Genetic and biochemical analysis of the molybdate-dependent expression of HYC Operon in Escherichia coli

MISSING IMAGE

Material Information

Title:
Genetic and biochemical analysis of the molybdate-dependent expression of HYC Operon in Escherichia coli
Physical Description:
xvi, 136 leaves : ill. ; 29 cm.
Language:
English
Creator:
Self, William Thomas, 1971-
Publication Date:

Subjects

Subjects / Keywords:
Microbiology and Cell Science thesis, Ph.D   ( lcsh )
Dissertations, Academic -- Microbiology and Cell Science -- UF   ( lcsh )
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1998.
Bibliography:
Includes bibliographical references (leaves 125-135).
Statement of Responsibility:
by William Thomas Self.
General Note:
Typescript.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 030040047
oclc - 40945286
System ID:
AA00017698:00001


This item is only available as the following downloads:


Full Text













GENETIC AND BIOCHEMICAL ANALYSIS OF THE MOLYBDATE-DEPENDENT
EXPRESSION OF HYC OPERON IN ESCHERICHIA COLI


















By

WILLIAM THOMAS SELF


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1998















ACKNOWLEDGMENTS


I would like to thank Dr. K. T. Shanmugam for helping me

to think as a scientist. His instruction has not only aided

me in my research, but it has helped me to gain the confidence

I need to tackle any question or carry out any experiment. I

would also like to thank Drs. Lonnie Ingram, James Preston,

Thomas Bobik, and Robert Cohen for their support and

encouragement as members of my supervisory committee. In

addition, I am thankful for all of the help from all of my

associates in Dr. Shanmugam's laboratory over the years.

Special thanks goes out to Dr. Julie Maupin-Furlow for use of

the spectroflourometer. Thanks also go out to other fellow

scientists and students from the Microbiology department. And

last, but certainly not least, I would like to thank my wife,

Marianne, for her unending patience and support over the last

four years.



















TABLE OF CONTENTS


ACKNOWLEDGMENTS . .. .... ii

LIST OF FIGURES . . .. v

LIST OF TABLES .. . xii

LIST OF ABBREVIATIONS . .. ix

LIST OF GENE SYMBOLS. . .. xii


ABSTRACT . .


. . xiv


INTRODUCTION ... .. . 1

LITERATURE REVIEW . .. 5

Molybdate Transport . . 6
MGD Biosynthesis . . 9


Formate Hydrogenlyase . .

MATERIALS AND METHODS . .

Bacterial Strains . .
Media and Growth Conditions . .
Construction of P,yclacZ . .
Construction of 0(hyfA-lacZ) . .
Construction of Ahyf . .
Mutagenesis of fhlA . .
Enzyme Assays . . .
Purification of FhlA Protein . .
Purification of FhlA165 Protein .
Purification of ModE . .
Purification of ModE Mutant Proteins .
Determination of Protein Concentration .
DNase I-footprinting Experiments .
ATPase Activity . .
DNA Electrophoretic Mobility Shift Experiments
Phosphorimaging Analysis . .


. 12


. 17

. 17
. 17
. 21
. 21
. 23
. 24
. 26
. 27
. 29
. 31
. 31
. 34
. 34
. 36
. 36
. 38









Optical Biosensor Experiments . 38
Fluorescence Spectroscopy Measurements. .. ... 39
Materials . . 40

RESULTS AND DISCUSSION

Expression of hyc Operon in Escherichia coli
Requires Molybdate .. . 41
ModE Protein is Required for Optimal Expression
of hyc Operon . . 48
Biochemical Analysis of ModE and
Molybdate-independent Mutant ModE .. .60
MoeA Protein is a Required Second Component in
Molybdate-dependent Expression of hyc Operon 77
FhlA Mutant Proteins Which Allow Expression of
hyc Operon in the Absence of Molybdate 84
Characterization of an Effector-independent
Mutant FhlA Protein, FhlA165. . .. .94
FhlA165 Protein also Activates Expression of a
Silent, hyc-like, Operon hyf in
Escherichia coli . . 115

CONCLUSION . . 121

REFERENCES . .. .125

BIOGRAPHICAL SKETCH .. .. .. ... .136
















LIST OF FIGURES


Figure


1 Molybdopterin guanine dinucleotide biosynthetic
pathway in E. coli . .

2 Location of lacZ in P,,clacZ. . .


Page


. 11

. 22


3 Effect of format on expression of Ph,,lacZ .. 47


4 DNA electrophoretic mobility shift with ModE
protein and DNA from the hyc promoter region

5 Protection of hyc DNA by ModE protein
from cleavage by DNase I . .

6 Comparison of the ModE-binding regions in
hyc promoter DNA and modA operator/promoter
DNA . . .

7 A proposed model for activation of
hyc operon by both FhlA and ModE proteins

8 DNase I footprinting of modABCD
operator/promoter DNA with ModE proteins .

9 DNA sequence of the modABCD
operator/promoter region protected by
ModE-molybdate from DNase I cleavage .

10 DNase I protection pattern of modABCD
operator/promoter DNA with *ModE
and its mutant forms . .


. 55


. 56




* 58


* 61


. 64




* 66




* 69


11 Optical Biosensor response curves for
ModE-binding to modABCD operator/promoter DNA 72

12 Fluorescence emission spectra of ModE and
mutant ModE proteins . .. 75









13 Location of mutation(s) in fhlA mutant alleles

14 Extent of deletions in fhlA deletion mutant
alleles . . .

15 DNA Mobility shift experiment using purified
FhlA and FhlA165 proteins and hyc promoter
DNA . . .


. 86


. 96



. .105


16 Effect of FhlA or FhlA165 concentration on
binding to hyc promoter DNA .. ..106

17 ATPase activity of FhlA and FhlA165 in
response to Formate and hyc promoter DNA 109

18 Alignment of N-terminal region of FhlA with
proteins from ABC transport systems and the
identity of a putative format binding domain 112

19 A proposed model for the format and
[Mo]-dependent transcriptional activation
of hyc operon by FhlA protein . .114
















LIST OF TABLES


Table Page

1 Bacterial Strains and phages used in this study .18

2 Plasmids used in this study. . .20

3 Expression of P,,clacZ requires both
format and molybdate . 43

4 Expression of Q(fhlA-lacZ) is independent
of format and molybdate . .. 45

5 Transcriptional activation of PtyclacZ in the
presence of mutations in the mod operons 50

6 ModE-dependent activation of hyc operon
requires molybdate. .. . .53

7 Effect of mutation in the genes coding
for proteins in MGD biosynthesis on
ModE-independent PhyclacZ expression .. 79

8 Inability of Tungstate to substitute for
Molybdate in MoeA-dependent expression of
hyc operon . . 83

9 Regulation of PhyclacZ by FhlA mutant proteins .. 89

10 Suppression of the effect of modE and moeA
mutations on hyc expression by FhlA mutant
proteins . .. 93

11 Regulation of PhyclacZ by FhlA165 protein .97

12 FhlA165-mediated expression of PyclacZ in the
presence of oxygen or nitrate .. ... 100


vii









13 Production of FHL activity in the presence
of FhlA165 is formate-independent .. 103

14 Expression of I (hyfA-lacZ) in the presence of
various fhlA alleles . .. 117


viii

















LIST OF ABBREVIATIONS


ABC ....................

AppY ...................


ATP ....................

bp .....................

CRP ....................

Da .....................

DppF ...................

DNA ....................

DNase I ................

DMSO ...................

DTT ....................

E. coli ................

EDTA ...................

FDH-H ..................


FHL ....................

FhlA ...................

GTP ....................

HisP ...................


ATP-binding cassette

Transcriptional activator for
cyx and hya operons

Adenosine triphosphate

base pair

Catabolite repressor protein

Dalton

Dipeptide transport protein

Deoxyribonucleic acid

Deoxyribonuclease I

Dimethyl Sulfoxide

Dithiothreitol

Escherichia coli

Ethylenediamine tetraacetic acid

Formate dehydrogenase linked
to Hydrogenase 3 (FHL)

Formate hydrogenlyase

Formate hydrogenlyase Activator

Guanosine triphosphate

Histidine transport









HYD ....................

IHF ....................

IPTG ...................



Klenow ................

L-agar ................

LB ....................

LBF ...................

LBG ...................

LBGF ..................

LBGM ..................

LBM ...................

LBW ...................

LivG ..................

MalK ..................

MGD ...................



Mo-cofactor ...........

[Mo] ..................

ModC ..................

Molybdopterin .........

ModE ..................

ModF ..................

MPT ...................


Hydrogenase

Integration Host Factor

Isopropyl-p-D-thiogalactopyranoside

Equilibrium dissociation constant

DNA polymerase I Klenow fragment

L-broth + agar

L-broth

L-broth + format

L-broth + glucose

L-broth + glucose + format

L-broth + glucose + molybdate

L-broth + molybdate

L-broth + tungstate

Branched-chain amino acid transport

Maltose transport protein

Molybdopterin guanine dinucleotide

Molybdenum

Molybdopterin with Mo

Activated molybdenum (putative)

Molybdate transport

A unique pterin found in MGD

Molybdate-dependent regulator

ModF protein; unknown function

Molybdopterin









NR ......... ..........

ONPG ..................


ORF ...................

PAGE ..................

PBST ..................


PCR ...................

PotA ..................

PotG ..................

SDS ...................

TMAO ..................

Tris ..................

UV ....................

X-gal .................


XylG ..................


Nitrate Reductase

Ortho-nitrophenyl-
P-D-galactopyranoside

Open reading frame

Polyacrylamide gel electrophoresis

Phosphate buffered saline with
Tween 20

Polymerase chain reaction

Putrescine transport protein

Putrescine transport protein

Sodium dodecyl sulfate

Trimethylamine-N-oxide

Tris-(hydroxymethyl)-aminomethane

Ultraviolet

5-bromo-4-chloro-3-indolyl-
P-D-galactopyranoside

Xylose transport protein















LIST OF GENE SYMBOLS

All of the genes listed below are from Escherichia coli K-12

Gene Symbol Alternate gene symbols; phenotype affected

bcp Gene encoding Bacterioferritin co-migratory
protein

bla P-lactamase

chl Chlorate resistant (renamed mol)

crp cAMP receptor protein (CRP); global
regulator; also known as CAP, catabolite
activator protein

cya Adenylate cyclase

fdhF FDH-H; format dehydrogenase-H (FHL)

fhlA FhlA; transcriptional activator for genes
encoding components of format
hydrogenlyase

fnr Fumarate nitrate reductase; global regulator;
involved in transcriptional regulation of
genes in anaerobic respiration

gal Galactose metabolism

hyc Hydrogenase isoenzyme 3 and putative electron
transfer proteins

hyf Putative hydrogenase-encoding operon; silent

hyp Proteins involved in hydrogenase (all 3
isoenzymes) maturation

moa molybdopterin biosynthesis; previously chlA

mob MGD biosynthesis; previously chlB


xii









mod Molybdate transport; previously chlD

moe MGD biosynthesis; previously chlE

mol undefined mutation in molybdate metabolism

mog MGD biosynthesis; previously chlG

pfl Pyruvate formatelyase

rpoN Sigma-54 subunit of RNA Polymerase

sri Sorbitol utilization


xiii















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

GENETIC AND BIOCHEMICAL ANALYSIS OF THE MOLYBDATE-DEPENDENT
EXPRESSION OF HYC OPERON IN ESCHERICHIA COLI

By

William Thomas Self

December, 1998

Chairperson: Dr. K. T. Shanmugam
Major Department: Microbiology and Cell Science

Escherichia coli growing under anaerobic conditions

produces H2 and CO2 by the enzymatic cleavage of format

catalyzed by format hydrogenlyase. The FHL complex

consists of a molybdoenzyme format dehydrogenase-H (fdhF),

hydrogenase 3 (hyc), and intermediate electron carriers

(hyc). Transcription of both fdhF and hyc operons requires

FhlA protein as a transcriptional activator and both format

and molybdate as small molecule effectors. In a modB mutant

(defective in molybdate transport) transcription of PyclacZ

requires supplementation of the growth medium with

molybdate. Transcriptional activation of PhylacZ by FhlA

protein also requires ModE-molybdate, a molybdate-dependent

repressor of modABCD operon (involved in molybdate


xiv








transport), and MoeA protein (required for activation of

molybdate). ModE-molybdate was shown to bind to hyc

promoter DNA (-204 to -177 with respect to the transcription

start site) upstream of the FhlA binding site in a DNase I

footprinting experiment. However, even in the absence of

ModE, molybdate-dependent transcription of hyc operon can

still be observed. Mutation in the moeA gene eliminated

this ModE-independent, molybdate-dependent activation since

in a modE, moeA double mutant, PhylacZ was not expressed.

MoeA protein has been proposed to catalyze the initial

activation of molybdate for incorporation into

molybdopterin. It is proposed that the product of MoeA

protein is an effector for transcriptional activation of the

hyc operon. In the presence of format, a mutant FhlA-126

protein with a single alteration (R495C) activated

expression of PhclacZ even in the absence of molybdate. A

second mutant, FhlA-132, with two mutations (A42T and E363K)

also activated PyclacZ in the absence of molybdate and the

level of expression was increased by both format and

molybdate. Deletion of the unique N-terminal region of FhlA

created an effector-independent activator (FhlA165). All

three FhlA mutant proteins activated PyclacZ in a modE, moeA

double mutant. Effector-independent activator FhlA165 also

activated transcription of hyf operon, a silent gene cluster


xv









with structural similarity to hyc. Based on these results,

a working model is proposed in which FhlA-formate-activated

molybdenum complex activates transcription of fdhF and hyc

operons and ModE-molybdate serves as a secondary activator

of transcription.


xvi
















INTRODUCTION


Under anaerobic growth conditions, Escherichia coli

catalyzes cleavage of format to H2 and CO2 using the enzyme

complex format hydrogenlyase (FHL; 10). This complex

includes a format dehydrogenase isoenzyme (FDH-H; fdhF), a

hydrogenase isoenzyme (HYD3; hyc) and intermediate electron

carriers also encoded by the hyc operon (10). The FDH-H

contains selenium and molybdenum in the form of

selenocysteine and molybdopterin guanine dinucleotide (MGD),

respectively (13, 95). In addition to the requirement of

molybdenum for activity of FDH-H, transcription of both fdhF

and hyc operon also requires sufficient levels of molybdate

in the growth medium (71, 81). This requirement for

molybdenum for optimum level of transcription is apparently

universal for all molybdoenzyme synthesis in E. coli (17,

66, 71).

Transcription of fdhF and hyc operons requires, besides

molybdate, FhlA protein as an activator, and format (10,

11, 30, 53, 83). Additionally, the o54-dependent hyc operon

also requires integration host factor for optimum








2
transcription (30). The FhlA protein is similar to the NtrC

protein of E. coli (20, 63) and NifA protein of Klebsiella

pneumoniae (8, 20). These proteins contain three

distinguishable domains; an N-terminal unique region, a

central domain which includes the nucleotide triphosphate

binding motif and a C-terminal DNA-binding domain. The

second half of the three proteins, which includes the

central and C-terminal domains, shares significant

similarity. Based on analysis of several point mutants, the

unique N-terminal part of the FhlA protein is responsible

for format interaction (41). These and other genetic and

physiological studies led to the conclusion that the FhlA-

formate complex is the activator of hyc operon (10, 41, 53).

Investigation of the regulation of transcription of

operons coding for molybdoenzymes in response to molybdate

is complicated by the requirement of Mo-containing cofactors

for the enzymatic activity of the gene products. Among the

several operons whose transcription requires molybdate, the

hyc operon is unique in that none of the proteins coded by

this operon contains the necessary amino acid sequence motif

found in molybdoenzymes for binding MGD (22). The fact that

the hyc operon does not code for a molybdoprotein allows the

molybdate-dependent regulation studies to be conducted










independent of the need for molybdate for activity of the

gene product.

Molybdate is transported in E. coli by a high-affinity

transport system, a member of the ABC-transporter family

(54, 92; see 26 for a review). This transport system

contains three proteins, ModABC, coding for the periplasmic-

binding protein, a membrane channel protein and an ATP-

binding, energizing protein, respectively. Mutation in

modAB or modC gene leads to a defect in molybdate transport

and transcription of the operons coding for the

molybdoenzymes in the cell is impaired in these mutants

(71). Supplementation of growth medium with molybdate

alleviates the defect and the molybdoenzymes are produced at

optimal levels.

Transport of molybdate into the cell is regulated by a

molybdate-sensitive repressor, ModE protein. The

interaction between ModE-molybdate complex and the modABCD

operator DNA has been well characterized (4, 24, 25, 26, 55,

57, 58). At present, the ModE protein is the only known

molybdenum response regulator in E. coli. Based on DNase I-

footprinting analysis, the ModE protein also binds to moa

promoter DNA but in a molybdate-independent manner (58).

A number of proteins are required for the biosynthesis

of MGD, and these are encoded by moa, mob, moe and mog genes










(36, 67). The role of the proteins encoded by moa, mob and

moeB in the biosynthesis of MGD is well established.

However, the physiological functions of the MoeA and Mog

proteins are not known. Hasona et al. recently proposed

that the MoeA protein plays a role in activation of

molybdenum (27). Although molybdate is required for

expression of hyc-lacZ, the regulation of transcription of

hyc operon utilizing O(hycD-lacZ) was found to be

independent of the components in the MGD biosynthetic

pathway (71). These results suggest that molybdopterin, Mo-

cofactor or MGD is not needed for the molybdate-dependent

control of transcription of hyc operon. Apparently,

molybdate and/or an activated form of molybdenum is the

small molecule effector in this regulation.

Since hyc operon is unique in that it does not encode a

molybdoenzyme but does requires molybdate for transcription,

this operon was chosen to elucidate the mechanism of

regulation of molybdate-dependent transcription in E. coli.
















LITERATURE REVIEW


Coupled electron transfer is the driving force behind

almost all energy-deriving processes in biological systems.

Peter Mitchell first proposed his chemiosmotic theory in

1967 (60), and this theory has been the foundation of

countless studies of energy metabolism in both eukaryotes

and prokaryotes. Bacteria, both aerobes and facultative

anaerobes, can utilize 02 as a terminal electron acceptor to

produce large amounts of ATP needed for growth. Escherichia

coli, a facultative anaerobe, can also utilize alternative

electron acceptors when oxygen is not available to generate

proton motive force which is then utilized both for

generation of ATP and for transport of nutrients. For E.

coli, these alternate electron acceptors include nitrate,

dimethyl sulfoxide and trimethylamine-N-oxide (34). Many of

the primary dehydrogenases and terminal reductases (e.g.

format dehydrogenases, nitrate reductase, see refer. 34)

which are the components of these anaerobic respiratory

systems require molybdenum in the form of enzyme cofactor

molybdopterin guanine dinucleotide (MGD, 67). The study of










these molybdoenzymes and the uptake and processing of

molybdenum into MGD has proven to be an important aspect of

investigation into the anaerobic metabolism of E. coli.

The earliest studies of molybdate metabolism utilized

chlorate, an analogue of nitrate, to identify the genes

required for active molybdoenzymes (28, 88). Upon reduction

by the molybdoenzyme nitrate reductase, chlorate is

converted to the toxic form chlorite which exists in

solution as hypochlorite and is toxic to the cell. In order

for E. coli to grow in the presence of chlorate a mutation

must occur which eliminates NR activity. Since these

mutations can occur not only within the genes encoding the

NR enzyme itself, but also in the uptake of molybdate and

biogenesis of molybdenum cofactor, chlorate-resistance

became a powerful tool to identify the genes encoding

proteins involved in molybdate metabolism. These chlorate-

resistant mutants which were originally termed chl, have

been renamed mol (85). Although there were several classes

of mol mutants, only one class was found to be suppressed by

the addition of molybdate to the culture medium (23). These

mutants were presumed to be deficient in molybdate-uptake.

Molybdate Transport

Molybdenum is found in nature most abundantly in the

oxidized form of molybdate, and it is this form which is










actively transported by E. coli for use in molybdoenzymes.

A high-affinity transporter of molybdate, encoded by the

modABCD operon, has been characterized (54, 92). This

transporter, which consists of a periplasmic molybdate-

binding protein, ModA (33, 68), an integral-membrane

channeling protein, ModB, and a cytoplasmic ATP-binding

energizer protein, ModC (54), resembles other ABC-type

transport systems (46). Although not known to be required

for high-affinity transport of molybdate, the product of

modD is proposed to be an outer-membrane protein, possibly a

molybdate porin (26). Mutation in either modA, modB or modC

eliminates the high-affinity uptake of molybdate and thus

all molybdoenzyme activity (3, 23, 54). Upon molybdate

supplementation of rich medium at a concentration of about

100 pM, molybdate is transported by a low-affinity, non-

specific anion transporter which is yet to be identified

(26, 45, 54). Under sulfur-limiting conditions, the sulfate

transport system also allows transport of molybdate, as seen

by the restoration of molybdoenzyme activity in a mod mutant

grown in glucose minimal medium or medium limiting in sulfur

compounds (45, 71).

Transcription of modABCD operon is tightly regulated in

response to intracellular molybdate levels by the

transcriptional regulator protein ModE (25, 26, 55). ModE











acts as a molybdate-dependent repressor of modABCD

transcription by binding to the operator/promoter of modABCD

in the presence of molybdate. This molybdate-dependent

ModE-DNA-binding has been demonstrated in vitro in DNA

electrophoretic mobility shift experiments (24, 25) as well

as in DNase I-footprinting experiments (4, 24, 58).

Mutagenesis of the region of DNA from the modA

operator/promoter in which the ModE protein interacts

determined that inverted repeats of the sequence GTTA, as

well as pentameric sequences TACAT and TATAT, are important

in ModE-molybdate binding (24). Mutations in modE gene

which eliminated molybdate-dependent repression of modA-lac

as well as mutations in modE which prevent expression of

modA-lac in the presence or absence of molybdate have been

isolated and characterized in vivo (25, 55). Purified ModE

protein also has been shown to display an intrinsic

fluorescence, which was quenched upon addition of molybdate

(4). Using this property, the Kd for ModE-molybdate

association was determined to be 80 nM (4).

In addition to interacting with molybdate, ModE protein

also apparently recognizes tungstate, an analog of

molybdate. In a modB mutant, tungstate can effectively

replace molybdate in the repression of transcription of

modA-lac in vivo, and this repression is mediated through










ModE-tungstate (24). Tungstate also supported efficient

ModE binding to modA operator DNA in a DNA electrophoretic

mobility shift experiment (24), although the affinity of

ModE-WO42- for DNA binding is about 10-fold lower than ModE-

molybdate. Tungstate also binds to ModE in vitro as seen by

a decrease in the intrinsic flourescence of purified ModE

protein (4). Although E. coli is not known to produce

tungsten-containing enzymes, hyperthermophiles such as

Pyrococcus furious have a number of tungsten-containing

enzymes (39). A tungsten-containing enzyme cofactor,

similar to MGD, apparently is more stable under high

temperatures. Tungstate, when present in E. coli culture

medium prevents production of active molybdoenzymes.

Whether this lack of activity in the presence of tungstate

is due to competition between molybdate and tungstate for

transport into the cell or competition between these two

similar anions during some step in MGD biosynthesis is not

known.

MGD Biosynthesis

Once transported, molybdate is incorporated into the

enzyme cofactor molybdopterin guanine dinucleotide (MGD) in

a series of reactions which have been characterized at the

biochemical level (Fig. 1; 67). Mutations in genes whose

products are required for MGD biosynthesis also arise in a










chlorate-resistance selection, and these mutants display a

pleiotropic null phenotype for the activity of all

molybdoenzymes. One such chlorate-resistant mutant has been

identified as having a mutation in the first gene in the

moeAB operon, the moeA gene. Hasona et al. (27)

demonstrated that a moeA mutant can be suppressed by

supplementing the culture medium with sulfide. Culturing

the moeA mutant strain in low-sulfur medium, which

derepresses the sulfate transport and activation system

(42), also allows for molybdoenzyme activity presumably by

production of endogenous sulfide from the products of cys

genes (27). Based on these observations, the product of

moeA has been proposed to be involved in the initial

activation of molybdate upon transport into the cytoplasm

(27). MoeA and Mog proteins are probably involved in

activation and incorporation of Mo into molybdopterin in the

synthesis of Mo-cofactor (Fig. 1).

Other chlorate-resistant mutants allowed identification

of genes and gene products involved in the organic component

of MGD biosynthesis (67, 74; Fig. 1). The gene products of

moaABC are involved in the synthesis of the Precursor Z from

a guanosine derivative termed Guanosine-X. This precursor Z

is then converted to Molybdopterin by the products of moaDE

genes and the product of moeB. Though it does not contain











0
HN


0 CH2OX


HO OH
Guanosine-X


MoaA MoaB O H OH
I oaB NHN- 0, 0 o

MN NH HO
H
Precursor Z (5,8-H2)

MoaD
MoaE
MoeB


0 H SH
HN, N-S

H2 N N HO -
H O0
Molybdopterin (5,8-H,)


O
\0
S-.o Moo
0 H 0|
HN-"f. N S MO(
0o

\0 MobA MobB


q


42-


MoO42-


0 0

0 H \ II
N SN
HN,_ T N" NNH2

H N N HO ,P P, O
H O'O" O

HO OH
Molybopterin guanine dinucleotide (5,8-H,)


Figure 1. Molybdopterin guanine dinucleotide biosynthetic
pathway in E. coli. (adapted from Ref. 67)


MoeA? Mog?




ModABC transport system
'A I











molybdenum, molybdopterin is a sulfurylated form of

precursor Z. In what is assumed to be the final step, the

guanine nucleotide is added by the products of the mobAB

operon. However, some of these reactions are inferred from

genetic and physiological data, and until the complete

biosynthesis of MGD is reconsitituted with purified proteins

in vitro, care must be taken when considering these proposed

reactions in context with physiological effects in vivo.

Formate Hydrogenlyase

All molybdoenzymes studied so far in E. coli contain

the MGD cofactor. The crystal structure of one of these

molybdoenzymes, format dehydrogenase H (FDH-H) has been

determined (13). This crystal structure confirmed the

proposed structure of MGD in E. coli. FDH-H, encoded by the

fdhF gene (95), is part of an enzyme complex format

hydrogenlyase. Formate hydrogenlyase carries out the

enzymatic conversion of format to H2 and CO2 during

fermentation (10). The overall reaction catalyzed out by

the format hydrogenlyase, though not known to be energy

conserving, is beneficial to an anaerobically growing E.

coli cell since it reduces the amount of one of the acidic

end products of fermentation, format. Besides FDH-H, the

FHL complex also contains hydrogenase 3 (HYD3, encoded by

hyc operon) as well as electron carrier proteins (also











encoded by hyc) which link the oxidation of format to CO2

by the FDH-H to the evolution of dihydrogen by HYD3 (78).

Formate hydrogenlyase complex can readily be assayed in

whole cells and extracts by the formate-dependent evolution

of dihydrogen.

The hyc operon contains nine open reading frames,

hycABCDEFGHI, and all genes except for hycA are required for

FHL activity (78). The product of hycA negatively regulates

transcription of hyc operon by an as yet undefined mechanism

(78). The product of hycE resembles the large subunit of

hydrogenases and is presumed to be the structural protein

for HYD3 (78). The product of hycI is a protease required

for the maturation of the HycE structural protein (72). The

remaining gene products of the hyc operon are presumed to be

involved either in processing, or insertion of HYD3 within

the cytoplasmic membrane, or to serve as electron carriers

linking FDH-H to HYD3 in the membrane-bound FHL complex.

Hydrogenase 3 isoenzyme, a [NiFe] hydrogenase, also requires

the products the hypB, hypC, hypD and hypE genes for

maturation (35). The hyp operon, whose gene products are

required for the activity of two other hydrogenase

isoenzymes in E. coli, hydrogenase 1 (HYD1) and hydrogenase

2 (HYD2), lies adjacent to the hyc operon and is transcribed

in the opposite direction (35, 49).










Both the hyc and hyp operons as well as the fdhF gene

are regulated positively by the transcriptional activator

FhlA (53, 77, 81, 82). FhlA, a member of the NtrC family of

transcriptional activators (61), activates transcription of

these genes in the presence of format, the substrate for

FHL (53, 82). This activation also requires the alternative

sigma factor, 054, of RNA polymerase (30, 52, 53). Purified

FhlA has been shown to bind to DNA upstream of hyc, hyp and

fdhF genes (83), and to activate transcription of hyc operon

in vitro in a transcription/translation experiment in

response to the effector format (30). In addition, FhlA

has an intrinsic ATPase activity similar to that of the

phosphorylated form of NtrC protein (31, 94) and this

activity responds positively to both format as well as DNA

from the hyc upstream region (31).

The FhlA protein has three distinct domains; an N-

terminal unique domain with little similarity to other NtrC-

type activators; a central domain which contains a

nucleotide binding motif; and a C-terminal DNA-binding

domain (53, 82). Although some of the activators of the

NtrC family are phosphorylated by a cognate sensor protein

(e.g. NtrB, 61), the FhlA is one of a handful of activators

which is not phosphorylated. The N-terminal region

apparently interacts with the effector format in such a way










to allow a conformational change in the FhlA which in turn

promotes the binding of DNA in the upstream regions of hyc,

hyp, and fdhF genes. Once bound to the upstream region, a

subsequent energy-dependent interaction with o54-bound RNA

polymerase promotes the initiation of transcription (30,

31). Mutants of FhlA which allowed expression of hyc operon

in the absence of format have been isolated, and these

mutations altered amino acids within the unique N-terminal

domain (41). These mutant FhlA proteins displayed a higher

level of intrinsic ATPase activity as well as activating

transcription of hyc-lac to a higher level than that of the

native FhlA.

In addition to o54, FhlA and format, transcription of

both fdhF and hyc operon also requires molybdate (71, 81).

Transcription of genes encoding other molybdoenzymes (e.g.

narGHJI encoding nitrate reductase and dmsABC encoding

dimethylsulfoxide reductase) has also been shown to require

molybdate for optimal expression (17, 64). Although it is

logical that the cell respond to the presence of

intracellular molybdate in the expression of molybdoenzymes

and molybdenum-requiring enzyme complexes (FHL complex), the

mechanism by which molybdate is sensed in this regulation

has not been established. Because transcription and

translation are closely linked in E. coli, analysis of









16
expression of operons which encode molybdoenzymes which

require molybdate at the transcriptional level could be

influenced by the need for the cofactor MGD. Because hyc

operon itself does not encode a molybdoenzyme but still

requires molybdate for transcription, hyc operon provides a

unique opportunity to investigate the mechanism of this

molybdate-dependent gene expression in E. coli.
















MATERIALS AND METHODS


Bacterial Strains

The bacterial strains, phages and plasmids used in this

study are listed in Tables 1 and 2. All strains are

derivatives of E. coli K-12.

Media and Growth Conditions

Media used for bacterial growth were previously

described (72). L-broth (LB) which served as rich medium

was supplemented with glucose (0.3%), sodium format (15 mM)

or sodium molybdate (1 mM), as needed. Antibiotics, when

included, were at the following concentrations: ampicillin,

100 pg/mL; tetracycline, 30 pg/mL; chloramphenicol, 50 pg/mL

(plates), 10 pg/mL (liquid); kanamycin, 50 pg/mL.

Transduction with phages P1 and X was performed as

previously described (72). Genetic and molecular biological

experiments were performed essentially as previously

described (25, 54, 72). Deletion mutants were constructed

after insertion of Tn1O and excision. Tetracycline-

sensitive deletion derivatives were selected using fusaric

acid medium (9, 50).












Table 1. Bacterial Strains and phages used in this study


Strain or phage Relevant genotype Source/Reference


Strains
BL21(DE3)
BW545
MC4100

MRi93
RK4353
VJS720
VJS1779
VJS1780
VJS1782
VJS1784
YMC18
SE1174
SE1188
SE1265
SE1781

SE1906
SE1910
SE1978
SE1980
SE1989
SE2147
AH30
WS219


Laboratory
Laboratory
Laboratory


collection
collection
collection


CGSC# 7066
Laboratory collection
V. Stewart
V. Stewart
V. Stewart
V. Stewart
V. Stewart
B. Magasanik
Laboratory collection
Laboratory collection
Laboratory collection
Laboratory collection


ompT gal dcm lon hsdSB XDE3
A(lacU)169 rpsL
araD139 A(argF-lacU)169 rpsL150
relAl flbB5301 deoCl ptsF25 rbsR
pcnB80 zad2084::TnlO
MC4100 gyrA219 non-9
modB247::Tn10
moeA251::TnlO
mob252::Tn10
moa254::Tn10
mog256::Tn1O
endA thi hsdR Alac rpoN::TnlO
fhlA102::TnlO
fnr zcj::TnlO
pfl-1 zba::TnlO
MC4100 Q(hycD-lacZ) Alac Aebg
modB::TnlO
Agal-modB) lacZ::TnlO
BW545 A(modE-Krm)2
BW545 AmodF-Km
BW545 AmodEF-Km
BW545 acya-Km crp*
BW545 moeAll3 zbiK-Km zbj::TnlO
moeB-Km zbj::TnlO
RK4353 a(hyfB-G)-Cm


collection

collection
collection
collection


0(fhlA-lacZ) derivatives


SE2007
SE1762
MJ101
WS151
WS152


MC4100 0(fhlA-lacZ)
SE2007 modB247::Tn10
SE2007 rpoN::TnlO
SE2007 fnr zcj::TnlO
SE2007 pfl-1 zba::TnlO


Derivatives of SE1497 A(srl-fhlA)


SE1497


WS113
WS118
WS127
WS131
WS132
WS198


cysC43 srl-300::Tn10 thr-1
leu-6 thi-1 proA2 galK2 ara-14
xyl-5 mtl-1 lacYl his-4 argE3
rpsL31 tsx-33 A(srl-fhlA)
SE1497 Alac Amod XWS1
WS113 pfl-1 zba::TnlO
WS113 Agal mod*
WS113 rpoN::TnlO
WS127 pfl-1 zba::TnlO
WS113 A(modE-Km)2 moeAll3 (modABC)*


(52)
SE2007 X (P1)VJS720
SE2007 X (P1)YMC18
SE2007 X (P1)SE1188
SE2007 X (P1)SE1265



Laboratory collection




This study
WS113 X (P1)SE1265
This study
WS113 X (P1)YMC18
WS127 X (P1)SE1265
This study


Laboratory
(25)
Laboratory
Laboratory
Laboratory
(27)
(27)
This study













Table 1. (continued)


Strain or phage Relevant genotype


Source/Reference


Derivatives of WS160 (hyc+, fhlA')


XWS1
A(modE-Km)2
modB247::Tn10
moeA251::TnlO
mob252::TnlO
mog256::Tn10
moeA113 moeB+ zbiK-Km
AmodF-Km
AmrodEF-Km
moeA113 zbj::Tn10
mob252::Tn10
moa254::Tn10
modB247::TnlO
moeB-Km
moeA113 pcnB80
AmodB pcnB80
moa252::TnlO
mog256::TnlO


This study
WS160 X (P1)SE1910
WS160 X (P1)VJS720
WS160 X (P1)VJS1779
WS160 X (PI)VJS1780
WS160 X (P1)VJS1784
WS160 X (P1)SE2147
WS160 X (P1)SE1978
WS160 X (P1)SE1980
WS161 X (P1)SE2147
WS161 X (P1)VJS1780
WS160 X (P1)VJS1782
WS161 X (P1)VJS720
WS160 X (P1)AH30
This study
This study
WS161 X (P1)VJS1782
WS161 X (P1)VJS1784


RK4353 XWS4
WS222 fhlA:TnlO
WS222 rpoN::TnlO
WS222 fnr zcj::TnlO
WS222 moeAll3
WS222 Ahyf-Cm
WS222 pfl-1 zba::TnlO
WS222 acya-Km
WS222 modB247::Tn10
WS222 A(modE-Km)2
WS234 Acya-Km crp*




Tn9 Cm" clr-100
X 'bla 'lacZ
X bla+ PhclacZ
X bla+ O(hyfA-lacZ)


This study
WS222 X (P1)SE1174
WS222 X (P1)YMC18
WS222 X (P1)SE1188
WS222 X (P1)WS167
WS222 X (P1)WS219
WS222 X (P1)SE1265
WS222 X (P1)SE1989
WS222 X (P1)VJS720
WS222 X (P1)SE1910
WS234 X (P1)SE1989





Laboratory collection
Laboratory collection
This study
This study


WS160
WS161
WS162
WS163
WS164
WS165
WS167
WS168
WS169
WS172
WS174
WS175
WS178
WS190
WS191
WS192
WS193
WS194


BW545
WS160
WS160
WS160
WS160
WS160
WS160
WS160
WS160
WS161
WS161
WS160
WS161
WS160
WS161
WS161
WS161
WS161


O(hyfA-lacZ) derivatives


WS222
WS228
WS229
WS230
WS231
WS232
WS233
WS234
WS235
WS236
WS237


Phages


P1
XRZ5
XWS1
XWS4












Table 2. Plasmids used in this study


Plasmid Relevant genotype Source/Reference


pAG1
pAM4
pFGH100
pHYCP1
pHYCl
pHYC3
pRM22
pWS2
pWS 9
pWS16
pWS57
pWS70
pWS126
pWS132
pWS164
pWS165
pWS166
pWS31
pWS32
pWS33
pWS34
pWS35
pWS36
pWS40
pWS42
pWS43
pWS44
pWTS3
pWTS7
pWTS5
pWTS6
pWTS8
pZCam
pZ1918


pTrc99a modE
pUC19 modA operator/promoter, ApR
pUC19 hypA hycA hycB' ApR
pACYC177 hypA'-P,, (PstI-BstEII) KmR
pACYC177 hypA'-PhclacZ Kme
pBR322 hypA'-PhylacZ, Ap"
pT7-7 -(modEF)*
pACYC184 fhlA*, CmR
pT7-7 fhlA', Ap"
pT7-7 fhlA165, Ap"
pACYC184 fhlA57, CmA
pACYC184 fhlA70, CmR
pACYC184 fhlA126, CmR
pACYC184 fhlA132, CmR
pACYC184 fhlA164, CmR
pACYC184 fhlA165, CmR
pACYC184 fhlA166, CmR
pAG1 CmR modE'
pAG1 Cm~ modE(A76V)
pAGI Cm" modE (G133D)
pAG1 CmR modE(252*)
pAG1 Cm" modE(216*)
pAGI Cm" modE(T125I)
pUC19 P,,c Ap'
pBR322 bcp hyfABCDEFGHIR', ApR
pBR322 bcp hyfA', ApR
pBR322 bcp hyfA-lacZ, ApR
pWS42 Ahyf-Cm, Ap"
pET15b modE*, ApR
pET15b modE(T125I), Ap"
pET15b modE(216*), ApR
pET15b modE(A76V), ApR
pZ1918 CmR lac-
'lacZ ApR


(25)
(24)
Lab collection
This study
This study
This study
(25)
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
Laboratory collection
(84)











Construction of PjlacZ

For construction of a lacZ fusion with the hyc promoter

DNA, a 0.5-kb PstI-BstEII fragment from plasmid pFGH100

containing the intergenic region between the hyc and hyp

operons (Fig. 2) was cloned into a 3.0-kb PstI-BstEII

fragment of plasmid pACYC177, yielding plasmid pHYCP1. A

3.2-kb SmaI fragment containing a promoterless lacZ gene

from plasmid pZ1918 (84) was cloned into the BstEII site of

pHYCP1 after digestion with BstEII and filling in the 3'

recessed ends with the Klenow fragment of DNA polymerase I

(Fig. 2). In plasmid pHYC1, the promoterless lacZ gene is

cloned 6 base pairs upstream of the 'A' in the translation

start codon 'ATG' for hycA at position +21 with respect to

the transcription start. The hyc promoter DNA with lac

fusion was removed from pHYCl as a 4.8-kb Pspl406I-SmaI

fragment and cloned into a 4.2-kb ClaI-EcoRV fragment of

plasmid pBR322 yielding plasmid pHYC3. The hyc promoter-

lacZ fusion (P,,1lacZ) was transferred from plasmid pHYC3 by

recombination in vivo to XRZ5 in the construction of XWS1

using procedures described previously (72).

Construction of <(hyfA-lacZ)

In order to construct a lacZ operon fusion for

transcriptional analysis of hyf operon, a 4.3 kb EcoRI-






















hyc promoter


hyp promoter


larZ


GG4ArCTCTGTTAAACGGGTAACGGG


pHYC1 I
P


I-


0.lkb














Figure 2. Location of lacZ in P,,lacZ. Top line represents
chromosomal DNA from the hyc-hyp intergenic region. Bottom
line represents the chromosomal DNA present in plasmid pHYC1
and location of insertion of lacZ in the hyc operator DNA.
Black boxes indicate the binding sites for both FhlA and
IHF. Bent arrows represent transcription start sites for
hyc and hyp operons. Restriction endonuclease sites shown
are as follows: P=PstI, M=MluI, Bs=BstEII.


hypA


|


w


hy rA- hvSB
0-IA-00
---* ---- ^ BM








23
HindIII fragment from a Kohara lambda clone #424 (40) which

carries the upstream DNA from the hyf operon and neighboring

genes was cloned into plasmid pBR322 which had been cleaved

with the restriction endonucleases EcoRI and HindIII. The

resulting plasmid, pWS43, was modified by inserting a 3.2 kb

HindIII fragment from plasmid pZ1918 (84) which carries a

promoterless lacZ gene into the HindIII site. The

consequent plasmid, pWS44, carries a hyfA-lacZ fusion which

is adjacent and opposite in orientation to the bla gene.

This hyfA-lacZ fusion was recombined in vivo into ARZ5 as

previously described (72).

Construction of Ahyf

In order to construct a chromosomal deletion of the hyf

operon, a 12-kb Ndel fragment from Kohara lambda clone #424

(40) was cloned into the plasmid vector pBR322 which had

been cleaved with the restriction endonuclease NdeI. The

resultant plasmid, pWS42, which carries hyfABCDEFGHIR' was

hydrolyzed with restriction enzyme NsiI. Digestion with

this enzyme released a 5.6 kb fragment from within the hyf

operon between hyfB and hyfG. A 1.0 kb PstI fragment from

pZCam carrying the Cm" gene was then ligated to the 12.0 kb

NsiI fragment from plasmid pWS42. The resultant plasmid

from this ligation, pWTS3, carries the gene for Cm

resistance in an orientation opposite to that of the









24

hyf operon transcription and thus the insertion should have

polar effect on the expression of downstream genes.

Insertion of the gene for CmR interrupts the hyfB gene and

the deletion of hyf extends into the coding sequence of hyfG

gene. In order to replace the wild type hyf DNA in the

chromosome with the ahyf-Cm DNA, an 8.0 kb NdeI fragment

from pWTS3 containing CmR gene and neighboring hyf genes,

was removed and self-ligated. This circular DNA lacks the

gene coding for ampicillin resistance and the origin of

replication. Approximately 1 ug of the self-ligated 8.0 kb

NdeI fragment was transformed into strain RK4353 and plated

on L-agar plates containing 50 pg/mL chloramphenicol.

Transformants were selected and restreaked to obtain single

colonies and then analyzed for the presence of any extra-

chromosomal DNA by standard alkaline lysis procedures. One

clone which was a stable Cm" transformant and contained no

visible extrachromosomal DNA was designated WS219 and used

in further studies.

Mutagenesis of fhIA

The fhlA gene was removed from plasmid pSE133 (77) as a

2.4 kb SpeI-ClaI fragment and ligated to a 4.2 kb XbaI-ClaI

DNA fragment of plasmid pACYC184 to yield plasmid pWS2.

Hydroxylamine mutagenesis of plasmid pWS2 was carried out as

previously described (25). Hydroxylamine-treated plasmid










population was transformed into strain WS113 {A(srl-fhlA),

Amod, PclacZ)} and the transformants were selected on L-

agar plates with ampicillin, chloramphenicol and X-gal.

Blue colonies were selected, grown in LBG mediummolybdate

under anaerobic conditions and assayed for P-galactosidase

activity. This selection yielded fhlA alleles fhlA57 and

fhlA70.

The central region of the fhlA gene flanked by Earl and

PstI sites in plasmid pWS2 was also mutated by PCR-mediated

mutagenesis. The primers used to amplify the central domain

of the fhlA gene were 5'GACGCAGGTGGGCTA3' and

5'ACACGGTGCCTGACT3'. Heat stable DNA polymerase (Biometra,

Tampa, FL) lacking proofreading activity was used to amplify

the 1.9-kb DNA fragment. The PCR product, after agarose gel

electrophoresis and elution, was cleaved by Earl and PstI

restriction endonucleases. This PCR-derived fragment pool,

which also included mutations introduced during

amplification by the DNA polymerase, was used to replace the

corresponding native fragment in the fhlA gene in plasmid

pWS2. The resultant ligation mixture was transformed into

strain WS113 and blue colonies were selected on L-agar

medium supplemented with ampicillin, chloramphenicol and X-

gal. This procedure yielded fhlA alleles fhlA126 and

fhlA132.











Internal deletion mutations within the fhlA gene were

isolated by Bal31 Nuclease treatment of plasmid pWS2

linearized by the restriction endonuclease HpaI. Nuclease

Bal31 reactions were stopped at 5, 10, and 15 minutes by

ethanol and the DNA was precipitated. After ligation using

T4 DNA ligase, the mixture was transformed into strain

SE1174 (fhlA::TnlO) and colonies expressing FDH-H activity

were selected by dye-overlay procedure as described

previously (45). This procedure yielded fhlA alleles

fhlA164, fhlA165, and fhlA166.

The location of the mutation in each mutant fhlA allele

was determined by sequencing both strands of the entire fhlA

gene by the Sanger dideoxy sequencing method (53, 75). DNA

sequence was analyzed using the software Genepro (Riverside

Scientific, Seattle, WA).

Enzyme Assays

Cells were grown and harvested for enzyme assays as

described previously (25, 72). P-galactosidase activity in

whole cells was determined with chloroform-sodium dodecyl

sulfate-permeabilized cells as described by Miller (59).

Specific activities expressed as nanomoles'min-l milligram

cell protein-1 are the average of at least 3 independent

experiments and varied by less than 15%. FHL activities










were determined using whole cells as previously described

(44).

Purification of Fh1A Protein

The strain used for high-level expression of the fhlA

gene was strain BL21(DE3), which contains an undefined

mutation in the mod operon (unpublished data). This allowed

production of FhlA protein without possible intracellular

molybdenum contamination by culturing the cells in medium

without molybdate supplementation. All buffers, media and

solutions used during the culture of the organism,

expression and purification of FhlA protein were prepared

using "nanopure" deionized water in order to minimize

molybdate contamination of the FhlA protein during

purification.

Plasmid pWS9, which carries fhlA under the control of

phage T7 gene 10 promoter (89), was constructed by cloning a

2.4-kb XbaI-ClaI fragment from pSE133 (77) into the plasmid

expression vector pT7-7 cleaved with XbaI and ClaI

restriction enzymes. Strain BL21(DE3) was transformed with

plasmid pWS9 and plated on L-agar with ampicillin. Fresh

transformants were transferred from plates into 2 liters of

LB with ampicillin in 2.8 liter Fernbach flasks (1

liter/flask). The cultures were grown with shaking (225

rpm) at 370C until an optical density of 0.7 (420 nm,










Spectronic 710) was reached. After adding IPTG to a final

concentration of 0.5 mM, the cultures were incubated at 23C

with shaking (225 rpm) for an additional 6 hours. The cells

were harvested and washed once with Tris-buffer (50mM Tris

pH 8.0; 0.5 mM EDTA; 1 mM benzamidine; 1 mM dithiothreitol).

The cells were resuspended in 25 mL of Tris-buffer, and

broken by passage through a French pressure cell at 20,000

Ib-in-2 and then centrifuged at 30,000 x g for 2 hours. The

supernatant fraction was loaded on Q-sepharose (30 cm X 2.5

cm; Pharmacia Biotech, Piscataway, NJ), and the column was

washed with Tris-buffer. Proteins were eluted with a linear

gradient of NaCl (0-0.4 M) in Tris-buffer. FhlA protein

eluted at approximately 0.37 M NaC1. FhlA containing

fractions, as determined by SDS-PAGE analysis, were pooled

and dialyzed overnight in Tris-buffer. This fraction was

loaded on a 5 mL Hi-Trap Heparin column (Pharmacia Biotech)

and the proteins were eluted using a linear NaCl gradient

(0-0.4 M). The FhlA protein eluted at approximately 0.3 M

NaC1. FhlA-containing fractions were pooled and dialyzed

overnight in HEPES buffer (30 mM, pH 7.0; 0.5 mM EDTA; 1 mM

Benzamidine; 1 mM DTT). This dialyzed sample was loaded on

a 1 mL Hi-S column (cation exchange, Bio-Rad Laboratories,

Hercules, CA) pre-equilibrated with the same HEPES buffer

and eluted with a linear gradient of 0-0.5 M NaC1. FhlA

protein was eluted at approximately 0.25 M NaCl and the








29

fractions containing FhlA protein were dialyzed overnight in

HEPES buffer. This sample was then chromatographed on 1 mL

Hi-Q anionn exchange, Bio-Rad) column equilibrated with

HEPES buffer and the FhlA protein was eluted using a linear

gradient of sodium citrate from 0-0.3 M. The pure FhlA

protein, as judged by SDS-PAGE analysis, was dialyzed in

HEPES buffer (25 mM, pH 7.0; 0.8 mM DTT; 10% glycerol) for

storage. Samples were aliquoted, quick frozen in liquid

nitrogen, and stored at -70" C.

Purification of FhlA165 Protein

FhlA165 protein was purified essentially as described

by Schlensog et al. (83), with minor changes. Plasmid

pWS16, which carries fhlA165 under the control of phage T7

gene 10 promoter (89), was derived by lighting a 1.4 kb

BstBI-ClaI fragment from plasmid pWS165 containing fhlA165

into the single ClaI site in the multiple cloning site of

plasmid pT7-7 (91). Strain BL21(DE3) was transformed with

plasmid pWS16 and plated on L-agar with ampicillin. Fresh

transformants were transferred into 1 liter of LB with

ampicillin in a 2.8 liter Fernbach flask. The culture was

grown with shaking (225 rpm) at 37C until an optical

density of 0.7 (420 nm, Spectronic 720) was reached. The

inducer IPTG was added to a final concentration of 0.34 mM

and the culture was incubated at 37C with shaking (225 rpm)








30

for 3 more hours. The cells were harvested and washed once

with Tris-buffer, pH 8.0 (50mM Tris pH 8.0; 0.5 mM EDTA; 1

mM benzamidine; 1 mM dithiothreitol). The cells were

resuspended in 12 mL of Tris-buffer, and broken by passage

through a French pressure cell operating at 20,000 Ib'in-2

and then centrifuged at 30,000 x g for 30 minutes. The

supernatant (14 mL) was subsequently centrifuged for 2 hours

at 120,000 x g. This resulting supernatant was brought to

an ammonium sulfate concentration of 37%. This sample was

then centrifuged for 30 minutes at 30,000 x g. The

resulting pellet was dissolved in 1.2 mL of Tris-buffer, pH

7.5 (50 mM Tris, pH 7.5; 0.5 mM EDTA; 1 mM benzamidine; 1 mM

dithiothreitol). This sample was dialyzed overnight in the

same Tris-buffer. Unlike the wild type FhlA protein, which

precipitates out of solution at this step (83), FhlA165

remained in solution. This dialyzed sample was loaded on

Heparin agarose (40 mL column, Pharmacia), washed with Tris-

buffer, pH 7.5, and eluted with a linear gradient of KC1 (0-

0.5 M). FhlA-containing fractions as determined by SDS-PAGE

analysis were pooled and dialyzed overnight in Tris-buffer

(pH 7.5). This fraction was loaded on Q-sepharose (12 mL;

Pharmacia Biotech) and the proteins were eluted using a

linear KC1 gradient (0-0.4 M) in Tris-buffer, pH 7.5. The

FhlA165 protein eluted at approximately 0.3 M NaC1. FhlA

containing fractions were pooled and dialyzed overnight in










Tris-glycerol buffer (25 mM; pH 7.5; 1 mM EDTA; 50%

glycerol). This sample was judged to be >99% pure based on

SDS-PAGE analysis and was stored at -20 C.

Purification of Native ModE

ModE protein from plasmid pRM22 was purified as

described previously (25).

Purification of Native and Mutant ModE proteins

Polymerase chain reaction was utilized to amplify the

wild type modE as well as mutant modE alleles from plasmid

pAG1 and its mutant derivatives using two primers;

5'GGACATTCATATGCAGGCCGAAATC-3' and 5'-

GCGGATCCTTAGCACAGCGTGGCGA-3'. Restriction sites NdeI and

BamHI were engineered into the primers in order to clone the

PCR product into the expression vector pET15b (Novagen,

Madison, WI). The protein(s) expressed from this vector

would include an additional N-terminal sequence of six

histidines which are separated from the ModE protein by a

linker containing thrombin protease cleavage site. The PCR

products were treated with phenol-chloroform and

precipitated with ethanol. A sample of each reaction was

digested with NdeI and BamHI and the 0.8-kb fragment was

purified by agarose (0.8 %) gel electrophoresis. The modE-

DNA and mutant ModE-DNA were ligated to a 5.7-kb fragment of

plasmid pET15b, also digested with the same restriction










endonucleases and purified after agarose gel

electrophoresis. The resultant plasmids which contain the

modE (pWTS7) and various modE mutant alleles (pWTS5, pWTS6

and pWTS8) under the transcription control of phage T7 gene

10 promoter were used for high-level expression of native

ModE and its mutant proteins. The mutation in each plasmid

containing the mutant modE allele was confirmed by

sequencing the entire modE gene in the pET15b-derived

plasmids.

Each of the ModE proteins was purified as follows.

Strain BL21(DE3) carrying pET15b-modE derivative was grown

in 250 mL of L broth with shaking (225 rpm) at 370C. When

the optical density of the culture reached 0.7 (420 nm;

Spectronic 710 spectrophotometer), IPTG was added to a final

concentration of 0.1 mM. Temperature of incubation was

reduced to 230C and the culture was incubated for an

additional 3 hours. The cells were harvested, washed once

with Tris-buffer (50mM Tris, pH 8.0) and resuspended in 25

mL of Tris-buffer. Cells were broken by passage through a

French pressure cell operating at 20,000 Ib-in-2 and the

extract was clarified by centrifugation at 27,000 x g for 30

min at 4C. The supernatant was filtered through a 0.2 pm

filter (Gelman Sciences) and then loaded on a HiTrap

chelating column (Pharmacia Biotech). The column was pre-










equilibrated with NiCl2 (40 mM in Tris-buffer) and free Ni

was removed by washing the column with 10 volumes of Tris-

buffer. After loading the sample, unbound proteins were

washed off the column with Tris-buffer. Tris-buffer

containing 50 mM imidazole was used to remove the proteins

bound nonspecifically to the matrix. The ModE protein was

eluted with 0.3 M imidazole in Tris-buffer. After adding

CaCl2 to a final concentration of 2.5 mM, thrombin protease

(25 units; Pharmacia) was added to the ModE preparation to

remove the N-terminal His-tag sequence. The thrombin-ModE

mixture was incubated for 16 hours at 40C. After cleavage

was complete, based on SDS-PAGE analysis, the sample was

loaded on a HiTrap Heparin column (5 mL; Pharmacia) to

separate ModE from thrombin. After washing the column with

five volumes of Tris-buffer to remove unbound thrombin, ModE

was eluted with 0.3 M NaCl and was determined to be pure by

SDS-PAGE. ModE protein was dialyzed overnight in 50mM Tris

(pH 8.0) containing 0.5 mM dithiothreitol and stored on ice

until use. This protein was found to be stable for several

months. ModE proteins purified by this Ni-affinity method,

contained an extra three amino acids (Gly, Ser, His) in the

N-terminus and are designated *ModE to denote this

alteration. Although a major fraction of the mutant ModE

proteins expressed from plasmid vector pET15b-derivatives

formed insoluble complexes, a significant portion of the










protein remained in the soluble, presumably native, form.

The mutant ModE proteins present in the soluble fraction

were purified using the above described procedure.

Determination of Protein Concentration

Concentrations of protein preparations were determined

using Comassie Blue as previously described (14) with bovine

serum albumin as a standard.

DNase I-Footprinting Experiments

DNase I protection experiments were performed

essentially as previously described (24, 69). For

experiments involving hyc promoter DNA and ModE protein, a

396-bp DNA containing the hyc operator/promoter DNA was

obtained after hydrolysis of plasmid pFGH100 by

endonucleases PstI and Sail and purification using a 10-30%

sucrose gradient (76). The SalI-end of the DNA was labeled

with 32P by filling in with Klenow and all four a-32P-labeled

dNTP's (DuPont-NEN). Unincorporated dNTP's were separated

from the labeled fragment using a G-25 spin column

(Pharmacia Biotech). Protein present in this eluent (heat-

inactivated Klenow) was precipitated using 2.5 M potassium

acetate and removed by centrifugation as previously

described (18). The labeled DNA was precipitated using two

volumes of 100% ethanol and recovered by centrifugation.










The DNA was resuspended in TE Buffer and stored at 40 C at

approximately 50,000 CPM/pl.

To facilitate binding of ModE protein to the DNA, a

mixture of buffer (10 mM Tris, pH 7.9, 10 mM MgCl2, 50 mM

NaCI, and 1 mM DTT), ModE protein and labeled DNA (50,000

CPM) was prepared in a volume of 19 pl and incubated at 37C

for 20 min. Molybdate was included in this reaction at a

final concentration of 0.1 mM, as needed. Unprotected DNA

was hydrolyzed by the addition of 1 pL of DNase I (Sigma;

0.9 ng/pl) to the final reaction mixture (20 ul). After 4

min of incubation at room temperature, DNase I activity was

stopped by addition of 5 pl of 200 mM EDTA to the reaction

and the proteins were hydrolyzed by inclusion of 1 pl of

Proteinase K (Sigma; 1 pg/pl; 15 min at 370C). Remaining

trace amounts of proteins were removed by 2.5 M ammonium

acetate precipitation. After addition of 1 pg of yeast

tRNA, nucleic acids were precipitated with 2 volumes of 100%

ethanol. Each sample was resuspended in 4 pl of formamide

loading buffer (69) and loaded on a 8% polyacrylamide

denaturing gel for electrophoresis at 50 watts for 100

minutes. The gel was dried and exposed to pre-flashed X-ray

film.

DNase I-protection experiments involving modA operator

DNA and ModE protein were carried out as described above for










hyc promoter DNA. For these experiments, a 446-bp FspI-

HindIII fragment from plasmid pAM4 which carries modA-

operator/promoter DNA spanning from -247 to +25 was used.

The DNA was labeled using a-32P-labeled dNTP's (Dupont-NEN)

and Klenow to fill in the HindIII end.

ATPase Activity

ATPase activity of FhlA was determined as described

previously (41).

DNA Electrophoretic Mobility Shift Experiments

DNA-mobility shift experiments were performed

essentially as previously described (25). All solutions

used for the experiments were made with 'nanopure' deionized

water without further treatment to remove trace levels of

contaminating molybdate.

ModE. A 396-bp PstI-SalI fragment from plasmid pFGH100

was used as the target DNA for the shift experiment. This

fragment, which also contains the DNA upstream of the FhlA

binding site (83), was labeled with "P-dNTP's by filling in

the recessed 3' end of the BstEII site with the Klenow

enzyme. ModE protein was pre-incubated with binding buffer

(10 mM Tris, pH 7.5, 1 mM EDTA, 1 mM dithiothreitol) for 2

minutes at 370 C before the labeled DNA was added. Binding

reactions were incubated for 30 minutes at 370 C. Gels were

pre-run at 100 V for 60 minutes at room temperature and run










for 60 minutes at 100 V with buffer recirculation after

loading the samples. The gels were dried and exposed to X-

ray film. Sodium molybdate was added at a final

concentration of 1 mM in the 5% polyacrylamide gel,

circulating TBE buffer, and the binding reactions, as

needed.

FhlA. FhlA target sequence (83) in hyc promoter was

amplified by PCR using two primers; 5'-

CCGGATCCGTTATTTCGAGCATATC-3' for the 5' end and 5'-

CCCTGCAGTTTAAGCTAAAGATGAA-3' for the 3' end. This amplified

DNA, after digestion with restriction endonucleases PstI and

BamHI, was cloned into pUC19 digested with PstI and BamHI,

yielding pWS40. This plasmid was the source for a 154-bp

PstI-BamHI fragment used in the mobility shift experiments.

This DNA fragment, after isolation on linear sucrose

gradient as previously described (76), was labeled with 3P-

dNTP's by filling in the recessed 3' end of the BamHI site

with the Klenow enzyme. FhlA or FhlA165 protein was pre-

incubated with binding buffer (10 mM Tris, pH 7.5, 1 mM

EDTA, 1 mM dithiothreitol, 1 mM ATP) for 5 minutes at 40 C

before the labeled DNA was added. Binding reactions were

incubated for 20 minutes at 370 C. Gels were pre-run at 100

V for 60 minutes at room temperature and run for 60 minutes










at 100 V with buffer recirculation after loading the

samples. The gels were dried and exposed to X-ray film.

Phosphorimaging Analysis

Dried gels from DNA mobility shift experiments were

exposed to a phosphorimaging screen and the bands were

quantified using a phosphorimager (Molecular Dynamics) at

the University of Florida Interdisciplinary Center for

Biotechnology Research.

Optical Biosensor Experiments

The kinetic characteristics of the interaction between

ModE and modA operator DNA was determined using Optical

evanescent wave biosensor (Affinity Sensors). The

principles of this biosensor have been described previously

(80). In this particular experiment, a cuvette containing

biotin on the sensor surface was utilized. Biotinylated DNA

was bound to the sensor surface using streptavidin

(Calbiochem) as an intermediate. Two 43 base complimentary

oligonucleotides covering the modA operator region between

-18 and +25, were synthesized (NBI) with biotin in the 5'-

end of one of the oligonucleotide which upon annealing would

be located in the 5-end of the DNA.

The biotin cuvette in the Optical biosensor was rinsed

with phosphate-buffered saline containing 0.1% Tween 20.

Streptavidin (100 pl; 1 mg/mL) in 10% PBST was added to the










cuvette (200 pl reaction volume) and incubated for 6.5 min

with mixing. After removing the unbound streptavidin, DNA

was added and incubated until no further response was noted.

Excess DNA was removed from the cuvette by 3 washes with

PBST. ModE protein with or without molybdate (1 mM) was

added to the cuvette and the rate of increase in response

was recorded. After the maximum response was attained, free

ModE in the cuvette was removed by a wash with PBST and the

rate of dissociation of ModE from the DNA was monitored.

When the dissociation of ModE-molybdate was followed, PBST

was supplemented with 1 mM molybdate. When needed, ModE was

dissociated from the DNA and removed by washing the cuvette

with IM MgCl2. The experiment was repeated with several ModE

concentrations as well as with mutant forms of ModE and

mutated modA operator DNA. The information obtained with

different ModE concentrations (2.25-54.0 nM) was used to

determine the kinetic constants as per Borza and Morgan

(12).

Fluorescence Spectroscopy Measurements

Fluorescence emission spectra were collected using an

Aminco Bowman Series 2 Spectrofluorometer (Spectronic).

ModE proteins were diluted in Tris-buffer (pH 8.0) with 0.5

mM dithiothreitol for measurement using 1 cm pathlength.

Samples were excited at 290 nm and emission spectra from 300









40

nm to 400 nm were collected. Three separate concentrations

of ModE and mutant ModE proteins (1, 2.4, and 4.8 pM) were

analyzed for intrinsic fluorescence with and without added

molybdate (1 mM). In these experiments, the bandpass width

was 4 nm and the detector voltage was set at 610V.

Materials

Biochemicals were purchased from Sigma Chemical Co.

(St. Louis, MO). Other organic and inorganic chemicals were

from Fisher Scientific (Pittsburgh, PA) and were analytical

grade. Restriction endonucleases and DNA modifying enzymes

were purchased from Promega (Madison, WI) and New England

Biolabs (Beverly, MA), with the exception of the

thermostable polymerase used in mutagenesis of fhlA gene,

which was from Biometra (Tampa, FL). Optical biosensor

cuvettes were from Affinity Sensors.














RESULTS AND DISCUSSION

Expression of hyc Operon in Escherichia coli Requires
Molybdate

Transcriptional Regulation of PlacZ

Previous investigations into the transcriptional

regulation of hyc operon utilized chromosomal operon fusions

in which the lacZ gene was inserted into a gene within the

hyc operon (hycB-lacZ, 78; hycD-lacZ, 53). Since the first

gene of the hyc operon negatively modulates the level of

transcription of hyc (78), a hyc promoter-lacZ fusion was

constructed in which the upstream DNA from hyc operon is

fused to a promoterless lacZ gene six base pairs before the

predicted translation start site (Fig. 2). This PyclacZ

fusion allows the regulation of hyc transcription to be

monitored without possible negative effect from a second

copy of the hycA. A recombinant lambda phage (XWS1) which

carries the PhlacZ in the Xatt site was used in this study

to analyze the transcriptional regulation of hyc operon in

both a wild type strain as well as in a deletion mutant

strain lacking the entire hyc and hyp region.










In order to confirm that regulation of PylacZ fusion

is similar to previous hyc-lac fusions (53, 78), the level

of 3-galactosidase activity produced by several mutant

strains carrying mutations in genes which had previously

been shown to be involved in the expression of hyc operon

was determined (Table 3). Since the chromosomal fhlA gene,

encoding the required transcriptional activator of the hyc

operon, is deleted in strain WS127, no P-galactosidase

activity was produced by this strain. Strain WS127 with

plasmid pWS2 (fhlA+) produced 1400 units of P-galactosidase

activity when grown in LBG and this level of activity

increased to 1800 units when format was also included. An

isogenic derivative carrying a mutation in the pfl gene

(WS132 with pWS2), and thus lacking the pyruvate

formatelyase activity, produced less than 10% of P-

galactosidase activity of the parent due to the absence of

format. Addition of format returned the level of hyc-lacZ

expression to that of the parent strain (pfl+). Strain

WS113(pWS2), which also carries a deletion in the modABCD

(molybdate transport operon), produced less than 25% of the

P-galactosidase activity of the parent, strain WS127(pWS2).

Although addition of format to the medium increased the

amount of P-galactosidase activity produced by the culture

by about 2-fold, molybdate was required for full restoration











Table 3 Expression of P,,clacZ requires both format and
molybdate



Strain' Relevant genotype S-aalactosidase activity'

LBG LBGF LBGFM


WS127 <50 <50 <50
WS127(pWS2)c p(fhlA)* 1400 1800 1800
WS132(pWS2) pfl-1 p(fhlA) 110 1650 1800
WS113(pWS2) Amod p(fhlA)+ 320 720 1900
WS131(pWS2) rpoN Amod p(fhlA) <50 <50 <50


a All strains contain PhclacZ via XWS1, and A(srl-fhlA)
which deleted chromosomal hydA, hyc, and hyp operons as well
as the fhlA gene.
b 3-galactosidase activity is expressed as nanomoles
*min.-"milligram of cell protein-1.
c Plasmid pWS2 carries fhlA'.










of hyc-lacZ expression. Mutation in the rpoN gene, which

encodes the sigma-54 subunit of RNA Polymerase holoenzyme,

also eliminated the expression of P-galactosidase activity

by strain WS131(pWS2). Therefore, production of P-

galactosidase activity by strains carrying PylacZ required

format, molybdate, FhlA protein, and a54. This pattern of

regulation corresponds to previous studies utilizing

chromosomal hyc-lacZ fusions (53).

Expression of fhlA Gene does not Require Molybdate

Since expression of both hyc-lacZ and PhyclacZ fusions

require molybdate, the possibility that the expression of

the fhlA gene, coding for the required transcriptional

activator FhlA, is influenced by molybdate, and thus has an

indirect effect on hyc was investigated. Strain SE2007, an

fhlA-lacZ derivative of strain MC4100, produced 610 units of

P-galactosidase activity when cultured in LBG (Table 4).

Strain SE1762, a modB isogenic derivative of strain SE2007

produced 490 units of P-galactosidase activity when cultured

in LBG. Addition of molybdate to either the parent strain

(SE2007) or the modB derivative had no significant effect on

the level of P-galactosidase activity produced (Table 4).

These results show that the fhlA expression is molybdate-

independent and thus strongly argues that the lack of











Table 4 Expression of 0(fhlA-lacZ) is independent of
format and molybdate



Strain Relevant genotype B-aalactosidase activity'

LBG LBGM


SE2007 wild type 610 740
SE1762 modB247 490 510
WS152 pfl-1 970 1000
MJ101 rpoN 770 1200
WS151 fnr 2030 2100
SE2007(pWS2) pfhlA' 570 NDc



a All strains are isogenic derivatives of strain SE2007
which carries (ffhlA-lacZ).
b P-galactosidase activity is expressed as nanomoles
*min- *milligram of cell protein-.
c Not determined.








46

hyc transcription in a modB mutant is not due to an absence

of expression of fhlA.

In addition, a mutation in rpoN had very little effect

on the level of expression of fhlA gene while a pfl mutation

increased the fhlA-lacZ expression (Table 4). Plasmid pWS2

which increased the copy of fhlA in strain SE2007 did not

alter the level of expression of fhlA-lacZ. However, an

fnr mutation (WS151) increased the level of fhlA-lacZ

expression by about three-fold to about 2000 units. No

consensus binding sequence for the global anaerobic

transcriptional regulator FNR (TTGAT-4 bp-ATCAA) was found

in the DNA sequence within and immediately upstream of the

fhlA gene. Therefore the mechanism of repression of fhlA

expression by FNR appears to be indirect and is yet to be

determined.

Formate and Molybdate act Independently on hyc Expression

In order to evaluate whether the requirement for

molybdate in hyc-lac expression is indirect and is related

to the need for format for activation of hyc operon, the

levels of P-galactosidase activity produced by the modB

mutant, strain WS162, grown with various format

concentrations were determined (Fig. 3). The P-

galactosidase activity of the culture not supplemented with

molybdate increased from about 250 units to 700 units














4000



-,- +Mo *
"- 3000




S2000
-I
o S
Cc 0
1000 -Mo




0
0 10 20 30 40 50

Formate (mM)









Figure 3 Effect of format on expression of PhylacZ.
Strain WS162 (modB) was cultured in LBG in the presence or
absence of added molybdate.










between the format concentrations of 2 and 20 mM. This

increase, indicating that endogenously produced format does

not fully saturate the ability to transcribe hyc operon, was

also reported before (52). Addition of molybdate alone

increased the level of expression of hyc-lacZ in strain

WS162 to about 1700 units (Fig. 3). Formate further

increased the level of expression of hyc-lacZ by an

additional 1000 units in the presence of molybdate. This

requirement for molybdate for optimum expression of hyc-lacZ

in strain WS162 which produced format internally, suggests

that the need for molybdate is independent of the need for

format in the expression of hyc-lacZ. It is the

elucidation of the components involved in this requirement

for molybdate which is the primary focus of this study.


ModE Protein is Required for Optimal Expression of hyc
Operon

ModE Protein has a Role in hyc Operon Transcription

The modE gene is the first gene in modEF operon which

is divergent from the modABCD operon in the E. coli

chromosome (25, 92). ModE protein is a molybdate-sensor and

represses transcription of modABCD in the presence of

molybdate (24, 25, 55). Since transcription of hyc operon

requires molybdate, and ModE protein had been shown to be a

molybdate-sensitive DNA-binding protein, the possibility










that ModE has a role in the molybdate-dependent

transcription of hyc operon was investigated.

As expected, molybdate was required for expression of

PyclacZ in an isogenic modB mutant derivative of WS160

(Table 5). Expression of PhclacZ in a modE mutant was

decreased by about 60% and molybdate supplementation of the

medium had no effect on the level of P-galactosidase

activity produced (Table 5). When the modE mutation was

complemented by modE* in a plasmid, strain WS161(pWS31)

produced about 2100 units of 3-galactosidase activity when

cultured in either LBG or LBGM. These results show that

ModE is an integral part of hyc transcription activation.

In order to determine if the effect of modE mutation on

hyc expression is due to a polar effect on the expression of

modF gene, which is located downstream of modE in the modEF

operon, expression of PclacZ was also analyzed in both

modEF and modF mutants (Table 5). Strain WS168 (modF)

produced about 90% of the P-galactosidase activity as that

of the parent, strain WS160. Strain WS169, which carries a

deletion of the modEF operon, produced only 850 units of p-

galactosidase activity when cultured in LBG. Addition of

molybdate had no effect on the expression of hyc-lacZ in

either of these strains. Plasmid pWS31 (modE+) restored the

expression of PhyclacZ in the modEF mutant (WS169) to optimal










Table 5 Transcriptional activation of PhclacZ in the
presence of mutations in the mod operons


Straina Relevant genotype 0-galactosidase activity

LBG LBGM


WS160 wild type 2000 (100) 2000 (100)
WS160(pWS31)c wild type p(modE) 2100 (103) 2300 (114)
WS162 modB 120 (6) 1800 (91)
WS161 AmodE 820 (40) 810 (40)
WS161(pWS31)c AmodE p(modE() 2100 (104) 2300 (115)
WS168 AmodF 1800 (91) 1700 (84)
WS169 AmodEF 850 (42) 800 (40)
WS169(pWS31)c AmodEF p(modE) 2700 (133) 2600 (128)
WS178 AmodE modB <50 (0) 800 (40)


SAll strains carry AWS1 (P,,yclacZ).
b P-galactosidase activity is expressed as nanomoles-
min.-'1milligram of cell protein-'. Values in parentheses
represent % of activity produced by the mutant strain as
compared to the wild type strain WS160.
0 Plasmid pWS31 carries modE'.










levels. These results indicate that the lack of ModE

protein, and not ModF, is responsible for the decrease in

expression of hyc operon.

It is also possible that the decrease in hyc-lacZ

expression in a modE mutant could be related to the lack of

control of molybdate transport, since ModE-molybdate

represses expression of modABCD operon (25, 55, 92). The

high intracellular molybdate may indirectly influence the

level of hyc-lac expression. In order to evaluate this

possibility, a modE, modB double mutant (strain WS178) was

constructed. This double mutant was completely dependent on

molybdate for production of hyc-dependent P-galactosidase

activity and even in the presence of molybdate (1 mM) the

level of P-galactosidase activity produced by strain WS178

was the same as that of a modE mutant, strain WS161 (Table

5). These results show that the decrease in transcription

of hyc-lac in a modE mutant can not be attributed to

unregulated expression of molybdate transport system coded

by modABC operon, and also demonstrates that the ModE-

independent activation of transcription of hyc operon still

requires molybdate. This suggests that ModE is not the only

molybdate-sensor in the transcriptional regulation of hyc

operon.










ModE-dependent Activation of hyc Operon Requires Molybdate

To establish that the molybdate-bound form of ModE is

the active form participating in hyc expression, a modE*

plasmid plasmidd pWS31) was introduced into a modE, modB

double mutant, strain WS192, carrying PhyclacZ fusion (Table

6). Strain WS192 also carries a pcnB mutation to reduce the

copy number of the modE* plasmid and minimize plasmid copy

number effect on hyc expression (47). Even in the presence

of plasmid pWS31 coding for the native ModE protein,

expression of P,y(lacZ was molybdate-dependent (Table 6).

These results suggest that the ModE-dependent expression of

hyc operon requires molybdate.

Mutant ModE proteins which repressed modA-lacZ

expression even in the absence of molybdate at different

levels were previously described (25) and when plasmids

coding for these mutant ModE proteins were introduced into

strain WS192, P,,clacZ expression was also independent of

added molybdate (Table 6). The levels of P-galactosidase

activity produced in the presence of these mutant proteins

varied between 1200 and 2000 units, suggesting that these

proteins have different abilities to enhance hyc

transcription in the presence and absence of molybdate. In

the presence of ModE(A76V) which failed to repress modA-lacZ

(25) only a modest increase in hyc-lac expression was











Table 6 ModE-dependent activation of hyc operon
molybdate


requires


Strain Relevant genotypea B-galactosidase activity

LBG LBGM


WS160 wild type 2000 2000
WS161 AmodE 820 810
WS162 modB 120 1840
WS192 AmodE modB <50 930
WS192(pWS31) AmodE modB p(modE+) 230 2500
WS192(pWS33) AmodE modB p(modE-G133D) 1300 1200
WS192(pWS34) AmodE modB p(modE-252*) 1900 2300
WS192(pWS35) AmodE modB p(modE-216*) 1800 1600


1 All strains carry XWS1. Wild type modE' gene (pWS31) and
mutant modE genes are carried by the plasmids listed.
b P-galactosidase activity is expressed as nanomoles
*min-1*milligram of cell protein-'.










observed and this required molybdate (930 to 1200 units).

These results are in agreement with the proposal that ModE-

molybdate is the active form in enhancing transcription of

hyc operon.

ModE Protein Binds to hyc Promoter DNA

Since the genetic and physiological experiments suggest

that ModE-molybdate is required for optimal expression of

P,,lacZ, direct binding experiments consisting of ModE

protein and promoter DNA were carried out. Electrophoretic

mobility of a 396-bp hyc promoter DNA was retarded in the

presence of ModE protein but only in the presence of

molybdate (Fig. 4). The minimal amount of ModE-molybdate

required for the mobility shift was about 250 nM and this is

about 10-times higher concentration of ModE protein than the

reported Kd for binding of ModE to modA operator DNA (4,

58). These results show that the ModE-molybdate binds to

hyc upstream DNA.

DNase I-footprinting experiments involving ModE and hyc

promoter DNA revealed that ModE-molybdate protects a 27-bp

region in this DNA from DNase I-mediated hydrolysis (Bases

-177 to -204; Fig. 5, panel A). The center of the ModE-

protected region is 94 bases upstream of the center of the

DNA protected by the transcriptional activator, FhlA protein

from DNase I hydrolysis (Fig. 5; 83). Although there is no




















1 2 3 4 5 6


1 2 3 4 6


Figure 4 DNM electrophoretic mobility shift with ModE protein and DNA from the hyc
promoter region. Panel A, minus molybdate; Panel B, plus molybdate. Lane 1, no
protein added; lane 2, 85 nM ModE; lane 3, 130 nM ModE; lane 4, 170 nM ModE; lane 5,
212 nM ModE; lane 6, 255 nM ModE; lane 7, 340 nM ModE.


0


























2 :)&


























1 2 3 4 5 6 7 8


Figure 5 Protection of hyc DNA by ModE protein from
cleavage by DNase I. Lanes 3-5 with 0.1 mM molybdate in the
binding reaction; lanes 6-8, without added molybdate. Lane
1, sequencing ladder (only C track is shown); lane 2, DNA
alone; lanes 3 and 6, 1.77 pM ModE; lanes 4 and 7, 3.54 pM
ModE; lanes 5 and 8, 7.08 pM ModE. The numbers represent










inverted repeat sequence within this ModE-protected region,

sequences similar to those found in the modA

operator/promoter DNA to which ModE has been shown to bind

(4, 24, 58) are present in the hyc promoter. This includes

both the tetramer, GTTA, and pentamer sequence CATAT (Fig.

6). The 29-bp ModE-protected modA operator DNA contains

three copies of the pentamer sequence TAYAT (Y=pyrimidine)

and the tetramer sequence, GTTA, can also be detected at 9

locations within a 80-bp region in the modA operator DNA

(Fig. 6; panel B). The role of these tetramer sequences in

modA DNA is not known. The GTTA and CATAT sequences in hyc

promoter are separated by 7 bases which is the same distance

between the two pentamer sequences (TATAT and TACAT; regions

1 and 2) in the modA operator (24, Fig. 6). An inverted

repeat, CAAT A ATTG (-153 to -145), and another sequence,

TAAC T ATTG (-173 to -165) containing the GTTA tetramers,

are also found near the ModE-recognition/binding sequence in

the hyc promoter DNA. Partial protection from DNase I

cleavage can also be observed in the hyc DNA within the -173

to -165 region (Fig. 5). Apparently, ModE-molybdate

recognizes this DNA but stable ModE-molybdate-DNA complex

forms only with the 27-bp region between -177 and -204. The

DNA between -153 and -145 containing the TAAC T ATTG

sequence was not protected by ModE.














-210 ModE -170
GCCCGTTGGAGAGG GTTA TTTCGTGCATATCGCCT CCATTAACTAT

hyp -150 -130
T GCCAGCTACAAGCAATAATTGTGCCAGTGTTGATTATCCCTGCGGTG
--110 -90
1 FhlA I
AATAATGTCGATGATGTCGAAATGACACGTCGACACGGCG ACGAAATT
-70 -50 IHF -30
CATCTTTAGCTTAAAAATCTCTTTAA AACAATAAATT AAGTTGGC
-10 hyc
ACAAAAAATGCTTAAAGCTGGC A'FCTCTGTTAAACGGGTAACCTGACA



-50 -40 -30 -20 -Tu
GTTA GCAATAACTGC TGGGAA AATTCCGA GTTA GTC T TATATT

Region 1
modABCD
S 1o +20 +30 modA
TGCC TACAT AAC GTTA CAT TAAGGGGTTACCA ATG

Region 2 Region 3




Figure 6 Comparison of the ModE-binding regions in hyc
promoter DNA and modA operator/promoter DNA. Panel A, hyc
promoter DNA; Panel B, modA operator/promoter DNA. The
single boxed bases indicate the transcription start site for
hyc and hyp operons. The FhlA and IHF binding sites are
also indicated by light boxed regions. ModE binding regions
are represented by dark boxes. The numbers represent the
positions of the bases in relation to the transcription
start site (+1). An asterisk over the A at +5 indicates
hypersensitivity to DNase I cleavage. GTTA sequences
abundantly present within this region are underlined.










The amount of ModE required for protection of hyc

promoter DNA from DNase I was higher than 1 uM and this is

about 7-times higher than the amount of the transcriptional

activator, FhlA protein, required for protection of hyc

promoter DNA from DNase I hydrolysis (83). The same

preparation of ModE-molybdate protected modA operator DNA

completely from DNase I hydrolysis at a concentration of

less than 3 nM.

Previous mutational analysis of modA operator/promoter

DNA established that binding of ModE protein to the modA

operator/promoter DNA required regions 1 and 2 (24).

Mutations in region 3 did not eliminate stable ModE-DNA

complex as assayed by both in vivo and in vitro experiments,

but the presence of this region enhanced overall binding by

about 2-fold. Direct binding experiments also determined

that ModE is bound to the DNA of the modA operator/promoter

region as a dimer (24). This mutational analysis also

showed that the GTTA sequences also play a role in ModE-

molybdate binding to modA operator DNA. In addition,

comparison of DNA from the promoter regions of other

molybdate-contolled operons in E. coli and other organisms

revealed the presence of only two pentamer sequences,

similar to regions 1 and 2 (Fig. 6 and ref. 56, 58, 62).

Since the protected region in the hyc promoter DNA contains








60

a GTTA-7bp-CATAT motif, it appears that the ModE protein can

recognize and bind to these sequence motifs at a lower

affinity than to a double pentamer motif. Whether ModE is

binding as a monomer or dimer in this interaction is yet to

be determined.

The higher concentration of ModE protein required for

protection of the hyc promoter DNA in vitro may reflect the

role of ModE as a secondary activator rather than a required

primary regulator of transcription. Figure 7 depicts a

model for the secondary activation of the hyc operon by

ModE-molybdate complex. As per this model, FhlA-formate-

mediated transcription of hyc operon is increased by the

ModE-molybdate complex. Since in the absence of FhlA hyc is

not expressed, the ModE-molybdate may not be interacting

with RNA Polymerase directly. It is possible that the ModE-

molybdate interacts with FhlA-formate and increases the

ability of FhlA-formate complex to activate transcription.

This may indeed be an adaptation of E. coli to increase the

level of molybdoenzyme synthesis when molybdate is in excess

in the cytoplasm.

Biochemical Analysis of ModE and Molybdate-Independent
Mutant ModE

ModE Binding Sites in modA Operator/Promoter DNA

Although ModE protein was found to require molybdate in

its role as a transcriptional activator of hyc














Formate


hyc operon






Figure 7 A proposed model for activation of hyc operon by
both FhlA and ModE proteins. Bold line represents DNA from
the E. coli chromosome for the hyc-hyp operon intergenic
region.


I -


/00










transcription, partial protection from DNase I of hyc

promoter DNA was seen in the presence of high concentrations

of ModE even in the absence of molybdate (Fig. 5). In

addition, higher levels of ModE protein produced from high

copy modE+ plasmid also suppressed in vivo the need for

molybdate in transcription of hyc operon (data not shown).

These experimental results raise the possibility that the

ModE protein enhances transcription of hyc operon in the

absence of molybdate. In agreement with this possibility,

ModE was also reported to bind to modA operator DNA even in

the absence of added molybdate and protected the DNA from

DNase I hydrolysis (56, 58).

However, an alternate possibility that a small fraction

of ModE used in the in vitro experiments is contaminated

with molybdate and the analytical sensitivity of molybdate

determination methods is not high enough to detect its

presence can not be ruled out. Increasing the copy number

of modE* may also have a similar effect on transcription of

hyc operon by scavenging the very small amount of molybdate

transported by alternate molybdate transport systems. In

order to distinguish between these two possibilities, ModE

purified as described previously (25) was compared with ModE

purified using Ni-affinity method (*ModE). The Ni-affinity

purification method was chosen since it involves only a








63

limited number of steps, thereby decreasing the exposure of

ModE protein to large volumes of buffer which could be a

possible source of molybdate contamination. The E. coli

host used for expression of modE in these experiments,

strain BL21(DE3), also carries an unidentified mod operon

mutation and thus is incapable of transporting molybdate

when grown in rich medium not supplemented with molybdate

(unpublished data). ModE-binding to modA operator DNA was

used as the assay for molybdate contamination of ModE

because of the higher affinity of ModE to modA operator DNA

and to increase the sensitivity, DNase I footprinting was

used as the analytical tool.

The results presented in Figure 8 show that ModE alone

protected modA DNA from DNase I hydrolysis at a

concentration of 50 nM (lanes 2-4). A hypersensitive "A" at

position +5 can also be seen at this concentration of ModE.

Addition of molybdate to the binding reaction reduced the

amount of ModE required for complete protection to less than

5 nM (Fig. 8, lane 6). In the presence of *ModE protein

purified using the Ni-affinity procedure, protection of modA

operator/promoter DNA from DNase I-mediated hydrolysis was

dependent on molybdate at the ModE concentrations tested

(Fig. 8, lanes 11-18). Even at 100 nM ModE, the

hypersensitivity of the "A" at +5 was only slightly
















ii!flitiS i5Bi igi





"les9O

1,.000


- II -
Z::a


S n--&tft


S-- -- -m m_ -_


- W


4r
a



: a -


i
on


40
OM


M. W S W
*' a S


mII aL a
S
a a, S -


4WS t4Se M os o e e 0 4 eW0


* we
em


* i


* -
a


O S
a. cOO


a -*


1 2 3 4 5 6 7 9 10 12131415*11718



Figure 8 DNase I footprinting of modABCD operator/promoter
DNA with ModE proteins. Lanes 1 and 10, DNA alone (1.7 nM);
lanes 2-5 and 11-14, without molybdate; lanes 6-9 and 15-18,
with 0.1 mM molybdate in the binding reaction. Lanes 2-9,
native ModE protein; lanes 11-18, *ModE (contains extra
three amino acids, Gly, Ser and His in the N-terminal end -
see text for details). Lanes 2, 6, 11 and 15, 5 nM protein;
lanes 3, 7, 12 and 16, 10 nM protein; lanes 4, 8, 13 and 17,
50 nM protein; lanes 5, 9, 14 and 18, 100 nM protein. The
numbers represent the position of the bases with respect to
the transcription start site of the modABCD operon.


- S


L


v










increased (Fig. 8, lane 14). In the presence of molybdate,

5 nM ModE almost completely protected modA operator/promoter

DNA from hydrolysis by DNase I. These results suggest that

greater than 95% of the *ModE in this preparation is free of

molybdate and the active form of ModE binding to modA

operator DNA is ModE-molybdate.

Analysis of the ModE-molybdate protected region of the

modA operator/promoter DNA after DNase I-mediated cleavage

of the coding strand (Fig. 8, lanes 6-9; 15-18) revealed

that there are three areas of protection detectable at a

ModE-molybdate concentration as low as 5 nM. The first

protected region, "GTTATATT", spans from -15 to -8 and

overlaps the modA "-10" sequence (Fig. 9). The second ModE-

protected region, "GCCTACAT" spans from -4 to +4 of the

modA-operator/promoter DNA, while the third protected

region, "GTTACAT", is located between bases +8 and +14.

Each of the three DNase I-cleavage-protected regions

contains either a "TATAT" (protected region 1) or "TACAT"

(protected regions 2 and 3) sequence, which suggests that it

is these sequences which are recognized by ModE as the

target binding site. The independent protected sites are

separated by three bases, and the pentameric sequences in

regions 1 and 3 are preceded by the same two bases, GT.

Aside from the three protected regions, the base "A" at















-So -40 -30 -20
I I 1. 1 I
GTTA GCAATAACTGC TGGGAA AATTCCGAGTTA GTC T TATAT T

Region 1
modABCD
mdA +10 +20 +3 modA
TCCC TCAT AAC GTTACAT TAAGGGGTTACCAATG

Region 2 Region 3















Figure 9 DNA sequence of the modABCD operator/promoter region protected by ModE-
molybdate from DNase I cleavage. The three protected regions are enclosed by boxes.
Letters in grey boxes represent the pentamer sequences present within the ModE-
molybdate-protected regions. The numbers represent the positions of the bases in
relation to the transcription start site (+1). An asterisk over the A at +5
indicates hypersensitivity to DNase I cleavage. GTTA sequences abundantly present
within this region are underlined.










position +5, located next to the 3' end of the second

protected region is hypersensitive to DNase I-cleavage. An

inverted repeat of bases also exists within the ModE-

protected region of the modA operator/promoter DNA.

McNicholas et al. (58), based on DNase I footprinting,

reported that ModE protected the entire region of DNA

spanning from -18 to +10 even in the absence of molybdate.

The hypersensitive "A" at position +5 was not detectable in

the reported ModE-footprint (58). Although the

hypersensitive site is recognizable in the ModE-modA DNase I

footprint reported by Anderson et al. (4), the unprotected

bases between the regions 1 and 2 were not discernable. The

fact that the DNase I footprint presented in Figure 6

resolves the modA-operator/promoter region into discreet

ModE-binding regions with a distinct DNase I hypersensitive

site delineating protected regions 2 and 3 suggests that

ModE binds and protects the three indicated regions in vivo

also. The *ModE also protected the same bases with the

hypersensitive adenine in the modA operator DNA but the

amount of protein required for complete protection was

slightly higher (10 nM vs 5 nM for ModE-molybdate). Similar

ModE-molybdate footprint in the non-coding strand of the

modA-operator/promoter DNA also was observed (data not

presented). Since the *ModE protein preparation apparently








68
did contain less molybdate than the native ModE preparation

(and thus did not protect the modA operator/promoter DNA at

the tested concentrations), the ability of mutant ModE

proteins to interact with the modA operator/promoter DNA was

analyzed in a similar manner.

Interactions of Mutant ModE Proteins with modA
Operator/Promoter DNA

Since the molybdate-independent mutant ModE activated

transcription of hyc in the absence of molybdate (Table 6),

the ability of these proteins to bind to DNA in the absence

of molybdate was investigated. For these experiments,

selected mutant proteins were purified using His-tag

affinity chromotography to minimize molybdate contamination.

In agreement with the in vivo results with both hyc-

lacZ and modA-lacZ (25), the *ModE(A76V) did not protect

modA operator/promoter DNA from DNase I hydrolysis (Fig. 10,

lanes 9-11). Inclusion of molybdate to the reaction mixture

did not increase the affinity of *ModE(A76V) for the DNA

(data not presented). Although the *ModE(T125I) mutant

protein protected the same region of DNA protected by native

ModE, the amount of protein required for complete protection

in the absence of molybdate was close to 100 nM (Fig. 10,

lanes 6-8). At this concentration, the level of protection











-20




1 .*-.- **"


M.1


1 2 3 4 5 6 7 8


Siii



9 10 11


Figure 10 DNase I protection pattern of modABCD
operator/promoter DNA with *ModE and its mutant forms. The
binding reaction lacked molybdate. Lane 1, DNA alone (1.7
nM); lanes 2-5, *ModE; lanes 6-8, *ModE(T125I); lanes 9-11,
*ModE(A76V). Lane 2, 10 nM protein; lanes 3, 6 and 9, 50 nM
protein; lanes 4, 7 and 10, 100 nM; lanes 5, 8 and 11, 150
nM. Numbers indicate the position of bases in relation to
the modA transcription start site.


*10










by the *ModE(T125I) protein was about 2-times better than

the *ModE protein without added molybdate.

The molybdate-independent repression of modA-lacZ by

ModE(T125I) in vivo cannot be reconciled with only a 2-fold

higher apparent affinity of *ModE(T125I) to the DNA in the

absence of molybdate in comparison to native ModE (25).

Also, the amount of *ModE(T125I) protein required for

protection from DNase I cleavage was still about 20-fold

higher than the amount of ModE-molybdate required for

complete protection. This raised the question of why so

much mutant ModE protein was required for stable DNA-protein

interaction in the absence of molybdate, and led to a more

thorough kinetic analysis of both ModE and mutant ModE

proteins.

Kinetics of Interaction between ModE and modA Operator DNA

The apparent Kd for binding of ModE-molybdate to modA

operator DNA was previously reported to be about 25 nM (4,

58). This Kd value is significantly higher than the <5 nM

of ModE-molybdate required for complete protection of modA

operator/promoter DNA from DNase I hydrolysis (Fig. 8, lane

6). To resolve this difference, and to resolve the need for

relatively high concentration of *ModE(T125I) to protect the

modA operator/promoter DNA in the absence of molybdate, the

interaction between ModE and modA operator/promoter DNA was










determined using an Evanescent Wave Biosensor. Upon

addition of 13.5 nM *ModE-molybdate, a rapid response

signifying binding was observed and the maximum binding was

achieved within 80 sec (Fig. 11, panel A). In the absence

of added molybdate, ModE bound to the same DNA at a much

lower rate and the total response signifying the amount of

protein bound was also lower. However, both forms of

protein showed a concentration response to association with

DNA in the cuvette. Upon removal of excess ModE, the ModE

without molybdate dissociated from DNA at a higher rate than

the sample with molybdate. Using varying concentrations of

ModE protein over a series of binding experiments the

apparent Kd for this interaction between *ModE and modA

operator/promoter DNA (-18 to +25) was calculated to be 0.3

nM. An apparent K1 of 0.4 nM was obtained when native ModE

was used in these experiments. This apparent Kd value is

similar to the apparent 1E value reported for trp repressor/

trp operator DNA interaction (32). In the absence of

molybdate, this apparent K1 value for the interaction

between ModE and modA operator/promoter DNA increased to 8

nM.

When *ModE(T125I) mutant protein was used in these

experiments, no significant difference was observed either

in the rate of association or dissociation of the protein





















150 IS--1
A (B
+M0 +V) too

/ -' 1 -Mo
s 50 -Mo 50
-M+M
i o


0 100 200 300 400 0 200 400 60 800
Time (sec) Time (sec)










Figure 11 Optical Biosensor response curves for ModE-
binding to modABCD operator/promoter DNA. A, *ModE protein;
B, *ModE(T125I). Proteins were present at a concentration
of 13.5 nM in the cuvette. Upward arrow indicates addition
of ModE protein and the down arrow denotes the time when the
excess ModE was removed from the cuvette to monitor the
dissociation of ModE from the DNA. Molybdate, when included
was present throughout the experiment at a final
concentration of 1 mM. Response units are in arc.sec.










with the DNA both in the presence and absence of molybdate

(Fig. 11, panel B). The apparent Kd for the interaction

between *ModE(T125I) and modA operator DNA was 3 nM in the

presence of molybdate and 4 nM in the absence of molybdate.

These values are about 10 times higher than the values

obtained with native ModE-molybdate but about one-half of

the Kd value obtained with ModE alone. The *ModE(A76V)

protein did not bind to the DNA at a protein concentration

as high as 54 nM, either with or without molybdate (data not

shown). This is in agreement with the observed inability of

this mutant form of the protein to activate hyc-lacZ, to

repress modA-lacZ in vivo (25), or to protect the modA DNA

from cleavage by DNase I (Fig. 8). The kinetics of

*ModE(Q216*) interaction with DNA was found to be complex

and the apparent Kd value for this interaction was not

determined.

It is interesting to note that the calculated apparent

K, for *ModE(T125I) is about 3 nM while that of native ModE

is 8 nM. However, in vivo, the ModE(T125I) serves as a

regulator in the absence of molybdate while the native ModE

requires molybdate for activity. The rate of dissociation

of the two proteins from the DNA was also found to be

significantly different (Fig. 11). It is possible that the

ModE(T125I), upon binding to DNA dissociates from the DNA-










protein complex at a significantly lower rate than the

native ModE from the protein-DNA complex accounting for the

difference in vivo.

Similar studies with the trp repressor and a mutant trp

superrepressor (32) protein also show that the

superrepressor mutant form has a 25-fold higher affinity for

the operator DNA than the aporepressor (native repressor

without effector molecule bound). In the presence of

tryptophan, the native trp repressor had a 25-fold higher

affinity to the operator DNA than the superrepressor form.

The difference was again found to be related to the rate of

dissociation of the repressor from the DNA-protein complex.

Fluorescence Characteristics of Mutant ModE Proteins

The intrinsic fluorescence of ModE protein decreased

upon binding molybdate and this could be a result of

conformational change of the protein (4). Since the mutant

ModE proteins are molybdate-independent, it is possible that

the mutant proteins structurally mimic the ModE-molybdate

complex. If this is indeed the case, the intrinsic

fluorescence of the mutant proteins should be comparable to

the ModE-molybdate complex and significantly lower than that

of the ModE protein. When the *ModE protein was excited by

irradiation at 290 nm, the emission spectrum had a peak at

347 nm and a shoulder at 370 nm (Fig. 12). The peak of
































ModET125I


ModEQ216


'" .. .. .. .. .. 0
300 320 340 360 380 400 3M 320 340 360 380 400 300 320 340 36 380 400
Emission wavelength (nm) Emission wavelength (nm) Emission wavelength (nm)


Figure 12 Fluorescence emission spectra of ModE and mutant
ModE proteins. Excitation wavelength was 290 nM.


0 4
u




"20


*,MnO,4'


0C








76

emission shifted down to 343 nm in the presence of molybdate

and the relative fluorescence was also reduced by about 50%.

These results are in agreement with that of Anderson et al.

(4) for ModEmolybdate. ModE has three tryptophans

(positions 49, 131 and 186) and the tryptophan at 131 is

located within a sequence motif (125-TSARNQWFG-133) which

was conserved in several ModE homologs from other organisms

[(T/S)SARNQXXG], and also in a molybdopterin-binding protein

from Clostridium pasteurianum (21, 26, 29, 43, 48, 54, 93),

as well as in the nitrate sensor protein NarX from E. coli

(16, 37). It is possible that molybdate-binding to ModE

reduced the accessibility of tryptophan at 131 to water and

its fluorescence is not readily observable or is rapidly

quenched. Since a mutation which changed the T (to I at

125) or G (to D at 133) in E. coli ModE converted the mutant

protein to be molybdate-independent (25) it is possible that

the conformation of the mutant protein mimics ModE-

molybdate.

In agreement with the possible confirmation change, the

relative fluorescence of ModE(T125I) was about the level of

*ModE-molybdate complex and was not altered by molybdate

(Fig. 12). The peak of emission was 339 nm which is closer

to the peak of emission of ModE-molybdate (343 nm) than that

of ModE (347 nm). The intrinsic fluorescence of the C-

terminal deletion protein ModE(Q216*) was only about 35% of










ModE and was not affected by addition of molybdate (Fig.

12). It is possible that the deletion of the last 47 amino

acids profoundly altered the structure of the protein and in

this conformation, only one of the three tryptophans is

contributing to the fluorescence of the protein. These

results show that the molybdate-independent ModE mutant

proteins resemble ModE-molybdate in its conformation. This

"locked-on" conformation allowed the protein to bind to DNA

even in the absence of added molybdate but this conformation

is apparently not the same as that of ModE-molybdate since

the apparent Kd for ModE(T125I) was about 10-times higher

than that of the native ModE-molybdate.

MoeA Protein is a Required Second Component in Molybdate-
Dependent Expression of hyc Operon

Effects of Mutations in Genes Encoding MGD Biosynthesis
(mol) on Expression of PlacZ

Various biochemical and genetic experiments described

in the previous sections show that ModE-molybdate is a

required second transcriptional activator of hyc operon but

in a modE mutant, E. coli still produced FHL activity.

About 40% of parental level of expression of PhclacZ in a

modE mutant which is molybdate-dependent (Table 5),

indicates the presence of a second molybdate-dependent

activation system for hyc operon. To identify the protein

or proteins responsible for this ModE-independent,










molybdate-dependent transcription of hyc operon, initial

experiments focused on the role of the products of various

genes in the MGD biosynthetic pathway in this regulation.

For these experiments, mutations in various genes encoding

components of the biosynthesis of MGD were introduced into

strain WS160 and its modE derivative, WS161. 3-

galactosidase activities produced by these mutant strains

were determined and the results are presented in Table 7.

Strain WS160 produced about 1800 units of P-

galactosidase activity when cultured in LBG medium

molybdate. Mutations in moa (Strain WS175) and moeB

(Strain WS190) had no significant effect on the amount of P-

galactosidase activity produced whether the cultures were

grown in LBG or LBG + molybdate (Table 7). Mutations in

moeAB (Strain WS163) and mog (Strain WS165) reduced the

amount of P-galactosidase activity produced by the strains

by about 20-30%. However, a mutation in either the mob

(Strain WS164) or moeA gene (Strain WS167) significantly

decreased the amount of 3-galactosidase activity produced by

the mutants to about 35% of the parent level. The addition

of molybdate to the growth medium did not alter the amount

of activity produced by any of these mutant strains. Among

the double mutants, only the modE, mog (Strain WS194) and

modE, moeA (Strain WS172) had a significant negative effect










Table 7
in MGD


Effect of mutation in the genes coding for proteins
biosynthesis on ModE-independent PhylacZ expression


Strain Relevant genotype B-galactosidase activity'

LBG LBGM


WS160 wild type 1800 (100) 1900 (100)
WS175 moa252 1800 (96) 1800 (97)
WS190 moeB 1800 (99) 1600 (86)
WS163 moe251 1500 (81) 1300 (69)
WS165 mog256 1200 (66) 1200 (62)
WS164 mob252 650 (36) 580 (31)
WS167 moeA113 600 (33) 590 (32)
WS161 AmodE 580 (32) 610 (33)
WS193 AmodE moa252 770 (42) 770 (42)
WS174 AmodE mob252 840 (46) 840 (45)
WS194 AmodE mog256 250 (14) 190 (10)
WS172 AmodE moeA113 <50 (0) <50 (0)



A" -galactosidase activity is expressed as nanomoles
*min.-"*milligram of cell protein-'. Values in parentheses
represent % of activity produced by the mutant strain as
compared to the wild type, strain WS160.










on PhclacZ expression, in comparison to the corresponding

isogenic modE mutant, strain WS161. Among the two, modE,

moeA double mutant did not express PhclacZ or produce FHL

activity. These results suggest that the product of moeA

gene is required for the ModE-independent activation of hyc

transcription, and the product of mog also has a role in

this regulation.

The product of moeA gene (MoeA protein) has been

proposed to be involved in activation of molybdate upon

entry into the cell (27). Mutation in moeA can be

suppressed by either addition of sulfide to the culture

medium, or growth of the culture under limiting-sulfur

conditions. Growth under limiting-sulfur conditions

increases the expression of genes involved in the

biosynthesis of cysteine, which can produce sulfide

internally (42). However, strain WS172, when grown in the

presence of sulfide or in low-sulfur medium did not produce

FHL activity or P-galactosidase activity. This indicates

that sulfide can only suppress the need for MoeA in MGD

biosynthesis and not for its role in hyc expression. In

strain WS167 (moeA alone), the presence of ModE-molybdate

allows transcription of hyc operon, although at a lower

level, and ultimately to FHL activity in the presence of

sulfide.









81
The proposed role of the product of mog is in insertion

of molybdenum into the pterin portion of the MGD cofactor

(36). Strains carrying mutations in both modE and mog did

produce FHL activity at a lower level than that of the

respective parent strains. Since neither the MoeA nor the

Mog protein has been characterized biochemically, the

possibility remains that these proteins act in concert in

the production of a small molecule effector which is

required for hyc transcription.

Analysis of the amino acid sequence of MoeA protein did

not reveal any obvious DNA-binding domains to suggest that

this protein is a transcriptional activator. From genetic

studies reported previously (27) it is reasonable to

conclude that the product of MoeA is a small molecule

effector which is required for transcription. Given the

present knowledge of the activation of transcription of hyc

operon at the time of these studies, it is tempting to

speculate that this small molecule effector (product of

MoeA) is interacting with another transcriptional activator,

possibly the FhlA protein.

MoeA-dependent transcription of hyc operon is sensitive to
tungstate

Tungstate, an analog of molybdate, has been shown both

in vivo and in vitro to interact with ModE protein to

repress transcription of modABCD operon (24). Tungstate










also reduced the extent of fluorescence emission of ModE

protein in a manner similar to that of molybdate (4). In

addition, tungstate also bound to the periplasmic ModA

protein (68), suggesting that tungstate can substitute for

molybdate both in vivo and in vitro. Since ModE is an

activator of hyc operon, the possibility that tungstate

could substitute for molybdate as an effector for the ModE

protein in this activation, as well as on MoeA-dependent

expression of hyc, was investigated. Results of these

experiments are summarized in Table 8.

Addition of tungstate to the growth medium had no

effect on the expression of PhclacZ, in a wild type, strain

WS160, as expected. The native molybdate transport system

has a higher affinity for molybdate over tungstate, and in a

wild type molybdate apparently competes effectively with

tungstate. Tungstate had only a minimal effect on hyc-lacZ

expression in a modB mutant, strain WS162, (89% of the

parent level), which lacks the ability to transport trace

amounts of molybdate present in the medium suggesting that

tungstate can effectively replace molybdate for hyc

activation. However in the absence of ModE protein (modE

mutant strain WS161), tungstate failed to support activation

of hyc-lacZ (only 6% of the modE' parent level of p-

galactosidase activity). In a modE, modB double mutant






Table 8 Inability of Tungstate to substitute for Molybdate in MoeA-dependent
expression of hyc operon


Strain Relevant genotype B-galactosidase activitya

LBG LBGM LBGW


WS160 wild type 1800 (100) 1900 (100) 1900 (100)
WS162 modB 210 (12) 1900 (100) 1700 (89)
WS161 modE 820 (46) 830 (44) 110 (6)
WS178 modE modB 90 (5) 870 (46) 150 (8)
WS172 modE moeA <50 (0) <50 (0) <50 (0)
WS167 moeA 600 (33) 590 (31) 590 (31)



a 3-galactosidase activity is expressed as nanomoles min.-1-milligram of cell
protein-'. Values in parentheses represent % of activity produced by the mutant
strain as compared to the wild type, strain WS160, grown in the same medium.










(strain WS178) which cannot transport the trace levels of

molybdate in the medium, expression of hyc-lac was strictly

dependent on externally added molybdate and tungstate failed

to replace molybdate. This lack of expression of hyc-lacZ

in the presence of tungstate in strain WS178 is apparently

not due to competition between molybdate and tungstate in

the transport of molybdate. As expected, addition of

tungstate to the culture medium of moeA, modE double mutant,

strain WS172, did not restore expression of hyc operon.

These results show that ModE-independent expression of hyc-

lacZ (MoeA-dependent) is strictly molybdate-dependent and

tungstate can not replace it. However, ModE can utilize

either molybdate or tungstate as an effector in activation

of hyc operon (Strain WS167; Table 8).

FhlA Mutant Proteins Which Allow Expression of hyc Operon in
the Absence of Molybdate

FhlA protein is also a Molybdate-Sensor

Since the transcription of fhlA gene is independent of

molybdate levels in the cell (Table 4), and transcription of

hyc operon in a modE mutant still requires molybdate,

mutants of strain SE1781 [Q(hycD-lacZ), Amod, debg], were

sought to identify the second molybdate-sensor needed for

transcription of hyc operon. Spontaneous mutants of strain

SE1781 which no longer required molybdate for transcription




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EWD0IW30U_C78OB8 INGEST_TIME 2013-10-24T20:51:58Z PACKAGE AA00017698_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES