Citation
Characterization of Zoogloea ramigera in biofilms

Material Information

Title:
Characterization of Zoogloea ramigera in biofilms
Creator:
Lu, Fuhua, 1969-
Publication Date:
Language:
English
Physical Description:
xii, 102 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Activated sludge ( jstor )
Bacteria ( jstor )
Biofilms ( jstor )
Chlorine ( jstor )
Phenols ( jstor )
Polymers ( jstor )
Reverse transcriptase polymerase chain reaction ( jstor )
Wastewater ( jstor )
Wastewater treatment ( jstor )
Zoogloea ( jstor )
Biofilms ( lcsh )
Dissertations, Academic -- Microbiology and Cell Science -- UF ( lcsh )
Microbial mats ( lcsh )
Microbiology and Cell Science thesis, Ph.D ( lcsh )
Sewage -- Purification -- Florida -- Gainesville ( lcsh )
Zoogloea ramigera ( lcsh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1998.
Bibliography:
Includes bibliographical references (leaves 88-101).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Fuhua Lu.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
030026657 ( ALEPH )
41869711 ( OCLC )

Downloads

This item has the following downloads:


Full Text










CHARACTERIZATION OF ZOOGLOEA RAMIGERA IN BIOFILMS


By

Fuhua Lu
















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

1998




CHARACTERIZATION OF ZOOGIOEA RAMIGERA IN BIOFILMS
By
Fuhua Lu
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1998


ACKNOWLEDGMENTS
I would like to express my sincere appreciation to chairman of my supervisory
committee, Dr. S. R. Farrah, for his support, guidance and commitment through the
course of this research. My gratitude is also due to Dr. K. T. Shanmugam, Dr. B. L.
Koopman, Dr. E. H. Hoffman and Dr. A. C. Wilkie for their guidance and counsel while
serving on the advisory committee.
Thanks are extended to Dr. Chris West and Dr. Chasey Rentz for helping me
conduct GC/MS analysis, Mr. Scott Whittaker and Ms. Karen Vaughn of the University
of Florida ICBR Core Laboratory for their assistant in preparation and examination of
SEM samples, and Ms. Sandy Fisher of University of Florida Lake Watch for providing
information on lakes. Special thanks to all colleagues in Dr Farrahs lab, Jerzy Lukasik,
Haitao Zhou, Mike Bume Jr., Troy Scott and Cheryl Boice, for their friendship and
encouragement. I would like to extend my thanks to Engineering Research Center (ERC)
professors and colleagues, for their support and participation during the course of this
research.
I also would like to thank Scott M. Buntin for his encouragement. Finally, I wish
to express sincere gratitude to my father, my mother, my brother and my sister, for their
unconditional love, understanding and patience.


TABLE OF CONTENTS
page
ACKNOWLEDGMENTS ii
LISTS OF FIGURES v
LIST OF TABLES vii
LIST OF ABBREVIATIONS viii
ABSTRACT x
INTRODUCTION 1
Zoogloea ramigera 1
Wastewater Treatment 2
Z. ramigera Extracellular Polymer 4
Biofilms 4
Chlorine Disinfection 5
Filtration Process in Wastewater Treatment 6
Objectives 7
LITERATURE REVIEW 8
Zoogloea ramigera 8
Overview of Wastewater Treatment Process 11
The Function of Z. ramigera in Activated Sludge 16
The Function of Z. ramigera During Biofilm Formation 18
Biofilm Reactors 22
Reverse Transcription-Polymerase Chain Reaction(RT-PCR)
For Microorganism Detection 23
MATERIALS AND METHODS 26
Bacterial Strains 26
Z. ramigera Enriched Biofilm Development 26
Column Studies 27
iii


Scanning Electron Microscopy (SEM) 27
Effect of Antibiotics on Z ramigera Growth 28
Isolation of Z. ramigera from Natural Environments 28
Isolation of Z. ramigera Extracellular Polymer 30
Polyclonal Antibodies Production 30
Indirect Immunofluorescence Staining 31
Enzyme Immunostaining 32
Immunoassay by Scanning Electron Microscopy (SEM) 33
Determination of Most Probable Number (MPN) of Z ramigera
in Wastewater Treatment Plants and Lake Water 34
RT-PCR 35
Glycosyl Composition Analysis by GC/MS 37
Zeta Potential Measurement 38
The Effect of Chlorine on Bacteria in Biofilm 38
The Effect of Chlorine on Z ramigera With or Without
Extracellular Polymer 39
Bacteriophage Assay 39
Preparation of Aluminum Hydroxide Coated Sand 40
Wastewater Exposure of the Coated Sand 40
Surface Characterization of the sands 41
Batch and Column Removal of Bacteriophages 41
RESULTS 44
Morphology of Z ramigera 44
Isolation of Z. ramigera from Natural Environments 45
Immunological Methods for Detection of Z. ramigera
from Natural Environments 46
RT-PCR 52
Distribution of Z. ramigera in Wastewater Treatment
Plants and in Lakes 58
Characterization of Z. ramigera Extracellular Polymer 59
The Effect of Chlorine on Bacteria in Biofilm
as well as on Z ramigera 66
Effect of Wastewater on Virus Removal by
Aluminum Hydroxide Coated Sands 71
DISCUSSION 80
APPENDIX: SEQUENCE OF ZOOGLOEA RAMIGERA 16S RRNA 87
REFERENCES 88
BIOGRAPHICAL SKETCH 102
iv


LISTS OF FIGURES
Figure Page
1. Conventional wastewater treatment process 13
2. SEM of Z. ramigera 106 (ATCC 19544) which was grown in YP medium
(2.5g/l yeast extract, 2.5g/l peptone) for 48 hours at 28C 47
3. SEM of sand exposed to raw sewage supplemented
with phenol for 2 weeks 48
4. Indirect immunofluorescence staining of biofilm that
developed over raw sewage supplemented with phenol 53
5. Immunostaining of biofilm that developed over raw sewage
supplemented with phenol 54
6. Secondary (A, C) and back scattered (B, D) electron images of
SEM photographs of biofilm that developed over raw sewage
supplemented with phenol. Samples were treated with rabbit
antiserum for Z. ramigera extracellular polymer followed by
treatment with gold labeled goat anti-rabbit serum 55
7. Secondary (A, C) and back scattered (B, D) electron images of
SEM photographs of biofilm developed over raw sewage
supplemented with phenol. Samples were treated with rabbit
antiserum for Z. ramigera cells followed by treatment with
gold-labeled goat anti-rabbit serum 56
8. Electrophoresis of RT-PCR by using primers specific for
Z. ramigera 106 16S rRNA 57
9. Effect of chlorine on respiratory activities
of bacteria in biofilm 69
10. Influence of extracellular polymer on Z. ramigera
inactivation by chlorine 70
v


11. MS2 removal by batch experiment
12. PRD1 removal by batch experiment


LIST OF TABLES
Table Page
1. The effect of antibiotics on Z. ramigera growth 49
2. The effect of different media on the isolation of Z. ramigera
from natural environments 50
3. The distribution of Z. ramigera and total aerobic bacteria in the
University of Florida Water Reclamation Facility and in Lake Alice 61
4. The distribution of Z. ramigera and total aerobic bacteria in
the Kanapaha Water Reclamation Facility 62
5. The distribution of Z. ramigera and total aerobic bacteria
in different lakes 63
6. Composition of Z. ramigera extracellular polymer by GC/MS analysis 64
7. Zeta potential of bacteria at pH 7 65
8. Effect of chlorine on respiring activity of bacteria in biofilms 67
9. Influence of extracellular polymer on Z. ramigera inactivation
by chlorine 68
10. Zeta potential (mv) of the aluminum hydroxide
coated sand after exposure to wastewater 75
11. Protein content (mg/g sand) of the aluminum hydroxide
coated sand after exposure to wastewater 76
12. MS2 and PRD1 removal by sand columns 77
vii


LIST OF ABBREVIATIONS
AEC
Aminoethyl carbozole
AHL
Acetylated homoserine lactones
BOD
Biological oxygen demand
BSA
Bovine serum albumin
CTAB
Cetyltrimethylammonium bromide
DABCO
1,4-diazabicyclo (2,2,2) octane
DEPC
Diethyl pyrocarbonate
DNase
Deoxyribonuclease
EDTA
Ethylenediaminetetraacetic acid
FITC
Fluorescein isothiocyanate
GC/MS
Gas chromatography / mass spectrometry
HMDS
Hexamethyldisilizane
MIC
Minimal inhibitory concentration
MINT
Malachite green 2(p-iodophenyl)-3-(p-
nitrophenyl)-5-phenyl tetrazolium chloride
MPN
Most probable number
PFA
Paraformaldehyde
viii


PBS
Phosphate buffered saline
RNase
Ribonuclease
rRNA
Ribosomal RNA
RT-PCR
Reverse transcriptase-polymerase chain reaction
SEM
Scanning electron microscopy
TBS
Tris buffered saline
TMS
Tetramethylsilane
Tris
Tris-(hydroxymethyl)-aminomethane
UV
Ultraviolet
YP
Yeast extract peptone
IX


Abstract of Dissertation Presented to the Graduate School of the University of Florida in
Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
CFLARACTERIZATION OF ZOOGLOEA RAMIGERA FN BIOFILMS
By
Fuhua Lu
December, 1998
Chairman: Dr. Samuel R. Farrah
Major Department: Microbiology and Cell Science
Zoogloea ramigera is an extracellular polymer-producing bacterium and forms
floes which include typical finger-like projections and amorphous floes. Scanning
electron microscopy (SEM) indicated that cells used the extracellular polymer as
attachment sites and were embedded within the extracellular polymer. Finger-like
projections which were similar to those from laboratory cultures of Z. ramigera were
also found on the surface of sand which had raw sewage supplemented with phenol
passed through them. Z. ramigera was isolated from raw sewage, mixed liquor suspended
solids and lake water. The efficiency of Z. ramigera isolation was greatly increased by
using m-toluic acid isolation medium combined with 1 pg/ml trimethoprim, and/or 10
pg/ml sulfadiazine.
Indirect immunoassay methods for the detection of Z. ramigera were developed
using polyclonal antibodies against the cells or the isolated extracellular polymer of the
x


neotype Z ramigera strain 106 (ATCC 19544). The use of goat anti-rabbit IgG
conjugated with FITC or biotin or colloidal gold as the secondary antibody allowed
detection of Z ramigera in environmental samples. These methods were also used as
part of a most probable number (MPN) procedure to quantitate Z ramigera at different
stages of the wastewater treatment processes as well as in different lakes. It was found
that the cells and the extracellular polymer of naturally occurring zoogloeal projections
are antigenically and structurally related to those of Z. ramigera 106. Z. ramigera could
be found in all stages of wastewater treatment processes, eutrophic lakes, mesotrophic
lakes, and some oligotrophic lakes. The highest concentration of Z. ramigera was found
in the mixed liquor stage of the two wastewater treatment plants in Gainesville, Florida.
By using bacterial 16S rRNA as template, and the primers specific for Z.
ramigera 106 16S rRNA, RT-PCR was also used to identify Z. ramigera in biofilms from
natural environments.
Zeta potential measurement indicated that overall surface charge of Z. ramigera
was negative. Gas chromatography-mass spectrometry (GC/MS) analysis indicated the
predominance of carbohydrate, especially amino sugars in the extracellular polymer
produced by Z. ramigera. The use of MINT test following treatment of chlorine indicated
that the extracellular polymer protected Z. ramigera cells from chlorine inactivation.
This is true for Z. ramigera in both biofilms from natural environments and laboratory
cultures.
Biofilms and other organic and inorganic materials in wastewater blocked
positively charged sites on the surface of aluminum hydroxides coated sand. This loss of
xi


electropositive charge character was found to correspond to the decrease in removal
efficiency of the two bacteriophages, which further supports the importance of
electrostatic forces in virus-sand interaction.


INTRODUCTION
Zooploea ramieera
Finger-like zoogloeal projections were observed among decaying algae and the
bacteria within the projections were named Zoogloea ramigera by Itzigsohn (1868).
Since then, finger-like zoogloeal projections have been observed in trickling filter slime
layers, and in association with solids formed during aerobic treatment of wastewater
(Bitton, 1994; Butterfield, 1935; Farrah and Unz, 1975; Rossello-mora et al., 1995; Unz
and Dondero, 1967a; Unz and Farrah, 1976a). In some cases, bacteria associated with
these samples were isolated and studied in pure culture (Butterfield, 1935; Unz and
Dondero, 1967a,b). Since the term "finger-like" projection was subjected to different
interpretations, bacteria with different morphological and chemical characteristics were
considered to be Z. ramigera (Butterfield, 1935; Crabtree et al., 1965; Friedman et al.,
1968; Unz, 1971; Unz and Dondero, 1967b). Studies by comparing 16S rRNA sequence
and chemotaxonomic properties have shown that Z. ramigera 106 (ATCC 19544) is
related to the bacteria within natural zoogloeal projections but not to the other bacteria
that were previously termed Z. ramigera (Rossello-mora et al., 1993; Shin et al., 1993).
Recently, one of the previously misclassified Zoogloea species was reclassified as
Duganella zoogloeoides (Hiraishi et al., 1997).
1


2
It has been difficult to isolate Z. ramigera from natural environments. Different
isolation procedures have been tried such as dispersion dilution method (Butterfield,
1935) and micro manipulation method (Unz and Dondero, 1967a). Effect of different
media on isolation was also investigated (Dugan and Lundgren, 1960). Since Z. ramigera
grows slowly, often resulting in overgrowth by other microorganisms, conventional
bacterial isolation techniques were not very effective for rapid isolation until aromatic
compounds such as benzoate, m-toluic acid, phenol and cresol were incorporated into
basal media as a carbon source (Unz and Farrah, 1972).
Wastewater Treatment
Since the proper settling of solids produced during aerobic wastewater treatment
is important to produce clear effluents, many researchers have studied the
microorganisms that affect this process. This settling requires a proper balance of floc-
forming bacteria and filamentous bacteria (Bitton, 1994; Nozawa et al., 1987). If the
numbers or activities of the floc-forming bacteria are reduced, sludge bulking may occur,
and turbid rather than clear effluents will be produced. Because of its observed
association with sludge floes, Z. ramigera has been regarded as an important bacterium
in the activated sludge treatment process (Bitton, 1994). In one study, the ability to settle
bulking sludge was restored by seeding the sludge with Z. ramigera and other bacteria
(Nozawa et al., 1987).
Similarly, in trickling filters, the slime layer that develops on the support media is
considered to be very important for the colonization of bacteria (Bitton, 1994). This


3
slime layer is an extensive polysaccharide matrix that is generally referred to as the
glycocalyx. This glycocalyx anchors the bacteria and helps in the removal of complex
organic and inorganic materials from wastewater (Bitton, 1994). Z ramigera has been
isolated from finger-like projections obtained from trickling filter slimes and is thought
to be an essential player in the filtration process (Butterfield, 1935; Unz and Dondero,
1967a).
Although Z ramigera has been thought to be important in wastewater treatment,
there is little information on the distribution and concentration of this organism in
wastewater treatment processes. Several procedures for the detection of Z. ramigera in
natural samples have been established and used to study Z. ramigera in wastewater
samples, including using fluorescein-conjugated antibody against Z. ramigera cells and
fluorescein-labeled 16S rRNA oliogonucleotide probe (Rossello-mora et al., 1995; Farrah
and Unz, 1975).
Williams and Unz (1983) used enrichment procedures to support the development
of finger-like Zoogloea. These authors found that bacteria capable of producing finger-
like Zoogloea were less than 0.01% of the total microbial population in mixed liquor
solids. However, Rossello-Mora et al.(1995) found that up to 10% of the bacteria within
activated sludge floes reacted to the fluorescein-labeled oligonucleotide probe
complementary to the 16S rRNA ofZ. ramigera (ATCC 19544). Unz and Farrah(1976a)
showed that finger-like zoogloeae were not usually observed in mixed liquor suspended
solids but could develop from the floes under the proper incubation conditions.


4
Z. ramfera Extracellular Polymer
Extensive studies have characterized the Z. ramigera extracellular polymer. It
was indicated that no protein or ether-soluble material was detected and amino sugars are
the principal constituent after acid hydrolysis of extracellular polymer (Farrah and Unz,
1976). Separation of hydrolyzed extracellular polymer ofZ ramigera isolated from
activated sludge by paper and ion-exchange chromatography suggested that amino sugars
might be glucosamine and fucosamine and the ratio of the two amino sugars was
between 1:1.5 to 1:2 (Tezuka, 1973). Amino sugars have also been found in an
extracellular polymer produced by other bacteria. In Streptococcus pneumoniae, the
extracellular polymer contains a tetrasaccharide repeating unit, three different amino
sugars, N-acetyl-D-mannosamine, N-acetyl-L-fucosamine and N-acetyl-D-galactosamine,
are sequentially linked to a D-galactopyranosyl residue carrying a 2,3-linked pyruvate
ketal (Jansson et al., 1981).
Biofilms
Surfaces exposed to a variety of types of water are found to develop biofilms of
microorganisms. Biofilm bacteria live in a complex microbial community that has
primitive homeostasis, a primitive circulatory system and metabolic cooperativity so that
each of these sessile cells reacts to special environment fundamentally different from
planktonic counterparts (Costerton et al, 1995; Kolter and Losick, 1998). Biofilm
microorganisms are usually more resistant to environmental stress and antimicrobial
agents than planktonic counterparts.


5
Besides the difference between biofilm microorganisms and planktonic
microorganisms, the precise manner by which extracellular polymer protects the cells is
unclear, but the presence of bound extracellular enzymes, such as P-lactamase, within the
Pseudomonas aeruginosa glycocalyx may reinforce its action as a diffusion barrier
(Bolister et al., 1991) with respect to some antibiotics, and its molecular severing
properties are enhanced through binding of divalent cations, such as calcium, from the
environment (Hoyle et al., 1992). It has also been proposed that the glycocalyx provides
intrinsic protective effects against antimicrobial agents which are additional to those
associated with its diffusion and charge-related properties (Hodges and Gordon, 1991).
For example, Pseudomonas aeruginosa povidone-iodine resistance seems to be due to
the protective layering of cells within the glycocalyx which increase the time required for
iodine to contact cells in the deepest layers of the biofilm (Brown et al., 1995). The
properties of biofilms have been considered in developing methods to control microbial
biofilm growth (Wood et al., 1996).
Chlorine Disinfection
In wastewater treatment processes, chlorine is a commonly used disinfectant to
inactivate bacteria and viruses (Bitton, 1994). The mechanisms of chlorine inactivation
were extensively investigated ( Bitton and Koopman, 1982; Costerton et al., 1995; De
Beer et al., 1994; Dutton et al., 1983; Herson et al., 1987; Huang et al., 1995;
LeChevallier et al., 1988a,b; LeChevallier et al., 1984) so that strategies could be
developed to effectively control water quality and prevent waterborne disease outbreaks.


6
Besides, chlorine was also used to control sludge bulking which results from a
predominance of filamentous bacteria and absence of floe forming bacteria during
activated sludge process (Bitton and Koopman, 1982). It was noticed that bacteria
attached to surfaces (Brown et al., 1995; De Beer et al., 1994) or extracellular-
polysaccharide-coated bacteria (Bolister et al, 1991) were more resistant to antibacterial
agents (including chlorine) than were their planktonic counterparts. It was suggested that
the reason for reduced efficacy of chlorine against biofilm bacteria as compared with its
action against planktonic cells might be the limited penetration of chlorine into the
biofilm matrix (De Beer et al., 1994; Herson et al., 1987; Huang et al., 1995;
LeChevallier et al., 1988a,b; LeChevallier et al., 1984).
Filtration Process in Wastewater Treatment
Filtration processes are used in both water and wastewater treatment. In
wastewater treatment process, trickling filters are used in aerobic treatment of
wastewater. These filters consist of inanimate materials such as rocks. Wastewater is
passed over these filters to allow biofilm developed on the surface of the filter, thus to
reduce the level of organic contaminants in wastewater. This filtration process has been
used to remove pathogenic bacteria and virus from water and wastewater. It was
indicated that biofilm development on filter media enhanced physical entrapment of
bacteria and bacteria-sized fine particles from water (Banks and Bryers, 1992; Drury et
al., 1993; Rittmann and Wirtel, 1991; Sprouse and Rittmann, 1990; Schuler et al., 1991).


7
Sand filters are also used in water and wastewater treatment. It has been shown
that surface modification of filter media with various metal oxides, peroxides or
hydroxides also increased the microorganism removal efficiency by changing the surface
charge of the media from electronegative to electropositive, thus decreasing the
electrostatic repulsion between the particles and the adsorbing solid (Lukasik et al., 1996;
Truesdail et al., 1998).
Objectives
The objectives of this study were (1) to study the structure of natural and
laboratory finger-like projections; (2) to improve the Z ramigera isolation method; (3) to
develop Z ramigera detection methods by using immunological and molecular
procedures; (4) to use these procedures to estimate the number of Z. ramigera in
wastewater at different stages of treatment and in lake water; (5) to characterize the
extracellular polymer of Z. ramigera and its influence on chlorine inactivation; and (6) to
evaluate the effect of biofilm and other organic and inorganic materials in wastewater on
virus removal by aluminum hydroxide coated sand.


LITERATURE REVIEW
Zooeloea ramfera
Z. ramigera is an extracellular polymer producing bacterium that forms typical
finger-like projections and is found among decaying algae, in wastewater, and in other
organically enriched environments. The bacteria within the finger-like zoogloeal
projections were named Zoogloea ramigera by Itzigsohn (1868). Z. ramigera is a gram-
negative, aerobic, chemoorganotrophic bacterium. It also grows anaerobically in the
presence of nitrate (nitrate respiration) and denitrification occurs with formation of Nz.
Major carbon sources include lactate, glutamate, alcohol, benzonate, and m-toluate.
Benzene derivatives are used by meta cleavage (Holt et al., 1994). Neither acid nor gas is
produced from carbohydrates (Butterfield, 1935; Heukelekian and Littman, 1939; Unz
and Dondero, 1967b). It might be that the bacterium either does not attack the
carbohydrates to produce acid by-products from them, or produces alkaline materials
from the proteins which neutralize the acids produced or further metabolizes the acids as
rapidly as they are formed (Heukelekian and Littman, 1939). Optimum temperature and
pH for growth are near 28C and pH 7.0, respectively (Unz and Dondero, 1967b). The
extracellular polymer produced by Z. ramigera attaches to its cell walls and does not
make broth viscous during the synthesis phase. This property allows high oxygen transfer
rates to be maintained during the high oxygen demand period. Furthermore, very low
8


9
oxygen consumption was observed during the period of polysaccharide release when the
oxygen transfer rate can not be raised without very high energy input (Norberg and
Enfors, 1982). The extracellular polymer production is also influenced by the carbon and
nitrogen sources (Unz and Farrah, 1976b).
Z. ramigera was originally observed among decaying algae (Itzigsohon, 1868).
Later, the recognition of the possible importance of Z. ramigera in activated sludge and
trickling filter have led to extensive studies of Z ramigera (Crabtree et al., 1965). The
dispersion dilution method (Butterfield, 1935), micro manipulation (Unz and Dondero,
1967a) and the use of isolation media containing aromatic compounds (Unz and Farrah,
1972) were used to isolate Z ramigera from natural environments such as activated
sludge and trickling filter slime. The effects of different media on isolation were also
investigated (Dugan and Lundgren, 1960).
Biochemical tests of Z ramigera allowed convenient identification of Z
ramigera from natural environments (Unz, 1971). It was found that Z ramigera isolated
from activated sludge and trickling filter functions similarly (Wattie, 1942). Fluorescence
microscopy (Farrah and Unz, 1975) and scanning electron microscopy (SEM) (Sich and
Van Rijn, 1997) were used to observe the presence of Z ramigera in natural
environments. In order to understand the mechanism of Z. ramigera function in activated
sludge and trickling filter, structure and composition of extracellular polymer
surrounding Z. ramigera have also been investigated (Crabtree et al., 1966; Friedman et
al., 1968; Horan and Eccles, 1986; Norberg and Enfors, 1982; Parsons and Dugan, 1971;
Unz and Farrah, 1976b).


10
Based on the physiology and biochemical properties of Z. ramigera (Heulelekian
and Littman, 1939; McKinney and Harwood, 1952; Unz and Dondero, 1967b; Krul,
1977), efforts were made to establish its identification criterion and generic status
(Zvirbulis and Hatt, 1967; Crabtree and McCoy, 1967; Munich, 1979; Skerman et al.,
1980; Rossello-mora et al., 1993; Shin et al., 1993). It was first requested that ATCC
19623 (strain I-16-M) should be accepted as the neotype strain in 1967 (Crabtree and
McCoy, 1967). In 1971, ATCC 19544 (strain 106) was suggested as the neotype strain
because I-16-M did not form typical finger-like projection (Unz, 1971) and no
extracellular material was observable around I-16-M (Friedman et al., 1968). However,
based on the observation of floe formation during growth, three phylogenetically
distantly related strains, ATCC 19544T (strain 106) (T=type strain), ATCC 25935 (strain
115), and ATCC 19623 (strain I-16-M), were included in the same species. Through
chemotaxonomic study (mainly polyamine and quinone composition) and comparative
analyses of 16S rRNA primary structure, it has been suggested that only isolates that
clearly resemble neotype strain ATCC 19544T phenotypically should be considered
genuine members of Z ramigera (Rossello-mora et al., 1993). In fact, 16S rRNA
sequence comparisons and distance matrix tree analysis revealed that Z. ramigera 106
forms a lineage with Rhodocyclus purpureus in the beta subclass ofproteobacteria.
ATCC 25935 was shown to belong to the beta subclass of the class Proteobacteria with
members of the genus Telluria as its closest relatives. In contrast, ATCC 19623 proved
to be a member of the alpha subclass of the proteobacteria, closely related to


11
Agrobacterium tumefaciens. (Shin et ai., 1993). Recently, ATCC 25935 was reclassified
as Duganella zoogloeoides (Hiraishi et al., 1997).
The possible biotechnological importance of Z ramigera is that it plays
important roles in wastewater treatment process, especially in flocculation of activated
sludge and biofilm formation on the surface of biofilm reactors.
Overview of Wastewater Treatment Process
The objectives of wastewater treatment processes are reduction of organic
content (BOD), nutrients (N, P) and removal/reduction of pathogenic microorganisms
and parasites. The conventional wastewater treatment process includes (1) preliminary
treatment to remove debris or coarse materials; (2) primary treatment which is by
physical means such as screening and sedimentation; (3) secondary treatment which is by
biological means such as activated sludge, trickling filter, or oxidation ponds, and
chemical means such as disinfection; and (4) tertiary or advanced treatment which is
mainly by chemical means, such as flocculation, filtration, and disinfection.
Influent from a collection system or pumping station is first treated by
preliminary processes (pumping, screening and grit removal) and primary settling to
remove heavy solids and floatable materials. Primary solids may go to landfills. Primary
effluent is treated by biological means (eg. activated sludge or trickling filter). If tricking
filters are used, the primary effluent is applied to filter beds containing natural materials
(rock, coal) or synthetic (plastic) supports that permit biofilm development. Then, sludge
(solid sloughed off the filters) and liquids are separated in settling tanks. In the activated


12
sludge process, primary effluent is mixed with returned activated sludge (RAS) to form
the mixed liquor in the aeration tank where aeration is provided by mechanical means.
When treatment with activated sludge is complete, the mixture goes to sedimentation
tanks to separate solids (sludge) and liquid. A portion of sludge is recycled to provide an
inoculum for the influent sewage. The rest of sludge is usually further processed by
screening, thickening, dewatering, conditioning, and stabilization (anaerobic digestion,
aerobic digestion, composting, lime stabilization and heat treatment) before land
application. The secondary effluent is further treated by chlorination, filtration,
flocculation, and so on before agriculture reuse, landscape irrigation, ground water
recharge, recreational reuse, nonpotable urban reuse, potable reuse, industrial reuse, or
released to receiving waters (Fig. 1).
BOD, N and P are greatly reduced during biological wastewater treatment
processes. They are also reduced by chemical means such as flocculation, composting
and lime stabilization. Efficient microorganism removal from wastewater is very
important in order to prevent waterborne disease outbreaks and to protect the publics
health. During primary and secondary wastewater treatment, most of the protozoans are
settled with sludge solid due to their bigger size compared with bacteria and viruses.
Many bacteria and viruses associated with sludge solids are also settled with the sludge.
Almost 90% of viruses may be removed from water by the activated sludge treatment
process (Rao and Melnick, 1986). It was reported that Z. ramigera extracellular polymer
avidly adsorbed 12!I-labeled polio virus and either precipitated the virions or neutralized
them (Smith, 1983; Rao and Melnick, 1986).


13
From collection
liquid
returned sludge
/N
mechanical screen
' solid
landfill
..V..IVUUV.UV.. .^jnecnanicai screen :^ Mixed
system or pumping and grit removal ^ soj¡d liquor phase
sedimentation
tank
disinfection
filtered effluent 1
filtration
liquid si
clarified effluent
reuse eg. lake limestone
solid
sludge to land application^:
filtered water
aerobic digestion/
anaerobic digestion
I
digested sludge
i
belt press and
belt filter press
Fig. 1. Conventional wastewater treatment process


14
Ciliated protozoans are the predominant protozoans present in activated sludge.
They consume many of the absorbed materials in sludge, including viruses and bacteria
(Rao and Melnick, 1986; Bitton, 1994). These microorganisms in the sludge are reduced
by sludge processes such as composting, heat treatment, aerobic/anaerobic digestion, and
so on. The microorganisms in the liquid phase of wastewater are removed by flocculation
and disinfection treatments such as with chlorine, ozone, chlorine dioxide, and so on.
The order of removal efficiency by disinfectants usually is bacteria > virus > protozoan.
Besides disinfection treatment, filtration has been a useful method for removal of
bacteria, virus and other fine particles from wastewater during tertiary wastewater
treatment. Rapid sand filtration and biofilm-mediated slow sand filters have been used
for removal of bacteria and viruses in wastewater treatment plants. In order to improve
the removal of microorganisms from water and wastewater, the mechanisms of
microorganism adsorption to solid particles have been investigated (Mills, et al., 1994;
Gerba., 1984). It was indicated that electrostatic interactions are important for filtration
of recombinant Norwalk virus particles and bacteriophage MS2 in quartz sand (Redman
et al., 1997). Hydrophobic interactions (Bales and Li, 1993), van der Waals forces, and
surface properties such as surface roughness and surface charge heterogeneity are also
important in microorganisms-solid interaction (Lukasik et al., 1996; Truesdail et al.,
1998).
Different modifications of filter media have been tried, including the use of
metal peroxide (Asghari and Farrah, 1993; Farrah and Preston, 1991; Gerba et al., 1988),
metal oxide (Stenkamp and Benjamin, 1995), and metal hydroxide coatings (Farrah and


15
Preston, 1985; Lukasik et al., 1996; Lukasik et al., 1998). Such modifications have
increased the removal of microorganisms from water relative to untreated granular
media. The reason is that modifying the sand or diatomaceous earth with various metal
oxide, peroxide or hydroxide surface coatings changed the surface charge from
electronegative to electropositive, thus decreasing the electrostatic repulsion between the
particles and the adsorbing solid. Therefore, these modified filter media are promising
materials to be used in removing microorganisms in wastewater filtration processes.
When the modified filter media are used in wastewater treatment plants, the
development of biofilms or the presence of organic and inorganic materials in the
wastewater have the potential to change the surface properties of the filter media, and
thus influence the microorganism removal capacity. It has been suggested that biofilm
development on slow sand filters (Schuler et al., 1991), glass, polycarbonate and granular
activated carbon surfaces (Banks and Bryers., 1992; Drury et al., 1993; Rittmann and
Wirtel., 1991; Sprouse and Rittmann., 1990) enhanced the physical entrapment of
bacteria and bacterium-sized fine particles. However, it was also found that sewage-
derived organic matter blocked the attachment sites on ferric oxyhydroxide-coated quartz
thus decreasing bacteriophage PRD1 adsorption (Pieper et al., 1997).
Overall, biological wastewater treatment processes are important for
microorganism removal as well as reduction of organic materials. It has long been
believed that Z. ramigera plays important roles in wastewater treatment processes such
as activated sludge flocculation and biofilm formation on the surface of trickling filters.


16
The Function of Z ramfera in Activated Sludge
In the activated sludge process, wastewater is fed continuously into an aerated
tank, where the microorganisms metabolize the organic materials. Biological floes form
during this process. These floes consist of a variety of microorganisms and are
collectively referred to as activated sludge. Following the treatment, a portion of the
sludge is discarded (wasted) and the rest is returned to the aeration tank. The relatively
clear supernatant from the final settling tank is the secondary effluent.
The primary feeders in activated sludge are bacteria. Secondary feeders are
holozoic protozoans. Microbial growth in the mixed liquor is maintained in the declining
or endogenous growth phase to ensure good settling characteristics. Activated sludge is
truly an aerobic treatment process since the biological floe is suspended in liquid media
containing dissolved oxygen. Dissolved oxygen extracted from the mixed liquor is
replenished by air supplied to the aeration tank (Viessman and Hammer, 1985).
In activated sludge, extracellular polymer produced by Z. ramigera and other
activated-sludge microorganisms plays a role in bacteria flocculation and floe formation
processes which are essential prerequisites for the efficient and economical operation of
an activated-sludge wastewater treatment plant (Bitton, 1994). Floe formation during the
aeration phase is also instrumental in removing undesirable microorganisms.
The proper settling of activated-sludge solid requires a proper balance of floe-
forming bacteria and filamentous bacteria. If the numbers or activities of the floc-
forming bacteria are reduced, sludge bulking may occur and turbid rather than clear
effluents will be produced (Bitton, 1994; Nozawa et al., 1987). Sludge bulking is one of


17
the major problems affecting biological wastewater treatment. There are several
approaches for controlling sludge bulking, including addition of oxidants such as
chlorine or hydrogen peroxide, flocculent such as synthetic organic polymers, lime and
iron salts, and using biological selectors (Bitton, 1994). It was indicated that the ability to
settle bulking sludge was also restored by seeding sludge with Z. ramigera (Nozawa et
al 1987).
Farrah and Unz (1976) studied Z. ramigera extracellular polymer and found that
amino sugars are the principal constituent after acid hydrolyzation of extracellular
polymer and the amino sugars content in extracellular polymer isolated from activated
sludge floes was similar to that of from Z. ramigera. Paper and ion-exchange
chromatography separation of hydrolyzed extracellular polymer of Zoogloea isolated
from activated sludge suggested that the amino sugars are glucosamine and fucosamine
(Tezuka, 1973). The isolated polymer from activated-sludge microorganisms has been
found to contain neutral sugars, amino sugars, uronic acids and amino acids, which
indicates their heteropolysaccharidic character (Hejlar and Chudoba, 1986). The
molecular weight of the extracellular polymer fraction ranged from 3xl05 to 2xl06
Daltons. Glucose, galactose, mannose, glucuronic acid and galacturonic acid were
detected in this fraction (Horan and Eccles, 1986).
Therefore, there are negative and positive charges in the extracellular polymer
which allow the polysaccharide to behave as polyelectrolyte. It is observed that
extracellular polymers produced by microorganisms commonly found in activated sludge
display a great affinity for metals. Several types of bacteria (e.g. Z. ramigera, Bacillus


18
lichenifomis), some of which have been isolated from activated sludge, produce
extracellular polymers that are able to complex and subsequently accumulate metals,
such as iron, cooper, cadmium, nickel or uranium. For example, Duganella zoogloeoides
(ATCC25935) can accumulate up to 0.17 g of Cu per gram of biomass (Norberg and
Persson,1984; Norberg and Rydin, 1984). This bacterium, when immobilized in alginate
beads, is also able to concentrate cadmium to as high as 250 mg/1 (the alginate beads also
absorb some of the cadmium) (Kuhn and Pfister, 1990). The heavy metal adsorption of
Duganella zoogloeoides (ATCC25935) might be related to its production of an acidic
extracellular polymer such as succinoglycan which contains glucose, succinate and
pyruvate (Ikeda et al., 1982). Correlation between highly anionic charged polymers and
metal complexing capacity was found by study of chelating properties of extracellular
polysaccharide produced by Chlorella spp. (Kaplan et al., 1987).
It is also noticed that the production of extracellular polymer by bacteria may
drastically reduce the saturated hydraulic conductivity of sand columns (HCsat) and this
effect was only observed when the extracellular polymer produced in the form of loose
slime layers. Cell-bound capsular extracellular polymer had no significant effect on the
HCsat (Vandevivere and Baveye, 1992).
The Function of Z. ramieera During Biofilm Formation
Biofilm formation is thought to result from the concerted action of primary
attachment to a specific surface and accumulation in multilayered cell clusters. Biofilms
are defined as matrix-enclosed bacterial populations adherent to each other and/or to


19
surfaces or interfaces. This definition includes microbial aggregates and floccule and
also adherent populations within the pore spaces of porous media (Costerton et al.,
1995). Biofilm is ubiquitous. It exists in natural environments (Gillan et al., 1998;
McLean et al., 1997), and in clinical settings (Stickler et al., 1998). The structural and
physiological heterogeneity of biofilm is now widely recognized (Huang et al., 1995;
Huang et al., 1998; Stewart et al., 1997; Xu et al., 1998).
In addition to traditional methods (cultivation and/or microscopy), genetic
methods are also available to characterize microbial diversity. Amplification and
sequence analysis of the 16S rRNA (rDNA) has been successfully used for understanding
the biology of microbial community (Britschgi and Givonnoni, 1991; DeLong et al.,
1993; Gillan et al., 1998; Liesack and Stackebrandt, 1992; Ward et al., 1990). In one
study, the genetic diversity and phylogenetic affiliation of biofilm bacteria which covered
the shell of bivalve Montecuta ferruginosa were determined by denaturing gradient gel
electrophoresis (DGGE) analysis of 16S ribosomal DNA PCR products obtained with
primers specific for the domain Bacteria (Gillan et al., 1998). Fluorescein in situ
hybridization (FISH) by using fluorescein labeled oligonucleotide probes are also
frequently used to detect and characterize bacteria in microbial community (Muyzer and
Ramsing, 1995).
During biofilm formation, initial attachment requires flagella or surface
adhensins and nutritional signal from environments (Costerton et al., 1995). Attached
bacteria excrete extracellular polymer as a matrix for biofilms (Costerton et al., 1987;
Allison and Sutherland, 1987). Mature biofilms form mushroom- and pillar-like


20
structures with water channel between them, which function much like primitive
circulatory system (Costerton et al., 1995). It has been noticed that bacterial cells in
biofilm are usually more resistant to environmental stress and antibacterial agents than
planktonic cells (Allison and Sutherland, 1987; Marshall et al., 1989; Ophir and Gutnick,
1994; Brown et al., 1995). It is said that bacterial adhesion might trigger the expression
of a sigma factor which regulates a large amount of genes so that biofilm cells are
phenotypically distinct from planktonic cells of the same species (Costerton et al., 1995;
Yu and Mcfeters, 1994). Recent study indicated that the pattern of gene expression
within biofilm is largely controlled by the metabolic activity of the microorganisms and
the local availability of carbon and energy sources (Huang et al., 1998; Xu et al., 1998).
It has been noticed that biofilm formation involves cell-to-cell signals (Passador
et al., 1993; Kolter and Losick, 1998; Davies et al., 1998). Acylated homoserine lactones
(AHLs) are chemical signals that mediate population density-dependent (quorum-
sensing) gene expression in numerous Gram-negative bacteria (Stickler et al., 1998).
Structures of signals in Pseudomonas aeruginosa are N-3-(oxooctanoyl)-L-homoserine
lactones and N-(butyryl)-L-homoserine lactones. These signals were required for the
expression of the virulence factors toxin A and elastase (Passador et al., 1993).
AHLs accumulated in bacterial cultures as membrane-permeant signal molecules.
At a threshold population density, the accumulated AHLs interact with cellular receptors
controlling the expression of a set of specific target genes which respond to local cell
density (Fuqua et al., 1996; Salmond et al., 1995; Stickler et al., 1998). Therefore, AHLs
are important in the development of the biofilm-specific physiology (Heyes et al., 1997).


21
For example, a Pseudomonas aeruginosa mutant strain unable to make AHLs did not
produce a typical biofilm and was sensitive to the biocide sodium dodecyl sulfate
(Davies et al., 1998). It was indicated that AHLs are not only produced in natural
biofilms growing on submerged stones taken from the San Marcos river in Texas
(McLean et al., 1997), but also produced by biofilm in clinical setting such as indwelling
urethral catheter (Stickler et al., 1998).
Analogues of AHLs capable of interfering with signaling have the potential to be
used to prevent the formation and development of biofilm on implanted medical devices.
It was indicated the furanone derivatives produced by the seaweed Delisa pulchra inhibit
swarming of Serrada liquefaciens which is AHLs-regulated. It was speculated that
furanone derivatives mimic AHLs signaling process by blocking transcriptional
activation of target genes (de Nys et al., 1995; Erble et al., 1996; Givskov et al., 1996).
Therefore, it is very likely to be able to control biofilm formation and dissolution in situ
by using AHLs and its analogues.
Extracellular polymer production by biofilm bacteria not only helps the initial
attachment of bacteria to surfaces but also helps the formation and maintenance of micro
colonies and biofilm structure, enhances biofilm resistance to environmental stress and
antimicrobial agents, protects bacteria in the biofilm from protozoan grazing and
provides biofilm nutrition (Allison and Sutherland, 1987; Heissenberger et al, 1996;
Marshall et al.,1989; Ophir and Gutnick, 1994). The extracellular polymer in biofilm is
also highly heterogenous and has been demonstrated in situ to vary spatially, chemically
and physically (Lawrence et al., 1994; Wolfaardt et al., 1993; Wolfaardt et al., 1994). In


22
addition, the chemically reactive extracellular polymer is generally the first biofilm
structure to come in contact with potential substrates, predators, antimicrobial
agents/antibiotics and other bacteria, and thus is of considerable applied and ecological
importance. For example, bacterial cells would be attached to the organic nutrients that
concentrate naturally at surfaces in aquatic systems, and the extracellular polymer that
mediate their adhesion to surfaces would further concentrate dissolved organic molecules
and cations out of bulk fluid.
Biofilm Reactors
In wastewater treatment plants, biofilm reactors include trickling filters, rotating
biological contractors (RBC), and submerged filters (down-flow and up-flow filters).
These reactors are used for oxidation of organic matter, nitrification, denitrification or
anaerobic digestion of wastewater. During biofilm formation on trickling filter surfaces,
the surface of the support materials is colonized with Gram-negative bacteria followed by
filamentous bacteria. There are two steps in the absorption of bacteria to biofilm
surfaces. The first step is reversible sorption, mainly controlled by electrostatic
interactions between absorbent and the cells. The second step consists of irreversible
absorption of cells, resulting from the formation of polysaccharide-containing matrix,
named glycocalyx. Glycocalyx not only helps anchor the biofilm microorganisms to the
surface, but also helps protect microorganisms from predation and from chemical insult.
There are also polyanionic compounds in glycocalyx that complex the metal ions (Bitton,
1994).


23
Z ramigera was found in biofilm during denitrification by fluidished bed reactors
(Sich and Rijn, 1997). It degraded phenols and nitrogen-containing aromatic compounds
(Koch et al., 1991) and co-existed with Pseudomonas during these processes. Initial
colonization on granules was mainly Zoogloea species. During the period of co
existence, Zoogloea cells provided a setting substrate for Pseudomonas and the
gelatinous matrix provided by Zoogloea might have served as nutrient trap for
Pseudomonas which eventually covered the entire outer layers of the granules (Sich and
Rijn, 1997).
Reverse Transcription-Polymerase Chain Reaction (RT-PCR1 for Microorganism
Detection
In addition to traditional microbiological and immunological methods for
microorganism detection, molecular procedures have been increasingly popular and more
frequently used to detect virus, bacteria and protozoan in clinical and environmental
samples.
Comparing with immunological methods (eg. immunohistology, ELISA, etc) and
tissue culture, RT-PCR has been extensively used as a sensitive, specific and time saving
method to detect genes of RNA viruses (Hayase and Tobita, 1998), including dengue
virus (Chow et al., 1998; Hober et al., 1998; Liu et al., 1997), hepatitis A virus
(Cromeans et al., 1997), hepatitis C virus (Jeannel, et al., 1998; Laursen et al., 1998;
Whitby and Garson, 1997), citrus psorosis virus (Barthe et al., 1998), reovirus (Tyler et
al., 1998), enterovirus (Chung et al., 1996; Gantzer, et al., 1997), respiratory virus


24
(Rohwdder et al., 1998; Valassina et al., 1997), measles virus (Chadwick et al., 1998;
Kawashima et al., 1996), mumps virus (Kashiwagi et al., 1997; Cusi et al., 1996), HIV
(Beilke et al., 1998; Contoreggi et al., 1997), and so on.
Several varieties of RT-PCR was developed for virus detection. For example,
multiplex RT-PCR was used to rapidly detect and identify different serotype of viruses
such as human parainfluenza viruses 1,2 and 3 (Echevarria et al., 1998), or different
species such as influenza A virus (IA) and respiratory syncytial virus (RS) (Valassina et
al., 1997). Nested or semi-nested RT-PCR can be used for rapid type-specific(Chow et
al., 1998) or genus-specific detection (Hafliger et al., 1997; Pfeffer et al., 1997). In situ
RT-PCR was used to localize the virus in the specimens (Walker et al., 1998; Qureshi et
al., 1997). RT-PCR-ELISA (Whitby et al., 1997) was also developed and much more
sensitive than southern blot hybridization. RT-PCR coupled with microplate colorimetric
assay (Legeay et al., 1997) can be used to quantitate PCR products.
RT-PCR targeting of bacterial ribosomal RNA has been frequently used to detect
bacteria. This method has several advantages. One of them is that bacterial rRNA has
conserved and variable regions. This makes it convenient to find general as well as
specific target sites for PCR primers. Second, various databases of rRNA sequences such
as Ribosomal Database Project and Gene Bank are available so that phylogenetic
analysis (Rossello-mora et al., 1995; Gillan et al., 1998) and primer design can be
performed. Third, each bacterial cell contains 1,000 to 10,000 copies of rRNA, detection
of rRNA should impart increased sensitivity over assays based on the detection of a


25
single copy or even multiple copies of genomic sequences. For example, RT-PCR assay
targeting the 16S rRNA of Mycobacterium leprae (Kurabachew et al., 1998) or
Treponema pallidum (Centurion et al., 1997) was used to detect low numbers of viable
organisms in samples.
RT-PCR targeting bacterial mRNA has also been used to detect viable bacteria
because bacterial mRNA has an extremely short half life, averaging only a few minuets.
Previously, the presence of viable Mycobacterium tuberculosis (Jou et al., 1997) and
Listeria monocytogenes (Klein and Juneja, 1997) were detected by using RT-PCR
targeting bacterial mRNA.
Efforts have been made to detect protozoans from environments. Procedures used
include flow cytometry (Vesey et al., 1993), laser scanning (Anguish and Ghiorse, 1997)
and immunomagnetic separation (Campbell and Smith, 1997). The sensitivity of
protozoan detection was greatly increased by concentrating cyst and oocysts with filters,
selectively capturing mRNA with oligo (dT)25 magnetic beads and then performing RT-
PCR. It was indicated that low numbers of viable Giardia cysts and Cryptosporidium
parvum oocysts were detected in water samples and the method was more sensitive than
using immunofluorescence assay (Kaucner and Stinear, 1998).


MATERIALS AND METHODS
Bacterial Strains
The following bacteria were used in this study: Salmonella typhimurium (ATCC
19585), Escherichia coli (ATCC 15597), Klebsiella pneumoniae (ATCC 13883), Proleus
vulgaris (ATCC 13315), Staphylococcus aureus (ATCC 12600), Pseudomonas
aeroginosa (ATCC 10145), Duganella zoogloeoides (ATCC 25935), Z. ramigera' 1-16-
M (ATCC 19623), andZ ramigera 106 (ATCC 19544). Z. ramigera 106 (ATCC 19544),
Z. ramigera I-16-M (ATCC 19623), and Duganella zoogloeoides (ATCC 25935) were
grown in YP medium (2.5 g/1 yeast extract, 2.5 g/1 peptone) for 36-48 hours at 28C. All
other bacteria were grown in Tryptic Soy Broth (Difco Laboratories, Detroit, MI) for 24
hours at 37C.
Z. rami vera Enriched Biofilm Development
Phenol (Acros Organics, Pittsburgh, PA) was added to 100 ml samples from
wastewater treatment plants or surface water contained in 250-ml beakers daily to
provide an initial concentration of 50 pg/ml. The samples were incubated at ambient
temperature (approximately 25C) for up to one week. During incubation, the samples
were periodically examined for the development of a biofilm that contained finger-like
projections characteristic of Z. ramigera.
26


27
Column Studies
Raw sewage was obtained from University of Florida Water Reclamation Facility
(Gainesville, FL). The raw sewage was filtered through cheese cloth (Fisher Scientific,
Springfield, NJ) to remove large particles from the water before passing through the
column.
Ottawa sand (Fisher Scientific, Springfield, NJ) was packed into an acrylic
column (1.5cm ID x 0.5 m). The raw sewage with 50 pg/ml phenols was passed through
the column in inflow mode. The treatment lasted for two weeks. The sand was then taken
out from the column, washed with deionized water for 3 times and ready for observation
under a scanning electron microscope.
Scanning Electron Microscopy (SEMI
Mid-log phase ofZ ramigera 106 (ATCC 19544) culture was centrifuged and
washed twice with deionized water. The sample was dehydrated by soaking for five
minutes serially in increasing ethanol solutions (25%, 50%, 75%, 95% and twice in
100% ethanol). It was then fixed by hexamethyldisilizane (FIMDS). The culture was then
mounted on a nucleopore filter (Fisher Scientific, Pittsburgh, PA) and sputter-coated with
gold particles for 5 minutes. The sample was viewed on the Hitachi S-4000 Field
Emission SEM. Natural biofilms that developed on sand filter media after the passage of
phenol fortified (50 pg/ml) wastewater were also processed and observed on a SEM as
described above.


28
Effect of Antibiotics on Z. ramieera Growth
All antibiotics were purchased from Sigma Chemicals (St. Louis, MO). Stock
solutions for trimethoprim (0.5 mg/ml) were made by dissolving 0.05 g of trimethoprim
in 5 ml benzyl alcohol and 5 ml deionized water. The solutions were passed through a
0.45pm filter (Fisher Scientific, Pittsburgh, PA). Stock solutions for penicillin (7.5
mg/ml), tetracycline (25 mg/ml), streptomycin (125 mg/ml), sulfadiazine (5 mg/ml), and
cephalosporin (100 mg/ml) were made in deionized water and filter sterilized.
Tests were carried out by adding different concentrations of antibiotics into YP
liquid medium. Z. ramigera (ATCC 19544) was inoculated and incubated at 28C for 4-5
days. Growth was determined by comparing growth in tubes without antibiotics to
growth in tubes with antibiotics.
Isolation of Z. ramieera from Natural Environments
In order to make m-toluic acid isolation media, the following solutions were used.
(A). Potassium phosphate solution (0.06M, lOOx) was made by adding 1.0 g of K2HP04
to 100 ml deionized water. The solution was adjusted pH to 7.2 and autoclaved for 15
min; (B). M-toluic acid (50 mg/ml) stock solution (l,000x) was made by mixing 5 g of
m-toluic acid, 1ml solution A, and 5 ml of IN NaOH. The mixture was heated until the
m-toluic acid was completely dissolved. The pH was adjusted to 7. The solution was
passed through a 0.2 pm pore size filter; (C). Salt solution (lOOx) was made by adding 2
g of MgSQ4,3.75 g of (NH4)2S04 and 0.02 g of CaCl2 to 100 ml deionized water;


29
(D). Yeast autolysate solution (100X) was made by adding 0.1 g of yeast autolysate into
100 ml deionized water.
To make the isolation medium, 1 ml solution C, 1 ml solution D, 97 ml deionized
waters and 1 gram of agar were mixed. After autoclaving and cooling to 55C, 1 ml of
solution A, 0.1 ml solution B and appropriate amount of sulfadiazine and/or
trimethoprim were added.
Raw sewage was obtained from University of Florida Water Reclamation Facility
(Gainesville, FL). Lake water was obtained from Lake Alice (Gainesville, FL). Z
ramigera enriched biofilm developed over raw sewage was conducted by adding 50
|ig/ml phenol into raw sewage and incubated at room temperature for 4-5 days. Z
ramigera enriched biofilm developed over lake water was conducted by adding 50|ig/ml
phenol into lake water and incubated at room temperature for 7-10 days. The
microorganisms from the biofilms were streaked on the m-toluic acid isolation medium
combined with lpg/ml trimethoprim and/or 10pg/ml sulfadiazine. Hard colones on the
agars resembling Z ramigera (Unz and Farrah, 1972) were selected and re-streaked on
the same medium 2-3 times for purification.
Mixed liquor suspensions were obtained from University of Florida Water
Reclamation Facility (Gainesville, FL). Mixed liquor suspensions were centrifuged at
5,000 rpm for 5 min. The pellet and an equal volume of the supernatant were blended for
1-2 min to release the microorganisms from the floe. The blended activated sludge was
streaked on the m-toluic acid isolation media combined with 1 pg/ml trimethoprim


30
and/or 10 pg/ml sulfadiazine. The isolated bacterial colonies were purified by re-
streaking the same medium 2-3 times.
Tests for nitrate reduction, oxidase, catalase, Gram stain, urea hydrolysis, glucose
utilization, indole production (Cappuccino and Sherman, 1992), and meta cleavage of
benzene derivatives (Unz and Farrah, 1972) were conducted to identify the isolated
strains.
Isolation of Z. ramfera Extracellular Polymer
Z. ramigera 106 was inoculated in YP medium and incubated at 28C until log-
phase. The cultures were centrifuged and washed twice with deionized water, then
suspended in equal volume of 0.4 M K2HP04 (final concentration is 0.2 M) and blended
(Tekmar, Cincinati, Ohio) for 1 min. The mixture was centrifuged for 10 min at 27,000 x
g and the pellet was discarded. Cetyltrimethylammonium bromide (CTAB) was added to
the supernatant to a final concentration 0.8% (wt/vol). The solution was centrifuged after
4h at room temperature. The precipitate was mixed with 10 volumes of 0.5 M NaCl and
the mixture was centrifuged. The supernatant fraction was dialyzed against deionized
water at 4C for 24 hours. The dialyzed sample was dried and washed with 80% ethanol
to remove the residual CTAB (Farrah and Unz, 1976).
Polyclonal Antibodies Production
For production of the antibody against cell walls, log-phase Z. ramigera 106
cultures were washed twice and suspended in deionized water. The suspension was


31
adjusted to pH 10 by using IN NaOH and boiled for 3 min, then cooled. The pH was
readjusted to 10 and the suspension was boiled for another 3 min. Finally, cells were
centrifuged at 10,000 rpm for 10 min and washed twice with deionized water.
Microscopic examination with India Ink revealed that cells were devoid of the
extracellular polymer. Formalin (2%) was used to fix the cells. A fraction of the cells was
hydrolyzed in IN NaOH and a protein assay was performed (Protein Assay Kit, Sigma
Chemicals, St. Louis, MO). Cell suspensions were adjusted to 200 mg/ml protein
concentrations in PBS buffer and were mixed with an equal volume of Freunds complete
adjuvant (Sigma Chemicals, St. Louis, MO). One ml of the suspension was then injected
subcutaneously into a rabbit. After 2 weeks, a 1 ml inoculum of the cells in Freunds
incomplete adjuvant was intravenously injected and this was repeated two weeks
thereafter. Ten days after the final injection, the rabbits were bled and the antiserum was
collected. For the production of antibody against Z. ramigera extracellular polymer, the
extracellular polymer was isolated from the cells as previously described (Farrah and
Unz, 1975). The same procedure was followed for antiserum production using the
rabbits. Unimmunized rabbit serum (Sigma Chemicals, St. Louis, MO) was used as
negative control in all immunological procedures.
Indirect Immunofluorescence Staining
Samples were spread on microscopic slides, air dried and fixed with 50%, 80%
and 96% ethanol sequentially for 3 minutes each time. The rabbit antiserum was diluted


32
with PBS buffer and added to the slides and incubated for 30 minutes at room
temperature in a hydrated chamber. The slides were washed with PBS buffer several
times. Then FITC-labeled goat anti-rabbit IgG (Sigma) diluted in PBS was added and
incubated for 30 minutes. The slides were then washed twice with PBS buffer. A drop of
10 mg/ml DABCO (1,4-diazabicyclo (2,2,2) octane) (Sigma Chemicals, St. Louis, MO)
was added to enhance fluorescence and a cover slip was placed on the slide. The slides
were examined by phase-contract and epifluorescence microscopy (Farrah and Unz,
1975).
Enzyme Immunostaining
All chemicals and reagents used were obtained from Sigma Chemicals (St. Louis,
MO). Samples were spread on microscopic slides, air dried and fixed with 50%, 80% and
96% ethanol sequentially for 3 minutes each time. The rabbit antiserum was added and
allowed to react for 30 minutes. The slides were washed with PBS buffer. Then biotin-
conjugated anti-rabbit IgG (l/500dilution with PBS buffer) was added and allowed to
react for 30 minutes. The slides were washed with PBS buffer and peroxidase-labeled
avidin was added (0.64 units of peroxidase /ml) and reacted for 30 minutes. After the
slides were washed with PBS buffer, 0.5 ml of the substrate, aminoethyl carbozole
(AEC) solution (3 volumes of 4.0 mg/ml AEC dissolved in N, N-dimethylformamide plus
7 volumes of 0.05M acetate buffer [pH 5.0]) was added. Then, 1 pi 30% H202 was added
to the slides to activate the substrate (Cleveland and Richman, 1987). After 10 min, the
slides were washed with PBS buffer and checked under a light microscope.


33
Immunoassay by Scanning Electron Microscopy SEM)
The scum layers of biofilm were put into microcentrifuge tubes and were
washed 3 times by Tris-buffered saline (TBS) (pH 7.4) thoroughly and fixed by 4 %
paraformaldehyde (PFA) solution for 30 min on ice or 10 min at room temperature.
Samples were washed once by TBS (pH 7.4) and incubated with 1% gelatin in TBS for
10 minutes. Three 5 minutes incubations with 0.02 M glycine in TBS were used to
preblock. Then samples were washed by 5 minutes incubation with TBS (with 1% BSA).
Goat serum (1:10) was added to block for 10-20 minutes and was washed with TBS once.
A rabbit antiserum (1:500) was added and reacted for 1 hour at room temperature.
Samples were washed for 5 minutes three times with TBS (with 1% BSA, pH 7.4)
followed by two 5 minutes washes with TBS (with 1% BSA, pH 8.2). Gold labeled goat
anti-rabbit IgG (1:100) was added and incubated for 1 hour at room temperature.
Samples were washed three times for 5 minutes with TBS ( pH 7.4) followed by fixation
with Trumps solution (4% formaldehyde, 1% glutaraldehyde in phosphate-buffered
saline, pH 7.4) for 30 minutes. Samples were washed three times for 5 minutes with TBS
(pH 7.4) followed by four 5 minutes ultra pure water washes. Silver enhancement was
performed for 5 minutes and was followed by three 5 minutes water washes. Samples
were then mounted on nucleopore fiter (Fisher Scientific, Pittsburgh, PA). Dehydration
and fixation were performed using gradient alcohol dehydration: 25%, 50%, 75%, 95%
for 5 min each, 100% for 5 min twice followed by 5 minutes hexamethyldisilizane
(HMDS) washes twice. Samples were dried, carbon coated for 10 seconds, and observed
under a Hitachi S-400 Field Emission SEM.


34
Determination of Most Probable Number (MPN1 of Z. ramfera in Wastewater
Treatment Plants and Lake Water
Autoclaved bottles were prepared prior to sample collection. Raw sewage,
mixed liquor suspension, unchlorinated effluent and chlorinated effluent were obtained
from the University of Florida Water Reclamation Facility (Gainesville, FL). Ten mg/1
sodium thiosulfate was added immediately to collected chlorinated effluent. Mixed
liquor suspension, primary aerobic digested sludge and final aerobic digested sludge
were obtained from the Kanapaha Water Treatment Plant (Gainesville, FL). Lake water
was obtained from Lake Sheelar, Lake Geneva, Lake Johnson (Clay county, FL), Lake
Alto, Santa Fe Lake, Lake Alice, and Lake Bivans Arm (Alachua county, FL).
In the University of Florida Water Reclamation Facility, raw sewage is mixed
with returned sludge in the mixed liquor tank. After the activated sludge process, sludge
solids are settled and separated from the supernatant. The mixed liquor supernatant is
then treated by rapid sand filtration. The effluent from the rapid sand filter is
unchlorinated effluent. The unchlorinated effluent is then chlorinated in the chlorination
basin. Part of the chlorinated effluent goes to Lake Alice. In the Kanapaha Wastewater
Treatment Plant, after the activated sludge process (mixed liquor stage), the sludge goes
through primary and secondary aerobic digestion.
A three-tube MPN procedure (American Public ffealth Association, 1989) was
used to determine the concentration of Z. ramigera and total bacteria in wastewater
samples. For determining the MPN for total bacteria, samples were serially diluted in YP
medium and incubated for up to 2 weeks at 28C. For determining the MPN for Z.


35
ramigera, samples were serially diluted in a filter sterilized raw sewage. The samples
were then supplemented with 50pg/ml phenol daily and incubated at 28"C up to 2 weeks.
The scum layer that developed was examined microscopically for the presence of typical
finger-like projection and/or cells that reacted with Z. ramigera antisera as described
above.
Chlorophyll concentrations (jj.g/1) in lakes were determined by pigment extraction
with ethanol (Sartory and Grobbelaar, 1984), followed by spectrophotometrical
measurement (method 10200H(2c), American Public Health Association, 1989). Total
phosphorus concentration (pg/1) in lakes were determined by a persulfate digestion
(Menzel and Corwin, 1965), followed by the procedures of Murphy and Riley (1962).
Total nitrogen concentrations (pg/1) were determined using the procedure described by
Bachmann and Canfield Jr. (1996).
RT-PCR
RNase free water was obtained by treating the water with 0.1% DEPC (diethyl
pyrocarbonate) (Sigma Chemicals, St. Louis, MO). Deionized water with 0.1% DEPC
was shaken vigorously to bring the DEPC into solution. The solution was then incubated
for 12 hours at 37C and autoclaved for 15 minutes to remove any trace of DEPC. All
solutions were made by using RNase free water. Isoporpanol, Mops (3-morpholino)
propanesulfonic acid), P-mercaptoethanol, 10 x Tris-EDTA buffer and lysozyme were
purchased from Sigma Chemicals (St. Louis, MO). RNase AWAY (Fisher Scientific,


36
sprinfield, NJ) was used to keep working areas and pipets RNase free. RNase free pipet
tips and PCR tubes were obtained by autoclaving overnight.
The sequence ofZ ramigera (ATCC 19544)16S rRNA was retrieved from Gene
Bank (ZR16SRRNA). The upstream and downstream primers were specific for Z
ramigera 106 16S rRNA and purchased from Genosys (The Woodlands, Texas).
Sequence for the upstream primer is CCG ATG TCG GAT TAG CTA GTT GG (position
219 to 242). Sequence for the downstream primer is AAT GAG TCT CCT CAC CGA
ACA ACT AG (position 813 to 836). The lyophilized primers were suspended in DNase
and RNase free water and incubated at 37C for complete dissolution.
Bacterial 16S rRNA were isolated by using QIAGEN RNA/DNA mini kit
(Valencia, CA). Briefly, 5x 10* bacterial cells were centrifuged and resuspended in 50 pi
of lysozme-containing TE buffer for 5 min. Then the lysing buffer was added to the
solution as described in the kit. The 16S rRNA was isolated exactly by using the Tow
molecular weight RNA isolation procedure in the kit. QIAGEN tip is anion-exchange
column which can be used to selectively isolate DNA, RNA and low molecular weight
rRNA. RT-PCR kit was purchased from Promega (Pittesburgh, PA). RT-PCR was
performed in a total volume of 50 pi reaction mixture containing 0.2 mM
deoxynucleoside triphosphate, 0.5 mM MgS04, 5 U of AMV reverse transcriptase, 5 U of
T/l DNA polymerase, 0.5 pM of the primers which are specific for Z. ramigera 106 16S
rRNA, 1 pg of template and IX reaction buffer. The cycling profile involved 48C
reverse transcription for 45 minutes, 94C AMV reverse trasriptase inactivation and


37
RNA/cDNA/primer denaturation, 40 cycles of denaturation at 94C for 30 seconds,
annealing at 60C for 1 minute and extension at 68C for 2 minutes, followed by 1 cycle
of final extension at 68C for 7 minutes.
Aliquotes (6gl) of the PCR products were electrophoresed through 2% agrose gel
(Sigma Chemicals, St. Louis, MO). Gel star (FMC Bioproducts, Rockland, ME) was used
to locate the DNA bands.
Glvcosvl Composition Analysis bv GC/MS
Z. ramigera extracellular polymer was isolated as described on page 30. After
80% ethanol treatment, deionized water was used to wash ethanol from the extracellular
polymer. The extracellular polymer then dispersed into deionized water and
homogenized by blending for 1 min. GC-MS analysis of TMS methyl glycosides was
used to determine the glycosyl composition of Z. ramigera extracellular polymer. The
TMS methyl glycosides were prepared by methanolysis in methanolic 1M HC1 at 70C
for 16 hours, re-N-acetylated and trimethysilylated (Chaplin, 1986). A Shimadzu QP5000
GC-MS work station was used for GC-MS analysis by staffs at the University of Florida
Glycobiology Core Lab. During the experiment, external standards which consisted of
known molar concentration of inositol and each monosaccharide in the hydrolysate were
used. Calculations of each monosaccharide were based on response factors which was
the ratio of peak area for each monosaccharide to a molar of the monosaccharide relative
to that for inositol.


38
Zeta Potential Measurement
Z. ramigera 106 (ATCC 19544), Z ramigera 1-16 M (ATCC 19623), Duganella
zoogloeoides (ATCC 25935) were inoculated in YP medium and incubated at 28C until
log phase. The cultures were centrifuged, rinsed twice with deionized water. The bacteria
were resuspended in distilled water (pH 7.0) to a final concentration of 1.0 x 107 CFU/ml.
Distilled water was chosen to minimize any change shielding within the invalidation of
the assumed equality between the measured zeta potential and the surface potential. The
zeta potential measurements were carried out with the use of a Brookhaven Instruments
Zetaplus Model V3.21 zeta potential analizer (Holtsviller, NY) (Turesdail et al., 1998).
The Effect of Chlorine on Bacteria in Biofilm
Phenol was added to 100 ml raw sewage in 250-ml beakers daily to provide an
initial concentration of 50 pg/ml and incubated at room temperature for 4-5 days. When
there were many finger-like projection in the biofilm, different concentrations of chlorine
(Clorox Bleach) were added to the beakers for 15 min. Then a HACH test kit (Loveland,
Colorado) was used to evaluate free chlorine and total chlorine. The reaction was
stopped by adding sodium thiosulfate to a final concentration of 0.2%. INT (0.2 %)
(Sigma Chemicals, St. Louis, MO) was added to the beaker to a final concentration of
0.02% and incubated at room temperature in the dark for 30 minutes. Formaldehyde
(37%) was added to a final concentration of 0.37% to stop the reaction. The scum layers
of biofilms were mounted on clean slides. The slides were air dried and gently fixed by


39
heat. Next, 0.05 % malachite green was added to the slide and reacted for 1 min.
Deionized water was used to wash the slides. The slides were then observed under bright
field microscope (Bitton and Koopman, 1982; Dutton et al., 1983).
The Effect of Chlorine on Z. ramieera With or Without Extracellular Polymer
Z. ramigera 106 was inoculated in YP medium or low Mg'*, Ca" salt minimal
medium (5.0 g glycerol, 0.3 g (NH4)2S04, 0.8 g sodium lactate, 1.0 g KN03 0.05 g
K2HP04, 0.1 g CaCl2,0.1 g MgS04) and incubated at 28C until log phase. The cultures
were centrifuged at 2,000 rpm for 5 min. The pellet which contained mostly floes was
discarded. The supernatant was further centrifuged at 10,000 rpm for 10 min. The pellet
which contained both free cells and cells in floes was resuspended in deionized water.
Different concentrations of chlorine were added Into the suspension for 15 min. The
determination of chlorine concentration and the MINT test were performed as described
above.
Bacteriophage Assay
PRD1 is an icosahedral lipid phage characterized by a diameter of 62nm. The
isoelectric point of PRD 1 is between 3 to 4 in a calcium-phosphate buffer (1 O'4 M Ca)
(Pieper et al., 1997). It grows on Its host Salmonella typhimurium (ATCC 19585). MS2 is
an icosahedral phages with an average diameter of ~25nm and has isoelectric point of 3.9
(Lin et al., 1997). It grows on its host Escherichia coli C3000 (ATCC 15597). Both
viruses were assayed as plaque- forming unit method (Snustad and Dean, 1971).


40
Preparation of Aluminum Hydroxide Coated Sand
A U. S. Standard No. 25 sieve was used to collect sand particles of 600-700 pm
in diameter from 25 x 30 meshes Ottawa sands (Fisher Scientific, Springfield, NJ). The
graded sand was rinsed with deionized water until the supernatant was clear. The sand
was then air dried. The sand was placed in 1,0M of A1C13.6H20 (Fisher Scientific,
Springfield, NJ) solution for 30 minutes. The excess solution was drained off. Then the
sand was air-dried for 24 hours. The dried sand was then socked in 3.0M ammonium
hydroxide for 10 minutes to precipitate aluminum hydroxides on the sand. The sand was
air dried and then rinsed with deionized water vigorously to remove loose precipitate,
then air dried again.
Wastewater Exposure of the Coated Sands
Uncoated sand and a portion of coated sand without exposure to wastewater were
used as negative and positive controls, respectively. The coated sand was packed into
acrylic columns (3.2 cm I. D. x 1.5 m). Wastewater effluent from University of Florida
Water Reclamation Facility was used in this study. The typical compositions of
wastewater effluent were: 1.0 mg/1 total Kjeldahl nitrogen, 1.2 mg/1 orthophosphate, 1.8
mg/1 total phosphate, 0.7 NTU turbidity, 795 pmhos/cm conductivity, 8mg/l Mg2*, 73
mg/1 Ca2\ 1.2 mg/1 N03-N, 0.2 mg/1 NH3-N, 44 mg/1 CaC03 (alkalinity), pH 7.2. The
experiments were carried out at room temperature. Dechlorination of wastewater effluent
was done with sodium thiosulfate. Chlorinated wastewater effluent was obtained by
treating water with 10 mg/1 ammonia nitrogen followed by titration with sodium


41
hypochlorite (Clorox Professional Products, Oakland, CA) so that final combined
chlorine was 2 mg/1 chlorine. The upflow rate was 57 ml/min and thus the superficial
velocity was 1,2mm/s. The columns were back washed every 72 hours at a superficial
velocity of 17mm/s for 15 minutes to fluidize the sand. Before each sampling, the sand
was taken out from the columns and rinsed with filter-sterilized wastewater to remove
loosely attached biomass. Portions of the sand were used for a protein assay, zeta
potential measurements, and virus removal assay by batch and column experiments. The
rest of the sand was returned to the columns and the wastewater passing was continued.
Surface Characterization of the Sands
Protein assays were conducted by the modified Lowty method (Bensadoun and
Weinstein, 1976; Peterson, 1977) and the procedure which was described in the Sigma
Protein Assay Kit (Sigma Chemical). Briefly, 20 g of the sand samples were immersed in
8.0 ml of 10.0 N NaOH to extract the protein. The supernatant was assayed according to
the instruction in the protein assay kit. The zeta potentials of the sands were measured
with a streaming potential apparatus as described previously (Chen et al., 1998; Truesdail
et al., 1998).
Batch and Column Removal of Bacteriophages
Bacteriophage removals by batch tests were determined as follows: MS2 and
PRD1 were diluted in a filter-sterilized (0.2pm) milli-molar ionic strength artificial


42
groundwater (AGW) (1 L deionized water, 35 mg MgS04.7H20, 12 mg CaS04.2H20, 12
mg NaHC03,6 mg NaCl and 2 mg KN03) (McCaulou et al., 1994) to produce a final
concentration of 10s PFU/ml for each bacteriophage. Uncoated sand, aluminum
hydroxide coated sand without wastewater exposure, aluminum hydroxide coated sand
exposed to dechlorinated wastewater, and aluminum hydroxide coated sand exposed to
chlorinated wastewater were used for testing. Briefly, four grams of sand were added to
10 ml of bacteriophage suspension in polypropylene tubes (Fisher Scientific, Springfield,
NJ) and the mixtures were shaken for 30 min using a 70 cm diameter wheel which was
rotated vertically at 30 rev/min at room temperature. The bacteriophage suspension
without sand was also shaken in the wheel along with other samples as a control. All
sands were tested in triplicate.
Parallel column tests on days 0,90 and 110 were carried out as follows: Four
acrylic sand columns (1.5 cm I.D. x 1.0 m) were used in upflow mode. The four sand
columns were uncoated sands, aluminum hydroxide coated sands without exposure to
wastewater effluent, aluminum hydroxide coated sands exposed to chlorinated
wastewater, and aluminum hydroxide coated sand exposed to dechlorinated effluent. A
suspension containing 10s PFU/ml of each bacteriophage in AGW was passed through
the column at a rate of 20 ml/min. Effluents representing steady state conditions (71-75
pore volumes) were collected (Chen et al., 1998). Bacteriophage concentrations in
inffluent and effluent were analyzed by the plaque assay procedure.


All plaque assays for both batch and column experiments were conducted in
triplicates. Virus removal capacities of the sands were indicated in terms of percent
removal of MS2 or PRD1. Students t test, with a p value of 0.05 was used to define
statistical significance.


RESULTS
Morphology of Z. ramivera
Z. ramigera is a floc-forming bacteria and produces an extracellular polymer.
Previously, negative staining by India Ink indicated that cells are inside the extracellular
polymer in both finger-like projections and amorphous floes (Farrah. 1974). In this study,
scanning electron microscopy was used to reveal the detail structure of Z. ramigera
finger-like projections and amorphous floes. A section of a branching zoogloeal
projection is shown in Fig. 2B. The cells are organized in the finger. A higher
magnification view of a zoogloeal projection reveals the presence of fibrils running along
and between the cells (Fig. 2A). This fibril is likely the extracellular polymer produced
by Z. ramigera. The presence of cells within the zoogloeal extracellular polymer is
clearly shown in Fig. 2D. In the case of amorphous floes, cells usually embed inside an
excessive extracellular polymer (Fig. 2C).
Previous studies have shown that Z ramigera can utilize several aromatic
compounds and these can be used to enrich samples for finger-like zoogloeae (Unz and
Farrah, 1972; Williams and Unz, 1983). Examination of sand particles from a column
that had received raw sewage supplemented with 50 pg/ml of phenol revealed natural
finger-like projection structures that resembled those observed in laboratory cultures of
Z. ramigera 106 (Fig. 3). The structures are smaller in diameter than those observed in
44


45
laboratory cultures (Fig. 2B) but show cells in similar arrangements and with similar
fibrils. There were little finger-like projections observed in biofilm developed on the
surface of sands which had been passed through wastewater without a phenol supplement
(Chen et al, 1998). Therefore, the supplement with phenol is effective for production of
Z. ramigera enriched biofilm.
Isolation of Z ram jeer a from Natural Environments
Z ramigera is sensitive to penicillin, tetracycline, streptomycin and
cephalosporin. Trimethoprim-sulfamethoxazole (TMP-SMZ) are used for prevention of
opportunistic infection in human immunodeficiency-virus-infected person (Kaplan et al.,
1996) and for prevention of relapses in patient with Wegeners granulomatosis in
remission after respiratory tract infection (Stegeman et al., 1996). The minimal inhibition
concentrations (MIC) of trimethoprim and sulfadiazine for Z ramigera are higher than
1 pg/ml and greater then 10 pg/ml, respectively (Table 1). Since a m-toluic acid isolation
medium was used for isolation of Z ramigera from natural environments (Unz and
Farrah, 1972), m-toluic acid isolation medium and m-toluic acid isolation medium
combined with trimethoprim and sulfadiazine was used to isolate Z ramigera from
activated sludge, biofilm developed over raw sewage, and biofilm developed from Lake
Alice water, respectively. Clones resembled Z ramigera were picked up and further
purified and identified. Isolates which were Gram negative, urease positive, catalase
positive, oxidase positive, nitrate reduction, meta cleavage of catechol, indole negative


46
and no production of gas or acid from glucose were further identified by indirect
immunoassay methods. The isolation efficiency obtained was increased from 64% to
over 90% by using the combination media (Table 2). The combination media were
especially effective when Z. ramigera was not abundant in natural environments, such as
in Lake Alice water. No synergistic effect was observed between trimethoprim and
sulfadiazine.
Immunological Methods for Detection of Z, ramfera from Natural
Environments
Initial tests using a FITC-labeled secondary antibody showed that the antibody
against Z. ramigera 106 cells or the matrix only reacted with Z. ramigera 106 but not
with other laboratory cultures of the bacteria listed in the Materials and Methods section,
including Z. ramigera I-16-M or Duganella zoogleoides. Also, during the course of this
investigation, Z. ramigera 106 antisera were observed to react with the cells and the
extracellular polymer associated with natural finger-like projections but not with other
bacteria from natural samples.
A portion of a scum layer that developed over raw sewage enriched with 50
pg/ml of phenol and treated with the primary antibody against the extracellular polymer
from Z. ramigera 106 followed by FITC-labeled secondary antibody is shown in Fig. 4. A
finger-like zoogloeal projection observed using light microscopy and phase contrast
optics is shown in Fig. 4A. The same field observed with UV illumination is shown in
Fig. 4B. Only finger-like projections characteristic of Z. ramigera were observed to
fluoresce under UV light.


Fig. 2. SEM of Z ramigera 106 (ATCC 19544) which was grown in YP medium (2.5 g/1 yeast extract, 2.5g/l
peptone) for 48 hours at 28C.
's4


Fig 3. SEM of sand exposed to raw sewage supplemented with
phenol for 2 weeks


49
Table 1. The effect of antibiotics on Z. ramigera growth
Antibiotics (pg/ml)
trimethoprim 1
5
10
20
50
sulfadiazine 1
5
10
20
50
Z. ra/mgerg growth
Note: Z ramigera 106 (ATCC 19544) was inoculated in YP medium (2.5 g/1 yeast
extract, 2.5 g/1 peptone) supplemented with different concentrations of trimethoprim or
sulfadiazine and incubated at 28C.


Table 2. The effect of different media on the isolation of 2. ramigera from natural
environments
50
Media
No. of
samples
processed
No. of colonies
purified from
samnles
No. of Z.
ramigera
isolated
Yield
(%)
m-toluate
9
14
9
64
m-toluate + 1 pg/ml
trimethoprim
9
12
12
100
m-toluate + 10 pg/ml
sulfadiazine
9
11
10
91
m-toluate + 1 pg/ml
trimethoprim + 10 pg/ml
sulfadiazine
9
13
12
92
Total (m-toluate+
antibiotics)
27
36
34
94
Note: Bacteria from activated sludge, biofilms developed over raw sewage and lake
waters supplemented with phenol were streaked on m-toluic acid isolation medium as
well as the isolation medium combined with 1 pg/ml trimethoprim and/or 10 pg/ml
sulfadiazine. Biochemical tests were conducted to identify the isolates.


51
When the scum layers were examined in a similar manner but using primary
antibody against Z ramigera cells followed by FITC-labeled secondary antibody, cells
within typical zoogloeal projections fluorescenced while other cells did not. The results
were similar to previously published results (Farrah and Unz, 1975).
Observation of the scum layers from samples of raw sewage enriched with
phenol and treated with the primary antibody against the cells or extracellular polymer
from Z ramigera are shown in Fig. 5. These samples were then treated with biotin-
labeled secondary antibody, avidin-peroxidase and substrate AEC and examined using
light microscopy. Cells within zoogloeal projections (Fig. 5A) or extracellular polymer
surrounding zoogloeal projections (Fig. 5B) were stained dark red by this procedure and
are shown as the darker cells and projections in Fig. 5.
SEM images of the scum layers treated with the primary antibody against the Z
ramigera extracellular polymer, and gold-labeled secondary antibody are shown in Fig. 6.
The label is surrounding the zoogloeal projection in the samples which were examined
by using secondary electrons (Fig. 6A, Fig. 6C), and back scattered electrons (Fig. 6B,
Fig. 6D) which are produced by the gold particles attached to the secondary antibody. In
Fig. 6A and Fig. 6B, it appears that more antibodies had reacted with the end of
zoogloeal projection than with the main body of the projection.
The results obtained using similar procedures but with the primary antibody
against Z ramigera 106 cells are shown in Fig. 7. The associations of gold particles with


52
Z. ramigera cells but not with other bacterial cells are shown using images created with
secondary (Fig. 7A, Fig. 7C) and back scattered electrons (Fig. 7B, Fig. 7D). No reactions
were observed with any of the immunological procedures when unimmunized rabbit
serum was used.
RT-PCR
RT-PCR was also used to detect the presence of Z. ramigera in samples by using
the primers specific for Z ramigera 106 16S rRNA. The region between upstream
primer and downstream included the fragment complimentary to the 16S rRNA
oligonucleotide probe which was used for Z. ramigera detection previously (Rossello-
more et al., 1995). When 16S rRNA isolated from Z. ramigera 106 (ATCC 19544) was
used as a template for RT-PCR reaction, there was 619 bases DNA fragment produced
(Fig. 8, lane A). There was no corresponding PCR product when 16S rRNA isolated
from Duganella zoogloeoides or Z. ramigera 1-16-M was used in the RT-PCR
reaction (Fig. 8, Lane B, Lane C). However, there was the RT-PCR product (619 bases)
when 16S rRNA isolated from one of Z. ramigera isolates which was isolated from raw
sewage by m-toluic acid isolation medium combined with trimethoprim and
sulfadiazine (Fig 8, Lane D), or from biofilm developed over raw sewage supplemented
with phenol (Fig. 8, Lane E). Therefore, the RT-PCR procedure is sensitive for Z.
ramigera detection.


53
Fig. 4. Indirect immunofluorescence staining of biofilm that developed over raw
sewage supplemented with phenol. Samples were treated with rabit antiserum against Z
ramigera extracellular polymer with FITC-labeled goat anti-rabbit IgG.
A. phase contrast microscopy B. epifluorescein microscopy


54
Fig 5, Immunostaining of biofilm that developed over raw sewage supplemented
with phenol. Samples were treated with rabbit antiserum for Z. ramigera cells (A) or
extracellular polymer (B) followed by treatment with biotin-labeled goat anti-rabbit IgG,
peroxidase labeled avidin and substrate AEC.


A
Fig 7. Secondary (A,C) and back scattered (B, D) electron images of SEM photographs of biofilm developed over
raw sewage supplemented with phenol Samples were treated with rabbit antiserum for Z. ramigera cells followed by
treatment with gold-labeled goat anti-rabbit serum.


Fig 6. Secondary (A,C) and back scattered (B, D) electron images of SEM photographs of biofilm developed over raw
sewage supplemented with phenol Samples were treated with rabbit antiserum for Z ramigera extracellular polymer
followed by treatment with gold-labeled goat anti-rabbit serum.
Ln
o


Fig. 8. Electrophoresis of RT-PCR by using primers specific for Z ramigera
16S rRNA.
A. 16S rRNA ffomZ ramigera 106 (ATCC19544)
B. 16S rRNA from Z ramigera I-16-M (ATCC19623)
C. 16S rRNA from Duganella zoogloeoides (ATCC25935)
D. 16S rRNA from Z ramigera isolated from raw sewage
E. 16S rRNA from biofilm developed in raw sewage supplemented with
50 pg/ml phenol


58
Distribution of Z. ramieera in Wastewater Treatment Plants and in Lakes
Enrichment procedures showed that the finger-like zoogloeal projections which
were characteristic of Z. ramigera and reacted with Z. ramigera 106 antisera were
observed in scum layers that developed over samples from all stages of two sewage
treatment plants (Tables 3 and 4). The highest percentage of Z ramigera was found
associated with samples from the aeration tanks (mixed liquor suspended solids or the
supernatant fraction).
In the University of Florida Water Reclamation Facility, the MPN of Z. ramigera
increased from raw sewage to the mixed liquor suspension, then rapidly decreased from
mixed liquor suspension to unchlorinated effluent (Table 3). It was likely that Z
ramigera was settled with activated-sludge solids due to its floc-forming characteristic.
During chlorination, total bacteria rapidly decreased (from 1.10.6 x lOVml to 2.41.6 x
lOVml), while there is little change for the number of Z ramigera between
unchlorinated and chlorinated effluent. Thus, the percentage of Z. ramigera increased
after chlorination (Table 3). Therefore, Z. ramigera was more resistant to chlorine than
other bacteria in the water. Compared with the chlorinated effluent, the percentage of Z.
ramigera in Lake Alice was decreased while the total bacteria increased (Table 3). This
suggested that there were some nutrients available for bacteria prolification in Lake
Alice.
In the Kanapaha Water Reclamation Facility, the percentage of Z ramigera
decreased from mixed liquor suspension to primary and final aerobic digested sludge in


59
both liquid phase and solid phase (Table 4). Overall, Z. ramigera could be found in all
stages of wastewater treatment processes. The highest concentration of Z. ramigera was
found in the mixed liquor stage in both wastewater treatment plants (Table 3, Table 4).
According to the content of chlorophyll, a lake is classified as oligotrophic,
mesotrophic and eutrophic lake. Distribution of Z. ramigera in different types of lakes
was also investigated (Table 5). Z ramigera was found in all eutrophic (Lake Alice,
Lake Bivans Arm), and mesotrophic (Lake Alto, Lake Santa Fe) lakes tested. However,
Z ramigera was present in some of oligotrophic lakes (Lake Geneva, Lake Johnson),
but absent in Lake Sheelar which is also an oligotrophic lake. Low content of nutrients
such as total nitrogen and total phosphorous might be the reason for absence of Z
ramigera in Lake Sheelar.
Characterization of Z ramieera Extracellular Polymer
GC/MS analysis of an acid hydrolyzed Z ramigera extracellular polymer
identified the following components: 1.5% arabinose, 1.38% rhamnose, 0.43% xylose,
4.65% mannose, 0.36% galactose, 1.6% galacturonic acid, 2.7% glucose and 37.7%
galactosamine, and another unknown amino sugar (Table 6). This unknown amino sugar
is not glucosamine or mannosamine. Due to lack of other standard amino sugars, we
could not identify this amino sugar. Total identified sugar in the extracellular polymer
was 50%.


60
Previous work also found two types of aminosugars (glucosamine and possible
fucosamine) in Z. ramigera extracellular polymer. The ratio between glucosamine and
fucosamine was 1:1.5 to 1:2 (Farrah, 1974; Tezuka, 1973). According to this ratio,
fucosamine might be almost 50% since 37.7% galactosamine was found in this study. In
addition, it was reported that no protein or ether-soluble materials were detected after
acid hydrolysis of extracellular polymer (Farrah and Unz, 1976). Therefore, almost
100% of the Z. ramigera extracellular polymer is carbohydrate.
It was claimed previously that there was glucosamine in Z. ramigera
extracellular polymer by paper chromatography. Rgill<:OOT,illc values for galactosamine and
glucosamine are similar since galactosamine is a C4 epimer of glucosamine. Therefore,
it was hard to differentiate these two sugars by paper chromatography. However,
GC/MS analysis indicated the presence of glactosamine instead of glucosamine in the
extracellular polymer.
The presence of the extracellular polymer also influences overall surface charge
of the cells. Zeta potential has been used to evaluate overall surface charge of the cells
(Truesdail, et al., 1998). Most bacteria are negatively charged due to the predominance
of the anionic groups present on the cell surfaces (carboxyl, phosphate groups). At pH7,
overall surface charges of Z. ramigera 106 as well as Z. ramigera' I-16-M, Duganella
zoogloeoides, E. coli, S. typhimuriium, S. aureus, S.faecalis were negative (between-17
mv to -40 mv) (Table 7). Therefore, it was suggested that amino groups of aminosugars
in Z. ramigera extracellular polymer might be acetylated.


Table 3. The distribution of Z ramigera and total aerobic bacteria in the University of
Florida Water Reclamation Facility and in Lake Alice
61
Sources
Total Aerobic
Bacteria (MP N)
Zoogloea ramigera
(MPN1
Percent Zoogloea
Raw sewage
5.42.3 x lOVmL
1.10.3 x 104/mL
0.20
Mixed liquor
supernatant
7.12.0 x lO/mL
4.22.4 x lOVmL
5.9
Mixed liquor solids
1.31.2 x 10/g
2.01.6 x 107/g
1.5
Unchlorinated
effluent
l.l0.6x 103/mL
8.45.9 x 10'3/mL
7.6 x 10"4
Chlorinated
effluent
2.41.6 x lO'/mL
8.05.7 x 10'3/mL
3.3 x 10-2
Lake Alice
6.0 1.8 x lOVmL
3.60.0 x lO '/mL
6.0 x IQ3
Note: Dilutions of the samples supplemented with 50 pg/ml of phenol were incubated
at room temperature for up to 2 weeks. The scum layer that developed was examined
for the presence of bacteria within typical finger-like zoogloeae. The samples were also
examined using the immunological procedures described in the text to confirm the
presence of Z. ramigera.


Table 4. The distribution of Z. ramigera and total aerobic bacteria in the Kanapaha
Water Reclamation Facility
62
Sources
Total Aerobic
Bacteria
tMPNl
Zoogloea ramigera
(MPN)
Percent
Zoogloea
ramieera
Mixed liquor
supernatant
9.76.9 x lOVmL
5.03.3 x 107mL
0.52
First stage aerobic
digested sludge
supernatant
3.01.2 x 107mL
2.51.4x lOVmL
0.08
Second stage
aerobic digested
sludge
supernatant
3.01.2 x 107/mL
1.20.9 x 104/mL
0.04
Mixed liquor
solids
1.20.5 x 10/g
2.00.4 x 10s/g
0.17
First stage aerobic
digested sludge
solids
2.21.0x 108/g
1.80.4xl05/g
0.08
Second stage
aerobic digested
sludge solids
2.31.4x lO'/g
1.40.2 x 105/g
0.06
Note: Dilutions of the samples supplemented with 50 mg/L of phenol were incubated
at room temperature for up to 2 weeks. The scum layer that developed was examined
for the presence of bacteria within typical finger-like zoogloeae. The samples were also
examined using the immunological procedures described in the text to confirm the
presence of Z. ramigera.


Table 5. The distribution of Z. ramigera and total aerobic bacterial in different lakes
Classification
Lake
CHL*
Uff/h
TPb
(ue/Il
TNC
(ue/n
Total Aerobic
Bacteria (MPN/ml)
Z. ramigera
MPN/mfi
Percent Z.
ramfera
Oligotrophic
Sheelar
1.5
2.5
80.0
1.2 x 103
<0.0013
<1.1 x 10-4
Geneva
1.2
7.7
206.7
5.5 x 102
0.09
0.017
Johnson
3.0
13.0
230.0
4.8 x 103
0.5
0.009
Mesotrophic
Alto
9.3
11.7
430.0
2.2 x 103
0.2
0.011
Santa Fe
14.3
14.3
500.0
1.9 x 104
3.6
0.019
Eutrophic
Alice
15.8
327
633.3
6.0 x 103
0.4
0.006
Bivans Arm
49.7
118.3
1240.0
2.5 x 104
2.4
0.010
Note: Dilutions of the samples supplemented with 50 pg/ml of phenol were incubated at room temperature for up to 2
weeks. The scum layer that developed was examined for the presence of bacteria within typical finger-like zoogloeae. The
samples were also examined using the immunological procedures described in the text to confirm the presence of Z.
ramigera.
a. Total chlorophyll
b. Total phosphorus
c. Total nitrogen


64
Table 6. Composition of Z. ramigera extracellular polymer by GC/MS analysis
Arabinose
1.5
Rhamnose
1.38
Xylose
0.43
Mannose
4.65
Galactose
0.36
Galacturonic acid
1.6
Glucose
2.7
Galactosamine
37.73
Unknown sugar type Ia
?
Total known sugar
50.35
Note: Acid hydrolyzed extracellular polymer of Z. ramigera was re-N-acetylated and
trimethysilylated before GC/MS analysis.
a. Unknown Sugar type I is an amino sugar but not glucosamine or mannosamine


65
Table 7. Zeta potential of bacteria at pH 7
Bacteria Zeta potential (tmg
Z ramigera 106 (ATCC 19544)
-24.7 1.93
Z. ramigera' I-16-M (ATCC 19623)
-41.0 0.78
Duganella zoogloeoides (ATCC 25935)
-30.1 1.86
E. coll*
-36.5 2.00
S. lyphimurium
-17.0 1.00
S. aureus*
-36.0 1.00
S.faecalis
-38.5 1.50
Note: The zeta potential of stationary phase bacteria was determined using a Lazer
Zee zeta meter.
a. Data from Truesdail et al., 1998


66
The Effect of Chlorine on Bacteria in Biofilm as well as on Z. ramieera
In the MINT test, INT acts as a hydrogen-acceptor. Respiring bacteria will
accumulate water-insoluble red INT-formazan crystals through the action of bacterial
electron transport system activity. Counter staining with malachite green results in
viable bacteria with red color and inactive bacteria with green color. Since the Z.
ramigera finger-like projection structure is easily distinguished from other bacteria, the
bacteria within finger-like projection structures in biofilms were considered to be Z
ramigera. The measured values for total chlorine and free chlorine were similar since
sodium hypochlorite was used in this study. When a low chlorine concentration (1.0
mg/1) was used, about 80% of the bacteria within finger-like projections were still alive
but only 30% of the other bacteria in the biofilm were respiring. At a chlorine
concentration of 2.5 mg/1, 65% of the bacteria within finger-like projections were still
respiring while most of the other bacteria were inactive. Higher concentration of
chlorine (3.5 mg/1) killed all bacteria (Table 8, Fig 9). Therefore, bacteria within finger
like projections can resist higher concentration of chlorine better than other biofilm
bacteria.
In order to investigate the influence of the extracellular polymer on Z. ramigera
inactivation by chlorine, the survival of Z. ramigera cells with and without the
extracellular polymer were compared during chlorine treatment (Table 9, Fig 10). About
65% of Z. ramigera cells with the extracellular polymer were still alive after exposure
to 2.5 mg/1 chlorine treatments while less than 5% of Z. ramigera cells without the
extracellular polymer were still alive. Therefore, the Z. ramigera extracellular polymer
seemed to protect the cells from chlorine inactivation.


67
Table 8. Effect of chlorine on the respiring activity of bacteria in biofilias
Chlorine concentration
tmgZl)
% survival of Z. ramigera
% survival of other
0
99 1
99 1
1.0
80 5
30 2
2.5
65 8
<5
3.5
<5
0
Note: The biofilm that developed over raw sewage supplemented with phenol was
treated with indicated concentrations of chlorine for 15 min. The residual chlorine was
neutralized with sodium thiosulfate and the MINT test was then performed to detect
respiring bacteria.


68
Table 9. Influence of extracellular polymer on Z. ramigera inactivation by chlorine
Chlorine concentration
Cnut/b
% survival of cells with
. extracellular polymer
% survival of cells without
extracellular polymer
0
99 1
99 I
2.5
65 4
<5
3.0
<5
0
Note: Z. ramigera cells with and without visible extracellular polymer were treated with the
indicated concentrations of chlorine for 15 min. The residual chlorine was neutralized with
sodium thiosulfate and the MINT test was then performed to detect respiring bacteria.


Fig. 9. Effect of chlorine on respiratory activities of bacteria in biofilm
A. 0 mg/1 chlorine B. 1.0 mg/1 chlorine C. 2.5 mg/1 chlorine D. 3.5 mg/1 chlorine


70
Fig. 10. Influence of the extracellular polymer on Z ramigera inactivation by
A. 2.5 mg/1 chlorine B. 3.0 mg/1 chlorine


71
Effect of Wastewater on Virus Removal bv Aluminum Hydroxide Coated Sands
Characterization of Aluminum Hydroxide Coated Sand Exposed to Either Chlorinated
or Dechlorinated Wastewater
Coating by in situ precipitation of metallic hydroxides on particles increased the
concentration of metals associated with sand particles, their zeta potential and their
capacity for removal of microorganisms from water. After coating the Ottawa sands
with aluminum hydroxides, the zeta potential of the sand increased from -99mv to
+20mv at pH 7 (Table 10). Coating increased the aluminum content of the sand from
approximately 0.05 mg/g to 0.4 mg/g (Chen et al., 1998). The coated sands removed
99% of the MS2 and 90% of the PRD1 from water in batch tests (Fig.l 1 and Fig. 12).
The corresponding values for MS2 or PRD1 removal by untreated sand are within 20%.
The zeta potential of aluminum hydroxide coated sands dropped after 1 day
exposure to either chlorinated or dechlorinated wastewater (Table 10). At the initial two
weeks exposure, the zeta potential of the coated sand exposed to chlorinated wastewater
decreased in similar degree as that of the sand exposed to dechlorinated wastewater
(from +20mv to 60-80mv). However, after 2 months treatment, the zeta potential of the
coated sand exposed to chlorinated wastewater remained around -75mv while the zeta
potential of the coated exposed to dechlorinated wastewater was about -40mv (Table
10).
The amount of aluminum on the surface of the sand dropped from 0.4 mg/g to 0.3
mg/g after two weeks of wastewater exposure, then remained approximately constant
throughout the experiment (Chen et al., 1998). It was still about 6 fold higher than that


72
of the uncoated sand (0.005 mg/g). This drop might be due to attrition and/or leaching
effects. In addition, since the zeta potential of the sand with 0.4 mg/g aluminum coats
was +20mv, zeta potential of the sand with 0.3 mg/g aluminum coats was much less
likely about -70mv without other influences. Therefore, the decrease of zeta potential
after exposure of the coated sand to wastewater was not likely due to the loss of
aluminum content.
Protein assay (Table 11) and SEM (not shown) indicated that biofilm developed
on the surface of coated sand which was exposed to dechlorinated wastewater.
However, there was no significant biofilm development when chlorinated wastewater
was used. Therefore, the effect of biofilm on virus removal by aluminum hydroxide
coated sand could be determined by comparing the performance of the sand exposed to
dechlorinated wastewater effluent with that exposed to chlorinated wastewater effluent.
Since wastewater effluent used in this study was obtained only after activated
sludge and rapid sand filtration processes, there were many organic or inorganic
materials in the water. These materials are mostly negatively charged at pH 7 (Sobsey et
al., 1984). Evidently, these materials interacted with the aluminum hydroxide coated
sand during exposure to chlorinated or dechlorinated wastewater and caused the overall
surface charge of the sands decrease (Table 10). It was suggested that organic and
inorganic materials in the water blocked the positively charged sites on the sand so
that the zeta potential of the sands were drastically decreased (-70 mv) at the earlier
stages of the treatment. The amount of biofilm bacteria on the surface of the sand
exposed to dechlorinated wastewater was sufficient to maintain the zeta potential of the


73
sand around -40 mv after 2 months treatment (Table 10 and 11) because the zeta
potential of most bacteria are about -20 mv to -40 mv at pH 7 (Truesdail et al., 1998).
In summary, the surface properties of aluminum hydroxide coated sand
considerably changed after exposure to dechlorinated or chlorinated wastewater
effluent.
Batch Removal of MS2 and PRD1
The aluminum coated sand without wastewater exposure removed about 99.99%
MS2 and 90% PRD1. After 1 day exposure to either chlorinated or dechlorinated
wastewater, the coated sand were still able to remove about 99.9% MS2 and 65% PRD1
(Fig. 11, Fig. 12). The ability of the coated sand for removal of MS2 and PRD1 declined
by approximately two thirds after two weeks exposure. After 3 months of treatment,
MS2 and PRD1 removal by the sand were not statistically different from that by
uncoated sand (p>0.05). The performance of the coated sand exposed to dechlorinated
wastewater and the sand exposed to chlorinated wastewater were similar for both MS2
and PRD1 removal.
The isoelectric points for MS2 and PRD1 are both between 3 to 4. They were
negatively charged in artificial ground water. However, PRD1 is more hydrophobic than
MS2 due to the presence of lipid in its protein coat (Kinoshita et al., 1993). The
magnitude difference between MS2 (about 99.99%) and PRD1 (about 90%) removed by
the coated sand might due to the fact that MS2 is less hydrophobic that PRD1.


74
Column removal of MS2 and PRD1
In column experiments, the coated sand without wastewater exposure removed
99.9% MS2 and 95.85% PRD1 (Table 12). After long-term exposure of the coated sand
to either chlorinated or dechlorinated wastewater, the removal of MS2 and PRD1 was
significantly decreased (Table 12). Chlorinated or dechlorinated wastewater exposure
resulted in decrease of MS2 and PRD1 removal by the coated sand in similar degree.
MS2 and PRD1 rmoval by the coated sand exposed to wastewater for 3 months became
statistically similar to the removal by the uncoated sand (p>0.05). The column
experiments confirmed the detrimental effect of wastewater exposure for MS2 and
PRD1 removal by the coated sand.


75
Table 10. Zeta potential (mv) of the aluminum hydroxide coated sand after exposure
to wastewater
'Operation Days
Sands ~~
0
1
13
60
90
110
Al-coated sand exposed to
+20
-69
-84
-75.5
-79
-75
chlorinated wastewater
Al-coated sand exposed to
+20
-56.6
-76
-43
-40
-36
dechlorinated wastewater
Note: Sand was washed twice with deionized water. Then the zeta potential was
measured as previously described (Chen et al., 1998). The zeta potential of uncoated
sand is -99 mv.


Table 11. Protein content (mg/g sand) of the aluminum hydroxide coated sand after
exposure to wastewater
76
Operation Days
Sands ~
0
1
13
60
90
110
Al-coated sand exposed to
chlorinated wastewater
5.6
7.3
3.8
4.7
9.3
10.3
Al-coated sand exposed to
dechlorinated wastewater
5.6
8.3
12.0
57.4
111.0
118.5
Note: Sand was washed twice with deionized water and then mixed with ION NaOH to
extract protein. The sand was allowed to settle and the protein in the supernatant was
determined.


77
Table 12. MS2 and PRD1 removal by sand columns
Virus
Percent Removal by
Days
Uncoated
sand
Al-coated sand
exposed to
dechlorinated
wastewater
Al-coated sand
exposed to
chlorinated
. wastewater
MS2
0
40.4
99.9
99.9
90
39.1
51.1
63.1
110
25.23
33.1
33.3
PRD1
0
8.5
95.85
95.85
90
10.52
40.89
23.28
110
11.86
23.28
12.15
Note: Sand was packed into columns (1.5 cm I.D. x 1.0m). AGW seeded with MS2 and
PRD1 was passed through these columns in upflow mode. At steady state, the MS2 and
PRD1 in the column ¡fluent and effluent samples were assayed.


% remova
120
Al-coated sand exposed Al-coated sand exposed Al-coated sand
to dechlorinated to chlorinated wastewater
wastewater
Sands
ffl 1 day
13 days
60 days
m 90 days
110 days
controls
uncoated sand
Fig. 11. MS2 removal by batch experiment


% removal
100
Al-coated sand exposed to Al-coated sand exposed to Al-coated sand
dechlorinated wastewater chlorinated wastewater
Sands
B 1 day
B 90 days
0 110 days
controls
uncoated sand
Fig. 12. PRD1 removal by batch experiment


DISCUSSION
Z. ramigera was found in wastewater treatment plants and some lakes. It was
isolated from raw sewage, mixed liquor suspension and lake water by using m-toluic
acid isolation medium combined with trimethoprim or sulfadiazine, which were more
efficient than m-toluic acid isolation medium alone for isolation of Z ramigera from
natural environments.
Detection of Z. ramigera from natural environments is greatly simplified by
using antibodies specific for the neotype strain ofZ. ramigera 106 as the primary
antibody, and different conjugates of goat anti-rabbit IgG which are commercially
available as the secondary antibody. The cells and extracellular polymer of Z. ramigera
were visualized in several ways using immunological procedures. These include using:
A. FITC-labeled secondary antibody and fluorescence microscopy; B. biotin-conjugated
secondary antibody and light microscopy; and C. gold-labeled antibody and SEM. The
advantage of immunofluorescence procedures is that they are fairly easy to use.
However, autofluorescence may be a problem with some samples. The enzymatic
procedures are also fairly simple and can be done with a light microscope. Using gold-
labeled antibody and SEM permits observation at higher magnifications than with light
or fluorescence microscopy. Observations using backscatter electrons show where the
antibody is localized, since only heavy metals, such as the gold of the secondary
antibody, can cause back scatters.
80


81
Previously, the FITC-labeled 16S rRNA oligonucleotide probe against Z.
ramigera 106 could also be used to detect Z ramigera in natural samples, as was shown
in a previous study by Rossello-Mora et al.( 1995). However, a reduced content of
intracellular 16S rRNA in less active cells, and limited penetration of the probe may be
problem with this procedure. These potential problems could be overcome by using
immunological methods. Indirect immunoassay methods are also technically simpler
and more time saving than the detection method using the fluorescein-labeled 16S
rRNA oligonucleotide probe.
PCR/RT-PCR has been used as a sensitive method to detect bacteria or viruses
from environmental samples. By using the primers specific for Z. ramigera 106 16S
rRNA, RT-PCR was used as another alternative method for detection of Z. ramigera
from natural environments. There were negative reactions when 16S rRNA isolated
from Duganella zoogloeoides, or from Z. ramigera I-16-M was used as template for
RT-PCR reaction. However, the same length of DNA fragments (619 bases) was
produced when 16S rRNA isolated from Z. ramigera 106, Z. ramigera isolated from raw
sewage, or from biofilm developed over raw sewage supplemented with phenol was
used as template for RT-PCR. Therefore, the current procedure is reliable for Z.
ramigera detection.
Immunological methods detect both dead and viable microorganisms as long as
the presence of the antigen. Since rRNA is a dominant cellular macromolecule and
related to viability of the cells, RT-PCR by using rRNA as template can be used to


82
detect only viable microorganisms. Generally, reproducibility and reliability of RNA
extraction is important for reliable information obtained by RT-PCR, especially during
studies of microbial community in dirty environments (Muyzer and Ramsing, 1995).
Therefore, RT-PCR combined with the use of immunological methods is preferred for
detection and understanding of Z. ramigera in natural environments.
Because it has been observed in association with biological floes and biofilms in
wastewater treatment plants, Z. ramigera has been considered to be an important
microorganism in the wastewater treatment processes. However, studies on the number
of bacteria capable of forming finger-like zoogloeae showed that these bacteria were a
minor portion of the population of the samples from waste water (Williams and Unz,
1983). Higher numbers ofZ. ramigera were found in activated sludge floes by Rosello-
Mora et al. (1995). These workers found that 10% of the cells in floes from an aeration
basin from one plant reacted with an oligonucleotide probe specific for Z. ramigera 16S
rRNA.
In the current study, enrichment cultures using phenol were used to determine
the MPN of Z. ramigera in wastewater and environmental samples. The presence of Z.
ramigera was determined by observing the presence of typical finger-like projections.
These were confirmed using immunological procedures. In some cases, fluorescence
techniques revealed the presence of bacteria in typical zoogloeal projections that were
obscured by other bacteria when the samples were observed using phase contrast
microscopy. Using these procedures, the numbers of Z. ramigera in mixed liquor


83
suspended solids was closer to the value obtained using the FITC-labeied 16S rRNA
oligonucleotide probe (Rossello-mora et a!., 1995) than to the values obtained using
microscopic examination of fingered zoogloeae (Williams and Unz, 1983).
The use of enrichment cultures and immunological procedures to enumerate Z
ramigera was meant to demonstrate their potential for studying the distribution of Z
ramigera in wastewater and environmental samples. Too few samples were taken for
the numbers to be considered definitive. However, the numbers do show some
interesting trends. It appears that Z. ramigera is more numerous in mixed liquor
suspended solids. They are relatively fewer in raw sewage and in solids undergoing
aerobic digestion. Besides wastewater treatment plants, Z ramigera was also found in
eutrophic, mesotrophic and some oligotrophic lakes. However, Z ramigera was not
found in one lake studied with very low total nitrogen content (Lake Sheelar, Table 5).
SEM observations of gold-coated Z ramigera 106 indicated the presence of
fibrils within and on the surface of the zoogloeal projections. It is likely that these fibrils
provide the structure for the observed zoogloeal projections. Similar structures were
found on the sand from the column that had sewage with phenol passed through it.
Structures resembling zoogloeae were also observed in the blofilm from a denitrifying
filter by Sich and Rijn (1997). Since natural zoogloeal finger-like projections reacted
with antibodies against Z ramigera 106 cells or extracellular polymer, the natural
zoogloeae were also antigenically similar to laboratory culture.The antigenic similarity
between natural finger-like projection and the laboratory culture suggests that the


84
material surrounding natural finger-like projections are chemically similar to that
surrounding Z. ramigera 106. This extracellular material was previously shown to be a
mucopolysaccharide associated with flocculation (Farrah and Unz, 1976; Tezuka, 1973;
Unz and Farrah, 1976b) and could be recovered from laboratory cultures of Z ramigera
and from mixed liquor suspended solids.
Unlike some extracellular polymer-producing bacteria whose clones on nutrient
agar plate are mucoid or butyrous, Z ramigera clones on the agar plate are gelatinous,
dry and hard. It was found that zoogloeal projections can even resist protozoan attack in
activated sludge floes (Farrah, 1974). Previous knowledge and current information
obtained by GC/MS analysis of the extracellular polymer produced by Z. ramigera
indicated that the predominance of carbohydrate, especially amino sugars. Generally, a
bacterial extracellular polymer not only provides a major source of biomass as an
alternation energy source, but also provides structural rigidity and a defensive barrier to
invading pathogens. It was observed that the finger-like projection structure of Z.
ramigera can even resist protozoan attack in activated sludge floes (Farrah, 1974).
It was found that bacterial cells in biofilm are usually more resistant to
environmental stress and antibacterial agents than planktonic cells ( Marshall et al.,
1989; Ophir and Gutnick, 1994; Brown et al., 1995). In the case of chlorination of
biofilm bacteria, it was suggested transport of chlorine to biofilm bacteria surface might
be an important rate-limiting step (LeChevallier et al., 1988 a,b; Huang et al., 1995).
Free chlorine is known to react with a wide variety of compounds, including


85
polysaccharide. Therefore, besides providing a physical barrier reducing the ability of
chlorine to approach the cell membrane, free chlorine might be consumed by reaction
with extracellular polymer before it can fully penetrate the biofilm surface
(LeChevallier et al., 1988 a,b). In this study, it was found that Z. ramigera extracellular
polymer had protected the cells from chlorine inactivation. Z ramigera extracellular
polymer might either prevent the direct contact of chlorine with the cells or react with
chlorine.
Biofilm development on the filter media enhances removal of bacteria and fine
particles from water (Schuler et al., 1991; Banks and Bryers, 1992; Drury et al., 1993;
Rittmann and Wirtel, 1991; Sprouse and Rittmann 1990). In this study, the loss in zeta
potential appeared to be more important than biofilm development on the surface of the
aluminum coated sand after long term exposure to dechlorinated wastewater. Therefore,
virus removal by the sand was greatly reduced after wastewater exposure. As with
biofilm development, organic and inorganic materials in wastewater also blocked
favorable sites for virus removal. Thus, the coated sand exposed to chlorinated
wastewater also reduced virus removal.
The results of this study can be summarized as follows:
1. Isolation media for the recovery of Z ramigera from natural environments can
be improved by adding the antibiotics trimethoprim and sulfadiazine.
2. SEM analysis of finger-like projections of laboratory cultures ofZ ramigera
shows the presence of fibrils running along the length of the zoogloeal projections.


86
3. Immunological assays showed that both the cells and extracellular polymer of
natural finger-like projections are antigenically similar to those of Z. ramigera 106.
4. The major components of the extracellular polymer surrounding Z. ramigera
are galactosamine and another unidentified amino sugar.
5. The extracellular polymer protects Z. ramigera cells from inactivation by
chlorine.
6. Z. ramigera can be found in all stages of wastewater treatment, but are present
in the highest percentage in muted liquor samples. Z. ramigera can also be found in
eutrophic, mesotrophic and some of oligotrophic lakes, but not in the lake with low
nitrogen content.
7. Exposure of modified sand to wastewater decreases its ability to adsorb
viruses in water.
8. Part of the biofilm that develops on sand exposed to wastewater containing
phenol have structures that resemble finger-like projections of Z. ramigera.


APPENDIX
SEQUENCE OF Z. RAMIGERA (ATCC 19544) 16S RRNA
ORIGIN
1 agagt t tga tnn tggct cagattgaacgctggcggcatgc 11 tacacatgcaag tcgaac
61 gg taacagggagc ttgc tccgc tgacgag tggcgaacgggt gagtaatgcatcggaacgt
121 gccg tg taa tggggga taacg tagcgaaag ttacgctaataccgca tacgccctgagggg
181 gaaag tgggggaccgcaaggcc tcacg t tataceaecggccga tgtcggat taectaett
241 gg tggggtaaaggcc taccaaggcgacga tccg tagcgggt ctgagaggatgatccgcca
->P1
301 cac tgggac tgagacacggcccagac tcctacgggaggcagcagt ggggaatt ttggaca
361 at gggggcaaccc tga tccagccatgccgcg tgagtgaacaaggcct tcgggt tgtaaag
421 ctct t tcagg tggaaagaaa tcgcatc tt ttaatacaggg tg tgga tgacgg tacca tea
481 gaagaagcaccggctaac tacg tgccagcagccgcggtaatacg taggg tgcgagcg tta
541 a teggaa ttac tgggcgtaaagcg tgcgcaggcggt tatg taagacaga tgtgaaa tccc
601 eggge tcaacctgggaactgcgt t tgtgac tgcataactagagtacggcagagggaggtg
661 gaa ttccgcg tg tageag tgaaatgcgtagagatgcggaggaacaccgatggcgaaggca
721 gcctcc tgggccag tactgacgctca tgcacgaaagcg tggggagcaaacaggat tagat
781 accc tgg tag t ccacgccct aaacgatgtcaactagt tgt tegg tgaggagac tcattga
P2 <-gatcaacaagccac tee tc tgagtaa
841 g taacgcagc taacgcgtgaagt tgaccgcctggggag tacggccgcaaggt taaaactc
901 aaaggaat tgacggggacccgcacaagcggt ggatgatg tggat taat tcgatgcaacgc
961 gaaaaacct tace taccct tgacatgccaggaact tgccagaga tggct tgg tgcccgaa
1021 agggaacc tggacacaggtgc tgea tggctg tegteage tegtg tcgtgagatgt tgggt
1081 taag t cccgcaacgagcgcaaccct tgteat tagt tgccagcat taagt tgggcac tc ta
1141 a tgagac tgeegg tgacaaaccggaggaaggtggggatgacgtcaagtcctca tggccct
1201 tatgggtagggct tcacacg tea tacaa tgg tcggtacagagggt tgccaagccgcgagg
1261 tggagccaa tcccagaaagccga tegtag teeggat tggagtc tgcaac tcgactcca tg
1321 aag teggaa tege tagtaa tcgcaga teageatge tgegg tgaatacg ttcccgggtctt
1381 gtacacaccgcccg tcacaccatgggag tggggt t taccagaagt aggtaget taacct t
1441 cgggagggcgct taccacggtgagct tcatgac tgggg tgaag tcgtaacaaggtagccg
1501 tatcggaaggtgcggctggatcacctcctt
//
Note: the bold letters indicate the sequence complementary to 16S rRNA
oligonucleotide probe used previously. Underlined letters indicate the primers used in
RT-PCR reaction.
87


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E7NQY2LFU_LSSUIX INGEST_TIME 2013-03-05T20:13:56Z PACKAGE AA00013520_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


LO
n 00
i W
,L% 5
8W



PAGE 1

&+$5$&7(5,=$7,21 2) =22*,2($ 5$0,*(5$ ,1 %,2),/06 %\ )XKXD /X $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*0(176 ZRXOG OLNH WR H[SUHVV P\ VLQFHUH DSSUHFLDWLRQ WR FKDLUPDQ RI P\ VXSHUYLVRU\ FRPPLWWHH 'U 6 5 )DUUDK IRU KLV VXSSRUW JXLGDQFH DQG FRPPLWPHQW WKURXJK WKH FRXUVH RI WKLV UHVHDUFK 0\ JUDWLWXGH LV DOVR GXH WR 'U 7 6KDQPXJDP 'U % / .RRSPDQ 'U ( + +RIIPDQ DQG 'U $ & :LONLH IRU WKHLU JXLGDQFH DQG FRXQVHO ZKLOH VHUYLQJ RQ WKH DGYLVRU\ FRPPLWWHH 7KDQNV DUH H[WHQGHG WR 'U &KULV :HVW DQG 'U &KDVH\ 5HQW] IRU KHOSLQJ PH FRQGXFW *&06 DQDO\VLV 0U 6FRWW :KLWWDNHU DQG 0V .DUHQ 9DXJKQ RI WKH 8QLYHUVLW\ RI )ORULGD ,&%5 &RUH /DERUDWRU\ IRU WKHLU DVVLVWDQW LQ SUHSDUDWLRQ DQG H[DPLQDWLRQ RI 6(0 VDPSOHV DQG 0V 6DQG\ )LVKHU RI 8QLYHUVLW\ RI )ORULGD /DNH :DWFK IRU SURYLGLQJ LQIRUPDWLRQ RQ ODNHV 6SHFLDO WKDQNV WR DOO FROOHDJXHV LQ 'U )DUUDKfV ODE -HU]\ /XNDVLN +DLWDR =KRX 0LNH %XPH -U 7UR\ 6FRWW DQG &KHU\O %RLFH IRU WKHLU IULHQGVKLS DQG HQFRXUDJHPHQW ZRXOG OLNH WR H[WHQG P\ WKDQNV WR (QJLQHHULQJ 5HVHDUFK &HQWHU (5&f SURIHVVRUV DQG FROOHDJXHV IRU WKHLU VXSSRUW DQG SDUWLFLSDWLRQ GXULQJ WKH FRXUVH RI WKLV UHVHDUFK DOVR ZRXOG OLNH WR WKDQN 6FRWW 0 %XQWLQ IRU KLV HQFRXUDJHPHQW )LQDOO\ ZLVK WR H[SUHVV VLQFHUH JUDWLWXGH WR P\ IDWKHU P\ PRWKHU P\ EURWKHU DQG P\ VLVWHU IRU WKHLU XQFRQGLWLRQDO ORYH XQGHUVWDQGLQJ DQG SDWLHQFH

PAGE 3

7$%/( 2) &217(176 SDJH $&.12:/('*0(176 LL /,676 2) ),*85(6 Y /,67 2) 7$%/(6 YLL /,67 2) $%%5(9,$7,216 YLLL $%675$&7 [ ,1752'8&7,21 =RRJORHD UDPLJHUD :DVWHZDWHU 7UHDWPHQW = UDPLJHUD ([WUDFHOOXODU 3RO\PHU %LRILOPV &KORULQH 'LVLQIHFWLRQ )LOWUDWLRQ 3URFHVV LQ :DVWHZDWHU 7UHDWPHQW 2EMHFWLYHV /,7(5$785( 5(9,(: =RRJORHD UDPLJHUD 2YHUYLHZ RI :DVWHZDWHU 7UHDWPHQW 3URFHVV 7KH )XQFWLRQ RI = UDPLJHUD LQ $FWLYDWHG 6OXGJH 7KH )XQFWLRQ RI = UDPLJHUD 'XULQJ %LRILOP )RUPDWLRQ %LRILOP 5HDFWRUV 5HYHUVH 7UDQVFULSWLRQ3RO\PHUDVH &KDLQ 5HDFWLRQ573&5f )RU 0LFURRUJDQLVP 'HWHFWLRQ 0$7(5,$/6 $1' 0(7+2'6 %DFWHULDO 6WUDLQV = UDPLJHUD (QULFKHG %LRILOP 'HYHORSPHQW &ROXPQ 6WXGLHV LLL

PAGE 4

6FDQQLQJ (OHFWURQ 0LFURVFRS\ 6(0f (IIHFW RI $QWLELRWLFV RQ = UDPLJHUD *URZWK ,VRODWLRQ RI = UDPLJHUD IURP 1DWXUDO (QYLURQPHQWV ,VRODWLRQ RI = UDPLJHUD ([WUDFHOOXODU 3RO\PHU 3RO\FORQDO $QWLERGLHV 3URGXFWLRQ ,QGLUHFW ,PPXQRIOXRUHVFHQFH 6WDLQLQJ (Q]\PH ,PPXQRVWDLQLQJ ,PPXQRDVVD\ E\ 6FDQQLQJ (OHFWURQ 0LFURVFRS\ 6(0f 'HWHUPLQDWLRQ RI 0RVW 3UREDEOH 1XPEHU 031f RI = UDPLJHUD LQ :DVWHZDWHU 7UHDWPHQW 3ODQWV DQG /DNH :DWHU 573&5 *O\FRV\O &RPSRVLWLRQ $QDO\VLV E\ *&06 =HWD 3RWHQWLDO 0HDVXUHPHQW 7KH (IIHFW RI &KORULQH RQ %DFWHULD LQ %LRILOP 7KH (IIHFW RI &KORULQH RQ = UDPLJHUD :LWK RU :LWKRXW ([WUDFHOOXODU 3RO\PHU %DFWHULRSKDJH $VVD\ 3UHSDUDWLRQ RI $OXPLQXP +\GUR[LGH &RDWHG 6DQG :DVWHZDWHU ([SRVXUH RI WKH &RDWHG 6DQG 6XUIDFH &KDUDFWHUL]DWLRQ RI WKH VDQGV %DWFK DQG &ROXPQ 5HPRYDO RI %DFWHULRSKDJHV 5(68/76 0RUSKRORJ\ RI = UDPLJHUD ,VRODWLRQ RI = UDPLJHUD IURP 1DWXUDO (QYLURQPHQWV ,PPXQRORJLFDO 0HWKRGV IRU 'HWHFWLRQ RI = UDPLJHUD IURP 1DWXUDO (QYLURQPHQWV 573&5 'LVWULEXWLRQ RI = UDPLJHUD LQ :DVWHZDWHU 7UHDWPHQW 3ODQWV DQG LQ /DNHV &KDUDFWHUL]DWLRQ RI = UDPLJHUD ([WUDFHOOXODU 3RO\PHU 7KH (IIHFW RI &KORULQH RQ %DFWHULD LQ %LRILOP DV ZHOO DV RQ = UDPLJHUD (IIHFW RI :DVWHZDWHU RQ 9LUXV 5HPRYDO E\ $OXPLQXP +\GUR[LGH &RDWHG 6DQGV ',6&866,21 $33(1',; 6(48(1&( 2) =22*/2($ 5$0,*(5$ 6 551$ 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ LY

PAGE 5

/,676 2) ),*85(6 )LJXUH 3DJH &RQYHQWLRQDO ZDVWHZDWHU WUHDWPHQW SURFHVV 6(0 RI = UDPLJHUD $7&& f ZKLFK ZDV JURZQ LQ <3 PHGLXP JO \HDVW H[WUDFW JO SHSWRQHf IRU KRXUV DW r& 6(0 RI VDQG H[SRVHG WR UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO IRU ZHHNV ,QGLUHFW LPPXQRIOXRUHVFHQFH VWDLQLQJ RI ELRILOP WKDW GHYHORSHG RYHU UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO ,PPXQRVWDLQLQJ RI ELRILOP WKDW GHYHORSHG RYHU UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO 6HFRQGDU\ $ &f DQG EDFN VFDWWHUHG % 'f HOHFWURQ LPDJHV RI 6(0 SKRWRJUDSKV RI ELRILOP WKDW GHYHORSHG RYHU UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO 6DPSOHV ZHUH WUHDWHG ZLWK UDEELW DQWLVHUXP IRU = UDPLJHUD H[WUDFHOOXODU SRO\PHU IROORZHG E\ WUHDWPHQW ZLWK JROG ODEHOHG JRDW DQWLUDEELW VHUXP 6HFRQGDU\ $ &f DQG EDFN VFDWWHUHG % 'f HOHFWURQ LPDJHV RI 6(0 SKRWRJUDSKV RI ELRILOP GHYHORSHG RYHU UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO 6DPSOHV ZHUH WUHDWHG ZLWK UDEELW DQWLVHUXP IRU = UDPLJHUD FHOOV IROORZHG E\ WUHDWPHQW ZLWK JROGODEHOHG JRDW DQWLUDEELW VHUXP (OHFWURSKRUHVLV RI 573&5 E\ XVLQJ SULPHUV VSHFLILF IRU = UDPLJHUD 6 U51$ (IIHFW RI FKORULQH RQ UHVSLUDWRU\ DFWLYLWLHV RI EDFWHULD LQ ELRILOP ,QIOXHQFH RI H[WUDFHOOXODU SRO\PHU RQ = UDPLJHUD LQDFWLYDWLRQ E\ FKORULQH Y

PAGE 6

06 UHPRYDO E\ EDWFK H[SHULPHQW 35' UHPRYDO E\ EDWFK H[SHULPHQW

PAGE 7

/,67 2) 7$%/(6 7DEOH 3DJH 7KH HIIHFW RI DQWLELRWLFV RQ = UDPLJHUD JURZWK 7KH HIIHFW RI GLIIHUHQW PHGLD RQ WKH LVRODWLRQ RI = UDPLJHUD IURP QDWXUDO HQYLURQPHQWV 7KH GLVWULEXWLRQ RI = UDPLJHUD DQG WRWDO DHURELF EDFWHULD LQ WKH 8QLYHUVLW\ RI )ORULGD :DWHU 5HFODPDWLRQ )DFLOLW\ DQG LQ /DNH $OLFH 7KH GLVWULEXWLRQ RI = UDPLJHUD DQG WRWDO DHURELF EDFWHULD LQ WKH .DQDSDKD :DWHU 5HFODPDWLRQ )DFLOLW\ 7KH GLVWULEXWLRQ RI = UDPLJHUD DQG WRWDO DHURELF EDFWHULD LQ GLIIHUHQW ODNHV &RPSRVLWLRQ RI = UDPLJHUD H[WUDFHOOXODU SRO\PHU E\ *&06 DQDO\VLV =HWD SRWHQWLDO RI EDFWHULD DW S+ (IIHFW RI FKORULQH RQ UHVSLULQJ DFWLYLW\ RI EDFWHULD LQ ELRILOPV ,QIOXHQFH RI H[WUDFHOOXODU SRO\PHU RQ = UDPLJHUD LQDFWLYDWLRQ E\ FKORULQH =HWD SRWHQWLDO PYf RI WKH DOXPLQXP K\GUR[LGH FRDWHG VDQG DIWHU H[SRVXUH WR ZDVWHZDWHU 3URWHLQ FRQWHQW PJJ VDQGf RI WKH DOXPLQXP K\GUR[LGH FRDWHG VDQG DIWHU H[SRVXUH WR ZDVWHZDWHU 06 DQG 35' UHPRYDO E\ VDQG FROXPQV YLL

PAGE 8

/,67 2) $%%5(9,$7,216 $(& $PLQRHWK\O FDUER]ROH $+/ $FHW\ODWHG KRPRVHULQH ODFWRQHV %2' %LRORJLFDO R[\JHQ GHPDQG %6$ %RYLQH VHUXP DOEXPLQ &7$% &HW\OWULPHWK\ODPPRQLXP EURPLGH '$%&2 GLD]DELF\FOR f RFWDQH '(3& 'LHWK\O S\URFDUERQDWH '1DVH 'HR[\ULERQXFOHDVH ('7$ (WK\OHQHGLDPLQHWHWUDDFHWLF DFLG ),7& )OXRUHVFHLQ LVRWKLRF\DQDWH *&06 *DV FKURPDWRJUDSK\ PDVV VSHFWURPHWU\ +0'6 +H[DPHWK\OGLVLOL]DQH 0,& 0LQLPDO LQKLELWRU\ FRQFHQWUDWLRQ 0,17 0DODFKLWH JUHHQ SLRGRSKHQ\OfS QLWURSKHQ\OfSKHQ\O WHWUD]ROLXP FKORULGH 031 0RVW SUREDEOH QXPEHU 3)$ 3DUDIRUPDOGHK\GH YLLL

PAGE 9

3%6 3KRVSKDWH EXIIHUHG VDOLQH 51DVH 5LERQXFOHDVH U51$ 5LERVRPDO 51$ 573&5 5HYHUVH WUDQVFULSWDVHSRO\PHUDVH FKDLQ UHDFWLRQ 6(0 6FDQQLQJ HOHFWURQ PLFURVFRS\ 7%6 7ULV EXIIHUHG VDOLQH 706 7HWUDPHWK\OVLODQH 7ULV 7ULVK\GUR[\PHWK\OfDPLQRPHWKDQH 89 8OWUDYLROHW <3
PAGE 10

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ &)/$5$&7(5,=$7,21 2) =22*/2($ 5$0,*(5$ )1 %,2),/06 %\ )XKXD /X 'HFHPEHU &KDLUPDQ 'U 6DPXHO 5 )DUUDK 0DMRU 'HSDUWPHQW 0LFURELRORJ\ DQG &HOO 6FLHQFH =RRJORHD UDPLJHUD LV DQ H[WUDFHOOXODU SRO\PHUSURGXFLQJ EDFWHULXP DQG IRUPV IORHV ZKLFK LQFOXGH W\SLFDO ILQJHUOLNH SURMHFWLRQV DQG DPRUSKRXV IORHV 6FDQQLQJ HOHFWURQ PLFURVFRS\ 6(0f LQGLFDWHG WKDW FHOOV XVHG WKH H[WUDFHOOXODU SRO\PHU DV DWWDFKPHQW VLWHV DQG ZHUH HPEHGGHG ZLWKLQ WKH H[WUDFHOOXODU SRO\PHU )LQJHUOLNH SURMHFWLRQV ZKLFK ZHUH VLPLODU WR WKRVH IURP ODERUDWRU\ FXOWXUHV RI = UDPLJHUD ZHUH DOVR IRXQG RQ WKH VXUIDFH RI VDQG ZKLFK KDG UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO SDVVHG WKURXJK WKHP = UDPLJHUD ZDV LVRODWHG IURP UDZ VHZDJH PL[HG OLTXRU VXVSHQGHG VROLGV DQG ODNH ZDWHU 7KH HIILFLHQF\ RI = UDPLJHUD LVRODWLRQ ZDV JUHDWO\ LQFUHDVHG E\ XVLQJ PWROXLF DFLG LVRODWLRQ PHGLXP FRPELQHG ZLWK SJPO WULPHWKRSULP DQGRU SJPO VXOIDGLD]LQH ,QGLUHFW LPPXQRDVVD\ PHWKRGV IRU WKH GHWHFWLRQ RI = UDPLJHUD ZHUH GHYHORSHG XVLQJ SRO\FORQDO DQWLERGLHV DJDLQVW WKH FHOOV RU WKH LVRODWHG H[WUDFHOOXODU SRO\PHU RI WKH [

PAGE 11

QHRW\SH = UDPLJHUD VWUDLQ $7&& f 7KH XVH RI JRDW DQWLUDEELW ,J* FRQMXJDWHG ZLWK ),7& RU ELRWLQ RU FROORLGDO JROG DV WKH VHFRQGDU\ DQWLERG\ DOORZHG GHWHFWLRQ RI = UDPLJHUD LQ HQYLURQPHQWDO VDPSOHV 7KHVH PHWKRGV ZHUH DOVR XVHG DV SDUW RI D PRVW SUREDEOH QXPEHU 031f SURFHGXUH WR TXDQWLWDWH = UDPLJHUD DW GLIIHUHQW VWDJHV RI WKH ZDVWHZDWHU WUHDWPHQW SURFHVVHV DV ZHOO DV LQ GLIIHUHQW ODNHV ,W ZDV IRXQG WKDW WKH FHOOV DQG WKH H[WUDFHOOXODU SRO\PHU RI QDWXUDOO\ RFFXUULQJ ]RRJORHDO SURMHFWLRQV DUH DQWLJHQLFDOO\ DQG VWUXFWXUDOO\ UHODWHG WR WKRVH RI = UDPLJHUD = UDPLJHUD FRXOG EH IRXQG LQ DOO VWDJHV RI ZDVWHZDWHU WUHDWPHQW SURFHVVHV HXWURSKLF ODNHV PHVRWURSKLF ODNHV DQG VRPH ROLJRWURSKLF ODNHV 7KH KLJKHVW FRQFHQWUDWLRQ RI = UDPLJHUD ZDV IRXQG LQ WKH PL[HG OLTXRU VWDJH RI WKH WZR ZDVWHZDWHU WUHDWPHQW SODQWV LQ *DLQHVYLOOH )ORULGD %\ XVLQJ EDFWHULDO 6 U51$ DV WHPSODWH DQG WKH SULPHUV VSHFLILF IRU = UDPLJHUD 6 U51$ 573&5 ZDV DOVR XVHG WR LGHQWLI\ = UDPLJHUD LQ ELRILOPV IURP QDWXUDO HQYLURQPHQWV =HWD SRWHQWLDO PHDVXUHPHQW LQGLFDWHG WKDW RYHUDOO VXUIDFH FKDUJH RI = UDPLJHUD ZDV QHJDWLYH *DV FKURPDWRJUDSK\PDVV VSHFWURPHWU\ *&06f DQDO\VLV LQGLFDWHG WKH SUHGRPLQDQFH RI FDUERK\GUDWH HVSHFLDOO\ DPLQR VXJDUV LQ WKH H[WUDFHOOXODU SRO\PHU SURGXFHG E\ = UDPLJHUD 7KH XVH RI 0,17 WHVW IROORZLQJ WUHDWPHQW RI FKORULQH LQGLFDWHG WKDW WKH H[WUDFHOOXODU SRO\PHU SURWHFWHG = UDPLJHUD FHOOV IURP FKORULQH LQDFWLYDWLRQ 7KLV LV WUXH IRU = UDPLJHUD LQ ERWK ELRILOPV IURP QDWXUDO HQYLURQPHQWV DQG ODERUDWRU\ FXOWXUHV %LRILOPV DQG RWKHU RUJDQLF DQG LQRUJDQLF PDWHULDOV LQ ZDVWHZDWHU EORFNHG SRVLWLYHO\ FKDUJHG VLWHV RQ WKH VXUIDFH RI DOXPLQXP K\GUR[LGHV FRDWHG VDQG 7KLV ORVV RI [L

PAGE 12

HOHFWURSRVLWLYH FKDUJH FKDUDFWHU ZDV IRXQG WR FRUUHVSRQG WR WKH GHFUHDVH LQ UHPRYDO HIILFLHQF\ RI WKH WZR EDFWHULRSKDJHV ZKLFK IXUWKHU VXSSRUWV WKH LPSRUWDQFH RI HOHFWURVWDWLF IRUFHV LQ YLUXVVDQG LQWHUDFWLRQ

PAGE 13

,1752'8&7,21 =RRSORHD UDPLHHUD )LQJHUOLNH ]RRJORHDO SURMHFWLRQV ZHUH REVHUYHG DPRQJ GHFD\LQJ DOJDH DQG WKH EDFWHULD ZLWKLQ WKH SURMHFWLRQV ZHUH QDPHG =RRJORHD UDPLJHUD E\ ,W]LJVRKQ f 6LQFH WKHQ ILQJHUOLNH ]RRJORHDO SURMHFWLRQV KDYH EHHQ REVHUYHG LQ WULFNOLQJ ILOWHU VOLPH OD\HUV DQG LQ DVVRFLDWLRQ ZLWK VROLGV IRUPHG GXULQJ DHURELF WUHDWPHQW RI ZDVWHZDWHU %LWWRQ %XWWHUILHOG )DUUDK DQG 8Q] 5RVVHOORPRUD HW DO 8Q] DQG 'RQGHUR D 8Q] DQG )DUUDK Df ,Q VRPH FDVHV EDFWHULD DVVRFLDWHG ZLWK WKHVH VDPSOHV ZHUH LVRODWHG DQG VWXGLHG LQ SXUH FXOWXUH %XWWHUILHOG 8Q] DQG 'RQGHUR DEf 6LQFH WKH WHUP ILQJHUOLNH SURMHFWLRQ ZDV VXEMHFWHG WR GLIIHUHQW LQWHUSUHWDWLRQV EDFWHULD ZLWK GLIIHUHQW PRUSKRORJLFDO DQG FKHPLFDO FKDUDFWHULVWLFV ZHUH FRQVLGHUHG WR EH = UDPLJHUD %XWWHUILHOG &UDEWUHH HW DO )ULHGPDQ HW DO 8Q] 8Q] DQG 'RQGHUR Ef 6WXGLHV E\ FRPSDULQJ 6 U51$ VHTXHQFH DQG FKHPRWD[RQRPLF SURSHUWLHV KDYH VKRZQ WKDW = UDPLJHUD $7&& f LV UHODWHG WR WKH EDFWHULD ZLWKLQ QDWXUDO ]RRJORHDO SURMHFWLRQV EXW QRW WR WKH RWKHU EDFWHULD WKDW ZHUH SUHYLRXVO\ WHUPHG = UDPLJHUD 5RVVHOORPRUD HW DO 6KLQ HW DO f 5HFHQWO\ RQH RI WKH SUHYLRXVO\ PLVFODVVLILHG =RRJORHD VSHFLHV ZDV UHFODVVLILHG DV 'XJDQHOOD ]RRJORHRLGHV +LUDLVKL HW DO f

PAGE 14

,W KDV EHHQ GLIILFXOW WR LVRODWH = UDPLJHUD IURP QDWXUDO HQYLURQPHQWV 'LIIHUHQW LVRODWLRQ SURFHGXUHV KDYH EHHQ WULHG VXFK DV GLVSHUVLRQ GLOXWLRQ PHWKRG %XWWHUILHOG f DQG PLFUR PDQLSXODWLRQ PHWKRG 8Q] DQG 'RQGHUR Df (IIHFW RI GLIIHUHQW PHGLD RQ LVRODWLRQ ZDV DOVR LQYHVWLJDWHG 'XJDQ DQG /XQGJUHQ f 6LQFH = UDPLJHUD JURZV VORZO\ RIWHQ UHVXOWLQJ LQ RYHUJURZWK E\ RWKHU PLFURRUJDQLVPV FRQYHQWLRQDO EDFWHULDO LVRODWLRQ WHFKQLTXHV ZHUH QRW YHU\ HIIHFWLYH IRU UDSLG LVRODWLRQ XQWLO DURPDWLF FRPSRXQGV VXFK DV EHQ]RDWH PWROXLF DFLG SKHQRO DQG FUHVRO ZHUH LQFRUSRUDWHG LQWR EDVDO PHGLD DV D FDUERQ VRXUFH 8Q] DQG )DUUDK f :DVWHZDWHU 7UHDWPHQW 6LQFH WKH SURSHU VHWWOLQJ RI VROLGV SURGXFHG GXULQJ DHURELF ZDVWHZDWHU WUHDWPHQW LV LPSRUWDQW WR SURGXFH FOHDU HIIOXHQWV PDQ\ UHVHDUFKHUV KDYH VWXGLHG WKH PLFURRUJDQLVPV WKDW DIIHFW WKLV SURFHVV 7KLV VHWWOLQJ UHTXLUHV D SURSHU EDODQFH RI IORF IRUPLQJ EDFWHULD DQG ILODPHQWRXV EDFWHULD %LWWRQ 1R]DZD HW DO f ,I WKH QXPEHUV RU DFWLYLWLHV RI WKH IORFIRUPLQJ EDFWHULD DUH UHGXFHG VOXGJH EXONLQJ PD\ RFFXU DQG WXUELG UDWKHU WKDQ FOHDU HIIOXHQWV ZLOO EH SURGXFHG %HFDXVH RI LWV REVHUYHG DVVRFLDWLRQ ZLWK VOXGJH IORHV = UDPLJHUD KDV EHHQ UHJDUGHG DV DQ LPSRUWDQW EDFWHULXP LQ WKH DFWLYDWHG VOXGJH WUHDWPHQW SURFHVV %LWWRQ f ,Q RQH VWXG\ WKH DELOLW\ WR VHWWOH EXONLQJ VOXGJH ZDV UHVWRUHG E\ VHHGLQJ WKH VOXGJH ZLWK = UDPLJHUD DQG RWKHU EDFWHULD 1R]DZD HW DO f 6LPLODUO\ LQ WULFNOLQJ ILOWHUV WKH VOLPH OD\HU WKDW GHYHORSV RQ WKH VXSSRUW PHGLD LV FRQVLGHUHG WR EH YHU\ LPSRUWDQW IRU WKH FRORQL]DWLRQ RI EDFWHULD %LWWRQ f 7KLV

PAGE 15

VOLPH OD\HU LV DQ H[WHQVLYH SRO\VDFFKDULGH PDWUL[ WKDW LV JHQHUDOO\ UHIHUUHG WR DV WKH JO\FRFDO\[ 7KLV JO\FRFDO\[ DQFKRUV WKH EDFWHULD DQG KHOSV LQ WKH UHPRYDO RI FRPSOH[ RUJDQLF DQG LQRUJDQLF PDWHULDOV IURP ZDVWHZDWHU %LWWRQ f = UDPLJHUD KDV EHHQ LVRODWHG IURP ILQJHUOLNH SURMHFWLRQV REWDLQHG IURP WULFNOLQJ ILOWHU VOLPHV DQG LV WKRXJKW WR EH DQ HVVHQWLDO SOD\HU LQ WKH ILOWUDWLRQ SURFHVV %XWWHUILHOG 8Q] DQG 'RQGHUR Df $OWKRXJK = UDPLJHUD KDV EHHQ WKRXJKW WR EH LPSRUWDQW LQ ZDVWHZDWHU WUHDWPHQW WKHUH LV OLWWOH LQIRUPDWLRQ RQ WKH GLVWULEXWLRQ DQG FRQFHQWUDWLRQ RI WKLV RUJDQLVP LQ ZDVWHZDWHU WUHDWPHQW SURFHVVHV 6HYHUDO SURFHGXUHV IRU WKH GHWHFWLRQ RI = UDPLJHUD LQ QDWXUDO VDPSOHV KDYH EHHQ HVWDEOLVKHG DQG XVHG WR VWXG\ = UDPLJHUD LQ ZDVWHZDWHU VDPSOHV LQFOXGLQJ XVLQJ IOXRUHVFHLQFRQMXJDWHG DQWLERG\ DJDLQVW = UDPLJHUD FHOOV DQG IOXRUHVFHLQODEHOHG 6 U51$ ROLRJRQXFOHRWLGH SUREH 5RVVHOORPRUD HW DO )DUUDK DQG 8Q] f :LOOLDPV DQG 8Q] f XVHG HQULFKPHQW SURFHGXUHV WR VXSSRUW WKH GHYHORSPHQW RI ILQJHUOLNH =RRJORHD 7KHVH DXWKRUV IRXQG WKDW EDFWHULD FDSDEOH RI SURGXFLQJ ILQJHU OLNH =RRJORHD ZHUH OHVV WKDQ b RI WKH WRWDO PLFURELDO SRSXODWLRQ LQ PL[HG OLTXRU VROLGV +RZHYHU 5RVVHOOR0RUD HW DOf IRXQG WKDW XS WR b RI WKH EDFWHULD ZLWKLQ DFWLYDWHG VOXGJH IORHV UHDFWHG WR WKH IOXRUHVFHLQODEHOHG ROLJRQXFOHRWLGH SUREH FRPSOHPHQWDU\ WR WKH 6 U51$ RI= UDPLJHUD $7&& f 8Q] DQG )DUUDKDf VKRZHG WKDW ILQJHUOLNH ]RRJORHDH ZHUH QRW XVXDOO\ REVHUYHG LQ PL[HG OLTXRU VXVSHQGHG VROLGV EXW FRXOG GHYHORS IURP WKH IORHV XQGHU WKH SURSHU LQFXEDWLRQ FRQGLWLRQV

PAGE 16

= UDPIHUD ([WUDFHOOXODU 3RO\PHU ([WHQVLYH VWXGLHV KDYH FKDUDFWHUL]HG WKH = UDPLJHUD H[WUDFHOOXODU SRO\PHU ,W ZDV LQGLFDWHG WKDW QR SURWHLQ RU HWKHUVROXEOH PDWHULDO ZDV GHWHFWHG DQG DPLQR VXJDUV DUH WKH SULQFLSDO FRQVWLWXHQW DIWHU DFLG K\GURO\VLV RI H[WUDFHOOXODU SRO\PHU )DUUDK DQG 8Q] f 6HSDUDWLRQ RI K\GURO\]HG H[WUDFHOOXODU SRO\PHU RI= UDPLJHUD LVRODWHG IURP DFWLYDWHG VOXGJH E\ SDSHU DQG LRQH[FKDQJH FKURPDWRJUDSK\ VXJJHVWHG WKDW DPLQR VXJDUV PLJKW EH JOXFRVDPLQH DQG IXFRVDPLQH DQG WKH UDWLR RI WKH WZR DPLQR VXJDUV ZDV EHWZHHQ WR 7H]XND f $PLQR VXJDUV KDYH DOVR EHHQ IRXQG LQ DQ H[WUDFHOOXODU SRO\PHU SURGXFHG E\ RWKHU EDFWHULD ,Q 6WUHSWRFRFFXV SQHXPRQLDH WKH H[WUDFHOOXODU SRO\PHU FRQWDLQV D WHWUDVDFFKDULGH UHSHDWLQJ XQLW WKUHH GLIIHUHQW DPLQR VXJDUV 1DFHW\O'PDQQRVDPLQH 1DFHW\O/IXFRVDPLQH DQG 1DFHW\O'JDODFWRVDPLQH DUH VHTXHQWLDOO\ OLQNHG WR D 'JDODFWRS\UDQRV\O UHVLGXH FDUU\LQJ D OLQNHG S\UXYDWH NHWDO -DQVVRQ HW DO f %LRILOPV 6XUIDFHV H[SRVHG WR D YDULHW\ RI W\SHV RI ZDWHU DUH IRXQG WR GHYHORS ELRILOPV RI PLFURRUJDQLVPV %LRILOP EDFWHULD OLYH LQ D FRPSOH[ PLFURELDO FRPPXQLW\ WKDW KDV SULPLWLYH KRPHRVWDVLV D SULPLWLYH FLUFXODWRU\ V\VWHP DQG PHWDEROLF FRRSHUDWLYLW\ VR WKDW HDFK RI WKHVH VHVVLOH FHOOV UHDFWV WR VSHFLDO HQYLURQPHQW IXQGDPHQWDOO\ GLIIHUHQW IURP SODQNWRQLF FRXQWHUSDUWV &RVWHUWRQ HW DO .ROWHU DQG /RVLFN f %LRILOP PLFURRUJDQLVPV DUH XVXDOO\ PRUH UHVLVWDQW WR HQYLURQPHQWDO VWUHVV DQG DQWLPLFURELDO DJHQWV WKDQ SODQNWRQLF FRXQWHUSDUWV

PAGE 17

%HVLGHV WKH GLIIHUHQFH EHWZHHQ ELRILOP PLFURRUJDQLVPV DQG SODQNWRQLF PLFURRUJDQLVPV WKH SUHFLVH PDQQHU E\ ZKLFK H[WUDFHOOXODU SRO\PHU SURWHFWV WKH FHOOV LV XQFOHDU EXW WKH SUHVHQFH RI ERXQG H[WUDFHOOXODU HQ]\PHV VXFK DV 3ODFWDPDVH ZLWKLQ WKH 3VHXGRPRQDV DHUXJLQRVD JO\FRFDO\[ PD\ UHLQIRUFH LWV DFWLRQ DV D GLIIXVLRQ EDUULHU %ROLVWHU HW DO f ZLWK UHVSHFW WR VRPH DQWLELRWLFV DQG LWV PROHFXODU VHYHULQJ SURSHUWLHV DUH HQKDQFHG WKURXJK ELQGLQJ RI GLYDOHQW FDWLRQV VXFK DV FDOFLXP IURP WKH HQYLURQPHQW +R\OH HW DO f ,W KDV DOVR EHHQ SURSRVHG WKDW WKH JO\FRFDO\[ SURYLGHV LQWULQVLF SURWHFWLYH HIIHFWV DJDLQVW DQWLPLFURELDO DJHQWV ZKLFK DUH DGGLWLRQDO WR WKRVH DVVRFLDWHG ZLWK LWV GLIIXVLRQ DQG FKDUJHUHODWHG SURSHUWLHV +RGJHV DQG *RUGRQ f )RU H[DPSOH 3VHXGRPRQDV DHUXJLQRVD SRYLGRQHLRGLQH UHVLVWDQFH VHHPV WR EH GXH WR WKH SURWHFWLYH OD\HULQJ RI FHOOV ZLWKLQ WKH JO\FRFDO\[ ZKLFK LQFUHDVH WKH WLPH UHTXLUHG IRU LRGLQH WR FRQWDFW FHOOV LQ WKH GHHSHVW OD\HUV RI WKH ELRILOP %URZQ HW DO f 7KH SURSHUWLHV RI ELRILOPV KDYH EHHQ FRQVLGHUHG LQ GHYHORSLQJ PHWKRGV WR FRQWURO PLFURELDO ELRILOP JURZWK :RRG HW DO f &KORULQH 'LVLQIHFWLRQ ,Q ZDVWHZDWHU WUHDWPHQW SURFHVVHV FKORULQH LV D FRPPRQO\ XVHG GLVLQIHFWDQW WR LQDFWLYDWH EDFWHULD DQG YLUXVHV %LWWRQ f 7KH PHFKDQLVPV RI FKORULQH LQDFWLYDWLRQ ZHUH H[WHQVLYHO\ LQYHVWLJDWHG %LWWRQ DQG .RRSPDQ &RVWHUWRQ HW DO 'H %HHU HW DO 'XWWRQ HW DO +HUVRQ HW DO +XDQJ HW DO /H&KHYDOOLHU HW DO DE /H&KHYDOOLHU HW DO f VR WKDW VWUDWHJLHV FRXOG EH GHYHORSHG WR HIIHFWLYHO\ FRQWURO ZDWHU TXDOLW\ DQG SUHYHQW ZDWHUERUQH GLVHDVH RXWEUHDNV

PAGE 18

%HVLGHV FKORULQH ZDV DOVR XVHG WR FRQWURO VOXGJH EXONLQJ ZKLFK UHVXOWV IURP D SUHGRPLQDQFH RI ILODPHQWRXV EDFWHULD DQG DEVHQFH RI IORH IRUPLQJ EDFWHULD GXULQJ DFWLYDWHG VOXGJH SURFHVV %LWWRQ DQG .RRSPDQ f ,W ZDV QRWLFHG WKDW EDFWHULD DWWDFKHG WR VXUIDFHV %URZQ HW DO 'H %HHU HW DO f RU H[WUDFHOOXODU SRO\VDFFKDULGHFRDWHG EDFWHULD %ROLVWHU HW DO f ZHUH PRUH UHVLVWDQW WR DQWLEDFWHULDO DJHQWV LQFOXGLQJ FKORULQHf WKDQ ZHUH WKHLU SODQNWRQLF FRXQWHUSDUWV ,W ZDV VXJJHVWHG WKDW WKH UHDVRQ IRU UHGXFHG HIILFDF\ RI FKORULQH DJDLQVW ELRILOP EDFWHULD DV FRPSDUHG ZLWK LWV DFWLRQ DJDLQVW SODQNWRQLF FHOOV PLJKW EH WKH OLPLWHG SHQHWUDWLRQ RI FKORULQH LQWR WKH ELRILOP PDWUL[ 'H %HHU HW DO +HUVRQ HW DO +XDQJ HW DO /H&KHYDOOLHU HW DO DE /H&KHYDOOLHU HW DO f )LOWUDWLRQ 3URFHVV LQ :DVWHZDWHU 7UHDWPHQW )LOWUDWLRQ SURFHVVHV DUH XVHG LQ ERWK ZDWHU DQG ZDVWHZDWHU WUHDWPHQW ,Q ZDVWHZDWHU WUHDWPHQW SURFHVV WULFNOLQJ ILOWHUV DUH XVHG LQ DHURELF WUHDWPHQW RI ZDVWHZDWHU 7KHVH ILOWHUV FRQVLVW RI LQDQLPDWH PDWHULDOV VXFK DV URFNV :DVWHZDWHU LV SDVVHG RYHU WKHVH ILOWHUV WR DOORZ ELRILOP GHYHORSHG RQ WKH VXUIDFH RI WKH ILOWHU WKXV WR UHGXFH WKH OHYHO RI RUJDQLF FRQWDPLQDQWV LQ ZDVWHZDWHU 7KLV ILOWUDWLRQ SURFHVV KDV EHHQ XVHG WR UHPRYH SDWKRJHQLF EDFWHULD DQG YLUXV IURP ZDWHU DQG ZDVWHZDWHU ,W ZDV LQGLFDWHG WKDW ELRILOP GHYHORSPHQW RQ ILOWHU PHGLD HQKDQFHG SK\VLFDO HQWUDSPHQW RI EDFWHULD DQG EDFWHULDVL]HG ILQH SDUWLFOHV IURP ZDWHU %DQNV DQG %U\HUV 'UXU\ HW DO 5LWWPDQQ DQG :LUWHO 6SURXVH DQG 5LWWPDQQ 6FKXOHU HW DO f

PAGE 19

6DQG ILOWHUV DUH DOVR XVHG LQ ZDWHU DQG ZDVWHZDWHU WUHDWPHQW ,W KDV EHHQ VKRZQ WKDW VXUIDFH PRGLILFDWLRQ RI ILOWHU PHGLD ZLWK YDULRXV PHWDO R[LGHV SHUR[LGHV RU K\GUR[LGHV DOVR LQFUHDVHG WKH PLFURRUJDQLVP UHPRYDO HIILFLHQF\ E\ FKDQJLQJ WKH VXUIDFH FKDUJH RI WKH PHGLD IURP HOHFWURQHJDWLYH WR HOHFWURSRVLWLYH WKXV GHFUHDVLQJ WKH HOHFWURVWDWLF UHSXOVLRQ EHWZHHQ WKH SDUWLFOHV DQG WKH DGVRUELQJ VROLG /XNDVLN HW DO 7UXHVGDLO HW DO f 2EMHFWLYHV 7KH REMHFWLYHV RI WKLV VWXG\ ZHUH f WR VWXG\ WKH VWUXFWXUH RI QDWXUDO DQG ODERUDWRU\ ILQJHUOLNH SURMHFWLRQV f WR LPSURYH WKH = UDPLJHUD LVRODWLRQ PHWKRG f WR GHYHORS = UDPLJHUD GHWHFWLRQ PHWKRGV E\ XVLQJ LPPXQRORJLFDO DQG PROHFXODU SURFHGXUHV f WR XVH WKHVH SURFHGXUHV WR HVWLPDWH WKH QXPEHU RI = UDPLJHUD LQ ZDVWHZDWHU DW GLIIHUHQW VWDJHV RI WUHDWPHQW DQG LQ ODNH ZDWHU f WR FKDUDFWHUL]H WKH H[WUDFHOOXODU SRO\PHU RI = UDPLJHUD DQG LWV LQIOXHQFH RQ FKORULQH LQDFWLYDWLRQ DQG f WR HYDOXDWH WKH HIIHFW RI ELRILOP DQG RWKHU RUJDQLF DQG LQRUJDQLF PDWHULDOV LQ ZDVWHZDWHU RQ YLUXV UHPRYDO E\ DOXPLQXP K\GUR[LGH FRDWHG VDQG

PAGE 20

/,7(5$785( 5(9,(: =RRHORHD UDPIHUD = UDPLJHUD LV DQ H[WUDFHOOXODU SRO\PHU SURGXFLQJ EDFWHULXP WKDW IRUPV W\SLFDO ILQJHUOLNH SURMHFWLRQV DQG LV IRXQG DPRQJ GHFD\LQJ DOJDH LQ ZDVWHZDWHU DQG LQ RWKHU RUJDQLFDOO\ HQULFKHG HQYLURQPHQWV 7KH EDFWHULD ZLWKLQ WKH ILQJHUOLNH ]RRJORHDO SURMHFWLRQV ZHUH QDPHG =RRJORHD UDPLJHUD E\ ,W]LJVRKQ f = UDPLJHUD LV D JUDP QHJDWLYH DHURELF FKHPRRUJDQRWURSKLF EDFWHULXP ,W DOVR JURZV DQDHURELFDOO\ LQ WKH SUHVHQFH RI QLWUDWH QLWUDWH UHVSLUDWLRQf DQG GHQLWULILFDWLRQ RFFXUV ZLWK IRUPDWLRQ RI 1] 0DMRU FDUERQ VRXUFHV LQFOXGH ODFWDWH JOXWDPDWH DOFRKRO EHQ]RQDWH DQG PWROXDWH %HQ]HQH GHULYDWLYHV DUH XVHG E\ PHWD FOHDYDJH +ROW HW DO f 1HLWKHU DFLG QRU JDV LV SURGXFHG IURP FDUERK\GUDWHV %XWWHUILHOG +HXNHOHNLDQ DQG /LWWPDQ 8Q] DQG 'RQGHUR Ef ,W PLJKW EH WKDW WKH EDFWHULXP HLWKHU GRHV QRW DWWDFN WKH FDUERK\GUDWHV WR SURGXFH DFLG E\SURGXFWV IURP WKHP RU SURGXFHV DONDOLQH PDWHULDOV IURP WKH SURWHLQV ZKLFK QHXWUDOL]H WKH DFLGV SURGXFHG RU IXUWKHU PHWDEROL]HV WKH DFLGV DV UDSLGO\ DV WKH\ DUH IRUPHG +HXNHOHNLDQ DQG /LWWPDQ f 2SWLPXP WHPSHUDWXUH DQG S+ IRU JURZWK DUH QHDU r& DQG S+ UHVSHFWLYHO\ 8Q] DQG 'RQGHUR Ef 7KH H[WUDFHOOXODU SRO\PHU SURGXFHG E\ = UDPLJHUD DWWDFKHV WR LWV FHOO ZDOOV DQG GRHV QRW PDNH EURWK YLVFRXV GXULQJ WKH V\QWKHVLV SKDVH 7KLV SURSHUW\ DOORZV KLJK R[\JHQ WUDQVIHU UDWHV WR EH PDLQWDLQHG GXULQJ WKH KLJK R[\JHQ GHPDQG SHULRG )XUWKHUPRUH YHU\ ORZ

PAGE 21

R[\JHQ FRQVXPSWLRQ ZDV REVHUYHG GXULQJ WKH SHULRG RI SRO\VDFFKDULGH UHOHDVH ZKHQ WKH R[\JHQ WUDQVIHU UDWH FDQ QRW EH UDLVHG ZLWKRXW YHU\ KLJK HQHUJ\ LQSXW 1RUEHUJ DQG (QIRUV f 7KH H[WUDFHOOXODU SRO\PHU SURGXFWLRQ LV DOVR LQIOXHQFHG E\ WKH FDUERQ DQG QLWURJHQ VRXUFHV 8Q] DQG )DUUDK Ef = UDPLJHUD ZDV RULJLQDOO\ REVHUYHG DPRQJ GHFD\LQJ DOJDH ,W]LJVRKRQ f /DWHU WKH UHFRJQLWLRQ RI WKH SRVVLEOH LPSRUWDQFH RI = UDPLJHUD LQ DFWLYDWHG VOXGJH DQG WULFNOLQJ ILOWHU KDYH OHG WR H[WHQVLYH VWXGLHV RI = UDPLJHUD &UDEWUHH HW DO f 7KH GLVSHUVLRQ GLOXWLRQ PHWKRG %XWWHUILHOG f PLFUR PDQLSXODWLRQ 8Q] DQG 'RQGHUR Df DQG WKH XVH RI LVRODWLRQ PHGLD FRQWDLQLQJ DURPDWLF FRPSRXQGV 8Q] DQG )DUUDK f ZHUH XVHG WR LVRODWH = UDPLJHUD IURP QDWXUDO HQYLURQPHQWV VXFK DV DFWLYDWHG VOXGJH DQG WULFNOLQJ ILOWHU VOLPH 7KH HIIHFWV RI GLIIHUHQW PHGLD RQ LVRODWLRQ ZHUH DOVR LQYHVWLJDWHG 'XJDQ DQG /XQGJUHQ f %LRFKHPLFDO WHVWV RI = UDPLJHUD DOORZHG FRQYHQLHQW LGHQWLILFDWLRQ RI = UDPLJHUD IURP QDWXUDO HQYLURQPHQWV 8Q] f ,W ZDV IRXQG WKDW = UDPLJHUD LVRODWHG IURP DFWLYDWHG VOXGJH DQG WULFNOLQJ ILOWHU IXQFWLRQV VLPLODUO\ :DWWLH f )OXRUHVFHQFH PLFURVFRS\ )DUUDK DQG 8Q] f DQG VFDQQLQJ HOHFWURQ PLFURVFRS\ 6(0f 6LFK DQG 9DQ 5LMQ f ZHUH XVHG WR REVHUYH WKH SUHVHQFH RI = UDPLJHUD LQ QDWXUDO HQYLURQPHQWV ,Q RUGHU WR XQGHUVWDQG WKH PHFKDQLVP RI = UDPLJHUD IXQFWLRQ LQ DFWLYDWHG VOXGJH DQG WULFNOLQJ ILOWHU VWUXFWXUH DQG FRPSRVLWLRQ RI H[WUDFHOOXODU SRO\PHU VXUURXQGLQJ = UDPLJHUD KDYH DOVR EHHQ LQYHVWLJDWHG &UDEWUHH HW DO )ULHGPDQ HW DO +RUDQ DQG (FFOHV 1RUEHUJ DQG (QIRUV 3DUVRQV DQG 'XJDQ 8Q] DQG )DUUDK Ef

PAGE 22

%DVHG RQ WKH SK\VLRORJ\ DQG ELRFKHPLFDO SURSHUWLHV RI = UDPLJHUD +HXOHOHNLDQ DQG /LWWPDQ 0F.LQQH\ DQG +DUZRRG 8Q] DQG 'RQGHUR E .UXO f HIIRUWV ZHUH PDGH WR HVWDEOLVK LWV LGHQWLILFDWLRQ FULWHULRQ DQG JHQHULF VWDWXV =YLUEXOLV DQG +DWW &UDEWUHH DQG 0F&R\ 0XQLFK 6NHUPDQ HW DO 5RVVHOORPRUD HW DO 6KLQ HW DO f ,W ZDV ILUVW UHTXHVWHG WKDW $7&& VWUDLQ ,0f VKRXOG EH DFFHSWHG DV WKH QHRW\SH VWUDLQ LQ &UDEWUHH DQG 0F&R\ f ,Q $7&& VWUDLQ f ZDV VXJJHVWHG DV WKH QHRW\SH VWUDLQ EHFDXVH ,0 GLG QRW IRUP W\SLFDO ILQJHUOLNH SURMHFWLRQ 8Q] f DQG QR H[WUDFHOOXODU PDWHULDO ZDV REVHUYDEOH DURXQG ,0 )ULHGPDQ HW DO f +RZHYHU EDVHG RQ WKH REVHUYDWLRQ RI IORH IRUPDWLRQ GXULQJ JURZWK WKUHH SK\ORJHQHWLFDOO\ GLVWDQWO\ UHODWHG VWUDLQV $7&& 7 VWUDLQ f 7 W\SH VWUDLQf $7&& VWUDLQ f DQG $7&& VWUDLQ ,0f ZHUH LQFOXGHG LQ WKH VDPH VSHFLHV 7KURXJK FKHPRWD[RQRPLF VWXG\ PDLQO\ SRO\DPLQH DQG TXLQRQH FRPSRVLWLRQf DQG FRPSDUDWLYH DQDO\VHV RI 6 U51$ SULPDU\ VWUXFWXUH LW KDV EHHQ VXJJHVWHG WKDW RQO\ LVRODWHV WKDW FOHDUO\ UHVHPEOH QHRW\SH VWUDLQ $7&& 7 SKHQRW\SLFDOO\ VKRXOG EH FRQVLGHUHG JHQXLQH PHPEHUV RI = UDPLJHUD 5RVVHOORPRUD HW DO f ,Q IDFW 6 U51$ VHTXHQFH FRPSDULVRQV DQG GLVWDQFH PDWUL[ WUHH DQDO\VLV UHYHDOHG WKDW = UDPLJHUD IRUPV D OLQHDJH ZLWK 5KRGRF\FOXV SXUSXUHXV LQ WKH EHWD VXEFODVV RISURWHREDFWHULD $7&& ZDV VKRZQ WR EHORQJ WR WKH EHWD VXEFODVV RI WKH FODVV 3URWHREDFWHULD ZLWK PHPEHUV RI WKH JHQXV 7HOOXULD DV LWV FORVHVW UHODWLYHV ,Q FRQWUDVW $7&& SURYHG WR EH D PHPEHU RI WKH DOSKD VXEFODVV RI WKH SURWHREDFWHULD FORVHO\ UHODWHG WR

PAGE 23

$JUREDFWHULXP WXPHIDFLHQV 6KLQ HW DL f 5HFHQWO\ $7&& ZDV UHFODVVLILHG DV 'XJDQHOOD ]RRJORHRLGHV +LUDLVKL HW DO f 7KH SRVVLEOH ELRWHFKQRORJLFDO LPSRUWDQFH RI = UDPLJHUD LV WKDW LW SOD\V LPSRUWDQW UROHV LQ ZDVWHZDWHU WUHDWPHQW SURFHVV HVSHFLDOO\ LQ IORFFXODWLRQ RI DFWLYDWHG VOXGJH DQG ELRILOP IRUPDWLRQ RQ WKH VXUIDFH RI ELRILOP UHDFWRUV 2YHUYLHZ RI :DVWHZDWHU 7UHDWPHQW 3URFHVV 7KH REMHFWLYHV RI ZDVWHZDWHU WUHDWPHQW SURFHVVHV DUH UHGXFWLRQ RI RUJDQLF FRQWHQW %2'f QXWULHQWV 1 3f DQG UHPRYDOUHGXFWLRQ RI SDWKRJHQLF PLFURRUJDQLVPV DQG SDUDVLWHV 7KH FRQYHQWLRQDO ZDVWHZDWHU WUHDWPHQW SURFHVV LQFOXGHV f SUHOLPLQDU\ WUHDWPHQW WR UHPRYH GHEULV RU FRDUVH PDWHULDOV f SULPDU\ WUHDWPHQW ZKLFK LV E\ SK\VLFDO PHDQV VXFK DV VFUHHQLQJ DQG VHGLPHQWDWLRQ f VHFRQGDU\ WUHDWPHQW ZKLFK LV E\ ELRORJLFDO PHDQV VXFK DV DFWLYDWHG VOXGJH WULFNOLQJ ILOWHU RU R[LGDWLRQ SRQGV DQG FKHPLFDO PHDQV VXFK DV GLVLQIHFWLRQ DQG f WHUWLDU\ RU DGYDQFHG WUHDWPHQW ZKLFK LV PDLQO\ E\ FKHPLFDO PHDQV VXFK DV IORFFXODWLRQ ILOWUDWLRQ DQG GLVLQIHFWLRQ ,QIOXHQW IURP D FROOHFWLRQ V\VWHP RU SXPSLQJ VWDWLRQ LV ILUVW WUHDWHG E\ SUHOLPLQDU\ SURFHVVHV SXPSLQJ VFUHHQLQJ DQG JULW UHPRYDOf DQG SULPDU\ VHWWOLQJ WR UHPRYH KHDY\ VROLGV DQG IORDWDEOH PDWHULDOV 3ULPDU\ VROLGV PD\ JR WR ODQGILOOV 3ULPDU\ HIIOXHQW LV WUHDWHG E\ ELRORJLFDO PHDQV HJ DFWLYDWHG VOXGJH RU WULFNOLQJ ILOWHUf ,I WULFNLQJ ILOWHUV DUH XVHG WKH SULPDU\ HIIOXHQW LV DSSOLHG WR ILOWHU EHGV FRQWDLQLQJ QDWXUDO PDWHULDOV URFN FRDOf RU V\QWKHWLF SODVWLFf VXSSRUWV WKDW SHUPLW ELRILOP GHYHORSPHQW 7KHQ VOXGJH VROLG VORXJKHG RII WKH ILOWHUVf DQG OLTXLGV DUH VHSDUDWHG LQ VHWWOLQJ WDQNV ,Q WKH DFWLYDWHG

PAGE 24

VOXGJH SURFHVV SULPDU\ HIIOXHQW LV PL[HG ZLWK UHWXUQHG DFWLYDWHG VOXGJH 5$6f WR IRUP WKH PL[HG OLTXRU LQ WKH DHUDWLRQ WDQN ZKHUH DHUDWLRQ LV SURYLGHG E\ PHFKDQLFDO PHDQV :KHQ WUHDWPHQW ZLWK DFWLYDWHG VOXGJH LV FRPSOHWH WKH PL[WXUH JRHV WR VHGLPHQWDWLRQ WDQNV WR VHSDUDWH VROLGV VOXGJHf DQG OLTXLG $ SRUWLRQ RI VOXGJH LV UHF\FOHG WR SURYLGH DQ LQRFXOXP IRU WKH LQIOXHQW VHZDJH 7KH UHVW RI VOXGJH LV XVXDOO\ IXUWKHU SURFHVVHG E\ VFUHHQLQJ WKLFNHQLQJ GHZDWHULQJ FRQGLWLRQLQJ DQG VWDELOL]DWLRQ DQDHURELF GLJHVWLRQ DHURELF GLJHVWLRQ FRPSRVWLQJ OLPH VWDELOL]DWLRQ DQG KHDW WUHDWPHQWf EHIRUH ODQG DSSOLFDWLRQ 7KH VHFRQGDU\ HIIOXHQW LV IXUWKHU WUHDWHG E\ FKORULQDWLRQ ILOWUDWLRQ IORFFXODWLRQ DQG VR RQ EHIRUH DJULFXOWXUH UHXVH ODQGVFDSH LUULJDWLRQ JURXQG ZDWHU UHFKDUJH UHFUHDWLRQDO UHXVH QRQSRWDEOH XUEDQ UHXVH SRWDEOH UHXVH LQGXVWULDO UHXVH RU UHOHDVHG WR UHFHLYLQJ ZDWHUV )LJ f %2' 1 DQG 3 DUH JUHDWO\ UHGXFHG GXULQJ ELRORJLFDO ZDVWHZDWHU WUHDWPHQW SURFHVVHV 7KH\ DUH DOVR UHGXFHG E\ FKHPLFDO PHDQV VXFK DV IORFFXODWLRQ FRPSRVWLQJ DQG OLPH VWDELOL]DWLRQ (IILFLHQW PLFURRUJDQLVP UHPRYDO IURP ZDVWHZDWHU LV YHU\ LPSRUWDQW LQ RUGHU WR SUHYHQW ZDWHUERUQH GLVHDVH RXWEUHDNV DQG WR SURWHFW WKH SXEOLFfV KHDOWK 'XULQJ SULPDU\ DQG VHFRQGDU\ ZDVWHZDWHU WUHDWPHQW PRVW RI WKH SURWR]RDQV DUH VHWWOHG ZLWK VOXGJH VROLG GXH WR WKHLU ELJJHU VL]H FRPSDUHG ZLWK EDFWHULD DQG YLUXVHV 0DQ\ EDFWHULD DQG YLUXVHV DVVRFLDWHG ZLWK VOXGJH VROLGV DUH DOVR VHWWOHG ZLWK WKH VOXGJH $OPRVW b RI YLUXVHV PD\ EH UHPRYHG IURP ZDWHU E\ WKH DFWLYDWHG VOXGJH WUHDWPHQW SURFHVV 5DR DQG 0HOQLFN f ,W ZDV UHSRUWHG WKDW = UDPLJHUD H[WUDFHOOXODU SRO\PHU DYLGO\ DGVRUEHG ,ODEHOHG SROLR YLUXV DQG HLWKHU SUHFLSLWDWHG WKH YLULRQV RU QHXWUDOL]HG WKHP 6PLWK 5DR DQG 0HOQLFN f

PAGE 25

)URP FROOHFWLRQ OLTXLG UHWXUQHG VOXGJH 1 PHFKDQLFDO VFUHHQ n VROLG ODQGILOO 9,988989 AMQHFQDQLFDL VFUHHQ f§A 0L[HG V\VWHP RU SXPSLQJ DQG JULW UHPRYDO A VRMcG OLTXRU SKDVH VHGLPHQWDWLRQ WDQN GLVLQIHFWLRQ ILOWHUHG HIIOXHQW ILOWUDWLRQ OLTXLG VL FODULILHG HIIOXHQW UHXVH HJ ODNH OLPHVWRQH VROLG VOXGJH WR ODQG DSSOLFDWLRQA ILOWHUHG ZDWHU DHURELF GLJHVWLRQ DQDHURELF GLJHVWLRQ GLJHVWHG VOXGJH L EHOW SUHVV DQG EHOW ILOWHU SUHVV )LJ &RQYHQWLRQDO ZDVWHZDWHU WUHDWPHQW SURFHVV

PAGE 26

&LOLDWHG SURWR]RDQV DUH WKH SUHGRPLQDQW SURWR]RDQV SUHVHQW LQ DFWLYDWHG VOXGJH 7KH\ FRQVXPH PDQ\ RI WKH DEVRUEHG PDWHULDOV LQ VOXGJH LQFOXGLQJ YLUXVHV DQG EDFWHULD 5DR DQG 0HOQLFN %LWWRQ f 7KHVH PLFURRUJDQLVPV LQ WKH VOXGJH DUH UHGXFHG E\ VOXGJH SURFHVVHV VXFK DV FRPSRVWLQJ KHDW WUHDWPHQW DHURELFDQDHURELF GLJHVWLRQ DQG VR RQ 7KH PLFURRUJDQLVPV LQ WKH OLTXLG SKDVH RI ZDVWHZDWHU DUH UHPRYHG E\ IORFFXODWLRQ DQG GLVLQIHFWLRQ WUHDWPHQWV VXFK DV ZLWK FKORULQH R]RQH FKORULQH GLR[LGH DQG VR RQ 7KH RUGHU RI UHPRYDO HIILFLHQF\ E\ GLVLQIHFWDQWV XVXDOO\ LV EDFWHULD YLUXV SURWR]RDQ %HVLGHV GLVLQIHFWLRQ WUHDWPHQW ILOWUDWLRQ KDV EHHQ D XVHIXO PHWKRG IRU UHPRYDO RI EDFWHULD YLUXV DQG RWKHU ILQH SDUWLFOHV IURP ZDVWHZDWHU GXULQJ WHUWLDU\ ZDVWHZDWHU WUHDWPHQW 5DSLG VDQG ILOWUDWLRQ DQG ELRILOPPHGLDWHG VORZ VDQG ILOWHUV KDYH EHHQ XVHG IRU UHPRYDO RI EDFWHULD DQG YLUXVHV LQ ZDVWHZDWHU WUHDWPHQW SODQWV ,Q RUGHU WR LPSURYH WKH UHPRYDO RI PLFURRUJDQLVPV IURP ZDWHU DQG ZDVWHZDWHU WKH PHFKDQLVPV RI PLFURRUJDQLVP DGVRUSWLRQ WR VROLG SDUWLFOHV KDYH EHHQ LQYHVWLJDWHG 0LOOV HW DO *HUED f ,W ZDV LQGLFDWHG WKDW HOHFWURVWDWLF LQWHUDFWLRQV DUH LPSRUWDQW IRU ILOWUDWLRQ RI UHFRPELQDQW 1RUZDON YLUXV SDUWLFOHV DQG EDFWHULRSKDJH 06 LQ TXDUW] VDQG 5HGPDQ HW DO f +\GURSKRELF LQWHUDFWLRQV %DOHV DQG /L f YDQ GHU :DDOV IRUFHV DQG VXUIDFH SURSHUWLHV VXFK DV VXUIDFH URXJKQHVV DQG VXUIDFH FKDUJH KHWHURJHQHLW\ DUH DOVR LPSRUWDQW LQ PLFURRUJDQLVPVVROLG LQWHUDFWLRQ /XNDVLN HW DO 7UXHVGDLO HW DO f 'LIIHUHQW PRGLILFDWLRQV RI ILOWHU PHGLD KDYH EHHQ WULHG LQFOXGLQJ WKH XVH RI PHWDO SHUR[LGH $VJKDUL DQG )DUUDK )DUUDK DQG 3UHVWRQ *HUED HW DO f PHWDO R[LGH 6WHQNDPS DQG %HQMDPLQ f DQG PHWDO K\GUR[LGH FRDWLQJV )DUUDK DQG

PAGE 27

3UHVWRQ /XNDVLN HW DO /XNDVLN HW DO f 6XFK PRGLILFDWLRQV KDYH LQFUHDVHG WKH UHPRYDO RI PLFURRUJDQLVPV IURP ZDWHU UHODWLYH WR XQWUHDWHG JUDQXODU PHGLD 7KH UHDVRQ LV WKDW PRGLI\LQJ WKH VDQG RU GLDWRPDFHRXV HDUWK ZLWK YDULRXV PHWDO R[LGH SHUR[LGH RU K\GUR[LGH VXUIDFH FRDWLQJV FKDQJHG WKH VXUIDFH FKDUJH IURP HOHFWURQHJDWLYH WR HOHFWURSRVLWLYH WKXV GHFUHDVLQJ WKH HOHFWURVWDWLF UHSXOVLRQ EHWZHHQ WKH SDUWLFOHV DQG WKH DGVRUELQJ VROLG 7KHUHIRUH WKHVH PRGLILHG ILOWHU PHGLD DUH SURPLVLQJ PDWHULDOV WR EH XVHG LQ UHPRYLQJ PLFURRUJDQLVPV LQ ZDVWHZDWHU ILOWUDWLRQ SURFHVVHV :KHQ WKH PRGLILHG ILOWHU PHGLD DUH XVHG LQ ZDVWHZDWHU WUHDWPHQW SODQWV WKH GHYHORSPHQW RI ELRILOPV RU WKH SUHVHQFH RI RUJDQLF DQG LQRUJDQLF PDWHULDOV LQ WKH ZDVWHZDWHU KDYH WKH SRWHQWLDO WR FKDQJH WKH VXUIDFH SURSHUWLHV RI WKH ILOWHU PHGLD DQG WKXV LQIOXHQFH WKH PLFURRUJDQLVP UHPRYDO FDSDFLW\ ,W KDV EHHQ VXJJHVWHG WKDW ELRILOP GHYHORSPHQW RQ VORZ VDQG ILOWHUV 6FKXOHU HW DO f JODVV SRO\FDUERQDWH DQG JUDQXODU DFWLYDWHG FDUERQ VXUIDFHV %DQNV DQG %U\HUV 'UXU\ HW DO 5LWWPDQQ DQG :LUWHO 6SURXVH DQG 5LWWPDQQ f HQKDQFHG WKH SK\VLFDO HQWUDSPHQW RI EDFWHULD DQG EDFWHULXPVL]HG ILQH SDUWLFOHV +RZHYHU LW ZDV DOVR IRXQG WKDW VHZDJH GHULYHG RUJDQLF PDWWHU EORFNHG WKH DWWDFKPHQW VLWHV RQ IHUULF R[\K\GUR[LGHFRDWHG TXDUW] WKXV GHFUHDVLQJ EDFWHULRSKDJH 35' DGVRUSWLRQ 3LHSHU HW DO f 2YHUDOO ELRORJLFDO ZDVWHZDWHU WUHDWPHQW SURFHVVHV DUH LPSRUWDQW IRU PLFURRUJDQLVP UHPRYDO DV ZHOO DV UHGXFWLRQ RI RUJDQLF PDWHULDOV ,W KDV ORQJ EHHQ EHOLHYHG WKDW = UDPLJHUD SOD\V LPSRUWDQW UROHV LQ ZDVWHZDWHU WUHDWPHQW SURFHVVHV VXFK DV DFWLYDWHG VOXGJH IORFFXODWLRQ DQG ELRILOP IRUPDWLRQ RQ WKH VXUIDFH RI WULFNOLQJ ILOWHUV

PAGE 28

7KH )XQFWLRQ RI = UDPIHUD LQ $FWLYDWHG 6OXGJH ,Q WKH DFWLYDWHG VOXGJH SURFHVV ZDVWHZDWHU LV IHG FRQWLQXRXVO\ LQWR DQ DHUDWHG WDQN ZKHUH WKH PLFURRUJDQLVPV PHWDEROL]H WKH RUJDQLF PDWHULDOV %LRORJLFDO IORHV IRUP GXULQJ WKLV SURFHVV 7KHVH IORHV FRQVLVW RI D YDULHW\ RI PLFURRUJDQLVPV DQG DUH FROOHFWLYHO\ UHIHUUHG WR DV DFWLYDWHG VOXGJH )ROORZLQJ WKH WUHDWPHQW D SRUWLRQ RI WKH VOXGJH LV GLVFDUGHG ZDVWHGf DQG WKH UHVW LV UHWXUQHG WR WKH DHUDWLRQ WDQN 7KH UHODWLYHO\ FOHDU VXSHUQDWDQW IURP WKH ILQDO VHWWOLQJ WDQN LV WKH VHFRQGDU\ HIIOXHQW 7KH SULPDU\ IHHGHUV LQ DFWLYDWHG VOXGJH DUH EDFWHULD 6HFRQGDU\ IHHGHUV DUH KROR]RLF SURWR]RDQV 0LFURELDO JURZWK LQ WKH PL[HG OLTXRU LV PDLQWDLQHG LQ WKH GHFOLQLQJ RU HQGRJHQRXV JURZWK SKDVH WR HQVXUH JRRG VHWWOLQJ FKDUDFWHULVWLFV $FWLYDWHG VOXGJH LV WUXO\ DQ DHURELF WUHDWPHQW SURFHVV VLQFH WKH ELRORJLFDO IORH LV VXVSHQGHG LQ OLTXLG PHGLD FRQWDLQLQJ GLVVROYHG R[\JHQ 'LVVROYHG R[\JHQ H[WUDFWHG IURP WKH PL[HG OLTXRU LV UHSOHQLVKHG E\ DLU VXSSOLHG WR WKH DHUDWLRQ WDQN 9LHVVPDQ DQG +DPPHU f ,Q DFWLYDWHG VOXGJH H[WUDFHOOXODU SRO\PHU SURGXFHG E\ = UDPLJHUD DQG RWKHU DFWLYDWHGVOXGJH PLFURRUJDQLVPV SOD\V D UROH LQ EDFWHULD IORFFXODWLRQ DQG IORH IRUPDWLRQ SURFHVVHV ZKLFK DUH HVVHQWLDO SUHUHTXLVLWHV IRU WKH HIILFLHQW DQG HFRQRPLFDO RSHUDWLRQ RI DQ DFWLYDWHGVOXGJH ZDVWHZDWHU WUHDWPHQW SODQW %LWWRQ f )ORH IRUPDWLRQ GXULQJ WKH DHUDWLRQ SKDVH LV DOVR LQVWUXPHQWDO LQ UHPRYLQJ XQGHVLUDEOH PLFURRUJDQLVPV 7KH SURSHU VHWWOLQJ RI DFWLYDWHGVOXGJH VROLG UHTXLUHV D SURSHU EDODQFH RI IORH IRUPLQJ EDFWHULD DQG ILODPHQWRXV EDFWHULD ,I WKH QXPEHUV RU DFWLYLWLHV RI WKH IORF IRUPLQJ EDFWHULD DUH UHGXFHG VOXGJH EXONLQJ PD\ RFFXU DQG WXUELG UDWKHU WKDQ FOHDU HIIOXHQWV ZLOO EH SURGXFHG %LWWRQ 1R]DZD HW DO f 6OXGJH EXONLQJ LV RQH RI

PAGE 29

WKH PDMRU SUREOHPV DIIHFWLQJ ELRORJLFDO ZDVWHZDWHU WUHDWPHQW 7KHUH DUH VHYHUDO DSSURDFKHV IRU FRQWUROOLQJ VOXGJH EXONLQJ LQFOXGLQJ DGGLWLRQ RI R[LGDQWV VXFK DV FKORULQH RU K\GURJHQ SHUR[LGH IORFFXOHQW VXFK DV V\QWKHWLF RUJDQLF SRO\PHUV OLPH DQG LURQ VDOWV DQG XVLQJ ELRORJLFDO VHOHFWRUV %LWWRQ f ,W ZDV LQGLFDWHG WKDW WKH DELOLW\ WR VHWWOH EXONLQJ VOXGJH ZDV DOVR UHVWRUHG E\ VHHGLQJ VOXGJH ZLWK = UDPLJHUD 1R]DZD HW DOf f )DUUDK DQG 8Q] f VWXGLHG = UDPLJHUD H[WUDFHOOXODU SRO\PHU DQG IRXQG WKDW DPLQR VXJDUV DUH WKH SULQFLSDO FRQVWLWXHQW DIWHU DFLG K\GURO\]DWLRQ RI H[WUDFHOOXODU SRO\PHU DQG WKH DPLQR VXJDUV FRQWHQW LQ H[WUDFHOOXODU SRO\PHU LVRODWHG IURP DFWLYDWHG VOXGJH IORHV ZDV VLPLODU WR WKDW RI IURP = UDPLJHUD 3DSHU DQG LRQH[FKDQJH FKURPDWRJUDSK\ VHSDUDWLRQ RI K\GURO\]HG H[WUDFHOOXODU SRO\PHU RI =RRJORHD LVRODWHG IURP DFWLYDWHG VOXGJH VXJJHVWHG WKDW WKH DPLQR VXJDUV DUH JOXFRVDPLQH DQG IXFRVDPLQH 7H]XND f 7KH LVRODWHG SRO\PHU IURP DFWLYDWHGVOXGJH PLFURRUJDQLVPV KDV EHHQ IRXQG WR FRQWDLQ QHXWUDO VXJDUV DPLQR VXJDUV XURQLF DFLGV DQG DPLQR DFLGV ZKLFK LQGLFDWHV WKHLU KHWHURSRO\VDFFKDULGLF FKDUDFWHU +HMODU DQG &KXGRED f 7KH PROHFXODU ZHLJKW RI WKH H[WUDFHOOXODU SRO\PHU IUDFWLRQ UDQJHG IURP [O WR [O 'DOWRQV *OXFRVH JDODFWRVH PDQQRVH JOXFXURQLF DFLG DQG JDODFWXURQLF DFLG ZHUH GHWHFWHG LQ WKLV IUDFWLRQ +RUDQ DQG (FFOHV f 7KHUHIRUH WKHUH DUH QHJDWLYH DQG SRVLWLYH FKDUJHV LQ WKH H[WUDFHOOXODU SRO\PHU ZKLFK DOORZ WKH SRO\VDFFKDULGH WR EHKDYH DV SRO\HOHFWURO\WH ,W LV REVHUYHG WKDW H[WUDFHOOXODU SRO\PHUV SURGXFHG E\ PLFURRUJDQLVPV FRPPRQO\ IRXQG LQ DFWLYDWHG VOXGJH GLVSOD\ D JUHDW DIILQLW\ IRU PHWDOV 6HYHUDO W\SHV RI EDFWHULD HJ = UDPLJHUD %DFLOOXV

PAGE 30

OLFKHQLIRPLVf VRPH RI ZKLFK KDYH EHHQ LVRODWHG IURP DFWLYDWHG VOXGJH SURGXFH H[WUDFHOOXODU SRO\PHUV WKDW DUH DEOH WR FRPSOH[ DQG VXEVHTXHQWO\ DFFXPXODWH PHWDOV VXFK DV LURQ FRRSHU FDGPLXP QLFNHO RU XUDQLXP )RU H[DPSOH 'XJDQHOOD ]RRJORHRLGHV $7&&f FDQ DFFXPXODWH XS WR J RI &X SHU JUDP RI ELRPDVV 1RUEHUJ DQG 3HUVVRQ 1RUEHUJ DQG 5\GLQ f 7KLV EDFWHULXP ZKHQ LPPRELOL]HG LQ DOJLQDWH EHDGV LV DOVR DEOH WR FRQFHQWUDWH FDGPLXP WR DV KLJK DV PJ WKH DOJLQDWH EHDGV DOVR DEVRUE VRPH RI WKH FDGPLXPf .XKQ DQG 3ILVWHU f 7KH KHDY\ PHWDO DGVRUSWLRQ RI 'XJDQHOOD ]RRJORHRLGHV $7&&f PLJKW EH UHODWHG WR LWV SURGXFWLRQ RI DQ DFLGLF H[WUDFHOOXODU SRO\PHU VXFK DV VXFFLQRJO\FDQ ZKLFK FRQWDLQV JOXFRVH VXFFLQDWH DQG S\UXYDWH ,NHGD HW DO f &RUUHODWLRQ EHWZHHQ KLJKO\ DQLRQLF FKDUJHG SRO\PHUV DQG PHWDO FRPSOH[LQJ FDSDFLW\ ZDV IRXQG E\ VWXG\ RI FKHODWLQJ SURSHUWLHV RI H[WUDFHOOXODU SRO\VDFFKDULGH SURGXFHG E\ &KORUHOOD VSS .DSODQ HW DO f ,W LV DOVR QRWLFHG WKDW WKH SURGXFWLRQ RI H[WUDFHOOXODU SRO\PHU E\ EDFWHULD PD\ GUDVWLFDOO\ UHGXFH WKH VDWXUDWHG K\GUDXOLF FRQGXFWLYLW\ RI VDQG FROXPQV +&VDWf DQG WKLV HIIHFW ZDV RQO\ REVHUYHG ZKHQ WKH H[WUDFHOOXODU SRO\PHU SURGXFHG LQ WKH IRUP RI ORRVH VOLPH OD\HUV &HOOERXQG FDSVXODU H[WUDFHOOXODU SRO\PHU KDG QR VLJQLILFDQW HIIHFW RQ WKH +&VDW 9DQGHYLYHUH DQG %DYH\H f 7KH )XQFWLRQ RI = UDPLHHUD 'XULQJ %LRILOP )RUPDWLRQ %LRILOP IRUPDWLRQ LV WKRXJKW WR UHVXOW IURP WKH FRQFHUWHG DFWLRQ RI SULPDU\ DWWDFKPHQW WR D VSHFLILF VXUIDFH DQG DFFXPXODWLRQ LQ PXOWLOD\HUHG FHOO FOXVWHUV %LRILOPV DUH GHILQHG DV PDWUL[HQFORVHG EDFWHULDO SRSXODWLRQV DGKHUHQW WR HDFK RWKHU DQGRU WR

PAGE 31

VXUIDFHV RU LQWHUIDFHV 7KLV GHILQLWLRQ LQFOXGHV PLFURELDO DJJUHJDWHV DQG IORFFXOH DQG DOVR DGKHUHQW SRSXODWLRQV ZLWKLQ WKH SRUH VSDFHV RI SRURXV PHGLD &RVWHUWRQ HW DO f %LRILOP LV XELTXLWRXV ,W H[LVWV LQ QDWXUDO HQYLURQPHQWV *LOODQ HW DO 0F/HDQ HW DO f DQG LQ FOLQLFDO VHWWLQJV 6WLFNOHU HW DO f 7KH VWUXFWXUDO DQG SK\VLRORJLFDO KHWHURJHQHLW\ RI ELRILOP LV QRZ ZLGHO\ UHFRJQL]HG +XDQJ HW DO +XDQJ HW DO 6WHZDUW HW DO ;X HW DO f ,Q DGGLWLRQ WR WUDGLWLRQDO PHWKRGV FXOWLYDWLRQ DQGRU PLFURVFRS\f JHQHWLF PHWKRGV DUH DOVR DYDLODEOH WR FKDUDFWHUL]H PLFURELDO GLYHUVLW\ $PSOLILFDWLRQ DQG VHTXHQFH DQDO\VLV RI WKH 6 U51$ U'1$f KDV EHHQ VXFFHVVIXOO\ XVHG IRU XQGHUVWDQGLQJ WKH ELRORJ\ RI PLFURELDO FRPPXQLW\ %ULWVFKJL DQG *LYRQQRQL 'H/RQJ HW DO *LOODQ HW DO /LHVDFN DQG 6WDFNHEUDQGW :DUG HW DO f ,Q RQH VWXG\ WKH JHQHWLF GLYHUVLW\ DQG SK\ORJHQHWLF DIILOLDWLRQ RI ELRILOP EDFWHULD ZKLFK FRYHUHG WKH VKHOO RI ELYDOYH 0RQWHFXWD IHUUXJLQRVD ZHUH GHWHUPLQHG E\ GHQDWXULQJ JUDGLHQW JHO HOHFWURSKRUHVLV '**(f DQDO\VLV RI 6 ULERVRPDO '1$ 3&5 SURGXFWV REWDLQHG ZLWK SULPHUV VSHFLILF IRU WKH GRPDLQ %DFWHULD *LOODQ HW DO f )OXRUHVFHLQ LQ VLWX K\EULGL]DWLRQ ),6+f E\ XVLQJ IOXRUHVFHLQ ODEHOHG ROLJRQXFOHRWLGH SUREHV DUH DOVR IUHTXHQWO\ XVHG WR GHWHFW DQG FKDUDFWHUL]H EDFWHULD LQ PLFURELDO FRPPXQLW\ 0X\]HU DQG 5DPVLQJ f 'XULQJ ELRILOP IRUPDWLRQ LQLWLDO DWWDFKPHQW UHTXLUHV IODJHOOD RU VXUIDFH DGKHQVLQV DQG QXWULWLRQDO VLJQDO IURP HQYLURQPHQWV &RVWHUWRQ HW DO f $WWDFKHG EDFWHULD H[FUHWH H[WUDFHOOXODU SRO\PHU DV D PDWUL[ IRU ELRILOPV &RVWHUWRQ HW DO $OOLVRQ DQG 6XWKHUODQG f 0DWXUH ELRILOPV IRUP PXVKURRP DQG SLOODUOLNH

PAGE 32

VWUXFWXUHV ZLWK ZDWHU FKDQQHO EHWZHHQ WKHP ZKLFK IXQFWLRQ PXFK OLNH SULPLWLYH FLUFXODWRU\ V\VWHP &RVWHUWRQ HW DO f ,W KDV EHHQ QRWLFHG WKDW EDFWHULDO FHOOV LQ ELRILOP DUH XVXDOO\ PRUH UHVLVWDQW WR HQYLURQPHQWDO VWUHVV DQG DQWLEDFWHULDO DJHQWV WKDQ SODQNWRQLF FHOOV $OOLVRQ DQG 6XWKHUODQG 0DUVKDOO HW DO 2SKLU DQG *XWQLFN %URZQ HW DO f ,W LV VDLG WKDW EDFWHULDO DGKHVLRQ PLJKW WULJJHU WKH H[SUHVVLRQ RI D VLJPD IDFWRU ZKLFK UHJXODWHV D ODUJH DPRXQW RI JHQHV VR WKDW ELRILOP FHOOV DUH SKHQRW\SLFDOO\ GLVWLQFW IURP SODQNWRQLF FHOOV RI WKH VDPH VSHFLHV &RVWHUWRQ HW DO
PAGE 33

)RU H[DPSOH D 3VHXGRPRQDV DHUXJLQRVD PXWDQW VWUDLQ XQDEOH WR PDNH $+/V GLG QRW SURGXFH D W\SLFDO ELRILOP DQG ZDV VHQVLWLYH WR WKH ELRFLGH VRGLXP GRGHF\O VXOIDWH 'DYLHV HW DO f ,W ZDV LQGLFDWHG WKDW $+/V DUH QRW RQO\ SURGXFHG LQ QDWXUDO ELRILOPV JURZLQJ RQ VXEPHUJHG VWRQHV WDNHQ IURP WKH 6DQ 0DUFRV ULYHU LQ 7H[DV 0F/HDQ HW DO f EXW DOVR SURGXFHG E\ ELRILOP LQ FOLQLFDO VHWWLQJ VXFK DV LQGZHOOLQJ XUHWKUDO FDWKHWHU 6WLFNOHU HW DO f $QDORJXHV RI $+/V FDSDEOH RI LQWHUIHULQJ ZLWK VLJQDOLQJ KDYH WKH SRWHQWLDO WR EH XVHG WR SUHYHQW WKH IRUPDWLRQ DQG GHYHORSPHQW RI ELRILOP RQ LPSODQWHG PHGLFDO GHYLFHV ,W ZDV LQGLFDWHG WKH IXUDQRQH GHULYDWLYHV SURGXFHG E\ WKH VHDZHHG 'HOLVD SXOFKUD LQKLELW VZDUPLQJ RI 6HUUDGD OLTXHIDFLHQV ZKLFK LV $+/VUHJXODWHG ,W ZDV VSHFXODWHG WKDW IXUDQRQH GHULYDWLYHV PLPLF $+/V VLJQDOLQJ SURFHVV E\ EORFNLQJ WUDQVFULSWLRQDO DFWLYDWLRQ RI WDUJHW JHQHV GH 1\V HW DO (UEOH HW DO *LYVNRY HW DO f 7KHUHIRUH LW LV YHU\ OLNHO\ WR EH DEOH WR FRQWURO ELRILOP IRUPDWLRQ DQG GLVVROXWLRQ LQ VLWX E\ XVLQJ $+/V DQG LWV DQDORJXHV ([WUDFHOOXODU SRO\PHU SURGXFWLRQ E\ ELRILOP EDFWHULD QRW RQO\ KHOSV WKH LQLWLDO DWWDFKPHQW RI EDFWHULD WR VXUIDFHV EXW DOVR KHOSV WKH IRUPDWLRQ DQG PDLQWHQDQFH RI PLFUR FRORQLHV DQG ELRILOP VWUXFWXUH HQKDQFHV ELRILOP UHVLVWDQFH WR HQYLURQPHQWDO VWUHVV DQG DQWLPLFURELDO DJHQWV SURWHFWV EDFWHULD LQ WKH ELRILOP IURP SURWR]RDQ JUD]LQJ DQG SURYLGHV ELRILOP QXWULWLRQ $OOLVRQ DQG 6XWKHUODQG +HLVVHQEHUJHU HW DO 0DUVKDOO HW DO 2SKLU DQG *XWQLFN f 7KH H[WUDFHOOXODU SRO\PHU LQ ELRILOP LV DOVR KLJKO\ KHWHURJHQRXV DQG KDV EHHQ GHPRQVWUDWHG LQ VLWX WR YDU\ VSDWLDOO\ FKHPLFDOO\ DQG SK\VLFDOO\ /DZUHQFH HW DO :ROIDDUGW HW DO :ROIDDUGW HW DO f ,Q

PAGE 34

DGGLWLRQ WKH FKHPLFDOO\ UHDFWLYH H[WUDFHOOXODU SRO\PHU LV JHQHUDOO\ WKH ILUVW ELRILOP VWUXFWXUH WR FRPH LQ FRQWDFW ZLWK SRWHQWLDO VXEVWUDWHV SUHGDWRUV DQWLPLFURELDO DJHQWVDQWLELRWLFV DQG RWKHU EDFWHULD DQG WKXV LV RI FRQVLGHUDEOH DSSOLHG DQG HFRORJLFDO LPSRUWDQFH )RU H[DPSOH EDFWHULDO FHOOV ZRXOG EH DWWDFKHG WR WKH RUJDQLF QXWULHQWV WKDW FRQFHQWUDWH QDWXUDOO\ DW VXUIDFHV LQ DTXDWLF V\VWHPV DQG WKH H[WUDFHOOXODU SRO\PHU WKDW PHGLDWH WKHLU DGKHVLRQ WR VXUIDFHV ZRXOG IXUWKHU FRQFHQWUDWH GLVVROYHG RUJDQLF PROHFXOHV DQG FDWLRQV RXW RI EXON IOXLG %LRILOP 5HDFWRUV ,Q ZDVWHZDWHU WUHDWPHQW SODQWV ELRILOP UHDFWRUV LQFOXGH WULFNOLQJ ILOWHUV URWDWLQJ ELRORJLFDO FRQWUDFWRUV 5%&f DQG VXEPHUJHG ILOWHUV GRZQIORZ DQG XSIORZ ILOWHUVf 7KHVH UHDFWRUV DUH XVHG IRU R[LGDWLRQ RI RUJDQLF PDWWHU QLWULILFDWLRQ GHQLWULILFDWLRQ RU DQDHURELF GLJHVWLRQ RI ZDVWHZDWHU 'XULQJ ELRILOP IRUPDWLRQ RQ WULFNOLQJ ILOWHU VXUIDFHV WKH VXUIDFH RI WKH VXSSRUW PDWHULDOV LV FRORQL]HG ZLWK *UDPQHJDWLYH EDFWHULD IROORZHG E\ ILODPHQWRXV EDFWHULD 7KHUH DUH WZR VWHSV LQ WKH DEVRUSWLRQ RI EDFWHULD WR ELRILOP VXUIDFHV 7KH ILUVW VWHS LV UHYHUVLEOH VRUSWLRQ PDLQO\ FRQWUROOHG E\ HOHFWURVWDWLF LQWHUDFWLRQV EHWZHHQ DEVRUEHQW DQG WKH FHOOV 7KH VHFRQG VWHS FRQVLVWV RI LUUHYHUVLEOH DEVRUSWLRQ RI FHOOV UHVXOWLQJ IURP WKH IRUPDWLRQ RI SRO\VDFFKDULGHFRQWDLQLQJ PDWUL[ QDPHG JO\FRFDO\[ *O\FRFDO\[ QRW RQO\ KHOSV DQFKRU WKH ELRILOP PLFURRUJDQLVPV WR WKH VXUIDFH EXW DOVR KHOSV SURWHFW PLFURRUJDQLVPV IURP SUHGDWLRQ DQG IURP FKHPLFDO LQVXOW 7KHUH DUH DOVR SRO\DQLRQLF FRPSRXQGV LQ JO\FRFDO\[ WKDW FRPSOH[ WKH PHWDO LRQV %LWWRQ f

PAGE 35

= UDPLJHUD ZDV IRXQG LQ ELRILOP GXULQJ GHQLWULILFDWLRQ E\ IOXLGLVKHG EHG UHDFWRUV 6LFK DQG 5LMQ f ,W GHJUDGHG SKHQROV DQG QLWURJHQFRQWDLQLQJ DURPDWLF FRPSRXQGV .RFK HW DO f DQG FRH[LVWHG ZLWK 3VHXGRPRQDV GXULQJ WKHVH SURFHVVHV ,QLWLDO FRORQL]DWLRQ RQ JUDQXOHV ZDV PDLQO\ =RRJORHD VSHFLHV 'XULQJ WKH SHULRG RI FRn H[LVWHQFH =RRJORHD FHOOV SURYLGHG D VHWWLQJ VXEVWUDWH IRU 3VHXGRPRQDV DQG WKH JHODWLQRXV PDWUL[ SURYLGHG E\ =RRJORHD PLJKW KDYH VHUYHG DV QXWULHQW WUDS IRU 3VHXGRPRQDV ZKLFK HYHQWXDOO\ FRYHUHG WKH HQWLUH RXWHU OD\HUV RI WKH JUDQXOHV 6LFK DQG 5LMQ f 5HYHUVH 7UDQVFULSWLRQ3RO\PHUDVH &KDLQ 5HDFWLRQ 573&5 IRU 0LFURRUJDQLVP 'HWHFWLRQ ,Q DGGLWLRQ WR WUDGLWLRQDO PLFURELRORJLFDO DQG LPPXQRORJLFDO PHWKRGV IRU PLFURRUJDQLVP GHWHFWLRQ PROHFXODU SURFHGXUHV KDYH EHHQ LQFUHDVLQJO\ SRSXODU DQG PRUH IUHTXHQWO\ XVHG WR GHWHFW YLUXV EDFWHULD DQG SURWR]RDQ LQ FOLQLFDO DQG HQYLURQPHQWDO VDPSOHV &RPSDULQJ ZLWK LPPXQRORJLFDO PHWKRGV HJ LPPXQRKLVWRORJ\ (/,6$ HWFf DQG WLVVXH FXOWXUH 573&5 KDV EHHQ H[WHQVLYHO\ XVHG DV D VHQVLWLYH VSHFLILF DQG WLPH VDYLQJ PHWKRG WR GHWHFW JHQHV RI 51$ YLUXVHV +D\DVH DQG 7RELWD f LQFOXGLQJ GHQJXH YLUXV &KRZ HW DO +REHU HW DO /LX HW DO f KHSDWLWLV $ YLUXV &URPHDQV HW DO f KHSDWLWLV & YLUXV -HDQQHO HW DO /DXUVHQ HW DO :KLWE\ DQG *DUVRQ f FLWUXV SVRURVLV YLUXV %DUWKH HW DO f UHRYLUXV 7\OHU HW DO f HQWHURYLUXV &KXQJ HW DO *DQW]HU HW DO f UHVSLUDWRU\ YLUXV

PAGE 36

5RKZGGHU HW DO 9DODVVLQD HW DO f PHDVOHV YLUXV &KDGZLFN HW DO .DZDVKLPD HW DO f PXPSV YLUXV .DVKLZDJL HW DO &XVL HW DO f +,9 %HLONH HW DO &RQWRUHJJL HW DO f DQG VR RQ 6HYHUDO YDULHWLHV RI 573&5 ZDV GHYHORSHG IRU YLUXV GHWHFWLRQ )RU H[DPSOH PXOWLSOH[ 573&5 ZDV XVHG WR UDSLGO\ GHWHFW DQG LGHQWLI\ GLIIHUHQW VHURW\SH RI YLUXVHV VXFK DV KXPDQ SDUDLQIOXHQ]D YLUXVHV DQG (FKHYDUULD HW DO f RU GLIIHUHQW VSHFLHV VXFK DV LQIOXHQ]D $ YLUXV ,$f DQG UHVSLUDWRU\ V\QF\WLDO YLUXV 56f 9DODVVLQD HW DO f 1HVWHG RU VHPLQHVWHG 573&5 FDQ EH XVHG IRU UDSLG W\SHVSHFLILF&KRZ HW DO f RU JHQXVVSHFLILF GHWHFWLRQ +DIOLJHU HW DO 3IHIIHU HW DO f ,Q VLWX 573&5 ZDV XVHG WR ORFDOL]H WKH YLUXV LQ WKH VSHFLPHQV :DONHU HW DO 4XUHVKL HW DO f 573&5(/,6$ :KLWE\ HW DO f ZDV DOVR GHYHORSHG DQG PXFK PRUH VHQVLWLYH WKDQ VRXWKHUQ EORW K\EULGL]DWLRQ 573&5 FRXSOHG ZLWK PLFURSODWH FRORULPHWULF DVVD\ /HJHD\ HW DO f FDQ EH XVHG WR TXDQWLWDWH 3&5 SURGXFWV 573&5 WDUJHWLQJ RI EDFWHULDO ULERVRPDO 51$ KDV EHHQ IUHTXHQWO\ XVHG WR GHWHFW EDFWHULD 7KLV PHWKRG KDV VHYHUDO DGYDQWDJHV 2QH RI WKHP LV WKDW EDFWHULDO U51$ KDV FRQVHUYHG DQG YDULDEOH UHJLRQV 7KLV PDNHV LW FRQYHQLHQW WR ILQG JHQHUDO DV ZHOO DV VSHFLILF WDUJHW VLWHV IRU 3&5 SULPHUV 6HFRQG YDULRXV GDWDEDVHV RI U51$ VHTXHQFHV VXFK DV 5LERVRPDO 'DWDEDVH 3URMHFW DQG *HQH %DQN DUH DYDLODEOH VR WKDW SK\ORJHQHWLF DQDO\VLV 5RVVHOORPRUD HW DO *LOODQ HW DO f DQG SULPHU GHVLJQ FDQ EH SHUIRUPHG 7KLUG HDFK EDFWHULDO FHOO FRQWDLQV WR FRSLHV RI U51$ GHWHFWLRQ RI U51$ VKRXOG LPSDUW LQFUHDVHG VHQVLWLYLW\ RYHU DVVD\V EDVHG RQ WKH GHWHFWLRQ RI D

PAGE 37

VLQJOH FRS\ RU HYHQ PXOWLSOH FRSLHV RI JHQRPLF VHTXHQFHV )RU H[DPSOH 573&5 DVVD\ WDUJHWLQJ WKH 6 U51$ RI 0\FREDFWHULXP OHSUDH .XUDEDFKHZ HW DO f RU 7UHSRQHPD SDOOLGXP &HQWXULRQ HW DO f ZDV XVHG WR GHWHFW ORZ QXPEHUV RI YLDEOH RUJDQLVPV LQ VDPSOHV 573&5 WDUJHWLQJ EDFWHULDO P51$ KDV DOVR EHHQ XVHG WR GHWHFW YLDEOH EDFWHULD EHFDXVH EDFWHULDO P51$ KDV DQ H[WUHPHO\ VKRUW KDOI OLIH DYHUDJLQJ RQO\ D IHZ PLQXHWV 3UHYLRXVO\ WKH SUHVHQFH RI YLDEOH 0\FREDFWHULXP WXEHUFXORVLV -RX HW DO f DQG /LVWHULD PRQRF\WRJHQHV .OHLQ DQG -XQHMD f ZHUH GHWHFWHG E\ XVLQJ 573&5 WDUJHWLQJ EDFWHULDO P51$ (IIRUWV KDYH EHHQ PDGH WR GHWHFW SURWR]RDQV IURP HQYLURQPHQWV 3URFHGXUHV XVHG LQFOXGH IORZ F\WRPHWU\ 9HVH\ HW DO f ODVHU VFDQQLQJ $QJXLVK DQG *KLRUVH f DQG LPPXQRPDJQHWLF VHSDUDWLRQ &DPSEHOO DQG 6PLWK f 7KH VHQVLWLYLW\ RI SURWR]RDQ GHWHFWLRQ ZDV JUHDWO\ LQFUHDVHG E\ FRQFHQWUDWLQJ F\VW DQG RRF\VWV ZLWK ILOWHUV VHOHFWLYHO\ FDSWXULQJ P51$ ZLWK ROLJR G7f PDJQHWLF EHDGV DQG WKHQ SHUIRUPLQJ 57 3&5 ,W ZDV LQGLFDWHG WKDW ORZ QXPEHUV RI YLDEOH *LDUGLD F\VWV DQG &U\SWRVSRULGLXP SDUYXP RRF\VWV ZHUH GHWHFWHG LQ ZDWHU VDPSOHV DQG WKH PHWKRG ZDV PRUH VHQVLWLYH WKDQ XVLQJ LPPXQRIOXRUHVFHQFH DVVD\ .DXFQHU DQG 6WLQHDU f

PAGE 38

0$7(5,$/6 $1' 0(7+2'6 %DFWHULDO 6WUDLQV 7KH IROORZLQJ EDFWHULD ZHUH XVHG LQ WKLV VWXG\ 6DOPRQHOOD W\SKLPXULXP $7&& f (VFKHULFKLD FROL $7&& f .OHEVLHOOD SQHXPRQLDH $7&& f 3UROHXV YXOJDULV $7&& f 6WDSK\ORFRFFXV DXUHXV $7&& f 3VHXGRPRQDV DHURJLQRVD $7&& f 'XJDQHOOD ]RRJORHRLGHV $7&& f f= UDPLJHUDn 0 $7&& f DQG= UDPLJHUD $7&& f = UDPLJHUD $7&& f f= UDPLJHUDf ,0 $7&& f DQG 'XJDQHOOD ]RRJORHRLGHV $7&& f ZHUH JURZQ LQ <3 PHGLXP J \HDVW H[WUDFW J SHSWRQHf IRU KRXUV DW r& $OO RWKHU EDFWHULD ZHUH JURZQ LQ 7U\SWLF 6R\ %URWK 'LIFR /DERUDWRULHV 'HWURLW 0,f IRU KRXUV DW r& = UDPL YHUD (QULFKHG %LRILOP 'HYHORSPHQW 3KHQRO $FURV 2UJDQLFV 3LWWVEXUJK 3$f ZDV DGGHG WR PO VDPSOHV IURP ZDVWHZDWHU WUHDWPHQW SODQWV RU VXUIDFH ZDWHU FRQWDLQHG LQ PO EHDNHUV GDLO\ WR SURYLGH DQ LQLWLDO FRQFHQWUDWLRQ RI SJPO 7KH VDPSOHV ZHUH LQFXEDWHG DW DPELHQW WHPSHUDWXUH DSSUR[LPDWHO\ r&f IRU XS WR RQH ZHHN 'XULQJ LQFXEDWLRQ WKH VDPSOHV ZHUH SHULRGLFDOO\ H[DPLQHG IRU WKH GHYHORSPHQW RI D ELRILOP WKDW FRQWDLQHG ILQJHUOLNH SURMHFWLRQV FKDUDFWHULVWLF RI = UDPLJHUD

PAGE 39

&ROXPQ 6WXGLHV 5DZ VHZDJH ZDV REWDLQHG IURP 8QLYHUVLW\ RI )ORULGD :DWHU 5HFODPDWLRQ )DFLOLW\ *DLQHVYLOOH )/f 7KH UDZ VHZDJH ZDV ILOWHUHG WKURXJK FKHHVH FORWK )LVKHU 6FLHQWLILF 6SULQJILHOG 1-f WR UHPRYH ODUJH SDUWLFOHV IURP WKH ZDWHU EHIRUH SDVVLQJ WKURXJK WKH FROXPQ 2WWDZD VDQG )LVKHU 6FLHQWLILF 6SULQJILHOG 1-f ZDV SDFNHG LQWR DQ DFU\OLF FROXPQ FP ,' [ Pf 7KH UDZ VHZDJH ZLWK SJPO SKHQROV ZDV SDVVHG WKURXJK WKH FROXPQ LQ LQIORZ PRGH 7KH WUHDWPHQW ODVWHG IRU WZR ZHHNV 7KH VDQG ZDV WKHQ WDNHQ RXW IURP WKH FROXPQ ZDVKHG ZLWK GHLRQL]HG ZDWHU IRU WLPHV DQG UHDG\ IRU REVHUYDWLRQ XQGHU D VFDQQLQJ HOHFWURQ PLFURVFRSH 6FDQQLQJ (OHFWURQ 0LFURVFRS\ 6(0, 0LGORJ SKDVH RI= UDPLJHUD $7&& f FXOWXUH ZDV FHQWULIXJHG DQG ZDVKHG WZLFH ZLWK GHLRQL]HG ZDWHU 7KH VDPSOH ZDV GHK\GUDWHG E\ VRDNLQJ IRU ILYH PLQXWHV VHULDOO\ LQ LQFUHDVLQJ HWKDQRO VROXWLRQV b b b b DQG WZLFH LQ b HWKDQROf ,W ZDV WKHQ IL[HG E\ KH[DPHWK\OGLVLOL]DQH ),0'6f 7KH FXOWXUH ZDV WKHQ PRXQWHG RQ D QXFOHRSRUH ILOWHU )LVKHU 6FLHQWLILF 3LWWVEXUJK 3$f DQG VSXWWHUFRDWHG ZLWK JROG SDUWLFOHV IRU PLQXWHV 7KH VDPSOH ZDV YLHZHG RQ WKH +LWDFKL 6 )LHOG (PLVVLRQ 6(0 1DWXUDO ELRILOPV WKDW GHYHORSHG RQ VDQG ILOWHU PHGLD DIWHU WKH SDVVDJH RI SKHQRO IRUWLILHG SJPOf ZDVWHZDWHU ZHUH DOVR SURFHVVHG DQG REVHUYHG RQ D 6(0 DV GHVFULEHG DERYH

PAGE 40

(IIHFW RI $QWLELRWLFV RQ = UDPLHHUD *URZWK $OO DQWLELRWLFV ZHUH SXUFKDVHG IURP 6LJPD &KHPLFDOV 6W /RXLV 02f 6WRFN VROXWLRQV IRU WULPHWKRSULP PJPOf ZHUH PDGH E\ GLVVROYLQJ J RI WULPHWKRSULP LQ PO EHQ]\O DOFRKRO DQG PO GHLRQL]HG ZDWHU 7KH VROXWLRQV ZHUH SDVVHG WKURXJK D SP ILOWHU )LVKHU 6FLHQWLILF 3LWWVEXUJK 3$f 6WRFN VROXWLRQV IRU SHQLFLOOLQ PJPOf WHWUDF\FOLQH PJPOf VWUHSWRP\FLQ PJPOf VXOIDGLD]LQH PJPOf DQG FHSKDORVSRULQ PJPOf ZHUH PDGH LQ GHLRQL]HG ZDWHU DQG ILOWHU VWHULOL]HG 7HVWV ZHUH FDUULHG RXW E\ DGGLQJ GLIIHUHQW FRQFHQWUDWLRQV RI DQWLELRWLFV LQWR <3 OLTXLG PHGLXP = UDPLJHUD $7&& f ZDV LQRFXODWHG DQG LQFXEDWHG DW r& IRU GD\V *URZWK ZDV GHWHUPLQHG E\ FRPSDULQJ JURZWK LQ WXEHV ZLWKRXW DQWLELRWLFV WR JURZWK LQ WXEHV ZLWK DQWLELRWLFV ,VRODWLRQ RI = UDPLHHUD IURP 1DWXUDO (QYLURQPHQWV ,Q RUGHU WR PDNH PWROXLF DFLG LVRODWLRQ PHGLD WKH IROORZLQJ VROXWLRQV ZHUH XVHG $f 3RWDVVLXP SKRVSKDWH VROXWLRQ 0 O22[f ZDV PDGH E\ DGGLQJ J RI .+3 WR PO GHLRQL]HG ZDWHU 7KH VROXWLRQ ZDV DGMXVWHG S+ WR DQG DXWRFODYHG IRU PLQ %f 0WROXLF DFLG PJPOf VWRFN VROXWLRQ O[f ZDV PDGH E\ PL[LQJ J RI PWROXLF DFLG PO VROXWLRQ $ DQG PO RI ,1 1D2+ 7KH PL[WXUH ZDV KHDWHG XQWLO WKH PWROXLF DFLG ZDV FRPSOHWHO\ GLVVROYHG 7KH S+ ZDV DGMXVWHG WR 7KH VROXWLRQ ZDV SDVVHG WKURXJK D SP SRUH VL]H ILOWHU &f 6DOW VROXWLRQ O22[f ZDV PDGH E\ DGGLQJ J RI 0J64 J RI 1+f6 DQG J RI &D&O WR PO GHLRQL]HG ZDWHU

PAGE 41

'f
PAGE 42

DQGRU SJPO VXOIDGLD]LQH 7KH LVRODWHG EDFWHULDO FRORQLHV ZHUH SXULILHG E\ UH VWUHDNLQJ WKH VDPH PHGLXP WLPHV 7HVWV IRU QLWUDWH UHGXFWLRQ R[LGDVH FDWDODVH *UDP VWDLQ XUHD K\GURO\VLV JOXFRVH XWLOL]DWLRQ LQGROH SURGXFWLRQ &DSSXFFLQR DQG 6KHUPDQ f DQG PHWD FOHDYDJH RI EHQ]HQH GHULYDWLYHV 8Q] DQG )DUUDK f ZHUH FRQGXFWHG WR LGHQWLI\ WKH LVRODWHG VWUDLQV ,VRODWLRQ RI = UDPIHUD ([WUDFHOOXODU 3RO\PHU = UDPLJHUD ZDV LQRFXODWHG LQ <3 PHGLXP DQG LQFXEDWHG DW r& XQWLO ORJ SKDVH 7KH FXOWXUHV ZHUH FHQWULIXJHG DQG ZDVKHG WZLFH ZLWK GHLRQL]HG ZDWHU WKHQ VXVSHQGHG LQ HTXDO YROXPH RI 0 .+3 ILQDO FRQFHQWUDWLRQ LV 0f DQG EOHQGHG 7HNPDU &LQFLQDWL 2KLRf IRU PLQ 7KH PL[WXUH ZDV FHQWULIXJHG IRU PLQ DW [ J DQG WKH SHOOHW ZDV GLVFDUGHG &HW\OWULPHWK\ODPPRQLXP EURPLGH &7$%f ZDV DGGHG WR WKH VXSHUQDWDQW WR D ILQDO FRQFHQWUDWLRQ b ZWYROf 7KH VROXWLRQ ZDV FHQWULIXJHG DIWHU K DW URRP WHPSHUDWXUH 7KH SUHFLSLWDWH ZDV PL[HG ZLWK YROXPHV RI 0 1D&O DQG WKH PL[WXUH ZDV FHQWULIXJHG 7KH VXSHUQDWDQW IUDFWLRQ ZDV GLDO\]HG DJDLQVW GHLRQL]HG ZDWHU DW r& IRU KRXUV 7KH GLDO\]HG VDPSOH ZDV GULHG DQG ZDVKHG ZLWK b HWKDQRO WR UHPRYH WKH UHVLGXDO &7$% )DUUDK DQG 8Q] f 3RO\FORQDO $QWLERGLHV 3URGXFWLRQ )RU SURGXFWLRQ RI WKH DQWLERG\ DJDLQVW FHOO ZDOOV ORJSKDVH = UDPLJHUD FXOWXUHV ZHUH ZDVKHG WZLFH DQG VXVSHQGHG LQ GHLRQL]HG ZDWHU 7KH VXVSHQVLRQ ZDV

PAGE 43

DGMXVWHG WR S+ E\ XVLQJ ,1 1D2+ DQG ERLOHG IRU PLQ WKHQ FRROHG 7KH S+ ZDV UHDGMXVWHG WR DQG WKH VXVSHQVLRQ ZDV ERLOHG IRU DQRWKHU PLQ )LQDOO\ FHOOV ZHUH FHQWULIXJHG DW USP IRU PLQ DQG ZDVKHG WZLFH ZLWK GHLRQL]HG ZDWHU 0LFURVFRSLF H[DPLQDWLRQ ZLWK ,QGLD ,QN UHYHDOHG WKDW FHOOV ZHUH GHYRLG RI WKH H[WUDFHOOXODU SRO\PHU )RUPDOLQ bf ZDV XVHG WR IL[ WKH FHOOV $ IUDFWLRQ RI WKH FHOOV ZDV K\GURO\]HG LQ ,1 1D2+ DQG D SURWHLQ DVVD\ ZDV SHUIRUPHG 3URWHLQ $VVD\ .LW 6LJPD &KHPLFDOV 6W /RXLV 02f &HOO VXVSHQVLRQV ZHUH DGMXVWHG WR PJPO SURWHLQ FRQFHQWUDWLRQV LQ 3%6 EXIIHU DQG ZHUH PL[HG ZLWK DQ HTXDO YROXPH RI )UHXQGV FRPSOHWH DGMXYDQW 6LJPD &KHPLFDOV 6W /RXLV 02f 2QH PO RI WKH VXVSHQVLRQ ZDV WKHQ LQMHFWHG VXEFXWDQHRXVO\ LQWR D UDEELW $IWHU ZHHNV D PO LQRFXOXP RI WKH FHOOV LQ )UHXQGV LQFRPSOHWH DGMXYDQW ZDV LQWUDYHQRXVO\ LQMHFWHG DQG WKLV ZDV UHSHDWHG WZR ZHHNV WKHUHDIWHU 7HQ GD\V DIWHU WKH ILQDO LQMHFWLRQ WKH UDEELWV ZHUH EOHG DQG WKH DQWLVHUXP ZDV FROOHFWHG )RU WKH SURGXFWLRQ RI DQWLERG\ DJDLQVW = UDPLJHUD H[WUDFHOOXODU SRO\PHU WKH H[WUDFHOOXODU SRO\PHU ZDV LVRODWHG IURP WKH FHOOV DV SUHYLRXVO\ GHVFULEHG )DUUDK DQG 8Q] f 7KH VDPH SURFHGXUH ZDV IROORZHG IRU DQWLVHUXP SURGXFWLRQ XVLQJ WKH UDEELWV 8QLPPXQL]HG UDEELW VHUXP 6LJPD &KHPLFDOV 6W /RXLV 02f ZDV XVHG DV QHJDWLYH FRQWURO LQ DOO LPPXQRORJLFDO SURFHGXUHV ,QGLUHFW ,PPXQRIOXRUHVFHQFH 6WDLQLQJ 6DPSOHV ZHUH VSUHDG RQ PLFURVFRSLF VOLGHV DLU GULHG DQG IL[HG ZLWK b b DQG b HWKDQRO VHTXHQWLDOO\ IRU PLQXWHV HDFK WLPH 7KH UDEELW DQWLVHUXP ZDV GLOXWHG

PAGE 44

ZLWK 3%6 EXIIHU DQG DGGHG WR WKH VOLGHV DQG LQFXEDWHG IRU PLQXWHV DW URRP WHPSHUDWXUH LQ D K\GUDWHG FKDPEHU 7KH VOLGHV ZHUH ZDVKHG ZLWK 3%6 EXIIHU VHYHUDO WLPHV 7KHQ ),7&ODEHOHG JRDW DQWLUDEELW ,J* 6LJPDf GLOXWHG LQ 3%6 ZDV DGGHG DQG LQFXEDWHG IRU PLQXWHV 7KH VOLGHV ZHUH WKHQ ZDVKHG WZLFH ZLWK 3%6 EXIIHU $ GURS RI PJPO '$%&2 GLD]DELF\FOR f RFWDQHf 6LJPD &KHPLFDOV 6W /RXLV 02f ZDV DGGHG WR HQKDQFH IOXRUHVFHQFH DQG D FRYHU VOLS ZDV SODFHG RQ WKH VOLGH 7KH VOLGHV ZHUH H[DPLQHG E\ SKDVHFRQWUDFW DQG HSLIOXRUHVFHQFH PLFURVFRS\ )DUUDK DQG 8Q] f (Q]\PH ,PPXQRVWDLQLQJ $OO FKHPLFDOV DQG UHDJHQWV XVHG ZHUH REWDLQHG IURP 6LJPD &KHPLFDOV 6W /RXLV 02f 6DPSOHV ZHUH VSUHDG RQ PLFURVFRSLF VOLGHV DLU GULHG DQG IL[HG ZLWK b b DQG b HWKDQRO VHTXHQWLDOO\ IRU PLQXWHV HDFK WLPH 7KH UDEELW DQWLVHUXP ZDV DGGHG DQG DOORZHG WR UHDFW IRU PLQXWHV 7KH VOLGHV ZHUH ZDVKHG ZLWK 3%6 EXIIHU 7KHQ ELRWLQ FRQMXJDWHG DQWLUDEELW ,J* OGLOXWLRQ ZLWK 3%6 EXIIHUf ZDV DGGHG DQG DOORZHG WR UHDFW IRU PLQXWHV 7KH VOLGHV ZHUH ZDVKHG ZLWK 3%6 EXIIHU DQG SHUR[LGDVHODEHOHG DYLGLQ ZDV DGGHG XQLWV RI SHUR[LGDVH POf DQG UHDFWHG IRU PLQXWHV $IWHU WKH VOLGHV ZHUH ZDVKHG ZLWK 3%6 EXIIHU PO RI WKH VXEVWUDWH DPLQRHWK\O FDUER]ROH $(&f VROXWLRQ YROXPHV RI PJPO $(& GLVVROYHG LQ 1 1GLPHWK\OIRUPDPLGH SOXV YROXPHV RI 0 DFHWDWH EXIIHU >S+ @f ZDV DGGHG 7KHQ SL b + ZDV DGGHG WR WKH VOLGHV WR DFWLYDWH WKH VXEVWUDWH &OHYHODQG DQG 5LFKPDQ f $IWHU PLQ WKH VOLGHV ZHUH ZDVKHG ZLWK 3%6 EXIIHU DQG FKHFNHG XQGHU D OLJKW PLFURVFRSH

PAGE 45

,PPXQRDVVD\ E\ 6FDQQLQJ (OHFWURQ 0LFURVFRS\ 6(0f 7KH VFXP OD\HUV RI ELRILOP ZHUH SXW LQWR PLFURFHQWULIXJH WXEHV DQG ZHUH ZDVKHG WLPHV E\ 7ULVEXIIHUHG VDOLQH 7%6f S+ f WKRURXJKO\ DQG IL[HG E\ b SDUDIRUPDOGHK\GH 3)$f VROXWLRQ IRU PLQ RQ LFH RU PLQ DW URRP WHPSHUDWXUH 6DPSOHV ZHUH ZDVKHG RQFH E\ 7%6 S+ f DQG LQFXEDWHG ZLWK b JHODWLQ LQ 7%6 IRU PLQXWHV 7KUHH PLQXWHV LQFXEDWLRQV ZLWK 0 JO\FLQH LQ 7%6 ZHUH XVHG WR SUHEORFN 7KHQ VDPSOHV ZHUH ZDVKHG E\ PLQXWHV LQFXEDWLRQ ZLWK 7%6 ZLWK b %6$f *RDW VHUXP f ZDV DGGHG WR EORFN IRU PLQXWHV DQG ZDV ZDVKHG ZLWK 7%6 RQFH $ UDEELW DQWLVHUXP f ZDV DGGHG DQG UHDFWHG IRU KRXU DW URRP WHPSHUDWXUH 6DPSOHV ZHUH ZDVKHG IRU PLQXWHV WKUHH WLPHV ZLWK 7%6 ZLWK b %6$ S+ f IROORZHG E\ WZR PLQXWHV ZDVKHV ZLWK 7%6 ZLWK b %6$ S+ f *ROG ODEHOHG JRDW DQWLUDEELW ,J* f ZDV DGGHG DQG LQFXEDWHG IRU KRXU DW URRP WHPSHUDWXUH 6DPSOHV ZHUH ZDVKHG WKUHH WLPHV IRU PLQXWHV ZLWK 7%6 S+ f IROORZHG E\ IL[DWLRQ ZLWK 7UXPSfV VROXWLRQ b IRUPDOGHK\GH b JOXWDUDOGHK\GH LQ SKRVSKDWHEXIIHUHG VDOLQH S+ f IRU PLQXWHV 6DPSOHV ZHUH ZDVKHG WKUHH WLPHV IRU PLQXWHV ZLWK 7%6 S+ f IROORZHG E\ IRXU PLQXWHV XOWUD SXUH ZDWHU ZDVKHV 6LOYHU HQKDQFHPHQW ZDV SHUIRUPHG IRU PLQXWHV DQG ZDV IROORZHG E\ WKUHH PLQXWHV ZDWHU ZDVKHV 6DPSOHV ZHUH WKHQ PRXQWHG RQ QXFOHRSRUH ILWHU )LVKHU 6FLHQWLILF 3LWWVEXUJK 3$f 'HK\GUDWLRQ DQG IL[DWLRQ ZHUH SHUIRUPHG XVLQJ JUDGLHQW DOFRKRO GHK\GUDWLRQ b b b b IRU PLQ HDFK b IRU PLQ WZLFH IROORZHG E\ PLQXWHV KH[DPHWK\OGLVLOL]DQH +0'6f ZDVKHV WZLFH 6DPSOHV ZHUH GULHG FDUERQ FRDWHG IRU VHFRQGV DQG REVHUYHG XQGHU D +LWDFKL 6 )LHOG (PLVVLRQ 6(0

PAGE 46

'HWHUPLQDWLRQ RI 0RVW 3UREDEOH 1XPEHU 031 RI = UDPIHUD LQ :DVWHZDWHU 7UHDWPHQW 3ODQWV DQG /DNH :DWHU $XWRFODYHG ERWWOHV ZHUH SUHSDUHG SULRU WR VDPSOH FROOHFWLRQ 5DZ VHZDJH PL[HG OLTXRU VXVSHQVLRQ XQFKORULQDWHG HIIOXHQW DQG FKORULQDWHG HIIOXHQW ZHUH REWDLQHG IURP WKH 8QLYHUVLW\ RI )ORULGD :DWHU 5HFODPDWLRQ )DFLOLW\ *DLQHVYLOOH )/f 7HQ PJ VRGLXP WKLRVXOIDWH ZDV DGGHG LPPHGLDWHO\ WR FROOHFWHG FKORULQDWHG HIIOXHQW 0L[HG OLTXRU VXVSHQVLRQ SULPDU\ DHURELF GLJHVWHG VOXGJH DQG ILQDO DHURELF GLJHVWHG VOXGJH ZHUH REWDLQHG IURP WKH .DQDSDKD :DWHU 7UHDWPHQW 3ODQW *DLQHVYLOOH )/f /DNH ZDWHU ZDV REWDLQHG IURP /DNH 6KHHODU /DNH *HQHYD /DNH -RKQVRQ &OD\ FRXQW\ )/f /DNH $OWR 6DQWD )H /DNH /DNH $OLFH DQG /DNH %LYDQV $UP $ODFKXD FRXQW\ )/f ,Q WKH 8QLYHUVLW\ RI )ORULGD :DWHU 5HFODPDWLRQ )DFLOLW\ UDZ VHZDJH LV PL[HG ZLWK UHWXUQHG VOXGJH LQ WKH PL[HG OLTXRU WDQN $IWHU WKH DFWLYDWHG VOXGJH SURFHVV VOXGJH VROLGV DUH VHWWOHG DQG VHSDUDWHG IURP WKH VXSHUQDWDQW 7KH PL[HG OLTXRU VXSHUQDWDQW LV WKHQ WUHDWHG E\ UDSLG VDQG ILOWUDWLRQ 7KH HIIOXHQW IURP WKH UDSLG VDQG ILOWHU LV XQFKORULQDWHG HIIOXHQW 7KH XQFKORULQDWHG HIIOXHQW LV WKHQ FKORULQDWHG LQ WKH FKORULQDWLRQ EDVLQ 3DUW RI WKH FKORULQDWHG HIIOXHQW JRHV WR /DNH $OLFH ,Q WKH .DQDSDKD :DVWHZDWHU 7UHDWPHQW 3ODQW DIWHU WKH DFWLYDWHG VOXGJH SURFHVV PL[HG OLTXRU VWDJHf WKH VOXGJH JRHV WKURXJK SULPDU\ DQG VHFRQGDU\ DHURELF GLJHVWLRQ $ WKUHHWXEH 031 SURFHGXUH $PHULFDQ 3XEOLF IIHDOWK $VVRFLDWLRQ f ZDV XVHG WR GHWHUPLQH WKH FRQFHQWUDWLRQ RI = UDPLJHUD DQG WRWDO EDFWHULD LQ ZDVWHZDWHU VDPSOHV )RU GHWHUPLQLQJ WKH 031 IRU WRWDO EDFWHULD VDPSOHV ZHUH VHULDOO\ GLOXWHG LQ <3 PHGLXP DQG LQFXEDWHG IRU XS WR ZHHNV DW r& )RU GHWHUPLQLQJ WKH 031 IRU =

PAGE 47

UDPLJHUD VDPSOHV ZHUH VHULDOO\ GLOXWHG LQ D ILOWHU VWHULOL]HG UDZ VHZDJH 7KH VDPSOHV ZHUH WKHQ VXSSOHPHQWHG ZLWK SJPO SKHQRO GDLO\ DQG LQFXEDWHG DW & XS WR ZHHNV 7KH VFXP OD\HU WKDW GHYHORSHG ZDV H[DPLQHG PLFURVFRSLFDOO\ IRU WKH SUHVHQFH RI W\SLFDO ILQJHUOLNH SURMHFWLRQ DQGRU FHOOV WKDW UHDFWHG ZLWK = UDPLJHUD DQWLVHUD DV GHVFULEHG DERYH &KORURSK\OO FRQFHQWUDWLRQV MMJf LQ ODNHV ZHUH GHWHUPLQHG E\ SLJPHQW H[WUDFWLRQ ZLWK HWKDQRO 6DUWRU\ DQG *UREEHODDU f IROORZHG E\ VSHFWURSKRWRPHWULFDO PHDVXUHPHQW PHWKRG +Ff $PHULFDQ 3XEOLF +HDOWK $VVRFLDWLRQ f 7RWDO SKRVSKRUXV FRQFHQWUDWLRQ SJf LQ ODNHV ZHUH GHWHUPLQHG E\ D SHUVXOIDWH GLJHVWLRQ 0HQ]HO DQG &RUZLQ f IROORZHG E\ WKH SURFHGXUHV RI 0XUSK\ DQG 5LOH\ f 7RWDO QLWURJHQ FRQFHQWUDWLRQV SJf ZHUH GHWHUPLQHG XVLQJ WKH SURFHGXUH GHVFULEHG E\ %DFKPDQQ DQG &DQILHOG -U f 573&5 51DVH IUHH ZDWHU ZDV REWDLQHG E\ WUHDWLQJ WKH ZDWHU ZLWK b '(3& GLHWK\O S\URFDUERQDWHf 6LJPD &KHPLFDOV 6W /RXLV 02f 'HLRQL]HG ZDWHU ZLWK b '(3& ZDV VKDNHQ YLJRURXVO\ WR EULQJ WKH '(3& LQWR VROXWLRQ 7KH VROXWLRQ ZDV WKHQ LQFXEDWHG IRU KRXUV DW r& DQG DXWRFODYHG IRU PLQXWHV WR UHPRYH DQ\ WUDFH RI '(3& $OO VROXWLRQV ZHUH PDGH E\ XVLQJ 51DVH IUHH ZDWHU ,VRSRUSDQRO 0RSV PRUSKROLQRf SURSDQHVXOIRQLF DFLGf 3PHUFDSWRHWKDQRO [ 7ULV('7$ EXIIHU DQG O\VR]\PH ZHUH SXUFKDVHG IURP 6LJPD &KHPLFDOV 6W /RXLV 02f 51DVH $:$< )LVKHU 6FLHQWLILF

PAGE 48

VSULQILHOG 1-f ZDV XVHG WR NHHS ZRUNLQJ DUHDV DQG SLSHWV 51DVH IUHH 51DVH IUHH SLSHW WLSV DQG 3&5 WXEHV ZHUH REWDLQHG E\ DXWRFODYLQJ RYHUQLJKW 7KH VHTXHQFH RI= UDPLJHUD $7&& f6 U51$ ZDV UHWULHYHG IURP *HQH %DQN =56551$f 7KH XSVWUHDP DQG GRZQVWUHDP SULPHUV ZHUH VSHFLILF IRU = UDPLJHUD 6 U51$ DQG SXUFKDVHG IURP *HQRV\V 7KH :RRGODQGV 7H[DVf 6HTXHQFH IRU WKH XSVWUHDP SULPHU LV &&* $7* 7&* *$7 7$* &7$ *77 ** SRVLWLRQ WR f 6HTXHQFH IRU WKH GRZQVWUHDP SULPHU LV $$7 *$* 7&7 &&7 &$& &*$ $&$ $&7 $* SRVLWLRQ WR f 7KH O\RSKLOL]HG SULPHUV ZHUH VXVSHQGHG LQ '1DVH DQG 51DVH IUHH ZDWHU DQG LQFXEDWHG DW r& IRU FRPSOHWH GLVVROXWLRQ %DFWHULDO 6 U51$ ZHUH LVRODWHG E\ XVLQJ 4,$*(1 51$'1$ PLQL NLW 9DOHQFLD &$f %ULHIO\ [ r EDFWHULDO FHOOV ZHUH FHQWULIXJHG DQG UHVXVSHQGHG LQ SL RI O\VR]PHFRQWDLQLQJ 7( EXIIHU IRU PLQ 7KHQ WKH O\VLQJ EXIIHU ZDV DGGHG WR WKH VROXWLRQ DV GHVFULEHG LQ WKH NLW 7KH 6 U51$ ZDV LVRODWHG H[DFWO\ E\ XVLQJ WKH 7RZ PROHFXODU ZHLJKW 51$ LVRODWLRQf SURFHGXUH LQ WKH NLW 4,$*(1 WLS LV DQLRQH[FKDQJH FROXPQ ZKLFK FDQ EH XVHG WR VHOHFWLYHO\ LVRODWH '1$ 51$ DQG ORZ PROHFXODU ZHLJKW U51$ 573&5 NLW ZDV SXUFKDVHG IURP 3URPHJD 3LWWHVEXUJK 3$f 573&5 ZDV SHUIRUPHG LQ D WRWDO YROXPH RI SL UHDFWLRQ PL[WXUH FRQWDLQLQJ P0 GHR[\QXFOHRVLGH WULSKRVSKDWH P0 0J6 8 RI $09 UHYHUVH WUDQVFULSWDVH 8 RI 7O '1$ SRO\PHUDVH S0 RI WKH SULPHUV ZKLFK DUH VSHFLILF IRU = UDPLJHUD 6 U51$ SJ RI WHPSODWH DQG ,; UHDFWLRQ EXIIHU 7KH F\FOLQJ SURILOH LQYROYHG r& UHYHUVH WUDQVFULSWLRQ IRU PLQXWHV r& $09 UHYHUVH WUDVULSWDVH LQDFWLYDWLRQ DQG

PAGE 49

51$F'1$SULPHU GHQDWXUDWLRQ F\FOHV RI GHQDWXUDWLRQ DW r& IRU VHFRQGV DQQHDOLQJ DW r& IRU PLQXWH DQG H[WHQVLRQ DW r& IRU PLQXWHV IROORZHG E\ F\FOH RI ILQDO H[WHQVLRQ DW r& IRU PLQXWHV $OLTXRWHV JOf RI WKH 3&5 SURGXFWV ZHUH HOHFWURSKRUHVHG WKURXJK b DJURVH JHO 6LJPD &KHPLFDOV 6W /RXLV 02f *HO VWDU )0& %LRSURGXFWV 5RFNODQG 0(f ZDV XVHG WR ORFDWH WKH '1$ EDQGV *OYFRVYO &RPSRVLWLRQ $QDO\VLV EY *&06 = UDPLJHUD H[WUDFHOOXODU SRO\PHU ZDV LVRODWHG DV GHVFULEHG RQ SDJH $IWHU b HWKDQRO WUHDWPHQW GHLRQL]HG ZDWHU ZDV XVHG WR ZDVK HWKDQRO IURP WKH H[WUDFHOOXODU SRO\PHU 7KH H[WUDFHOOXODU SRO\PHU WKHQ GLVSHUVHG LQWR GHLRQL]HG ZDWHU DQG KRPRJHQL]HG E\ EOHQGLQJ IRU PLQ *&06 DQDO\VLV RI 706 PHWK\O JO\FRVLGHV ZDV XVHG WR GHWHUPLQH WKH JO\FRV\O FRPSRVLWLRQ RI = UDPLJHUD H[WUDFHOOXODU SRO\PHU 7KH 706 PHWK\O JO\FRVLGHV ZHUH SUHSDUHG E\ PHWKDQRO\VLV LQ PHWKDQROLF 0 +& DW r& IRU KRXUV UH1DFHW\ODWHG DQG WULPHWK\VLO\ODWHG &KDSOLQ f $ 6KLPDG]X 43 *&06 ZRUN VWDWLRQ ZDV XVHG IRU *&06 DQDO\VLV E\ VWDIIV DW WKH 8QLYHUVLW\ RI )ORULGD *O\FRELRORJ\ &RUH /DE 'XULQJ WKH H[SHULPHQW H[WHUQDO VWDQGDUGV ZKLFK FRQVLVWHG RI NQRZQ PRODU FRQFHQWUDWLRQ RI LQRVLWRO DQG HDFK PRQRVDFFKDULGH LQ WKH K\GURO\VDWH ZHUH XVHG &DOFXODWLRQV RI HDFK PRQRVDFFKDULGH ZHUH EDVHG RQ UHVSRQVH IDFWRUV ZKLFK ZDV WKH UDWLR RI SHDN DUHD IRU HDFK PRQRVDFFKDULGH WR D PRODU RI WKH PRQRVDFFKDULGH UHODWLYH WR WKDW IRU LQRVLWRO

PAGE 50

=HWD 3RWHQWLDO 0HDVXUHPHQW = UDPLJHUD $7&& f f= UDPLJHUD f 0 $7&& f 'XJDQHOOD ]RRJORHRLGHV $7&& f ZHUH LQRFXODWHG LQ <3 PHGLXP DQG LQFXEDWHG DW r& XQWLO ORJ SKDVH 7KH FXOWXUHV ZHUH FHQWULIXJHG ULQVHG WZLFH ZLWK GHLRQL]HG ZDWHU 7KH EDFWHULD ZHUH UHVXVSHQGHG LQ GLVWLOOHG ZDWHU S+ f WR D ILQDO FRQFHQWUDWLRQ RI [ &)8PO 'LVWLOOHG ZDWHU ZDV FKRVHQ WR PLQLPL]H DQ\ FKDQJH VKLHOGLQJ ZLWKLQ WKH LQYDOLGDWLRQ RI WKH DVVXPHG HTXDOLW\ EHWZHHQ WKH PHDVXUHG ]HWD SRWHQWLDO DQG WKH VXUIDFH SRWHQWLDO 7KH ]HWD SRWHQWLDO PHDVXUHPHQWV ZHUH FDUULHG RXW ZLWK WKH XVH RI D %URRNKDYHQ ,QVWUXPHQWV =HWDSOXV 0RGHO 9 ]HWD SRWHQWLDO DQDOL]HU +ROWVYLOOHU 1
PAGE 51

KHDW 1H[W b PDODFKLWH JUHHQ ZDV DGGHG WR WKH VOLGH DQG UHDFWHG IRU PLQ 'HLRQL]HG ZDWHU ZDV XVHG WR ZDVK WKH VOLGHV 7KH VOLGHV ZHUH WKHQ REVHUYHG XQGHU EULJKW ILHOG PLFURVFRSH %LWWRQ DQG .RRSPDQ 'XWWRQ HW DO f 7KH (IIHFW RI &KORULQH RQ = UDPLHHUD :LWK RU :LWKRXW ([WUDFHOOXODU 3RO\PHU = UDPLJHUD ZDV LQRFXODWHG LQ <3 PHGLXP RU ORZ 0Jnr &D VDOW PLQLPDO PHGLXP J JO\FHURO J 1+f6 J VRGLXP ODFWDWH J .1 J .+3 J &D&O J 0J6f DQG LQFXEDWHG DW r& XQWLO ORJ SKDVH 7KH FXOWXUHV ZHUH FHQWULIXJHG DW USP IRU PLQ 7KH SHOOHW ZKLFK FRQWDLQHG PRVWO\ IORHV ZDV GLVFDUGHG 7KH VXSHUQDWDQW ZDV IXUWKHU FHQWULIXJHG DW USP IRU PLQ 7KH SHOOHW ZKLFK FRQWDLQHG ERWK IUHH FHOOV DQG FHOOV LQ IORHV ZDV UHVXVSHQGHG LQ GHLRQL]HG ZDWHU 'LIIHUHQW FRQFHQWUDWLRQV RI FKORULQH ZHUH DGGHG ,QWR WKH VXVSHQVLRQ IRU PLQ 7KH GHWHUPLQDWLRQ RI FKORULQH FRQFHQWUDWLRQ DQG WKH 0,17 WHVW ZHUH SHUIRUPHG DV GHVFULEHG DERYH %DFWHULRSKDJH $VVD\ 35' LV DQ LFRVDKHGUDO OLSLG SKDJH FKDUDFWHUL]HG E\ D GLDPHWHU RI QP 7KH LVRHOHFWULF SRLQW RI 35' LV EHWZHHQ WR LQ D FDOFLXPSKRVSKDWH EXIIHU 2n 0 &Df 3LHSHU HW DO f ,W JURZV RQ ,WV KRVW 6DOPRQHOOD W\SKLPXULXP $7&& f 06 LV DQ LFRVDKHGUDO SKDJHV ZLWK DQ DYHUDJH GLDPHWHU RI aQP DQG KDV LVRHOHFWULF SRLQW RI /LQ HW DO f ,W JURZV RQ LWV KRVW (VFKHULFKLD FROL & $7&& f %RWK YLUXVHV ZHUH DVVD\HG DV SODTXH IRUPLQJ XQLW PHWKRG 6QXVWDG DQG 'HDQ f

PAGE 52

3UHSDUDWLRQ RI $OXPLQXP +\GUR[LGH &RDWHG 6DQG $ 8 6 6WDQGDUG 1R VLHYH ZDV XVHG WR FROOHFW VDQG SDUWLFOHV RI SP LQ GLDPHWHU IURP [ PHVKHV 2WWDZD VDQGV )LVKHU 6FLHQWLILF 6SULQJILHOG 1-f 7KH JUDGHG VDQG ZDV ULQVHG ZLWK GHLRQL]HG ZDWHU XQWLO WKH VXSHUQDWDQW ZDV FOHDU 7KH VDQG ZDV WKHQ DLU GULHG 7KH VDQG ZDV SODFHG LQ 0 RI $&+ )LVKHU 6FLHQWLILF 6SULQJILHOG 1-f VROXWLRQ IRU PLQXWHV 7KH H[FHVV VROXWLRQ ZDV GUDLQHG RII 7KHQ WKH VDQG ZDV DLUGULHG IRU KRXUV 7KH GULHG VDQG ZDV WKHQ VRFNHG LQ 0 DPPRQLXP K\GUR[LGH IRU PLQXWHV WR SUHFLSLWDWH DOXPLQXP K\GUR[LGHV RQ WKH VDQG 7KH VDQG ZDV DLU GULHG DQG WKHQ ULQVHG ZLWK GHLRQL]HG ZDWHU YLJRURXVO\ WR UHPRYH ORRVH SUHFLSLWDWH WKHQ DLU GULHG DJDLQ :DVWHZDWHU ([SRVXUH RI WKH &RDWHG 6DQGV 8QFRDWHG VDQG DQG D SRUWLRQ RI FRDWHG VDQG ZLWKRXW H[SRVXUH WR ZDVWHZDWHU ZHUH XVHG DV QHJDWLYH DQG SRVLWLYH FRQWUROV UHVSHFWLYHO\ 7KH FRDWHG VDQG ZDV SDFNHG LQWR DFU\OLF FROXPQV FP [ Pf :DVWHZDWHU HIIOXHQW IURP 8QLYHUVLW\ RI )ORULGD :DWHU 5HFODPDWLRQ )DFLOLW\ ZDV XVHG LQ WKLV VWXG\ 7KH W\SLFDO FRPSRVLWLRQV RI ZDVWHZDWHU HIIOXHQW ZHUH PJ WRWDO .MHOGDKO QLWURJHQ PJ RUWKRSKRVSKDWH PJ WRWDO SKRVSKDWH 178 WXUELGLW\ SPKRVFP FRQGXFWLYLW\ PJO 0Jr PJ &D? PJ 11 PJ 1+1 PJ &D& DONDOLQLW\f S+ 7KH H[SHULPHQWV ZHUH FDUULHG RXW DW URRP WHPSHUDWXUH 'HFKORULQDWLRQ RI ZDVWHZDWHU HIIOXHQW ZDV GRQH ZLWK VRGLXP WKLRVXOIDWH &KORULQDWHG ZDVWHZDWHU HIIOXHQW ZDV REWDLQHG E\ WUHDWLQJ ZDWHU ZLWK PJ DPPRQLD QLWURJHQ IROORZHG E\ WLWUDWLRQ ZLWK VRGLXP

PAGE 53

K\SRFKORULWH &ORUR[ 3URIHVVLRQDO 3URGXFWV 2DNODQG &$f VR WKDW ILQDO FRPELQHG FKORULQH ZDV PJ FKORULQH 7KH XSIORZ UDWH ZDV POPLQ DQG WKXV WKH VXSHUILFLDO YHORFLW\ ZDV PPV 7KH FROXPQV ZHUH EDFN ZDVKHG HYHU\ KRXUV DW D VXSHUILFLDO YHORFLW\ RI PPV IRU PLQXWHV WR IOXLGL]H WKH VDQG %HIRUH HDFK VDPSOLQJ WKH VDQG ZDV WDNHQ RXW IURP WKH FROXPQV DQG ULQVHG ZLWK ILOWHUVWHULOL]HG ZDVWHZDWHU WR UHPRYH ORRVHO\ DWWDFKHG ELRPDVV 3RUWLRQV RI WKH VDQG ZHUH XVHG IRU D SURWHLQ DVVD\ ]HWD SRWHQWLDO PHDVXUHPHQWV DQG YLUXV UHPRYDO DVVD\ E\ EDWFK DQG FROXPQ H[SHULPHQWV 7KH UHVW RI WKH VDQG ZDV UHWXUQHG WR WKH FROXPQV DQG WKH ZDVWHZDWHU SDVVLQJ ZDV FRQWLQXHG 6XUIDFH &KDUDFWHUL]DWLRQ RI WKH 6DQGV 3URWHLQ DVVD\V ZHUH FRQGXFWHG E\ WKH PRGLILHG /RZW\ PHWKRG %HQVDGRXQ DQG :HLQVWHLQ 3HWHUVRQ f DQG WKH SURFHGXUH ZKLFK ZDV GHVFULEHG LQ WKH 6LJPD 3URWHLQ $VVD\ .LW 6LJPD &KHPLFDOf %ULHIO\ J RI WKH VDQG VDPSOHV ZHUH LPPHUVHG LQ PO RI 1 1D2+ WR H[WUDFW WKH SURWHLQ 7KH VXSHUQDWDQW ZDV DVVD\HG DFFRUGLQJ WR WKH LQVWUXFWLRQ LQ WKH SURWHLQ DVVD\ NLW 7KH ]HWD SRWHQWLDOV RI WKH VDQGV ZHUH PHDVXUHG ZLWK D VWUHDPLQJ SRWHQWLDO DSSDUDWXV DV GHVFULEHG SUHYLRXVO\ &KHQ HW DO 7UXHVGDLO HW DO f %DWFK DQG &ROXPQ 5HPRYDO RI %DFWHULRSKDJHV %DFWHULRSKDJH UHPRYDOV E\ EDWFK WHVWV ZHUH GHWHUPLQHG DV IROORZV 06 DQG 35' ZHUH GLOXWHG LQ D ILOWHUVWHULOL]HG SPf PLOOLPRODU LRQLF VWUHQJWK DUWLILFLDO

PAGE 54

JURXQGZDWHU $*:f / GHLRQL]HG ZDWHU PJ 0J6+ PJ &D6+ PJ 1D+& PJ 1D&O DQG PJ .1f 0F&DXORX HW DO f WR SURGXFH D ILQDO FRQFHQWUDWLRQ RI V 3)8PO IRU HDFK EDFWHULRSKDJH 8QFRDWHG VDQG DOXPLQXP K\GUR[LGH FRDWHG VDQG ZLWKRXW ZDVWHZDWHU H[SRVXUH DOXPLQXP K\GUR[LGH FRDWHG VDQG H[SRVHG WR GHFKORULQDWHG ZDVWHZDWHU DQG DOXPLQXP K\GUR[LGH FRDWHG VDQG H[SRVHG WR FKORULQDWHG ZDVWHZDWHU ZHUH XVHG IRU WHVWLQJ %ULHIO\ IRXU JUDPV RI VDQG ZHUH DGGHG WR PO RI EDFWHULRSKDJH VXVSHQVLRQ LQ SRO\SURS\OHQH WXEHV )LVKHU 6FLHQWLILF 6SULQJILHOG 1-f DQG WKH PL[WXUHV ZHUH VKDNHQ IRU PLQ XVLQJ D FP GLDPHWHU ZKHHO ZKLFK ZDV URWDWHG YHUWLFDOO\ DW UHYPLQ DW URRP WHPSHUDWXUH 7KH EDFWHULRSKDJH VXVSHQVLRQ ZLWKRXW VDQG ZDV DOVR VKDNHQ LQ WKH ZKHHO DORQJ ZLWK RWKHU VDPSOHV DV D FRQWURO $OO VDQGV ZHUH WHVWHG LQ WULSOLFDWH 3DUDOOHO FROXPQ WHVWV RQ GD\V DQG ZHUH FDUULHG RXW DV IROORZV )RXU DFU\OLF VDQG FROXPQV FP ,' [ Pf ZHUH XVHG LQ XSIORZ PRGH 7KH IRXU VDQG FROXPQV ZHUH XQFRDWHG VDQGV DOXPLQXP K\GUR[LGH FRDWHG VDQGV ZLWKRXW H[SRVXUH WR ZDVWHZDWHU HIIOXHQW DOXPLQXP K\GUR[LGH FRDWHG VDQGV H[SRVHG WR FKORULQDWHG ZDVWHZDWHU DQG DOXPLQXP K\GUR[LGH FRDWHG VDQG H[SRVHG WR GHFKORULQDWHG HIIOXHQW $ VXVSHQVLRQ FRQWDLQLQJ V 3)8PO RI HDFK EDFWHULRSKDJH LQ $*: ZDV SDVVHG WKURXJK WKH FROXPQ DW D UDWH RI POPLQ (IIOXHQWV UHSUHVHQWLQJ VWHDG\ VWDWH FRQGLWLRQV SRUH YROXPHVf ZHUH FROOHFWHG &KHQ HW DO f %DFWHULRSKDJH FRQFHQWUDWLRQV LQ LQIIOXHQW DQG HIIOXHQW ZHUH DQDO\]HG E\ WKH SODTXH DVVD\ SURFHGXUH

PAGE 55

$OO SODTXH DVVD\V IRU ERWK EDWFK DQG FROXPQ H[SHULPHQWV ZHUH FRQGXFWHG LQ WULSOLFDWHV 9LUXV UHPRYDO FDSDFLWLHV RI WKH VDQGV ZHUH LQGLFDWHG LQ WHUPV RI SHUFHQW UHPRYDO RI 06 RU 35' 6WXGHQWfV W WHVW ZLWK D S YDOXH RI ZDV XVHG WR GHILQH VWDWLVWLFDO VLJQLILFDQFH

PAGE 56

5(68/76 0RUSKRORJ\ RI = UDPLYHUD = UDPLJHUD LV D IORFIRUPLQJ EDFWHULD DQG SURGXFHV DQ H[WUDFHOOXODU SRO\PHU 3UHYLRXVO\ QHJDWLYH VWDLQLQJ E\ ,QGLD ,QN LQGLFDWHG WKDW FHOOV DUH LQVLGH WKH H[WUDFHOOXODU SRO\PHU LQ ERWK ILQJHUOLNH SURMHFWLRQV DQG DPRUSKRXV IORHV )DUUDK f ,Q WKLV VWXG\ VFDQQLQJ HOHFWURQ PLFURVFRS\ ZDV XVHG WR UHYHDO WKH GHWDLO VWUXFWXUH RI = UDPLJHUD ILQJHUOLNH SURMHFWLRQV DQG DPRUSKRXV IORHV $ VHFWLRQ RI D EUDQFKLQJ ]RRJORHDO SURMHFWLRQ LV VKRZQ LQ )LJ % 7KH FHOOV DUH RUJDQL]HG LQ WKH ILQJHU $ KLJKHU PDJQLILFDWLRQ YLHZ RI D ]RRJORHDO SURMHFWLRQ UHYHDOV WKH SUHVHQFH RI ILEULOV UXQQLQJ DORQJ DQG EHWZHHQ WKH FHOOV )LJ $f 7KLV ILEULO LV OLNHO\ WKH H[WUDFHOOXODU SRO\PHU SURGXFHG E\ = UDPLJHUD 7KH SUHVHQFH RI FHOOV ZLWKLQ WKH ]RRJORHDO H[WUDFHOOXODU SRO\PHU LV FOHDUO\ VKRZQ LQ )LJ ,Q WKH FDVH RI DPRUSKRXV IORHV FHOOV XVXDOO\ HPEHG LQVLGH DQ H[FHVVLYH H[WUDFHOOXODU SRO\PHU )LJ &f 3UHYLRXV VWXGLHV KDYH VKRZQ WKDW = UDPLJHUD FDQ XWLOL]H VHYHUDO DURPDWLF FRPSRXQGV DQG WKHVH FDQ EH XVHG WR HQULFK VDPSOHV IRU ILQJHUOLNH ]RRJORHDH 8Q] DQG )DUUDK :LOOLDPV DQG 8Q] f ([DPLQDWLRQ RI VDQG SDUWLFOHV IURP D FROXPQ WKDW KDG UHFHLYHG UDZ VHZDJH VXSSOHPHQWHG ZLWK SJPO RI SKHQRO UHYHDOHG QDWXUDO ILQJHUOLNH SURMHFWLRQ VWUXFWXUHV WKDW UHVHPEOHG WKRVH REVHUYHG LQ ODERUDWRU\ FXOWXUHV RI = UDPLJHUD )LJ f 7KH VWUXFWXUHV DUH VPDOOHU LQ GLDPHWHU WKDQ WKRVH REVHUYHG LQ

PAGE 57

ODERUDWRU\ FXOWXUHV )LJ %f EXW VKRZ FHOOV LQ VLPLODU DUUDQJHPHQWV DQG ZLWK VLPLODU ILEULOV 7KHUH ZHUH OLWWOH ILQJHUOLNH SURMHFWLRQV REVHUYHG LQ ELRILOP GHYHORSHG RQ WKH VXUIDFH RI VDQGV ZKLFK KDG EHHQ SDVVHG WKURXJK ZDVWHZDWHU ZLWKRXW D SKHQRO VXSSOHPHQW &KHQ HW DO f 7KHUHIRUH WKH VXSSOHPHQW ZLWK SKHQRO LV HIIHFWLYH IRU SURGXFWLRQ RI = UDPLJHUD HQULFKHG ELRILOP ,VRODWLRQ RI = UDP MHHU D IURP 1DWXUDO (QYLURQPHQWV = UDPLJHUD LV VHQVLWLYH WR SHQLFLOOLQ WHWUDF\FOLQH VWUHSWRP\FLQ DQG FHSKDORVSRULQ 7ULPHWKRSULPVXOIDPHWKR[D]ROH 70360=f DUH XVHG IRU SUHYHQWLRQ RI RSSRUWXQLVWLF LQIHFWLRQ LQ KXPDQ LPPXQRGHILFLHQF\YLUXVLQIHFWHG SHUVRQ .DSODQ HW DO f DQG IRU SUHYHQWLRQ RI UHODSVHV LQ SDWLHQW ZLWK :HJHQHUfV JUDQXORPDWRVLV LQ UHPLVVLRQ DIWHU UHVSLUDWRU\ WUDFW LQIHFWLRQ 6WHJHPDQ HW DO f 7KH PLQLPDO LQKLELWLRQ FRQFHQWUDWLRQV 0,&f RI WULPHWKRSULP DQG VXOIDGLD]LQH IRU = UDPLJHUD DUH KLJKHU WKDQ SJPO DQG JUHDWHU WKHQ SJPO UHVSHFWLYHO\ 7DEOH f 6LQFH D PWROXLF DFLG LVRODWLRQ PHGLXP ZDV XVHG IRU LVRODWLRQ RI = UDPLJHUD IURP QDWXUDO HQYLURQPHQWV 8Q] DQG )DUUDK f PWROXLF DFLG LVRODWLRQ PHGLXP DQG PWROXLF DFLG LVRODWLRQ PHGLXP FRPELQHG ZLWK WULPHWKRSULP DQG VXOIDGLD]LQH ZDV XVHG WR LVRODWH = UDPLJHUD IURP DFWLYDWHG VOXGJH ELRILOP GHYHORSHG RYHU UDZ VHZDJH DQG ELRILOP GHYHORSHG IURP /DNH $OLFH ZDWHU UHVSHFWLYHO\ &ORQHV UHVHPEOHG = UDPLJHUD ZHUH SLFNHG XS DQG IXUWKHU SXULILHG DQG LGHQWLILHG ,VRODWHV ZKLFK ZHUH *UDP QHJDWLYH XUHDVH SRVLWLYH FDWDODVH SRVLWLYH R[LGDVH SRVLWLYH QLWUDWH UHGXFWLRQ PHWD FOHDYDJH RI FDWHFKRO LQGROH QHJDWLYH

PAGE 58

DQG QR SURGXFWLRQ RI JDV RU DFLG IURP JOXFRVH ZHUH IXUWKHU LGHQWLILHG E\ LQGLUHFW LPPXQRDVVD\ PHWKRGV 7KH LVRODWLRQ HIILFLHQF\ REWDLQHG ZDV LQFUHDVHG IURP b WR RYHU b E\ XVLQJ WKH FRPELQDWLRQ PHGLD 7DEOH f 7KH FRPELQDWLRQ PHGLD ZHUH HVSHFLDOO\ HIIHFWLYH ZKHQ = UDPLJHUD ZDV QRW DEXQGDQW LQ QDWXUDO HQYLURQPHQWV VXFK DV LQ /DNH $OLFH ZDWHU 1R V\QHUJLVWLF HIIHFW ZDV REVHUYHG EHWZHHQ WULPHWKRSULP DQG VXOIDGLD]LQH ,PPXQRORJLFDO 0HWKRGV IRU 'HWHFWLRQ RI = UDPIHUD IURP 1DWXUDO (QYLURQPHQWV ,QLWLDO WHVWV XVLQJ D ),7&ODEHOHG VHFRQGDU\ DQWLERG\ VKRZHG WKDW WKH DQWLERG\ DJDLQVW = UDPLJHUD FHOOV RU WKH PDWUL[ RQO\ UHDFWHG ZLWK = UDPLJHUD EXW QRW ZLWK RWKHU ODERUDWRU\ FXOWXUHV RI WKH EDFWHULD OLVWHG LQ WKH 0DWHULDOV DQG 0HWKRGV VHFWLRQ LQFOXGLQJ f= UDPLJHUD f ,0 RU 'XJDQHOOD ]RRJOHRLGHV $OVR GXULQJ WKH FRXUVH RI WKLV LQYHVWLJDWLRQ = UDPLJHUD DQWLVHUD ZHUH REVHUYHG WR UHDFW ZLWK WKH FHOOV DQG WKH H[WUDFHOOXODU SRO\PHU DVVRFLDWHG ZLWK QDWXUDO ILQJHUOLNH SURMHFWLRQV EXW QRW ZLWK RWKHU EDFWHULD IURP QDWXUDO VDPSOHV $ SRUWLRQ RI D VFXP OD\HU WKDW GHYHORSHG RYHU UDZ VHZDJH HQULFKHG ZLWK SJPO RI SKHQRO DQG WUHDWHG ZLWK WKH SULPDU\ DQWLERG\ DJDLQVW WKH H[WUDFHOOXODU SRO\PHU IURP = UDPLJHUD IROORZHG E\ ),7&ODEHOHG VHFRQGDU\ DQWLERG\ LV VKRZQ LQ )LJ $ ILQJHUOLNH ]RRJORHDO SURMHFWLRQ REVHUYHG XVLQJ OLJKW PLFURVFRS\ DQG SKDVH FRQWUDVW RSWLFV LV VKRZQ LQ )LJ $ 7KH VDPH ILHOG REVHUYHG ZLWK 89 LOOXPLQDWLRQ LV VKRZQ LQ )LJ % 2QO\ ILQJHUOLNH SURMHFWLRQV FKDUDFWHULVWLF RI = UDPLJHUD ZHUH REVHUYHG WR IOXRUHVFH XQGHU 89 OLJKW

PAGE 59

)LJ 6(0 RI = UDPLJHUD $7&& f ZKLFK ZDV JURZQ LQ <3 PHGLXP J \HDVW H[WUDFW JO SHSWRQHf IRU KRXUV DW r& nV

PAGE 60

)LJ 6(0 RI VDQG H[SRVHG WR UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO IRU ZHHNV

PAGE 61

7DEOH 7KH HIIHFW RI DQWLELRWLFV RQ = UDPLJHUD JURZWK $QWLELRWLFV SJPOf WULPHWKRSULP VXOIDGLD]LQH = UDPJHUJ JURZWK 1RWH = UDPLJHUD $7&& f ZDV LQRFXODWHG LQ <3 PHGLXP J \HDVW H[WUDFW J SHSWRQHf VXSSOHPHQWHG ZLWK GLIIHUHQW FRQFHQWUDWLRQV RI WULPHWKRSULP RU VXOIDGLD]LQH DQG LQFXEDWHG DW r&

PAGE 62

7DEOH 7KH HIIHFW RI GLIIHUHQW PHGLD RQ WKH LVRODWLRQ RI UDPLJHUD IURP QDWXUDO HQYLURQPHQWV 0HGLD 1R RI VDPSOHV SURFHVVHG 1R RI FRORQLHV SXULILHG IURP VDPQOHV 1R RI = UDPLJHUD LVRODWHG
PAGE 63

:KHQ WKH VFXP OD\HUV ZHUH H[DPLQHG LQ D VLPLODU PDQQHU EXW XVLQJ SULPDU\ DQWLERG\ DJDLQVW = UDPLJHUD FHOOV IROORZHG E\ ),7&ODEHOHG VHFRQGDU\ DQWLERG\ FHOOV ZLWKLQ W\SLFDO ]RRJORHDO SURMHFWLRQV IOXRUHVFHQFHG ZKLOH RWKHU FHOOV GLG QRW 7KH UHVXOWV ZHUH VLPLODU WR SUHYLRXVO\ SXEOLVKHG UHVXOWV )DUUDK DQG 8Q] f 2EVHUYDWLRQ RI WKH VFXP OD\HUV IURP VDPSOHV RI UDZ VHZDJH HQULFKHG ZLWK SKHQRO DQG WUHDWHG ZLWK WKH SULPDU\ DQWLERG\ DJDLQVW WKH FHOOV RU H[WUDFHOOXODU SRO\PHU IURP = UDPLJHUD DUH VKRZQ LQ )LJ 7KHVH VDPSOHV ZHUH WKHQ WUHDWHG ZLWK ELRWLQ ODEHOHG VHFRQGDU\ DQWLERG\ DYLGLQSHUR[LGDVH DQG VXEVWUDWH $(& DQG H[DPLQHG XVLQJ OLJKW PLFURVFRS\ &HOOV ZLWKLQ ]RRJORHDO SURMHFWLRQV )LJ $f RU H[WUDFHOOXODU SRO\PHU VXUURXQGLQJ ]RRJORHDO SURMHFWLRQV )LJ %f ZHUH VWDLQHG GDUN UHG E\ WKLV SURFHGXUH DQG DUH VKRZQ DV WKH GDUNHU FHOOV DQG SURMHFWLRQV LQ )LJ 6(0 LPDJHV RI WKH VFXP OD\HUV WUHDWHG ZLWK WKH SULPDU\ DQWLERG\ DJDLQVW WKH = UDPLJHUD H[WUDFHOOXODU SRO\PHU DQG JROGODEHOHG VHFRQGDU\ DQWLERG\ DUH VKRZQ LQ )LJ 7KH ODEHO LV VXUURXQGLQJ WKH ]RRJORHDO SURMHFWLRQ LQ WKH VDPSOHV ZKLFK ZHUH H[DPLQHG E\ XVLQJ VHFRQGDU\ HOHFWURQV )LJ $ )LJ &f DQG EDFN VFDWWHUHG HOHFWURQV )LJ % )LJ 'f ZKLFK DUH SURGXFHG E\ WKH JROG SDUWLFOHV DWWDFKHG WR WKH VHFRQGDU\ DQWLERG\ ,Q )LJ $ DQG )LJ % LW DSSHDUV WKDW PRUH DQWLERGLHV KDG UHDFWHG ZLWK WKH HQG RI ]RRJORHDO SURMHFWLRQ WKDQ ZLWK WKH PDLQ ERG\ RI WKH SURMHFWLRQ 7KH UHVXOWV REWDLQHG XVLQJ VLPLODU SURFHGXUHV EXW ZLWK WKH SULPDU\ DQWLERG\ DJDLQVW = UDPLJHUD FHOOV DUH VKRZQ LQ )LJ 7KH DVVRFLDWLRQV RI JROG SDUWLFOHV ZLWK

PAGE 64

= UDPLJHUD FHOOV EXW QRW ZLWK RWKHU EDFWHULDO FHOOV DUH VKRZQ XVLQJ LPDJHV FUHDWHG ZLWK VHFRQGDU\ )LJ $ )LJ &f DQG EDFN VFDWWHUHG HOHFWURQV )LJ % )LJ 'f 1R UHDFWLRQV ZHUH REVHUYHG ZLWK DQ\ RI WKH LPPXQRORJLFDO SURFHGXUHV ZKHQ XQLPPXQL]HG UDEELW VHUXP ZDV XVHG 573&5 573&5 ZDV DOVR XVHG WR GHWHFW WKH SUHVHQFH RI = UDPLJHUD LQ VDPSOHV E\ XVLQJ WKH SULPHUV VSHFLILF IRU = UDPLJHUD 6 U51$ 7KH UHJLRQ EHWZHHQ XSVWUHDP SULPHU DQG GRZQVWUHDP LQFOXGHG WKH IUDJPHQW FRPSOLPHQWDU\ WR WKH 6 U51$ ROLJRQXFOHRWLGH SUREH ZKLFK ZDV XVHG IRU = UDPLJHUD GHWHFWLRQ SUHYLRXVO\ 5RVVHOOR PRUH HW DO f :KHQ 6 U51$ LVRODWHG IURP = UDPLJHUD $7&& f ZDV XVHG DV D WHPSODWH IRU 573&5 UHDFWLRQ WKHUH ZDV EDVHV '1$ IUDJPHQW SURGXFHG )LJ ODQH $f 7KHUH ZDV QR FRUUHVSRQGLQJ 3&5 SURGXFW ZKHQ 6 U51$ LVRODWHG IURP 'XJDQHOOD ]RRJORHRLGHV RU f= UDPLJHUDf 0 ZDV XVHG LQ WKH 573&5 UHDFWLRQ )LJ /DQH % /DQH &f +RZHYHU WKHUH ZDV WKH 573&5 SURGXFW EDVHVf ZKHQ 6 U51$ LVRODWHG IURP RQH RI = UDPLJHUD LVRODWHV ZKLFK ZDV LVRODWHG IURP UDZ VHZDJH E\ PWROXLF DFLG LVRODWLRQ PHGLXP FRPELQHG ZLWK WULPHWKRSULP DQG VXOIDGLD]LQH )LJ /DQH 'f RU IURP ELRILOP GHYHORSHG RYHU UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO )LJ /DQH (f 7KHUHIRUH WKH 573&5 SURFHGXUH LV VHQVLWLYH IRU = UDPLJHUD GHWHFWLRQ

PAGE 65

)LJ ,QGLUHFW LPPXQRIOXRUHVFHQFH VWDLQLQJ RI ELRILOP WKDW GHYHORSHG RYHU UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO 6DPSOHV ZHUH WUHDWHG ZLWK UDELW DQWLVHUXP DJDLQVW = UDPLJHUD H[WUDFHOOXODU SRO\PHU ZLWK ),7&ODEHOHG JRDW DQWLUDEELW ,J* $ SKDVH FRQWUDVW PLFURVFRS\ % HSLIOXRUHVFHLQ PLFURVFRS\

PAGE 66

)LJ ,PPXQRVWDLQLQJ RI ELRILOP WKDW GHYHORSHG RYHU UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO 6DPSOHV ZHUH WUHDWHG ZLWK UDEELW DQWLVHUXP IRU = UDPLJHUD FHOOV $f RU H[WUDFHOOXODU SRO\PHU %f IROORZHG E\ WUHDWPHQW ZLWK ELRWLQODEHOHG JRDW DQWLUDEELW ,J* SHUR[LGDVH ODEHOHG DYLGLQ DQG VXEVWUDWH $(&

PAGE 67

$ )LJ 6HFRQGDU\ $&f DQG EDFN VFDWWHUHG % 'f HOHFWURQ LPDJHV RI 6(0 SKRWRJUDSKV RI ELRILOP GHYHORSHG RYHU UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO 6DPSOHV ZHUH WUHDWHG ZLWK UDEELW DQWLVHUXP IRU = UDPLJHUD FHOOV IROORZHG E\ WUHDWPHQW ZLWK JROGODEHOHG JRDW DQWLUDEELW VHUXP

PAGE 68

)LJ 6HFRQGDU\ $&f DQG EDFN VFDWWHUHG % 'f HOHFWURQ LPDJHV RI 6(0 SKRWRJUDSKV RI ELRILOP GHYHORSHG RYHU UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO 6DPSOHV ZHUH WUHDWHG ZLWK UDEELW DQWLVHUXP IRU = UDPLJHUD H[WUDFHOOXODU SRO\PHU IROORZHG E\ WUHDWPHQW ZLWK JROGODEHOHG JRDW DQWLUDEELW VHUXP /Q R

PAGE 69

)LJ (OHFWURSKRUHVLV RI 573&5 E\ XVLQJ SULPHUV VSHFLILF IRU = UDPLJHUD 6 U51$ $ 6 U51$ IIRP= UDPLJHUD $7&&f % 6 U51$ IURP f= UDPLJHUDf ,0 $7&&f & 6 U51$ IURP 'XJDQHOOD ]RRJORHRLGHV $7&&f 6 U51$ IURP = UDPLJHUD LVRODWHG IURP UDZ VHZDJH ( 6 U51$ IURP ELRILOP GHYHORSHG LQ UDZ VHZDJH VXSSOHPHQWHG ZLWK SJPO SKHQRO

PAGE 70

'LVWULEXWLRQ RI = UDPLHHUD LQ :DVWHZDWHU 7UHDWPHQW 3ODQWV DQG LQ /DNHV (QULFKPHQW SURFHGXUHV VKRZHG WKDW WKH ILQJHUOLNH ]RRJORHDO SURMHFWLRQV ZKLFK ZHUH FKDUDFWHULVWLF RI = UDPLJHUD DQG UHDFWHG ZLWK = UDPLJHUD DQWLVHUD ZHUH REVHUYHG LQ VFXP OD\HUV WKDW GHYHORSHG RYHU VDPSOHV IURP DOO VWDJHV RI WZR VHZDJH WUHDWPHQW SODQWV 7DEOHV DQG f 7KH KLJKHVW SHUFHQWDJH RI = UDPLJHUD ZDV IRXQG DVVRFLDWHG ZLWK VDPSOHV IURP WKH DHUDWLRQ WDQNV PL[HG OLTXRU VXVSHQGHG VROLGV RU WKH VXSHUQDWDQW IUDFWLRQf ,Q WKH 8QLYHUVLW\ RI )ORULGD :DWHU 5HFODPDWLRQ )DFLOLW\ WKH 031 RI = UDPLJHUD LQFUHDVHG IURP UDZ VHZDJH WR WKH PL[HG OLTXRU VXVSHQVLRQ WKHQ UDSLGO\ GHFUHDVHG IURP PL[HG OLTXRU VXVSHQVLRQ WR XQFKORULQDWHG HIIOXHQW 7DEOH f ,W ZDV OLNHO\ WKDW = UDPLJHUD ZDV VHWWOHG ZLWK DFWLYDWHGVOXGJH VROLGV GXH WR LWV IORFIRUPLQJ FKDUDFWHULVWLF 'XULQJ FKORULQDWLRQ WRWDO EDFWHULD UDSLGO\ GHFUHDVHG IURP s [ O29PO WR s [ O29POf ZKLOH WKHUH LV OLWWOH FKDQJH IRU WKH QXPEHU RI = UDPLJHUD EHWZHHQ XQFKORULQDWHG DQG FKORULQDWHG HIIOXHQW 7KXV WKH SHUFHQWDJH RI = UDPLJHUD LQFUHDVHG DIWHU FKORULQDWLRQ 7DEOH f 7KHUHIRUH = UDPLJHUD ZDV PRUH UHVLVWDQW WR FKORULQH WKDQ RWKHU EDFWHULD LQ WKH ZDWHU &RPSDUHG ZLWK WKH FKORULQDWHG HIIOXHQW WKH SHUFHQWDJH RI = UDPLJHUD LQ /DNH $OLFH ZDV GHFUHDVHG ZKLOH WKH WRWDO EDFWHULD LQFUHDVHG 7DEOH f 7KLV VXJJHVWHG WKDW WKHUH ZHUH VRPH QXWULHQWV DYDLODEOH IRU EDFWHULD SUROLILFDWLRQ LQ /DNH $OLFH ,Q WKH .DQDSDKD :DWHU 5HFODPDWLRQ )DFLOLW\ WKH SHUFHQWDJH RI = UDPLJHUD GHFUHDVHG IURP PL[HG OLTXRU VXVSHQVLRQ WR SULPDU\ DQG ILQDO DHURELF GLJHVWHG VOXGJH LQ

PAGE 71

ERWK OLTXLG SKDVH DQG VROLG SKDVH 7DEOH f 2YHUDOO = UDPLJHUD FRXOG EH IRXQG LQ DOO VWDJHV RI ZDVWHZDWHU WUHDWPHQW SURFHVVHV 7KH KLJKHVW FRQFHQWUDWLRQ RI = UDPLJHUD ZDV IRXQG LQ WKH PL[HG OLTXRU VWDJH LQ ERWK ZDVWHZDWHU WUHDWPHQW SODQWV 7DEOH 7DEOH f $FFRUGLQJ WR WKH FRQWHQW RI FKORURSK\OO D ODNH LV FODVVLILHG DV ROLJRWURSKLF PHVRWURSKLF DQG HXWURSKLF ODNH 'LVWULEXWLRQ RI = UDPLJHUD LQ GLIIHUHQW W\SHV RI ODNHV ZDV DOVR LQYHVWLJDWHG 7DEOH f = UDPLJHUD ZDV IRXQG LQ DOO HXWURSKLF /DNH $OLFH /DNH %LYDQV $UPf DQG PHVRWURSKLF /DNH $OWR /DNH 6DQWD )Hf ODNHV WHVWHG +RZHYHU = UDPLJHUD ZDV SUHVHQW LQ VRPH RI ROLJRWURSKLF ODNHV /DNH *HQHYD /DNH -RKQVRQf EXW DEVHQW LQ /DNH 6KHHODU ZKLFK LV DOVR DQ ROLJRWURSKLF ODNH /RZ FRQWHQW RI QXWULHQWV VXFK DV WRWDO QLWURJHQ DQG WRWDO SKRVSKRURXV PLJKW EH WKH UHDVRQ IRU DEVHQFH RI = UDPLJHUD LQ /DNH 6KHHODU &KDUDFWHUL]DWLRQ RI = UDPLHHUD ([WUDFHOOXODU 3RO\PHU *&06 DQDO\VLV RI DQ DFLG K\GURO\]HG = UDPLJHUD H[WUDFHOOXODU SRO\PHU LGHQWLILHG WKH IROORZLQJ FRPSRQHQWV b DUDELQRVH b UKDPQRVH b [\ORVH b PDQQRVH b JDODFWRVH b JDODFWXURQLF DFLG b JOXFRVH DQG b JDODFWRVDPLQH DQG DQRWKHU XQNQRZQ DPLQR VXJDU 7DEOH f 7KLV XQNQRZQ DPLQR VXJDU LV QRW JOXFRVDPLQH RU PDQQRVDPLQH 'XH WR ODFN RI RWKHU VWDQGDUG DPLQR VXJDUV ZH FRXOG QRW LGHQWLI\ WKLV DPLQR VXJDU 7RWDO LGHQWLILHG VXJDU LQ WKH H[WUDFHOOXODU SRO\PHU ZDV b

PAGE 72

3UHYLRXV ZRUN DOVR IRXQG WZR W\SHV RI DPLQRVXJDUV JOXFRVDPLQH DQG SRVVLEOH IXFRVDPLQHf LQ = UDPLJHUD H[WUDFHOOXODU SRO\PHU 7KH UDWLR EHWZHHQ JOXFRVDPLQH DQG IXFRVDPLQH ZDV WR )DUUDK 7H]XND f $FFRUGLQJ WR WKLV UDWLR IXFRVDPLQH PLJKW EH DOPRVW b VLQFH b JDODFWRVDPLQH ZDV IRXQG LQ WKLV VWXG\ ,Q DGGLWLRQ LW ZDV UHSRUWHG WKDW QR SURWHLQ RU HWKHUVROXEOH PDWHULDOV ZHUH GHWHFWHG DIWHU DFLG K\GURO\VLV RI H[WUDFHOOXODU SRO\PHU )DUUDK DQG 8Q] f 7KHUHIRUH DOPRVW b RI WKH = UDPLJHUD H[WUDFHOOXODU SRO\PHU LV FDUERK\GUDWH ,W ZDV FODLPHG SUHYLRXVO\ WKDW WKHUH ZDV JOXFRVDPLQH LQ = UDPLJHUD H[WUDFHOOXODU SRO\PHU E\ SDSHU FKURPDWRJUDSK\ 5JLOO227LOOF YDOXHV IRU JDODFWRVDPLQH DQG JOXFRVDPLQH DUH VLPLODU VLQFH JDODFWRVDPLQH LV D & HSLPHU RI JOXFRVDPLQH 7KHUHIRUH LW ZDV KDUG WR GLIIHUHQWLDWH WKHVH WZR VXJDUV E\ SDSHU FKURPDWRJUDSK\ +RZHYHU *&06 DQDO\VLV LQGLFDWHG WKH SUHVHQFH RI JODFWRVDPLQH LQVWHDG RI JOXFRVDPLQH LQ WKH H[WUDFHOOXODU SRO\PHU 7KH SUHVHQFH RI WKH H[WUDFHOOXODU SRO\PHU DOVR LQIOXHQFHV RYHUDOO VXUIDFH FKDUJH RI WKH FHOOV =HWD SRWHQWLDO KDV EHHQ XVHG WR HYDOXDWH RYHUDOO VXUIDFH FKDUJH RI WKH FHOOV 7UXHVGDLO HW DO f 0RVW EDFWHULD DUH QHJDWLYHO\ FKDUJHG GXH WR WKH SUHGRPLQDQFH RI WKH DQLRQLF JURXSV SUHVHQW RQ WKH FHOO VXUIDFHV FDUER[\O SKRVSKDWH JURXSVf $W S+ RYHUDOO VXUIDFH FKDUJHV RI = UDPLJHUD DV ZHOO DV f= UDPLJHUDn ,0 'XJDQHOOD ]RRJORHRLGHV ( FROL 6 W\SKLPXULLXP 6 DXUHXV 6IDHFDOLV ZHUH QHJDWLYH EHWZHHQ PY WR PYf 7DEOH f 7KHUHIRUH LW ZDV VXJJHVWHG WKDW DPLQR JURXSV RI DPLQRVXJDUV LQ = UDPLJHUD H[WUDFHOOXODU SRO\PHU PLJKW EH DFHW\ODWHG

PAGE 73

7DEOH 7KH GLVWULEXWLRQ RI = UDPLJHUD DQG WRWDO DHURELF EDFWHULD LQ WKH 8QLYHUVLW\ RI )ORULGD :DWHU 5HFODPDWLRQ )DFLOLW\ DQG LQ /DNH $OLFH 6RXUFHV 7RWDO $HURELF f§%DFWHULD 03 1f =RRJORHD UDPLJHUD 031 3HUFHQW =RRJORHD 5DZ VHZDJH s [ O29P/ s [ P/ 0L[HG OLTXRU VXSHUQDWDQW s [ O2fP/ s [ O29P/ 0L[HG OLTXRU VROLGV s [ fJ s [ J 8QFKORULQDWHG HIIOXHQW OOs[ P/ s [ nP/ [ &KORULQDWHG HIIOXHQW s [ O2nP/ s [ nP/ [ /DNH $OLFH s [ O29P/ s [ O2 nP/ [ ,4 1RWH 'LOXWLRQV RI WKH VDPSOHV VXSSOHPHQWHG ZLWK SJPO RI SKHQRO ZHUH LQFXEDWHG DW URRP WHPSHUDWXUH IRU XS WR ZHHNV 7KH VFXP OD\HU WKDW GHYHORSHG ZDV H[DPLQHG IRU WKH SUHVHQFH RI EDFWHULD ZLWKLQ W\SLFDO ILQJHUOLNH ]RRJORHDH 7KH VDPSOHV ZHUH DOVR H[DPLQHG XVLQJ WKH LPPXQRORJLFDO SURFHGXUHV GHVFULEHG LQ WKH WH[W WR FRQILUP WKH SUHVHQFH RI = UDPLJHUD

PAGE 74

7DEOH 7KH GLVWULEXWLRQ RI = UDPLJHUD DQG WRWDO DHURELF EDFWHULD LQ WKH .DQDSDKD :DWHU 5HFODPDWLRQ )DFLOLW\ 6RXUFHV 7RWDO $HURELF %DFWHULD W031O =RRJORHD UDPLJHUD 031f 3HUFHQW =RRJORHD UDPLHHUD 0L[HG OLTXRU VXSHUQDWDQW s [ O29P/ s [ P/ )LUVW VWDJH DHURELF GLJHVWHG VOXGJH VXSHUQDWDQW s [ P/ s[ O29P/ 6HFRQG VWDJH DHURELF GLJHVWHG VOXGJH VXSHUQDWDQW s [ P/ s [ P/ 0L[HG OLTXRU VROLGV s [ pJ s [ VJ )LUVW VWDJH DHURELF GLJHVWHG VOXGJH VROLGV s[ J s[OJ 6HFRQG VWDJH DHURELF GLJHVWHG VOXGJH VROLGV s[ O2nJ s [ J 1RWH 'LOXWLRQV RI WKH VDPSOHV VXSSOHPHQWHG ZLWK PJ/ RI SKHQRO ZHUH LQFXEDWHG DW URRP WHPSHUDWXUH IRU XS WR ZHHNV 7KH VFXP OD\HU WKDW GHYHORSHG ZDV H[DPLQHG IRU WKH SUHVHQFH RI EDFWHULD ZLWKLQ W\SLFDO ILQJHUOLNH ]RRJORHDH 7KH VDPSOHV ZHUH DOVR H[DPLQHG XVLQJ WKH LPPXQRORJLFDO SURFHGXUHV GHVFULEHG LQ WKH WH[W WR FRQILUP WKH SUHVHQFH RI = UDPLJHUD

PAGE 75

7DEOH 7KH GLVWULEXWLRQ RI = UDPLJHUD DQG WRWDO DHURELF EDFWHULDO LQ GLIIHUHQW ODNHV &ODVVLILFDWLRQ /DNH &+/r 8IIK 73E XH,O 71& XHQ 7RWDO $HURELF %DFWHULD 031POf = UDPLJHUD 031PIL 3HUFHQW = UDPIHUD 2OLJRWURSKLF 6KHHODU [ [ *HQHYD [ -RKQVRQ [ 0HVRWURSKLF $OWR [ 6DQWD )H [ (XWURSKLF $OLFH [ %LYDQV $UP [ 1RWH 'LOXWLRQV RI WKH VDPSOHV VXSSOHPHQWHG ZLWK SJPO RI SKHQRO ZHUH LQFXEDWHG DW URRP WHPSHUDWXUH IRU XS WR ZHHNV 7KH VFXP OD\HU WKDW GHYHORSHG ZDV H[DPLQHG IRU WKH SUHVHQFH RI EDFWHULD ZLWKLQ W\SLFDO ILQJHUOLNH ]RRJORHDH 7KH VDPSOHV ZHUH DOVR H[DPLQHG XVLQJ WKH LPPXQRORJLFDO SURFHGXUHV GHVFULEHG LQ WKH WH[W WR FRQILUP WKH SUHVHQFH RI = UDPLJHUD D 7RWDO FKORURSK\OO E 7RWDO SKRVSKRUXV F 7RWDO QLWURJHQ

PAGE 76

7DEOH &RPSRVLWLRQ RI = UDPLJHUD H[WUDFHOOXODU SRO\PHU E\ *&06 DQDO\VLV $UDELQRVH 5KDPQRVH ;\ORVH 0DQQRVH *DODFWRVH *DODFWXURQLF DFLG *OXFRVH *DODFWRVDPLQH 8QNQRZQ VXJDU W\SH ,D 7RWDO NQRZQ VXJDU 1RWH $FLG K\GURO\]HG H[WUDFHOOXODU SRO\PHU RI = UDPLJHUD ZDV UH1DFHW\ODWHG DQG WULPHWK\VLO\ODWHG EHIRUH *&06 DQDO\VLV D 8QNQRZQ 6XJDU W\SH LV DQ DPLQR VXJDU EXW QRW JOXFRVDPLQH RU PDQQRVDPLQH

PAGE 77

7DEOH =HWD SRWHQWLDO RI EDFWHULD DW S+ %DFWHULD =HWD SRWHQWLDO WPJ = UDPLJHUD $7&& f s f= UDPLJHUDn ,0 $7&& f s 'XJDQHOOD ]RRJORHRLGHV $7&& f s ( FROOr s 6 O\SKLPXULXPf s 6 DXUHXVr s 6IDHFDOLVf s 1RWH 7KH ]HWD SRWHQWLDO RI VWDWLRQDU\ SKDVH EDFWHULD ZDV GHWHUPLQHG XVLQJ D /D]HU =HH ]HWD PHWHU D 'DWD IURP 7UXHVGDLO HW DO

PAGE 78

7KH (IIHFW RI &KORULQH RQ %DFWHULD LQ %LRILOP DV ZHOO DV RQ = UDPLHHUD ,Q WKH 0,17 WHVW ,17 DFWV DV D K\GURJHQDFFHSWRU 5HVSLULQJ EDFWHULD ZLOO DFFXPXODWH ZDWHULQVROXEOH UHG ,17IRUPD]DQ FU\VWDOV WKURXJK WKH DFWLRQ RI EDFWHULDO HOHFWURQ WUDQVSRUW V\VWHP DFWLYLW\ &RXQWHU VWDLQLQJ ZLWK PDODFKLWH JUHHQ UHVXOWV LQ YLDEOH EDFWHULD ZLWK UHG FRORU DQG LQDFWLYH EDFWHULD ZLWK JUHHQ FRORU 6LQFH WKH = UDPLJHUD ILQJHUOLNH SURMHFWLRQ VWUXFWXUH LV HDVLO\ GLVWLQJXLVKHG IURP RWKHU EDFWHULD WKH EDFWHULD ZLWKLQ ILQJHUOLNH SURMHFWLRQ VWUXFWXUHV LQ ELRILOPV ZHUH FRQVLGHUHG WR EH = UDPLJHUD 7KH PHDVXUHG YDOXHV IRU WRWDO FKORULQH DQG IUHH FKORULQH ZHUH VLPLODU VLQFH VRGLXP K\SRFKORULWH ZDV XVHG LQ WKLV VWXG\ :KHQ D ORZ FKORULQH FRQFHQWUDWLRQ PJf ZDV XVHG DERXW b RI WKH EDFWHULD ZLWKLQ ILQJHUOLNH SURMHFWLRQV ZHUH VWLOO DOLYH EXW RQO\ b RI WKH RWKHU EDFWHULD LQ WKH ELRILOP ZHUH UHVSLULQJ $W D FKORULQH FRQFHQWUDWLRQ RI PJ b RI WKH EDFWHULD ZLWKLQ ILQJHUOLNH SURMHFWLRQV ZHUH VWLOO UHVSLULQJ ZKLOH PRVW RI WKH RWKHU EDFWHULD ZHUH LQDFWLYH +LJKHU FRQFHQWUDWLRQ RI FKORULQH PJf NLOOHG DOO EDFWHULD 7DEOH )LJ f 7KHUHIRUH EDFWHULD ZLWKLQ ILQJHUn OLNH SURMHFWLRQV FDQ UHVLVW KLJKHU FRQFHQWUDWLRQ RI FKORULQH EHWWHU WKDQ RWKHU ELRILOP EDFWHULD ,Q RUGHU WR LQYHVWLJDWH WKH LQIOXHQFH RI WKH H[WUDFHOOXODU SRO\PHU RQ = UDPLJHUD LQDFWLYDWLRQ E\ FKORULQH WKH VXUYLYDO RI = UDPLJHUD FHOOV ZLWK DQG ZLWKRXW WKH H[WUDFHOOXODU SRO\PHU ZHUH FRPSDUHG GXULQJ FKORULQH WUHDWPHQW 7DEOH )LJ f $ERXW b RI = UDPLJHUD FHOOV ZLWK WKH H[WUDFHOOXODU SRO\PHU ZHUH VWLOO DOLYH DIWHU H[SRVXUH WR PJ FKORULQH WUHDWPHQWV ZKLOH OHVV WKDQ b RI = UDPLJHUD FHOOV ZLWKRXW WKH H[WUDFHOOXODU SRO\PHU ZHUH VWLOO DOLYH 7KHUHIRUH WKH = UDPLJHUD H[WUDFHOOXODU SRO\PHU VHHPHG WR SURWHFW WKH FHOOV IURP FKORULQH LQDFWLYDWLRQ

PAGE 79

7DEOH (IIHFW RI FKORULQH RQ WKH UHVSLULQJ DFWLYLW\ RI EDFWHULD LQ ELRILOLDV &KORULQH FRQFHQWUDWLRQ WPJ=Of b VXUYLYDO RI = UDPLJHUD b VXUYLYDO RI RWKHU s s s s s 1RWH 7KH ELRILOP WKDW GHYHORSHG RYHU UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO ZDV WUHDWHG ZLWK LQGLFDWHG FRQFHQWUDWLRQV RI FKORULQH IRU PLQ 7KH UHVLGXDO FKORULQH ZDV QHXWUDOL]HG ZLWK VRGLXP WKLRVXOIDWH DQG WKH 0,17 WHVW ZDV WKHQ SHUIRUPHG WR GHWHFW UHVSLULQJ EDFWHULD

PAGE 80

7DEOH ,QIOXHQFH RI H[WUDFHOOXODU SRO\PHU RQ = UDPLJHUD LQDFWLYDWLRQ E\ FKORULQH &KORULQH FRQFHQWUDWLRQ &QXWE b VXUYLYDO RI FHOOV ZLWK H[WUDFHOOXODU SRO\PHU b VXUYLYDO RI FHOOV ZLWKRXW H[WUDFHOOXODU SRO\PHU s s s 1RWH = UDPLJHUD FHOOV ZLWK DQG ZLWKRXW YLVLEOH H[WUDFHOOXODU SRO\PHU ZHUH WUHDWHG ZLWK WKH LQGLFDWHG FRQFHQWUDWLRQV RI FKORULQH IRU PLQ 7KH UHVLGXDO FKORULQH ZDV QHXWUDOL]HG ZLWK VRGLXP WKLRVXOIDWH DQG WKH 0,17 WHVW ZDV WKHQ SHUIRUPHG WR GHWHFW UHVSLULQJ EDFWHULD

PAGE 81

)LJ (IIHFW RI FKORULQH RQ UHVSLUDWRU\ DFWLYLWLHV RI EDFWHULD LQ ELRILOP $ PJ FKORULQH % PJ FKORULQH & PJ FKORULQH PJ FKORULQH

PAGE 82

)LJ ,QIOXHQFH RI WKH H[WUDFHOOXODU SRO\PHU RQ = UDPLJHUD LQDFWLYDWLRQ E\ $ PJ FKORULQH % PJ FKORULQH

PAGE 83

(IIHFW RI :DVWHZDWHU RQ 9LUXV 5HPRYDO EY $OXPLQXP +\GUR[LGH &RDWHG 6DQGV &KDUDFWHUL]DWLRQ RI $OXPLQXP +\GUR[LGH &RDWHG 6DQG ([SRVHG WR (LWKHU &KORULQDWHG RU 'HFKORULQDWHG :DVWHZDWHU &RDWLQJ E\ LQ VLWX SUHFLSLWDWLRQ RI PHWDOOLF K\GUR[LGHV RQ SDUWLFOHV LQFUHDVHG WKH FRQFHQWUDWLRQ RI PHWDOV DVVRFLDWHG ZLWK VDQG SDUWLFOHV WKHLU ]HWD SRWHQWLDO DQG WKHLU FDSDFLW\ IRU UHPRYDO RI PLFURRUJDQLVPV IURP ZDWHU $IWHU FRDWLQJ WKH 2WWDZD VDQGV ZLWK DOXPLQXP K\GUR[LGHV WKH ]HWD SRWHQWLDO RI WKH VDQG LQFUHDVHG IURP PY WR PY DW S+ 7DEOH f &RDWLQJ LQFUHDVHG WKH DOXPLQXP FRQWHQW RI WKH VDQG IURP DSSUR[LPDWHO\ PJJ WR PJJ &KHQ HW DO f 7KH FRDWHG VDQGV UHPRYHG b RI WKH 06 DQG b RI WKH 35' IURP ZDWHU LQ EDWFK WHVWV )LJO DQG )LJ f 7KH FRUUHVSRQGLQJ YDOXHV IRU 06 RU 35' UHPRYDO E\ XQWUHDWHG VDQG DUH ZLWKLQ b 7KH ]HWD SRWHQWLDO RI DOXPLQXP K\GUR[LGH FRDWHG VDQGV GURSSHG DIWHU GD\ H[SRVXUH WR HLWKHU FKORULQDWHG RU GHFKORULQDWHG ZDVWHZDWHU 7DEOH f $W WKH LQLWLDO WZR ZHHNV H[SRVXUH WKH ]HWD SRWHQWLDO RI WKH FRDWHG VDQG H[SRVHG WR FKORULQDWHG ZDVWHZDWHU GHFUHDVHG LQ VLPLODU GHJUHH DV WKDW RI WKH VDQG H[SRVHG WR GHFKORULQDWHG ZDVWHZDWHU IURP PY WR PYf +RZHYHU DIWHU PRQWKV WUHDWPHQW WKH ]HWD SRWHQWLDO RI WKH FRDWHG VDQG H[SRVHG WR FKORULQDWHG ZDVWHZDWHU UHPDLQHG DURXQG PY ZKLOH WKH ]HWD SRWHQWLDO RI WKH FRDWHG H[SRVHG WR GHFKORULQDWHG ZDVWHZDWHU ZDV DERXW PY 7DEOH f 7KH DPRXQW RI DOXPLQXP RQ WKH VXUIDFH RI WKH VDQG GURSSHG IURP PJJ WR PJJ DIWHU WZR ZHHNV RI ZDVWHZDWHU H[SRVXUH WKHQ UHPDLQHG DSSUR[LPDWHO\ FRQVWDQW WKURXJKRXW WKH H[SHULPHQW &KHQ HW DO f ,W ZDV VWLOO DERXW IROG KLJKHU WKDQ WKDW

PAGE 84

RI WKH XQFRDWHG VDQG PJJf 7KLV GURS PLJKW EH GXH WR DWWULWLRQ DQGRU OHDFKLQJ HIIHFWV ,Q DGGLWLRQ VLQFH WKH ]HWD SRWHQWLDO RI WKH VDQG ZLWK PJJ DOXPLQXP FRDWV ZDV PY ]HWD SRWHQWLDO RI WKH VDQG ZLWK PJJ DOXPLQXP FRDWV ZDV PXFK OHVV OLNHO\ DERXW PY ZLWKRXW RWKHU LQIOXHQFHV 7KHUHIRUH WKH GHFUHDVH RI ]HWD SRWHQWLDO DIWHU H[SRVXUH RI WKH FRDWHG VDQG WR ZDVWHZDWHU ZDV QRW OLNHO\ GXH WR WKH ORVV RI DOXPLQXP FRQWHQW 3URWHLQ DVVD\ 7DEOH f DQG 6(0 QRW VKRZQf LQGLFDWHG WKDW ELRILOP GHYHORSHG RQ WKH VXUIDFH RI FRDWHG VDQG ZKLFK ZDV H[SRVHG WR GHFKORULQDWHG ZDVWHZDWHU +RZHYHU WKHUH ZDV QR VLJQLILFDQW ELRILOP GHYHORSPHQW ZKHQ FKORULQDWHG ZDVWHZDWHU ZDV XVHG 7KHUHIRUH WKH HIIHFW RI ELRILOP RQ YLUXV UHPRYDO E\ DOXPLQXP K\GUR[LGH FRDWHG VDQG FRXOG EH GHWHUPLQHG E\ FRPSDULQJ WKH SHUIRUPDQFH RI WKH VDQG H[SRVHG WR GHFKORULQDWHG ZDVWHZDWHU HIIOXHQW ZLWK WKDW H[SRVHG WR FKORULQDWHG ZDVWHZDWHU HIIOXHQW 6LQFH ZDVWHZDWHU HIIOXHQW XVHG LQ WKLV VWXG\ ZDV REWDLQHG RQO\ DIWHU DFWLYDWHG VOXGJH DQG UDSLG VDQG ILOWUDWLRQ SURFHVVHV WKHUH ZHUH PDQ\ RUJDQLF RU LQRUJDQLF PDWHULDOV LQ WKH ZDWHU 7KHVH PDWHULDOV DUH PRVWO\ QHJDWLYHO\ FKDUJHG DW S+ 6REVH\ HW DO f (YLGHQWO\ WKHVH PDWHULDOV LQWHUDFWHG ZLWK WKH DOXPLQXP K\GUR[LGH FRDWHG VDQG GXULQJ H[SRVXUH WR FKORULQDWHG RU GHFKORULQDWHG ZDVWHZDWHU DQG FDXVHG WKH RYHUDOO VXUIDFH FKDUJH RI WKH VDQGV GHFUHDVH 7DEOH f ,W ZDV VXJJHVWHG WKDW RUJDQLF DQG LQRUJDQLF PDWHULDOV LQ WKH ZDWHU fEORFNHGf WKH SRVLWLYHO\ FKDUJHG VLWHV RQ WKH VDQG VR WKDW WKH ]HWD SRWHQWLDO RI WKH VDQGV ZHUH GUDVWLFDOO\ GHFUHDVHG PYf DW WKH HDUOLHU VWDJHV RI WKH WUHDWPHQW 7KH DPRXQW RI ELRILOP EDFWHULD RQ WKH VXUIDFH RI WKH VDQG H[SRVHG WR GHFKORULQDWHG ZDVWHZDWHU ZDV VXIILFLHQW WR PDLQWDLQ WKH ]HWD SRWHQWLDO RI WKH

PAGE 85

VDQG DURXQG PY DIWHU PRQWKV WUHDWPHQW 7DEOH DQG f EHFDXVH WKH ]HWD SRWHQWLDO RI PRVW EDFWHULD DUH DERXW PY WR PY DW S+ 7UXHVGDLO HW DO f ,Q VXPPDU\ WKH VXUIDFH SURSHUWLHV RI DOXPLQXP K\GUR[LGH FRDWHG VDQG FRQVLGHUDEO\ FKDQJHG DIWHU H[SRVXUH WR GHFKORULQDWHG RU FKORULQDWHG ZDVWHZDWHU HIIOXHQW %DWFK 5HPRYDO RI 06 DQG 35' 7KH DOXPLQXP FRDWHG VDQG ZLWKRXW ZDVWHZDWHU H[SRVXUH UHPRYHG DERXW b 06 DQG b 35' $IWHU GD\ H[SRVXUH WR HLWKHU FKORULQDWHG RU GHFKORULQDWHG ZDVWHZDWHU WKH FRDWHG VDQG ZHUH VWLOO DEOH WR UHPRYH DERXW b 06 DQG b 35' )LJ )LJ f 7KH DELOLW\ RI WKH FRDWHG VDQG IRU UHPRYDO RI 06 DQG 35' GHFOLQHG E\ DSSUR[LPDWHO\ WZR WKLUGV DIWHU WZR ZHHNV H[SRVXUH $IWHU PRQWKV RI WUHDWPHQW 06 DQG 35' UHPRYDO E\ WKH VDQG ZHUH QRW VWDWLVWLFDOO\ GLIIHUHQW IURP WKDW E\ XQFRDWHG VDQG S!f 7KH SHUIRUPDQFH RI WKH FRDWHG VDQG H[SRVHG WR GHFKORULQDWHG ZDVWHZDWHU DQG WKH VDQG H[SRVHG WR FKORULQDWHG ZDVWHZDWHU ZHUH VLPLODU IRU ERWK 06 DQG 35' UHPRYDO 7KH LVRHOHFWULF SRLQWV IRU 06 DQG 35' DUH ERWK EHWZHHQ WR 7KH\ ZHUH QHJDWLYHO\ FKDUJHG LQ DUWLILFLDO JURXQG ZDWHU +RZHYHU 35' LV PRUH K\GURSKRELF WKDQ 06 GXH WR WKH SUHVHQFH RI OLSLG LQ LWV SURWHLQ FRDW .LQRVKLWD HW DO f 7KH PDJQLWXGH GLIIHUHQFH EHWZHHQ 06 DERXW bf DQG 35' DERXW bf UHPRYHG E\ WKH FRDWHG VDQG PLJKW GXH WR WKH IDFW WKDW 06 LV OHVV K\GURSKRELF WKDW 35'

PAGE 86

&ROXPQ UHPRYDO RI 06 DQG 35' ,Q FROXPQ H[SHULPHQWV WKH FRDWHG VDQG ZLWKRXW ZDVWHZDWHU H[SRVXUH UHPRYHG b 06 DQG b 35' 7DEOH f $IWHU ORQJWHUP H[SRVXUH RI WKH FRDWHG VDQG WR HLWKHU FKORULQDWHG RU GHFKORULQDWHG ZDVWHZDWHU WKH UHPRYDO RI 06 DQG 35' ZDV VLJQLILFDQWO\ GHFUHDVHG 7DEOH f &KORULQDWHG RU GHFKORULQDWHG ZDVWHZDWHU H[SRVXUH UHVXOWHG LQ GHFUHDVH RI 06 DQG 35' UHPRYDO E\ WKH FRDWHG VDQG LQ VLPLODU GHJUHH 06 DQG 35' UPRYDO E\ WKH FRDWHG VDQG H[SRVHG WR ZDVWHZDWHU IRU PRQWKV EHFDPH VWDWLVWLFDOO\ VLPLODU WR WKH UHPRYDO E\ WKH XQFRDWHG VDQG S!f 7KH FROXPQ H[SHULPHQWV FRQILUPHG WKH GHWULPHQWDO HIIHFW RI ZDVWHZDWHU H[SRVXUH IRU 06 DQG 35' UHPRYDO E\ WKH FRDWHG VDQG

PAGE 87

7DEOH =HWD SRWHQWLDO PYf RI WKH DOXPLQXP K\GUR[LGH FRDWHG VDQG DIWHU H[SRVXUH WR ZDVWHZDWHU nf§2SHUDWLRQ 'D\V 6DQGV aa $OFRDWHG VDQG H[SRVHG WR FKORULQDWHG ZDVWHZDWHU $OFRDWHG VDQG H[SRVHG WR GHFKORULQDWHG ZDVWHZDWHU 1RWH 6DQG ZDV ZDVKHG WZLFH ZLWK GHLRQL]HG ZDWHU 7KHQ WKH ]HWD SRWHQWLDO ZDV PHDVXUHG DV SUHYLRXVO\ GHVFULEHG &KHQ HW DO f 7KH ]HWD SRWHQWLDO RI XQFRDWHG VDQG LV PY

PAGE 88

7DEOH 3URWHLQ FRQWHQW PJJ VDQGf RI WKH DOXPLQXP K\GUR[LGH FRDWHG VDQG DIWHU H[SRVXUH WR ZDVWHZDWHU f§2SHUDWLRQ 'D\V 6DQGV n a $OFRDWHG VDQG H[SRVHG WR FKORULQDWHG ZDVWHZDWHU $OFRDWHG VDQG H[SRVHG WR GHFKORULQDWHG ZDVWHZDWHU 1RWH 6DQG ZDV ZDVKHG WZLFH ZLWK GHLRQL]HG ZDWHU DQG WKHQ PL[HG ZLWK ,21 1D2+ WR H[WUDFW SURWHLQ 7KH VDQG ZDV DOORZHG WR VHWWOH DQG WKH SURWHLQ LQ WKH VXSHUQDWDQW ZDV GHWHUPLQHG

PAGE 89

7DEOH 06 DQG 35' UHPRYDO E\ VDQG FROXPQV 9LUXV 3HUFHQW 5HPRYDO E\ 'D\V 8QFRDWHG VDQG $OFRDWHG VDQG H[SRVHG WR GHFKORULQDWHG ZDVWHZDWHU $OFRDWHG VDQG H[SRVHG WR FKORULQDWHG ZDVWHZDWHU 06 35' 1RWH 6DQG ZDV SDFNHG LQWR FROXPQV FP ,' [ Pf $*: VHHGHG ZLWK 06 DQG 35' ZDV SDVVHG WKURXJK WKHVH FROXPQV LQ XSIORZ PRGH $W VWHDG\ VWDWH WKH 06 DQG 35' LQ WKH FROXPQ cIOXHQW DQG HIIOXHQW VDPSOHV ZHUH DVVD\HG

PAGE 90

b UHPRYD $OFRDWHG VDQG H[SRVHG $OFRDWHG VDQG H[SRVHG $OFRDWHG VDQG WR GHFKORULQDWHG WR FKORULQDWHG ZDVWHZDWHU ZDVWHZDWHU 6DQGV IIO GD\ ’ GD\V ’ GD\V P GD\V ’ GD\V ‘ FRQWUROV XQFRDWHG VDQG )LJ 06 UHPRYDO E\ EDWFK H[SHULPHQW

PAGE 91

b UHPRYDO $OFRDWHG VDQG H[SRVHG WR $OFRDWHG VDQG H[SRVHG WR $OFRDWHG VDQG GHFKORULQDWHG ZDVWHZDWHU FKORULQDWHG ZDVWHZDWHU 6DQGV % GD\ % GD\V GD\V ‘ FRQWUROV XQFRDWHG VDQG )LJ 35' UHPRYDO E\ EDWFK H[SHULPHQW

PAGE 92

',6&866,21 = UDPLJHUD ZDV IRXQG LQ ZDVWHZDWHU WUHDWPHQW SODQWV DQG VRPH ODNHV ,W ZDV LVRODWHG IURP UDZ VHZDJH PL[HG OLTXRU VXVSHQVLRQ DQG ODNH ZDWHU E\ XVLQJ PWROXLF DFLG LVRODWLRQ PHGLXP FRPELQHG ZLWK WULPHWKRSULP RU VXOIDGLD]LQH ZKLFK ZHUH PRUH HIILFLHQW WKDQ PWROXLF DFLG LVRODWLRQ PHGLXP DORQH IRU LVRODWLRQ RI = UDPLJHUD IURP QDWXUDO HQYLURQPHQWV 'HWHFWLRQ RI = UDPLJHUD IURP QDWXUDO HQYLURQPHQWV LV JUHDWO\ VLPSOLILHG E\ XVLQJ DQWLERGLHV VSHFLILF IRU WKH QHRW\SH VWUDLQ RI= UDPLJHUD DV WKH SULPDU\ DQWLERG\ DQG GLIIHUHQW FRQMXJDWHV RI JRDW DQWLUDEELW ,J* ZKLFK DUH FRPPHUFLDOO\ DYDLODEOH DV WKH VHFRQGDU\ DQWLERG\ 7KH FHOOV DQG H[WUDFHOOXODU SRO\PHU RI = UDPLJHUD ZHUH YLVXDOL]HG LQ VHYHUDO ZD\V XVLQJ LPPXQRORJLFDO SURFHGXUHV 7KHVH LQFOXGH XVLQJ $ ),7&ODEHOHG VHFRQGDU\ DQWLERG\ DQG IOXRUHVFHQFH PLFURVFRS\ % ELRWLQFRQMXJDWHG VHFRQGDU\ DQWLERG\ DQG OLJKW PLFURVFRS\ DQG & JROGODEHOHG DQWLERG\ DQG 6(0 7KH DGYDQWDJH RI LPPXQRIOXRUHVFHQFH SURFHGXUHV LV WKDW WKH\ DUH IDLUO\ HDV\ WR XVH +RZHYHU DXWRIOXRUHVFHQFH PD\ EH D SUREOHP ZLWK VRPH VDPSOHV 7KH HQ]\PDWLF SURFHGXUHV DUH DOVR IDLUO\ VLPSOH DQG FDQ EH GRQH ZLWK D OLJKW PLFURVFRSH 8VLQJ JROG ODEHOHG DQWLERG\ DQG 6(0 SHUPLWV REVHUYDWLRQ DW KLJKHU PDJQLILFDWLRQV WKDQ ZLWK OLJKW RU IOXRUHVFHQFH PLFURVFRS\ 2EVHUYDWLRQV XVLQJ EDFNVFDWWHU HOHFWURQV VKRZ ZKHUH WKH DQWLERG\ LV ORFDOL]HG VLQFH RQO\ KHDY\ PHWDOV VXFK DV WKH JROG RI WKH VHFRQGDU\ DQWLERG\ FDQ FDXVH EDFN VFDWWHUV

PAGE 93

3UHYLRXVO\ WKH ),7&ODEHOHG 6 U51$ ROLJRQXFOHRWLGH SUREH DJDLQVW = UDPLJHUD FRXOG DOVR EH XVHG WR GHWHFW = UDPLJHUD LQ QDWXUDO VDPSOHV DV ZDV VKRZQ LQ D SUHYLRXV VWXG\ E\ 5RVVHOOR0RUD HW DO f +RZHYHU D UHGXFHG FRQWHQW RI LQWUDFHOOXODU 6 U51$ LQ OHVV DFWLYH FHOOV DQG OLPLWHG SHQHWUDWLRQ RI WKH SUREH PD\ EH SUREOHP ZLWK WKLV SURFHGXUH 7KHVH SRWHQWLDO SUREOHPV FRXOG EH RYHUFRPH E\ XVLQJ LPPXQRORJLFDO PHWKRGV ,QGLUHFW LPPXQRDVVD\ PHWKRGV DUH DOVR WHFKQLFDOO\ VLPSOHU DQG PRUH WLPH VDYLQJ WKDQ WKH GHWHFWLRQ PHWKRG XVLQJ WKH IOXRUHVFHLQODEHOHG 6 U51$ ROLJRQXFOHRWLGH SUREH 3&5573&5 KDV EHHQ XVHG DV D VHQVLWLYH PHWKRG WR GHWHFW EDFWHULD RU YLUXVHV IURP HQYLURQPHQWDO VDPSOHV %\ XVLQJ WKH SULPHUV VSHFLILF IRU = UDPLJHUD 6 U51$ 573&5 ZDV XVHG DV DQRWKHU DOWHUQDWLYH PHWKRG IRU GHWHFWLRQ RI = UDPLJHUD IURP QDWXUDO HQYLURQPHQWV 7KHUH ZHUH QHJDWLYH UHDFWLRQV ZKHQ 6 U51$ LVRODWHG IURP 'XJDQHOOD ]RRJORHRLGHV RU IURP f= UDPLJHUDf ,0 ZDV XVHG DV WHPSODWH IRU 573&5 UHDFWLRQ +RZHYHU WKH VDPH OHQJWK RI '1$ IUDJPHQWV EDVHVf ZDV SURGXFHG ZKHQ 6 U51$ LVRODWHG IURP = UDPLJHUD = UDPLJHUD LVRODWHG IURP UDZ VHZDJH RU IURP ELRILOP GHYHORSHG RYHU UDZ VHZDJH VXSSOHPHQWHG ZLWK SKHQRO ZDV XVHG DV WHPSODWH IRU 573&5 7KHUHIRUH WKH FXUUHQW SURFHGXUH LV UHOLDEOH IRU = UDPLJHUD GHWHFWLRQ ,PPXQRORJLFDO PHWKRGV GHWHFW ERWK GHDG DQG YLDEOH PLFURRUJDQLVPV DV ORQJ DV WKH SUHVHQFH RI WKH DQWLJHQ 6LQFH U51$ LV D GRPLQDQW FHOOXODU PDFURPROHFXOH DQG UHODWHG WR YLDELOLW\ RI WKH FHOOV 573&5 E\ XVLQJ U51$ DV WHPSODWH FDQ EH XVHG WR

PAGE 94

GHWHFW RQO\ YLDEOH PLFURRUJDQLVPV *HQHUDOO\ UHSURGXFLELOLW\ DQG UHOLDELOLW\ RI 51$ H[WUDFWLRQ LV LPSRUWDQW IRU UHOLDEOH LQIRUPDWLRQ REWDLQHG E\ 573&5 HVSHFLDOO\ GXULQJ VWXGLHV RI PLFURELDO FRPPXQLW\ LQ GLUW\ HQYLURQPHQWV 0X\]HU DQG 5DPVLQJ f 7KHUHIRUH 573&5 FRPELQHG ZLWK WKH XVH RI LPPXQRORJLFDO PHWKRGV LV SUHIHUUHG IRU GHWHFWLRQ DQG XQGHUVWDQGLQJ RI = UDPLJHUD LQ QDWXUDO HQYLURQPHQWV %HFDXVH LW KDV EHHQ REVHUYHG LQ DVVRFLDWLRQ ZLWK ELRORJLFDO IORHV DQG ELRILOPV LQ ZDVWHZDWHU WUHDWPHQW SODQWV = UDPLJHUD KDV EHHQ FRQVLGHUHG WR EH DQ LPSRUWDQW PLFURRUJDQLVP LQ WKH ZDVWHZDWHU WUHDWPHQW SURFHVVHV +RZHYHU VWXGLHV RQ WKH QXPEHU RI EDFWHULD FDSDEOH RI IRUPLQJ ILQJHUOLNH ]RRJORHDH VKRZHG WKDW WKHVH EDFWHULD ZHUH D PLQRU SRUWLRQ RI WKH SRSXODWLRQ RI WKH VDPSOHV IURP ZDVWH ZDWHU :LOOLDPV DQG 8Q] f +LJKHU QXPEHUV RI= UDPLJHUD ZHUH IRXQG LQ DFWLYDWHG VOXGJH IORHV E\ 5RVHOOR 0RUD HW DO f 7KHVH ZRUNHUV IRXQG WKDW b RI WKH FHOOV LQ IORHV IURP DQ DHUDWLRQ EDVLQ IURP RQH SODQW UHDFWHG ZLWK DQ ROLJRQXFOHRWLGH SUREH VSHFLILF IRU = UDPLJHUD 6 U51$ ,Q WKH FXUUHQW VWXG\ HQULFKPHQW FXOWXUHV XVLQJ SKHQRO ZHUH XVHG WR GHWHUPLQH WKH 031 RI = UDPLJHUD LQ ZDVWHZDWHU DQG HQYLURQPHQWDO VDPSOHV 7KH SUHVHQFH RI = UDPLJHUD ZDV GHWHUPLQHG E\ REVHUYLQJ WKH SUHVHQFH RI W\SLFDO ILQJHUOLNH SURMHFWLRQV 7KHVH ZHUH FRQILUPHG XVLQJ LPPXQRORJLFDO SURFHGXUHV ,Q VRPH FDVHV IOXRUHVFHQFH WHFKQLTXHV UHYHDOHG WKH SUHVHQFH RI EDFWHULD LQ W\SLFDO ]RRJORHDO SURMHFWLRQV WKDW ZHUH REVFXUHG E\ RWKHU EDFWHULD ZKHQ WKH VDPSOHV ZHUH REVHUYHG XVLQJ SKDVH FRQWUDVW PLFURVFRS\ 8VLQJ WKHVH SURFHGXUHV WKH QXPEHUV RI = UDPLJHUD LQ PL[HG OLTXRU

PAGE 95

VXVSHQGHG VROLGV ZDV FORVHU WR WKH YDOXH REWDLQHG XVLQJ WKH ),7&ODEHLHG 6 U51$ ROLJRQXFOHRWLGH SUREH 5RVVHOORPRUD HW D f WKDQ WR WKH YDOXHV REWDLQHG XVLQJ PLFURVFRSLF H[DPLQDWLRQ RI ILQJHUHG ]RRJORHDH :LOOLDPV DQG 8Q] f 7KH XVH RI HQULFKPHQW FXOWXUHV DQG LPPXQRORJLFDO SURFHGXUHV WR HQXPHUDWH = UDPLJHUD ZDV PHDQW WR GHPRQVWUDWH WKHLU SRWHQWLDO IRU VWXG\LQJ WKH GLVWULEXWLRQ RI = UDPLJHUD LQ ZDVWHZDWHU DQG HQYLURQPHQWDO VDPSOHV 7RR IHZ VDPSOHV ZHUH WDNHQ IRU WKH QXPEHUV WR EH FRQVLGHUHG GHILQLWLYH +RZHYHU WKH QXPEHUV GR VKRZ VRPH LQWHUHVWLQJ WUHQGV ,W DSSHDUV WKDW = UDPLJHUD LV PRUH QXPHURXV LQ PL[HG OLTXRU VXVSHQGHG VROLGV 7KH\ DUH UHODWLYHO\ IHZHU LQ UDZ VHZDJH DQG LQ VROLGV XQGHUJRLQJ DHURELF GLJHVWLRQ %HVLGHV ZDVWHZDWHU WUHDWPHQW SODQWV = UDPLJHUD ZDV DOVR IRXQG LQ HXWURSKLF PHVRWURSKLF DQG VRPH ROLJRWURSKLF ODNHV +RZHYHU = UDPLJHUD ZDV QRW IRXQG LQ RQH ODNH VWXGLHG ZLWK YHU\ ORZ WRWDO QLWURJHQ FRQWHQW /DNH 6KHHODU 7DEOH f 6(0 REVHUYDWLRQV RI JROGFRDWHG = UDPLJHUD LQGLFDWHG WKH SUHVHQFH RI ILEULOV ZLWKLQ DQG RQ WKH VXUIDFH RI WKH ]RRJORHDO SURMHFWLRQV ,W LV OLNHO\ WKDW WKHVH ILEULOV SURYLGH WKH VWUXFWXUH IRU WKH REVHUYHG ]RRJORHDO SURMHFWLRQV 6LPLODU VWUXFWXUHV ZHUH IRXQG RQ WKH VDQG IURP WKH FROXPQ WKDW KDG VHZDJH ZLWK SKHQRO SDVVHG WKURXJK LW 6WUXFWXUHV UHVHPEOLQJ ]RRJORHDH ZHUH DOVR REVHUYHG LQ WKH EORILOP IURP D GHQLWULI\LQJ ILOWHU E\ 6LFK DQG 5LMQ f 6LQFH QDWXUDO ]RRJORHDO ILQJHUOLNH SURMHFWLRQV UHDFWHG ZLWK DQWLERGLHV DJDLQVW = UDPLJHUD FHOOV RU H[WUDFHOOXODU SRO\PHU WKH QDWXUDO ]RRJORHDH ZHUH DOVR DQWLJHQLFDOO\ VLPLODU WR ODERUDWRU\ FXOWXUH7KH DQWLJHQLF VLPLODULW\ EHWZHHQ QDWXUDO ILQJHUOLNH SURMHFWLRQ DQG WKH ODERUDWRU\ FXOWXUH VXJJHVWV WKDW WKH

PAGE 96

PDWHULDO VXUURXQGLQJ QDWXUDO ILQJHUOLNH SURMHFWLRQV DUH FKHPLFDOO\ VLPLODU WR WKDW VXUURXQGLQJ = UDPLJHUD 7KLV H[WUDFHOOXODU PDWHULDO ZDV SUHYLRXVO\ VKRZQ WR EH D PXFRSRO\VDFFKDULGH DVVRFLDWHG ZLWK IORFFXODWLRQ )DUUDK DQG 8Q] 7H]XND 8Q] DQG )DUUDK Ef DQG FRXOG EH UHFRYHUHG IURP ODERUDWRU\ FXOWXUHV RI = UDPLJHUD DQG IURP PL[HG OLTXRU VXVSHQGHG VROLGV 8QOLNH VRPH H[WUDFHOOXODU SRO\PHUSURGXFLQJ EDFWHULD ZKRVH FORQHV RQ QXWULHQW DJDU SODWH DUH PXFRLG RU EXW\URXV = UDPLJHUD FORQHV RQ WKH DJDU SODWH DUH JHODWLQRXV GU\ DQG KDUG ,W ZDV IRXQG WKDW ]RRJORHDO SURMHFWLRQV FDQ HYHQ UHVLVW SURWR]RDQ DWWDFN LQ DFWLYDWHG VOXGJH IORHV )DUUDK f 3UHYLRXV NQRZOHGJH DQG FXUUHQW LQIRUPDWLRQ REWDLQHG E\ *&06 DQDO\VLV RI WKH H[WUDFHOOXODU SRO\PHU SURGXFHG E\ = UDPLJHUD LQGLFDWHG WKDW WKH SUHGRPLQDQFH RI FDUERK\GUDWH HVSHFLDOO\ DPLQR VXJDUV *HQHUDOO\ D EDFWHULDO H[WUDFHOOXODU SRO\PHU QRW RQO\ SURYLGHV D PDMRU VRXUFH RI ELRPDVV DV DQ DOWHUQDWLRQ HQHUJ\ VRXUFH EXW DOVR SURYLGHV VWUXFWXUDO ULJLGLW\ DQG D GHIHQVLYH EDUULHU WR LQYDGLQJ SDWKRJHQV ,W ZDV REVHUYHG WKDW WKH ILQJHUOLNH SURMHFWLRQ VWUXFWXUH RI = UDPLJHUD FDQ HYHQ UHVLVW SURWR]RDQ DWWDFN LQ DFWLYDWHG VOXGJH IORHV )DUUDK f ,W ZDV IRXQG WKDW EDFWHULDO FHOOV LQ ELRILOP DUH XVXDOO\ PRUH UHVLVWDQW WR HQYLURQPHQWDO VWUHVV DQG DQWLEDFWHULDO DJHQWV WKDQ SODQNWRQLF FHOOV 0DUVKDOO HW DO 2SKLU DQG *XWQLFN %URZQ HW DO f ,Q WKH FDVH RI FKORULQDWLRQ RI ELRILOP EDFWHULD LW ZDV VXJJHVWHG WUDQVSRUW RI FKORULQH WR ELRILOP EDFWHULD VXUIDFH PLJKW EH DQ LPSRUWDQW UDWHOLPLWLQJ VWHS /H&KHYDOOLHU HW DO DE +XDQJ HW DO f )UHH FKORULQH LV NQRZQ WR UHDFW ZLWK D ZLGH YDULHW\ RI FRPSRXQGV LQFOXGLQJ

PAGE 97

SRO\VDFFKDULGH 7KHUHIRUH EHVLGHV SURYLGLQJ D SK\VLFDO EDUULHU UHGXFLQJ WKH DELOLW\ RI FKORULQH WR DSSURDFK WKH FHOO PHPEUDQH IUHH FKORULQH PLJKW EH FRQVXPHG E\ UHDFWLRQ ZLWK H[WUDFHOOXODU SRO\PHU EHIRUH LW FDQ IXOO\ SHQHWUDWH WKH ELRILOP VXUIDFH /H&KHYDOOLHU HW DO DEf ,Q WKLV VWXG\ LW ZDV IRXQG WKDW = UDPLJHUD H[WUDFHOOXODU SRO\PHU KDG SURWHFWHG WKH FHOOV IURP FKORULQH LQDFWLYDWLRQ = UDPLJHUD H[WUDFHOOXODU SRO\PHU PLJKW HLWKHU SUHYHQW WKH GLUHFW FRQWDFW RI FKORULQH ZLWK WKH FHOOV RU UHDFW ZLWK FKORULQH %LRILOP GHYHORSPHQW RQ WKH ILOWHU PHGLD HQKDQFHV UHPRYDO RI EDFWHULD DQG ILQH SDUWLFOHV IURP ZDWHU 6FKXOHU HW DO %DQNV DQG %U\HUV 'UXU\ HW DO 5LWWPDQQ DQG :LUWHO 6SURXVH DQG 5LWWPDQQ f ,Q WKLV VWXG\ WKH ORVV LQ ]HWD SRWHQWLDO DSSHDUHG WR EH PRUH LPSRUWDQW WKDQ ELRILOP GHYHORSPHQW RQ WKH VXUIDFH RI WKH DOXPLQXP FRDWHG VDQG DIWHU ORQJ WHUP H[SRVXUH WR GHFKORULQDWHG ZDVWHZDWHU 7KHUHIRUH YLUXV UHPRYDO E\ WKH VDQG ZDV JUHDWO\ UHGXFHG DIWHU ZDVWHZDWHU H[SRVXUH $V ZLWK ELRILOP GHYHORSPHQW RUJDQLF DQG LQRUJDQLF PDWHULDOV LQ ZDVWHZDWHU DOVR fEORFNHGf IDYRUDEOH VLWHV IRU YLUXV UHPRYDO 7KXV WKH FRDWHG VDQG H[SRVHG WR FKORULQDWHG ZDVWHZDWHU DOVR UHGXFHG YLUXV UHPRYDO 7KH UHVXOWV RI WKLV VWXG\ FDQ EH VXPPDUL]HG DV IROORZV ,VRODWLRQ PHGLD IRU WKH UHFRYHU\ RI = UDPLJHUD IURP QDWXUDO HQYLURQPHQWV FDQ EH LPSURYHG E\ DGGLQJ WKH DQWLELRWLFV WULPHWKRSULP DQG VXOIDGLD]LQH 6(0 DQDO\VLV RI ILQJHUOLNH SURMHFWLRQV RI ODERUDWRU\ FXOWXUHV RI= UDPLJHUD VKRZV WKH SUHVHQFH RI ILEULOV UXQQLQJ DORQJ WKH OHQJWK RI WKH ]RRJORHDO SURMHFWLRQV

PAGE 98

,PPXQRORJLFDO DVVD\V VKRZHG WKDW ERWK WKH FHOOV DQG H[WUDFHOOXODU SRO\PHU RI QDWXUDO ILQJHUOLNH SURMHFWLRQV DUH DQWLJHQLFDOO\ VLPLODU WR WKRVH RI = UDPLJHUD 7KH PDMRU FRPSRQHQWV RI WKH H[WUDFHOOXODU SRO\PHU VXUURXQGLQJ = UDPLJHUD DUH JDODFWRVDPLQH DQG DQRWKHU XQLGHQWLILHG DPLQR VXJDU 7KH H[WUDFHOOXODU SRO\PHU SURWHFWV = UDPLJHUD FHOOV IURP LQDFWLYDWLRQ E\ FKORULQH = UDPLJHUD FDQ EH IRXQG LQ DOO VWDJHV RI ZDVWHZDWHU WUHDWPHQW EXW DUH SUHVHQW LQ WKH KLJKHVW SHUFHQWDJH LQ PXWHG OLTXRU VDPSOHV = UDPLJHUD FDQ DOVR EH IRXQG LQ HXWURSKLF PHVRWURSKLF DQG VRPH RI ROLJRWURSKLF ODNHV EXW QRW LQ WKH ODNH ZLWK ORZ QLWURJHQ FRQWHQW ([SRVXUH RI PRGLILHG VDQG WR ZDVWHZDWHU GHFUHDVHV LWV DELOLW\ WR DGVRUE YLUXVHV LQ ZDWHU 3DUW RI WKH ELRILOP WKDW GHYHORSV RQ VDQG H[SRVHG WR ZDVWHZDWHU FRQWDLQLQJ SKHQRO KDYH VWUXFWXUHV WKDW UHVHPEOH ILQJHUOLNH SURMHFWLRQV RI = UDPLJHUD

PAGE 99

$33(1',; 6(48(1&( 2) = 5$0,*(5$ $7&& f 6 551$ 25,*,1 DJDJW W WJD WQQ WJJFW FDJDWWJDDFJFWJJFJJFDWJF WDFDFDWJFDDJ WFJDDF JJ WDDFDJJJDJF WWJF WFFJF WJDFJDJ WJJFJDDFJJJW JDJWDDWJFDWFJJDDFJW JFFJ WJ WDD WJJJJJD WDDFJ WDJFJDDDJ WWDFJFWDDWDFFJFD WDFJFFFWJDJJJJ JDDDJ WJJJJJDFFJFDDJJFF WFDFJ W WDWDFHDHFJJFFJD WJWFJJDW WDHFWDHWW JJ WJJJJWDDDJJFF WDFFDDJJFJDFJD WFFJ WDJFJJJW FWJDJDJJDWJDWFFJFFD !3 FDF WJJJDF WJDJDFDFJJFFFDJDF WFFWDFJJJDJJFDJFDJW JJJJDDWW WWJJDFD DW JJJJJFDDFFF WJD WFFDJFFDWJFFJFJ WJDJWJDDFDDJJFFW WFJJJW WJWDDDJ FWFW W WFDJJ WJJDDDJDDD WFJFDWF WW WWDDWDFDJJJ WJ WJJD WJDFJJ WDFFD WHD JDDJDDJFDFFJJFWDDF WDFJ WJFFDJFDJFFJFJJWDDWDFJ WDJJJ WJFJDJFJ WWD D WHJJDD WWDF WJJJFJWDDDJFJ WJFJFDJJFJJW WDWJ WDDJDFDJD WJWJDDD WFFF HJJJH WFDDFFWJJJDDFWJFJW W WJWJDF WJFDWDDFWDJDJWDFJJFDJDJJJDJJWJ JDD WWFFJFJ WJ WDJHDJ WJDDDWJFJWDJDJDWJFJJDJJDDFDFFJDWJJFJDDJJFD JFFWFF WJJJFFDJ WDFWJDFJFWFD WJFDFJDDDJFJ WJJJJDJFDDDFDJJDW WDJDW DFFF WJJ WDJ W FFDFJFFFW DDDFJDWJWFDDFWDJW WJW WHJJ WJDJJDJDF WFDWWJD 3 f§JDWFDDFDDJFFDF WHH WF WJDJWDD J WDDFJFDJF WDDFJFJWJDDJW WJDFFJFFWJJJJDJ WDFJJFFJFDDJJW WDDDDFWF DDDJJDDW WJDFJJJJDFFFJFDFDDJFJJW JJDWJDWJ WJJDW WDDW WFJDWJFDDFJF JDDDDDFFW WDFH WDFFFW WJDFDWJFFDJJDDFW WJFFDJDJD WJJFW WJJ WJFFFJDD DJJJDDFF WJJDFDFDJJWJF WJHD WJJFWJ WHJWHDJH WHJWJ WFJWJDJDWJW WJJJW WDDJ W FFFJFDDFJDJFJFDDFFFW WJWHDW WDJW WJFFDJFDW WDDJW WJJJFDF WF WD D WJDJDF WJHHJJ WJDFDDDFFJJDJJDDJJWJJJJDWJDFJWFDDJWFFWFD WJJFFFW WDWJJJWDJJJFW WFDFDFJ WHD WDFDD WJJ WFJJWDFDJDJJJW WJFFDDJFFJFJDJJ WJJDJFFDD WFFFDJDDDJFFJD WHJWDJ WHHJJDW WJJDJWF WJFDDF WFJDFWFFD WJ DDJ WHJJDD WHJH WDJWDD WFJFDJD WHDJHDWJH WJHJJ WJDDWDFJ WWFFFJJJWFWW JWDFDFDFFJFFFJ WFDFDFFDWJJJDJ WJJJJW W WDFFDJDDJW DJJWDJHW WDDFFW W FJJJDJJJFJFW WDFFDFJJWJDJFW WFDWJDF WJJJJ WJDDJ WFJWDDFDDJJWDJFFJ WDWFJJDDJJWJFJJFWJJDWFDFFWFFWW 1RWH WKH EROG OHWWHUV LQGLFDWH WKH VHTXHQFH FRPSOHPHQWDU\ WR 6 U51$ ROLJRQXFOHRWLGH SUREH XVHG SUHYLRXVO\ 8QGHUOLQHG OHWWHUV LQGLFDWH WKH SULPHUV XVHG LQ 573&5 UHDFWLRQ

PAGE 100

5()(5(1&(6 $OOLVRQ DQG : 6XWKHUODQG 7KH UROH RI H[RSRO\VDFFKDULGHV LQ DGKHVLRQ RI IUHVKZDWHU EDFWHULD *HQ 0LFURELRO $PHULFDQ 3XEOLF +HDOWK $VVRFLDWLRQ 6WDQGDUG 0HWKRGV IRU WKH ([DPLQDWLRQ RI :DWHU DQG :DVWHZDWHU WK HGLWLRQ $PHULFDQ 3XEOLF +HDOWK $VVRFLDWLRQ ,QF 1HZ
PAGE 101

%LWWRQ DQG % .RRSPDQ 7HWUD]ROLXP UHGXFWLRQPDODFKLWH JUHHQ PHWKRG IRU DVVHVVLQJ WKH YLDELOLW\ RI ILODPHQWRXV EDFWHULD LQ DFWLYDWHG VOXGJH $SSO (QYLURQ 0LFURELRO %ROLVWHU 1 0 %DVNHU 1 $ +RGJHV DQG & 0DUULRW 7KH GLIIXVLRQ RI %HWD ODFWDP DQWLELRWLFV WKURXJK PL[HG JHOV RI F\VWLF ILEURVLVGHULYHG PXFLQ DQG 3VHXGRPRQDV DHUXJLQRVD DOJLQDWH $QWLPLFURE &KHPRWKHU %ULWVFKJL 7 % DQG 6 *LYRQQRQL 3K\ORJHQHWLF DQDO\VLV RI D QDWXUDO PDULQH EDFWHULRSODQNWRQ SRSXODWLRQ E\ U51$ JHQH FORQLQJ DQG VHTXHQFLQJ $SSO (QYLURQ 0LFURELRO %URZQ 0 / + & $OGULFK DQG *DXWKLHU 5HODWLRQVKLS EHWZHHQ JO\FRFDL\[ DQG SRYLGRQHLRGLQH UHVLVWDQFH LQ 3VHXGRPRQDV DHUXJLQRVD $7&&f ELRILOPV $SSO (QYLURQ 0LFURELRO %XWWHUILHOG & 7 6WXGLHV RI 6HZDJH 3XULILFDWLRQ ,, $ ]RRJORHDIRUPLQJ EDFWHULXP LVRODWHG IURP DFWLYDWHG VOXGJH 8 6 3XE +HDOWK 5HS &DPSEHOO $ DQG + 6PLWK ,PPXQRPDJQHWLF VHSDUDWLRQ RI &U\SWRVSRULGLXP RRF\VWV IURP ZDWHU VDPSOHVURXQG URELQ FRPSDULVRQ RI WHFKQLTXHV :DWHU 6FL 7HFKQRO &DSSXFFLQR DQG 1 6KHUPDQ 0LFURELRORJ\ D /DERUDWRU\ 0DQXDO 7KLUG (GLWLRQ 7KH %HQMDPLQ&XPPLQJV 3XEOLVKLQJ &RPSDQ\ ,QF &HQWXULRQ / $ & &DVWUR 0 6KDIIHU 9 : & 9DQ & 0 0DUUD DQG 6 $ /XNHKDUW 'HWHFWLRQ RI 7UHSRQHPD SDOOLGXP E\ D VHQVLWLYH UHYHUVH WUDQVFULSWDVH 3&5 &OLQ 0LFURELRO &KDGZLFN 1 %UXFH 0 'DYLHV % YDQ*HPHQ 5 6FKXNNLQN .KDQ 5 3RXQGHU DQG $:DNHILHOG $ VHQVLWLYH DQG UREXVW PHWKRG IRU PHDVOHV 51$ GHWHFWLRQ 9LURO 0HWKRGV &KDSOLQ 0) 0RQRVDFFKDULGHV ,Q &DUERK\GUDWH $QDO\VLV D 3UDFWLFDO $SSURDFK QG HGLWLRQ (GV 0) &KDSOLQ DQG ) .HQQHG\ ,5/ 3UHVV 2[IRUG8. S &KHQ 6 7UXHVGDLO ) /X =KDQ & %HOYLQ % .RRSPDQ 6 5 )DUUDK DQG '2 6KDK /RQJWHUP HYDOXDWLRQ RI DOXPLQXP K\GUR[LGHFRDWHG VDQG IRU UHPRYDO RI EDFWHULD IURP ZDVWHZDWHU :DWHU 5HV LQ SUHVV

PAGE 102

&KRZ 9 7 < & &KDQ 5
PAGE 103

'H %HHU 5 6ULQLYDVDQ DQG 3 6 6WHZDUW 'LUHFW PHDVXUHPHQW RI FKORULQH SHQHWUDWLRQ LQWR ELRILOPV GXULQJ GLVLQIHFWLRQ $SSO (QYLURQ 0LFURELRO 'H/RQJ ( ) )UDQNV DQG $ / $OOXOUHGJH 3K\ORJHQHWLF GLYHUVLW\ RI DJJUHJDWHDWWDFKHG YV IUHHOLYLQJ PDULQH EDFWHULDO DVVHPEODJHV /LPQRL 2FHDQRUJU GH 1\V 5 3 6WHLQEHUJ 3 :LOOHPVRQ 6 'ZDUMDQ\Q & / *DEHOLVK DQG 5 .LQJ %URDG VSHFWUXP HIIHFWV RI VHFRQGDU\ PHWDEROLWHV IURP WKH UHG DOJDH 'HOLVHD SXOFKUD LQ DQWLIRXOLQJ DVVD\V %LRIRXOLQJ 'UXL\ : : &KDUDFNOLV DQG 3 6 6WHZDUW ,QWHUDFWLRQ RI PP ODWH[ SDUWLFOHV ZLWK 3VHXGRPRQDV DHUXJLQRVD ELRILOPV :DWHU 5HV 'XJDQ 35 DQG /XQGJUHQ ,VRODWLRQ RI WKH IORFIRUPLQJ RUJDQLVP =RRJORHD UDPLJHUD DQG LWV FXOWXUH LQ FRPSOH[ DQG V\QWKHWLF PHGLD $SSO 0LFURELRO 'XWWRQ 5 %LWWRQ DQG % .RRSPDQ 0DODFKLWH JUHHQ,17 0,17f PHWKRG IRU GHWHUPLQJ DFWLYH EDFWHULD LQ VHZDJH $SSO (QYLURQ 0LFURELRO (FKHYDUULD ( ' (UGPDQ ( 0 6ZLHUNRV] % 3 +ROORZD\ DQG / $QGHUVRQ 6LPXOWDQHRXV GHWHFWLRQ DQG LGHQWLILFDWLRQ RI KXPDQ SDUDLQIOXHQ]D YLUXVHV DQG IURP FOLQLFDO VDPSOHV E\ PXOWLSOH[ 3&5 &OLQ 0LFURELRO (UEHUO / 0 :LQVRQ & 6WHUQEHUJ 6 $ % 6WHZDUW &KULVWLDQVHQ 6 5 &KKDEUD % %\FURIW 3 :LOOLDPV 6 0ROLQ DQG 0 *LYVNRY ,QYROYHPHQW RI 1DF\O/KRPRVHULQH ODFWRVH DXWRLQGXFHUV LQ FRQWUROOLQJ WKH PXOWLFHOOXODU EHKDYLRU RI 6HUUDGD OLTXHIDFLHQV 0RO 0LFURELRO )DUUDK 6 5 %DFWHULDO ]RRJORHD IRUPDWLRQ 3K GLVVHUWDWLRQ 3HQQV\OYDQLD 6WDWH 8QLYHUVLW\ )DUUDK 6 5 DQG 5 3UHVWRQ &RQFHQWUDWLRQ RI YLUXVHV IURP ZDWHU E\ XVLQJ FHOOXORVH ILOWHUV PRGLILHG E\ LQ VLWX SUHFLSLWDWLRQ RI IHUULF DQG DOXPLQXP K\GUR[LGHV $SSO (QYLURQ 0LFURELRO )DUUDK 6 5 DQG 5 3UHVWRQ $GVRUSWLRQ RI YLUXVHV E\ GLDWRPDFHRXV HDUWK FRDWHG ZLWK PHWDOOLF R[LGHV DQG PHWDOOLF SHUR[LGHV :DWHU 6FL 7HFK )DUUDK 6 5 DQG 5 ) 8Q] )OXRUHVFHQWDQWLERG\ VWXG\ RI QDWXUDO ILQJHUOLNH =RRJORHDH $SSO (QYLURQ 0LFURELRO

PAGE 104

)DUUDK 6 5 DQG 5 ) 8Q] ,VRODWLRQ RI H[WUDFHOOXODU SRO\PHU IURP =RRJORHD VWUDLQ 03 DQG DQG IURP DFWLYDWHG VOXGJH $SSO (QYLURQ 0LFURELRO )ULHGPDQ % $ DQG 3 5 'XQJDQ ,GHQWLILFDWLRQ RI =RRJORHD VSHFLHV DQG WKH UHODWLRQVKLS WR ]RRJORHDO PDWUL[ DQG IORH IRUPDWLRQ %DFWHULRO )ULHGPDQ % $ 3 5 'XJDQ 5 0 3ILVWHU DQG & & 5HPVHQ )LQH VWUXFWXUH DQG FRPSRVLWLRQ RI WKH ]RRJORHDO PDWUL[ VXUURXQGLQJ =RRJORHD UDPLJHUD %DFWHULRO )XTXD & 6 & :LOODQV DQG ( 3 *UHHQEHUJ &HQVXV DQG FRQVHQVXV LQ EDFWHULDO HFRV\VWHPV WKH /X[5/X[/ IDPLO\ RI TXRUXPVHQVLQJ WUDQVFULSWLRQDO UHJXODWRUV $QQX 5HY 0LFURELRO *DQW]HU & 6 6HQRXFL $ 0DXO < /HYL DQG / 6FKZDUW]EURG (QWHURYLUXV JHQRPHV LQ ZDVWHZDWHU FRQFHQWUDWLRQ RQ JODVV ZRRO DQG JODVV SRZGHU DQG GHWHFWLRQ E\ 573&5 9LURO 0HWKRGV *HUED & 3 $SSOLHG DQG WKHRUHWLFDO DVSHFWV RI YLUXV DGVRUSWLRQ WR VXUIDFHV $GY ,Q $SSO 0LFUR *HUED &3 +RX DQG 0 6REVH\ 0LFURELDO UHPRYDO DQG LQDFWLYDWLRQ IURP ZDWHU E\ ILOWHUV FRQWDLQLQJ PDJQHVLXP SHUR[LGH (QYLURQ 6FL +HDOWK $ *LOODQ & $* & / 6SHNVQLMGHU =ZDUW DQG & 'H 5LGGHU *HQHWLF GLYHUVLW\ RI WKH ELRILOP FRYHULQJ 0RQWDFXWD IHUUXJLQRVD 0ROOXVFD %LYDOYLDf DV HYDOXDWHG E\ GHQDWXULQJ JUDGLHQW JHO HOHFWURSKRUHVLV DQDO\VLV DQG FORQLQJ RI 3&5 DPSOLILHG JHQH IUDJPHQWV FRGLQJ IRU 6 U51$ $SSO (QYLURQ 0LFURELRO *LYVNRY 0 5 GH1\V 0 0DQHILHOG / *UDP 5 0D[LPLOLHQ / (EHUO 6 0ROLQ 3 6WHLQEHUJ DQG 6 .MLOOHEHUJ (XNDU\RWLF LQWHUIHUHQFH ZLWK KRPRVHULQH ODFWRVHPHGLDWHG SURNDU\RWLF VLJQDOLQJ %DFWHULRO +DIOLJHU 0 *LOJHQ /XWK\ DQG 3 +XEQHU 6HPLQHVWHG 573&5 V\VWHPV IRU VPDOO URXQG VWUXFWXUHG YLUXVHV DQG GHWHFWLRQ RI HQWHULF YLUXVHV LQ VHDIRRG ,QW )RRG 0LFURELRO +D\DVH < DQG 7RELWD 'HWHFWLRQ RI JHQHV RI .1$ YLUXVHV IURP IUHVKO\ ELRSVLHV JDVWULF PXFRVD E\ UHYHUVH WUDQVFULSWLRQ SRO\PHUDVH FKDLQ UHDFWLRQ *DVWURHQWHURO

PAGE 105

+HLVVHQEHUJHU $ * /HSSDUG DQG +HPGO 5HODWLRQVKLS EHWZHHQ WKH LQWUDFHOOXODU LQWHJULW\ DQG WKH PRUSKRORJ\ RI WKH FDSVXODU HQYHORSH LQ DWWDFKHG DQG IUHHOLYLQJ PDULQH EDFWHULD $SSO (QYLURQ 0LFURELRO +HMODU DQG &KXGRED 0LFURELDO SRO\PHUV LQ WKH DTXDWLF HQYLURQPHQW, SURGXFWLRQ E\ DFWLYH VOXGJH PLFURRUJDQLVPV XQGHU GLIIHUHQW FRQGLWLRQV :DW 5HV +HUVRQ '6 % 0F*RQLJOH 0$ 3D\HU DQG + %DNHU $WWDFKPHQW DV D IDFWRU LQ WKH SURWHFWLRQ RI (QWHUREDFWHU FORDFDH IURP FKORULQDWLRQ $SSO (QYLURQ 0LFURELRO +HXNHOHNLDQ + DQG 0 / /LWWPDQ &DUERQ DQG QLWURJHQ WUDQVIRUPDWLRQV LQ WKH SXULILFDWLRQ RI VHZDJH E\ WKH DFWLYDWHG VOXGJH SURFHVV ,, 0RUSKRORJLFDO DQG ELRFKHPLFDO VWXGLHV RI ]RRJORHDO RUJDQLVPV 6HZDJH :RUNV -RXUQDO +H\HV 6 3 *LOEHUW $ (EHUKDUG DQG $OOLVRQ +RPRVHULQH ODFWRQHV DQG EDFWHULDO ELRILOPV 3 ,Q :LPSHQQ\ 3 +DQGOH\ 3 *LOEHUW + /DSSLU6FRWW DQG 0 -RQHV HGf %LRILOPV FRPPXQLW\ LQWHUDFWLRQV DQG FRQWURO %LROLQH &DUGLII 8QLWHG .LQGRP +LUDLVKL $ < 6KLQ DQG 6XJL\DPD 3URSRVDO WR UHFODVVLI\ =RRJORHD UDPLJHUD ,$0 3 5 'XJDQ f DV 'XJDQHOOD ]RRJORHRLGHV JHQ 1RY VS 1RY ,QW 6\VW %DFWHULRO f +REHU 7 / 1JX\HQ / 6KHQ '4 +D 9 7 +XRQJ 6 %HQ\RXFHI 7 + 1JX\HQ 7 0 %XL + /RDQ % / /H $ %RX]LGL 'H *URWH 0 7 'URXHW 9 'HXEHO DQG 3 :DWWUH 7XPRU QHFURVLV IDFWRU DOSKD OHYHOV LQ SDOVPD DQG ZKROHEORRG FXOWXUH LQ GHQJXHLQIHFWHG SDWLHQWV UHODWLRQVKLS EHWZHHQ YLUXV GHWHFWLRQ DQG SUHH[LVWLQJ VSHFLILF DQWLERGLHV 0HG 9LURO +RGJHV 1 $ DQG & $ *RUGRQ 3URWHFWLRQ RI 3VHXGRPRQDV DHUXJLQRVD DJDLQVW FLSURIOR[DFLQ DQG EHWDODFWDPV E\ KRPRORJRXV DOJLQDWH $QWLPLFURE $JHQWV &KHPRWKHU +ROW -RKQ 1 5 .ULHJ 3 + $ 6QHDWK 7 6WDOH\ DQG 6 7 :LOOLDPV %HUJH\ nV 0DQXDO RI 'HWHUPLQDWLYH %DFWHULRORJ\ WK (GLWLRQ S +RUDQ 1 DQG & 5 (FFOHV 3XULILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI H[WUDFHOOXODU SRO\VDFFKDULGH IURP DFWLYH VOXGJH :DWHU 5HV +R\OH % $OFKQWDUD DQG : &RVWHUWRQ 3VHXGRPRQDV DHUXJLQRVD ELRILOP DV D GLIIXVLRQ EDUULHU WR SLSHUDFLOOLQ $QWLPLFURE $JHQWV &KHPRWKHU

PAGE 106

+XDQJ &7 ) 3
PAGE 107

.DZDVKLPD + 7 0L\DMLPD 7 0RUL /
PAGE 108

/H&KHYDOOLHU 0 : 7 6 +DVVHQDXHU $ / &DPSHU DQG $ 0F)HWHUV 'LVLQIHFWLRQ RI EDFWHULD DWWDFKHG WR JUDQXODU DFWLYDWHG FDUERQ $SSO (QYLURQ 0LFURELRO /HJHD\ 2 6 %RXQDL[ 0 'HQLV & $PDXOG ( +XWHW 5 &DULROHW ( $OELQD DQG $ -HVWLQ 'HYHORSPHQW RI D 573&5 WHVW FRXSOHG ZLWK D PLFURSODWH FRORULPHWULF DVVD\ IRU WKH GHWHFWLRQ RI D VZLQH $UWHULYLUXV 35569f LQ ERDU VHPHQ 9LURO 0HWKRGV /LHVDFN : DQG ( 6WDFNHEUDQGW 2FFXUDQFH RI QRYHO JURXSV RI WKH GRPDLQ %DFWHULD DV UHYHDOHG E\ DQDO\VLV RI JHQHWLF PDWHULDOV LVRODWHG IURP DQ $XVWUDOLDQ WHUUHVWULDO HQYLURQPHQW %DFWHULG /LQ < 0 9
PAGE 109

0HQ]HO : DQG 1 &RUZLQ 7KH PHDVXUHPHQW RI WRWDO SKRVSKRUXV VHDZDWHU EDVHG RQ WKH OLEHUDWLRQ RI RUJDQLFDOO\ ERXQG IUDFWLRQV E\ SHUVXOIDWH R[LGDWLRQ /LPQRORJ\ DQG 2FHDQRJUDSK\ 0LOOV $ / 6 +HUPDQ *0 +RPEHUJHU DQG 7 + 'HMHVXV (IIHFW RI VROXWLRQ LRQLF VWUHQJWK DQG LURQ FRDWLQJV RQ PLQHUDO JUDLQV RQ VRUSWLRQ RI EDFWHULDO FHOOV WR TXDUW] VDQG $SSO (QYLURQ 0LFURELRO 0XQLFK ,QWHUQDWLRQDO FRPPLWWHH RQ V\VWHPDWLF EDFWHULRORJ\ MXGLFLDO FRPPLVVLRQ ,QW 6\VW %DFWHULRO 0XUSK\ DQG 3 5LOH\ $ PRGLILHG VLQJOH VROXWLRQ PHWKRG IRU WKH GHWHUPLQDWLRQ RI SKRVSKDWH LQ QDWXUDO ZDWHUV $QDO\WLFD &KLPLFD $FWD 0X\]HU DQG 1 % 5DPVLQJ 0ROHFXODU PHWKRGV WR VWXG\ WKH RUJDQL]DWLRQ RI PLFURELDO FRPPXQLWLHV :DWHU 6FL 7HFK 1RUEHUJ $ % DQG 62 (QIRUV 3URGXFWLRQ RI ([WUDFHOOXODU SRO\VDFFKDULGH E\ =RRJORHD UDPLJHUD $SSO (QYLURQ 0LFURELRO f 1RUEHUJ $ % DQG + 3HUVVRQ $FFXPXODWLRQ RI KHDY\PHWDO LRQV E\ =RRJORHD UDPLJHUD %LRWHFKQRORJ\ DQG %LRHQJLQHHULQJ 1RUEHUJ $ DQG 6 5\GLQ 'HYHORSPHQW RI D FRQWLQXRXV SURFHVV IRU PHWDO DFFXPXODWLRQ E\ =RRJORHD UDPLJHUD %LRWHFKQRORJ\ DQG %LRHQJLQHHULQJ 1R]DZD 1 7DNL]DZD DQG + .L\RKDUD 5HVWRUDWLRQ RI WKH DELOLW\ WR VHWWOH EXONLQJ VOXGJH E\ EDFWHULD VHHGLQJ LQ ZDVWHZDWHU WUHDWPHQW )HUPHQW 7HFKQRO 2SKLU 7 DQG / *XWQLFN $ UROH IRU H[RSRO\VDFFKDULGHV LQ WKH SURWHFWLRQ RI PLFURRUJDQLVPV IURP GHVLFFDWLRQ $SSO (QYLURQ 0LFURELRO 3DUVRQV $ % DQG 3 5 'XJDQ 3URGXFWLRQ RI H[WUDFHOOXODU SRO\VDFFKDULGH PDWUL[ E\ =RRJORHD UDPLJHUD $SSO 0LFURELRO 3DVVDGRU / 0 &RRN 0 *DPEHOOR / 5XVW DQG % + ,JOHZVNL ([SUHVVLRQ RI 3VHXGRPRQDV DHUXJLQRVD YLUXOHQFH JHQHV UHTXLUHV FHOOWRFHOO FRPPXQLFDWLRQ 6FLHQFH 3HWHUVRQ / $ VLPSOLILFDWLRQ RI WKH SURWHLQ DVVD\ PHWKRG RI /RZU\ HW DO ZKLFK LV PRUH JHQHUDOO\ DSSOLFDEOH $QDO %LRFKHP

PAGE 110

3IHLIHU 0 % 3URHEVWHU 5 0 .LQQH\ DQG 2 5 .DDGHQ *HQXVVSHFLILF GHWHFWLRQ RI D DOSKDYLUXVHV E\ D VHPLQHVWHG UHYHUVH WUDQVFULSWLRQSRO\PHUDVH FKDLQ UHDFWLRQ $P 7URS 0HG +\J 3LHSHU $ 3 1 5\DQ 5 : +DUYH\ / $P\ 7 + ,OODQJDVHNDUH DQG : 0HWJH 7UDQVSRUW DQG UHFRYHU\ RI EDFWHULRSKDJH 35' LQ D VDQG DQG JUDYHO DTXLIHU HIIHFW RI VHZDJHGHULYHG RUJDQLF PDWWHU (QYLURQ 6FL 7HFKQRO 4XUHVKL 0 1 & ( %DUU +HZOLWW 5 %RRUVWHLQ ) .RQJ 2 %DJDVUD / ( %REURVNL DQG % -RVKL 'HWHFWLRQ RI +,9 LQ RUDO PXFRVD FHOOV 2UDO 'LV 6XSSO O6 5DR 9 & DQG / 0HOQLFN (QYLURQPHQWDO 9LURORJ\ $PHULFDQ 6RFLHW\ IRU 0LFURELRORJ\ S 5HGPDQ $ 6 % *UDQW DQG 7 0 2OVRQ )LOWUDWLRQ RI UHFRPELQDQW 1RUZDON YLUXV SDUWLFOHV DQG EDFWHULRSKDJH 06 LQ 4XDUW] VDQG ,PSRUWDQFH RI HOHFWURVWDWLF LQWHUDFWLRQV (QYLURQ 6FL 7HFKQRO 5LWWPDQQ % ( DQG 6 $ :LUWHO (IIHFW RI ELRILOP DFFXPXODWLRQ RQ FROORLG FRKHVLRQ (QYLURQ (QJLQ 5RKZGGHU $ 2 .HPLQHU )RUVWHU 6FKQHLGHU ( 6FKQHLGHU DQG + :HUFKDX 'HWHFWLRQ RI UHVSLUDWRU\ V\QF\WLDO YLUXV 51$ LQ EORRG RI QHRQDWHV E\ SRO\PHUDVH FKDLQ UHDFWLRQ 0HG 9LURO 5RVVHOORPRUD 5 $ : /XGZLJ DQG + 6FKOHLIHU =RRJORHD UDPLJHUD $ SK\ORJHQHWLFDOO\ GLYHUVH VSHFLHV )(06 0LFURELRORJ\ /HWWHUV 5RVVHOORPRUD 5$ 0 :DJQHU 5 $PDQQ DQG + 6FKOHLIHU 7KH DEXQGDQFH RI =RRJORHD UDPLJHUD LQ VHZDJH WUHDWPHQW SODQWV $SSO DQG (QYLURQ 0LFURELRO f 6DOPRQG 3 & % : %\FURIW 6 $ % 6WHZDUW DQG 3 :LOOLDPV 7KH EDFWHULDO fHQLJPDf FUDFNLQJ WKH FRGH RI FHOOFHOO FRPPXQLFDWLRQ 0RO 0LFURELRO 6DUWRU\ 3 DQG 8 *UREEHODDU ([WUDFWLRQ RI &KORURSK\OO D IURP IUHVKZDWHU SK\WRSODQNWRQ IRU VSHFWURSKRWRPHWULF DQDO\VLV +\GURELRORJLD 6FKXOHU 3 ) 0 0 *KRVK DQG 3 *RSDODQ 6ORZ VDQG DQG GLDWRPDFHRXV HDUWK ILOWUDWLRQ RI F\VWV DQG RWKHU SDUWLFXODWHV :DWHU 5HV

PAGE 111

6KLQ < $ +LUDLVKL DQG 6XJL\DPD 0ROHFXODU V\VWHPDWLF RI JHQXV =RRJORHD DQG HPHQGDWLRQ RI WKH JHQXV ,QW 6\VW %DFWHULRO f 6LFK + DQG 9 5LMQ 6FDQQLQJ HOHFWURQ PLFURVFRS\ RI ELRILOP IRUPDWLRQ LQ GHQLWULI\LQJ IOXLGLVKHG EHG UHDFWRUV :DWHU 5HV f 6NHUPDQ 9 % 9 0F*RZDQ DQG 3 + $ 6QHDWK $SSURYHG OLVWV RI EDFWHULDO QDPHV ,QW 6\VW %DFWHULRO 6PLWK ( 4XDQWLWDWLRQ RI YLUXVHV LQ ZDVWH DQG RWKHU ZDVWHV 8 6 (QYLURQPHQWDO 3URWHFWLRQ $JHQF\ 3URMHFW 6XPPDU\ (3$ 6 6QXVWDG 6 $ DQG 6 'HDQ *HQHWLF ([SHULPHQWV ZLWK %DFWHULDO 9LUXVHV : + )UHHPDQ DQG &R 6DQ )UDQFLVFR 6REVH\ 0 7 &URPHDQV $ 5 +LFNH\ DQG 6 *ODVV (IIHFWV RI ZDWHU TXDOLW\ RQ PLFURSRURXV ILOWHU PHWKRGV IRU HQWHULF YLUXV FRQFHQWUDWLRQ :DWHU 6FL 7HFK 6SURXVH DQG % ( 5LWWPDQQ &ROORLG UHPRYDO LQ IOXLGL]HG EHG ELRILOP UHDFWRU (QYLURQ (QJLQ 6WHJHPDQ & $ : &RKHQ 7HUYDHUW 3 ( GH -RQJ DQG & .DOOHQJHUJ 7ULPHWKRSULPVXOIDPHWKR[D]ROH FRWULPR[D]ROHf IRU WKH SUHYHQWLRQ RI UHODSVHV RI :HJHQHUfV JUDQXORPDWRVLV 'XWFK &RWULPR[D]ROH :HJHQHU 6WXG\ *URXS 1 (QJO 0HG Of 6WHQNDPS 9 6 DQG 0 0 %HQMDPLQ (IIHFW RI ,URQ 2[LGH &RDWLQJ RQ 6DQG )LOWUDWLRQ :DWHU 5HV 6WHZDUW 3 6 $ &DPSHU 6 +DUGUDQ &7 +XDQJ DQG 0 :DPHFNH 6SDWLDO GLVWULEXWLRQ DQG FRH[LVWHQFH RI .OHEVLHOOD SQHXPRQLD DQG 3VHXGRPRQDV DHUXJLQRVD LQ ELRILOPV 0LFURELRO (FRO 6WLFNOHU 1 6 0RUULV 5 & 0F/HDQ DQG & )XTXD %LRILOPV RQ LQGZHOOLQJ XUHWKUDO FDWKHWHUV SURGXFH TXRUXPVHQVLQJ VLJQDO PROHFXOHV LQ VLWX DQG LQ YLWUR $SSO (QYLURQ 0LFURELRO 7H]XND < $ ]RRJORHD EDFWHULXP ZLWK JHODWLQRXV PXFRSRO\VDFFKDULGH PDWUL[ :DWHU 3ROOXW &RQWURO )HG 7UXHVGDLO 6 ( /XNDVLN 6 5 )DUUDK 2 6KDK DQG 5 % 'LFNLQVRQ $QDO\VLV RI EDFWHULDO GHSRVLWLRQ RQ PHWDO K\GUfR[ LGHFRDWHG VDQG ILOWHU PHGLD FROORLG ,QWHUIDFH 6FL

PAGE 112

7\OHU /f 5 6RNRO 6 0 2EHUKDXV 0 /H ) 0 .DUUHU 0 5 0DUNHZLF] 5: 7\VRQ 5 0XUSK\ 5 /RZ DQG : 5 %URZQ 'HWHFWLRQ RI UHRYLUXV 51$ LQ KHSDWRELOLDU\ WLVVXHV IURP SDWLHQWV ZLWK H[WUDKHSDWLF ELOLDU\ DWUHVLD DQG FKROHGRFKDO F\VWV +HSDWRORJ\ 8Q] 5 ) 1HRW\SH VWUDLQ RI =RRJORHD UDPLJHUD ,W]LJVRKQ UHTXHVW IRU RSLQLRQ ,QW 6\VW %DFWHULG 8Q] 5 ) DQG 1 & 'RQGHUR D 7KH SUHGRPLQDQW EDFWHULDO LQ QDWXUDO ]RRJORHDO FRORQLHV LVRODWLRQ DQG LGHQWLILFDWLRQ &DQDGLDQ -RXUQDO RI 0LFURELRORJ\ 8Q] 5 ) DQG 1 & 'RQGHUR E 7KH SUHGRPLQDQW EDFWHULDO LQ QDWXUDO ]RRJORHDO FRORQLHV ,, 3K\VLRORJ\ DQG QXWULWLRQ &DQDGLDQ -RXUQDO RI 0LFURELRORJ\ 8Q] 5 ) DQG 6 5 )DUUDK 8VH RI DURPDWLF FRPSRXQGV IRU JURZWK DQG LVRODWLRQ RI =RRJORHD $SSO 0LFURELRO 8Q] 5 ) DQG 6 5 )DUUDK D 2EVHUYDWLRQV RQ WKH IRUPDWLRQ RI ZDVWHZDWHU ]RRJORHDH :DWHU 5HV 8Q] 5 ) DQG 6 5 )DUUDK E (36 SURGXFWLRQ DQG IORFFXODWLRQ E\ =RRJORHD 03 $SSO (QYLURQ 0LFURELRO f 9DODVVLQD 0 $ 0 &XSSRQH 0 &XVL DQG 3 ( 9DOHQVLQ 5DSLG GHWHFWLRQ RI GLIIHUHQW 51$ UHVSLUDWRU\ YLUXV VSHFLHV E\ PXOWLSOH[ 573&5 DSSOLFDWLRQ WR FOLQLFDO VSHFLPHQV &OLQ 'LDJQ 9LURO 9DQGHYLYHUH 3 DQG 3 %DYH\H (IIHFW RI EDFWHULDO H[WUDFHOOXODU SRO\PHUV RQ WKH VDWXUDWHG K\GUDXOLF FRQGXFWLYLW\ RI VDQG FROXPQV $SSO (QYLURQ 0LFURELRO 9HVH\ 6 6ODGH 0 %\UQH 6KHSKHUG 3 'HQQLV DQG & 5 )ULFNHU 5RXWLQH PRQLWRULQJ RI &U\SWRVSRULGLXP RRF\VWV LQ ZDWHU XVLQJ IORZ F\WRPHWU\ $SSO %DFWHULRO 9LHVVPDQ : -U DQG 0 +DPPHU :DWHU 6XSSO\ DQG 3ROOXWLRQ &RQWURO +DUSHU&ROOLQ SXEOLVKHU S :DONHU ) 0 0 & 'D]]D 0 & 'DXJH 2 %RXFKHU & %HGHO +HQLQ DQG 7 /HK\ 'HWHFWLRQ DQG ORFDOL]DWLRQ E\ LQ VLWX PROHFXODU ELRORJ\ WHFKQLTXHV DQG LPPXQRKLVWRFKHPLVWL\ RI KHSDWLWLV & YLUXV LQ OLYHUV RI FKURQLFDOO\ LQIHFWHG SDWLHQWV +LVWRFKHP &\WRFKHP

PAGE 113

:DUG 0 5 :HOOHU DQG 0 0 %DWHVRQ 6 U51$ VHTXHQFHV UHYHDO QXPHURXV XQFXOWXUHG PLFURRUJDQLVPV LQ D QDWXUDO FRPPXQLW\ 1DWXUH :DWWLH ( &XOWXUDO FKDUDFWHULVWLFV RI ]RRJOHDIRUPLQJ EDFWHULD LVRODWHG IURP DFWLYDWHG VOXGJH DQG WULFNOLQJ ILOWHU 3XEOLF +HDOWK 5HSRUWV :KLWE\ DQG $ *DUVRQ $ VLQJOH WXEH WZR FRPSDUWPHQW UHYHUVH WUDQVFULSWLRQ SRO\PHUDVH FKDLQ UHDFWLRQ V\VWHP IRU XOWUDVHQVLWLYH GHWHFWLRQ RI KHSDWLWLV & YLUXV 51$ 9LURO 0HWKRGV :KLWE\ ( 3 5 +HDWRQ + ( :KLWE\ ( 2f6XOOLYDQ DQG 3 -RKQVWRQH 5DSLG GHWHFWLRQ RI UDELHV DQG UDELHVUHODWHG YLUXVHV E\ 573&5 DQG HQ]\PHOLQNHG LPPXQRVRUEHQW DVVD\ 9LURO 0HWKRGV :LOOLDPV 7 0 DQG 5 ) 8Q] (QYLURQPHQWDO GLVWULEXWLRQ RI =RRJORHD VWUDLQV :DWHU 5HV :ROIDDUGW 0 5 /DZUHQFH 9 +HDGOH\ 5 5REHUWV DQG ( &DOGZHOO 0LFURELDO (36V SURYLGH D PHFKDQLVP IRU ELRDFFXPXODWLRQ RI FRQWDPLQDQWV 0LFURELRO (FRO :ROIDDUGW 0 5 /DZUHQFH 5 5REDUWV DQG ( &DOGZHOO ,Q VLWX YLVXDOL]DWLRQ RI (36 FKHPLVWU\ DQG VHOHFWLYH ELQGLQJ RI D FKORULQDWHG KHUELFLGH LQ PLFURELDO ELRILOPV $EVWU &606,0 $QQX 0HHW 7RURQWR :RRG 3 0 -RQHV 0 %DQNRR DQG 3 *LOEHUW $ QRYHO VWUDWHJ\ IRU FRQWURO RI PLFURELDO ELRILOPV WKURXJK JHQHUDWLRQ RI ELRFLGH DW WKH ELRILOPVXUIDFH LQWHUIDFH $SSO (QYLURQ 0LFURELRO ;X 3 6 6WHZDUW ) ;LD &7 +XDQJ DQG $ 0F)HWHUV 6SDWLDO SK\VLRORJLFDO KHWHURJHQHLW\ LQ SVHXGRPRQDV DHUXJLQRVD ELRILOP LV GHWHUPLQHG E\ R[\JHQ DYDLODELOLW\ $SSO (QYLURQ 0LFURELRO
PAGE 114

%,2*5$3+,&$/ 6.(7&+ )XKXD /X ZDV ERP RQ -XQH LQ 6KDQ[L SURYLQFH 3 5 &KLQD 6KH UHFHLYHG D %DFKHORU RI 6FLHQFH GHJUHH LQ ELRORJ\ LQ -XO\ IURP :XKDQ 8QLYHUVLW\ 3 5 &KLQD $IWHU JUDGXDWLRQ VKH ZHQW WR WKH ,QVWLWXWH RI $SSOLHG (FRORJ\ $FDGHPLD 6LQLFD DQG UHFHLYHG D 0DVWHU RI 6FLHQFH LQ PLFURELRORJ\ LQ -XO\ ,Q IDOO RI VKH HQUROOHG LQ WKH 3K' SURJUDP LQ WKH 'HSDUWPHQW RI 0LFURELRORJ\ DQG &HOO 6FLHQFH DW WKH 8QLYHUVLW\ RI )ORULGD

PAGE 115

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 6 A )GW$ 6DPXHO 5 )DUUDK &KDLU 3URIHVVRU RI 0LFURELRORJ\ DQG &HOO 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLI\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ .HHOQDWKDP 7 6KDQPXJDP 3URIHVVRU RI 0LFURELRORJ\ DQG &HOO 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLI\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ (GZDUG 3URIHVVRU RI 0LFURELRORJ\ DQG &HOO 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ MPU f M-/6&We $QQ & :LONLH $VVLVWDQW 3URIHVVRU RI 6RLO DQG :DWHU 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ %HQ / .RR@ 3URIHVVRU RI (QYLURL 6FLHQFHV (QJLQHHULQJ

PAGE 116

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI $JULFXOWXUH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU 'HDQ *UDGXDWH 6FKRRO ƒ&0 &ROOHJH RI $JULFXOWXUH

PAGE 117

/2 Q L : /b :



PAGE 1

CHARACTERlZA TION OF ZOOGLOEA RAMIGERA IN BIOFILMS By FuhuaLu A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITYOFFLORIDAINPARTIALFULFILLMENTOFTHEREQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1998

PAGE 2

ACKNOWLEDGMENTS I would like to express my sincere appreciation to chairman of my supervisory committee, Dr S. R Farrah, for his support, guidance and commitment through the course of this research. My gratitude is also due to Dr. K. T. Shanmugaro Dr. B. L. Koopman, Dr E. H Hoffinan and Dr. A C. Wilkie for their guidance and counsel while serving on the advisory committee. Thanks are extended to Dr Chris West and Dr Chasey Rentz for helping me conduct GC/MS analysis, Mr. Scott Whittaker and Ms. Karen Vaughn of the University of Florida ICBR Core Laboratory for their assistant in preparation and examination of SEM samples, and Ms. Sandy Fisher of University of Florida Lake Watch for providing information on lakes. Special thanks to all colleagues in Dr Farrah s lab, Jerzy Lukasik, Haitao Zhou, Mike Burne Jr., Troy Scott and Cheryl Boice, for their friendship and encouragement. I would like to extend my thanks to Engineering Research Center (ERC ) professors and colleagues, for their support and participation during the course of this research. I also would like to thank Scott M. Buntin for his encouragement. Finally I wi s h to express sincere gratitude to my father my mother my brother and my sister, for the ir unconditional love, understanding and patience. 11

PAGE 3

TABLE OF CONTENTS nage ACKNOWLEDGMENTS . . . . . . . . . . . . . . . . . . . . . . ii LISTS OF FIGURES . . . . . . . . . . . . . . . . . . . . . . v LIST OF TABLES . . . . . . . . . . . . . . . . . . . . . . . . vii LIST OF ABBREVIATIONS .. .. .... .. ..... .. .. .. .......... .. ...... viii ABSTRACT . . . . . . . . . . . . . . . . . . . . . . . . . . X INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . 1 Zoogloea ramigera . . . . . . . . . . . . . . . . . . . . . 1 Wastewater Treatment . . . . . . . . . . . . . . . . . . . . 2 Z ramigera Extracellular Polymer . . . . . . . . . . . . . . . . 4 Biofilms . . . . . . . . . . . . . . . . . . . . . . . . . 4 Chlorine Disinfection . . . . . . . . . . . . . . . . . . . . . 5 Filtration Process in Wastewater Treatment . . . . . . . . . . . . . 6 Objectives . . . . . . . . . . . . . . . . . . . . . . . . . 7 LITE.RA TURE REVIEW . . . . . . . . . . . . . . . . . . . . . . 8 Zoogloea ramigera . . . . . . . . . . . . . . . . . . . . . 8 Overview of Wastewater Treatment Process . . . . . . . . . . . . 11 The Function of Z. ramigera in Activated Sludge . . . . . . . . . . 16 The Function of Z. ramigera During Biofilm For1nation . . . . . . . . 18 Biofilm Reactors . . . . . . . . . . . . . . . . . . . . . . 22 Reverse Transcription-Polymerase Chain Reaction(RT-PCR) For Microorganism Detection . . . . . . . . . . . . . . . . 23 MATERIALS AND METHODS . . . . . . . . . . . . . . . . . . 26 Bacterial Strains . . . . . . . . . . . . . . . . . . . . . . 26 Z ramigera Enriched Biofilm Development . . . . . . . . . . . . 26 Column Studies . . . . . . . . . . . . . . . . . . . . . . 27 Ill

PAGE 4

Scanning Electron Microscopy ( SEM ) . . . . . . . . . . . . . 2 7 Effect of Antibiotics on Z ramig e ra Growth . . . . . . . . . . . . 2 8 Isolation of Z ramigera from Natural Environments . . . . . . . . . 2 8 Isolation of Z ramigera Extracellular Polymer . . . . . . . . . . . 30 Polyclonal Antibodies Production . . . . . . . . . . . . . . . . 30 Indirect Immunofluorescence Staining . . . . . . . . . . . . . . 31 Enzyme Immunostaining . . . . . . . . . . . . . . . . . . . 32 Immunoassay by Scanning Electron Microscopy (SEM ) . . . . . . . . 3 3 Dete1n1ination of Most Probable Number (MPN) of Z ramigera in Wastewater Treatment Plants and Lake Water . . . . . . . . . 34 RT-PCR . . . . . . . . . . . . . . . . . . . . . . . . . 35 Glycosyl Composition Analysis by GC/MS . . . . . . . . . . . . 37 Zeta Potential Measurement . . . . . . . . . . . . . . . . . 38 The Effect of Chlorine on Bacteria in Biofilm . . . . . . . . . . . 38 The Effect of Chlorine on Z. ramigera With or Without Extracellular Polymer . . . . . . . . . . . . . . . . . . . 39 Bacteriophage Assay . . . . . . . . . . . . . . . . . . . . 3 9 Preparation of Aluminum Hydroxide Coated Sand . . . . . . . . . . 40 Wastewater Exposure of the Coated Sand . . . . . . . . . . . . . 40 Surface Characterization of the sands . . . . . . . . . . . . . . 41 Batch and Column Removal of Bacteriophages . . . . . . . . . . . 41 RESULTS ...... .. ........ ... .. .. .. . ... ...... ... .. .. . . 44 Morphology of Z. ramigera . . . . . . . . . . . . . . . . . . 44 Isolation of Z. ramigera from Natural Environments . . . . . . . . . 45 Immunological Methods for Detection of Z. ramigera from Natural Environments . . . . . . . . . . . . . . . . . 46 RT-PCR . . . . . . . . . . . . . . . . . . . . . . . . . 5 2 Distribution of Z ramigera in Wastewater Treatment Plants and in Lakes ....... .. .................... . . .... . ... ... 58 Characterization of Z ramig e ra Extracellular Polymer . . . . . . . . 59 The Effect of Chlorine on Bacteria in Biofilm as well as on Z ramigera . . . . . . . . . . . . . . . . . . 66 Effect of Wastewater on Viru s Removal by Aluminum Hydroxide Coated Sands . . . . . . . . . . . . . . 71 DISCUSSION . . . . . . . . . . . . . . . . . . . . . . . . . 8 0 APPENDIX: SEQUEN C E OF ZOOGLOEA RAMIGERA 16S RRNA . .... .. ... 8 7 REFE.RENCES . . . . . . . . . . . . . . . . . . . . . . . . . 88 BIOGRAPHICAL SKET C H . . . . . . . . . . . . . . . . . . . 102 lV

PAGE 5

LISTS OF FIGURES Figure Page I Conventional wastewater treatment process . . . . . . . . . . . . . . 13 2. SEM of Z ramigera 106 (ATCC 19544 ) which was grown in YP medium ( 2.5g/l yeast extract, 2.5g/l peptone) for 48 hours at 28 C . . . . . . . . 4 7 3. SEM of sand exposed to raw sewage supplemented with phenol for 2 weeks . . . . . . . . . . . . . . . . . . . . 48 4. Indirect immunofluorescence staining ofbiofilm that developed over raw sewage supplemented with phenol . . . . . . . . . 53 5. Immunostaining of biofilm that developed over raw sewage supplemented with phenol . . . . . . . . . . . . . . . . . . . 54 6. Secondary (A C) and back scattered (B, D) electron images of SEM photographs of bioftlm that developed over raw sewage supplemented with phenol. Samples were treated with rabbit antiserum for Z. ramigera extracellular polymer followed by treatment with gold labeled goat anti-rabbit serum . . . . . . . . . . . 55 7. Secondary (A, C) and back scattered (B, D) electron images of SEM photographs of biofilm developed over raw sewage supplemented with phenol. Samples were treated with rabbit antiserum for Z ramigera cells followed by treatment with gold-labeled goat anti-rabbit serum . . . . . . . . . . . . . . . . 56 8. Electrophoresis ofRT-PCR by using primers specific for Z ramigera 106 l 6S rRNA . . . . . . . . . . . . . . . . . . 5 7 9. Effect of chlorine on respiratory activities of bacteria in biofilm . . . . . . . . . . . . . . . . . . . . . 6 9 10. Influence of extracellular polymer on Z ramig e ra inactivation by chlorine . . . . . . . . . . . . . . . . . . . . 7 0 V

PAGE 6

11. MS2 removal by batch experiment . . . . . . . . . . . . . . . . . 78 12. PRD 1 removal by batch experiment . . . . . . . . . . . . . . . . 79 VI

PAGE 7

LIST OF TABLES Table Page 1. The effect of antibiotics on Z ramigera growth . . . . . . . . . . . . 49 2. The effect of different media on the isolation of Z. ramigera from natural environments . . . . . . . . . . . . . . . . . . . 5 0 3. The distribution of Z ramigera and total aerobic bacteria in the University of Florida Water Reclamation Facility and in Lake Alice ..... .. .. 61 4. The distribution of Z. ramigera and total aerobic bacteria in the Kanapaha Water Reclamation Facility . . . . . . . . . . . . . . 62 5. The distribution of Z. ramigera and total aerobic bacteria in different lakes . . . . . . . . . . . . . . . . . . . . . . . 63 6. Composition of Z. ramigera extracellular polymer by G C /MS analysis . . . . 64 7. Zeta potential of bacteria at pH 7 . . . . . . . . . . . . . . . . . . 65 8. Effect of chlorine on respiring activity of bacteria in biofilms . . . . . . . . 67 9. Influence of extracellular polymer on Z. ramigera inactivation by chlorine . . . . . . . . . . . . . . . . . . . . . . . . . 68 10. Zeta potential (mv) of the aluminum hydroxide coated sand after exposure to wastewater . . . . . . . . . . . . . . 7 5 11. Protein content (mglg sand) of the aluminum hydroxide coated sand after exposure to wastewater . . . . . . . . . . . . . . 7 6 12. MS2 and PRDI removal by sand columns . . . . . . . . . . . . . . 77 Vll

PAGE 8

AEC AHL BOD BSA CTAB DABCO DEPC DNase EDTA FI l C GC/MS HMDS MIC MINT MPN PFA LIST OF ABBREVIATIONS Aminoethyl carbozole Acetylated homoserine lactones Biological oxygen demand Bovine serum albumin Cetyltrimethylammonium bromide 1 4-diazabicyclo (2,2,2) octane Diethyl pyrocarbonate Deoxyribonuclease Ethylenediaminetetraacetic acid Fl uorescein isothiocyanate Gas chromatography / mass spectrometry Hexamethyldisilizane Minimal inhibitory concentration Malachite green 2(p iodophenyl)-3-(p nitrophenyl)-5-phenyl tetrazolium chloride Most probable number Paraformaldehyde ... Vlll

PAGE 9

PBS RNase rRNA RT PCR SEM TBS TMS Tris UV yp Phosphate buffered saline Ribonuclease Ribosomal RNA Reverse transcriptase-polymerase chain reaction Scanning electron microscopy Tris buffered saline Tetramethylsilane Tris-(hydroxymethyl )-aminomethane Ultraviolet Yeast extract peptone 1X

PAGE 10

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF ZOOGLOEA RAMIGERA IN BIOFILMS By Fuhua Lu December, 1998 Chairman: Dr. Samuel R. Farrah Major Depart111ent: Microbiology and Cell Science Zoogloea ramigera is an extracellular polymer-producing bacterium and fo11ns floes which include typical fmger-like projections and amorphous floes. Scanning electron microscopy (SEM) indicated that cells used the extracellular polymer as attachment sites and were embedded within the extracellular polymer. Finger-like projections which were similar to those from laboratory cultures of Z ramigera were also found on the surface of sand which had raw sewage supplemented with phenol passed through them. Z ramigera was isolated from raw sewage, mixed liquor suspended solids and lake water. The efficiency of Z. ramigera isolation was greatly increased by using m-toluic acid isolation medi11m combined with I g/ml trimethoprim, and/or I 0 g/ml sulfadiazine. Indirect immunoassay methods for the detection of Z. ramigera were developed using polyclonal antibodies against the cells or the isolated extracellular polymer of the X

PAGE 11

neotype Z ramigera strain 106 ( ATCC 19544). The use of goat anti-rabbit IgG conjugated with FITC or biotin or colloidal gold as the secondary antibody allowed detection of Z. ramigera in environmental samples These methods were also used as part of a most probable number (MPN) procedure to quantitate Z ramig e ra at different stages of the wastewater treatment processes as well as in different lakes. It was found that the cells and the extracellular polymer of naturally occurring zoogloeal projections are antigenically and structurally related to those of Z ramigera 106. Z. ramigera could be found in all stages of wastewater treatment processes eutrophic lakes, mesotrophic lakes, and some oligotrophic lakes The highest concentration of Z ramigera was found in the mixed liquor stage of the two wastewater treatment plants in Gainesville, Florida. By using bacterial 16S rRNA as template, and the primers specific for Z ramigera 106 16S rRNA, RT-PCR was also used to identify Z ramigera in biofilms from natural environments. Zeta potential measurement indicated that overall surface charge of Z. ramigera was negative. Gas chromatography-mass spectrometry (GC/MS) analysis indicated the predominance of carbohydrate, especially amino sugars in the extracellular polymer produced by Z ramigera. The use of MINT test following treatment of chlorine indicated that the extracellular polymer protected Z. ramigera cells from chlorine inactivation. This is true for Z ramigera in both biofilms from natural environments and laboratory cultures. Biofilms and other organic and inorganic materials in wastewater blocked positively charged sites on the surface of aluminum hydroxides coated sand This loss of Xl

PAGE 12

electropositive charge character was found to correspond to the decrease in removal efficiency of the two bacteriophages, which further supports the importance of electrostatic forces in virus-sand interaction. XU

PAGE 13

INTRODUCTION Zoogloea ramigera Finger-like zoogloeal projections were observed among decaying algae and the bacteria within the projections were named Zoogloea ramigera by ltzigsohn (1868). Since then, finger-like zoogloeal projections have been observed in trickling filter slime layers, and in association with solids formed during aerobic treatment of wastewater (Bitton, 1994; Butterfield, 1935; Farrah and Unz, 1975; Rossello-mora et al., 1995; Unz and Dondero, 1967a; Unz and Farrah, 1976a). ln some cases, bacteria associated with these samples were isolated and studied in pure culture (Butterfield, 1935; Unz and Dondero, l 967a,b ). Since the term "finger-like" projection was subjected to different interpretations, bacteria with different morphological and chemical characteristics were considered to be Z. ramigera (Butterfield, 1935; Crabtree et al., 1965; Friedman et al., 1968; Unz, 1971; Unz and Dondero, 1967b). Studies by comparing 16S rRNA sequence and chemotaxonomic properties have shown that Z ramigera 106 (ATCC 19544) is related to the bacteria within natural zoogloeal projections but not to the other bacteria that were previously termed Z. ramigera (Rossello-mora et al., 1993; Shin et al., 1993). Recently, one of the previously misclassified Zoogloea species was reclassified as Duganella zoogloeoides (Hiraishi et al., 1997). 1

PAGE 14

2 It has been difficult to isolate Z. ramigera from natural environments. Different isolation procedures have been tried such as dispersion dilution method (Butterfield, 1935) and micro manipulation method (Unz and Dondero, 1967a). Effect of different media on isolation was also investigated (Dugan and Lundgren, 1960). Since Z ramigera grows slowly, often resulting in overgrowth by other microorganisms, conventional bacterial isolation techniques were not very effective for rapid isolation until aromatic compounds such as benzoate, m-toluic acid, phenol and cresol were incorporated into basal media as a carbon source (Unz and Farrah, 1972). Wastewater Treatment Since the proper settling of solids produced during aerobic wastewater treatment is important to produce clear effluents, many researchers have studied the microorganisms that affect this process. This settling requires a proper balance of floc fo1t11ing bacteria and filamentous bacteria (Bitton, 1994; Nozawa et al., 1987). If the numbers or activities of the floc-fo1111ing bacteria are reduced, sludge bulking may occur, and turbid rather than clear effluents will be produced. Because of its observed association with sludge floes, Z. ramigera has been regarded as an important bacterium in the activated sludge treatment process (Bitton,1994). In one study, the ability to settle bulking sludge was restored by seeding the sludge with Z. ramigera and other bacteria (Nozawa et al., 1987) Similarly, in trickling filters, the slime layer that develops on the support media is considered to be very important for the colonization of bacteria (Bitton, 1994 ). This

PAGE 15

slime layer is an extensive polysaccharide matrix that is generally referred to as the glycocalyx. This glycocalyx anchors the bacteria and helps in the removal of complex organic and inorganic materials from wastewater (Bitton, 1994 ). Z ramigera has been isolated from finger-like projections obtained from trickling filter slimes and is thought to be an essential player in the filtration process (Butterfield, 1935; Unz and Dondero, 1967a). Although Z. ramigera has been thought to be important in wastewater treatment, there is little inforrnation on the distribution and concentration of this organism in 3 wastewater treatment processes. Several procedures for the detection of Z. ramigera in natural samples have been established and used to study Z. ramigera in wastewater samples, including using fluorescein-conjugated antibody against Z. ramigera cells and fluorescein-labeled 16S rRNA oliogonucleotide probe (Rossello-mora et al., 1995; Farrah and Unz, 1975). Williams and Unz (1983) used enrichment procedures to support the development of fmger-like Zoogloea. These authors found that bacteria capable of producing finger like Zoogloea were less than 0.01 % of the total microbial population in mixed liquor solids. However, Rossello-Mora et al.(1995) found that up to 10% of the bacteria within activated sludge floes reacted to the fluorescein-labeled oligonucleotide probe complementary to the 16S rRNA of Z. ramigera (ATCC 19544). Unz and Farrah(l976a) showed that finger-like zoogloeae were not usually observed in mixed liquor suspended solids but could develop from the floes under the proper incubation conditions.

PAGE 16

4 Z. ramigera Extracellular Polymer Extensive studies have characterized the Z ramigera extracellular polymer It was indicated that no protein or ether-soluble material was detected and amino sugars are the principal constituent after acid hydrolysis of extracellular polymer (Farrah and Unz, 1976). Separation of hydrolyzed extracellular polymer of Z ramigera isolated from activated sludge by paper and ion-exchange chromatography suggested that amino sugars might be glucosamine and fucosamine and the ratio of the two amino sugars was between 1: 1.5 to 1 :2 (Tezuka, 1973). Amino sugars have also been fot1nd in an extracellular polymer produced by other bacteria. In Streptococcus pneumoniae, the ext! acellular polymer contains a tetrasaccharide repeating unit three different amino sugars, N-acetyl-D-mannosamine, N-acetyl-L-fucosamine and N-acetyl-D-galactosamine, are sequentially linked to a D-galactopyranosyl residue carrying a 2,3-linked pyruvate ketal (Jansson et al., 1981). Biofi}ms Surfaces exposed to a variety of types of water are found to develop biofilms of microorganisms. Biofilm bacteria live in a complex microbial community that has primitive homeostasis a primitive circulatory system and metabolic cooperativity so that each of these sessile cells reacts to special environment fundamentally different from planktonic counterparts (Costerton et al, 1995; Kolter and Losick, 1998). Biofilm microorganisms are u s ually more resistant to environmental stress and antimicrobial agents than plank.tonic counterparts.

PAGE 17

5 Besides the difference between biofilm microorganisms and planktonic microorganisms, the precise manner by which extracellular polymer protects the cells is unclear, but the presence ofbo11nd extracellular enzymes, such as P-lactamase, within the Pseudomonas aeruginosa glycocalyx may reinforce its action as a diffusion barrier (Bo lister et al., 1991) with respect to some antibiotics, and its molecular severing properties are enhanced through binding of divalent cations, such as calcium, from the environment (Hoyle et al., 1992). It has also been proposed that the glycocalyx provides intrinsic protective effects against antimicrobial agents which are additional to those associated with its diffusion and charge-related properties (Hodges and Gordon, 1991 ). For example, Pseudomonas aeruginosa povidone-iodine resistance seems to be due to the protective layering of cells within the glycocalyx which increase the time required for iodine to contact cells in the deepest layers of the biofilm (Brown et al., 1995). The properties of biofilms have been considered in developing methods to control microbial biofilm growth (Wood et al., 1996) Chlorine Disinfection In wastewater treatment processes, chlorine is a commonly used disinfectant to inactivate bacteria and viruses (Bitton, 1994). The mechanisms of chlorine inactivation were extensively investigated ( Bitton and Koopman, 1982; Costerton et al., 1995; De Beer et al., 1994; Dutton et al., 1983; Herson et al., 1987; Huang et al., 1995; LeChevallier et al., 1988a,b; LeChevallier et al., 1984) so that strategies could be developed to effectively control water quality and prevent waterborne disease outbreaks.

PAGE 18

6 Besides, chlorine was also used to control sludge bulking which results from a predominance of filamentous bacteria and absence of floe for111ing bacteria during activated sludge process (Bitton and Koopman, 1982). It was noticed that bacteria attached to surfaces (Brown et al., 1995 ; De Beer et al., 1994) or extracellular polysaccharide-coated bacteria (Bo lister et al, 1991 ) were more resistant to antibacterial agents (including chlorine) than were their planktonic counterparts. It was suggested that the reason for reduced efficacy of chlorine against bioftlm bacteria as compared with its action against planktonic cells might be the limited penetration of chlorine into the biofilm matrix (De Beer et al., 1994; Herson et al., 1987; Huang et al. 1995; LeChevallier et al. l 988a,b; LeChevallier et al., 1984). Filtration Process in Wastewater Treatment Filtration processes are used in both water and wastewater treatment. In wastewater treatment process, trickling filters are used in aerobic treatment of wastewater. These filters consist of inanimate materials such as rocks. Wastewater is passed over these filters to allow biofilm developed on the surface of the filter, thus to reduce the level of organic contaminants in wastewater. This filtration process has been used to remove pathogenic bacteria and virus from water and wastewater. It was indicated that biofilm development on filter media enhanced physical entrapment of bacteria and bacteria-sized fine particles from water (Banks and Bryers, 1992 ; Drucy et al., 1993; Rittmann and Wirtel, 1991; Sprouse and Rittniann, 1990; Schuler et al. 1991 )

PAGE 19

7 Sand filters are also used in water and wastewater treatment. It has been shown that surface modification of filter media with various metal oxides, peroxides or hydroxides also increased the microorganism removal efficiency by changing the surface charge of the media from electronegative to electropositive, thus decreasing the electrostatic repulsion between the particles and the adsorbing solid (Lukasik et al. 1996; Truesdail et al., 1998 ) Obiectives a. The objectives of this study were (I) to study the structure of natural and laboratory fmger-like projections; (2) to improve the Z ramigera isolation method; (3) to develop Z ramigera detection methods by using immunological and molecular procedures; ( 4) to use these procedures to estimate the number of Z ramigera in wastewater at different stages of treatment and in lake water; ( 5) to characterize the extracellular polymer of Z. ramigera and its influence on chlorine inactivation; and (6) to evaluate the effect ofbiofilm and other organic and inorganic materials in wastewater on virus removal by aluminum hydroxide coated sand

PAGE 20

LITERATURE REVIEW Zoogloea ramigera Z ramigera is an extracellular polymer producing bacteriwn that for1ns typical finger-like projections and is fot1nd among decaying algae, in wastewater, and in other organically enriched environments. The bacteria within the fmger-like zoogloeal projections were named Zoogloea ramigera by Itzigsohn (1868). Z ramigera is a gram negative, aerobic, chemoorganotrophic bacteri11mIt also grows anaerobically in the presence of nitrate (nitrate respiration) and denitrification occurs with fo1mation of N 2 Major carbon sources include lactate glutamate alcohol, benzonate and m-toluate. Benzene derivatives are used by meta cleavage (Holt et al., 1994). Neither acid nor gas is produced from carbohydrates (Butterfield, 1935; Heukelekian and Litt1oan, 1939; Unz and Dondero, 1967b ). It might be that the bacterium either does not attack the carbohydrates to produce acid by-products from them, or produces alkaline materials from the proteins which neutralize the acids produced or further metabolizes the acids as rapidly as they are fo1med (Heukelekian and Littrn~ 1939). Optimum temperature and pH for growth are near 28 C and pH 7.0, respectively (Unz and Dondero, 1967b ). The extracellular polymer produced by Z. ramigera attaches to its cell walls and does not make broth viscou s during the synthe s is phase. This property allows high oxygen tran s fer rates to be maintained during the high oxygen demand period. Furthennore very low 8

PAGE 21

oxygen consumption was observed during the period of polysaccharide release when the oxygen transfer rate can not be raised without very high energy input (Norberg and Enfors, 1982) The extracellular polymer production is also influenced by the carbon and nitrogen sources (Unz and Farrah, 1976b). Z. ramigera was originally observed among decaying algae (Itzigsohon, 1868). Later, the recognition of the possible importance of Z. ramigera in activated sludge and trickling filter have led to extensive studies of Z ramigera (Crabtree et al., 1965). The dispersion dilution method (Butterfield, 1935), micro manipulation (Unz and Dondero 1967a) and the use of isolation media containing aromatic compounds (Unz and Farrah, 1972) were used to isolate Z. ramigera from natural environments such as activated sludge and trickling filter slime. The effects of different media on isolation were also investigated (Dugan and Lundgren, 1960). 9 Biochemical tests of Z ramigera allowed convenient identification of Z. ramigera from natural environments (Unz, 1971). It was found that Z. ramigera isolated from activated sludge and trickling filter functions similarly (Wattie, 1942). Fluorescence microscopy (Farrah and Unz, 1975) and scanning electron microscopy (SEM) (Sich and Van Rijo, 1997) were used to observe the presence of Z. ramigera in natural environments. In order to understand the mechanism of Z. ramigera function in activated sludge and trickling filter, structure and composition of extracellular polymer surrounding Z ramigera have also been investigated (Crabtree et al., 1966; Friedman et al 1968; Horan and Eccles, 1986; Norberg and Enfors, 1982; Parsons and Dugan 1971 ; Unz and Farrah, 1976b).

PAGE 22

10 Based on the physiology and biochemical properties of Z ramigera ( Heulelekian and Litt111an, 1939; McKinney and Harwood 1952; Unz and Dondero 1967b ; Krul 1977), efforts were made to establish its identification criterion and generic status (Zvirbulis and Hatt, 1967; Crabtree and McCoy 1967; Munich, 1979 ; Skerman et al., 1980; Rossello-mora et al., 1993; Shin et al., 1993) It was ftrSt requested that ATCC 19623 (strain 1-16-M) should be accepted as the neotype strain in 1967 (Crabtree and McCoy, 1967) In 1971 ATCC 19544 ( strain 106) was suggested as the neotype strain because 1-16-M did not form typical finger-like projection (Unz, 1971) and no extracellular material was observable around I-16-M (Friedman et al., 1968) However based on the observation of floe formation during growth, three phylogenetically distantly related strains, ATCC 19544 T ( strain 106) (T=type strain), ATCC 25935 (strain 115) and ATCC 19623 (strain 1-16-M) were included in the same species Through chemotaxonomic study (mainly polyamine and quinone composition) and comparative analyses of 16S rRNA primary structure, it has been suggested that only isolates that clearly resemble neotype strain ATCC 19544 T phenotypically should be considered genuine members of Z. ramigera (Rossello-mora et al., 1993). In fact, 16S rRNA sequence comparisons and distance matrix tree analysis revealed that Z ramigera I 06 forms a lineage with Rhodocyclus purpureus in the beta subclass of proteobacteria. ATCC 25935 was shown to belong to the beta subclass of the class Proteobacteria with members of the genus T e lluria as its closest relatives. In contrast ATCC 19623 proved to be a member of the alpha subclass of the proteobacteria, closely related to

PAGE 23

1 I Agrobacterium tume f aciens. ( Shin et al. 1993). Recently, ATCC 25935 was reclassified as Dugane//a zoogloeoides (Hiraishi et al 1997 ) The possible biotechnological importance of Z. ramigera is that it plays important roles in wastewater treatment process, especially in flocculation of activated sludge and biofilm fot'mation on the surface of biofilm reactors. Overview of Wastewater Treatment Process The objectives of wastewater treatment processes are reduction of organic content (BOD), nutrients (N P) and removal/reduction of pathogenic microorganisms and parasites. The conventional wastewater treatment process includes (1 ) preliminary treatment to remove debris or coarse materials; (2) primary treatment which is by physical means such as screening and sedimentation; (3) secondary treatment which is by biological means such as activated sludge, trickling filter, or oxidation ponds, and chemical means such as disinfection; and ( 4) tertiary or advanced treatment which is mainly by chemical means, such as flocculation, filtration, and disinfection. Influent from a collection system or pumping station is first treated by preliminary processes (pumping, screening and grit removal) and primary settling to remove heavy solids and floatable materials. Primary solids may go to landfills. Primary effluent is treated by biological means (eg. activated sludge or trickling filter). If trickin g filters are used, the primary effluent is applied to filter beds containing natural material s (rock, coal) or synthetic (plastic) supports that permit biofilm development. Then, s lud ge (solid sloughed off the filters) and liquids are separated in settling tanks In the activat e d

PAGE 24

12 s)udge process, primary effluent is mixed with returned activated sludge (RAS) to for1n the mixed liquor in the aeration tank where aeration is provided by mechanical means. When treatment with activated sludge is complete, the mixture goes to sedimentation tanks to separate solids (sludge) and liquid. A portion of sludge is recycled to provide an inoculum for the influent sewage. The rest of sludge is usually further processed by screening, thickening, dewatering, conditioning, and stabilization (anaerobic digestion, aerobic digestion, composting, lime stabilization and beat treatment) before land application. The secondary eftluent is further treated by chlorination, filtration, flocculation, and so on before agriculture reuse, landscape irrigation, ground water recharge, recreational reuse, nonpotable urban reuse, potable reuse, industrial reuse, or released to receiving waters (Fig. 1 ). BOD, N and P are greatly reduced during biological wastewater treatment processes. They are also reduced by chemical means such as flocculation, composting and lime stabilization. Efficient microorganism removal from wastewater is very important in order to prevent waterborne disease outbreaks and to protect the public's health. During primary and secondary wastewater treatment, most of the protozoans are settled with sludge solid due to their bigger size compared with bacteria and viruses. Many bacteria and viruses associated with sludge solids are also settled with the sludge. Almost 90% of viruses may be removed from water by the activated sludge treatment process (Rao and Melnick, 1986). It was reported that Z ramigera extracellular polyiner avidly adsorbed 125 1-labeled polio virus and either precipitated the virions or neutralized them (Smith, 1983; Rao and Melnick, 1986).

PAGE 25

From collection h I > mec an1ca screen system or pwnp1ng -....-and grit removal station liquid I /' solid landfill returned slud e Mixed liquor phase sedimentation / tank liquid 13 disinfection < filtered effluent < filtration < clarified effluent solid '\!,/ reuse eg. lake limestone sludge to land applicatio, .. ~;___, filtered water aerobic digestion/ anaerobic digestion l digested sludge l belt press and belt ftlter press Fig. 1. Conventional wastewater treatment process

PAGE 26

14 Ciliated protozoans are the predominant protozoans present in activated sludge. They consume many of the absorbed materials in sludge, including viruses and bacteria (Rao and Melnick, 1986; Bitton, 1994 ). These microorganisms in the sludge are reduced by sludge processes such as composting, heat treatment, aerobic / anaerobic digestion, and so on. The microorganisms in the liquid phase of wastewater are removed by flocculation and disinfection treatments such as with chlorine, ozone, chlorine dioxide, and so on The order of removal efficiency by disinfectants usually is bacteria > virus > protozoan. Besides disinfection treatment, filtration has been a useful method for removal of bacteria, virus and other fme particles from wastewater during tertiary wastewater treatment. Rapid sand filtration and biofiltn-mediated slow sand filters have been used for removal of bacteria and viruses in wastewater treatment plants. In order to improve the removal of microorganisms from water and wastewater, the mechanisms of microorganism adsorption to solid particles have been investigated (Mills, et al., 1994; Gerba., 1984). It was indicated that electrostatic interactions are important for filtration of recombinant Norwalk virus particles and bacteriophage MS2 in quartz sand (Redman et al., 1997). Hydrophobic interactions (Bales and Li, 1993), van der Waals forces, and surface properties such as surface roughness and surface charge heterogeneity are also important in microorganisms-solid interaction (Lukasik et al., 1996; Truesdail et al., 1998). Different modifications of filter media have been tried, including the use of metal peroxide (Asghari and Farrah, 1993 ; Farrah and Preston, 1991; Gerba et al 1988 ) metal oxide (Stenkamp and Benjamin, 1995), and metal hydroxide coatings (Farrah and

PAGE 27

15 Preston, 1985; Lukasik et al. 1996; Lukasik et al., 1998). Such modifications have increased the removal of microorganisms from water relative to untreated granular media. The reason is that modifying the sand or diatomaceous earth with various metal oxide, peroxide or hydroxide surface coatings changed the surface charge from electronegative to electropositive, thus decreasing the electrostatic repulsion between the particles and the adsorbing solid. Therefore, these modified filter media are promising materials to be used in removing microorganisms in wastewater filtration processes When the modified filter media are used in wastewater treatment plants, the development ofbiofilms or the presence of organic and inorganic materials in the wastewater have the potential to change the surface properties of the filter media, and thus influence the microorganism removal capacity. It has been suggested that biofilm development on slow sand filters (Schuler et al., 1991 ), glass, polycarbonate and granular activated carbon surfaces (Banks and Bryers., 1992; Drury et al., 1993; Rittmann and Wirtel., 1991; Sprouse and Rittr11ann., 1990) enhanced the physical entrapment of bacteria and bacterium-sized fme particles. However, it was also found that sewage derived organic matter blocked the attachment sites on ferric oxyhydroxide-coated quartz thus decreasing bacteriophage PRO 1 adsorption (Pieper et al., 1997). Overall, biological wastewater treatment processes are important for microorganism removal as well as reduction of organic materials. It has long been believed that Z ramig e ra plays important roles in wastewater treatment processes such as activated sludge flocculation and bioftlm formation on the surface of trickling filters.

PAGE 28

The Function of Z. ramigera in Activated Sludge In the activated sludge process, wastewater is fed continuously into an aerated tank, where the microorganisms metabolize the organic materials Biological floes focm during this process. These floes consist of a variety of microorganisms and are collectively referred to as activated sludge. Following the treatment, a portion of the sludge is discarded ( wasted) and the rest is returned to the aeration tank. The relatively clear supernatant from the final settling tank is the secondary effiuent. 16 The primary feeders in activated sludge are bacteria. Secondary feeders are holozoic protozoans. Microbial growth in the mixed liquor is maintained in the declining or endogenous growth phase to ensure good settling characteristics. Activated sludge is truly an aerobic treatment process since the biological floe is suspended in liquid media containing dissolved oxygen. Dissolved oxygen extracted from the mixed liquor is replenished by air supplied to the aeration tank (Viessman and Hammer, 1985). In activated sludge, extracellular polymer produced by Z. ramigera and other activated-sludge microorganisms plays a role in bacteria flocculation at)d floe formation processes which are essential prerequisites for the efficient and economical operation of an activated-sludge wastewater treatment plant (Bitton, 1994). Floe fortnation during the aeration phase is also instrumental in removing undesirable microorganisms. The proper settling of activated-sludge solid requires a proper balance of floc for1ning bacteria and filamentous bacteria. If the numbers or activities of the floc forrning bacteria are reduced sludge bulking may occur and turbid rather than clear effluents will be produced (Bitton, 1994; Nozawa et al. 1987). Sludge bulking is one of

PAGE 29

17 the major problems affecting biological wastewater treatment. There are several approaches for controlling sludge bulking, including addition of oxidants such as chlorine or hydrogen peroxide, flocculent such as synthetic organic polymers lime and iron salts, and using biological selectors (Bitton 1994). It was indicated that the ability to settle bulking sludge was also restored by seeding sludge with Z. ramigera (No.zawa et al., 1987). Farrah and Unz (1976) studied Z. ramigera extracellular polymer and found that amino sugars are the principal constituent after acid hydroly.zation of extracellular polymer and the amino sugars content in extracellular polymer isolated from activated sludge floes was similar to that of from Z. ramigera. Paper and ion-exchange chromatography separation of hydrolyzed extracellular polymer of Zoogloea isolated from activated sludge suggested that the amino sugars are glucosamine and fucosamine (Tezuka, 1973). The isolated polymer from activated-sludge microorganisms has been found to contain neutral sugars, amino sugars, uronic acids and amino acids, which indicates their heteropolysaccharidic character (Hejlar and Chudoba, 1986). The molecular weight of the extracellular polymer fraction ranged from 3xl0 5 to 2xl0 6 Daltons. Glucose, galactose, mannose, glucuronic acid and galacturonic acid were detected in this fraction (Horan and Eccles, 1986). Therefore, there are negative and positive charges in the extracellular polymer which allow the polysaccharide to behave as polyelectrolyte. It is observed that extracellular polymers produced by microorganisms commonly found in activated sludge display a great affinity for metals. Several types of bacteria ( e.g. Z ramigera Bacillus

PAGE 30

18 lichenifomis), some of which have been isolated from activated sludge, produce extracellular polymers that are able to complex and subsequently accumulate metals, such as iron, cooper, cadmium, nickel or uranium. For example, Dugane/la zoogloeoides (ATCC25935) can acc11mulate up to 0.17 g of Cu per gram of biomass (Norberg and Persson,1984; Norberg and Rydin, 1984). This bacterium, when immobilized in alginate beads, is also able to concentrate cadmium to as high as 250 mg/1 (the alginate beads also absorb some of the cadmi11m) (Kuhn and Pfister, 1990). The heavy metal adsorption of Duganella zoogloeoides (A TCC2593 5) might be related to its production of an acidic extracellular polymer such as succinoglycan which contains glucose, succinate and pyruvate (Ikeda et al., 1982). Correlation between highly anionic charged polymers and metal complexing capacity was found by study of chelating properties of extracellular polysaccharide produced by Chlorella spp. (Kaplan et al., 1987). It is also noticed that the production of extracellular polymer by bacteria may drastically reduce the saturated hydraulic conductivity of sand columns (HCsat ) and this effect was only observed when the extracellular polymer produced in the forrn of loose slime layers. Cell-bound capsular extracellular polymer had no significant effect on the HCsat (V andevivere and Baveye, 1992). The Function of Z ramigera During Biofilm For1nation Bio film formation is thought to result from the concerted action of primary attachment to a specific surface and accumulation in multilayered cell clusters. Biofilms are defmed as matrix-enclosed bacterial populations adherent to each other and/or to

PAGE 31

19 surfaces or interfaces. This defmition includes microbial aggregates and floccule and also adherent populations within the pore spaces of porous media (Costerton et al., 1995). Biofilm is ubiquitous. It exists in natural environments (Gillan et al., 1998; McLean et al., 1997), and in clinical settings (Stickler et al., 1998). The structural and physiological heterogeneity ofbiofihn is now widely recognized (Huang et al., 1995; Huang et al., 1998; Stewart et al., 1997; Xu et al., 1998). In addition to traditional methods (cultivation and/or microscopy), genetic methods are also available to characterize microbial diversity. Amplification and sequence analysis of the 16S rRNA (rDNA) has been successfully used for understanding the biology of microbial community (Britschgi and Givonnoni, 1991; DeLong et al., 1993; Gillan et al., 1998; Liesack and Stackebrandt, 1992; Ward et al., 1990). In one study, the genetic diversity and phylogenetic afftliation ofbiofilm bacteria which covered the shell of bivalve Montecutaferruginosa were deterrnined by denaturing gradient gel electrophoresis (DGGE) analysis of 16S ribosomal DNA PCR products obtained with primers specific for the domain Bacteria (Gillan et al., 1998). Fluorescein in situ hybridization (FISH) by using fluorescein labeled oligonucleotide probes are also frequently used to detect and characterize bacteria in microbial community (Muyzer and Ramsing, 1995). During biofilm forrr1ation, initial attachment requires flagella or surface adhensins and nutritional signal from environments (Costerton et al., 1995). Attached bacteria excrete extracellular polymer as a matrix for biofilms (Costerton et al., 1987; Allison and Sutherland, 1987). Mature biofilms form mushroomand pillar-like

PAGE 32

20 structures with water channel between them, which function much like primitive circulatory system (Costerton et al., 1995) It has been noticed that bacterial cells in biofilm are usually more resistant to environmental stress and antibacterial agents than planktonic cells (Allison and Sutherland, 1987; Marshall et al., 1989; Ophir and Gutnick, 1994; Brown et al., 1995). It is said that bacterial adhesion might trigger the expression of a sigma factor which regulates a large amount of genes so that biofilm cells are phenotypically distinct from planktonic cells of the same species (Costerton et al. 1995 ; Yu and Mcfeters, 1994). Recent study indicated that the pattern of gene expression within biofilm is largely controlled by the metabolic activity of the microorganisms and the local availability of carbon and energy sources (Huang et al., 1998; Xu et al., 1998 ) It has been noticed that bioftlm forn1ation involves cell-to-cell signals (Passador et al., 1993; Kolter and Losick, 1998; Davies et al., 1998). Acylated homoserine lactones (A.HLs) are chemical signals that mediate population density-dependent (quorum sensing) gene expression in nwnerous Gram-negative bacteria (Stickler et al., 1998). Structures of signals in Pseudomonas aeruginosa are N-3-( oxooctanoyl)-L-homoserine lactones and N-(butyryl)-L-homoserine lactones. These signals were required for the expression of the virulence factors toxin A and elastase (Passador et al., 1993). AHLs accumulated in bacterial cultures as membrane-pe11neant signal molecules At a threshold population density, the accwnulated AHLs interact with cellular receptors controlling the expression of a set of specific target genes which respond to local cell density (Fuqua et al. 1996; Salmond et al., 1995; Stickler et al., 1998). Therefore, AHLs are important in the development of the biofilm-specific physiology (Heyes et al., 1997)

PAGE 33

21 For example, a Pseudomonas aeruginosa mutant strain unable to make AHLs did not produce a typical bioftlm and was sensitive to the biocide sodium dodecyl sulfate (Davies et al. 1998 ) It was indicated that AHLs are not only produced in natural biofilms growing on submerged stones taken from the San Marcos river in Texas (McLean et al., 1997 ) but also produced by bioftlm in clinical setting such as indwelling urethral catheter (Stickler et al., 1998). Analogues of AHLs capable of interfering with signaling have the potential to be used to prevent the formation and development ofbiofilm on implanted medical devices. It was indicated the furanone derivatives produced by the seaweed Delisa pulchra inhibit swarming of Serratia liquejaciens which is AHLs-regulated. It was speculated that furanone derivatives mimic AHLs signaling process by blocking transcriptional activation of target genes ( de Nys et al., 1995; Erb le et al., 1996; Givskov et al., 1996 ) Therefore, it is vecy likely to be able to control biofilm formation and dissolution in situ by using AHLs and its analogues. Extracellular polymer production by biofilm bacteria not only helps the initial attachment of bacteria to surfaces but also helps the formation and maintenance of micro colonies and biofilm structure enhances biofilm resistance to environmental stress and antimicrobial agents protects bacteria in the biofilm from protozoan grazing and provides biofilm nutrition (Allison and Sutherland, 1987; Heissenberger et al, 1996; Marshall et al.,1989; Ophir and Gutnick 1994 ) The extracellular polymer in biofilm i s also highly heterogenous and has been demonstrated in s itu to vary spatially, chemicall y and physically (Lawrence et al. 1994 ; Wolfaardt et al. 1993 ; Wolfaardt et al. 1994 ) In

PAGE 34

22 addition, the chemically reactive extracellular polymer is generally the frrst biofilm structure to come in contact with potential s ubstrates, predators, antimicrobial agents / antibiotics and other bacteria, and thus is of considerable applied and ecological importance. For example, bacterial cells would be attached to the organic nutrients that concentrate naturally at surfaces in aquatic systems, and the extracellular polymer that mediate their adhesion to surfaces would further concentrate dissolved organic molecules and cations out of bulk fluid. Biofilm Reactors In wastewater treatment plants, biofilm reactors include trickling filters rotating biological contractors (RBC) and submerged filters (down-flow and up-flow filters ). These reactors are used for oxidation of organic matter, nitrification, denitrification or anaerobic digestion of wastewater. During biofilm formation on trickling filter surfaces the surface of the support materials is colonized with Gram-negative bacteria followed by filamentous bacteria. There are two steps in the absorption of bacteria to biofilm surfaces. The frrst step is reversible sorption, mainly controlled by electrostatic interactions between absorbent and the cells. The second step consists of irreversible absorption of cells, resulting from the formation of polysaccharide-containing matrix named glycocalyx. Glycocalyx not only helps anchor the bioftlm microorganisms to th e surface, but also helps protect microorganisms from predation and from chemical in s ult There are also polyanionic compounds in glycocalyx that complex the metal ion s (Bitt o n 1994).

PAGE 35

23 Z. ramigera was found in biofilm during denitrification by fluidished bed reactors (Sich and Rijn, 1997). It degraded phenols and nitrogen-containing aromatic compounds (Koch et al. 1991) and co-existed with Pseudomonas during these processes. Initial colonization on granules was mainly Zoog/oea species. During the period of co existence, Zoogloea cells provided a setting substrate for Pseudomonas and the gelatinous matrix provided by Zoogloea might have served as nutrient trap for Pseudomonas which eventually covered the entire outer layers of the granules (Sich and Rijn, 1997). Reverse Transcription-Polymerase Chain Reaction (RT-PCR) for Microorganism Detection In addition to traditional microbiological and immunological methods for microorganism detection, molecular procedures have been increasingly popular and more frequently used to detect virus, bacteria and protozoan in clinical and environmental samples. Comparing with immunological methods (eg. immunohistology, ELIS~ etc) and tissue culture, RT-PCR has been extensively used as a sensitive, specific and time saving method to detect genes of RNA viruses (Hayase and Tobita, 1998), including dengue virus (Chow et al., 1998; Hober et al., 1998; Liu et al., 1997), hepatitis A virus (Cromeans et al., 1997), hepatitis C virus (Jeannel, et al., 1998; Laursen et al., 1998; Whitby and Garson, 1997), citrus psorosis virus (Barthe et al., 1998), reovirus (Tyler et al., 1998), enterovirus (Chung et al., 1996; Gantzer, et al., 1997), respiratory virus

PAGE 36

(Rohwdder et al., 1998; Valassina et al., 1997), measles virus ( Chadwick et al. 1998; Kawashima et al., 1996), mumps virus ( Kashiwagi et al., 1997; Cusi et al., 1996 ) HIV (Beilke et al., 1998; Contoreggi et al., 1997), and so on 24 Several varieties of RT-PCR was developed for virus detection. For example, multiplex RT-PCR was used to rapidly detect and identify different serotype of viruses such as human parainfluenza viruses 1, 2 and 3 (Echevarria et al., 1998), or different species such as influenza A virus (IA) and respiratory syncytial virus (RS) (V alassina et al., 1997). Nested or semi-nested RT-PCR can be used for rapid type-specific(Chow et al., 1998) or genus-specific detection (Hafliger et al., 1997; Pfeffer et al., 1997). In situ RT-PCR was used to localize the virus in the specimens (Walker et al., 1998; Qureshi et al., 1997). RT-PCR-ELISA (Whitby et al., 1997) was also developed and much more sensitive than southern blot hybridization. RT-PCR coupled with microplate colorimetric assay (Legeay et al., 1997) can be used to quantitate PCR products. RT-PCR targeting of bacterial ribosomal RNA has been frequently used to detect bacteria. This method has several advantages. One of them is that bacterial rRNA has conserved and variable regions. This makes it convenient to find general as well as specific target sites for PCR primers. Second, various databases of rRNA sequences such as Ribosomal Database Project and Gene Bank are available so that phylogenetic analysis (Rossello-mora et al., 1995; Gillan et al., 1998) and primer design can be performed. Third, each bacterial cell contains 1,000 to 10,000 copies of rRNA, detection of rRNA should impart increased sensitivity over assays based on the detection of a

PAGE 37

25 single copy or even multiple copies of genomic sequences. For example, RT-PCR assay targeting the l 6S rRNA of Mycobacterium leprae (Kurabachew et al., 1998) or Treponema pal/idum (Centurion et al., 1997) was used to detect low numbers of viable organisms in samples. RT-PCR targeting bacterial mRNA has also been used to detect viable bacteria because bacterial mRNA has an extremely short half life, averaging only a few minuets. Previously, the presence of viable Mycobacterium tuberculosis (Jou et al., 1997) and Listeria monocytogenes (Klein and Juneja, 1997) were detected by using RT-PCR targeting bacterial mRNA. Efforts have been made to detect protozoans from environments. Procedures used include flow cytometcy (Vesey et al., 1993), laser scanning {Anguish and Ghiorse, 1997) and immunomagnetic separation (Campbell and Smith, 1997). The sensitivity of protozoan detection was greatly increased by concentrating cyst and oocysts with filters, selectively capturing mRNA with oligo (d1) 25 magnetic beads and then perfo11ning RT PCR. It was indicated that low numbers of viable Giardia cysts and Cryptosporidium parvum oocysts were detected in water samples and the method was more sensitive than using immunofluorescence assay (Kaucner and Stinear, 1998).

PAGE 38

MATERIALS AND METHODS Bacterial Strains The following bacteria were used in this study: Salmonella typhimurium (ATCC 19585), Escherichia coli (ATCC 15597), Klebsiella pneumoniae (ATCC 13883), Proteus vulgaris (ATCC 13315), Staphylococcus aureus (ATCC 12600), Pseudomonas aeroginosa (ATCC 10145), Duganella zoog/oeoides (ATCC 25935), 'Z ramigera' I-16M (ATCC 19623), and Z ramigera 106 (ATCC 19544). Z ramigera 106 (ATCC 19544), 'Z ramigera' 1-16-M (ATCC 19623), and Duganel/a zoogloeoides (ATCC 25935) were grown in YP medium (2.5 g/1 yeast extract, 2.5 g/1 peptone) for 36-48 hours at 28C All other bacteria were grown in Tryptic Soy Broth (Difeo Laboratories, Detroit, MI) for 24 hours at 37C Z. ramigera Enriched Biofilm Development Phenol (Acros Organics, Pittsburgh, PA) was added to 100 ml samples from wastewater treatment plants or surface water contained in 250-ml beakers daily to provide an initial concentration of 50 g/ml. The samples were incubated at ambient temperature ( approximately 25C) for up to one week. During incubation, the samples were periodically examined for the development of a biofilm that contained fmger-like projections characteristic of Z. ramigera 26

PAGE 39

27 Column Studies Raw sewage was obtained from University of Florida Water Reclamation Facility (Gainesville, FL) The raw sewage was filtered through cheese cloth (Fisher Scientific Springfield, NJ) to remove large particles from the water before passing through the column. Ottawa sand (Fisher Scientific, Springfield, NJ) was packed into an acrylic column (I .5cm ID x 0.5 m). The raw sewage with 50 g/ml phenols was passed through the column in inflow mode. The treatment lasted for two weeks. The sand was then taken out from the column washed with deionized water for 3 times and ready for observation under a scanning electron microscope Scanning Electron Microscopy (SEM) Mid-log phase of Z. ramigera 106 (ATCC 19544) culture was centrifuged and washed twice with deionized water. The sample was dehydrated by soaking for five minutes serially in increasing ethanol solutions (25%, 50%, 75o/o, 95% and twice in 100% ethanol). It was then fixed by hexamethyldisilizane (HMDS). The culture was then mounted on a nucleopore filter (Fisher Scientific, Pittsburgh, PA) and sputter-coated with gold particles for 5 minutes. The sample was viewed on the Hitachi S-4000 Field Emission SEM. Natural biofilms that developed on sand filter media after the passage of phenol fortified (50 g/ ml) wastewater were also processed and observed on a SEM as described above.

PAGE 40

28 Effect of Antibiotics on Z. ramigera Growth All antibiotics were purchased from Sigma Chemicals (St. Louis, MO). Stock solutions for trimethoprirn (0.5 mg/ml) were made by dissolving 0.05 g of trimethoprim in 5 ml benzyl alcohol and 5 ml deionized water. The solutions were passed through a 0.45m filter (Fisher Scientific, Pittsburgh, PA). Stock solutions for penicillin (7.5 mg/ml), tetracycline (25 mg/ml), streptomycin (125 mg/ml), sulfadiazine (5 mg/ml), and cephalosporin (100 mg/ml) were made in deionized water and ftlter sterilized. Tests were carried out by adding different concentrations of antibiotics into YP liquid medium. Z ramigera (A TCC 19544) was inoculated and incubated at 28 C for 4-5 days. Growth was deter111ined by comparing growth in tubes without antibiotics to growth in tubes with antibiotics. Isolation of Z. ramigera from Natural Environments In order to make m-toluic acid isolation media, the following solutions were used. (A). Potassium phosphate solution (0.06M, lOOx) was made by adding 1.0 g ofK 2 HP0 4 to 100 ml deionized water. The solution was adjusted pH to 7.2 and autoclaved for 15 min; (B). M-toluic acid (50 mg/ml) stock solution (l,OOOx) was made by mixing 5 g of m-toluic acid, 1ml solution A, and 5 ml of IN NaOH. The mixture was heated until the m-toluic acid was completely dissolved. The pH was adjusted to 7. The solution was passed through a 0.2 m pore size filter; (C). Salt solution (I OOx) was made by adding 2 g ofMgS0 4 3.75 g of (NH 4 ) 2 S0 4 and 0.02 g ofCaCl 2 to 100 ml deionized water;

PAGE 41

29 (D).Yeast autolysate solution (IOOX) was made by adding 0.1 g of yeast autolysate into 100 ml deionized water. To make the isolation medium, 1 ml solution C, 1 ml solution D, 97 ml deionized waters and I gram of agar were mixed. After autoclaving and cooling to 55 C, 1 ml of solution A, 0 1 ml solution B and appropriate amount of sulfadjazine and/or trimethoprim were added. Raw sewage was obtained from University of Florida Water Reclamation Facility (Gainesville, FL). Lake water was obtained from Lake Alice (Gainesville, FL). Z ramigera enriched biofilm developed over raw sewage was conducted by adding 50 g/ml phenol into raw sewage and incubated at room temperature for 4-5 days. Z. ramigera enriched biofilm developed over lake water was conducted by adding 50g/ml phenol into lake water and incubated at room temperature for 7-10 days. The microorganisms from the biofilms were streaked on the m-toluic acid isolation medium combined with 1 g/ml trimethoprim and/or I Og/ml sulfacliazine. Hard colones on the agars resembling Z. ramigera (Unz and Farrah, 1972) were selected and re-streaked on the same medi11m 2-3 times for purification. Mixed liquor suspensions were obtained from University of Florida Water Reclamation Facility (Gainesville, FL). Mixed liquor suspensions were centrifuged at 5,000 rpm for 5 min. The pellet and an equal volume of the supernatant were blended for 1-2 min to release the microorganisms from the floe. The blended activated sludge was streaked on the m-toluic acid isolation media combined with l g/ml trimethoprim

PAGE 42

and/or 10 g/ml sulfadiazine. The isolated bacterial colonies were purified by re streaking the same medium 2-3 times. 30 Tests for nitrate reduction, oxidase, catalase, Gram stain, urea hydrolysis, glucose utilization, indole production (Cappuccino and Sherman, 1992), and meta cleavage of benzene derivatives (Unz and Farrah, 1972) were conducted to identify the isolated strains. Isolation of Z. ramigera Extracellular Polymer Z. ramigera 106 was inoculated in YP medium and incubated at 28C until log phase. The cultures were centrifuged and washed twice with deionized water, then suspended in equal volume of0.4 M K 2 HP0 4 (final concentration is 0 2 M) and blended (Tekmar, Cincinati, Ohio) for 1 min. The mixture was centrifuged for 10 min at 27,000 x g and the pellet was discarded. Cetyltrimethylammonium bromide (CTAB) was added to the supernatant to a fmal concentration 0.8% (wt/vol). The solution was centrifuged after 4h at room temperature. The precipitate was mixed with 10 volumes of 0.5 M NaCl and the mixture was centrifuged. The supernatant fraction was dialyzed against deionized water at 4C for 24 hours. The dialyzed sample was dried and washed with 80% ethanol to remove the residual CTAB (Farrah and Unz, 1976). Polyclonal Antibodies Production For production of the antibody against cell walls, log-phase Z. ramigera 106 cultures were washed twice and suspended in deionized water. The suspension was

PAGE 43

31 adjusted to pH 10 by using IN NaOH and boiled for 3 min, then cooled. The pH was readjusted to 10 and the suspension was boiled for another 3 min. Finally, cells were centrifuged at 10,000 rpm for 10 min and washed twice with deionized water. Microscopic examination with India Ink revealed that cells were devoid of the extracellular polymer. Formalin (2%) was used to fix the cells. A fraction of the cells was hydrolyzed in IN NaOH and a protein assay was performed (Protein Assay Kit, Sigma Chemicals, St. Louis MO). Cell suspensions were adjusted to 200 mg/ml protein concentrations in PBS buffer and were mixed with an equal voltime ofFreunds complete adjuvant (Sigma Chemicals, St. Louis, MO). One ml of the suspension was then injected subcutaneously into a rabbit. After 2 weeks, a 1 ml inocu1tim of the cells in Freunds incomplete adjuvant was intravenously injected and this was repeated two weeks thereafter. Ten days after the final injection, the rabbits were bled and the antiserum was collected. For the production of antibody against Z ramigera extracellular polymer, the extracellular polymer was isolated from the cells as previously described (Farrah and Unz, 1975). The same procedure was followed for antiserum productiqn using the rabbits. Unimm11nized rabbit serum (Sigma Chemicals, St. Louis, MO) was used as negative control in all immunological procedures. Indirect Immunofluorescence Staining Samples were spread on microscopic slides, air dried and fixed with 50% 80% and 96% ethanol sequentially for 3 minutes each time. The rabbit antiserum was diluted

PAGE 44

32 with PBS buffer and added to the slides and incubated for 30 minutes at room temperature in a hydrated chamber. The slides were washed with PBS buffer several times. Then FITC-labeled goat anti-rabbit IgG (Sigma) diluted in PBS was added and incubated for 30 minutes. The slides were then washed twice with PBS buffer A drop of 10 mg/ml DABCO (1,4-diazabicyclo (2,2,2) octane) (Sigma Chemicals, St. Louis, MO) was added to enhance fluorescence and a cover slip was placed on the slide. The slides were examined by phase-contract and epifluorescence microscopy (Farrah and Unz, 1975). Enzyme Immunostaining All chemicals and reagents used were obtained from Sigma Chemicals (St. Louis, MO). Samples were spread on microscopic slides, air dried and fixed with 50%, 80% and 96% ethanol sequentially for 3 minutes each time. The rabbit antiserum was added and allowed to react for 30 minutes. The slides were washed with PBS buffer. Then biotin conjugated anti-rabbit IgG (l/500dilution with PBS buffer) was added and allowed to react for 30 minutes. The slides were washed with PBS buffer and peroxidase-labeled avidin was added (0.64 units of peroxidase /ml) and reacted for 30 minutes. After the slides were washed with PBS buffer, 0.5 ml of the substrate, aroinoethyl carbozole (AEC) solution (3 volumes of 4.0 mg/ml AEC dissolved in N, N-dimethylforn1amide plus 7 volumes of 0.05M acetate buffer [pH 5.0]) was added. Then, l % H 2 0 2 was added to the slides to activate the substrate (Cleveland and Richman, 1987). After 10 min, the slides were washed with PBS buffer and checked under a light microscope.

PAGE 45

33 Immunoassay by Scanning Electron Microscopy (SEM) The scum layers of biofilm were put into microcentrifuge tubes and were washed 3 times by Tris-buffered saline (TBS) (pH 7.4) thoroughly and fixed by 4 % paraformaldehyde (PFA) solution for 30 min on ice or IO min at room temperature. Samples were washed once by TBS (pH 7.4) and incubated with 1% gelatin in TBS for 10 minutes. Three 5 minutes incubations with 0.02 M glycine in TBS were used to preblock. Then samples were washed by 5 minutes incubation with TBS ( with 1 % BSA ) Goat serum (1: 10) was added to block for 10-20 minutes and was washed with TBS once. A rabbit antiserum (1 :500) was added and reacted for 1 hour at room temperature Samples were washed for 5 minutes three times with TBS ( with 1 % BSA, pH 7.4 ) followed by two 5 minutes washes with TBS (with 1 % BSA, pH 8.2). Gold labeled goat anti-rabbit IgG (1:100) was added and incubated for 1 hour at room temperature. Samples were washed three times for 5 minutes with TBS ( pH 7.4) followed by fixation with Trump's solution (4% formaldehyde, 1% glutaraldehyde in phosphate-buffered saline, pH 7.4) for 30 minutes. Samples were washed three times for 5 minutes with TBS (pH 7.4) followed by four 5 minutes ultra pure water washes. Silver enhancement was performed for 5 minutes and was followed by three 5 minutes water washes Samples were then mounted on nucleopore titer (Fisher Scientific, Pittsburgh, PA). Dehydration and fixation were perfo11ned using gradient alcohol dehydration: 25%, 50% 75%, 95% for 5 min each, 100% for 5 min twice followed by 5 minutes hexamethyldisilizane (HMDS ) washes twice. Samples were dried, carbon coated for 10 seconds, and observed under a Hitachi S-400 Field Emission SEM.

PAGE 46

34 Detennination of Most Probable Number (MPN) of Z ramigera in Wastewater Treatment Plants and Lake Water Autoclaved bottles were prepared prior to sample collection. Raw sewage, mixed liquor suspension, unchlorinated effluent and chlorinated effluent were obtained from the University of Florida Water Reclamation Facility (Gainesville, FL). Ten mg/1 sodium thiosulfate was added immediately to collected chlorinated effluent. Mixed liquor suspension, primary aerobic digested sludge and final aerobic digested sludge were obtained from the Kanapaha Water Treatment Plant (Gainesville, FL). Lake water was obtained from Lake Sheelar, Lake Geneva, Lake Johnson (Clay county, FL), Lake Alto, Santa Fe Lake, Lake Alice, and Lake Bivans Arm (Alachua county, FL). In the University of Florida Water Reclamation Facility, raw sewage is mixed with returned sludge in the mixed liquor tank. After the activated sludge process, sludge solids are settled and separated from the supernatant. The mixed liquor supernatant is then treated by rapid sand filtration. The effluent from the rapid sand filter is unchlorinated effluent. The unchlorinated effluent is then chlorinated in the chlorination basin. Part of the chlorinated effluent goes to Lake Alice. In the Kanapaha Wastewater Treatment Plant, after the activated sludge process (mixed liquor stage), the sludge goes through primary and secondary aerobic digestion. A three-tube MPN procedure (American Public Health Association, 1989) was used to determine the concentration of Z ramigera and total bacteria in wastewater samples. For determining the MPN for total bacteria, samples were serially diluted in YP medi11m and incubated for up to 2 weeks at 28C. For determining the MPN for Z

PAGE 47

35 ramigera, samples were serially diluted in a filter sterilized raw sewage. The samples were then supplemented with 50g/ml phenol daily and incubated at 28 C up to 2 weeks. The scum layer that developed was examined microscopically for the presence of typical fmger-like projection and/or cells that reacted with Z. ramigera antisera as described above. Chlorophyll concentrations (g/1) in lakes were detertnined by pigment extraction with ethanol (Sartory and Grobbelaar, 1984), followed by spectrophotometrical measurement (method 10200H(2c), American Public Health Association, 1989). Total phosphorus concentration (g/1) in lakes were dete11nined by a persulfate digestion (Menzel and Corwin, 1965), followed by the procedures of Murphy and Riley (1962). Total nitrogen concentrations (g/1) were deter1nined using the procedure described by Bachmann and Canfield Jr. (1996). RT-PCR RNase free water was obtained by treating the water with 0.1 % DEPC (diethyl pyrocarbonate) (Sigma Chemicals, St Louis, MO). Deionized water with 0.1 % DEPC was shaken vigorously to bring the DEPC into solution. The solution was then incubated for 12 hours at 37C and autoclaved for 15 minutes to remove any trace ofDEPC. All solutions were made by using RNase free water. Isoporpanol, Mops (3-morpholino) propanesulfonic acid), P-mercaptoethanol, 10 x Tris-EDT A buffer and lysozyme were purchased from Sigma Chemicals (St. Louis, MO). RNase AW A Y (Fisher Scientific

PAGE 48

36 sprinfield, NJ) was used to keep working areas and pipets RNase free. RNase free pipet tips and PCR tubes were obtained by autoclaving overnight. The sequence of Z ramigera (ATCC 19544)16S rRNA was retrieved from Gene Bank (ZR16SRRNA). The upstream and downstream primers were specific for Z ramigera 106 16S rRNA and purchased from Genosys (The Woodlands, Texas). Sequence for the upstream primer is CCG ATG TCG GAT TAG CT A GTT GG (position 219 to 242). Sequence for the downstream primer is AA T GAG TCT CCT CAC CGA ACA ACT AG (position 813 to 836). The lyophilized primers were suspended in DNase and RNase free water and incubated at 37C for complete dissolution. Bacterial l 6S rRNA were isolated by using QIAGEN RNA/DNA mini kit (Valencia, CA). Briefly, Sx 10 8 bacterial cells were centrifuged and resuspended in 50 I of lysozr11e-containing TE buff er for 5 min. Then the lysing buffer was added to the solution as described in the kit. The 16S rRNA was isolated exactly by using the 'low molecular weight RNA isolation' procedure in the kit. QIAGEN tip is anion-exchange column which can be used to selectively isolate DNA, RNA and low molecular weight rRNA. RT-PCR kit was purchased from Promega (Pittesburgh, PA). RT-PCR was perfo11ned in a total volume of 50 l reaction mixture containing 0.2 mM deoxynucleoside triphosphate, 0.5 mM MgS0,1, 5 U of AMV reverse transcriptase, 5 U of Tjl DNA polymerase, 0.5 M of the primers which are specific for Z. ramigera 106 16S rRNA, 1 g of template and lX reaction buffer. The cycling profile involved 48C reverse transcription for 45 minutes, 94 C AMV reverse trasriptase inactivation and

PAGE 49

37 RNA/cDNA/primer denaturation, 40 cycles of denaturation at 94C for 30 seconds, annealing at 60C for 1 minute and extension at 68 C for 2 minutes, followed by I cycle of fmal extension at 68 C for 7 minutes. Aliquotes (6) of the PCR products were electrophoresed through 2% agrose gel (Sigma Chemicals, St. Louis, MO). Gel star (FMC Bioproducts Rockland, ME) was used to locate the DNA bands. Glycosyl Composition Analysis by GC/MS Z ramigera extracellular polymer was isolated as described on page 30. After 80% ethanol treatment, deionized water was used to wash ethanol from the extracellular polymer. The extracellular polymer then dispersed into deionized water and homogenized by blending for I min. GC-MS analysis ofTMS methyl glycosides was used to deterrr1ine the glycosyl composition of Z. ramigera extracellular polymer. The TMS methyl glycosides were prepared by methanolysis in methanolic 1 M HCl at 70C for 16 hours, re-N-acetylated and trimethysilylated (Chaplin, 1986). A Shimadzu QP5000 GC-MS work station was used for GC-MS analysis by staffs at the University of Florida Glycobiology Core Lab. During the experiment, external standards which consisted of known molar concentration of inositol and each monosaccharide in the hydrolysate were used. Calculations of each monosaccharide were based on response factors which was the ratio of peak area for each monosaccharide to a molar of the monosaccharide relative to that for inositol.

PAGE 50

38 Zeta Potential Measurement Z ramigera 106 (ATCC 19544), Z. ramigera 1-16 M (ATCC 19623), Dugan e lla zoogloeoides (ATCC 25935) were inoculated in YP medi11m and incubated at 28C until log phase. The cultures were centrifuged, rinsed twice with deionized water. The bacteria were resuspended in distilled water (pH 7.0) to a final concentration of 1.0 x I 0 7 CFU / ml. Distilled water was chosen to minimize any change shielding within the invalidation of the assumed equality between the measured zeta potential and the surface potential. The zeta potential measurements were carried out with the use of a Brookhaven Instruments Zetaplus Model V3.21 zeta potential analizer (Holtsviller, NY) (Turesdail et al., 1998). The Effect of Chlorine on Bacteria in Biofilm Phenol was added to 100 ml raw sewage in 250-ml beakers daily to provide an initial concentration of 50 g/ml and incubated at room temperature for 4-5 days. When there were many finger-like projection in the biofilm, different concentrations of chlorine (Clorox Bleach) were added to the beakers for 15 min. Then a HACH test kit (Loveland, Colorado) was used to evaluate free chlorine and total chlorine. The reaction was stopped by adding sodium thiosulfate to a fmal concentration of0.2%. INT (0.2 %) (Sigma Chemicals, St Louis, MO) was added to the beaker to a fmal concentration of 0.02% and incubated at room temperature in the dark for 30 minutes. Formaldehyde (37%) was added to a fmal concentration of 0.37% to stop the reaction. The scum layers of biofilms were mounted on clean slides. The slides were air dried and gently fixed by

PAGE 51

39 heat. Next, 0.05 % malachite green was added to the slide and reacted for 1 min. Deionized water was used to wash the slides. The slides were then observed under bright field microscope (Bitton and Koopman, 1982; Dutton et al., 1983). The Effect of Chlorine on Z. ramigera With or Without Extracellular Polymer Z. ramigera 106 was inoculated in YP medium or low Mg ++ Ca ++ salt minimal medium (5.0 g glycerol, 0.3 g (NH 4 ) 2 S0 4 0.8 g sodium lactate, 1.0 g KN0 3 0.05 g K 2 HP0 4 0.1 g CaCl 2 0.1 g MgS0 4 ) and incubated at 28C until log phase. The cultures were centrifuged at 2,000 rpm for 5 min. The pellet which contained mostly floes was discarded. The supernatant was further centrifuged at I 0,000 rpm for IO min. The pellet which contained both free cells and cells in floes was resuspended in deionized water. Different concentrations of chlorine were added into the suspension for 15 min. The deter111ination of chlorine concentration and the MINT test were performed as described above. Bacteriophage Assay PRD 1 is an icosahedral lipid phage characterized by a diameter of 62nm The isoelectric point of PRDI is between 3 to 4 in a calcium-phosphate buffer (10 4 M Ca) (Pieper et al., 1997). It grows on its host Salmonella typhimurium (ATCC 19585). MS2 is an icosahedral phages with an average diameter of '""' 25nm and has isoelectric point of 3.9 (Lin et al., 1997). It grows on its host Escherichia coli C3000 (ATCC 15597). Both viruses were assayed as plaqueforrning unit method (Snustad and Dean, 1971).

PAGE 52

40 Preparation of Alumint1m Hydroxide Coated Sand AU. S. Standard No. 25 sieve was used to collect sand particles of 600700 m in diameter from 25 x 30 meshes Ottawa sands (Fisher Scientific, Springfield, NJ ) The graded sand was rinsed with deionized water until the supernatant was clear. The sand was then air dried. The sand was placed in 1 0M of A1Cl 3 .6H 2 0 ( Fisher Scientific, Springfield NJ) solution for 30 minutes The excess solution was drained off. Then the sand was air-dried for 24 hours The dried sand was then socked in 3 OM ammonium hydroxide for 10 minutes to precipitate aluminum hydroxides on the sand. The sand was air dried and then rinsed with deionized water vigorously to remove loose precipitate then air dried again. Wastewater Exposure of the Coated Sands Uncoated sand and a portion of coated sand without exposure to wastewater were used as negative and positive controls respectively. The coated sand was packed into acrylic columns (3.2 cm I. D. x 1.5 m). Wastewater effluent from University of Florida Water Reclamation Facility was used in this study. The typical compositions of wastewater effluent were: 1.0 m g/ I total Kjeldahl nitrogen~ 1.2 mg/I orthophosphate 1.8 mg/I total phosphate 0.7 NTU turbidity, 795 mhos / cm conductivity 8mg/I Mg2 +, 73 mg/1 Ca 2 +, 1.2 mg/I N0 3 -N, 0.2 mg/I NH 3 -N 44 mg/1 CaC0 3 (alkalinity), pH 7.2. The experiments were carried out at room temperature. Dechlorination of wastewater effluent was done with sodium thiosulfate. Chlorinated wastewater effluent was obtained by treating water with 10 m g/ I ammonia nitrogen followed by titration with sodium

PAGE 53

41 hypochlorite (Clorox Professional Products, Oakland, CA) so that final combined chlorine was 2 mg/I chlorine The upflow rate was 57 ml/min and thus the superficial velocity was l .2mm/s. The columns were back washed every 72 hours at a superficial velocity of 17mm/s for 15 minutes to fluidize the sand. Before each sampling, the sand was taken out from the columns and rinsed with filter-sterilized wastewater to remove loosely attached biomass. Portions of the sand were used for a protein assay zeta potential measurements, and virus removal assay by batch and column experiments. The rest of the sand was returned to the columns and the wastewater passing was continued. Surface Characterization of the Sands Protein assays were conducted by the modified Lowry method ( Bensadoun and Weinstein, 1976; Peterson, 1977) and the procedure which was described in the Sigma Protein Assay Kit (Sigma Chemical). Briefly, 20 g of the sand samples were immersed in 8.0 ml of 10.0 N NaOH to extract the protein. The supernatant was assayed according to the instruction in the protein assay kit. The zeta potentials of the sands were measured with a streaming potential apparatus as described previously (Chen et al., 1998; Truesdail et al., 1998). Batch and Column Removal ofBacteriophages Bacteriophage removals by batch tests were deter111ined as follows; MS2 and PRDl were diluted in a filter-sterilized (0.2m) milli-molar ionic strength artificial

PAGE 54

42 groundwater (AGW) ( IL deionized water, 35 mg MgS0 4 .7H 2 0, 12 mg CaS0 4 .2H 2 0, 12 mg NaHC0 3 6 mg NaCl and 2 mg KN0 3 ) (McCaulou et al., 1994) to produce a fmal concentration of I 0 5 PFU / ml for each bacteriophage. Uncoated sand, aluminum hydroxide coated sand without wastewater exposure, aluminum hydroxide coated sand exposed to dechlorinated wastewater, and aluminum hydroxide coated sand exposed to chlorinated wastewater were used for testing. Briefly, four grams of sand were added to 10 ml of bacteriophage suspension in polypropylene tubes (Fisher Scientific, Springfield, NJ) and the mixtures were shaken for 30 min using a 70 cm diameter wheel which was rotated vertically at 30 rev / min at room temperature. The bacteriophage suspension without sand was also shaken in the wheel along with other samples as a control. All sands were tested in triplicate. Parallel column tests on days 0, 90 and 110 were carried out as follows: Four acrylic sand columns (1.5 cm I.D. x 1.0 m) were used in upflow mode. The four sand columns were uncoated sands, al\1min\1m hydroxide coated sands without exposure to wastewater effluent, aluminum hydroxide coated sands exposed to chlorinated wastewater, and aluminum hydroxide coated sand exposed to dechlorinated effluent. A suspension containing I 0 5 PFU / ml of each bacteriophage in AGW was passed through the column at a rate of20 ml/min. Effluents representing steady state conditions (71-75 pore volumes) were collected (Chen et al., 1998). Bacteriophage concentrations in intlluent and effluent were analyzed by the plaque assay procedure.

PAGE 55

All plaque assays for both batch and column experiments were conducted in triplicates. Virus removal capacities of the sands were indicated in terms of percent removal ofMS2 or PRDl. Student's t test, with ap value of0.05 was used to defme statistical significance. 43

PAGE 56

RESULTS Morphology of Z ramigera Z. ramigera is a floc-for1ning bacteria and produces an extracellular polymer Previously, negative staining by India Ink indicated that cells are inside the extracellular polymer in both fmger-like projections and amorphous floes (Farrah, 1974). In this study, scanning electron microscopy was used to reveal the detail structure of Z. ramigera finger-like projections and amorphous floes. A section of a branching zoogloeal projection is shown in Fig. 2B. The cells are organized in the finger. A higher magnification view of a zoogloeal projection reveals the presence of fibrils running along and between the cells (Fig. 2A). This fibril is likely the extracellular polymer produced by Z. ramigera. The presence of cells within the zoogloeal extracellular polymer is clearly shown in Fig. 2D. In the case of amorphous floes, cells usually embed inside an excessive extracellular polymer (Fig. 2C). Previous studies have shown that Z ramigera can utilize several aromatic compounds and these can be used to enrich samples for fmger-like zoogloeae (Unz and Farrah, 1972; Williams and Unz ; 1983). Examination of sand particles from a column that had received raw sewage supplemented with 50 g/ml of phenol revealed natural fmger-like projection structures that resembled those observed in laboratory cultures of Z ramigera 106 (Fig. 3). The structures are smaller in diameter than those observed in 44

PAGE 57

45 laboratory cultures (Fig. 2B) but show cells in similar arrangements and with similar fibrils There were little fmger-like projections observed in biofilm developed on the surface of sands which had been passed through wastewater without a phenol supplement (Chen et al, 1998). Therefore, the supplement with phenol is effective for production o f Z ramigera enriched biofilm. Isolation of Z ramigera from Natural Environments Z. ramigera is sensitive to penicillin, tetracycline, streptomycin and cephalosporin. Trimethoprim-sulfamethoxazole ( TMP-SMZ) are used for prevention of opportunistic infection in human immunodeficiency-virus-infected person (Kaplan et al. 1996) and for prevention of relapses in patient with Wegener' s granulomatosis in remission after respiratory tract infection (Stegeman et al., 1996 ) The minimal inhibition concentrations (MIC ) of trimethoprim and sulfadiazine for Z. ramigera are higher than 1 g/rnl and greater then IO g/ml, respectively (Table I). Since a m toluic acid isolation medium was used for isolation of Z ramigera from natural environments (Unz and Farrah, 1972), m-toluic acid isolation medium and m-toluic acid isolation medium combined with trimethoprim and sulfadiazine was used to isolate Z ramigera from activated sludge biofilm developed over raw sewage, and bioftlm developed from Lake Alice water respectively Clones resembled Z ramigera were picked up and further purified and identified Isolates which were Gram negative, urease positive catalase positive, oxidase po s itive, nitrate reduction, meta cleavage of catechol indole negative

PAGE 58

46 and no production of gas or acid from glucose were further identified by indirect immunoassay methods. The isolation efficiency obtained was increased from 64% to over 90% by using the combination media (Table 2). The combination media were especially effective when Z ramigera was not abundant in natural environments, such as in Lake Alice water. No synergistic effect was observed between trimethoprim and sulfadiazine Immunological Methods for Detection of Z. ramigera from Natural Environments Initial tests using a FITC-labeled secondary antibody showed that the antibody against Z. ramigera I 06 cells or the matrix only reacted with Z. ramigera I 06 but not with other laboratory cultures of the bacteria listed in the Materials and Methods section, including 'Z. ramigera' 1-16-M or Duganella zoogleoides. Also, during the course of this investigation, Z. ramigera 106 antisera were observed to react with the cells and the extracellular polymer associated with natural fmger-like projections but not with other bacteria from natural samples. A portion of a scum layer that developed over raw sewage enriched with 50 g/ml of phenol and treated with the primary antibody against the extracellt1lar polymer from Z. ramigera 106 followed by FITC-Iabeled secondary antibody is shown in Fig. 4. A finger-like zoogloeal projection observed using light microscopy and phase contrast optics is shown in Fig. 4A. The same field observed with UV illumination is shown in Fig. 4B. Only fmger-like projections characteristic of Z ramigera were observed to fluoresce under UV light.

PAGE 59

A B I ,. .. ? . 0 0 I I I I I I 0 01:3135 6.0 kV X2 50K 7.20,m ,_ C t O O t I O I O I I 0 013088 6.0 kV X2.00K 9.00>m Fig. 2. SEM of Z. ramigera 106 (ATCC 19544) which was grown in YP medium (2.5 g/1 yeast extract, 2.5g/I peptone) for 48 hours at 28C.

PAGE 60

Fig 3. SEM of sand exposed to raw sewage supplemented with phenol for 2 weeks 48

PAGE 61

Table I. The effect of antibiotics on Z. ramigera growth Antibiotics (J&gLmJ) trimethoprim 1 5 10 20 50 Z. rami,era growth + --------------------------------------------------------------------------sulfadjazine 1 5 10 20 50 + + + Note: Z ramigera 106 (ATCC 19544) was inoculated in YP medium (2.5 g/1 yeast extract, 2.5 g/l peptone) supplemented with different concentrations of trimethoprim or sulfadiazine and incubated at 28C. 49

PAGE 62

Table 2. The effect of different media on the isolation of Z ramigera from natural environments 50 Media No. of No. of colonies No. of Z. Yield m-toluate m-toluate + 1 g/ml trimethoprim m-toluate + 10 g/ml sulfadiazine m-toluate + 1 g/ml trimethoprim + 10 g/ml sulfadiazine Total (m-toluate+ antibiotics) samples proces!ed 9 9 9 9 27 purified from samples 14 12 11 13 36 (O/o) ram,gera iso!at5d 9 64 12 100 10 91 12 92 34 94 Note: Bacteria from activated sludge, biofilms developed over raw sewage and lake waters supplemented with phenol were streaked on m-toluic acid isolation medium as well as the isolation medium combined with 1 g/ml trimethoprim and/or 10 g/ml sulfadiazine. Biochemical tests were conducted to identify the isolates.

PAGE 63

51 When the scum layers were examined in a similar manner but using primary antibody against Z ramigera cells followed by FITC-labeled secondary antibody cells within typical zoogloeal projections fluorescenced while other cells did not The results were similar to previously published results (Farrah and Unz 1975). Observation of the scum layers from samples of raw sewage enriched with phenol and treated with the primary antibody against the cells or extracellular polymer from Z. ramig e ra are shown in Fig 5 These samples were then treated with biotin labeled secondary antibody, avidin-peroxidase and substrate AEC and examined using light microscopy. Cells within zoogloeal projections (Fig. 5A) or extracellular polymer surrounding zoogloeal projections (Fig. 5B) were stained dark red by this procedure and are shown as the darker cells and projections in Fig 5 SEM images of the scum layers treated with the primary antibody against the Z ramigera extracellular polymer and gold-labeled secondary antibody are shown in Fig. 6 The label is surrounding the zoogloeal projection in the samples which were examined by using secondary electrons (Fig. 6A Fig 6C), and back scattered electrons (Fig. 6B Fig. 6D) which are produced by the gold particles attached to the secondary antibody In Fig. 6A and Fig. 6B it appears that more antibodies had reacted with the end of zoogloeal projection than with the main body of the projection The results obtained using similar procedures but with the primary antibody against Z ramigera l 06 cells are shown in Fig 7 The associations of gold particles with

PAGE 64

52 Z ramigera cells but not with other bacterial cells are shown using images created with secondary (Fig. 7 A, Fig. 7C) and back scattered electrons (Fig. 7B, Fig. 7D). No reactions were observed with any of the immunological procedures when unimmunized rabbit serum was used. RT-PCR RT-PCR was also used to detect the presence of Z. ramigera in samples by using the primers specific for Z ramigera I 06 16S rRNA. The region between upstream primer and downstream included the fragment complimentary to the 16S rRNA oligonucleotide probe which was used for Z ramigera detection previously (Rossello more et al., 1995). When 16S rRNA isolated from Z. ramigera 106 (ATCC 19544) was used as a template for RT-PCR reaction, there was 619 bases DNA fragment produced (Fig. 8, lane A). There was no corresponding PCR product when 16S rRNA isolated from Duganel/a zoogloeoides or 'Z ramigera' I-16-M was used in the RT-PCR reaction (Fig. 8, Lane B, Lane C). However, there was the RT-PCR product (619 bases) when 16S rRNA isolated from one of Z ramigera isolates which was isolated from raw sewage by m-toluic acid isolation medium combined with trimethoprim and sulfadiazine (Fig 8, Lane D), or from bioftlm developed over raw sewage supplemented with phenol (Fig. 8, Lane E). Therefore, the RT-PCR procedure is sensitive for Z. ramigera detection.

PAGE 65

A B Fig. 4. Indirect immunofluorescence staining of biofilm that developed over raw sewage supplemented with phenol. Samples were treated with rabit antiserum against Z. ramigera extracellular polymer with FITC-labeled goat anti-rabbit lgG. A. phase contrast microscopy B. epifluorescein microscopy 53

PAGE 66

54 A "\ I I. I ,. I .. I .. -.. r . ,.. .) I / .. I ... B Fig 5. Immunostaining of bioftlm that developed over raw sewage supplemented with phenol. Samples were treated with rabbit antiserum for Z ramigera cells (A) or extracellular polymer (B) followed by treatment with biotin-labeled goat anti-rabbit lgG, peroxidase labeled avidin and substrate AEC.

PAGE 67

A B ,~ '' .. ""f"Y .. ,,. .. . .... ii ,.,.,. .... .. .., L. ,, ;.}. . T.. :. .. .... .: #,,. .. .... .. .,. .; ~: .. / .. .. ... ,.~ .. ' .. . ~ '\ "" .. . I Fig 7. Secondary (A,C) and back scattered (B, D) electron images of SEM photographs of biofilm developed over raw sewage supplemented with phenol Samples were treated with rabbit antiserum for Z ramig e ra cells followed by treatment with gold-labeled goat anti-rabbit serum C D

PAGE 68

A B . ,. ;; .: ,: ., .. .... I .. I I . ;,. .. I . ii' I &.&;,,,. .. : . .. > e,,A D .. ~ .J ... : ~.. .... ~. , ... \. 'LI .... " .. Fig 6. Secondary (A,C) and back scattered (B, D) electron images of SEM photographs of biofilm developed over raw sewage supplemented with phenol Samples were treated with rabbit antiserum for Z ramigera extracellular polymer followed by treatment with gold-labeled goat anti-rabbit serum.

PAGE 69

Fig. 8. Electrophoresis ofRT-PCR by using primers specific for Z. ramig e ra 106 16S rRNA. A. 16S rRNA from Z. ramigera 106 (A TCC 19544) B. 16S rRNA from 'Z ramigera' I-16-M (ATCC19623) C. 16S rRNA fromDuganel/a zoog/oeoides (ATCC25935) D. 16S rRNA from Z. ramigera isolated from raw sewage E. 16S rRNA from biofilm developed in raw sewage supplemented with 50 g/ml phenol 57

PAGE 70

58 Distribution of Z. ramigera in Wastewater Treatment Plants and in Lakes Enrichment procedures showed that the finger-like zoogloeal projections which were characteristic of Z ramigera and reacted with Z ramigera 106 antisera were observed in scum layers that developed over samples from all stages of two sewage treatment plants (Tables 3 and 4). The highest percentage of Z ramigera was found associated with samples from the aeration tanks (mixed liquor suspended solids or the supernatant fraction). In the University of Florida Water Reclamation Facility, the MPN of Z ramigera increased from raw sewage to the mixed liquor suspension, then rapidly decreased from mixed liquor suspension to unchlorinated effluent {Table 3). It was likely that Z ramigera was settled with activated-sludge solids due to its floe-forming characteristic During chlorination, total bacteria rapidly decreased (from 1.1.6 x 10 5 / ml to 2 4.6 x 10 1 / ml), while there is little change for the number of Z. ramigera between unchlorinated and chlorinated effluent. Thus, the percentage of Z ramigera increased after chlorination (Table 3). Therefore, Z ramigera was more resistant to chlorine than other bacteria in the water Compared with the chlorinated effluent, the percentage of Z ramigera in Lake Alice was decreased while the total bacteria increased {Table 3) This suggested that there were some nutrients available for bacteria prolification in Lake Alice. In the Kanapaha Water Reclamation Facility, the percentage of Z ramigera decreased from mixed liquor suspension to primary and fmal aerobic digested sludge in

PAGE 71

59 both liquid phase and solid phase (Table 4). Overall, Z. ramigera could be found in all stages of wastewater treatment processes. The highest concentration of Z. ramigera was found in the mixed liquor stage in both wastewater treatment plants {Table 3, Table 4 ) According to the content of chlorophyll, a lake is classified as oligotrophic, mesotrophic and eutrophic lake. Distribution of Z ramigera in different types of lakes was also investigated (Table 5). Z ramigera was found in all eutrophic (Lake Alice, Lake Bivans Arm), and mesotrophic (Lake Alto, Lake Santa Fe) lakes tested. However Z. ramigera was present in some of oligotrophic lakes (Lake Geneva, Lake Johnson) but absent in Lake Sheelar which is also an oligotrophic lake. Low content of nutrients such as total nitrogen and total phosphorous might be the reason for absence of Z. ramigera in Lake Sheelar. Characterization of Z ramigera Extracellular Polymer GC/MS analysis of an acid hydrolyzed Z. ramigera extracellular polymer identified the following components: 1.5% arabinose, 1.38% rhamnose, 0.43% xylose 4.65% mannose, 0.36% galactose, 1.6% galacturonic acid, 2.7% glucose and 37.7% galactosam.ine, and another unknown amino sugar (Table 6). This unknown amino sugar is not glucosamine or mannosamine. Due to lack of other standard amino sugars, we could not identify this amino sugar. Total identified sugar in the extracellular polymer was 50%.

PAGE 72

60 Previous work also found two types of aminosugars ( glucosamine and possible fucosamine) in Z ramigera extracellular polymer. The ratio between glucosamine and fucosamine was 1:1.5 to 1:2 (Farrah, 1974; Tezuka, 1973 ) According to this ratio fucosamine might be almost 50% since 37.7% galactosam ine was found in this study In addition, it was reported that no protein or ether-soluble materials were detected after acid hydrolysis of extracellular polymer (Farrah and Unz, 1976). Therefore, almost I 00% of the Z ramigera extracellular polymer is carbohydrate. It was claimed previously that there was glucosamine in Z ramigera extracellular polymer by paper chromatography. ~ucosammc values for galactosamine and glucosamine are similar since galactosamine is a C4 epimer of glucosamine. Therefore it was hard to differentiate these two sugars by paper chromatography. However GC/MS analysis indicated the presence of glactosamine instead of glucosamine in the extracellular polymer. The presence of the extracellular polymer also influences overall swface charge of the cells. Zeta potential has been used to evaluate overall surface charge of the cells (Truesdail, et al., 1998). Most bacteria are negatively charged due to the predominance of the anionic groups present on the cell surfaces ( carboxyl, phosphate groups ) At pH 7, overall surface charges of Z rami ge ra 106 as well as 'Z. ramigera' I-16-M Duganella z oogloeoid e s, E coli, S typhimuriium S. aureus S. faecal is were negative (between-17 mv to -40 mv) (Table 7) Therefore, it was suggested that amino groups of aminosugar s in Z ramig e ra extracellular polymer might be acetylated.

PAGE 73

Table 3. The distribution of Z ramigera and total aerobic bacteria in the University of Florida Water Reclamation Facility and in Lake Alice 61 Sources Percent Zoogloea Raw sewage Mixed liquor supernatant Mixed liquor solids Unchlorinated effluent Chlorinated effluent Lake Alice 7.1.0 X 10 5 / mL 1.3.2 X 10 9 / g 1.1.6 X 10 5 / mL 2.4.6 x 10 1 / mL 6 0 .8 X 10 3 / mL 1.1.3 X 10 4 / mL 0.20 4.2.4 X 10 4 / mL 5.9 2.0.6 X I 0 7 / g 1.5 8.4.9 X 103 / mL 7.6 X 10 --6 8.0.7 X 103 / mL 3.3 X 102 3.6 0.0 X 101 / mL 6.0x10 3 Note: Dilutions of the samples supplemented with 50 g/ml of phenol were incubated at room temperature for up to 2 weeks. The scum layer that developed was examined for the presence of bacteria within typical finger-like zoogloeae. The samples were al s o examined using the immunological procedures described in the text to confirm the presence of Z. ramigera.

PAGE 74

Table 4. The distribution of Z ramigera and total aerobic bacteria in the Kanapaha Water Reclamation Facility Sources Mixed liquor supernatant First stage aerobic digested sludge supernatant Second stage aerobic digested sludge supernatant Mixed liquor solids First stage aerobic digested sludge solids Second stage aerobic digested sludge solids Total Aerobic 9.7.9 X 10 5 / mL 3.0.2 X 10 7 / m.L 3.0.2 X I 0 7 / mL 1.2.5 X 10 8 / g 2.2.0x 10 8 / g 2.3 4 X 10 8 / g Zoogloea ramigera (MPN) 5.0.3 X 10 3 / mL 2.5 4 X 10 4 / mL 1.2.9 X I 0 4 / m.L 2.0.4 X 10 5 / g 1.8 0.4 X 10 5 / g 1.4.2 X 10 5 / g Percent Zoogloea 0.52 0.08 0.04 0.17 0.08 0 06 Note: Dilutions of the samples supplemented with 50 mg/L of phenol were incubated at room temperature for up to 2 weeks The scum layer that developed was examined for the presence of bacteria within typical fmger-like zoogloeae. The samples were also examined using the immunological procedures described in the text to conf rrm the presence of Z ramigera. 62

PAGE 75

Classification Oligotrophic Table 5. The distribution of Z. ramigera and total aerobic bacterial in different lakes Lake Sheelar Geneva Johnson 1.5 1.2 3.0 2.5 7.7 13.0 80.0 206.7 230.0 1.2 X 10 3 5.5x10 2 4 8 X 10 3 < 0.0013 0.09 0.5 PercentZ. < 1.1 X 10 4 0.017 0.009 ---------------------------------------------------------------------------------------------------------------------------Mesotrophic Alto Santa Fe 9.3 14.3 11.7 14.3 430.0 500.0 2.2 X 10 3 1.9 X I 0 4 0.2 3.6 0.011 0.019 ---------------------------------------------------------------------------------------------------------------------------Eutrophic Alice Bivans Ann 15.8 49.7 327 118.3 633.3 1240.0 6.0 X 10 3 2.5 X 10 4 0.4 2.4 0.006 0 010 Note: Dilutions of the samples supplemented with 50 g/ml of phenol were incubated at room temperature for up to 2 weeks. The scum layer that developed was examined for the presence of bacteria within typical fmger-like zoogloeae. The samples were also examined using the immunological procedures described in the text to confirtn the presence of Z ram1gera. a. Total chlorophyll b. Total phosphorus c. Total nitrogen

PAGE 76

Table 6. Composition of Z. ramigera extracellular polymer by GC/MS analysis Mougsaccha rjdes Arabinose Rbamnose Xylose Mannose Galactose Galacturonic acid Glucose Galactosamine Unknown sugar type Ia Total known sugar (mg/total mg) 1.5 1.38 0.43 4.65 0.36 1.6 2.7 37.73 ? 50.35 Note: Acid hydrolyzed extracellular polymer of Z. ramigera was re-N-acetylated and trimethysilylated before GC/MS analysis. 64 a. Unknown Sugar type I is an amino sugar but not glucosamine or mannosamine

PAGE 77

Table 7. Zeta potential of bacteria at pH 7 Z ramigera l 06 (A TCC 19544) 'Z. ramigera' 1-16-M {ATCC 19623) Duganella zoogloeoides (ATCC 25935) E. colz-a S typhimurium 8 S aureus 8 S. faecalis 8 Zeta potential (mv) -24.7 1.93 -41.0 0.78 -30.1 l.86 -36.5 2.00 -17.0 1.00 -36.0 1.00 -38.5 1.50 Note: The zeta potential of stationary phase bacteria was determined using a Lazer Zee zeta meter. a. Data from Truesdail et al., 1998 65

PAGE 78

66 The Effect of Chlorine on Bacteria in Bio film as well as on Z. ramigera In the MINT test, INT acts as a hydrogen-acceptor. Respiring bacteria will accumulate water insoluble red INT-forn1azan crystals through the action of bacterial electron transport system activity. Counter staining with malachite green results in viable bacteria with red color and inactive bacteria with green color. Since the Z. ramigera finger-like projection structure is easily distinguished from other bacteria, the bacteria within fmger-like projection structures in biofilms were considered to be Z. ramig e ra. The measured values for total chlorine and free chlorine were similar since sodit1m hypochlorite was used in this study. When a low chlorine concentration (1 .0 mg/I) was used, about 80% of the bacteria within fmger-like projections were still alive but only 30% of the other bacteria in the bioftlm were respiring. At a chlorine concentration of 2.5 mg/1, 65% of the bacteria within fmger-like projections were still respiring while most of the other bacteria were inactive. Higher concentration of chlorine (3 .5 mg/1) killed all bacteria (Tab le 8, Fig 9). Therefore, bacteria within fmger like projections can resist higher concentration of chlorine better than other biofilm bacteria. In order to investigate the influence of the extracellular polymer on Z. ramigera inactivation by chlorine, the survival of Z. ramigera cells with and without the extracellular polymer were compared during chlorine treatment (Table 9, Fig 10). About 65% of Z. ramigera cells with the extracellular polymer were still alive after exposure to 2.5 mg/I chlorine treatments while less than 5% of Z. ramigera cells without the extracellular polymer were still alive. Therefore, the Z. ramigera extracellular polymer seemed to protect the cells from chlorine inactivation.

PAGE 79

Table 8. Effect of chlorine on the respiring activity of bacteria in biofilms Chlorine concentration /o survival of Z. ramigera 0 99 1 1.0 80 5 2.5 65 8 3.5 < 5 0 /o survival of other 99 I 30 2 < 5 0 Note: The biofilm that developed over raw sewage supplemented with phenol was treated with indicated concentrations of chlorine for 15 min. The residual chlorine was neutralized with sodium thiosulfate and the MINT test was then perforn1ed to detect respiring bacteria. 6 7

PAGE 80

68 Table 9. Influence of extracellular polymer on Z. ramigera inactivation by chlorine Chlorine concentration ,m1t1> 0 /o survival of cells with e1tracellular pob'mer 0 /o survival of cells without e1tra5ellular pob'rner 0 2 5 3 0 99 I 65 < 5 9 9 1 < 5 0 Note: Z. ramigera cells with and without visible extracellular polymer were treated with the indicated concentrations of chlorine for 15 min The residual chlorine was neutralized with sodium thiosulfate and the MINT test was then performed to detect respiring bacteria.

PAGE 81

A B ,,,. Fig. 9. Effect of chlorine on respiratory activities of bacteria in biofilm A. 0 mg/I chlorine B. 1.0 mg/I chlorine C. 2.5 mg/I chlorine D. 3.5 mg/1 chlorine C D

PAGE 82

A II B Fig. 10. Influence of the extracellular polymer on Z. ramigera inactivation by chlorine. A. 2.5 mg/1 chlorine B. 3.0 mg/I chlorine 70

PAGE 83

Effect of Wastewater on Virus Removal by Aluminum Hydroxide Coated Sands Characterization of Aluminum Hydroxide Coated Sand Exposed to Either Chlorinated or Dechlorinated Wastewater 71 Coating by in situ precipitation of metallic hydroxides on particles increased the concentration of metals associated with sand particles, their zeta potential and their capacity for removal of microorganisms from water. After coating the Ottawa sands with aluminum hydroxides, the zeta potential of the sand increased from -99mv to +20mv at pH 7 (Table IO). Coating increased the aluminum content of the sand from approximately 0.05 mg/g to 0.4 mg/g (Chen et al., 1998). The coated sands removed 99% of the MS2 and 90% of the PRDI from water in batch tests (Fig.I I and Fig. 12). The corresponding values for MS2 or PRD I removal by untreated sand are within 20%. The zeta potential of aluminum hydroxide coated sands dropped after I day exposure to either chlorinated or dechlorinated wastewater (Table I 0). At the initial two weeks exposure, the zeta potential of the coated sand exposed to chlorinated wastewater decreased in similar degree as that of the sand exposed to dechlorinated wastewater (from +20mv to 60-80mv). However, after 2 months treatment, the zeta potential of the coated sand exposed to chlorinated wastewater remained around -75mv while the zeta potential of the coated exposed to dechlorin ated wastewater was about -40mv (Table 10). The amount of aluminum on the surface of the sand dropped from 0.4 mg/g to 0.3 mg/ g after two weeks of wastewater exposure, then remained approximately constant throughout the experiment (Chen et al., 1998). It was still about 6 fold higher than that

PAGE 84

of the uncoated sand (0.005 mg/g). This drop might be due to attrition and/or leaching effects. In addition since the zeta potential of the sand with 0.4 mg/g aluminum coats was +20mv zeta potential of the sand with 0.3 mg/g aluminum coats was much less likely about 70mv without other influences. Therefore, the decrease of zeta potential after exposure of the coated sand to wastewater was not likely due to the loss of aluminum content. Protein assay (Table 11) and SEM (not shown) indicated that biofilm developed on the surface of coated sand which was exposed to dechlorinated wastewater. However, there was no significant biofilm development when chlorinated wastewater was used. Therefore, the effect of biofilm on virus removal by aluminum hydroxide coated sand could be deter1nined by comparing the perfor1nance of the sand exposed to dechlorinated wastewater effluent with that exposed to chlorinated wastewater effluent. Since wastewater effluent used in this study was obtained only after activated sludge and rapid sand filtration processes, there were many organic or inorganic materials in the water. These materials are mostly negatively charged at pH 7 (Sobsey et al., 1984). Evidently, these materials interacted with the aluminum hydroxide coated sand during exposure to chlorinated or dechlorinated wastewater and caused the overall surface charge of the sands decrease ( Table 10). It was suggested that organic and inorganic materials in the water 'blocked' the positively charged sites on the sand so that the zeta potential of the sands were drastically decreased (-70 mv) at the earlier stages of the treatment. The amount of biofilm bacteria on the surface of the s and exposed to dechlorinated wastewater was sufficient to maintain the z eta potential of the 72

PAGE 85

sand around -40 mv after 2 months treatment {Table IO and 11) because the zeta potential of most bacteria are about -20 mv to 40 mv at pH 7 (Truesdail et al., 1998 ) In summary, the surface properties of alumint1m hydroxide coated sand considerably changed after exposure to dechlorinated or chlorinated wastewater effluent. Batch Removal of MS2 and PRD 1 73 The aluminum coated sand without wastewater exposure removed about 99.99% MS2 and 90% PRD 1. After 1 day exposure to either chlorinated or dechlorinated wastewater, the coated sand were still able to remove about 99.9% MS2 and 65% PRDI (Fig.I 1, Fig. 12). The ability of the coated sand for removal ofMS2 and PRDI declined by approximately two thirds after two weeks exposure. After 3 months of treatment, MS2 and PRO 1 removal by the sand were not statistically different from that by uncoated sand (p > 0.05). The perforinance of the coated sand exposed to dechlorinated wastewater and the sand exposed to chlorinated wastewater were simi l ar for both MS2 and PRD 1 removal. The isoelectric points for MS2 and PRDI are both between 3 to 4. They were negatively charged in artificial ground water. However, PRD I is more hydrophobic than MS2 due to the presence of lipid in its protein coat (Kinoshita et al., 1993). The magnitude difference between MS2 (about 99.99%) and PRDl (about 90%) removed by the coated sand might due to the fact that MS2 is less hydrophobic that PRD I

PAGE 86

74 Column removal of MS2 and PRD 1 In column experiments, the coated sand without wastewater exposure removed 99 9% MS2 and 95.85% PRDl (Table 12). After long-tertn exposure of the coated sand to either chlorinated or dechlorinated wastewater, the removal ofMS2 and PRDl was significantly decreased (Table 12). Chlorinated or dechlorinated wastewater exposure resulted in decrease of MS2 and PRD 1 removal by the coated sand in similar degree. MS2 and PRDl 1moval by the coated sand exposed to wastewater for 3 months became statistically similar to the removal by the uncoated sand (p>0.05). The column experiments conf1m1ed the detrimental effect of wastewater exposure for MS2 and PRDl removal by the coated sand.

PAGE 87

Table 10. Zeta potential ( mv ) of the aluminum hydroxide coated sand after exposure to wastewater tion Days Al-coated sand exposed to chlorinated wastewater Al-coated sand exposed to dechlorinated wastewater 0 +20 +2 0 1 13 -69 -84 -56 6 -76 60 90 110 -75.5 -79 -75 -43 -40 -36 Note: Sand was washed twice with deionized water. Then the zeta potential was measured as previously described (C hen et al., 1998). The zeta potential of uncoated sand is -99 mv 75

PAGE 88

Table 11. Protein content (mg/g sand) of the aluminum hydroxide coated sand after exposure to wastewater ration Days 0 1 13 60 90 110 Al-coated sand exposed to 5.6 7.3 3.8 4.7 9 .3 I 0.3 chlorinated wastewater Al coated sand exposed to 5.6 8.3 12 0 57 .4 111 .0 118 5 dechlorinated wastewater 76 Note: Sand was washed twice with deionized water and then mixed with 1 ON NaOH to ext:tact protein. The sand was allowed to settle and the protein in the supernatant was deter111ined.

PAGE 89

Virus MS2 Days 0 90 110 Table 12. MS2 and PRDl removal by sand columns Uncoated sand 40.4 39.1 25.23 Percent Removal by Al-coated sand exposed to dechlorinated wastewater Al-coated sand exposed to chlorinated wastewater 77 99.9 51.1 33.1 -------------------------------------------------------------------------------------99.9 63.l 33.3 PRDl 0 90 110 8.5 10.52 11 86 95.85 40.89 23.28 95.85 23.28 12.15 Note: Sand was packed into coltimns ( 1.5 cm I.D. x I.Om). AGW seeded with MS2 and PRDl was passed through these col11mns in upflow mode. At steady state, the MS2 and PRDl in the column ifluent and effluent samples were assayed.

PAGE 90

' 0 E 0 120 100 80 60 40 20 0 --I-.......... . . .. . . . . . . . . . . . . . . . . .. . . . . . . . . . . ..... . . .. .. . . . .. ......... . . . . .. . . ... . . . . . .. .. .. . . . . . . . .. . . . . . . . . . . . . . .. . . . . . . . . . ......... . . . . . . . . .. .......... . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . ..... ......... . . . . . . ...... . . . . .......... . . . . ......... . . . . . . ..... . . . . .. . . . ., .......... . . . . . . .. . . . . . . . .. . .. . .. . . . . . . . . ........ . . . . . . ..... . . . . . . ..... . . . . . . . . ... . . . . .. .. .. . . .. . . . . . . . . . . . . . . . . . . . .... .......... . . ... . . . . . . ..... . ...... .......... ........ . .. .... . ... "' ...... .. . . . . . . . . . . . . . . . ..... . . .. . . . .. '" . .. . . . .. . . . . . . . . . . . .. .. . . . .. .. . . . . . .. . .. . . . . . ... . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . ....... . . . . . . .. . . . . . . . . . ....... . .. . .. . ....... . . . . . . . . . . . . ..... ........ .. . . .. . ........ . . . . . . . . . . . . . . . . . . . . . . . . . . . .... . . . . ....... .. . . ..... . . . . . . . . . . . . . . . . . . . . . . . . . . . . ... . . . . . . . .. . . . . . . .. . . . . . . .... . . . . . ....... .. . . . .. . . . . . ........ . . . . . . . . . . . . . . . . . . . . .. -.... . . . . . .. . ... . . . . .......... . . . . . .... ..... . . . . . .. . . .. . . .... . ....... . . . . . . . . . . .......... . . . .. . .. . . . . . . . . . . . . .. . . . . . .......... . . . . . . . . . . .. . . . . . . . . . .. . .. ... .... .. .. .. ... ... .. .. . .. . . . . . . . . . . . . . .. . . . . . .. . . .......... . . .... .. .. .. . . . . .. . ..... .. . . . . . . .. . . .. . . . At-coated sand exposed At-coated sand exposed At-coated sand to dechlorinated to chlorinated wastewater wastewater Sands Fig 11. MS2 removal by batch experiment 1111 day El 13 days crl 60 days W90days m 110 days controls uncoated sand .....J 00

PAGE 91

' 0 E 0 100 90 80 70 60 50 40 30 20 10 ............. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............. . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . . . . . . . . . . . . . . . . . . . . . . . .... . . .. . . . . . . . . . .. . . . . . . . . . .. .. .. .. .. . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . .. . . . .... . . .. . . . .. . . . . . . .. . . . . . . . . . . . . . . . . . .. . .. . . .. . ... .. .. . . . . . . .. . . .. . .. . . . . . . . . . . . . ............. . . . . .. . . . . . . . . . . . . . . . .. .. . ... .. ... . .. . .. . . . . . . . . . . . . . . . . . . . . ....... .. ....... : .... ..... : ..... ..... . "' .. ~ .. .;,,s,s ... ...... .. ........... . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . ............. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .............. . . . . . . . . . . . . . ............. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............. ............. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............. . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............. ............. . . . . . . .............. .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. .... .... .. . . . .. .. . . . .. . . .. . . . . . . . . . . . ............. . . . . . . . . . . . ... . . . . . .. ............. .............. . . . . . . ............. . . . . . . . . . .. . . . ..... ..... ... .............. . . . . . . . . . . . . . . .. . . . . . . . . . .. . . . . . . . . . . . . . . ............. .. . . .. . .. . . . .. . . . . . . . . . . . . . . . . . . . . .. . . . . .. .. . . . . . . . . . . . .. . . . . . . . . . . . . .. . . . . . . . . . ... ..... . . . .. . . ....... : ...... 0 --~~ ............ ,._,.. ... ,., ,._ ... ............. .. . . . . . . . . . . . .. . . .. . . . . . . . . . . ... .......... ,., ...... Al-coated sand exposed to Al-coated sand exposed to dechlorinated wastewater chlorinated wastewater Al-coated sand Sands Fig. 12 PRD 1 removal by batch experiment Ill 1 day Bl 90 days m 110 days controls uncoated sand

PAGE 92

DISCUSSION Z. ramigera was found in wastewater treatment plants and some lakes. It was isolated from raw sewage, mixed liquor suspension and lake water by using m-toluic acid isolation medium combined with trimethoprim or sulfadiazine, which were more efficient than m-toluic acid isolation medi11m alone for isolation of Z. ramigera from natural environments. Detection of Z. ramigera from natural environments is greatly simplified by using antibodies specific for the neotype strain of Z. ramigera 106 as the primary antibody, and different conjugates of goat anti-rabbit IgG which are commercially available as the secondary antibody. The cells and extracellular polymer of Z. ramigera were visualized in several ways using immunological procedures. These include using: A. FITC-labeled secondary antibody and fluorescence microscopy; B. biotin-conjugated secondary antibody and light microscopy; and C. gold-labeled antibody and SEM. The advantage of immunofluorescence procedures is that they are fairly easy to use. However, autofluorescence may be a problem with some samples. The enzymatic procedures are also fairly simple and can be done with a light microscope. Using gold labeled antibody and SEM per1nits observation at higher magnifications than with light or fluorescence microscopy. Observations using backscatter electrons show where the antibody is localized, since only heavy metals, such as the gold of the secondary antibody, can cause back scatters. 80

PAGE 93

81 Previously, the FITC-labeled 16S rRNA oligonucleotide probe against Z ramigera 106 could also be used to detect Z ramigera in natural samples, as was shown in a previous study by Rossello-Mora et al.( 1995). However, a reduced content of intracellular l 6S rRNA in less active cells, and limited penetration of the probe may be problem with this procedure. These potential problems could be overcome by using immunological methods. Indirect immunoassay methods are also technically simpler and more time saving than the detection method using the tluorescein-labeled 16S rRNA oligonucleotide probe. PCR/RT-PCR has been used as a sensitive method to detect bacteria or viruses from environmental samples. By using the primers specific for Z. ramigera 106 16S rRNA, RT-PCR was used as another alternative method for detection of Z. ramigera from natural environments. There were negative reactions when 16S rRNA isolated fromDuganella zoogloeoides, or from 'Z. ramigera' 1-16-M was used as template for RT-PCR reaction. However, the same length of DNA fragments (619 bases) was produced when l 6S rRNA isolated from Z. ramigera 106, Z. ramigerq isolated from raw sewage, or from biofilm developed over raw sewage supplemented with phenol was used as template for RT-PCR. Therefore, the current procedure is reliable for Z ramigera detection. Immunological methods detect both dead and viable microorganisms as long as the presence of the antigen. Since rRNA is a dominant cellular macromolecule and related to viability of the cells, RT-PCR by using rRNA as template can be used to

PAGE 94

detect only viable microorganisms. Generally reproducibility and reliability of RNA extraction is important for reliable information obtained by RT-PCR, especially during studies of microbial community in dirty environments (Muyzer and Ramsing, 1995 ) Therefore, RT-PCR combined with the use of immunological methods is preferred for detection and understanding of Z ramigera in natural environments. 82 Because it has been observed in association with biological floes and biofilms in wastewater treatment plants, Z ramigera has been considered to be an important microorganism in the wastewater treatment processes. However, studies on the n11mber of bacteria capable of for1ning fmger-like zoogloeae showed that these bacteria were a minor portion of the population of the samples from waste water (Williams and Unz, 1983). Higher numbers of Z ramigera were fo11nd in activated sludge floes by Rosello Mora et al. (1995). These workers found that 10% of the cells in floes from an aeration basin from one plant reacted with an oligonucleotide probe specific for Z ramigera 16S rRNA. In the current study, enrichment cultures using phenol were u~d to detennine the MPN of Z ramigera in wastewater and environmental samples The presence of Z ramigera was detertnined by observing the presence of typical finger-like projections. These were confrrmed using immunological procedures. In some cases, fluorescence techniques revealed the presence of bacteria in typical zoogloeal projections that were obscured by other bacteria when the samples were observed using phase contrast microscopy. Using these procedures, the number s of Z ramigera in mixed liquor

PAGE 95

83 suspended solids was closer to the value obtained using the FITC-labeled 16S rRNA oligonucleotide probe (Rossello-mora et al., 1995) than to the values obtained using microscopic examination of fmgered zoogloeae (Williams and Unz, 1983 ). The use of enrichment cultures and immunological procedures to enumerate Z ramigera was meant to demon strate their potential for studying the distribution of Z ramigera in wastewater and environmental samples. Too few samples were taken for the numbers to be considered definitive. However, the num hers do show some interesting trends. It appears that Z. ramigera is more numerous in mixed liquor suspended solids. They are relatively fewer in raw sewage and in solids undergoing aerobic digestion. Besides wastewater treatment plants, Z. ramigera was also found in eutrophic, mesotrophic and some oligotrophic lakes. However, Z ramigera was not found in one lake studied with very low total nitrogen content (Lake Sheelar, Table 5). SEM observations of gold-coated Z. ramigera 106 indicated the presence of fibrils within and on the surface of the zoogloeal projections. It is likely that these fibrils provide the structure for the observed zoogloeal projections. Similar structures were found on the sand from the column that had sewage with phenol passed through it. Structures resembling zoogloeae were also observed in the bioftlm from a denitrifying filter by Sich and Rijn (1997). Since natural zoogloeal finger-like projections reacted with antibodies against Z. ramigera 106 cells or extracellular polymer, the natural zoogloeae were also antigenically similar to laboratory culture. The antigenic similarity between natural fmger-like projection and the laboratory culture suggests that the

PAGE 96

84 material surrounding natural finger-like projections are chemically similar to that surrounding Z ramigera 106. This extracellular material was previously shown to be a mucopolysaccharide associated with floc culation (Farrah and Unz, 1976; Tezuka, 1973 ; Unz and Farrah, 1976b) and could be recovered from laboratory cultures of Z ramigera and from mixed liquor suspended solids. Unlike some extracellular polymer-producing bacteria whose clones on nutrient agar plate are mucoid or butyrous Z ramigera clones on the agar plate are gelatinous, dry and hard. It was found that zoogloeal projections can even resist protozoan attack in activated sludge floes (Farrah, 1974). Previous knowledge and current information obtained by GC/MS analysis of the extracellular polymer produced by Z. ramigera indicated that the predominance of carbohydrate, especially amino sugars. Generally, a bacterial extracellular polymer not only provides a major source of biomass as an alternation energy source, but also provides structural rigidity and a defensive barrier to invading pathogens. It was observed that the finger-like projection structure of Z ramigera can even resist protozoan attack in activated sludge floes (Farrah, 1974). It was found that bacterial cells in biofilm are usually more resistant to environmental stress and antibacterial agents than p1anktonic cells ( Marshall et al., 1989; Ophir and Gutnick, 1994; Brown et al., 1995). In the case of chlorination of biofilm bacteria, it was suggested transport of chlorine to biofilm bacteria surface might be an important rate-limiting step (LeChevallier et al., 1988 a,b; Huang et al., 1995) Free chlorine is known to react with a wide variety of compounds, including

PAGE 97

85 polysaccharide. Therefore, besides providing a physical barrier reducing the ability of chlorine to approach the cell membrane, free chlorine might be consumed by reaction with extracellular polymer before it can fully penetrate the biofilm surface (LeChevallier et al., 1988 a,b ). In this study, it was found that Z. ramigera extracellular polymer had protected the cells from chlorine inactivation. Z. ramigera extracellular polymer might either prevent the direct contact of chlorine with the cells or react with chlorine. Biofilm development on the filter media enhances removal of bacteria and ftne particles from water (Schuler et al., 1991; Banks and Bryers, 1992; Drury et al., 1993; Rittmann and Wirtel, 1991; Sprouse and Rittmann, 1990). In this study, the loss in zeta potential appeared to be more important than biofilm development on the surface oftbe aluminum coated sand after long te1n1 exposure to dechlorinated wastewater. Therefore, virus removal by the sand was greatly reduced after wastewater exposure. As with bioftlm development, organic and inorganic materials in wastewater also 'blocked' favorable sites for virus removal. Thus, the coated sand exposed to chlorinated wastewater also reduced virus removal. The results of this study can be summarized as follows: I. Isolation media for the recovery of Z ramigera from natural environments can be improved by adding the antibiotics trimethoprim and sulfadiazine. 2. SEM analysis of finger-like projections of laboratory cultures of Z ramigera shows the presence of fibrils running along the length of the zoogloeal projections.

PAGE 98

86 3. Immunological assays showed that both the cells and extracellular polymer of natural fmger-like projections are antigenically similar to those of Z ramigera 106. 4. The major components of the extracellular polymer surrounding Z ramigera are galactosamine and another unidentified amino sugar. 5. The extracellular polymer protects Z. ramigera cells from inactivation by chlorine. 6. Z. ramigera can be found in all stages of wastewater treatment, but are present in the highest percentage in mixed liquor samples. Z. ramigera can also be found in eutrophic, mesotrophic and some of oligotrophic lakes, but not in the lake with low nitrogen content. 7. Exposure of modified sand to wastewater decreases its ability to adsorb viruses in water. 8. Part of the biofilm that develops on sand exposed to wastewater containing phenol have structures that resemble fmger-like projections of Z. ramigera

PAGE 99

APPENDIX SEQUENCE OF Z RAMJGERA (ATCC 19544) 16S RRNA ORIGIN 1 agagt t tga tnn tgget eagattgaaegetggcggcatgc t t tacacatgcaag tcgaae 61 gg taacagggagc ttge tcege tgacgag tggcgaaegggt gagtaatgcatcggaaegt 121 gecg tg taa tggggga taacg tagegaaag ttacgctaataccgea tacgccctgagggg 181 gaaag tgggggaecgcaaggcc teaeg t tatacgagcggecga tgtcggat tagctagtt 241 gg tggggtaaaggcc taccaaggcgacga tccg tagcgggt etgagaggatgatccgcca -->Pl 301 eae tgggac tgagacacggeceagae tectacgggaggcagcagt ggggaatt ttggaca 361 atgggggcaaceetgatccagccatgccgcgtgagtgaacaaggccttcgggttgtaaag 4 21 ctct t tcagg tggaaagaaa tcgcate tt ttaatacaggg tg tgga tgaegg tacca tea 481 gaagaageaceggetaac taeg tgceagcagccgeggtaatacg taggg tgegagcg tta 541 a teggaa ttac tgggcgtaaagcg tgcgeaggcggt tatg taagaeaga tgtgaaa tccc 601 cgggctcaaectgggaactgcgtttgtgactgeataactagagtacggcagagggaggtg 661 gaa ttcegeg tg tagcag tgaaatgegtagagatgeggaggaacaecgatggcgaaggca 721 gcctcc tgggccag tactgacgetea tgeaegaaageg tggggagcaaacaggat tagat 781 aeee tgg tag t eeaegccet aaacgatgtcaactagt tgt tcgg tgaggagae tcattga P2 < -----gatcaacaagccac tee tc tgagtaa 841 g taacgeagc taacgcgtgaagt tgaccgcetggggag tacggcegeaaggt taaaactc 901 aaaggaat tgaeggggaceegeaeaagcggt ggatgatg tggat taat tegatgcaacgc 961 gaaaaaeet taec taecet tgacatgecaggaact tgecagaga tggct tgg tgecegaa 1021 agggaaec tggaeacaggtgc tgca tggetg tcgtcagc tcgtg tcgtgagatgt tgggt 1081 taag t ccegcaacgagcgeaaecct tgtcat tagt tgecagcat taagt tgggcae tc ta 1141 a tgagae tgecgg tgacaaaeeggaggaaggtggggatgacgtcaagtectca tggcect 1201 tatgggtaggget teaeacg tea tacaa tgg teggtacagagggt tgecaagccgegagg 1261 tggagecaa tceeagaaagccga tegtag tccggat tggagtc tgeaae tcgacteca tg 1321 aag tcggaa tcgc tagtaa tegeaga teageatgc tgegg tgaataeg ttccegggtett 13 81 gtacacaccgcccg tcacaeeatgggag tggggt t taceagaagt aggtagct taacct t 1441 cgggagggcgct taecacggtgaget tcatgac tgggg tgaag tegtaacaaggtagccg 150 I tatcggaaggtgcggctggatcacctcctt II Note: the bold letters indicate the sequence complementary to 16S rRNA oligonucleotide probe used previously. Underlined letters indicate the primers used in RT-PCR reaction. 87

PAGE 100

REFERENCES Allison D. G., and I. W. Sutherland. 1987. The role of exopolysaccharides in adhesion of freshwater bacteria. J. Gen. Microbiol 133 : 1319-1327. American Public Health Association. 1989. Standard Methods for the &amination of Water and Wastewater. 17th edition. American Public Health Association, Inc New York. Anguish, L. J., and W. C. Ghiorse. 1997. Computer-assisted Laser scanning and video microscopy for analysis of Cryptosporidium parvum oocysts in soil, sediment, and feces. Appl. Environ. Microbiol 63:724-733. Asghari A., and S. R. Farrah. 1993 Inactivation of bacteria by solids coated with magnesium peroxide. J. Environ. Sci. Health. A28( 4):779793. Bachmann, R. W., and D. E. Canfield Jr. 1996. Use of an alternative method for monitoring total nitrogen concentrations in Florida Lakes. Hydrobiologia. 323: 1-8 Bales, R. C., and S. Li. 1993 MS2 and polio virus transport in porous media: hydrophobic effects and chemical perturbations. Water Resources Res. 29:957-963. Banks, M. K. and J. D. Bryers. 1992. Microbial deposition rates onto clean glass and pure culture bacterial biofilm surfaces, Biofouling, 6:81-86. Barthe, G. A., T. L. Ceccardi, K. L. Manjunath, and K. S. Derrick. 1998. Citrus psorosis virus: nucleotide sequencing of the coat protein gene and detection by hybridization and RT-PCR. J. Gen. Virol. 79(pt6):1531-1537. Beilke, M.A., S. Japa, and D. G. Vinson.1998. HTL V-1 and HTLV-II virus expression increase with HIV confection J Acquir. Immune. Defic. Syndr. Hum. Retrovirol. 17:391-397. Bensadoun, A., and D. Weinstein. 1976. Assay of proteins in the presence of interfering materials. Anal. Biochem. 70:241-250. Bitton, G. 1994. Wastewater Microbiology. John Wiley and Sons, Inc. 88

PAGE 101

Bitton, G., and B. Koopman. 1982 Tetrazolium reduction-malachite green method for assessing the viability of filamentous bacteria in activated sludge. Appl. Environ Microbial. 43 :9640-9646 Bo lister, N M. Basker, N. A. Hodges, and C. Marriot. 1991. The diffusion of Beta lactam antibiotics through mixed gels of cystic fibrosis-derived mucin and Pseudomonas aeruginosa alginate J. Antimicrob. Chemother 27 : 285-293 89 Britschgi, T B. and S. J. Givonnoni. 1991. Phylogenetic analysis of a natural marine bacterioplankton population by rRNA gene cloning and sequencing. Appl. Environ Microbial. 57:1707-1713. Brown, M. L., H. C Aldrich, and J J Gauthier. 1995. Relationship between glycocalyx and povidone-iodine resistance in Pseudomonas aeruginosa (ATCC27853) biofilms. Appl. Environ. Microbial. 61: 187-193 Butterfield, C. T. 1935. Studies of Sewage Purification. II. A zoogloea-forming bacterium isolated from activated sludge. U S. Pub. Health Rep. 50:671-684 Campbell, A., and H. Smith. 1997. Immunomagnetic separation of Cryptosporidium oocysts from water samples:round robin comparison of techniques Water Sci. Technol. 35:397-401. Cappuccino, J. G., and N. Sherman 1992. Microbiology a Laboratory Manual, Third Edition, The Benjamin/Cummings Publishing Company, Inc. Centurion, L. A., C. Castro, J. M. Shaffer, V. W. C. Van, C M. Marra, and S. A. Lukehart. 1997. Detection of Treponema pallidum by a sensitive reverse transcriptase PCR. J. Clin. Microbial. 35:1348-1352. Chadwick, N., I. Bruce M. Davies, B. van-Gemen R. Schukkink, K. Khan, R. Pounder, and A.Wakefield. 1998. A sensitive and robust method for measles RNA detection J. Virol. Methods. 70:59-70 Chaplin, M.F. 1986. Monosaccharides. In: Carbohydrate Analysis a Practical Approach 2pd edition, Eds. M F. Chaplin and J. F. Kennedy. IRL Press: Oxford,UK. p. 1-4 Chen J., S. Truesdail, F. Lu, G. Zhan C. Belvin, B. Koopman, S. R Farrah, and D 0 Shah. 1998. Long-te11n evaluation of aluminum hydroxide-coated sand for removal of bacteria from wastewater Water Res. in press.

PAGE 102

90 Chow V. T., Y. C. Chan, R. Yong, K. M. Lee, L. K. Lim, Y. K. Chung, P S. G Lam, and B. T. Tan. 1998. Monitoring of dengue viruses in field-caught Aedes aegypti and Aedes albopictus mosquitoes by a type specific polymerase chain reaction and cycle sequencing, Am J. Trop. Med. Hyg. 58:578-586 Chung, H., L.A. Jaykus, and M D. Sobsey. 1996. Detection of human enteric viruses in oysters by in vivo and in vitro amplification of nucleic acids. Appl. Environ. Microbial. 62:3772-3778. Cleveland, P.H. and D D. Richman.1987. Enzyme Immunofiltration staining assay for immediate diagnosis of herpes simplex virus and varicella-zoster virus directly from clinical specimens. J. Clini. Microbial. 25(2):416-420. Contoreggi, C. S S. W. Jones, W.R. Lange and W. A. 3ro Meyer 1997. Evaluation of IDV l infection status by HIV 1 PCR and culture methodologies in a small cohort of intravenous drug users. Res. Virol. 148:215-224. Costerton, J. W., K-J Cheng, G. G Geesey T. I. Ladd, and N. C Nickel. 1987. Bacterial biofilms in nature and disease. Annu. Rev. Microbial. 41 :435-464. Costerton, J. W., Z. Lewandowski, D. E. Caldwell, D.R. Korber, and H. M. Lappin Scott. 1995. Microbial biofilms Annu. Rev. Microbial. 49:711745. Crabtree, K. W. Boyle, E. McCoy, and G. A. Rohlich 1966 A mechanism of floc fortnation by Zoogloea ramigera Journal WPCF. 38:1968-1980. Crabtree, K., and E. McCoy. 1967. Zoogloea ramigera Itzigsohn, identification and description, request for an opinion as to the status of generic name Zoogloea. Int. J. Syst. Bacteriol. 17: 1-10. Crabtree, K. E. McCoy, W C. Boyle, and G. A. Rohlich. 1965 Isolation, Identification and metabolic role of the sudanophilic granules of Zoogloea ramigera. Appl Microbiol. 13 :218-226. Cromeans, T L 0 V. Nainan, and H. S. Margolis. 1997. Detection of hepatitis A virus RNA in oyster meat. Appl. Environ. Microbiol. 63:2460-2463. Cusi M. G., S. Bianchi M. Valassina, L Santini, M Arnetoli, and P. E. Valensin. 1996. Rapid detection and typing of circulationg mumps virus by reverse transcription / polymerase chain reaction. Res. Virol. 147:2 2 7-232. Davies, D G., M. R. Paese~ J.P Pearson B. H. lglewski, J. W. Co s terton and E P Greenberg. 1998. The involvement of cell-to cell signals in the development of a bacterial biofilm. Science 280:295 298.

PAGE 103

De Beer, D., R. Srinivasan, and P. S. Stewart. 1994. Direct measurement of chlorine penetration into biofilms during disinfection. Appl. Environ. Microbiol. 60:43394344. DeLong, E. F., D. G. Franks, and A. L. Allulredge. 1993. Phylogenetic diversity of aggregate-attached vs. free-living marine bacterial assemblages. Limnol. Oceanorgr. 38:924-934. de Nys, R. P. D. Steinberg, P. Willemson, S. D. Dwarjanyn, C. L. Gabelish, and R. J. King. 1995. Broad spectrum effects of secondary metabolites from the red algae Delisea pulchra in antifouling assays. Biofouling. 8:259-271. Drury, W. J., W. G. Characklis, and P. S. Stewart. 1993. Interaction of I mm latex particles with Pseudomonas aeruginosa bioftlms. Water Res. 27: 1119-1126. 91 Dugan, P.R., and D. G. Lundgren. 1960. Isolation of the floc-fo1111ing organism Zoogloea ramigera and its culture in complex and synthetic media. Appl. Microbial. 8 : 357361. Dutton, R. J., G. Bitton, and B. Koopman. 1983. Malachite green-INT (MINT) method for detertning active bacteria in sewage. Appl. Environ. Microbial. 46:1263-1267 Echevarria, J.E., D. D. Erdman, E. M. Swierkosz, B. P. Holloway, and L. J. Anderson. 1998. Simultaneous detection and identification of ht1man parainfluenza viruses 1, 2 and 3 from clinical samples by multiplex PCR J. Clin. Microbial. 36:1388-1391 Erber!, L., M. K. Winson, C. Sternberg, G. S. A. B. Stewart G. Christiansen, S. R. Chhabra, B. Bycroft, P. Williams, S. Molin, and M. Givskov. 1996. Involvement of N-acyl-L-homoserine lactose autoinducers in controlling the multicellular behavior of Serratia liquefaciens. Mol. Microbial. 20:127-136. Farrah S. R. 1974. Bacterial zoogloea formation. PhD dissertation. Pennsylvania State University. Farrah, S. R., and D.R. Preston. 1985. Concentration of viruses from water by using cellulose filters modified by in situ precipitation of ferric and aluminum hydroxides. Appl. Environ. Microbial. 50: 1502-1504. Farrah, S. R., and D.R. Preston. 1991. Adsorption of viruses by diatomaceous earth coated with metallic oxides and metallic peroxides. Water Sci Tech. 24:35-240. Farrah S. R., and R. F. Unz. 1975. Fluorescent-antibody study of natural fmger-like Zooglo e a e. Appl. Environ. Microbial. 30:132-139.

PAGE 104

92 Farrah S. R., and R. F. Unz. 1976. Isolation of extracellular polymer from Zoogloea strain MP6 and I 06 and from activated sludge. Appl. Environ. Microbiol. 32:33-37. Friedman, B. A., and P.R. Dungan. 1968. Identification of Zoogloea species and the relationship to zoogloeal matrix and floe f 01 mation. J. Bacterio 1. 9 5: 1903 -1909 Friedman, B. A., P. R. Dugan, R. M. Pfister, and C. C. Remsen. 1968. Fine structure and composition of the zoogloeal matrix surrounding Zoogloea ramigera. J. Bacteriol. 96:2144-2153. Fuqua, C., S. C. Willans, and E. P. Greenberg. 1996. Census and consensus in bacterial ecosystems: the Lux.R-LuxL family of quorum-sensing transcriptional regulators. Annu. Rev. Microbiol. 50:727-751. Gantzer, C., S. Senouc~ A. Maul, Y. Levi, and L. Schwartzbrod. 1997. Enterovirus genomes in wastewater: concentration on glass wool and glass powder and detection by RT-PCR. J. Virol. Methods. 65:265-271. Gerba, C. P., 1984, Applied and theoretical aspects of virus adsorption to surfaces. Adv. In Appl. Micro. 30:133-167. Gerba, C.P., K. Hou, and M. D. Sobsey. 1988. Microbial removal and inactivation from water by filters containing magnesitim peroxide. J. Environ. Sci. Health. A 23 :4158. Gillan, D. C., A.G. C. L. Speksnijder, G. Zwart, and C. De Ridder. 1998. Genetic diversity of the biofilm covering Montacuta ferruginosa (Mollusca, Bivalvia) as evaluated by denaturing gradient gel electrophoresis analysis and cloning of PCRamplified gene fragments coding for 16S rRNA. Appl. Environ. Microbiol. 64:3463-34 72. Givskov, M., R. deNys, M. Manefield, L. Gram, R. Maximilien, L. Eberl, S. Molin, P. Steinberg, and S. Kjilleberg. 1996. Eukaryotic interference with homoserine lactose-mediated prokaryotic signaling. J. Bacteriol. 178:6618-6622. Hafliger, D., M. Gilgen, J. Luthy, and P. Hubner. 1997. Seminested RT-PCR systems for small round structured viruses and detection of enteric viruses in seafood. Int. J. Food Microbiol. 37:27-36. Hayase, Y., and K. Tobita. 1998. Detection of genes of RNA viruses from freshly biopsies gastric mucosa by reverse transcription polymerase chain reaction. J. Gastroenterol. 33:147-152.

PAGE 105

93 Heissenberger, A., G. G. Leppard, and G. J. Herndl 1996. Relationship between the intracellular integrity and the morphology of the capsular envelope in attached and free-living marine bacteria. Appl. Environ. Microbiol. 62:4521-4528. Hejlar, J. and J. Chudoba. 1986. Microbial polymers in the aquatic environment-I production by active sludge microorganisms under different conditions. Wat. Res. 20:1209-1216. Herson, D.S B. McGonigle, M.A. Payer and K H. Baker 1987. Attachment as a factor in the protection of Enterobacter cloacae from chlorination. Appl. Environ. Microbiol. 53: 1178-1180. Heukelekian, H., and M. L Littman. 1939 Carbon and nitrogen transformations in the purification of sewage by the activated sludge process II Morphological and biochemical studies of zoogloeal organisms. Sewage Works Journal. 11 :752763 Heyes, S. J. D., P. Gilbert, A. Eberhard, and D. G. Allison. 1997. Homoserine lactones and bacterial biofilms. Pl03-l 12. In J Wimpenny, P Handley, P. Gilbert, H Lappir-Scott, and M. Jones (ed.). Bio.films: community interactions and control Bioline, Cardiff United Kindom .. Hiraishi, A Y. K Shin, and J. Sugiyama 1997 Proposal to reclassify Zoog/oea ramigera IAM 12670 (P R. Dugan 115) as Duganel/a zoogloeoides gen Nov., sp Nov. Int. J. Syst Bacteriol. 47(4):1249-1252. Hober, D., T. L. Nguyen, L. Shen, D.Q. Ha, V. T. Huong, S. Benyoucef, T H. Nguyen, T. M. Bui, H.K. Loan, B. L. Le A. Bouzidi, D. De Groote, M. T. Drouet, V. Deubel, and P. Wattre. 1998. Tumor necrosis factor alpha levels in palsma and whole-blood culture in dengue-infected patients: relationship between virus detection and pre-existing specific antibodies. J Med. Virol. 54:210-218. Hodges, N. A., and C. A. Gordon. 1991. Protection of Pseudomonas aeruginosa against ciprofloxacin and beta-lactams by homologous alginate, Antimicrob Agents Chemother. 35:2450-2452. Holt John G., N. R. Krieg, P.H. A. Sneath, J. T. Staley, and S T Williams. 1994 Bergey 's Manual of Determinative Bacteriology 9th Edition. p. l O 1 Horan, N. J and C. R. Eccles. 1986. Purification and characterization of extracellular polysaccharide from active sludge. Water Res. 20:1427-1432 Hoyle, B. D., J. Alchntara, and J. W. Costerton. 1992 Ps e udomonas a e ruginosa biofilm as a diffusion barrier to piperacillin. Antimicrob. Agents Chemother. 36:2054-2056

PAGE 106

Huang, C.-T .. F P Yu, G. A. Mcfeters, and P. S. Stewart. 1995. Nonuniform spatial patterns of respiratory activity within biofilms during disinfection. Appl. Environ. Microbiol. 61 :2252-2256. 94 Huang C.-T., K. D. Xu, G. A. McFeters, and P. S. Stewart. 1998. Spatial patterns of alkaline phosphatase expression within bacterial colonies and biofilms in response to phosphate starvation Appl. Environ Micro biol. 64: 1526-1531. Ikeda, F., H. Shute, T. Saito, T. Fukui, and K.Tomita. 1982. An extracellular polysaccharide produced by Zoogloea ramigera 115. Eur. J. Biochem. 123:437-445. ltzigsohn., H. 1868. Entwicklungsvorgange von Zoogloea, Ocil/oria, Synedra, Syaurastrum, Spirotaenia und Chroolepus. p. 30-31. Sitzungs-Berichte der Gesellschaft naturforscbender Freunde zu Berlin. Jansson, P. E., B. Lindberg, and U. Lindquist. 1981. Structural studies of the capsular polysaccharide from Streptococcus pneumoniae type 4. Carbohydr. Res. 95:73-80. Jeanne!, D., C. Fretz, Y. Traore, N. Kohdjo, A. Bigot, G. E. Pe, G Jourdan, K. Kourouma, G. Maertens, F. Fumoux, J. J. Fournel, and L. Stuyver. 1998. Evidence for high genetic diversity an dlong-terrn endemicity of hepatitis C virus genotypes 1 and 2 in west africa. J. Med. Virol. 55:92-97. Jou, N T., R. B. Yoshimori, G. R. Mason, J. S. Louie, and M. R. Liebling. 1997. Single tube, nested, reverse tlanscriptase PCR for detection of viable Mycobacterium tuberculosis. J. Clin. Microbiol. 35:1161-1165. Kaplan, D., D. Christiaen, and S. (Malis) Arad. 1987. Chelating proper.ties of extracellular polysaccyharides from Ch/ore/la spp. Appl. Environ. Microbiol. 53 :2953-2956. Kaplan. J.E., D. J. Hu, and K. K Holmes. 1996. Preventing opportunistic infections in human immunodeficiency-virus-infected persons. Am. J. Trop. Med. Hyg. 55:1-11. Kashiwagi, Y., H. Kawashima, K. Takekuma, A. Hoshika, T. Mori, and T. Nakayama. 1997. Detection of mumps virus genome directly from clinical samples and a simple method for genetic differentiation of the Hoshino vaccine strain from wild strains of mumps virus. J. Med. Virol. 52:195-199. Kaucner, C., and T. Stinear. 1998. Sensitive and rapid detection of viable Giadia cysts and Cryptosporidium parvum oocysts in large-volume water samples with wound fiberglass cartridge filters and reverse transcription-PCR. Appl. Environ. Microbiol. 64:1743-1749.

PAGE 107

95 Kawashima, H., T. Miyajima, T. Mori, L. Yuan, M. Ogihara, K K. inoue, K. Takekuma, and A. Hoshika. 1996. A case of intractable epilepsy positive for the detection of measles virus genome in the cerebrospinal fluid and peripheral mononuclear cells using reverse transcriptase-polymerase chain reaction. Brain Dev. 18:220-223. Kinoshita, T., R. C. Bales; K. M. Maguire, and C. P. Gerba. 1993. Effect of pH on bacteriophage transport through sandy soils. J. of Contaminant Hydrology. 14:5570. Klein, P. G and V. K. Juneja. 1997. Sensitive detection of viable Listeria monocytogenes by reverse transcription-PCR. Appl. Environ. Microbiol. 63 : 44414448. Koch, B., M. Ostermann, H. Hoeke, and 0.-C.Hempel. 1991. Sand and activated carbon as biofilm carriers for microbial degradation of phenols and nitrogen-containing aromatic compounds. Water Res. 25:1-8. Kolter, R., and R. Losick. 1998. One for all and all for one. Science. 280:226-227. Krul, J.M 1977. Activity of Zoogloea ramigera growing in floes and in suspension. Water Res. 11 :45-50. Kuhn, S. P., and R. M. Pfister.1990 Accumulation of Cadmium by immobilized Zoogloea ramigera 115 J. Industrial Microbiol. 6 : 123-128. Kurabachew, M., A. Wondimu, and J. J. Ryon. 1998. Reverse transcription-PCR detection of Mycobacterium Leprae in clinical specimens. J. Clin. Microbiol. 36:1352-1356. Laursen, A. L. J. Ingerslev, P. L. Andersen, and L. Ostergaard. 1998. Viremia in chronic hepatitis C patients evaluated by the Amplicor RT-PCR, a nested RT-PCR and transaminase levels. APMIS. 106 : 334-338. Lawrence, J. R., G. M. Wolfaardt and D.R. Korber. 1994. Monitoring diffusion in biofilm matrices using confocal laser microscopy. Appl Environ. Microbiol. 60:1166-1173. LeChevallier, M.W., C D. Cawthon, and R. G. Lee. 1988a. Inactivation ofbiofilm bacteria. Appl. Environ. Microbiol. 54:2492-2499. LeChevallier, M.W., C D. Cawthon and R.G. L ee 1988b Factors promoting survival of bacteria in chlorinated water supplies. Appl. Environ. Microbiol. 54:649-654.

PAGE 108

96 LeChevallier, M. W., T. S. Hassenauer, A. L. Camper, and G. A. McFeters. 1984. Disinfection of bacteria attached to granular activated carbon. Appl. Environ. Microbiol. 48 :918-923. Legeay, 0., S. Bounaix, M. Denis, C. Arnauld, E. Hutet, R. Cariolet, E. Albina, and A. Jestin. 1997. Development of a RT-PCR test coupled with a microplate colorimetric assay for the detection of a swine Arterivirus (PRRSV) in boar semen. J. Virol. Methods. 68:65-80. Liesack, W., and E. Stackebrandt. 1992. Occurance of novel groups of the domain Bacteria as revealed by analysis of genetic materials isolated from an Australian terrestrial environment. J. Bacteriol. 174:5072-5078. Lin, Y., M. V. Yates, S.S. Thompson, and W. A. Jury. 1997. Sorption of viruses during flow through saturated sand columns. Environ. Sci. Technol. 31 :548-555. Liu, H. S., Y. L. Lin, and C. C. Chen. 1997. Comparison of various methods of detection of different forms of dengue virus type 2 RNA in cultured cells. Acta-Virol. 41 : 317324. Lukas~ J., Y-F. Cheng, F. Lu, M. Tamplin, and S. R. Farrah. 1998. Removal of microorganisms from water by columns containing sand coated with ferric and aluminum hydroxides. Water Res. in press. Lukasik J., S. R. Farrah, S. Truesdail, and D. 0. Shah. 1996. Adsorption of microorganisms to sand and diatomaceous earth particles coated with metallic hydroxides. KONA 14:1-6. Marshall P.A., G. I. Loeb, M. M. Cowan, and M. Fletcher. 1989. Response of microbial adhesives and biofilm matrix polymers to chemical treatments as deter111ined by interference reflection microscopy and light section microscopy. Appl. Environ. Microbiol. 55:2827-2831. McCaulou, D.R., R. C. Bales, and J. F. McCarthy. 1994. Use of short-pulse experiments to study bacteria transport through porous media. J. Contam. Hydro 1. 15: 1-14. McKinney, R. E., and M. P. Harwood. 1952. Sewage Works: Fundamental approach to the activated sludge process I. floe-producing bacteria. Sewage and Industrial Wastes. 24:117-123. McLean, R. J.C., M. Whitely, D. J. Stickler, and W. C. Fuqua. 1997. Evidence of autoinducier activity in naturally occurring biofilms. FEMS Microbiol. Lett. 154:259-263.

PAGE 109

Menzel, D. W ., and N. Corwin.1965. The measurement of total phosphorus seawater based on the liberation of organically bound fractions by persulfate oxidation. Limnology and Oceanography. 10:280-282. 97 Mills, A. L., J. S. Her1nan, G.M. Hornberger, and T. H. Dejesus 1994. Effect of solution ionic strength and iron coatings on mineral grains on sorption of bacterial cells to quartz sand. Appl. Environ. Microbiol. 60:3300-3306. Munich. 1979. International committee on systematic bacteriology judicial commission. Int. J. Syst. Bacteriol. 29:267-269. Murphy, J., and J.P. Riley. 1962. A modified single solution method for the deter1nination of phosphate in natural waters. Analytica Chimica Acta. 27:31-36. Muyzer, G., and N. B. Ramsing. 1995. Molecular methods to study the organization of microbial communities. Water Sci. Tech. 3 2: 1-9. Norberg, A. B., and S.-0. Enfors. 1982. Production of Extracellular polysaccharide by Zoogloea ramigera. Appl. Environ. Microbiol. 44( 5): 1231-123 7. Norberg, A. B., and H. Persson. 1984. Acc\1m11lation of heavy-metal ions by Zoogloea ramigera. Biotechnology and Bioengineering. 26:239-246. Norberg, A., and S. Rydin. 1984. Development of a continuous process for metal accumulation by Zoogloea ramigera. Biotechnology and Bioengineering. 26:265268. Nozawa, I., N. Takizawa, and H. Kiyohara. 1987. Restoration of the ability to settle bulking sludge by bacteria seeding in wastewater treatment. J. FeI"ment. Technol. 65:333-340. Ophir, T., and D. L. Gutnick. 1994. A role for exopolysaccharides in the protection of microorganisms from desiccation. Appl. Environ. Microbiol. 60:740-745. Parsons, A. B ., and P. R. Dugan. 1971. Production of extracellular polysaccharide matrix by Zoogloea ramigera. Appl. Microbiol. 21 :657-661. Passador, L., J.M. Cook, M. J. Grunbello, L. Rust, and B. H. Iglewski. 1993. Expression of Pseudomonas aeruginosa virulence genes requires cell-to-cell communication. Science. 260:1127-1130 Peterson, G. L. 1977. A simplification of the protein assay method of Lowry et al. which is more generally applicable. Anal. Biochem. 83:346-356.

PAGE 110

98 Pfeffer, M., B. Proebster, R. M. Kinney, and 0. R. Kaaden. 1997. Genus-specific detection of a alphaviruses by a semi-nested reverse transcription-polymerase chain reaction. Am. J. Trap. Med. Hyg. 57:709-718. Pieper, A. P., J. N. Ryan, R. W. Harvey, G. L. Amy, T. H. Illangasekare, and D. W. Metge. 1997. Transport and recovery of bacteriophage PRD l in a sand and gravel aquifer: effect of sewage-derived organic matter. Environ. Sci. Technol. 31: 11631170. Qureshi, M. N., C. E. Barr, I. Hewlitt, R. Boorstein, F Kong, 0. Bagasra, L. E. Bobroski, and B. Joshi. 1997. Detection of I-llV in oral mucosa cells. Oral. Dis 3 Suppl 1 :S73-78. Rao, V. C., and J. L. Melnick. 1986. Environmental Virology American Society for Microbiology. p. 41-54. Redman, J. A., S. B. Grant, and T. M Olson. 1997. Filtration of recombinant Norwalk virus particles and bacteriophage MS2 in Quartz sand: Importance of electrostatic interactions. Environ. Sci. Technol. 31 :3378-3383. Rittmann, B. E., and S. A. Wirtel. 1991. Effect ofbiofilm accumulation on colloid cohesion. J. Environ. Engin. 117:692-695. Rohwdder, A., 0. Keminer, J. Forster, K. Schneider, E. Schneider, and H. Werchau. 1998. Detection of respiratory syncytial virus RNA in blood of neonates by polymerase chain reaction. J. Med. Viral. 54:320-327. Rossello-mora, R. A., W. Ludwig, and K. H. Schleifer. 1993. Zoogloea ramigera: A phylogenetically diverse species. FEMS Microbiology Letters. 114:129-134. Rossello-mora, R A., M. Wagner, R. Amann and K. H. Schleifer. 1995 Tl1e abundance of Zoogloea ramigera in sewage treatment plants. Appl. and Environ. Microbial 61(2):702707. Salmond, G. P. C., B. W. Bycroft, S. A. B. Stewart, and P. Williams. 1995 The bacterial ''enigma'': cracking the code of cell-cell communication. Mal. Microbial. 16:6 I 5624. Sartory, D. P., and J. U. Grobbelaar. 1984. Extraction of Chlorophyll a from freshwater phytoplankton for spectrophotometric analysis. Hydrobiologia. 114: 177-187. Schu l er, P. F., M M Ghosh, and P. Gopalan. 1991. Slow sand and diatomaceous earth filtration of cysts and other particulates. Water Res. 25:995-1005.

PAGE 111

99 Shin, Y. K., A Hiraishi, and J. Sugiyama. 1993. Molecular systematic of genus Zoogloea and emendation of the genus Int. J. Syst Bacterial. 43(4):826-831. Sich, H., and J. V. Rijn.1997. Scanning electron microscopy of biofiltn for111ation in denitrifying, fluidished bed reactors. Water Res. 31( 4):733-742. Sker1nan, V. B. D., V. McGowan, and P.H. A. Sneath. 1980. Approved lists of bacterial names. Int. J. Syst. Bacterial. 30:225-421. Smith, J.E. 1983. Quantitation of viruses in waste and other wastes. U.S. Environmental Protection Agency Project St1mmary. EPA 600/S4-83-012. Snustad, S. A., and D. S. Dean. 1971. Genetic Experiments with Bacterial Viruses. W. H. Freeman and Co., San Francisco. Sobsey, M. D., T. Cromeans, A. R. Hickey, and J. S. Glass. 1984. Effects of water quality on micro porous filter methods for enteric virus concentration. Water Sci. Tech. 17:665-679. Sprouse, G., and B. E. Ritttr1ann. 1990. Colloid removal in fluidized bed biofilln reactor, J. Environ. Engin. 116:314-329. Stegeman C. A., J. W. Cohen Tervaert, P. E. de. Jong., and C. G. Kallengerg. 1996. Trimethoprim-sulfamethoxazole ( co-trimoxazole) for the prevention of relapses of Wegener' s granulomatosis. Dutch Co-trimoxazole Wegener Study Group. N. Engl. J. Med. 335(1 ): I 6-20. Stenkamp, V. S., and M. M. Benjamin. 1995. Effect of Iron Oxide Coating on Sand Filtration. Water Res. 20:145-151. Stewart, P S., A. K. Camper, S. D. Hardran, C.-T. Huang, and M. Warnecke. 1997. Spatial distribution and coexistence of Klebsiella pneumonia and Pseudomonas aeruginosa in biofilms. Microbiol. Ecol. 33 :2-10. Stickler, D. J., N. S. Morris, R. J. C. McLean, and C. Fuqua. 1998. Biofillns on indwelling urethral catheters produce quorum-sensing signal molecules in situ and in vitro. Appl. Environ. Microbiol. 64:3486-3490. Tezuka, Y. 1973. A zoogloea bacterium with gelatinous mucopolysaccharide matrix. J. Water Pollut. Control Fed. 45: 531-536. Truesdail, S. E., J. Lukasik, S. R. Farrah, D. 0. Shah~ and R. B. Dickinson. 1998. Analysis of bacterial deposition on metal (hydr)oxide-coated sand filter media. J. colloid Interface Sci. 203 :369-378.

PAGE 112

100 Tyler K. L. R J Sokol, S. M Oberhaus, M. Le, F M Karrer, M. R. Markewicz R.W Tyson, J R. Murphy, R Low, and W.R. Brown. 1998. Detection of reovirus RNA in hepatobiliary tissues from patients with extrahepatic biliary atresia and choledochal cysts. Hepatology. 27:1475-1482. Unz, R F. 1971 Neotype strain of Zoogloea ramigera Itzigsohn, request for opinion. Int. J. Syst Bacteriol. 21 :91-99. Unz, R. F., and N. C. Dondero 1967a. The predominant bacterial in natural zoogloeal colonies I. isolation and identification. Canadian Journal of Microbiology 13 : 16711682. Unz, R. F. and N. C. Dondero.1967b. The predominant bacterial in natural zoogloeal colonies II. Physiology and nutrition. Canadian Journal of Microbiology. 13:16831694 U nz, R. F ., and S. R. Farrah. I 972. Use of aromatic compounds for growth and isolation of Zoogloea. Appl. Microbiol. 23 :524-530. Unz, R. F., and S. R. Farrah. 1976a. Observations on the fotmation of wastewater zoogloeae. Water Res. 10:665-671. Unz, R. F., and S. R. Farrah. 1976b EPS production and flocculation by Zoogloea MP6 Appl. Environ. Microbiol. 31(4):623-626. Valassina, M., A. M. Cuppone, M. G. Cusi, and P. E. Valensin. 1997. Rapid detection of different RNA respiratory virus species by multiplex RT-PCR: application to clinical specimens. Clin. Diagn. Virol. 8: 227-232. Vandevivere, P., and P. Baveye. 1992. Effect of bacterial extracellular polymers on the saturated hydraulic conductivity of sand colwnns. Appl. Environ. Microbiol. 58:1690-1698. Vesey, G., J. S. Slade, M. Byrne, K. Shepherd, P. J. Dennis, and C.R. Fricker 1993. Routine monitoring of Cryptosporidium oocysts in water using flow cytometry J Appl. Bacteriol. 75:87-90. Viessman, W. Jr., and M. J. Hammer. 1985. Water Supply and Pollution Control HarperCollin publisher. p. 497-545 Walker F. M. M. C. Dazza, M. C. Dauge, 0. Boucher C. Bedel, D. Henin, and T Lehy. 1998 Detection and localization by in situ molecular biology techniques and immunohistochemistry of hepatitis C virus in livers of chronically infected patients. J Histochem. Cytochem. 46:653-660.

PAGE 113

101 Ward, D. M., R. Weller, and M. M. Bateson. 1990. 16S rRNA sequences reveal numerous uncultured microorganisms in a natural comro11nity. Nature. 345:63-65. Wattie, E. 1942. Cultural characteristics of zooglea-fonning bacteria isolated from activated sludge and trickling filter. Public Health Reports. 57: 1519-1534. Whitby, K., and J. A. Garson. 1997. A single tube two compartment reverse transcription polymerase chain reaction system for ultrasensitive detection of hepatitis C virus RNA. J. Virol. Methods. 66:15-18. Whitby, J.E., P.R. Heaton, H. E. Whitby, E. O'Sullivan, and P. Johnstone. 1997. Rapid detection of rabies and rabies-related viruses by RT-PCR and enzyme-linked immunosorbent assay. J. Virol. Methods. 69:63-72. Williams, T. M., and R. F. Unz. 1983. Environmental distribution of Zoogloea strains. Water Res. 17:779-787. Wolfaardt G. M., J. R. Lawrence, J. V. Headley, R. D. Roberts, and D E. Caldwell. 1994. Microbial EPSs provide a mechanism for bioaccumulation of contaminants. Microbiol. Ecol. 27:279-291. Wolfaardt G. M., J. R. Lawrence, R. D. Robarts, and D. E. Caldwell. 1993. In situ visualization of EPS chemistry and selective binding of a chlorinated herbicide in microbial biofilms. Abstr. CSM/SIM Annu. Meet. Toronto. Wood, P ., M. Jones, M. Bankoo, and P. Gilbert. 1996. A novel strategy for control of microbial biofi)ms through generation of biocide at the biofilm-surface interface. Appl. Environ. Microbiol. 62:2598-2602. Xu, K. D., P. S. Stewart, F. Xia, C.-T. Huang, and G. A. McFeters. 1998. Spatial physiological heterogeneity in pseudomonas aeruginosa biofilm is detertnined by oxygen availability. Appl. Environ Microbiol. 64:4035-4039. Yu, F. P., and G. A. Mcfeters. 1994. Physiological response of bacteria in biofilm to disinfection. Appl. Environ. Microbiol. 60:2462-2466. Zvirbulis, E., and H. D. Hatt. 1967. Status and generic name Zoogloea and its species an aid to the formulation of an opinion. Int. J. Syst. Bacteriol. 17: 11-21.

PAGE 114

BIOGRAPHICAL SKETCH Fuhua Lu was born on June 4, 1969, in Shanxi province, P R. China She received a Bachelor of Science degree in biology in July, 1991, from Wuhan University P R. China. After graduation, she went to the Institute of Applied Ecology Academia Sinica, and received a Master of Science in microbiology in July 1994. In fall of 1994 she enrolled in the Ph.D program in the Departrnent of Microbiology and Cell Science at the University of Florida. 102

PAGE 115

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Samuel R. Farrah, Chair Professor of Microbiology and Cell Science I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Keelnatham T. Shanmugam Professor of Microbiology and Cell Science I certify that I have read this study and that in my opinion it confor1ns to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Edward Professor of Micr'U'..,.iology and Cell Science I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Ann C. Wilkie Assistant Professor of Soil and Water Science I certify that I have read this study and that in my opinion it conf onns to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Ben L. Koopman Professor of Enviro rn.6n4'6l Engineering Sciences

PAGE 116

This dissertation was submitted to the Graduate Faculty of the College of Agriculture and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. December, 1998 Dean Graduate School

PAGE 117

i ;z ,f f