Characterization of Zoogloea ramigera in biofilms

MISSING IMAGE

Material Information

Title:
Characterization of Zoogloea ramigera in biofilms
Physical Description:
xii, 102 leaves : ill. ; 29 cm.
Language:
English
Creator:
Lu, Fuhua, 1969-
Publication Date:

Subjects

Subjects / Keywords:
Zoogloea ramigera   ( lcsh )
Biofilms   ( lcsh )
Microbial mats   ( lcsh )
Sewage -- Purification -- Florida -- Gainesville   ( lcsh )
Microbiology and Cell Science thesis, Ph.D   ( lcsh )
Dissertations, Academic -- Microbiology and Cell Science -- UF   ( lcsh )
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1998.
Bibliography:
Includes bibliographical references (leaves 88-101).
Statement of Responsibility:
by Fuhua Lu.
General Note:
Typescript.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 030026657
oclc - 41869711
System ID:
AA00013520:00001


This item is only available as the following downloads:


Full Text










CHARACTERIZATION OF ZOOGLOEA RAMIGERA IN BIOFILMS


By

Fuhua Lu
















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

1998














ACKNOWLEDGMENTS


I would like to express my sincere appreciation to chairman of my supervisory

committee, Dr. S. R. Farrah, for his support, guidance and commitment through the

course of this research. My gratitude is also due to Dr. K. T. Shanmugam, Dr. B. L.

Koopman, Dr. E. H. Hoffman and Dr. A. C. Wilkie for their guidance and counsel while

serving on the advisory committee.

Thanks are extended to Dr. Chris West and Dr. Chasey Rentz for helping me

conduct GC/MS analysis, Mr. Scott Whittaker and Ms. Karen Vaughn of the University

of Florida ICBR Core Laboratory for their assistant in preparation and examination of

SEM samples, and Ms. Sandy Fisher of University of Florida Lake Watch for providing

information on lakes. Special thanks to all colleagues in Dr Farrah's lab, Jerzy Lukasik,

Haitao Zhou, Mike Burne Jr., Troy Scott and Cheryl Boice, for their friendship and

encouragement. I would like to extend my thanks to Engineering Research Center (ERC)

professors and colleagues, for their support and participation during the course of this

research.

I also would like to thank Scott M. Buntin for his encouragement. Finally, I wish

to express sincere gratitude to my father, my mother, my brother and my sister, for their

unconditional love, understanding and patience.















TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ................... ............. ............ ii

LISTS OF FIGURES ............................................... v

LIST OF TABLES ......................................... ...... vii

LIST OF ABBREVIATIONS ........................................ viii

ABSTRACT ................................................... x

INTRODUCTION ................................................ 1

Zoogloea ramigera ............................. ........ ... 1
Wastewater Treatment ......................................... 2
Z ramigera Extracellular Polymer ................................. 4
Biofilms .................................................. 4
Chlorine Disinfection .......................................... 5
Filtration Process in Wastewater Treatment .......................... 6
Objectives .................................................. 7

LITERATURE REVIEW ............................................ 8

Zoogloea ramigera .......................................... 8
Overview of Wastewater Treatment Process ........................ 11
The Function of Z ramigera in Activated Sludge .................... 16
The Function ofZ. ramigera During Biofilm Formation ................ 18
Biofilm Reactors ............................... ............. 22
Reverse Transcription-Polymerase Chain Reaction(RT-PCR)
For Microorganism Detection ................................ 23

MATERIALS AND METHODS ..................................... 26

Bacterial Strains ...................................... .... 26
Z. ramigera Enriched Biofilm Development ......................... 26
Column Studies ............................................. 27









Scanning Electron Microscopy (SEM) ........................... 27
Effect of Antibiotics on Z. ramigera Growth ........................ 28
Isolation ofZ. ramigera from Natural Environments .................. 28
Isolation ofZ. ramigera Extracellular Polymer ...................... 30
Polyclonal Antibodies Production ................................ 30
Indirect Immunofluorescence Staining ............................ 31
Enzyme Immunostaining ...................................... 32
Immunoassay by Scanning Electron Microscopy (SEM) ................ 33
Determination of Most Probable Number (MPN) ofZ. ramigera
in Wastewater Treatment Plants and Lake Water ................... 34
RT-PC R .................................................. 35
Glycosyl Composition Analysis by GC/MS ......................... 37
Zeta Potential Measurement ................................... 38
The Effect of Chlorine on Bacteria in Biofilm ...................... 38
The Effect of Chlorine on Z. ramigera With or Without
Extracellular Polymer ...................................... 39
Bacteriophage Assay ......................................... 39
Preparation of Aluminum Hydroxide Coated Sand .................... 40
Wastewater Exposure of the Coated Sand .......................... 40
Surface Characterization of the sands ............................. 41
Batch and Column Removal of Bacteriophages ...................... 41

RESULTS .................................................... 44

Morphology ofZ. ramigera .................................... 44
Isolation ofZ. ramigera from Natural Environments .................. 45
Immunological Methods for Detection of Z ramigera
from Natural Environments .............. .................. 46
RT-PCR ................................................. 52
Distribution ofZ. ramigera in Wastewater Treatment
Plants and in Lakes ............................................ 58
Characterization ofZ. ramigera Extracellular Polymer ................. 59
The Effect of Chlorine on Bacteria in Biofilm
aswellasonZ. ramigera .............. ...................... 66
Effect of Wastewater on Virus Removal by
Aluminum Hydroxide Coated Sands ............................ 71

DISCUSSION ...................................... ............. 80

APPENDIX: SEQUENCE OF ZOOGLOEA RAMIGERA 16S RRNA ............ 87

REFERENCES .............. ................. ..... 88

BIOGRAPHICAL SKETCH ....................................... 102














LISTS OF FIGURES


Figure Page

1. Conventional wastewater treatment process ............................. 13

2. SEM ofZ. ramigera 106 (ATCC 19544) which was grown in YP medium
(2.5g/1 yeast extract, 2.5g/l peptone) for 48 hours at 280C ................ 47

3. SEM of sand exposed to raw sewage supplemented
with phenol for 2 weeks ......................................... 48

4. Indirect immunofluorescence staining of biofilm that
developed over raw sewage supplemented with phenol ................... 53

5. Immunostaining ofbiofilm that developed over raw sewage
supplemented with phenol .................. .... .............. 54

6. Secondary (A, C) and back scattered (B, D) electron images of
SEM photographs ofbiofilm that developed over raw sewage
supplemented with phenol. Samples were treated with rabbit
antiserum for Z. ramigera extracellular polymer followed by
treatment with gold labeled goat anti-rabbit serum ...................... 55

7. Secondary (A, C) and back scattered (B, D) electron images of
SEM photographs of biofilm developed over raw sewage
supplemented with phenol. Samples were treated with rabbit
antiserum for Z. ramigera cells followed by treatment with
gold-labeled goat anti-rabbit serum ................................ 56

8. Electrophoresis ofRT-PCR by using primers specific for
Z. ramigera 106 16S rRNA ..................................... 57

9. Effect of chlorine on respiratory activities
of bacteria in biofilm ........................................... 69

10. Influence of extracellular polymer on Z ramigera
inactivation by chlorine ......................................... 70










11. MS2 removal by batch experiment .................................. 78

12. PRDI removal by batch experiment ................................. 79















LIST OF TABLES


Table Page

1. The effect of antibiotics on Z ramigera growth ......................... 49

2. The effect of different media on the isolation ofZ. ramigera
from natural environments ...................................... 50

3. The distribution ofZ. ramigera and total aerobic bacteria in the
University of Florida Water Reclamation Facility and in Lake Alice ......... 61

4. The distribution ofZ. ramigera and total aerobic bacteria in
the Kanapaha Water Reclamation Facility ............................ 62

5. The distribution ofZ. ramigera and total aerobic bacteria
in different lakes .............................................. 63

6. Composition ofZ. ramigera extracellular polymer by GC/MS analysis ......... 64

7. Zeta potential of bacteria at pH 7 .................................... 65

8. Effect of chlorine on respiring activity of bacteria in biofilms ................ 67

9. Influence of extracellular polymer on Z ramigera inactivation
by chlorine ................... ................................ 68

10. Zeta potential (mv) of the aluminum hydroxide
coated sand after exposure to wastewater ............................. 75

11. Protein content (mg/g sand) of the aluminum hydroxide
coated sand after exposure to wastewater ............................. 76

12. MS2 and PRDI removal by sand columns ............................. 77














LIST OF ABBREVIATIONS


AEC Aminoethyl carbozole

AHL Acetylated homoserine lactones

BOD Biological oxygen demand

BSA Bovine serum albumin

CTAB Cetyltrimethylammonium bromide

DABCO 1,4-diazabicyclo (2,2,2) octane

DEPC Diethyl pyrocarbonate

DNase Deoxyribonuclease

EDTA Ethylenediaminetetraacetic acid

FITC Fluorescein isothiocyanate

GC/MS Gas chromatography / mass spectrometry

HMDS Hexamethyldisilizane

MIC Minimal inhibitory concentration

MINT Malachite green 2(p-iodophenyl)-3-(p-
nitrophenyl)-5-phenyl tetrazolium chloride

MPN Most probable number

PFA Paraformaldehyde










PBS Phosphate buffered saline

RNase Ribonuclease

rRNA Ribosomal RNA

RT-PCR Reverse transcriptase-polymerase chain reaction

SEM Scanning electron microscopy

TBS Tris buffered saline

TMS Tetramethylsilane

Tris Tris-(hydroxymethyl)-aminomethane

UV Ultraviolet

YP Yeast extract peptone














Abstract of Dissertation Presented to the Graduate School of the University of Florida in
Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy


CHARACTERIZATION OF ZOOGLOEA RAAMIGERA IN BIOFILMS

By

Fuhua Lu

December, 1998

Chairman: Dr. Samuel R. Farrah
Major Department: Microbiology and Cell Science


Zoogloea ramigera is an extracellular polymer-producing bacterium and forms

flocs which include typical finger-like projections and amorphous flocs. Scanning

electron microscopy (SEM) indicated that cells used the extracellular polymer as

attachment sites and were embedded within the extracellular polymer. Finger-like

projections which were similar to those from laboratory cultures ofZ. ramigera were

also found on the surface of sand which had raw sewage supplemented with phenol

passed through them. Z ramigera was isolated from raw sewage, mixed liquor suspended

solids and lake water. The efficiency ofZ. ramigera isolation was greatly increased by

using m-toluic acid isolation medium combined with 1 tg/ml trimethoprim, and/or 10

lg/ml sulfadiazine.

Indirect immunoassay methods for the detection ofZ. ramigera were developed

using polyclonal antibodies against the cells or the isolated extracellular polymer of the









neotype Z ramigera strain 106 (ATCC 19544). The use of goat anti-rabbit IgG

conjugated with FITC or biotin or colloidal gold as the secondary antibody allowed

detection of Z ramigera in environmental samples. These methods were also used as

part of a most probable number (MPN) procedure to quantitate Z ramigera at different

stages of the wastewater treatment processes as well as in different lakes. It was found

that the cells and the extracellular polymer of naturally occurring zoogloeal projections

are antigenically and structurally related to those of Z. ramigera 106. Z ramigera could

be found in all stages of wastewater treatment processes, eutrophic lakes, mesotrophic

lakes, and some oligotrophic lakes. The highest concentration of Z. ramigera was found

in the mixed liquor stage of the two wastewater treatment plants in Gainesville, Florida.

By using bacterial 16S rRNA as template, and the primers specific for Z

ramigera 106 16S rRNA, RT-PCR was also used to identify Z ramigera in biofilms from

natural environments.

Zeta potential measurement indicated that overall surface charge of Z. ramigera

was negative. Gas chromatography-mass spectrometry (GC/MS) analysis indicated the

predominance of carbohydrate, especially amino sugars in the extracellular polymer

produced by Z ramigera. The use of MINT test following treatment of chlorine indicated

that the extracellular polymer protected Z. ramigera cells from chlorine inactivation.

This is true for Z ramigera in both biofilms from natural environments and laboratory

cultures.

Biofilms and other organic and inorganic materials in wastewater blocked

positively charged sites on the surface of aluminum hydroxides coated sand. This loss of








electropositive charge character was found to correspond to the decrease in removal

efficiency of the two bacteriophages, which further supports the importance of

electrostatic forces in virus-sand interaction.














INTRODUCTION


Zooeloea ramizera

Finger-like zoogloeal projections were observed among decaying algae and the

bacteria within the projections were named Zoogloea ramigera by Itzigsohn (1868).

Since then, finger-like zoogloeal projections have been observed in trickling filter slime

layers, and in association with solids formed during aerobic treatment of wastewater

(Bitton, 1994; Butterfield, 1935; Farrah and Unz, 1975; Rossello-mora et al., 1995; Unz

and Dondero, 1967a; Unz and Farrah, 1976a). In some cases, bacteria associated with

these samples were isolated and studied in pure culture (Butterfield, 1935; Unz and

Dondero, 1967a,b). Since the term "finger-like" projection was subjected to different

interpretations, bacteria with different morphological and chemical characteristics were

considered to be Z. ramigera (Butterfield, 1935; Crabtree et al., 1965; Friedman et al.,

1968; Unz, 1971; Unz and Dondero, 1967b). Studies by comparing 16S rRNA sequence

and chemotaxonomic properties have shown that Z ramigera 106 (ATCC 19544) is

related to the bacteria within natural zoogloeal projections but not to the other bacteria

that were previously termed Z. ramigera (Rossello-mora et al., 1993; Shin et al., 1993).

Recently, one of the previously misclassified Zoogloea species was reclassified as

Duganella zoogloeoides (Hiraishi et al., 1997).











It has been difficult to isolate Z ramigera from natural environments. Different

isolation procedures have been tried such as dispersion dilution method (Butterfield,

1935) and micro manipulation method (Unz and Dondero, 1967a). Effect of different

media on isolation was also investigated (Dugan and Lundgren, 1960). Since Z ramigera

grows slowly, often resulting in overgrowth by other microorganisms, conventional

bacterial isolation techniques were not very effective for rapid isolation until aromatic

compounds such as benzoate, m-toluic acid, phenol and cresol were incorporated into

basal media as a carbon source (Unz and Farrah, 1972).



Wastewater Treatment

Since the proper settling of solids produced during aerobic wastewater treatment

is important to produce clear effluents, many researchers have studied the

microorganisms that affect this process. This settling requires a proper balance of floc-

forming bacteria and filamentous bacteria (Bitton, 1994; Nozawa et al., 1987). If the

numbers or activities of the floc-forming bacteria are reduced, sludge bulking may occur,

and turbid rather than clear effluents will be produced. Because of its observed

association with sludge flocs, Z. ramigera has been regarded as an important bacterium

in the activated sludge treatment process (Bitton,1994). In one study, the ability to settle

bulking sludge was restored by seeding the sludge with Z. ramigera and other bacteria

(Nozawa et al., 1987).

Similarly, in trickling filters, the slime layer that develops on the support media is

considered to be very important for the colonization of bacteria (Bitton, 1994). This











slime layer is an extensive polysaccharide matrix that is generally referred to as the

glycocalyx. This glycocalyx anchors the bacteria and helps in the removal of complex

organic and inorganic materials from wastewater (Bitton, 1994). Z ramigera has been

isolated from finger-like projections obtained from trickling filter slimes and is thought

to be an essential player in the filtration process (Butterfield, 1935; Unz and Dondero,

1967a).

Although Z. ramigera has been thought to be important in wastewater treatment,

there is little information on the distribution and concentration of this organism in

wastewater treatment processes. Several procedures for the detection ofZ. ramigera in

natural samples have been established and used to study Z ramigera in wastewater

samples, including using fluorescein-conjugated antibody against Z ramigera cells and

fluorescein-labeled 16S rRNA oliogonucleotide probe (Rossello-mora et al., 1995; Farrah

and Unz, 1975).

Williams and Unz (1983) used enrichment procedures to support the development

of finger-like Zoogloea. These authors found that bacteria capable of producing finger-

like Zoogloea were less than 0.01% of the total microbial population in mixed liquor

solids. However, Rossello-Mora et al.(1995) found that up to 10% of the bacteria within

activated sludge flocs reacted to the fluorescein-labeled oligonucleotide probe

complementary to the 16S rRNA ofZ. ramigera (ATCC 19544). Unz and Farrah(1976a)

showed that finger-like zoogloeae were not usually observed in mixed liquor suspended

solids but could develop from the flocs under the proper incubation conditions.











Z ramigera Extracellular Polymer

Extensive studies have characterized the Z. ramigera extracellular polymer. It

was indicated that no protein or ether-soluble material was detected and amino sugars are

the principal constituent after acid hydrolysis of extracellular polymer (Farrah and Unz,

1976). Separation ofhydrolyzed extracellular polymer ofZ. ramigera isolated from

activated sludge by paper and ion-exchange chromatography suggested that amino sugars

might be glucosamine and fucosamine and the ratio of the two amino sugars was

between 1:1.5 to 1:2 (Tezuka, 1973). Amino sugars have also been found in an

extracellular polymer produced by other bacteria. In Streptococcus pneumoniae, the

extracellular polymer contains a tetrasaccharide repeating unit, three different amino

sugars, N-acetyl-D-mannosamine, N-acetyl-L-fucosamine and N-acetyl-D-galactosamine,

are sequentially linked to a D-galactopyranosyl residue carrying a 2,3-linked pyruvate

ketal (Jansson et al., 1981).



Biofilms

Surfaces exposed to a variety of types of water are found to develop biofilms of

microorganisms. Biofilm bacteria live in a complex microbial community that has

primitive homeostasis, a primitive circulatory system and metabolic cooperativity so that

each of these sessile cells reacts to special environment fundamentally different from

planktonic counterparts (Costerton et al, 1995; Kolter and Losick, 1998). Biofilm

microorganisms are usually more resistant to environmental stress and antimicrobial

agents than planktonic counterparts.










Besides the difference between biofilm microorganisms and planktonic

microorganisms, the precise manner by which extracellular polymer protects the cells is

unclear, but the presence of bound extracellular enzymes, such as P-lactamase, within the

Pseudomonas aeruginosa glycocalyx may reinforce its action as a diffusion barrier

(Bolister et al., 1991) with respect to some antibiotics, and its molecular severing

properties are enhanced through binding of divalent cations, such as calcium, from the

environment (Hoyle et al., 1992). It has also been proposed that the glycocalyx provides

intrinsic protective effects against antimicrobial agents which are additional to those

associated with its diffusion and charge-related properties (Hodges and Gordon, 1991).

For example, Pseudomonas aeruginosa povidone-iodine resistance seems to be due to

the protective layering of cells within the glycocalyx which increase the time required for

iodine to contact cells in the deepest layers of the biofilm (Brown et al., 1995). The

properties of biofilms have been considered in developing methods to control microbial

biofilm growth (Wood et al., 1996).



Chlorine Disinfection

In wastewater treatment processes, chlorine is a commonly used disinfectant to

inactivate bacteria and viruses (Bitton, 1994). The mechanisms of chlorine inactivation

were extensively investigated ( Bitton and Koopman, 1982; Costerton et al., 1995; De

Beer et al., 1994; Dutton et al., 1983; Herson et al., 1987; Huang et al., 1995;

LeChevallier et al., 1988a,b; LeChevallier et al., 1984) so that strategies could be

developed to effectively control water quality and prevent waterborne disease outbreaks.











Besides, chlorine was also used to control sludge bulking which results from a

predominance of filamentous bacteria and absence of floc forming bacteria during

activated sludge process (Bitton and Koopman, 1982). It was noticed that bacteria

attached to surfaces (Brown et al., 1995; De Beer et al., 1994) or extracellular-

polysaccharide-coated bacteria (Bolister et al, 1991) were more resistant to antibacterial

agents (including chlorine) than were their planktonic counterparts. It was suggested that

the reason for reduced efficacy of chlorine against biofilm bacteria as compared with its

action against planktonic cells might be the limited penetration of chlorine into the

biofilm matrix (De Beer et al., 1994; Herson et al., 1987; Huang et al., 1995;

LeChevallier et al., 1988a,b; LeChevallier et al., 1984).



Filtration Process in Wastewater Treatment

Filtration processes are used in both water and wastewater treatment. In

wastewater treatment process, trickling filters are used in aerobic treatment of

wastewater. These filters consist of inanimate materials such as rocks. Wastewater is

passed over these filters to allow biofilm developed on the surface of the filter, thus to

reduce the level of organic contaminants in wastewater. This filtration process has been

used to remove pathogenic bacteria and virus from water and wastewater. It was

indicated that biofilm development on filter media enhanced physical entrapment of

bacteria and bacteria-sized fine particles from water (Banks and Bryers, 1992; Drury et

al., 1993; Rittmann and Wirtel, 1991; Sprouse and Rittmann, 1990; Schuler et al., 1991).











Sand filters are also used in water and wastewater treatment. It has been shown

that surface modification of filter media with various metal oxides, peroxides or

hydroxides also increased the microorganism removal efficiency by changing the surface

charge of the media from electronegative to electropositive, thus decreasing the

electrostatic repulsion between the particles and the adsorbing solid (Lukasik et al., 1996;

Truesdail et al., 1998).



Objectives

The objectives of this study were (1) to study the structure of natural and

laboratory finger-like projections; (2) to improve the Z ramigera isolation method; (3) to

develop Z ramigera detection methods by using immunological and molecular

procedures; (4) to use these procedures to estimate the number of Z ramigera in

wastewater at different stages of treatment and in lake water; (5) to characterize the

extracellular polymer of Z. ramigera and its influence on chlorine inactivation; and (6) to

evaluate the effect of biofilm and other organic and inorganic materials in wastewater on

virus removal by aluminum hydroxide coated sand.














LITERATURE REVIEW


Zoogloea ramirera

Z ramigera is an extracellular polymer producing bacterium that forms typical

finger-like projections and is found among decaying algae, in wastewater, and in other

organically enriched environments. The bacteria within the finger-like zoogloeal

projections were named Zoogloea ramigera by Itzigsohn (1868). Z ramigera is a gram-

negative, aerobic, chemoorganotrophic bacterium. It also grows anaerobically in the

presence of nitrate (nitrate respiration) and denitrification occurs with formation of N2.

Major carbon sources include lactate, glutamate, alcohol, benzonate, and m-toluate.

Benzene derivatives are used by meta cleavage (Holt et al., 1994). Neither acid nor gas is

produced from carbohydrates (Butterfield, 1935; Heukelekian and Littman, 1939; Unz

and Dondero, 1967b). It might be that the bacterium either does not attack the

carbohydrates to produce acid by-products from them, or produces alkaline materials

from the proteins which neutralize the acids produced or further metabolizes the acids as

rapidly as they are formed (Heukelekian and Littman, 1939). Optimum temperature and

pH for growth are near 28*C and pH 7.0, respectively (Unz and Dondero, 1967b). The

extracellular polymer produced by Z. ramigera attaches to its cell walls and does not

make broth viscous during the synthesis phase. This property allows high oxygen transfer

rates to be maintained during the high oxygen demand period. Furthermore, very low











oxygen consumption was observed during the period of polysaccharide release when the

oxygen transfer rate can not be raised without very high energy input (Norberg and

Enfors, 1982). The extracellular polymer production is also influenced by the carbon and

nitrogen sources (Unz and Farrah, 1976b).

Z ramigera was originally observed among decaying algae (Itzigsohon, 1868).

Later, the recognition of the possible importance of Z ramigera in activated sludge and

trickling filter have led to extensive studies ofZ. ramigera (Crabtree et al., 1965). The

dispersion dilution method (Butterfield, 1935), micro manipulation (Unz and Dondero,

1967a) and the use of isolation media containing aromatic compounds (Unz and Farrah,

1972) were used to isolate Z ramigera from natural environments such as activated

sludge and trickling filter slime. The effects of different media on isolation were also

investigated (Dugan and Lundgren, 1960).

Biochemical tests of Z ramigera allowed convenient identification of Z

ramigera from natural environments (Unz, 1971). It was found that Z. ramigera isolated

from activated sludge and trickling filter functions similarly (Wattie, 1942). Fluorescence

microscopy (Farrah and Unz, 1975) and scanning electron microscopy (SEM) (Sich and

Van Rijn, 1997) were used to observe the presence ofZ. ramigera in natural

environments. In order to understand the mechanism of Z ramigera function in activated

sludge and trickling filter, structure and composition ofextracellular polymer

surrounding Z ramigera have also been investigated (Crabtree et al., 1966; Friedman et

al., 1968; Horan and Eccles, 1986; Norberg and Enfors, 1982; Parsons and Dugan, 1971;

Unz and Farrah, 1976b).









10

Based on the physiology and biochemical properties ofZ. ramigera (Heulelekian

and Littman, 1939; McKinney and Harwood, 1952; Unz and Dondero, 1967b; Krul,

1977), efforts were made to establish its identification criterion and generic status

(Zvirbulis and Hatt, 1967; Crabtree and McCoy, 1967; Munich, 1979; Skerman et al.,

1980; Rossello-mora et al., 1993; Shin et al., 1993). It was first requested that ATCC

19623 (strain I-16-M) should be accepted as the neotype strain in 1967 (Crabtree and

McCoy, 1967). In 1971, ATCC 19544 (strain 106) was suggested as the neotype strain

because 1-16-M did not form typical finger-like projection (Unz, 1971) and no

extracellular material was observable around I-16-M (Friedman et al., 1968). However,

based on the observation of floc formation during growth, three phylogenetically

distantly related strains, ATCC 19544T (strain 106) (T=type strain), ATCC 25935 (strain

115), and ATCC 19623 (strain I-16-M), were included in the same species. Through

chemotaxonomic study (mainly polyamine and quinone composition) and comparative

analyses of 16S rRNA primary structure, it has been suggested that only isolates that

clearly resemble neotype strain ATCC 19544T phenotypically should be considered

genuine members ofZ. ramigera (Rossello-mora et al., 1993). In fact, 16S rRNA

sequence comparisons and distance matrix tree analysis revealed that Z ramigera 106

forms a lineage with Rhodocyclus purpureus in the beta subclass ofproteobacteria.

ATCC 25935 was shown to belong to the beta subclass of the class Proteobacteria with

members of the genus Telluria as its closest relatives. In contrast, ATCC 19623 proved

to be a member of the alpha subclass of the proteobacteria, closely related to









11

Agrobacterium tumefaciens. (Shin et al., 1993). Recently, ATCC 25935 was reclassified

as Duganella zoogloeoides (Hiraishi et al., 1997).

The possible biotechnological importance of Z. ramigera is that it plays

important roles in wastewater treatment process, especially in flocculation of activated

sludge and biofilm formation on the surface of biofilm reactors.



Overview of Wastewater Treatment Process

The objectives of wastewater treatment processes are reduction of organic

content (BOD), nutrients (N, P) and removal/reduction of pathogenic microorganisms

and parasites. The conventional wastewater treatment process includes (1) preliminary

treatment to remove debris or coarse materials; (2) primary treatment which is by

physical means such as screening and sedimentation; (3) secondary treatment which is by

biological means such as activated sludge, trickling filter, or oxidation ponds, and

chemical means such as disinfection; and (4) tertiary or advanced treatment which is

mainly by chemical means, such as flocculation, filtration, and disinfection.

Influent from a collection system or pumping station is first treated by

preliminary processes (pumping, screening and grit removal) and primary settling to

remove heavy solids and floatable materials. Primary solids may go to landfills. Primary

effluent is treated by biological means (eg. activated sludge or trickling filter). If tricking

filters are used, the primary effluent is applied to filter beds containing natural materials

(rock, coal) or synthetic (plastic) supports that permit biofilm development. Then, sludge

(solid sloughed off the filters) and liquids are separated in settling tanks. In the activated











sludge process, primary effluent is mixed with returned activated sludge (RAS) to form

the mixed liquor in the aeration tank where aeration is provided by mechanical means.

When treatment with activated sludge is complete, the mixture goes to sedimentation

tanks to separate solids (sludge) and liquid. A portion of sludge is recycled to provide an

inoculum for the influent sewage. The rest of sludge is usually further processed by

screening, thickening, dewatering, conditioning, and stabilization (anaerobic digestion,

aerobic digestion, composting, lime stabilization and heat treatment) before land

application. The secondary effluent is further treated by chlorination, filtration,

flocculation, and so on before agriculture reuse, landscape irrigation, ground water

recharge, recreational reuse, nonpotable urban reuse, potable reuse, industrial reuse, or

released to receiving waters (Fig. 1).

BOD, N and P are greatly reduced during biological wastewater treatment

processes. They are also reduced by chemical means such as flocculation, composting

and lime stabilization. Efficient microorganism removal from wastewater is very

important in order to prevent waterbore disease outbreaks and to protect the public's

health. During primary and secondary wastewater treatment, most of the protozoans are

settled with sludge solid due to their bigger size compared with bacteria and viruses.

Many bacteria and viruses associated with sludge solids are also settled with the sludge.

Almost 90% of viruses may be removed from water by the activated sludge treatment

process (Rao and Melnick, 1986). It was reported that Z ramigera extracellular polymer

avidly adsorbed 'SI-labeled polio virus and either precipitated the virions or neutralized

them (Smith, 1983; Rao and Melnick, 1986).
















returned sludge


From collection liquid I sedimentation
mechanical screen Mixed
system or pumping grit removaltank
station solid iquorphase
landfill liquid

disinfection solid

reuse eg. lake limestone aerobic digestion/
anaerobic digestion

di etrsegid slud o


filtered water


sludge to land application I

belt press and
belt filter press


Fig. 1. Conventional wastewater treatment process











Ciliated protozoans are the predominant protozoans present in activated sludge.

They consume many of the absorbed materials in sludge, including viruses and bacteria

(Rao and Melnick, 1986; Bitton, 1994). These microorganisms in the sludge are reduced

by sludge processes such as composting, heat treatment, aerobic/anaerobic digestion, and

so on. The microorganisms in the liquid phase of wastewater are removed by flocculation

and disinfection treatments such as with chlorine, ozone, chlorine dioxide, and so on.

The order of removal efficiency by disinfectants usually is bacteria > virus > protozoan.

Besides disinfection treatment, filtration has been a useful method for removal of

bacteria, virus and other fine particles from wastewater during tertiary wastewater

treatment. Rapid sand filtration and biofilm-mediated slow sand filters have been used

for removal of bacteria and viruses in wastewater treatment plants. In order to improve

the removal of microorganisms from water and wastewater, the mechanisms of

microorganism adsorption to solid particles have been investigated (Mills, et al., 1994;

Gerba., 1984). It was indicated that electrostatic interactions are important for filtration

of recombinant Norwalk virus particles and bacteriophage MS2 in quartz sand (Redman

et al., 1997). Hydrophobic interactions (Bales and Li, 1993), van der Waals forces, and

surface properties such as surface roughness and surface charge heterogeneity are also

important in microorganisms-solid interaction (Lukasik et al., 1996; Truesdail et al.,

1998).

Different modifications of filter media have been tried, including the use of

metal peroxide (Asghari and Farrah, 1993; Farrah and Preston, 1991; Gerba et al., 1988),

metal oxide (Stenkamp and Benjamin, 1995), and metal hydroxide coatings (Farrah and











Preston, 1985; Lukasik et al., 1996; Lukasik et al., 1998). Such modifications have

increased the removal of microorganisms from water relative to untreated granular

media. The reason is that modifying the sand or diatomaceous earth with various metal

oxide, peroxide or hydroxide surface coatings changed the surface charge from

electronegative to electropositive, thus decreasing the electrostatic repulsion between the

particles and the adsorbing solid. Therefore, these modified filter media are promising

materials to be used in removing microorganisms in wastewater filtration processes.

When the modified filter media are used in wastewater treatment plants, the

development of biofilms or the presence of organic and inorganic materials in the

wastewater have the potential to change the surface properties of the filter media, and

thus influence the microorganism removal capacity. It has been suggested that biofilm

development on slow sand filters (Schuler et al., 1991), glass, polycarbonate and granular

activated carbon surfaces (Banks and Bryers., 1992; Drury et al., 1993; Rittmann and

Wirtel., 1991; Sprouse and Rittmann., 1990) enhanced the physical entrapment of

bacteria and bacterium-sized fine particles. However, it was also found that sewage-

derived organic matter blocked the attachment sites on ferric oxyhydroxide-coated quartz

thus decreasing bacteriophage PRDI adsorption (Pieper et al., 1997).

Overall, biological wastewater treatment processes are important for

microorganism removal as well as reduction of organic materials. It has long been

believed that Z ramigera plays important roles in wastewater treatment processes such

as activated sludge flocculation and biofilm formation on the surface of trickling filters.










The Function of Z ramigera in Activated Sludge

In the activated sludge process, wastewater is fed continuously into an aerated

tank, where the microorganisms metabolize the organic materials. Biological flocs form

during this process. These flocs consist of a variety of microorganisms and are

collectively referred to as activated sludge. Following the treatment, a portion of the

sludge is discarded (wasted) and the rest is returned to the aeration tank. The relatively

clear supernatant from the final settling tank is the secondary effluent.

The primary feeders in activated sludge are bacteria. Secondary feeders are

holozoic protozoans. Microbial growth in the mixed liquor is maintained in the declining

or endogenous growth phase to ensure good settling characteristics. Activated sludge is

truly an aerobic treatment process since the biological floc is suspended in liquid media

containing dissolved oxygen. Dissolved oxygen extracted from the mixed liquor is

replenished by air supplied to the aeration tank (Viessman and Hammer, 1985).

In activated sludge, extracellular polymer produced by Z ramigera and other

activated-sludge microorganisms plays a role in bacteria flocculation and floc formation

processes which are essential prerequisites for the efficient and economical operation of

an activated-sludge wastewater treatment plant (Bitton, 1994). Floc formation during the

aeration phase is also instrumental in removing undesirable microorganisms.

The proper settling of activated-sludge solid requires a proper balance of floc-

forming bacteria and filamentous bacteria. If the numbers or activities of the floc-

forming bacteria are reduced, sludge bulking may occur and turbid rather than clear

effluents will be produced (Bitton, 1994; Nozawa et al., 1987). Sludge bulking is one of










the major problems affecting biological wastewater treatment. There are several

approaches for controlling sludge bulking, including addition ofoxidants such as

chlorine or hydrogen peroxide, flocculent such as synthetic organic polymers, lime and

iron salts, and using biological selectors (Bitton, 1994). It was indicated that the ability to

settle bulking sludge was also restored by seeding sludge with Z ramigera (Nozawa et

al., 1987).

Farrah and Unz (1976) studied Z. ramigera extracellular polymer and found that

amino sugars are the principal constituent after acid hydrolyzation of extracellular

polymer and the amino sugars content in extracellular polymer isolated from activated

sludge flocs was similar to that of from Z. ramigera. Paper and ion-exchange

chromatography separation of hydrolyzed extracellular polymer of Zoogloea isolated

from activated sludge suggested that the amino sugars are glucosamine and fucosamine

(Tezuka, 1973). The isolated polymer from activated-sludge microorganisms has been

found to contain neutral sugars, amino sugars, uronic acids and amino acids, which

indicates their heteropolysaccharidic character (Hejlar and Chudoba, 1986). The

molecular weight of the extracellular polymer fraction ranged from 3xl0' to 2x106

Daltons. Glucose, galactose, mannose, glucuronic acid and galacturonic acid were

detected in this fraction (Horan and Eccles, 1986).

Therefore, there are negative and positive charges in the extracellular polymer

which allow the polysaccharide to behave as polyelectrolyte. It is observed that

extracellular polymers produced by microorganisms commonly found in activated sludge

display a great affinity for metals. Several types of bacteria (e.g. Z ramigera, Bacillus











lichenifomis), some of which have been isolated from activated sludge, produce

extracellular polymers that are able to complex and subsequently accumulate metals,

such as iron, cooper, cadmium, nickel or uranium. For example, Duganella zoogloeoides

(ATCC25935) can accumulate up to 0.17 g of Cu per gram of biomass (Norberg and

Persson,1984; Norberg and Rydin, 1984). This bacterium, when immobilized in alginate

beads, is also able to concentrate cadmium to as high as 250 mg/1 (the alginate beads also

absorb some of the cadmium) (Kuhn and Pfister, 1990). The heavy metal adsorption of

Duganella zoogloeoides (ATCC25935) might be related to its production of an acidic

extracellular polymer such as succinoglycan which contains glucose, succinate and

pyruvate (Ikeda et al., 1982). Correlation between highly anionic charged polymers and

metal completing capacity was found by study of chelating properties of extracellular

polysaccharide produced by Chlorella spp. (Kaplan et al., 1987).

It is also noticed that the production of extracellular polymer by bacteria may

drastically reduce the saturated hydraulic conductivity of sand columns (HCsat) and this

effect was only observed when the extracellular polymer produced in the form of loose

slime layers. Cell-bound capsular extracellular polymer had no significant effect on the

HCsat (Vandevivere and Baveye, 1992).



The Function ofZ. ramigera During Biofilm Formation

Biofilm formation is thought to result from the concerted action of primary

attachment to a specific surface and accumulation in multilayered cell clusters. Biofilms

are defined as matrix-enclosed bacterial populations adherent to each other and/or to










surfaces or interfaces. This definition includes microbial aggregates and floccule and

also adherent populations within the pore spaces of porous media (Costerton et al.,

1995). Biofilm is ubiquitous. It exists in natural environments (Gillan et al., 1998;

McLean et al., 1997), and in clinical settings (Stickler et al., 1998). The structural and

physiological heterogeneity ofbiofilm is now widely recognized (Huang et al., 1995;

Huang et al., 1998; Stewart et al., 1997; Xu et al., 1998).

In addition to traditional methods (cultivation and/or microscopy), genetic

methods are also available to characterize microbial diversity. Amplification and

sequence analysis of the 16S rRNA (rDNA) has been successfully used for understanding

the biology of microbial community (Britschgi and Givonnoni, 1991; DeLong et al.,

1993; Gillan et al., 1998; Liesack and Stackebrandt, 1992; Ward et aL, 1990). In one

study, the genetic diversity and phylogenetic affiliation ofbiofilm bacteria which covered

the shell of bivalve Montecutaferruginosa were determined by denaturing gradient gel

electrophoresis (DGGE) analysis of 16S ribosomal DNA PCR products obtained with

primers specific for the domain Bacteria (Gillan et al., 1998). Fluorescein in situ

hybridization (FISH) by using fluorescein labeled oligonucleotide probes are also

frequently used to detect and characterize bacteria in microbial community (Muyzer and

Ramsing, 1995).

During biofilm formation, initial attachment requires flagella or surface

adhensins and nutritional signal from environments (Costerton et al., 1995). Attached

bacteria excrete extracellular polymer as a matrix for biofilms (Costerton et al., 1987;

Allison and Sutherland, 1987). Mature biofilms form mushroom- and pillar-like










structures with water channel between them, which function much like primitive

circulatory system (Costerton et al., 1995). It has been noticed that bacterial cells in

biofilm are usually more resistant to environmental stress and antibacterial agents than

planktonic cells (Allison and Sutherland, 1987; Marshall et al., 1989; Ophir and Gutnick,

1994; Brown et al., 1995). It is said that bacterial adhesion might trigger the expression

of a sigma factor which regulates a large amount of genes so that biofilm cells are

phenotypically distinct from planktonic cells of the same species (Costerton et al., 1995;

Yu and Mcfeters, 1994). Recent study indicated that the pattern of gene expression

within biofilm is largely controlled by the metabolic activity of the microorganisms and

the local availability of carbon and energy sources (Huang et al., 1998; Xu et al., 1998).

It has been noticed that biofilm formation involves cell-to-cell signals (Passador

et al., 1993; Kolter and Losick, 1998; Davies et al., 1998). Acylated homoserine lactones

(AHLs) are chemical signals that mediate population density-dependent (quorum-

sensing) gene expression in numerous Gram-negative bacteria (Stickler et al., 1998).

Structures of signals in Pseudomonas aeruginosa are N-3-(oxooctanoyl)-L-homoserine

lactones and N-(butyryl)-L-homoserine lactones. These signals were required for the

expression of the virulence factors toxin A and elastase (Passador et al., 1993).

AHLs accumulated in bacterial cultures as membrane-permeant signal molecules.

At a threshold population density, the accumulated AHLs interact with cellular receptors

controlling the expression of a set of specific target genes which respond to local cell

density (Fuqua et al., 1996; Salmond et al., 1995; Stickler et al., 1998). Therefore, AHLs

are important in the development of the biofilm-specific physiology (Heyes et al., 1997).











For example, a Pseudomonas aeruginosa mutant strain unable to make AHLs did not

produce a typical biofilm and was sensitive to the biocide sodium dodecyl sulfate

(Davies et al., 1998). It was indicated that AHLs are not only produced in natural

biofilms growing on submerged stones taken from the San Marcos river in Texas

(McLean et al., 1997), but also produced by biofilm in clinical setting such as indwelling

urethral catheter (Stickler et al., 1998).

Analogues of AHLs capable of interfering with signaling have the potential to be

used to prevent the formation and development of biofilm on implanted medical devices.

It was indicated the furanone derivatives produced by the seaweed Delisapulchra inhibit

swarming ofSerratia liquefaciens which is AHLs-regulated. It was speculated that

furanone derivatives mimic AHLs signaling process by blocking transcriptional

activation of target genes (de Nys et al., 1995; Erble et al., 1996; Givskov et al., 1996).

Therefore, it is very likely to be able to control biofilm formation and dissolution in situ

by using AHLs and its analogues.

Extracellular polymer production by biofilm bacteria not only helps the initial

attachment of bacteria to surfaces but also helps the formation and maintenance of micro

colonies and biofilm structure, enhances biofilm resistance to environmental stress and

antimicrobial agents, protects bacteria in the biofilm from protozoan grazing and

provides biofilm nutrition (Allison and Sutherland, 1987; Heissenberger et al, 1996;

Marshall et al.,1989; Ophir and Gutnick, 1994). The extracellular polymer in biofilm is

also highly heterogenous and has been demonstrated in situ to vary spatially, chemically

and physically (Lawrence et al., 1994; Wolfaardt et al., 1993; Wolfaardt et al., 1994). In











addition, the chemically reactive extracellular polymer is generally the first biofilm

structure to come in contact with potential substrates, predators, antimicrobial

agents/antibiotics and other bacteria, and thus is of considerable applied and ecological

importance. For example, bacterial cells would be attached to the organic nutrients that

concentrate naturally at surfaces in aquatic systems, and the extracellular polymer that

mediate their adhesion to surfaces would further concentrate dissolved organic molecules

and cations out of bulk fluid.



Biofilm Reactors

In wastewater treatment plants, biofilm reactors include trickling filters, rotating

biological contractors (RBC), and submerged filters (down-flow and up-flow filters).

These reactors are used for oxidation of organic matter, nitrification, denitrification or

anaerobic digestion of wastewater. During biofilm formation on trickling filter surfaces,

the surface of the support materials is colonized with Gram-negative bacteria followed by

filamentous bacteria. There are two steps in the absorption of bacteria to biofilm

surfaces. The first step is reversible sorption, mainly controlled by electrostatic

interactions between absorbent and the cells. The second step consists of irreversible

absorption of cells, resulting from the formation of polysaccharide-containing matrix,

named glycocalyx. Glycocalyx not only helps anchor the biofilm microorganisms to the

surface, but also helps protect microorganisms from predation and from chemical insult.

There are also polyanionic compounds in glycocalyx that complex the metal ions (Bitton,

1994).









23
Z ramigera was found in biofilm during denitrification by fluidished bed reactors

(Sich and Rijn, 1997). It degraded phenols and nitrogen-containing aromatic compounds

(Koch et al., 1991) and co-existed with Pseudomonas during these processes. Initial

colonization on granules was mainly Zoogloea species. During the period of co-

existence, Zoogloea cells provided a setting substrate for Pseudomonas and the

gelatinous matrix provided by Zoogloea might have served as nutrient trap for

Pseudomonas which eventually covered the entire outer layers of the granules (Sich and

Rijn, 1997).



Reverse Transcription-Polvmerase Chain Reaction (RT-PCR) for Microorganism
Detection

In addition to traditional microbiological and immunological methods for

microorganism detection, molecular procedures have been increasingly popular and more

frequently used to detect virus, bacteria and protozoan in clinical and environmental

samples.

Comparing with immunological methods (eg. immunohistology, ELISA, etc) and

tissue culture, RT-PCR has been extensively used as a sensitive, specific and time saving

method to detect genes of RNA viruses (Hayase and Tobita, 1998), including dengue

virus (Chow et al., 1998; Hober et al., 1998; Liu et al., 1997), hepatitis A virus

(Cromeans et al., 1997), hepatitis C virus (Jeannel, et al., 1998; Laursen et al., 1998;

Whitby and Garson, 1997), citrus psorosis virus (Barthe et al., 1998), reovirus (Tyler et

al., 1998), enterovirus (Chung et al., 1996; Gantzer, et al., 1997), respiratory virus










(Rohwdder et al., 1998; Valassina et al., 1997), measles virus ( Chadwick et al., 1998;

Kawashima et al., 1996), mumps virus (Kashiwagi et al., 1997; Cusi et al., 1996), HIV

(Beilke et al., 1998; Contoreggi et al., 1997), and so on.

Several varieties of RT-PCR was developed for virus detection. For example,

multiplex RT-PCR was used to rapidly detect and identify different serotype of viruses

such as human parainfluenza viruses 1, 2 and 3 (Echevarria et al., 1998), or different

species such as influenza A virus (IA) and respiratory syncytial virus (RS) (Valassina et

al., 1997). Nested or semi-nested RT-PCR can be used for rapid type-specific(Chow et

al., 1998) or genus-specific detection (Hafliger et al., 1997; Pfeffer et al., 1997). In situ

RT-PCR was used to localize the virus in the specimens (Walker et al., 1998; Qureshi et

al., 1997). RT-PCR-ELISA (Whitby et al., 1997) was also developed and much more

sensitive than southern blot hybridization. RT-PCR coupled with microplate colorimetric

assay (Legeay et al., 1997) can be used to quantitate PCR products.

RT-PCR targeting of bacterial ribosomal RNA has been frequently used to detect

bacteria. This method has several advantages. One of them is that bacterial rRNA has

conserved and variable regions. This makes it convenient to find general as well as

specific target sites for PCR primers. Second, various databases of rRNA sequences such

as Ribosomal Database Project and Gene Bank are available so that phylogenetic

analysis (Rossello-mora et al., 1995; Gillan et al., 1998) and primer design can be

performed. Third, each bacterial cell contains 1,000 to 10,000 copies of rRNA, detection

of rRNA should impart increased sensitivity over assays based on the detection of a









25

single copy or even multiple copies of genomic sequences. For example, RT-PCR assay

targeting the 16S rRNA of Mycobacterium leprae (Kurabachew et al., 1998) or

Treponema pallidum (Centurion et al., 1997) was used to detect low numbers of viable

organisms in samples.

RT-PCR targeting bacterial mRNA has also been used to detect viable bacteria

because bacterial mRNA has an extremely short half life, averaging only a few minuets.

Previously, the presence of viable Mycobacterium tuberculosis (Jou et al., 1997) and

Listeria monocytogenes (Klein and Juneja, 1997) were detected by using RT-PCR

targeting bacterial mRNA.

Efforts have been made to detect protozoans from environments. Procedures used

include flow cytometry (Vesey et al., 1993), laser scanning (Anguish and Ghiorse, 1997)

and immunomagnetic separation (Campbell and Smith, 1997). The sensitivity of

protozoan detection was greatly increased by concentrating cyst and oocysts with filters,

selectively capturing mRNA with oligo (dT)25 magnetic beads and then performing RT-

PCR. It was indicated that low numbers of viable Giardia cysts and Cryptosporidium

parvum oocysts were detected in water samples and the method was more sensitive than

using immunofluorescence assay (Kaucner and Stinear, 1998).














MATERIALS AND METHODS


Bacterial Strains

The following bacteria were used in this study: Salmonella typhimurium (ATCC

19585), Escherichia coli (ATCC 15597), Klebsiellapneumoniae (ATCC 13883), Proteus

vulgaris (ATCC 13315), Staphylococcus aureus (ATCC 12600), Pseudomonas

aeroginosa (ATCC 10145), Duganella zoogloeoides (ATCC 25935), 'Z ramigera' 1-16-

M (ATCC 19623), and Z. ramigera 106 (ATCC 19544). Z ramigera 106 (ATCC 19544),

'Z. ramigera' I-16-M (ATCC 19623), and Duganella zoogloeoides (ATCC 25935) were

grown in YP medium (2.5 g/l yeast extract, 2.5 g/1 peptone) for 36-48 hours at 280C. All

other bacteria were grown in Tryptic Soy Broth (Difco Laboratories, Detroit, MI) for 24

hours at 37C.



Z ramigera Enriched Biofilm Development

Phenol (Acros Organics, Pittsburgh, PA) was added to 100 ml samples from

wastewater treatment plants or surface water contained in 250-ml beakers daily to

provide an initial concentration of 50 pg/ml. The samples were incubated at ambient

temperature (approximately 250C) for up to one week. During incubation, the samples

were periodically examined for the development ofa biofilm that contained finger-like

projections characteristic of Z. ramigera.











Column Studies

Raw sewage was obtained from University of Florida Water Reclamation Facility

(Gainesville, FL). The raw sewage was filtered through cheese cloth (Fisher Scientific,

Springfield, NJ) to remove large particles from the water before passing through the

column.

Ottawa sand (Fisher Scientific, Springfield, NJ) was packed into an acrylic

column (1.5cm ID x 0.5 m). The raw sewage with 50 tg/ml phenols was passed through

the column in inflow mode. The treatment lasted for two weeks. The sand was then taken

out from the column, washed with deionized water for 3 times and ready for observation

under a scanning electron microscope.



Scanning Electron Microscopy (SEM)

Mid-log phase of Z. ramigera 106 (ATCC 19544) culture was centrifuged and

washed twice with deionized water. The sample was dehydrated by soaking for five

minutes serially in increasing ethanol solutions (25%, 50%, 75%, 95% and twice in

100% ethanol). It was then fixed by hexamethyldisilizane (HMDS). The culture was then

mounted on a nucleopore filter (Fisher Scientific, Pittsburgh, PA) and sputter-coated with

gold particles for 5 minutes. The sample was viewed on the Hitachi S-4000 Field

Emission SEM. Natural biofilms that developed on sand filter media after the passage of

phenol fortified (50 ag/ml) wastewater were also processed and observed on a SEM as

described above.











Effect of Antibiotics on Z. ramipera Growth

All antibiotics were purchased from Sigma Chemicals (St. Louis, MO). Stock

solutions for trimethoprim (0.5 mg/ml) were made by dissolving 0.05 g of trimethoprim

in 5 ml benzyl alcohol and 5 ml deionized water. The solutions were passed through a

0.45mi filter (Fisher Scientific, Pittsburgh, PA). Stock solutions for penicillin (7.5

mg/ml), tetracycline (25 mg/ml), streptomycin (125 mg/ml), sulfadiazine (5 mg/ml), and

cephalosporin (100 mg/ml) were made in deionized water and filter sterilized.

Tests were carried out by adding different concentrations of antibiotics into YP

liquid medium. Z ramigera (ATCC 19544) was inoculated and incubated at 28C for 4-5

days. Growth was determined by comparing growth in tubes without antibiotics to

growth in tubes with antibiotics.



Isolation ofZ. ramieera from Natural Environments

In order to make m-toluic acid isolation media, the following solutions were used.

(A). Potassium phosphate solution (0.06M, 100x) was made by adding 1.0 g of K2HPO4

to 100 ml deionized water. The solution was adjusted pH to 7.2 and autoclaved for 15

min; (B). M-toluic acid (50 mg/ml) stock solution (1,000x) was made by mixing 5 g of

m-toluic acid, Iml solution A, and 5 ml of IN NaOH. The mixture was heated until the

m-toluic acid was completely dissolved. The pH was adjusted to 7. The solution was

passed through a 0.2 upn pore size filter; (C). Salt solution (100x) was made by adding 2

g of MgSO4, 3.75 g of (NH4)2SO4 and 0.02 g of CaCl2 to 100 ml deionized water;










(D).Yeast autolysate solution (100X) was made by adding 0.1 g of yeast autolysate into

100 ml deionized water.

To make the isolation medium, 1 ml solution C, I ml solution D, 97 ml deionized

waters and 1 gram of agar were mixed. After autoclaving and cooling to 550C, I ml of

solution A, 0.1 ml solution B and appropriate amount of sulfadiazine and/or

trimethoprim were added.

Raw sewage was obtained from University of Florida Water Reclamation Facility

(Gainesville, FL). Lake water was obtained from Lake Alice (Gainesville, FL). Z

ramigera enriched biofilm developed over raw sewage was conducted by adding 50

gg/ml phenol into raw sewage and incubated at room temperature for 4-5 days. Z

ramigera enriched biofilm developed over lake water was conducted by adding 50pg/ml

phenol into lake water and incubated at room temperature for 7-10 days. The

microorganisms from the biofilms were streaked on the m-toluic acid isolation medium

combined with lg/ml trimethoprim and/or 10g/ml sulfadiazine. Hard colones on the

agars resembling Z. ramigera (Unz and Farrah, 1972) were selected and re-streaked on

the same medium 2-3 times for purification.

Mixed liquor suspensions were obtained from University of Florida Water

Reclamation Facility (Gainesville, FL). Mixed liquor suspensions were centrifuged at

5,000 rpm for 5 min. The pellet and an equal volume of the supernatant were blended for

1-2 min to release the microorganisms from the floc. The blended activated sludge was

streaked on the m-toluic acid isolation media combined with 1 pg/ml trimethoprim











and/or 10 .g/ml sulfadiazine. The isolated bacterial colonies were purified by re-

streaking the same medium 2-3 times.

Tests for nitrate reduction, oxidase, catalase, Gram stain, urea hydrolysis, glucose

utilization, indole production (Cappuccino and Sherman, 1992), and meta cleavage of

benzene derivatives (Unz and Farrah, 1972) were conducted to identify the isolated

strains.



Isolation ofZ. ramigera Extracellular Polymer

Z ramigera 106 was inoculated in YP medium and incubated at 28C until log-

phase. The cultures were centrifuged and washed twice with deionized water, then

suspended in equal volume of 0.4 M KHPO4 (final concentration is 0.2 M) and blended

(Tekmar, Cincinati, Ohio) for 1 min. The mixture was centrifuged for 10 min at 27,000 x

g and the pellet was discarded. Cetyltrimethylammonium bromide (CTAB) was added to

the supematant to a final concentration 0.8% (wt/vol). The solution was centrifuged after

4h at room temperature. The precipitate was mixed with 10 volumes of 0.5 M NaCI and

the mixture was centrifuged. The supernatant fraction was dialyzed against deionized

water at 4C for 24 hours. The dialyzed sample was dried and washed with 80% ethanol

to remove the residual CTAB (Farrah and Unz, 1976).



Polvclonal Antibodies Production

For production of the antibody against cell walls, log-phase Z. ramigera 106

cultures were washed twice and suspended in deionized water. The suspension was










adjusted to pH 10 by using IN NaOH and boiled for 3 min, then cooled. The pH was

readjusted to 10 and the suspension was boiled for another 3 min. Finally, cells were

centrifuged at 10,000 rpm for 10 min and washed twice with deionized water.

Microscopic examination with India Ink revealed that cells were devoid of the

extracellular polymer. Formalin (2%) was used to fix the cells. A fraction of the cells was

hydrolyzed in IN NaOH and a protein assay was performed (Protein Assay Kit, Sigma

Chemicals, St. Louis, MO). Cell suspensions were adjusted to 200 mg/ml protein

concentrations in PBS buffer and were mixed with an equal volume of Freunds complete

adjuvant (Sigma Chemicals, St. Louis, MO). One ml of the suspension was then injected

subcutaneously into a rabbit. After 2 weeks, a 1 ml inoculum of the cells in Freunds

incomplete adjuvant was intravenously injected and this was repeated two weeks

thereafter. Ten days after the final injection, the rabbits were bled and the antiserum was

collected. For the production of antibody against Z. ramigera extracellular polymer, the

extracellular polymer was isolated from the cells as previously described (Farrah and

Unz, 1975). The same procedure was followed for antiserum production using the

rabbits. Unimmunized rabbit serum (Sigma Chemicals, St. Louis, MO) was used as

negative control in all immunological procedures.



Indirect Immunofluorescence Staining

Samples were spread on microscopic slides, air dried and fixed with 50%, 80%

and 96% ethanol sequentially for 3 minutes each time. The rabbit antiserum was diluted










with PBS buffer and added to the slides and incubated for 30 minutes at room

temperature in a hydrated chamber. The slides were washed with PBS buffer several

times. Then FITC-labeled goat anti-rabbit IgG (Sigma) diluted in PBS was added and

incubated for 30 minutes. The slides were then washed twice with PBS buffer. A drop of

10 mg/ml DABCO (1,4-diazabicyclo (2,2,2) octane) (Sigma Chemicals, St. Louis, MO)

was added to enhance fluorescence and a cover slip was placed on the slide. The slides

were examined by phase-contract and epifluorescence microscopy (Farrah and Unz,

1975).



Enzyme Immunostaining

All chemicals and reagents used were obtained from Sigma Chemicals (St. Louis,

MO). Samples were spread on microscopic slides, air dried and fixed with 50%, 80% and

96% ethanol sequentially for 3 minutes each time. The rabbit antiserum was added and

allowed to react for 30 minutes. The slides were washed with PBS buffer. Then biotin-

conjugated anti-rabbit IgG (l/500dilution with PBS buffer) was added and allowed to

react for 30 minutes. The slides were washed with PBS buffer and peroxidase-labeled

avidin was added (0.64 units ofperoxidase /ml) and reacted for 30 minutes. After the

slides were washed with PBS buffer, 0.5 ml of the substrate, aminoethyl carbozole

(AEC) solution (3 volumes of 4.0 mg/ml AEC dissolved in N, N-dimethylformamide plus

7 volumes of 0.05M acetate buffer [pH 5.0]) was added. Then, 1 il 30% H202 was added

to the slides to activate the substrate (Cleveland and Richman, 1987). After 10 min, the

slides were washed with PBS buffer and checked under a light microscope.










Immunoassav by Scanning Electron Microscopy (SEM)

The scum layers of biofilm were put into microcentrifuge tubes and were

washed 3 times by Tris-buffered saline (TBS) (pH 7.4) thoroughly and fixed by 4 %

paraformaldehyde (PFA) solution for 30 min on ice or 10 min at room temperature.

Samples were washed once by TBS (pH 7.4) and incubated with 1% gelatin in TBS for

10 minutes. Three 5 minutes incubations with 0.02 M glycine in TBS were used to

preblock. Then samples were washed by 5 minutes incubation with TBS (with 1% BSA).

Goat serum (1:10) was added to block for 10-20 minutes and was washed with TBS once.

A rabbit antiserum (1:500) was added and reacted for 1 hour at room temperature.

Samples were washed for 5 minutes three times with TBS (with 1% BSA, pH 7.4)

followed by two 5 minutes washes with TBS (with 1% BSA, pH 8.2). Gold labeled goat

anti-rabbit IgG (1:100) was added and incubated for 1 hour at room temperature.

Samples were washed three times for 5 minutes with TBS ( pH 7.4) followed by fixation

with Trump's solution (4% formaldehyde, 1% glutaraldehyde in phosphate-buffered

saline, pH 7.4) for 30 minutes. Samples were washed three times for 5 minutes with TBS

(pH 7.4) followed by four 5 minutes ultra pure water washes. Silver enhancement was

performed for 5 minutes and was followed by three 5 minutes water washes. Samples

were then mounted on nucleopore fiter (Fisher Scientific, Pittsburgh, PA). Dehydration

and fixation were performed using gradient alcohol dehydration: 25%, 50%, 75%, 95%

for 5 min each, 100% for 5 min twice followed by 5 minutes hexamethyldisilizane

(HMDS) washes twice. Samples were dried, carbon coated for 10 seconds, and observed

under a Hitachi S-400 Field Emission SEM.









34
Determination of Most Probable Number (MPN) of Z. ramigera in Wastewater
Treatment Plants and Lake Water

Autoclaved bottles were prepared prior to sample collection. Raw sewage,

mixed liquor suspension, unchlorinated effluent and chlorinated effluent were obtained

from the University of Florida Water Reclamation Facility (Gainesville, FL). Ten mg/l

sodium thiosulfate was added immediately to collected chlorinated effluent Mixed

liquor suspension, primary aerobic digested sludge and final aerobic digested sludge

were obtained from the Kanapaha Water Treatment Plant (Gainesville, FL). Lake water

was obtained from Lake Sheelar, Lake Geneva, Lake Johnson (Clay county, FL), Lake

Alto, Santa Fe Lake, Lake Alice, and Lake Bivans Arm (Alachua county, FL).

In the University of Florida Water Reclamation Facility, raw sewage is mixed

with returned sludge in the mixed liquor tank. After the activated sludge process, sludge

solids are settled and separated from the supernatant. The mixed liquor supernatant is

then treated by rapid sand filtration. The effluent from the rapid sand filter is

unchlorinated effluent. The unchlorinated effluent is then chlorinated in the chlorination

basin. Part of the chlorinated effluent goes to Lake Alice. In the Kanapaha Wastewater

Treatment Plant, after the activated sludge process (mixed liquor stage), the sludge goes

through primary and secondary aerobic digestion.

A three-tube MPN procedure (American Public Health Association, 1989) was

used to determine the concentration of Z ramigera and total bacteria in wastewater

samples. For determining the MPN for total bacteria, samples were serially diluted in YP

medium and incubated for up to 2 weeks at 280C. For determining the MPN for Z










ramigera, samples were serially diluted in a filter sterilized raw sewage. The samples

were then supplemented with 50pg/ml phenol daily and incubated at 280C up to 2 weeks.

The scum layer that developed was examined microscopically for the presence of typical

finger-like projection and/or cells that reacted with Z ramigera antisera as described

above.

Chlorophyll concentrations (pg/1) in lakes were determined by pigment extraction

with ethanol (Sartory and Grobbelaar, 1984), followed by spectrophotometrical

measurement (method 10200H(2c), American Public Health Association, 1989). Total

phosphorus concentration (gg/1) in lakes were determined by a persulfate digestion

(Menzel and Corwin, 1965), followed by the procedures of Murphy and Riley (1962).

Total nitrogen concentrations (ig/1) were determined using the procedure described by

Bachmann and Canfield Jr. (1996).



RT-PCR

RNase free water was obtained by treating the water with 0.1% DEPC diethyll

pyrocarbonate) (Sigma Chemicals, St. Louis, MO). Deionized water with 0.1% DEPC

was shaken vigorously to bring the DEPC into solution. The solution was then incubated

for 12 hours at 370C and autoclaved for 15 minutes to remove any trace of DEPC. All

solutions were made by using RNase free water. Isoporpanol, Mops (3-morpholino)

propanesulfonic acid), P-mercaptoethanol, 10 x Tris-EDTA buffer and lysozyme were

purchased from Sigma Chemicals (St. Louis, MO). RNase AWAY (Fisher Scientific,









36
sprinfield, NJ) was used to keep working areas and pipets RNase free. RNase free pipet

tips and PCR tubes were obtained by autoclaving overnight.

The sequence ofZ ramigera (ATCC 19544)16S rRNA was retrieved from Gene

Bank (ZR16SRRNA). The upstream and downstream primers were specific for Z.

ramigera 106 16S rRNA and purchased from Genosys (The Woodlands, Texas).

Sequence for the upstream primer is CCG ATG TCG GAT TAG CTA GTT GG (position

219 to 242). Sequence for the downstream primer is AAT GAG TCT CCT CAC CGA

ACA ACT AG (position 813 to 836). The lyophilized primers were suspended in DNase

and RNase free water and incubated at 37oC for complete dissolution.

Bacterial 16S rRNA were isolated by using QIAGEN RNA/DNA mini kit

(Valencia, CA). Briefly, 5x 10' bacterial cells were centrifuged and resuspended in 50 pl

of lysozme-containing TE buffer for 5 min. Then the lysing buffer was added to the

solution as described in the kit. The 16S rRNA was isolated exactly by using the 'low

molecular weight RNA isolation' procedure in the kit. QIAGEN tip is anion-exchange

column which can be used to selectively isolate DNA, RNA and low molecular weight

rRNA. RT-PCR kit was purchased from Promega (Pittesburgh, PA). RT-PCR was

performed in a total volume of 50 il reaction mixture containing 0.2 mM

deoxynucleoside triphosphate, 0.5 mM MgSO, 5 U of AMV reverse transcriptase, 5 U of

Tfl DNA polymerase, 0.5 pM of the primers which are specific for Z ramigera 106 16S

rRNA, 1 jg of template and IX reaction buffer. The cycling profile involved 48C

reverse transcription for 45 minutes, 940C AMV reverse trasriptase inactivation and










RNA/cDNA/primer denaturation, 40 cycles of denaturation at 94C for 30 seconds,

annealing at 600C for 1 minute and extension at 680C for 2 minutes, followed by 1 cycle

of final extension at 680C for 7 minutes.

Aliquotes (6Al) of the PCR products were electrophoresed through 2% agrose gel

(Sigma Chemicals, St. Louis, MO). Gel star (FMC Bioproducts, Rockland, ME) was used

to locate the DNA bands.



Glycosvl Composition Analysis by GC/MS

Z ramigera extracellular polymer was isolated as described on page 30. After

80% ethanol treatment, deionized water was used to wash ethanol from the extracellular

polymer. The extracellular polymer then dispersed into deionized water and

homogenized by blending for 1 min. GC-MS analysis of TMS methyl glycosides was

used to determine the glycosyl composition of Z. ramigera extracellular polymer. The

TMS methyl glycosides were prepared by methanolysis in methanolic 1M HCI at 70C

for 16 hours, re-N-acetylated and trimethysilylated (Chaplin, 1986). A Shimadzu QP5000

GC-MS work station was used for GC-MS analysis by staffs at the University of Florida

Glycobiology Core Lab. During the experiment, external standards which consisted of

known molar concentration ofinositol and each monosaccharide in the hydrolysate were

used. Calculations of each monosaccharide were based on response factors which was

the ratio of peak area for each monosaccharide to a molar of the monosaccharide relative

to that for inositol.











Zeta Potential Measurement

Z ramigera 106 (ATCC 19544), Z. ramigera'1-16 M (ATCC 19623), Duganella

zoogloeoides (ATCC 25935) were inoculated in YP medium and incubated at 280C until

log phase. The cultures were centrifuged, rinsed twice with deionized water. The bacteria

were resuspended in distilled water (pH 7.0) to a final concentration of 1.0 x 107 CFU/ml.

Distilled water was chosen to minimize any change shielding within the invalidation of

the assumed equality between the measured zeta potential and the surface potential. The

zeta potential measurements were carried out with the use of a Brookhaven Instruments

Zetaplus Model V3.21 zeta potential analizer (Holtsviller, NY) (Turesdail et al., 1998).



The Effect of Chlorine on Bacteria in Biofilm

Phenol was added to 100 ml raw sewage in 250-ml beakers daily to provide an

initial concentration of 50 gg/ml and incubated at room temperature for 4-5 days. When

there were many finger-like projection in the biofilm, different concentrations of chlorine

(Clorox Bleach) were added to the beakers for 15 min. Then a HACH test kit (Loveland,

Colorado) was used to evaluate free chlorine and total chlorine. The reaction was

stopped by adding sodium thiosulfate to a final concentration of 0.2%. INT (0.2 %)

(Sigma Chemicals, St. Louis, MO) was added to the beaker to a final concentration of

0.02% and incubated at room temperature in the dark for 30 minutes. Formaldehyde

(37%) was added to a final concentration of 0.37% to stop the reaction. The scum layers

ofbiofilms were mounted on clean slides. The slides were air dried and gently fixed by










heat. Next, 0.05 % malachite green was added to the slide and reacted for 1 min.

Deionized water was used to wash the slides. The slides were then observed under bright

field microscope (Bitton and Koopman, 1982; Dutton et al., 1983).



The Effect of Chlorine on Z ramigera With or Without Extracellular Polymer

Z ramigera 106 was inoculated in YP medium or low Mg", Ca- salt minimal

medium (5.0 g glycerol, 0.3 g (NH4)2SO4, 0.8 g sodium lactate, 1.0 g KN03, 0.05 g

K2HPO4, 0.1 g CaCl2, 0.1 g MgSO4 ) and incubated at 28C until log phase. The cultures

were centrifuged at 2,000 rpm for 5 min. The pellet which contained mostly flocs was

discarded. The supernatant was further centrifuged at 10,000 rpm for 10 min. The pellet

which contained both free cells and cells in floes was resuspended in deionized water.

Different concentrations of chlorine were added into the suspension for 15 min. The

determination of chlorine concentration and the MINT test were performed as described

above.



BacterioDhage Assay

PRD1 is an icosahedral lipid phage characterized by a diameter of 62nm. The

isoelectric point of PRD1 is between 3 to 4 in a calcium-phosphate buffer (104 M Ca)

(Pieper et al., 1997). It grows on its host Salmonella typhimurium (ATCC 19585). MS2 is

an icosahedral phages with an average diameter of 25nm and has isoelectric point of 3.9

(Lin et al., 1997). It grows on its host Escherichia coli C3000 (ATCC 15597). Both

viruses were assayed as plaque- forming unit method (Snustad and Dean, 1971).










Preparation of Aluminum Hydroxide Coated Sand

A U. S. Standard No. 25 sieve was used to collect sand particles of 600-700 Mn

in diameter from 25 x 30 meshes Ottawa sands (Fisher Scientific, Springfield, NJ). The

graded sand was rinsed with deionized water until the supernatant was clear. The sand

was then air dried. The sand was placed in 1.OM ofAICl3.6H20 (Fisher Scientific,

Springfield, NJ) solution for 30 minutes. The excess solution was drained off. Then the

sand was air-dried for 24 hours. The dried sand was then socked in 3.0M ammonium

hydroxide for 10 minutes to precipitate aluminum hydroxides on the sand. The sand was

air dried and then rinsed with deionized water vigorously to remove loose precipitate,

then air dried again.



Wastewater Exposure of the Coated Sands

Uncoated sand and a portion of coated sand without exposure to wastewater were

used as negative and positive controls, respectively. The coated sand was packed into

acrylic columns (3.2 cm I. D. x 1.5 m). Wastewater effluent from University of Florida

Water Reclamation Facility was used in this study. The typical compositions of

wastewater effluent were: 1.0 mg/l total Kjeldahl nitrogen, 1.2 mg/1 orthophosphate, 1.8

mg/1 total phosphate, 0.7 NTU turbidity, 795 pmhos/cm conductivity, 8mg/l Mg2, 73

mg/l Ca", 1.2 mg/1 NO3-N, 0.2 mg/l NH3-N, 44 mg/1 CaCO3 (alkalinity), pH 7.2. The

experiments were carried out at room temperature. Dechlorination of wastewater effluent

was done with sodium thiosulfate. Chlorinated wastewater effluent was obtained by

treating water with 10 mg/1 ammonia nitrogen followed by titration with sodium










hypochlorite (Clorox Professional Products, Oakland, CA) so that final combined

chlorine was 2 mg/1 chlorine. The upflow rate was 57 ml/min and thus the superficial

velocity was 1.2mm/s. The columns were back washed every 72 hours at a superficial

velocity of 17mm/s for 15 minutes to fluidize the sand. Before each sampling, the sand

was taken out from the columns and rinsed with filter-sterilized wastewater to remove

loosely attached biomass. Portions of the sand were used for a protein assay, zeta

potential measurements, and virus removal assay by batch and column experiments. The

rest of the sand was returned to the columns and the wastewater passing was continued.



Surface Characterization of the Sands

Protein assays were conducted by the modified Lowry method ( Bensadoun and

Weinstein, 1976; Peterson, 1977) and the procedure which was described in the Sigma

Protein Assay Kit (Sigma Chemical). Briefly, 20 g of the sand samples were immersed in

8.0 ml of 10.0 N NaOH to extract the protein. The supernatant was assayed according to

the instruction in the protein assay kit. The zeta potentials of the sands were measured

with a streaming potential apparatus as described previously (Chen et al., 1998; Truesdail

et al., 1998).



Batch and Column Removal of Bacteriophaaes

Bacteriophage removals by batch tests were determined as follows: MS2 and

PRD1 were diluted in a filter-sterilized (0.2jm) milli-molar ionic strength artificial









42
groundwater (AGW) (I L deionized water, 35 mg MgSO4.7H20, 12 mg CaSO4.2H20, 12

mg NaHCO3, 6 mg NaCI and 2 mg KNO,) (McCaulou et al., 1994) to produce a final

concentration of 10' PFU/ml for each bacteriophage. Uncoated sand, aluminum

hydroxide coated sand without wastewater exposure, aluminum hydroxide coated sand

exposed to dechlorinated wastewater, and aluminum hydroxide coated sand exposed to

chlorinated wastewater were used for testing. Briefly, four grams of sand were added to

10 ml of bacteriophage suspension in polypropylene tubes (Fisher Scientific, Springfield,

NJ) and the mixtures were shaken for 30 min using a 70 cm diameter wheel which was

rotated vertically at 30 rev/min at room temperature. The bacteriophage suspension

without sand was also shaken in the wheel along with other samples as a control. All

sands were tested in triplicate.

Parallel column tests on days 0, 90 and 110 were carried out as follows: Four

acrylic sand columns (1.5 cm I.D. x 1.0 m) were used in upflow mode. The four sand

columns were uncoated sands, aluminum hydroxide coated sands without exposure to

wastewater effluent, aluminum hydroxide coated sands exposed to chlorinated

wastewater, and aluminum hydroxide coated sand exposed to dechlorinated effluent. A

suspension containing 10' PFU/ml of each bacteriophage in AGW was passed through

the column at a rate of 20 ml/min. Effluents representing steady state conditions (71-75

pore volumes) were collected (Chen et al., 1998). Bacteriophage concentrations in

inffluent and effluent were analyzed by the plaque assay procedure.









43
All plaque assays for both batch and column experiments were conducted in

triplicates. Virus removal capacities of the sands were indicated in terms of percent

removal of MS2 or PRD1. Student's t test, with ap value of 0.05 was used to define

statistical significance.














RESULTS


Morphology ofZ. ramigera

Z ramigera is a floc-forming bacteria and produces an extracellular polymer.

Previously, negative staining by India Ink indicated that cells are inside the extracellular

polymer in both finger-like projections and amorphous flocs (Farrah, 1974). In this study,

scanning electron microscopy was used to reveal the detail structure of Z ramigera

finger-like projections and amorphous flocs. A section of a branching zoogloeal

projection is shown in Fig. 2B. The cells are organized in the finger. A higher

magnification view of a zoogloeal projection reveals the presence of fibrils running along

and between the cells (Fig. 2A). This fibril is likely the extracellular polymer produced

by Z ramigera. The presence of cells within the zoogloeal extracellular polymer is

clearly shown in Fig. 2D. In the case of amorphous flocs, cells usually embed inside an

excessive extracellular polymer (Fig. 2C).

Previous studies have shown that Z. ramigera can utilize several aromatic

compounds and these can be used to enrich samples for finger-like zoogloeae (Unz and

Farrah, 1972; Williams and Unz, 1983). Examination of sand particles from a column

that had received raw sewage supplemented with 50 lig/ml of phenol revealed natural

finger-like projection structures that resembled those observed in laboratory cultures of

Z ramigera 106 (Fig. 3). The structures are smaller in diameter than those observed in










laboratory cultures (Fig. 2B) but show cells in similar arrangements and with similar

fibrils. There were little finger-like projections observed in biofilm developed on the

surface of sands which had been passed through wastewater without a phenol supplement

(Chen et al, 1998). Therefore, the supplement with phenol is effective for production of

Z ramigera enriched biofilm.



Isolation of Z ramigera from Natural Environments

Z ramigera is sensitive to penicillin, tetracycline, streptomycin and

cephalosporin. Trimethoprim-sulfamethoxazole (TMP-SMZ) are used for prevention of

opportunistic infection in human immunodeficiency-virus-infected person (Kaplan et al.,

1996) and for prevention of relapses in patient with Wegener's granulomatosis in

remission after respiratory tract infection (Stegeman et al., 1996). The minimal inhibition

concentrations (MIC) of trimethoprim and sulfadiazine for Z. ramigera are higher than

lu g/ml and greater then 10 tg/ml, respectively (Table 1). Since a m-toluic acid isolation

medium was used for isolation ofZ. ramigera from natural environments (Unz and

Farrah, 1972), m-toluic acid isolation medium and m-toluic acid isolation medium

combined with trimethoprim and sulfadiazine was used to isolate Z. ramigera from

activated sludge, biofilm developed over raw sewage, and biofilm developed from Lake

Alice water, respectively. Clones resembled Z ramigera were picked up and further

purified and identified. Isolates which were Gram negative, urease positive, catalase

positive, oxidase positive, nitrate reduction, meta cleavage of catechol, indole negative










and no production of gas or acid from glucose were further identified by indirect

immunoassay methods. The isolation efficiency obtained was increased from 64% to

over 90% by using the combination media (Table 2). The combination media were

especially effective when Z ramigera was not abundant in natural environments, such as

in Lake Alice water. No synergistic effect was observed between trimethoprim and

sulfadiazine.


Immunological Methods for Detection of Z ramigera from Natural
Environments

Initial tests using a FITC-labeled secondary antibody showed that the antibody

against Z. ramigera 106 cells or the matrix only reacted with Z. ramigera 106 but not

with other laboratory cultures of the bacteria listed in the Materials and Methods section,

including 'Z. ramigera' I-16-M or Duganella zoogleoides. Also, during the course of this

investigation, Z. ramigera 106 antisera were observed to react with the cells and the

extracellular polymer associated with natural finger-like projections but not with other

bacteria from natural samples.

A portion of a scum layer that developed over raw sewage enriched with 50

lg/ml of phenol and treated with the primary antibody against the extracellular polymer

from Z. ramigera 106 followed by FITC-labeled secondary antibody is shown in Fig. 4. A

finger-like zoogloeal projection observed using light microscopy and phase contrast

optics is shown in Fig. 4A. The same field observed with UV illumination is shown in

Fig. 4B. Only finger-like projections characteristic ofZ. ramigera were observed to

fluoresce under UV light.

















'V 0 *TS ?D W' W .- -_
4-4-
;;- .wmo .w -- ,











Fig. 2. SEM of Z ramigera 106 (ATCC 19544) which was grown in YP medium (2.5 g/1 yeast extract, 2.5g/
peptone) for 48 hours at 281C.
Fig2.SMo .raiea16(TC154whhwagrwin Pmeim(.g/yasexrc,25/
peptne)for 8 hurs t 20(2








48





.1
-b





1B. 8





















phenol for 2 weeks
Ir,:' 't .
-t<_ .-, ,.. *. .








-. -. -, ,


r','











Fig 3. SEM of sand exposed to raw sewage supplemented with
phenol for 2 weeks











Table 1. The effect of antibiotics on Z ramigera growth


trimethoprim 1


sulfadiazine


Note: Z ramigera 106 (ATCC 19544) was inoculated in YP medium (2.5 g/1 yeast
extract, 2.5 g/l peptone) supplemented with different concentrations of trimethoprim or
sulfadiazine and incubated at 28C.


--Ik. L; ---- i..--I--I\











Table 2. The effect of different media on the isolation of Z ramigera from natural
environments

Media No. of No. of colonies No. ofZ. Yield
samples purified from ramigera (%)
processed samples isolated
m-toluate 9 14 9 64

m-toluate + 1 tg/ml 9 12 12 100
trimethoprim

m-toluate + 10 pg/ml 9 11 10 91
sulfadiazine

m-toluate + 1 gg/ml 9 13 12 92
trimethoprim + 10 gg/ml
sulfadiazine

Total (m-toluate+ 27 36 34 94
antibiotics)

Note: Bacteria from activated sludge, biofilms developed over raw sewage and lake
waters supplemented with phenol were streaked on m-toluic acid isolation medium as
well as the isolation medium combined with 1 gg/ml trimethoprim and/or 10 gg/ml
sulfadiazine. Biochemical tests were conducted to identify the isolates.











When the scum layers were examined in a similar manner but using primary

antibody against Z ramigera cells followed by FITC-labeled secondary antibody, cells

within typical zoogloeal projections fluorescenced while other cells did not. The results

were similar to previously published results (Farrah and Unz, 1975).

Observation of the scum layers from samples of raw sewage enriched with

phenol and treated with the primary antibody against the cells or extracellular polymer

from Z ramigera are shown in Fig. 5. These samples were then treated with biotin-

labeled secondary antibody, avidin-peroxidase and substrate AEC and examined using

light microscopy. Cells within zoogloeal projections (Fig. 5A) or extracellular polymer

surrounding zoogloeal projections (Fig. 5B) were stained dark red by this procedure and

are shown as the darker cells and projections in Fig. 5.

SEM images of the scum layers treated with the primary antibody against the Z

ramigera extracellular polymer, and gold-labeled secondary antibody are shown in Fig. 6.

The label is surrounding the zoogloeal projection in the samples which were examined

by using secondary electrons (Fig. 6A, Fig. 6C), and back scattered electrons (Fig. 6B,

Fig. 6D) which are produced by the gold particles attached to the secondary antibody. In

Fig. 6A and Fig. 6B, it appears that more antibodies had reacted with the end of

zoogloeal projection than with the main body of the projection.

The results obtained using similar procedures but with the primary antibody

against Z ramigera 106 cells are shown in Fig. 7. The associations of gold particles with









52
Z ramigera cells but not with other bacterial cells are shown using images created with

secondary (Fig. 7A, Fig. 7C) and back scattered electrons (Fig. 7B, Fig. 7D). No reactions

were observed with any of the immunological procedures when unimmunized rabbit

serum was used.



RT-PCR

RT-PCR was also used to detect the presence of Z. ramigera in samples by using

the primers specific for Z ramigera 106 16S rRNA. The region between upstream

primer and downstream included the fragment complimentary to the 16S rRNA

oligonucleotide probe which was used for Z. ramigera detection previously (Rossello-

more et al., 1995). When 16S rRNA isolated from Z ramigera 106 (ATCC 19544) was

used as a template for RT-PCR reaction, there was 619 bases DNA fragment produced

(Fig. 8, lane A). There was no corresponding PCR product when 16S rRNA isolated

from Duganella zoogloeoides or 'Z. ramigera' I-16-M was used in the RT-PCR

reaction (Fig. 8, Lane B, Lane C). However, there was the RT-PCR product (619 bases)

when 16S rRNA isolated from one ofZ. ramigera isolates which was isolated from raw

sewage by m-toluic acid isolation medium combined with trimethoprim and

sulfadiazine (Fig 8, Lane D), or from biofilm developed over raw sewage supplemented

with phenol (Fig. 8, Lane E). Therefore, the RT-PCR procedure is sensitive for Z.

ramigera detection.















A *

































Fig. 4. Indirect immunofluorescence staining of biofilm that developed over raw
sewage supplemented with phenol. Samples were treated with rabit antiserum against Z
ramigera extracellular polymer with FITC-labeled goat anti-rabbit IgG.
A. phase contrast microscopy B. epifluorescein microscopy



















































Fig 5. Immunostaining of biofilm that developed over raw sewage supplemented
with phenol. Samples were treated with rabbit antiserum for Z ramigera cells (A) or
extracellular polymer (B) followed by treatment with biotin-labeled goat anti-rabbit IgG,
peroxidase labeled avidin and substrate AEC.






















B D












Fig 7. Secondary (A,C) and back scattered (B, D) electron images of SEM photographs of biofilm developed over
raw sewage supplemented with phenol Samples were treated with rabbit antiserum for Z ramigera cells followed by
treatment with gold-labeled goat anti-rabbit serum.








m11


Fig 6. Secondary (A,C) and back scattered (B, D) electron images of SEM photographs of biofilm developed (
sewage supplemented with phenol Samples were treated with rabbit antiserum for Z ramigera extracellular polymer
followed by treatment with gold-labeled goat anti-rabbit serum.










































Fig. 8. Electrophoresis of RT-PCR by using primers specific for Z ramigera 106
16S rRNA.
A. 16S rRNA from Z ramigera 106 (ATCC19544)
B. 16S rRNA from 'Z ramigera' I-16-M (ATCC19623)
C. 16S rRNA from Duganella zoogloeoides (ATCC25935)
D. 16S rRNA from Z ramigera isolated from raw sewage
E. 16S rRNA from biofilm developed in raw sewage supplemented with
50 Ig/ml phenol










Distribution of Z ramigera in Wastewater Treatment Plants and in Lakes

Enrichment procedures showed that the finger-like zoogloeal projections which

were characteristic of Z ramigera and reacted with Z. ramigera 106 antisera were

observed in scum layers that developed over samples from all stages of two sewage

treatment plants (Tables 3 and 4). The highest percentage ofZ. ramigera was found

associated with samples from the aeration tanks (mixed liquor suspended solids or the

supernatant fraction).

In the University of Florida Water Reclamation Facility, the MPN of Z. ramigera

increased from raw sewage to the mixed liquor suspension, then rapidly decreased from

mixed liquor suspension to unchlorinated effluent (Table 3). It was likely that Z

ramigera was settled with activated-sludge solids due to its floc-forming characteristic.

During chlorination, total bacteria rapidly decreased (from 1.10.6 x 10'/ml to 2.41.6 x

10'/ml), while there is little change for the number of Z ramigera between

unchlorinated and chlorinated effluent. Thus, the percentage ofZ. ramigera increased

after chlorination (Table 3). Therefore, Z. ramigera was more resistant to chlorine than

other bacteria in the water. Compared with the chlorinated effluent, the percentage ofZ.

ramigera in Lake Alice was decreased while the total bacteria increased (Table 3). This

suggested that there were some nutrients available for bacteria prolification in Lake

Alice.

In the Kanapaha Water Reclamation Facility, the percentage ofZ. ramigera

decreased from mixed liquor suspension to primary and final aerobic digested sludge in










both liquid phase and solid phase (Table 4). Overall, Z ramigera could be found in all

stages of wastewater treatment processes. The highest concentration of Z ramigera was

found in the mixed liquor stage in both wastewater treatment plants (Table 3, Table 4).

According to the content of chlorophyll, a lake is classified as oligotrophic,

mesotrophic and eutrophic lake. Distribution ofZ. ramigera in different types of lakes

was also investigated (Table 5). Z ramigera was found in all eutrophic (Lake Alice,

Lake Bivans Arm), and mesotrophic (Lake Alto, Lake Santa Fe) lakes tested. However,

Z ramigera was present in some of oligotrophic lakes (Lake Geneva, Lake Johnson),

but absent in Lake Sheelar which is also an oligotrophic lake. Low content of nutrients

such as total nitrogen and total phosphorous might be the reason for absence of Z

ramigera in Lake Sheelar.



Characterization of Z ramieera Extracellular Polymer

GC/MS analysis of an acid hydrolyzed Z ramigera extracellular polymer

identified the following components: 1.5% arabinose, 1.38% rhamnose, 0.43% xylose,

4.65% mannose, 0.36% galactose, 1.6% galacturonic acid, 2.7% glucose and 37.7%

galactosamine, and another unknown amino sugar (Table 6). This unknown amino sugar

is not glucosamine or mannosamine. Due to lack of other standard amino sugars, we

could not identify this amino sugar. Total identified sugar in the extracellular polymer

was 50%.









60
Previous work also found two types of aminosugars (glucosamine and possible

fucosamine) in Z ramigera extracellular polymer. The ratio between glucosamine and

fucosamine was 1:1.5 to 1:2 (Farrah, 1974; Tezuka, 1973). According to this ratio,

fucosamine might be almost 50% since 37.7% galactosamine was found in this study. In

addition, it was reported that no protein or ether-soluble materials were detected after

acid hydrolysis of extracellular polymer (Farrah and Unz, 1976). Therefore, almost

100% of the Z. ramigera extracellular polymer is carbohydrate.

It was claimed previously that there was glucosamine in Z. ramigera

extracellular polymer by paper chromatography. Roo values for galactosamine and

glucosamine are similar since galactosamine is a C4 epimer of glucosamine. Therefore,

it was hard to differentiate these two sugars by paper chromatography. However,

GC/MS analysis indicated the presence ofglactosamine instead of glucosamine in the

extracellular polymer.

The presence of the extracellular polymer also influences overall surface charge

of the cells. Zeta potential has been used to evaluate overall surface charge of the cells

(Truesdail, et al., 1998). Most bacteria are negatively charged due to the predominance

of the anionic groups present on the cell surfaces carboxyll, phosphate groups). At pH7,

overall surface charges ofZ. ramigera 106 as well as 'Z. ramigera' I-16-M, Duganella

zoogloeoides, E. coli, S. typhimuriium, S. aureus, S.faecalis were negative (between-17

my to -40 my) (Table 7). Therefore, it was suggested that amino groups of aminosugars

in Z. ramigera extracellular polymer might be acetylated.











Table 3. The distribution ofZ. ramigera and total aerobic bacteria in the University of
Florida Water Reclamation Facility and in Lake Alice

Sources Total Aerobic Zoogloea ramigera Percent Zoogloea
Bacteria (MPNM (MPN) ramiera
Raw sewage 5.42.3 x 10'/mL 1.10.3 x 10O/mL 0.20
Mixed liquor 7.12.0 x 105/mL 4.22.4 x 104/mL 5.9
supernatant
Mixed liquor solids 1.31.2 x 109/g 2.01.6 x 107/g 1.5

Unchlorinated 1.10.6 x 10/mL 8.45.9 x 10"3/mL 7.6 x 10-
effluent
Chlorinated 2.41.6 x 10'/mL 8.05.7 x 10-/mL 3.3 x 10-2
effluent
Lake Alice 6.0 1.8 x 103/mL 3.60.0 x 10-'/mL 6.0 x 10

Note: Dilutions of the samples supplemented with 50 4g/ml of phenol were incubated
at room temperature for up to 2 weeks. The scum layer that developed was examined
for the presence of bacteria within typical finger-like zoogloeae. The samples were also
examined using the immunological procedures described in the text to confirm the
presence ofZ. ramigera.











Table 4. The distribution of Z. ramigera and total aerobic bacteria in the Kanapaha
Water Reclamation Facility

Sources Total Aerobic Zoogloea ramigera Percent
Bacteria (MPN) Zoogloea
,MPN r'amifera
Mixed liquor 9.76.9 x 10'/mL 5.0-3.3 x 10'/mL 0.52
supernatant
First stage aerobic 3.01.2 x 107/mL 2.51.4 x 10'/mL 0.08
digested sludge
supernatant

Second stage 3.01.2 x 107/mL 1.20.9 x 104/mL 0.04
aerobic digested
sludge
supernatant

Mixed liquor 1.20.5 x 10'/g 2.00.4 x 10S/g 0.17
solids

First stage aerobic 2.21.0x 10'/g 1.8+0.4 x 10/g 0.08
digested sludge
solids
Second stage 2.31.4 x 10'/g 1.40.2 x 105/g 0.06
aerobic digested
sludge solids

Note: Dilutions of the samples supplemented with 50 mg/L of phenol were incubated
at room temperature for up to 2 weeks. The scum layer that developed was examined
for the presence of bacteria within typical finger-like zoogloeae. The samples were also
examined using the immunological procedures described in the text to confirm the
presence of Z ramigera.










Table 5. The distribution ofZ. ramigera and total aerobic bacterial in different lakes


Classification Lake CHL' TPb TNc Total Aerobic Z. ramigera Percent Z.
(ua/) (ue/ (ug/ln Bacteria (MPN/ml) (MPN/ml ramiOera

Oligotrophic Sheelar 1.5 2.5 80.0 1.2 x 10' <0.0013 <1.1 x 104
Geneva 1.2 7.7 206.7 5.5 x 102 0.09 0.017
Johnson 3.0 13.0 230.0 4.8 x 103 0.5 0.009
..........................................................................................................................
Mesotrophic Alto 9.3 11.7 430.0 2.2 x 10' 0.2 0.011
Santa Fe 14.3 14.3 500.0 1.9 x 104 3.6 0.019

Eutrophic Alice 15.8 327 633.3 6.0 x 10' 0.4 0.006

Bivans Arm 49.7 118.3 1240.0 2.5 x 104 2.4 0.010

Note: Dilutions of the samples supplemented with 50 tg/ml of phenol were incubated at room temperature for up to 2
weeks. The scum layer that developed was examined for the presence of bacteria within typical finger-like zoogloeae. The
samples were also examined using the immunological procedures described in the text to confirm the presence ofZ.
ramigera.
a. Total chlorophyll
b. Total phosphorus
c. Total nitrogen











Table 6. Composition ofZ. ramigera extracellular polymer by GC/MS analysis

Monnnancbhrides % (mg/tntal mg)

Arabinose 1.5

Rhamnose 1.38

Xylose 0.43
Mannose 4.65
Galactose 0.36

Galacturonic acid 1.6

Glucose 2.7
Galactosamine 37.73
Unknown sugar type P ?

Total known sugar 50.35

Note: Acid hydrolyzed extracellular polymer of Z. ramigera was re-N-acetylated and
trimethysilylated before GC/MS analysis.
a. Unknown Sugar type I is an amino sugar but not glucosamine or mannosamine











Table 7. Zeta potential of bacteria at pH 7

RBcteria Zeta ntential (mv)
Z ramigera 106 (ATCC 19544) -24.7 1.93
'Z. ramigera' I-16-M (ATCC 19623) -41.0 0.78
Duganella zoogloeoides (ATCC 25935) -30.1 1.86

E. coli -36.5 2.00
S. typhimuriumw -17.0 1.00

S. aureus" -36.0 + 1.00

S. faecalis' -38.5 1.50

Note: The zeta potential of stationary phase bacteria was determined using a Lazer
Zee zeta meter.
a. Data from Truesdail et al., 1998









The Effect of Chlorine on Bacteria in Biofilm as well as on Z ramigera

In the MINT test, INT acts as a hydrogen-acceptor. Respiring bacteria will

accumulate water-insoluble red INT-formazan crystals through the action of bacterial

electron transport system activity. Counter staining with malachite green results in

viable bacteria with red color and inactive bacteria with green color. Since the Z

ramigera finger-like projection structure is easily distinguished from other bacteria, the

bacteria within finger-like projection structures in biofilms were considered to be Z

ramigera. The measured values for total chlorine and free chlorine were similar since

sodium hypochlorite was used in this study. When a low chlorine concentration (1.0

mg/l) was used, about 80% of the bacteria within finger-like projections were still alive

but only 30% of the other bacteria in the biofilm were respiring. At a chlorine

concentration of 2.5 mg/1, 65% of the bacteria within finger-like projections were still

respiring while most of the other bacteria were inactive. Higher concentration of

chlorine (3.5 mg/1) killed all bacteria (Table 8, Fig 9). Therefore, bacteria within finger-

like projections can resist higher concentration of chlorine better than other biofilm

bacteria.

In order to investigate the influence of the extracellular polymer on Z ramigera

inactivation by chlorine, the survival of Z ramigera cells with and without the

extracellular polymer were compared during chlorine treatment (Table 9, Fig 10). About

65% of Z ramigera cells with the extracellular polymer were still alive after exposure

to 2.5 mg/l chlorine treatments while less than 5% of Z ramigera cells without the

extracellular polymer were still alive. Therefore, the Z ramigera extracellular polymer

seemed to protect the cells from chlorine inactivation.









Table 8. Effect of chlorine on the respiring activity of bacteria in biofilms

Chlorine concentration % survival ofZ. ramigera % survival of other
(mu/ finger-like projections bacteria

0 991 99 1
1.0 80 5 30 2
2.5 65 8 <5
3.5 <5 0

Note: The biofilm that developed over raw sewage supplemented with phenol was
treated with indicated concentrations of chlorine for 15 min. The residual chlorine was
neutralized with sodium thiosulfate and the MINT test was then performed to detect
respiring bacteria.









68
Table 9. Influence of extracellular polymer on Z. ramigera inactivation by chlorine

Chlorine concentration % survival of cells with % survival of cells without
(mg/r extracellular novymr extracelular nohmer

0 991 991

2.5 65 4 <5

3.0 <5 0

Note: Z ramigera cells with and without visible extracellular polymer were treated with the
indicated concentrations of chlorine for 15 min. The residual chlorine was neutralized with
sodium thiosulfate and the MINT test was then performed to detect respiring bacteria.




































Fig. 9. Effect of chlorine on respiratory activities of bacteria in biofilm
A. 0 mg/1 chlorine B. 1.0 mg/1 chlorine C. 2.5 mg/1 chlorine D. 3.5 mg/1 chlorine


















1* i U
', :"r :




; .* U .


t 41 .

IIf 'I rlB

f.a ^iaI


B :




'. .
s~il..s- '


i!~l'"U;

'I


ie. at
A*
1% 9



*V B IS *


U *




.. m





$ : ". :
,T '. I


Fig. 10. Influence of the extracellular polymer on Z ramigera inactivation by
chlorine.
A. 2.5 mg/l chlorine B. 3.0 mg/I chlorine








71
Effect of Wastewater on Virus Removal by Aluminum Hydroxide Coated Sands

Characterization of Aluminum Hydroxide Coated Sand Exposed to Either Chlorinated
or Dechlorinated Wastewater

Coating by in situ precipitation of metallic hydroxides on particles increased the

concentration of metals associated with sand particles, their zeta potential and their

capacity for removal of microorganisms from water. After coating the Ottawa sands

with aluminum hydroxides, the zeta potential of the sand increased from -99mv to

+20mv at pH 7 (Table 10). Coating increased the aluminum content of the sand from

approximately 0.05 mg/g to 0.4 mg/g (Chen et al., 1998). The coated sands removed

99% of the MS2 and 90% of the PRDI from water in batch tests (Fig.ll and Fig. 12).

The corresponding values for MS2 or PRDI removal by untreated sand are within 20%.

The zeta potential of aluminum hydroxide coated sands dropped after 1 day

exposure to either chlorinated or dechlorinated wastewater (Table 10). At the initial two

weeks exposure, the zeta potential of the coated sand exposed to chlorinated wastewater

decreased in similar degree as that of the sand exposed to dechlorinated wastewater

(from +20mv to 60-80mv). However, after 2 months treatment, the zeta potential of the

coated sand exposed to chlorinated wastewater remained around -75mv while the zeta

potential of the coated exposed to dechlorinated wastewater was about -40mv (Table

10).

The amount of aluminum on the surface of the sand dropped from 0.4 mg/g to 0.3

mg/g after two weeks of wastewater exposure, then remained approximately constant

throughout the experiment (Chen et al., 1998). It was still about 6 fold higher than that









of the uncoated sand (0.005 mg/g). This drop might be due to attrition and/or leaching

effects. In addition, since the zeta potential of the sand with 0.4 mg/g aluminum coats

was +20mv, zeta potential of the sand with 03 mg/g aluminum coats was much less

likely about -70mv without other influences. Therefore, the decrease of zeta potential

after exposure of the coated sand to wastewater was not likely due to the loss of

aluminum content.

Protein assay (Table 11) and SEM (not shown) indicated that biofilm developed

on the surface of coated sand which was exposed to dechlorinated wastewater.

However, there was no significant biofilm development when chlorinated wastewater

was used. Therefore, the effect of biofilm on virus removal by aluminum hydroxide

coated sand could be determined by comparing the performance of the sand exposed to

dechlorinated wastewater effluent with that exposed to chlorinated wastewater effluent.

Since wastewater effluent used in this study was obtained only after activated

sludge and rapid sand filtration processes, there were many organic or inorganic

materials in the water. These materials are mostly negatively charged at pH 7 (Sobsey et

al., 1984). Evidently, these materials interacted with the aluminum hydroxide coated

sand during exposure to chlorinated or dechlorinated wastewater and caused the overall

surface charge of the sands decrease (Table 10). It was suggested that organic and

inorganic materials in the water 'blocked' the positively charged sites on the sand so

that the zeta potential of the sands were drastically decreased (-70 my) at the earlier

stages of the treatment. The amount of biofilm bacteria on the surface of the sand

exposed to dechlorinated wastewater was sufficient to maintain the zeta potential of the









sand around -40 my after 2 months treatment (Table 10 and 11) because the zeta

potential of most bacteria are about -20 my to -40 my at pH 7 (Truesdail et al., 1998).

In summary, the surface properties of aluminum hydroxide coated sand

considerably changed after exposure to dechlorinated or chlorinated wastewater

effluent.


Batch Removal of MS2 and PRD1

The aluminum coated sand without wastewater exposure removed about 99.99%

MS2 and 90% PRD1. After 1 day exposure to either chlorinated or dechlorinated

wastewater, the coated sand were still able to remove about 99.9% MS2 and 65% PRD1

(Fig. 1, Fig. 12). The ability of the coated sand for removal of MS2 and PRDI declined

by approximately two thirds after two weeks exposure. After 3 months of treatment,

MS2 and PRDI removal by the sand were not statistically different from that by

uncoated sand (p>0.05). The performance of the coated sand exposed to dechlorinated

wastewater and the sand exposed to chlorinated wastewater were similar for both MS2

and PRDI removal.

The isoelectric points for MS2 and PRDI are both between 3 to 4. They were

negatively charged in artificial ground water. However, PRDI is more hydrophobic than

MS2 due to the presence of lipid in its protein coat (Kinoshita et al., 1993). The

magnitude difference between MS2 (about 99.99%) and PRDI (about 90%) removed by

the coated sand might due to the fact that MS2 is less hydrophobic that PRDI.








74
Column removal of MS2 and PRDI

In column experiments, the coated sand without wastewater exposure removed

99.9% MS2 and 95.85% PRDI (Table 12). After long-term exposure of the coated sand

to either chlorinated or dechlorinated wastewater, the removal of MS2 and PRDI was

significantly decreased (Table 12). Chlorinated or dechlorinated wastewater exposure

resulted in decrease of MS2 and PRDI removal by the coated sand in similar degree.

MS2 and PRD1 removal by the coated sand exposed to wastewater for 3 months became

statistically similar to the removal by the uncoated sand (p>0.05). The column

experiments confirmed the detrimental effect of wastewater exposure for MS2 and

PRDI removal by the coated sand.








75
Table 10. Zeta potential (mv) of the aluminum hydroxide coated sand after exposure
to wastewater

tionDays 0 1 13 60 90 110
San&d ~~.. ..... ...

Al-coated sand exposed to +20 -69 -84 -75.5 -79 -75
chlorinated wastewater

Al-coated sand exposed to +20 -56.6 -76 -43 -40 -36
dechlorinated wastewater

Note: Sand was washed twice with deionized water. Then the zeta potential was
measured as previously described (Chen et al., 1998). The zeta potential of uncoated
sand is -99 my.








76
Table 11. Protein content (mg/g sand) of the aluminum hydroxide coated sand after
exposure to wastewater

tioDays 0 1 13 60 90 110
Sands ,

Al-coated sand exposed to 5.6 7.3 3.8 4.7 9.3 10.3
chlorinated wastewater

Al-coated sand exposed to 5.6 8.3 12.0 57.4 111.0 118.5
dechlorinated wastewater

Note: Sand was washed twice with deionized water and then mixed with ION NaOH to
extract protein. The sand was allowed to settle and the protein in the supernatant was
determined.










Table 12. MS2 and PRDI removal by sand columns


Percent Removal by
Virus Days
Uncoated Al-coated sand Al-coated sand
sand exposed to exposed to
dechlorinated chlorinated
wastewater wastewater
MS2 0 40.4 99.9 99.9

90 39.1 51.1 63.1

110 25.23 33.1 33.3
PRDI 0 8.5 95.85 95.85

90 10.52 40.89 23.28

110 11.86 23.28 12.15

Note: Sand was packed into columns (1.5 cm I.D. x 1.0m). AGW seeded with MS2 and
PRDI was passed through these columns in upflow mode. At steady state, the MS2 and
PRDI in the column ifluent and effluent samples were assayed.



































At-coated sand exposed
to dechlornated
wastewater


Al-coated sand exposed
to chlorinated wastewater


Al-coated sand


Sands




Fig. 11. MS2 removal by batch experiment


100


80


60


40


20


0


S1 day
a 13 days
a 60 days
M 90 days
l110 days
* controls


uncoated sand














90

80

70

60

50

40

30

20

10

0
Al-coated sand exposed to Al-coated sand exposed to Al-coated sand
dechlorinated wastewater chlorinated wastewater
Sands


Fig. 12. PRD1 removal by batch experiment


a 1 day
a 90 days
S110 days
8 controls















uncoated sand














DISCUSSION


Z ramigera was found in wastewater treatment plants and some lakes. It was

isolated from raw sewage, mixed liquor suspension and lake water by using m-toluic

acid isolation medium combined with trimethoprim or sulfadiazine, which were more

efficient than m-toluic acid isolation medium alone for isolation of Z. ramigera from

natural environments.

Detection ofZ. ramigera from natural environments is greatly simplified by

using antibodies specific for the neotype strain ofZ. ramigera 106 as the primary

antibody, and different conjugates of goat anti-rabbit IgG which are commercially

available as the secondary antibody. The cells and extracellular polymer of Z ramigera

were visualized in several ways using immunological procedures. These include using:

A. FITC-labeled secondary antibody and fluorescence microscopy; B. biotin-conjugated

secondary antibody and light microscopy; and C. gold-labeled antibody and SEM. The

advantage of immunofluorescence procedures is that they are fairly easy to use.

However, autofluorescence may be a problem with some samples. The enzymatic

procedures are also fairly simple and can be done with a light microscope. Using gold-

labeled antibody and SEM permits observation at higher magnifications than with light

or fluorescence microscopy. Observations using backscatter electrons show where the

antibody is localized, since only heavy metals, such as the gold of the secondary

antibody, can cause back scatters.










Previously, the FITC-labeled 16S rRNA oligonucleotide probe against Z

ramigera 106 could also be used to detect Z ramigera in natural samples, as was shown

in a previous study by Rossello-Mora et al.( 1995). However, a reduced content of

intracellular 16S rRNA in less active cells, and limited penetration of the probe may be

problem with this procedure. These potential problems could be overcome by using

immunological methods. Indirect immunoassay methods are also technically simpler

and more time saving than the detection method using the fluorescein-labeled 16S

rRNA oligonucleotide probe.

PCR/RT-PCR has been used as a sensitive method to detect bacteria or viruses

from environmental samples. By using the primers specific for Z ramigera 106 16S

rRNA, RT-PCR was used as another alternative method for detection ofZ. ramigera

from natural environments. There were negative reactions when 16S rRNA isolated

fromDuganella zoogloeoides, or from 'Z ramigera' I-16-M was used as template for

RT-PCR reaction. However, the same length of DNA fragments (619 bases) was

produced when 16S rRNA isolated from Z ramigera 106, Z ramigera isolated from raw

sewage, or from biofilm developed over raw sewage supplemented with phenol was

used as template for RT-PCR. Therefore, the current procedure is reliable for Z

ramigera detection.

Immunological methods detect both dead and viable microorganisms as long as

the presence of the antigen. Since rRNA is a dominant cellular macromolecule and

related to viability of the cells, RT-PCR by using rRNA as template can be used to










detect only viable microorganisms. Generally, reproducibility and reliability of RNA

extraction is important for reliable information obtained by RT-PCR, especially during

studies of microbial community in dirty environments (Muyzer and Ramsing, 1995).

Therefore, RT-PCR combined with the use of immunological methods is preferred for

detection and understanding of Z ramigera in natural environments.

Because it has been observed in association with biological flocs and biofilms in

wastewater treatment plants, Z ramigera has been considered to be an important

microorganism in the wastewater treatment processes. However, studies on the number

of bacteria capable of forming finger-like zoogloeae showed that these bacteria were a

minor portion of the population of the samples from waste water (Williams and Unz,

1983). Higher numbers ofZ. ramigera were found in activated sludge flocs by Rosello-

Mora et al. (1995). These workers found that 10% of the cells in flocs from an aeration

basin from one plant reacted with an oligonucleotide probe specific for Z. ramigera 16S

rRNA.

In the current study, enrichment cultures using phenol were used to determine

the MPN of Z ramigera in wastewater and environmental samples. The presence of Z

ramigera was determined by observing the presence of typical finger-like projections.

These were confirmed using immunological procedures. In some cases, fluorescence

techniques revealed the presence of bacteria in typical zoogloeal projections that were

obscured by other bacteria when the samples were observed using phase contrast

microscopy. Using these procedures, the numbers ofZ. ramigera in mixed liquor










suspended solids was closer to the value obtained using the FITC-labeled 16S rRNA

oligonucleotide probe (Rossello-mora et al., 1995) than to the values obtained using

microscopic examination of fingered zoogloeae (Williams and Unz, 1983).

The use of enrichment cultures and immunological procedures to enumerate Z

ramigera was meant to demonstrate their potential for studying the distribution of Z

ramigera in wastewater and environmental samples. Too few samples were taken for

the numbers to be considered definitive. However, the numbers do show some

interesting trends. It appears that Z. ramigera is more numerous in mixed liquor

suspended solids. They are relatively fewer in raw sewage and in solids undergoing

aerobic digestion. Besides wastewater treatment plants, Z ramigera was also found in

eutrophic, mesotrophic and some oligotrophic lakes. However, Z ramigera was not

found in one lake studied with very low total nitrogen content (Lake Sheelar, Table 5).

SEM observations of gold-coated Z. ramigera 106 indicated the presence of

fibrils within and on the surface of the zoogloeal projections. It is likely that these fibrils

provide the structure for the observed zoogloeal projections. Similar structures were

found on the sand from the column that had sewage with phenol passed through it.

Structures resembling zoogloeae were also observed in the biofilm from a denitrifying

filter by Sich and Rijn (1997). Since natural zoogloeal finger-like projections reacted

with antibodies against Z ramigera 106 cells or extracellular polymer, the natural

zoogloeae were also antigenically similar to laboratory culture.The antigenic similarity

between natural finger-like projection and the laboratory culture suggests that the











material surrounding natural finger-like projections are chemically similar to that

surrounding Z ramigera 106. This extracellular material was previously shown to be a

mucopolysaccharide associated with flocculation (Farrah and Unz, 1976; Tezuka, 1973;

Unz and Farrah, 1976b) and could be recovered from laboratory cultures ofZ. ramigera

and from mixed liquor suspended solids.

Unlike some extracellular polymer-producing bacteria whose clones on nutrient

agar plate are mucoid or butyrous, Z ramigera clones on the agar plate are gelatinous,

dry and hard. It was found that zoogloeal projections can even resist protozoan attack in

activated sludge flocs (Farrah, 1974). Previous knowledge and current information

obtained by GC/MS analysis of the extracellular polymer produced by Z ramigera

indicated that the predominance of carbohydrate, especially amino sugars. Generally, a

bacterial extracellular polymer not only provides a major source of biomass as an

alternation energy source, but also provides structural rigidity and a defensive barrier to

invading pathogens. It was observed that the finger-like projection structure of Z

ramigera can even resist protozoan attack in activated sludge floes (Farrah, 1974).

It was found that bacterial cells in biofilm are usually more resistant to

environmental stress and antibacterial agents than planktonic cells ( Marshall et al.,

1989; Ophir and Gutnick, 1994; Brown et al., 1995). In the case of chlorination of

biofilm bacteria, it was suggested transport of chlorine to biofilm bacteria surface might

be an important rate-limiting step (LeChevallier et al., 1988 a,b; Huang et al., 1995).

Free chlorine is known to react with a wide variety of compounds, including










polysaccharide. Therefore, besides providing a physical barrier reducing the ability of

chlorine to approach the cell membrane, free chlorine might be consumed by reaction

with extracellular polymer before it can fully penetrate the biofilm surface

(LeChevallier et al., 1988 a,b). In this study, it was found that Z ramigera extracellular

polymer had protected the cells from chlorine inactivation. Z. ramigera extracellular

polymer might either prevent the direct contact of chlorine with the cells or react with

chlorine.

Biofilm development on the filter media enhances removal of bacteria and fine

particles from water (Schuler et al., 1991; Banks and Bryers, 1992; Drury et al., 1993;

Rittmann and Wirtel, 1991; Sprouse and Rittmann, 1990). In this study, the loss in zeta

potential appeared to be more important than biofilm development on the surface of the

aluminum coated sand after long term exposure to dechlorinated wastewater. Therefore,

virus removal by the sand was greatly reduced after wastewater exposure. As with

biofilm development, organic and inorganic materials in wastewater also 'blocked'

favorable sites for virus removal. Thus, the coated sand exposed to chlorinated

wastewater also reduced virus removal.

The results of this study can be summarized as follows:

1. Isolation media for the recovery of Z. ramigera from natural environments can

be improved by adding the antibiotics trimethoprim and sulfadiazine.

2. SEM analysis of finger-like projections of laboratory cultures of Z ramigera

shows the presence of fibrils running along the length of the zoogloeal projections.









86
3. Immunological assays showed that both the cells and extracellular polymer of

natural finger-like projections are antigenically similar to those ofZ ramigera 106.

4. The major components of the extracellular polymer surrounding Z ramigera

are galactosamine and another unidentified amino sugar.

5. The extracellular polymer protects Z ramigera cells from inactivation by

chlorine.

6. Z ramigera can be found in all stages of wastewater treatment, but are present

in the highest percentage in mixed liquor samples. Z ramigera can also be found in

eutrophic, mesotrophic and some of oligotrophic lakes, but not in the lake with low

nitrogen content.

7. Exposure of modified sand to wastewater decreases its ability to adsorb

viruses in water.

8. Part of the biofilm that develops on sand exposed to wastewater containing

phenol have structures that resemble finger-like projections ofZ. ramigera.














APPENDIX
SEQUENCE OF Z. RAMIGERA (ATCC 19544) 16S RRNA

ORIGIN
I agagt t tga tnn tggct cagattgaacgctggcggcatgc t t tacacatgcaag tcgaac
61 gg taacagggagc ttgc tccgc tgacgag tggcgaacgggt gagtaatgcatcggaacgt
121 gccg tg taa tggggga taacg tagcgaaag ttacgctaataccgca tacgccctgagggg
181 gaaag tgggggaccgcaaggcc tcacg t tatacgagcggccga tgtcggat tagctaett
241 gg tggggtaaaggcc taccaaggcgacga tccg tagcgggt ctgagaggatgatccgcca
-->P1
301 cac tgggac tgagacacggcccagac tcctacgggaggcagcagt ggggaatt ttggaca
361 at gggggcaaccc tga tccagccatgccgcg tgagtgaacaaggcct tcgggt tgtaaag
421 ctct t tcagg tggaaagaaa tcgcatc tt ttaatacaggg tg tgga tgacgg tacca tea
481 gaagaagcaccggctaac tacg tgccagcagccgcggtaatacg taggg tgcgagcg tta
541 a tcggaa ttac tgggcgtaaagcg tgcgcaggcggt tatg taagacaga tgtgaaa tccc
601 cgggc tcaacctgggaactgcgt t tgtgac tgcataactagagtacggcagagggaggtg
661 gaa ttccgcg tg tagcag tgaaatgcgtagagatgcggaggaacaccgatggcgaaggca
721 gcctcc tgggccag tactgacgctca tgcacgaaagcg tggggagcaaacaggat tagat
781 accc tgg tag t ccacgccct aaacgatgtcaactagt tgt tcgg tgaggagac tcattga
P2 <--gatcaacaaQccac tec tc tgata
841 g taacgcagc taacgcgtgaagt tgaccgcctggggag tacggccgcaaggt taaaactc
901 aaaggaat tgacggggacccgcacaagcggt ggatgatg tggat taat tcgatgcaacgc
961 gaaaaacct tace taccct tgacatgccaggaact tgccagaga tggct tgg tgcccgaa
1021 agggaacc tggacacaggtgc tgca tggctg tcgtcagc tcgtg tcgtgagatgt tgggt
1081 taag t cccgcaacgagcgcaaccct tgtcat tagt tgccagcat taagt tgggcac tc ta
1141 a tgagac tgccgg tgacaaaccggaggaaggtggggatgacgtcaagtcctca tggccct
1201 tatgggtagggct tcacacg tea tacaa tgg tcggtacagagggt tgccaagccgcgagg
1261 tggagccaa tcccagaaagccga tcgtag tccggat tggagtc tgcaac tcgactcca tg
1321 aag tcggaa tcgc tagtaa tcgcaga tcagcatgc tgcgg tgaatacg ttcccgggtctt
1381 gtacacaccgcccg tcacaccatgggag tggggt t taccagaagt aggtagct taacct t
1441 cgggagggcgct taccacggtgagct tcatgac tgggg tgaag tcgtaacaaggtagccg
1501 tatcggaaggtgcggctggatcacctcctt
//

Note: the bold letters indicate the sequence complementary to 16S rRNA
oligonucleotide probe used previously. Underlined letters indicate the primers used in
RT-PCR reaction.














REFERENCES


Allison D. G., and I. W. Sutherland. 1987. The role of exopolysaccharides in adhesion of
freshwater bacteria. J. Gen. Microbiol. 133:1319-1327.

American Public Health Association. 1989. Standard Methods for the Examination of
Water and Wastewater. 17th edition. American Public Health Association, Inc.
New York.

Anguish, L. J., and W. C. Ghiorse. 1997. Computer-assisted Laser scanning and video
microscopy for analysis of Cryptosporidium parvum oocysts in soil, sediment, and
feces. Appl. Environ. Microbiol. 63:724-733.

Asghari A., and S. R. Farrah. 1993. Inactivation of bacteria by solids coated with
magnesium peroxide. J. Environ. Sci. Health. A28(4):779-793.

Bachmann, R. W., and D. E. Canfield Jr. 1996. Use of an alternative method for
monitoring total nitrogen concentrations in Florida Lakes. Hydrobiologia. 323:1-8.

Bales, R. C., and S. Li. 1993. MS2 and polio virus transport in porous media:
hydrophobic effects and chemical perturbations. Water Resources Res. 29:957-963.

Banks, M. K. and J. D. Bryers. 1992. Microbial deposition rates onto clean glass and pure
culture bacterial biofilm surfaces, Biofouling, 6:81-86.

Barthe, G. A., T. L. Ceccardi K. L. Manjunath, and K. S. Derrick. 1998. Citrus psorosis
virus: nucleotide sequencing of the coat protein gene and detection by hybridization
and RT-PCR. J. Gen. Virol. 79(pt6):1531-1537.

Beilke, M. A., S. Japa, and D. G. Vinson.1998. HTLV-I and HTLV-II virus expression
increase with HIV confection. J. Acquir. Immune. Defic. Syndr. Hum. Retrovirol.
17:391-397.

Bensadoun, A., and D. Weinstein. 1976. Assay of proteins in the presence of interfering
materials. Anal. Biochem. 70:241-250.

Bitton, G. 1994. Wastewater Microbiology. John Wiley and Sons, Inc.




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E7NQY2LFU_LSSUIX INGEST_TIME 2013-03-05T20:13:56Z PACKAGE AA00013520_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES