Citation
Characterization of the Chediak-Higashi syndrome gene in human and mouse

Material Information

Title:
Characterization of the Chediak-Higashi syndrome gene in human and mouse
Creator:
Tchernev, Velizar T
Publication Date:

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Chediak Higashi syndrome ( jstor )
Complementary DNA ( jstor )
Genetic mutation ( jstor )
Messenger RNA ( jstor )
Nucleotides ( jstor )
Polymerase chain reaction ( jstor )
Protein isoforms ( jstor )
Proteins ( jstor )
Yeasts ( jstor )

Record Information

Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
29684549 ( ALEPH )
51334513 ( OCLC )

Downloads

This item has the following downloads:


Full Text











CHARACTERIZATION OF THE CHEDIAK-HIGASHI SYNDROME GENE IN
HUMAN AND MOUSE















By

VELIZAR T. TCHERNEV


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1998





























Copyright 1998

by

Velizar T. Tchemev

































To my parents














ACKNOWLEDGMENTS


The author would like to thank his mentor, Dr. Stephen F. Kingsmore, and the

supervisory committee members, Dr. M. Wallace, Dr. E. Wakeland, Dr. E. Sobel and Dr.

M. Bubb, for their valuable advice and encouragement.

The author's appreciation is extended to all former and present members of Dr.

Kingsmore's laboratory, Dr. Maria D.F.S. Barbosa, Dr. Vishnu S. Mishra, John C. Detter,

Dr. Elizabeth B. McMurtrie, Quan A. Nguyen, Sandra M. Holt, Juan M. Teodoro and

Andrea Hofig, as well as to Dr. Krishnan Nandabalan and Dr. Madan Kumar from

CuraGen Corporation, who contributed to the successful completion of this work.

The author wishes to express his gratitude to Ms. Anna V. Gueorguieva and Mr.

Nathan S. Collier for their kindness and continuous support.

Finally, but most importantly, the author would like to thank his parents Lilia

Jeleva and Tzvetan Tchemev for their loving care and guidance, his beloved wife Ralitza

Gueorguieva for her invaluable support and inspiration, and his fellow-players Ivajlo

Kortezov, Rada Kortezova, Ludwig Lubih, Anastas Assenov and Isak Beraha for their

true friendship and thought-provoking conversations.














TABLE OF CONTENTS
page


ACKNOWLEDGMENTS ................................................................................................. iv

A B ST R A C T ...................................................................................................................... vii

IN TR O D U C TIO N ............................................................................................................... 1

MATERIALS AND METHODS....................................................................................... 22
Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Amplification of CHS Patient and Beige Mouse cDNAs...................................... 22
TA Cloning of PCR Products and Plasmid Purification.............................................. 23
Single-Strand Conformation Polymorphism (SSCP) Analysis ................................... 24
DNA Sequencing and Sequence Analysis ................................................................... 24
Allele-Specific Oligonucleotide Analysis.................................................................... 25
PCR Amplification of Mouse Lyst cDNA Isoforms .................................................... 25
Cloning of Human LYSTcDNAs................................................................................. 26
Molecular Probes ......................................................................................................... 28
Isolation of LYST2 cDNA Clones................................................................................ 29
Southern Blot Analysis and Autoradiography ............................................................. 30
Northern Blot Analysis................................................................................................ 30
Simple Sequence Length Polymorphism (SSLP) PCR Amplification........................ 31
Backcross Mouse Panel and Genetic Mapping............................................................ 31
Cloning of LYST and LYST2 Bait cDNA Fragments in Yeast Two-
H ybrid V ectors....................................................................................................... 32
Yeast Two-Hybrid Screens.......................................................................................... 36
Confirmation of the Specificity of Protein Interactions by the Yeast
Two-Hybrid System............................................................................................... 40

R E SU L T S .......................................................................................................................... 43
Identification of Mutations in Patients with Chediak-Higashi
Syndrome and in Beige Mice................................................................................. 43
Identification and Characterization of Lyst mRNA Isoforms...................................... 52
Identification and Characterization ofLyst2, a Brain-Specific Member
of the Chediak-Higashi Syndrome Gene Family................................................... 61
Identification and Sequence Analysis.................................................................... 61
Genetic Mapping.................................................................................................... 62
Expression Analysis............................................................................................... 67








Identification of Proteins that Interact with the CHS Protein and with
LYST2, Using a Yeast Two-Hybrid Approach ..................................................... 71
IP-1 (EST cg50136.f6, APPENDIX, Sequence 13)............................................... 76
IP-2 (EST AA010799, APPENDIX,.Sequence 14)............................................... 77
IP-3 (EST cg50136.c10, APPENDIX, Sequence 15)............................................ 77
IP-4 (EST cg50136.a7, APPENDIX, Sequencel6) ............................................... 78
IP-5 (EST cg50175.c7, APPENDIX, Sequence 17) .............................................. 79
IP-6 (EST cg50138.g5, APPENDIX, Sequence 18).............................................. 80
IP-7 (EST cg50173.dlO, APPENDIX, Sequence 19)............................................ 81
IP-8 (EST cg50175.h7, APPENDIX, Sequence 20).............................................. 82
IP-9 (EST KIAA0192, APPENDIX, Sequence 21)............................................... 83
IP-10 (EST cg50136.a5.b, APPENDIX, Sequence 22) ......................................... 83
IP-11 (EST cg51287.dl 0, APPENDIX, Sequence 23).......................................... 84
IP-12 (EST cg49432.h3.b, APPENDIX, Sequence 24)......................................... 85
IP-13 (EST cg50175.c ll, APPENDIX, Sequence 25).......................................... 86

D ISC U SSIO N .................................................................................................................... 88
Identification and Characterization of Lyst mRNA Isoforms ...................................... 88
Identification of Mutations in Patients with Chediak-Higashi
Syndrom e and in Beige M ice................................................................................. 92
Identification and Characterization of Lyst2, a Brain-Specific Member
of the Chediak-Higashi Syndrome Gene Family................................................... 94
Identification of Proteins that Interact with the CHS Protein, Using a
Yeast Two-Hybrid Approach................................................................................. 98

APPENDIX SEQUENCES OF MOLECULES INTERACTING WITH LYST
A N D L Y ST 2 .............................................................................................................. 123

B IB LIO G R A PH Y ............................................................................................................ 177

BIOGRA PHICAL SKETCH ........................................................................................... 192














Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

CHARACTERIZATION OF THE CHEDIAK-HIGASHI SYNDROME GENE IN
HUMAN AND MOUSE

By

Velizar T. Tchemrnev

December 1998

Chairman: Stephen F. Kingsmore
Major Department: Pathology, Immunology and Laboratory Medicine

Chediak-Higashi syndrome (CHS) is an autosomal recessive, immune deficiency

disorder of human and mouse (beige, bg) that is characterized by abnormal intracellular

protein transport to and from the lysosome/late endosome. Recent reports have described

the positional cloning of homologous genes, LYST and Lyst, that are mutated in human

CHS and in bg mice, respectively. However, since the encoded proteins were novel and

unlike any of the molecules previously implicated in vesicular trafficking, their

identification did not prove immediately helpful in establishing the precise mechanism

whereby CHS dysregulates protein transport. Therefore, the main goal of this dissertation

was to characterize the Chediak-Higashi gene and its products in more detail using

functional genomics approaches. We demonstrated that each of the previously reported

bg gene sequences are derived from a single gene with alternatively spliced mRNAs.

Alternative splicing results in bg gene isoforms (Lyst-I and Lyst-II) that contain different









3' regions. Similarly to mouse, the human mRNA isoforms arise from incomplete

splicing and retention of a transcribed intron that encodes the C-terminus of the predicted

LYST protein. Additional splicing complexity of smaller isoforms exists. The Lyst-Il

isoform lacks exons a and 13, while in Lyst-IV, exons a, 13 and y are absent. Novel

mutations were identified within the coding domain of LYST in several CHS patients and

bg alleles. Interestingly, all bg and LYST mutations identified to date are predicted to

result in either truncated or absent proteins. Mutation and expression analyses suggested

that defects in the full-length mRNA alone can elicit Chediak-Higashi syndrome and that

expression of the smaller isoform alone cannot compensate for loss of the largest isoform.

We have also identified a novel gene in human (LYST2) and mouse (Lyst2) that appears

to be a relative of the CHS gene, based on sequence similarity, predicted protein structure

and on similar transcript size. Comparison of the relative abundance of LYST2 and LYST

mRNAs suggests that LYST2 is expressed abundantly only in brain and therefore it may

represent a brain-specific member of the CHS gene family. Using a modified yeast two-

hybrid system, a human cDNA library was screened with baits from the coding domains

of LYST and LYST2. Several proteins, which play important roles in protein transport and

signal transduction, such as 14-3-3, casein kinase II, calmodulin and Hrs, were found to

interact with LYST and/or LYST2. Many of the interacting proteins could be linked in a

common pathway that regulates vesicular trafficking and degranulation.














INTRODUCTION


Chediak-Higashi syndrome (CHS) is a primary immunodeficiency, characterized

by severe recurrent infections (Blume & Wolff, 1972), partial albinism (Windhorst et al.,

1968), nervous system abnormalities (Misra et al., 1991), high incidence of malignancy

(Hayakawa et al., 1986) and predisposition to bleeding (Meyers et al., 1974). Eighty-five

percent of patients undergo an accelerated lymphoma-like phase, characterized by fever,

hepatosplenomegaly, lymphadenopathy, pancytopenia, coagulopathy and widespread

lymphohistiocytic organ infiltrates. This complication is fatal in the absence of bone

marrow transplantation.

The first 3 cases of Chediak-Higashi syndrome were reported by Beguez-Cesar in

1943, then one case by Steinbrink in 1948, and one case by Higashi in 1954. Chediak

published certain aspects of Beguez-Cesar's cases in 1952, and Sato in 1955 recognized

the similarities between Chediak's and Higashi's data, inventing the eponym "Chediak-

Higashi syndrome." Except for the occasional usage of single names or combinations of

the above authors' names, the disease has been most commonly referred to as the

Chediak-Higashi syndrome.

Approximately 150 cases of CHS have been reported in the literature. Males and

females are affected equally. The mean age of death of CHS patients is 6 years. The

Chediak-Higashi syndrome occurs with a low frequency throughout the world. Europe,






2


America and Japan are the areas from which the majority of the known cases have been

described. While most of the reports deal with isolated cases, a unique cluster of Chediak-

Higashi syndrome patients has also been published (Ramirez-Duque et al., 1982).

Fourteen cases of CHS were found in 12 families living in a defined and relatively

isolated geographical area (Pregonero) in the Venezuelan Andes. The patients were pre-

school children except one 11-year-old female. Six of the patients were male. All showed

the same typical clinical characteristics of the syndrome. Since CHS is an autosomal

recessive disease (Sato, 1955), the existence of this high-frequency cluster of CHS

patients in a restricted region could be explained by a founder effect in an isolated

population with inbreeding.

The presence of giant, perinuclear vesicles with protein markers characteristic of

late endosomes and mature lysosomes is pathognomonic for CHS (Burkhardt et al.,

1993). The organelles are abnormal both in size (enlarged) and in cytoplasmic

distribution (perinuclear). While the late endosomal/lysosomal compartment is uniformly

affected in CHS, the histological designation of affected organelles varies by cell type:

melanosomes are affected in CHS melanocytes, while secretary granules are affected in

CHS neutrophils, eosinophils, mast cells, cytolytic T-cells, proximal renal tubules, and

lysosomes are affected in monocytes and fibroblasts. The giant organelles are thought to

result from dysregulated fusion of primary endosomes and lysosomes (Burkhardt et al.,

1993; Willingham et al., 1981). The morphological abnormalities of bg and CHS

lysosomes are accompanied by compartmental mis-sorting of proteins such as elastase, 3-

glucuronidase, and cathepsin G (Holcombe et al., 1994).









The disease also occurs in other mammalian species mouse, rat, cat, cattle,

mink, fox and killer whale. Beige (bg) is a well described mouse model of CHS. The

clinical and pathological features of CHS patients and bg mice are indistinguishable.

Prior to the cloning of bg, the strongest evidence of homologous defects in beige and

CHS came from interspecific genetic complementation studies, which demonstrated that

fusion of bg and CHS fibroblasts failed to reverse lysosomal abnormalities, while fusion

with normal cells did eliminate cytological defects of bg or CHS fibroblasts (Perou and

Kaplan, 1993; Penner and Prieur, 1987).

Partial albinism is one of the main clinical manifestations of the Chediak-Higashi

syndrome. Most patients have hypopigmentation of their hair, skin and ocular fundi, as

well as misrouting of the optic nerve fibers that is characteristic of all types of albinism.

Windhorst et al., 1966, 1968 reported the presence of giant melanosomes in melanocytes

from CHS patients. Some melanosomes were highly irregular, with a suggestion of fusion

of separate granules. Most epidermal melanosomes from a CHS patient, observed by

Zhao et al., 1994, were several times larger than normal, relatively amelanotic, and

occasionally clustered into complexes. No melanosomes were detected in keratinocytes

adjacent to melanocytes, suggesting that the normal transport of melanosomes from

melanocytes to neighboring keratinocytes is defective. After DOPA histochemistry, used

to localize functional tyrosinase, reaction product was observed throughout the

cytoplasm, but not in most of the aberrant large melanosomes and complexes, indicating

that functional tyrosinase is either not translocated to or is not retained within the giant

granules. In contrast to control melanocytes, DOPA-positive vesicles migrated far beyond

their usual perinuclear and trans Golgi network location and were seen in the vicinity of









the plasma membrane in melanocytes from CHS patients. When several melanocyte-

specific proteins were localized histochemically or immunohistochemically, they were

predominantly detected in the perinuclear area and less prevalent in the dendrites of CHS

cells, compared to their relatively uniform distribution throughout the cytoplasm of

control cells (Zhao et al., 1994), suggesting an inefficient intracellular translocation of

these proteins. Medium, conditioned by CHS cells for 1 to 3 days, displayed increasing

amounts of tyrosinase activity that did not exist in medium conditioned by numerous

control cell lines. P3-glucuronidase was also released into the culture medium by CHS

melanocytes but not by control melanocytes. These data suggest that the low tyrosinase

activity in giant melanosomes results from mislocalization and eventual extracellular

secretion of tyrosinase. This hypothesis is supported by the presence of DOPA-positive

vesicles beneath the plasma membrane where fusion/secretion could occur.

Patients with Chediak-Higashi syndrome, especially those who survive into

adulthood, and elderly beige mice, develop serious neurologic defects. Lockman et al.,

1967, reported a patient with the typical clinical and cytological picture of CHS and a

severe motor neuropathy. A median nerve biopsy showed that many Schwann cells

contained large cytoplasmic particles which the authors considered to be abnormal

lysosomes. Two cases with lymphohistiocytic infiltration of the sural and femoral nerves

were described by Sung et al., 1969. The myelin sheaths and axons showed swelling and

fragmentation or had disappeared. Schwann cells were hypertrophic and contained

cytoplasmic inclusions. Ultrastructural examination of dorsal root and sympathetic

ganglion cells demonstrated inclusions resembling lysosomes and lipofuscin granules.









Pettit and Berdal, 1984, reported a 25-year-old man with a neurologic disorder that

resembled a spinocerebellar degeneration and Parkinsonism. Cerebellar cortical atrophy

(Kondo et al., 1994) and diffuse atrophy of the brain with abnormalities in the

periventricular and corona radiata regions were detected by computer tomography and

magnetic resonance imaging (Ballard et al., 1994). The oldest known CHS patient first

seen with a neurologic disorder in early adult life was described by Uyama et al., 1994.

This 39-year-old woman developed mental deterioration, Parkinsonism, muscular atrophy

of limbs, and loss of tendon reflexes. MRI showed marked temporal dominant brain

atrophy and diffuse spinal cord atrophy. Similarly, beige mice that survive to 17 months

of age show a progressive neurologic disorder accompanied by nearly complete loss of

cerebellar Purkinje cells (Murphy and Roths, 1978). Guo et al., 1992, reported

cytoarchitectonic abnormalities in the brains of beige mice. In the cerebellum, Purkinje

cells and clusters of granule cells, and occasionally glia cells, were located ectopically in

the molecular level. In the hippocampus, ectopically situated pyramidal cells were found.

The infrapyramidal mossy fiber layer was not compact, but appeared as clumps of

scattered fiber bundles. Pezeshkpour et al., 1986, reported the presence of giant

lysosomes in Schwann cells in a nerve biopsy from a CHS patient. Peripheral neuropathy

in a 33-year-old brother and a 29-year-old sister with CHS were described by Misra et al.,

1991. Both showed evidence of a sensory neuropathy associated with central nervous

system involvement. Nerve conduction studies indicated an axonal neuropathy. Sural

nerve biopsy demonstrated a loss of myelinated nerve fibers, particularly those of larger

size, and of unmyelilnated axons. By light and electron microscopy, granulated cells with

the staining properties of mast cells were present in the endoneurium. Instead of being the









usual 0.1-0.2 pm in diameter, the granules were approximately 10 times larger and with

unusual appearance. Blume and Wolf, 1972, reported irregular giant inclusions, thought

to be lysosomes, in the cytoplasm of Schwann cells. These morphologic observations of

abnormally large granules suggest that the neurological aberrations in CHS result from

defective vesicular transport of molecules that are important for the normal cellular

function.

Bleeding tendency is another major clinical manifestation in patients and animals

with CHS. While the platelet numbers are normal (Novak et al., 1985; Phillips et al.,

1967), dense platelet granules are virtually absent, whole-blood serotonin is markedly

decreased, and platelets have reduced ability to accumulate serotonin (Meyers et al.,

1974; Meyers et al., 1983). The prolonged bleeding time and low serotonin

concentrations were converted to normal values following transplantation of normal bone

marrow in beige mice. Likewise, control mice displayed symptoms of storage pool

deficiency when transplanted with mutant marrow (Novak et al., 1985). These studies

demonstrate that the CHS platelet storage pool deficiency results from a defect in bone

marrow precursor cells. In agreement with this conclusion, Menard and Meyers, 1988,

showed that the dense granule precursors in maturing and mature megakaryocytes were

absent. Abnormal platelet aggregation was described in 6 patents with CHS (Apitz-Castro

et al., 1985). The total content and the maximal amounts of the dense granule constituents

secreted after thrombin stimulation were greatly decreased. CHS platelets loaded with

radiolabelled serotonin showed a spontaneous release of radioactivity not observed in

normal platelets under the same conditions. Similar defects were reported in cats (Colgan









et al., 1989) and in blue foxes (Sjaastad et al., 1990) with Chediak-Higashi syndrome. In

beige mice, platelet aggregation after stimulation was significantly decreased compared

to that of normal mice (Pratt et al., 1991). Platelets from beige mice were approximately

10 times more sensitive to prostacyclin inhibition of collagen-induced aggregation than

control platelets. The stores of serotonin and adenine nucleotides were decreased. Rendu

et al., 1983, reported a large reduction in the number of serotonin-storage granules (dense

bodies) but otherwise normal ultrastructure and normal amounts of a- and catalase-

positive granules in 3 patients with Chediak-Higashi syndrome. The platelet release

reaction, studied with thrombin as an inducer, was impaired. The serotonin uptake by the

patients' platelets was low and its metabolism was increased. These findings show that

human CHS platelets are deficient in the storage pool of dense granule substances and

suggest that this granule defect influences the release mechanism of other granule

constituents, leading to abnormal aggregation and bleeding predisposition.

Most morbidity and mortality in CHS result from immune deficiency, with severe

defects in innate immunity granulocytess and NK cells) and relatively mild impairment of

acquired immune function (B and T cells).

The initial immune defect recognized in CHS was a striking reduction in the

ability of granulocytes to kill phagocytosed microorganisms (Blume et al., 1968; Gallin

et al., 1974). Phagocytosis of radiolabelled Staphylococcus aureus by CHS granulocytes

was normal. However, there was reduced bactericidal activity of S. aureus and group D

Streptococcus by CHS cells through 90 min of incubation. This defect was most

pronounced at early time periods and was related to impaired intracellular killing. There









are occasional reports suggesting more widespread neutrophil abnormalities. In one study

(Bellinati-Pires et al., 1992), in which phagocytosis and killing of Staphylococcus aureus

were simultaneously evaluated by a fluorochrome phagocytosis assay, both appeared to

be deficient in neutrophils form two patients with CHS. The presence of giant

phagolysosomes, enclosing bacteria in active proliferation 45 min after phagocytosis was

noteworthy, and corresponded with the impaired bactericidal activity of these leukocytes.

In an under-agarose assay, phagocytes of homozygote and phenotypically normal

heterozygote CHS cats recognized and responded equally well to bacterial stimuli as did

cells from control animals but traveled shorter distances primarily because of a reduced

inherent motility. Similar results were obtained when phagocyte chemotaxis was

evaluated with zymosan-activated serum (Colgan et al., 1992). Mildly defective CHS

neutrophil and monocyte locomotion was discovered by the micropore filter technique

using modified Boyden chambers (Yegin et al., 1983). Isolated reports suggest that

diminished surface expression of C3bi receptor and decreased oxygen radical generation

by polymorphonuclear leukocytes (PMNs) might be some of the factors to explain the

moderately defective PMN mobility, chemotaxis and bactericidal activity (Cairo et al.,

1988; Kubo et al., 1987). While the literature contains some conflicting data, the

consensus is that, with the exception of the ability to kill phagocytosed microorganisms,

other granulocyte activities, such as phagocytosis, chemotaxis and protein degradation,

are relatively well preserved in CHS (Gallin et al., 1974; Clawson et al., 1978).

Analogous defects occur in CHS monocytes and macrophages -- cytolysis of tumor

targets is impaired, while phagocytosis and chemotaxis are almost normal (Gallin et al.,

1975; Mahoney et al., 1980). CHS selectively involves crystalloid granules in late









eosinophils, while the non-crystalloid granules are preserved, suggesting that the

underlying pathology does not affect all lysosomal subpopulations (Hamanaka et al.,

1993).

The second category of CHS immune defects is a virtual ablation of natural killer

(NK) cell activity and antibody dependent cellular cytotoxicity (Roder and Duwe, 1979;

Roder et al., 1979, 1982). Mature NK cells demonstrate low lytic efficiency, assessed by

conventional 4 h chromium release assay and by a more recently developed single cell

liquid cytotoxic assay. The NK cells were not activated by prolonged in vitro incubation

with IFN-y, but they exhibited IL-2 induced cytotoxicity, though the magnitude of

induction was uniformly less than in controls (Virelizier and Griscelli, 1980; Holcombe,

1992). CHS NK cells have the necessary cellular structures required for their role as lytic

effector cells, but lack cytotoxic function due to a relative refractoriness in initiating the

post-binding lytic mechanism. NK cells in CHS patients are blocked at a post-

recognition, post-activation step in the cytolytic pathway, subsequent to the burst of

oxygen intermediates but preceding the lethal hit. In summary, while NK cells are present

in normal numbers, bind target cells effectively and generate superoxide ions normally,

exocytosis of lytic granules from the CHS NK cells is refractory (Targan and Oseas,

1983; Roder et al., 1983; Brahmi, 1983).

Tumor susceptibility of bg mice was examined as a direct test of the hypothesis

that NK cells are involved in surveillance against neoplasia. Subcutaneous inoculation in

a transplantation test yielded higher tumor take incidence in bg/bg mice than in

heterozygous littermates. The differences were most striking in the early phase of the









observation period, with a majority of the total tumor takes in bg/bg registered within 2

weeks, whereas only a small part of the tumors in bg/+ mice were palpable at this time.

Thus, in addition to the increased incidence in homozygous mice, the progressively

growing tumors appeared with a shorter latency than in controls. This was also reflected

in the larger mean tumor diameter by 2 and 3 weeks and the earlier deaths among tumor-

bearing bg/bg than bg/+ mice. These findings correlated well with the in vitro measured

splenic NK activity against both tumors tested. Tumor cells had a low, but significant,

sensitivity to bg/+ spleen cell cytotoxicity (5-10 % specific lysis), whereas bg/bg spleen

consistently gave values below 3% specific lysis (Kaerre et al., 1980). In another study, a

tumor line modified to be sensitive to NK cytotoxicity in vitro, demonstrated in vivo an

increased growth rate, faster induction time and an enhanced metastatic capability in bg

compared to control mice. This was not found with a tumor line insensitive to NK

activity. In vivo activation of NK cells in bg and control mice resulted in decrease in

tumor growth rate and metastatic frequency (Talmage et al., 1980). In a large Japanese

cohort, non-Hodgkin's lymphoma occurred in over one third of CHS patients (Hayakawa

et al., 1986). These results indicate that NK cells have an important function in the host's

control of tumor growth and metastasis. The idea to use the bg model to dissect the

contribution of NK cells to immunity, and in particular, to tumor immunosurveillance

was dispelled somewhat, however, by the subsequent recognition of concomitant

impairment, albeit mild, in T and B cell function.

Although both B and T cells are affected in CHS, the abnormalities in the specific

defense mechanisms are not as severe as those in natural immunity and have less

importance for the pathogenesis of CHS. The pathognomonic giant cytoplasmic vesicles









are detected in B cells from CHS patients following activation and differentiation (Grossi

et al., 1985). Moderate and variable reduction of LPS-induced B cell mitogenesis is

demonstrated in CHS. The in vivo anti-trinitrophenyl antibody response to a thymus-

independent antigen (TNP-Ficoll) was found to be significantly lower in C57BL/6J-bg

than in C57BL/6J mice, although both strains responded similarly to an analogous

thymus-dependent antigen (TNP-ovalbumin) (Pflumio et al., 1990). Since the marginal

zone macrophages of the spleen were previously shown to be essential for the initiation of

antibody responses to thymus-independent antigens, they might be another target of the

bg mutation, possibly resulting in impaired antigen presentation to B cells.

It is notable that homozygosity at the bg locus confers protection against immune

complex glomerulonephritis to BXSB mice with systemic autoimmune disease (Clark et

al., 1982). However, this phenomenon is probably not due to a decreased B cell function

because the levels and types of autoantibodies remain unchanged in bg homozygotes.

Extremely high antibody titers to the Epstein-Barr virus specific viral capsid

antigen, to the restricted component of the EBV-induced early antigen complex and to the

EBV-associated nuclear antigen were detected in CHS patients (Merino et al., 1983). It is

likely that the elevated antibody titers reflect an increased production of these antigens

due to defective NK and antibody-dependent cellular cytotoxicity (ADCC) activities.

Cytotoxic lymphocytes (CTLs) from CHS patients are unable to destroy target

cells recognized via the T cell receptor (TCR). Individual CTL clones show poor killing

that can be increased in longer assays. However, in the presence of cycloheximide, the

small amount of killing is abolished, indicating that killing arises from newly synthesized

proteins, rather than from proteins stored in granules. It has been shown that the CHS









CTL clones express normal levels of the lytic proteins granzyme A, granzyme B and

performin, which are processed properly during biosynthesis and targeted correctly to giant

lytic granules. Despite the difference in size, CHS and normal lytic granules are similar,

both contain the lysosomal enzyme cathepsin D and granzyme A, and lack the mannose-

6-phosphate receptor. However, unlike normal CTL clones, the CHS CTLs are unable to

secrete their giant granules in which the lytic proteins are stored. After cross-linking the

TCR, CHS CTL clones fail to secrete granzyme A, as assayed by both enzyme release

and confocal microscopy (Baetz et al., 1995).

The proportion of gamma-delta T cells among peripheral blood mononuclear cells

is significantly increased in CHS. The cellular machinery for lysis of target cells in vitro

is present in CHS-derived gamma-delta T cell clones (Holcombe et al., 1990). This is the

first example of a specific immunodeficiency disorder with a relative expansion of these

T cells.

A short summary of the immunological features of CHS is presented in Table 1.











Table 1. Main immunologic features in Chediak-Higashi syndrome


INNATE IMMUNITY ACQUIRED IMMUNITY



Granulocytes NK cells B cells T cells



1. Greatly reduced 1. Very low lytic 1. Reduced antibody 1. Decreased ability

ability to kill activity caused by response to thymus- of CTLs to kill target

phagocytosed micro- defective exocytosis independent antigens cells, caused by

organisms of lytic granules (may be due to defective secretion of

2. Chemotaxis, 2. Numbers of NK impaired natural lytic granules

phagocytosis and cells, binding to tar- immunity) 2. Relative expansion

other activities are get cells, and oxygen 2. Mildly reduced of gamma-delta T

relatively well radical production are proliferative response cell population

preserved normal to LPS





PATHOGNOMONIC GIANT PERINUCLEAR VESICLES








Most mortality in CHS patients is caused by two manifestations of their immune

deficiency -- severe pyogenic infections and the accelerated phase. Lung, upper

respiratory tract and skin infections caused by Staphylococcus, Streptococcus and

Pneumococcus predominate in CHS, although a wide variety of infection sites and

organisms occur. The accelerated phase is considered a clinicopathologic expression of a

virus-associated lymphoproliferation because of low CD4' to CD8+ T lymphocyte ratio,

presence of Epstein-Barr virus genome in the mononuclear cells of the lymph node, blood

and bone marrow, and possible clinical responses to acyclovir. The current treatment for

CHS patients ranges from vitamins to cytostatic agents and bone marrow transplantation,

but the prognosis remains poor because of increasing susceptibility to infections and

progressive neurologic deterioration. Several studies suggest novel strategies for

immunomodulation: recombinant canine granulocyte colony-stimulating factor to

improve the neutrophil function (Colgan et al., 1992), IL-2 to induce cytotoxicity of CHS

lymphocytes (Holcombe, 1992), and high-dose intravenous gammaglobulin for

management of the accelerated phase (Kinugawa and Ohtani, 1985). The goal of such

therapies would be to partially compensate the immune cell dysfunction caused by the

basic genetic defect and manifested as abnormal protein trafficking.

The transport of newly synthesized proteins from the endoplasmic reticulum to

the Golgi apparatus and from there to the cell surface and elsewhere, is mediated by

transport vesicles, which transfer enclosed proteins by cycles of vesicle budding and

fusion. The abnormalities in CHS can be explained by a compartmental mis-sorting of a

variety of proteins, which are necessary for the proper function of the affected cell types,

for example CHS CTLs cannot secrete stored granzyme A and other lytic proteins, and









therefore cannot lyse target cells efficiently. The morphologic manifestation of the

protein sorting defect in CHS is the presence of giant perinuclear vesicles in the

cytoplasm of the affected cells. The assortment of protein trafficking defects observed in

CHS defies simple explanation: trafficking both to and from the late

endosomal/lysosomal compartments is affected, and proteins which utilize both the

cation-independent mannose-6-phosphate and other transport mechanisms are mis-sorted.

In contrast, targeting of membrane proteins to lysosomal/late endosomal compartments

(LAMP1, LAMP2, rab7, acid phosphatase) is intact. Experiments demonstrating

spontaneous concavalin-A induced capping of CHS granulocytes suggest that the defect

impairs interactions between microtubules and endosomes/lysosomes (Oliver et al.,

1975). However, detailed examination of microtubules and microtubule-based motors has

not disclosed an abnormality (Perou and Kaplan, 1993). In summary, abnormalities in

lysosomal and endosomal processing may explain the clinical features of CHS,

suggesting that the defect involves a protein that regulates certain aspects of trafficking to

and from lysosomal/late endosomal compartments in many cell types.

A summary of the mechanisms involved in the pathogenesis of Chediak-Higashi

syndrome is presented in Fig. 1. All clinical manifestations are caused by a common

defect in the regulation of vesicular trafficking in different cell types: melanosomes are

affected in melanocytes, resulting in partial albinism; dense granules in platelets are

defective, leading to bleeding predisposition; lysosomes and secretary vesicles in

numerous immune cells are deficient, causing frequent infections and increased incidence

of tumors; and giant inclusions are present in Schwann and Purkinje cells, which could be

associated with neurological abnormalities.






BASIC MOLECULAR DEFECT


ABNORMAL LYSOSOMAL/LATE ENDOSOMAL COMPARTMENT (GIANT VESICLES)


MELANOSOMES



MELANOCYTES


LYSOSOMES



MONOCYTES

MACROPHAGES

NEUTROPHILS


SECRETARY VESICLES



EOSINOPHILS

MAST CELLS

NK CELLS

LYMPHOCYTES


DENSE GRANULES



PLATELETS


GIANT INCLUSIONS



SCHWANN CELLS

PURKINJE CELLS


$

PARTIAL

ALBINISM


FREQUENT SEVERE INFECTIONS

INCREASED TUMOR INCIDENCE


BLEEDING

PREDISPOSITION


NEUROLOGICAL

ABNORMALITIES


Figure 1. Mechanisms involved in the pathogenesis of Chediak-Higashi syndrome.









The need for molecular understanding of the basic defect in Chediak-Higashi

syndrome led to the first mapping studies, which were greatly facilitated by the existence

of the mouse model beige. Linkage of satin (sa) with bg defined a new linkage group,

later found to lie on proximal mouse chromosome (Chr) 13 (St. Amand and Cupp, 1958;

Lyon and Meredith, 1969; Lane, 1971). Owen et al., 1986, showed that in mouse, bg is

closely linked to the gene for the y-chain of the T cell receptor (TCR). However, in 3

families with CHS, RFLPs in the TCR y-gene were inherited discordantly with CHS,

demonstrating non-linkage (Holcombe et al., 1987) and suggesting a break in the region

of homology between human chromosome 7p and mouse chromosome 13. Further

refinement of the genetic map of proximal mouse Chr 13 (Justice et al., 1990) led to

linkage of bg to the gene encoding nidogen (Nid), a structural basement membrane

protein (Jenkins et al., 1991). No crossovers between Nid and bg were detected in 123

mice, suggesting that the two loci are within approximately 2.4 cM. Since human nidogen

(NID) has been assigned to Chr lq43 (Olsen et al., 1989), the close linkage between bg

and Nid established a new group of homology between mouse Chr 13 and human Chr 1 q,

suggesting that the gene responsible for the Chediak-Higashi syndrome is located in the

telomeric region of human chromosome I q. These results confirmed the earlier

observation of non-linkage between CHS and TCR-y (Holcombe et al., 1987) and the

existence of a breaking point in the region of homology between mouse Chr 13 and

human Chr 7p. Indeed, linkage between NID and CHS on human chromosome lq was

reported by Goodrich and Holcombe in 1995. Homozygosity mapping using markers

derived from distal human chromosome I q was carried out by Fukai et al., 1996, in four









inbred families or probands with typical childhood Chediak-Higashi syndrome. The

human CHS gene was localized to an 18.8 cM interval, flanked by D1S446 and D1S184,

on Chr lq42-q44. Barrat et al., 1996, studied 10 CHS patients from 9 families and

mapped the CHS locus to an approximately 5 cM region between D 1S163 and D1 S2680

on human chromosome lq42.1-q42.2. As a first step in a positional cloning effort,

Kingsmore et al., 1996a, precisely localized the beige gene to a 0.24 cM interval on

proximal mouse Chr 13 by segregation analysis. In a total of 726 mice from 3 different

backcrosses, bg was found to cosegregate with 6 genetic markers (Nid, Estm9, D13Mit56,

D13Mit]162, D13Mit237 and D13Mit240). The candidacy of Nid and Estm9 was

evaluated by Southern, northern and RT-PCR analyses, which suggested that neither of

these two genes represented the bg gene. However, interstrain differences in pulsed field

restriction fragment lengths were observed, providing a useful and simple test for initial

evaluation of candidate genes. A refined physical map of the bg critical region was

reported by Kingsmore et al., 1996b. Interspersed repetitive element-polymerase chain

reaction (IRE-PCR) and direct cDNA selection were used to identify 20 novel sequence

tag sites which enabled the construction of 2 contigs composed of overlapping YAC and

P 1 clones, covering approximately 2400 kb of the bg non-recombinant interval. In 1996,

two groups simultaneously reported the identification of the homologous beige and

Chediak-Higashi syndrome genes. Barbosa et al., 1996, isolated a gene designated Lyst

(Lysosomal trafficking regulator), from YAC 195A8 by direct selection with mouse

spleen cDNA. It was shown that Lyst represented the beige gene with a complete open

reading frame of 4635 nucleotides, encoding a protein of 1545 amino acids. It was also

demonstrated that corresponding human clones with high degree of homology to mouse









Lyst represented the gene responsible for Chediak-Higashi syndrome. Perou et al., 1996b,

also reported the identification of the beige gene by YAC complementation and

positional cloning. Interestingly, the partial cDNA sequence isolated by Perou et al., did

not match or even overlap with the sequence of Lyst, described by Barbosa et al. One of

the aims of the present dissertation was to explain this discrepancy. This issue was

resolved by the demonstration that each of the previously reported beige gene sequences

was derived from a single gene by alternative splicing (Barbosa et al., 1997; Nagle et al.,

1996), as described in the RESULTS section of this dissertation. However, the

expectations that the identification of the complete mouse and human cDNA sequences of

the CHS gene would elucidate the precise function of the encoded protein, were not met.

The 11403-bp full-length open reading frame corresponded to a polypeptide of 3,801

amino acids, with an estimated molecular mass of 429,153 daltons. Although several

putative domains were found in Lyst, the predicted protein was novel and unlike any of

the molecules previously implicated in vesicular transport (Barbosa et al., 1996, 1997;

Perou et al., 1996b; Nagle et al., 1996). A helical region of Lyst was similar to stathmin,

a phosphoprotein that regulates the polymerization of microtubules and acts as a relay for

intracellular signal transduction. Therefore, this region of Lyst potentially encodes a

protein interaction domain that may regulate microtubule-mediated lysosome trafficking.

Although the CHS protein (LYST) is not predicted to have transmembrane helices, the

carboxy-terminal tetrapeptide (CYSP) of the mouse Lyst-II isoform is similar to known

prenylation sites and may provide attachment to membranes through thioester linkage

with the cysteine. A novel conserved domain, designated BEACH (BEige And CHs), was

defined based on homology with open reading frames from S. cerevisiae, C. elegans and









a human cell division control protein 4-related protein (CDC4L). The function of the

BEACH domain remains unknown. Helical regions in the CHS protein resemble ARM

and HEAT repeat motifs, which tend to form long rods. Some HEAT-containing proteins

are associated with vesicular trafficking but the functional significance of these motifs in

Lyst is unclear. The C-terminal region of the CHS protein contains several consecutive

WD40 motifs, which were originally identified in the P-subunit of the G-protein

transducin. This WD40 region may form P-sheets arranged in a propeller-like structure

that is thought to mediate protein-protein interactions. Based on the presence of ARM,

HEAT, BEACH and WD40 domains, it has been proposed that, similarly to the yeast

serine/threonine protein kinase VPS15, Lyst functions as a component of a membrane-

associated signal transduction complex that regulates intracellular protein trafficking. The

CHS protein contains multiple sites of potential phosphorylation by casein kinase II

(CKII), PKC, cAMP-dependent protein kinase and tyrosine kinase. Lyst seems to contain

helical bundles with clusters of phosphorylation sites at their ends. Phosphorylation of

these positions could provide a control mechanism by causing conformational change in

the bundles, thereby affecting interactions with other molecules. In summary, the

domains identified in Lyst support its potential involvement in the regulation of signal

transduction and protein trafficking but do not place the CHS protein in any known

family and do not define any proteins that interact with Lyst, leaving the question about

its mechanism of action unanswered.

Therefore, the main objective of this dissertation was to characterize the Chediak-

Higashi syndrome gene and its products in more detail, and to identify proteins that









interact with Lyst, in order to get some insights about its biological role. Following the

cloning of the CHS gene in human and mouse, the following specific aims for the present

dissertation were determined:

1. Identification of mutations in patients with Chediak-Higashi syndrome and in

beige mice.

2. Identification and characterization of Lyst mRNA isoforms.

3. Identification and characterization of Lyst2, a brain-specific member of the

Chediak-Higashi syndrome gene family.

4. Identification of proteins that interact with the CHS protein and with LYST2,

using a yeast two-hybrid approach.

Detection of mutations in the CHS gene would help the identification of critical

amino acids and domains in Lyst and would enable genotype-phenotype correlation, as

well as the design of tests for early diagnosis of Chediak-Higashi syndrome. The

characterization of different mRNA isoforms would determine the functional importance

of individual alternatively spliced variants and their expression in different tissues. The

identification of proteins that interact with Lyst would reveal the pathways in which the

CHS protein is involved and would enhance our knowledge about the mechanisms of

regulation of protein trafficking, particularly to and from the lysosomes.














MATERIALS AND METHODS


Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Amplification of CHS

Patient and Beige Mouse cDNAs


Lymphoblastoid and fibroblast cell lines from CHS patients were obtained from

the Coriell Institute for Medical Research (Camden, NJ). Mice carrying different alleles

of the beige mutation and control mice were obtained from The Jackson Laboratory (Bar

Harbor, ME), sacrificed, and their organs were harvested and homogenized. Total cellular

RNA was isolated from human and mouse cells by extraction with phenol/guanidine

isothiocyanate (TRIzol Reagent, Life Technologies Inc., Gaithersburg, MD). One to three

p.g of RNA were reverse transcribed using SuperScript II RNase H- reverse transcriptase

(Life Technologies Inc.), with oligo(dT)-primed first strand cDNA synthesis. DNA

fragments of interest were PCR amplified with KlenTaq DNA polymerase (Clontech

Laboratories, Palo Alto, CA) using the following amplification conditions: 94C for 2

min, then 30 cycles of 94C for 20 s, 55C for 15 s, 68C for 1 min, followed by 6 min at

68C. PCR products were separated by electrophoresis on agarose gels, visualized by

ethidium bromide staining and purified using Wizard PCR Preps DNA Purification

System (Promega, Madison, WI). One tL of purified PCR product was used as template

for a hemi-nested PCR amplification with KlenTaq DNA polymerase under the same









conditions as above. PCR products were separated by electrophoresis on agarose gels,

visualized by ethidium bromide staining and purified using Wizard PCR Preps DNA

Purification System. The DNA concentration in each sample was determined using a

Spectronic 1001 spectrophotometer (Milton Roy/Bausch & Lomb, Rochester, NY) and

the purified PCR products were sequenced either directly or following TA cloning and

plasmid purification.




TA Cloning of PCR Products and Plasmid Purification


PCR products were cloned in the pCR 2.1 vector using the TA Cloning kit

(Invitrogen, San Diego, CA) according to the manufacturer's instructions. Briefly, PCR

products were ligated in pCR 2.1 vector overnight at 14C and INVaF' competent E. coli

cells were transformed with the constructs. Cells were grown overnight at 37C on LB

plates containing 50 plg/mL kanamycin and 40 mg/mL X-Gal, then liquid LB/kanamycin

cultures were inoculated with positive colonies and incubated overnight with shaking

(RPM=225) at 37C, and plasmids were isolated using the Wizard Plus Minipreps DNA

Purification System (Promega). Purified plasmids were visualized on ethidium bromide-

stained agarose gels, the DNA concentration in each sample was determined using a

Spectronic 1001 spectrophotometer and -0.3 [tg were used for sequencing.








Single-Strand Conformation Polymorphism (SSCP) Analysis


Detection of nucleotide changes by SSCP was performed as described by

Aberanthy et al., 1997. Briefly, each PCR product was mixed with an equal volume of

denaturing buffer and heated to 95C for 3 min. The samples were loaded onto 0.8 mm

thick, 10% native polyacrylamide gels which were run at ambient temperature at 9 W for

6-10 h, depending on the size of the PCR product. Bands were visualized by silver

staining (Beidler et al., 1982).




DNA Sequencing and Sequence Analysis


An ABI PRISM 310 Genetic Analyzer and dye terminator cycle sequencing kit

(Perkin Elmer, Foster City, CA) with AmpliTaq DNA polymerase, FS were used for

sequencing according to the manufacturer's instructions. Both strands of purified PCR

products and plasmids were sequenced to confirm the accuracy of the results. Sequences

were analyzed with the GCG Package (Devereux et al., 1984) and searches of the

National Center for Biotechnology Information database were performed using the

BLAST network server (Altschul et al., 1990) (National Library of Medicine, via

INTERNET) and the Whitehead Institute Sequence Analysis Program (MIT, Cambridge,

MA). For analysis of sequences, identified by the yeast two-hybrid method as potential

interacting proteins, see the "Yeast Two-Hybrid Screens" section later in this chapter.








Allele-Specific Oligonucleotide Analysis


PCR products spanning the mutation site in patient 371 were transferred to nylon

membranes using a slot-blot apparatus. Approximately 5 ng of each PCR product was

treated with a denaturing solution (0.5 M NaOH, 1.5 M NaCl), split in half and loaded in

duplicate. Two 17mer oligonucleotides that span the region containing the mutation were

synthesized. One contained the sequence of the normal allele (5'-CGCACATG

GCAACCCTT-3'), while the other contained the sequence of the mutant allele (5'-

GCACATGGGCAACCCTT-3'). These were end-labeled with [y-32P]dATP using T4

polynucleotide kinase and hybridized to the membranes at 50C. Hybridization and wash

buffers were as described (Church and Gilbert, 1984). Membranes were washed

sequentially at 45 C, 55 C and 65C for 10 min each and exposed to X-ray film.




PCR Amplification of Mouse Lyst cDNA Isoforms


Total cellular RNA was isolated from mouse bone marrow cells by extraction

with phenol/guanidine isothiocyanate (TRIzol Reagent). Five jIg of RNA were reverse

transcribed using SuperScript II RNase H reverse transcriptase, with first strand cDNA

synthesis priming by an oligo(dT) primer and a gene-specific primer (5'-CTCGCAGAG

CGGTGCTTATGTCCTGTG-3', 5'-CACAGTCATGGGACTGCTAA-3', for Lyst-I and

Lyst-II, respectively). One iL of cDNA was used as template for PCR amplification

using KlenTaq DNA polymerase. PCR conditions were: 94C for 1 min, then 30 cycles of

94C for 15 s, 68 C for 10 or 5 min (for Lyst-I and Lyst-II, respectively), followed by 20








or 10 min (for Lyst-I and Lyst-II, respectively) at 68 C. The same upstream primer (5'-

AGCGGAGGTGAAGCCTTATGCTGAGACAGT-3') was used for PCR amplification

of both isoforms. Isoform-specific downstream primers used were 5'-

TTATGTCCTGTGGGGACACTCCTTC-3' (for Lyst-I) and 5'-ACAGAGCATCC

CCACTTCCCTATCTAAAGT-3' (for Lyst-II). The 2 shorter mouse isoforms (Lyst-III

and Lyst-IV) were PCR amplified from mouse melanocyte cDNA using KlenTaq DNA

polymerase. PCR conditions were: 94C for 2 min, then 36 cycles of 94C for 20 s, 56C

for 15 s, 68C for 2.5 min, followed by 10 min at 68C. PCR products were separated by

electrophoresis on agarose gels and visualized by ethidium bromide staining. One p.L of

1:500 dilution of PCR products was used as template for a nested PCR amplification with

KlenTaq DNA polymerase. PCR conditions were: 94C for 2 min, then 33 cycles of 94C

for 20 s, 56C for 6 s, 68C for 3 min, followed by 6 min at 68C. PCR products were

separated by electrophoresis on 1.2% low melting point agarose gels, visualized by

ethidium bromide staining, excised from the gel with a sterile blade and purified using

Wizard PCR Preps DNA Purification System. Purified PCR products were cloned in pCR

2.1 vector by the TA method, and sequenced.




Cloning of Human LYST cDNAs


Normal human bone marrow poly(A) RNA was obtained from Clontech

Laboratories and 1 p.g was reverse transcribed using SuperScript II RNase H reverse

transcriptase, with a LYST-specific primer (5'-CTTGTTGGCTAGTGCATATTGA

CACAATCTTCC-3') used for first strand cDNA synthesis. The resulting LYST-specific








cDNA was used as a template for PCR amplification of the LYST coding domain with

KlenTaq DNA polymerase in 50 ptL reactions. PCR conditions were: 94C for 2 min, then

33 cycles of 94 C for 20 s, 63 C for 15 s (for some reactions) and 68C for 10 min,

followed by 12 min at 68C. PCR products were separated on ethidium bromide-stained

low melting point 1% agarose gels, excised with a sterile blade, purified using Wizard

PCR Preps Purification System, and cloned in pCR 2.1 vector by the TA method. Some

PCR products were treated with 10 U exonuclease I (United States Biochemicals) for 15

min at 37 C and reamplified by a nested PCR with KlenTaq DNA polymerase prior to

cloning in the pCR 2.1 vector. The identity of the cloned products was confirmed by PCR

amplification from purified plasmids with LYST-specific primers using Taq DNA

polymerase in 20-uL reactions. PCR conditions were: 94C for 2 min, then 30 cycles of

94C for 20 s, 56 C for 10 s, 72C for 1 min, followed by 5 min at 72 C. PCR products

were visualized on ethidium bromide stained agarose gels and photographed.

Segments of the human LYST cDNA sequence were obtained by an anchored,

nested PCR (5'RACE-PCR) using liver cDNA (Clontech Laboratories) as a template, by

RT-PCR using total RNA and by sequencing of human expressed sequence tags (EST)

similar in sequence to mouse Lyst. For the 5'RACE-PCR, 2 nested primers were derived

from a human EST (GenBank accession No. W26957) and had the following nucleotide

sequences: 5'-CCAAGATGAAAGCAGCCGATGGGGAAAACT-3' and 5'-

TCAGCCTCTTTCTT GCTCCGTGAAACTGCT-3'. For RT-PCR experiments, total

RNA was prepared from the promyelocytic HL-60 cell line. RT-PCR was performed with

Expand polymerase (Boehringer Mannheim) with the following primer pairs: 5'-








AGTTTATGAGTCCAAATGAT-3' and 5'-GAATGATGAAGTTGCTCTGA-3' (bp

490-2034); 5'-CAGCAGTTCTTCAGATGGA-3' and 5'-ATCTTTCTGTTGTTCCC

CTA-3' (bp 1891-3050); and 5'-TAGGGGAGCAACAGAAAGAT-3' and 5'-GCTCAT

AGTAGTATCACTTT-3' (bp 3320-4722). The primers used to amplify the cDNA

between base pairs 1891 and 3050 were derived from the mouse Lyst sequence. Human

primers were designed from the sequence of the PCR product (1159 bp) and used to

amplify the flanking sequences. Human LYST intron oa' was PCR amplified from human

genomic DNA (100 ng) with the primers 5'-CCGCTCGAGTAGGATCTT

TAAGGTGAATAAC-3' and 5'-GTGATACTACTATGAGCCCTTCACAGTATC-3'.

PCR conditions were: 94C for 1 min, then 32 cycles of 94 C for 15 s, 63 C for 20 s and

72 C for 30 s, followed by 10 min at 72 C.




Molecular Probes


The LYST2 probe was PCR amplified from a human fetal brain partial length

cDNA clone (#32273), obtained from Image Consortium, using internal primers.

KlenTaq DNA polymerase was used for amplification and the PCR conditions were as

follows: 94C for 2 min, then 36 cycles of 94 C for 30 s, 54 C for 15 s, 68 C for 5 min,

followed by 5 min at 68 C. PCR product was then purified with Wizard PCR Preps DNA

Purification kit. Other probes are described in the text or in the legends of the

corresponding figures. All probes were radio-labeled by the hexanucleotide technique

(Prime-It II random primer kit, Stratagene) with [at-32P]dCTP (Amersham) according to

the manufacturer's instructions.









Isolation ofLYST2 cDNA Clones


LYST2 clones were isolated by screening cDNA libraries using vector-insert PCR

and hybridization. A human fetal brain cDNA library (Life Technologies Inc.) was

screened using hemi-nested PCR with one vector primer and one LYST2-specific primer.

One p.L of cDNA library (5x109 cfu/ml) was used as template for PCR amplification with

KlenTaq DNA polymerase. PCR conditions were: 94C for 5 min, then 33 cycles of 94C

for 30 s, 63 C for 30 s, 68 C for 3.5 min, followed by 10 min at 68 C. PCR products

were separated by electrophoresis on agarose gels and visualized by ethidium bromide

staining. PCR products were excised from low melting agarose gels, purified (Wizard

PCR Preps DNA Purification kit), and cloned using the TA method. Resulting plasmids

were purified with Wizard Plus Minipreps DNA Purification kit and sequenced.

Membranes containing clones from a human fetal brain cDNA library (Clontech

Laboratories) were screened by hybridization with a radioactively labeled cDNA probe

from the 3'-end of the LYST2 coding domain. Positive clones were detected by

phosphorimaging (Molecular Dynamics), and purified plasmids were isolated and

sequenced. Then new probes were PCR amplified from the 5'-end of the novel cDNA

sequence and the library screening was repeated in order to isolate overlapping clones

extending the sequence in the 5' direction.

A ZAP Express EcoRI mouse embryo cDNA library was screened by

hybridization with the LYST2 probe. Identified cDNA clones were purified using Wizard

Plus Minipreps DNA Purification kit and sequenced.








Southern Blot Analysis and Autoradiography


Genomic DNA was isolated from mouse organs using standard techniques

(Sambrook et al., 1989) or obtained from The Jackson Laboratory (Bar Harbor, ME).

DNA was digested with restriction endonucleases from Promega (Madison, WI) or

Boehringer Mannheim (Indianapolis, IN), and 10-jig samples were subjected to

electrophoresis in 0.85% agarose gels for 20 h at 35V. DNA was transferred to

ZetaProbe (Bio-Rad Laboratories, Hercules, CA) or GenescreenPlus (DuPont Co.,

Wilmington, DE) membranes, which were neutralized in 2x SSC, UV-crosslinked for 1

min and prehybridized at 65C overnight. Hybridization to probes labeled by the

hexanucleotide technique (Prime-It II random primer kit, Stratagene, La Jolla, CA) with

[a-32P]dCTP (Amersham, Arlington Heights, IL) was performed at 65C overnight.

Membranes were washed in a solution containing 2x SSC, 0.1% SDS and 1 mM EDTA

for 30 min at 65C and then in a solution containing 0.5x SSC, 0.1% SDS and 1 mM

EDTA for 5-15 min at 65C. Blots were exposed to X-ray film (DuPont) in FisherBiotech

(Pittsburgh, PA) autoradiography cassettes for 1-7 days and films were developed using a

Konica QX60A processor.




Northern Blot Analysis


Isolation of poly(A) RNA from fibroblast and Epstein-Barr virus-transformed B

lymphoblastoid cell lines, formaldehyde agarose gel electrophoresis and northern blotting

to ZetaProbe membranes were performed according to standard procedures (Sambrook et








al., 1989). Northern blots of 2 [tg poly(A) RNA from various mouse tissues, human

cancer cell lines and human lymphoid tissues, as well as a dot-blot containing poly(A)

RNA from 50 human adult and fetal tissues were obtained from Clontech Laboratories.

The quantity of poly(A) RNA on each dot was normalized for 8 housekeeping genes,

and varied from 100 to 500 ng. Membranes were hybridized with various probes labeled

with [a-32p]dCTP by the hexanucleotide technique (Prime-It II random primer kit).

Hybridization conditions were the same as those employed with Southern blots.

Autoradiography or phosphorimaging was performed using X-ray film or

phosphorimager (Molecular Dynamics, Sunnyvale, CA), respectively.




Simple Sequence Length Polymorphism (SSLP) PCR Amplification


PCR reactions with Taq DNA polymerase (Boehringer Mannheim) were

performed using 40 ng of mouse genomic DNA, 1 jimol/L of each primer (Research

Genetics, Inc., Huntsville, AL) and 200 jimol/L of each dNTP in a 20 gL reaction. PCR

conditions were: 95C for 2 min, then 30-36 cycles of 94C for 20 s, 55 C for 30 s, 72 C

for 20 s, followed by 72 C for 1 min. Amplification products were separated on 3%

agarose gels, visualized by ethidium bromide staining and photographed.




Backcross Mouse Panel and Genetic Mapping


C57BL/6J-bg' X (C57BL/6J-bgo' x CAST/EiJ)F, backcross mice were bred and

maintained as described in Holcombe et al., 1991. Genomic DNA was isolated from









mouse organs using standard techniques (Sambrook et al., 1989) and Southern blots were

prepared. The chromosomal assignment of each probe was determined by linkage

analysis in 93 intersubspecific backcross mice. The 192 genetic markers (156

microsatellite markers, 14 genes, 20 expressed sequence tags (Tchemev et al., 1997) and

2 coat color loci) that have been previously mapped in this panel served as anchor loci

with average genetic distance between them 10 cM. Gene order was determined by

minimization of crossover events and elimination of double crossovers between linked

genes. Intergene distances were expressed in centimorgans (cM) and standard errors were

determined as previously described (Green, 1981; Bishop, 1985).




Cloning of LYST and LYST2 Bait cDNA Fragments in Yeast Two-Hybrid Vectors


Fourteen overlapping cDNA fragments (with average size of -850 bp each),

covering the entire coding domain of LYST, were PCR amplified from LYST cDNAs

cloned in the pCR 2.1 vector. LYST2 cDNA fragments were amplified from EST clone

#32273, obtained from Image Consortium. Primer design ensured that all cDNA

fragments would be amplified in frame and that known domains with potential functional

significance would be preserved. All primers contained specific restriction sites at their

5'-ends and all reverse primers contained stop codons near their 5'-ends. The sequence of

all forward and reverse primers with their restriction sites, and the length and the position

(according to GenBank accession number U67615 for LYST) of the amplified cDNA

fragments are shown in Table 2 (for LYST) and in Table 3 (for LYST2).






Table 2. PCR primers, with restriction sites on their 5'-ends, used to amplify bait cDNA fragments from the LYST gene

GENE, PRIMER SEQUENCE, 5'-> 3' RESTR. FRAGMENT FRAGM
FRAGMENT # (forward upper sequence; reverse lower sequence) ENZYME POSITION,bp SIZE,bp
LYST GCGGTGGATCCCATGAGCACCGACAGTAACTCAC BamHI 190-1056 866
1 GCGGAATTCTCATAGTGTGGGCACTACACTGG EcoRI 9-6_
LYST GCGGTGGATCCCACACTAACTGAGTTCCTAGCAGGCTTTGGGGACTGC BamHI 1051-1950 899
2 (GAGAGA)3CTCGAGTCAATCCATACAACAGCATATTCCAATG XhoI
L YST GCGGAACTAGTGGATCCCAAATCTGTAATCATTCC SpeI 1948-2370 422
3 GGAATTCTCACTGAACAACTATATTGCCTTTCTG EcoRI
L YST GCGAGTGTGGATCCCCAGAAAGGCAATATAGTTGTTCAG BamH 2I
4 GCGGAATTCTCACTCCTCTTTGTGACTTCTGAAC EcoRI
LYST GCGGTGGATCCCCTGTTCAGAAGTCACAAAGAGG BamHI 3190-4032 842
5 GGAATTCTCAAGCAGAAAGCAAATTTAATTCCAG EcoRI
LYST GCGGTGGATCCCCTGGAATTAAATTTGCTTTCTGC BamHI 4009-4821 812
6 GCGGAATTCTCAGGAGCCCAGTGAAATTATATG EcoRI
LYST GCGGTGGATCCCTCCAAAGCGTTGATGATCCAAG BamHI
7 GCGGAATTCTCAAACTCGCAGTGCTAATGCTTG EcoRI 419-5
LYST GCGGTGGATCCCACTCAAGCATTAGCACTGCGAG BamHI 5677-6612 935
8 (GAGAGA)3CTCGAGTCAGGCAACATAAGTATCTGCAATATTTTG XhoI
LYST GCGGTGGATCCCCAAAATATTGCAGATACTTATGTTGCC BamHI 6586-7449 863
9 GCGGAATTCTCATCCCATGTTTCTCACATCTTCCAG EcoRI
LYST GCGGTGGATCCCCTGGAAGATGTGAGAAACATGGG BamHI 7426-8238 812
10 GCGGAATTCTCAGGTCTGGAAAACTGAGGTCTTG EcoRI _
LYST GCGGTGGATCCCAAGACCTCAGTTTTCCAGACCG BamHI 8218-9039 821
11 GCGGAATTCTCAATCCAACTGCCATGAGGTTGG EcoRI
LYST GCGGTGGATCCCGATCCAACAGAAGGGCCAAATC BamHI 9037-9585 548
12 GCGGAATTCTCATGTCAGAGCGGTGATGTTACC EcoRI
LYST GCGGTGGATCCCAAGGTTCGTGATGATGTATACCAC BamHI 9502-10590 1088
13 GCGGAATTCTCACAAGCCTTTTATCCATGACAAAGG EcoRI I_21__
LYST GCGGTGGATCCCTGGATAAAAGGCTTGAAATGGGG BamHI 10576-11611 1035
14 GCGGAATTCTCATGAAGTTCATTCGCATTCACCC EcoRI I_ __ _









Table 3. PCR primers, with restriction sites on their 5'-ends, used to amplify bait cDNA fragments from the LYST2 gene ___
GENE, PRIMER SEQUENCE, 5'-+ 3' RESTR. FRAGMENT FRAGM.
FRAGMENT # (forward upper sequence; reverse lower sequence) ENZYME POSITION, bp* SIZE, bp
L YST2 GCGGAACTAGTGACTTCTGATGTAAAGGAAC SpeI (3-794) 791
1 GCGGAATTCTCAATAGCGATTATCTGCGTGTAC EcoRI (374) 791
LYST2 GCGGAACTAGTGACTTCTGATGTAAAGGAAC SpeI (3-686) 683
2 GCGGAATTCTCATGGATCCATTTCAATGGG EcoRI (3-66)
LYST2 GCGGAACTAGTGGTAACAGCAGATAATCGCTAT SpeI (774-1424) 650
3 GCGGAATTCTCACCAGGGTTAAATGTACAGTTG EcoRi (4424)
LYST2 GCGGAACTAGTGACTTCTGATGTAAAGGAAC Spel 141
4 GCGGAATTCTCACCAGGGTTAAATGTACAGTTG EcoRI (3-1424) 1421


* Since the entire LYST2 cDNA sequence is not known, fragment positions are relative to the beginning of the known LYST2
sequence.









KlenTaq DNA polymerase and 12.5 pmol of each primer were used in each 50 JIL

amplification reaction. PCR conditions were: 94C for 5 min, then 30 cycles of 94 C for

40 s, 50 C for 40 s, 72 C for 2 min, followed by 72 C for 5 min. PCR products were

visualized on ethidium bromide-stained agarose gels, purified using QIAquick PCR

purification kit (QIAGEN Inc., Valencia, CA) and digested with the corresponding

restriction enzymes (Tables 2 and 3) in 20 iiL-reactions overnight at 37 C. Digested PCR

products were excised from 1% low melting point agarose gels, purified using QIAquick

gel extraction kit (QIAGEN Inc.) and ligated in the yeast Gal4 activation domain cloning

vector pAD-GAL4 (modified pGAD GH, Clontech Laboratories) and in the yeast Gal4

DNA-binding domain vector pGB-GAL4 (modified pGBT9, Clontech Laboratories).

DH 10OB competent cells were transformed with the purified constructs by electroporation,

incubated for 1 h at 37 C with shaking (RPM=150) and plated on LB/ampicillin (50

p.g/mL) plates containing X-Gal and IPTG. The identity of cloned fragments was

confirmed by PCR of bacterial colonies with one vector primer and one fragment-specific

primer under the same amplification conditions as above. LB/ampicillin liquid cultures

were inoculated with positive colonies and incubated overnight at 37 C with shaking.

Purified plasmids were isolated using QIAprep Spin Plasmid kit (QIAGEN Inc.) and

visualized on ethidium bromide-stained agarose gels. All inserts were sequenced to

ensure that PCR amplification reproduced an accurate copy of the LYST and LYST2

sequence and that the cDNA fragments were cloned in frame.









Yeast Two-Hybrid Screens


Two types of screening for protein-protein interactions were performed by the

yeast two-hybrid method. In a "forward" screen, one hybrid consisted of the DNA

binding domain of the yeast transcriptional activator Gal4 fused to a "bait" portion of

LYST or LYST2. The other hybrid consisted of the Gal4 activation domain fused to

"prey" sequences encoded by a mammalian cDNA library. In a "reverse" screen, the

"bait" part of LYST or LYST2 was fused to the Gal4 activation domain, and the "prey"

sequences of the mammalian cDNA library were fused to the Gal4 DNA binding domain.

The prey cDNAs were obtained from a human fetal brain cDNA library of 1 x 107

independent isolates (Clontech Laboratories). The library was synthesized from

XhoI-(dT)15-primed fetal brain mRNA (pooled from five male/female 19-22 week fetuses)

that was directionally cloned into either pAD-GAL4, an yeast Gal4 activation domain

cloning vector including the LEU2 gene for selection in yeast deficient in leucine

biosynthesis, or pBD-GAL4, an yeast Gal4 DNA-binding domain cloning vector

including the TRP1 gene for selection in yeast deficient in tryptophane biosynthesis.

To ensure that the bait DNA-binding domain fusions do not possess intrinsic

transcriptional activity, a test for "bait self-activation" was performed. YULH yeast cells,

transformed by the lithium acetate/polyethylene glycol method (Ito et al., 1983) with the

pBD-GAL4 bait constructs, were grown at 30C on SC-Trp medium to select for the

presence of the DNA-binding domain plasmid. The selected yeast cells were then plated

on SC-Ura medium, grown overnight at 30C, and examined for growth. Cells that did

not grow contained baits which were not "self-activating" proteins, that is, these proteins









required interaction with a second protein domain in order to form a functional complex

that can activate the transcription of reporter genes. Baits from non-growing cells were

used for further screening.

In the forward screens, the constructs encoding the baits were introduced by

lithium acetate/polyethylene glycol transformation into the yeast strain YULH (mating

type a, ura3, his3, lys2, Ade2, trpl, leu2, gal4, gal80, GAL1-URA3, GAL]-lacZ), while

the prey sequences were transformed into the yeast strain N106r (mating type a, ura3,

his3, ade2, trpI, leu2, gal4, gal80, cyhr, Lys2::GALlUAS-HIS37A7A-HIS3,

ura3::GALlJu GALTATA-lacZ). For the reverse screens, baits were transformed into N106r

and preys into YULH. Initially, a limited screening using approximately 50,000 prey

library members was performed to ensure that bait fusions do not interact promiscuously

with many proteins (test for non-specific binding). Only baits that did not possess

intrinsic transcriptional activity (i.e., passed the test for "bait self-activation") and that did

not interact indiscriminately with numerous proteins (i.e., passed the test for non-specific

binding), were used for screening the entire prey library. In these full-scale screens, the

two transformed populations were mated using standard methods (Sherman et al., 1991).

Briefly, cells were grown at 30C until mid-to-late log phase on media that selected for

the presence of the appropriate plasmids, i.e. yeast containing activation domain

constructs were grown on SC-Leu medium, while cells containing DNA binding domain

plasmids were grown on SC-Trp medium. The two mating strains, a and a, were then

diluted in YPAD media (Sherman et al., 1991), filtered onto nitrocellulose membranes,

and incubated at 30C for 6-8 hours. The cells were then transferred to media selective for









the desired diploids, i.e., for yeast harboring reporter genes for beta-galactosidase, uracil

auxotrophy, and histidine auxotrophy, and for expression of the vectors encoding the bait

and prey. The mating products were plated on SC (synthetic complete) media (Kaiser et

al., 1994) lacking adenine and lysine (to select for successful mating), leucine and

tryptophane (to select for expression of genes encoded by the bait and prey plasmids),

and uracil and histidine (to select for protein interactions). This medium is referred to as

SCS medium, for SC Selective medium.

Selected clones were tested for expression of P3-galactosidase to confirm the

formation of an LYST:LYST-interacting protein (IP), resp. LYST2:LYST2-IP,

interactions. Filter-lift p3-galactosidase assays were performed as modified from the

protocol of Breeden and Nasmyth, 1985. Colonies were patched onto SCS plates, grown

overnight, and replicated onto Whatman No. 1 filters. The filters were then assayed for

P3-galactosidase activity. Colonies that were positive turned a visible blue, indicating that

a protein-protein interaction has occurred, enabling the transcription of the reporter gene

LacZ.

Cells in colonies positive for protein interaction contained both DNA-binding and

activation-domain plasmids. These cells were regrown as single isolates in individual

wells of 96-well plates. Ten microliters of each isolate were lysed, the inserts within the

pAD-GAL4 and pBD-GAL4 plasmids were amplified by PCR using primers specific for

the insert-flanking sequences of the vectors, and approximately 300 amino-terminal bases

of each insert were determined using an ABI 377 sequencer. Comparison to known

sequences was made using the BLAST program publicly available through the National









Center for Biotechnology Information (N.C.B.I.). The assembly and identity searches of

the sequences encoding human EST were performed by using publicly available EST

assembly databases such as the N.C.B.I. BlastN 2.0 program (Altschul et al, 1990).

Sequences that aligned with 95% or greater identity at the nucleic acid level over their

termini of at least 30 nucleotides were utilized if the alignment resulted in 5' extension or

3' extension of the EST sequence. Once this first assembly was complete, the extended

sequence was again subject to the BlastN comparison to detect new homologies to the

added extensions. The sequence was extended in both directions until new related

sequences that allowed extension of the assembled sequence were no longer detected. The

assembled EST sequence was subjected to further searches using the BlastX 2.0 program

for the identification of protein coding regions by database similarity search (Gish and

States, 1993). The BlastX software translates the DNA sequence in all six reading frames

and compares the translated protein sequence with those in protein databases. The

statistical significance is estimated under the assumption that the equivalent of one entire

reading frame in the query sequence codes for protein and that significant alignments will

involve only coding reading frames. Furthermore, the sequences were analyzed for open

reading frames using software that translates the assembled DNA sequence in all six

reading frames using the standard genetic code. The interacting ESTs were obtained from

directionally-cloned libraries, and thus the direction of translation of the assembled EST

is known as 5' to 3' and the open reading frame is also known. ORFs longer than 50

amino acids following an initiator codon or an ORF with no initiator methionine encoded

at the 5'-end were determined to be possible protein products, and were compared to









sequences in protein data bases using the BLASTP 2.0 program (Altschul et al., 1990).

Further protein sequence analysis was performed after selecting a suitable open reading

frame. The protein sequence was compared to previously characterized protein domains

present in the BLOCKS and PRODOM motif databases (Bairoch, 1992; Henikoff and

Henikoff, 1991; Nakai and Kanehisa, 1992; Wallace and Henikoff, 1992).




Confirmation of the Specificity of Protein Interactions by the Yeast Two-Hybrid System


In addition to sequencing all baits, and the tests for "bait self-activation" and for

non-specific binding, described in the previous section, several other tests were

performed to determine the specificity of the detected bait:prey interactions. In the test for

"prey self-activation", YULH yeast cells were transformed with individual plasmids

encoding the DNA-binding domain fusions of all preys that were detected to interact with

LYST or LYST2. The transformed haploid yeast cells were grown at 30C on SC-Trp

medium to select for the presence of the DNA-binding domain plasmid. The selected

yeast cells were plated on SC-Ura medium, grown overnight at 30C, and examined for

growth. Cells that did not grow contained preys which were not "self-activating" proteins,

that is, these proteins required interaction with a second protein domain in order to form a

functional complex that can activate the transcription of reporter genes. Preys from non-

growing cells were used in the other confirmation tests.

YULH and N106r haploid yeast cells, transformed with DNA-binding domain,

resp. activation domain fusions of preys that were detected to interact with LYST or

LYST2, were grown on SC-Trp or SC-Leu media to select for the corresponding








plasmids. Filter-lift P3-galactosidase assay was performed on the selected haploid cells.

Colonies that did not turn blue contained preys that needed to interact with another

protein in order to activate the transcription of the LacZ reporter gene. Only cells that did

not grow on SC-Ura medium (i.e., passed the test for "prey self-activation") and that did

not turn blue (i.e., passed the P-galactosidase test for haploids) were used in the next

confirmation tests.

The following "matrix mating" test was performed to duplicate the initial forward

and reverse screens and to determine whether the same protein-protein interactions would

be detected. YULH yeast cells, transformed with DNA-binding domain fusions of baits

(forward screen) or preys (reverse screen), and N106r cells, transformed with activation

domain fusions of baits (reverse screen) or preys (forward screen), were grown in YPAD

medium at 30C. The "matrix mating" was performed by spreading yeast containing

individual baits on YPAD plates, transferring (in 96-well format) prey-containing cells

onto the spread baits, and incubating the plates overnight at 30C. Each plate contained

also positive (proteins that are known to interact) and negative (proteins that do not

interact with a particular bait) controls. Resulting diploid colonies were replica-plated on

2 types of media: on SCS, which selected for successful mating, for protein-protein

interactions and for presence of plasmids, and on SC-Leu-Trp plates, which were used for

a filter-lift 13-galactosidase assay. Only baits and preys from diploid yeast cells that were

able to grow on SCS medium (i.e., passed the "matrix mating" test) and that turned blue

(i.e., passed the P3-galactosidase test for diploids), were PCR amplified with vector

primers and the resulting PCR products were sequenced. If sequencing determined that











the identity of a particular bait:prey pair matched that obtained after the initial screens,


the interaction was considered confirmed by the yeast two-hybrid method. An overview


of the described yeast two-hybrid screening and confirmation procedures is shown in


Figure 2.




CLONE LYSTAND LYST2 BAITS IN
ACTIVATION- AND BINDING-DOMAIN VECTORS
4,
SEQUENCE ALL CONSTRUCTS
4,
TRANSFORM IN YEAST
4' 4,
TEST FOR TEST FOR
BAIT SELF-ACTIVATION NON-SPECIFIC BINDING
4, 4,
FORWARD AND REVERSE SCREENS
4,
P3-GAL. TEST FOR DIPLOIDS
4,
PCRINSERIS
4'
SEQUENCE INSERTS
4,
DETERMINE IDENTITY OF BAIT:PREY INTERACTIONS
4,
RE-TRANSFORM YEAST
4, 4,
TEST FOR PREY SELF-ACTIVATION P3-GAL. TEST FOR HAPLOIDS
4, 4,
MATRIX MATING
4,
P3-GAL. TEST FOR DIPLOIDS
4,
PCR INSERTS
4,
SEQUENCE INSERTS
4,
DETERMINE IDENTITY OF BAIT:PREY INTERACTIONS
4,
COMPARE TO INITIAL IDENTITIES
4,
INTERACTION CONFIRMED BY THE YEAST TWO-HYBRID METHOD

Figure 2. Overview of the screening and confirmation procedures by the yeast
two-hybrid method.














RESULTS


Identification of Mutations in Patients with Chediak-Higashi Syndrome and in Beige

Mice


Detection of mutations in the CHS gene of human patients and beige mice was

undertaken for three main reasons:

To provide additional evidence that LYST, resp. Lyst is indeed the gene

responsible for the Chediak-Higashi syndrome in human and for the beige

mutation in mouse

To identify critical amino acids and domains that are essential to the function

of the CHS gene

To determine whether a genotype-phenotype correlation could be established

between different genetic defects and specific disease manifestations.

A summary of mutations detected in patients with Chediak-Higashi syndrome is

shown in Table 4. Several different approaches were used for mutation detection. As an

initial screen for mutations, we analyzed northern blots of poly(A) RNA from CHS

patients. The largest mRNA species (-13 kb) was greatly reduced in abundance or absent

in lymphoblastoid mRNA of patients P 1 and P3, respectively (Fig. 3A), while the smaller

transcript (-4.4 kb) was present and undiminished in abundance in all three patients.










B


4N 4


12kb-

4.4kb-


C


imA> It


373


Figure 3. Mutation analysis in CHS patients. (A) Northern blot of 2 jg aliquots of
lymphoblastoid poly(A) RNA from CHS patients and a control. The probe used for
hybridization corresponds to nucleotides 490-817 of the CHS cDNA (GenBank accession
No. U70064). Exposure time for autoradiography was 48 h. (B) SSCP analysis of cDNA
corresponding to nucleotides 439-806 of the CHS cDNA. Each lane contains samples
from individual patients as indicated. Extra bands in lanes corresponding to patients 371
and 373 are denoted with an arrow. (C) Sequence chromatograms showing mutations in
cDNA clones from patients 371 and 373. The upper part is normal human CHS cDNA
sequence. The arrows indicate the positions of a G insertion (coding domain nucleotide
118, patient 371), and C-+T substitution (coding domain nucleotide 148, patient 373).
The sense strand is shown.








While the selective loss of the larger transcript in these two patients cannot be

excluded definitively, rehybridization of this blot with an actin probe suggested that the

absence of the larger transcript was not due to uneven gel loading or RNA degradation.

Fibroblast poly(A) RNA from three other CHS patients (369, 370 and 373) showed a

moderate reduction in the -13 kb mRNA (51-60% of control by densitometry), while the

-4.4 kb mRNA was essentially unaltered in abundance (103-147% of control).

Single-strand conformation polymorphism (SSCP) analysis was undertaken using

cDNA samples derived from lymphoblastoid or fibroblast cell lines from CHS patients, in

collaboration with Drs. Steve Colman and Margaret Wallace. Anomalous bands were

detected in PCR products from the 5'-end of the open reading frame in two unrelated

CHS patients (371 and 373) that were different from those with probable selective loss of

the larger transcript on northern blots (Fig. 3B). Sequence analysis identified a C--T

substitution at nucleotide 148 of the coding domain in patient 373 (Fig.3C). Four of the

nine cDNA clones derived from patient 373 contained this mutation. Restriction enzyme

digestion confirmed the mutation: TaqI digestion of cDNA (nucleotides 520-808) showed

loss of this restriction site in patient 373 to be heterozygous. The C-+T substitution

creates a stop codon at amino acid 50 (R50X). The mutation in patient 373 occurs within

a CpG dinucleotide, which, when the cytosine is methylated, represents a common

hotspot for mammalian mutations due to deamination.

In patient 371, a G insertion was found at nucleotide 118 of the coding domain,

resulting in a frame shift at codon 40 and termination after amino acid 62 (Fig. 3C).

While analysis of genomic DNA had shown patient 371 to be heterozygous for this









mutation (Nagle et al., 1996), each of five cDNA clones isolated from lymphoblasts of

this patient contained the G insertion. Allele-specific oligonucleotide hybridization of

cDNA from this patient failed to detect a signal with an oligonucleotide corresponding to

the normal allele, suggesting that the patient is transcriptionally hemizygous for the G

insertion. Alternatively, the lack of allele-specific oligonucleotide hybridization may

reflect a base mismatch (such as a polymorphism) within the patient's cDNA.

Mutations were identified in three other CHS patients by cloning and sequencing

fragments of their LYST coding domains. A homozygous C->T substitution at nucleotide

3085 of the coding domain creating a stop codon at amino acid 1029 (Q1029X) was

found in patient 370. In patient 369, a heterozygous frameshift mutation was detected.

Nucleotides 3073 and 3074 of the coding domain were deleted in two of five cDNA

clones, resulting in a frameshift at codon 1026 and termination at codon 1030. A

homozygous C->T substitution at nucleotide 3310 of the coding domain was identified in

patient 372. This mutation created a stop codon at amino acid 1103, resulting in

premature termination. Despite mutation analysis of >6 kb of open reading frame, the

mutations in CHS patients P1 and P3, that may have a selective loss of the larger

transcript on northern blots, have not been identified.

Lymphoblasts from all of these patients (369, 370, 371, 373, P1 and P3) contain

the giant perinuclear lysosomal vesicles that are the hallmark of the Chediak-Higashi

syndrome. The parents of patients 369 and 370 are known not to have been

consanguineous. Patients 369, 370 and 371 had typical clinical presentations of CHS,

with recurrent childhood infections and oculocutaneous albinism. In contrast, the clinical








course of patient 373 was milder this patient has not had systemic infections and

remains alive at age 37. Patient 373 does, however, have hypopigmented hair and irides,

as well as peripheral neuropathy. A summary of the described mutations, detected in

patients with Chediak-Higashi syndrome, is shown in Table 4.

Table 4. Mutations identified in patients with Chediak-Higashi syndrome.


PATIENT ZYGOSITY MUTATION CONSEQUENCE

,,. p .,. ,, Codon 1026 frameshift,
369 Heterozygous bp 3073 & 3074 deleted Codon 1026 frameshift,
stop at codon 1030



370 Homozygous C3085T Q1029X


Codon 40 frameshift,
371 Heterozygous G insertion at bp 118 Codon 40 frameshift,
stop at codon 62



372 Homozygous C3310T stop at codon 1103



373 Heterozygous C148T R50X


X .^,,,Codon 489 frameshift,
Nagle et al., 1996 Homozygous bp 1467 deleted Codon 489 frameshift,
Nagle et aL., 1996 '*stop at codon 566



PI ? 13.5 kb mRNA lack of protein



P3 ? 13.5 kb mRNA lack of protein











Mutations were also identified in several beige alleles. A 5-kb genomic deletion

that contained the 3'-end ofLyst exon P3, and exons y and 6, was found in bg"' DNA. This

mutation was detected by hybridization of Lyst-derived probes to Southern blots of

genomic DNA from all potential progenitor mouse strains (Fig. 4), and by PCR

amplification of several Lyst fragments (Fig. 5). This deletion corresponds to a loss of

approximately 400 internal amino acids of the predicted Lyst protein. Furthermore,

whereas the 5'-end of the bg"' deletion occurs within Lyst exon 3, the 3'-end is intronic.

Therefore the truncated Lyst mRNA in bg"j mice is also anticipated to splice incorrectly,

terminate prematurely, and lack polyadenylation. Unfortunately, it was not possible to

confirm this prediction since bg"j mice are extinct and only archived genomic DNA was

available.

Quantitative reverse transcription (RT)-PCR demonstrated a moderate reduction

in Lyst mRNA in bg and bg' liver, and a gross reduction in bge (Lyst AOD after

normalization for P3-actin mRNA: +/+, 1.00; bgj/bgj, 0.19; bg/bg, 0.28; bg'/bg', 0.40)

(Fig. 6). A commensurate reduction in bg2e transcript abundance was noted by using

several primer pairs derived from different regions of the Lyst cDNA. Aberrant Lyst RT-

PCR products were not observed. The particularly striking (more than fivefold) reduction

in Lyst expression evident in bgj homozygotes suggested the existence of a mutation in

bgZ that results in decreased transcription or mRNA instability. The molecular basis of

the reduction in Lyst mRNA in bge is not yet known.













A B C


9.4-
6.6-~
4.36- -



2.2-
2.0- -m

1.4- -
1.1- -
0.9- "" <
0.6- -

HindIII Mspl Taql Hind III Mspl TaqI Hind Ill Msp Taql









Figure 4. Southern blot identification of an intragenic Lyst deletion in bg"j. A
Southern blot was sequentially hybridized with 3 Lyst probes: (A) the probe (nucleotides
1262-3433 of Lyst cDNA) extends upstream of the bg"j deletion. (B) the probe
(nucleotides 2835-3433 of Lyst eDNA) is completely deleted; (C) the probe (nucleotides
3594-4237 of Lyst cDNA) extends downstream of the bg"' deletion. Restriction
endonucleases are indicated at the bottom of each panel, and molecular size standards (in
kb) are shown to the left. Southern blots were prepared from genomic DNA of all
potential progenitor mouse strains, but only C57BL/10J, C57BL/6J and C57BL/6J- bg'jJ
are shown.









A+

'+ '0e


1.4-
1.1-
0.9-

0.6 -


B

CID


C A


s -
t's- P


S1.9-kb


1.6-kb 0.9-kb 2


bg11J deletion--


.1-kb


-i 3
03


Figure 5. PCR analysis of the bg"' deletion and genomic structure of Lyst in the
vicinity of the deletion. C57BL/10J, C3HeB/FeJ, C57BL/6J and C57BL/6J- bg"j
genomic DNA and Lyst cDNA were used templates in the PCR reactions. Amplicons
illustrated correspond to: (A) Lyst cDNA nucleotides 1337-1837, which represent exon 3
and are upstream of the deletion; (B) nucleotides 2670-3210, which represent exon y,
deleted in bg"j DNA; (C) nucleotides 4913-5433, which represent an exon downstream
from the deletion. No amplicon was observed in control PCR reactions performed
without template. More than 30 other STSs that had been localized within the bg non-
recombinant interval amplified normally from bg"' DNA. (D) Genomic structure of Lyst
in the vicinity of the bg"' deletion. Lyst exons (ac, 1, y, 6, c and <) are depicted by black
boxes, and intervening introns by a solid line. Nucleotides of the mouse Lyst cDNA that
correspond to exonic boundaries are indicated above the boxes. The 3' end of exon P3, and
all of exons y and 6, are deleted in bg"j DNA. Genomic structure and intronic sequences
were ascertained by sequence analysis of nested PCR products, performed with exonic
primers and P1 genomic clone as template. Boundaries of the bg"j deletion were
determined by PCR of genomic DNA.


*B


19















Lyst


Actb

% of +/+
(normalized)


100 40


19 28


Figure 6. Quantitative reverse transcription (RT)-PCR analysis of Lyst in several
bg alleles. Lyst mRNA from bg', bgj, bg and control livers was reverse transcribed, PCR
amplified and the amount of the resulting PCR products was quantitated by measuring
AOD after normalization for P-actin mRNA (% AOD for Lyst are shown below the gel
image).


X\


^ ^ 0











Identification and Characterization of Lyst mRNA Isoforms


The investigation of mRNA isoforms of the CHS gene was undertaken for the

following reasons:

To resolve the discrepancy between the initial reports about the identification

of the beige gene. The partial cDNA sequence, published by Perou et al.,

1996b, did not match the complete open reading frame, reported by Barbosa et

al., 1996.

To identify the isoform of primary functional significance, as well as other

alternatively spliced variants that may have some importance.

To determine which of the predicted domains are crucial for the function of

the CHS protein.

The existence of more than one mRNA isoform of the mouse beige gene

(designated Lyst) had been suggested by northern analysis (Fig. 7) and by the two

different Lyst cDNA sequences that were reported. Northern blots indicated that Lyst is

ubiquitously transcribed, both temporally and spatially, in mouse and human tissues.

Complex alternative splicing, with both constitutive and anatomically restricted Lyst

mRNA isoforms, was also revealed. The largest Lyst transcript in human and mouse was

12-13 kb and additional smaller alternatively spliced variants were also present with

varying abundance in different tissues (Fig. 7).









A


9.5-
7.5-
4.4-

2.5-
1.4-











9.5-
7.5-
4.4-

2.5-
1.4-


B

AAs4y *


3' Lyst Mid. Lyst

C D


x o


5' LYST


5' LYST


Figure 7. Northern blot analysis of mouse and human LYST. (A), (B): northern
blots of 2 jtg poly(A) mRNA from various mouse tissues hybridized with probes that
correspond to (A), nucleotides 4423-4631, and (B), nucleotides 1430-2457 (exon 3) of
mouse Lyst cDNA. (C), (D): northern blots of 2 jLg poly(A) mRNA from (C), human
lymphoid tissues, and (D), human cancer cell lines, hybridized with a probe that
corresponds to nucleotides 357-800 of human LYST cDNA. Molecular size standards (in
kb) are shown to the left.








Mouse Lyst cDNA isoforms were identified by anchored nested PCR (3'-RACE-

PCR). Two fragments (1.25 kb and 2 kb) were amplified from mouse spleen cDNA using

this technique. The 1.25 kb clone contained the 3'-end of the previously described 5893

bp Lyst cDNA that corresponds to a small mRNA isoform (Lyst-II). The 5'-end of the 2

kb clone, however, contained sequence derived from the Lyst-II cDNA, while the 3'-end

sequence was from the largest isoform (Lyst-I, previously called BG) of the beige gene.

Reverse transcription (RT)-PCR confirmed that nucleotides 1-4706 of Lyst are common

to both mRNA isoforms (Fig. 8A). The large isoform cDNA that contains the entire

coding domain was assembled from nucleotides 1-4706 of Lyst, the 2 kb 3'RACE-PCR

clone, and 6824 nucleotides of BG cDNA. This 11 817 bp cDNA sequence (Lyst-I,

GenBank accession number U70015) corresponds to the largest mRNA observed on

northern blots (Fig. 7). This -11.8 kb cDNA however, is truncated at both the 5'-end of

the 5'-untranslated region (UTR) and at the 3'-end of the 3'-UTR, and thus is smaller

than the largest mRNA (-12-13 kb), observed on mouse northern blots.

Analysis of a P1 genomic clone (number 8592), containing the entire beige gene,

revealed that the 11,817 bp Lyst-I cDNA results when splicing occurs from Lyst exon a

(containing nucleotide 4706) to downstream exon T (Figs. 8 and 10). In contrast,

incomplete splicing and reading through intron c' (interposed between exons a and r)

yields the truncated Lyst-II isoform, of length 5893 bp cDNA (Lyst-II, Fig. 8, GenBank

accession number L77884). Lyst intron c' encodes 37 in-frame amino acids followed by a

stop codon and a polyadenylation signal. Lyst-II corresponds to one of several smaller

mRNAs observed on northern blots (Fig. 7). Full-length cDNAs corresponding to the








Lyst-l and Lyst-II isoforms were both amplified from mouse bone marrow RNA by RT-

PCR. The putative Lyst-I and Lyst-II proteins are of relative molecular mass 425 287 (MK

425 kDa) and Mr 172.5 kDa, respectively.


a 477 b

Lyst-I 11.8kb IN
1078
Exon-I Exon-II 72
Intron-I'


Lyst-II Lyst-I
RNA nNA RNA -r


Lyst-l 5.9kb


F1/R1 FI/R2


Figure 8. Alternative splicing of the CHS gene. (A) Alternative splicing of mouse
Lyst. Solid lines represent Lyst exons a and T (not drawn to scale). Splicing of exon aC to
exon -r occurs in the Lyst-I mRNA (-12 kb). The hatched box represents the intronic
region that forms the 3' end of the Lyst-II ORF (5.9 kb). The intron contains a stop codon
(*) and a polyadenylation signal (A). Nucleotide positions indicated are from GenBank
accession No. L77884 (Lyst-II) and U70015 (Lyst-I). (B) Detection of mRNA isoforms of
mouse Lyst by RT-PCR and genomic PCR. DNase-treated mouse melanocyte RNA was
reverse transcribed and amplified with primers F 1/R1 (expected amplicon size 273 bp) or
Fl/R2 (expected amplicon size 560 bp). RNase-treated C57BL/6J DNA was amplified
with primers F 1/R 1.


47.06









cDNAs corresponding to the human homolog of the largest mRNA isoform of the

beige gene were obtained by identification of human expressed sequence tags (ESTs)

similar in sequence to mouse Lyst-I by database searches (GenBank accession numbers

L77889, W26957 and H51623). Intervening cDNA sequences were isolated using RT-

PCR, and a partial human cDNA sequence (GenBank accession number U70064; 7.1 kb)

was assembled by alignment of these clones with the largest mouse bg gene cDNA. The

predicted human and mouse peptides shared 82% identity over 1990 amino acids. The

predicted human amino acid sequence contains a six amino acid insertion at residue 1039,

relative to that of mouse. The complete sequence of the human CHS cDNA was reported

by Nagle et al., 1996. This 13.5 kb cDNA sequence corresponds to the largest mRNA

observed on northern blots from human tissues (CHS-I, Fig. 7 and inset of Fig. 9). These

northern blots also demonstrated the existence of a smaller human transcript (4.5 kb) that

was similar in size to the small mouse Lyst mRNA, and that appeared to differ from the

large isoform in distribution of expression in human tissues (Fig. 7). Assuming that the

genomic derivation of the small human isoform might be the same as the small mouse

isoform, the 3'-end of the small human isoform was identified by cloning human intron

or' using PCR of human genomic DNA with primers derived from exon a and intron ac'.

Similarly to intron a' in the mouse, the sequence of the 5'-end of human intron c'

contained 17 codons in frame with exon a, followed by a stop codon (CHS-II, inset of

Fig. 9). cDNA corresponding to this short human isoform was amplified from human

peripheral blood RNA by RT-PCR with primers from a 5' exon and from intron a',

indicating that this intron was indeed present in CHS-II mRNA.















IU

9 CHS-I -13kb WD40
5' 3'

Stathmin-like .. Probe 2


t 6 Probe 1 Intron o'
Uo
Z
w 5 CHS-II 6kb
z4.

3-








n0 0
W ,O







Figure 9. Comparison of the relative abundance of CHS (LYST) mRNA isoforms
in 50 human tissues after normalization. Probe 2 (specific for the largest isoform CHS-I,
or LYST-I) and the corresponding signal intensity levels are shown in black. Probe 1
(identifies all CHS transcripts) and the corresponding signal intensity levels are shown in
white. Variation of the relative mRNA abundance among tissues was assessed by
phosphorimaging, dot quantitation, subtraction of background and calculation of the
intensity percentage for each tissue. The relative mRNA abundance between normalized
tissues for each probe was expressed as the percentage of the total hybridization signal
obtained for each tissue with that probe. The average percentage intensity for
housekeeping genes in all tissues was -2%. No hybridization was evident to control dots,
containing yeast total RNA, yeast tRNA, E. coli rRNA, E. coli DNA, poly r(A), human
Cotl DNA and human DNA. Exposure time for phosphorimaging was 20 h.









Nucleotides 1-5905 of human small and long isoform cDNAs are identical, and

are followed either by intron a' sequence in the short isoform (GenBank accession

number U84744), or by exon T and the rest of the exons, in the long isoform (inset of Fig.

9). The predicted intron-encoded amino termini of the short mouse and human isoform

peptides share 65% identity.

Additional splicing complexity of smaller isoforms exists. The Lyst-Ill isoform

lacks exons a and 13, while in Lyst-IV, exons a, 13 and y are absent. In both isoforms the

alternative splicing occurs out of frame and results in termination shortly after the splice

junction, suggesting that most likely these two isoforms do not have functional

significance. These splice variants correspond to additional bands observed on northern

blots (Fig. 7). A schematic representation of the four Lyst isoforms is shown in Fig. 10.





exons
Lyst-1,~-12kb 5'1 a 1 cP3 157 1Y1E 1 3'

Lyst-I,~-5.9kb JP 17 1 l I al

Lyst-IlI, 720 bp P INTRONIC

Lyst-IV, 744 bp Ml1
*



Figure 10. Schematic representation of the four mRNA isoforms of the Chediak-
Higashi syndrome gene (*, stop codon; A, poly-A).








In an effort to evaluate the functional significance of the two largest Lyst

isoforms, genetic complementation experiments were initiated in collaboration with Dr.

Stephen Brandt, Vanderbilt University. Full-length Lyst-I and Lyst-II isoforms were

amplified from mouse bone marrow cDNA by long-range PCR and cloned in expression

vectors. The resulting constructs were expressed in cultured fibroblasts from beige mice,

exhibiting the characteristic giant perinuclear granules in the cytoplasm. The effect was

evaluated by observing the changes in the size and distribution of specifically stained

lysosomes and endosomes. Some cells, expressing full-length Lyst-I, demonstrated more

peripheral distribution of the stained granules in the cytoplasm and slight reduction of

their size. Such changes were not visible in cells expressing the smaller Lyst-II isoform,

supporting the hypothesis that the largest splice variant (Lyst-I) represents the mRNA

isoform of primary functional significance. However, since the effects of the

complementation were not very prominent and were not observed in all cells expressing

Lyst-I, the significance of the described genetic complementation is questionable.

Analysis of northern blots of mouse mRNA had suggested that the relative

abundance of the large and small transcripts differed from tissue to tissue (Fig. 7). The

relative abundance of mRNA isoforms of the homologous gene in human tissues at

different developmental stages was examined (Fig. 9) by sequential hybridization of a

poly(A) RNA dot-blot with a cDNA probe (inset of Fig. 9, Probe 2, shown in black,

nucleotides 10941-11590 of human CHS, GenBank accession No U67615) specific for

the largest isoform and with a cDNA probe (inset of Fig. 9, Probe 1, shown in white,

nucleotides 190-445 of human CHS, GenBank accession No U70064 and U84744) that

identifies all CHS transcripts (Fig. 9). The inset in Fig. 9 shows the human 5.8 kb cDNA









isoform (CHS-II, or LYST-II, which arises through incomplete splicing, with intron o'

supplying the 3'-end of the transcript), the largest isoform (CHS-I, or LYST-I, 13.5 kb,

which results from removal of intron a') and the location of the probes. The quantity of

poly(A) RNA on the blot was normalized to eight housekeeping genes (phospholipase,

ribosomal protein S9, tubulin, highly basic 23 kDa protein, glyceraldehyde-3-phosphate

dehydrogenase, hypoxantine guanine phosphoribosil transferase, P-actin and ubiquitin).

Using a probe that hybridized only to the largest mRNA isoform on northern

blots, transcripts were most abundant in thymus (adult and fetal), peripheral blood

leukocytes, bone marrow and several regions of the adult brain (Fig. 9). Interestingly, the

largest mRNA isoform was not detected in fetal brain. There was also low relative

expression of this isoform in heart, lung, kidney and liver in both adult and fetal tissues.

A somewhat different pattern of relative expression was evident upon

rehybridization of the blot with a probe derived from the 5'-end of the coding domain of

the CHS gene, a region that hybridized to all mRNA isoforms on northern blots.

Consistent with the transcription pattern of the largest isoform, this probe detected

abundant expression on peripheral blood leukocytes, thymus (adult and fetal) and bone

marrow. However, several tissues with abundant large isoform transcripts exhibited

considerably less relative expression with the 5'-probe, including most regions of the

adult brain, fetal and adult thymus, and spleen. Furthermore, several tissues with

negligible relative transcription of the large isoform exhibited increased relative

expression with the 5'-probe, including adult and fetal heart, kidney, liver, and lung; adult

aorta, thyroid gland, salivary gland and appendix; and fetal brain (Fig. 9).








Identification and Characterization of Lyst2. a Brain-Specific Member of the Chediak-

Higashi Syndrome Gene Family


Identification and Sequence Analysis

In an effort to identify genes similar to the CHS gene, extensive database searches

were performed. BLASTX comparison of mouse Lyst (U70015) to public EST databases

revealed a significant, but non-identical, match with an uncharacterized human EST

(R17955). The corresponding partial-length cDNA clone (#32273, length 1986 bp),

derived from a human infant brain cDNA library, was sequenced. An additional 250 bp of

cDNA sequence, located immediately 5' of clone 32273, was obtained by insert-vector

PCR of a human fetal brain cDNA library. The resulting total sequence (2.2 kb, Fig. 11 a)

corresponded to the 3' end of the coding domain and the 3' UTR of a novel gene that was

designated LYST2 (lysosomal trafficking regulator 2, Fig.1 lb). Amino acid identity of

LYST2 with LYST varied from region to region: LYST2 amino acids 16-222 shared 50.2

% identity with LYST residues 3215-3425. This region corresponds to the BEACH

domain (amino acids 3116-3461) of LYST, and exhibited sequence similarity to

anonymous ORFs from S. cerevisiae, C. elegans and human CDC4L protein (Nagle et

al., 1996). In contrast, the WD repeat-containing carboxy-terminal domain of LYST,

which is predicted to assume a six-bladed beta-propeller structure similar to the B-subunit

of heterotrimeric G proteins (Sondek et al., 1996), shared little amino acid similarity with

LYST2. The latter region of LYST2 did, however, contain LYST-like WD repeats, and

also exhibited significant sequence similarity to the B-subunit of heterotrimeric G proteins








(30.4 % identity LYST2 amino acids 368-501 to GB {P49027}). The LYST 3' UTR

demonstrated 42.1% identity to 584 bp of the 3' UTR of LYST2.

In an effort to identify the mouse homolog of human LYST2, a mouse embryo

cDNA library was screened with a human LYST2 probe, and two overlapping clones of

total length of-2.5 kb were identified (Fig. l ic). The corresponding partial mouse

putative protein (Lyst2, Fig. 1 ld) exhibited 29.4% identity over 676 amino acids to

mouse Lyst and 96.2 % identity in 557 amino acids to human LYST2.

Genetic Mapping

In order to confirm that Lyst and Lyst2 are indeed two different genes, and to

evaluate the potential candidacy of Lyst2 for mouse coat color mutations, Lyst2 was

mapped by cross-hybridization in the mouse using unique CAST/EiJ restriction fragment

length polymorphisms with MspI (-4.1 kb) and EcoRI (-3.6 kb). Linkage analysis using

DNA from 93 intersubspecific backcross [C57BL/6J-bg X (C57BL/6J-bg' x CAST/EiJ)

F1] mice revealed that Lyst2 maps on mouse Chr 3 (Fig. 12). The best gene order and

recombination frequency ( standard error) were: centromere D3MUt21 6.452.5 cM -

Lyst2 5.382.3 cM D3Mit22-telomere (GenBank accession number AF072372).

LYST2 was mapped on human Chr 13 by hybridization to Southern blots of

human-rodent somatic cell hybrids, in collaboration with Dr. Margaret Wallace. No

cross-hybridization to LYST was observed (Fig. 13). While the CHS gene maps on human

Chr 1 and on mouse chromosome 13, LYST2 was localized to human Chr 13 and to

mouse chromosome 3, confirming that LYST and LYST2 are indeed two different genes.







63



a) Human LYST2 DNA:
1 CCGAAGAGAG CTGTGTTTTA TGCAGAGCGT TATGAGACAT GGGAAGATGA
51 TCAAAGCCCA CCCTACCATT ATAATACCCA TTATTCAACA GCAACATATA
101 CTTTATCCTG GCTTGTTCGA ATTGAACCTT TCACAACCTT CTTCCTCAAT
151 GCAAATGATG GAAAATTTGA TCATCCAGAT CGAACCTTCT CATCCGTTGC
201 AAGGTCTTGG AGAACTAGTC AGAGGGATAC TTCTGATGTA AAGGAACTAA
251 TTCCAGAGTT CTACTACCTA CCAGAGATGT TTGTCAACAG TAATGGATAT
301 AATCTTGGAG TCAGAGAAGA TGAAGTAGTG GTAAATGATG TTGATCTTCC
351 CCCTTGGGCA AAAAAACCTG AAGACTTTGT GCGGATCAAC AGGATGGCCC
401 TAGAAAGTGA ATTTGTTTCT TGCCAACTTC ATCAGTGGAT CGACCTTATA
451 TTTGGCTATA AGCAGCGAGG ACCAGAAGCA GTTCGTGCTC TGAATGTTTT
501 TCACTACTTG ACTTATGAAG GCTCTGTGAA CCTGGATAGT ATCACTGATC
551 CTGTGCTCAG GGAGGCCATG GAGGCACAGA TACAGAACTT TGGACAGACG
601 CCATCTCAGT TGCTTATTGA GCCACATCCG CCTCGGAACT CTGCCATGCA
651 CCTGTGTTTC CTTCCACAGA GTCCGCTCAT GTTTAAAGAT CAGATGCAAC
701 AGGATGTGAT AATGGTGCTG AAGTTTCCTT CAAATTCTCC AGTAACCCAT
751 GTGGCAGCCA ACACTCTGCC CCACTTGACC ATCCCCGCAG TGGTGACAGT
801 GACTTGCAGC CGACTCTTTG CAGTGAATAG ATGGCACAAC ACAGTAGGCC
851 TCAGAGGAGC TCCAGGATAC TCCTTGGATC AAGCCCACCA TCTTCCCATT
901 GAAATGGATC CATTAATAGC CAATAATTCA GGTGTAAACA AACGGCAGAT
951 CACAGACCTC GTTGACCAGA GTATACAAAT CAATGCACAT TGTTTTGTGG
1001 TAACAGCAGA TAATCGCTAT ATTCTTATCT GTGGATTCTG GGATAAGAGC
1051 TTCAGAGTTT ATACTACAGA AACAGGGAAA TTGACTCAGA TTGTATTTGG
1101 CCATTGGGAT GTGGTCACTT GCTTGGCCAG GTCCGAGTCA TACATTGGTG
1151 GGGACTGCTA CATCGTGTCC GGATCTCGAG ATGCCACCCT GCTGCTCTGG
1201 TACTGGAGTG GGCGGCACCA TATCATAGGA GACAACCCTA ACAGCAGTGA
1251 CTATCCGGCA CCAAGAGCCG TCCTCACAGG CCATGACCAT GAAGTTGTCT
1301 GTGTTTCTGT CTGTGCAGAA CTTGGGCTTG TTATCAGTGG TGCTAAAGAG
1351 GGCCCTTGCC TTGTCCACAC CATCACTGGA GATTTGCTGA GAGCCCTTGA
1401 AGGACCAGAA AACTGCTTAT TCCCACGCTT GATATCTGTC TCCAGCGAAG
1451 GCCACTGTAT CATATACTAT GAACGAGGGC GATTCAGTAA TITCAGCATF
1501 AATGGGAAAC TITI'GGCTCA AATGGAGATC AATGATTCAA CACGGGCCAT
1551 TCTCCTGAGC AGTGACGGCC AGAACCTGGT CACCGGAGGG GACAATGGGG
1601 TAGTAGAGGT CTGGCAGGCC TGTGACTTCA AGCAACTGTA CATTTAACCC
1651 TGGATGTGAT GCTGGCATTA GAGCAATGGA CTTGTCCCAT GACCAGAGGA
1701 CTCTGATCAC TGGCATGGCT TCTGGTAGCA TTGTAGCTTT TAATATAGAT
1751 TTTAATCGGT GGCATTATGA GCATCAGAAC AGATACTGAA GATAAAGGAA
1801 GAACCAAAAG CCAAGTTAAA GCTGAGGGCA CAAGTGCTGCATGGAAAGGC
1851 AATATCTCTG GTGGAAAAAA TTCGTCTACA TCGACCTCCG TTTGTACATT
1901 CCATCACACC CAGCAATAGC TGTACATTGT AGTCAGCAAC CATTTTACTT
1951 TGTGTGTTTT TTCACGACTG AACACCAGCT GCTATCAAGC AAGCTTATAT
2001 CATGTAAATT ATATGAATTA GGAGATGTTT TGGTAATTAT TTCATATATT
2051 GTTGTITATT GAGAAAAGGT TGTAGGATGT GTCACAAGAG ACTTTTGACA
2101 ATTCTGAGGA ACCT'GTGTC CAGTTGTTAC AAAGTTTAAG CTTTGAACCT
2151 AACCTGCATC CCATIVCCAG CCTCTTTTCA AGCTGAGAAA AAAAAAAAAA
2201 AAAAA

b) Human LYST2 peptide:
1 PKRAVFYAER YETWEDDQSP PYHYNTHYST ATYTLSWLVR IEPFTTFFLN
51 ANDGKFDHPD RTFSSVARSW RTSQRDTSDV KELIPEFYYL PEMFVNSNGY
101 NLGVREDEWVV VNDVDLPPWA KKPEDFVRIN RMALESEFVS CQLHQWIDLI
151 FGYKQRGPEA VRALNVFHYL TYEGSVNLDS ITDPVLREAM EAQIQNFGQT
201 PSQLLIEPHP PRNSAMHLCF LPQSPLMFKD QMQQDVIMVL KFPSNSPVTH
251 VAANTLPHLT IPAVVTVTCS RLFAVNRWHN TVGLRGAPGY SLDQAHHLPI
301 EMDPLIANNS GVNKRQITDL VDQSIQINAH CFVVTADNRY ILICGFWDKS
351 FRVYTTETGK LTQIVFGHWD VVTCLARSES YIGGDCYIVS GSRDATLLLW
401 YWSGRHHIIG DNPNSSDYPA PRAVLTGHDH EVVCVSVCAE LGLVISGAKE
451 GPCLVHTITG DLLRALEGPE NCLFPRLISV SSEGHCIIYY ERGRFSNFSI
501 NGKLLAQMEI NDSTRAILLS SDGQNLVTGG DNGVVEVWQA CDFKQLYI*

c) Mouse Lyst2 DNA:
1 GCAGCAGGGC GAACCGGACC TCTGTGATGT TTAATTTTCC TGACCAAGCA
51 ACAGTTAAAA AAGTTGTCTA CAGCTTGCCT CGGGTTGGAG TGGGGACCAG
101 CTATGGTTrG CCACAAGCCA GGAGGATATC ACTGGCCACT CCTCGACAGC
151 TGTATAAGTC TTCCAATATG ACTCAGCGCT GGCAAAGAAG GGAAATCTCC
201 AACTTrGAGT ATTrGATGTT TCTCAACACG ATAGCAGGTC GGACGTATAA
251 TGATCTGAAC CAGTATCCTG TGTTTCCATG GGTGTTAACA AACTATGAAT







64


301 CAGAGGAGTT GGACCTGACT CTCCCAGGAA ACTTCAGGCA TCTGTCAAAG
351 CCAAAAGGTG CTTTGAACCC GAAGAGAGCA GTGTTTTACG CAGAGCGCTA
401 TGAGACATGG GAGGAGGATC AAAGCCCACC CTTCCACTAC AACACACATT
451 ACTCAACGGC GACTTCCCCC CTTTCATGGC TTGTTCGGAT TGAGCCATTC
501 ACAACCTTCT TCCTCAATGC AAATGATGGG AAATTTGACC ATCCAGACCG
551 AACCTTCTCA TCCATTGCAA GGTCATGGAG AACCAGTCAG AGAGATACAT
601 CCGATGTCAA GGAACTAATT CCAGAGTTCT ATTACGTACC AGAGATGTTT
651 GTCAACAGCA ATGGGTACCA TCTTGGAGTG AGGGAGGACG AAGTGGTGGT
701 TAATGATGTG GACCTGCCCC CCTGGGCCAA GAAGCCAGAA GACTTTGTGC
751 GGATCAACAG GATGGCCCTG GAAAGTGAAT TTGTTTCTTG CCAACTCCAT
801 CAATGGATTG ACCTTATATT TGGCTACAAA CAGCGAGGGC CAGAGGCAGT
851 CCGTGCTCTC AATG'T1TCC ACTACTTGAC CTACGAAGGC TCTGTAAACC
901 TGGACAGCAT CACAGACCCT GTGCTCCGGG AGGCCATGGT TGCACAGATA
951 CAGAACTTTG CCCAGACGCC ATCTCAGTTG CTCATTGAGC CGCATCCGCC
1001 TAGGACTTCA GCCATGCATC TGTGTTCCCT TCCACAGAGC CCACTCATGT
1051 TCAAAGATCA GATGCAGCAG GATGTGATCA TGGTGCTGAA GTTTCCATCC
1101 AATTCTCCTG TGACTCATGT GGCTGCCAAC ACCCTGCCCC ACCTGACCAT
1151 CCCTGCAGTG GTGACAGTGA CCTGCAGCCG ACTGTTTGCA GTGAACAGAT
1201 GGCACAACAC AGTCGGCCTC AGAGGAGCCC CCGGATACTC CTTGGATCAA
1251 GCACACCATC TTCCCATTGA GATGGACCCA TTAATCGCAA ATAACTCTGG
1301 TGTGAACAAG CGGCAGATCA CAGACCTTGT AGACCAGAGC ATCCAGATCA
1351 ATGCCCACTG CTTCGTGGTC ACAGCTGATA ATCGCTACAT CCTCATCTGT
1401 GGGTTTTGGG ATAAAAGTTT CAGAGTTTAC TCGACAGAAA CAGGGAAACT
1451 GACACAGATT GTATTTGGCC ACTGGGATGT TGTCACATGC CTGGCCAGGT
1501 CGGAGTCCTA CATTGGTGGA GACTGCTACA TAGTGTCTGG ATCTCGGGAC
1551 GCCACCTTGC TTCTCTGGTA CTGGAGTGGG CGTCACCACA TCATCGGAGA
1601 CAACCCCAAT AGCAGTGACT ATCCTGCGCC CAGAGCTGTC CTCACAGGCC
1651 ATGACCATGA AGTTGTCTGT GTCTCCGTCT GTGCAGAACT CGGACTCGTT
1701 ATCAGTGGTG CTAAAGAGGG CCCTUGCCTC GTTCATACCA TCACTGGAAA
1751 TCTGCTGAAG GCCCTGGAAG GACCAGAAAA CTGCTTATTT CCACGCCTAA
1801 TTTCGGTATC CAGTGAAGGC CACTGCATCA TATATTATGA GCGAGGACGG
1851 TTTAGCAACT TCAGCATCAA TGGGAAACTT TTGGCTCAAA TGGAGATCAA
1901 TGATTCCACT AGGGCTATTC TCCTGAGCAG CGATGGACAG AACCTGGTGA
1951 CTGGAGGGGA CAATGGTGTG GTGGAGGTCT GGCAGGCCTG TGACTTTAAG
2001 CAGCTGTACA TTTACCCAGG ATGTGATGCT GGCATTAGAG CGATGGATTT
2051 ATCCCATGAC CAAAGGACTC TGATCACTGG CATGGCTTCC GGCAGCATTG
2101 TACTTTTAAT ATAGATTTTA ATCGGTGGCA TTATGAGCAT CAGAACAGTA
2151 CTGAAGAGAA GCAGCAGAAG CCACATTCAA GTGAGAGCAC AAGTGCTTCT
2201 GTGGAAAGGC AGTATCTCTG GTGGGACGCT GGTCCACATC GGCCTCTGCT
2251 TGTACATCCA TCCCACCCAG CAGTCGCCGA ACATCATAGT CGGGAGCCAT
2301 TTCACCCTGT TTTTCCAGGA CTGAACACCA GCTGCTGTCA AGCAAGCTTA
2351 TATCATGTAA ATTATCTGAA TTAGGAGCCG TTTTGGTAAT TATTTCATAT
2401 ATCGCCGTTT ATTGAGAAAA GGTTGTAGGA AGCCTCACAA GAGACTITTG
2451 ACAATTCTGA GGAACCTTGT GCCCAGTTGT TACAAAGTTT AAGCTTTGAA
CCTAACTTGC ATCCCATTTC CAGCCTCGGG CTTCACTCGT GCC

d) Mouse Lyst2 peptide:
1 SRANRTSVMF NFPDQATVKK VVYSLPRVGV GTSYGLPQAR RISLATPRQL
51 YKSSNMTQRW QRREISNFEY LMFLNTIAGR TYNDLNQYPV FPWVLTNYES
101 EELDLTLPGN FRHLSKPKGA LNPKRAVFYA ERYETWEEDQ SPPFHYNTHY
151 STATSPLSWL VRIEPFTTFF LNANDGKFDH PDRTFSSIAR SWRTSQRDTS
201 DVKELIPEFY YVPEMFVNSN GYHLGVREDE VVVNDVDLPP WAKKPEDFVR
251 INRMALESEF VSCQLHQWID LIFGYKQRGP EAVRALNVFH YLTYEGSVNL
301 DSITDPVLRE AMVAQIQNFA QTPSQLLIEP HPPRTSAMHL CSLPQSPLMF
351 KDQMQQDVIM VLKFPSNSPV THVAANTLPH LTIPAVVTVT CSRLFAVNRW
401 HNTVGLRGAP GYSLDQAHHL PIEMDPLIAN NSGVNKRQIT DLVDQSIQIN
451 AHCFVVTADN RYILICGFWD KSFRVYSTET GKLTQIVFGH WDVVTCLARS
501 ESYIGGDCYI VSGSRDATLL LWYWSGRHHI IGDNPNSSDY PAPRAVLTGH
551 DHEVVCVSVC AELGLVISGA KEGPCLVHTI TGNLLKALEG PENCLFPRLI
601 SVSSEGHCII YYERGRFSNF SINGKLLAQM EINDSTRAIL LSSDGQNLVT
651 GGDNGVVEVW QACDFKQLYI YPGCDAGIRA MDLSHDQRTL ITGMASGSIV
LLI*


Fig. 11. Partial cDNA (a, c) and predicted amino acid (b, d) sequences of human
(a, b) and mouse (c, d) lysosomal trafficking regulator 2, LYST2.


















D3Mit2 l [] DEWED
Lyst2 F] DDF EED
D3Mit221[ [I [ D

#of mice3745 4 2 4 1


D3Mit21


Lyst2


D3Mit22.


-cM 19.2
6.452.5 cM
5.382.3 cM
-cM33.7


EcoRP


Figure 12. Genetic mapping of Lyst2 on mouse chromosome 3.
a) Autoradiograph of a Southern blot of mouse genomic DNA, digested with
EcoRI and hybridized to a Lyst2 probe. Molecular size standards (in kilobases) are shown
to the left. The arrowhead indicates the RFLP, which was used for the genetic mapping
and was present in DNA from (C57BL/6J-bg' x CAST/EiJ) F, (be) but not in
homozygous C57BL/6J-bgj (bb) DNA.
b) Haplotype analysis of Lyst2, D3Mi21 and D3Mit22 on mouse chromosome 3
in 93 [C57BL/6J-bg X (C57BL/6J-bg x CAST/EiJ) FI] intersubspecific backcross mice.
Black squares represent the homozygous C57BL/6J pattern and white squares, the F1
pattern. The number of mice of each haplotype is indicated.
c) Composite genetic map of part of mouse chromosome 3, showing the relative
position of the Lyst2 locus. Marker locations are expressed as genetic distance from the
centromere (in centimorgans), and intermarker distances ( standard error) are shown.


bbbc
9.4 -*,g,
6 6 ^
4.4 T-

2.3













E -g E
-r 2 22 13 14 15 16 17 -
9.4--

6.6- I .

4.3-











Figure 13. Mapping of LYST2 on human chromosome 13 by human-rodent
somatic cell hybrids. An EcoRI monochromosomal somatic cell hybrid Southern blot was
hybridized to [a-2P]dCTP-labeled LYST2 probe. Lane 1 contains control human DNA;
lane 2 control mouse DNA; lane 3 human Chr 22 on hamster background; lanes 4 to 8
- human Chr 13, 14, 15, 16, and 17, respectively, on mouse background; lane 9 control
hamster DNA. Molecular size standards (in kilobases) are shown to the left of the gel.








Expression Analysis

In order to determine the size of the LYST2 transcripts) and their abundance in

different organs, expression analysis was performed using northern blots from various

human and mouse tissues.

Transcript size in mouse and human. Hybridization of a LYST2 probe to northern

blots of mouse and human tissues (Fig. 14) revealed that the largest band was 12-13 kb,

very similar to the size of the largest isoform (LYST-I) of the Chediak-Higashi syndrome

gene (Barbosa et al., 1997). Low levels of additional transcripts of -6 kb and -5 kb were

visible in mouse brain RNA.

Transcript abundance in mouse. Hybridization to poly(A) northern blots from 8

mouse tissues showed that Lyst2 was abundantly expressed only in brain. Moderate

expression was observed in kidney, and weak expression in heart, lung, skeletal muscle

and testis. The gene was not expressed in spleen and liver (Fig. 14a).

Transcript abundance in human. In northern blots of selected human tumor cell

lines (Fig. 14b), LYST2 was moderately expressed in melanoma and colorectal

adenocarcinoma, weakly expressed in HeLa, lymphoblastic leukaemia and Burkitt's

lymphoma cells and not expressed in promyelocytic and myelogenous leukaemia, or in

lung carcinoma lines. In 7 normal human tissues, LYST2 was weakly expressed in spleen,

lymph node, thymus and appendix and not expressed in peripheral blood leukocyte, bone

marrow and fetal liver (Fig. 14c).

The relative abundance of LYST and LYST2 mRNA in 50 human tissues was

compared by sequential hybridization of corresponding gene-specific probes to a








poly(A) RNA dot blot (Fig. 15). The quantity of poly(A) RNA loaded on the blot was

normalized to 8 housekeeping genes (phospholipase, ribosomal protein S9, tubulin, a

highly basic 23 kDa protein, glyceraldehyde-3-phosphate dehydrogenase, hypoxanthine

guanine phosphoribosil transferase, 13-actin and ubiquitin).

When a probe specific for the largest mRNA isoform of LYST was hybridized to

the blot, transcripts were most abundant in immune system organs (adult and fetal

thymus, peripheral blood leukocytes, bone marrow) and in several regions of adult brain

(Fig. 15). There was moderate to low relative LYST expression in most of the other

tissues tested. Interestingly, no LYST expression was detected in fetal brain, as well as in

salivary gland, kidney, lung and fetal heart.

Following hybridization of the same blot with a LYST2-specific probe, a different

pattern of expression was observed (Fig. 15). LYST2 transcripts were most abundant in

whole brain (adult and fetal) and in 14 specific adult brain regions, as well as in kidney,

while there was low to negligible LYST2 expression in the rest of the tissues.


















1 2 34 5678


1234 5 6 7 8


C




1234567


'4


9.5-
7.5-

4.4-

2.5-

1.4-


Mouse


9.5-
7.5-

4.4-

2.5-

1.4-


Human


Human


Figure 14. Northern blot analysis of mouse and human LYST2.
Northern blots of 2 tg poly(A) RNA from various mouse tissues (a), human
cancer cell lines (b), or human lymphoid tissues (c), hybridized to a [a-32P]dCTP-
labeled LYST2 probe. Lanes: (a) 1-heart, 2-brain, 3-spleen, 4-lung, 5-liver, 6-
muscle, 7-kidney, 8-testis; (b) 1-promyelocytic leukemia, 2-HeLa, 3-
myelogenous leukemia, 4-lymphoblastic leukemia, 5-Burkitt's lymphoma, 6-
adenocarcinoma, 7-lung carcinoma, 8-melanoma; (c) 1-spleen, 2-lymph node, 3-
thymus, 4-appendix, 5-leukocyte, 6-bone marrow, 7-fetal liver. Molecular size
standards (in kb) are shown to the left.


9.5-
7.5-
4.4-

2.5-

1.4-





















S6
u)
Z
zU 5
uJ



3

2 i i






s I 8 i !










Figure 15. Comparison of the relative abundance of LYST and LYST2 transcripts
in 50 human tissues after normalization. Variation of the relative mRNA abundance
among tissues was assessed by phosphorimaging, dot quantitation, subtraction of
background and calculation of the intensity percentage for each tissue. The relative
mRNA abundance between normalized tissues for each probe was expressed as the
percentage of the total hybridization signal obtained for each tissue with that probe. The
average percentage intensity for housekeeping genes in all tissues was -2%. No
hybridization was evident to control dots, containing yeast total RNA, yeast tRNA, E.
coli rRNA, E. coli DNA, poly r(A), human Cotl DNA and human DNA. Exposure time
for phosphorimaging was 20 h.









Identification of Proteins that Interact with the CHS Protein and with LYST2. Using a

Yeast Two-Hybrid Approach


In an effort to investigate the function of the LYST and LYST2 proteins, two

types of screens for protein-protein interactions were performed by the yeast two-hybrid

method, as described in MATERIALS AND METHODS. In a "forward" screen, one

hybrid consisted of the DNA binding domain of the yeast transcriptional activator Gal4

fused to a "bait" portion of LYST or LYST2. The other hybrid consisted of the Gal4

activation domain fused to "prey" sequences encoded by a mammalian cDNA library. In

a "reverse" screen, the "bait" part of LYST or LYST2 was fused to the Gal4 activation

domain, and the "prey" sequences of the mammalian cDNA library were fused to the

Gal4 DNA binding domain. The activation domain vector contained the LEU2 gene for

selection in yeast deficient in leucine biosynthesis, and the DNA-binding domain cloning

vector included the TRP1 gene for selection in yeast deficient in tryptophane

biosynthesis. Each of the vectors was transformed into complementary (a and a) mating

types of yeast. Mating was carried out to express both vector constructs within the same

yeast cells, thus allowing interaction to occur. Interaction between the bait and prey

proteins led to transcriptional activation of reporter genes containing cis-binding elements

for Gal4. The reporter genes encoding the indicator protein beta-galactosidase, and

metabolic markers for uracil and histidine auxotrophy, were included in specific fashion

in one or the other of the yeast strains used in the mating, as described in the

MATERIALS AND METHODS chapter. As a result, yeast were selected for expression

of both fusion constructs, for successful mating, and for expression of LYST- or LYST2-








interacting proteins (IPs). Yeast clones that contained interacting proteins were grown in

individual wells of microtiter plates and the plasmids containing the IP-sequences were

isolated and characterized. Numerous tests (for bait self-activation, prey self-activation,

non-specific binding, sequencing of all baits, matrix mating, P3-galactosidase tests for

haploids and for diploids) were performed, as described in the MATERIALS AND

METHODS chapter, to determine the specificity of the detected bait:prey interactions.

The following interactions, summarized in Table 5, passed all confirmation tests.

In the forward screens, four different molecules were found to interact with the

CHS protein. LYST fragment 190-1056 interacted with sequences identical to the 14-3-3

protein. Three independent isolates of 14-3-3 sequence, starting at nucleotides 270, 306,

and 330, representing the same region of the molecule (as shown in APPENDIX,

Sequence 1), were identified. Another sequence which was found to interact with LYST

fragment 3190-4032 was identical to casein kinase II P13-subunit. Four independent isolates

of CKII-P3, starting at nucleotides 1, 4, 31, and 82 (APPENDIX, Sequence 3) and

representing the same region of the molecule, were identified. LYST fragment 6586-7449

was found to interact with a sequence identical to human hepatocyte growth factor-

regulated tyrosine kinase substrate (Hrs), starting at nucleotide 326 (APPENDIX,

Sequence 4). Another identified sequence interacting with LYST fragment 9037-9585

was identical to the EST cg51287.dlO sequence (IP-11, APPENDIX, Sequence 23),

starting at nucleotide 1.

In the reverse screens, a total of 22 molecules were identified as LYST- or

LYST2-IPs. Ten of those were identical to published proteins and thirteen molecules








were identified as EST sequences (eleven novel and two known ESTs). Identified

sequences interacting with the LYST fragment 190-1056 were identical to 14-3-3 protein

sequence starting at nucleotides 270, 288 and 354, i.e. representing the same domain of

14-3-3 protein identified in the forward screen (APPENDIX, Sequence 1), to B 14-3-3

protein sequence starting at nucleotide 466 (APPENDIX, Sequence 2), to calmodulin

sequence starting at nucleotide 474 (APPENDIX, Sequence 5), to estrogen receptor-

related protein, starting at nucleotide 756 (as shown in APPENDIX, Sequence 6), and to

EST cg50173.dlO sequence (IP-7, APPENDIX, Sequence 19), starting at nucleotide 1.

The sequence identical to 14-3-3 protein, starting at nucleotide 270, also interacted with

the LYST fragment 4009-4821. LYST fragment 6586-7449 was found to interact with

sequences identical to importin P-subunit (starting at nucleotide 1970, APPENDIX,

Sequence 7), imogen 38 (starting at nucleotide 492, APPENDIX, Sequence 8), DGS-I (a

gene with unknown function, isolated from the DiGeorge syndrome critical region,

starting at nucleotide 455, APPENDIX, Sequence 9), EST cg50136.f6 (IP-1, starting at

nucleotide 1, APPENDIX, Sequence 3), EST AA010799 (IP-2, starting at nucleotide 1,

APPENDIX, Sequence 4), EST cg50136.a7 (IP-4, starting at nucleotide 1, APPENDIX,

Sequence 16), EST cg50175.c7 (IP-5, starting at nucleotide 25, APPENDIX, Sequence

17), EST cg50138.g5 (IP-6, starting at nucleotide 1, APPENDIX, Sequence 18), EST

cg50175.h7 (IP-8, starting at nucleotide 1, APPENDIX, Sequence 20), EST cg50136.a5.b

(IP-10, starting at nucleotide 1, APPENDIX, Sequence 22), and EST cg49432.h3 (IP-12,

starting at nucleotide 1, APPENDIX, Sequence 24). The sequence identical to EST

cg50138.g5 (IP-6, starting at nucleotide 1) interacted also with LYST fragment 10576-








11611. Identified sequences interacting with LYST fragment 9502-10590 were identical

to atrophin-1 (starting at nucleotide 2660, APPENDIX, Sequence 10), embryonic fyn

substrate 2 (Efs2, starting at nucleotide 1665, APPENDIX, Sequence 11), similar to EST

cg50136.clO0 (IP-3, starting at nucleotide 356, APPENDIX, Sequence 5), identical to EST

KIAA0192 (IP-9, starting at nucleotide 5092, APPENDIX, Sequence 21), and similar to

EST cg50138.el.b (IP-13, starting at nucleotide 75, APPENDIX, Sequence 25). The

sequence identical to EST cg50136.clO0 (IP-3) interacted also with LYST fragment 9037-

9585. The sequences identical to casein kinase II P3-subunit (starting at nucleotides 1 and

58) interacted not only with the LYST fragment 3190-4032 in the forward screen, but

also with LYST fragment 10576-11611 in the reverse screen.

In summary, eleven LYST-interacting sequences were found to be identical to

published sequences encoding proteins (14-3-3, B14-3-3, Hrs, calmodulin, casein kinase

II P-subunit, Efs2, importin P3-subunit, estrogen receptor-related protein, imogen 38,

atrophin-1, and DGS-I), two LYST-interacting sequences were found to be highly

homologous or identical to published EST sequences (AA010799 and KIAA0192,

encoding for IP-2 and IP-9, respectively), and eleven LYST-interacting sequences were

found to be novel ESTs (cg50136.f6, cg50136.clO, cg50136.a7, cg50175.c7, cg50138.g5,

cg50173.dlO, cg50175.h7, cg50136.a5.b, cg51287.dlO, cg49432.h3.b, and cg50138.el.b;

encoding for IP-1, IP-3, IP-4, IP-5, IP-6, IP-7, IP-8, IP-10, IP-11, IP-12, and IP-13

respectively).

In the reverse screen searching for LYST2-IPs, one interacting sequence was

found to be identical to the published sequence encoding human brain factor 2 (HBF-G2,








starting at nucleotide 1638, APPENDIX, Sequence 2) and one to the same region

(starting at nucleotide 354, APPENDIX, Sequence 1) of 14-3-3 protein, identified to

interact with LYST. The nucleic acid sequences and corresponding amino acid sequences

of all LYST- and LYST2-interacting proteins are shown in APPENDIX, Sequences 1-25.

A summary of the described protein-protein interactions is shown in Table 5.

Table 5. Protein interactions identified by forward and reverse yeast two-hybrid
screens using fragments of LYST and LYST2 as baits



BAIT FRAGMENT INTERACTING PROTEINS IDENTIFIED IN
AND POSITION,
bp* FORWARD SCREENS REVERSE SCREENS


LYST 190-1056 14-3-3 protein 14-3-3 protein; B14-3-3;

Calmodulin; IP-7; Estrogen
receptor-related protein
LYST 3190-4032 Casein kinase II p-subunit
LYST 4009-4821 14-3-3 protein
LYST 6586-7449 Hepatocyte growth factor Importin P-subunit; Imogen 38;
regulated tyrosine kinase DGS-I (DiGeorge syndrome);
substrate (Hrs) IP- 1 ,-2,-4,-5,-6,-8,- 10,- 12
LYST 9037-9585 IP-1 I IP-3
LYST 9502-10590 Atrophin-1; Embryonic Fyn

substrate 2 (Efs2); IP-3,-9,-13
LYST 10576-11611 Casein kinase II 3-subunit; IP-6
LYST2 774-1424 14-3-3 protein; Human brain

factor-2 (HBF-G2)

* According to GenBank accession number U67615 for LYST; for LYST2, fragment
positions are relative to the beginning of the known sequence









The potential functional significance of the interactions between LYST/LYST2

and the previously published proteins will be discussed in the next chapter. A short

description of all ESTs, detected as LYST-IPs, and their similarity to known sequences

follows.

IP-1 (EST cg50136.f6. APPENDIX. Sequence 13)

One identified sequence (cg50136.f6, 503 nucleotides), interacting with LYST,

was 98% identical to nucleotides 1-128, 90% to nucleotides 339-455, and 71% to

nucleotides 201-445 of the human EST AA452346. This EST of 455 nucleotides was

initially obtained from a human Soares total fetus (8-9 week) library (Hillier et al., 1997).

However, EST AA452346 could be not be used for an extension of EST cg50136.f6 in

either direction.

EST cg50136.f6 showed 68% nucleotide identity to mouse T-complex protein

Tcp-10 genes (GenBank accession No. M73509, M73506, M22601, M73505). An open

reading frame could be translated from nucleotides 3 to 503. The resulting 167 amino

acids correspond to a c-terminal or core region of a novel protein, which was designated

IP-1. Amino acids 2-126 of IP-1 show 68% homology to the c-terminal region (amino

acids 242-365) of mouse Tcp-10 protein (GenBank accession No. X58170)

Therefore, IP-1 represents a novel protein with homology to mouse Tcp-10

protein. Interestingly, another LYST-interactant, IP-10 (see later in this chapter), shows

homology to the amino-terminal region of Tcp-10. In addition, LYST-interactant IP-11

has a region homologous to ATP-binding proteins and chaperonin Tcp-1. The nucleotide

and amino acid sequences of IP-1 are shown in APPENDIX, Sequence 13.








IP-2 (EST AA010799. APPENDIX. Sequence 14)

Three identical sequences (cg50136.a4, cg50136.d6, cg50136.c9), interacting with

LYST, were 96% identical to nucleotides 1-441 of the human EST AA010799. This EST

of 495 nucleotides was initially obtained from a human Soares fetal heart (19 weeks)

library (Hillier et al., 1995). EST AA010799 could not be further extended by database

searches and was used for further analysis.

The 5' end of this EST was similar to the human 50 S ribosomal protein L17. An

open reading frame could be translated from nucleotides 3 to 494 of EST AA0 10799. The

resulting 164 amino acids correspond to a c-terminal or core region of a novel protein,

which was called IP-2. Amino acids 1-107 of IP-2 show 55% homology to amino acids 5-

117 of bacterial ribosomal protein L17 (GenBank accession No. S07223, M26414,

L33834, AE00633, D90905).

Therefore, IP-2 represents a novel human protein with homology to ribosomal

protein L 17. The nucleotide and amino acid sequences of IP-2 are shown in APPENDIX,

Sequence 14.

IP-3 (EST cg50136.clO, APPENDIX, Sequence !15)

Two identical sequences (cg50136.clO and cg50136.glO0), interacting with LYST,

showed significant homology to published ESTs. An extended expressed sequence of

1198 nucleotides was assembled from nucleotides 1 to 466 of human fetal lung EST

W40354 (Hillier et al., 1995), nucleotides 57 to 194 from cg50136.clO (corresponding to

nucleotides 345 to 539 in the extended sequence), nucleotides 1 to 382 from human

endothelial cell EST AA 186481 (Hillier et al., 1995), corresponding to nucleotides 483 to








863 in the extended sequence, nucleotides 336 to 446 from human fetal EST AA436726

(Hillier et al., 1997), corresponding to nucleotides 529 to 974 in the extended sequence,

and nucleotides 199 to 423 from EST N49053 from a human multiple sclerosis library

(Hillier et al., 1995), corresponding to nucleotides 777 to 1198 in the extended sequence.

The fragment interacting with LYST starts at nucleotide 345. The extended sequence of

1198 nucleotides was used for subsequent analysis.

Nucleotides 213 to 599 of the extended expressed sequence showed 75% identity

to nucleotides 3589 to 3975 of rat Olf-1/EBF associated Zn finger protein Roaz

(GenBank accession No. U92564). An open reading frame could be translated from

nucleotides 1 to 594. These 198 amino acids represent a core or c-terminal region of a

novel protein, which was designated IP-3. Amino acids 26 to 197 of IP-3 show 84%

homology to amino acids 1023 to 1185 of the rat Zn finger protein Roaz. Weaker

homologies (40 to 50%) were seen to different zinc-finger proteins of several species.

Interestingly, conserved zinc-finger domains exist in other proteins, e.g., protein kinase C

and Hrs, that may be associated with LYST (see next chapter).

Therefore, IP-3 represents a novel human protein with homologies to rat Olf-

1 /EBF associated Zn finger protein Roaz. The nucleotide and amino acid sequences of IP-

3 are shown in APPENDIX, Sequence 15.

IP-4 (EST cg50136.a7. APPENDIX. Sequence 16)

One identified prey sequence (cg50136.a7, 493 nucleotides), interacting with

LYST, was 91% identical to human EST AA009453, starting at nucleotide 1. This EST

of 505 nucleotides was initially obtained from a human Soares fetal heart (19 weeks)








library (Hillier et al., 1997). EST AA009453 could be extended in the 5' direction with

nucleotides 57 to 76 of clone cg50136.a7, resulting in a sequence of 524 nucleotides.

An open reading frame could be translated from nucleotides 2 to 244. These 81

amino acids correspond to a carboxy-terminal, proline-rich region of a novel protein,

which was called IP-4.

Therefore, IP-4 represents a novel, proline-rich protein without homology to

known proteins. The nucleotide and amino acid sequences of IP-4 are shown in

APPENDIX, Sequence 16.

IP-5 (EST cg50175.c7. APPENDIX. Sequence 17)

One identified prey sequence (cg50175.c7, 548 nucleotides), interacting with

LYST, was 98% identical to human cDNA clone AA403189, starting at nucleotide 24.

This EST of 386 nucleotides was initially obtained from a human Soares total fetus (8-9

week) library (Hillier et al., 1997). EST AA403189 was extended with nucleotides 418 to

548 of clone 50175.c7, resulting in a sequence of 517 nucleotides. This sequence could

not be extended further by database searches and was used for subsequent analysis.

An open reading frame could be translated from nucleotides 1 to 288. This

corresponds to a 96 amino acid protein, which was designated IP-5. Amino acids 10 to 84

of IP-5 were found to be 48% homologous to Bacillus subtilis ATP-dependent protease

La (GenBank accession No. X76424 and P37945), to Bacillus subtilis ATP-dependent

Lon protease (GenBlank accession No. Z75208), and to Bacillus subtilis endopeptidase La

(GenBank accession No. 140421).









Therefore, IP-5 represents a novel protein with homology to ATP-dependent

proteases Lon/La. The nucleotide and amino acid sequences of IP-5 are shown in

APPENDIX, Sequence 17.

IP-6 (EST cg50138.g5. APPENDIX. Sequence 18)

Two identified sequences (cg50138.g5, 498 nucleotides, and the identical

cg50138.f2), interacting with LYST, showed significant homology to published

expressed sequences. Nucleotides 222 to 492 of cg50138.g5 were 98% identical to

nucleotides 1 to 270 of EST AA460131 (588 nucleotides; Hillier et al., 1997). This

sequence was obtained from a human total fetus (9 weeks) cDNA library. A longer

sequence was assembled from nucleotides 1-449 of cg50138.g5 and nucleotides 228-588

of AA460131, and the extended sequence of 753 nucleotides was used for subsequent

analysis.

The extended sequence showed homology to several viral nonstructural proteins:

nucleotides 2 to 487 showed 83% identity to nucleotides 170 to 653 of the nonstructural

protein Ns2-3 of a border disease virus strain (pestivirus type 3) (GenBank accession No.

U43603), nucleotides 42 to 405 showed 90% identity to nucleotides 17 to 378 of proteins

p54, p80 and p125 of the bovine viral diarrhea virus (GenBank accession No. Z54331).

Nucleotides 311 to 753 showed 58% identity to nucleotides 3025 to 3464 of the human

growth hormone and chorionic somatomammotropin genes (GenBank accession No.

J03071).

An open reading frame could be translated from nucleotides 1 to 582. These 194

amino acids represent a core or c-terminal region of a novel protein, which was called IP-









6. Amino acids 6 to 144 of IP-6 show 93% homology to amino acids 64 to 198 of the

viral (pestivirus type 3) nonstructural protein Ns2-3 (GenBank accession No. U43603).

Amino acids 31 to 135 are 98% homologous to amino acids 22 to 126 of the

nonstructural protein p125 of the bovine viral diarrhea virus (GenBank accession No.

Z54332). BLOCKS analysis searching for similarities to known protein families showed

some homology to 14-3-3 proteins (amino acids 17 to 68; identities are shown in capital

letters): Efl SK1QD dLKea mntmm CSRcQ GkhRr Femdr Epksa RycAE cnrlh pAE.

Therefore, IP-6 represents a novel human protein with homology to viral

nonstructural proteins. The nucleotide and amino acid sequences of IP-6 are shown in

APPENDIX, Sequence 18.

IP-7 (EST cg50173.dl 0. APPENDIX. Sequence 19)

One identified sequence (cg50173.dlO, 449 nucleotides), interacting with LYST,

showed homology to published expressed sequences. Nucleotides 79 to 325 of

cg50173.dl0 were 91% identical to nucleotides 30 to 283 of the expressed sequence

H62553 (293 nucleotides; Hillier et al., 1995). This sequence was obtained from a human

male fetal (20 weeks) liver and spleen cDNA library. The expressed sequence

cg50175.dlO could not be further extended by database searches and was used for further

analysis.

An open reading frame could be translated from nucleotides 17 to 289, starting

with a methionine start codon. These 91 amino acids correspond to a novel protein with a

calculated molecular weight of 10589,9, which was designated IP-7. Both the nucleotide

and the amino acid sequence of IP-7 show some homology to Alu-domains.








Therefore, IP-7 represents a novel human protein without homology to known

proteins. The nucleotide and amino acid sequences of IP-7 are shown in APPENDIX,

Sequence 19.

IP-8 (EST cg50175.h7. APPENDIX. Sequence 20)

One identified sequence (cg50175.h7), interacting with LYST, showed significant

homology to published expressed sequences. Nucleotides 254 to 555 of cg50175.h7 were

96% identical to nucleotides 1 to 330 of the expressed sequence T09146. This sequence

was obtained from a human infant brain cDNA library (Adams et al., 1993). Nucleotides

61 to 433 of cg50175.h7 were assembled to nucleotides 181 to 330 of T09146, resulting

in an extended sequence of 523 nucleotides. This sequence could not be further extended

by database searches and was used for further analysis.

Nucleotides 2 to 523 of the assembled expressed sequence were 89% homologous

to the rat mRNA for norbin (GenBank accession No. AB006461; Shinozaki et al., 1997).

Norbin is a novel brain gene, induced by treatment of tetraethylammonium in rat

hippocampal slice and accompanied with neurite-outgrowth in neuro 2a cells. The

neurite-outgrowth-related protein norbin may play a role in neural plasticity because of

the formation of new synapses.

An open reading frame could be translated from nucleotides 2 to 523. These 174

amino acids correspond to a c-terminal or core region of a novel protein, which was

called IP-8 and which was 98% identical to amino acids 486 to 659 of rat norbin brain

protein (729 amino acids).








Therefore, IP-8 represents a novel protein that appears to be the human homolog

of the rat brain gene norbin. The nucleotide and amino acid sequences of IP-8 are shown

in APPENDIX, Sequence 20.

IP-9 (EST KIAA0192. APPENDIX. Sequence 21)

One identified prey sequence of 499 nucleotides interacting with LYST was 96%

identical to human mRNA clone D83783 for the KIAA0192 gene, starting at nucleotide

5092. The mRNA for KIAA0192 was initially obtained from a human male myeloblast

cell line (Nagase et al., 1996).

An open reading frame without a methionine start codon could be translated from

nucleotides 1 to 6372. This sequence represents the carboxy-terminal part of a protein

which was designated IP-9.

Since no homologies to known proteins could be identified, it appears that IP-9,

encoded by the human mRNA for the KIAA0192 gene, represents a novel protein that

interacts with LYST. The nucleotide and amino acid sequences of IP-9 are shown in

APPENDIX, Sequence 21.

IP-10 (EST cg50136.a5.b. APPENDIX. Sequence 22)

Two identified sequences (cg50136a5 and cg50136c4), interacting with LYST,

showed no significant homology to published sequences. Nucleotides 62-309 were 57%

homologous to nucleotides 61 to 310 of the human immunodeficiency virus envelope

protein (GenBank accession No. L08337). The interacting sequence of 451 nucleotides

was used for further analysis.








An open reading frame could be translated from nucleotides 2 to 451. These 150

amino acids correspond to a c-terminal or core region of a novel protein, which was

called IP-10. Amino acids 59 to 139 of IP-10 showed 59% homology to amino acids 29-

109 of the human T-complex protein TCP-10 (GenBank accession No. U03399). Other

homologies (-50%) were found to several cytoskeletal proteins (e.g. myosin I isoform,

kinesin precursor, cytokeratin, caldesmon, NUF1, tropomyosin, neurofilament protein,

kinesin-like protein KIF1, myosin like protein MLP1, troponin T) and to proteins

involved in vesicular transport intracellularr protein transport protein, nuclear fusion

protein Biki, synaptonemal complex protein). BLOCKS analysis showed homologies to

postsynaptic proteins, gas vesicles protein, clusterin proteins, clathrin light chain proteins,

tropomyosin protein and intermediate filament protein.

Therefore, IP-10 represents a novel protein with homologies to the amino-

terminal region of Tcp-10 and with homologies to cytoskeletal and vesicular transport

proteins. It is interesting that the LYST-interactant IP-1 shows homology to the c-

terminal region of Tcp-10. Furthermore, LYST-interactant IP-11 has homologous

domains to ATP-binding proteins and chaperonin Tcp-1. The nucleotide and amino acid

sequences of IP-10 are shown in APPENDIX, Sequence 22.

IP- 11 (EST cg51287.d 10. APPENDIX. Sequence 23)

One identified sequence (cg51287.d10), interacting with LYST, was 90%

identical to nucleotides 1-325 of the human EST AA310287. This EST of 470

nucleotides was initially obtained from a human Jurkat T-cells library (Adams et al.,

1995). The 5' end of EST AA310287 could be extended with nucleotides 154 to 180 of








EST cg51287.dlO, resulting in a sequence of 497 nucleotides, which was used for further

analysis.

An open reading frame could be translated from nucleotides 3 to 497. These 165

amino acids correspond to a c-terminal or core region of a novel protein, which was

designated IP-11. No significant homologies could be found using the BLASTN search

program. Using the BLOCKS analysis program, homologies to ATP-binding proteins and

chaperonins TCP-1 proteins could be found.

Therefore, IP-11 represents a novel protein with homologies to ATP-binding

proteins and TCP-1. The nucleotide and amino acid sequences of IP-11 are shown in

APPENDIX, Sequence 23.

IP-12 (EST cg49432.h3.b. APPENDIX. Sequence 24)

Two identified sequences (cg50136c6 and cg50136d2), interacting with LYST,

showed no significant homologies to published sequences. The interacting sequence of

402 nucleotides was used for further analysis.

Nucleotides 27-266 of EST cg49432.h3.b were 70% homologous to nucleotides

1115 to 1348 of the human RNA for the cellular oncogene c-fes (GenBank accession No.

X52192).

An open reading frame could be translated from nucleotides 2 to 400. These 133

amino acids correspond to a c-terminal or core region of a novel protein, which was

called IP-12. Only weak homologies to known proteins could be found, especially to

proline-rich regions of different proteins. For example, the proline rich region of IP-12

consisting of amino acids 57 to 89 was 69% homologous to the TGF-3 binding protein 3,








amino acids 57 to 75 were 66% homologous to a region in human semaphorin IV, 64%

homologous to StpC139 (Saimiriine herpesvirus 2), 63% homologous to a collagen-like

protein and 55% homologous to homeobox protein HOX-A4. Although the functions of

proline-rich regions are often unclear, they could be involved in protein-protein

interactions. Some transcription factors contain a proline-rich sequence in the

transcriptional activation domain, which has no DNA-binding activity but is essential for

activating transcription (Mitchell and Tjian, 1989). Amino acids 14 to 67 of IP-12

showed 53% homology to ORF homolog membrane peroxisomal 70 kDa protein P34230

(ALDP), involved in adrenoleukodystrophy.

Therefore, IP-12 represents a novel protein with a proline-rich region. Other

LYST interactants, IP-4 and Hrs, have also proline-rich regions. The nucleotide and

amino acid sequences of IP-12 are shown in APPENDIX, Sequence 24.

IP-13 (EST cg50175.cl 1. APPENDIX. Sequence 25)

One identified sequence (cg50175.c 1, 481 nucleotides), interacting with LYST,

showed significant homology to published expressed sequences. Nucleotides 1 to 355 of

cg50175.cl 1 were 96% identical to nucleotides 74 to 428 of the expressed sequence

H51347 (428 nucleotides; Hillier et al., 1995), obtained from a mouse brain cDNA

library. The expressed sequence cg50175.cll was extended in the 5' direction with

nucleotides 1-73 of H51347. This extended sequence showed 96% identity to an

expressed sequence Hs21767 of the same length. The extended sequence of 554

nucleotides was used for further analysis.








The extended expressed sequence of 554 nucleotides showed 71% identity to

nucleotides 463 to 982 of Xenopus laevis elav-type ribonucleoprotein etr-1 (GenBank

accession No. U 16800). An open reading frame could be translated from nucleotides 3 to

554. These 184 amino acids represent the core or c-terminus of a novel protein, which

was designated IP-13. The amino acid sequence of IP-13 shows homologies to

ribonucleoproteins of different species, including 67% homology to Xenopus laevis elav-

type ribonucleoprotein etr-1 (GenBank accession No. U16800) and 54% homology to the

human etr-3 protein (GenBank accession No. U69546).

Therefore, IP-13 represents a novel human protein with homology to

ribonucleoproteins. The nucleotide and amino acid sequences of IP-13 are shown in

APPENDIX, Sequence 25.














DISCUSSION


Since the predicted mouse and human CHS proteins were novel and unlike any of

the molecules previously implicated in vesicular transport, their identification did not

prove immediately helpful in establishing the precise mechanism whereby CHS

dysregulates protein transport and lysosomal trafficking. Therefore, the main goal of this

dissertation was to characterize the Chediak-Higashi gene and its products in more detail

by using functional genomics approaches:

identifying alternatively spliced Lyst mRNA isoforms and therefore resolving

the discrepancy between the initially reported Lyst sequences

identification of mutations in Chediak-Higashi patients and beige alleles

identification of proteins that interact with LYST





Identification and Characterization of Lyst mRNA Isoforms


In order to investigate the expression of the CHS gene and to explain the

discrepancy between the previously published Lyst sequences, extensive northern and

RT-PCR analyses were performed. We demonstrated that each of the previously reported

bg gene sequences (Barbosa et al., 1996; Perou et al., 1996b) is derived from a single

gene with alternatively spliced mRNAs (Fig. 8). The previously reported sequences are









derived from non-overlapping parts of two Lyst mRNA isoforms with different predicted

C-terminal regions. By sequencing RT-PCR products, we have shown that nucleotides 1-

4706 of Lyst also represent the previously undetermined 5' region of the largest Lyst

isoform. Alternative splicing at nucleotide 4706 results in bg gene isoforms that contain

different 3' regions. Splicing from exon a (containing nucleotide 4706) to exon T results

in an -12 kb mRNA (Lyst-I) that corresponds to the largest band observed on northern

blots. Incomplete splicing at nucleotide 4706 results in a 5893 bp cDNA (Lyst-II) that

contains intron-derived sequence at the 3' end. Lyst-II corresponds to a smaller mRNA

observed on northern blots (Barbosa et al., 1996). While several other genes generate an

alternative C-terminus by incomplete splicing (Myers et al., 1995; Sugimoto et al., 1995;

Sygiyama et al., 1996; Zhao and Manlley, 1996; Van De Wetering et al., 1996), the bg

gene is unique in that the predicted structures of the two C-termini are quite different. The

C-terminus of Lyst-I contains a WD-repeat domain that is similar to the 13-subunit of

heterotrimeric G proteins and which may assume a propeller-like secondary structure

(Lambright et al., 1996). This domain is absent in Lyst-II.

Northern blots of human tissues had suggested that transcription of the

homologous human gene, LYST, had a similar complexity to the mouse. We identified

two human ESTs homologous to mouse Lyst and described a mutation in one of these in

a Chediak-Higashi patient (Barbosa et al., 1996). Subsequently, another group published

the cDNA sequence of the largest LYST isoform, and identified mutations in this gene in

two additional patients with CHS (Nagle et al., 1996). We have described the

identification of a second isoform of the human gene. This mRNA encodes a protein of








1531 amino acids that is homologous to mouse Lyst-II. Like the latter, this human mRNA

arises from incomplete splicing and retention of a transcribed intron that encodes the C-

terminus of the predicted LYST protein. The mouse and human codons unique to this

short isoform share 65% amino acid identity. The stop codon, however, is not conserved

precisely between the human and mouse short isoforms. While mouse Lyst-II is predicted

to contain a C-terminal prenylation motif (CYSP), translation of human short isoform is

predicted to terminate 22 codons earlier and to lack this motif.

However, the other predicted structural features of the human short isoform were

conserved with mouse. The most notable of these was a region similar in sequence to

stathmin (amino acids 376-540) (Barbosa et al., 1996). While the mouse and human CHS

genes had an overall amino acid identity of 81%, identity in the stathmin-like domain was

92% and similarity was 99%. Stathmin is a coiled-coil phosphoprotein that regulates

microtubule polymerization in a phosphorylation-dependent manner, and acts as a relay

for intracellular signal transduction (Sobel, 1991; Belmont and Mitchison, 1996;

Marklund et al., 1996). This region of the LYST gene may encode a coiled-coil protein

interaction domain and may regulate microtubule-mediated lysosome trafficking.

Intriguingly, a defect in microtubule dynamics has been documented previously in CHS

(Oliver et al., 1975) and intact microtubules are required for maintenance of lysosomal

morphology and trafficking (Matteoni and Kreis, 1987; Swanson et al., 1987; Swanson et

al., 1992; Oka and Weigel, 1983).

Mutation and expression analyses suggested that the largest Lyst splice variant

(Lyst-I) represents the isoform of primary functional significance and that expression of

the smaller isoform (Lyst-II) alone cannot compensate for loss of Lyst-I. This hypothesis








was supported by the genetic complementation experiments initiated in collaboration

with Dr. Stephen Brandt. These studies revealed that some beige mouse fibroblasts,

expressing full-length Lyst-I, demonstrated more peripheral distribution in the cytoplasm

and slight reduction of the size of the stained granules. Such changes were not visible in

cells expressing the smaller Lyst-II isoform. However, since the effects of the

complementation were not very prominent and were not observed in all cells expressing

Lyst-I, the significance of the described genetic complementation is questionable.

Comparison of the relative abundance of LYST gene transcripts in human tissues

at different developmental stages revealed an overlapping but distinct pattern of

expression (Fig. 9). A quantitative estimate of the relative expression of the smaller

mRNA isoforms was generated by comparing the relative hybridization intensity

obtained with a probe specific for the large isoform with that obtained with a probe that

hybridizes to all LYST transcripts. Large isoform transcripts predominated in thymus,

fetal thymus, spleen and brain (with the exception of amygdala, occipital lobe, putamen

and pituitary gland). Large and small mRNA transcripts were abundant in the latter brain

tissues, peripheral blood leukocytes and bone marrow. However, in several tissues, only

the small isoforms were expressed, e.g. in fetal heart, salivary gland, kidney, lung, and

fetal brain. The developmental pattern of mRNA isoform expression in brain was

particularly interesting, since only the small isoforms were expressed in fetal brain,

whereas the largest isoform predominated in many regions of the adult brain.








Identification of Mutations in Patients with Chediak-Higashi Syndrome and in Beige

Mice


Mutation analysis was performed in order to provide additional evidence that

LYST, resp. Lyst is indeed the gene responsible for the CHS in human and for the beige

mutation in mouse, as well as to determine whether a genotype-phenotype correlation

could be established between different genetic defects and specific disease

manifestations. Novel mutations were identified within the coding domain of LYST in

several CHS patients (Table 4 and Fig.3). The genetic lesions in three patients (370, 372,

373) were C--T substitutions that resulted in premature termination. Another patient was

heterozygous for a dinucleotide deletion that results in a frameshift and premature

termination. Interestingly, all bg and LYST mutations identified to date are predicted to

result in the production of either truncated or absent proteins, suggesting that missense

mutations may not be likely to cause CHS. Unlike Fanconi anemia, type C (Yamashita et

al., 1996) there does not appear to be a correlation between the length of the truncated

proteins (which may or may not be stable) with clinical features or disease severity in

CHS patients, given that a CHS patient with mild manifestations has a truncating

mutation early in the protein. However, until the other mutant allele in the compound

heterozygote patients is identified, and the exact effects of each mutation at the protein

level are characterized, such correlation is imprecise.

Mutation and expression analyses were also useful in addressing the important

question about the biological relevance of the 2 main LYST transcripts in regulating

lysosomal trafficking and in preventing Chediak-Higashi syndrome. The distribution of




Full Text

PAGE 1

&+$5$&7(5,=$7,21 2) 7+( &+(',$.+,*$6+, 6<1'520( *(1( ,1 +80$1 $1' 0286( %\ 9(/,=$5 7 7&+(51(9 $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

&RS\ULJKW E\ 9HOL]DU 7 7FKHPHY

PAGE 3

7R P\ SDUHQWV

PAGE 4

$&.12:/('*0(176 7KH DXWKRU ZRXOG OLNH WR WKDQN KLV PHQWRU 'U 6WHSKHQ ) .LQJVPRUH DQG WKH VXSHUYLVRU\ FRPPLWWHH PHPEHUV 'U 0 :DOODFH 'U ( :DNHODQG 'U ( 6REHO DQG 'U 0 %XEE IRU WKHLU YDOXDEOH DGYLFH DQG HQFRXUDJHPHQW 7KH DXWKRUfV DSSUHFLDWLRQ LV H[WHQGHG WR DOO IRUPHU DQG SUHVHQW PHPEHUV RI 'U .LQJVPRUHfV ODERUDWRU\ 'U 0DULD ')6 %DUERVD 'U 9LVKQX 6 0LVKUD -RKQ & 'HWWHU 'U (OL]DEHWK % 0F0XUWULH 4XDQ $ 1JX\HQ 6DQGUD 0 +ROW -XDQ 0 7HRGRUR DQG $QGUHD +RILJ DV ZHOO DV WR 'U .ULVKQDQ 1DQGDEDODQ DQG 'U 0DGDQ .XPDU IURP &XUD*HQ &RUSRUDWLRQ ZKR FRQWULEXWHG WR WKH VXFFHVVIXO FRPSOHWLRQ RI WKLV ZRUN 7KH DXWKRU ZLVKHV WR H[SUHVV KLV JUDWLWXGH WR 0V $QQD 9 *XHRUJXLHYD DQG 0U 1DWKDQ 6 &ROOLHU IRU WKHLU NLQGQHVV DQG FRQWLQXRXV VXSSRUW )LQDOO\ EXW PRVW LPSRUWDQWO\ WKH DXWKRU ZRXOG OLNH WR WKDQN KLV SDUHQWV /LOLD -HOHYD DQG 7]YHWDQ 7FKHUQHY IRU WKHLU ORYLQJ FDUH DQG JXLGDQFH KLV EHORYHG ZLIH 5DOLW]D *XHRUJXLHYD IRU KHU LQYDOXDEOH VXSSRUW DQG LQVSLUDWLRQ DQG KLV IHOORZSOD\HUV ,YDMOR .RUWH]RY 5DGD .RUWH]RYD /XGZLJ /XELK $QDVWDV $VVHQRY DQG ,VDN %HUDKD IRU WKHLU WUXH IULHQGVKLS DQG WKRXJKWSURYRNLQJ FRQYHUVDWLRQV ,9

PAGE 5

7$%/( 2) &217(176 SDJH $&.12:/('*0(176 LY $%675$&7 YLL ,1752'8&7,21 0$7(5,$/6 $1' 0(7+2'6 5HYHUVH 7UDQVFULSWLRQ3RO\PHUDVH &KDLQ 5HDFWLRQ 573&5f $PSOLILFDWLRQ RI &+6 3DWLHQW DQG %HLJH 0RXVH F'1$V 7$ &ORQLQJ RI 3&5 3URGXFWV DQG 3ODVPLG 3XULILFDWLRQ 6LQJOH6WUDQG &RQIRUPDWLRQ 3RO\PRUSKLVP 66&3f $QDO\VLV '1$ 6HTXHQFLQJ DQG 6HTXHQFH $QDO\VLV $OOHOH6SHFLILF 2OLJRQXFOHRWLGH $QDO\VLV 3&5 $PSOLILFDWLRQ RI 0RXVH /\VW F'1$ ,VRIRUPV &ORQLQJ RI +XPDQ /<67 F'1$V 0ROHFXODU 3UREHV ,VRODWLRQ RI /<67 F'1$ &ORQHV 6RXWKHUQ %ORW $QDO\VLV DQG $XWRUDGLRJUDSK\ 1RUWKHUQ %ORW $QDO\VLV 6LPSOH 6HTXHQFH /HQJWK 3RO\PRUSKLVP 66/3f 3&5 $PSOLILFDWLRQ %DFNFURVV 0RXVH 3DQHO DQG *HQHWLF 0DSSLQJ &ORQLQJ RI /<67 DQG /<67 %DLW F'1$ )UDJPHQWV LQ
PAGE 6

,GHQWLILFDWLRQ RI 3URWHLQV WKDW ,QWHUDFW ZLWK WKH &+6 3URWHLQ DQG ZLWK /<67 8VLQJ D
PAGE 7

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ &+$5$&7(5,=$7,21 2) 7+( &+(',$.+,*$6+, 6<1'520( *(1( ,1 +80$1 $1' 0286( %\ 9HOL]DU 7 7FKHUQHY 'HFHPEHU &KDLUPDQ 6WHSKHQ ) .LQJVPRUH 0DMRU 'HSDUWPHQW 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH &KHGLDN+LJDVKL V\QGURPH &+6f LV DQ DXWRVRPDO UHFHVVLYH LPPXQH GHILFLHQF\ GLVRUGHU RI KXPDQ DQG PRXVH EHLJH EJf WKDW LV FKDUDFWHUL]HG E\ DEQRUPDO LQWUDFHOOXODU SURWHLQ WUDQVSRUW WR DQG IURP WKH O\VRVRPHODWH HQGRVPH 5HFHQW UHSRUWV KDYH GHVFULEHG WKH SRVLWLRQDO FORQLQJ RI KRPRORJRXV JHQHV /<67 DQG /\VW WKDW DUH PXWDWHG LQ KXPDQ &+6 DQG LQ EJ PLFH UHVSHFWLYHO\ +RZHYHU VLQFH WKH HQFRGHG SURWHLQV ZHUH QRYHO DQG XQOLNH DQ\ RI WKH PROHFXOHV SUHYLRXVO\ LPSOLFDWHG LQ YHVLFXODU WUDIILFNLQJ WKHLU LGHQWLILFDWLRQ GLG QRW SURYH LPPHGLDWHO\ KHOSIXO LQ HVWDEOLVKLQJ WKH SUHFLVH PHFKDQLVP ZKHUHE\ &+6 G\VUHJXODWHV SURWHLQ WUDQVSRUW 7KHUHIRUH WKH PDLQ JRDO RI WKLV GLVVHUWDWLRQ ZDV WR FKDUDFWHUL]H WKH &KHGLDN+LJDVKL JHQH DQG LWV SURGXFWV LQ PRUH GHWDLO XVLQJ IXQFWLRQDO JHQRPLFV DSSURDFKHV :H GHPRQVWUDWHG WKDW HDFK RI WKH SUHYLRXVO\ UHSRUWHG EJ JHQH VHTXHQFHV DUH GHULYHG IURP D VLQJOH JHQH ZLWK DOWHUQDWLYHO\ VSOLFHG P51$V $OWHUQDWLYH VSOLFLQJ UHVXOWV LQ EJ JHQH LVRIRUPV /\VW DQG /\VW,,f WKDW FRQWDLQ GLIIHUHQW YL

PAGE 8

f UHJLRQV 6LPLODUO\ WR PRXVH WKH KXPDQ P51$ LVRIRUPV DULVH IURP LQFRPSOHWH VSOLFLQJ DQG UHWHQWLRQ RI D WUDQVFULEHG LQWURQ WKDW HQFRGHV WKH &WHUPLQXV RI WKH SUHGLFWHG /<67 SURWHLQ $GGLWLRQDO VSOLFLQJ FRPSOH[LW\ RI VPDOOHU LVRIRUPV H[LVWV 7KH /\VWO,, LVRIRUP ODFNV H[RQV D DQG ZKLOH LQ /\VW<9 H[RQV D DQG \ DUH DEVHQW 1RYHO PXWDWLRQV ZHUH LGHQWLILHG ZLWKLQ WKH FRGLQJ GRPDLQ RI /<67 LQ VHYHUDO &+6 SDWLHQWV DQG EJ DOOHOHV ,QWHUHVWLQJO\ DOO EJ DQG /<67 PXWDWLRQV LGHQWLILHG WR GDWH DUH SUHGLFWHG WR UHVXOW LQ HLWKHU WUXQFDWHG RU DEVHQW SURWHLQV 0XWDWLRQ DQG H[SUHVVLRQ DQDO\VHV VXJJHVWHG WKDW GHIHFWV LQ WKH IXOOOHQJWK P51$ DORQH FDQ HOLFLW &KHGLDN+LJDVKL V\QGURPH DQG WKDW H[SUHVVLRQ RI WKH VPDOOHU LVRIRUP DORQH FDQQRW FRPSHQVDWH IRU ORVV RI WKH ODUJHVW LVRIRUP :H KDYH DOVR LGHQWLILHG D QRYHO JHQH LQ KXPDQ /<67f DQG PRXVH /\VWf WKDW DSSHDUV WR EH D UHODWLYH RI WKH &+6 JHQH EDVHG RQ VHTXHQFH VLPLODULW\ SUHGLFWHG SURWHLQ VWUXFWXUH DQG RQ VLPLODU WUDQVFULSW VL]H &RPSDULVRQ RI WKH UHODWLYH DEXQGDQFH RI /<67 DQG /<67 P51$V VXJJHVWV WKDW /<67 LV H[SUHVVHG DEXQGDQWO\ RQO\ LQ EUDLQ DQG WKHUHIRUH LW PD\ UHSUHVHQW D EUDLQVSHFLILF PHPEHU RI WKH &+6 JHQH IDPLO\ 8VLQJ D PRGLILHG \HDVW WZR K\EULG V\VWHP D KXPDQ F'1$ OLEUDU\ ZDV VFUHHQHG ZLWK EDLWV IURP WKH FRGLQJ GRPDLQV RI /<67 DQG /<67 6HYHUDO SURWHLQV ZKLFK SOD\ LPSRUWDQW UROHV LQ SURWHLQ WUDQVSRUW DQG VLJQDO WUDQVGXFWLRQ VXFK DV FDVHLQ NLQDVH ,, FDOPRGXOLQ DQG +UV ZHUH IRXQG WR LQWHUDFW ZLWK /<67 DQGRU /<67 0DQ\ RI WKH LQWHUDFWLQJ SURWHLQV FRXOG EH OLQNHG LQ D FRPPRQ SDWKZD\ WKDW UHJXODWHV YHVLFXODU WUDIILFNLQJ DQG GHJUDQXODWLRQ 9OOO

PAGE 9

,1752'8&7,21 &KHGLDN+LJDVKL V\QGURPH &+6f LV D SULPDU\ LPPXQRGHILFLHQF\ FKDUDFWHUL]HG E\ VHYHUH UHFXUUHQW LQIHFWLRQV %OXPH t :ROII f SDUWLDO DOELQLVP :LQGKRUVW HW DO f QHUYRXV V\VWHP DEQRUPDOLWLHV 0LVUD HW DO f KLJK LQFLGHQFH RI PDOLJQDQF\ +D\DNDZD HW DO f DQG SUHGLVSRVLWLRQ WR EOHHGLQJ 0H\HUV HW DO f (LJKW\ILYH SHUFHQW RI SDWLHQWV XQGHUJR DQ DFFHOHUDWHG O\PSKRPDOLNH SKDVH FKDUDFWHUL]HG E\ IHYHU KHSDWRVSOHQRPHJDO\ O\PSKDGHQRSDWK\ SDQF\WRSHQLD FRDJXORSDWK\ DQG ZLGHVSUHDG O\PSKRKLVWLRF\WLF RUJDQ LQILOWUDWHV 7KLV FRPSOLFDWLRQ LV IDWDO LQ WKH DEVHQFH RI ERQH PDUURZ WUDQVSODQWDWLRQ 7KH ILUVW FDVHV RI &KHGLDN+LJDVKL V\QGURPH ZHUH UHSRUWHG E\ %HJXH]&HVDU LQ WKHQ RQH FDVH E\ 6WHLQEULQN LQ DQG RQH FDVH E\ +LJDVKL LQ &KGLDN SXEOLVKHG FHUWDLQ DVSHFWV RI %HJXH]&HVDUfV FDVHV LQ DQG 6DWR LQ UHFRJQL]HG WKH VLPLODULWLHV EHWZHHQ &KGLDNfV DQG +LJDVKLfV GDWD LQYHQWLQJ WKH HSRQ\P f&KHGLDN +LJDVKL V\QGURPHf ([FHSW IRU WKH RFFDVLRQDO XVDJH RI VLQJOH QDPHV RU FRPELQDWLRQV RI WKH DERYH DXWKRUVf QDPHV WKH GLVHDVH KDV EHHQ PRVW FRPPRQO\ UHIHUUHG WR DV WKH &KHGLDN+LJDVKL V\QGURPH $SSUR[LPDWHO\ FDVHV RI &+6 KDYH EHHQ UHSRUWHG LQ WKH OLWHUDWXUH 0DOHV DQG IHPDOHV DUH DIIHFWHG HTXDOO\ 7KH PHDQ DJH RI GHDWK RI &+6 SDWLHQWV LV \HDUV 7KH &KHGLDN+LJDVKL V\QGURPH RFFXUV ZLWK D ORZ IUHTXHQF\ WKURXJKRXW WKH ZRUOG (XURSH

PAGE 10

$PHULFD DQG -DSDQ DUH WKH DUHDV IURP ZKLFK WKH PDMRULW\ RI WKH NQRZQ FDVHV KDYH EHHQ GHVFULEHG :KLOH PRVW RI WKH UHSRUWV GHDO ZLWK LVRODWHG FDVHV D XQLTXH FOXVWHU RI &KHGLDN +LJDVKL V\QGURPH SDWLHQWV KDV DOVR EHHQ SXEOLVKHG 5DPLUH]'XTXH HW DO f )RXUWHHQ FDVHV RI &+6 ZHUH IRXQG LQ IDPLOLHV OLYLQJ LQ D GHILQHG DQG UHODWLYHO\ LVRODWHG JHRJUDSKLFDO DUHD 3UHJRQHURf LQ WKH 9HQH]XHODQ $QGHV 7KH SDWLHQWV ZHUH SUHn VFKRRO FKLOGUHQ H[FHSW RQH \HDUROG IHPDOH 6L[ RI WKH SDWLHQWV ZHUH PDOH $OO VKRZHG WKH VDPH W\SLFDO FOLQLFDO FKDUDFWHULVWLFV RI WKH V\QGURPH 6LQFH &+6 LV DQ DXWRVRPDO UHFHVVLYH GLVHDVH 6DWR f WKH H[LVWHQFH RI WKLV KLJKIUHTXHQF\ FOXVWHU RI &+6 SDWLHQWV LQ D UHVWULFWHG UHJLRQ FRXOG EH H[SODLQHG E\ D IRXQGHU HIIHFW LQ DQ LVRODWHG SRSXODWLRQ ZLWK LQEUHHGLQJ 7KH SUHVHQFH RI JLDQW SHULQXFOHDU YHVLFOHV ZLWK SURWHLQ PDUNHUV FKDUDFWHULVWLF RI ODWH HQGRVRPHV DQG PDWXUH O\VRVRPHV LV SDWKRJQRPRQLF IRU &+6 %XUNKDUGW HW DO f 7KH RUJDQHOOHV DUH DEQRUPDO ERWK LQ VL]H HQODUJHGf DQG LQ F\WRSODVPLF GLVWULEXWLRQ SHULQXFOHDUf :KLOH WKH ODWH HQGRVRPDOO\VRVRPDO FRPSDUWPHQW LV XQLIRUPO\ DIIHFWHG LQ &+6 WKH KLVWRORJLFDO GHVLJQDWLRQ RI DIIHFWHG RUJDQHOOHV YDULHV E\ FHOO W\SH PHODQRVRPHV DUH DIIHFWHG LQ &+6 PHODQRF\WHV ZKLOH VHFUHWRU\ JUDQXOHV DUH DIIHFWHG LQ &+6 QHXWURSKLOV HRVLQRSKLOV PDVW FHOOV F\WRO\WLF 7FHOOV SUR[LPDO UHQDO WXEXOHV DQG O\VRVRPHV DUH DIIHFWHG LQ PRQRF\WHV DQG ILEUREODVWV 7KH JLDQW RUJDQHOOHV DUH WKRXJKW WR UHVXOW IURP G\VUHJXODWHG IXVLRQ RI SULPDU\ HQGRVRPHV DQG O\VRVRPHV %XUNKDUGW HW DO :LOOLQJKDP HW DO f 7KH PRUSKRORJLFDO DEQRUPDOLWLHV RI EJ DQG &+6 O\VRVRPHV DUH DFFRPSDQLHG E\ FRPSDUWPHQWDO PLVVRUWLQJ RI SURWHLQV VXFK DV HODVWDVH JOXFXURQLGDVH DQG FDWKHSVLQ +ROFRPEH HW DO f

PAGE 11

7KH GLVHDVH DOVR RFFXUV LQ RWKHU PDPPDOLDQ VSHFLHV PRXVH UDW FDW FDWWOH PLQN IR[ DQG NLOOHU ZKDOH %HLJH EJf LV D ZHOO GHVFULEHG PRXVH PRGHO RI &+6 7KH FOLQLFDO DQG SDWKRORJLFDO IHDWXUHV RI &+6 SDWLHQWV DQG EJ PLFH DUH LQGLVWLQJXLVKDEOH 3ULRU WR WKH FORQLQJ RI EJ WKH VWURQJHVW HYLGHQFH RI KRPRORJRXV GHIHFWV LQ EHLJH DQG &+6 FDPH IURP LQWHUVSHFLILF JHQHWLF FRPSOHPHQWDWLRQ VWXGLHV ZKLFK GHPRQVWUDWHG WKDW IXVLRQ RI EJ DQG &+6 ILEUREODVWV IDLOHG WR UHYHUVH O\VRVRPDO DEQRUPDOLWLHV ZKLOH IXVLRQ ZLWK QRUPDO FHOOV GLG HOLPLQDWH F\WRORJLFDO GHIHFWV RI EJ RU &+6 ILEUREODVWV 3HURX DQG .DSODQ 3HQQHU DQG 3ULHXU f 3DUWLDO DOELQLVP LV RQH RI WKH PDLQ FOLQLFDO PDQLIHVWDWLRQV RI WKH &KHGLDN+LJDVKL V\QGURPH 0RVW SDWLHQWV KDYH K\SRSLJPHQWDWLRQ RI WKHLU KDLU VNLQ DQG RFXODU IXQGL DV ZHOO DV PLVURXWLQJ RI WKH RSWLF QHUYH ILEHUV WKDW LV FKDUDFWHULVWLF RI DOO W\SHV RI DOELQLVP :LQGKRUVW HW DO UHSRUWHG WKH SUHVHQFH RI JLDQW PHODQRVRPHV LQ PHODQRF\WHV IURP &+6 SDWLHQWV 6RPH PHODQRVRPHV ZHUH KLJKO\ LUUHJXODU ZLWK D VXJJHVWLRQ RI IXVLRQ RI VHSDUDWH JUDQXOHV 0RVW HSLGHUPDO PHODQRVRPHV IURP D &+6 SDWLHQW REVHUYHG E\ =KDR HW DO ZHUH VHYHUDO WLPHV ODUJHU WKDQ QRUPDO UHODWLYHO\ DPHODQRWLF DQG RFFDVLRQDOO\ FOXVWHUHG LQWR FRPSOH[HV 1R PHODQRVRPHV ZHUH GHWHFWHG LQ NHUDWLQRF\WHV DGMDFHQW WR PHODQRF\WHV VXJJHVWLQJ WKDW WKH QRUPDO WUDQVSRUW RI PHODQRVRPHV IURP PHODQRF\WHV WR QHLJKERULQJ NHUDWLQRF\WHV LV GHIHFWLYH $IWHU '23$ KLVWRFKHPLVWU\ XVHG WR ORFDOL]H IXQFWLRQDO W\URVLQDVH UHDFWLRQ SURGXFW ZDV REVHUYHG WKURXJKRXW WKH F\WRSODVP EXW QRW LQ PRVW RI WKH DEHUUDQW ODUJH PHODQRVRPHV DQG FRPSOH[HV LQGLFDWLQJ WKDW IXQFWLRQDO W\URVLQDVH LV HLWKHU QRW WUDQVORFDWHG WR RU LV QRW UHWDLQHG ZLWKLQ WKH JLDQW JUDQXOHV ,Q FRQWUDVW WR FRQWURO PHODQRF\WHV '23$SRVLWLYH YHVLFOHV PLJUDWHG IDU EH\RQG WKHLU XVXDO SHULQXFOHDU DQG WUDQV *ROJL QHWZRUN ORFDWLRQ DQG ZHUH VHHQ LQ WKH YLFLQLW\ RI

PAGE 12

WKH SODVPD PHPEUDQH LQ PHODQRF\WHV IURP &+6 SDWLHQWV :KHQ VHYHUDO PHODQRF\WH VSHFLILF SURWHLQV ZHUH ORFDOL]HG KLVWRFKHPLFDOO\ RU LPPXQRKLVWRFKHPLFDOO\ WKH\ ZHUH SUHGRPLQDQWO\ GHWHFWHG LQ WKH SHULQXFOHDU DUHD DQG OHVV SUHYDOHQW LQ WKH GHQGULWHV RI &+6 FHOOV FRPSDUHG WR WKHLU UHODWLYHO\ XQLIRUP GLVWULEXWLRQ WKURXJKRXW WKH F\WRSODVP RI FRQWURO FHOOV =KDR HW DO f VXJJHVWLQJ DQ LQHIILFLHQW LQWUDFHOOXODU WUDQVORFDWLRQ RI WKHVH SURWHLQV 0HGLXP FRQGLWLRQHG E\ &+6 FHOOV IRU WR GD\V GLVSOD\HG LQFUHDVLQJ DPRXQWV RI W\URVLQDVH DFWLYLW\ WKDW GLG QRW H[LVW LQ PHGLXP FRQGLWLRQHG E\ QXPHURXV FRQWURO FHOO OLQHV JOXFXURQLGDVH ZDV DOVR UHOHDVHG LQWR WKH FXOWXUH PHGLXP E\ &+6 PHODQRF\WHV EXW QRW E\ FRQWURO PHODQRF\WHV 7KHVH GDWD VXJJHVW WKDW WKH ORZ W\URVLQDVH DFWLYLW\ LQ JLDQW PHODQRVRPHV UHVXOWV IURP PLVORFDOL]DWLRQ DQG HYHQWXDO H[WUDFHOOXODU VHFUHWLRQ RI W\URVLQDVH 7KLV K\SRWKHVLV LV VXSSRUWHG E\ WKH SUHVHQFH RI '23$SRVLWLYH YHVLFOHV EHQHDWK WKH SODVPD PHPEUDQH ZKHUH IXVLRQVHFUHWLRQ FRXOG RFFXU 3DWLHQWV ZLWK &KHGLDN+LJDVKL V\QGURPH HVSHFLDOO\ WKRVH ZKR VXUYLYH LQWR DGXOWKRRG DQG HOGHUO\ EHLJH PLFH GHYHORS VHULRXV QHXURORJLF GHIHFWV /RFNPDQ HW DO UHSRUWHG D SDWLHQW ZLWK WKH W\SLFDO FOLQLFDO DQG F\WRORJLFDO SLFWXUH RI &+6 DQG D VHYHUH PRWRU QHXURSDWK\ $ PHGLDQ QHUYH ELRSV\ VKRZHG WKDW PDQ\ 6FKZDQQ FHOOV FRQWDLQHG ODUJH F\WRSODVPLF SDUWLFOHV ZKLFK WKH DXWKRUV FRQVLGHUHG WR EH DEQRUPDO O\VRVRPHV 7ZR FDVHV ZLWK O\PSKRKLVWLRF\WLF LQILOWUDWLRQ RI WKH VXUDO DQG IHPRUDO QHUYHV ZHUH GHVFULEHG E\ 6XQJ HW DO 7KH P\HOLQ VKHDWKV DQG D[RQV VKRZHG VZHOOLQJ DQG IUDJPHQWDWLRQ RU KDG GLVDSSHDUHG 6FKZDQQ FHOOV ZHUH K\SHUWURSKLF DQG FRQWDLQHG F\WRSODVPLF LQFOXVLRQV 8OWUDVWUXFWXUDO H[DPLQDWLRQ RI GRUVDO URRW DQG V\PSDWKHWLF JDQJOLRQ FHOOV GHPRQVWUDWHG LQFOXVLRQV UHVHPEOLQJ O\VRVRPHV DQG OLSRIXVFLQ JUDQXOHV

PAGE 13

3HWWLW DQG %HUGDO UHSRUWHG D \HDUROG PDQ ZLWK D QHXURORJLF GLVRUGHU WKDW UHVHPEOHG D VSLQRFHUHEHOODU GHJHQHUDWLRQ DQG 3DUNLQVRQLVP &HUHEHOODU FRUWLFDO DWURSK\ .RQGR HW DO f DQG GLIIXVH DWURSK\ RI WKH EUDLQ ZLWK DEQRUPDOLWLHV LQ WKH SHULYHQWULFXODU DQG FRURQD UDGLDWD UHJLRQV ZHUH GHWHFWHG E\ FRPSXWHU WRPRJUDSK\ DQG PDJQHWLF UHVRQDQFH LPDJLQJ %DOODUG HW DO f 7KH ROGHVW NQRZQ &+6 SDWLHQW ILUVW VHHQ ZLWK D QHXURORJLF GLVRUGHU LQ HDUO\ DGXOW OLIH ZDV GHVFULEHG E\ 8\DPD HW DO 7KLV \HDUROG ZRPDQ GHYHORSHG PHQWDO GHWHULRUDWLRQ 3DUNLQVRQLVP PXVFXODU DWURSK\ RI OLPEV DQG ORVV RI WHQGRQ UHIOH[HV 05, VKRZHG PDUNHG WHPSRUDO GRPLQDQW EUDLQ DWURSK\ DQG GLIIXVH VSLQDO FRUG DWURSK\ 6LPLODUO\ EHLJH PLFH WKDW VXUYLYH WR PRQWKV RI DJH VKRZ D SURJUHVVLYH QHXURORJLF GLVRUGHU DFFRPSDQLHG E\ QHDUO\ FRPSOHWH ORVV RI FHUHEHOODU 3XUNLQMH FHOOV 0XUSK\ DQG 5RWKV f *XR HW DO UHSRUWHG F\WRDUFKLWHFWRQLF DEQRUPDOLWLHV LQ WKH EUDLQV RI EHLJH PLFH ,Q WKH FHUHEHOOXP 3XUNLQMH FHOOV DQG FOXVWHUV RI JUDQXOH FHOOV DQG RFFDVLRQDOO\ JOLD FHOOV ZHUH ORFDWHG HFWRSLFDOO\ LQ WKH PROHFXODU OHYHO ,Q WKH KLSSRFDPSXV HFWRSLFDOO\ VLWXDWHG S\UDPLGDO FHOOV ZHUH IRXQG 7KH LQIUDS\UDPLGDO PRVV\ ILEHU OD\HU ZDV QRW FRPSDFW EXW DSSHDUHG DV FOXPSV RI VFDWWHUHG ILEHU EXQGOHV 3H]HVKNSRXU HW DO UHSRUWHG WKH SUHVHQFH RI JLDQW O\VRVRPHV LQ 6FKZDQQ FHOOV LQ D QHUYH ELRSV\ IURP D &+6 SDWLHQW 3HULSKHUDO QHXURSDWK\ LQ D \HDUROG EURWKHU DQG D \HDUROG VLVWHU ZLWK &+6 ZHUH GHVFULEHG E\ 0LVUD HW DO %RWK VKRZHG HYLGHQFH RI D VHQVRU\ QHXURSDWK\ DVVRFLDWHG ZLWK FHQWUDO QHUYRXV V\VWHP LQYROYHPHQW 1HUYH FRQGXFWLRQ VWXGLHV LQGLFDWHG DQ D[RQDO QHXURSDWK\ 6XUDO QHUYH ELRSV\ GHPRQVWUDWHG D ORVV RI P\HOLQDWHG QHUYH ILEHUV SDUWLFXODUO\ WKRVH RI ODUJHU VL]H DQG RI XQP\HOLOQDWHG D[RQV %\ OLJKW DQG HOHFWURQ PLFURVFRS\ JUDQXODWHG FHOOV ZLWK WKH VWDLQLQJ SURSHUWLHV RI PDVW FHOOV ZHUH SUHVHQW LQ WKH HQGRQHXULXP ,QVWHDG RI EHLQJ WKH

PAGE 14

XVXDO DP LQ GLDPHWHU WKH JUDQXOHV ZHUH DSSUR[LPDWHO\ WLPHV ODUJHU DQG ZLWK XQXVXDO DSSHDUDQFH %OXPH DQG :ROI UHSRUWHG LUUHJXODU JLDQW LQFOXVLRQV WKRXJKW WR EH O\VRVRPHV LQ WKH F\WRSODVP RI 6FKZDQQ FHOOV 7KHVH PRUSKRORJLF REVHUYDWLRQV RI DEQRUPDOO\ ODUJH JUDQXOHV VXJJHVW WKDW WKH QHXURORJLFDO DEHUUDWLRQV LQ &+6 UHVXOW IURP GHIHFWLYH YHVLFXODU WUDQVSRUW RI PROHFXOHV WKDW DUH LPSRUWDQW IRU WKH QRUPDO FHOOXODU IXQFWLRQ %OHHGLQJ WHQGHQF\ LV DQRWKHU PDMRU FOLQLFDO PDQLIHVWDWLRQ LQ SDWLHQWV DQG DQLPDOV ZLWK &+6 :KLOH WKH SODWHOHW QXPEHUV DUH QRUPDO 1RYDN HW DO 3KLOOLSV HW DO f GHQVH SODWHOHW JUDQXOHV DUH YLUWXDOO\ DEVHQW ZKROHEORRG VHURWRQLQ LV PDUNHGO\ GHFUHDVHG DQG SODWHOHWV KDYH UHGXFHG DELOLW\ WR DFFXPXODWH VHURWRQLQ 0H\HUV HW DO 0H\HUV HW DO f 7KH SURORQJHG EOHHGLQJ WLPH DQG ORZ VHURWRQLQ FRQFHQWUDWLRQV ZHUH FRQYHUWHG WR QRUPDO YDOXHV IROORZLQJ WUDQVSODQWDWLRQ RI QRUPDO ERQH PDUURZ LQ EHLJH PLFH /LNHZLVH FRQWURO PLFH GLVSOD\HG V\PSWRPV RI VWRUDJH SRRO GHILFLHQF\ ZKHQ WUDQVSODQWHG ZLWK PXWDQW PDUURZ 1RYDN HW DO f 7KHVH VWXGLHV GHPRQVWUDWH WKDW WKH &+6 SODWHOHW VWRUDJH SRRO GHILFLHQF\ UHVXOWV IURP D GHIHFW LQ ERQH PDUURZ SUHFXUVRU FHOOV ,Q DJUHHPHQW ZLWK WKLV FRQFOXVLRQ 0HQDUG DQG 0H\HUV VKRZHG WKDW WKH GHQVH JUDQXOH SUHFXUVRUV LQ PDWXULQJ DQG PDWXUH PHJDNDU\RF\WHV ZHUH DEVHQW $EQRUPDO SODWHOHW DJJUHJDWLRQ ZDV GHVFULEHG LQ SDWHQWV ZLWK &+6 $SLW]&DVWUR HW DO f 7KH WRWDO FRQWHQW DQG WKH PD[LPDO DPRXQWV RI WKH GHQVH JUDQXOH FRQVWLWXHQWV VHFUHWHG DIWHU WKURPELQ VWLPXODWLRQ ZHUH JUHDWO\ GHFUHDVHG &+6 SODWHOHWV ORDGHG ZLWK UDGLRODEHOOHG VHURWRQLQ VKRZHG D VSRQWDQHRXV UHOHDVH RI UDGLRDFWLYLW\ QRW REVHUYHG LQ QRUPDO SODWHOHWV XQGHU WKH VDPH FRQGLWLRQV 6LPLODU GHIHFWV ZHUH UHSRUWHG LQ FDWV &ROJDQ

PAGE 15

HW DO f DQG LQ EOXH IR[HV 6MDDVWDG HW DO f ZLWK &KHGLDN+LJDVKL V\QGURPH ,Q EHLJH PLFH SODWHOHW DJJUHJDWLRQ DIWHU VWLPXODWLRQ ZDV VLJQLILFDQWO\ GHFUHDVHG FRPSDUHG WR WKDW RI QRUPDO PLFH 3UDWW HW DO f 3ODWHOHWV IURP EHLJH PLFH ZHUH DSSUR[LPDWHO\ WLPHV PRUH VHQVLWLYH WR SURVWDF\FOLQ LQKLELWLRQ RI FROODJHQLQGXFHG DJJUHJDWLRQ WKDQ FRQWURO SODWHOHWV 7KH VWRUHV RI VHURWRQLQ DQG DGHQLQH QXFOHRWLGHV ZHUH GHFUHDVHG 5HQGX HW DO UHSRUWHG D ODUJH UHGXFWLRQ LQ WKH QXPEHU RI VHURWRQLQVWRUDJH JUDQXOHV GHQVH ERGLHVf EXW RWKHUZLVH QRUPDO XOWUDVWUXFWXUH DQG QRUPDO DPRXQWV RI D DQG FDWDODVHn SRVLWLYH JUDQXOHV LQ SDWLHQWV ZLWK &KHGLDN+LJDVKL V\QGURPH 7KH SODWHOHW UHOHDVH UHDFWLRQ VWXGLHG ZLWK WKURPELQ DV DQ LQGXFHU ZDV LPSDLUHG 7KH VHURWRQLQ XSWDNH E\ WKH SDWLHQWVf SODWHOHWV ZDV ORZ DQG LWV PHWDEROLVP ZDV LQFUHDVHG 7KHVH ILQGLQJV VKRZ WKDW KXPDQ &+6 SODWHOHWV DUH GHILFLHQW LQ WKH VWRUDJH SRRO RI GHQVH JUDQXOH VXEVWDQFHV DQG VXJJHVW WKDW WKLV JUDQXOH GHIHFW LQIOXHQFHV WKH UHOHDVH PHFKDQLVP RI RWKHU JUDQXOH FRQVWLWXHQWV OHDGLQJ WR DEQRUPDO DJJUHJDWLRQ DQG EOHHGLQJ SUHGLVSRVLWLRQ 0RVW PRUELGLW\ DQG PRUWDOLW\ LQ &+6 UHVXOW IURP LPPXQH GHILFLHQF\ ZLWK VHYHUH GHIHFWV LQ LQQDWH LPPXQLW\ JUDQXORF\WHV DQG 1. FHOOVf DQG UHODWLYHO\ PLOG LPSDLUPHQW RI DFTXLUHG LPPXQH IXQFWLRQ % DQG 7 FHOOVf 7KH LQLWLDO LPPXQH GHIHFW UHFRJQL]HG LQ &+6 ZDV D VWULNLQJ UHGXFWLRQ LQ WKH DELOLW\ RI JUDQXORF\WHV WR NLOO SKDJRF\WRVHG PLFURRUJDQLVPV %OXPH HW DO *DOOLQ HW DO f 3KDJRF\WRVLV RI UDGLRODEHOOHG 6WDSK\ORFRFFXV DXUHXV E\ &+6 JUDQXORF\WHV ZDV QRUPDO +RZHYHU WKHUH ZDV UHGXFHG EDFWHULFLGDO DFWLYLW\ RI 6 DXUHXV DQG JURXS 6WUHSWRFRFFXV E\ &+6 FHOOV WKURXJK PLQ RI LQFXEDWLRQ 7KLV GHIHFW ZDV PRVW SURQRXQFHG DW HDUO\ WLPH SHULRGV DQG ZDV UHODWHG WR LPSDLUHG LQWUDFHOOXODU NLOOLQJ 7KHUH

PAGE 16

DUH RFFDVLRQDO UHSRUWV VXJJHVWLQJ PRUH ZLGHVSUHDG QHXWURSKLO DEQRUPDOLWLHV ,Q RQH VWXG\ %HOOLQDWL3LUHV HW DO f LQ ZKLFK SKDJRF\WRVLV DQG NLOOLQJ RI 6WDSK\ORFRFFXV DXUHXV ZHUH VLPXOWDQHRXVO\ HYDOXDWHG E\ D IOXRURFKURPH SKDJRF\WRVLV DVVD\ ERWK DSSHDUHG WR EH GHILFLHQW LQ QHXWURSKLOV IRUP WZR SDWLHQWV ZLWK &+6 7KH SUHVHQFH RI JLDQW SKDJRO\VRVRPHV HQFORVLQJ EDFWHULD LQ DFWLYH SUROLIHUDWLRQ PLQ DIWHU SKDJRF\WRVLV ZDV QRWHZRUWK\ DQG FRUUHVSRQGHG ZLWK WKH LPSDLUHG EDFWHULFLGDO DFWLYLW\ RI WKHVH OHXNRF\WHV ,Q DQ XQGHUDJDURVH DVVD\ SKDJRF\WHV RI KRPR]\JRWH DQG SKHQRW\SLFDOO\ QRUPDO KHWHUR]\JRWH &+6 FDWV UHFRJQL]HG DQG UHVSRQGHG HTXDOO\ ZHOO WR EDFWHULDO VWLPXOL DV GLG FHOOV IURP FRQWURO DQLPDOV EXW WUDYHOHG VKRUWHU GLVWDQFHV SULPDULO\ EHFDXVH RI D UHGXFHG LQKHUHQW PRWLOLW\ 6LPLODU UHVXOWV ZHUH REWDLQHG ZKHQ SKDJRF\WH FKHPRWD[LV ZDV HYDOXDWHG ZLWK ]\PRVDQDFWLYDWHG VHUXP &ROJDQ HW DO f 0LOGO\ GHIHFWLYH &+6 QHXWURSKLO DQG PRQRF\WH ORFRPRWLRQ ZDV GLVFRYHUHG E\ WKH PLFURSRUH ILOWHU WHFKQLTXH XVLQJ PRGLILHG %R\GHQ FKDPEHUV
PAGE 17

HRVLQRSKLOV ZKLOH WKH QRQFU\VWDOORLG JUDQXOHV DUH SUHVHUYHG VXJJHVWLQJ WKDW WKH XQGHUO\LQJ SDWKRORJ\ GRHV QRW DIIHFW DOO O\VRVRPDO VXESRSXODWLRQV +DPDQDND HW DO f 7KH VHFRQG FDWHJRU\ RI &+6 LPPXQH GHIHFWV LV D YLUWXDO DEODWLRQ RI QDWXUDO NLOOHU 1.f FHOO DFWLYLW\ DQG DQWLERG\ GHSHQGHQW FHOOXODU F\WRWR[LFLW\ 5RGHU DQG 'XZH 5RGHU HW DO f 0DWXUH 1. FHOOV GHPRQVWUDWH ORZ O\WLF HIILFLHQF\ DVVHVVHG E\ FRQYHQWLRQDO K FKURPLXP UHOHDVH DVVD\ DQG E\ D PRUH UHFHQWO\ GHYHORSHG VLQJOH FHOO OLTXLG F\WRWR[LF DVVD\ 7KH 1. FHOOV ZHUH QRW DFWLYDWHG E\ SURORQJHG LQ YLWUR LQFXEDWLRQ ZLWK ,)1\ EXW WKH\ H[KLELWHG ,/ LQGXFHG F\WRWR[LFLW\ WKRXJK WKH PDJQLWXGH RI LQGXFWLRQ ZDV XQLIRUPO\ OHVV WKDQ LQ FRQWUROV 9LUHOL]LHU DQG *ULVFHOOL +ROFRPEH f &+6 1. FHOOV KDYH WKH QHFHVVDU\ FHOOXODU VWUXFWXUHV UHTXLUHG IRU WKHLU UROH DV O\WLF HIIHFWRU FHOOV EXW ODFN F\WRWR[LF IXQFWLRQ GXH WR D UHODWLYH UHIUDFWRULQHVV LQ LQLWLDWLQJ WKH SRVWELQGLQJ O\WLF PHFKDQLVP 1. FHOOV LQ &+6 SDWLHQWV DUH EORFNHG DW D SRVWn UHFRJQLWLRQ SRVWDFWLYDWLRQ VWHS LQ WKH F\WRO\WLF SDWKZD\ VXEVHTXHQW WR WKH EXUVW RI R[\JHQ LQWHUPHGLDWHV EXW SUHFHGLQJ WKH OHWKDO KLW ,Q VXPPDU\ ZKLOH 1. FHOOV DUH SUHVHQW LQ QRUPDO QXPEHUV ELQG WDUJHW FHOOV HIIHFWLYHO\ DQG JHQHUDWH VXSHUR[LGH LRQV QRUPDOO\ H[RF\WRVLV RI O\WLF JUDQXOHV IURP WKH &+6 1. FHOOV LV UHIUDFWRU\ 7DUJDQ DQG 2VHDV 5RGHU HW DO %UDKPL f 7XPRU VXVFHSWLELOLW\ RI EJ PLFH ZDV H[DPLQHG DV D GLUHFW WHVW RI WKH K\SRWKHVLV WKDW 1. FHOOV DUH LQYROYHG LQ VXUYHLOODQFH DJDLQVW QHRSODVLD 6XEFXWDQHRXV LQRFXODWLRQ LQ D WUDQVSODQWDWLRQ WHVW \LHOGHG KLJKHU WXPRU WDNH LQFLGHQFH LQ EJEJ PLFH WKDQ LQ KHWHUR]\JRXV OLWWHUPDWHV 7KH GLIIHUHQFHV ZHUH PRVW VWULNLQJ LQ WKH HDUO\ SKDVH RI WKH

PAGE 18

REVHUYDWLRQ SHULRG ZLWK D PDMRULW\ RI WKH WRWDO WXPRU WDNHV LQ EJEJ UHJLVWHUHG ZLWKLQ ZHHNV ZKHUHDV RQO\ D VPDOO SDUW RI WKH WXPRUV LQ EJ PLFH ZHUH SDOSDEOH DW WKLV WLPH 7KXV LQ DGGLWLRQ WR WKH LQFUHDVHG LQFLGHQFH LQ KRPR]\JRXV PLFH WKH SURJUHVVLYHO\ JURZLQJ WXPRUV DSSHDUHG ZLWK D VKRUWHU ODWHQF\ WKDQ LQ FRQWUROV 7KLV ZDV DOVR UHIOHFWHG LQ WKH ODUJHU PHDQ WXPRU GLDPHWHU E\ DQG ZHHNV DQG WKH HDUOLHU GHDWKV DPRQJ WXPRUn EHDULQJ EJEJ WKDQ EJ PLFH 7KHVH ILQGLQJV FRUUHODWHG ZHOO ZLWK WKH LQ YLWUR PHDVXUHG VSOHQLF 1. DFWLYLW\ DJDLQVW ERWK WXPRUV WHVWHG 7XPRU FHOOV KDG D ORZ EXW VLJQLILFDQW VHQVLWLYLW\ WR EJ VSOHHQ FHOO F\WRWR[LFLW\ b VSHFLILF O\VLVf ZKHUHDV EJEJ VSOHHQ FRQVLVWHQWO\ JDYH YDOXHV EHORZ b VSHFLILF O\VLV .DHUUH HW DO f ,Q DQRWKHU VWXG\ D WXPRU OLQH PRGLILHG WR EH VHQVLWLYH WR 1. F\WRWR[LFLW\ LQ YLWUR GHPRQVWUDWHG LQ YLYR DQ LQFUHDVHG JURZWK UDWH IDVWHU LQGXFWLRQ WLPH DQG DQ HQKDQFHG PHWDVWDWLF FDSDELOLW\ LQ EJ FRPSDUHG WR FRQWURO PLFH 7KLV ZDV QRW IRXQG ZLWK D WXPRU OLQH LQVHQVLWLYH WR 1. DFWLYLW\ ,Q YLYR DFWLYDWLRQ RI 1. FHOOV LQ EJ DQG FRQWURO PLFH UHVXOWHG LQ GHFUHDVH LQ WXPRU JURZWK UDWH DQG PHWDVWDWLF IUHTXHQF\ 7DOPDJH HW DO f ,Q D ODUJH -DSDQHVH FRKRUW QRQ+RGJNLQfV O\PSKRPD RFFXUUHG LQ RYHU RQH WKLUG RI &+6 SDWLHQWV +D\DNDZD HW DO f 7KHVH UHVXOWV LQGLFDWH WKDW 1. FHOOV KDYH DQ LPSRUWDQW IXQFWLRQ LQ WKH KRVWfV FRQWURO RI WXPRU JURZWK DQG PHWDVWDVLV 7KH LGHD WR XVH WKH EJ PRGHO WR GLVVHFW WKH FRQWULEXWLRQ RI 1. FHOOV WR LPPXQLW\ DQG LQ SDUWLFXODU WR WXPRU LPPXQRVXUYHLOODQFH ZDV GLVSHOOHG VRPHZKDW KRZHYHU E\ WKH VXEVHTXHQW UHFRJQLWLRQ RI FRQFRPLWDQW LPSDLUPHQW DOEHLW PLOG LQ 7 DQG % FHOO IXQFWLRQ $OWKRXJK ERWK % DQG 7 FHOOV DUH DIIHFWHG LQ &+6 WKH DEQRUPDOLWLHV LQ WKH VSHFLILF GHIHQVH PHFKDQLVPV DUH QRW DV VHYHUH DV WKRVH LQ QDWXUDO LPPXQLW\ DQG KDYH OHVV LPSRUWDQFH IRU WKH SDWKRJHQHVLV RI &+6 7KH SDWKRJQRPRQLF JLDQW F\WRSODVPLF YHVLFOHV

PAGE 19

DUH GHWHFWHG LQ % FHOOV IURP &+6 SDWLHQWV IROORZLQJ DFWLYDWLRQ DQG GLIIHUHQWLDWLRQ *URVVL HW DO f 0RGHUDWH DQG YDULDEOH UHGXFWLRQ RI /36LQGXFHG % FHOO PLWRJHQHVLV LV GHPRQVWUDWHG LQ &+6 7KH LQ YLYR DQWLWULQLWURSKHQ\O DQWLERG\ UHVSRQVH WR D WK\PXV LQGHSHQGHQW DQWLJHQ 713)LFROOf ZDV IRXQG WR EH VLJQLILFDQWO\ ORZHU LQ &%/-J WKDQ LQ &%/PLFH DOWKRXJK ERWK VWUDLQV UHVSRQGHG VLPLODUO\ WR DQ DQDORJRXV WK\PXVGHSHQGHQW DQWLJHQ 713RYDOEXPLQf 3IOXPLR HW DO f 6LQFH WKH PDUJLQDO ]RQH PDFURSKDJHV RI WKH VSOHHQ ZHUH SUHYLRXVO\ VKRZQ WR EH HVVHQWLDO IRU WKH LQLWLDWLRQ RI DQWLERG\ UHVSRQVHV WR WK\PXVLQGHSHQGHQW DQWLJHQV WKH\ PLJKW EH DQRWKHU WDUJHW RI WKH EJ PXWDWLRQ SRVVLEO\ UHVXOWLQJ LQ LPSDLUHG DQWLJHQ SUHVHQWDWLRQ WR % FHOOV ,W LV QRWDEOH WKDW KRPR]\JRVLW\ DW WKH EJ ORFXV FRQIHUV SURWHFWLRQ DJDLQVW LPPXQH FRPSOH[ JORPHUXORQHSKULWLV WR %;6% PLFH ZLWK V\VWHPLF DXWRLPPXQH GLVHDVH &ODUN HW DO f +RZHYHU WKLV SKHQRPHQRQ LV SUREDEO\ QRW GXH WR D GHFUHDVHG % FHOO IXQFWLRQ EHFDXVH WKH OHYHOV DQG W\SHV RI DXWRDQWLERGLHV UHPDLQ XQFKDQJHG LQ EJ KRPR]\JRWHV ([WUHPHO\ KLJK DQWLERG\ WLWHUV WR WKH (SVWHLQ%DUU YLUXV VSHFLILF YLUDO FDSVLG DQWLJHQ WR WKH UHVWULFWHG FRPSRQHQW RI WKH (%9LQGXFHG HDUO\ DQWLJHQ FRPSOH[ DQG WR WKH (%9DVVRFLDWHG QXFOHDU DQWLJHQ ZHUH GHWHFWHG LQ &+6 SDWLHQWV 0HULQR HW DO f ,W LV OLNHO\ WKDW WKH HOHYDWHG DQWLERG\ WLWHUV UHIOHFW DQ LQFUHDVHG SURGXFWLRQ RI WKHVH DQWLJHQV GXH WR GHIHFWLYH 1. DQG DQWLERG\GHSHQGHQW FHOOXODU F\WRWR[LFLW\ $'&&f DFWLYLWLHV &\WRWR[LF O\PSKRF\WHV &7/Vf IURP &+6 SDWLHQWV DUH XQDEOH WR GHVWUR\ WDUJHW FHOOV UHFRJQL]HG YLD WKH 7 FHOO UHFHSWRU 7&5f ,QGLYLGXDO &7/ FORQHV VKRZ SRRU NLOOLQJ WKDW FDQ EH LQFUHDVHG LQ ORQJHU DVVD\V +RZHYHU LQ WKH SUHVHQFH RI F\FORKH[LPLGH WKH VPDOO DPRXQW RI NLOOLQJ LV DEROLVKHG LQGLFDWLQJ WKDW NLOOLQJ DULVHV IURP QHZO\ V\QWKHVL]HG SURWHLQV UDWKHU WKDQ IURP SURWHLQV VWRUHG LQ JUDQXOHV ,W KDV EHHQ VKRZQ WKDW WKH &+6

PAGE 20

&7/ FORQHV H[SUHVV QRUPDO OHYHOV RI WKH O\WLF SURWHLQV JUDQ]\PH $ JUDQ]\PH % DQG SHUIRULQ ZKLFK DUH SURFHVVHG SURSHUO\ GXULQJ ELRV\QWKHVLV DQG WDUJHWHG FRUUHFWO\ WR JLDQW O\WLF JUDQXOHV 'HVSLWH WKH GLIIHUHQFH LQ VL]H &+6 DQG QRUPDO O\WLF JUDQXOHV DUH VLPLODU ERWK FRQWDLQ WKH O\VRVRPDO HQ]\PH FDWKHSVLQ DQG JUDQ]\PH $ DQG ODFN WKH PDQQRVH SKRVSKDWH UHFHSWRU +RZHYHU XQOLNH QRUPDO &7/ FORQHV WKH &+6 &7/V DUH XQDEOH WR VHFUHWH WKHLU JLDQW JUDQXOHV LQ ZKLFK WKH O\WLF SURWHLQV DUH VWRUHG $IWHU FURVVOLQNLQJ WKH 7&5 &+6 &7/ FORQHV IDLO WR VHFUHWH JUDQ]\PH $ DV DVVD\HG E\ ERWK HQ]\PH UHOHDVH DQG FRQIRFDO PLFURVFRS\ %DHW] HW DO f 7KH SURSRUWLRQ RI JDPPDGHOWD 7 FHOOV DPRQJ SHULSKHUDO EORRG PRQRQXFOHDU FHOOV LV VLJQLILFDQWO\ LQFUHDVHG LQ &+6 7KH FHOOXODU PDFKLQHU\ IRU O\VLV RI WDUJHW FHOOV LQ YLWUR LV SUHVHQW LQ &+6GHULYHG JDPPDGHOWD 7 FHOO FORQHV +ROFRPEH HW DO f 7KLV LV WKH ILUVW H[DPSOH RI D VSHFLILF LPPXQRGHILFLHQF\ GLVRUGHU ZLWK D UHODWLYH H[SDQVLRQ RI WKHVH 7 FHOOV $ VKRUW VXPPDU\ RI WKH LPPXQRORJLFDO IHDWXUHV RI &+6 LV SUHVHQWHG LQ 7DEOH

PAGE 21

7DEOH 0DLQ LPPXQRORJLF IHDWXUHV LQ &KHGLDN+LJDVKL V\QGURPH ,11$7( ,0081,7< $&48,5(' ,0081,7< *UDQXORF\WHV 1. FHOOV % FHOOV 7 FHOOV *UHDWO\ UHGXFHG 9HU\ ORZ O\WLF 5HGXFHG DQWLERG\ 'HFUHDVHG DELOLW\ DELOLW\ WR NLOO DFWLYLW\ FDXVHG E\ UHVSRQVH WR WK\PXV RI &7/V WR NLOO WDUJHW SKDJRF\WRVHG PLFUR GHIHFWLYH H[RF\WRVLV LQGHSHQGHQW DQWLJHQV FHOOV FDXVHG E\ RUJDQLVPV RI O\WLF JUDQXOHV PD\ EH GXH WR GHIHFWLYH VHFUHWLRQ RI &KHPRWD[LV 1XPEHUV RI 1. LPSDLUHG QDWXUDO O\WLF JUDQXOHV SKDJRF\WRVLV DQG FHOOV ELQGLQJ WR WDU LPPXQLW\f 5HODWLYH H[SDQVLRQ RWKHU DFWLYLWLHV DUH JHW FHOOV DQG R[\JHQ 0LOGO\ UHGXFHG RI JDPPDGHOWD 7 UHODWLYHO\ ZHOO UDGLFDO SURGXFWLRQ DUH SUROLIHUDWLYH UHVSRQVH FHOO SRSXODWLRQ SUHVHUYHG QRUPDO WR /36 3$7+2*12021,& *,$17 3(5,18&/($5 9(6,&/(6

PAGE 22

0RVW PRUWDOLW\ LQ &+6 SDWLHQWV LV FDXVHG E\ WZR PDQLIHVWDWLRQV RI WKHLU LPPXQH GHILFLHQF\ f§ VHYHUH S\RJHQLF LQIHFWLRQV DQG WKH DFFHOHUDWHG SKDVH /XQJ XSSHU UHVSLUDWRU\ WUDFW DQG VNLQ LQIHFWLRQV FDXVHG E\ 6WDSK\ORFRFFXV 6WUHSWRFRFFXV DQG 3QHXPRFRFFXV SUHGRPLQDWH LQ &+6 DOWKRXJK D ZLGH YDULHW\ RI LQIHFWLRQ VLWHV DQG RUJDQLVPV RFFXU 7KH DFFHOHUDWHG SKDVH LV FRQVLGHUHG D FOLQLFRSDWKRORJLF H[SUHVVLRQ RI D YLUXVDVVRFLDWHG O\PSKRSUROLIHUDWLRQ EHFDXVH RI ORZ &' WR &' 7 O\PSKRF\WH UDWLR SUHVHQFH RI (SVWHLQ%DUU YLUXV JHQRPH LQ WKH PRQRQXFOHDU FHOOV RI WKH O\PSK QRGH EORRG DQG ERQH PDUURZ DQG SRVVLEOH FOLQLFDO UHVSRQVHV WR DF\FORYLU 7KH FXUUHQW WUHDWPHQW IRU &+6 SDWLHQWV UDQJHV IURP YLWDPLQV WR F\WRVWDWLF DJHQWV DQG ERQH PDUURZ WUDQVSODQWDWLRQ EXW WKH SURJQRVLV UHPDLQV SRRU EHFDXVH RI LQFUHDVLQJ VXVFHSWLELOLW\ WR LQIHFWLRQV DQG SURJUHVVLYH QHXURORJLF GHWHULRUDWLRQ 6HYHUDO VWXGLHV VXJJHVW QRYHO VWUDWHJLHV IRU LPPXQRPRGXODWLRQ UHFRPELQDQW FDQLQH JUDQXORF\WH FRORQ\VWLPXODWLQJ IDFWRU WR LPSURYH WKH QHXWURSKLO IXQFWLRQ &ROJDQ HW DO f ,/ WR LQGXFH F\WRWR[LFLW\ RI &+6 O\PSKRF\WHV +ROFRPEH f DQG KLJKGRVH LQWUDYHQRXV JDPPDJOREXOLQ IRU PDQDJHPHQW RI WKH DFFHOHUDWHG SKDVH .LQXJDZD DQG 2KWDQL f 7KH JRDO RI VXFK WKHUDSLHV ZRXOG EH WR SDUWLDOO\ FRPSHQVDWH WKH LPPXQH FHOO G\VIXQFWLRQ FDXVHG E\ WKH EDVLF JHQHWLF GHIHFW DQG PDQLIHVWHG DV DEQRUPDO SURWHLQ WUDIILFNLQJ 7KH WUDQVSRUW RI QHZO\ V\QWKHVL]HG SURWHLQV IURP WKH HQGRSODVPLF UHWLFXOXP WR WKH *ROJL DSSDUDWXV DQG IURP WKHUH WR WKH FHOO VXUIDFH DQG HOVHZKHUH LV PHGLDWHG E\ WUDQVSRUW YHVLFOHV ZKLFK WUDQVIHU HQFORVHG SURWHLQV E\ F\FOHV RI YHVLFOH EXGGLQJ DQG IXVLRQ 7KH DEQRUPDOLWLHV LQ &+6 FDQ EH H[SODLQHG E\ D FRPSDUWPHQWDO PLVVRUWLQJ RI D YDULHW\ RI SURWHLQV ZKLFK DUH QHFHVVDU\ IRU WKH SURSHU IXQFWLRQ RI WKH DIIHFWHG FHOO W\SHV IRU H[DPSOH &+6 &7/V FDQQRW VHFUHWH VWRUHG JUDQ]\PH $ DQG RWKHU O\WLF SURWHLQV DQG

PAGE 23

WKHUHIRUH FDQQRW O\VH WDUJHW FHOOV HIILFLHQWO\ 7KH PRUSKRORJLF PDQLIHVWDWLRQ RI WKH SURWHLQ VRUWLQJ GHIHFW LQ &+6 LV WKH SUHVHQFH RI JLDQW SHULQXFOHDU YHVLFOHV LQ WKH F\WRSODVP RI WKH DIIHFWHG FHOOV 7KH DVVRUWPHQW RI SURWHLQ WUDIILFNLQJ GHIHFWV REVHUYHG LQ &+6 GHILHV VLPSOH H[SODQDWLRQ WUDIILFNLQJ ERWK WR DQG IURP WKH ODWH HQGRVRPDOO\VRVRPDO FRPSDUWPHQWV LV DIIHFWHG DQG SURWHLQV ZKLFK XWLOL]H ERWK WKH FDWLRQLQGHSHQGHQW PDQQRVHSKRVSKDWH DQG RWKHU WUDQVSRUW PHFKDQLVPV DUH PLVVRUWHG ,Q FRQWUDVW WDUJHWLQJ RI PHPEUDQH SURWHLQV WR O\VRVRPDOODWH HQGRVRPDO FRPSDUWPHQWV /$03 /$03 UDE DFLG SKRVSKDWDVHf LV LQWDFW ([SHULPHQWV GHPRQVWUDWLQJ VSRQWDQHRXV FRQFDYDOLQ$ LQGXFHG FDSSLQJ RI &+6 JUDQXORF\WHV VXJJHVW WKDW WKH GHIHFW LPSDLUV LQWHUDFWLRQV EHWZHHQ PLFURWXEXOHV DQG HQGRVRPHVO\VRVRPHV 2OLYHU HW DO f +RZHYHU GHWDLOHG H[DPLQDWLRQ RI PLFURWXEXOHV DQG PLFURWXEXOHEDVHG PRWRUV KDV QRW GLVFORVHG DQ DEQRUPDOLW\ 3HURX DQG .DSODQ f ,Q VXPPDU\ DEQRUPDOLWLHV LQ O\VRVRPDO DQG HQGRVRPDO SURFHVVLQJ PD\ H[SODLQ WKH FOLQLFDO IHDWXUHV RI &+6 VXJJHVWLQJ WKDW WKH GHIHFW LQYROYHV D SURWHLQ WKDW UHJXODWHV FHUWDLQ DVSHFWV RI WUDIILFNLQJ WR DQG IURP O\VRVRPDOODWH HQGRVRPDO FRPSDUWPHQWV LQ PDQ\ FHOO W\SHV $ VXPPDU\ RI WKH PHFKDQLVPV LQYROYHG LQ WKH SDWKRJHQHVLV RI &KHGLDN+LJDVKL V\QGURPH LV SUHVHQWHG LQ )LJO $OO FOLQLFDO PDQLIHVWDWLRQV DUH FDXVHG E\ D FRPPRQ GHIHFW LQ WKH UHJXODWLRQ RI YHVLFXODU WUDIILFNLQJ LQ GLIIHUHQW FHOO W\SHV PHODQRVRPHV DUH DIIHFWHG LQ PHODQRF\WHV UHVXOWLQJ LQ SDUWLDO DOELQLVP GHQVH JUDQXOHV LQ SODWHOHWV DUH GHIHFWLYH OHDGLQJ WR EOHHGLQJ SUHGLVSRVLWLRQ O\VRVRPHV DQG VHFUHWRU\ YHVLFOHV LQ QXPHURXV LPPXQH FHOOV DUH GHILFLHQW FDXVLQJ IUHTXHQW LQIHFWLRQV DQG LQFUHDVHG LQFLGHQFH RI WXPRUV DQG JLDQW LQFOXVLRQV DUH SUHVHQW LQ 6FKZDQQ DQG 3XUNLQMH FHOOV ZKLFK FRXOG EH DVVRFLDWHG ZLWK QHXURORJLFDO DEQRUPDOLWLHV

PAGE 24

%$6,& 02/(&8/$5 '()(&7 L $%1250$/ /<62620$//$7( (1'2620$/ &203$570(17 I2,$17 9(6,&/(6A L U 0(/$12620(6 /<62620(6 6(&5(725< 9(6,&/(6 '(16( *5$18/(6 *,$17 ,1&/86,216 L L 0(/$12&<7(6 0212&<7(6 (26,123+,/6 3/$7(/(76 6&+:$11 &(//6 0$&523+$*(6 0$67 &(//6 385.,1-( &(//6 1(87523+,/6 1. &(//6 /<03+2&<7(6 3$57,$/ )5(48(17 6(9(5( ,1)(&7,216 %/((',1* 1(852/2*,&$/ $/%,1,60 ,1&5($6(' 78025 ,1&,'(1&( 35(',6326,7,21 $%1250$/,7,(6 )LJXUH 0HFKDQLVPV LQYROYHG LQ WKH SDWKRJHQHVLV RI &KHGLDN+LJDVKL V\QGURPH

PAGE 25

7KH QHHG IRU PROHFXODU XQGHUVWDQGLQJ RI WKH EDVLF GHIHFW LQ &KHGLDN+LJDVKL V\QGURPH OHG WR WKH ILUVW PDSSLQJ VWXGLHV ZKLFK ZHUH JUHDWO\ IDFLOLWDWHG E\ WKH H[LVWHQFH RI WKH PRXVH PRGHO EHLJH /LQNDJH RI VDWLQ VDf ZLWK EJ GHILQHG D QHZ OLQNDJH JURXS ODWHU IRXQG WR OLH RQ SUR[LPDO PRXVH FKURPRVRPH &KUf 6W $PDQG DQG &XSS /\RQ DQG 0HUHGLWK /DQH f 2ZHQ HW DO VKRZHG WKDW LQ PRXVH EJ LV FORVHO\ OLQNHG WR WKH JHQH IRU WKH \FKDLQ RI WKH 7 FHOO UHFHSWRU 7&5f +RZHYHU LQ IDPLOLHV ZLWK &+6 5)/3V LQ WKH 7&5 \JHQH ZHUH LQKHULWHG GLVFRUGDQWO\ ZLWK &+6 GHPRQVWUDWLQJ QRQOLQNDJH +ROFRPEH HW DO f DQG VXJJHVWLQJ D EUHDN LQ WKH UHJLRQ RI KRPRORJ\ EHWZHHQ KXPDQ FKURPRVRPH S DQG PRXVH FKURPRVRPH )XUWKHU UHILQHPHQW RI WKH JHQHWLF PDS RI SUR[LPDO PRXVH &KU -XVWLFH HW DO f OHG WR OLQNDJH RI EJ WR WKH JHQH HQFRGLQJ QLGRJHQ 1LGf D VWUXFWXUDO EDVHPHQW PHPEUDQH SURWHLQ -HQNLQV HW DO f 1R FURVVRYHUV EHWZHHQ 1LG DQG EJ ZHUH GHWHFWHG LQ PLFH VXJJHVWLQJ WKDW WKH WZR ORFL DUH ZLWKLQ DSSUR[LPDWHO\ F0 6LQFH KXPDQ QLGRJHQ 1,'f KDV EHHQ DVVLJQHG WR &KU OT 2OVHQ HW DO f WKH FORVH OLQNDJH EHWZHHQ EJ DQG 1LG HVWDEOLVKHG D QHZ JURXS RI KRPRORJ\ EHWZHHQ PRXVH &KU DQG KXPDQ &KU OT VXJJHVWLQJ WKDW WKH JHQH UHVSRQVLEOH IRU WKH &KHGLDN+LJDVKL V\QGURPH LV ORFDWHG LQ WKH WHORPHULF UHJLRQ RI KXPDQ FKURPRVRPH OT 7KHVH UHVXOWV FRQILUPHG WKH HDUOLHU REVHUYDWLRQ RI QRQOLQNDJH EHWZHHQ &+6 DQG 7&5\ +ROFRPEH HW DO f DQG WKH H[LVWHQFH RI D EUHDNLQJ SRLQW LQ WKH UHJLRQ RI KRPRORJ\ EHWZHHQ PRXVH &KU DQG KXPDQ &KU S ,QGHHG OLQNDJH EHWZHHQ 1,' DQG &+6 RQ KXPDQ FKURPRVRPH OT ZDV UHSRUWHG E\ *RRGULFK DQG +ROFRPEH LQ +RPR]\JRVLW\ PDSSLQJ XVLQJ PDUNHUV GHULYHG IURP GLVWDO KXPDQ FKURPRVRPH OT ZDV FDUULHG RXW E\ )XNDL HW DO LQ IRXU

PAGE 26

LQEUHG IDPLOLHV RU SUREDQGV ZLWK W\SLFDO FKLOGKRRG &KHGLDN+LJDVKL V\QGURPH 7KH KXPDQ &+6 JHQH ZDV ORFDOL]HG WR DQ F0 LQWHUYDO IODQNHG E\ '6 DQG '6 RQ &KU ,TT %DUUDW HW DO VWXGLHG &+6 SDWLHQWV IURP IDPLOLHV DQG PDSSHG WKH &+6 ORFXV WR DQ DSSUR[LPDWHO\ F0 UHJLRQ EHWZHHQ '6 DQG '6 RQ KXPDQ FKURPRVRPH ,TT $V D ILUVW VWHS LQ D SRVLWLRQDO FORQLQJ HIIRUW .LQJVPRUH HW DO D SUHFLVHO\ ORFDOL]HG WKH EHLJH JHQH WR D F0 LQWHUYDO RQ SUR[LPDO PRXVH &KU E\ VHJUHJDWLRQ DQDO\VLV ,Q D WRWDO RI PLFH IURP GLIIHUHQW EDFNFURVVHV EJ ZDV IRXQG WR FRVHJUHJDWH ZLWK JHQHWLF PDUNHUV 1LG (VWP '08 '08 '08 DQG '08f 7KH FDQGLGDF\ RI 1LG DQG (VWP ZDV HYDOXDWHG E\ 6RXWKHUQ QRUWKHUQ DQG 573&5 DQDO\VHV ZKLFK VXJJHVWHG WKDW QHLWKHU RI WKHVH WZR JHQHV UHSUHVHQWHG WKH EJ JHQH +RZHYHU LQWHUVWUDLQ GLIIHUHQFHV LQ SXOVHG ILHOG UHVWULFWLRQ IUDJPHQW OHQJWKV ZHUH REVHUYHG SURYLGLQJ D XVHIXO DQG VLPSOH WHVW IRU LQLWLDO HYDOXDWLRQ RI FDQGLGDWH JHQHV $ UHILQHG SK\VLFDO PDS RI WKH EJ FULWLFDO UHJLRQ ZDV UHSRUWHG E\ .LQJVPRUH HW DO E ,QWHUVSHUVHG UHSHWLWLYH HOHPHQWSRO\PHUDVH FKDLQ UHDFWLRQ ,5(3&5f DQG GLUHFW F'1$ VHOHFWLRQ ZHUH XVHG WR LGHQWLI\ QRYHO VHTXHQFH WDJ VLWHV ZKLFK HQDEOHG WKH FRQVWUXFWLRQ RI FRQWLJV FRPSRVHG RI RYHUODSSLQJ <$& DQG 3, FORQHV FRYHULQJ DSSUR[LPDWHO\ NE RI WKH EJ QRQUHFRPELQDQW LQWHUYDO ,Q WZR JURXSV VLPXOWDQHRXVO\ UHSRUWHG WKH LGHQWLILFDWLRQ RI WKH KRPRORJRXV EHLJH DQG &KHGLDN+LJDVKL V\QGURPH JHQHV %DUERVD HW DO LVRODWHG D JHQH GHVLJQDWHG /\VW 7\VRVRPDO WUDIILFNLQJ UHJXODWRUf IURP <$& $ E\ GLUHFW VHOHFWLRQ ZLWK PRXVH VSOHHQ F'1$ ,W ZDV VKRZQ WKDW /\VW UHSUHVHQWHG WKH EHLJH JHQH ZLWK D FRPSOHWH RSHQ UHDGLQJ IUDPH RI QXFOHRWLGHV HQFRGLQJ D SURWHLQ RI DPLQR DFLGV ,W ZDV DOVR GHPRQVWUDWHG WKDW FRUUHVSRQGLQJ KXPDQ FORQHV ZLWK KLJK GHJUHH RI KRPRORJ\ WR PRXVH

PAGE 27

/\VW UHSUHVHQWHG WKH JHQH UHVSRQVLEOH IRU &KHGLDN+LJDVKL V\QGURPH 3HURX HW DO E DOVR UHSRUWHG WKH LGHQWLILFDWLRQ RI WKH EHLJH JHQH E\ <$& FRPSOHPHQWDWLRQ DQG SRVLWLRQDO FORQLQJ ,QWHUHVWLQJO\ WKH SDUWLDO F'1$ VHTXHQFH LVRODWHG E\ 3HURX HW DO GLG QRW PDWFK RU HYHQ RYHUODS ZLWK WKH VHTXHQFH RI /\VW GHVFULEHG E\ %DUERVD HW DO 2QH RI WKH DLPV RI WKH SUHVHQW GLVVHUWDWLRQ ZDV WR H[SODLQ WKLV GLVFUHSDQF\ 7KLV LVVXH ZDV UHVROYHG E\ WKH GHPRQVWUDWLRQ WKDW HDFK RI WKH SUHYLRXVO\ UHSRUWHG EHLJH JHQH VHTXHQFHV ZDV GHULYHG IURP D VLQJOH JHQH E\ DOWHUQDWLYH VSOLFLQJ %DUERVD HW DO 1DJOH HW DO f DV GHVFULEHG LQ WKH 5(68/76 VHFWLRQ RI WKLV GLVVHUWDWLRQ +RZHYHU WKH H[SHFWDWLRQV WKDW WKH LGHQWLILFDWLRQ RI WKH FRPSOHWH PRXVH DQG KXPDQ F'1$ VHTXHQFHV RI WKH &+6 JHQH ZRXOG HOXFLGDWH WKH SUHFLVH IXQFWLRQ RI WKH HQFRGHG SURWHLQ ZHUH QRW PHW 7KH ES IXOOOHQJWK RSHQ UHDGLQJ IUDPH FRUUHVSRQGHG WR D SRO\SHSWLGH RI DPLQR DFLGV ZLWK DQ HVWLPDWHG PROHFXODU PDVV RI GDOWRQV $OWKRXJK VHYHUDO SXWDWLYH GRPDLQV ZHUH IRXQG LQ /\VW WKH SUHGLFWHG SURWHLQ ZDV QRYHO DQG XQOLNH DQ\ RI WKH PROHFXOHV SUHYLRXVO\ LPSOLFDWHG LQ YHVLFXODU WUDQVSRUW %DUERVD HW DO 3HURX HW DO E 1DJOH HW DO f $ KHOLFDO UHJLRQ RI /\VW ZDV VLPLODU WR VWDWKPLQ D SKRVSKRSURWHLQ WKDW UHJXODWHV WKH SRO\PHUL]DWLRQ RI PLFURWXEXOHV DQG DFWV DV D UHOD\ IRU LQWUDFHOOXODU VLJQDO WUDQVGXFWLRQ 7KHUHIRUH WKLV UHJLRQ RI /\VW SRWHQWLDOO\ HQFRGHV D SURWHLQ LQWHUDFWLRQ GRPDLQ WKDW PD\ UHJXODWH PLFURWXEXOHPHGLDWHG O\VRVRPH WUDIILFNLQJ $OWKRXJK WKH &+6 SURWHLQ /<67f LV QRW SUHGLFWHG WR KDYH WUDQVPHPEUDQH KHOLFHV WKH FDUER[\WHUPLQDO WHWUDSHSWLGH &<63f RI WKH PRXVH /\VW,, LVRIRUP LV VLPLODU WR NQRZQ SUHQ\ODWLRQ VLWHV DQG PD\ SURYLGH DWWDFKPHQW WR PHPEUDQHV WKURXJK WKLRHVWHU OLQNDJH ZLWK WKH F\VWHLQH $ QRYHO FRQVHUYHG GRPDLQ GHVLJQDWHG %($&+ %(LJH $QG &+Vf ZDV GHILQHG EDVHG RQ KRPRORJ\ ZLWK RSHQ UHDGLQJ IUDPHV IURP 6 FHUHYLVLDH & HOHJDQV DQG

PAGE 28

D KXPDQ FHOO GLYLVLRQ FRQWURO SURWHLQ UHODWHG SURWHLQ &'&/f 7KH IXQFWLRQ RI WKH %($&+ GRPDLQ UHPDLQV XQNQRZQ +HOLFDO UHJLRQV LQ WKH &+6 SURWHLQ UHVHPEOH $50 DQG +($7 UHSHDW PRWLIV ZKLFK WHQG WR IRUP ORQJ URGV 6RPH +($7FRQWDLQLQJ SURWHLQV DUH DVVRFLDWHG ZLWK YHVLFXODU WUDIILFNLQJ EXW WKH IXQFWLRQDO VLJQLILFDQFH RI WKHVH PRWLIV LQ /\VW LV XQFOHDU 7KH &WHUPLQDO UHJLRQ RI WKH &+6 SURWHLQ FRQWDLQV VHYHUDO FRQVHFXWLYH :' PRWLIV ZKLFK ZHUH RULJLQDOO\ LGHQWLILHG LQ WKH 3VXEXQLW RI WKH *SURWHLQ WUDQVGXFLQ 7KLV :' UHJLRQ PD\ IRUP SVKHHWV DUUDQJHG LQ D SURSHOOHUOLNH VWUXFWXUH WKDW LV WKRXJKW WR PHGLDWH SURWHLQSURWHLQ LQWHUDFWLRQV %DVHG RQ WKH SUHVHQFH RI $50 +($7 %($&+ DQG :' GRPDLQV LW KDV EHHQ SURSRVHG WKDW VLPLODUO\ WR WKH \HDVW VHULQHWKUHRQLQH SURWHLQ NLQDVH 936 /\VW IXQFWLRQV DV D FRPSRQHQW RI D PHPEUDQH DVVRFLDWHG VLJQDO WUDQVGXFWLRQ FRPSOH[ WKDW UHJXODWHV LQWUDFHOOXODU SURWHLQ WUDIILFNLQJ 7KH &+6 SURWHLQ FRQWDLQV PXOWLSOH VLWHV RI SRWHQWLDO SKRVSKRU\ODWLRQ E\ FDVHLQ NLQDVH ,, &.,,f 3.& F$03GHSHQGHQW SURWHLQ NLQDVH DQG W\URVLQH NLQDVH /\VW VHHPV WR FRQWDLQ KHOLFDO EXQGOHV ZLWK FOXVWHUV RI SKRVSKRU\ODWLRQ VLWHV DW WKHLU HQGV 3KRVSKRU\ODWLRQ RI WKHVH SRVLWLRQV FRXOG SURYLGH D FRQWURO PHFKDQLVP E\ FDXVLQJ FRQIRUPDWLRQDO FKDQJH LQ WKH EXQGOHV WKHUHE\ DIIHFWLQJ LQWHUDFWLRQV ZLWK RWKHU PROHFXOHV ,Q VXPPDU\ WKH GRPDLQV LGHQWLILHG LQ /\VW VXSSRUW LWV SRWHQWLDO LQYROYHPHQW LQ WKH UHJXODWLRQ RI VLJQDO WUDQVGXFWLRQ DQG SURWHLQ WUDIILFNLQJ EXW GR QRW SODFH WKH &+6 SURWHLQ LQ DQ\ NQRZQ IDPLO\ DQG GR QRW GHILQH DQ\ SURWHLQV WKDW LQWHUDFW ZLWK /\VW OHDYLQJ WKH TXHVWLRQ DERXW LWV PHFKDQLVP RI DFWLRQ XQDQVZHUHG 7KHUHIRUH WKH PDLQ REMHFWLYH RI WKLV GLVVHUWDWLRQ ZDV WR FKDUDFWHUL]H WKH &KHGLDN +LJDVKL V\QGURPH JHQH DQG LWV SURGXFWV LQ PRUH GHWDLO DQG WR LGHQWLI\ SURWHLQV WKDW

PAGE 29

LQWHUDFW ZLWK /\VW LQ RUGHU WR JHW VRPH LQVLJKWV DERXW LWV ELRORJLFDO UROH )ROORZLQJ WKH FORQLQJ RI WKH &+6 JHQH LQ KXPDQ DQG PRXVH WKH IROORZLQJ VSHFLILF DLPV IRU WKH SUHVHQW GLVVHUWDWLRQ ZHUH GHWHUPLQHG ,GHQWLILFDWLRQ RI PXWDWLRQV LQ SDWLHQWV ZLWK &KHGLDN+LJDVKL V\QGURPH DQG LQ EHLJH PLFH ,GHQWLILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI /\VW P51$ LVRIRUPV ,GHQWLILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI /\VW D EUDLQVSHFLILF PHPEHU RI WKH &KHGLDN+LJDVKL V\QGURPH JHQH IDPLO\ ,GHQWLILFDWLRQ RI SURWHLQV WKDW LQWHUDFW ZLWK WKH &+6 SURWHLQ DQG ZLWK /<67 XVLQJ D \HDVW WZRK\EULG DSSURDFK 'HWHFWLRQ RI PXWDWLRQV LQ WKH &+6 JHQH ZRXOG KHOS WKH LGHQWLILFDWLRQ RI FULWLFDO DPLQR DFLGV DQG GRPDLQV LQ /\VW DQG ZRXOG HQDEOH JHQRW\SHSKHQRW\SH FRUUHODWLRQ DV ZHOO DV WKH GHVLJQ RI WHVWV IRU HDUO\ GLDJQRVLV RI &KHGLDN+LJDVKL V\QGURPH 7KH FKDUDFWHUL]DWLRQ RI GLIIHUHQW P51$ LVRIRUPV ZRXOG GHWHUPLQH WKH IXQFWLRQDO LPSRUWDQFH RI LQGLYLGXDO DOWHUQDWLYHO\ VSOLFHG YDULDQWV DQG WKHLU H[SUHVVLRQ LQ GLIIHUHQW WLVVXHV 7KH LGHQWLILFDWLRQ RI SURWHLQV WKDW LQWHUDFW ZLWK /\VW ZRXOG UHYHDO WKH SDWKZD\V LQ ZKLFK WKH &+6 SURWHLQ LV LQYROYHG DQG ZRXOG HQKDQFH RXU NQRZOHGJH DERXW WKH PHFKDQLVPV RI UHJXODWLRQ RI SURWHLQ WUDIILFNLQJ SDUWLFXODUO\ WR DQG IURP WKH O\VRVRPHV

PAGE 30

0$7(5,$/6 $1' 0(7+2'6 5HYHUVH 7UDQVFULSWLRQ3RO\PHUDVH &KDLQ 5HDFWLRQ 573&5f $PSOLILFDWLRQ RI &+6 3DWLHQW DQG %HLJH 0RXVH F'1$V /\PSKREODVWRLG DQG ILEUREODVW FHOO OLQHV IURP &+6 SDWLHQWV ZHUH REWDLQHG IURP WKH &RULHOO ,QVWLWXWH IRU 0HGLFDO 5HVHDUFK &DPGHQ 1-f 0LFH FDUU\LQJ GLIIHUHQW DOOHOHV RI WKH EHLJH PXWDWLRQ DQG FRQWURO PLFH ZHUH REWDLQHG IURP 7KH -DFNVRQ /DERUDWRU\ %DU +DUERU 0(f VDFULILFHG DQG WKHLU RUJDQV ZHUH KDUYHVWHG DQG KRPRJHQL]HG 7RWDO FHOOXODU 51$ ZDV LVRODWHG IURP KXPDQ DQG PRXVH FHOOV E\ H[WUDFWLRQ ZLWK SKHQROJXDQLGLQH LVRWKLRF\DQDWH 75,]RO 5HDJHQW /LIH 7HFKQRORJLHV ,QF *DLWKHUVEXUJ 0'f 2QH WR WKUHH SJ RI 51$ ZHUH UHYHUVH WUDQVFULEHG XVLQJ 6XSHUVFULSW ,, 51DVH +n UHYHUVH WUDQVFULSWDVH /LIH 7HFKQRORJLHV ,QFf ZLWK ROLJRG7fSULPHG ILUVW VWUDQG F'1$ V\QWKHVLV '1$ IUDJPHQWV RI LQWHUHVW ZHUH 3&5 DPSOLILHG ZLWK .OHQ7DT '1$ SRO\PHUDVH &ORQWHFK /DERUDWRULHV 3DOR $OWR &$f XVLQJ WKH IROORZLQJ DPSOLILFDWLRQ FRQGLWLRQV r& IRU PLQ WKHQ F\FOHV RI r& IRU V r& IRU V r& IRU PLQ IROORZHG E\ PLQ DW r& 3&5 SURGXFWV ZHUH VHSDUDWHG E\ HOHFWURSKRUHVLV RQ DJDURVH JHOV YLVXDOL]HG E\ HWKLGLXP EURPLGH VWDLQLQJ DQG SXULILHG XVLQJ :L]DUG 3&5 3UHSV '1$ 3XULILFDWLRQ 6\VWHP 3URPHJD 0DGLVRQ :,f 2QH S/ RI SXULILHG 3&5 SURGXFW ZDV XVHG DV WHPSODWH IRU D KHPLQHVWHG 3&5 DPSOLILFDWLRQ ZLWK .OHQ7DT '1$ SRO\PHUDVH XQGHU WKH VDPH

PAGE 31

FRQGLWLRQV DV DERYH 3&5 SURGXFWV ZHUH VHSDUDWHG E\ HOHFWURSKRUHVLV RQ DJDURVH JHOV YLVXDOL]HG E\ HWKLGLXP EURPLGH VWDLQLQJ DQG SXULILHG XVLQJ :L]DUG 3&5 3UHSV '1$ 3XULILFDWLRQ 6\VWHP 7KH '1$ FRQFHQWUDWLRQ LQ HDFK VDPSOH ZDV GHWHUPLQHG XVLQJ D 6SHFWURQLF VSHFWURSKRWRPHWHU 0LOWRQ 5R\%DXVFK t /RPE 5RFKHVWHU 1
PAGE 32

6LQJOH6WUDQG &RQIRUPDWLRQ 3RO\PRUSKLVP 66&3f $QDO\VLV 'HWHFWLRQ RI QXFOHRWLGH FKDQJHV E\ 66&3 ZDV SHUIRUPHG DV GHVFULEHG E\ $EHUDQWK\ HW DO %ULHIO\ HDFK 3&5 SURGXFW ZDV PL[HG ZLWK DQ HTXDO YROXPH RI GHQDWXULQJ EXIIHU DQG KHDWHG WR r& IRU PLQ 7KH VDPSOHV ZHUH ORDGHG RQWR PP WKLFN b QDWLYH SRO\DFU\ODPLGH JHOV ZKLFK ZHUH UXQ DW DPELHQW WHPSHUDWXUH DW : IRU K GHSHQGLQJ RQ WKH VL]H RI WKH 3&5 SURGXFW %DQGV ZHUH YLVXDOL]HG E\ VLOYHU VWDLQLQJ %HLGOHU HW DO f '1$ 6HTXHQFLQJ DQG 6HTXHQFH $QDO\VLV $Q $%, 35,60 *HQHWLF $QDO\]HU DQG G\H WHUPLQDWRU F\FOH VHTXHQFLQJ NLW 3HUNLQ (OPHU )RVWHU &LW\ &$f ZLWK $PSOL7DT '1$ SRO\PHUDVH )6 ZHUH XVHG IRU VHTXHQFLQJ DFFRUGLQJ WR WKH PDQXIDFWXUHUfV LQVWUXFWLRQV %RWK VWUDQGV RI SXULILHG 3&5 SURGXFWV DQG SODVPLGV ZHUH VHTXHQFHG WR FRQILUP WKH DFFXUDF\ RI WKH UHVXOWV 6HTXHQFHV ZHUH DQDO\]HG ZLWK WKH *&* 3DFNDJH 'HYHUHX[ HW DO f DQG VHDUFKHV RI WKH 1DWLRQDO &HQWHU IRU %LRWHFKQRORJ\ ,QIRUPDWLRQ GDWDEDVH ZHUH SHUIRUPHG XVLQJ WKH %/$67 QHWZRUN VHUYHU $OWVFKXO HW DO f 1DWLRQDO /LEUDU\ RI 0HGLFLQH YLD ,17(51(7f DQG WKH :KLWHKHDG ,QVWLWXWH 6HTXHQFH $QDO\VLV 3URJUDP 0,7 &DPEULGJH 0$f )RU DQDO\VLV RI VHTXHQFHV LGHQWLILHG E\ WKH \HDVW WZRK\EULG PHWKRG DV SRWHQWLDO LQWHUDFWLQJ SURWHLQV VHH WKH f
PAGE 33

$OOHOH6SHFLILF 2OLJRQXFOHRWLGH $QDO\VLV 3&5 SURGXFWV VSDQQLQJ WKH PXWDWLRQ VLWH LQ SDWLHQW ZHUH WUDQVIHUUHG WR Q\ORQ PHPEUDQHV XVLQJ D VORWEORW DSSDUDWXV $SSUR[LPDWHO\ QJ RI HDFK 3&5 SURGXFW ZDV WUHDWHG ZLWK D GHQDWXULQJ VROXWLRQ 0 1D2+ 0 1D&Of VSOLW LQ KDOI DQG ORDGHG LQ GXSOLFDWH 7ZR PHU ROLJRQXFOHRWLGHV WKDW VSDQ WKH UHJLRQ FRQWDLQLQJ WKH PXWDWLRQ ZHUH V\QWKHVL]HG 2QH FRQWDLQHG WKH VHTXHQFH RI WKH QRUPDO DOOHOH f&*&$&$7* *&$$&&&77ff ZKLOH WKH RWKHU FRQWDLQHG WKH VHTXHQFH RI WKH PXWDQW DOOHOH f *&$&$7***&$$&&&77ff 7KHVH ZHUH HQGODEHOHG ZLWK >\3@G$73 XVLQJ 7 SRO\QXFOHRWLGH NLQDVH DQG K\EULGL]HG WR WKH PHPEUDQHV DW r& +\EULGL]DWLRQ DQG ZDVK EXIIHUV ZHUH DV GHVFULEHG &KXUFK DQG *LOEHUW f 0HPEUDQHV ZHUH ZDVKHG VHTXHQWLDOO\ DW r& r& DQG r& IRU PLQ HDFK DQG H[SRVHG WR ;UD\ ILOP 3&5 $PSOLILFDWLRQ RI 0RXVH /\VW F'1$ ,VRIRUPV 7RWDO FHOOXODU 51$ ZDV LVRODWHG IURP PRXVH ERQH PDUURZ FHOOV E\ H[WUDFWLRQ ZLWK SKHQROJXDQLGLQH LVRWKLRF\DQDWH 75,]RO 5HDJHQWf )LYH SJ RI 51$ ZHUH UHYHUVH WUDQVFULEHG XVLQJ 6XSHUVFULSW ,, 51DVH +n UHYHUVH WUDQVFULSWDVH ZLWK ILUVW VWUDQG F'1$ V\QWKHVLV SULPLQJ E\ DQ ROLJRG7f SULPHU DQG D JHQHVSHFLILF SULPHU f&7&*&$*$* &**7*&77$7*7&&7*7*f f&$&$*7&$7***$&7*&7$$? IRU /\VWO DQG /\VW,, UHVSHFWLYHO\f 2QH S/ RI F'1$ ZDV XVHG DV WHPSODWH IRU 3&5 DPSOLILFDWLRQ XVLQJ .OHQ7DT '1$ SRO\PHUDVH 3&5 FRQGLWLRQV ZHUH r& IRU PLQ WKHQ F\FOHV RI r& IRU V r& IRU RU PLQ IRU /\VWO DQG /\VW,, UHVSHFWLYHO\f IROORZHG E\

PAGE 34

RU PLQ IRU /\VWO DQG /\VW,, UHVSHFWLYHO\f DW r& 7KH VDPH XSVWUHDP SULPHU f $*&**$**7*$$*&&77$7*&7*$*$&$*7 ff ZDV XVHG IRU 3&5 DPSOLILFDWLRQ RI ERWK LVRIRUPV ,VRIRUPVSHFLILF GRZQVWUHDP SULPHUV XVHG ZHUH f 77$7*7&&7*7****$&$&7&&77& f IRU /\VWOf DQG f$&$*$*&$7&& &&$&77&&&7$7&7$$$*7f IRU /\VW,,f 7KH VKRUWHU PRXVH LVRIRUPV /\VWO?? DQG /\VW79f ZHUH 3&5 DPSOLILHG IURP PRXVH PHODQRF\WH F'1$ XVLQJ .OHQ7DT '1$ SRO\PHUDVH 3&5 FRQGLWLRQV ZHUH r& IRU PLQ WKHQ F\FOHV RI r& IRU V r& IRU V r& IRU PLQ IROORZHG E\ PLQ DW r& 3&5 SURGXFWV ZHUH VHSDUDWHG E\ HOHFWURSKRUHVLV RQ DJDURVH JHOV DQG YLVXDOL]HG E\ HWKLGLXP EURPLGH VWDLQLQJ 2QH S/ RI GLOXWLRQ RI 3&5 SURGXFWV ZDV XVHG DV WHPSODWH IRU D QHVWHG 3&5 DPSOLILFDWLRQ ZLWK .OHQ7DT '1$ SRO\PHUDVH 3&5 FRQGLWLRQV ZHUH r& IRU PLQ WKHQ F\FOHV RI r& IRU V r& IRU V r& IRU PLQ IROORZHG E\ PLQ DW r& 3&5 SURGXFWV ZHUH VHSDUDWHG E\ HOHFWURSKRUHVLV RQ b ORZ PHOWLQJ SRLQW DJDURVH JHOV YLVXDOL]HG E\ HWKLGLXP EURPLGH VWDLQLQJ H[FLVHG IURP WKH JHO ZLWK D VWHULOH EODGH DQG SXULILHG XVLQJ :L]DUG 3&5 3UHSV '1$ 3XULILFDWLRQ 6\VWHP 3XULILHG 3&5 SURGXFWV ZHUH FORQHG LQ S&5 YHFWRU E\ WKH 7$ PHWKRG DQG VHTXHQFHG &ORQLQJ RI +XPDQ /<67 F'1$V 1RUPDO KXPDQ ERQH PDUURZ SRO\$f 51$ ZDV REWDLQHG IURP &ORQWHFK /DERUDWRULHV DQG SJ ZDV UHYHUVH WUDQVFULEHG XVLQJ 6XSHUVFULSW ,, 51DVH +n UHYHUVH WUDQVFULSWDVH ZLWK D 7767VSHFLILF SULPHU f&77*77**&7$*7*&$7$77*$ &$&$$7&77&&ff XVHG IRU ILUVW VWUDQG F'1$ V\QWKHVLV 7KH UHVXOWLQJ /.67VSHFLILF

PAGE 35

F'1$ ZDV XVHG DV D WHPSODWH IRU 3&5 DPSOLILFDWLRQ RI WKH /<67 FRGLQJ GRPDLQ ZLWK .OHQ7DT '1$ SRO\PHUDVH LQ S/ UHDFWLRQV 3&5 FRQGLWLRQV ZHUH r& IRU PLQ WKHQ F\FOHV RI r& IRU V r& IRU V IRU VRPH UHDFWLRQVf DQG r& IRU PLQ IROORZHG E\ PLQ DW r& 3&5 SURGXFWV ZHUH VHSDUDWHG RQ HWKLGLXP EURPLGHVWDLQHG ORZ PHOWLQJ SRLQW b DJDURVH JHOV H[FLVHG ZLWK D VWHULOH EODGH SXULILHG XVLQJ :L]DUG 3&5 3UHSV 3XULILFDWLRQ 6\VWHP DQG FORQHG LQ S&5 YHFWRU E\ WKH 7$ PHWKRG 6RPH 3&5 SURGXFWV ZHUH WUHDWHG ZLWK 8 H[RQXFOHDVH 8QLWHG 6WDWHV %LRFKHPLFDOVf IRU PLQ DW r& DQG UHDPSOLILHG E\ D QHVWHG 3&5 ZLWK .OHQ7DT '1$ SRO\PHUDVH SULRU WR FORQLQJ LQ WKH S&5 YHFWRU 7KH LGHQWLW\ RI WKH FORQHG SURGXFWV ZDV FRQILUPHG E\ 3&5 DPSOLILFDWLRQ IURP SXULILHG SODVPLGV ZLWK ,.67VSHFLILF SULPHUV XVLQJ 7DT '1$ SRO\PHUDVH LQ S/ UHDFWLRQV 3&5 FRQGLWLRQV ZHUH r& IRU PLQ WKHQ F\FOHV RI r& IRU V r& IRU V r& IRU PLQ IROORZHG E\ PLQ DW r& 3&5 SURGXFWV ZHUH YLVXDOL]HG RQ HWKLGLXP EURPLGH VWDLQHG DJDURVH JHOV DQG SKRWRJUDSKHG 6HJPHQWV RI WKH KXPDQ /<67 F'1$ VHTXHQFH ZHUH REWDLQHG E\ DQ DQFKRUHG QHVWHG 3&5 f5$&(3&5f XVLQJ OLYHU F'1$ &ORQWHFK /DERUDWRULHVf DV D WHPSODWH E\ 573&5 XVLQJ WRWDO 51$ DQG E\ VHTXHQFLQJ RI KXPDQ H[SUHVVHG VHTXHQFH WDJV (67f VLPLODU LQ VHTXHQFH WR PRXVH /\VW )RU WKH f5$&(3&5 QHVWHG SULPHUV ZHUH GHULYHG IURP D KXPDQ (67 *HQ%DQN DFFHVVLRQ 1R :f DQG KDG WKH IROORZLQJ QXFOHRWLGH VHTXHQFHV f && $$*$7 *$$$*& $*&&*$7****$$$$&7 f DQG f 7&$*&&7&777&77 *&7&&*7*$$$&7*&7f )RU 573&5 H[SHULPHQWV WRWDO 51$ ZDV SUHSDUHG IURP WKH SURP\HORF\WLF +/ FHOO OLQH 573&5 ZDV SHUIRUPHG ZLWK ([SDQG SRO\PHUDVH %RHKULQJHU 0DQQKHLPf ZLWK WKH IROORZLQJ SULPHU SDLUV f

PAGE 36

$*777$7*$*7&&$$$7*$7 f DQG f *$$7*$7*$$*77*&7&7*$ f ES f f&$*&$*77&77&$*$7**$f DQG f$7&777&7*77*77&&& &7$f ES f DQG f7$****$*&$$&$*$$$*$7f DQG f*&7&$7 $*7$*7$7&$&777f ES f 7KH SULPHUV XVHG WR DPSOLI\ WKH F'1$ EHWZHHQ EDVH SDLUV DQG ZHUH GHULYHG IURP WKH PRXVH /\VW VHTXHQFH +XPDQ SULPHUV ZHUH GHVLJQHG IURP WKH VHTXHQFH RI WKH 3&5 SURGXFW ESf DQG XVHG WR DPSOLI\ WKH IODQNLQJ VHTXHQFHV +XPDQ /<67 LQWURQ Df ZDV 3&5 DPSOLILHG IURP KXPDQ JHQRPLF '1$ QJf ZLWK WKH SULPHUV f&&*&7&*$*7$**$7&77 7$$**7*$$7$$&f DQG f*7*$7$&7$&7$7*$*&&&77&$&$*7$7&f 3&5 FRQGLWLRQV ZHUH r& IRU PLQ WKHQ F\FOHV RI r& IRU V r& IRU V DQG r& IRU V IROORZHG E\ PLQ DW r& 0ROHFXODU 3UREHV 7KH /<67 SUREH ZDV 3&5 DPSOLILHG IURP D KXPDQ IHWDO EUDLQ SDUWLDO OHQJWK F'1$ FORQH f REWDLQHG IURP ,PDJH &RQVRUWLXP XVLQJ LQWHUQDO SULPHUV .OHQ7DT '1$ SRO\PHUDVH ZDV XVHG IRU DPSOLILFDWLRQ DQG WKH 3&5 FRQGLWLRQV ZHUH DV IROORZV r& IRU PLQ WKHQ F\FOHV RI r& IRU V r& IRU V r& IRU PLQ IROORZHG E\ PLQ DW r& 3&5 SURGXFW ZDV WKHQ SXULILHG ZLWK :L]DUG 3&5 3UHSV '1$ 3XULILFDWLRQ NLW 2WKHU SUREHV DUH GHVFULEHG LQ WKH WH[W RU LQ WKH OHJHQGV RI WKH FRUUHVSRQGLQJ ILJXUHV $OO SUREHV ZHUH UDGLRODEHOHG E\ WKH KH[DQXFOHRWLGH WHFKQLTXH 3ULPH,W ,, UDQGRP SULPHU NLW 6WUDWDJHQHf ZLWK >D3@G&73 $PHUVKDPf DFFRUGLQJ WR WKH PDQXIDFWXUHUfV LQVWUXFWLRQV

PAGE 37

,VRODWLRQ RI /<67 F'1$ &ORQHV /<67 FORQHV ZHUH LVRODWHG E\ VFUHHQLQJ F'1$ OLEUDULHV XVLQJ YHFWRULQVHUW 3&5 DQG K\EULGL]DWLRQ $ KXPDQ IHWDO EUDLQ F'1$ OLEUDU\ /LIH 7HFKQRORJLHV ,QFf ZDV VFUHHQHG XVLQJ KHPLQHVWHG 3&5 ZLWK RQH YHFWRU SULPHU DQG RQH =/7VSHFLILF SULPHU 2QH S/ RI F'1$ OLEUDU\ [ FIXPOf ZDV XVHG DV WHPSODWH IRU 3&5 DPSOLILFDWLRQ ZLWK .OHQ7DT '1$ SRO\PHUDVH 3&5 FRQGLWLRQV ZHUH r& IRU PLQ WKHQ F\FOHV RI r& IRU V r& IRU V r& IRU PLQ IROORZHG E\ PLQ DW r& 3&5 SURGXFWV ZHUH VHSDUDWHG E\ HOHFWURSKRUHVLV RQ DJDURVH JHOV DQG YLVXDOL]HG E\ HWKLGLXP EURPLGH VWDLQLQJ 3&5 SURGXFWV ZHUH H[FLVHG IURP ORZ PHOWLQJ DJDURVH JHOV SXULILHG :L]DUG 3&5 3UHSV '1$ 3XULILFDWLRQ NLWf DQG FORQHG XVLQJ WKH 7$ PHWKRG 5HVXOWLQJ SODVPLGV ZHUH SXULILHG ZLWK :L]DUG 3OXV 0LQLSUHSV '1$ 3XULILFDWLRQ NLW DQG VHTXHQFHG 0HPEUDQHV FRQWDLQLQJ FORQHV IURP D KXPDQ IHWDO EUDLQ F'1$ OLEUDU\ &ORQWHFK /DERUDWRULHVf ZHUH VFUHHQHG E\ K\EULGL]DWLRQ ZLWK D UDGLRDFWLYHO\ ODEHOHG F'1$ SUREH IURP WKH fHQG RI WKH /<67 FRGLQJ GRPDLQ 3RVLWLYH FORQHV ZHUH GHWHFWHG E\ SKRVSKRULPDJLQJ 0ROHFXODU '\QDPLFVf DQG SXULILHG SODVPLGV ZHUH LVRODWHG DQG VHTXHQFHG 7KHQ QHZ SUREHV ZHUH 3&5 DPSOLILHG IURP WKH fHQG RI WKH QRYHO F'1$ VHTXHQFH DQG WKH OLEUDU\ VFUHHQLQJ ZDV UHSHDWHG LQ RUGHU WR LVRODWH RYHUODSSLQJ FORQHV H[WHQGLQJ WKH VHTXHQFH LQ WKH f GLUHFWLRQ $ =$3 ([SUHVV LVFR5, PRXVH HPEU\R F'1$ OLEUDU\ ZDV VFUHHQHG E\ K\EULGL]DWLRQ ZLWK WKH /<67 SUREH ,GHQWLILHG F'1$ FORQHV ZHUH SXULILHG XVLQJ :L]DUG 3OXV 0LQLSUHSV '1$ 3XULILFDWLRQ NLW DQG VHTXHQFHG

PAGE 38

6RXWKHUQ %ORW $QDO\VLV DQG $XWRUDGLRJUDSK\ *HQRPLF '1$ ZDV LVRODWHG IURP PRXVH RUJDQV XVLQJ VWDQGDUG WHFKQLTXHV 6DPEURRN HW DO f RU REWDLQHG IURP 7KH -DFNVRQ /DERUDWRU\ %DU +DUERU 0(f '1$ ZDV GLJHVWHG ZLWK UHVWULFWLRQ HQGRQXFOHDVHV IURP 3URPHJD 0DGLVRQ :,f RU %RHKULQJHU 0DQQKHLP ,QGLDQDSROLV ,1f DQG SJ VDPSOHV ZHUH VXEMHFWHG WR HOHFWURSKRUHVLV LQ b DJDURVH JHOV IRU a K DW 9 '1$ ZDV WUDQVIHUUHG WR =HWD3UREH %LR5DG /DERUDWRULHV +HUFXOHV &$f RU *HQHVFUHHQ3OXV 'X3RQW &R :LOPLQJWRQ '(f PHPEUDQHV ZKLFK ZHUH QHXWUDOL]HG LQ [ 66& 89FURVVOLQNHG IRU PLQ DQG SUHK\EULGL]HG DW r& RYHUQLJKW +\EULGL]DWLRQ WR SUREHV ODEHOHG E\ WKH KH[DQXFOHRWLGH WHFKQLTXH 3ULPH,W ,, UDQGRP SULPHU NLW 6WUDWDJHQH /D -ROOD &$f ZLWK >D3@G&73 $PHUVKDP $UOLQJWRQ +HLJKWV ,/f ZDV SHUIRUPHG DW r& RYHUQLJKW 0HPEUDQHV ZHUH ZDVKHG LQ D VROXWLRQ FRQWDLQLQJ [ 66& b 6'6 DQG P0 ('7$ IRU PLQ DW r& DQG WKHQ LQ D VROXWLRQ FRQWDLQLQJ [ 66& b 6'6 DQG P0 ('7$ IRU PLQ DW r& %ORWV ZHUH H[SRVHG WR ;UD\ ILOP 'X3RQWf LQ )LVKHU%LRWHFK 3LWWVEXUJK 3$f DXWRUDGLRJUDSK\ FDVVHWWHV IRU GD\V DQG ILOPV ZHUH GHYHORSHG XVLQJ D .RQLFD 4;$ SURFHVVRU 1RUWKHUQ %ORW $QDO\VLV ,VRODWLRQ RI SRO\$f 51$ IURP ILEUREODVW DQG (SVWHLQ%DUU YLUXVWUDQVIRUPHG % O\PSKREODVWRLG FHOO OLQHV IRUPDOGHK\GH DJDURVH JHO HOHFWURSKRUHVLV DQG QRUWKHUQ EORWWLQJ WR =HWD3UREH PHPEUDQHV ZHUH SHUIRUPHG DFFRUGLQJ WR VWDQGDUG SURFHGXUHV 6DPEURRN HW

PAGE 39

DO f 1RUWKHUQ EORWV RI MXJ SRO\$f 51$ IURP YDULRXV PRXVH WLVVXHV KXPDQ FDQFHU FHOO OLQHV DQG KXPDQ O\PSKRLG WLVVXHV DV ZHOO DV D GRWEORW FRQWDLQLQJ SRO\$f 51$ IURP KXPDQ DGXOW DQG IHWDO WLVVXHV ZHUH REWDLQHG IURP &ORQWHFK /DERUDWRULHV 7KH TXDQWLW\ RI SRO\$f 51$ RQ HDFK GRW ZDV QRUPDOL]HG IRU KRXVHNHHSLQJ JHQHV DQG YDULHG IURP WR QJ 0HPEUDQHV ZHUH K\EULGL]HG ZLWK YDULRXV SUREHV ODEHOHG ZLWK >D3@G&73 E\ WKH KH[DQXFOHRWLGH WHFKQLTXH 3ULPH,W ,, UDQGRP SULPHU NLWf +\EULGL]DWLRQ FRQGLWLRQV ZHUH WKH VDPH DV WKRVH HPSOR\HG ZLWK 6RXWKHUQ EORWV $XWRUDGLRJUDSK\ RU SKRVSKRULPDJLQJ ZDV SHUIRUPHG XVLQJ ;UD\ ILOP RU SKRVSKRULPDJHU 0ROHFXODU '\QDPLFV 6XQQ\YDOH &$f UHVSHFWLYHO\ 6LPSOH 6HTXHQFH /HQJWK 3RO\PRUSKLVP n66/3nf 3&5 $PSOLILFDWLRQ 3&5 UHDFWLRQV ZLWK 7DT '1$ SRO\PHUDVH %RHKULQJHU 0DQQKHLPf ZHUH SHUIRUPHG XVLQJ QJ RI PRXVH JHQRPLF '1$ SPRO/ RI HDFK SULPHU 5HVHDUFK *HQHWLFV ,QF +XQWVYLOOH $/f DQG SPRO/ RI HDFK G173 LQ D S/ UHDFWLRQ 3&5 FRQGLWLRQV ZHUH r& IRU PLQ WKHQ F\FOHV RI r& IRU V r& IRU V r& IRU V IROORZHG E\ r& IRU PLQ $PSOLILFDWLRQ SURGXFWV ZHUH VHSDUDWHG RQ b DJDURVH JHOV YLVXDOL]HG E\ HWKLGLXP EURPLGH VWDLQLQJ DQG SKRWRJUDSKHG %DFNFURVV 0RXVH 3DQHO DQG *HQHWLF 0DSSLQJ &%/-J ; &%/-JA [ &$67(L-f) EDFNFURVV PLFH ZHUH EUHG DQG PDLQWDLQHG DV GHVFULEHG LQ +ROFRPEH HW DO *HQRPLF '1$ ZDV LVRODWHG IURP

PAGE 40

PRXVH RUJDQV XVLQJ VWDQGDUG WHFKQLTXHV 6DPEURRN HW DO f DQG 6RXWKHUQ EORWV ZHUH SUHSDUHG 7KH FKURPRVRPDO DVVLJQPHQW RI HDFK SUREH ZDV GHWHUPLQHG E\ OLQNDJH DQDO\VLV LQ LQWHUVXEVSHFLILF EDFNFURVV PLFH 7KH JHQHWLF PDUNHUV PLFURVDWHOOLWH PDUNHUV JHQHV H[SUHVVHG VHTXHQFH WDJV 7FKHUQHY HW DO f DQG FRDW FRORU ORFLf WKDW KDYH EHHQ SUHYLRXVO\ PDSSHG LQ WKLV SDQHO VHUYHG DV DQFKRU ORFL ZLWK DYHUDJH JHQHWLF GLVWDQFH EHWZHHQ WKHP a F0 *HQH RUGHU ZDV GHWHUPLQHG E\ PLQLPL]DWLRQ RI FURVVRYHU HYHQWV DQG HOLPLQDWLRQ RI GRXEOH FURVVRYHUV EHWZHHQ OLQNHG JHQHV ,QWHUJHQH GLVWDQFHV ZHUH H[SUHVVHG LQ FHQWLPRUJDQV F0f DQG VWDQGDUG HUURUV ZHUH GHWHUPLQHG DV SUHYLRXVO\ GHVFULEHG *UHHQ %LVKRS f &ORQLQJ RI /<67 DQG /<67 %DLW F'1$ )UDJPHQWV LQ
PAGE 41

7DEOH 3&5 SULPHUV ZLWK UHVWULFWLRQ VLWHV RQ WKHLU fHQGV XVHG WR DPSOLI\ EDLW F'1$ IUDJPHQWV IURP WKH /<67JHQH *(1( 35,0(5 6(48(1&( f! f 5(675 )5$*0(17 )5$*0 )5$*0(17 IRUZDUG XSSHU VHTXHQFH UHYHUVH ORZHU VHTXHQFHf (1=<0( 326,7,21ES 6,=(ES /<67 *&**7**$7&&&$7*$*&$&&*$&$*7$$&7&$& %DP:O *&**$$77&7& $7 $*7 *7 ***& $&7$& $&7** (FR5O /<67 *&**7**$7&&&$&$&7$$&7*$*77&&7$*&$**&777****$&7*& %DP:O *$*$*$f&7&*$*7&$$7&&$7$&$$&$*&$7$77&&$$7* ;KRO /<67 *&**$$&7$*7**$7&&&$$$7&7*7$$7&$77&& ** $ $77 &7 & $&7* $ $& $$&7 $7 $77 *& &777 &7* 6SH (FR5O /<67 *&* $*7 *7 **$7&&&& $* $$ $**& $$7 $7 $*77 *77& $* %DP:O *&**$$77&7&$&7&&7&777*7*$&77&7*$$& (FR5O /<67 *&**7**$7&&&&7*77&$*$$*7&$&$$$*$** %DP:O **$$77&7&$$*&$*$$$*&$$$777$$77&&$* (FR5O /<67 *&**7 **$7&&&&7 ** $$77 $ $$777 *&777&7*& %DP:O *&**$ $77&7& $**$*&&& $*7 *$ $$77 $7 $7 (FR5O /<67 *&**7**$7&&&7&&$$$*&*77*$7*$7&&$$* %DP:O *&**$$77&7& $$$&7&*& $*7 *&7$ $7 *&77 (FR5O /<67 *&**7**$7&&&$&7&$$*&$77$*&$&7*&*$* %DP:O *$*$*$f&7&*$*7&$**&$$&$7$$*7$7&7*&$$7$7777* ;KRO /<67 *&**7 **$7&&&& $$$ $7 $77 *& $*$7 $&77 $7 *77 *&& %DP:O *&**$$77&7&$7&&&$7*777&7&$&$7&77&&$* (FR5O /<67 *&**7 ** $7&&&&7** $$*$7 *7 $* $ $$& $7 *** %DP:O *&**$$77&7&$**7&7**$$$$&7*$**7&77* (FR5O /<67 *&**7**$7&&&$$*$&&7&$*7777&&$*$&&* %DP:O *&**$$77&7&$$7&&$$&7*&&$7*$**77** (FR5O /<67 *&**7 ** $7&&&* $7&& $$& $*$ $***&& $ $$7 & %DP:O *&**$$77&7&$7*7&$*$*&**7*$7*77$&& (FR5O /<67 *&**7 **$7&&& $ $**77&*7 *$7 *$7 *7 $7$&& $& %DP:O *&**$$77&7&$&$$*&&7777$7&&$7*$&$$$** LVFR5, /<67 *&**7 **$7&&&7 ** $7 $$ $ $**&77 $ $$7 **** %DP:O *&**$$77&7&$7*$$*77&$77&*&$77&$&&& (FR5O

PAGE 42

7DEOH 3&5 SULPHUV ZLWK UHVWULFWLRQ VLWHV RQ WKHLU fHQGV XVHG WR DPSOLI\ EDLW F'1$ IUDJPHQWV IURP WKH /<67 JHQH *(1( )5$*0(17 35,0(5 6(48(1&( f! f IRUZDUG XSSHU VHTXHQFH UHYHUVH ORZHU VHTXHQFHf 5(675 (1=<0( )5$*0(17 326,7,21 ESn )5$*0 6,=( ES /<67 *& ** $ $&7 $*7 $&77 &7 *$7 *7 $ $$** $ $& *&**$$77&7&$$7$*&*$77$7&7*&*7*7$& 6SHO (FR5O f /<67 *&**$$&7$*7 *$&77&7 *$7 *7 $$$** $ $& *&**$$77&7& $7 **$7&& $777& $$7*** 6SHO (FR5O f /<67 *&**$$&7$*7 **7 $$& $*& $* $7$$7&*&7$7 *&**$$77&7& $&& $***77 $$$7 *7 $& $*77 6SHO (FR5O f /<67 *&**$$&7$*7 *$&77&7 *$7*7 $$$** $ $& *&**$$77&7& $&& $***77 $$$7 *7$& $*77 6SHO (FR5O f r 6LQFH WKH HQWLUH /<67 F'1$ VHTXHQFH LV QRW NQRZQ IUDJPHQW SRVLWLRQV DUH UHODWLYH WR WKH EHJLQQLQJ RI WKH NQRZQ /<67 VHTXHQFH

PAGE 43

.OHQ7DT '1$ SRO\PHUDVH DQG SPRO RI HDFK SULPHU ZHUH XVHG LQ HDFK S/ DPSOLILFDWLRQ UHDFWLRQ 3&5 FRQGLWLRQV ZHUH r& IRU PLQ WKHQ F\FOHV RI r& IRU V r& IRU V r& IRU PLQ IROORZHG E\ r& IRU PLQ 3&5 SURGXFWV ZHUH YLVXDOL]HG RQ HWKLGLXP EURPLGHVWDLQHG DJDURVH JHOV SXULILHG XVLQJ 4,$TXLFN 3&5 SXULILFDWLRQ NLW 4,$*(1 ,QF 9DOHQFLD &$f DQG GLJHVWHG ZLWK WKH FRUUHVSRQGLQJ UHVWULFWLRQ HQ]\PHV 7DEOHV DQG f LQ S/UHDFWLRQV RYHUQLJKW DW r& 'LJHVWHG 3&5 SURGXFWV ZHUH H[FLVHG IURP b ORZ PHOWLQJ SRLQW DJDURVH JHOV SXULILHG XVLQJ 4,$TXLFN JHO H[WUDFWLRQ NLW 4,$*(1 ,QFf DQG OLJDWHG LQ WKH \HDVW *DO DFWLYDWLRQ GRPDLQ FORQLQJ YHFWRU S$'*$/ PRGLILHG S*$' *+ &ORQWHFK /DERUDWRULHVf DQG LQ WKH \HDVW *DO '1$ELQGLQJ GRPDLQ YHFWRU S*%*$/ PRGLILHG S*%7 &ORQWHFK /DERUDWRULHVf '+% FRPSHWHQW FHOOV ZHUH WUDQVIRUPHG ZLWK WKH SXULILHG FRQVWUXFWV E\ HOHFWURSRUDWLRQ LQFXEDWHG IRU K DW r& ZLWK VKDNLQJ 530 f DQG SODWHG RQ /%DPSLFLOOLQ SJP/f SODWHV FRQWDLQLQJ ;*DO DQG ,37* 7KH LGHQWLW\ RI FORQHG IUDJPHQWV ZDV FRQILUPHG E\ 3&5 RI EDFWHULDO FRORQLHV ZLWK RQH YHFWRU SULPHU DQG RQH IUDJPHQWVSHFLILF SULPHU XQGHU WKH VDPH DPSOLILFDWLRQ FRQGLWLRQV DV DERYH /%DPSLFLOOLQ OLTXLG FXOWXUHV ZHUH LQRFXODWHG ZLWK SRVLWLYH FRORQLHV DQG LQFXEDWHG RYHUQLJKW DW r& ZLWK VKDNLQJ 3XULILHG SODVPLGV ZHUH LVRODWHG XVLQJ 4,$SUHS 6SLQ 3ODVPLG NLW 4,$*(1 ,QFf DQG YLVXDOL]HG RQ HWKLGLXP EURPLGHVWDLQHG DJDURVH JHOV $OO LQVHUWV ZHUH VHTXHQFHG WR HQVXUH WKDW 3&5 DPSOLILFDWLRQ UHSURGXFHG DQ DFFXUDWH FRS\ RI WKH /<67 DQG /<67 VHTXHQFH DQG WKDW WKH F'1$ IUDJPHQWV ZHUH FORQHG LQ IUDPH

PAGE 44


PAGE 45

UHTXLUHG LQWHUDFWLRQ ZLWK D VHFRQG SURWHLQ GRPDLQ LQ RUGHU WR IRUP D IXQFWLRQDO FRPSOH[ WKDW FDQ DFWLYDWH WKH WUDQVFULSWLRQ RI UHSRUWHU JHQHV %DLWV IURP QRQJURZLQJ FHOOV ZHUH XVHG IRU IXUWKHU VFUHHQLQJ ,Q WKH IRUZDUG VFUHHQV WKH FRQVWUXFWV HQFRGLQJ WKH EDLWV ZHUH LQWURGXFHG E\ OLWKLXP DFHWDWHSRO\HWK\OHQH JO\FRO WUDQVIRUPDWLRQ LQWR WKH \HDVW VWUDLQ <8/+ PDWLQJ W\SH D XUD KLV O\V $GH WUSO OHX JDO JDO *$/85$ *$/OODF=f ZKLOH WKH SUH\ VHTXHQFHV ZHUH WUDQVIRUPHG LQWR WKH \HDVW VWUDLQ 1U PDWLQJ W\SH D XUD KLV DGH WUSO OHX JFG JDO F\K? /\V*$/O8$6+,67$7$+O6 XUD*$/ 8$6*$/7$7$ODF=f )RU WKH UHYHUVH VFUHHQV EDLWV ZHUH WUDQVIRUPHG LQWR 1U DQG SUH\V LQWR <8/+ ,QLWLDOO\ D OLPLWHG VFUHHQLQJ XVLQJ DSSUR[LPDWHO\ SUH\ OLEUDU\ PHPEHUV ZDV SHUIRUPHG WR HQVXUH WKDW EDLW IXVLRQV GR QRW LQWHUDFW SURPLVFXRXVO\ ZLWK PDQ\ SURWHLQV WHVW IRU QRQVSHFLILF ELQGLQJf 2QO\ EDLWV WKDW GLG QRW SRVVHVV LQWULQVLF WUDQVFULSWLRQDO DFWLYLW\ L H SDVVHG WKH WHVW IRU fEDLW VHOIDFWLYDWLRQff DQG WKDW GLG QRW LQWHUDFW LQGLVFULPLQDWHO\ ZLWK QXPHURXV SURWHLQV n H SDVVHG WKH WHVW IRU QRQVSHFLILF ELQGLQJf ZHUH XVHG IRU VFUHHQLQJ WKH HQWLUH SUH\ OLEUDU\ ,Q WKHVH IXOOVFDOH VFUHHQV WKH WZR WUDQVIRUPHG SRSXODWLRQV ZHUH PDWHG XVLQJ VWDQGDUG PHWKRGV 6KHUPDQ HW DO f %ULHIO\ FHOOV ZHUH JURZQ DW r& XQWLO PLGWRODWH ORJ SKDVH RQ PHGLD WKDW VHOHFWHG IRU WKH SUHVHQFH RI WKH DSSURSULDWH SODVPLGV LH \HDVW FRQWDLQLQJ DFWLYDWLRQ GRPDLQ FRQVWUXFWV ZHUH JURZQ RQ 6&/HX PHGLXP ZKLOH FHOOV FRQWDLQLQJ '1$ ELQGLQJ GRPDLQ SODVPLGV ZHUH JURZQ RQ 6&7US PHGLXP 7KH WZR PDWLQJ VWUDLQV D DQG D ZHUH WKHQ GLOXWHG LQ <3$' PHGLD 6KHUPDQ HW DO f ILOWHUHG RQWR QLWURFHOOXORVH PHPEUDQHV DQG LQFXEDWHG DW r& IRU KRXUV 7KH FHOOV ZHUH WKHQ WUDQVIHUUHG WR PHGLD VHOHFWLYH IRU

PAGE 46

WKH GHVLUHG GLSORLGV LH IRU \HDVW KDUERULQJ UHSRUWHU JHQHV IRU EHWDJDODFWRVLGDVH XUDFLO DX[RWURSK\ DQG KLVWLGLQH DX[RWURSK\ DQG IRU H[SUHVVLRQ RI WKH YHFWRUV HQFRGLQJ WKH EDLW DQG SUH\ 7KH PDWLQJ SURGXFWV ZHUH SODWHG RQ 6& V\QWKHWLF FRPSOHWHf PHGLD .DLVHU HW DO f ODFNLQJ DGHQLQH DQG O\VLQH WR VHOHFW IRU VXFFHVVIXO PDWLQJf OHXFLQH DQG WU\SWRSKDQH WR VHOHFW IRU H[SUHVVLRQ RI JHQHV HQFRGHG E\ WKH EDLW DQG SUH\ SODVPLGVf DQG XUDFLO DQG KLVWLGLQH WR VHOHFW IRU SURWHLQ LQWHUDFWLRQVf 7KLV PHGLXP LV UHIHUUHG WR DV 6&6 PHGLXP IRU 6& 6HOHFWLYH PHGLXP 6HOHFWHG FORQHV ZHUH WHVWHG IRU H[SUHVVLRQ RI SJDODFWRVLGDVH WR FRQILUP WKH IRUPDWLRQ RI DQ /<67/<67LQWHUDFWLQJ SURWHLQ ,3f UHVS /<67/<67,3 LQWHUDFWLRQV )LOWHUOLIW 3JDODFWRVLGDVH DVVD\V ZHUH SHUIRUPHG DV PRGLILHG IURP WKH SURWRFRO RI %UHHGHQ DQG 1DVP\WK &RORQLHV ZHUH SDWFKHG RQWR 6&6 SODWHV JURZQ RYHUQLJKW DQG UHSOLFDWHG RQWR :KDWPDQ 1RO ILOWHUV 7KH ILOWHUV ZHUH WKHQ DVVD\HG IRU 3JDODFWRVLGDVH DFWLYLW\ &RORQLHV WKDW ZHUH SRVLWLYH WXUQHG D YLVLEOH EOXH LQGLFDWLQJ WKDW D SURWHLQSURWHLQ LQWHUDFWLRQ KDV RFFXUUHG HQDEOLQJ WKH WUDQVFULSWLRQ RI WKH UHSRUWHU JHQH /DF= &HOOV LQ FRORQLHV SRVLWLYH IRU SURWHLQ LQWHUDFWLRQ FRQWDLQHG ERWK '1$ELQGLQJ DQG DFWLYDWLRQGRPDLQ SODVPLGV 7KHVH FHOOV ZHUH UHJURZQ DV VLQJOH LVRODWHV LQ LQGLYLGXDO ZHOOV RI ZHOO SODWHV 7HQ PLFUROLWHUV RI HDFK LVRODWH ZHUH O\VHG WKH LQVHUWV ZLWKLQ WKH S$'*$/ DQG S%'*$/ SODVPLGV ZHUH DPSOLILHG E\ 3&5 XVLQJ SULPHUV VSHFLILF IRU WKH LQVHUWIODQNLQJ VHTXHQFHV RI WKH YHFWRUV DQG DSSUR[LPDWHO\ DPLQRWHUPLQDO EDVHV RI HDFK LQVHUW ZHUH GHWHUPLQHG XVLQJ DQ $%, VHTXHQFHU &RPSDULVRQ WR NQRZQ VHTXHQFHV ZDV PDGH XVLQJ WKH %/$67 SURJUDP SXEOLFO\ DYDLODEOH WKURXJK WKH 1DWLRQDO

PAGE 47

&HQWHU IRU %LRWHFKQRORJ\ ,QIRUPDWLRQ 1&%,f 7KH DVVHPEO\ DQG LGHQWLW\ VHDUFKHV RI WKH VHTXHQFHV HQFRGLQJ KXPDQ (67 ZHUH SHUIRUPHG E\ XVLQJ SXEOLFO\ DYDLODEOH (67 DVVHPEO\ GDWDEDVHV VXFK DV WKH 1&%, %ODVW1 SURJUDP $OWVFKXO HW DO f 6HTXHQFHV WKDW DOLJQHG ZLWK b RU JUHDWHU LGHQWLW\ DW WKH QXFOHLF DFLG OHYHO RYHU WKHLU WHUPLQL RI DW OHDVW QXFOHRWLGHV ZHUH XWLOL]HG LI WKH DOLJQPHQW UHVXOWHG LQ f H[WHQVLRQ RU f H[WHQVLRQ RI WKH (67 VHTXHQFH 2QFH WKLV ILUVW DVVHPEO\ ZDV FRPSOHWH WKH H[WHQGHG VHTXHQFH ZDV DJDLQ VXEMHFW WR WKH %ODVW1 FRPSDULVRQ WR GHWHFW QHZ KRPRORJLHV WR WKH DGGHG H[WHQVLRQV 7KH VHTXHQFH ZDV H[WHQGHG LQ ERWK GLUHFWLRQV XQWLO QHZ UHODWHG VHTXHQFHV WKDW DOORZHG H[WHQVLRQ RI WKH DVVHPEOHG VHTXHQFH ZHUH QR ORQJHU GHWHFWHG 7KH DVVHPEOHG (67 VHTXHQFH ZDV VXEMHFWHG WR IXUWKHU VHDUFKHV XVLQJ WKH %ODVW; SURJUDP IRU WKH LGHQWLILFDWLRQ RI SURWHLQ FRGLQJ UHJLRQV E\ GDWDEDVH VLPLODULW\ VHDUFK *LVK DQG 6WDWHV f 7KH %ODVW; VRIWZDUH WUDQVODWHV WKH '1$ VHTXHQFH LQ DOO VL[ UHDGLQJ IUDPHV DQG FRPSDUHV WKH WUDQVODWHG SURWHLQ VHTXHQFH ZLWK WKRVH LQ SURWHLQ GDWDEDVHV 7KH VWDWLVWLFDO VLJQLILFDQFH LV HVWLPDWHG XQGHU WKH DVVXPSWLRQ WKDW WKH HTXLYDOHQW RI RQH HQWLUH UHDGLQJ IUDPH LQ WKH TXHU\ VHTXHQFH FRGHV IRU SURWHLQ DQG WKDW VLJQLILFDQW DOLJQPHQWV ZLOO LQYROYH RQO\ FRGLQJ UHDGLQJ IUDPHV )XUWKHUPRUH WKH VHTXHQFHV ZHUH DQDO\]HG IRU RSHQ UHDGLQJ IUDPHV XVLQJ VRIWZDUH WKDW WUDQVODWHV WKH DVVHPEOHG '1$ VHTXHQFH LQ DOO VL[ UHDGLQJ IUDPHV XVLQJ WKH VWDQGDUG JHQHWLF FRGH 7KH LQWHUDFWLQJ (67V ZHUH REWDLQHG IURP GLUHFWLRQDOO\FORQHG OLEUDULHV DQG WKXV WKH GLUHFWLRQ RI WUDQVODWLRQ RI WKH DVVHPEOHG (67 LV NQRZQ DV f WR f DQG WKH RSHQ UHDGLQJ IUDPH LV DOVR NQRZQ 25)V ORQJHU WKDQ DPLQR DFLGV IROORZLQJ DQ LQLWLDWRU FRGRQ RU DQ 25) ZLWK QR LQLWLDWRU PHWKLRQLQH HQFRGHG DW WKH nHQG ZHUH GHWHUPLQHG WR EH SRVVLEOH SURWHLQ SURGXFWV DQG ZHUH FRPSDUHG WR

PAGE 48

VHTXHQFHV LQ SURWHLQ GDWD EDVHV XVLQJ WKH %/$673 SURJUDP $OWVFKXO HW DO f )XUWKHU SURWHLQ VHTXHQFH DQDO\VLV ZDV SHUIRUPHG DIWHU VHOHFWLQJ D VXLWDEOH RSHQ UHDGLQJ IUDPH 7KH SURWHLQ VHTXHQFH ZDV FRPSDUHG WR SUHYLRXVO\ FKDUDFWHUL]HG SURWHLQ GRPDLQV SUHVHQW LQ WKH %/2&.6 DQG 352'20 PRWLI GDWDEDVHV %DLURFK +HQLNRII DQG +HQLNRII 1DNDL DQG .DQHKLVD :DOODFH DQG +HQLNRII f &RQILUPDWLRQ RI WKH 6SHFLILFLW\ RI 3URWHLQ ,QWHUDFWLRQV E\ WKH
PAGE 49

SODVPLGV )LOWHUOLIW JDODFWRVLGDVH DVVD\ ZDV SHUIRUPHG RQ WKH VHOHFWHG KDSORLG FHOOV &RORQLHV WKDW GLG QRW WXUQ EOXH FRQWDLQHG SUH\V WKDW QHHGHG WR LQWHUDFW ZLWK DQRWKHU SURWHLQ LQ RUGHU WR DFWLYDWH WKH WUDQVFULSWLRQ RI WKH /DF= UHSRUWHU JHQH 2QO\ FHOOV WKDW GLG QRW JURZ RQ 6&8UD PHGLXP L H SDVVHG WKH WHVW IRU fSUH\ VHOIDFWLYDWLRQff DQG WKDW GLG QRW WXUQ EOXH LH SDVVHG WKH JDODFWRVLGDVH WHVW IRU KDSORLGVf ZHUH XVHG LQ WKH QH[W FRQILUPDWLRQ WHVWV 7KH IROORZLQJ fPDWUL[ PDWLQJf WHVW ZDV SHUIRUPHG WR GXSOLFDWH WKH LQLWLDO IRUZDUG DQG UHYHUVH VFUHHQV DQG WR GHWHUPLQH ZKHWKHU WKH VDPH SURWHLQSURWHLQ LQWHUDFWLRQV ZRXOG EH GHWHFWHG <8/+ \HDVW FHOOV WUDQVIRUPHG ZLWK '1$ELQGLQJ GRPDLQ IXVLRQV RI EDLWV IRUZDUG VFUHHQf RU SUH\V UHYHUVH VFUHHQf DQG 1U FHOOV WUDQVIRUPHG ZLWK DFWLYDWLRQ GRPDLQ IXVLRQV RI EDLWV UHYHUVH VFUHHQf RU SUH\V IRUZDUG VFUHHQf ZHUH JURZQ LQ <3$' PHGLXP DW r& 7KH fPDWUL[ PDWLQJf ZDV SHUIRUPHG E\ VSUHDGLQJ \HDVW FRQWDLQLQJ LQGLYLGXDO EDLWV RQ <3$' SODWHV WUDQVIHUULQJ LQ ZHOO IRUPDWf SUH\FRQWDLQLQJ FHOOV RQWR WKH VSUHDG EDLWV DQG LQFXEDWLQJ WKH SODWHV RYHUQLJKW DW r& (DFK SODWH FRQWDLQHG DOVR SRVLWLYH SURWHLQV WKDW DUH NQRZQ WR LQWHUDFWf DQG QHJDWLYH SURWHLQV WKDW GR QRW LQWHUDFW ZLWK D SDUWLFXODU EDLWf FRQWUROV 5HVXOWLQJ GLSORLG FRORQLHV ZHUH UHSOLFDSODWHG RQ W\SHV RI PHGLD RQ 6&6 ZKLFK VHOHFWHG IRU VXFFHVVIXO PDWLQJ IRU SURWHLQSURWHLQ LQWHUDFWLRQV DQG IRU SUHVHQFH RI SODVPLGV DQG RQ 6&/HX7US SODWHV ZKLFK ZHUH XVHG IRU D ILOWHUOLIW _JDODFWRVLGDVH DVVD\ 2QO\ EDLWV DQG SUH\V IURP GLSORLG \HDVW FHOOV WKDW ZHUH DEOH WR JURZ RQ 6&6 PHGLXP LH SDVVHG WKH fPDWUL[ PDWLQJf WHVWf DQG WKDW WXUQHG EOXH LH SDVVHG WKH 3JDODFWRVLGDVH WHVW IRU GLSORLGVf ZHUH 3&5 DPSOLILHG ZLWK YHFWRU SULPHUV DQG WKH UHVXOWLQJ 3&5 SURGXFWV ZHUH VHTXHQFHG ,I VHTXHQFLQJ GHWHUPLQHG WKDW

PAGE 50

WKH LGHQWLW\ RI D SDUWLFXODU EDLWSUH\ SDLU PDWFKHG WKDW REWDLQHG DIWHU WKH LQLWLDO VFUHHQV WKH LQWHUDFWLRQ ZDV FRQVLGHUHG FRQILUPHG E\ WKH \HDVW WZRK\EULG PHWKRG $Q RYHUYLHZ RI WKH GHVFULEHG \HDVW WZRK\EULG VFUHHQLQJ DQG FRQILUPDWLRQ SURFHGXUHV LV VKRZQ LQ )LJXUH &/21( /<67 $1' /<67 %$,76 ,1 $&7,9$7,21 $1' %,1',1*'20$,1 9(&7256 6(48(1&( $// &216758&76 75$16)250 ,1 <($67 L 7(67 )25 7(67 )25 %$,7 6(/)$&7,9$7,21 12163(&,),& %,1',1* )25:$5' $1' 5(9(56( 6&5((16 3*$/ 7(67 )25 ',3/2,'6 3&5,16(576 6(48(1&( ,16(576 '(7(50,1( ,'(17,7< 2) %$,735(< ,17(5$&7,216 5(75$16)250 <($67 7(67 )25 35(< 6(/)$&7,9$7,21 3*$/ 7(67 )25 +$3/2,'6 0$75,; 0$7,1* 3*$/ 7(67 )25 ',3/2,'6 3&5 ,16(576 6(48(1&( ,16(576 '(7(50,1( ,'(17,7< 2) %$,735(< ,17(5$&7,216 &203$5( 72 ,1,7,$/ ,'(17,7,(6 ,17(5$&7,21 &21),50(' %< 7+( <($67 7:2+<%5,' 0(7+2' )LJXUH 2YHUYLHZ RI WKH VFUHHQLQJ DQG FRQILUPDWLRQ SURFHGXUHV E\ WKH \HDVW WZRK\EULG PHWKRG

PAGE 51

5(68/76 ,GHQWLILFDWLRQ RI 0XWDWLRQV LQ 3DWLHQWV ZLWK &KHGLDN+LJDVKL 6\QGURPH DQG LQ %HLJH 0LFH 'HWHFWLRQ RI PXWDWLRQV LQ WKH &+6 JHQH RI KXPDQ SDWLHQWV DQG EHLJH PLFH ZDV XQGHUWDNHQ IRU WKUHH PDLQ UHDVRQV 7R SURYLGH DGGLWLRQDO HYLGHQFH WKDW 7(67 UHVS /\VW LV LQGHHG WKH JHQH UHVSRQVLEOH IRU WKH &KHGLDN+LJDVKL V\QGURPH LQ KXPDQ DQG IRU WKH EHLJH PXWDWLRQ LQ PRXVH 7R LGHQWLI\ FULWLFDO DPLQR DFLGV DQG GRPDLQV WKDW DUH HVVHQWLDO WR WKH IXQFWLRQ RI WKH &+6 JHQH 7R GHWHUPLQH ZKHWKHU D JHQRW\SHSKHQRW\SH FRUUHODWLRQ FRXOG EH HVWDEOLVKHG EHWZHHQ GLIIHUHQW JHQHWLF GHIHFWV DQG VSHFLILF GLVHDVH PDQLIHVWDWLRQV $ VXPPDU\ RI PXWDWLRQV GHWHFWHG LQ SDWLHQWV ZLWK &KHGLDN+LJDVKL V\QGURPH LV VKRZQ LQ 7DEOH 6HYHUDO GLIIHUHQW DSSURDFKHV ZHUH XVHG IRU PXWDWLRQ GHWHFWLRQ $V DQ LQLWLDO VFUHHQ IRU PXWDWLRQV ZH DQDO\]HG QRUWKHUQ EORWV RI SRO\$f 51$ IURP &+6 SDWLHQWV 7KH ODUJHVW P51$ VSHFLHV a, NEf ZDV JUHDWO\ UHGXFHG LQ DEXQGDQFH RU DEVHQW LQ O\PSKREODVWRLG P51$ RI SDWLHQWV 3, DQG 3 UHVSHFWLYHO\ )LJ $f ZKLOH WKH VPDOOHU WUDQVFULSW a NEf ZDV SUHVHQW DQG XQGLPLQLVKHG LQ DEXQGDQFH LQ DOO WKUHH SDWLHQWV

PAGE 52

$ "1 S NE NE & )LJXUH 0XWDWLRQ DQDO\VLV LQ &+6 SDWLHQWV $f 1RUWKHUQ EORW RI SJ DOLTXRWV RI O\PSKREODVWRLG SRO\$f 51$ IURP &+6 SDWLHQWV DQG D FRQWURO 7KH SUREH XVHG IRU K\EULGL]DWLRQ FRUUHVSRQGV WR QXFOHRWLGHV RI WKH &+6 F'1$ *HQ%DQN DFFHVVLRQ 1R 8f ([SRVXUH WLPH IRU DXWRUDGLRJUDSK\ ZDV K %f 66&3 DQDO\VLV RI F'1$ FRUUHVSRQGLQJ WR QXFOHRWLGHV RI WKH &+6 F'1$ (DFK ODQH FRQWDLQV VDPSOHV IURP LQGLYLGXDO SDWLHQWV DV LQGLFDWHG ([WUD EDQGV LQ ODQHV FRUUHVSRQGLQJ WR SDWLHQWV DQG DUH GHQRWHG ZLWK DQ DUURZ &f 6HTXHQFH FKURPDWRJUDPV VKRZLQJ PXWDWLRQV LQ F'1$ FORQHV IURP SDWLHQWV DQG 7KH XSSHU SDUW LV QRUPDO KXPDQ &+6 F'1$ VHTXHQFH 7KH DUURZV LQGLFDWH WKH SRVLWLRQV RI D LQVHUWLRQ FRGLQJ GRPDLQ QXFOHRWLGH SDWLHQW f DQG &f§!7 VXEVWLWXWLRQ FRGLQJ GRPDLQ QXFOHRWLGH SDWLHQW f 7KH VHQVH VWUDQG LV VKRZQ

PAGE 53

:KLOH WKH VHOHFWLYH ORVV RI WKH ODUJHU WUDQVFULSW LQ WKHVH WZR SDWLHQWV FDQQRW EH H[FOXGHG GHILQLWLYHO\ UHK\EULGL]DWLRQ RI WKLV EORW ZLWK DQ DFWLQ SUREH VXJJHVWHG WKDW WKH DEVHQFH RI WKH ODUJHU WUDQVFULSW ZDV QRW GXH WR XQHYHQ JHO ORDGLQJ RU 51$ GHJUDGDWLRQ )LEUREODVW SRO\$f 51$ IURP WKUHH RWKHU &+6 SDWLHQWV DQG f VKRZHG D PRGHUDWH UHGXFWLRQ LQ WKH a NE P51$ b RI FRQWURO E\ GHQVLWRPHWU\f ZKLOH WKH a NE P51$ ZDV HVVHQWLDOO\ XQDOWHUHG LQ DEXQGDQFH b RI FRQWUROf 6LQJOHVWUDQG FRQIRUPDWLRQ SRO\PRUSKLVP 66&3f DQDO\VLV ZDV XQGHUWDNHQ XVLQJ F'1$ VDPSOHV GHULYHG IURP O\PSKREODVWRLG RU ILEUREODVW FHOO OLQHV IURP &+6 SDWLHQWV LQ FROODERUDWLRQ ZLWK 'UV 6WHYH &ROPDQ DQG 0DUJDUHW :DOODFH $QRPDORXV EDQGV ZHUH GHWHFWHG LQ 3&5 SURGXFWV IURP WKH fHQG RI WKH RSHQ UHDGLQJ IUDPH LQ WZR XQUHODWHG &+6 SDWLHQWV DQG f WKDW ZHUH GLIIHUHQW IURP WKRVH ZLWK SUREDEOH VHOHFWLYH ORVV RI WKH ODUJHU WUDQVFULSW RQ QRUWKHUQ EORWV )LJ %f 6HTXHQFH DQDO\VLV LGHQWLILHG D &f§!7 VXEVWLWXWLRQ DW QXFOHRWLGH RI WKH FRGLQJ GRPDLQ LQ SDWLHQW )LJ&f )RXU RI WKH QLQH F'1$ FORQHV GHULYHG IURP SDWLHQW FRQWDLQHG WKLV PXWDWLRQ 5HVWULFWLRQ HQ]\PH GLJHVWLRQ FRQILUPHG WKH PXWDWLRQ 7DTO GLJHVWLRQ RI F'1$ QXFOHRWLGHV f VKRZHG ORVV RI WKLV UHVWULFWLRQ VLWH LQ SDWLHQW WR EH KHWHUR]\JRXV 7KH &f§}7 VXEVWLWXWLRQ FUHDWHV D VWRS FRGRQ DW DPLQR DFLG 5;f 7KH PXWDWLRQ LQ SDWLHQW RFFXUV ZLWKLQ D &S* GLQXFOHRWLGH ZKLFK ZKHQ WKH F\WRVLQH LV PHWK\ODWHG UHSUHVHQWV D FRPPRQ KRWVSRW IRU PDPPDOLDQ PXWDWLRQV GXH WR GHDPLQDWLRQ ,Q SDWLHQW D LQVHUWLRQ ZDV IRXQG DW QXFOHRWLGH RI WKH FRGLQJ GRPDLQ UHVXOWLQJ LQ D IUDPH VKLIW DW FRGRQ DQG WHUPLQDWLRQ DIWHU DPLQR DFLG )LJ &f :KLOH DQDO\VLV RI JHQRPLF '1$ KDG VKRZQ SDWLHQW WR EH KHWHUR]\JRXV IRU WKLV

PAGE 54

PXWDWLRQ 1DJOH HW DO f HDFK RI ILYH F'1$ FORQHV LVRODWHG IURP O\PSKREODVWV RI WKLV SDWLHQW FRQWDLQHG WKH LQVHUWLRQ $OOHOHVSHFLILF ROLJRQXFOHRWLGH K\EULGL]DWLRQ RI F'1$ IURP WKLV SDWLHQW IDLOHG WR GHWHFW D VLJQDO ZLWK DQ ROLJRQXFOHRWLGH FRUUHVSRQGLQJ WR WKH QRUPDO DOOHOH VXJJHVWLQJ WKDW WKH SDWLHQW LV WUDQVFULSWLRQDOO\ KHPL]\JRXV IRU WKH LQVHUWLRQ $OWHUQDWLYHO\ WKH ODFN RI DOOHOHVSHFLILF ROLJRQXFOHRWLGH K\EULGL]DWLRQ PD\ UHIOHFW D EDVH PLVPDWFK VXFK DV D SRO\PRUSKLVPf ZLWKLQ WKH SDWLHQWfV F'1$ 0XWDWLRQV ZHUH LGHQWLILHG LQ WKUHH RWKHU &+6 SDWLHQWV E\ FORQLQJ DQG VHTXHQFLQJ IUDJPHQWV RI WKHLU /<67 FRGLQJ GRPDLQV $ KRPR]\JRXV &}7 VXEVWLWXWLRQ DW QXFOHRWLGH RI WKH FRGLQJ GRPDLQ FUHDWLQJ D VWRS FRGRQ DW DPLQR DFLG 4;f ZDV IRXQG LQ SDWLHQW ,Q SDWLHQW D KHWHUR]\JRXV IUDPHVKLIW PXWDWLRQ ZDV GHWHFWHG 1XFOHRWLGHV DQG RI WKH FRGLQJ GRPDLQ ZHUH GHOHWHG LQ WZR RI ILYH F'1$ FORQHV UHVXOWLQJ LQ D IUDPHVKLIW DW FRGRQ DQG WHUPLQDWLRQ DW FRGRQ $ KRPR]\JRXV &}7 VXEVWLWXWLRQ DW QXFOHRWLGH RI WKH FRGLQJ GRPDLQ ZDV LGHQWLILHG LQ SDWLHQW 7KLV PXWDWLRQ FUHDWHG D VWRS FRGRQ DW DPLQR DFLG UHVXOWLQJ LQ SUHPDWXUH WHUPLQDWLRQ 'HVSLWH PXWDWLRQ DQDO\VLV RI NE RI RSHQ UHDGLQJ IUDPH WKH PXWDWLRQV LQ &+6 SDWLHQWV 3, DQG 3 WKDW PD\ KDYH D VHOHFWLYH ORVV RI WKH ODUJHU WUDQVFULSW RQ QRUWKHUQ EORWV KDYH QRW EHHQ LGHQWLILHG /\PSKREODVWV IURP DOO RI WKHVH SDWLHQWV 3, DQG 3f FRQWDLQ WKH JLDQW SHULQXFOHDU O\VRVRPDO YHVLFOHV WKDW DUH WKH KDOOPDUN RI WKH &KHGLDN+LJDVKL V\QGURPH 7KH SDUHQWV RI SDWLHQWV DQG DUH NQRZQ QRW WR KDYH EHHQ FRQVDQJXLQHRXV 3DWLHQWV DQG KDG W\SLFDO FOLQLFDO SUHVHQWDWLRQV RI &+6 ZLWK UHFXUUHQW FKLOGKRRG LQIHFWLRQV DQG RFXORFXWDQHRXV DOELQLVP ,Q FRQWUDVW WKH FOLQLFDO

PAGE 55

FRXUVH RI SDWLHQW ZDV PLOGHU WKLV SDWLHQW KDV QRW KDG V\VWHPLF LQIHFWLRQV DQG UHPDLQV DOLYH DW DJH 3DWLHQW GRHV KRZHYHU KDYH K\SRSLJPHQWHG KDLU DQG LULGHV DV ZHOO DV SHULSKHUDO QHXURSDWK\ $ VXPPDU\ RI WKH GHVFULEHG PXWDWLRQV GHWHFWHG LQ SDWLHQWV ZLWK &KHGLDN+LJDVKL V\QGURPH LV VKRZQ LQ 7DEOH 7DEOH 0XWDWLRQV LGHQWLILHG LQ SDWLHQWV ZLWK &KHGLDN+LJDVKL V\QGURPH 3$7,(17 =<*26,7< 087$7,21 &216(48(1&( +HWHUR]\JRXV ES t GHOHWHG &RGRQ IUDPHVKLIW VWRS DW FRGRQ +RPR]\JRXV &7 4; +HWHUR]\JRXV LQVHUWLRQ DW ES &RGRQ IUDPHVKLIW VWRS DW FRGRQ +RPR]\JRXV &7 VWRS DW FRGRQ +HWHUR]\JRXV &7 5; ; 1DJOH HW DO +RPR]\JRXV ES GHOHWHG &RGRQ IUDPHVKLIW VWRS DW FRGRQ 3, 8 NEP51$ ODFN RI SURWHLQ 3 LL NE P51$ ODFN RI SURWHLQ

PAGE 56

0XWDWLRQV ZHUH DOVR LGHQWLILHG LQ VHYHUDO EHLJH DOOHOHV $ NE JHQRPLF GHOHWLRQ WKDW FRQWDLQHG WKH fHQG RI /\VW H[RQ S DQG H[RQV \ DQG ZDV IRXQG LQ EJf'1$ 7KLV PXWDWLRQ ZDV GHWHFWHG E\ K\EULGL]DWLRQ RI 7\VIGHULYHG SUREHV WR 6RXWKHUQ EORWV RI JHQRPLF '1$ IURP DOO SRWHQWLDO SURJHQLWRU PRXVH VWUDLQV )LJ f DQG E\ 3&5 DPSOLILFDWLRQ RI VHYHUDO /\VW IUDJPHQWV )LJ f 7KLV GHOHWLRQ FRUUHVSRQGV WR D ORVV RI DSSUR[LPDWHO\ LQWHUQDO DPLQR DFLGV RI WKH SUHGLFWHG /\VW SURWHLQ )XUWKHUPRUH ZKHUHDV WKH fHQG RI WKH EJGHOHWLRQ RFFXUV ZLWKLQ /\VW H[RQ S WKH fHQG LV LQWURQLF 7KHUHIRUH WKH WUXQFDWHG /\VW P51$ LQ EJ,PLFH LV DOVR DQWLFLSDWHG WR VSOLFH LQFRUUHFWO\ WHUPLQDWH SUHPDWXUHO\ DQG ODFN SRO\DGHQ\ODWLRQ 8QIRUWXQDWHO\ LW ZDV QRW SRVVLEOH WR FRQILUP WKLV SUHGLFWLRQ VLQFH EJPLFH DUH H[WLQFW DQG RQO\ DUFKLYHG JHQRPLF '1$ ZDV DYDLODEOH 4XDQWLWDWLYH UHYHUVH WUDQVFULSWLRQ 57f3&5 GHPRQVWUDWHG D PRGHUDWH UHGXFWLRQ LQ /\VW P51$ LQ EJ DQG EJr OLYHU DQG D JURVV UHGXFWLRQ LQ EJ\/\VW $2' DIWHU QRUPDOL]DWLRQ IRU 3DFWLQ P51$ EJ-EJEJEJ EJnEJn f )LJ f $ FRPPHQVXUDWH UHGXFWLRQ LQ EJWUDQVFULSW DEXQGDQFH ZDV QRWHG E\ XVLQJ VHYHUDO SULPHU SDLUV GHULYHG IURP GLIIHUHQW UHJLRQV RI WKH /\VW F'1$ $EHUUDQW /\VW 57 3&5 SURGXFWV ZHUH QRW REVHUYHG 7KH SDUWLFXODUO\ VWULNLQJ PRUH WKDQ ILYHIROGf UHGXFWLRQ LQ /\VW H[SUHVVLRQ HYLGHQW LQ EJnn KRPR]\JRWHV VXJJHVWHG WKH H[LVWHQFH RI D PXWDWLRQ LQ EJWKDW UHVXOWV LQ GHFUHDVHG WUDQVFULSWLRQ RU P51$ LQVWDELOLW\ 7KH PROHFXODU EDVLV RI WKH UHGXFWLRQ LQ /\VW P51$ LQ EJLV QRW \HW NQRZQ

PAGE 57

, ,, ,, ,, ,, ,, ,, +LQG ,,, 0VSO 7DTO +LQG ,,, 0VSO 7DTO +LQG ,,, 0VSO 7DTO )LJXUH 6RXWKHUQ EORW LGHQWLILFDWLRQ RI DQ LQWUDJHQLF /\VW GHOHWLRQ LQ EJX $ 6RXWKHUQ EORW ZDV VHTXHQWLDOO\ K\EULGL]HG ZLWK /\VW SUREHV $f WKH SUREH QXFOHRWLGHV RI /\VW F'1$f H[WHQGV XSVWUHDP RI WKH EJGHOHWLRQ %f WKH SUREH QXFOHRWLGHV RI /\VW F'1$f LV FRPSOHWHO\ GHOHWHG &f WKH SUREH QXFOHRWLGHV RI /\VW F'1$f H[WHQGV GRZQVWUHDP RI WKH EJfGHOHWLRQ 5HVWULFWLRQ HQGRQXFOHDVHV DUH LQGLFDWHG DW WKH ERWWRP RI HDFK SDQHO DQG PROHFXODU VL]H VWDQGDUGV LQ NEf DUH VKRZQ WR WKH OHIW 6RXWKHUQ EORWV ZHUH SUHSDUHG IURP JHQRPLF '1$ RI DOO SRWHQWLDO SURJHQLWRU PRXVH VWUDLQV EXW RQO\ &%/&%/DQG &%/EJDUH VKRZQ

PAGE 58

' \ " L n(+ $ 9}  L L U Y f§V NE NE n NE EJ8 GHOHWLRQ NE )LJXUH 3&5 DQDO\VLV RI WKH EJGHOHWLRQ DQG JHQRPLF VWUXFWXUH RI /\VW LQ WKH YLFLQLW\ RI WKH GHOHWLRQ &%/&+H%)H&%/DQG &%/EJJHQRPLF '1$ DQG /\VW F'1$ ZHUH XVHG WHPSODWHV LQ WKH 3&5 UHDFWLRQV $PSOLFRQV LOOXVWUDWHG FRUUHVSRQG WR $f /\VW F'1$ QXFOHRWLGHV ZKLFK UHSUHVHQW H[RQ 3 DQG DUH XSVWUHDP RI WKH GHOHWLRQ %f QXFOHRWLGHV ZKLFK UHSUHVHQW H[RQ \ GHOHWHG LQ EJ'1$ &f QXFOHRWLGHV ZKLFK UHSUHVHQW DQ H[RQ GRZQVWUHDP IURP WKH GHOHWLRQ 1R DPSOLFRQ ZDV REVHUYHG LQ FRQWURO 3&5 UHDFWLRQV SHUIRUPHG ZLWKRXW WHPSODWH 0RUH WKDQ RWKHU 676V WKDW KDG EHHQ ORFDOL]HG ZLWKLQ WKH EJ QRQn UHFRPELQDQW LQWHUYDO DPSOLILHG QRUPDOO\ IURP EJ'1$ 'f *HQRPLF VWUXFWXUH RI /\VW LQ WKH YLFLQLW\ RI WKH EJnX GHOHWLRQ /\VW H[RQV D S \ V DQG _!f DUH GHSLFWHG E\ EODFN ER[HV DQG LQWHUYHQLQJ LQWURQV E\ D VROLG OLQH 1XFOHRWLGHV RI WKH PRXVH /\VW F'1$ WKDW FRUUHVSRQG WR H[RQLF ERXQGDULHV DUH LQGLFDWHG DERYH WKH ER[HV 7KH f HQG RI H[RQ S DQG DOO RI H[RQV \ DQG DUH GHOHWHG LQ EJ'1$ *HQRPLF VWUXFWXUH DQG LQWURQLF VHTXHQFHV ZHUH DVFHUWDLQHG E\ VHTXHQFH DQDO\VLV RI QHVWHG 3&5 SURGXFWV SHUIRUPHG ZLWK H[RQLF SULPHUV DQG 3, JHQRPLF FORQH DV WHPSODWH %RXQGDULHV RI WKH EJGHOHWLRQ ZHUH GHWHUPLQHG E\ 3&5 RI JHQRPLF '1$

PAGE 59

b 2I QRUPDOL]HGf )LJXUH 4XDQWLWDWLYH UHYHUVH WUDQVFULSWLRQ 57f3&5 DQDO\VLV RI /\VW LQ VHYHUDO EJ DOOHOHV /\VW P51$ IURP NJf EJEJ DQG FRQWURO OLYHUV ZDV UHYHUVH WUDQVFULEHG 3&5 DPSOLILHG DQG WKH DPRXQW RI WKH UHVXOWLQJ 3&5 SURGXFWV ZDV TXDQWLWDWHG E\ PHDVXULQJ $2' DIWHU QRUPDOL]DWLRQ IRU 3DFWLQ P51$ b $2' IRU /\VW DUH VKRZQ EHORZ WKH JHO LPDJHf

PAGE 60

,GHQWLILFDWLRQ DQG &KDUDFWHUL]DWLRQ RI /YVW P51$ ,VRIRUPV 7KH LQYHVWLJDWLRQ RI P51$ LVRIRUPV RI WKH &+6 JHQH ZDV XQGHUWDNHQ IRU WKH IROORZLQJ UHDVRQV 7R UHVROYH WKH GLVFUHSDQF\ EHWZHHQ WKH LQLWLDO UHSRUWV DERXW WKH LGHQWLILFDWLRQ RI WKH EHLJH JHQH 7KH SDUWLDO F'1$ VHTXHQFH SXEOLVKHG E\ 3HURX HW DO E GLG QRW PDWFK WKH FRPSOHWH RSHQ UHDGLQJ IUDPH UHSRUWHG E\ %DUERVD HW DO 7R LGHQWLI\ WKH LVRIRUP RI SULPDU\ IXQFWLRQDO VLJQLILFDQFH DV ZHOO DV RWKHU DOWHUQDWLYHO\ VSOLFHG YDULDQWV WKDW PD\ KDYH VRPH LPSRUWDQFH 7R GHWHUPLQH ZKLFK RI WKH SUHGLFWHG GRPDLQV DUH FUXFLDO IRU WKH IXQFWLRQ RI WKH &+6 SURWHLQ 7KH H[LVWHQFH RI PRUH WKDQ RQH P51$ LVRIRUP RI WKH PRXVH EHLJH JHQH GHVLJQDWHG /\VWf KDG EHHQ VXJJHVWHG E\ QRUWKHUQ DQDO\VLV )LJ f DQG E\ WKH WZR GLIIHUHQW /\VW F'1$ VHTXHQFHV WKDW ZHUH UHSRUWHG 1RUWKHUQ EORWV LQGLFDWHG WKDW /\VW LV XELTXLWRXVO\ WUDQVFULEHG ERWK WHPSRUDOO\ DQG VSDWLDOO\ LQ PRXVH DQG KXPDQ WLVVXHV &RPSOH[ DOWHUQDWLYH VSOLFLQJ ZLWK ERWK FRQVWLWXWLYH DQG DQDWRPLFDOO\ UHVWULFWHG /\VW P51$ LVRIRUPV ZDV DOVR UHYHDOHG 7KH ODUJHVW /\VW WUDQVFULSW LQ KXPDQ DQG PRXVH ZDV NE DQG DGGLWLRQDO VPDOOHU DOWHUQDWLYHO\ VSOLFHG YDULDQWV ZHUH DOVR SUHVHQW ZLWK YDU\LQJ DEXQGDQFH LQ GLIIHUHQW WLVVXHV )LJ f

PAGE 61

n /\VW 0LG /\VW & n /<67 n /<67 )LJXUH 1RUWKHUQ EORW DQDO\VLV RI PRXVH DQG KXPDQ /<67 $f %f QRUWKHUQ EORWV RI MDJ SRO\$f P51$ IURP YDULRXV PRXVH WLVVXHV K\EULGL]HG ZLWK SUREHV WKDW FRUUHVSRQG WR $f QXFOHRWLGHV DQG %f QXFOHRWLGHV H[RQ 3f RI PRXVH /\VW F'1$ &f 'f QRUWKHUQ EORWV RI SJ SRO\$f P51$ IURP &f KXPDQ O\PSKRLG WLVVXHV DQG 'f KXPDQ FDQFHU FHOO OLQHV K\EULGL]HG ZLWK D SUREH WKDW FRUUHVSRQGV WR QXFOHRWLGHV RI KXPDQ /<67 F'1$ 0ROHFXODU VL]H VWDQGDUGV LQ NEf DUH VKRZQ WR WKH OHIW

PAGE 62

0RXVH /\VW F'1$ LVRIRUPV ZHUH LGHQWLILHG E\ DQFKRUHG QHVWHG 3&5 f5$&( 3&5f 7ZR IUDJPHQWV NE DQG NEf ZHUH DPSOLILHG IURP PRXVH VSOHHQ F'1$ XVLQJ WKLV WHFKQLTXH 7KH NE FORQH FRQWDLQHG WKH fHQG RI WKH SUHYLRXVO\ GHVFULEHG ES /\VW F'1$ WKDW FRUUHVSRQGV WR D VPDOO P51$ LVRIRUP /\VWOOf 7KH fHQG RI WKH NE FORQH KRZHYHU FRQWDLQHG VHTXHQFH GHULYHG IURP WKH /\VWO, F'1$ ZKLOH WKH fHQG VHTXHQFH ZDV IURP WKH ODUJHVW LVRIRUP /\VW SUHYLRXVO\ FDOOHG %*f RI WKH EHLJH JHQH 5HYHUVH WUDQVFULSWLRQ 57f3&5 FRQILUPHG WKDW QXFOHRWLGHV RI /\VW DUH FRPPRQ WR ERWK P51$ LVRIRUPV )LJ $f 7KH ODUJH LVRIRUP F'1$ WKDW FRQWDLQV WKH HQWLUH FRGLQJ GRPDLQ ZDV DVVHPEOHG IURP QXFOHRWLGHV RI /\VW WKH NE f5$&(3&5 FORQH DQG QXFOHRWLGHV RI %* F'1$ 7KLV ES F'1$ VHTXHQFH /\VWO *HQ%DQN DFFHVVLRQ QXPEHU 8f FRUUHVSRQGV WR WKH ODUJHVW P51$ REVHUYHG RQ QRUWKHUQ EORWV )LJ f 7KLV f§ NE F'1$ KRZHYHU LV WUXQFDWHG DW ERWK WKH fHQG RI WKH fXQWUDQVODWHG UHJLRQ 875f DQG DW WKH fHQG RI WKH f875 DQG WKXV LV VPDOOHU WKDQ WKH ODUJHVW P51$ NEf REVHUYHG RQ PRXVH QRUWKHUQ EORWV $QDO\VLV RI D 3, JHQRPLF FORQH QXPEHU f FRQWDLQLQJ WKH HQWLUH EHLJH JHQH UHYHDOHG WKDW WKH ES /\VWO F'1$ UHVXOWV ZKHQ VSOLFLQJ RFFXUV IURP /\VW H[RQ D FRQWDLQLQJ QXFOHRWLGH f WR GRZQVWUHDP H[RQ [ )LJV DQG f ,Q FRQWUDVW LQFRPSOHWH VSOLFLQJ DQG UHDGLQJ WKURXJK LQWURQ Df LQWHUSRVHG EHWZHHQ H[RQV D DQG [f \LHOGV WKH WUXQFDWHG /\VWOO LVRIRUP RI OHQJWK ES F'1$ /\VW,, )LJ *HQ%DQN DFFHVVLRQ QXPEHU /f /\VW LQWURQ Df HQFRGHV LQIUDPH DPLQR DFLGV IROORZHG E\ D VWRS FRGRQ DQG D SRO\DGHQ\ODWLRQ VLJQDO /\VWOO FRUUHVSRQGV WR RQH RI VHYHUDO VPDOOHU P51$V REVHUYHG RQ QRUWKHUQ EORWV )LJ f )XOOOHQJWK F'1$V FRUUHVSRQGLQJ WR WKH

PAGE 63

/\VWO DQG /\VWO, LVRIRUPV ZHUH ERWK DPSOLILHG IURP PRXVH ERQH PDUURZ 51$ E\ 57 3&5 7KH SXWDWLYH /\VW, DQG /\VW,, SURWHLQV DUH RI UHODWLYH PROHFXODU PDVV 0U N'Df DQG 0U N'D UHVSHFWLYHO\ D /\VWO NE ([RQ, ([RQ,, ,QWURQ) /\VWO NE E /\VWO /\VWO )5 )5 )LJXUH $OWHUQDWLYH VSOLFLQJ RI WKH &+6 JHQH $f $OWHUQDWLYH VSOLFLQJ RI PRXVH /\VW 6ROLG OLQHV UHSUHVHQW /\VW H[RQV D DQG [ QRW GUDZQ WR VFDOHf 6SOLFLQJ RI H[RQ D WR H[RQ [ RFFXUV LQ WKH /\VWO P51$ a NEf 7KH KDWFKHG ER[ UHSUHVHQWV WKH LQWURQLF UHJLRQ WKDW IRUPV WKH f HQG RI WKH /\VWO 25) NEf 7KH LQWURQ FRQWDLQV D VWRS FRGRQ rf DQG D SRO\DGHQ\ODWLRQ VLJQDO $f 1XFOHRWLGH SRVLWLRQV LQGLFDWHG DUH IURP *HQ%DQN DFFHVVLRQ 1R / =MWI,,f DQG 8 ^/\VWOf %f 'HWHFWLRQ RI P51$ LVRIRUPV RI PRXVH /\VW E\ 573&5 DQG JHQRPLF 3&5 '1DVHWUHDWHG PRXVH PHODQRF\WH 51$ ZDV UHYHUVH WUDQVFULEHG DQG DPSOLILHG ZLWK SULPHUV )O5O H[SHFWHG DPSOLFRQ VL]H ESf RU )5 H[SHFWHG DPSOLFRQ VL]H ESf 51DVHWUHDWHG &%/'1$ ZDV DPSOLILHG ZLWK SULPHUV )O5O

PAGE 64

F'1$V FRUUHVSRQGLQJ WR WKH KXPDQ KRPRORJ RI WKH ODUJHVW P51$ LVRIRUP RI WKH EHLJH JHQH ZHUH REWDLQHG E\ LGHQWLILFDWLRQ RI KXPDQ H[SUHVVHG VHTXHQFH WDJV (67Vf VLPLODU LQ VHTXHQFH WR PRXVH /\VWO E\ GDWDEDVH VHDUFKHV *HQ%DQN DFFHVVLRQ QXPEHUV / : DQG +f ,QWHUYHQLQJ F'1$ VHTXHQFHV ZHUH LVRODWHG XVLQJ 57 3&5 DQG D SDUWLDO KXPDQ F'1$ VHTXHQFH *HQ%DQN DFFHVVLRQ QXPEHU 8 NEf ZDV DVVHPEOHG E\ DOLJQPHQW RI WKHVH FORQHV ZLWK WKH ODUJHVW PRXVH EJ JHQH F'1$ 7KH SUHGLFWHG KXPDQ DQG PRXVH SHSWLGHV VKDUHG b LGHQWLW\ RYHU DPLQR DFLGV 7KH SUHGLFWHG KXPDQ DPLQR DFLG VHTXHQFH FRQWDLQV D VL[ DPLQR DFLG LQVHUWLRQ DW UHVLGXH UHODWLYH WR WKDW RI PRXVH 7KH FRPSOHWH VHTXHQFH RI WKH KXPDQ &+6 F'1$ ZDV UHSRUWHG E\ 1DJOH HW DO 7KLV NE F'1$ VHTXHQFH FRUUHVSRQGV WR WKH ODUJHVW P51$ REVHUYHG RQ QRUWKHUQ EORWV IURP KXPDQ WLVVXHV ^&+6 )LJ DQG LQVHW RI )LJ f 7KHVH QRUWKHUQ EORWV DOVR GHPRQVWUDWHG WKH H[LVWHQFH RI D VPDOOHU KXPDQ WUDQVFULSW NEf WKDW ZDV VLPLODU LQ VL]H WR WKH VPDOO PRXVH /\VW P51$ DQG WKDW DSSHDUHG WR GLIIHU IURP WKH ODUJH LVRIRUP LQ GLVWULEXWLRQ RI H[SUHVVLRQ LQ KXPDQ WLVVXHV )LJ f $VVXPLQJ WKDW WKH JHQRPLF GHULYDWLRQ RI WKH VPDOO KXPDQ LVRIRUP PLJKW EH WKH VDPH DV WKH VPDOO PRXVH LVRIRUP WKH fHQG RI WKH VPDOO KXPDQ LVRIRUP ZDV LGHQWLILHG E\ FORQLQJ KXPDQ LQWURQ Df XVLQJ 3&5 RI KXPDQ JHQRPLF '1$ ZLWK SULPHUV GHULYHG IURP H[RQ FW DQG LQWURQ Df 6LPLODUO\ WR LQWURQ FI LQ WKH PRXVH WKH VHTXHQFH RI WKH fHQG RI KXPDQ LQWURQ Df FRQWDLQHG FRGRQV LQ IUDPH ZLWK H[RQ D IROORZHG E\ D VWRS FRGRQ &+6,, LQVHW RI )LJ f F'1$ FRUUHVSRQGLQJ WR WKLV VKRUW KXPDQ LVRIRUP ZDV DPSOLILHG IURP KXPDQ SHULSKHUDO EORRG 51$ E\ 573&5 ZLWK SULPHUV IURP D f H[RQ DQG IURP LQWURQ Df LQGLFDWLQJ WKDW WKLV LQWURQ ZDV LQGHHG SUHVHQW LQ &+68 P51$

PAGE 65

&+6 aNE :' aaQ FX ‘ 6WDWKPLQOLNH 3UREH f? &+6,, aNE r ,QWURQ Df c c J 2 2 2 2 2 & e J i e J D V 6 M ’ 6 i R D ] i i ,, cD ! 3 3 c BL 3 4@ + 3 88. % f‘ e f‘ /L )LJXUH &RPSDULVRQ RI WKH UHODWLYH DEXQGDQFH RI &+6 /<67f P51$ LVRIRUPV LQ KXPDQ WLVVXHV DIWHU QRUPDOL]DWLRQ 3UREH VSHFLILF IRU WKH ODUJHVW LVRIRUP &+6O RU /<67Of DQG WKH FRUUHVSRQGLQJ VLJQDO LQWHQVLW\ OHYHOV DUH VKRZQ LQ EODFN 3UREH LGHQWLILHV DOO &+6 WUDQVFULSWVf DQG WKH FRUUHVSRQGLQJ VLJQDO LQWHQVLW\ OHYHOV DUH VKRZQ LQ ZKLWH 9DULDWLRQ RI WKH UHODWLYH P51$ DEXQGDQFH DPRQJ WLVVXHV ZDV DVVHVVHG E\ SKRVSKRULPDJLQJ GRW TXDQWLWDWLRQ VXEWUDFWLRQ RI EDFNJURXQG DQG FDOFXODWLRQ RI WKH LQWHQVLW\ SHUFHQWDJH IRU HDFK WLVVXH 7KH UHODWLYH P51$ DEXQGDQFH EHWZHHQ QRUPDOL]HG WLVVXHV IRU HDFK SUREH ZDV H[SUHVVHG DV WKH SHUFHQWDJH RI WKH WRWDO K\EULGL]DWLRQ VLJQDO REWDLQHG IRU HDFK WLVVXH ZLWK WKDW SUREH 7KH DYHUDJH SHUFHQWDJH LQWHQVLW\ IRU KRXVHNHHSLQJ JHQHV LQ DOO WLVVXHV ZDV ab 1R K\EULGL]DWLRQ ZDV HYLGHQW WR FRQWURO GRWV FRQWDLQLQJ \HDVW WRWDO 51$ \HDVW W51$ ( FROL U51$ ( FROL '1$ SRO\ U$f KXPDQ &WO '1$ DQG KXPDQ '1$ ([SRVXUH WLPH IRU SKRVSKRULPDJLQJ ZDV K

PAGE 66

1XFOHRWLGHV RI KXPDQ VPDOO DQG ORQJ LVRIRUP F'1$V DUH LGHQWLFDO DQG DUH IROORZHG HLWKHU E\ LQWURQ Df VHTXHQFH LQ WKH VKRUW LVRIRUP *HQ%DQN DFFHVVLRQ QXPEHU 8f RU E\ H[RQ [ DQG WKH UHVW RI WKH H[RQV LQ WKH ORQJ LVRIRUP LQVHW RI )LJ f 7KH SUHGLFWHG LQWURQHQFRGHG DPLQR WHUPLQL RI WKH VKRUW PRXVH DQG KXPDQ LVRIRUP SHSWLGHV VKDUH b LGHQWLW\ $GGLWLRQDO VSOLFLQJ FRPSOH[LW\ RI VPDOOHU LVRIRUPV H[LVWV 7KH /\VWO,, LVRIRUP ODFNV H[RQV D DQG S ZKLOH LQ /\VW<9 H[RQV D 3 DQG \ DUH DEVHQW ,Q ERWK LVRIRUPV WKH DOWHUQDWLYH VSOLFLQJ RFFXUV RXW RI IUDPH DQG UHVXOWV LQ WHUPLQDWLRQ VKRUWO\ DIWHU WKH VSOLFH MXQFWLRQ VXJJHVWLQJ WKDW PRVW OLNHO\ WKHVH WZR LVRIRUPV GR QRW KDYH IXQFWLRQDO VLJQLILFDQFH 7KHVH VSOLFH YDULDQWV FRUUHVSRQG WR DGGLWLRQDO EDQGV REVHUYHG RQ QRUWKHUQ EORWV )LJ f $ VFKHPDWLF UHSUHVHQWDWLRQ RI WKH IRXU /\VW LVRIRUPV LV VKRZQ LQ )LJ /\VW? a NE /\V0, a NE /\V0,O ES /\V09 ES H[RQV &2 D 3 H O! D &2 D 3 < W! n FR r $ ,17521,& &2 )LJXUH 6FKHPDWLF UHSUHVHQWDWLRQ RI WKH IRXU P51$ LVRIRUPV RI WKH &KHGLDN +LJDVKL V\QGURPH JHQH r VWRS FRGRQ $ SRO\$f

PAGE 67

,Q DQ HIIRUW WR HYDOXDWH WKH IXQFWLRQDO VLJQLILFDQFH RI WKH WZR ODUJHVW /\VW LVRIRUPV JHQHWLF FRPSOHPHQWDWLRQ H[SHULPHQWV ZHUH LQLWLDWHG LQ FROODERUDWLRQ ZLWK 'U 6WHSKHQ %UDQGW 9DQGHUELOW 8QLYHUVLW\ )XOOOHQJWK /\VW DQG /\VW,, LVRIRUPV ZHUH DPSOLILHG IURP PRXVH ERQH PDUURZ F'1$ E\ ORQJUDQJH 3&5 DQG FORQHG LQ H[SUHVVLRQ YHFWRUV 7KH UHVXOWLQJ FRQVWUXFWV ZHUH H[SUHVVHG LQ FXOWXUHG ILEUREODVWV IURP EHLJH PLFH H[KLELWLQJ WKH FKDUDFWHULVWLF JLDQW SHULQXFOHDU JUDQXOHV LQ WKH F\WRSODVP 7KH HIIHFW ZDV HYDOXDWHG E\ REVHUYLQJ WKH FKDQJHV LQ WKH VL]H DQG GLVWULEXWLRQ RI VSHFLILFDOO\ VWDLQHG O\VRVRPHV DQG HQGRVRPHV 6RPH FHOOV H[SUHVVLQJ IXOOOHQJWK /\VW GHPRQVWUDWHG PRUH SHULSKHUDO GLVWULEXWLRQ RI WKH VWDLQHG JUDQXOHV LQ WKH F\WRSODVP DQG VOLJKW UHGXFWLRQ RI WKHLU VL]H 6XFK FKDQJHV ZHUH QRW YLVLEOH LQ FHOOV H[SUHVVLQJ WKH VPDOOHU /\VW,, LVRIRUP VXSSRUWLQJ WKH K\SRWKHVLV WKDW WKH ODUJHVW VSOLFH YDULDQW /\VWf UHSUHVHQWV WKH P51$ LVRIRUP RI SULPDU\ IXQFWLRQDO VLJQLILFDQFH +RZHYHU VLQFH WKH HIIHFWV RI WKH FRPSOHPHQWDWLRQ ZHUH QRW YHU\ SURPLQHQW DQG ZHUH QRW REVHUYHG LQ DOO FHOOV H[SUHVVLQJ /\VW WKH VLJQLILFDQFH RI WKH GHVFULEHG JHQHWLF FRPSOHPHQWDWLRQ LV TXHVWLRQDEOH $QDO\VLV RI QRUWKHUQ EORWV RI PRXVH P51$ KDG VXJJHVWHG WKDW WKH UHODWLYH DEXQGDQFH RI WKH ODUJH DQG VPDOO WUDQVFULSWV GLIIHUHG IURP WLVVXH WR WLVVXH )LJ f 7KH UHODWLYH DEXQGDQFH RI P51$ LVRIRUPV RI WKH KRPRORJRXV JHQH LQ KXPDQ WLVVXHV DW GLIIHUHQW GHYHORSPHQWDO VWDJHV ZDV H[DPLQHG )LJ f E\ VHTXHQWLDO K\EULGL]DWLRQ RI D SRO\$f 51$ GRWEORW ZLWK D F'1$ SUREH LQVHW RI )LJ 3UREH VKRZQ LQ EODFN QXFOHRWLGHV RI KXPDQ &+6 *HQ%DQN DFFHVVLRQ 1R 8f VSHFLILF IRU WKH ODUJHVW LVRIRUP DQG ZLWK D F'1$ SUREH LQVHW RI )LJ 3UREH VKRZQ LQ ZKLWH QXFOHRWLGHV RI KXPDQ &+6 *HQ%DQN DFFHVVLRQ 1R 8 DQG 8f WKDW LGHQWLILHV DOO &+6 WUDQVFULSWV )LJ f 7KH LQVHW LQ )LJ VKRZV WKH KXPDQ NE F'1$

PAGE 68

LVRIRUP &+6OO RU /<67OO ZKLFK DULVHV WKURXJK LQFRPSOHWH VSOLFLQJ ZLWK LQWURQ Ff VXSSO\LQJ WKH fHQG RI WKH WUDQVFULSWf WKH ODUJHVW LVRIRUP &+6O RU /<67, NE ZKLFK UHVXOWV IURP UHPRYDO RI LQWURQ Dff DQG WKH ORFDWLRQ RI WKH SUREHV 7KH TXDQWLW\ RI SRO\$f 51$ RQ WKH EORW ZDV QRUPDOL]HG WR HLJKW KRXVHNHHSLQJ JHQHV SKRVSKROLSDVH ULERVRPDO SURWHLQ 6 WXEXOLQ KLJKO\ EDVLF N'D SURWHLQ JO\FHUDOGHK\GHSKRVSKDWH GHK\GURJHQDVH K\SR[DQWLQH JXDQLQH SKRVSKRULERVLO WUDQVIHUDVH 3DFWLQ DQG XELTXLWLQf 8VLQJ D SUREH WKDW K\EULGL]HG RQO\ WR WKH ODUJHVW P51$ LVRIRUP RQ QRUWKHUQ EORWV WUDQVFULSWV ZHUH PRVW DEXQGDQW LQ WK\PXV DGXOW DQG IHWDOf SHULSKHUDO EORRG OHXNRF\WHV ERQH PDUURZ DQG VHYHUDO UHJLRQV RI WKH DGXOW EUDLQ )LJ f ,QWHUHVWLQJO\ WKH ODUJHVW P51$ LVRIRUP ZDV QRW GHWHFWHG LQ IHWDO EUDLQ 7KHUH ZDV DOVR ORZ UHODWLYH H[SUHVVLRQ RI WKLV LVRIRUP LQ KHDUW OXQJ NLGQH\ DQG OLYHU LQ ERWK DGXOW DQG IHWDO WLVVXHV $ VRPHZKDW GLIIHUHQW SDWWHUQ RI UHODWLYH H[SUHVVLRQ ZDV HYLGHQW XSRQ UHK\EULGL]DWLRQ RI WKH EORW ZLWK D SUREH GHULYHG IURP WKH fHQG RI WKH FRGLQJ GRPDLQ RI WKH &+6 JHQH D UHJLRQ WKDW K\EULGL]HG WR DOO P51$ LVRIRUPV RQ QRUWKHUQ EORWV &RQVLVWHQW ZLWK WKH WUDQVFULSWLRQ SDWWHUQ RI WKH ODUJHVW LVRIRUP WKLV SUREH GHWHFWHG DEXQGDQW H[SUHVVLRQ RQ SHULSKHUDO EORRG OHXNRF\WHV WK\PXV DGXOW DQG IHWDOf DQG ERQH PDUURZ +RZHYHU VHYHUDO WLVVXHV ZLWK DEXQGDQW ODUJH LVRIRUP WUDQVFULSWV H[KLELWHG FRQVLGHUDEO\ OHVV UHODWLYH H[SUHVVLRQ ZLWK WKH fSUREH LQFOXGLQJ PRVW UHJLRQV RI WKH DGXOW EUDLQ IHWDO DQG DGXOW WK\PXV DQG VSOHHQ )XUWKHUPRUH VHYHUDO WLVVXHV ZLWK QHJOLJLEOH UHODWLYH WUDQVFULSWLRQ RI WKH ODUJH LVRIRUP H[KLELWHG LQFUHDVHG UHODWLYH H[SUHVVLRQ ZLWK WKH fSUREH LQFOXGLQJ DGXOW DQG IHWDO KHDUW NLGQH\ OLYHU DQG OXQJ DGXOW DRUWD WK\URLG JODQG VDOLYDU\ JODQG DQG DSSHQGL[ DQG IHWDO EUDLQ )LJ f

PAGE 69

,GHQWLILFDWLRQ DQG &KDUDFWHUL]DWLRQ RI /\VW D %UDLQ6SHFLILF 0HPEHU RI WKH &KHGLDN +LJDVKL 6\QGURPH *HQH )DPLO\ ,GHQWLILFDWLRQ DQG 6HTXHQFH $QDO\VLV ,Q DQ HIIRUW WR LGHQWLI\ JHQHV VLPLODU WR WKH &+6 JHQH H[WHQVLYH GDWDEDVH VHDUFKHV ZHUH SHUIRUPHG %/$67; FRPSDULVRQ RI PRXVH /\VW 8f WR SXEOLF (67 GDWDEDVHV UHYHDOHG D VLJQLILFDQW EXW QRQLGHQWLFDO PDWFK ZLWK DQ XQFKDUDFWHUL]HG KXPDQ (67 5f 7KH FRUUHVSRQGLQJ SDUWLDOOHQJWK F'1$ FORQH OHQJWK ESf GHULYHG IURP D KXPDQ LQIDQW EUDLQ F'1$ OLEUDU\ ZDV VHTXHQFHG $Q DGGLWLRQDO ES RI F'1$ VHTXHQFH ORFDWHG LPPHGLDWHO\ f RI FORQH ZDV REWDLQHG E\ LQVHUWYHFWRU 3&5 RI D KXPDQ IHWDO EUDLQ F'1$ OLEUDU\ 7KH UHVXOWLQJ WRWDO VHTXHQFH NE )LJ ODf FRUUHVSRQGHG WR WKH f HQG RI WKH FRGLQJ GRPDLQ DQG WKH f 875 RI D QRYHO JHQH WKDW ZDV GHVLJQDWHG /<67 O\VRVRPDO WUDIILFNLQJ UHJXODWRU )LJOLEf $PLQR DFLG LGHQWLW\ RI /<67 ZLWK /<67 YDULHG IURP UHJLRQ WR UHJLRQ /<67 DPLQR DFLGV VKDUHG b LGHQWLW\ ZLWK /<67 UHVLGXHV 7KLV UHJLRQ FRUUHVSRQGV WR WKH %($&+ GRPDLQ DPLQR DFLGV f RI /<67 DQG H[KLELWHG VHTXHQFH VLPLODULW\ WR DQRQ\PRXV 25)V IURP 6 FHUHYLVLDH & HOHJDQV DQG KXPDQ &'&/ SURWHLQ 1DJOH HW DO f ,Q FRQWUDVW WKH :' UHSHDWFRQWDLQLQJ FDUER[\WHUPLQDO GRPDLQ RI /<67 ZKLFK LV SUHGLFWHG WR DVVXPH D VL[EODGHG EHWDSURSHOOHU VWUXFWXUH VLPLODU WR WKH %VXEXQLW RI KHWHURWULPHULF SURWHLQV 6RQGHN HW DO f VKDUHG OLWWOH DPLQR DFLG VLPLODULW\ ZLWK /<67 7KH ODWWHU UHJLRQ RI /<67 GLG KRZHYHU FRQWDLQ /<67OLNH :' UHSHDWV DQG DOVR H[KLELWHG VLJQLILFDQW VHTXHQFH VLPLODULW\ WR WKH %VXEXQLW RI KHWHURWULPHULF SURWHLQV

PAGE 70

b LGHQWLW\ /<67 DPLQR DFLGV WR *IL ^3`f 7KH /<67 f 875 GHPRQVWUDWHG b LGHQWLW\ WR ES RI WKH f 875 RI /<67 ,Q DQ HIIRUW WR LGHQWLI\ WKH PRXVH KRPRORJ RI KXPDQ /<67 D PRXVH HPEU\R F'1$ OLEUDU\ ZDV VFUHHQHG ZLWK D KXPDQ /<67 SUREH DQG WZR RYHUODSSLQJ FORQHV RI WRWDO OHQJWK RI a NE ZHUH LGHQWLILHG )LJ Ff 7KH FRUUHVSRQGLQJ SDUWLDO PRXVH SXWDWLYH SURWHLQ /\VW )LJ OLGf H[KLELWHG b LGHQWLW\ RYHU DPLQR DFLGV WR PRXVH /\VW DQG b LGHQWLW\ LQ DPLQR DFLGV WR KXPDQ /<67 *HQHWLF 0DSSLQJ ,Q RUGHU WR FRQILUP WKDW /\VW DQG /\VW DUH LQGHHG WZR GLIIHUHQW JHQHV DQG WR HYDOXDWH WKH SRWHQWLDO FDQGLGDF\ RI /\VW IRU PRXVH FRDW FRORU PXWDWLRQV /\VW ZDV PDSSHG E\ FURVVK\EULGL]DWLRQ LQ WKH PRXVH XVLQJ XQLTXH &$67(LUHVWULFWLRQ IUDJPHQW OHQJWK SRO\PRUSKLVPV ZLWK 0VSO a NEf DQG (FR5O a NEf /LQNDJH DQDO\VLV XVLQJ '1$ IURP LQWHUVXEVSHFLILF EDFNFURVV >&%/; &%/-E [ &$67(L-f )@ PLFH UHYHDOHG WKDW /\VW PDSV RQ PRXVH &KU )LJ f 7KH EHVW JHQH RUGHU DQG UHFRPELQDWLRQ IUHTXHQF\ s VWDQGDUG HUURUf ZHUH FHQWURPHUH '08 s F0 /\VW s F0 '08WHORPHUH *HQ%DQN DFFHVVLRQ QXPEHU $)f /<67 ZDV PDSSHG RQ KXPDQ &KU E\ K\EULGL]DWLRQ WR 6RXWKHUQ EORWV RI KXPDQURGHQW VRPDWLF FHOO K\EULGV LQ FROODERUDWLRQ ZLWK 'U 0DUJDUHW :DOODFH 1R FURVVK\EULGL]DWLRQ WR /<67 ZDV REVHUYHG )LJ f :KLOH WKH &+6 JHQH PDSV RQ KXPDQ &KU DQG RQ PRXVH FKURPRVRPH /<67 ZDV ORFDOL]HG WR KXPDQ &KU DQG WR PRXVH FKURPRVRPH FRQILUPLQJ WKDW /<67 DQG /<67 DUH LQGHHG WZR GLIIHUHQW JHQHV

PAGE 71

Df +XPDQ /<67 '1$ &&*$$*$*$* &7*7*7777$ 7*&$*$*&*7 7$7*$*$&$7 ***$$*$7*$ 7&$$$*&&&$ &&&7$&&$77 $7$$7$&&&$ 77$77&$$&$ *&$$&$7$7$ &777$7&&7* *&77*77&*$ $77*$$&&77 7&$&$$&&77 &77&&7&$$7 *&$$$7*$7* *$$$$777*$ 7&$7&&$*$7 &*$$&&77&7 &$7&&*77*& $$**7&77** $*$$&7$*7& $*$***$7$& 77&7*$7*7$ $$**$$&7$$ 77&&$*$*77 &7$&7$&&7$ &&$*$*$7*7 77*7&$$&$* 7$$7**$7$7 $$7&77**$* 7&$*$*$$*$ 7*$$*7$*7* *7$$$7*$7* 77*$7&77&& &&&77***&$ $$$$$$&&7* $$*$&777*7 *&**$7&$$& $**$7**&&& 7$*$$$*7*$ $777*777&7 7*&&$$&77& $7&$*7**$7 &*$&&77$7$ 777**&7$7$ $*&$*&*$** $&&$*$$*&$ *77&*7*&7& 7*$$7*7777 7&$&7$&77* $&77$7*$$* *&7&7*7*$$ &&7**$7$*7 $7&$&7*$7& &7*7*&7&$* **$**&&$7* *$**&$&$*$ 7$&$*$$&77 7**$&$*$&* &&$7&7&$*7 7*&77$77*$ *&&$&$7&&* &&7&**$$&7 &7*&&$7*&$ &&7*7*777& &77&&$&$*$ *7&&*&7&$7 *777$$$*$7 &$*$7*&$$& $**$7*7*$7 $$7**7*&7* $$*777&&77 &$$$77&7&& $*7$$&&&$7 *7**&$*&&$ $&$&7&7*&& &&$&77*$&& $7&&&&*&$* 7**7*$&$*7 *$&77*&$*& &*$&7&777* &$*7*$$7$* $7**&$&$$& $&$*7$**&& 7&$*$**$*& 7&&$**$7$& 7&&77**$7& $$*&&&$&&$ 7&77&&&$77 *$$$7**$7& &$77$$7$*& &$$7$$77&$ **7*7$$$&$ $$&**&$*$7 &$&$*$&&7& *77*$&&$*$ *7$7$&$$$7 &$$7*&$&$7 7*7777*7** 7$$&$*&$*$ 7$$7&*&7$7 $77&77$7&7 *7**$77&7* **$7$$*$*& 77&$*$*777 $7$&7$&$*$ $$&$***$$$ 77*$&7&$*$ 77*7$777** &&$77***$7 *7**7&$&77 *&77**&&$* *7&&*$*7&$ 7$&$77**7* ***$&7*&7$ &$7&*7*7&& **$7&7&*$* $7*&&$&&&7 *&7*&7&7** 7$&7**$*7* **&**&$&&$ 7$7&$7$**$ *$&$$&&&7$ $&$*&$*7*$ &7$7&&**&$ &&$$*$*&&* 7&&7&$&$** &&$7*$&&$7 *$$*77*7&7 *7*777&7*7 &7*7*&$*$$ &77***&77* 77$7&$*7** 7*&7$$$*$* **&&&77*&& 77*7&&$&$& &$7&$&7**$ *$777*&7*$ *$*&&&77*$ $**$&&$*$$ $$&7*&77$7 7&&&$&*&77 *$7$7&7*7& 7&&$*&*$$* *&&$&7*7$7 &$7$7$&7$7 *$$&*$***& *$77&$*7$$ 777&$*&$77 $$7***$$$& 7777**&7&$ $$7**$*$7& $$7*$77&$$ &$&***&&$7 7&7&&7*$*& $*7*$&**&& $*$$&&7**7 &$&&**$*** *$&$$7**** 7$*7$*$**7 &7**&$**&& 7*7*$&77&$ $*&$$&7*7$ &$777$$&&& 7**$7*7*$7 *&7**&$77$ *$*&$$7**$ &77*7&&&$7 *$&&$*$**$ &7&7*$7&$& 7**&$7**&7 7&7**7$*&$ 77*7$*&777 7$$7$7$*$7 777$$7&**7 **&$77$7*$ *&$7&$*$$& $*$7$&7*$$ *$7$$$**$$ *$$&&$$$$* &&$$*77$$$ *&7*$***&$ &$$*7*&7*&$7**$$$**& $$7$7&7&7* *7**$$$$$$ 77&*7&7$&$ 7&*$&&7&&* 777*7$&$77 &&$7&$&$&& &$*&$$7$*& 7*7$&$77*7 $*7&$*&$$& &$7777$&77 7*7*7*7777 77&$&*$&7* $$&$&&$*&7 *&7$7&$$*& $$*&77$7$7 &$7*7$$$77 $7$7*$$77$ **$*$7*777 7**7$$77$7 77&$7$7$77 *77*777$77 *$*$$$$**7 7*7$**$7*7 *7&$&$$*$* $&7777*$&$ $77&7*$**$ $&&77*7*7& &$*77*77$& $$$*777$$* &777*$$&&7 $$&&7*&$7& &&$777&&$* &&7&7777& $ $*&7*$*$$$ $$$$$$$$$$ $$$$$ Ef +XPDQ /<67 SHSWLGH 3.5$9)<$(5 <(7:(''463 3<+<17+<67 $7<7/6:/95,(3)77))/1 $1'*.)'+3' 57)669$56: 57645'76'9 .(/3()<
PAGE 72

&$*$**$*77 **$&&7*$&7 &7&&&$**$$ $&77&$**&$ 7&7*7&$$$* &&$$$$**7* &777*$$&&& *$$*$*$*& $ *7*7777$&* &$*$*&*&7$ 7*$*$&$7** *$**$**$7& $$$*&&&$&& &77&&$&7$& $$&$&$&$77 $&7&$$&**& *$&77&&&&& &777&$7**& 77*77&**$7 7*$*&&$77& $&$$&&77&7 7&&7&$$7*& $$$7*$7*** $$$777*$&& $7&&$*$&&* $$&&77&7&$ 7&&$77*&$$ **7&$7**$* $$&&$*7&$* $*$*$7$&$7 &&*$7*7&$$ **$$&7$$77 &&$*$*77&7 $77$&*7$&& $*$*$7*777 *7&$$&$*&$ $7***7$&&$ 7&77**$*7* $***$**$&* $$*7**7**7 7$$7*$7*7* *$&&7*&&&& &&7***&&$$ *$$*&&$*$$ *$&777*7*& **$7&$$&$* *$7**&&&7* *$$$*7*$$7 77*777&77* &&$$&7&&$7 &$$7**$77* $&&77$7$77 7**&7$&$$$ &$*&*$***& &$*$**&$*7 &&*7*&7&7& $$7*7777&& $&7$&77*$& &7$&*$$**& 7&7*7$$$&& 7**$&$*&$7 &$&$*$&&&7 *7*&7&&*** $**&&$7**7 7*&$&$*$7$ &$*$$&777* &&&$*$&*&& $7&7&$*77* &7&$77*$*& &*&$7&&*&& 7$**$&77&$ *&&$7*&$7& 7*7*77&&&7 7&&$&$*$*& &&$&7&$7*7 7&$$$*$7&$ *$7*&$*&$* *$7*7*$7&$ 7**7*&7*$$ *777&&$7&& $$77&7&&7* 7*$&7&$7*7 **&7*&&$$& $&&&7*&&&& $&&7*$&&$7 &&&7*&$*7* *7*$&$*7*$ &&7*&$*&&* $&7*777*&$ *7*$$&$*$7 **&$&$$&$& $*7&**&&7& $*$**$*&&& &&**$7$&7& &77**$7&$$ *&$&$&&$7& 77&&&$77*$ *$7**$&&&$ 77$$7&*&$$ $7$$&7&7** 7*7*$$&$$* &**&$*$7&$ &$*$&&77*7 $*$&&$*$*& $7&&$*$7&$ $7*&&&$&7* &77&*7**7& $&$*&7*$7$ $7&*&7$&$7 &&7&$7&7*7 ***7777*** $7$$$$*777 &$*$*777$& 7&*$&$*$$$ &$***$$$&7 *$&$&$*$77 *7$777**&& $&7***$7*7 7*7&$&$7*& &7**&&$**7 &**$*7&&7$ &$77**7**$ *$&7*&7$&$ 7$*7*7&7** $7&7&***$& *&&$&&77*& 77&7&7**7$ &7**$*7*** &*7&$&&$&$ 7&$7&**$*$ &$$&&&&$$7 $*&$*7*$&7 $7&&7*&*&& &$*$*&7*7& &7&$&$**&& $7*$&&$7*$ $*77*7&7*7 *7&7&&*7&7 *7*&$*$$&7 &**$&7&*77 $7&$*7**7* &7$$$*$*** &&&77*&&7& *77& $7$&&$ 7&$&7**$$$ 7&7*&7*$$* *&&&7**$$* *$&&$*$$$$ &7*&77$777 &&$&*&&7$$ 777&**7$7& &$*7*$$**& &$&7*&$7&$ 7$7$77$7*$ *&*$**$&** 777$*&$$&7 7&$*&$7&$$ 7***$$$&77 77**&7&$$$ 7**$*$7&$$ 7*$77&&$&7 $***&7$77& 7&&7*$*&$* &*$7**$&$* $$&&7**7*$ &7**$****$ &$$7**7*7* *7**$**7&7 **&$**&&7* 7*$&777$$* &$*&7*7$&$ 777$&&&$** $7*7*$7*&7 **&$77$*$* &*$7**$777 $7&&&$7*$& &$$$**$&7& 7*$7&$&7** &$7**&77&& **&$*&$77* 7$&7777$$7 $7$*$7777$ $7&**7**& $ 77$7*$*& $7 &$*$$& $*7$ &7*$$*$*$$ *&$*&$*$$* &&$&$77&$$ *7*$*$*&$& $$*7*&77&7 *7**$$$**& $*7$7&7&7* *7***$&*&7 **7&&$&$7& **&&7&7*&7 7*7$&$7&&$ 7&&&$&&&$* &$*7&*&&*$ $&$7&$7$*7 &***$*&&$7 77&$&&&7*7 7777&&$**$ &7*$$&$&&$ *&7*&7*7&$ $*&$$*&77$ 7$7&$7*7$$ $77$7&7*$$ 77$**$*&&* 7777**7$$7 7$777&$7$7 $7&*&&*777 $77*$*$$$$ **77*7$**$ $*&&7&$&$$ *$*$&7777* $&$$77&7*$ **$$&&77*7 *&&&$*77*7 7$&$$$*777 $$*&777*$$ &&7$$&77*& $7&&&$777& &$*&&7&*** &77&$&7&*7 *&& Gf 0RXVH /\VW SHSWLGH 65$157690) 1)3'4$79.. :<6/359*9 *76<*/34$5 5,6/$7354/ <.6610745: 455(,61)(< /0)/17$*5 7<1'/14<39 )3:9/71<(6 ((/'/7/3*1 )5+/6.3.*$ /13.5$9)<$ (5<(7:(('4 633)+<17+< 67$763/6:/ 95,(3)77)) /1$1'*.)'+ 3'57)66,$5 6:57645'76 '9.(/,3()< <93(0)9161 *<+/*95('( :91'9'/33 :$..3(')95 ,150$/(6() 96&4/+4:,' /,)*<.45*3 ($95$/19)+
PAGE 73

D E EEEH 666 '08 /\VW '080 ’ ’ ‘ ’ ‘ RI PLFH cILIL (FR9G F R '0LW /\VW '08 aF0 s F0 s F0 aF0 )LJXUH *HQHWLF PDSSLQJ RI /\VW RQ PRXVH FKURPRVRPH Df $XWRUDGLRJUDSK RI D 6RXWKHUQ EORW RI PRXVH JHQRPLF '1$ GLJHVWHG ZLWK eFR5, DQG K\EULGL]HG WR D /\VW SUREH 0ROHFXODU VL]H VWDQGDUGV LQ NLOREDVHVf DUH VKRZQ WR WKH OHIW 7KH DUURZKHDG LQGLFDWHV WKH 5)/3 ZKLFK ZDV XVHG IRU WKH JHQHWLF PDSSLQJ DQG ZDV SUHVHQW LQ '1ƒ IURP &%/- [ &$67(L-f )L EHf EXW QRW LQ KRPR]\JRXV &7t/,LEA EEf '1$ Ef +DSORW\SH DQDO\VLV RI /\VW '08 DQG '08 RQ PRXVH FKURPRVRPH LQ >&%/-b ; &%/-EJ [ &$67(f )L@ LQWHUVXEVSHFLILF EDFNFURVV PLFH %ODFN VTXDUHV UHSUHVHQW WKH KRPR]\JRXV &%/SDWWHUQ DQG ZKLWH VTXDUHV WKH )M SDWWHUQ 7KH QXPEHU RI PLFH RI HDFK KDSORW\SH LV LQGLFDWHG Ff &RPSRVLWH JHQHWLF PDS RI SDUW RI PRXVH FKURPRVRPH VKRZLQJ WKH UHODWLYH SRVLWLRQ RI WKH /\VW ORFXV 0DUNHU ORFDWLRQV DUH H[SUHVVHG DV JHQHWLF GLVWDQFH IURP WKH FHQWURPHUH LQ FHQWLPRUJDQVf DQG LQWHUPDUNHU GLVWDQFHV s VWDQGDUG HUURUf DUH VKRZQ

PAGE 74

f§ f§ f§ F ( &' &' 2 f§} &f ( [ )LJXUH 0DSSLQJ RI /<67 RQ KXPDQ FKURPRVRPH E\ KXPDQURGHQW VRPDWLF FHOO K\EULGV $Q eFR5, PRQRFKURPRVRPDO VRPDWLF FHOO K\EULG 6RXWKHUQ EORW ZDV K\EULGL]HG WR >D3@G&73ODEHOHG /<67 SUREH /DQH FRQWDLQV FRQWURO KXPDQ '1$ ODQH FRQWURO PRXVH '1$ ODQH KXPDQ &KU RQ KDPVWHU EDFNJURXQG ODQHV WR KXPDQ &KU DQG UHVSHFWLYHO\ RQ PRXVH EDFNJURXQG ODQH FRQWURO KDPVWHU '1$ 0ROHFXODU VL]H VWDQGDUGV LQ NLOREDVHVf DUH VKRZQ WR WKH OHIW RI WKH JHO

PAGE 75

([SUHVVLRQ $QDO\VLV ,Q RUGHU WR GHWHUPLQH WKH VL]H RI WKH /<67 WUDQVFULSWVf DQG WKHLU DEXQGDQFH LQ GLIIHUHQW RUJDQV H[SUHVVLRQ DQDO\VLV ZDV SHUIRUPHG XVLQJ QRUWKHUQ EORWV IURP YDULRXV KXPDQ DQG PRXVH WLVVXHV 7UDQVFULSW VL]H LQ PRXVH DQG KXPDQ +\EULGL]DWLRQ RI D /<67 SUREH WR QRUWKHUQ EORWV RI PRXVH DQG KXPDQ WLVVXHV )LJ f UHYHDOHG WKDW WKH ODUJHVW EDQG ZDV NE YHU\ VLPLODU WR WKH VL]H RI WKH ODUJHVW LVRIRUP /<67Of RI WKH &KHGLDN+LJDVKL V\QGURPH JHQH %DUERVD HW DO f /RZ OHYHOV RI DGGLWLRQDO WUDQVFULSWV RI NE DQG NE ZHUH YLVLEOH LQ PRXVH EUDLQ 51$ 7UDQVFULSW DEXQGDQFH LQ PRXVH +\EULGL]DWLRQ WR SRO\$f QRUWKHUQ EORWV IURP PRXVH WLVVXHV VKRZHG WKDW /\VW ZDV DEXQGDQWO\ H[SUHVVHG RQO\ LQ EUDLQ 0RGHUDWH H[SUHVVLRQ ZDV REVHUYHG LQ NLGQH\ DQG ZHDN H[SUHVVLRQ LQ KHDUW OXQJ VNHOHWDO PXVFOH DQG WHVWLV 7KH JHQH ZDV QRW H[SUHVVHG LQ VSOHHQ DQG OLYHU )LJ Df 7UDQVFULSW DEXQGDQFH LQ KXPDQ ,Q QRUWKHUQ EORWV RI VHOHFWHG KXPDQ WXPRU FHOO OLQHV )LJ Ef /<67 ZDV PRGHUDWHO\ H[SUHVVHG LQ PHODQRPD DQG FRORUHFWDO DGHQRFDUFLQRPD ZHDNO\ H[SUHVVHG LQ +H/D O\PSKREODVWLF OHXNDHPLD DQG %XUNLWWfV O\PSKRPD FHOOV DQG QRW H[SUHVVHG LQ SURP\HORF\WLF DQG P\HORJHQRXV OHXNDHPLD RU LQ OXQJ FDUFLQRPD OLQHV ,Q QRUPDO KXPDQ WLVVXHV /<67 ZDV ZHDNO\ H[SUHVVHG LQ VSOHHQ O\PSK QRGH WK\PXV DQG DSSHQGL[ DQG QRW H[SUHVVHG LQ SHULSKHUDO EORRG OHXNRF\WH ERQH PDUURZ DQG IHWDO OLYHU )LJ Ff 7KH UHODWLYH DEXQGDQFH RI /<67 DQG /<67 P51$ LQ KXPDQ WLVVXHV ZDV FRPSDUHG E\ VHTXHQWLDO K\EULGL]DWLRQ RI FRUUHVSRQGLQJ JHQHVSHFLILF SUREHV WR D

PAGE 76

SRO\$f 51$ GRW EORW )LJ f 7KH TXDQWLW\ RI SRO\$f 51$ ORDGHG RQ WKH EORW ZDV QRUPDOL]HG WR KRXVHNHHSLQJ JHQHV SKRVSKROLSDVH ULERVRPDO SURWHLQ 6 WXEXOLQ D KLJKO\ EDVLF N'D SURWHLQ JO\FHUDOGHK\GHSKRVSKDWH GHK\GURJHQDVH K\SR[DQWKLQH JXDQLQH SKRVSKRULERVLO WUDQVIHUDVH %DFWLQ DQG XELTXLWLQf :KHQ D SUREH VSHFLILF IRU WKH ODUJHVW P51$ LVRIRUP RI /<67 ZDV K\EULGL]HG WR WKH EORW WUDQVFULSWV ZHUH PRVW DEXQGDQW LQ LPPXQH V\VWHP RUJDQV DGXOW DQG IHWDO WK\PXV SHULSKHUDO EORRG OHXNRF\WHV ERQH PDUURZf DQG LQ VHYHUDO UHJLRQV RI DGXOW EUDLQ )LJ f 7KHUH ZDV PRGHUDWH WR ORZ UHODWLYH /<67 H[SUHVVLRQ LQ PRVW RI WKH RWKHU WLVVXHV WHVWHG ,QWHUHVWLQJO\ QR /<67 H[SUHVVLRQ ZDV GHWHFWHG LQ IHWDO EUDLQ DV ZHOO DV LQ VDOLYDU\ JODQG NLGQH\ OXQJ DQG IHWDO KHDUW )ROORZLQJ K\EULGL]DWLRQ RI WKH VDPH EORW ZLWK D /<67VSHFLILF SUREH D GLIIHUHQW SDWWHUQ RI H[SUHVVLRQ ZDV REVHUYHG )LJ f /<67 WUDQVFULSWV ZHUH PRVW DEXQGDQW LQ ZKROH EUDLQ DGXOW DQG IHWDOf DQG LQ VSHFLILF DGXOW EUDLQ UHJLRQV DV ZHOO DV LQ NLGQH\ ZKLOH WKHUH ZDV ORZ WR QHJOLJLEOH /<67 H[SUHVVLRQ LQ WKH UHVW RI WKH WLVVXHV

PAGE 77

D E F 0RXVH +XPDQ +XPDQ )LJXUH 1RUWKHUQ EORW DQDO\VLV RI PRXVH DQG KXPDQ /<67 1RUWKHUQ EORWV RI SJ SRO\$f 51$ IURP YDULRXV PRXVH WLVVXHV Df KXPDQ FDQFHU FHOO OLQHV Ef RU KXPDQ O\PSKRLG WLVVXHV Ff K\EULGL]HG WR D >FW3@G&73 ODEHOHG /<67 SUREH /DQHV Df KHDUW EUDLQ VSOHHQ OXQJ OLYHU PXVFOH NLGQH\ WHVWLV Ef SURP\HORF\WLF OHXNHPLD +H/D P\HORJHQRXV OHXNHPLD O\PSKREODVWLF OHXNHPLD %XUNLWWfV O\PSKRPD DGHQRFDUFLQRPD OXQJ FDUFLQRPD PHODQRPD Ff VSOHHQ O\PSK QRGH WK\PXV DSSHQGL[ OHXNRF\WH ERQH PDUURZ IHWDO OLYHU 0ROHFXODU VL]H VWDQGDUGV LQ NEf DUH VKRZQ WR WKH OHIW

PAGE 78

!‘ 8L 8+ = & Xc 8 X = ,6 HcJH )LJXUH &RPSDULVRQ RI WKH UHODWLYH DEXQGDQFH RI /<67 DQG /<67 WUDQVFULSWV LQ KXPDQ WLVVXHV DIWHU QRUPDOL]DWLRQ 9DULDWLRQ RI WKH UHODWLYH P51$ DEXQGDQFH DPRQJ WLVVXHV ZDV DVVHVVHG E\ SKRVSKRULPDJLQJ GRW TXDQWLWDWLRQ VXEWUDFWLRQ RI EDFNJURXQG DQG FDOFXODWLRQ RI WKH LQWHQVLW\ SHUFHQWDJH IRU HDFK WLVVXH 7KH UHODWLYH P51$ DEXQGDQFH EHWZHHQ QRUPDOL]HG WLVVXHV IRU HDFK SUREH ZDV H[SUHVVHG DV WKH SHUFHQWDJH RI WKH WRWDO K\EULGL]DWLRQ VLJQDO REWDLQHG IRU HDFK WLVVXH ZLWK WKDW SUREH 7KH DYHUDJH SHUFHQWDJH LQWHQVLW\ IRU KRXVHNHHSLQJ JHQHV LQ DOO WLVVXHV ZDV ab 1R K\EULGL]DWLRQ ZDV HYLGHQW WR FRQWURO GRWV FRQWDLQLQJ \HDVW WRWDO 51$ \HDVW W51$ ( FROL U51$ ( FROL '1$ SRO\ U$f KXPDQ &WO '1$ DQG KXPDQ '1$ ([SRVXUH WLPH IRU SKRVSKRULPDJLQJ ZDV K

PAGE 79

,GHQWLILFDWLRQ RI 3URWHLQV WKDW ,QWHUDFW ZLWK WKH &+6 3URWHLQ DQG ZLWK /<67 8VLQJ D
PAGE 80

LQWHUDFWLQJ SURWHLQV ,3Vf
PAGE 81

ZHUH LGHQWLILHG DV (67 VHTXHQFHV HOHYHQ QRYHO DQG WZR NQRZQ (67Vf ,GHQWLILHG VHTXHQFHV LQWHUDFWLQJ ZLWK WKH /<67 IUDJPHQW ZHUH LGHQWLFDO WR SURWHLQ VHTXHQFH VWDUWLQJ DW QXFOHRWLGHV DQG LH UHSUHVHQWLQJ WKH VDPH GRPDLQ RI SURWHLQ LGHQWLILHG LQ WKH IRUZDUG VFUHHQ $33(1',; 6HTXHQFH f WR % SURWHLQ VHTXHQFH VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f WR FDOPRGXOLQ VHTXHQFH VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f WR HVWURJHQ UHFHSWRU UHODWHG SURWHLQ VWDUWLQJ DW QXFOHRWLGH DV VKRZQ LQ $33(1',; 6HTXHQFH f DQG WR (67 FJGO VHTXHQFH ,3 $33(1',; 6HTXHQFH f VWDUWLQJ DW QXFOHRWLGH 7KH VHTXHQFH LGHQWLFDO WR SURWHLQ VWDUWLQJ DW QXFOHRWLGH DOVR LQWHUDFWHG ZLWK WKH /<67 IUDJPHQW /<67 IUDJPHQW ZDV IRXQG WR LQWHUDFW ZLWK VHTXHQFHV LGHQWLFDO WR LPSRUWLQ 3VXEXQLW VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f LPRJHQ VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f '*6, D JHQH ZLWK XQNQRZQ IXQFWLRQ LVRODWHG IURP WKH 'L*HRUJH V\QGURPH FULWLFDO UHJLRQ VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f (67 FJI ,3 VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f (67 $$ ,3 VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f (67 FJD ,3 VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f (67 FJF ,3 VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f (67 FJJ ,3 VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f (67 FJK ,3 VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f (67 FJDE ,3 VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f DQG (67 FJK ,3 VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f 7KH VHTXHQFH LGHQWLFDO WR (67 FJJ ,3 VWDUWLQJ DW QXFOHRWLGH f LQWHUDFWHG DOVR ZLWK /<67 IUDJPHQW

PAGE 82

,GHQWLILHG VHTXHQFHV LQWHUDFWLQJ ZLWK /<67 IUDJPHQW ZHUH LGHQWLFDO WR DWURSKLQ VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f HPEU\RQLF I\Q VXEVWUDWH (IV VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f VLPLODU WR (67 FJFO ,3 VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f LGHQWLFDO WR (67 .,$$ ,3 VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f DQG VLPLODU WR (67 FJHOE ,3 VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f 7KH VHTXHQFH LGHQWLFDO WR (67 FJFO ,3f LQWHUDFWHG DOVR ZLWK /<67 IUDJPHQW 7KH VHTXHQFHV LGHQWLFDO WR FDVHLQ NLQDVH ,, VXEXQLW VWDUWLQJ DW QXFOHRWLGHV DQG f LQWHUDFWHG QRW RQO\ ZLWK WKH /<67 IUDJPHQW LQ WKH IRUZDUG VFUHHQ EXW DOVR ZLWK /<67 IUDJPHQW LQ WKH UHYHUVH VFUHHQ ,Q VXPPDU\ HOHYHQ /<67LQWHUDFWLQJ VHTXHQFHV ZHUH IRXQG WR EH LGHQWLFDO WR SXEOLVKHG VHTXHQFHV HQFRGLQJ SURWHLQV % +UV FDOPRGXOLQ FDVHLQ NLQDVH ,, VXEXQLW (IV LPSRUWLQ 3VXEXQLW HVWURJHQ UHFHSWRUUHODWHG SURWHLQ LPRJHQ DWURSKLQ DQG '*6,f WZR /<67LQWHUDFWLQJ VHTXHQFHV ZHUH IRXQG WR EH KLJKO\ KRPRORJRXV RU LGHQWLFDO WR SXEOLVKHG (67 VHTXHQFHV $$ DQG .,$$ HQFRGLQJ IRU ,3 DQG ,3 UHVSHFWLYHO\f DQG HOHYHQ /<67LQWHUDFWLQJ VHTXHQFHV ZHUH IRXQG WR EH QRYHO (67V FJI FJFO FJD FJF FJJ FJGO FJK FJDE FJGO FJKE DQG FJHOE HQFRGLQJ IRU ,3 ,3 ,3 ,3 ,3 ,3 ,3 ,3 ,3 ,3 DQG ,3 UHVSHFWLYHO\f ,Q WKH UHYHUVH VFUHHQ VHDUFKLQJ IRU /<67,3V RQH LQWHUDFWLQJ VHTXHQFH ZDV IRXQG WR EH LGHQWLFDO WR WKH SXEOLVKHG VHTXHQFH HQFRGLQJ KXPDQ EUDLQ IDFWRU +%)*

PAGE 83

VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f DQG RQH WR WKH VDPH UHJLRQ VWDUWLQJ DW QXFOHRWLGH $33(1',; 6HTXHQFH f RI SURWHLQ LGHQWLILHG WR LQWHUDFW ZLWK /<67 7KH QXFOHLF DFLG VHTXHQFHV DQG FRUUHVSRQGLQJ DPLQR DFLG VHTXHQFHV RI DOO /<67 DQG /<67LQWHUDFWLQJ SURWHLQV DUH VKRZQ LQ $33(1',; 6HTXHQFHV $ VXPPDU\ RI WKH GHVFULEHG SURWHLQSURWHLQ LQWHUDFWLRQV LV VKRZQ LQ 7DEOH 7DEOH 3URWHLQ LQWHUDFWLRQV LGHQWLILHG E\ IRUZDUG DQG UHYHUVH \HDVW WZRK\EULG VFUHHQV XVLQJ IUDJPHQWV RI /<67 DQG /<67 DV EDLWV %$,7 )5$*0(17 $1' 326,7,21 ESr ,17(5$&7,1* 3527(,16 ,'(17,),(' ,1 )25:$5' 6&5((16 5(9(56( 6&5((16 /<67 SURWHLQ SURWHLQ % &DOPRGXOLQ ,3 (VWURJHQ UHFHSWRUUHODWHG SURWHLQ /<67 &DVHLQ NLQDVH ,, SVXEXQLW /<67 SURWHLQ /<67 +HSDWRF\WH JURZWK IDFWRU UHJXODWHG W\URVLQH NLQDVH VXEVWUDWH +UVf ,PSRUWLQ 3VXEXQLW ,PRJHQ '*6, 'L*HRUJH V\QGURPHf ,3 /<67 ,3 ,3 /<67 $WURSKLQ (PEU\RQLF )\Q VXEVWUDWH (IVf ,3 /<67 &DVHLQ NLQDVH ,, 3VXEXQLW ,3 /<67 SURWHLQ +XPDQ EUDLQ IDFWRU +%)*f r $FFRUGLQJ WR *HQ%DQN DFFHVVLRQ QXPEHU 8 IRU /<67 IRU /<67 IUDJPHQW SRVLWLRQV DUH UHODWLYH WR WKH EHJLQQLQJ RI WKH NQRZQ VHTXHQFH

PAGE 84

7KH SRWHQWLDO IXQFWLRQDO VLJQLILFDQFH RI WKH LQWHUDFWLRQV EHWZHHQ /<67/<67 DQG WKH SUHYLRXVO\ SXEOLVKHG SURWHLQV ZLOO EH GLVFXVVHG LQ WKH QH[W FKDSWHU $ VKRUW GHVFULSWLRQ RI DOO (67V GHWHFWHG DV /<67,3V DQG WKHLU VLPLODULW\ WR NQRZQ VHTXHQFHV IROORZV ,3 (67 FJI $33(1',; 6HTXHQFH 2QH LGHQWLILHG VHTXHQFH FJI QXFOHRWLGHVf LQWHUDFWLQJ ZLWK /<67 ZDV b LGHQWLFDO WR QXFOHRWLGHV b WR QXFOHRWLGHV DQG b WR QXFOHRWLGHV RI WKH KXPDQ (67 $$ 7KLV (67 RI QXFOHRWLGHV ZDV LQLWLDOO\ REWDLQHG IURP D KXPDQ 6RDUHV WRWDO IHWXV ZHHNf OLEUDU\ +LOOLHU HW DO f +RZHYHU (67 $$ FRXOG EH QRW EH XVHG IRU DQ H[WHQVLRQ RI (67 FJI LQ HLWKHU GLUHFWLRQ (67 FJI VKRZHG b QXFOHRWLGH LGHQWLW\ WR PRXVH 7FRPSOH[ SURWHLQ 7FS JHQHV *HQ%DQN DFFHVVLRQ 1R 0 0 0 0f $Q RSHQ UHDGLQJ IUDPH FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR 7KH UHVXOWLQJ DPLQR DFLGV FRUUHVSRQG WR D FWHUPLQDO RU FRUH UHJLRQ RI D QRYHO SURWHLQ ZKLFK ZDV GHVLJQDWHG ,3 $PLQR DFLGV RI ,3 VKRZ b KRPRORJ\ WR WKH FWHUPLQDO UHJLRQ DPLQR DFLGV f RI PRXVH 7FS SURWHLQ *HQ%DQN DFFHVVLRQ 1R ;f 7KHUHIRUH ,3 UHSUHVHQWV D QRYHO SURWHLQ ZLWK KRPRORJ\ WR PRXVH 7FS SURWHLQ ,QWHUHVWLQJO\ DQRWKHU /<67LQWHUDFWDQW ,3 VHH ODWHU LQ WKLV FKDSWHUf VKRZV KRPRORJ\ WR WKH DPLQRWHUPLQDO UHJLRQ RI 7FS ,Q DGGLWLRQ /<67LQWHUDFWDQW ,3 KDV D UHJLRQ KRPRORJRXV WR $73ELQGLQJ SURWHLQV DQG FKDSHURQLQ 7FS 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH

PAGE 85

73 7(67 $$ $33(1',; 6HTXHQFH W 7KUHH LGHQWLFDO VHTXHQFHV FJD FJG FJFf LQWHUDFWLQJ ZLWK /<67 ZHUH b LGHQWLFDO WR QXFOHRWLGHV RI WKH KXPDQ (67 $$2 7KLV (67 RI QXFOHRWLGHV ZDV LQLWLDOO\ REWDLQHG IURP D KXPDQ 6RDUHV IHWDO KHDUW ZHHNVf OLEUDU\ +LOOLHU HW DO f (67 $$2 FRXOG QRW EH IXUWKHU H[WHQGHG E\ GDWDEDVH VHDUFKHV DQG ZDV XVHG IRU IXUWKHU DQDO\VLV 7KH f HQG RI WKLV (67 ZDV VLPLODU WR WKH KXPDQ 6 ULERVRPDO SURWHLQ / $Q RSHQ UHDGLQJ IUDPH FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR RI (67 $$ 7KH UHVXOWLQJ DPLQR DFLGV FRUUHVSRQG WR D FWHUPLQDO RU FRUH UHJLRQ RI D QRYHO SURWHLQ ZKLFK ZDV FDOOHG ,3 $PLQR DFLGV RI ,3 VKRZ b KRPRORJ\ WR DPLQR DFLGV RI EDFWHULDO ULERVRPDO SURWHLQ / *HQ%DQN DFFHVVLRQ 1R 6 0 / $( 'f 7KHUHIRUH ,3 UHSUHVHQWV D QRYHO KXPDQ SURWHLQ ZLWK KRPRORJ\ WR ULERVRPDO SURWHLQ /, 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH ,3 (67 FJFO $33(1',; 6HTXHQFH W 7ZR LGHQWLFDO VHTXHQFHV FJFO DQG FJJOf LQWHUDFWLQJ ZLWK /<67 VKRZHG VLJQLILFDQW KRPRORJ\ WR SXEOLVKHG (67V $Q H[WHQGHG H[SUHVVHG VHTXHQFH RI QXFOHRWLGHV ZDV DVVHPEOHG IURP QXFOHRWLGHV WR RI KXPDQ IHWDO OXQJ (67 : +LOOLHU HW DO f QXFOHRWLGHV WR IURP FJFO FRUUHVSRQGLQJ WR QXFOHRWLGHV WR LQ WKH H[WHQGHG VHTXHQFHf QXFOHRWLGHV WR IURP KXPDQ HQGRWKHOLDO FHOO (67 $$ +LOOLHU HW DO f FRUUHVSRQGLQJ WR QXFOHRWLGHV WR

PAGE 86

LQ WKH H[WHQGHG VHTXHQFH QXFOHRWLGHV WR IURP KXPDQ IHWDO (67 $$ +LOOLHU HW DO f FRUUHVSRQGLQJ WR QXFOHRWLGHV WR LQ WKH H[WHQGHG VHTXHQFH DQG QXFOHRWLGHV WR IURP (67 1 IURP D KXPDQ PXOWLSOH VFOHURVLV OLEUDU\ +LOOLHU HW DO f FRUUHVSRQGLQJ WR QXFOHRWLGHV WR LQ WKH H[WHQGHG VHTXHQFH 7KH IUDJPHQW LQWHUDFWLQJ ZLWK /<67 VWDUWV DW QXFOHRWLGH 7KH H[WHQGHG VHTXHQFH RI QXFOHRWLGHV ZDV XVHG IRU VXEVHTXHQW DQDO\VLV 1XFOHRWLGHV WR RI WKH H[WHQGHG H[SUHVVHG VHTXHQFH VKRZHG b LGHQWLW\ WR QXFOHRWLGHV WR RI UDW 2OIO(%) DVVRFLDWHG =Q ILQJHU SURWHLQ 5RD] *HQ%DQN DFFHVVLRQ 1R 8f $Q RSHQ UHDGLQJ IUDPH FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR 7KHVH DPLQR DFLGV UHSUHVHQW D FRUH RU FWHUPLQDO UHJLRQ RI D QRYHO SURWHLQ ZKLFK ZDV GHVLJQDWHG ,3 $PLQR DFLGV WR RI ,3 VKRZ b KRPRORJ\ WR DPLQR DFLGV WR RI WKH UDW =Q ILQJHU SURWHLQ 5RD] :HDNHU KRPRORJLHV WR bf ZHUH VHHQ WR GLIIHUHQW ]LQFILQJHU SURWHLQV RI VHYHUDO VSHFLHV ,QWHUHVWLQJO\ FRQVHUYHG ]LQFILQJHU GRPDLQV H[LVW LQ RWKHU SURWHLQV HJ SURWHLQ NLQDVH & DQG +UV WKDW PD\ EH DVVRFLDWHG ZLWK /<67 VHH QH[W FKDSWHUf 7KHUHIRUH ,3 UHSUHVHQWV D QRYHO KXPDQ SURWHLQ ZLWK KRPRORJLHV WR UDW 2OI O(%) DVVRFLDWHG =Q ILQJHU SURWHLQ 5RD] 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH ,3 (67 &JD $33(1',; 6HTXHQFHA 2QH LGHQWLILHG SUH\ VHTXHQFH FJD QXFOHRWLGHVf LQWHUDFWLQJ ZLWK /<67 ZDV b LGHQWLFDO WR KXPDQ (67 $$ VWDUWLQJ DW QXFOHRWLGH 7KLV (67 RI QXFOHRWLGHV ZDV LQLWLDOO\ REWDLQHG IURP D KXPDQ 6RDUHV IHWDO KHDUW ZHHNVf

PAGE 87

OLEUDU\ +LOOLHU HW DO f (67 $$ FRXOG EH H[WHQGHG LQ WKH f GLUHFWLRQ ZLWK QXFOHRWLGHV WR RI FORQH FJD UHVXOWLQJ LQ D VHTXHQFH RI QXFOHRWLGHV $Q RSHQ UHDGLQJ IUDPH FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR 7KHVH DPLQR DFLGV FRUUHVSRQG WR D FDUER[\WHUPLQDO SUROLQHULFK UHJLRQ RI D QRYHO SURWHLQ ZKLFK ZDV FDOOHG ,3 7KHUHIRUH ,3 UHSUHVHQWV D QRYHO SUROLQHULFK SURWHLQ ZLWKRXW KRPRORJ\ WR NQRZQ SURWHLQV 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH ,3 7(67 FJF $33(1',; 6HTXHQFH 2QH LGHQWLILHG SUH\ VHTXHQFH FJF QXFOHRWLGHVf LQWHUDFWLQJ ZLWK /<67 ZDV b LGHQWLFDO WR KXPDQ F'1$ FORQH $$ VWDUWLQJ DW QXFOHRWLGH 7KLV (67 RI QXFOHRWLGHV ZDV LQLWLDOO\ REWDLQHG IURP D KXPDQ 6RDUHV WRWDO IHWXV ZHHNf OLEUDU\ +LOOLHU HW DO f (67 $$ ZDV H[WHQGHG ZLWK QXFOHRWLGHV WR RI FORQH F UHVXOWLQJ LQ D VHTXHQFH RI QXFOHRWLGHV 7KLV VHTXHQFH FRXOG QRW EH H[WHQGHG IXUWKHU E\ GDWDEDVH VHDUFKHV DQG ZDV XVHG IRU VXEVHTXHQW DQDO\VLV $Q RSHQ UHDGLQJ IUDPH FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR 7KLV FRUUHVSRQGV WR D DPLQR DFLG SURWHLQ ZKLFK ZDV GHVLJQDWHG ,3 $PLQR DFLGV WR RI ,3 ZHUH IRXQG WR EH b KRPRORJRXV WR %DFLOOXV VXEWLOLV $73GHSHQGHQW SURWHDVH /D *HQ%DQN DFFHVVLRQ 1R ; DQG 3f WR %DFLOOXV VXEWLOLV $73GHSHQGHQW /RQ SURWHDVH *HQ%DQN DFFHVVLRQ 1R =f DQG WR %DFLOOXV VXEWLOLV HQGRSHSWLGDVH /D *HQ%DQN DFFHVVLRQ 1R f

PAGE 88

7KHUHIRUH ,3 UHSUHVHQWV D QRYHO SURWHLQ ZLWK KRPRORJ\ WR $73GHSHQGHQW SURWHDVHV /RQ/D 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH 73 7(67 FJJ $33(1',; 6HTXHQFH 7ZR LGHQWLILHG VHTXHQFHV FJJ QXFOHRWLGHV DQG WKH LGHQWLFDO FJIf LQWHUDFWLQJ ZLWK /<67 VKRZHG VLJQLILFDQW KRPRORJ\ WR SXEOLVKHG H[SUHVVHG VHTXHQFHV 1XFOHRWLGHV WR RI FJJ ZHUH b LGHQWLFDO WR QXFOHRWLGHV WR RI (67 $$ QXFOHRWLGHV +LOOLHU HW DO f 7KLV VHTXHQFH ZDV REWDLQHG IURP D KXPDQ WRWDO IHWXV ZHHNVf F'1$ OLEUDU\ $ ORQJHU VHTXHQFH ZDV DVVHPEOHG IURP QXFOHRWLGHV RI FJJ DQG QXFOHRWLGHV RI $$ DQG WKH H[WHQGHG VHTXHQFH RI QXFOHRWLGHV ZDV XVHG IRU VXEVHTXHQW DQDO\VLV 7KH H[WHQGHG VHTXHQFH VKRZHG KRPRORJ\ WR VHYHUDO YLUDO QRQVWUXFWXUDO SURWHLQV QXFOHRWLGHV WR VKRZHG b LGHQWLW\ WR QXFOHRWLGHV WR RI WKH QRQVWUXFWXUDO SURWHLQ 1V RI D ERUGHU GLVHDVH YLUXV VWUDLQ SHVWLYLUXV W\SH f *HQ%DQN DFFHVVLRQ 1R 8f QXFOHRWLGHV WR VKRZHG b LGHQWLW\ WR QXFOHRWLGHV WR RI SURWHLQV S S DQG SO RI WKH ERYLQH YLUDO GLDUUKHD YLUXV *HQ%DQN DFFHVVLRQ 1R =f 1XFOHRWLGHV WR VKRZHG b LGHQWLW\ WR QXFOHRWLGHV WR RI WKH KXPDQ JURZWK KRUPRQH DQG FKRULRQLF VRPDWRPDPPRWURSLQ JHQHV *HQ%DQN DFFHVVLRQ 1R -f $Q RSHQ UHDGLQJ IUDPH FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR 7KHVH DPLQR DFLGV UHSUHVHQW D FRUH RU FWHUPLQDO UHJLRQ RI D QRYHO SURWHLQ ZKLFK ZDV FDOOHG ,3

PAGE 89

$PLQR DFLGV WR RI ,3 VKRZ b KRPRORJ\ WR DPLQR DFLGV WR RI WKH YLUDO SHVWLYLUXV W\SH f QRQVWUXFWXUDO SURWHLQ 1V *HQ%DQN DFFHVVLRQ 1R 8f $PLQR DFLGV WR DUH b KRPRORJRXV WR DPLQR DFLGV WR RI WKH QRQVWUXFWXUDO SURWHLQ SL RI WKH ERYLQH YLUDO GLDUUKHD YLUXV *HQ%DQN DFFHVVLRQ 1R =f %/2&.6 DQDO\VLV VHDUFKLQJ IRU VLPLODULWLHV WR NQRZQ SURWHLQ IDPLOLHV VKRZHG VRPH KRPRORJ\ WR SURWHLQV DPLQR DFLGV WR LGHQWLWLHV DUH VKRZQ LQ FDSLWDO OHWWHUVf (IO 6.4' G/.HD PQWPP &65F4 *NK5U )HPGU (SNVD 5\F$( FQUOK S$( 7KHUHIRUH ,3 UHSUHVHQWV D QRYHO KXPDQ SURWHLQ ZLWK KRPRORJ\ WR YLUDO QRQVWUXFWXUDO SURWHLQV 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH ,3 (67 FJG $33(1',; 6HTXHQFH 2QH LGHQWLILHG VHTXHQFH FJGO QXFOHRWLGHVf LQWHUDFWLQJ ZLWK /<67 VKRZHG KRPRORJ\ WR SXEOLVKHG H[SUHVVHG VHTXHQFHV 1XFOHRWLGHV WR RI FJGO ZHUH b LGHQWLFDO WR QXFOHRWLGHV WR RI WKH H[SUHVVHG VHTXHQFH + QXFOHRWLGHV +LOOLHU HW DO f 7KLV VHTXHQFH ZDV REWDLQHG IURP D KXPDQ PDOH IHWDO ZHHNVf OLYHU DQG VSOHHQ F'1$ OLEUDU\ 7KH H[SUHVVHG VHTXHQFH FJGO FRXOG QRW EH IXUWKHU H[WHQGHG E\ GDWDEDVH VHDUFKHV DQG ZDV XVHG IRU IXUWKHU DQDO\VLV $Q RSHQ UHDGLQJ IUDPH FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR VWDUWLQJ ZLWK D PHWKLRQLQH VWDUW FRGRQ 7KHVH DPLQR DFLGV FRUUHVSRQG WR D QRYHO SURWHLQ ZLWK D FDOFXODWHG PROHFXODU ZHLJKW RI ZKLFK ZDV GHVLJQDWHG ,3 %RWK WKH QXFOHRWLGH DQG WKH DPLQR DFLG VHTXHQFH RI ,3 VKRZ VRPH KRPRORJ\ WR $OXGRPDLQV

PAGE 90

7KHUHIRUH ,3 UHSUHVHQWV D QRYHO KXPDQ SURWHLQ ZLWKRXW KRPRORJ\ WR NQRZQ SURWHLQV 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH ,3 (67 FJK $33(1',; 6HTXHQFH f 2QH LGHQWLILHG VHTXHQFH FJKf LQWHUDFWLQJ ZLWK /<67 VKRZHG VLJQLILFDQW KRPRORJ\ WR SXEOLVKHG H[SUHVVHG VHTXHQFHV 1XFOHRWLGHV WR RI FJK ZHUH b LGHQWLFDO WR QXFOHRWLGHV WR RI WKH H[SUHVVHG VHTXHQFH 7 7KLV VHTXHQFH ZDV REWDLQHG IURP D KXPDQ LQIDQW EUDLQ F'1$ OLEUDU\ $GDPV HW DO f 1XFOHRWLGHV WR RI FJK ZHUH DVVHPEOHG WR QXFOHRWLGHV WR RI 7 UHVXOWLQJ LQ DQ H[WHQGHG VHTXHQFH RI QXFOHRWLGHV 7KLV VHTXHQFH FRXOG QRW EH IXUWKHU H[WHQGHG E\ GDWDEDVH VHDUFKHV DQG ZDV XVHG IRU IXUWKHU DQDO\VLV 1XFOHRWLGHV WR RI WKH DVVHPEOHG H[SUHVVHG VHTXHQFH ZHUH b KRPRORJRXV WR WKH UDW P51$ IRU QRUELQ *HQ%DQN DFFHVVLRQ 1R $% 6KLQR]DNL HW DO f 1RUELQ LV D QRYHO EUDLQ JHQH LQGXFHG E\ WUHDWPHQW RI WHWUDHWK\ODPPRQLXP LQ UDW KLSSRFDPSDO VOLFH DQG DFFRPSDQLHG ZLWK QHXULWHRXWJURZWK LQ QHXUR D FHOOV 7KH QHXULWHRXWJURZWKUHODWHG SURWHLQ QRUELQ PD\ SOD\ D UROH LQ QHXUDO SODVWLFLW\ EHFDXVH RI WKH IRUPDWLRQ RI QHZ V\QDSVHV $Q RSHQ UHDGLQJ IUDPH FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR 7KHVH DPLQR DFLGV FRUUHVSRQG WR D FWHUPLQDO RU FRUH UHJLRQ RI D QRYHO SURWHLQ ZKLFK ZDV FDOOHG ,3 DQG ZKLFK ZDV b LGHQWLFDO WR DPLQR DFLGV WR RI UDW QRUELQ EUDLQ SURWHLQ DPLQR DFLGVf

PAGE 91

7KHUHIRUH ,3 UHSUHVHQWV D QRYHO SURWHLQ WKDW DSSHDUV WR EH WKH KXPDQ KRPRORJ RI WKH UDW EUDLQ JHQH QRUELQ 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH 73 7(67 . $ $ $33(1',; 6HTXHQFH 2QH LGHQWLILHG SUH\ VHTXHQFH RI QXFOHRWLGHV LQWHUDFWLQJ ZLWK /<67 ZDV b LGHQWLFDO WR KXPDQ P51$ FORQH IRU WKH .,$$ JHQH VWDUWLQJ DW QXFOHRWLGH 7KH P51$ IRU .,$$ ZDV LQLWLDOO\ REWDLQHG IURP D KXPDQ PDOH P\HOREODVW FHOO OLQH 1DJDVH HW DO f $Q RSHQ UHDGLQJ IUDPH ZLWKRXW D PHWKLRQLQH VWDUW FRGRQ FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR 7KLV VHTXHQFH UHSUHVHQWV WKH FDUER[\WHUPLQDO SDUW RI D SURWHLQ ZKLFK ZDV GHVLJQDWHG ,3 6LQFH QR KRPRORJLHV WR NQRZQ SURWHLQV FRXOG EH LGHQWLILHG LW DSSHDUV WKDW ,3 HQFRGHG E\ WKH KXPDQ P51$ IRU WKH .,$$ JHQH UHSUHVHQWV D QRYHO SURWHLQ WKDW LQWHUDFWV ZLWK /<67 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH ,3 (67 FJDE $33(1',; 6HTXHQFH 7ZR LGHQWLILHG VHTXHQFHV FJD DQG FJFf LQWHUDFWLQJ ZLWK /<67 VKRZHG QR VLJQLILFDQW KRPRORJ\ WR SXEOLVKHG VHTXHQFHV 1XFOHRWLGHV ZHUH b KRPRORJRXV WR QXFOHRWLGHV WR RI WKH KXPDQ LPPXQRGHILFLHQF\ YLUXV HQYHORSH SURWHLQ *HQ%DQN DFFHVVLRQ 1R /f 7KH LQWHUDFWLQJ VHTXHQFH RI QXFOHRWLGHV ZDV XVHG IRU IXUWKHU DQDO\VLV

PAGE 92

$Q RSHQ UHDGLQJ IUDPH FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR 7KHVH DPLQR DFLGV FRUUHVSRQG WR D FWHUPLQDO RU FRUH UHJLRQ RI D QRYHO SURWHLQ ZKLFK ZDV FDOOHG ,3 $PLQR DFLGV WR RI ,3 VKRZHG b KRPRORJ\ WR DPLQR DFLGV RI WKH KXPDQ 7FRPSOH[ SURWHLQ 7&3 *HQ%DQN DFFHVVLRQ 1R 8f 2WKHU KRPRORJLHV bf ZHUH IRXQG WR VHYHUDO F\WRVNHOHWDO SURWHLQV HJ P\RVLQ LVRIRUP NLQHVLQ SUHFXUVRU F\WRNHUDWLQ FDOGHVPRQ 18) WURSRP\RVLQ QHXURILODPHQW SURWHLQ NLQHVLQOLNH SURWHLQ .,) P\RVLQ OLNH SURWHLQ 0/3 WURSRQLQ 7f DQG WR SURWHLQV LQYROYHG LQ YHVLFXODU WUDQVSRUW LQWUDFHOOXODU SURWHLQ WUDQVSRUW SURWHLQ QXFOHDU IXVLRQ SURWHLQ %LNO V\QDSWRQHPDO FRPSOH[ SURWHLQf %/2&.6 DQDO\VLV VKRZHG KRPRORJLHV WR SRVWV\QDSWLF SURWHLQV JDV YHVLFOHV SURWHLQ FOXVWHULQ SURWHLQV FODWKULQ OLJKW FKDLQ SURWHLQV WURSRP\RVLQ SURWHLQ DQG LQWHUPHGLDWH ILODPHQW SURWHLQ 7KHUHIRUH ,3 UHSUHVHQWV D QRYHO SURWHLQ ZLWK KRPRORJLHV WR WKH DPLQR WHUPLQDO UHJLRQ RI 7FS DQG ZLWK KRPRORJLHV WR F\WRVNHOHWDO DQG YHVLFXODU WUDQVSRUW SURWHLQV ,W LV LQWHUHVWLQJ WKDW WKH /<67LQWHUDFWDQW ,3 VKRZV KRPRORJ\ WR WKH F WHUPLQDO UHJLRQ RI 7FS )XUWKHUPRUH /<67LQWHUDFWDQW ,3 KDV KRPRORJRXV GRPDLQV WR $73ELQGLQJ SURWHLQV DQG FKDSHURQLQ 7FS 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH ,3 (67 FJGO $33(1',; 6HTXHQFH 2QH LGHQWLILHG VHTXHQFH FJGOf LQWHUDFWLQJ ZLWK /<67 ZDV b LGHQWLFDO WR QXFOHRWLGHV RI WKH KXPDQ (67 $$ 7KLV (67 RI QXFOHRWLGHV ZDV LQLWLDOO\ REWDLQHG IURP D KXPDQ -XUNDW 7FHOOV OLEUDU\ $GDPV HW DO f 7KH f HQG RI (67 $$ FRXOG EH H[WHQGHG ZLWK QXFOHRWLGHV WR RI

PAGE 93

(67 FJGO UHVXOWLQJ LQ D VHTXHQFH RI QXFOHRWLGHV ZKLFK ZDV XVHG IRU IXUWKHU DQDO\VLV $Q RSHQ UHDGLQJ IUDPH FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR 7KHVH DPLQR DFLGV FRUUHVSRQG WR D FWHUPLQDO RU FRUH UHJLRQ RI D QRYHO SURWHLQ ZKLFK ZDV GHVLJQDWHG ,3 1R VLJQLILFDQW KRPRORJLHV FRXOG EH IRXQG XVLQJ WKH %/$671 VHDUFK SURJUDP 8VLQJ WKH %/2&.6 DQDO\VLV SURJUDP KRPRORJLHV WR $73ELQGLQJ SURWHLQV DQG FKDSHURQLQV 7&3 SURWHLQV FRXOG EH IRXQG 7KHUHIRUH ,3 UHSUHVHQWV D QRYHO SURWHLQ ZLWK KRPRORJLHV WR $73ELQGLQJ SURWHLQV DQG 7&3 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH ,3 7(67 FJKE $33(1',; 6HTXHQFH 7ZR LGHQWLILHG VHTXHQFHV FJF DQG FJGf LQWHUDFWLQJ ZLWK /<67 VKRZHG QR VLJQLILFDQW KRPRORJLHV WR SXEOLVKHG VHTXHQFHV 7KH LQWHUDFWLQJ VHTXHQFH RI QXFOHRWLGHV ZDV XVHG IRU IXUWKHU DQDO\VLV 1XFOHRWLGHV RI (67 FJKE ZHUH b KRPRORJRXV WR QXFOHRWLGHV WR RI WKH KXPDQ 51$ IRU WKH FHOOXODU RQFRJHQH FIHV *HQ%DQN DFFHVVLRQ 1R ;f $Q RSHQ UHDGLQJ IUDPH FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR 7KHVH DPLQR DFLGV FRUUHVSRQG WR D FWHUPLQDO RU FRUH UHJLRQ RI D QRYHO SURWHLQ ZKLFK ZDV FDOOHG ,3 2QO\ ZHDN KRPRORJLHV WR NQRZQ SURWHLQV FRXOG EH IRXQG HVSHFLDOO\ WR SUROLQHULFK UHJLRQV RI GLIIHUHQW SURWHLQV )RU H[DPSOH WKH SUROLQH ULFK UHJLRQ RI ,3 FRQVLVWLQJ RI DPLQR DFLGV WR ZDV b KRPRORJRXV WR WKH 7*) ELQGLQJ SURWHLQ

PAGE 94

DPLQR DFLGV WR ZHUH b KRPRORJRXV WR D UHJLRQ LQ KXPDQ VHPDSKRULQ ,9 b KRPRORJRXV WR 6WS& 6DLPLULLQH KHUSHVYLUXV f b KRPRORJRXV WR D FROODJHQOLNH SURWHLQ DQG b KRPRORJRXV WR KRPHRER[ SURWHLQ +2;$ $OWKRXJK WKH IXQFWLRQV RI SUROLQHULFK UHJLRQV DUH RIWHQ XQFOHDU WKH\ FRXOG EH LQYROYHG LQ SURWHLQSURWHLQ LQWHUDFWLRQV 6RPH WUDQVFULSWLRQ IDFWRUV FRQWDLQ D SUROLQHULFK VHTXHQFH LQ WKH WUDQVFULSWLRQDO DFWLYDWLRQ GRPDLQ ZKLFK KDV QR '1$ELQGLQJ DFWLYLW\ EXW LV HVVHQWLDO IRU DFWLYDWLQJ WUDQVFULSWLRQ 0LWFKHOO DQG 7MLDQ f $PLQR DFLGV WR RI ,3 VKRZHG b KRPRORJ\ WR 25) KRPRORJ PHPEUDQH SHUR[LVRPDO N'D SURWHLQ 3 $/'3f LQYROYHG LQ DGUHQROHXNRG\VWURSK\ 7KHUHIRUH ,3 UHSUHVHQWV D QRYHO SURWHLQ ZLWK D SUROLQHULFK UHJLRQ 2WKHU /<67 LQWHUDFWDQWV ,3 DQG +UV KDYH DOVR SUROLQHULFK UHJLRQV 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH ,3 (67 FJ[ $33(1',; 6HTXHQFH 2QH LGHQWLILHG VHTXHQFH FJFO QXFOHRWLGHVf LQWHUDFWLQJ ZLWK /<67 VKRZHG VLJQLILFDQW KRPRORJ\ WR SXEOLVKHG H[SUHVVHG VHTXHQFHV 1XFOHRWLGHV WR RI FJFOO ZHUH b LGHQWLFDO WR QXFOHRWLGHV WR RI WKH H[SUHVVHG VHTXHQFH + QXFOHRWLGHV +LOOLHU HW DO f REWDLQHG IURP D PRXVH EUDLQ F'1$ OLEUDU\ 7KH H[SUHVVHG VHTXHQFH FJFOO ZDV H[WHQGHG LQ WKH f GLUHFWLRQ ZLWK QXFOHRWLGHV RI + 7KLV H[WHQGHG VHTXHQFH VKRZHG b LGHQWLW\ WR DQ H[SUHVVHG VHTXHQFH +V RI WKH VDPH OHQJWK 7KH H[WHQGHG VHTXHQFH RI QXFOHRWLGHV ZDV XVHG IRU IXUWKHU DQDO\VLV

PAGE 95

7KH H[WHQGHG H[SUHVVHG VHTXHQFH RI QXFOHRWLGHV VKRZHG b LGHQWLW\ WR QXFOHRWLGHV WR RI ;HQRSXV ODHYLV HODYW\SH ULERQXFOHRSURWHLQ HWU *HQ%DQN DFFHVVLRQ 1R 8f $Q RSHQ UHDGLQJ IUDPH FRXOG EH WUDQVODWHG IURP QXFOHRWLGHV WR 7KHVH DPLQR DFLGV UHSUHVHQW WKH FRUH RU FWHUPLQXV RI D QRYHO SURWHLQ ZKLFK ZDV GHVLJQDWHG ,3 7KH DPLQR DFLG VHTXHQFH RI ,3 VKRZV KRPRORJLHV WR ULERQXFOHRSURWHLQV RI GLIIHUHQW VSHFLHV LQFOXGLQJ b KRPRORJ\ WR ;HQRSXV ODHYLV HODY W\SH ULERQXFOHRSURWHLQ HWU *HQ%DQN DFFHVVLRQ 1R 8f DQG b KRPRORJ\ WR WKH KXPDQ HWU SURWHLQ *HQ%DQN DFFHVVLRQ 1R 8f 7KHUHIRUH ,3 UHSUHVHQWV D QRYHO KXPDQ SURWHLQ ZLWK KRPRORJ\ WR ULERQXFOHRSURWHLQV 7KH QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV RI ,3 DUH VKRZQ LQ $33(1',; 6HTXHQFH

PAGE 96

',6&866,21 6LQFH WKH SUHGLFWHG PRXVH DQG KXPDQ &+6 SURWHLQV ZHUH QRYHO DQG XQOLNH DQ\ RI WKH PROHFXOHV SUHYLRXVO\ LPSOLFDWHG LQ YHVLFXODU WUDQVSRUW WKHLU LGHQWLILFDWLRQ GLG QRW SURYH LPPHGLDWHO\ KHOSIXO LQ HVWDEOLVKLQJ WKH SUHFLVH PHFKDQLVP ZKHUHE\ &+6 G\VUHJXODWHV SURWHLQ WUDQVSRUW DQG O\VRVRPDO WUDIILFNLQJ 7KHUHIRUH WKH PDLQ JRDO RI WKLV GLVVHUWDWLRQ ZDV WR FKDUDFWHUL]H WKH &KHGLDN+LJDVKL JHQH DQG LWV SURGXFWV LQ PRUH GHWDLO E\ XVLQJ IXQFWLRQDO JHQRPLFV DSSURDFKHV LGHQWLI\LQJ DOWHUQDWLYHO\ VSOLFHG /\VW P51$ LVRIRUPV DQG WKHUHIRUH UHVROYLQJ WKH GLVFUHSDQF\ EHWZHHQ WKH LQLWLDOO\ UHSRUWHG /\VW VHTXHQFHV LGHQWLILFDWLRQ RI PXWDWLRQV LQ &KHGLDN+LJDVKL SDWLHQWV DQG EHLJH DOOHOHV LGHQWLILFDWLRQ RI SURWHLQV WKDW LQWHUDFW ZLWK /<67 ,GHQWLILFDWLRQ DQG &KDUDFWHUL]DWLRQ RI /YVW P51$ ,VRIRUPV ,Q RUGHU WR LQYHVWLJDWH WKH H[SUHVVLRQ RI WKH &+6 JHQH DQG WR H[SODLQ WKH GLVFUHSDQF\ EHWZHHQ WKH SUHYLRXVO\ SXEOLVKHG /\VW VHTXHQFHV H[WHQVLYH QRUWKHUQ DQG 573&5 DQDO\VHV ZHUH SHUIRUPHG :H GHPRQVWUDWHG WKDW HDFK RI WKH SUHYLRXVO\ UHSRUWHG EJ JHQH VHTXHQFHV %DUERVD HW DO 3HURX HW DO Ef LV GHULYHG IURP D VLQJOH JHQH ZLWK DOWHUQDWLYHO\ VSOLFHG P51$V )LJ f 7KH SUHYLRXVO\ UHSRUWHG VHTXHQFHV DUH

PAGE 97

GHULYHG IURP QRQRYHUODSSLQJ SDUWV RI WZR /\VW P51$ LVRIRUPV ZLWK GLIIHUHQW SUHGLFWHG &WHUPLQDO UHJLRQV %\ VHTXHQFLQJ 573&5 SURGXFWV ZH KDYH VKRZQ WKDW QXFOHRWLGHV RI /\VW DOVR UHSUHVHQW WKH SUHYLRXVO\ XQGHWHUPLQHG f UHJLRQ RI WKH ODUJHVW /\VW LVRIRUP $OWHUQDWLYH VSOLFLQJ DW QXFOHRWLGH UHVXOWV LQ EJ JHQH LVRIRUPV WKDW FRQWDLQ GLIIHUHQW f UHJLRQV 6SOLFLQJ IURP H[RQ D FRQWDLQLQJ QXFOHRWLGH f WR H[RQ [ UHVXOWV LQ DQ a NE P51$ /\VWf WKDW FRUUHVSRQGV WR WKH ODUJHVW EDQG REVHUYHG RQ QRUWKHUQ EORWV ,QFRPSOHWH VSOLFLQJ DW QXFOHRWLGH UHVXOWV LQ D ES F'1$ =M!V,,f WKDW FRQWDLQV LQWURQGHULYHG VHTXHQFH DW WKH f HQG /\VW8 FRUUHVSRQGV WR D VPDOOHU P51$ REVHUYHG RQ QRUWKHUQ EORWV %DUERVD HW DO f :KLOH VHYHUDO RWKHU JHQHV JHQHUDWH DQ DOWHUQDWLYH &WHUPLQXV E\ LQFRPSOHWH VSOLFLQJ 0\HUV HW DO 6XJLPRWR HW DO 6\JL\DPD HW DO =KDR DQG 0DQOOH\ 9DQ 'H :HWHULQJ HW DO f WKH EJ JHQH LV XQLTXH LQ WKDW WKH SUHGLFWHG VWUXFWXUHV RI WKH WZR &WHUPLQL DUH TXLWH GLIIHUHQW 7KH &WHUPLQXV RI /\VW, FRQWDLQV D :'UHSHDW GRPDLQ WKDW LV VLPLODU WR WKH 3VXEXQLW RI KHWHURWULPHULF SURWHLQV DQG ZKLFK PD\ DVVXPH D SURSHOOHUOLNH VHFRQGDU\ VWUXFWXUH /DPEULJKW HW DO f 7KLV GRPDLQ LV DEVHQW LQ /\VW,, 1RUWKHUQ EORWV RI KXPDQ WLVVXHV KDG VXJJHVWHG WKDW WUDQVFULSWLRQ RI WKH KRPRORJRXV KXPDQ JHQH /<67 KDG D VLPLODU FRPSOH[LW\ WR WKH PRXVH :H LGHQWLILHG WZR KXPDQ (67V KRPRORJRXV WR PRXVH /\VW DQG GHVFULEHG D PXWDWLRQ LQ RQH RI WKHVH LQ D &KHGLDN+LJDVKL SDWLHQW %DUERVD HW DO f 6XEVHTXHQWO\ DQRWKHU JURXS SXEOLVKHG WKH F'1$ VHTXHQFH RI WKH ODUJHVW /<67 LVRIRUP DQG LGHQWLILHG PXWDWLRQV LQ WKLV JHQH LQ WZR DGGLWLRQDO SDWLHQWV ZLWK &+6 1DJOH HW DO f :H KDYH GHVFULEHG WKH LGHQWLILFDWLRQ RI D VHFRQG LVRIRUP RI WKH KXPDQ JHQH 7KLV P51$ HQFRGHV D SURWHLQ RI

PAGE 98

DPLQR DFLGV WKDW LV KRPRORJRXV WR PRXVH /\VW,, /LNH WKH ODWWHU WKLV KXPDQ P51$ DULVHV IURP LQFRPSOHWH VSOLFLQJ DQG UHWHQWLRQ RI D WUDQVFULEHG LQWURQ WKDW HQFRGHV WKH & WHUPLQXV RI WKH SUHGLFWHG /<67 SURWHLQ 7KH PRXVH DQG KXPDQ FRGRQV XQLTXH WR WKLV VKRUW LVRIRUP VKDUH b DPLQR DFLG LGHQWLW\ 7KH VWRS FRGRQ KRZHYHU LV QRW FRQVHUYHG SUHFLVHO\ EHWZHHQ WKH KXPDQ DQG PRXVH VKRUW LVRIRUPV :KLOH PRXVH /\VW,, LV SUHGLFWHG WR FRQWDLQ D &WHUPLQDO SUHQ\ODWLRQ PRWLI &<63f WUDQVODWLRQ RI KXPDQ VKRUW LVRIRUP LV SUHGLFWHG WR WHUPLQDWH FRGRQV HDUOLHU DQG WR ODFN WKLV PRWLI +RZHYHU WKH RWKHU SUHGLFWHG VWUXFWXUDO IHDWXUHV RI WKH KXPDQ VKRUW LVRIRUP ZHUH FRQVHUYHG ZLWK PRXVH 7KH PRVW QRWDEOH RI WKHVH ZDV D UHJLRQ VLPLODU LQ VHTXHQFH WR VWDWKPLQ DPLQR DFLGV f %DUERVD HW DO f :KLOH WKH PRXVH DQG KXPDQ &+6 JHQHV KDG DQ RYHUDOO DPLQR DFLG LGHQWLW\ RI b LGHQWLW\ LQ WKH VWDWKPLQOLNH GRPDLQ ZDV b DQG VLPLODULW\ ZDV b 6WDWKPLQ LV D FRLOHGFRLO SKRVSKRSURWHLQ WKDW UHJXODWHV PLFURWXEXOH SRO\PHUL]DWLRQ LQ D SKRVSKRU\ODWLRQGHSHQGHQW PDQQHU DQG DFWV DV D UHOD\ IRU LQWUDFHOOXODU VLJQDO WUDQVGXFWLRQ 6REHO %HOPRQW DQG 0LWFKLVRQ 0DUNOXQG HW DO f 7KLV UHJLRQ RI WKH /<67 JHQH PD\ HQFRGH D FRLOHGFRLO SURWHLQ LQWHUDFWLRQ GRPDLQ DQG PD\ UHJXODWH PLFURWXEXOHPHGLDWHG O\VRVRPH WUDIILFNLQJ ,QWULJXLQJO\ D GHIHFW LQ PLFURWXEXOH G\QDPLFV KDV EHHQ GRFXPHQWHG SUHYLRXVO\ LQ &+6 2OLYHU HW DO f DQG LQWDFW PLFURWXEXOHV DUH UHTXLUHG IRU PDLQWHQDQFH RI O\VRVRPDO PRUSKRORJ\ DQG WUDIILFNLQJ 0DWWHRQL DQG .UHLV 6ZDQVRQ HW DO 6ZDQVRQ HW DO 2ND DQG :HLJHO f 0XWDWLRQ DQG H[SUHVVLRQ DQDO\VHV VXJJHVWHG WKDW WKH ODUJHVW /\VW VSOLFH YDULDQW /\VW,f UHSUHVHQWV WKH LVRIRUP RI SULPDU\ IXQFWLRQDO VLJQLILFDQFH DQG WKDW H[SUHVVLRQ RI WKH VPDOOHU LVRIRUP /\VW,,f DORQH FDQQRW FRPSHQVDWH IRU ORVV RI /\VW, 7KLV K\SRWKHVLV

PAGE 99

ZDV VXSSRUWHG E\ WKH JHQHWLF FRPSOHPHQWDWLRQ H[SHULPHQWV LQLWLDWHG LQ FROODERUDWLRQ ZLWK 'U 6WHSKHQ %UDQGW 7KHVH VWXGLHV UHYHDOHG WKDW VRPH EHLJH PRXVH ILEUREODVWV H[SUHVVLQJ IXOOOHQJWK /\VW, GHPRQVWUDWHG PRUH SHULSKHUDO GLVWULEXWLRQ LQ WKH F\WRSODVP DQG VOLJKW UHGXFWLRQ RI WKH VL]H RI WKH VWDLQHG JUDQXOHV 6XFK FKDQJHV ZHUH QRW YLVLEOH LQ FHOOV H[SUHVVLQJ WKH VPDOOHU /\VW?, LVRIRUP +RZHYHU VLQFH WKH HIIHFWV RI WKH FRPSOHPHQWDWLRQ ZHUH QRW YHU\ SURPLQHQW DQG ZHUH QRW REVHUYHG LQ DOO FHOOV H[SUHVVLQJ /\VWO WKH VLJQLILFDQFH RI WKH GHVFULEHG JHQHWLF FRPSOHPHQWDWLRQ LV TXHVWLRQDEOH &RPSDULVRQ RI WKH UHODWLYH DEXQGDQFH RI /<67 JHQH WUDQVFULSWV LQ KXPDQ WLVVXHV DW GLIIHUHQW GHYHORSPHQWDO VWDJHV UHYHDOHG DQ RYHUODSSLQJ EXW GLVWLQFW SDWWHUQ RI H[SUHVVLRQ )LJ f $ TXDQWLWDWLYH HVWLPDWH RI WKH UHODWLYH H[SUHVVLRQ RI WKH VPDOOHU P51$ LVRIRUPV ZDV JHQHUDWHG E\ FRPSDULQJ WKH UHODWLYH K\EULGL]DWLRQ LQWHQVLW\ REWDLQHG ZLWK D SUREH VSHFLILF IRU WKH ODUJH LVRIRUP ZLWK WKDW REWDLQHG ZLWK D SUREH WKDW K\EULGL]HV WR DOO /<67 WUDQVFULSWV /DUJH LVRIRUP WUDQVFULSWV SUHGRPLQDWHG LQ WK\PXV IHWDO WK\PXV VSOHHQ DQG EUDLQ ZLWK WKH H[FHSWLRQ RI DP\JGDOD RFFLSLWDO OREH SXWDPHQ DQG SLWXLWDU\ JODQGf /DUJH DQG VPDOO P51$ WUDQVFULSWV ZHUH DEXQGDQW LQ WKH ODWWHU EUDLQ WLVVXHV SHULSKHUDO EORRG OHXNRF\WHV DQG ERQH PDUURZ +RZHYHU LQ VHYHUDO WLVVXHV RQO\ WKH VPDOO LVRIRUPV ZHUH H[SUHVVHG HJ LQ IHWDO KHDUW VDOLYDU\ JODQG NLGQH\ OXQJ DQG IHWDO EUDLQ 7KH GHYHORSPHQWDO SDWWHUQ RI P51$ LVRIRUP H[SUHVVLRQ LQ EUDLQ ZDV SDUWLFXODUO\ LQWHUHVWLQJ VLQFH RQO\ WKH VPDOO LVRIRUPV ZHUH H[SUHVVHG LQ IHWDO EUDLQ ZKHUHDV WKH ODUJHVW LVRIRUP SUHGRPLQDWHG LQ PDQ\ UHJLRQV RI WKH DGXOW EUDLQ

PAGE 100

,GHQWLILFDWLRQ RI 0XWDWLRQV LQ 3DWLHQWV ZLWK &KHGLDN+LJDVKL 6\QGURPH DQG LQ %HLJH 0LFH 0XWDWLRQ DQDO\VLV ZDV SHUIRUPHG LQ RUGHU WR SURYLGH DGGLWLRQDO HYLGHQFH WKDW /<67 UHVS /\VW LV LQGHHG WKH JHQH UHVSRQVLEOH IRU WKH &+6 LQ KXPDQ DQG IRU WKH EHLJH PXWDWLRQ LQ PRXVH DV ZHOO DV WR GHWHUPLQH ZKHWKHU D JHQRW\SHSKHQRW\SH FRUUHODWLRQ FRXOG EH HVWDEOLVKHG EHWZHHQ GLIIHUHQW JHQHWLF GHIHFWV DQG VSHFLILF GLVHDVH PDQLIHVWDWLRQV 1RYHO PXWDWLRQV ZHUH LGHQWLILHG ZLWKLQ WKH FRGLQJ GRPDLQ RI /<67 LQ VHYHUDO &+6 SDWLHQWV 7DEOH DQG )LJf 7KH JHQHWLF OHVLRQV LQ WKUHH SDWLHQWV f ZHUH &f§!7 VXEVWLWXWLRQV WKDW UHVXOWHG LQ SUHPDWXUH WHUPLQDWLRQ $QRWKHU SDWLHQW ZDV KHWHUR]\JRXV IRU D GLQXFOHRWLGH GHOHWLRQ WKDW UHVXOWV LQ D IUDPHVKLIW DQG SUHPDWXUH WHUPLQDWLRQ ,QWHUHVWLQJO\ DOO EJ DQG /<67 PXWDWLRQV LGHQWLILHG WR GDWH DUH SUHGLFWHG WR UHVXOW LQ WKH SURGXFWLRQ RI HLWKHU WUXQFDWHG RU DEVHQW SURWHLQV VXJJHVWLQJ WKDW PLVVHQVH PXWDWLRQV PD\ QRW EH OLNHO\ WR FDXVH &+6 8QOLNH )DQFRQL DQHPLD W\SH &
PAGE 101

H[SUHVVLRQ RI P51$ LVRIRUPV LQ KXPDQ WLVVXHV ZDV FRQVLVWHQW ZLWK WKH SDWWHUQ RI FOLQLFDO IHDWXUHV REVHUYHG LQ &+6 SDWLHQWV WUDQVFULSWV ZHUH PRVW DEXQGDQW LQ SHULSKHUDO EORRG OHXNRF\WHV ERQH PDUURZ WK\PXV O\PSK QRGH VSOHHQ DQG EUDLQ DQG FRPPRQ FOLQLFDO IHDWXUHV DPRQJ &+6 SDWLHQWV DUH LPPXQH GHILFLHQF\ SODWHOHW VWRUDJH SRRO GHILFLHQF\ DQG QHXURORJLF PDQLIHVWDWLRQV 1RUWKHUQ EORWV VXJJHVWHG WKDW DQ a NE P51$ FRUUHVSRQGLQJ WR WKH ODUJHVW LVRIRUPf LV VHYHUHO\ UHGXFHG LQ DEXQGDQFH LQ WZR &+6 SDWLHQWV )LJ f $ NE EDQG FRUUHVSRQGLQJ WR D VPDOOHU LVRIRUPf KRZHYHU ZDV SUHVHQW LQ QRUPDO DEXQGDQFH LQ P51$ IURP WKHVH SDWLHQWV 7KHVH UHVXOWV VXJJHVW WKDW LQ VRPH SDWLHQWV &KHGLDN+LJDVKL V\QGURPH UHVXOWV IURP ORVV RI WKH SURWHLQ HQFRGHG E\ WKH ODUJHVW LVRIRUP $OPRVW DOO RI WKH PXWDWLRQV LGHQWLILHG LQ &+6 SDWLHQWV WR GDWH DUH ZLWKLQ WKH UHJLRQ RI WKH FRGLQJ GRPDLQ WKDW LV FRPPRQ WR DOO LVRIRUPV %DUERVD HW DO 1DJOH HW DO f +RZHYHU LQ RQH &+6 SDWLHQW GHVFULEHG E\ .DULP HW DO WKHUH ZDV D IUDPHVKLIW DW FRGRQ f OHDGLQJ WR SUHPDWXUH WHUPLQDWLRQ LQ D UHJLRQ RI WKH PROHFXOH WKDW EHORQJV RQO\ WR /\VW, ,Q DGGLWLRQ WKH PRXVH EJ PXWDWLRQ UHVXOWV LQ WKH JHQHUDWLRQ RI D SUHPDWXUH VWRS FRGRQ LQ /\VW WKDW LV XQOLNHO\ WR DIIHFW /\VW,, P51$ SURFHVVLQJ 3HURX HW DO Ef 7RJHWKHU WKHVH UHVXOWV VXJJHVW WKDW GHIHFWV LQ WKH IXOO OHQJWK P51$ DORQH FDQ HOLFLW &KHGLDN+LJDVKL V\QGURPH DQG WKDW H[SUHVVLRQ RI WKH VPDOOHU LVRIRUP DORQH FDQQRW FRPSHQVDWH IRU ORVV RI WKH ODUJHVW LVRIRUP $OWKRXJK ZH ZHUH QRW DEOH WR HVWDEOLVK D PRUH SUHFLVH JHQRW\SHSKHQRW\SH FRUUHODWLRQ EHWZHHQ GLIIHUHQW JHQHWLF GHIHFWV DQG VSHFLILF GLVHDVH PDQLIHVWDWLRQV E\ LGHQWLI\LQJ PXWDWLRQV LQ VHYHUDO &+6 SDWLHQWV DQG EJ DOOHOHV ZH GLG FRQILUP WKDW /<67/\VW LV LQGHHG WKH JHQH UHVSRQVLEOH IRU WKH &KHGLDN+LJDVKL V\QGURPH

PAGE 102

,GHQWLILFDWLRQ DQG &KDUDFWHUL]DWLRQ RI/\VWBD %UDLQ6SHFLILF 0HPEHU RI WKH &KHGLDN +LJDVKL 6\QGURPH *HQH )DPLO\ ,Q DQ HIIRUW WR LGHQWLI\ JHQHV VLPLODU WR /<67 WKDW PD\ SOD\ UROHV LQ WKH UHJXODWLRQ RI YHVLFXODU WUDIILFNLQJ ZH KDYH LVRODWHG D QRYHO JHQH )LJ f LQ KXPDQ /<67f DQG PRXVH /\VWf WKDW H[KLELWV VLJQLILFDQW VHTXHQFH LGHQWLW\ VLPLODU SXWDWLYH SURWHLQ GRPDLQV DQG D FRPSDUDEOH P51$ VL]H a NEf WR WKH &KHGLDN+LJDVKL V\QGURPH F'1$ /<67f 7KH VHJPHQW RI JUHDWHVW VHTXHQFH VLPLODULW\ EHWZHHQ /<67 DQG /<67 !b SUHGLFWHG DPLQR DFLG LGHQWLW\f LV ORFDWHG ZLWKLQ WKH %($&+ GRPDLQ RI /<67 D UHJLRQ H[KLELWLQJ VHTXHQFH FRQVHUYDWLRQ WR 25)V IURP 6 FHUHYLVLDH DQG &HOHJDQV DQG WKH KXPDQ FHOO GLYLVLRQ FRQWURO SURWHLQ UHODWHG SURWHLQ 1DJOH HW DO f $OWKRXJK WKH &WHUPLQDO UHVLGXHV RI /<67 DUH QRW ZHOO FRQVHUYHG ZLWK /<67 WKH\ GR KDYH D VLPLODU SUHGLFWHG VHFRQGDU\ VWUXFWXUH 7KLV UHJLRQ RI /<67 FRQWDLQV :' UHSHDWV DQG LV SUHGLFWHG WR DVVXPH D SURSHOOHU VHFRQGDU\ VWUXFWXUH VLPLODU WR WKH VXEXQLW RI KHWHURWULPHULF SURWHLQV )XUWKHUPRUH WKH VWRS FRGRQV RI PRXVH /\VW DQG KXPDQ /<67 RFFXU DSSUR[LPDWHO\ WKH VDPH GLVWDQFH IURP WKH PDWFKLQJ UHJLRQ 7KHUH LV DOVR KLJK GHJUHH RI KRPRORJ\ b LGHQWLW\ LQ DPLQR DFLGVf EHWZHHQ KXPDQ /<67 DQG PRXVH /\VW SURWHLQV %DVHG XSRQ WKHVH REVHUYDWLRQV /<67 LV VXJJHVWHG WR EH D QRYHO PHPEHU RI WKH /<67 JHQH IDPLO\ 6LQFH WKH f HQG RI /<67 KDV QRW EHHQ LGHQWLILHG \HW WKH OHYHO RI KRPRORJ\ EHWZHHQ /<67 DQG /<67 PD\ FKDQJH DV QHZ VHTXHQFH LV REWDLQHG :KLOH /\VW PDSV RQ PRXVH &KU .LQJVPRUH HW DO D .LQJVPRUH HW DO Ef /\VW ZDV PDSSHG E\ OLQNDJH DQDO\VLV EHWZHHQ '08 DQG '08 RQ PRXVH

PAGE 103

&KU )LJ f 7KH RQO\ NQRZQ PRXVH PXWDWLRQ ORFDWHG LQ WKLV FKURPRVRPDO UHJLRQ LV EOHEV P\f DW a F0 %OHEV PLFH H[KLELW VRPH DEQRUPDOLWLHV HJ SVHXGHQFHSKDO\ PLGFHUHEUDO OHVLRQV UHQDO DJHQHVLV DQG K\GURQHSKURVLVf WKDW FRUUHVSRQG WR WKH RUJDQV ZLWK PRVW DEXQGDQW /\VW H[SUHVVLRQ EUDLQ DQG NLGQH\f +RZHYHU /\VW LV QRW D YHU\ OLNHO\ FDQGLGDWH IRU WKH P\ JHQH EHFDXVH EOHEV PLFH KDYH QXPHURXV GHIHFWV VSOLW VWHUQXP SUHD[LDO SRO\GDFW\O\ DQG V\QGDFW\O\ RI WKH PLGGOH GLJLWV H\H VNLQ DQG KDLU DEQRUPDOLWLHV HFWRSLD YLVFHUXPf LQ RUJDQV RWKHU WKDQ EUDLQ DQG NLGQH\ ,Q DGGLWLRQ P\ PDSV YHU\ FORVH WR WKH GLVWDO PLFURVDWHOOLWH PDUNHU '08 DW a F0 f XVHG IRU WKH JHQHWLF PDSSLQJ RI /\VW ,Q KXPDQ /<67 ZDV VKRZQ WR PDS RQ &KU )XNDL HW DO %DUUDW HW DO f ZKLOH /<67 ZDV PDSSHG LQ D VRPDWLF FHOO K\EULG SDQHO WR KXPDQ &KU )LJ f &RPSDUDWLYH DQDO\VLV RI WKH JHQRPH RUJDQL]DWLRQ RI KXPDQ DQG PRXVH
PAGE 104

H[SUHVVLRQ :KLOH /\VW LV H[SUHVVHG UHODWLYHO\ XQLIRUPO\ LQ GLIIHUHQW QRUPDO PRXVH WLVVXHV %DUERVD HW DO f /\VW H[KLELWHG DEXQGDQW H[SUHVVLRQ RQO\ LQ EUDLQ ,Q DGGLWLRQ VPDOOHU /\VW WUDQVFULSWV a NEf ZHUH PXFK PRUH DEXQGDQW %DUERVD HW DO f WKDQ WKRVH RI /\VW )LJ Df 7KH H[SUHVVLRQ SDWWHUQV RI /<67 DQG /<67 LQ KXPDQ WXPRU FHOO OLQHV ZHUH DOVR GLIIHUHQW )LJ Ef :KLOH WKH SUHGRPLQDQW /<67 LVRIRUP LV a NE WKH RQO\ /<67 WUDQVFULSW LV a NE 6LPLODUO\ LQ QRUPDO KXPDQ LPPXQH WLVVXHV WKH RQO\ YLVLEOH /<67 LVRIRUP ZDV a NE ZKLOH WKH PRVW DEXQGDQW /<67 WUDQVFULSW ZDV a NE ,Q ERWK QRUPDO DQG WXPRU KXPDQ WLVVXHV WKH H[SUHVVLRQ RI /<67 ZDV PRUH XQLIRUP WKDQ WKDW RI /<67 $QDO\VLV RI WKH UHODWLYH DEXQGDQFH RI /<67 DQG /<67 WUDQVFULSWV LQ QRUPDO KXPDQ WLVVXHV GHPRQVWUDWHG WKDW WKHUH DUH FRQVLGHUDEOH GLIIHUHQFHV LQ WKH H[SUHVVLRQ SDWWHUQV )LJ f /<67 H[KLELWHG KLJKHVW OHYHOV RI H[SUHVVLRQ LQ WLVVXHV RI WKH LPPXQH V\VWHP HJ DGXOW DQG IHWDO WK\PXV SHULSKHUDO EORRG OHXNRF\WHV ERQH PDUURZ VSOHHQf DQG LQ VRPH DGXOW EUDLQ UHJLRQV HJ FHUHEHOOXP PHGXOOD REORQJDWD IURQWDO OREH FHUHEUDO FRUWH[ KLSSRFDPSXVf ,Q FRQWUDVW /<67 ZDV H[SUHVVHG SULPDULO\ LQ ZKROH EUDLQ DGXOW DQG IHWDOf LQ PRVW EUDLQ UHJLRQV DQG LQ NLGQH\ DQG GHPRQVWUDWHG ORZ UHODWLYH H[SUHVVLRQ LQ WKH LPPXQH V\VWHP RUJDQV 1RWDEO\ WKHUH ZHUH VRPH WLVVXHV ZKHUH /<67 ZDV H[SUHVVHG EXW QR /<67 WUDQVFULSWV ZHUH GHWHFWHG HJ NLGQH\ IHWDO EUDLQ IHWDO KHDUW VDOLYDU\ JODQG DQG OXQJ +RZHYHU WKHUH ZHUH DOVR RUJDQV ZLWK KLJK UHODWLYH DEXQGDQFH RI /<67 P51$ DQG ORZ UHODWLYH H[SUHVVLRQ RI /<67 PDLQO\ WLVVXHV RI WKH LPPXQH V\VWHP WK\PXV DGXOW DQG

PAGE 105

IHWDOf SHULSKHUDO EORRG OHXNRF\WH ERQH PDUURZ VSOHHQ O\PSK QRGH DV ZHOO DV LQ SODFHQWD DQG WHVWLV ,W LV XQOLNHO\ WKDW /<67 SUREHV FURVVK\EULGL]H WR /<67 VHTXHQFHV EHFDXVH RI WKH XQDPELJXRXV JHQHWLF PDSSLQJ DQG EHFDXVH RI WKH REVHUYHG H[SUHVVLRQ GLIIHUHQFHV EHWZHHQ WKH WZR JHQHV ,Q JHQHUDO /<67 GHPRQVWUDWHG PRUH XQLIRUP SDWWHUQ RI UHODWLYH H[SUHVVLRQ WKDQ /<67 ZKLFK ZDV H[SUHVVHG LQ KLJK OHYHOV RQO\ LQ EUDLQ DQG WR D OHVVHU H[WHQW LQ NLGQH\ :H LGHQWLILHG D QRYHO JHQH LQ KXPDQ /<67f DQG PRXVH /\VWf WKDW DSSHDUV WR EH D UHODWLYH RI WKH &KHGLDN+LJDVKL V\QGURPH JHQH EDVHG RQ VHTXHQFH VLPLODULW\ SUHGLFWHG SURWHLQ VWUXFWXUH DQG RQ VLPLODU WUDQVFULSW VL]H &RPSDULVRQ RI WKH UHODWLYH DEXQGDQFH RI /<67 DQG /<67 P51$V VXJJHVWV WKDW /<67 LV H[SUHVVHG DEXQGDQWO\ RQO\ LQ EUDLQ DQG WKHUHIRUH LW PD\ UHSUHVHQW D EUDLQVSHFLILF PHPEHU RI WKH &KHGLDN +LJDVKL V\QGURPH JHQH IDPLO\ 7KHVH UHVXOWV VXJJHVW WKDW WKHVH WZR JHQHV PD\ SHUIRUP VLPLODU IXQFWLRQV LQ GLIIHUHQW WLVVXHV ZKLOH /<67 LV H[SHFWHG WR SDUWLFLSDWH LQ WKH UHJXODWLRQ RI O\VRVRPDO WUDIILFNLQJ DQG GHJUDQXODWLRQ SULPDULO\ LQ LPPXQH WLVVXHV /<67 PD\ SOD\ D VLPLODU UROH LQ FHOOV RI WKH QHUYRXV V\VWHP 7KLV K\SRWKHVLV LV VXSSRUWHG E\ WKH \HDVW WZRK\EULG LGHQWLILFDWLRQ RI D SURWHLQ IURP WKH IDPLO\ WKDW LQWHUDFWV ZLWK ERWK /<67 DQG /<67 VHH EHORZf SURWHLQV KDYH EHHQ VKRZQ WR EH LQYROYHG LQ WKH UHJXODWLRQ RI &DGHSHQGHQW H[RF\WRVLV RI VHFUHWRU\ YHVLFOHV &KDPEHUODLQ HW DO 5RWK HW DO f DV ZHOO DV LQ VLJQDO WUDQVGXFWLRQ )X HW DO 5HXWKHU HW DO f

PAGE 106

,GHQWLILFDWLRQ RI 3URWHLQV WKDW ,QWHUDFW ZLWK WKH &+6 3URWHLQ 8VLQJ D
PAGE 107

$FWLYDWLRQ RI W\URVLQH DQG WU\SWRSKDQH K\GUR[\ODVHV WKH UDWHOLPLWLQJ HQ]\PHV LQYROYHG LQ QHXURWUDQVPLWWHU FDWHFKRODPLQH DQG VHURWRQLQf ELRV\QWKHVLV ,VKLPXUD HW DO f $OWKRXJK W\URVLQH K\GUR[\ODVH ZDV DFWLYDWHG E\ 3.& DQG F$03GHSHQGHQW SURWHLQ NLQDVH SKRVSKRU\ODWLRQ WKH SURWHLQ ZDV QHFHVVDU\ IRU DFWLYDWLRQ DIWHU SKRVSKRU\ODWLRQ E\ &DFDOPRGXOLQGHSHQGHQW &$0f NLQDVH ,, 5HJXODWLRQ RI SURWHLQ NLQDVH & 3.&f DFWLYLW\ 7KHUH KDYH EHHQ FRQIOLFWLQJ UHSRUWV RYHU WKH UROH RI DV UHJXODWRUV RI 3.& 7RNHU HW DO IRXQG WKDW LQKLELWHG 3.& ZKLOH ,VREH HW DO VKRZHG WKDW DFWLYDWHG 3.& DSSUR[LPDWHO\ IROG 1HYHUWKHOHVV LQWHUDFWLRQ RI ZLWK 3.& LV HVWDEOLVKHG DQG LW PD\ EH WKDW WKH LQWHUDFWLRQ RI GLIIHUHQW LVRIRUPV ZLWK 3.& LV UHVSRQVLEOH IRU WKH GLIIHUHQW UHVXOWV REWDLQHG ,Q DGGLWLRQ SURWHLQV DUH SKRVSKRU\ODWHG E\ 3.& LWVHOI EXW QRW E\ D ZLGH UDQJH RI RWKHU SURWHLQ NLQDVHV ,QWHUDFWLRQ DQG DFWLYDWLRQ RI 5DI SURWHLQ NLQDVH D FRQYHUJHQW SRLQW IRU GLIIHUHQW VLJQDOV WKDW UHJXODWH JURZWK IDFWRU DQG KRUPRQH HIIHFWV RQ GLIIHUHQWLDWLRQ DQG SUROLIHUDWLRQ )X HW DO f ,QWHUDFWLRQV RI ZLWK RWKHU VLJQDO WUDQVGXFWLRQ PROHFXOHV KDYH EHHQ GHVFULEHG 5HXWKHU HW DO %XUEHOR DQG +DOO 0RUULVRQ f VXJJHVWLQJ D UROH RI WKH IDPLO\ DV PRGXODWRUV RI VLJQDOLQJ SURWHLQV 6WLPXODWLRQ RI &DnGHSHQGHQW H[RF\WRVLV LQ DGUHQDO FKURPDIILQ FHOOV %XUJR\QH HW DO f 7KLV DFWLRQ RI LV SRWHQWLDWHG E\ 3.& ZKLFK VXJJHVWV D UROH IRU LQ 3.&PHGLDWHG FRQWURO RI H[RF\WRVLV 7KHVH UHVXOWV DUH VXSSRUWHG E\ WKH REVHUYDWLRQ RI PHPEUDQHERXQG SURWHLQV IRXQG DW KLJK FRQFHQWUDWLRQ RQ WKH PHPEUDQH RI V\QDSWLF YHVLFOHV 0DUWLQ HW DO f ,Q DGGLWLRQ SURWHLQV KDYH EHHQ VKRZQ WR VHOHFWLYHO\ VWLPXODWH WKH UHOHDVH RI DUDFKLGRQLF DFLG IURP FKROLQH DQG HWKDQRODPLQH

PAGE 108

JO\FHURSKRVSKROLSLGV =XSDQ HW DO f $UDFKLGRQLF DFLG VWLPXODWHV VHFUHWLRQ IURP PDQ\ FHOO W\SHV ZKLFK PD\ EH UHOHYDQW WR WKH UROH RI LQ H[RF\WRVLV ,Q SODQWV PHGLDWHG LQFUHDVH LQ H[RF\WRVLV KDV EHHQ SURSRVHG DV D PDMRU PHFKDQLVP LQYROYHG LQ GHIHQVH UHVSRQVHV $LWNHQ HW DO f %\ XVLQJ VWDJHVSHFLILF DVVD\V IRU H[RF\WRVLV LQ FKURPDIILQ FHOOV LW KDV EHHQ VKRZQ WKDW SURWHLQV VLPLODUO\ WR D61$3 HQKDQFHG H[RF\WRVLV E\ DFWLQJ LQ DQ HDUO\ SULPLQJ VWDJH &KDPEHUODLQ HW DO f +RZHYHU WKH HIIHFWV RI DQG D61$3 VKRZHG GLIIHUHQW &DGHSHQGHQFLHV DQG WLPH FRXUVHV VXJJHVWLQJ WKDW WKH\ KDG GLVWLQFW DFWLRQV LQ SULPLQJ 7KH WLPH FRXUVHV RI DFWLRQ RI DQG D61$3 ZRXOG EH FRQVLVWHQW ZLWK SURWHLQV DFWLYDWLQJ D SURFHVV ZKLFK PXVW RFFXU RQO\ RQFH IRU LQFUHDVHG VHFUHWLRQ ZKHUHDV D61$3 PD\ EH QHHGHG FRQWLQXRXVO\ GXULQJ VHFUHWLRQ WR IDFLOLWDWH PXOWLSOH URXQGV RI YHVLFOH UHFUXLWPHQW GRFNLQJ DQG IXVLRQ ,W KDV EHHQ GHPRQVWUDWHG WKDW WKH VWLPXODWLRQ RI FDWHFKRODPLQH UHOHDVH E\ SURWHLQV ZDV DEROLVKHG E\ SULRU LQFXEDWLRQ ZLWK WKH DFWLQ ILODPHQW VWDELOL]LQJ GUXJ SKDOORLGLQ 5RWK DQG %XUJR\QH f 7KH FRUWLFDO DFWLQ QHWZRUN ZDV GLVDVVHPEOHG DQG DFWLQ ZDV UHRUJDQL]HG LQWR LQWUDFHOOXODU IRFL IROORZLQJ WUHDWPHQW ZLWK SURWHLQV 7KHVH GDWD VXJJHVW WKDW SURWHLQV HQKDQFH FDWHFKRODPLQH UHOHDVH E\ UHRUJDQL]DWLRQ RI WKH FRUWLFDO DFWLQ EDUULHU WR DOORZ LQFUHDVHG DYDLODELOLW\ RI VHFUHWRU\ YHVLFOHV IRU H[RF\WRVLV ,W KDV EHHQ VKRZQ WKDW RWKHU VWLPXOL WKDW DFWLYDWH H[RF\WRVLV OHDG WR DFWLQ UHRUJDQL]DWLRQ LQ RWKHU FHOO W\SHV HJ LQ PDVW FHOOV .RIIHU HW DO f DQG SDURWLG DFLQDU FHOOV 3HUULQ HW DO f 5RWK HW DO UHSRUWHG WKDW LV DVVRFLDWHG ZLWK JUDQXOH PHPEUDQHV DQG WKDW LW FDQ ELQG SKRVSKROLSLG YHVLFOHV DQG LQGXFH WKHLU DJJUHJDWLRQ 6LQFH PHPEUDQH IXVLRQ LQ H[RF\WRVLV LQYROYHV SURWHLQV DEOH WR PRGLI\ RU UHRUJDQL]H OLSLGV ZLWKLQ WKH

PAGE 109

SODVPD DQG JUDQXOH PHPEUDQHV WKH DELOLW\ RI WR ELQG SKRVSKROLSLGV DQG WR DJJUHJDWH SKRVSKROLSLG YHVLFOHV VXJJHVWV WKDW SURWHLQV FRXOG SOD\ D UROH LQ PHPEUDQH HYHQWV GXULQJ H[RF\WRVLV 7KH IXQFWLRQV RI SURWHLQV LQ YHVLFXODU WUDQVSRUW DUH LQ FORVH DJUHHPHQW ZLWK WKH H[SHFWHG UROHV RI WKH &+6 SURWHLQ $V GHVFULEHG LQ WKH ,1752'8&7,21 RI WKLV GLVVHUWDWLRQ WKHUH DUH QXPHURXV H[DPSOHV RI LPSDLUHG YHVLFOH WUDIILFNLQJ LQ &+6 PHODQRVRPHV DUH DIIHFWHG LQ PHODQRF\WHV GHQVH JUDQXOHV LQ SODWHOHWV O\VRVRPHV DQG VHFUHWRU\ YHVLFOHV LQ YDULRXV LPPXQH FHOOV 7KHVH GHIHFWV LQGLFDWH WKDW /<67 PD\ SDUWLFLSDWH LQ WKH UHJXODWLRQ RI LQWUDFHOOXODU YHVLFXODU WUDQVSRUW DQG LQ H[RF\WRVLV ZKHUH SURWHLQV KDYH EHHQ VKRZQ WR SHUIRUP LPSRUWDQW IXQFWLRQV 7KHVH REVHUYDWLRQV VXSSRUW WKH GHWHFWHG DVVRFLDWLRQ EHWZHHQ WKH &+6 SURWHLQ DQG 6LPLODUO\ WR WKH PRGXODWLRQ RI SURWHLQ NLQDVH & E\ D UDSLG GRZQUHJXODWLRQ RI PHPEUDQHERXQG 3.& DFWLYLW\ IROORZLQJ VKRUWWHUP DFWLYDWLRQ KDV EHHQ GHVFULEHG LQ EHLJH PDFURSKDJHV 1. FHOOV DQG SRO\PRUSKRQXFOHDU OHXNRF\WHV ,WR HW DO f ,Q DGGLWLRQ D FRQFDYDOLQ $ &RQ $fLQGXFHG 3.&GHSHQGHQW FDS IRUPDWLRQ ZDV VLJQLILFDQWO\ LQFUHDVHG LQ EHLJH 301V FRPSDUHG WR WKDW LQ FRQWURO FHOOV 6DWR HW DO f 7KH GHFOLQH LQ 3.& DFWLYLW\ DQG WKH DEQRUPDOO\ HQKDQFHG FDS IRUPDWLRQ ZHUH ERWK DEROLVKHG E\ SUHWUHDWPHQW RI FHOOV ZLWK OHXSHSWLQ DQ LQKLELWRU RI FDOSDLQ D &DGHSHQGHQW WKLRO SURWHLQDVH WKDW K\GURO\VHV 3.&f )XUWKHUPRUH WKH WUHDWPHQW ZLWK OHXSHSWLQ LPSURYHG WKH LPSDLUHG 1. FHOO DFWLYLW\ IURP EJEJ PLFH ZKHUHDV WKH 1. FHOOV IURP EJ DQG ZHUH QRW DIIHFWHG 7KHVH ILQGLQJV VXJJHVW WKDW LQ &+6 WKHUH LV D G\VUHJXODWLRQ RI SURWHLQ NLQDVH & DFWLYLW\ WKDW PD\ DOWHU RWKHU VLJQDO WUDQVGXFWLRQ SDWKZD\V DQG FDXVH IXQFWLRQDO FHOOXODU GHIHFWV 7KH LQYROYHPHQW RI DQG WKH &+6 SURWHLQ LQ ERWK YHVLFXODU

PAGE 110

WUDQVSRUW DQG VLJQDO WUDQVGXFWLRQ LQGLFDWH WKDW WKHVH WZR PROHFXOHV IXQFWLRQ LQ FRPPRQ SDWKZD\V DQG VXSSRUWV WKH /<67 LQWHUDFWLRQ GHWHFWHG E\ WKH \HDVW WZRK\EULG V\VWHP &DVHLQ NLQDVH ,, &. &.,,f VHULQHWKUHRQLQH SURWHLQ NLQDVH WKDW LV SUHVHQW LQ WKH QXFOHXV DQG F\WRSODVP RI DOO HXNDU\RWLF FHOOV WKDW KDYH EHHQ VWXGLHG &. LV D KHWHURWHWUDPHU ZLWK D PROHFXODU PDVV RI N'D FRPSRVHG RI W\SHV RI VXEXQLWV D DQG 3f DQG KDV WKH JHQHUDO VWUXFWXUH D3 RU DDf3 7KH D DQG Df DUH FDWDO\WLFDOO\ DFWLYH ZKLOH WKH 3 VXEXQLW LV LQDFWLYH E\ LWVHOI EXW LW VWLPXODWHV WKH FDWDO\WLF DFWLYLW\ RI D WR IROG FDXVHV VWDELOL]DWLRQ RI D DQG PRUH LPSRUWDQWO\ FDQ FKDQJH WKH LQWHUDFWLRQV ZLWK VXEVWUDWHV DQG LQKLELWRUV $OOHQGH DQG $OOHQGH f &DVHLQ NLQDVH ,, LV XQXVXDO DPRQJ WKH SURWHLQ NLQDVHV LQ WKDW LW FDQ XVH ERWK $73 DQG *73 DV SKRVSKDWH GRQRUV 7KHUH DUH PRUH WKDQ GLIIHUHQW SURWHLQ VXEVWUDWHV WKDW DUH SKRVSKRU\ODWHG E\ &. PDQ\ RI WKHP LQYROYHG LQ '1$ UHSOLFDWLRQ WUDQVFULSWLRQ DQG VLJQDO WUDQVGXFWLRQ ,W KDV EHHQ GHPRQVWUDWHG WKDW RQH RI WKH PDMRU EUDLQ VXEVWUDWHV IRU &. LV V\QDSWRWDJPLQ DQ DEXQGDQW V\QDSWLF YHVLFOH SURWHLQ WKDW KDV EHHQ LPSOLFDWHG LQ YHVLFOH GRFNLQJ DQG IXVLRQ ZLWK WKH SODVPD PHPEUDQH 'DYOHWRY HW DO f 6\QDSWRWDJPLQ ELQGV &D DQG SKRVSKROLSLGV DW FRQFHQWUDWLRQV WKDW DUH WKRXJKW WR RFFXU SK\VLRORJLFDOO\ LQ WKH QHUYH WHUPLQDO GXULQJ GHSRODUL]DWLRQ VXJJHVWLQJ WKDW LW PD\ EH D UHJXODWRU\ &DELQGLQJ SURWHLQ LQYROYHG LQ V\QDSWLF YHVLFOH H[RF\WRVLV 6\QDSWRWDJPLQ LV SDUW RI D WHWUDPHU ZLWK PXOWLSOH &DELQGLQJ VLWHV DQG UHSUHVHQWV WKH RQO\ NQRZQ &DELQGLQJ SURWHLQ RQ WKH V\QDSWLF YHVLFOH VXUIDFH DQG WKH ILUVW PHPEUDQHERXQG SXWDWLYH UHJXODWRU\ &DELQGLQJ SURWHLQ 'DYOHWRY HW DO f &D FDXVHV DQ LQFUHDVH LQ WKH SKRVSKRU\ODWLRQ RI

PAGE 111

V\QDSWRWDJPLQ E\ &. DQG QRW E\ D &DGHSHQGHQW NLQDVH 7KH PHFKDQLVP RI WKLV DFWLYDWLRQ LV XQFOHDU EXW LW FRXOG EH UHODWHG WR WKH IDFW WKDW V\QDSWRWDJPLQ LV D &D DQG SKRVSKROLSLGELQGLQJ SURWHLQ WKDW PD\ XQGHUJR &DGHSHQGHQW FRQIRUPDWLRQDO FKDQJHV 6\QDSWRWDJPLQ KDV EHHQ UHSRUWHG WR LQWHUDFW ZLWK VHYHUDO GLIIHUHQW SODVPD PHPEUDQH SURWHLQV LQFOXGLQJ V\QWD[LQ DQG PD\ KDYH D UROH LQ WKH GRFNLQJ RI V\QDSWLF YHVLFOHV ,W LV WKH RQO\ RQH RI WKH PDMRU V\QDSWLF YHVLFOH SURWHLQV ZLWK D SXWDWLYH IXQFWLRQ LQ YHVLFXODU WUDIILFNLQJ WKDW LV DOVR IRXQG RQ RWKHU VHFUHWRU\ YHVLFOHV ZLWK &DUHJXODWHG H[RF\WRVLV 3HULQ HW DO f 7KLV VXJJHVWV WKDW LI V\QDSWRWDJPLQ IXQFWLRQV LQ WKH ILQDO VWHSV RI YHVLFOH H[RF\WRVLV WKHVH VWHSV PD\ EH VLPLODU LQ GLIIHUHQW VHFUHWRU\ SDWKZD\V 7KH SRWHQWLDO VLJQLILFDQFH RI WKH SKRVSKRU\ODWLRQ RI V\QDSWRWDJPLQ E\ FDVHLQ NLQDVH ,, LV VXSSRUWHG E\ WKH ILQGLQJ WKDW V\QDSWRWDJPLQ LV D YHU\ HIILFLHQW VXEVWUDWH EHWWHU WKDQ FDVHLQf IRU &. DQG QRW IRU RWKHU NLQDVHV 'DYOHWRY HW DO f 7KH SKRVSKRU\ODWLRQ VLWH LV SUHVHQW LQ ERWK V\QDSWRWDJPLQV DQG ,, DQG LV HYROXWLRQDULO\ FRQVHUYHG LQ GLIIHUHQW VSHFLHV %HQQHW HW DO GHPRQVWUDWHG WKDW FDVHLQ NLQDVH ,, QRW RQO\ SKRVSKRU\ODWHV V\QDSWRWDJPLQ EXW DOVR LQWHUDFWV ZLWK D GRPDLQ RI V\QDSWRWDJPLQ WKDW LV GLVWLQFW IURP WKH SKRVSKRU\ODWLRQ VLWH 7KH IXQFWLRQDO VLJQLILFDQFH RI WKH &.V\QDSWRWDJPLQ DVVRFLDWLRQ LV XQFOHDU EXW LW SUREDEO\ GRHV QRW VLPSO\ UHSUHVHQW DQ HQ]\PH cVXEVWUDWH LQWHUDFWLRQ DQG PD\ KDYH D PRGXODWRU\ UROH LQ QHUYH WHUPLQDO IXQFWLRQ 7KH LQYROYHPHQW RI FDVHLQ NLQDVH ,, LQ V\QDSWLF YHVLFOH WUDIILFNLQJ ZDV IXUWKHU VXSSRUWHG E\ WKH ILQGLQJV RI %HQQHW HW DO DQG +LUOLQJ DQG 6FKHOOHU WKDW &. SKRVSKRU\ODWHV V\QWD[LQ DQG SRVVLEO\ V\QDSWREUHYLQ WKH WZR PDLQ QHXURQDO 61$5(V FDOOHG DOVR W61$5( DQG Y61$5( UHVSHFWLYHO\ 7KH LQWHUDFWLRQ EHWZHHQ V\QWD[LQ DQG V\QDSWREUHYLQ LV FRQVLGHUHG RQH RI WKH FULWLFDO VWHSV LQ YHVLFOH GRFNLQJ DQG

PAGE 112

IXVLRQ ,Q JHQHUDO SURWHLQ SKRVSKRU\ODWLRQ KDV EHHQ ZHOO HVWDEOLVKHG DV D UHJXODWRU\ PHFKDQLVP IRU YHVLFOH WUDQVSRUW WKH V\QDSWLF YHVLFOH SURWHLQ V\QDSVLQ E\ &DFDOPRGXOLQGHSHQGHQW SURWHLQ NLQDVH ,, UHJXODWHV LWV LQWHUDFWLRQ ZLWK ERWK V\QDSWLF YHVLFOHV DQG DFWLQ ILODPHQWV 6FKLHEOHU HW DO %HQIHQDWL HW DO f 7KLV LQ WXUQ PD\ UHJXODWH WKH DYDLODELOLW\ RI V\QDSWLF YHVLFOHV IRU UHOHDVH 6LPLODUO\ SKRVSKRU\ODWLRQ RI QVHFO E\ SURWHLQ NLQDVH & KDV EHHQ VKRZQ WR UHJXODWH WKH QVHFOV\QWD[LQ ELQGLQJ )XMLWD HW DO f &. LV DOVR LQGLUHFWO\ LQYROYHG LQ WKH UHJXODWLRQ RI V\QDSWLF YHVLFOH WUDQVSRUW E\ SKRVSKRU\ODWLQJ FDOPRGXOLQ DQG 3.& ZKLFK DUH NQRZQ WR SOD\ LPSRUWDQW UROHV LQ WKLV SURFHVV &DVHLQ NLQDVH ,, FRXOG EH FRSXULILHG ZLWK FODWKULQFRDWHG YHVLFOHV DQG LW FRXOG SKRVSKRU\ODWH WKH 3OLJKW FKDLQ RI FODWKULQ LPSOLFDWLQJ &. LQ YHVLFXODU WUDIILFNLQJ LQ JHQHUDO /<67 KDV VHYHUDO VLWHV RI SRWHQWLDO SKRVSKRU\ODWLRQ E\ FDVHLQ NLQDVH ,, +RZHYHU WKH &./<67 LQWHUDFWLRQ GHWHFWHG E\ WKH \HDVW WZRK\EULG V\VWHP LV QRW RQH RI HQ]\PH DQG VXEVWUDWH VLQFH WKH 3VXEXQLW RI &. ZKLFK LQWHUDFWV ZLWK /<67 KDV D UHJXODWRU\ DQG QRW D FDWDO\WLF DFWLYLW\ 7KLV GRHV QRW KRZHYHU H[FOXGH WKH SRVVLELOLW\ WKDW /<67 LV SKRVSKRU\ODWHG E\ WKH FDWDO\WLF DVXEXQLW RI &. $ VLPLODU H[DPSOH RI GLVWLQFW SKRVSKRU\ODWLRQ DQG LQWHUDFWLRQ EHWZHHQ V\QDSWRWDJPLQ DQG FDVHLQ NLQDVH ,, ZDV GHVFULEHG DERYH 7KH LQYROYHPHQW RI &. LQ WKH UHJXODWLRQ RI V\QDSWLF YHVLFOH H[RF\WRVLV DQG YHVLFXODU WUDIILFNLQJ ZKHUH /<67 LV H[SHFWHG WR SHUIRUP LWV IXQFWLRQ IXUWKHU VXSSRUWV WKH GHWHFWHG LQWHUDFWLRQ EHWZHHQ WKHVH PROHFXOHV E\ WKH \HDVW WZRK\EULG PHWKRG

PAGE 113

&DOPRGXOLQ &D0f DQ DEXQGDQW &DELQGLQJ SURWHLQ IRXQG LQ DOO HXNDU\RWLF FHOOV WKDW KDYH EHHQ VWXGLHG ,W LV D KLJKO\ FRQVHUYHG VLQJOH SRO\SHSWLGH FKDLQ ZLWK IRXU KLJKDIILQLW\ &D ELQGLQJ VLWHV DQG LW XQGHUJRHV D FRQIRUPDWLRQDO FKDQJH ZKHQ LW ELQGV &D &D0 IXQFWLRQV DV D PXOWLSXUSRVH LQWUDFHOOXODU &D UHFHSWRU PHGLDWLQJ PDQ\ &D UHJXODWHG SURFHVVHV &DOPRGXOLQ KDV QR HQ]\PH DFWLYLW\ E\ LWVHOI EXW DFWV E\ ELQGLQJ WR RWKHU SURWHLQV DQG DOWHULQJ WKHLU DFWLYLW\ $PRQJ WKH WDUJHWV UHJXODWHG E\ &DFDOPRGXOLQ DUH YDULRXV HQ]\PHV DQG PHPEUDQH WUDQVSRUW SURWHLQV ,Q PDQ\ FHOOV IRU H[DPSOH &DFDOPRGXOLQ ELQGV WR DQG DFWLYDWHV WKH SODVPD PHPEUDQH &D$73DVH WKDW SXPSV &D RXW RI WKH FHOO 0RVW HIIHFWV RI &DFDOPRGXOLQ KRZHYHU DUH PRUH LQGLUHFW DQG DUH PHGLDWHG E\ &DFDOPRGXOLQGHSHQGHQW SURWHLQ NLQDVHV &D0NLQDVHVf $OEHUWV HW DO f 7KHVH HQ]\PHV SKRVSKRU\ODWH VHULQHV RU WKUHRQLQHV LQ SURWHLQV DQG WKH UHVSRQVH RI D WDUJHW FHOO WR DQ LQFUHDVH LQ IUHH &D FRQFHQWUDWLRQ GHSHQGV RQ ZKLFK &D0NLQDVH UHJXODWHG WDUJHW SURWHLQV DUH SUHVHQW LQ WKH FHOO 7KH EHVW VWXGLHG H[DPSOH LV &D0NLQDVH ,, ZKLFK LV IRXQG LQ DOO DQLPDO FHOOV EXW LV HVSHFLDOO\ HQULFKHG LQ WKH QHUYRXV V\VWHP ZKHUH LW LV KLJKO\ FRQFHQWUDWHG LQ V\QDSVHV :KHQ QHXURQV WKDW XVH FDWHFKRODPLQHV DV WKHLU QHXURWUDQVPLWWHUV DUH DFWLYDWHG WKH LQIOX[ RI &D WKURXJK WKH SODVPD PHPEUDQH VWLPXODWHV WKH FHOO WR VHFUHWH WKHLU QHXURWUDQVPLWWHU 7KH &D LQIOX[ DOVR DFWLYDWHV &D0 NLQDVH ,, WR SKRVSKRU\ODWH DQG WKHUHE\ DFWLYDWH W\URVLQH K\GUR[\ODVHV WKH VDPH HQ]\PHV WKDW DUH DFWLYDWHG E\ WKH SURWHLQV DV GHVFULEHG DERYH &D0NLQDVH ,, FDQ IXQFWLRQ DV D PROHFXODU PHPRU\ GHYLFH VZLWFKLQJ WR DQ DFWLYH VWDWH ZKHQ H[SRVHG WR &DFDOPRGXOLQ DQG WKHQ UHPDLQLQJ DFWLYH GXH WR DXWRSKRVSKRU\ODWLRQ HYHQ DIWHU &D LV ZLWKGUDZQ ,W KDV EHHQ VKRZQ WKDW &D0NLQDVH ,, SKRVSKRU\ODWHV D QXPEHU RI QHUYH

PAGE 114

WHUPLQDO SURWHLQV LQFOXGLQJ V\QWD[LQ V\QDSWREUHYLQ 61$3 D61$3 16) DQG V\QDSWRWDJPLQ LQGLFDWLQJ D VLJQLILFDQW LQYROYHPHQW RI WKLV NLQDVH LQ QHXURWUDQVPLWWHU UHOHDVH +LUOLQJ DQG 6FKHOOHU f 7KHUH LV FRQYLQFLQJ HYLGHQFH WKDW FDOPRGXOLQ LV LQYROYHG LQ QHXURWUDQVPLWWHU UHOHDVH DQG VHFUHWLRQ LQ JHQHUDO ,W LV SUHVHQW LQ QHUYH WHUPLQDOV DQG LV DVVRFLDWHG ZLWK V\QDSWLF YHVLFOHV 'H/RUHQ]R f DV ZHOO DV ZLWK RWKHU VHFUHWRU\ YHVLFOHV SODWHOHW D JUDQXOHV FKURPDIILQ YHVLFOHV DQG SRVWHULRU SLWXLWDU\ VHFUHWRU\ JUDQXOHV :LWK WKH XVH RI GLIIHUHQW DQWDJRQLVWV FDOPRGXOLQ KDV EHHQ LPSOLFDWHG LQ VHFUHWLRQ LQ D QXPEHU RI FHOO V\VWHPV LQFOXGLQJ DGUHQDO PHGXOOD HQGRFULQH SDQFUHDV DQWHULRU SLWXLWDU\ SODWHOHWV PDVW FHOOV DGUHQDO FRUWH[ QHUYH WHUPLQDOV DQG OHXNRF\WHV 7ULIDUR HW DO f &DOPRGXOLQ LV RQH RI WKH SURWHLQV IURP D FUXGH F\WRVRO IUDFWLRQ WKDW ZLOO ELQG WR FKURPDIILQ JUDQXOHV LQ WKH SUHVHQFH RI &D 7KLV ELQGLQJ LQYROYHV VSHFLILF SURWHLQV RQ WKH F\WRSODVPLF VXUIDFH RI WKH JUDQXOHV 7ZR PDMRU &DGHSHQGHQW FDOPRGXOLQ ELQGLQJ SURWHLQV RI WKH FKURPDIILQ JUDQXOH PHPEUDQH KDYH EHHQ GHVFULEHG DQG RQH RI WKHP KDV EHHQ LGHQWLILHG DV WKH LQWHJUDO PHPEUDQH SURWHLQ V\QDSWRWDJPLQ Sf ZKLFK DOVR LQWHUDFWV ZLWK DQG LV SKRVSKRU\ODWHG E\ FDVHLQ NLQDVH ,, DV GHVFULEHG DERYH $OWKRXJK WKH VLJQLILFDQFH RI WKH JUDQXOH PHPEUDQH&D0 ELQGLQJ LV XQFOHDU WKH IDFW WKDW V\QDSWRWDJPLQ LV D FRPSRQHQW RI V\QDSWLF DQG VHFUHWRU\ YHVLFOHV IURP VHYHUDO W\SHV VXJJHVWV WKDW FDOPRGXOLQ ELQGLQJ WR WKLV SURWHLQ PD\ SDUWLFLSDWH LQ WKH FRQWURO RI H[RF\WRVLV ,Q DJUHHPHQW ZLWK WKHVH UHVXOWV KLJKDIILQLW\ ELQGLQJ VLWHV IRU FDOPRGXOLQ KDYH EHHQ IRXQG LQ FRDWHG YHVLFOHV 0RVNRZLW] HW DO f :KHQ DQWLFDOPRGXOLQ DQWLERGLHV DUH LQWURGXFHG LQWR FKURPDIILQ FHOOV VHFUHWLRQ LV LQKLELWHG LQGLFDWLQJ LQYROYHPHQW RI &D0 LQ H[RF\WRVLV 6LPLODU UHVXOWV KDYH

PAGE 115

EHHQ REWDLQHG ZLWK DQWLFDOPRGXOLQ DQWLERGLHV LQ RWKHU V\VWHPV DV ZHOO 7ULIDUR HW DO f VXSSRUWLQJ D UROH IRU &D0 LQ VHFUHWLRQ )XVLRQ H[SHULPHQWV FDUULHG RXW ZLWK SODVPD PHPEUDQHV DQG DQWHULRU SLWXLWDU\ VHFUHWRU\ JUDQXOHV RU SDQFUHDWLF JUDQXOHV KDYH LQGLFDWHG WKH UHTXLUHPHQW RI FDOPRGXOLQ IRU YHVLFOHSODVPD PHPEUDQH IXVLRQ SURFHVVHV :DWNLQV DQG &RRSHUVWHLQ f $GGLWLRQ RI FDOPRGXOLQ WR SHUPHDELOL]HG FKURPDIILQ FHOOV LQFUHDVHG &DGHSHQGHQW QRUHSLQHSKULQH UHOHDVH LQ D GRVHGHSHQGHQW DQG &D0 VSHFLILF PDQQHU 7KH HQKDQFHG QRUHSLQHSKULQH UHOHDVH ZDV LQKLELWHG E\ WHWDQXV WR[LQ LQGLFDWLQJ WKDW FDOPRGXOLQ SOD\V DQ LPSRUWDQW UROH LQ H[RF\WRVLV IURP FKURPDIILQ FHOOV 0DWVXGD HW DO f 6LPLODUO\ H[RF\WRVLV RI FRUWLFDO JUDQXOHV FDXVHG E\ DQ LQFUHDVH RI &D FRQWHQW LPPHGLDWHO\ XSRQ IHUWLOL]DWLRQ RI VHD XUFKLQ HJJV DSSHDUV WR EH FRQWUROOHG E\ &DFDOPRGXOLQ ,QFXEDWLRQ ZLWK DQWLERGLHV DJDLQVW &D0 FDXVHV D ORVV RI VHQVLWLYLW\ WR &D 6HQVLWLYLW\ LV UHVWRUHG ZKHQ FDOPRGXOLQ LV DGGHG LQ H[FHVV WR LQKLELWHG SUHSDUDWLRQV &RUWLFDO H[RF\WRVLV LV DOVR LQKLELWHG E\ &D0DQWDJRQLVWV DGGHG WR VHD XUFKLQ HJJV .UHLPHU DQG .KRWLPFKHQNR f %\ XVLQJ VWDJHVSHFLILF DVVD\V IRU $73GHSHQGHQW SULPLQJ DQG &DPHGLDWHG WULJJHULQJ RI H[RF\WRVLV &KDPEHUODLQ HW DO GHPRQVWUDWHG WKDW FDOPRGXOLQ DFWHG LQ WKH $73LQGHSHQGHQW WULJJHULQJ VWHS DQG VWLPXODWHG H[RF\WRVLV $Q LQGLUHFW SDUWLFLSDWLRQ RI &D0 LQ QHXURWUDQVPLWWHU UHOHDVH PD\ LQYROYH FDOFLQHXULQ D &DFDOPRGXOLQGHSHQGHQW SURWHLQ SKRVSKDWDVH WKDW LV HQULFKHG LQ QHXUDO WLVVXHV $PRQJ WKH VHULQHWKUHRQLQH SURWHLQ SKRVSKDWDVHV FDOFLQHXULQ LV XQLTXH LQ LWV UHTXLUHPHQW IRU &DFDOPRGXOLQ DFWLYDWLRQ $ YDULHW\ RI LRQ FKDQQHOV ERWK OLJDQG DQG YROWDJHJDWHGf WKDW SOD\ PDMRU UROHV LQ UHJXODWLQJ QHXURQDO H[FLWDELOLW\ DQG WUDQVPLWWHU UHOHDVH DSSHDU WR EH QHJDWLYHO\ UHJXODWHG E\ FDOFLQHXULQ ,Q DGGLWLRQ WKH

PAGE 116

UHOHDVH RI JOXWDPDWH IURP SUHV\QDSWLF WHUPLQDOV DQG KRUPRQH VHFUHWLRQ LQ SDQFUHDWLF 3 FHOOV DQG SLWXLWDU\ FHOOV DOVR VHHP WR EH XQGHU QHJDWLYH UHJXODWLRQ E\ FDOFLQHXULQ
PAGE 117

DQG .LWDPXUD f 7\URVLQH SKRVSKRU\ODWLRQ RI +UV ZDV DOVR LQGXFHG LQ FHOOV WUHDWHG ZLWK HSLGHUPDO JURZWK IDFWRU DQG SODWHOHWGHULYHG JURZWK IDFWRU VXJJHVWLQJ WKDW +UV PD\ SOD\ D UROH LQ WKH VLJQDO WUDQVGXFWLRQ SDWKZD\V RI GLIIHUHQW JURZWK IDFWRUV LQ D YDULHW\ RI FHOO W\SHV %HDQ HW DO GHPRQVWUDWHG WKDW +UV LV DQ $73DVH DQG WKDW LW LQWHUDFWV ZLWK 61$3 V\QDSWRVRPDODVVRFLDWHG SURWHLQ f D QHUYH WHUPLQDO SURWHLQ WKDW UHVLGHV RQ WKH LQWHUQDO VXUIDFH RI WKH SODVPD PHPEUDQH DQG LQWHUDFWV ZLWK V\QWD[LQ W61$5(f V\QDSWREUHYLQ Y61$5(f DQG D61$3 WR IRUP D FRUH FRPSOH[ WKRXJKW WR EH DQ LQWHUPHGLDWH LQ D ELRFKHPLFDO SDWKZD\ WKDW LV HVVHQWLDO IRU YHVLFXODU WUDQVSRUW 7KH ELQGLQJ RI +UV WR 61$3 LV LQKLELWHG E\ &D LQ WKH SK\VLRORJLFDO FRQFHQWUDWLRQ UDQJH WKDW VXSSRUWV V\QDSWLF WUDQVPLVVLRQ +UV LV H[SUHVVHG DEXQGDQWO\ WKURXJKRXW WKH EUDLQ DQG LV SUHVHQW DW QHUYH WHUPLQDOV 5HFRPELQDQW +UV LQKLELWV &DWULJJHUHG QRUDGUHQDOLQH UHOHDVH IURP SHUPHDELOL]HG FHOOV LQ D GRVHGHSHQGHQW DQG VDWXUDEOH PDQQHU 7KH +UV 61$3 ELQGLQJ ZDV LQKLELWHG E\ =Q DQG WKH SUHYLRXVO\ UHSRUWHG HQKDQFHPHQW RI QHXURWUDQVPLWWHU UHOHDVH LQGXFHG E\ =Q VXJJHVWV WKDW WKH LQKLELWLRQ RI +UV61$3 ELQGLQJ PD\ IDFLOLWDWH WUDQVPLWWHU UHOHDVH 7KHVH GDWD SURYLGH D IXQFWLRQDO GHPRQVWUDWLRQ RI WKH DELOLW\ RI +UV WR UHJXODWH WKH VHFUHWRU\ SURFHVVHV WKURXJK &D DQG QXFOHRWLGH GHSHQGHQW PRGXODWLRQ RI YHVLFOH WUDIILFNLQJ SURWHLQ FRPSOH[HV ,W LV SRVVLEOH WKDW +UV SOD\V D UHJXODWRU\ UROH LQ YHVLFOH GRFNLQJ WKURXJK LWV $73DVH DFWLYLW\ DQG LQ ODWHU VWDJHV RI VHFUHWLRQ SRVVLEO\ PHPEUDQH IXVLRQ DV D UHVXOW RI FDOFLXPUHJXODWHG LQWHUDFWLRQ ZLWK 61$3 7KLV K\SRWKHVLV ZDV VXSSRUWHG E\ WKH ILQGLQJ WKDW +UV LV SHULSKHUDOO\ DVVRFLDWHG ZLWK WKH F\WRSODVPLF VXUIDFH RI HDUO\ HQGRVRPHV .RPDGD HW DO f %\

PAGE 118

VXEFHOOXODU IUDFWLRQDWLRQ +UV ZDV UHFRYHUHG ERWK LQ WKH F\WRSODVPLF DQG PHPEUDQH IUDFWLRQV 7KHVH UHVXOWV WRJHWKHU ZLWK WKH ILQGLQJ WKDW +UV LV KRPRORJRXV WR 9SVS D PROHFXOH HVVHQWLDO IRU SURWHLQ WUDIILFNLQJ WKURXJK D SUHYDFXRODU FRPSDUWPHQW LQ \HDVW VXJJHVW WKDW +UV LV LQYROYHG LQ HQGRVRPDO WUDQVSRUW ,W LV K\SRWKHVL]HG WKDW WKH JURZWK IDFWRUERXQG UHFHSWRU W\URVLQH NLQDVH LV LQWHUQDOL]HG DQG GHOLYHUHG WR WKH HDUO\ HQGRVPH ZKHUH LW SKRVSKRU\ODWHV +UV UHVLGLQJ RQ WKH F\WRSODVPLF VXUIDFH RI WKH HDUO\ HQGRVPH 7\URVLQH SKRVSKRU\ODWLRQ DFWLYDWHV +UV DQG LW VWLPXODWHV WKH YHVLFOH WUDQVSRUW RI WKH JURZWK IDFWRUUHFHSWRU FRPSOH[ WR WKH ODWH HQGRVPH DQG O\VRVRPH 7KHUHIRUH +UV PD\ EH D UHJXODWRU RI VHYHUDO W\SHV RI YHVLFXODU IXQFWLRQV HQGR DQG H[RF\WRVLVf LQ D YDULHW\ RI FHOOV ,Q DGGLWLRQ WR LWV UROH LQ WKH KHSDWRF\WH JURZWK IDFWRU LQWUDFHOOXODU VLJQDOLQJ SDWKZD\ +UV ZDV IRXQG WR LQWHUDFW ZLWK 67$0 VLJQDO WUDQVGXFLQJ DGDSWRU PROHFXOHf ZKLFK ZDV VKRZQ WR EH LQYROYHG LQ F\WRNLQHPHGLDWHG LQWUDFHOOXODU VLJQDO WUDQVGXFWLRQ $VDR HW DO f 7\URVLQH SKRVSKRU\ODWLRQ RI +UV ZDV LQGXFHG UDSLGO\ DIWHU VWLPXODWLRQ ZLWK ,/ DQG *0&6) DV ZHOO DV +*) 7KH PXWXDO DVVRFLDWLRQ VLWHV RI +UV DQG 67$0 LQFOXGH KLJKO\ FRQVHUYHG FRLOHGFRLO VHTXHQFHV VXJJHVWLQJ WKDW WKHLU DVVRFLDWLRQ LV PHGLDWHG E\ WKH FRLOHGFRLO VWUXFWXUHV ([RJHQRXV LQWURGXFWLRQ RI +UV VLJQLILFDQWO\ VXSSUHVVHG '1$ V\QWKHVLV XSRQ VWLPXODWLRQ ZLWK ,/ DQG *0&6) ZKLOH DQ +UV PXWDQW GHOHWHG RI WKH 67$0ELQGLQJ VLWH ORVW VXFK VXSSUHVVLYH DELOLW\ LH +UV 67$0 DVVRFLDWLRQ LV D SUHUHTXLVLWH IRU VXFK DFWLYLW\ 7KHVH UHVXOWV VXJJHVW WKDW +UV FRXQWHUDFWV WKH 67$0 IXQFWLRQ ZKLFK LV HVVHQWLDO IRU FHOO JURZWK VLJQDOLQJ PHGLDWHG E\ WKH F\WRNLQHV

PAGE 119

,OO 7KH LQYROYHPHQW RI +UV LQ ERWK VLJQDO WUDQVGXFWLRQ DQG YHVLFXODU WUDIILFNLQJ FRUUHODWHV ZHOO QRW RQO\ ZLWK WKH SUHGLFWHG IXQFWLRQ RI /<67 EXW DOVR ZLWK WKH UROHV RI WKH RWKHU /<67LQWHUDFWLQJ SURWHLQV GHWHFWHG E\ WKH \HDVW WZRK\EULG PHWKRG ,/ ZKLFK LQGXFHV UDSLG W\URVLQH SKRVSKRU\ODWLRQ RI +UV DOVR DFWLYDWHV WKH 6KF*UE6RV5DV 5DIOPLWRJHQDFWLYDWHG SURWHLQ NLQDVH FDVFDGH $VDR HW DO f 5DIL KDV EHHQ VKRZQ WR LQWHUDFW ZLWK SURWHLQV DQRWKHU /\VWLQWHUDFWLQJ SURWHLQf DV GHVFULEHG DERYH ,/ DOVR DFWLYDWHV )\Q W\URVLQH NLQDVH DQG WKH 6+ GRPDLQ RI )\Q KDV EHHQ UHSRUWHG WR LQWHUDFW ZLWK 5DIO 0RUULVRQ f SURYLGLQJ DQ DGGLWLRQDO OLQN WR DQG WKHUHIRUH WR /<67 7KLV DVVRFLDWLRQ LV VXSSRUWHG IXUWKHU E\ WKH ILQGLQJ RI LQWHUDFWLRQ EHWZHHQ DQG %FU D SURWHLQ NLQDVH WKDW LV LQYROYHG LQ WKH VDPH JURZWK IDFWRU VLJQDOLQJ 6KF*UE6RV5DV5DIO0$3NLQDVH FDVFDGH 2Q WKH RWKHU KDQG LW KDV EHHQ GHPRQVWUDWHG WKDW +UV LV KRPRORJRXV WR 9SVS D \HDVW SURWHLQ ORFDOL]HG WR WKH SUHYDFXRODU FRPSDUWPHQW FRQVLGHUHG WR EH WKH FRXQWHUSDUW RI PDPPDOLDQ HQGRVRPHV 936 LV RQH RI WKH JHQHV ZKRVH GLVUXSWLRQ LQ 6 FHUHYLVLDH G\VUHJXODWHV WKH WUDIILF RI HQGRF\WRVHG SURWHLQV DQG QHZO\ V\QWKHVL]HG YDFXRODU SURWHLQV WR YDFXROHV D FRXQWHUSDUW RI PDPPDOLDQ O\VRVRPHVf DQG FDXVHV WKH DFFXPXODWLRQ RI WKHVH SURWHLQV LQ D SUHYDFXRODU FRPSDUWPHQW 7KH ILQGLQJ WKDW +UV LV ORFDOL]HG WR WKH F\WRSODVPLF VXUIDFH RI HDUO\ HQGRVRPHV LQGLFDWHV WKDW LQ PDPPDOLDQ FHOOV +UV PD\ SOD\ D UROH VLPLODU WR WKDW RI 9SVS LQ \HDVW 7KH LQYROYHPHQW RI +UV LQ &DUHJXODWHG VHFUHWLRQ DQG LWV LQWHUDFWLRQ ZLWK 61$3 D SURWHLQ WKDW IXQFWLRQV LQ H[RF\WRVLV RI QHXURWUDQVPLWWHU YHVLFOHV IXUWKHU VXSSRUWV WKH /<67+UV LQWHUDFWLRQ GHWHFWHG E\ WKH \HDVW WZRK\EULG V\VWHP 7KH UHVW RI WKH SUHYLRXVO\ SXEOLVKHG SURWHLQV LGHQWLILHG DV /<67LQWHUDFWDQWV E\ WKH \HDVW WZRK\EULG VFUHHQV DUH QRW DV REYLRXVO\ LQYROYHG LQ YHVLFXODU WUDIILFNLQJ DQG LWV

PAGE 120

UHJXODWLRQ DV WKH DERYH GHVFULEHG SURWHLQV FDVHLQ NLQDVH ,, FDOPRGXOLQ DQG +UV +RZHYHU IRU PRVW RI WKHVH SURWHLQV WKHUH DUH VRPH IXQFWLRQDO DQGRU PRUSKRORJLFDO LQGLFDWLRQV WKDW WKH\ PD\ SDUWLFLSDWH LQ WKH VDPH SDWKZD\V DV /<67 &. &D0 DQG +UV $WURSKLQ WKH JHQH UHVSRQVLEOH IRU GHQWDWRUXEUDO SDOOLGROX\VLDQ DWURSK\ '53/$ 6PLWKfV GLVHDVHf D UDUH DXWRVRPDO GRPLQDQW QHXURGHJHQHUDWLYH GLVRUGHU FKDUDFWHUL]HG E\ FHUHEHOODU DWD[LD P\RFORQLF HSLOHSV\ FKRUHRDWKHWRVLV DQG GHPHQWLD 7KH PROHFXODU GHIHFW LQ '53/$ LV DQ H[SDQVLRQ RI D &$* WULQXFOHRWLGH UHSHDW HQFRGLQJ JOXWDPLQHf LQ DWURSKLQ 7KH JHQH LV H[SUHVVHG LQ PDQ\ PDPPDOLDQ EXW QRW LQ DYLDQf VSHFLHV LQ DOO EUDLQ UHJLRQV WHVWHG PRVW DEXQGDQWO\ LQ FHUHEHOOXP 7KHUH LV QR GHWHFWDEOH GLIIHUHQFH LQ WKH OHYHO RU GLVWULEXWLRQ RI DWURSKLQ H[SUHVVLRQ EHWZHHQ QRUPDO DQG '53/$EUDLQ LQGLFDWLQJ WKDW GLVHDVH SDWKRORJ\ PD\ UHVXOW IURP DOWHUHG SURWHLQ IXQFWLRQ 0DUJROLV HW DO f ,PPXQRKLVWRFKHPLFDO VWXGLHV GHPRQVWUDWHG SUHGRPLQDQWO\ F\WRSODVPLF VLJQDO ZLWK SURPLQHQW JUDQXODU DQG SXQFWDWH VWDLQLQJ ZLWKLQ FHOO ERGLHV DQG GHQGULWHV VXJJHVWLQJ WKDW DWURSKLQ PD\ SOD\ D UROH LQ YHVLFOH WUDQVSRUW .QLJKW HW DO
PAGE 121

,PRJHQ D QRYHO a N'D SURWHLQ UHFRJQL]HG E\ D 7 FHOO FORQH IURP D W\SH GLDEHWLF SDWLHQW 7KH SURWHLQ LV H[SUHVVHG DW YDULDEOH OHYHOV LQ PDQ\ WLVVXHV DQG FHOO OLQHV 7KHUH LV VRPH GLVFUHSDQF\ UHJDUGLQJ WKH VXEFHOOXODU ORFDOL]DWLRQ RI LPRJHQ $UGHQ HW DO f VKRZHG WKDW WKH PLWRFKRQGULRQ LV WKH PDMRU VLWH RI WKH SURWHLQ DOWKRXJK WKHUH ZDV VRPH RYHUODS RI WKH DQWLJHQ GLVWULEXWLRQ ZLWK WKDW RI VHFUHWRU\ JUDQXOHVf ZKLOH 5RHS HW DO f GHWHUPLQHG WKDW LPRJHQ ZDV DVVRFLDWHG ZLWK LQVXOLQ VHFUHWRU\ JUDQXOHV $OWKRXJK WKH SUHFLVH IXQFWLRQ RI WKH SURWHLQ LV QRW NQRZQ LWV YHVLFXODU ORFDOL]DWLRQ VXJJHVWV D SRVVLEOH LQYROYHPHQW LQ VHFUHWLRQ LQGLUHFWO\ VXSSRUWLQJ WKH GHWHFWHG /<67LPRJHQ LQWHUDFWLRQ E\ WKH \HDVW WZRK\EULG V\VWHP (PEU\RQDO )\Q VXEVWUDWH (IVf DQ LVRIRUP RI WKH (IV JHQH ODFNLQJ WKH 6+ GRPDLQ (IV ZDV RULJLQDOO\ GLVFRYHUHG WKURXJK LWV )\QELQGLQJ FDSDFLW\ (PEU\RQDO )\Q VXEVWUDWH KDV FKDUDFWHULVWLF UHJLRQV LPSRUWDQW LQ LQWUDFHOOXODU VLJQDO WUDQVGXFWLRQ DQ 6+ GRPDLQ D FOXVWHU RI SXWDWLYH OLJDQGV IRU 6+ GRPDLQV DQG SUROLQHULFK VHTXHQFHV ZLWK 6+ELQGLQJ FRQVHQVXV 7KH SURWHLQ ZDV QDPHG fHPEU\RQDO )\Q VXEVWUDWHf EHFDXVH LWV 51$ ZDV PRVW DEXQGDQWO\ H[SUHVVHG LQ HPEU\R DOWKRXJK H[SUHVVLRQ ZDV VKRZQ LQ PDQ\ DGXOW WLVVXHV DV ZHOO ,VKLQR HW DO f 7KH 6+ GRPDLQ KDV EHHQ VKRZQ WR PHGLDWH VSHFLILF ELQGLQJ RI 6RVO WR *UE DQG WKLV LPSRUWDQW SURWHLQSURWHLQ LQWHUDFWLRQ OLQNV WKH W\URVLQH NLQDVH SDWKZD\ LQLWLDWHG DW WKH PHPEUDQH VXUIDFH WR WKH 5DV SDWKZD\ (IV ZKLFK ODFNV WKH 6+ GRPDLQ PD\ SDUWLFLSDWH LQ WKH UHJXODWLRQ RI FRXSOLQJ RI WKHVH VLJQDOLQJ SURWHLQV 7KH DVVRFLDWLRQV RI (IV(IV ZLWK WKH W\URVLQH NLQDVH )\Q DQG ZLWK WKH *UE6RVO5DV SDWKZD\ LQGLFDWH LWV SRVVLEOH LQYROYHPHQW LQ WKH VDPH SURFHVVHV DV +UV DQG WZR RWKHU /<67LQWHUDFWLQJ SURWHLQV

PAGE 122

,PSRUWLQ 3VXEXQLW D N'D SURWHLQ WKDW ELQGV WKH N'D DVXEXQLW IRUPLQJ D KHWHURGLPHU FDOOHG LPSRUWLQ RU NDU\RSKHULQ 7KH DVXEXQLW UHFRJQL]HV WKH QXFOHDU ORFDOL]DWLRQ VLJQDO 1/6f RI D FDUJR SURWHLQ FDOOHG NDU\RSKLOHf WKDW LV WR EH WUDQVSRUWHG IURP WKH F\WRSODVP WKURXJK D QXFOHDU SRUH LQWR WKH QXFOHXV ZKLOH WKH 3 VXEXQLW ILUVW GRFNV WKH DSNDU\RSKLOH FRPSOH[ DW WKH F\WRSODVPLF IDFH RI WKH QXFOHDU SRUH DQG WKHQ PHGLDWHV WKH WUDQVORFDWLRQ E\ LQWHUDFWLQJ ZLWK WKH SRUH SURWHLQV 7KH VPDOO *73DVH 5DQ DV ZHOO DV D FRIDFWRU FDOOHG SO2 SL RU 17) DUH UHTXLUHG IRU QXFOHDU LPSRUW 5DQ*73 GLVVRFLDWHV D IURP 3 DQG PD\ SURPRWH WKH WUDQVORFDWLRQ RI WKH DSNDU\RSKLOH FRPSOH[ DFURVV WKH SRUH DQG WKH UHOHDVH RI WKH FRPSOH[ IURP WKH QXFOHDU VLGH RI WKH SRUH /DVNH\ HW DO f ,QWHUHVWLQJO\ ERWK LPSRUWLQ D DQG 3 FRQVLVW ODUJHO\ RI UHSHDWHG GRPDLQV WKH VR FDOOHG DUP UHSHDWV ZKLFK DUH DOVR SUHVHQW LQ /<67 7KHVH UHSHDWV DUH IRXQG LQ VHYHUDO IXQFWLRQDOO\ XQUHODWHG SURWHLQV LQFOXGLQJ WKH IRXQGHU PHPEHU RI WKH IDPLO\ WKH 'URVRSKLOD DUPDGLOOR SURWHLQ 3HLIHU HW DO f ,PSRUWLQ D KDV DUP UHSHDWV ZKLOH LPSRUWLQ 3 KDV PRUH GLYHUJHQW UHSHDWV DOWKRXJK WKH SUHFLVH QXPEHU GHSHQGV RQ KRZ WKH GRPDLQV DUH GHILQHG 7KH 1/6 ELQGV GLUHFWO\ WR WKH DUP UHSHDW UHJLRQ RI WKH DVXEXQLW %HVLGHV WKH SUHVHQFH RI WKH DUP UHSHDWV WKH RQO\ RWKHU FRPPRQ IHDWXUH RI /<67 DQG LPSRUWLQ S LV WKDW ERWK SURWHLQV DUH LQYROYHG LQ SURWHLQ WUDQVSRUW DOWKRXJK LPSRUWLQ SOD\V D UROH LQ QXFOHDU WUDQVSRUW ZKLOH /<67 LV H[SHFWHG WR SDUWLFLSDWH LQ YHVLFXODU SURWHLQ WUDIILFNLQJ (VWURJHQ UHFHSWRUUHODWHG SURWHLQ (55f D PHPEHU RI WKH QXFOHDU KRUPRQH UHFHSWRU VXSHUIDPLO\ RI ]LQF ILQJHU WUDQVFULSWLRQ IDFWRUV 7KH (55 GLIIHUV IURP WKH FODVVLFDO QXFOHDU KRUPRQH UHFHSWRUV LQ WKDW LW KDV QR NQRZQ OLJDQG PDNLQJ LW DQ fRUSKDQ

PAGE 123

UHFHSWRUf ,W KDV EHHQ VKRZQ WKDW WKH WUDQVFULSWLRQ DFWLYLW\ PHGLDWHG E\ WKH JOXFRFRUWLFRLG UHFHSWRU ZDV VWURQJO\ VXSSUHVVHG E\ HVWURJHQ UHFHSWRUUHODWHG SURWHLQ LQ D FHOO DQG UHFHSWRUVSHFLILF PDQQHU 7UDSS DQG +ROVERHU f +RZHYHU (55 DFWLYDWHV HVWURJHQ UHFHSWRUPHGLDWHG UHVSRQVH RI WKH ODFWRIHUULQ JHQH SURPRWHU E\ ELQGLQJ WR D UHJXODWRU\ '1$ VHTXHQFH XSVWUHDP RI WKH HVWURJHQ UHVSRQVH HOHPHQW
PAGE 124

GLVVHUWDWLRQ 1RWDEO\ RQH RI WKH LQWHUDFWDQWV ,3f LV D QRYHO SURWHLQ ZLWK KRPRORJ\ WR WKH FKDSHURQH 7&3 0ROHFXODU FKDSHURQHV JXLGH WKH IROGLQJ RI QHZO\ V\QWKHVL]HG SURWHLQV WKURXJK D fPROWHQ JOREXOHf VWDWH WR WKH ILQDO FRUUHFW SURWHLQ FRQIRUPDWLRQ (XNDU\RWLF FHOOV KDYH FKDSHURQH SURWHLQV RI WKH KVS DQG KVS KHDWVKRFN SURWHLQVf IDPLOLHV 'LIIHUHQW IDPLO\ PHPEHUV KDYH VSHFLILF VXEFHOOXODU GLVWULEXWLRQ DQG IXQFWLRQ LQ GLIIHUHQW RUJDQHOOHV HJ PLWRFKRQGULD FRQWDLQ WKHLU RZQ KVS DQG KVS PROHFXOHV WKDW DUH GLVWLQFW IURP WKRVH WKDW IXQFWLRQ LQ WKH F\WRVRO $ VSHFLDO KVS FKDSHURQH FDOOHG ELQGLQJ SURWHLQ %L3f QRW RQO\ KHOSV LQ SURWHLQ IROGLQJ LQ WKH HQGRSODVPLF UHWLFXOXP EXW DOVR NHHSV WKH UHVLGHQW SURWHLQV LQ WKH (5 DQG WKXV RXW RI WKH *ROJL DSSDUDWXV DQG WKH UHVW RI WKH VHFUHWRU\ SDWKZD\ ,Q &+6 FHOOV WKHUH LV FRPSDUWPHQWDO PLVVVRUWLQJ RI SURWHLQV VXFK DV HODVWDVH 3JOXFXURQLGDVH DQG FDWKHSVLQ +ROFRPEH HW DO f ,Q DGGLWLRQ WKH ORZ W\URVLQDVH DFWLYLW\ LQ JLDQW PHODQRVRPHV UHVXOWV IURP PLVORFDOL]DWLRQ DQG HYHQWXDO H[WUDFHOOXODU VHFUHWLRQ RI W\URVLQDVH 7KHVH REVHUYDWLRQV VXSSRUW WKH GHWHFWHG /<67,3 LQWHUDFWLRQ VLQFH LW LV SRVVLEOH WKDW WKH SURWHLQ PLVVVRUWLQJ GHPRQVWUDWHG LQ &+6 FHOOV LV UHODWHG WR GHILFLHQW 7&3OOLNH FKDSHURQH IXQFWLRQ LQ WKH DEVHQFH RI /<67 8VLQJ WKH \HDVW WZRK\EULG V\VWHP /<67 ZDV IRXQG WR LQWHUDFW ZLWK SURWHLQV DQG KXPDQ EUDLQ IDFWRU 7KH ILQGLQJ RI D SURWHLQ f WKDW LQWHUDFWV ZLWK ERWK /<67 DQG /<67 VXSSRUWV QRW RQO\ WKH YDOLGLW\ RI WKH GHWHFWHG LQWHUDFWLRQV E\ WKH \HDVW WZRK\EULG V\VWHP EXW DOVR WKH SUHGLFWHG UHODWLRQVKLS EHWZHHQ /<67 DQG /<67 6LQFH WKH LQYROYHPHQW RI LQ YHVLFXODU WUDIILFNLQJ DQG VLJQDO WUDQVGXFWLRQ ZDV DOUHDG\ GHVFULEHG DERYH RQO\ WKH UROH RI +%)* ZLOO EH GLVFXVVHG KHUH

PAGE 125

+XPDQ EUDLQ IDFWRU +%)*f D PHPEHU RI WKH IRUN KHDG IDPLO\ RI WUDQVFULSWLRQ IDFWRUV ,W LV H[SUHVVHG SULPDULO\ LQ HPEU\RQLF EUDLQ EXW DOVR DW ORZHU OHYHOV LQ VHYHUDO DGXOW WLVVXHV +%)* VKRZV KLJK KRPRORJ\ WR KXPDQ EUDLQ IDFWRU DQG WR WKH UHWURYLUDO RQFRJHQH TLQ :LHVH HW DK f 7KH FHOOXODU KRPRORJV RI UHWURYLUDO RQFRJHQHV UHSUHVHQW LPSRUWDQW JURZWKUHJXODWRU\ JHQHV $OWKRXJK LWV IXQFWLRQ LV QRW NQRZQ LW LV K\SRWKHVL]HG WKDW +%)* SOD\V D UROH LQ FHOO SUROLIHUDWLRQ GXULQJ HPEU\RQLF EUDLQ GHYHORSPHQW DQG SRVVLEO\ LQ VRPH DGXOW WLVVXHV 7KH ILQGLQJV WKDW ERWK /<67 DQG +%)* DUH H[SUHVVHG PRVW DEXQGDQWO\ LQ EUDLQ LQGLUHFWO\ VXSSRUWV WKHLU LQWHUDFWLRQ GHWHFWHG E\ WKH \HDVW WZRK\EULG V\VWHP $OO RI WKH GHVFULEHG ,3V ZHUH LGHQWLILHG E\ VFUHHQLQJ RQO\ D KXPDQ EUDLQ F'1$ OLEUDU\ 2WKHU /<67 DQG /<67LQWHUDFWLQJ SURWHLQV FRXOG E\ LVRODWHG LI RWKHU OLEUDULHV HJO\PSKRLGf DUH VFUHHQHG $Q DWWHPSW ZDV PDGH WR JURXS WKH SUHYLRXVO\ SXEOLVKHG /<67 DQG /<67 LQWHUDFWLQJ SURWHLQV EDVHG RQ WKHLU NQRZQ RU SUHGLFWHG IXQFWLRQ )LJXUH f 7HQ RI WKH SURWHLQV FRXOG EH FDWHJRUL]HG LQ RQO\ RYHUODSSLQJ VHWV HPEU\RQDO )\Q VXEVWUDWH HVWURJHQ UHFHSWRUUHODWHG SURWHLQ DQG KXPDQ EUDLQ IDFWRU SOD\ UROHV LQ VLJQDO WUDQVGXFWLRQ DWURSKLQ LPRJHQ DQG LPSRUWLQ IXQFWLRQ LQ SURWHLQ WUDQVSRUW DQG SURWHLQV FDVHLQ NLQDVH ,, FDOPRGXOLQ DQG +UV DUH LQYROYHG LQ ERWK VLJQDO WUDQVGXFWLRQ DQG SURWHLQ WUDQVSRUW 7KH RQO\ /<67LQWHUDFWLQJ SURWHLQ ZLWK FXUUHQWO\ XQNQRZQ IXQFWLRQ LV '*6, EXW LQ WKH IXWXUH IROORZLQJ LWV FKDUDFWHUL]DWLRQ LW PD\ DOVR EH FDWHJRUL]HG LQ RQH RI WKH DERYH JURXSV

PAGE 126

3527(,1 75$163257 6,*1$/ 75$16'8&7,21 )LJXUH $ FODVVLILFDWLRQ RI WKH SUHYLRXVO\ NQRZQ /<67 DQG /<67 LQWHUDFWLQJ SURWHLQV EDVHG RQ WKHLU HVWDEOLVKHG RU SUHGLFWHG IXQFWLRQ $OPRVW DOO RI WKH ,3V FRXOG EH FDWHJRUL]HG LQ RQO\ RYHUODSSLQJ JURXSV SURWHLQ WUDQVSRUW DQG VLJQDO WUDQVGXFWLRQ )RXU SURWHLQV FDVHLQ NLQDVH ,, FDOPRGXOLQ DQG +UVf EHORQJ WR ERWK FDWHJRULHV DQG SURYLGH D OLQN EHWZHHQ WKH RWKHU LQWHUDFWLQJ SURWHLQV

PAGE 127

)LJXUH UHSUHVHQWV D VLPSOLILHG GLDJUDP RI WKH LQWHUDFWLRQV EHWZHHQ /<67 /<67 DQG RI WKHLU LQWHUDFWLQJ SURWHLQV LQ WKH FRQWH[W RI QHXURWUDQVPLWWHU YHVLFOH GRFNLQJIXVLRQ ZLWK WKH SUHV\QDSWLF SODVPD PHPEUDQH RI D QHXURQ 7KHVH /<67,3V &. FDOPRGXOLQ DQG +UVf ZHUH VHOHFWHG DQG LQFOXGHG LQ WKLV GLDJUDP EHFDXVH WKHLU UROHV LQ ERWK VLJQDO WUDQVGXFWLRQ DQG YHVLFXODU WUDQVSRUW DUH ZHOO HVWDEOLVKHG DQG WKHVH SURWHLQV SURYLGH D OLQN EHWZHHQ WKH RWKHU /<67,3V FDWHJRUL]HG LQ HLWKHU VLJQDO WUDQVGXFWLRQ RU SURWHLQ WUDQVSRUW RQO\ ,W LV VKRZQ WKDW /<67 &. FDOPRGXOLQ +UV DQG RWKHU SURWHLQV NQRZQ WR EH LQYROYHG LQ YHVLFXODU WUDIILFNLQJ DQG VLJQDO WUDQVGXFWLRQ IRUP D FRPPRQ QHWZRUN RI LQWHUDFWLQJ PROHFXOHV LQYROYHG LQ WKH UHJXODWLRQ RI WKHVH SURFHVVHV $Q LQGHSHQGHQW ZD\ RI FRQILUPLQJ WKH GHWHFWHG /<67,3 LQWHUDFWLRQV ZRXOG EH WR SHUIRUP FRLPPXQRSUHFLSLWDWLRQ XVLQJ VSHFLILF DQWLERGLHV :KLOH DQWLERGLHV DJDLQVW VRPH RI WKH /<67,3V DUH DYDLODEOH D KLJKTXDOLW\ /<67VSHFLILF DQWLERG\ KDV SURYHG GLIILFXOW WR UDLVH DIWHU VHYHUDO DWWHPSWV E\ GLIIHUHQW JURXSV $Q DQWLERG\ DJDLQVW WKH & WHUPLQXV RI /\VW JHQHUDWHG LQ FROODERUDWLRQ ZLWK 'U 6WHSKHQ %UDQGW GLG UHFRJQL]H D SURWHLQ ZLWK WKH H[SHFWHG VL]H IRU /\VW LQ QRUPDO PRXVH FHOOV +RZHYHU WKLV DQWLERG\ UHFRJQL]HG D SURWHLQ ZLWK WKH VDPH VL]H LQ EJEJ FHOOV ZKLFK DUH QRW VXSSRVHG WR SURGXFH IXOOOHQJWK /\VW EHFDXVH RI D /,1( HOHPHQW UHWURWUDQVSRVLWLRQ OHDGLQJ WR D SUHPDWXUH WHUPLQDWLRQ 7KHUHIRUH LW DSSHDUV WKDW WKLV DQWLERG\ LV QRW /\VWVSHFLILF DQG FDQQRW EH XVHG IRU FRLPPXQRSUHFLSLWDWLRQ H[SHULPHQWV *HQHUDWLRQ RI DQ DQWL/<67 DQWLERG\ DQG FRQILUPDWLRQ RI WKH /<67/<67,3 LQWHUDFWLRQV ZRXOG EH DQ LPSRUWDQW VWHS LQ WKH IXWXUH FKDUDFWHUL]DWLRQ RI WKH &KHGLDN+LJDVKL V\QGURPH JHQH DQG LWV SURGXFWV

PAGE 128

)LJXUH $ VLPSOLILHG VFKHPDWLF UHSUHVHQWDWLRQ RI WKH LQWHUDFWLRQV EHWZHHQ /<67 /<67 VRPH RI WKHLU LQWHUDFWLQJ SURWHLQV DQG RWKHU UHOHYDQW PROHFXOHV LQ WKH FRQWH[W RI QHXURWUDQVPLWWHU YHVLFOH GRFNLQJIXVLRQ ZLWK WKH SUHV\QDSWLF SODVPD PHPEUDQH RI D QHXURQ $OO SURWHLQV IRUP D FRPPRQ QHWZRUN RI LQWHUDFWLQJ PROHFXOHV LQYROYHG LQ WKH UHJXODWLRQ RI YHVLFOH H[RF\WRVLV

PAGE 129

,Q VXPPDU\ LW ZDV GHPRQVWUDWHG WKDW HDFK RI WKH SUHYLRXVO\ UHSRUWHG EJ JHQH VHTXHQFHV DUH GHULYHG IURP D VLQJOH JHQH ZLWK DOWHUQDWLYHO\ VSOLFHG P51$V $OWHUQDWLYH VSOLFLQJ UHVXOWV LQ EJ JHQH LVRIRUPV /\VWO DQG /\VW,,f WKDW FRQWDLQ GLIIHUHQW f UHJLRQV 6LPLODUO\ WR PRXVH WKH KXPDQ P51$ LVRIRUPV DULVH IURP LQFRPSOHWH VSOLFLQJ DQG UHWHQWLRQ RI D WUDQVFULEHG LQWURQ WKDW HQFRGHV WKH &WHUPLQXV RI WKH SUHGLFWHG /<67 SURWHLQ $GGLWLRQDO VSOLFLQJ FRPSOH[LW\ RI VPDOOHU LVRIRUPV H[LVWV /\VW?,, LVRIRUP ODFNV H[RQV D DQG S ZKLOH LQ /\VW,9 H[RQV D S DQG \ DUH DEVHQW 1RYHO PXWDWLRQV ZHUH LGHQWLILHG ZLWKLQ WKH FRGLQJ GRPDLQ RI /<67 LQ VHYHUDO &+6 SDWLHQWV DQG EJ DOOHOHV ,QWHUHVWLQJO\ DOO EJ DQG /<67 PXWDWLRQV LGHQWLILHG WR GDWH DUH SUHGLFWHG WR UHVXOW LQ WKH SURGXFWLRQ RI HLWKHU WUXQFDWHG RU DEVHQW SURWHLQV 0XWDWLRQ DQG H[SUHVVLRQ DQDO\VHV VXJJHVWHG WKDW GHIHFWV LQ WKH IXOOOHQJWK P51$ DORQH FDQ HOLFLW &+6 DQG WKDW H[SUHVVLRQ RI WKH VPDOOHU LVRIRUP DORQH FDQQRW FRPSHQVDWH IRU ORVV RI WKH ODUJHVW LVRIRUP :H KDYH DOVR LGHQWLILHG D QRYHO JHQH LQ KXPDQ ^/<67f DQG PRXVH ^/\VWf WKDW DSSHDUV WR EH D UHODWLYH RI WKH &+6 JHQH EDVHG RQ VHTXHQFH VLPLODULW\ SUHGLFWHG SURWHLQ VWUXFWXUH DQG RQ VLPLODU WUDQVFULSW VL]H &RPSDULVRQ RI WKH UHODWLYH DEXQGDQFH RI /<67 DQG /<67 P51$V VXJJHVWV WKDW /<67 LV H[SUHVVHG DEXQGDQWO\ RQO\ LQ EUDLQ DQG WKHUHIRUH LW PD\ UHSUHVHQW D EUDLQVSHFLILF PHPEHU RI WKH &+6 JHQH IDPLO\ 8VLQJ D PRGLILHG \HDVW WZRK\EULG V\VWHP D KXPDQ F'1$ OLEUDU\ ZDV VFUHHQHG ZLWK EDLWV IURP WKH FRGLQJ GRPDLQV RI /<67 DQG /<67 6HYHUDO SURWHLQV ZKLFK SOD\ LPSRUWDQW UROHV LQ SURWHLQ WUDQVSRUW DQG VLJQDO WUDQVGXFWLRQ VXFK DV &. FDOPRGXOLQ DQG +UV ZHUH IRXQG WR LQWHUDFW ZLWK /<67 DQGRU /<67 0DQ\ RI WKH LQWHUDFWLQJ SURWHLQV FRXOG EH OLQNHG LQ D FRPPRQ SDWKZD\ WKDW UHJXODWHV YHVLFXODU WUDIILFNLQJ DQG GHJUDQXODWLRQ

PAGE 130

7KH PROHFXODU FKDUDFWHUL]DWLRQ RI WKH &KHGLDN+LJDVKL V\QGURPH JHQH LV RI PHGLFDO VLJQLILFDQFH IRU VHYHUDO UHDVRQV ,W ZLOO OHDG WR LPSURYHG XQGHUVWDQGLQJ RI &+6 SDWKRORJ\ DQG PD\ VXJJHVW WUHDWPHQWV WKDW DUH QRW FXUUHQWO\ EHLQJ FRQVLGHUHG 7DUJHWV IRU GUXJV WKDW ZLOO OLPLW GHJUDQXODWLRQ DQG WKHUHE\ DPHOLRUDWH RUJDQ GDPDJH LQ LQIODPPDWRU\ GLVHDVHV PD\ EH GHYHORSHG DV D UHVXOW RI FKDUDFWHUL]DWLRQ RI PROHFXOHV WKDW UHJXODWH O\VRVRPDO VHFUHWLRQ IURP JUDQXODU FHOOV 7KH REVHUYDWLRQ WKDW EJ PLFH DUH SURWHFWHG IURP LPPXQH FRPSOH[ QHSKULWLV LQ WKH VHWWLQJ RI V\VWHPLF DXWRLPPXQH GLVHDVH &ODUN HW DL f VXJJHVWV WKDW VHOHFWLYH EORFNDGH RI /\VW PD\ EH D QRYHO PRGH RI SURWHFWLRQ IURP LPPXQRSDWKRORJ\ LQ LQIODPPDWRU\ GLVHDVHV VXFK DV OXSXV QHSKULWLV )LQDOO\ /\VW FKDUDFWHUL]DWLRQ PD\ FRQWULEXWH WR WKH PROHFXODU GLVVHFWLRQ RI WKH DVVRFLDWHG FDQFHU SUHGLVSRVLWLRQ DQG FODULI\ WKH UROH RI QDWXUDO LPPXQLW\ LQ VXUYHLOODQFH DJDLQVW WXPRU GHYHORSPHQW DQG PHWDVWDVLV

PAGE 131

$33(1',; 6(48(1&(6 2) 02/(&8/(6 ,17(5$&7,1* :,7+ /<67 $1' /<67 )RU DOO SUHYLRXVO\ NQRZQ SURWHLQV *HQ%DQN DFFHVVLRQ QXPEHUV DUH VKRZQ LQ SDUHQWKHVHV 7KH DUURZV LQGLFDWH WKH EHJLQQLQJ RI WKH LQWHUDFWLQJ IUDJPHQWV 6(48(1&( 3527(,1 ;f *7**7***$&7&*&*7&*&**&&*&**$*$&*7*$$*&7&7&*$* *&7&&7&&&*&7*&***7&**&*&7&*&&&7&*&7&7&&7&*&&& 7&&*&&&&**&&&&**&&&&**&&&&*&*&&&*&&$7**$*$$*$ 0HW*OX/\V7 &7*$*&7*$7&&$*$$**&&$$*&7**&&*$*&$**&&*$*&*&7 KU*OX/HX,OH*OQ/\V$OD/\V/HX$OD*OX*OQ$OD*OX$UJ7 $&*$&*$&$7**&&$&&7*&$7*$$**&$*7*$&&*$*&$***&* \U$VS$VS0HW$OD7KU&\V0HW/\V$OD9DO7KU*OX*OQ*O\$ 7 &&*$*&7*7&&$$&*$**$*&*&$$&&7*&7&7&&*7**&&7$&$ OD*OX/HX6HU$VQ*OX*OX$UJ$VQ/HX/HX6HU9DO$OD7\U/ 7 $*$$&*7**7&*****&&*&$**7&&*&&7**$***7&$7&7&7$ \V$VQ9DO9DO*O\*O\$UJ$UJ6HU$OD7US$UJ9DOOOH6HU6 7 *&$7&*$*&$*$$*$&&*$&$&&7&&*$&$$*$$*77*&$*&7*$ HUOOH*OX*OQ/\V7KU$VS7KU6HU$VS/\V/\V/HX*OQ/HX, 77$$**$&7$7&***$*$$$*7**$*7&&*$*&7*$*$7&&$7&7 OH/\V$VS7\U$UJ*OX/\V9DO*OX6HU*OX/HX$UJ6HUOOH& *&$&&$&**7*&7**$$77*77**$7$$$7$777$$7$*&&$$7* \V7KU7KU9DO/HX*OX/HX/HX$VS/\V7\U/HX,OH$OD$VQ$ &$$&7$$7&&$*$*$*7$$**7&77&7$7&7*$$$$7*$$***7* OD7KU$VQ3UR*OX6HU/\V9DO3KH7\U/HX/\V0HW/\V*O\$

PAGE 132

$77$&77&&**7$&&77*&7*$$*77*&*7*7**7*$7*$7&*$$ VS7\U3KH$UJ7\U/HX$OD*OX9DO$OD&\V*O\$VS$VS$UJ/ $$&$$$&*$7$*$7$$77&&&$$**$*&77$&&$$*$**&$777* \V*OQ7KUOOH$VS$VQ6HU*OQ*O\$OD7\U*OQ*OX$OD3KH$ $7$7$$*&$$*$$$*$*$7*&$$&&&$&$&$&&&$$7&&*&&7** VS,OH6HU/\V/\V*OX0HW*OQ3UR7KU+LV3UR,OH$UJ/HX* **&77*&7&77$$&7777&7*7$7777$&7$7*$*$77&77$$7$ O\/HX$OD/HX$VQ3KH6HU9DO3KH7\U7\U*OX,OH/HX$VQ$ $&&&$*$*&77*&&7*&$&*&7**&7$$$$&**&7777*$7*$** VQ3UR*OX/HX$OD&\V7KU/HX$OD/\V7KU$OD3KH$VS*OX$ &&$77*&7*$$&77*$7$&$&7*$$7*$$*$&7&$7$&$$$*$&$ D,H$OD*OX/HX$VS7KU/HX$VQ*OX$VS6HU7\U/\V$VS6 *&$&&&7&$7&$7*&$*77*&77$*$*$&$$&&7$$&$&777**$ HU7KU/HX,OH0HW*OQ/HX/HX$UJ$VS$VQ/HX7KU/HX7US7 &$7&$*$&$*7*&$**$*$$*$$7*7*$7*&**&$*$$****&7* KU6HU$VS6HU$OD*O\*OX*OX&\V$VS$OD$OD*OX*O\$OD* $$$$&7$$$7&&$7$&$***7*7&$7&&77&777&&77&$$*$$$ OX$VQ &&77777$&$&$7&7&&$77&&77$77&&$&77**$777&&7$7$ *&$$$*$$$&&&$77&$7*7*7$7**$$7&$$&7*777$7$*7&7 777&$&$&7*&$*&777***$$$$&77&$77&&77*$777*7*77 7*7&77**&&77&&7**7*7*&$*7$&7*&7*7$*$$$$*7$77$ $7$*&77&$777&$7$7$$$&$7$$*7$$&7&&&$$$&$&77$7* 7$*$**$&7$$$$$7*7$7&7**7$777$$*7$$7&7*$$&&$*7 7&7*&$$*7*$&7*7*7777*7$77$&7*7*$$$$7$$*$$$$7* 7$*77$$77$&$$777$$$*$*7$77&&$&$7$$&77&77$$777 &7$&$77&&&7&&&77$&7&77&*****777&&777&$*7$$*&$ $&7777&&$7*&7&77$$7*7$77&&77777$*7$**$$7&&**$ $*7$77$*$77*$$7**$$$$*&$&77*&&$7&7&7*7&7$**** 7&$&$$$77*$$$7**&7&&7*7$7&$&$7$&&**$**7&77*7* 7$7&7*7**&&$$&$***$*777&&77$77&$&7&777$777*&7 *&7*777$$*77*&&$$&&7&&&&7&&&$$7$$$$$77&$&77$& $&&7&&7*&&777*7$*77&7**7$77&$&777$&7$7*7*$7$* $$*7$*&$7*77*&7*&&$*$$7$&$$*&$77*&7777**&$$$7 7$$$*7*&$7*7&$777&77$$7$&$&7$*$$$****$$$7$$$7 7$$$*7$&$&$$*7&&$$*7&7$$$$&777$*7$&7777&&&$7* &$*$777*7*&$&$7*7*$*$***7*7&&$*777*7&7$*7*$77 *77$777$*$*$*77**$&&$&7$77*7*7*77*&7$$7&$77*$ &7*7$*7&&&$$$$$$*&&77*7*$$$$7*77$7*&&&7$7*7$$ &$*&$*$*7$$&$7$$$

PAGE 133

6(48(1&( % 3527(,1 ;f 7$&&*&&$&&*&&*&&*&&*$77&&**$*&&****7$*7&*&&*& &*&&*&&*&&*&&*&7*&$*&&$&7*&$**&$&&*&7*&&*&&*& &7*$*7$*7*7$&&*&&$&&*&&*&&*&&*$77&&**$*&&**** 7$*7&*&&*&&*&&*&&*&&*&&*&7*&$*&&$&7*&$**&$&&* &7*&&*&&*&&7*$*7$*7***&77$**$$**$$*$**7&$7&7& *&7&**$*&77&*&7&**$$***7&777*77&&&7*&$*&&&7&& &$&**&$*$*7&7&&$*$*$777***&&*&7$&$$$$$*7*&$77 77*&&&$77&**&7*7**$7$*$*$$*&$**$$*$*&$&7**$&7 7**$*7&$***$$7*$&$$7**$7$$$$*7*$*&7**7$&$*$$$ 0HW7KU0HW$VS/\V6HU*OX/HX9DO*OQ/\V *&&$$$&7&*&7*$*&$**&7*$*&*&7$7*$7*$7$7**&7*&$ $OD/\V/HX$OD*OX*OQ$OD*OX$UJ7\U$VS$VS0HW$OD$OD *&&$7*$$**&$*7&$&$*$$&$****&$7*$$&7&7&&$$&*$$ $OD0HW/\V$OD9DO7KU*OX*OQ*O\+LV*OX/HX6HU$VQ*OX *$*$*$$$7&7*&7&7&7*77*&&7$&$$*$$7*7**7$**&*&& *OX$UJ$VQ/HX/HX6HU9DO$OD7\U/\V$VQ9DO9DO*O\$OD &*&&*&7&77&&7**&*7*7&$7&7&&$*&$77*$*&$*$$$$&$ $UJ$UJ6HU6HU7US$UJ9DOOOH6HU6HUOOH*OX*OQ/\V7KU *$*$**$$7*$*$$*$$*&$*&$*$7***&$$$*$*7$&&*7*$* *OX$UJ$VQ*OX/\V/\V*OQ*OQ0HW*O\/\V*OX7\U$UJ*OX $$*$7$*$**&$*$$&7*&$**$&$7&7*&$$7*$7*77&7**$* /\V,OH*OX$OD*OX/HX*OQ$VS,OH&\V$VQ$VS9DO/HX*OX &7*77**$&$$$7$7&77$77&&&$$7*&7$&$&$$&&$*$$$*7 /HX/HX$VS/\V7\U/HX,OH3UR$VQ$OD7KU*OQ3UR*OX6HU $$**7*77&7$&77*$$$$7*$$$**$*$77$7777$**7$7&77 /\V9DO3KH7\U/HX/\V0HW/\V*O\$VS7\U3KH$UJ7\U/HX 7&7*$$*7**&$7&7**$*$&$$&$$$&$$$&&$&7*7*7&*$$& 6HU*OX9DO$OD6HU*O\$VS$VQ/\V*OQ7KU7KU9DO6HU$VQ 7&&&$*&$**&77$&&$**$$*&$777*$$$77$*7$$*$$$*$$ 6HU*OQ*OQ$OD7\U*OQ*OX$OD3KH*OX,OH6HU/\V/\V*OX $7*&$*&&7$&$&$&&&$$77&*7&77**7&7**&$&7$$$777& 0HW*OQ3UR7KU+LV3UR,OH$UJ/HX*O\/HX$OD/HX$VQ3KH 7&$*7&7777$&7$7*$*$77&7$$$&7&7&&7*$$$$**&&7*7 6 HU9DO3KH7\U7\U*OX,H/HX$VQ6 HU3UR*OX/\V$OD&\V $*&&7**&$$$$$&**&$777*$7*$$*&$$77*&7*$$77**$7 6HU/HX$OD/\V7KU$OD3KH$VS*OX$ODOH$OD*OX/HX$VS

PAGE 134

$&*&7*$$7*$$*$*7&77$7$$$*$&$*&$&7&7*$7&$7*&$* 7KU/HX$VQ*OX*OX6HU7\U/\V$VS6HU7KU/HX,OH0HW*OQ 77$&77$***$&$$7&7&$&7&7*7**$&$7&**$$$$&&$***$ /HX/HX$UJ$VS$VQ/HX7KU/HX7US7KU6HU*OX$VQ*OQ*O\ *$&*$$**$*$&*&7****$***$*$*$$&7$$7*777&7&*7*& $VS*OX*O\$VS$OD*O\*OX*O\*OX$VQ 777*7*$7&7*7&&$*7*7&$&7&7*7$&&&7&$$&$7$7$7&&& 77*7*&*$7$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$

PAGE 135

6(48(1&( &$6(,1 .,1$6( ,, 368%81,7 0f 8 O 7&&***&&7**&&7*7$&**7&*&&*&&*77&&&7**$$*7$*&$ DFWWFFFWDFFF$DFFFFDJWFFWJJWFFFFJWFFDAfFFJFWJDF *7*$$*$7*$*&$*&7&$*$**$**7*7&&7**$777&&7**77& 0HW6HU6HU6HU*OX*OX9DO6HU7US,OH6HU7US3KH 7*7***&7&&*7**&$$7*$$77&77&7*7*$$*7**$7*$$*$& &\V*O\/HX$UJ*O\$VQ*OX3KH3KH&\V*OX9DO$VS*OX$VS 7$&$7&&$**$&$$$777$$7&77$&7**$&7&$$7*$*&$**7& 7\UH*OQ$VS/\V 3KH$VQ/HX7KU*O\/HX$VQ*OX*OQ9DO &&7&$&7$&&*$&$$*&7&7$*$&$7*$7&77**$&&7**$*&&7 3UR+LV7\U$UJ*OQ$OD/HX$VS0HW,OH/HX$VS/HX*OX3UR *$7*$$*$$&7**$$*$&$$&&&&$$&&$*$*7*$&&7*$77*$* $VS*OX*OX/HX*OX$VS$VQ3UR$VQ*OQ6HU$VS/HX,OH*OX &$**&$*&&*$*$7*&777$7**$77*$7&&$&*&&&*&7$&$7& *OQ$OD$OD*OX0HW/HX7\U*O\/HX,OH+LV$OD$UJ7\UOOH &77$&&$$&&*7**&$7&*&&&$*$7*77**$$$$*7$&&$*&$$ /HX7KU$VQ$UJ*O\OOH$OD*OQ0HW/HX*OX/\V7\U*OQ*OQ **$*$&777**77$&7*7&&7&*7*7*7$&7*7*$*$$&&$*&&$ *O\$VS3KH*O\7\U&\V3UR$UJ9DO7\U&\V*OX$VQ*OQ3UR $7*&77&&&$77**&&777&$*$&$7&&&$**7*$$*&&$7**7* 0HW/HX3UR,OH*O\/HX6HU$VS,OH3UR*O\*OX$OD0HW9DO $$*&7&7$&7*&&&&$$*7*&$7**$7*7*7$&$&$&&&$$*7&$ /\V/HX7\U&\V3UR/\V&\V0HW$VS9DO7\U7KU3UR/\V6HU 7&$$*$&$&&$7&$&$&**$7**&*&&7$&77&**&$&7**777& 6HU$UJ+LV+LV+LV7KU$VS*O\$OD7\U3KH*O\7KU*O\3KH &&7&$&$7*&7&77&$7**7*&$7&&&*$*7$&&**&&&$$*$*$ 3UR+LV0HW/HX3KH0HW9DO+LV3UR*OX7\U$UJ3UR/\V$UJ &&7*&&$$&&$*777*7*&&&$**&7&7$&**777&$$*$7&&$7 3UR$OD$VQ*OQ3KH9DO3UR$UJ/HX7\U*O\3KH/\V,OH+LV *&*$7**&&7$&&$*&7*&$*&7&&$$*&&*&&$*&$$&77&$$* $OD0HW$OD7\U*OQ/HX*OQ/HX*OQ$OD$OD6HU$VQ3KH/\V $*&&&$*7&$$*$&*$77&*&7*$77&&&7&&&&&$&&7*7&&7* 6HU3UR9DO/\V7KUOOH$UJ

PAGE 136

&$*7&777*$&7777&&777&777777*&&$&&&777&$**$$&& &7*7$7**77777$*777$$$77$$$**$*7&*77$77*7**7** *$$7$7*$$$7$$$*7$*$$*$$$$**&&$7*$$$$$$$$$$$$$ $$$$$$$$$$$$$**777*7*77&7&*$&*&&77**7$*77**&$ 7$**&7$$$*$$$$***$7&7&$*&&&&*$**$$***7&$&&&7& &7$*$*$7$*&7$&7$&&&&*7&7&$**$*$&&&7**7$777&7$ *$*&$&*&777*&777&$&&$$$&&&$$**$**7*$&$**$**$* &&&&&*&$&$**$&&7$$*$$7*&7*7*$&&$*$$*$7***$7&* &**$$&$*&$*&$*7*&$**$7&&**7&&**$*$&&&&7&&*$** *&77*&&&&*$$*$****&7**&&7*&*7&**$*7*$**$$*$** $$*$$*$**$7*$$*$7*7**$7&7**&&&$**7$&7**&&7$7& 7&&7&&*&$*$**&&$$*7*$**77**7*&$***$**$**7*&$* &$$$777$&$$77&$77&$**&&&7&77**$&7&$*$**$$*$*$ $7*$&$*$*&77***$7**7&*7&77****$7&*$7$&$$&&&$& &7*7**$7*&7$&&&&7*$&$&&&***$*&7**$$77&&7**$*7 7*7*$$&*&&*&**$&7&&**$*&&*&$&$$$&&$***&7&*&&$ 7*$$*&&$**$77&$*7&&&&&*7*****7**&777**&**&&*$ *****&777**7*$&&*7**7**7&*7**$**&&*$*****&777 **&*****&&*$**7&*$**&**$**&777$*$**7&*7**$&*$ **$**$**7**$**&**&**&**&**7**$**$**$**$$*$**7 **$**&77&&$77&7**7**&$$&&****7&*7**7&****$**$ $$$$*$**$$$&&$*7&****$$*$$7*7*$7**7**$*&&*&$7 &**$&7*$***7*7&77&$777*7&*$**$$$**$*$7*&$&7** 7&$&&$$*$$&&7**7&&7***$$7&$$*77$7**$*$*$$*$*$ *7&7&*$77&**$$**$*$7*$&$$$$77*$*7$&&*$*&&7**$ $&&&&77&&*&7&&$$*&7$*&$*&$*&$$7&&7***7**7*7** $&&$*$7&&$&$7&$$$&&*****&7$$**77&7&7$&&7&**** &7*&&7&***&$&&$&**7&7&&&$7*7&7&7*$&$7&*77**7& &**$7**7&7$*7&7$7*&$*7&*$*777&&&&$&&*&7&7**&& *7*$&&7&$77$$&77**&&$$*$$*$**$&&$$&$7&$77&&7* 7*$7&*$**$7*&7&*$&$&&&$&$&$$$7$&&*&$7*&7&$7&* &$$7**7**$7*7*$7&777*&7*$7*7**&&&$*&&$*$&&$*$ &&&**$$7*7**&&&7*$$$*&&&$&$&&77&&7*&*&7$$7**$ **$&$&777*7*$777&&$77$$**&&$$&7*&$77*$&7&&$&$ *&&7$*&**7&$**&&*7*777*&&7&&*$$*7*$$$$$*$7*&$ $&$**$*$$&$7*$$*&&*&$**$*&$*77*$&&&77*$*&&$7$ 7*$$$*$*$&&$7*&&*7**7&*7***$*7*7$&$**&&$&&&&& &$$**7*$$*$$&7*$$*77&$*&*&7*7&$**$77*&*$*$*$7 *7*7*77*$7$&7*77*&&&*7*7*77777&7$$77$$$$*$&7& &7&&*7&

PAGE 137

6(48(1&( +(3$72&<7( *52:7+ )$&725 5(*8/$7(' 7<526,1( .,1$6( 68%675$7( +56 'f ***&*&*&&$*&7&*7$*&$****$*&*&&&*&**&*7&***777 ***&7**$**7&*&&$7****&*$**&$*&**&$&&77&*$*&*7 0HW*O\$UJ*O\6HU*O\7KU3KH*OX$UJ &7&&7$*$&$$**&*$&&$*&&$*&7&&7*77**$*$&$*$77** /HX/HX$VS/\V$OD7KU6HU*OQ/HX/HX/HX*OX7KU$VS7US *$*7&&$7777*&$*$7&7*&*$&&7*$7&&*&&$$****$&$&$ *OX6HUOOH/HX*OQOOH&\V$VS/HX,OH$UJ*OQ*O\$VS7KU &$$*&$$$$7$7*&7*7*$$77&&$7&$$*$$*$$$*7&$$&*$& *OQ$OD/\V7\U$OD9DO$VQ6HUOOH/\V/\V/\V9DO$VQ$VS $$*$$&&&$&$&*7&*&&77*7$7*&&&7**$**7&$7**$$7&7 /\V$VQ3UR+LV9DO$OD/HX7\U$OD/HX*OX9DO0HW*OX6HU *7**7$$$*$$&7*7**&&$*$&$*77&$7*$7*$**7**&&$$& 9DO9DO/\V$VQ&\V*O\*OQ7KU9DO+LV$VS*OX9DO$OD$VQ $$*&$*$&&$7**$**$*&7*$$**$&&7*&7*$$*$*$&$$*7* /\V*OQ7KU0HW*OX*OX/HX/\V$VS/HX/HX/\V$UJ*OQ9DO *$**7$$$&*7&&*7$$&$$*$7&&7*7$&&7*$7&&$**&&7** *OX9DO$VQ9DO$UJ$VQ/\V,OH/HX7\U/HX,OH*OQ$OD7US *&*&$7*&&77&&**$$&*$*&&&$$*7$&$$**7**7&&$**$& $OD+LV$OD3KH$UJ$VQ*OX3UR/\V7\U/\V9DO9DO*OQ$VS $&&7$&&$*$7&$7*$$**7**$****&$&*7&777&&$*$$77& 7KU7\U*OQOOH0HW/\V9DO*OX*O\+LV9DO3KH3UR*OX3KH $$$*$*$*&*$7*&&$7*777*&7*&&*$*$*$*&&&&$*$&7** /\V*OX6HU$VS$OD0HW3KH$OD$OD*OX$UJ$OD3UR$VS7US *7**$&*&7*$**$$7*&&$&&*&7*&$***7*&$*77&****7* 9DO$VS$OD*OX*OX&\V+LV$UJ&\V$UJ9DO*OQ3KH*O\9DO $7*$&&&*7$$*&$&&$&7*&&***&*7*7***&$*$7$77&7*7 0HW7KU$UJ/\V+LV+LV&\V$UJ$OD&\V*O\*OQOOH3KH&\V **$$$*7*77&77&&$$*7$&7&&$&&$7&&&&$$*777**&$7& *O\/\V&\V6HU6HU/\V7\U6HU7KUOOH3UR/\V3KH*O\OOH *$*$$**$**7*&*&*7*7*7*$*&&&7*&7$&*$*&$*&7*$$& *OX/\V*OX9DO$UJ9DO&\V*OX3UR&\V7\U*OX*OQ/HX$VQ $**$$$*&**$***$$$**&&$&77&&$&&$&7*$*&7*&&&&&& $UJ/\V$OD*OX*O\/\V$OD7KU6HU7KU7KU*OX/HX3UR3UR

PAGE 138

*$*7$&&7*$&&$*&&&&&7*7&7&$*&$*7&&&$*&7*&&&&&& *OX7\U/HX7KU6HU3UR/HX6HU*OQ*OQ6HU*OQ/HX3UR3UR $$*$***$&*$*$&**&&&7*&$**$**$**$**$*&7*&$*&7* /\V$UJ$VS*OX7KU$OD/HX*OQ*OX*OX*OX*OX/HX*OQ/HX *&&&7**&*&7*7&$&$*7&$*$**&**$**$*$$**$*$**&7* $OD/HX$OD/HX6HU*OQ6HU*OX$OD*OX*OX/\V*OX$UJ/HX $*$&$*$$*7&&$&*7$&$&77&*7$&&&&$$**&**$*&&&$7* $UJ*OQ/\V6HU7KU7\U7KU6HU7\U3UR/\V$OD*OX3UR0HW &&&7&**&&7&&7&$*&*&&&&&&*&&$*&$*&&7*7$&7&77&$ 3UR6HU$OD6HU6HU$OD3UR3UR$OD6HU6HU/HX7\U6HU6HU &&7*7*$$&7&*7&**&*&&7&7**&7*$**$&$7&*$&&&7*$* 3UR9DO$VQ6HU6HU$OD3UR/HX$OD*OX$VS,OH$VS3UR*OX &7&*&$&**7$7&7&$$&&**$$&7$&7***$*$$*$$*&$**$* /HX$OD$UJ7\U/HX$VQ$UJ$VQ7\U7US*OX/\V/\V*OQ*OX *$**&7&*&$$*$*&&&&$&*&&$7&7*&*&&&*7*&&&&7*$&* *OX$OD$UJ/\V6HU3UR7KU3UR6HU$OD3UR9DO3UR/HX7KU *$*&&**&7*&$&$*&&7****$$***&$&*&$*&&&&&$&&$$& *OX3UR$OD$OD*OQ3UR*O\*OX*O\+LV$OD$OD3UR7KU$VQ *7**7**$*$$&&&&&7&&&**$*$&$*$&7&7&$*&&&$77&&7 9DO9DO*OX$VQ3UR/HX3UR*OX7KU$VS6HU*OQ3UR,OH3UR &&&7&7**7**&&&&777$*7*$*&&$&$*77&&$&$$7**&*$* 3UR6HU*O\*O\3UR3KH6HU*OX3UR*OQ3KH+LV$VQ*O\*OX 7&7*$**$*$*&&$&*$*&$*77&&7*$$**&*&7*&$*$$&*&& 6HU*OX*OX6HU+LV*OX*OQ3KH/HX/\V$OD/HX*OQ$VQ$OD *7&$&&$&&77&*7*$$&&*&$7*$$*$*7$$&&$&$7*&****& 9DO7KU7KU3KH9DO$VQ$UJ0HW/\V6HU$VQ+LV0HW$UJ*O\ &*&$*&$7&$&&$$7*$&7&**&&*7*&7&7&$&7&77&&$*7&& $UJ6HUOOH7KU$VQ$VS6HU$OD9DO/HX6HU/HX3KH*OQ6HU $7&$$&**&$7*&$&&&*&$*&7*&7**$*&7*&7&$$&&$*&7* ,OH$VQ*O\0HW+LV3UR*OQ/HX/HX*OX/HX/HX$VQ*OQ/HX *$&*$*&*&$**&7*7$&7$7*$****&7*&$**$&$$*&7**&$ $VS*OX$UJ$UJ/HX7\U7\U*OX*O\/HX*OQ$VS/\V/HX$OD &$*$7&&*&*$7*&&&******&*&7*$*7*&&&7*&*&*$$*$* *OQOOH$UJ$VS$OD$UJ*O\$OD/HX6HU$OD/HX$UJ*OX*OX &$&&***$*$$*&77&*&&***&$*&&*$**$**&$*$*&*&&$* +LV$UJ*OX/\V/HX$UJ$UJ$OD$OD*OX*OX$OD*OX$UJ*OQ

PAGE 139

&*&&$*$7&&$*&7**&&&$*$$*&7**$*$7$$7*&**&$*$$* $UJ*OQOOH*OQ/HX$OD*OQ/\V/HX*OX,OH0HW$UJ*OQ/\V $$*&$**$*7$&&7**$**7*&$*$**&$*&7**&&$7&&$*&*& /\V*OQ*OX7\U/HX*OX9DO*OQ$UJ*OQ/HX$ODOOH*OQ$UJ &7*&$**$*&$**$*$$**$*&**&$*$7*&**&7**$*&$*&$* /HX*OQ*OX*OQ*OX/\V*OX$UJ*OQ0HW$UJ/HX*OX*OQ*OQ $$*&$*$&**7&&$*$7*&*&*&*&$*$7*&&&*&&77&&&&&7* /\V*OQ7KU9DO*OQ0HW$UJ$OD*OQ0HW3UR$OD3KH3UR/HX &&&7$&*&&&$*&7&&$**&&$7*&&&*&$*&&**$**7*7*&7& 3UR7\U$OD*OQ/HX*OQ$OD0HW3UR$OD$OD*O\*O\9DO/HX 7$&&$*&&&7&***$&&$*&&$*&77&&&&$*&$&&77&$*&&&7 7\U*OQ3UR6HU*O\3UR$OD6HU3KH3UR6HU7KU3KH6HU3UR *&&**&7&**7**$***&7&&&&$$7*&$&**&*7*7$&$7*$*& $OD*O\6HU9DO*OX*O\6HU3UR0HW+LV*O\9DO7\U0HW6HU &$*&&**&&&&7*&&*&7**&&&&7$&&&&$*&$7*&&&$*&$&7 *OQ3UR$OD3UR$OD$OD*O\3UR7\U3UR6HU0HW3UR6HU7KU *&**&7*$7&&&$*&$7**7*$*7*&&7$&$7*7$&&&$*&$*** $OD$OD$VS3UR6HU0HW9DO6HU$OD7\U0HW7\U3UR$OD*O\ *&&$&7****&*&$**&**&&&&&&$**&&&$**&&**$&&&$&& $OD7KU*O\$OD*OQ$OD$OD3UR*OQ$OD*OQ$OD*O\3UR7KU *&&$*&&&&*&77$&7&$7&&7$&&$*&&7$&7&&&$&$*&***& $OD6HU3UR$OD7\U6HU6HU7\U*OQ3UR7KU3UR7KU$OD*O\ 7$&&$*$$&*7**&&7&&&$**&&&&$&$*$*&&7&&&**&&$7& 7\U*OQ$VQ9DO$OD6HU*OQ$OD3UR*OQ6HU/HX3UR$ODOOH 7&7&$*&&7&&*&$*7&&$*&$&&$7***&7$&$7****$*&&$* 6HU*OQ3UR3UR*OQ6HU6HU7KU0HW*O\7\U0HW*O\6HU*OQ 7&$*7&7&&$7***&7$&&$*&&77$&$$&$7*&$*$$7&7&$7* 6HU9DO6HU0HW*O\7\U*OQ3UR7\U$VQ0HW*OQ$VQ/HX0HW $&&$&&&7&&&$$*&&$**$7*&*7&7&7*&&$&&&&$*&$*&&& 7KU7KU/HX3UR6HU*OQ$VS$OD6HU/HX3UR3UR*OQ*OQ3UR 7$&$7&*&****&$*&$*&&&$7*7$&&$*&$*$7**&$&&&7&7 7\UOOH$OD*O\*OQ*OQ3UR0HW7\U*OQ*OQ0HW$OD3UR6HU **&**7&&&&&&&$*&$*&$*&&&&&&*7**&&&$*&$$&&*&$* *O\*O\3UR3UR*OQ*OQ*OQ3UR3UR9DO$OD*OQ*OQ3UR*OQ *&$&$****&&*&&**&$&$***&$*&*$**&&&$*&7&$777&$ $OD*OQ*O\3UR3UR$OD*OQ*O\6HU*OX$OD*OQ/HX,OH6HU

PAGE 140

77&*$&7*$&&&$**&&$7*&7&$&*7&&**$*7$$&$&7$&$7$ 3KH$VS &$*77&$&&7*$$$&*&&7&*7&7&7$$&7*&&*7&*7&&7*&&7 &&&7*7&&7&7$&7*&&**7$*7*7&&&77&7&7*&*$*7*$*** ****&&77&$&&&&$$*&&&$&&7&&&77*7&&7&$*&&7$&7*& $*7&&&7*$*77$*7&7&7*&777&777&&&&$***&7***&&$7 ****$***$$**$&777&7&&&$****$$*&&&&&$*&&&7*7** *7&$7**7&7*7*$*$**7**&$**$$7****$&&&7&$&&&&&& $$*&$*&&7*7*&&&7&7**&&*&$&7*7*$*&7**&7*7**7*7 &7***7*7**&&7****&7&&&7&7*&$****&&7&7&7&**&$* &&$&$*&&$$***7**$**&77&$**7&7&&$*&77&7&7*&77& 7&$*&7*&&$7&7&&$*7*&&&&$*$$7**7$&$*&*$7$$7$$$ $7*7$777&$*$$$**

PAGE 141

6(48(1&( &$/02'8/,1 'f $*7&&*$*7**$*$*$*&*$*&7*$*7**77*7*7**7&*&*7&7 &**$$$&&**7$*&*&77*&$*&$7**&7*$&&$$&7*$&7*$$* 0HW$OD$VS*OQ/HX7KU*OX* $*&$*$77*&$*$$77&$$$*$$*&77777&$&7$777*$&$$$* OX*OQOOH$OD*OX3KH/\V*OX$OD3KH6HU/HX3KH$VS/\V$ $7**7*$7**$$&7$7$$&$$&$$$**$$77***$$&7*7$$7*$ VS*O\$VS*O\7KUOOH7KU7KU/\V*OX/HX*O\7KU9DO0HW$ *$7&7&77***&$*$$7&&&$&$*$$*&$*$*77$&$**$&$7*$ UJ6HU/HX*O\*OQ$VQ3UR7KU*OX$OD*OX/HX*OQ$VS0HWO 77$$7*$$*7$*$7*&7*$7**7$$7**&$&$$77*$&77&&&7* OH$VQ*OX9DO$VS$OD$VS*O\$VQ*O\7KUOOH$VS3KH3UR* $$777&7*$&$$7*$7**&$$*$$$$$7*$$$*$&$&$*$&$*7* OX3KH/HX7KU0HW0HW$OD$UJ/\V0HW/\V$VS7KU$VS6HU* $$*$$*$$$77$*$*$$*&$77&&*7*7*777*$7$$**$7**&$ OX*OX*OX,OH$UJ*OX$OD3KH$UJ9DO3KH$VS/\V$VS*O\$ $7**&7$7$77$*7*&7*&$*$$&77&*&&$7*7*$7*$&$$$&& VQ*O\7\UOOH6HU$OD$OD*OX/HX$UJ+LV9DO0HW7KU$VQ/ 77**$*$*$$*77$$&$*$7*$$*$$*77*$7*$$$7*$7&$*** HX*O\*OX/\V/HX7KU$VS*OX*LOX9DO$VS*OX0HWOOH$UJ* $$*&$*$7$77*$7**7*$7**7&$$*7$$$&7$7*$$*$*777* OX$OD$VS,OH$VS*O\$VS*O\*OQ9DO$VQ7\U*OX*OX3KH9 7$&$$$7*$7*$&$*&$$$*7*$$*$&&77*7$&$*$$7*7*77$ DO*OQ0HW0HW7KU$OD/\V $$777&77*7$&$$$$77*777$777*&&7777&777*777*7$$ &77$7&7*7$$$$**777&7&&&7$&7*7&$$$$$$$7$7*&$7* 7$7$*7$$77$**$&77&$77&&7&&$7*7777&77&&&77$7&7 7$&7*7&$77*7&&7$$$$&&77$7777$*$$$$77*$7&$$*7$ $&$7*77*&$7*7**&77$&7&7**$7$7$7&7$$*&&&77&7*& $&$7&7$$$&77$*$7**$*77**7&$$$7*$***$$&$7&7*** 77$7*&&777777$$$*7$*7777&777$**$$&7*7&$*&$7*7 7*77*77*$$*7*7**$*77*7$$&7&7*&*7**$&7$7**$&$* 7&$$&$$7$7*7$&77$$$$*77*&$&7$77*&$$$$&***7*7$ 77$7&&$**7$&7&*7$&$&7$7777777*7$&7*&7**7&&7*7 $&&$*$$$&$7777&7777$77*77$&77*&77777$$$&777*7 77$*&&$&77$$$$7&7*&77$7**&$&$$777*&&7&$$$$7&& $77&&$$*77*7$7$777*7777&&$$7$$$$$$$77$&$$777$ &&&

PAGE 142

6(48(1&( (6752*(1 5(&(37255(/$7(' 3527(,1 /f 7&&7$&$$*&$*&&**&**&*&&*&&*$*7*$****$&*&**&*& 6HU7\U/\V*OQ3UR$OD$OD3UR3UR6HU*OX*O\7KU$UJ$UJ **7****&**&*&**&&&*$**$**&**&**$**$****&&*&&& *O\*O\$OD$OD$UJ3UR*OX*OX$OD$OD*OX*OX*O\3UR3UR *&**&&&&&**&7&$&7&&**&$&7&&***&&*&7&**&&&&&$7 $OD$OD3UR*O\6HU/HX$UJ+LV6HU*O\3UR/HX*O\3UR+LV *&&7*&&&*$&&*&*&7*&&**$*&&&&$**7*$&&$*&*&&$7* $OD&\V3UR7KU$OD/HX3UR*OX3UR*OQ9DO7KU6HU$OD0HW 7&&$*&&$**7**7***&$77*$*&&7&7&7$&$7&$$**&$*$* 6HU6HU*OQ9DO9DO*O\OOH*OX3UR/HX7\UOOH/\V$OD*OX &&**&&$*&&&7*$&$*7&&$$$***77&&7&**$*$&$*$*$&& 3UR$OD6HU3UR$VS6HU3UR/\V*O\6HU6HU*OX7KU*OX7KU *$*&&7&&7*7**&&&7**&&&&7**7&&$*&7&&&$&7&*&7*& *OX3UR3UR9DO$OD/HX$OD3UR*O\3UR$OD3UR7KU$UJ&\V &7&&&$**&&$&$$**$$*$**$**$7****$*****&7***&&7 /HX3UR*O\+LV/\V*OX*OX*OX$VS*O\*OX*O\$OD*O\3UR **&*$*&$***&**7***$$*&7**7*&7&$*&7&&&7*&&&$$* *O\*OX*OQ*O\*O\*O\/\V/HX9DO/HX6HU6HU/HX3UR/\V &*&&7&7*&&7**7&7*7****$&*7**&&7&&**&7$&&$&7$7 $UJ/HX&\V/HX9DO&\V*O\$VS9DO$OD6HU*O\7\U+LV7\U **7*7**&$7&&7*7*$**&&7*&$$$*&&77&77&$$*$**$&& *O\9DO$OD6HU&\V*OX$OD&\V/\V$OD3KH3KH/\V$UJ7KU $7&&$****$*&$7&*$*7$&$*&7*7&&**&&7&&$$&*$*7*7 ,OH*OQ*O\6HUOOH*OX7\U6HU&\V3UR$OD6HU$VQ*OX&\V *$*$7&$&&$$*&**$*$&*&$$**&&7*&&$**&&7*&&*&77& *OXOH7KU/\V$UJ$UJ$UJ/\V$D&\V*OQ$OD&\V$UJ3KH $&&$$*7*&&7*&***7***&$7*&7&$$**$***$*7*&*&&7* 7KU/\V&\V/HX$UJ9DO*O\0HW/HX/\V*OX*O\9DO$UJ/HX *$&&*&*7&&****7***&**&$*$$*7$&$$*&**&**&&**$* $VS$UJ9DO$UJ*O\*O\$UJ*OQ/\V7\U/\V$UJ$UJ3UR*OX *7**$&&&$&7*&&&77&&&***&&&&77&&&7*&7***&&&&7* 9DO$VS3UR/HX3UR3KH3UR*O\3UR3KH3UR$OD*O\3UR/HX *&$*7&*&7**$**&&&&&**$$*$&$*&&&&$*7*$$7*&$&7* $OD9DO$OD*O\*O\3UR$UJ/\V7KU$OD3UR9DO$VQ$OD/HX

PAGE 143

*7*7&7&$7&7*&7**7**77*$*&&7*$*$$*&7&7$7*&&$7* 9DO6HU+LV/HX/HX9DO9DO*OX3UR*OX/\V/HX7\U$OD0HW &&7*$&&&&*&$**&&&7*$7***&$&&7&&&$*&&*7**&7$&& 3UR$VS3UR$OD*O\3UR$VS*O\+LV/HX3UR$OD9DO$OD7KU &7&7*7*$&&7&777*$&&*$*$*$77*7**7&$&&$7&$*&7** /HX&\V$VS/HX3KH$VS$UJ*OX,OH9DO9DO7KUOOH6HU7US *&&$$*$*&$7&&&$**&77&7&$7&*&7*7&*&7*7&7*$&&$* $OD/\V6HUOOH3UR*O\3KH6HU6HU/HX6HU/HX6HU$VS*OQ $7*7&$*7$&7*&$*$*&*7*7**$7**$**7*&7**7*&7***7 0HW6HU9DO/HX*OQ6HU9DO7US0HW*OX9DO/HX9DO/HX*O\ *7**&&&$*&*&7&$&7*&&$&7*&$**$7*$*&7**&&77&*&7 9DO$OD*OQ$UJ6HU/HX3UR/HX*OQ$VS*OX/HX$OD3KH$OD *$**$&77$*7&&7**$7*$$*$*****&$&***&$*&7**&&7* *OX$VS/HX9DO/HX$VS*OX*OX*O\$OD$UJ$OD$OD*O\/HX ****$$&7*****&7*&&&7*&7*&$$&7$*7*&**&**&7*&$* *O\*OX/HX*O\$OD$OD/HX/HX*OQ/HX9DO$UJ$UJ/HX*OQ *&&&7*&**&7**$*&*$*$**$*7$7*77&7$&7$$$**&&77* $OD/HX$UJ/HX*OX$UJ*OX*OX7\U9DO/HX/HX/\V$OD/HX *&&&77*&&$$77&$*$&7&7*7*&$&$7&*$$*$7*&&*$**&7 $OD/HX$OD$VQ6HU$VS6HU9DO+LV,OH*OX$VS$OD*OX$OD *7**$*&$*&7*&*$*$$*&7&7*&$&*$**&&&7*&7**$*7$7 9DO*OX*OQ/HX$UJ*OX$OD/HX+LV*OX$OD/HX/HX*OX7\U *$$*&&**&&***&7**&&&&**$*****7*&7*$*&**&**&** *OX$OD*O\$UJ$OD*O\3UR*O\*O\*O\$OD*OX$UJ$UJ$UJ *&***&$**&7*&7*&7&$&*&7$&&*&7&&7&&*&&$*$&$*&* $OD*O\$UJ/HX/HX/HX7KU/HX3UR/HX/HX$UJ*OQ7KU$OD **&$$$*7*&7**&&&$777&7$7****7*$$*&7**$***&$$* *O\/\V9DO/HX$OD+LV3KH7\U*O\9DO/\V/HX*OX*O\/\V *7*&&&$7*&$&$$*&7*77&77**$*$7*&7&*$**&&$7*$7* 9DO3UR0HW+LV/\V/HX3KH/HX*OX0HW/HX*OX$OD0HW0HW *$&7*$**&$$****7***$&7**7*****77&7**&$**$&&7* $VS &&7$*&$7****7&$*&&&&$$***&7****&**$*&7****7&7 ***&$*7*&&$&$*&&7*&7**&$***&&$***&$$7*&&$7&$* &&&&7***$$&$**&&&&$&*&&&7&7&&7&&&&&7&&7$***** 7*7&$*$$*&7***$$&*7*7*7&&$**&7&7***&$&$*7*&7* &&&&77*&$$*&&$7$$&*7*&&&&&$*$*7*7$*****&&77*&

PAGE 144

**$$*&&$7$*****&7*&$&***$7*&*7***$**&$*$$$&&7 $7&7&$***$***$$****$7**$**&&$*$*7&7&&&$*7***7 *$7*&7777*&7*&7*&77$$7&&7$&&&&&7&77&$$$*&$*$* 7***$&77**$*$*&$$$**&&&$7*&&&&&77&*&7&&7&&7&7 &$7&$777*&$77***&$77$*7*7&&&&&&77*$$*&$$7$$&7 &&$$*&$*$&7&&$*&&&&7**$&&&&7****7**&&$***&77& &&&$7&$*&7&&&$$&*$*&&7&&7&$*****7$**$*$*&$&7* &&7&7$7*&&&7*&$*$*&$$7$$&$&7$7$777$77777***77 7**&&$***$**&*&$***$&$7****&$$*&&$***&&&$*$*& &&77**&7*7$&$*$*$&7&7$7777$$7*7$7$777*&7*&$$$ *$*$$$&&*&7777**7777$$$&&777$$7*$*$$$$$$$7$7$ 7$$7$&&*$*&7&

PAGE 145

6(48(1&( ,03257,1 368%81,7 /f &7&&&7&*&7&&&7&&&7*&*&*&&*&&7&7&$&7&$&$*&&7&& &77&&77&777&7&&&7&&*&&7&&&*$*&$&&$*&*&*&7&7*$ *&7*&&&&&$***7&&&&7&&&&&*&&*&&$*&$*&&&$777**$ ***$**$$*7$$***$$*$**$*$**$$****$*&&**$&&*$&7 $&&&$*$&$*$*&&**7*$$7***777*7**7*$&&&&&*&&&&& &$&&&&$&&&7&&&77&&&$&&&*$&&&&&$$&&&&&$7&&&&$* 77&*$*&&*&&*&&&*$$$**&&***&&*7&*7&77$**$**$*7 &*&&*&&*&&*&&$&&7&&*&&$7**$*&7*$7&$&&$77&7&*$ 0HW*OX/HX,OH7KUOOH/HX*O *$$*$&&*7*7&7&&&*$7&**&7**$*&7**$$*&**&*&$*$$ X/\V7KU9DO6HU3UR$VS$UJ/HX*OX/HX*OX$OD$OD*OQ/\ *77&&7**$*&*7*&**&&*7**$*$$&&7*&&&$&777&&77*7 V3KH/HX*OX$UJ$OD$OD9DO*OX$VQ/HX3UR7KU3KH/HX9D **$$&7*7&&$*$*7*&7**&$$$7&&$**$$$&$*7&$**77*& O*OX/HX6HU$UJ9DO/HX$OD$VQ3UR*O\$VQ6HU*OQ9DO$O &$*$*77*&$*&7**7&7$&$$$7&$$*$$&7&777*$&$7&7$$ D$UJ9DO$OD$OD*O\/HX*OQOOH/\V$VQ6HU/HX7KU6HU/\ $*$7&&$*$7$7&$$**&$&$$7$7&$*&$*$**7**&77*&7$7 V$VS3UR$VS,H/\V$OD*OQ7\U*OQ*OQ$UJ7US/HX$ODO 7*$7*&7$$7*&7&*$&*$*$$*7&$$*$$&7$7*7777*&$*$& H$VS$OD$VQ$OD$UJ$UJ*OX9DO/\V$VQ7\U9DO/HX*OQ7K $77***7$&$*$$$&77$&&**&&7$*77&7*&&7&$&$*7*7*7 U/HX*O\7KU*OX7KU7\U$UJ3UR6HU6HU$OD6HU*OQ&\V9D **&7**7$77*&77*7*&$*$*$7&&&$*7$$$&&$*7**&&$*$ O$OD*O\OOH$OD&\V$OD*OX,OH3UR9DO$VQ*OQ7US3UR*O $&7&$77&&7&$*&7**7**&&$$7*7&$&$$$&&&&$$&$*&$& X/HX,OH3UR*OQ/HX9DO$OD$VQ9DO7KU$VQ3UR$VQ6HU7K $*$*&$&$7*$$**$*7&*$&$77**$$*&&$7&**77$7$777* U*OX+LV0HW/\V*OX6HU7KU/HX*OX$ODOOH*O\7\UOOH&\ & &$$*$7$7$*$& & &$*$*&$*&7$&$$*$7$$$7 & &$$7*$*$7 V*OQ$VS,OH$VS3UR*OX*OQ/HX*OQ$VS/\V6HU$VQ*OX,O 7&7*$&7*&&$7$$7&&$****$7*$**$$$*$$*$*&&7$*7$$ H/HX7KU$ODOOHOOH*OQ*O\0HW$UJ/\V*OX*OX3UR6HU$V 7$$7*7*$$*&7$*&7*&7$&$$$7*&$&7&&7*$$&7&$77**$ Q$VQ9DO/\V/HX$OD$OD7KU$VQ$OD/HX/HX$VQ6HU/HX*O *77&$&&$$$*&$$$&777*$7$$$*$*7&7*$$$**&$&777$7 X3KH7KU/\V$OD$VQ3KH$VS/\V*OX6HU*OX$UJ+LV3KHOO

PAGE 146

7$7*&$**7**7&7*7*$$*&&$&$&$*7*7&&$*$7$&*$***7 H0HW*OQ9DO9DO&\V*OX$OD7KU*OQ&\V3UR$VS7KU$UJ9D $&*$*7**&7*&777$&$*$$7&7**7*$$*$7$$7*7&&77$7$ O$UJ9DO$OD$OD/HX*OQ$VQ/HX9DO/\V,OH0HW6HU/HX7\ 77$7&$*7$&$7**$*$&$7$7$7***7&&7*&7&77777*&$$7 U7\U*OQ7\U0HW*OX7KU7\U0HW*O\3UR$OD/HX3KH$ODOO &$&$$7&*$$*&$$7*$$$$*7*$&$77*$7*$**7**&777$&$ H7KUOOH*OX$OD0HW/\V6HU$VS,OH$VS*OX9DO$OD/HX*O $***$7$*$$77&7**7&&$$7*7&7*7*$7*$**$$$7**$777 Q*O\OOH*OX3KH7US6HU$VQ9DO&\V$VS*OX*OX0HW$VS/H **&&$77*$$*&77&$*$**&$*&$*$$&$$**$&**&&&&&7*$ X$ODOOH*OX$OD6HU*OX$OD$OD*OX*OQ*O\$UJ3UR3UR*O *&$&$&&$*&$$*7777$7*&*$$***$*&$&7$&$*7$7&7**7 X+LV7KU6HU/\V3KH7\U$OD/\V*O\$OD/HX*OQ7\U/HX9D 7&&$$7&&7&$&$&$*$&$&7$$&7$$$&$**$&*$$$$7*$7*$ 3UR,H/HX7KU*OQ7KU/HX7KU/\V*OQ$VS*OX$VQ$VS$V 7*$&*$7*$&7**$$&&&&7*&$$$*&$*&$****7*7*&&7&$7 S$VS$VS$VS7US$VQ3UR&\V/\V$OD$OD*O\9DO&\V/HX0H *&77&7**&&$&&7*&7*7*$$*$7*$&$77*7&&&$&$7*7&&7 W/HX/HX$OD7KU&\V&\V*OX$VS$VS,H9DO3UR+LV9DO/H &&&&77&$77$$$*$$&$&$7&$$*$$&&&$*$77**&**7$&&* X3UR3KHOOH/\V*OX+LV,OH/\V$VQ3UR$VS7US$UJ7\U$U **$7*&$*&$*7*$7**&7777**77*7$7&77**$$**$&&$*$ J$VS$OD$OD9DO0HW$OD3KH*O\&\V,OH/HX*OX*O\3UR*O *&&&$*7&$*&7&$$$&&$&7$*77$7$&$**&7$7*&&&$&&&7 X3UR6HU*OQ/HX/\V3UR/HX9DOOOH*OQ$OD0HW3UR7KU/H $$7$*$$77$$7*$$$*$&&&&$*7*7$*77*77&*$*$7$&$*& X,OH*OX/HX0HW/\V$VS3UR6HU9DO9DO9DO$UJ$VS7KU$O 7*&$7**$&7*7$**&$*$$777*7*$*&7*&77&&7*$$*&7*& D$OD7US7KU9DO*O\$UJOOH&\V*OX/HX/HX3UR*OX$OD$O &$7&$$7*$7*7&7$&77**&7&&&&7*&7$&$*7*7&7*$77*$ DOOH$VQ$VS9DO7\U/HX$OD3UR/HX/HX*OQ&\V/HX,OH*O ***7&7&$*7*&7*$$&&&$*$*7**&77&$$$7*7*7*&7***& X*O\/HX6HU$OD*OX3UR$UJ9DO$OD6HU$VQ9DO&\V7US$O 777&7&&$*7&7**&7*$$*&7*&77$7*$$*&7*&$*$&*77*& D3KH6HU6HU/HX$OD*OX$OD$OD7\U*OX$OD$OD$VS9DO$O

PAGE 147

7*$7*$7&$**$$*$$&&$*&7$&77$&7*&77$7&77&77&$77 D$VS$VS*OQ*OX*OX3UR$OD7KU7\U&\V/HX6HU6HU6HU3K 7*$$&7&$7$*77&$*$$*&7&&7$*$*$&7$&$*$&$*$&&7*$ H*OX/HX,OH9DO*OQ/\V/HX/HX*OX7KU7KU$VS$UJ3UR$V 7**$&$&&$*$$&$$&&7*$**$*77&7*&$7$7*$$7&7&7*$7 S*O\+LV*OQ$VQ$VQ/HX$UJ6HU6HU$OD7\ALOX6HU/HX0H **$$$77*7*$$$$$&$*7*&&$$**$77*77$&&&7*&7*7&&$ W*OX,OH9DO/\V$VQ6HU$OD/\V$VS&\V7\U3UR$OD9DO*O *$$$$&*$&777**7&$7&$7**$$&*$&7*&$$&$**77&77&$ Q/\V7KU7KU/HX9DOOOH0HW*OX$UJ/HX*OQ*OQ9DO/HX*O *$7**$*7&$&$7$7&&$*$*&$&$7&&*$7$*$$7&&$*77&$$ Q0HW*OX6HU+LV,OH*OQ6HU7KU6HU$VS$UJOOH*OQ3KH$V 7*$&&77&$*7&777$&7&7*7*&$$&7&77&$*$$7*77&77&* Q$VS/HX*OQ6HU/HX/HX&\V$OD7KU/HX*OQ$VQ9DO/HX$U *$$$*7*&$$&$7&$$*$7*&777*&$*$7&7&7*$7*7**77$7 J/\V9DO*OQ+LV*OQ$VS$OD/HX*OQOOH6HU$VS9DO9DO0H **&&7&&&7*77$$**$7*77&&$$$*&$&$*&7***7&7***** W$OD6HU/HX/HX$UJ0HW3KH*OQ6HU7KU$OD*O\6HU*O\*O $*7$&$$*$**$7*&&&7*$7**&$*77$*&$&$&7**7**$$*7 \9DO*OQ*OX$VS$OD/HX0HW$OD9DO6HU7KU/HX9DO*OX9D *77***7**7*$$77&&7&$$*7$&$7**$**&&777$$$&&&77 O/HX*O\*O\*OX3KH/HX/\V7\U0HW*OX$OD3KH/\V3UR3K &&7***&$77**$77$$$$$$77$7*&7*$$7$&&$**777*777 H/HX*O\OOH*O\/HX/\V$VQ7\U$OD*OX7\U*OQ9DO&\V/H **&$*&7*7***&77$*7***$*$&77*7*&&*7*&&&7*&$$7& X$OD$OD9DO*O\/HX9DO*O\$VS/HX&\V$UJ$OD/HX*OQ6H &$$&$7&$7$&&777&7*7*$&*$**7*$7*&$*&7*&77&7**$ U$VQOOH,OH3UR3KH&\V$VS*OX9DO0HW*OQ/HX/HX/HX*O $$$777****$$7*$*$$&*7&&$&$**7&7*7*$$*&&*&$*$7 X$VQ/HX*O\$VQ*OX$VQ9DO+LV$UJ6HU9DO/\V3UR*OQLO 7&7*7&$*7*777**7*$7$77*&&&77*&7$77**$**$*$*77 H/HX6HU9DO3KH*O\$VS,OH$OD/HX$ODOOH*O\*O\*OX3K 7$$$$$$7$&77$*$**77*7$77*$$7$&7&77&$*&$**&&7& H/\V/\V7\U/HX*OX9DO9DO/HX$VQ7KU/HX*OQ*OQ$OD6H &&$$*&&&$**7**$&$$*7&$*$&7$7*$&$7**7**$77$7&7 U*OQ$OD*OQ9DO$VS/\V6HU$VS7\U$VS0HW9DO$VS7\U/H

PAGE 148

*$$7*$*&7$$***$$$*&7*&77**$$*&&7$7$&7**$$7&*7 X$VQ*OX/HX$UJ*OX6HU&\V/HX*OX$OD7\U7KU*O\OOH9D &&$***$77$$$*****$7&$**$*$$&*7$&$&&&**$7*7*$7 O*OQ*O\/HX/\V*O\$VS*OQ*OX$VQ9DO+LV3UR$VS9DO0H *&7**7$&$$&&&$*$*7$*$$777$77&7*7&777&$77*$&&$ W/HX9DO*OQ3UR$UJ9DO*OX3KHOOH/HX6HU3KHOOH$VS+L &$77*&7**$*$7*$**$7&$&$&$*$7**$*7$*7$*&77*7*& V,OH$OD*O\$VS*OX$VS+LV7KU$VS*O\9DO9DO$OD&\V$O 7*&7**$&7$$7$****$&77$7*7$&$*&$777***$$**$7*7 D$OD*O\/HX,OH*O\$VS/HX&\V7KU$OD3KH*O\/\V$VS9D $&7*$$$77$*7$*$$*&7$**&&$$7*$7&&$7*$$77*77$$& O/HX/\V/HX9DO*OX$OD$UJ3UR0HWOOH+LV*OX/HX/HX7K 7*$$***&**$*$7&*$$*$&7$$&$$$*&$$$$$&&&77*&7$& U*OX*O\$UJ$UJ6HU/\V7KU$VQ/\V$OD/\V7KU/HX$OD7K $7***&$$&$$$$*$$&7*$**$$$&7*$$*$$&&$$*&77*$7& U7US$OD7KU/\V*OX/HX$UJ/\V/HX/\V$VQ*OQ$OD 7*77$&&$77***$7*$7$$&&7*$**$&&&&&$&7**$$$7&7& &&$7&7777*$$$$$&&7**$$*7*$**$*7*7*&$&**$7*&7* $$7*777***$$7*$*$**$7*$*7*$*7*$**&77*$$$$&$&$ &&$&$77*$$$$7&&7*&&$&$*&$*&$*&&*&$*&&*&&$$&$* &$*&*&7*77$*7*$*&7$$*7$$*&$&7*$&77&*7$*$$$$&& $7$$&$7&**&&$7&77**$$$$*$*$$$$$&$$7**$*77$&77 $777$$$$$$$$$*$$$*$$$*77$7&7&77&&&$**$*$**&7$ *$$*7$*&7777&7*7&7777**&&$*7*&&*$*7**$$7*&&7* *777&****$**$**$***$&7***77&$*&7*7**7*&777*77 *7$$$$**&$*&&7**&&777*&7$&7*$**$*$$$*$7**$*&& 7***7&7&$$*&&&$&&77&*&7*7$&&777*&&$&$7**7$&7* 7$7*&77*&&$*&7$*$$**$***7&$***777777$&$*7&7*$ *$$7*$*7*7*7*7*$*7*$**&**7$7&&$&$77&7&$$&77&$ $*7&$77*&7*777&77777&&&$*$$$$&$$****77$*$7*77 *&$777&$7$$$$&7$$&&*$$*77&7*7&7$&7*$7*&$*&$&$ $*$*$7*7$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$&$&$&$ $$$$$$&$&$&$&$&$*$**$$$*$&*&7&777$**7777*7777 *7777777777777**7777*777777*77777777777$&7&7$ ***$$$$&$&7*$&*$$7**7&$*$*&7&&7$7&&7*$7&7777& $7&$$**&*&&777&&7$$7$$7$7**77&$$&7*7*$$7*7$*$ $*7*****11$******$*$$$$$*$$$$&7&7**&*77$*$**$ 7$7$$$$$$$7$7$$*7$&$$77*77$&$$$7$$&*&$*$&77&$ $$$$&$$$$$$$7&$&$$&&&$$$&$$$&&$$$$777$$$7*$7& $*$$77**&$*&$&$$$*$$$$&*&&&7&7&&7*$&77*7$77*7 **&$*7&7*$$&*&&&&&$*$$$$77*7*&&$$$*$*777$*$$$ $$7$$$7$7$&$$7$$$$*7$$$&$&$7$&$&$&$$$$&$*&$$$ &77&$**7$$&7$7777**$77*&$$$&$**$7$$77$$$7*77& $$$&$$7&7*$7$$$$7$$&&$777**

PAGE 149

6(48(1&( ,02*(1 =f &**&*$7*777&&7$*$*7&7&*$&*77&&7$&&7&77&*&&&&& 0HW3KH3UR$UJ9DO6HU7KU3KH/HX3UR/HX$UJ3UR/ 777&&&*&&$&&&777*7&&7&7**$$*&&&**$*$&$7&$*&** HX6HU$UJ+LV3UR/HX6HU6HU*O\6HU3UR*OX7KU6HU$OD$ &7*&*$77$7*&7$&7&$&7*77&**&$&**$$&$*7&$**7$&& OD$ODOOH0HW/HX/HX7KU9DO$UJ+LV*O\7KU9DO$UJ7\U$ *&$*77&$*&*&7*77**&&&**$&$$$$$$7$$&$7&&$$$*$7 UJ6 HU6HU$OD/HX/HX$OD$UJ7KU/\V$VQ$VQOH*OQ$UJ7 $7777**&$&7$$&$*7*7*$7&7*7$*&$$*$$$*$7$$*&$*7 \U3KH*O\7KU$VQ6HU9DOOOH&\V6HU/\V/\V$VS/\V*OQ6 &7*77&*$$&7*$**$*$&77&&$$**$*$&77&$*$*$*&&$$* HU9DO$UJ7KU*OX*OX7KU6HU/\V*OX7KU6HU*OX6HU*OQ$ $&$*7*$$$$**$$$$7$&*$$$$$$*$&77*77$**&$77$77$ VS6HU*OX/\V*OX$VQ7KU/\V/\V$VS/HX/HX*O\OOH,OH/ $***&$7*$$$*77*$$77$$*&$&$*7$$$7*7$&*$$&$$&$$ \V*O\0HW/\V9DO*OX/HX6HU7KU9DO$VQ9DO$UJ7KU7KU/ $*&&&&&&$$$$*$$*$&&$&77$$$$*777**$$*&7$&$&77* \V3UR3UR/\V$UJ$UJ3UR/HX/\V6HU/HX*OX$OD7KU/HX* *&$**&77&*$$*$*&7$&$*$$7$7*&7&&$$$*$$*$*$$77* O\$UJ/HX$UJ$UJ$OD7KU*OX7\U$OD3UR/\V/\V$UJOOH* $*&&&&7*$*7&&7*$*77**7**&$*&7*&$7&7*&7*7**&$* OX3UR/HX6HU3UR*OX/HX9DO$OD$OD$OD6HU$OD9DO$OD$ $77&7&7&&&7777*$7$$*&$$$&$$&&$$*7&$*$*&7*&7*$ VS6HU/HX3UR3KH$VS/\V*OQ7KU7KU/\V6HU*OX/HX/HX6 *&&$*&7&&$*&$*&$7*$**$$*$*7&$$***&$&$*$*$*$7* HU*OQ/HX*OQ*OQ+LV*OX*OX*OX6HU$UJ$OD*OQ$UJ$VS$ &$$$*&*$&&7$$$$77$*777&$*7$$&$7$$7$7&$*$7$7*$ D/\V$UJ3UR/\V,OH6HU3KH6HU$VQ,OHOOH6HU$VS0HW/ $$*77*&&$*$7&7*&7$&$*&7$*$*77&*77&$$*$&&$*$*& \V9DO$OD$UJ6HU$OD7KU$OD$UJ9DO$UJ6HU$UJ3UR*OX/ 77&**$77&$*777*$7*$$**&7$7*$&$$77$7&&7**&&$** HX$UJOOH*OQ3KH$VS*OX*O\7\U$VS$VQ7\U3UR*O\*OQ* $*$$*$&**$7*$7&77$$$$$$$**$$$$$7$7$77&$&$***$ OX/\V7KU$VS$VS/HX/\V/\V$UJ/\V$VQOOH3KH7KU*O\/

PAGE 150

$$$*$&77$$7$77777*$&$7*$7**&$*77$&7$$$*$$*&$& \V$UJ/HX$VQOOH3KH$VS0HW0HW$OD9DO7KU/\V*OX$OD3 &7*$$$&$*$&$&$7&$&&77&$&777**$$7*7**$$777*&7$ UR*OX7KU$VS7KU6HU3UR6HU/HX7US$VQ9DO*OX3KH$OD/ $*&$*77$*&&$&$*7$$$7*$$&$$&&&&77&$*$$7**$777* \V*OQ/HX$OD7KU9DO$VQ*OX*OQ3UR/HX*OQ$VQ*O\3KH* $$*$*&7*$7&&$*7**$&$$$$*$****$$$&7$7***$*77&& OX*OX/HX,OH*OQ7US7KU/\V*OX*O\/\V/HX7US*OX3KH3 &$$77$$&$$7*$$*&$**7777*$7*$7*$7**77&$*$$777& UROOH$VQ$VQ*OX$OD*O\3KH$VS$VS$VS*O\6HU*OX3KH+ $7*$$&$7$7$777&7**$*$$$&$&&7**$*$*&777&&$$$$& LV*OX+LV,OH3KH/HX*OX/\V+LV/HX*OX6HU3KH3UR/\V* $$**$&&$$77&*&&$&77&$7**$*&7**7*$&77*7**&&777 ,Q*O\3UR,OH$UJ+LV3KH0HW*OX/HX9DO7KU&\V*O\/HX6 &&$$$$$&&&$7$7&77$*7*77$$$&$*$$**77*$$&$&$7$* HU/\V$VQ3UR7\U/HX6HU9DO/\V*OQ/\V9DO*OX+LV,OH* $*7**777$*$$$77$7777$$7*$$$$$$$**$7$77&7$$$$* OX7US3KH$UJ$VQ7\U3KH$VQ*OX/\V/\V$VS,OH/HX/\V* $$$*7$$&$7$&$*77&$$77$$*$&&$7**$ OX6HU$VQOOH*OQ3KH$VQ

PAGE 151

6(48(1&( '*6, ',*(25*( 6<1'520( /f ****$7$*&*$7**$*$&*&&***&*&$7&$*&*7&*7&&77*77 *O\OOH$OD0HW*OX7KU3UR*O\$OD6HU$OD6HU6HU/HX/H *&77&&&*&&*&*7&&$**&&&&&*$**$$*&*&*$**&***$*$ X/HX3UR$OD$OD6HU$UJ3UR3UR$UJ/\V$UJ*OX$OD*O\*O **&7****&7*&*$&*$*&$$*&$*&***7&&7**$&*$**$$*$ X$OD*O\$OD$OD7KU6HU/\V*OQ$UJ9DO/HX$VS*OX*OX*O *7$7$7&*$***&&7&&$*$&**7&$7&&$$$***$777&777&& X7\UOOH*OX*O\/HX*OQ7KU9DOOOH*OQ$UJ$VS3KH3KH3U 7*$7*7**$*$$*&7&&$**&$&$*$$**$*7$&&7**$$*&&*$ R$VS9DO*OX/\V/HX*OQ$OD*OQ/\V*OX7\U/HX*OX$OD*O **$*$$7**$*$&77**$$&**$7*&*&&$*$77*&&$7&$$*77 X*OX$VQ*O\$VS/HX*OX$UJ0HW$UJ*OQOH$OD,OH/\V 3K 7**&7&7*&&77***&$$*$7*7&&&***$*&&&&&*&&$&&&7$ H*O\6HU$OD/HX*O\/\V0HW6HU$UJ*OX3UR3UR3UR3UR7\ 7*7*$&7&&$*&&$&$777*$$$&&&&7*$**7*&$7*&$**&$& U9DO7KU3UR$OD7KU3KH*OX7KU3UR*OX9DO+LV$OD*O\7K 7**$*7**7***&$$&$$*&&&$**&&&&*&**&&*$**&&7**$ U*O\9DO9DO*O\$VQ/\V3UR$UJ3UR$UJ*O\$UJ*O\/HX*O **$7**$*$**&7**$*$**$**$**$*$$**$*&&*&7*&&&$* X$VAO\*OX$OD*O\*OX*OX*OX*OX/\V*OX3UR/HX3UR6H &&7$*$7*7&77&&7*$*&&*&7$&$&*$*7*$**$&$$7*&&7& U/HX$VS9DO3KH/HX6HU$UJ7\U7KU6HU*OX$VS$VQ$OD6H &77&&$**$*$7&$7**$**7**&&$$**$*$*$$*&&***&$&* U3KH*OQ*OX,OH0HW*OX9DO$OD/\V*OX$UJ6HU$UJ$OD$U &&$&*&77**&7&7$&&$**&7*$**$$*$*777*$*$$*$**&$ J+LV$OD7US/HX7\U*OQ$OD*OX*OX*OX3KH*OX/\V$UJ*O *$$$*$7$$7&7&*$$&7&&&*7&$*&$*$*&$&&$**&&$7&*$ Q/\V$VS$VQ/HX*OX/HX3UR6HU$OD*OX+LV*OQ$ODOOH*O *$*&$*&&$**&&$*7*7**$*$&&7**$$*7$&$$**&&$$*$$ X6HU6HU*OQ$OD6HU9DO*OX7KU7US/\V7\U/\V$OD/\V$V 77&&&7&$7*7$&7$7&&$*$***7*7&&&7*$&*$**$*&$*&7 Q6HU/HX0HW7\U7\U3UR*OX*O\9DO3UR$VS*OX*OX*OQ/H *777$$*$$*&&&&**&$**7**7$&$7$$*$$&$&*&*&77&&7 X3KH/\V/\V3UR$UJ*OQ9DO9DO+LV/\V$VQ7KU$UJ3KH/H

PAGE 152

7$***$&&&&77&$*&&$$*&&&7*$*&$**7*&&$*&7&&$*&$ X$UJ$VS3UR3KH6HU*OQ$OD/HX6HU$UJ&\V*OQ/HX*OQ*O **&$*&&*&&&7&$$7*&&&$*&$&$$$&$***&$$**7***&&& Q$OD$OD$OD/HX$VQ$OD*OQ+LV/\V*OQ*O\/\V9DO*O\3U &*$7**&$$**$*&7*$7&&&&&$**$*7&&&&7&*$*7***7** R$VS*O\/\V*OX/HX,OH3UR*OQ*OX6HU3UR$UJ9DO*O\*O $777**$777*77*&&$&7&&77&&&&7*&&&&7**7*7*$$&*$ \3KH*O\3KH9DO$OD7KU3UR6HU3UR$OD3UR*O\9DO$VQ*O *7&&&&*$7*$7*$&&7******$**77*$*$$&$&$&&&77*$* X6HU3UR0HW0HW7KU7US*O\*OX9DO*OX$VQ7KU3UR/HX$U $*77*$$***7&**$$$&*&&&7$&*7**$&$**$&$&&&**&&& J9DO*OX*O\6HU*OX7KU3UR7\U9DO$VS$UJ7KU3UR*O\3U $*&7777$$*$7&&7**$*&&$**&&*&$***$*&**&7***7&7 R$OD3KH/\V,OH/HX*OX3UR*O\$UJ$UJ*OX$UJ/HX*O\/H *$$*$7**&&$$&*$**&&*&7*&&$$*$$&&***&&$$*$$*&$ X/\V0H W$OD$VQ*OX$OD$OD$OD/\V$VQ$UJ$OD/\V/\V* **$$*&&77*&**$*$*7*$&**$*$$7&7**&&$*&&7&$&&&& Q*OX$OD/HX$UJ$UJ9DO7KU*OX$VQ/HX$OD6HU/HX7KU3U &$$$**&&7*$*&&&$*&&$7*7&*&&$*&&&7$&$*&*&&77*7 R/\V*O\/HX6HU3UR$OD0HW6HU3UR$OD/HX*OQ$UJ/HX9D *$*&$**$&**&&$*&$$*7$&$&$*$&&***&&&7*&***&&$* 6 HU$UJ7KU$OD6 HU/\V7\U7KU$VS$UJ$OD/HX$UJ$OD6 H &7$&$&$&&$7&&&&$*&$&*&7&&$&&&$&&7&$$*$&&&&**& U7\U7KU3UR6HU3UR$OD$UJ6HU7KU+LV/HX/\V7KU3UR$O &$*7***&7*&$*$&&&&&$&$$*&$&$&&**&*&&7**&7&7*& D6HU*O\/HX*OQ7KU3UR7KU6HU7KU3UR$OD3UR*O\6HU$O &$&$&*&$&&&&7&7&$&$&$**$&&&**&&7&&$7&$&**$&$$ D7KU$UJ7KU3UR/HX7KU*OQ$VS3UR$OD6HUOOH7KU$VS$V &&7*&7*&$*&7&&&7*&&&**&*&$$$*&77&**$&77&7777$ Q/HX/HX*OQ/HX3UR$OD$UJ$UJ/\V$OD6HU$VS3KH3KH *$*&&$**&&7***&7***&7&$7$*$&*&77&$&$*$*&&7*&$ ***&$*&7*7$&$&&&$*&$*$**$&7&&$*&&77&7&****&&& $**&&7***&&$*$$*&7*77*$&&$7$&&$**$*7&$&7**$*$ $$****&7*7*&7****&&$*$&7**&$&$$**&$&7&*7*&&&$ &$&&$&$&&&&$***&&77*&&$$*&7*777*&7*777$$77**& &&&77*$$&7*7&$77$$$*$$&$&&7$**7$&

PAGE 153

6(48(1&( $7523+,1 8f 77****7**$*&$*$*$$*777&7*7$77&$*&7*&&&$**&$*$ **$*$$7****7&7&&$&$*&&7*$$*$$7*$$*$&$&*$&$*$$ 0HW/\V7KU$UJ*OQ$V 7$$$*$&7&*$7*7&$$7*$**$*7**$&**$$*$$$*$**&&&& Q/\V$VS6HU0HW6HU0HW$UJ6HU*O\$UJ/\V/\V*OX$OD3U 7***&&&&***$$*$$&7*$*$7&*$****&&***&&7&&&&7** R*O\3UR$UJ*OX*OX/HX$UJ6HU$UJ*O\$UJ$OD6HU3UR*O $****7&$*&$&*7&&$*&$*7*$7**&$$$*&7*$*$$*7&&$* \*O\9DO6HU7KU6HU6HU6HU$VS*O\/\V$OD*OX/\V6HU$U *&$*$&$*&&$$*$$**&&&*$*7$*$**$$*&&7&&$&&&&$$$ J*OQ7KU$OD/\V/\V$OD$UJ9DO*OX*OX$OD6HU7KU3UR/\ **7&$$&$$*&$***7&**$*7*$**$*$7&7&$*$*$*7*$$$* V9DO$VQ/\V*OQ*O\$UJ6HU*OX*OX,OH6HU*OX6HU*OX6H 7*$**$*$&&$$7*&$&&$$$$$$*$&&$$$$&7*$**$$&7&&& U*OX*OX7KU$VQ$OD3UR/\V/\V7KU/\V7KU*OX*OX/HX3U 7&**&&$&$*7&7&&&7&&*$7&7**$7$*&77**$&***&**$* R$UJ3UR*OQ6HU3UR6HU$VS/HX$VS6HU/HX$VS*O\$UJ6H &&77$$7*$7*$7**&$*&$*&*$&&&7$***$7$7&*$&&$**$ U/HX$VQ$VS$VS*O\6HU6HU$VS3UR$UJ$VS,OH$VS*OQ$V &$$&&*$$*&$&*7&&&&&$*7$7&7$&$*&&&7**$$*7*7**$ S$VQ$UJ6HU7KU6HU3UR6HUOOH7\U6HU3UR*O\6HU9DO*O *$$7*$&7&7*$&7&$7&77&7**&&7*7&&&$***&&&$*&&&* X$VQ$VS6HU$VS6HU6HU6HU*O\/HX6HU*OQ*O\3UR$OD$U &&&&7$&&$&&&$&&7&&$&7&777&&7&&77&&&&7&$$&&*&& J3UR7\U+LV3UR3UR3UR/HX3KH3UR3UR6HU3UR*OQ3UR3U $*$&$*&$&&&&7&*$&$*&&$*$**&7$*&777*$$&&&&$7&& R$VS6HU7KU3UR$UJ*OQ3UR*OX$OD6HU3KH*OX3UR+LV3U 77&7*7*$&$&&&$&7**$7$7&$7*&7&&&$7**$*&&&&&&$& R6HU9DO7KU3UR7KU*O\7\U+LV$OD3UR0HW*OX3UR3UR7K $7&7&*$$7*77&&$**&7&&7&&7****&&&&7&&&&&7&$&&& U6HU$UJ0HW3KH*OQ$OD3UR3UR*O\$OD3UR3UR3UR+LV3U $&$*&7&7$7&&&*****&$&7**7**$*7777*7&7**$&&&&& R*OQ/HX7\U3UR*O\*O\7KU*O\*O\9DO/HX6HU*O\3UR3U

PAGE 154

$$7***7&&&$$******$****&7*&&7&$7&$*7******&&& R0HW*O\3UR/\V*O\*O\*O\$OD$OD6HU6HU9DO*O\*O\3U 7$$7*****7$$*&$*&$&&&&&&$&&&$&7$&7&&&$777&$*7 R$VQ*O\*O\/\V*OQ+LV3UR3UR3UR7KU7KU3UR,OH6HU9D $7&$$*&7&7****&7$*7**7*&7&&&&&$$&$$$*&&*&&7$& O6HU6HU6HU*O\$OD6HU*O\$OD3UR3UR7KU/\V3UR3UR7K &$&7&&$*7***7**7***$$&&7$&&77&7*&7&&$&&$&&$*& U7KU3UR9DO*O\*O\*O\$VQ/HX3UR6HU$OD3UR3UR3UR$O &$$&77&&&&&$7*7*$&$&&*$$&&7*&&7&&&&&$&&7*&&&7 D$VQ3KH3UR+LV9DO7KU3UR$VQ/HX3UR3UR3UR3UR$OD/H *$*$&&&&7&$$&$$7*&$7&$*&&7&7&&&&&7**&&7*****& X$UJ3UR/HX$VQ$VQ$OD6HU$OD6HU3UR3UR*O\/HX*O\$O &&$$&&$&7$&&7**7&$7&7*&&&7&7&&&&$&*&&$7***$&$ D*OQ3UR/HX3UR*O\+LV/HX3UR6HU3UR+LV$OD0HW*O\*O ***7$7&**7**$&77&&7&&7**&&&$*$*$$***&&&$$&7&7 Q*O\OOH*O\*O\/HX3UR3UR*O\3UR*OX/\V*O\3UR7KU/H **&7&&77&$&&&&$&7&7&7*&&7&&7*&77&&7&77&7*&7&& X$OD3UR6HU3UR+LV6HU/HX3UR3UR$OD6HU6HU6HU$OD3U $*&*&&&&&&$7*$**777&&77$77&$7&&7&7$*7$*7$*&7& R$OD3UR3UR0HW$UJ3KH3UR7\U6HU6HU6HU6HU6HU6HU6H 7*&$*&$*&&7&&7&77&&$*77&77&&7&&7&77&&7&7*&&7& U$OD$OD$OD6HU6HU6HU6HU6HU6HU6HU6HU6HU6HU$OD6H &&&&77&&&$*&77&&&$**&$77*&&&$*&7$&&&&&$&7&777 U3UR3KH3UR$OD6HU*OQ$OD/HX3UR6HU7\U3UR+LV6HU3K &&&7&&&&&$$&$$*&&7&7&7*7&7&&$$7&$*&&&&&&$$*7$ H3UR3UR3UR7KU6HU/HX6HU9DO6HU$VQ*OQ3UR3UR/\V7\ 7$&7&$*&&77&7&7&&&$7&&&$**&7*7*7**$*&&$***7&& U7KU*OQ3UR6HU/HX3UR6HU*OQ$OD9DO7US6HU*OQ*O\3U &&&$&&$&&7&&7&&&7$7**&&*&&7&77$*&&$$&$*&$$7*& R3UR3UR3UR3UR3UR7\U*O\$UJ/HX/HX$OD$VQ6HU$VQ$O &&$7&&$**&&&&77&&&7&&&7&7$&7****&&&$*7&&$&&*& D+LV3UR*O\3UR3KH3UR3UR6HU7KU*O\$OD*OQ6HU7KU$O & &$& & &$& &$*7&7&$$&$&$7 &$& &$7&$& &$& &$*&$$&$*&$ D+LV3UR3UR9DO6HU7KU+LV+LV+LV+LV+LV*OQ*OQ*OQ*O $&$*&$*&$*&$*&$*&$*&$*&$*&$*&$*&$7&$&**$$$&7& Q*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ+LV+LV*O\$VQ6H

PAGE 155

7***&&&&&7&&7&&7**$*&$777&&&&$&&&$&7**$***&** U*O\3UR3UR3UR3UR*O\$OD3KH3UR+LV3UR/HX*OX*O\*O 7$*&7&&&$&&$&*&$&$&&&77$&*&&$7*7&7&&&7&&&7*** \6HU6HU+LV+LV$OD+LV3UR7\U$OD0HW6HU3UR6HU/HX*O *7&7&7*$**&&&7$&&&$&&$***&&$*&$&$&&7*&&&&&$&& \6HU/HX$UJ3UR7\U3UR3UR*O\3UR$OD+LV/HX3UR3UR3U 7&$&$*&&$**7*7&&7$&$*&&$$*&$**&&&&$$7**&&&7&& R+LV6HU*OQ9DO6HU7\U6HU*OQ$OD*O\3UR$VQ*O\3UR3U $*7&7&77&&7&77&&$$&7&77&&7&77&&$&77&7&$$***7& R9DO6HU6HU6HU6HU$VQ6HU6HU6HU6HU7KU6HU*OQ*O\6H &7$&&&$7*77&$&$&&&&7&&&&77&&&$***&&&7&$$****& U7\U3UR&\V6HU+LV3UR6HU3UR6HU*OQ*O\3UR*OQ*O\$O *&&&7$&&&777&&&$&&**7*&&7$&**7&$&&$&&7&77&**& D3UR7\U3UR3KH3UR3UR9DO3UR7KU9DO7KU7KU6HU6HU$O 7$&&&777&&$&**7&$77*&&$&&*7**&77&&7&*&&$*&$** D7KU/HX6HU7KU9DOOOH$OD7KU9DO$OD6HU6HU3UR$OD*O &7$&$$$$&**&&7&&&&$&&7***&&&&&$&&*7$&**$$$*$* \7\U/\V7KU$OD6HU3UR3UR*O\3UR3UR3UR7\U*O\/\V$U $*&&&&*7&&&&*****&&7$&$$*$&$*&&$&&&&$&&&**$7$ J$OD3UR6HU3UR*O\$OD7\U/\V7KU$OD7KU3UR3UR*O\7\ &$$$&&&***7&*&&7&&&7&&77&&*$$&****$&&&&$&&*** U/\V3UR*O\6HU3UR3UR6HU3KH$UJ7KU*O\7KU3UR3UR*O &7$7&*$**$$&&7&*&&$&&7*&$**&&&$***$&&77&$$*&& \7\U$UJ*O\7KU6HU3UR3UR$OD*O\3UR*O\7KU3KH/\V3U ***&7&*&&&$&&*7***$&&7***&&&&7*&&$&&7*&****&& R*O\6HU3UR7KU9DO*O\3UR*O\3UR/HX3UR3UR$OD*O\3U &7&$**&&7*&&$7&*&7*&&$&&$&&$&&7*&**&&&&7*&&7& R6HU*O\/HX3UR6HU/HX3UR3UR3UR3UR$OD$OD3UR$OD6H $***&&*&&&&7*$*&*&&$&*&$*$7&$$$&$**$*&&**&7*$ U*O\3UR3UR/HX6HU$OD7KU*OQOOH/\V*OQ*OX3UR$OD*O **$*7$7*$*$&&&&&*$*$*&&&**7*&&&&&$*&&&*&$*&&& X*OX7\U*OX7KU3UR*OX6HU3UR9DO3UR3UR$OD$UJ6HU3U &7&*&&&&&7&&&$$**7**7$*$7*7$&&&$*&&$7*&&$*7&$ R6HU3UR3UR3UR/\V9DO9DO$VS9DO3UR6HU+LV$OD6HU*O *7&7*&&$**77&$$&$$$&$&&7**$7&*&**&77&$$&7&*7* Q6HU$OD$UJ3KH$VQ/\V+LV/HX$VS$UJ*O\3KH$VQ6HU&\

PAGE 156

&*&*&*&$*&*$&&7*7$&77&*7*&&$&7**$***&7&&$$*&7 V$OD$UJ6HU$VS/HX7\U3KH9DO3UR/HX*OX*O\6HU/\V/H **&&$$*$$*&***&&*$&&7**7**$*$$**7*&**&*&*$**& X$OD/\V/\V$UJ$OD$VS/HX9DO*OX/\V9DO$UJ$UJ*OX$O &*$*&$*&*&*&*&*&*$$*$$$$**$*&*&*$*&*&*$*&***$ D*OX*OQ$UJ$OD$UJ*OX*OX/\V*OX$UJ*OX$UJ*OX$UJ*O $&*&*$*$$$*$*&*&*$*&*&*$*$$**$*&*&*$*&77*$$&* X$UJ*OX/\V*OX$UJ*OX$UJ*OX/\V*OX$UJ*OX/HX*OX$U &$*&*7*$$*77**&7&$**$***&&*7*&7&&**7**$$7*&&& J6HU9DO/\V/HX$OD*OQ*OX*O\$UJ$OD3UR9DO*OX&\V3U $7&7&7***&&&$*7*&&&&$7&*&&&7&&$777*$$&&***&$* R6HU/HX*O\3UR9DO3UR+LV$UJ3UR3UR3KH*OX3UR*O\6H 7 7*&**7**&7$&$*7*&&&&&&7$&&7***7&&7*$&$&7&&$*& U$OD9DO$OD7KU9DO3UR3UR7\U/HX*O\3UR$VS7KU3UR$O &77*&*&$&7&7&$*7*$$7$7*&&&**&&7&$7*7&$7*7&7&& D/HX$UJ7KU/HX6HU*OX7\U$OD$UJ3UR+LV9DO0HW6HU3U 7**&$$7&*&$$&&$7&&$77&7$&*7*&&&&7*****&$*7**$ R*O\$VQ$UJ$VQ+LV3UR3KH7\U9DO3UR/HX*O\$OD9DO$V &&&****&7&&7***77$&$$7*7&&&**&&&7*7$&$*&$*7*$ S3UR*O\/HX/HX*O\7\U$VQ9DO3UR$OD/HX7\U6HU6HU$V 7&&$*&7*&&&***$*$***$$&***$$*&&&*7*$$&*$*$&&7 S3UR$OD$OD$UJ*OX$UJ*OX$UJ*OX$OD$UJ*OX$UJ$VS/H &&*7*$&&*&&7&$$*&&7**&777*$**7*$$*&&7$*7*$*&7 X$UJ$VS$UJ/HX/\V3UR*O\3KH*OX9DO/\V3UR6HU*OX/H **$$&&&&7$&$7****7&&&7***&&***&77**$7&&&777&& X*OX3UR/HX+LV*O\9DO3UR*O\3UR*O\/HX$VS3UR3KH3U &&*$&$7*****&&7**&7&7*&$*&&7**&&&$&&7**&&7*&$ R$UJ+LV*O\*O\/HX$OD/HX*OQ3UR*O\3UR3UR*O\/HX+L &&&777&&&&777&$7&&*$*&&7****&&&&7**$*&*$*$$&* V3UR3KH3UR3KH+LV3UR6HU/HX*O\3UR/HX*OX$UJ*OX$U 7&7$*&*&7**&$*&7***&&$*&&&7*&**&&7*$&$7*7&&7$ J/HX$OD/HX$OD$OD*O\3UR$OD/HX$UJ3UR$VS0HW6HU7\ 7*&7*$*&**&7**&$*&7*$*$**&$*&$&*&$*$$$***7**& U$OD*OX$UJ/HX$OD$OD*OX$UJ*OQ+LV$OD*OX$UJ9DO$O **&&&7***&$$7*$&&&$&7**&&&**&7*&$*$7*&7&$$7*7 D$OD/HX*O\$VQ$VS3UR/HX$OD$UJ/HX*OQ0HW/HX$VQ9D

PAGE 157

*$&7&&&&$7&$&&$&&$*&$&7&&&$&$7&&$&7&*&$&&7*&$ O7KU3UR+LV+LV+LV*OQ+LV6HU+LV,OH+LV6HU+LV/HX+L &&7*&$&&$*&$$*$7*&7$7&&$7*&$*&&7&7*&&7&**7*&$ V/HX+LV*OQ*OQ$VS$ODOOH+LV$OD$OD6HU$OD6HU9DO+L &&&7&7&$77*$&&&&&7**&&7&$***7&7&$&&77$&&&**$7 V3UR/HX,OH$VS3UR/HX$OD6HU*O\6HU+LV/HX7KU$UJLO &&&&7$&&&$*&7**$$&7&7&&&7$$&&&&&7*&77&&7&$&&& H3UR7\U3UR$OD*O\7KU/HX3UR$VQ3UR/HX/HX3UR+LV3U 7&7*&$&*$*$$&*$$*77&77&*7&$&&$*&7&777*&7*&&&& R/HX+LV*OX$VQ*OX9DO/HX$UJ+LV*OQ/HX3KH$OD$OD3U 77$&&***$&&7*&&**&&7&&&777&7*&&&&*$7*7&$*&$*& R7\U$UJ$VS/HX3 UR$OD6HU/HX6HU$D3UR0HW6HU$O D$O 7&$7&$*&7*&$**&&$7*&$&*&$&$*7&$*&7*$*&7*&$*&* D+LV*OQ/HX*OQ$OD0HW+LV$OD*OQ6HU$OD*OX/HX*OQ$U &77**&*&7**$$&$*&$*&$*7**&7*&$7*&&&$7&$&&&*&7 J/HX$OD/HX*OX*OQ*OQ*OQ7US/HX+LV$OD+LV+LV3UR/H *&$&$*7*7*&&*&7*&&7*&&&$**$**$&7$&7$&$*7&$&&7 X+LV6HU9DO3UR/HX3UR$OD*OQ*OX$VS7\U7\U6HU+LV/H *$$*$$**$$$*&*$&$$*&&$&7*7$*$$&&7*&*$7&$$*$*$ X/\V/\V*OX6HU$VS/\V3UR/HX *&$&&$7**&7&&7$&$77**$&&77**$*&$&&&&&$&&&7&&& &&&$&&*7*&&&77**&&7*&&$&&&$*$*&&$$*$***7*&7*& 7&$*77*&$***&&7&&*&$*&7**$&$*$*$*7*****$***$* **$&$*$&$*$$**&&$$**&&&*$7*7**7*7*&$*$**7**** $**7**&*$**$7****$&$*$$$*&*&$&$*$$7&77**$&&$* *7&7&7&77&&77*7&&&&&&7*&7777&7&&7&&&&&$7*&&&$ $&&&&7*7**&&*&&*&&&&7&&&&7*&&&&*77**7*7*$77$7 77&$7&7*77$*$7*7**&7*7777*&*7$*&$7&*7*7*&&$&& &&7*&&&&7&&&&*$7&&&7*7*7*&*&*&&&&&7&7*&$$7*7$ 7*&&&&77*&&&&77&&&&$&$&7$$7$$777$7$7$7$7$$$7$ 7&7$7$7*$&*&7&77$$$$$$$&$7&&&$$&&$$$$&&$$&&$$ $&$$$$$&$7 & &7 &$&$$& 7& & & &$**$

PAGE 158

6(48(1&( (0%5<21$/ )<1 68%675$7( ()6 $%f &7&&$**&$$&77****&$$*&*7&7&$*77&7&*&7&7&&&77& &7&&&$*&****7&*&&*&$*$&&&&$*&&&7***$*&$&&*&7& 7*&$*&*&**&&**&***7**$*$&**77**&&&&7$$$&7&*&7 &*7&&$*&&&$$&&*&&&&**&**&77&7&&&$*&&&7&*$**&7 &7&&7*$*&**&&7**$*$**&*7&*$*&*&$*&&&$*&*&&&*& &7*&7&$&&&*&&&&**&&&***$$***$$7777&**$7&&7*&* $*&&&****&*&&&&&*&**&&7$***&***&$*&7&&&****&& 7**&&*$*&&**7**&*&&&***$**&&*&****$&$*&$&*&$* &*&*&*&&&77**$7*&&*7&&&*&$*&*$&*&&&&**&&&*&&& &*&7&&7&&7&&7*&&7**&7$*&&7*&&7&7&$777***$$*77 77*7***7777&777&7&&7&&7&&$$&&77**&**$**&&$&*$ &7&$**&*&&$&$*&7*****&7$*$**&&*&**$&&$7**7*&* ***&$*&&$&&*&7*$$*7&$*&$$$$&&*$*&&7**&&7*$**& $**&7*&*&***$**&&$$$*&&$7**&&$77*&&$&*7&*$&&& 0HW$ODOOH$OD7KU6HU7KU* $*&7**&&&***&$&7*7$7*$&$$&$&&*&7*$*7&&&&&&$** ,Q/HX$OD$UJ$OD/HX7\U$VS$VQ7KU$OD*OX6HU3UR*,Q* $*&7*7&&77&&*&&*$****$7*7&&7$&***7&&7*&$*$*$* OX/HX6HU3KH$UJ$UJ*O\$VS9DO/HX$UJ9DO/HX*OQ$UJ* $***&*&7**7**$&7**$&**&7**7*&&7&7*&7&&&7$&$&* OX*O\$OD*O\*O\/HX$VS*O\7US&\V/HX&\V6HU/HX+LV* *&&$*&$***&$77*7*&&&*&&$$&$***7*$$*&7&77*&&7* O\*OQ*OQ*O\OOH9DO3UR$OD$VQ$UJ9DO/\V/HX/HX3UR$ &7**&&&$*&$&&&$$*&&&$*&&7&7&7&&7*&*7&&&&$*&&& OD*O\3UR$OD3UR/\V3UR6HU/HX6HU3UR$OD6HU3UR$OD* $*&&7**&7&$&&$7$7&&$*&&&&$*$7&$&$*&$$7*$**$&& ,Q3UR*O\6HU3UR7\U3UR$OD3UR$VS+LV6HU$VQ*OX$VS* $**$**7*7$7*7**7*&&*&&&&&$*&7&**&&&7*7&&$$&&7 ,Q*OX9DO7\U9DO9DO3UR3UR3UR$OD$UJ3UR&\V3UR7KU6 &$**$&&7&&$*&7**$&&77*&&&$&&&7&7&&7*$&&7&$7&7 HU*O\3UR3UR$OD*O\3UR&\V3UR3UR6HU3UR$VS/HX,OH7 $&$$$$7&&&&$*$*&7$*7***$&&&$*&7**&7*&7&&&$*$* \U/\V,OH3UR$UJ$OD6HU*O\7KU*OQ/HX$OD$OD3UR$UJ$ $7*&&77**$**7&7$&*$7*7*&&&&&&$&&*&&&7&&***7*& VS$OD/HX*OX9DO7\U$VS9DO3UR3UR7KU$OD/HX$UJ9DO3 &&7&&$*7**&&&&7$7*$&7*&&&7*&&7&&7777&&&$&&&7& UR6HU6HU*O\3UR7\U$VS&\V3UR$OD6HU3KH6HU+LV3UR/

PAGE 159

7*$&&&***77*&&&&*&$*&&&&&7**$*$**$7*$7*&7&&&7 HX7KU$UJ9DO$OD3UR*OQ3UR3UR*O\*OX$VS$VS$OD3UR7 $7*$7*7*&&7&7*$&&&&$$$*&&$&&7*&$*$*&7**$$&&$* \U$VS9DO3UR/HX7KU3UR/\V3UR3UR$OD*OX/HX*OX3UR$ $7&7**$*7***$$**$**&&***$*&&****&&&&&&$7&7$7* VS/HX*OX7US*OX*O\*O\$UJ*OX3UR*O\3UR3UR,OH7\U$ &7*&&&&&7&&$$&&7*$$$&*$*&*7&$*&&77$&7&$$777*7 OD$OD3UR6H U$VQ/HX/\V$UJ$OD6HU$OD/HX/HX$VQ/HX7 $7*$$*&$&&&*$**$$&7*&7**&$*$&****$***&*****&$ \U*OX$OD3UR*OX*OX/HX/HX$OD$VS*O\*OX*O\*O\*O\7 &7*$7*$****$7&7$&*$7*7*&&7&7*&7****&&$*$**&7& KU$VS*OX*O\OOH7\U$VS9DO3UR/HX/HX*O\3UR*OX$OD3 &&&&77&7&&$*$*&&&&&7**$*&&77**&&7&&&$7*$&&$** UR3UR6HU3UR*OX3UR3UR*O\$OD/HX$OD6HU+LV$VS*OQ$ $&$&&&7**&&&$*&77&7**&&$*$$*&&&&&&$&&&&&$&$&$ VS7KU/HX$OD*OQ/HX/HX$OD$UJ6HU3UR3UR3UR3UR+LV$ **&&&&**&7&&&&7&$*&7*$*$*&&7*7&&&*&&*&&&7&7*& UJ3UR$UJ/HX3UR6HU$OD*OX6HU/HX6HU$UJ$UJ3UR/HX3 &7*&&&7*&&7*7&&&7*$**&&&&&$*&&&&7&&&&$*7*&&&7 UR$OD/HX3UR9DO3UR*OX$OD3UR6HU3UR6HU3UR9DO3UR6 &7&&7*&&&&$**&&**$$***&$*&$7&&$**$&&**&&7&7*& HU3UR$OD3UR*O\$UJ/\V*O\6HUOOH*OQ$VS$UJ3UR/HX3 7 &&&&$&&&&&$&&&&*&&7*&&7**77$7**$**&&&&$$**7&* UR3UR3UR3UR3UR$UJ/HX3UR*O\7\U*O\*O\3UR/\V9DO* $*****$7&&$*$***&$***$*$7**$**$7*$&&&$*&$**$& OX*O\$VS3UR*OX*O\$UJ*OX0HW*OX$VS$VS3UR$OD*O\+ $&&$&$$7*$*7$&*$***&$77&&*$7**&&*$**$*7$7*$&7 LV+LV$VQ*OX7\U*OX*O\OOH3UR0HW$OD*OX*OX7\U$VS7 $7*7&&$&&7*$$***&$7**$&$$$*&7&$***$7&7$**&&&& \U9DO+LV/HX/\V*O\0HW$VS/\V$OD*OQ*O\6HU$UJ3UR3 &**$7&$**&&7*&$&$****$7&&7*$$&7*&&&*$*$*****$ UR$VS*OQ$OD&\V7KU*O\$VS3UR*OX/HX3UR*OX$UJ*O\0 7*&&**&*&&*&$**$**&&&7*7&&&&$****$*&&$&7**77* HW3UR$OD3UR*OQ*OX$OD/HX6HU3UR*O\*OX3UR/HX9DO9 7*7&&$&&**$*$7&7*&$*&7&&7*7$&77&7$7*&7***&$$7 DO6HU7KU*O\$VS/HX*OQ/HX/HX7\U3KH7\U$OD*O\*OQ&

PAGE 160

*&&$*$*&&$&7$&7&$*&&&7*&$**&$*&&*7**&$*&&&7*$ \V*OQ6HU+LV7\U6HU$OD/HX*OQ$OD$OD9DO$OD$OD/HX0 7*7&&$*7$&&&$**&7$$7&$*&&&&&*&*&&7777&*7*&&&& HW6HU6HU7KU*OQ$OD$VQ*OQ3UR3UR$UJ/HX3KH9DO3UR+ $&$*&$$*$***7**7**7**&7*&7&$7&*&&7**7*777*77* LV6HU/\V$UJ9DO9DO9DO$OD$OD+LV$UJ/HX9DO3KH9DO* ***$&$&&&7***&&**&7**&$*&&7&7*&&&&7&7*$*$*&$& O\$VS7KU/HX*O\$UJ/HX$OD$OD6 HU$OD3UR/HX$UJ$OD* $**7&$***&7*&$**7$&$*&$&7***&&$**&$77*&***&&$ ,Q9DO$UJ$OD$OD*O\7KU$OD/HX*O\*,Q$OD/HX$UJ$OD7 &7*7*&7**&7*7&$$***$*&7*&&&7***&7$&&&$7&&$*&& KU9DO/HX$OD9DO/\V*O\$OD$OD/HX*O\7\U3UR6HU6HU3 &7*&&$7&&$$*$*$7**7*&$*7*7*7$$&$*$$&7**&$***& UR$ODOOH*OQ*OX0HW9DO*OQ&\V9DO7KU*OX/HX$OD*O\* $**&&&7*&$$77&$&7$&&&7*&7&$&7$*&&7**&7&&$7*$$ ,Q$OD/HX*,Q3KH7KU7KU/HX/HX7KU6HU/HX$OD3UR **7&&777**&$&$*&7&7*&7&&7&&&&7*&&7*&&$$$*&&&& &&777$**&&77***7**&7**$$**&777*77$$***$&7$**$ *$$$7*****7$7&777&&&&777&&7*&&&777&7*&7&$7&7& $$&&7&7&$&$*$**7*7&77&7&&&&&7$$&&7$&$*&77777* 7$&$$*&&$7777*7*7$$$77$777$7$777$$7$77$77&&&7 *&777*7&$**$*&$**7$&7$**&7&7****&$*7*$**$$&7$ *$7&&77&7&7&&7&$*&&7$***7**$**7&$&7*&$&7$&&$& &&$&&7&7**$$*$&7**&7*7*$$$$*7&$**7**&$*$$$&&7 ****&&$&$7$*$*&&7&7&7&7777&&7*777&77**&7&7$*$ $*$7&$*&$&7*&$&7*77$*&7*$*$*7*&***&$$*$&$7$$$ &7*7&&$*$*777*$$**77&7&**$$$*$&&**$***&77&7&& &&$&$*$$**&**$*$*$*&7****&7&$*$&$7***7*7*&$&& 77$$7$$$&&&7*&7*7&7*&&7&&&7*$&7&7*&77&77***$* &$7**7*$*&$*&&&7**7*&7&$*&$*&&$7$&&7$7***$&$& $&$&7$&*$$$$**$7*&&777$***777*****$*$7777$&7& &777&77&$$&$$&7$77&$&7**$&$$*77&7&7*&7&&&$7*$ &*&*&&$**&$&$*77&7*&$$*7$7$77*7*$$7*7$77*77&7 $*7***$7$&$&$$$7$$*7&$*77$$$$7$&$7$$$7$$$$$&$ 7$$$&&7*&

PAGE 161

6(48(1&( +80$1 %5$,1 )$&725 +%)* ;f **&*$*$*$*$&*&7&&&*&7&*&&*&&$*&7&7*$77**&&&$* &**7$**$$$**77$$$&&$$$$$7777777$&$*&&&7$*7*7* &*&&7*7$*&7&**$$$$77$$77*7**&7$7$*&&*&&7&*$7& *&7*7&7&&&&$*&&7&*&&*&**$&*&7&&***$&*&*&&&*&& &*&&*&&&**77&7&&&&&&&777***&7**7*&7*&7*&7*&7* 7*$&7*&7*&7*&*$$$**$**$**$**$**$**$$*&$*&**** *****$*&**7***7*7*****$$$&&$$*$*7$&$*7**$&*$* *$&7&$&&&&**&*7**7*77&777777&77&77&77777&777& &7777777777777777&7$$77&&7*$****7**77*&7*&777 7*&7$&$7*$&77*&&$*&*&&&*$*&&7*&**7&&$$&7*&*&7 *&7*&&**$*&*&7&$*7*&&*&&*&7*&&*&&&*7*&&&&&&*& *&&&&*77&**&$&&&$&&**7&*&&*&&&&*&&&*&*&*&&*&7 *7&&&*&7&&&*&*&&*&&*&&*&&*777&&&&&&*$&*$&7*** 7*$7*&7**$&$7***$*$7$**$$$*$**7*$$$$7*$7&&&&$ 0HW/HX$VS0HW*O\$VS$UJ/\V*OX9DO/\V0HWOOH3UR/ $*7&&7&*77&$*&$7&$$&$*&&7**7*&&&*$***&&7&&$*$ \V6HU6HU3KH6HUOOH$VQ6HU/HX9DO3UR*OX*O\/HX*OQ$ $&*$&$$&&$&&$&*&*$*&&$&**&&$&&$&$$&$*&&$&&$&& VQ$VS$VQ+LV+LV$OD6HU+LV*O\+LV+LV$VQ6HU+LV+LV3 &&&$*&$&&$&&$&&$&&$&&$&&$&&$7&$&&$&&$&&&*&&*& UR*OQ+LV+LV+LV+LV+LV+LV+LV+LV+LV+LV+LV3UR3UR3 &*&&&*&&&&*&$$&&*&&*&&*&&*&&*&$*&$*&$*&$*&&*& UR3UR$OD3UR*OQ3UR3UR3UR3UR3UR*OQ*OQ*OQ*OQ3UR3 &*&&*&&*&&*$*$&*&****&&&**&*&&*$&*$&*$&*$**&& UR3UR3UR3UR$UJ$UJ*O\$OD$UJ$UJ$UJ$UJ$UJ$UJ*O\3 &&$*&$*77*77*77&&*&&*&*&$&*&$&$&**&*&*&&7*$** UR6HU6HU&\V&\V6HU$OD$OD+LV$OD+LV*O\$OD3UR*OX* *&&$$&**&$*&7**&*&$$**&*$&&**&*&**&&*****$7&7 O\*OQ$UJ*OQ/HX$OD*OQ*O\$VS$UJ$UJ*O\$UJ*O\OOH& *&&&&*7&***&&**$&*$*$$**$*$$**&&&*&*&&******* \V3UR9DO*O\3UR$VS*OX/\V*OX/\V$OD$UJ$OD*O\*O\* $**$*$$*$$*****&***&*$***&**&$$**$&****$***** OX*OX/\V/\V*O\$OD*O\*OX*O\*O\/\V$VS*O\*OX*O\* *&$$**$***&*$*$$*$$*$$&**&$$*7$&*$*$$*&&*&&*7 O\/\V*OX*O\*OX/\V/\V$VQ*O\/\V7\U*OX/\V3UR3UR3 7&$*&7$&$$&*&*&7&$7&$7*$7**&&$7*&**&$*$*&&&&* KH6HU7\U$VQ$OD/HX,OH0HW0HW$OD0HW$UJ*OQ6HU3UR*

PAGE 162

$*$$*&**&7&$&*&7&$$&**&$7&7$&*$*77&$7&$7*$$*$ OX/\V$UJ/HX7KU/HX$VQ*O\OOH7\U*OX3KHOOH0HW/\V$ $&77&&&77$&7$&&*&*$*$$&$$*&$***&7**&$*$$&7&&$ VQ3KH3UR7\U7\U$UJ*OX$VQ/\V*OQ*O\7US*OQ$VQ6HUO 7&&*&&$&$$7&7*7&&&7&$$&$$*7*&77&*7*$$**7*&&*& OH$UJ+LV$VQ/HX6HU/HX$VQ/\V&\V3KH9DO/\V9DO3UR$ *&&$&7$&*$&*$&&&***&$$***&$$&7$&7**$7*&7**$&& UJ+LV7\U$VS$VS3UR*O\/\V*O\$VQ7\U7US0HW/HX$VS3 &*7&*$*&*$&*$&*7*77&$7&**&**&$&&$&***&$$*&7*& UR6HU6HU$VS$VS9DO3KHOOH*O\*O\7KU7KU*O\/\V/HX$ **&*&7&&$&&$&&7&*&&**&&$$*&&**&&77&$$*&*&**7* UJ$UJ6 HU7KU7KU6 HU3UR$OD/\V 3UR$OD3KH/\V$UJ*O\$ &&*&*&7&$&&7&&$&&**&&7&$&&77&$7**$&*&*&&**&7& OD$OD/HX7KU6HU7KU*O\/HX7KU3KH0HW$VS$OD3UR$OD3 &&7&7$&7**&&&$7*7&*&&&77&&7*7&&&7*&$&&$&&&&&* UR6HU7KU*O\3UR&\V$UJ3UR6HU&\V3UR&\V7KU7KU3UR$ &&$*&$*&$&777*$*77$&$$&***$&&$&*7&**&&7$&&&&$ OD6HU6HU7KU/HX6HU7\U$VQ*O\7KU7KU6HU$OD7\U3UR6 *&&$&&&&$7*&&&7$&$*&7&&*7*77*$&7&$$$$&7&*&7** HU+LV3UR0HW3UR7\U6HU6HU9DO/HX7KU*OQ$VQ6HU/HX* *&$$&$$&&$&7&&7&&7&&$&&*&&$$&***&7*$*&*7**$&& O\$VQ$VQ+LV6HU6HU6HU7KU$OD$VQ*O\/HX6HU9DO$VS$ 7 **&7**7&$$&*****$$7&&&*7$&*&&$&*&$&&$&&7&$&** UJ/HX9DO$VQ*O\*O\OOH3UR7\U$OD7KU+LV+LV/HX7KU$ &&*&&*&*&7$$&&*&&7&**7*&&&7*&**&&7*&7**7*&&&7 OD$OD$OD/HX7KU$OD6HU9DO3UR&\V*O\/HX/HX9DO3UR& *&7&7***$&&7$&7&&&7&$$&&&&7*&7&&*7&$$&&7*&7&* \V6HU*O\7KU7\U6HU/HX$VQ3UR&\V6HU9DO$VQ/HX/HX$ &***&&$*$&&$*77$&77777&&&&&$&*7&&&*&$&&&*7&$$ OD*O\*OQ7KU6HU7\U3KH3KH3UR+LV9DO3UR+LV3UR6HU0 7*$&77&*&$*$*&$*&$&*7&&$7*$*&*&&$***&&*&*7&&7 HW7KU6HU*OQ6HU6HU7KU6HU0HW6HU$OD$UJ$OD$OD6HU6 &&7&&$&*7&*&&**&$**&&&&&&7&*$&&&&7*&&&7*7*$*7 HU6HU7KU6HU3UR$OD*O\3UR3UR$UJ3UR/HX3UR&\V*OX6 &777$$*$&&&7&777*&&$$*7777$&*$&***$&7*7&7**** HU/HX$UJ3UR6HU/HX3UR6HU3KH7KU7KU*O\/HX6HU*O\*

PAGE 163

*$&7*7&7*$77$777&$&$&$7&$$$$7&$****7&77&77&&$ O\/HX6HU$VS7\U3KH7KU+LV*OQ$VQ*OQ*O\6HU6HU6HU$ $&&&777$$7$&$77$$&$7&&&7***$&&$*$&7*7$$*7*$$& VQ3UR/HX,OH+LV *7777$&$&$&$777*&$77*7$$$7*$7$$77$$$$$$$7$$*7 &&$**7$777777$77$$*&&&&&&&&7&&&$777&7*7$&*777 *77&$*7&7&7$***77*777$77$77&7$$&$$**7*7**$*7* 7&$*&*$**7*&$$7*7****$*$$7$&$77*7$*$$7$7$$**7 77**$$*7&$$$77$7$*7$*$$7*7*7$7&7$$$7$*7*$&7*& 777*&&$777&$77&$$$&&7*$&$$*7&7$7&7&7$$*$*&&*& &$*$777&&$7*7*7*&$*7$77$7$$*77$7&$7**$$&7$7$7 **7**$&*&$*$&&77*$*$$&$$&&7$$$77$7****$*$$777 7$$$$7*77$$$&7*7$$777*7$777$$$$$*&$77&*7$*7$$ $**7*&&&$$*$$$77$7777**&&$777$77*7777&7&&7777 &777$$$*$$&7*777777777&7777*777$&7777$*$&&$$$ *$77***&**77&7$*$$$$7*&*&&77**7$7$&7$$*7$77$$ $$&$$$&$$$$$**$$$*77*777&$*77$$&*&7*&&&$77&$$ 77*$$7&$*$$****$&$$$$77$$&*$77*&&77&$*777*7*7 7*7*7$7$7777*$7*7$7*7**7&$&7$$&$**7&$&7777$77 7777&7$$$7*7$*7*$$$7*77$$7$&&7$77*7$&77$7$**7 $$$&&77*&$$$7$7*7$$&&7*7*77*&*&$$$7*&&*&$7$$$ 777*$*7*$77*77$$7*77*7&77$$$$777&77*$77*7*$&7 $7*7**7&$7$7*&&&*7*777*7&$&77$&$$$$$7*777$&7$ 7*$$&$&$&$7$$$7$$$$$$7$*

PAGE 164

6(48(1&( ,3 *$$77&**$&*$***$**$**$$*$&&$$*$&$7$&$***$*$$$ ,OH$UJ7KU$UJ*OX*OX*OX$VS*OQ$VS,OH*OQ*O\*OX, 7&$*7&$7&&7*$7**$$$**7**$$$$**777$7$$*$$7***7 OH6HU+LV3UR$VS*O\/\V9DO*OX/\V9DO7\U/\V$VQ*O\& *&&*7*77$7$&7*777&&&$$7**$$&7&*$$$**$$*7*$*7* \V$UJ9DOOOH/HX3KH3UR$VQ*O\7KU$UJ/\V*OX9DO6HU$ &$*$7***$$*$&&$7&$&7*7&$&777&777$$7**7*$&*7*$ OD$VS*O\/\V7KUOOH7KU9DO7KU3KH3KH$VQ*O\$VS9DO/ $*&$**7&$7*&&$*$&&$$$*$*7*$7&7$&7$&7$7*&$*&7* \V*OQ9DO0HW3UR$VS*OQ$UJ9DOOOH7\U7\U7\U$OD$OD$ &&&$*$&&$&7&$&$**$&$7$&&&**$*$1&7***$$*7&77$& OD*OQ7KU7KU+LV$UJ7KU7\U3UR*OX 7US*OX9DO/HX+ $777&7&$$*7**$&$$$7$*$$$$$&$77$&&&$*$7**$$*$$ LV3KH6HU6HU*O\*OQOOH*OX/\V+LV7\U3UR$VS*O\$UJ/ $$*$$$7&$&*777&&7*$&&$*$&7*77$$$$$&77$777&&7* \V*OX,OH7KU3KH3UR$VS*OQ7KU9DO/\V$VQ/HX3KH3UR$ $7**$&$$*$$*$$$*&$777&&&$*$7**7$&$$77*7&$*$*7 VS*O\*OQ*OX*OX6HUOOH6HU*OQ0HW9DO*OQ/HX6HU*OX7 $&$$&&&&&7&*&$$&$$$&7&$7$7$*777$77$77*$&$$$$$ \U$VQ3UR/HX$OD7KU$VQ6HU7\U6HU/HX/HX/HX7KU/\V/ $$$& 7$$&7$&$7$& 7*& & &$*77 &$$*$*$&***$$7$& &$*$7 \V7KU$VQ7\UOOH/HX3UR6HU6HU$UJ$VS*O\$VQ7KU$UJ7 **&$&7*7 US+LV&\V

PAGE 165

6(48(1&( ,3 L *7***$$$&$7*&**&7*7&**7&*&7*&$*&$7&7&&&$7**&& *O\/\V+LV$OD$OD9DO*O\$UJ&\V6HUOOH6HU+LV*O\$ *&*7$777&*&&*7$7***&&7&**7&&&*$*7&&&*&$7&&$7& UJ9DO3KH$UJ$UJ0HW*O\/HX*O\3UR*OX6HU$UJOOH+LV/ 7*77*&**$$&77*&7&$&$***&7**7*&**&$&*$$&*&$7&* HX/HX$UJ$VQ/HX/HX7KU*O\/HX9DO$UJ+LV*OX$UJOOH* $**&$&&$7***&*&*7*7**$&*$$$7*$****&7$&*&**$*$ OX$OD3UR7US$OD$UJ9DO$VS*OX0HW$UJ*O\7\U$OD*OX/ $*&7&$7&*$&7$7***$$*&7***$*$&$&7$$&*$$&*$*&&$ \V/HX,OH$VS7\U*O\/\V/HX*O\$VS7KU$VQ*OX$UJ$OD0 7*&*&$7**&7*$&77&7**&7&$&$*$*$$**$777*$7&&&$$ HW$UJ0HW$OD$VS3KH7US/HX7KU*OX/\V$VS/HX,OH3UR/ $*&7*777&$$*7$&7**&&&&7&**7$&$$$*$7&$$$&7**** \V/HX3KH*OQ9DO/HX$OD3UR$UJ7\U/\V$VS*OQ7KU*O\* *&7$&$&$$*$$7*&7*&$*$7&&&$$$7&**$*777**$7&*** O\7\U7KU$UJ0HW/HX*OQOOH3UR$VQ$UJ6HU/HX$VS$UJ$ &&$$*$7**&$*7*$7&*$*7$7$$$***$$77*&&7&&&$&&&& OD/\V0HW$OD9DOOOH*OX7\U/\V*O\$VQ&\V/HX3UR3UR/ 77*&&7&77*&&7&&*&$*$*$&$$*&&$&&77$&$&7&&7$$$& HX$OD6HU&\V/HX$UJ$UJ$VS/\V3UR3UR7\U7KU3UR/\V3 &$*&7*&7*&$***777*&**&$**$&&77&$**&$$$*&&$**$ UR$OD$OD$OD*O\3KH$OD$OD*O\3UR6HU*O\/\V$OD$UJ

PAGE 166

6(48(1&( ,3 $$7$*$&&$**&77***&&$*$$7*$*$$7&7*$*7*&&$77*$* $VQ$UJ3UR*O\/HX*O\*OQ$VQ*OX$VQ/HX6HU$ODOOH*OX ***$$$**&$$**7******$&7*$$*$&$&*&7*&7&7$*&7*& *O\/\V*O\/\V9DO*O\*O\/HX/\V7KU$UJ&\V6HU6HU&\V $$&*77$$*777*$*7&7*$$$*7*$$&7&&$*$$&&$&$7&&$$ $VQ9DO/\V3KH*OX6HU*OX6HU*OX/HX*OQ$VQ+LV,OH*OQ $&&$7&&$&&*$*$*&7&*7*&&$*$&$*&$$&$*&$&$&$*77* 7KU,H+LV$UJ*OX/HX9DO3UR$VS6HU$VQ6HU7KU*OQ/HX $$$$&*&&&&$$*7$7&$&&$$7*&&&$*$$7&$*7&&&7&&&$* /\V7KU3UR*OQ9DO6HU3UR0HW3UR$UJOOH6HU3UR6HU*OQ 7&**$7*$*$$*$$*$&&7$7&$$7*&$7&$$*7*7&$*$7**77 6HU$VS*OX/\V/\V7KU7\U*OQ&\V,OH/\V&\V*OQ0HW9DO 77&7$&$$7*$$7***$7$77&$**77&$7*77*&$$$7&$&$7* 3KH7\U$VQ*OX7US$VS,OH*OQ9DO+LVADO$OD$VQ+LV0HW $77*$7*$$**$&7*$$&&$7*$$7*&$$$&7&7*&$*&&$*$&& ,OH$VS*OX*O\/HX$VQ+LV*OX&\V/\V/HX&\V6HU*OQ7KU 777*$&7&7&&7*&&$$$&7&&$*7*&&$&&7*$7$*$*&$&$*& 3KH$VS6HU3UR$OD/\V/HX*OQ&\V+LV/HX,OH*OX+LV6HU 77&*$$***$7***$**&$&&77&$$*7*7&&$*7&7*&777$&$ 3KH*OX*O\0HW*O\*O\7KU3KH/\V&\V3UR9DO&\V3KH7KU *7$777*77&$$*&$$$&$$*77*&$*&$*&$7$7777&7&7*&& 9DO3KH9DO*OQ$OD$VQ/\V/HX*OQ*OQ+LV,OH3KH6HU$OD &$7**$&$$*$$*$&$$*$7&7$7*$&7*7$&$&$$7*7&&$&$* +LV*O\*OQ*OX$VS/\V,OH7\U$VS&\V7KU*OQ&\V3UR*OQ $$*77777&77&&$$$&$*$*&7*&$*$$7&$7$&$$7*$&&&$$ /\V3KH3KH3KH*OQ7KU*OX/HX*OQ$VQ+LV7KU0HW7KU*OQ &$&$*&$*77$*7*&$$*7$&$*7&7&7&$$**$*$$77*$7777 +LV6HU6HU *7**&$&$$$$$***$$&$7*7777$&7&777*&$&*$$$&777& $77*77$$7*7$7$77$77&$*$$$&$77*7$77*7$&&$7$$$$ &77*7$77$7&$$$&7*77**$7*77&$7*7*777*$$&7777*& *&$&&**$7$*$&&&&77*7$7$7$$$*7*77*&$&$7*7$77$7 *7&*7&7*$7$&7$$$$7**7&77$7$$$*$&$$*7**$&77*** &&&7$77&$**&$$*$77$$$$$$$$$$$$$$*$&7$7*$&&$$$ $7**&77$$*$7$$$*7$77777$$**$$*$$$*$77$$$$$&$$ &7*77$7$&$7*$*$&7$7**77**$&77&&7777&777$&$&77 $$*&&7$*$$777&7&777$**7$7$7&$*&*&77$$$7&&$$*$

PAGE 167

&7$777777$77*&7*$$*$77&77*&$$$&&$7*$$*$*$7*77 &7&$&$*$$&$*$$&&&&&$&$*&7**1$7$$**&&&**7$7$7$ 7$7$777**7$$$*&&&77*&$$7*7*$&$***7$*&$7&$&7$$ 7$7$7*&$$7$**77*77$7**$*$&7*

PAGE 168

6(48(1&( ,3 &&7**&&&$*7$&&7&$7&$&7*&&7*7&7$*$*$&**&&$$*7& /HX$OD*OQ7\U/HX,OH7KU$OD&\V/HX*OX7KU$OD/\V6H 7$&&7&7******$&*&&&$*&7&**&&&&&*&$*$&&7*&&7*& U7KU6HU*O\*O\7KU3UR6HU6HU$OD3UR$OD$VS/HX3UR$O &&&&77&7&*&&$&&&&7*$&**&&&7*&&$&$*&7&&&&&7**& D3UR3KH6HU3UR3UR/HX7KU$OD/HX3UR*OQ/HX3UR/HX$O &7*&7***&$&$&&&7$7*&&$7&7&&&7&7&&$$&77&$7&**& D&\V7US$OD+LV3UR0HW3UR6HU3UR6HU3UR7KU6HU6HU$O &7&$$*&&&$7*&&&77&77**&777$&&$&&7*&77&&&&$*** D6HU6HU3UR&\V3UR6HU7US/HX7\U+LV/HX/HX3UR*OQ*O &&*&&*&&***&77**&*&7$$&$&7*&&$$*$7**&$*&$*&7$ \$UJ$UJ$UJ$OD7US$UJ $7***$*&$$*$$**&7*$*&**&$*$$$77&7&&&&&7$&7*$* *&&$*&7*$**7$&$**&$****&$**&$**$&&$&&$*&$**** *&77*&&7&7*&$&&&7$&&&*&&&$$**$*$&7&&$&&&7**** 7&&&$$$&*&&*&7$$&*&&&$*$&*&$7**$77*&$&&&&&7$& &&7*&&7&&$7&7$7***$*77&777&7&7&$*$*7*****&$*7 77&7***&&&$****7&7*$*&7*&**&$

PAGE 169

6(48(1&( ,3 *7$*$*$7**&&*&*&77*&$&&*&7*&&&&&*&7&&&&*&$&$* 9DO*OX0HW$OD$OD/HX$OD3UR/HX3UR3UR/HX3UR$OD*OQ 77&$$*$*&$7$&$*&$7&$7&7*$**$&**&7&$**$*&$7*$& 3KH/\V6HUOOH*OQ+LV+LV/HX$UJ7KU$OD*OQ*OX+LV$VS $$*&*$*$&&&7*7**7**&77$77$&7*7&*777$7$&*&$$7* /\V$UJ$VS3UR9DO9DO$OD7\U7\U&\V$UJ/HX7\U$OD0HW &$*$&7**$$7*$$*$7&*$7$*7$$$$&7&&7*$$7*7&*&$$$ *OQ7KU*O\0HW/\V,OH$VS6HU/\V7KU3UR*OX&\V$UJ/\V 77777$7&$$$*77$$7**$7&$*77$*$$*&7&7$$$*$$*&$* 3KH/HX6HU/\V/HX0HW$VS*OQ/HX*OX$OD/HX/\V/\V*OQ 77***7*$7$$7*$$*&7$77$&7&$$*$$$7$*7***&7*7*&$ /HX*O\$VS$VQ*OX$ODOOH7KU*OQ*OX,OH9DO*O\&\V$OD &777**$*$$77$7*&777*$$$$7*77777*7$7*&$*$&$$7* /HX7US$UJOOH0HW/HX $$*$7&*7*&7**$&*$777&$&$$$$$&$7*$7&$$*7&&77&7 $7$&7*&$$*7&7777*$7$*$7*7&$7$$&$*7$777**$*$$& 7&$&7*$7*$$$$7*7*$$$&$&$**$$*7$7**&&$*$***$$* *&$$&$7$&$7&&$7$$77*7771$$*$17****$*$&7&&&$$* &$**&&&7*17**$$77*$$*$

PAGE 170

6(48(1&( ,3 *$*7$7*$*$7*$$$&*$$7**&$*$*$$7*$*&7*$*&&**7&$ *OX7\U*OX0HW/\V$UJ0HW$OD*OX$VQ*OX/HX6HU$UJ6HU *7$$$7*$*777&7*7&&$$*&7*&$$*$7*$&&7&$$**$**&$ 9DO$VQ*OX3KH/HX6HU/\V/HX*OQ$VS$VS/HX/\V*OX$OD $7*$$7$&7$7*$7*7*7$*&&*$7*&&$$**$$$*&$7$**$** 0HW$VQ7KU0HW0HW&\V6HU$UJ&\V*OQ*O\/\V+LV$UJ$UJ 777*$$$7**$&&***$$&&7$$*$*7*&&$*$7$&7*7*&7*$* 3KH*OX0HW$VS$UJ*OX3UR/\V6HU$OD$UJ7\U&\V$OD*OX 7*7$$7$**&7*&$7&&7*&7*$**$$**$*$&7777***&$*$* &\V$VQ$UJ/HX+LV3UR$OD*OX*OX*O\$VS3KH7US$OD*OX 7&$$*&$7*77***&&7&$$*$7&$&&7$&777*&$&7*$7**$7 6HU6HU0HW/HX*O\/HX/\V,OH7KU7\U3KH$OD/HX0HW$VS **$$$**7*7$7*$&$7&$&$*$*7***&7**$7*&&$*&*7*7$ *O\/\V9DO7\U$VS,OH7KU*OX7US$OD*O\&\V*OQ$UJ9DO **7$7&7&&&&$*$7$&&&$&$*$*7&&&&7$7&$&$7&7&$777 *O\OOH6HU3UR$VS7KU+LV$UJ9DO3UR7\U+LV,OH6HU3KH **77&7&**$77&&$**&$&&$*$***&**&$*$*$*&&$&&&&$ *O\6HU$UJOOH3UR*O\7KU$UJ*O\$UJ*OQ$UJ$OD7KU3UR *$7*&&&&7&&7*&7*$7&77&$**$777&77*$*7&**$7&777 $VS$OD3UR3UR$OD$VS/HX*OQ$VS3KH/HX6HU$UJOOH3KH &$$*7$&&&&&$***&$*$7*&&$$7***$$&77&777*&$*&7& *OQ9DO3UR3UR*O\*OQ0HW3UR0HW*O\7KU6HU/HX*OQ/HX &7&$*&&7*&&&&7**$*&&*&7*&$*&&7&7$$*&&&$$&$*&$ /HX6HU/HX3UR/HX*OX3UR/HX*OQ3UR/HX6HU3UR7KU$OD &$*7$&&&$$***$*$$*&&$$$&&7$$*&**&**$$*$$$*7*$ *OQ7\U3UR$UJ*OX/\V3UR$VQ/HX6HU*O\*O\$UJ/\V **$**&&&77&&$$&*77*$7*&&&&77&7&777&&7&$$$7&$$ 7*7&$***$*7&$$$$***&7*7$*&$&$**$7**$*777*$777 $7&&&7&&7&&&&&$$&$&&7$**$$&7*$$7&77777&77777$ 777777*$*$7**$*7&77*&7&7*77*&&&$*

PAGE 171

6(48(1&( ,3 $$$$&***7777&*&&$7*77*&7&$**&7**7&77*$$&7&&7* 0HW/HX/HX$UJ/HX9DO/HX$VQ6HU7U **&7&$$*$$7&7*7&7*&&77$*&&$$&&$$$*7*&7**7$77$ S$OD*OQ*OX6HU9DO&\V/HX6HU*OQ3UR/\V&\V7US7\U7\ &$*$7*7*$*&7$77*&$&*7**&7$**777&7&7*&777*$$*7 U$UJ&\V*OX/HX/HX+LV9DO$OD$UJ3KH/HX&\V3KH*OX9D 7$$7&77777&7&&&7777&$7$$$7&777**$$**$$*7&$&7* O$VQ/HX3KH/HX3UR3KH+LV/\V6HU/HX*OX*O\6HU+LV&\ 7*7*$$*&&7$&$&*7$**$$7***$$*77$&&&7*77&&7&&$$ V9DO/\V3UR7KU$UJ$UJ$VQ*O\/\V/HX3UR&\V6HU6HU/\ **7**7**$*7$7&7$&$7$$7&77&7**$$77&7*77&7**$*$ V9DO9DO*OX7\U/HX+LV$VQ/HX/HX*OX3KH&\V6HU*O\*O *77*&&7*77&7&&&&&$77$$77$$&77$7$7&$*7$7**$&1& X/HX3UR9DO/HX3UR+LV $7*7$7$777$&777$7$&&77***77$$$$7&&$$7$&7$*77$ *$777*77*&7&$$$77*71&&$*&777**&&$&7*$$$&7&777 &$*77**&$*7*&1*&7*77$$$$$1$$$$$$$1$$$$&&1*77

PAGE 172

6(48(1&( ,3 **&&&&&7&*&77&7*7*&$$*7$777&&7*&$*&$*7***$$&7 $OD3UR6HU/HX/HX&\V/\V7\U3KH/HX*OQ*OQ7US*OX/H &$&$7&&&&7**&&$&*$&$&&7&**7*&7*$17*$&$*&*7**$ X7KU6HU3UR*O\+LV$VS7KU6HU9DO/HX $VS6HU9DO*O *$77**&&7*&$*$&&7*&7*&&$&$7&77&&7&$$&&7&*7**7 X,OH*O\/HX*OQ7KU&\V&\V+LV,OH3KH/HX$VQ/HX9DO9D &$&&*&$&&****&7*$7&$$*&*7*$&*&&7*&77&$&$7&7&7 O7KU$OD3UR*O\/HX,OH/\V$UJ$VS$OD&\V3KH7KU6HU/H $$7*$$&$&&&7&$7*$&*7&*&7$&&$*&$&7$*7*&$*&$$&$ X0HW$VQ7KU/HX0HW7KU6HU/HX3UR$OD/HX9DO*OQ*OQ*O ***$$**&7*&77&7**&7*&7$$7*7**&&$&&&7****&7&&7 Q*O\$UJ/HX/HX/HX$OD$OD$VQ9DO$OD7KU/HX*O\/HX/H &$7**&&&**&7&&77$*&$&&7&7&&$*&7&77&$***$$&$&& X0HW$OD$UJ/HX/HX6HU7KU6HU3UR$OD/HX*OQ*O\7KU3U $*&$7&&&*$***77&77&*&$*&7*&&$7&&7&77&&7$7&$&$ R$OD6HU$UJ*O\3KH3KH$OD$OD$ODOOH/HX3KH/HX6HU*O *7&&&$&*7**&*&***&&$&&&&***&7&$*$&&$**&$*7*&7 Q6HU+LV9DO$OD$UJ$OD7KU3UR*O\6HU$VS*OQ$OD9DO/H $*&&&7*7&&&&7*$*7$7*$***&$7&7***&&*$&&7*&$**$ X$OD/HX6HU3UR*OX7\U*OX*O\OOH7US$OD$VS/HX*OQ*O *&7&7**77&&7***&$7*&$**&&77&$&&**&7*7*7*&&7&7 X/HX7US3KH/HX*O\0HW*OQ$OD3KH7KU*O\&\V9DO3UR/H *&7*&&&7**&7**&&&&&*&7*&&&7* X/HX3UR7US/HX$OD3UR$OD$OD

PAGE 173

6(48(1&( ,3 *$7*$*&$7**&$*7*&&$$*$$&*7&$*&77&$$7&&7*&&$$* $VS*OX+LV*O\6HU$OD/\V$VQ9DO6HU3KH$VQ3UR$OD/\V $7&$*77&&$$&77&$*&$*&$77$77*&$*$*$$$77$&*77*7 ,OH6HU6HU$VQ3KH6HU6HUOOHOOH$OD*OX/\V/HX$UJ&\V $$7$&&&77&&7*$&$&7**7&*&$**$$*&&&&$$*7*$$&&$* $VQ7KU/HX3UR$VS7KU*O\$UJ$UJ/\V3UR*OQ9DO$VQ*OQ $$**$7$$&77&7**&7**7*$&7*&$&*$7&&&$*$*7*&&$77 /\V$VS$VQ3KH7US/HX9DO7KU$OD$UJ6HU*OQ6HU$ODOOH $$&$&77**77&$&7*$&77**&7**&$&&$$*&&$&7&$&*&$$ $VQ7KU7US3KH7KU$VS/HX$OD*O\7KU/\V3UR/HX7KU*OQ &7$*&&$$$$$**7&&&&$7777&$*7$$*$$**$$*$**7*777 /HX$OD/\V/\V9DO3UR,OH3KH6HU/\V/\V*OX*OX9DO3KH ***7$&77$*&&$$$7$&$&$*7*&&7*7*$7*&***&7*&&7** *O\7\U/HX$OD/\V7\U7KU9DO3UR9DO0HW$UJ$OD$OD7US &7&$77$$*$7*$&&7*7*&&7$&7$7*&$*&$$7&7&7*$*$&& /HX,H/\V0H W7KU&\V$OD7\U7\U$OD$ODH6HU*OX7KU $$**77$$*$$*$*$&$7*77*$&&&777&$7**$$7**$&7&$* /\V9DO/\V/\V$UJ+LV9DO$VS3UR3KH0HW*OX7US7KU*OQ $7&$7&$&&$$*7$&77$7***$*&$*77$&$*$$*$7**&7*$$ ,OHOOH7KU/\V7\U/HX7US*OX*OQ/HX*OQ/\V0HW$OD*OX 7$&7$&&**&&$***&&7*&$**$$*7*****&7*7**77&&$&* 7\U7\U$UJ3UR*O\3UR$OD*O\6HU*O\*O\&\V*O\6HU7KU $7$***&&&77*&&&&$7*$7*7$*$**7**&$$7&&**&$*7** ,OH*O\3UR/HX3UR+LV$VS9DO*OX9DO$ODOOH$UJ*OQ7US *$77$&$&&*$*$$*&7**&&$7*77&$7*777&$**$7**$$7* $VS7\U7KU*OX/\V/HX$OD0HW3KH0HW3KH*OQ$VS*O\0HW &7**$&$*$&$7*$*77&&7*$&&7***7*&77*$*7*7777*$* /HX$VS$UJ+LV*OX3KH/HX7KU7US9DO/HX*OX&\V3KH*OX $$*$7&&*&&&7**$*$**$7*$$77*&77$$$&7*&7*&7*&&7 /\V,OH$UJ3UR*O\*OX$VS*OX/HX/HX/\V/HX/HX/HX3UR &7*&77&7&&*$7$&7&7****$$777*77&$*7&7*&$7$&&7* /HX/HX/HX$UJ7\U6HU*O\*OX3KH9DO*OQ6HU$OD7\U/HX 7&&&*&&**&77*&&7$&77&7*7$&$&**$*$&7**&&&7*&$* 6HU$UJ$UJ/HX$OD7\U3KH&\V7KU$UJ$UJ/HX$OD/HX*OQ

PAGE 174

&7**$7**7*7*$*&$*7&$&7&$7&7&$7*77$7$7&7*&7&$* /HX$VS*O\9DO6HU6HU+LV6HU6HU+LV9DOOOH6HU$OD*OQ 7&$$&$$*&$&*&7$&&&$&&$&&&&7*&7&&7&$*&&&&&$$&7 6HU7KU6HU7KU/HX3UR7KU7KU3UR$OD3UR*OQ3UR3UR7KU $*&$*&$&$&&&7&*$&7&&&777$*7*$&&7*&77$7*7*&&&7 6HU6HU7KU3UR6HU7KU3UR3KH6HU$VS/HX/HX0HW&\V3UR &$*&$&&**&&&&7**77777**&&7&$*&7*7$7&&7$&$*$&& *OQ+LV$UJ3UR/HX9DO3KH*O\/HX6HU&\V,OH/HX*OQ7KU $7&&7&&7*7*&7*7&&7$*7*&&77**777**&$&7$&7&$&7* ,OH/HX/HX&\V&\V3UR6HU$OD/HX9DO7US+LV7\U6HU/HX $&7*$7$*&$*$$77$$*$&&**&7&$&&$&77*$&&$&77*&&7 7KU$VS6HU$UJOOH/\V7KU*O\6HU3UR/HX$VS+LV/HX3UR $77*&&&&*7&&$$&&7*&&&$7*&&$*$***7$$&$*7*&&77& ,OH$OD3UR6HU$VQ/HX3UR0HW3UR*OX*O\$VQ6HU$OD3KH $&7&$*&$**7&&*7*&$$$*77*&***$*$7&*$*&$*&$*$7& 7KU*OQ*OQ9DO$UJ$OD/\V/HX$UJ*OX,OH*OX*OQ*OQOOH $$**$*&****$&$**&$*77*$$*77&*&7**7&777&*$7$$$ /\V*OX$UJ*O\*OQ$OD9DO*OX9DO$UJ7US6HU3KH$VS/\V 7*&&$**$$*&7$&7*&$**&77&$&&$77**$&***7$&77&$7 &\V*OQ*OX$OD7KU$OD*O\3KH7KUOOH*O\$UJ9DO/HX+LV $&777**$$*7*&7**$&$*&&$7$*7777*$$&*&7&7*$&77& 7KU/HX*OX9DO/HX$VS6HU+LV6HU3KH*OX$UJ6HU$VS3KH $*&$$&7&7&77*$&7&&&777*7$$&&*$$7&777**$77***$ 6HU$VQ6HU/HX$VS6HU/HX&\V$VQ$UJOOH3KH*O\/HX*O\ &&7$*&$$**$7***&$7*$*$7&7&&7&$*$7*$7*$7*&7*7* 3UR6HU/\V$VS*O\+LV*OX,OH6HU6HU$VS$VS$VS$OD9DO *7*7&$77*&7$7*7*$$7***&7*7&$*&7*&$$*&*77&7**7 9DO6HU/HX/HX&\V*OX7US$OD9DO6HU&\V/\V$UJ6HU*O\ &**&$7&*7*&7$7**7**7$*&&$$*&7&&7**$*$$*$*$&$* $UJ+LV$UJ$OD0HW9DO9DO$OD/\V/HX/HX*OX/\V$UJ*OQ *&**$*$77*$**&7*$*&*77*7**$*$$7&$*$$*&&*&$*$7 $OD*OX,OH*OX$OD*OX$UJ&\V*O\*OX6HU*OX$OD$OD$VS *$*$$***77&&$7&*&&7&7**&7&&&777&7*&7&&&$*7*&7 *OX/\V*O\6HUOOH$OD6HU*O\6HU/HX6HU$OD3UR6HU$OD &&&$7777&&$**$7*7&&7&&7*&$*777&7**$7$&$&$**&7 3UR,OH3KH*OQ$VS9DO/HX/HX*OQ3KH/HX$VS7KU*OQ$OD

PAGE 175

&&&$7*&7*$&**$&&&7&*$$*7*$*$*7*$*&***7**$$77& 3UR0HW/HX7KU$VS3UR$UJ6HU*OX6HU*OX$UJ9DO*OX3KH 777$$&77$*7$&7*&7*77&7*7*$$&7*$77&*$&$7*$7*77 3KH$VQ/HX9DO/HX/HX3KH&\V*OX/HX,OH$UJ+LV$VS9DO 77&7&&&$&$$&$7*7$7$&77*&$&7&7&$7&7&&&*$****$& 3KH6HU+LV$VQ0HW7\U7KU&\V7KU/HX,OH6HU$UJ*O\$VS &77*&&777**$*&&&&7**7&&&&**&&7&&&7&7&&&777*$7 /HX$OD3KH*O\$OD3UR*O\3UR$UJ3UR3UR6HU3UR3KH$VS *$7&&7*&&*$7*$&&&$*$*&$&$$**$**&7*$$**&$*&$*& $VS3UR$OD$VS$VS3UR*OX+LV/\V*OX$OD*OX*O\6HU6HU $*&$*&$$*&7**$$*$7&&$***&7&7&$*$$7&7$7**$&$77 6HU6HU/\V/HX*OX$VS3UR*O\/HX6HU*OX6HU0HW$VS,OH *$&&&7$*77&&$*7*77&7&777*$**$&$7**$*$$*&&7*$7 $VS3UR6HU6HU6HU9DO/HX3KH*OX$VS0HW*OX/\V3UR$VS 77&7&$77*77&7&&&&7$&7$7*&&&7*7*$****$$***&$*7 3KH6HU/HX3KH6HU3UR7KU0HW3UR&\V*OX*O\/\V*O\6HU &&$7&&&&7*$*$$*&&$*$7*7&*$*$$**$**7*$$*&&&&&$ 3UR6HU3UR*OX/\V3UR$VS9DO*OX/\V*OX9DO/\V3UR3UR &&&$$**$*$$*$77*$$***$&&&77****77&777$&*$&&$* 3UR/\V*OX/\V,OH*OX*O\7KU/HX*O\9DO/HX7\U$VS*OQ &&$&*$&$&*7*&$*7$&*&&$&&&$7777&&&$7&&&&&$**$* 3UR$UJ+LV9DO*OQ7\U$OD7KU+LV3KH3UR,OH3UR*OQ*OX *$*7&$7*&$*&&$7*$*7*&$$&&$*&**77**7&*7$&7*777 *OX6HU&\V6HU+LV*OX&\V$VQ*OQ$UJ/HX9DO9DO/HX3KH ****7***$$$*&$*&*$*$7*$7*&&&*&&$7*&&$7&$$*$$$ *O\9DO*O\/\V*OQ$UJ$VS$VS$OD$UJ+LV$ODOOH/\V/\V $7&$&&$$**$7$7&77*$$**77&7*$$&&*&$$$***$&$*&$ ,H7KU/\V$VS,H/HX/\V9DO/HX$VQ$UJ/\V*O\7KU$OD *$$$&7*$&&$*&77*&7&&7$77*7*&&7&7*$$7&&7**$*$& *OX7KU$VS*OQ/HX$OD3UR,OH9DO3UR/HX$VQ3UR*O\$VS &7*$&$77&77$**7****$**$7***&$*$$*&**&*$&*&$$& /HX7KU3KH/HX*O\*O\*OX$VS*O\*OQ/\V$UJ$UJ$UJ$VQ &**&&7*$$*&&77&&&&$&7*&7*$$*$7$7&777*&7$$*77& $UJ3UR*OX$OD3KH3UR7KU$OD*OX$VS,OH3KH$OD/\V3KH &$*&$&&777&$&$77$7*$&&$$&$&&$**7&$&**&7&$**7& *OQ+LV/HX6HU+LV7\U$VS*OQ+LV*OQ9DO7KU$OD*OQ9DO

PAGE 176

7&&&**$$7*77&7**$*&$*$7&$&*$*&777*&&&77**&$7* 6HU$UJ$VQ9DO/HX*OX*OQOOH7KU6HU3KH$OD/HX*O\0HW 7&$7$&&$&77*&&7&7**7*&$*&$7*7*&$*77&$7&77&*$& 6HU7\U+LV/HX3UR/HX9DO*OQ+LV9DO*OQ3KHOOH3KH$VS &7&$7**$$7$77&$&7&$*&$7&$*7**&&7&$7&*$&777*&& /HX0HW*OX7\U6HU/HX6HUOOH6HU*O\/HX,OH$VS3KH$OD $77&$*&7*&7*$$7*$$&7*$*7*7$*77*$**&7*$*&7*&77 ,OH*OQ/HX/HX$VQ*OX/HX6HU9DO9DO*OX$OD*OX/HX/HX &7&$$$7&&7&**$7&7**7***&$*&7$&$&7$&7$*&&7*7*& /HX/\V6HU6HU$VS/HX9DO*O\6HU7\U7KU7KU6HU/HX&\V &7*7*&$7&*7**&7*7&&7*&**&$&7$7&$7*&&7*&&7&$7& /HX&\V,OH9DO$OD9DO/HX$UJ+LV7\U+LV$OD&\V/HX,OH &7&$$&&$**$&&$*$7**&$&$**7&777*$****&7*7*7**& /HX$VQ*OQ$VS*OQ0HW$OD*OQ9DO3KH*OX*O\/HX&\V*O\ *7&*7*$$*&$7***$7*$$&&**7&&*$7**&7&&7&7*&$*$* 9DO9DO/\V+LV*O\0HW$VQ$UJ6HU$VS*O\6HU6HU$OD*OX &*&7*7$7&&77*&77$7&7&7$7*$7&7*7$&$&&7&&7*7$*& $UJ&\VH/HX$OD7\U/HX7\U$VS/HX7\U7KU6HU&\V 6 HU &$777$$$*$$&$$$777****$*&7&77&$*&*$&7777*&7&$ +LV/HX/\V$VQ/\V3KH*O\*OX/HX3KH6HU$VS3KH&\V6HU $$**7*$$*$$&$&&$7&7$&7*&$$&*7**$*&&$7&**$$7&$ /\V9DO/\V$VQ7KUOOH7\U&\V$VQ9DO*OX3UR6HU*OX6HU $$7$7*&*&7***&$&&7*$*77&$7*$7&*$&$&7&7$*$*$$& $VQ0HW$UJ7US$OD3UR*OX3KH0HW,H$VS7KU/HX*OX$VQ &&7*&$*&7&$&$&&77&$&&7$&$&****&7$**&$$*$*7&77 3UR$OD$OD+LV7KU3KH7KU7\U7KU*O\/HX*O\/\V6HU/HX $*7*$*$$&&&7*&7$$&&*&7$&$*&777*7&7*&$$7*&&&77 6HU*OX$VQ3UR$OD$VQ$UJ7\U6HU3KH9DO&\V$VQ$OD/HX $7*&$&*7&7*7*7****&$&&$7*$7&&&*$7$***7*$$7*$& 0HW+LV9DO&\V9DO*O\+LV+LV$VS3UR$VS$UJ9DO$VQ$VS $7&*&$$7&&7*7*7*&$*$*&7*$&&**&7$77*&$$*7&$&7* H$ODH/HX&\V$OD*OX/HX7KU*O\7\U&\V/\V6 HU/HX $*7*&$*$$7**&7$**$*7*&77$$**&&77*7*&7*&7&&7&7 6HU$OD*OX7US/HX*O\9DO/HX/\V$OD/HX&\V&\V6HU6HU $$&$$7**&$&77*7**777&$$&*$7&7&&7&7*&$$7*77*$7 $VQ$VQ*O\7KU&\V*O\3KH$VQ$VS/HX/HX&\V$VQ9DO$VS

PAGE 177

*7&$*7*$&&7$7&7777&$7*$&7&*&7**&7$&7777*77*&& 9DO6HU$VS/HX6HU3KH+LV$VS6HU/HX$OD7KU3KH9DO$OD $7&&7&$7&*&7&**&$*7*777*&7&&7**$$*$7&7*$77&*& ,H/HXOH$OD$UJ*,Q&\V/HX/HX/HX*OX$VS/HXOH$UJ 7*7*&7*&&$7&&&77&$&7&&77$$7*&7*&77*7$*7*$$&$* &\V$OD$ODOOH3UR6HU/HX/HX$VQ$OD$OD&\V6HU*OX*OQ *$&7&7*$*&&$****&&&**&77$&&7*&&*&$7&&7&&77&$& $VS6HU*OX3UR*O\$OD$UJ/HX7KU&\V$UJOOH/HX/HX+LV &7777&$$*$&$&&*&$*&7&$$7&&77*&&$*7&7*$7**$$$& /HX3KH/\V7KU3UR*OQ/HX$VQ3UR&\V*OQ6HU$VS*O\$VQ $$*&&7$&$*7$**$$7&&*&7&&7&&7*&*$&&*&&$&&7*&7* /\V3UR7KU9DO*O\OOH$UJ6HU6HU&\V$VS$UJ+LV/HX/HX *&7*&&7&&&$*$$&&*&$7&*7**$7**$*&&*7*777*&7*77 $OD$OD6HU*OQ$VQ$UJOOH9DO$VS*O\$OD9DO3KH$OD9DO &7&$$**&7*7*777*7$&77****$7*&**$$&7*$$$**77&$ /HX/\V$OD9DO3KH9DO/HX*O\$VS$OD*OX/HX/\V*O\6HU **&77&$&7*7*$&$**$**$$&$*$$*$$&77&&$*$**$**$* *O\3KH7KU9DO7KU*O\*O\7KU*OX*OX/HX3UR*OX*OX*OX **$**$**7**&$*7**7**7&**$**&$***7**&&*&$$&$7& *O\*O\*O\*O\6HU*O\*O\$UJ$UJ*OQ*O\*O\$UJ$VQOOH 7&7*7**$*$&$*&&$*7&7**$7*7&7$7*&&$$*7$&*7*&7* 6HU9DO*OX7KU$OD6HU/HX$VS9DO7\U$OD/\V7\U9DO/HX &*&$*&$7&7*&&$$&$**$$7***7$**$*$$&*77*&&77$$* $UJ6HUOOH&\V*OQ*OQ*OX7US9DO*O\*OX$UJ&\V/HX/\V 7&7&7*7*7*$**$&$*&$$7*$&&7*&$$*$&&&$*7*77*$*7 6HU/HX&\V*OX$VS6HU$VQ$VS/HX*OQ$VS3UR9DO/HX6HU $*7*&&&$**&*&$*&*&&7&$7*&$*&7&$777*&7$7&&$&$7 6HU$OD*OQ$OD*OQ$UJ/HX0HW*OQ/HX,OH&\V7\U3UR+LV &*$&7*&7**$&$$7*$**$7****$$$$&&&&&$*&**&$*&*& $UJ/HX/HX$VS$VQ*OX$VS*O\*OX$VQ3UR*OQ$UJ*OQ$UJ $7$$$*&*&$77&7&&$*$$&77**$&&$*7**$&&$7*&*&&$* ,H/\V$UJ,H/HX*OQ$VQ/HX$VS*OQ7US7KU0HW$UJ*OQ 7&77&&77**$*&7*&$*&7&$7*$7&$$*&$*$&&&&7$$&$$7 6HU6HU/HX*OX/HX*OQ/HX0HWOOH/\V*OQ7KU3UR$VQ$VQ *$*$7*$$&7&&&7&77**$*$$&$7&*&&$$**&&$&$$7&*$* *OX0HW$VQ6HU/HX/HX*OX$VQOOH$OD/\V$OD7KUOOH*OX

PAGE 178

*7777&&$$&**7&$*&$*$*$&$***7&$7&77&7**$$*7$&7 9DO3KH*OQ$UJ6HU$OD*OX7KU*O\6HU6HU6HU*O\6HU7KU *&$$*&$$&$7*&&&$*&$*&$*&$$*$&&$$*&&7*7*&7&$*& $OD6HU$VQ0HW3UR6HU6HU6HU/\V7KU/\V3UR9DO/HX6HU 7&7&7$*$*&*&7&7**7*7$7**&7**7**&&&&&&7&$77*&7 6HU/HX*OX$UJ6HU*O\9DO7US/HX9DO$OD3UR/HX,OH$OD $$$&7*&&&$&&7&$*7&&$***$&$7*7*77$$$**&7*&7*** /\V/HX3UR7KU6HU9DO*OQ*O\+LV9DO/HX/\V$OD$OD*O\ *$$*$$77**$*$$***7&$*&$&&7***77&&7&77&$&*&$$$ *OX*OX/HX*OX/\V*O\*OQ+LV/HX*O\6HU6HU6HU$UJ/\V *$$&*7*$7&*$&$$$$*&$*$$*$*&$7*7&&&7$77*$*&&$* *OX$UJ$VS$UJ*OQ/\V*OQ/\V6HU0HW6HU/HX/HX6HU*OQ &$*&&&77&77$7&*&7**7*&7$$&$7*7&7*$$$***&$**$7 *OQ3UR3KH/HX6HU/HX9DO/HX7KU&\V/HX/\V*O\*OQ$VS *$$&$$&*&*$***$&7&&77$&&7&&&7&7$&$*&&$**7*&$& *OX*OQ$UJ*OX*O\/HX/HX7KU6HU/HX7\U6HU*OQ9DO+LV &$*$77*7*$$7$$77**&*$*$7*$&&$*7$&77$*$7*$77*& *OQOOH9DO$VQ$VQ7US$UJ$VS$VS*OQ7\U/HX$VS$VS&\V $$$&&$$$*&$*&77$7*&$7*$**&$&7&$$$&7*&**&7&$$& /\V3UR/\V*OQ/HX0HW+LV*OX$OD/HX/\V/HX$UJ/HX$VQ &7**7******&$7*777*$&$&**7*&$*&*&$*&$&&&$*&$* /HX9DO*O\*O\0HW3KH$VS7KU9DO*OQ$UJ6HU7KU*OQ*OQ $&&$&**$*7***&&$7*&7&&7&&7**$*$7&$7&$7&$*&**& 7KU7KU*OX7US$OD0HW/HX/HX/HX*OX,OHOOHOOH6HU*O\ $&7*7&*$&$7*&$*7&&$$&$$7*$*&7&77&$&7$&7*7*77* 7KU9DO$VS0HW*OQ6HU$VQ$VQ*OX/HX3KH7KU7KU9DO/HX *$&$7*&7*$*&*7*&7&$7&$$7***$&$77**&7*&$*$&$7* $VS0H W/HX6 HU9DO/HX,OH$VQ*O\7KU/HX$OD$OD$VS0HW 7&7$*&$7&7&*&$$**7$*&$7**$**$$$$&$$*&*7*&$7$& 6HU6HUOOH6HU*OQ*O\6HU0HW*OX*OX$VQ/\V$UJ$OD7\U $7*$$&&7**&*$$*$$*77*&$*$$**$*77*****$*&*&&$* 0HW$VQ/HX$OD/\V/\V/HX*OQ/\V*OX/HX*O\*OX$UJ*OQ 7&$*$&$*7&7**$$$$**77&*&&$*&7*&7*&&$&7*&&&$$* 6HU$VS6HU/HX*OX/\V9DO$UJ*OQ/HX/HX3UR/HX3UR/\V &$*$&&&*$*$7*7&$7&$&*7*7*$*&&$&$***&7&&&77$7& *OQ7KU$UJ$VS9DOOOH7KU&\V*OX3UR*OQ*O\6HU/HX,OH

PAGE 179

*$7$&&$$***&$$&$$*$77*&7**&77&*$77&&$7&77&$$* $VS7KU/\V*O\$VQ/\VH$OD*O\3KH$VS6 HUH 3KH/\V $$**$***7&7$&$**777&&$&&$$$&$*$$*$7&7&*&&&7** /\V*OX*O\/HX*OQ9DO6HU7KU/\V*OQ/\V,OH6HU3UR7US *$7&77777*$****77*$$*&&*7&$*&$&&$&7&7&77****& $VS/HX3KH*OX*O\/HX/\V3UR6HU$OD3UR/HX6HU7US*O\ 7**777**$$&$*7&&*$*7**$&&**&*$*7**&7&*$**$*$* 7US3KH*O\7KU9DO$UJ9DO$VS$UJ$UJ9DO$OD$UJ*O\*OX *$*&$*&$*&**77*&7*&7&7$&&$&$&$&$&&7*$**&&&&** *OX*OQ*OQ$UJ/HX/HX/HX7\U+LV7KU+LV/HX$UJ3UR$UJ &&&&*&*&&7$77$&&7**$*&&$&7*&&$&7*&&&&&$*$$*$7 3UR$UJ$OD7\U7\U/HX*OX3UR/HX3UR/HX3UR3UR*OX$VS *$**$*&&*&&7*&7&&7$&&&7*&7$*$*&&7*$*$$$$$**&7 *OX*OX3UR3UR$OD3UR7KU/HX/HX*OX3UR*OX/\V/\V$OD &&$*$*&&&&&&$$$$&7*$&$$$&&*****&7*&7&&$&&&$*7 3UR*OX3UR3UR/\V7KU$VS/\V3UR*O\$OD$OD3UR3UR6HU $&7*$**$$&*&$$*$$*$$*7&&$&&$$***&$$*$$$&*&$*& 7KU*OX*OX$UJ/\V/\V/\V6HU7KU/\V*O\/\V/\V$UJ6HU &$*&&$*&7$&&$$*$&$*$**$&7$7**$$7***&&&***7&** *OQ3UR$OD7KU/\V7KU*OX$VS7\U*O\0HW*O\3UR*O\$UJ $*&**&&&77$7**7*7*$&$*7*&&7&&**$&&7&&7*&$&&$& 6HU*O\3UR7\U*O\9DO7KU9DO3UR3UR$VS/HX/HX+LV+LV &&$$$&&&7**77&7$7$$&$&$&&77$$&7$&$**&$$**&7&& 3UR$VQ3UR*O\6HUOOH7KU+LV/HX$VQ7\U$UJ*OQ*O\6HU $7$**&&7*7$&$&&&$*$$&&$*&&$&7$&&7*&$**7**&&&7 ,OH*O\/HX7\U7KU*OQ$VQ*OQ3UR/HX3UR$OD*O\*O\3UR &*7*7**$&&&$7$&&*7&&7*7*&*&77$&&$$7*&$*$$*&7* $UJ9DO$VS3UR7\U$UJ3UR9DO$UJ/HX3UR0HW*OQ/\V/HX &&&$&&&*$&&$$&77$&&&7**$*7*&7*&&&$&$$&&$7*$&7 3UR7KU$UJ3UR7KU7\U3UR*O\9DO/HX3UR7KU7KU0HW7KU **&*7&$7***777$*$$&&&7&&7&77$7$$*$&&7&7*7*7$& *O\9DO0HW*O\/HX*OX3UR6HU6HU7\U/\V7KU6HU9DO7\U &**&$*&$*&$$&&7*&**7*&&&&$$**$&$*&*&&77&*&&$$ $UJ*OQ*OQ*OQ3UR$OD9DO3UR*OQ*O\*OQ$UJ/HX$UJ*OQ &$*&7&&$*&$*$*7&$***&$7*77***$&$*7&$7&7*7&&$7 *OQ/HX*OQ*OQ6HU*OQ*O\0HW/HX*O\*OQ6HU6HU9DO+LV

PAGE 180

&$*$7*$&7&&&$*&7&77&&7$&**777*&$*$&77&&&$***& *OQ0HW7KU3UR6HU6HU6HU7\U*O\/HX*OQ7KU6HU*OQ*O\ 7$7$&7&&77$7*777&7&$7*7***$77*&$*&$$&$&$&$**& 7\U7KU3UR7\U9DO6HU+LV9DO*O\/HX*OQ*OQ+LV7KU*O\ &&7*&$**7$&&$7**7*&&&&&&$*&7$&7&&$*&&$*&&77$& 3UR$OD*O\7KU0HW9DO3UR3UR6HU7\U6HU6HU*OQ3UR7\U &$*$*&$&&&$&&&77&7$&&$$7&&7$&7&77*7$*$7&&7$&& *OQ6HU7KU+LV3UR6HU7KU$VQ3UR7KU/HX9DO$VS3UR7KU &*&&$&&7*&$$&$*&**&&&$*7**&7$7*7*&$&&$*&$**&& $UJ+LV/HX*OQ*OQ$UJ3UR6HU*O\7\U9DO+LV*OQ*OQ$OD &&&$&&7$7**$&$7**$&7*$&&7&&$&7&$$$**7777&$&$& 3UR7KU7\U*O\+LV*O\/HX7KU6HU7KU*OQ$UJ3KH6HU+LV &$*$&$&7*&$*&$*$&$&&&$7*$7$$*7$&&$7*$&7&&$$7* *OQ7KU/HX*OQ*OQ7KU3UR0HWOOH6HU7KU0HW7KU3UR0HW $*7*&&&$***&*7&&$**&$**&*7&&*77&$$&$*&&$7&&7$ 6HU$OD*OQ*O\9DO*OQ$OD*O\9DO$UJ6HU7KU$ODLOH/HX &&7*$*&$*&$*&$*&$*&$*&$$&$*&$*&$$&$*&$$&$*&$* 3UR*OX*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ &$*&$*&$*&$$&$*&$$&$*&$*&$*&$*&$*&$*&$*7$&&$& *OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ7\U+LV $7&&**&$*&$*&$*&$*&$*&$*$7&&7*&**&$*&$*&$*&$$ ,OH$UJ*OQ*OQ*OQ*OQ*OQ*OQOOH/HX$UJ*OQ*OQ*OQ*OQ &$*&$$&$*&$*&$*&$*&$*&$*&$*&$$&$*&$$&$*&$*&$* *OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ*OQ &$*&$$&$*&$$&$$&$*&$$&$&&$*&$*&$$&$*&$*&$$&$* *OQ*OQ*OQ*OQ*OQ*OQ*OQ+LV*OQ*OQ*OQ*OQ*OQ*OQ*OQ *&**&7&&7&&&&$$&&&&$*&&&&$*7&&&$*&&&&$*77&&$* $OD$OD3UR3UR*OQ3UR*OQ3UR*OQ6HU*OQ3UR*OQ3KH*OQ &*&&$****&77&$*&$*$&&&$*&$*&$*&$$&$*$&$*&$*&7 $UJ*OQ*O\/HX*OQ*OQ7KU*OQ*OQ*OQ*OQ*OQ7KU$OD$OD 77**7&&**&$$&77&$$&$$&$*&7&7&7$$7$&&&$*&&$&$* /HX9DO$UJ*OQ/HX*OQ*OQ*OQ/HX6HU$VQ7KU*OQ3UR*OQ &&&$*7$&&$$&$7$777**$&*&7$&7*$*&&$&&7**$**$$& 3UR6HU7KU$VQOOH3KH*O\$UJ7\U 7*&77*7*&$&7**$7*7**&&&&$&&&777&&7&77$$77&&&$ $7&&&$77&&7***&7$*&$&&$*7$*7**77****&&&7&&&&7 &$**&7&&$77777$$7$$*77777$*7$77777*77$$7*7*$* *&$77*$*&7*77***7777*7$7$77$777$7$7$*$*$&&&&$ *$*&7*77*&$&&&$$7$&$&$*$*&77&777*&

PAGE 181

6(48(1&( ,3 *777$$$*&7*$*$$&*&$7&777$*&7$$$&77&*&$77*$$&* 3KH/\V$OD*OX$VQ$OD6HU/HX$OD/\V/HX$UJOOH*OX$U $*$$$*7*&&77**$$$$$&7&$**$$$*$$$77*&$*$&77&*$ J*OX6HU$OD/HX*OX/\V/HX$UJ/\V*OX,OH$OD$VS3KH*O $&$$&$*$$$*&$$$$*$$77$*&7&*$$7$*$$*$*777$$$$$ X*OQ*OQ/\V$OD/\V*OX/HX$OD$UJOOH*OX*OX3KH/\V/\ **$**$*$7*$**$$*&7$&$$$$**$$&*7$$$*77777*$$$$ V*OX*OX0HW$UJ/\V/HX*OQ/\V*OX$UJ/\V9DO3KH*OX/\ *7$7$&7$&$*&7*&$$*$$&7777&&$*$7$$$$$**$$&*7*$ V7\U7KU7KU$OD$OD$UJ7KU3KH3UR$VS/\V/\V*OX$UJ*O $*$$$7$&$*$&777$$$$&$*&$$$7$*&$*$777$&***$$*$ X*OX,OH*OQ7KU/HX/\V*OQ*OQOOH$OD$VS/HX$UJ*OX$V 777*$$$$*$$$**$*$&&$$$7**7&$$*7$&$&$&$*&&*7&7 S/HX/\V$UJ/\V*OX7KU/\V7US6HU6HU7KU+LV6HU$UJ/H &$*$$*&&$*$7$&$$$7*77$*7&$*$*$*$$&$&$*$&&7&&* X$UJ6HU*OQOOH*OQ0HW/HX9DO$UJ*OX$VQ7KU$VS/HX$U **$$*$$$7$$$$*7*$7**$$$*$77&&*$&7**$7*7&7**$$ J*OX*OX,OH/\V9DO0HW*OX$UJ3KH$UJ/HX$VS9DO7US/\ *$*$*&$*$$*&&$7$*$*$*&$*&&7&*$**7**$**$**$*** V$UJ$OD*OX$ODOOH*OX6HU6HU/HX*OX9DO*OX*OX*OX*O & \

PAGE 182

6(48(1&( ,3 $$77&*&**1**&7&*$&*&&*&*&&$&&**&&&**&$**7*&7* 3KH$OD $OD$UJ$UJ$UJ$OD7KU*O\3UR$OD*O\$OD9 7&&77$77&&&$*&&&$*7&$$*$*&7$&&****&7**&7$*7&$ DO/HX,OH3UR6HU3UR9DO/\V6HU7\U$UJ*O\7US/HX9DO0 7*****$*&&&$*7$*$*$**$*7$7$$$$7&&$*7&&777*$7* HW*O\*OX3UR6HU$UJ*OX*OX7\U/\V,OH*OQ6HU3KH$VS$ &$*$*$&&&$*&$*&7*&7*$$*$&$*&$&7&$$$*$7&&***7* OD*OX7KU*OQ*OQ/HX/HX/\V7KU$OD/HX/\V$VS3UR*O\$ &7*7**$&77**$*$$$*7**&&$$7*7*$77*7**$&&$77&7& OD9DO$VS/HX*OX/\V9DO$OD$VQ9DOOOH9DO$VS+LV6HU/ 7*&$**$&7*7*7*77&$*&$$**$$*&$**$&*&$7*7*&7$&* HX*OQ$VS&\V9DO3KH6HU/\V*OX$OD*O\$UJ0HW&\V7\U$ &&$7&$77&$**&$*$*$*7$$$&$$*&$**&&$*$*7*7&77&& ODOOHOOH*OQ$OD*OX6HU/\V*OQ$OD*O\*OQ6HU9DO3KH$ *$&*7**$&7&&7&$$&&**&7*&$*&$**$*7$&&$**&7&*** UJ$UJ*O\/HX/HX$VQ$UJ/HX*OQ*OQ*OX7\U*OQ$OD$UJ* $*&$*&7*&*$*&$&*&7&&&7*&$***&7***7&7*&7$7*7&$ OX*OQ/HX$UJ$OD$UJ6HU/HX*OQ*O\7US9DO&\V7\U9DO7 &&777$7&7*&$$&$7&777*$&7$&&7*$***7*$$&$$&$7*& KU3KHOOH&\V$VQOOH3KH$VS7\U/HX$UJ9DO$VQ$VQ0HW3 &&$7*$7**&&&7**7*$$&&&7*7&7$7*$&7*&&7&77&&**& UR0HW0HW$OD/HX9DO$VQ3UR9DO7\U$VS&\V/HX3KH$UJ/ 77 HX

PAGE 183

6(48(1&( ,3 &77&77&7&7&777*&77&$*$&7**&&&***$*&$$*&*&*$*7 3KH3KH6HU/HX&\V3KH$UJ/HX$OD$UJ*OX*OQ$OD$UJ9D *7*&*$$&7*&$*$*7***$$&&$*&$*&7**$**$*&$*&***7 ,&\V*OX/HX*,Q6HU*O\$VQ*,Q*,Q/HX*OX*OX*,Q$UJ9D **$*&7**7**$$$*$&7*&$**&&$7*&7*&$**&&&$&7***$ O*OX/HX9DO*OX$UJ/HX*OQ$OD0HW/HX*OQ$OD+LV7US$V 7*$**7&$$&&$*&7*&7&$*&$&&$&7&7&&&*&&*&&&$$&&& S*OX9DO$VQ*OQ/HX/HX6HU7KU7KU/HX3UR3UR3UR$VQ3U 7&$$*&7&&7&&7*$7**$&&&7&&$*&&&&***&&7&$**$*$& R*OQ$OD3UR3UR$VS*O\3UR6HU6HU3UR*O\3UR*OQ*OX7K **$*$$**$**$*$**$***777**$&7$7&&&7&&&$7**&&*7 U*OX/\V*OX*OX$UJ$UJ9DO7US7KUOOH3UR3UR0HW$OD9D **&&7&$$&&&7*7$77&&$$&$*$*&&***$$*&$$**&$&*$* O$OD6HU7KU/HX7\U6HU$VQ$UJ$OD*O\/\V*OQ*O\7KU6H 77$&&7**$&&*&&7&&7*77&7777&$$777&77&7&$*$7&77 U7\U/HX$VS$UJ/HX/HX3KH3KH6HUOOH6HU6HU*OQOOH/H $*&&7&&7*77***&&&&7&7777&$7$$7&$$&$777777& X$OD6HU&\V7US$OD3UR/HX3KHOOHOOH$VQOOH3KH

PAGE 184

6(48(1&( ,3 *&*$*&*7*$*7&$*&*&7*$$**&&&$*$*&*&*&7*&$&*$*& *OX$UJ*OX6HU$OD/HX/\V$OD*OQ6HU$OD/HX+LV*OX* $*$$*$&7&7*&&&***$7*$$&&**&&A7&&$**7*$$*&7*& ,Q/\V7KU/HX3UR*O\0HW$VQ$UJ3UR,OH*,Q9DO/\V/HX$ *$$&$&*$*$&&*$**$*$7$*$$$$&7&77&*7***&$7*&7&$ UJ7KU$UJ$VS$UJ*O\$VS$UJ/\V/HX3KH9DO*O\0HW/HX$ $&$$*&$$$$*7&&*$**$&*$&*7*&*&&*&&7777&*$**&&7 VQ/\V*OQ/\V6HU*OX$VS$VS9DO$UJ$UJ/HX3KH*OX$OD3 77***$$&$7&*$**$*7*&$&&$7&&7*&*&***&&&*$&**&$ KH*O\$VQOH*OX*OX&\V7KU,H/HX$UJ*O\3UR$VS*O\$ $&$*&$$****7*&*&&777*7*$$*7$&7&&7&&&$&*&&*$** VQ6HU/\V*O\&\V$OD3KH9DO/\V7\U6HU6HU+LV$OD*OX* **&$**&&*&&$77&$$&*&*&7$&$&**&$*&&$*$&&$7*&&* O\*OQ$OD$ODOOH*OQ$UJ$OD7KU$UJ*OQ3UR$VS+LV$OD* **$*&&7&*7&&$*7&7**7**7&$$*77&*&&*$&$&&*$&$$* O\6HU/HX9DO*OQ6HU*O\*O\*OQ9DO$UJ$UJ+LV$UJ*OQ* *$*&*&$&*$7*&**&*$$7*&$*&$*$7**77**&&$*$7***& O\$OD+LV$VS$OD$OD$VQ$OD$OD$VS*O\7US3UR$VS*O\+ $7*77&$$&&&&$7**&&$7&&&777&****&&7$&***&&7$&* LV9DO*OQ3UR+LV*O\+LV3UR3KH$UJ*O\/HX$UJ$OD7\U$ &7&$**&$$7*&$*&$*&$$*&**&&&7*$7**&$7&$*7&*&*& OD*OQ$OD0HW*OQ*OQ*OQ$OD$OD/HX0HW$OD6HU9DO$OD* $*****&&7$&&7*$$&&&&$7**&7*&&77&*&7*7&*&&&$*$ ,Q*O\$OD7\U/HX$VQ3UR0HW$OD$OD3KH$OD9DO$OD*,Q0 7*&$*&$*$7**&* HW*OQ*OQ0HW$OD

PAGE 185

%,%/,2*5$3+< $EHUDQWK\ &5 5DVPXVVHQ 6$ 6WDONHU +=RUL 5 'ULVFROO ':LOOLDPV &$ .RXVVHII %* :DOODFH 05 f 1) PXWDWLRQ DQDO\VLV XVLQJ D FRPELQHG KHWHURGXSOH[66&3 DSSURDFK +XP 0XWDWLRQ $GDPV 0' .HUODYDJH $5 )OHLVFKPDQQ 5' )XOGQHU 5$ %XOW &/HH 1+ .LUNQHVV () :HLQVWRFN .* *RFD\QH -' :KLWH 2 f ,QLWLDO DVVHVVPHQW RI KXPDQ JHQH GLYHUVLW\ DQG H[SUHVVLRQ SDWWHUQV EDVHG XSRQ PLOOLRQ QXFOHRWLGHV RI F'1$ VHTXHQFH 1DWXUH 6XSSOf $GDPV 0' 6RDUHV 0% .HUODYDJH $5 )LHOGV & 9HQWHU -& f 5DSLG F'1$ VHTXHQFLQJ H[SUHVVHG VHTXHQFH WDJVf IURP D GLUHFWLRQDOO\ FORQHG KXPDQ LQIDQW EUDLQ F'1$ OLEUDU\ 1DWXUH *HQHWLFV f $LWNHQ $ &ROOLQJH '% YDQ +HXVGHQ %3 ,VREH 7 5RVHERRP 3+ 5RVHQIHOG 6RLO f SURWHLQV D KLJKO\ FRQVHUYHG ZLGHVSUHDG IDPLO\ RI HXNDU\RWLF SURWHLQV 7UHQGV %LRFKHP 6FL f $LWNHQ $ -RQHV 6RQHML < +RZHOO 6 f SURWHLQV ELRORJLFDO IXQFWLRQ DQG GRPDLQ VWUXFWXUH %LRFKHPLFDO 6RFLHW\ 7UDQVDFWLRQV f $OEHUWV % %UD\ /HZLV 5DII 0 5REHUWV :DWVRQ -' f 0ROHFXODU ELRORJ\ RI WKH FHOO *DUODQG 3XEOLVKLQJ ,QF 1HZ
PAGE 186

$VDR + 6DVDNL < $ULWD 7 7DQDND 1 (QGR .DVDL + 7DNHVKLWD 7 (QGR < )XMLWD 7 6XJDPXUD f +UV LV DVVRFLDWHG ZLWK 67$0 D VLJQDO WUDQVGXFLQJ DGDSWRU PROHFXOH -%LRO &KHP %DHW] ,VDD] 6 *ULIILWKV *0 f /RVV RI F\WRWR[LF 7 O\PSKRF\WH IXQFWLRQ LQ &KHGLDN+LJDVKL V\QGURPH DULVHV IURP D VHFUHWRU\ GHIHFW WKDW SUHYHQWV O\WLF JUDQXOH H[RF\WRVLV ,PPXQRO %DLURFK $ f 3526,7( D GLFWLRQDU\ RI VLWHV DQG SDWWHUQV LQ SURWHLQV 1XFOHLF $FLGV 5HVHDUFK 6XSSO %DOODUG 5 7LHQ 5' 1RKULD 9 -XHO 9 f 7KH &KHGLDN+LJDVKL V\QGURPH &7 DQG 05 ILQGLQJV 3HGLDWU 5DGLRO f %DUERVD 0')6 %DUUDW )7FKHPHY 97 1JX\HQ 4$ 0LVKUD 96 &ROPDQ 6' 3DVWXUDO ( 'XIRXUFT/DJHORXVH 5 )LVFKHU $ +ROFRPEH 5) :DOODFH 05 %UDQGW 6GH 6DLQW %DVLOH .LQJVPRUH 6) f ,GHQWLILFDWLRQ RI PXWDWLRQV LQ WZR PDMRU P51$ LVRIRUPV RI WKH &KHGLDN+LJDVKL V\QGURPH JHQH LQ KXPDQ DQG PRXVH +XP 0RO *HQHW %DUERVD 0')6 1JX\HQ 4$ 7FKHPHY 97 $VKOH\ -$ 'HWWHU &' %OD\GHV 60 %UDQGW 6&KRWDL +RGJPDQ & 6RODUL 5&( /RYHWW 0 .LQJVPRUH 6) f ,GHQWLILFDWLRQ RI WKH KRPRORJRXV EHLJH DQG &KHGLDN+LJDVKL V\QGURPH JHQHV 1DWXUH %DUUDW )$XORJH / 3DVWXUDO ( 'XIRXUFT/DJHORXVH 5 9LOPHU ( &DQW $:HLVVHQEDFK /H 3DVOLHU )LVFKHU$ GH 6DLQW %DVLOH f *HQHWLF DQG SK\VLFDO PDSSLQJ RI WKH &KHGLDN+LJDVKL V\QGURPH RQ &KURPRVRPH OT $P +XP *HQHW %HDQ $6HLIHUW 5 &KHQ <$ 6DFNV 5 6FKHOOHU 5+ f +UV LV DQ $73DVH LPSOLFDWHG LQ FDOFLXPUHJXODWHG VHFWUHWLRQ 1DWXUH %HJXH]&HVDU $ f 1HXWURSHQLD FUQLFD PDOLJQD IDPLOLDU FRQ JUDQXODFLRQHV DWLSLFDV GH ORV OHXFRFLWRV %RO 6RF &XEDQD 3HGLDW %HLGOHU -/ +LOOLDUG 35 5LOO 5/ f 8OWUDVHQVLWLYH VWDLQLQJ RI QXFOHLF DFLGV ZLWK VLOYHU $QDO %LRFKHP %HOOLQDWL3LUHV 5 6DOJDGR 00 -RD]HULR 33 &DPHLUR6DPSDLR 00 f 'HOD\HG SKDJRF\WRVLV DQG EDFWHULDO NLOOLQJ LQ &KHGLDN+LJDVKL V\QGURPH QHXWURSKLOV GHWHFWHG E\ D IOXRURFKURPH DVVD\ 0HP ,QVW 2VZDOGR &UX] f %HOPRQW /' 0LWFKLVRQ 7f ,GHQWLILFDWLRQ RI D SURWHLQ WKDW LQWHUDFWV ZLWK WXEXOLQ GLPHUV DQG LQFUHDVHV WKH FDWDVWURSKH UDWH RI PLFURWXEXOHV &HOO

PAGE 187

%HQIHQDWL ) 9DOWRUWD ) &KLHUHJDWWL ( *UHHQJDUG 3 f ,QWHUDFWLRQ RI IUHH DQG V\QDSWLF YHVLFOHERXQG V\QDSVLQ ZLWK )DFWLQ 1HXURQ %HQQHW 0. 0LOOHU .* 6FKHOOHU 5+ f &DVHLQ NLQDVH ,, SKRVSKRU\ODWHV WKH V\QDSWLF YHVLFOH SURWHLQ S -1HXURVFLHQFH %LVKRS '7 f 7KH LQIRUPDWLRQ FRQWHQW RI SKDVHNQRZQ PDWLQJV IRU RUGHULQJ JHQHWLF ORFL *HQHW (SLGHPLRO %OXPH 56 %HQQHWW -0
PAGE 188

&KGLDN 0 f 1RXYHOOH DQRPDOLH OHXFRF\WDLUH GH FDUDFWHUH FRQVWLWXWLRQQHO HW IDPLOLDO 5HY +HPDWRO &KXUFK *0 *LOEHUW : f *HQRPLF VHTXHQFLQJ 3URF 1DWO $FDG 6FL 86$ &ODUN ($ 5RWKV -% 0XUSK\ (' /HGEHWWHU -$ &ODJHWW -$ f 7KH EHLJH EJf JHQH LQIOXHQFHV WKH GHYHORSPHQW RI DXWRLPPXQH GLVHDVH LQ 6%/H PDOH PLFH ,Q 1. FHOOV DQG RWKHU QDWXUDO HIIHFWRU FHOOV +HEHUPDQ5% HGf $FDGHPLF 3UHVV S &ODZVRQ && :KLWH -* 5HSLQH -( f 7KH &KHGLDN+LJDVKL V\QGURPH (YLGHQFH WKDW GHIHFWLYH OHXNRWD[LV LV SULPDULO\ GXH WR DQ LPSHGLPHQW E\ JLDQW JUDQXOHV $P 3DWKRO f &ROJDQ 63 %ODQFTXDHUW $0 7KUDOO 0$ %UX\QLQFN[ :f 'HIHFWLYH LQ YLWUR PRWLOLW\ RI SRO\PRUSKRQXFOHDU OHXNRF\WHV RI KRPR]\JRWH DQG KHWHUR]\JRWH &KHGLDN +LJDVKL FDWV 9HW ,PPXQRO ,PPXQRSRDWKRO f &ROJDQ 63 *DVSHU 3: 7KUDOO 0$ %RRQH 7& %ODQFTXDHUW $0 %UX\QLQFN[ :f 1HXWURSKLO IXQFWLRQ LQ QRUPDO DQG &KHGLDN+LJDVKL V\QGURPH FDWV IROORZLQJ DGPLQLVWUDWLRQ RI UHFRPELQDQW FDQLQH JUDQXORF\WH FRORQ\VWLPXODWLQJ IDFWRU ([S +HPDWRO f &ROJDQ 63 +XOO7KUDOO 0$ *DVSHU 3: f 3ODWHOHW DJJUHJDWLRQ DQG $73 VHFUHWLRQ LQ ZKROH EORRG RI QRUPDO FDWV DQG FDWV KRPR]\JRXV DQG KHWHUR]\JRXV IRU &KHGLDN +LJDVKL V\QGURPH %ORRG &HOOV f 'DYOHWRY % 6RQWDJ -0 +DWD < 3HWUHQNR $* )\NV (0 -DKQ 5 6XHGKRI 7& f 3KRVSKRU\ODWLRQ RI V\QDSWRWDJPLQ E\ FDVHLQ NLQDVH ,, %LRO &KHP 'H/RUHQ]R 5f 7KH FDOPRGXOLQ K\SRWKHVLV RI QHXURWUDQVPLVVLRQ &HOO &DOFLXP 'HYHUHX[ +DHEHUOL 0 6PLWKLHV 2 f $ FRPSUHKHQVLYH VHW RI VHTXHQFH DQDO\VLV SURJUDPV IRU WKH 9$; 1XFOHLF $FLGV 5HV )X + ;LD 3DOODV '& &XL & &RQUR\ 1DUVLPKDQ 53 0DPQ + &ROOLHU 55REHUWV 70 f ,QWHUDFWLRQ RI WKH SURWHLQ NLQDVH 5DI ZLWK SURWHLQV 6FLHQFH )XMLWD < )XNXL .RWDQL + .LPXUD 7 +DWD < 6XGKRI 7& 6FKHOOHU 5+ 7DNDL < f-%LRO &KHP )XNDL 2K .DULP 0$ 0RRUH ..DQGLO ++ ,WR + %XHUJHU 6SULW] 5$ f +RPR]\JRVLW\ PDSSLQJ RI WKH JHQH IRU &KHGLDN+LJDVKL V\QGURPH WR FKURPRVRPH OT

PAGE 189

T LQ D VHJPHQW RI FRQVHUYHG V\QWHQ\ WKDW LQFOXGHV WKH PRXVH EHLJH ORFXV EJf $P +XP *HQHW *DOOLQ -, %XMDN -6 3DWWHQ ( :ROII 60 f *UDQXORF\WH IXQFWLRQ LQ WKH &KHGLDN+LJDVKL V\QGURPH RI PLFH %ORRG f *DOOLQ -, .OLPHUPDQ -$ 3DGJHWW *$ :ROII 60 f 'HIHFWLYH PRQRQXFOHDU OHXNRF\WH FKHPRWD[LV LQ WKH &KHGLDN+LJDVKL V\QGURPH RI KXPDQV PLQN DQG FDWWOH %ORRG f *LVK : 6WDWHV 'f ,GHQWLILFDWLRQ RI SURWHLQ FRGLQJ UHJLRQV E\ GDWDEDVH VLPLODULW\ VHDUFK 1DW *HQHW f *RQJ : (PDQXHO %6 &ROOLQV .LP '+ :DQJ = &KHQ ) =KDQJ 5RH % %XGDUI 0 f $ WUDQVFULSWLRQ PDS RI WKH 'L*HRUJH DQG YHORFDUGLRIDFLDO V\QGURPH PLQLPDO FULWLFDO UHJLRQ RQ TO +XP 0RO *HQHW *RRGULFK .+ +ROFRPEH 5) f *HQHWLF ORFDOL]DWLRQ RI WKH JHQH IRU &KHGLDN +LJDVKL V\QGURPH WR KXPDQ FKURPRVRPH OT DQG OLQNDJH WR QLGRJHQ ,QYHVWLJ 0HG f 6XSSOO $ *UHHQ (/ f /LQNDJH UHFRPELQDWLRQ DQG PDSSLQJ ,Q f*HQHWLFV DQG 3UREDELOLWLHV LQ $QLPDO %UHHGLQJ ([SHULPHQWVf SS 0DFPLOODQ 1HZ
PAGE 190

+LOOLHU / &ODUN 1 'XEXTXH 7 (OOLVWRQ +DZNLQV 0 +ROPDQ 0 +XOWPDQ 0 .XFDED 7 /H 0 /HQQRQ 0DUUD 0 3DUVRQV 5LINLQ / 5RKOILQJ 7 6RDUHV 0 7DQ ) 7UHYDVNLV ( :DWHUVRQ 5 :LOOLDPVRQ $ :RKOGPDQQ 3 :LOVRQ 5 f :DVK8 0HUFN (67 3URMHFW +LUOLQJ + 6FKHOOHU 5+ f 3KRVSKRU\ODWLRQ RI V\QDSWLF YHVLFOH SURWHLQV PRGXODWLRQ RI WKH D61$3 LQWHUDFWLRQ ZLWK WKH FRUH FRPSOH[ 3URF 1DWO $FDG 6FL +ROFRPEH 5) f ,QWHUOHXNLQLQGXFHG F\WRWR[LFLW\ RI &KHGLDN+LJDVKL O\PSKRF\WHV $FWD +HPDWRO Of +ROFRPEH 5) -RQHV ./ 6WHZDUW 50 f /\VRVRPDO HQ]\PH DFWLYLWLHV LQ &KHGLDN +LJDVKL V\QGURPH HYDOXDWLRQ RI O\PSKREODVWRLG FHOO OLQHV DQG UHYLHZ RI WKH OLWHUDWXUH ,PPXQXGHILFLHQF\ +ROFRPEH 5) 6WHSKHQVRQ '$ =ZHLGOHU $ 6WHZDUW 50 &KDSPDQ 90 6HLGPDQ -* f /LQNDJH RI ORFL DVVRFLDWHG ZLWK WZR SLJPHQW PXWDWLRQV RQ PRXVH &KURPRVRPH *HQHW 5HV +ROFRPEH 5) 6WUDXVV : 2ZHQ )/ %R[HU /$ :DUUHQ 5: &RQOH\ 0( )HUUDUD /HDYLWW 5< )DXFL $6 7D\ORU %$ 6HLGPDQ -* f 5HODWLRQVKLS RI WKH JHQHV IRU &KHGLDN+LJDVKL V\QGURPH EHLJHf DQG WKH 7FHOO UHFHSWRU \FKDLQ LQ PRXVH DQG PDQ *HQRPLFV +ROFRPEH 5) YDQ GH *ULHQG 5 $QJ 6/ %ROKXLV 5/ 6HLGPDQ -* f *DPPDGHOWD 7 FHOOV LQ &KHGLDN+LJDVKL V\QGURPH $FWD +HPDWRO f ,VKLPXUD 7 ,VREH 7 2NX\DPD 7
PAGE 191

,WR 0 6DWR $ 7DQDEH ) ,VKLGD ( 7DNDPL < 6KLJHWD 6 f 7KH WKLRO SURWHLQDVH LQKLELWRUV LPSURYH WKH DEQRUPDO UDSLG GRZQUHJXODWLRQ RI SURWHLQ NLQDVH & DQG WKH LPSDLUHG QDWXUDO NLOOHU FHOO DFWLYLW\ LQ &KHGLDN+LJDVKL V\QGURPHf EHLJH PRXVH %LRFKHP %LRSK\V 5HV &RPPXQ ,WR 0 7DQDEH ) 7DNDPL < 6DWR $ 6KLJHWD 6 f 5DSLG GRZQUHJXODWLRQ RI SURWHLQ NLQDVH & LQ &KHGLDN+LJDVKL V\QGURPHf EHLJH PRXVH E\ SKRUERO HVWHU %LRFKHP %LRSK\V 5HV &RPPXQ -HQNLQV 1$ -XVWLFH 0$ *LOEHUW '&KX 0/ &RSHODQG 1* f 1LGRJHQHQWDFWLQ 1LGf PDSV WR WKH SUR[LPDO HQG RI PRXVH FKURPRVRPH OLQNHG WR EHLJH EJf DQG LGHQWLILHV D QHZ UHJLRQ RI KRPRORJ\ EHWZHHQ PRXVH DQG KXPDQ FKURPRVRPHV *HQRPLFV -XVWLFH 06LODQ &0 &HFL -' %XFKEHUJ $0 &RSHODQG 1* -HQNLQV 1$ f $ PROHFXODU JHQHWLF OLQNDJH PDS RI PRXVH FKURPRVRPH DQFKRUHG E\ WKH EHLJH EJf DQG VDWLQ VDf ORFL *HQRPLFV .DHUUH .OHLQ *2 .LHVVOLQJ 5 .OHLQ 5RGHU -& f /RZ QDWXUDO LQ YLYR UHVLVWDQFH WR V\QJHQHLF OHXNDHPLDV LQ QDWXUDO NLOOHUGHILFLHQW PLFH 1DWXUH f .DLVHU & 0LFKDHOLV 6 0LWFKHOO $ f 0HWKRGV LQ
PAGE 192

.RIIHU $ 7DWKDP 3(5 *RPSHUWV %' f &KDQJHV LQ WKH VWDWH RI DFWLQ GXULQJ WKH H[RF\WRWLF UHDFWLRQ LQ PDVW FHOOV &HOO %LRO .RPDGD 0 .LWDPXUD 1 f 5HJXODWRU\ UROH RI PDMRU W\URVLQH DXWRSKRVSKRU\ODWLRQ VLWH RI NLQDVH GRPDLQ RI F0HW UHFHSWRU VFDWWHU IDFWRUKHSDWRF\WH JURZWK IDFWRU UHFHSWRU %LRO &KHP .RPDGD 0 .LWDPXUD 1 f *URZWK IDFWRULQGXFHG W\URVLQH SKRVSKRU\ODWLRQ RI +UV D QRYHO NLORGDOWRQ SURWHLQ ZLWK D VWUXFWXUDOO\ FRQVHUYHG SXWDWLYH ]LQF ILQJHU GRPDLQ 0RO &HOO %LRO .RPDGD 0 0DVDNL 5
PAGE 193

0DUJROLV 5/ /L 6+
PAGE 194

0XUSK\ (' 5RWKV -% f 3XUNLQMH FHOO GHJHQHUDWLRQ D ODWH HIIHFW RI EHLJH PXWDWLRQV LQ PLFH -DFNVRQ /DE $QQ 5HS 0\HUV 60 (QJ & 3RQGHU %$0XOOLJDQ /0 f &KDUDFWHUL]DWLRQ RI 5(7 SURWRn RQFRJHQH f VSOLFLQJ YDULDQWV DQG SRO\DGHQ\ODWLRQ VLWHV D QRYHO &WHUPLQXV IRU 5(7 2QFRJHQH 1DJDVH 7 6HNL 1 ,VKLNDZD 7DQDND $ 1RPXUD 1 f 3UHGLFWLRQ RI WKH FRGLQJ VHTXHQFHV RI XQLGHQWLILHG KXPDQ JHQHV 9 7KH FRGLQJ VHTXHQFHV RI QHZ JHQHV .,$$ .,$$f GHGXFHG E\ DQDO\VLV RI F'1$ FORQHV IURP KXPDQ FHOO OLQH .* '1$ 5HV f 1DJOH '/ .DULP 0$ :RROI ($ +ROPJUHQ / %RUN 3 0LVXPL '0F*UDLO 6+ 'XVVDXOW %3HURX &0 %RLVV\ 5( 'X\N *0 6SULW] 5$ 0RRUH .f ,GHQWLILFDWLRQ DQG PXWDWLRQ DQDO\VLV RI WKH FRPSOHWH JHQH IRU &KHGLDN+LJDVKL V\QGURPH 1DW *HQHW 1DNDL .DQHKLVD 0 f $ NQRZOHGJH EDVH IRU SUHGLFWLQJ SURWHLQ ORFDOL]DWLRQ VLWHV LQ HXNDU\RWLF FHOOV *HQRPLFV 1RYDN (. 0F*DUU\ 03 6ZDQN 57 f &RUUHFWLRQ RI V\PSWRPV RI SODWHOHW VWRUDJH SRRO GHILFLHQF\ LQ DQLPDO PRGHOV IRU &KHGLDN+LJDVKL V\QGURPH DQG +HUPDQVN\3XGODN V\QGURPH %ORRG f 2ND -$ :HLJHO 3+ f 0LFURWXEXOHGHSRO\PHUL]LQJ DJHQWV LQKLELW DVLDOR RURVRPXFRLG GHOLYHU\ WR O\VRVRPHV EXW QRW LWV HQGRF\WRVLV RU GHJUDGDWLRQ LQ LVRODWHG UDW KHSDWRF\WHV %LRFKLP %LRSK\V $FWD 2OLYHU -0 =XULHU 5% %HUOLQ 5' f &RQFDYDOLQ $ FDS IRUPDWLRQ RQ SRO\PRUSKRQXFOHDU OHXNRF\WHV RI QRUPDO DQG EHLJH &KHGLDN+LJDVKLf PLFH 1DWXUH 2OVHQ '5 1DJD\RVKL 7 )D]LR 0 0DWWHL 0* 3DVVDJH ( :HLO 7LPSO 5 &KX 0/ 8LWWR f +XPDQ QLGRJHQ F'1$ FORQLQJ FHOOXODU H[SUHVVLRQ DQG PDSSLQJ RI WKH JHQH WR FKURPRVRPH OT $PHU +XP *HQHW 2ZHQ )/ 7D\ORU %$ =ZHLGOHU $ 6HLGPDQ -* f 7KH PXULQH \FKDLQ RI WKH 7 FHOO UHFHSWRU LV FORVHO\ OLQNHG WR D VSHUPDWRF\WH VSHFLILF KLVWRQH JHQH DQG WKH EHLJH FRDW FRORU ORFXV RQ FKURPRVRPH ,PPXQRORJ\ 3HLIHU 0 %HUJ 6 5H\QROGV $ f $ UHSHDWLQJ DPLQRDFLG PRWLI VKDUHG E\ SURWHLQV ZLWK GLYHUVH FHOOXODU IXQFWLRQV &HOO

PAGE 195

3HQQHU -' 3ULHXU 'f ,QWHUVSHFLILF JHQHWLF FRPSOHPHQWDWLRQ DQDO\VLV ZLWK ILEUREODVWV IURP KXPDQV DQG IRXU VSHFLHV RI DQLPDOV ZLWK &KHGLDN+LJDVKL V\QGURPH $P -0HG *HQHW f 3HULQ 06 %URVH 1 -DKQ 5 6XHGKRI7& f %LRO &KHP 3HURX & -XVWLFH 03U\RU 5.DSODQ Df &RPSOHPHQWDWLRQ RI WKH EHLJH PXWDWLRQ LQ FXOWXUHG FHOOV E\ HSLVRPDOO\ UHSOLFDWLQJ PXULQH \HDVW DUWLILFLDO FKURPRVRPHV 3URF 1DWO $FDG 6FL 86$ 3HURX &0 .DSODQ f &KHGLDN+LJDVKL V\QGURPH LV QRW GXH WR D GHIHFW LQ PLFURWXEXOHEDVHG O\VRVRPDO PRELOLW\ &HOO 6FL 3W f 3HURX &0 0RRUH .1DJOH '/ 0LVXPL ':RROI ($ 0F*UDLO 6+ +ROPJUHQ / %URG\ %-' 0RQURH &$ 'X\N *0 3U\RU 5/L / -XVWLFH 0 .DSODQ Ef ,GHQWLILFDWLRQ RI WKH PXULQH EHLJH JHQH E\ <$& FRPSOHPHQWDWLRQ DQG SRVLWLRQDO FORQLQJ 1DWXUH *HQHWLFV 3HUULQ 0RHOOHU +DQNH 6RHOLQJ +' f F$03 DQG &D PHGLDWHG VHFUHWLRQ LQ SDURWLG DFLQDU FHOOV LV DVVRFLDWHG ZLWK UHYHUVLEOH FKDQJHV LQ WKH RUJDQL]DWLRQ RI WKH F\WRVNHOHWRQ &HOO %LRO 3HWWLW 5( %HUGDO .* f &KHGLDN+LJDVKL V\QGURPH 1HXURORJLF DSSHDUDQFH $UFK 1HXURO f 3H]HVKNSRXU .XUHQW -6 .UDUXS & %XFKWKDO ) )DXFL $6 f 3HULSKHUDO QHXURSDWK\ LQ &KHGLDN+LJDVKL V\QGURPH -1HXURSDWKRO ([S 1HXURO 3IOXPLR ) )RQWHQHDX 3 /RRU ) f ,PSDLUHG DQWLERG\ UHVSRQVH RI &%/ EHLJH PXWDQW PLFH WR D WK\PXVLQGHSHQGHQW W\SH DQWLJHQ ,PPXQRO /HWW f 3KLOOLSV // .DSODQ +$ 3DGJHWW *$ *RUKDP -5 f &RPSDUDWLYH VWXGLHV RQ WKH &KHGLDN+LJDVKL V\QGURPH FRDJXODWLRQ DQG ILEULQRO\WLF PHFKDQLVPV RI PLQN DQG FDWWOH $P 9HW &OLQ 3DWK 3UDWW +/ &DUUROO 5& -RQHV -% /RWKURS &' -U f 3ODWHOHW DJJUHJDWLRQ VWRUDJH SRRO GHILFLHQF\ DQG SURWHLQ SKRVSKRU\ODWLRQ LQ PLFH ZLWK &KHGLDN+LJDVKL V\QGURPH $P 9HW 5HV f 5DPLUH]'XTXH 3 $UHQGV 7 0HULQR ) f &KHGLDN+LJDVKL V\QGURPH GHVFULSWLRQ RI D FOXVWHU LQ D 9HQH]XHODQ$QGHDQ LVRODWHG UHJLRQ 0HGLFLQH f 5HQGX ) %UHWRQ*RULXV /HEUHW 0 .OHEDQRII & %XULRW *ULVFHOOL & /HY\7ROHGDQR 6 &DHQ -3 f (YLGHQFH WKDW DEQRUPDO SODWHOHW IXQFWLRQV LQ KXPDQ &KHGLDN+LJDVKL V\QGURPH DUH WKH UHVXOW RI D ODFN RI GHQVH ERGLHV $P 3DWKRO f

PAGE 196

5HXWKHU *: )X + &ULSH /' &ROOLHU 53HQGHUJDVW $0 f $VVRFLDWLRQ RI WKH SURWHLQ NLQDVHV F%FU DQG %FU$EO ZLWK SURWHLQV RI WKH IDPLO\ 6FLHQFH 5RGHU 'XZH $ f 7KH EHLJH PXWDWLRQ LQ WKH PRXVH VHOHFWLYHO\ LPSDLUV QDWXUDO NLOOHU FHOO IXQFWLRQ 1DWXUH f 5RGHU -& +DOLRWLV 7 /DLQJ / .R]ERU 5XELQ 3 3URVV + %R[HU /$ :KLWH -* )DXFL $6 0RVWRZVNL + 0DWKHVRQ '6 f )XUWKHU VWXGLHV RI QDWXUDO NLOOHU FHOO IXQFWLRQ LQ &KHGLDN+LJDVKL SDWLHQWV ,PPXQRORJ\ f 5RGHU -& /RKPDQQ0DWWKHV 0/ 'RP]LJ : :LJ]HOO + f 7KH EHLJH PXWDWLRQ LQ WKH PRXVH ,, 6HOHFWLYLW\ RI WKH QDWXUDO NLOOHU 1.f FHOO GHIHFW ,PPXQRO f 5RGHU -& 7RGG 5) 5XELQ 3 +DOLRWLV 7 +HOIDQG 6/ :HUNPHLVWHU 3URVV +) %R[HU /$ 6FKORVVPDQ 6) )DXFL $6 f 7KH &KHGLDN+LJDVKL JHQH LQ KXPDQV ,,, 6WXGLHV RQ WKH PHFKDQLVPV RI 1. LPSDLUPHQW &OLQ ([S ,PPXQRO f 5RHS %2 $UGHQ 6' GH 9ULHV 553 +XWWRQ -& f 7FHOO FORQHV IURP D W\SH GLDEHWHV SDWLHQW UHVSRQG WR LQVXOLQ VHFUHWRU\ JUDQXOH SURWHLQV 1DWXUH 5RVV &$ %HFKHU 0: &RORPHU 9 (QJHOHQGHU 6 :RRG -' 6KDUS $+ f +XQWLQJWRQfV GLVHDVH DQG GHQWDWRUXEUDOSDOOLGROX\VLDQ DWURSK\ SURWHLQV SDWKRJHQHVLV DQG SDWKRORJ\ %UDLQ 3DWKRO 5RWK %XUJR\QH 5' f 6WLPXODWLRQ RI FDWHFKRODPLQH VHFUHWLRQ IURP DGUHQDO FKURPDIILQ FHOOV E\ SURWHLQV LV GXH WR UHRUJDQLVDWLRQ RI WKH FRUWLFDO DFWLQ QHWZRUN )(%6/HWW 5RWK 0RUJDQ $ 0DUWLQ + -RQHV 0DUWHQV *-0 $LWNHQ $ %XUJR\QH 5' f &KDUDFWHUL]DWLRQ RI SURWHLQV LQ DGUHQDO FKURPDIILQ FHOOV DQG GHPRQVWUDWLRQ RI LVRIRUPVSHFLILF SKRVSKROLSLG ELQGLQJ %LRFKHP6DPEURRN )ULWVFK () 0DQLDWLV 7 f ,Q f0ROHFXODU FORQLQJ D ODERUDWRU\ PDQXDOf 9RO S &ROG 6SULQJ +DUERU /DERUDWRU\ 3UHVV &ROG 6SULQJ +DUERU 1< 6DWR $ f &KGLDN DQG +LJDVKLfV GLVHDVH SUREDEOH LGHQWLW\ RI fD QHZ OHXFRF\WDO DQRPDO\ &KGLDNff DQG fFRQJHQLWDO JLJDQWLVP RI SHUR[LGDVH JUDQXOHV +LJDVKLff 7KH 7RKRNX ([S 0HG 6DWR $ 7DQDEH ) ,WR 0 ,VKLGD ( 6KLJHWD 6 f 7KLRO SURWHLQDVH LQKLELWRUV UHYHUVH WKH LQFUHDVHG SURWHLQ NLQDVH & GRZQUHJXODWLRQ DQG FRQFDYDOLQ $ FDS IRUPDWLRQ LQ

PAGE 197

SRO\PRUSKRQXFOHDU OHXNRF\WHV IURP &KHGLDN+LJDVKL V\QGURPH EHLJHf PRXVH /HXNRF %LRO 6FKLHEOHU : -DKQ 5 'RXFHW -3 5RWKOHLQ *UHHQJDUG 3 f &KDUDFWHUL]DWLRQ RI V\QDSVLQ ELQGLQJ WR VPDOO V\QDSWLF YHVLFOHV %LRO &KHP 6KHUPDQ ) f *HWWLQJ VWDUWHG ZLWK \HDVW 0HWKRGV (Q]\PRO 6KLQR]DNL 0DUX\DPD .XPH + .X]XPH + 2EDWD f $ QRYHO EUDLQ JHQH QRUELQ LQGXFHG E\ WUHDWPHQW RI WHWUDHWK\ODPPRQLXP LQ UDW KLSSRFDPSDO VOLFH DQG DFFRPSDQLHG ZLWK QHXULWHRXWJURZWK LQ QHXUR D FHOOV %LRFKHP %LRSK\V 5HV &RPPXQ f 6MDDVWDG 29 %ORP $. 6WRUPRUNHQ + 1HV 1 f $GHQLQH QXFOHRWLGHV VHURWRQLQ DQG DJJUHJDWLRQ SURSHUWLHV RI EOXH IR[HV $ORSH[ ODJRSXVf ZLWK WKH &KHGLDN+LJDVKL V\QGURPH $P 0HG *HQHW f 6REHO $ f 6WDWKPLQ D UHOD\ SKRVSKRSURWHLQ IRU PXOWLSOH VLJQDO WUDQVGXFWLRQ" 7UHQGV %LRFKHP 6FL 6W $PDQG : &XSS 0% f 1HZ OLQNDJH 0RXVH 1HZV /HWW 6WHLQEULQFN : f 8HEHU HLQH QHXH *UDQXODWLRQVDQRPDOLH GHU /HXNRF\WHQ 'HXWVFK $UFKLY .OLQ 0HG 6XJLPRWR < .XVDNDEH 7 .DL 7 f $QDO\VLV RI WKH LQ YLWUR WUDQVODWLRQ SURGXFW RI D QRYHOW\SH 'URVRSKLOD PHODQRJDVWHU DOGRODVH P51$ LQ ZKLFK WZR FDUER[\WHUPLQDO H[RQV UHPDLQ XQVSOLFHG $UFK %LRFKHP %LRSK\V 6XQJ -+ 0H\HUV -3 6WDGODQ (0 &RZHQ :ROI $ f 1HXURSDWKRORJLFDO FKDQJHV LQ &KHGLDN+LJDVKL GLVHDVH -1HXURSDWKRO ([S 1HXURO 6ZDQVRQ -$ %XVKQHOO $ 6LOYHUVWHLQ 6& f 7XEXODU O\VRVRPH PRUSKRORJ\ DQG GLVWULEXWLRQ ZLWKLQ PDFURSKDJHV GHSHQG XSRQ WKH LQWHJULW\ RI F\WRSODVPLF PLFURWXEXOHV 3URF 1DWO $FDG 6FL 86$ 6ZDQVRQ -$ /RFNH $ $QVHO 3 +ROOHQEHFN 3f 5DGLDO PRYHPHQW RI O\VRVRPHV DORQJ PLFURWXEXOHV LQ SHUPHDOL]HG PDFURSKDJHV &HOO 6FL 6\JL\DPD 7 1LVKLR < .LVKLPRWR 7 $NLUD 6 f ,GHQWLILFDWLRQ RI DOWHUQDWLYH VSOLFLQJ IRUP RI 6WDW )(%6 /HWW 7DOPDJH -( 0H\HUV .0 3ULHXU '6WDUNH\ -5 f 5ROH RI 1. FHOOV LQ WXPRXU JURZWK DQG PHWDVWDVLV LQ EHLJH PLFH 1DWXUH

PAGE 198

7DUJDQ 65 2VHDV 5 f 7KH OD]\ 1. FHOOV RI &KHGLDN+LJDVKL V\QGURPH ,PPXQRO f 7FKHUQHY 97 %DUERVD 0')6 'HWWHU -& 3DWHO 7' $FKH\ :DNHODQG (. *XHRUJXLHYD 59
PAGE 199

:LOOLQJKDP 0& 6SLFHU 66 9LQFHQW 5$ -U f 7KH RULJLQ DQG IDWH RI ODUJH GHQVH ERGLHV LQ EHLJH PRXVH ILEUREODVWV /\VRVRPDO IXVLRQ DQG H[RF\WRVLV ([S &HOO 5HV f :LQGKRUVW '% =HOLFNVRQ $6 *RRG 5$ f &KHGLDN+LJDVKL V\QGURPH KHUHGLWDU\ JLJDQWLVP RI F\WRSODVPLF RUJDQHOOHV 6FLHQFH :LQGKRUVW '% =HOLFNVRQ $6 *RRG 5$ f $ KXPDQ SLJPHQWDU\ GLOXWLRQ EDVHG RQ D KHULWDEOH VXEFHOOXODU VWUXFWXUDO GHIHFWf§WKH &KHGLDN+LJDVKL V\QGURPH ,QYHVW 'HUPDWRO f
PAGE 200

%,2*5$3+,&$/ 6.(7&+ 9HOL]DU 7 7FKHPHY ZDV ERUQ LQ 6RILD %XOJDULD ,Q KH JUDGXDWHG IURP KLJK VFKRRO ZLWK H[WHQVLYH VWXG\ RI WKH *HUPDQ ODQJXDJH LQ 6RILD 9HOL]DU 7FKHPHY UHFHLYHG KLV 'RFWRU RI 0HGLFLQH GHJUHH IURP WKH +LJKHU 0HGLFDO ,QVWLWXWH6RILD %XOJDULD LQ +H DOVR REWDLQHG GLSORPDV IRU 7UDQVODWRU RI 0HGLFDO /LWHUDWXUH IURP *HUPDQ f DQG IURP (QJOLVK f ODQJXDJHV IURP WKH +LJKHU 0HGLFDO ,QVWLWXWH6RILD ,Q 9HOL]DU 7FKHPHY HQWHUHG WKH 3K' SURJUDP LQ ,PPXQRORJ\ DQG 0ROHFXODU 3DWKRORJ\ DW WKH 'HSDUWPHQW RI 3DWKRORJ\ DQG /DERUDWRU\ 0HGLFLQH &ROOHJH RI 0HGLFLQH 8QLYHUVLW\ RI )ORULGD

PAGE 201

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ V £ SL $O$$ +$ 0 b$$f 6WHSKHL ,I .LQJVPRUH &O $VVLVWDQW 3URIHVVRU RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0DUJDUHW 5 :DOODFH $VVRFLDWH 3URIHVVRU RI 3HGLDWULFV FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0O0" (ULF 6 6REHO $VVRFLDWH 3URIHVVRU RI 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ -0 ^8/ 0LFKDHO 5 %XEE $VVLVWDQW 3URIHVVRU RI 0HGLFLQH

PAGE 202

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ (GZDUG :DNHODQG 3URIHVVRU RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU 'HDQ &ROOHJH RI 0HGLFLQH 'HDQ JUDGXDWH 6FKRL

PAGE 203

An9(56n79 2) )/25,'$


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID ED11OQ9CW_2G5O9H INGEST_TIME 2014-05-16T15:18:29Z PACKAGE AA00020931_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES