Whole genome wide expression profiles of Vitis amurensis grape responding to downy mildew by using Solexa sequencing tec...

MISSING IMAGE

Material Information

Title:
Whole genome wide expression profiles of Vitis amurensis grape responding to downy mildew by using Solexa sequencing technology
Physical Description:
Mixed Material
Language:
English
Creator:
Wu, Jiao
Zhang, Yali
Zhang, Huiqin
Huang, Hong
Folta, Kevin M.
Lu, Jiang
Publisher:
BioMed Central (BMC Plant Biology)
Publication Date:

Notes

Abstract:
Background: Downy mildew (DM), caused by pathogen Plasmopara viticola (PV) is the single most damaging disease of grapes (Vitis L.) worldwide. However, the mechanisms of the disease development in grapes are poorly understood. A method for estimating gene expression levels using Solexa sequencing of Type I restrictionendonuclease- generated cDNA fragments was used for deep sequencing the transcriptomes resulting from PV infected leaves of Vitis amurensis Rupr. cv. Zuoshan-1. Our goal is to identify genes that are involved in resistance to grape DM disease. Results: Approximately 8.5 million (M) 21-nt cDNA tags were sequenced in the cDNA library derived from PV pathogen-infected leaves, and about 7.5 M were sequenced from the cDNA library constructed from the control leaves. When annotated, a total of 15,249 putative genes were identified from the Solexa sequencing tags for the infection (INF) library and 14,549 for the control (CON) library. Comparative analysis between these two cDNA libraries showed about 0.9% of the unique tags increased by at least five-fold, and about 0.6% of the unique tags decreased more than five-fold in infected leaves, while 98.5% of the unique tags showed less than five-fold difference between the two samples. The expression levels of 12 differentially expressed genes were confirmed by Real-time RT-PCR and the trends observed agreed well with the Solexa expression profiles, although the degree of change was lower in amplitude. After pathway enrichment analysis, a set of significantly enriched pathways were identified for the differentially expressed genes (DEGs), which associated with ribosome structure, photosynthesis, amino acid and sugar metabolism. Conclusions: This study presented a series of candidate genes and pathways that may contribute to DM resistance in grapes, and illustrated that the Solexa-based tag-sequencing approach was a powerful tool for gene expression comparison between control and treated samples.
General Note:
Publication of this article was funded in part by the University of Florida Open-Access publishing Fund. In addition, requestors receiving funding through the UFOAP project are expected to submit a post-review, final draft of the article to UF's institutional repository, IR@UF, (www.uflib.ufl.edu/UFir) at the time of funding. The institutional Repository at the University of Florida community, with research, news, outreach, and educational materials.
General Note:
Wu et al. BMC Plant Biology 2010, 10:234 http://www.biomedcentral.com/1471-2229/10/234; Pages 1-16
General Note:
doi:10.1186/1471-2229-10-234 Cite this article as: Wu et al.: Whole genome wide expression profiles of Vitis amurensis grape responding to downy mildew by using Solexa sequencing technology. BMC Plant Biology 2010 10:234.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All rights reserved by the source institution.
System ID:
AA00013950:00001

Full Text

PAGE 1

RESEARCHARTICLEOpenAccess Wholegenomewideexpressionprofilesof Vitis amurensis graperespondingtodownymildewby usingSolexasequencingtechnology JiaoWu 1,2 † ,YaliZhang 1 † ,HuiqinZhang 1 ,HongHuang 3 ,KevinMFolta 2 ,JiangLu 1,4* Abstract Background: Downymildew(DM),causedbypathogen Plasmoparaviticola (PV)isthesinglemostdamaging diseaseofgrapes( Vitis L.)worldwide.However,themechanismsofthediseasedevelopmentingrapesarepoorly understood.AmethodforestimatinggeneexpressionlevelsusingSolexasequencingofTypeIrestrictionendonuclease-generatedcDNAfragmentswasusedfordeepsequencingthetranscriptomesresultingfromPV infectedleavesof Vitisamurensis Rupr.cv.Zuoshan-1.Ourgoalistoidentifygenesthatareinvolvedinresistance tograpeDMdisease. Results: Approximately8.5million(M)21-ntcDNAtagsweresequencedinthecDNAlibraryderivedfromPV pathogen-infectedleaves,andabout7.5MweresequencedfromthecDNAlibraryconstructedfromthecontrol leaves.Whenannotated,atotalof15,249putativegeneswereidentifiedfromtheSolexasequencingtagsforthe infection(INF)libraryand14,549forthecontrol(CON)library.ComparativeanalysisbetweenthesetwocDNA librariesshowedabout0.9%oftheuniquetagsincreasedbyatleastfive-fold,andabout0.6%oftheuniquetags decreasedmorethanfive-foldininfectedleaves,while98.5%oftheuniquetagsshowedlessthanfive-fold differencebetweenthetwosamples.Theexpressionlevelsof12differentiallyexpressedgeneswereconfirmedby Real-timeRT-PCRandthetrendsobservedagreedwellwiththeSolexaexpressionprofiles,althoughthedegreeof changewaslowerinamplitude.Afterpathwayenrichmentanalysis,asetofsignificantlyenrichedpathwayswere identifiedforthedifferentiallyexpressedgenes(DEGs),whichassociatedwithribosomestructure,photosynthesis, aminoacidandsugarmetabolism. Conclusions: ThisstudypresentedaseriesofcandidategenesandpathwaysthatmaycontributetoDMresistance ingrapes,andillustratedthattheSolexa-basedtag-sequencingapproachwasapowerfultoolforgeneexpression comparisonbetweencontrolandtreatedsamples. Background Downymildewofgrapesoccursinmostpartsofthe worldwheregrapesaregrown,butfavorsthoseregions thatexperiencewarm,wetconditionsduringthevegetativegrowthofthevine.Amajoroutbreakofthedisease cancauseseverelossesinyieldandberryquality.SymptomsofDMareusuallyfirstnoticedonleavesasyellowishandlateroilylesionsontheleaf ’ suppersurface witha ‘ downy ’ massobservedonthecorresponding undersideoftheleaf.Itcanalsocausedeformationof shoots,tendrils,inflorescencesandclustersofyoung berries.Berriesbecomelesssusceptibleastheymature, howeverrachisinfectioncanspreadintotheolderfruit whichleadstodirectcroplossbyshellingofberries[1]. Downymildewiscausedbythepathogen Plasmopara viticola (PV).Primaryinfectionbeginswiththeoverwinteringoosporeoninfectedl eavesorplantlitterinthe soilthatgerminatesinthes pringandproducesasporangium[2].Whenplantpartsarecoveredwithafilmof moisturefromrainorirrigation,thesporangium releasessmallswimmingspores(zoospores)thatare thenspreadbysplashingwater.Thesporescangerminatebyproducingagermtubethatentersthegreen *Correspondence:j.lu.cau@gmail.com † Contributedequally 1 CollegeofFoodScienceandNutritionalEngineering,ChinaAgricultural University,Beijing,100083,China Fulllistofauthorinformationisavailableattheendofthearticle Wu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 2010Wuetal;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreativeCommons AttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,andreproductionin anymedium,providedtheoriginalworkisproperlycited.

PAGE 2

tissue(includingleaves,inflorescences,bunchesand youngberries)throughthestomates[3].Secondary infection,whichisthemajorsourceofdiseasespread, producessporesthatmaybemobilizedbywindand raintoestablishnewinfectionsites.Thecycleendswith thesexualproductionofover-winteringoospores[2]. Differentgenotypesofgrapesshowvaryinglevelof resistancetoPV,rangingfromsusceptible V.vinifera ,to themoderatelyresistant V.rupestris and V.amurensis V.cinerea V.riparia and V.candicans ,tothetotally resistant Muscadiniarotundifolia [4-6].Theworld-wide grapeindustryreliespredominantlyon V.vinifera whichrequireschemicalprotectiontoproducehealthy fruits.However,suchchemicalsmayhavenegative environmentalimpactsand/orposerisktohuman health.Apromisingalterna tivestrategythatcould simultaneouslyimprovegrapehealthandlimitchemical useistoidentifytheuniquegenesormechanismsfrom resistantspeciesthatcouldpotentiallyconferresistance tothepathogenorlowerpresentationofsymptoms. Theseelementsmaypotentiallybeintroducedinto V. vinifera throughlong-termbreedingeffortsortransgenicmethods.Withthisperspective,itisimportantto unravelthemolecularbasisofnaturaldefenseresponses inresistantgrapevinestoDMchallenge,includingidentificationofthegeneticprocessesthatmaycontributeto resistance. ResponsestoPVhavebeencharacterizedinvarious resistantspecies.Mechanismsofresistanceinclude inductionofchemicalbarriers,initiationofprocesses thatdelayinvasivegrowthofmycelia,ormechanisms thatestablishhypersensitiv eresponseafterinoculation ofPV[7-9].Geneticandgene expressionprofilingstudieshaveconcludedthat Rpv1 ,NPR1homologs,andPR proteinencodinggenescontributetothefunctionof DMresistanceingrapevines[10-12].Othersfactors, includingtheaminoacidbeta-aminobutyricacid[13], andtheproteinsbeta-1,3-Glucanase[14],stilbene synthase(STS)[15],phenylalanineammonialyase(PAL) [16],thaumatin-likeproteinsandchitinase[17]mayalso playanimportantroleinDMresistance.Many attempts,includingtransgenic[18-21]andtraditional breedingapproaches[10,22,23],havebeenundertaken tointrogressresistanceinto V.vinifera genotypes. Tounderstandthemechanism(s)ofthehostresistance atthemolecularlevel,acriticalfirststepistoidentifythe transcriptsthataccumulateinresponsetothepathogen attack.Inthisstudy, “ Zuoshan-1 ” ,aclonalselectionfrom wild V.amurensis withcoldhardinessandhighresistance toDM[24],wasemployedtoidentifyasetofcandidate genesassociatedwithDMresistanceusingSolexa sequencingtechnology.Solexasequencingisatechnologycapableofobtainingnov elinformationforwholegenome-widetranscriptexpressionwithoutprior sequenceknowledge.Thisreportpresentsthefindingof thesetests.ResultsInoculationandsymptomdevelopmentThefourthunfoldedleaffromtheshootapexof “ Zuoshan-1 ” wasinoculatedwithPV.Novisiblesymptomswereobservedinthefirst4days(Figure1aand 1b).The ‘ downy ’ masswasobviouslyobservedonthe 6thday(Figure1c)andexacerbatedonthe8thday (Figure1d).Oilspotsemerg edgraduallyonthesiteof pathogenandthesporesdidnotspreadtotheother healthytissues18daysafterinoculation(Figure1e and1f).TagidentificationandquantificationAtotalof8,549,948and7,527,499tagsweresequenced ininfected(INF)andcontrol(CON)libraries,respectively(Table1).Afterfilteringoutlowqualitytags(tags containing ‘ N ’ andadaptorsequences),8,474,583and 7,525,307tags(notedhereinas “ clean ” tags)remainedin INFandCONlibraries.Toincreasetherobustnessof theapproach,single-copytagsinthetwolibraries (247,900inINFand253,1 56inCONlibrary)were excludedfromfurtheranalysis.Asaresult,atotalof 8,226,683and7,272,151cleantagsremainedfromthe twolibraries,fromwhich233,653(INF)and203,514 (CON)uniquetagswereobtained.Therewere30,139 moreuniquetagsintheINFthanintheCONlibrary, possiblyrepresentinggenesrelatedtopathogeninteractionandsymptomdevelopment.Thepercentageof uniquetagsrapidlydeclined ascopynumberincreased, indicatingonlyasmallportionofthetranscriptswere expressedathighlevelintheconditionstested.DepthofsamplingSaturationofthelibraryisdeterminedbyidentification ofuniquetags.Sequencingreachessaturationwhenno newuniquetagsaredetected.TheresultsshowninFigure2indicatethatINFandCONlibrarieswere sequencedtosaturation,producingafullrepresentation ofthetranscriptsintheconditionstested.Inboth librariesfeweruniquetagswereidentifiedasthenumberofsequencingtagsincreases,reachingaplateau shortlyafter6Mtagsweresequenced.Nonewunique tagswereidentifiedasthetotaltagnumberapproached 8.5MinINFlibraryand7.5MinCONlibrary.AnnotationanalysisoftheuniquetagTheuniquetagswerecomparedagainstthegenomeand genesequencesof V.vinifera cv.PinotNoir[25]using blastn.Tagswithacompletematchoronebase pairmismatchwereconsideredfurther.Theresultsin Table2showthatasubstantialproportionoftagsWu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page2of16

PAGE 3

(81.60%inINFlibrarya nd83.72%inCONlibrary) matchedtothe “ PinotNoir ” genome,and91,638 (39.21%ofuniquetags)and83,079(40.82%ofunique tags)inINFandCONlibrarymatchedto18,841 (61.91%)and18,068(59.37%) “ PinotNoir ” genes. Furtheranalysisrevealedthat82,886uniquetags (35.47%)inINFlibraryand75,290(36.99%)inCON librarymatchedtoonlyonegenesequenceinthe “ Pinot Noir ’ genome(Table2).Thesedataindicatedthat Figure1 Symptomdevelopmentonleafsurfaceof “ Zuoshan-1 ” afterPVinfection .Thefourthunfoldedleaffromtheshootapexof “ Zuoshan-1 ” wasinoculatedon(a)day0.Subsequentimagesdepictthestateofinfectionandsymptomdevelopmenton(b)day4,(c)day6, (d)day8and(eandf)18d.Paneleshowstheupperleafandpanelfshowsthelowerleafsurface. Table1Solexatagsintheinfected(INF)andcontrol (CON)librariesINFCON totaltag85499487527499 cleantag84745837525307 cleantagcopynumber=1247900253156 uniquetag233653203514 uniquetagcopynumber>59831880345 uniquetagcopynumber>106320251438 uniquetagcopynumber>203977231441 uniquetagcopynumber>501977614804 uniquetagcopynumber>100106157701 Figure2 AccumulationofSolexatotaltaganduniquetagin thetwolibraries .Newuniquetag("y ” axis)ofINF(solidline)and CON(brokenline)librariesdecreasedasthesolexasequencing increased("x ” axis).Thetotaluniquetagwas233,653inINFand 203,514inCONlibrary. Wu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page3of16

PAGE 4

approximately50%oftranscriptspredictedingrapeare expressedintheinfectedorcontrolleaves,withmore transcriptspresentintheinfectedsample. Tagswithnohomologytograpewerecomparedwith blastntotheVBIMicrobialDatabase[26]containing genomicsequenceinformationfrom Phytophthorasojae Phytophthorainfestans and Hyaloperonosporaparasitica Therewere251tagsidentifiedinINFlibraryfoundto beidenticaltothoseoftheoomyceteduringPVinfection(additionalfile1).Comparisonofgeneexpressionlevelbetweenthetwo librariesDifferencesoftagfrequenciesthatappearedintheINF andCONlibrarieswereusedforestimatinggeneexpressionlevelsinresponsetoPVinfection.Thetranscripts detectedwithatleasttwo-folddifferencesinthetwo librariesareshowninFigure3(FDR<0.001).Thereddots (3,125)andgreendots(1,847)representtranscriptshigher orlowerinabundanceformorethantwofoldinINF library,respectively.Thebluedotsrepresenttranscripts thatdifferedlessthantwofoldbetweenthetwolibraries, whichwerearbitrarilydesignatedas “ nodifferencein expression ” .TheDEGswithfivefoldorgreaterdifferences inaccumulationwereshowninFigure4.Atotalof513 genes(about0.9%totaluniquetags)increasedbyatleast fivefold,and167genes(about0.6%totaluniquetags) weredecreasedbyatleastfivefoldintheINFlibrary, whiletheexpressionlevelof98.5%uniquetagswaswithin five-folddifferencebetweenthetwosamples. OfDEGswithdifferencesgreaterthantwentyfold (Table3),69geneswerepresentathigherlevelsinthe INFlibrary,67ofwhichwereassociatedwithdefense (6),transport(3),transcription(11),signaltransduction (14)andmetabolism(33).ThehighestDEGwasphosphate-inducedproteingenewhichwaspresentat229 foldofcontrollevels.Amongthesehighlyexpressed genes,manywereassociatedwithsenescence,abiotic andbioticstresses. FifteenDEGswerelessabundantintheINFlibrary. ThosepresenttwentyfoldormoreintheCONlibrary werealsolistedinTable3,inwhich13geneswereclassifiedasdefense(2)andmetabolism(11),including genesencodingcytochromeP450andPRproteins.The greatestdifferencesbetweenINFandCONDEGswere (-)-germacreneDsynthaseandimmunoglobulin/major histocompatibilitycomplexthatbothwerepresent164foldlowerintheINFlibrarythanintheCONlibrary.Real-timeRT-PCRanalysisInordertovalidateSolexaexpressionprofiles,the steady-statetranscriptlevelsof12 “ defenserelated ” geneswereanalyzed.Amongthem,sevengenes (CHI4D,TL3,PR10,TIP2;1,CYSP,ERF4,STS5)were upregulatedandfivegenes(THX,SHM1,HypP,GLO, ClpP)weredownregulated(Figure5).Actin,testedtobe stableinourpreviouswork,waschosenasareference genefordatanormalization.ThetrendofRT-PCR basedexpressionprofilesamongtheseselectedgenes wassimilartothosedetectedbySolexa-sequencing Table2Annotationof “ Zuoshan-1 ” Solexatagsagainstthe “ PinotNoir ” genomicsequenceINFCON matchtogenomematchtogenematchtogenomematchtogene uniquetag190665(81.60%)*91638(39.21%)*170380(83.72%)*83079(40.82%)* matchedgenes18841(61.91%)#18068(59.37%)#uniquetagmatchedtoonegene82886(35.47%)*75290(36.99%)* matchedgenes15249(50.51%)#14549(47.81%)#Note:*percentageofmatchedtags/totaltags;#percentageofmatchedgenes/totalassembledCDsof “ PinotNoir ” Figure3 Comparisionofgeneexpressionlevelbetweenthe twolibraries .Forcomparinggeneexpressionlevelbetweenthe twolibraries,eachlibrarywasnormalizedto1milliontags.Reddots representtranscriptsmoreprevalentintheinfectedleaflibrary, greendotsshowthosepresentatalowerfrequencyintheinfected tissueandbluedotsindicatetranscriptsthatdidnotchange significantly.Theparameters “ FDR<0.001 ” and “ log2Ratio 1 ” were usedasthethresholdtojudgethesignificanceofgeneexpression difference. Wu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page4of16

PAGE 5

basedmethod.However,thescalesofdifference betweentheINFandCONweregenerallysmallerin Real-timePCR(1-18folddifferences)thaninthose detectedbytheSolexa-sequencingbasedmethod(2-57 folds)(Table4).PathwayenrichmentanalysisofDEGsThePVaffectedbiologicalpathwayswereevaluatedby enrichmentanalysisofDEGs.Significantlyenriched metabolicpathwaysandsignaltransductionpathways wereidentified.Atotalof115pathwayswereaffected byup-and107wereaffectedbydown-regulatedDEGs, respectively(additionalfile2and3).DEGswithpathway annotationwerelistedaccordingtoenrichmentpriority (additionalfile4and5).Thefirsttenenrichedpathways werereportedinTable5.PathwayswithQvalue<0.05 aresignificantlyenriched. Ribosomal-associatedproteinsconstitutedtheonlysignificantlyaffectedpathwayfortheupregulatedDEGs(Q <0.05).Othernon-significantenrichedpathwayswith largenumberofupregulatedDEGsincludedaminosugar andnucleotidesugarmetabolism,starchandsucrose metabolism,secondarymetabolism,planthormonebiosynthesis,andsplicesomeassociatedproteins.Therewere moresignificantlyenrichedpathways(10)forthedownregulatedDEGs,whichwereinvolvedinphotosynthesis, aswellasmetabolismoffolate,nicotinate,nicotinamide, fructose,mannose,pyruvate,polyketidesugarunit,and purines,alongwithalkaloidsfromhistidineandpurines.DiscussionInthisreportSolexasequencingtechnology,ahighthroughputDNAsequencingapproach,wasutilizedto estimategeneexpressioninlibrariespreparedfrom infectedandcontroltissues.Theresults(Figure2)providedestimatesofgeneexpressionasdeterminedbythe frequencythatanygiventag(representingatranscript) issequenced.Thedataindicatethatthereissufficient coveragedepthtoreachsatur ation,thatis,acomplete assessmentofalltranscriptspresentinthelibraries. Theoretically,therateofnoveltagdiscoveryshould equalzeroifalluniquetagsoftheinitialsamplehad beensequenced.However,thisnumbermightbeslightly higherbecausenewtagsmaybeaddedduetotheaccumulationofsequencingerrorsasthesizeofthelibrary increased[27].Strictfilteringandconservativematching allowsrecognitionoferroneoustags,whicharethendisregarded.Allofthesepreceptsmaycontributetoaloss ofsubstantialsequenceinformation.However,lossof somedatapotentiallymadetheresultsmoreconservative,revealingonlyrobustandbonafidedifferences. Moreover,thetotalnumberoftagsafterstringentfilteringwassufficientforannotationtothereferencegenes inthegrapegenomesequence.Theoretically,tags shouldbegeneratedby NlaIII fromthe3 ’ -mostendsof transcripts,butalmost50%oftagsfromother NlaIII siteswerealsogeneratedinourresult.Sinceonlyone tagcouldbegeneratedineachtranscriptfromany NlaIII siteinacDNA,theseother NlaIII tagsrepresentedagivengeneredundantlyintheexpressionprofile.Thisphenomenonaccountsfortheinflatednumber ofuniquetagsgenerated(about200,000)relativetothat oftheannotatedgrapegenome(about30,000).These othertagsmayalsoarisebecauseofalternativesplicing orincompleteenzymedigestion. Theresultsrepresentthefirstlarge-scaleinvestigation ofthegeneexpressioninDManalysisofgrapevine. Polesanietal[28]reported804transcriptsidentifiedin PVinfectedleavesofsusceptiblecultivar “ Riesling ” usingcDNA-AFLP.Figueiredoetal[29]found121transcripts,representing29un iquegenedifferentially expressedbetweentwo V.vinifera cultivars “ Regent ” and “ Trincadeira ” (resistantandsusceptibletofungi, respectively)bycDNAmicroarray.Inthecurrentstudy, 15,249putativegeneswereidentifiedamongtheSolexa sequencingtagsfortheINFlibraryand14,549forthe CONlibrary. Thesteady-statetranscriptlevelforasetofselected geneswasconfirmedbyReal-timeRT-PCR.Although thedifferencesingeneexpressiondidnotmatchthe magnitudeofthosedetectedbySolexa-basedsequencing method,thetrendsofup-anddown-regulationwere similar.ThelowerexpressionleveldetectedbyReal-time Figure4 Differentiallyexpressedtagsininfected(INF)tissue library .The “ x ” axisrepresentsfold-changeofdifferentially expresseduniquetagsintheINFlibrary.The “ y ” axisrepresentsthe numberofuniquetags(log10).Differentiallyaccumulatingunique tagswitha5-folddifferencebetweenlibrariesareshowninthered region(98.49%).Theblue(0.89%)andgreen(0.61%)regions representuniquetagsthatareup-anddownregulatedformore than5foldintheINFlibrary,respectively. Wu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page5of16

PAGE 6

Table3ListofDEGschangedfor20foldandmoreinINFlibraryGeneAnnotationStressrelatedfunctionAccessionIdentityFold Upregulatedgenes Defence GSVIVT00025506001polygalacturonase-inhibitingprotein[ Vitislabrusca x VitisRiparia ] inhibitsfungal endopolygalacturonases ACS16072.1333/333(100%)60 GSVIVT00001105001thaumatin-likeprotein[ Vitisvinifera ]pathogendefence;drought andheatcombination AAQ10092.1217/225(96%)57 GSVIVT00017370001harpin-inducedprotein-related/HIN1-related/ harpin-responsiveprotein-related[ Arabidopsis thaliana ] pathogendefence;senescenceNP_565634.1141/267(52%)33 GSVIVT00002965001TMVresponse-relatedprotein[ Zeamays ]TobaccoMosaicVirus response ACG48457.139/91(42%)32 GSVIVT00005362001glutaredoxin[ Populustrichocarpa ]senescenceEEE75685.191/155(58%)29 GSVIVT00024683001beta-glucosidase[ Rosa hybridcultivar]activationofphytoanticipinsBAG13451.1382/531(71%)21 Transport GSVIVT00001094001multidrugresistancepump,putative[ Ricinus communis ] fungalresistanceEEF51093.1407/509(79%)121 GSVIVT00015121001mitochondrialdicarboxylatecarrierprotein, putative[ RicinusCommunis ] aluminumtoleranceEEF48606.1271/324(83%)38 GSVIVT00030447001multidrugresistanceproteinABCtransporterfamily protein[ PopulusTrichocarpa ] Senescence;droughtandheat combination EEE80779.164/194(32%)25 Signaltransduction GSVIVT00030628001leucine-richrepeatreceptor-likeproteinkinase [ Nicotianatabacum ] senescenceAAF66615.1644/923(69%)145 GSVIVT00006178001FERONIAreceptor-likekinase[ Arabidopsisthaliana ]defence,stressesABT18100.1317/621(51%)56 GSVIVT00019504001MAP3K-likeproteinkinase[ Arabidopsisthaliana ]diseaseresistance,drought andheatcombination CAB16796.1184/359(51%)52 GSVIVT00002706001calmodulin-bindingprotein[ Arabidopsisthaliana ]senescenceNP_565379.121/45(46%)39 GSVIVT00020989001calcium-bindingEFhandfamilyprotein [ Arabidopsisthaliana ] defencerelated;senescence; droughtandheat combination NP_568568.181/166(48%)35 GSVIVT00029809001ethylene-regulatedtranscript2(ERT2)[ Arabidopsis thaliana ] senescenceCAB45883.196/204(47%)34 GSVIVT00036549001calmodulin-bindingprotein[ Arabidopsisthaliana ]senescenceNP_565379.1149/366(40%)28 GSVIVT00002973001calmodulinbindingprotein-like[ Elaeisguineensis ]senescenceABP04242.189/135(65%)27 GSVIVT00025017001BRASSINOSTEROIDINSENSITIVE1-associated receptorkinase1precursor,putative[ Ricinus communis ] disease,celldeathEEF29110.1415/639(64%)26 GSVIVT00000612001nodulin-likeprotein[ Arabidopsisthaliana ]droughtandheat combination AAC28987.1397/550(72%)23 GSVIVT00033036001RING-H2subgroupRHEprotein[ Populustremula x Populusalba ] droughtandheatcombination AAW33880.1168/296(56%)22 GSVIVT00009150001PAR-1a[ Nicotianatabacum ]potatovirusY,SARinduceCAA58733.1127/178(71%)22 GSVIVT00027614001receptor-proteinkinase-likeprotein[ Arabidopsis thaliana ] droughtandheat combination BAA98098.1632/849(74%)20 GSVIVT00030574001leucine-richrepeatreceptor-likeproteinkinase [ Arabidopsisthaliana ] senescenceACN59244.1317/611(51%)20 Transcription GSVIVT00014947001zinc-fingerprotein1[ Datiscaglomerata ]defence,stressesAAD26942.1144/246(58%)60 GSVIVT00016398001dehydration-responsiveelementbindingprotein3 [ Glycinemax ] bioticandabioticstressesABB36646.1116/187(62%)52 GSVIVT00007409001DRE-bindingprotein3b[ Gossypiumhirsutum ]droughtandheat combination ABB45861.1134/237(56%)22 GSVIVT00020131001basichelix-loop-helixprotein[ Nicotianatabacum ]senescenceBAF30984.1105/228(46%)33 GSVIVT00001092001Dehydration-responsiveelement-bindingprotein 1F,putative[ Ricinuscommunis ] phytohormone,pathogenand environmentalstresses EEF51090.1143/242(59%)30 GSVIVT00007410001CBF4transcriptionfactor[ Vitisvinifera ]coldstressABE96792.1218/218(100%)30 GSVIVT00016403001jasmonateZIMdomain1[ Catharanthusroseus ]wounding;herbivory;salinityACM89457.1131/275(47%)27 Wu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page6of16

PAGE 7

Table3ListofDEGschangedfor20foldandmoreinINFlibrary (Continued)GSVIVT00028041001AP2domainclasstranscriptionfactor[ Malus x domestica ] senescence;droughtandheat combination ADE41117.1172/327(52%)26 GSVIVT00027444001GRASfamilytranscriptionfactor[ Populus trichocarpa ] chitinresponseEEE95719.1446/586(76%)26 GSVIVT00006790001basichelix-loop-helix(bHLH)familyprotein [ Arabidopsisthaliana ] fugalresistancerelated; senescence NP_568850.1152/239(63%)21 GSVIVT00002446001WRKYtranscriptionfactor21[ Populustomentosa x P.bolleana ] senescence,stressesACV92023.1196/364(53%)21 Metabolism GSVIVT00015203001putativephosphate-inducedprotein[ Nicotiana tabacum ] unidentifiedBAA33810.1243/317(76%)229 GSVIVT00016518001saltresponsiveprotein2[ Solanumlycopersicum ]droughtandheat combination ACG50004.1309/464(66%)165 GSVIVT00024884001S-adenosyl-L-methionine:salicylicacidcarboxyl methyltransferase[ Chimonanthuspraecox ] bioticandaboticstressesABU88887.2191/377(50%)97 GSVIVT00024408001potein-bindingprotein,putative[ Ricinuscommunis ]unidentifiedEEF27653.1393/605(64%)87 GSVIVT00028930001ubiquitin-proteinligase,putative[ Ricinus communis ] senescenceEEF42248.1357/602(59%)72 GSVIVT00014730001cytochromeP450[ Populustrichocarpa ]senescence;droughtandheat combination EEE73840.1261/453(57%)70 GSVIVT000009880019-cis-epoxycarotenoiddioxygenase1[ Vitisvinifera ]senescence;defenceAAR11193.1602/610(98%)62 GSVIVT00023009001ATPP2-A2,putative[ Ricinuscommunis ]unidentifiedEEF38353.1114/158(72%)56 GSVIVT00014704001putativeintegralmembraneprotein[ Cyanothece sp.CCY0110] unidentifiedEAZ88012.153/176(30%)51 GSVIVT00018424001tropinonereductase,putative[ Ricinuscommunis ]senescence;droughtandheat combination EEF38138.1194/264(73%)48 GSVIVT00032938001asparticproteinasenepenthesin-1precursor, putative[ Ricinuscommunis ] phosphorusdeficiency;salt stress EEF29846.1306/441(69%)39 GSVIVT00024072001proteinphosphatase2c,putative[ Ricinus communis ] senescenceEEF41194.1254/393(64%)37 GSVIVT00015200001putativephosphate-inducedprotein[ Capsicum chinense ] unidentifiedBAG16530.1186/289(64%)37 GSVIVT00022245001f-boxfamilyprotein[ Populustrichocarpa ]senescenceEEE87327.1139/345(40%)37 GSVIVT00016166001ATP-dependentDNAhelicase[ Brevibacillusbrevis ]DNArepairBAH41662.116/45(35%)36 GSVIVT00024387001nucleicacidbindingprotein,putative[ Ricinus communis ] oxidative;ABA;abioticstressesEEF29282.1102/164(62%)34 GSVIVT00024235001proteinphosphatase2C[ Nicotianatabacum ]senescenceCAC10358.1257/429(59%)34GSVIVT00035825001ubiquitin-proteinligase,putative[ Ricinus communis ] senescenceEEF40124.1572/719(79%)32 GSVIVT00019233001TPA:isoflavonereductase-likeprotein3[ Vitis vinifera ] putativedefenceCAI56332.1301/319(94%)31 GSVIVT00014029001TPA_exp:cellulosesynthase-likeD1[ Oryzasativa ]unidentifiedDAA01752.1999/1171(85%)31 GSVIVT00007984001serineacetyltransferase[ Nicotianaplumbaginifolia ]oxidativestressAAR18403.1179/307(58%)30 GSVIVT00036225001Beta-expansin1aprecursor,putative[ Ricinus communis ] osmoticstressEEF28288.1207/259(79%)27 GSVIVT00017518001spottedleafprotein,putative[ Ricinuscommunis ]hypersensitiveresponse;cell death;senescence EEF38265.1243/402(60%)27 GSVIVT00007452001wound-inducedproteinWIN2precursor,putative [ Ricinuscommunis ] antifungalEEF31100.1142/197(72%)26 GSVIVT00002450001UDP-glucose:glucosyltransferase[ Lyciumbarbarum ]droughtandheat combination BAG80556.1293/464(63%)24 GSVIVT00036349001glucose-1-phosphateadenylyltransferase,putative [ Ricinuscommunis ] droughtandheat combination EEF49428.1412/531(77%)24 GSVIVT00028839001spottedleafprotein,putative[ Ricinuscommunis ]hypersensitiveresponse;cell death;senescence EEF52025.1385/674(57%)24 GSVIVT00009741001f-boxfamilyprotein[ Populustrichocarpa ]senescenceEEE86166.193/182(51%)24 GSVIVT00019669001galactinolsynthase[ Solanumlycopersicum ]oxidativestress;drought; salinity;chilling;heatshock BAH98060.1231/316(73%)24 Wu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page7of16

PAGE 8

RT-PCRcouldbeduetothedifferenceofsensitivity betweenthetwotechnologie s.Solexasequencinghas beendocumentedtobemoresensitiveforestimationof geneexpression,especiallyforlow-abundancetranscripts comparedtomicroarraysandReal-timeRT-PCR[30]. Thedifferencecouldalsobeattributedtodifferentinoculationseasonsanddevelopmentalstagesofthegrapevines.ThematerialsusedfortheSolexasequencing methodwereobtainedfrommaterialsinoculatedand harvestedinSeptember,whilematerialsusedforthe Real-timeRT-PCRanalyseswereobtainedfromplants inoculatedandharvestedinJune. DuetothesensitivityofSolexasequencingtechnology, manyraretranscriptsweredetected.Among536transcriptspresentpredominantly(<2-20fold)intheINF library,89werenotdetectedintheCONlibraryatall. Thesegeneswerepredictedtobeinvolvedinmanyplant Table3ListofDEGschangedfor20foldandmoreinINFlibrary (Continued)GSVIVT00030537001senescence-associatedprotein,putative[ Medicago truncatula ] Senescence;droughtandheat combination ABD32641.199/144(68%)23 GSVIVT00001432001proteinphosphatase2c,putative[ Ricinus communis ] senescence;droughtandheat combination EEF34881.1319/389(82%)23 GSVIVT00033193001galactinolsynthase[ Capsicumannuum ]oxidativestress;drought; salinity;chilling;heatshock ABQ44212.1239/315(75%)21 GSVIVT00023109001ATEXO70H4(exocystsubunitEXO70familyprotein H4);proteinbinding[ Arabidopsisthaliana ] unidentifiedNP_187563.1331/585(56%)21 variousfunctions GSVIVT00017533001PREDICTED:hypotheticalprotein[ Vitisvinifera ]unidentifiedXP_002279648.1500/500(100%)20 GSVIVT00020834001CW14[ Arabidopsisthaliana ]unidentifiedBAA87958.1300/533(56%)23 Downregulatedgenes Defence GSVIVT00016961001Immunoglobulin/majorhistocompatibilitycomplex [ Medicagotruncatula ] diseaseresistanceABP03850.1426/672(63%)-164 GSVIVT00014282001pathogenesis-relatedlikeprotein[ Arabidopsis thaliana ] defenceAAM66077.1117/215(54%)-67 Metabolism GSVIVT00027449001(-)-germacreneDsynthase[ Vitisvinifera ]wounding;methyljasmonateAAS66357.1500/553(90%)-164 GSVIVT00027451001(-)-germacreneDsynthase[ Vitisvinifera ]wounding;methyljasmonateAAS66357.1503/557(90%)-150 GSVIVT00027450001(-)-germacreneDsynthase[ Vitisvinifera ]wounding;methyljasmonateAAS66357.1274/319(85%)-53 GSVIVT00027456001(-)-germacreneDsynthase[ Vitisvinifera ]wounding;methyljasmonateAAS66357.1454/545(83%)-22 GSVIVT00014725001cytochromeP450[ Populustrichocarpa ]pathogeninducedEEE73840.1299/511(58%)-41 GSVIVT00014727001cytochromeP450[ Populustrichocarpa ]pathogeninducedEEE73840.1269/447(60%)-35 GSVIVT00007099001thioredoxinx[ Populustrichocarpa ]defence;abioticstresses, senescence EEE90516.198/117(83%)-39 GSVIVT00008711001beta-cyanoalaninesynthase[ Betulapendula ]cyanidemetabolismAAN86822.1311/352(88%)-36 GSVIVT00037489001non-specificlipidtransferprotein[ Vitisvinifera ]defencerelatedABA29446.1119/119(100%)-28 GSVIVT00029445001expansin[ VitislabruscaxVitisvinifera ]defencerelatedBAC66695.1252/252(100%)-22 GSVIVT00006300001UDP-glucosyltransferase,putative[ Ricinus communis ] defencerelatedEEF47681.1268/466(57%)-22 variousfunctions GSVIVT00005678001malesterility-relatedprotein[ Linumusitatissimum ]unidentifiedACA28679.1260/503(51%)-23 GSVIVT00032599001hypotheticalprotein[ Vitisvinifera ]unidentifiedXP_002284962.1368/368(100%)-22 Figure5 Real-timeRT-PCRanalysisfortwelvedifferentially expressedgenes .Real-timeRT-PCRanalysisfortwelvetranscripts incontrol(white)andinfected(gray)samples,including(a)seven moreabundantintheINFlibraryand(b)fivelessprevalentinthe INFlibraryasidentifiedbySolexaexpressionprofile.Alldatawere normalizedtotheactinexpressionlevel.Datarepresentfoldchange ofRQ(relativequantification)ininfectedvs.controlsamples.Bars representRQstandarddeviationcalculatedfromthreebiological replicates. Wu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page8of16

PAGE 9

biologicalprocesses,includingdefense.Forexample, genesencodingcinnamylalcoholdehydrogenase,lipaselikeprotein,glutathionesynthetase,GDSL-motiflipase, ankyrinrepeatfamilyprotein,serinehydrolase,prolinerichcellwallproteinandmulticopperoxidasewere previouslydescribedasplantdefense-relatedgenes. OtherraretranscriptsdetectedbySolexatechnology werepredictedtofunctioninsignaltransduction(protein kinase,calciumionbindingprotein,wall-associated kinase),transport(typeIIIamembraneprotein,ATP Table4GenesselectedforReal-timeRT-PCRGeneDescriptionForwardprimerReverseprimerTarget size Solexa fold RTPCR fold CHI4D V.vinifera classIVchitinase(gb|AF532966.1) TCCCACGTTCCCCCTTCTGTAGCTTGGCTGCCATTTTTG 59114 TL3 V.vinifera thaumatin-likeprotein(gb| AF532965.1) ACCCCACTCCAACCATCAAGGATTTTGCAGAGGCCCATTG 59574 PR10TamnaraTam-RP10pathogenesis-related protein10(dbj|AB372561.1) GGTCAGGCCTCAAGCTATCAACAGGGCCTCCGTCTCCTT 56103 TIP2;1 V.vinifera aquaporinTIP2;1(gb|EF364439.1) GCATCATTGCACCCATTGCGCCTGCAGCCAGGATGTT 5961 CYSP V.vinifera cysteineprotease(gb|EU280160.1) CCTCGCAGGAGGAGCACGATCCGGCGCAGGTTTGC 5421 ERF4 V.aestivalis putativeethyleneresponsefactor 4(gb|AY484580.1) TCATCACTGCAACTCATCCATTACAATCTTCGGCCTCTGA 101114 STS5 V.vinifera stilbenesynthase5(gb|AY670312.1) CGCTCAAGGGAGGAAAGACAAGCCAAACAAAACACCCCAATC 581218 THXthioredoxinx[Populustrichocarpa] (XP_002310066.1) TGCTCAGGAATACGGGGACAGATCGCGGGTTTGCATCAT 61-39-2 SHM1 A.thaliana serinehydroxymethyltransferase 1(ref|NM_119954.3) TGTTCATCAGGTCAGCCAGTTTTGCGTCGAATTGCAGCAAGAT 63-2-2 HypPHypotheticalproteinLOC100264849 TGCCCCTACCCTTGTGACAGATCAAAATGGCTCATCGGAA 58-5-3 GLO V.pseudoreticulata glyoxaloxidase(gb| D201181.1) TCCCAACGCCGGTATAGCACCGTGCCGTAACGTGTGA 54-5-1 ClpP Caricapapaya ATP-dependentClpprotease proteolyticsubunit(gb|DQ159405.1|) GGGCGCCGGACAAGATTTGCAAATCATCCCTAATGGA 55-2-2 Table5Listoffirsttenpathwaysforup-anddownregulatedEDGsPathwaytermPathwayIDDEGstestedPvalueQvalue PathwaysforupregulatedDEGs Ribosomeko0301053(4.36%)0.00040.0406 Aminosugarandnucleotidesugarmetabolismko0052025(2.06%)0.00100.0563 Glycolysis/Gluconeogenesisko0001028(2.3%)0.00430.1660 Biosynthesisofalkaloidsderivedfromhistidineandpurineko0106531(2.55%)0.01260.3636 Biosynthesisofalkaloidsderivedfromornithine,lysineandnicotinicacidko0106435(2.88%)0.02070.4459 Starchandsucrosemetabolismko0050049(4.03%)0.02330.4459 Biosynthesisofalkaloidsderivedfromshikimatepathwayko0106339(3.21%)0.03610.5868 N-Glycanbiosynthesisko0051010(0.82%)0.05280.5868 Fructoseandmannosemetabolismko0005114(1.15%)0.05600.5868 Selenoaminoacidmetabolismko0045011(0.91%)0.05870.5868 PathwaysfordownregulatedDEGs Photosynthesisko0019520(3.14%)9.9613e-060.0011 Photosynthesis-antennaproteinsko001966(0.94%)4.2252e-050.0023 Folatebiosynthesisko007905(0.78%)0.00020.0064 Nicotinateandnicotinamidemetabolismko007605(0.78%)0.00070.0125 Fructoseandmannosemetabolismko0005113(2.04%)0.00070.0125 Carbonfixationinphotosyntheticorganismsko0071013(2.04%)0.00070.0125 Pyruvatemetabolismko0062014(2.2%)0.00140.0210 Polyketidesugarunitbiosynthesisko005234(0.63%)0.00160.0210 Purinemetabolismko0023021(3.3%)0.00180.0215 Biosynthesisofalkaloidsderivedfromhistidineandpurineko0106521(3.3%)0.00250.0270 Wu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page9of16

PAGE 10

bindingprotein,D-galactonatetransporter,peptidetransporter),transcription(ccaat-bindingtranscriptionfactor, AP2/ERFdomain-containingtr anscriptionfactor,mutator-liketransposase-likepro tein),andproteinmetabolism(ubiquitin-proteinligase,50Sribosomalprotein,Slocus-specificglycoproteinS13precursor,Rab5-interactingprotein).Twonovelgenes(nectarprotein1,vernalization-insensitiveprotein)andsomegenesencoding hypotheticalproteins(LOC100244011,LOC100258240, LOC100249110)werealsoidentifiedfromthePVinducedrareDEGs.Amongthe608raretranscriptspresentmoreinCONthanINF,69werenotdetectedatall intheINFlibrary.Mostofthesetranscriptshavepredicatedbiologicalfunctionsin growthregulation(growth regulatorprotein,A-typecyclin,auxinresponsefactor8), transport(ATP-bindingcassettetransporter,AWPM-19likemembranefamilyprot ein,copper-transporting atpasep-type),signaltransduction(serine-threonineproteinkinase,leucine-richrepeatfamilyprotein,calciumbindingEFhandfamilyprotein,calcium-dependent phospholipidbinding),andmetabolism(galacturonosyltransferase6,methylenetetrahydrofolatedehydrogenase, ironionbinding/oxidoreduct ase,trehalose-6-phosphate synthase,senescence-associatedprotein). PathwayenrichmentanalysisrevealedthemostsignificantlyaffectedpathwaysduringthePVinfectionin “ Zuoshan-1 ” .Itisnotsurprisingthatthe “ ribosomerelated ” pathwaywasthemostaffectedfortheDEGs morecommoninINFlibrary.Thisfindingimpliesthat thegrapevineutilizesnewribosomesorchangesinribosomecomponentstohelpsynthesizeadditionalproteins, suchasPRproteins,toprotectitselffromthepathogen attack.Thesecondaffectedpathwaywasthe “ amino sugarandnucleotidesugarmetabolism ” pathway.Inthis pathwaygenesencodingchitinaseweremoreprevalent intheINFthantheCONlibrary.Inaddition,genes requiredforcellwallbiosynthesiswerealsoaffected, suchasD-xylansynthase,UDP-glucosedehydrogenase, andUDP-glucose4,6-dehydratase.Theseenzymesare involvedintheinterconversionofnucleotidesugars,and mayregulateglycosylationpatternsinresponseto pathogen,therebylinkingsi gnalingwithprimarymetabolismandthedynamicsoftheextracellularmatrix. Theothernoticeablepathwayswithalargeamountof DEGsassociatedwithPVinfectionwerestarchand sucrosemetabolism,secondarymetabolism,planthormonebiosynthesis,andsplicesome-associatedproteins. ForDEGslessprevalentininfectedvs.controllibraries, therewassignificantenrichmentfortranscriptsassociatedwithphotosynthesis.Thisresultwassimilarto thereportsofPolesanietal[28,31].PhotosystemIproteins(PsaA,PsaB,PsaC),photosystemIIproteins(PsbB, PsbD,PsbO,PsbP,PsbS),cytochormeb6/fcomplex (PetD,PetN)andF-typeATPase(beta,alpha,delta,a,b) wereallsubstantiallylowerinabundanceinINF librariescomparedtoCONlibraries.Thereductionof photosynthesiswaspossiblyduetotheincreaseofinvertaseactivityinnucleotidesugarmetabolismpathway. Invertasewouldcleavesucroseintohexosesugarsand theiraccumulationinhibitstheCalvincycle. Itwasobservedthat251tagsidentifiedinINFlibrary werehomologoustotheoomycete,indicatingthatthey maybelongtoPVtranscripts,predictablynotingthe presenceofthepathogen.ManyoftheseputativePV transcriptscorrespondedtogenesinvolvedinprotein metabolism(16S,18S,26S,28Sand60Sribosomalproteinsubunits)asarequirem entforproteinsynthesisin thepathogenduringtheplant-pathogeninteraction. Manyhousekeepinggenes(alpha-tubulin,elongation factor1alpha,ubiquitinandheatshockprotein70)and genesrelatedtoimmuneresponse(spike1proteinand cyclophilin)werealsodetected.SeveralPVtranscripts showedsimilaritytoenzyme sinvolvedincarbohydrate andaminoacidmetabolism(chlorophyllapoprotein, aspartateaminotransferase,glutaminesynthetaseand hyaluronoglucosaminidase-4),energyproduction(ATP synthasesubunitB,glyceraldehyde-3-phosphatedehydrogenase,phosphoenolp yruvatecarboxykinaseand nitratereductase),andcellulartransport(transportin1, K+channelproteinandcalmodulin).TranscriptsmoreabundantininfectedleavesAsetoftranscriptswereclearlymoreabundantintissue arisingafterPVinfectioncomparedtocontrol.This grouppossiblycontainselementsthatconferresistance tothespreadofthepathogenin “ Zuoshan-1 ” .Among thesetranscripts,thoseexpressedatarelativelyhighlevel ininfectedtissueareofthemostinterest.Thesetranscriptslikelyencodegenesrespondingtothepathogenor genuinefactorsthatunderlie geneticresistance,which werebroadlygroupedintothefollowingcategoriesbased ontheirknownrolesinotherplantsystems.DefenseresponsegenesAmongdefenseresponsegene s,thaumatin-likeprotein [17],polygalacturonase-inhibitingprotein(PGIP)[32,33], harpin-inducedprotein-related[34,35],glutaredoxin [36,37]andbeta-glucosidase[38,39]havebeenwidely studiedinplantpathogenresistance.Thaumatin-like protein,likemanyotherdiseaseresistantproteins[40], isalsoinducedbyabioticstresses,whichmayindicate existenceofacrosstalkbetweenpathogenandabiotic stresses.Inthiscategory,tobaccomosaicvirus(TMV) response-relatedprotei n(+32foldinINFvsCON)is associatedwithTMVattackandmayalsoplayan importantroleinDMresistanceofgrape.Wu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page10of16

PAGE 11

TransportThreetranscriptswereassociatedwithtransportfunction.Multidrugresistancepumpproteins(+121foldin INFvsCON)andmultidrugresistanceABCtransporter (+25foldinINFvsCON)arewellknowntransportersin clinicalstudyforbacteriainfectionofhuman[41].Such transportersalsohavebeenisolatedfromplants,suchas Coptisjaponica [42].Theytransportseveralcompounds associatedwithmultidrug(an tibiotic)resistancewhich caninhibitpathogeninfect ioninanimalmodel[41,43]. Anothergeneidentifiedtobetransportrelatedismitochondrialdicarboxylatecarrierprotein(+38foldinINF vsCON)whichmightbeinvolvedintheexcretionof organicacidsandrhizotoxicaluminumtolerance[44].SignaltransductionTherewerefourteentranscriptsinourresultsassociated withsignaltransducti on.Twocamefromgenes (GSVIVT00030628001,GSVIVT00030574001)encoding leucine-richrepeatreceptor-likeproteinkinaseswhich weremoreprevalent(145and20fold)intheINFlibrary thanincontrol.Moleculesthatindicatethepresenceof pathogen(elicitors)activatehostreceptorsandthat rapidlygenerateaninternalsignalthattriggersearly defenseresponses[45].Varioussignalspresentedinour results,includingphytohormoneslikeABAandethylene,aswellasintracellularmessengerslikecalcium, phosphoinositideandkinases,havebeenproposed toregulateplantresponsesinadverseenvironmental conditionsandthuscontributetothecoordinationof plantstressphysiology[46].Transcriptsrepresenting threekinase-encodinggenes(GSVIVT00030628001, GSVIVT00006178001,GSVIVT00019504001)werepresent52-145foldhigherinINFthanCON,andhave beenwidelydocumentedassignalingfactorsinmany stresses[47-50]andsenescence[51].Fourtranscripts(GSVIVT00002706001,GSVIVT00020989001, GSVIVT00036549001,GSVIVT00002973001)were foundtobemoreabundant(27to39fold)inINFthan CON,andwereassociatedwithcalciumsignalingpathway.Allofthesearealsoinducedbysenescence[52] andmanystresses[53,54].Nodulin-likeprotein(+23 foldinINFvsCON)inducedinfungalpathogentreatment[55]anddrought/heatcombinationstress[40]has beenshowntobeinvolvedinsalicylicacid(SA)signalingpathway[56].ARING-H2gene(+22foldinINFvs CON)hasdemonstratedregulatoryfunctioninABAsignaling[57],droughttolerance[57],regulationofgrowth anddefenseresponsesagainstabiotic/bioticstresses [58].Ethylene-regulatedtranscript2(ERT2)(+34foldin INFvsCON)isinvolvedinethyleneresponse ‘ circuit ’ includingethylenesynthesis,perception,signaltransductionandregulationofgeneexpression[59].ThePAR-1a (photoassimilate-responsive)protein(+22foldinINFvs CON)isaserine/threoninekinasewithdiversephosphorylationtargetsandhasbeenreportedtobeinduced byinfectionwithpotatovirusY[60,61].TranscriptionEleventranscriptsassociatedwithtranscriptionwere21 to60foldmoreabundantinINFthanCONlibraries. Transcriptsannotatedaszinc-fingerprotein1,DREB protein,AP2domainclasstranscriptionfactor,basic helix-loop-helixprotein,CBF4(C-repeatbindingfactor 4),jasmonateZIMdomain1,GRASfamilytranscription factor,andWRKYtranscriptionfactor21wereallpresentathighersteadystatelevelsininfectedtissue.They havebeendocumentedtoplayimportantrolesin respondingtophytohormonestasis,pathogenattackand environmentalstresses[62-69].Metabolism SynthesisofthehormonesS-adenosyl-L-methionine(GSVIVT00024884001)and9cis-epoxycarotenoiddioxygenase1(NCED1) (GSVIVT00000988001)aretranscriptsrelatedtosynthesisofplanthormones,andwerefoundmorefrequently (97and62fold,respectively)intheINFlibrary.S-adenosyl-L-methionineistheprecursorofethylene[70] whichparticipatesinregulationofgrowth,development, andresponsestostressandpathogenattackinplants [71].NCEDisanimportantenzymeinsynthesizingthe phytohormoneABAwhichplaysacentralrolein responsestopathogenattack[72].ProteinmetabolismTwelvetranscriptsrelatedt oproteinmetabolismwere moreabundantintheINFlibrary,21foldto72fold. Amongthem,ubiquitin-proteinligase(GSVIVT00028930001,GSVIVT00035825001),spottedleafprotein (GSVIVT00017518001,GSVIVT00028839001)andf-box familyprotein(GSVIVT00022245001,GSVIVT00009741001)wereidentified,andrepresentproteinsinvolved inubiquitinationandsubsequentdegradationoftarget proteins.Asparticprotein asenepenthesin-1precursor (GSVIVT00032938001)isexpressedathigherlevelin “ Nipponbare ” inresponsetophosphorusdeficiency[73] andisolatedfromsalt-stresswildrice “ Porteresiacoarctata “ [74].Proteinphosphatase2c(GSVIVT00024072001, GSVIVT00024235001,GSVIVT00001432001)regulates numerousABAresponses[75,76].Nucleicacidbinding proteins(GSVIVT00024387001)controlgenesexpression inresponsetooxidativestress[77],ABAtreatment[78] andabioticstresses[79].E xocystsubunitEXO70family proteinH4(GSVIVT00023109001)hasbeenshowntobe involvedintheexocyticpathway,whichsortsnewly synthesizedproteinsfromtheendoplasmicreticulumto theirfinaldestinationatthelysosome,vacuoleorplasma membrane[80].Wu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page11of16

PAGE 12

SecondarymetabolismThissubcategorycontained 4genes,includingahigher leveloftropinonereductase(GSVIVT00018424001,+48 foldinINFvsCON)transcriptininfectedleaves,consistent withpreviousreportsshowingittobemoreabundantafter pathogeninfection[81].Isoflavonereductase-likeprotein3 (GSVIVT00019233001,+31foldinINFvsCON)alsohasa potentialpathogenresistancerolebecauseitisinvolvedin biosynthesisofisoflavonoidph ytoalexins[82],animportant productinresistancetopathogeninfection[83,84].UDPglucoseglucosyltransferase(GSVIVT00002450001,+24 foldinINFvsCON)andgalactinolsynthase (GSVIVT00019669001,+24foldinINFvsCON)are reportedtobeinducedbyabioticstresses[85,86].CellwallorganizationThreegeneswereclassifiedintothissubcategory.Cellulosesynthase-likeD1(GSVIVT00014029001,+31foldin INFvsCON)andbeta-expansin1aprecursor (GSVIVT00036225001,+27foldinINFvsCON)contributetocellwallsynthesisandmodification[87,88].The wound-inducedprotein(WIN2)(GSVIVT00007452001, +26foldinINFvsCON)withanti-fungalactivity[89] possessesadomainthatbindsPAMP(pathogen-associatedmolecularpatterns)elic itors(e.g.,chitin)[90]and isinducedinresponsetopathogen.Inaddition,other highlyexpressedmetabolicgenesintheINFsamples wereglucose-1-phosphat eadenylyltransferase (GSVIVT00036349001,+24foldinINFvsCON),cytochromeP450(GSVIVT00014730001,+70foldinINFvs CON)andserineacetyltransferase(GSVIVT00007984001,+30foldinINFvsCON).Thesetranscriptsare relatedtocarbohydratemetabolism,photosynthesisand cysteinesynthesis.Cysteinesynthesishasreportedto respondtooxidativestressbycalciumsignaling[91]. Eventhoughmostofthesegeneshavebeenreported tobebioticorabioticstressesrelated,sevenhigh expressedgenesintheinfectedleaveshavenotbeen previouslyreportedbeingassociatedwithstress.They werenotedasprotein-bindingprotein(GSVIVT00024408001,+87foldinINFvsCON),ATPP2-A2( Arabidopsisthaliana phloemprotein2-A2)(GSVIVT00023009001,+56foldinINFvsCON),putativeintegral membraneprotein(GSVIVT00014704001,+51foldin INFvsCON),putativephosphate-inducedprotein (GSVIVT00015203001,+229;GSVIVT00015200001, +37foldinINFvsCON),ATP-dependentDNAhelicase (GSVIVT00016166001,+36foldinINFvsCON),CW14 (GSVIVT00020834001,+23foldinINFvsCON),anda hypotheticalprotein(GSVIVT00017533001,+20foldin INFvsCON).TranscriptslessabundantininfectedleavesThemoststrikingfunctionsfortranscriptslessabundantininfectedtissuewerethoseassociatedwith metabolismanddefenseresponsetopathogenattack. FifteenDEGsweredetectedtobelessprevalentinthe INFlibrariesmorethan20foldcomparedtoCON, mostofwhich,suchas(-)-germacreneDsynthase[92], non-specificlipidtransferprotein[93],majorhistocompatibilitycomplex[94],thioredoxin[95],beta-cyano-alaninesynthase[96],expansin[97]andUDPglucosyltransferase[98]arereportedtobepositively associatedwithplantdefenseresponsestopathogen attack.However,ourdataindicatedthattheexpression levelofthesetranscriptswaslowerininfectedtissues. Anothertwotranscriptsthatwerelessprevalentin infectedtissue(GSVIVT00014727001,-35foldinINFvs CON;GSVIVT00014725001,-41inINFvsCON)belong tocytochromeP450familywithoxidativefunction.Interestingly,anovelgeneencodingmalesterility-relatedproteinwasalsoidentifiedinthisgroup,anditsfunction associatedwithDMresponsehasnotbeenclarified.ConclusionsSolexa-basedsequencingcanbeusedforanalyzingvariationingeneexpressionbetweentwosamples.Thegene expressionlevelin “ Zuoshan-1 ” leavesinfectedwithPV changedsignificantlyincomparisonwithcontrolleaves. Analysisofdifferentially-expressedgenesinvolvedinthe pathogeninfectionallowsdelineationofcandidategenes potentiallyrelevanttoDMresistanceingrapevines.MethodsPlantsmaterialandpathogeninfectionOne-year-old,certifiedvirus-freeseedlingsof “ Zuoshan-1 ” weregrownandmaintainedinthegreenhouseundera16hlight/8-hdarkphotoperiodat25C,85%relativehumidity.Controlplantsweremaintainedunderthesameconditions. P.viticola wascollectedfromsporulatedfieldleaves andusedfortheartificialinoculationsofsurface-sterilized leaves.Infectionswereconductedbydippingthefourth grapevineleavesinasuspensionof10,000sporangiaper mlpurewater.Theleaveswerecoveredwithplasticbags foronenighttoensurehighhumidity.Thefourthunfolded leaffromtheshootapexwasharvestedfromeachofthree vines,andthethreeleaveswerecombinedtorepresentone replicate.Threeindependentreplicateswerecollectedfor eachsample.Infectedleaveswerecollectedevery24hfor 9days.Controlsampleswereharvestedfromwater-treated leavesincubatedunderthesameconditions.PreparationofDigitalExpressionLibrariesSamplesfrominfectedleavesfrom4dto8dwere pooledforRNAisolationandlibraryconstruction. Comparablecontrolleavesweretreatedidenticallyand inparallel.TotalRNAwasisolatedfromtheleafmixtureusingamodificationoftheCTABmethodaspresentedbyMurrayandThompson[99].SequencetagWu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page12of16

PAGE 13

preparationwasdonewiththeDigitalGeneExpression TagProfilingKit(IlluminaInc;SanDiego,CA,USA) accordingtothemanufacturer ’ sprotocol(version2.1B). SixmicrogramsoftotalRNAwasextractedandmRNA waspurifiedusingbiotin-Oligo(dT)magneticbead adsorption.First-andsecond-strandcDNAsynthesis wasperformedaftertheRNAwasboundtothebeads. Whileonthebeads,doublestrandcDNAwasdigested with NlaIII endonucleasetoproduceabead-bound cDNAfragmentcontainingsequencefromthe3 ’ -most CATGtothepoly(A)-tail.These3 ’ cDNAfragments werepurifiedusingmagneticbeadprecipitationandthe Illuminaadapter1(GEXadapter1)wasaddedtonew5 ’ end.ThejunctionofIlluminaadapter1andCATGsite wasrecognizedby MmeI ,whichisaTypeIendonuclease(withseparatedrecognitionsitesanddigestion sites).Theenzymecuts17bpdownstreamoftheCATG site,producing17bpcDNAsequencetagswithadapter 1.Afterremoving3 ’ fragmentswithmagneticbeadprecipitation,theIlluminaadapter2(GEXadapter2)was ligatedto3 ’ endofthecDNAtag.ThesecDNAfragmentsrepresentedthetaglibrary.SolexasequencingSequencingwasperformedby “ HuaDaGene ” [100]with themethodofsequencingbysynthesis.APCRamplificationwith15cyclesusingPhusionpolymerase(Finnzymes,Espoo,Finland)wasperformedwithprimers complementarytotheadaptersequencestoenrichthe samplesforthedesiredfragments.Theresulting85base stripswerepurifiedby6%TBEPAGEGelelectrophoresis.Thesestripswerethendigested,andthesinglechainmoleculeswerefixedontotheSolexaSequencing Chip(flowcell).Eachmoleculegrewintoasingle-moleculeclustersequencingtemplatethroughinsituamplification.Fourcolor-labelednucleotideswereadded,and sequencingwasperformedwiththemethodofsequencingbysynthesis.Imageanalysisandbasecallingwere performedusingtheIlluminaPipeline,andcDNA sequencetagswererevealedafterpurityfiltering.The tagspassinginitialqualitytestsweresortedandcounted. Eachtunnelgeneratesmillionsofrawreadswithsequencinglengthof35bp(targettagsplus3 ’ adaptor).Each moleculeinthelibraryrepresentedasingletagderived fromasingletranscript.Sequenceannotation“ CleanTags ” wereobtainedbyfilteringoffadaptor-only tagsandlow-qualitytags(containingambiguousbases). Comparisonofthesequencesbyblastnwascarriedout usingthefollowingdatabases:NCBI[101],Genoscope GrapeGenomedatabase[25]andVBIMicrobialDatabase[26].Allcleantagswereannotatedbasedongrape referencegenes.Forconservativeandpreciseannotation, onlysequenceswithperfecthomologyor1ntmismatch wereconsideredfurther.Thenumberofannotatedclean tagsforeachgenewascalculatedandthennormalizedto TPM(numberoftranscriptspermillioncleantags) [30,102].Sequencesweremanuallyassignedtofunctional categoriesbasedontheanalysisofscientificliterature.Identificationofdifferentiallyexpressedgenes(DEGs)Arigorousalgorithmtoidentifydifferentiallyexpressed genesbetweentwosampleswasdeveloped[103].Pvalue wasusedtotestdifferentialtranscriptaccumulation.In theformulabelowthetotalcleantagnumberofthe CONlibraryisnotedasN1,andtotalcleantagnumber ofINFlibraryasN2;geneAholdsxtagsinCONandy tagsinINFlibrary.TheprobabilityofgeneAexpressed equallybetweentwosamplescanbecalculatedwith: Pyx xy xyy xy(|) ()! !!()= + + ++N N N N 2 1 12 1 1FDR(FalseDiscoveryRate)wasappliedtodetermine thethresholdofPValueinmu ltipletestsandanalyses [104].An “ FDR<0.001andtheabsolutevalueoflog2Ratio 1 ” wasusedasthethresholdtojudgethesignificanceofgeneexpressiondifference.Real-timeRT-PCRanalysisSampleswerepreparedusingthesamemethodmentionedaboveandtotalRNAwasisolatedfromtheleaf mixture.Experimentswerecarriedoutonthreeindependentbiologicalreplicateseachcontainingthreetechnicalreplicates.First-strandcDNAwassynthesizedfrom 650ngDNase(Promega,Mad ison,Wisconsin,USA) -treatedtotalRNAusing “ ImProm-IITMReverseTranscriptase ” (Promega,Madison,Wisconsin,USA)and diluted20foldastemplate.Specificprimerpairsof twelverandomlyselectedgenesweredesigned(Table4) usingPrimerExpress3.0andtestedbyReal-timeRTPCR.Primersspecificfor V.vinifera actin(Forward: AATGTGCCTGCCATGTATGT;Reverse:TCACACCATCACCAGAATCC)wereusedforthenormalization ofreactions.ExperimentswerecarriedoutusingPower SYBRGreenPCRMasterMix(AppliedBiosystems, Warrington,UK)inaStepOne ™ Real-TimePCRSystem (AppliedBiosystems).T hereactionvolumewas20 l, including10 lPowerSYBRGreenPCRmastermix,0.9 l10mMprimer,2.0 lcDNAsampleand6.20 l dH2O.Thefollowingthermalcyclingprofilewasused: 95C10min;40cyclesof95Cfor15s,59Cfor1min; 95Cfor15s,60Cfor1min,95Cfor15s.Datawere analyzedusingStepOne ™ SoftwareVersion2.0(Applied Biosystems).Actinexpress ionwasusedasaninternalWu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page13of16

PAGE 14

controltonormalizealldata.ThefoldchangeinmRNA expressionwasestimatedusingthresholdcycles,bythe CTmethod[105].PathwayEnrichmentAnalysisofDEGsPathwayenrichmentanalysisbasedonKEGG[106]was usedtoidentifysignificantlyenrichedmetabolicpathwaysorsignaltransductionpathwaysindifferentiallyexpressedgenescomparingwiththewholegenome background.Thecalculatingformulais: P =Š Š Š = Š10 1M i NM ni N ni mwhereNisthenumberofallgenesthatwithKEGG annotation,nisthenumberofDEGsinN,Misthe numberofallgenesannotatedtospecificpathways,and misnumberofDEGsinM.QvaluewasusedfordeterminingthethresholdofPValueinmultipletestand analysis[107].PathwayswithQvalue<0.05aresignificantlyenrichedinDEGs.AdditionalmaterialAdditionalfile1:Completelistoftranscriptsattributedto P. viticola Additionalfile2:Completelistofinvolvedpathwaysfor upregualtedDEGs .PathwayswithQvalue<0.05aresignificantly enrichedforupregulatedDEGs. Additionalfile3:Completelistofinvolvedpathwaysfor downregualtedDEGs .PathwayswithQvalue<0.05aresignificantly enrichedfordownregulatedDEGs. Additionalfile4:Listof “ Zuoshan-1 ” transcriptsupregulatedforat least2foldinINFlibrary .Twofoldandmoreupregualtedgeneswith pathwayannotationinINFlibrarywerelistedindifferentcategories. Additionalfile5:Listof “ Zuoshan-1 ” transcriptsdownregulatedfor atleast2foldinINFlibrary .Twofoldandmoredownregualtedgenes withpathwayannotationinINFlibrarywerelistedindifferentcategories. Abbreviations AFLP:AmplifiedFragmentLengthPolymorphism;BLAST:BasicLocal AlignmentSearchTool;cDNA:ComplementaryDNA;CTAB: Hexadecyltrimethylammoniumbromide;DEGs:differentiallyexpressed transcripts;NCBI:NationalCenterforBiotechnologyInformation. Acknowledgements Thisresearchwassupportedbythe “ 948 ” Program,MinistryofAgriculture, China(grantno.2006-G26)andNationalGrapeIndustryTechnologySystem (grantno.nycytx-30-zy-05).WethankJunWangforgenerousgiftof “ Zuoshan-1 ” propagationmaterial,and “ HuaDaGene ” fortechnicalassistance throughoutthedataanalysismanuscriptpreparation. Authordetails1CollegeofFoodScienceandNutritionalEngineering,ChinaAgricultural University,Beijing,100083,China.2HorticulturalSciencesDepartmentand theGraduatePrograminPlantMolecularandCellularBiology,Universityof Florida,Gainesville,FL,32611,USA.3SchoolofInformation,Universityof SouthFloridaTampa,FL,33620,USA.4CenterforViticultureandSmallFruit Research,FloridaA&MUniversity,Tallahassee,FL,32317,USA. Authors ’ contributions JWandYLZcarriedouttheplantmaterialpreparation,PVinfection,RNA extraction,preparationofdigitalexpressionlibraries,sequenceanalysis,and contributedtodatainterpretationandmanuscriptwriting.HQZparticipated inPVinfectionandRNAextraction.HHcontributedtosequenceanalysis. KMFparticipatedindatainterpretationandmanuscriptmodification.JL conceivedthestudy,ledtheexperimentdesignandcoordinatedallthe researchactivities,contributedtointerpretationofthedata,manuscript writingandmodification.Allauthorsreadandapprovedthefinal manuscript. Received:12January2010Accepted:28October2010 Published:28October2010 References1.PearsonRC,GoheenAC: CompendiumofGrapeDiseases. APSPress;1988. 2.SpencerDM: TheDownymildews. London:AcademicPress;1981. 3.KieferB,RiemannM,BucheC,KassemeyerHH,NickP: Thehostguides morphogenesisandstomataltargetinginthegrapevinepathogen Plasmoparaviticola Planta 2002, 215 :387-393. 4.StaudtG,KassemeyerHH: Evaluationofdownymildewresistancein variousaccessionsofwild Vitis species. Vitis 1995, 34 :225-228. 5.BrownMV,MorreJN,FennP,McNewRW: Evaluationofgrapegermplasm fordownymildewresistance. FruitVarietiesJournal 1999, 53 :22-29. 6.OlmoHP: Vinifera x rotundifolia hybridsaswinesgrapes. AmJEnolVitic 1971, 22 :87-91. 7.DaiGH,AndaryC,Mondolot-CossonL,BoubalsD: Histochemicalstudies ontheinteractionbetweenthreespeciesofgrapevine, Vitisvinifera V. rupestris and V.rotundifolia andthedownymildewfungus, Plasmopara viticola PhysiolMolPlantPathol 1995, 46 :177-188. 8.UngerS,BucheC,BosoS,KassemeyerHH: TheCourseofColonizationof TwoDifferent Vitis Genotypesby Plasmoparaviticola Indicates CompatibleandIncompatibleHost-PathogenInteractions. Phytopathology 2007, 97 :780-786. 9.Diez-NavajasAM,Wiedemann-MerdinogluS,GreifC,MerdinogluD: Nonhostversushostresistancetothegrapevinedownymildew, Plasmoparaviticola ,studiedatthetissuelevel. Phytopathology 2008, 98 :776-780. 10.MerdinogluD,Wiedemann-MerdinogluS,CosteP,DumasV,HaettyS, ButterlinG,GreifC: GeneticAnalysisofDownyMildewResistance Derivedfrom Muscadiniarotundifolia ActaHort 2003, 603 :451-456. 11.HenanffGL,HeitzT,MestreP,MuttererJ,WalterB,ChongJ: Characterizationof Vitisvinifera NPR1homologsinvolvedinthe regulationofPathogenesis-Relatedgeneexpression. BMCPlantBiology 2009, 9 :54-67. 12.KortekampA: Expressionanalysisofdefence-relatedgenesingrapevine leavesafterinoculationwithahostandanon-hostpathogen. Plant PhysiolBiochem 2006, 44 :58-67.13.SlaughterAR,HamiduzzamanMM,GindroK,NeuhausJM,Mauch-ManiB: Beta-aminobutyricacid-inducedresistanceingrapevineagainstdowny mildew:involvementofpterostilbene. EurJPlantPathol 2008, 122 :185-195. 14.KiniKR,VasanthiNS,ShettyHS: Inductionofbeta-1,3-glucanasein SeedlingsofPearlMilletinResponsetoInfectionby Sclerospora graminicola EuropeanJournalofPlantPathology 2000, 106 :267-274. 15.RichterH,PezetR,ViretO,GindroK: Characterizationof3newpartial stilbenesynthasegenesoutofover20expressedin Vitisvinifera during theInteractionwith Plasmoparaviticola PhysiologicalandMolecularPlant Pathology 2006, 67 :248-260. 16.NagarathnaKC,ShettySA,ShettyHS: PhenylalanineAmmoniaLyase ActivityinPearlMilletSeedlingsanditsRelationtoDownyMildew DiseaseResistance. JournalofExperimentalBotany 1993, 44 :1291-1296. 17.PunjaZK: Geneticengineeringofplantstoenhanceresistancetofungal pathogens-areviewofprogressandfutureprospects. PlantPathol 2001, 23 :216-235. 18.YamamotoT,IketaniH,IekiH,NishizawaY,NotsukaK,HibiT,HayashiT, MatsutaN: TransgenicgrapevineplantsexpressingaricechitinasewithWu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page14of16

PAGE 15

enhancedresistancetofungalpathogens. PlantCellReports 2000, 19 :639-646. 19.VidalJR,KikkertJR,WallacePG,ReischBI: High-efficiencybiolisticcotransformationandregenerationof ‘ Chardonnay ’ ( Vitisvinifera L.) containing npt-II andantimicrobialpeptidegenes. PlantCellRep 2003, 22 :252-260. 20.BornhoffBA,HarstM,ZyprianE,TopferR: Transgenicplantsof Vitis vinifera cv.Seyvalblanc. PlantCellRep 2005, 24 :433-438. 21.FanCH,PuN,WangXP,WangYJ,FangL,XuWR,ZhangJX: Agrobacterium -mediatedgenetictransformationofgrapevine( Vitis vinifera L.)withanovelstilbenesynthasegenefromChinesewild Vitis pseudoreticulata PlantCellTissOrganCult 2008, 92 :197-206. 22.AngarawaiII,KadamsAM,BelloD: GeneEffectsControllingHeritabilityof DownyMildewResistanceinNigerianElitePearlMilletLines. World JournalofAgriculturalSciences 2008, 4 :545-549. 23.ZyprianE,WelterLJ,AkkurtM,EbertS,SalakhutdinovI,Gktrk-BaydarN, EibachR,TpferR: CandidategenesmappingandcomparativeQTL analysisforpowderyanddownymildewresistanceingrape. ActaHort 2009, 827 :535-538. 24.LiX,ShenY,GeY,ZangP,AiJ,JinS: Studyforevaluatinginfectingdiseasepropertyon plasmoparaviticola tothegermplasmresourcesof vitisamurensis rupr. SpecialWildEconomicAnimalandPlantResearch 1999, 2 :10-13. 25. GenoscopeGrapeGenomedatabase. [http://www.cns.fr/spip/Vitis-niniferae.html]. 26. VBIMicrobialDatabase. [http://phytophthora.vbi.vt.edu/]. 27.KeimeC,SemonM,MouchiroudD,DuretL,GandrillonO: Unexpected observationsaftermappingLongSAGEtagstothehumangenome. BMC Bioinformatics 2007, 8 :154. 28.PolesaniM,DesarioF,FerrariniA,ZamboniA,PezzottiM,KortekampA, PolverariA: cDNA-AFLPanalysisofplantandpathogengenesexpressed ingrapevineinfectedwith Plasmoparaviticola BMCGenomics 2008, 9 :142-156. 29.FigueiredoA,FortesAM,FerreiraS,SebastianaM,ChoiYH,SousaL,AcioliSantosB,PessoaF,VerpoorteR,PaisMS: Transcriptionalandmetabolic profilingofgrape( Vitisvinifera L.)leavesunravelpossibleinnateresistanceagainstpathogenicfungi. JExpBot 2008, 59 :3371-3381. 30.tHoenPA,AriyurekY,ThygesenHH,VreugdenhilE,VossenRH,de MenezesRX,BoerJM,vanOmmenGJ,denDunnenJT: Deepsequencingbasedexpressionanalysisshowsmajoradvancesinrobustness, resolutionandinter-labportabilityoverfivemicroarrayplatforms. Nucleic AcidsRes 2008, 36 :e141. 31.PolesaniM,BortesiL,FerrariniA,ZamboniA,FasoliM,ZadraC,LovatoA, PezzottiM,DelledonneM,PolverariA: Generalandspecies-specific transcriptionalresponsestodownymildewinfectioninasusceptible ( Vitisvinifera )andaresistant( V.riparia )grapevinespecies. BMC Genomics 2010, 11 :117. 32.DiMatteoA,BoniventoD,TsernoglouD,FedericiL,CervoneF: Polygalacturonase-inhibitingprotein(PGIP)inplantdefence:astructural view. Phytochemistry 2006, 67 :528-533. 33.JoubertDA,KarsI,WagemakersL,BergmannC,KempG,VivierMA,van KanJA: Apolygalacturonase-inhibitingproteinfromgrapevinereduces thesymptomsoftheendopolygalacturonaseBcPG2from Botrytis cinerea in Nicotianabenthamiana leaveswithoutanyevidenceforin vitrointeraction. MolPlantMicrobeInteract 2007, 20 :392-402. 34.DittRF,KerrKF,deFigueiredoP,DelrowJ,ComaiL,NesterEW: The Arabidopsisthaliana transcriptomeinresponseto Agrobacterium tumefaciens MolPlantMicrobeInteract 2006, 19 :665-681. 35.JolivetK,GrenierE,BouchetJP,EsquibetM,KerlanMC,CaromelB, MugnieryD,LefebvreV: Identificationofplantgenesregulatedin resistantpotato Solanumsparsipilum duringtheearlystagesofinfection by Globoderapallida Genome 2007, 50 :422-427. 36.NdamukongI,AbdallatAA,ThurowC,FodeB,ZanderM,WeigelR,GatzC: SA-inducible Arabidopsis glutaredoxininteractswithTGAfactorsand suppressesJA-responsivePDF1.2transcription. PlantJ 2007, 50 :128-139. 37.WangZ,XingS,BirkenbihlRP,ZachgoS: Conservedfunctionsof Arabidopsis andriceCC-typeglutaredoxinsinflowerdevelopmentand pathogenresponse. MolPlant 2009, 2 :323-335. 38.BeffaRS,NeuhausJM,MeinsFJr: Physiologicalcompensationinantisense transformants:specificinductionofan “ ersatz ” glucanendo-1,3-betaglucosidaseinplantsinfectedwithnecrotizingviruses. ProcNatlAcadSci USA 1993, 90:8792-8796. 39.MattiacciL,DickeM,PosthumusMA: beta-Glucosidase:anelicitorof herbivore-inducedplantodorthatattractshost-searchingparasitic wasps. ProcNatlAcadSciUSA 1995, 92 :2036-2040. 40.RizhskyL,LiangH,ShumanJ,ShulaevV,DavletovaS,MittlerR: When defensepathwayscollide.Theresponseof Arabidopsis toacombination ofdroughtandheatstress. PlantPhysiol 2004, 134 :1683-1696. 41.PiddockLJ: Multidrug-resistanceeffluxpumps-notjustforresistance. NatRevMicrobiol 2006, 4 :629-636. 42.ShitanN,BazinI,DanK,ObataK,KigawaK,UedaK,SatoF,ForestierC, YazakiK: InvolvementofCjMDR1,aplantmultidrug-resistance-typeATPbindingcassetteprotein,inalkaloidtransportin Coptisjaponica Proc NatlAcadSciUSA 2003, 100 :751-756. 43.MorschhauserJ: Regulationofmultidrugresistanceinpathogenicfungi. FungalGenetBiol 47 :94-106. 44.DengW,LuoK,LiZ,YangY: Molecularcloningandcharacterizationofa mitochondrialdicarboxylate/tricarboxylatetransportergenein Citrus junos responsetoaluminumstress. MitochondrialDNA 2008, 19 :376-384. 45.BlumwaldE,AharonGS,LamBCH: Earlysignaltransductionpathwaysin plant-pathogeninteractions. TrendsinPlantScience 1998, 3 :342-346. 46.ZhuJK: Saltanddroughtstresssignaltransductioninplants. AnnuRev PlantBiol 2002, 53 :247-273. 47.XiongL,LeeB,IshitaniM,LeeH,ZhangC,ZhuJK: FIERY1encodingan inositolpolyphosphate1-phosphataseisanegativeregulatorofabscisic acidandstresssignalingin Arabidopsis GenesDev 2001, 15 :1971-1984. 48.TangD,ChristiansenKM,InnesRW: Regulationofplantdiseaseresistance, stressresponses,celldeath,andethylenesignalingin Arabidopsis bythe EDR1proteinkinase. PlantPhysiol 2005, 138 :1018-1026. 49.YouMK,OhSI,OkSH,ChoSK,ShinHY,JeungJU,ShinJS: Identificationof putativeMAPKkinasesin Oryzaminuta and O.sativa responsiveto bioticstresses. MolCells 2007, 23 :108-114. 50.PitzschkeA,SchikoraA,HirtH: MAPKcascadesignallingnetworksinplant defence. CurrOpinPlantBiol 2009,12 :421-426. 51.ZhouC,CaiZ,GuoY,GanS: An arabidopsis mitogen-activatedprotein kinasecascade,MKK9-MPK6,playsaroleinleafsenescence. PlantPhysiol 2009, 150 :167-177. 52.EspinozaC,MedinaC,SomervilleS,Arce-JohnsonP: Senescenceassociatedgenesinducedduringcompatibleviralinteractionswith grapevineand Arabidopsis JExpBot 2007, 58 :3197-3212. 53.KnightH: Calciumsignalingduringabioticstressinplants. IntRevCytol 2000, 195 :269-324. 54.LiA,WangX,LesebergCH,JiaJ,MaoL: Bioticandabioticstress responsesthroughcalcium-dependentproteinkinase(CDPK)signaling inwheat( Triticumaestivum L.). PlantSignalBehav 2008, 3 :654-666. 55.SicilianoV,GenreA,BalestriniR,DewitPJ,BonfanteP: Pre-Penetration ApparatusFormationDuringAMInfectionisAssociatedWithaSpecific TranscriptomeResponseinEpidermalCells. PlantSignalBehav 2007, 2 :533-545. 56.Peleg-GrossmanS,GolaniY,KayeY,Melamed-BookN,LevineA: NPR1 proteinregulatespathogenicandsymbioticinteractionsbetween Rhizobium andlegumesandnon-legumes. PLoSOne 2009, 4 :e8399. 57.KoJH,YangSH,HanKH: Upregulationofan Arabidopsis RING-H2gene, XERICO ,confersdroughttolerancethroughincreasedabscisicacid biosynthesis. PlantJ 2006, 47 :343-355. 58.LiuH,ZhangH,YangY,LiG,WangX,BasnayakeBM,LiD,SongF: FunctionalanalysisrevealspleiotropiceffectsofriceRING-H2finger proteingene OsBIRF1 onregulationofgrowthanddefenseresponses againstabioticandbioticstresses. PlantMolBiol 2008, 68 :17-30. 59.ZhongGY,BurnsJK: Profilingethylene-regulatedgeneexpressionin Arabidopsisthaliana bymicroarrayanalysis. PlantMolBiol 2003, 53 :117-131. 60.GuoS,KemphuesKJ: par-1 ,agenerequiredforestablishingpolarityin C. elegans embryos,encodesaputativeSer/Thrkinasethatis asymmetricallydistributed. Cell 1995, 81 :611-620. 61.HerbersK,MonkeG,BadurR,SonnewaldU: Asimplifiedprocedureforthe subtractivecDNAcloningofphotoassimilate-respondinggenes:isolation ofcDNAsencodinganewclassofpathogenesis-relatedproteins. Plant MolBiol 1995, 29 :1027-1038. 62.TakatsujiH:Zinc-fingertranscriptionfactorsinplants. CellMolLifeSci 1998, 54 :582-596.Wu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page15of16

PAGE 16

63.AgarwalPK,AgarwalP,ReddyMK,SoporySK: RoleofDREBtranscription factorsinabioticandbioticstresstoleranceinplants. PlantCellRep 2006, 25 :1263-1274. 64.PreM,AtallahM,ChampionA,DeVosM,PieterseCM,MemelinkJ: The AP2/ERFdomaintranscriptionfact orORA59integratesjasmonicacid andethylenesignalsinplantdefense. PlantPhysiol 2008, 147 :1347-1357. 65.DuekPD,FankhauserC: bHLHclasstranscriptionfactorstakecentrestage inphytochromesignalling. TrendsPlantSci 2005, 10 :51-54. 66.HaakeV,CookD,RiechmannJL,PinedaO,ThomashowMF,ZhangJZ: TranscriptionfactorCBF4isaregulatorofdroughtadaptationin Arabidopsis PlantPhysiol 2002, 130 :639-648. 67.ChungHS,KooAJ,GaoX,JayantyS,ThinesB,JonesAD,HoweGA: Regulationandfunctionof Arabidopsis JASMONATEZIM-domaingenes inresponsetowoundingandherbivory. PlantPhysiol 2008, 146 :952-964. 68.SmitP,RaedtsJ,PortyankoV,DebelleF,GoughC,BisselingT,GeurtsR: NSP1oftheGRASproteinfamilyisessentialfor rhizobial Nodfactorinducedtranscription. Science 2005, 308 :1789-1791. 69.EulgemT,RushtonPJ,RobatzekS,SomssichIE: TheWRKYsuperfamilyof planttranscriptionfactors. TrendsPlantSci 2000, 5 :199-206. 70.RojeS: S-Adenosyl-L-methionine:beyondtheuniversalmethylgroup donor. Phytochemistry 2006, 67 :1686-1698. 71.BleeckerAB,KendeH: Ethylene:agaseoussignalmoleculeinplants. AnnuRevCellDevBiol 2000, 16 :1-18. 72.deTorres-ZabalaM,TrumanW,BennettMH,LafforgueG,MansfieldJW, RodriguezEgeaP,BogreL,GrantM: Pseudomonassyringae pv.tomato hijacksthe Arabidopsis abscisicacidsignallingpathwaytocausedisease. EMBOJ 2007, 26 :1434-1443. 73.Pariasca-TanakaJ,SatohK,RoseT,MauleonR,WissuwaM: StressResponse VersusStressTolerance:ATranscriptomeAnalysisofTwoRiceLines ContrastinginTolerancetoPhosphorusDeficiency. Rice 2009, 2 :167-185. 74.SenguptaS,MajumderAL: Porteresiacoarctata (Roxb.)Tateoka,awild rice:apotentialmodelforstudyingsalt-stressbiologyinrice. PlantCell Environ 2010, 33 :526-542. 75.GostiF,BeaudoinN,SerizetC,WebbAA,VartanianN,GiraudatJ: ABI1 proteinphosphatase2Cisanegativeregulatorofabscisicacid signaling. PlantCell 1999, 11 :1897-1910. 76.VladF,RubioS,RodriguesA,SirichandraC,BelinC,RobertN,LeungJ, RodriguezPL,LauriereC,MerlotS: Proteinphosphatases2Cregulatethe activationoftheSnf1-relatedkinaseOST1byabscisicacidin Arabidopsis PlantCell 2009, 21 :3170-3184. 77.Rodriguez-GabrielMA,BurnsG,McDonaldWH,MartinV,YatesJR,BahlerJ, RussellP: RNA-bindingproteinCsx1mediatesglobalcontrolofgene expressioninresponsetooxidativestress. EMBOJ 2003, 22 :6256-6266. 78.RazemFA,El-KereamyA,AbramsSR,HillRD: TheRNA-bindingproteinFCA isanabscisicacidreceptor. Nature 2006, 439 :290-294. 79.KimJS,JungHJ,LeeHJ,KimKA,GohCH,WooY,OhSH,HanYS,KangH: Glycine-richRNA-bindingprotein7affectsabioticstressresponsesby regulatingstomataopeningandclosingin Arabidopsisthaliana PlantJ 2008, 55 :455-466. 80.DongG,HutagalungAH,FuC,NovickP,ReinischKM: Thestructuresof exocystsubunitExo70pandtheExo84pC-terminaldomainsreveala commonmotif. NatStructMolBiol 2005, 12 :1094-1100. 81.EspinozaC,VegaA,MedinaC,SchlauchK,CramerG,Arce-JohnsonP: Gene expressionassociatedwithcompatibleviraldiseasesingrapevine cultivars. FunctIntegrGenomics 2007, 7 :95-110. 82.KimST,ChoKS,KimSG,KangSY,KangKY: Ariceisoflavonereductase-like gene, OsIRL ,isinducedbyriceblastfungalelicitor. MolCells 2003, 16 :224-231. 83.PrasannaTB,VairamaniM,KasbekarDP: Effectsofpisatinon Dictyostelium discoideum :itsrelationshiptoinducibleresistancetonystatinand extensiontootherisoflavonoidphytoalexins. ArchMicrobiol 1998, 170 :309-312. 84.HeXZ,DixonRA: Geneticmanipulationofisoflavone7-Omethyltransferaseenhancesbiosynthesisof4 ’ -O-methylated isoflavonoidphytoalexinsanddiseaseresistanceinalfalfa. PlantCell 2000, 12 :1689-1702. 85.GachonCM,Langlois-MeurinneM,SaindrenanP: Plantsecondary metabolismglycosyltransferases:theemergingfunctionalanalysis. TrendsPlantSci 2005, 10 :542-549. 86.Nishizawa-YokoiA,YabutaY,ShigeokaS: Thecontributionof carbohydratesincludingraffinosefamilyoligosaccharidesandsugar alcoholstoprotectionofplantcellsfromoxidativedamage. PlantSignal Behav 2008, 3 :1016-1018. 87.HazenSP,Scott-CraigJS,WaltonJD: Cellulosesynthase-likegenesofrice. PlantPhysiol 2002, 128 :336-340. 88.ZhengJ,FuJ,GouM,HuaiJ,LiuY,JianM,HuangQ,GuoX,DongZ, WangH, etal : Genome-widetranscriptomeanalysisoftwomaizeinbred linesunderdroughtstress. PlantMolBiol 72 :407-421. 89.StanfordA,BevanM,NorthcoteD: Differentialexpressionwithinafamily ofnovelwound-inducedgenesinpotato. MolGenGenet 1989, 215 :200-208. 90.PonsteinAS,Bres-VloemansSA,Sela-BuurlageMB,vandenElzenPJ, MelchersLS,CornelissenBJ: Anovelpathogen-andwound-inducible tobacco( Nicotianatabacum )proteinwithantifungalactivity. PlantPhysiol 1994, 104 :109-118. 91.LiuF,YooBC,LeeJY,PanW,HarmonAC: Calcium-regulated phosphorylationofsoybeanserineacetyltransferaseinresponseto oxidativestress. JBiolChem 2006, 281 :27405-27415. 92.ArimuraG,HuberDP,BohlmannJ: Foresttentcaterpillars( Malacosoma disstria )inducelocalandsystemicdiurnalemissionsofterpenoid volatilesinhybridpoplar( Populustrichocarpa x deltoides ):cDNAcloning, functionalcharacterization,andpatternsofgeneexpressionof (-)-germacreneDsynthase,PtdTPS1. PlantJ 2004, 37 :603-616. 93.MolinaA,SeguraA,Garcia-OlmedoF: Lipidtransferproteins(nsLTPs)from barleyandmaizeleavesarepotentinhibitorsofbacterialandfungal plantpathogens. FEBSLett 1993, 316 :119-122. 94.IlmonenP,PennDJ,DamjanovichK,MorrisonL,GhotbiL,PottsWK: Major histocompatibilitycomplexheterozygosityreducesfitnessin experimentallyinfectedmice. Genetics 2007, 176 :2501-2508. 95.MakinoY,OkamotoK,YoshikawaN,AoshimaM,HirotaK,YodoiJ, UmesonoK,MakinoI,TanakaH: Thioredoxin:aredox-regulatingcellular cofactorforglucocorticoidhormoneaction.Crosstalkbetween endocrinecontrolofstressresponseandcellularantioxidantdefense system. JClinInvest 1996, 98 :2469-2477. 96.TakahashiH,IshiharaT,HaseS,ChibaA,NakahoK,ArieT,TeraokaT, IwataM,TuganeT,ShibataD, etal : Beta-cyanoalaninesynthaseasa molecularmarkerforinducedresistancebyfungalglycoproteinelicitor andcommercialplantactivators. Phytopathology 2006, 96 :908-916. 97.NembawareV,SeoigheC,SayedM,GehringC: Aplantnatriureticpeptidelikegeneinthebacterialpathogen Xanthomonasaxonopodis may inducehyper-hydrationintheplanthost:ahypothesisofmolecular mimicry. BMCEvolBiol 2004, 4 :10. 98.PoppenbergerB,BerthillerF,LucyshynD,SiebererT,SchuhmacherR, KrskaR,KuchlerK,GlosslJ,LuschnigC,AdamG: Detoxificationofthe Fusarium mycotoxindeoxynivalenolbyaUDP-glucosyltransferasefrom Arabidopsisthaliana JBiolChem 2003, 278 :47905-47914. 99.MurrayMG,ThompsonWF: Rapidisolationofhighmolecularweight plantDNA. NucleicAcidsRes 1980, 8 :4321-4325. 100. HuaDaGene. [http://www.genomics.org.cn/]. 101. NCBI. [http://blast.ncbi.nlm.nih.gov/Blast.cgi]. 102.MorrissyAS,MorinRD,DelaneyA,ZengT,McDonaldH,JonesS,ZhaoY, HirstM,MarraMA: Next-generationtagsequencingforcancergene expressionprofiling. GenomeRes 2009, 19 :1825-1835. 103.AudicS,ClaverieJM: Thesignificanceofdigitalgeneexpressionprofiles. GenomeRes 1997, 7 :986-995. 104.BenjaminiY,DraiD,ElmerG,KafkafiN,GolaniI: Controllingthefalse discoveryrateinbehaviorgeneticsresearch. BehavBrainRes 2001, 125 :279-284. 105.LivakKJ,SchmittgenTD: Analysisofrelativegeneexpressiondatausing real-timequantitativePCRandthe2(-DeltaDeltaC(T))Method. Methods 2001, 25 :402-408. 106. KEGG. [http://www.genome.jp/kegg/]. 107.BenjaminiY,HochbergY: Controllingthefalsediscoveryrate:apractical andpowerfulapproachtomultipletesting. JournaloftheRoyalStatistical Society,SeriesB(Methodological) 1995, 57 :289-300. doi:10.1186/1471-2229-10-234 Citethisarticleas: Wu etal .: Wholegenomewideexpressionprofilesof Vitisamurensis graperespondingtodownymildewbyusingSolexa sequencingtechnology. BMCPlantBiology 2010 10 :234. Wu etal BMCPlantBiology 2010, 10 :234 http://www.biomedcentral.com/1471-2229/10/234 Page16of16



PAGE 1

Pathway enrichment for downregulated DEGs # Pathway DEGs tested Pvalue Qvalue Pathway ID 1 Photosynthesis 20 (3.14%) 9.961282e 06 0.001065857 ko00195 2 Photosynthesis antenna proteins 6 (0.94%) 4.225173e 05 0.002260468 ko00196 3 Folate biosynthesis 5 (0.78%) 0.0001794234 0.006399435 ko00790 4 Nicotinate and nicotinamide metabolism 5 (0.78%) 0.0006685412 0.012489297 ko00760 5 Fructose and mannose metabolism 13 (2.04%) 0.0007003344 0.012489297 ko00051 6 Carbon fixation in photosynthetic organisms 13 (2.04%) 0.0007003344 0.012489297 ko00710 7 Pyruvate metabolism 14 (2.2%) 0.001380648 0.020996704 ko00620 8 Polyketide sugar unit biosynthesis 4 (0.63%) 0.001569847 0.020996704 ko00523 9 Purine metabolism 21 (3.3%) 0.001809214 0.021509544 ko00230 10 Biosynthesis of alkaloids derived from histidine and purine 21 (3.3%) 0.002527123 0.027040216 ko01065 11 Pentose phosph ate pathway 8 (1.26%) 0.00643259 0.058005895 ko00030 12 Glycolysis / Gluconeogenesis 17 (2.67%) 0.006505334 0.058005895 ko00 010 13 Circadian rhythm plant 18 (2.83%) 0.01467605 0.120795181 ko04712 14 Pyrimidine metabolism 18 (2.83%) 0.01766656 0.135022994 ko00240 15 Glycosaminoglycan degradation 5 (0.78%) 0.02193242 0.156451263 ko00531 16 Linoleic acid metabolism 1 1 (1.73%) 0.02408730 0.161083819 ko00591 17 Glycine, serine and threonine metabolism 8 (1.26%) 0.03551871 0.212098075 ko00260 18 Metabolic pathways 181 (28.41%) 0.03568005 0.212098075 ko01100 19 Glycosphingolipid biosynthesis ganglio series 4 (0.63%) 0.04239424 0.238746509 ko00604 20 Riboflavin metabolism 3 (0.47%) 0.07586645 0.405885508 ko00740 21 RNA polymerase 7 (1.1%) 0.08452502 0.430675102 ko03020 22 Biosynthesis of unsaturated fatty acids 9 (1.41%) 0.1216181 0.591506214 ko01040 23 Butanoate metabolism 9 (1.41%) 0.150618 0.700701130 ko00650 24 Regulation of autophagy 4 (0.63%) 0.1614949 0.719998096 ko04140 25 Valine, leucine and isoleucine biosynthesis 5 (0.78%) 0.1798197 0.769257775 ko00290 26 Porphyrin and chlorophyll me tabolism 5 (0.78%) 0.1941836 0.769257775 ko00860 27 Citrate cycle (TCA cycle) 6 (0.94%) 0.1968385 0.769257775 ko00020 28 Protein export 2 (0.31%) 0.2013011 0.769257775 ko03060 29 Aminoacyl tRNA biosynthesis 8 (1.26%) 0.211242 0.779410138 ko00970 30 Brassinosteroid biosynthesis 3 (0.47%) 0.2201083 0.785052937 ko00905 31 Galactose metabolism 6 (0.94%) 0.2368585 0.7865 96131 ko00052 32 Monoterpenoid biosynthesis 7 (1.1%) 0.2515863 0.786596131 ko00902 33 Other glycan degradation 4 (0.63%) 0.2572201 0.786596131 ko00511 34 Sphingolipid metabolism 4 (0.63%) 0.2572201 0.786596131 ko00600 35 Biotin metabolism 1 (0. 16%) 0.2572978 0.786596131 ko00780 36 Glyoxylate and dicarboxylate metabolism 4 (0.63%) 0.2757718 0.807088565 ko00630 37 Homologous recombination 6 (0.94%) 0.2790867 0.807088565 ko03440 38 Cyanoamino acid metabolism 13 (2.04%) 0.2873314 0.809064732 ko00460 39 Natural killer cell mediated cytotoxicity 4 (0.63%) 0.3039755 0.830209790 ko04650 40 Lysine biosynthesis 2 (0 .31%) 0.3103588 0.830209790 ko00300 41 Glucosinolate biosynthesis 6 (0.94%) 0.3228523 0.842565759 ko00966 42 Ubiquitin mediated proteolysis 14 (2.2%) 0.349429 0.877287028 ko04120 43 Glycerolipid metabolism 6 (0.94%) 0.3525546 0.877287028 ko00561 44 Biosynthesis of terpenoids and steroids 27 (4.24%) 0.3871793 0.935680998 ko01062 45 Metabolism of xenobiotics by cytochro me P450 9 (1.41%) 0.3935107 0.935680998 ko00980 46 Diterpenoid biosynthesis 7 (1.1%) 0.4193735 0.975499228 ko00904 47 Alanine, aspartate and glutamate metabolism 6 (0.94%) 0.4347225 0.983485655 ko00250 48 Proteasome 4 (0.63%) 0.4461335 0.983485655 ko03050 49 Biosynthesis of alkaloids derived from shikimate pathway 16 (2.51%) 0.4555588 0.983485655 ko01063 50 Benzoxazi noid biosynthesis 6 (0.94%) 0.4642744 0.983485655 ko00402 51 One carbon pool by folate 2 (0.31%) 0.4730283 0.983485655 ko006 70 52 Oxidative phosphorylation 14 (2.2%) 0.4808736 0.983485655 ko00190 53 Glutathione metabolism 7 (1.1%) 0.4871471 0.983485655 ko00480

PAGE 2

54 Limonene and pinene degradation 14 (2.2%) 0.499533 0.989815389 ko00903 55 Biosynthesis of alkaloids deriv ed from ornithine, lysine and nicotinic acid 13 (2.04%) 0.52362 0.999318000 ko01064 56 DNA replication 5 (0.78%) 0.5320393 0 .999318000 ko03030 57 Glycosylphosphatidylinositol(GPI) anchor biosynthesis 1 (0.16%) 0.572694 0.999318000 ko00563 58 Valine, leucine and isoleucine degradation 4 (0.63%) 0.5781888 0.999318000 ko00280 59 Biosynthesis of alkaloids derived from terpenoid and polyketide 12 (1.88%) 0.6015937 0.999318000 ko01066 60 Sulfur metabolism 2 (0.31%) 0.6215714 0.999318000 ko00920 61 Arachidonic acid metabolism 1 (0.16%) 0.6238966 0.999318000 ko00590 62 Stilbenoid, diarylheptanoid and gingerol biosynthes is 16 (2.51%) 0.6243524 0.999318000 ko00945 63 Fatty acid biosynthesis 3 (0.47%) 0.6266521 0.999318000 ko00061 64 Inositol phosphate metabolism 3 (0.47%) 0.6266521 0.999318000 ko00562 65 Ubiquinone and other terpenoid quinone biosynthesis 3 (0.47%) 0.6353734 0.999318000 ko00130 66 alpha Linolenic acid metabolism 7 (1.1%) 0.6371748 0.999318000 ko00592 67 Zeatin biosyn thesis 3 (0.47%) 0.6439518 0.999318000 ko00908 68 Mismatch repair 3 (0.47%) 0.6523867 0.999318000 ko03430 69 Histidine metabolism 2 (0.31%) 0.6532613 0.999318000 ko00340 70 Phosphatidylinositol signaling system 5 (0.78%) 0.6600323 0.999318000 ko04070 71 Selenoamino acid metabolism 3 (0.47%) 0.6688252 0.999318000 ko00450 72 Carotenoid biosynthesis 5 (0.78%) 0.6790193 0.999318000 ko00906 73 Phenylpropanoid biosynthesis 25 (3.92%) 0.6872993 0.999318000 ko00940 74 Biosynthesis of plant hormones 34 (5.34%) 0.6945073 0.999318000 ko01070 75 Peroxisome 8 (1.26%) 0.7051898 0.999318000 ko04146 76 Non homologous end joining 1 (0.16%) 0.7207948 0.999318000 ko03450 77 Terpenoid backbone biosynthesis 4 (0.63%) 0.7226751 0.999318000 ko00900 78 Starch and sucrose metabolism 17 (2.67%) 0.7363995 0.999318000 ko00500 79 Propanoate metabolism 3 (0.47%) 0.7424505 0.999318000 ko00640 80 Anthocyanin biosynthesis 2 (0.31%) 0.7515581 0.999318000 ko00942 81 Flavonoid biosynthesis 19 (2.98%) 0 .7958237 0.999318000 ko00941 82 Flavone and flavonol biosynthesis 7 (1.1%) 0.8070607 0.999318000 ko00944 83 Amino sugar and nucleotide sugar metabolism 5 (0.78%) 0.8091537 0.999318000 ko00520 84 Biosynthesis of phenylpropanoids 35 (5.49%) 0.8359223 0.999318000 ko01061 85 Base excision repair 3 (0.47%) 0.8502516 0.999318000 ko03410 86 Nitrogen metabolism 6 (0.94%) 0.8 53474 0.999318000 ko00910 87 Pantothenate and CoA biosynthesis 1 (0.16%) 0.8587588 0.999318000 ko00770 88 Pentose and glucuronate interconversions 5 (0.78%) 0.8645796 0.999318000 ko00040 89 Ascorbate and aldarate metabolism 5 (0.78%) 0.8768494 0.999318000 ko00053 90 Methane metabolism 4 (0.63%) 0.878726 0.999318000 ko00680 91 Fatty acid metabolism 4 (0.63%) 0.8878943 0.999318000 ko00071 92 Tyrosine metabolism 3 (0.47%) 0.9058801 0.999318000 ko00350 93 Nucleotide excision repair 3 (0.47%) 0.926009 0.999318000 ko03420 94 ABC transporters 5 (0.78%) 0.9435343 0.999318000 ko02010 95 Tryptophan metabolism 5 (0.7 8%) 0.9464346 0.999318000 ko00380 96 Phenylalanine, tyrosine and tryptophan biosynthesis 1 (0.16%) 0.9470385 0.999318000 ko00 400 97 N Glycan biosynthesis 1 (0.16%) 0.951372 0.999318000 ko00510 98 Indole alkaloid biosynthesis 1 (0.16%) 0.9534042 0.999318000 ko00901 99 Steroid biosynthesis 2 (0.31%) 0.9583674 0.999318000 ko00100 100 Glycerophospholipid metabolism 2 (0 .31%) 0.96391 0.999318000 ko00564 101 RNA degradation 3 (0.47%) 0.9672207 0.999318000 ko03018 102 Endocytosis 3 (0.47%) 0.9692657 0.999318000 ko04144 103 Arginine and proline metabolism 1 (0.16%) 0.986505 0.999318000 ko00330 104 Ribosome 9 (1.41%) 0.990812 0.999318000 ko03010 105 Cysteine and methionine metabolism 4 (0.63%) 0.9980626 0.999318000 ko00270 106 Phenylalanine metabolism 1 (0.16%) 0.9992994 0.999318000 ko00360 107 Spliceosome 10 (1.57%) 0.999318 0.999318000 ko03040


!DOCTYPE art SYSTEM 'http:www.biomedcentral.comxmlarticle.dtd'
ui 1471-2229-10-234ji 1471-2229fm
dochead Research article
bibl
title
p Whole genome wide expression profiles of it Vitis amurensis grape responding to downy mildew by using Solexa sequencing technology
aug
au id A1 ce yes snm Wufnm Jiaoinsr iid I1 I2 email jiaolong722@gmail.com
A2 ZhangYaliolivia.yl.zhang@gmail.com
A3 ZhangHuiqinforeverjiaxin@gmail.com
A4 HuangHongI3 huanghon2003@gmail.com
A5 Foltami MKevinkfolta@ufl.edu
ca A6 LuJiangI4 j.lu.cau@gmail.com
insg
ins College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083, China
Horticultural Sciences Department and the Graduate Program in Plant Molecular and Cellular Biology, University of Florida, Gainesville, FL, 32611, USA
School of Information, University of South Florida Tampa, FL, 33620, USA
Center for Viticulture and Small Fruit Research, Florida A&M University, Tallahassee, FL, 32317, USA
source BMC Plant Biology
issn 1471-2229
pubdate 2010
volume 10
issue 1
fpage 234
url http://www.biomedcentral.com/1471-2229/10/234
xrefbib pubidlist pubid idtype doi 10.1186/1471-2229-10-234pmpid 21029438
history rec date day 12month 1year 2010acc 28102010pub 28102010
cpyrt 2010collab Wu et al; licensee BioMed Central Ltd.note This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
abs
sec
st
Abstract
Background
Downy mildew (DM), caused by pathogen Plasmopara viticola (PV) is the single most damaging disease of grapes (Vitis L.) worldwide. However, the mechanisms of the disease development in grapes are poorly understood. A method for estimating gene expression levels using Solexa sequencing of Type I restriction-endonuclease-generated cDNA fragments was used for deep sequencing the transcriptomes resulting from PV infected leaves of Vitis amurensis Rupr. cv. Zuoshan-1. Our goal is to identify genes that are involved in resistance to grape DM disease.
Results
Approximately 8.5 million (M) 21-nt cDNA tags were sequenced in the cDNA library derived from PV pathogen-infected leaves, and about 7.5 M were sequenced from the cDNA library constructed from the control leaves. When annotated, a total of 15,249 putative genes were identified from the Solexa sequencing tags for the infection (INF) library and 14,549 for the control (CON) library. Comparative analysis between these two cDNA libraries showed about 0.9% of the unique tags increased by at least five-fold, and about 0.6% of the unique tags decreased more than five-fold in infected leaves, while 98.5% of the unique tags showed less than five-fold difference between the two samples. The expression levels of 12 differentially expressed genes were confirmed by Real-time RT-PCR and the trends observed agreed well with the Solexa expression profiles, although the degree of change was lower in amplitude. After pathway enrichment analysis, a set of significantly enriched pathways were identified for the differentially expressed genes (DEGs), which associated with ribosome structure, photosynthesis, amino acid and sugar metabolism.
Conclusions
This study presented a series of candidate genes and pathways that may contribute to DM resistance in grapes, and illustrated that the Solexa-based tag-sequencing approach was a powerful tool for gene expression comparison between control and treated samples.
bdy
Background
Downy mildew of grapes occurs in most parts of the world where grapes are grown, but favors those regions that experience warm, wet conditions during the vegetative growth of the vine. A major outbreak of the disease can cause severe losses in yield and berry quality. Symptoms of DM are usually first noticed on leaves as yellowish and later oily lesions on the leaf's upper surface with a 'downy' mass observed on the corresponding underside of the leaf. It can also cause deformation of shoots, tendrils, inflorescences and clusters of young berries. Berries become less susceptible as they mature, however rachis infection can spread into the older fruit which leads to direct crop loss by shelling of berries abbrgrp
abbr bid B1 1
.
Downy mildew is caused by the pathogen Plasmopara viticola (PV). Primary infection begins with the overwintering oospore on infected leaves or plant litter in the soil that germinates in the spring and produces a sporangium
B2 2
. When plant parts are covered with a film of moisture from rain or irrigation, the sporangium releases small swimming spores (zoospores) that are then spread by splashing water. The spores can germinate by producing a germ tube that enters the green tissue (including leaves, inflorescences, bunches and young berries) through the stomates
B3 3
. Secondary infection, which is the major source of disease spread, produces spores that may be mobilized by wind and rain to establish new infection sites. The cycle ends with the sexual production of over-wintering oospores
2
.
Different genotypes of grapes show varying level of resistance to PV, ranging from susceptible V. vinifera, to the moderately resistant V. rupestris and V. amurensis, V. cinerea, V. riparia and V. candicans, to the totally resistant Muscadinia rotundifolia
B4 4
B5 5
B6 6
. The world-wide grape industry relies predominantly on V. vinifera, which requires chemical protection to produce healthy fruits. However, such chemicals may have negative environmental impacts and/or pose risk to human health. A promising alternative strategy that could simultaneously improve grape health and limit chemical use is to identify the unique genes or mechanisms from resistant species that could potentially confer resistance to the pathogen or lower presentation of symptoms. These elements may potentially be introduced into V. vinifera through long-term breeding efforts or transgenic methods. With this perspective, it is important to unravel the molecular basis of natural defense responses in resistant grapevines to DM challenge, including identification of the genetic processes that may contribute to resistance.
Responses to PV have been characterized in various resistant species. Mechanisms of resistance include induction of chemical barriers, initiation of processes that delay invasive growth of mycelia, or mechanisms that establish hypersensitive response after inoculation of PV
B7 7
B8 8
B9 9
. Genetic and gene expression profiling studies have concluded that Rpv1, NPR1 homologs, and PR protein encoding genes contribute to the function of DM resistance in grapevines
B10 10
B11 11
B12 12
. Others factors, including the amino acid beta-aminobutyric acid
B13 13
, and the proteins beta-1, 3-Glucanase
B14 14
, stilbene synthase (STS)
B15 15
, phenylalanine ammonia lyase (PAL)
B16 16
, thaumatin-like proteins and chitinase
B17 17
may also play an important role in DM resistance. Many attempts, including transgenic
B18 18
B19 19
B20 20
B21 21
and traditional breeding approaches
10
B22 22
B23 23
, have been undertaken to introgress resistance into V. vinifera genotypes.
To understand the mechanism(s) of the host resistance at the molecular level, a critical first step is to identify the transcripts that accumulate in response to the pathogen attack. In this study, "Zuoshan-1", a clonal selection from wild V. amurensis with cold hardiness and high resistance to DM
B24 24
, was employed to identify a set of candidate genes associated with DM resistance using Solexa sequencing technology. Solexa sequencing is a technology capable of obtaining novel information for whole-genome-wide transcript expression without prior sequence knowledge. This report presents the finding of these tests.
Results
Inoculation and symptom development
The fourth unfolded leaf from the shoot apex of "Zuoshan-1" was inoculated with PV. No visible symptoms were observed in the first 4 days (Figure figr fid F1 1a and 1b). The 'downy' mass was obviously observed on the 6th day (Figure 1c) and exacerbated on the 8th day (Figure 1d). Oil spots emerged gradually on the site of pathogen and the spores did not spread to the other healthy tissues 18 days after inoculation (Figure 1e and 1f).
fig Figure 1caption Symptom development on leaf surface of "Zuoshan-1" after PV infectiontext
b Symptom development on leaf surface of "Zuoshan-1" after PV infection. The fourth unfolded leaf from the shoot apex of "Zuoshan-1" was inoculated on (a) day 0. Subsequent images depict the state of infection and symptom development on (b) day 4, (c) day 6, (d) day 8 and (e and f) 18 d. Panel e shows the upper leaf and panel f shows the lower leaf surface.
graphic file 1471-2229-10-234-1 hint_layout double
Tag identification and quantification
A total of 8,549,948 and 7,527,499 tags were sequenced in infected (INF) and control (CON) libraries, respectively (Table tblr tid T1 1). After filtering out low quality tags (tags containing 'N' and adaptor sequences), 8,474,583 and 7,525,307 tags (noted herein as "clean" tags) remained in INF and CON libraries. To increase the robustness of the approach, single-copy tags in the two libraries (247,900 in INF and 253,156 in CON library) were excluded from further analysis. As a result, a total of 8,226,683 and 7,272,151 clean tags remained from the two libraries, from which 233,653 (INF) and 203,514 (CON) unique tags were obtained. There were 30,139 more unique tags in the INF than in the CON library, possibly representing genes related to pathogen interaction and symptom development. The percentage of unique tags rapidly declined as copy number increased, indicating only a small portion of the transcripts were expressed at high level in the conditions tested.
tbl Table 1Solexa tags in the infected (INF) and control (CON) libraries.tblbdy cols 3
r
c
right
INF
CON
cspan
hr
left
total tag
8549948
7527499
clean tag
8474583
7525307
clean tag copy number = 1
247900
253156
unique tag
233653
203514
unique tag copy number 5/p
/c
c ca="right"
p98318/p
/c
c ca="right"
p80345/p
/c
/r
r
c ca="left"
punique tag copy number 10p
c
c ca="right"
p63202p
c
c ca="right"
p51438p
c
r
r
c ca="left"
punique tag copy number 20p
c
c ca="right"
p39772p
c
c ca="right"
p31441p
c
r
r
c ca="left"
punique tag copy number 50p
c
c ca="right"
p19776p
c
c ca="right"
p14804p
c
r
r
c ca="left"
punique tag copy number 100p
c
c ca="right"
p10615p
c
c ca="right"
p7701p
c
r
tblbdytbl
sec
sec
st
pDepth of samplingp
st
pSaturation of the library is determined by identification of unique tags. Sequencing reaches saturation when no new unique tags are detected. The results shown in Figure figr fid="F2"2figr indicate that INF and CON libraries were sequenced to saturation, producing a full representation of the transcripts in the conditions tested. In both libraries fewer unique tags were identified as the number of sequencing tags increases, reaching a plateau shortly after 6 M tags were sequenced. No new unique tags were identified as the total tag number approached 8.5 M in INF library and 7.5 M in CON library.p
fig id="F2"titlepFigure 2ptitlecaptionpAccumulation of Solexa total tag and unique tag in the two librariespcaptiontext
pbAccumulation of Solexa total tag and unique tag in the two librariesb. New unique tag ("y" axis) of INF (solid line) and CON (broken line) libraries decreased as the solexa sequencing increased ("x" axis). The total unique tag was 233,653 in INF and 203,514 in CON library.p
textgraphic file="1471-2229-10-234-2" hint_layout="single"fig
sec
sec
st
pAnnotation analysis of the unique tagp
st
pThe unique tags were compared against the genome and gene sequences of itV. vinifera itcv. Pinot Noir abbrgrp
abbr bid="B25"25abbr
abbrgrp using blastn. Tags with a complete match or one base pair mismatch were considered further. The results in Table tblr tid="T2"2tblr show that a substantial proportion of tags (81.60% in INF library and 83.72% in CON library) matched to the "Pinot Noir" genome, and 91,638 (39.21% of unique tags) and 83,079 (40.82% of unique tags) in INF and CON library matched to 18,841 (61.91%) and 18,068 (59.37%) "Pinot Noir" genes. Further analysis revealed that 82,886 unique tags (35.47%) in INF library and 75,290 (36.99%) in CON library matched to only one gene sequence in the "Pinot Noir' genome (Table tblr tid="T2"2tblr). These data indicated that approximately 50% of transcripts predicted in grape are expressed in the infected or control leaves, with more transcripts present in the infected sample.p
tbl id="T2"titlepTable 2ptitlecaptionpAnnotation of "Zuoshan-1" Solexa tags against the "Pinot Noir" genomic sequence.pcaptiontblbdy cols="5"
r
c
p
c
c cspan="2" ca="center"
p
bINFb
p
c
c cspan="2" ca="center"
p
bCONb
p
c
r
r
c
p
c
c cspan="4"
hr
c
r
r
c
p
c
c ca="center"
p
bmatch to genomeb
p
c
c ca="center"
p
bmatch to geneb
p
c
c ca="center"
p
bmatch to genomeb
p
c
c ca="center"
p
bmatch to geneb
p
c
r
r
c cspan="5"
hr
c
r
r
c ca="left"
punique tagp
c
c ca="center"
p190665 (81.60%)*p
c
c ca="center"
p91638 (39.21%)*p
c
c ca="center"
p170380 (83.72%)*p
c
c ca="center"
p83079 (40.82%)*p
c
r
r
c ca="left"
pmatched genesp
c
c
p
c
c ca="center"
p18841 (61.91%)sup#supp
c
c
p
c
c ca="center"
p18068 (59.37%)sup#supp
c
r
r
c cspan="5"
hr
c
r
r
c ca="left"
punique tag matched to one genep
c
c
p
c
c ca="center"
p82886 (35.47%)*p
c
c
p
c
c ca="center"
p75290 (36.99%)*p
c
r
r
c ca="left"
pmatched genesp
c
c
p
c
c ca="center"
p15249 (50.51%)sup#supp
c
c
p
c
c ca="center"
p14549 (47.81%)sup#supp
c
r
tblbdytblfn
pNote: *percentage of matched tagstotal tags;sup#suppercentage of matched genestotal assembled CDs of "Pinot Noir".p
tblfntbl
pTags with no homology to grape were compared with blastn to the VBI Microbial Database abbrgrp
abbr bid="B26"26abbr
abbrgrp containing genomic sequence information from itPhytophthora sojaeit, itPhytophthora infestans itand itHyaloperonospora parasiticait. There were 251 tags identified in INF library found to be identical to those of the oomycete during PV infection (additional file supplr sid="S1"1supplr).p
suppl id="S1"
title
pAdditional file 1p
title
text
p
bComplete list of transcripts attributed to itP. viticolait
b.p
text
file name="1471-2229-10-234-S1.XLS"
pClick here for filep
file
suppl
sec
sec
st
pComparison of gene expression level between the two librariesp
st
pDifferences of tag frequencies that appeared in the INF and CON libraries were used for estimating gene expression levels in response to PV infection. The transcripts detected with at least two-fold differences in the two libraries are shown in Figure figr fid="F3"3figr (FDR <0.001). The red dots (3,125) and green dots (1,847) represent transcripts higher or lower in abundance for more than two fold in INF library, respectively. The blue dots represent transcripts that differed less than two fold between the two libraries, which were arbitrarily designated as "no difference in expression". The DEGs with five fold or greater differences in accumulation were shown in Figure figr fid="F4"4figr. A total of 513 genes (about 0.9% total unique tags) increased by at least five fold, and 167 genes (about 0.6% total unique tags) were decreased by at least five fold in the INF library, while the expression level of 98.5% unique tags was within five-fold difference between the two samples.p
fig id="F3"titlepFigure 3ptitlecaptionpComparision of gene expression level between the two librariespcaptiontext
pbComparision of gene expression level between the two librariesb. For comparing gene expression level between the two libraries, each library was normalized to 1 million tags. Red dots represent transcripts more prevalent in the infected leaf library, green dots show those present at a lower frequency in the infected tissue and blue dots indicate transcripts that did not change significantly. The parameters "FDR <0.001" and "log2 Ratio ≥ 1" were used as the threshold to judge the significance of gene expression difference.p
textgraphic file="1471-2229-10-234-3" hint_layout="single"fig
fig id="F4"titlepFigure 4ptitlecaptionpDifferentially expressed tags in infected (INF) tissue librarypcaptiontext
pbDifferentially expressed tags in infected (INF) tissue libraryb. The "x" axis represents fold-change of differentially expressed unique tags in the INF library. The "y" axis represents the number of unique tags (log10). Differentially accumulating unique tags with a 5-fold difference between libraries are shown in the red region (98.49%). The blue (0.89%) and green (0.61%) regions represent unique tags that are up- and downregulated for more than 5 fold in the INF library, respectively.p
textgraphic file="1471-2229-10-234-4" hint_layout="single"fig
pOf DEGs with differences greater than twenty fold (Table tblr tid="T3"3tblr), 69 genes were present at higher levels in the INF library, 67 of which were associated with defense (6), transport (3), transcription (11), signal transduction (14) and metabolism (33). The highest DEG was phosphate-induced protein gene which was present at 229 fold of control levels. Among these highly expressed genes, many were associated with senescence, abiotic and biotic stresses.p
tbl id="T3"titlepTable 3ptitlecaptionpList of DEGs changed for 20 fold and more in INF library.pcaptiontblbdy cols="6"
r
c ca="left"
p
bGeneb
p
c
c ca="left"
p
bAnnotationb
p
c
c ca="left"
p
bStress related functionb
p
c
c ca="left"
p
bAccessionb
p
c
c ca="left"
p
bIdentityb
p
c
c ca="right"
p
bFoldb
p
c
r
r
c cspan="6"
hr
c
r
r
c cspan="6" ca="center"
p
bUpregulated genesb
p
c
r
r
c cspan="6" ca="left"
p
b
itDefenceit
b
p
c
r
r
c ca="left"
pGSVIVT00025506001p
c
c ca="left"
ppolygalacturonase-inhibiting protein [itVitis labrusca itx itVitis Ripariait]p
c
c ca="left"
pinhibits fungal endopolygalacturonasesp
c
c ca="left"
pACS16072.1p
c
c ca="left"
p333333 (100%)p
c
c ca="right"
p60p
c
r
r
c ca="left"
pGSVIVT00001105001p
c
c ca="left"
pthaumatin-like protein [itVitis viniferait]p
c
c ca="left"
ppathogen defence; drought and heat combinationp
c
c ca="left"
pAAQ10092.1p
c
c ca="left"
p217225 (96%)p
c
c ca="right"
p57p
c
r
r
c ca="left"
pGSVIVT00017370001p
c
c ca="left"
pharpin-induced protein-relatedHIN1-relatedharpin-responsive protein-related [itArabidopsis thalianait]p
c
c ca="left"
ppathogen defence; senescencep
c
c ca="left"
pNP_565634.1p
c
c ca="left"
p141267 (52%)p
c
c ca="right"
p33p
c
r
r
c ca="left"
pGSVIVT00002965001p
c
c ca="left"
pTMV response-related protein [itZea maysit]p
c
c ca="left"
pTobacco Mosaic Virus responsep
c
c ca="left"
pACG48457.1p
c
c ca="left"
p3991 (42%)p
c
c ca="right"
p32p
c
r
r
c ca="left"
pGSVIVT00005362001p
c
c ca="left"
pglutaredoxin [itPopulus trichocarpait]p
c
c ca="left"
psenescencep
c
c ca="left"
pEEE75685.1p
c
c ca="left"
p91155 (58%)p
c
c ca="right"
p29p
c
r
r
c ca="left"
pGSVIVT00024683001p
c
c ca="left"
pbeta-glucosidase [itRosa ithybrid cultivar]p
c
c ca="left"
pactivation of phytoanticipinsp
c
c ca="left"
pBAG13451.1p
c
c ca="left"
p382531 (71%)p
c
c ca="right"
p21p
c
r
r
c cspan="6" ca="left"
p
b
itTransportit
b
p
c
r
r
c ca="left"
pGSVIVT00001094001p
c
c ca="left"
pmultidrug resistance pump, putative [itRicinus communisit]p
c
c ca="left"
pfungal resistancep
c
c ca="left"
pEEF51093.1p
c
c ca="left"
p407509 (79%)p
c
c ca="right"
p121p
c
r
r
c ca="left"
pGSVIVT00015121001p
c
c ca="left"
pmitochondrial dicarboxylate carrier protein, putative [itRicinus Communisit]p
c
c ca="left"
paluminum tolerancep
c
c ca="left"
pEEF48606.1p
c
c ca="left"
p271324 (83%)p
c
c ca="right"
p38p
c
r
r
c ca="left"
pGSVIVT00030447001p
c
c ca="left"
pmultidrug resistance protein ABC transporter family protein [itPopulus Trichocarpait]p
c
c ca="left"
pSenescence; drought and heat combinationp
c
c ca="left"
pEEE80779.1p
c
c ca="left"
p64194 (32%)p
c
c ca="right"
p25p
c
r
r
c cspan="6" ca="left"
p
b
itSignal transductionit
b
p
c
r
r
c ca="left"
pGSVIVT00030628001p
c
c ca="left"
pleucine-rich repeat receptor-like protein kinase [itNicotiana tabacumit]p
c
c ca="left"
psenescencep
c
c ca="left"
pAAF66615.1p
c
c ca="left"
p644923 (69%)p
c
c ca="right"
p145p
c
r
r
c ca="left"
pGSVIVT00006178001p
c
c ca="left"
pFERONIA receptor-like kinase [itArabidopsis thalianait]p
c
c ca="left"
pdefence, stressesp
c
c ca="left"
pABT18100.1p
c
c ca="left"
p317621 (51%)p
c
c ca="right"
p56p
c
r
r
c ca="left"
pGSVIVT00019504001p
c
c ca="left"
pMAP3K-like protein kinase [itArabidopsis thalianait]p
c
c ca="left"
pdisease resistance, drought and heat combinationp
c
c ca="left"
pCAB16796.1p
c
c ca="left"
p184359 (51%)p
c
c ca="right"
p52p
c
r
r
c ca="left"
pGSVIVT00002706001p
c
c ca="left"
pcalmodulin-binding protein [itArabidopsis thalianait]p
c
c ca="left"
psenescencep
c
c ca="left"
pNP_565379.1p
c
c ca="left"
p2145 (46%)p
c
c ca="right"
p39p
c
r
r
c ca="left"
pGSVIVT00020989001p
c
c ca="left"
pcalcium-binding EF hand family protein [itArabidopsis thalianait]p
c
c ca="left"
pdefence related; senescence; drought and heat combinationp
c
c ca="left"
pNP_568568.1p
c
c ca="left"
p81166 (48%)p
c
c ca="right"
p35p
c
r
r
c ca="left"
pGSVIVT00029809001p
c
c ca="left"
pethylene-regulated transcript 2 (ERT2) [itArabidopsis thalianait]p
c
c ca="left"
psenescencep
c
c ca="left"
pCAB45883.1p
c
c ca="left"
p96204 (47%)p
c
c ca="right"
p34p
c
r
r
c ca="left"
pGSVIVT00036549001p
c
c ca="left"
pcalmodulin-binding protein [itArabidopsis thalianait]p
c
c ca="left"
psenescencep
c
c ca="left"
pNP_565379.1p
c
c ca="left"
p149366 (40%)p
c
c ca="right"
p28p
c
r
r
c ca="left"
pGSVIVT00002973001p
c
c ca="left"
pcalmodulin binding protein-like [itElaeis guineensisit]p
c
c ca="left"
psenescencep
c
c ca="left"
pABP04242.1p
c
c ca="left"
p89135 (65%)p
c
c ca="right"
p27p
c
r
r
c ca="left"
pGSVIVT00025017001p
c
c ca="left"
pBRASSINOSTEROID INSENSITIVE 1-associated receptor kinase 1 precursor, putative [itRicinus communisit]p
c
c ca="left"
pdisease, cell deathp
c
c ca="left"
pEEF29110.1p
c
c ca="left"
p415639 (64%)p
c
c ca="right"
p26p
c
r
r
c ca="left"
pGSVIVT00000612001p
c
c ca="left"
pnodulin-like protein [itArabidopsis thalianait]p
c
c ca="left"
pdrought and heat combinationp
c
c ca="left"
pAAC28987.1p
c
c ca="left"
p397550 (72%)p
c
c ca="right"
p23p
c
r
r
c ca="left"
pGSVIVT00033036001p
c
c ca="left"
pRING-H2 subgroup RHE protein [itPopulus tremula itx itPopulus albait]p
c
c ca="left"
pdrought and heat combinationp
c
c ca="left"
pAAW33880.1p
c
c ca="left"
p168296 (56%)p
c
c ca="right"
p22p
c
r
r
c ca="left"
pGSVIVT00009150001p
c
c ca="left"
pPAR-1a [itNicotiana tabacumit]p
c
c ca="left"
ppotato virus Y, SAR inducep
c
c ca="left"
pCAA58733.1p
c
c ca="left"
p127178 (71%)p
c
c ca="right"
p22p
c
r
r
c ca="left"
pGSVIVT00027614001p
c
c ca="left"
preceptor-protein kinase-like protein [itArabidopsis thalianait]p
c
c ca="left"
pdrought and heat combinationp
c
c ca="left"
pBAA98098.1p
c
c ca="left"
p632849 (74%)p
c
c ca="right"
p20p
c
r
r
c ca="left"
pGSVIVT00030574001p
c
c ca="left"
pleucine-rich repeat receptor-like protein kinase [itArabidopsis thalianait]p
c
c ca="left"
psenescencep
c
c ca="left"
pACN59244.1p
c
c ca="left"
p317611 (51%)p
c
c ca="right"
p20p
c
r
r
c cspan="6" ca="left"
p
b
itTranscriptionit
b
p
c
r
r
c ca="left"
pGSVIVT00014947001p
c
c ca="left"
pzinc-finger protein 1 [itDatisca glomeratait]p
c
c ca="left"
pdefence, stressesp
c
c ca="left"
pAAD26942.1p
c
c ca="left"
p144246 (58%)p
c
c ca="right"
p60p
c
r
r
c ca="left"
pGSVIVT00016398001p
c
c ca="left"
pdehydration-responsive element binding protein 3 [itGlycine maxit]p
c
c ca="left"
pbiotic and abiotic stressesp
c
c ca="left"
pABB36646.1p
c
c ca="left"
p116187 (62%)p
c
c ca="right"
p52p
c
r
r
c ca="left"
pGSVIVT00007409001p
c
c ca="left"
pDRE-binding protein 3b [itGossypium hirsutumit]p
c
c ca="left"
pdrought and heat combinationp
c
c ca="left"
pABB45861.1p
c
c ca="left"
p134237 (56%)p
c
c ca="right"
p22p
c
r
r
c ca="left"
pGSVIVT00020131001p
c
c ca="left"
pbasic helix-loop-helix protein [itNicotiana tabacumit]p
c
c ca="left"
psenescencep
c
c ca="left"
pBAF30984.1p
c
c ca="left"
p105228 (46%)p
c
c ca="right"
p33p
c
r
r
c ca="left"
pGSVIVT00001092001p
c
c ca="left"
pDehydration-responsive element-binding protein 1F, putative [itRicinus communisit]p
c
c ca="left"
pphytohormone, pathogen and environmental stressesp
c
c ca="left"
pEEF51090.1p
c
c ca="left"
p143242 (59%)p
c
c ca="right"
p30p
c
r
r
c ca="left"
pGSVIVT00007410001p
c
c ca="left"
pCBF4 transcription factor [itVitis viniferait]p
c
c ca="left"
pcold stressp
c
c ca="left"
pABE96792.1p
c
c ca="left"
p218218 (100%)p
c
c ca="right"
p30p
c
r
r
c ca="left"
pGSVIVT00016403001p
c
c ca="left"
pjasmonate ZIM domain 1 [itCatharanthus roseusit]p
c
c ca="left"
pwounding; herbivory; salinityp
c
c ca="left"
pACM89457.1p
c
c ca="left"
p131275 (47%)p
c
c ca="right"
p27p
c
r
r
c ca="left"
pGSVIVT00028041001p
c
c ca="left"
pAP2 domain class transcription factor [itMalus itx itdomesticait]p
c
c ca="left"
psenescence; drought and heat combinationp
c
c ca="left"
pADE41117.1p
c
c ca="left"
p172327 (52%)p
c
c ca="right"
p26p
c
r
r
c ca="left"
pGSVIVT00027444001p
c
c ca="left"
pGRAS family transcription factor [itPopulus trichocarpait]p
c
c ca="left"
pchitin responsep
c
c ca="left"
pEEE95719.1p
c
c ca="left"
p446586 (76%)p
c
c ca="right"
p26p
c
r
r
c ca="left"
pGSVIVT00006790001p
c
c ca="left"
pbasic helix-loop-helix (bHLH) family protein [itArabidopsis thalianait]p
c
c ca="left"
pfugal resistance related; senescencep
c
c ca="left"
pNP_568850.1p
c
c ca="left"
p152239 (63%)p
c
c ca="right"
p21p
c
r
r
c ca="left"
pGSVIVT00002446001p
c
c ca="left"
pWRKY transcription factor 21 [itPopulus tomentosa itx itP. bolleanait]p
c
c ca="left"
psenescence,stressesp
c
c ca="left"
pACV92023.1p
c
c ca="left"
p196364 (53%)p
c
c ca="right"
p21p
c
r
r
c cspan="6" ca="left"
p
b
itMetabolismit
b
p
c
r
r
c ca="left"
pGSVIVT00015203001p
c
c ca="left"
pputative phosphate-induced protein [itNicotiana tabacumit]p
c
c ca="left"
punidentifiedp
c
c ca="left"
pBAA33810.1p
c
c ca="left"
p243317 (76%)p
c
c ca="right"
p229p
c
r
r
c ca="left"
pGSVIVT00016518001p
c
c ca="left"
psalt responsive protein 2 [itSolanum lycopersicumit]p
c
c ca="left"
pdrought and heat combinationp
c
c ca="left"
pACG50004.1p
c
c ca="left"
p309464 (66%)p
c
c ca="right"
p165p
c
r
r
c ca="left"
pGSVIVT00024884001p
c
c ca="left"
pS-adenosyl-L-methionine:salicylic acid carboxyl methyltransferase [itChimonanthus praecoxit]p
c
c ca="left"
pbiotic and abotic stressesp
c
c ca="left"
pABU88887.2p
c
c ca="left"
p191377 (50%)p
c
c ca="right"
p97p
c
r
r
c ca="left"
pGSVIVT00024408001p
c
c ca="left"
ppotein-binding protein, putative [itRicinus communisit]p
c
c ca="left"
punidentifiedp
c
c ca="left"
pEEF27653.1p
c
c ca="left"
p393605 (64%)p
c
c ca="right"
p87p
c
r
r
c ca="left"
pGSVIVT00028930001p
c
c ca="left"
pubiquitin-protein ligase, putative [itRicinus communisit]p
c
c ca="left"
psenescencep
c
c ca="left"
pEEF42248.1p
c
c ca="left"
p357602 (59%)p
c
c ca="right"
p72p
c
r
r
c ca="left"
pGSVIVT00014730001p
c
c ca="left"
pcytochrome P450 [itPopulus trichocarpait]p
c
c ca="left"
psenescence; drought and heat combinationp
c
c ca="left"
pEEE73840.1p
c
c ca="left"
p261453 (57%)p
c
c ca="right"
p70p
c
r
r
c ca="left"
pGSVIVT00000988001p
c
c ca="left"
p9-cis-epoxycarotenoid dioxygenase 1 [itVitis viniferait]p
c
c ca="left"
psenescence; defencep
c
c ca="left"
pAAR11193.1p
c
c ca="left"
p602610 (98%)p
c
c ca="right"
p62p
c
r
r
c ca="left"
pGSVIVT00023009001p
c
c ca="left"
pATPP2-A2, putative [itRicinus communisit]p
c
c ca="left"
punidentifiedp
c
c ca="left"
pEEF38353.1p
c
c ca="left"
p114158 (72%)p
c
c ca="right"
p56p
c
r
r
c ca="left"
pGSVIVT00014704001p
c
c ca="left"
pputative integral membrane protein [itCyanothece itsp. CCY0110]p
c
c ca="left"
punidentifiedp
c
c ca="left"
pEAZ88012.1p
c
c ca="left"
p53176 (30%)p
c
c ca="right"
p51p
c
r
r
c ca="left"
pGSVIVT00018424001p
c
c ca="left"
ptropinone reductase, putative [itRicinus communisit]p
c
c ca="left"
psenescence; drought and heat combinationp
c
c ca="left"
pEEF38138.1p
c
c ca="left"
p194264 (73%)p
c
c ca="right"
p48p
c
r
r
c ca="left"
pGSVIVT00032938001p
c
c ca="left"
paspartic proteinase nepenthesin-1 precursor, putative [itRicinus communisit]p
c
c ca="left"
pphosphorus deficiency; salt stressp
c
c ca="left"
pEEF29846.1p
c
c ca="left"
p306441 (69%)p
c
c ca="right"
p39p
c
r
r
c ca="left"
pGSVIVT00024072001p
c
c ca="left"
pprotein phosphatase 2c, putative [itRicinus communisit]p
c
c ca="left"
psenescencep
c
c ca="left"
pEEF41194.1p
c
c ca="left"
p254393 (64%)p
c
c ca="right"
p37p
c
r
r
c ca="left"
pGSVIVT00015200001p
c
c ca="left"
pputative phosphate-induced protein [itCapsicum chinenseit]p
c
c ca="left"
punidentifiedp
c
c ca="left"
pBAG16530.1p
c
c ca="left"
p186289 (64%)p
c
c ca="right"
p37p
c
r
r
c ca="left"
pGSVIVT00022245001p
c
c ca="left"
pf-box family protein [itPopulus trichocarpait]p
c
c ca="left"
psenescencep
c
c ca="left"
pEEE87327.1p
c
c ca="left"
p139345 (40%)p
c
c ca="right"
p37p
c
r
r
c ca="left"
pGSVIVT00016166001p
c
c ca="left"
pATP-dependent DNA helicase [itBrevibacillus brevisit]p
c
c ca="left"
pDNA repairp
c
c ca="left"
pBAH41662.1p
c
c ca="left"
p1645 (35%)p
c
c ca="right"
p36p
c
r
r
c ca="left"
pGSVIVT00024387001p
c
c ca="left"
pnucleic acid binding protein, putative [itRicinus communisit]p
c
c ca="left"
poxidative; ABA; abiotic stressesp
c
c ca="left"
pEEF29282.1p
c
c ca="left"
p102164 (62%)p
c
c ca="right"
p34p
c
r
r
c ca="left"
pGSVIVT00024235001p
c
c ca="left"
pprotein phosphatase 2C [itNicotiana tabacumit]p
c
c ca="left"
psenescencep
c
c ca="left"
pCAC10358.1p
c
c ca="left"
p257429 (59%)p
c
c ca="right"
p34p
c
r
r
c ca="left"
pGSVIVT00035825001p
c
c ca="left"
pubiquitin-protein ligase, putative [itRicinus communisit]p
c
c ca="left"
psenescencep
c
c ca="left"
pEEF40124.1p
c
c ca="left"
p572719 (79%)p
c
c ca="right"
p32p
c
r
r
c ca="left"
pGSVIVT00019233001p
c
c ca="left"
pTPA: isoflavone reductase-like protein 3 [itVitis viniferait]p
c
c ca="left"
pputative defencep
c
c ca="left"
pCAI56332.1p
c
c ca="left"
p301319 (94%)p
c
c ca="right"
p31p
c
r
r
c ca="left"
pGSVIVT00014029001p
c
c ca="left"
pTPA_exp: cellulose synthase-like D1 [itOryza sativait]p
c
c ca="left"
punidentifiedp
c
c ca="left"
pDAA01752.1p
c
c ca="left"
p9991171 (85%)p
c
c ca="right"
p31p
c
r
r
c ca="left"
pGSVIVT00007984001p
c
c ca="left"
pserine acetyltransferase [itNicotiana plumbaginifoliait]p
c
c ca="left"
poxidative stressp
c
c ca="left"
pAAR18403.1p
c
c ca="left"
p179307 (58%)p
c
c ca="right"
p30p
c
r
r
c ca="left"
pGSVIVT00036225001p
c
c ca="left"
pBeta-expansin 1a precursor, putative [itRicinus communisit]p
c
c ca="left"
posmotic stressp
c
c ca="left"
pEEF28288.1p
c
c ca="left"
p207259 (79%)p
c
c ca="right"
p27p
c
r
r
c ca="left"
pGSVIVT00017518001p
c
c ca="left"
pspotted leaf protein, putative [itRicinus communisit]p
c
c ca="left"
phypersensitive response; cell death; senescencep
c
c ca="left"
pEEF38265.1p
c
c ca="left"
p243402 (60%)p
c
c ca="right"
p27p
c
r
r
c ca="left"
pGSVIVT00007452001p
c
c ca="left"
pwound-induced protein WIN2 precursor, putative [itRicinus communisit]p
c
c ca="left"
pantifungalp
c
c ca="left"
pEEF31100.1p
c
c ca="left"
p142197 (72%)p
c
c ca="right"
p26p
c
r
r
c ca="left"
pGSVIVT00002450001p
c
c ca="left"
pUDP-glucose:glucosyltransferase [itLycium barbarumit]p
c
c ca="left"
pdrought and heat combinationp
c
c ca="left"
pBAG80556.1p
c
c ca="left"
p293464 (63%)p
c
c ca="right"
p24p
c
r
r
c ca="left"
pGSVIVT00036349001p
c
c ca="left"
pglucose-1-phosphate adenylyltransferase, putative [itRicinus communisit]p
c
c ca="left"
pdrought and heat combinationp
c
c ca="left"
pEEF49428.1p
c
c ca="left"
p412531 (77%)p
c
c ca="right"
p24p
c
r
r
c ca="left"
pGSVIVT00028839001p
c
c ca="left"
pspotted leaf protein, putative [itRicinus communisit]p
c
c ca="left"
phypersensitive response; cell death; senescencep
c
c ca="left"
pEEF52025.1p
c
c ca="left"
p385674 (57%)p
c
c ca="right"
p24p
c
r
r
c ca="left"
pGSVIVT00009741001p
c
c ca="left"
pf-box family protein [itPopulus trichocarpait]p
c
c ca="left"
psenescencep
c
c ca="left"
pEEE86166.1p
c
c ca="left"
p93182 (51%)p
c
c ca="right"
p24p
c
r
r
c ca="left"
pGSVIVT00019669001p
c
c ca="left"
pgalactinol synthase [itSolanum lycopersicumit]p
c
c ca="left"
poxidative stress; drought; salinity; chilling; heat shockp
c
c ca="left"
pBAH98060.1p
c
c ca="left"
p231316 (73%)p
c
c ca="right"
p24p
c
r
r
c ca="left"
pGSVIVT00030537001p
c
c ca="left"
psenescence-associated protein, putative [itMedicago truncatulait]p
c
c ca="left"
pSenescence; drought and heat combinationp
c
c ca="left"
pABD32641.1p
c
c ca="left"
p99144 (68%)p
c
c ca="right"
p23p
c
r
r
c ca="left"
pGSVIVT00001432001p
c
c ca="left"
pprotein phosphatase 2c, putative [itRicinus communisit]p
c
c ca="left"
psenescence; drought and heat combinationp
c
c ca="left"
pEEF34881.1p
c
c ca="left"
p319389 (82%)p
c
c ca="right"
p23p
c
r
r
c ca="left"
pGSVIVT00033193001p
c
c ca="left"
pgalactinol synthase [itCapsicum annuumit]p
c
c ca="left"
poxidative stress; drought; salinity; chilling; heat shockp
c
c ca="left"
pABQ44212.1p
c
c ca="left"
p239315 (75%)p
c
c ca="right"
p21p
c
r
r
c ca="left"
pGSVIVT00023109001p
c
c ca="left"
pATEXO70H4 (exocyst subunit EXO70 family protein H4); protein binding [itArabidopsis thalianait]p
c
c ca="left"
punidentifiedp
c
c ca="left"
pNP_187563.1p
c
c ca="left"
p331585 (56%)p
c
c ca="right"
p21p
c
r
r
c cspan="6" ca="left"
p
b
itvarious functionsit
b
p
c
r
r
c ca="left"
pGSVIVT00017533001p
c
c ca="left"
pPREDICTED: hypothetical protein [itVitis viniferait]p
c
c ca="left"
punidentifiedp
c
c ca="left"
pXP_002279648.1p
c
c ca="left"
p500500 (100%)p
c
c ca="right"
p20p
c
r
r
c ca="left"
pGSVIVT00020834001p
c
c ca="left"
pCW14 [itArabidopsis thalianait]p
c
c ca="left"
punidentifiedp
c
c ca="left"
pBAA87958.1p
c
c ca="left"
p300533 (56%)p
c
c ca="right"
p23p
c
r
r
c cspan="6" ca="center"
p
bDownregulated genesb
p
c
r
r
c cspan="6" ca="left"
p
b
itDefenceit
b
p
c
r
r
c ca="left"
pGSVIVT00016961001p
c
c ca="left"
pImmunoglobulinmajor histocompatibility complex [itMedicago truncatulait]p
c
c ca="left"
pdisease resistancep
c
c ca="left"
pABP03850.1p
c
c ca="left"
p426672 (63%)p
c
c ca="right"
p-164p
c
r
r
c ca="left"
pGSVIVT00014282001p
c
c ca="left"
ppathogenesis-related like protein [itArabidopsis thalianait]p
c
c ca="left"
pdefencep
c
c ca="left"
pAAM66077.1p
c
c ca="left"
p117215 (54%)p
c
c ca="right"
p-67p
c
r
r
c cspan="6" ca="left"
p
b
itMetabolismit
b
p
c
r
r
c ca="left"
pGSVIVT00027449001p
c
c ca="left"
p(-)-germacrene D synthase [itVitis viniferait]p
c
c ca="left"
pwounding; methyl jasmonatep
c
c ca="left"
pAAS66357.1p
c
c ca="left"
p500553 (90%)p
c
c ca="right"
p-164p
c
r
r
c ca="left"
pGSVIVT00027451001p
c
c ca="left"
p(-)-germacrene D synthase [itVitis viniferait]p
c
c ca="left"
pwounding; methyl jasmonatep
c
c ca="left"
pAAS66357.1p
c
c ca="left"
p503557 (90%)p
c
c ca="right"
p-150p
c
r
r
c ca="left"
pGSVIVT00027450001p
c
c ca="left"
p(-)-germacrene D synthase [itVitis viniferait]p
c
c ca="left"
pwounding; methyl jasmonatep
c
c ca="left"
pAAS66357.1p
c
c ca="left"
p274319 (85%)p
c
c ca="right"
p-53p
c
r
r
c ca="left"
pGSVIVT00027456001p
c
c ca="left"
p(-)-germacrene D synthase [itVitis viniferait]p
c
c ca="left"
pwounding; methyl jasmonatep
c
c ca="left"
pAAS66357.1p
c
c ca="left"
p454545 (83%)p
c
c ca="right"
p-22p
c
r
r
c ca="left"
pGSVIVT00014725001p
c
c ca="left"
pcytochrome P450 [itPopulus trichocarpait]p
c
c ca="left"
ppathogen inducedp
c
c ca="left"
pEEE73840.1p
c
c ca="left"
p299511 (58%)p
c
c ca="right"
p-41p
c
r
r
c ca="left"
pGSVIVT00014727001p
c
c ca="left"
pcytochrome P450 [itPopulus trichocarpait]p
c
c ca="left"
ppathogen inducedp
c
c ca="left"
pEEE73840.1p
c
c ca="left"
p269447 (60%)p
c
c ca="right"
p-35p
c
r
r
c ca="left"
pGSVIVT00007099001p
c
c ca="left"
pthioredoxin x [itPopulus trichocarpait]p
c
c ca="left"
pdefence; abiotic stresses, senescencep
c
c ca="left"
pEEE90516.1p
c
c ca="left"
p98117 (83%)p
c
c ca="right"
p-39p
c
r
r
c ca="left"
pGSVIVT00008711001p
c
c ca="left"
pbeta-cyanoalanine synthase [itBetula pendulait]p
c
c ca="left"
pcyanide metabolismp
c
c ca="left"
pAAN86822.1p
c
c ca="left"
p311352 (88%)p
c
c ca="right"
p-36p
c
r
r
c ca="left"
pGSVIVT00037489001p
c
c ca="left"
pnon-specific lipid transfer protein [itVitis viniferait]p
c
c ca="left"
pdefence relatedp
c
c ca="left"
pABA29446.1p
c
c ca="left"
p119119 (100%)p
c
c ca="right"
p-28p
c
r
r
c ca="left"
pGSVIVT00029445001p
c
c ca="left"
pexpansin [itVitis labrusca x Vitis viniferait]p
c
c ca="left"
pdefence relatedp
c
c ca="left"
pBAC66695.1p
c
c ca="left"
p252252 (100%)p
c
c ca="right"
p-22p
c
r
r
c ca="left"
pGSVIVT00006300001p
c
c ca="left"
pUDP-glucosyltransferase, putative [itRicinus communisit]p
c
c ca="left"
pdefence relatedp
c
c ca="left"
pEEF47681.1p
c
c ca="left"
p268466 (57%)p
c
c ca="right"
p-22p
c
r
r
c cspan="6" ca="left"
p
b
itvarious functionsit
b
p
c
r
r
c ca="left"
pGSVIVT00005678001p
c
c ca="left"
pmale sterility-related protein [itLinum usitatissimumit]p
c
c ca="left"
punidentifiedp
c
c ca="left"
pACA28679.1p
c
c ca="left"
p260503 (51%)p
c
c ca="right"
p-23p
c
r
r
c ca="left"
pGSVIVT00032599001p
c
c ca="left"
phypothetical protein [itVitis viniferait]p
c
c ca="left"
punidentifiedp
c
c ca="left"
pXP_002284962.1p
c
c ca="left"
p368368 (100%)p
c
c ca="right"
p-22p
c
r
tblbdytbl
pFifteen DEGs were less abundant in the INF library. Those present twenty fold or more in the CON library were also listed in Table tblr tid="T3"3tblr, in which 13 genes were classified as defense (2) and metabolism (11), including genes encoding cytochrome P450 and PR proteins. The greatest differences between INF and CON DEGs were (-)-germacrene D synthase and immunoglobulinmajor histocompatibility complex that both were present 164-fold lower in the INF library than in the CON library.p
sec
sec
st
pReal-time RT-PCR analysisp
st
pIn order to validate Solexa expression profiles, the steady-state transcript levels of 12 "defense related" genes were analyzed. Among them, seven genes (CHI4D, TL3, PR10, TIP2;1, CYSP, ERF4, STS5) were upregulated and five genes (THX, SHM1, HypP, GLO, ClpP) were downregulated (Figure figr fid="F5"5figr). Actin, tested to be stable in our previous work, was chosen as a reference gene for data normalization. The trend of RT-PCR based expression profiles among these selected genes was similar to those detected by Solexa-sequencing based method. However, the scales of difference between the INF and CON were generally smaller in Real-time PCR (1-18 fold differences) than in those detected by the Solexa-sequencing based method (2 57 folds) (Table tblr tid="T4"4tblr).p
tbl id="T4"titlepTable 4ptitlecaptionpGenes selected for Real-time RT-PCR.pcaptiontblbdy cols="7"
r
c ca="left"
p
bGeneb
p
c
c ca="left"
p
bDescriptionb
p
c
c ca="left"
p
bForward primerb
p
c
c ca="left"
p
bReverse primerb
p
c
c ca="left"
p
bTarget sizeb
p
c
c ca="right"
p
bSolexa foldb
p
c
c ca="right"
p
bRT-PCR foldb
p
c
r
r
c cspan="7"
hr
c
r
r
c ca="left"
pCHI4Dp
c
c ca="left"
pitV. vinifera itclass IV chitinase (gb|AF532966.1)p
c
c ca="left"
p
monospaceTCCCACGTTCCCCCTTCTmonospace
p
c
c ca="left"
p
monospaceGTAGCTTGGCTGCCATTTTTGmonospace
p
c
c ca="right"
p59p
c
c ca="right"
p11p
c
c ca="right"
p4p
c
r
r
c ca="left"
pTL3p
c
c ca="left"
pitV.vinifera itthaumatin-like protein (gb|AF532965.1)p
c
c ca="left"
p
monospaceACCCCACTCCAACCATCAAGmonospace
p
c
c ca="left"
p
monospaceGATTTTGCAGAGGCCCATTGmonospace
p
c
c ca="right"
p59p
c
c ca="right"
p57p
c
c ca="right"
p4p
c
r
r
c ca="left"
pPR10p
c
c ca="left"
pTamnara Tam-RP10 pathogenesis-related protein 10 (dbj|AB372561.1)p
c
c ca="left"
p
monospaceGGTCAGGCCTCAAGCTATCAAmonospace
p
c
c ca="left"
p
monospaceCAGGGCCTCCGTCTCCTTmonospace
p
c
c ca="right"
p56p
c
c ca="right"
p10p
c
c ca="right"
p3p
c
r
r
c ca="left"
pTIP2;1p
c
c ca="left"
pitV. vinifera itaquaporin TIP2;1 (gb|EF364439.1)p
c
c ca="left"
p
monospaceGCATCATTGCACCCATTGCmonospace
p
c
c ca="left"
p
monospaceGCCTGCAGCCAGGATGTTmonospace
p
c
c ca="right"
p59p
c
c ca="right"
p6p
c
c ca="right"
p1p
c
r
r
c ca="left"
pCYSPp
c
c ca="left"
pitV. vinifera itcysteine protease (gb|EU280160.1)p
c
c ca="left"
p
monospaceCCTCGCAGGAGGAGCACGATmonospace
p
c
c ca="left"
p
monospaceCCGGCGCAGGTTTGCmonospace
p
c
c ca="right"
p54p
c
c ca="right"
p2p
c
c ca="right"
p1p
c
r
r
c ca="left"
pERF4p
c
c ca="left"
pitV. aestivalis itputative ethylene response factor 4 (gb|AY484580.1)p
c
c ca="left"
p
monospaceTCATCACTGCAACTCATCCAmonospace
p
c
c ca="left"
p
monospaceTTACAATCTTCGGCCTCTGAmonospace
p
c
c ca="right"
p101p
c
c ca="right"
p11p
c
c ca="right"
p4p
c
r
r
c ca="left"
pSTS5p
c
c ca="left"
pitV. vinifera itstilbene synthase5 (gb|AY670312.1)p
c
c ca="left"
p
monospaceCGCTCAAGGGAGGAAAGACAmonospace
p
c
c ca="left"
p
monospaceAGCCAAACAAAACACCCCAATCmonospace
p
c
c ca="right"
p58p
c
c ca="right"
p12p
c
c ca="right"
p18p
c
r
r
c ca="left"
pTHXp
c
c ca="left"
pthioredoxin x [Populus trichocarpa] (XP_002310066.1)p
c
c ca="left"
p
monospaceTGCTCAGGAATACGGGGACAGAmonospace
p
c
c ca="left"
p
monospaceTCGCGGGTTTGCATCATmonospace
p
c
c ca="right"
p61p
c
c ca="right"
p-39p
c
c ca="right"
p-2p
c
r
r
c ca="left"
pSHM1p
c
c ca="left"
pitA. thaliana itserine hydroxymethyl transferase 1 (ref|NM_119954.3)p
c
c ca="left"
p
monospaceTGTTCATCAGGTCAGCCAGTTTmonospace
p
c
c ca="left"
p
monospaceTGCGTCGAATTGCAGCAAGATmonospace
p
c
c ca="right"
p63p
c
c ca="right"
p-2p
c
c ca="right"
p-2p
c
r
r
c ca="left"
pHypPp
c
c ca="left"
pHypothetical protein LOC100264849p
c
c ca="left"
p
monospaceTGCCCCTACCCTTGTGACAmonospace
p
c
c ca="left"
p
monospaceGATCAAAATGGCTCATCGGAAmonospace
p
c
c ca="right"
p58p
c
c ca="right"
p-5p
c
c ca="right"
p-3p
c
r
r
c ca="left"
pGLOp
c
c ca="left"
pitV. pseudoreticulata itglyoxal oxidase (gb|D201181.1)p
c
c ca="left"
p
monospaceTCCCAACGCCGGTATAGCmonospace
p
c
c ca="left"
p
monospaceACCGTGCCGTAACGTGTGAmonospace
p
c
c ca="right"
p54p
c
c ca="right"
p-5p
c
c ca="right"
p-1p
c
r
r
c ca="left"
pClpPp
c
c ca="left"
pitCarica papaya itATP-dependent Clp protease proteolytic subunit (gb|DQ159405.1|)p
c
c ca="left"
p
monospaceGGGCGCCGGACAAGAmonospace
p
c
c ca="left"
p
monospaceTTTGCAAATCATCCCTAATGGAmonospace
p
c
c ca="right"
p55p
c
c ca="right"
p-2p
c
c ca="right"
p-2p
c
r
tblbdytbl
fig id="F5"titlepFigure 5ptitlecaptionpReal-time RT-PCR analysis for twelve differentially expressed genespcaptiontext
pbReal-time RT-PCR analysis for twelve differentially expressed genesb. Real-time RT-PCR analysis for twelve transcripts in control (white) and infected (gray) samples, including (a) seven more abundant in the INF library and (b) five less prevalent in the INF library as identified by Solexa expression profile. All data were normalized to the actin expression level. Data represent fold change of RQ (relative quantification) in infected vs. control samples. Bars represent RQ standard deviation calculated from three biological replicates.p
textgraphic file="1471-2229-10-234-5" hint_layout="single"fig
sec
sec
st
pPathway enrichment analysis of DEGsp
st
pThe PV affected biological pathways were evaluated by enrichment analysis of DEGs. Significantly enriched metabolic pathways and signal transduction pathways were identified. A total of 115 pathways were affected by up- and 107 were affected by down-regulated DEGs, respectively (additional file supplr sid="S2"2supplr and supplr sid="S3"3supplr). DEGs with pathway annotation were listed according to enrichment priority (additional file supplr sid="S4"4supplr and supplr sid="S5"5supplr). The first ten enriched pathways were reported in Table tblr tid="T5"5tblr. Pathways with Q value < 0.05 are significantly enriched.p
suppl id="S2"
title
pAdditional file 2p
title
text
p
bComplete list of involved pathways for upregualted DEGsb. Pathways with Q value < 0.05 are significantly enriched for upregulated DEGs.p
text
file name="1471-2229-10-234-S2.DOC"
pClick here for filep
file
suppl
suppl id="S3"
title
pAdditional file 3p
title
text
p
bComplete list of involved pathways for downregualted DEGsb. Pathways with Q value < 0.05 are significantly enriched for downregulated DEGs.p
text
file name="1471-2229-10-234-S3.DOC"
pClick here for filep
file
suppl
suppl id="S4"
title
pAdditional file 4p
title
text
p
bList of "Zuoshan-1" transcripts upregulated for at least 2 fold in INF libraryb. Two fold and more upregualted genes with pathway annotation in INF library were listed in different categories.p
text
file name="1471-2229-10-234-S4.XLS"
pClick here for filep
file
suppl
suppl id="S5"
title
pAdditional file 5p
title
text
p
bList of "Zuoshan-1" transcripts downregulated for at least 2 fold in INF libraryb. Two fold and more downregualted genes with pathway annotation in INF library were listed in different categories.p
text
file name="1471-2229-10-234-S5.XLSX"
pClick here for filep
file
suppl
tbl id="T5"titlepTable 5ptitlecaptionpList of first ten pathways for up- and downregulated EDGs.pcaptiontblbdy cols="5"
r
c ca="left"
p
bPathway termb
p
c
c ca="left"
p
bPathway IDb
p
c
c ca="left"
p
bDEGs testedb
p
c
c ca="left"
p
bP valueb
p
c
c ca="left"
p
bQ valueb
p
c
r
r
c cspan="5"
hr
c
r
r
c cspan="5" ca="left"
p
b
itPathways for upregulated DEGsit
b
p
c
r
r
c ca="left"
pRibosomep
c
c ca="left"
pko03010p
c
c ca="left"
p53 (4.36%)p
c
c ca="left"
p0.0004p
c
c ca="left"
p0.0406p
c
r
r
c ca="left"
pAmino sugar and nucleotide sugar metabolismp
c
c ca="left"
pko00520p
c
c ca="left"
p25 (2.06%)p
c
c ca="left"
p0.0010p
c
c ca="left"
p0.0563p
c
r
r
c ca="left"
pGlycolysisGluconeogenesisp
c
c ca="left"
pko00010p
c
c ca="left"
p28 (2.3%)p
c
c ca="left"
p0.0043p
c
c ca="left"
p0.1660p
c
r
r
c ca="left"
pBiosynthesis of alkaloids derived from histidine and purinep
c
c ca="left"
pko01065p
c
c ca="left"
p31 (2.55%)p
c
c ca="left"
p0.0126p
c
c ca="left"
p0.3636p
c
r
r
c ca="left"
pBiosynthesis of alkaloids derived from ornithine, lysine and nicotinic acidp
c
c ca="left"
pko01064p
c
c ca="left"
p35 (2.88%)p
c
c ca="left"
p0.0207p
c
c ca="left"
p0.4459p
c
r
r
c ca="left"
pStarch and sucrose metabolismp
c
c ca="left"
pko00500p
c
c ca="left"
p49 (4.03%)p
c
c ca="left"
p0.0233p
c
c ca="left"
p0.4459p
c
r
r
c ca="left"
pBiosynthesis of alkaloids derived from shikimate pathwayp
c
c ca="left"
pko01063p
c
c ca="left"
p39 (3.21%)p
c
c ca="left"
p0.0361p
c
c ca="left"
p0.5868p
c
r
r
c ca="left"
pN-Glycan biosynthesisp
c
c ca="left"
pko00510p
c
c ca="left"
p10 (0.82%)p
c
c ca="left"
p0.0528p
c
c ca="left"
p0.5868p
c
r
r
c ca="left"
pFructose and mannose metabolismp
c
c ca="left"
pko00051p
c
c ca="left"
p14 (1.15%)p
c
c ca="left"
p0.0560p
c
c ca="left"
p0.5868p
c
r
r
c ca="left"
pSelenoamino acid metabolismp
c
c ca="left"
pko00450p
c
c ca="left"
p11 (0.91%)p
c
c ca="left"
p0.0587p
c
c ca="left"
p0.5868p
c
r
r
c cspan="5" ca="left"
p
b
itPathways for downregulated DEGsit
b
p
c
r
r
c ca="left"
pPhotosynthesisp
c
c ca="left"
pko00195p
c
c ca="left"
p20 (3.14%)p
c
c ca="left"
p9.9613e-06p
c
c ca="left"
p0.0011p
c
r
r
c ca="left"
pPhotosynthesis antenna proteinsp
c
c ca="left"
pko00196p
c
c ca="left"
p6 (0.94%)p
c
c ca="left"
p4.2252e-05p
c
c ca="left"
p0.0023p
c
r
r
c ca="left"
pFolate biosynthesisp
c
c ca="left"
pko00790p
c
c ca="left"
p5 (0.78%)p
c
c ca="left"
p0.0002p
c
c ca="left"
p0.0064p
c
r
r
c ca="left"
pNicotinate and nicotinamide metabolismp
c
c ca="left"
pko00760p
c
c ca="left"
p5 (0.78%)p
c
c ca="left"
p0.0007p
c
c ca="left"
p0.0125p
c
r
r
c ca="left"
pFructose and mannose metabolismp
c
c ca="left"
pko00051p
c
c ca="left"
p13 (2.04%)p
c
c ca="left"
p0.0007p
c
c ca="left"
p0.0125p
c
r
r
c ca="left"
pCarbon fixation in photosynthetic organismsp
c
c ca="left"
pko00710p
c
c ca="left"
p13 (2.04%)p
c
c ca="left"
p0.0007p
c
c ca="left"
p0.0125p
c
r
r
c ca="left"
pPyruvate metabolismp
c
c ca="left"
pko00620p
c
c ca="left"
p14 (2.2%)p
c
c ca="left"
p0.0014p
c
c ca="left"
p0.0210p
c
r
r
c ca="left"
pPolyketide sugar unit biosynthesisp
c
c ca="left"
pko00523p
c
c ca="left"
p4 (0.63%)p
c
c ca="left"
p0.0016p
c
c ca="left"
p0.0210p
c
r
r
c ca="left"
pPurine metabolismp
c
c ca="left"
pko00230p
c
c ca="left"
p21 (3.3%)p
c
c ca="left"
p0.0018p
c
c ca="left"
p0.0215p
c
r
r
c ca="left"
pBiosynthesis of alkaloids derived from histidine and purinep
c
c ca="left"
pko01065p
c
c ca="left"
p21 (3.3%)p
c
c ca="left"
p0.0025p
c
c ca="left"
p0.0270p
c
r
tblbdytbl
pRibosomal-associated proteins constituted the only significantly affected pathway for the upregulated DEGs (Q <0.05). Other non-significant enriched pathways with large number of upregulated DEGs included amino sugar and nucleotide sugar metabolism, starch and sucrose metabolism, secondary metabolism, plant hormone biosynthesis, and splicesome associated proteins. There were more significantly enriched pathways (10) for the downregulated DEGs, which were involved in photosynthesis, as well as metabolism of folate, nicotinate, nicotinamide, fructose, mannose, pyruvate, polyketide sugar unit, and purines, along with alkaloids from histidine and purines.p
sec
sec
sec
st
pDiscussionp
st
pIn this report Solexa sequencing technology, a high-throughput DNA sequencing approach, was utilized to estimate gene expression in libraries prepared from infected and control tissues. The results (Figure figr fid="F2"2figr) provided estimates of gene expression as determined by the frequency that any given tag (representing a transcript) is sequenced. The data indicate that there is sufficient coverage depth to reach saturation, that is, a complete assessment of all transcripts present in the libraries. Theoretically, the rate of novel tag discovery should equal zero if all unique tags of the initial sample had been sequenced. However, this number might be slightly higher because new tags may be added due to the accumulation of sequencing errors as the size of the library increased abbrgrp
abbr bid="B27"27abbr
abbrgrp. Strict filtering and conservative matching allows recognition of erroneous tags, which are then disregarded. All of these precepts may contribute to a loss of substantial sequence information. However, loss of some data potentially made the results more conservative, revealing only robust and bona fide differences. Moreover, the total number of tags after stringent filtering was sufficient for annotation to the reference genes in the grape genome sequence. Theoretically, tags should be generated by itNlaIII itfrom the 3'-most ends of transcripts, but almost 50% of tags from other itNlaIII itsites were also generated in our result. Since only one tag could be generated in each transcript from any itNlaIII itsite in a cDNA, these other itNlaIII ittags represented a given gene redundantly in the expression profile. This phenomenon accounts for the inflated number of unique tags generated (about 200,000) relative to that of the annotated grape genome (about 30,000). These other tags may also arise because of alternative splicing or incomplete enzyme digestion.p
pThe results represent the first large-scale investigation of the gene expression in DM analysis of grapevine. Polesani et al abbrgrp
abbr bid="B28"28abbr
abbrgrp reported 804 transcripts identified in PV infected leaves of susceptible cultivar "Riesling" using cDNA-AFLP. Figueiredo et al abbrgrp
abbr bid="B29"29abbr
abbrgrp found 121 transcripts, representing 29 unique gene differentially expressed between two itV. vinifera itcultivars "Regent" and "Trincadeira" (resistant and susceptible to fungi, respectively) by cDNA microarray. In the current study, 15,249 putative genes were identified among the Solexa sequencing tags for the INF library and 14,549 for the CON library.p
pThe steady-state transcript level for a set of selected genes was confirmed by Real-time RT-PCR. Although the differences in gene expression did not match the magnitude of those detected by Solexa-based sequencing method, the trends of up- and down- regulation were similar. The lower expression level detected by Real-time RT-PCR could be due to the difference of sensitivity between the two technologies. Solexa sequencing has been documented to be more sensitive for estimation of gene expression, especially for low-abundance transcripts compared to microarrays and Real-time RT-PCR abbrgrp
abbr bid="B30"30abbr
abbrgrp. The difference could also be attributed to different inoculation seasons and developmental stages of the grapevines. The materials used for the Solexa sequencing method were obtained from materials inoculated and harvested in September, while materials used for the Real-time RT- PCR analyses were obtained from plants inoculated and harvested in June.p
pDue to the sensitivity of Solexa sequencing technology, many rare transcripts were detected. Among 536 transcripts present predominantly (<2-20 fold) in the INF library, 89 were not detected in the CON library at all. These genes were predicted to be involved in many plant biological processes, including defense. For example, genes encoding cinnamyl alcohol dehydrogenase, lipase-like protein, glutathione synthetase, GDSL-motif lipase, ankyrin repeat family protein, serine hydrolase, proline-rich cell wall protein and multicopper oxidase were previously described as plant defense-related genes. Other rare transcripts detected by Solexa technology were predicted to function in signal transduction (protein kinase, calcium ion binding protein, wall-associated kinase), transport (type IIIa membrane protein, ATP binding protein, D-galactonate transporter, peptide transporter), transcription (ccaat-binding transcription factor, AP2ERF domain-containing transcription factor, mutator-like transposase-like protein), and protein metabolism (ubiquitin-protein ligase, 50S ribosomal protein, S-locus-specific glycoprotein S13 precursor, Rab5-interacting protein). Two novel genes (nectar protein 1, vernalization-insensitive protein) and some genes encoding hypothetical proteins (LOC100244011, LOC100258240, LOC100249110) were also identified from the PV-induced rare DEGs. Among the 608 rare transcripts present more in CON than INF, 69 were not detected at all in the INF library. Most of these transcripts have predicated biological functions in growth regulation (growth regulator protein, A-type cyclin, auxin response factor 8), transport (ATP-binding cassette transporter, AWPM-19-like membrane family protein, copper-transporting atpase p-type), signal transduction (serine-threonine protein kinase, leucine-rich repeat family protein, calcium-binding EF hand family protein, calcium-dependent phospholipid binding ), and metabolism (galacturonosyltransferase 6, methylenetetrahydrofolate dehydrogenase, iron ion bindingoxidoreductase, trehalose-6-phosphate synthase, senescence-associated protein).p
pPathway enrichment analysis revealed the most significantly affected pathways during the PV infection in "Zuoshan-1". It is not surprising that the "ribosome-related" pathway was the most affected for the DEGs more common in INF library. This finding implies that the grapevine utilizes new ribosomes or changes in ribosome components to help synthesize additional proteins, such as PR proteins, to protect itself from the pathogen attack. The second affected pathway was the "amino sugar and nucleotide sugar metabolism" pathway. In this pathway genes encoding chitinase were more prevalent in the INF than the CON library. In addition, genes required for cell wall biosynthesis were also affected, such as D-xylan synthase, UDP-glucose dehydrogenase, and UDP-glucose 4,6-dehydratase. These enzymes are involved in the interconversion of nucleotide sugars, and may regulate glycosylation patterns in response to pathogen, thereby linking signaling with primary metabolism and the dynamics of the extracellular matrix. The other noticeable pathways with a large amount of DEGs associated with PV infection were starch and sucrose metabolism, secondary metabolism, plant hormone biosynthesis, and splicesome-associated proteins. For DEGs less prevalent in infected vs. control libraries, there was significant enrichment for transcripts associated with photosynthesis. This result was similar to the reports of Polesani et al abbrgrp
abbr bid="B28"28abbr
abbr bid="B31"31abbr
abbrgrp. Photosystem I proteins (PsaA, PsaB, PsaC), photosystem II proteins (PsbB, PsbD, PsbO, PsbP, PsbS), cytochorme b6f complex (PetD, PetN) and F-type ATPase (beta, alpha, delta, a, b) were all substantially lower in abundance in INF libraries compared to CON libraries. The reduction of photosynthesis was possibly due to the increase of invertase activity in nucleotide sugar metabolism pathway. Invertase would cleave sucrose into hexose sugars and their accumulation inhibits the Calvin cycle.p
pIt was observed that 251 tags identified in INF library were homologous to the oomycete, indicating that they may belong to PV transcripts, predictably noting the presence of the pathogen. Many of these putative PV transcripts corresponded to genes involved in protein metabolism (16S, 18S, 26S, 28S and 60S ribosomal protein subunits) as a requirement for protein synthesis in the pathogen during the plant-pathogen interaction. Many housekeeping genes (alpha-tubulin, elongation factor 1 alpha, ubiquitin and heat shock protein 70) and genes related to immune response (spike 1 protein and cyclophilin) were also detected. Several PV transcripts showed similarity to enzymes involved in carbohydrate and amino acid metabolism (chlorophyll apoprotein, aspartate aminotransferase, glutamine synthetase and hyaluronoglucosaminidase-4), energy production (ATP synthase subunit B, glyceraldehyde-3-phosphate dehydrogenase, phosphoenolpyruvate carboxykinase and nitrate reductase), and cellular transport (transportin 1, Ksup+ supchannel protein and calmodulin).p
sec
st
pTranscripts more abundant in infected leavesp
st
pA set of transcripts were clearly more abundant in tissue arising after PV infection compared to control. This group possibly contains elements that confer resistance to the spread of the pathogen in "Zuoshan-1". Among these transcripts, those expressed at a relatively high level in infected tissue are of the most interest. These transcripts likely encode genes responding to the pathogen or genuine factors that underlie genetic resistance, which were broadly grouped into the following categories based on their known roles in other plant systems.p
sec
sec
st
pDefense response genesp
st
pAmong defense response genes, thaumatin-like protein abbrgrp
abbr bid="B17"17abbr
abbrgrp, polygalacturonase-inhibiting protein (PGIP) abbrgrp
abbr bid="B32"32abbr
abbr bid="B33"33abbr
abbrgrp, harpin-induced protein-related abbrgrp
abbr bid="B34"34abbr
abbr bid="B35"35abbr
abbrgrp, glutaredoxin abbrgrp
abbr bid="B36"36abbr
abbr bid="B37"37abbr
abbrgrp and beta-glucosidase abbrgrp
abbr bid="B38"38abbr
abbr bid="B39"39abbr
abbrgrp have been widely studied in plant pathogen resistance. Thaumatin-like protein, like many other disease resistant proteins abbrgrp
abbr bid="B40"40abbr
abbrgrp, is also induced by abiotic stresses, which may indicate existence of a crosstalk between pathogen and abiotic stresses. In this category, tobacco mosaic virus (TMV) response -related protein (+32 fold in INF vs CON) is associated with TMV attack and may also play an important role in DM resistance of grape.p
sec
sec
st
pTransportp
st
pThree transcripts were associated with transport function. Multidrug resistance pump proteins (+121 fold in INF vs CON) and multidrug resistance ABC transporter (+25 fold in INF vs CON) are well known transporters in clinical study for bacteria infection of human abbrgrp
abbr bid="B41"41abbr
abbrgrp. Such transporters also have been isolated from plants, such as itCoptis japonica it
abbrgrp
abbr bid="B42"42abbr
abbrgrp. They transport several compounds associated with multidrug (antibiotic) resistance which can inhibit pathogen infection in animal model abbrgrp
abbr bid="B41"41abbr
abbr bid="B43"43abbr
abbrgrp. Another gene identified to be transport related is mitochondrial dicarboxylate carrier protein (+38 fold in INF vs CON) which might be involved in the excretion of organic acids and rhizotoxic aluminum tolerance abbrgrp
abbr bid="B44"44abbr
abbrgrp.p
sec
sec
st
pSignal transductionp
st
pThere were fourteen transcripts in our results associated with signal transduction. Two came from genes (GSVIVT00030628001, GSVIVT00030574001) encoding leucine-rich repeat receptor-like protein kinases which were more prevalent (145 and 20 fold) in the INF library than in control. Molecules that indicate the presence of pathogen (elicitors) activate host receptors and that rapidly generate an internal signal that triggers early defense responses abbrgrp
abbr bid="B45"45abbr
abbrgrp. Various signals presented in our results, including phytohormones like ABA and ethylene, as well as intracellular messengers like calcium, phosphoinositide and kinases, have been proposed to regulate plant responses in adverse environmental conditions and thus contribute to the coordination of plant stress physiology abbrgrp
abbr bid="B46"46abbr
abbrgrp. Transcripts representing three kinase-encoding genes (GSVIVT00030628001, GSVIVT00006178001, GSVIVT00019504001) were present 52-145 fold higher in INF than CON, and have been widely documented as signaling factors in many stresses abbrgrp
abbr bid="B47"47abbr
abbr bid="B48"48abbr
abbr bid="B49"49abbr
abbr bid="B50"50abbr
abbrgrp and senescence abbrgrp
abbr bid="B51"51abbr
abbrgrp. Four transcripts (GSVIVT00002706001, GSVIVT00020989001, GSVIVT00036549001, GSVIVT00002973001) were found to be more abundant (27 to 39 fold) in INF than CON, and were associated with calcium signaling pathway. All of these are also induced by senescence abbrgrp
abbr bid="B52"52abbr
abbrgrp and many stresses abbrgrp
abbr bid="B53"53abbr
abbr bid="B54"54abbr
abbrgrp. Nodulin-like protein (+23 fold in INF vs CON) induced in fungal pathogen treatment abbrgrp
abbr bid="B55"55abbr
abbrgrp and droughtheat combination stress abbrgrp
abbr bid="B40"40abbr
abbrgrp has been shown to be involved in salicylic acid (SA) signaling pathway abbrgrp
abbr bid="B56"56abbr
abbrgrp. A RING-H2 gene (+22 fold in INF vs CON) has demonstrated regulatory function in ABA signaling abbrgrp
abbr bid="B57"57abbr
abbrgrp, drought tolerance abbrgrp
abbr bid="B57"57abbr
abbrgrp, regulation of growth and defense responses against abioticbiotic stresses abbrgrp
abbr bid="B58"58abbr
abbrgrp. Ethylene-regulated transcript 2 (ERT2) (+34 fold in INF vs CON) is involved in ethylene response 'circuit' including ethylene synthesis, perception, signal transduction and regulation of gene expression abbrgrp
abbr bid="B59"59abbr
abbrgrp. The PAR-1a (photoassimilate-responsive) protein (+22 fold in INF vs CON) is a serinethreonine kinase with diverse phosphorylation targets and has been reported to be induced by infection with potato virus Y abbrgrp
abbr bid="B60"60abbr
abbr bid="B61"61abbr
abbrgrp.p
sec
sec
st
pTranscriptionp
st
pEleven transcripts associated with transcription were 21 to 60 fold more abundant in INF than CON libraries. Transcripts annotated as zinc-finger protein 1, DREB protein, AP2 domain class transcription factor, basic helix-loop-helix protein, CBF4(C-repeat binding factor 4), jasmonate ZIM domain 1, GRAS family transcription factor, and WRKY transcription factor 21 were all present at higher steady state levels in infected tissue. They have been documented to play important roles in responding to phytohormone stasis, pathogen attack and environmental stresses abbrgrp
abbr bid="B62"62abbr
abbr bid="B63"63abbr
abbr bid="B64"64abbr
abbr bid="B65"65abbr
abbr bid="B66"66abbr
abbr bid="B67"67abbr
abbr bid="B68"68abbr
abbr bid="B69"69abbr
abbrgrp.p
sec
sec
st
pMetabolismp
st
sec
st
pSynthesis of the hormonesp
st
pS-adenosyl-L-methionine (GSVIVT00024884001) and 9-cis-epoxycarotenoid dioxygenase 1(NCED1) (GSVIVT00000988001) are transcripts related to synthesis of plant hormones, and were found more frequently (97 and 62 fold, respectively) in the INF library. S-adenosyl-L-methionine is the precursor of ethylene abbrgrp
abbr bid="B70"70abbr
abbrgrp which participates in regulation of growth, development, and responses to stress and pathogen attack in plants abbrgrp
abbr bid="B71"71abbr
abbrgrp. NCED is an important enzyme in synthesizing the phytohormone ABA which plays a central role in responses to pathogen attack abbrgrp
abbr bid="B72"72abbr
abbrgrp.p
sec
sec
st
pProtein metabolismp
st
pTwelve transcripts related to protein metabolism were more abundant in the INF library, 21 fold to 72 fold. Among them, ubiquitin-protein ligase (GSVIVT00028930001, GSVIVT00035825001), spotted leaf protein (GSVIVT00017518001, GSVIVT00028839001) and f-box family protein (GSVIVT00022245001, GSVIVT00009741001) were identified, and represent proteins involved in ubiquitination and subsequent degradation of target proteins. Aspartic proteinase nepenthesin-1 precursor (GSVIVT00032938001) is expressed at higher level in "Nipponbare" in response to phosphorus deficiency abbrgrp
abbr bid="B73"73abbr
abbrgrp and isolated from salt-stress wild rice "itPorteresia coarctatait" abbrgrp
abbr bid="B74"74abbr
abbrgrp. Protein phosphatase 2c (GSVIVT00024072001, GSVIVT00024235001, GSVIVT00001432001) regulates numerous ABA responses abbrgrp
abbr bid="B75"75abbr
abbr bid="B76"76abbr
abbrgrp. Nucleic acid binding proteins (GSVIVT00024387001) control genes expression in response to oxidative stress abbrgrp
abbr bid="B77"77abbr
abbrgrp, ABA treatment abbrgrp
abbr bid="B78"78abbr
abbrgrp and abiotic stresses abbrgrp
abbr bid="B79"79abbr
abbrgrp. Exocyst subunit EXO70 family protein H4 (GSVIVT00023109001) has been shown to be involved in the exocytic pathway, which sorts newly synthesized proteins from the endoplasmic reticulum to their final destination at the lysosome, vacuole or plasma membrane abbrgrp
abbr bid="B80"80abbr
abbrgrp.p
sec
sec
st
pSecondary metabolismp
st
pThis subcategory contained 4 genes, including a higher level of tropinone reductase (GSVIVT00018424001, +48 fold in INF vs CON) transcript in infected leaves, consistent with previous reports showing it to be more abundant after pathogen infection abbrgrp
abbr bid="B81"81abbr
abbrgrp. Isoflavone reductase-like protein 3 (GSVIVT00019233001, +31 fold in INF vs CON) also has a potential pathogen resistance role because it is involved in biosynthesis of isoflavonoid phytoalexins abbrgrp
abbr bid="B82"82abbr
abbrgrp, an important product in resistance to pathogen infection abbrgrp
abbr bid="B83"83abbr
abbr bid="B84"84abbr
abbrgrp. UDP-glucose glucosyltransferase (GSVIVT00002450001, + 24 fold in INF vs CON) and galactinol synthase (GSVIVT00019669001, + 24 fold in INF vs CON) are reported to be induced by abiotic stresses abbrgrp
abbr bid="B85"85abbr
abbr bid="B86"86abbr
abbrgrp.p
sec
sec
st
pCell wall organizationp
st
pThree genes were classified into this subcategory. Cellulose synthase-like D1 (GSVIVT00014029001, + 31 fold in INF vs CON) and beta-expansin 1a precursor (GSVIVT00036225001, + 27 fold in INF vs CON) contribute to cell wall synthesis and modification abbrgrp
abbr bid="B87"87abbr
abbr bid="B88"88abbr
abbrgrp. The wound-induced protein (WIN2) (GSVIVT00007452001, + 26 fold in INF vs CON) with anti-fungal activity abbrgrp
abbr bid="B89"89abbr
abbrgrp possesses a domain that binds PAMP (pathogen-associated molecular patterns) elicitors (e.g., chitin) abbrgrp
abbr bid="B90"90abbr
abbrgrp and is induced in response to pathogen. In addition, other highly expressed metabolic genes in the INF samples were glucose-1-phosphate adenylyltransferase (GSVIVT00036349001, + 24 fold in INF vs CON), cytochrome P450 (GSVIVT00014730001, + 70 fold in INF vs CON) and serine acetyltransferase (GSVIVT00007984001, + 30 fold in INF vs CON). These transcripts are related to carbohydrate metabolism, photosynthesis and cysteine synthesis. Cysteine synthesis has reported to respond to oxidative stress by calcium signaling abbrgrp
abbr bid="B91"91abbr
abbrgrp.p
pEven though most of these genes have been reported to be biotic or abiotic stresses related, seven high expressed genes in the infected leaves have not been previously reported being associated with stress. They were noted as protein-binding protein (GSVIVT00024408001, + 87 fold in INF vs CON), ATPP2-A2 (itArabidopsis thaliana itphloem protein 2-A2) (GSVIVT00023009001, + 56 fold in INF vs CON), putative integral membrane protein (GSVIVT00014704001, + 51 fold in INF vs CON), putative phosphate-induced protein (GSVIVT00015203001, + 229; GSVIVT00015200001, +37 fold in INF vs CON), ATP-dependent DNA helicase (GSVIVT00016166001, +36 fold in INF vs CON), CW14 (GSVIVT00020834001, +23 fold in INF vs CON), and a hypothetical protein (GSVIVT00017533001, +20 fold in INF vs CON).p
sec
sec
sec
st
pTranscripts less abundant in infected leavesp
st
pThe most striking functions for transcripts less abundant in infected tissue were those associated with metabolism and defense response to pathogen attack. Fifteen DEGs were detected to be less prevalent in the INF libraries more than 20 fold compared to CON, most of which, such as (-)-germacrene D synthase abbrgrp
abbr bid="B92"92abbr
abbrgrp, non-specific lipid transfer protein abbrgrp
abbr bid="B93"93abbr
abbrgrp, major histocompatibility complex abbrgrp
abbr bid="B94"94abbr
abbrgrp, thioredoxin abbrgrp
abbr bid="B95"95abbr
abbrgrp, beta-cyano-alanine synthase abbrgrp
abbr bid="B96"96abbr
abbrgrp, expansin abbrgrp
abbr bid="B97"97abbr
abbrgrp and UDP-glucosyltransferase abbrgrp
abbr bid="B98"98abbr
abbrgrp are reported to be positively associated with plant defense responses to pathogen attack. However, our data indicated that the expression level of these transcripts was lower in infected tissues.p
pAnother two transcripts that were less prevalent in infected tissue (GSVIVT00014727001, -35 fold in INF vs CON; GSVIVT00014725001, -41 in INF vs CON) belong to cytochrome P450 family with oxidative function. Interestingly, a novel gene encoding male sterility-related protein was also identified in this group, and its function associated with DM response has not been clarified.p
sec
sec
sec
st
pConclusionsp
st
pSolexa-based sequencing can be used for analyzing variation in gene expression between two samples. The gene expression level in "Zuoshan-1" leaves infected with PV changed significantly in comparison with control leaves. Analysis of differentially-expressed genes involved in the pathogen infection allows delineation of candidate genes potentially relevant to DM resistance in grapevines.p
sec
sec
st
pMethodsp
st
sec
st
pPlants material and pathogen infectionp
st
pOne-year-old, certified virus-free seedlings of "Zuoshan-1" were grown and maintained in the greenhouse under a 16-h light8-h dark photoperiod at 25°C, 85% relative humidity. Control plants were maintained under the same conditions. itP. viticola itwas collected from sporulated field leaves and used for the artificial inoculations of surface-sterilized leaves. Infections were conducted by dipping the fourth grapevine leaves in a suspension of 10,000 sporangia per ml pure water. The leaves were covered with plastic bags for one night to ensure high humidity. The fourth unfolded leaf from the shoot apex was harvested from each of three vines, and the three leaves were combined to represent one replicate. Three independent replicates were collected for each sample. Infected leaves were collected every 24 h for 9 days. Control samples were harvested from water-treated leaves incubated under the same conditions.p
sec
sec
st
pPreparation of Digital Expression Librariesp
st
pSamples from infected leaves from 4 d to 8 d were pooled for RNA isolation and library construction. Comparable control leaves were treated identically and in parallel. Total RNA was isolated from the leaf mixture using a modification of the CTAB method as presented by Murray and Thompson abbrgrp
abbr bid="B99"99abbr
abbrgrp. Sequence tag preparation was done with the Digital Gene Expression Tag Profiling Kit (Illumina Inc; San Diego, CA, USA) according to the manufacturer's protocol (version 2.1B). Six micrograms of total RNA was extracted and mRNA was purified using biotin-Oligo (dT) magnetic bead adsorption. First- and second-strand cDNA synthesis was performed after the RNA was bound to the beads. While on the beads, double strand cDNA was digested with itNlaIII itendonuclease to produce a bead-bound cDNA fragment containing sequence from the 3'-most CATG to the poly (A)-tail. These 3' cDNA fragments were purified using magnetic bead precipitation and the Illumina adapter 1 (GEX adapter 1) was added to new 5' end. The junction of Illumina adapter 1 and CATG site was recognized by itMmeIit, which is a Type I endonuclease (with separated recognition sites and digestion sites). The enzyme cuts 17 bp downstream of the CATG site, producing 17 bp cDNA sequence tags with adapter 1. After removing 3' fragments with magnetic bead precipitation, the Illumina adapter 2 (GEX adapter 2) was ligated to 3' end of the cDNA tag. These cDNA fragments represented the tag library.p
sec
sec
st
pSolexa sequencingp
st
pSequencing was performed by "HuaDa Gene" abbrgrp
abbr bid="B100"100abbr
abbrgrp with the method of sequencing by synthesis. A PCR amplification with 15 cycles using Phusion polymerase (Finnzymes, Espoo, Finland) was performed with primers complementary to the adapter sequences to enrich the samples for the desired fragments. The resulting 85 base strips were purified by 6% TBE PAGE Gel electrophoresis. These strips were then digested, and the single-chain molecules were fixed onto the Solexa Sequencing Chip (flow cell). Each molecule grew into a single-molecule cluster sequencing template through in situ amplification. Four color-labeled nucleotides were added, and sequencing was performed with the method of sequencing by synthesis. Image analysis and basecalling were performed using the Illumina Pipeline, and cDNA sequence tags were revealed after purity filtering. The tags passing initial quality tests were sorted and counted. Each tunnel generates millions of raw reads with sequencing length of 35 bp (target tags plus 3'adaptor). Each molecule in the library represented a single tag derived from a single transcript.p
sec
sec
st
pSequence annotationp
st
p"Clean Tags" were obtained by filtering off adaptor-only tags and low-quality tags (containing ambiguous bases). Comparison of the sequences by blastn was carried out using the following databases: NCBI abbrgrp
abbr bid="B101"101abbr
abbrgrp, Genoscope Grape Genome database abbrgrp
abbr bid="B25"25abbr
abbrgrp and VBI Microbial Database abbrgrp
abbr bid="B26"26abbr
abbrgrp. All clean tags were annotated based on grape reference genes. For conservative and precise annotation, only sequences with perfect homology or 1 nt mismatch were considered further. The number of annotated clean tags for each gene was calculated and then normalized to TPM (number of transcripts per million clean tags) abbrgrp
abbr bid="B30"30abbr
abbr bid="B102"102abbr
abbrgrp. Sequences were manually assigned to functional categories based on the analysis of scientific literature.p
sec
sec
st
pIdentification of differentially expressed genes (DEGs)p
st
pA rigorous algorithm to identify differentially expressed genes between two samples was developed abbrgrp
abbr bid="B103"103abbr
abbrgrp. P value was used to test differential transcript accumulation. In the formula below the total clean tag number of the CON library is noted as N1, and total clean tag number of INF library as N2; gene A holds x tags in CON and y tags in INF library. The probability of gene A expressed equally between two samples can be calculated with:p
p
display-formula
m:math name="1471-2229-10-234-i1" xmlns:m="http:www.w3.org1998MathMathML"m:mrow
m:mtextPm:mtext
m:mo stretchy="false"(m:mo
m:mtextym:mtext
m:mo stretchy="false"|m:mo
m:mtextxm:mtext
m:mo stretchy="false")m:mo
m:mo=m:mo
m:msup
m:mrow
m:mrow
m:mo(m:mo
m:mrow
m:mfrac
m:mrow
m:miNm:mi
m:mn2m:mn
m:mrow
m:mrow
m:miNm:mi
m:mn1m:mn
m:mrow
m:mfrac
m:mrow
m:mo)m:mo
m:mrow
m:mrow
m:mtextym:mtext
m:msup
m:mfrac
m:mrow
m:mo stretchy="false"(m:mo
m:mtextxm:mtext
m:mo+m:mo
m:mtextym:mtext
m:mo stretchy="false")m:mo
m:mo!m:mo
m:mrow
m:mrow
m:mtextxm:mtext
m:mo!m:mo
m:mtextym:mtext
m:mo!m:mo
m:msup
m:mrow
m:mrow
m:mo(m:mo
m:mrow
m:mn1m:mn
m:mo+m:mo
m:mfrac
m:mrow
m:msub
m:miNm:mi
m:mn2m:mn
m:msub
m:mrow
m:mrow
m:msub
m:miNm:mi
m:mn1m:mn
m:msub
m:mrow
m:mfrac
m:mrow
m:mo)m:mo
m:mrow
m:mrow
m:mrow
m:mo stretchy="false"(m:mo
m:mtextxm:mtext
m:mo+m:mo
m:mtextym:mtext
m:mo+m:mo
m:mn1m:mn
m:mo stretchy="false")m:mo
m:mrow
m:msup
m:mrow
m:mfrac
m:mrow
m:math
display-formula
p
pFDR (False Discovery Rate) was applied to determine the threshold of P Value in multiple tests and analyses abbrgrp
abbr bid="B104"104abbr
abbrgrp. An "FDR < 0.001 and the absolute value of log2Ratio ≥ 1" was used as the threshold to judge the significance of gene expression difference.p
sec
sec
st
pReal-time RT-PCR analysisp
st
pSamples were prepared using the same method mentioned above and total RNA was isolated from the leaf mixture. Experiments were carried out on three independent biological replicates each containing three technical replicates. First-strand cDNA was synthesized from 650 ng DNase (Promega, Madison, Wisconsin, USA) -treated total RNA using "ImProm-II TM Reverse Transcriptase" (Promega, Madison, Wisconsin, USA) and diluted 20 fold as template. Specific primer pairs of twelve randomly selected genes were designed (Table tblr tid="T4"4tblr) using Primer Express 3.0 and tested by Real-time RT-PCR. Primers specific for itV. vinifera itactin (Forward: AATGTGCCTGCCATGTATGT; Reverse: TCACACCATCACCAGAATCC) were used for the normalization of reactions. Experiments were carried out using Power SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK) in a StepOne™ Real-Time PCR System (Applied Biosystems). The reaction volume was 20 μl, including 10 μl Power SYBR Green PCR master mix, 0.9 μl 10 mM primer, 2.0 μl cDNA sample and 6.20 μl dH2O. The following thermal cycling profile was used: 95°C 10 min; 40 cycles of 95°C for 15 s, 59°C for 1 min; 95°C for 15 s, 60°C for 1 min, 95°C for 15 s. Data were analyzed using StepOne™ Software Version 2.0 (Applied Biosystems). Actin expression was used as an internal control to normalize all data. The fold change in mRNA expression was estimated using threshold cycles, by the ΔΔCT method abbrgrp
abbr bid="B105"105abbr
abbrgrp.p
sec
sec
st
pPathway Enrichment Analysis of DEGsp
st
pPathway enrichment analysis based on KEGG abbrgrp
abbr bid="B106"106abbr
abbrgrp was used to identify significantly enriched metabolic pathways or signal transduction pathways in differentially-expressed genes comparing with the whole genome background. The calculating formula is:p
p
display-formula
m:math name="1471-2229-10-234-i2" xmlns:m="http:www.w3.org1998MathMathML"m:mrow
m:mtextPm:mtext
m:mo=m:mo
m:mn1m:mn
m:mo−m:mo
m:mstyle displaystyle="true"
m:munderover
m:mo∑m:mo
m:mrow
m:miim:mi
m:mo=m:mo
m:mn0m:mn
m:mrow
m:mrow
m:mimm:mi
m:mo−m:mo
m:mn1m:mn
m:mrow
m:munderover
m:mrow
m:mfrac
m:mrow
m:mrow
m:mo(m:mo
m:mrow
m:mtable
m:mtr
m:mtd
m:miMm:mi
m:mtd
m:mtr
m:mtr
m:mtd
m:miim:mi
m:mtd
m:mtr
m:mtable
m:mrow
m:mo)m:mo
m:mrow
m:mrow
m:mo(m:mo
m:mrow
m:mtable
m:mtr
m:mtd
m:mrow
m:miNm:mi
m:mo−m:mo
m:miMm:mi
m:mrow
m:mtd
m:mtr
m:mtr
m:mtd
m:mrow
m:minm:mi
m:mo−m:mo
m:miim:mi
m:mrow
m:mtd
m:mtr
m:mtable
m:mrow
m:mo)m:mo
m:mrow
m:mrow
m:mrow
m:mrow
m:mo(m:mo
m:mrow
m:mtable
m:mtr
m:mtd
m:miNm:mi
m:mtd
m:mtr
m:mtr
m:mtd
m:minm:mi
m:mtd
m:mtr
m:mtable
m:mrow
m:mo)m:mo
m:mrow
m:mrow
m:mfrac
m:mrow
m:mstyle
m:mrow
m:math
display-formula
p
pwhere N is the number of all genes that with KEGG annotation, n is the number of DEGs in N, M is the number of all genes annotated to specific pathways, and m is number of DEGs in M. Q value was used for determining the threshold of P Value in multiple test and analysis abbrgrp
abbr bid="B107"107abbr
abbrgrp. Pathways with Q value < 0.05 are significantly enriched in DEGs.p
sec
sec
sec
st
pAbbreviationsp
st
pAFLP: Amplified Fragment Length Polymorphism; BLAST: Basic Local Alignment Search Tool; cDNA: Complementary DNA; CTAB: Hexadecyltrimethylammonium bromide; DEGs: differentially expressed transcripts; NCBI: National Center for Biotechnology Information.p
sec
sec
st
pAuthors' contributionsp
st
pJW and YLZ carried out the plant material preparation, PV infection, RNA extraction, preparation of digital expression libraries, sequence analysis, and contributed to data interpretation and manuscript writing. HQZ participated in PV infection and RNA extraction. HH contributed to sequence analysis. KMF participated in data interpretation and manuscript modification. JL conceived the study, led the experiment design and coordinated all the research activities, contributed to interpretation of the data, manuscript writing and modification. All authors read and approved the final manuscript.p
sec
bdybm
ack
sec
st
pAcknowledgementsp
st
pThis research was supported by the "948" Program, Ministry of Agriculture, China (grant no.2006-G26) and National Grape Industry Technology System (grant no.nycytx-30-zy-05). We thank Jun Wang for generous gift of "Zuoshan-1" propagation material, and "HuaDa Gene" for technical assistance throughout the data analysis manuscript preparation.p
sec
ack
refgrpbibl id="B1"titlepCompendium of Grape DiseasesptitleaugausnmPearsonsnmfnmRCfnmauausnmGoheensnmfnmACfnmauaugpublisherAPS Presspublisherpubdate1988pubdatebiblbibl id="B2"titlepThe Downy mildewsptitleaugausnmSpencersnmfnmDMfnmauaugpublisherLondon: Academic Presspublisherpubdate1981pubdatebiblbibl id="B3"titlepThe host guides morphogenesis and stomatal targeting in the grapevine pathogen itPlasmopara viticolaitptitleaugausnmKiefersnmfnmBfnmauausnmRiemannsnmfnmMfnmauausnmBuchesnmfnmCfnmauausnmKassemeyersnmfnmHHfnmauausnmNicksnmfnmPfnmauaugsourcePlantasourcepubdate2002pubdatevolume215volumefpage387fpagelpage393lpagexrefbibpubidlistpubid idtype="doi"10.1007s00425-002-0760-2pubidpubid idtype="pmpid" link="fulltext"12111219pubidpubidlistxrefbibbiblbibl id="B4"titlepEvaluation of downy mildew resistance in various accessions of wild itVitis itspeciesptitleaugausnmStaudtsnmfnmGfnmauausnmKassemeyersnmfnmHHfnmauaugsourceVitissourcepubdate1995pubdatevolume34volumefpage225fpagelpage228lpagebiblbibl id="B5"titlepEvaluation of grape germplasm for downy mildew resistanceptitleaugausnmBrownsnmfnmMVfnmauausnmMorresnmfnmJNfnmauausnmFennsnmfnmPfnmauausnmMcNewsnmfnmRWfnmauaugsourceFruit Varieties Journalsourcepubdate1999pubdatevolume53volumefpage22fpagelpage29lpagebiblbibl id="B6"titlepitVinifera itx itrotundifolia ithybrids as wines grapesptitleaugausnmOlmosnmfnmHPfnmauaugsourceAm J Enol Viticsourcepubdate1971pubdatevolume22volumefpage87fpagelpage91lpagebiblbibl id="B7"titlepHistochemical studies on the interaction between three species of grapevine, itVitis viniferait, itV. rupestris itand itV. rotundifolia itand the downy mildew fungus, itPlasmopara viticolaitptitleaugausnmDaisnmfnmGHfnmauausnmAndarysnmfnmCfnmauausnmMondolot-CossonsnmfnmLfnmauausnmBoubalssnmfnmDfnmauaugsourcePhysiol Mol Plant Patholsourcepubdate1995pubdatevolume46volumefpage177fpagelpage188lpagexrefbibpubid idtype="doi"10.1006pmpp.1995.1014pubidxrefbibbiblbibl id="B8"titlepThe Course of Colonization of Two Different itVitis itGenotypes by itPlasmopara viticola itIndicates Compatible and Incompatible Host-Pathogen InteractionsptitleaugausnmUngersnmfnmSfnmauausnmBuchesnmfnmCfnmauausnmBososnmfnmSfnmauausnmKassemeyersnmfnmHHfnmauaugsourcePhytopathologysourcepubdate2007pubdatevolume97volumefpage780fpagelpage786lpagexrefbibpubidlistpubid idtype="doi"10.1094PHYTO-97-7-0780pubidpubid idtype="pmpid" link="fulltext"18943926pubidpubidlistxrefbibbiblbibl id="B9"titlepNonhost versus host resistance to the grapevine downy mildew, itPlasmopara viticolait, studied at the tissue levelptitleaugausnmDiez-NavajassnmfnmAMfnmauausnmWiedemann-MerdinoglusnmfnmSfnmauausnmGreifsnmfnmCfnmauausnmMerdinoglusnmfnmDfnmauaugsourcePhytopathologysourcepubdate2008pubdatevolume98volumefpage776fpagelpage780lpagexrefbibpubidlistpubid idtype="doi"10.1094PHYTO-98-7-0776pubidpubid idtype="pmpid" link="fulltext"18943253pubidpubidlistxrefbibbiblbibl id="B10"titlepGenetic Analysis of Downy Mildew Resistance Derived from itMuscadinia rotundifoliaitptitleaugausnmMerdinoglusnmfnmDfnmauausnmWiedemann-MerdinoglusnmfnmSfnmauausnmCostesnmfnmPfnmauausnmDumassnmfnmVfnmauausnmHaettysnmfnmSfnmauausnmButterlinsnmfnmGfnmauausnmGreifsnmfnmCfnmauaugsourceActa Hortsourcepubdate2003pubdatevolume603volumefpage451fpagelpage456lpagebiblbibl id="B11"titlepCharacterization of itVitis vinifera itNPR1 homologs involved in the regulation of Pathogenesis-Related gene expressionptitleaugausnmHenanffsnmfnmGLfnmauausnmHeitzsnmfnmTfnmauausnmMestresnmfnmPfnmauausnmMutterersnmfnmJfnmauausnmWaltersnmfnmBfnmauausnmChongsnmfnmJfnmauaugsourceBMC Plant Biologysourcepubdate2009pubdatevolume9volumefpage54fpagelpage67lpagexrefbibpubidlistpubid idtype="doi"10.11861471-2229-9-54pubidpubid idtype="pmcid"2686700pubidpubid idtype="pmpid"19432948pubidpubidlistxrefbibbiblbibl id="B12"titlepExpression analysis of defence-related genes in grapevine leaves after inoculation with a host and a non-host pathogenptitleaugausnmKortekampsnmfnmAfnmauaugsourcePlant Physiol Biochemsourcepubdate2006pubdatevolume44volumefpage58fpagelpage67lpagexrefbibpubidlistpubid idtype="doi"10.1016j.plaphy.2006.01.008pubidpubid idtype="pmpid" link="fulltext"16531058pubidpubidlistxrefbibbiblbibl id="B13"titlepBeta-aminobutyric acid-induced resistance in grapevine against downy mildew: involvement of pterostilbeneptitleaugausnmSlaughtersnmfnmARfnmauausnmHamiduzzamansnmfnmMMfnmauausnmGindrosnmfnmKfnmauausnmNeuhaussnmfnmJMfnmauausnmMauch-ManisnmfnmBfnmauaugsourceEur J Plant Patholsourcepubdate2008pubdatevolume122volumefpage185fpagelpage195lpagexrefbibpubid idtype="doi"10.1007s10658-008-9285-2pubidxrefbibbiblbibl id="B14"titlepInduction of beta-1,3-glucanase in Seedlings of Pearl Millet in Response to Infection by itSclerospora graminicolaitptitleaugausnmKinisnmfnmKRfnmauausnmVasanthisnmfnmNSfnmauausnmShettysnmfnmHSfnmauaugsourceEuropean Journal of Plant Pathologysourcepubdate2000pubdatevolume106volumefpage267fpagelpage274lpagexrefbibpubid idtype="doi"10.1023A:1008771124782pubidxrefbibbiblbibl id="B15"titlepCharacterization of 3 new partial stilbene synthase genes out of over 20 expressed in itVitis vinifera itduring the Interaction with itPlasmopara viticolaitptitleaugausnmRichtersnmfnmHfnmauausnmPezetsnmfnmRfnmauausnmViretsnmfnmOfnmauausnmGindrosnmfnmKfnmauaugsourcePhysiological and Molecular Plant Pathologysourcepubdate2006pubdatevolume67volumefpage248fpagelpage260lpagexrefbibpubid idtype="doi"10.1016j.pmpp.2006.03.001pubidxrefbibbiblbibl id="B16"titlepPhenylalanine Ammonia Lyase Activity in Pearl Millet Seedlings and its Relation to Downy Mildew Disease ResistanceptitleaugausnmNagarathnasnmfnmKCfnmauausnmShettysnmfnmSAfnmauausnmShettysnmfnmHSfnmauaugsourceJournal of Experimental Botanysourcepubdate1993pubdatevolume44volumefpage1291fpagelpage1296lpagexrefbibpubid idtype="doi"10.1093jxb44.8.1291pubidxrefbibbiblbibl id="B17"titlepGenetic engineering of plants to enhance resistance to fungal pathogens-a review of progress and future prospectsptitleaugausnmPunjasnmfnmZKfnmauaugsourcePlant Patholsourcepubdate2001pubdatevolume23volumefpage216fpagelpage235lpagebiblbibl id="B18"titlepTransgenic grapevine plants expressing a rice chitinase with enhanced resistance to fungal pathogensptitleaugausnmYamamotosnmfnmTfnmauausnmIketanisnmfnmHfnmauausnmIekisnmfnmHfnmauausnmNishizawasnmfnmYfnmauausnmNotsukasnmfnmKfnmauausnmHibisnmfnmTfnmauausnmHayashisnmfnmTfnmauausnmMatsutasnmfnmNfnmauaugsourcePlant Cell Reportssourcepubdate2000pubdatevolume19volumefpage639fpagelpage646lpagexrefbibpubid idtype="doi"10.1007s002999900174pubidxrefbibbiblbibl id="B19"titlepHigh-efficiency biolistic co-transformation and regeneration of 'Chardonnay' (itVitis vinifera itL.) containing itnpt-II itand antimicrobial peptide genesptitleaugausnmVidalsnmfnmJRfnmauausnmKikkertsnmfnmJRfnmauausnmWallacesnmfnmPGfnmauausnmReischsnmfnmBIfnmauaugsourcePlant Cell Repsourcepubdate2003pubdatevolume22volumefpage252fpagelpage260lpagexrefbibpubidlistpubid idtype="doi"10.1007s00299-003-0682-xpubidpubid idtype="pmpid" link="fulltext"12908080pubidpubidlistxrefbibbiblbibl id="B20"titlepTransgenic plants of itVitis vinifera itcv. Seyval blancptitleaugausnmBornhoffsnmfnmBAfnmauausnmHarstsnmfnmMfnmauausnmZypriansnmfnmEfnmauausnmTopfersnmfnmRfnmauaugsourcePlant Cell Repsourcepubdate2005pubdatevolume24volumefpage433fpagelpage438lpagexrefbibpubidlistpubid idtype="doi"10.1007s00299-005-0959-3pubidpubid idtype="pmpid" link="fulltext"15812658pubidpubidlistxrefbibbiblbibl id="B21"titlepitAgrobacteriumit-mediated genetic transformation of grapevine (itVitis vinifera itL.) with a novel stilbene synthase gene from Chinese wild itVitis pseudoreticulataitptitleaugausnmFansnmfnmCHfnmauausnmPusnmfnmNfnmauausnmWangsnmfnmXPfnmauausnmWangsnmfnmYJfnmauausnmFangsnmfnmLfnmauausnmXusnmfnmWRfnmauausnmZhangsnmfnmJXfnmauaugsourcePlant Cell Tiss Organ Cultsourcepubdate2008pubdatevolume92volumefpage197fpagelpage206lpagexrefbibpubid idtype="doi"10.1007s11240-007-9324-2pubidxrefbibbiblbibl id="B22"titlepGene Effects Controlling Heritability of Downy Mildew Resistance in Nigerian Elite Pearl Millet LinesptitleaugausnmAngarawaisnmfnmIIfnmauausnmKadamssnmfnmAMfnmauausnmBellosnmfnmDfnmauaugsourceWorld Journal of Agricultural Sciencessourcepubdate2008pubdatevolume4volumefpage545fpagelpage549lpagebiblbibl id="B23"titlepCandidate genes mapping and comparative QTL analysis for powdery and downy mildew resistance in grapeptitleaugausnmZypriansnmfnmEfnmauausnmWeltersnmfnmLJfnmauausnmAkkurtsnmfnmMfnmauausnmEbertsnmfnmSfnmauausnmSalakhutdinovsnmfnmIfnmauausnmGöktürk-BaydarsnmfnmNfnmauausnmEibachsnmfnmRfnmauausnmTöpfersnmfnmRfnmauaugsourceActa Hortsourcepubdate2009pubdatevolume827volumefpage535fpagelpage538lpagebiblbibl id="B24"titlepStudy for evaluating infecting disease property on itplasmopara viticola itto the germplasm resources of itvitis amurensis itruprptitleaugausnmLisnmfnmXfnmauausnmShensnmfnmYfnmauausnmGesnmfnmYfnmauausnmZangsnmfnmPfnmauausnmAisnmfnmJfnmauausnmJinsnmfnmSfnmauaugsourceSpecial Wild Economic Animal and Plant Researchsourcepubdate1999pubdatevolume2volumefpage10fpagelpage13lpagebiblbibl id="B25"titlepGenoscope Grape Genome databaseptitleurlhttp:www.cns.frspipVitis-ninifera-e.htmlurlbiblbibl id="B26"titlepVBI Microbial Databaseptitleurlhttp:phytophthora.vbi.vt.eduurlbiblbibl id="B27"titlepUnexpected observations after mapping LongSAGE tags to the human genomeptitleaugausnmKeimesnmfnmCfnmauausnmSemonsnmfnmMfnmauausnmMouchiroudsnmfnmDfnmauausnmDuretsnmfnmLfnmauausnmGandrillonsnmfnmOfnmauaugsourceBMC Bioinformaticssourcepubdate2007pubdatevolume8volumefpage154fpagexrefbibpubidlistpubid idtype="doi"10.11861471-2105-8-154pubidpubid idtype="pmcid"1884178pubidpubid idtype="pmpid"17504516pubidpubidlistxrefbibbiblbibl id="B28"titlepcDNA-AFLP analysis of plant and pathogen genes expressed in grapevine infected with itPlasmopara viticolaitptitleaugausnmPolesanisnmfnmMfnmauausnmDesariosnmfnmFfnmauausnmFerrarinisnmfnmAfnmauausnmZambonisnmfnmAfnmauausnmPezzottisnmfnmMfnmauausnmKortekampsnmfnmAfnmauausnmPolverarisnmfnmAfnmauaugsourceBMC Genomicssourcepubdate2008pubdatevolume9volumefpage142fpagelpage156lpagexrefbibpubidlistpubid idtype="doi"10.11861471-2164-9-142pubidpubid idtype="pmcid"2292706pubidpubid idtype="pmpid"18366764pubidpubidlistxrefbibbiblbibl id="B29"titlepTranscriptional and metabolic profiling of grape (itVitis vinifera itL.) leaves unravel possible innate resistance against pathogenic fungiptitleaugausnmFigueiredosnmfnmAfnmauausnmFortessnmfnmAMfnmauausnmFerreirasnmfnmSfnmauausnmSebastianasnmfnmMfnmauausnmChoisnmfnmYHfnmauausnmSousasnmfnmLfnmauausnmAcioli-SantossnmfnmBfnmauausnmPessoasnmfnmFfnmauausnmVerpoortesnmfnmRfnmauausnmPaissnmfnmMSfnmauaugsourceJ Exp Botsourcepubdate2008pubdatevolume59volumefpage3371fpagelpage3381lpagexrefbibpubidlistpubid idtype="doi"10.1093jxbern187pubidpubid idtype="pmpid" link="fulltext"18648103pubidpubidlistxrefbibbiblbibl id="B30"titlepDeep sequencing-based expression analysis shows major advances in robustness, resolution and inter-lab portability over five microarray platformsptitleaugausnmt HoensnmfnmPAfnmauausnmAriyureksnmfnmYfnmauausnmThygesensnmfnmHHfnmauausnmVreugdenhilsnmfnmEfnmauausnmVossensnmfnmRHfnmauausnmde MenezessnmfnmRXfnmauausnmBoersnmfnmJMfnmauausnmvan OmmensnmfnmGJfnmauausnmden DunnensnmfnmJTfnmauaugsourceNucleic Acids Ressourcepubdate2008pubdatevolume36volumefpagee141fpagexrefbibpubidlistpubid idtype="doi"10.1093nargkn705pubidpubid idtype="pmcid"2588528pubidpubid idtype="pmpid"18927111pubidpubidlistxrefbibbiblbibl id="B31"titlepGeneral and species-specific transcriptional responses to downy mildew infection in a susceptible (itVitis viniferait) and a resistant (itV. ripariait) grapevine speciesptitleaugausnmPolesanisnmfnmMfnmauausnmBortesisnmfnmLfnmauausnmFerrarinisnmfnmAfnmauausnmZambonisnmfnmAfnmauausnmFasolisnmfnmMfnmauausnmZadrasnmfnmCfnmauausnmLovatosnmfnmAfnmauausnmPezzottisnmfnmMfnmauausnmDelledonnesnmfnmMfnmauausnmPolverarisnmfnmAfnmauaugsourceBMC Genomicssourcepubdate2010pubdatevolume11volumefpage117fpagexrefbibpubidlistpubid idtype="doi"10.11861471-2164-11-117pubidpubid idtype="pmcid"2831845pubidpubid idtype="pmpid"20167053pubidpubidlistxrefbibbiblbibl id="B32"titlepPolygalacturonase-inhibiting protein (PGIP) in plant defence: a structural viewptitleaugausnmDi MatteosnmfnmAfnmauausnmBoniventosnmfnmDfnmauausnmTsernoglousnmfnmDfnmauausnmFedericisnmfnmLfnmauausnmCervonesnmfnmFfnmauaugsourcePhytochemistrysourcepubdate2006pubdatevolume67volumefpage528fpagelpage533lpagexrefbibpubidlistpubid idtype="doi"10.1016j.phytochem.2005.12.025pubidpubid idtype="pmpid" link="fulltext"16458942pubidpubidlistxrefbibbiblbibl id="B33"titlepA polygalacturonase-inhibiting protein from grapevine reduces the symptoms of the endopolygalacturonase BcPG2 from itBotrytis cinerea itin itNicotiana ititbenthamiana itleaves without any evidence for in vitro interactionptitleaugausnmJoubertsnmfnmDAfnmauausnmKarssnmfnmIfnmauausnmWagemakerssnmfnmLfnmauausnmBergmannsnmfnmCfnmauausnmKempsnmfnmGfnmauausnmViviersnmfnmMAfnmauausnmvan KansnmfnmJAfnmauaugsourceMol Plant Microbe Interactsourcepubdate2007pubdatevolume20volumefpage392fpagelpage402lpagexrefbibpubidlistpubid idtype="doi"10.1094MPMI-20-4-0392pubidpubid idtype="pmpid" link="fulltext"17427809pubidpubidlistxrefbibbiblbibl id="B34"titlepThe itArabidopsis thaliana ittranscriptome in response to itAgrobacterium tumefaciensitptitleaugausnmDittsnmfnmRFfnmauausnmKerrsnmfnmKFfnmauausnmde FigueiredosnmfnmPfnmauausnmDelrowsnmfnmJfnmauausnmComaisnmfnmLfnmauausnmNestersnmfnmEWfnmauaugsourceMol Plant Microbe Interactsourcepubdate2006pubdatevolume19volumefpage665fpagelpage681lpagexrefbibpubidlistpubid idtype="doi"10.1094MPMI-19-0665pubidpubid idtype="pmpid" link="fulltext"16776300pubidpubidlistxrefbibbiblbibl id="B35"titlepIdentification of plant genes regulated in resistant potato itSolanum sparsipilum itduring the early stages of infection by itGlobodera pallidaitptitleaugausnmJolivetsnmfnmKfnmauausnmGreniersnmfnmEfnmauausnmBouchetsnmfnmJPfnmauausnmEsquibetsnmfnmMfnmauausnmKerlansnmfnmMCfnmauausnmCaromelsnmfnmBfnmauausnmMugnierysnmfnmDfnmauausnmLefebvresnmfnmVfnmauaugsourceGenomesourcepubdate2007pubdatevolume50volumefpage422fpagelpage427lpagexrefbibpubidlistpubid idtype="doi"10.1139G07-015pubidpubid idtype="pmpid" link="fulltext"17546100pubidpubidlistxrefbibbiblbibl id="B36"titlepSA-inducible itArabidopsis itglutaredoxin interacts with TGA factors and suppresses JA-responsive PDF1.2 transcriptionptitleaugausnmNdamukongsnmfnmIfnmauausnmAbdallatsnmfnmAAfnmauausnmThurowsnmfnmCfnmauausnmFodesnmfnmBfnmauausnmZandersnmfnmMfnmauausnmWeigelsnmfnmRfnmauausnmGatzsnmfnmCfnmauaugsourcePlant Jsourcepubdate2007pubdatevolume50volumefpage128fpagelpage139lpagexrefbibpubidlistpubid idtype="doi"10.1111j.1365-313X.2007.03039.xpubidpubid idtype="pmpid" link="fulltext"17397508pubidpubidlistxrefbibbiblbibl id="B37"titlepConserved functions of itArabidopsis itand rice CC-type glutaredoxins in flower development and pathogen responseptitleaugausnmWangsnmfnmZfnmauausnmXingsnmfnmSfnmauausnmBirkenbihlsnmfnmRPfnmauausnmZachgosnmfnmSfnmauaugsourceMol Plantsourcepubdate2009pubdatevolume2volumefpage323fpagelpage335lpagexrefbibpubidlistpubid idtype="doi"10.1093mpssn078pubidpubid idtype="pmpid" link="fulltext"19825617pubidpubidlistxrefbibbiblbibl id="B38"titlepPhysiological compensation in antisense transformants: specific induction of an "ersatz" glucan endo-1,3-beta-glucosidase in plants infected with necrotizing virusesptitleaugausnmBeffasnmfnmRSfnmauausnmNeuhaussnmfnmJMfnmauausnmMeinssnmfnmFfnmsufJrsufauaugsourceProc Natl Acad Sci USAsourcepubdate1993pubdatevolume90volumefpage8792fpagelpage8796lpagexrefbibpubidlistpubid idtype="doi"10.1073pnas.90.19.8792pubidpubid idtype="pmcid"47446pubidpubid idtype="pmpid"8415609pubidpubidlistxrefbibbiblbibl id="B39"titlepbeta-Glucosidase: an elicitor of herbivore-induced plant odor that attracts host-searching parasitic waspsptitleaugausnmMattiaccisnmfnmLfnmauausnmDickesnmfnmMfnmauausnmPosthumussnmfnmMAfnmauaugsourceProc Natl Acad Sci USAsourcepubdate1995pubdatevolume92volumefpage2036fpagelpage2040lpagexrefbibpubidlistpubid idtype="doi"10.1073pnas.92.6.2036pubidpubid idtype="pmcid"42418pubidpubid idtype="pmpid"11607516pubidpubidlistxrefbibbiblbibl id="B40"titlepWhen defense pathways collide. The response of itArabidopsis itto a combination of drought and heat stressptitleaugausnmRizhskysnmfnmLfnmauausnmLiangsnmfnmHfnmauausnmShumansnmfnmJfnmauausnmShulaevsnmfnmVfnmauausnmDavletovasnmfnmSfnmauausnmMittlersnmfnmRfnmauaugsourcePlant Physiolsourcepubdate2004pubdatevolume134volumefpage1683fpagelpage1696lpagexrefbibpubidlistpubid idtype="doi"10.1104pp.103.033431pubidpubid idtype="pmcid"419842pubidpubid idtype="pmpid"15047901pubidpubidlistxrefbibbiblbibl id="B41"titlepMultidrug-resistance efflux pumps not just for resistanceptitleaugausnmPiddocksnmfnmLJfnmauaugsourceNat Rev Microbiolsourcepubdate2006pubdatevolume4volumefpage629fpagelpage636lpagexrefbibpubidlistpubid idtype="doi"10.1038nrmicro1464pubidpubid idtype="pmpid" link="fulltext"16845433pubidpubidlistxrefbibbiblbibl id="B42"titlepInvolvement of CjMDR1, a plant multidrug-resistance-type ATP-binding cassette protein, in alkaloid transport in itCoptis japonicaitptitleaugausnmShitansnmfnmNfnmauausnmBazinsnmfnmIfnmauausnmDansnmfnmKfnmauausnmObatasnmfnmKfnmauausnmKigawasnmfnmKfnmauausnmUedasnmfnmKfnmauausnmSatosnmfnmFfnmauausnmForestiersnmfnmCfnmauausnmYazakisnmfnmKfnmauaugsourceProc Natl Acad Sci USAsourcepubdate2003pubdatevolume100volumefpage751fpagelpage756lpagexrefbibpubidlistpubid idtype="doi"10.1073pnas.0134257100pubidpubid idtype="pmcid"141068pubidpubid idtype="pmpid"12524452pubidpubidlistxrefbibbiblbibl id="B43"titlepRegulation of multidrug resistance in pathogenic fungiptitleaugausnmMorschhausersnmfnmJfnmauaugsourceFungal Genet Biolsourcevolume47volumefpage94fpagelpage106lpagexrefbibpubidlistpubid idtype="doi"10.1016j.fgb.2009.08.002pubidpubid idtype="pmpid" link="fulltext"19665571pubidpubidlistxrefbibbiblbibl id="B44"titlepMolecular cloning and characterization of a mitochondrial dicarboxylatetricarboxylate transporter gene in itCitrus junos itresponse to aluminum stressptitleaugausnmDengsnmfnmWfnmauausnmLuosnmfnmKfnmauausnmLisnmfnmZfnmauausnmYangsnmfnmYfnmauaugsourceMitochondrial DNAsourcepubdate2008pubdatevolume19volumefpage376fpagelpage384lpagexrefbibpubid idtype="pmpid"19462511pubidxrefbibbiblbibl id="B45"titlepEarly signal transduction pathways in plant-pathogen interactionsptitleaugausnmBlumwaldsnmfnmEfnmauausnmAharonsnmfnmGSfnmauausnmLamsnmfnmBCHfnmauaugsourceTrends in Plant Sciencesourcepubdate1998pubdatevolume3volumefpage342fpagelpage346lpagexrefbibpubid idtype="doi"10.1016S1360-1385(98)01289-8pubidxrefbibbiblbibl id="B46"titlepSalt and drought stress signal transduction in plantsptitleaugausnmZhusnmfnmJKfnmauaugsourceAnnu Rev Plant Biolsourcepubdate2002pubdatevolume53volumefpage247fpagelpage273lpagexrefbibpubidlistpubid idtype="doi"10.1146annurev.arplant.53.091401.143329pubidpubid idtype="pmpid" link="fulltext"12221975pubidpubidlistxrefbibbiblbibl id="B47"titlepFIERY1 encoding an inositol polyphosphate 1-phosphatase is a negative regulator of abscisic acid and stress signaling in itArabidopsisitptitleaugausnmXiongsnmfnmLfnmauausnmLeesnmfnmBfnmauausnmIshitanisnmfnmMfnmauausnmLeesnmfnmHfnmauausnmZhangsnmfnmCfnmauausnmZhusnmfnmJKfnmauaugsourceGenes Devsourcepubdate2001pubdatevolume15volumefpage1971fpagelpage1984lpagexrefbibpubidlistpubid idtype="doi"10.1101gad.891901pubidpubid idtype="pmcid"312749pubidpubid idtype="pmpid"11485991pubidpubidlistxrefbibbiblbibl id="B48"titlepRegulation of plant disease resistance, stress responses, cell death, and ethylene signaling in itArabidopsis itby the EDR1 protein kinaseptitleaugausnmTangsnmfnmDfnmauausnmChristiansensnmfnmKMfnmauausnmInnessnmfnmRWfnmauaugsourcePlant Physiolsourcepubdate2005pubdatevolume138volumefpage1018fpagelpage1026lpagexrefbibpubidlistpubid idtype="doi"10.1104pp.105.060400pubidpubid idtype="pmcid"1150416pubidpubid idtype="pmpid"15894742pubidpubidlistxrefbibbiblbibl id="B49"titlepIdentification of putative MAPK kinases in itOryza minuta itand itO. sativa itresponsive to biotic stressesptitleaugausnmYousnmfnmMKfnmauausnmOhsnmfnmSIfnmauausnmOksnmfnmSHfnmauausnmChosnmfnmSKfnmauausnmShinsnmfnmHYfnmauausnmJeungsnmfnmJUfnmauausnmShinsnmfnmJSfnmauaugsourceMol Cellssourcepubdate2007pubdatevolume23volumefpage108fpagelpage114lpagexrefbibpubid idtype="pmpid"17464219pubidxrefbibbiblbibl id="B50"titlepMAPK cascade signalling networks in plant defenceptitleaugausnmPitzschkesnmfnmAfnmauausnmSchikorasnmfnmAfnmauausnmHirtsnmfnmHfnmauaugsourceCurr Opin Plant Biolsourcepubdate2009pubdatevolume12volumefpage421fpagelpage426lpagexrefbibpubidlistpubid idtype="doi"10.1016j.pbi.2009.06.008pubidpubid idtype="pmpid" link="fulltext"19608449pubidpubidlistxrefbibbiblbibl id="B51"titlepAn itarabidopsis itmitogen-activated protein kinase cascade, MKK9-MPK6, plays a role in leaf senescenceptitleaugausnmZhousnmfnmCfnmauausnmCaisnmfnmZfnmauausnmGuosnmfnmYfnmauausnmGansnmfnmSfnmauaugsourcePlant Physiolsourcepubdate2009pubdatevolume150volumefpage167fpagelpage177lpagexrefbibpubidlistpubid idtype="doi"10.1104pp.108.133439pubidpubid idtype="pmcid"2675715pubidpubid idtype="pmpid"19251906pubidpubidlistxrefbibbiblbibl id="B52"titlepSenescence-associated genes induced during compatible viral interactions with grapevine and itArabidopsisitptitleaugausnmEspinozasnmfnmCfnmauausnmMedinasnmfnmCfnmauausnmSomervillesnmfnmSfnmauausnmArce-JohnsonsnmfnmPfnmauaugsourceJ Exp Botsourcepubdate2007pubdatevolume58volumefpage3197fpagelpage3212lpagexrefbibpubidlistpubid idtype="doi"10.1093jxberm165pubidpubid idtype="pmpid" link="fulltext"17761729pubidpubidlistxrefbibbiblbibl id="B53"titlepCalcium signaling during abiotic stress in plantsptitleaugausnmKnightsnmfnmHfnmauaugsourceInt Rev Cytolsourcepubdate2000pubdatevolume195volumefpage269fpagelpage324lpagexrefbibpubidlistpubid idtype="doi"full_textpubidpubid idtype="pmpid"10603578pubidpubidlistxrefbibbiblbibl id="B54"titlepBiotic and abiotic stress responses through calcium-dependent protein kinase (CDPK) signaling in wheat (itTriticum aestivum itL.)ptitleaugausnmLisnmfnmAfnmauausnmWangsnmfnmXfnmauausnmLesebergsnmfnmCHfnmauausnmJiasnmfnmJfnmauausnmMaosnmfnmLfnmauaugsourcePlant Signal Behavsourcepubdate2008pubdatevolume3volumefpage654fpagelpage666lpagexrefbibpubidlistpubid idtype="pmcid"2634547pubidpubid idtype="pmpid"19704816pubidpubidlistxrefbibbiblbibl id="B55"titlepPre-Penetration Apparatus Formation During AM Infection is Associated With a Specific Transcriptome Response in Epidermal CellsptitleaugausnmSicilianosnmfnmVfnmauausnmGenresnmfnmAfnmauausnmBalestrinisnmfnmRfnmauausnmDewitsnmfnmPJfnmauausnmBonfantesnmfnmPfnmauaugsourcePlant Signal Behavsourcepubdate2007pubdatevolume2volumefpage533fpagelpage545lpagexrefbibpubidlistpubid idtype="pmcid"2634361pubidpubid idtype="pmpid"19704551pubidpubidlistxrefbibbiblbibl id="B56"titlepNPR1 protein regulates pathogenic and symbiotic interactions between itRhizobium itand legumes and non-legumesptitleaugausnmPeleg-GrossmansnmfnmSfnmauausnmGolanisnmfnmYfnmauausnmKayesnmfnmYfnmauausnmMelamed-BooksnmfnmNfnmauausnmLevinesnmfnmAfnmauaugsourcePLoS Onesourcepubdate2009pubdatevolume4volumefpagee8399fpagexrefbibpubidlistpubid idtype="doi"10.1371journal.pone.0008399pubidpubid idtype="pmcid"2793007pubidpubid idtype="pmpid"20027302pubidpubidlistxrefbibbiblbibl id="B57"titlepUpregulation of an itArabidopsis itRING-H2 gene, itXERICOit, confers drought tolerance through increased abscisic acid biosynthesisptitleaugausnmKosnmfnmJHfnmauausnmYangsnmfnmSHfnmauausnmHansnmfnmKHfnmauaugsourcePlant Jsourcepubdate2006pubdatevolume47volumefpage343fpagelpage355lpagexrefbibpubidlistpubid idtype="doi"10.1111j.1365-313X.2006.02782.xpubidpubid idtype="pmpid" link="fulltext"16792696pubidpubidlistxrefbibbiblbibl id="B58"titlepFunctional analysis reveals pleiotropic effects of rice RING-H2 finger protein gene itOsBIRF1 iton regulation of growth and defense responses against abiotic and biotic stressesptitleaugausnmLiusnmfnmHfnmauausnmZhangsnmfnmHfnmauausnmYangsnmfnmYfnmauausnmLisnmfnmGfnmauausnmWangsnmfnmXfnmauausnmBasnayakesnmfnmBMfnmauausnmLisnmfnmDfnmauausnmSongsnmfnmFfnmauaugsourcePlant Mol Biolsourcepubdate2008pubdatevolume68volumefpage17fpagelpage30lpagexrefbibpubidlistpubid idtype="doi"10.1007s11103-008-9349-xpubidpubid idtype="pmpid" link="fulltext"18496756pubidpubidlistxrefbibbiblbibl id="B59"titlepProfiling ethylene-regulated gene expression in itArabidopsis thaliana itby microarray analysisptitleaugausnmZhongsnmfnmGYfnmauausnmBurnssnmfnmJKfnmauaugsourcePlant Mol Biolsourcepubdate2003pubdatevolume53volumefpage117fpagelpage131lpagexrefbibpubidlistpubid idtype="doi"10.1023B:PLAN.0000009270.81977.efpubidpubid idtype="pmpid" link="fulltext"14756311pubidpubidlistxrefbibbiblbibl id="B60"titlepitpar-1it, a gene required for establishing polarity in itC. elegans itembryos, encodes a putative SerThr kinase that is asymmetrically distributedptitleaugausnmGuosnmfnmSfnmauausnmKemphuessnmfnmKJfnmauaugsourceCellsourcepubdate1995pubdatevolume81volumefpage611fpagelpage620lpagexrefbibpubidlistpubid idtype="doi"10.10160092-8674(95)90082-9pubidpubid idtype="pmpid" link="fulltext"7758115pubidpubidlistxrefbibbiblbibl id="B61"titlepA simplified procedure for the subtractive cDNA cloning of photoassimilate-responding genes: isolation of cDNAs encoding a new class of pathogenesis-related proteinsptitleaugausnmHerberssnmfnmKfnmauausnmMonkesnmfnmGfnmauausnmBadursnmfnmRfnmauausnmSonnewaldsnmfnmUfnmauaugsourcePlant Mol Biolsourcepubdate1995pubdatevolume29volumefpage1027fpagelpage1038lpagexrefbibpubidlistpubid idtype="doi"10.1007BF00014975pubidpubid idtype="pmpid"8555446pubidpubidlistxrefbibbiblbibl id="B62"titlepZinc-finger transcription factors in plantsptitleaugausnmTakatsujisnmfnmHfnmauaugsourceCell Mol Life Scisourcepubdate1998pubdatevolume54volumefpage582fpagelpage596lpagexrefbibpubidlistpubid idtype="doi"10.1007s000180050186pubidpubid idtype="pmpid" link="fulltext"9676577pubidpubidlistxrefbibbiblbibl id="B63"titlepRole of DREB transcription factors in abiotic and biotic stress tolerance in plantsptitleaugausnmAgarwalsnmfnmPKfnmauausnmAgarwalsnmfnmPfnmauausnmReddysnmfnmMKfnmauausnmSoporysnmfnmSKfnmauaugsourcePlant Cell Repsourcepubdate2006pubdatevolume25volumefpage1263fpagelpage1274lpagexrefbibpubidlistpubid idtype="doi"10.1007s00299-006-0204-8pubidpubid idtype="pmpid" link="fulltext"16858552pubidpubidlistxrefbibbiblbibl id="B64"titlepThe AP2ERF domain transcription factor ORA59 integrates jasmonic acid and ethylene signals in plant defenseptitleaugausnmPresnmfnmMfnmauausnmAtallahsnmfnmMfnmauausnmChampionsnmfnmAfnmauausnmDe VossnmfnmMfnmauausnmPietersesnmfnmCMfnmauausnmMemelinksnmfnmJfnmauaugsourcePlant Physiolsourcepubdate2008pubdatevolume147volumefpage1347fpagelpage1357lpagexrefbibpubidlistpubid idtype="doi"10.1104pp.108.117523pubidpubid idtype="pmcid"2442530pubidpubid idtype="pmpid"18467450pubidpubidlistxrefbibbiblbibl id="B65"titlepbHLH class transcription factors take centre stage in phytochrome signallingptitleaugausnmDueksnmfnmPDfnmauausnmFankhausersnmfnmCfnmauaugsourceTrends Plant Scisourcepubdate2005pubdatevolume10volumefpage51fpagelpage54lpagexrefbibpubidlistpubid idtype="doi"10.1016j.tplants.2004.12.005pubidpubid idtype="pmpid" link="fulltext"15708340pubidpubidlistxrefbibbiblbibl id="B66"titlepTranscription factor CBF4 is a regulator of drought adaptation in itArabidopsisitptitleaugausnmHaakesnmfnmVfnmauausnmCooksnmfnmDfnmauausnmRiechmannsnmfnmJLfnmauausnmPinedasnmfnmOfnmauausnmThomashowsnmfnmMFfnmauausnmZhangsnmfnmJZfnmauaugsourcePlant Physiolsourcepubdate2002pubdatevolume130volumefpage639fpagelpage648lpagexrefbibpubidlistpubid idtype="doi"10.1104pp.006478pubidpubid idtype="pmcid"166593pubidpubid idtype="pmpid"12376631pubidpubidlistxrefbibbiblbibl id="B67"titlepRegulation and function of itArabidopsis itJASMONATE ZIM-domain genes in response to wounding and herbivoryptitleaugausnmChungsnmfnmHSfnmauausnmKoosnmfnmAJfnmauausnmGaosnmfnmXfnmauausnmJayantysnmfnmSfnmauausnmThinessnmfnmBfnmauausnmJonessnmfnmADfnmauausnmHowesnmfnmGAfnmauaugsourcePlant Physiolsourcepubdate2008pubdatevolume146volumefpage952fpagelpage964lpagexrefbibpubidlistpubid idtype="doi"10.1104pp.107.115691pubidpubid idtype="pmcid"2259048pubidpubid idtype="pmpid"18223147pubidpubidlistxrefbibbiblbibl id="B68"titlepNSP1 of the GRAS protein family is essential for itrhizobial itNod factor-induced transcriptionptitleaugausnmSmitsnmfnmPfnmauausnmRaedtssnmfnmJfnmauausnmPortyankosnmfnmVfnmauausnmDebellesnmfnmFfnmauausnmGoughsnmfnmCfnmauausnmBisselingsnmfnmTfnmauausnmGeurtssnmfnmRfnmauaugsourceSciencesourcepubdate2005pubdatevolume308volumefpage1789fpagelpage1791lpagexrefbibpubidlistpubid idtype="doi"10.1126science.1111025pubidpubid idtype="pmpid" link="fulltext"15961669pubidpubidlistxrefbibbiblbibl id="B69"titlepThe WRKY superfamily of plant transcription factorsptitleaugausnmEulgemsnmfnmTfnmauausnmRushtonsnmfnmPJfnmauausnmRobatzeksnmfnmSfnmauausnmSomssichsnmfnmIEfnmauaugsourceTrends Plant Scisourcepubdate2000pubdatevolume5volumefpage199fpagelpage206lpagexrefbibpubidlistpubid idtype="doi"10.1016S1360-1385(00)01600-9pubidpubid idtype="pmpid" link="fulltext"10785665pubidpubidlistxrefbibbiblbibl id="B70"titlepS-Adenosyl-L-methionine: beyond the universal methyl group donorptitleaugausnmRojesnmfnmSfnmauaugsourcePhytochemistrysourcepubdate2006pubdatevolume67volumefpage1686fpagelpage1698lpagexrefbibpubidlistpubid idtype="doi"10.1016j.phytochem.2006.04.019pubidpubid idtype="pmpid" link="fulltext"16766004pubidpubidlistxrefbibbiblbibl id="B71"titlepEthylene: a gaseous signal molecule in plantsptitleaugausnmBleeckersnmfnmABfnmauausnmKendesnmfnmHfnmauaugsourceAnnu Rev Cell Dev Biolsourcepubdate2000pubdatevolume16volumefpage1fpagelpage18lpagexrefbibpubidlistpubid idtype="doi"10.1146annurev.cellbio.16.1.1pubidpubid idtype="pmpid" link="fulltext"11031228pubidpubidlistxrefbibbiblbibl id="B72"titlepitPseudomonas syringae itpv. tomato hijacks the itArabidopsis itabscisic acid signalling pathway to cause diseaseptitleaugausnmde Torres-ZabalasnmfnmMfnmauausnmTrumansnmfnmWfnmauausnmBennettsnmfnmMHfnmauausnmLafforguesnmfnmGfnmauausnmMansfieldsnmfnmJWfnmauausnmRodriguez EgeasnmfnmPfnmauausnmBogresnmfnmLfnmauausnmGrantsnmfnmMfnmauaugsourceEMBO Jsourcepubdate2007pubdatevolume26volumefpage1434fpagelpage1443lpagexrefbibpubidlistpubid idtype="doi"10.1038sj.emboj.7601575pubidpubid idtype="pmcid"1817624pubidpubid idtype="pmpid"17304219pubidpubidlistxrefbibbiblbibl id="B73"titlepStress Response Versus Stress Tolerance: A Transcriptome Analysis of Two Rice Lines Contrasting in Tolerance to Phosphorus DeficiencyptitleaugausnmPariasca-TanakasnmfnmJfnmauausnmSatohsnmfnmKfnmauausnmRosesnmfnmTfnmauausnmMauleonsnmfnmRfnmauausnmWissuwasnmfnmMfnmauaugsourceRicesourcepubdate2009pubdatevolume2volumefpage167fpagelpage185lpagexrefbibpubid idtype="doi"10.1007s12284-009-9032-0pubidxrefbibbiblbibl id="B74"titlepitPorteresia coarctata it(Roxb.) Tateoka, a wild rice: a potential model for studying salt-stress biology in riceptitleaugausnmSenguptasnmfnmSfnmauausnmMajumdersnmfnmALfnmauaugsourcePlant Cell Environsourcepubdate2010pubdatevolume33volumefpage526fpagelpage542lpagexrefbibpubidlistpubid idtype="doi"10.1111j.1365-3040.2009.02054.xpubidpubid idtype="pmpid" link="fulltext"19843254pubidpubidlistxrefbibbiblbibl id="B75"titlepABI1 protein phosphatase 2C is a negative regulator of abscisic acid signalingptitleaugausnmGostisnmfnmFfnmauausnmBeaudoinsnmfnmNfnmauausnmSerizetsnmfnmCfnmauausnmWebbsnmfnmAAfnmauausnmVartaniansnmfnmNfnmauausnmGiraudatsnmfnmJfnmauaugsourcePlant Cellsourcepubdate1999pubdatevolume11volumefpage1897fpagelpage1910lpagexrefbibpubidlistpubid idtype="doi"10.1105tpc.11.10.1897pubidpubid idtype="pmcid"144098pubidpubid idtype="pmpid"10521520pubidpubidlistxrefbibbiblbibl id="B76"titlepProtein phosphatases 2C regulate the activation of the Snf1-related kinase OST1 by abscisic acid in itArabidopsisitptitleaugausnmVladsnmfnmFfnmauausnmRubiosnmfnmSfnmauausnmRodriguessnmfnmAfnmauausnmSirichandrasnmfnmCfnmauausnmBelinsnmfnmCfnmauausnmRobertsnmfnmNfnmauausnmLeungsnmfnmJfnmauausnmRodriguezsnmfnmPLfnmauausnmLaurieresnmfnmCfnmauausnmMerlotsnmfnmSfnmauaugsourcePlant Cellsourcepubdate2009pubdatevolume21volumefpage3170fpagelpage3184lpagexrefbibpubidlistpubid idtype="doi"10.1105tpc.109.069179pubidpubid idtype="pmcid"2782292pubidpubid idtype="pmpid"19855047pubidpubidlistxrefbibbiblbibl id="B77"titlepRNA-binding protein Csx1 mediates global control of gene expression in response to oxidative stressptitleaugausnmRodriguez-GabrielsnmfnmMAfnmauausnmBurnssnmfnmGfnmauausnmMcDonaldsnmfnmWHfnmauausnmMartinsnmfnmVfnmauausnmYatessnmfnmJRfnmauausnmBahlersnmfnmJfnmauausnmRussellsnmfnmPfnmauaugsourceEMBO Jsourcepubdate2003pubdatevolume22volumefpage6256fpagelpage6266lpagexrefbibpubidlistpubid idtype="doi"10.1093embojcdg597pubidpubid idtype="pmcid"291838pubidpubid idtype="pmpid"14633985pubidpubidlistxrefbibbiblbibl id="B78"titlepThe RNA-binding protein FCA is an abscisic acid receptorptitleaugausnmRazemsnmfnmFAfnmauausnmEl-KereamysnmfnmAfnmauausnmAbramssnmfnmSRfnmauausnmHillsnmfnmRDfnmauaugsourceNaturesourcepubdate2006pubdatevolume439volumefpage290fpagelpage294lpagexrefbibpubidlistpubid idtype="doi"10.1038nature04373pubidpubid idtype="pmpid" link="fulltext"16421562pubidpubidlistxrefbibbiblbibl id="B79"titlepGlycine-rich RNA-binding protein 7 affects abiotic stress responses by regulating stomata opening and closing in itArabidopsis thalianaitptitleaugausnmKimsnmfnmJSfnmauausnmJungsnmfnmHJfnmauausnmLeesnmfnmHJfnmauausnmKimsnmfnmKAfnmauausnmGohsnmfnmCHfnmauausnmWoosnmfnmYfnmauausnmOhsnmfnmSHfnmauausnmHansnmfnmYSfnmauausnmKangsnmfnmHfnmauaugsourcePlant Jsourcepubdate2008pubdatevolume55volumefpage455fpagelpage466lpagexrefbibpubidlistpubid idtype="doi"10.1111j.1365-313X.2008.03518.xpubidpubid idtype="pmpid" link="fulltext"18410480pubidpubidlistxrefbibbiblbibl id="B80"titlepThe structures of exocyst subunit Exo70p and the Exo84p C-terminal domains reveal a common motifptitleaugausnmDongsnmfnmGfnmauausnmHutagalungsnmfnmAHfnmauausnmFusnmfnmCfnmauausnmNovicksnmfnmPfnmauausnmReinischsnmfnmKMfnmauaugsourceNat Struct Mol Biolsourcepubdate2005pubdatevolume12volumefpage1094fpagelpage1100lpagexrefbibpubidlistpubid idtype="doi"10.1038nsmb1017pubidpubid idtype="pmpid" link="fulltext"16249794pubidpubidlistxrefbibbiblbibl id="B81"titlepGene expression associated with compatible viral diseases in grapevine cultivarsptitleaugausnmEspinozasnmfnmCfnmauausnmVegasnmfnmAfnmauausnmMedinasnmfnmCfnmauausnmSchlauchsnmfnmKfnmauausnmCramersnmfnmGfnmauausnmArce-JohnsonsnmfnmPfnmauaugsourceFunct Integr Genomicssourcepubdate2007pubdatevolume7volumefpage95fpagelpage110lpagexrefbibpubidlistpubid idtype="doi"10.1007s10142-006-0031-6pubidpubid idtype="pmpid" link="fulltext"16775684pubidpubidlistxrefbibbiblbibl id="B82"titlepA rice isoflavone reductase-like gene, itOsIRLit, is induced by rice blast fungal elicitorptitleaugausnmKimsnmfnmSTfnmauausnmChosnmfnmKSfnmauausnmKimsnmfnmSGfnmauausnmKangsnmfnmSYfnmauausnmKangsnmfnmKYfnmauaugsourceMol Cellssourcepubdate2003pubdatevolume16volumefpage224fpagelpage231lpagexrefbibpubid idtype="pmpid"14651265pubidxrefbibbiblbibl id="B83"titlepEffects of pisatin on itDictyostelium ititdiscoideumit: its relationship to inducible resistance to nystatin and extension to other isoflavonoid phytoalexinsptitleaugausnmPrasannasnmfnmTBfnmauausnmVairamanisnmfnmMfnmauausnmKasbekarsnmfnmDPfnmauaugsourceArch Microbiolsourcepubdate1998pubdatevolume170volumefpage309fpagelpage312lpagexrefbibpubidlistpubid idtype="doi"10.1007s002030050647pubidpubid idtype="pmpid" link="fulltext"9732446pubidpubidlistxrefbibbiblbibl id="B84"titlepGenetic manipulation of isoflavone 7-O-methyltransferase enhances biosynthesis of 4'-O-methylated isoflavonoid phytoalexins and disease resistance in alfalfaptitleaugausnmHesnmfnmXZfnmauausnmDixonsnmfnmRAfnmauaugsourcePlant Cellsourcepubdate2000pubdatevolume12volumefpage1689fpagelpage1702lpagexrefbibpubidlistpubid idtype="doi"10.1105tpc.12.9.1689pubidpubid idtype="pmcid"149079pubidpubid idtype="pmpid"11006341pubidpubidlistxrefbibbiblbibl id="B85"titlepPlant secondary metabolism glycosyltransferases: the emerging functional analysisptitleaugausnmGachonsnmfnmCMfnmauausnmLanglois-MeurinnesnmfnmMfnmauausnmSaindrenansnmfnmPfnmauaugsourceTrends Plant Scisourcepubdate2005pubdatevolume10volumefpage542fpagelpage549lpagexrefbibpubidlistpubid idtype="doi"10.1016j.tplants.2005.09.007pubidpubid idtype="pmpid" link="fulltext"16214386pubidpubidlistxrefbibbiblbibl id="B86"titlepThe contribution of carbohydrates including raffinose family oligosaccharides and sugar alcohols to protection of plant cells from oxidative damageptitleaugausnmNishizawa-YokoisnmfnmAfnmauausnmYabutasnmfnmYfnmauausnmShigeokasnmfnmSfnmauaugsourcePlant Signal Behavsourcepubdate2008pubdatevolume3volumefpage1016fpagelpage1018lpagexrefbibpubidlistpubid idtype="pmcid"2633762pubidpubid idtype="pmpid"19704439pubidpubidlistxrefbibbiblbibl id="B87"titlepCellulose synthase-like genes of riceptitleaugausnmHazensnmfnmSPfnmauausnmScott-CraigsnmfnmJSfnmauausnmWaltonsnmfnmJDfnmauaugsourcePlant Physiolsourcepubdate2002pubdatevolume128volumefpage336fpagelpage340lpagexrefbibpubidlistpubid idtype="doi"10.1104pp.010875pubidpubid idtype="pmcid"1540205pubidpubid idtype="pmpid"11842136pubidpubidlistxrefbibbiblbibl id="B88"titlepGenome-wide transcriptome analysis of two maize inbred lines under drought stressptitleaugausnmZhengsnmfnmJfnmauausnmFusnmfnmJfnmauausnmGousnmfnmMfnmauausnmHuaisnmfnmJfnmauausnmLiusnmfnmYfnmauausnmJiansnmfnmMfnmauausnmHuangsnmfnmQfnmauausnmGuosnmfnmXfnmauausnmDongsnmfnmZfnmauausnmWangsnmfnmHfnmauetalaugsourcePlant Mol Biolsourcevolume72volumefpage407fpagelpage421lpagexrefbibpubidlistpubid idtype="doi"10.1007s11103-009-9579-6pubidpubid idtype="pmpid" link="fulltext"19953304pubidpubidlistxrefbibbiblbibl id="B89"titlepDifferential expression within a family of novel wound-induced genes in potatoptitleaugausnmStanfordsnmfnmAfnmauausnmBevansnmfnmMfnmauausnmNorthcotesnmfnmDfnmauaugsourceMol Gen Genetsourcepubdate1989pubdatevolume215volumefpage200fpagelpage208lpagexrefbibpubidlistpubid idtype="doi"10.1007BF00339718pubidpubid idtype="pmpid"2710099pubidpubidlistxrefbibbiblbibl id="B90"titlepA novel pathogen- and wound-inducible tobacco (itNicotiana tabacumit) protein with antifungal activityptitleaugausnmPonsteinsnmfnmASfnmauausnmBres-VloemanssnmfnmSAfnmauausnmSela-BuurlagesnmfnmMBfnmauausnmvan den ElzensnmfnmPJfnmauausnmMelcherssnmfnmLSfnmauausnmCornelissensnmfnmBJfnmauaugsourcePlant Physiolsourcepubdate1994pubdatevolume104volumefpage109fpagelpage118lpagexrefbibpubidlistpubid idtype="doi"10.1104pp.104.1.109pubidpubid idtype="pmcid"159168pubidpubid idtype="pmpid"8115541pubidpubidlistxrefbibbiblbibl id="B91"titlepCalcium-regulated phosphorylation of soybean serine acetyltransferase in response to oxidative stressptitleaugausnmLiusnmfnmFfnmauausnmYoosnmfnmBCfnmauausnmLeesnmfnmJYfnmauausnmPansnmfnmWfnmauausnmHarmonsnmfnmACfnmauaugsourceJ Biol Chemsourcepubdate2006pubdatevolume281volumefpage27405fpagelpage27415lpagexrefbibpubidlistpubid idtype="doi"10.1074jbc.M604548200pubidpubid idtype="pmpid" link="fulltext"16854983pubidpubidlistxrefbibbiblbibl id="B92"titlepForest tent caterpillars (itMalacosoma disstriait) induce local and systemic diurnal emissions of terpenoid volatiles in hybrid poplar (itPopulus trichocarpa itx itdeltoidesit): cDNA cloning, functional characterization, and patterns of gene expression of (-)-germacrene D synthase, PtdTPS1ptitleaugausnmArimurasnmfnmGfnmauausnmHubersnmfnmDPfnmauausnmBohlmannsnmfnmJfnmauaugsourcePlant Jsourcepubdate2004pubdatevolume37volumefpage603fpagelpage616lpagexrefbibpubidlistpubid idtype="doi"10.1111j.1365-313X.2003.01987.xpubidpubid idtype="pmpid" link="fulltext"14756770pubidpubidlistxrefbibbiblbibl id="B93"titlepLipid transfer proteins (nsLTPs) from barley and maize leaves are potent inhibitors of bacterial and fungal plant pathogensptitleaugausnmMolinasnmfnmAfnmauausnmSegurasnmfnmAfnmauausnmGarcia-OlmedosnmfnmFfnmauaugsourceFEBS Lettsourcepubdate1993pubdatevolume316volumefpage119fpagelpage122lpagexrefbibpubidlistpubid idtype="doi"10.10160014-5793(93)81198-9pubidpubid idtype="pmpid" link="fulltext"8420795pubidpubidlistxrefbibbiblbibl id="B94"titlepMajor histocompatibility complex heterozygosity reduces fitness in experimentally infected miceptitleaugausnmIlmonensnmfnmPfnmauausnmPennsnmfnmDJfnmauausnmDamjanovichsnmfnmKfnmauausnmMorrisonsnmfnmLfnmauausnmGhotbisnmfnmLfnmauausnmPottssnmfnmWKfnmauaugsourceGeneticssourcepubdate2007pubdatevolume176volumefpage2501fpagelpage2508lpagexrefbibpubidlistpubid idtype="doi"10.1534genetics.107.074815pubidpubid idtype="pmcid"1950649pubidpubid idtype="pmpid"17603099pubidpubidlistxrefbibbiblbibl id="B95"titlepThioredoxin: a redox-regulating cellular cofactor for glucocorticoid hormone action. Cross talk between endocrine control of stress response and cellular antioxidant defense systemptitleaugausnmMakinosnmfnmYfnmauausnmOkamotosnmfnmKfnmauausnmYoshikawasnmfnmNfnmauausnmAoshimasnmfnmMfnmauausnmHirotasnmfnmKfnmauausnmYodoisnmfnmJfnmauausnmUmesonosnmfnmKfnmauausnmMakinosnmfnmIfnmauausnmTanakasnmfnmHfnmauaugsourceJ Clin Investsourcepubdate1996pubdatevolume98volumefpage2469fpagelpage2477lpagexrefbibpubidlistpubid idtype="doi"10.1172JCI119065pubidpubid idtype="pmcid"507704pubidpubid idtype="pmpid"8958209pubidpubidlistxrefbibbiblbibl id="B96"titlepBeta-cyanoalanine synthase as a molecular marker for induced resistance by fungal glycoprotein elicitor and commercial plant activatorsptitleaugausnmTakahashisnmfnmHfnmauausnmIshiharasnmfnmTfnmauausnmHasesnmfnmSfnmauausnmChibasnmfnmAfnmauausnmNakahosnmfnmKfnmauausnmAriesnmfnmTfnmauausnmTeraokasnmfnmTfnmauausnmIwatasnmfnmMfnmauausnmTuganesnmfnmTfnmauausnmShibatasnmfnmDfnmauetalaugsourcePhytopathologysourcepubdate2006pubdatevolume96volumefpage908fpagelpage916lpagexrefbibpubidlistpubid idtype="doi"10.1094PHYTO-96-0908pubidpubid idtype="pmpid" link="fulltext"18943757pubidpubidlistxrefbibbiblbibl id="B97"titlepA plant natriuretic peptide-like gene in the bacterial pathogen itXanthomonas axonopodis itmay induce hyper-hydration in the plant host: a hypothesis of molecular mimicryptitleaugausnmNembawaresnmfnmVfnmauausnmSeoighesnmfnmCfnmauausnmSayedsnmfnmMfnmauausnmGehringsnmfnmCfnmauaugsourceBMC Evol Biolsourcepubdate2004pubdatevolume4volumefpage10fpagexrefbibpubidlistpubid idtype="doi"10.11861471-2148-4-10pubidpubid idtype="pmcid"387824pubidpubid idtype="pmpid"15038836pubidpubidlistxrefbibbiblbibl id="B98"titlepDetoxification of the itFusarium itmycotoxin deoxynivalenol by a UDP-glucosyltransferase from itArabidopsis thalianaitptitleaugausnmPoppenbergersnmfnmBfnmauausnmBerthillersnmfnmFfnmauausnmLucyshynsnmfnmDfnmauausnmSieberersnmfnmTfnmauausnmSchuhmachersnmfnmRfnmauausnmKrskasnmfnmRfnmauausnmKuchlersnmfnmKfnmauausnmGlosslsnmfnmJfnmauausnmLuschnigsnmfnmCfnmauausnmAdamsnmfnmGfnmauaugsourceJ Biol Chemsourcepubdate2003pubdatevolume278volumefpage47905fpagelpage47914lpagexrefbibpubidlistpubid idtype="doi"10.1074jbc.M307552200pubidpubid idtype="pmpid" link="fulltext"12970342pubidpubidlistxrefbibbiblbibl id="B99"titlepRapid isolation of high molecular weight plant DNAptitleaugausnmMurraysnmfnmMGfnmauausnmThompsonsnmfnmWFfnmauaugsourceNucleic Acids Ressourcepubdate1980pubdatevolume8volumefpage4321fpagelpage4325lpagexrefbibpubidlistpubid idtype="doi"10.1093nar8.19.4321pubidpubid idtype="pmcid"324241pubidpubid idtype="pmpid"7433111pubidpubidlistxrefbibbiblbibl id="B100"titlepHuaDa Geneptitleurlhttp:www.genomics.org.cnurlbiblbibl id="B101"titlepNCBIptitleurlhttp:blast.ncbi.nlm.nih.govBlast.cgiurlbiblbibl id="B102"titlepNext-generation tag sequencing for cancer gene expression profilingptitleaugausnmMorrissysnmfnmASfnmauausnmMorinsnmfnmRDfnmauausnmDelaneysnmfnmAfnmauausnmZengsnmfnmTfnmauausnmMcDonaldsnmfnmHfnmauausnmJonessnmfnmSfnmauausnmZhaosnmfnmYfnmauausnmHirstsnmfnmMfnmauausnmMarrasnmfnmMAfnmauaugsourceGenome Ressourcepubdate2009pubdatevolume19volumefpage1825fpagelpage1835lpagexrefbibpubidlistpubid idtype="doi"10.1101gr.094482.109pubidpubid idtype="pmcid"2765282pubidpubid idtype="pmpid"19541910pubidpubidlistxrefbibbiblbibl id="B103"titlepThe significance of digital gene expression profilesptitleaugausnmAudicsnmfnmSfnmauausnmClaveriesnmfnmJMfnmauaugsourceGenome Ressourcepubdate1997pubdatevolume7volumefpage986fpagelpage995lpagexrefbibpubid idtype="pmpid" link="fulltext"9331369pubidxrefbibbiblbibl id="B104"titlepControlling the false discovery rate in behavior genetics researchptitleaugausnmBenjaminisnmfnmYfnmauausnmDraisnmfnmDfnmauausnmElmersnmfnmGfnmauausnmKafkafisnmfnmNfnmauausnmGolanisnmfnmIfnmauaugsourceBehav Brain Ressourcepubdate2001pubdatevolume125volumefpage279fpagelpage284lpagexrefbibpubidlistpubid idtype="doi"10.1016S0166-4328(01)00297-2pubidpubid idtype="pmpid"11682119pubidpubidlistxrefbibbiblbibl id="B105"titlepAnalysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) MethodptitleaugausnmLivaksnmfnmKJfnmauausnmSchmittgensnmfnmTDfnmauaugsourceMethodssourcepubdate2001pubdatevolume25volumefpage402fpagelpage408lpagexrefbibpubidlistpubid idtype="doi"10.1006meth.2001.1262pubidpubid idtype="pmpid" link="fulltext"11846609pubidpubidlistxrefbibbiblbibl id="B106"titlepKEGGptitleurlhttp:www.genome.jpkeggurlbiblbibl id="B107"titlepControlling the false discovery rate: a practical and powerful approach to multiple testingptitleaugausnmBenjaminisnmfnmYfnmauausnmHochbergsnmfnmYfnmauaugsourceJournal of the Royal Statistical Society, Series B (Methodological)sourcepubdate1995pubdatevolume57volumefpage289fpagelpage300lpagebiblrefgrp
bmart


xml version 1.0 encoding utf-8 standalone no
mets ID sort-mets_mets OBJID sword-mets LABEL DSpace SWORD Item PROFILE METS SIP Profile xmlns http:www.loc.govMETS
xmlns:xlink http:www.w3.org1999xlink xmlns:xsi http:www.w3.org2001XMLSchema-instance
xsi:schemaLocation http:www.loc.govstandardsmetsmets.xsd
metsHdr CREATEDATE 2012-12-22T12:07:08
agent ROLE CUSTODIAN TYPE ORGANIZATION
name BioMed Central
dmdSec sword-mets-dmd-1 GROUPID sword-mets-dmd-1_group-1
mdWrap SWAP Metadata MDTYPE OTHER OTHERMDTYPE EPDCX MIMETYPE textxml
xmlData
epdcx:descriptionSet xmlns:epdcx http:purl.orgeprintepdcx2006-11-16 xmlns:MIOJAVI
http:purl.orgeprintepdcxxsd2006-11-16epdcx.xsd
epdcx:description epdcx:resourceId sword-mets-epdcx-1
epdcx:statement epdcx:propertyURI http:purl.orgdcelements1.1type epdcx:valueURI http:purl.orgeprintentityTypeScholarlyWork
http:purl.orgdcelements1.1title
epdcx:valueString Whole genome wide expression profiles of Vitis amurensis grape responding to downy mildew by using Solexa sequencing technology
http:purl.orgdctermsabstract
Abstract
Background
Downy mildew (DM), caused by pathogen Plasmopara viticola (PV) is the single most damaging disease of grapes (Vitis L.) worldwide. However, the mechanisms of the disease development in grapes are poorly understood. A method for estimating gene expression levels using Solexa sequencing of Type I restriction-endonuclease-generated cDNA fragments was used for deep sequencing the transcriptomes resulting from PV infected leaves of Vitis amurensis Rupr. cv. Zuoshan-1. Our goal is to identify genes that are involved in resistance to grape DM disease.
Results
Approximately 8.5 million (M) 21-nt cDNA tags were sequenced in the cDNA library derived from PV pathogen-infected leaves, and about 7.5 M were sequenced from the cDNA library constructed from the control leaves. When annotated, a total of 15,249 putative genes were identified from the Solexa sequencing tags for the infection (INF) library and 14,549 for the control (CON) library. Comparative analysis between these two cDNA libraries showed about 0.9% of the unique tags increased by at least five-fold, and about 0.6% of the unique tags decreased more than five-fold in infected leaves, while 98.5% of the unique tags showed less than five-fold difference between the two samples. The expression levels of 12 differentially expressed genes were confirmed by Real-time RT-PCR and the trends observed agreed well with the Solexa expression profiles, although the degree of change was lower in amplitude. After pathway enrichment analysis, a set of significantly enriched pathways were identified for the differentially expressed genes (DEGs), which associated with ribosome structure, photosynthesis, amino acid and sugar metabolism.
Conclusions
This study presented a series of candidate genes and pathways that may contribute to DM resistance in grapes, and illustrated that the Solexa-based tag-sequencing approach was a powerful tool for gene expression comparison between control and treated samples.
http:purl.orgdcelements1.1creator
Wu, Jiao
Zhang, Yali
Zhang, Huiqin
Huang, Hong
Folta, Kevin M
Lu, Jiang
http:purl.orgeprinttermsisExpressedAs epdcx:valueRef sword-mets-expr-1
http:purl.orgeprintentityTypeExpression
http:purl.orgdcelements1.1language epdcx:vesURI http:purl.orgdctermsRFC3066
en
http:purl.orgeprinttermsType
http:purl.orgeprinttypeJournalArticle
http:purl.orgdctermsavailable
epdcx:sesURI http:purl.orgdctermsW3CDTF 2010-10-28
http:purl.orgdcelements1.1publisher
BioMed Central Ltd
http:purl.orgeprinttermsstatus http:purl.orgeprinttermsStatus
http:purl.orgeprintstatusPeerReviewed
http:purl.orgeprinttermscopyrightHolder
Jiao Wu et al.; licensee BioMed Central Ltd.
http:purl.orgdctermslicense
http://creativecommons.org/licenses/by/2.0
http:purl.orgdctermsaccessRights http:purl.orgeprinttermsAccessRights
http:purl.orgeprintaccessRightsOpenAccess
http:purl.orgeprinttermsbibliographicCitation
BMC Plant Biology. 2010 Oct 28;10(1):234
http:purl.orgdcelements1.1identifier
http:purl.orgdctermsURI http://dx.doi.org/10.1186/1471-2229-10-234
fileSec
fileGrp sword-mets-fgrp-1 USE CONTENT
file sword-mets-fgid-0 sword-mets-file-1
FLocat LOCTYPE URL xlink:href 1471-2229-10-234.xml
sword-mets-fgid-1 sword-mets-file-2 applicationpdf
1471-2229-10-234.pdf
sword-mets-fgid-3 sword-mets-file-3 applicationmsword
1471-2229-10-234-S2.DOC
sword-mets-fgid-4 sword-mets-file-4
1471-2229-10-234-S3.DOC
sword-mets-fgid-5 sword-mets-file-5 applicationvnd.openxmlformats-officedocument.spreadsheetml.sheet
1471-2229-10-234-S5.XLSX
sword-mets-fgid-6 sword-mets-file-6 applicationvnd.ms-excel
1471-2229-10-234-S1.XLS
sword-mets-fgid-7 sword-mets-file-7
1471-2229-10-234-S4.XLS
structMap sword-mets-struct-1 structure LOGICAL
div sword-mets-div-1 DMDID Object
sword-mets-div-2 File
fptr FILEID
sword-mets-div-3
sword-mets-div-4
sword-mets-div-5
sword-mets-div-6
sword-mets-div-7
sword-mets-div-8



PAGE 1

Pathways enrichment for upregulated DEGs # Pathway DEGs tested Pvalue Qvalue Pathway ID 1 Ribosome 53 (4.36%) 0.0003533584 0.040 63622 ko03010 2 Amino sugar and nucleotide sugar metabolism 25 (2.06%) 0.0009797429 0.05633522 ko00520 3 Glycolysis / Gluconeogenesis 28 (2.3%) 0.004330702 0.16601024 ko00010 4 Biosynthesis of alkaloids derived from histidine and purine 31 (2.55%) 0.01264678 0.36359493 ko01065 5 Biosynthesis of alkaloids derived from ornithine, lysine and nicotinic acid 35 (2.88%) 0.02071211 0.44594125 ko01064 6 Starch and sucrose metabolism 49 (4.03%) 0.0232665 0.44594125 ko00500 7 Biosynthesis of alkaloids derived from shi kimate pathway 39 (3.21%) 0.03609649 0.58676105 ko01063 8 N Glycan biosynthesis 10 (0.82%) 0.05281267 0.58676105 ko00510 9 Fructose and mannose metabolism 14 (1.15%) 0.05598061 0.58676105 ko00051 10 Selenoamino acid metabolism 11 (0.91%) 0.058659 0.58676105 ko00450 11 Endocytosis 19 (1.56%) 0.0611623 0.58676105 ko04144 12 Glyoxylate and dicarboxylate metabolism 9 (0.74%) 0.0646 5981 0.58676105 ko00630 13 Biosynthesis of plant hormones 82 (6.75%) 0.06632951 0.58676105 ko01070 14 Glycerolipid metabolism 14 (1.15%) 0.07520365 0.61774427 ko00561 15 Pentose phosphate pathway 9 (0.74%) 0.08156704 0.62534731 ko00030 16 Glucosinolate biosynthesis 13 (1.07%) 0.1062271 0.74686141 ko00966 17 Linoleic acid metabolism 15 (1.23%) 0.1104056 0.74686141 ko00591 18 SNARE interactions in vesicular transport 8 (0.66%) 0.1324604 0.82576018 ko04130 19 Glycerophospholipid metabolism 13 (1.07%) 0.1625328 0.82576018 ko00564 20 Thiamine metabolism 3 (0.25%) 0.1671543 0.82576018 ko00730 21 Galactose metabolism 11 (0.91%) 0. 168421 0.82576018 ko00052 22 Carbon fixation in photosynthetic organisms 12 (0.99%) 0.1693123 0.82576018 ko00710 23 Arginine and proline metabolism 11 (0.91%) 0.1763977 0.82576018 ko00330 24 Glutathione metabolism 16 (1.32%) 0.1873108 0.82576018 ko00480 25 Phenylpropanoid biosynthesis 58 (4.77%) 0.1883479 0.82576018 ko00940 26 Ubiquitin mediated proteolysis 28 (2.3%) 0.1894998 0.82576018 ko04120 27 Carotenoid biosynthesis 14 (1.15%) 0.1977340 0.82576018 ko00906 28 Sulfur metabolism 6 (0.49%) 0.2025984 0.82576018 ko00920 29 Biosynthesis of alkaloids derived from terpenoid and polyketide 28 (2.3%) 0.2144095 0.82576018 ko01066 30 Regulation of autophagy 6 (0.49%) 0.2154157 0.82576018 ko04140 31 Anthocyanin biosynthesis 7 (0.58%) 0.2430823 0.86912609 k o00942 32 Spliceosome 48 (3.95%) 0.2464756 0.86912609 ko03040 33 Metabolism of xenobiotics by cytochrome P450 18 (1.48%) 0.2494014 0.86912609 ko00980 34 Glycine, serine and threonine metabolism 9 (0.74%) 0.2951433 0.99827881 ko00260 35 Cyanoamino acid m etabolism 23 (1.89%) 0.3232934 0.99999820 ko00460 36 Citrate cycle (TCA cycle) 9 (0.74%) 0.3287696 0.99999820 ko00020 37 Pentose and glucuronate interconversions 16 (1.32%) 0.3302179 0.99999820 ko00040 38 Ether lipid metabolism 5 (0.41%) 0.3642860 0.99999820 ko00565 39 Flavonoid biosynthesis 45 (3.7%) 0.3668869 0.99999820 ko00941 40 Sphingolipid metabolism 6 (0.49%) 0.3690742 0.99999820 ko00600 41 alpha Linolenic acid metabolism 16 (1.32%) 0.3718613 0.99999820 ko00592 42 Phosphatidylinositol signaling system 12 (0.99%) 0.3746693 0.99999820 ko04070 43 Biosynthesis of phenylpropanoids 80 (6.58%) 0.3761452 0.99999820 ko01061 44 Lipoic acid metabolism 1 (0.08%) 0.3910785 0.99999820 ko00785 45 Nicotinate and nicotinamide metabolism 2 (0.16%) 0.4239257 0.99999820 ko00760 46 Tryptophan metabolism 18 (1.48%) 0.4337001 0.99999820 ko00380 47 Tyrosine metabolism 11 (0.91%) 0.4371867 0.99999820 ko00350 48 Taurine and hypotaurine metabolism 1 (0.08%) 0.4394087 0.99999820 ko00430 49 Fatty acid elongation in m itochondria 1 (0.08%) 0.4394087 0.99999820 ko00062 50 Biotin metabolism 1 (0.08%) 0.4394087 0.99999820 ko00780 51 beta Alanine metabolism 6 (0.49%) 0.4559292 0.99999820 ko00410

PAGE 2

52 Phenylalanine, tyrosine and tryptophan biosynthesis 6 (0.49%) 0.4701938 0.99999820 ko00400 53 Biosynthesis of terpenoids and steroids 49 (4.03%) 0.4712886 0.99999820 ko01062 54 Pyruvate metabolism 1 1 (0.91%) 0.4989662 0.99999820 ko00620 55 Pantothenate and CoA biosynthesis 4 (0.33%) 0.5011226 0.99999820 ko00770 56 RNA degradation 13 (1.07%) 0.5250507 0.99999820 ko03018 57 Isoquinoline alkaloid biosynthesis 4 (0.33%) 0.5352912 0.99999820 ko00950 58 Basal transcription factors 7 (0.58%) 0.5663183 0.99999820 ko03022 59 Riboflavin metabolism 2 (0.16%) 0.5782229 0.99999820 ko 00740 60 Butanoate metabolism 11 (0.91%) 0.6066106 0.99999820 ko00650 61 Brassinosteroid biosynthesis 3 (0.25%) 0.6077089 0.99999820 ko00905 62 Natural killer cell mediated cytotoxicity 5 (0.41%) 0.6224466 0.99999820 ko04650 63 Vitamin B6 metabolism 1 (0.08%) 0.6292897 0.99999820 ko00750 64 Lysine biosynthesis 2 (0.16%) 0.6432084 0.99999820 ko00300 65 Polyketide sugar unit biosynthesis 1 (0.08%) 0.6587246 0.99999820 ko00523 66 Glycosphingolipid biosynthesis globo series 1 (0.08%) 0.6858241 0.99999820 ko00603 67 Tropane, piperidine and pyridine alkaloid biosynthesis 4 (0.33%) 0.6858523 0.99999820 ko00960 68 Alanine, asparta te and glutamate metabolism 9 (0.74%) 0.6861948 0.99999820 ko00250 69 Phenylalanine metabolism 12 (0.99%) 0.7053478 0.99999820 ko00360 70 Benzoxazinoid biosynthesis 9 (0.74%) 0.7210209 0.99999820 ko00402 71 Fatty acid biosynthesis 5 (0.41%) 0.7411899 0.99999820 ko00061 72 Ubiquinone and other terpenoid quinone biosynthesis 5 (0.41%) 0.7513931 0.99999820 ko00130 73 Zeatin biosy nthesis 5 (0.41%) 0.7612938 0.99999820 ko00908 74 Methane metabolism 10 (0.82%) 0.7679758 0.99999820 ko00680 75 Synthesis and degradation of ketone bodies 1 (0.08%) 0.7922814 0.99999820 ko00072 76 Protein export 1 (0.08%) 0.808782 0.99999820 ko03060 77 Glycosaminoglycan degradation 2 (0.16%) 0.826799 0.99999820 ko00531 78 Indole alkaloid biosynthesis 4 (0.33%) 0.8332405 0.999 99820 ko00901 79 Peroxisome 14 (1.15%) 0.8446981 0.99999820 ko04146 80 Porphyrin and chlorophyll metabolism 4 (0.33%) 0.8486837 0.99999820 ko00860 81 Arachidonic acid metabolism 1 (0.08%) 0.8508328 0.99999820 ko00590 82 Biosynthesis of unsaturated fatty acids 8 (0.66%) 0.8652043 0.99999820 ko01040 83 Cysteine and methionine metabolism 18 (1.48%) 0.8800483 0.99999820 ko00270 8 4 Proteasome 4 (0.33%) 0.898869 0.99999820 ko03050 85 Terpenoid backbone biosynthesis 6 (0.49%) 0.9104849 0.99999820 ko00900 86 Non homologous end joining 1 (0.08%) 0.916454 0.99999820 ko03450 87 Fatty acid metabolism 8 (0.66%) 0.9289326 0.99999820 ko00 071 88 Glycosphingolipid biosynthesis ganglio series 1 (0.08%) 0.9292094 0.99999820 ko00604 89 Circadian rhythm plant 14 (1.15%) 0.9296028 0.99999820 ko04712 90 Lysine degradation 4 (0.33%) 0.9337707 0.99999820 ko00310 91 Propanoate metabolism 4 (0 .33%) 0.9405905 0.99999820 ko00640 92 Base excision repair 5 (0.41%) 0.9486342 0.99999820 ko03410 93 Inositol phosphate metabolism 3 (0.25%) 0.9498757 0.99999820 ko00562 94 Stilbenoid, diarylheptanoid and gingerol biosynthesis 24 (1.98%) 0.9524244 0.99999820 ko00945 95 Diterpenoid biosynthesis 7 (0.58%) 0.9544997 0.99999820 ko00904 96 Valine, leucine and isoleucine degradation 4 (0.33%) 0.9549298 0.99999820 ko00280 97 One carbon pool by folate 1 (0.08%) 0.9569408 0.99999820 ko00670 98 DNA replication 5 (0.41%) 0.9582548 0.99999820 ko03030 99 Other glycan degradation 2 (0.16%) 0.9625526 0.99999820 ko00511 100 Limonene and pi nene degradation 18 (1.48%) 0.9664413 0.99999820 ko00903 101 Purine metabolism 12 (0.99%) 0.9814211 0.99999820 ko00230 102 Valine, leucine and isoleucine biosynthesis 2 (0.16%) 0.981447 0.99999820 ko00290 103 Nitrogen metabolism 9 (0.74%) 0.9833426 0.99999820 ko00910 104 Nucleotide excision repair 5 (0.41%) 0.9859516 0.99999820 ko03420 105 Aminoacyl tRNA biosynthesis 5 ( 0.41%) 0.9867233 0.99999820 ko00970 106 Mismatch repair 2 (0.16%) 0.989537 0.99999820 ko03430 107 Metabolic pathways 274 (22.55%) 0.9900928 0.99999820 ko01100

PAGE 3

108 Ascorbate and aldarate metabolism 7 (0.58%) 0.9911425 0.99999820 ko00053 109 Flavone a nd flavonol biosynthesis 9 (0.74%) 0.9918617 0.99999820 ko00944 110 Pyrimidine metabolism 10 (0.82%) 0.9962046 0.99999820 ko0 0240 111 Steroid biosynthesis 2 (0.16%) 0.9993225 0.99999820 ko00100 112 Oxidative phosphorylation 12 (0.99%) 0.9994185 0.99999820 ko00190 113 Monoterpenoid biosynthesis 2 (0.16%) 0.9995698 0.99999820 ko00902 114 ABC transporters 5 (0.41%) 0.999870 5 0.99999820 ko02010 115 Photosynthesis 1 (0.08%) 0.9999982 0.99999820 ko00195