The Molecular characterization of swinepox virus

MISSING IMAGE

Material Information

Title:
The Molecular characterization of swinepox virus
Physical Description:
xiv, 150 leaves : ill. ; 29 cm.
Language:
English
Creator:
Massung, Robert F., 1953-
Publication Date:

Subjects

Subjects / Keywords:
Research   ( mesh )
Suipoxvirus -- ultrastructure   ( mesh )
Suipoxvirus -- genetics   ( mesh )
Poxviridae -- genetics   ( mesh )
Gene Expression Regulation   ( mesh )
Poxviridae Infections -- pathology   ( mesh )
Amino Acid Sequence   ( mesh )
Base Sequence   ( mesh )
Molecular Sequence Data   ( mesh )
Genome, Viral   ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Immunology and Medical Microbiology -- UF   ( mesh )
Department of Immunology and Medical Microbiology thesis Ph.D   ( mesh )
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1991.
Bibliography:
Bibliography: leaves 133-148.
Statement of Responsibility:
by Robert F. Massung.
General Note:
Typescript.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 025206452
oclc - 25506672
System ID:
AA00013524:00001


This item is only available as the following downloads:


Full Text












THE MOLECULAR CHARACTERIZATION OF SWINEPOX VIRUS


By

ROBERT F. MASSUNG




















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

1991




































Copyright 1991

by

Robert F. Massung















ACKNOWLEDGEMENTS

I would like to thank Dick Moyer for his unending

support, advice and encouragement. He was always there to

give me direction when I needed it, while also providing the

freedom necessary for me to develop as a scientist. I also

want to thank Sue Moyer for the many contributions she has

made towards my work, and also the personal support she has

provided to myself and my family throughout these difficult

years of graduate school.

I thank all the members of the Moyer lab group for

their input and for making life in the lab enjoyable. I

particularly want to thank Joyce, the other "pig person" in

the lab, for her help on numerous facets of my work. I

appreciate the sequencing help from Duke and Dot, without

which I would still be running gels today.

I would like to thank the members of my committee, Paul

Gulig, Henry Baker and Carl Feldherr, for their advice and

support, and particularly Dr. Felherr for all his help with

my previous oocyte work. I also appreciate all the

assistance I received from other faculty members and

graduate students, too numerous to mention. In particular, I

want to thank Rich Condit for his assistance with the

sequencing project and for making me VAX literate.


iii









I thank my family, for without them nothing I have done

would have been possible. I thank my parents, Dorothea and

Fred, for never giving up on me and always being there when

I needed them. Lastly, and most importantly, I thank my

wife, Marcia, for her love, sacrifices and constant support

through the good and bad times, and my children, Robbie,

Breanne and Valerie, for helping me maintain the proper

perspective and allowing me to realize what is really

important in life.

















TABLE OF CONTENTS


ACKNOWLEDGEMENTS.....................................

LIST OF TABLES.......................................

LIST OF FIGURES ......................................

ABBREVIATIONS ........................................

ABSTRACT .............................................

CHAPTERS

1 INTRODUCTION...................................

2 MATERIALS AND METHODS.........................

Viruses and Cell Culture...................
Viral DNA Isolation........................
DNA Electrophoresis, Blotting and
Hybridization............................
Terminal Fragment Analysis................
Radiolabeling and Resolution of Protein
from Virus-Infected Cells...............
RNA Isolation and Northern Analysis.......
DNA Clonong and Sequence Analysis.........

3 COMPARATIVE ANALYSIS OF SPV VERSUS OTHER
POXVIRUSES ..................................

The Cross-hybridization of SPV DNA to the
DNA of Other Poxviruses.................
Immunoprecipitation of SPV and Vaccinia
Proteins With Homologous and
Heterologous Antisera..................

4 THE SWINEPOX VIRUS INFECTIOUS CYCLE............

Swinepox Virus Growth in Tissue Culture...
Kinetics of Vaccinia and SPV DNA
Accumulation ............................
Kinetics of Swinepox Virus Protein
Expression....................................


page

iii

vii

viii

x

xiii



1

10

10
11

13
14

17
20
21


25


26


27

33

34

34

39










Kinetics of Swinepox Virus mRNA
Synthesis................................ 45

5 ANALYSIS OF THE SPV GENOME.................... 48

Size of SPV Genomic DNA ................... 48
SPV DNA Terminal Crosslinks............... 52
Detailed Restriction Mapping of the SPV
Genome ................................. 55

Identification of SPV DNA Terminal
Fragments................................ 58
Length of the SPV DNA Inverted Terminal
Repeats................................. 65
Repeat Elements Within the SPV ITR's...... 69

6 PARTIAL SPV DNA SEQUENCE ANALYSIS............. 73

Analysis of SPV Conserved Region DNA
Sequence............................... 77
Analysis of SPV Terminal Region Sequence.. 87

7 SUMMARY AND CONCLUSIONS....................... 113

REFERENCES............................................ 133

BIOGRAPHICAL SKETCH.................................... 149
















LIST OF TABLES


page

5-1 Restriction fragment sizes of the swinepox
virus genome ................................... 57

6-1 The open reading frames deduced from the left
terminus of swinepox virus DNA................ 108















LIST OF FIGURES


page

3-1 Cross hybridization of swinepox virus DNA to
other poxvirus DNA's.......................... 29

3-2 Swinepox virus immunologic cross reactivity
with vaccinia virus........................... 31

4-1 Swinepox virus growth in tissue culture........... 36

4-2 Analysis of vaccinia virus and swinepox virus
DNA accumulation kinetics....................... 38

4-3 Kinetics of total protein expression in swinepox
virus infected tissue culture cells............ 41

4-4 Analysis of swinepox virus protein synthesis by
immunoprecipitation with anti-SPV sera......... 43

4-5 Kinetics of swinepox virus RNA synthesis.......... 47

5-1 Size of the swinepox virus genome................ 51

5-2 "Snapback" analysis of the Bgl I digest of
swinepox virus genomic DNA..................... 54

5-3 Swinepox virus restriction maps.................. 56

5-4 Identification of the terminal Hind III fragment
of swinepox virus DNA.......................... 61

5-5 Identification of the swinepox virus DNA
terminal fragments resulting from various
digests of SPV DNA...... ............ .......... 63

5-6 Schematic representation of the swinepox virus
inverted terminal repeat........................ 66

5-7 Length of the swinepox virus inverted terminal
repeats........................................ 68

5-8 Characterization of the swinepox virus terminal
repeat elements.................................. 71









6-1 Swinepox virus core open reading frames.......... 78

6-2 The complete nucleotide sequence and the deduced
amino acid sequences from the conserved core
of swinepox virus.............................. 80

6-3 Swinepox virus core open reading frames
comparison..................................... 85

6-4 Swinepox virus terminal open reading frames....... 89

6-5 Complete nucleotide sequence and the deduced
amino acid sequences near the left terminus
of swinepox virus.............................. 91

6-6 Swinepox virus and vaccinia virus open reading
frame homologues ................................ 110
















KEY TO ABBREVIATIONS

A Adenosine

A260 Absorbance260

AA Amino acid

bp Basepair

/-ME Beta-mercaptoethanol

BSA Bovine serum albumin

C Cytosine

CAR Cytosine arabinoside

Ci Curie

CPE Cytopathic effect

dATP Deoxyadenosine 5'-triphosphate

dCTP Deoxycytidine 5'-triphosphate

dGTP Deoxyguanosine 5'-triphosphate

DNA Deoxyribonucleic acid

dT Deoxythymidine

DTT Dithiothreitol

dTTP Deoxythymidine 5'-triphosphate

EDTA Disodium ethylenediamine tetraacetate

FBS Fetal bovine serum

G Guanosine

g Gravity

HC1 Hydrochloric acid









HEPES N-2-hydroxyethylpiperazine-N'-2-
ethane sulfonic acid

hr Hour

ITR Inverted terminal repeat

kb Kilobase

kbp Kilobasepair

kD Kilodalton

pCi Microcurie

qg Microgram

pl Microliter

mg Milligram

ml Millileter

mM Millimolar

mmol Millimole

min Minute

mRNA Messenger ribonucleic acid

nm Nanometer

NP40 Nonidet P-40

O.D.U. Optical density unit

PEG Polyethylene glycol

PBS Phosphate buffered saline

RNA Ribonucleic acid

SDS Sodium dodecyl sulfate

TBE Tris(99mM)/borate(99mM)/EDTA (mM)

TE Tris(50 mM)/EDTA(lmM), pH8.0

Tris Tris(hydroxymethyl)aminomethane










V Volt

V-hr Volt-hour















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

THE MOLECULAR CHARACTERIZATION OF SWINEPOX VIRUS

By

Robert F. Massung

May, 1991

Chairman: Richard W. Moyer
Major Department: Immunology and Medical Microbiology

Swinepox virus, the prototype and only member of the

Suispoxvirus genus, has not been previously characterized at

the molecular level, and its classification is based solely

on in vitro neutralization assays. We have analyzed the DNA

of this virus and demonstrate that the genome is 175

kilobases in size and, like the more commonly studied

Orthopoxvirus, Avipoxvirus and Leporipoxvirus genera, is

terminally cross-linked and contains inverted terminal

repetitions. The length of the inverted repeats are shown to

be approximately 5 kilobases, and the DNA comprising these

repeats are unstable, probably due to the presence of a

variable number of direct repeats 70 basepairs in length.

Restriction endonuclease cleavage maps for the enzymes

HindIII, Aval, HaeII, KpnI, BlIl, SalI and XhoI are also

presented.


xiii









The growth characteristics of swinepox virus in tissue

culture were examined by light microscopy and revealed both

a delayed and different cytopathology compared to that of

vaccinia virus, the prototype poxvirus. Gene expression was

characterized at the levels of DNA accumulation, RNA

transcription and protein synthesis, and the kinetics of

each facet of expression are shown to be considerably

delayed when compared to vaccinia.

Studies based on low stringency hybridizations of

radiolabeled swinepox virus DNA to Southern blots containing

DNA of representative members of various other poxvirus

genera revealed no DNA homology at this level of resolution.

The antigenic relateness between swinepox and vaccinia virus

was analyzed by immunoprecipitations and revealed little, if

any, cross-reactivity.

We have analyzed the genetic content of swinepox virus

by sequencing the DNA from selected regions of the genome. A

region sequenced from within the central core of DNA was

shown to have a high degree of homology to the analogous

region of vaccinia virus DNA. However, the DNA sequence from

the terminal region of the swinepox virus genome was

remarkably dissimilar to the same region of vaccina DNA. The

combined data indicates that swinepox virus is unique from

other poxviruses characterized to date and confirms the

previous classification of swinepox virus into a separate

genus within the poxvirus family.















CHAPTER 1

INTRODUCTION

The poxviruses comprise a large and diverse family of

viruses which, as a group, are capable of infecting a wide

variety of hosts ranging from insects to man. The severity

of natural infections vary widely from highly virulent to

subclinical. Some, such as Variola in man or Ectromelia in

mice, frequently result in host death. Others, such as

swinepox virus (SPV), result in a mild, often inapparent

infection. Several other poxviruses, including Shope fibroma

virus (Shope, 1932), Yaba tumor virus (Bearcroft and

Jamieson, 1958) and Molluscum contagiosum (Brown et al.

1981), have been implicated in tumor induction. Likewise,

the range of host specificity varies drastically among the

individual members of the family. Many, such as SPV and

ectromelia, are limited to a single host species, whereas

others, such as vaccinia virus, the most well studied member

of the family, demonstrate a very wide host range. The

reasons responsible for the variations noted among the

various members of the poxvirus family with regard to host

range and pathogenicity are not well understood at the

molecular level, partly because poxviruses, and the

expression of their genes, are quite complex.









2

Poxviruses are among the largest animal viruses. The

virions are approximately 250 x 350 nm in size and are often

referred to as brick shaped. More than 100 polypeptides can

be resolved by two dimensional electrophoresis of purified

virions (Essani and Dales, 1979; Oie and Ichihashi, 1981).

The double stranded DNA of these viruses is packaged within

a biconcave core composed of a lipoprotein bilayer. In the

vertebrate poxviruses, two stuctures of unknown function

termed lateral bodies are located outside the core and

within the concavities. The core and lateral bodies are

surrounded by an outer membrane or envelope. Upon infection

of a susceptible host, the first event to occur is the

removal of this outer membrane via fusion with either the

host cell membrane or an endocytic vesicle membrane (Chang

and Metz, 1976; Dales, 1973; Dales and Kajioka, 1964). The

removal of this outer membrane appears to be the signal

required for the initiation of viral gene expression because

expression can also be induced in vitro by removing the

outer membrane by treatment with a nonionic detergent and a

reducing agent (Paoletti, 1977).

Poxvirus genomes range in size from approximately 130

to 300 kb, and every one examined to date has termini that

are covalently cross-linked. The termini of these viruses

also contain inverted terminal repetitions (ITRs) of

variable length, the only possible notable exception being

variola, the causative agent of smallpox (Dumbell and









3

Archard, 1980; Esposito and Knight, 1985). In contrast to

most members of the poxvirus family, vaccinia has been

intensively studied at the molecular level, and the entire

genome of the Copenhagen strain and most of the Western

Reserve strain have recently been sequenced. The Copenhagen

strain has a genome of 191.6 kilobasepairs, ITRs of 12 kbp,

a nucleotide composition of 66.6% A+T, and potentially

encodes for greater than 200 polypeptides (Goebel et al.,

1990). Genes are transcribed from both strands. There are no

introns, and many of the open reading frames are arranged in

a head to tail tandem orientation with very short

untranscribed intergenic regions (Earl and Moss, 1989). Most

of the genes essential for replication are clustered in the

central area of the genome, while the regions near the

termini are nonessential, at least in tissue culture, and

much more variable in terms of genetic content (Mackett and

Archard, 1979; Esposito and Knight, 1985).

Poxvirus gene expression is classically and for

simplicity, divided into two phases: early and late. Early

gene expression initiates rapidly after uncoating, utilizes

enzymes packaged within the virion, and must occur prior to

subsequent late gene expression. Early messages are capped,

polyadenylated, and have discrete 5' and 3' termini (Moss,

1990). The beginning of late gene expression coincides with

the initiation of DNA replication and results in the

synthesis of gene products required for viral morphogenesis









4

(Dales and Pogo, 1981; Moss, 1990). Late messages are also

capped and polyadenylated, but also include a unique

nonencoded 5' poly(A) leader and heterogeneous 3' ends due

to a deficiency in transcriptional termination (Bertholet et

al., 1987; Schwer et al., 1987). However, recently a subset

of genes referred to as "intermediate" have been identified

that are expressed after the initiation of replication but

appear to be independent of replication per se, requiring

only a naked template (Vos and Stunnenberg, 1988; Keck et

al., 1990). Therefore, it seems likely that a much more

complex cascade model of gene expression, as noted for other

viral families such as the herpesviruses (Roizman and

Batterson, 1985), is emerging for the poxviruses.

Poxvirus gene expression and the kinetics of DNA

replication in cell culture has been best characterized for

the Orthopoxvirus genus, with most of the studies performed

with vaccinia virus. For vaccinia, early gene expression

begins rapidly after uncoating, replication begins at 2-4 hr

postinfection, and late gene expression is observed as early

as 3-5 hr postinfection (Carrasco and Bravo, 1986; Kates and

McAuslan, 1967a; Moss and Salzman, 1968; Munyon and Kit,

1966; Pennington, 1974). Some poxviruses of other genera,

such as the leporipoxviruses, have been shown to exhibit

kinetics similar to vaccinia (Pogo et al., 1982). Others,

such as the avipoxviruses and tanapoxviruses, have been

reported to be "slow" relative to vaccinia but have not been











well characterized at the molecular level (Knight et

al.1989; Schnitzlein et al.1988).

One of the unique characteristics common to all members

of the poxvirus family is that the entire lifecycle of the

virus occurs in the cytoplasm of the host cell. A

consequence of a cytoplasmic site of development is that

these complex viruses encode many enzymes, including those

needed to initiate viral transcription such as a DNA

dependent RNA polymerase (Kates and McAuslan, 1967; Munyon

et al., 1967), capping and methylating enzymes (Ensinger et

al., 1975; Martin and Moss, 1975; Martin et al., 1975;

Martin and Moss, 1976; Moss et al., 1975b; Moss et al.,

1976; Shuman et al., 1980; Wei and Moss, 1974; Wei and Moss,

1975), and a poly (A) polymerase (Moss et al., 1973; Moss

and Rosenblum, 1974; Moss et al., 1975a). Poxviruses also

encode numerous enzymes involved in DNA metabolism including

a DNA polymerase (Challberg and Englund, 1979; Earl et al.,

1986; Jones and Moss, 1985; Traktman et al., 1984),

topoisomerase (Bauer et al., 1977; Shuman and Moss, 1987),

and ribonucleotide reductase (Slabaugh et al., 1988;

Tengelsen et al., 1988), and they express these genes at

early times. The majority of late gene expression is

dedicated to the synthesis of viral structural proteins,

viral enzymes that are packaged within the virions, and

other factors involved in the morphogenesis of immature











virions to mature viral particles (Bauer et al., 1977; Moss

et al., 1973).

The potential for vaccinia to be used as a multipurpose

live vaccine vector has been the subject of much interest

within the last decade (Tartaglia et al., 1990; Moss and

Flexner, 1987). More recently, fowlpox virus, a member of

the Avipoxvirus genus, has been suggested as a suitable

vector strain (Boyle and Coupar, 1988; Taylor and Paoletti,

1988). In theory, any poxvirus has the potential to be

adapted and manipulated to serve as a live virus vaccine

vector. However, there are certain features inherent in many

poxviruses that are disadvantageous with respect to their

use as vaccine vectors. One such problem with some members

is their general promiscuity, or lack of strict species

specificity, which in turn might lead to the spread of the

vector in the field to animal species other than those for

which the vaccine is intended. A more important concern is

the innate virulence of many of these viruses, such as

vaccinia, which normally produces an acute systemic

infection, and occasionally results in post-vaccinial

encephalitis (PVE) with a mortality rate of 25% (Fenner et

al., 1989). The ideal poxvirus to be selected for vaccine

development would elicit a strong immune response with

limited virulence, and be capable of infecting only the

species to be vaccinated, which would eliminate the

possibility of spread of the virus through the environment









7

to non-intended hosts. One poxvirus which potentially

fulfills all these criteria is swinepox virus (SPV), the

type species and only reported member of the genus

Suipoxvirus (Matthews, 1982). This virus has previously been

uncharacterized except with regard to the ultrastructure of

the virion, and the pathology and histopathology of

infections in swine (Cheville, 1966; Conroy and Meyer, 1971;

Meyer and Conroy, 1972; Kasza et al., 1960). The

classification of SPV was based primarily on serological

data, specifically the reported lack of neutralizing

antibodies that are cross-reactive with members of the other

poxvirus genera (Shope, 1940; Schwarte and Biester, 1941).

Swinepox virus is species specific in that it only infects

swine (Datt, 1964), and the clinical presentation is that of

a mild, self-limiting infection, with lesions detected only

in the skin and regional lymph nodes (Kasza and Griesemer,

1962). This is in contrast to numerous other poxviruses

such as vaccinia, capripox, ectromelia, and fowlpox viruses,

for which infection of susceptible hosts results in spread

to and lesions of internal organs. However, before swinepox

virus can be explored as a potential live virus vaccine, a

physical, molecular and biological characterization of the

virus and its development within the host is required. This

information would also be very useful in terms of

taxonomically classifying this virus, allowing us to

determine the evolutionary divergence of swinepox virus as









8

compared to the other members of the poxvirus family, and

extend our overall knowledge of the biological properties of

the entire poxvirus family.

The work presented here provides the first extensive

examination of swinepox virus infections at the biological

and molecular levels. The restriction endonuclease cleavage

maps for seven enzymes within the SPV genome have been

determined. The complexity of the viral genome has also been

determined, and evidence is presented that the termini of

the DNA are covalently closed. These data are consistent

with the presence of both tandem and inverted terminal

repeats near the termini of the genome. These studies have

demonstrated that many of the distinct genomic features

common to the members of the poxvirus family have been

conserved within another, and until now, unexamined member

of the Chordopoxviridae subfamily of the family Poxviridae.

The work presented suggests that there is no gross

detectable homology at the DNA level between SPV and the

ortho-, lepori-, avi- or entomopox virus groups via

hybridization data. The data also demonstrate that there is

little or no antigenic cross-reactivity between vaccinia and

swinepox virus as evidenced by immunoprecipitations with

appropriate antisera. This work shows that vaccinia and SPV

infections of a given tissue culture cell line differ

dramatically, both in the eventual outcome of the infection

(plaques for vaccinia versus foci for SPV) and in the time









9

required for cytopathic effects (CPE) to become visible.

Also examined are the kinetics of DNA accumulation, protein

synthesis, and RNA transcription. These studies demonstrate

that the development of swinepox virus within its host cell

is delayed when compared to that of the ortho- and

leporipoxviruses. The DNA sequence of approximately 2.8

kilobases from the central conserved core region and 7.6

kilobases near the left terminus of the SPV genome is

presented. The open reading frames deduced from the core

region sequence are highly conserved with regard to other

paxviruses, while the terminal sequence demonstrates little

conservation. Therefore, despite the similarity in terms of

genomic features and the conservation noted in the sequence

of the conserved region, the evidence presented here

indicates that SPV is indeed unique from vaccinia and other

poxvirus family members, and confirms the previous

classification of SPV into a separate genus.















CHAPTER 2

MATERIALS AND METHODS

Viruses and Cell Culture

Vaccinia virus (IHD-J strain) and swinepox virus (Kasza

strain) were obtained from the American Type Culture

Collection. Vaccinia strain IHD-W was obtained from B. Pogo

(Mt. Sinai School of Medicine), Shope fibroma virus from G.

McFadden (University of Alberta), myxoma virus from Dr. D.

Strayer (Univ. of Texas Health Science Center), Amsacta

moorei entomopox virus (AmEPV) from R. Hall and F. Hink

(Ohio State University), and fowlpox virus (CEVA strain)

from D. Tripathy (University of Illinois-Urbana). Vaccinia

was grown in either Rat 2 or porcine kidney (PK-15) cells,

swinepox virus in PK-15 cells, and myxoma and Shope fibroma

virus in rabbit kidney (RK-77) cells. Each of these cell

lines was maintained as monolayers in Eagle's MEM (F-ll;

GIBCO laboratories) supplemented with 10% fetal bovine

serum, 2 mM glutamine, 100 units penicillin, 100 pg

streptomycin and 0.1 mg pyruvate per ml. Fowlpox virus (FPV)

was grown in quail (QT-35) cells maintained as monolayers in

Opti-MEM media (GIBCO Laboratories) supplemented with 5%

fetal bovine serum, 2 mM glutamine, 100 units penicillin,

100 gg streptomycin and 0.1 mg pyruvate per ml. AmEPV was









11

grown in gypsy moth (IPLB-LD-652) cells obtained from Ed

Dougherty (Insect Pathology Laboratory, USDA, Beltsville,

MD) which were cultured in Excell 400 (J R Scientific)

supplemented with 5% fetal bovine serum.



Viral DNA Isolation

Viral DNA was isolated by one of two protocols. For

vaccinia, Shope fibroma and myxoma viruses, virions were

initially purified by the method of Moyer and Rothe (1980).

The procedure involved first pelleting the virus through a

pad of 1.46 M sucrose followed by banding of the virus on

potassium tartrate gradients. The viral band was then

diluted with PBS and pelleted through another 1.46 M sucrose

pad in order to remove the potassium tartrate. The DNA was

subsequently extracted by lysis of the purified virions in a

solution containing 1% sodium dodecyl sulfate (SDS) and 100

mg/ml proteinase K (Boehringer) which was then allowed to

digest for 3 hr at 600 C followed by three extractions with

an equal volume of phenol:chloroform (1:1) and ethanol

precipitation.

For the isolation of DNA from swinepox, fowlpox, and

AmEPV tissue culture cells infected at a multiplicity of 0.1

were collected at 4-6 days postinfection by first scraping

the cells into the medium followed by centrifugation at 800

x g for 5 min at 40 C. Each 5 x 106 of infected cells was

then resuspended in 0.5 ml phosphate buffered saline (PBS=10









12

mM sodium phosphate plus 150 mM NaCl [pH 7.2]) that

contained 40 mM EDTA and incubated for 5 min at 370 C. Next

0.5 ml of 1.5% low melt agarose (SeaPlaque, FMC) containing

120 mM EDTA, prewarmed to 420 C, was added to the cells and

gently mixed until a uniform suspension was achieved. The

suspension was transferred to an agarose plug mold (BioRad),

and the agarose allowed to solidify for 15 min at room

temperature. The agarose plugs were then removed from the

mold and incubated for 12-16 hr at 500 C in plug lysis

buffer (1% Sarkosyl, 100 pg/ml proteinase K, 10 mM Tris-HCl

[pH 7.5], and 200 mM EDTA). The lysis buffer was then

removed and replaced with 5 ml of sterile 0.5 x TBE

electrophoresis running buffer ( 1 x TBE is 89 mM Tris base,

89 mM boric acid, 1 mM EDTA) and equilibrated at 40 C for 6

hr with 3 changes of 0.5 x TBE buffer. The viral DNA was

separated from the cellular RNA and DNA contained within the

agarose plug by electrophoresis of the plug using the CHEF

(Bio-Rad) pulsed field system. Samples were loaded into a

continuous well of a 15 cm 1% agarose gel (SeaKem LE, FMC)

and electrophoresis was for 20 hr at 180 V with a continuous

ramp of 50-90 sec and performed at 150 C in 0.5 x TBE. The

isolated band of viral DNA was visualized by staining with

ethidium bromide (0.5 gg/ml), excised from the gel and

electroeluted from the agarose by electrophoresis in 0.5 x

TBE for 2 hr at 100 V in dialysis tubing followed by a 30

sec reverse pulse. The electroeluted viral DNA was ethanol









13

precipitated and resuspended in TE (50 mM Tris-HCl [pH 8.0],

1 mM EDTA) for analysis. Approximately 50 ig of SPV viral

DNA can be obtained from 107 cells by this method.



DNA Electrophoresis, Blotting and Hybridization

The preparation of blots for the terminal fragment

analyses and the Southern cross-hybridization analysis

involved the digestion of purified viral DNA with the

appropriate restriction endonucleases and electrophoresis in

a 22 cm, 0.8% agarose gel for 800 V-hr in Tris-phosphate

buffer (30 mM sodium phosphate monobasic, 36 mM Tris base, 1

mM EDTA [pH 7.7]). The DNA was transferred to a nylon

membrane (Hybond-N, 0.45 micron, Amersham) by a modified

Southern blotting protocol (Southern, 1975) involving acid

hydrolysis and alkaline denaturation of the DNA. Briefly,

the gels were soaked for 2 x 15 min in hydrloysis buffer

(0.25 M HC1), 2 x 15 min in denaturation buffer (0.5 M NaOH,

1.5 M NaCl), and finally, 2 x 15 min in neutralization

buffer (0.5 M Tris-HC1 [pH 7.2], 1.5 M NaCl). Capillary

transfer was for 16 hr with low ionic strength phosphate

buffer (25 mM sodium phosphate [pH 6.5]). The blots were air

dried and UV irradiated with 120 millijoules using the UV

Stratalinker 1800 (Stratagene) to fix the DNA.

DNA probes were made by radiolabeling the DNA with

[32P]dCTP (3000 Ci/mmol, Amersham) to a specific activity of

greater than 109 using the random oligo primer extension









14

method of Feinberg & Vogelstein (1983). Prehybridizations

were at 630 C for lhr with blotto (non-fat dry milk,

Carnation) (Johnson et al., 1984) in 6 x SSC, and

hybridization was carried out for 16 hr at the same

temperature in the same solution. Washes were with 2 x SSC,

0.1% SDS for 2 x 15 min at room temperature followed by 2 x

15 min at 630 C. The blots were then exposed to Kodak X-Omat

AR film at -700 C.

For experiments designed to measure the accumulation of

viral DNA, electrophoresis was performed on the CHEF

apparatus and involved the suspension of total infected cell

samples in agarose plugs (approximately 106 cells/200 M1

plug) as previously described for SPV DNA purification.

Southern blotting, probe synthesis, hybridization and

autoradiography were the same as described above with the

temperature of the hybridization and the last set of washes

at 630 C.

The pulsed field electrophoresis used to determine the

size of the swinepox virus genome utilized the same

electrophoretic conditions as described above for the

isolation of swinepox virus DNA from infected tissue culture

cells. The DNA was subsequently stained with ethidium

bromide and the gel photographed.



Terminal Fragment Analysis

The identification of the restriction fragments

resulting from a BIll digest of SPV DNA that contain the









15

terminal hairpins of the SPV genome employed the snapbackk"

method of analysis as previously described (Esposito et al.,

1981; Wills et al., 1983). Following digestion, the

resulting fragments were subject to heat denaturation (950 C

for 5 min) followed immediately by rapid cooling in an ice

water bath. The fragments were separated by pulsed field

electrophoresis for 16 hr at 150 V with a continuous ramp

from 50 to 90 seconds followed by 6 hr at 180 V with a

continuous ramp from 1 to 4 seconds.

The examination of the terminal heterogeneity involved

first the restriction enzyme digestion of genomic DNA. The

restriction fragments were then end labeled by a "filling

in" reaction using [32P]dCTP (3000 Ci/mmol, Amersham) and

the large fragment of E. coli DNA polymerase (New England

Biolabs) as described by Maniatis et al. (1982). After

labeling, fragments were electrophoretically separated on

standard 0.8% agarose gels as described above. The gels were

collapsed onto slab gel drying paper (Bio-Rad) by subjecting

the gels to 2 hr under vacuum without heat using a slab gel

dryer (Hoefer Scientific Instruments, Model SE1160). The

collapsed gels were then subjected to autoradiography at

-700 C.

The analysis of the length of the inverted terminal

repeats involved the preparation of a Southern blot

containing restriction enzyme HaeII digested genomic

swinepox virus DNA. The DNA was restriction digested, loaded

into a 4 cm continuous well, and electrophoresed for 150 V-









16

hr through a 10 cm 0.8% agarose gel (SeaKem LE, FMC). The

DNA was transferred to a nylon membrane (Hybond-N, 0.45

micron, Amersham) as previously described. The membrane was

cut into 0.5 cm wide strips and hybridized individually to

specific probes from near the the left terminus of the SPV

genome. The probes were derived from larger cloned DNA

fragments that were digested with appropriate restriction

enzymes and separated electrophoretically for 150 V-hr in a

10 cm low melting point 0.8% agarose gel (SeaPlaque GTG,

FMC) using 1 x Tris acetate buffer containing 0.1 mM EDTA.

The subfragments of interest were cut out of the gel, melted

at 950 C for 10 min, and [32P]dCTP (3000 Ci/mmol, Amersham)

radiolabeled using a modification of the technique described

by Feinberg and Vogelstein (1983). The melted gel slices

were maintained at 420 C to prevent solidification of the

agarose and 32 1l of the slice combined with a mixture,

prewarmed to 370 C, containing 5 Al [ P]dCTP (10 ACi/ul,

3000 Ci/mmol, Amersham), 2 Al of 10 mg/ml BSA, 1 Al of DNA

polymerase (50 U/Ml, New England Biolabs), and 10 pA of

oligonucleotide labeling buffer (250 mM Tris HC1 [pH 7.6]; 1

M HEPES [pH 6.6]; 28 mM magnesium chloride; 0.3 mM EDTA; 86

MM dATP, dGTP, dTTP; 48 mM mercaptoethanol; 27 A260 O.D.U.

random sixmer oligonucleotide mix [pd(n6) Amersham]). The

labeling reaction (total volume=50 Al) was at 370 C for 1

hr. The blots were prehybridized for 1 hr at 400 C in

approximately 7 ml of solution containing 40% formamide, 2.5

x Denhardt's (100 x Denhardt's=2% [w/v] BSA, 2% [w/v]









17

Ficoll, 2% [w/v] polyvinyl pyrrolidone), 6 x SSPE (20 x

SSPE=3.6 M NaC1, 0.2 M sodium phosphate, 0.02 M EDTA), 0.1%

SDS, and 2.5 mg denatured salmon sperm DNA. The radiolabeled

probes were denatured by heating to 950 C for 5 min, quick

cooled, and then added directly to the prehybridization

solution. Hybridization was for 16 hr at 400 C. The blots

were washed individually with 50 ml of 2 x SSPE, 0.1% SDS

for 2 x 15 min at room temperature, dried, and exposed to

film.



Radiolabelinq and Resolution of Protein from
Virus-Infected Cells


Confluent monolayers of PK-15 cells were infected with

swinepox virus or vaccinia virus at a multiplicity of 5.

Adsorption was for 2 hr at 370 C in the normal growth media

previously described but lacking FBS. After adsorption, the

infected cells were maintained in normal growth media that

contained 10% FBS. Radiolabeling was performed in media

lacking methionine for 1 hr with [35S]methionine (1000

Ci/mmol, Amersham) using 60 MCi per 5 x 106 cells. All

samples were collected immediately after labeling. The

samples used for total protein analysis were harvested by

scraping the cells into the medium and pelleting them at 800

x g. The pellet was suspended in 1 ml of PBS, pelleted

again, and the supernatant removed. The cell pellet was then

lysed by the addition of 100 ul of sample buffer (0.2% SDS,









18

5% glycerol, 0.2% ME, 15% urea, 50 mM EDTA and 80 mM Tris

HC1 [pH 8.7]) and stored at -700 C prior to use.

Radiolabeled proteins were resolved by electrophoresis

on 10% SDS polyacrylamide (30:1 acrylamide/bis ratio) gels.

Samples were subjected to electrophoresis at 70 V for 16 hr

in Tris-glycine buffer (25 mM Tris base, 200mM glycine, 0.1

% [w/v] SDS). Gels were processed for fluorography as

described by Bonner and Laskey (1974), dried onto filter

paper (BioRad, slab gel drying paper), and exposed to film

at -700 C.

The immunoprecipitations involved the radiolabeling of

uninfected or virus infected cells as described above.

Immediately after radiolabeling, the cells were scraped into

the medium, chilled, pelleted by centrifugation at 800 x g

for 5 min at 40 C, and resuspended in 0.5 to 1.0 ml of RIPA

buffer (0.15 mM NaCl, 1% SDS, 1% Triton X-100, 0.1% sodium

deoxycholate, 10mM Tris hydrochloride [pH 7.4], 100,000 U of

aprotinin per ml) plus 1 mM phenylmethylsulfonyl fluoride.

The cells wre incubated at 40 C for 30 min and then

sonicated briefly. All subsequent steps were also performed

at 40 C. Cellular debris was pelleted by centrifugation at

12,800 x g for 10 min. The supernatant was removed and

stored at -700 C prior to immunoprecipitation. Equal amounts

(100 Al) of supernatant and NET-NP40 (0.5% NP40, 150 mM

NaC1, 5 mM EDTA, 50 mM Tris hydrochloride [pH 7.4] were

combined and added to 50 Al of a 10% suspension of

Staphylococcus aureus (Cowen strain) which had been heat









19

killed, fixed, and stored as a 10% solution in NET-NP40.

Each sample was mixed, incubated for 15 min, mixed again,

and incubated for an additional 15 min. Samples were then

centrifuged for 3 min at 10,000 x g to remove proteins

adhering nonspecifically to the bacterial surface. The

supernatant was removed and mixed with 3 l1 of undiluted

polyclonal rabbit anti-vaccinia (ATCC) or swine anti-SPV,

obtained from swine infected experimentally by

scarification, and incubated for 12-15 hr. Samples were then

mixed with 50 Al of the S. aureus suspension, incubated for

15 min, mixed, and incubated an additional 15 min. The

bacterial pellets were collected by centrifugation at 10,000

x g for 1.3 min. The supernatant was discarded and the

pellet was suspended in 800 gl of NET-NP40. The suspension

was pelleted two additional times in order to minimize

nonspecific adherence of protein. The final pellet was

suspended in 50 gl of immunoprecipitation lysis buffer (2%

SDS, 30 mM Tris hydrochloride [pH 6.8], 1.5% DTT, 20%

glycerol, and 0.05% bromphenol blue) by water bath

sonication. The samples were then heated to 1000 C for 2 min

and cooled to room temperature. Bacterial debris was

pelleted by centrifugation at 10,000 x g for 3 min, and the

resulting sample supernatants were analyzed by

polyacrylamide gel electrophoresis as described previously.









20

RNA Isolation and Northern Analysis

Total RNA was isolated from uninfected PK-15 cells or

cells infected with swinepox virus at a multiplicity of 5 by

the guanidinium isothiocyanate/cesium chloride method

(Glisin et al., 1974; Chirgwin et al., 1979). The poly (A1)

mRNA was isolated by oligo dT affinity chromatography (Aviv

and Leder, 1972). The resultant mRNA was resolved by

electrophoresis on a 1.4% formaldehyde/agarose gel for 800

V-hr at room temperature (Lehrach et al., 1977). Capillary

transfer to nitrocellulose (Schleicher and Schuell) was for

16 hr with 20 X SSC, and the membrane was baked for 2 hr at

800 C under vacuum. Prehybridization was for 4 hr at 400 C

in 50% deionized formamide, 6 x SSPE (20 x SSPE=3.6 M NaCl,

0.2 M sodium phosphate, 0.02 M EDTA), 5 x Denhardt's (100 x

Denhardt's=2% [w/v] BSA, 2% [w/v] Ficoll, 2% [w/v] polyvinyl

pyrrolidone) and 0.1% SDS with 2.5 mg denatured salmon sperm

DNA in a final volume of 50 ml. The probe was radiolabeled

with [32]dCTP (3000 Ci/mmol, Amersham) by the random primer

oligo extension method (Feinberg and Vogelstein, 1983).

Hybridization was at 400 C for 16 hr in 50 ml of the

prehybridization solution. The hybridized blot was washed

for 2 x 15 min at room temperature in 2 x SSC, 0.1% SDS and

autoradiography was as described previously for the Southern

blots.









21

DNA Cloning and Sequence Analysis

Cloning of the regions of the SPV genome into bacterial

plasmid vectors involved the digestion of the viral DNA into

easily cloned fragments (<8 kilobase) with appropriate

restriction enzymes, and subsequent ligation into the

pBlueScript KS+ phagemid (Stratagene). All ligations,

including those into M13, were done at 150 C for 12-18 hr.

Each restriction fragment analyzed was sequenced

individually. The alignment of adjacent clones, when in

doubt, was confirmed by polymerase chain reaction using

primers that corresponded to the ends of the individual

clones. The entire sequencing project was accomplished by a

combination single stranded M13 based dideoxy-sequencing and

double stranded plasmid based dideoxy-sequencing in order to

maximize the accuracy of the sequence, while minimizing the

time required.

Beginning with a single SPV fragment cloned into the

BlueScript KS+ vector, M13 based sequencing was used to

generate the majority of the sequence data. The M13 clones

were generated from the cloned SPV fragments by the

following protocol. Individual SPV fragments were sheared

randomly by sonication, and the 400-600 bp fragments were

separated by gel electrophoresis and extracted from the gel

by the freeze squeeze technique. The fragments were then

"blunt-ended" with T4 DNA polymerase (International

Biotechnology Incorporated) and ligated into the SmaI site

of the double-stranded replicative form of M13mpl9 (Messing









22

et al., 1977; Messing and Vieira, 1982). The ligation

products were transformed into E. coli (strain UT 481), made

competent by the rubidium chloride method (Kushner, 1978),

and grown for 12-16 hr on nonselective media (2 x YT).

Plaques were tested by hybridization to the parent SPV

clone, and positive plaques were picked individually and

grown for 7-14 hr in 1.5 ml of 2 x YT with a 1:100 diluted

inoculum of a log phase culture of UT 481 cells. Bacteria

were then pelleted by centrifugation ( 5 min at 12,800 x g),

and the supernatant, containing the single stranded

infectious M13 clones, was removed and stored at 40 C. A

second growth phase, overnight in 10 ml of 2 x YT, with an

inoculum of 100 Al of the M13 supernatant and 40 41 of log

phase bacteria, was then used to amplify the clones. The

bacteria were pelleted, as before, and 8 ml of the

supernatant was removed. The phage were precipitated from

the supernatant by a 20 min incubation at room temperature

following the addition of 2 ml of NaCl-PEG (2.5 M NaC1, 20%

[w/v] PEG-8000). The precipitated M13 phage clones were

pelleted by centrifugation for 10 min at 8000 x g,

resuspended in 300 Al TE (50 mM Tris, 1 mM EDTA [pH 8.0]),

and extracted one time with an equal volume of phenol and

then once with an equal volume of chloroform. The DNA was

ethanol precipitated (5 min at -700 C), pelleted (15 min at

12,800 x g), and resuspended in 40 il of TE. Exactly 2 pl of

this resuspended M13 clone was then used as the template for

each sequencing reaction. The individual clones were









23

sequenced from these single-stranded clones utilizing a

single universal primer (New England Biolabs #1212) located

near the cloning site. All sequencing reactions employed the

dideoxynucleotide chain termination method (Sanger et al.,

1977; Sanger et al., 1980), using a modified T7 polymerase

(Tabor and Richardson, 1987)(Sequenase, Promega), and

utilized the incorporation of [35S]dATP, as described in the

manufacturer's DNA sequencing instruction manual (United

States Biochemical Corpoation). Sequencing reaction products

were separated by electrophoresis for 42,000 V-hr on 8%

polyacrylamide gels (83 cm length; 0.4 mM thick) containing

11.2 M urea, using the BRL (Bethesda Research Laboratory)

model Sl sequencing gel apparatus, and a Bio-Rad model

3000Xi power supply. Following electrophoresis, the gels

were soaked for 15 min in fixing solution (5% methanol; 5%

acetic acid), and dried onto filter paper (Whatman 3 MM)

under vaccuum for 40 min at 700 C. The dried gels were

subjected to autoradiography at -700 C.

The DNA sequences obtained for individual clones were

manually entered into a Macintosh IIci computer using the

DNA Inspector II+ program. The files were subsequently

transferred to a DEC VAX, the DNA sequence analyzed, and

contiguous sequences aligned using the program of Staden

(1986). After completion of approximately 90-95% coverage

for a given fragment, sequencing directly from the SPV

fragment cloned in the plasmid vector was utilized. This

required the synthesis of specific primers adjacent to the









24

gaps present in the sequence, and utilized the same

sequencing protocol as used for the M13 sequencing. However,

the double stranded plasmid DNA required denaturation (in

0.2 M sodium hydroxide for 5 min at room temperature) and

ethanol precipitation (with 1.5 M ammonium acetate) prior to

the annealing reaction. The use of plasmid sequencing

allowed for the rapid and specific compilation of the

remaining sequence for the gaps within the M13 derived data.

The University of Wisconsin Genetics Computer Group

programs (Devereux et al., 1984) were used to analyze the

completed DNA sequence data for putative open reading

frames, and detect the homology of SPV open reading frames

to other sequences in the genbank database. Specifically,

TFASTA (Pearson and Lipman, 1988) was used to compare each

SPV open reading frame to the genbank database, and identify

homology to existing proteins. The ALOM program (Klein et

al., 1985), of the MIT DNA analysis package, was used to

detect potential membrane spanning domains. The MacPattern

program (Fuchs, 1990) was used to identify potential protein

modification sites.















CHAPTER 3

COMPARATIVE ANALYSIS OF SPV VERSUS OTHER POXVIRUSES

The poxviruses are an extremely diverse family of

viruses. The proper classification of individual members is

a subject of debate as new members of the family are

discovered. The classification of a novel virus into the

Poxviridae family is based on several characteristic

features common among all members including the morphology

of the virion and the cytoplasmic location of the entire

viral lifecycle (Matthews, 1982). The family is divided into

two subfamilies, the Chordopoxvirinae and the

Entomopoxvirinae, based on host range; the Chordopoxvirinae

containing poxviruses capable of infecting vertebrate hosts

and the Entomopoxvirinae those that infect invertebrate

hosts. There is no known poxvirus that is capable of

infecting both a vertebrate and invertebrate host. The

Chordopoxvirinae subfamily is further subdivided into

numerous genera based on antibody neutralization data.

Namely, that an antiserum directed against one member of a

given genus will neutralize the infectivity of all other

members of that same genus, but will not neutralize members

of other genera. This is the basis for classifying SPV into

its own separate genus, Suispoxvirus. However, the data in









26

the literature regarding SPV conclude that SPV infections

induce no neutralizing antibodies (Shope, 1940; Schwarte and

Biester, 1941). Therefore, this classification based on a

neutralization assay would seem rather tenuous. Additional

support for the uniqueness of SPV includes several features

noted in natural infections including limited pathogenesis,

restricted host range, and the extended duration before

clearing of the virus (Datt, 1964; Cheville, 1966; Conroy

and Meyer, 1971; Kasza et al., 1960; Kasza and Griesemer,

1962; Shope, 1940). However, considering all the evidence,

there clearly existed the possibility that SPV was merely an

attenuated version of some other poxvirus, such as vaccinia,

for which attenuated deletion mutants have been described

that exhibit limited host range and pathogenesis (Perkus et

al., 1990a). Therefore, several experiments were designed to

test the relatedness of SPV to other poxviruses, and to

vaccinia in particular. These included assays at the DNA

level by DNA cross-hybridizations, and at the level of

immuno-crossreactivity via immunoprecipitations.



The Cross-hybridization of SPV DNA to
the DNA of Other Poxviruses

In order to assess the degree of relatedness at the DNA

level of SPV to other poxviruses, we have assayed the

ability of radiolabeled SPV DNA to hybridize at low

stringency to the DNA of vaccinia, shope fibroma, fowlpox









27

and entomopoxviruses. The results of this experiment are

shown in Figure 3-1, Panel A in which a blot containing

restriction enzyme digests of the DNA from fowlpox virus

(lane 1), entomopoxvirus (lane 2), SPV (lane 3), Shope

fibroma virus (lane 4), and vaccinia virus (Lane 5) was

hybridized to radiolabeled SPV DNA. The SPV DNA probe did

not hybridize to the DNA of any of the other poxviruses and,

therefore, SPV DNA appears to lack, at this level, any

significant degree of homology to the other poxviruses

examined. This conclusion is consistent with the

dissimilarity of the HindIII digest pattern of SPV DNA as

compared to the pattern of the HindIII digests of the other

poxviruses (Figure 3-1, Panel B).



Immunoprecipitation of SPV and Vaccinia Proteins
With Homologous and Heterologous Antisera

The previous classification of swinepox virus into a

genus distinct from all other poxviruses was based primarily

on the lack of crossreactive neutralizing antibodies.

However, this assay is quite limited and would not detect

any crossreactivity between non-neutralizing epitopes.

Therefore, we readdressed the issue of relatedness through

immuno-crossreactivity using immunoprecipitations of

proteins isolated from infected cells to explore the

antigenic relatedness of SPV and vaccinia. The results of

this experiment are shown in Figure 3-2. Lanes A include





























Figure 3-1. Cross hybridization of swinepox virus DNA to
other poxvirus DNA's. Approximately 500 ng of purified viral
DNA of fowlpox virus (lanes 1), entomopox virus (lanes 2),
SPV (lanes 3), Shope fibroma virus (lanes 4) and vaccinia
virus (lanes 5) was digested with HindIII, separated
electrophoretically and Southern blotted as described in
Chapter 2. Hybridization was at 500 C with a SPV specific
radiolabeled probe in panel A. Panel B shows the same blot
hybridized at high stringency (630 C) to a probe derived
from the combined DNA of all 5 viruses in order to show all
the viral DNA bands which result on HindIII digestion.
Lambda HindIII marker positions are indicated in kb.










A
1 2 3


i 4


B
5 1 2 3 4 5

-23.1 -


-9.42 -

-6.56 -

.. e
-4.36 *
I,
e


- 2.32 -
- 2.03 -


I





























Figure 3-2. Swinepox virus immunologic cross reactivity with
vaccinia virus. The cross reactivity of anti-vaccinia and
anti-swinepox virus sera was analyzed by
immunoprecipitation. Radiolabeled uninfected, vaccinia
infected, or SPV infected PK-15 cells were separated on a
denaturing 10% polyacrylamide gel. Infected samples were not
precipitated (lanes A), immunoprecipitated with homologous
antiserum (lanes B), or immunoprecipitated with heterologous
antiserum (lanes C). Immunoprecipitations of uninfected PK-
15 cells with each antiserum are shown in lanes D. Molecular
weight standards are indicated in kD.












VACCINIA
A B C D


SWINE POX
DC B A
'f -180
-116
-84

-58

: -48.5



-36.5

quo -26.6


a-
aw









32

total radiolabeled protein samples and are not

immunoprecipitations. Lanes B are immunoprecipitations using

the appropriate homologous antisera and demonstrate the

quality of the two antisera as well as the large number of

immunogenic, immunoprecipitable peptides. This is in

contrast to lanes C in which very few proteins are

precipitated by the heterologous antisera. From

this data, I conclude that there are few, if any, shared

epitopes between these poxviruses indicating they are

antigenically unrelated.















CHAPTER 4

THE SWINEPOX VIRUS INFECTIOUS CYCLE

The literature concerning natural and experimental

infections of swine with SPV describes a lingering infection

with persistence of the virus in host tissues until nearly 4

weeks postinfection (Shope, 1940). The normal clearance time

for an orthopoxvirus infection as described by Fenner et

al.(1989) is 10-14 days. This discepancy could be

attributable to several factors including the effectiveness

of the immune response of the host and the kinetics of

expression of the virus itself. There is much information in

the literature regarding the kinetics of gene expression

during vaccinia virus growth in tissue culture cells (Moss,

1990). The entire vaccinia life cycle, including early and

late gene expression, DNA replication, and virion

morphogenesis occurs rapidly with mature infective viral

progeny produced within 24 hr. However, there has been

little experimental data accumulated regarding the

repicative cycle of poxviruses other than vaccinia. During

experiments involving the initial characterization of SPV it

soon became obvious that the rate of SPV development was

quite different than that of vaccinia. Therefore,

experiments were designed to more closely examine the









34

kinetics of SPV gene expression in tissue culture compared

to vaccinia virus.



Swinepox Virus Growth in Tissue Culture

Swine kidney (PK-15) cells are permissive for the

productive infection of either swinepox virus (Garg and

Meyer, 1972) or vaccinia virus. However, the cytopathology

of infection differs dramatically for these two viruses as

shown in Figure 4-1. Noticeable cytopathic effect (CPE) is

evident in cells infected with vaccinia by 1 day

postinfection (Panel A); however, CPE is not noticeable in

cells infected with SPV until 4 days postinfection (Panel

I). In the case of vaccinia infected cells, once CPE is

noted, spread of the virus and destruction of the

surrounding monolayer (Panels B & C) rapidly ensues. By

contrast, the SPV cytopathology remains localized and is

mostly limited to self-contained foci with little immediate

effect on the surrounding monolayer (Panels I & J).



Kinetics of Vaccinia and SPV DNA Accumulation

The accumulation of SPV or vaccinia DNA within infected

cells was analyzed by a combination of pulsed field

electrophoresis and Southern blot techniques. The rationale

for this experiment assumes that once DNA replication is

initiated the DNA will accumulate in the infected cell and

eventually become detectable above the background level. The























Figure 4-1. Swinepox virus growth in tissue culture. Comparative analysis of vaccinia
virus and swinepox virus growth in tissue culture cells. Confluent monolayers of porcine
kidney (PK-15) cells were infected with either vaccinia virus (strain IHD-W) or SPV at a
multiplicity of 1 x 104. Adsorption was for 2 hr in media without serum. The inoculum was
then replaced with media containing 10% FBS and dishes were incubated undisturbed at 370
until photographed. Panels A, B and C are vaccinia infected cells at 1, 2 and 3 days post-
infection, respectively. Panels D (day 1) and E (day 5) are uninfected cells used as a
control. Panels F through J represent SPV infected cells at days 1 through 5,
respectively.






















3.t.'j::
'


L-










; en~at~: ~a;:na~i~p
'"
w









E i



'"'
'~3:: :; L;
.I..,






























Figure 4-2. Analysis of vaccinia virus and swinepox virus
DNA accumulation kinetics. Uninfected PK-15 cells, or cells
infected with either vaccinia or SPV at a MOI of 5 were
collected, lysed and then the viral DNA separated by pulsed
field electrophoresis. Southern blotting and hybridizations
were as described in Chapter 2. The time postinfection is
indicated above each lane. The lane labeled U is an
uninfected cell sample. The migration position of viral DNA
monomers (M) and dimers (D) is indicated.














SWINE POXVIRUS
U 2 4 6 12 18 24 48












VACCINIA
U 2 4 6 12 18 24 48


-D
-M









39

results of this analysis for SPV and vaccinia are shown in

Figure 4-2. Swinepox virus DNA was not detected until 12 hr

postinfection. In additional experiments in which we

examined, in detail, time intervals between 6 and 12 hr

postinfection, we have been unable to detect SPV DNA earlier

than 11 hr postinfection (data not shown). These results are

in contrast to what is observed for vaccinia infections

where DNA accumulation is readily detectable by 6 hr

postinfection. SPV and vaccinia also differ as to when DNA

accumulation becomes maximal. The level of vaccinia DNA

peaks by 24 hr postinfection and actually decreases by 48 hr

postinfection. SPV DNA, on the other hand, continues to

accumulate throughout the 48 hr time period examined in this

experiment.



Kinetics of Swinepox Virus Protein Expression

SPV protein synthesis was examined by the radiolabeling

of the newly synthesized protein within cells infected with

SPV at various times postinfection followed by an analysis

of the products by SDS-polyacrylamide gel electrophoresis,

either with or without prior immunoprecipitation. The total

radiolabeled protein pattern of SPV infected cells is shown

in Figure 4-3. Little or no virus specific proteins were

detectable prior to 24 hr postinfection. However, between 24

to 48 hr postinfection, viral proteins became clearly

evident and were synthesized in ever increasing amounts with





























Figure 4-3. Kinetics of total protein expression in swinepox
virus infected tissue culture cells. PK-15 cells infected
with SPV at a moi=5 were radiolabeled for 1 hr prior to
collection and harvested as described in Chapter 2. Proteins
were separated on denaturing 10% polyacrylamide gels. The
time of sample collection is indicated above each lane. The
lane labeled E represents a sample maintained in 40 gg/ml
cytosine arabinoside, an inhibitor of DNA replication, which
blocks late but not early viral protein synthesis. Lane U
represents an uninfected control sample. Molecular weights
are indicated in kD.















E U 4 8 12 16 20 24 32 40 48
-180

-84

11 -58
-48.5


-36.5

U -26.6




a a































Figure 4-4. Analysis of swinepox virus protein synthesis by
immunoprecipitation with anti-SPV sera. Infections, protein
labeling, collection of samples, and immunoprecipitations
are described in Figure 4-3 and Chapter 2. The time of
sample collection is indicated above each lane. The lane
labeled E represents a sample infected in the presence of 40
Ag/ml cytosine arabinoside, and lane U is an uninfected
control. Molecular weights are indicated in kD.












E U 4

1*V



e


8 12 16 20 24 32 40 48
180
-116
-84
-58
48.5

-36.5
26.6


) 1). we









44

time. It is also interesting to note that host protein

synthesis continues until between 24 and 32 hr

postinfection. Vaccinia virus, by contrast, inhibits host

protein synthesis much more rapidly. The DNA accumulation

experiments previously described revealed SPV DNA

replication had begun by 12 hr postinfection. It was,

therefore, somewhat surprising that viral protein synthesis

was not apparent until 24 hr postinfection. Therefore,

immunoprecipitation of viral proteins was utilized as a more

sensitive and specific method for the detection of SPV

protein synthesis (Figure 4-4). This experiment allowed us

to detect SPV protein synthesis as early as 4 hr

postinfection, and in agreement with the DNA accumulation

experiment, late viral proteins were evident by 12 hr

postinfection. The lane labeled E in Figures 4-3 and 4-4

represents a sample of cells infected in the presence of

cytosine arabinoside, an inhibitor of DNA replication that

prevents subsequent late protein synthesis. Therefore, the

samples in these lanes should contain only early viral

proteins. In Figure 4-4 (Lane E), a major immunoprecipitable

early viral protein of approximately 46 kD is clearly

evident under conditions (+ CAR) where unregulated early

expression leads to extended synthesis of early proteins.

This protein can also be detected in a normal infection by 4

hr if the autoradiograms are overexposed.









45

Kinetics of Swinepox Virus mRNA Synthesis

Evidence based on our experience with vaccinia as well

as other poxviruses has clearly demonstrated that early

mRNAs are synthesized as discrete entities of a unique size,

as opposed to the majority of late mRNAs which are

polydisperse (Cooper et al., 1981). One can, therefore,

estimate the initiation of late mRNA synthesis as the time

at which the mRNA encoded within a given DNA fragment

becomes ill-defined, i.e., polydisperse. The kinetics of SPV

mRNA synthesis for one region of the viral genome has been

examined by Northern blot analysis and the data are shown in

Figure 4-5. Cycloheximide, an inhibitor of protein

synthesis, is commonly used in poxvirus infections to

accentuate and prolong the synthesis of early mRNAs

(Woodson, 1967). Under these conditions, no late messages

are expressed, presumably because the translation of early

proteins required for DNA synthesis and expression of late

genes is blocked through the action of the drug. Therefore,

the lane labeled E, in which RNA was isolated and examined

from cells infected in the presence of cycloheximide,

represents the expression of only early viral mRNAs. The

data show that early SPV mRNA can be detected as early as 4

hr postinfection and that late gene expression was initiated

at 8-10 hr postinfection at which time the RNA pattern

becomes heterodisperse.






























Figure 4-5. Kinetics of swinepox virus RNA synthesis. Poly
(A) mRNA isolated from SPV infected PK-15 cells was
separated on a 1.4% formaldehyde/agarose gel, transferred to
nylon membrane, and hybridized as described in Chapter 2.
The probe was an 8.2 kb EcoRI SPV fragment that spans the
junction of SPV HindIII fragments G and F. The time of
sample collection is indicated above each lane. Lane U
represents an uninfected control sample. Lane E represents a
sample maintained in the presence of cycloheximide, an
inhibitor of protein synthesis, and therefore contains only
early viral mRNA. RNA size standards are indicated in kb.

















E U 2 4 6 8 10 12


-9.49
-7.46



-4.40




-2.37




-1.35


-0.24















CHAPTER 5

ANALYSIS OF THE SPV GENOME

As previously mentioned, the classification of swine

poxvirus as a member of the poxvirus family was based on

several criteria. First, SPV exhibits the typical virion

morphology of a poxvirus, and, second, it appears to

replicate exclusively within discrete foci within the

cytoplasm of the infected host cell. These are features that

all members of the family have in common, however, in

addition to these characteristics, more recent studies have

demonstrated that all vertebrate poxviruses also seem to

share certain common molecular features in terms of their

DNA genomes. Among these shared features are the large size

of the linear DNA molecules (130-300 kb), the presence of

short, single stranded loops of DNA at each end of the

genome serving to covalently crosslink the molecule, and the

presence of repetitive elements at each end of the molecule

in an inverted orientation with respect to each other (Moss,

1990). These repetitive elements, referred to as inverted

terminal repeats (ITRs), are of variable length, depending

on the species of poxvirus, but are invariably present with

the possible exception of smallpox (Esposito and Knight,

1985; Mackett and Archard, 1979). In addition, there are









49

also a series of small direct repeats near the each terminus

of the genome for all members of the Orthopoxvirus genus

(Pickup et al.,1982; Wittek and Moss, 1980). These repeats

are not present among the leporipoxviruses (Upton et al.,

1987b) and there are few data regarding this region of the

DNA of the other poxvirus genera. Therefore, there is a

substantial amount of data regarding the genomes of

poxviruses, some of it specific for the entire family, and

some which is genus- and species-specific. The

characterization of the genome of SPV was therefore

undertaken for several reasons. For one, this information

would assist the classification of SPV by identifying

family, genus, or species specific traits. It would also

provide essential evidence important for furthering our

currently limited understanding of the evolutionary

relationship between SPV and other members of the poxvirus

family. Lastly, these data would allow for the possible

identification of the unique features of SPV, thereby adding

to our knowledge of poxvirus genome structure-function

relationships and of the molecular basis of poxvirus

pathogenesis.



Size of SPV Genomic DNA

Comparative pulsed field electrophoresis was used to

estimate the size of the swinepox virus genome. As shown in

Figure 5-1, SPV DNA (lane B) exhibits an electrophoretic























Figure 5-1. Size of the swinepox virus genome. The size of the swinepox virus genome was
determined by pulsed field electrophoresis. DNA extracted from purified virions of
vaccinia virus (lane A), swinepox virus (lane B), myxoma virus (lane C) and Shope fibroma
virus (lane D) were separated on a 1% agarose gel as described in Chapter 2. Lambda
ladder size standards are shown in lane E with the sizes of the first four bands indicated
in kilobases.









A B C D E


*.. ...
iffs.

fin


-194.0
-145.5
- 97.0
- 48.5


IrrII









52

mobility between that of the orthopoxvirus vaccinia virus

(lane A) and the leporipoxviruses, myxoma (lane C) and Shope

fibroma virus (lane D). The size of the vaccinia genome is

approximately 185 kb (Dales and Pogo, 1981) and the sizes of

myxoma and Shope fibroma virus are estimated to be 163 kb

and 160 kb, respectively (Delange et al., 1984; Russell and

Robbins, 1989). Therefore, the conclusion from these data is

that the size of the SPV genome is approximately 175 kb.

This estimate is also in agreement with the size deduced

from the lambda ladder size standard shown in lane E.



SPV DNA Terminal Crosslinks

The DNA from all poxviruses examined to date have

termini that are covalently closed by a short single

stranded loop of DNA (Baroudy et al., 1982). This same

characteristic for SPV DNA is demonstrated by a "snap-back"

analysis (Esposito et al., 1981; Wills et al., 1983) as

shown in Figure 5-2. The enzyme BqlI cuts the SPV genome

into three fragments of approximately 22, 24 and 105 kb

(lane C). Following digestion with Bgll, the DNA was heat-

denatured and quick chilled. Only terminal fragments which

are crosslinked will then spontaneously reanneal. As shown

in Lane D, the 24 and 105 kb fragments but not the 22 kb

fragment, were able to reanneal (lane D) and remain as

discrete bands. Therefore, from these data we conclude that

SPV does have covalently closed termini that the 22 kb
































Figure 5-2. "Snapback" analysis of the BglI digest of
swinepox virus genomic DNA. Purified SPV DNA was separated
by pulsed field electrophoresis on a 1% agarose gel as
described in Chapter 2. Undigested samples of purified DNA
(lane B), or DNA digested with BglI without further
treatment (lane C), or digested with BglI and subsequently
heat denatured and quick chilled (lane D) prior to
electrophoresis are shown in the figure. The lambda ladder
size standards are shown in lane A.






54




A B C









55

fragment is the internal fragment. These data were useful

for the preliminary mapping of additional digests of the SPV

genomic DNA.



Detailed Restriction Mapping of the SPV Genome

A preliminary restriction map of SPV was constructed by

doing single and double digests with the restriction

endonucleases Bgll, XhoI and SalI. XhoI has only a single

recognition site in SPV DNA, whereas the other two enzymes

each cut SPV DNA twice. The use of pulsed field

electrophoresis was critical for this analysis because it

enabled the separation, accurate sizing and identification

of these large fragments. The restriction endonucleases

HindIII, AvaI, HaeII and KfnI were selected for more precise

mapping because each cut SPV DNA into between 8 and 16

fragments, most of which were easily separable by standard

electrophoretic techniques. The size of each of these

fragments was estimated based on the electrophoretic

mobility when compared to HindIII single digests and

HindIII/Eco RI double digests of lambda DNA as size

standards. A tabulation of the size and number of fragments

from each digest, as determined from electrophoretic

mobility, as well as the size of each fragment derived from

calculated values based on the overall size of the SPV

genome (Figure 5-1) are shown in Table 5-1. Double digests

of SPV using one of the four enzymes which cuts frequently








Hind III O c


B M IN I L GI F H


A I E JI D IKH


Ava I


IHae
Hae II 1E F D


A


B


H
B IG


I I


Kpn I


B D C EP
B K D C E IL G 11


M
H J| I


BgI I A I C B


Sal I A BI C


Xho I A EB
10 kb


Figure 5-3. Swinepox virus restriction maps. The restriction maps of swinepox virus DNA
for the endonucleases Hind III, Ava I, Hae II, Kpn I, Bgl I, Sal I and Xho I are shown.
The sizes of the individual restriction fragments are presented in Table 5-1.


S I F GI


D H


A


' '


'


'


I I I I I ~


A WN


' I ..


I I





















Table 5-1. Restriction fragment sizes of the swinepox virus
genome.


HindIII AvaI
24.6(28.6)a 30.0(34.9)
17.7(20.6) 29.5(34.3)
14.5(16.9) 28.0(32.6)
11.7(13.6) 22.3(25.9)
10.4(12.1) 15.1(17.6)
10.4(12.1) 13.3(15.5)
9.6(11.2) 7.9 (9.2)
8.8(10.2) 2.2 (2.6)x2
7.7 (9.0)
6.9 (8.0)
6.7 (7.8)
6.4 (7.5)
5.6 (6.5)
3.2 (3.7)
2.1 (2.4)x2
1.9 (2.2)
150.3(175) 150.5(175)


SBgli
b104.8(121.9)
23.7 (27.6)
21.9 (25.5)
150.4 (175)


SalI
b69.5(81.9)
b58.8(69.3)
20.2(23.8)
148.5(175)


HaeII KpnI
64.0(74.7) 30.0(35.3)
25.8(30.1) 21.0(24.7)
24.0(28.0) 15.8(18.6)
11.5(13.4) 12.9(15.2)
8.1 (9.5) 11.6(13.7)
8.0 (9.3) 10.0(11.8)
2.0 (2.3) 8.2 (9.7)
1.1 (1.3)x2 8.1 (9.5)
7.9 (9.3)
6.0 (7.1)
4.1 (4.8)
3.3 (3.9)
3.1 (3.6)
2.3 (2.7)x2
1.3 (1.5)
0.8 (0.9)
149.9(175) 148.7(175)

XhoI
b126.7(147.3)
24.8 (28.8)

150.5 (175)


Sizes in parentheses were calculated from the estimated
genome size of 175 kilobases. Sizes not in parentheses
were determined based on lambda size standards. All
sizes are expressed in kilobases.

b Size estimated from multiple digests.


Fragment
A
B
C
D
E
F
G
H
I
J
K
L
M
N
O
P
Total


A
B
C
Total









58

in combination with one of the other enzymes which cuts

infrequently (BgIl, XhoI & Sail) identified the HindIII,

AvaI, HaeII and KPnI fragments which overlapped the

infrequent cut sites. The maps for these four enzymes were

subsequently determined by the hybridization of overlapping

fragments as follows.

SPV DNA was digested with HindIII, AvaI, HaeII or KpnI,

and the fragments separated electrophoretically in 0.6%

agarose gels and Southern blotted as described in Chapter 2.

DNA Probes were prepared from individual fragments isolated

from identical SPV digests separated by electrophoresis in

0.6% low melting point agarose gels. Each fragment was

excised from the gel and radiolabeled in situ by random

oligonucleotide extension as described by Feinberg and

Vogelstein (1983). The labeled probe fragments were

individually hybridized to the blots as described in the

Chapter 2. The results of these hybridizations allowed for

the identification of overlapping fragments and the

construction of the composite restriction maps of SPV DNA as

presented in Figure 5-3.



Identification of SPV DNA Terminal Fragments

The terminal fragments of various DNA digests were

determined by a novel approach utilizing the analysis of the

dimeric DNA intermediates generated during the process of in

vivo viral DNA replication (Moyer and Graves, 1981).









59

Replicative dimers can be isolated from genomic monomers by

pulsed field gel electrophoresis (Delange, 1989). This

analysis assumes that replicative dimeric forms of SPV DNA,

like those of other poxviruses, represent monomers joined in

a head-to-head or tail-to-tail fashion. The monomeric and

dimeric DNA forms were first resolved from one another, and

separately electroeluted. Digestion of the dimeric form and

subsequent electrophoretic separation of the resulting

fragments should reveal the creation of a new restriction

fragment derived from the fused terminal fragments where two

monomers are joined in either a head-to-head or tail-to-tail

fashion. The corresponding new terminal fusion fragment

would be expected to migrate with a molecular weight twice

that of the corresponding terminal fragment derived from the

monomer. A dimer should contain two termini joined to form a

unique fusion fragment plus two terminal fragments as in the

original monomer. The data shown in Figure 5-4 demonstrate

how this approach was used to identify the terminal

fragments) of the HindIII digest of SPV DNA. When HindIII

digests of monomeric and dimeric DNA are hybridized to total

genomic DNA, a unique fragment of 4.2 kb present only in

dimers is noted (figure 5-4, Panel B). If one assumes the

unique fragment results from head-to-head or tail-to-tail

fusion of two monomers, then this unique fragment should be

derived from the HindIII 0 fragment previously determined to

be the terminal-most fragment present at each end of the






























Figure 5-4. Identification of the terminal HindIII fragment
of swinepox virus DNA. Fragments derived from HindIII
digested SPV monomeric (M) or dimeric (D) DNA were separated
electrophoretically and Southern blotted as described in
Chapter 2. The blot was hybridized with a radiolabeled probe
specific for the SPV HindIII fragment O (panel A) or a probe
for total SPV genomic DNA (panel B). The arrows indicate the
unique junction fragment seen only with the dimeric DNA.
Lambda DNA size standards are indicated in kilobases.











A
MD


B
MD


-6.6 3
e, a


-4.4-






- 2.3-

- 2.0-


a --


em




























Figure 5-5. Identification of the swinepox virus DNA
terminal fragments resulting from various digests of SPV
DNA. SPV DNA was digested with the appropriate restriction
enzyme, electrophoretically separated, Southern blotted, and
hybridized with a probe specific for the SPV HindIII
terminal fragment (fragment 0) as described in Chapter 2.
The hybridizations shown in panel A are for SPV DNA digested
with HindIII (lane 1), Aval (lane 2), HaeII (lane 3) and
KpnI (lane 4). Panel B contains the Sall (lane 1) and XhoI
(lane 2) fragment hybridizations. The position of HindIII
and HindIII/EcoRI digested lambda DNA size standards are
shown for comparison in kilobases.





















A B

1 2 3 4 12


:. -2.32 i

-2.03 l -23.1

-1.59
-1.37


-0.94









64

monomers (Table 5-1 and Figure 5-3). The hybridization of

HindIII digested monomers and dimers to radiolabeled Hind

III O fragment shows this to be the case (Fig. 5-4, Panel

A). We conclude that the 2.1 kb fragment (HindIII fragment

O) is the terminal-most fragment derived from each end of

the HindIII digested SPV genome. The HindIII O terminal

fragment was then utilized as a probe to locate the terminal

fragments of the other restriction enzyme maps as shown in

Figure 5-5. This allowed for the identification of a single

terminal fragment of the Aval digest as fragment H, fragment

I of the HaeII digest and fragment N of the KonI

digest with sizes of 2.2 kb, 1.1 kb, and 2.3 kb,

respectively (Figure 5-5, Panel A) consistent with cutting

within a terminal repetitive element. The hybridization of

the 2.1 kb radiolabeled terminal HindIII O fragment to

either XhoI or SalI digests of SPV DNA recognizes two bands

in each digest (Fig 5-5, panel B). This result together with

the results shown in of Fig 5-5, panel A is consistent with

the presence of repetitive elements at or near the terminal

extremes of the molecule and confirms the previous mapping

of the terminal fragments for the XhoI and SalI digests

shown in Figure 5-3. The fact that the terminal HindIII

fragment detects homologous sequences at both ends of the

genome provides evidence that the termini of the swinepox

virus genome contain inverted repetitions as has been

described for nearly all other poxviruses.









65

Length of the SPV DNA Inverted Terminal Repeats

The length of poxvirus inverted terminal repeats (ITRs)

varies dramatically among the various species of the family.

Vaccinia ITRs are larger than 12 kilobases as are those of

all members of the leporipox group (Goebel et al., 1990;

Upton et al., 1987a). In contrast, smallpox ITRs if

present at all, are estimated to be less than 500 basepairs

(Esposito and Knight, 1985; Mackett and Archard, 1979). The

length of the SPV ITRs were determined by hybridization

analysis as follows. Genomic SPV DNA was digested with the

restriction enzyme HaeII, separated electrophoretically, and

Southern blotted. HaeII was used because the restriction

fragments at each end of the genome just internal to the

small 1.1 kb terminal fragment .(fragments E and A) are

easily separated electrophoretically. Also, the E fragment

and the F fragment, which is just internal relative to the

entire genome, migrate as a single band. The A and E/F

fragments should span the ITRs at alternate ends of the

genome. Using small subfragments (2 kb or less) of the E and

F fragments as probes, fragments from within the ITR will

hybridize to both the E/F and A fragments because of the

repetitive nature of genetic content within the ITR.

Subfragments not within the ITR will conversely recognize

only the E or F fragment from which they were derived.

Therefore, the loss of hybridization to the A fragment

defines the boundary of the ITR. Figure 5-6 shows the















Hindll BamHI BamHI

( I



Probes E D |B

Hybridization to Haell
A fragment + + +


2 kb



Figure 5-6. Schematic representation of the swinepox virus inverted terminal repeats.
Representation includes the probes used, and the results obtained from the analysis of the
swinepox virus inverted terminal repeat length. The drawing represents the left terminus
of the SPV genome including 7664 bp from the Hind III site at the left end of the Hind III
C fragment through the two internal BamHI sites. The relative locations of the individual
fragments, designated a through G, used as probes are shown. The length of the fragments
are A, 662 bp; B, 1048 bp; C, 1145 bp; D, 1178 bp; E, 1377 bp; F, 1851 bp; and G, 924 bp.
The results of the hybridizations shown in Figure 5-7 are also indicated with (+)
representing a positive signal, (-) no signal, and (+/-) a weak signal.























Figure 5-7. Length of the swinepox virus inverted terminal repeats. Genomic SPV DNA was
digested with HaeII, electrophoretically separated, Southern blotted and hybridized to the
various probes shown in Figure 5-6 as described in Chapter 2. The lanes A through G
represent the individual fragments that were radiolabeled and used as probes, also
described in Chapter 2. The position of the HaeII fragments A and E/F to which the probes
hybridized are indicated.








A B C D E F G


S-A

m* *S S -E/F









69

derivation of the subfragments used as probes in relation to

left end of the SPV genome, the probe designations, and a

summary of the hybridization results. Figure 5-7 shows the

actual hybridization data showing that probes A through D

hybridized only to the E or F fragment while probes E, F,

and G hybridized to both the A and E fragments, although the

signal with probe E was faint. This evidence limits the ITR

boundary to within the region spanned by probe E. Therefore,

the length of the SPV ITRs are between 4.3 and 5.6 kb, with

the actual length probably closer to the lower limit because

of the limited hybridization with the E probe.



Repeat Elements Within the SPV ITRs

When a serially propagated stock of SPV DNA is digested

with either HindIII (Figure 5-8, lane B) or AvaI (Figure 5-

8, lane D), end labeled, and separated electrophoretically,

it is very difficult to discern a single discrete terminal

fragment. Instead, a ladder of fragments appear ranging in

size from approximately 1.5 kb to 3.0 kb. Each fragment

within the ladder is separated by an interval of

approximately 70 bp and although each interval is

represented, there appears to be several favored forms.

However, when the virus is first purified by cloning, a

distinct, unique terminal fragment is seen (Figure 5-8,

lanes C and E). The simplest interpretation of these data is

that the heterogenous population of termini seen are the































Figure 5-8. Characterization of the swinepox virus terminal
repeat elements. The DNA from plaque purified (lanes C and
E) or serially passed (lanes B and D) SPV was digested with
either HindIII (lanes B and C) or Aval (lanes D and E).
Fragments were end labeled and separated electrophoretically
as described in Chapter 2. Lane A contains the end labeled
HindIII digest fragments of lambda DNA with the size of the
2.32 kb and 2.03 kb fragments indicated.










A B C D E


2.3-

2.0-









72

result of multiple recombinatorial events involving a series

of repeated elements 70 bp in length. However, the

unequivocal confirmation of the presence of these repeats

must await detailed sequence analysis.















CHAPTER 6

PARTIAL SPV DNA SEQUENCE ANALYSIS

Studies of poxviruses by DNA sequence analysis,

restriction enzyme mapping, and open reading frame analysis

have revealed several interesting features concerning

poxvirus genome organization including several highly

conserved characteristics. The genomes of all members of the

family contain a central core element of conserved viral

enzymatic and structural genes required for maintenance of a

normal poxvirus lifecycle (Hirt et al., 1986; Weir and Moss,

1984; Wittek et al., 1984a; Wittek et al., 1984b). Although

the genes in this region are generally not highly conserved

at the nucleotide level (except for closely related members

such as vaccinia and rabbitpox virus), there is much more

conservation at the amino acid level, and the location and

orientation of open reading frames is highly conserved

(Binns et al., 1988; Drillien et al., 1987; Gershon and

Black, 1989). However, the near terminal regions of poxvirus

genomes are quite dissimilar among the various species with

limited conservation between members of a given genus, but

little conservation between genera (Tomley et al., 1988;

Upton et al., 1987a). There is evidence that located within

these regions is the genetic material responsible for the









74

wide range of pathogenicity and host range specificity

exhibited within the poxvirus family. It is within this

region that several host range genes of vaccinia and cowpox

have been characterized (Drillien et al., 1981; Gillard et

al., 1986; Perkus et al., 1990a). A wide array of gene

families with homologies to various host factors have also

been identified here. For vaccinia these products include a

growth factor, a serine protease inhibitor (SERPIN), and

complement component binding analogs, and there has been

much speculation regarding the function of these products

and how they might contribute to viral pathogenicity in

natural infections (Kotwal and Moss, 1988a; Kotwal and Moss,

1989; Stroobant et al.,1985).

This wealth of information regarding vaccinia is in

contrast to what is known concerning the genes of SPV. Prior

to the studies described herein, SPV had not been

characterized at the molecular level. I therefore elected to

further our understanding of swinepox gene organization by

DNA sequence analysis of selected regions of the genome. I

chose to analyze of the region of the genome adjacent to the

junction between the inverted terminal repeat at the left

hand end of the genome, and a region of internal unique

sequences. The rationale for these two choices was that we

could gain insight about both the internal conserved region

of the virus, and the terminal region of the genome, which

in other poxviruses is related to pathogenesis and host









75

range properties. We hoped to elucidate the reasons for the

limited pathogenesis of SPV and its host range restriction

to swine by means of this sequence analysis.

Specifically then, sequence analysis of the 2.85 kb

internal fragment was chosen to text the hypothesis that the

central core of SPV is conserved in terms of open reading

frame order, content and orientation, as has been shown for

several other poxviruses. This analysis also allows for a

comparison of vaccinia intergenic regulatory regions, which

are involved in viral mRNA transcript initiation and

termination, to the analogous regions in SPV. Although there

is not a true vaccinia consensus early or late promoter,

there are several features that are conserved among early

vaccinia virus genes which are also present and functional

in several other poxvirus species and genera. All poxvirus

promoter elements appear to be located within approximately

30 nucleotides of the start of transcription and are very

A/T rich (Coupar et al., 1987; Mars and Beaud, 1987; Weir

and Moss, 1987). Mutagenesis studies have been used to

specifically define an early vaccinia promoter consensus

sequence AAAAATGAAAAA(T/A)A located 10-15 bp upstream of the

transcription initiation site (Davison and Moss, 1990a).

Single or multiple nucleotide changes within this sequence

usually reduce, but do not eliminate, expression. Since most

early vaccinia genes do not conform exactly to the consensus

sequence, it has been suggested that variations constitute a









76

mechanism whereby poxviruses regulate the expression of

early genes. Another feature usually present for early

transcripts is a conserved TTTTTNT motif (where N represents

any nucleotide), that serves as a transcription termination

signal, located approximately 20-50 nucleotides upstream of

the 3' termination site (Yuen and Moss, 1987).

The examination of the upsteam sequences of numerous

late vaccinia genes provided the first evidence for a

conserved late promoter element (a TAAAT motif) close to the

mRNA start site (Rosel et al., 1986). In fact, the majority

of late genes have this motif within the sequence TAAATG,

with the ATG serving as the translation initiation codon.

Additional mutagenesis studies confirmed the essentiality of

this element and further noted runs of A's or T's

approximately 20 bp upstream of the start site which

contribute to late promoter strength (Davison and Moss,

1989b). The comparison of SPV early and late promoter

elements to the vaccinia consensus elements will be useful

for determining whether the promoter homologies and ability

to cross-function between genera noted among other

poxviruses is also true for SPV (Boyle and Coupar, 1986;

Boyle and Coupar, 1988; Taylor et al., 1988).

The sequence analysis and subsequent comparison of

these regions of the SPV genome and gene products to those

of vaccinia and other poxviruses should lead to a better

understanding of the phylogenetic relationship between the









77

members of this viral family. Specific mutagenesis studies

would then allow for the identification of specific genetic

elements which might be responsible for some of the unique

properties of SPV.



Analysis of SPV Conserved Region DNA Sequence

The sequencing of an internal region of the swinepox

virus genome was therefore undertaken to determine if the

conservation of open reading frames and intergenic

regulatory elements noted in other poxviruses was maintained

within SPV. This analysis involved the sequencing of 2857

basepairs of DNA from within the SPV HindIII H fragment. The

total A+T content of this region was found to be 71.7%.

Figure 6-1 represents the relative location of the sequenced

region within the SPV genome and the orientation of the open

reading frames that were deduced from this sequence. There

were 2 complete and one partial open reading frames

identified, designated H1L, H2L and H3L, all transcribed

towards the left terminal hairpin. The nucleotide sequence

of this region and the deduced amino acid sequences are

shown in Figure 6-2. Each of the SPV open reading frames

corresponded to analogous open reading frames within the

HindIII D fragment of vaccinia virus. The gene products, at

least in the case of vaccinia, are essential for a

productive viral infection. The alignment of the SPV open

reading frames to the corresponding ones from vaccinia,
















SPV
Hind III


M C B MN I L G F H A I E J D K 0


H3L


Figure 6-1. Swinepox virus core open reading frames. Schematic representation of the
location and orientation of the SPV open reading frames deduced from the conserved region
sequence. The Hind III genomic map is shown with an expanded view of the 2.85 kb region at
the right end of the Hind III H fragment that was sequenced. The 3 deduced open reading
frames designated H1L, H2L, and H3L are indicated.































Figure 6-2. The complete nucleotide sequence and the deduced
amino acid sequences from the conserved core of swinepox
virus. Nucleotide number 1 begins at the right end of
HindIII fragment H and proceeds towards the left terminus.
The deduced amino acids are indicated below the first
nucleotide of each codon triplet, and the open reading frame
designation below the initiating methionine.















AAGCTTTTCATACTTTAAATACGACAATGAATAATACTGTTATTAACTCGATTATAGGTA
1 -----+-------------------------------+ + ----+ 60
M N N T V I N S I I G N
MNNTVINSIIGN
H1L
ATGATGATATTGTTAAACGTCATAATGTATTCGGTGTAGATGTACAAAATCCTACTTTAT
61 --------- ----------+------+-- ----+---- -+ -----+ 120
D I V K R H N V F G V D V Q N P T L Y

ATATGCCACAGTATATAACTATAAACGGCATAACCTCTACAGACAGTAACTGCGACCAAC
121 -------------------- +-------+------ ------- --------+ 180
M P Q Y IT IN G IT S T D SN C D Q H

ATGTTGTATCTACTTTTGAAATACGTGATCAATATATTACAGCGCTTAGTCATGTTATGC
181 ---------+---------+---------+---------+---------+---------+ 240
V V S T F E I RD Q Y I T A Y I TA L S H V M L

TAAGCATAGAATTACCAGAAGTTAAAGGTGTTGGTAGATTCGGTTATGTTCCATATGTTG
241 ---------+---------+---------+---------+---- -+ -----+ 300
S I E L P E V K G V G R F G Y V P Y V G

GATATAAGTGTATTCAACATGTATCTATATCCAGCTATGATGATATATTATGGGAATCAT
301 ---------+---------+---------+---------+---------+---------+ 360
Y K C I Q H V S I S S Y D D I L W E S S
YKCIQHVSISSYDDILWESS

CCGGAGAAGATTTATATAACTCGTGTTTAGATAATGATACGGCATTAACAAATTCTGGAT
361 --------------------------------------------- 420
G E D L Y N S C L D N D T A L T N S G Y

ATTCGCATGAACTTAATACAATATCTACAGGATTGACTCCAACGACACAATTAAAGAAT
421 ---------+---------+--------+---------+------ -+- ---+ 480
S H E L N T I S T G L T P N D T I K E S

CTACAACTGTGTGTAGTT TATAAAAACTCCCTTTGATGTAGAAAACATTTAGTAGTT
481 ---------+-------------------+---------+- ----+---------+ 540
T V Y V Y I K T P F D V E K T F S S L

TAAAGTTGGCAGATACAAAAATTGTCATTACCGTCACATTTAATCCTGTTTCTGATATTA
541 -------------------------+--- ---------+--------+-------+ 600
K L A D T K I V IT V T F N P V SD I I

TTATAAGAGATATAACGTTTAATTATGATAATTTCGTTAAAGATTTTGTCTATGTTACAG
601 -----------+---------+-------- ---------+--------+--- -+ 660
IRD IT F N Y D N FV K D FV Y V T E

AACTCAGTTGTATAGGGTATATGGTAAAAATATACAAATAAAACCGTCTTATATAGAAA
661 ---------+---------+-----------------+ ------+--------+ 720
L SC I G Y M V K N I Q I K P S Y I E R

GGCCTAGAAGAGTATTTGGTCAATTAAATCAATCTACAGCTGTAATATCTGATGTTCATT
721 ---------+---------+---------+---------+-- ------+-------+ 780
P R RV F G Q L N Q S T A V I S D V H S

CTGTATCATCATTATCTGTATATATCAAACCATACTATGGAAATGCAGATATAAATTCA
781 ---------+------------------+---------+--------------------- 840
V S S L SV Y IK P Y Y G N A D N K F















TATCATATCCTGGATATTCACAATCAGAAAAAGATTATATATGTGTTTTTGTAGAGAGAC
841 ---------+--------+---------+----- ------ +--------++ 900
S Y P G Y S Q S E K D Y I C V F V E R L

TTTTAGATGACCTCGTCACAGTATGTGATACATCTCCAAAATGGTTTCCAGAGACTGCAG
901 ---------+---------+------------------+---------+--------- 960
L D D L V TV C D T S P K W F P E T A E

AACTCGTTGAAGTACCAAATAGTGGTATTGTAACAATACAAGATGTTGATATTTTTGTTC
961 ---------+---------+---------+--------+--------+---------+ 1020
LV E V P N S G IV T I Q D V D I F V R F

GTATAGATAATGTTCCATGTAATATGAAAGTTTATTTTCATACTAATATATTAGTATTTG
1021 ---------+---------+---- ---- -+--------+---------+---------+ 1080
ID N V P C N M K V Y F H T N I LV F G

GAACACGAAAAAATTCAGTTACATATAATTTATCTAAAAAGTTTACAACGATAACAGGCA
1081 ---------+---------+---------+--------+---------+--------+ 1140
T R K N S V T Y N L S K K F T T I T G T

CCTATAGCGAAAGCACTAATAGAATTATGTTTTCTCATGTGTCACATTCTATAAATATTA
1141 -------+---------++------------------ +- -+- -+ 1200
Y S E S T N R IM F S H V S H S I N I T

CAGATGTATCAATTCCTGTAAGTGTAT GGACC TCAACGTAATATATACAACGGTGATA
1201 -- ---------+--- ------+-------+---- -------+ 1260
D V S I P V S V W T C Q R N I Y N G D N

ATCGATCAGAATCATCAAAAAATAAAGATTTATTTATTAATGATCCGTTCATAAAAGGTA
1261 ------------------+--------+-------- +------+--------+ 1320
R S E S S K N K D L F I N D P F I K G I

TCGATTTCAAAAATAAAACCGATATTATTTCTAGATTAGAAGTAAGATTGGTAACGATG
1321 ---------+---------+---------+---------+---------+--------+ 1380
D F K N K T D I I S R L E V R F G N D V

TATTATATTCTGAAACGAGTCCTATTTCTAAAGTTTACAATGATCTACTTTCTAATCATA
1381 ---------+---------+---------+---------+-- ------+------+ 1440
L Y S E T S P I SK V Y N D L L S N H K

AATGTGGTATGAGAACATTACGATTTAATTTCACACCCCCTACATTTTTTAAACCCACTA
1441 ---------+----------------------+----------- 1500
C G M R T L R F N F T P P T F F K P T T

CAATTGTTGCAAATCCTTCTAGAGGTAAGGATAAATTATCCGTACGTGTCGTATTTACCT
1501 ------------------+--- ---+----------+--------+--------+ 1560
IV A N P S R G K D K L SV R V V F T S

CGTTAGATCCTAATAATCCTATCTATTACATATCGAAACAATTGGTATTAGTTTGTAAAG
1561 ---------+--------- + -------- ---------+--------+---------+ 1620
L D P N N P I Y Y I S K Q L V L V C K D


Figure 6-2 continued















ATCTGTATAAAGTTACTAACGATGACGGTATTAACGTAACAAAGATTATTGGAGAATTAT
1621 ---------+---------+---------+---------+--------+--------+ 1680
L Y K V TN DD G I N V T K I I G E L *

AATACTGAAAACAAACCTATATCAAATAAATGGATAAAATTACTAGAAATATCAGAGAAG
1681 ---------+---------+-------- ---+ ------+------ -+--- -+ 1740
M D K I T R N I R E G
H2L
GAATACATATATTGTTACCATTTTATGAAAATCTTCCTGATATTAGCCTAAGTTTAGGAA
1741 --------+---------+---------+---------+ ------- + 1800
I H I L L P F Y E N L P D I S L S L G K

AAAGTCCATTACCTAGTTTGGAGTATGGAACCAATTACTTTCTACAATTATCAAGAGTAA
1801 -----------------+------------- +----- +---------+---------+ 1860
S P L P S L E Y G TN Y F L Q L S R V N

ATGACCTAAATAGATTACCTACGGATATGTTGAGTTTATTTACACATGATATAATGTTGC
1861 ---------+--+------ -++--------------------- + 1920
D L N R L P T D M L S L F T H D I M L P

CTGAAACAGATATGGAAAAGGTATATGATATACTTAATATAAAATCTGTAAATCATACG
1921 -----------+-------+---------+---------+------ -+- -+ 1980
E TD M E K V Y D I LN IK S V K Y G

GTAAAAGTATTAAAGCCGATGCTGTTGTTGCAGATCTAAGTGCTAGGAACAGATTATTCA
1981 ---------+---------+---------+-- ----------+ ++ 2040
K S I K A DA V V A D L S A R N R L F K

AAAAAGATAGAGAATTGATTAAATCTAATAATTATCTCACGGATAATAATCTATATATAA
2041 ---------+---------+---------+---------+---------+---------+ 2100
KD R E L IKS N N Y LT D N N L Y I S Y I

GTGATTATAAAATGTTGACATTTGAAGTATTTAGACCGCTTTTGATCTATCGTCGGAAA
2101 ---------+-------+--- -----+---------+ -----------+ 2160
D Y K M L T F E V F R P L F D L S S E K

AATATTGCATAGTAAAGTTACCCACGTTATTTGGTAAATGTGTTATAGATACGATTAGA
2161 ---------+---------+---------+ ---------+--------+--------+ 2220
Y C I V K L P T L F G K C V I D T I R V

TATACTGTAGTCTTTTTAAATCAGTTAGATTATTCAAATGTGCTAGCGATAGTTGGTTAA
2221 ------------------+---------+--------+ ---- ---------+ 2280
Y C S LF K SV R L F K CA SD SW L K

AAGACAGCGCTATCATGGTCGCGAGTGATATATATAAAAAAAAATATAGATATTTTTATGT
2281 -----------+--------+---------------+ -------------- 2340
D S A IM V A SD I Y K K N I D I F M S

CACATATTAGATCTGTTTTAAATCGCAATATTGGAAAGATTCTAATAACGTTCAGTTTA
2341 ---------+---------+---------+--------+---------+---------+ 2400
H IR SV LKS QY W KD SN N V Q F S N V Q F


Figure 6-2 continued















GTATATTGAAAGAATCTGTTGATAAGGAATTTATTAACAAATTTTTGGAATTTTCTACAT
2401 --------------------------+---------------------------+ 2460
ILKESVDKEFINK FLEFST S S

CTGTATACGAATCGTTATATTATGTACATTCATTATTATATTCTAGTATGATATCTGATA
2461 -- -------------+--------+---------------------+ 2520
V Y E S L Y Y V H S LL Y S SM IS D N

ATAAAAGTATAGAAAACGAATATCAAAAAAAATTGACAAAACTCTTATTATAAGAAATCC
2521 --------------------------+------ ------------- + + 2580
K S I E N E Y Q K K L T K L L L *

GTACAGATAAATGAGTAGTTATCATGCAGCATATATTGATTACGCACTTAGAGTTACGGA
2581 ---------+--------+---------+---------------+---------+ 2640
M SS Y HA A Y ID Y A L R V T E
H3L
ATCTATGACCGATACAATGGAACAGATACAGAAATTACATTAAACCTTATCAACATTT
2641 --------- --------------------------+ -----+------+ 2700
S M T D T M G TD T E I T L K P Y Q H F

TGTAGCTCGTGTTTTTTTAGGATTAGATAAAATGCATTCATTATTACTATTTCATGACAC
2701 ---------+--------+----------+--------+------------------+ 2760
V A RV FL GL D K M H S L L L F H D T

AGGTGTTGGTAAAACTATTACAACAACGTTTATTATTAAACAATTAAAAAATATATACAC
2761 --------+---------+-----------------+---------+---------+ 2820
G V G K T I T T T F I I K Q L K N I Y T

AAATTGGTCTATATTATTGCTGGTTAAAAAGCACTTG
2821 -----------------+-----------+---- 2857
NW SILLLV KKH L


Figure 6-2 continued









84

including the length of the peptides and the percent

identity at the amino acid level, are shown in Figure 6-3.

The SPV open reading frame H1L encodes a peptide of 551

amino acids. Comparison of this orf to sequences within the

genbank database revealed a high degree of homology to

vaccinia orf D13L. This orf represents the locus to which

resistance of vaccinia virus to the antibiotic rifampicin

has been mapped (Seto et al, 1987; Tartaglia and Paoletti,

1985; Baldick and Moss, 1987). The vaccinia orf is also 551

amino acids in length and there is 70.4% identity at the

amino acid level to SPV H1L.

The SPV open reading frame H2L encodes a polypeptide of

287 amino acids, the exact length of its counterpart in

vaccinia, orf D12L. For vaccinia, this open reading frame

encodes the small subunit of the messenger RNA capping

enzyme (Niles et al., 1989). The identity at the amino acid

level between SPV orf H2L and the vaccinia enzyme is 77.0%.

Downstream and adjacent to the capping enzyme in the

vaccinia genome is the gene encoding a nucleotide

triphosphatase (Rodriguez et al., 1986; Broyles and Moss,

1987; Seto et al., 1987). The open reading frame for this

enzyme encodes a 631 amino acid polypeptide. The sequence

for SPV downstream of H2L (designated orf H3L) consists of

267 nuleotides encoding a polypeptide of at least 89 amino

acids, before the sequenced region ends. However, a

comparison of these 89 amino acids to the amino terminal 89








A

VACCINIA
HINDIII D

SWINEPOX
HINDIII H


SPV ORF


GENE


PEPTIDE
I CMETru


Rifampicin resistance


PEPTIDE
H !RJIMO fL.-U


H1L Rifampicin VV-551 70.4%
resistance SPV-551

H2L Capping VV-287
enzyme SPV-287 77.0%


NTPase


VV-631
SPV-89+


69.7%


Figure 6-3. Swinepox virus core open reading frames comparison.
A. A representation of the colinearity of swinepox DNA conserved region sequence compared
to the analogous region of vaccinia virus. The 3 open reading frames deduced from the
sequence within the SPV HindIII H fragment are aligned with the analogous vaccinia open
reading frames. The gene designations refer to data from vaccinia.
B. A comparison of the length of the open reading frames and the identity at the amino
acid level between the SPV and vaccinia products are shown.


NTPase Capping enzyme-
small subunit
I---









86

amino acids of the vaccinia NTPase reveals 69.7% identity.

From the high degree of conservation seen in the 2 complete

SPV orfs (H1L and H2L), it seems probable that SPV orf H3L

represents the NTPase equivalent and probably has a total

length similar to that of its vaccinia homolog.

An examination of the intergenic regions of the SPV

sequence demonstrated that many of the characteristics

present for vaccinia open reading frames are conserved. In

vaccinia, the capping enzyme is expressed at both early

andlate times, whereas the rifampicin resistance and NTPase

genes are expressed only at late times. The region upstream

of the putative translation initiation codon for all three

SPV genes is A+T rich as are all vaccinia promoter regions.

Approximately 20 bp upstream of the start site of the

vaccinia capping enzyme gene is the sequence AATAATGAAAAC,

differing from the vaccinia early promoter consensus motif,

AAAAATGAAAA/TA, by only two nucleotides. The SPV capping

enzyme has a similarly located sequence, AATACTGAAAAC,

differing from the consensus by 3 nucleotides, and from the

vaccinia sequence by only a single base (C at position 5).

Located 27 nucleotides downstream of the translation

termination codon of the SPV capping enzyme is the consensus

early transcription termination signal TTTTTNT. This signal

is also seen downstream of the vaccinia capping enzyme. In

addition, the SPV homologues of both the capping enzyme and

the NTPase genes contain the consensus late transcription




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EV2LAJC1S_TFBMG3 INGEST_TIME 2013-03-05T20:29:35Z PACKAGE AA00013524_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES