A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inferences from comparative mapping

MISSING IMAGE

Material Information

Title:
A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inferences from comparative mapping
Physical Description:
Mixed Material
Language:
English
Creator:
Ollitrault, Patrick
Terol, Javier
Chen, Chunxian
Federici, Claire T.
Lotfy, Samia
Hippolyte, Isabelle
Publisher:
BioMed Central (BMC Genomics)
Publication Date:

Notes

Abstract:
Background: Most modern citrus cultivars have an interspecific origin. As a foundational step towards deciphering the interspecific genome structures, a reference whole genome sequence was produced by the International Citrus Genome Consortium from a haploid derived from Clementine mandarin. The availability of a saturated genetic map of Clementine was identified as an essential prerequisite to assist the whole genome sequence assembly. Clementine is believed to be a ‘Mediterranean’ mandarin × sweet orange hybrid, and sweet orange likely arose from interspecific hybridizations between mandarin and pummelo gene pools. The primary goals of the present study were to establish a Clementine reference map using codominant markers, and to perform comparative mapping of pummelo, sweet orange, and Clementine. Results: Five parental genetic maps were established from three segregating populations, which were genotyped with Single Nucleotide Polymorphism (SNP), Simple Sequence Repeats (SSR) and Insertion-Deletion (Indel) markers. An initial medium density reference map (961 markers for 1084.1 cM) of the Clementine was established by combining male and female Clementine segregation data. This Clementine map was compared with two pummelo maps and a sweet orange map. The linear order of markers was highly conserved in the different species. However, significant differences in map size were observed, which suggests a variation in the recombination rates. Skewed segregations were much higher in the male than female Clementine mapping data. The mapping data confirmed that Clementine arose from hybridization between ‘Mediterranean’ mandarin and sweet orange. The results identified nine recombination break points for the sweet orange gamete that contributed to the Clementine genome. Conclusions: A reference genetic map of citrus, used to facilitate the chromosome assembly of the first citrus reference genome sequence, was established. The high conservation of marker order observed at the interspecific level should allow reasonable inferences of most citrus genome sequences by mapping next-generation sequencing (NGS) data in the reference genome sequence. The genome of the haploid Clementine used to establish the citrus reference genome sequence appears to have been inherited primarily from the ‘Mediterranean’ mandarin. The high frequency of skewed allelic segregations in the male Clementine data underline the probable extent of deviation from Mendelian segregation for characters controlled by heterozygous loci in male parents. Keywords: C. clementina, C. sinensis, C. maxima, SSRs, SNPs, Indels, Genetic maps
General Note:
Publication of this article was funded in part by the University of Florida Open-Access publishing Fund. In addition,requestors receiving funding through the UFOAP project are expected to submit a post-review, final draft of the article to UF's institutional repository, IR @ UF, (www.uflib.ufl.edu/UFir) at the time of funding. The institutional Repository at the University of Florida community, with research, news, outreach, and educational materials.
General Note:
Ollitrault et al. BMC Genomics 2012, 13:593 Page 2 of 20 http://www.biomedcentral.com/1471-2164/13/593; Pages 1-20
General Note:
doi:10.1186/1471-2164-13-593 Cite this article as: Ollitrault et al.: A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inferences from comparative mapping. BMC Genomics 2012 13:593.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All rights reserved by the source institution.
System ID:
AA00013683:00001

Full Text


Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


BM ics
Genomics


A reference genetic map of C. clementina hort. ex

Tan.; citrus evolution inferences from comparative

mapping

Patrick Ollitrault1'2, Javier Terol3, Chunxian Chen4, Claire T Federici5, Samia Lotfy1'6, Isabelle Hippolyte1,
Fr6d6rique Ollitrault2 Aur6lie B6rard7, Aur6lie Chauveau7, Jose Cuenca 2, Gilles Costantino8, Yildiz Kacar9, Lisa Mu5,
Andres Garcia-Lor2, Yann Froelicherl, Pablo Aleza2, Anne Bolando, Claire Billoti, Luis Navarro2, Francois Luro8,
Mikeal L Rooses, Frederick G Gmitter4, Manuel Talon3 and Dominique Brunel7


Abstract
Background: Most modern citrus cultivars have an interspecific origin. As a foundational step towards deciphering
the interspecific genome structures, a reference whole genome sequence was produced by the International Citrus
Genome Consortium from a haploid derived from Clementine mandarin. The availability of a saturated genetic map
of Clementine was identified as an essential prerequisite to assist the whole genome sequence assembly.
Clementine is believed to be a 'Mediterranean' mandarin x sweet orange hybrid, and sweet orange likely arose
from interspecific hybridizations between mandarin and pummelo gene pools. The primary goals of the present
study were to establish a Clementine reference map using codominant markers, and to perform comparative
mapping of pummelo, sweet orange, and Clementine.
Results: Five parental genetic maps were established from three segregating populations, which were genotyped
with Single Nucleotide Polymorphism (SNP), Simple Sequence Repeats (SSR) and Insertion-Deletion (Indel) markers.
An initial medium density reference map (961 markers for 1084.1 cM) of the Clementine was established by
combining male and female Clementine segregation data. This Clementine map was compared with two pummelo
maps and a sweet orange map. The linear order of markers was highly conserved in the different species. However,
significant differences in map size were observed, which suggests a variation in the recombination rates. Skewed
segregations were much higher in the male than female Clementine mapping data. The mapping data confirmed
that Clementine arose from hybridization between 'Mediterranean' mandarin and sweet orange. The results
identified nine recombination break points for the sweet orange gamete that contributed to the Clementine
genome.
Conclusions: A reference genetic map of citrus, used to facilitate the chromosome assembly of the first citrus
reference genome sequence, was established. The high conservation of marker order observed at the interspecific
level should allow reasonable inferences of most citrus genome sequences by mapping next-generation
sequencing (NGS) data in the reference genome sequence. The genome of the haploid Clementine used to
establish the citrus reference genome sequence appears to have been inherited primarily from the 'Mediterranean'
mandarin. The high frequency of skewed allelic segregations in the male Clementine data underline the probable
extent of deviation from Mendelian segregation for characters controlled by heterozygous loci in male parents.
Keywords: C clementina, C sinensis, C maxima, SSRs, SNPs, Indels, Genetic maps


*Correspondence patrickollitrault@ciradfr
CIRAD, UMR AGAP, F-34398 Montpellier, France
21VIA, Centro Proteccion Vegetal y Biotechnologia, Ctra Moncada-Niquera
Km 45, 46113 Moncada, Valencia, Spain
Full list of author information is available at the end of the article
` 2012 Ollitrault et al., licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Biole Med Central Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.






Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


Background
Citrus fruits were domesticated in South East Asia several
thousand years ago and subsequently spread throughout
the world. Today, the area of citrus cultivation is primarily
found between the latitudes of 40'N and 40oS, and global
citrus production has reached 122 M tonnes [1]. The pro-
duction of sweet orange, the leading varietal type,
approaches close to 69 M tonnes [1]. Small citrus fruits
(mandarin-like) are preponderant in China and very im-
portant in the Mediterranean Basin where Clementine is
the main cultivar.
Despite controversial Citrus classifications, most authors
now agree on the origin of cultivated citrus species. Scora
[2] and Barrett and Rhodes [3] were the first to suggest
that three primary Citrus species (C. medical L. citrons,
C reticulata Blanco mandarins, and C. maxima L.
Osbeck pummelos) were the ancestors of most culti-
vated citrus. The differentiation between these sexually
compatible taxa can be explained via the foundation effect
in three geographic zones and by an initial allopatric evo-
lution [2,4]. Other cultivated species (referred to hereafter
as secondary species) such as C aurantium L. (sour or-
ange), C. sinensis (L.) Osb. (sweet orange), C paradise
Macf. (grapefruit), C clementina hort. Ex Tan. (Clemen-
tine) and C limon Osb. (lemon) originated later through
hybridization and a limited number of sexual recombin-
ation events among the basic taxa. Molecular marker
studies [5-8] generally support the role of these three taxa
as ancestors of cultivated Citrus. Furthermore, some of
these studies [8-10] highlighted the probable contribution
of a fourth taxon, C micrantha Wester, as the ancestor of
some limes [C aurantifolia (Christm.) Swingle].
In general, Citrus species are diploid with a basic
chromosome number x = 9 [11]. Citrus species have
small genomes. While estimating citrus genome size by
flow cytometry, Ollitrault et al. [12] found significant
genome size variation between citrus species. The largest
and smallest genomes were C. medical (average value of
398 Mb/haploid genome) and C reticulata (average
value of 360 Mb/haploid genome), respectively. C max-
ima had an intermediate genome size, with an average
value of 383 Mb/haploid genome. Interestingly, the
secondary species presented intermediate values be-
tween their putative ancestral parental taxa, C. sinensis
(370 Mb), C aurantium (368 Mb), C. paradisi, (381 Mb)
and C limon (380 Mb) per haploid genome.
As mentioned previously, most modern cultivars have
an interspecific origin and their genomes can be consid-
ered mosaics of large DNA fragments inherited from the
basic taxa [7]. These cultivars are generally highly het-
erozygous [6,7]. The C maxima and C reticulata gene
pools contributed to the genesis of most of the econom-
ically important species and cultivars including sweet
and sour oranges, grapefruits, tangors (mandarin x sweet


orange hybrids), tangelos (mandarin x grapefruit hybrids)
and lemons [6,7,9]. Barkley et al. and Garcia-Lor et al.
[10,11] estimated the relative contributions of primary
species to modern cultivars. Some discrepancies have been
observed between these studies, and the detailed interspe-
cific genome organization of cultivated secondary species
and modern cultivars is still largely unknown. As a foun-
dational step towards deciphering the phylogenetic struc-
tures of citrus genomes and the molecular bases of
phenotypic variation, a reference whole genome sequence
of a haploid derived from Clementine was produced and
is currently being revised by the International Citrus Gen-
ome Consortium (ICGC) [13,14]. The Clementine manda-
rin is an interspecific hybrid that was selected one century
ago in Algeria by Father Clement as a chance offspring
among seedlings of the 'Mediterranean' mandarin (C reti-
culata) [15]. Since that time, the Clementine has been
vegetatively propagated by grafting. In a recent large SNP
diversity survey, Ollitrault et al. [8] confirmed that the
Clementine is a 'Mediterranean' mandarin x sweet orange
hybrid tangorr). This conclusion is in agreement with the
hypothesis of Deng et al. and Nicolosi et al. [9,16] The
supposed parental relationships between Clementine,
sweet orange, pummelo and mandarin are summarized in
Figure 1. The Clementine genome size is estimated to be
367 Mb/haploid genome [12].
The ICGC identified the construction of a saturated
genetic map of Clementine as an essential prerequisite to
improve the sequence assembly of the haploid Clementine
reference genome. Compared with other crops, genetic
mapping in citrus is relatively less well developed. The
partial genetic maps built with codominant markers


Page 2 of 20


C. reticulata C. maxima
(Mandarins) (Pummelos)











C.sinensis
C.clementina I wetl orangs
iCl--mneniinei
Figure 1 Assumed parentage relationships between C.
reticulata, C. maxima, C. sinensis and C. clementina. From
Ollitrault et al. [8].






Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


(primarily SSRs) [17-19] encompass around 150 markers,
while maps based on dominant markers such as AFLPs,
[20] SRAPs, ISSRs, and RAPDs [21] include slightly more
than 200 markers. Moreover, few of the mapped markers
have been published in GenBank (or other public nucleo-
tide databases). Within the last 15 years, the citrus com-
munity developed Simple Sequence Repeat (SSR) markers
with reference sequences that were deposited in public
databases. While a limited number of SSR markers were
obtained from genomic libraries [6,22-24], the implemen-
tation of large EST databases allowed the development of
many more SSR markers [25,26], and additional markers
have been developed from Clementine BACs end sequen-
cing (BES; [27-29]). From the same Clementine BES data-
base, Ollitrault et al. [30] developed 33 Indel markers to
contribute to Clementine genetic mapping. Despite these
international efforts, the number of available heterozygous
SSRs and Indels in Clementine was still insufficient to es-
tablish a saturated Clementine genetic map. SNP markers
are well adapted for high throughput methods for marker
saturation. Ollitrault et al. [8] took advantage of the Clem-
entine BES database [27] to identify SNPs heterozygous in
Clementine, and a GoldenGate SNPs array was developed.
Interestingly, 63% of the validated SNP markers were het-
erozygous in the sweet orange. Therefore, these SNPs can
be used for comparative mapping between the Clementine
and sweet orange.
The primary goals of the present study were: (i) to estab-
lish a saturated reference map of Clementine using codo-
minant markers with sequences available in public
databases; (ii) to perform comparative mapping between
sweet orange, pummelo and Clementine; and (iii) to
localize the crossover events that produced the sweet or-
ange gamete that contributed to the Clementine genome,
and those involved in the gamete formation that gave rise
to the haploid Clementine [13] used for the citrus refer-
ence whole genome sequence [14]. The clementine refer-
ence map and the pummelo map were established from
two interspecific hybrid populations ('Chandler' pummelo
x 'Nules' Clementine CP x NC (156 hybrids) and 'Nules'
Clementine x 'Pink' pummelo NC x PP, (140 hybrids))
with 1166 codominant markers. The sweet orange map
anchored with the Clementine map was established by
genotyping 582 segregating SNP markers from 147 pro-
geny from crosses between sweet orange and trifoliate or-
ange (SO x TO). This study also yielded information
regarding the magnitude and distribution of segregation
distortion within the different crosses.

Results
Polymorphism and allele calls for the SNP markers
For all SNPs, genotyping was visually confirmed, taking
advantage of the distribution of the segregating progen-
ies relative to the parental positions. This observation


was conducted individually for each plate of 96 geno-
types. Plate/marker combinations with unclear clustering
of genotypes were removed from the analysis. No differ-
ences were found between the different sweet orange
parents or between the trifoliate orange parents of the
SO x TO progenies. Therefore, all individuals resulting
from the different crosses were considered as single fam-
ily. For the selected data, the markers were assigned to
different categories based on the observed segregations,
the detection of null alleles and, finally, the type of seg-
regation assumed according to the JoinMap nomencla-
ture (Tables 1 and 2).
The observed segregation within a progeny permitted
identification of the null alleles in terms of homozygosity
(00) or heterozygosity (AO) in the parents (Figure 2).
These two configurations of null alleles were found for 0
and 31 markers in the Clementine, 69 and 19 in Chandler,
78 and 17 in Pink, 0 and 72 in sweet orange, and 128 and
0 in trifoliate orange, respectively (Table 2 and Additional
file 1). Markers with AO x BB and AO x 00 configurations
were treated as < Im x 11> and the reciprocal configu-
rations were treated as < nn x np >. Markers with the
AB x AO configuration were analyzed as < Im x 11 > by con-
sidering (i) BA and BO hybrids as < Im > genotypes, (ii) the
undistinguishable AA and AO as < 11 >; thus, considering
only the segregation of the AB parent. Reciprocal config-
urations were treated as < nn x np >.
Considering all markers (with and without null alleles),
the first category consisted of markers heterozygous in
one parent and homozygous in the other (classified as
< nn x np > or < Im x 11 > in JoinMap). These markers
represented the majority of the useful markers (with 606
and 6 < mxll> in CPxNC, 8
and 644 < Im x 11 > in NC x PP and 1 < nn x np > and 572
< Im x 11 > in SO x TO). These markers were only mapped
for the heterozygous parents. As SNP markers are diallelic,
the only other conformation encountered was < hk x hk >,
where the two parents displayed the same heterozygosity.
These markers were not frequent, and 29, 24 and 9 mar-
kers with such a configuration were observed for CP x NC,
NC x PP and SO x TO, respectively. Considering our stra-
tegy to develop independent maps for each parent, the lack

Table 1 Join map codification for the different allelic
configurations encountered for SNP markers
AA AB BB AO BO 00
AA Imxl Imxil Imxll
AB nnxnp hkxhk nnxnp nnxnp nnxnp nnxnp
BB Imxl Imxil Imx -


AO nnxnp Imxl
BO nnxnp Imxl


nxnp NO NO
nxnp NO NO
mxll Imxl


NO: Non observed configuration.


Page 3 of 20







Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593




Table 2 Segregation types observed for the different parents and progenies
SSF
Null allele Nules Clementine Hom 2
Het IC
Chandler pummelo Hom 9
Het 4
Pink Pummelo Hom 1C
Het 5
Sweet Orange Homrn
Het
trifoliate orange Hom


JoinMap Segregati<


Chandler x Nules


Nules x Pir


Orange x trifoliate orange


of information when assigning the parental allele for each
hybrid (only possible for the homozygous hybrid and, thus,
only half of the population) and the relatively low number
of markers with this < hk x hk > conformation, these mar-
kers were removed from the mapping analysis.

SSR and Indel genotyping
The genotyping of the CP x NC population was performed
in the framework of the ICGC. SSR analysis was performed
by six international groups (University of California at
Riverside; University of Florida; University of Cukurova-
Turkey; IVIA-Spain; INRA-France and CIRAD-France,
with the collaboration of INRAM-Morocco). The genoty-
ping of the NC x PP was performed at CIRAD and IVIA.
Homozygous or heterozygous null alleles in the par-
ents were assumed from the observed SSR segregations.
These two configurations of null alleles were found in 2
and 10 markers in Clementine, 9 and 4 in 'Chandler' and
10 and 5 in 'Pink, respectively (Table 2 and Additional
file 1). Loci containing null alleles were treated as pre-
viously described for SNP markers. With multiallelic
SSRs, six allelic configurations were possible. AA x AB or


CC x AB were treated equally as < nn x np > by JoinMap,
and the two reciprocal configurations were assumed to be
< lm x 11 >. Fully heterozygous configurations with four
alleles (AB x CD) or three alleles (ABxBC) were coded
< ab x cd > and < ef x eg >, respectively. Among the SSRs
successfully genotyped, the five JoinMap configurations
(nn x np, Im x 11, hk x hk, ef x eg, and ab x cd) were
encountered for 130, 34, 1, 43 and 70 markers in CP x NC
and 24, 79, 3, 19 and 26 markers in NC x PP progenies, re-
spectively. As for SNPs, the very few markers with the
hk x hk configuration were removed from the analysis.
The nn x np and Im x 11 markers were mapped for the
male or female parents, respectively. The fully heterozy-
gous markers (< ef x eg> and < ab x cd >) were mapped
for the two parents and, therefore, allowed anchoring of
the male and female parent maps.
Only four Indel markers displayed homozygous null
alleles in 'Chandler' pummelo (Table 2 and Additional
file 1). No heterozygous null alleles were indicated in
'Nules' Clementine, 'Chandler' or 'Pink' pummelos. For
Indels, the five JoinMap configurations (nn x np, Im x 11,
hk x hk, ef x eg, and ab x cd) were encountered for 20, 2,


Page 4 of 20


Indels
0
0
4
0
0


Het
nnxnp
mxll
hkxhk
efxeg
abxcd
nnxnp
mxll
hkxhk
efxeg
abxcd
nnxnp
mxll
hkxhk
efxeg
abxcd






Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


NC x PP hybrids: BO


NC: AB
0O_


NC x PP hybrids: AO


PP hybrids: BB


PP: BO


b
+ BO





NC x PP hybrids: AB






NC x PP hybrids: AO


Figure 2 Example of segregation profiles for SNP markers with null alleles for one parent and heterozygous for the other. (a) AB x 00;
(b) AB x BO.


0, 3 and 0 markers in CP x NC and for 2, 15, 1, 5, and 0
markers in NC x PP, respectively.

Parental genetic mapping
Parental gamete genotypes were generated from the dip-
loid data using nn x np, Im x 11, ef x eg and ab x cd scored
markers. SNP, SSR and Indel genotyping data resulted in


a matrix of 156 individuals and 872 markers for male
Clementine (CP x NC progeny), 156 individuals and 158
markers for 'Chandler' pummelo (CP x NC progeny), 140
individuals and 788 markers for female Clementine
(NC x PP progeny), 140 individuals and 84 markers for
'Pink' pummelo (NC x PP progeny), and 572 markers for
147 hybrids for sweet orange (SO x TO progeny). All of


omFl


Page 5 of 20


-r


0 h







Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


these matrices were analyzed using JoinMap 4. The lin-
kage group numbering was performed according to the
sweet orange genetic map established by the US citrus
genome working group (Mikeal Roose; personal commu-
nication). The main results of the individual mapping
analyses are given in Table 3, and detailed results are pre-
sented in Additional file 2.

'Nules' Clementine genetic map
The reference Clementine genetic map was obtained in
two steps. In the first step, male and female Clementine
data were analyzed separately.
Male Clementine map: Among the 872 segregating
markers, 869 (606 SNPs, 240 SSRs and 23 Indels) were
distributed into nine linkage groups (LGs) while three
markers remained ungrouped. Most of the LG conserved
their integrity until LOD=10. Only LG8 was disrupted in
three sub-groups at LOD 9.The three sub-groups corre-
sponded to three regions of LG8 separated by relatively
wide intervals without intermediate markers. When
mapped individually they displayed conserved order and
very similar distances compared with the entire LG8.
The map spanned 1164.26 cM. The Clementine male
gametes exhibited 57% of the markers deviating from
the expected Mendelian ratio (with a 0.05 probability
threshold). Skewed markers were grouped within several
parts of the genome. The skewed markers were un-
equally spread throughout the linkage groups with rela-
tively low frequencies in LG2 (3.6%) and LG8 (13.5%),
but with very high frequencies in LG4 (71.6%), LG5
(83.1%), LG7 (74.5%) and LG9 (85.6%). This distribution
of segregation distortions is detailed below in compari-
son with the other parents.


Female Clementine map: Among the 788 markers suc-
cessfully genotyped, 783 (642 SNPs, 122 SSRs and 21
Indels) were grouped in nine LGs, while five remained
ungrouped. Most of the LG conserved their integrity until
LOD=10. Only LG8 was disrupted in two sub-groups at
LOD=8 corresponding to two regions of le LG8 separated
by a relatively wide interval without marker. When
mapped individually the sub-groups displayed conserved
order and very similar distances compared with the entire
LG8.The map size was 923.5 cM. The frequency of skewed
markers (13.0%) was much lower than that observed
among male gametes. Skewed markers were mainly con-
centrated in LG5 (33.3%) and LG9 (24.1%).
Despite the high frequency of skewed markers in the
male Clementine map, the colinearity between the male
and female maps was highly conserved (Additional
file 3). Therefore, the reference Clementine map was
established by joining the two data sets for each LG,
including all markers present in at least one map.
Nine hundred and sixty-one markers (677 SNPs, 258
SSRs and 26 Indels) were grouped into nine linkage
groups totaling 1084.07 cM (Figure 3 and Additional
files 2 and 4). The proportion of skewed markers
remained high (46.1% for p < 0.05). The LG size ran-
ged from 87.5 cM (LG9) to 186.3 cM (LG3). LG7 and
LG8 possessed a relatively low density of markers
with an average of 0.45 and 0.52 markers/cM, respect-
ively. On average, nearly one marker/cM was found
on the other LGs. Each LG exhibited a heterogeneous
density of markers (Figure 4). A few gaps larger than
10 cM were observed without mapped markers, and more
gaps between 5 cM and 10 cM were observed without mar-
kers (Figure 3). These gaps were distributed, respectively, as


Table 3 Main parameters of the six genetic maps inferred from three segregating progenies
N LG 1 LG 2 LG3 LG 4
M D Size M D Size M D Size M D Size
Clementine F 140 96 3 118.08 92 9 120.06 137 2 159.42 85 13 66.13
Clementine M 156 98 54 131.09 110 4 155.69 160 88 208.00 95 68 114.17
Clementine F+ M 296 112 42 128.46 113 15 138.92 176 86 186.32 104 58 89.49
Chandler Pummelo 156 19 0 101 79 26 9 10939 18 2 15723 15 0 8993


8 0 67.29 10 1 100.37
54 13 71.70 27 1 54.33


Size
88.20
100.46


Clementine F+ M 296 95 59 99.80


LG 7
D Size
0 86.24
35 112.22


52 19


4 0 39.34 6 2 69.07 15 0 71.11
117 25 93.15 64 2 76.22 96 48 99.87
LG 8 LG 9 Total
M D Size M D Size M D Size
44 0 97.74 95 23 79.33 783 102 923.54
52 7 12581 97 83 9253 869 495 116426


59 61


18.03 107 88 87.54 961 443 1084.07


Chandler Pummel,
Pink Pummelo
Sweet Oranqe


156 19 0 64.83
140 14 6 79.83
147 60 9 65.57


8 0 53.96
4 0 36.84
36 2 84.17


16 6 115.17 6 0
12 0 98.47 8 4
45 2 39.68 70 51


N: number of gametes; LG: linkage group; M: number of markers in the LG; D: number of markers with non-Mendelian segregation (p<0.05); Size: size of the LG in
cM; F:female; M: male.


Page 6 of 20


Pink Pummelo
Sweet Orange



Clementine F
Clementine M


D Size
36 108.34
03 124.30
71 119.93
3 6329


73.03 151
71.58 81
84.91 569


20 828.62
13 633.90
53 669.61







Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


follows: LG1 (0, 6), LG2 (0, 7), LG3 (2, 3), LG4 (0, 0), LG5
(1, 4), LG6 (1, 2), LG7 (3, 5), LG8 (3, 4) and LG9 (0, 6). On
LG9, a special feature was observed, in which 55 markers
were mapped within a 5-cM interval.

'Chandler' pummelo genetic map
Among the 158 segregating markers, 151 (141 SSRs, 5
SNPs and 5 Indels) were successfully mapped in nine link-
age groups (Additional files 2 and 5). One hundred and
nine of these markers were common with the Clementine
map. The level of segregation distortion was low (13.2%)
and was mainly observed on two LGs (LG2: 34.6% and
LG8: 37.5%). The total size of the map was 828.6 cM.

'Pink' pummelo map
Only 84 segregating markers were available for Pink
pummelo mapping. Eighty-one (67 SSRs, 7 SNPs and 7


Indels) were mapped in nine linkage groups (Additional
files 2 and 6). Fifty-two of these markers were shared
with the Clementine map. The level of segregation dis-
tortion was similar to the Chandler pummelo map
(15.9%), but affected other LGs, mainly LG6 (42.9%) and
LG9 (50%). The map spanned 633.9 cM.

Sweet orange map
The sweet orange map was only based on SNP markers.
Among the 572 segregating markers, 569 were mapped in
nine linkage groups, with a total size of 669.6 cM
(Additional files 2 and 7). Most of the LG conserved
their integrity until LOD=10. However three LG (2, 3
and 5) were disrupted in two sub-groups at LOD 9, 6
and 10 respectively. As for male and female clementine
these disruptions corresponded to relatively wide interval
without intermediate markers. When mapped individually


Page 7 of 20


LG1 LG2 LG3 LG4 LG5 LG6 LG7 LG8 LG9


0


20

30 *





60

70
-- 70*





110
-100 1



120 -

130

140

150

160

170

180


Figure 3 Distribution of markers in the 'Nules' Clementine genetic map. Red: Indels, green: SSRs, blue: SNPs, interval between two markers
> 10 CM; interval between two markers > 5 cM and <10 cM.







Page 8 of 20


Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


the sub-groups displayed conserved order and very similar
distances compared with their relative entire LGs. Four
hundred and eighteen of these markers were in common
with the reference Clementine genetic map. Segregation
distortion was relatively frequent (26.9%) and was particu-
larly clustered in LG5 (50%) and LG9 (72.9%).


Genetic map comparisons
Analysis of colinearity between the different genetic maps
Synteny, considered as the collocation of marker in the
same chromosome, was completely conserved between
all of the parental genetic maps. The linear order of the
common markers was also highly conserved between


30 LG1 LG2 LG3 LG4


20
10




E 20






z
c)





o 10 1
So LG5 LG6 LG7 LG8 :09L








Location in the linkage groups (5cMintervals)
Figure 4 Density of markers along the 'Nules' Clementine genetic map.


CP C?
Figure 5 Conservation of synteny and linear order of markers in the four genetic maps. NC: 'Nules' Clementine, CP: 'Chandler' pummelo,
PP: 'Pink' pummelo, SO: sweet orange.







Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


parents (Figure 5), with only a few cases of inverted
order in small intervals. However, the genetic distance
between markers appeared to be unequal between par-
ents. Sweet orange in particular displayed smaller dis-
tances between shared markers than Clementine. To
avoid bias due to the different number of loci analyzed,
new genetic maps of sweet orange and Clementine
(male, female and consensus) were constructed using
only the data generated from the 418 SNP markers
that were successfully genotyped in the NC x PP,
CP x NC and SO x TO progenies. The results (Additional
file 8) confirmed that the genetic distances were gene-
rally lower (except for LG4 and LG9) in the sweet
orange map than in the Clementine reference map.
Moreover, differences were confirmed between the
male and female Clementine maps for LG3, LG4, LG7,
LG8 and LG9, with systematically lower distances in
the female map. Interestingly, markers with very strong
linkage localized in the very high marker density area
of LG9 for the Clementine and sweet orange maps
were much farther apart in 'Chandler' and 'Pink' pum-
melos (Figure 5).


Location of crossover events in the sweet orange gamete at
the origin of Clementine and in the Clementine gamete at
the origin of the haploid Clementine used for the reference
citrus whole genome sequence
For each linkage group, the haplotypes of sweet orange
and Clementine were inferred from SNP marker phases
given by JoinMap. The origin of Clementine from a
'Mediterranean mandarin' x sweet orange hybridization
was proven by Ollitrault et al. [8]. Homozygous mar-
kers in sweet oranges and Mediterranean mandarin
were used to identify the haplotype of Clementine
inherited from sweet orange. Comparison of this haplo-
type with the two sweet orange haplotypes allowed the
identification of nine recombination break points, one
each in LG1, LG7 and LG9, and two each in LG3, LG4
and LG5 (Figure 6a). The two Clementine haplotypes
were compared with the genotyping data of the haploid
Clementine used by the ICGC to establish the refer-
ence citrus WGS haploid sequence. This permitted the
identification of eight recombination break points, one
each in LG1, LG7 and LG8, two in LG 5 and three in
LG3 (Figure 6b). Interestingly, LG2, LG4, LG6 and


Page 9 of 20


a b



0



50







0 r
1255

125 125


150 G)
Mediterranean mandarin haplotype
Sweet Orange haplotypel
175 175 U Sweet Orange haplotype 2
Sweet Orange haplotype not assigned
M r No data
C cM Recombination break point
Figure 6 Haplotype constitution of the sweet orange gamete at the origin of Clementine (a) and of the haploid Clementine used to
establish the reference whole citrus genome sequence (b).






Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


LG9 appeared to have been entirely inherited from
'Mediterranean' mandarin without recombination.

Comparative distribution of segregation distortions
To compare the location of the genome areas affected
by segregation distortions in the different parental maps,
a rough location in the reference Clementine maps was
estimated for markers (i) mapped in sweet orange but
not in Clementine, (ii) mapped in 'Chandler' pummelo
but not in Clementine or sweet orange and, finally (iii)
for markers only mapped in 'Pink' pummelo. These loca-
tion estimates were performed by applying tendency
curve equations of the location in the reference Clemen-
tine map (y axis) according to the location (x axis) for
the parent map, where additional markers were mapped.
An example of such a location is presented in Additional
file 9b. The estimated locations of all markers in the
framework of the Clementine reference map are given in
the "synthesis" column of Additional file 2. The values of
the X2 conformity test of the observed segregation
against the 1:1 Mendelian hypothesis are represented
along the linkage groups for all of the parental maps in
Additional file 9a. Skewed markers appeared to be con-
centrated in specific areas for the different parents.
However sporadic occurrences of a non-distorted mar-
ker within a cluster of distorted markers (CiC5563-02),
or vice versa (e.g., marker CID5573) are observed in the
Clementine reference map. Such exceptions can be
explained by the inclusion of these markers with missing
data, of probable non random origin, affecting the real
segregation ratio.
The patterns of segregation distortion are consistent
with the local selection of gametes that differ in terms of
the probability of contributing to the next generation.
Male Clementine presents the higher proportion of
skewed loci. In LG1 and at the initial part of LG5, these
distortions seem to be shared with female Clementine and
sweet orange, although at a lower intensity than in male
Clementine. Shared areas of skewed loci were also
observed for male Clementine and sweet orange at the
end of LG5 and in the middle of LG9, where high marker
density was observed. In these two regions, the magnitude
of sweet orange distortions was higher than in the male
Clementine. The very severe level of segregation distortion
observed in the middle of LG3 for male Clementine is
shared at a much lower level with sweet orange. The
skewed loci of male Pink pummelo in LG6 and LG9 were
observed in areas common with male Clementine. Distor-
tions that were observed in Chandler in the initial part of
LG2 were not observed in the other parents.
The identification of the Clementine haplotypes inher-
ited from 'Mediterranean mandarin' and sweet orange
allowed determining at each locus which allele was
inherited from both parents of Clementine. Therefore, it


was possible to determine which parental alleles (man-
darin versus sweet orange) were favored for the skewed
areas of the male and female Clementine segregations
(Figure 7). No systematic tendency was observed. For
male Clementine, the skewed segregations were globally
in favor of sweet orange alleles for LG1, LG5 and LG7,
while the skewed segregations favored mandarin alleles
in LG3, LG8 and LG9. Interestingly, in LG6 and more
markedly in LG4, a transition from positive selection for
sweet orange alleles to positive selection for mandarin
alleles was observed when moving from one end of the
LG to the other. For LG1, LG2 and LG9, similar patterns
of allele segregation were observed in female and male
gametes (but generally with a lower distortion magni-
tude in the female). In LG4 and LG5, the patterns be-
tween male and female Clementine were very different,
with significant distortion in opposite directions. In the
second part of LG4, the mandarin alleles were favored in
male Clementine, while sweet orange alleles were signifi-
cantly favored in female Clementine. In the first part of
LG5, mandarin and sweet orange allele were favored re-
spectively in the female and male Clementine.

Discussion
A first reference genetic map for Citrus
The reviews of citrus genetic mapping performed by
Ruiz and Asins [31], Chen et al. [19] and Roose [32]
underlined that most of the earlier citrus genetic maps
were based on intergeneric hybrids between Citrus and
Poncirus. This was due to the importance of Poncirus
trifoliata for rootstock breeding. Most of these studies
suffered from relatively low numbers of analyzed hybrids
and from the dominant nature of the markers (RAPD,
AFLP) without sequence data on the mapped fragments.
Several of the more recent maps were generated using
co-dominant markers, particularly SSRs [17-19]. How-
ever, the number of mapped markers was insufficient to
establish the nine linkage groups corresponding to the
nine chromosomes present in haploid citrus. Some re-
cent studies also focused on the genetic mapping of Cit-
rus varieties [17,20,21,33]. The map of Gulsen et al. [21]
was the first C. clementina map, while Bernet et al. [17]
mapped Chandler pummelo and Fortune mandarin, a C.
clementina x C. tangerina hybrid. None of these maps
encompassed enough markers with published sequences
to establish a reference citrus map useful to be com-
bined with whole genome sequence data.
The current reference Clementine map, established
from Clementine male and female segregation, includes
961 co-dominant markers (677 SNPs, 258 SSRs and 26
Indels) spread among nine LG. The map spans 1084.1 cM,
with an average marker spacing of 1.13 cM. This is a sub-
stantially higher marker density than reported in previous
citrus maps, in which nine LG were obtained. Omura


Page 10 of 20







Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


et al. [34] established a genetic map spanning 801 cM with
120 CAPS markers. Sankar and Moore [35] published an
874 cM map including 310 markers (mostly ISSR and
RAPD). Carlos de Oliveira et al. [20]) established an
845 cM map with 227 AFLP markers and more re-
cently using 215 markers (mostly SRAP) Gulsen et al.
[21] produced a 858 cM map.
The marker density in the current reference Clemen-
tine map varied along the genome. The density was par-
ticularly low in some regions of LG7 and LG8, with
three gaps over 10 cM between markers in each of these
LGs. The SNP markers are the most numerous markers
on the Clementine map and were randomly selected.
Therefore, these low marker density areas probably re-
veal highly homozygous regions of the Clementine
genome. WGS data for the diploid Clementine will be
very useful for developing targeted markers within
these "no marker" regions. At the opposite extreme,


high density areas were observed in some LGs. As
described by Lindner et al. [36] and Van Os et al. [37],
some of these high marker density regions may be
associated with centromeric locations with large phys-
ical distances, possibly corresponding to low genetic
distances. Another hypothesis is that some areas with
high marker density correspond to portions of the gen-
ome in interspecific heterozygosity. Indeed, Clementine
is considered to be a hybrid between Mediterranean
mandarin and sweet orange [8,9,16]. As sweet orange is
thought to have originated as a result of interspecific
hybridization between C maxima and C reticulata
gene pools [6,7,9], some parts of the Clementine gen-
ome may represent interspecific heterozygosity (C
maxima/C. reticulata). Garcia-Lor et al. [38] showed
that the SNP/kb frequency was approximately six times
higher between C reticulata and C maxima that it
was within C. reticulata. Thus, randomly selected


Page 11 of 20


0.25
0.2 LG1 LG2 LG3 4. LG4
0.15
0.12






-.15----',-'-
I0.1 ----- ---------------- -I--.---





0.05
-0.2 ----------------------------------------- ----------







0.05 X X N
.....2 -------- --------------------- ----I------....................................-........--------P- 5






02 LG5 LG6 LG7 LG8 LG9


0.1. -- ..........-------- ------------------.-------.................. ---'.....'-'x.....-'-'-- --- 4 ....------......P=5%






-0.15 -I -- % -
-0.1 -, ,. ----- l----- ---:---1--,--...-:------- --------.........--------------------=-
-0.1 -f-------- '---------- --------- --------- --------------
-0.15 ---------l-------- --------l------------------
-0.25
Figure 7 Distribution of the segregation distortions for female and male Clementine, along the reference Clementine genetic map. The
x axis represents the location on each linkage group (LG) and y axis represents the excess of the mandarin allele relatively to Mendelian
segregation (y frequency of mandarin allele minus 0.5). Blue represents male Clementine segregation; red represents female Clementine
segregation. The discontinuous lines represent the threshold for i distortion (p < 0.05).






Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


markers should be six times more frequent (by physical
distance unit) in those parts of the Clementine genome
involved in interspecific heterozygosity. Despite the het-
erogeneity of marker dispersion, the distance to the
nearest mapped marker is less than 5 cM in most loca-
tions of the Clementine genome. Moreover previous
published diversity studies done with the mapped SSRs
(5, 23-26, 28), InDels (30) and SNPs (8) gave accurate
information of their transferability and polymorphisms,
at individual locus level, within and between the princi-
pal varietal groups. Therefore, this marker framework
will be very useful for marker-trait association studies
based on linkage disequilibrium, such as QTL analysis,
bulk segregant analysis, or even genetic association
studies in the mandarin group, where strong diversity
was observed for the mapped SNP markers [8]. This
map is being used to facilitate the chromosome assem-
bly of the reference whole genome citrus sequence
based on a haploid Clementine genotype [13,39].


Linear marker order is highly conserved between species,
but genetic distances are variable between sexes and
species
The citrus genetic maps based on dominant and mainly
cross-specific markers (such as RAPD, AFLP and ISSR)
do not permit genetic map comparisons. Multi-allelic
codominant markers, such as SSRs, are more powerful
for such applications [30]. Chen et al. [19] and Bernet
et al. [17] successfully used SSRs for citrus map com-
parison at the interspecific and intergeneric levels.
In the present study, the main genotyping effort con-
cerned SNPs. Eight hundred and thirty-six SNP markers
were genotyped in the three populations. Most of these
markers were mined from Nules Clementine BAC end
sequences [8,27] and, as a result, were heterozygous for
Clementine. The development of the GoldenGate SNP
markers from the Clementine sequence without informa-
tion on the interspecific variability in flanking areas
resulted in numerous homozygous null alleles in pummelo
as described by Ollitrault et al. [8] and in trifoliate orange.
Heterozygous null alleles for 72 markers were found in
sweet orange, expanding the number of markers mapped
in this species. The selected SNP markers were not effi-
cient for pummelo or trifoliate orange mapping due to the
very low number of heterozygous loci in these species.
Moreover, the biallelic nature of SNP markers limited the
establishment of two anchored maps (male and female)
from a single cross. Therefore, comparison between Clem-
entine and pummelo was still primarily limited to com-
mon multiallelic SSRs (109 between Clementine and
Chandler pummelo and 52 between Clementine and Pink
Pummelo). With sweet orange and Clementine maps
being developed from different populations, the 418


common heterozygous SNPs allowed more substantial an-
chorage of the two maps.
The conservation of synteny was complete between
the species, with no discrepancy in marker localization
on the different linkage groups between the maps. Fur-
thermore, the linear order of markers also appeared to
be highly conserved between C. clementina, C. sinensis
and C maxima. This is in agreement with the conclu-
sions of Bernet et al. [17] following their comparative
study of partial maps between three species (C auran-
tium, C. maxima and P. trifoliata) and Fortune manda-
rin, a Clementine-derived mandarin hybrid. In the
present study, small localized inversions of marker
orders were observed between maps, particularly in
dense markers areas. Bernet et al. [17] concluded that
similar results, for local ordering changes in the inte-
grated maps, resulted from the inclusion of markers with
missing data, and eventually different levels of distorted
segregations between populations. It is also possible that
small genotyping errors concerning the markers located
in these dense regions disturbs the mapping order
[40,41]. The fine mapping of such regions will require
larger populations than the ones genotyped in this study.
For this reason, these local inversions are not detailed in
the results of this study since artifactual origins were
quite probable. Chen et al. [19] also concluded that co-
linearity at the intergeneric level was highly conserved
between genetic maps of C sinensis and P. trifoliata.
However, they also observed some inversions between
shared loci that might reveal chromosomal rearrange-
ment events, such as translocations or inversions. Con-
sidering the data of this study and the two previous
comparative mapping studies, marker colinearity appears
highly conserved at the intrageneric level (Clementine,
mandarin, pummelo, sweet orange and sour orange), but
also between Citrus and Poncirus. This global conserva-
tion of citrus genome organization will allow reasonable
inferences of most citrus genome sequences via mapping
NGS re-sequencing data to the haploid Clementine
reference genome sequence.
Variations in LG sizes were observed between the
current male Clementine and female Clementine maps.
These variations were confirmed when the new maps
were exclusively built using the markers shared between
the three populations used for the implementation of
the Clementine and sweet orange maps. Several LGs
were longer in the male Clementine map than in the fe-
male one. This was observed in LGs with significant and
extensive segregation distortions in the male haplotype
populations compared with the female populations, and
this was also observed in LG2, where very similar pat-
terns of low skewed loci were observed. From simulated
data, Hackett and Broadfoot [41] found that segregation
distortion (due to gametic selection) alone had very little


Page 12 of 20






Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


effect on marker order or map length. As discussed
below, the observed distortion in Clementine probably
results from gametic rather than zygotic selection.
Therefore, it is probable that the longer LGs observed
within the male Clementine map do not result from
biased estimations due to segregation distortion, but in-
stead reflect differential recombination rates. Such het-
erochiasmy between sexes is frequent in plants and
animals [42-47]. According to species, recombination
should be higher in male or in female gametes [43]. Des-
pite the fact that heterochiasmy was documented early
in the last century [44], there is still no consensus as to
which of the several proposed hypotheses may explain
its occurrence [45]. The various models were reviewed
by Lenormand and Duteil [46]. Based on a large survey
in animals and plants, these authors concluded that sex-
ual heterochiasmy is not influenced by the presence of
heteromorphic sex chromosomes; rather, it should result
from a male-female difference in gametic selection.
However, in this study, the citrus observations do not fit
their global model considering as Trivers [47], that
higher gametic selection in one sex reduced recombin-
ation in that sex to preserve the favorable gene combina-
tions that confer reproductive success. Indeed, we found
(see discussion on segregation distortion below) much
more significant segregation distortion, and therefore
probable gametic selection, for Clementine male gametes
than for female gametes. The citrus data is more in
agreement with models that suggest that the sex experi-
encing the more intense selection, or otherwise having
the higher variance in reproductive success, should show
more recombination (as reported by Burt et al. [47]).
Important differences in LG lengths were also
observed between Clementine (male and female) and
sweet orange for LG1, LG2, LG3, LG5, LG6 and LG8.
The LGs for sweet orange were systematically shorter.
The literature on plants and animals shows that the im-
pact of structural heterozygosity on recombination fre-
quency is variable. Different situations have been
discussed by Parker et al. [48]. It is well established that
sequence divergence at the interspecific level has an in-
hibitory effect on sexual recombination [49-52]. Chetelat
et al. [52] observed a strong reduction in the recombin-
ation rate in a mapping population of an interspecific F1
tomato hybrid of Lycopersicon esculentum x Solanum
lycopersicoides. The authors concluded that the high
DNA sequence divergence between L. esculentum and S.
lycopersicoides is a better explanation of reduced recom-
bination than structural reorganization. Previously (and
also in tomato), Liharska et al. [53] showed that the
amount of recombination in a defined genetic interval
decreased as the proportion of foreign chromatin (intro-
gressed from close relatives of L. esculentum) increased.
The authors also mentioned that, as the donor of


the foreign chromatin became more distantly related,
the level of observed recombination was lower. As the
Clementine is a mandarin x sweet orange hybrid, and
sweet orange arose from mandarin and pummelo gene
pools (with a higher proportion of C reticulata; [7,9]), it
is highly probable that sweet orange contains more gen-
ome regions of interspecific heterozygosity (C. reticu-
lataI/C maxima) than the Clementine. Therefore, it can
be hypothesized that the lower LG sizes, and the asso-
ciated lower recombination rates observed in sweet or-
ange compared with Clementine, are associated with the
relative interspecific patterns along the genome of these
two species. The area of LG9 that displays substantially
greater marker density in Clementine and sweet-orange
suggests limited recombination within a large genome
portion. Thus, two set of markers were common between
the Clementine map and the two pummelo maps
(MEST308, CIBE6092 and MEST065 for Pink pummelo
and mCrCIR07F11, JI-AAG03, MEST 308 and CIBE6092
for Chandler pummelo). Interestingly, in the pummelo
maps, these markers cover 26.5 cM and 30 cM, respect-
ively, compared with an area concentrated within 2 cM
in the Clementine map. It appears that both Clementine
and sweet orange are strongly affected by a similar re-
combination limitation in LG9 for which they display
equivalent map sizes. Haplotype analysis of sweet orange
and diploid Clementine shows that the Clementine
haplotype transmitted by sweet orange was inherited pri-
marily from one of the sweet orange haplotypes, and only
a small telomeric fragment was likely to be transmitted
from the other sweet orange haplotype. Further genome
analysis along with cytogenetic and mapping studies will
be necessary to explain the different recombination pat-
terns observed between species.

Extensive segregation distortions are observed in specific
linkage group areas particularly when Clementine is used
as the male parent
Distortions from expected Mendelian allelic segregations
were observed for all mapped parents of the segregating
progenies. The highest rate was recorded for male Clem-
entine with 56% skewed loci (p < 0.05). This percentage
is more than four times higher than that of female
Clementine (13%), which was equal with the estimate of
female 'Chandler' pummelo. Male 'Pink' pummelo dis-
played a slightly higher level of distortion than female
'Chandler' pummelo (16%), while sweet orange (mainly
from female data) displayed an intermediate level (27%).
Distorted loci were also observed in most of the previ-
ous citrus mapping studies [17,20,54-57]. Bernet et al.
[18] also reported a higher percentage of skewed loci in
the male parents compared to the female parents in a re-
ciprocal cross between 'Chandler' pummelo and 'For-
tune' mandarin. Since most segregation distortions affect


Page 13 of 20






Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


the allele frequencies without disturbing the genotypic
frequency equilibrium (non significant F value-Wright
fixation index; data not shown), it is probable that gam-
etic selection was the main factor causing skewed segre-
gation. Bernet et al. [17] reached the same conclusion
from supporting biological data on parental fertility.
Upon cross pollination with compatible parents, the pro-
portion of fertilized ovules is much greater than the pro-
portion of successful male gametes. Therefore, it appears
logical that gametic selection is likely to be much more
pronounced in male gametes than in females ones. This
can result from several mechanisms such as gamete
abortion, pollen competition or, the citrus gametophytic
incompatibility system [58]. The pattern of X2 conform-
ity test values, as well as the excess of mandarin alleles
along the linkage groups, suggests that the presence of a
small number of loci under relatively strong selection
pressure on each chromosome is more likely than selec-
tion at multiple loci. Similar patterns were observed in
tomato [52]. Identical areas of skewed loci were
observed between Clementine and sweet orange in sev-
eral linkage groups (LG1, LG3, LG5 and LG9). Modern
sweet orange varieties arose from an interspecific hybrid
prototype that has undergone vegetative propagation or
propagation from seeds containing nucellar embryos
over a several thousand year period. Besides favorable
mutations and stable epigenetic variations that have
been selected by man and the environment, it is prob-
able that without the filter of sexual reproduction, the
sweet orange genome accumulated unfavorable muta-
tions in a heterozygous status. Some of these unfavor-
able mutations were likely transmitted to Clementine, as
attested by the high proportion of weak progeny
obtained from Clementine x sweet orange hybridization
(our unpublished data), which should affect both sweet
orange and Clementine segregations. Interestingly, the
gametic selections have the same orientation for male
and female Clementine in the genomic regions where
sweet orange segregations are also skewed (LG1, end of
LG5, and LG9). In other genome regions, male and fe-
male Clementine segregation distortions appeared dis-
connected. A very strong selection is observed in the
middle of LG3 for the male Clementine, without signifi-
cant skewing in the female. The male and female distor-
tions appeared totally opposite at the end of LG4 and in
the first part of LG5. The gametophytic incompatibility
system described in citrus [58] could be a factor for male
gametic selection. However, this may lead to a complete
exclusion of one allele for the concerned locus and
therefore, a very high distortion for the linked marker
locus. This pattern was not observed in the present
study. The gametophytic incompatibility system was also
excluded as an explanation for the segregation distortion
observed in the reciprocal crosses between 'Fortune'


mandarin and 'Chandler' pummelo [17]. Some of the
more extremely unequal allelic ratios (70/30) for the
male Clementine occurred in areas without significant
distortion (or even opposite selection) in the female.
Such differences between male and female selection may
partly explain the inconsistent results observed for trait
segregation in the reciprocal crosses. Thus, it is difficult
to infer genetic control from observed trait segregations
without concomitant marker segregation analysis. This
is particularly true if major genes controlling the studied
trait are heterozygous in the male parent. QTL analysis
may also be affected as described by Xu [59].

Haplotype structure of the diploid Clementine and the
haploid Clementine used for the implementation of the
citrus whole genome reference sequence
Clementine is thought to have been selected as a chance
seedling from a 'Mediterranean' mandarin by Father
Clement just over one century ago in Algeria. The man-
darin female parentage was confirmed by mitochondrial
genome analysis [10]. The 'Granito' sour orange was ini-
tially considered to be the male parent [15]. However,
molecular studies demonstrated that the Clementine
was more likely a mandarin x sweet orange hybrid
[8,9,16]. The marker phase analysis performed from the
Clementine and sweet orange mapping data confirmed
this hypothesis, and allowed the identification of the
haplotype structures of the mandarin and sweet orange
gametes that produced the Clementine. Nine recombin-
ation break points between the two sweet orange haplo-
types (one each in LG1, LG7 and LG9, and two each in
LG3, LG4 and LG5) were identified for the sweet orange
gamete that produced the Clementine.
The implementation of a reference citrus whole gen-
ome sequence has been the primary focus of the ICGC
for the last 5 years. Polymorphism in a whole genome
sequence complicates the assembly process. Assembly
contiguity and completeness is significantly lower than
would have been expected in the absence of heterozy-
gosity [60]. Commercial citrus varieties are characterized
by high heterozygosity levels [6,7]. The comparison of
blind versus "known-haplotype" assemblies of shotgun
sequences obtained from a set of BAC clones from the
heterozygous sweet orange [61] led the ICGC to estab-
lish the reference sequence of the citrus genome from a
homozygous genotype. A haploid plant derived from the
Clementine was selected due to its immediate availability
and preexisting molecular resources [26,27,62-64]. The
selected haploid was obtained by induced gynogenesis
after in situ pollination with irradiated pollen [13]. The
haploid Clementine was genotyped using the markers
mapped in diploid Clementine and sweet orange. This
permitted the constitution of the haploid genome to be
determined according to the mandarin and sweet orange


Page 14 of 20






Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


haplotypes constitutive of the diploid Clementine. Eight
recombination break points were identified between the
two Clementine haplotypes (one in LG1, LG7 and LG8;
two in LG 5 and three in LG3). LG2, LG4, LG6 and LG9
appear to have been entirely inherited from the 'Medi-
terranean' mandarin haplotype without recombination.
Overall, a very large fraction of the genome of the hap-
loid Clementine used for WGS was inherited from the
'Mediterranean' mandarin.

Conclusions
Five parental genetic maps were established from three
segregating populations that were genotyped using SNP,
SSR and Indel markers. A first medium density reference
map (961 markers for 1084.1cM) of citrus was estab-
lished by joining male and female Clementine segrega-
tion data. Despite the heterogeneous dispersion of
markers, this constitutes a good framework for further
marker-trait association studies, and it has been used to
enable the chromosome assembly of the reference whole
genome citrus sequence [39]. The Clementine map was
compared with two pummelo maps ('Chandler' map:
151 markers for 828.6 cM; 'Pink' map: 81 markers for
633 cM) and a sweet orange map (569 markers for
669.6 cM). The linear order of the markers appeared
to be highly conserved at the interspecific level. This
should allow for reasonable inferences of most citrus
genome sequences via mapping NGS re-sequencing
data in the haploid Clementine reference genome se-
quence. Important variations between the Clementine and
sweet orange map sizes were observed, as well as varia-
tions between the male and female Clementine maps. This
suggests variations in recombination rates. The smaller
length of the sweet orange map is likely related to the
higher interspecific heterozygosity within the sweet orange
genome. Skewed segregations are numerous in the male
Clementine map, underlining the potential extent of devi-
ation from Mendelian segregation for characters con-
trolled by heterozygous loci in the male parent. Genetic
mapping data confirmed that the Clementine is a hybrid
between the 'Mediterranean' mandarin and sweet orange.
Nine recombination break points were identified between
the two sweet orange haplotypes for the sweet orange
gamete that contributed to the Clementine genome. The
genome of the haploid Clementine used to establish the
citrus reference sequence appears to be have been primar-
ily inherited from the 'Mediterranean' mandarin haplotype
of the diploid Clementine.

Materials and methods
Segregating progenies and DNA extraction
Clementine and pummelo genetic mapping
Two inter-specific segregating populations between C.
clementina and C. maxima were used to establish the


genetic maps. One hundred and fifty-six hybrids of
'Chandler' pummelo x 'Nules' Clementine (CP x NC)
were produced and grown at CIRAD/INRA (Corsica),
while 140 hybrids of 'Nules' Clementine x 'Pink' pum-
melo (NC x PP) were obtained at IVIA. Total DNA was
extracted from fresh leaves according to Doyle and
Doyle [65]. In addition to the interspecific hybrids, total
DNA was extracted from the parental lines: diploid
'Nules' Clementine (IVIA-22), 'Chandler' pummelo
(ICVN 0100608) and 'Pink' Pummelo (IVIA-275). DNA
was also extracted from the haploid Clementine selected
for the whole genome sequence implementation and
'Mediterranean' mandarin (IVIA-154), the assumed fe-
male parent of Clementine.


Sweet orange genetic mapping
One hundred and forty seven intergeneric hybrids be-
tween sweet orange and trifoliate orange (Citrus sinensis x
Poncirus trifoliata; SO x TO) were used for sweet orange
mapping using SNP markers shared with the Clementine
map. These hybrids were obtained at UF-CREC (Florida)
and previously used for sweet orange and trifoliate orange
mapping using SSR markers [19]. The different crosses
used were: (i) 56 hybrids of C sinensis cv Sanford (Sa) x P.
trifoliata cv Argentina (Ar), (ii) 40 hybrids of C sinensis
cv Fiwicke (Fi) x P. trifoliata cv Flying Dragon (FD); (iii)
15 hybrids of C sinensis cv Ridge Pineapple (RP) x P. trifo-
liata cv Flying Dragon (FD), (iv) seven hybrids of C. sinen-
sis cv Fiwicke (Fi) x P. trifoliata cv Argentina (Ar); (v) six
hybrids of C sinensis cv Ruby (Ru) x P. trifoliata cv Flying
Dragon (FD), (vi) five hybrids of C sinensis cv Ridge
Pineapple (RP) x P. trifoliata cv DPI0906 (Ps), (vii) five
hybrids of C sinensis cv Ruby (Ru) x P. trifoliata Ar-
gentina cv (Ar), and (viii) 13 hybrids of P. trifoliata cv
Flying Dragon (FD) x C sinensis Ridge cv Pineapple
(RP). Due to the nature of C. sinensis intraspecific
evolution (somatic mutations but not sexual recom-
bination), molecular polymorphisms between sweet
orange cultivars is very rare [8,19]. Therefore, after
confirming the lack of polymorphism between paren-
tal sweet oranges at the marker loci, all of the hybrids
were considered to be derived from a single sweet or-
ange genotype for the mapping analysis. Prior to
DNA extraction, the ploidy level of all hybrids was
estimated by flow cytometry, and only diploid hybrids
were used. Genomic DNA was isolated from tender
leaves using the CTAB method as described by
Aldrich and Cullis [66].


Markers
A total of 1166 markers were used to genotype the pro-
genies. Of these markers, 837 were SNPs, 301 were SSRs
and 28 were Indels.


Page 15 of 20






Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


SNPs
CiC****-**: the 802 SNPs were mined from the Clemen-
tine BAC end sequence database [27]. These markers
are part of the 1536 total SNPs used to implement an
Illumina GoldenGate assay. These markers were
selected based on their quality and segregation in the
analyzed progenies for at least one parent. They have
been published by Ollitrault et al. [8] and the corre-
sponding GenBank accession numbers can be found in
Additional file 1.
ACO-*-***, ADC****, Aoc****, ATGGcM155, Cax4****,
CHI-*-***, DXS-M-***, FLS-M-***; HKT1c800F141; Lap
XcF***; LCY2-*-***; LCYB-*-***, MDH-P-84; NADK2c
800F***; PKF-M-186, PSY-M-289, TRPA-M-***, TScMI
1331: These 34 SNP markers were mined by Sanger se-
quencing of 44 genotypes representative of Citrus and
relative diversity, and were obtained from 19 genes im-
plicated in the primary and secondary metabolite biosyn-
thesis pathway and salt tolerance [38]. Corresponding
GenBank accession numbers can be found in Additional
file 1. Seventeen of these SNPs have been published [8].
Details on the 17 remaining markers can be found in
Additional file 10.


SSR markers
The 301 SSR markers used for mapping were developed
from genomic libraries (79), ESTs (188), and BACend
sequences (34).
CI***** and mCrCIR*****: These 57 markers were
developed by Froelicher and colleagues at CIRAD/INRA
(France) from a genomic library of 'Cleopatra' mandarin.
Corresponding GenBank accession numbers can be
found in Additional file 1. Most of the mapped markers
have been published [23,67-69]. Primers for the
remaining markers are given in Additional file 11.
CIBE****: These 34 markers were developed by
Ollitrault and colleagues at CIRAD/IVIA (France/Spain)
from a Clementine BAC end sequence database [27].
These markers are published in Ollitrault et al. [28]. Cor-
responding GenBank accession numbers can be found in
Additional file 1.
CF-*****, JI.***** and NB-****: These 59 markers were
developed by Roose and colleagues at UCR (California).
Fourteen of the markers are from genomic libraries and
45 are from ESTs. Corresponding GenBank accession
numbers can be found in Additional file 1. Only the four
NB-**** markers have been published [6]. Data on the
remaining markers can be obtained upon request
(Mikeal L. Roose ).
CTV2745: This marker is closely linked to the citrus
tristeza virus immunity gene of trifoliate orange and was
developed in the Roose laboratory (UCR, California)
from a genomic sequence [70].


Cms** and jk-****: These seven markers were devel-
oped from genomic libraries and were published by
Ahmad et al. [71] and Kijas et al. [55], respectively.
CX****: These 70 markers were developed by Chunxian
Chen and colleagues at the CREC (Florida) from an EST
database. The corresponding GenBank accession numbers
can be found in Additional file 1. Some of the mapped
markers have been published by Chen et al. [19,25]. Data
on the remaining markers can be obtained upon request
(Chunxian Chen: cxchen@ufl.edu).
Mest****: These 73 markers were developed by Luro
and Col. at INRA/CIRAD from EST databases (France).
The corresponding GenBank accession numbers can be
found in Additional file 1. Seven of these markers were
published by Luro et al. [26]. The primer sequences of
the remaining markers can be obtained upon request
(luro@corse.inra.fr).

Indel markers
CID****: These 28 markers were developed from a Clem-
entine BAC end sequence database [27] at IVIA/CIRAD
(Spain), and have been published by Ollitrault et al. [30].
IDCAX is an Indel marker developed by Garcia-Lor
et al. [7]. The corresponding GenBank accession num-
bers can be found in Additional file 1.

Genotyping methods
SSRs
SSR genotyping was performed using different methods
in different laboratories (Additional file 1).
At IVIA/CIRAD and INRA, PCR products (using
wellRED oligonucleotides, Sigma) were separated by ca-
pillary gel electrophoresis (CEQ- 8000 Genetic Analysis
System; Beckman Coulter Inc.) as described by Ollitrault
et al. [28]. The data collection and analysis were per-
formed with GenomeLab- GeXP software, version 10.0.
At CIRAD and Cukurova University, PCR products
(using tailing M13 associated with three fluorescent dyes)
were separated by electrophoresis on a Li-Cor DNA
Analyzer 4200 system (Licor Biosciences, BadHomburg,
Germany). The alleles were sized according to 50- to 350-
bp standards (MWG Biotech AG, Ebersberg, Germany).
SSR alleles were detected and scored using SAGA
Generation 2 software (LI-COR, USA) and controlled
visually.
At the CREC, PCR products (using tailing M13) were
separated by capillary gel electrophoresis on an ABI
3130xl Genetic Analyzer (Applied Biosystems Inc., Foster
City, CA, USA). GeneScan 3.7 NT and Genotyper 3.7
NT were used to extract the trace data and generate
the microsatellite allele tables, respectively. More details
can be found in Chen et al. [25].
At UCR, PCR products labeled by an M13-tailed pri-
mer strategy were separated using a denaturing 7% Long


Page 16 of 20







Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


Ranger (BMA, Rockland, ME, USA) polyacrylamide gel
attached to a LI-COR IR2 4200LR Global DNA sequen-
cer dual dye system. Alleles were sized manually by
comparison with 50-350 bp size standards (LI-COR),
and then scored manually from gel image files. More
details can be found in Barkley et al. [6].

Indels
Indel markers were genotyped by Capillary Gel Electro-
phoresis (CEQT 8000 Genetic Analysis System; Beckman
Coulter Inc.) using wellRED oligonucleotides (Sigma)
as described by Ollitrault et al. [34]. Data collection and
analysis were performed with GenomeLabT GeXP soft-
ware, version 10.0.

SNPs
All SNP markers were genotyped on a GoldenGate array
platform according to the standard Illumina GoldenGate
assay instructions (www.illumina.com). More details can
be found in Ollitrault et al. [8]. Two genotype controls
('Nules' Clementine and 'Chandler' pummelo) were
repeated twice in each plate. The data were collected
and analyzed using the Genome Studio software (Illu-
mina). The automatic allele calling was visually checked
for each marker/plate and corrected if necessary.

Linkage analysis and genetic mapping
The two-way pseudo-testcross mapping strategy was
used to determine the linkages in the different F1 popu-
lations from the two heterozygous parents as previously
described [72] and used in previous mapping studies in
citrus [17,19,73]. Each progeny was analyzed with Join-
Map 4.0 [74]. The genotyping data were coded according
to the "CP" population option adapted for such two-way
pseudo-testcrosses with no previous knowledge of the
marker linkage phases. In the first step, JoinMap was
used to establish male and female gamete populations,
which were analyzed separately. Segregation distortion
was tested by X2 conformity tests against the Mendelian
segregation ratio of 1:1. Linkage analysis and marker
grouping were performed using the independence LOD
and a minimum threshold LOD=4. Phases (coupling and
repulsion) of the linked marker loci were automatically
detected by the software. Map distances were established
in centiMorgans (cM) using the regression mapping al-
gorithm and the Kosambi mapping function. Given that
missing observations have much less negative impact on
the quality of the map than errors, several authors rec-
ommend identifying suspicious data and treating them
as missing observations [75,76]. In high density genetic
mapping, a genotype error usually manifests itself as a
singleton (or a double cross-over) under a reasonably ac-
curate ordering of the markers. A singleton is a locus
whose phase is different from both the marker phases


immediately before and after. A reasonable strategy to
deal with genotyping errors is to remove singletons by
treating them as missing observations, and then refine
the map by running the ordering algorithm [75,76]. For
the Clementine map in which a relatively high number
of markers was genotyped, singletons were automatically
checked after a first mapping round and replaced by
missing data using an excel page routine. The Clemen-
tine maps were established from these cleaned data.
Distorted markers were not removed from the analysis
because they were very frequent for some parents.
Moreover, using JoinMap, each grouping of linked loci
was based upon a test for independence in a contingency
table. Since the test for independence is not affected by
segregation distortion like the LOD score used by other
methods of linkage analysis, a lower incidence of spuri-
ous linkage is expected [74]. The linkage maps were
drawn using the MapChart program [77]. The circle plot
diagram used to compare the marker order in four gen-
etic maps was performed using Circos software (http://
circos.ca/). Clementine and sweet orange haplotypes
were drawn with GGT 2.0 software [78].




Additional files

Additional file 1: Origin and information for all markers. This fle
contains a table showing detailed information for all markers type of
marker (Indels, SSRs or SNPs); the type of sequence data from which the
markers were developed genomicc library, BAC end sequences, ESTs);
GenBank accession number; the laboratory in which the markers were
developed; the laboratory in which the different progenies were
genotyped, the occurrence and configuration of null allele for the
parents of analyzed progenies and the references for the papers in which
the markers were published, with an indication of the modifications (if
any) in the marker names
Additional file 2: Detailed results of genetic mapping. This file
contains the detailed information (marker locations, X2 for Mendelian
segregation, and level of significance) on the genetic maps for male
Clementine, female Clemente, reference Clementine, sweet orange,
'Chandler' pummelo and 'Pink' pummelo The estimated location of all
markers in the reference Clementine map is also provided (synthesis
columns)
Additional file 3: Conserved linear order between male and female
Clementine genetic maps. This file contains a figure showing the
relative positions of the markers in the female Clementine map (y axis)
and in the male Clementine map (x axis) for each linkage group
Additional file 4: Reference Clementine genetic map. This file
contains a figure showing the nine linkage groups of the reference
Clementine genetic map and the position of each marker (blue SNPs;
green SSRs; red Indels)
Additional file 5: 'Chandler' pummelo genetic map. This file contains
a figure showing the nine linkage groups from the 'Chandler' pummelo
genetic map and the position of each marker (blue SNPs; green SSRs;
red Indels)
Additional file 6: 'Pink' pummelo genetic map. This file contains a
figure showing the nine linkage groups of the 'Pink' pummelo genetic
map and the position of each marker (blue SNPs; green SSRs; red
Indels)


Page 17 of 20








Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


Additional file 7: Sweet orange genetic map. This fle contains a
figure showing the nine linkage groups of the sweet orange genetic
map and the position of each marker (blue SNPs)
Additional file 8: Variation of map length between male
Clementine, female Clementine, and sweet orange based only on
common SNP markers. This file contains a figure for each linkage group
showing the relative position of the markers in the female Clementine
map, the male Clementine map, and the sweet orange map in a new
mapping analysis performed using only the common markers for the
three parents The x axis represent the location on the reference
Clementine map established from all Clementine gametes (male +
female) The relative locations in the other maps (the ratio between the
locations in the other map relative to the location in the Clementine
reference map) are shown on the y axis
Additional file 9: Comparative distribution of the skewed markers
in the nine linkage groups for five parents. This fle contains a figure
for each linkage group showing the distortion magnitude (X2 of
conformity with Mendelian segregation) for each marker and each
mapped parent Furthermore, 9b shows an example illustrating the
method used to estimate the location in the reference Clementine map
of markers mapped in the other parents
Additional file 10: Information on the new SNP markers included in
the GoldenGate array. This file contains information regarding the new
SNP markers included in the GoldenGate array It includes the GenBank
accession number, the sequence surrounding the SNPs, SNP position, the
GoldenGate primers and designability rank
Additional file 11: Characteristics and primers for the new SSR
markers developed from 'Cleopatra' mandarin genomic library at
CIRAD. This file contains information on the primers used for the new
SSRs developed from a Cleopatra mandarin (C reshni) genomic library
(GenBank accession number, primer sequences, annealing temperature
and microsatellite motif)


Competing interests
The authors declare that they have no competing interests


Authors' contributions
PO managed the work, analyzed the data and wrote the manuscript JT and
MT provided the SNP markers and contributed to data analysis DB, ABe, ABo
and AC developed the GoldenGate array and performed the SNP
genotyping YF developed the CPxNC population and provided DNA PA
developed the CNxPP population and provided DNA CC and FGG provided
the SOxTO progeny DNA and performed part of the SSR genotyping CTF,
SL, IH, FO, GC, YK, LM, AGL, CB, LN, FL and MLR contributed to the SSR and
Indels genotyping, and JC contributed to the analysis of mapping data All
authors have read and approved the final manuscript


Acknowledgements
This work was principally funded by the French ANR CITRUSSEQ project The
European Commission, under the FP6-2003- INCO-DEV-2 project CIBEWU
(n015453), the Spanish Ministerio de Ciencia e Innovac6n grants, AGL2007-
65437-C04-01/AGR and AGL2008-00596-MCI, the Spanish PSE-060000-2009-8
and IPT-010000-2010-43 projects, the Prometeo project 2008/121 Generalidad
Valenciana, the Turkish TUBITAK Project No 1080568, the California Citrus
Research Board and UC Discovery grant itl-bio-03-10122 and the Florida
Citrus Research and Development Foundation (CRDF), grants #67 and 71 also
contributed to the work

Author details
CIRAD, UMR AGAP, F-34398 Montpellier, France 21VIA, Centro Proteccion
Vegetal y Biotechnologia, Ctra Moncada-Niquera Km 45, 46113 Moncada,
Valencia, Spain 3VIA, Centro de Genomica, Apartado Oficial, 46113 Moncada,
Valencia, Spain 4Citrus Research and Education Center, University of Florida,
Lake Alfred, FL 33850 USA SDepartment of Botany and Plant Sciences,
University of California, Riverside, CA 92521 USA 61nstitut National de la
Recherche Agronomique, BP293, 14 000 K4nitra, Morocco 7INRA, UR EPGV, 2
rue Gaston Cremieux, 91057 Evry, France "INRA, UR GEQA, San Giuliano,
20230 San Nicolao, France 9Department of Horticulture, Faculty of


Agriculture, University of Cukurova, 01330 Adana, Turkey 'oCNG, CEA/DSV/
Institute de Genomique, 2 rue Gaston Cremieux, 91057 Evry, France

Received: 28 May 2012 Accepted: 29 October 2012
Published: 5 November 2012


References
1 FAOSTAT; 2009 i i i l I I i
2 Scora RW On the history and origin of Citrus. Bull Torrey Bot Club 1975,
102:369-375
3 Barrett HC RA A numerical taxonomic study of affinity relationships in
cultivated Citrus and its close relatives. Syst Bot 1976, 1:105-136
4 Webber HJ History and development of the citrus industry In The citrus
industry Volume 1 Edited by Reuther W, Webber HJ Berkeley University of
California Press; 19671-39
5 Luro F, Rist D, Ollitrault P Evaluation of genetic relationships in Citrus
genus by means of sequence tagged microsatellites. Acta Hortic 2001,
546:237-242
6 Barkley NA, Roose ML, Krueger RR, Federici CT Assessing genetic diversity
and population structure in a citrus germplasm collection utilizing
simple sequence repeat markers (SSRs). Theor App Genet 2006,
112(8)1519-1531
7 Garcia-Lor A, Luro F, Navarro L, Ollitrault P Comparative use of InDel and
SSR markers in deciphering the interspecific structure of cultivated citrus
genetic diversity: a perspective for genetic association studies. Mol Genet
Genomics 2012, 287(1)77-94
8 Ollitrault P, Terol J, Garcia-Lor A, Berard A, Chauveau A, Froelicher Y, Belzile
C, Morillon R, Navarro L, Brunel D, Talon M SNP mining in C. clementina
BAC end sequences; transferability in the Citrus genus (Rutaceae),
phylogenetic inferences and perspectives for genetic mapping. BMC
Genomics 2012, 13:13
9 Nicolosi E, Deng ZN, Gentile A, Malfa S, Continella G, Tribulato E Citrus
phylogeny and genetic origin of important species as investigated by
molecular markers. Theor App/ Genet 2000, 100(8)'1155-1166
10 Froelicher Y, Mouhaya W, Bassene JB, Costantino G, Kamiri M, Luro F, Morillon R,
Ollitrault P New universal mitochondrial PCR markers reveal new information
on maternal citrus phylogeny. Tree Genet Genomes 2011, 7(1)49-61
11 Krug CA Chromosome numbers in the subfamily Arantioideae, with
special reference in the genus Citrus. Citrus Bot Gaz 1943, 104:602-611
12 Ollitrault P, Jacquemond C, Dubois C, Luro F Citrus In Genetic diversity of
cultivated tropical plants Edited by Hamon P, Seguin M, Perrier X,
Glaszmann JC Montpellier CIRAD; 2003'193-217
13 Aleza P, Juarez J, Hernandez M, Pina JA, Ollitrault P, Navarro L Recovery
and characterization of a Citrus clementina Hort. ex Tan. 'Clemenules'
haploid plant selected to establish the reference whole Citrus genome
sequence. BMC Plant Biol 2009, 9:110
14 Gmitter FG Jr The Haploid Mandarin and Diploid Sweet Orange Genome
Sequences San Diego, CA Plant & Animal Genomes XIX Conference; 2011
15 Trabut JL' L'hybridation des Citrus : une nouvelle tangerine "la
Clementine". Revue Horticole 1902, 10:232-234
16 Deng ZN, Gentile A, Nicolosi E, Continella G, Tribulato E Parentage
determination of some citrus hybrids by molecular markers. Proceedings
of the International Society of Citriculture XIII Congress 1996, 2:849-854
17 Bernet GP, Fernandez Ribacoba J, Carbonell EA, Asins MJ Comparative
genome-wide segregation analysis and map construction using a
reciprocal cross design to facilitate citrus germplasm utilization. Mol
Breed 2010, 25(4)'659-673
18 Lyon MT, Federici CT, Kacar Y, Chen C, O'Malley D, Chaparro JX, Gmitter FG,
Roose ML SSR-Based Linkage Maps For Sweet Orange And Trifoliate Orange
San Diego, CA Plant & Animal Genome XVth Conference; 2007
19 Chen CX, Bowman KD, Choi YA, Dang PM, Rao MN, Huang S, Soneji JR,
McCollum TG, Gmitter FG Jr EST-SSR genetic maps for Citrus sinensis and
Poncirus trifoliata. Tree Genet Genomes 2008, 4(1)'1-10
20 CarlosdeOliveira A, Bastianel M, Cristofani-Yaly M, MoraisdoAmaral A,
Machado MA Development of genetic maps of the citrus varieties
'Murcott' tangor and 'Pera' sweet orange by using fluorescent AFLP
markers. J App Genet 2007, 48(3)'219-231
21 Gulsen 0, Uzun A, Canan I, Seday U, Canihos E A new citrus linkage map
based on SRAP, SSR, ISSR, POGP, RGA and RAPD markers. Euphytica 2010,
173(2) 265-277


Page 18 of 20








Ollitrault et al. BMC Genomics 2012, 13:593
http://www.biomedcentral.com/1471-2164/13/593


22 Novelli VM, Cristofani M, Souza AA, Machado MA Development and
characterization of polymorphic microsatellite markers for the sweet
orange (Citrus sinensis L. Osbeck). Genet Mol Biol 2006, 29(1)'90-96
23 Froelicher Y, Dambier D, Bassene JB, Costantino G, Lotfy S, Didout C,
Beaumont V, Brottier P, Risterucci AM, Luro F, Ollitrault P Characterization
of microsatellite markers in mandarin orange (Citrus reticulata Blanco).
Mol Ecol Resour 2008, 8(1)'119-122
24 Kijas JM, Fowler JC, Thomas MR An evaluation of sequence tagged
microsatellite site markers for genetic analysis within Citrus and related
species. Genome 1995, 38(2)'349-355
25 Chen CX, Zhou P, Choi YA, Huang S, Gmitter FG Jr Mining and
characterizing microsatellites from citrus ESTs. TAG Theor Appl Genet 2006,
112(7) 1248-1257
26 Luro FL, Costantino G, Terol J, Argout X, Allario T, Wincker P, Talon M,
Ollitrault P, Morillon R Transferability of the EST-SSRs developed on
Nules clementine (Citrus clementina Hort ex Tan) to other Citrus
species and their effectiveness for genetic mapping. BMC Genomics
2008, 9:287
27 Terol J, Naranjo MA, Ollitrault P, Talon M Development of genomic
resources for Citrus clementina: characterization of three deep-coverage
BAC libraries and analysis of 46,000 BAC end sequences. BMC Genomics
2008, 9:423
28 Ollitrault F, Terol J, Pina JA, Navarro L, Talon M, Ollitrault P Development of
SSR markers from Citrus clementina (Rutaceae) BAC end sequences and
interspecific transferability in Citrus. Am J Bot 2010, 97(11)'e124-el29
29 Biswas MK, Chai L, Qiang X, Deng X Generation, functional analysis and
utility of Citrus grandis EST from a flower-derived cDNA library. Mol Biol
Rep 2012, 39:7221-7235
30 Ollitrault F, Terol J, Alonso Martin A, Pina JA, Navarro L, Talon M, Ollitrault P'
Development of InDel markers from Citrus clementina (Rutaceae) BAC-
end sequences and interspecific transferability in Citrus. Am J Bot 2012,
99(7)'e268-e273
31 Ruiz C, Asins MJ Comparison between Poncirus and Citrus genetic
linkage maps. Theor Appl Genet 2003, 106(5)'826-836
32 Roose ML' Mapping and marker assisted selection in Citrus In Citrus
genetics, breeding oand biotechnology Edited by Khan IA Wallingford, UK'
CAB International; 2007275-286
33 Oliveira RP, Cristofani M, Vildoso CIA, Machado MA Genetic linkage maps
of 'Pera' sweet orange and 'Cravo' mandarin with RAPD markers.
Pesquisa Agropecudrioa Brosiler 2004, 39:159-165
34 Omura M, Ueda T, Kita M, Komatsu A, Takanokura Y, Shimada T, Endo-
Inagaki T, Nesumi H, Yoshida T EST Mopping of Citrus Orlando, FL'
Proceedings of the International Society of Citriculture IX Congress;
200071-74
35 Sankar AA, Moore GA Evaluation of inter-simple sequence repeat analysis
for mapping in Citrus and extension of the genetic linkage map. Theor
Apple Genet 2001, 102:206-214
36 Lindner KR, Seeb JE, Habicht C, Knudsen KL, Kretschmer E, Reedy DJ, Spruell
P, Allendorf FW Gene-centromere mapping of 312 loci in pink salmon by
half-tetrad analysis. Genome 2000, 43(3)'538-549
37 van Os H, Andrzejewski 5, Bakker E, Barrena I, Bryan GJ, Caromel B, Ghareeb
B, Isidore E, de Jong W, van Koert P, Lefebvre V, Milbourne D, Ritter E, van
der Voort JN, Rousselle-Bourgeois F, van Vliet J, Waugh R, Visser RG, Bakker
J, van Eck HJ Construction of a 10,000-marker ultradense genetic
recombination map of potato: providing a framework for accelerated
gene isolation and a genomewide physical map. Genetics 2006,
173(2) 1075-1087
38 Garcia-Lor A, Curk F, Morillon R, Ancillo G, Luro F, Navarro L, Ollitrault P'
Nuclear phylogeny within Citrus (Rutaceae) and four related genera. Ann
Bot 2012 doi 101093/aob/mcs227
39 Gmitter FG New Citrus Genome Sequence Resources San Diego, CA Plant &
Animal Genome XX Conference; 2012
40 Buetow KH Influence of aberrant observations on high-resolution
linkage analysis outcomes. Am J Hum Genet 1991, 49(5)'985-994
41 Hackett CA, Broadfoot LB Effects of genotyping errors, missing values
and segregation distortion in molecular marker data on the construction
of linkage maps. Heredity (Edinb) 2003, 90(1)'33-38
42 Popa A, Samollow P, Gautier C, Mouchiroud D The sex-specific impact of
meiotic recombination on nucleotide composition. Genome Biol Evol
2012, 4(3)412-422


43 Lorch PD Sex differences in recombination and mapping adaptations.
Genetic 2005, 123(1-2)'39-47
44 Haldane JBS Sex ratio and unisexual sterility in hybrid animals. J Gener
1922, 12:101-109
45 Giraut L, Falque M, Drouaud J, Pereira L, Martin OC, Mezard C Genome-
wide crossover distribution in Arabidopsis thaliana meiosis reveals sex-
specific patterns along chromosomes. PLoS Genet 2011, 7(11)'e1002354
46 Lenormand T, Dutheil J Recombination difference between sexes: a role
for haploid selection. PLoS Biol 2005, 3(3)'e63
47 Trivers RL Sex differences in rates of recombination and sexual selection
In The Evolution of Sex Edited by Michod RE, Levin BR Sunderlan,
Massachusetts Sinauer Associates Inc; 1988'270-286
48 Parker J5, Palmer RW, Whitehorn MAF, Edgar LA Chiasma frequency
effects of structural chromosome change. Chromosome 1982, 85:673-686
49 Chambers SR, Hunter N, Louis EJ, Borts RH The mismatch repair system
reduces meiotic homeologous recombination and stimulates
recombination-dependent chromosome loss. Mol Cell Biol 1996,
16(11)'6110-6120
50 Opperman R, Emmanuel E, Levy AA The effect of sequence divergence
on recombination between direct repeats in Arabidopsis. Genetics 2004,
168(4) 2207-2215
51 Li L, Jean M, Belzile F The impact of sequence divergence and DNA
mismatch repair on homeologous recombination in Arabidopsis. Plont J
2006, 45(6)908-916
52 Chetelat RT, Meglic V, Cisneros P A genetic map of tomato based on
BC(1) Lycopersicon esculentum x Solanum lycopersicoides reveals
overall synteny but suppressed recombination between these
homeologous genomes. Genetics 2000, 154(2) 857-867
53 Liharska T, Wordragen M, Kammen A, Zabel P, Koornneef M Tomato
chromosome 6: effect of alien chromosomal segments on recombinant
frequencies. Genome 1996, 39(3)485-491
54 Luro F, Lorieux M, Laigret F, Bove JM, Ollitrault P Genetic mapping of an
intergeneric citrus hybrid using molecular markers. Fruits (Paris) 1994,
49(5/6) 404-408
55 Kijas JMH, Thomas MR, Fowler JCS, Roose ML' Integration of trinucleotide
microsatellites into a linkage map of Citrus. Theor AppI Genet 1997,
94(5)'701-706
56 Oliveira RP, Aguilar Vildoso CI, Cristofani M, Machado MA Skewed RAPD
markers in linkage maps of Citrus. Genet Mol Biol 2004, 27(3)437-441
57 Raga V, Bernet GP, Carbonell EA, Asins MJ Segregation and linkage
analyses in two complex populations derived from the citrus rootstock
Cleopatra mandarin. Inheritance of seed reproductive traits. Tree Genet
Genomes 2012, 8(5) 1061 -1071
58 Soost RK The incompatibility gene system in citrus In Proc First nt Citrus
Symp Volume 1 Edited by Chapmn H Riverside Univ California; 1968 189-190
59 Xu S Quantitative trait locus mapping can benefit from segregation
distortion. Genetics 2008, 180(4) 2201-2208
60 Vinson JP, Jaffe DB, O'Neill K, Karlsson EK, Stange-Thomann N, Anderson 5,
Mesirov JP, Satoh N, Satou Y, Nusbaum C, Birren B, Galagan JE, Lander ES
Assembly of polymorphic genomes: algorithms and application to Ciona
savignyi. Genome Res 2005, 15(8)'1127-1135
61 Roose ML, Niedz RP, Gmitter FG, Timothy JC, Abhaya MD, Jan-Fang C,
Daniel SR Analysis of a 1 2x whole genome sequence of Citrus sinensis San
Diego, CA Plant & Animal Genome XV Conference; 2007
62 Forment J, Gadea J, Huerta L, Abizanda L, Agusti J, Alamar 5, Alos E, Andres
F, Arribas R, Beltran JP, Berbel A, Blazquez MA, Brumos J, Canas LA, Cercos
M, Colmenero-Flores JM, Conesa A, Estables B, Gandia M, Garcia-Martinez JIL,
Gimeno J, Gisbert A, Gomez G, Gonzalez-Candelas L, Granell A, Guerri J,
Lafuente MT, Madueno F, Marcos JF, Marques MC, Martinez F, Martinez-
Godoy MA, Miralles 5, Moreno P, Navarro L, Pallas V, Perez-Amador MA,
Perez Valle J, Pons C, Rodrigo I, Rodriguez PL, Royo C, Serrano R, Soler G,
Tadeo F, Talon M, Terol J, Trenor M, Vaello L, Vicente 0, Vidal C, Zacarias L,
Conejero V Development of a citrus genome-wide EST collection and
cDNA microarray as resources for genomic studies. Plant Mol Biol 2005,
57(3)'375-391
63 Terol J, Conesa A, Colmenero JM, Cercos M, Tadeo F, Agusti J, Alos E,
Andres F, Soler G, Brumos J, Iglesias DJ, Gotz 5, Legaz F, Argout X, Courtois
B, Ollitrault P, Dossat C, Wincker P, Morillon R, Talon M Analysis of 13000
unique Citrus clusters associated with fruit quality, production and
salinity tolerance. BMC Genomics 2007, 8:31


Page 19 of 20








Ollitrault et al. BMC Genomics 2012, 13:593 Page 20 of 20
http://www.biomedcentral.com/1471-2164/13/593





64 MartinezGodoy MA, Mauri N, Juarez J, Marques MC, Santiago J, Forment J,
Gadea J A genome-wide 20 K citrus microarray for gene expression
analysis. BMC Genomics 2008, 9(318)
65 Doyle JJ, Doyle JL A rapid DNA isolation procedure for small quantities
of fresh leaf tissue. Phytochemical Bulletin 1987, 19(1)'11-15
66 Aldrich KJ, Cullis CA RAPD analysis in flax: optimization of yield and
reproducibility using KlenTaqi DNA polymerase, chelex 100 and gel
purification of genomic DNA. Plant Mol Bio Rep 1993, 11:128-141
67 Aleza P, Froelicher Y, Schwarz S, Agusti M, Hernandez M, Juarez J, Luro F,
Morillon R, Navarro L, Ollitrault P Tetraploidization events by
chromosome doubling of nucellar cells are frequent in apomictic
citrus and are dependent on genotype and environment. Ann Bot
2011, 108(1)'37-50
68 Cuenca J, Froelicher Y, Aleza P, Juarez J, Navarro L, Ollitrault P Multilocus
half-tetrad analysis and centromere mapping in citrus: evidence of SDR
mechanism for 2n megagametophyte production and partial chiasma
interference in mandarin cv 'Fortune'. Heredity 2011, 107(5)462-470
69 Kamiri M, Stift M, Srairi I, Costantino G, El Moussadik A, Hmyene A, Bakry F,
Ollitrault P, Froelicher Y Evidence for non-disomic inheritance in a Citrus
interspecific tetraploid somatic hybrid between C. reticulata and C.
limon using SSR markers and cytogenetic analysis. Plant Cell Rep 2011,
30(8)'1415-1425
70 Yang ZN, Ye XR, Molina J, Roose ML, Mirkov TE Sequence analysis of a
282-kilobase region surrounding the citrus tristeza virus resistance gene
(Ctv) locus in Poncirus trifoliata L. Raf Plant Physio/ 2003, 131(2) 482-492
71 Ahmad R, Struss D, Southwick SM Development and characterization of
microsatellite markers in Citrus. J Am Soc Hortic Sc 2003, 128 584-590
72 Ritter E, Gebhardt C, Salamini F Estimation of recombination frequencies
and construction of RFLP linkage maps in plants from crosses between
heterozygous parents. Genetics 1990, 125:645-654
73 Luro F, Laigret F, Lorieux M, Ollitrault P Citrus genome mapping with
molecular markers: two maps obtained by segregation analysis of
progeny of one intergeneric cross. Proc Int/ Soc Citricult 1996, 2:862-866
74 Van Ooijen JW JoinMap 4, software for the calculation of genetic linkage
maps in experimental populations Wageningen, Netherlands Kyazma BV;
2006 http//www kyazma nl/index php/mcJoinMap/sc General/
75 van Os H, Stam P, Visser RG, van Eck HJ SMOOTH: a statistical method for
successful removal of genotyping errors from high-density genetic
linkage data. Theor App/ Genet 2005, 112(1) 187-194
76 Wu Y, Bhat PR, Close TJ, Lonardi S Efficient and accurate construction of
genetic linkage maps from the minimum spanning tree of a graph. PLoS
Genet 2008, 4(10)'el000212
77 Voorrips RE MapChart: software for the graphical presentation of linkage
maps and QTLs. J Hered 2002, 93:77-78
78 van Berloo R' GGT 2.0: versatile software for visualization and analysis of
genetic data. J Hered 2008, 99(2)'232-236

doi:10.1186/1471-2164-13-593
Cite this article as: Ollitrault et al A reference genetic map of C.
clementine hort. ex Tan.; citrus evolution inferences from comparative
mapping. BMC Genomics 2012 13'593


Submit your next manuscript to BioMed Central
and take full advantage of:

* Convenient online submission
* Thorough peer review
* No space constraints or color figure charges
* Immediate publication on acceptance
* Inclusion in PubMed, CAS, Scopus and Google Scholar
* Research which is freely available for redistribution

Submit your manuscript at nt
www.biomedcentral.com/submit I0 i oI*d Central




Full Text

PAGE 1

0 0.2 0.4 0.6 0.8 1 1.2 0 0.5 1 0 0.2 0.4 0.6 0.8 1 1.2 1.4 0 0.5 1 0 0.2 0.4 0.6 0.8 1 1.2 0 0.5 1 0 0.2 0.4 0.6 0.8 1 1.2 0 0.5 1 LG1 0 0.2 0.4 0.6 0.8 1 1.2 0 0.5 1 LG2 0 0.2 0.4 0.6 0.8 1 1.2 0 0.5 1 LG9 LG7 0 0.2 0.4 0.6 0.8 1 1.2 0 0.5 1 0 0.2 0.4 0.6 0.8 1 1.2 0 0.5 1 0 0.2 0.4 0.6 0.8 1 1.2 1.4 0 0.5 1 LG4 LG5 LG6 LG8 LG3 Additional file 8: variation of map length between male clementine female clementine and sweet orange based only on the common SNP markers. The location on the reference clementine map established from all clementine gametes (male + female) is used as x axis. Y axis are the relative location in the other maps (ratio between the location in the other map over the location in the clementine reference map). The diagonal blue line represent this reference clementine map (y=x). Green: male clementine map, red: female clementine map and blue: sweet orange map. Ollitrault et al. (2012) A reference genetic map of C. clementina hort ex Tan.; citrus evolution inferences from comparative mapping BMC Genomics .2012, 13:593



PAGE 1

0 5 10 15 20 25 30 0 5 10 15 20 25 30 LG1 LG2 LG3 LG4 LG5 LG6 LG7 LG8 LG9 P=1% P=1% P=5% P=5% Ollitrault et al. (2012) A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inferences from comparative mapping. BMC Genomics.2012, 13:593 Additional file 9: Comparative distribution of the skewed markers for the different parents in the nine linkage groups X axis is the location of the markers on the reference clementine map; for markers mapped on sweet orange and pummelo but not present in the clementine map, the position was estimated by u sing the best tendencial curve equation (these locations are given in the synthesis column of additional file 1 ; the sequencial location of the markers not mapped in clementine was done as follow: first additional markers in sweet orange, 2 nd additional markers in Chandler and 3 rd : remaining markers in Pink.) Y axis are the value of the conformity X 2 test against 1/1 segregation Blue cross: male Nule s clementine ; red cross: female Nules clementine ; red circle: Chandler pummelo; bl ue circle: Pink Pummelo; red square : sweet orange P: threshold for the X 2 test for probability 0.05 and 0.01

PAGE 2

Additional file 9b : Estimation of the location of markers in the clementine reference map from locations in other maps. A rough location in the reference clementine maps was estimated for markers (i) mapped in sweet orange but not in clementine, (ii) then for the markers mapped in Chandler pummelo but not in clementine nore in sweet orange and by the end (iii) for the markers only mapped in Pink pummelo. These location estimations were performed applying the equations of the tendencies curves of the location in the reference clementine map (y axis) according to the location (x axis) for the parent map where additional markers were mapped. An example is given below for the linkage group 1. R = 0.99233042 0 20 40 60 80 100 120 140 020406080 R = 0.99278 0 20 40 60 80 100 120 140 050100150 R = 0.972293 0 10 20 30 40 50 60 70 80 90 020406080Location in sweetorange (cM) Location in Chandler (cM) Location in Pink(cM) Tendencialcurvesestablishedfromsharedmarkers betweenthe referenceclementinemap(y axis) and the othergenotypesin LG1 0 20 40 60 80 100 0.0020.0040.0060.0080.00100.00120.00140.00Red symbol represent the estimated positions in the reference clementinemap (x axis) according to the locations in the sweet orange map (losange), in the Chandler map (circle)and in the Pink map (triangle) given in the y axis. Buesymbols are the relative locations of the shared markers for the samesmaps. Location in clementinereferencemapLG1 (cM) The estimated position in the clementine reference map are given with the one established from clementine segregation in the column Synthesis of the additional file 2.



PAGE 1

Ollitrault et al. (2012) A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inf erences from comparative mapping BMC Genomics.2012, 13:593 Additional file 11: Characteristics and primers of the new SSR markers developed from genomic Cleopatra mandarin library at Cirad Marker GeneBank motif Foward Reverse Tm mCrCIR01D10 FR692357 (GA)9 AAGCGACGGAAATAGAGAG ATGGGGATGGGTGATGAAT 50 mCrCIR02B11 FR692358 (GA)11 GTAT TTGGCGTGATGAA CAAAGTAAATAGGGTGTGAG 50 mCrCIR02C09 FR692359 (GT)3(GA)9 TACTGACTGACCCCACC TCCCCGTCTCCTACC 50 mCrCIR02D03 FR692360 (GA)8CA(GA)4X4(GA)8 CAGACAACAGAAAACCAA GACCATTTTCCACTCAA 50 mCrCIR02E08 FR692361 (TGA)4(TCA)5 GGTTTGTGGGAGGTG TGATTAGCATGTTGC G 50 mCrCIR02G08 FR692362 (GA)10 CATGCAATGTTCCACTT AGGCAGTTGTTAGACCC 50 mCrCIR02H05 HE801214 (GA)13 GCATCATCCTACTTCTGTT TGGAGGACTTGTGATTG 50 mCrCIR03E06 FR692363 (GT)8 AATACACCCTTCAAATCC CTCCTAACAGATTTCATTACTC 50 mCrCIR03F05 FR692364 (GT)12 CTAAGGAAGAGTAGAGAGC A TAAAATCCAAGGTTCCA 50 mCrCIR04A02 FR692365 (GA)11 GTTGTTGGTGTTGGTGT TTCTCTCTGGTGGTGG 50 mCrCIR04A11 FR692366 (GT)12 GCACTGTAACAAACAACA AATCCAAGGTTCCAAA 50 mCrCIR04B06 FR692367 (AT)4(GT)13 TTTTGTGTGAATGTTGG GGAAATATCTTACTTGTGCT 50 mCrCIR04F01 FR692368 (GA)12 TCTTGTGAATGTTAGGCA ACTTACGACACAAAACACAC 50 mCrCIR04F12 FR692369 (GAGT)3(GT)7 AAACAATCTTACAAGCCAC TGTCCTGGGTTTTACTTAC 50 mCrCIR04H09 FR692370 (GT)11 GGGTCTGGATTTTGATT CCATTTAGTGCCCAAG 50 mCrCIR04H12 FR692371 (CAT)7 TTCCTCTACAACTACAACCA ATTATCCTCAA CCTCCAA 50 mCrCIR05A04 FR692372 (GA)8 AAACGAGACAAGACCAAC TATCAAACTCCCCTCACT 50


!DOCTYPE art SYSTEM 'http:www.biomedcentral.comxmlarticle.dtd'
ui 1471-2164-13-593
ji 1471-2164
fm
dochead Research article
bibl
title
p A reference genetic map of it C. clementina hort. ex Tan.; citrus evolution inferences from comparative mapping
aug
au id A1 ca yes snm Ollitraultfnm Patrickinsr iid I1 I2 email patrick.ollitrault@cirad.fr
A2 TerolJavierI3 terol_javalc@gva.es
A3 ChenChunxianI4 cxchen@ufl.edu
A4 Federicimi TClaireI5 claire.federici@ucr.edu
A5 LotfySamiaI6 samilotfy@yahoo.fr
A6 HippolyteIsabellehippolyte@cirad.fr
A7 OllitraultFrédériquefollitrault@ivia.es
A8 BérardAurélieI7 berard@cng.fr
A9 ChauveauAuréliechauveau@cng.fr
A10 CuencaJosejcuenca@ivia.es
A11 CostantinoGillesI8 costantino@corse.inra.fr
A12 KacarYildizI9 ykacar@cu.edu.tr
A13 MuLisal.mu28@yahoo.com
A14 Garcia-LorAndresangarcia@ivia.es
A15 FroelicherYannyann.froelicher@cirad.fr
A16 AlezaPabloaleza@ivia.es
A17 BolandAnneI10 boland@cng.fr
A18 BillotClaireclaire.billot@cirad.fr
A19 NavarroLuislnavarro@ivia.es
A20 LuroFrançoisluro@corse.inra.fr
A21 RooseLMikealmikeal.roose@ucr.edu
A22 GmitterGFrederickfgmitter@ufl.edu
A23 TalonManueltalon_man@gva.es
A24 BrunelDominiquebrunel@versailles.inra.fr
insg
ins CIRAD, UMR AGAP, F-34398 Montpellier, France
IVIA, Centro Proteccion Vegetal y Biotechnologia, Ctra. Moncada-Náquera Km 4.5, 46113 Moncada, Valencia, Spain
IVIA, Centro de Genomica, Apartado Oficial, 46113, Moncada, Valencia, Spain
Citrus Research and Education Center, University of Florida, Lake Alfred, FL, 33850, USA
Department of Botany and Plant Sciences, University of California, Riverside, CA, 92521, USA
Institut National de la Recherche Agronomique, BP, 293, 14 000, Kénitra, Morocco
INRA, UR EPGV, 2 rue Gaston Cremieux, 91057, Evry, France
INRA, UR GEQA, San Giuliano, 20230, San Nicolao, France
Department of Horticulture, Faculty of Agriculture, University of Çukurova, 01330, Adana, Turkey
CNG, CEA/DSV/Institut de Génomique, 2 rue Gaston Cremieux, 91057, Evry, France
source BMC Genomics
section Plant genomicsissn 1471-2164
pubdate 2012
volume 13
issue 1
fpage 593
url http://www.biomedcentral.com/1471-2164/13/593
xrefbib pubidlist pubid idtype doi 10.1186/1471-2164-13-593pmpid 23126659
history rec date day 28month 5year 2012acc 29102012pub 5112012
cpyrt 2012collab Ollitrault et al.; licensee BioMed Central Ltd.note This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
kwdg
kwd
C. clementina
C. sinensis
C. maxima
SSRs
SNPs
Indels
Genetic maps
abs
sec
st
Abstract
Background
Most modern citrus cultivars have an interspecific origin. As a foundational step towards deciphering the interspecific genome structures, a reference whole genome sequence was produced by the International Citrus Genome Consortium from a haploid derived from Clementine mandarin. The availability of a saturated genetic map of Clementine was identified as an essential prerequisite to assist the whole genome sequence assembly. Clementine is believed to be a ‘Mediterranean’ mandarin × sweet orange hybrid, and sweet orange likely arose from interspecific hybridizations between mandarin and pummelo gene pools. The primary goals of the present study were to establish a Clementine reference map using codominant markers, and to perform comparative mapping of pummelo, sweet orange, and Clementine.
Results
Five parental genetic maps were established from three segregating populations, which were genotyped with Single Nucleotide Polymorphism (SNP), Simple Sequence Repeats (SSR) and Insertion-Deletion (Indel) markers. An initial medium density reference map (961 markers for 1084.1 cM) of the Clementine was established by combining male and female Clementine segregation data. This Clementine map was compared with two pummelo maps and a sweet orange map. The linear order of markers was highly conserved in the different species. However, significant differences in map size were observed, which suggests a variation in the recombination rates. Skewed segregations were much higher in the male than female Clementine mapping data. The mapping data confirmed that Clementine arose from hybridization between ‘Mediterranean’ mandarin and sweet orange. The results identified nine recombination break points for the sweet orange gamete that contributed to the Clementine genome.
Conclusions
A reference genetic map of citrus, used to facilitate the chromosome assembly of the first citrus reference genome sequence, was established. The high conservation of marker order observed at the interspecific level should allow reasonable inferences of most citrus genome sequences by mapping next-generation sequencing (NGS) data in the reference genome sequence. The genome of the haploid Clementine used to establish the citrus reference genome sequence appears to have been inherited primarily from the ‘Mediterranean’ mandarin. The high frequency of skewed allelic segregations in the male Clementine data underline the probable extent of deviation from Mendelian segregation for characters controlled by heterozygous loci in male parents.
bdy
Background
Citrus fruits were domesticated in South East Asia several thousand years ago and subsequently spread throughout the world. Today, the area of citrus cultivation is primarily found between the latitudes of 40°N and 40°S, and global citrus production has reached 122 M tonnes
abbrgrp
abbr bid B1 1
. The production of sweet orange, the leading varietal type, approaches close to 69 M tonnes
1
. Small citrus fruits (mandarin-like) are preponderant in China and very important in the Mediterranean Basin where Clementine is the main cultivar.
Despite controversial Citrus classifications, most authors now agree on the origin of cultivated citrus species. Scora
B2 2
and Barrett and Rhodes
B3 3
were the first to suggest that three primary Citrus species (C. medica L. – citrons, C. reticulata Blanco – mandarins, and C. maxima L. Osbeck – pummelos) were the ancestors of most cultivated citrus. The differentiation between these sexually compatible taxa can be explained via the foundation effect in three geographic zones and by an initial allopatric evolution
2
B4 4
. Other cultivated species (referred to hereafter as secondary species) such as C. aurantium L. (sour orange), C. sinensis (L.) Osb. (sweet orange), C. paradisi Macf. (grapefruit), C. clementina hort. Ex Tan. (Clementine) and C. limon Osb. (lemon) originated later through hybridization and a limited number of sexual recombination events among the basic taxa. Molecular marker studies
B5 5
B6 6
B7 7
B8 8
generally support the role of these three taxa as ancestors of cultivated Citrus. Furthermore, some of these studies
8
B9 9
B10 10
highlighted the probable contribution of a fourth taxon, C. micrantha Wester, as the ancestor of some limes C. aurantifolia (Christm.) Swingle].
In general, Citrus species are diploid with a basic chromosome number x = 9
B11 11
. Citrus species have small genomes. While estimating citrus genome size by flow cytometry, Ollitrault et al.
B12 12
found significant genome size variation between citrus species. The largest and smallest genomes were C. medica (average value of 398 Mb/haploid genome) and C. reticulata (average value of 360 Mb/haploid genome), respectively. C. maxima had an intermediate genome size, with an average value of 383 Mb/haploid genome. Interestingly, the secondary species presented intermediate values between their putative ancestral parental taxa, C. sinensis (370 Mb), C. aurantium (368 Mb), C. paradisi, (381 Mb) and C. limon (380 Mb) per haploid genome.
As mentioned previously, most modern cultivars have an interspecific origin and their genomes can be considered mosaics of large DNA fragments inherited from the basic taxa
7
. These cultivars are generally highly heterozygous
6
7
. The C. maxima and C. reticulata gene pools contributed to the genesis of most of the economically important species and cultivars including sweet and sour oranges, grapefruits, tangors (mandarin × sweet orange hybrids), tangelos (mandarin × grapefruit hybrids) and lemons
6
7
9
. Barkley et al. and Garcia-Lor et al.
10
11
estimated the relative contributions of primary species to modern cultivars. Some discrepancies have been observed between these studies, and the detailed interspecific genome organization of cultivated secondary species and modern cultivars is still largely unknown. As a foundational step towards deciphering the phylogenetic structures of citrus genomes and the molecular bases of phenotypic variation, a reference whole genome sequence of a haploid derived from Clementine was produced and is currently being revised by the International Citrus Genome Consortium (ICGC)
B13 13
B14 14
. The Clementine mandarin is an interspecific hybrid that was selected one century ago in Algeria by Father Clement as a chance offspring among seedlings of the ‘Mediterranean’ mandarin (C. reticulata)
B15 15
. Since that time, the Clementine has been vegetatively propagated by grafting. In a recent large SNP diversity survey, Ollitrault et al.
8
confirmed that the Clementine is a ‘Mediterranean’ mandarin × sweet orange hybrid (tangor). This conclusion is in agreement with the hypothesis of Deng et al. and Nicolosi et al.
9
B16 16
The supposed parental relationships between Clementine, sweet orange, pummelo and mandarin are summarized in Figure 
figr fid F1 1. The Clementine genome size is estimated to be 367 Mb/haploid genome
12
.
fig Figure 1caption Assumed parentage relationships between C. reticulata, C. maxima, C. sinensis and C. clementinatext
b Assumed parentage relationships between C. reticulata, C. maxima, C. sinensis and C. clementina. From Ollitrault et al.
8.
graphic file 1471-2164-13-593-1
The ICGC identified the construction of a saturated genetic map of Clementine as an essential prerequisite to improve the sequence assembly of the haploid Clementine reference genome. Compared with other crops, genetic mapping in citrus is relatively less well developed. The partial genetic maps built with codominant markers (primarily SSRs)
B17 17
B18 18
B19 19
encompass around 150 markers, while maps based on dominant markers such as AFLPs,
B20 20
SRAPs, ISSRs, and RAPDs
B21 21
include slightly more than 200 markers. Moreover, few of the mapped markers have been published in GenBank (or other public nucleotide databases). Within the last 15 years, the citrus community developed Simple Sequence Repeat (SSR) markers with reference sequences that were deposited in public databases. While a limited number of SSR markers were obtained from genomic libraries
6
B22 22
B23 23
B24 24
, the implementation of large EST databases allowed the development of many more SSR markers
B25 25
B26 26
, and additional markers have been developed from Clementine BACs end sequencing (BES;
B27 27
B28 28
B29 29
). From the same Clementine BES database, Ollitrault et al.
B30 30
developed 33 Indel markers to contribute to Clementine genetic mapping. Despite these international efforts, the number of available heterozygous SSRs and Indels in Clementine was still insufficient to establish a saturated Clementine genetic map. SNP markers are well adapted for high throughput methods for marker saturation. Ollitrault et al.
8
took advantage of the Clementine BES database
27
to identify SNPs heterozygous in Clementine, and a GoldenGate SNPs array was developed. Interestingly, 63% of the validated SNP markers were heterozygous in the sweet orange. Therefore, these SNPs can be used for comparative mapping between the Clementine and sweet orange.
The primary goals of the present study were: (i) to establish a saturated reference map of Clementine using codominant markers with sequences available in public databases; (ii) to perform comparative mapping between sweet orange, pummelo and Clementine; and (iii) to localize the crossover events that produced the sweet orange gamete that contributed to the Clementine genome, and those involved in the gamete formation that gave rise to the haploid Clementine
13
used for the citrus reference whole genome sequence
14
. The clementine reference map and the pummelo map were established from two interspecific hybrid populations (‘Chandler’ pummelo × ‘Nules’ Clementine – CP × NC (156 hybrids) and ‘Nules’ Clementine × ‘Pink’ pummelo – NC × PP, (140 hybrids)) with 1166 codominant markers. The sweet orange map anchored with the Clementine map was established by genotyping 582 segregating SNP markers from 147 progeny from crosses between sweet orange and trifoliate orange (SO × TO). This study also yielded information regarding the magnitude and distribution of segregation distortion within the different crosses.
Results
Polymorphism and allele calls for the SNP markers
For all SNPs, genotyping was visually confirmed, taking advantage of the distribution of the segregating progenies relative to the parental positions. This observation was conducted individually for each plate of 96 genotypes. Plate/marker combinations with unclear clustering of genotypes were removed from the analysis. No differences were found between the different sweet orange parents or between the trifoliate orange parents of the SO × TO progenies. Therefore, all individuals resulting from the different crosses were considered as single family. For the selected data, the markers were assigned to different categories based on the observed segregations, the detection of null alleles and, finally, the type of segregation assumed according to the JoinMap nomenclature (Tables 
tblr tid T1 1 and
T2 2).
table
Table 1
Join map codification for the different allelic configurations encountered for SNP markers
tgroup align left cols 7
colspec colname c1 colnum 1 colwidth 1*
c2 2
c3 3
c4 4
c5 5
c6 6
c7
thead valign top
row rowsep
entry
AA
AB
BB
A0
B0
00
tfoot
NO: Non observed configuration.
tbody
AA

lmxll

lmxll
lmxll

AB
nnxnp
hkxhk
nnxnp
nnxnp
nnxnp
nnxnp
BB

lmxll

lmxll
lmxll

A0
nnxnp
lmxll
nnxnp
NO
NO
nnxnp
B0
nnxnp
lmxll
nnxnp
NO
NO
nnxnp
00

lmxll

lmxll
lmxll

Table 2
Segregation types observed for the different parents and progenies
center
SSRs
Indels
SNPs
Total
Null allele
Nules Clementine
Hom
2
0
0
2
Het
10
0
31
41
Chandler pummelo
Hom
9
4
69
82
Het
4
0
19
23
Pink Pummelo
Hom
10
0
78
88
Het
5
0
17
22
Sweet Orange
Hom
-
-
0
0
Het
-
-
72
72
trifoliate orange
Hom
-
-
128
128
Het
-
-
0
0
JoinMap Segregation type
Chandler x Nules
nnxnp
130
20
606
756
lmxll
34
2
6
42
hkxhk
1
0
29
30
efxeg
43
3
0
46
abxcd
70
0
0
70
Nules x Pink
nnxnp
24
2
8
34
lmxll
79
15
644
738
hkxhk
3
1
24
28
efxeg
19
5
0
24
abxcd
26
0
0
26
Orange x trifoliate orange
nnxnp
-
-
1
1
lmxll
-
-
572
572
hkxhk
-
-
9
9
efxeg
-
-
0
0
abxcd
-
-
0
0
The observed segregation within a progeny permitted identification of the null alleles in terms of homozygosity (00) or heterozygosity (A0) in the parents (Figure 
F2 2). These two configurations of null alleles were found for 0 and 31 markers in the Clementine, 69 and 19 in Chandler, 78 and 17 in Pink, 0 and 72 in sweet orange, and 128 and 0 in trifoliate orange, respectively (Table 
2 and Additional file
supplr sid S1 1). Markers with A0 × BB and A0 × 00 configurations were treated as < lm × ll > and the reciprocal configurations were treated as < nn × np >. Markers with the AB × A0 configuration were analyzed as < lm × ll > by considering (i) BA and B0 hybrids as < lm > genotypes, (ii) the undistinguishable AA and A0 as < ll >; thus, considering only the segregation of the AB parent. Reciprocal configurations were treated as < nn × np >.
suppl
Additional file 1
Origin and information for all markers. This file contains a table showing detailed information for all markers: type of marker (Indels, SSRs or SNPs); the type of sequence data from which the markers were developed (genomic library, BAC end sequences, ESTs); GenBank accession number; the laboratory in which the markers were developed; the laboratory in which the different progenies were genotyped, the occurrence and configuration of null allele for the parents of analyzed progenies and the references for the papers in which the markers were published, with an indication of the modifications (if any) in the marker names.
name 1471-2164-13-593-S1.xlsx
Click here for file
Figure 2Example of segregation profiles for SNP markers with null alleles for one parent and heterozygous for the other
Example of segregation profiles for SNP markers with null alleles for one parent and heterozygous for the other. (a) AB × 00; (b) AB × B0.
1471-2164-13-593-2
Considering all markers (with and without null alleles), the first category consisted of markers heterozygous in one parent and homozygous in the other (classified as < nn × np > or < lm × ll > in JoinMap). These markers represented the majority of the useful markers (with 606 < nn × np > and 6 < lm × ll > in CP × NC, 8 < nn × np > and 644 < lm × ll > in NC × PP and 1 < nn × np > and 572 < lm × ll > in SO × TO). These markers were only mapped for the heterozygous parents. As SNP markers are diallelic, the only other conformation encountered was < hk × hk >, where the two parents displayed the same heterozygosity. These markers were not frequent, and 29, 24 and 9 markers with such a configuration were observed for CP × NC, NC × PP and SO × TO, respectively. Considering our strategy to develop independent maps for each parent, the lack of information when assigning the parental allele for each hybrid (only possible for the homozygous hybrid and, thus, only half of the population) and the relatively low number of markers with this < hk × hk > conformation, these markers were removed from the mapping analysis.
SSR and Indel genotyping
The genotyping of the CP × NC population was performed in the framework of the ICGC. SSR analysis was performed by six international groups (University of California at Riverside; University of Florida; University of Cukurova–Turkey; IVIA–Spain; INRA–France and CIRAD–France, with the collaboration of INRAM–Morocco). The genotyping of the NC × PP was performed at CIRAD and IVIA.
Homozygous or heterozygous null alleles in the parents were assumed from the observed SSR segregations. These two configurations of null alleles were found in 2 and 10 markers in Clementine, 9 and 4 in ‘Chandler’ and 10 and 5 in ‘Pink’, respectively (Table 
2 and Additional file
1). Loci containing null alleles were treated as previously described for SNP markers. With multiallelic SSRs, six allelic configurations were possible. AA × AB or CC × AB were treated equally as < nn × np > by JoinMap, and the two reciprocal configurations were assumed to be < lm × ll >. Fully heterozygous configurations with four alleles (AB × CD) or three alleles (AB×BC) were coded < ab × cd > and < ef × eg >, respectively. Among the SSRs successfully genotyped, the five JoinMap configurations (nn × np, lm × ll, hk × hk, ef × eg, and ab × cd) were encountered for 130, 34, 1, 43 and 70 markers in CP × NC and 24, 79, 3, 19 and 26 markers in NC × PP progenies, respectively. As for SNPs, the very few markers with the hk × hk configuration were removed from the analysis. The nn × np and lm × ll markers were mapped for the male or female parents, respectively. The fully heterozygous markers (< ef × eg > and < ab × cd >) were mapped for the two parents and, therefore, allowed anchoring of the male and female parent maps.
Only four Indel markers displayed homozygous null alleles in ‘Chandler’ pummelo (Table 
2 and Additional file
1). No heterozygous null alleles were indicated in ‘Nules’ Clementine, ‘Chandler’ or ‘Pink’ pummelos. For Indels, the five JoinMap configurations (nn × np, lm × ll, hk × hk, ef × eg, and ab × cd) were encountered for 20, 2, 0, 3 and 0 markers in CP × NC and for 2, 15, 1, 5, and 0 markers in NC × PP, respectively.
Parental genetic mapping
Parental gamete genotypes were generated from the diploid data using nn × np, lm × ll, ef × eg and ab × cd scored markers. SNP, SSR and Indel genotyping data resulted in a matrix of 156 individuals and 872 markers for male Clementine (CP × NC progeny), 156 individuals and 158 markers for ‘Chandler’ pummelo (CP × NC progeny), 140 individuals and 788 markers for female Clementine (NC × PP progeny), 140 individuals and 84 markers for ‘Pink’ pummelo (NC × PP progeny), and 572 markers for 147 hybrids for sweet orange (SO × TO progeny). All of these matrices were analyzed using JoinMap 4. The linkage group numbering was performed according to the sweet orange genetic map established by the US citrus genome working group (Mikeal Roose; personal communication). The main results of the individual mapping analyses are given in Table 
T3 3, and detailed results are presented in Additional file
S2 2.
Additional file 2
Detailed results of genetic mapping. This file contains the detailed information (marker locations, Xsup 2 for Mendelian segregation, and level of significance) on the genetic maps for male Clementine, female Clementine, reference Clementine, sweet orange, ‘Chandler’ pummelo and ‘Pink’ pummelo. The estimated location of all markers in the reference Clementine map is also provided (synthesis columns).
1471-2164-13-593-S2.xlsx
Click here for file
Table 3
Main parameters of the six genetic maps inferred from three segregating progenies
17
c8 8
c9 9
c10 10
c11 11
c12 12
c13 13
c14 14
c15 15
c16 16
c17
N
nameend namest
LG 1
LG 2
LG3
LG 4
LG 5
char .
M
D
Size
M
D
Size
M
D
Size
M
D
Size
M
D
Size
N: number of gametes; LG: linkage group; M: number of markers in the LG; D: number of markers with non-Mendelian segregation (p<0.05); Size: size of the LG in cM; F:female; M: male.
Clementine F
140
96
3
118.08
92
9
120.06
137
2
159.42
85
13
66.13
108
36
108.34
Clementine M
156
98
54
131.09
110
4
155.69
160
88
208.00
95
68
114.17
124
103
124.30
Clementine F+ M
296
112
42
128.46
113
15
138.92
176
86
186.32
104
58
89.49
141
71
119.93
Chandler Pummelo
156
19
0
101.79
26
9
109.39
18
2
157.23
15
0
89.93
24
3
63.29
Pink Pummelo
140
8
0
67.29
10
1
100.37
4
0
39.34
6
2
69.07
15
0
71.11
Sweet Orange
147
54
13
71.70
27
1
54.33
117
25
93.15
64
2
76.22
96
48
99.87
N
LG 6
LG 7
LG 8
LG 9
Total
M
D
Size
M
D
Size
M
D
Size
M
D
Size
M
D
Size
Clementine F
140
86
16
88.20
40
0
86.24
44
0
97.74
95
23
79.33
783
102
923.54
Clementine M
156
86
53
100.46
47
35
112.22
52
7
125.81
97
83
92.53
869
495
1164.26
Clementine F+ M
296
95
59
99.80
52
19
115.59
61
5
118.03
107
88
87.54
961
443
1084.07
Chandler Pummelo
156
19
0
64.83
8
0
53.96
16
6
115.17
6
0
73.03
151
20
828.62
Pink Pummelo
140
14
6
79.83
4
0
36.84
12
0
98.47
8
4
71.58
81
13
633.90
Sweet Orange
147
60
9
65.57
36
2
84.17
45
2
39.68
70
51
84.91
569
153
669.61
‘Nules’ Clementine genetic map
The reference Clementine genetic map was obtained in two steps. In the first step, male and female Clementine data were analyzed separately.
Male Clementine map: Among the 872 segregating markers, 869 (606 SNPs, 240 SSRs and 23 Indels) were distributed into nine linkage groups (LGs) while three markers remained ungrouped. Most of the LG conserved their integrity until LOD=10. Only LG8 was disrupted in three sub-groups at LOD 9.The three sub-groups corresponded to three regions of LG8 separated by relatively wide intervals without intermediate markers. When mapped individually they displayed conserved order and very similar distances compared with the entire LG8. The map spanned 1164.26 cM. The Clementine male gametes exhibited 57% of the markers deviating from the expected Mendelian ratio (with a 0.05 probability threshold). Skewed markers were grouped within several parts of the genome. The skewed markers were unequally spread throughout the linkage groups with relatively low frequencies in LG2 (3.6%) and LG8 (13.5%), but with very high frequencies in LG4 (71.6%), LG5 (83.1%), LG7 (74.5%) and LG9 (85.6%). This distribution of segregation distortions is detailed below in comparison with the other parents.
Female Clementine map: Among the 788 markers successfully genotyped, 783 (642 SNPs, 122 SSRs and 21 Indels) were grouped in nine LGs, while five remained ungrouped. Most of the LG conserved their integrity until LOD=10. Only LG8 was disrupted in two sub-groups at LOD=8 corresponding to two regions of le LG8 separated by a relatively wide interval without marker. When mapped individually the sub-groups displayed conserved order and very similar distances compared with the entire LG8.The map size was 923.5 cM. The frequency of skewed markers (13.0%) was much lower than that observed among male gametes. Skewed markers were mainly concentrated in LG5 (33.3%) and LG9 (24.1%).
Despite the high frequency of skewed markers in the male Clementine map, the colinearity between the male and female maps was highly conserved (Additional file
S3 3). Therefore, the reference Clementine map was established by joining the two data sets for each LG, including all markers present in at least one map. Nine hundred and sixty-one markers (677 SNPs, 258 SSRs and 26 Indels) were grouped into nine linkage groups totaling 1084.07 cM (Figure 
F3 3 and Additional files
2 and
S4 4). The proportion of skewed markers remained high (46.1% for p < 0.05). The LG size ranged from 87.5 cM (LG9) to 186.3 cM (LG3). LG7 and LG8 possessed a relatively low density of markers with an average of 0.45 and 0.52 markers/cM, respectively. On average, nearly one marker/cM was found on the other LGs. Each LG exhibited a heterogeneous density of markers (Figure 
F4 4). A few gaps larger than 10 cM were observed without mapped markers, and more gaps between 5 cM and 10 cM were observed without markers (Figure 
3). These gaps were distributed, respectively, as follows: LG1 (0, 6), LG2 (0, 7), LG3 (2, 3), LG4 (0, 0), LG5 (1, 4), LG6 (1, 2), LG7 (3, 5), LG8 (3, 4) and LG9 (0, 6). On LG9, a special feature was observed, in which 55 markers were mapped within a 5-cM interval.
Additional file 3
Conserved linear order between male and female Clementine genetic maps. This file contains a figure showing the relative positions of the markers in the female Clementine map (y axis) and in the male Clementine map (x axis) for each linkage group.
1471-2164-13-593-S3.pdf
Click here for file
Additional file 4
Reference Clementine genetic map. This file contains a figure showing the nine linkage groups of the reference Clementine genetic map and the position of each marker (blue: SNPs; green: SSRs; red: Indels).
1471-2164-13-593-S4.pdf
Click here for file
Figure 3Distribution of markers in the ‘Nules’ Clementine genetic map
Distribution of markers in the ‘Nules’ Clementine genetic map. Red: Indels, green: SSRs, blue: SNPs, **interval between two markers 10 cM; *interval between two markers 5 cM and < 10 cM.p
textgraphic file="1471-2164-13-593-3"fig
fig id="F4"titlepFigure 4ptitlecaptionpDensity of markers along the ‘Nules’ Clementine genetic mappcaptiontext
p
bDensity of markers along the ‘Nules’ Clementine genetic map.b
p
textgraphic file="1471-2164-13-593-4"fig
sec
sec
st
p‘Chandler’ pummelo genetic mapp
st
pAmong the 158 segregating markers, 151 (141 SSRs, 5 SNPs and 5 Indels) were successfully mapped in nine linkage groups (Additional files
supplr sid="S2"2supplr and
supplr sid="S5"5supplr). One hundred and nine of these markers were common with the Clementine map. The level of segregation distortion was low (13.2%) and was mainly observed on two LGs (LG2: 34.6% and LG8: 37.5%). The total size of the map was 828.6 cM.p
suppl id="S5"
title
pAdditional file 5p
title
text
p
b‘Chandler’ pummelo genetic map.b This file contains a figure showing the nine linkage groups from the ‘Chandler’ pummelo genetic map and the position of each marker (blue: SNPs; green: SSRs; red: Indels).p
text
file name="1471-2164-13-593-S5.pdf"
pClick here for filep
file
suppl
sec
sec
st
p‘Pink’ pummelo mapp
st
pOnly 84 segregating markers were available for Pink pummelo mapping. Eighty-one (67 SSRs, 7 SNPs and 7 Indels) were mapped in nine linkage groups (Additional files
supplr sid="S2"2supplr and
supplr sid="S6"6supplr). Fifty-two of these markers were shared with the Clementine map. The level of segregation distortion was similar to the Chandler pummelo map (15.9%), but affected other LGs, mainly LG6 (42.9%) and LG9 (50%). The map spanned 633.9 cM.p
suppl id="S6"
title
pAdditional file 6p
title
text
p
b‘Pink’ pummelo genetic map.b This file contains a figure showing the nine linkage groups of the ‘Pink’ pummelo genetic map and the position of each marker (blue: SNPs; green: SSRs; red: Indels).p
text
file name="1471-2164-13-593-S6.pdf"
pClick here for filep
file
suppl
sec
sec
st
pSweet orange mapp
st
pThe sweet orange map was only based on SNP markers. Among the 572 segregating markers, 569 were mapped in nine linkage groups, with a total size of 669.6 cM (Additional files
supplr sid="S2"2supplr and
supplr sid="S7"7supplr). Most of the LG conserved their integrity until LOD=10. However three LG (2, 3 and 5) were disrupted in two sub-groups at LOD 9, 6 and 10 respectively. As for male and female clementine these disruptions corresponded to relatively wide interval without intermediate markers. When mapped individually the sub-groups displayed conserved order and very similar distances compared with their relative entire LGs. Four hundred and eighteen of these markers were in common with the reference Clementine genetic map. Segregation distortion was relatively frequent (26.9%) and was particularly clustered in LG5 (50%) and LG9 (72.9%).p
suppl id="S7"
title
pAdditional file 7p
title
text
p
bSweet orange genetic map.b This file contains a figure showing the nine linkage groups of the sweet orange genetic map and the position of each marker (blue: SNPs).p
text
file name="1471-2164-13-593-S7.pdf"
pClick here for filep
file
suppl
sec
sec
sec
st
pGenetic map comparisonsp
st
sec
st
pAnalysis of colinearity between the different genetic mapsp
st
pSynteny, considered as the collocation of marker in the same chromosome, was completely conserved between all of the parental genetic maps. The linear order of the common markers was also highly conserved between parents (Figure 
figr fid="F5"5figr), with only a few cases of inverted order in small intervals. However, the genetic distance between markers appeared to be unequal between parents. Sweet orange in particular displayed smaller distances between shared markers than Clementine. To avoid bias due to the different number of loci analyzed, new genetic maps of sweet orange and Clementine (male, female and consensus) were constructed using only the data generated from the 418 SNP markers that were successfully genotyped in the NC × PP, CP × NC and SO × TO progenies. The results (Additional file
supplr sid="S8"8supplr) confirmed that the genetic distances were generally lower (except for LG4 and LG9) in the sweet orange map than in the Clementine reference map. Moreover, differences were confirmed between the male and female Clementine maps for LG3, LG4, LG7, LG8 and LG9, with systematically lower distances in the female map. Interestingly, markers with very strong linkage localized in the very high marker density area of LG9 for the Clementine and sweet orange maps were much farther apart in ‘Chandler’ and ‘Pink’ pummelos (Figure 
figr fid="F5"5figr).p
suppl id="S8"
title
pAdditional file 8p
title
text
p
bVariation of map length between male Clementine, female Clementine, and sweet orange based only on common SNP markers.b This file contains a figure for each linkage group showing the relative position of the markers in the female Clementine map, the male Clementine map, and the sweet orange map in a new mapping analysis performed using only the common markers for the three parents. The x axis represent the location on the reference Clementine map established from all Clementine gametes (male + female). The relative locations in the other maps (the ratio between the locations in the other map relative to the location in the Clementine reference map) are shown on the y axis.p
text
file name="1471-2164-13-593-S8.pdf"
pClick here for filep
file
suppl
fig id="F5"titlepFigure 5ptitlecaptionpConservation of synteny and linear order of markers in the four genetic mapspcaptiontext
pbConservation of synteny and linear order of markers in the four genetic maps.b NC: ‘Nules’ Clementine, CP: ‘Chandler’ pummelo, PP: ‘Pink’ pummelo, SO: sweet orange.p
textgraphic file="1471-2164-13-593-5"fig
sec
sec
st
pLocation of crossover events in the sweet orange gamete at the origin of Clementine and in the Clementine gamete at the origin of the haploid Clementine used for the reference citrus whole genome sequencep
st
pFor each linkage group, the haplotypes of sweet orange and Clementine were inferred from SNP marker phases given by JoinMap. The origin of Clementine from a ‘Mediterranean mandarin’ × sweet orange hybridization was proven by Ollitrault et al.
abbrgrp
abbr bid="B8"8abbr
abbrgrp. Homozygous markers in sweet oranges and Mediterranean mandarin were used to identify the haplotype of Clementine inherited from sweet orange. Comparison of this haplotype with the two sweet orange haplotypes allowed the identification of nine recombination break points, one each in LG1, LG7 and LG9, and two each in LG3, LG4 and LG5 (Figure 
figr fid="F6"6figra). The two Clementine haplotypes were compared with the genotyping data of the haploid Clementine used by the ICGC to establish the reference citrus WGS haploid sequence. This permitted the identification of eight recombination break points, one each in LG1, LG7 and LG8, two in LG 5 and three in LG3 (Figure 
figr fid="F6"6figrb). Interestingly, LG2, LG4, LG6 and LG9 appeared to have been entirely inherited from ’Mediterranean’ mandarin without recombination.p
fig id="F6"titlepFigure 6ptitlecaptionpHaplotype constitution of the sweet orange gamete at the origin of Clementine (a) and of the haploid Clementine used to establish the reference whole citrus genome sequence (b)pcaptiontext
p
bHaplotype constitution of the sweet orange gamete at the origin of Clementine (a) and of the haploid Clementine used to establish the reference whole citrus genome sequence (b).b
p
textgraphic file="1471-2164-13-593-6"fig
sec
sec
st
pComparative distribution of segregation distortionsp
st
pTo compare the location of the genome areas affected by segregation distortions in the different parental maps, a rough location in the reference Clementine maps was estimated for markers (i) mapped in sweet orange but not in Clementine, (ii) mapped in ‘Chandler’ pummelo but not in Clementine or sweet orange and, finally (iii) for markers only mapped in ‘Pink’ pummelo. These location estimates were performed by applying tendency curve equations of the location in the reference Clementine map (y axis) according to the location (x axis) for the parent map, where additional markers were mapped. An example of such a location is presented in Additional file
supplr sid="S9"9supplrb. The estimated locations of all markers in the framework of the Clementine reference map are given in the “synthesis” column of Additional file
supplr sid="S2"2supplr. The values of the Xsup2sup conformity test of the observed segregation against the 1:1 Mendelian hypothesis are represented along the linkage groups for all of the parental maps in Additional file
supplr sid="S9"9supplra. Skewed markers appeared to be concentrated in specific areas for the different parents. However sporadic occurrences of a non-distorted marker within a cluster of distorted markers (CiC5563-02), or vice versa (e.g., marker CID5573) are observed in the Clementine reference map. Such exceptions can be explained by the inclusion of these markers with missing data, of probable non random origin, affecting the real segregation ratio.p
suppl id="S9"
title
pAdditional file 9p
title
text
p
bComparative distribution of the skewed markers in the nine linkage groups for five parents.b This file contains a figure for each linkage group showing the distortion magnitude (Xsup2sup of conformity with Mendelian segregation) for each marker and each mapped parent. Furthermore, 9b shows an example illustrating the method used to estimate the location in the reference Clementine map of markers mapped in the other parents.p
text
file name="1471-2164-13-593-S9.pdf"
pClick here for filep
file
suppl
pThe patterns of segregation distortion are consistent with the local selection of gametes that differ in terms of the probability of contributing to the next generation. Male Clementine presents the higher proportion of skewed loci. In LG1 and at the initial part of LG5, these distortions seem to be shared with female Clementine and sweet orange, although at a lower intensity than in male Clementine. Shared areas of skewed loci were also observed for male Clementine and sweet orange at the end of LG5 and in the middle of LG9, where high marker density was observed. In these two regions, the magnitude of sweet orange distortions was higher than in the male Clementine. The very severe level of segregation distortion observed in the middle of LG3 for male Clementine is shared at a much lower level with sweet orange. The skewed loci of male Pink pummelo in LG6 and LG9 were observed in areas common with male Clementine. Distortions that were observed in Chandler in the initial part of LG2 were not observed in the other parents.p
pThe identification of the Clementine haplotypes inherited from ‘Mediterranean mandarin’ and sweet orange allowed determining at each locus which allele was inherited from both parents of Clementine. Therefore, it was possible to determine which parental alleles (mandarin versus sweet orange) were favored for the skewed areas of the male and female Clementine segregations (Figure 
figr fid="F7"7figr). No systematic tendency was observed. For male Clementine, the skewed segregations were globally in favor of sweet orange alleles for LG1, LG5 and LG7, while the skewed segregations favored mandarin alleles in LG3, LG8 and LG9. Interestingly, in LG6 and more markedly in LG4, a transition from positive selection for sweet orange alleles to positive selection for mandarin alleles was observed when moving from one end of the LG to the other. For LG1, LG2 and LG9, similar patterns of allele segregation were observed in female and male gametes (but generally with a lower distortion magnitude in the female). In LG4 and LG5, the patterns between male and female Clementine were very different, with significant distortion in opposite directions. In the second part of LG4, the mandarin alleles were favored in male Clementine, while sweet orange alleles were significantly favored in female Clementine. In the first part of LG5, mandarin and sweet orange allele were favored respectively in the female and male Clementine.p
fig id="F7"titlepFigure 7ptitlecaptionpDistribution of the segregation distortions for female and male Clementine, along the reference Clementine genetic mappcaptiontext
pbDistribution of the segregation distortions for female and male Clementine, along the reference Clementine genetic map.b The x axis represents the location on each linkage group (LG) and y axis represents the excess of the mandarin allele relatively to Mendelian segregation (y = frequency of mandarin allele minus 0.5). Blue represents male Clementine segregation; red represents female Clementine segregation. The discontinuous lines represent the threshold for significant distortion (p < 0.05).p
textgraphic file="1471-2164-13-593-7"fig
sec
sec
sec
sec
st
pDiscussionp
st
sec
st
pA first reference genetic map for Citrusp
st
pThe reviews of citrus genetic mapping performed by Ruiz and Asins
abbrgrp
abbr bid="B31"31abbr
abbrgrp, Chen et al.
abbrgrp
abbr bid="B19"19abbr
abbrgrp and Roose
abbrgrp
abbr bid="B32"32abbr
abbrgrp underlined that most of the earlier citrus genetic maps were based on intergeneric hybrids between itCitrusit and itPoncirusit. This was due to the importance of itPoncirus trifoliatait for rootstock breeding. Most of these studies suffered from relatively low numbers of analyzed hybrids and from the dominant nature of the markers (RAPD, AFLP) without sequence data on the mapped fragments. Several of the more recent maps were generated using co-dominant markers, particularly SSRs
abbrgrp
abbr bid="B17"17abbr
abbr bid="B18"18abbr
abbr bid="B19"19abbr
abbrgrp. However, the number of mapped markers was insufficient to establish the nine linkage groups corresponding to the nine chromosomes present in haploid citrus. Some recent studies also focused on the genetic mapping of itCitrusit varieties
abbrgrp
abbr bid="B17"17abbr
abbr bid="B20"20abbr
abbr bid="B21"21abbr
abbr bid="B33"33abbr
abbrgrp. The map of Gulsen et al.
abbrgrp
abbr bid="B21"21abbr
abbrgrp was the first itC. clementinait map, while Bernet et al.
abbrgrp
abbr bid="B17"17abbr
abbrgrp mapped Chandler pummelo and Fortune mandarin, a itC. clementina × C. tangerinait hybrid. None of these maps encompassed enough markers with published sequences to establish a reference citrus map useful to be combined with whole genome sequence data.p
pThe current reference Clementine map, established from Clementine male and female segregation, includes 961 co-dominant markers (677 SNPs, 258 SSRs and 26 Indels) spread among nine LG. The map spans 1084.1 cM, with an average marker spacing of 1.13 cM. This is a substantially higher marker density than reported in previous citrus maps, in which nine LG were obtained. Omura et al.
abbrgrp
abbr bid="B34"34abbr
abbrgrp established a genetic map spanning 801 cM with 120 CAPS markers. Sankar and Moore
abbrgrp
abbr bid="B35"35abbr
abbrgrp published an 874 cM map including 310 markers (mostly ISSR and RAPD). Carlos de Oliveira et al.
abbrgrp
abbr bid="B20"20abbr
abbrgrp) established an 845 cM map with 227 AFLP markers and more recently using 215 markers (mostly SRAP) Gulsen et al.
abbrgrp
abbr bid="B21"21abbr
abbrgrp produced a 858 cM map.p
pThe marker density in the current reference Clementine map varied along the genome. The density was particularly low in some regions of LG7 and LG8, with three gaps over 10 cM between markers in each of these LGs. The SNP markers are the most numerous markers on the Clementine map and were randomly selected. Therefore, these low marker density areas probably reveal highly homozygous regions of the Clementine genome. WGS data for the diploid Clementine will be very useful for developing targeted markers within these "no marker" regions. At the opposite extreme, high density areas were observed in some LGs. As described by Lindner et al.
abbrgrp
abbr bid="B36"36abbr
abbrgrp and Van Os et al.
abbrgrp
abbr bid="B37"37abbr
abbrgrp, some of these high marker density regions may be associated with centromeric locations with large physical distances, possibly corresponding to low genetic distances. Another hypothesis is that some areas with high marker density correspond to portions of the genome in interspecific heterozygosity. Indeed, Clementine is considered to be a hybrid between Mediterranean mandarin and sweet orange
abbrgrp
abbr bid="B8"8abbr
abbr bid="B9"9abbr
abbr bid="B16"16abbr
abbrgrp. As sweet orange is thought to have originated as a result of interspecific hybridization between itC. maximait and itC. reticulatait gene pools
abbrgrp
abbr bid="B6"6abbr
abbr bid="B7"7abbr
abbr bid="B9"9abbr
abbrgrp, some parts of the Clementine genome may represent interspecific heterozygosity (itC. maximaC. reticulatait). Garcia-Lor et al.
abbrgrp
abbr bid="B38"38abbr
abbrgrp showed that the SNPkb frequency was approximately six times higher between itC. reticulatait and itC. maximait that it was within itC. reticulata.it Thus, randomly selected markers should be six times more frequent (by physical distance unit) in those parts of the Clementine genome involved in interspecific heterozygosity. Despite the heterogeneity of marker dispersion, the distance to the nearest mapped marker is less than 5 cM in most locations of the Clementine genome. Moreover previous published diversity studies done with the mapped SSRs (5, 23–26, 28), InDels (30) and SNPs (8) gave accurate information of their transferability and polymorphisms, at individual locus level, within and between the principal varietal groups. Therefore, this marker framework will be very useful for marker-trait association studies based on linkage disequilibrium, such as QTL analysis, bulk segregant analysis, or even genetic association studies in the mandarin group, where strong diversity was observed for the mapped SNP markers
abbrgrp
abbr bid="B8"8abbr
abbrgrp. This map is being used to facilitate the chromosome assembly of the reference whole genome citrus sequence based on a haploid Clementine genotype
abbrgrp
abbr bid="B13"13abbr
abbr bid="B39"39abbr
abbrgrp.p
sec
sec
st
pLinear marker order is highly conserved between species, but genetic distances are variable between sexes and speciesp
st
pThe citrus genetic maps based on dominant and mainly cross-specific markers (such as RAPD, AFLP and ISSR) do not permit genetic map comparisons. Multi-allelic codominant markers, such as SSRs, are more powerful for such applications
abbrgrp
abbr bid="B30"30abbr
abbrgrp. Chen et al.
abbrgrp
abbr bid="B19"19abbr
abbrgrp and Bernet et al.
abbrgrp
abbr bid="B17"17abbr
abbrgrp successfully used SSRs for citrus map comparison at the interspecific and intergeneric levels.p
pIn the present study, the main genotyping effort concerned SNPs. Eight hundred and thirty-six SNP markers were genotyped in the three populations. Most of these markers were mined from Nules Clementine BAC end sequences
abbrgrp
abbr bid="B8"8abbr
abbr bid="B27"27abbr
abbrgrp and, as a result, were heterozygous for Clementine. The development of the GoldenGate SNP markers from the Clementine sequence without information on the interspecific variability in flanking areas resulted in numerous homozygous null alleles in pummelo as described by Ollitrault et al.
abbrgrp
abbr bid="B8"8abbr
abbrgrp and in trifoliate orange. Heterozygous null alleles for 72 markers were found in sweet orange, expanding the number of markers mapped in this species. The selected SNP markers were not efficient for pummelo or trifoliate orange mapping due to the very low number of heterozygous loci in these species. Moreover, the biallelic nature of SNP markers limited the establishment of two anchored maps (male and female) from a single cross. Therefore, comparison between Clementine and pummelo was still primarily limited to common multiallelic SSRs (109 between Clementine and Chandler pummelo and 52 between Clementine and Pink Pummelo). With sweet orange and Clementine maps being developed from different populations, the 418 common heterozygous SNPs allowed more substantial anchorage of the two maps.p
pThe conservation of synteny was complete between the species, with no discrepancy in marker localization on the different linkage groups between the maps. Furthermore, the linear order of markers also appeared to be highly conserved between itC. clementinait, itC. sinensisit and itC. maximait. This is in agreement with the conclusions of Bernet et al.
abbrgrp
abbr bid="B17"17abbr
abbrgrp following their comparative study of partial maps between three species (itC. aurantiumit, itC. maximait and itP. trifoliatait) and Fortune mandarin, a Clementine-derived mandarin hybrid. In the present study, small localized inversions of marker orders were observed between maps, particularly in dense markers areas. Bernet et al.
abbrgrp
abbr bid="B17"17abbr
abbrgrp concluded that similar results, for local ordering changes in the integrated maps, resulted from the inclusion of markers with missing data, and eventually different levels of distorted segregations between populations. It is also possible that small genotyping errors concerning the markers located in these dense regions disturbs the mapping order
abbrgrp
abbr bid="B40"40abbr
abbr bid="B41"41abbr
abbrgrp. The fine mapping of such regions will require larger populations than the ones genotyped in this study. For this reason, these local inversions are not detailed in the results of this study since artifactual origins were quite probable. Chen et al.
abbrgrp
abbr bid="B19"19abbr
abbrgrp also concluded that colinearity at the intergeneric level was highly conserved between genetic maps of itC. sinensisit and itP. trifoliatait. However, they also observed some inversions between shared loci that might reveal chromosomal rearrangement events, such as translocations or inversions. Considering the data of this study and the two previous comparative mapping studies, marker colinearity appears highly conserved at the intrageneric level (Clementine, mandarin, pummelo, sweet orange and sour orange), but also between itCitrusit and itPoncirusit. This global conservation of citrus genome organization will allow reasonable inferences of most citrus genome sequences via mapping NGS re-sequencing data to the haploid Clementine reference genome sequence.p
pVariations in LG sizes were observed between the current male Clementine and female Clementine maps. These variations were confirmed when the new maps were exclusively built using the markers shared between the three populations used for the implementation of the Clementine and sweet orange maps. Several LGs were longer in the male Clementine map than in the female one. This was observed in LGs with significant and extensive segregation distortions in the male haplotype populations compared with the female populations, and this was also observed in LG2, where very similar patterns of low skewed loci were observed. From simulated data, Hackett and Broadfoot
abbrgrp
abbr bid="B41"41abbr
abbrgrp found that segregation distortion (due to gametic selection) alone had very little effect on marker order or map length. As discussed below, the observed distortion in Clementine probably results from gametic rather than zygotic selection. Therefore, it is probable that the longer LGs observed within the male Clementine map do not result from biased estimations due to segregation distortion, but instead reflect differential recombination rates. Such heterochiasmy between sexes is frequent in plants and animals
abbrgrp
abbr bid="B42"42abbr
abbr bid="B43"43abbr
abbr bid="B44"44abbr
abbr bid="B45"45abbr
abbr bid="B46"46abbr
abbr bid="B47"47abbr
abbrgrp. According to species, recombination should be higher in male or in female gametes
abbrgrp
abbr bid="B43"43abbr
abbrgrp. Despite the fact that heterochiasmy was documented early in the last century
abbrgrp
abbr bid="B44"44abbr
abbrgrp, there is still no consensus as to which of the several proposed hypotheses may explain its occurrence
abbrgrp
abbr bid="B45"45abbr
abbrgrp. The various models were reviewed by Lenormand and Duteil
abbrgrp
abbr bid="B46"46abbr
abbrgrp. Based on a large survey in animals and plants, these authors concluded that sexual heterochiasmy is not influenced by the presence of heteromorphic sex chromosomes; rather, it should result from a male–female difference in gametic selection. However, in this study, the citrus observations do not fit their global model considering as Trivers
abbrgrp
abbr bid="B47"47abbr
abbrgrp, that higher gametic selection in one sex reduced recombination in that sex to preserve the favorable gene combinations that confer reproductive success. Indeed, we found (see discussion on segregation distortion below) much more significant segregation distortion, and therefore probable gametic selection, for Clementine male gametes than for female gametes. The citrus data is more in agreement with models that suggest that the sex experiencing the more intense selection, or otherwise having the higher variance in reproductive success, should show more recombination (as reported by Burt et al.
abbrgrp
abbr bid="B47"47abbr
abbrgrp).p
pImportant differences in LG lengths were also observed between Clementine (male and female) and sweet orange for LG1, LG2, LG3, LG5, LG6 and LG8. The LGs for sweet orange were systematically shorter. The literature on plants and animals shows that the impact of structural heterozygosity on recombination frequency is variable. Different situations have been discussed by Parker et al.
abbrgrp
abbr bid="B48"48abbr
abbrgrp. It is well established that sequence divergence at the interspecific level has an inhibitory effect on sexual recombination
abbrgrp
abbr bid="B49"49abbr
abbr bid="B50"50abbr
abbr bid="B51"51abbr
abbr bid="B52"52abbr
abbrgrp. Chetelat et al.
abbrgrp
abbr bid="B52"52abbr
abbrgrp observed a strong reduction in the recombination rate in a mapping population of an interspecific F1 tomato hybrid of itLycopersicon esculentumit × itSolanum lycopersicoidesit. The authors concluded that the high DNA sequence divergence between itL. esculentumit and itS. lycopersicoidesit is a better explanation of reduced recombination than structural reorganization. Previously (and also in tomato), Liharska et al.
abbrgrp
abbr bid="B53"53abbr
abbrgrp showed that the amount of recombination in a defined genetic interval decreased as the proportion of foreign chromatin (introgressed from close relatives of itL. esculentumit) increased. The authors also mentioned that, as the donor of the foreign chromatin became more distantly related, the level of observed recombination was lower. As the Clementine is a mandarin × sweet orange hybrid, and sweet orange arose from mandarin and pummelo gene pools (with a higher proportion of itC. reticulatait;
abbrgrp
abbr bid="B7"7abbr
abbr bid="B9"9abbr
abbrgrp), it is highly probable that sweet orange contains more genome regions of interspecific heterozygosity (itC. reticulataititC. maximait) than the Clementine. Therefore, it can be hypothesized that the lower LG sizes, and the associated lower recombination rates observed in sweet orange compared with Clementine, are associated with the relative interspecific patterns along the genome of these two species. The area of LG9 that displays substantially greater marker density in Clementine and sweet-orange suggests limited recombination within a large genome portion. Thus, two set of markers were common between the Clementine map and the two pummelo maps (MEST308, CIBE6092 and MEST065 for Pink pummelo and mCrCIR07F11, JI-AAG03, MEST 308 and CIBE6092 for Chandler pummelo). Interestingly, in the pummelo maps, these markers cover 26.5 cM and 30 cM, respectively, compared with an area concentrated within 2 cM in the Clementine map. It appears that both Clementine and sweet orange are strongly affected by a similar recombination limitation in LG9 for which they display equivalent map sizes. Haplotype analysis of sweet orange and diploid Clementine shows that the Clementine haplotype transmitted by sweet orange was inherited primarily from one of the sweet orange haplotypes, and only a small telomeric fragment was likely to be transmitted from the other sweet orange haplotype. Further genome analysis along with cytogenetic and mapping studies will be necessary to explain the different recombination patterns observed between species.p
sec
sec
st
pExtensive segregation distortions are observed in specific linkage group areas particularly when Clementine is used as the male parentp
st
pDistortions from expected Mendelian allelic segregations were observed for all mapped parents of the segregating progenies. The highest rate was recorded for male Clementine with 56% skewed loci (p < 0.05). This percentage is more than four times higher than that of female Clementine (13%), which was equal with the estimate of female ‘Chandler’ pummelo. Male ‘Pink’ pummelo displayed a slightly higher level of distortion than female ‘Chandler’ pummelo (16%), while sweet orange (mainly from female data) displayed an intermediate level (27%). Distorted loci were also observed in most of the previous citrus mapping studies
abbrgrp
abbr bid="B17"17abbr
abbr bid="B20"20abbr
abbr bid="B54"54abbr
abbr bid="B55"55abbr
abbr bid="B56"56abbr
abbr bid="B57"57abbr
abbrgrp. Bernet et al.
abbrgrp
abbr bid="B18"18abbr
abbrgrp also reported a higher percentage of skewed loci in the male parents compared to the female parents in a reciprocal cross between ‘Chandler’ pummelo and ‘Fortune’ mandarin. Since most segregation distortions affect the allele frequencies without disturbing the genotypic frequency equilibrium (non significant F value–Wright fixation index; data not shown), it is probable that gametic selection was the main factor causing skewed segregation. Bernet et al.
abbrgrp
abbr bid="B17"17abbr
abbrgrp reached the same conclusion from supporting biological data on parental fertility. Upon cross pollination with compatible parents, the proportion of fertilized ovules is much greater than the proportion of successful male gametes. Therefore, it appears logical that gametic selection is likely to be much more pronounced in male gametes than in females ones. This can result from several mechanisms such as gamete abortion, pollen competition or, the citrus gametophytic incompatibility system
abbrgrp
abbr bid="B58"58abbr
abbrgrp. The pattern of Xsup2sup conformity test values, as well as the excess of mandarin alleles along the linkage groups, suggests that the presence of a small number of loci under relatively strong selection pressure on each chromosome is more likely than selection at multiple loci. Similar patterns were observed in tomato
abbrgrp
abbr bid="B52"52abbr
abbrgrp. Identical areas of skewed loci were observed between Clementine and sweet orange in several linkage groups (LG1, LG3, LG5 and LG9). Modern sweet orange varieties arose from an interspecific hybrid prototype that has undergone vegetative propagation or propagation from seeds containing nucellar embryos over a several thousand year period. Besides favorable mutations and stable epigenetic variations that have been selected by man and the environment, it is probable that without the filter of sexual reproduction, the sweet orange genome accumulated unfavorable mutations in a heterozygous status. Some of these unfavorable mutations were likely transmitted to Clementine, as attested by the high proportion of weak progeny obtained from Clementine × sweet orange hybridization (our unpublished data), which should affect both sweet orange and Clementine segregations. Interestingly, the gametic selections have the same orientation for male and female Clementine in the genomic regions where sweet orange segregations are also skewed (LG1, end of LG5, and LG9). In other genome regions, male and female Clementine segregation distortions appeared disconnected. A very strong selection is observed in the middle of LG3 for the male Clementine, without significant skewing in the female. The male and female distortions appeared totally opposite at the end of LG4 and in the first part of LG5. The gametophytic incompatibility system described in citrus
abbrgrp
abbr bid="B58"58abbr
abbrgrp could be a factor for male gametic selection. However, this may lead to a complete exclusion of one allele for the concerned locus and therefore, a very high distortion for the linked marker locus. This pattern was not observed in the present study. The gametophytic incompatibility system was also excluded as an explanation for the segregation distortion observed in the reciprocal crosses between ‘Fortune’ mandarin and ‘Chandler’ pummelo
abbrgrp
abbr bid="B17"17abbr
abbrgrp. Some of the more extremely unequal allelic ratios (7030) for the male Clementine occurred in areas without significant distortion (or even opposite selection) in the female. Such differences between male and female selection may partly explain the inconsistent results observed for trait segregation in the reciprocal crosses. Thus, it is difficult to infer genetic control from observed trait segregations without concomitant marker segregation analysis. This is particularly true if major genes controlling the studied trait are heterozygous in the male parent. QTL analysis may also be affected as described by Xu
abbrgrp
abbr bid="B59"59abbr
abbrgrp.p
sec
sec
st
pHaplotype structure of the diploid Clementine and the haploid Clementine used for the implementation of the citrus whole genome reference sequencep
st
pClementine is thought to have been selected as a chance seedling from a ‘Mediterranean’ mandarin by Father Clement just over one century ago in Algeria. The mandarin female parentage was confirmed by mitochondrial genome analysis
abbrgrp
abbr bid="B10"10abbr
abbrgrp. The ‘Granito’ sour orange was initially considered to be the male parent
abbrgrp
abbr bid="B15"15abbr
abbrgrp. However, molecular studies demonstrated that the Clementine was more likely a mandarin × sweet orange hybrid
abbrgrp
abbr bid="B8"8abbr
abbr bid="B9"9abbr
abbr bid="B16"16abbr
abbrgrp. The marker phase analysis performed from the Clementine and sweet orange mapping data confirmed this hypothesis, and allowed the identification of the haplotype structures of the mandarin and sweet orange gametes that produced the Clementine. Nine recombination break points between the two sweet orange haplotypes (one each in LG1, LG7 and LG9, and two each in LG3, LG4 and LG5) were identified for the sweet orange gamete that produced the Clementine.p
pThe implementation of a reference citrus whole genome sequence has been the primary focus of the ICGC for the last 5 years. Polymorphism in a whole genome sequence complicates the assembly process. Assembly contiguity and completeness is significantly lower than would have been expected in the absence of heterozygosity
abbrgrp
abbr bid="B60"60abbr
abbrgrp. Commercial citrus varieties are characterized by high heterozygosity levels
abbrgrp
abbr bid="B6"6abbr
abbr bid="B7"7abbr
abbrgrp. The comparison of blind versus "known-haplotype" assemblies of shotgun sequences obtained from a set of BAC clones from the heterozygous sweet orange
abbrgrp
abbr bid="B61"61abbr
abbrgrp led the ICGC to establish the reference sequence of the citrus genome from a homozygous genotype. A haploid plant derived from the Clementine was selected due to its immediate availability and preexisting molecular resources
abbrgrp
abbr bid="B26"26abbr
abbr bid="B27"27abbr
abbr bid="B62"62abbr
abbr bid="B63"63abbr
abbr bid="B64"64abbr
abbrgrp. The selected haploid was obtained by induced gynogenesis after itin situit pollination with irradiated pollen
abbrgrp
abbr bid="B13"13abbr
abbrgrp. The haploid Clementine was genotyped using the markers mapped in diploid Clementine and sweet orange. This permitted the constitution of the haploid genome to be determined according to the mandarin and sweet orange haplotypes constitutive of the diploid Clementine. Eight recombination break points were identified between the two Clementine haplotypes (one in LG1, LG7 and LG8; two in LG 5 and three in LG3). LG2, LG4, LG6 and LG9 appear to have been entirely inherited from the ’Mediterranean’ mandarin haplotype without recombination. Overall, a very large fraction of the genome of the haploid Clementine used for WGS was inherited from the ‘Mediterranean’ mandarin.p
sec
sec
sec
st
pConclusionsp
st
pFive parental genetic maps were established from three segregating populations that were genotyped using SNP, SSR and Indel markers. A first medium density reference map (961 markers for 1084.1cM) of citrus was established by joining male and female Clementine segregation data. Despite the heterogeneous dispersion of markers, this constitutes a good framework for further marker-trait association studies, and it has been used to enable the chromosome assembly of the reference whole genome citrus sequence
abbrgrp
abbr bid="B39"39abbr
abbrgrp. The Clementine map was compared with two pummelo maps (‘Chandler’ map: 151 markers for 828.6 cM; ‘Pink’ map: 81 markers for 633 cM) and a sweet orange map (569 markers for 669.6 cM). The linear order of the markers appeared to be highly conserved at the interspecific level. This should allow for reasonable inferences of most citrus genome sequences via mapping NGS re-sequencing data in the haploid Clementine reference genome sequence. Important variations between the Clementine and sweet orange map sizes were observed, as well as variations between the male and female Clementine maps. This suggests variations in recombination rates. The smaller length of the sweet orange map is likely related to the higher interspecific heterozygosity within the sweet orange genome. Skewed segregations are numerous in the male Clementine map, underlining the potential extent of deviation from Mendelian segregation for characters controlled by heterozygous loci in the male parent. Genetic mapping data confirmed that the Clementine is a hybrid between the ‘Mediterranean’ mandarin and sweet orange. Nine recombination break points were identified between the two sweet orange haplotypes for the sweet orange gamete that contributed to the Clementine genome. The genome of the haploid Clementine used to establish the citrus reference sequence appears to be have been primarily inherited from the ‘Mediterranean’ mandarin haplotype of the diploid Clementine.p
sec
sec
st
pMaterials and methodsp
st
sec
st
pSegregating progenies and DNA extractionp
st
sec
st
pClementine and pummelo genetic mappingp
st
pTwo inter-specific segregating populations between itC. clementinait and itC. maximait were used to establish the genetic maps. One hundred and fifty-six hybrids of ‘Chandler’ pummelo × ‘Nules’ Clementine (CP × NC) were produced and grown at CIRADINRA (Corsica), while 140 hybrids of ‘Nules’ Clementine × ‘Pink’ pummelo (NC × PP) were obtained at IVIA. Total DNA was extracted from fresh leaves according to Doyle and Doyle
abbrgrp
abbr bid="B65"65abbr
abbrgrp. In addition to the interspecific hybrids, total DNA was extracted from the parental lines: diploid ‘Nules’ Clementine (IVIA-22), ‘Chandler’ pummelo (ICVN 0100608) and ‘Pink’ Pummelo (IVIA-275). DNA was also extracted from the haploid Clementine selected for the whole genome sequence implementation and ‘Mediterranean’ mandarin (IVIA-154), the assumed female parent of Clementine.p
sec
sec
st
pSweet orange genetic mappingp
st
pOne hundred and forty seven intergeneric hybrids between sweet orange and trifoliate orange (itCitrus sinensis × Poncirus trifoliatait; SO × TO) were used for sweet orange mapping using SNP markers shared with the Clementine map. These hybrids were obtained at UF-CREC (Florida) and previously used for sweet orange and trifoliate orange mapping using SSR markers
abbrgrp
abbr bid="B19"19abbr
abbrgrp. The different crosses used were: (i) 56 hybrids of itC. sinensisit cv Sanford (Sa) × itP. trifoliatait cv Argentina (Ar), (ii) 40 hybrids of itC. sinensisit cv Fiwicke (Fi) × itP. trifoliatait cv Flying Dragon (FD); (iii) 15 hybrids of itC. sinensisit cv Ridge Pineapple (RP) × itP. trifoliatait cv Flying Dragon (FD), (iv) seven hybrids of itC. sinensisit cv Fiwicke (Fi) × itP. trifoliatait cv Argentina (Ar); (v) six hybrids of itC. sinensisit cv Ruby (Ru) × itP. trifoliatait cv Flying Dragon (FD), (vi) five hybrids of itC. sinensisit cv Ridge Pineapple (RP) × itP. trifoliatait cv DPI0906 (Ps), (vii) five hybrids of itC. sinensisit cv Ruby (Ru) × itP. trifoliatait Argentina cv (Ar), and (viii) 13 hybrids of itP. trifoliatait cv Flying Dragon (FD) × itC. sinensisit Ridge cv Pineapple (RP). Due to the nature of itC. sinensisit intraspecific evolution (somatic mutations but not sexual recombination), molecular polymorphisms between sweet orange cultivars is very rare
abbrgrp
abbr bid="B8"8abbr
abbr bid="B19"19abbr
abbrgrp. Therefore, after confirming the lack of polymorphism between parental sweet oranges at the marker loci, all of the hybrids were considered to be derived from a single sweet orange genotype for the mapping analysis. Prior to DNA extraction, the ploidy level of all hybrids was estimated by flow cytometry, and only diploid hybrids were used. Genomic DNA was isolated from tender leaves using the CTAB method as described by Aldrich and Cullis
abbrgrp
abbr bid="B66"66abbr
abbrgrp.p
sec
sec
sec
st
pMarkersp
st
pA total of 1166 markers were used to genotype the progenies. Of these markers, 837 were SNPs, 301 were SSRs and 28 were Indels.p
sec
st
pSNPsp
st
pCiC****-**: the 802 SNPs were mined from the Clementine BAC end sequence database
abbrgrp
abbr bid="B27"27abbr
abbrgrp. These markers are part of the 1536 total SNPs used to implement an Illumina GoldenGate assay. These markers were selected based on their quality and segregation in the analyzed progenies for at least one parent. They have been published by Ollitrault et al.
abbrgrp
abbr bid="B8"8abbr
abbrgrp and the corresponding GenBank accession numbers can be found in Additional file
supplr sid="S1"1supplr.p
pACO-*-***, ADC****, Aoc****, ATGGcM155, Cax4****, CHI-*-***, DXS-M-***, FLS-M-***; HKT1c800F141; LapXcF***; LCY2-*-***; LCYB-*-***, MDH-P-84; NADK2c800F***; PKF-M-186, PSY-M-289, TRPA-M-***, TScMI1331: These 34 SNP markers were mined by Sanger sequencing of 44 genotypes representative of itCitrusit and relative diversity, and were obtained from 19 genes implicated in the primary and secondary metabolite biosynthesis pathway and salt tolerance
abbrgrp
abbr bid="B38"38abbr
abbrgrp. Corresponding GenBank accession numbers can be found in Additional file
supplr sid="S1"1supplr. Seventeen of these SNPs have been published
abbrgrp
abbr bid="B8"8abbr
abbrgrp. Details on the 17 remaining markers can be found in Additional file
supplr sid="S10"10supplr.p
suppl id="S10"
title
pAdditional file 10p
title
text
p
bInformation on the new SNP markers included in the GoldenGate array.b This file contains information regarding the new SNP markers included in the GoldenGate array. It includes the GenBank accession number, the sequence surrounding the SNPs, SNP position, the GoldenGate primers and designability rank.p
text
file name="1471-2164-13-593-S10.xlsx"
pClick here for filep
file
suppl
sec
sec
st
pSSR markersp
st
pThe 301 SSR markers used for mapping were developed from genomic libraries (79), ESTs (188), and BACend sequences (34).p
pCI***** and mCrCIR*****: These 57 markers were developed by Froelicher and colleagues at CIRADINRA (France) from a genomic library of ‘Cleopatra’ mandarin. Corresponding GenBank accession numbers can be found in Additional file
supplr sid="S1"1supplr. Most of the mapped markers have been published
abbrgrp
abbr bid="B23"23abbr
abbr bid="B67"67abbr
abbr bid="B68"68abbr
abbr bid="B69"69abbr
abbrgrp. Primers for the remaining markers are given in Additional file
supplr sid="S11"11supplr.p
suppl id="S11"
title
pAdditional file 11p
title
text
p
bCharacteristics and primers for the new SSR markers developed from ‘Cleopatra’ mandarin genomic library at CIRAD.b This file contains information on the primers used for the new SSRs developed from a Cleopatra mandarin (itC. reshniit) genomic library (GenBank accession number, primer sequences, annealing temperature and microsatellite motif).p
text
file name="1471-2164-13-593-S11.pdf"
pClick here for filep
file
suppl
pCIBE****: These 34 markers were developed by Ollitrault and colleagues at CIRADIVIA (FranceSpain) from a Clementine BAC end sequence database
abbrgrp
abbr bid="B27"27abbr
abbrgrp. These markers are published in Ollitrault et al.
abbrgrp
abbr bid="B28"28abbr
abbrgrp. Corresponding GenBank accession numbers can be found in Additional file
supplr sid="S1"1supplr.p
pCF-*****, JI-***** and NB-****: These 59 markers were developed by Roose and colleagues at UCR (California). Fourteen of the markers are from genomic libraries and 45 are from ESTs. Corresponding GenBank accession numbers can be found in Additional file
supplr sid="S1"1supplr. Only the four NB-**** markers have been published
abbrgrp
abbr bid="B6"6abbr
abbrgrp. Data on the remaining markers can be obtained upon request (Mikeal L. Roose ).p
pCTV2745: This marker is closely linked to the citrus tristeza virus immunity gene of trifoliate orange and was developed in the Roose laboratory (UCR, California) from a genomic sequence
abbrgrp
abbr bid="B70"70abbr
abbrgrp.p
pCms** and jk-****: These seven markers were developed from genomic libraries and were published by Ahmad et al.
abbrgrp
abbr bid="B71"71abbr
abbrgrp and Kijas et al.
abbrgrp
abbr bid="B55"55abbr
abbrgrp, respectively.p
pCX****: These 70 markers were developed by Chunxian Chen and colleagues at the CREC (Florida) from an EST database. The corresponding GenBank accession numbers can be found in Additional file
supplr sid="S1"1supplr. Some of the mapped markers have been published by Chen et al.
abbrgrp
abbr bid="B19"19abbr
abbr bid="B25"25abbr
abbrgrp. Data on the remaining markers can be obtained upon request (Chunxian Chen: cxchen@ufl.edu).p
pMest****: These 73 markers were developed by Luro and Col. at INRACIRAD from EST databases (France). The corresponding GenBank accession numbers can be found in Additional file
supplr sid="S1"1supplr. Seven of these markers were published by Luro et al.
abbrgrp
abbr bid="B26"26abbr
abbrgrp. The primer sequences of the remaining markers can be obtained upon request (luro@corse.inra.fr).p
sec
sec
st
pIndel markersp
st
pCID****: These 28 markers were developed from a Clementine BAC end sequence database
abbrgrp
abbr bid="B27"27abbr
abbrgrp at IVIACIRAD (Spain), and have been published by Ollitrault et al.
abbrgrp
abbr bid="B30"30abbr
abbrgrp. IDCAX is an Indel marker developed by Garcia-Lor et al.
abbrgrp
abbr bid="B7"7abbr
abbrgrp. The corresponding GenBank accession numbers can be found in Additional file
supplr sid="S1"1supplr.p
sec
sec
sec
st
pGenotyping methodsp
st
sec
st
pSSRsp
st
pSSR genotyping was performed using different methods in different laboratories (Additional file
supplr sid="S1"1supplr).p
pAt IVIACIRAD and INRA, PCR products (using wellRED oligonucleotides, Sigma®) were separated by capillary gel electrophoresis (CEQ™ 8000 Genetic Analysis System; Beckman Coulter Inc.) as described by Ollitrault et al.
abbrgrp
abbr bid="B28"28abbr
abbrgrp. The data collection and analysis were performed with GenomeLabit™it GeXP software, version 10.0.p
pAt CIRAD and Cukurova University, PCR products (using tailing M13 associated with three fluorescent dyes) were separated by electrophoresis on a Li-Cor DNA Analyzer 4200 system (Licor Biosciences, BadHomburg, Germany). The alleles were sized according to 50- to 350-bp standards (MWG Biotech AG, Ebersberg, Germany). SSR alleles were detected and scored using SAGA Generation 2 software (LI-COR, USA) and controlled visually.p
pAt the CREC, PCR products (using tailing M13) were separated by capillary gel electrophoresis on an ABI 3130xl Genetic Analyzer (Applied Biosystems Inc., Foster City, CA, USA). GeneScan 3.7 NT and Genotyper 3.7 NT were used to extract the trace data and generate the microsatellite allele tables, respectively. More details can be found in Chen et al.
abbrgrp
abbr bid="B25"25abbr
abbrgrp.p
pAt UCR, PCR products labeled by an M13-tailed primer strategy were separated using a denaturing 7% Long Ranger (BMA, Rockland, ME, USA) polyacrylamide gel attached to a LI-COR IR2 4200LR Global DNA sequencer dual dye system. Alleles were sized manually by comparison with 50–350 bp size standards (LI-COR), and then scored manually from gel image files. More details can be found in Barkley et al.
abbrgrp
abbr bid="B6"6abbr
abbrgrp.p
sec
sec
st
pIndelsp
st
pIndel markers were genotyped by Capillary Gel Electrophoresis (CEQ™ 8000 Genetic Analysis System; Beckman Coulter Inc.) using wellRED oligonucleotides (Sigma®) as described by Ollitrault et al.
abbrgrp
abbr bid="B34"34abbr
abbrgrp. Data collection and analysis were performed with GenomeLabit™it GeXP software, version 10.0.p
sec
sec
st
pSNPsp
st
pAll SNP markers were genotyped on a GoldenGate array platform according to the standard Illumina GoldenGate assay instructions (urlhttp:www.illumina.comurl). More details can be found in Ollitrault et al.
abbrgrp
abbr bid="B8"8abbr
abbrgrp. Two genotype controls (‘Nules’ Clementine and ‘Chandler’ pummelo) were repeated twice in each plate. The data were collected and analyzed using the Genome Studio software (Illumina). The automatic allele calling was visually checked for each markerplate and corrected if necessary.p
sec
sec
sec
st
pLinkage analysis and genetic mappingp
st
pThe two-way pseudo-testcross mapping strategy was used to determine the linkages in the different F1 populations from the two heterozygous parents as previously described
abbrgrp
abbr bid="B72"72abbr
abbrgrp and used in previous mapping studies in citrus
abbrgrp
abbr bid="B17"17abbr
abbr bid="B19"19abbr
abbr bid="B73"73abbr
abbrgrp. Each progeny was analyzed with JoinMap 4.0
abbrgrp
abbr bid="B74"74abbr
abbrgrp. The genotyping data were coded according to the “CP” population option adapted for such two-way pseudo-testcrosses with no previous knowledge of the marker linkage phases. In the first step, JoinMap was used to establish male and female gamete populations, which were analyzed separately. Segregation distortion was tested by χ2 conformity tests against the Mendelian segregation ratio of 1:1. Linkage analysis and marker grouping were performed using the independence LOD and a minimum threshold LOD=4. Phases (coupling and repulsion) of the linked marker loci were automatically detected by the software. Map distances were established in centiMorgans (cM) using the regression mapping algorithm and the Kosambi mapping function. Given that missing observations have much less negative impact on the quality of the map than errors, several authors recommend identifying suspicious data and treating them as missing observations
abbrgrp
abbr bid="B75"75abbr
abbr bid="B76"76abbr
abbrgrp. In high density genetic mapping, a genotype error usually manifests itself as a singleton (or a double cross-over) under a reasonably accurate ordering of the markers. A singleton is a locus whose phase is different from both the marker phases immediately before and after. A reasonable strategy to deal with genotyping errors is to remove singletons by treating them as missing observations, and then refine the map by running the ordering algorithm
abbrgrp
abbr bid="B75"75abbr
abbr bid="B76"76abbr
abbrgrp. For the Clementine map in which a relatively high number of markers was genotyped, singletons were automatically checked after a first mapping round and replaced by missing data using an excel page routine. The Clementine maps were established from these cleaned data. Distorted markers were not removed from the analysis because they were very frequent for some parents. Moreover, using JoinMap, each grouping of linked loci was based upon a test for independence in a contingency table. Since the test for independence is not affected by segregation distortion like the LOD score used by other methods of linkage analysis, a lower incidence of spurious linkage is expected
abbrgrp
abbr bid="B74"74abbr
abbrgrp. The linkage maps were drawn using the MapChart program
abbrgrp
abbr bid="B77"77abbr
abbrgrp. The circle plot diagram used to compare the marker order in four genetic maps was performed using Circos software (urlhttp:circos.caurl). Clementine and sweet orange haplotypes were drawn with GGT 2.0 software
abbrgrp
abbr bid="B78"78abbr
abbrgrp.p
sec
sec
sec
st
pCompeting interestsp
st
pThe authors declare that they have no competing interests.p
sec
sec
st
pAuthors’ contributionsp
st
pPO managed the work, analyzed the data and wrote the manuscript. JT and MT provided the SNP markers and contributed to data analysis. DB, ABe, ABo and AC developed the GoldenGate array and performed the SNP genotyping. YF developed the CP×NC population and provided DNA. PA developed the CN×PP population and provided DNA. CC and FGG provided the SO×TO progeny DNA and performed part of the SSR genotyping. CTF, SL, IH, FO, GC, YK, LM, AGL, CB, LN, FL and MLR contributed to the SSR and Indels genotyping, and JC contributed to the analysis of mapping data. All authors have read and approved the final manuscript.p
sec
bdy
bm
ack
sec
st
pAcknowledgementsp
st
pThis work was principally funded by the French ANR CITRUSSEQ project. The European Commission, under the FP6-2003- INCO-DEV-2 project CIBEWU (n°015453), the Spanish Ministerio de Ciencia e Innovación grants, AGL2007-65437-C04-01AGR and AGL2008-00596-MCI, the Spanish PSE-060000-2009-8 and IPT-010000-2010-43 projects, the Prometeo project 2008121 Generalidad Valenciana, the Turkish TUBITAK Project No: 108O568, the California Citrus Research Board and UC Discovery grant itl-bio-03-10122 and the Florida Citrus Research and Development Foundation (CRDF), grants #67 and 71 also contributed to the work.p
sec
ack
refgrpbibl id="B1"sourceFAOSTATsourcepubdate2009pubdateurlhttp:faostat.fao.orgsite567default.aspxurlbiblbibl id="B2"titlepOn the history and origin of CitrusptitleaugausnmScorasnmfnmRWfnmauaugsourceBull Torrey Bot Clubsourcepubdate1975pubdatevolume102volumefpage369fpagelpage375lpagexrefbibpubid idtype="doi"10.23072484763pubidxrefbibbiblbibl id="B3"titlepA numerical taxonomic study of affinity relationships in cultivated Citrus and its close relativesptitleaugausnmBarrett HCsnmfnmRAfnmauaugsourceSyst Botsourcepubdate1976pubdatevolume1volumefpage105fpagelpage136lpagexrefbibpubid idtype="doi"10.23072418763pubidxrefbibbiblbibl id="B4"titlepHistory and development of the citrus industryptitleaugausnmWebbersnmfnmHJfnmauaugsourceThe citrus industry. Volume 1sourcepublisherBerkeley: University of California PresspublishereditorReuther W, Webber HJeditorpubdate1967pubdatefpage1fpagelpage39lpagebiblbibl id="B5"titlepEvaluation of genetic relationships in Citrus genus by means of sequence tagged microsatellitesptitleaugausnmLurosnmfnmFfnmauausnmRistsnmfnmDfnmauausnmOllitraultsnmfnmPfnmauaugsourceActa Horticsourcepubdate2001pubdatevolume546volumefpage237fpagelpage242lpagebiblbibl id="B6"titlepAssessing genetic diversity and population structure in a citrus germplasm collection utilizing simple sequence repeat markers (SSRs)ptitleaugausnmBarkleysnmfnmNAfnmauausnmRoosesnmfnmMLfnmauausnmKruegersnmfnmRRfnmauausnmFedericisnmfnmCTfnmauaugsourceTheor Appl Genetsourcepubdate2006pubdatevolume112volumeissue8issuefpage1519fpagelpage1531lpagexrefbibpubidlistpubid idtype="doi"10.1007s00122-006-0255-9pubidpubid idtype="pmpid" link="fulltext"16699791pubidpubidlistxrefbibbiblbibl id="B7"titlepComparative use of InDel and SSR markers in deciphering the interspecific structure of cultivated citrus genetic diversity: a perspective for genetic association studiesptitleaugausnmGarcia-LorsnmfnmAfnmauausnmLurosnmfnmFfnmauausnmNavarrosnmfnmLfnmauausnmOllitraultsnmfnmPfnmauaugsourceMol Genet Genomicssourcepubdate2012pubdatevolume287volumeissue1issuefpage77fpagelpage94lpagexrefbibpubidlistpubid idtype="doi"10.1007s00438-011-0658-4pubidpubid idtype="pmpid" link="fulltext"22160318pubidpubidlistxrefbibbiblbibl id="B8"titlepSNP mining in C. clementina BAC end sequences; transferability in the Citrus genus (Rutaceae), phylogenetic inferences and perspectives for genetic mappingptitleaugausnmOllitraultsnmfnmPfnmauausnmTerolsnmfnmJfnmauausnmGarcia-LorsnmfnmAfnmauausnmBerardsnmfnmAfnmauausnmChauveausnmfnmAfnmauausnmFroelichersnmfnmYfnmauausnmBelzilesnmfnmCfnmauausnmMorillonsnmfnmRfnmauausnmNavarrosnmfnmLfnmauausnmBrunelsnmfnmDfnmauausnmTalonsnmfnmMfnmauaugsourceBMC Genomicssourcepubdate2012pubdatevolume13volumefpage13fpagexrefbibpubidlistpubid idtype="doi"10.11861471-2164-13-13pubidpubid idtype="pmcid"3320530pubidpubid idtype="pmpid" link="fulltext"22233093pubidpubidlistxrefbibbiblbibl id="B9"titlepCitrus phylogeny and genetic origin of important species as investigated by molecular markersptitleaugausnmNicolosisnmfnmEfnmauausnmDengsnmfnmZNfnmauausnmGentilesnmfnmAfnmauausnmMalfasnmfnmSfnmauausnmContinellasnmfnmGfnmauausnmTribulatosnmfnmEfnmauaugsourceTheor Appl Genetsourcepubdate2000pubdatevolume100volumeissue8issuefpage1155fpagelpage1166lpagexrefbibpubid idtype="doi"10.1007s001220051419pubidxrefbibbiblbibl id="B10"titlepNew universal mitochondrial PCR markers reveal new information on maternal citrus phylogenyptitleaugausnmFroelichersnmfnmYfnmauausnmMouhayasnmfnmWfnmauausnmBassenesnmfnmJBfnmauausnmCostantinosnmfnmGfnmauausnmKamirisnmfnmMfnmauausnmLurosnmfnmFfnmauausnmMorillonsnmfnmRfnmauausnmOllitraultsnmfnmPfnmauaugsourceTree Genet Genomessourcepubdate2011pubdatevolume7volumeissue1issuefpage49fpagelpage61lpagexrefbibpubid idtype="doi"10.1007s11295-010-0314-xpubidxrefbibbiblbibl id="B11"titlepChromosome numbers in the subfamily Arantioideae, with special reference in the genus CitrusptitleaugausnmKrugsnmfnmCAfnmauaugsourceCitrus Bot Gazsourcepubdate1943pubdatevolume104volumefpage602fpagelpage611lpagebiblbibl id="B12"titlepCitrusptitleaugausnmOllitraultsnmfnmPfnmauausnmJacquemondsnmfnmCfnmauausnmDuboissnmfnmCfnmauausnmLurosnmfnmFfnmauaugsourceGenetic diversity of cultivated tropical plantssourcepublisherMontpellier: CIRADpublishereditorHamon P, Seguin M, Perrier X, Glaszmann JCeditorpubdate2003pubdatefpage193fpagelpage217lpagebiblbibl id="B13"titlepRecovery and characterization of a Citrus clementina Hort. ex Tan. 'Clemenules' haploid plant selected to establish the reference whole Citrus genome sequenceptitleaugausnmAlezasnmfnmPfnmauausnmJuarezsnmfnmJfnmauausnmHernandezsnmfnmMfnmauausnmPinasnmfnmJAfnmauausnmOllitraultsnmfnmPfnmauausnmNavarrosnmfnmLfnmauaugsourceBMC Plant Biolsourcepubdate2009pubdatevolume9volumefpage110fpagexrefbibpubidlistpubid idtype="doi"10.11861471-2229-9-110pubidpubid idtype="pmcid"2747335pubidpubid idtype="pmpid" link="fulltext"19698121pubidpubidlistxrefbibbiblbibl id="B14"augausnmGmittersnmfnmFGfnmsufJrsufauaugsourceThe Haploid Mandarin and Diploid Sweet Orange Genome SequencessourcepublisherSan Diego, CA: Plant & Animal Genomes XIX Conferencepublisherpubdate2011pubdatebiblbibl id="B15"titlepL'hybridation des Citrus : une nouvelle tangérine "la Clémentine"ptitleaugausnmTrabutsnmfnmJLfnmauaugsourceRevue Horticolesourcepubdate1902pubdatevolume10volumefpage232fpagelpage234lpagebiblbibl id="B16"titlepParentage determination of some citrus hybrids by molecular markersptitleaugausnmDengsnmfnmZNfnmauausnmGentilesnmfnmAfnmauausnmNicolosisnmfnmEfnmauausnmContinellasnmfnmGfnmauausnmTribulatosnmfnmEfnmauaugsourceProceedings of the International Society of Citriculture XIII Congresssourcepubdate1996pubdatevolume2volumefpage849fpagelpage854lpagebiblbibl id="B17"titlepComparative genome-wide segregation analysis and map construction using a reciprocal cross design to facilitate citrus germplasm utilizationptitleaugausnmBernetsnmfnmGPfnmauausnmFernandez RibacobasnmfnmJfnmauausnmCarbonellsnmfnmEAfnmauausnmAsinssnmfnmMJfnmauaugsourceMol Breedsourcepubdate2010pubdatevolume25volumeissue4issuefpage659fpagelpage673lpagexrefbibpubid idtype="doi"10.1007s11032-009-9363-ypubidxrefbibbiblbibl id="B18"augausnmLyonsnmfnmMTfnmauausnmFedericisnmfnmCTfnmauausnmKacarsnmfnmYfnmauausnmChensnmfnmCfnmauausnmO'MalleysnmfnmDfnmauausnmChaparrosnmfnmJXfnmauausnmGmittersnmfnmFGfnmauausnmRoosesnmfnmMLfnmauaugsourceSSR-Based Linkage Maps For Sweet Orange And Trifoliate OrangesourcepublisherSan Diego, CA: Plant & Animal Genome XVth Conferencepublisherpubdate2007pubdatebiblbibl id="B19"titlepEST-SSR genetic maps for Citrus sinensis and Poncirus trifoliataptitleaugausnmChensnmfnmCXfnmauausnmBowmansnmfnmKDfnmauausnmChoisnmfnmYAfnmauausnmDangsnmfnmPMfnmauausnmRaosnmfnmMNfnmauausnmHuangsnmfnmSfnmauausnmSonejisnmfnmJRfnmauausnmMcCollumsnmfnmTGfnmauausnmGmittersnmfnmFGfnmsufJrsufauaugsourceTree Genet Genomessourcepubdate2008pubdatevolume4volumeissue1issuefpage1fpagelpage10lpagebiblbibl id="B20"titlepDevelopment of genetic maps of the citrus varieties 'Murcott' tangor and 'Pera' sweet orange by using fluorescent AFLP markersptitleaugausnmCarlosdeOliveirasnmfnmAfnmauausnmBastianelsnmfnmMfnmauausnmCristofani-YalysnmfnmMfnmauausnmMoraisdoAmaralsnmfnmAfnmauausnmMachadosnmfnmMAfnmauaugsourceJ Appl Genetsourcepubdate2007pubdatevolume48volumeissue3issuefpage219fpagelpage231lpagexrefbibpubidlistpubid idtype="doi"10.1007BF03195216pubidpubid idtype="pmpid"17666774pubidpubidlistxrefbibbiblbibl id="B21"titlepA new citrus linkage map based on SRAP, SSR, ISSR, POGP, RGA and RAPD markersptitleaugausnmGulsensnmfnmOfnmauausnmUzunsnmfnmAfnmauausnmCanansnmfnmIfnmauausnmSedaysnmfnmUfnmauausnmCanihossnmfnmEfnmauaugsourceEuphyticasourcepubdate2010pubdatevolume173volumeissue2issuefpage265fpagelpage277lpagexrefbibpubid idtype="doi"10.1007s10681-010-0146-7pubidxrefbibbiblbibl id="B22"titlepDevelopment and characterization of polymorphic microsatellite markers for the sweet orange (Citrus sinensis L. Osbeck)ptitleaugausnmNovellisnmfnmVMfnmauausnmCristofanisnmfnmMfnmauausnmSouzasnmfnmAAfnmauausnmMachadosnmfnmMAfnmauaugsourceGenet Mol Biolsourcepubdate2006pubdatevolume29volumeissue1issuefpage90fpagelpage96lpagexrefbibpubid idtype="doi"10.1590S1415-47572006000100018pubidxrefbibbiblbibl id="B23"titlepCharacterization of microsatellite markers in mandarin orange (Citrus reticulata Blanco)ptitleaugausnmFroelichersnmfnmYfnmauausnmDambiersnmfnmDfnmauausnmBassenesnmfnmJBfnmauausnmCostantinosnmfnmGfnmauausnmLotfysnmfnmSfnmauausnmDidoutsnmfnmCfnmauausnmBeaumontsnmfnmVfnmauausnmBrottiersnmfnmPfnmauausnmRisteruccisnmfnmAMfnmauausnmLurosnmfnmFfnmauausnmOllitraultsnmfnmPfnmauaugsourceMol Ecol Resoursourcepubdate2008pubdatevolume8volumeissue1issuefpage119fpagelpage122lpagexrefbibpubidlistpubid idtype="doi"10.1111j.1471-8286.2007.01893.xpubidpubid idtype="pmpid"21585732pubidpubidlistxrefbibbiblbibl id="B24"titlepAn evaluation of sequence tagged microsatellite site markers for genetic analysis within Citrus and related speciesptitleaugausnmKijassnmfnmJMfnmauausnmFowlersnmfnmJCfnmauausnmThomassnmfnmMRfnmauaugsourceGenomesourcepubdate1995pubdatevolume38volumeissue2issuefpage349fpagelpage355lpagexrefbibpubidlistpubid idtype="doi"10.1139g95-045pubidpubid idtype="pmpid"7774802pubidpubidlistxrefbibbiblbibl id="B25"titlepMining and characterizing microsatellites from citrus ESTsptitleaugausnmChensnmfnmCXfnmauausnmZhousnmfnmPfnmauausnmChoisnmfnmYAfnmauausnmHuangsnmfnmSfnmauausnmGmittersnmfnmFGfnmsufJrsufauaugsourceTAG Theor Appl Genetsourcepubdate2006pubdatevolume112volumeissue7issuefpage1248fpagelpage1257lpagexrefbibpubid idtype="doi"10.1007s00122-006-0226-1pubidxrefbibbiblbibl id="B26"titlepTransferability of the EST-SSRs developed on Nules clementine (Citrus clementina Hort ex Tan) to other Citrus species and their effectiveness for genetic mappingptitleaugausnmLurosnmfnmFLfnmauausnmCostantinosnmfnmGfnmauausnmTerolsnmfnmJfnmauausnmArgoutsnmfnmXfnmauausnmAllariosnmfnmTfnmauausnmWinckersnmfnmPfnmauausnmTalonsnmfnmMfnmauausnmOllitraultsnmfnmPfnmauausnmMorillonsnmfnmRfnmauaugsourceBMC Genomicssourcepubdate2008pubdatevolume9volumefpage287fpagexrefbibpubidlistpubid idtype="doi"10.11861471-2164-9-287pubidpubid idtype="pmcid"2435559pubidpubid idtype="pmpid" link="fulltext"18558001pubidpubidlistxrefbibbiblbibl id="B27"titlepDevelopment of genomic resources for Citrus clementina: characterization of three deep-coverage BAC libraries and analysis of 46,000 BAC end sequencesptitleaugausnmTerolsnmfnmJfnmauausnmNaranjosnmfnmMAfnmauausnmOllitraultsnmfnmPfnmauausnmTalonsnmfnmMfnmauaugsourceBMC Genomicssourcepubdate2008pubdatevolume9volumefpage423fpagexrefbibpubidlistpubid idtype="doi"10.11861471-2164-9-423pubidpubid idtype="pmcid"2561056pubidpubid idtype="pmpid" link="fulltext"18801166pubidpubidlistxrefbibbiblbibl id="B28"titlepDevelopment of SSR markers from Citrus clementina (Rutaceae) BAC end sequences and interspecific transferability in CitrusptitleaugausnmOllitraultsnmfnmFfnmauausnmTerolsnmfnmJfnmauausnmPinasnmfnmJAfnmauausnmNavarrosnmfnmLfnmauausnmTalonsnmfnmMfnmauausnmOllitraultsnmfnmPfnmauaugsourceAm J Botsourcepubdate2010pubdatevolume97volumeissue11issuefpagee124fpagelpagee129lpagexrefbibpubidlistpubid idtype="doi"10.3732ajb.1000280pubidpubid idtype="pmpid" link="fulltext"21616814pubidpubidlistxrefbibbiblbibl id="B29"titlepGeneration, functional analysis and utility of Citrus grandis EST from a flower-derived cDNA libraryptitleaugausnmBiswassnmfnmMKfnmauausnmChaisnmfnmLfnmauausnmQiangsnmfnmXfnmauausnmDengsnmfnmXfnmauaugsourceMol Biol Repsourcepubdate2012pubdatevolume39volumefpage7221fpagelpage7235lpagexrefbibpubidlistpubid idtype="doi"10.1007s11033-012-1553-8pubidpubid idtype="pmpid" link="fulltext"22477149pubidpubidlistxrefbibbiblbibl id="B30"titlepDevelopment of InDel markers from Citrus clementina (Rutaceae) BAC-end sequences and interspecific transferability in CitrusptitleaugausnmOllitraultsnmfnmFfnmauausnmTerolsnmfnmJfnmauausnmAlonso MartinsnmfnmAfnmauausnmPinasnmfnmJAfnmauausnmNavarrosnmfnmLfnmauausnmTalonsnmfnmMfnmauausnmOllitraultsnmfnmPfnmauaugsourceAm J Botsourcepubdate2012pubdatevolume99volumeissue7issuefpagee268fpagelpagee273lpagexrefbibpubidlistpubid idtype="doi"10.3732ajb.1100569pubidpubid idtype="pmpid" link="fulltext"22733984pubidpubidlistxrefbibbiblbibl id="B31"titlepComparison between Poncirus and Citrus genetic linkage mapsptitleaugausnmRuizsnmfnmCfnmauausnmAsinssnmfnmMJfnmauaugsourceTheor Appl Genetsourcepubdate2003pubdatevolume106volumeissue5issuefpage826fpagelpage836lpagexrefbibpubid idtype="pmpid" link="fulltext"12647056pubidxrefbibbiblbibl id="B32"titlepMapping and marker assisted selection in CitrusptitleaugausnmRoosesnmfnmMLfnmauaugsourceCitrus genetics, breeding and biotechnologysourcepublisherWallingford, UK: CAB InternationalpublishereditorKhan IAeditorpubdate2007pubdatefpage275fpagelpage286lpagebiblbibl id="B33"titlepGenetic linkage maps of ‘Pêra’ sweet orange and ‘Cravo’ mandarin with RAPD markersptitleaugausnmOliveirasnmfnmRPfnmauausnmCristofanisnmfnmMfnmauausnmVildososnmfnmCIAfnmauausnmMachadosnmfnmMAfnmauaugsourcePesquisa Agropecuária Brasileirasourcepubdate2004pubdatevolume39volumefpage159fpagelpage165lpagexrefbibpubid idtype="pmpid"23315804pubidxrefbibbiblbibl id="B34"augausnmOmurasnmfnmMfnmauausnmUedasnmfnmTfnmauausnmKitasnmfnmMfnmauausnmKomatsusnmfnmAfnmauausnmTakanokurasnmfnmYfnmauausnmShimadasnmfnmTfnmauausnmEndo-InagakisnmfnmTfnmauausnmNesumisnmfnmHfnmauausnmYoshidasnmfnmTfnmauaugsourceEST Mapping of CitrussourcepublisherOrlando, FL: Proceedings of the International Society of Citriculture IX Congresspublisherpubdate2000pubdatefpage71fpagelpage74lpagebiblbibl id="B35"titlepEvaluation of inter-simple sequence repeat analysis for mapping in Citrus and extension of the genetic linkage mapptitleaugausnmSankarsnmfnmAAfnmauausnmMooresnmfnmGAfnmauaugsourceTheor Appl Genetsourcepubdate2001pubdatevolume102volumefpage206fpagelpage214lpagexrefbibpubid idtype="doi"10.1007s001220051637pubidxrefbibbiblbibl id="B36"titlepGene-centromere mapping of 312 loci in pink salmon by half-tetrad analysisptitleaugausnmLindnersnmfnmKRfnmauausnmSeebsnmfnmJEfnmauausnmHabichtsnmfnmCfnmauausnmKnudsensnmfnmKLfnmauausnmKretschmersnmfnmEfnmauausnmReedysnmfnmDJfnmauausnmSpruellsnmfnmPfnmauausnmAllendorfsnmfnmFWfnmauaugsourceGenomesourcepubdate2000pubdatevolume43volumeissue3issuefpage538fpagelpage549lpagexrefbibpubidlistpubid idtype="doi"10.1139g00-016pubidpubid idtype="pmpid"10902719pubidpubidlistxrefbibbiblbibl id="B37"titlepConstruction of a 10,000-marker ultradense genetic recombination map of potato: providing a framework for accelerated gene isolation and a genomewide physical mapptitleaugausnmvan OssnmfnmHfnmauausnmAndrzejewskisnmfnmSfnmauausnmBakkersnmfnmEfnmauausnmBarrenasnmfnmIfnmauausnmBryansnmfnmGJfnmauausnmCaromelsnmfnmBfnmauausnmGhareebsnmfnmBfnmauausnmIsidoresnmfnmEfnmauausnmde JongsnmfnmWfnmauausnmvan KoertsnmfnmPfnmauausnmLefebvresnmfnmVfnmauausnmMilbournesnmfnmDfnmauausnmRittersnmfnmEfnmauausnmvan der VoortsnmfnmJNfnmauausnmRousselle-BourgeoissnmfnmFfnmauausnmvan VlietsnmfnmJfnmauausnmWaughsnmfnmRfnmauausnmVissersnmfnmRGfnmauausnmBakkersnmfnmJfnmauausnmvan EcksnmfnmHJfnmauaugsourceGeneticssourcepubdate2006pubdatevolume173volumeissue2issuefpage1075fpagelpage1087lpagexrefbibpubidlistpubid idtype="doi"10.1534genetics.106.055871pubidpubid idtype="pmcid"1526527pubidpubid idtype="pmpid" link="fulltext"16582432pubidpubidlistxrefbibbiblbibl id="B38"titlepNuclear phylogeny within Citrus (Rutaceae) and four related generaptitleaugausnmGarcia-LorsnmfnmAfnmauausnmCurksnmfnmFfnmauausnmMorillonsnmfnmRfnmauausnmAncillosnmfnmGfnmauausnmLurosnmfnmFfnmauausnmNavarrosnmfnmLfnmauausnmOllitraultsnmfnmPfnmauaugsourceAnn Botsourcepubdate2012pubdatexrefbibpubid idtype="doi"10.1093aobmcs227pubidxrefbibbiblbibl id="B39"augausnmGmittersnmfnmFGfnmauaugsourceNew Citrus Genome Sequence ResourcessourcepublisherSan Diego, CA: Plant & Animal Genome XX Conferencepublisherpubdate2012pubdatebiblbibl id="B40"titlepInfluence of aberrant observations on high-resolution linkage analysis outcomesptitleaugausnmBuetowsnmfnmKHfnmauaugsourceAm J Hum Genetsourcepubdate1991pubdatevolume49volumeissue5issuefpage985fpagelpage994lpagexrefbibpubidlistpubid idtype="pmcid"1683261pubidpubid idtype="pmpid"1928104pubidpubidlistxrefbibbiblbibl id="B41"titlepEffects of genotyping errors, missing values and segregation distortion in molecular marker data on the construction of linkage mapsptitleaugausnmHackettsnmfnmCAfnmauausnmBroadfootsnmfnmLBfnmauaugsourceHeredity (Edinb)sourcepubdate2003pubdatevolume90volumeissue1issuefpage33fpagelpage38lpagexrefbibpubid idtype="doi"10.1038sj.hdy.6800173pubidxrefbibbiblbibl id="B42"titlepThe sex-specific impact of meiotic recombination on nucleotide compositionptitleaugausnmPopasnmfnmAfnmauausnmSamollowsnmfnmPfnmauausnmGautiersnmfnmCfnmauausnmMouchiroudsnmfnmDfnmauaugsourceGenome Biol Evolsourcepubdate2012pubdatevolume4volumeissue3issuefpage412fpagelpage422lpagexrefbibpubidlistpubid idtype="doi"10.1093gbeevs023pubidpubid idtype="pmcid"3318449pubidpubid idtype="pmpid" link="fulltext"22417915pubidpubidlistxrefbibbiblbibl id="B43"titlepSex differences in recombination and mapping adaptationsptitleaugausnmLorchsnmfnmPDfnmauaugsourceGeneticasourcepubdate2005pubdatevolume123volumeissue1–2issuefpage39fpagelpage47lpagexrefbibpubid idtype="pmpid" link="fulltext"15881679pubidxrefbibbiblbibl id="B44"titlepSex ratio and unisexual sterility in hybrid animalsptitleaugausnmHaldanesnmfnmJBSfnmauaugsourceJ Genetsourcepubdate1922pubdatevolume12volumefpage101fpagelpage109lpagexrefbibpubid idtype="doi"10.1007BF02983075pubidxrefbibbiblbibl id="B45"titlepGenome-wide crossover distribution in Arabidopsis thaliana meiosis reveals sex-specific patterns along chromosomesptitleaugausnmGirautsnmfnmLfnmauausnmFalquesnmfnmMfnmauausnmDrouaudsnmfnmJfnmauausnmPereirasnmfnmLfnmauausnmMartinsnmfnmOCfnmauausnmMezardsnmfnmCfnmauaugsourcePLoS Genetsourcepubdate2011pubdatevolume7volumeissue11issuefpagee1002354fpagexrefbibpubidlistpubid idtype="doi"10.1371journal.pgen.1002354pubidpubid idtype="pmcid"3207851pubidpubid idtype="pmpid" link="fulltext"22072983pubidpubidlistxrefbibbiblbibl id="B46"titlepRecombination difference between sexes: a role for haploid selectionptitleaugausnmLenormandsnmfnmTfnmauausnmDutheilsnmfnmJfnmauaugsourcePLoS Biolsourcepubdate2005pubdatevolume3volumeissue3issuefpagee63fpagexrefbibpubidlistpubid idtype="doi"10.1371journal.pbio.0030063pubidpubid idtype="pmcid"1044830pubidpubid idtype="pmpid" link="fulltext"15736976pubidpubidlistxrefbibbiblbibl id="B47"titlepSex differences in rates of recombination and sexual selectionptitleaugausnmTriverssnmfnmRLfnmauaugsourceThe Evolution of SexsourcepublisherSunderlan, Massachusetts: Sinauer Associates IncpublishereditorMichod RE, Levin BReditorpubdate1988pubdatefpage270fpagelpage286lpagebiblbibl id="B48"titlepChiasma frequency effects of structural chromosome changeptitleaugausnmParkersnmfnmJSfnmauausnmPalmersnmfnmRWfnmauausnmWhitehornsnmfnmMAFfnmauausnmEdgarsnmfnmLAfnmauaugsourceChromosomasourcepubdate1982pubdatevolume85volumefpage673fpagelpage686lpagexrefbibpubid idtype="doi"10.1007BF00330780pubidxrefbibbiblbibl id="B49"titlepThe mismatch repair system reduces meiotic homeologous recombination and stimulates recombination-dependent chromosome lossptitleaugausnmChamberssnmfnmSRfnmauausnmHuntersnmfnmNfnmauausnmLouissnmfnmEJfnmauausnmBortssnmfnmRHfnmauaugsourceMol Cell Biolsourcepubdate1996pubdatevolume16volumeissue11issuefpage6110fpagelpage6120lpagexrefbibpubidlistpubid idtype="pmcid"231614pubidpubid idtype="pmpid" link="fulltext"8887641pubidpubidlistxrefbibbiblbibl id="B50"titlepThe effect of sequence divergence on recombination between direct repeats in ArabidopsisptitleaugausnmOppermansnmfnmRfnmauausnmEmmanuelsnmfnmEfnmauausnmLevysnmfnmAAfnmauaugsourceGeneticssourcepubdate2004pubdatevolume168volumeissue4issuefpage2207fpagelpage2215lpagexrefbibpubidlistpubid idtype="doi"10.1534genetics.104.032896pubidpubid idtype="pmcid"1448723pubidpubid idtype="pmpid" link="fulltext"15611187pubidpubidlistxrefbibbiblbibl id="B51"titlepThe impact of sequence divergence and DNA mismatch repair on homeologous recombination in ArabidopsisptitleaugausnmLisnmfnmLfnmauausnmJeansnmfnmMfnmauausnmBelzilesnmfnmFfnmauaugsourcePlant Jsourcepubdate2006pubdatevolume45volumeissue6issuefpage908fpagelpage916lpagexrefbibpubidlistpubid idtype="doi"10.1111j.1365-313X.2006.02657.xpubidpubid idtype="pmpid" link="fulltext"16507082pubidpubidlistxrefbibbiblbibl id="B52"titlepA genetic map of tomato based on BC(1) Lycopersicon esculentum x Solanum lycopersicoides reveals overall synteny but suppressed recombination between these homeologous genomesptitleaugausnmChetelatsnmfnmRTfnmauausnmMeglicsnmfnmVfnmauausnmCisnerossnmfnmPfnmauaugsourceGeneticssourcepubdate2000pubdatevolume154volumeissue2issuefpage857fpagelpage867lpagexrefbibpubidlistpubid idtype="pmcid"1460941pubidpubid idtype="pmpid" link="fulltext"10655236pubidpubidlistxrefbibbiblbibl id="B53"titlepTomato chromosome 6: effect of alien chromosomal segments on recombinant frequenciesptitleaugausnmLiharskasnmfnmTfnmauausnmWordragensnmfnmMfnmauausnmKammensnmfnmAfnmauausnmZabelsnmfnmPfnmauausnmKoornneefsnmfnmMfnmauaugsourceGenomesourcepubdate1996pubdatevolume39volumeissue3issuefpage485fpagelpage491lpagexrefbibpubidlistpubid idtype="doi"10.1139g96-062pubidpubid idtype="pmpid"18469910pubidpubidlistxrefbibbiblbibl id="B54"titlepGenetic mapping of an intergeneric citrus hybrid using molecular markersptitleaugausnmLurosnmfnmFfnmauausnmLorieuxsnmfnmMfnmauausnmLaigretsnmfnmFfnmauausnmBovesnmfnmJMfnmauausnmOllitraultsnmfnmPfnmauaugsourceFruits (Paris)sourcepubdate1994pubdatevolume49volumeissue56issuefpage404fpagelpage408lpagebiblbibl id="B55"titlepIntegration of trinucleotide microsatellites into a linkage map of CitrusptitleaugausnmKijassnmfnmJMHfnmauausnmThomassnmfnmMRfnmauausnmFowlersnmfnmJCSfnmauausnmRoosesnmfnmMLfnmauaugsourceTheor Appl Genetsourcepubdate1997pubdatevolume94volumeissue5issuefpage701fpagelpage706lpagexrefbibpubid idtype="doi"10.1007s001220050468pubidxrefbibbiblbibl id="B56"titlepSkewed RAPD markers in linkage maps of CitrusptitleaugausnmOliveirasnmfnmRPfnmauausnmAguilar-VildososnmfnmCIfnmauausnmCristofanisnmfnmMfnmauausnmMachadosnmfnmMAfnmauaugsourceGenet Mol Biolsourcepubdate2004pubdatevolume27volumeissue3issuefpage437fpagelpage441lpagexrefbibpubid idtype="doi"10.1590S1415-47572004000300021pubidxrefbibbiblbibl id="B57"titlepSegregation and linkage analyses in two complex populations derived from the citrus rootstock Cleopatra mandarin. Inheritance of seed reproductive traitsptitleaugausnmRagasnmfnmVfnmauausnmBernetsnmfnmGPfnmauausnmCarbonellsnmfnmEAfnmauausnmAsinssnmfnmMJfnmauaugsourceTree Genet Genomessourcepubdate2012pubdatevolume8volumeissue5issuefpage1061fpagelpage1071lpagexrefbibpubid idtype="doi"10.1007s11295-012-0486-7pubidxrefbibbiblbibl id="B58"titlepThe incompatibility gene system in citrusptitleaugausnmSoostsnmfnmRKfnmauaugsourceProc First Int Citrus Symp Volume 1sourcepublisherRiverside: Univ CaliforniapublishereditorChapmn Heditorpubdate1968pubdatefpage189fpagelpage190lpagebiblbibl id="B59"titlepQuantitative trait locus mapping can benefit from segregation distortionptitleaugausnmXusnmfnmSfnmauaugsourceGeneticssourcepubdate2008pubdatevolume180volumeissue4issuefpage2201fpagelpage2208lpagexrefbibpubidlistpubid idtype="doi"10.1534genetics.108.090688pubidpubid idtype="pmcid"2600952pubidpubid idtype="pmpid" link="fulltext"18957707pubidpubidlistxrefbibbiblbibl id="B60"titlepAssembly of polymorphic genomes: algorithms and application to Ciona savignyiptitleaugausnmVinsonsnmfnmJPfnmauausnmJaffesnmfnmDBfnmauausnmO'NeillsnmfnmKfnmauausnmKarlssonsnmfnmEKfnmauausnmStange-ThomannsnmfnmNfnmauausnmAndersonsnmfnmSfnmauausnmMesirovsnmfnmJPfnmauausnmSatohsnmfnmNfnmauausnmSatousnmfnmYfnmauausnmNusbaumsnmfnmCfnmauausnmBirrensnmfnmBfnmauausnmGalagansnmfnmJEfnmauausnmLandersnmfnmESfnmauaugsourceGenome Ressourcepubdate2005pubdatevolume15volumeissue8issuefpage1127fpagelpage1135lpagexrefbibpubidlistpubid idtype="doi"10.1101gr.3722605pubidpubid idtype="pmcid"1182225pubidpubid idtype="pmpid" link="fulltext"16077012pubidpubidlistxrefbibbiblbibl id="B61"augausnmRoosesnmfnmMLfnmauausnmNiedzsnmfnmRPfnmauausnmGmittersnmfnmFGfnmauausnmTimothysnmfnmJCfnmauausnmAbhayasnmfnmMDfnmauausnmJan-FangsnmfnmCfnmauausnmDanielsnmfnmSRfnmauaugsourceAnalysis of a 1.2× whole genome sequence of Citrus sinensissourcepublisherSan Diego, CA: Plant & Animal Genome XV Conferencepublisherpubdate2007pubdatebiblbibl id="B62"titlepDevelopment of a citrus genome-wide EST collection and cDNA microarray as resources for genomic studiesptitleaugausnmFormentsnmfnmJfnmauausnmGadeasnmfnmJfnmauausnmHuertasnmfnmLfnmauausnmAbizandasnmfnmLfnmauausnmAgustisnmfnmJfnmauausnmAlamarsnmfnmSfnmauausnmAlossnmfnmEfnmauausnmAndressnmfnmFfnmauausnmArribassnmfnmRfnmauausnmBeltransnmfnmJPfnmauausnmBerbelsnmfnmAfnmauausnmBlazquezsnmfnmMAfnmauausnmBrumossnmfnmJfnmauausnmCanassnmfnmLAfnmauausnmCercossnmfnmMfnmauausnmColmenero-FloressnmfnmJMfnmauausnmConesasnmfnmAfnmauausnmEstablessnmfnmBfnmauausnmGandiasnmfnmMfnmauausnmGarcia-MartinezsnmfnmJLfnmauausnmGimenosnmfnmJfnmauausnmGisbertsnmfnmAfnmauausnmGomezsnmfnmGfnmauausnmGonzalez-CandelassnmfnmLfnmauausnmGranellsnmfnmAfnmauausnmGuerrisnmfnmJfnmauausnmLafuentesnmfnmMTfnmauausnmMaduenosnmfnmFfnmauausnmMarcossnmfnmJFfnmauausnmMarquessnmfnmMCfnmauausnmMartinezsnmfnmFfnmauausnmMartinez-GodoysnmfnmMAfnmauausnmMirallessnmfnmSfnmauausnmMorenosnmfnmPfnmauausnmNavarrosnmfnmLfnmauausnmPallassnmfnmVfnmauausnmPerez-AmadorsnmfnmMAfnmauausnmPerez-VallesnmfnmJfnmauausnmPonssnmfnmCfnmauausnmRodrigosnmfnmIfnmauausnmRodriguezsnmfnmPLfnmauausnmRoyosnmfnmCfnmauausnmSerranosnmfnmRfnmauausnmSolersnmfnmGfnmauausnmTadeosnmfnmFfnmauausnmTalonsnmfnmMfnmauausnmTerolsnmfnmJfnmauausnmTrenorsnmfnmMfnmauausnmVaellosnmfnmLfnmauausnmVicentesnmfnmOfnmauausnmVidalsnmfnmCfnmauausnmZacariassnmfnmLfnmauausnmConejerosnmfnmVfnmauaugsourcePlant Mol Biolsourcepubdate2005pubdatevolume57volumeissue3issuefpage375fpagelpage391lpagexrefbibpubidlistpubid idtype="doi"10.1007s11103-004-7926-1pubidpubid idtype="pmpid" link="fulltext"15830128pubidpubidlistxrefbibbiblbibl id="B63"titlepAnalysis of 13000 unique Citrus clusters associated with fruit quality, production and salinity toleranceptitleaugausnmTerolsnmfnmJfnmauausnmConesasnmfnmAfnmauausnmColmenerosnmfnmJMfnmauausnmCercossnmfnmMfnmauausnmTadeosnmfnmFfnmauausnmAgustisnmfnmJfnmauausnmAlossnmfnmEfnmauausnmAndressnmfnmFfnmauausnmSolersnmfnmGfnmauausnmBrumossnmfnmJfnmauausnmIglesiassnmfnmDJfnmauausnmGotzsnmfnmSfnmauausnmLegazsnmfnmFfnmauausnmArgoutsnmfnmXfnmauausnmCourtoissnmfnmBfnmauausnmOllitraultsnmfnmPfnmauausnmDossatsnmfnmCfnmauausnmWinckersnmfnmPfnmauausnmMorillonsnmfnmRfnmauausnmTalonsnmfnmMfnmauaugsourceBMC Genomicssourcepubdate2007pubdatevolume8volumefpage31fpagexrefbibpubidlistpubid idtype="doi"10.11861471-2164-8-31pubidpubid idtype="pmcid"1796867pubidpubid idtype="pmpid" link="fulltext"17254327pubidpubidlistxrefbibbiblbibl id="B64"titlepA genome-wide 20 K citrus microarray for gene expression analysisptitleaugausnmMartinezGodoysnmfnmMAfnmauausnmMaurisnmfnmNfnmauausnmJuarezsnmfnmJfnmauausnmMarquessnmfnmMCfnmauausnmSantiagosnmfnmJfnmauausnmFormentsnmfnmJfnmauausnmGadeasnmfnmJfnmauaugsourceBMC Genomicssourcepubdate2008pubdatevolume9volumeissue318issuebiblbibl id="B65"titlepA rapid DNA isolation procedure for small quantities of fresh leaf tissueptitleaugausnmDoylesnmfnmJJfnmauausnmDoylesnmfnmJLfnmauaugsourcePhytochemical Bulletinsourcepubdate1987pubdatevolume19volumeissue1issuefpage11fpagelpage15lpagebiblbibl id="B66"titlepRAPD analysis in flax: optimization of yield and reproducibility using KlenTaq1 DNA polymerase, chelex 100 and gel purification of genomic DNAptitleaugausnmAldrichsnmfnmKJfnmauausnmCullissnmfnmCAfnmauaugsourcePlant Mol Biol Repsourcepubdate1993pubdatevolume11volumefpage128fpagelpage141lpagexrefbibpubid idtype="doi"10.1007BF02670471pubidxrefbibbiblbibl id="B67"titlepTetraploidization events by chromosome doubling of nucellar cells are frequent in apomictic citrus and are dependent on genotype and environmentptitleaugausnmAlezasnmfnmPfnmauausnmFroelichersnmfnmYfnmauausnmSchwarzsnmfnmSfnmauausnmAgustisnmfnmMfnmauausnmHernandezsnmfnmMfnmauausnmJuarezsnmfnmJfnmauausnmLurosnmfnmFfnmauausnmMorillonsnmfnmRfnmauausnmNavarrosnmfnmLfnmauausnmOllitraultsnmfnmPfnmauaugsourceAnn Botsourcepubdate2011pubdatevolume108volumeissue1issuefpage37fpagelpage50lpagexrefbibpubidlistpubid idtype="doi"10.1093aobmcr099pubidpubid idtype="pmcid"3119611pubidpubid idtype="pmpid" link="fulltext"21586529pubidpubidlistxrefbibbiblbibl id="B68"titlepMultilocus half-tetrad analysis and centromere mapping in citrus: evidence of SDR mechanism for 2n megagametophyte production and partial chiasma interference in mandarin cv 'Fortune'ptitleaugausnmCuencasnmfnmJfnmauausnmFroelichersnmfnmYfnmauausnmAlezasnmfnmPfnmauausnmJuarezsnmfnmJfnmauausnmNavarrosnmfnmLfnmauausnmOllitraultsnmfnmPfnmauaugsourceHereditysourcepubdate2011pubdatevolume107volumeissue5issuefpage462fpagelpage470lpagexrefbibpubidlistpubid idtype="doi"10.1038hdy.2011.33pubidpubid idtype="pmcid"3199928pubidpubid idtype="pmpid" link="fulltext"21587302pubidpubidlistxrefbibbiblbibl id="B69"titlepEvidence for non-disomic inheritance in a Citrus interspecific tetraploid somatic hybrid between C. reticulata and C. limon using SSR markers and cytogenetic analysisptitleaugausnmKamirisnmfnmMfnmauausnmStiftsnmfnmMfnmauausnmSrairisnmfnmIfnmauausnmCostantinosnmfnmGfnmauausnmEl MoussadiksnmfnmAfnmauausnmHmyenesnmfnmAfnmauausnmBakrysnmfnmFfnmauausnmOllitraultsnmfnmPfnmauausnmFroelichersnmfnmYfnmauaugsourcePlant Cell Repsourcepubdate2011pubdatevolume30volumeissue8issuefpage1415fpagelpage1425lpagexrefbibpubidlistpubid idtype="doi"10.1007s00299-011-1050-xpubidpubid idtype="pmpid" link="fulltext"21409551pubidpubidlistxrefbibbiblbibl id="B70"titlepSequence analysis of a 282-kilobase region surrounding the citrus tristeza virus resistance gene (Ctv) locus in Poncirus trifoliata LptitleaugausnmYangsnmfnmZNfnmauausnmYesnmfnmXRfnmauausnmMolinasnmfnmJfnmauausnmRoosesnmfnmMLfnmauausnmMirkovsnmfnmTEfnmauaugsourceRaf. Plant Physiolsourcepubdate2003pubdatevolume131volumeissue2issuefpage482fpagelpage492lpagexrefbibpubid idtype="doi"10.1104pp.011262pubidxrefbibbiblbibl id="B71"titlepDevelopment and characterization of microsatellite markers in CitrusptitleaugausnmAhmadsnmfnmRfnmauausnmStrusssnmfnmDfnmauausnmSouthwicksnmfnmSMfnmauaugsourceJ Am Soc Hortic Scisourcepubdate2003pubdatevolume128volumefpage584fpagelpage590lpagebiblbibl id="B72"titlepEstimation of recombination frequencies and construction of RFLP linkage maps in plants from crosses between heterozygous parentsptitleaugausnmRittersnmfnmEfnmauausnmGebhardtsnmfnmCfnmauausnmSalaminisnmfnmFfnmauaugsourceGeneticssourcepubdate1990pubdatevolume125volumefpage645fpagelpage654lpagexrefbibpubidlistpubid idtype="pmcid"1204090pubidpubid idtype="pmpid" link="fulltext"1974227pubidpubidlistxrefbibbiblbibl id="B73"titlepCitrus genome mapping with molecular markers: two maps obtained by segregation analysis of progeny of one intergeneric crossptitleaugausnmLurosnmfnmFfnmauausnmLaigretsnmfnmFfnmauausnmLorieuxsnmfnmMfnmauausnmOllitraultsnmfnmPfnmauaugsourceProc Intl Soc Citricultsourcepubdate1996pubdatevolume2volumefpage862fpagelpage866lpagebiblbibl id="B74"augausnmVan OoijensnmfnmJWfnmauaugsourceJoinMap® 4, software for the calculation of genetic linkage maps in experimental populationssourcepublisherWageningen, Netherlands: Kyazma B.Vpublisherpubdate2006pubdateurlhttp:www.kyazma.nlindex.phpmc.JoinMapsc.Generalurlxrefbibpubid idtype="pmpid"23315811pubidxrefbibbiblbibl id="B75"titlepSMOOTH: a statistical method for successful removal of genotyping errors from high-density genetic linkage dataptitleaugausnmvan OssnmfnmHfnmauausnmStamsnmfnmPfnmauausnmVissersnmfnmRGfnmauausnmvan EcksnmfnmHJfnmauaugsourceTheor Appl Genetsourcepubdate2005pubdatevolume112volumeissue1issuefpage187fpagelpage194lpagexrefbibpubidlistpubid idtype="doi"10.1007s00122-005-0124-ypubidpubid idtype="pmpid" link="fulltext"16258753pubidpubidlistxrefbibbiblbibl id="B76"titlepEfficient and accurate construction of genetic linkage maps from the minimum spanning tree of a graphptitleaugausnmWusnmfnmYfnmauausnmBhatsnmfnmPRfnmauausnmClosesnmfnmTJfnmauausnmLonardisnmfnmSfnmauaugsourcePLoS Genetsourcepubdate2008pubdatevolume4volumeissue10issuefpagee1000212fpagexrefbibpubidlistpubid idtype="doi"10.1371journal.pgen.1000212pubidpubid idtype="pmcid"2556103pubidpubid idtype="pmpid" link="fulltext"18846212pubidpubidlistxrefbibbiblbibl id="B77"titlepMapChart: software for the graphical presentation of linkage maps and QTLsptitleaugausnmVoorripssnmfnmREfnmauaugsourceJ Heredsourcepubdate2002pubdatevolume93volumefpage77fpagelpage78lpagexrefbibpubidlistpubid idtype="doi"10.1093jhered93.1.77pubidpubid idtype="pmpid" link="fulltext"12011185pubidpubidlistxrefbibbiblbibl id="B78"titlepGGT 2.0: versatile software for visualization and analysis of genetic dataptitleaugausnmvan BerloosnmfnmRfnmauaugsourceJ Heredsourcepubdate2008pubdatevolume99volumeissue2issuefpage232fpagelpage236lpagexrefbibpubidlistpubid idtype="doi"10.1093jheredesm109pubidpubid idtype="pmpid" link="fulltext"18222930pubidpubidlistxrefbibbiblrefgrp
bm
art



PAGE 1

SNPs SSRs InDels Ollitrault et al. (2012) A reference genetic map of C. clementina hort ex Tan.; citrus evolution inferences from comparative mapping BMC Genomics .2012, 13:593. Additional file 4: Nules clementine genetic map



PAGE 1

Ollitrault et al. (2012) A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inf erences from comparative mappin g BMC Genomics.2012, 13:593. Additional File 3 : Conserved linear order between male and female Clementine genetic maps (x axis male map location in cM; y axis female map location in cM)


xml version 1.0 encoding utf-8 standalone no
mets ID sort-mets_mets OBJID sword-mets LABEL DSpace SWORD Item PROFILE METS SIP Profile xmlns http:www.loc.govMETS
xmlns:xlink http:www.w3.org1999xlink xmlns:xsi http:www.w3.org2001XMLSchema-instance
xsi:schemaLocation http:www.loc.govstandardsmetsmets.xsd
metsHdr CREATEDATE 2013-01-16T04:14:46
agent ROLE CUSTODIAN TYPE ORGANIZATION
name BioMed Central
dmdSec sword-mets-dmd-1 GROUPID sword-mets-dmd-1_group-1
mdWrap SWAP Metadata MDTYPE OTHER OTHERMDTYPE EPDCX MIMETYPE textxml
xmlData
epdcx:descriptionSet xmlns:epdcx http:purl.orgeprintepdcx2006-11-16 xmlns:MIOJAVI
http:purl.orgeprintepdcxxsd2006-11-16epdcx.xsd
epdcx:description epdcx:resourceId sword-mets-epdcx-1
epdcx:statement epdcx:propertyURI http:purl.orgdcelements1.1type epdcx:valueURI http:purl.orgeprintentityTypeScholarlyWork
http:purl.orgdcelements1.1title
epdcx:valueString A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inferences from comparative mapping
http:purl.orgdctermsabstract
Abstract
Background
Most modern citrus cultivars have an interspecific origin. As a foundational step towards deciphering the interspecific genome structures, a reference whole genome sequence was produced by the International Citrus Genome Consortium from a haploid derived from Clementine mandarin. The availability of a saturated genetic map of Clementine was identified as an essential prerequisite to assist the whole genome sequence assembly. Clementine is believed to be a ‘Mediterranean’ mandarin × sweet orange hybrid, and sweet orange likely arose from interspecific hybridizations between mandarin and pummelo gene pools. The primary goals of the present study were to establish a Clementine reference map using codominant markers, and to perform comparative mapping of pummelo, sweet orange, and Clementine.
Results
Five parental genetic maps were established from three segregating populations, which were genotyped with Single Nucleotide Polymorphism (SNP), Simple Sequence Repeats (SSR) and Insertion-Deletion (Indel) markers. An initial medium density reference map (961 markers for 1084.1 cM) of the Clementine was established by combining male and female Clementine segregation data. This Clementine map was compared with two pummelo maps and a sweet orange map. The linear order of markers was highly conserved in the different species. However, significant differences in map size were observed, which suggests a variation in the recombination rates. Skewed segregations were much higher in the male than female Clementine mapping data. The mapping data confirmed that Clementine arose from hybridization between ‘Mediterranean’ mandarin and sweet orange. The results identified nine recombination break points for the sweet orange gamete that contributed to the Clementine genome.
Conclusions
A reference genetic map of citrus, used to facilitate the chromosome assembly of the first citrus reference genome sequence, was established. The high conservation of marker order observed at the interspecific level should allow reasonable inferences of most citrus genome sequences by mapping next-generation sequencing (NGS) data in the reference genome sequence. The genome of the haploid Clementine used to establish the citrus reference genome sequence appears to have been inherited primarily from the ‘Mediterranean’ mandarin. The high frequency of skewed allelic segregations in the male Clementine data underline the probable extent of deviation from Mendelian segregation for characters controlled by heterozygous loci in male parents.
http:purl.orgdcelements1.1creator
Ollitrault, Patrick
Terol, Javier
Chen, Chunxian
Federici, Claire T
Lotfy, Samia
Hippolyte, Isabelle
Ollitrault, Frédérique
Bérard, Aurélie
Chauveau, Aurélie
Cuenca, Jose
Costantino, Gilles
Kacar, Yildiz
Mu, Lisa
Garcia-Lor, Andres
Froelicher, Yann
Aleza, Pablo
Boland, Anne
Billot, Claire
Navarro, Luis
Luro, François
Roose, Mikeal L
Gmitter, Frederick G
Talon, Manuel
Brunel, Dominique
http:purl.orgeprinttermsisExpressedAs epdcx:valueRef sword-mets-expr-1
http:purl.orgeprintentityTypeExpression
http:purl.orgdcelements1.1language epdcx:vesURI http:purl.orgdctermsRFC3066
en
http:purl.orgeprinttermsType
http:purl.orgeprinttypeJournalArticle
http:purl.orgdctermsavailable
epdcx:sesURI http:purl.orgdctermsW3CDTF 2012-11-05
http:purl.orgdcelements1.1publisher
BioMed Central Ltd
http:purl.orgeprinttermsstatus http:purl.orgeprinttermsStatus
http:purl.orgeprintstatusPeerReviewed
http:purl.orgeprinttermscopyrightHolder
Patrick Ollitrault et al.; licensee BioMed Central Ltd.
http:purl.orgdctermslicense
http://creativecommons.org/licenses/by/2.0
http:purl.orgdctermsaccessRights http:purl.orgeprinttermsAccessRights
http:purl.orgeprintaccessRightsOpenAccess
http:purl.orgeprinttermsbibliographicCitation
BMC Genomics. 2012 Nov 05;13(1):593
http:purl.orgdcelements1.1identifier
http:purl.orgdctermsURI http://dx.doi.org/10.1186/1471-2164-13-593
fileSec
fileGrp sword-mets-fgrp-1 USE CONTENT
file sword-mets-fgid-0 sword-mets-file-1
FLocat LOCTYPE URL xlink:href 1471-2164-13-593.xml
sword-mets-fgid-1 sword-mets-file-2 applicationpdf
1471-2164-13-593.pdf
sword-mets-fgid-3 sword-mets-file-3
1471-2164-13-593-S9.PDF
sword-mets-fgid-4 sword-mets-file-4
1471-2164-13-593-S7.PDF
sword-mets-fgid-5 sword-mets-file-5
1471-2164-13-593-S4.PDF
sword-mets-fgid-6 sword-mets-file-6 applicationvnd.openxmlformats-officedocument.spreadsheetml.sheet
1471-2164-13-593-S10.XLSX
sword-mets-fgid-7 sword-mets-file-7
1471-2164-13-593-S5.PDF
sword-mets-fgid-8 sword-mets-file-8
1471-2164-13-593-S1.XLSX
sword-mets-fgid-9 sword-mets-file-9
1471-2164-13-593-S11.PDF
sword-mets-fgid-10 sword-mets-file-10
1471-2164-13-593-S8.PDF
sword-mets-fgid-11 sword-mets-file-11
1471-2164-13-593-S3.PDF
sword-mets-fgid-12 sword-mets-file-12
1471-2164-13-593-S6.PDF
sword-mets-fgid-13 sword-mets-file-13
1471-2164-13-593-S2.XLSX
structMap sword-mets-struct-1 structure LOGICAL
div sword-mets-div-1 DMDID Object
sword-mets-div-2 File
fptr FILEID
sword-mets-div-3
sword-mets-div-4
sword-mets-div-5
sword-mets-div-6
sword-mets-div-7
sword-mets-div-8
sword-mets-div-9
sword-mets-div-10
sword-mets-div-11
sword-mets-div-12
sword-mets-div-13
sword-mets-div-14


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E8G4UDGWM_PSL1YU INGEST_TIME 2013-03-05T20:17:54Z PACKAGE AA00013683_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

SNPs SSRs InDels Ollitrault et al. (2012) A reference genetic map of C. clementina hort ex Tan.; citrus evolution inferences from comparative mapping BMC Genomics .2012, 13:593 Additional file 6: Pink pummelo genetic map



PAGE 1

RESEARCHARTICLEOpenAccessAreferencegeneticmapof C.clementina hort.ex Tan.;citrusevolutioninferencesfromcomparative mappingPatrickOllitrault1,2*,JavierTerol3,ChunxianChen4,ClaireTFederici5,SamiaLotfy1,6,IsabelleHippolyte1, FrdriqueOllitrault2,AurlieBrard7,AurlieChauveau7,JoseCuenca2,GillesCostantino8,YildizKacar9,LisaMu5, AndresGarcia-Lor2,YannFroelicher1,PabloAleza2,AnneBoland10,ClaireBillot1,LuisNavarro2,FranoisLuro8, MikealLRoose5,FrederickGGmitter4,ManuelTalon3andDominiqueBrunel7AbstractBackground: Mostmoderncitruscultivarshaveaninterspecificorigin.Asafoundationalsteptowardsdeciphering theinterspecificgenomestructures,areferencewholegenomesequencewasproducedbytheInternationalCitrus GenomeConsortiumfromahaploidderivedfromClementinemandarin.Theavailabilityofasaturatedgeneticmap ofClementinewasidentifiedasanessentialprerequisitetoassistthewholegenomesequenceassembly. Clementineisbelievedtobea ‘ Mediterranean ’ mandarinsweetorangehybrid,andsweetorangelikelyarose frominterspecifichybridizationsbetweenmandarinandpummelogenepools.Theprimarygoalsofthepresent studyweretoestablishaClementinereferencemapusingcodominantmarkers,andtoperformcomparative mappingofpummelo,sweetorange,andClementine. Results: Fiveparentalgeneticmapswereestablishedfromthreesegregatingpopulations,whichweregenotyped withSingleNucleotidePolymorphism(SNP),SimpleSequenceRepeats(SSR)andInsertion-Deletion(Indel)markers. Aninitialmediumdensityreferencemap(961markersfor1084.1cM)oftheClementinewasestablishedby combiningmaleandfemaleClementinesegregationdata.ThisClementinemapwascomparedwithtwopummelo mapsandasweetorangemap.Thelinearorderofmarkerswashighlyconservedinthedifferentspecies.However, significantdifferencesinmapsizewereobserved,whichsuggestsavariationintherecombinationrates.Skewed segregationsweremuchhigherinthemalethanfemaleClementinemappingdata.Themappingdataconfirmed thatClementinearosefromhybridizationbetween ‘ Mediterranean ’ mandarinandsweetorange.Theresults identifiedninerecombinationbreakpointsforthesweetorangegametethatcontributedtotheClementine genome. Conclusions: Areferencegeneticmapofcitrus,usedtofacilitatethechromosomeassemblyofthefirstcitrus referencegenomesequence,wasestablished.Thehighconservationofmarkerorderobservedattheinterspecific levelshouldallowreasonableinferencesofmostcitrusgenomesequencesbymappingnext-generation sequencing(NGS)datainthereferencegenomesequence.ThegenomeofthehaploidClementineusedto establishthecitrusreferencegenomesequenceappearstohavebeeninheritedprimarilyfromthe ‘ Mediterranean ’ mandarin.ThehighfrequencyofskewedallelicsegregationsinthemaleClementinedataunderlinetheprobable extentofdeviationfromMendeliansegregationforcharacterscontrolledbyheterozygouslociinmaleparents. Keywords: C.clementina C.sinensis C.maxima ,SSRs,SNPs,Indels,Geneticmaps *Correspondence: patrick.ollitrault@cirad.fr1CIRAD,UMRAGAP,F-34398Montpellier,France2IVIA,CentroProteccionVegetalyBiotechnologia,Ctra.Moncada-Nquera Km4.5,46113Moncada,Valencia,Spain Fulllistofauthorinformationisavailableattheendofthearticle 2012Ollitraultetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycited.Ollitrault etal.BMCGenomics 2012, 13 :593 http://www.biomedcentral.com/1471-2164/13/593

PAGE 2

BackgroundCitrusfruitsweredomesticatedinSouthEastAsiaseveral thousandyearsagoandsubsequentlyspreadthroughout theworld.Today,theareaofcitruscultivationisprimarily foundbetweenthelatitudesof40Nand40S,andglobal citrusproductionhasreached122Mtonnes[1].Theproductionofsweetorange,theleadingvarietaltype, approachescloseto69Mtonnes[1].Smallcitrusfruits (mandarin-like)arepreponderantinChinaandveryimportantintheMediterraneanBasinwhereClementineis themaincultivar. Despitecontroversial Citrus classifications,mostauthors nowagreeontheoriginofcultivatedcitrusspecies.Scora [2]andBarrettandRhodes[3]werethefirsttosuggest thatthreeprimary Citrus species (C.medica L. – citrons, C.reticulata Blanco – mandarins,and C.maxima L. Osbeck – pummelos)weretheancestorsofmostcultivatedcitrus.Thedifferentiationbetweenthesesexually compatibletaxacanbeexplainedviathefoundationeffect inthreegeographiczonesandbyaninitialallopatricevolution[2,4].Othercultivatedspecies(referredtohereafter assecondaryspecies)suchas C.aurantium L.(sourorange), C.sinensis (L.)Osb.(sweetorange), C.paradisi Macf.(grapefruit), C.clementina hort.ExTan.(Clementine)and C.limon Osb.(lemon)originatedlaterthrough hybridizationandalimitednumberofsexualrecombinationeventsamongthebasictaxa.Molecularmarker studies[5-8]generallysupporttheroleofthesethreetaxa asancestorsofcultivated Citrus .Furthermore,someof thesestudies[8-10]highlightedtheprobablecontribution ofafourthtaxon, C.micrantha Wester,astheancestorof somelimes[ C.aurantifolia (Christm.)Swingle]. Ingeneral, Citrus speciesarediploidwithabasic chromosomenumber x =9[11]. Citrus specieshave smallgenomes.Whileestimatingcitrusgenomesizeby flowcytometry,Ollitraultetal.[12]foundsignificant genomesizevariationbetweencitrusspecies.Thelargest andsmallestgenomeswere C.medica (averagevalueof 398Mb/haploidgenome)and C.reticulata (average valueof360Mb/haploidgenome),respectively. C.maxima hadanintermediategenomesize,withanaverage valueof383Mb/haploidgenome.Interestingly,the secondaryspeciespresentedintermediatevaluesbetweentheirputativeancestralparentaltaxa, C.sinensis (370Mb), C.aurantium (368Mb), C.paradisi ,(381Mb) and C.limon (380Mb)perhaploidgenome. Asmentionedpreviously,mostmoderncultivarshave aninterspecificoriginandtheirgenomescanbeconsideredmosaicsoflargeDNAfragmentsinheritedfromthe basictaxa[7].Thesecultivarsaregenerallyhighlyheterozygous[6,7].The C.maxima and C.reticulata gene poolscontributedtothegenesisofmostoftheeconomicallyimportantspeciesandcultivarsincludingsweet andsouroranges,grapefruits,tangors(mandarinsweet orangehybrids),tangelos(mandaringrapefruithybrids) andlemons[6,7,9].Barkleyetal.andGarcia-Loretal. [10,11]estimatedtherelativecontributionsofprimary speciestomoderncultivars.Somediscrepancieshavebeen observedbetweenthesestudies,andthedetailedinterspecificgenomeorganizationofcultivatedsecondaryspeciesandmoderncultivarsisstilllargelyunknown.Asafoundationalsteptowardsdecipheringthephylogeneticstructuresofcitrusgenomesandthemolecularbasesof phenotypicvariation,areferencewholegenomesequence ofahaploidderivedfromClementinewasproducedand iscurrentlybeingrevisedbytheInternationalCitrusGenomeConsortium(ICGC)[13,14].TheClementinemandarinisaninterspecifichybridthatwasselectedonecentury agoinAlgeriabyFatherClementasachanceoffspring amongseedlingsofthe ‘ Mediterranean ’ mandarin( C.reticulata )[15].Sincethattime,theClementinehasbeen vegetativelypropagatedbygrafting.InarecentlargeSNP diversitysurvey,Ollitraultetal.[8]confirmedthatthe Clementineisa ‘ Mediterranean ’ mandarinsweetorange hybrid(tangor).Thisconclusionisinagreementwiththe hypothesisofDengetal.andNicolosietal.[9,16]The supposedparentalrelationshipsbetweenClementine, sweetorange,pummeloandmandarinaresummarizedin Figure1.TheClementinegenomesizeisestimatedtobe 367Mb/haploidgenome[12]. TheICGCidentifiedtheconstructionofasaturated geneticmapofClementineasanessentialprerequisiteto improvethesequenceassemblyofthehaploidClementine referencegenome.Comparedwithothercrops,genetic mappingincitrusisrelativelylesswelldeveloped.The partialgeneticmapsbuiltwithcodominantmarkers C. reticulata (Mandarins) C. maxima (Pummelos) Interspecific hybridizations C.sinensis (Sweet oranges) C.clementina (Clementine) Figure1 Assumedparentagerelationshipsbetween C. reticulata C.maxima C.sinensis and C.clementina. From Ollitraultetal.[8]. Ollitrault etal.BMCGenomics 2012, 13 :593 Page2of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 3

(primarilySSRs)[17-19]encompassaround150markers, whilemapsbasedondominantmarkerssuchasAFLPs, [20]SRAPs,ISSRs,andRAPDs[21]includeslightlymore than200markers.Moreover,fewofthemappedmarkers havebeenpublishedinGenBank(orotherpublicnucleotidedatabases).Withinthelast15years,thecitruscommunitydevelopedSimpleSequenceRepeat(SSR)markers withreferencesequencesthatweredepositedinpublic databases.WhilealimitednumberofSSRmarkerswere obtainedfromgenomiclibraries[6,22-24],theimplementationoflargeESTdatabasesallowedthedevelopmentof manymoreSSRmarkers[25,26],andadditionalmarkers havebeendevelopedfromClementineBACsendsequencing(BES;[27-29]).FromthesameClementineBESdatabase,Ollitraultetal.[30]developed33Indelmarkersto contributetoClementinegeneticmapping.Despitethese internationalefforts,thenumberofavailableheterozygous SSRsandIndelsinClementinewasstillinsufficienttoestablishasaturatedClementinegeneticmap.SNPmarkers arewelladaptedforhighthroughputmethodsformarker saturation.Ollitraultetal.[8]tookadvantageoftheClementineBESdatabase[27]toidentifySNPsheterozygousin Clementine,andaGoldenGateSNPsarraywasdeveloped. Interestingly,63%ofthevalidatedSNPmarkerswereheterozygousinthesweetorange.Therefore,theseSNPscan beusedforcomparativemappingbetweentheClementine andsweetorange. Theprimarygoalsofthepresentstudywere:(i)toestablishasaturatedreferencemapofClementineusingcodominantmarkerswithsequencesavailableinpublic databases;(ii)toperformcomparativemappingbetween sweetorange,pummeloandClementine;and(iii)to localizethecrossovereventsthatproducedthesweetorangegametethatcontributedtotheClementinegenome, andthoseinvolvedinthegameteformationthatgaverise tothehaploidClementine[13]usedforthecitrusreferencewholegenomesequence[14].Theclementinereferencemapandthepummelomapwereestablishedfrom twointerspecifichybridpopulations( ‘ Chandler ’ pummelo ‘ Nules ’ Clementine – CPNC(156hybrids)and ‘ Nules ’ Clementine ‘ Pink ’ pummelo – NCPP,(140hybrids)) with1166codominantmarkers.Thesweetorangemap anchoredwiththeClementinemapwasestablishedby genotyping582segregatingSNPmarkersfrom147progenyfromcrossesbetweensweetorangeandtrifoliateorange(SOTO).Thisstudyalsoyieldedinformation regardingthemagnitudeanddistributionofsegregation distortionwithinthedifferentcrosses.ResultsPolymorphismandallelecallsfortheSNPmarkersForallSNPs,genotypingwasvisuallyconfirmed,taking advantageofthedistributionofthesegregatingprogeniesrelativetotheparentalpositions.Thisobservation wasconductedindividuallyforeachplateof96genotypes.Plate/markercombinationswithunclearclustering ofgenotypeswereremovedfromtheanalysis.Nodifferenceswerefoundbetweenthedifferentsweetorange parentsorbetweenthetrifoliateorangeparentsofthe SOTOprogenies.Therefore,allindividualsresulting fromthedifferentcrosseswereconsideredassinglefamily.Fortheselecteddata,themarkerswereassignedto differentcategoriesbasedontheobservedsegregations, thedetectionofnullallelesand,finally,thetypeofsegregationassumedaccordingtotheJoinMapnomenclature(Tables1and2). Theobservedsegregationwithinaprogenypermitted identificationofthenullallelesintermsofhomozygosity (00)orheterozygosity(A0)intheparents(Figure2). Thesetwoconfigurationsofnullalleleswerefoundfor0 and31markersintheClementine,69and19inChandler, 78and17inPink,0and72insweetorange,and128and 0intrifoliateorange,respectively(Table2andAdditional file1).MarkerswithA0BBandA000configurations weretreatedasandthereciprocalconfigurationsweretreatedas.Markerswiththe ABA0configurationwereanalyzedasbyconsidering(i)BAandB0hybridsasgenotypes,(ii)the undistinguishableAAandA0as;thus,considering onlythesegregationoftheABparent.Reciprocalconfigurationsweretreatedas. Consideringallmarkers(withandwithoutnullalleles), thefirstcategoryconsistedofmarkersheterozygousin oneparentandhomozygousintheother(classifiedas orinJoinMap).Thesemarkers representedthemajorityoftheusefulmarkers(with606 and6inCPNC,8 and644inNCPPand1and572 inSOTO).Thesemarkerswereonlymapped fortheheterozygousparents.AsSNPmarkersarediallelic, theonlyotherconformationencounteredwas, wherethetwoparentsdisplayedthesameheterozygosity. Thesemarkerswerenotfrequent,and29,24and9markerswithsuchaconfigurationwereobservedforCPNC, NCPPandSOTO,respectively.Consideringourstrategytodevelopindependentmapsforeachparent,thelack Table1Joinmapcodificationforthedifferentallelic configurationsencounteredforSNPmarkersAAABBBA0B000 AA – lmxll – lmxlllmxll – AB nnxnphkxhknnxnpnnxnpnnxnpnnxnp BB – lmxll – lmxlllmxll – A0 nnxnplmxllnnxnpNONOnnxnp B0 nnxnplmxllnnxnpNONOnnxnp 00 – lmxll – lmxlllmxll –NO:Nonobservedconfiguration.Ollitrault etal.BMCGenomics 2012, 13 :593 Page3of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 4

ofinformationwhenassigningtheparentalalleleforeach hybrid(onlypossibleforthehomozygoushybridand,thus, onlyhalfofthepopulation)andtherelativelylownumber ofmarkerswiththisconformation,thesemarkerswereremovedfromthemappinganalysis.SSRandIndelgenotypingThegenotypingoftheCPNCpopulationwasperformed intheframeworkoftheICGC.SSRanalysiswasperformed bysixinternationalgroups(UniversityofCaliforniaat Riverside;UniversityofFlorida;UniversityofCukurova – Turkey;IVIA – Spain;INRA – FranceandCIRAD – France, withthecollaborationofINRAM – Morocco).ThegenotypingoftheNCPPwasperformedatCIRADandIVIA. HomozygousorheterozygousnullallelesintheparentswereassumedfromtheobservedSSRsegregations. Thesetwoconfigurationsofnullalleleswerefoundin2 and10markersinClementine,9and4in ‘ Chandler ’ and 10and5in ‘ Pink ’ ,respectively(Table2andAdditional file1).LocicontainingnullallelesweretreatedaspreviouslydescribedforSNPmarkers.Withmultiallelic SSRs,sixallelicconfigurationswerepossible.AAABor CCABweretreatedequallyasbyJoinMap, andthetworeciprocalconfigurationswereassumedtobe .Fullyheterozygousconfigurationswithfour alleles(ABCD)orthreealleles(ABBC)werecoded and,respectively.AmongtheSSRs successfullygenotyped,thefiveJoinMapconfigurations (nnnp,lmll,hkhk,efeg,andabcd)were encounteredfor130,34,1,43and70markersinCPNC and24,79,3,19and26markersinNCPPprogenies,respectively.AsforSNPs,theveryfewmarkerswiththe hkhkconfigurationwereremovedfromtheanalysis. Thennnpandlmllmarkersweremappedforthe maleorfemaleparents,respectively.Thefullyheterozygousmarkers(and)weremapped forthetwoparentsand,therefore,allowedanchoringof themaleandfemaleparentmaps. OnlyfourIndelmarkersdisplayedhomozygousnull allelesin ‘ Chandler ’ pummelo(Table2andAdditional file1).Noheterozygousnullalleleswereindicatedin ‘ Nules ’ Clementine, ‘ Chandler ’ or ‘ Pink ’ pummelos.For Indels,thefiveJoinMapconfigurations(nnnp,lmll, hkhk,efeg,andabcd)wereencounteredfor20,2, Table2SegregationtypesobservedforthedifferentparentsandprogeniesSSRsIndelsSNPsTotal NullalleleNulesClementineHom2002 Het1003141 ChandlerpummeloHom946982 Het401923 PinkPummeloHom1007888 Het501722 SweetOrangeHom--00 Het--7272 trifoliateorangeHom--128128 Het--00 JoinMapSegregationtypeChandlerxNulesnnxnp13020606756 lmxll342642 hkxhk102930 efxeg433046 abxcd700070 NulesxPinknnxnp242834 lmxll7915644738 hkxhk312428 efxeg195024 abxcd260026 Orangextrifoliateorangennxnp--11 lmxll--572572 hkxhk--99 efxeg--00 abxcd--00 Ollitrault etal.BMCGenomics 2012, 13 :593 Page4of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 5

0,3and0markersinCPNCandfor2,15,1,5,and0 markersinNCPP,respectively.ParentalgeneticmappingParentalgametegenotypesweregeneratedfromthediploiddatausingnnnp,lmll,efegandabcdscored markers.SNP,SSRandIndelgenotypingdataresultedin amatrixof156individualsand872markersformale Clementine(CPNCprogeny),156individualsand158 markersfor ‘ Chandler ’ pummelo(CPNCprogeny),140 individualsand788markersforfemaleClementine (NCPPprogeny),140individualsand84markersfor ‘ Pink ’ pummelo(NCPPprogeny),and572markersfor 147hybridsforsweetorange(SOTOprogeny).Allof NC: AB CP and PP: 00 NC x PP hybrids: A0 NC x PP hybrids: B0 NC: ABPP: B0 NC x PP hybrids: A0 NC x PP hybrids: BB + B0 NC x PP hybrids: AB a bNorm Intensity (A) Norm Intensit y (A)NormIntensity (B) NormIntensity (B) Figure2 ExampleofsegregationprofilesforSNPmarkerswithnullallelesforoneparentandheterozygousfortheother. ( a )AB00; ( b )ABB0. Ollitrault etal.BMCGenomics 2012, 13 :593 Page5of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 6

thesematriceswereanalyzedusingJoinMap4.Thelinkagegroupnumberingwasperformedaccordingtothe sweetorangegeneticmapestablishedbytheUScitrus genomeworkinggroup(MikealRoose;personalcommunication).Themainresultsoftheindividualmapping analysesaregiveninTable3,anddetailedresultsarepresentedinAdditionalfile2.‘ Nules ’ ClementinegeneticmapThereferenceClementinegeneticmapwasobtainedin twosteps.Inthefirststep,maleandfemaleClementine datawereanalyzedseparately. MaleClementinemap:Amongthe872segregating markers,869(606SNPs,240SSRsand23Indels)were distributedintoninelinkagegroups(LGs)whilethree markersremainedungrouped.MostoftheLGconserved theirintegrityuntilLOD=10.OnlyLG8wasdisruptedin threesub-groupsatLOD9.Thethreesub-groupscorrespondedtothreeregionsofLG8separatedbyrelatively wideintervalswithoutintermediatemarkers.When mappedindividuallytheydisplayedconservedorderand verysimilardistancescomparedwiththeentireLG8. Themapspanned1164.26cM.TheClementinemale gametesexhibited57%ofthemarkersdeviatingfrom theexpectedMendelianratio(witha0.05probability threshold).Skewedmarkersweregroupedwithinseveral partsofthegenome.TheskewedmarkerswereunequallyspreadthroughoutthelinkagegroupswithrelativelylowfrequenciesinLG2(3.6%)andLG8(13.5%), butwithveryhighfrequenciesinLG4(71.6%),LG5 (83.1%),LG7(74.5%)andLG9(85.6%).Thisdistribution ofsegregationdistortionsisdetailedbelowincomparisonwiththeotherparents. FemaleClementinemap:Amongthe788markerssuccessfullygenotyped,783(642SNPs,122SSRsand21 Indels)weregroupedinnineLGs,whilefiveremained ungrouped.MostoftheLGconservedtheirintegrityuntil LOD=10.OnlyLG8wasdisruptedintwosub-groupsat LOD=8correspondingtotworegionsofleLG8separated byarelativelywideintervalwithoutmarker.When mappedindividuallythesub-groupsdisplayedconserved orderandverysimilardistancescomparedwiththeentire LG8.Themapsizewas923.5cM.Thefrequencyofskewed markers(13.0%)wasmuchlowerthanthatobserved amongmalegametes.SkewedmarkersweremainlyconcentratedinLG5(33.3%)andLG9(24.1%). Despitethehighfrequencyofskewedmarkersinthe maleClementinemap,thecolinearitybetweenthemale andfemalemapswashighlyconserved(Additional file3).Therefore,thereferenceClementinemapwas establishedbyjoiningthetwodatasetsforeachLG, includingallmarkerspresentinatleastonemap. Ninehundredandsixty-onemarkers(677SNPs,258 SSRsand26Indels)weregroupedintoninelinkage groupstotaling1084.07cM(F igure3andAdditional files2and4).Theproportionofskewedmarkers remainedhigh(46.1%forp<0.05).TheLGsizerangedfrom87.5cM(LG9)to186.3cM(LG3).LG7and LG8possessedarelativelylowdensityofmarkers withanaverageof0.45and0.52markers/cM,respectively.Onaverage,nearlyonemarker/cMwasfound ontheotherLGs.EachLGexhibitedaheterogeneous densityofmarkers(Figur e4).Afewgapslargerthan 10cMwereobservedwithoutmappedmarkers,andmore gapsbetween5cMand10cMwereobservedwithoutmarkers(Figure3).Thesegapsweredistributed,respectively,as Table3MainparametersofthesixgeneticmapsinferredfromthreesegregatingprogeniesNLG1LG2LG3LG4LG5 MDSizeMDSizeMDSizeMDSizeMDSize ClementineF140963118.08929120.061372159.42851366.1310836108.34 ClementineM1569854131.091104155.6916088208.009568114.17124103124.30 ClementineF+M29611242128.4611315138.9217686186.321045889.4914171119.93 ChandlerPummelo156190101.79269109.39182157.2315089.9324363.29 PinkPummelo1408067.29101100.374039.346269.0715071.11 SweetOrange147541371.7027154.331172593.1564276.22964899.87 NLG6LG7LG8LG9Total MDSizeMDSizeMDSizeMDSizeMDSize ClementineF140861688.2040086.2444097.74952379.33783102923.54 ClementineM1568653100.464735112.22527125.81978392.538694951164.26 ClementineF+M296955999.805219115.59615118.031078887.549614431084.07 ChandlerPummelo15619064.838053.96166115.176073.0315120828.62 PinkPummelo14014679.834036.8412098.478471.588113633.90 SweetOrange14760965.5736284.1745239.68705184.91569153669.61N:numberofgametes;LG:linkagegroup;M:numberofmarkersintheLG;D:numberofmarkerswithnon-Mendeliansegregation(p<0.05);Size:sizeofthe LGin cM;F:female;M:male.Ollitrault etal.BMCGenomics 2012, 13 :593 Page6of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 7

follows:LG1(0,6),LG2(0,7),LG3(2,3),LG4(0,0),LG5 (1,4),LG6(1,2),LG7(3,5),LG8(3,4)andLG9(0,6).On LG9,aspecialfeaturewasobserved,inwhich55markers weremappedwithina5-cMinterval.‘ Chandler ’ pummelogeneticmapAmongthe158segregatingmarkers,151(141SSRs,5 SNPsand5Indels)weresuccessfullymappedinninelinkagegroups(Additionalfiles2and5).Onehundredand nineofthesemarkerswerecommonwiththeClementine map.Thelevelofsegregationdistortionwaslow(13.2%) andwasmainlyobservedontwoLGs(LG2:34.6%and LG8:37.5%).Thetotalsizeofthemapwas828.6cM.‘ Pink ’ pummelomapOnly84segregatingmarkerswereavailableforPink pummelomapping.Eighty-one(67SSRs,7SNPsand7 Indels)weremappedinninelinkagegroups(Additional files2and6).Fifty-twoofthesemarkerswereshared withtheClementinemap.ThelevelofsegregationdistortionwassimilartotheChandlerpummelomap (15.9%),butaffectedotherLGs,mainlyLG6(42.9%)and LG9(50%).Themapspanned633.9cM.SweetorangemapThesweetorangemapwasonlybasedonSNPmarkers. Amongthe572segregatingmarkers,569weremappedin ninelinkagegroups,withatotalsizeof669.6cM (Additionalfiles2and7).MostoftheLGconserved theirintegrityuntilLOD=10.HoweverthreeLG(2,3 and5)weredisruptedintwosub-groupsatLOD9,6 and10respectively.Asformaleandfemaleclementine thesedisruptionscorrespondedtorelativelywideinterval withoutintermediatemarkers.Whenmappedindividually * * * * *** * *** *LG1LG2LG3LG4LG5LG6LG7LG8LG90 10 20 30 405060 70 80 90 100 110 120 130 140 150 160 170 180 *** Figure3 Distributionofmarkersinthe ‘ Nules ’ Clementinegeneticmap. Red:Indels,green:SSRs,blue:SNPs,**intervalbetweentwomarkers >10cM;*intervalbetweentwomarkers>5cMand<10cM. Ollitrault etal.BMCGenomics 2012, 13 :593 Page7of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 8

thesub-groupsdisplayedconservedorderandverysimilar distancescomparedwiththeirrelativeentireLGs.Four hundredandeighteenofthesemarkerswereincommon withthereferenceClementinegeneticmap.Segregation distortionwasrelativelyfrequent(26.9%)andwasparticularlyclusteredinLG5(50%)andLG9(72.9%).Geneticmapcomparisons AnalysisofcolinearitybetweenthedifferentgeneticmapsSynteny,consideredasthecollocationofmarkerinthe samechromosome,wascompletelyconservedbetween alloftheparentalgeneticmaps.Thelinearorderofthe commonmarkerswasalsohighlyconservedbetween 60 20 10 10 20 30 Number of markers in 5cM intervals Location in the linkage groups (5cMintervals) LG1 LG2 LG3 LG4 LG5 LG6 LG7 LG8 LG9 Figure4 Densityofmarkersalongthe ‘ Nules ’ Clementinegeneticmap. Figure5 Conservationofsyntenyandlinearorderofmarkersinthefourgeneticmaps. NC: ‘ Nules ’ Clementine,CP: ‘ Chandler ’ pummelo, PP: ‘ Pink ’ pummelo,SO:sweetorange. Ollitrault etal.BMCGenomics 2012, 13 :593 Page8of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 9

parents(Figure5),withonlyafewcasesofinverted orderinsmallintervals.However,thegeneticdistance betweenmarkersappearedtobeunequalbetweenparents.SweetorangeinparticulardisplayedsmallerdistancesbetweensharedmarkersthanClementine.To avoidbiasduetothedifferentnumberoflocianalyzed, newgeneticmapsofsweetorangeandClementine (male,femaleandconsensus)wereconstructedusing onlythedatageneratedfromthe418SNPmarkers thatweresuccessfullygenotypedintheNCPP, CPNCandSOTOprogenies.Theresults(Additional file8)confirmedthatthegeneticdistancesweregenerallylower(exceptforLG4andLG9)inthesweet orangemapthanintheClementinereferencemap. Moreover,differenceswereconfirmedbetweenthe maleandfemaleClementinemapsforLG3,LG4,LG7, LG8andLG9,withsystematicallylowerdistancesin thefemalemap.Interestingly,markerswithverystrong linkagelocalizedintheveryhighmarkerdensityarea ofLG9fortheClementineandsweetorangemaps weremuchfartherapartin ‘ Chandler ’ and ‘ Pink ’ pummelos(Figure5).Locationofcrossovereventsinthesweetorangegameteat theoriginofClementineandintheClementinegameteat theoriginofthehaploidClementineusedforthereference citruswholegenomesequenceForeachlinkagegroup,thehaplotypesofsweetorange andClementinewereinferredfromSNPmarkerphases givenbyJoinMap.TheoriginofClementinefroma ‘ Mediterraneanmandarin ’ sweetorangehybridization wasprovenbyOllitraultetal.[8].HomozygousmarkersinsweetorangesandMediterraneanmandarin wereusedtoidentifythehaplotypeofClementine inheritedfromsweetorange.Comparisonofthishaplotypewiththetwosweetorangehaplotypesallowedthe identificationofninerecombinationbreakpoints,one eachinLG1,LG7andLG9,andtwoeachinLG3,LG4 andLG5(Figure6a).ThetwoClementinehaplotypes werecomparedwiththegenotypingdataofthehaploid ClementineusedbytheICGCtoestablishthereferencecitrusWGShaploidsequence.Thispermittedthe identificationofeightrecombinationbreakpoints,one eachinLG1,LG7andLG8,twoinLG5andthreein LG3(Figure6b).Interestingly,LG2,LG4,LG6and LG1 LG2 LG3 LG4 LG5 LG6 LG7 LG8 LG9 0 25 50 75 100 125 150 175 cMLG1Mediterranean mandarin haplotype Sweet Orange haplotype1 Sweet Orange haplotype 2 Sweet Orange haplotype not assigned No data Recombination break point b a Figure6 HaplotypeconstitutionofthesweetorangegameteattheoriginofClementine(a)andofthehaploidClementineusedto establishthereferencewholecitrusgenomesequence(b). Ollitrault etal.BMCGenomics 2012, 13 :593 Page9of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 10

LG9appearedtohavebeenentirelyinheritedfrom ’ Mediterranean ’ mandarinwithoutrecombination.ComparativedistributionofsegregationdistortionsTocomparethelocationofthegenomeareasaffected bysegregationdistortionsinthedifferentparentalmaps, aroughlocationinthereferenceClementinemapswas estimatedformarkers(i)mappedinsweetorangebut notinClementine,(ii)mappedin ‘ Chandler ’ pummelo butnotinClementineorsweetorangeand,finally(iii) formarkersonlymappedin ‘ Pink ’ pummelo.Theselocationestimateswereperformedbyapplyingtendency curveequationsofthelocationinthereferenceClementinemap(yaxis)accordingtothelocation(xaxis)for theparentmap,whereadditionalmarkersweremapped. AnexampleofsuchalocationispresentedinAdditional file9b.Theestimatedlocationsofallmarkersinthe frameworkoftheClementinereferencemaparegivenin the “ synthesis ” columnofAdditionalfile2.Thevaluesof theX2conformitytestoftheobservedsegregation againstthe1:1Mendelianhypothesisarerepresented alongthelinkagegroupsforalloftheparentalmapsin Additionalfile9a.Skewedmarkersappearedtobeconcentratedinspecificareasforthedifferentparents. Howeversporadicoccurrencesofanon-distortedmarkerwithinaclusterofdistortedmarkers(CiC5563-02), orviceversa(e.g.,markerCID5573)areobservedinthe Clementinereferencemap.Suchexceptionscanbe explainedbytheinclusionofthesemarkerswithmissing data,ofprobablenonrandomorigin,affectingthereal segregationratio. Thepatternsofsegregationdistortionareconsistent withthelocalselectionofgametesthatdifferintermsof theprobabilityofcontributingtothenextgeneration. MaleClementinepresentsthehigherproportionof skewedloci.InLG1andattheinitialpartofLG5,these distortionsseemtobesharedwithfemaleClementineand sweetorange,althoughatalowerintensitythaninmale Clementine.Sharedareasofskewedlociwerealso observedformaleClementineandsweetorangeatthe endofLG5andinthemiddleofLG9,wherehighmarker densitywasobserved.Inthesetworegions,themagnitude ofsweetorangedistortionswashigherthaninthemale Clementine.Theveryseverelevelofsegregationdistortion observedinthemiddleofLG3formaleClementineis sharedatamuchlowerlevelwithsweetorange.The skewedlociofmalePinkpummeloinLG6andLG9were observedinareascommonwithmaleClementine.DistortionsthatwereobservedinChandlerintheinitialpartof LG2werenotobservedintheotherparents. TheidentificationoftheClementinehaplotypesinheritedfrom ‘ Mediterraneanmandarin ’ andsweetorange alloweddeterminingateachlocuswhichallelewas inheritedfrombothparentsofClementine.Therefore,it waspossibletodeterminewhichparentalalleles(mandarinversussweetorange)werefavoredfortheskewed areasofthemaleandfemaleClementinesegregations (Figure7).Nosystematictendencywasobserved.For maleClementine,theskewedsegregationswereglobally infavorofsweetorangeallelesforLG1,LG5andLG7, whiletheskewedsegregationsfavoredmandarinalleles inLG3,LG8andLG9.Interestingly,inLG6andmore markedlyinLG4,atransitionfrompositiveselectionfor sweetorangeallelestopositiveselectionformandarin alleleswasobservedwhenmovingfromoneendofthe LGtotheother.ForLG1,LG2andLG9,similarpatterns ofallelesegregationwereobservedinfemaleandmale gametes(butgenerallywithalowerdistortionmagnitudeinthefemale).InLG4andLG5,thepatternsbetweenmaleandfemaleClementinewereverydifferent, withsignificantdistortioninoppositedirections.Inthe secondpartofLG4,themandarinalleleswerefavoredin maleClementine,whilesweetorangeallelesweresignificantlyfavoredinfemaleClementine.Inthefirstpartof LG5,mandarinandsweetorangeallelewerefavoredrespectivelyinthefemaleandmaleClementine.DiscussionAfirstreferencegeneticmapforCitrusThereviewsofcitrusgeneticmappingperformedby RuizandAsins[31],Chenetal.[19]andRoose[32] underlinedthatmostoftheearliercitrusgeneticmaps werebasedonintergenerichybridsbetween Citrus and Poncirus .Thiswasduetotheimportanceof Poncirus trifoliata forrootstockbreeding.Mostofthesestudies sufferedfromrelativelylownumbersofanalyzedhybrids andfromthedominantnatureofthemarkers(RAPD, AFLP)withoutsequencedataonthemappedfragments. Severalofthemorerecentmapsweregeneratedusing co-dominantmarkers,particularlySSRs[17-19].However,thenumberofmappedmarkerswasinsufficientto establishtheninelinkagegroupscorrespondingtothe ninechromosomespresentinhaploidcitrus.Somerecentstudiesalsofocusedonthegeneticmappingof Citrus varieties[17,20,21,33].ThemapofGulsenetal.[21] wasthefirst C.clementina map,whileBernetetal.[17] mappedChandlerpummeloandFortunemandarin,a C. clementinaC.tangerina hybrid.Noneofthesemaps encompassedenoughmarkerswithpublishedsequences toestablishareferencecitrusmapusefultobecombinedwithwholegenomesequencedata. ThecurrentreferenceClementinemap,established fromClementinemaleandfemalesegregation,includes 961co-dominantmarkers(677SNPs,258SSRsand26 Indels)spreadamongnineLG.Themapspans1084.1cM, withanaveragemarkerspacingof1.13cM.Thisisasubstantiallyhighermarkerdensitythanreportedinprevious citrusmaps,inwhichnineLGwereobtained.OmuraOllitrault etal.BMCGenomics 2012, 13 :593 Page10of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 11

etal.[34]establishedageneticmapspanning801cMwith 120CAPSmarkers.SankarandMoore[35]publishedan 874cMmapincluding310markers(mostlyISSRand RAPD).CarlosdeOliveiraetal.[20])establishedan 845cMmapwith227AFLPmarkersandmorerecentlyusing215markers(mostlySRAP)Gulsenetal. [21]produceda858cMmap. ThemarkerdensityinthecurrentreferenceClementinemapvariedalongthegenome.ThedensitywasparticularlylowinsomeregionsofLG7andLG8,with threegapsover10cMbetweenmarkersineachofthese LGs.TheSNPmarkersarethemostnumerousmarkers ontheClementinemapandwererandomlyselected. Therefore,theselowmarkerdensityareasprobablyrevealhighlyhomozygousregionsoftheClementine genome.WGSdataforthediploidClementinewillbe veryusefulfordevelopingtargetedmarkerswithin these"nomarker"regions.Attheoppositeextreme, highdensityareaswereobservedinsomeLGs.As describedbyLindneretal.[36]andVanOsetal.[37], someofthesehighmarkerdensityregionsmaybe associatedwithcentromericlocationswithlargephysicaldistances,possiblycorrespondingtolowgenetic distances.Anotherhypothesisisthatsomeareaswith highmarkerdensitycorrespondtoportionsofthegenomeininterspecificheterozygosity.Indeed,Clementine isconsideredtobeahybridbetweenMediterranean mandarinandsweetorange[8,9,16].Assweetorangeis thoughttohaveoriginatedasaresultofinterspecific hybridizationbetween C.maxima and C.reticulata genepools[6,7,9],somepartsoftheClementinegenomemayrepresentinterspecificheterozygosity( C. maxima/C.reticulata ).Garcia-Loretal.[38]showed thattheSNP/kbfrequencywasapproximatelysixtimes higherbetween C.reticulata and C.maxima thatit waswithin C.reticulata. Thus,randomlyselected -0.25 -0.2 -0.15 -0.1 -0.05 0 0.05 0.1 0.15 0.2 0.25 -0.25 -0.2 -0.15 -0.1 -0.05 0 0.05 0.1 0.15 0.2 0.25 LG1 LG2 LG3 LG4 LG5 LG6 LG7 LG8 LG9 P=5% P=5% P=5% P=5% Figure7 DistributionofthesegregationdistortionsforfemaleandmaleClementine,alongthereferenceClementinegeneticmap. The xaxisrepresentsthelocationoneachlinkagegroup(LG)andyaxisrepresentstheexcessofthemandarinallelerelativelytoMendelian segregation(y=frequencyofmandarinalleleminus0.5).BluerepresentsmaleClementinesegregation;redrepresentsfemaleClementine segregation.Thediscontinuouslinesrepresentthethresholdforsignificantdistortion(p<0.05). Ollitrault etal.BMCGenomics 2012, 13 :593 Page11of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 12

markersshouldbesixtimesmorefrequent(byphysical distanceunit)inthosepartsoftheClementinegenome involvedininterspecificheterozygosity.Despitetheheterogeneityofmarkerdispersion,thedistancetothe nearestmappedmarkerislessthan5cMinmostlocationsoftheClementinegenome.Moreoverprevious publisheddiversitystudiesdonewiththemappedSSRs (5,23 – 26,28),InDels(30)andSNPs(8)gaveaccurate informationoftheirtransferabilityandpolymorphisms, atindividuallocuslevel,withinandbetweentheprincipalvarietalgroups.Therefore,thismarkerframework willbeveryusefulformarker-traitassociationstudies basedonlinkagedisequilibrium,suchasQTLanalysis, bulksegregantanalysis,orevengeneticassociation studiesinthemandaringroup,wherestrongdiversity wasobservedforthemappedSNPmarkers[8].This mapisbeingusedtofacilitatethechromosomeassemblyofthereferencewholegenomecitrussequence basedonahaploidClementinegenotype[13,39].Linearmarkerorderishighlyconservedbetweenspecies, butgeneticdistancesarevariablebetweensexesand speciesThecitrusgeneticmapsbasedondominantandmainly cross-specificmarkers(suchasRAPD,AFLPandISSR) donotpermitgeneticmapcomparisons.Multi-allelic codominantmarkers,suchasSSRs,aremorepowerful forsuchapplications[30].Chenetal.[19]andBernet etal.[17]successfullyusedSSRsforcitrusmapcomparisonattheinterspecificandintergenericlevels. Inthepresentstudy,themaingenotypingeffortconcernedSNPs.Eighthundredandthirty-sixSNPmarkers weregenotypedinthethreepopulations.Mostofthese markerswereminedfromNulesClementineBACend sequences[8,27]and,asaresult,wereheterozygousfor Clementine.ThedevelopmentoftheGoldenGateSNP markersfromtheClementinesequencewithoutinformationontheinterspecificvariabilityinflankingareas resultedinnumeroushomozygousnullallelesinpummelo asdescribedbyOllitraultetal.[8]andintrifoliateorange. Heterozygousnullallelesfor72markerswerefoundin sweetorange,expandingthenumberofmarkersmapped inthisspecies.TheselectedSNPmarkerswerenotefficientforpummeloortrifoliateorangemappingduetothe verylownumberofheterozygouslociinthesespecies. Moreover,thebiallelicnatureofSNPmarkerslimitedthe establishmentoftwoanchoredmaps(maleandfemale) fromasinglecross.Therefore,comparisonbetweenClementineandpummelowasstillprimarilylimitedtocommonmultiallelicSSRs(109betweenClementineand Chandlerpummeloand52betweenClementineandPink Pummelo).WithsweetorangeandClementinemaps beingdevelopedfromdifferentpopulations,the418 commonheterozygousSNPsallowedmoresubstantialanchorageofthetwomaps. Theconservationofsyntenywascompletebetween thespecies,withnodiscrepancyinmarkerlocalization onthedifferentlinkagegroupsbetweenthemaps.Furthermore,thelinearorderofmarkersalsoappearedto behighlyconservedbetween C.clementina C.sinensis and C.maxima .ThisisinagreementwiththeconclusionsofBernetetal.[17]followingtheircomparative studyofpartialmapsbetweenthreespecies( C.aurantium C.maxima and P.trifoliata )andFortunemandarin,aClementine-derivedmandarinhybrid.Inthe presentstudy,smalllocalizedinversionsofmarker orderswereobservedbetweenmaps,particularlyin densemarkersareas.Bernetetal.[17]concludedthat similarresults,forlocalorderingchangesintheintegratedmaps,resultedfromtheinclusionofmarkerswith missingdata,andeventuallydifferentlevelsofdistorted segregationsbetweenpopulations.Itisalsopossiblethat smallgenotypingerrorsconcerningthemarkerslocated inthesedenseregionsdisturbsthemappingorder [40,41].Thefinemappingofsuchregionswillrequire largerpopulationsthantheonesgenotypedinthisstudy. Forthisreason,theselocalinversionsarenotdetailedin theresultsofthisstudysinceartifactualoriginswere quiteprobable.Chenetal.[19]alsoconcludedthatcolinearityattheintergenericlevelwashighlyconserved betweengeneticmapsof C.sinensis and P.trifoliata However,theyalsoobservedsomeinversionsbetween sharedlocithatmightrevealchromosomalrearrangementevents,suchastranslocationsorinversions.Consideringthedataofthisstudyandthetwoprevious comparativemappingstudies,markercolinearityappears highlyconservedattheintragenericlevel(Clementine, mandarin,pummelo,sweetorangeandsourorange),but alsobetween Citrus and Poncirus .Thisglobalconservationofcitrusgenomeorganizationwillallowreasonable inferencesofmostcitrusgenomesequencesviamapping NGSre-sequencingdatatothehaploidClementine referencegenomesequence. VariationsinLGsizeswereobservedbetweenthe currentmaleClementineandfemaleClementinemaps. Thesevariationswereconfirmedwhenthenewmaps wereexclusivelybuiltusingthemarkerssharedbetween thethreepopulationsusedfortheimplementationof theClementineandsweetorangemaps.SeveralLGs werelongerinthemaleClementinemapthaninthefemaleone.ThiswasobservedinLGswithsignificantand extensivesegregationdistortionsinthemalehaplotype populationscomparedwiththefemalepopulations,and thiswasalsoobservedinLG2,whereverysimilarpatternsoflowskewedlociwereobserved.Fromsimulated data,HackettandBroadfoot[41]foundthatsegregation distortion(duetogameticselection)alonehadverylittleOllitrault etal.BMCGenomics 2012, 13 :593 Page12of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 13

effectonmarkerorderormaplength.Asdiscussed below,theobserveddistortioninClementineprobably resultsfromgameticratherthanzygoticselection. Therefore,itisprobablethatthelongerLGsobserved withinthemaleClementinemapdonotresultfrom biasedestimationsduetosegregationdistortion,butinsteadreflectdifferentialrecombinationrates.Suchheterochiasmybetweensexesisfrequentinplantsand animals[42-47].Accordingtospecies,recombination shouldbehigherinmaleorinfemalegametes[43].Despitethefactthatheterochiasmywasdocumentedearly inthelastcentury[44],thereisstillnoconsensusasto whichoftheseveralproposedhypothesesmayexplain itsoccurrence[45].Thevariousmodelswerereviewed byLenormandandDuteil[46].Basedonalargesurvey inanimalsandplants,theseauthorsconcludedthatsexualheterochiasmyisnotinfluencedbythepresenceof heteromorphicsexchromosomes;rather,itshouldresult fromamale – femaledifferenceingameticselection. However,inthisstudy,thecitrusobservationsdonotfit theirglobalmodelconsideringasTrivers[47],that highergameticselectioninonesexreducedrecombinationinthatsextopreservethefavorablegenecombinationsthatconferreproductivesuccess.Indeed,wefound (seediscussiononsegregationdistortionbelow)much moresignificantsegregationdistortion,andtherefore probablegameticselection,forClementinemalegametes thanforfemalegametes.Thecitrusdataismorein agreementwithmodelsthatsuggestthatthesexexperiencingthemoreintenseselection,orotherwisehaving thehighervarianceinreproductivesuccess,shouldshow morerecombination(asreportedbyBurtetal.[47]). ImportantdifferencesinLGlengthswerealso observedbetweenClementine(maleandfemale)and sweetorangeforLG1,LG2,LG3,LG5,LG6andLG8. TheLGsforsweetorangeweresystematicallyshorter. Theliteratureonplantsandanimalsshowsthattheimpactofstructuralheterozygosityonrecombinationfrequencyisvariable.Differentsituationshavebeen discussedbyParkeretal.[48].Itiswellestablishedthat sequencedivergenceattheinterspecificlevelhasaninhibitoryeffectonsexualrecombination[49-52].Chetelat etal.[52]observedastrongreductionintherecombinationrateinamappingpopulationofaninterspecificF1 tomatohybridof Lycopersiconesculentum Solanum lycopersicoides .Theauthorsconcludedthatthehigh DNAsequencedivergencebetween L.esculentum and S. lycopersicoides isabetterexplanationofreducedrecombinationthanstructuralreorganization.Previously(and alsointomato),Liharskaetal.[53]showedthatthe amountofrecombinationinadefinedgeneticinterval decreasedastheproportionofforeignchromatin(introgressedfromcloserelativesof L.esculentum )increased. Theauthorsalsomentionedthat,asthedonorof theforeignchromatinbecamemoredistantlyrelated, thelevelofobservedrecombinationwaslower.Asthe Clementineisamandarinsweetorangehybrid,and sweetorangearosefrommandarinandpummelogene pools(withahigherproportionof C.reticulata ;[7,9]),it ishighlyprobablethatsweetorangecontainsmoregenomeregionsofinterspecificheterozygosity( C.reticulata / C.maxima )thantheClementine.Therefore,itcan behypothesizedthatthelowerLGsizes,andtheassociatedlowerrecombinationratesobservedinsweetorangecomparedwithClementine,areassociatedwiththe relativeinterspecificpatternsalongthegenomeofthese twospecies.TheareaofLG9thatdisplayssubstantially greatermarkerdensityinClementineandsweet-orange suggestslimitedrecombinationwithinalargegenome portion.Thus,twosetofmarkerswerecommonbetween theClementinemapandthetwopummelomaps (MEST308,CIBE6092andMEST065forPinkpummelo andmCrCIR07F11,JI-AAG03,MEST308andCIBE6092 forChandlerpummelo).Interestingly,inthepummelo maps,thesemarkerscover26.5cMand30cM,respectively,comparedwithanareaconcentratedwithin2cM intheClementinemap.ItappearsthatbothClementine andsweetorangearestronglyaffectedbyasimilarrecombinationlimitationinLG9forwhichtheydisplay equivalentmapsizes.Haplotypeanalysisofsweetorange anddiploidClementineshowsthattheClementine haplotypetransmittedbysweetorangewasinheritedprimarilyfromoneofthesweetorangehaplotypes,andonly asmalltelomericfragmentwaslikelytobetransmitted fromtheothersweetorangehaplotype.Furthergenome analysisalongwithcytogeneticandmappingstudieswill benecessarytoexplainthedifferentrecombinationpatternsobservedbetweenspecies.Extensivesegregationdistortionsareobservedinspecific linkagegroupareasparticularlywhenClementineisused asthemaleparentDistortionsfromexpectedMendelianallelicsegregations wereobservedforallmappedparentsofthesegregating progenies.ThehighestratewasrecordedformaleClementinewith56%skewedloci(p<0.05).Thispercentage ismorethanfourtimeshigherthanthatoffemale Clementine(13%),whichwasequalwiththeestimateof female ‘ Chandler ’ pummelo.Male ‘ Pink ’ pummelodisplayedaslightlyhigherlevelofdistortionthanfemale ‘ Chandler ’ pummelo(16%),whilesweetorange(mainly fromfemaledata)displayedanintermediatelevel(27%). Distortedlociwerealsoobservedinmostofthepreviouscitrusmappingstudies[17,20,54-57].Bernetetal. [18]alsoreportedahigherpercentageofskewedlociin themaleparentscomparedtothefemaleparentsinareciprocalcrossbetween ‘ Chandler ’ pummeloand ‘ Fortune ’ mandarin.SincemostsegregationdistortionsaffectOllitrault etal.BMCGenomics 2012, 13 :593 Page13of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 14

theallelefrequencieswithoutdisturbingthegenotypic frequencyequilibrium(nonsignificantFvalue – Wright fixationindex;datanotshown),itisprobablethatgameticselectionwasthemainfactorcausingskewedsegregation.Bernetetal.[17]reachedthesameconclusion fromsupportingbiologicaldataonparentalfertility. Uponcrosspollinationwithcompatibleparents,theproportionoffertilizedovulesismuchgreaterthantheproportionofsuccessfulmalegametes.Therefore,itappears logicalthatgameticselectionislikelytobemuchmore pronouncedinmalegametesthaninfemalesones.This canresultfromseveralmechanismssuchasgamete abortion,pollencompetitionor,thecitrusgametophytic incompatibilitysystem[58].ThepatternofX2conformitytestvalues,aswellastheexcessofmandarinalleles alongthelinkagegroups,suggeststhatthepresenceofa smallnumberoflociunderrelativelystrongselection pressureoneachchromosomeismorelikelythanselectionatmultipleloci.Similarpatternswereobservedin tomato[52].Identicalareasofskewedlociwere observedbetweenClementineandsweetorangeinseverallinkagegroups(LG1,LG3,LG5andLG9).Modern sweetorangevarietiesarosefromaninterspecifichybrid prototypethathasundergonevegetativepropagationor propagationfromseedscontainingnucellarembryos overaseveralthousandyearperiod.Besidesfavorable mutationsandstableepigeneticvariationsthathave beenselectedbymanandtheenvironment,itisprobablethatwithoutthefilterofsexualreproduction,the sweetorangegenomeaccumulatedunfavorablemutationsinaheterozygousstatus.SomeoftheseunfavorablemutationswerelikelytransmittedtoClementine,as attestedbythehighproportionofweakprogeny obtainedfromClementinesweetorangehybridization (ourunpublisheddata),whichshouldaffectbothsweet orangeandClementinesegregations.Interestingly,the gameticselectionshavethesameorientationformale andfemaleClementineinthegenomicregionswhere sweetorangesegregationsarealsoskewed(LG1,endof LG5,andLG9).Inothergenomeregions,maleandfemaleClementinesegregationdistortionsappeareddisconnected.Averystrongselectionisobservedinthe middleofLG3forthemaleClementine,withoutsignificantskewinginthefemale.ThemaleandfemaledistortionsappearedtotallyoppositeattheendofLG4andin thefirstpartofLG5.Thegametophyticincompatibility systemdescribedincitrus[58]couldbeafactorformale gameticselection.However,thismayleadtoacomplete exclusionofoneallelefortheconcernedlocusand therefore,averyhighdistortionforthelinkedmarker locus.Thispatternwasnotobservedinthepresent study.Thegametophyticincompatibilitysystemwasalso excludedasanexplanationforthesegregationdistortion observedinthereciprocalcrossesbetween ‘ Fortune ’ mandarinand ‘ Chandler ’ pummelo[17].Someofthe moreextremelyunequalallelicratios(70/30)forthe maleClementineoccurredinareaswithoutsignificant distortion(orevenoppositeselection)inthefemale. Suchdifferencesbetweenmaleandfemaleselectionmay partlyexplaintheinconsistentresultsobservedfortrait segregationinthereciprocalcrosses.Thus,itisdifficult toinfergeneticcontrolfromobservedtraitsegregations withoutconcomitantmarkersegregationanalysis.This isparticularlytrueifmajorgenescontrollingthestudied traitareheterozygousinthemaleparent.QTLanalysis mayalsobeaffectedasdescribedbyXu[59].HaplotypestructureofthediploidClementineandthe haploidClementineusedfortheimplementationofthe citruswholegenomereferencesequenceClementineisthoughttohavebeenselectedasachance seedlingfroma ‘ Mediterranean ’ mandarinbyFather ClementjustoveronecenturyagoinAlgeria.Themandarinfemaleparentagewasconfirmedbymitochondrial genomeanalysis[10].The ‘ Granito ’ sourorangewasinitiallyconsideredtobethemaleparent[15].However, molecularstudiesdemonstratedthattheClementine wasmorelikelyamandarinsweetorangehybrid [8,9,16].Themarkerphaseanalysisperformedfromthe Clementineandsweetorangemappingdataconfirmed thishypothesis,andallowedtheidentificationofthe haplotypestructuresofthemandarinandsweetorange gametesthatproducedtheClementine.Ninerecombinationbreakpointsbetweenthetwosweetorangehaplotypes(oneeachinLG1,LG7andLG9,andtwoeachin LG3,LG4andLG5)wereidentifiedforthesweetorange gametethatproducedtheClementine. TheimplementationofareferencecitruswholegenomesequencehasbeentheprimaryfocusoftheICGC forthelast5years.Polymorphisminawholegenome sequencecomplicatestheassemblyprocess.Assembly contiguityandcompletenessissignificantlylowerthan wouldhavebeenexpectedintheabsenceofheterozygosity[60].Commercialcitrusvarietiesarecharacterized byhighheterozygositylevels[6,7].Thecomparisonof blindversus"known-haplotype"assembliesofshotgun sequencesobtainedfromasetofBACclonesfromthe heterozygoussweetorange[61]ledtheICGCtoestablishthereferencesequenceofthecitrusgenomefroma homozygousgenotype.Ahaploidplantderivedfromthe Clementinewasselectedduetoitsimmediateavailability andpreexistingmolecularresources[26,27,62-64].The selectedhaploidwasobtainedbyinducedgynogenesis after insitu pollinationwithirradiatedpollen[13].The haploidClementinewasgenotypedusingthemarkers mappedindiploidClementineandsweetorange.This permittedtheconstitutionofthehaploidgenometobe determinedaccordingtothemandarinandsweetorangeOllitrault etal.BMCGenomics 2012, 13 :593 Page14of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 15

haplotypesconstitutiveofthediploidClementine.Eight recombinationbreakpointswereidentifiedbetweenthe twoClementinehaplotypes(oneinLG1,LG7andLG8; twoinLG5andthreeinLG3).LG2,LG4,LG6andLG9 appeartohavebeenentirelyinheritedfromthe ’ Mediterranean ’ mandarinhaplotypewithoutrecombination. Overall,averylargefractionofthegenomeofthehaploidClementineusedforWGSwasinheritedfromthe ‘ Mediterranean ’ mandarin.ConclusionsFiveparentalgeneticmapswereestablishedfromthree segregatingpopulationsthatweregenotypedusingSNP, SSRandIndelmarkers.Afirstmediumdensityreference map(961markersfor1084.1cM)ofcitruswasestablishedbyjoiningmaleandfemaleClementinesegregationdata.Despitetheheterogeneousdispersionof markers,thisconstitutesagoodframeworkforfurther marker-traitassociationstudies,andithasbeenusedto enablethechromosomeassemblyofthereferencewhole genomecitrussequence[39].TheClementinemapwas comparedwithtwopummelomaps( ‘ Chandler ’ map: 151markersfor828.6cM; ‘ Pink ’ map:81markersfor 633cM)andasweetorangemap(569markersfor 669.6cM).Thelinearorderofthemarkersappeared tobehighlyconservedattheinterspecificlevel.This shouldallowforreasonableinferencesofmostcitrus genomesequencesviamappingNGSre-sequencing datainthehaploidClementinereferencegenomesequence.ImportantvariationsbetweentheClementineand sweetorangemapsizeswereobserved,aswellasvariationsbetweenthemaleandfemaleClementinemaps.This suggestsvariationsinrecombinationrates.Thesmaller lengthofthesweetorangemapislikelyrelatedtothe higherinterspecificheterozygositywithinthesweetorange genome.Skewedsegregationsarenumerousinthemale Clementinemap,underliningthepotentialextentofdeviationfromMendeliansegregationforcharacterscontrolledbyheterozygouslociinthemaleparent.Genetic mappingdataconfirmedthattheClementineisahybrid betweenthe ‘ Mediterranean ’ mandarinandsweetorange. Ninerecombinationbreakpointswereidentifiedbetween thetwosweetorangehaplotypesforthesweetorange gametethatcontributedtotheClementinegenome.The genomeofthehaploidClementineusedtoestablishthe citrusreferencesequenceappearstobehavebeenprimarilyinheritedfromthe ‘ Mediterranean ’ mandarinhaplotype ofthediploidClementine.MaterialsandmethodsSegregatingprogeniesandDNAextraction ClementineandpummelogeneticmappingTwointer-specificsegregatingpopulationsbetween C. clementina and C.maxima wereusedtoestablishthe geneticmaps.Onehundredandfifty-sixhybridsof ‘ Chandler ’ pummelo ‘ Nules ’ Clementine(CPNC) wereproducedandgrownatCIRAD/INRA(Corsica), while140hybridsof ‘ Nules ’ Clementine ‘ Pink ’ pummelo(NCPP)wereobtainedatIVIA.TotalDNAwas extractedfromfreshleavesaccordingtoDoyleand Doyle[65].Inadditiontotheinterspecifichybrids,total DNAwasextractedfromtheparentallines:diploid ‘ Nules ’ Clementine(IVIA-22), ‘ Chandler ’ pummelo (ICVN0100608)and ‘ Pink ’ Pummelo(IVIA-275).DNA wasalsoextractedfromthehaploidClementineselected forthewholegenomesequenceimplementationand ‘ Mediterranean ’ mandarin(IVIA-154),theassumedfemaleparentofClementine.SweetorangegeneticmappingOnehundredandfortysevenintergenerichybridsbetweensweetorangeandtrifoliateorange( Citrussinensis Poncirustrifoliata ;SOTO)wereusedforsweetorange mappingusingSNPmarkerssharedwiththeClementine map.ThesehybridswereobtainedatUF-CREC(Florida) andpreviouslyusedforsweetorangeandtrifoliateorange mappingusingSSRmarkers[19].Thedifferentcrosses usedwere:(i)56hybridsof C.sinensis cvSanford(Sa) P. trifoliata cvArgentina(Ar),(ii)40hybridsof C.sinensis cvFiwicke(Fi) P.trifoliata cvFlyingDragon(FD);(iii) 15hybridsof C.sinensis cvRidgePineapple(RP) P.trifoliata cvFlyingDragon(FD),(iv)sevenhybridsof C.sinensis cvFiwicke(Fi) P.trifoliata cvArgentina(Ar);(v)six hybridsof C.sinensis cvRuby(Ru) P.trifoliata cvFlying Dragon(FD),(vi)fivehybridsof C.sinensis cvRidge Pineapple(RP) P.trifoliata cvDPI0906(Ps),(vii)five hybridsof C.sinensis cvRuby(Ru) P.trifoliata Argentinacv(Ar),and(viii)13hybridsof P.trifoliata cv FlyingDragon(FD) C.sinensis RidgecvPineapple (RP).Duetothenatureof C.sinensis intraspecific evolution(somaticmutationsbutnotsexualrecombination),molecularpolymorphismsbetweensweet orangecultivarsisveryrare[8,19].Therefore,after confirmingthelackofpolymorphismbetweenparentalsweetorangesatthemarkerloci,allofthehybrids wereconsideredtobederivedfromasinglesweetorangegenotypeforthemappinganalysis.Priorto DNAextraction,theploid ylevelofallhybridswas estimatedbyflowcytometry,andonlydiploidhybrids wereused.GenomicDNAwasisolatedfromtender leavesusingtheCTABmethodasdescribedby AldrichandCullis[66].MarkersAtotalof1166markerswereusedtogenotypetheprogenies.Ofthesemarkers,837wereSNPs,301wereSSRs and28wereIndels.Ollitrault etal.BMCGenomics 2012, 13 :593 Page15of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 16

SNPsCiC****-**:the802SNPswereminedfromtheClementineBACendsequencedatabase[27].Thesemarkers arepartofthe1536totalSNPsusedtoimplementan IlluminaGoldenGateassay.Thesemarkerswere selectedbasedontheirqualityandsegregationinthe analyzedprogeniesforatleastoneparent.Theyhave beenpublishedbyOllitraultetal.[8]andthecorrespondingGenBankaccessionnumberscanbefoundin Additionalfile1. ACO-*-***,ADC****,Aoc****,ATGGcM155,Cax4****, CHI-*-***,DXS-M-***,FLS-M-***;HKT1c800F141;Lap XcF***;LCY2-*-***;LCYB-*-***,MDH-P-84;NADK2c 800F***;PKF-M-186,PSY-M-289,TRPA-M-***,TScMI 1331:These34SNPmarkerswereminedbySangersequencingof44genotypesrepresentativeof Citrus and relativediversity,andwereobtainedfrom19genesimplicatedintheprimaryandsecondarymetabolitebiosynthesispathwayandsalttolerance[38].Corresponding GenBankaccessionnumberscanbefoundinAdditional file1.SeventeenoftheseSNPshavebeenpublished[8]. Detailsonthe17remainingmarkerscanbefoundin Additionalfile10.SSRmarkersThe301SSRmarkersusedformappingweredeveloped fromgenomiclibraries(79),ESTs(188),andBACend sequences(34). CI*****andmCrCIR*****:These57markerswere developedbyFroelicherandcolleaguesatCIRAD/INRA (France)fromagenomiclibraryof ‘ Cleopatra ’ mandarin. CorrespondingGenBankaccessionnumberscanbe foundinAdditionalfile1.Mostofthemappedmarkers havebeenpublished[23,67-69].Primersforthe remainingmarkersaregiveninAdditionalfile11. CIBE****:These34markersweredevelopedby OllitraultandcolleaguesatCIRAD/IVIA(France/Spain) fromaClementineBACendsequencedatabase[27]. ThesemarkersarepublishedinOllitraultetal.[28].CorrespondingGenBankaccessionnumberscanbefoundin Additionalfile1. CF-*****,JI-*****andNB-****:These59markerswere developedbyRooseandcolleaguesatUCR(California). Fourteenofthemarkersarefromgenomiclibrariesand 45arefromESTs.CorrespondingGenBankaccession numberscanbefoundinAdditionalfile1.Onlythefour NB-****markershavebeenpublished[6].Dataonthe remainingmarkerscanbeobtaineduponrequest (MikealL.Roose). CTV2745:Thismarkeriscloselylinkedtothecitrus tristezavirusimmunitygeneoftrifoliateorangeandwas developedintheRooselaboratory(UCR,California) fromagenomicsequence[70]. Cms**andjk-****:Thesesevenmarkersweredevelopedfromgenomiclibrariesandwerepublishedby Ahmadetal.[71]andKijasetal.[55],respectively. CX****:These70markersweredevelopedbyChunxian ChenandcolleaguesattheCREC(Florida)fromanEST database.ThecorrespondingGenBankaccessionnumbers canbefoundinAdditionalfile1.Someofthemapped markershavebeenpublishedbyChenetal.[19,25].Data ontheremainingmarkerscanbeobtaineduponrequest (ChunxianChen:cxchen@ufl.edu). Mest****:These73markersweredevelopedbyLuro andCol.atINRA/CIRADfromESTdatabases(France). ThecorrespondingGenBankaccessionnumberscanbe foundinAdditionalfile1.Sevenofthesemarkerswere publishedbyLuroetal.[26].Theprimersequencesof theremainingmarkerscanbeobtaineduponrequest (luro@corse.inra.fr).IndelmarkersCID****:These28markersweredevelopedfromaClementineBACendsequencedatabase[27]atIVIA/CIRAD (Spain),andhavebeenpublishedbyOllitraultetal.[30]. IDCAXisanIndelmarkerdevelopedbyGarcia-Lor etal.[7].ThecorrespondingGenBankaccessionnumberscanbefoundinAdditionalfile1.Genotypingmethods SSRsSSRgenotypingwasperformedusingdifferentmethods indifferentlaboratories(Additionalfile1). AtIVIA/CIRADandINRA,PCRproducts(using wellREDoligonucleotides,SigmaW)wereseparatedbycapillarygelelectrophoresis(CEQ ™ 8000GeneticAnalysis System;BeckmanCoulterInc.)asdescribedbyOllitrault etal.[28].ThedatacollectionandanalysiswereperformedwithGenomeLab ™ GeXPsoftware,version10.0. AtCIRADandCukurovaUniversity,PCRproducts (usingtailingM13associatedwiththreefluorescentdyes) wereseparatedbyelectrophoresisonaLi-CorDNA Analyzer4200system(LicorBiosciences,BadHomburg, Germany).Theallelesweresizedaccordingto50-to350bpstandards(MWGBiotechAG,Ebersberg,Germany). SSRallelesweredetectedandscoredusingSAGA Generation2software(LI-COR,USA)andcontrolled visually. AttheCREC,PCRproducts(usingtailingM13)were separatedbycapillarygelelectrophoresisonanABI 3130xlGeneticAnalyzer(AppliedBiosystemsInc.,Foster City,CA,USA).GeneScan3.7NTandGenotyper3.7 NTwereusedtoextractthetracedataandgenerate themicrosatellitealleletables,respectively.Moredetails canbefoundinChenetal.[25]. AtUCR,PCRproductslabeledbyanM13-tailedprimerstrategywereseparatedusingadenaturing7%LongOllitrault etal.BMCGenomics 2012, 13 :593 Page16of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 17

Ranger(BMA,Rockland,ME,USA)polyacrylamidegel attachedtoaLI-CORIR24200LRGlobalDNAsequencerdualdyesystem.Allelesweresizedmanuallyby comparisonwith50 – 350bpsizestandards(LI-COR), andthenscoredmanuallyfromgelimagefiles.More detailscanbefoundinBarkleyetal.[6].IndelsIndelmarkersweregenotypedbyCapillaryGelElectrophoresis(CEQ ™ 8000GeneticAnalysisSystem;Beckman CoulterInc.)usingwellREDoligonucleotides(SigmaW) asdescribedbyOllitraultetal.[34].Datacollectionand analysiswereperformedwithGenomeLab ™ GeXPsoftware,version10.0.SNPsAllSNPmarkersweregenotypedonaGoldenGatearray platformaccordingtothestandardIlluminaGoldenGate assayinstructions(www.illumina.com).Moredetailscan befoundinOllitraultetal.[8].Twogenotypecontrols ( ‘ Nules ’ Clementineand ‘ Chandler ’ pummelo)were repeatedtwiceineachplate.Thedatawerecollected andanalyzedusingtheGenomeStudiosoftware(Illumina).Theautomaticallelecallingwasvisuallychecked foreachmarker/plateandcorrectedifnecessary.LinkageanalysisandgeneticmappingThetwo-waypseudo-testcrossmappingstrategywas usedtodeterminethelinkagesinthedifferentF1populationsfromthetwoheterozygousparentsaspreviously described[72]andusedinpreviousmappingstudiesin citrus[17,19,73].EachprogenywasanalyzedwithJoinMap4.0[74].Thegenotypingdatawerecodedaccording tothe “ CP ” populationoptionadaptedforsuchtwo-way pseudo-testcrosseswithnopreviousknowledgeofthe markerlinkagephases.Inthefirststep,JoinMapwas usedtoestablishmaleandfemalegametepopulations, whichwereanalyzedseparately.Segregationdistortion wastestedby 2conformitytestsagainsttheMendelian segregationratioof1:1.Linkageanalysisandmarker groupingwereperformedusingtheindependenceLOD andaminimumthresholdLOD=4.Phases(couplingand repulsion)ofthelinkedmarkerlociwereautomatically detectedbythesoftware.Mapdistanceswereestablished incentiMorgans(cM)usingtheregressionmappingalgorithmandtheKosambimappingfunction.Giventhat missingobservationshavemuchlessnegativeimpacton thequalityofthemapthanerrors,severalauthorsrecommendidentifyingsuspiciousdataandtreatingthem asmissingobservations[75,76].Inhighdensitygenetic mapping,agenotypeerrorusuallymanifestsitselfasa singleton(oradoublecross-over)underareasonablyaccurateorderingofthemarkers.Asingletonisalocus whosephaseisdifferentfromboththemarkerphases immediatelybeforeandafter.Areasonablestrategyto dealwithgenotypingerrorsistoremovesingletonsby treatingthemasmissingobservations,andthenrefine themapbyrunningtheorderingalgorithm[75,76].For theClementinemapinwhicharelativelyhighnumber ofmarkerswasgenotyped,singletonswereautomatically checkedafterafirstmappingroundandreplacedby missingdatausinganexcelpageroutine.TheClementinemapswereestablishedfromthesecleaneddata. Distortedmarkerswerenotremovedfromtheanalysis becausetheywereveryfrequentforsomeparents. Moreover,usingJoinMap,eachgroupingoflinkedloci wasbaseduponatestforindependenceinacontingency table.Sincethetestforindependenceisnotaffectedby segregationdistortionliketheLODscoreusedbyother methodsoflinkageanalysis,alowerincidenceofspuriouslinkageisexpected[74].Thelinkagemapswere drawnusingtheMapChartprogram[77].Thecircleplot diagramusedtocomparethemarkerorderinfourgeneticmapswasperformedusingCircossoftware(http:// circos.ca/).Clementineandsweetorangehaplotypes weredrawnwithGGT2.0software[78].AdditionalfilesAdditionalfile1: Originandinformationforallmarkers. Thisfile containsatableshowingdetailedinformationforallmarkers:typeof marker(Indels,SSRsorSNPs);thetypeofsequencedatafromwhichthe markersweredeveloped(genomiclibrary,BACendsequences,ESTs); GenBankaccessionnumber;thelaboratoryinwhichthemarkerswere developed;thelaboratoryinwhichthedifferentprogenieswere genotyped,theoccurrenceandconfigurationofnullalleleforthe parentsofanalyzedprogeniesandthereferencesforthepapersinwhich themarkerswerepublished,withanindicationofthemodifications(if any)inthemarkernames. Additionalfile2: Detailedresultsofgeneticmapping. Thisfile containsthedetailedinformation(markerlocations,X2forMendelian segregation,andlevelofsignificance)onthegeneticmapsformale Clementine,femaleClementine,referenceClementine,sweetorange, ‘ Chandler ’ pummeloand ‘ Pink ’ pummelo.Theestimatedlocationofall markersinthereferenceClementinemapisalsoprovided(synthesis columns). Additionalfile3: Conservedlinearorderbetweenmaleandfemale Clementinegeneticmaps. Thisfilecontainsafigureshowingthe relativepositionsofthemarkersinthefemaleClementinemap(yaxis) andinthemaleClementinemap(xaxis)foreachlinkagegroup. Additionalfile4: ReferenceClementinegeneticmap. Thisfile containsafigureshowingtheninelinkagegroupsofthereference Clementinegeneticmapandthepositionofeachmarker(blue:SNPs; green:SSRs;red:Indels). Additionalfile5: ‘ Chandler ’ pummelogeneticmap. Thisfilecontains afigureshowingtheninelinkagegroupsfromthe ‘ Chandler ’ pummelo geneticmapandthepositionofeachmarker(blue:SNPs;green:SSRs; red:Indels). Additionalfile6: ‘ Pink ’ pummelogeneticmap. Thisfilecontainsa figureshowingtheninelinkagegroupsofthe ‘ Pink ’ pummelogenetic mapandthepositionofeachmarker(blue:SNPs;green:SSRs;red: Indels).Ollitrault etal.BMCGenomics 2012, 13 :593 Page17of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 18

Additionalfile7: Sweetorangegeneticmap. Thisfilecontainsa figureshowingtheninelinkagegroupsofthesweetorangegenetic mapandthepositionofeachmarker(blue:SNPs). Additionalfile8: Variationofmaplengthbetweenmale Clementine,femaleClementine,andsweetorangebasedonlyon commonSNPmarkers. Thisfilecontainsafigureforeachlinkagegroup showingtherelativepositionofthemarkersinthefemaleClementine map,themaleClementinemap,andthesweetorangemapinanew mappinganalysisperformedusingonlythecommonmarkersforthe threeparents.Thexaxisrepresentthelocationonthereference ClementinemapestablishedfromallClementinegametes(male+ female).Therelativelocationsintheothermaps(theratiobetweenthe locationsintheothermaprelativetothelocationintheClementine referencemap)areshownontheyaxis. Additionalfile9: Comparativedistributionoftheskewedmarkers intheninelinkagegroupsforfiveparents. Thisfilecontainsafigure foreachlinkagegroupshowingthedistortionmagnitude(X2of conformitywithMendeliansegregation)foreachmarkerandeach mappedparent.Furthermore,9bshowsanexampleillustratingthe methodusedtoestimatethelocationinthereferenceClementinemap ofmarkersmappedintheotherparents. Additionalfile10: InformationonthenewSNPmarkersincludedin theGoldenGatearray. Thisfilecontainsinformationregardingthenew SNPmarkersincludedintheGoldenGatearray.ItincludestheGenBank accessionnumber,thesequencesurroundingtheSNPs,SNPposition,the GoldenGateprimersanddesignabilityrank. Additionalfile11: CharacteristicsandprimersforthenewSSR markersdevelopedfrom ‘ Cleopatra ’ mandaringenomiclibraryat CIRAD. Thisfilecontainsinformationontheprimersusedforthenew SSRsdevelopedfromaCleopatramandarin( C.reshni )genomiclibrary (GenBankaccessionnumber,primersequences,annealingtemperature andmicrosatellitemotif). Competinginterests Theauthorsdeclarethattheyhavenocompetinginterests. Authors ’ contributions POmanagedthework,analyzedthedataandwrotethemanuscript.JTand MTprovidedtheSNPmarkersandcontributedtodataanalysis.DB,ABe,ABo andACdevelopedtheGoldenGatearrayandperformedtheSNP genotyping.YFdevelopedtheCPNCpopulationandprovidedDNA.PA developedtheCNPPpopulationandprovidedDNA.CCandFGGprovided theSOTOprogenyDNAandperformedpartoftheSSRgenotyping.CTF, SL,IH,FO,GC,YK,LM,AGL,CB,LN,FLandMLRcontributedtotheSSRand Indelsgenotyping,andJCcontributedtotheanalysisofmappingdata.All authorshavereadandapprovedthefinalmanuscript. Acknowledgements ThisworkwasprincipallyfundedbytheFrenchANRCITRUSSEQproject.The EuropeanCommission,undertheFP6-2003-INCO-DEV-2projectCIBEWU (n015453),theSpanishMinisteriodeCienciaeInnovacingrants,AGL200765437-C04-01/AGRandAGL2008-00596-MCI,theSpanishPSE-060000-2009-8 andIPT-010000-2010-43projects,thePrometeoproject2008/121Generalidad Valenciana,theTurkishTUBITAKProjectNo:108O568,theCaliforniaCitrus ResearchBoardandUCDiscoverygrantitl-bio-03-10122andtheFlorida CitrusResearchandDevelopmentFoundation(CRDF),grants#67and71also contributedtothework. Authordetails1CIRAD,UMRAGAP,F-34398Montpellier,France.2IVIA,CentroProteccion VegetalyBiotechnologia,Ctra.Moncada-NqueraKm4.5,46113Moncada, Valencia,Spain.3IVIA,CentrodeGenomica,ApartadoOficial,46113Moncada, Valencia,Spain.4CitrusResearchandEducationCenter,UniversityofFlorida, LakeAlfred,FL33850USA.5DepartmentofBotanyandPlantSciences, UniversityofCalifornia,Riverside,CA92521USA.6InstitutNationaldela RechercheAgronomique,BP293,14000Knitra,Morocco.7INRA,UREPGV,2 rueGastonCremieux,91057Evry,France.8INRA,URGEQA,SanGiuliano, 20230SanNicolao,France.9DepartmentofHorticulture,Facultyof Agriculture,Universityofukurova,01330Adana,Turkey.10CNG,CEA/DSV/ InstitutdeGnomique,2rueGastonCremieux,91057Evry,France. Received:28May2012Accepted:29October2012 Published:5November2012 References1. FAOSTAT ;2009http://faostat.fao.org/site/567/default.aspx. 2.ScoraRW: OnthehistoryandoriginofCitrus. BullTorreyBotClub 1975, 102: 369 – 375. 3.BarrettHCRA: Anumericaltaxonomicstudyofaffinityrelationshipsin cultivatedCitrusanditscloserelatives. SystBot 1976, 1: 105 – 136. 4.WebberHJ: Historyanddevelopmentofthecitrusindustry .In Thecitrus industry.Volume1 .EditedbyReutherW,WebberHJ.Berkeley:Universityof CaliforniaPress;1967:1 – 39. 5.LuroF,RistD,OllitraultP: Evaluationofgeneticrelationshipsin Citrus genusbymeansofsequencetaggedmicrosatellites. ActaHortic 2001, 546: 237 – 242. 6.BarkleyNA,RooseML,KruegerRR,FedericiCT: Assessinggeneticdiversity andpopulationstructureinacitrusgermplasmcollectionutilizing simplesequencerepeatmarkers(SSRs). TheorApplGenet 2006, 112 (8):1519 – 1531. 7.Garcia-LorA,LuroF,NavarroL,OllitraultP: ComparativeuseofInDeland SSRmarkersindecipheringtheinterspecificstructureofcultivatedcitrus geneticdiversity:aperspectiveforgeneticassociationstudies. MolGenet Genomics 2012, 287 (1):77 – 94. 8.OllitraultP,TerolJ,Garcia-LorA,BerardA,ChauveauA,FroelicherY,Belzile C,MorillonR,NavarroL,BrunelD,TalonM: SNPmininginC.clementina BACendsequences;transferabilityintheCitrusgenus(Rutaceae), phylogeneticinferencesandperspectivesforgeneticmapping. BMC Genomics 2012, 13: 13. 9.NicolosiE,DengZN,GentileA,MalfaS,ContinellaG,TribulatoE: Citrus phylogenyandgeneticoriginofimportantspeciesasinvestigatedby molecularmarkers. TheorApplGenet 2000, 100 (8):1155 – 1166. 10.FroelicherY,MouhayaW,BasseneJB,Cos tantinoG,KamiriM,LuroF,MorillonR, OllitraultP: NewuniversalmitochondrialPCRmarkersrevealnewinformation onmaternalcitrusphylogeny. TreeGenetGenomes 2011, 7 (1):49 – 61. 11.KrugCA: ChromosomenumbersinthesubfamilyArantioideae,with specialreferenceinthegenus Citrus CitrusBotGaz 1943, 104: 602 – 611. 12.OllitraultP,JacquemondC,DuboisC,LuroF:Citrus .In Geneticdiversityof cultivatedtropicalplants .EditedbyHamonP,SeguinM,PerrierX, GlaszmannJC.Montpellier:CIRAD;2003:193 – 217. 13.AlezaP,JuarezJ,HernandezM,PinaJA,OllitraultP,NavarroL: Recovery andcharacterizationofaCitrusclementinaHort.exTan.'Clemenules' haploidplantselectedtoestablishthereferencewholeCitrusgenome sequence. BMCPlantBiol 2009, 9: 110. 14.GmitterFGJr: TheHaploidMandarinandDiploidSweetOrangeGenome Sequences .SanDiego,CA:Plant&AnimalGenomesXIXConference;2011. 15.TrabutJL: L'hybridationdes Citrus :unenouvelletangrine"la Clmentine". RevueHorticole 1902, 10: 232 – 234. 16.DengZN,GentileA,NicolosiE,ContinellaG,TribulatoE: Parentage determinationofsomecitrushybridsbymolecularmarkers. Proceedings oftheInternationalSocietyofCitricultureXIIICongress 1996, 2: 849 – 854. 17.BernetGP,FernandezRibacobaJ,CarbonellEA,AsinsMJ: Comparative genome-widesegregationanalysisandmapconstructionusinga reciprocalcrossdesigntofacilitatecitrusgermplasmutilization. Mol Breed 2010, 25 (4):659 – 673. 18.LyonMT,FedericiCT,KacarY,ChenC,O'MalleyD,ChaparroJX,GmitterFG, RooseML: SSR-BasedLinkageMapsForSweetOrangeAndTrifoliateOrange SanDiego,CA:Plant&AnimalGenomeXVthConference;2007. 19.ChenCX,BowmanKD,ChoiYA,DangPM,RaoMN,HuangS,SonejiJR, McCollumTG,GmitterFGJr: EST-SSRgeneticmapsfor Citrussinensis and Poncirustrifoliata TreeGenetGenomes 2008, 4 (1):1 – 10. 20.CarlosdeOliveiraA,BastianelM,Cristofani-YalyM,MoraisdoAmaralA, MachadoMA: Developmentofgeneticmapsofthecitrusvarieties 'Murcott'tangorand'Pera'sweetorangebyusingfluorescentAFLP markers. JApplGenet 2007, 48 (3):219 – 231. 21.GulsenO,UzunA,CananI,SedayU,CanihosE: Anewcitruslinkagemap basedonSRAP,SSR,ISSR,POGP,RGAandRAPDmarkers. Euphytica 2010, 173 (2):265 – 277.Ollitrault etal.BMCGenomics 2012, 13 :593 Page18of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 19

22.NovelliVM,CristofaniM,SouzaAA,MachadoMA: Developmentand characterizationofpolymorphicmicrosatellitemarkersforthesweet orange(CitrussinensisL.Osbeck). GenetMolBiol 2006, 29 (1):90 – 96. 23.FroelicherY,DambierD,BasseneJB,CostantinoG,LotfyS,DidoutC, BeaumontV,BrottierP,RisterucciAM,LuroF,OllitraultP: Characterization ofmicrosatellitemarkersinmandarinorange(CitrusreticulataBlanco). MolEcolResour 2008, 8 (1):119 – 122. 24.KijasJM,FowlerJC,ThomasMR: Anevaluationofsequencetagged microsatellitesitemarkersforgeneticanalysiswithinCitrusandrelated species. Genome 1995, 38 (2):349 – 355. 25.ChenCX,ZhouP,ChoiYA,HuangS,GmitterFGJr: Miningand characterizingmicrosatellitesfromcitrusESTs. TAGTheorApplGenet 2006, 112 (7):1248 – 1257. 26.LuroFL,CostantinoG,TerolJ,ArgoutX,AllarioT,WinckerP,TalonM, OllitraultP,MorillonR: TransferabilityoftheEST-SSRsdevelopedon Nulesclementine(CitrusclementinaHortexTan)tootherCitrus speciesandtheireffectivenessforgeneticmapping. BMCGenomics 2008, 9: 287. 27.TerolJ,NaranjoMA,OllitraultP,TalonM: Developmentofgenomic resourcesforCitrusclementina:characterizationofthreedeep-coverage BAClibrariesandanalysisof46,000BACendsequences. BMCGenomics 2008, 9: 423. 28.OllitraultF,TerolJ,PinaJA,NavarroL,TalonM,OllitraultP: Developmentof SSRmarkersfromCitrusclementina(Rutaceae)BACendsequencesand interspecifictransferabilityinCitrus. AmJBot 2010, 97 (11):e124 – e129. 29.BiswasMK,ChaiL,QiangX,DengX: Generation,functionalanalysisand utilityofCitrusgrandisESTfromaflower-derivedcDNAlibrary. MolBiol Rep 2012, 39: 7221 – 7235. 30.OllitraultF,TerolJ,AlonsoMartinA,PinaJA,NavarroL,TalonM,OllitraultP: DevelopmentofInDelmarkersfrom Citrusclementina (Rutaceae)BACendsequencesandinterspecifictransferabilityin Citrus AmJBot 2012, 99 (7):e268 – e273. 31.RuizC,AsinsMJ: Comparisonbetween Poncirus and Citrus genetic linkagemaps. TheorApplGenet 2003, 106 (5):826 – 836. 32.RooseML:MappingandmarkerassistedselectioninCitrus .In Citrus genetics,breedingandbiotechnology .EditedbyKhanIA.Wallingford,UK: CABInternational;2007:275 – 286. 33.OliveiraRP,CristofaniM,VildosoCIA,MachadoMA: Geneticlinkagemaps of ‘ Pra ’ sweetorangeand ‘ Cravo ’ mandarinwithRAPDmarkers. PesquisaAgropecuriaBrasileira 2004, 39: 159 – 165. 34.OmuraM,UedaT,KitaM,KomatsuA,TakanokuraY,ShimadaT,EndoInagakiT,NesumiH,YoshidaT: ESTMappingofCitrus .Orlando,FL: ProceedingsoftheInternationalSocietyofCitricultureIXCongress; 2000:71 – 74. 35.SankarAA,MooreGA: Evaluationofinter-simplesequencerepeatanalysis formappinginCitrusandextensionofthegeneticlinkagemap. Theor ApplGenet 2001, 102: 206 – 214. 36.LindnerKR,SeebJE,HabichtC,KnudsenKL,KretschmerE,ReedyDJ,Spruell P,AllendorfFW: Gene-centromeremappingof312lociinpinksalmonby half-tetradanalysis. Genome 2000, 43 (3):538 – 549. 37.vanOsH,AndrzejewskiS,BakkerE,BarrenaI,BryanGJ,CaromelB,Ghareeb B,IsidoreE,deJongW,vanKoertP,LefebvreV,MilbourneD,RitterE,van derVoortJN,Rousselle-BourgeoisF,vanVlietJ,WaughR,VisserRG,Bakker J,vanEckHJ: Constructionofa10,000-markerultradensegenetic recombinationmapofpotato:providingaframeworkforaccelerated geneisolationandagenomewidephysicalmap. Genetics 2006, 173 (2):1075 – 1087. 38.Garcia-LorA,CurkF,MorillonR,AncilloG,LuroF,NavarroL,OllitraultP: NuclearphylogenywithinCitrus(Rutaceae)andfourrelatedgenera. Ann Bot 2012.doi:10.1093/aob/mcs227. 39.GmitterFG: NewCitrusGenomeSequenceResources .SanDiego,CA:Plant& AnimalGenomeXXConference;2012. 40.BuetowKH: Influenceofaberrantobservationsonhigh-resolution linkageanalysisoutcomes. AmJHumGenet 1991, 49 (5):985 – 994. 41.HackettCA,BroadfootLB: Effectsofgenotypingerrors,missingvalues andsegregationdistortioninmolecularmarkerdataontheconstruction oflinkagemaps. Heredity(Edinb) 2003, 90 (1):33 – 38. 42.PopaA,SamollowP,GautierC,MouchiroudD: Thesex-specificimpactof meioticrecombinationonnucleotidecomposition. GenomeBiolEvol 2012, 4 (3):412 – 422. 43.LorchPD:Sexdifferencesinrecombinationandmappingadaptations. Genetica 2005, 123 (1 – 2):39 – 47. 44.HaldaneJBS: Sexratioandunisexualsterilityinhybridanimals. JGenet 1922, 12: 101 – 109. 45.GirautL,FalqueM,DrouaudJ,PereiraL,MartinOC,MezardC: GenomewidecrossoverdistributioninArabidopsisthalianameiosisrevealssexspecificpatternsalongchromosomes. PLoSGenet 2011, 7 (11):e1002354. 46.LenormandT,DutheilJ: Recombinationdifferencebetweensexes:arole forhaploidselection. PLoSBiol 2005, 3 (3):e63. 47.TriversRL: Sexdifferencesinratesofrecombinationandsexualselection In TheEvolutionofSex .EditedbyMichodRE,LevinBR.Sunderlan, Massachusetts:SinauerAssociatesInc;1988:270 – 286. 48.ParkerJS,PalmerRW,WhitehornMAF,EdgarLA: Chiasmafrequency effectsofstructuralchromosomechange. Chromosoma 1982, 85: 673 – 686. 49.ChambersSR,HunterN,LouisEJ,BortsRH: Themismatchrepairsystem reducesmeiotichomeologousrecombinationandstimulates recombination-dependentchromosomeloss. MolCellBiol 1996, 16 (11):6110 – 6120. 50.OppermanR,EmmanuelE,LevyAA: Theeffectofsequencedivergence onrecombinationbetweendirectrepeatsinArabidopsis. Genetics 2004, 168 (4):2207 – 2215. 51.LiL,JeanM,BelzileF: TheimpactofsequencedivergenceandDNA mismatchrepaironhomeologousrecombinationinArabidopsis. PlantJ 2006, 45 (6):908 – 916. 52.ChetelatRT,MeglicV,CisnerosP: Ageneticmapoftomatobasedon BC(1)LycopersiconesculentumxSolanumlycopersicoidesreveals overallsyntenybutsuppressedrecombinationbetweenthese homeologousgenomes. Genetics 2000, 154 (2):857 – 867. 53.LiharskaT,WordragenM,KammenA,ZabelP,KoornneefM: Tomato chromosome6:effectofalienchromosomalsegmentsonrecombinant frequencies. Genome 1996, 39 (3):485 – 491. 54.LuroF,LorieuxM,LaigretF,BoveJM,OllitraultP: Geneticmappingofan intergenericcitrushybridusingmolecularmarkers. Fruits(Paris) 1994,49 (5/6):404 – 408. 55.KijasJMH,ThomasMR,FowlerJCS,RooseML: Integrationoftrinucleotide microsatellitesintoalinkagemapof Citrus TheorApplGenet 1997, 94 (5):701 – 706. 56.OliveiraRP,Aguilar-VildosoCI,CristofaniM,MachadoMA: SkewedRAPD markersinlinkagemapsofCitrus. GenetMolBiol 2004, 27 (3):437 – 441. 57.RagaV,BernetGP,CarbonellEA,AsinsMJ: Segregationandlinkage analysesintwocomplexpopulationsderivedfromthecitrusrootstock Cleopatramandarin.Inheritanceofseedreproductivetraits. TreeGenet Genomes 2012, 8 (5):1061 – 1071. 58.SoostRK: Theincompatibilitygenesystemincitrus .In ProcFirstIntCitrus SympVolume1 .EditedbyChapmnH.Riverside:UnivCalifornia;1968:189 – 190. 59.XuS: Quantitativetraitlocusmappingcanbenefitfromsegregation distortion. Genetics 2008, 180 (4):2201 – 2208. 60.VinsonJP,JaffeDB,O'NeillK,KarlssonEK,Stange-ThomannN,AndersonS, MesirovJP,SatohN,SatouY,NusbaumC,BirrenB,GalaganJE,LanderES: Assemblyofpolymorphicgenomes:algorithmsandapplicationtoCiona savignyi. GenomeRes 2005, 15 (8):1127 – 1135. 61.RooseML,NiedzRP,GmitterFG,TimothyJC,AbhayaMD,Jan-FangC, DanielSR: Analysisofa1.2wholegenomesequenceofCitrussinensis .San Diego,CA:Plant&AnimalGenomeXVConference;2007. 62.FormentJ,GadeaJ,HuertaL,AbizandaL,AgustiJ,AlamarS,AlosE,Andres F,ArribasR,BeltranJP,BerbelA,BlazquezMA,BrumosJ,CanasLA,Cercos M,Colmenero-FloresJM,ConesaA,EstablesB,GandiaM,Garcia-MartinezJL, GimenoJ,GisbertA,GomezG,Gonzalez-CandelasL,GranellA,GuerriJ, LafuenteMT,MaduenoF,MarcosJF,MarquesMC,MartinezF,MartinezGodoyMA,MirallesS,MorenoP,NavarroL,PallasV,Perez-AmadorMA, Perez-ValleJ,PonsC,RodrigoI,RodriguezPL,RoyoC,SerranoR,SolerG, TadeoF,TalonM,TerolJ,TrenorM,VaelloL,VicenteO,VidalC,ZacariasL, ConejeroV: Developmentofacitrusgenome-wideESTcollectionand cDNAmicroarrayasresourcesforgenomicstudies. PlantMolBiol 2005, 57 (3):375 – 391. 63.TerolJ,ConesaA,ColmeneroJM,CercosM,TadeoF,AgustiJ,AlosE, AndresF,SolerG,BrumosJ,IglesiasDJ,GotzS,LegazF,ArgoutX,Courtois B,OllitraultP,DossatC,WinckerP,MorillonR,TalonM: Analysisof13000 uniqueCitrusclustersassociatedwithfruitquality,productionand salinitytolerance. BMCGenomics 2007, 8: 31.Ollitrault etal.BMCGenomics 2012, 13 :593 Page19of20 http://www.biomedcentral.com/1471-2164/13/593

PAGE 20

64.MartinezGodoyMA,MauriN,JuarezJ,MarquesMC,SantiagoJ,FormentJ, GadeaJ: Agenome-wide20Kcitrusmicroarrayforgeneexpression analysis. BMCGenomics 2008, 9 (318). 65.DoyleJJ,DoyleJL: ArapidDNAisolationprocedureforsmallquantities offreshleaftissue. PhytochemicalBulletin 1987, 19 (1):11 – 15. 66.AldrichKJ,CullisCA: RAPDanalysisinflax:optimizationofyieldand reproducibilityusingKlenTaq1DNApolymerase,chelex100andgel purificationofgenomicDNA. PlantMolBiolRep 1993, 11: 128 – 141. 67.AlezaP,FroelicherY,SchwarzS,AgustiM,HernandezM,JuarezJ,LuroF, MorillonR,NavarroL,OllitraultP: Tetraploidizationeventsby chromosomedoublingofnucellarcellsarefrequentinapomictic citrusandaredependentongenotypeandenvironment. AnnBot 2011, 108 (1):37 – 50. 68.CuencaJ,FroelicherY,AlezaP,JuarezJ,NavarroL,OllitraultP: Multilocus half-tetradanalysisandcentromeremappingincitrus:evidenceofSDR mechanismfor2nmegagametophyteproductionandpartialchiasma interferenceinmandarincv'Fortune'. Heredity 2011, 107 (5):462 – 470. 69.KamiriM,StiftM,SrairiI,CostantinoG,ElMoussadikA,HmyeneA,BakryF, OllitraultP,FroelicherY: Evidencefornon-disomicinheritanceinaCitrus interspecifictetraploidsomatichybridbetweenC.reticulataandC. limonusingSSRmarkersandcytogeneticanalysis. PlantCellRep 2011, 30 (8):1415 – 1425. 70.YangZN,YeXR,MolinaJ,RooseML,MirkovTE: Sequenceanalysisofa 282-kilobaseregionsurroundingthecitrustristezavirusresistancegene ( Ctv )locusin Poncirustrifoliata L. Raf.PlantPhysiol 2003, 131 (2):482 – 492. 71.AhmadR,StrussD,SouthwickSM: Developmentandcharacterizationof microsatellitemarkersinCitrus. JAmSocHorticSci 2003, 128 :584 – 590. 72.RitterE,GebhardtC,SalaminiF: Estimationofrecombinationfrequencies andconstructionofRFLPlinkagemapsinplantsfromcrossesbetween heterozygousparents. Genetics 1990, 125: 645 – 654. 73.LuroF,LaigretF,LorieuxM,OllitraultP: Citrusgenomemappingwith molecularmarkers:twomapsobtainedbysegregationanalysisof progenyofoneintergenericcross. ProcIntlSocCitricult 1996, 2: 862 – 866. 74.VanOoijenJW: JoinMapW4,softwareforthecalculationofgeneticlinkage mapsinexperimentalpopulations .Wageningen,Netherlands:KyazmaB.V; 2006.http://www.kyazma.nl/index.php/mc.JoinMap/sc.General/. 75.vanOsH,StamP,VisserRG,vanEckHJ: SMOOTH:astatisticalmethodfor successfulremovalofgenotypingerrorsfromhigh-densitygenetic linkagedata. TheorApplGenet 2005, 112 (1):187 – 194. 76.WuY,BhatPR,CloseTJ,LonardiS: Efficientandaccurateconstructionof geneticlinkagemapsfromtheminimumspanningtreeofagraph. PLoS Genet 2008, 4 (10):e1000212. 77.VoorripsRE: MapChart:softwareforthegraphicalpresentationoflinkage mapsandQTLs. JHered 2002, 93: 77 – 78. 78.vanBerlooR: GGT2.0:versatilesoftwareforvisualizationandanalysisof geneticdata. JHered 2008, 99 (2):232 – 236.doi:10.1186/1471-2164-13-593 Citethisarticleas: Ollitrault etal. : Areferencegeneticmapof C. clementina hort.exTan.;citrusevolutioninferencesfromcomparative mapping. BMCGenomics 2012 13 :593. Submit your next manuscript to BioMed Central and take full advantage of: € Convenient online submission € Thorough peer review € No space constraints or color “gure charges € Immediate publication on acceptance € Inclusion in PubMed, CAS, Scopus and Google Scholar € Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Ollitrault etal.BMCGenomics 2012, 13 :593 Page20of20 http://www.biomedcentral.com/1471-2164/13/593



PAGE 1

Ollitrault et al. (2012) A reference genetic map of C. clementina hort ex Tan.; citrus evolution inferences from comparative mapping BMC Genomics .2012, 13:593. Additional file 7 : Sweet orange genetic map



PAGE 1

SNPs SSRs InDels Ollitrault et al. (2012) A reference genetic map of C. clementina hort ex Tan.; citrus evolution inferences from comparative mapping BMC Genomics .2012, 13:593. Additional file 5 : Chandler pummelo genetic map