Genetic and physiological analysis of moeA (molybdate metabolism) in Escherichia coli

MISSING IMAGE

Material Information

Title:
Genetic and physiological analysis of moeA (molybdate metabolism) in Escherichia coli
Physical Description:
xvii, 140 leaves : ill. ; 29 cm.
Language:
English
Creator:
Hasona, Adnan, 1964-
Publication Date:

Subjects

Subjects / Keywords:
Escherichia coli -- Genetics   ( lcsh )
Escherichia coli -- Physiology   ( lcsh )
Molybdenum enzymes   ( lcsh )
Microbiology and Cell Science thesis, Ph. D   ( lcsh )
Dissertations, Academic -- Microbiology and Cell Science -- UF   ( lcsh )
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1999.
Bibliography:
Includes bibliographical references (leaves 127-139).
Statement of Responsibility:
by Adnan Hasona.
General Note:
Typescript.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 030474466
oclc - 43401126
System ID:
AA00014254:00001


This item is only available as the following downloads:


Full Text












GENETIC AND PHYSIOLOGICAL ANALYSIS OF MOEA (MOLYBDATE
METABOLISM) IN ESCHERICHIA COLI



















By

ADNAN HASONA


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

1999















ACKNOWLEDGMENTS

First and foremost I thank my advisor, Dr. K. T.

Shanmugam, for his advice, encouragement, patience, and help

with all aspects of this work. His input was instrumental in

inspiring this journey and without him the road would have

been unsurpassable. The knowledge he has imparted and patience

he has displayed were vital to completing this study. I would

like to express my sincere gratitude to my committee members-

Drs. Arnold Bleiweis, Thomas Bobik, Lonnie Ingram, and James

Preston- for each contributing in special and meaningful ways

to my personal development and academic success. I also thank

all of my associates in Dr. Shanmugam's laboratory. Without

the advice and friendship of these colleagues, surviving the

last five years would have been impossible.

I owe much of my academic and personal success to my

wife, Kheir, who, by example, provided me with the motivation

and courage to pursue a Ph.D. degree. Her academic success,

sense of purpose, and optimism are constant reminders of

personal satisfaction and opportunity that result from hard

work and a good education. I also thank my children, Amani and

Ahmad, whose cheerfulness gave added incentive to complete my

study.











I would also like to thank my parents, Ahmad and Fatima,

who from the beginning provided the love, encouragement, and

financial support necessary for me to meet my educational

goals.


iii















TABLE OF CONTENTS

Page

ACKNOWLEDGMENTS . ....... .. ii

LIST OF FIGURES . ... .... .. vi

LIST OF TABLES . .... .viii

ABBREVIATION AND ACRONYMS . ... .x

GENE SYMBOLS ......... .. .. ..xiii

ABSTRACT . . . xv

INTRODUCTION . . .. .. 1

LITERATURE REVIEW . . 5

Molybdenum Cofactor Biosynthesis . .. .10
Eucaryotic MoeA Homologs . ... .17
Nitrate Reductase . . .. 20
Adaptive Response to Anaerobic Conditions 23
Human Molybdenum Cofactor Deficiency .. .24

MATERIALS AND METHODS . ... .26

Materials . . .. 26
Bacterial Strains . ... 26
Media and Growth Conditions ... .26
Isolation of Chlorate-Resistant Mutants .. .30
Enzyme Assay . . .31
In Vitro Activation of Apo-Nitrate Reductase 32
Construction of moe Plasmids. ... .33
Construction of moeA Deletion Strain .. .33
Construction of moeB-Km ... . 37
Construction of moeA-lacZ Fusions . ... 38
Purification of MoeA Protein ... .40
Purification of Mog Protein . ... 42
Purification of ArcA Protein . .. .44
Purification of NarL Protein . .. 46
In Vitro Phosphorylation . ... .47
RNA Preparation . ... .. .48















Primer Extension Experiment. .
DNA Electrophoretic Mobility Shift Assay. .
DNase I Protection Experiment .

RESULTS AND DISCUSSION

Characterization of moeA Mutants .
Putative Physiological Role of MoeA Protein
Role of MoeA in Mo-Cofactor Synthesis .
Role of MoeA Protein in the Regulation of
nar Operons . .
Transcriptional Regulation of moe Operon
in E. coli. . .


. 48
. 49
. 50




. 52
. 70
. 71

. 82

. 97


CONCLUSION . . ... 125

REFERENCES . . ... .... .127

BIOGRAPHICAL SKETCH . . .. .140















LIST OF FIGURES


Figure Page

1 Proposed biosynthetic pathway for the molybdenum
cofactor, MGD, in E. coli. ... .. .. 12

2 Schematic representation of molybdenum cofactor
biosynthetic protein from eukaryotes and E. coli
MoeA and Mog proteins ... . 19

3 Mechanism of nitrate regulation of nar operon
in E. coli . .. 22

4 Restriction map of plasmids containing moe DNA and
its deletion derivatives used in this study 34

5 Location of lacZ gene in the moeA-lacZ fusions. 39

6 Classification of chlorate-resistant mutants based
on their FHL phenotype . .. 53

7 A proposed model for activation of molybdenum in
a moeA mutant grown in LSM. . ... 64

8 Time course of MoeA-dependent activation of
nitrate reductase. . . .73

9 MoeA-dependent activation of strain AH69 extract 74

10 Activation of nitrate reductase in tungstate-
grown moeA mutant, strain AH69, extract .. .76

11 Suppression of Mog requirement for activation
of apo-nitrate reductase produced by strain
AH165 (mog, moeA) by molybdate ... .79

12 Kinetic of activation of apo-nitrate reductase
produced by E. coli, mog mutant, strain AH160 81

13 A proposed model for the regulation of narXL by
NarL-P, ModE, and MoeA-catalyzed product [Mo] 96











14 Identification of transcription start site of
moe operon . . .. 98

15 DNA sequence of moeAB promoter . ... .99

16 DNase I hydrolysis pattern of moe DNA in the presence
of NarL or NarL-P . ... .105

17 The bases in moe-zbiK intergenic region which
are hypersensitive to DNase I in the presence
of NarL-P . .... .106

18 Electrophoretic mobility shift of moe promoter
DNA in the presence of ArcA-P. . ... 121

19 DNase I protection of moe promoter by ArcA
protein . . .122

20 ArcA-binding region in the moeAB promoter
sequence . . ... 124


vii















LIST OF TABLES


Table Page

1 Bacterial strains and phages used in this study 27

2 Plasmids used in this study . ... .35

3 FHL and nitrate reductase activities of Class III
chlorate-resistant mutants . ... .55

4 Complementation of the mutation in Class III
mutants by various palsmids . ... .58

5 Complementation analysis of various moe mutants. 60

6 Effect of cys mutation on production of FHL and
nitrate reductase activities by moeA mutants 66

7 Effect of sulfide on the levels of nitrate
reductase activity produced by moeA mutants 68

8 Effect of mod mutations on narG-lacZ expression 83

9 Effect of moeA mutation on ModE-independent
narG-lacZ expression in the presence
of nitrate . .... .86

10 Effect of moeA mutation on ModE-dependent
expression of narK-lacZ in the presence
of nitrate . . .. 88

11 Effect of modE mutation on narX-lacZ expression 91

12 Transcription regulation of moe operon ...... 101

13 Nitrate-dependent expression of moe-lacZ requires
NarL and upstream promoter DNA ... 103

14. Requirement of ModE protein and molybdate for
expression of moeA-lacZ . ... 108


viii











15 Effect of mutations in MGD biosynthetic pathway
on moeA-lacZ expression . ... 111

16 Effect of mutations in MGD biosynthetic pathway
on the ModE-independent enhancement of
narG-lacZ expression . ... .113

17 Regulation of moeA-lacZ by global regulators .115

18 Effect of fnr on derepression of moeA-lacZ in
MPT-negative mutants . ... .119















ABBREVIATIONS AND ACRONYMS


AOR Aldehyde ferredoxin oxidoreductase

ApoNR Apo-nitrate reductase lacking MGD
cofactor

ArcA Oxygen-sensitive redox response regulator

ArcA-P ArcA phosphorylated form

ArcB Oxygen-sensitive redox sensor protein

ATP Adenosine triphosphate

bp base pair

CRP cAMP receptor protein

Da Dalton

DNA Deoxyribonucleic acid

DNase I Deoxyribonuclease I

DMS Dimethyl sulfide

DMSO Dimethyl sulfoxide

DTT Dithiothreitol

E. coli Escherichia coli

EDTA Ethylenediamine tetraacetic acid

FDH-H Formate dehydrogenase linked to
Hydrogenase 3 (FHL)

FDH-N Formate dehydrogenase

FHL Formate hydrogenlyase

FNR Fumarate-Nitrate Reductase (oxygen-
sensitive regulatory protein)









GTP

IPTG

Kd

Klenow

L-agar

LB

LBG

LBGM

LBGN

LBGMN

LSM

MGD

Mo

Mo-cofactor

[Mo]

MoCoD

ModC

Molybdopterin

ModE

MPT

mRNA

NarL

NarL-P

NR

ONPG

ORF


Guanosine triphosphate

Isopropyl-p-D-thiogalactopyranoside

Equilibrium dissociation constant

DNA polymerase I Klenow fragment

L-broth + agar

L-broth

L-broth + glucose

L-broth + glucose + molybdate

L-broth + molybdate + nitrate

L-broth + glucose + molybdate + nitrate

Low-sulfur medium

Molybdopterin guanine dinucleotide

Molybdenum

Molybdopterin with Mo

Activated molybdenum (putative)

Molybdenum cofactor deficiency

Molybdate transport protein

A unique pterin found in MGD

Molybdate-dependent regulator

Molybdopterin

Massenger ribonucleic acid

Nitrate response regulator

NarL phosphorylated form

Nitrate Reductase

Ortho-nitrophenyl-p-D-galactopyranoside

Open reading frame









PAGE Polyacrylamide gel electrophoresis

PCR Polymerase chain reaction

SDS Sodium dodecyl sulfate

TMAO Trimethylamine-N-oxide

Tris Tris-(hydroxymethyl)-aminomethane

X-gal 5-bromo-4-chloro-3-indolyl-
p-D-galactopyranoside

YbiK Open reading frame diverging from
moe operon with unknown function















GENE SYMBOLS

All of the genes listed below are from Escherichia coli K-12

Gene Symbol Alternate gene symbols; phenotype affected

arcA Redox response regulator

arcB Redox sensor


p-lactamase

Chlorate resistant (renamed mol)

mol mutants in plants and fungi (cofactor for
nitrate reductase and xanthine
dehydrogense)

FDH-H; format dehydrogenase-H (FHL)

Fumarate nitrate reductase; global regulator;
involved in transcriptional regulation of
genes in anaerobic respiration

Galactose metabolism

Hydrogenase isoenzyme 3 and putative electron
transfer proteins

molybdopterin biosynthesis; previously chlA

MGD biosynthesis; previously chlB

Molybdate transport; previously chlD

MGD biosynthesis; previously chlE

undefined mutation in molybdate metabolism

MGD biosynthesis; previously chlG

Nitrate-reductase structural genes


xiii


bla

chl

cnx


fdhF

fnr



gal

hyc


moa

mob

mod

moe

mol

mog

narGHJI









narK Nitrate/nitrite antiporter

narL Nitrate-response regulator

narX Nitrate sensor

zbiK Diverging gene upstream of moe operon with
unknown function















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

GENETIC AND PHYSIOLOGICAL ANALYSIS OF MOEA (MOLYBDATE
METABOLISM) IN ESCHERICHIA COLI

By

Adnan Hasona

August 1999

Chairperson: K. T. Shanmugam
Major Department: Microbiology and Cell Science

The biochemical pathway for the synthesis of molybdenum

cofactor present in molybdoenzymes such as nitrate reductase

and format hydrogenlyase has been described except for the

enzyme(s) in the activation and insertion of molybdenum into

the molybdopterin. In order to define the missing part of

the Mo-cofactor biosynthetic pathway, a unique class of

chlorate-resistant mutants of Escherichia coli defective in

molybdoenzymes was isolated. The mutation in these mutants

mapped in the moeA gene. These moeA mutants with a second

mutation in either cysDNCJI or cysH did not produce active

molybdoenzymes irrespective of the growth medium. Addition

of sulfide, the product of CysDNCJIH and CysG, to the growth

medium of moeA, cysN double mutant suppressed the MoeA-

phenotype. These results suggest that in a moeA mutant, the









sulfide produced by the sulfate activation/reduction pathway

reacts with molybdate for the production of activated

molybdenum ([Mo]) and molybdenum cofactor. By analogy, it is

proposed that the MoeA protein activates Mo and participates

in Mo-cofactor biosynthesis.

The activated molybdenum is also required for

molybdate-dependent transcriptional activation of narG and

narK operons (nitrate respiration). It is proposed that the

[Mo] modulates the biochemical activity of nitrate-sensitive

control proteins by regulating the activity of NarX protein,

which controls the level of NarL-P, the active form of

transcriptional activator. A molybdate-response regulator,

ModE-molybdate, is additionally required for the nitrate-

dependent expression of narXL operon.

The transcription of moe operon measured as P-

galactosidase activity produced by a moeA-lacZ is controlled

at two levels. The basal level of expression required the

redox regulator ArcA-P as positive activator. The ArcA-P

bound to the moe DNA and protected a region between -47 and

-146 bases from the transcription start site from DNase I

hydrolysis. The FNR protein negatively regulated moe operon

transcription. In addition, nitrate enhanced the level of

transcription of moe operon in a molybdate-dependent manner,

and this required NarL-P. These results show that the moe









operon expression is controlled by redox regulators and is

also increased to meet the higher demand for MGD during

nitrate respiration.


xvii














INTRODUCTION

Molybdenum-containing enzymes catalyze diverse redox

reactions, which play important roles in global nitrogen,

sulfur and carbon cycles (37, 38, 115). Some of these

oxidoreductases are essential for survival of humans (45,

55). All molybdoenzymes, other than dinitrogenase, contain a

molybdenum cofactor, which consist of a unique molybdopterin

(MPT) completed with molybdenum (1, 37, 81, 82). The core

structure of MPT is highly conserved in all organisms. In

bacteria, including Escherichia coli, MPT is further

modified by covalent attachment of a guanosine monophosphate

to produce molybdopterin guanine dinucleotide (MGD), the

active Mo-containing cofactor (12, 81, 88, 106). Synthesis

of MGD requires transport of molybdate into the cell,

activation of molybdate to appropriate form of molybdenum

([Mo]), synthesis of the organic skeleton of MGD and

incorporation of [Mo] to produce the active cofactor (34,

82).

Mutants which are defective in molybdate metabolism

were isolated as chlorate-resistant mutants (30, 31). Many

of these mutants are defective in the biosynthesis of

molybdenum cofactor and are thus pleiotropic for all

molybdoenzyme activities (2, 104, 105). These mutations map











at five distinct loci, moa, mob, mod, mog and moe, all of

which have been cloned and sequenced (41, 66, 72, 77, 85,

111).

The mod operon encodes the high-affinity molybdate-

specific uptake system through which molybdate is

transported into the cell and the mod mutation can be

suppressed by increasing the molybdate concentration in the

medium (30, 34). The control of molybdate transport into the

cell is mediated through a molybdate-response regulator,

ModE protein (32, 34, 111). Analysis of transcriptional

control of the genes coding for molybdoenzymes, indicates

that the ModE protein is a secondary transcriptional

activator of hyc and nar operons coding for hydrogenase 3

isoenzyme and respiratory nitrate reductase, respectively

(96).

The moa gene products (MoaA, B, and C) are required for

the biosynthesis of precursor Z, a precursor to MPT (48, 76,

81). The moe operon codes for two proteins, and only the

physiological role of the second product, MoeB protein, is

known. The MoaD and MoaE proteins (MPT synthase) along with

MoeB protein catalyze the conversion of precursor Z to MPT.

The MoeB protein, MPT synthase sulfurylase, is the known S

donor in the activation of MPT synthase.

The physiological role of MoeA protein coded by the

first gene of the moe operon or the Mog protein is not











known. In three different eukaryotes, Drosophila

melanogaster (51), Arabidopsis thaliana (102) and rat (78),

the MoeA and Mog protein homologs constitute a single

protein. Mendel and his coworkers (94, 103) showed that the

purified Mog-domain from the Cnxl protein from A. thaliana

or the gephyrin from rat binds MPT with high affinity.

Although MPT also binds to the MoeA-domain from these two

proteins, the affinity is lower. These results suggest that

the MoeA and Mog proteins from E. coli function as a complex

in molybdenum-cofactor biosynthesis.

The MobA protein from E. coli catalyzes the

guanylylation of molybdopterin to produce the final form of

the cofactor, MGD.

Rivers et al. (85) reported that the expression of moa

operon is increased when the cells were grown under

anaerobic conditions in an FNR-independent manner. Nitrate

had no effect on the level of expression of moa operon (5).

The mob operon is transcribed constitutively although the

cellular demand for MGD varies with the growth medium (41).

The physiology and biochemistry of all the proteins in

the MGD biosynthesis pathway in E. coli except the MoeA and

Mog proteins are known. In order to fully understand the

molybdenum-cofactor biosynthesis in E. coli and by

extrapolation to other organisms, the physiological role of









4
MoeA is investigated in this study. Additionally, the

genetic regulation of the moe operon is also studied.















LITERATURE REVIEW

Molybdenum, an essential trace element, provides a

redox active center in the molybdenum cofactor. The known

molybdoenzymes catalyze either two-electron reduction or

two-electron oxidation reactions with respect to their

substrate (37, 106). Reductive molybdoenzymes (other than

tetrathionate reductase), catalyze the removal of an oxygen

atom from either sulfur, nitrogen, or carbon in the

substrate. The oxygen atom eventually ends up in water. The

molybdoenzymes that facilitate substrate oxidation are

defined as oxidase, hydroxylase or dehydrogenase. The basic

features of the oxidative reaction (other than format

dehydrogenase) involve the transfer of an oxygen atom

derived from water to a substrate.

The molybdenum cofactor present in all molybdoenzymes

except nitrogenase contains a unique molybdopterin (MPT)

completed with molybdenum ion (12, 81). The metal ion is

coordinated to the cofactor through the dithiolene sulfurs

from two molybdopterin molecules. In general, molybdoenzymes

from eukaryotes and archaea contain only the pterin-

containing cofactor, while the bacterial enzymes usually

contain a nucleotide conjugate of the cofactor with a GMP,











CMP, AMP or IMP linked via a pyrophosphate linkage (20, 67,

81, 86, 92, 93).

Escherichia coli, a facultative anaerobic bacterium,

like many other enteric bacteria, has evolved the ability to

adapt rapidly to environmental changes. Short term

adaptation involves regulation of the activities of

particular enzymes and longer term adaptation involves

controlling the expression of energy generating pathways

(29, 44, 101, 109). E. coli is able to grow aerobically by

respiration and in the absence of oxygen by anaerobic

respiration with nitrate, fumarate, dimethylsulfoxide, and

trimethylamine-N-oxide as an electron acceptor or by

fermentation (8, 29, 109). Anaerobic terminal

oxidoreductases, such as nitrate reductase,

dimethylsulfoxide reductase, and trimethylamine-N-oxide

reductase contain molybdenum as a cofactor in the form of

MGD (81, 99, 114). Formate dehydrogenase isoenzyme N,

another molybdoenzyme, serves as the electron donor for

these terminal oxidoreductases (29). Other molybdoenzymes,

such as biotin sulfoxide reductase, which catalyzes the

reduction of biotin sulfoxide to biotin is constitutively

expressed in E. coli (21). Formate dehydrogenase isoenzyme H

is part of fermentation reactions (8, 9). Several of these

molybdoenzymes from E. coli have been purified and

characterized.











The crystal structure of E. coli FDH-H revealed that

the enzyme consists of four domains (12) and the molybdenum

active site is deeply buried and is accessible through an

extended tunnel. The Mo active site is coordinated by two

MGD cofactors each containing a tricyclic ring with a pyran

ring fused to the pterin. The bis-MGD is ligated within the

interfaces of all four domains through an extensive network

of hydrogen bonds, salt bridges, and Van der Waals

interactions (12). The coordination sphere of the Mo is

accommodated by four sulfurs originating from the two

dithiolene groups, by selenium from the Se-cysteine-140 and

by a hydroxyl species. The selenium group is involved in Mo

ligation and in proton transfer during format oxidation.

The format dehydrogenase has an additional redox center, a

[4Fe-4S] cluster, which is located in the N-terminal domain

in close proximity to the molybdenum cofactor. This cofactor

receives electrons from the molybdenum center upon substrate

binding. The crystal structures of several other

molybdoenzymes have been solved to various degrees of

resolution, aldehyde ferredoxin oxidoreductase (AOR) from

pyrococcus furious (15), aldehyde oxidoreductase from

Desulfovibrio gigas (86), dimethylsulfoxide (DMSO) reductase

from Rhodobacter sphaeroides (92), and Rhodobacter

capsulatus (67, 93), sulfite oxidase from chicken (55) and

most recently, trimethylamine-N-oxide (TMAO) reductase from











Shewanella massilia (20). These proteins also contain

molybdenum cofactor in a conformation similar to that of E.

coli FDH-H but with different side chain substitutions in

place of GMP.

Molybdenum and tungsten are chemically similar. Because

of their similarity, tungsten can substitute for the

molybdenum ion in the active site (49, 56). However, E. coli

grown in presence of excess tungstate, produced inactive

nitrate reductase, DMSO reductase and format hydrogenlyase.

Recently, Buc et al. (14) demonstrated that a W-substituted

TMAO reductase is competent in reducing TMAO to

trimethylamine or DMSO to dimethylsulfate as well as

supporting the growth of E. coli with these substrates as

anaerobic terminal electron acceptors. The W-substituted

enzyme is relatively more stable at high temperature than

the molybdenum containing enzyme. Probably because of the

higher thermostability, the enzymes from various themophilic

organisms contain tungsten instead of molybdenum in their

active site. These W-enzymes also contain a cofactor which

is similar to the molybdenum cofactor found in mesophilic

organisms. Coordination of tungsten through the dithiolene

group in the bis-configuration is identical to that of

molybdenum coordination (15). If the W sites in

tungstoenzymes are structurally analogous to the Mo sites in

molybdoenzymes, one might expect that molybdoenzymes as well











as tungstoenzymes would retain catalytic activity after

substitution of one metal with another. However, in most

organisms, the metal ion specificity is strict and in the

presence of the other ion, only inactive enzymes are

produced by the cell (36, 88) with few exceptions such as

the TMAO reductase of E. coli (14).

In contrast to the sufficiency of structural

information, very little is known about how the molybdenum

cofactor is synthesized, assembled and inserted into the

apoprotein. It has been demonstrated that MGD is essential

for the assembly of nitrate reductase and dimethylsulfoxide

reductase complex in the membrane (88, 89). Rothery et al.

(89) demonstrated that in the absence of the mobAB gene

products, the cofactorless NarGH dimer was not translocated

to the membrane. It has been suggested that the insertion of

the molybdenum cofactor into apo-nitrate reductase is

facilitated by the NarJ protein another member of the

narGHJI operon (7, 63). The mobAB mutation also has a

similar effect on the assembly of the E. coli

dimethylsulfoxide reductase, into the membrane (88). The

presence of Mo-MGD in the cytoplasm is also a prerequisite

for the translocation of TMAO reductase to the periplasmic

space (14). Apparently, the TMAO reductase crosses the

cytoplasmic membrane in stable folded conformation with the











cofactor, which is independent of Sec proteins, known

chaperons for protein translocation in E. coli.



Molybdenum Cofactor Biosynthesis

The molybdenum cofactor is a ubiquitous molecule found

in almost all organisms from bacteria to humans and is

required for activity of all molybdoenzymes (37, 115). The

molybdenum cofactor consists of a unique and highly

conserved organic moiety termed molybdopterin (MPT), and

molybdenum ion (81). In spite of the name, the molybdopterin

also serves as the organic component of tungsten-cofactor in

appropriate organisms (49, 56).

Genetic analysis of the Mo-cofactor biosynthetic

pathway which started with Pateman et al. (74) led to the

isolation of a series of pleiotropic mutations in

Aspergillus nidulans resulting in deficiency of nitrate

reductase and xanthine dehydrogenase. These findings led to

the suggestion of a common cofactor required by both

enzymes. Subsequent studies by Nason et al. (71), showed

that a molybdenum-free aponitrate-reductase from a mutant

strain of Neurospora crassa, nit-1, could be activated

byacid-denatured extract from other molybdoenzymes. The

acid- and heat-stable low molecular weight component, which

can be extracted from molybdoenzymes from bacteria, fungi or

human, was identified as molybdenum cofactor. This

molybdenum cofactor is capable of reconstituting the NADPH-











dependent, inactive, apo-nitrate reductase in the extracts

of N. crassa mutant strain nit-1. This finding provided

further evidence for the universality of the molybdenum

cofactor. This in vitro reconstitution of the nitrate

reductase apoprotein in extracts of nitrate-induced N.

crassa nit-1 has become the most commonly used assay for

molybdenum cofactor during the elucidation of molybdenum

cofactor biosynthesis.

Our current understanding on the biosynthesis of

molybdenum cofactor has been acquired from studies of

molybdenum cofactor defective mutants (chlorate-resistant

mutants) of E. coli. Proteins encoded by four different

operons, designated moa, mob, moe, and mog, are required for

synthesis of active molybdenum cofactor (81). Extensive

molecular, genetic and biochemical analysis of these mutants

led to the proposed pathway for molybdenum cofactor

biosynthesis in E. coli that consists of five stages (Fig.

1).

The structure of the cofactor which is extremely labile

was initially deduced by analysis of its stable degradation

products and was later established by X-ray diffraction

analysis of the molybdoenzymes (12, 81). The first stage in

MGD synthesis is the formation of precursor Z, a S-free form

of MPT possessing the 6-alkyl side chain from a guanosine or

guanosine derivative (Fig. 1) (76). The synthesis of














Guanosine


SMoaA-C



Precursor Z



MPT Synthase
MPT Synthase


MoaE





).


o H
H C = C -CHOH CHOPO,'

H

Molybdopterin (MPT)

SMogAL

0 H
H C=C-CHOH CHiOPO,
IH, NX I I s

Mo
S"o
Molybdenum cofactor


MoaD M
MoaD



S
MoeB


XS X


MoeA (?)
[Mo] --- MoO42


Mob Molybdopterin Guanine
dinucleotide (MGD)


Fig. 1. Proposed biosynthetic pathway for the molybdenum
cofactor, MGD, in E. coli.











precursor Z is catalyzed by the products of moaA and moaC

genes, although the mechanism of this reaction is not known.

During the second stage, the molybdopterin synthase

(MPT synthase) transfers sulfur atoms to precursor Z

generating molybdopterin (Fig. 1). The MPT synthase is a

hetrodimeric protein composed of two different subunits of

8.5 KDa and 16.8 KDa (76) encoded by moaD and moaE genes,

respectively. The MoeB protein, MPT synthase sulfurylase,

sulfurylates the MoaD protein which is the donor of the

dithiolene sulfurs in MPT (76). The physiological source of

the sulfur atom in MoeB is yet to be determined.

In the environment, molybdenum is normally available in

trace quantities as a soluble oxyanion molybdate (Mo04'2).

Specific transport systems for molybdate have evolved that

consist of membrane proteins whose expression is generally

subject to transcriptional regulation. Tight regulation is

required to allow the cell to respond to fluctuating growth

conditions in order to maintain the required concentration

of molybdate. Corcuera et al. (18) showed, using whole

cells, that the high-affinity molybdate transport is energy-

dependent. Early work with E. coli suggest that a specific

class of chlorate-resistant mutants, chlD (mod; 98), which

lack the activities of both format dehydrogenase and

nitrate reductase, are defective in molybdate transport

since the mutant phenotype can be suppressed by high

concentration of molybdate (30). These mutants were later









14
shown to be defective in modABC operon (34, 69). The modABC

operon, has been characterized (66, 87, 111), and the genes

are located at 17.1 min on the E. coli chromosome (6). The

mod gene products are similar to other proteins comprising

ABC-type transport system in E. coli suggesting that

molybdate is transported by an ATP-dependent transport

system (66). The first gene product is ModA, a periplasmic

binding protein (83) that specifically recognizes and binds

molybdate at a Kd of 80 nM. ModA also binds tungstate but

with a lower affinity (83). However, using whole cells, a Kd

of 9 nM and 20 nM was obtained in two separate experiments

for initial binding of 9Mo to E. coli cells (18, 40). The

ModA protein does not bind other oxyanions sulfate,

phosphate or vanadate (83).

The crystal structure of ModA with bound molybdate or

tungstate from E. coli and Azotobacter vinelandii, are

essentially identical (39, 60) and resemble periplasmic

small molecule-binding proteins (79). Comparison of ModA

ligand structure to the sulfate binding protein (SBP) from

E. coli and Salmonella typhimurium revealed significant

similarity. However, the amino acid sequence is only about

34% similar (39). Although in both ModA and SBP the anion is

bound by seven hydrogen bonds, there are differences in the

chemical nature of the hydrogen donors which might account











for the selective discrimination between molybdate/

tungstate, the larger oxyanion, and sulfate (39, 60).

The ModB protein contains several hydrophobic regions

suggesting a location in the inner cell membrane (66, 111).

Based on comparative analysis of ABC-type transporter

systems, it appears that the ModB protein forms a

homohexameric-transmembrane channel for molybdate. The third

component of the transport system, ModC, is a membrane-

associated ATP-binding protein (34, 66, 111). Mutations in

modABC genes can be suppressed by the addition of high

concentration of molybdate (higher than 0.1 mM) to the

growth medium. In these mutants molybdate is apparently

transported by a low affinity, non-specific, anion

transporter (61). In addition, under sulfur-limiting

conditions, molybdate is also transported through the

sulfate transport system (61, 87).

The expression of modABC operon is elevated when the

cells were grown under molybdate starvation conditions

introduced by either medium composition or by a mutation in

the modABC genes. Addition of molybdate to the growth medium

greatly reduced the level of mod operon expression (32,

111). A regulatory protein, ModE, is responsible for this

molybdate-dependent repression of transcription of the mod

operon (32). Grunden et al. (32) have shown that the

transcription/translation of modAB genes is repressed by











molybdate both in vivo and in vitro and requires ModE-

molybdate. The regulatory protein ModE is encoded by the

first gene in a divergent operon modEF (32, 111). The N-

terminal domain of ModE contains a helix-turn-helix motif

found in other DNA binding proteins and mutations in this

region result in constitutive expression of the mod operon.

Sequence comparison of ModE homologs from several organisms

identified a conserved amino-acid motif, (T/S)SARNQxxG, and

mutations within this sequence converted the protein into a

Mo-independent repressor (32, 34). The apparent Kd for ModE-

molybdate association was determined to be 80 pM (3, 34).

Constitutive expression of ModE is consistent with its

proposed role as a regulatory protein. In vitro DNA mobility

shift experiments and DNase I protection experiments

confirmed the association of ModE with its cognate modA

operator region (3, 33), and this interaction is molybdate-

dependent. The ModE-MoO4,2 protected region (DNase I foot-

printing experiment) contains unique pentamer sequence,

TAYAT ( where Y = C or T) as well as tetramer sequence, GTTA

(33). The apparent Kd for the interaction between the modA

operator DNA and ModE-molybdate was 0.3 nM and this value

increased to 8 nM in the absence of molybdate (33).

The fourth part of MGD synthesis involves processing or

activation of molybdate for incorporation into MPT in the

formation of the Mo-cofactor (Fig. 1). The mechanism of










activation of molybdate and incorporation of the molybdenum

into MPT is not known. The mog gene product is dispensable

in this process since the Mog- phenotype can be suppressed

by increasing the medium concentration of molybdate (105).

The Mog protein which binds MPT is apparently required for

incorporation of molybdenum into MPT in the presence of low

concentration of molybdate (81).

The final stage in MGD biosynthesis involves the

attachment of a nucleotide, GMP in E. coli, to the terminal

phosphate group of molybdopterin via a pyrophosphate link,

to form molybdopterin guanine dinucleotide (MGD) (Fig. 1).

In E. coli, this final step is catalyzed by the proteins

encoded by the mob locus in the presence of GTP (88). Other

prokaryotic variants of the cofactor containing GMP, CMP,

AMP and IMP linked to the MPT were identified as well (2,

20, 67, 81, 86, 92, 93). These dinucleotide forms were only

found in enzymes from prokaryotes. The MobB protein encoded

by the second gene in the mob locus was not essential for

MGD biosynthesis but in vitro this protein enhanced the rate

of nucleotide addition to the molybdenum cofactor (27).

Eucaryotic MoeA Homologs

Proteins with similarity to the E. coli MoeA and Mog

proteins have been identified and characterized in other

organisms including rat (Gephyrin), Arabidopsis thaliana

(Cnxl), and Drosophila melanogaster (Cinnamon) (51, 78,











102). Mutations in these genes lead to defects in

molybdoenzyme activity (28, 103). Besides its putative role

in the molybdenum-cofactor biosynthesis, gephyrin also plays

a role in linking the glycinergic receptor to the

subsynaptic cytoskeleton in the central nervous system (54).

Sequence analysis of the three proteins revealed that

they consist of two domains; the N-terminus of gephyrin and

cinnamon is similar to the E. coli Mog protein (Mog-domain)

and the C-terminus is similar to the E. coli MoeA protein

(MoeA-domain) (Fig. 2). The two domains in the gephyrin

protein are connected to each other with a 136 amino-acid

linker region, which presumably interacts with the glycine

receptor. However, in the case of Cnxl protein, the order of

the two domains is reversed as compared with the gephyrin

and cinnamon protein. Both the Cnxl and gephyrin

complemented an E. coli mog mutation but not a moeA mutation

(94, 102, 103). Apparently, these eukaryotic proteins after

expression in E. coli lack the appropriate processing

required for MoeA-activity. Biochemical analysis of Cnxl and

gephyrin proteins demonstrated that the Mog-domain binds MPT

with high affinity while the MoeA-domain binds with lower

affinity (94).

These studies suggest that each of the three eucaryotic

proteins, gephyrin, Cnxl, and cinnamon, catalyze the

reaction carried out by two separate E. coli proteins. It is

















Mog MoeA

LZZZZIZZ


Mog-domain MoeA-domain


Cinnamon (Drosophila)


Mog-domain


MoeA-domain


Gephyrin (Rat)


MoeA-domain Mog-domain

I EMM>~


Cnxl (Arabidopsis)


Fig. 2. Schematic representation of molybdenum cofactor
biosynthetic protein from eukaryotes and E. coli MoeA and
Mog proteins. Regions with significant amino acid sequence
similarity to the E. coli Mog and MoeA proteins carry
similar shading. Interdomain linker region in gephyrin and
Cnxl is shaded dark and these are not similar.


E. coli


~8~i"e~









20

possible that the MoeA and Mog proteins function in E. coli

as a complex and in eukaryotes the moeA and mog genes were

fused during evolution, resulting in a single gene product.

The use of such a protein from the molybdate metabolism in

glycine receptor clustering in mammals is a mystery (28,

54).

Nitrate Reductase

E. coli can use a variety of electron donors and

acceptors for respiration (29). Under anaerobic conditions,

nitrate is the preferred electron acceptor. Formate serves

as an efficient electron donor for nitrate respiration. The

oxidation of format during nitrate respiration is catalyzed

by format dehydrogenase-N, encoded by fdnGHI operon {33.3

min on the E. coli chromosome (6)}. The format

dehydrogenase-N contains MGD at its active site.

The nitrate reductase structural genes are coded by the

genes in the narGHJI operon (27.4 min on the E. coli

chromosome) (6). Transcription of this operon is induced by

nitrate under anaerobic conditions. Concurrent with this

activation, operons encoding other enzymes involved in

anaerobic respiration utilizing other electron acceptors

(including fumarate reductase, dimethylsulfoxide reductase)

as well as pyruvate-formatelyase are repressed partially or

completely (29). Anaerobic expression of narGHJI operon











requires the product of the fnr gene, a redox-sensitive

global regulator (101).

The nitrate-specific induction/repression of narGHJI is

mediated through the NarL response regulator protein (Fig.

3). The narXL operon diverges from the narK, narGHJI cluster

(11, 80). The NarX and NarL proteins are members of the

histidine protein kinase (sensor) and response regulator

family of proteins (two-component regulatory systems) in

which NarX is the membrane-bound sensor of nitrate and the

NarL is the DNA-binding regulator (29, 112). The

phosphorylated NarL protein (NarL-P) binds to specific DNA

sites to effect transcriptional induction or repression of

the various nitrate-controlled genes. DNase I-footprinting

has identified a NarL-P binding site consensus sequence,

TACYNMT (where Y = C or T and M = A or C), termed NarL

heptamer (62, 108). Besides this pair of nitrate response

regulators, two other proteins, NarQ and NarP also serve to

regulate the levels of narG expression in E. coli, in which

the NarQ protein is a homolog of the NarX protein, the

histidine protein kinase, and the NarP protein is the

response regulator (80).

Transcription of genes coding for molybdoenzymes such

as nitrate reductase also requires the presence of molybdate

(19, 87). The nitrate-dependent increase in transcription of

the nar operons requires molybdate and not the molybdopterin

























/ ATP a
I I NarL-P FNR
+ N03


(?) | Nitrate reductase apoprotein

I 'Mo-cofactor

Mo


Active nitrate reductase

Fig. 3. Mechanism of nitrate regulation of nar operon in E.
coli









23

(73, 96). The molybdate-dependent enhancement of nar operons

is mediated through the control of expression of narXL by

ModE protein (96). A second ModE-independent, Mo-dependent

control of both narK and narGHJI also exist in E. coli and

this study provides evidence that MoeA protein is part of

this second control system.

Adaptive Response to Anaerobic Conditions

The two global regulatory systems, FNR and ArcA/ArcB,

play a major role in the adaptation of the cell to anaerobic

and aerobic environments (44, 101, 109). In response to

anaerobic conditions, FNR protein activates the expression

of a number of genes involved in fermentation and anaerobic

respiration, such as nitrate-, fumarate- and TMAO-

reductases (109). The FNR protein shares structural

similarity with the transcriptional regulator CRP (cAMP

receptor protein) of E. coli (101). Like CRP, FNR contains a

DNA-binding regulatory domain and binds DNA as a dimer. In

contrast to CRP, FNR contains an oxygen sensing domain at

the N-terminus, which contains a Fe-S cluster (52, 53).

Under anaerobic conditions, the acquisition of a [4Fe-4S]

center leads to FNR dimerization. The dimeric FNR, present

under anaerobic conditions, is the regulatory-competent

state and binds specifically to target DNA with sequence

TTGAT-4N-ATCAA (52, 53, 110).











The ArcA/ArcB two component control system of E. coli

consists of the ArcB protein as the membrane-sensor kinase

comprising both a transmitter domain and a receiver domain,

and the ArcA protein as its response regulator (64, 65).

Upon stimulation, ArcB protein undergoes autophosphorylation

and transfers a phosphoryl group to ArcA, which then becomes

active (42). ArcA generally behaves as an anaerobic

repressor, but in some cases it has been shown to activate

transcription (42). The exact nature of the signal

activating the Arc system is not known. luchi et al. (43)

proposed that the generation of the signal requires terminal

cytochromes, suggesting that the stimulus sensed by ArcB is

a terminal electron carrier in a reduced form that

accumulates in the absence of oxygen.

Human Molybdenum Cofactor Deficiency

Molybdenum cofactor deficiency in mammals, including

humans, is a rare and devastating disease, characterized by

severe neurological abnormalities, decreased brain size and

dislocated ocular lenses, which most often leads to death at

a young age (28, 45, 46). The molybdenum cofactor deficiency

is inherited as an autosomal recessive inborn error of

metabolism resulting from an inability to synthesize

functional molybdopterin. In mammals, defects in

molybdopterin synthesis lead to the pleiotropic loss of the

molybdoenzymes aldehyde oxidase, sulfite oxidase and

xanthine dehydrogenase (45). Among these enzymes, the











absence of sulfite oxidase is attributed to the severe

clinical complexity (45). The neurological damage could be

due to the toxic effects of higher sulfite concentration,

sulfate deficiency or a combination of both (45, 46). No

treatment is currently available for halting or reversing

the progression of the neurological damage (45).

Patients defective in molybdenum cofactor biosynthesis

were classified into two groups that are thought to

represent two steps in molybdopterin synthesis: type A

defective in the formation of precursor Z and type B

defective in the conversion of this intermediate into

molybdopterin (47).

Mutations in genes encoding the first two proteins

(MoaA and MoaC) required in the molybdenum cofactor

biosynthetic pathway are located in an 8-CM region on human

chromosome 6 (97). cDNA encoding these two genes, human-moaA

homologs (MOCS1A) and human-moaC homologs (MOCS1B), was

isolated as a single transcript (84). Recently, another

human locus encoding molybdopterin synthase (MOCO1-A and

MOCO1-B) which is involved in the conversion of precursor Z

to molybdopterin has been identified on human chromosome 6

(MOCO1 locus) (100). Localization of these genes can lead to

diagnostic markers for prenatal detection of molybdenum

cofactor biosynthesis. The severity of the pathology

observed in this fatal disorder emphasizes the essential

need for molybdenum and molybdenum cofactor for normal human

development.














MATERIALS AND METHODS

Materials

Biochemicals were purchased from Sigma Chemical Co (St.

Louis, MO). Other organic and inorganic chemicals were from

Fisher Scientific (Pittsburgh, PA) and were analytical or

molecular biological grade. Restriction endonucleases and

DNA-modifying enzymes were purchased from Promega (Madison,

Wis.), New England Biolabs (Beverly, MA) and Gibco-BRL

(Gaithersburg, MD).

Bacterial Strains

Bacterial strains used in this study are listed in

Table 1. All bacterial strains used are derivatives of

Escherichia coli K-12.

Media and Growth Conditions

L broth (LB) which contains BBL-trypticase peptone (10

g), BBL-yeast extract (5 g), and NaCl (5 g) in 1L H20 was

used as rich medium for growth of organisms under aerobic

conditions, and LB with glucose (0.3%; LBG) was used as rich

medium for anaerobic growth. LBG was supplemented with

format (15 mM; LBGF), sodium molybdate (1 mM; LBG-Mo), or

nitrate (20 mM; LBGN), as needed. The composition of

glucose-minimal medium was reported previously (87).

Limiting-sulfur medium (LSM) (61) had the following











Bacterial strains and phages used in this study


Relevant genotype


Source or
Reference


BW545 D(lacU)169 rpsL
MC4100 araD139 rpsL150 A(argF-lacU)205
relAl flb5301 deoC1 ptsF25
RK4353 MC4100 gyrA219 non-9
RK5278 RK4353 narL215::Tn0O
VJS720 chlD247::TnlO (modB247)
VJS1779 RK4353 moe-251::TnlOd(Tc)
VJS1780 RK4353 mob-252::TnlOd(Tc)
VJS1782 RK4353 moa-254::Tnl0d(Tc)
VJS1783 RK4353 moe-255::Tn10d(Tc)
VJS1784 RK4353 mog-256::TnlOd(Tc)
WS178 modB::TnlO AmodE-Km
C26 gal-26 chlE5 (moeA5) supE42
ECL594 arcBl zgi::TnlO
ECL618 arcA2 zjj::TnlO
N3030 gal::TnlO IN(rrnD-rrnE)1
JT1 thr-1 ara-14 leuB6 A(gpt-proA)
62 lacY1 sbcC201 tsx-33 kdg51
galK2 sbcB15 hisG4(Oc) recB21
rbfDl mgl-51 cysN-Km recC22
xylA5 rpsL31 mtl-1 argE3(Oc)
thi-1 glnV44 (AS)
JM73 thr-1 leuB6 fhuA2 lacYl gal-6
trp-1 rfbDl hisG1 (Fs) thi-1
cysJ90 galP63 A(gltB-gltF)500
rpsL9 malTl(AR) xylA7 mtlA2
glnV44(AS) AargHl
SE1581 BW545 moeAlOl
SE1588 BW545 moeA103
SE1905 SE1588 zbh::TnlO
SE1595 BW545 modCll8
SE1910 BW545 AmodE-Km
SE1932 BW545 fnr zcj::TnlO
SE2147 BW545 AmoeA113 zbi::TnlO
Azbi-Km
AH1 SE1588 cysN-Km
AH8 JM73 moeA103 zbh::TnlO
AH10 JT1 moeA103 zbh::TnlO
AH29 BW545, AAH1


Lab. collection

CGSC 6152
V. Stewart
V. Stewart
V. Stewart
V. Stewart
V. Stewart
V. Stewart
V. Stewart
V. Stewart
Lab. collection
CGSC 4459
E. C. C. Lin
E. C. C. Lin
CGSC 6659






CGSC 7057





CGSC 5748
This study
This study
This study
(66)
(32)
Lab. collection

Lab. collection
SE1588 X Pl(JT1)
JM73 X P1 (SE1905)
JT1 X P1 (SE1905)
This study


Table 1.

Strain
or Phage











Table 1, continued


Strain Relevant genotype Source or
or phage Reference


AH30
AH47
AH48
AH49
AH52
AH55
AH56
AH57
AH58
AH59
AH60
AH61
AH63
AH108
AH109
AH111
AH112
AH113
AH116
AH119
AH124
AH160
AH165

\e(narG-
SE2176
SE2163
SE2160
SE2161
SE2162
SE2164
SE2165
SE2166
AH85
AH100
AH117
AH128
SE2200
SE2202


moeB101-Km
AH29 modB247::Tn10
AH29 moeA103 zbh::TnlO
AH29 AmodE-Km
AH49 moeA103 zbh::TnlO
AH29 mob-252
AH29 mog-256
AH29 arcBl zgi::TnlO
AH29 narL::TnlO
AH29 fnr zcj::TnlO
AH29 arcA2 zjj::TnlO
AH29 moeBl-Km
AH29 moa-254::TnlO
AH29 AmoeA113
AH49 AmoeA113
AH55 AmodE-Km
AH56 AmodE-Km
AH63 AmodE-Km
SE1910 gal::TnlO
AH61 narL::TnlO
AH61 AmodE-Km gal::TnlO
BW545 Amog zji::TnlO
AH160 AmoeA

lacZ) derivative
BW545 A'(narG-lacZ)
SE2176 AmodE-Km
SE2176 moa-254
SE2176 mob-252
SE2176 mog-256
SE2160 AmodE-Km
SE2161 AmodE-Km
SE2162 AmodE-Km
SE2176 AmoeA113
SE2163 AmoeA113
SE2176 moeBlO-Km
AH117 AmodE-Km, gal::TnlO
SE2176 modB::TnlO AmodE-Km
SE2176 modB::Tn10


This study
AH29 X P1 (VJS720)
AH29 X Pl (SE1905)
AH29 X P1 (SE1910)
AH49 X P1 (SE1905)
AH29 X P1 (VJS1780)
AH29 X Pl (VJS1784)
AH29 X P1 (ECL594)
AH29 X P1 (RK5278)
AH29 X P1 (SE1932)
AH29 X P1 (ECL618)
AH29 X P1 (AH30)
AH29 X Pi (VJS1782)
AH29 X PI (SE2147)
AH49 X P1 (SE2147)
AH55 X Pl (SE1910)
AH56 X PI (SE1910)
AH63 X P1 (SE1910)
SE1910 X P1 (N3030)
AH61 X P1 (RK5278)
AH61 X P1 (AH116)
This study
AH160 X P1 (AH69)


This study
SE2176 X Pl(SE1910)
SE2176 X P1(VJS1782)
SE2176 X P1(VJS1780)
SE2176 X P1(VJS1784)
SE2160 X P1(SE1910)
SE2161 X P1(SE1910)
SE2162 X P1(SE1910)
SE2176 X P1(SE2147)
SE2163 X P1(SE2147)
SE2176 X Pl(AH30)
AH117 X P1(AH116)
SE2176 X Pl(WS178)
SE2176 X P1(VJS720)











Table 1, continued


Strain Relevant genotype Source or
or Phage Reference


A\(narK-
VJS4809
AH121
AH77
AH79
AH81
AH83
AH93
AH105
AH107
AH120
AH127

XO((narX-
VJS2009
AH122
AH76
AH78
AH80
AH82
AH92
AH104
AH106
AH126


lacZ) derivative
AX(narK-lacZ)
BW545 Xh(narK-lacZ)
AH79 AmoeA113
AH121 AmodE-Km
AH121 AmoeA113
AH121 modB::TnlO
AH121 moeB-Km
AH83 AmoeAll3
AH121 narL::TnlO
AH93 narL::TnlO
AH93 AmodE-Km

lacZ) derivative
A(trpEA)2 AQ(narX-lacZ)
BW545 Xh(narX-lacZ)
AH78 AmoeAll3
AH122 AmodE-Km
AH122 AmoeA113
AH122 modB::TnlO
AH122 moeB-Km
AH82 AmoeA113
AH122 narL::TnlO
AH92 AmodE-Km



Tn9 CmR clr-100
A 'bla 'lacZ lacY'
X Q((moeA'-'lacZ*)
(-228bp to +45bp) bla'
A S(moeA'-'lacZt)
(-46bp to +45) bla'


This

This


study

study


V. Stewart
This study
AH79 X Pl(SE2147)
AH121 X P1(SE1910)
AH121 X P1 (SE2147)
AH121 X Pl(VJS720)
AH121 X Pl(AH30)
AH83 X Pl(AH69)
AH121 X Pl(RK5278)
AH93 X P1(RK5278)
AH93 X Pl(AH69)


V. Stewart
This study
AH78 X P1(SE2147)
AH122 X Pl(SE1910)
AH122 X Pl(SE2147)
AH122 X Pl(VJS720)
AH122 X Pl(AH30)
AH82 X P1(AH69)
AH122 X Pl(RK5278)
AH92 X P1(AH116)



Lab. collection
Lab. collection


Phages

P1
XRZ5
AAH1

XAH3










composition: NazHPO4, 14.89g; KH2PO4, 6.09g; NaC1, 0.5g;

NH4C1, 1.0g; MgCl2, 0.2g; Trypticase peptone (BBL), 1.0g;

yeast extract, 0.5g; glucose, 10g; and deionized water, 1

liter. In all experiments described in this study, both the

glucose-minimal medium and LSM were supplemented with 0.1 mM

molybdate, when needed. Dimethylsulfoxide (DMSO) and

trimethylamine-N-oxide (TMAO) were added to media at a final

concentration of 40 mM and 90 mM, respectively. Bacterial

cultures were grown under anaerobic conditions as previously

described (87, 90). Ampicillin (100 pg/ml), kanamycin (50

pg/ml), tetracycline (20 pg/ml), chloramphenicol (15 pg/ml)

and X-gal (40 pg/ml) were included in the media, as needed.

Genetic and molecular biological experiments were

performed as described previously (87). DNA was sequenced

with custom primers based on DNA sequence, using the sanger

dideoxy procedure and sequenase 2.0 (Amersham, Arlington

Heights, Ill). DNA sequence was manipulated with the

Genetics computer Group software (23) or Genepro (Riverside

Scientific, Seattle, Wash).

Isolation of Chlorate-Resistant Mutants

Chlorate-resistant mutants of strain BW545 were

isolated as described previously (66). A culture in the mid-

exponential phase of growth was serially diluted and spread

on L-agar supplemented with potassium chlorate (2 mg. ml-1).

These plates were incubated under anaerobic conditions at

37C for 3 days. Small chlorate-resistant colonies were











transferred to L agar by replica plating and incubated

aerobically at 370C for 16 h. Chlorate-resistant mutants

were tested for the ability to produce dihydrogen when

cultured in LBG-Mo and LSM-Mo. Chlorate-resistant mutants

which were FHL positive only when grown in LSM with

molybdate were used in this study.

Enzyme Assays

FHL and nitrate reductase activities of cells in the

late-exponential phase of growth were determined by

procedures described previously (61). Sodium nitrate (20 mM)

was included in all media used for culturing cells for

determination of nitrate reductase activity. All FHL assays

were carried out with whole cells instead of crude extracts

to avoid oxygen inactivation of the enzyme.

The p-galactosidase activity was determined as

described by Miller (70). The specific activities are

expressed as nanomoles of o-nitrophenol produced per minute

per millgram of protein where a value of 350 pg protein/ml

was used as the total protein content of 1 ml of cells at an

optical density (O.D.) at 420nm of 1.0 unit in a Spectronic

710 (Rochester, NY) spectrophotometer. The unit of activity

presented are the mean of at least three independent

experiments in which a deviation from the mean was less than

15%.










In Vitro Activation of Apo-nitrate Reductase

For in vitro activation of apo-nitrate reductase

produced by a moeA mutant, one liter of LB (in 1 liter

Erlenmayer flask) supplemented with 0.3% glucose, 30 mM

nitrate, and 0.1 mM molybdate or tungstate, as needed, was

inoculated with 50 ml of aerobically grown overnight

culture. The culture was incubated at 37C without shaking

for 4 hours. The cells were harvested by centrifugation at

5,000 X g for 10 min. The cells were washed twice with 50 ml

phosphate buffer (0.1 mM K-phosphate pH 7.3; 0.5 mM EDTA; 1

mM p-mercaptoethanol and 1 mM benzamidine) and were

resuspended in 8 ml of the same buffer. This cell suspension

was passed twice through a French pressure cell at 20,000

Ib.in-2. The broken cell suspension was spun at 12,000 X g

for 20 min to remove cellular debris. The extract was stored

on ice under H2 by passing H2 over the supernatant for 15

sec. The bottle was sealed with a serum stopper and aluminum

seal. The total protein concentration was determined by

Bradford method using BSA as a standard (13). Protein

concentration was adjusted to 10 mg/ml using phosphate

buffer. For the activation assay, 0.2 ml of the cell extract

was injected into sealed tubes containing 50 pl of reaction

buffer (0.1 mM K-phosphate pH 7.0; 5 mM ATP; 0.1 mg/ml BSA;

molybdate or tungstate). The tubes were sparged with H2 and

sealed with serum stoppers prior to the injection of cell

extract. The samples were incubated at 30*C for one hour or










longer. A sample of the reaction mixture was used to

determine nitrate reductase activity (61).

Construction of moe Plasmids

A 4.4 Kb SphI fragment which contained the entire moeAB

operon including the upstream regulatory region was removed

from a larger plasmid, pFGH1, and cloned into plasmid vector

pUC19 at the SphI site plasmidd pAH1 (Fig. 4)}. DNA coding

for the moeAB operon without the upstream regulatory

sequence was removed from plasmid pFGH1 as a 2.3 Kb AvaI-

SphI fragment and cloned into plasmid vector pUC19 at the

AvaI-SphI sites plasmidd pAH2 (Fig. 4, Table 2)}. Plasmid

pAH6, which carries an internal deletion of the moeA DNA and

is still MoeB*, was constructed by removing a BssHII-MluI

fragment from within the moeA gene in plasmid pAH2 and self-

ligating the large DNA fragment (Fig. 4). Plasmid pAH20

lacks the 574 bp BstEII-SphI fragment in plasmid pAH2 (Fig.

4) and produced only the MoeA' protein.

Construction of moeA Deletion Strain

Strain AH69, which carries an internal deletion of

moeA and a kanamycin resistance (KmR) gene cartridge which

did not affect production of MoeB' activity (moeA113), was

constructed by first deleting the EcoRV-MluI fragment within

the moeA gene in plasmid pAHl (palsmid pAH43; Fig. 4). The

















S RV BS M BSA RV BS M B S
pAH1 ml -

pAH2 I n

pAH6 -------

pAH20


pAH43 -
Km
pAH44 --- 7- --
Km
pAH3-1 -7

pAH3



0.5 Kb


Fig. 4 Restriction map of plasmids containing moe DNA and
its deletion derivatives used in this study. Solid line
represents E. coli chromosomal DNA present in the plasmid;
dashed line indicates regions) of chromosomal DNA deleted
during the construction of the plasmid. Vector DNA is not
presented. Inverted triangle shows the position of insertion
of KmR gene. A, AvaI; B, BstEII; BS, BssHII; M, Mlul; RV,
EcoRV; S, SphI. See Table 2 for other details.












Table 2. Plasmids used in this study.


Plasmids Relevant genotype Source or
Reference


pACYC184
pBR322
pMAK705
pUC19
pUC4K
pZ1918
pFGHl
pAH1
pAH2
pAH3
pAH3-1
pAH6
pAH11
pAH20
pAH40
pAH41
pAH43
pAH44
pAH47
pAH52
pAH55
pAH60
pAH67

pAH74
pAH91
pAH101
pRM20
pGS24-1
pQE30ArcA
pREP4
pVJS1
pT7-7
pET15b


TcR CmR cloning vector
AmR TcR cloning vector
'lacZ rep(Ts) CmR
AmR lacZ' cloning vector
lacZ' Km" AmR
'lacZ AmR
pACYC184 based moe(AB)t
pUC19 based moe(AB)*
pUC19 based moe(AB)'
pUC19 based moeA*
Q((moeB-Km) 'lacZ AmR
pUC19 based AmoeA moeB*
S((moeB-Km) rep(Ts) CmR
pUC19 based moeA*
pBR322 based moeA'
pBR322 based 0(moeA'-'lacZ)
pUC19 based AmoeA-Km moeB*
pUC19 based AzbiK-Km AmoeA moeB'
pBR322 based <(moeA'-lacZ)
pBR325 based moe(AB)+
pMAK705 based AmoeA moeB*
T7-7 based moe(AB)*
pUC19 based moe promoter
(-228 to +52)
pBR322 based mog*
pT7-7 based narL'
pET15b based mog
pACYC184 based modE+
pBR322 based fnr* KmR
pQE30 based arcA'
lacl, KmR
pBR322 based nar(XL)'
expression vector
expression vector


(16)
(10)
(35)
(115)
Pharmacia
(95)
Lab. collection
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study

This study
This study
This study
This study
Lab. collection
This study
E. C. C. Lin
E. C. C. Lin
V. Stewart
Lab. collection
Novagen










Mull site was modified with DNA plymerase I Klenow fragment

before self-ligation in the construction of plasmid pAH43. A

661 bp BssHII fragment located 260 bp upstream of the moeA

gene (Fig. 4) was removed from plasmid pAH43 for insertion

of KmR gene from plasmid pUC4K (Pharmacia Biotech,

Piscataway, N.J.). After the ends of the large fragment were

filled in, a 1.3 kb HincII fragment containing KmR gene was

ligated to produce plasmid pAH44. The entire SphI fragment

containing moe operon with AmoeA and the upstream KmR gene

(zbiK-Km) was removed from plasmid pAH44 and ligated into

SphI site in plasmid pMAK705 (35) (yielding plasmid pAH55)

for mobilization into the E. coli chromosome. The moeA113

allele from plasmid pAH55 was recombined into the chromosome

of strain BW545, creating strain AH69. Strain AH69 is MoeA'

and MoeB'.

Deletion of moeA in strain AH69 was confirmed by PCR

amplification of chromosomal DNA from strain AH69 and its

parent, strain BW545. Two primers flanking the moeA gene

(primer 1, ATATGGCATGTAAAGGCAGG; primer 2,

CCTGATCGCTGAGTTCCGCC) were synthesized (Genosys, Woodlands,

TX) and used to amplify the moeA DNA. An expected PCR

product of 1.3 kb was detected when the chromosomal DNA from

strain BW545 served as the template. DNA of this size was

absent when the chromosomal DNA from the moeA deletion

strain AH69 was used as template. The moeA113 and zbiK-Km










mutations in strain AH69 cotransduced (phage P1) with each

other at a frequency close to 100% and with gal and mod

genes at about 20%. The moeA113 mutation was also

complemented by plasmid pAH20 carrying only the moeA* gene.

These results are in agreement with the fact that strain

AH69 carries a deletion in the moeA gene.

Construction of moeB-Km Strain

To construct a moeB-Km strain, a HincII fragment

containing the Km" gene from plasmid pUC4K was ligated into

the BstEII site in the moeB gene in plasmid pAH2, which had

been previously modified by DNA polymerase I (Klenow

fragment), yielding plasmid pAH3-1. A SphI-SacI (from vector

DNA) fragment containing the entire chromosomal DNA insert

from plasmid pAH3-1 was removed and ligated into the SphI-

SacI sites of plasmid pMAK705 (35), resulting in plasmid

pAH11. Strain BW545 was transformed with plasmid pAH11, and

the moeB-Km was transferred to the chromosomal DNA by

homologous recombination as previously described (35),

generating strain AH30. The moeB-Km mutation cotransduced

(phage P1) with gal and mod mutations at a frequency of 20%,

and the mutation was complemented by plasmid pAH6,

containing only the moeB* gene. The observed phenotype of

strain AH30, genetic characteristics, and complementation

profile are in agreement with the reported phenotype of the

moeB mutation (72, 81).













Construction of moaA-lacZ Fusions

Plasmid pAH40 which was used in the construction of

moeA-lacZ contains a 273 bp moe operon upstream DNA in

plasmid vector pBR322. This region of DNA obtained after PCR

amplification and manipulation includes the region between a

BssHII site at the 5'-end and 12 bp downstream from the ATG

codon of moeA gene as the 3'-end. This DNA also contains the

5'-end of zbiK from a diverging operon of unknown function.

A 3.2 Kb BamHI fragment containing a promoterless lacZ gene

from plasmid pZ1918 (95) was ligated into the BamHI site in

plasmid pAH40, resulting in plasmid pAH41 (Fig. 5). The

moeA-lacZ fusion was transferred from plasmid to phage XRZ5

by in vivo recombination as previously described (87). The

resulting phage, XAH1, was transduced into strain BW545 and

single lysogens were selected for further study.

In the construction of plasmid pAH47, promoterless lacZ

was inserted in the BamHI site after deleting the moeA DNA

upstream of the AvaI site. The moeA-lacZ fusion from plasmid

pAH47 was also transferred to ARZ5 and the resultant phage,

XAH3 (Fig. 5), was used to analyze the role of moeA upstream

DNA in the transcriptional regulation of moe operon.





















BS zbiK A r moeA
AAH1 m



AL GAATTTACCACCG lacZ


AAH3 A I moeA


"--\
AInGAATTTACCACCG l




Fig. 5. Location of lacZ gene in the moeA-lacZ fusions. The
solid line represents the moeA-ZbiK intergenic region. The
phage XH1 carries the entire moe regulatory sequence while
in XAH3 the sequence upstream of AvaI was deleted.
Restriction endonuclease sites shown are as follows: A, AvaI
and BS, BssHII.











Purification of MoeA Protein

For high level expression of moeA gene, the moeA gene

was cloned into expression vector pT7-7 (107) and its

expression was controlled by an IPTG-inducible T7-RNA

polymerase. The plasmid pT7-7 was digested with Apol, the

linear DNA was treated with 1 unit mung bean nuclease for 20

min to remove the overhang sequences, and was subsequently

digested with HindIII. Plasmid pAH2 which carries the entire

moe operon was digested with ApoI and the 5'-overhang

sequence was removed in order to fuse moeA in-frame to the

ATG codon from T7-gene 10 in plasmid pT7-7. The digested

sample was treated with phenol-chloroform-isoamyl alcohol

and ethanol precipitated, and subsequently digested with

HindIII. The 2.25 Kb ApoI(Exo)/HindIII DNA containing moeA'

and linear T7-7 digested with ApoI(Exo)/HindIII were

purified after agarose gel electrophoresis and ligated

together plasmidd pAH60). Although the first two amino-acids

of the MoeA protein were changed as a result of mung bean

nuclease treatment (Glu, Phe to Ala, Ser respectively)

during this construction, plasmid pAH60 still complemented

moeA mutant strains for molybdoenzyme activity.

One liter of LB supplemened with 100 pg/ml ampicillin,

was inoculated with a fresh culture of strain BL21(DE3)/

pAH60. The cells were grown at 37*C with shaking (200 rpm)

for 3.5 hours until the optical density of 0.6 at 420nm










(Spectronic 710) was reached. The expression of moeA gene

was induced with 0.1 mM Isopropyl-p-D-thiogalactopyranoside

(IPTG) for 3 hours at 37C with shaking (200 rpm). The cells

were harvested and washed once with 50 ml Tris buffer (50 mM

Tris-HCl pH 8.0; 0.5 mM EDTA; 1 mM benzamidine; ImM

dithiothreitol). The cells were resuspended in 20 ml Tris

buffer, and broken by passing through a French pressure cell

twice at 20,000 lb.in-2. The cell lysate was centrifuged at

30,000 x g for 1.5 hours to remove cellular debris. The

supernatant fraction was loaded on 10 ml of Q-sepharose

(Pharmacia Biotech, Piscataway, NJ) that had been

equilibrated with Tris buffer and washed with 60 ml Tris

buffer. Proteins were eluted with a stepwise NaCl gradient

(0-1.0 M) in Tris buffer. MoeA protein eluted with 0.2 M

NaC1. MoeA containing fractions were pooled and diaylzed

overnight against Tris buffer. After adding ammonium sulfate

to a final concentration of 1.7 M, the MoeA-containing

sample was loaded on a 35 ml octyl-sepharose column which

had been pre-equilibrated with Tris-HCl buffer containing

1.7 M ammonium sulfate. After washing the column with the

same buffer, the MoeA protein was eluted with a descending

gradient of ammonium sulfate (1.7-0 M) in Tris-HCl buffer.

MoeA-containing fractions were pooled and dialyzed overnight

in Tris buffer. The MoeA protein which was determined to be

pure after SDS-PAGE was concentrated using a centriprep 10

spin cartridge (Amicon). The MoeA protein was stored in 50











mM Tris-HCl pH 7.0 with 20% glycerol at a final

concentration of 0.6 mg/ml at -75C.

Purification of Mog Protein

For isolation of MogA protein, a fragment carrying the

mog gene was subcolned from X101 {Kohara clone (101)9E4 (57)

generously supplied by Dr. Kenn Rudd, University of Miami}

into a plasmid vector. Lambda phage DNA was purified

essentially as previously described by Donovan et al (24). A

1.46 Kb PstI-MluI fragment carrying the entire mog gene was

cloned into plasmid pAH67 at BssHII-PstI sites, a pUC19-

based vector. The resulting plasmid pAH74 complemented the

mog deletion in strain AH160 for FHL activity. The mog gene

was amplified by polymerase chain reaction from plasmid

pAH74 using two primers; 5'CCGGGATCCATATGAATACTTTACGT3' and

5'TTTGGTGGATCCGTTCTGCCGA3'. Recognition sequences for NdeI

and BamHI were designed into the primers in order to clone

the PCR product into plasmid vector, pET15b (Novagen,

Madison, WI), for expression from a T7 promoter. The PCR

product was extracted with phenol-chloroform-isoamyl alcohol

and precipitated with ethanol. A sample of the PCR product

was digested with NdeI-BamHI and the mog DNA was "gel-

purified" after agarose gel electrophoresis. A 653-bp NdeI-

BamHI fragment which contained the mog gene was ligated to

the expression vector pET15b at the NdeI-BamHI sites, to

create an in-frame fusion with the methionine following the










six histidines and thrombin protease cleavage site. The

resulting plasmid was designated pAH101. In this plasmid,

the expression of mog is under the control of phage T7 gene

10 promoter (107) and the protein contained a histidine tag

in the N-terminus.

For purification of Mog protein, strain BL21(DE3) with

plasmid pAH101 was grown aerobically in 1 liter L broth

supplemented with 100 pg/ml ampicillin, with shaking (200

rpm), at 370C. When the optical density of the culture

reached 0.7 (420nm; Spectronic 710 spectrophotmeter), IPTG

was added to the culture medium at a final concentration of

0.1 mM, and cells were incubated for an additional 4 hours

at room temperature. The cells were harvested by

centrifugation at 4C, washed once with 50 ml Tris buffer

(50 mM Tris-HCl pH 8.0). Cells were resuspended in 25 ml of

Tris buffer and broken by two passages through a French

pressure cell at 20,000 lb.in-2. The cell lysate was

centrifuged at 30,000 x g for 30 min at 4C and the

supernatant was filtered through a 0.2 pM filter (Gelman

Sciences). All purification steps were performed at 4C. The

Mog containing supernatant was passed through a 5 ml NTA-Ni-

affinity chromatography column which was pre-equilibrated

with 50 mM NiCl2. Free nickel was removed from the column by

washing the column with 100 ml of Tris buffer before binding

the Mog protein. The column was washed with 100 ml Tris

buffer to remove unbound proteins. Since imidazole compete










with histidine for the Ni-chelating matrix, imidazole was

used to elute the His-Mog protein. The nonspecifically bound

proteins were removed by 50 mM imidazole. The elution of Mog

protein was achieved with 0.2 M imidazole in Tris buffer.

Purified protein was analyzed by SDS-PAGE on 12.5%

polyacrylamide gel, and fractions which contained pure Mog

were pooled and dialyzed against 50 mM Tris-HCl pH 7.0, 1 mM

DTT. Thrombin protease (2 units; Phamacia) was added to the

purified Mog protein supplemented with 2.5 mM CaCld to

remove the N-terminal histidines and the mixture was

incubated at 40C for 18 hours. The effect of the additional

20 amino acids in the N-terminus on the biological activity

of Mog protein was determined in an in vitro activation

assay. Since the additional N-terminus amino acids had no

detectable negative effect on Mog protein activity, in most

of the experiments, Mog protein was used as His-Mog.

Glycerol was added to the purified Mog protein to a final

concentration of 20% (vol/vol), and the purified protein was

stored at -750C.

Purification of ArcA Protein

ArcA-His tagged protein was expressed from plasmid

pQE30ArcA which was generously provided by Dr. E. C. C. Lin

(64). Strain M15 carrying plasmids pQE30ArcA and pREP4 was

grown in 1 liter L broth supplemented with 100 pg/ml

ampicillin and 25 pg/ml kanamycin, with shaking (200 rpm),

at 37C. The pREP4 plasmid carries the lacI gene encoding











the Lac repressor. The multiple copies of pREP4 in in the

host, strain M15 host strain ensures tight regulation of

arcA expression. The expression of arcA gene from plasmid

pQE30ArcA was controlled from an IPTG-inducible T5 promoter

under control of the Lac repressor. When the optical density

of the culture reached 0.7 (420 nm; Spectronic 710

spectrophotometer), IPTG was added to a final concentration

of 0.2 mM. The temperature of incubation was shifted to 22C

and the culture was incubated for an additional 4 hours. The

cells were harvested by centrifugation at 40C and washed

once with Tris buffer (50 mM Tris-HCl, pH 8.0). The cell

pellet was resuspended in 20 ml Tris buffer and disrupted by

two passages through a French pressure cell at 20,000 lb.

in-2. The extract was clarified by centrifugation at 30,000

x g for 30 min at 4C. All purification steps were performed

at 4"C. The supernatant was loaded onto a pre-equilibrated

Ni-chelating column with 50 mM Tris buffer. The column was

washed with 10 column volumes of Tris buffer. The

nonspecifically bound proteins were washed with Tris buffer

supplemented with 20 mM imidazole. The ArcA protein was

eluted with Tris buffer containing 50 mM imidazole. The

purified ArcA fractions were pooled and loaded onto a 5 ml

heparin column (HiTrap; Pharmacia) that had been washed

with Tris buffer. The column was washed with 50 ml Tris

buffer to remove contaminating proteins. ArcA containing

fractions eluted at 0.2 M NaCl. SDS-PAGE analysis revealed











that the His-ArcA protein migrated with an apparent

molecular mass of approximately 29 KDa in good agreement

with the sequence-derived anhydrous molecular mass of 28.8

KDa. ArcA protein was dialyzed overnight against 50 mM Tris-

HC1 pH 7.0, 1 mM DTT, and 25% glycerol and stored at 4*C.

The purified ArcA protein was only active for up to a week

as judged by DNase I footprinting assay.

Purification of NarL Protein

To purify NarL protein, the polymerase chain reaction

was used to amplify the narL gene from plasmid pVJSl

(generously provided by Dr. Valley Stewart, Cornell

university) using two primers; 5'CAAGGAGATCATATGAGTA3' and

5'GCGCTGGGATCCGTAATC3'. Restriction sites NdeI and BamHI

were created in the primers in order to facilitate cloning

of the PCR product into the expression vector, pT7-7 (107).

The PCR product was treated with phenol-chloroform-isoamyl

alcohol and ethanol precipitated. A sample of the PCR

product was digested with NdeI and BamHI and subsequently

purified after 0.8% agarose gel electrophoresis. The 659-bp

NdeI-BamHI fragment was ligated to plasmid pT7-7 at the

NdeI-BamHI sites, yielding plasmid pAH91.

Strain BL21(DE3) carrying plasmid pAH91 was grown in 1

liter L broth supplemented with 100 pg/ml ampicillin with

vigorous shaking (200 rpm) at 37C. When the cells reached

an optical density of 0.7 at 420 nm, narL gene was induced

by the addition of IPTG at 0.2 mM. The temperature of











incubation was switched to room temperature and the culture

was incubated for an additional 4 hours. Cells were

harvested by centrifugation at 4*C and washed once with 50

ml Tris buffer (50 mM Tris-HCl pH 8.0, 1 mM DTT, 1 mM EDTA,

1 mM benzamidine). The cell pellet was resuspended in 20 ml

Tris buffer and the cells were lysed by two passages through

a French pressure cell at 20,000 lb.in-2. The extract was

clarified by centrifugation at 30,000 x g for 45 min 40C.

The supernatant was applied onto a Q-Sepharose, pre-

equilibrated with Tris buffer. The NarL protein did not bind

to the Q-Sepharose matrix and was about 98% pure after its

elution as determined by SDS-PAGE and was used without

further purification. The purified NarL protein migrated

with an apparent molecular mass of 24 KDa in good agreement

with the anticipated molecular mass of 23.8 KDa.

In Vitro Phosphorylation

In vitro phosphorylation assays were performed

essentially as described by Lynch and Lin (64), with minor

changes. The phosphorylation of purified proteins (ArcA or

NarL at a final concentration of 4.6 pM) was carried out in

a buffer containing 100 mM Tris-HCl, pH 7.4, 10 mM MgCl2,

100 mM KC1 and 50 mM acetyl-phosphate (sigma). The reactions

were incubated at 300C for one hour. Phosphorylated proteins

were used immediately. The fraction of phosphorylated

protein or the number of phosphate molecules per protein

used in the binding assay was not determined.











RNA Preparation

Strain RK4353(pAH3) was used for RNA isolation for

determining the transcription start site of moe operon. The

plasmid pAH3 carries the entire moe operon including 2 kb of

upstream region of moeA. Total RNA was prepared by phenol

extraction of cells grown under anaerobic condition in L

broth supplemented with 30 mM nitrate and 1 mM sodium

molybdate. Cells were harvested during mid-exponential

phase. The isolated total RNA was stored at -20*C at a

concentration of 1 mg/ml.

Primer Extension Experiment

Total RNA (20 ig) was dissolved in 12 pl of

Diethylpyrocarbonate (DEPC)-treated water and 4 pl of 5X-

Superscript II reverse transcriptase buffer (50 mM Tris-HCl

pH 8.3, 75 mM KC1, 3 mM MgCl; Gibco-BRL), 10 mM DTT, 1 mM of

each dCTP, dGTP and dTTP, and 1 pmol primer DNA

(GTGGGGTGACGCGAGAAAGC). The oligonucleotide primer

complementary to bases 81-100 downstream of the

transcription start site was used in this experiment. The

RNA was denatured at 80C for 3 min and immediately annealed

to the primer at 47C for 30 min. The reaction was initiated

with the addition of 5 pCi a-32P-labeled dATP (NEN-life

sciences), 10 units of reverse transcriptase {Superscript II

RNase H- reverse transcriptase from Moloney Murine Leukemia

Virus (M-MLV RT); GIBCO-BRL, Life Technologies} and the

reaction was incubated at 47C for 50 min. Nucleic acids










were extracted with phenol-chloroform and precipitated by

ethanol. The cDNA was dissolved with formamide loading dye

solution (96) and separated on a 6% denaturing polyacryamide

gel. The size of the primer-extended product was determined

using a sequence ladder of plasmid pAH3 DNA, obtained using

the same primer.

DNA Electrophoretic Mobility Shift Assay

DNA electrophoretic mobility shift experiment involving

ArcA and ArcA-P was performed as described by Lynch and Lin

(64) with modifications. A 286-bp BssHII-BamHI fragment

isolated from plasmid pAH67 was used in all mobility shift

experiments. The DNA fragment was end-labeled with [a-

3p]dCTP by filling in the 3'-end of the BssHII site with

DNA polymerase Klenow fragment. The reaction mixture for the

mobility shift assay consisted of 100 mM Tris-HCl, pH 7.4,

10 mM MgCl2, 100 mM KC1, 2 mM DTT, 10% glycerol, ArcA

protein, and 5 nM end-labeled DNA substrate in 20 p1

reaction volume. Binding reactions were incubated for 30 min

at 23"C. A 5%-polyacrylamide gel in 40 mM Tris-HC1 pH 8.0,

was pre-run for 45 min at 100V at room temperature prior to

application of the samples. The samples were loaded and the

gel was run for 60 min at 100 volts, with continuous

circulation of the buffer. The gel was transferred to 3MM

Whatman filter paper, dried under vacuum and exposed to X-

ray film.










DNase I Protection Experiments

ArcA-protection assay. A 286 bp BssHII-BamHI fragment

from plasmid pAH67 was used for DNase I footprinting

experiments. This DNA fragment contained moe operon DNA

between -228 and 52. The DNA fragment was radioactively

labeled at either BamHI or BssHII site for DNase I

protection analysis of the coding or noncoding strand,

respectively. The 3'-end of the DNA fragment was labeled

with 32pdNTP by filling in the overhang sequences with

Klenow. The unincorporated dNTP's were removed form the

labeled fragment using a G-25 spin column (Pharmacia). The

Klenow polymerase was removed by ammonium acetate

precipitation and the labeled DNA was ethanol precipitated.

The DNA fragment was resuspended in TE buffer at

approximately 50,000 CPM/pl and stored at 4C. Protein

samples were combined with 32p-end labeled DNA substrate (4

nM) in 20 Ml reaction mixture containing 10mM Tris-HC1, pH

7.4, 100 mM KC1, 10 mM MgCl, 1 mM DTT, 2 pg poly(dIdC-dIdC),

and 20% glycerol. The ArcA protein was phosphorylated

immediately before use. The reaction mixture was incubated

at room temperature for 15 min. Twenty pi of 10 mM MgCl2-5

mM CaC12 mixture was added to the samples and were incubated

for another 1 min at room temperature. The DNA was digested

with the addition of 0.9 ng/pl DNase I (sigma) solution for

5 min at room temperature. The DNA hydrolysis was terminated

by the addition of 40 mM EDTA and the proteins were










hydrolysed by inclusion of 2 pl of proteinase K (1 mg/ml;

sigma). The reaction samples were treated with phenol-

chloroform to remove residual proteins. The DNA fragments

were precipitated with 1 1p of yeast tRNA (1 mg/ml) and 0.3

M sodium acetate by 2 volumes of ethanol. The DNA was

resuspended in 6 pl of 0.1 N NaOH-formamide (1:2, vol/vol)

with 0.1% xylene cyanol. Nucleic acids were separated in a

8% polyacryamide, TBE-denaturing gel running at 50 Watts for

100 min. Gels were dried and exposed to X-ray film to

visualize the area of DNA protected by ArcA-P from DNase I

hydrolysis.

DNase I footprinting analysis involving ModE and NarL

were performed essentially as mentioned above with minor

changes. A 286 bp BssHII-BamHI, end labeled DNA was used for

binding. The binding mixture for ModE or NarL protein

contained (10 mM Tris-HCl, pH 7.9, 10 mM MgCl2, 50mM NaC1, 1

mM DTT and 5% glycerol), protein and labeled promoter DNA in

19 pl reaction volume. The reaction mixtures were incubated

at 37'C for 20 min. After binding, DNase I treatment and

sample processing was the same as described for ArcA-

footprinting experiment.














RESULTS AND DISCUSSION

Characterization of moeA Mutants

Chlorate-Resistant Mutants

Mutants which are defective in molybdate metabolism can

be readily isolated, because they are resistant to chlorate.

Chlorate, an analog of nitrate, is reduced by nitrate

reductase to its toxic form chlorite. Mutations at several

loci result in chlorate-resistance and loss of nitrate

reductase activity. These genes include the structural genes

which encode the nitrate reductase enzyme and other genes

whose products are required for synthesis and assembly of

molybdenum cofactor (Moco). Mutations in genes encoding for

cofactor biosynthesis can be readily distinguished due to a

pleiotropic effect and result in loss of all molybdoenzyme

activities.

Mutant strains of E. coli strain BW545 isolated as

chlorate-resistant were separated into three groups based on

the ability to produce FHL activity when grown in different

media (Fig. 6). Class I mutants were found to be defective

in molybdate transport (mod). The mutation in this class of

mutants was suppressed when the molybdate concentration in

growth medium was increased to 100 pM or higher. Mutations


















Chlorate-Resistant Mutants


FHL in LBG Medium +Mo


FHL in LSM


No
Class II
(moa)
(mob)
(mocB)


Yes
Class I
(mod)
(mog)


Yes
Class III


Fig. 6. Classification of chlorate-resistant mutants based
on their FHL phenotype.











in mog would also fall into this class since this mutation

can also be suppressed by higher concentration of molybdate.

Class II mutants failed to produce FHL activity in any media

tested. These mutants are apparently defective in moa, mob,

or moeB genes which are responsible for the synthesis of the

organic moiety of the MGD cofactor. These two classes of

mutants were previously described (38, 81, 104).

This selection of mutants and screening also yielded a

third class of mutants (Class III). These mutants are

conditional mutants and produced FHL and nitrate reductase

activities only when cultured in medium limiting in sulfur

compounds (LSM).

Strain BW545, a wild type strain used in these

experiments, produced FHL and nitrate reductase activities

when cultured in LBG medium (Table 3). Strains SE1581 and

SE1588, two mutants of the Class III chlorate-resistant

mutants, grown in the same medium, did not produce FHL

activity and produced very low levels of nitrate reductase

activity. When cultured in medium limiting in LSM, the

parent strain BW545 produced only 30% of the FHL activity as

compared to strain BW545 grown in LBG+Mo. However, the

nitrate reductase activity of the parent, strain BW545, was

not significantly influenced by changing the growth medium.

Both mutant strains, SE1581 and SE1588, produced active

molybdoenzymes when grown in LSM, but the levels of activity

were only about 30-40% of that of









55


Table 3. FHL and nitrate reductase activities of Class III
chlorate-resistant mutants


Strain Relevant FHL Nitrate reductasea
Genotype LBG LBG+Mo LSM LBG LBG+Mo LSM


BW545 wild type 230 200 60 560 650 530

SE1581 <1 <1 20 15 20 225
SE1588 <1 <1 20 20 30 200

SE1595 modC <1 160 40 25 620 370


Enzyme activities are expressed as nanomoles.min-1.milligram
of cell protein'.
a-Sodium nitrate was present in all three media.











the parent, strain BW545, grown in the same medium.

Production of the two molybdoenzyme activities by the two

mutants (strains SE1581 and SE1588) still required molybdate

in LSM. Increasing the concentrations of molybdate in the

LSM to 1 mM or higher did not fully restore the ability of

these two mutant strains to produce FHL or nitrate reductase

activities to the wild type levels. In contrast, a modC

mutant, strain SE1595, responded to molybdate in both LBG

and LSM (Table 3). These results show that the suppression

of FHL- phenotype of strains SE1581 and SE1588 required

growth in medium limiting for sulfur-compounds. It is

possible that cystine or sulfate even at 0.1 mM repressed

the production of some key components required for

molybdoenzyme activity in these mutants.

Strains SE1581 and SE1588 reverted to wild type

phenotype at a frequency of about 10-', suggesting that the

observed phenotype is due to a single mutation. In a typical

chlorate-resistant population, the Class III mutants

constituted about 25% of the population. Since the phenotype

of the Class III mutants is unique, these mutants were

further analyzed.

Class III Mutants are Defective in moeA

A recombinant plasmid carrying E. coli chromosomal DNA

which can complement the mutation in strain SE1588 was

obtained after transformation with DNA from E. coli gene

bank in plasmid vector pACYC184. The complementing plasmid









57

was selected using glycerol-nitrate medium without molybdate

supplementation. E. coli chromosomal DNA in this plasmid was

sequenced. Based on the DNA sequence analysis, the

complementing DNA was identified as moe DNA. The moe operon

is composed of two genes (72) and a plasmid containing the

moeAB genes plasmidd pAH2) complemented the mutation in all

Class III mutants. The moeA gene is the first of two genes

in the moeAB operon and its stop codon overlap by one base

of the start codon of the moeB, the second reading frame

(TAATG). Because of the unique nature of the phenotype of

strain SE1588, the mutation was localized within a specific

gene by complementation analysis. For these experiments, two

plasmids containing either the moeA' plasmidd pAH20) or moeB*

plasmid pAH6) were constructed (Fig. 4; Methods section).

Plasmid pAH6 carries a deletion in moeA (moeA113) which

still allowed production of MoeB activity.

In the presence of plasmid pAH2 (moeAB), strains SE1581

and SE1588 regained the ability to produce FHL and nitrate

reductase activities even when cultured in LBG medium (Table

4). Plasmid pAH20 which only contains intact moeA* gene also

complemented the mutation in strains SE1581 and SE1588 but

not in a moeB mutant, strain AH30. However, the level of FHL

activity produced by the strains SE1581(pAH20) and

SE1588(pAH20) was lower than the parent strain with or










Table 4. Complementation of the mutation in Class III
mutants by various plasmids


Strain Relevant FHL Nitrate reductase
Genotype No pAH2 pAH20 No pAH2 PAH20
Plasmid Plasmid


Bw545 Wild type 230 220 220 650 730 620

SE1581 <1 160 90 40 500 510
SE1588 <1 180 80 40 610 450
AH30 moeBlOl <1 150 <1 40 600 40


Cultures were grown in LBG medium for FHL activity and
LBG+nitrate medium for nitrate reductase activity. Enzyme
activities are expressed as nanomoles.min'l.milligram of
cell protein-.










without the plasmid (less than 40%) or the amount produced

by the mutant strains with plasmid pAH2. This lower level of

FHL activity produced by strain SE1581(pAH20) and

SE1588(pAH20) is apparently due to overproduction of MoeA

protein from the plasmid without the corresponding increase

in MoeB protein. The reason for this is unclear. However,

the levels of nitrate reductase activity in the plasmid-

containing mutant strains SE1581 and SE1588 were about 70%

to 80% of the parent levels and were not significantly

altered by the moe genotype of the plasmid.

Plasmid pAH6, which contains only moeB* DNA,

complemented the moeB101 mutation in strain AH30 and not the

mutation in strain SE1588 (Table 5). These results suggest

that the mutation in the class III chlorate-resistant

mutants, such as SE1581 and SE1588, is located in the moeA

gene. The moeA mutation in these strains was also

cotransducible by phage P1 with the mod operon as well as

with the gal operon. The cotransduction frequency between

the moeA mutation and gal was about 20%. This finding is in

agreement with known locations of these two operons on the

E. coli chromosome {17 min for the gal-mod region and 18.6

min for the moe operon (6)}.









60


Table 5. Complementation analysis of various moe mutants


Strain Relevant FHL activity


Genotype LBG LSM


No pAH2 pAH20 pAH6 No PAH6
Plasmid Plasmid


RK4353 Wild type 240 250 250 240 50 25
BW545 Wild type 230 210 220 170 70 80

SE1588 moeA103 <1 180 100 <1 30 50
AH30 moeBlO-1Km <1 250 <1 135 -a +a

VJS1779 moe-251 <1 210 <1 <1 <1 15
VJS1783 moe-255 <1 250 <1 <1 <1 15
C26 moeAB <1 190 <1 <1 <1 25


Cultures were grown in LBG medium or low sulfur medium.
Enzyme activities are expressed as nanomoles.min-1.milligram
of cell protein-'.
a and + denotes the absence and presence of activity.









61

Based on these results, moeA mutation can be defined as

having a molybdoenzyme activity-negative phenotype when

grown in rich medium and a molybdoenzyme activity-positive

phenotype when cultured in medium low in sulfur compounds.

Mutant strains which are defective in moeA (chlE) have

been previously described and these strains were reported to

be defective in molybdoenzyme activity even when grown in

minimal medium. Mutation in three of these mutants (C26,

VJS1779, and VJS1783) were mapped using the plasmids pAH2,

pAH6, and pAH20 carrying different regions of the moe operon

and these results are presented in Table 5. All three

mutants produced FHL activity when plasmid pAH2 (moeA'B*)

was present in the cell. Plasmids carrying only the moeA'

plasmidd pAH20) or moeB' plasmidd pAH6) DNA failed to

complement the mutation when the cells were grown in LBG

medium. However, plasmid pAH6 supported the production of

about 20% of FHL activity of that produced by a wild type,

strain BW545, only when grown in LSM. The FHL activity

produced by these three mutants, carrying the moeB* gene on

the plasmid, is comparable to the level of activity produced

by strain SE1581 and SE1588 grown in LSM (Table 3). These

results indicate that the mutation in these previously

reported moeA mutants is located in the moeA gene but a

polar effect of the mutation on moeB expression makes them

moeAB. In the presence of plasmid pAH6, these mutant strains










C26, VJS1779, and VJS1783 produced MoeB protein from the

plasmid and the defect in moeA gene was suppressed by growth

in LSM. Similar results were obtained when FHL was replaced

by nitrate reductase as the assay system. In appropriate

control experiments, plasmid pAH20 complemented the mutation

in a moeA mutant, strain SE1588, and plasmid pAH6

complemented the moeB mutation in strain AH30.

To confirm that the observed phenotype of the strains

SE1581 and SE1588 is due to a mutation in the moeA gene, a

AmoeA, moeB' mutant (moeA113; strain AH69) was constructed.

Strain AH69 produced FHL and nitrate reductase activities

only when grown in LSM. The moeA113 mutation was also

complemented by plasmid pAH20 and not by plasmid pAH6.



Role of cys Gene Products in Suppression of moaA Mutation

Previous studies in our lab showed that the molybdate

transport mutants are capable of transporting molybdate

through the sulfate transport system coded by the cysUWA

(59). This required cultivation of the mod mutants in LSM to

activate the production of sulfate transport system.

Addition of cystine to LSM prevented production of

molybdoenzyme activity by the mod mutants since cystine is

known to significantly reduce the level of sulfate transport

by decreasing the transcription of the cysUWA (59).

Suppression of the moeA mutation by growth in LSM suggests











that the cys gene products are also responsible for

molybdoenzyme production in the moeA mutants grown in LSM.

Since the moeA mutants were found to be molybdate transport

competent, the cys gene products needed for suppression of

MoeA- phenotype must be after the sulfate transport, in the

cysteine biosynthetic pathway.

In E. coli, intracellular sulfate, is activated and

reduced by the gene products in two operons (cysDNC and

cysJIH; Fig. 7). The cysDNC proteins activate sulfate to

adenosine phosphosulfate (APS) and to phosphoadenosine

phosphosulfate (PAPS) while the cysJIH proteins along with

cysG (siroheme synthesis) reduce PAPS to sulfide with

sulfite as an intermediate (59). In order to identify the

enzymes in sulfate metabolic pathway responsible for

suppressing the moeA mutation phenotype in LSM, double

mutants carrying the moeA mutation and one of several cys

mutations (cysDNCJIH) were constructed. These double mutants

were tested for FHL activity after growth in LSM. Double

mutants with moeA mutation and a second mutation in any of

the genes in the two operons coding for the proteins in the

sulfate activation/reduction pathway (cysDNC and cysJIH)
















MoO,2 Sulfate
cysD i ATP sulfurylase
cysN

Is] APS


cysC APS kinase


PAPS
MoeA
cysH PAPS reductase

Sulfite
cysG
cysI Sulfite reductase
cysJ
Sulfide
[Mo-S] (?) --
[Activated Mo]
MoO42


Fig. 7. Proposed model for activation of molybdenum in a
moeA mutant grown in LSM.











failed to produce FHL or nitrate reductase activities in

LSM. Results for two such double mutants involving one cys

gene from each operon are presented in Table 6. In the

construction of double mutants, strains AH1 and AH10, the

moeA and cysN mutations were transduced in both directions.

The moeA, cysN double mutants did not produce FHL or nitrate

reductase activities. Other double mutants with point

mutations in the cysC or cysD and moeA also had similar

phenotype.

A double mutant involving cysJ, a component of the

second operon (cysJIH) coding for the enzymes in the

activated sulfate (PAPS) reduction pathway and moeA (strain

AH8) also failed to produce FHL and nitrate reductase

activities in all media tested (Table 6). Spontaneous

revertants of strain AH8 for cys' phenotype produced both

molybdoenzyme activities when grown in LSM, suggesting that

the cys and moeA mutations are the only mutations causing

the observed molybdoenzyme-negative phenotype of strain AH8.

Similar results were also obtained with double mutants, cysI

or cysH and moeA. Apparently, the CysDNCJIH proteins are not

produced in the moeA mutants grown in rich medium due to the

presence of sulfur compounds which prevented expression of

the cys gene products to optimal levels (59) for suppression

of MoeA- phenotype.











Table 6. Effect of cys mutation on production of FHL and
nitrate reductase activities by moeA mutants


Strain Relevant FHL Nitrate reductase
Genotype LBG LSM LBG LSM


BW545 Wild type 240 65 570 530

SE1588 moeA103 <1 35 50 320
AH69 moeA113 <1 25 40 300
AH131 cysN-Km 231 45 630 570

AH1 cysN-Km, moeA103 <1 <1 35 55
AH10 cysN-Km, moeA103 <1 <1 45 40
AH134 cysN-Km, moeA113 <1 <1 50 40

JM73 cysJ 130 25 720 450
AH8 cysJ, moeA103 <1 <1 50 60


Enzyme activities are expressed as nanomoles.min-1.
milligram of cell protein-'.
Sodium nitrate was present in both media.










The MoeA- Phenotype Is Suppressed by Sulfide

The ability of the enzymes in the sulfate activation/

reduction pathway to suppress the effect of moeA mutation in

the production of FHL and nitrate reductase activities

suggest, by analogy, that the MoeA protein participates in

the activation of molybdate (Fig. 7). Since all the enzymes

in the sulfate activation/reduction pathway are essential

for production of FHL and nitrate reductase activities by

moeA mutants grown in LSM, it is possible that the end

product sulfide is a necessary component of Mo metabolism in

the absence of MoeA protein.

When wild-type strain BW545 or cysN mutant, strain

AH131, was grown in rich medium or LSM, the amount of

nitrate reductase activity produced by the culture was not

altered by including sodium sulfide in the growth medium

(Table 7).

The moeA mutant, strain AH69, produced about 380 units

(about 50% of the wild-type level) of nitrate reductase

activity when grown in rich medium only when the medium was

also supplemented with sodium sulfide. Similarly, the FHL

activity of the mutant grown in LBG was also increased from

undetectable levels to about 25 units with the addition of

sulfide. Sulfide also restored the ability of the moeA, cysN

double mutants (strains AH1 and AH134) to produce nitrate

reductase activity when grown in either rich medium or LSM










Table 7. Effect of sulfide on the levels of nitrate
reductase activity produced by moeA mutants


Strain Relevant Nitrate reductase activity
Genotype LBG LBG+S2- LSM LSM+S2-


BW545 Wild type 670 700 585 530

AH131 cysN-Km 630 725 570 625
AH69 moeA113 40 380 320 300

AH1 moeA103, cysN-Km 55 400 65 360
AH134 moeA113, cysN-Km 50 280 40 275



Enzyme activities are expressed as nanomoles.min-1.
milligram of cell protein'1.
Sodium nitrate was present in all media. Sodium sulfide
concentration was 2 mM in LBG and 0.2 mM in LSM.










(Table 7). Similar results were also obtained when the FHL

activity of AH1 and AH134 was determined. Addition of

sulfide to glucose-minimal medium failed to suppress the

FHL- phenotype of moeA mutants, probably due to the presence

of sulfate in the medium which prevented sulfide uptake.

When sulfide served as the sole sulfur source, strain SE1581

and SE1588 produced low but detectable levels of FHL

activity.

These results suggest that the MoeA protein either

provides sulfur in the formation of a molybdenum compound or

catalyzes the formation of a Mo-S compound (activated

molybdenum) needed for molybdenum-cofactor synthesis. In the

absence of MoeA protein (moeA mutant), sulfide,

generated by the sulfate activation/reduction pathway,

chemically interacts with molybdate in the production of

activated molybdenum for incorporation into molybdopterin.

Apparently, cystine is not a sulfur donor in this process

since inclusion of cystine at a concentration as high as 200

pg/ml in LSM or glucose-minimal medium failed to overcome

the defect in the moeA, cysN mutant, strain AH1. Since

cysteine inhibited growth of strain AH69, the role of

cysteine in this reaction was not studied.

Hydrogen sulfide is known to react with molybdate in

the production of various thiomolybdates (monothiomolybdate,

dithiomolybdate, tetrathiomolybdate, etc.) depending on the

ratio of sulfide and molybdate (4). Inclusion of various










thiomolybdates to the culture medium of strain AH1 did not

restore the ability of this moeA, cysN mutant to produce

molybdoenzyme activities, probably due to a lack of

thiomolybdate transport. However, thiomolybdate did serve as

a source of molybdate for molybdoenzyme synthesis and

activity in mod mutants defective in high-affinity molybdate

transport.

Putative Physiological Role of MoeA Protein

These results suggest that the MoeA protein catalyzes

the formation of a Mo-S complex, activated molybdenum. It is

possible that in the synthesis of activated molybdenum the

MoeA protein itself or another protein provides the needed

sulfur. This Mo-S complex could serve as the substrate

during incorporation of molybdenum into molybdopterin in the

synthesis of molybdenum cofactor. This proposed role of MoeA

as a sulfur source for the synthesis of a molybdenum-sulfur

complex would be similar to the role of MoeB as a sulfur

donor (MPT synthase sulfurylase) in the activation of MPT

synthase (76, 81). Thus, the two proteins coded by the moe

operon would catalyze similar reactions but with different

substrates.

An alternative possibility that the MoeA protein is the

sulfur donor for MoeB protein in the activation of MPT

synthase small subunit (MoaD) can not be ruled out. In this

role, the MoeA protein would be similar to the NifS protein

of Azotobacter vinelandii which apparently desulfurylate











cysteine and provides the needed sulfur for biosynthesis of

Fe-Mo cofactor during the activation of nitrogenase (117).

It is possible that in the absence of MoeA protein, sulfide

serves as a direct source of sulfur for MoeB protein,

although at a lower level. Experiments with pure MoeA

protein showed that this protein lacks the ability to

desulfurylate cysteine and thus the MoeA protein may not

serve as a primary source of sulfur. Direct biochemical

experiments are needed to establish the role of MoeA protein

in the molybdenum cofactor biosynthesis and Mo metabolism.



Role of MoeA in Mo-Cofactor Synthesis

The nitrate reductase apoenzyme synthesis is

independent of molybdenum cofactor and the apo-nitrate

reductase (apo-NR) in crude extracts can be activated to

active form by the addition of molybdopterin extracted from

molybdoenzymes (48, 71). This in vitro activation of

aponitrate reductase was used to establish the role of MoaD,

MoaE and MoeB proteins in the molybdopterin synthesis (76).

Almost all of these experiments on Mo-cofactor biosynthesis

utilized an extract from a N. crassa nit-1 mutant which is

defective in molybdopterin synthase activity as the source

of apo-nitrate reductase and precursor Z.

An assay similar to the N. crassa nit-1 apo-nitrate

reductase activation was used in this study to evaluate the

role of MoeA protein in molybdenum cofactor synthesis in E.









72

coli. In these experiments, an extract obtained from a moeA

mutant, strain AH69, grown under anaerobic conditions in the

presence of nitrate and molybdate, the two needed effectors,

was used as the source of apo-nitrate reductase and

molybdopterin. In this extract, the molybdopterin is

expected to be in a Mo-free form. If Mo is inserted into the

MPT, the Mo-cofactor can then be incorporated into the apoNR

leading to the production of active NR.

Upon addition of MoeA protein, the strain AH69 extract

started to produce active nitrate reductase after a lag of

about 10 min (Fig. 8). The nitrate reductase activity

increased linearly between 10 and 40 min and reached the

maximum level by about 60 min. Under the experimental

conditions used, the total nitrate reductase activity

reached was about 250 units.

The amount of apo-nitrate reductase activated by MoeA

was dependent on the concentration of MoeA added to the

extract (Fig. 9). In the absence of MoeA protein active

nitrate reductase was not detected even after incubation of

the extract with molybdate for over 4 hours. The amount of

active nitrate reductase detected in the extract increased

linearly with increasing concentration of MoeA protein and

reached a maximum of 240 units of active nitrate reductase.

It is not known whether the limiting factor in the extract

from strain AH69 was the amount of apo-nitrate reductase or















300


250


200

Q-.
S150


Is 100


f5 50


0 50 100 150
Time (min)

Fig. 8. Time course of MoeA-dependent activation of nitrate
reductase. The reaction samples were incubated at 30C for
the time indicated. MoeA protein and molybdate were included
at a final concentration of 100ng and 50 pM, respectively.
The reaction volume is 0.25 ml.


*













300


-250

SI 200

: S 150

S100


50


0 50 100 150 200

[MoeA] (ng)

Fig. 9. MoeA-dependent activation of strain AH69 extract.
The cell extract of the moeA mutant was incubated with
differing MoeA protein concentration and 50 pM sodium
molybdate, at 300C, for one hr. The reaction volume is 0.25
ml.











the quantity of molybdopterin. The molybdopterin is oxygen-

labile (81) and although the extract was maintained under

anaerobic conditions and the assays were carried out under

dihydrogen, it is possible an unknown fraction of the

molybdopterin from the cells was inactivated during the

experiment. These results indicate that the MoeA protein is

an essential component of the Mo-cofactor synthesis.

Molybdate was not essential for this MoeA-dependent

activation of apo-nitrate reductase in strain AH69 extract.

Since the moeA mutant strain was cultured in the presence of

molybdate, a needed effector for transcription of narGHJI

operon coding for the components of nitrate reductase, it is

possible that the extract carries an unknown amount of the

molybdate present in the cytoplasm. Since this carry over

molybdate could account for the activation of apo-nitrate

reductase in the absence of added molybdate, apparently the

concentration of molybdate required in this experiment is

extremely small. If the molybdate in the growth medium was

replaced by tungstate, an alternate effector for narGHJI

transcription, a molybdate-dependent activation of apo-

nitrate reductase can be demonstrated (Fig. 10). Even the

extract from tungstate-grown cells produced a basal level of

about 75 units of active nitrate reductase in the absence of

added molybdate but only with MoeA protein. In this

activation process, tungstate competed with molybdate and in

the presence of tungstate active nitrate reductase was not












200


i5 150



100 .*



r 50




0 50 100 150 200

[Mo] (nM)

Fig. 10. Activation of nitrate reductase in a tungstate-
grown moeA mutant, strain AH69, extract. The MoeA protein
was added at 100 ng per reaction and the reaction samples
were incubated at 300C for 1 hr. The reaction volume is 0.25
ml.











detected. These results show that although tungstate can

substitute for molybdate in the transcription control of

narGHJI operon, tungsten-containing nitrate reductase is not

active. Since E. coli produces an active tungsten-containing

TMAO-reductase, an alternate possibility that tungstate is

not activated by MoeA and W-containing cofactor is not

produced by the extract, is unlikely. Apparently, the

extract from tungstate-grown cells also contained a small

amount of molybdate as a contaminant to support a lower

level of active nitrate reductase production.

The MoeA- phenotype of strain AH69 can be suppressed in

vivo by sulfide and molybdate. Addition of sulfide alone or

with molybdate to the extract from strain AH69 failed to

support active NR production. Various thiomolybdates (mono-,

di-, and tetra-thiomolybdates), proposed MoeA-catalyzed

product (Fig. 7) also had no effect in replacing MoeA

protein in this activation.

Since the MoeA protein is only one part of a eukaryotic

protein homolog (gephyrin, cinnamon or Cnxl; 51, 78, 102),

the putative role of Mog protein in the in vitro activation

of apo-nitrate reductase by MoeA protein was investigated.

For these experiments, a double mutant lacking both moeA and

mog activities was constructed (strain AH165). The extract

obtained from this strain also lacked nitrate reductase

activity. Active nitrate reductase production by this

extract was dependent on preincubation with both MoeA and











Mog proteins. In the presence of 100 ng of MoeA the optimum

amount of Mog protein required for activation of apo-nitrate

reductase was about 200 ng per reaction (Fig. 11). In this

double mutant also, as seen with the extracts from the moeA

mutant (strain AH69), the activation of apo-nitrate

reductase was molybdate-independent as long as the two

missing components of the molybdate metabolism are added to

the extract. In vivo, the Mog- phenotype can be suppressed

by high concentration of molybdate (1 mM) in the growth

medium. In vitro also, the requirement for Mog protein for

activation of apo-nitrate reductase in the extract from

strain AH165 can be partly overcome by molybdate but only in

the presence of MoeA protein. The optimum concentration of

molybdate required for replacing the Mog protein in this

activation was about 20 pM which is at least 20-times higher

than the amount of molybdate required for MoeA-dependent

activation of apoNR in the extracts from W-grown cells of

the moeA mutant, strain AH69 (Fig. 9). Even with 0.2 mM

molybdate, the amount of active NR produced by the extract

was less than 50% of the values obtained with Mog protein in

the absence of added molybdate. The ability of molybdate to

replace Mog protein in this activation of apoNR was also

seen in the extract from a mutant carrying only the mog













200 [MogA]


150


S100[Mo


50



0 100 200 300








by molybdate. The MoeA concentration was 100 ng. The filled
squares represent the Mog protein concentrations without
addition of molybdate to the reaction sample. The filled
circles represent molybdate concentration curve without
addition of Mog protein. The reaction volume is 0.25 ml.











mutation and the kinetics of activation of apoNR (Fig. 12)

was similar to that of the double mutant. Irrespective of

the concentration of molybdate, the MoeA protein is an

absolute requirement for the conversion of apo-NR to active

nitrate reductase by the extract from molybdate-grown strain

AH165.

These results suggest that the Mog protein only serves

a structural role, probably binding MPT, during the

synthesis of Mo-cofactor catalyzed by the MoeA protein. The

Mog protein from E. coli as well as the Mog-domain of both

Cnxl protein and rat gephyrin (94, 103) were shown to bind

MPT in agreement with this proposed role. The MoeA protein

apparently plays a catalytic role in the activation of Mo

and insertion of Mo into MPT bound to the Mog protein. This

MoeA-Mog complex is probably the source of Mo-cofactor and

ultimately MGD for the maturation of the apoNR to its active

form. In the absence of Mog protein, the MoeA protein

catalyzes Mo activation and insertion into free MPT with a

lower affinity for free MPT reflected by the requirement for

high concentration of molybdate for this reaction.

Alternatively, the MoeA catalyzed product reacts chemically

with the MPT in solution to produce the Mo-cofactor which

also requires higher concentration of molybdate and

activated molybdenum compound.













250

+Mo + MogA
200







50 1 150 200 250
50
50 /No Addition


0 50 100 150 200 250

Time (min)

Fig. 12. Kinetic of activation of ap-onitrate reductase
produced by E. coli, mog mutant, strain AH160. Sodium
molybdate and Mog protein were added at 50 pM and 150 ng,
respectively. Samples were incubated at 30C. The reaction
volume is 0.25 ml.











Role of MoeA Protein in the Regulation of nar Operons

Previous studies (96, 104) reported that the

transcription of narGHJI operon, coding for the anaerobic

respiratory nitrate reductase structural genes, required

both nitrate and molybdate. Under anaerobic growth

conditions, strain SE2176 carrying O(narG-lacZ) in the wild

type background produced 3,000 units of 0-galactosidase

activity when grown in LBG. When nitrate was included in the

growth medium the level of activity increased by about 7-

fold (Table 8).

In a molybdate transport defective mutant, strain

SE2202 (modB::TnlO), the nitrate-dependent increase in P-

galactosidase activity was dependent on supplementation of

the growth medium with molybdate. These results show that

molybdate is needed only for the nitrate-dependent increase

in narGHJI expression and not for the basal level of

expression.

Since the expression of narG requires molybdate, the

role of the molybdate response regulator ModE, in the

regulation of narG operon was evaluated. A modE deletion

derivative of strain SE2176, strain SE2163, produced P-

galactosidase activity at about 40% of the level of modE*

parent grown in LBG + nitrate medium (Table 8). Addition of

molybdate to the medium only slightly increased this level










Table 8. Effect of mod mutations on narG-lacZ expression


Strain Relevant P-Galactosidase activity
Genotype No +Mo +NO3- +N03O+Mo
Addition


SE2176 Wild type 3,500 2,900 20,000 19,000
SE2202 modB 2,900 3,100 2,700 21,000

SE2163 AmodE 3,200 2,500 7,600 9,000
SE2163(pAGl) AmodE, (modE*) 3,100 2,400 19,000 21,000

SE2200 AmodE, modB 3,000 3,000 3,100 9,000
SE2200(pAG1) AmodE, modB 2,900 2,800 3,000 21,000
(modE*)


Cells were grown in LBG with and without sodium molybdate (1
mM) or/and sodium nitrate (30 mM).
P-galactosidase activity is expressed as nanomoles.
min'. milligram of cell protein-'.




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E74PN3ALJ_JX2663 INGEST_TIME 2013-09-27T21:01:23Z PACKAGE AA00014254_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES