaster Mixreagent(AppliedBiosystems),2 LDNAtemplate (~30ng),0.625 Lof10 Mofeachgene-specificprimer pairinafinalvolumeof25 L.Thestandardthermalprofileforallamplificationswasfollowed,whichinvolved95C for20minfollowedby40cyclesof95Cfor3sec,and 50Cfor30sec.Allassayswereperformedintriplicates. MeltingcurveanalysiswasperformedusingABIPRISM 7500FASTReal-timePCRSystemSoftwareversionSDS v1.421CFRPart11Module(AppliedBiosystems)to characterizetheampliconsproducedinaPCRreaction.AdditionalfilesAdditionalfile1: PERLscript1facilitatesthesimilaritysearchinan automatedfashion. Thisscriptperformssimilaritysearchesagainstthe specifiednucleotidesequencedatabaseusingastand-aloneBLASTprogram foreachoftheinputgenesequencesfromtheLasgenome. Additionalfile2: PERLscript2facilitatestheidentificationof uniquegenestoLas. Thisscriptfacilitatestheidentificationofunique genesbyautomaticallyparsingalltheBLASToutputfilesgeneratedfrom theAdditionalfile1PERLscript1andreturnstheuniquegenesequences withnosimilaritytotheDNAsequencesofotherorganisms. Additionalfile3:FigureS1. Snapshotoftheuniquegenesidentified bybioinformaticsisshowninthecontextofthewholegenomeofLas. Theabsolutepositionsoftheregionsareshown.Thenovelunique regionsofLasidentifiedinthisstudyareshowninbluishgreen,while thecurrentlyknowntargetsarecoloredingreen. Additionalfile4:TableS1. Customdesignedprimerpairsspecifictothe uniquesequencesofLasidentifiedbybioinformaticanalysis.Theforward andreverseprimerpairforeachoftheuniquegenicregionsisgiven.The productsizeforeachoftheprimersisshownalongwiththe%GCcontent. Competinginterests Wedeclarenocompetinginterests. Authors ’ contributions NWconceivedandcoordinatedtheworkandwrotethemanuscript.SK designed,performedbioinformaticanalysisandwrotethemanuscript.SK, QYandNRperformedqRT-PCRexperiments.SK,QY,XD,CR,TE,MR,MI,GP, andCRparticipatedinexperimentaldesign,manuscriptwritingandprovided reagents.Allauthorsreadandapprovedthefinalmanuscript. Acknowledgments WethankDr.NelsonA.Wulff,Fundecitrus – FundodeDefesadaCitricultura, SaoPaulo,Brazil,forkindlyprovidingtheLamDNA.DNAsamplesoffungal pathogens Colletotrichumacutatum KLA-207, Elsinoefawcettii werekindly providedbyDr.Kuang-RenChung.WealsothankVladimirKolbasovforthe technicalassistanceinDNAisolation.ThisworkwassupportedbyCitrus ResearchandDevelopmentFoundation. Authordetails1CitrusResearchandEducationCenter,DepartmentofMicrobiologyandCell Science,IFAS,UniversityofFlorida,LakeAlfred33850,USA.2Presentaddress: DivisionofNephrology,DepartmentofInternalMedicine,Universityof MichiganMedicalSchool,AnnArbor,MI48109-0676,USA.3Departmentof PlantPathologyandMicrobiology,UniversityofCalifornia,Riverside,CA 92521,USA.4DepartmentofPlantPathology,SouthChinaAgricultural University,Guangzhou,Guangdong,P.R.China.5DepartmentofEntomology andNematology,CitrusResearchandEducationCenter,IFAS,Universityof Florida,LakeAlfred33850,USA.6USSugarCorporation,Clewiston,FL33440, USA.7DepartmentofMicrobiology&PlantPathology,ARC-PlantProtection ResearchInstitute,UniversityofPretoria,Pretoria,SouthAfrica.8TexasA&M AgriLifeResearchandExtensionCenter,TexasA&MUniversity,Amarillo,USA. Received:2November2013Accepted:12February2014 Published:17February2014 References1.BovJM: Huanglongbing:adestructive,newly-emerging,century-olddisease ofcitrus. JPlantPathol 2006, 88 (1):7 – 37. 2.doCarmoTeixeiraD,LucDanetJ,EveillardS,CristinaMartinsE,deJesus JuniorWC,TakaoYamamotoP,AparecidoLopesS,BeozzoBassaneziR, JulianoAyresA,SaillardC,BovJM: CitrushuanglongbinginSaoPaulo State,Brazil:PCRdetectionofthe ‘ Candidatus ’ Liberibacterspecies associatedwiththedisease. MolCellProbes 2005, 19 (3):173 – 179. 3.JagoueixS,BovJM,GarnierM: Comparisonofthe16S/23Sribosomal intergenicregionsof “ Candidatus Liberobacterasiaticum ” and “ Candidatus Liberobacterafricanum ” ,thetwospeciesassociatedwithcitrus huanglongbing(greening)disease. IntJSystBacteriol 1997, 47 (1):224 – 227.Kogenaru etal.BMCMicrobiology 2014, 14 :39 Page9of11 http://www.biomedcentral.com/1471-2180/14/39

PAGE 10

4.LopesSA,FrareGF,BertoliniE,CambraM,FernandesNG,AyresAJ,Marin DR,BovJM: LiberibactersassociatedwithcitrusHuanglongbingin Brazil: ‘ Candidatus Liberibacterasiaticus ’ isheattolerant, ‘ Ca .L. americanus ’ isheatsensitive. PlantDis 2009, 93 (3):257 – 262. 5.TatineniS,SagaramUS,GowdaS,RobertsonCJ,DawsonWO,IwanamiT, WangN: Inplantadistributionof ‘ Candidatus Liberibacterasiaticus ’ as revealedbypolymerasechainreaction(PCR)andreal-timePCR. Phytopathology 2008, 98 (5):592 – 599. 6.ManjunathKL,HalbertSE,RamaduguC,WebbS,LeeRF: Detectionof ‘ Candidatus Liberibacterasiaticus ’ in Diaphorinacitri anditsimportance inthemanagementofcitrushuanglongbinginFlorida. Phytopathology 2008, 98 (4):387 – 396. 7.McCleanAPD,O berholzerPCJ: Citruspsylla,avectorofthegreening diseaseofsweetorange. SouthAfricanJofAgriculturalSci 1965, 8: 297 – 298. 8.ShiJ,PagliacciaD,MorganR,QiaoY,PanS,VidalakisG,MaW: Novel diagnosisforCitrusStubbornDiseasebydetectionofa Spiroplasmacitri secretedprotein. Phytopathology 2014, 104 (2):188 – 195. 9.ChenJ,PuX,DengX,LiuS,LiH,CiveroloE: Aphytoplasmarelatedto ‘ Candidatus phytoplasmaasteri ’ detectedincitrusshowing Huanglongbing(yellowshootdisease)symptomsinGuangdong,P.R. China. Phytopathology 2009, 99 (3):236 – 242. 10.TeixeiraDC,WulffNA,MartinsEC,KitajimaEW,BassaneziR,AyresAJ, EveillardS,SaillardC,BovJM: Aphytoplasmacloselyrelatedtothe pigeonpeawitches ’ -broomphytoplasma(16SrIX)isassociatedwith citrushuanglongbingsymptomsinthestateofSaoPaulo,Brazil. Phytopathology 2008, 98 (9):977 – 984. 11.WangN,TrivediP:Citrushuanglongbing:anewlyrelevantdisease presentsunprecedentedchallenges. Phytopathology 2013, 103 (7):652 – 665. 12.GottwaldTR,daGracaJV,BassaneziRB: Citrushuanglongbing:thepathogen anditsimpact. PlantHealthProgress 2007.doi:10.1094/PHP-2007-0906-1001-RV. 13.OkudaM,MitsuhitoM,TanakaY,SubandiyahS,IwanamiT: Characterization ofthe tufB-secE-nusG-rplKSJL-ropB geneclusterofthecitrusgreening organismanddetectionbyloop-mediatedisothermalamplification. PlantDis 2005, 89 (7):705 – 711. 14.VillechanouxS,GarnierM,RenaudinJ,BovJ: Detectionofseveralstrains ofthebacterium-likeorganismofcitrusgreeningdiseasebyDNA probes. CurrMicrobiol 1992, 24 (2):89 – 95. 15.GarnierM,Martin-GrosG,BovJM: Monoclonalantibodiesagainstthe bacterial-likeorganismassociatedwithcitrusgreeningdisease. AnnInst PasteurMicrobiol 1987, 138 (6):639 – 650. 16.GurtlerV,StanisichVA: Newapproachestotypingandidentification ofbacteriausingthe16S-23SrDNAspacerregion. Microbiology 1996, 142 (1):3 – 16. 17.HocquelletA,ToorawaP,BovJM,GarnierM: Detectionandidentification ofthetwo Candidatus Liberobacterspeciesassociatedwithcitrus huanglongbingbyPCRamplificationofribosomalproteingenesofthe betaoperon. MolCellProbes 1999, 13 (5):373 – 379. 18.HungTH,WuML,SuHJ: Developmentofarapidmethodforthe diagnosisofCitrusGreeningDiseaseusingthePolymeraseChain Reaction. JPhytopathol 1999, 147 (10):599 – 604. 19.JagoueixS,BovJM,GarnierM: PCRdetectionofthetwo ‘ Candidatus ’ Liberobacterspeciesassociatedwithgreeningdiseaseofcitrus. MolCell Probes 1996, 10 (1):43 – 50. 20.ShangS,FuJ,DongG,HongW,DuL,YuX: Establishmentand analysisofspecificDNApatternsin16S-23SrRNAgenespacer regionsfordifferentiatingdifferentbacteria. ChinMedJ(Engl) 2003, 116 (1):129 – 133. 21.FujikawaT,IwanamiT: Sensitiveandrobustdetectionofcitrusgreening (huanglongbing)bacterium“ Candidatus Liberibacterasiaticus ” byDNA amplificationwithnew16SrDNA-specificprimers. MolCellProbes 2012, 26 (5):194 – 197. 22.TeixeiraDC,SaillardC,CoutureC,MartinsEC,WulffNA,Eveillard-JagoueixS, YamamotoPT,AyresAJ,BovJM: Distributionandquantificationof Candidatus Liberibacteramericanus,agentofhuanglongbing diseaseofcitrusinSaoPauloState,Brasil,inleavesofanaffected sweetorangetreeasdeterminedbyPCR. MolCellProbes 2008, 22 (3):139 – 150. 23.LiW,HartungJS,LevyL: Quantitativereal-timePCRfordetectionand identificationof Candidatus Liberibacterspeciesassociatedwithcitrus huanglongbing. JMicrobiolMethods 2006, 66 (1):104 – 115. 24.LiW,LiD,TwiegE,HartungJS,LevyL: Optimizedquantificationof unculturableCandidatusLiberibacterspp.inhostplantsusingreal-time PCR. PlantDis 2008, 92 (6):854 – 861. 25.MorganJK,ZhouL,LiW,ShattersRG,KeremaneM,DuanYP: Improved real-timePCRdetectionof ‘ Candidatus Liberibacterasiaticus ’ fromcitrus andpsyllidhostsbytargetingtheintragenictandem-repeatsofitsprophage genes. MolCellProbes 2012, 26 (2):90 – 98. 26.WangZ,YinY,HuH,YuanQ,PengG,XiaY: Developmentand applicationofmolecular-baseddiagnosisfor ‘ Candidatus Liberibacter asiaticus ’ ,thecausalpathogenof citrushuanglongbing. PlantPathol 2006, 55 (5):630 – 638. 27.LaneD: 16s/23srRNAsequencing .In Nucleicacidtechniquesinbacterial systematics. EditedbyStackebrandtE,GoodfellowM.WestSussex,United Kingdom:JohnWiley&Sons;1991:115 – 175. 28.Nageswara-RaoM,IreyM,GarnseySM,GowdaS: Candidategenemarkers for Candidatus Liberibacterasiaticusfordetectingcitrusgreening disease. JBiosci 2013, 38 (2):229 – 237. 29.DuanY,ZhouL,HallDG,LiW,DoddapaneniH,LinH,LiuL,VahlingCM,GabrielDW,WilliamsKP,DickermanA,SunY,GottwaldT: Complete genomesequenceofcitrushuanglongbingbacterium, ‘ Candidatus Liberibacterasiaticus ’ obtainedthroughmetagenomics. MPMI 2009, 22 (8):1011 – 1020. 30.LinH,HanCS,LiuB,LouB,BaiX,DengC,CiveroloEL,GuptaG: CompletegenomesequenceofaChinesestrainof “ Candidatus Liberibacterasiaticus ” GenomeAnnounc 2013, 1 (2).doi:10.1128/ genomeA.00184-13. 31.LinH,Coletta-FilhoHD,HanCS,LouB,CiveroloEL,MachadoMA,GuptaG: Draftgenomesequenceof “ Candidatus Liberibacteramericanus ” bacteriumassociatedwithCitrusHuanglongbinginBrazil. Genome Announc 2013, 1 (3).doi:10.1128/genomeA.00275-13. 32.LeonardMT,FagenJR,Davis-RichardsonAG,DavisMJ,TriplettEW: Completegenomesequenceof Liberibactercrescens BT-1. StandGenomic Sci 2012, 7 (2):271 – 283. 33.LinH,LouB,GlynnJM,DoddapaneniH,CiveroloEL,ChenC,DuanY,Zhou L,VahlingCM: Thecompletegenomesequenceof ‘ Candidatus Liberibactersolanacearum ’ ,thebacteriumassociatedwithpotatozebra chipdisease. PLoSOne 2011, 6 (4):e19135. 34.HoCC,YuenKY,LauSK,WooPC: Rapididentificationandvalidationof specificmoleculartargetsfordetectionof Escherichiacoli O104:H4 outbreakstrainbyuseofhigh-throughputsequencingdatafromnine genomes. JClinMicrobiol 2011, 49 (10):3714 – 3716. 35.PhillippyAM,AyanbuleK,EdwardsNJ,SalzbergSL: Insignia:aDNA signaturesearchwebserverfordiagnosticassaydevelopment. Nucleic AcidsRes 2009, 37 (suppl2):W229 – W234. 36.PhillippyAM,MasonJA,AyanbuleK,SommerDD,TavianiE,HuqA,Colwell RR,KnightIT,SalzbergSL: ComprehensiveDNAsignaturediscoveryand validation. PLoSComputBiol 2007, 3 (5):e98. 37.PritchardL,HoldenNJ,BielaszewskaM,KarchH,TothIK: Alignment-free designofhighlydiscriminatorydiagnosticprimersetsfor Escherichiacoli O104:H4outbreakstrains. PLoSOne 2012, 7(4):e34498. 38.SlezakT,KuczmarskiT,OttL,TorresC,MedeirosD,SmithJ,TruittB, MulakkenN,LamM,VitalisE,ZemlaA,ZhouCE,GardnerS: Comparative genomicstoolsappliedtobioterrorismdefence. BriefBioinform 2003, 4 (2):133 – 149. 39.VijayaSatyaR,KumarK,ZavaljevskiN,ReifmanJ: Ahigh-throughput pipelineforthedesignofreal-timePCRsignatures. BMCBioinforma 2010, 11: 340. 40.VijayaSatyaR,ZavaljevskiN,KumarK,BodeE,PadillaS,WasieloskiL,GeyerJ, ReifmanJ: Insilicomicroarrayprobedesignfordiagnosisofmultiple pathogens. BMCGenomics 2008, 9: 496. 41.NielsenR: Molecularsignaturesofnaturalselection. AnnuRevGenet 2005, 39: 197 – 218. 42.AltschulSF,GishW,MillerW,MyersEW,LipmanDJ: Basiclocalalignment searchtool. JMolBiol 1990, 215 (3):403 – 410. 43.AltschulSF,MaddenTL,SchafferAA,ZhangJ,ZhangZ,MillerW,LipmanDJ: GappedBLASTandPSI-BLAST:anewgenerationofproteindatabase searchprograms. NucleicAcidsRes 1997, 25 (17):3389 – 3402. 44.LiuR,ZhangP,PuX,XingX,ChenJ,DengX: Analysisofaprophagegene frequencyrevealedpopulationvariationof ‘ Candidatus Liberibacter asiaticus ’ fromtwocitrus-growingprovincesinChina. PlantDis 2010, 95 (4):431 – 435.Kogenaru etal.BMCMicrobiology 2014, 14 :39 Page10of11 http://www.biomedcentral.com/1471-2180/14/39

PAGE 11

45.TylerHL,RoeschLF,GowdaS,DawsonWO,TriplettEW: Confirmationof thesequenceof ‘ Candidatus Liberibacterasiaticus ’ andassessmentof microbialdiversityinHuanglongbing-infectedcitrusphloemusinga metagenomicapproach. MPMI 2009, 22 (12):1624 – 1634. 46.KimJS,WangN: Characterizationofcopynumbersof16SrDNAand 16SrRNAof Candidatus Liberibacterasiaticusandtheimplicationin detectioninplantausingquantitativePCR. BMCResearchNotes 2009, 2: 37.doi:10.1186/1471-2180-14-39 Citethisarticleas: Kogenaru etal. : Repertoireofnovelsequence signaturesforthedetectionof Candidatus Liberibacterasiaticusby quantitativereal-timePCR. BMCMicrobiology 2014 14 :39. Submit your next manuscript to BioMed Central and take full advantage of: € Convenient online submission € Thorough peer review € No space constraints or color “gure charges € Immediate publication on acceptance € Inclusion in PubMed, CAS, Scopus and Google Scholar € Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Kogenaru etal.BMCMicrobiology 2014, 14 :39 Page11of11 http://www.biomedcentral.com/1471-2180/14/39