The Acquisition of Cowdria ruminantium infection and immunity in calves

MISSING IMAGE

Material Information

Title:
The Acquisition of Cowdria ruminantium infection and immunity in calves implications for the epidemiology and control of heartwater
Alternate title:
Implications for the epidemiology and control of heartwater
Physical Description:
xvi, 226 leaves : ill. ; 29 cm.
Language:
English
Creator:
Deem, Sharon Lynn, 1963-
Publication Date:

Subjects

Subjects / Keywords:
Ehrlichia -- pathogenicity   ( mesh )
Heartwater Disease -- epidemiology   ( mesh )
Heartwater Disease -- transmission   ( mesh )
Heartwater Disease -- prevention & control   ( mesh )
Cattle   ( mesh )
Cattle -- immunology   ( mesh )
Colostrum -- immunology   ( mesh )
Disease Transmission, Vertical   ( mesh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1994.
Bibliography:
Includes bibliographical references (leaves 212-225).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Sharon Lynn Deem.

Record Information

Source Institution:
University of Florida
Rights Management:
Permission granted to the University of Florida to digitize, archive and distributed this item for non-profit and educational purposes only. Any reuse of this item in excess of fair use requires permission of the copyright holder.
Resource Identifier:
oclc - 50397341
ocm50397341
System ID:
AA00020032:00001

Table of Contents
    Title Page
        Page i
        Page ii
    Dedication
        Page iii
    Acknowledgement
        Page iv
        Page v
    Table of Contents
        Page vi
        Page vii
    List of Tables
        Page viii
        Page ix
        Page x
    List of Figures
        Page xi
        Page xii
        Page xiii
    Glossary
        Page xiv
    Abstract
        Page xv
        Page xvi
    Chapter 1. Introduction
        Page 1
        Page 2
        Page 3
        Page 4
        Page 5
        Page 6
        Page 7
        Page 8
        Page 9
        Page 10
        Page 11
        Page 12
        Page 13
        Page 14
        Page 15
    Chapter 2. Diagnostics
        Page 16
        Page 17
        Page 18
        Page 19
        Page 20
        Page 21
        Page 22
        Page 23
        Page 24
        Page 25
        Page 26
        Page 27
        Page 28
        Page 29
        Page 30
        Page 31
        Page 32
        Page 33
        Page 34
        Page 35
        Page 36
        Page 37
        Page 38
        Page 39
        Page 40
        Page 41
        Page 42
        Page 43
        Page 44
        Page 45
        Page 46
        Page 47
        Page 48
        Page 49
        Page 50
        Page 51
        Page 52
        Page 53
        Page 54
        Page 55
        Page 56
        Page 57
        Page 58
        Page 59
        Page 60
        Page 61
        Page 62
        Page 63
        Page 64
        Page 65
        Page 66
        Page 67
        Page 68
        Page 69
        Page 70
        Page 71
        Page 72
        Page 73
        Page 74
        Page 75
        Page 76
    Chapter 3. A comparison between the pCS20 DNA probe and the polymerase chain reaction in detecting cowdria ruminantium in amblyomma hebraeum ticks
        Page 77
        Page 78
        Page 79
        Page 80
        Page 81
        Page 82
        Page 83
        Page 84
        Page 85
        Page 86
        Page 87
        Page 88
        Page 89
        Page 90
        Page 91
        Page 92
        Page 93
        Page 94
        Page 95
        Page 96
        Page 97
        Page 98
        Page 99
        Page 100
        Page 101
        Page 102
        Page 103
        Page 104
        Page 105
    Chapter 4. Demonstration of vertical transmission of cowdria ruminantium, the causative agent of heartwater, from cows to their calves
        Page 106
        Page 107
        Page 108
        Page 109
        Page 110
        Page 111
        Page 112
        Page 113
        Page 114
        Page 115
        Page 116
        Page 117
        Page 118
        Page 119
        Page 120
        Page 121
        Page 122
        Page 123
        Page 124
        Page 125
        Page 126
        Page 127
        Page 128
        Page 129
        Page 130
        Page 131
        Page 132
        Page 133
        Page 134
        Page 135
        Page 136
        Page 137
        Page 138
        Page 139
        Page 140
        Page 141
        Page 142
        Page 143
        Page 144
        Page 145
        Page 146
    Chapter 5. The role of colostrum in and the duration of calfhood immunity to cowdria ruminantium
        Page 147
        Page 148
        Page 149
        Page 150
        Page 151
        Page 152
        Page 153
        Page 154
        Page 155
        Page 156
        Page 157
        Page 158
        Page 159
        Page 160
        Page 161
        Page 162
        Page 163
        Page 164
        Page 165
        Page 166
        Page 167
        Page 168
        Page 169
        Page 170
        Page 171
        Page 172
        Page 173
        Page 174
        Page 175
        Page 176
        Page 177
        Page 178
        Page 179
        Page 180
        Page 181
        Page 182
        Page 183
        Page 184
        Page 185
        Page 186
        Page 187
        Page 188
        Page 189
    Chapter 6. The epidemiology of heartwater (cowdria ruminantium infection): Factors important in the establishment and maintenance of endemic stability
        Page 190
        Page 191
        Page 192
        Page 193
        Page 194
        Page 195
        Page 196
        Page 197
        Page 198
        Page 199
        Page 200
        Page 201
        Page 202
        Page 203
        Page 204
    Chapter 7. Recommendations
        Page 205
        Page 206
        Page 207
        Page 208
        Page 209
    Appendix. Western blot diagnostic test
        Page 210
        Page 211
    Reference list
        Page 212
        Page 213
        Page 214
        Page 215
        Page 216
        Page 217
        Page 218
        Page 219
        Page 220
        Page 221
        Page 222
        Page 223
        Page 224
        Page 225
    Biographical sketch
        Page 226
        Page 227
        Page 228
Full Text












THE ACQUISITION OF Cowdria ruminantium
INFECTION AND IMMUNITY IN CALVES: IMPLICATIONS FOR THE EPIDEMIOLOGY
AND CONTROL OF HEARTWATER
















By

SHARON LYNN DEEM


















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

1994


































Copyright 1994

by

Sharon Lynn Deem

































This dissertation is dedicated to the animals used in research projects throughout the world.















ACKNOWLEDGMENTS


I would like to give special thanks to the Government of Zimbabwe, particularly the Department of Veterinary Services and Dr. Ushewokunze-Obatolu for allowing me the opportunity to conduct research in Zimbabwe. A special thanks is also extended to the Howard Hughes Medical Institute for providing monetary support.

I thank all those people who gave encouragement during the two years I spent working in Zimbabwe. I especially would like to thank all the members of the Heartwater Research Project at the Veterinary Research Laboratory in Harare; Barbara Byrom, Lameck Chakurungama, Nicolette de Vries, Penny Donachie, Suman Mahan, Kim Mondale, Calister Munjeri, Andy Norval, Trevor Peter, Cathy Roche, Shalt Semu, Bigboy Simbi, Gillian Smith, Ntando Tebele, and Lillian Wassink. I also wish to thank Renzik Karunkomo, Clarence Nyarota, Nenela Nkoza, Bigboy Maruta, Mike Chakala, John Chikondera, Reuben Mushure, Shadrack Mutowa, Cephas Nemunyadzo, and Daniel Semba for their help in keeping the animals well-cared for and the laboratory in order.

I wish to thank Mr. Dan Parker and Mr. Osmon Berry of Glenara Estates, Mr. David Smith of Kintyre Estates, and Mr. A.J. and Mrs. Debbie Bradnick of Manifest Farm for their iv









cooperation. Without the support of these individuals the experiments would not have been possible.

I sincerely appreciate the guidance given to me from my

five committee members, Drs. Barbet, Burridge, Mahan, Norval, and Rao. I especially would like to thank Dr. Norval for the extra guidance he provided during my months of field work in Zimbabwe. Additionally, I wish to acknowledge Ms. Jill

Roberts for making the maps, Ms. Grace McLaughlin for help with statistics, Dr. Martin Meltzer for help with table and graph presentation, and Dr. Euan Anderson for his support and encouragement.

My utmost appreciation is extended to Mr. Trevor Peter for his continual intellectual and personal support during the years of research in Florida and Zimbabwe. I also must thank all the workers at the Mbizi Quarantine Station, Hickie and Joan Visagie, Phineas Dube, Power, Hlengani Hanyoweje, George

Chituni, Timothy Matsilele, and Dani Jeke, (with a special mention of Mr. Phineas Dube) for teaching me about the ways of the African bush.

I thank my family for understanding and kindling my continual quest of knowledge and love of nature.

Lastly, I would like to give special thanks to those animals that lost their lives directly related to my research

and to all researchers who strive to minimize animal suffering and who realize the inherent worth of all living creatures.




v















TABLE OF CONTENTS



ACKNOWLEDGMENTS ....... .................... .. iv

LIST OF TABLES ........ .................... viii

LIST OF FIGURES ......... ..................... ..xi

GLOSSARY ................................. xiv

ABSTRACT ......... ....................... xv

CHAPTERS

1. INTRODUCTION ........ ................ 1

Background ...................... 1
GeneralInformation .... ........... 1
Diagnosis of Heartwater .... ......... 4
Control Principles ...... ............ 9
Epidemiological Factors ... ......... ..12

Specific Aims and Overall Importance of
This Research ....... ................. ..14

2. DIAGNOSTICS ...... ................. .. 16

Introduction ..... ................ 16
Materials and Methods .... ............ 19
Results ....... ................... .. 43
Discussion ...... ................. .. 65

3. A COMPARISON BETWEEN THE pCS20 DNA PROBE
AND THE POLYMERASE CHAIN REACTION IN
DETECTING COWDRIA RUMINANTIUM IN AMBLYOMMA
HEBRAEUM TICKS ....... ................. 77

Introduction .................... 77
Materials and Methods ..... ............. .79
Results .......... ................. ..86
Discussion . . .... ........... 102




vi









4. DEMONSTRATION OF VERTICAL TRANSMISSION OF
COWDRIA RUMINANTIUM, THE CAUSATIVE AGENT
OF HEARTWATER, FROM COWS TO THEIR CALVES . 106

Introduction ... ................ 106
Materials and Methods ............ 108
Results ........ ......... .... 125
Discussion . ..... .......... .. 137

5. THE ROLE OF COLOSTRUM IN AND THE DURATION OF
CALFHOOD IMMUNITY TO COWDRIA RUMINANTIUM . 147

Introduction ........ 147
Materials and Methods for the Preliminary
Studies ........ ............. .. 150
Results for the Preliminary Studies . . 159
Materials and Methods for the Final Studies 167
Results for the Final Studies ......... 174
Discussion ...... ................. 183

6. THE EPIDEMIOLOGY OF HEARTWATER (COWDRIA
RUMINANTIUM INFECTION): FACTORS IMPORTANT
IN THE ESTABLISHMENT AND MAINTENANCE OF
ENDEMIC STABILITY ..... .............. 190


7. RECOMMENDATIONS .... ............... 205
Future Research Recommendations ........ 205
Conclusions ...... ................. 208

APPENDIX ......... ....................... 210

REFERENCE LIST ........ .................... 212

BIOGRAPHICAL SKETCH ....... .................. 226

















vii














LIST OF TABLES


Tableae


2-1 Small Ruminant Virulence Studies Using Blood
Stabilates, Tissue Culture-Derived Organisms, and
Tick Stabilates ....... .................. 37

2-2 Blood Stabilates and Tissue Culture-Derived Organisms
for Infecting Experimental Calves and
Small Ruminants ....... .................. 40

2-3 Validation Study of the Indirect Fluorescent Antibody
Test Using Adult Cattle Sera .... ............. 45

2-4 Statistics for the Indirect Fluorescent Antibody Test
Validation Using Adult Cattle Sera. A) Sensitivity with the Associated 95% Confidence Limits; B) Specificity with the Associated 95% Confidence Limits ... ........ ..49

2-5 Statistics for the Indirect Fluorescent Antibody Test
Validation Using Cowdria Infected and Uninfected Cells and Calf Sera ........... ................... 50

2-6 Small Ruminant Intravenous Inoculations of Viable Cells
Collected from the Colostrum of Dams Living in a Heartwater-Endemic Area ..... .............. .61

3-1 Methods of Infecting Amblyomma hebraeum with Cowdria
ruminantium and Confirmation of Infection by Small Ruminant/Tick Transmission Studies ... ......... ..87

3-2 Comparison of the pCS20 DNA Probe and Polymerase
Chain Reaction Using Matched Samples of
Tick DNA ......... ...................... ..95

3-3 Results of the ANOVA for the Comparison of the DNA Probe,
PCR with Ethidium Bromide Stained Agarose Gel Visualization, and PCR with Southern Blot and DNA Probe Hybridization ....... ................... ..97





viii









3-4 Tick Spiking Experiment: Results of the pCS20 DNA
Probe and the Polymerase Chain Reaction Using
Amblyomma hebraeum Ticks Spiked With Cowdria ruminantium Genomic DNA ........ .................... 99

4-1 Small Ruminant/Tick Transmission Schedule For The
Experiment One Vertical Transmission Study . . 113

4-2 Uninfected Laboratory-Reared Amblyomma hebraeum Tick
Feeds on Calves in The Experiment Two Vertical Transmission Study ...... ................ 119

4-3 Reciprocal IFAT Cowdria ruminantium Antibody Titers For
Experiment One Dams at Parturition and Calves from Birth to Twelve Weeks of Age .... ............. 127

4-4 Results of Small Ruminant/Tick Transmission Studies For
Experiment One ....... .................. ..128

4-5 Reciprocal IFAT Cowdria ruminantium Antibody Titers of
Calves in The Experiment Two Vertical Transmission
Study .......... ....................... .131

4-6 Vertical Transmission Study (Experiment Two): Calf Small
Ruminant/Tick Transmissions (Group One Supplemental Colostrum) ........ .................... 133

4-7 Vertical Transmission Study (Experiment Two): Calf Small
Ruminant/Tick Transmissions (Group Two Own Dam Colostrum) ........ .................... 134

4-8 Small Ruminant Intravenous Inoculations of Viable
Colostral Cells Collected From The Colostrum of Dams Living in a Heartwater-Endemic Area ... ........ ..136

4-9 Detection of Cowdria ruminantium in Laboratory-Reared
Amblyomma hebraeum Ticks Fed on Experiment Two
Calves ......... ...................... 138

5-1 Cowdria ruminantium Challenge and Rechallenge Time
Periods For Calves in Experiment One .. ....... ..155

5-2 Cowdria ruminantium Challenge Time Periods For The Calves
in Experiment Two ...... ................. .156

5-3 Reciprocal IFAT Cowdria ruminantium Antibody Titers of
The Calves in Experiment One .... ........... .160

5-4 Results of the ANOVA for the Comparison of Antibody
Titers for the Four Calf Groups in Experiment One, Based
on Dam Acaricide Treatment and Calf Colostral
Source ........ ..................... .. 162

ix









5-5 Reciprocal IFAT Cowdria ruminantium Antibody Titers of
Dams in Experiment One . . . . . . . 164

5-6 Reciprocal IFAT Cowdria ruminantium Antibody Titers of
Calves in Experiment Two . . . . . . 165

5-7 Reciprocal IFAT Cowdria ruminantium Antibody Titers of
Dams in Experiment Two . . . . . . . 166

5-8 Clinical Reactions, Post-Mortem Lesions, and Giemsa
Stained Brain crush Smears of Experiment Three
Calves . . . . . . . . . . . 175

5-9 Reciprocal IFAT Cowdria ruminantium Antibody Titers of
Experiment Three Animals . . . ... . . 178

5-10 Reciprocal IFAT Cowdria ruminantium Antibody Titers of
Experiment Four Calves . . . . . . . 182


































x















LIST OF FIGURES


1-1 Geographical distribution of Amblyomma
hebraeum and Amblyomma variegatum ticks
in Zimbabwe ..................... 5

2-1 Goat used in a tick transmission study with cloth
tick bags glued to its back ... ......... 35

2-2 Indirect fluorescent antibody test. A) Negative
fluorescence on Cowdria ruminantium infected bovine aortic endothelial cell antigen with pre-infection bovine sera; B) Positive fluorescence on intracellular Cowdria ruminantium organisms (Solid Arrow) and on extracellular Cowdria ruminantium organisms (Open Arrow) with post-infection bovine sera ........ ..................... ..46

2-3 Bovine serum albumin standard curve by Lowry's
assay. Bovine serum albumin absorbance plotted against protein concentration with extrapolated
Crystal Springs, Mbizi, and Plumtree Cowdria
ruminantium Zimbabwean strains .. ........ ..52

2-4 Western blot evaluation of the antigenic patterns
for the three Cowdria ruminantium Zimbabwean
strains: Crystal Springs, Mbizi, and
Plumtree ....... ................... ..53

2-5 Western blot analysis with sera from goats living
in a heartwater-free region of Zimbabwe and
challenged with Cowdria ruminantium. A) No crossreactions in pre-challenge sera; B) Cross-reactions in pre-challenge sera ..... ............. .54
2-6 Sheep demonstrating characteristic paddling
position associated with central nervous system
abnormalities during the terminal stage of
heartwater ....... .................. 62

2-7 Giemsa stained brain biopsy smear of Cowdria
ruminantium organisms located in the capillary
endothelial cells of a heartwater positive
animal ........ .................... 64

xi









3-1 Detection of Cowdria ruminantium in adult
Amblyomma hebraeum ticks using the polymerase
chain reaction (PCR) and ethidium bromide stained gels of PCR products. A) Ticks fed on a clinically
reacting animal infected with the Mbizi strain;
B) Ticks fed on a subclinical carrier animal infected with the Mbizi strain . . . . 89
3-2 Detection of Cowdria ruminantium in adult
Amblyomma hebraeum ticks using the polymerase
chain reaction and Southern blot analysis
of gels in Figure 3-1. A) Ticks fed on a clinically
reacting animal infected with the Mbizi strain;
B) Ticks fed on a subclinical carrier animal infected with the Mbizi strain . . . . 92

3-3 Tick spiking experiment: detection limit of the
pCS20 DNA probe . . . . . . . 100

3-4 Tick spiking experiment: detection limit of the
polymerase chain reaction (PCR) assay using
ethidium bromide stained gels of PCR products 101

4-1 Map of Zimbabwe with the geographical distributions
of Amblyomma hebraeum and Amblyomma variegatum and the study sites at Manifest Farm, Veterinary Research Laboratory, Mazowe Field Station, and Sandringham Farm . . . . . . . 109

4-2 Western blot analysis with sera from goat #4651.
Lane 1, positive control serum; lane 2, negative control serum; lane 3, pre-infection serum and lanes 4,5,6, and 7 are 3,6,9, and 12 weeks postinfection sera . . . . . . . 129

4-3 Detection of Cowdria ruminantium in Amblyomma
hebraeum ticks using the polymerase chain reaction and Southern blot analysis. A)
Autoradiograph of a Southern bot of PCR products from calf #34 after hybridization with an [a32nP]dCTP-labeled pCS20 probe; B) Autoradiograph of a Southern bot of PCR products from calf #45 after hybridization with an [a-n32]dCTP-labeled pCS20 probe. . . . . . . . . . 139

5-1 Map of the Mbizi Quarantine Station, Zimbabwe 152

5-2 The geometric means of reciprocal IFAT Cowdria
ruminantium titers in experiment one calves 161



xii









5-3 The geometric means of reciprocal IFAT Cowdria
ruminantium titers in experiment three
calves ....... ................... 179

6-1 The epidemiology of heartwater based on the
literature prior to 1985: transmission dynamics are controlled by Amblyomma ticks acquiring infection from clinically infected hosts ....... ..192

6-2 The epidemiology of heartwater based on the
literature prior to 1993: transmission dynamics are controlled by Amblyomma ticks acquiring infection
from clinically infected and subclinical
carrier hosts ...... ................ 195

6-3 The epidemiology of heartwater based on all
available literature: transmission dynamics are controlled by Amblyomma ticks acquiring infection from clinically infected and subclinical carrier hosts and by vertical transmission of Cowdria ruminantium from dams to their offspring . 200






























xiii














GLOSSARY

AAP Aggregation/Attachment Pheromone

ANOVA Analysis of Variance

BSA Bovine Serum Albumin

CPE Cytopathic Effect

DMSO Dimethylsulphoxide

DNA Deoxyribonucleic Acid

EBs Elementary Bodies

IFAT Indirect Fluorescent Antibody Test

IV Intravenous
kDa Kilodaltons

ng Nanogram

PBS Phosphate Buffered Saline

PCR Polymerase Chain Reaction

PK Proteinase K

SDS-PAGE Sodium Dodecylsulfate Polyacrylamide Gel

WB Washing Buffer

VRL Veterinary Research Laboratory










xiv















Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

THE ACQUISITION OF Cowdria ruminantium
INFECTION AND IMMUNITY IN CALVES: IMPLICATIONS FOR THE EPIDEMIOLOGY
AND CONTROL OF HEARTWATER

By

Sharon Lynn Deem

August 1994

Chairperson: Dr. Michael J. Burridge Major Department: Veterinary Medicine

Although heartwater is one of the most economically significant tick-borne diseases of ruminants in sub-Saharan Africa, the epidemiology of the disease is poorly understood. Recent evidence, which supports widespread endemic stability of heartwater, led me to study possible factors related to the disease dynamics under natural field conditions. I focused on two important questions that relate to heartwater under endemic conditions in Zimbabwe: 1) if colostrum plays a role in calfhood immunity; and 2) whether or not Cowdria ruminantium is vertically transmitted from cows to their calves.

The findings from experiments in which colostrum, from either C. ruminantium exposed or non-exposed dams, was fed to neonatal calves prior to challenge with C. ruminantium showed

xv









that colostrum does play a role in calfhood immunity. Calves born to both C. ruminantium exposed and non-exposed dams displayed a greater immunity to challenge if fed colostrum from the C. ruminantium exposed dams.

In experiments conducted to determine whether or not vertical transmission of C. ruminantium from carrier dams to their offspring does occur in heartwater-endemic areas, it was demonstrated that neonatal calves are infected by their dams. The rate of vertical transmission was shown to be 33%, 50%, and 67% in three groups of six calves.

It cannot be conclusively stated, from this work, whether vertical transmission is in utero, via colostrum, or both. However, in one experiment C. ruminantium transmission did occur when colostral cells, collected from dams living in a heartwater-endemic area, were inoculated intravenously into susceptible goats, supporting colostrum as a route.

My research findings, in addition to recent findings by other researchers, are significant in relation to the

epidemiology and control of heartwater. In the concluding dissertation chapters I present the factors currently viewed as the most important in heartwater epidemiology and appropriate control strategies based on these factors. I also give recommendations for necessary studies to address the many unanswered questions on the epidemiology of heartwater.





xvi














CHAPTER 1
INTRODUCTION



Background


General Information


Causative organism

Heartwater is a tick-borne rickettsial disease of

domestic and wild ruminants. The causative agent, Cowdria ruminantium, is the only species in the genus Cowdria and is currently classified as a member of the Ehrlichieae tribe in the family Rickettsiaceae, order Rickettsiales (Ristic and Huxsoll, 1984). Two other genera included in this tribe are Ehrlichia and Neorickettsia. Recently, C. ruminantium was classified in the Ehrlichieace tribe, in a tight phylogenetic cluster with E. canis and E. chaffeensis, based on the analysis of 16S ribosomal DNA sequences (van Vliet et al., 1992).

Cowdria ruminantium is a gram-negative, intracellular, bacterium-like organism ranging in size from 0.2 to 5 Am (Cowdry, 1925). In the mammalian host, C. ruminantium has a predilection for the cytoplasm of vascular endothelial cells (Cowdry, 1926; Pienaar, 1970; Stewart and Howell, 1981), but

1









2

is also present in the circulating plasma (Mahan et al., 1992) and circulating leukocytes (Sahu, 1986; Logan et al., 1987; Prozesky and DuPlessis, 1987). Clinical picture

In domestic ruminants (cattle, sheep, and goats),

heartwater varies from a subclinical to a peracute disease. Clinical signs can range from a mild transient fever in subclinical cases to death without premonitory signs in peracute cases. In susceptible naive hosts, the acute form is the most common presentation, characterized by rapid onset of fever, tachypnea, inappetence, and neurological signs which often results in death (Mebus and Logan, 1988). Mortality rates can be as high as 90% in infected Angora goats and up to 60% in susceptible cattle (Uilenberg, 1983).

Many wildlife species, both ruminants and nonruminants, can also become infected with C. ruminantium (Young and Basson, 1973; Uilenberg, 1983; Oberem and Bezuidenhout, 1987a). Although cases of clinical disease have been documented in a few wild ruminants (Young and Basson, 1973; Oberem and Bezuidenhout, 1987a; Okoh et al., 1987), an asymptomatic carrier state is more commonly encountered (Young and Basson, 1973; Oberem and Bezuidenhout, 1987a; Okoh et al., 1987; Andrew and Norval, 1989a). Therefore, wildlife most likely play an important role in the epidemiology of heartwater as reservoirs for









3

infecting Amblyomma ticks, without developing overt clinical signs (Oberem and Bezuidenhout, 1987a). Distribution

Originally a disease confined to the African continent, heartwater has now been confirmed on Madagascar, various small islands in the Indian and Atlantic oceans, islands in the Caribbean, as well as in most of sub-Saharan Africa (Provost and Bezuidenhout, 1987). In Africa, heartwater is considered the third most important vector-borne disease of livestock after theileriosis and trypanosomiasis (Uilenberg, 1983). The recent spread of heartwater outside of Africa has led to an increased economic constraint on livestock industries in different regions of the world. Additionally, many heartwater-free countries are in danger of the introduction of the disease from foci established close to their borders. One example is the current threat that heartwater in the Caribbean poses for the American mainland (Barre et al., 1987).

Vectors

The only known vectors capable of transmitting C.

ruminantium are 13 species of ticks in the genus Amblyomma (Uilenberg, 1982; Bezuidenhout, 1987; Jongejan, 1992). The two most important vectors are A. variegatum, the tropical bont tick, and A. hebraeum, the southern African bont tick (Petney et al., 1987; Walker and Olwage, 1987). Amblyomma variegatum has a large geographical distribution and is









4

therefore considered to be the most significant vector on a global scale (Walker and Olwage, 1987). However, in vast areas of southern Africa (including most of Zimbabwe), A. hebraeum is probably the only major field vector present (Norval, 1983a; Walker and Olwage, 1987) (Figure 1-1). Transmission by the nymphal and adult ticks has been shown to occur transstadially in females and males (Bezuidenhout, 1987; Kocan et al., 1987; Andrew and Norval, 1989b) and intrastadially in males (Andrew and Norval, 1989b). The ability of both transstadial and intrastadial transmission, as well as the three-host life cycle of Amblyomma ticks (Petney et al., 1987), allows an individual tick to spread the disease to more than one host.



Diagnosis of Heartwater


Diagnostic limitations

The lack of a suitable ante-mortem diagnostic test has been an obstacle to our understanding and control of heartwater in the past. One problem is related to C. ruminantium's predilection for endothelial cells, and associated low parasitemia in the circulating blood of vertebrate hosts, making the detection of C. ruminantium from stained blood smears impossible (Uilenberg, 1981). For










5














Harare















A. hebraeum

SA. variegatum

A. hebraeum and A. variegatum

Figure 1-1 Geographical distribution of Amblyomma hebraeum
and Amblyomma variegatum ticks in Zimbabwe. Sources: Norval, 1983a; de Vries et al., 1993.









6

many years the only tests available for detecting C. ruminantium in the live animal were subinoculation of blood into susceptible ruminants or microscopic examination for the presence of colonies in the capillary endothelial cells of brain material obtained by biopsy (Synge, 1978; Uilenberg, 1983). Both these test can detect infection in clinically reacting animals but cannot identify subclinical carriers, thus precluding their use in large-scale epidemiological studies. Additionally, the difficulties in performing these tests limits their value for routine diagnostic testing of individual animals.

The development of diagnostic tests for heartwater has been hampered by the lack of suitable quantities of antigen. This obstacle was overcome after C. ruminantium was successfully grown in vitro in bovine endothelial cells (Bezuidenhout et al., 1985). Cell culture techniques for the growth of C. ruminantium have since been refined (Yunker et al., 1988; Byrom and Yunker, 1990) and large numbers of organisms are now available for use in the development of improved diagnostics (Jongejan et al., 1991a; Waghela et al., 1991; Mahan et al., 1992; Semu et al., 1992; Mahan et al., 1993).

Xenodiagnosis

In this dissertation the term xenodiagnosis will refer to the administration of potentially infectious material (i.e., ticks, blood, colostral cells), collected from an









7

animal of unknown heartwater status, to a susceptible animal which is subsequently monitored for the development of disease. The early method of subinoculation of blood taken from clinically reacting animals into susceptible small ruminants is one example of a heartwater xenodiagnosis method. Tick transmission studies, in which attached ticks collected from carrier or clinically reacting animals are fed on susceptible small ruminants, have proven valuable tools for determining the presence of heartwater in a region (Norval, 1981), the carrier status of individual animals (Andrew and Norval, 1989a; Jongejan et al., 1988), and the presence of C. ruminantium in field ticks (Norval et al., 1990). Positive C. ruminantium transmission by this method provides a definitive diagnosis of heartwater. Serological tests

As mentioned above, successful in vitro cultivation of C. ruminantium in the 1980s proved to be a catalyst for the advancement of diagnostic tests. Serological tests for detecting C. ruminantium antibodies in infected vertebrate hosts include the indirect fluorescent antibody test (IFAT) (Logan et al., 1986; Du Plessis and Malan, 1987a; Jongejan et al., 1989; Semu et al., 1992), the competitive enzyme linked immunoassay (CELISA) (Jongejan et al., 1991a), and the Western blot assay (Mahan et al., 1993). Two major drawbacks of these serological tests are the occurrence of cross-reactive antigenic determinants, most likely with









8

Eh.rlichia organisms (Logan et al., 1986; Du Plessis et al., 1987a; Jongejan et al., 1989; Mahan et al., 1993), and C. ruminantium stock-specific antibodies (Jongejan et al., 1989). The inadequate sensitivity and specificity of these tests limit their value in conducting large-scale epidemiological studies. Additionally, the detection of antibodies can only provide information on whether an animal has been exposed to C. ruminantium. The tests do not differentiate between C. ruminantium clinically infected and carrier animals, a necessary distinction for understanding the epidemiology of heartwater. Molecular tests

The recent development and application of both a C. ruminantium specific deoxyribonucleic acid (DNA) probe (Waghela et al., 1991; Mahan et al., 1992; Yunker et al., 1993) and polymerase chain reaction (PCR) assay (Mahan et al., 1992; Peter et al., 1994) has been a major advancement for the ante-mortem detection of C. ruminantium in clinically infected animals and in ticks. One disadvantage associated with the DNA probe has been the poor sensitivity for detecting C. ruminantium in carrier animals, most likely due to a low rickettsemia (S.M. Mahan, unpublished data). Research is currently in progress on the identification of subclinical carrier animals, using the PCR assay directly on the blood of vertebrate hosts and by the DNA probe and PCR assay on laboratory-reared uninfected Amblyomma ticks that









9

have fed on carrier animals. Thus far, PCR results have been more rewarding then the DNA probe. In one study, the PCR was shown to detect between one and 10 organisms using C. ruminantium genomic DNA and an estimated 200 C. ruminantium organisms within an individual Amblyomma tick (Peter et al., 1994). Unfortunately, the application of PCR for routine use in detecting C. ruminantium directly from the blood of vertebrate hosts has been unreliable to date (S.L. Deem, unpublished data). Importance of recently developed tests

The molecular diagnostic tests presented above show the advances being made towards the development of sensitive, specific, and practical diagnostic tests for the detection of C. ruminantium. Much work remains to be done to improve the tests currently available, as well as to develop new tests, for the detection of both C. ruminantium-specific antibodies and antigens. It is imperative that research continue in this area if we are to understand heartwater disease in individual animals, as well as in vertebrate host and vector populations.



Control Principles



Current approaches to the control of heartwater are based on one or more of the following: individual chemotherapy, artificial immunization by infection and









10

treatment, and acaricide tick control (Oberem and Bezuidenhout, 1987b; Uilenberg, 1989; Norval, 1991). None of these control measures alone is suitable for all situations in which heartwater is encountered. More importantly, it has become apparent that an integrated approach, incorporating different control strategies, may be the most efficient method for heartwater control and management (Bezuidenhout, 1985; Norval et al., 1992a).

The use of individual chemotherapy in clinically ill animals is of limited value since mortality is quite high once nervous signs are noted, irrespective of treatment (Oberem and Bezuidenhout, 1987b; Uilenberg, 1989). Also of limited value is the present "infection and treatment" method of artificial immunization (Howell et al., 1981; Van Der Merwe, 1987). The vaccine contains live unattenuated C. ruminantium organisms, requiring liquid nitrogen or dry ice for storage and transport. Additionally, the vaccine must be administered intravenously and often causes clinical and/or fatal heartwater in susceptible animals (Howell et al., 1981; Van Der Merwe, 1987). Due to the unreliable results and inconvenience associated with current treatment and vaccination protocols, neither of these methods are employed in wide reaching control programs.

Measures directed at tick control include both

intensive and strategic acaricide usage (Bezuidenhout and Bigalke, 1987; Norval, 1991). Intensive control programs











have many disadvantages which have led some authors to dispute the value of this approach (Bezuidenhout and Bigalke, 1987; Howell et al., 1981; Norval, 1983b). The main disadvantages are the high cost of frequent acaricide application, logistic problems in sustaining long-term dipping campaigns, and the adverse effect on immunity to the disease due to reduced transmission rates (Bezuidenhout and Bigalke, 1987; Norval, 1991).

On the other hand, strategic tick control, in terms of heartwater, is an approach that offers control of Amblyomma ticks to a level that promotes a stable disease situation with minimum adverse effects caused by tick worry on the host. This method has the advantages over intensive tick control of requiring less money and time input, less dependence on the availability of a stable work force, and the opportunity for animals to achieve natural immunity by receiving continual low level C. ruminantium exposure (Bezuidenhout and Bigakle, 1987; Norval et al., 1992a). Therefore, in heartwater-endemic regions this method of control has the added theoretical advantage of ensuring that acquired immunity develops within the vertebrate host population and will help maintain endemic stability (Bezuidenhout and Bigakle, 1987; Norval et al., 1992a).









12

Heartwater Epidemiological Factors



Recent insights on the epidemiologv of heartwater

The epidemiology of heartwater remains poorly

understood even though it is recognized as one of the most devastating livestock diseases of sub-Saharan Africa. In the past large-scale epidemiological studies were performed using insensitive and/or non-specific tests which resulted in conflicting reports on various epidemiological factors. Many of these results and misconceptions have now been dispelled. For example, the view that endemic stability of heartwater is never established in the field because of a lack of long-term carrier vertebrate hosts and a low prevalence of C. ruminantium in Amblyomma field ticks (Uilenberg, 1983; Uilenberg, 1990) has now been proven incorrect. Both a long-term carrier state in domestic and wild ruminants (Andrew and Norval, 1989a) and a high prevalence of C. ruminantium infection in A. hebraeum field ticks (Norval et al., 1990) have been demonstrated. A large C. ruminantium reservoir in both vertebrate host and tick populations supports the establishment and maintenance of endemic stability which is now viewed as a common epidemiological states in sub-Saharan Africa (Howell et al., 1981; Bezuidenhout, 1985; Bezuidenhout and Bigalke, 1987; Norval et al., 1992a; Soldan et al., 1993). These findings have made many researchers re-evaluate the earlier views on









13

the maintenance of endemic stability and the factors driving the epidemiology of heartwater. Calfhood role in heartwater eDidemiologv

One requirement for endemic stability of heartwater is that the initial C. ruminantium exposure of young stock occurs during a period of high tolerance to clinical disease. Therefore, both the mode of initial C. ruminantium infection of calves and the mechanism of calfhood immunity must be properly studied to understand fully how endemic stability is established for heartwater. Although never proven, it has been assumed that calves are initially exposed to C. ruminantium by the Amblyomma tick vector. However, two studies conducted in heartwater-endemic areas showed that calves do not get infested with Amblyomma ticks until after 12 weeks of life and yet no heartwater-related morbidity or mortality occurred at the time of tick infestation (Du Plessis et al., 1992; Norval et al., 1994).

It has also been accepted that neonatal ruminants

possess an age-related resistance to C. ruminantium, which in calves is believed to last up to three to four weeks of age (Neitz and Alexander, 1941, Alexander et al., 1946; Neitz et al., 1947; Uilenberg, 1981; Uilenberg, 1983). The literature suggests that this greater resistance to clinical heartwater disease in calves is the same irrespective of the dam's immune status (Neitz and Alexander, 1941; Du Plessis and Malan, 1988), despite the detection of colostrum-derived









14

antibodies to C. ruminantium in newborns of infected dams (DuPlessis, 1984; Du Plessis et al., 1992; Soldan et al., 1993). Although the literature states that the immunity in calves is innate and not influenced by extraneous factors, early studies were not well-controlled and therefore the results are ambiguous.


SDecific Aims And Overall Importance Of This Research



The evidence which suggests the existence of endemic stability has changed the views on heartwater epidemiology. The establishment of heartwater endemic stability would not be obtainable if calfhood immunity waned by four weeks of life and initial C. ruminantium infection in calves did not occur until 12 weeks of age (as currently stated in the literature). It was for this reason that I studied the role of calves in the epidemiology of heartwater and hypothesized that calves do have an immunity to clinical heartwater disease that lasts beyond the stated three to four week period and/or that calves are initially infected with C. ruminantium before they are infested with Amblyomma ticks.

The four specific aims of the dissertation research were as follows:

1) To optimize the polymerase chain reaction assay for the detection of C. ruminantium in laboratory-reared Amblyomma ticks fed on carrier animals;









15

2) To determine whether or not vertical transmission of Cowdria ruminantium from carrier dams to their offspring occurs under natural conditions in heartwater-endemic areas;

3) To determine if colostrum from dams living in a heartwater-endemic area influences calfhood immunity to C. ruminantium; and

4) To present the epidemiological factors important

in the establishment and maintenance of endemic stability of heartwater and provide guidelines for the development of epidemiological models.

The overall importance of this research is directly

related to a better understanding of factors that play key roles in the epidemiology of heartwater. I investigated both the acquisition of C. ruminantium infection in calves and calfhood immunity to clinical heartwater disease. The results of these studies are presented in the dissertation and indicate the significance of calves in relation to the epidemiology and control of heartwater.















CHAPTER 2
DIAGNOSTICS



Introduction




Two of the most important requirements for a welldesigned epidemiological study are the choice of a sensitive and specific diagnostic test(s) and knowledge on how to interpret the test(s) employed. Many epidemiological studies have arrived at incorrect conclusions because of the reliance on unsuitable diagnostic tests. This is especially evident for studies on the epidemiology of heartwater. For example, the paper by Muller Kobold et al. (1992) in which the distribution of heartwater in the Caribbean was determined based on serological tests that detect antibodies against the 32-kilodalton (kDa) protein of C. ruminantium undoubtedly overestimated the distribution. It is now evident that antibodies produced against other rickettsial agents cross-react with the 32-kDa protein which may cause false positives with the currently used serodiagnostic tests for heartwater (Logan et al., 1986; Du Plessis et al., 1987a; Jongejan et al., 1989; Mahan et al., 1993).




16









17

The misinterpretation of diagnostic test results can also lead to inaccurate statements based on experimental data. A common problem is the presentation of test results without differentiating between a test that detects antibodies in an animal that has been exposed to a disease, vaccinated against an agent, or in the case of neonates, acquired maternally-derived antibodies, with a test that detects the actual presence of infection (antigen). This is exemplified by the epidemiological study of Du Plessis et al. (1992). In their study, antibody titers, as determined by the IFAT, were interpreted as directly representative of C. ruminantium infection (calves) and reinfection (adults) rates of individual animals. Unfortunately, possible interfering factors, such as maternally-derived antibodies in calves and varying antibody titers due to cyclical parasitemias in adults or persistent antibody in the absence of infection were not addressed.

The biggest single obstacle to the study of heartwater epidemiology has been the lack of suitable diagnostic tests. To the credit of researchers in the past, many studies had to be designed based on the few inadequate tests available. Even today, with the advancements in the development of C. .ruminantium diagnostic tests, there remain limitations with each of the tests. To overcome the various limitations, I approached the epidemiological research in the dissertation by validating or modifying the interpretation methods for









18

two assays (IFAT and the Western blot assay, respectively), employing parallel tests to increase the overall sensitivity (xenodiagnosis), and by optimizing a PCR assay for the detection of C. ruminantium in Amblyomma ticks.

Two serological tests were used for the detection of Cowdria-specific antibodies. The IFAT, based on the protocol of Semu et al. (1992), was used on cattle sera. Earlier studies, demonstrating that the IFAT is not reliable for the detection of Cowdria-specific antibodies in small ruminants (S.M. Semu, unpublished data), directed me to use the Western blot assay (Mahan et al., 1993) on sheep and goat sera. The presence of C. ruminantium in vertebrate hosts and Amblyomma ticks was tested using the pCS20 DNA probe, PCR, and xenodiagnosis for the detection of Cowdria organisms. The xenodiagnosis tests utilized in this research included intravenous (IV) inoculation of nymphal stabilates (Bezuidenhout, 1981), IV inoculation of colostral cells, and small ruminant/tick transmission feeds. The IV inoculation of nymphal stabilates and colostral cells and two different tick feeding methods were used in the vertical transmission studies (chapter 4).

Two additional diagnostic methods, based on the

inoculation of blood stabilates (Oberem and Bezuidenhout, 1987b; Bezuidenhout, 1989) or tissue culture-derived organisms (Byrom and Yunker, 1990) into vertebrate hosts, were used to determine the heartwater immune status of









19

individual animals (chapter 5). All animals employed in the xenodiagnosis or immunity studies were subsequently monitored for clinical heartwater disease to determine whether C. ruminantium transmission had occurred.

In this chapter the various diagnostic tests employed in the dissertation research for the detection of both Cowdria-specific antibodies and antigens are presented. (The DNA probe and PCR are covered separately in chapter 3). The purpose of this chapter is to provide in-depth information on test protocols, why individual tests were selected, and methods for interpreting the results.



Materials And Methods



Blood Collection And Sera Processingi



Blood was collected from cattle, sheep, and goats into Vacutainer tubes (Becton Dickinson, Rutherford, NJ) by jugular puncture. The samples were kept at room temperature

until clot formation, placed at 40C overnight, and then the sera were separated by centrifugation at 3,000 X g for 15 minutes. One to three milliliter aliquots were stored at

-800C until used in the IFAT (cattle) or Western blot (sheep and goats).









20

Indirect Fluorescent Antibody Test



Antigen and slide preparations

Cowdria ruminantium cell culture. Two Zimbabwean

strains of C. ruminantium; Crystal Springs (Yunker et al., 1988) and Mbizi (Mahan et al., 1994) were used in this study. Four separate batches of Mbizi and one batch of Crystal Springs antigen were grown in bovine aortic endothelial cells as described by Byrom and Yunker (1990). Cells from an uninfected culture were also harvested to test calf sera in the validation study.

Harvesting cells. Infected cells were harvested from cultures with a 3-4+ cytopathic effect (CPE), as determined by light microscopy. (The uninfected cell culture was processed after seven days of growth.) Monolayers were scraped from flasks using disposable cell scrapers (Costar, Cambridge, MA). The supernatants, containing elementary bodies' (EBs) and infected cells, were dispensed into 50 ml polypropylene tubes and centrifuged at 3,000 X g at 40C for 10 minutes to separate the EBs from the infected cell pellet. The supernatants, containing the EBs, were poured off and processed for use in the Western blot assay (see below). The infected cell pellets were washed three times in 10 mls phosphate buffered saline (PBS) (pH 7.2) for 10


In this dissertation the term elementary body will refer to the
electron-dense extracellular infectious stage of C. ruminantium's
developmental cycle.









21

minutes at 3, 000 X g at 40C. Following the third wash the pellets were resuspended in PBS (1 ml PBS / 900 cm2 roller bottle). The suspensions were then diluted two-fold (1:1, 1:2, 1:4, 1:8, and 1:16) and each dilution was placed on a FlowRmulti-test slide (Flow Labs, McLean, VA) well. The slides were stained with LeukostatR (Fisher Scientific, Orangeburg, NY) and cells were visualized using a light microscope. The dilution containing a uniform cell layer throughout the well, without cell clumping, was selected as the best dilution for each antigen batch. The suspensions were spun down and the pellets containing the infected cells were resuspended in PBS at the appropriate dilution. The cells were stored at -800 C until slide preparation.

Preparation of antigen slides. The cell suspension was removed from -800 C and thawed at room temperature. One drop (about 4 Al) of the thawed antigen was placed on

individual wells of a multitest slide, fixed at -200C in acetone overnight, dried in air, and wrapped and stored at

-800C until use.

Conjugate and Evans blue optimization. To determine the proper conjugate (fluorescein isothiocyanate labeled anti-bovine IgG (H + L)) (Kirkegaard and Perry Laboratory Inc., Gaithersburg, MD) dilution and Evans blue concentration, two-fold conjugate dilutions of 1:10, 1:20, 1:40, and 1:80 were tested using known C. rumninantium positive and negative cattle sera. These four dilutions









22

were tested in duplicate using 0.1% and 0.04% Evans blue. Both the negative and positive cattle sera were titrated out in two-fold dilutions from 1:40 to 1:1280. The IFAT protocol was followed as described below. Results for each sample using the different conjugate and Evans blue combinations were compared.
Test sera

Thirteen known negative sera were obtained from adult cattle in Florida, USA. Sera were shipped to Zimbabwe in

0.01% azide. Known positive adult sera were collected from twelve cattle during the post-infection period following IV inoculation with C. ruminantium tissue culture-derived organisms, tick stabilate, or blood stabilate from the Ball 3 (Haig, 1952) or Palm River (Yunker et al., 1988) strains. Positive test sera had titers ranging from 1:80 to 1:512, as determined previously by the IFAT (Semu et al., 1992) (Table 2-3).

Blood was collected from 40 calves at the time of

parturition and before initial colostrum intake. The calves were representative of three areas of Zimbabwe; two in heartwater-endemic areas, Mbizi Quarantine Station (19 calves) and Manifest Farm (six calves) and one in a heartwater-free area, Glenara Estates Dairy (15 calves). Indirect fluorescent antibody test protocol

Slides were thawed slowly to room temperature and

washed three times in PBS for five minutes before staining.









23

Sera from adult animals were thawed and diluted with PBS to 1:40, 1:80, and 1:160 for each sample. Calf sera were tested undiluted, and at 1:10, 1:20, and 1:40 dilutions. Thirty microliters of each dilution of sera were reacted with antigen. Each calf serum was tested in duplicate using slides with uninfected cells and slides with the Crystal Springs strain of C. ruminantium infected cells. On each slide known positive and negative adult sera were tested at a 1:80 dilution as controls. All samples were coded to avoid bias.

Slides were incubated in a moist chamber at 370C for 30 minutes with the test sera and washed three times with PBS for five minutes each followed by incubation with 30 gl of a fluorescein isothiocyanate-labeled anti-bovine IgG (H + L) diluted 1:20 in 0.1% Evans blue dye for 30 minutes at 370C. (This was the conjugate and Evans blue combination determined as optimal.) Slides were washed three times with PBS and mounted in 50% glycerol in PBS. Fluorescence was observed with a Zeiss microscope equipped with an epi condenser IV fluorescence (Carl Zeiss, D-7082, Oberkochen, Germany). Representative photomicrographs were taken using a Wild MPS 45 Photoautomat unit (Wild Heerbrugg LTD, Switzerland) and Kodak TX 5063 black and white film (Eastman Kodak Company, Rochester, NY).









24

Statistical analysis

The estimated sensitivity and specificity with 95% associated confidence limits were determined for each antigen batch based on the 13 and 12 adult serum samples, respectively. The results from the five separate antigen batches were then pooled to estimate the overall sensitivity and specificity with 95% confidence limits. For small sample sizes (n<30) the confidence intervals were calculated from a table of confidence limits for proportions (Crow, 1956). The large sample (n2:30) confidence limits were calculated using the formula P +/- 1.96 V' P(l-P)/n (Ott, 1988), where P is the proportion true positive (for sensitivity) and true negative (for specificity).

The data for estimation of specificity and the

associated confidence limits were obtained using neonatal calf sera and slides with the uninfected and C. ruminantium infected cells for determining background noise and crossreaction with C. r-uminantium antigens, respectively. All 40 calf sera were pooled to determine the specificity and confidence limits using the uninfected cells. The 15 heartwater-free versus 25 heartwater-endemic sera were tested separately using the C. ruminantium infected cells to determine specificities and confidence limits. The significance of the difference between the heartwater-free and heartwater-endemic calf sera specificities, using the infected cells, were tested statistically by Fisher's exact









25

test (SAS Instiutue Inc. SAS/STATTm User's Guide, Release

6.03 Edition, 1988).



Western Blot



General principle

Western blot is used to detect the presence of serum antibodies by the binding of antibodies to polypeptides which have been separated, by molecular weight, through a sodium dodecylsulfate polyacrylamide gel (SDS-PAGE) (Burnette, 1981). Theoretically, each organism has a unique antigenic pattern and thus only antibodies specific to that organism are detected.

Preparation of antiQen

Cowdria ruminantium cell cultures. Three C.

ruminantium Zimbabwean strains; Crystal Springs, Mbizi, and Plumtree (S.L. Deem, unpublished data) were used for this study. These C. ruminantium strains were cultured in bovine aortic endothelial cells as described in Byrom and Yunker (1990).

Harvesting elementary bodies. Elementary bodies were harvested from cultures with a 3-4+ CPE, as determined by light microscopy. Monolayers were scraped from flasks using disposable cell scrapers. The supernatants, containing EBs and infected cells, were dispensed into 50 ml polypropylene tubes and centrifuged at 3,000 X g at 40C for 10 minutes to









26

separate the EBs from the infected cell pellet. The supernatants containing the EBs were used for the Western blot assay and the pellets were used for the IFAT (see above). The supernatants were transferred to high-speed centrifuge tubes (Nalgene Lab., Rochester, NY) and spun at 30,000 X g for 30 minutes in a Beckman J2-21 centrifuge (Beckman Instruments Inc., Palo Alto, CA). The resulting pellets were resuspended and washed three times in PBS (pH

7.2) at 30,000 X g for 30 minutes each wash. The final pellet was resuspended in approximately 1 ml of PBS/900 cm2 flask and stored at -800C until use.

To disrupt the EBs, the material was subjected to three cycles of freeze, thaw, and sonication by placing in liquid nitrogen, a 370C water bath, and a sonication bath set for one minute at maximum setting, respectively. The protein was quantitated for each antigen batch using the Lowry method2 (Lowry et al., 1951). Lowry semi-quantitative method of protein quantitation

Bovine serum albumin (BSA) diluted in PBS was used to create a standard curve which was then used to determine protein concentrations of test samples (Crystal Springs, Mbizi, and Plumtree). Using a 96-well flat bottom microtiter plate, dilutions, in duplicate, were made from

2.0 mg/ml to 0.05 mg/ml BSA protein concentration.


2 All materials used in both the Lowry protein quantitation method
and the Western blot protocol are presented in Appendix 1.









27

Additionally, a two-fold dilution from 1:2 to 1:256 of each C. ruminantium sample was made in PBS. Phosphate buffered saline served as a blank negative control. Twenty-five microliters of each sample was transferred, in duplicate, to a second 96-well microtiter plate. Three separate plates (one each for Crystal Springs, Mbizi, and Plumtree) were used with PBS added to the first two columns as the blank, the BSA standard added to columns three and four, and the test sample to columns five and six. Two hundred microliters of reagent D was added to each well. Each plate was vigorously shaken on a microshaker plate and then allowed to stand for 10 minutes at room temperature. Twenty-five microliters of reagent E was added, the plate was again well shaken and left to stand for 30 minutes at room temperature.

The optical densities (OD) were read using a 492 nm filter in an ELISA plate reader (Titertek Multiscan RMCC; EFLAB ov.; Lab Systems and Flow Laboratory, Finland). The average OD of the duplicates of the BSA standard were calculated and then plotted against the protein concentration. The average OD of each test sample was calculated and the protein concentration determined by extrapolation based on the BSA standard curve. The antigen was stored in a 1:1 dilution with 2X treatment buffer.

The antigenic patterns of the three strains (Crystal

Springs, Mbizi, and Plumtree) were evaluated by the Western









28

blot assay (see protocol below) using known heartwater positive sera collected from a sheep following an experimental C. ruminantium infection. The pattern of each antigen was evaluated based on the previously determined concentration/ volume calculation from the Lowry protein quantitat ion.

SDS-PAGE and Western blottingi

Protein separation on the basis of molecular weight by SDS-PAGE electro~horesis. Two vertical slab gel units (Hoefer Scientific Instruments, San Francisco, CA) were assembled in the casting mode, using 1.5mm spacers. The separating gel solution (12% SDS-PAGE) was prepared in a 125 ml flask according to Table 1 in the Appendix. The solution was loaded for two gels using a pipet, to a level approximately 3.5 cm from the top of each gel cast. Six hundred microliters of distilled water was then added to the top of each separating gel solution and the apparatus was kept at room temperature for : one hour to allow polymerization. once the gel polymerized, the water was poured of f. The top of the gels were washed once with 1 ml distilled water and the apparatus edges were blotted dry.

The stacking gel solution was mixed in a 50m1 flask

according to Table 1 in the Appendix. The separating gels were rinsed once with the stacking gel solution, and the stacking gel solution was then poured on top of the gel, leaving a 1.75 cm space at the top of each one. A comb was









29

inserted into both solutions and the remaining space was filled with additional stacking gel solution. The apparatus was kept at room temperature for 30 minutes to allow polymerization.

After 30 minutes (once the gels had polymerized) the combs were removed, and the gel tops rinsed once with distilled water and tank buffer. The apparatus edges were blotted dry and the wells filled with tank buffer. The tank buffer was loaded in the chamber and cooled by a refrigerated circulating bath set at 100C.

For each gel, a 10 Al aliquot of the RainbowTm protein molecular weight marker (Amersham, Arlington Heights, IL) was mixed with 10 Al of 2X treatment buffer, heated at 960C for one minute, and placed on ice until use. The antigen, at a concentration of 20 gg per well, was thawed, heated at

960C for five minutes, and placed on ice until use.

The molecular weight marker and antigen were underlaid on the gels using a Hamilton syringe. The gel apparatus was attached to the chamber, the upper buffer chamber filled with tank buffer, the lid placed on the chamber, and set to 100 mAMP for three to four hours to allow separation of proteins to occur. The gels were switched off when the dye front reached the bottom of the gel.

Electrophoretic transfer. The gels were removed from

the apparatus, placed in 200-300 mls of transfer buffer, and incubated for 10 minutes at room temperature. Two









30

nitrocellulose membranes (each cut to the size of one gel) were incubated for 10 minutes in transfer buffer. While the gels and membranes were incubated, the tank was filled with four liters of transfer buffer and the cassettes assembled in a tray containing transfer buffer. The cassettes were assembled in the following order: one side of the cassette on top, foam pad, two sheets of 3MM paper, nitrocellulose membrane, gel, two sheets of 3MM paper, foam pad, and the other side of the cassette. The cassette tray was placed in the buffer chamber with the membrane nearest to the anode and the gel nearest to the cathode. The power lid was connected and set to 20 volts for overnight and then 70 volts for two hours to allow the electrophoretic transfer to occur. The power was disconnected, the membranes removed from the cassette, and marked according to the gel outline.

Immuno-detection of antigens on nitrocellulose. The

membranes were placed on a rocker platform and washed twice for five minutes each in washing buffer (WB) 1. The membranes were then incubated with gentle rocking at room temperature for three hours in WB 1. The membranes were cut into strips, labeled, and placed in individual troughs of a multi-trough apparatus (Biorad Lab., Hercules, CA). Antisera at a 1:100 dilution in WB 1 (30 4l: 2,970 Al) were incubated overnight at room temperature with gentle rocking. One known heartwater positive and negative sheep serum sample were used per blot. The antiserum in WB was poured









31

off and individual strips were washed, using vigorous rocking, twice for 10 minutes each with 2 mls of WB 1. The strips were then pooled and washed twice for 10 minutes in WB 2. The strips were incubated with Protein G-horseradish peroxidase conjugate (HRP)(Zymed Laboratories Inc., San Francisco, CA) at a dilution of 1:500 in WB 2 (60 Al HRP:29,940 Al WB 2), the container was covered with foil, and incubated for two hours at room temperature. Strips were then washed three times for 10 minutes in WB 3, twice for five minutes in WB 2, and once for 15 minutes in WB 4.

Equal volumes of the substrate, 4-chloro-l-napthol, and H202solution (Kirkegaard and Perry Laboratory Inc., Gaithersburg, MD), were added to the strips and incubated to develop the reaction of the antibody and antigens for 15 minutes. The reaction was stopped by pouring off the substrate and rinsing in distilled water. The strips were placed on a pre-wetted glass plate and photographs (Polaroid film, Polaroid Co., Cambridge, MA) taken using a Wild MPS 45 photoautomat unit (Wild Heerbrugg Ltd, Switzerland). Test sera

All sheep and goats used in the xenodiagnosis studies

and tested by the Western blot originated from a heartwaterfree region of Zimbabwe. Any animal with a positive Western blot reaction using serum collected before the C. ruminantium challenge was removed from the study. The presence of C. ruminantium-specific antibodies was









32

determined based on a comparison of Western blot results between pre- and post-challenge serum samples in animals with a negative pre-challenge sample.



Xenodiaqnosis (Small Ruminant Transmission Studies)



Tick transmission studies

Tick Feedings. Uninfected unfed A. hebraeum nymphs and adult males were obtained from laboratory colonies established from original collections made in Zimbabwe (Sengwe strain). The colonies were maintained by feeding on laboratory rabbits and on C. ruminantium, Anaplasma marginale, A. centrale, Theileria parva, and Babesia bigemina negative cattle.

Four hundred uninfected unfed A. hebraeum nymphs and 35 uninfected unfed A. hebraeum adult males were placed in separate cloth bags which were glued to a previously shaven area. Small ruminant tick feeds were performed in tick proof stables at the Veterinary Research Laboratory (VRL) and calf tick feeds were performed in the field. Nymphs were allowed to feed until they engorged and dropped. Bags were checked daily and all replete ticks were collected. Male ticks fed for two to four weeks and then were removed manually. Ticks collected from calves in the field were transported to the VRL in a cool, humidified cooler box.









33

Preparation of nymphal stabilates. Twenty six of the 400 engorged nymphs collected from each calf and one batch of 26 uninfected nymphs were processed by the protocol described by Bezuidenhout (1981) with some modifications. Briefly, the surfaces of the nymphs were washed by placing the ticks in a filter and rinsing for 30 minutes under cold tap water. Nymphs were then surface sterilized in 1% benzalkonium for 10 minutes, 70% ethanol twice for 10 minutes each, 1% sodium hypochlorite for five minutes, and then three times for 10 minutes in sterile distilled water. Sterile nymphs were then placed in a prechilled mortar with four to five mls of Leibovitz's L-15 medium (Gibco, BRL, Gaithersburg, MD) with 3.5% BSA and ground with a pestle. Once the particulate matter settled, the supernatant was removed with a sterile pipette and stored on ice. An adrenalin-coated syringe was used to collect the supernatant. The supernatant within the syringe was kept on ice, for a maximum of 15 minutes, until inoculated intraveously into a susceptible goat (chapter 4). As a negative control, one goat was inoculated with the uninfected A. hebraeum nymphal stabilate. All goats were given an intramuscular injection of 1 mg 9fluoroprednisolone acetate (Predef TM, Upjohn, Transvaal, South Africa) 30-60 minutes before the nymphal stabilate to minimize shock reactions. Goats were monitored as described below.









34

Amblyoma hebraeun adult male tick transmission feeds.

A total of 35-100 adult male ticks, collected from one to three calves, were pooled and fed on an individual susceptible small ruminant. Uninfected males were fed on a separate animal for each feed as negative controls (chapter 4). An area on the dorsum of each small ruminant was shaved and a cloth bag glued directly to the skin (Figure 2-1). Ticks were placed in the bags and the bags were closed with a rubber band. The number of ticks that successfully attached and fed were recorded. Ticks were allowed to feed for four weeks at which time they were removed manually. Transmission of heartwater to susceptible small ruminants was monitored as described below.

Amblyomma hebraeum adult (from engorged nymphs) tick transmission feeds. The number of adult ticks fed on individual susceptible small ruminants varied greatly, especially in the first vertical transmission study (chapter 4). This was due to the poor survival rate of nymphs during the molting period. In the second vertical transmission study (chapter 4), approximately fifty two A. hebraeum ticks, collected from each calf, were fed on an individual small ruminant. However, in this study four of the 13 small ruminants had only five, 10, 25, and 35 ticks fed on them due to the low number of nymphs that molted from four of the experimental calves. As negative controls, one small ruminant had 30 and 52 uninfected A. hebraeum adult ticks









35








































Figure 2-1 Goat used in one of the tick transmission studies
with cloth tick bags glued to its back.









36

fed on it for experiments one and two vertical transmission studies (chapter 4), respectively.

An area on the dorsum of each small ruminant was shaved and a cloth bag glued directly to the skin. Ticks were placed in the bags and a few drops of natural Amblyomma adult male aggregation-attachment pheromone (AAP) were added to the skin to improve tick feeding (Norval et al., 1989). The AAP was prepared by the method of Norval et al. (1991) with the following modifications. Amblyomma hebraeum male ticks that had fed for eight days on a heartwater-free animal were placed in a bottle with equal parts of n-hexane and diethyl ether at a volume of 1 ml per tick and stored at 40C until use.

Transmission of heartwater to susceptible small ruminants was monitored as described below.

Preparation of blood stabilates. tissue culture derived organisms, and tick stabilates for artificial infection of small ruminants. Previously prepared blood stabilates (following the method described below), the Ball

3 vaccine (Onderstepoort Veterinary Institute, South Africa), tissue culture-derived C. ruminantium organisms (Byrom and Yunker, 1990), and tick stabilates prepared from adult field ticks collected from a heartwater-endemic area (following the method described above for nymphal stabilates) were used to infect small ruminants for harvesting infectious blood stabilates (Table 2-1).










37






Table 2-1 Small Ruminant Virulence Studies Using Blood
Stabilates, Tissue Culture-Derived Organisms, and Tick
Stabliates


SPECIES RECIPIENT DONOR AMOUNT B/S' OR TREATMENT'
NUMBER MATERIAL (MLS) B/Cr /OUTCOME
CAPRINE 4813 BALL 3 5 + T/S
VACCINEv
CAPRINE 4800 MBIZI 4706 12 + T/S
CAPRINE 4614 MBIZI 4706 6 + D
CAPRINE 4667 MBIZI 4706 3 + D
OVINE 4733 MBIZI 4800 12 + T/S
OVINE 4735 MBIZI 4703 12 + T/D
OVINE 196 MBIZI 4703 9 + T/S
OVINE 1041 MBIZI 4735 12 + D
OVINE 4703 MBIZI 3 + T/D
94/92 TC"
OVINE 4706 MBIZI 16 + T/D
F91/1 TC
OVINE 4722 MBIZI 3.5 + T/S
F91/1 TC
OVINE 4960 PLUMTREE 26 (ADULT + T/S
TICK TICKS)
STABILATE
OVINE 4931 PLUMTREE 3 + D
4960

B/S B/S brain biopsy smears; B/Cr brain crush smears
TREATMENT 3 days of intramuscular oxytetracycline (10mg/kg per day)
beginning on the third day of fever; T-treated; S-survived;
D-died
'VACCINE The Ball 3 vaccine is an ovine blood stabilate prepare by
Ondestepoort Veterinary Institute, South Africa TC Tissue culture-derived organisms









38

Preparation of blood stabilates and tissue culturederived organisms. Blood stabilates were prepared as described by Oberem and Bezuidenhout (1987b) with modifications. Three to four hundred mls whole blood were collected by jugular puncture from sheep, during the febrile period following an experimental heartwater infection. Blood was collected into a flask containing 5,000 IU heparin/100 ml blood. All sheep were confirmed heartwater positive by the presence of C. ruminantium in Giemsa stained brain biopsy smears at the time of blood collection, and post-mortem gross lesions consistent with heartwater (Prozesky, 1987) and C. ruminantium positive Giemsa stained brain crush smears (Purchase, 1945) in those animals that succumbed to infection. Blood was kept on ice, and dimethylsulphoxide (DMSO) (to 10% as a cryopreservative) was added drop wise with continual stirring. The blood was stirred manually for an additional five minutes and aliquoted into 5 ml cryoprotective tubes. Blood stabilates were placed at -200C for 20 minutes and overnight at -800C. The following day, blood stabilates were transferred to liquid nitrogen until use.

All stabilates with tissue culture-derived C.

ruminantium organisms were prepared using the protocol of Byrom and Yunker (1990).

Animal inoculations. Blood stabilates or tissue

culture-derived C. ruminantium organisms were removed from









39

the liquid nitrogen and slowly thawed in a 370C water bath. Before using a batch of stabilate in this dissertation research, different volumes were inoculated into individual susceptible small ruminants to determine the minimal volume necessary for a lethal dose (Table 2-1). The volume deemed the most appropriate was aspirated into an adrenalin-coated syringe and inoculated intravenously into the jugular vein of an experimental animal (Table 2-2) (chapter 5). Blood stabilate challenge was also used as an immunity test of small ruminants in the various xenodiagnosis studies to determine whether they had developed immunity following initial infection (Table 2-2). Nine of the animals used in the vertical transmission experiment one were re-challenged three months after the initial challenge. Twenty eight of the animals used in the vertical transmission experiment two were re-challenged two to four months following the initial challenge. Calves and small ruminants were monitored as described below.

Colostral cells transmission studies. Colostrum,

pooled from all four teats into 15 ml polypropylene tubes (Corning Inc., Corning, NY), was collected from dams within 36 hours of parturition. Four tubes per dam were immediately spun 1100 X g for 20 minutes. The supernatant was discarded and cells were resuspended in 2.5 mls Leibovitz's L-15 medium (Gibco, BRL, Gaithersburg, MD), 2.5 mls Fetal Bovine Serum (Hyclone R Laboratory Inc., Logan,











40











Table 2-2 Blood Stabilates and Tissue Culture-Derived Organisms
for Infecting Experimental Calves and Small Ruminants


EXPERIMENTAL CHALLENGE AMOUNT CHALLENGE
ANIMALS MATERIAL (MLS) TIME PERIOD

SMALL RUMINANTS MBIZI 3 3 MONTHS
FOR EXPERIMENT 1 BLOOD STABILATE AFTER INITIAL
VERTICAL 4706 CHALLENGE
TRANSMISISON

SMALL RUMINANTS PLUMTREE 3 2-4 MONTHS
FOR EXPERIMENT 2 BLOOD STABILATE AFTER INITIAL
VERTICAL 4960 CHALLENGE
TRANSMISSION

PRELIMINARY MBIZI F91/1 TC- 3.5 3 DAYS OLD
IMMUNITY CALVES
3 DAY CHALLENGE MBIZI 4703 B/Sb 12 42 DAYS OLD

PRELIMINARY MBIZI 12 6-9 WEEKS
IMMUNITY CALVES BLOOD STABILATE OLD
6-9 WEEK 4706
CHALLENGE

FINAL MBIZI 4706 B/S 12 3 DAYS OLD
IMMUNITY CALVES
3 DAY MBIZI 4706 B/S 12 42 DAYS OLD
CHALLENGE

FINAL BALL 3 5 6-9 WEEKS
IMMUNITY CALVES VACCINEv OLD
6-9 WEEK CHALLENGE


ITC Tissue culture-derived organisms
NB/S Blood stabilate

VACCINE The Ball 3 vaccine is an ovine blood stabliate









41

UT), and 0.55 ml DMSO (to 10% as a cryopreservative) per

tube. Tubes were kept f or 20 minutes at 40C, overnight on dry ice, and then placed in liquid nitrogen. As a negative control, colostrum from a dam located in a heartwater-free area (Kintyre Estates Dairy, Norton, Zimbabwe) was collected in a similar manner.

The colostral cell samples were thawed at 370C and kept on ice, for a maximum of 15 minutes, before use. The cells were either pooled, two to three dams, or kept separate for inoculating into susceptible Boer goats (Table 2-6). A trypan blue exclusion test for the determination of cell viability was performed using a 1:1 dilution of the colostral cell suspension and trypan blue in a 1% PBS solution. After determining viablity of the cells, the samples were aspirated in a syringe coated with adrenalin and inoculated intravenously into susceptible Boer goats (Table 2-6). The goats were monitored as described below. Methods for monitoring experimental animals

Rectal temperatures and clinical signs were monitored daily in all small ruminants used in the transmission studies (chapter 4) and in calves challenged in the immunity studies (chapter 5). Brain biopsies were performed on the third day of fever in reacting small ruminants and Giemsa stained brain smears were examined for the presence of C. .ruminantium colonies in capillary endothelial cells. The procedure was similar to Synge (1978) with the following









42

modifications. The entire dorsum of the sheep or goat's head was shaved. A point was marked, 0.5 cm anterior to a horizontal line, between the ears, and 0.5 cm to either side of the midline. The skin was cleaned with 70% ethanol and local anesthesia induced with a subcutaneous injection of 40 mg lignocaine hydrochloride. Adequate anesthesia was assessed by needle pricks of the skin, and then a scalpel blade was used to make an incision through the skin until the surface of the skull was reached. Skin and subcutaneous tissue were pulled aside and a hand held electric drill was used to drill a hole through the bone. A 14-gauge needle was inserted through the hole and into the cerebral cortex. A 10 ml syringe was fitted to the needle and negative pressure was produced, aspirating brain tissue into the syringe. The needle was swiftly removed from the hole and the surgical site cleaned with 70% ethanol and sprayed with a broad spectrum antibiotic wound spray. The material was removed from the syringe and blood was cleared from the tissue using a paper towel. Brain tissue was squashed between two microscope slides as described by Leeflang (1972). After slides had air dried they were fixed with methanol and stained with Giemsa. The presence of C. .ruminantium in capillary endothelial cells was assessed using a light microscope under oil immersion.

A post-mortem examination consisting of gross lesion identification and Giemsa stained brain crush smears was









43

performed on all cattle, sheep, and goats that succumbed to infection. Brain crush smears were obtained by removing the

brain from the skull. A 0. 5 cm2 wedge of tissue was cut (in the same region described for brain biopsy) and processed by the method described by Leeflang (1972). All Giemsa stained brain biopsy smear and brain crush smear slides were coded to avoid bias.

Serology for sheep. goats. and cattle. The Western

blot was used for testing small ruminant sera. The IFAT was used for testing adult and calf sera. The positive reciprocal cut-off values were 2: 80 in adults and 2: 20 in calves based on the results from the validation study (see results) and from Semu et al. (1992) and Norval et al. (1994).

Immunity challenges for sheep and goats. A total of 52 small ruminants that survived the initial challenge in the xenodiagnosis studies were re-challenged two to four months later with a C. ruminantium blood stabilate (Table 2-2).



Results



Indirect Fluorescent Antibody Test



A 1:20 conjugate dilution and 0.1% Evans blue

concentration were determined to be the best combination for









44

fluorescent staining of positive sera and differentiation of negative versus positive sera.

Table 2-3 shows the results from the validation study of the five separate antigen batches tested using the 25 adult sera. The antibody titers of the known positive sera are also indicated. In Figure 2-2 IFAT negative (A) and positive (B) photographs are depicted.

The estimated sensitivity and specificity, with

associated 95% confidence limits, of the IFAT using adult sera are presented in Table 2-4A and 2-4B, respectively. Specificity of each of the five antigen batches was 100% with a lower confidence limit of 81.6%. The sensitivity of individual antigen batches was 76.92% for batches 2 and 4 and 92.31% for batches 1, 3, and 5, with confidence limits of 48.00% 93.40% and 67.30% 99.20%, respectively. The overall sensitivity was 86.15% with confidence limits of 77.80% 94.55%. In the dissertation research each study, in which IFAT were conducted, was based on slides from a single antigen batch. Therefore, all Mbizi calves were tested using batch 2 (76.92% sensitivity), Glenara calves using batch 1 (92.31% sensitivity), and Manifest calves using batch 5 (92.31% sensitivity).

The specificity and the associated 95% confidence

limits of the IFAT using calf sera are presented in Table 25 using slides with uninfected (to test background noise) and infected (to test cross-reactions) cells. Individual










45


Table 2-3 Validation Study of the Indirect Fluorescent Antibody
Test Using Adult Cattle Sera


ANIMAL IFAT BATCHb 1 BATCH 2 BATCH 3 BATCH 4 BATCH 5
CODE TITER* 40'/ 80 40 /80 40 /80 40 /80 40 /80
UF18 -/- -/- -/- -/UF5 -/- -/- -/- -/- -/UF 26 -/- -I- -/- -I- -IUF41 -/- -/- -/- -/UF 6 -/- -/- -/- -/- -lUF 17 -/- -/- -/- -/UFl0 -/- -/- -/- -/- -/UF34 -/- -/- -/- -/UF 14 -I- -I- -I- -IUF33 -/- -/- -/- -/- -/UF 13 -I- -I- -I- -IoF 15 -/ -/ --/

032 512 +P /+ + + + + + + + +
028 256 + + + + + + + + + +
037 512 + + +/- + + + + + +
4334 80 + + + + + + + + + +
88052 256 + + + + + / + +/- + +
010 128 + + +1- + + + + + +
949 128 + + + + + + -/- +/+
4344 256 + + +/4+ -+- +/- + +
156 512 + + +/ + + + + /+ + +
4289 128 +/- +/- -1+ + + + +
016 256 + + + + + + + + + /+
020 80 + + + /+ + /+ + /+ + /
056 128 + + + /+ + / + + / + + / +
bBATCH Batches 1,2,3, and 4 are C. ruminantium Mbizi antigen; batch 5 is
C. ruminantium Crystal Springs antigen
*TITER Previously determined reciprocal antibody titers (Semu et al.,
1992)
'40 1:40 dilution; 80 = 1:80 dilution; "-= negative; P+ = positive





























Figure 2-2 Indirect fluorescent antibody test.
A) Negative fluorescence on Cowdria ruminantium
infected bovine aortic endothelial cell antigen
with pre-infection bovine sera;
B) Positive fluorescence on intracellular Cowdria
ruminantium organisms (solid arrow) and on
extracellular Cowdria ruminantium organisms (open
arrow) with post-infection bovine sera.










47









48











































Figure 2-2 continued










49






Table 2-4 Statistics for the Indirect Fluorescent Antibody Test
Validation Using Adult Cattle Sera


(A) Sensitivity with the Associated 95% Confidence Limits


ANTIGEN SAMPLE SENSITIVITY 95% LOWER 95% UPPER
BATCH* SIZE CONFIDENCE CONFIDENCE
LIMIT LIMIT

1 13 92.3% 67.3% 99.2%
2 13 76.9% 48.0% 93.4%
3 13 92.3% 67.3% 99.2%
4 13 76.9% 48.0% 93.4%
5 13 92.3% 67.3% 99.2%
AGGREGATED- 65 86.2% 77.8% 94.6%
OVERALL

*Batch Confidence limits for batches 1 5 were calculated from a table
of confidence limits for proportions, at a 95% confidence and for the aggregated-overall batch using the formula P +/- 1.96 V P(lP)/n.


(B) Specificity with the Associated 95% Confidence Limits

ANTIGEN SAMPLE SPECIFICITY 95% LOWER 95% UPPER
BATCH SIZE CONFIDENCE CONFIDENCE
LIMIT LIMIT

1 12 100% 81.6% 100%
2 12 100% 81.6% 100%
3 12 100% 81.6% 100%
4 12 100% 81.6% 100%
5 12 100% 81.6% 100%
AGGREGATED- 60 100% 100% 100%
OVERALL











50



















Table 2-5 Statistics for the Indirect Fluorescent Antibody Test
Validation Using Cowdria Infected and Uninfected Cells
and Calf Sera


CALF SAMPLE SPECIFICITY 95% LOWER 95% UPPER
SERA* SIZE CONFIDENCE CONFIDENCE
LIMIT LIMIT

POOLEDc 40 92.5% 84.4% 100%
HEARTWATER- 25 92.0% 76.2% 98.6%
ENDEMIC
HEARTWATER- 15 93.3% 69.8% 99.7%
FREE

*SERA Confidence limits for the pooled sera were calculated using
the formula P +/- 1.96 V P(1-P)/n and for the heartwaterendemic and heartwater-free sera using the table of
confidence limits for proportions, at a 95% confidence.

TOOLED Pooled sera were tested using slides with uninfected cells
and heartwater-endemic and heartwater-free sera were tested
using slides with Cowdria-infected cells.









51

specificities for the heartwater-endemic and heartwater-free calf sera, using infected cells as antigen, was 92.00% with confidence limits of 76.20% 98.60% and 93.33% with confidence limits of 69.80% 99.70%, respectively. The difference between specificity for calves located in these two regions was not statistically significant based on Fisher's exact test (p = 1.00).



Western Blot


The BSA standard curve with absorbance plotted against the protein concentration is shown in Figure 2-3. From this curve, the protein concentration was determined for the three strains. The protein concentration of the C. ruminantium Crystal Springs, Mbizi, and Plumtree stocks were

1.48 Ag/l, 1.14 Ag/M1, and 0.96 Ag/l, respectively. Twenty micrograms of antigen per well were used in all Western blot assays. Based on the estimated protein concentration and the 1:1 dilution of antigen in sample buffer, a total of 27 Al, 35 Al, and 41.6 Al were loaded on to gels for Crystal Springs, Mbizi, and Plumtree, respectively. The initial evaluation of antigenic patterns for the three strains is presented in Figure 2-4.

Figures 2-5A and 2-5B are examples of Western blot results of pre- and post-challenge sera from two small ruminants experimentally infected with C. ruminantium. In








52













0.7
Legend
0.6 1 = Plumtree 3
2 = Mbizi
0.5-- 3 = Crystal Springs 2

0.4
-e
0
v 0.3

0.2

0.1

0 I I I I I I I
0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2 Protein [mg/mQ



Figure 2-3 Bovine serum albumin standard curve by
Lowry's assay. Bovine serum albumin absorbance plotted against protein concentration with extrapolated Crystal Springs, Mbizi, and Plumtree Cowdria ruminantium Zimbabwean strains.









53





A B C


97400


S 69000 46000








Cr32- 30000



,



-21 500






Figure 2-4 Western blot evaluation of the antigenic
patterns for the three Cowdria ruminantium
Zimbabwean strains: (A) Crystal Springs, (B) Mbizi, (C) Plumtree. Molecular mass markers in Daltons are indicated on the
right.




























Figure 2-5 Western blot analysis with sera from goats living
in a heartwater-free region of Zimbabwe and
challenged with Cowdria ruminantium.
A) No cross-reactions in pre-challenge sera.
Lane 1, positive control serum; lane 2, negative
control serum; lane 3, pre-infection serum and
lanes 4,5,6, and 7 are 3,6,9, and 12 weeks postinfection sera. Molecular mass markers in Dalton
are indicated on the left;
B) Cross-reactions in pre-challenge sera. Lane 1,
positive control serum; lane 2, negative control
serum; lane 3, pre-infection serum and lanes
4,5,6, and 7 are 4,6,12, and 16 weeks postinfection sera. Molecular mass markers in Dalton
are indicated on the left.











55



1 2 3 4 5 6 7



200 000



97400 69000



46000








30000






21 500






1-4300










56


1 2 3 4 5 6 7


20000097400 69000




46 0003000021 500






14300Figure 2-5 continued









57

Figure 2-5A, the pre-challenge serum is negative and the post-challenge sera are positive. However, in Figure 2-5B both pre- and post-challenge sera are positive, demonstrating the problem with false positives.



Xenodiagnosis



Intravenous nymphal stabilates

Of the 13 small ruminants inoculated with nymphal stabliates, of which 12 received nymphs collected from experimental calves and one received uninfected unfed laboratory-reared nymphs as a negative control, a mild anaphylactic shock response was noted in one animal within five minutes of the inoculation. Anaphylactic signs, including facial and periocular swelling, nervousness as demonstrated by pacing, and tachycardia, were all eliminated by administering an IV dose of 0.5 ml 1:1000 adrenalin with

3 mg PredefTm and an intramuscular injection of 2 mg PredefTm.

Cowdria ruminantium transmission was confirmed in three of the 12 inoculated small ruminants by one or more of the following methods; Western blot, Giemsa stained brain biopsy smear and/or brain crush smear, and post-mortem examination (chapter 4). No transmission occurred in the negative control animal.









58

Ambiyomma hebraeum adult male tick feeds

The male ticks attached quickly and efficiently to both the calves in the field and the susceptible small ruminants in the laboratory. One problem with the field tick feeds was that males feeding on the calves attracted field A. hebraeum ticks by the production of AAP (Norval et al., 1989). For this reason, the actual male feeding period on calves was shortened to two weeks (from a planned feeding period of four weeks) to ensure no Amblyomma field ticks attached to the calves. Out of a total of five small ruminants that had adult male ticks (collected from the calves) fed on them, C. ruminantium transmission was confirmed in one sheep by seroconversion, detected by the Western blot, and positive Giemsa stained brain biopsy smears (chapter 4). No transmission occurred to the negative control animal. Amblyomma hebraeum adults (from engorged nvmDhs) tick feeds

Adult ticks did not attach well to six of the 13

susceptible small ruminants used in the study. Additional natural AAP was placed on the skin, near the ticks, every other day until attachment of all live ticks was noted.

Of the 12 small ruminants (one of the 13 small

ruminants had uninfected control ticks fed on it) that had adult ticks fed on them, C. ruminantium was confirmed in four animals by one or more of the following methods; Western blot, Giemsa stained brain biopsy smears and/or









59

brain crush smears, and post-mortem examination (chapter 4). No transmission occurred to the negative control animal. Intravenous inoculation of blood stabilates. tissue culturederived organisms stabilates. and tick stabliates

Table 2-1 shows the results from the initial small

ruminant virulence studies. A total of six blood stabilates and one stabilate with tissue culture-derived organisms were used in the immunity studies of calves and the immunity tests of susceptible small ruminants (Table 2-2).

Few calves challenged in the immunity studies (chapter 5) succumbed to challenge. I concluded that the original virulence testing in small ruminants had been sufficient for determining appropriate volumes for these studies.

The results from the small ruminant immunity tests were not valid. Only four of the 37 animals tested survived the challenge. Of these four animals only two had been confirmed C. ruminantium positive following the initial challenge, whereas a number of the animals that succumbed to the immunity test challenge had been confirmed C. r-uminantium positive following the initial infection. For this reason, I concluded that the immunity test was not valid and therefore excluded it from the actual dissertation research.

Intravenous inoculation of colostral cells

No shock reactions were noted in any of the six small ruminants that were inoculated with colostral cells. The









60

number of viable cells injected into individual small ruminants ranged from 2.37 X 105 to 1.9 X 106 (Table 2-6).

In the five animals (not including the negative

control) inoculated with viable colostral cells, three were confirmed C. ruminantium positive by Western blot, Giemsa stained brain smears and/or brain crush smears, and/or postmortem examination (chapter 4). No transmission occurred to the negative control.

Animal monitoring

Any febrile response of >400C, >400C, or >40.50C for two or more consecutive days in cattle, goats, or sheep, respectively, was considered to indicate a reaction to C. ruminantium infection. The most common clinical signs recorded in experimental animals were fever, tachypnea, dyspnea, anorexia, listlessness, diarrhea, petechiae on conjunctival and mucous membranes, nervous signs including mild incoordination to pronounced convulsions, head tremors, nystagmus, and terminal paddling. A sheep in the characteristic paddling position, associated with the terminal stage of heartwater, is shown in Figure 2-6.

Post-mortem examination often provided confirmational evidence of heartwater infections. The lesions most commonly observed in the small ruminants and calves in the dissertation research were hydropericardium, hydrothorax, ascites, and abomasal congestion and petechiae. Gross lesions were much more subtle or nonexistent in experimental











61















Table 2-6 Small Ruminant Intravenous Inoculations of Viable Cells
Collected From The Colostrum of Dams Living in a
Heartwater-Endemic Area



DAM AMOUNT VIABLE GOAT WESTERN BRAIN POSTNUMBERS OF CELLS/ NUMBER BLOT BIOPSY MORTEM
INOCULUM ML SMEAR AND BRAIN
(MLS) CRUSH
SMEAR

99 20 7.4 X 4839 + NA' NA
105
35,34,31 25 1.9 X 4639 NA NA NA
106
87,95 20 8.4 X 4819 NA + NA
105

81,91 26 2.4 X 4821 -NA NA


9 26 5.2 X 4822 NA NA +


CONTROL 26 1.0 X 4836 -NA NA
106


aNA Not applicable (due to cross-reactions with pre-challenge sera f or
Western blot, no reaction for brain smear, and no death for post-mortem)









62
































Figure 2-6 Sheep demonstrating the characteristic paddling
position associated with central nervous system
abnormalities during the terminal stage of
heartwater.

Source: Barre, N. 1989. Biologie et ecologie de la tiue
Amblyomma variegatum (Acarina: Ixodina) en
Guadeloupe (Antilles Francaises). PhD Thesis,
Univerite de Paris-Sud Centre D'orsay.









63

animals infected with the Mbizi strain. This was true even for animals confirmed C. ruminantium positive by Giemsa stained brain crush smears and/or Western blot seroconversion.

A definitive ante-mortem and post-mortem diagnosis of heartwater infection can be made based on the detection of C. ruminantium organisms in capillary endothelial cells of Giemsa stained brain smears and brain crush smears, respectively. Cowdria ruminantium organisms located in the capillary endothelial cells of a heartwater positive animal are depicted in Figure 2-7. In the dissertation research, any live or dead animal with C. ruminantium organisms detected in capillary endothelial cells of brain tissue was recorded as heartwater positive. However, animals that were C. ruminantium negative on Giemsa stained brain smears and/or brain crush smears were not stated as heartwater negative unless all other tests were negative.

The results from the serological tests used for

monitoring animals, IFAT in cows and calves and Western blot in small ruminants are presented in chapters 4 and 5. Both these tests were performed as described in the IFAT and Western blot sections of this chapter. It should be noted that a total of 20 of the 52 small ruminants tested by the Western blot could not be assessed by this method due to false positives in the pre-challenge sera (see discussion). The outcome of the immunity tests of small ruminants in the










64




































01
2ii'


















Figure 2-7 Giemsa stained brain biopsy smear of Cowdria
ruminantium organisms located in the capillary
endothelial cells of a heartwater positive animal.









65

xenodiagnosis studies is presented in the section on IV blood stabilate and tissue culture-derived organisms (see above).


Discussion


All tests presented in this chapter with the exception of the IV inoculation of colostral cells have been described in the literature; IFAT (Semu et al., 1992), Western blot (Mahan et al., 1993), nymphal stabilate (Bezuidenhout, 1981; Oberem and Bezuidenhout, 1987b; Bezuidenhout, 1989), tick transmission feeds (Norval, 1981; Jongejan et al., 1988; Andrew and Norval, 1989a; Norval et al., 1990), and blood stabilates and tissue culture-derived organisms (Oberem and Bezuidenhout, 1987b; Byrom and Yunker, 1990). I employed a range of diagnostic tests in my dissertation research to provide the sensitivity required for the detection of low levels of C. ruminantium, which I assumed would be present if neonatal calves are initially infected by vertical transmission. Problems associated with the interpretation of diagnostic test results were minimized. For example, if cross-reactions were noted on a Western blot using prechallenge sera, the animal was not evaluated by this test. Secondly, in the chapter 4 small ruminant/tick transmission studies some animals were confirmed infected with C.









66

ruminantium by positive results from diagnostic tests done in parallel.

The IFAT was used as a marker of C. ruminantium exposed and non-exposed dams. I chose a 80 reciprocal titer as the cut-off value for heartwater exposed dams based on the 100% specificity result in the validation study and the previous work establishing 80 as the cut-off value (Semu et al., 1992). However, it should be noted that the negative test sera in the validation study were from Florida, a heartwater-free region geographically distinct from the region of study in Zimbabwe. Cross-reactions are still a problem with related organisms in cattle sera from Zimbabwe (de Vries et al., 1993; Mahan et al., 1993). In this research, all dams from heartwater-free areas had negative IFAT results, so it can be concluded that cross-reactions were not a problem in confirming the heartwater-free status of non-exposed dams.

A more probable limitation to the IFAT would be a low sensitivity. It has been noted by de Vries et al. (1993) that the C. ruminantium-specific antibody titer is often relatively low in sera collected from dams living in heartwater-endemic areas and known to be exposed to C. ruminantium. My own experience confirmed this. In the validation study, the overall sensitivity of the five antigen batches was 86.15% (95% confidence limits of 77.80% and 94.46%) using known positive sera collected from









67

experimentally infected dams. It has been noted that experimentally infected dams will have higher titers, on the average, than dams living in heartwater-endemic areas (de Vries et al., 1993; S.L. Deem, unpublished data). Therefore, the sensitivity of the IFAT was probably lower in the studies conducted for specific aims #2 and #3 than determined in the validation study.

For the detection of maternally-derived and calf

produced C. ruminantium-specific antibodies in calves, the pre-colostral blood of each individual calf served as a negative control for that calf. Based on this validation study a positive cut-off value of 20 was determined for neonatal calf sera. It must be noted that validating the specificity of the IFAT using pre-colostral calf sera is based on an assumption that neonatal calves are born without Cowdria-specific antibodies. The validation work in this research and the work by Norval et al. (1994) would support such a claim.

All 40 calf serum samples, 25 from heartwater-endemic areas and 15 from a heartwater-free area, were pooled into one group for validation of the IFAT using the uninfected cells. This was based on the assumption that geographic location did not influence components in calf blood that might cause non-specific background noise with the uninfected bovine aortic endothelial cells. However, the sera from calves living in the heartwater-free versus









68

heartwater-endemic areas were statistically analyzed separately for the IFAT using the C. ruminantium infected cells. This was based on the assumption that the calves living in the heartwater-free area were located on a farm with intensive tick control and thus were less likely to have exposure to organisms that possibly cross-react with Cowdria. No demonstrable difference between the specificity of calves from the heartwater-free and heartwater-endemic areas (Fisher's exact test; p = 1.00) was noted suggesting the location of the calves was not of importance as initially assumed. The overall specificity for all 40 calf sera, using infected cells, was 92.50% with 95% confidence limits of 84.34% 100.00%.

Cross-reactions with the Western blot have been a

problem, most likely associated with Ehrlichia organisms. To overcome this limitation, results from the Western blot were recorded as positive only if the pre-challenge serum (collected before the small ruminant received potentially C. ruminantium infectious material in the xenodiagnosis studies) was negative and either of the two post-challenge sera was positive. This test interpretation method is based on the assumption that the material administered to each small ruminant (Amblyomma ticks and colostral cells) does not contain other agents which would elicit an immune response that cross-reacts with C. ruminantium. I felt this was a valid assumption since A. hebraeum is not known to









69

transmit any Ehrlichia species (Rikihisa, 1991) and there are no documented cases of transmission of southern African bovine Ehr-lichia species via colostrum. Unfortunately, it was not until late in the research that the problem of cross-reactions was fully appreciated. Therefore, although pre-challenge sera were collected, they were not tested until after the transmission studies were in progress. A total of 20 of the 52 small ruminants tested by the Western blot could not be assessed by this method due to false positives.

Tick transmission studies have been used in the past to detect C. ruminantium antigen in carrier animals and are often used as a "gold standard" in research directed at developing new C. ruminantium diagnostic tests (Waghela et al., 1991; Yunker et al., 1993; Peter et al., 1994). A positive transmission is definitive evidence of C. .ruminantium infection. The major disadvantages of this test and other xenodiagnosis methods are the labor, money, and time required to perform them. Additionally, although it is theoretically possible to infect a susceptible small ruminant with a single C. ruminantiun organism, the real sensitivity of these tests remains unknown. In this dissertation research, I increased the probability of detecting C. ruminantlum in neonatal calves by performing a variety of small ruminant transmission studies in parallel for each calf.









70

The individual transmission methods also have

disadvantages unique to each test. For example, the IV inoculation of nymphal stabilates can cause anaphylactic shock (Alexander, 1931; Van der Merwe, 1987) and thus is limited by the amount of tick material that can be inoculated into one animal. I minimized this problem by pre-treating each animal with corticosteroids and inoculating animals using adrenalin-coated syringes and material from a low number of ticks.

The tick transmission studies presented in the

literature are often performed by feeding nymphs on the animal of unknown heartwater status, allowing the nymphs to molt to adults, and feeding the adults on a susceptible small ruminant. This method takes advantage of the concentrating effect noted in nymphs (Andrew and Norval, 1989a) and the transtadial transmission from nymphs to adults. Tick attachment on the susceptible small ruminants can be a problem associated with this test. The adult tick feeds in this study were improved by adding natural AAP directly to the skin near the ticks.

The number of adult ticks that should have been fed on an individual small ruminant to be 99% confident of detecting C. ruminantlum if a calf was infected can be calculated using the equation from Cannon and Roe (1982):

n -_(1- (1-) ') (N-d/ 2) + 1,









71

where:

N population size

d number of positives in the population

a desired confidence level (probability of

finding at least one positive in the sample) For N=400 nymphs fed on calves, n=40 based on a prevalence of 10% (Norval et al., 1990) and a=0.01, the required number for n is 42. Unfortunately, this number was not achieved for all animals in the transmission studies (chapter 4). Therefore, the small ruminant transmission studies using adult ticks probably underestimated the number of calves infected by vertical transmission.

The male tick feed studies were attempted to take

advantage of the continual, long-term, intermittent feeding pattern observed in Amblyomma males (Norval, 1974; Jordaan and Baker, 1981; Andrew and Norval, 1989b). One disadvantage of this method, was the production of AAP from the attached males which attracted field ticks to the experimental calves. For this reason, the male tick feeding periods on the calves had to be aborted early to ensure field ticks did not attach to the calves.

The IV inoculation of small ruminants with colostral

cells was utilized to determine whether colostrum can serve as a route for vertical transmission of C. ruminantium. The original hypothesis was based on the fact that Cowdria is present in circulating leukocytes in the blood of host and









72

that these infectious cells could be among the population of cells in bovine colostrum, which is known to include neutrophils and macrophages (Lee et al., 1980). In support of this hypothesis is the finding that cells do cross the gastrointestinal epithelium of newborn lambs (Schnorr and Pearson, 1984) and newborn piglets (Tuboly et al., 1988) and therefore can play a significant role in transmitting C. .ruminantium infection to neonates.

In the dissertation research (chapter 4) I showed that colostral cells collected from dams living in a heartwaterendemic area are infected with C. ruminantium. Due to logistical constraints associated with experimental conditions in Zimbabwe I elected to infect susceptible small ruminants by IV administration of the colostral cells. The positive transmission of C. ruminantium to inoculated small ruminants demonstrates that colostral cells can be infectious. Future studies must now address whether neonatal calves can become infected by the oral route from suckling their dams.

Experimental C. ruminantium challenge using blood stabilates, tissue culture-derived organisms, and tick stabilates can be employed to determine whether an animal has passive/innate immunity, as in calves, or has been previously infected with the agent and has acquired an immunity. This latter point is based on the fact that animals recovered from heartwater infection possess an









73

immunity upon recovery, although the exact period of immunity is unknown (Alexander, 1931; Uilenberg, 1983). In this study, a crude estimate of the stabilate virulence was determined before challenging calves and small ruminants, to minimize the possibility of using a dose that would overwhelm the immune system. Unfortunately, in the small ruminant immunity tests the rechallenge dose appears to have been too high or outside the period of immunity following recovery. This is supported by the fact that many of the animals that were definitively diagnosed as heartwater positive to the initial infection succumbed following rechallenge. Alternatively, although homologous stocks were used for the challenges, it is possible that antigenic variation within stocks was present.

An important aspect of the interpretation of small

ruminant transmission studies is the ability to confirm if C. ruminantium transmission occurred. The application of many different tests ( Giemsa stained brain biopsy and brain crush smears, Western blot, and post-mortem gross examination, as methods for monitoring the small ruminants) improved the sensitivity and ensured a definitive diagnosis for the C. rurninantium infection status of each calf. The detection of C. ruminantium organisms in capillary endothelial cells of Giemsa stained brain smears and brain crush smears is definitive diagnosis of heartwater infection. However, C. r-uminantium is often difficult to









74

detect in brain tissue from heartwater positive animals if the animal has a low level of infection (sub-acute clinical disease), the biopsy is not performed at the critical period, or if the brain tissue obtained is of poor quality (S.L. Deem, personal observation). Additionally, Giemsa stained brain crush smears can be negative in animals that die acutely or if a non-representative tissue sample is obtained (S.L. Deem, personal observation). Therefore, if C. ruminantium was not detected in Giemsa stained brain smears or brain crush smears the animal was assessed on the outcome of other diagnostic tests. In addition to the detection of C. ruminantium in capillary endothelial cells, confirmation of seroconversion by the Western blot assay and the presence of various lesions detected at post-mortem examination are highly suggestive of heartwater infection.

The final method of monitoring susceptible small ruminants, observation for clinical signs and febrile response, did not provide conclusive evidence. The infectious material inoculated into small ruminants probably contained low numbers of C. ruminantium organisms which often resulted in mild to no clinical signs or fever, consistent with subclinical infections (Van de Pyperkamp and Prozesky, 1987). Therefore, a negative result in these two measurements was of little value, whereas a positive result was highly suggestive of heartwater infection.









75

The most sensitive diagnostic test used in this research was the PCR on Amblyomma ticks that had fed directly on experimental calves. The optimization and validation of this test is presented separately in great detail in chapter 3. The PCR has been shown to detect one to 10 C. rumlnantium organisms using C. ruminantium genomic DNA and has also been shown to be highly specific (Peter et al., 1994). The high sensitivity of the PCR should make it a good candidate as the new "gold standard" for the detection of C. ruminantium in live animals. A greater sensitivity of the PCR over small ruminant/tick transmission methods is exemplified in chapter 4 in which one or more Cowdria positive tick was detected in 11 of the 12 and five of the 12 calves, respectively, using the two tests. Additionally, the lower input of labor, time, and money associated with the PCR make this test more feasible than xenodiagnosis for large-scale epidemiological studies. Advancements in molecular diagnostic tests, particularly the development of a PCR assay f or detecting C. r-uminantium directly in the blood of carrier animals, will greatly enhance epidemiological studies in the future.

The scientific value of any epidemiological study is directly dependent on the diagnostic tests employed. In this chapter I have presented the tests employed throughout the research, noting the advantages and disadvantages of individual tests, and the methods I used to ensure tests









76

were appropriately interpretated. This initial work was essential for accomplishing the overall dissertation objective which was to answer two important questions on calfhood C. ruminantium infection and immunity as they relate to the epidemiology of heartwater.














CHAPTER 3
A COMPARISON BETWEEN THE pCS20 DNA PROBE AND
THE POLYMERASE CHAIN REACTION IN DETECTING
COWDRIA RUMINANTIUM IN AMBLYOMMA HEBRAEUM TICKS



Introduction



One of the major obstacles to the study of heartwater has been the lack of a suitable diagnostic test for detection of C. ruminantium in both vertebrate hosts and Amblyomma tick vectors. Presently the tests available for detecting C. ruminantium-specific antibodies in hosts are non-specific and/or have low sensitivity (Jongejan, 1991; de Vries et al., 1993; Mahan et al., 1993). The two common methods for detecting C. ruminantium organisms in clinically infected animals (subinoculation of blood into susceptible small ruminants and the demonstration of colonies in the capillary endothelial cells of the brain), are impractical for routine ante-mortem diagnosis. Similarly, it has been extremely difficult to detect C. ruminantium in the Amblyomma tick vectors. Previous diagnostic methods that have been used to detect the organism in ticks are small ruminant/tick transmission feeds (Andrew and Norval, 1989a; Norval et al., 1990), inoculation of nymphal stabilates into susceptible small ruminants (Bezuidenhout, 1981) and mice 77









78

(Du Plessis, 1985), detection of colonies in tick midgut tissue by electron microscopy (Bezuidenhout, 1984; Kocan et al., 1987) and light microscopy (Bezuidenhout, 1984; Yunker et al., 1987), enzyme-linked immunosorbent assay on various tick organs (Neitz et al., 1986), and fluorescent antibody tests (Bezuidenhout, 1984). All these methods have limitations, due to impracticalities of time and labor, expense, and/or unacceptable sensitivity and specificity, which precludes their use in large-scale epidemiological studies.

Two tests, a DNA probe and a PCR assay, have been

developed for detecting C. ruminantium in Amblyomma ticks (Waghela et al., 1991; Mahan et al., 1992; Yunker et al., 1993; Peter et al., 1994) and in experimentally infected small ruminants (Mahan et al., 1992). Presently, the DNA probe that has shown the best specificity and sensitivity is a cloned 1,306 base pair (bp) insert from the C. ruminantium DNA of the Crystal Springs Zimbabwean strain (Waghela et al., 1991). To date this probe, designated pCS20, has been shown to have the sensitivity to detect C. ruminantium in plasma collected from clinically reacting small ruminants (Mahan et al., 1992) and in A. hebraeum (Mahan et al., 1993; Yunker et al., 1993; Peter et al., 1994) and A. variegatum (Waghela et al., 1991; Peter et al., 1994) ticks fed on clinically reacting small ruminants following an experimental infection. The pCS20 DNA probe also has been









79

tested on Amblyomma ticks fed on subclinical carrier animals (Peter et al., 1994).

The objective of this study was to determine the

reliability of the pCS20 DNA probe and the PCR assay in detecting three different Zimbabwean strains of C. ruminantium in ticks fed on small ruminants during both the clinical reaction (febrile) and subclinical carrier periods. The DNA probe and PCR were performed on tick DNA from matched samples. Additionally, both tests were evaluated using ticks spiked with C. ruminantium, the genomic DNA of potentially cross-reactive organisms, and DNA present in ruminant blood3.



Materials And Methods


Infection Of Small Ruminants With Cowdria ruminantium



The three C. ruminantium Zimbabwean strains used in the experiment were Crystal Springs, Mbizi, and Plumtree. Two small ruminants were infected with each strain. All small ruminants were Merino sheep with the exception of one Boer goat (#4667). Animals were infected by IV inoculation of a virulent blood stabilate from an animal with clinical heartwater, caused by the inoculation of tissue cultureThis study was conducted prior to the Peter et al. (1994) study.
A more extensive evaluation of both the DNA probe and PCR is
presented in that work.









80

derived C. ruminantium organisms, or a tick feed using known C. ruminantium infected ticks (Table 3-1).



Infection Of Ticks With Cowdria ruminantium



All ticks used in this study were derived from the heartwater-free A. hebraeum laboratory colony (Sengwe strain) maintained at the VRL in Harare, Zimbabwe. These ticks were fed as larvae on rabbits and allowed to molt to

the nymphal stage in an incubator set at 270C and 80% relative humidity. Uninfected nymphs were subsequently fed on clinical (reacting) or subclinical (carrier) small ruminants (donor) (Table 3-1). Four hundred nymphs were fed in a bag glued to the dorsum of each animal. Nymphs were placed on donor animals a few days prior to the anticipated febrile period for clinically ill animals and 60 days following the second boost for carrier animals (unless specified differently in Table 3-1).

Nymphs were allowed to feed until they engorged and

dropped. Bags were checked daily and all replete ticks were

collected and kept in an incubator at 270C and 80% relative humidity until they melted to adults. The ticks were either dissected and processed for the DNA probe and PCR tests or used in small ruminant/tick transmission studies within six months of molting.









81

Confirmation Of Tick Infection By Small Ruminant/Tick Transmissions



To ensure that nymphs had acquired C. ruminantium from either the clinical (reacting) or subclinical (carrier) animals, a batch of 30 ticks per animal (unless specified differently in Table 3-1) was fed on a susceptible Merino sheep (recipient). Individual animals were monitored daily by rectal temperature and observation for clinical signs. On the third day of any febrile reaction a brain biopsy was performed to confirm the presence of C. r-uminantium colonies. All heartwater positive animals were treated with a three day course of oxytetracycline (10mg/kg SID) once it was confirmed that transmission had occurred.



Tick DNA Preparations



Amblyomna hebraeum ticks were processed using sterile techniques to prevent cross contamination between ticks. Uninfected (negative controls) and experimentally infected ticks were processed by the same protocol. The cuticle on the posterior part of each tick was cut using a scalpel blade. All internal organs were pushed out caudally using the blunt side of the blade. The tissue was transferred to individual sterile 1.5 ml eppendorf tubes and stored at

-800C until they were digested.









82

Digestions were carried out as previously described (Yunker et al., 1993), with the following modifications. Samples were frozen and thawed (-800C / 370C) twice to lyse the cells. A 100 Al aliquot of PCR buffer (50mM KCI, 10mM Tris HCl, [pH 8.3], 2.5mM MgCl2, 0.5% NP40, 0.5% Tween 20) containing 5mg/ml lysozyme was added to the samples which were then incubated at 370C for 30 minutes. Proteinase K

(PK) at 250 Ag/ml was then added and the samples incubated for >16 hours at 370C. The samples were then incubated for one hour at 560C. To inactivate the PK all samples were heated in a boiling water bath for 10 minutes and undigested material was pelleted by centrifuging at 12,000 X g for five minutes. Individual supernatants containing the DNA were transferred to fresh tubes and stored at -800C until extracted. Tick DNA samples were extracted using the standard phenol-chloroform extraction method as described by Sambrook et al. (1989). Each tick DNA supernatant was separated into a probe aliquot (80-90 Al) and a PCR aliquot (5 Al). All aliquots were stored at -800C.



Hybridization Of RCS20 DNA Probe To Tick DNA Samples


The extracted tick supernatants were denatured with

0.4N NaOH and blotted onto nylon membranes (GeneScreen Plus'; DuPont, Boston, MA) using a Hybridot apparatus (Hybriblot; Gibco, BRL, Gaithersburg, MD) as described by









83

Mahan et al. (1992). The DNA was crosslinked to the membranes with ultraviolet light for three minutes; the membranes were allowed to air dry, wrapped in Saran WrapR (Dow Chemical Company, Indianapolis, IN), and stored at room temperature.

The number of ticks tested is presented in Table 3-2. On each dot blot four negative controls (two male and two female uninfected A. hebraeum ticks) and three positive controls (100, 10, 1 nanograms of Crystal Springs strain C. ruminantium genomic DNA) were included.

The cloned 1,306-bp insert (pCS20) from the C.

ruminantium Crystal Springs strain was labeled with (a 32P]dCTP (Amersham International plc, Bucks, England) by the random-primed extension method (Boehringer Mannheim, Indianapolis, IN) and used to probe both the dot and Southern blots. The protocol for the hybridization of the pCS20 probe to both dot blots and Southern blots was performed as previously described (Mahan et al., 1992; Yunker et al., 1993).



Polymerase Chain Reaction


Polymerase chain reaction amplification was performed in 50 Al PCR mixtures containing 10mM Tris-HC1 [pH 8.3]; 200AM (each) dATP, dCTP, dTTP, dGTP; 3.0mM MgC12; 50mM KCl; 0.001% gelatin (GeneAmp DNA amplification Kit; Perkin-Elmer









84

Cetus Corporation, Norwalk, CT); oligonucleotides AB 128 (ACTAGTAGAAATTGCACAATCTAT) and AB 129 (TGATAACTTGGTGCGGGAAATCCTT) at 0.5M each; 1.25 Units Taq DNA polymerase; and 5 Ai of sample template. Samples were run for a total of 45 cycles set for one minute at 940C, one minute at 550C, two minutes at 720C, with a final extension of 10 minutes at 720C in a Coy Tempcycler (Coy Laboratory Products, Inc., Grass Lake, MI).

Polymerase chain reaction products were electrophoresed through 1.5% agarose gels containing 0.4Ag/ml ethidium bromide. Gels were visualized by ultraviolet light illumination and photography (Sambrook et al., 1989). The electrophoresed PCR products were then Southern blotted onto nylon membranes by the capillary blot technique (Sambrook et al., 1989) and hybridized with the radiolabeled pCS20 DNA probe (Mahan et al., 1992; Yunker et al., 1993).

Matched samples of tick DNA tested by the pCS20 DNA

probe were also tested in the PCR assay, however a few more ticks were tested in each strain/infectious state category by the DNA probe than the PCR methods (Table 3-2). There were three negative controls (a no template DNA sample, and DNA from both an uninfected A. hebraeum male and female tick) and one positive control (one nanogram of C. ruminantium genomic DNA, homologous strain to the test samples) included in each PCR run.