Expression of genes involved in prostanoid synthesis in the endometrium and chorioallantois cow

MISSING IMAGE

Material Information

Title:
Expression of genes involved in prostanoid synthesis in the endometrium and chorioallantois cow
Physical Description:
xi, 185 leaves : ill. ; 29 cm.
Language:
English
Creator:
Binta, Hilary
Publication Date:

Subjects

Subjects / Keywords:
Animal Sciences thesis, Ph.D   ( lcsh )
Dissertations, Academic -- Animal Sciences -- UF   ( lcsh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 2003.
Bibliography:
Includes bibliographical references.
Statement of Responsibility:
by Hilary Binta.
General Note:
Printout.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 030586753
oclc - 78276789
System ID:
AA00014263:00001


This item is only available as the following downloads:


Full Text










EXPRESSION OF GENES INVOLVED IN PROSTANOID SYNTHESIS IN THE
ENDOMETRIUM AND CHORIOALLANTOIS OF THE COW














By

HILARY BINTA


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA














ACKNOWLEDGMENTS

I would like to thank Dr. M. J. Fields for being my graduate advisor and chairman

of my supervisory committee. Without his constant encouragement and support it would

have not been possible to finish my dissertation. My thanks go to all of my committee

members (Drs. William Thatcher, Peter Hansen, Nancy Denslow and Maarten Drost) for

their valuable input and advice regarding my research. I would like to thank Dr. Shou-

Mei Chang for introducing me to most of the laboratory techniques that I used to conduct

my research. My thanks also go to Drs. Lokenga Badinga and Rosalia Simmen for

allowing me to use the facilities in their labs. I would also like to thank Allan Eldred and

the graduate students in our lab (Nicole Nichols and Elizabeth Johnson) for their

assistance and friendship during my stay in the lab.

I am grateful to the Institute for International Education for having offered me a

Fulbright Fellowship; and to Makerere University for granting me study leave to pursue

my graduate studies at the University of Florida. My gratitude also goes to University of

Florida for granting me an assistantship to complete my studies. I would like to thank my

family for their support throughout my education. My thanks also go to all of the

graduate students, faculty, and staff in the Department of Animal Sciences for their

friendship and assistance during my studies. I thank all of my friends especially Dr.

Edmond Kabagambe, Jurjen Luykx, Justin Sobota, and Eric Hiers for their constant

encouragement and support.








I would like to thank my wife Angela for all of the love, understanding, and

support that she gave me during my graduate studies. Last but not least, I would like to

thank my son Jeffrey for all of the happiness and love that he brings to my life.















TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS................. ..................... ............. ii

L IST O F T A B L E S .......................................................................... ............................ vii

LIST O F FIG U R ES ........................................................................... .................... ix

A B STR A C T ...................... ........ ......................................................................... xii

CHAPTER

S IN TR O D U C T IO N .................................................................... .... ................... 1

2 LITERATURE REVIEW ............................................................ .......................4
L uteolysis..................................................................... .......................................... 4
Functional Luteolysis...................................................... ........ ............... 7
Structural Luteolysis ................................................................. ......................8
Regulation of Prostaglandin Synthesis .................................................. 10
Inhibition of Luteolysis by the Embryo.......................................................................... 16
Resumption of Prostaglandin Synthesis after Maternal Recognition of Pregnancy.....21
Properties of the Key Elements Involved in Luteolysis.................................. .........22
Bovine O xytocin Receptor......................................................... ....................... 22
Oxytocin Receptor Signaling.......................... .................... ....................... 23
Regulation of Oxytocin Receptor ............................. .. ....................... 23
Prostaglandin H-Synthase-2....................... ..............................26
Structure of Bovine PGHS-2 Gene................... ... .............................26
Signal Transduction through PGHS-2 ........................................ ............ ....... 27
Regulation of PGHS-2 Gene Expression............................. ....................28
Prostaglandin F Synthase................................ .................................................. 30
Regulation of Prostaglandin F Synthase.............................. .....................32
Prostaglandin E Synthase............................................................. ..................... 33
Regulation of Prostaglandin E Synthase........................... ....................35
B ovine Luteal O T ..................................................... .................................... ......35








iv









3 RELEASE OF OXYTOCIN FROM OVARIAN VERSUS PITUITARY
TISSUES IN RESPONSE TO PGF2, IN OVARIECTOMIZED AND SHAM-
OVARIECTOMIZED COWS DURING THE PERI-IMPLANTATION PERIOD...40

In production ........................................................................ ....................................4 0
M materials and M ethods.............................................................. .......................42
R esu lts............................................................................... .....................................4 6
D iscu ssio n ...................................................... ................................... ....................5 1

4 EXPRESSION OF OXYTOCIN RECEPTOR, PROSTAGLANDIN G/H
SYNTHASE-2, E AND F SYNTHASES IN THE BOVINE ENDOMETRIUM AND
CHORIOALLANTOIS DURING THE ESTROUS CYCLE AND PERI-
IMPLANTATION PERIOD.................... .......... ......................57

Introduction ........................................................................ ....................................57
M materials and M ethods.............................................................. ....... ..............61
R esu lts............................................................................... .....................................89
D discussion .................................................................. ............................... .......... 112

5 GENERAL DISCUSSION AND CONCLUSIONS..................... .....................132

APPENDIX

A CONTRASTS FOR TREATMENT, PERIOD, TIME AND INTERACTIONS ......149

B DATA FOR OTR mRNA EXPRESSION.......................................................151

C DATA FOR 18S rRNA EXPRESSION.................... .... ...........................152

D DATA FOR PGHS-2 mRNA EXPRESSION ................... .....................153

E DATA FOR PGES mRNA EXPRESSION......................... .....................154

F DATA FOR PGFS mRNA EXPRESSION...................... ..........................155

R E F E R E N C E S ............................................................................. .............................156

BIOGRAPHICAL SKETCH ..................... ...............................185














LIST OF TABLES


Table page

2-1 Prostaglandin synthase enzymes that belong to the aldoketoreductase
superfam ily ................................ .... .................................. ...................... 32

2-2 Membrane associated proteins in eicosanoids and glutathione metabolism
superfam ily ................................................ .. ................ ... .............34

3-1 Experimental design for in vivo study to ascertain response of PGF2 or saline
on luteal OT release in peri-implantation cows ........................................43

4-1 Sequences of primers and probes used for RT-PCR................................... ..64

4-2 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in
intercaruncular endometrium of beef cows from day 7 to 18 of the estrous
cycle or pregnancy ............................................................. ... .....................90

4-3 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in inter-
caruncular endometrium of beef cows from days 0 to 18 of the estrous cycle......92

4-4 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in
intercaruncular endometrium of beef cows from days 7 to 50 of pregnancy ........93

4-5 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in the
chorioallantois of beef cows from days 30 to 50 of pregnancy..................... 95

4-6 Least squares means for OTR and PGHS-2 mRNA in caruncular endometrium
of beef cows from days 7 to 18 of the estrous cycle or pregnancy......................96

4-7 Least squares means for OTR and PGHS-2 mRNA in caruncular endometrium
of beef cows from days 7 to 18 of the estrous cycle............................................96

4-8 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in caruncular
endometrium of beef cows from days 7 to 50 of pregnancy................................98

4-9 Correlations between mRNAs for OTR, PGES, PGHS-2 and PGFS in
intercaruncular endometrium of beef cows on days 0, 3, 7, 14 and 18
of the estrous cycle.................................. ....... ..... ..............................101








4-10 Correlations between mRNAs for OTR, PGES, PGHS-2 and PGFS in
intercaruncular endometrium of beef cows on days 7, 14 and 18 of the estrous
cycle or pregnancy ................................... ........................ ......................101














LIST OF FIGURES


Figure pge

3-1 Experimental protocol for response of PGF2a or saline on luteal OT release
in peri-im plantation cow s .................................................. ........... .... 43

3-2 Least squares means ( SEM) plasma concentrations ofoxytocin in
ovariectomized and sham-ovariectomized PGF2a-treated cows, day 22
pregnant..................... ........................ ..............47

3-3 Least squares means ( SEM) plasma concentrations of oxytocin in
sham-ovariectomized PGF2a and saline-treated cows, day 22 pregnant................48

3-4 Least squares means ( SEM) plasma concentrations ofoxytocin in
sham-ovariectomized PGF2a and saline-treated cows, day 40 pregnant................49

3-5 Treatment by day of pregnancy by period interaction for oxytocin in
sham-ovariectomized cows, receiving PGF2a or saline on day 22 or 40 of
pregnancy ........................... ... ..... ......................... ................................ 50

4-1 Amplification plot showing serial dilutions of total RNA used in the validation
to quantitate O TR m RN A ............................................... .................... ... 70

4-2 Amplification plot showing serial dilutions of total RNA used in the validation
to quantitate 18S rRNA.................... ........... ...................... 72

4-3 Standard curve for estimation of efficiency of amplification of OTR gene for
validation of A CT m ethod......................................................74

4-4 Standard curve for estimation of efficiency of amplification of 18S rRNA
gene for validation of A A CT method............................. ......................76

4-5 Amplification plot showing serial dilutions of total RNA used in the
validation to quantitate PGHS-2 mRNA .................... ......................78

4-6 Standard curve for estimation of efficiency of amplification of PGHS-2
gene for validation of A ACT method................................................80

4-7 Amplification plot showing serial dilutions of total RNA used in validation to
quantitate PGES mRNA expression .................... .........................82









4-8 Standard curve for estimation of efficiency of amplification of PGES
gene for validation of A A CT method.............................. .................... 84

4-9 Amplification plot showing serial dilutions of total RNA used in
the validation to quantitate PGFS mRNA expression............................. ....86

4-10 Standard curve for estimation of efficiency of amplification of PGFS
gene for validation of A ACT method............................ .....................88

4-11 Oxytocin receptor concentrations in intercaruncular endometrium of beef cows:
cyclic-pregnant interaction by day 14-18. .................... .....................90

4-12 Prostaglandin G/H Synthase-2 mRNA concentrations in intercaruncular
endometrium of beef cows: cyclic-pregnant interaction by day 7 vs D14, 18......91

4-13 Regression curves for OTR, PGFS, PGHS-2 and PGES mRNA expression in
intercaruncular endometrium of beef cows from days 7 to 50 of pregnancy ........94

4-14 Oxytocin receptor and PGHS-2 mRNA concentrations in caruncular endometrium
of beef cows, cyclic-pregnant by day 14-18 interaction for OTR and day 7-14
for PG H S-2 ......................... .................. ...................................................97

4-15 Regression curves for OTR and PGHS-2 mRNA expression in caruncular
endometrium of beef cows from days 0 (estrus) to 18 of the estrous cycle...........99

4-16 Regression curves for OTR and PGHS-2 mRNA expression in caruncular
endometrium of beef cows from days 7 to 50 of pregnancy..............................100

4-17 Immunohistochemical staining of bovine OTR in representative sections of the
intercaruncular endometrium during the estrous cycle......................................105

4-18 Immunohistochemical staining of bovine OTR in representative sections
of the intercaruncular endometrium during the peri-implantation period ...........107

4-19 Immunohistochemical staining of bovine PGHS-2 in representative
sections of the intercaruncular endometrium during the estrous cycle................109

4-20 Immunohistochemical staining of bovine PGHS-2 in representative sections
of the intercaruncular endometrium during the peri-implantation period ...........1 11

5-1 Hypothetical model for the regulation of OTR, PGHS-2, PGES and PGFS
expression during the bovine estrous cycle ... .................................................146

5-2 Hypothetical model for the regulation of OTR, PGHS-2, PGES and PGFS
expression during the peri-implantation period .....................................148














Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

EXPRESSION OF GENES INVOLVED IN PROSTANOID SYNTHESIS IN THE
ENDOMETRIUM AND CHORIOALLANTOIS OF THE COW

By

Hilary Binta

December 2003

Chairman: Michael J. Fields
Major Department: Animal Sciences

Oxytocin (OT) produced by the corpus luteum (CL) and the neurohypophysis

augments pulsatile prostaglandin F2 (PGF2.) that ultimately leads to luteolysis. Enzymes

involved in the pathway for prostaglandin synthesis have a role in luteolysis and may

have important functions during the implantation period that influence embryo survival

or loss. Our objectives were:

1) To determine the effect of PGF2a on plasma OT in peri-implantation cows.

2) To determine how the expression of oxytocin receptor (OTR), prostaglandin G/H

synthase-2 (PGHS-2), and E and F synthases (PGES and PGFS) changes in the

endometrium of cyclic cows.

3) To ascertain the effect of the concepts on expression of prostaglandin synthesis

enzymes and OTR during the period of maternal recognition of pregnancy.








4) To determine whether OTR and prostaglandin synthesis system are re-established after

maternal recognition of pregnancy. To evaluate the role of OT during the peri-

implantation period, ovariectomized (Day 22) or ovarian intact (Days 22 and 40)

pregnant cows were challenged with either PGF2 or saline. A dose of 25 mg PGF2.

resulted in significant release ofluteal OT in Day 22 but not Day 40 cows. Expression of

OTR and PGES was high at estrus and low during the luteal phase. The PGHS-2 was

highly expressed during the late luteal phase, proestrus and from days 14 to 22 of

pregnancy. Expression of PGES decreased during the peri-implantation period. The

PGFS was expressed highly on Days 7 and 18 of the cycle and comparable days of

pregnancy, but was down-regulated later. Positive correlations were observed for

OTR/PGES, PGES/PGFS and OTR/PGFS.

It is concluded that the CL is capable of secreting OT in response to PGF2a during

the early peri-implantation period. The neurohypophysis is a source of plasma OT during

peri-implantation period. The low expression of OTR mRNA and protein during peri-

implantation and low luteal OT may not be adequate to initiate pulsatile PGF2a synthesis.

Increased expression of PGES at estrus may be involved in ovulation. Increased PGHS-2

may be beneficial during implantation. The low luteal OT, decreased expression of OTR,

PGFS and PGES during the peri-implantation period may enhance maintenance of

pregnancy.














CHAPTER 1
INTRODUCTION

During the estrous cycle in cattle, prostaglandin F2a secreted from the

endometrium plays an important role in luteolysis whereby it causes regression of the

corpus luteum and enables ovulation of a new follicle (Milvae et al., 1996). Prostaglandin

F2a also plays an important role during parturition through its actions to cause contraction

of the uterus. Prostaglandin E2, on the other hand, is involved in cervical relaxation during

estrus and parturition (Mizrachi and Shemesh, 1999; Fuchs et al., 2002). Prostaglandins

are synthesized by hydrolysis of membrane phospholipids by phospholipases to

arachidonic acid. Arachidonic acid is converted to PGH2 by cyclooxygenases

(Prostaglandin G/H synthases). The PGH2 is converted to either PGF2. or PGE2 by

prostaglandin F synthase (PGFS) or prostaglandin E2 synthase (PGES) respectively.

Prostaglandin E synthase stimulates PGE2 which is implicated in the implantation process

(Emond et al., 1998; Leung et al., 2000).

During early stages of pregnancy, a change in the pattern of synthesis of

prostaglandin synthesizing enzymes is necessary to enable the embryo to inhibit the

luteolyic PGF2a pulses that occur towards the end of the cycle. Failure of this to occur

may lead to luteolysis and pregnancy loss and could be a potential cause for infertility in

cattle. For the embryo to survive, it must secrete adequate interferon-tau (IFN-i), the

signal for maternal recognition of pregnancy, to depress the pulses of PGF2. and sustain

pregnancy (Thatcher et al., 1995; Robinson et al., 1999; Mann and Lamming, 2001).








Oxytocin is produced by the large luteal cells from the corpus luteum (CL) as well

as the neurohypophysis (McCracken et al., 1995; Fields and Fields, 1996). Studies have

indicated that OT plays a modulatory role in the luteolytic process (Kotwica et al., 1997).

During pregnancy, OT-containing luteal granules are released at about the time

when implantation is taking place (Melton et al., 1951; King et al., 1982; Fields et al.,

1987; Wooding and Flint, 1994). A possibility exists that during the release of these OT-

containing granules, luteolytic pulses of PGF2a could be initiated. An active OT/OTR

system may be functionally coupled to the prostanoid system during this period and in

circumstances where the luteotrophic signals are not strong there could be the possibility

of failure to establish and maintain pregnancy (Mann and Lamming, 2001). Exogenous

OT has been shown to interfere with embryonic development and resulted in reduced

pregnancy rates when administered to cows during 5 to 8 days of pregnancy (Lemaster et

al., 1999). Furthermore, premature uterine secretion of PGF2a has been shown to lead to

short luteal phases and early embryo loss in cattle (Copelin et al., 1987; 1989). Bridges et

al. (2000) suggested that PGF2a secreted by the endometrium or embryo may be

beneficial for maintenance of pregnancy but concentrations beyond some threshold can

lead to luteal regression and loss of pregnancy. It is important to know whether PGF2Q

causes release of these granules since OT could augment luteolytic pulses in case an

embryo does not produce sufficient interferon-T (IFN-t) or if the CL does not produce

sufficient progesterone to sustain pregnancy. The luteolytic machinery becomes

reestablished after maternal recognition of pregnancy, since neither temporary presence

of the concepts or IFN-T infusion into the uterus extends the CL lifespan more than a

few days (Northey and French, 1980). Thus post-implantation synthesis of PGF2z








synthesis is important since activation of PGF2a after maternal recognition of pregnancy

may lead to pregnancy loss.

Although the expression of endometrial PGHS-2 and OTR have been well

described during the estrous cycle and early pregnancy in cattle, no comprehensive study

has looked at the change in expression patterns of PGHS-2, PGES, PGFS and OTR

before, during and after maternal recognition of pregnancy using comparisons between

cyclic and pregnant cows on similar days. The results from this study will increase our

understanding about peri-implantation events and may prove useful in strategies to

minimize embryo losses during this period.

The first objective of this dissertation was to determine the effect of PGF2a on

plasma OT in beef cows during the early (day 22) and late (day 40) peri-implantation

period. The second objective was to determine how OTR and the prostaglandin

synthesizing enzymes change during the process of luteolyis. The third objective was to

ascertain the effect of the concepts on PGF2a synthesis during early stages of pregnancy.

The final objective was to determine whether the OTR and the prostaglandin synthesis

system are re-established after maternal recognition of pregnancy.














CHAPTER 2
LITERATURE REVIEW


Luteolysis

Luteolysis is the process by which a functional CL is converted into a non-

functional corpus albicans. It occurs at the end of the estrous cycle or at the end of

pregnancy. Prostaglandin F2, is the luteolytic agent that is released from the uterus and

transported to the CL where it induces luteolysis. It is usually released in a series of

pulses (Nancarrow et al., 1973). Transfer of PGF2. to the uterus involves a

countercurrent mechanism (Thatcher et al., 1984) as well as systemic delivery (Ward et

al., 1976). The fact that both systemic and local transfer of PGF2. occur in cows is further

supported by the finding that only 65% of [ H] PGF2, is metabolized in one passage

through the lungs of cows (Davis et al., 1985).

Luteolysis involves changes in expression of many genes in the small and large

luteal steroidogenic cells and the endothelial cells within the CL (Mamluk et al., 1998;

Ivell et al., 1999; Meidan et al., 1999). Endothelin-1 (ET-1) plays an essential role in

PGF2,-induced luteal regression (Meidan et al., 1999) and lack of ET-1 in early bovine

CL has been attributed to their refractoriness to exogenously administered PGF2,. The

mechanism of refractoriness is not well understood but has been attributed to several

factors. Endothelins (ET) are initially synthesized as precursor proteins called preproETs

(ppT) that are first cleaved to generate big ETs and then processed to active peptides by








endothelin converting enzyme (ECE). Endothelin converting enzyme-1 (ECE-1) cleaves

inactive big ET-1 to active ET-1 peptide (Levy et al., 2003). Prostaglandin F2a regulates

the amount of mRNA encoding ECE-1 in a cycle-phase specific manner, being

constitutively expressed in CL at days 4 and 10 of the estrous cycle (Wright et al., 2001).

The pulsatile release of OT by the neurohypophysis and CL stimulates the production of

pulsatile uterine PGF2a (Goff, 1991). Oxytocin stimulation of PGF2a increases at

luteolysis (Lafrance and Goff, 1985). Increase in response to OT is due to the increase in

number of OTR (McCracken et al., 1999). Oxytocin binds to endometrial OTR to

stimulate PGF2a production (Roberts et al., 1976, Silvia et al., 1991). The initial release

of PGF2a triggers release of additional OT from the CL by a positive feedback loop (Flint

et al., 1990). Whereas PGF2, is luteolytic, PGE2 is luteotrophic (Pratt et al., 1977; Bazer

et al., 1991).

In vitro, PGF2a is synthesized in greater quantity in epithelial cells than in

stromal cells, whereas stromal cells synthesize more PGE2 than epithelial cells (Fortier et

al., 1988; Desnoyers et al., 1994). Recombinant ovine IFN-T and recombinant bovine

IFN-T preferentially stimulate PGE2 in epithelial cells and both prostaglandins in stromal

cells (Asselin et al., 1997a). Asselin et al. (1997a) suggested a role for PGE2-9-

ketoreductase (9K-PGR) which converts PGE2 to PGF2a. The presence of 9K-PGR in the

endometrial epithelial cells could lead to synthesis of more PGF2a whereas its absence in

the stromal cells would lead to a net accumulation of PGE2. Alternatively IFN-T may

inhibit or downregulate 9K-PGR activity in epithelial cells so that PGHS-2 is upregulated

resulting in an accumulation of PGEz (Asselin et al., 1997a). However, there are now

doubts that 9K-PGR exists in the bovine endometrium. There exists a positive feedback









pathway in the CL of cattle whereby a small amount of PGF2a stimulates intraluteal

production of PGF2, due to induction of PGHS-2. Critical regulation of this positive

feedback pathway is mediated by protein kinase C (PKC)-mediated activation of

transcriptional factors that interact with the E-box in the 5'- flanking region of the PGHS-

2 gene (Diaz et al., 2002).

Corpus luteum growth necessitates increased vasculature and several factors have

been implicated in this vascular growth (Webb et al., 2002). The angiogenic factors,

fibroblast growth factor and vascular endothelial growth factor are involved in regulation

of luteal function (Redmer and Reynolds, 1996). The major histocompatibility complex

(MHC) proteins may also play a role during luteolysis. Changes in MHC expression on

luteal cells have been implicated in T lymphocyte-mediated immune response during

luteolysis (Penny et al., 1999). Insulin-like growth factors (IGF-I and IGF-II) are intra-

ovarian factors that have been reported to modulate luteal function and luteal

steroidogenesis by changing LH receptor stability in granulosa cells (McArdle and

Holtorf, 1989; Hirakawa et al., 1999).

Controversy still exists on the role of OT during luteolysis although numerous

studies have demonstrated that OT is crucial for luteolysis in cattle (Lamming and Mann,

1995; Bums et al., 1998). However, other studies suggest that luteolysis can be initiated

without OT. Kotwica et al. (1997) showed that continuous blockade of OTR using a

specific OT antagonist from day 15 until estrus did not affect luteolysis. This led to the

suggestion that OT may play a permissive role or may contribute to the completion of

luteolysis once it has begun (Kotwica et al., 1997).








Schams et al. (1985) observed a decrease in OT secretion after midluteal phase of

the estrous cycle in hysterectomized cows, suggesting that the PGF2a synthesized in the

uterus stimulates release of OT during luteolysis. Blair et al. (1997) showed that luteal

and plasma concentrations of OT during spontaneous and induced luteolysis in heifers

remained unaltered when measured using an in vivo microdialysis system.

Oxytocin from the neurohypophysis appears to be released in a pulsatile way to

initiate PGF2, secretion from the uterus (Silvia et al., 1991). Responsiveness of the uterus

to OT increases at luteolysis when endogenous pulsatile secretion of PGF2a has begun.

Progesterone promotes accumulation of arachidonic acid and PGHS-2 in the uterus, thus

ensuring that luteolysis occurs at the appropriate time (Silvia et al., 1991).

Functional Luteolysis

Functional luteolysis is the reduction in progesterone concentration associated

with the luteolytic process caused by PGF2a (McCracken et al., 1999). It has been

attributed to several factors, namely a change in luteal membrane composition and

decreased fluidity which may prevent luteinizing hormone (LH) receptor aggregation and

blocking LH function. This could prevent coupling to adenylate cyclase and cause a

decline in cyclic adenosine monosphosphate (cAMP) and progesterone synthesis

(Henderson and McNatty, 1975). In addition, PGF2I activates the phospholipase C

(PLC) pathway leading to an increase in calcium ions in the large luteal cells which is

associated with luteolysis (McCracken et al., 1999). The PGF2a exerts antisteroidogenic

effects that involve synthesis of progesterone from cholesterol. It may also affect

luteolysis by altering luteal blood flow to the ovary with the CL. Decreased ovarian blood

flow has been suggested as one of the mechanisms by which PGF2, leads to luteolysis








(Niswender et al., 2000). It has recently been shown that there is increased blood flow

which parallels increased CL volume and plasma concentration of progesterone from

days 4 to 6 of the estrous cycle (Acosta et al., 2002). It was further observed that mid-

cycle CL have decreased blood flow suggesting that the lack of intraluteal vascular

response to PGF2a may be one of the reasons for early cycle CL failure to respond to

PGF2a (Acosta et al., 2002).

Structural Luteolysis

Structural luteolysis involves involution of the CL. Several factors have been

implicated in structural luteolysis including tumor necrosis factor at (TNFa) that has been

shown to inhibit LH-induced progesterone production in bovine luteal cells (Benyo and

Pate, 1992). Monocyte chemoattractant protein expressed in the CL acts as a mediator of

invasion of immune cells that are involved in phagocytosis as well as production of

cytokines which play a role in structural luteolysis (Tsai et al., 1997).

Matrix metalloproteinase-2 (MMP-2) is localized in the bovine luteal endothelial

cells and is involved in angiogenesis in the CL (Zhang and Tsang, 2001). Membrane type

1 matrix metalloproteinase (MT1-MMP) activates pro-MMP2 to MMP-2. Active MTI-

MMP and MMP-2 are increased coordinately in mid to late stage bovine CL and may be

involved in digestion of extracellular matrix and structural regression of the CL (Zhang et

al., 2002). Tissue inhibitors of metalloproteinases (TIMP) are produced by the CL to

inhibit the actions of tissue metalloproteinases that are involved in tissue remodeling of

the extracellular matrix. In particular TIMP-I in the bovine CL increases tremendously

24 h after PGF2,-induced luteolysis (Smith et al., 1996).








During structural luteolysis, cells of the CL undergo apoptosis (Juengel et al.,

1993; Rueda et al., 1997). Immune cells (macrophages and T-lymphocytes) have been

reported to play a role in structural luteolysis (Penny et al., 1999). It is seems that this

mechanism is mediated by the Fas-Fas ligand system. T-lymphocytes express the Fas

ligand and TNFa whereas macrophages are the main source of the TNFa. The Fas

antigen is a member of the TNFu family of receptors that interacts with its ligand to

induce apoptosis (Nagata and Goldstein, 1995). Structural luteolysis is enhanced by the T

cells sending apoptotic signals to the luteal cells where Fas expression is induced by

leukocyte-stimulated cytokines such as TNFu and interferon gamma (IFN-y). It has been

shown that IFN-y by itself reduces the viability of bovine luteal cells and its cytotoxic

effect is augmented when combined with TNFa (Taniguchi et al., 2002). However, TNFa

has no effect on bovine luteal cell death until day 5 oft uliurc i Ben ., and Pate, 1992).

The Fas mRNA is expressed highly in bovine luteal cells about the time of luteolysis

implicating its role in apoptosis-mediated structural luteolysis (Taniguchi et al., 2002).

The TNFa is secreted by macrophages in response to PGF2. in the CL (Wuttke et al.,

1997). Its effects are mediated via the tumor necrosis a receptor 1 (TNFR1) whose

mRNA was shown to be expressed in endothelial and steroidogenic cells of the bovine

CL with highest expression in endothelial cells (Friedman et al., 2000). Furthermore,

TNFR1 was expressed highest on days 18 21 during the time of luteal regression

(Friedman et al., 2000).

Luteal endothelial cells also express progesterone receptor which protects against

programmed cell death. Endothelial cell-derived ET-I causes a decline in steroidogenic

activity thus leading to functional luteolysis (Meidan et al., 1999). However, ET-1 may








also lead to structural luteolysis via a mechanism where it regulates apoptosis. Friedman

et al. (2000) proposed that, during luteolysis, PGF2a stimulates secretion of ET-1 and

macrophages secrete TNFa. There is a synergistic effect between TNFa and ET-1 to

inhibit steroidogenesis and reduce progesterone secretion. This leads to increased

expression of TNFR1 and thus facilitates TNFa induced apoptosis and structural

luteolysis (Meidan et al., 1999).

Regulation of Prostaglandin Synthesis

Prostaglandin is the luteolytic agent in cows and its regulation is dependent on

several pathways that involve OT, steroids and cytokines (Okuda et al., 2002). The

production of PGF2a in the bovine endometrium is regulated by estrogens and

progesterone at two levels, basal and OT-stimulated (Skarzynski et al., 1999).

Progesterone has been shown to stimulate basal production of PGF2a in endometrial cells

(Xiao et al., 1998). The stimulatory effect may be associated with post-translational

events since it has been shown that progesterone stimulated basal PGF2a synthesis in

bovine endometrial cells but did not increase expression of either PGHS-2 or PGFS

mRNA (Asselin et al., 1996; Xiao et al., 1998; Skarzynski et al., 1999; Okuda et al.,

2002).

Progesterone is the principal regulator of endometrial PGF2a secretion during the

intraluteal phase (Skarzynski et al., 1999). Both OT and progesterone increased PGF2,

synthesis from bovine endometrium in vitro. Estrogen alone had no effect but augmented

that of progesterone (Skarzynski et al., 1999). Further evidence of progesterone

regulation comes from studies which have shown that PGF2. and PGE2 concentrations








are higher in bovine endometrium from the uterine horn ipsilateral to the active CL and

are positively correlated with progesterone concentrations (Cerbito et al., 1997).

A positive feedback pathway exists in large luteal cells in the CL, such that PGF2,

stimulation induces intraluteal PGF2. as a result of induction of PGHS-2. The effect of

progesterone on uterine sensitivity to OT involves a non genomic action (Zinng et al.,

1998). Progesterone binds to the OTR with high affinity and inhibits binding of OT to its

receptor. Intact cows in the mid-luteal phase and ovariectomized progesterone-primed

cows secrete PGF2, after treatment with estrogen (Thatcher et al., 1984), suggesting that

progesterone priming is necessary to induce PGF2a secretion by the bovine uterus and

that estrogen may just be acting as a modulator of this process (Okuda et al., 2002).

Mann et al. (2001) suggested that the most likely mechanism by which progesterone

treatment induces responsiveness to oxytocin may be through the upregulation of post

receptor signaling pathways and/or enzymes involved in prostaglandin synthesis.

Progesterone appears to promote uterine accumulation of arachidonic acid, PGHS-2 and

other substances needed for synthesis of PGF2. and also exerts a suppressive effect on

secretion that is decreased after prolonged exposure (Silvia et al., 1991).

Estradiol on the other hand has both stimulatory and inhibitory effects on PGF2a

secretion from the endometrium (Wathes and Lamming, 1995). Estradiol has been shown

to have no effect on PGF2a secretion from the endometrium alone whereas, in

combination with progesterone, it amplified the stimulatory effects of progesterone

(Skarzynski et al., 1999). Oxytocin stimulation of prostaglandin secretion is induced in

ovariectomized animals by treatment with progesterone alone, suggesting that estrogen is

not essential for increase in response to OT (Goff and Kombe, 2003). However, estrogen









may play a role of completion of luteolysis by stimulating the increase in OTR. Estradiol

induces PGF2a production in vivo (Thatcher et al., 1984) and increases OTR expression

after priming with progesterone (Lamming and Mann, 1995).

Under in vitro conditions, OTR upregulates spontaneously in endometrial tissues

taken from any stage of the estrous cycle (Sheldrick et al., 1993), suggesting a form of

constitutive upregulation of OTR. In vivo, OTR and its mRNA are upregulated within a

short window of 2 to 3 days around the day of estrus, are undetectable between days 6

and 15, and start to develop in the luminal epithelium of the endometrium between 15

and 17 days after estrus (Fuchs et al., 1990; Jenner et al., 1991; Mann and Lamming,

1995; Robinson et al., 1999). They become apparent later in the superficial glands of the

endometrium (Robinson et al., 2001). Oxytocin receptors were shown to appear before

changes in plasma concentrations of progesterone or estradiol (Robinson et al., 2001)

indicating that upregulation of OTR is not a result of changes in plasma steroid

concentrations.

In the bovine endometrium, the highest number of OTR are expressed in the

luminal epithelium and it is this layer of cells that is most responsive to exogenous OT in

terms of PGF2, secretion (Robinson et al., 2001). Development of OTR in the luminal

epithelium alone is probably sufficient to elicit full luteolytic secretion ofPGF2z (Wathes

and Lamming, 1995). Development of OTR in the caruncular stroma and deep glands at

estrus is dependent on estrogen (Wathes and Lamming, 1995). The decreased expression

of OTR after estrus is reportedly due to decreased plasma estradiol concentrations and the

further decline in the luteal phase is due to progesterone acting via high concentrations of

progesterone receptors present in the stroma (Lamming and Mann, 1995). This action is








probably indirect since no progesterone response element has been identified in the

bovine OTR gene promoter (Bathgate et al., 1995).

In most cells and tissues, PGHS-2 is an inducible enzyme that is not expressed

under normal or resting conditions (Smith et al., 1996; Kniss, 1999; Smith et al., 2000).

Both the PGHS-2 mRNA and protein are expressed in the endometrium at low levels

between days I and 12 and at high levels between days 13 and 21 of the estrous cycle

(Arosh et al., 2002). The PGHS-2 mRNA and protein are highly correlated, suggesting

that PGHS-2 expression is regulated at both the mRNA and protein levels. Maximal

expression of PGHS-2 occurs at the expected time of luteolysis (days 16 to 17) in the

cow. The PGHS-I mRNA and protein are not expressed in the bovine endometrium on

any day of the cycle (Arosh et al., 2002). Prostaglandin H synthase-2 and PGES may be

responsible for PGE2 production during the estrous cycle. The PGES and PGHS-2 are

functionally coupled in the preovulatory follicle (Filion et al., 2001) and in the

endometrium (Arosh et al., 2002). This functional coupling appears to be an efficient

mechanism for regulation of the conversion of arachidonic acid into PGE2.

Prostaglandin H synthase-2 is expressed in preovulatory follicles during the

estrous cycle, with levels low at onset of estrus and 18 h after estrus but high levels 24 h

after estrus (18 h post-LH surge). This result suggests that induction of PGHS-2 in bovine

preovulatory follicles is physiological and dependent on the LH surge (Liu et al., 1997).

Exogenous, PGF2 probably acts through protein kinase C and calcium-dependent

pathways to stimulate large luteal cells to express PGHS-2 which then leads to luteal

production of PGF2, (Tsai et al., 1996; Tsai and Wiltbank, 1997). Thus the PGF2, creates








an autocrine/paracrine loop that augments the luteolytic effect of PGF2a produced by the

uterus.

Oxytocin stimulates PGF2, secretion from the endometrium during the follicular

phase, estrus, early luteal and mid to late luteal stages of the estrous cycle (Silvia and

Taylor, 1989; Meidan et al., 1993; Mirando et al., 1993; Wolfenson et al., 1993; Xiao et

al., 1999; Miyamoto et al., 2000). Oxytocin may play a supportive role to regulate PGF2a

synthesis since it has been reported that OT is not necessary for luteolysis in cows

(Kotwica et al., 1998b). It has been reported that the concentrations of OT in intact and

microdialyzed CL are low during spontaneous luteolysis (Parkinson et al., 1992; Douglas

and Britt, 2000). Furthermore, Kotwica et al. (1997) showed that administration of OT

antagonist at the time of luteolysis did not stop the luteolytic process nor did it affect the

duration of the estrous cycle in heifers.

Several studies have shown that OT binding to its receptor stimulates uterine

production of PGF2, (Newcomb et al., 1977; Silvia and Taylor, 1979; Lafrance and Goff,

1990). This effect is also affected by ovarian steroids which influence the responsiveness

of the uterus to OT (Lafrance and Goff, 1985; Lamming and Mann, 1995). Oxytocin

stimulates PGF2a synthesis by endometrial cells via increased intracellular calcium ions

(Bums et at., 1998). The increase in calcium ions is due to stimulation of PLC and

inositol triphosphate (IP3) in the PKC signaling pathway (Bums et al., 1998). Treatment

of endometrial epithelial cells with OT followed by progesterone inhibits the increase of

calcium ions, suggesting that progesterone blocks the synthesis of PGF2, by disrupting

this intracellular pathway. It appears that this effect is mediated through the direct

interference of the interaction of OT with its own receptor (Bogacki et al., 2002).








Luteinizing hormone has been implicated in the synthesis and regulation of PGF2,

production (Freidman et al., 1995; Shemesh et al., 2000), its effect being restricted to mid

to late luteal phases of the cycle (Shemesh, 2001). Prostaglandin F2a acting via the PKC

pathway, may activate an increase in intracellular calcium which in turn stimulates PGF2,

synthesis from the endometrium to form an autoamplification system of its own

production (Bums et al., 1997; Skarzynski et al., 1999).

Norepinephrine stimulates PGF2, release during the follicular phase and early

luteal phase, time periods when the influence of progesterone is minimal (Skarzynski et

al., 2001). It has been demonstrated that TNFa receptors are present in the bovine

endometrium (Skarzynski et al., 2000a). Furthermore TNFa can stimulate release of

PGF2, from bovine endometrial stromal cells but not in epithelial cells (Skarzynski et al.,

2000a). Moreover, TNFa stimulates synthesis of PGF2, during both luteal and follicular

phases of the cycle. This effect is in contrast to the effects of OT which only stimulates

PGF2, synthesis during the follicular phase. The fact that the bulk of PGF2, is produced

by the epithelial cells (Asselin et al., 1996; Skarzynski et al., 2000a) whereas TNFa

stimulation is directed to the stromal cells may suggest that an auto-amplification loop of

PGF2, synthesis may exist early in luteolysis. Tumor necrosis factor a may play an active

role in the initiation of luteolysis and later, OT-induced PGF2, plays a role in the

completion of luteolysis (Okuda et al., 2002).

Arosh et al. (2002) showed co-expression of PGHS-2 and PGES mRNA in bovine

endometrium during the estrous cycle. The PGES was co-expressed at high level with

PGHS-2 between days 13 and 21 of the estrous cycle, suggesting that the mechanism for

the synthesis of PGE2 is already present by day 13 of the cycle. Prostaglandin E synthase








was expressed at moderate, low and high levels on days 1 3, 4 12 and 13 21 of the

estrous cycle, respectively (Arosh et al., 2002).

Inhibition of Luteolvsis by the Embryo

Expansion and cell division of the embryo is controlled by factors secreted by the

endometrium, but the complete nature of these factors is still unknown (Goff, 2002). It is

necessary that the concepts elongates rapidly so as to attach to as much area of the

endometrium as possible in order to reduce the secretion of PGF2, (Goff, 2002).

Interferon-r is produced by the trophoblast between days 15 to 24 of gestation (Bartol et

al., 1985) and prevents luteolysis by suppressing endometrial PGF2a secretion via

downregulation of expression of estrogen and OTR (Spencer et al., 1995b). Evidence

that the embryo or IFN-T inhibits luteolysis is provided from studies by Knickerbocker et

al. (1986) where they showed that administration of whole concepts secretary proteins

into the uterus reduced pulsatile PGF2a pulses from the uterus and extended the estrous

cycle from 23 24 days to 30 39 days in cyclic cows. Intrauterine administration of

recombinant bovine interferon-T (rbIFN-t) increased the interestrous interval, extended

the life of the CL and abolished OT-induced PGF2, synthesis (Meyer et al., 1995).

Presence of an intracellular endometrial inhibitor of PGF2, in the endometrium of

pregnant cows was shown by the inhibition of PGF2a synthesis by cotyledonary

microsomes from parturient cattle, whereby, synthesis was reduced by 51% when

incubation was done in endometrial cytosolic supematants from pregnant cows but only

by 17% when incubated with endometrial cytosolic supernatant from cyclic cows day 17

post-estrus (Gross et al., 1988a).








Using a perifusion device, Gross et al. (1988b) showed that the secretion rates of

PGE2 were not affected by pregnancy status whereas PGF2a secretion was decreased.

However, the rates were increased in cyclic and bred cows that were not pregnant. They

further demonstrated that prostaglandin secretion was not stimulated by OT in day 17

pregnant cows. This is in contrast to results from in vitro studies that have shown that

IFN-T increases synthesis of PGE2 (Asselin et al., 1997a). This effect however may be a

dose response since low doses of IFN-T, there is inhibition whereas at high doses there is

stimulation.

Spencer et al. (1996) proposed that IFN-r may block estrogen receptor synthesis

and thus OTR synthesis by (1) indirectly stabilizing or preventing the down-regulation of

progesterone receptor gene expression by progesterone and (2) directly inhibiting

estrogen receptor gene expression and thus allowing the maintenance of the CL and

successful maternal recognition of pregnancy. However, it has recently been reported that

IFN-z prevents luteolysis in sheep by directly inhibiting and silencing transcription of

ERa gene which prevents the ability of activated estrogen receptor a (ERa) to increase

OTR gene transcription (Bazer et al., 2003). Increased output of IFN-T is due to increased

size of the embryo rather than increased synthesis, suggesting that embryo elongation is

important in preventing luteolysis since smaller embryos will produce less IFN-T and lead

to embryo loss. Interferon-r also stimulates protein secretion from the endometrium

(Emond et al., 2000).

Endometrial proteins and granulocyte macrophage colony stimulating factor

(GM-CSF) have been shown to increase IFN-T production in ovine embryos (Imakawa et

al., 1997). The GM-CSF is a cytokine that promotes concepts growth and survival,








however, it had no effect on IFN-T in the cow (de Moraes and Hansen, 1997). Interferon-

T produced by the trophoblast may be further stimulated by GM-CSF from the

endometrial epithelium (Imakawa et al., 1997). The stromal cells in the uterus respond

by increasing GM-CSF leading to an auto amplification loop (Emond et al., 2000).

Recombinant ovine interferon-z (roIFN-T) has been shown to upregulate PGHS-2

expression in both epithelial and stromal cells, followed by increased production of PGE2

in epithelial and PGF2, in stromal cells of bovine endometrium in vitro (Asselin et al.,

1997c). Upregulation of PGHS-2 was greater in stromal than epithelial cells.

Under in vitro conditions, natural bovine IFN-T significantly diminished basal

PGF2c but not PGE2 secretion from bovine endometrial explants (Godkin et al., 1997).

However, rbIFN-T was found to inhibit both PGF2, and PGE2 in bovine epithelial but

had no effect on stromal cells (Smith and Godkin, 1992; Smith et al., 1993; Desnoyers et

al., 1994; Godkin et al., 1997).

During early pregnancy in cows (days 12 to 25) there is suppression of OTR and

estrogen receptors (Farin et al., 1990; Robinson et al., 2001). Bazer et al. (1997)

hypothesized that IFN-t downregulates OTR by inhibition of upregulation of OTR.

Decreased expression of estrogen receptors occurs in the pregnant horn of unilaterally

pregnant ewes (Lamming et al., 1995), and intrauterine infusion of roIFN-T during the

luteal phase inhibits estrogen and OTR expression in the endometrium (Spencer et al.,

1995c). Recombinant oIFN-T prevents upregulation of estrogen and OTR mRNA and

protein expression after exogenous estradiol administration on day 12 (Spencer et al.,

1995c). Robinson et al. (1999) failed to detect OTR mRNA and protein in the luminal








epithelium of cows at day 16 of pregnancy but was able to detect it in non pregnant cows

indicating that presence of the embryo suppressed expression of OTR.

The efficiency of inhibition of the luteolytic mechanism during pregnancy

depends on IFN-T (Mann and Lamming, 2001). They showed that day 16 pregnant dairy

cows produced less PGF2~ metabolite, 13,14-dihydro-15-ketoPGF2. (PGFM ) after an

OT (50 i.u) challenge, compared to uninseminated control cows. They further showed

that cows with an embryo and measurable quantities of IFN-- attenuated the PGF2a

response to OT than those without an embryo. Consequently, successful establishment of

pregnancy appears to depend on the presence of a well developed embryo that produces

enough IFN-r.

In both cows and sheep, expression of PGHS-2 is modulated in response to

various stimuli and is correlated with production of prostaglandins during maternal

recognition of pregnancy (Asselin et al., 1997b; Charpigny et al., 1997). The PGHS-2

protein is expressed for extended periods in pregnant animals, suggesting that increased

production of prostaglandins may be involved in recognition of pregnancy (Charpigny et

al., 1997). Binelli et al. (2000) showed that IFN-T directly inhibits PKC-regulated PGF2.

production and expression of PGHS-2 and phospholipase A2 (PLA2). Interferon-t also

was shown to suppress PGF2, production and PGHS-2 independent of OT-induced early

signaling events (PLC-IP3/DAG-PKC) in immortalized bovine endometrial (BEND) cells

(Pru et al., 2001). Interferon-t may inhibit luteolysis by shifting the primary

prostaglandin produced in the endometrium from luteolytic PGF2c to luteotrophic PGE2

(Okuda et al., 2002). The TNFa stimulates PGF2a synthesis in stromal cells but not in

epithelial cells of the bovine endometrium (ISkf j', ,n et al., 2000b). It has been








suggested that it may induce local autoamplification of PGF2a in the endometrium

(Skarzynski et al., 1999) and thus initiate a positive loop between pituitary and ovarian

OT and uterine PGF2O to complete luteolysis (Skarzynski et al., 1999; Okuda et al.,

2002). It was recently shown that suppression of TNFa induced-PGF2, secretion by IFN-

r is via downregulation of PGHS-2 expression, stimulated by TNFa (Okuda et al., 2003).

Interferon-T inhibits production of PGF2a in bovine endometrial epithelial cells by

downregulating the expression of PGHS-2 (Xiao et al., 1998). However, it enhances

PGHS-2 mRNA and PGF2; synthesis in stromal cells which are the principal site for

PGE2 synthesis. The expression of PGHS-2 in bovine embryos appears to be transient

and is associated with the first cleavages, with a decrease occurring at the morula stage

(Guverich and Shemesh, 1994). Large amounts of the enzyme have been reported to be

produced between hatching and implantation in ovine (Lewis and Waterman, 1985) and

bovine conceptuses (Shemesh et al., 1979; Lewis et al., 1982).

Elongation of the concepts may be due to stimulation by several mitogens and

growth factors some of which stimulate PGHS-2 expression. The expression of PGHS-2

in ovine embryos is developmentally related and occurs at a time when the embryo turns

into a filamentous type. The pattern is also similar to that ofIFN-t which begins on day

10 and ends about day 21 of pregnancy in sheep (Charpigny et al., 1988; Guillomot et al.,

1990).

High levels of progesterone during pregnancy also have an inhibitory effect on

upregulation of estradiol and OTR. The embryo may further prevent luteolysis by

secreting a protein that blocks the effect of prostaglandins on the large luteal cells in the

CL to maintain a constant source of progesterone (Wiltbank et al., 1992).








Concentrations of linolenic acid are increased in the endometrium of cattle during

pregnancy and linolenic acid is a competitive inhibitor of arachidonic acid metabolism

(Thatcher et al., 1995). Linolenic acid has an effect on limiting the amount of

arachidonic acid that can be converted to PGF2Z and its synthesis is increased by IFN-t.

Resumption of the Prostaglandin Synthesis System after Maternal Recognition of

Pregnancy

Termination of IFN-t expression is dependent on implantation, since cessation of

olFN-r expression occurs in the regions of the trophoblast that have established cellular

contacts with the uterine epithelium during the implantation process (Demmers et al.,

2001). Intrauterine infusion of IFN-T into cyclic Jersey cows from days 15.5 to 21

increased the cycle length to 26 days (Helmer et al., 1989), whereas when the concepts

was left in the uterus and then removed on days 17 or 19, luteal life span was extended,

but only for a few days (Northey and French, 1980) which suggests that PGF2, synthesis

becomes re-established after maternal recognition of pregnancy. In the intercaruncular

bovine endometrium, OTR were low on day 20 and became upregulated by more than ten

fold on day 50 (Fuchs et al., 1992). Endometrial OTR has been shown to change as a

function of gestational age in pregnant beef cattle from days 50 to 250 (Fuchs et al.,

1996b). There was also a parallel increase in plasma PGFM after challenge with 100 i.u

of OT suggesting that at day 50 of pregnancy, the OTR is functionally coupled to PGF2,

release and their concentration determines the magnitude of OT-induced PGF2, during

gestation. Balaguer et al. (2000) challenged beef pregnant cows with OT (100 i.u) from

days 20 to 50 of pregnancy and reported increased PGFM in plasma. The response of








PGFM after OT increased from days 20 to 50 of pregnancy. This result suggests that the

OT-prostanoid system may be active during this peri-implantation period (days 20 to 50).

Maternal plasma progesterone concentrations were correlated with IFN-T

production in bovine conceptuses suggesting that higher maternal progesterone provides

a more suitable environment for the developing concepts (Kerbler, et al., 1997). This

means that in the absence of IFN-T, after maternal recognition of pregnancy, the high

concentrations of progesterone are enough to maintain pregnancy.

Properties of the Key Elements Involved in Luteolysis

Bovine Oxvtocin Receptor

The bovine OTR is a member of the rhodopsin-type (class ) G protein coupled

receptor family (GPCR). The seven transmembrane a helixes are highly conserved

(Gimpl and Fahrenholz, 2001). The OTR encodes a protein of 391 amino acids. It

consists of two introns, one in the 5' noncoding region that appears to be differentially

spliced in the bovine uterus and a conserved intron within the open reading frame

between the regions encoding the transmembrane domains VI and VII. The bovine OTR

consists of three major transcripts at 6.5 kb, 3.5 kb and 2.0 kb (Bathgate et al., 1995). The

OTR gene promoter lacks an estrogen response element (ERE) (Horn et al., 1998).

Similarly, the human OTR gene does not have ERE in its sequence, upstream of the

transcription start site and none of its ERE half-sites respond to increased estrogen

activity when co-transfected with estrogen receptor (Ivell et al., 1998; Telgmann et al.,

2003). However, the lack of ERE does not exclude potential effects of estrogen on gene

expression, since there are half palindromic ERE motifs that could act synergistically to

mediate estrogen activation as has been shown in the ovalbumin gene (Kato et al., 1992).








In sheep, however, it has recently been shown that liganded ERa stimulates OTR

promoter through both DNA and protein-protein interactions with the promoter elements,

activator protein 1 (Ap-1) and Spl despite the lack of consensus binding sites for ERa on

ovine OTR (Bazer, et al., 2003).

Oxvtocin Receptor Signaling

Oxytocin binds to a cell-surface membrane receptor and activates an intracellular

signaling pathway that leads to activation of PLC (Gimpl and Fahrenholz, 2001). Once

activated, PLC cleaves phosphatidylinositol bisphosphate into the second messengers,

diacylglycerol (DAG) and IP3. The DAG increases PGF2a synthesis by activating protein

kinase C activity. Protein kinase C then activates a number of intracellular enzymes that

lead to activation ofphospholipase A2 (PLA2) (Bums et al., 2001). The PKC activates

Ras or Raf-1 which phosphorylates and activates mitogen activated protein kinase

(MAPK kinase) (MEK1/2) (Lewis et al., 1998). The cytosolic form of PLA2 mobilizes

arachidonic acid from phospholipids (Kramer and Sharp, 1997). The arachidonic acid is

converted to prostaglandin H2 (PGH2) by prostaglandin H synthase-2 (PGHS-2) (Smith,

1989). The PGH2 is then converted to PGF2. by the enzyme prostaglandin F synthase

(PGFS).

Regulation of Oxvtocin Receptor

Although administration of estradiol in vivo stimulates an increase in uterine

OTR (Beard and Lamming, 1994; Wathes et al., 1996), OTR upregulation in vitro occurs

spontaneously in the absence of estrogens (Sheldrick et al., 1993; Horn et al., 1998;

Leung and Wathes, 2000). In vitro and in vivo, OT causes short-term upregulation of








OTR expression, but this effect is not maintained for more than I to 2 days (Leung and

Wathes, 2000).

Estrogens also may initiate non-genomic reactions in the absence of estradiol

receptor (Ignar-Trowbridge et al., 1996). There seem to be species differences between

cattle and sheep in the way OTR are regulated (Leung and Wathes, 2000). Duririg early

pregnancy in cows, the embryo is able to suppress development of OTR around day 16

despite the presence of a high number of estrogen receptors (Robinson et al., 1999). It has

been suggested that in sheep, however, that the inhibition of OTR expression by IFN-T

may be mediated initially by inhibition of uterine estradiol receptors (Spencer et al.,

1995a).

Progesterone has an inhibitory effect on OTR expression, but this effect is lost

after 10 days because progesterone downregulates its own receptor (McCracken et al.,

1999; Kombe et al., 2003). Inhibitory effects of progesterone on endometrial tissue are

not mediated through genomic mechanisms such as activation or suppression of specific

genes like OTR or PGHS-2 since the effects can be seen under very short term culture

conditions (Bogacki et al., 2002). Progesterone was able to suppress the ability of

oxytocin to induce endometrial secretion of PGF2, at concentrations as low as 2 nM (0.6

ng/ml) which is in the physiological range. Further evidence from non-genomic effects

was the finding that progesterone inhibits OT binding to OTR-containing membranes in

vitro and suppresses OT-induced inositol phosphate production and calcium mobilization

which are highly steroid and receptor specific effects (Grazzini et al., 1998; Bogacki et

al., 2002). Picard (1998) suggested that progesterone binds to the OTR at an allosteric

receptor site to induce conformational change and thus prevents OT binding to its








receptor. In vitro studies have shown that stimulation of PGF2, by OT is mediated by

calcium ions (Bums et al., 1998). This OT-induced intracellular calcium release is

inhibited in bovine endometrial cells that have been pre-incubated with progesterone,

suggesting that the inhibitory effects of progesterone may be via disruption of the

calcium signaling pathway (Bogacki et al., 2002). Development of OTR in the luminal

epithelium is not directly preceded by changes in the concentration of progesterone or its

receptors; an indication that a time dependent mechanism may mediate the inhibitory

effect of progesterone on OTR function (Wathes and Lamming, 1995; Robinson et al.,

1999).

During the luteal phase in non-pregnant cows, pro-inflammatory interleukins may

form part of the inhibitory mechanism by which progesterone inhibits OTR, while at the

same time enhancing basal prostaglandin synthesis (Leung et al., 2001). An increase in

basal prostaglandin synthesis does not activate luteolysis in the absence of OTR, since

pulses of PGF2a are required (McCracken et al., 1999). Lipopolysaccharide stimulates

PGF2a without altering OTR mRNA, whereas IL-la, 2, and 6 suppress OTR in the late

luteal phase (Leung et al., 2001).

During pregnancy, the upregulation of OTR and luteolysis is inhibited by

secretion of IFN-T from the trophoectoderm from days 12 to 25 in cattle (Bartol et al.,

1985; Fari et al., 1990). Administration of recombinant IFN-T during pregnancy inhibits

OT-induced PGF2, secretion by down-regulation of OTR in the endometrium and by

decreasing PGHS-2 and PGFS via a mechanism independent of changes in OTR (Xiao et

al., 1999). Possibly increased basal secretion of PGHS-2 occurs during pregnancy. The

antiluteolytic effects of IFN-r are to directly inhibit and silence estrogen receptor a gene








transcription that in turn inhibit the ability of activated ERa to increase OTR gene

transcription (Bazer et al., 2003).

Caruncles are differentiated sites of the endometrium in which placentation occurs

in ruminants. Intercaruncular areas are privileged sites for regulation of PGF,2 production

by OT, a process that results in luteolysis (Asselin et al., 1998). Endometrial cells from

intercaruncular areas are more responsive to OT and those from caruncular regions are

more responsive to IFN-T (Asselin et al., 1998).

Prostaglandin H Svnthase-2 (PGHS-2)

Structure of the Bovine PGHS-2 Gene

There are two isoforms of PGHS called variously as PGHS-1 and PGHS-2 or

COX-1 and COX-2. The two isoforms have molecular weights of 70,000 and 72,000,

respectively, and their amino acids are 60% identical but their structural and functional

domains are conserved (Hla and Nielson, 1992). These enzymes are derived from genes

located on different chromosomes that encode different sizes ofmRNA, 2.8 kb for

PGHS-1 and 4.8 kb for PGHS-2. Whereas PGHS-2 is inducible (Hershmann, 1996),

PGHS-1 is constitutively expressed (Williams and Dubois, 1996).

The bovine PGHS-2 mRNA consists of a 5'-untranslated region of 128 bp, an

open reading frame of 1815 bp and a 3'-untranslated region of 1565 bp containing

multiple repeats of the Shaw-Kamen sequence 5'-ATTTA-3' (Liu et al., 2001). It is

undetectable in most tissues but can be induced by agonists and is generally referred to as

the inducible isoform. The gene consists of 10 exons and 9 introns. The transcription

start site is a guanidine residue. The gene consists of several cis-acting elements 600 bp

upstream of the cap site, including cyclic adenosine monophosphate binding protein








(C/EBP), AP-1, AP-2, nuclear factor kappa B (NF-KB), activator transcription

factor/cyclic AMP response element (ATF/CRE) and E-box binding proteins. It does not

contain TATA box motifs (Liu et al., 1999). Mutation of the C/EBP results in reduction

of forskolin activity, whereas deletion of ATF/CRE abolishes TPA-stimulated

transcription of PGHS-2 in human endothelial cells (Subbaramaiah et al., 1998). The

protein encoded by the bovine PGHS-2 gene is similar to other mammalian homologs,

being 89% and 97% identical to human (Hla and Wielson, 1992) and ovine (Zhang et al.,

1996) protein sequences, respectively.

Signal Transduction Through PGHS-2

Prostaglandin H synthase-2 is present in both the endoplasmic reticulum and the

nuclear envelope, but appears twice as much in the nuclear envelope, whereas PGHS-1 is

equally distributed in the endoplasmic reticulum and nuclear envelope (Morita et al.,

1995). Swinney et al. (1997) reported that negative regulation of PGHS-1 permits PGHS-

2 to oxygenate low concentrations of arachidonic acid (AA) (1 lM) up to four times

more efficiently than PGHS-1. Limiting intracellular concentrations of AA leads to the

PGHS-2 pathway and higher concentrations (10 iM) leads to PGHS-1 synthesis

(Murakami et al., 2000). Three phospholipase A2 (PLA2) forms are involved in agonist-

stimulated AA release but there is no general coupling of specific lipases to PGHS-2 or

PGHS-1 (Murakami et al., 2000). Prostaglandin H synthase-2 selectively couples to

other terminal isomerases, especially PGE2 synthase and PGI2 synthase (Smith et al.,

2000). A number of inflammatory agents such as IL-1, lipopolysaccharide (LPS) and

other growth factors share convergent pathways that regulate transcription of PGHS-2.

These include NFKB and C/EBP, signaling pathways common in inflammatory








responses. The others are one or more of the mitogen activated protein kinase (MAPK)

cascades: extracellular regulated 1,.,1. I K I i, Janus kinase (JNK/SAPK) and

p38/RK/Mpk2. Each of these pathways has been shown to contribute or be solely

required for increased expression of PGHS-2 in different cell culture systems (Smith et

al., 2000).

Regulation of PGHS-2 Gene Expression

Prostaglandin G/H synthase-2 gene is elevated by growth factors and mediators of

inflammation such as IL-1, TNFa, LPS and 12-O-tetradecanoylphorbol 13-acetate

(TPA). However, glucocorticoids and anti-inflammatory cytokines suppress PGHS-2

expression (Smith et al., 2000).

Several cis-responsive elements act as key regulatory elements that mediate

PGHS-2 transcription in various cell types. The DNA elements are utilized in a cell-

specific and activator-specific manner. In bovine granulosa cells and ovine large luteal

cells, E-box are essential elements (Liu et al., 1999; Wu and Wiltbank, 2001). In rat

granulosa cells, C/EBP or E box have been reported to be the essential elements for

regulation of PGHS-2 (Sirois and Richards, 1993), whereas in bovine granulosa cells it is

only the E box that is important for transcription of PGHS-2 by LH or protein kinase A

(PKA) activators (Liu et al., 1999). In ovine large luteal cells, the E-box, C/EBP and CRE

in combination are involved in the induction of PGHS-2 by PGF2, as well as PKC

activators (Wu and Wiltbank, 2001). The PGHS-2 promoter has been shown to be

inducible by 8-bromo cAMP but not phorbol esters in fresh granulosa cells. However,

after luteinization of granulosa cells by day 8 of treatment with forskolin, the PGHS-2

promoter was immediately inducible by phorbol esters but not by forskolin (Wu and








Wiltbank, 2002). This change in responsiveness has led to the suggestion that

luteinization changes transcriptional regulation of PGHS-2 from PKA to PKC

dependence, with the E-box being the crucial element in transcriptional activation and

remaining conserved (Wu and Wiltbank, 2002). The intracellular effector systems

involved in induction of PGHS-2 are via PKC directly regulating transcription of PGHS-

2 gene in large luteal cells by acting through DNA elements (CRE and C/EBP) close to a

putative transcriptional start point, and particularly an E-box region (-CACGTG-) at -50

bp (Wu and Wiltbank, 2001).

Bovine uterine stromal cells stimulated with phorbol 12-myristate 13-acetate

(PMA) an activator of PKC exhibit a marked expression of PGHS-2 mRNA and protein

after 3 tol2 h of stimulation (Liu et al., 2001). However, this stimulation is transient and

the PGHS-2 transcript is very unstable whereas the protein is more stable. Waning of

PGHS-2 expression by 24 h is accompanied by increased PGE2 synthesis, suggesting that

a temporal association exists between induction of PGHS-2 mRNA, PGHS-2 protein and

PGE2. There seems to be a difference in the mechanism of regulation of PGHS-2 gene

between uterine stromal cells and granulosa cells. In uterine stromal cells there is a

promoter region located at -1574/- 492 that does not play a role in granulosa cells (Liu et

al., 1999). This may account for the differences in stimulation, PMA stimulation in

uterine stromal cells and forskolin in granulosa cells (Liu et al., 2001). Mutation of CRE

and C/EBP leads to reduced PKC-mediated transcription (Wu and Wiltbank, 2001). In

the CL, PGF2a acts by stimulating protein kinase C and calcium ions to stimulate large

luteal cells which express PGHS-2 and then produce PGF2 (Tsai and Wiltbank, 1997).








The luteal PGF2a functions in an autocrine/paracrine way to increase the luteolytic effects

caused by PGF2. of endometrial origin.

Tumor necrosis factor a is a potent stimulator of PGF2a secretion from the bovine

endometrium. Whereas the target for TNFa are the endometrial stromal cells via

activation of PLA2 and arachidonic acid conversion, the target for OT to stimulate PGF2,

are the epithelial cells (Skarzynski et al., 2000b). It has further been suggested that TNFa

may stimulate PGF2a synthesis by inducing nitric oxide synthase. Evidence of this

process comes from experiments showing increased production of PGF2a after incubation

of endometrial cells with a nitric oxide donor, S-nitroso-N-acetylpenicillamine

(Skarzynski et al., 2000a).

Recombinant bovine interferon T induces activation of the Janus kinase-signal

transducer and activator of transcription and p38 MAPK pathways in bovine myometrial

cells. Inhibition of p38 MAPK pathway by a specific inhibitor (SB203580) has been

shown in vitro to decrease mRNA and protein for PGHS-2 in myometrial cells (Doualla-

Bell and Koromilas, 2001). This result suggests that p38 pathway upregulates PGHS-2

expression at the post-transcriptional level because inhibition destabilizes IFN-T induced

PGHS-2 mRNA. The increased sensitivity suggests that MAP kinase and PI3 kinase

pathways are both stimulated by PGE2 and both are involved in PGHS-2 expression, and

that PKA is upstream of PGE2-induced activation of MAP kinase in these cells (Munir et

al., 2000).

Prostaglandin F Svnthase

Arachidonic acid that is produced by hydrolysis of phospholipids is the precursor

for PGF2. synthesis. It is converted to PGH2 by PGHS-2. Evidence that PGH2 is the








direct precursor for PGF2, was first presented by Hamberg and Samuelson (1967). It was

later demonstrated that the enzyme catalyzing the conversion has glutathione S-

transferase (GST) peroxidase activity and does not have a PGD 11- ketoreductase activity

(Burgess et al., 1987). The PGH2 can be converted to PGF2, via three pathways. In the

first, PGH2 is converted to PGF2, by PGFS, also known as 9, 11 endoperoxide

dehydrogenase. The second pathway involves conversion of PGH2 to PGD2 by PGD

synthase and then PGD2 conversion to PGF2, by PGD 11-ketoreductase. The third

pathway involves conversion of PGH2 to PGE2 by PGES and then PGE2 to PGF2a by

PGE 9-ketoreductase (Watanabe, 2002).

Prostaglandin F synthases belong to the aldoketoreductase (AKR) superfamily

(Table 2-1). Six different forms of PGFS have been reported in literature, three of which

were identified in cows. Lung type prostaglandin F synthase (PGFS1) (Watanabe et al.,

1985, 1988) catalyzes the reduction of PGH2 to PGF2, and PGD2 to a stereoisomer of

PGF2a (9a, 11 P-PGF2). The other two are lung type PGFS found in the liver, also known

as PGFS2 (Kuchinke et al., 1992; Watanabe et al., 2002) and the liver type PGFS, also

known as dihydrodiol dehydrogenase 3 (DDBX) (Suzuki et al., 1999a). The others are

human PGFS (Suzuki et al., 1999b), sheep PGFS (Wu et al., 2001) and a PGFS isolated

from Trypanosoma brucei (Kubata et al., 2000). The PGFS1 and PGFS2 are 99%

identical, whereas DDBX is 86% identical to PGFS1 and PGFS2.

Among the above family members, only PGFS is also classified as AKR1C3 and

catalyzes the reduction of PGD2 and PGH2 and the oxidation of 9a, 11 P-PGF2 despite

very high homology within the family (Suzuki et al., 1999a).









Regulation of Prostaglandin F Synthase

Asselin and Fortier (2000) reported expression of a 9-keto prostaglandin reductase

enzyme (9K-PGR) also known as PGFSL1 in the bovine endometrium. This enzyme is

92% homologous to bovine lung PGFS. The PGFSL1 is downregulated by recombinant

ovine IFN-T, whereas lung type PGFS is reduced by high and low doses of roIFN-i.

However, OT did not have any effect on the mRNA expression ofPGFSL1 and PGFS in

bovine endometrial epithelial cells (Asselin and Fortier, 2000). Oxytocin upregulates

PGFS mRNA in bovine endometrial epithelial cells but rbIFN-T inhibits OT-induced

PGFS as well as PGHS-2 (Xiao et al., 1999).

Table 2-1. Prostaglandin synthase enzymes that belong to the aldoketoreductase
superfamily.
Enzyme Source Intracellular Reference
Location
PGE 9-ketoreductase


Human placenta

Rabbit CL
Bovine placenta


Cytosol

Cytosol
Cytosol


PGD 11-ketoreductase


Lung-type
Liver-type

PGH 9-11-endoperox
reductase





PGFS


Human lung
Bovine lung
Bovine liver

ide

Bovine lung
Sheep seminal
vesicle
Trypanosoma brucei

Bovine endometrium


Cytosol
Cytosol
Cytosol



Cytosol
Microsomes

Cytosol


Westbrook and
Jarabak (1975)
Wintergalen et al. (1995)
Kankofer and
Wiercinski (1999)


Suzuki et al. (1999b)
Watanabe et al. (1988)
Suzuki et al. (1999a)



Watanabe et al. (1988)
Burgess and Reddy (1997)

Kubata et al. (2000)

Madore et al. (2003)


After Watanabe et al. (2002) with modifications.








Regulation of PGFS in endometrial cells in vitro is dependent on the steroid

present and the cell type. In stromal cells, neither estrogen nor progesterone had any

effect on PGFS mRNA levels (Xiao et al., 1998). However, the presence of both steroids

upregulated PGFS mRNA compared to progesterone alone. Furthermore rblFN-r alone or

in the presence of both steroids decreased PGFS mRNA expression (Xiao et a., 1998).

The decreased expression of PGFS mRNA in both the epithelial and stromal cells by

rbIFN-T could be the cause of the observed increase in the PGE2/PGF2a ratio.

Madore et al. (2003) reported expression in the bovine endometrium of an

aldoketoreductase with 20-aHSD activity known as AKR1B5. The AKR1B5 has 45%

homology with PGFS of the AKRI family. Unlike the other PGFS, the mRNA for

AKR1B5 was expressed in the endometrium from days 10 to 21 of the estrous cycle and

in endometrial cell cultures, suggesting that AKRIB5 is the main isoform that is present

in the bovine endometrium.

Prostaglandin E Svnthase (PGES)

In cows, IFN-T is the embryonic signal that is responsible for maternal

recognition of pregnancy. Prostaglandin E synthase (PGES) is a downstream enzyme that

catalyzes the conversion of PGH2 to PGE2. Bovine PGES was cloned recently (Filion et

al., 2001) and is a member of a protein superfamily consisting of membrane-associated

proteins involved in eicosanoid and glutathione metabolism (MPEG family) (Jakobsson

et al., 1999a, Table 2-2). The activity of PGES is dependent on glutathione which may

act as a coenzyme (Ogino et al., 1977; Jakobsson et al., 1999b; Murakami et al., 2000).

The bovine PGES cDNA consists of a 5'-untranslated region of 8 bp, an open reading

frame of 462 bp and a 3'-untranslated region of 406 bp, GenBank accession number








AY032727 (Filion, et al., 2001). The coding region of the PGES cDNA encodes a 153

amino acid protein. Two isoforms of PGES have been reported, nuclear membrane

associated PGES (mPGES) and cytosolic PGES (cPGES). The mPGES was partially

purified from microsomal fractions of bovine (Ogino et al., 1977) and ovine seminal

vesicular glands and has been shown to require glutathione (Moonen et al., 1982). The

mPGES is glutathione-dependent, inducible and functionally linked to PGHS-2. It has

been proposed to be a regulator of inflammatory processes (Murakami et al., 2000). The

isoform expressed in ovarian follicles is the mPGES (Filion et al., 2001). The cPGES is

constitutively expressed and is functionally coupled to PGHS-1 and is thought to be

involved in the synthesis of PGE2 needed to maintain tissue homeostatic functions

(Tanioka et al., 2000).

Table 2-2. Membrane associated proteins in eicosanoids and glutathione metabolism
superfamily.

Subfamily Protein Function

I 5-lipooxygenase activating protein Mediators in inflammation
Leukotriene synthase Mediators in airway
obstruction
Microsomal glutathione S-transferase 2 Protect against metabolites
from oxidative stress
II Microsomal glutathione S-transferase 3

III E. coli
V. cholera

IV Microsomal glutathione S-transferase 1 Catalyzes glutathione
dependent reduction of lipid
hydroperoxides
Microsomal glutathione S-transferase Involved in redox regulation
1-like


After Jakobsson et al. (1999a).








Regulation ofProstaglandin E Synthase

Expression of PGES in follicular cells is not constitutive but is induced by

gonadotropins prior to follicular rupture, and induction of PGES parallels that of PGHS-2

(Filion et al., 2001). The PGES is also regulated by pro-inflammatory agonists including

IL- 13, LPS, TNFa and PMA. Thoren and Jakobsson (2000) used a human lung cancer

adenocarcinoma cell line and demonstrated that PGES activity was stimulated by IL-1P

and TNFu but inhibited by dexamethasone. Cyclic AMP-dependent protein kinase is the

primary second messenger involved in signal transduction by gonadotropins (Richards et

al., 1998). Several agonists that effect transduction via this pathway may also be involved

in regulation ofPGES gene expression. In vitro studies involving the use of bovine

epithelial and stromal endometrial cells have shown that PGES expression is increased in

the presence of LPS, TNFcx and IFN-T in stromal cells and IFN-T in epithelial cells

(Parent et al., 2002). In stromal cells, IFN-t induces a rapid increase of PGES and PGHS-

2 mRNA expression. In BEND cells, PMA increased PGES mRNA, PGHS-2 mRNA

PGF2a and PGE2 suggesting that there is a correlation between PGES and PGHS-2

expression as regards the synthesis of PGE2 (Parent et al., 2002).

Bovine Luteal OT

The ruminant CL synthesizes and secretes OT besides producing progesterone

(Wathes et al., 1983; Ivell and Richter, 1984). Oxytocin is also produced by granulosa

cells of the preovulatory follicle (Salli et al., 2000). Concentrations of luteal OT and

vasopressin increase during the early luteal phase (days 1 to 4), are maximal during the

mid-luteal phase (days 5 to 10) and decline afterwards (Wathes et al., 1984; Abdelgadir et

al., 1987; Parkinson et al., 1992). However, mRNA concentrations of OT reach a peak








much earlier at day 3 of the cycle (Ivell, et al., 1985; Salli et al., 2000). The high

concentrations of OT and neurophysin I within the CL suggests that OT is synthesized

locally. Flint and Sheldrick (1982) administered PGF2a (125 pg i.m) to cows during the

luteal phase and observed release of luteal OT within 5 min that reached a maximum in

10 20 min. Similarly, norepinephrine causes secretion of luteal OT when administered

to heifers during the mid luteal phase (Skarzynski and Kotwica, 1993). The mechanism

of action for release of OT is via sympathetic activation of P-adrenergic receptors of

luteal cells and through cAMP mediation (Skarzynski and Kotwica, 1993). The bovine

CL contains both large and small luteal steroidogenic cells and it is the former that

predominantly produce OT (Fields and Fields, 1996).

The OT-neurophysin-I mRNA increases after luteinization and reaches a peak by

day 3 of the cycle, then declines to low concentrations during the mid-luteal phase (Ivell

et al., 1985). The OT concentrations in the CL are maintained by stimulation of the post-

translational OT-neurophysin process (Wathes et al., 1984; Abdelgadir et al., 1987;

Fuchs, 1987; Wathes and Denning-Kendall, 1992). Peptidyl glycine a-amidating

mono-oxygenase is the terminal enzyme responsible for post-translational processing of

OT-neurophysin (Abdelgadir et al., 1987; Furuya et al., 1990) and has been reported to be

highest in the ovaries of ruminants during the mid-luteal phase (Sheldrick and Flint,

1989; Bogacki et al., 1999). This coincides with the time of highest levels of luteal OT

(Skarzynski et al., 2001).

Prostaglandins act on the CL to induce the release of OT which is facilitated by

the high number of PGF2, receptors in the large luteal cells (Niswender et al., 1985). In

ruminants during the luteal phase, OT and progesterone are secreted concomitantly from








the ovary. However, progesterone secretion is inhibited and OT secretion stimulated by

exogenous PGF2, (Walters et al., 1983). It has been postulated that a central OT pulse

generator functions as the pacemaker for luteolysis (McCracken et al. 1999). The uterus

transduces hypothalamic signals in the form of OT secretion into luteolytic pulses of

uterine PGF2I (Gimpl and Fahrenholz, 2001). A positive feedback loop exists that

amplifies neural and luteal OT signals. Prostaglandin F2. has been shown to induce

release of OT from luteal slices in vitro (Abdelgadir et al., 1987).

Luteal cells contain vesicles which carry OT-neurophysin granules. Oxytocin is

secreted as a prohormone (Ivell and Richter, 1984), packaged and stored in secretary

granules, and released at the cell surface by exocytosis (Fields et al., 1992). The

production of the granules is restricted to the large luteal cells (Guldenar et al., 1984).

During the estrous cycle, the highest number of granules occurs about day 11 and are

progressively depleted beginning at about day 14 after estrus (Fields et al., 1992). In

pregnant animals, however, the granules are maintained at high levels beyond day 20 of

pregnancy but become depleted by day 30 (Fields and Fields, 1996). It is not known

exactly why this difference exists between pregnant and cyclic cows, although it has been

suggested that the presence of the embryo may play a major role (Salli et al., 2000). From

day 45 and onwards in pregnant cattle, a second population of granules emerges and

increases until maximal numbers are detected about day 180 and day 210 of pregnancy.

The content of these granules is not known (Fields et al., 1992).

In vitro, PGF2 treatment has been shown to deplete the large luteal cells of their

secretary granules within 1 h of treatment in cyclic (Heath et al., 1983) and pregnant

cows (Fields et al., 1987; 1989). Corteel (1975) reported that depletion of granules in








sheep CL occurred within 30 min of treatment, whereas Chegini and Rao (1987) reported

in vitro depletion after 2 h of treatment in 3 to 4 mo pregnant cows. Using a microdialysis

system in the CL, Shaw and Britt (2000) showed that administration of a luteolytic dose

of 25 mg PGF2, i.m. led to release of luteal OT in cows 13 to 15 days of the cycle.

However, no OT was detected in animals which were undergoing spontaneous luteolysis

which suggests that luteal OT may contribute less to luteolysis in cows than has been

proposed in sheep (McCracken et al., 1995). Stimulation of bovine luteal cells with

PGF2, on day 8 of cycle was shown to promote phosphorylation of a protein that is

phosphorylated by protein kinase, called myristoylated alanine-rich C kinase substrate

(MARKS) (Salli et al., 2000). After phosphorylation, MARKS translocates to the plasma

membrane and dissociates actin cortex which enhances exocytosis of OT containing

granules.

Exocytosis involves transport of the granules via an actin complex that is usually

associated with the plasma membrane (Salli et al., 2000). Fuchs et al. (2001) observed

low amplitude spurts of OT which were intermittent during pregnancy in cows. Towards

term there was an increase in both frequency and amplitude, and during labor a dramatic

increase was observed. Individual peaks of OT observed in the utero-ovarian vein during

late gestation could be due to OT from the CL as well as the posterior pituitary (Fuchs et

al., 2001). Maternal caruncles have been suggested as another putative source of OT

(Ivell et al., 1995; Fuchs et al., 2001).

The presence of OT-containing luteal granules followed by their delayed release

during the early peri-implantation period suggests that luteal OT may be involved in

OT-driven prostaglandin synthesis. The presence of the respective OTR in the






39

endometrium in the peri-implantation period as well as increased expression of enzymes

involved in prostaglandin synthesis would increase chances of embryo loss. In this

dissertation, the effect of PGF2r on release of luteal OT on representative days during

early (day 22) and late (day 40) peri-implantation period will be examined. The other

major objectives will be to determine the changes in expression of prostaglandin

synthesis enzymes (PGHS-2, PGES and PGFS) and OTR that occur during luteolysis,

how their expression is affected by the presence of a concepts and whether the

prostaglandin synthesis system is re-established after the period of maternal recognition

of pregnancy.














CHAPTER 3
RELEASE OF OXYTOCIN FROM OVARIAN VERSUS PITUITARY TISSUES IN
RESPONSE TO PGF2a IN OVARIECTOMIZED AND SHAM-OVARIECTOMIZED
COWS DURING THE PERI-IMPLANTATION PERIOD


Introduction


The major source ofluteal OT are the large luteal cells that are derived from

granulosa cells after ovulation (Abdelgadir et al., 1987; Parkinson et al., 1992). Luteal

OT is maximal during the mid-luteal phase whereas the OT mRNA is maximal on day 3

of the cycle (Ivell et al., 1985). Luteal OT is stored in secretary granules. During the

estrous cycle, exocytosis results in a decline in the number of secretary granules between

days 11 to 14 whereas OT containing secretary granules in pregnant cows are maintained

at a high level beyond day 20 (Fields and Fields, 1996). In pregnant animals, exocytosis

of OT-containing luteal secretary granules coincides with the decline in IFN-T secretion

(Fields and Fields, 1996). One secretogogue that releases luteal OT in vitro (Abdelgadir

et al., 1987; Chegini and Rao, 1987; Jarry et al., 1992) and in vivo (Flint and Sheldrick,

1982; Fields et al., 1987, 1989; Orwig et al., 1994) is PGF2a. Norepinephrine has also

been shown to stimulate synthesis and release of OT from the CL by stimulation of

P-adrenergic receptors as well as post-translational modification of the OT precursor

(Skarzynski and Kotwica, 1993). McCracken et al. (1999) hypothesized that OT from the

neurohypophysis stimulates secretion of uterine PGF2,. Subsequently, uterine PGF2~

stimulates release of OT from the CL.








Although this seems to be the situation in sheep, the contribution of luteal OT in

cattle to luteolysis is questionable since depletion of luteal OT by 75% using

norepinephrine failed to extend the luteal phase in cyclic cows (Kotwica and Skarzynski,

1993; Skarzynski and Kotwica, 1993). Similar results have been reported in sheep where

exogenous PGF2a induced luteolysis in hysterectomized ewes possessing less than 5% of

mid-luteal OT stores as rapidly as for intact animals (Sheldrick and Flint, 1983a).

Moreover, Shaw et al. (2000), using microdialysis, observed a rapid decline in luteal OT

secretion after day 14 of the cycle. The absence of any measurable OT in the CL during

luteolysis led the authors to suggest that the contribution of luteal OT to the luteolytic

process in cows may be minimal. Luteal OT concentrations do not differ between

pregnant and cyclic cows from day 0 to 19 of the cycle (Parkinson et al., 1992). In

pregnant animals, concentrations decrease after day 19 and remain at significantly lower

levels than in the luteal phase of non-pregnant animals (Parkinson et al., 1992).

Most studies on luteal OT have been conducted in cows during the estrous cycle.

Scant information has been published regarding luteal OT during the peri-implantation

period. There is a possibility that the OT-prostanoid system may be functional after day

21 during the peri-implantation period in instances where the concepts fails to initiate a

strong antiluteolytic signal. It is important, therefore, to determine whether at this stage

the CL is capable of responding to PGF2a by release of OT from the granules that still

remain in the CL. This could be one of the mechanisms that lead to luteolysis and

consequently embryo loss during the peri-implantation period.

The objectives of this study were to determine the source of OT that serves to

drive the OTR-prostanoid system of the endometrium and concepts during the peri-








implantation period. It is hypothesized that OT-containing secretary granules in the CL of

pregnant animals between days 22 and 40 release their contents in response to

sub-luteolytic doses of PGF2,. Alternatively, the source of OT at this time may be the

posterior pituitary. The specific objectives were to test whether PGF2, increases

circulating OT during the peri-implantation period and whether the source of OT is luteal

or of pituitary origin. Another goal was to determine whether there was a difference in

OT response between the early (day 22) and late (day 40) peri-implantation period to

PGF2,.

Materials and Methods

Brahman-Angus crossbred cows at day 22 of pregnancy were divided into two

groups. One group was bilaterally ovariectomized (OVX, n = 4) and the other sham-

ovariectomized (Sham-OVX, n = 9, Table 3-1). Ovariectomy was conducted as

described by Drost et al. (1992). Briefly, animals were restrained in a chute. The perineal

region and vulva were washed and disinfected. The status of the ovaries and uterus were

determined by rectal examination. Animals were given epidural anesthesia using 5 ml 2%

Lidocaine HCI. A vaginoscope was used to confirm the absence of infections and a stab

incision was made and enlarged in the fomix to gain access to the ovaries. An ecraseur

was then used to remove the ovaries. All the animals in the sham-ovariectomized group

underwent the same procedures as those ovariectomized including the stab incision and

manipulation of the ovaries. Cows were then injected (i.v.) at I h intervals with two 25

ug sub-luteolytic doses of PGF2, (Lutalyse Pharmacia & Upjohn, Kalamazoo, MI) or

saline (Periods 1 and 2, Fig 3-1). One hour after the second injection (Period 3), the cows

received a luteolytic dose of PGF2c (25 mg) (i.v.) or saline.









An additional group of nine, day 40 pregnant cows were sham-ovariectomized

and divided into two groups to receive either PGF2, (n = 6) or saline (n = 3). Blood

samples were collected from the jugular vein every 5 min starting 15 min before

ovariectomy or sham-ovariectomy until the first PGF2, /saline injection, every 5 min for

the first 15 min following each PGF2a /saline injection and then every 15 min until 60

min following each injection (Fig. 3-1). Blood samples were kept on ice, transported to

the laboratory and plasma harvested and stored at -200C until assayed for OT.

Table 3-1. Experimental design for in vivo study to ascertain response of PGF2, or saline
on luteal OT release in peri-implantation cows.

Day of Pregnancy


Day 22


Day 40


Treatments PGF2a Saline PGF2a Saline

Sham-Ovariectomized n=6 n=3 n = 6 n= 3

Ovariectomized n= 4



Fig. 3-1. Experimental protocol for response of PGF2a or saline on luteal OT release in
peri-implantation cows. Crossbars represent times at which blood samples were taken.

OVX PGF2a (25 gg)/saline PGF2a (25 pg)/saline PGF2a (25 mg)/saline
Sham-OVX

4 4 4 4


Period 1


Period 2


Period 3


-30 0 60 120 180

Time (min)


--


-------~








Oxvtocin Radioimmunoassav

Extraction of Plasma Samples

The method used for OT extraction from plasma samples was adapted from

Wathes et al. (1986) with modifications. Each SEP-PAK C18 cartridge (Waters

Associates, Milford, MA, USA) was pre-wetted with 10 ml of 0.1% trifluoroacetic acid

in 80% acetonitrile. The columns were then eluted with 20 ml deionized-distilled water.

Plasma samples (0.5 2.0 ml) were diluted (1:1) with phosphate buffer (0.05 M, pH 7.5).

Following application of the plasma, 25 ml 0.1% trifluoroacetic acid was added, and the

extract eluted with 3 ml of 0.1% trifluoroacetic acid in 80% acetonitrile into 13 x 100 mm

tubes. Elution solvent was dried under an air stream apparatus in a water bath set at 370C

and extract redissolved in 0.5 ml assay buffer (0.05 M phosphate buffer, pH 7.5 with 0.05

M EDTA, 0.15 M NaCI and 0.2% BSA).

Each extraction batch included the following controls:

1) Phosphate buffer (2.0 ml).

2) 1.0 ml bovine plasma + 1.0 ml phosphate buffer.

3) 1.0 ml bovine plasma spiked with low amount (0.2 ml) of OT (3.9 pg) in 0.8 ml

phosphate buffer.

4) 1.0 ml bovine plasma spiked with high amount (0.2 ml) of OT (31.25 pg) in 0.8

ml phosphate buffer.

The mean extraction efficiency was 65.7 5.5%.

Assay procedure

Duplicates from each extracted sample (200 pl) and triplicates of OT standards

(0.195 pg 100 pg/200 pl) were used for the assay. The OT antibody was from rabbit # 8








and was kindly donated by Dr. D. Dieter Schams, Technical University of Munich,

Freising, Germany. The working dilution of the antibody was 1:16000. Assay buffer

was added to glass assay tubes (12 x 75 mm), followed by 200 il extract. The tubes were

kept on ice throughout the procedure. The antiserum (100 p1) was added to all plasma

extracts, mixed thoroughly and incubated at 40C for 24 h. The tracer, [125I-OT] (Cat #

NEX-187, 10 piCi stock solution) from Perkin-Elmer Life Sciences, Boston, MA, was

added to 2 ml assay buffer and aliquoted into 100 il in 0.5 ml centrifuge tubes and stored

at -200C. Approximately 3500 cpm/100 (pl [125I-OT] was added to all tubes and

incubation continued at 40C for another 48 h. Pansorbin cell suspension (40 1l)

(Calbiochem, San Diego, CA) was prepared by adding 400 Pl phosphate buffer, vortexed

and centrifuged at 3000 x g for 5 min. The supernatant was aspirated and discarded, and

the pellet resuspended in phosphate buffer. Washing was repeated as above and the final

pellet resuspended in 4 ml phosphate buffer. To separate the bound and free OT within

the assay, 100 pl protein cell suspension was added to each assay tube (except the total

count tubes), mixed well and incubated at 40C for 1 h.

Following incubation, tubes were centrifuged at 30, 978 x g using a Sorvall RC-

5B centrifuge with an HS-4 rotor (Du Pont Instruments, Newtown, CT), the supernatant

discarded and the tubes with pellets (i.e., bound OT) counted in a gamma counter. The

concentrations of OT were expressed as pg/ml. The sensitivity of the assay was 1 pg/ml.

The inter and intra assay coefficients of variation were 10 and 11 %.








Statistical Analysis

Data were analyzed using the Statistical Analysis System (SAS) software version

8 (SAS Institute, Cary, NC). Oxytocin concentrations were analyzed by least squares

analysis of variance using the Mixed Model system of SAS (PROC MIXED) for repeated

measures analysis. The mathematical model included the independent effects of

treatment, time, period, treatment x time, treatment x period, period x time and treatment

x period x time. Cow was considered as a random variable nested within treatment. A

series of orthogonal contrasts were conducted to examine differences between treatments

(see Appendix A) ( T :day 22-PGF2,-Sham-ovariectomized ; T2:day 22-Saline-Sham-

ovariectomized; T3:day 40-PGF2,-Sham-ovariectomized; T4:day 40-Saline-Sham-

ovariectomized; T5:day 22-PGF,,-ovariectomized) and Periods: Period 1 from 5 to 60

min, Period 2 from 65 to 120 min and Period 3 from 125 to 180 min. Time within each

period was from 5 to 60 min (Fig. 3-1). Data are presented as least squares means

SEM. The covariance structure used was autoregressive of order 1 (Littell et al., 1998).

Results

Effect of PGF2, on OT response in sham-ovariectomized and ovariectomized day

22 pregnant cows is shown in Fig. 3-2. There was no major increase in plasma OT from

the time of ovariectomy to the time of first injection of PGF2a. In two of the four

ovariectomized cows, plasma OT increased 45 min following the first injection of PGF2,.

No additional increase in OT was observed following the second and third injection of

PGF2a (Fig. 3-2). Ovarian intact cows showed no response to the first two injections of

PGF2. probably because the concentration of PGF2, used was too low. The third injection

ofPGF2, (25 mg) resulted in a significant increase in plasma OT in all cows.









Day 22 Pregnancy

-- Sham-OVX, PGF (n = 6)
-- OVX, PGF (n =4)
250

OVX
Sham OVX
200 PGF:. (25 gg) PGF2. (25 gg) PGF2. (25 mg)



150


100


50


0
-50 0 50 100 150 200
Time (min)

Fig. 3-2. Least squares means ( SEM) plasma concentrations of oxytocin in
ovariectomized and sham-ovariectomized PGF2,-treated cows, day 22
pregnant. Arrows indicate time (0, 60 and 120 min) at which PGF2, injection
was given (i.v.).


The response to PGF2a or saline in sham-ovariectomized cows on day 22 of

pregnancy is shown in Fig. 3-3. No difference was observed in OT response to PGF2~ or

saline after the first and second injections (P > 0.05). However, in saline-treated cows

there was a numerical increase after the second injection. Subsequently, plasma OT

declined to concentrations observed prior to treatment. In cows treated with PGF2., there

was a significant increase in plasma OT 5 min after the third injection (25 mg). There

was no treatment by time interaction in any of the time periods.









Day 22 Pregnancy

-- Sham-OVX, PGF (n = 6)
-0-- Sham-OVX, Saline (n = 3)

250


Sham PGF2, (25 tg) PGF2, (25 pg) PGF2 (25 g)
20 OVX Saline Saline Saine


150


0
x 100-



50 -


0

-50 0 50 100 150 200

Time (min)

Fig. 3-3. Least squares means ( SEM) plasma concentrations ofoxytocin in sham-
ovariectomized PGF2, and saline-treated cows, day 22 pregnant. Arrows
indicate time (0, 60 and 120 min) at which PGF2 or saline was injected
(i.v.).


Plasma concentrations of OT in sham-ovariectomized day 40 pregnant cows

following PGF2a or saline treatment are shown in Fig. 3-4. Little variation was observed

in plasma OT following the first and second injections of either PGF2a or saline.

However, a temporal acute response of OT to PGF2a or saline was observed after the

third injection. This was not a sustained increase as observed in sham-ovariectomized

animals response to PGF2a at day 22 of pregnancy (Fig. 3-3).This indicates that in day 40

pregnant cows neither PGF2, nor saline had any appreciable effect in increasing plasma

OT concentrations.











Day 40 Pregnancy


E
- 150
ac
C
0
' 100
0


-0- Sham-OVX, PGF (n = 6)
-0- Sham-OVX, Saline (n = 3)


Sham PGF, (25 Wg) PGFo, (25 pg)
OVX Saline Saline

I I I


-50 0 50 100 150 200
Time (min)

Fig. 3-4. Least squares means ( SEM) plasma concentrations ofoxytocin in sham-
ovariectomized PGF2. and saline-treated cows, day 40 pregnant. Arrows
indicate time (0, 60 and 120 min) at which either PGF2, or saline was injected
(i.v.).


The OT response to PGF2, versus saline was different on day 22 versus day 40 of

pregnancy. Orthogonal contrasts showed a treatment by day of pregnancy by period of

interaction (Fig. 3-5A). On day 22 of pregnancy there was a significant (P < 0.03)

treatment by period interaction, indicative of an increase in plasma OT in period 3 in

PGF2z treated cows, whereas for saline treated cows there was no increase in plasma OT.

However, on day 40 cows there was no substantial increase in plasma OT in either PGF2,

or saline treated cows for any of the periods. (Fig 3-5 B).















-- PGF, day 22
-o- Saline, day 22


0.5 1.0 1.5 2.0 2.5 3.0 3.5

Period





--- PGF, day 40
-o- Saline, day 40


0.5 1.0 1.5 2.0 2.5 3.0
Period


Fig 3-5. Treatment by day of pregnancy by period interaction for oxytocin in sham-
ovariectomized cows receiving either PGF2a or saline on day 22 or 40 of
pregnancy (P < 0.03). Data represent least squares means SEM.








Discussion

Administration of sub-luteolytic doses of 25 tg PGF2 (i.v.) failed to cause a

significant increase in OT secretion in day 22 ovariectomized or ovarian-intact pregnant

cows. However, a luteolytic dose of 25 mg (i.v.) did increase plasma OT concentrations

in ovarian-intact cows. This suggests that most of the increase in plasma OT

concentrations measured in ovarian-intact cows at day 22 of pregnancy was secreted from

the CL in response to PGF2a. Intact cows at day 22 or 40 of pregnancy failed to respond

to sub-luteolytic PGF2, doses of 25 lsg. The failure of an OT response to the sub-

luteolytic dose of PGF2a is likely a result of an inadequate dose of PGF2a. This is in

contrast to the higher dose of 25 mg of PGF2a that was administered in the third period of

day 22 pregnant cows.

The increase in plasma OT concentrations at day 22 in pregnant cows was

observed within 5 min after injection of 25 mg of PGF2,, reached a peak within 25 min,

and declined thereafter. These results are similar to those reported in cyclic beef heifers

by Salli et al. (2000) where there was an increase in plasma OT concentrations within 5

min of treatment with PGF2a which remained elevated for 20 min and then declined to

basal concentrations by 40 min. Fields et al. (1989) reported that only 0.5% of large

luteal cells had secretary granules at 60 min after administration of 25 mg, PGF2a in

pregnant cows one to two weeks prior to parturition. Salli et al. (2000) reported that the

mechanism by which PGF2a induces release of OT from OT containing granules in the

CL is a PKC mediated event that activates MARKS protein which translocates the OT

granules to the membrane and disrupts the actin complex in the secretary process. They

determined the location of MARKS protein in cytosolic and membrane fractions of








sections from CL of day 17 pregnant cows that had been treated with PGF2,.

Translocation of MARKS causes movement of secretary granules to the membrane

where they release OT.

A dose dependent effect of PGF2~ (20 to 50 jg) on OT secretion was reported by

Skarzynski et al. (1997) who showed that CL sensitivity to PGF2a increased in the late

luteal phase. To evoke a similar OT response on days 12 and 18 of the cycle, PGF2a on

day 18 could be reduced 10 fold. The lack of response with 25 jg PGF2, in the present

experiment indicates the concentration was too low to effect a change in plasma OT

concentration. Skarzynski et al. (1997) failed to achieve luteal regression using 50 pg

PGF2, although the plasma OT concentration increase was comparable to that observed

during spontaneous luteolysis (50 70 pg/ml). A 30 gg dose of PGF2a released 67 pg/ml

whereas 20 gg had no effect on luteal OT release. We used 25 gg in this experiment not

knowing the results by Skarzynski et al. (1997).

Orwig et al. (1994) investigated the effect of 500 jg PGF2a on OT release from

the CL of day 8 cyclic beef cows and activation of PKC. Peak plasma concentrations of

OT occurred 1.5 to 10 min after injection of PGF2. In addition, there was a high

correlation (r = 0.82) between membrane PKC and OT release suggesting a role for PKC

in OT release from luteal cells. In their study, the CL was removed at different times after

PGF2a injection. A smaller peak in OT was observed in animals in which the CL was

removed at 0 min relative to the PGF2, injection than in those animals in which it was

removed later suggesting that most of the OT was of luteal origin.

In the present study, an increase in plasma OT concentrations occurred in

ovariectomized PGF2a-treated animals at 25 to 30 min after the first PGF2a injection. The








cause of this single elevation in plasma OT concentration is not clear. One possible

source of plasma OT is the neurohypophsis (McCracken et al., 1999). However, Schams

et al. (1985) reported that its contribution is minimal. The sampling in the present study

was in the jugular vein which would be an indication of possible secretion from the head

or neurohypophysis. Prostaglandins have been shown to stimulate release of several

hormones from both the posterior (oxytocin) and anterior pituitary gland (prolactin,

adrenocorticotrophic, growth and luteinizing hormone) (Haynes et al., 1978; Renegar et

al., 1978; Collier et al., 1979). The release of pituitary hormones modulated by

exogenous PGF2, is either direct or via the hypothalamus (Hedge, 1972; Ojeda et al.,

1975).

Unexpectedly, we observed increased OT release in sham-ovariectomized cows

treated with saline. It has been suggested that OT can be released as result of manual

manipulation of the ovary or the uterus (Williams et al., 2001). No increase in plasma OT

was observed immediately following ovariectomy. All animals in the group that was

sham-ovariectomized underwent the same procedures as those ovariectomized including

incision and manipulation of the ovaries.

It has been shown that norepinephrine also induces release of OT from the CL and

is involved in post-translational processing of OT. Oxytocin may also autoregulate its

own concentration in the CL although the mechanism is not clear (Bogacki and Kotwica,

1999). Norepinephrine affects luteal synthesis of OT by stimulating p-adrenergic

receptors. Similar effects as those due to norepinephrine may have occurred in this study

brought about by the stress animals experienced during the experiment (Kotwica et al.,

2002). This could lead to secretion of norepinephrine into circulation resulting in release








of luteal OT. This may be the case in those instances where there was an increase in

plasma OT following saline injection. However, since no major OT increase was

observed in periods 1 and 2, the supposed effect from norepinephrine may be minimal.

Alternatively the increase in OT may have been from the posterior pituitary as a neural

afferent reflex from handling the cervix, fomix and vagina e.g. Ferguson's reflex.

Norepinephrine stimulates concomitant progesterone synthesis and post-

translational processing of OT synthesis by activating 3p-hydroxysteroid dehydrogenase

in the bovine CL. It has been shown that stress mimicked by norepinephrine infusion may

increase progesterone synthesis, ovarian OT and P-adrenergic receptors (Kotwica et al.,

1991; 1994). No progesterone measurements were done in this study.

Skarzynski and Kotwica (1993) reported that administration of repeated 5 mg

doses of norepinephrine at 30 min intervals to cyclic cows resulted in a decrease in the

quantity of OT released each time from the CL indicating a depletion of OT. In the

present study, no responsiveness was seen following PGF2, until after the third injection

of a large PGF2, dose of 25 mg. This indicates that the sub-luteolytic 25 tg doses

administered were not capable of eliciting an observable response.

Ivell et al. (1985) reported that there was no de novo synthesis of OT pro-

hormone in the mid-luteal CL. This suggests that once OT is depleted there is no

replenishment of stored OT. Ovariectomized cows at 22 days of pregnancy treated with

PGF2u had a slight but nonsignificant increase in OT concentrations of about 10 to 15

pg/ml following the second and third injections. This minimal increase in OT

concentrations indicates an OT contribution ofneurohypophyseal origin in

ovariectomized cows in the absence ofa CL. The OT response to PGF2. in sham-








ovariectomized cows on days 22 was greater than at day 40 of pregnancy (Fig. 3-5A and

B). In both groups of animals, a significant release of OT was observed after the

luteolytic dose of OT. Day 40 CL, believed to be depleted of OT, were expected to give a

minimal response to PGF2a. The response observed may indicate an alternative source of

OT since Nichols et al. (2003) showed no luteal OT or OT mRNA in day 40 CL. Indeed a

similar elevation in plasma OT concentrations was observed in the saline treated cows at

day 40 indicating neurohypophyseal release. Sheldrick and Flint (1983b) reported

decreased concentration of OT in ovine CL during pregnancy from 373 ng/g wet weight

at day 14 to less than 5 ng/g at day 50 of pregnancy. A decrease in luteal OT therefore

reduces the likelihood of luteal regression and uterine contractility which would further

assist in the establishment of pregnancy. One known cause for failure of PGF2a to

stimulate further release of OT may be PGF2a receptor desensitization (Skarzynski and

Okuda, 1999). In the ovary, this has been attributed to prostaglandins produced locally in

the CL (Denning-Kendall et al., 1994). Lamsa et al. (1992) showed that low level

infusion of PGF2a into the ovarian artery led to desensitization of the CL in releasing OT

in ewes. However, in this study we observed release of OT after the third injection

suggesting that desensitization was not the cause of failure to release high amounts of OT

on the first and second injections of PGF2a in the sham-ovariectomized cows. In periods

one and two doses of PGF2, were too low.

Flint and Sheldrick (1983) and Schallenberger et al. (1989) reported an increase in

plasma OT in pregnant cows between days 14 to 16. Higher concentrations of OT were

found in the aorta than in the cauda vena cava suggesting a non-luteal source. Hooper et

al. (1986) reported higher OT concentrations in the jugular vein than in the carotid artery








of late luteal phase sheep, an indication that the neurohypophysis could be contributing to

the plasma OT. Parkinson et al. (1992) suggested a possibility of OT release from the

neurohypophysis in cows after the levels of OT from the CL declined around the time of

maternal recognition of pregnancy. Schams et al. (1983), Wathes et al. (1984) and

Meidan et al. (1993) reported that follicles could also be a source of OT. In the present

study, however, both ovaries were removed.

The conclusions from this study are that PGF2a induces release of OT from the

CL of day 22 but not day 40 pregnant cows and that the dose of PGFz2 has to be

luteolytic in order for a substantial amount of OT to be released. These two groups of

cows represent cows in the early (i.e. day 22) and late (i.e. day 40) peri-implantation

periods. Failure for release of OT at day 40 means cows at this stage have very little OT

in the CL and that OT from the CL at this stage is unlikely to initiate pulsatile secretion

of PGF2,.














CHAPTER 4
EXPRESSION OF OXYTOCIN RECEPTOR, PROSTAGLANDIN G/H, F AND E
SYNTHASES IN THE BOVINE ENDOMETRIUM AND CHORIOALLANTOIS
DURING THE ESTROUS CYCLE AND PERI-IMPLANTATION PERIOD

Introduction


Oxytocin and the OTR play important roles in reproductive processes including

luteolysis, establishment of pregnancy, milk-let down and parturition in females and

ejaculation in males (Ivell and Russel, 1995; Assinder et al., 2000). Inhibition of the

OTR plays an important role in the establishment of pregnancy (Wathes and Lamming,

1995); and the induction of OTR during labor facilitates delivery of the fetus (Fuchs et

al., 1996).

Blockade of endometrial OTR with an OT antagonist from days 15 to 22 of the

cycle affects neither the duration of luteolysis nor the duration of the estrous cycle in

heifers (Kotwica et al., 1997). However, Kotwica et al. (1998b) reported that blockade of

OTR decreases the magnitude of PGF2, release indicating that OT has a supportive and

modulatory role of the amplitude of PGF2a that initiates luteolysis in cattle. Using ligand

binding assays, Fuchs et al. (1990) reported that OTR concentrations on days 7 and 14 of

pregnancy were similar to those in cyclic cows. On days 17 and 21, receptor

concentrations in pregnant cows remained low and were lower than in cyclic cows.

Oxytocin administered to pregnant cows leads to increased production of PGFM in a








dose-dependent fashion that occurs later in pregnancy at approximately day 50 (Fuchs et

al., 1996b). Prostaglandin F2.is a luteolysin released by the endometrium at the end of a

normal estrous cycle in response to OT when no concepts is present. However, in the

presence of a viable embryo there is suppression of pulsatile PGF2a secretion (Silvia et

al., 1991; Flint et al., 1992). It is now well established that OTR is suppressed by IFN-T

during the period of maternal recognition of pregnancy (Telgmann et al., 2003). In cases

where the concepts secretes inadequate interferon-T (IFN-T) there may be a possibility of

OTR stimulation and PGF2a secretion that could augment the luteolytic process and lead

to embryo loss.

Oxytocin binds to its receptor and couples to Gi and Gq proteins leading to

activation of PKC and PLC pathways (Sanborn et al., 1995; Copland et al., 1999).

Eventually PGHS-2 and PGF2a synthesis occur which leads to luteolysis during the

estrous cycle. Although these events occur in an estrogen dominated environment, the

bovine OTR does not respond to activated estradiol receptors (Ivell et al., 1998). It was

recently shown that the ovine OTR promoter is stimulated by liganded ERa through

protein-protein and protein DNA interactions (Bazer et al., 2003). A progesterone-primed

endometrium seems to be necessary for OT-induced activation of PGHS-2 since it has

been shown that prepubertal heifers fail to respond to OT unless they are primed by

progesterone (Fuchs et al., 1997). Although several studies on the expression of OTR

have been conducted during the estrous cycle and early pregnancy, expression of OTR

mRNA during most of the peri-implantation has not been investigated. The importance of

understanding the pattern of expression of OTR dJuri, The peri-implantation period arises

because if OTR are actively expressed and coupled to the prostaglandin synthesis








pathway, this may initiate luteolytic pulses of PGF2, during early pregnancy. This may be

one of the mechanisms that lead to high embryo loss during early pregnancy in cattle.

Particularly in high producing dairy cows.

Prostaglandin G/H synthase (PGHS), also known as cyclooxygenase, is a key rate

limiting enzyme in the prostaglandin biosynthetic pathway which converts arachidonic

acid to PGH2. The PGH2 is converted to PGF2a by PGFS (Watanabe et al., 1985). The

PGHS-2 is present at low concentrations in most tissues but is usually induced by a

variety ofmitogens (Kujubu et al., 1991; Xie et al., 1991), interleukin-l (Habib et al.,

1993) and growth factors (Wong et al., 1989; Herschmann, 1996). Within the bovine

endometrium, two types of cells play an important role in the synthesis of prostaglandins.

The epithelial cells predominantly secrete PGF2a whereas the stromal cells secrete PGE2

(Schatz et al., 1987; Fortier et al., 1988; Desnoyers et al., 1994; Parent et al., 2003b).

During early pregnancy, the loss of uterine responsiveness to OT causes the

suppression of the pulsatile pattern of PGF2a secretion leading to maintenance of the CL.

In vivo studies have revealed the expression and regulation of PGHS-2 in uterine tissues

during the estrous cycle (Arosh et al., 2002) and later stages of pregnancy (Fuchs et al.,

1999). Arosh et al. (2002) reported high expression of PGHS-2 mRNA in endometrium

of cows between days 13 21 of the estrous cycle and low expression between days 1 -

12. Although Guzeloglu et al. (2003) reported high expression of PGHS-2 mRNA in

endometrium of day 17 pregnant dairy cows, no extensive studies have been conducted

on the expression in the endometrium and chorioallantois during the peri-implantation

period. Evaluation of the pattern of expression of PGHS-2 during the entire peri-

implantation period is necessary since it would enhance our understanding of its probable








role in establishment of pregnancy. Depending upon the relative amounts of each, the

downstream enzymes PGFS and PGES may lead to predominantly conversion of PGH2 to

PGF2a, which is luteolytic, or to PGE2, which may be luteotrophic in ruminants (Pratt et

al., 1977).

In a situation where there is increased endometrial expression of PGHS-2 in

cyclic or pregnant cows around the time of luteolysis or maternal recognition of

pregnancy, there would probably be increased synthesis of PGES in pregnancy. This

could be in anticipation for successful pregnancy to maintain a PGE2:PGF2. ratio that is

favorable for maintaining pregnancy. Studies on the expression of PGES and PGFS in the

bovine endometrium and chorioallantois will increase our understanding of the

physiological functions of these enzymes in cyclic and peri-implantation cows.

Prostaglandin E and F synthases are key enzymes in the pathway to prostaglandin

synthesis that are involved in conversion of PGH2 to PGE2 and PGF2, respectively

(Watanabe et al., 1985). Despite the importance of PGFS in prostanoid synthesis and

reproduction, little information exists about its mRNA expression and regulation during

the estrous cycle and the peri-implantation period. Increased expression of PGFS during

the peri-implantation period could lead to increased synthesis of PGF2, which may lead

to high PGF2,:PGE2 ratio not favoring implantation. Understanding the mechanisms that

control the maintenance of pregnancy and viability of the concepts during the peri-

implantation period should provide insight into causes of embryo loss that occur during

this time.

It is hypothesized that OTR, PGHS-2 and PGFS mRNA are downregulated

whereas PGES is upregulated in the endometrium and chorioallantois during the peri-








implantation period. Such a response should lead to less chances of luteolysis and

increase embryo survival. The objectives of this study were to characterize the expression

of OTR, PGHS-2, PGES and PGFS in bovine caruncular and intercaruncular

endometrium as well as the chorioallantois during the estrous cycle and the peri-

implantation period.

Materials and Methods

Animals

Tissues were collected from multiparous Brahman-Angus crossbred cows (n = 4

each day) on day 0 (estrus), 3, 7, 14 and 18 of the estrous cycle and at days 7, 14, 18, 22,

30, 40 and 50 of pregnancy (n = 4 to 5 cows each day). Estrus was induced with PGF2a

(25 mg, i.m, Lutalyse, Pharmacia & Upjohn, Kalamazoo, MI). Cows were exposed to a

fertile bull with a chin ball marker, and also bred at estrus by artificial insemination to

enhance pregnancy rates. Cows were slaughtered and tissues collected from animals

processed through the University of Florida Animal Science abattoir. For cows less than

30 days of pregnancy, pregnancy was confirmed by observation of a concepts or embryo

after flushing the uterine horns with physiological saline. For cows at 40 or 50 days,

pregnancy was confirmed using ultrasound. Endometrial samples were collected from

the uterine horn ipsilateral to the CL and care was taken to separate the caruncular from

the intercaruncular endometrium. The chorioallantois was collected from cows which

were at least 30 days pregnant. Tissues were snap-frozen in liquid nitrogen and then

stored at -80C until RNA extraction.








RNA Extraction

Total RNA was isolated from the caruncular and intercaruncular endometrium as

well as the chorioallantois using Trizol reagent (InVitrogen, Carlsbad, CA) following the

manufacturers instructions. After extraction, the RNA pellet was re-suspended in 75 P1

pre-warmed (600C) RNAsecure M Resuspension solution (Ambion, Austin, TX), and the

resultant RNA suspension heated at 600C for 10 min to remove contaminating RNAse. A

DNA-free TM kit (Ambion) was used to remove contaminating genomic DNA from the

RNA samples. Briefly, 0.1 volume of 10X DNase I buffer (100 mM Tris-Cl, pH 7.5, 25

mM MgC12, 1 mM CaCl2 ) and 1 p1 DNAse I, RNAse free (2 units/pl) were added to the

RNA suspension. The RNA samples were then mixed gently and incubated at 370C for

30 min. At end of incubation, 0.1 volume (7.5 pl) of DNase Inactivation Reagent from

the DNA-free kit was added and the contents were mixed and incubated at 240C for 2

min. The mixture was centrifuged at 10,000 x g for 1 min to pellet the DNase

Inactivation Reagent. Treated RNA samples were recovered and their concentrations

determined using a spectrophotometer at 260 nm. The quality of the RNA samples was

assessed by the integrity of 28S and 18S ribosomal RNA after electrophoresis of 10 pg

total RNA. The RNA samples were stored at -800C until analysis.

Validation of the Relative Ouantitation of OTR. PGES. PGFS mRNA and 18S rRNA

The A ACT method for relative gene quantitation is based on the following

principle. The threshold cycle CT indicates the fractional cycle number at which the

amount of amplified target reaches a fixed threshold. The mean CT (Threshold) values of

replicate runs for the target gene are determined. The difference (ACT) between the mean

CT values of the target gene and the endogenous control (18S rRNA) is calculated. Then








A ACT is the difference between ACT and the CT value of the calibrator. The amount of

target (OTR, PGHS-2, PGES, PGFS) normalized to endogenous reference (18S rRNA)

and relative to the calibrator is determined by the formula, relative concentration of target

mRNA = 2-acT. Intercaruncular endometrial RNA sample from a cow in estrus was

chosen in which the OTR and PGHS-2 transcripts were believed to be highly expressed

calibratorr sample). For PGES and PGFS, the calibrator was total RNA from

intercaruncular endometrium from a cow at day 15 of pregnancy.

In order to use the A A CT method for relative quantitation of mRNA expression

for the respective genes, a validation study was conducted to demonstrate that the

efficiencies of amplification for the OTR, PGHS-2, PGES and PGFS genes (target

amplification) and 18S rRNA (reference amplification) are approximately equal. In order

for the efficiencies of amplification for the two genes to be equal, the absolute value of

the slope of log input amount of RNA versus ACT should be less than 0.1 (Applied

Biosystems user Bulletin #2) or the slopes of the dilution curves for the specific target

gene and that for 18S rRNA should be approximately equal. The validation study also

provided information on the concentration of total RNA to be used during PCR for all the

genes and 18S rRNA. For OTR gene expression, serial dilutions of total RNA were

conducted from 200 ng to 1.56 ng (Appendix B), 200 pg to 1.56 pg for 18S rRNA

(Appendix C), 800 ng to 1.56 ng for PGHS-2 (Appendix D), and 400 ng to 1.56 ng for

PGES and PGFS (Appendices E and F). Amplification plots for OTR (Fig. 4-1), 18S

rRNA (Fig. 4-2), PGHS-2 (Fig. 4-5), PGES (Fig. 4-7) and PGFS (Fig 4-9) were

constructed. Threshold cycle (CT) values were plotted against log concentration and the

slope was determined. The slope (-3.4) for the standard curve of the OTR gene (Fig. 4-3),








-3.3 for PGHS-2 (Fig. 4-6), -3.1 for PGES (Fig. 4-8) and -3.3 for PGFS (Fig. 4-10) were

comparable to that of 18S rRNA (-3.5, Fig. 4-4). The values obtained confirmed the

validity of the A A CT method for determining relative abundance of the genes studied.

PCR Primers and Probes

Primers were designed by Assay by Design, Applied Biosystems (Foster City, CA) and

are shown in Table 4-1.

Table 4-1. Sequences of primers and probes used for RT-PCR.

mRNA Primer sequence/Probe (P) Amplicon Reference
Forward (F) Reverse (R) size (bases)
OTR GGCCTACATCACGTGGATCAC (F) Bathgate et al.
(1995)
AGCAGGTGGCAAGGACGAT (R) 66

ACGGGCACAATGTA (P)

PGHS-2 CGTGAAGCCCTATGAATCATTTG (F) Liu et al. (1999)
CTTCTAACTCTGCAGCCATTTCCT (R) 66

TCTCTCCTGTAAGTTCC (P)

PGES GGAACGACCCAGATGTGGAA (F) 85 Filion et al.
ACAAAGCCCAGGAACAGGAA (R) (2001)

6FAMCCTCAGAGCCCACCGGMGBNF (P)

PGFS CAAGCCTGGGAAGGACTTCTT (F) 78 Suzuki et al.
CAGGTATCCACGAAATCTTTCTCA (R) (1999)

6FAMAGGACGGCAACGTGATMGBNFQ (P)


PCR Protocol
The PCR mastermix consisted of 25 pl of2X ThermoScript Reaction mix

Platinum Quantitative RT-PCR ThemoScript One-Step system (InVitrogen). Primers,

20X (2.5 il, 900 nM) and probes (2.5 pil, 250 nM) were obtained from Applied








Biosystems, Customer Set ID OTR-cDNA-OTR1, COX-2-cDNA-COXa, PGES-cDNA-

GESd, PGFS-cDNA-GFSb, TaqMan probes (antisense sequence) used FAM as reporter

dye and a minor groove binding non-fluorescent quencher dye (MGB-NFQ). Primers for

18S rRNA (2.5 pl, 900 nM each) and TaqMan probe (2.5 t1, 250 nM, eukaryotic 18S

rRNA MGB endogenous control) were obtained from Applied Biosystems. The probe

uses VIC as reporter dye and MGB-NFQ as a quencher. ThermoScript plus/Platinum Taq

enzyme mix (1 pl, Platinum Quantitative, RT-PCR ThermoScript One-Step System) was

obtained from InVitrogen. Autoclaved distilled water (11.5 pl) was added to the above

components to give a final volume of 50 il per reaction tube. Total RNA (200 ng) was

used for OTR, PGHS-2, PGES and PGFS gene expression analysis, and 200 pg total

RNA per reaction for thel8S rRNA gene. For inter and intra-assay control, total RNA

from caruncular endometrium from a cow in estrus was used for OTR and PGHS-2

genes, whereas intercaruncular endometrium from a cow at day 15 of pregnancy was

used for PGES and PGFS. All samples were run in triplicate. A set of two reactions for

no-template controls (NTC) for both the target gene and 18S rRNA were included. The

NTC consisted of 10 pl water. The individual genes (OTR, PGHS-2, PGES, and PGFS)

and 18S rRNA gene expression RT-PCR were conducted on the same sample plate.

Procedure

All reagents were kept on ice. In each assay, the master mixture for either OTR,

PGHS-2 and 18S rRNA or, PGES, PGFS and 18S rRNA were added to the wells first,

followed by deionized double-distilled water, primers and probe. The Taq polymerase

was added last. Autoclaved double distilled water was then added to the NTC wells and

these wells capped with optical caps (Applied Biosystems) prior to addition of RNA to








the rest of the wells. The well contents were vortexed briefly and transported on ice to

the Interdisciplinary Center for Biotechnology Research (ICBR) Protein Core Laboratory.

The plate was centrifuged briefly to bring down the well contents before it was loaded

into a GeneAmp 5700 for one-step Real Time PCR.

Thermal Cycler Protocol

Reverse transcription reaction for first strand cDNA synthesis was conducted at

500C for 30 min. Inactivation of reverse transcriptase, denaturation of RNA/DNA and

activation ofTaq DNA polymerase were conducted at 950C for 5 min. Amplification was

achieved with 40 cycles at 950C for 15 sec (extension) and 600C for 1 min (annealing).

Run time was 2 h 19 min.

Analysis of Results From Gene AMP 5700

Data from the GeneAmp 5700 runs were entered into the GeneAmp 5700 SDS

software program to determine CT values (threshold cycle) and amplification plots. The

data for CT values for OTR, PGHS-2, PGES, PGFS and 18S rRNA and calibrator sample

were used to determine the relative quantity of the individual genes using the AA ACT

method. Results were expressed as arbitrary units relative to the calibrator sample and

normalized against 18S rRNA.


Immunohistochemical Localization for OTR and PGHS-2

Caruncular and intercaruncular endometrium were dissected separately. Tissues

were fixed in 4% (w/v) paraformaldehyde in phosphate buffered saline (pH 7.5) for 24 h.

Following fixation, tissues were dehydrated in ethanol and embedded in paraffin. Tissue

sections were cut at 4 pm thickness and mounted onto Superfrost charged microscopic

slides (Fisher, Pittsburg, PA). Sections were deparaffinized and hydrated in a series of








graded alcohols: xylene 1 (5 min), xylene 2 (5 min), 100% ethanol for 2 min (x 2), 3%

hydrogen peroxide in methanol to block endogenous peroxidases (10 min), 95% ethanol

(2 min), 70% ethanol (1 min), and water (2 min).

Antigen retrieval was used to unmask antigenic OTR and PGHS-2 sites. Briefly,

slides were boiled at 1000 C for 20 min in EDTA buffer (pH 8.0) for OTR and 0.01 M

citric acid buffer for PGHS-2 (Richard Allan Scientific, Kalamazoo, MI). Slides were

kept in Tris buffer (IX) until blocking serum was added. Sections were incubated at 24C

for 20 min in Avidin-Biotin blocking reagent containing goat serum to block nonspecific

binding. The primary mouse monoclonal antibody against human OTR (anti-OTR 2F8,

was a kind donation from Dr. T. Kimura, Osaka University Medical School, Osaka,

Japan) (Takemura et al., 1994), was shown to react with bovine OTR (Fuchs et al.,

1996a). Antiserum was added to the sections at a dilution of 1:50 and incubation

conducted at room temperature (24C) for 1 h.

For PGHS-2 immunostaining, the primary polyclonal antibody (PG 27b human

anti-PGHS-2, Oxford Biomedical Research, Oxford, MI) was used at a dilution of 1:100.

Secondary biotinylated antibody in the ABC Vectastain kit (Vector Laboratories Inc,

Burlingame, CA) was added and sections incubated at 24C for 30 min followed by

Vectastain ABC reagent for 30 min. Diaminobenzidine-tetrahydrochloride (DAB)

reagent was then applied to the tissue sections for 3 min. Excess DAB was washed away

by placing the slides in distilled water. Counterstaining was conducted for 1.5 min using

hematoxylin (Richard Allan Scientific). Sections were rinsed in running water for 30 sec

and clarified with a clarifier (Richard Allan Scientific). Sections were then dehydrated

using a series of graded ethanol from 70%, 95%, 100% (x 2) and xylene (15 dips in each








solution). Sections were sealed with Richard Allan Scientific mounting medium and

cover slips. Sections were viewed under a Zeiss Axioplan II microscope to detect for

specific immunostaining for OTR or PGHS-2 antigen. Photomicrographs were taken at

200X magnification. For OTR, negative controls included sections from the same tissue

with antibody dilution buffer substituting for the primary antibody; whereas for PGHS-2

preimmune rabbit serum (PG 27c, Oxford Biochemical Research) at a dilution of 1:100

was substituted for primary antibody.

Statistical Analysis

Data were analyzed using the Statistical Analysis System (SAS) software version

8 (SAS Institute, Cary, NC). Group means of OTR, PGHS-2, PGES and PGFS mRNA

by tissue and day of pregnancy or cycle were computed. Data with unequal error

variances were log-transformed for data analysis. The model consisted of concentration

of OTR, PGHS-2, PGES and PGFS mRNA as the dependent variables and status (cyclic

or pregnant), tissue (caruncular, intercaruncular endometrium and chorioallantois), day of

cycle/pregnancy, status x tissue, status x day, tissue x day, status x tissue x day as

independent variables. Significance of differences between group means by status, type

of tissue and day of pregnancy or cycle were tested using ANOVA. Orthogonal contrasts

were conducted for the effects of status, day and tissue. Differences in means were

considered statistically significant at P < 0.05. Simple and partial correlations were

conducted to determine the relationships between the different genes. Transformed data

are presented as least squares means SEM.

























Fig. 4-1. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate OTR mRNA.
Rn (normalized reporter) = fluorescent emission intensity of the reporter dye divided by the fluorescent
emission intensity of the passive reference dye.






















0.01 -- --




0.001
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number

























Fig. 4-2. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate 18S rRNA.





























1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number


0.01




0.001

























Fig 4-3. Standard curve for estimation of efficiency of amplification of the OTR gene for validation of AA CT method.





Standard Curve






IM

4,

$





_ ______


1.2
Log CO


Slope: -3.485842
Intercept: 28.359133
Correlation: -0.996098


0.4


0.8


2.4





















Fig. 4-4. Standard curve for estimation of efficiency of amplification of 18S rRNA gene for validation of AA C-r method.






29

28

27

26

25

24

23

22

21

20


Standard Curve


-1------------




-,


=^^===


1.2
Log CO


Slope: -3.485842
Intercept: 28.359133
Correlation: -0.996098


0.4


0.8


2.4

























Fig. 4-5. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate PGHS-2 mRNA.
















1 -i -- -t--- -u t a- -- -- -u--uN -- N




0.01




0.001 --
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number

























Fig. 4-6. Standard curve for estimation of efficiency of amplification of PGHS-2 gene for validation of A A CT method.
























0 0.4


Standard Curve

*
*





*


0.8


1.2 1.6
Log CO


2 2.4


2.8


Slope: -3.216199
Intercept: 33.979012
Correlation: -0.997429


3.2

























Fig. 4-7. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate PGES mRNA.






10





1 ------_ -



0.001 *N ---J ----I--N---N----N-- --N--M------N--K--N N-------------------

n




0 .0 1 .





0.001 ".""
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number

























Fig. 4-8. Standard curve for estimation of efficiency of amplification of PGES gene for validation of AA CT method.





Standard Curve


0.4


0.8 1.2 1.6 2 2.4
Log CO


Slope: -3.107788
Intercept: 35.300079
Correlation: -0.998248


2.8

























Fig. 4-9. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate PGFS mRNA.
















-01 --^- --- I- -- ---- -- -

n /,




0.01 -




0.001
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number
























Fig. 4-10. Standard curve for estimation of efficiency of amplification of PGFS gene for validation of A A CT method.

























0.4


Standard Curve







4,

*I


0.8


1.2
Log CO


1.6


2.4


Slope: -3.300591
Intercept: 26.870775
Correlation: -0.999276


2.8








Results

Expression of OTR, PGHS-2, PGES and PGFS mRNA in Intercaruncular Endometrium

of Cyclic-Pregnant Cows from Days 7 to18.

A significant difference was observed between day 14 and 18 for OTR mRNA as

shown by orthogonal contrasts (P < 0.05) (Table 4-2). There was a significant status

(cyclic-pregnant) by day 14 versus day 18 interaction (P < 0.05). The mRNA for OTR

increased from day 14 to day 18 in cyclic cows but remained low in pregnant cows. The

status by day 14-18 interaction is shown in Fig. 4-11.

A status by day interaction (P < 0.01) was detected for PGHS-2 mRNA (Table 4-

2). In both cyclic and pregnant cows, PGHS-2 mRNA increased on days 14 and 18, but

the increase was appreciably greater in pregnant cows (Table 4-2 and Fig. 4-12). For

PGES mRNA significant status by day interactions (P < 0.05 and P < 0.01) were detected

(Table 4-2). In particular, PGES mRNA increased appreciably on day 18 for cyclic cows

but did not change for pregnant cows (Table 4-2). The change in PGES mRNA

associated with pregnancy reflects an attenuation in contrast to a stimulation for PGHS-2

mRNA. A more complex pattern of change was detected for PGFS mRNA (Table 4-2).

The mean expression of PGFS mRNA on day 7 was higher than for days 14-18 for both

cyclic and pregnant cows (P < 0.01). The expression declined by day 14 in cyclic cows

but was more sustained in pregnant cows at day 14 followed by a decrease on day 18

(Table 4-2).




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID ETJJS4F4A_PN9C82 INGEST_TIME 2014-04-14T19:31:47Z PACKAGE AA00014263_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES